Kong, Beijing
Chris Kong, Beijing CN
Patent application number | Description | Published |
---|---|---|
20150359201 | Methods and Apparatus for Tracking and Analyzing Animal Behaviors - Described herein are methods and systems for tracking and analyzing animal behaviors. Specifically, certain animal data, such as animal motions of interest (running, walking, resting, playing), are captured through a device attached to the animal. Such data can be locally processed and stored or periodically uploaded into servers or cloud storage for further processing to generate animal reports or sickness notifications for the pet owner to view via an animal tracking and viewing application in a user terminal device. | 12-17-2015 |
Deli Kong, Beijing CN
Patent application number | Description | Published |
---|---|---|
20130324720 | SYSTEM AND PROCESS FOR MELAMINE PRODUCTION BY GAS-PHASE QUENCHING METHOD OF ENERGY EFFICIENT AND COST SAVING TYPE - A system and process for melamine production by gas-phase quenching method and its process are provided. The said system includes a urea scrubber, after which a fluidized bed reactor, a hot-air cooler, a hot-air filter, a crystallizer and a melamine collector are installed in series successively, where the said melamine collector is connected to the said urea scrubber and the said fluidized bed reactor is connected to a carrier gas pre-heater which is connected to a carrier gas compressor; the said system further includes a gas-liquid separator which is connected to the said urea scrubber which is connected to a crystallizer; wherein a cool air blower is provided between the said gas-liquid separator and the crystallizer. The production system of the invention has the advantages of high productivity, stable operation, low energy consumption, low investment and high economic value of tail gas. | 12-05-2013 |
Deqian Kong, Beijing CN
Patent application number | Description | Published |
---|---|---|
20140076888 | Device For Curing Alignment Film And Method Using The Same - There is provided a device for curing an alignment film comprising a microwave heating chamber ( | 03-20-2014 |
De Shuo Kong, Beijing CN
Patent application number | Description | Published |
---|---|---|
20110106841 | METHOD AND SYSTEM OF SAVING AND QUERYING CONTEXT DATA FOR ONLINE APPLICATIONS - The present invention provides methods and systems for saving and querying context data for an online application. The context data of an online application related to pages visited by a user are collected, where the context data is associated with page identifiers of the visited pages. A step-by-step path is generated based on the page identifiers of the pages visited by the user, and a context data record is generated and saved based on the collected context data and the step-by-step path. According to the methods and systems, a query term is further generated using on the collected context data and the step-by-step path, for performing query to the context data. By applying the methods and systems of the present invention to different contexts, the user is able to easily save and later reference the previous actual running data of some functional contexts. | 05-05-2011 |
Fanguang Kong, Beijing CN
Patent application number | Description | Published |
---|---|---|
20100325536 | APPLICATION ORCHESTRATOR - A method for orchestrating various applications is described herein. A request to store a context information regarding a document may be received. An application in which the document is modified may be determined. The context information may be requested from the application. The context information may be stored. A request to recall the context information may be received. The context information may be displayed on a computer screen. | 12-23-2010 |
20120141968 | Evaluation Assistant for Online Discussion - Discussion evaluation may be provided. First, an assignment page including an evaluation link may be displayed and a user initiated input corresponding to the evaluation link may be received. Next, an evaluation view may be displayed in response to the received user initiated input. The displayed evaluation view may comprise an evaluation assistant data section and a raw discussion data section. Evaluation data may then be received in response to the displayed evaluation view. | 06-07-2012 |
Fansheng Kong, Beijing CN
Patent application number | Description | Published |
---|---|---|
20140296261 | KINASE MODULATING COMPOUNDS, COMPOSITIONS CONTAINING THE SAME AND USE THEREOF - The invention provides a compound represented by formula (I) which may modulate a kinase, and a pharmaceutical composition thereof, as well as the method for preventing or treating a protein kinase mediated disease or condition. | 10-02-2014 |
Hongwei Kong, Beijing CN
Patent application number | Description | Published |
---|---|---|
20090190705 | System And Method For In-Phase/Quadrature-Phase (I/Q) Time Delay Measurement And Compensation - A system for determining a time delay between an in-phase signal component and a quadrature-phase signal component includes an in-phase signal start time determination module coupled to an in-phase delay module, the in-phase signal start time determination module and the in-phase delay module configured to receive an in-phase signal component of a received signal. The in-phase signal start time determination module is configured to receive a reference signal. The system also includes a quadrature-phase signal start time determination module coupled to a quadrature-phase delay module, the quadrature-phase signal start time determination module and the quadrature-phase delay module configured to receive a quadrature-phase signal component of a received signal. The quadrature-phase signal start time determination module is configured to receive a reference signal, wherein the in-phase delay module is configured to develop an in-phase delay signal and the quadrature-phase delay module is configured to develop a quadrature-phase delay signal. | 07-30-2009 |
20090196334 | System and Method for In-Phase/Quadrature-Phase (I/Q) Mismatch Measurement and Compensation - A system for determining in-phase and quadrature-phase mismatch in a multiple-input, multiple-output (MIMO) communication architecture includes at least one transmitter coupled to at least one receiver and an in-phase (I) signal, quadrature-phase (Q) signal mismatch element configured to receive I and Q signal components over at least one communication channel, the I/Q signal mismatch element also configured to provide a signal representing gain imbalance, a signal representing quadrature error and a signal representing I/Q offset. | 08-06-2009 |
20100063791 | System And Method For Channel Emulator Performance Measurement And Evaluation - A system and method for determining the performance of a channel emulator includes an input signal, at least one transmitter configured to receive the input signal, the at least one transmitter coupled to at least one receiver through the channel emulator, the at least one transmitter configured to transmit the input signal through the channel emulator, the at least one receiver configured to receive a faded receive signal. The system also comprises a signal processor configured to receive a processor signal and the faded receive signal, the signal processor configured to correlate the processor signal and the faded receive signal to develop a correlated signal that represents a channel impulse of the channel emulator. The channel impulse of the channel emulator is used to extract at least one channel coefficient that reflects the performance of the channel emulator. | 03-11-2010 |
Hong Wei Kong, Beijing CN
Patent application number | Description | Published |
---|---|---|
20080310531 | ROBUST CHANNEL ESTIMATION IN COMMUNICATION SYSTEMS - An apparatus for archiving robust channel estimation in a communication system includes a training sequence generator to generate a training sequence. A formatter inserts the training sequence to a frame. A transmitting module is employed to transmit the frame. The training sequence generator further includes a symbol generator to generate a plurality of training symbols satisfying a predetermined constraint such that the training symbols are insensitive to synchronization error and a training sequence forming unit that forms the training sequence from the training symbols generated by the training symbol generator. | 12-18-2008 |
20090003425 | Inter-carrier Interference Measurement In Orthogonal Frequency Division Multiplexing Systems - A system for measuring inter-carrier interference (ICI) in an OFDM system includes a test symbol generator coupled to a transmitter of the OFDM system to generate an N*N orthogonal matrix having N*N test symbols, and to send the test symbols in a test symbol stream via the transmitter to a receiver of the OFDM system. The N*N test symbols are arranged by the test symbol generator into an N*N orthogonal matrix before being sent to the receiver. The system also includes an ICI measuring module coupled to the receiver to detect the N*N test symbols received in the receiver and to arrange the test symbols as a receiving matrix in the same way as the orthogonal matrix in the transmitter. The ICI measuring module outputs the receiving matrix as an ICI matrix of the OFDM system, wherein an element on the kth row, lth column of the ICI matrix represents interference from the lth sub-carrier on the kth sub-carrier, wherein k≠l. | 01-01-2009 |
20090037163 | Fast and Flexible Communication System Simulation - A simulation system for a communication system includes a user interface to receive user definition and system configuration parameters of a simulation configuration file that includes a plurality of data structures representing various functional modules of the simulated communication system. A model library is provided to store different implementation models corresponding to different communication standards for each of the functional modules. A parsing module accesses the model library according to the user definition and system configuration parameters to obtain the appropriate implementation model for each of the functional modules, and generates a simulated system program based on the selected implementation models such that the simulated system program is reconfigurable to different implementations and communication standards. A simulation engine runs the simulated system program to simulate the simulated communication system. A simulated system program generation system is also described. | 02-05-2009 |
20140058692 | MULTILEVEL TRIGGERING SYSTEM FOR OUTPUTTING COMPLEX TRIGGER SIGNAL - A multilevel triggering system of a signal analysis instrument outputs a complex trigger signal. The triggering system includes a trigger controlled buffer for receiving and buffering an input signal, triggering function modules, and a triggering matrix. Each triggering function module performs a corresponding triggering function for detecting a corresponding triggering condition. The triggering matrix includes multiple triggering levels, each of which is configurable to include at least one trigger block and each trigger block being configurable to implement one of the triggering function modules. Each trigger block generates a corresponding block trigger when the triggering condition of the corresponding triggering function module is detected in the buffered input signal. Each triggering level generates a corresponding level trigger when the at least one trigger block in the triggering level generates the corresponding block trigger, and the triggering matrix generates the complex trigger signal when the triggering levels generate corresponding level triggers. | 02-27-2014 |
Jiang Kong, Beijing CN
Patent application number | Description | Published |
---|---|---|
20120128803 | PROCESS FOR PREPARING WATER EXTRACT OF CINNAMON - This invention relates to an improved process for preparing water extract of cinnamon in a large scale. The process comprises the steps of: (a) adding an aqueous solvent such as water to at least 5 kg of a cinnamon raw material at a water to material ratio of 1:1 to 100:1, (b) boiling the mixture of (a) for at least 5 minutes, (c) removing the solid debris from the mixture, (d) storing the liquid portion of the mixture at about −5 to 25° C., preferably 0-10° C., until a top layer of oil is formed and partitioned, (e) removing the top layer of oil, and (f) collecting the remaining liquid portion. The present process prepares a cinnamon water extract product with a minimal content of potentially toxic cinnamaldehyde and coumarin, while increasing the contents of the active ingredients of polyphenolic polymers for controlling blood glucose level. | 05-24-2012 |
20120128804 | PROCESS FOR PREPARING WATER EXTRACT OF CINNAMON - This invention relates to an improved process for preparing water extract of cinnamon in a large scale. The process comprises the steps of: (a) adding an aqueous solvent such as water to at least 5 kg of a cinnamon raw material at a water to material ratio of 1:1 to 100:1, (b) boiling the mixture of (a) for at least 5 minutes, (c) removing the solid debris from the mixture, (d) storing the liquid portion of the mixture at about −5 to 25° C., preferably 0-10° C., until a top layer of oil is formed and partitioned, (e) removing the top layer of oil, and (f) collecting the remaining liquid portion. The present process prepares a cinnamon water extract product with a minimal content of potentially toxic cinnamaldehyde and coumarin, while increasing the contents of the active ingredients of polyphenolic polymers for controlling blood glucose level. | 05-24-2012 |
Ling Kong, Beijing CN
Patent application number | Description | Published |
---|---|---|
20110262564 | Treatment of Cancer with Selenium Nanoparticles - Novel chemopreventive and chemotherapeutic cancer treatment method using elemental selenium nanoparticles. Cancer cells, especially androgen dependent prostate cancers are exposed to selenium from elemental selenium nanoparticle treatment, and apoptosis is induced in the cancer cells. | 10-27-2011 |
Ming Kong, Beijing CN
Patent application number | Description | Published |
---|---|---|
20140003101 | VALVE CURRENT CONTROL METHOD BASED ON MODULAR MULTI-LEVEL CONVERTER | 01-02-2014 |
Norman Kong, Beijing CN
Patent application number | Description | Published |
---|---|---|
20150361059 | SUBSTITUTED HETERO-AZEPINONES - There are provided compounds of the formula | 12-17-2015 |
Qingli Kong, Beijing CN
Patent application number | Description | Published |
---|---|---|
20130250443 | PORTABLE MAGNIFYING DEVICE AND USES THEREOF - A portable magnifying device is provided comprising a housing and a viewing plate mounted inside the housing, the housing comprises at least one magnifying lens disposed within a top surface of the housing, and the viewing plate is configured to support a substrate that can be viewed through the magnifying lens. The portable magnifying device can be used to allow consumers to visually assess the effectiveness of a treatment of a product on a substrate at the micro level. | 09-26-2013 |
Qinglong Kong, Beijing CN
Patent application number | Description | Published |
---|---|---|
20150317479 | Scanning device, cloud management device, method and system for checking and killing malicious programs - The invention discloses a scanning device, a cloud management device, a method and system for checking and killing a malicious program. Therein, a cloud management device for checking and killing a malicious program comprises: a second transmission interface; a first indicator configured to generate a first scanning content indication according to characteristics of a newborn malicious program and system environment information transmitted by a client device; a first matcher configured to obtain via the second transmission interface feature data of the unknown program file transmitted by the client device, and hereby perform matching in known records of feature data of malicious programs; and a second indicator configured to generate a second scanning content indication when the first matcher fails to match to a known record, the second scanning content indication comprising scanning a specified attribute of the unknown program file and/or a specified attribute of the contextual environment of the unknown program file, and transmit the same to the client device through the second transmission interface. | 11-05-2015 |
Qingmei Kong, Beijing CN
Patent application number | Description | Published |
---|---|---|
20140162261 | DETECTION KIT FOR IDENTIFYING GENOTYPE IN DEPRESSION PATIENTS AND METHOD OF USING THE SAME - The present invention relates to a rs6311 test kit, which includes a probe, a primer, and a polymerase chain reaction solution, wherein said probe sequence is as follows: rs6311T-fam: CTGTGAGTGTCTGGC (SEQ. ID. NO. 1) and rs6311C-vic: CTGTGAGTGTCCGGC (SEQ. ID. NO. 2); and said primer sequence is as follows: rs6311-F: AGAGAGAACATAAATAAGGCTAGAAAACAGTA (SEQ. ID. NO. 3) and rs6311-R: CACTGTTGGCTTTGGATGGA (SEQ. ID. NO. 4). The test kit is used to determine genotype of a depression patient, in order to treat the depression patient with a combination of serotonin reuptake inhibitors (SSRI) and low dose risperidone. The actual dose of risperidone and the ratio between SSRIs and risperidone is determined by the genotype of the depression patient. The present invention determines human drug metabolism rate through a single nucleotide polymorphism and provides a platform to adjust the patient's treatment. | 06-12-2014 |
Weiguang Kong, Beijing CN
Patent application number | Description | Published |
---|---|---|
20150024796 | METHOD FOR MOBILE TERMINAL TO PROCESS TEXT, RELATED DEVICE, AND SYSTEM - Embodiments of the present invention disclose a method for a mobile terminal to process text, a related device, and a system. The text processing method for a mobile terminal includes: sending a request message, which carries text information and start-processing position information, to a cloud application platform, where the text information includes at least one of or any combination of text to be processed, an obtaining address of the text to be processed, and an identifier of the text to be processed; and when or after receiving a response message, which is returned by the cloud application platform, of the request message, receiving and playing an audio stream from the cloud application platform. The technical solutions provided in the present invention can satisfy a requirement of a user for “listening to” text on a mobile terminal. | 01-22-2015 |
Wei-Jia Kong, Beijing CN
Patent application number | Description | Published |
---|---|---|
20110158932 | Methods And Compositions For The Treatment of Hyperlipidemia - Methods and compositions containing a berberine compound or berberine related or derivative compound are provided for the prevention and treatment of hyperlipidemia, elevated cholesterol, and/or cardiovascular disease in mammalian subjects. The methods and compositions of the invention are effective for prevention and treatment of atherosclerosis, coronary artery disease, angina pectoris, carotid artery disease, stroke, cerebral arteriosclerosis, high blood pressure, myocardial infarction, cerebral infarction, restenosis following balloon angioplasty, intermittent claudication, dyslipidemia post-prandial lipidemia or xanthoma. Additional compositions and methods are provided which employ a berberine compound or berberine related or derivative compound in combination with a second anti-hyperlipidemia agent, or a different therapeutic agent to yield more effective treatment tools against hyperlipidemia and/or cardiovascular disease, and/or dual activity therapeutic methods and formulations useful to prevent or reduce hyperlipidemia and one or more causal or related symptoms or conditions associated with hyperlipidemia in mammalian subjects. | 06-30-2011 |
Wenjun Kong, Beijing CN
Patent application number | Description | Published |
---|---|---|
20130133329 | AIR FUEL PREMIXER HAVING ARRAYED MIXING VANES FOR GAS TURBINE COMBUSTOR - A fuel-air premixer for use in a combustor of a gas turbine includes an air inlet, a fuel inlet, a shroud, a central body and a cascade of vanes. The premixer mixes fuel and air in the annular mixing passage into a uniform mixture for injecting into a combustor reaction zone. The air from a compressor is injected into the mixer through an air inlet. The fuel is introduced into air stream via fuel injection holes that pass through the walls of the vanes which contain internal fuel flow passages. The flow field inside the premixer is broken up by the arrayed vanes into a series of small regions each containing a well designed small size mixing eddy which is steadily attached to the surface of the vanes. | 05-30-2013 |
Xiangbing Kong, Beijing CN
Patent application number | Description | Published |
---|---|---|
20120067795 | CENTRALIZED SUPPLY SYSTEM FOR ELECTROLYZED OXIDIZING WATER AND INTELLIGENT CONTROL METHOD THEREOF - A centralized supply system for electrolyzed oxidizing water comprises a water softener ( | 03-22-2012 |
Xiangchun Kong, Beijing CN
Patent application number | Description | Published |
---|---|---|
20140138717 | DISPLAY DEVICE, TRANSFLECTIVE THIN FILM TRANSISTOR ARRAY SUBSTRATE AND MANUFACTURING METHOD THEREOF - The present invention provides a display device, a transflective thin film transistor array substrate and a manufacturing method thereof, the manufacturing method comprises: providing a substrate; forming a gate line, a data line which is broken when passing through a gate line area, a gate electrode, a reflective electrode and a common electrode line; forming a patterned gate insulating layer and an active layer located above the gate insulating layer; forming a pixel electrode, a source electrode, a drain electrode, a connection line of the data line and a channel; forming a passivation layer and a common electrode via hole; forming a common electrode. The present invention can avoid the problem of poor display effect under strong light. | 05-22-2014 |
20150340455 | THIN FILM TRANSISTOR AND METHOD OF FABRICATING THE SAME, ARRAY SUBSTRATE AND METHOD OF FABRICATING THE SAME, AND DISPLAY DEVICE - The present invention provides a thin film transistor and a method of fabricating the thin film transistor, an array substrate and a method of fabricating the array substrate, and a display device. The thin film transistor includes a substrate and a gate, an insulation layer, an active layer, a source and a drain which are provided on the substrate. A spacer layer is also provided between the gate and the active layer, and the spacer layer overlaps at least with one of the gate and the active layer having a smaller area in an orthographic projection direction. The spacer layer can effectively prevent material forming the gate from being diffused into the active layer, thereby ensuring stability of performance of the thin film transistor. In the array substrate utilizing the thin film transistor, the spacer layer further extends to a region corresponding to a gate line. | 11-26-2015 |
Xiangjun Kong, Beijing CN
Patent application number | Description | Published |
---|---|---|
20130256602 | MANNICH-BASE INHIBITOR FOR DECALCIFICATION, PREPARATION METHOD AND APPLICATION THEREOF - A mannich-base inhibitor for decalcification, a preparation method and application thereof are provided. The inhibitor comprises 10-80% mannich-base component calculated in the total weight percent of the inhibitor, while the rest is at least one compound selected from imidazoline inhibitor with molecular weight between 110 and 750, and alkynyloxy amine inhibitor. The mannich-base inhibitor component is prepared through mannich reaction with 1 mol organic polyamine containing three or more primary amine bases and/or secondary amine bases, 3-7 mol ketones, and 3-7 mol aldehydes. The inhibitor which can be effectively compounded and cooperated with oil demulsifying agent and oil decalcifying agent, have the advantages of stable property, strong absorbability, high film strength and film density with its inhibition rate exceeding 90%. The inhibitor is especially adapted for inhibiting the steel corrosion caused by the mixed medium of salt, acid and water from the desalination and dehydration apparatus of oil refinery below 160° C. | 10-03-2013 |
Xiangli Kong, Beijing CN
Patent application number | Description | Published |
---|---|---|
20130283140 | SNAPSHOT GENERATION FOR SEARCH RESULTS PAGE PREVIEW - Methods, systems, and programming for providing web page snapshots are disclosed. A URL is received. A snapshot of the web page associated with the URL is generated. A plurality of features is extracted from the snapshot. A determination is made regarding whether the snapshot is high quality based on the plurality of extracted features of the snapshot. The generated snapshot is provided as a viewable and actionable link to the URL. | 10-24-2013 |
Xiangyong Kong, Beijing CN
Patent application number | Description | Published |
---|---|---|
20150102338 | THIN FILM TRANSISTOR AND MANUFACTURING METHOD THEREOF, AND DISPLAY DEVICE - Embodiments of the invention provide a thin film transistor and a manufacturing method thereof and a display device. The thin film transistor includes a gate electrode, a gate insulation layer, an active layer, an ohmic contact layer, a source electrode and a drain electrode, and the source electrode and the drain electrode are connected to the active layer by the ohmic contact layer. The ohmic contact layer is provided at a lateral side of the active layer and contacts the lateral side of the active layer. | 04-16-2015 |
20150129881 | PIXEL UNIT AND METHOD OF FABRICATING THE SAME, ARRAY SUBSTRATE AND DISPLAY DEVICE - The present invention provides a pixel unit including a thin film transistor and a pixel electrode, the thin film transistor includes a gate, a source and a drain, and the pixel electrode is electrically connected to the drain through a via hole. An upper end surface of the via hole is connected to the pixel electrode, and a lower end surface of the via hole is connected to the drain. The via hole is a step-shaped hole, and an area of the upper end surface of the via hole is larger than that of the lower end surface of the via hole. The present invention also provides a method of fabricating the pixel unit, an array substrate including the pixel unit, and a display device including the array substrate. | 05-14-2015 |
20150214249 | Array Substrate, Display Device and Manufacturing Method - An array substrate, a display device and a manufacturing method. The array substrate includes a thin film transistor and a pixel electrode ( | 07-30-2015 |
20150236303 | PIXEL STRUCTURE AND MANUFACTURING METHOD THEREOF - Embodiments of the present invention relate to a pixel structure and a manufacturing method thereof. The pixel structure includes: a substrate; an organic light emitting layer, disposed on the substrate; and an organic light gathering layer, disposed on a light exiting side of the organic light emitting layer, wherein light emitted from the organic light emitting layer is incident on the organic light gathering layer which is configured to gather the light emitted from the organic light emitting layer. | 08-20-2015 |
Xiangyu Kong, Beijing CN
Patent application number | Description | Published |
---|---|---|
20090311749 | Method for methanol independent induction from methanol inducible promoters in Pichia - The present invention relates to a method for producing a polypeptide in a methylotrophic yeast host cell, wherein expression of the polypeptide is controlled by a methanol inducible promoter, comprising: i) expression of a positive regulator from a non-native promoter, said positive regulator activating transcription from the methanol inducible promoter, and ii) no addition of methanol. | 12-17-2009 |
20100261259 | Expression of Genes from Gram Negative Bacteria in Fungi - The present invention provides a method for the recombinant expression of polypeptides originating from gram negative bacteria, in a fungal host suitable for industrial production. In a first aspect the present invention relates to a method for recombinant expression of a polypeptide from a gram negative bacterium in a fungal host cell, comprising the steps: i) providing a nucleic acid sequence encoding the polypeptide, said nucleic acid sequence comprising a first nucleic acid sequence encoding a fungal signal peptide and a second nucleic acid sequence encoding the polypeptide, having at least one modified codon, wherein the modification does not change the amino acid encoded by said codon and the nucleic acid sequence of said codon is different compared to the corresponding codon in the wild type nucleic acid sequence present in the said gram negative bacterium; ii) expressing the modified nucleic acid sequence in the fungal host. | 10-14-2010 |
20120142053 | METHOD FOR METHANOL INDEPENDENT INDUCTION FROM METHANOL INDUCIBLE PROMOTERS IN PICHIA - A method for producing a polypeptide in a methylotrophic yeast host cell is described, where expression of the polypeptide is controlled by a methanol inducible promoter, including: i) expression of a positive regulator from a non-native promoter, the positive regulator activating transcription from the methanol inducible promoter, and ii) no addition of methanol. | 06-07-2012 |
Xiao Kong, Beijing CN
Patent application number | Description | Published |
---|---|---|
20110289182 | AUTOMATIC ONLINE VIDEO DISCOVERY AND INDEXING - A classifier may be integrated into a pipeline of a general web crawler. The classifier may classify crawled webpages as either video pages or non-video pages. Video pages and information regarding domain importance may be aggregated. Ones of the domains of the video pages may be selected based on domain importance rankings. Webpages of the selected domains may be randomly sampled. The sampled webpages may be structurally analyzed and hint information may be generated with respect to each of the selected domains. The hint information may guide a deep crawling operation for discovering all video pages within the selected domains. Video links within the video pages may be found, one or more videos may be downloaded, and one or more representations of the one or more videos may be indexed. | 11-24-2011 |
Yanmei Kong, Beijing CN
Patent application number | Description | Published |
---|---|---|
20140374857 | CANTILEVER BEAM STRUCTURE WHERE STRESS IS MATCHED AND METHOD OF MANUFACTURING THE SAME - A cantilever beam structure where stress is matched and a method of manufacturing the same are provided. An example method may comprise depositing a first sub-layer of a first material with a first deposition menu and depositing a second sub-layer of the first material with a second deposition menu different from the first deposition menu. The first sub-layer and the second sub-layer can be disposed adjacent to each other to form a first layer. The method may further comprise depositing a second layer of a second material different from the first material. The first layer and the second layer can be disposed adjacent to each other. The method may further comprise matching stress between the first layer and the second layer by adjusting at least one of thicknesses of the respective sub-layers of the first layer and a thickness of the second layer. | 12-25-2014 |
Yi Kong, Beijing CN
Patent application number | Description | Published |
---|---|---|
20140169518 | SHIFT RGISTER UNIT, GATE DRIVER, AND DISPLAY DEVICE - Provided are a shift register unit, a gate driver and a display device. The shift register unit comprises: a pull-up control module, a pull-up module, a reset module, and a denoise module for holding a signal output from the first output terminal when the signal has a level higher than a first preset threshold and outputting the held signal from a second output terminal when a signal output from a denoise control signal output terminal has a level higher than a second preset threshold. The signal output from the first output terminal is filtered by using the signal output from the first output terminal and the signal output from the denoise control signal output terminal, and thus burrs in the signal output from the first output terminal are eliminated, that is, noise is eliminated, solving the problem that a defective display picture due to the noise in the output signal. | 06-19-2014 |
20150120678 | AUTOMATICALLY CORRECTING INVALID SCRIPTS IN WEB APPLICATIONS - According to an aspect, a method for correcting an invalid script in a web application includes determining an invalid reference in an invalid script. A storage location is determined in a database corresponding to the invalid reference based on a data relationship mapping, wherein the data relationship mapping indicates the correspondence between the reference and a storage location in the database. An up-to-date value at the storage location is queried and the queried up-to-date value is determined to be the correct value of the invalid reference. | 04-30-2015 |
Yong Kong, Beijing CN
Patent application number | Description | Published |
---|---|---|
20140186626 | MODIFIED STARCH, PREPARATION METHOD AND USE OF THE SAME, AND DRILLING FLUID - The present invention provides a modified starch, preparation method and use of the same, also provides a drilling fluid comprising the modified starch which contains bi-substituted starch structural units and tri-substituted starch structural units, wherein, the tri-substituted starch structural units are represented by the following formula (1), the bi-substituted starch structural units are the structural units represented by the following formula (2) and/or the structural units represented by the following formula (3), and the total content of the bi-substituted starch structural units and tri-substituted starch structural units accounts for 20 wt % or more of the modified starch, preferably 20-30 wt %, the weight-average molecular weight of the etherified starch is 50,000-600,000, preferably 80,000-580,000, wherein, R | 07-03-2014 |
Zhenyu Kong, Beijing CN
Patent application number | Description | Published |
---|---|---|
20110244930 | PROTECTIVE GASKET FOR DISPLAY MODULE OF PORTABLE ELECTRONIC DEVICE AND METHOD FOR ASSEMBLING THE DEVICE - A protective gasket for a display module of a portable electronic device and a method for assembling the device. The electronic device includes a housing frame, a main body having a display module, and a flexible gasket between the frame and main body, the frame having a display window corresponding to the display module. A cut is at corner portions of the gasket so that inner edges of the flexible gasket are bent after the display module is embedded into the display window, and then compressed and fitted between the outer periphery of the display module and the inner periphery of the display window. With the inner edges of the flexible gasket bent, the thickness of the electronic device can be reduced, and the periphery of the display module can be protected. The display module also can be protected from intrusion by foreign matters such as dust and moisture. | 10-06-2011 |
Zhike Kong, Beijing CN
Patent application number | Description | Published |
---|---|---|
20150269969 | Thumbnail Generation and Presentation for Recorded TV Programs - Thumbnail images representative of recorded TV programs are generated and presented to aid a user in browsing the recorded TV programs. In one implementation, a temporary thumbnail image is generated when a TV program first starts recording. The temporary thumbnail is used to populate any user interface (UI) screens that reference the recoded TV program. Once the TV program has reached a threshold amount of recording (e.g., a prescribed duration of recording, or completion of the recording), a permanent thumbnail image is generated and associated with the TV program. The permanent thumbnail is then presented in any subsequent UI screens, replacing the temporary thumbnail. In another implementation, display of the thumbnail images in the UI screens may be further controlled by setting preferences, such as parental controls. | 09-24-2015 |