Agnès
Agnés Bombrun, Chambesy CH
Patent application number | Description | Published |
---|---|---|
20110293564 | 2-MORPHOLINO-PYRIDO[3,2-D]PYRIMIDINES - This invention relates to compounds of Formula (I) as Pi3k inhibitors for treating autoimmune diseases, inflammatory disorders, multiple sclerosis and other deseases like cancers. | 12-01-2011 |
20120022109 | OXADIAZOLE DERIVATIVES - The invention relates to oxadiazole compounds of formula I. The compounds are useful e.g. in the treatment of autoimmune disorders, such as multiple sclerosis. | 01-26-2012 |
20120035226 | OXADIAZOLE DERIVATIVES - The invention relates to oxadiazole compounds of formula I. The compounds are useful e.g. in the treatment of autoimmune disorders, such as multiple sclerosis. | 02-09-2012 |
20120115869 | TETRAZOLE DERIVATIVES - The present invention relates to compounds of formula (I) for use as pharmaceutical active compounds, as well as pharmaceutical formulations containing the same, for the treatment of allergic diseases. | 05-10-2012 |
Agnés Degeorges, Clermont-Ferrand FR
Patent application number | Description | Published |
---|---|---|
20130292027 | TIRE, THE CARCASS REINFORCEMENT OF WHICH IS REINFORCED WITH A LAYER OF REINFORCING ELEMENTS IN THE BEAD REGION - The invention relates to a tire having a radial carcass reinforcement, consisting of at least one layer of reinforcing elements anchored in each of the beads by an upturn around a bead wire, said carcass reinforcement upturn being reinforced by at least one layer of reinforcing elements or stiffener, the radially outer end of which is radially on the outside of the end of the upturn. According to the invention, the reinforcing elements of at least one stiffener are non-wrapped metal cords with saturated layers, having, in what is called the permeability test, a flow rate of less than 5 cm | 11-07-2013 |
Agnés Doreau-Bastid, Craponne FR
Patent application number | Description | Published |
---|---|---|
20110293629 | Methods of Treating and/or Preventing Cell Proliferation Disorders with IL-17 Antagonists - The invention relates generally to methods of treating and/or preventing proliferative diseases, such as cancers, using antagonists of IL-17. The invention also relates to methods and kits for identifying subjects who are likely to respond to treatment and/or prevention of proliferative diseases with antagonists of IL-17. | 12-01-2011 |
Agnés Ladous, Charenton Le Pont FR
Patent application number | Description | Published |
---|---|---|
20120281183 | Method for Determining Binocular Performance of a Pair of Spectacle Lenses - A method of determining binocular performance of a pair of spectacle lenses comprises: a eyes characteristics providing step, a pair of spectacle lenses providing step, a environment providing step, a cyclopean eye positioning step, a binocular performance criteria defining step, and a binocular performance criteria determining step, wherein the cyclopean eye position is customized. | 11-08-2012 |
20120287405 | Method for Determining Binocular Performance of a Pair of Spectacle Lenses - A method of determining binocular performance of a pair of spectacle lenses comprises: a eyes characteristics providing step, a pair of spectacle lenses providing step, a environment providing step, a binocular performance criteria selecting step, and a binocular performance criteria determining step, wherein the at least one binocular performance criterion is selected among one or a combination of the following criteria groups consisting of central vision criteria group and/or peripheral vision criteria group. | 11-15-2012 |
Agnès Bénardeau, Saint Louis FR
Patent application number | Description | Published |
---|---|---|
20100267745 | 3-Pyridinecarboxamide Derivatives as HDL-Cholesterol Raising Agents - The present invention relates to a method of raising HDL cholesterol comprising administering to a patient in need thereof a compound of the formula | 10-21-2010 |
20110020300 | COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF GLUCOCORTICOID RECEPTOR (GCR) GENES - This invention relates to a double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of a GCR gene. The invention also relates to a pharmaceutical composition comprising the dsRNA or nucleic acid molecules or vectors encoding the same together with a pharmaceutically acceptable carrier; methods for treating diseases caused by the expression of a GCR gene using said pharmaceutical composition; and methods for inhibiting the expression of GCR in a cell. | 01-27-2011 |
20110065695 | USE OF AMINODIHYDROTHIAZINES FOR THE TREATMENT OR PREVENTION OF DIABETES - This invention relates to compounds of formula I, | 03-17-2011 |
Agnès Bénardeau, Saint Louis FR
Patent application number | Description | Published |
---|---|---|
20090143409 | 3-PYRIDINECARBOXAMIDE DERIVATIVES AS HDL-CHOLESTEROL RAISING AGENTS - The present invention relates to a method of raising HDL cholesterol comprising administering to a patient in need thereof a compound of the formula | 06-04-2009 |
20100267745 | 3-Pyridinecarboxamide Derivatives as HDL-Cholesterol Raising Agents - The present invention relates to a method of raising HDL cholesterol comprising administering to a patient in need thereof a compound of the formula | 10-21-2010 |
20110020300 | COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF GLUCOCORTICOID RECEPTOR (GCR) GENES - This invention relates to a double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of a GCR gene. The invention also relates to a pharmaceutical composition comprising the dsRNA or nucleic acid molecules or vectors encoding the same together with a pharmaceutically acceptable carrier; methods for treating diseases caused by the expression of a GCR gene using said pharmaceutical composition; and methods for inhibiting the expression of GCR in a cell. | 01-27-2011 |
20110065695 | USE OF AMINODIHYDROTHIAZINES FOR THE TREATMENT OR PREVENTION OF DIABETES - This invention relates to compounds of formula I, | 03-17-2011 |
20130096107 | USE OF AMINODIHYDROTHIAZINES FOR THE TREATMENT OR PREVENTION OF DIABETES - This invention relates to compounds of formula I, | 04-18-2013 |
20140221360 | USE OF AMINODIHYDROTHIAZINES FOR THE TREATMENT OR PREVENTION OF DIABETES - This invention relates to compounds of formula I, | 08-07-2014 |
Agnès Cibiel, Avon FR
Patent application number | Description | Published |
---|---|---|
20130266515 | Specific Ligand for Annexin 2 - The present invention relates to an aptamer which includes a nucleic acid including or made up of: the sequence GGAACGCAAGAACUGAGGCCAUGAGGCGCCUUCCCUUGCUCA GGACGC (SEQ ID NO: 1), or the sequence AGCUAGGCCGCAAGGUGCCUCAACGCCAUCUGAGUGCCGACC CGAUCGC (SEQ ID NO: 2), or a sequence including or made up of at least 25 consecutive nucleotides of a sequence that is at least 80% identical to SEQ ID NO: 1 or to SEQ ID NO: 2, with the condition that a nucleic acid made up of said sequence is bonded to annexin 2. | 10-10-2013 |
Agnès Degeorges, Clermont-Ferrand Cedex 9 FR
Patent application number | Description | Published |
---|---|---|
20130292028 | TIRE, THE CARCASS REINFORCEMENT OF WHICH IS REINFORCED WITH A LAYER OF REINFORCING ELEMENTS IN THE BEAD REGION - The invention relates to a tire having a radial carcass reinforcement, consisting of at least one layer of reinforcing elements anchored in each of the beads by an upturn around a bead wire, said carcass reinforcement upturn being reinforced by at least one layer of reinforcing elements or stiffener. According to the invention, the reinforcing elements of at least one stiffener are non-wrapped metal cords with saturated layers, having, in what is called the permeability test, a flow rate of less than 5 cm | 11-07-2013 |
Agnès Desfarges-Berthelemot, Couzeix FR
Patent application number | Description | Published |
---|---|---|
20130188244 | METHOD AND DEVICE FOR AMPLIFYING AN OPTICAL SIGNAL - According to the invention, the optical signal (SE) is spatially divided into N elementary optical signals (SE. | 07-25-2013 |
Agnès Dupont Filliard, Les Adrets FR
Patent application number | Description | Published |
---|---|---|
20120171662 | Simplified Device for Nucleic Acid Amplification and Method for Using Same - The present invention relates to a disposable device ( | 07-05-2012 |
Agnès Ferroni, Clamart FR
Patent application number | Description | Published |
---|---|---|
20100116980 | Means for identifying a strain isolated from a clinical sample at the species and/or subspecies level - The invention relates to a method for identifying a strain isolated from a clinical sample, at the species and/or subspecies level, using MALDI-TOF-MS analysis comprising a step of classifying the germ in a group before performing the MALDI-TOF-MS analysis | 05-13-2010 |
Agnès Ferroni, Clamart FR
Patent application number | Description | Published |
---|---|---|
20100116980 | Means for identifying a strain isolated from a clinical sample at the species and/or subspecies level - The invention relates to a method for identifying a strain isolated from a clinical sample, at the species and/or subspecies level, using MALDI-TOF-MS analysis comprising a step of classifying the germ in a group before performing the MALDI-TOF-MS analysis | 05-13-2010 |
20110318776 | Method for identifying germs in a liquid medium - This invention relates to a method for identifying germs in a liquid medium, comprising adding a membrane detergent to the liquid medium containing components of a host infected with germs, i.e. cellular components and proteins from the extracellular environment, so as to release the germs from these components without degrading them, and in that the germs that have grown in the liquid medium are analysed by MALDI-TOF MS. | 12-29-2011 |
Agnès Gouble, Paris FR
Patent application number | Description | Published |
---|---|---|
20120159659 | CUSTOM-MADE MEGANUCLEASE AND USE THEREOF - New rare-cutting endonucleases, also called custom-made meganucleases, which recognize and cleave a specific nucleotide sequence, derived polynucleotide sequences, recombinant vector cell, animal, or plant comprising said polynucleotide sequences, process for producing said rare-cutting endonucleases and any use thereof, more particularly, for genetic engineering, antiviral therapy and gene therapy. | 06-21-2012 |
20130059387 | MEGANUCLEASE VARIANTS CLEAVING A DNA TARGET SEQUENCE FROM THE HPRT GENE AND USES THEREOF - A method for inducing a site-specific modification in the HPRT gene, for a non-therapeutic purpose, by contacting a DNA target sequence selected from the group consisting of the sequences SEQ ID NO: 1 to 14 thereby cleaving the DNA target with an I-CreI variant or single-chain derivative having at least one substitution in one of the two functional subdomains of the LAGLIDADG (SEQ ID NO: 153) core domain situated from positions 26 to 40 and 44 to 77 of I-CreI. | 03-07-2013 |
20130315884 | METHODS FOR ENGINEERING ALLOGENEIC AND IMMUNOSUPPRESSIVE RESISTANT T CELL FOR IMMUNOTHERAPY - Methods for developing engineered T-cells for immunotherapy that are both non-alloreactive and resistant to immunosuppressive drugs. The present invention relates to methods for modifying T-cells by inactivating both genes encoding target for an immunosuppressive agent and T-cell receptor, in particular genes encoding CD52 and TCR. This method involves the use of specific rare cutting endonucleases, in particular TALE-nucleases (TAL effector endonuclease) and polynucleotides encoding such polypeptides, to precisely target a selection of key genes in T-cells, which are available from donors or from culture of primary cells. The invention opens the way to standard and affordable adoptive immunotherapy strategies for treating cancer and viral infections. | 11-28-2013 |
Agnès Jallouli, St. Petersburg, FL US
Patent application number | Description | Published |
---|---|---|
20120070654 | Method For Improving The Edging Of An Optical Article By Providing A Temporary Layer Of An Organic Matter - Methods for edging optical articles comprising two main faces, at least one of which being coated with an outermost layer comprising fixing the optical article to a chuck with a holding pad that adheres to both the optical article and the chuck, wherein the surface of the holding pad contacting the optical comprises an adhesive material; and edging the optical article with an edging device; wherein prior to fixing the optical article to the chuck, at least one temporary layer of an organic material is formed onto said outermost layer of the optical article, the organic material of the temporary layer comprising at least one organic compound having a fluorinated functional moiety and at least one linking functional moiety capable of establishing at least one intermolecular bond or interaction with the adhesive material of the holding pad. Optical articles obtained via these methods. | 03-22-2012 |
Agnès Kammoun, Reze FR
Patent application number | Description | Published |
---|---|---|
20120322098 | CULTURE MEDIUM FOR SCREENING OR ENRICHMENT OF METHICILLIN-RESISTANT S. AUREUS - The invention relates to culture medium for screening or enrichment of methicillin-resistant | 12-20-2012 |
Agnès Pailloux, Gif Sur Yvette FR
Patent application number | Description | Published |
---|---|---|
20120036920 | DEVICE FOR DETECTING MICRO-LEAKS - Micro-leaks are detected by means of a sniffer device including, in an original manner, a flat suction capsule ( | 02-16-2012 |