Agnes

Agnes Bajza, Budapest HU

Patent application number	Description	Published
20090214677	Pharmaceutical Composition Containing an Extract of a Solidago Species - An extract of a part of a	08-27-2009

Agnes Barouh, Paris FR

Patent application number	Description	Published
20080295929	Storage Bag - The invention concerns a bag (	12-04-2008

Agnes Bonvilain, Myans FR

Patent application number	Description	Published
20110137330	SURGICAL INTERVENTION DEVICE COMPRISING AN INSTRUMENT LIKELY TO DEFORM - The disclosure relates to a surgical intervention device, including a surgical instrument capable of passing through human or animal tissue and a system comprising so-called “passive” components capable of measuring deformation or a local strain of the instrument and/or so-called “active” components capable of imposing a local strain on the instrument, the system comprising at least two series of passive components arranged at the surface of the instrument so as to establish a biunivocal relation between the position of the instrument or the position of the distal end of the instrument and all the data originating from the series, and, where required, at least two series of active components arranged at the surface of the instrument. The disclosure also relates to a process for determining the position of the distal end of a surgical instrument capable of passing through human or animal tissue.	06-09-2011

Agnes Bonvilain, Francin FR

Agnes Cadavid Labrada, Santiago CL

Patent application number	Description	Published
20080216194	METHOD TO PRODUCE STERILE MALE FLOWERS AND PARTENOCARPIC FRUITS BY GENETIC SILENCING, ASSOCIATED SEQUENCES AND VECTORS CONTAINING SAID SEQUENCES - Genes VvPI from	09-04-2008
20150067916	GENERATION OF GRAPEVINE ROOTSTOCKS THAT PROVIDE RESISTANCE AND SANITATION IN RELATION TO GRAPEVINE FANLEAF VIRUS (GFLV) - The invention discloses a vector plasmid called “GFLV silencing construct” that confers resistance and sanitation against the grapevine fanleaf virus (GFLV); plant cells transformed with said vector plasmid and a method to impart resistance and sanitation against the grapevine fanleaf virus (GFLV) in non-transgenic grapevines when being grafted onto seedlings generated from cells transformed with said plasmid vector. The “GFLV silencing construct” plasmid vector of the invention comprises inverted sequence duplicates coding for the grapevine fanleaf virus (GFLV) capsid protein.	03-05-2015

Agnes Chalbi, Hurth DE

Patent application number	Description	Published
20120238655	METHOD FOR PRODUCING A POLYURETHANE FOAM AND POLYURETHANE FOAM OBTAINABLE THEREBY - A process for producing a polyurethane foam with bimodal cell size distribution, comprising the following steps:	09-20-2012
20120245243	PROCESS FOR PRODUCING A POLYURETHANE FOAM BY MEANS OF SUPERCRITICAL OR NEAR-CRITICAL BLOWING AGENT - The present invention relates to a process for producing a polyurethane foam, where the blowing agent used is present in the supercritical or near-critical state. A reaction mixture is introduced into a closed mould, where the closed mould has been set up in such a way that its interior volume and/or the pressure prevailing in its interior can be altered after the introduction of the mixture by external influence. Through the selection of the surfactant it is possible to obtain microemulsions of the blowing agent in the polyol phase. The invention further relates to a nanocellular polyurethane foam obtainable by the process of the invention.	09-27-2012
20150232629	PROCESS FOR PRODUCING A POLYURETHANE FOAM AND POLYURETHANE FOAM OBTAINABLE THEREFROM - A process for producing a polyurethane foam with bimodal cell size distribution, comprising the following steps:	08-20-2015

Agnes Chapotot, Tavaux FR

Patent application number	Description	Published
20120328806	Composition based on a vinylidene chloride copolymer - A compostion comprising: at least one copolymer (A) of vinylidene chloride and of at least one comonomer copolymerizable therewith selected from butyl acrylates; and from 1 to 20% by weight, relative to the total weight of the composition, of at least one polymeric plasticizer (B) selected from polyesters derived from a polycondensation reaction of at least one aliphatic polycarboxylic acid and at least one polyhydroxylated aliphatic alcohol. The composition is suitable for the preparation of mono- or multi-layer films for the packaging of food products.	12-27-2012

Agnes Cibiel, Bures Su Yvette FR

Patent application number	Description	Published
20130266516	LAR Protein-Specific Ligand - The present invention relates to an aptamer comprising a nucleic acid comprising, or consisting of: the sequence ACUGU CCCAG UAUGA CGCGA CUGCU UAGGU GGGAU GUUUC CCAUG CCUCG (SEQ ID NO: 1), or a sequence comprising, or consisting of, at least 25 consecutive nucleotides in a sequence having at least 80% identity with SEQ ID NO: 1, with the proviso that a nucleic acid consisting of this sequence binds to the LAR protein.	10-10-2013

Agnes Csiszar, Niederzier DE

Patent application number	Description	Published
20120100077	MIXTURE OF AMPHIPATHIC MOLECULES AND METHOD FOR MODIFYING CELL MEMBRANES BY MEANS OF FUSION - Disclosed is a mixture of amphipathic molecules and a method for modifying cells in vivo by way of membrane fusion with these molecules.	04-26-2012

Agnes Degeorges, Clermont-Ferrand FR

Patent application number	Description	Published
20110232819	Tire for Heavy Vehicles Comprising at Least Two Additional Layers in the Beads - A tire with a radial carcass reinforcement comprising a crown reinforcement, itself radially capped by a tread strip, the said tread strip being connected to two beads via two sidewalls, the carcass reinforcement being anchored in each of the beads to form an anchorage region. The tire additionally comprises, in part of at least each of the anchorage regions, at least two layers formed by circumferential winding of a complex strip formed of two layers consisting of continuous reinforcing elements passing from one layer to the other, the said reinforcing elements being parallel within a layer and crossed from one layer to the other at angles with respect to the circumferential direction that are identical in terms of absolute value.	09-29-2011
20130292027	TIRE, THE CARCASS REINFORCEMENT OF WHICH IS REINFORCED WITH A LAYER OF REINFORCING ELEMENTS IN THE BEAD REGION - The invention relates to a tire having a radial carcass reinforcement, consisting of at least one layer of reinforcing elements anchored in each of the beads by an upturn around a bead wire, said carcass reinforcement upturn being reinforced by at least one layer of reinforcing elements or stiffener, the radially outer end of which is radially on the outside of the end of the upturn. According to the invention, the reinforcing elements of at least one stiffener are non-wrapped metal cords with saturated layers, having, in what is called the permeability test, a flow rate of less than 5 cm	11-07-2013
20140305568	TIRE, THE CARCASS REINFORCEMENT OF WHICH IS REINFORCED WITH A LAYER OF REINFORCING ELEMENTS IN THE BEAD REGION - Tire having a radial carcass reinforcement anchored in each bead by an upturn around a bead wire, reinforced by at least one layer of reinforcing elements turned up around the bead wire, one end of said at least one layer of reinforcing elements being axially on the outside of the carcass reinforcement upturn and radially on the inside of the end of said upturn, the other end turned up around the bead wire being axially on the inside of the carcass reinforcement. The reinforcing elements are non-wrapped metal cords with saturated layers, having, in a permeability test, a flow rate of less than 5 cm	10-16-2014

Agnes Delaunay, La Jolla, CA US

Patent application number	Description	Published
20100077491	Modulators of RNF5 and Uses Thereof - Provided herein are compositions and methods relating to the involvement of RNF5 in muscle wasting.	03-25-2010

Agnes De Leuze-Jallouli, St. Petersburg, FL US

Patent application number	Description	Published
20090059383	Process for Edging Optical Lenses - A process for edging an optical lens for conforming the optical lens to the size and shape of a lens frame into which the optical lens is to be accommodated, said process comprising: a) providing an optical lens having a convex surface, the convex surface being provided with an anti-smudge topcoat rendering the optical lens inappropriate for edging; b) fixing a mounting element on the convex surface of the optical lens, preferably on its center, by means of an adhesive pad adhering both to the mounting element and the convex surface of the optical lens to form a mounting element/optical lens assembly; c) placing the mounting element/optical lens assembly in a grinding machine so that the optical lens is firmly maintained; and d) edging the optical lens to the intended size and shape, wherein, prior to step (b) of fixing the mounting element, the anti-smudge topcoat on the convex surface of the optical lens is pre-treated with a solvent selected from the group consisting of alkanols and dialkylketones under a mechanical stress.	03-05-2009

Agnes Depostel, Waly FR

Patent application number	Description	Published
20140148855	SPINAL OSTEOSYNTHESIS DEVICE AND PREPARATION METHOD - A spinal internal implantation device for osteosynthesis has one or more bars for supporting for moving the spine and at least one implant for connecting the bars and vertebrae. The implant includes a blown anchor attached to a body of the implant and a fixation arrangement for the bars. The fixation arrangement includes a clamp for clamping the bar against internal walls of a channel formed in the body of the implant. At least part of the length of the bars includes a transversal bearing structure that is a cross-section of the bars having at least one flat part of a part having a lower forepost convexity than the rest of the cross section.	05-29-2014

Agnes De Postel, Waly FR

Patent application number	Description	Published
20090182381	Spinal Osteosynthesis Device and Preparation Method - A spinal internal implantation device for osteosynthesis has one or more bars for supporting for moving the spine and at least one implant for connecting the bars and vertebrae. The implant includes a blown anchor attached to a body of the implant and a fixation arrangement for the bars. The fixation arrangement includes a clamp for clamping the bar against internal walls of a channel formed in the body of the implant. At least part of the length of the bars includes a transversal bearing structure that is a cross-section of the bars having at least one flat part of a part having a lower forepost convexity than the rest of the cross section.	07-16-2009

Agnes Derecskei-Kovacs, Macungie, PA US

Patent application number	Description	Published
20130078392	HALOGENATED ORGANOAMINOSILANE PRECURSORS AND METHODS FOR DEPOSITING FILMS COMPRISING SAME - Described herein are precursors and methods of forming films. In one aspect, there is provided a precursor having Formula I:	03-28-2013
20130129940	ORGANOAMINOSILANE PRECURSORS AND METHODS FOR MAKING AND USING SAME - Described herein are organoaminosilane precursors which can be used to deposit silicon containing films which contain silicon and methods for making these precursors. Also disclosed herein are deposition methods for making silicon-containing films or silicon containing films using the organoaminosilane precursors described herein. Also disclosed herein are the vessels that comprise the organoaminosilane precursors or a composition thereof that can be used, for example, to deliver the precursor to a reactor in order to deposit a silicon-containing film.	05-23-2013
20130243968	CATALYST SYNTHESIS FOR ORGANOSILANE SOL-GEL REACTIONS - A formulation comprising a first organosilane precursor and a halogenation reagent wherein at least a portion or all of the halogenation reagent reacts to provide the second organosilane precursor. Methods of generating such formulation in situ from readily available pure materials are also provided. Further provided are methods of using the formulations as the precursor for a flowable vapor deposition process.	09-19-2013
20140272194	ORGANOAMINOSILANE PRECURSORS AND METHODS FOR MAKING AND USING SAME - Described herein are organoaminosilane precursors which can be used to deposit silicon containing films which contain silicon and methods for making these precursors. Also disclosed herein are deposition methods for making silicon-containing films or silicon containing films using the organoaminosilane precursors described herein. Also disclosed herein are the vessels that comprise the organoaminosilane precursors or a composition thereof that can be used, for example, to deliver the precursor to a reactor in order to deposit a silicon-containing film.	09-18-2014

Agnes Derecskei-Kovacs, Gambrills, MD US

Patent application number	Description	Published
20120103857	Cylinder Surface Treatment For Monochlorosilane - The present invention is a container and a processing for passivating the internal surface of the container to store monochlorosilane in a stable manner without degradation of the monochlorosilane. Various container surface modifications have been identified to reduce surface reactions to acceptable levels. Some of the described surface modifications result in significant reduction in monochlorosilane instability.	05-03-2012

Agnes Desfarges-Berthelemot, Couzeix FR

Patent application number	Description	Published
20130121364	LASER CAVITY WITH CENTRAL EXTRACTION BY POLARISATION FOR COHERENT COUPLING OF INTENSE INTRA-CAVITY BEAMS - The invention relates to a laser cavity with central extraction by polarisation for coherent coupling of intense intra-cavity beams. The laser cavity (	05-16-2013
20130188244	METHOD AND DEVICE FOR AMPLIFYING AN OPTICAL SIGNAL - According to the invention, the optical signal (SE) is spatially divided into N elementary optical signals (SE.	07-25-2013

Agnes Dimayuga, Mountain View, CA US

Patent application number	Description	Published
20110251930	DATA MANAGEMENT FOR TOP-DOWN RISK BASED AUDIT APPROACH - Particular embodiments generally relate to providing risk management. In one embodiment, a first risk is linked to an account group assertion in a data structure. A second risk is linked to a control objective in the data structure. Access to the first risk is granted through the account group's assertion. Access to the second risk is granted through the control objective. Risk management is then performed using the accessed first risk and second risk.	10-13-2011

Agnes Dupontfilliard, Les Adrets FR

Patent application number	Description	Published
20110250680	AUTOMATED SYSTEM FOR THE LYSIS OF MICROORGANISMS PRESENT IN A SAMPLE, FOR EXTRACTION AND FOR PURIFICATION OF THE NUCLEIC ACIDS OF SAID MICROORGANISMS FOR PURPOSES OF ANALYSIS - The present invention relates to, among other things, a device for collecting airborne microorganisms, said device having:	10-13-2011

Agnes Fonverne, Vizille FR

Patent application number	Description	Published
20090084496	Method for fabricating a microfluidic component comprising at least one microchannel filled with nanostructures - A microfluidic component comprises at least one closed microchannel filled with nanostructures. The microchannel is produced by previously forming an opening delineating a bottom wall and two opposite side walls of the microchannel in a surface of a substrate. The nanostructures filling said microchannel are formed by in situ growth to constitute a layer of metallic catalyst deposited on said side walls and on said wall bottom. The microchannel is closed, before the nanostructures are formed, by sealing a protective cover onto said surface of the substrate. Sealing is obtained by formation of an eutectic compound between a material of the cover and the metal of the catalyst used for in situ growth of the nanostructures and deposited on the surface of the substrate designed to come into contact with the cover.	04-02-2009

Agnes Gorce, Marseille FR

Patent application number	Description	Published
20110311598	POWDERY EMULSIFYING COMPOSITION OF ALKYL POLYGLYCOSIDES, USE THEREOF FOR PREPARING COSMETIC EMULSIONS, AND METHOD FOR PREPARING SAME - A powdery composition C1 contains for 100% of the mass: 5 to 70 mass % and more particularly 10 to 50 mass % of at least one compound of formula (I): R—O-(G)	12-22-2011
20120114573	OIL-IN-WATER EMULSION HAVING IMPROVED SENSORY PROPERTIES - An oil-in-water emulsion includes, for 100 wt % thereof: a) 0.1 to 10 wt % of an emulsifying system including, for 100 wt % thereof: (i) 5 to 95 wt % of the mixture of the reaction products of a reducing sugar and 1,12-octadecanediol essentially consisting of hydroxyl-octadecyl polyglycosides of formula (I): HO—R—O-(G)	05-10-2012
20140219936	OIL-IN-WATER EMULSION HAVING IMPROVED SENSORY PROPERTIES - An oil-in-water emulsion includes, for 100 wt % thereof: a) 0.1 to 10 wt % of an emulsifying system including, for 100 wt % thereof: (i) 5 to 95 wt % of the mixture of the reaction products of a reducing sugar and 1,12-octadecanediol essentially consisting of hydroxyl-octadecyl polyglycosides of formula (I): HO—R—O-(G)	08-07-2014
20140248321	POWDERY EMULSIFYING COMPOSITION OF ALKYL POLYGLYCOSIDES, USE THEREOF FOR PREPARING COSMETIC EMULSIONS, AND METHOD FOR PREPARING SAME - A powdery composition C1 contains for 100% of the mass: 5 to 70 mass % and more particularly 10 to 50 mass % of at least one compound of formula (I): R—O-(G)	09-04-2014
20140248323	POWDERY EMULSIFYING COMPOSITION OF ALKYL POLYGLYCOSIDES, USE THEREOF FOR PREPARING COSMETIC EMULSIONS, AND METHOD FOR PREPARING SAME - A powdery composition C1 contains for 100% of the mass: 5 to 70 mass % and more particularly 10 to 50 mass % of at least one compound of formula (I): R—O-(G)	09-04-2014
20140248368	POWDERY EMULSIFYING COMPOSITION OF ALKYL POLYGLYCOSIDES, USE THEREOF FOR PREPARING COSMETIC EMULSIONS, AND METHOD FOR PREPARING SAME - A powdery composition C1 contains for 100% of the mass: 5 to 70 mass % and more particularly 10 to 50 mass % of at least one compound of formula (I): R—O-(G)	09-04-2014
20140255457	POWDERY EMULSIFYING COMPOSITION OF ALKYL POLYGLYCOSIDES, USE THEREOF FOR PREPARING COSMETIC EMULSIONS, AND METHOD FOR PREPARING SAME - A powdery composition C1 contains for 100% of the mass: 5 to 70 mass % and more particularly 10 to 50 mass % of at least one compound of formula (I): R—O-(G)	09-11-2014

Agnes Gouble, Paris FR

Patent application number	Description	Published
20100144012	USE OF MEGANUCLEASES FOR INDUCING HOMOLOGOUS RECOMBINATION EX VIVO AND IN TOTO IN VERTEBRATE SOMATIC TISSUES AND APPLICATION THEREOF - A single chain homing endonuclease, comprising a first variant of I-CreI having the amino acid sequence of accession number pdb 1g9y and a second variant of I-CreI variant having the amino acid sequence of accession number pdb 1g9y in a single polypeptide.	06-10-2010
20100146651	MEGANUCLEASE VARIANTS CLEAVING A DNA TARGET SEQUENCE FROM THE HPRT GENE AND USES THEREOF - An I-CreI variant or a single-chain derivative having at least one substitution in one of the two functional subdomains of the LAGLIDADG (SEQ ID NO: 153) core domain situated from positions 26 to 40 and 44 to 77 of I-CreI, and being able to cleave a DNA target sequence from the HPRT gene having a nucleotide sequence of SEQ ID NO: 1 to 14. Use of said variant for inducing a site-specific modification in the HPRT gene, for therapeutic (gene therapy of Lesch-Nyhan syndrome) or non-therapeutic purpose (engineering of transgenic animals and recombinant cell lines).	06-10-2010
20100203031	METHOD FOR ENHANCING THE CLEAVAGE ACTIVITY OF I-CREI DERIVED MEGANUCLEASES - A method for enhancing the cleavage activity of an I-CreI derived meganuclease, comprising the site-specific mutation of at least one amino acid residue which is selected in the group consisting of: the glycine at position 19, the phenylalanine at position 54, the phenylalanine at position 87, the serine at position 79, the valine at position 105 and the isoleucine at position 132 of I-CreI, and its application for the manufacturing of meganuclease cleaving a DNA target of interest, for use in genome therapy (treatment of genetic diseases) and genome engineering (making of transgenic animals, transgenic plants and recombinant cell lines).	08-12-2010
20100325745	MEGANUCLEASE VARIANTS CLEAVING A DNA TARGET SEQUENCE FROM THE MOUSE ROSA26 LOCUS AND USES THEREOF - An I-CreI variant, wherein one of the two I-CreI monomers has at least two substitutions, one in each of the two functional subdomains of the LAGLIDADG (SEQ ID NO: 150) core domain situated respectively from positions 26 to 40 and 44 to 77 of I-CreI, said variant being able to cleave a DNA target sequence from the mouse ROSA26 locus. Use of said variant and derived products for the engineering of transgenic mice and recombinant mouse cell lines expressing an heterologous protein of interest.	12-23-2010
20110091441	MEGANUCLEASE VARIANTS CLEAVING A DNA TARGET SEQUENCE FROM THE HUMAN INTERLEUKIN-2 RECEPTOR GAMMA CHAIN GENE AND USES THEREOF - An I-CreI variant, wherein at least one of the two I-CreI monomers has at least two substitutions, one in each of the two functional subdomains of the LAGLIDADG core domain situated respectively from positions 26 to 40 and 44 to 77 of I-CreI, said variant being able to cleave a DNA target sequence from the human IL2RG gene. Use of said variant and derived products for the prevention and the treatment of X-linked severe combined immunodeficiency.	04-21-2011
20110151539	USE OF MEGANUCLEASES FOR INDUCING HOMOLOGOUS RECOMBINATION EX VIVO AND IN TOTO IN VERTEBRATE SOMATIC TISSUES AND APPLICATION THEREOF - A single chain homing endonuclease, comprising a first variant of I-CreI having the amino acid sequence of accession number pdb 1g9y and a second variant of I-CreI variant having the amino acid sequence of accession number pdb 1g9y in a single polypeptide.	06-23-2011
20110287513	USE OF MEGANUCLEASES FOR INDUCING HOMOLOGOUS RECOMBINATION EX VIVO AND IN TOTO IN VERTEBRATE SOMATIC TISSUES AND APPLICATION THEREOF - A single chain homing endonuclease, comprising a first variant of I-CreI having the amino acid sequence of accession number pdb 1g9y and a second variant of I-CreI variant having the amino acid sequence of accession number pdb 1g9y in a single polypeptide.	11-24-2011
20130059387	MEGANUCLEASE VARIANTS CLEAVING A DNA TARGET SEQUENCE FROM THE HPRT GENE AND USES THEREOF - A method for inducing a site-specific modification in the HPRT gene, for a non-therapeutic purpose, by contacting a DNA target sequence selected from the group consisting of the sequences SEQ ID NO: 1 to 14 thereby cleaving the DNA target with an I-CreI variant or single-chain derivative having at least one substitution in one of the two functional subdomains of the LAGLIDADG (SEQ ID NO: 153) core domain situated from positions 26 to 40 and 44 to 77 of I-CreI.	03-07-2013
20130236946	MEGANUCLEASE VARIANTS CLEAVING A DNA TARGET SEQUENCE FROM THE MOUSE ROSA26 LOCUS AND USES THEREOF - An I-CreI variant, wherein one of the two I-CreI monomers has at least two substitutions, one in each of the two functional subdomains of the LAGLIDADG core domain situated respectively from positions 26 to 40 and 44 to 77 of I-CreI, said variant being able to cleave a DNA target sequence from the mouse ROSA26 locus. Use of said variant and derived products for the engineering of transgenic mice and recombinant mouse cell lines expressing an heterologous protein of interest.	09-12-2013
20130315884	METHODS FOR ENGINEERING ALLOGENEIC AND IMMUNOSUPPRESSIVE RESISTANT T CELL FOR IMMUNOTHERAPY - Methods for developing engineered T-cells for immunotherapy that are both non-alloreactive and resistant to immunosuppressive drugs. The present invention relates to methods for modifying T-cells by inactivating both genes encoding target for an immunosuppressive agent and T-cell receptor, in particular genes encoding CD52 and TCR. This method involves the use of specific rare cutting endonucleases, in particular TALE-nucleases (TAL effector endonuclease) and polynucleotides encoding such polypeptides, to precisely target a selection of key genes in T-cells, which are available from donors or from culture of primary cells. The invention opens the way to standard and affordable adoptive immunotherapy strategies for treating cancer and viral infections.	11-28-2013
20140017731	MEGANUCLEASE VARIANTS CLEAVING A DNA TARGET SEQUENCE FROM THE HUMAN INTERLEUKIN-2 RECEPTOR GAMMA CHAIN GENE AND USES THEREOF - An I-CreI variant, wherein at least one of the two I-CreI monomers has at least two substitutions, one in each of the two functional subdomains of the LAGLIDADG core domain situated respectively from positions 26 to 40 and 44 to 77 of I-CreI, said variant being able to cleave a DNA target sequence from the human IL2RG gene. Use of said variant and derived products for the prevention and the treatment of X-linked severe combined immunodeficiency.	01-16-2014
20140112904	METHOD FOR ENHANCING THE CLEAVAGE ACTIVITY OF I-CREI DERIVED MEGANUCLEASES - A method for enhancing the cleavage activity of an I-CreI derived meganuclease, comprising the site-specific mutation of at least one amino acid residue which is selected in the group consisting of: the glycine at position 19, the phenylalanine at position 54, the phenylalanine at position 87, the serine at position 79, the valine at position 105 and the isoleucine at position 132 of I-CreI, and its application for the manufacturing of meganuclease cleaving a DNA target of interest, for use in genome therapy (treatment of genetic diseases) and genome engineering (making of transgenic animals, transgenic plants and recombinant cell lines).	04-24-2014
20140121115	CUSTOM-MADE MEGANUCLEASE AND USE THEREOF - New rare-cutting endonucleases, also called custom-made meganucleases, which recognize and cleave a specific nucleotide sequence, derived polynucleotide sequences, recombinant vector cell, animal, or plant comprising said polynucleotide sequences, process for producing said rare-cutting endonucleases and any use thereof, more particularly, for genetic engineering, antiviral therapy and gene therapy.	05-01-2014
20150017136	METHODS FOR ENGINEERING ALLOGENEIC AND HIGHLY ACTIVE T CELL FOR IMMUNOTHERAPY - The present invention relates to methods for developing engineered T-cells for immunotherapy that are non-alloreactive. The present invention relates to methods for modifying T-cells by inactivating both genes encoding T-cell receptor and an immune checkpoint gene to unleash the potential of the immune response. This method involves the use of specific rare cutting endonucleases, in particular TALE-nucleases (TAL effector endonuclease) and polynucleotides encoding such polypeptides, to precisely target a selection of key genes in T-cells, which are available from donors or from culture of primary cells. The invention opens the way to standard and affordable adoptive immunotherapy strategies for treating cancer and viral infections.	01-15-2015
20150203817	USE OF PRE T ALPHA OR FUNCTIONAL VARIANT THEREOF FOR EXPANDING TCR ALPHA DEFICIENT T CELLS - A method of expanding TCRalpha deficient T-cells by expressing pTalpha or functional variants thereof into said cells, thereby restoring a functional CD3 complex. This method is particularly useful to enhance the efficiency of immunotherapy using primary T-cells from donors. This method involves the use of pTalpha or functional variants thereof and polynucleotides encoding such polypeptides to expand TCRalpha deficient T-cells. Such engineered cells can be obtained by using specific rare-cutting endonuclease, preferably TALE-nucleases. The use of Chimeric Antigen Receptor (CAR), especially multi-chain CAR, in such engineered cells to target malignant or infected cells. The invention opens the way to standard and affordable adoptive immunotherapy strategies for treating cancer and viral infections.	07-23-2015

Agnes Gruart I Masso, Sevilla ES

Patent application number	Description	Published
20090131339	COMPOUNDS HAVING NEUROPROTECTIVE PROPERTIES - The invention relates to the use of morin and mangiferin, the pharmaceutically acceptable salts, prodrugs and/or solvates thereof in the production of a pharmaceutical composition for the prevention and/or treatment of a neurodegenerative disease and symptoms associated with ageing, as well as to food compositions comprising said compounds.	05-21-2009

Agnes Hincelin-Mery, Paris FR

Patent application number	Description	Published
20130065828	PHARMACEUTICAL COMBINATION FOR USE IN GLYCEMIC CONTROL IN DIABETES TYPE 2 PATIENTS - The present invention refers to a pharmaceutical combination for use in glycemic control in diabetes type 2 patients.	03-14-2013

Agnes Hirschler-Rea, Aubagne FR

Patent application number	Description	Published
20080206839	Use of Thermophilic Sulphate-Reducing Archaea For the Implementation of a Process For the Degradation of Hydrocarbons - The aim of the invention is to use sulphate-reducing thermophilic archaeobacteria for carrying out a method for degrading linear or branched, saturated or unsaturated, when necessary sulphur, aromatic hydrocarbons under anaerobic conditions.	08-28-2008

Agnes Jallouli, Largo, FL US

Patent application number	Description	Published
20120300170	Optical Article Comprising an Anti-Reflecting Coating Having Anti-Fogging Properties - An optical article having anti-fogging properties, comprising a substrate having one main face coated with an anti-reflecting stack of layers of low refractive index (Ll) and high refractive index (HI) including an outermost and innermost layer, wherein the outermost layer of the anti-reflecting stack is a sandwich layer comprising a core portion interleaved between two side portions, said core portion being made of SiO	11-29-2012

Agnes Jaszenovics, Newark, CA US

Patent application number	Description	Published
20110300766	Silicone Gel Seal And Method For Its Preparation And Use - A form stable gel may be used to make a seal between substrates to minimize air and moisture penetration. The form stable gel is useful in construction industry applications such as sealing window frame members, sealing retrofit and replacement windows, as well as indoor applications such as sealing bathtubs, sinks and shower surrounds. The form stable gel is also useful for sealing applications in boat hulls.	12-08-2011

Agnes Jaulent, Cambridge GB

Patent application number	Description	Published
20140005126	SCAFFOLD PEPTIDES	01-02-2014

Agnes Keri, Budapest HU

Patent application number	Description	Published
20090130234	Composition for the Treatment of Diabetic Periodontitis - The invention refers to the use of an extract of a part of a	05-21-2009
20090214677	Pharmaceutical Composition Containing an Extract of a Solidago Species - An extract of a part of a	08-27-2009

Agnes Kim-Meade, Fanwood, NJ US

Patent application number	Description	Published
20080279822	Crystalline Polymorphs of a CXC-Chemokine Receptor Ligand - The present invention relates to four distinct crystalline polymorphs of a monohydrate of Compound A having the following chemical structure:	11-13-2008

Agnes Klucha, Colchester, CT US

Patent application number	Description	Published
20130026338	RAPID CASTING ARTICLE MANUFACTURING - A method of manufacturing a casting article for use in a casting process includes rapidly forming the casting article out of a metallic material. A ceramic coating is applied to an exterior surface of the casting article.	01-31-2013
20130193620	MULTI-DIMENSIONAL COMPONENT BUILD SYSTEM AND PROCESS - An example multi-dimensional component building system includes a first chamber having at least one base, a second chamber adjacent to and in fluid communication with the first chamber through a first door, and a third chamber adjacent to and in fluid communication with the second chamber through a second door. The second chamber is fluidly sealed from the first chamber if the first door is in a closed position. The second chamber includes a directed heat source, a build-up material and is configured to receive the at least one base if the fluid parameters of the first chamber and second chamber are approximately equal. The third chamber is fluidly sealed from the second chamber if the first door is in a closed position. The third chamber is configured to receive the at least one base, having a formed component disposed thereon, if the second door is in an open position.	08-01-2013
20130276461	AIRFOIL HAVING INTERNAL LATTICE NETWORK - An airfoil includes an airfoil body that defines a longitudinal axis. The airfoil body includes a leading edge and a trailing edge and a first side wall and a second side wall that is spaced apart from the first side wall. The first side wall and the second side wall join the leading edge and the trailing edge and at least partially define a cavity in the airfoil body. A lattice network connects the first side and the second side. The lattice network includes at least one enlarged node spaced apart from the first side wall and the second side wall and ribs that extend from the at least one enlarged node. Each of the ribs connects to one of the first side wall and the second side wall.	10-24-2013
20130294901	METAL POWDER CASTING - A method of component forming according to an exemplary aspect of the present disclosure includes, among other things, positioning a metal powder in a mold cavity, melting the metal powder within the mold cavity, and cooling the melted metal powder to form a component.	11-07-2013
20140093384	Method of Manufacturing Complex Shaped Component - A method of forming a complex shaped part includes the steps of forming a polymer core by an additive manufacturing process. A metal is plated about surfaces of the polymer core, and the polymer core is removed, leaving hollows within a plate core. Metal powder is deposited within the hollows. An integral blade rotor is also disclosed.	04-03-2014
20140169981	UBER-COOLED TURBINE SECTION COMPONENT MADE BY ADDITIVE MANUFACTURING - A gas turbine airfoil having internal cooling passages is formed by additive manufacturing. Layers of superalloy powder are fused by an energy beam using a two-dimensional pattern providing unmelted areas forming passageways therein. Layers of the powder are added and fused using sufficient two-dimensional patterns to form the entire airfoil with the desired pattern of internal cooling passages. After completion of the formation of the airfoil, it may be hot isostatic pressed, directionally recrystallized, bond coated, and covered with a thermal barrier layer.	06-19-2014
20140178241	ABSORBED IMPURITIES REDUCTION IN ADDITIVE MANUFACTURING SYSTEMS - A pulverant material supply system has an outer shell, an inner shell, and a plurality of openings to a passage within the inner shell to allow a reducing fluid into the pulverant material contained therein. The liner is made from a non-evaporable getter alloy.	06-26-2014
20140186098	WORK PIECE HAVING SELF-SUPPORTING GUSSET AND METHOD RELATED THERETO - A powder-derived, non-finished work piece includes a first body section that has a wall that spans in a vertical direction. The wall has a relatively thin thickness with respect to a length and a width of the wall. A second body section is arranged next to, but spaced apart from, the first body section. A gusset connects the first body section and the second body section. The gusset extends obliquely from the wall of the first body section with respect to the vertical direction such that the gusset is self-supporting. The first body section has a geometry that corresponds to an end-use component exclusive of the gusset.	07-03-2014
20150069668	MULTI-DIMENSIONAL COMPONENT BUILD SYSTEM AND PROCESS - An example multi-dimensional component building system includes a first chamber having at least one base disposed therein, a second chamber adjacent to and in fluid communication with the first chamber through a first door, and a third chamber adjacent to and in fluid communication with the second chamber through a second door. The second chamber is fluidly sealed from the first chamber if the first door is in a closed position. The second chamber is configured to receive the at least one base via a first transfer mechanism if the fluid parameters of the first chamber are approximately equal to the fluid parameters of the second chamber. The second chamber includes a directed heat source and a build-up material configured to form a component on the at least one base by melting or sintering. The third chamber is fluidly sealed from the second chamber if the first door is in a closed position. The third chamber is configured to receive the at least one base, having a formed component disposed thereon, via a second transfer mechanism if the second door is in an open position. The fluid parameters of the second chamber are not substantially affected by fluid communication with the first chamber or the third chamber.	03-12-2015

Agnes Kulosa, Herne DE

Patent application number	Description	Published
20110070175	USE OF ORGANOMODIFIED SILOXANE BLOCK COPOLYMERS AS CARE ACTIVE INGREDIENT FOR THE CARE OF HUMAN OR ANIMAL BODY PARTS - The present invention relates to the use of organomodified siloxane block copolymers as care active ingredient for the care of human or animal body parts.	03-24-2011

Agnes Ladous, Charenton-Le-Pont FR

Patent application number	Description	Published
20120002162	METHOD FOR CUTTING A PATCH TO BE APPLIED ONTO A CURVED SUBSTRATE - A method cuts a patch to be applied onto a curved substrate and includes the preliminary calculation of curvilinear lengths on the substrate between a reference point and a peripheral edge of said substrate. The calculated lengths are applied to a planar film for making the patch, and then the patch is cut by connecting the ends of the applied lengths. The patch then precisely coincides with the edge of the substrate. Such a method is particularly useful for applying a functional film onto a spectacle lens, as a trimming of the lens after the film is assembled with the lens would degrade said film.	01-05-2012
20140347626	Process Of Determination Of A Semi - Finished Blank - Method for determining a semi-finished lens blank, comprising the steps consisting of:—determining, for a given material, a set of faces (S-i , S	11-27-2014

Agnes Lehuen, Paris FR

Patent application number	Description	Published
20140037607	CULTURE MEDIUM AND METHOD FOR OBTAINING A POPULATION OF TOLEROGENIC DENDRITIC CELLS - The present invention relates to a culture medium suitable for inducing dendritic cell differentiation comprising an effective amount of secretory immunoglobulins A (SIgA) and also to a method for obtaining a population of tolerogenic dendritic cells from cells, in particular monocytes. The present invention relates to uses of tolerogenic dendritic cells thus obtained in therapy and in induction of transplant tolerance.	02-06-2014

Agnes Liu, Walnut, CA US

Patent application number	Description	Published
20100115426	AVATAR ENVIRONMENTS - Embodiments are directed towards providing dynamic and interactive avatars of social networking members for use in visually displaying interactions and activities within a messaging context. A user interface is provided that enables relationships toy be displayed within a messaging context through automatic and/or dynamic grouping and/or re-arranging of avatars representing the member and a messaging user. Similar to, albeit it different from, an actual social event/party the dynamic displaying of members' avatars reflects how groups of people may interact. Thus, the disclosed embodiments provide a dynamic visual interface illustrating social congregation and interactions between members of a messaging social network.	05-06-2010
20140095328	INTERACTIVE REVEAL AD UNIT - An interactive reveal advertising unit is presented in a webpage. The motion and animation of the advertising unit's creative is tied to the user interaction with the device displaying the webpage, the web page or the advertising unit itself, so that the creative responds directly to the user interaction. The overall layout of the creative elements in the unit is changed based on various factors. The advertising unit also expands to reveal an expanded canvas that displays additional media.	04-03-2014
20140095329	OPEN CANVAS ADVERTISING UNIT - A full screen advertisement is embedded within the content of a webpage that comprises a plurality of portions that are configured to form fit the display so that each portion of the webpage extends between the four edges of the display. The advertisement is also response as it reshapes to form fit the resolution of the output device. The advertisement also includes a gated content section that can be unlocked through a product purchase or through a social tie-in.	04-03-2014
20150193122	SYSTEMS AND METHODS FOR DELIVERING TASK-ORIENTED CONTENT - Various embodiments of the present disclosure relate to systems and methods for delivering various types of content (such as news articles) to users. Among other things, embodiments of the present disclosure help provide users with concise articles containing the best content from a variety of sources, and present such content in a task-oriented manner that is finite and incentivizes the user to review the content.	07-09-2015
20150193426	SYSTEMS AND METHODS FOR IMAGE PROCESSING - Various embodiments of the present disclosure relate to systems and methods for dynamically modifying images based on the content of articles associated with the images, particularly the emotional content of an article. Among other things, embodiments of the present disclosure allow users to quickly and easily identify the emotional nature of an article based on such an image. Characteristics of an image associated with an article may also be modified in response to comments from viewers regarding the article.	07-09-2015
20150286346	GESTURE INPUT FOR ITEM SELECTION - Many applications may display information through lists. For example, an email application may display a current visual interface comprising a list of emails. A gesture input may be received for an item within the item list. Responsive to receiving the gesture input, the item may be selected. In an example, the item list may be transitioned into an editing mode based upon the gesture input. While in the editing mode, context indicators (e.g., indicating whether an email item has been read or is unread) may be modified (e.g., shrunk) and/or selection indicators may be displayed for items within the item list. A selection indicator may be selected to select a corresponding item. In this way, gesture input (e.g., single gesture) may be used to select items and/or to transition the item list into the editing mode without transitioning away from the item list.	10-08-2015
20150286383	SYSTEMS AND METHODS FOR DELIVERING TASK-ORIENTED CONTENT USING A DESKTOP WIDGET - Various embodiments of the present disclosure relate to systems and methods for presenting content to users using desktop widgets. Among other things, embodiments of the present disclosure allow users to quickly and easily access content (such as news articles) from their home screen without having to independently start a software application to do so.	10-08-2015

Agnes Luty, New South Wales AU

Patent application number	Description	Published
20100028356	METHOD OF DIAGNOSING A NEURODEGENERATIVE DISEASE - The present invention provides a method for diagnosing a neurodegenerative disease or for determining the predisposition of a subject to a neurodegenerative disease. In particular, the methods of the present invention comprise detecting a marker linked to map position 9p21, e.g., a marker within an opioid receptor sigma 1 (OPRS1) gene or an expression produce thereof. The present invention also provides a method for identifying new markers that are associated with a neurodegenerative disease. The present invention also provides mutant forms of an OPRS1 gene or an expression product thereof and reagents for detecting those mutations.	02-04-2010

Agnes Mannel, Obergunzburg DE

Patent application number	Description	Published
20120321229	POUCH PACKAGING WITH ADHESIVE BONDING TAB - The present invention relates to a bag pack (	12-20-2012

Agnes Moreau-Aubry, Nantes Cedex FR

Patent application number	Description	Published
20140088290	Novel Melanoma Antigen Peptide and Uses Thereof - The present invention relates to novel melanoma antigen peptides and specific T lymphocytes directed to said peptides and the use thereof for treating melanoma.	03-27-2014

Agnes Moreau-Aubry, Nantes FR

Patent application number	Description	Published
20110212098	Novel Melanoma Antigen Peptide and Uses Thereof - The present invention relates to novel melanoma antigen peptides and specific T lymphocytes directed to said peptides and the use thereof for treating melanoma.	09-01-2011

Agnes Ostafin, Layton, UT US

Patent application number	Description	Published
20090169866	NANOCOMPOSITE MATERIALS WITH DYNAMICALLY ADJUSTING REFRACTIVE INDEX AND METHODS OF MAKING THE SAME - A concept and synthesis technology for a composite nanoparticle material which can be used to develop nanocomposite films and suspension with 1) dynamic refractive index control across a wide temperature and wavelength of light, and specified refractive index range, or 2) magnetic susceptibility or electronic conductivity over a wide temperature, magnetic field and electric field range. Core-shell nanoparticles can be made from two or more materials whose temperature dependent, electric field dependent or magnetic field dependent properties compensate one another will dynamically maintain a targeted refractive index, electronic conductivity or magnetic susceptibility over a specified temperature, electric and/or magnetic field range. Mixtures of composite nanoparticles with complementary behavior can optionally be used to widen the operational range of the nanocomposite material further or dampen temperature dependency in a controlled manner, e.g. using a non-random distribution of particles to affect a compensating gradient in the property of interest.	07-02-2009
20110207232	WATER SOLUBLE PH RESPONSIVE FLUORESCENT NANOPARTICLES - A nano-pH sensor can include a nanoparticle having an outer surface functionalized by a carboxy functional group. The nanoparticle is reversibly aggregated as a function of pH and is generally non-toxic. A fluorometer can be oriented to expose the nanoparticles to a light source at a given wavelength. Further, the fluorometer can be configured to detect changes in fluorescence of the gold nanoparticle with changes in pH.	08-25-2011
20120077662	Method And Apparatus For Continuous Removal Of Submicron Sized Particles In A Closed Loop Liquid Flow System - A method and apparatus for continuous removal of submicron sized artificial oxygen carriers (rAOC) and other materials such as cancer cells and bacteria from blood and other liquids. A centrifuge rotor having a curved shape is offset on a spinning rotor base and creates contiguous areas of low to high centrifugal force depending on the distances from the axis of the rotor base. This creates a density gradient field that separates materials of different densities input to the centrifuge that exit via different outputs. A monitor detects any red blood cells (RBC) with the rAOC before they exit the centrifuge. If there are any RBC detected logic circuitry changes the speed of rotation of the rotor, and the flow rate of pumps inputting and removing separated blood and rAOC to and from the centrifuge until there are no RBC in the rAOC exiting the centrifuge.	03-29-2012
20120164231	Synthesis Of Oxygen Carrying, Turbulence Resistant, High Density Submicron Particulates - An artificial oxygen carrier (AOC) for use in the body. A first gas permeable first shell encloses an oxygen carrying agent. The first shell has a second oxygen carrying agent surrounding it, and there is a second gas permeable shell enclosing the second agent. The concentric shells are not subject to turbulent breakup, or chemical decomposition, do not release the agents.	06-28-2012
20140008301	THERAPEUTIC RETRIEVAL OF TARGETS IN BIOLOGICAL FLUIDS - Method and apparatus for removing high density particles from a biological fluid such as blood using aphaeresis. The particles are preferably sub-micron in size and denser than normally occurring components of the fluid and can be removed by a modified reverse-flow gradient density centrifuge without damaging the fluid. The particles can be provided to a patient in vivo or added to the fluid after it is removed from the patient. Some particles can carry and deliver oxygen and scavenge carbon dioxide. Other particles are conjugated to capture molecules for attaching to targets such as cancer cells, viruses, pathogens, toxins, or excess concentrations of a drug or element in the fluid. The targets are then removed from the fluid along with the particles by the aphaeresis instrument.	01-09-2014

Agnes Pappne Behr, Budapest HU

Patent application number	Description	Published
20080280961	New amino-alkyl-amide derivatives as CCR3 receptor ligands - The invention relates to a compound of the general formula (I),	11-13-2008
20080280963	New amino-alkyl-amide derivatives as CCR3 receptor ligands - The invention relates to a compound of the general formula (I),	11-13-2008
20080287434	New amino-alkyl-amide derivatives as CCR3 receptor ligands - The invention relates to a compound of the general formula (I),	11-20-2008
20080293745	New amino-alkyl-amide derivatives as CCR3 receptor ligands - The invention relates to a compound of the general formula (I),	11-27-2008

Agnes Penaud, Mouans-Sartoux FR

Patent application number	Description	Published
20100293235	METHOD AND SYSTEM FOR MANAGING THE ORDER OF MESSAGES - A method of ordering a plurality of messages received from a sender to be sent to a receiver in a sequence based on the dependency of one message on one or more other messages, the method comprising the steps of: receiving one or more messages from a stream of messages and storing them in a database; identifying a characteristic (P-Key-Order) of each message which is common to a group of messages; identifying a message dependency for the messages in the group of messages from a parameter of the message; reviewing a particular stored message in the database to determine if the stored message can be sent by; determining whether the stored message is dependent on a previous message and determining a status of the previous message; updating the status of the stored message based on the status of the previous message; sending the stored message after acknowledgement that the previous message has been sent.	11-18-2010

Agnes Pesteil, Alfortville FR

Patent application number	Description	Published
20130064673	VORTEX GENERATORS FOR GENERATING VORTICES UPSTREAM OF A CASCADE OF COMPRESSOR BLADES - A blade assembly for a turbomachine compressor includes a plurality of individual devices acting on the flow. The individual devices are provided upstream of the blade assembly and are formed at least so as to generate vortices. Each of the individual devices is arranged on an upstream face of a shroud around which a recirculating flow passes, circulating in a cavity. The recirculating flow is reinjected into the principal flow such that the individual devices act simultaneously on the principal flow and on the recirculating flow.	03-14-2013
20130156559	COMPRESSOR AND A TURBINE ENGINE WITH OPTIMIZED EFFICIENCY - A turbine engine compressor including a casing having its inside wall defining an aerodynamic reference surface for a gas-passing passage and in which a rotor wheel having radial blades is mounted. A circumferential trench is formed in the inside wall of the casing. Its shape is defined from upstream to downstream by three surfaces, respectively an upstream surface, a middle surface, and a downstream surface, which surfaces are substantially conical. The upstream surface extends upstream from the leading edges of the blades. The middle surface is substantially parallel to the aerodynamic reference surface. The downstream surface extends downstream at least as far as the trailing edges of the blades. The junction between the middle and downstream surfaces is in a range of 30% to 80% or 50% to 65% of the axial length of the blades starting from their leading edges.	06-20-2013
20130266451	TURBINE ENGINE BLADE HAVING IMPROVED STACKING LAW - A turbine engine blade, including an airfoil which extends radially between a blade root and an airfoil tip, axially between a leading edge and a trailing edge, and tangentially between a pressure side and a suction side, the profile of the blade having a series of basic profiles, in a form of a vane section, stacked on one another along a stacking line connecting the center of gravity of all the vane sections. The projection of the stacking line of the airfoil on at least one plane extending radially from the blade root includes a double tangential inversion of the direction of the curvature thereof, located in the last thirty percent of the height of the airfoil, the projection plane being positioned substantially perpendicular to the chord of the blade.	10-10-2013
20140286768	TURBOMACHINE ELEMENT - A turbomachine element including an airfoil set including a plurality of airfoils that are offset from one another in a lateral direction, and upstream from at least one end of each airfoil, a group of a plurality of vortex generator devices that are mutually offset both laterally and axially.	09-25-2014

Agnes Pilas-Begue, Miribel FR

Patent application number	Description	Published
20120238527	ORGANOPHOSPHORUS DERIVATIVES AND USE THEREOF AS UNCOUPLING AGENTS - The present invention relates to an organophosphonium derivative of the mean general formula (1), where n is a number comprised between 4 and 20, preferably between 5 and 10, m is a number between 0 and 10, preferably between 0 and 1, and Y is an anion.	09-20-2012
20130005810	ORGANIC UNCOUPLING AGENTS - The present invention relates to a method for controlling the growth of bacterial biomass in an aqueous system, including adding to the aqueous system or contacting the aqueous system, with an efficient amount of an uncoupling agent selected from vanillin, pentaerythritol and a betaine of general formula (1): (R)	01-03-2013
20130105387	TREATMENT FOR DEPOLLUTING WATER CONTAMINATED BY MICRO POLLUTANTS AND/OR EMERGENT POLLUTANTS, NOTABLY BY ORGANOCHLORINATED COMPOUNDS	05-02-2013

Agnes Poulbot, Les Martres D'Artiere FR

Patent application number	Description	Published
20110277898	TREAD WITH AN IMPROVED DRAINAGE SPACE - Tyre tread band (	11-17-2011

Agnes Princivalle, Lagnes FR

Patent application number	Description	Published
20100229542	TEXTURIZED PURIFICATION STRUCTURE INCORPORATING AN ELECTROCHEMICAL CATALYST SYSTEM - A structure for the purification of a polluted gas comprising a porous matrix of an inorganic material, in the form of interconnected grains and an electrochemical system for the treatment of said gas, formed by a reduction catalyst A for reducing the polluting species of the NO	09-16-2010
20110250112	PURIFICATION STRUCTURE INCLUDING A CATALYSIS SYSTEM SUPPORTED BY A ZIRCON IN REDUCED STATE - The invention relates to a filtration structure, for filtering a gas coming from a diesel engine, which is laden with gaseous pollutants of the nitrogen oxide NO	10-13-2011
20130136676	ELECTROCHEMICAL CATALYSIS SYSTEM - The present invention relates to the use, for the reduction of oxidizing contaminating entities of the NO	05-30-2013
20130142702	ELECTROCHEMICAL CATALYSIS SYSTEM - The present invention relates to an electrocatalytic system for the joint treatment of oxidizing polluting entities of the NO	06-06-2013
20150111729	EXHAUST GAS TREATMENT CATALYST - Catalyst system suitable especially for the removal of CO compounds, comprising or consisting of an oxide, preferably of fluorite crystalline structure, conforming to the following molar formulation:	04-23-2015

Agnes Rey-Giraud, Clarkson Valley, MO US

Patent application number	Description	Published
20130103602	SYSTEM AND METHOD FOR BENEFIT PLAN COST ESTIMATION - A computer-based method and system to enable a benefit plan sponsor to design a plurality of benefit plans to be offered to a given participant population and for determining the cost of sponsoring the plans for the participant population by predicting utilization for each of the plans based upon historical utilization data for the population, projected plan selections based upon presumed participant objectives, and/or survey or historical data from a sample of the given population or from preexisting statistical samples exhibiting analogous demographic characteristics to the given participant population relating to expected benefit utilization and plan preference criteria.	04-25-2013

Agnes Sandor, Meylan FR

Patent application number	Description	Published
20090265304	METHOD AND SYSTEM FOR RETRIEVING STATEMENTS OF INFORMATION SOURCES AND ASSOCIATING A FACTUALITY ASSESSMENT TO THE STATEMENTS - A system and method for providing a factuality assessment of a retrieved information source's statement are disclosed. The method includes receiving a user's query which identifies an information source whose statements are to be retrieved, retrieving documents which refer to the information source, mapping statements in the retrieved documents to their authors, identifying as information source statements, the mapped statements that are mapped to an author which is compatible with the information source, and for at least one of the information source's statements, assessing a factuality of the information source's statement according to the information source.	10-22-2009
20130346402	METHOD AND SYSTEM FOR IDENTIFYING UNEXPLORED RESEARCH AVENUES FROM PUBLICATIONS - A method, system and a computer program for identifying unexplored research avenues in a plurality of publications is provided. Citation maps for the plurality of publications are generated. The initial set of publications is filtered on the basis of the citation maps and resulting set of publications are ranked according to their prestige value. Natural language processing means are used to perform context matching in order to identify set of sentences in the publications. Paragraphs containing the set of sentences are displayed to a user along with pointers to the respective publication.	12-26-2013
20140163951	HYBRID ADAPTATION OF NAMED ENTITY RECOGNITION - A machine translation method includes receiving a source text string and identifying any named entities. The identified named entities may be processed to exclude common nouns and function words. Features are extracted from the source text string relating to the identified named entities. Based on the extracted features, a protocol is selected for translating the source text string. A first translation protocol includes forming a reduced source string from the source text string in which the named entity is replaced by a placeholder, translating the reduced source string by machine translation to generate a translated reduced target string, while processing the named entity separately to be incorporated into the translated reduced target string. A second translation protocol includes translating the source text string by machine translation, without replacing the named entity with the placeholder. The target text string produced by the selected protocol is output.	06-12-2014
20140365206	Method and system for idea spotting in idea-generating social media platforms - A computer-implemented system and method provide for identifying the core of an idea. The method includes receiving an idea submission which includes a textual description of an idea. The textual description of the idea is natural language processed to identify dependencies (syntactic and/or semantic relations between text elements) in at least a part of the textual description. Provision is made for identifying directive illocutionary acts in the textual description, based on the identified dependencies. The method further includes providing for identifying an idea core of the idea submission, based on an identified directive illocutionary act, where present, and outputting information based on the identified idea core.	12-11-2014
20140365207	Method and system for classifying reviewers' comments and recommending related actions in idea-generating social media platforms - A system and method for classifying comments are disclosed. The method includes receiving a collection of comments. Each of the comments in the collection includes text in a natural language and is associated with a previously-submitted idea submission which includes a description of an idea. The method further includes natural language processing each of the comments to identify dependencies (syntactic and/or semantic relations between text elements) in at least a part of the comment. Based on the identified dependencies, the comments are each automatically classified into one (or more) of a plurality of comment classes. The comment classes may include a first class for reaction to the content of the idea, a second class for expression of a commenter's judgment of an idea's value, and a third class for reaction to an idea generation process in which the associated idea submission is made. Information based on the assigned comment classes is output. For example, actions are proposed to use the comments according to their class.	12-11-2014

Agnes Taillardat, Seewen CH

Patent application number	Description	Published
20100022565	PHARMACEUTICAL COMPOSITIONS - Provided is a pharmaceutical composition comprising a calcilytic agent which, when administered orally to a subject induces a rapid and short-lasting absorption of the calcilytic agent and/or a rapid and short-lasting release of the parathyroid hormone.	01-28-2010
20100068265	GELATIN CAPSULES COMPRISING AN ACID - A pharmaceutical composition in the form of a gelatin capsule comprising a pharmaceutically acceptable acid.	03-18-2010
20110189286	Pulsatile Release of Valsartan - The present invention provides gastroretentive pulsatile pharmaceutical delivery systems that improve the bioavailability of Valsartan wherein the medicament has improved solubility, improved residence time in the gastrointestinal tract and a pulsatile release profile.	08-04-2011

Agnes Taillardat, Seewen So CH

Patent application number	Description	Published
20080213385	Formulations for 7- (T-Butoxy) Iminomethyl Camptothecin - The present invention relates to nanoparticulate compositions in which the active agent is a topoisomerase I inhibitor and pharmaceutical compositions comprising the nanoparticulate compositions that are useful for the treatment and prevention of proliferative diseases including cancer.	09-04-2008
20110028526	VALSARTAN SOLID ORAL DOSAGE FORMS AND METHODS OF MAKING SUCH FORMULATIONS - The invention relates to melt granulation processes for preparing immediate release and sustained release pharmaceutical formulations comprising valsartan.	02-03-2011

Agnes Taman-Chardonnens, Bovenkarspel NL

Patent application number	Description	Published
20100170003	Transgenic Plants with Increased Stress Tolerance and Yield - Polynucleotides are disclosed which are capable of enhancing a growth, yield under water-limited conditions, and/or increased tolerance to an environmental stress of a plant transformed to contain such polynucleotides. Also provided are methods of using such polynucleotides and transgenic plants and agricultural products, including seeds, containing such polynucleotides as transgenes.	07-01-2010

Agnes Tamin, Brindas FR

Patent application number	Description	Published
20080230739	Hydrofluorocarbon-Based Composition - The objective of the present invention is to provide a composition capable of being used as a refrigerant and which corresponds to the desire for a reduced environmental impact.	09-25-2008

Agnes Tempez, Massy FR

Patent application number	Description	Published
20090309015	NEUTRAL/ION REACTOR IN ADIABATIC SUPERSONIC GAS FLOW FOR ION MOBILITY TIME-OF-FLIGHT MASS SPECTROMETRY - The content of the invention comprises a concept of reactor for isolated ion transformations induced by collisions with neutral species. This reactor is also an interface between mobility cell and orthogonal injection TOFMS based on supersonic adiabatic gas flow with variable controlled composition directed along the axis of a multipole ion guide with sectioned rods for possibility of creating of controlled distributions of RF, DC and AC rotating fields.	12-17-2009
20110291567	DISCHARGE LAMP FOR GDS WITH AN AXIAL MAGNETIC FIELD - A glow discharge spectrometer discharge lamp includes: a lamp body having a vacuum enclosure connected to pump elements and to injector elements for injecting an inert gas into the enclosure; a hollow cylindrical first electrode of longitudinal axis X-X′; a second electrode for receiving a sample for analysis and for holding the sample facing one end of the cylindrical electrode; electric field generator including an applicator for applying to the terminals of the electrodes an electric field that is continuous, pulsed, radiofrequency, or hybrid, and suitable for generating a glow discharge plasma in the presence of the gas; coupler elements for coupling the discharge lamp to a spectrometer suitable for measuring at least one component of the plasma; and magnetic field generator elements for generating a magnetic field having field lines oriented along the axis X-X′, the magnetic field being uniform in orientation and in intensity over an area of the sample that is not less than the inside area of the hollow cylindrical electrode as projected along the direction X-X′.	12-01-2011
20130200257	METHOD AND DEVICE FOR MEASURING GLOW DISCHARGE SPECTROMETRY IN PULSED MODE - The present invention relates to a device for measuring glow discharge spectrometry in pulsed mode, which includes an RF electric field generator in pulsed mode, a discharge lamp, an impedance matching device for transferring the electric power supplied by the generator to the discharge lamp and a mass spectrometer suitable for measuring at least one signal representative of an ionised plasma species. According to the invention, the device includes a measurement system suitable for measuring a signal representative of the impedance mismatch ΔΩ between the generator and the discharge lamp, said measurement system including a fast acquisition system, synchronized with the pulses and suitable for supplying the impedance matching device with a signal representing the impedance mismatch ΔΩ for at least one part of said pulses. The device enables continuous impedance adaptation.	08-08-2013

Agnes Tempez, Houston, TX US

Patent application number	Description	Published
20090140140	MULTI-BEAM ION MOBILITY TIME-OF-FLIGHT MASS SPECTROMETRY WITH MULTI-CHANNEL DATA RECORDING - The content of the invention comprises a concept of multi-beam ion pre-selection from a single sample, coordinated mobility (against the gas flow) separation, cooling ions in supersonic gas flow and mass separation of thus low divergent ions by single or plural compact high-resolution orthogonal time-of-flight mass spectrometers both linear or reflectron type with controlled collision-induced dissociation (CID) and multi-channel data recording for the optimization of sample use in the analysis, and obtaining as much useful information about the sample as possible in a reasonably short time.	06-04-2009
20100090101	GOLD IMPLANTATION/DEPOSITION OF BIOLOGICAL SAMPLES FOR LASER DESORPTION TWO AND THREE DIMENSIONAL DEPTH PROFILING OF BIOLOGICAL TISSUES - The present invention enhances the laser desorption of biological molecular ions from surfaces by creating a surface localized MALDI particle matrix by ion implantation of low energy ionized clusters (gold, aluminum, etc.) or chemically derivatized clusters into the near surface region of the sample. MALDI analysis of the intact biomolecules on the surface or within a narrow subsurface region defined by the implantation range of the ions can then be performed by laser desorption into a mass spectrometer or, in a preferred embodiment, into a combined ion mobility orthogonal time of flight mass spectrometer.	04-15-2010

Agnes Themens, Bourg La Reine FR

Patent application number	Description	Published
20090068238	Cosmetic composition containing elastomers - The present invention relates to a solid anhydrous cosmetic composition comprising at least one non-spherical silicone elastomer and at least one silicone elastomer powder coated with a silicone resin. The invention also relates to a makeup process comprising the application to keratin materials of the said composition, and also to its use for obtaining a uniform makeup result that shows good fastness of the color over time.	03-12-2009
20120321578	SOLID WATER-IN-OIL EMULSION COMPRISING A VOLATILE HYDROCARBON SOLVENT, A POLYGLYCEROLATED SURFACTANT AND A POLAR WAX - The invention relates to a solid water-in-oil emulsion comprising an aqueous phase emulsified in a fatty phase, comprising: one or more volatile linear alkane(s), especially C7-C14 alkane(s), a non-silicone polyglycerolated surfactant and a polar wax, especially a natural or natural-origin polar wax.	12-20-2012

Agnes Thomas-Collignon, Montigny Le Bretonneux FR

Patent application number	Description	Published
20130324477	PEPTIDES THAT MODULATE COMPLEX SASPASE-FLG2 - The invention relates to a peptide isolated from SASpase or FLG2, a fragment or homologue thereof, which can modify the three-dimensional shape of a complex formed by interaction between a first amino acide sequence from Filaggrin-2 and a second amino acid sequence from SASPase.	12-05-2013
20140005207	SASPASE-FLG2 COMPLEX, MODULATING AGENTS, AND USES	01-02-2014
20150148356	COMPOUNDS FOR DRY SKIN AND ANTI-AGEING APPLICATION - The present invention relates to the cosmetic use, as agent for preventing and/or treating an aesthetic defect in the skin and/or its appendages that is associated with an imbalance in the differentiation and/or proliferation of the cells of an epidermis, of an effective amount of at least one compound represented by one of the general formulae, (Ia) or (Ib)	05-28-2015
20150152101	ACTIVE COMPOUNDS FOR COMBATING GREASY SKIN - The present invention relates to the cosmetic use, as an agent for preventing and/or treating greasy skin or greasy-prone skin and/or an associated aesthetic skin disorder, of an effective amount of at least one compound represented by either of the general formulae (Ia) and (Ib).	06-04-2015

Agnes Vercillo, Cicero, NY US

Patent application number	Description	Published
20080215363	Tissue management system - The present invention provides a comprehensive tissue management system for transplantable materials like tissues and organs. The tracking portion of the system prompts and verifies that staff members of a medical establishment like a hospital have handled, stored, transported, reconstituted, and used the tissue or organ materials in a safe and regulatory-compliant manner from the point of receipt to the point of issuance or surgical use throughout the hospital's organization. The tracing portion of the system creates an integral record that documents which hospital staff members have provided which processing steps to the tissue or organ, any associated materials used in conjunction with such tissue or organ, and an identification of the tissue or organ that was transplanted or implanted inside a patient. Such a system will enable adverse reaction investigations for transplant patients, and recalls of transplantable materials.	09-04-2008
20140297325	TISSUE MANAGEMENT SYSTEM - The present invention provides a comprehensive tissue management system for transplantable materials like tissues and organs. The tracking portion of the system prompts and verifies that staff members of a medical establishment like a hospital have handled, stored, transported, reconstituted, and used the tissue or organ materials in a safe and regulatory-compliant manner from the point of receipt to the point of issuance or surgical use throughout the hospital's organization. The tracing portion of the system creates an integral record that documents which hospital staff members have provided which processing steps to the tissue or organ, any associated materials used in conjunction with such tissue or organ, and an identification of the tissue or organ that was transplanted or implanted inside a patient. Such a system will enable adverse reaction investigations for transplant patients, and recalls of transplantable materials.	10-02-2014

Agnes Vermuelen, Cheminas FR

Patent application number	Description	Published
20110214201	Method for Producing Haploid, Doubled Haploid and/or Dihaploid Plants by Gynogenesis - The invention relates to a method for producing haploid H, doubled haploid HD and/or dihaploid DH plants, the HD and DH being homozygous or essentially homozygous, this method being a method such as those which come under the technique of gynogenesis induced by irradiated pollen. This method comprises a step of irradiating the reproductive material of the male parent at a dose of between 160 and 190 gamma ray and/or a step of selecting the haploid H and/or DH plants by using one or more molecular marker(s). The invention also relates to a method for producing homozygous haploid, doubled haploid and/or dihaploid plants, comprising a step of determining the appropriate irradiation dose(s) for increasing the yields of said plants according to multiple given factors such as the plant species, the genotypes of the male parent and of the female parent, the climatic and weather conditions, the time at which the fruits are harvested, the level of growth of the embryos collected with a view to the culturing thereof, the level of development of the embryos placed in culture. Moreover, the invention concerns the molecular marker(s) used in the selection step and also the haploid embryos and the dihaploid embryos obtained by means of the method of the invention, and the progeny and the seeds of the plants obtained by means of the method of the invention.	09-01-2011

Agnes Vignery, Branford, CT US

Patent application number	Description	Published
20080213333	Methods and compositions for fostering and preserving bone growth - A method for augmenting bone in a subject in need thereof including installing within an interior portion of a bone located in the subject a sufficient amount of a biocompatible material to form a scaffold within the bone interior, wherein the scaffold serves as a support for the formation of new bone within the bone interior portion, and administering to the subject a sufficient amount of at least one bone augmentation agent to elevate blood concentration of at least one anabolic agent in the subject. The method may further include administering at least one anti-resorptive agent to the subject in an amount sufficient to substantially prevent resorption of new bone growth. In another embodiment, the method may further include a step of mechanically inducing an increase in osteoblast activity in the subject, wherein the elevation in blood concentration of the anabolic agent and the increase in osteoblast activity at least partially overlap in time.	09-04-2008
20100104582	CD200 and its receptor, CD200R, modulate bone mass via the differentiation of osteoclasts - Disclosed are methods and compositions relating to CD200 and its receptor, CD200R which modulate bone mass via the differentiation of osteoclasts.	04-29-2010

Agnes Von Garnier, Oberursel DE

Patent application number	Description	Published
20140083010	PROCESS AND PLANT FOR THE PRODUCTION AND FURTHER TREATMENT OF FUEL GAS - A process for producing fuel gas and for carrying out a metallurgical process includes providing first and second process stages. In the first process stage, biomass is reacted with an oxygen-containing gas so as to obtain a fuel gas containing at least one of carbon monoxide, hydrogen, carbon dioxide and steam. The fuel gas is cooled to a temperature in a range from 300 to 600° C. The cooled fuel gas is subjected to a solids separation. In the second process stage, the fuel gas after the solids separation is directly supplied to at least one burner of the metallurgical process, the temperature of the fuel gas being maintained above the condensation temperature of tar and within the range from 300 to 600° C. by supplying heat.	03-27-2014

Agnes Waliczek, Braunschweig DE

Patent application number	Description	Published
20120231972	Probe Compound for Detecting and Isolating Enzymes and Means and Methods Using the Same - The present invention relates to a probe compound that can comprise any substrate or metabolite of an enzymatic reaction in addition to an indicator component, such as, for example, a fluorescence dye, or the like. Moreover, the present invention relates to means for detecting enzymes in form of an array, which comprises any number of probe compounds of the invention which each comprise a different metabolite of interconnected metabolites representing the central pathways in all forms of life. Moreover, the present invention relates to a method for detecting enzymes involving the application of cell extracts or the like to the array of the invention which leads to reproducible enzymatic reactions with the substrates. These specific enzymatic reactions trigger the indicator (e.g. a fluorescence signal) and bind the enzymes to the respective cognate substrates. Moreover, the invention relates to means for isolating enzymes in form of nanoparticles coated with the probe compound of the invention. The immobilisation of the cognate substrates or metabolites on the surface of nanoparticles by means of the probe compounds allows capturing and isolating the respective enzyme, e.g. for subsequent sequencing.	09-13-2012

Agnes Zoldowski, Aurora CA

Patent application number	Description	Published
20090148849	ONE-STEP TARGET DETECTION ASSAY - The present invention provides nucleic acid amplification, detection, and genotyping techniques. In one embodiment, the present invention provides a method for amplifying and detecting a target nucleic acid sequence by providing a first primer pair comprising: a first primer comprising a target specific sequence, a tag sequence 5′ of the target specific sequence, and a blocker between the target specific sequence and the tag sequence, and a second primer comprising a target specific sequence; providing a reporter attached to either the second primer or to a dNTP; providing a capture complex comprising an anti-tag sequence attached to a solid support; combining the first primer pair, the capture complex, the reporter, and a sample comprising a target nucleic acid sequence under conditions suitable for amplification of the target nucleic acid sequence and hybridization of the amplified target nucleic acid sequence to the capture complex; and detecting the amplified target nucleic acid sequence.	06-11-2009

Agnes Zvara, Szeged HU

Patent application number	Description	Published
20080274455	Use Of Genes As Molecular Markers In Diagnosis Of Schizophrenia And Diagnostic Kit For The Same - Drug-naive and drug-free schizophrenic PBL were screened to identify additional markers that are differentially expressed compared to healthy individuals using microarray and quantitative real-time PCR (QRT-PCR) techniques. Genes for dopamine D	11-06-2008

Ágnes Ágoston, Szekesfehervar HU

Patent application number	Description	Published
20130035481	PRODUCTION OF 6'-O-SIALYLLACTOSE AND INTERMEDIATES - The present invention relates to a method for preparation of the trisaccharide 6′-0-sialyllactose (formula (I)) or salts thereof as well as intermediates in the synthesis and for the use of 6′-0-sialyllactose salts in pharmaceutical or nutritional compositions.	02-07-2013

Ágnes Ágoston, Telki HU

Patent application number	Description	Published
20120309949	METHOD FOR PREPARATION OF THE TETRASACCHARIDE LACTO-N-NEOTETRAOSE (LNNT) CONTAINING N-ACETYLLACTOSAMINE - The present invention relates to a method for preparation of the tetrasaccharide lacto-N-neotetraose (LNnt, formula (I)) especially in large scale, as well as intermediates in the synthesis, a new crystal form (polymorph) of LNnt, and the use thereof in pharmaceutical or nutritional compositions.	12-06-2012
20130165406	POLYMORPHS OF 2'-O-FUCOSYLLACTOSE AND PRODUCING THEREOF - The present invention relates to novel polymorphs of the trisaccharide 2′-O-fucosyllactose (2-FL) of formula (1), methods for producing said polymorphs and their use in pharmaceutical or nutritional compositions.	06-27-2013
20130171696	SYNTHESIS OF NEW SIALOOLIGOSACCHARIDE DERIVATIVES - The invention relates to a method for the synthesis of compounds of general formula (1A) and salts thereof wherein one of the R groups is an α-sialyl moiety and the other is H, X	07-04-2013
20130172548	DERIVATIZATION OF OLIGOSACCHARIDES - A method for purifying, separating and/or isolating an oligosaccharide or a salt thereof is presented. An embodiment of the invention is based upon the formation of anomeric O-benzyl/substituted O-benzyl derivatives in a selective anomeric alkylation reaction.	07-04-2013

Ágnes Ágoston, Szekesfehervar HU

Patent application number	Description	Published
20130035481	PRODUCTION OF 6'-O-SIALYLLACTOSE AND INTERMEDIATES - The present invention relates to a method for preparation of the trisaccharide 6′-0-sialyllactose (formula (I)) or salts thereof as well as intermediates in the synthesis and for the use of 6′-0-sialyllactose salts in pharmaceutical or nutritional compositions.	02-07-2013

Ágnes Jánosi, Budapest HU

Patent application number	Description	Published
20130072675	METHOD FOR CYRSTALLIZATION OF FUCOSE - The present application discloses a method for the crystallization of fucose, characterized in that the crystallization is carried out from a mixture comprising fucose and at least one 6-deoxy sugar selected from 6-deoxy-talose and 6-deoxy-gulose. In one embodiment, the mixture comprises fucose and 6-deoxy-talose.	03-21-2013

Ágnes Proszenyák, Molnari HU

Patent application number	Description	Published
20150175623	THIENOPYRIMIDINE DERIVATIVES, A PROCESS FOR THEIR PREPARATION AND PHARMACEUTICAL COMPOSITIONS CONTAINING THEM - Compounds of formula (I):	06-25-2015

Ágnes Sándor, Meylan FR

Patent application number	Description	Published
20110271173	Method and apparatus for automatic filling of forms with data - A system and a method for filling a form are provided which take as input a user's data file, which is configured for use in filling in forms, and an image of an original form to be filled in using the user's personal data. Form filling rules encoded in the image are decoded and used to determine values of a plurality of fields of the form by applying the decoded rules to the user's data. The plurality of fields of the form are filled with the determined values to generate an at least partially filled form, which is then output, e.g., to a printer or a display. The exemplary system and method are able to operate independently of the language used in the text of the form, have the capability of filling in previously unseen forms, and are particularly suited to filling in paper forms.	11-03-2011

Ágnes Telbisz, Budapest HU

Patent application number	Description	Published
20100021927	CHOLESTEROL LOADED INSECT CELL MEMBRANES AS TEST SYSTEMS FOR ABC TRANSPORTER PROTEINS - The invention provides for a novel cholesterol loaded insect cell membrane preparation having an increased cholesterol level as compared to physiological cholesterol levels of insect cell membranes or to control insect cell membrane preparations without cholesterol loading, wherein said cholesterol loaded membrane preparation comprises an ABC transporter protein having an increased substrate transport activity due to increased cholesterol level of the membrane. The invention also relates to reagent kits comprising the preparations of the invention. The invention also relates to methods for manufacturing said preparations and methods for measuring any type of activity of the ABC transporters present in the cholesterol loaded membranes as well as studying or testing compounds and interaction of compounds and ABC transporters, in this assay systems. The invention also provides for a test system useful for testing whether ABC transporter proteins can be activated by cholesterol in an insect cell membrane.	01-28-2010

Ágnes Telbisz, Budapest HU

Patent application number	Description	Published
20100021927	CHOLESTEROL LOADED INSECT CELL MEMBRANES AS TEST SYSTEMS FOR ABC TRANSPORTER PROTEINS - The invention provides for a novel cholesterol loaded insect cell membrane preparation having an increased cholesterol level as compared to physiological cholesterol levels of insect cell membranes or to control insect cell membrane preparations without cholesterol loading, wherein said cholesterol loaded membrane preparation comprises an ABC transporter protein having an increased substrate transport activity due to increased cholesterol level of the membrane. The invention also relates to reagent kits comprising the preparations of the invention. The invention also relates to methods for manufacturing said preparations and methods for measuring any type of activity of the ABC transporters present in the cholesterol loaded membranes as well as studying or testing compounds and interaction of compounds and ABC transporters, in this assay systems. The invention also provides for a test system useful for testing whether ABC transporter proteins can be activated by cholesterol in an insect cell membrane.	01-28-2010

Agnés Bombrun, Chambesy CH

Patent application number	Description	Published
20110293564	2-MORPHOLINO-PYRIDO[3,2-D]PYRIMIDINES - This invention relates to compounds of Formula (I) as Pi3k inhibitors for treating autoimmune diseases, inflammatory disorders, multiple sclerosis and other deseases like cancers.	12-01-2011
20120022109	OXADIAZOLE DERIVATIVES - The invention relates to oxadiazole compounds of formula I. The compounds are useful e.g. in the treatment of autoimmune disorders, such as multiple sclerosis.	01-26-2012
20120035226	OXADIAZOLE DERIVATIVES - The invention relates to oxadiazole compounds of formula I. The compounds are useful e.g. in the treatment of autoimmune disorders, such as multiple sclerosis.	02-09-2012
20120115869	TETRAZOLE DERIVATIVES - The present invention relates to compounds of formula (I) for use as pharmaceutical active compounds, as well as pharmaceutical formulations containing the same, for the treatment of allergic diseases.	05-10-2012

Agnés Degeorges, Clermont-Ferrand FR

Patent application number	Description	Published
20130292027	TIRE, THE CARCASS REINFORCEMENT OF WHICH IS REINFORCED WITH A LAYER OF REINFORCING ELEMENTS IN THE BEAD REGION - The invention relates to a tire having a radial carcass reinforcement, consisting of at least one layer of reinforcing elements anchored in each of the beads by an upturn around a bead wire, said carcass reinforcement upturn being reinforced by at least one layer of reinforcing elements or stiffener, the radially outer end of which is radially on the outside of the end of the upturn. According to the invention, the reinforcing elements of at least one stiffener are non-wrapped metal cords with saturated layers, having, in what is called the permeability test, a flow rate of less than 5 cm	11-07-2013

Agnés Degeorges, Clermont-Ferrand Cedex 9 FR

Patent application number	Description	Published
20130292028	TIRE, THE CARCASS REINFORCEMENT OF WHICH IS REINFORCED WITH A LAYER OF REINFORCING ELEMENTS IN THE BEAD REGION - The invention relates to a tire having a radial carcass reinforcement, consisting of at least one layer of reinforcing elements anchored in each of the beads by an upturn around a bead wire, said carcass reinforcement upturn being reinforced by at least one layer of reinforcing elements or stiffener. According to the invention, the reinforcing elements of at least one stiffener are non-wrapped metal cords with saturated layers, having, in what is called the permeability test, a flow rate of less than 5 cm	11-07-2013
20130340913	TIRE, THE CARCASS REINFORCEMENT OF WHICH IS REINFORCED WITH A LAYER OF REINFORCING ELEMENTS IN THE BEAD REGION - The invention relates to a tire having a radial carcass reinforcement, consisting of at least one layer of reinforcing elements anchored in each of the beads by an upturn around a bead wire, said carcass reinforcement upturn being reinforced by at least one layer of reinforcing elements or stiffener, the radially outer end of which is radially on the outside of the end of the upturn.	12-26-2013
20140008003	TIRE, THE CARCASS REINFORCEMENT OF WHICH IS REINFORCED WITH A LAYER OF REINFORCING ELEMENTS IN THE BEAD REGION - The invention relates to a tire having a radial carcass reinforcement, consisting of at least one layer of reinforcing elements anchored in each of the beads by an upturn around a bead wire, said carcass reinforcement upturn being reinforced by at least one layer of reinforcing elements or stiffener, the radially outer end of which is radially on the outside of the end of the upturn.	01-09-2014

Agnés Desfarges-Berthellemot, Couzeix FR

Patent application number	Description	Published
20130342896	METHOD AND LASER OSCILLATOR FOR THE GENERATION OF A LASER BEAM - Method and laser oscillator for the generation of a laser beam—According to the invention with a view to adjusting, inside said laser oscillator (	12-26-2013

Agnés Doreau-Bastid, Craponne FR

Patent application number	Description	Published
20110293629	Methods of Treating and/or Preventing Cell Proliferation Disorders with IL-17 Antagonists - The invention relates generally to methods of treating and/or preventing proliferative diseases, such as cancers, using antagonists of IL-17. The invention also relates to methods and kits for identifying subjects who are likely to respond to treatment and/or prevention of proliferative diseases with antagonists of IL-17.	12-01-2011

Agnés Ladous, Charenton Le Pont FR

Patent application number	Description	Published
20120281183	Method for Determining Binocular Performance of a Pair of Spectacle Lenses - A method of determining binocular performance of a pair of spectacle lenses comprises: a eyes characteristics providing step, a pair of spectacle lenses providing step, a environment providing step, a cyclopean eye positioning step, a binocular performance criteria defining step, and a binocular performance criteria determining step, wherein the cyclopean eye position is customized.	11-08-2012
20120287405	Method for Determining Binocular Performance of a Pair of Spectacle Lenses - A method of determining binocular performance of a pair of spectacle lenses comprises: a eyes characteristics providing step, a pair of spectacle lenses providing step, a environment providing step, a binocular performance criteria selecting step, and a binocular performance criteria determining step, wherein the at least one binocular performance criterion is selected among one or a combination of the following criteria groups consisting of central vision criteria group and/or peripheral vision criteria group.	11-15-2012

Agnès Arbat Bugié, Barcelona ES

Patent application number	Description	Published
20150359820	USE OF TUNGSTEN (VI) SALTS FOR THE TREATMENT OF FEMALE INFERTILITY IN NON-DIABETIC MAMMALS - The present invention comprises the use of a therapeutically effective amount of a tungsten (VI) salt with a pharmaceutically or veterinarily acceptable cationic group, or a solvate of said salt, for the preparation of a medicinal product for the treatment of female infertility in non-diabetic mammals.	12-17-2015

Agnès Aymonier, Begles FR

Patent application number	Description	Published
20150322305	AUTO-ADHESIVE ELASTOMER COMPOSITION - A crosslinkable elastomer composition includes a mixture (a) of an elastomer composition based on an ethylene-propylene-diene terpolymer elastomer and (b) between 2 and 14 wt. %, in relation to the total weight of the composition, of an amphiphilic statistical or block copolymer of a saturated or unsaturated hydrocarbonated C	11-12-2015

Agnès Bénardeau, Saint Louis FR

Patent application number	Description	Published
20090143409	3-PYRIDINECARBOXAMIDE DERIVATIVES AS HDL-CHOLESTEROL RAISING AGENTS - The present invention relates to a method of raising HDL cholesterol comprising administering to a patient in need thereof a compound of the formula	06-04-2009
20100267745	3-Pyridinecarboxamide Derivatives as HDL-Cholesterol Raising Agents - The present invention relates to a method of raising HDL cholesterol comprising administering to a patient in need thereof a compound of the formula	10-21-2010
20110020300	COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF GLUCOCORTICOID RECEPTOR (GCR) GENES - This invention relates to a double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of a GCR gene. The invention also relates to a pharmaceutical composition comprising the dsRNA or nucleic acid molecules or vectors encoding the same together with a pharmaceutically acceptable carrier; methods for treating diseases caused by the expression of a GCR gene using said pharmaceutical composition; and methods for inhibiting the expression of GCR in a cell.	01-27-2011
20110065695	USE OF AMINODIHYDROTHIAZINES FOR THE TREATMENT OR PREVENTION OF DIABETES - This invention relates to compounds of formula I,	03-17-2011
20130096107	USE OF AMINODIHYDROTHIAZINES FOR THE TREATMENT OR PREVENTION OF DIABETES - This invention relates to compounds of formula I,	04-18-2013
20140221360	USE OF AMINODIHYDROTHIAZINES FOR THE TREATMENT OR PREVENTION OF DIABETES - This invention relates to compounds of formula I,	08-07-2014

Agnès Bénardeau, Saint Louis FR

Patent application number	Description	Published
20100267745	3-Pyridinecarboxamide Derivatives as HDL-Cholesterol Raising Agents - The present invention relates to a method of raising HDL cholesterol comprising administering to a patient in need thereof a compound of the formula	10-21-2010
20110020300	COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF GLUCOCORTICOID RECEPTOR (GCR) GENES - This invention relates to a double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of a GCR gene. The invention also relates to a pharmaceutical composition comprising the dsRNA or nucleic acid molecules or vectors encoding the same together with a pharmaceutically acceptable carrier; methods for treating diseases caused by the expression of a GCR gene using said pharmaceutical composition; and methods for inhibiting the expression of GCR in a cell.	01-27-2011
20110065695	USE OF AMINODIHYDROTHIAZINES FOR THE TREATMENT OR PREVENTION OF DIABETES - This invention relates to compounds of formula I,	03-17-2011

Agnès Cibiel, Avon FR

Patent application number	Description	Published
20130266515	Specific Ligand for Annexin 2 - The present invention relates to an aptamer which includes a nucleic acid including or made up of: the sequence GGAACGCAAGAACUGAGGCCAUGAGGCGCCUUCCCUUGCUCA GGACGC (SEQ ID NO: 1), or the sequence AGCUAGGCCGCAAGGUGCCUCAACGCCAUCUGAGUGCCGACC CGAUCGC (SEQ ID NO: 2), or a sequence including or made up of at least 25 consecutive nucleotides of a sequence that is at least 80% identical to SEQ ID NO: 1 or to SEQ ID NO: 2, with the condition that a nucleic acid made up of said sequence is bonded to annexin 2.	10-10-2013
20140329289	ANTI-FH APTAMERS, METHOD FOR PRODUCING SAME, AND USES THEREOF - The invention relates to nucleic acid aptamers binding specifically to factor H, to a method for obtaining same, and to the uses thereof, in particular for the purposes of purifying factor H.	11-06-2014

Agnès Cibiel, Avon FR

Patent application number	Description	Published
20130266515	Specific Ligand for Annexin 2 - The present invention relates to an aptamer which includes a nucleic acid including or made up of: the sequence GGAACGCAAGAACUGAGGCCAUGAGGCGCCUUCCCUUGCUCA GGACGC (SEQ ID NO: 1), or the sequence AGCUAGGCCGCAAGGUGCCUCAACGCCAUCUGAGUGCCGACC CGAUCGC (SEQ ID NO: 2), or a sequence including or made up of at least 25 consecutive nucleotides of a sequence that is at least 80% identical to SEQ ID NO: 1 or to SEQ ID NO: 2, with the condition that a nucleic acid made up of said sequence is bonded to annexin 2.	10-10-2013

Agnès Degeorges, Clermont-Ferrand Cedex 9 FR

Patent application number	Description	Published
20130292028	TIRE, THE CARCASS REINFORCEMENT OF WHICH IS REINFORCED WITH A LAYER OF REINFORCING ELEMENTS IN THE BEAD REGION - The invention relates to a tire having a radial carcass reinforcement, consisting of at least one layer of reinforcing elements anchored in each of the beads by an upturn around a bead wire, said carcass reinforcement upturn being reinforced by at least one layer of reinforcing elements or stiffener. According to the invention, the reinforcing elements of at least one stiffener are non-wrapped metal cords with saturated layers, having, in what is called the permeability test, a flow rate of less than 5 cm	11-07-2013

Agnès Desfarges-Berthelemot, Couzeix FR

Patent application number	Description	Published
20130188244	METHOD AND DEVICE FOR AMPLIFYING AN OPTICAL SIGNAL - According to the invention, the optical signal (SE) is spatially divided into N elementary optical signals (SE.	07-25-2013

Agnès Doreau-Bastid, Crappone FR

Patent application number	Description	Published
20140023650	Methods of Treating and/or Preventing Cell Proliferation Disorders with IL-17 Antagonists - The invention relates generally to methods of treating and/or preventing proliferative diseases, such as cancers, using antagonists of IL-17. The invention also relates to methods and kits for identifying subjects who are likely to respond to treatment and/or prevention of proliferative diseases with antagonists of IL-17.	01-23-2014

Agnès Dupont Filliard, Les Adrets FR

Patent application number	Description	Published
20120171662	Simplified Device for Nucleic Acid Amplification and Method for Using Same - The present invention relates to a disposable device (	07-05-2012

Agnès Dupont-Filliard, Les Adrets FR

Patent application number	Description	Published
20150087003	METHOD FOR OBTAINING PEPTIDES - The present invention relates to a method of obtaining peptides from procaryotic and/or eucaryotic cells.	03-26-2015

Agnès Durin-France, Montelimar FR

Patent application number	Description	Published
20150017292	PACKAGING SHEET, PACKAGING AND USE OF SUCH A PACKAGING SHEET - The packaging sheet (	01-15-2015
20150050414	PACKAGING SHEET, PACKAGING AND ASSOCIATED MANUFACTURING METHOD - Packaging sheet (	02-19-2015

Agnès Ferroni, Clamart FR

Patent application number	Description	Published
20100116980	Means for identifying a strain isolated from a clinical sample at the species and/or subspecies level - The invention relates to a method for identifying a strain isolated from a clinical sample, at the species and/or subspecies level, using MALDI-TOF-MS analysis comprising a step of classifying the germ in a group before performing the MALDI-TOF-MS analysis	05-13-2010

Agnès Ferroni, Clamart FR

Patent application number	Description	Published
20100116980	Means for identifying a strain isolated from a clinical sample at the species and/or subspecies level - The invention relates to a method for identifying a strain isolated from a clinical sample, at the species and/or subspecies level, using MALDI-TOF-MS analysis comprising a step of classifying the germ in a group before performing the MALDI-TOF-MS analysis	05-13-2010
20110318776	Method for identifying germs in a liquid medium - This invention relates to a method for identifying germs in a liquid medium, comprising adding a membrane detergent to the liquid medium containing components of a host infected with germs, i.e. cellular components and proteins from the extracellular environment, so as to release the germs from these components without degrading them, and in that the germs that have grown in the liquid medium are analysed by MALDI-TOF MS.	12-29-2011

Agnès Gouble, Paris FR

Patent application number	Description	Published
20120159659	CUSTOM-MADE MEGANUCLEASE AND USE THEREOF - New rare-cutting endonucleases, also called custom-made meganucleases, which recognize and cleave a specific nucleotide sequence, derived polynucleotide sequences, recombinant vector cell, animal, or plant comprising said polynucleotide sequences, process for producing said rare-cutting endonucleases and any use thereof, more particularly, for genetic engineering, antiviral therapy and gene therapy.	06-21-2012
20130059387	MEGANUCLEASE VARIANTS CLEAVING A DNA TARGET SEQUENCE FROM THE HPRT GENE AND USES THEREOF - A method for inducing a site-specific modification in the HPRT gene, for a non-therapeutic purpose, by contacting a DNA target sequence selected from the group consisting of the sequences SEQ ID NO: 1 to 14 thereby cleaving the DNA target with an I-CreI variant or single-chain derivative having at least one substitution in one of the two functional subdomains of the LAGLIDADG (SEQ ID NO: 153) core domain situated from positions 26 to 40 and 44 to 77 of I-CreI.	03-07-2013
20130315884	METHODS FOR ENGINEERING ALLOGENEIC AND IMMUNOSUPPRESSIVE RESISTANT T CELL FOR IMMUNOTHERAPY - Methods for developing engineered T-cells for immunotherapy that are both non-alloreactive and resistant to immunosuppressive drugs. The present invention relates to methods for modifying T-cells by inactivating both genes encoding target for an immunosuppressive agent and T-cell receptor, in particular genes encoding CD52 and TCR. This method involves the use of specific rare cutting endonucleases, in particular TALE-nucleases (TAL effector endonuclease) and polynucleotides encoding such polypeptides, to precisely target a selection of key genes in T-cells, which are available from donors or from culture of primary cells. The invention opens the way to standard and affordable adoptive immunotherapy strategies for treating cancer and viral infections.	11-28-2013

Agnès Jallouli, St. Petersburg, FL US

Patent application number	Description	Published
20120070654	Method For Improving The Edging Of An Optical Article By Providing A Temporary Layer Of An Organic Matter - Methods for edging optical articles comprising two main faces, at least one of which being coated with an outermost layer comprising fixing the optical article to a chuck with a holding pad that adheres to both the optical article and the chuck, wherein the surface of the holding pad contacting the optical comprises an adhesive material; and edging the optical article with an edging device; wherein prior to fixing the optical article to the chuck, at least one temporary layer of an organic material is formed onto said outermost layer of the optical article, the organic material of the temporary layer comprising at least one organic compound having a fluorinated functional moiety and at least one linking functional moiety capable of establishing at least one intermolecular bond or interaction with the adhesive material of the holding pad. Optical articles obtained via these methods.	03-22-2012

Agnès Kammoun, Reze FR

Patent application number	Description	Published
20120322098	CULTURE MEDIUM FOR SCREENING OR ENRICHMENT OF METHICILLIN-RESISTANT S. AUREUS - The invention relates to culture medium for screening or enrichment of methicillin-resistant	12-20-2012

Agnès Kammoun, Reze FR

Patent application number	Description	Published
20120322098	CULTURE MEDIUM FOR SCREENING OR ENRICHMENT OF METHICILLIN-RESISTANT S. AUREUS - The invention relates to culture medium for screening or enrichment of methicillin-resistant	12-20-2012

Agnès Pailloux, Gif Sur Yvette FR

Patent application number	Description	Published
20120036920	DEVICE FOR DETECTING MICRO-LEAKS - Micro-leaks are detected by means of a sniffer device including, in an original manner, a flat suction capsule (	02-16-2012