47th week of 2013 patent applcation highlights part 51 |
Patent application number | Title | Published |
20130310435 | Pharmaceutical Composition Comprising (1r,4r)-6'-fluoro-N, N-dimethyl-4-phenyl-4,9' -dihydro-3'H-spiro[cyclohexane-1,1' -pyrano[3,4,b]indol]-4-amine and Paracetamol or Propacetamol - The invention relates to a pharmaceutical composition comprising a first pharmacologically active ingredient selected from (1r,4r)-6′-fluoro-N,N-dimethyl-4-phenyl-4′,9′-dihydro-3′H-spiro[cyclohexane-1,1′-pyrano[3,4,b]indol]-4-amine and the physiologically acceptable salts thereof, and a second pharmacologically active ingredient selected from paracetamol and propacetamol. | 2013-11-21 |
20130310436 | METHODS FOR PREDICTING RESPONSE TO BETA-BLOCKER THERAPY IN NON-ISCHEMIC HEART FAILURE PATIENTS - The present invention provides methods and apparatuses for predicting mortality and determining the likelihood of success of β-blocker therapy in a patient who has suffered non-ischemic heart failure as well as providing probability of short-term and/or long term survival rate of a non-ischemic heart failure patient. In addition, the present invention provides a method for determining a treatment procedure for a non-ischemic heart failure patient. | 2013-11-21 |
20130310437 | COMBINATION FOR THE TREATMENT OF OSTEOARTHRITIS - The present invention relates to the use of a combination of glycine, proline, and optionally a natural or synthetic viscosity-controlling polymer, and/or lysine and/or leucine, to prepare a composition for the treatment of osteoarthritis. | 2013-11-21 |
20130310438 | BICYCLIC COMPOUND AND USE THEREOF FOR MEDICAL PURPOSES - Provided is a compound which has strong intraocular pressure lowering action and has no side effect on eyes such as ocular stimulating property, humor protein rise etc. | 2013-11-21 |
20130310439 | METHOD OF REDUCING PROTEINS MISFOLDING AND/OR AGGREGATION - The present invention is directed to methods of reducing protein misfolding and/or aggregation in a subject and to method of treating a condition mediated by a dysfunction in protein homeostasis comprising modulating cholinergic signaling activity. | 2013-11-21 |
20130310440 | METHOD FOR TREATING NON-SMALL CELL LUNG CANCER - The present invention provides methods for treating a human patient afflicted with unresectable, advanced or metastatic non-small cell lung cancer comprising periodically administering to the human patient chemotherapy comprising an amount of docetaxel; and 640 mg of an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2′-O-methoxyethyl modifications, has nucleotides 5-17 which are 2′deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19, thereby treating the human patient afflicted with unresectable, advanced or metastatic non-small cell lung cancer. The present invention also provides compositions and combinations, packages, and uses thereof for treating a human patient afflicted with unresectable, advanced or metastatic non-small cell lung cancer. | 2013-11-21 |
20130310441 | ANTISENSE OLIGONUCLEOTIDES AGAINST AchE IN THE TREATMENT OF GASTROINTESTINAL INFLAMMATION DISORDERS - AChE antisense oligonucleotides are used as antiinflammatory agents, such oligonucleotides preferably having the sequence of SEQ ID NO:1 and SEQ ID NO:7. Methods of treatment of inflammatory conditions, as well as fever, and particularly inflammation of the gastrointestinal tract, are described. | 2013-11-21 |
20130310442 | SDF-1 Binding Nucleic Acids and the use Thereof in Cancer Treatment - The present invention is related to a nucleic acid molecule capable of binding to SDF-1, preferably capable of inhibiting SDF-1, whereby the nucleic acid molecule is for use in a method for the treatment and/or prevention of a disease or disorder, for use in a method for the treatment of a subject suffering from a disease or disorder or being at risk of developing a disease or disorder as an adjunct therapy, or for use as a medicament for the treatment and/or prevention of a disease or disorder, whereby the disease or disorder is cancer. | 2013-11-21 |
20130310443 | AAV VECTORS WITH HIGH TRANSDUCTION EFFICIENCY AND USES THEREOF FOR GENE THERAPY - The present invention provides AAV capsid proteins comprising modification of one or a combination of the surface-exposed lysine, serine, threonine and/or tyrosine residues in the VP3 region. Also provided are rAAV virions comprising the AAV capsid proteins of the present invention, as well as nucleic acid molecules and rAAV vectors encoding the AAV capsid proteins of the present invention. Advantageously, the rAAV vectors and virions of the present invention have improved efficiency in transduction of a variety of cells, tissues and organs of interest, when compared to wild-type rAAV vectors and virions. | 2013-11-21 |
20130310444 | Combination Therapy for Cancer - An agent comprises a vector having a functional gene, a prodrug which can be converted into a cytotoxic agent by an expression product of the gene, and another cytotoxic agent, as a combined preparation for simultaneous, sequential or separate use in the therapy of cancer or of a disease characterised by an impaired mismatch repair (MMR) pathway, wherein the dosage regimen comprises beginning the another cytotoxic agent therapy no later than 7 days after the prodrug therapy has finished. | 2013-11-21 |
20130310445 | OLIGONUCLEOTIDE CHELATE COMPLEX METHODS - It is described pharmaceutical compositions and methods for the treatment of viral infections, hypercholesterolemia, hypertriglyceridemia, Alzheimer's disease, prion disease and Duchene's muscular dystrophy with oligonucleotide chelate complexes. | 2013-11-21 |
20130310446 | MIR-21 PROMOTER DRIVEN TARGETED CANCER THERAPY - The invention provides a nucleic acid construct comprising a promoter sequence derived from microRNA-21 (miR-21) linked to a nucleic acid sequence encoding an anti-cancer agent, an example of which is a toxin. The constructs of the invention are particularly useful for treating tumors expressing miR-21. | 2013-11-21 |
20130310447 | PHARMACEUTICAL COMPOSITION OF TAXOIDS - The present invention relates to a stable oral pharmaceutical composition with improved solubility and bioavailability; comprising a taxoid, a solubilizer, a stabilizing agent, a surfactant(s), a solvent(s), and an oil wherein the concentration of taxoid is in the range of 0.1 to 10%. | 2013-11-21 |
20130310448 | METHODS AND COMPOSITIONS FOR INHIBITION OF ATR AND FANCD2 ACTIVATION - This invention is announcing a composition of flavonoid skeleton in the formula I or formula II compound, wherein each of the substituents is given the definition as set forth in the specification and claims. This composition have the capacity to Inhibit functions of ATR and FANCD2 on DNA replication, damage checkpoint, and repair; therefore, this composition can improve the cancer sensitivity and poor prognosis to DNA-damaging therapeutics. | 2013-11-21 |
20130310449 | FUNCTIONAL FOODS AND BEVERAGES WITH SYNERGISTIC PROPERTIES TO PROMOTE HOMEOSTASIS - The present invention provides compositions having synergistic antioxidant properties in the modulation of Toll-like receptor signaling for the promotion of homeostasis, immunity, energy conservation, protection of neural cells and anti-inflammatory responses, said compositions comprising plant and/or fruit extracts and a natural sweetener with high oxidation potential as defined by ORAC value. | 2013-11-21 |
20130310450 | Compound Separated from Monascus-Fermented Rice,The Preparation Method and Uses Thereof - The present invention discloses a compound separated from | 2013-11-21 |
20130310451 | TRICYCLIC LACTONES FOR TREATMENT OF CANCER - The present invention discloses novel compounds useful for the inhibition of IL-6/STAT signaling and/or PI3K/NF-κB signaling in the treatment of associated diseases or conditions, e.g. cancer. A pharmaceutical composition comprising such novel compounds, its use and a method thereof, is also disclosed. | 2013-11-21 |
20130310452 | ANTIFUNGAL FLAVOURING INGREDIENTS AND COMPOSITIONS - The present invention relates to the use of flavouring ingredients and compositions as antifungal agents. The invention also relates to a method for preserving food products and beverages comprising adding said flavouring ingredients or compositions to the food product or beverage. | 2013-11-21 |
20130310453 | GREEN GARLIC AND METHODS OF PRODUCTION - A new vegetable, referred to herein as green garlic, grown from garlic bulbils is disclosed. In particular examples, the green garlic is rich in one or more thiosulfinates. Methods of producing green garlic are also disclosed. In some examples, such methods permit year-round commercial production of green garlic. | 2013-11-21 |
20130310454 | PHARMACEUTICAL COMPOSITION COMPRISING EXTRACT OF LONICERA JAPONICA FOR PREVENTION AND TREATMENT OF GASTROESOPHAGEAL REFLUX DISEASE - Disclosed is a composition for treating or preventing gastroesophageal reflux disease, which includes an organic solvent extract of Lonicerae Flos Thunberg. A fraction of the disclosed extract can be very effectively used for treating, preventing, or improving gastroesophageal reflux disease without side effects. | 2013-11-21 |
20130310455 | ACAMPROSATE FORMULATIONS, METHODS OF USING THE SAME, AND COMBINATIONS COMPRISING THE SAME - Embodiments disclosed herein generally relate to acamprosate formulations, methods of use of the formulations, to methods of using the formulations in combination with at least one other medication, and to combination products and compositions comprising the formulations and at least one other medication, such as neuroleptic (antipsychotic) and/or antidepressant drugs. | 2013-11-21 |
20130310456 | ACAMPROSATE FORMULATIONS, METHODS OF USING THE SAME, AND COMBINATIONS COMPRISING THE SAME - Embodiments disclosed herein generally relate to acamprosate formulations, methods of use of the formulations, to methods of using the formulations in combination with at least one other medication, and to combination products and compositions comprising the formulations and at least one other medication, such as neuroleptic (antipsychotic) and/or antidepressant drugs. | 2013-11-21 |
20130310457 | SOLID-IN-OIL DISPERSIONS - A grain free solid-in-oil dispersion comprising a medium chain fatty acid (MCFA), at least one polyunsaturated fatty acid (PUFA), and at least one solid, is provided. The dispersion compositions are useful for preparing dosage forms, dietary supplements and foods that provide health benefits. | 2013-11-21 |
20130310458 | Sensors For The Detection Of Intracellular Metabolites - The present invention relates to a cell which is genetically modified with respect to its wild type and which comprises a gene sequence coding for an autofluorescent protein, wherein the expression of the autofluorescent protein depends on the intracellular concentration of a particular metabolite. | 2013-11-21 |
20130310459 | AMIDE DERIVATIVE, PEST CONTROL AGENT CONTAINING THE AMIDE DERIVATIVE, AND USE OF THE AMIDE DERIVATIVE - An amide derivative represented by the following Formula (1) is provided as an amide derivative showing a significantly excellent effect for a pest control action. | 2013-11-21 |
20130310460 | MODIFIED RELEASE FORMULATIONS OF MEMANTINE ORAL DOSAGE FORMS - The present invention provides pharmaceutical compositions given once daily containing at least one therapeutically active ingredient selected from the group consisting of memantine and a pharmaceutically acceptable salt of memantine, and a pharmaceutically acceptable polymeric matrix carrier. The dosage forms of the invention sustain the release of the therapeutically active agent from about 4 to about 24 hours when said dosage form is exposed to aqueous solutions. following entry of said form into a use environment, wherein said dosage form has a dissolution rate of more than about 80% after passage of about 6 hours to about 12 hours following said entry into said use environment. | 2013-11-21 |
20130310461 | STABILIZED COMPOSITIONS OF VOLATILE ALKYLATING AGENTS AND METHODS OF USING THEREOF - A composition and method for treatment of cancer. The composition for treating a skin disorder, comprising: a Nitrogen Mustard or an HX salt of the Nitrogen Mustard, wherein the Nitrogen Mustard or the HX salt of the Nitrogen Mustard is in a non-aqueous vehicle or carrier that does not include petrolatum or ethanol, wherein the non-aqueous vehicle or carrier that does not include petrolatum or ethanol does not include petrolatum or ethanol. The method comprises topically applying the composition of a Nitrogen Mustard or a HX salt of the Nitrogen Mustard to the affected skin, wherein the Nitrogen Mustard or the HX salt of the Nitrogen Mustard is in a non-aqueous vehicle or carrier that does not include petrolatum or ethanol, wherein the non-aqueous vehicle or carrier does not include petrolatum or ethanol. | 2013-11-21 |
20130310463 | Aromatase Activator - Provided is a material safely promoting the production of estrogen in a living body. The invention relates to use of a compound represented by the following formula (I) or a solvate thereof for producing an aromatase activator. The invention relates to an aromatase activation method comprising administering a compound represented by the following formula (I) or a solvate thereof (wherein the dashed line indicates that the bond may be a double bond, provided that a and b in the formula (I) do not simultaneously represent a double bond). | 2013-11-21 |
20130310464 | COPOLYMERS WHICH CAN BE OBTAINED FROM URETHANE-BASED, POLYSILOXANE-CONTAINING MACROMONOMERS, PROCESSES FOR THE PREPARATION THEREOF AND THEIR USE - The invention relates to a copolymer which can be obtained by free-radical copolymerization of one or more urethane-based, polysiloxane-containing macromonomers and one or more further free-radically polymerizable comonomers. Processes for preparing the copolymer and its use as additive in coating compositions and plastics and as wetting agent and dispersant in homogeneous dispersions are also described. | 2013-11-21 |
20130310465 | WATER-SOLUBLE POLYALKYLENE OXIDE-MODIFIED PRODUCT - The present invention provides a water-soluble polyalkylene oxide-modified product which is nonionic, has a high thickening effect and is also excellent in transparency, and an emulsion composition and a cosmetic material containing the same. More specifically, the present invention provides a water-soluble polyalkylene oxide-modified product obtained by reacting a monovalent hydrophobic alcohol, a linear diol compound, a polyalkylene oxide compound and a diisocyanate compound, and an emulsion composition and a cosmetic material containing the same. | 2013-11-21 |
20130310466 | PASTE-LIKE BONE CEMENT - Kit for producing a bone cement paste, comprising a paste A and a paste B; paste A comprising at least one monomer for radical polymerization, at least one peroxide polymerization initiator and at least one tertiary amine, at least one amidine or a mixture of a tertiary amine and amidine; paste B comprising at least one monomer for radical polymerization, at least one heavy metal compound as polymerization accelerator, and as polymerization co-accelerator at least one sulfimide, at least one dicarboxylic acid imide or a mixture thereof, at least one of the pastes A and B comprising at least one filling agent that is insoluble in the monomer of paste A and/or the monomer of paste B. | 2013-11-21 |
20130310467 | TREHALOSE FATTY ACID ESTER COMPOSITION - The present invention relates to a trehalose fatty acid ester composition, including a trehalose fatty acid ester, wherein all the fatty acid residues held by all the trehalose fatty acid esters in the composition are saturated fatty acid residues having 8 to 22 carbon atoms, the composition contains at least two types of esters selected from the group consisting of a triester, a tetraester, a pentaester, a hexaester, a heptaester, and an octaester, and the sum amount of the esters relative to the total amount of the trehalose fatty acid ester in the composition, is from 20 to 100% by area. According to the present invention, it is possible to provide a composition which has excellent thermostability and an excellent effect of adjusting the hardness for various types of waxes, and which can be used as a solidifier together with a wax for various types of cosmetics. | 2013-11-21 |
20130310468 | Natural Gas to Liquid Fuels - A method and apparatus for converting natural gas from a source, such as a wellhead, pipeline, or a storage facility, into hydrocarbon liquid stable at room temperature, comprising a skid or trailer mounted portable gas to liquids reactor. The reactor includes a preprocessor which desulfurizes and dehydrates the natural gas, a first stage reactor which transforms the preprocessed natural gas into synthesis gas, and a liquid production unit using a Fischer-Tropsch or similar polymerization process. The hydrocarbon liquid may be stored in a portable tank for later transportation or further processed on site. | 2013-11-21 |
20130310469 | PRODUCTION OF HIGHER ALCOHOLS WITH MINIMUM METHANOL CONTENT FROM THE GASIFICATION OF CARBONACEOUS MATERIALS - Systems and methods for generating higher alcohols from synthesis gas produced from carbonaceous materials are described, which can include a reactor configured to produce an alcohol stream and CO | 2013-11-21 |
20130310470 | KEGGIN-TYPE STRUCTURE HETEROPOLY COMPOUND-BASED CATALYST COMPOSITIONS AND THEIR USE IN CONVERSION OF SYNTHESIS GAS TO OXYGENATES - Use a transition metal-containing, Keggin-type heteropoly compound as a catalyst to convert synthesis gas to an alcohol, especially a C | 2013-11-21 |
20130310471 | USE OF DI(ISONONYL)CYCLOHEXANOATE (DINCH) IN EXPANDABLE PVC FORMULATIONS - The invention relates to a foamable composition containing at least one polymer selected from the group consisting of polyvinyl chloride, polyvinylidene chloride, polyvinyl butyrate, polyalkyl (meth)acrylate and copolymers thereof, a foam former and/or foam stabilizer and diisononyl 1,2-cyclohexanedicarboxylate as plasticizer. | 2013-11-21 |
20130310472 | USE OF DI(2-ETHYLHEXYL)TEREPHTHALATE (DEHT) IN FOAMABLE PVC FORMULATIONS - The invention relates to a foamable composition containing a polymer selected from the group consisting of polyvinyl chloride, polyvinylidene chloride, polyvinyl butyrate, polyalkyl(meth)acrylate and copolymers thereof, a foam former and/or foam stabilizer and di-2-ethylhexyl terephthalate as plasticizer. | 2013-11-21 |
20130310473 | DINT IN EXPANDED PVC PASTES - The invention relates to a foamable composition containing at least one polymer selected from the group consisting of polyvinyl chloride, polyvinylidene chloride, polyvinyl butyrate, polyalkyl methacrylate and copolymers thereof, a foam former and/or foam stabilizer and diisononyl terephthalate as plasticizer, wherein the average degree of branching of the isononyl groups in the ester is in the range from 1.15 to 2.5. | 2013-11-21 |
20130310474 | POLYETHER POLYURETHANES EXHIBITING ENHANCED SLIP RESISTANCE UNDER WET CONDITIONS - A polyurethane foam is prepared by combining a polyether triol with a hydroxyl value of from 25 to 30 and a molecular weight from 5000 to 7000 g/mol; a polyether diol with a hydroxyl value of from 25 to 30 and a molecular weight from 3000 to less than 5000 g/mol; a chain extender mixture including 1,4-butanediol and at least one of monoethylene glycol, hexanediol, neopentyl glycol, and isomers thereof; a copolymer polyether polyol having a styrene acrylonitrile solids content of at least 38 wt % and an average hydroxyl number of at least 23; an isocyanate component; and a blowing agent. It is particularly suitable for shoe sole applications, where it exhibits improvement in slip resistance under wet conditions when compared with some other polyether-polyurethane formulations. | 2013-11-21 |
20130310475 | EXPANDED COMPOSITE POLYSTYRENE-BASED RESIN PARTICLES AND EXPANDED MOLDED ARTICLE THEREOF - Expanded composite polystyrene-based resin particles having a plurality of cells and cell membranes separating the plurality of cells, said cell membranes including a polystyrene-based resin forming a continuous phase and polyacrylic acid alkyl ester-based resin fine particles dispersed in said continuous phase to form a dispersed phase, and said polystyrene-based resin being complexed with said polyacrylic acid alkyl ester-based resin fine particles, wherein said dispersed phase is present in the form of a plurality of layers in a cell membrane thickness direction in a cell membrane cross-section of said expanded composite polystyrene-based resin particles. | 2013-11-21 |
20130310476 | EXPANDED POLYPROPYLENE RESIN PARTICLES, AND POLYPROPYLENE RESIN IN-MOLD-EXPANDED MOLDING - Polypropylene resin expanded particles comprising: a polypropylene resin as a base material resin, the propylene resin having at least two melting peaks on a DSC curve for a second temperature rise measured at a heating rate of 10 g/min with use of a heat flux differential scanning calorimeter (DSC), the at least two melting peaks including (i) a lowest temperature melting peak of not lower than 100° C. and not higher than 130° C. and (ii) a highest temperature melting peak of not lower than 140° C. and not higher than 160° C., the propylene resin having a resin DSC ratio change rate of 0.5%/° C. to 3.0%/° C., the expanded particles having two melting peaks in a DSC measurement made at a first temperature rise at the heating rate of 10 g/min, the two melting peaks including, (i) on a lower temperature side, a melting peak temperature of not lower than 100° C. and not higher than 130° C. and, (ii) on a higher temperature side, a melting peak temperature of not lower than 140° C. and not higher than 160° C. allow an in-mold foaming molded product to be produced of expanded particles that (i) have only a small change in expanded particle DSC ratio, the change corresponding to a change in foaming temperature, (ii) allow production of an in-mold foaming molded product at a very low mold heating steam pressure, (iii) exhibit low distortion, low shrinkage, and a wide range of heating conditions for molding, even if the mold heating steam pressure is increased, (iv) indicate a satisfactory moldability even in a case where the expanded particles are molded with use of, for example, a mold having a complicated shape, a large mold, and (v) keep its properties such as compressive strength, without being impaired largely, in a case where the polypropylene resin expanded particles are used to prepare an in-mold foaming molded product. | 2013-11-21 |
20130310477 | POLYOL COMPOSITION FOR PRODUCTION OF POLYURETHANE RESINS, AND POLYURETHANE RESIN PRODUCING PROCESS USING SAME - The present invention is a polyol composition (A) for the production of polyurethane resins which comprises a compound (a1) having a vinyl-polymerizable functional group represented by general formula (I) and a strength improver (a2) represented by general formula (II). In general formula (I), R is hydrogen, C | 2013-11-21 |
20130310478 | VISCOSITY REDUCING AGENTS FOR POLYETHER POLYOLS - The present invention relates to a process for the preparation of a polyurethane, comprising the process steps:
| 2013-11-21 |
20130310479 | METHODS FOR MANUFACTURING CURABLE INKS FOR DIGITAL OFFSET PRINTING APPLICATIONS AND THE INKS MADE THEREFROM - Methods for making pigmented, curable, liquid ink compositions, and the ink compositions prepared from the methods are disclosed. The method includes adding at least one monomer and a dispersant to mixing vessel, and metering into the mixing vessel at least one pigment over a period of time. The method further includes adding at least one initiator and at least one curing agent, and then milling the composition. The pigmented, curable, high viscosity liquid ink compositions are suitable for digital offset printing. | 2013-11-21 |
20130310480 | PHOTOSENSITIVE RESIN COMPOSITION FOR FORMING MICROLENS - There is provided a photosensitive resin composition for forming a microlens. A photosensitive resin composition for forming a microlens, the photosensitive resin composition comprising: a component (A), a component (B), a component (C) and a solvent. The component (A) is a copolymer having a maleimide structural unit of formula (1) below, a vinyl ether structural unit of formula (2) below, and at least one of the three structural units of formula (3), formula (4), and formula (5) below, the component (B) is a photosensitizer, and the component (C) is a cross-linking agent | 2013-11-21 |
20130310481 | DENTAL CEMENT COMPOSITION - A dental cement composition comprising more than 50% by weight Portland cement, and characterized in that it further comprises a polymer selected from styrene, vinyl, and acrylic polymers carrying a sulfonate function. | 2013-11-21 |
20130310482 | POLYIMIDE RESIN COMPOSITION FOR USE IN FORMING REVERSE REFLECTING LAYER IN PHOTOVOLTAIC CELL AND METHOD OF FORMING REVERSE REFLECTING LAYER IN PHOTOVOLTAIC CELL USED THEREWITH - Disclosed are a method of forming a back reflection layer in a solar cell, a composition used therefor, and a solar cell having a back reflection layer formed by the method, which layer has superior heat-resistance and various types of durabilities, and can contribute to improving the conversion rate of solar cells and reliability during long-term use, and which method can form a back reflection layer in a solar cell easily and at low cost. The polyimide resin composition for use in forming a back reflection layer in a solar cell includes an organic solvent, a polyimide resin dissolved in the organic solvent, and light-reflecting particles dispersed in the organic solvent. | 2013-11-21 |
20130310483 | METHOD OF PRODUCING A TREAD COMPOUND - A method of producing a rubber compound, which includes mixing at least one cross-linkable unsaturated-chain polymer base, silica, a first type of silane coupling agent, and a second type of silane coupling agent. The second type of silane coupling agent is added to the mix after the first type of silane coupling agent has reacted with the silica. The first type of silane coupling agent is a trialkoxymercaptoalkyl-silane, and the second type of silane coupling agent is a mercaptosilane protected in the form of thioester. | 2013-11-21 |
20130310484 | POLYMER MICROPARTICLE-DISPERSED RESIN COMPOSITION AND METHOD FOR PRODUCING SAME - The present invention provides a means for improving the elastic modulus (rigidity), heat resistance, toughness, and impact resistance of a resin to provide these properties in a good balance. The present invention provides a polymer microparticle-dispersed resin composition containing 100 parts by weight of a resin and 0.1 to 150 parts by weight of polymer microparticles each containing at least two layers: a crosslinked polymer layer and a coating polymer layer, the resin composition having a particle dispersity of the polymer microparticles in the resin of not lower than 50%, the crosslinked polymer layer including 50% by weight to 99% by weight of at least one monomer having a Tg, as determined as a homopolymer, of not lower than 0° C., and 50% by weight to 1% by weight of at least one monomer having a Tg, as determined as a homopolymer, of lower than 0° C. | 2013-11-21 |
20130310485 | EPOXY-ADDUCT HARDENING AGENTS - Embodiments of the present disclosure include an epoxy-adduct hardening agent formed as a reaction product of a first adduct formed as a reaction product of a first epoxy resin and a polyether monoamine and second adduct formed as a reaction product of an ethyleneamine and a glycidyl ether. Embodiments include a curable composition having an epoxy resin and the epoxy-adduct hardening agent. | 2013-11-21 |
20130310486 | CARBOXYL GROUP-CONTAINING POLYIMIDE, THERMOSETTING RESIN COMPOSITION AND FLEXIBLE METAL-CLAD LAMINATE - The present invention aims to provide a carboxyl group-containing polyimide, and prepolymer thereof which give a cured product highly satisfying thermosetting property, PCT resistance, solvent resistance and peel strength at the same time. The present invention relates to a terminal acid anhydride group-containing imide prepolymer which is characterized by being produced by reacting an acid anhydride group in a tetracarboxylic acid dianhydride with an isocyanate group in a diisocyanate compound, and a carboxyl group-containing polyimide which is characterized in having such a structure where the chain of said terminal acid anhydride group-containing imide prepolymer is extended via a polyol compound. The present invention also relates to a thermosetting resin composition and a flexible metal-clad laminate which utilize such carboxyl group-containing polyimide. | 2013-11-21 |
20130310487 | Thermally Conductive, Electrically Insulating, Silicon-Containing Epoxy Molding Compounds - Thermally conductive, electrically insulating epoxy molding compounds that use milled silicon as a filler material, and methods and processes for making the same. Some example embodiments of the present invention comprise the use of a passivation agent, for example ethyl silicate, to deposit a thin layer of glass on the surfaces of the powders as the powders are milled, creating an attractive surface dielectric property on these surfaces. | 2013-11-21 |
20130310488 | DUST REDUCER AGENT FOR DRY MIXERS OF BUILDING MATERIAL FORMULATIONS - The invention provides methods for producing building material formulations in the form of dry mixers, characterized in that (a) one or more dust reducer agents are applied to one or more inorganic supports, to form supported dust reducer agents, the inorganic supports having a porosity of ≧65%, and the dust reducer agents being selected from the group consisting of fatty acids, fatty acid derivatives, natural oils, hydrocarbons and polysiloxanes composed of units of the general formula R | 2013-11-21 |
20130310489 | PROCESS FOR PROVIDING AND PROCESSING NATURAL FIBRES - A process for providing and processing natural fibres, wherein the process includes the following steps: 1) providing a biomass including fibres and having a dry substance content of at most 50% by weight; 2) adding water to produce a suspension including the biomass; 3) extracting the natural fibres from the biomass; 4) separating the liquid from the suspension; 5) at least single repetition of at least one of steps 2) to 4), the suspension having at least one agent for finishing of the fibres in the last repetition of at least one of steps 2) to 4); and 6) drying the natural fibres. | 2013-11-21 |
20130310490 | ENVIRONMENTALLY FRIENDLY HEAT-SHRINKABLE FILM - A heat-shrinkable film comprising an aliphatic polycarbonate, wherein the film is uniaxially or biaxially oriented, and exhibits a heat-shrinkage of at least 30% in at least one direction when treated with hot air at 70° C. for 10 min, has an improved transparency and good heat-shrinkability which can be used for various purposes such as a label or wrapping material. | 2013-11-21 |
20130310491 | DEGRADABLE FIBERS - There is provided self-degrading fibers, and methods of making and methods of using such self-degrading fibers. | 2013-11-21 |
20130310492 | PROCESS FOR IMPROVING THE PHYSICAL PROPERTIES OF BITUMEN - Additives may be used to improve certain physical properties of bitumen. The additives are prepared using a formulation comprising: a first component selected from the group consisting of (alkoxylated)-(di or tri)-alkyl phenol-aldehyde (amine) resins; α-Olefin-maleic anhydride co-polymers and grafted polymers including half ester/amide and full ester/amide derivatives; and combinations thereof; and a second component which is a synergist and selected from the group consisting of polyamines, amidoamines, imidazolines, and combinations thereof. | 2013-11-21 |
20130310493 | FLAME RETARDANT POLYESTER RESIN COMPOSITION - The present invention provides a flame retardant polyester resin composition that is free from halogen and can have a high level of initial flame retardancy and maintain flammability even after a long-term heat aging test. By allowing an organophosphorous flame retardant (B) represented by the general formula (1) below: | 2013-11-21 |
20130310494 | FLAME-RETARDANT THERMOPLASTIC COMPOSITION - A thermoplastic composition comprising A) a polyalkylene terephthalate; B) an elastomer selected from b1) the polyalkylene terephthalate polyester urethanes, b2) the polyalkylene terephthalate polyether urethanes, b3) the polyalkylene terephthalate polyethers, b4) of the polyalkylene terephthalate polyesters, and mixtures of these; C) a halogen-free flame retardant selected from c1) the nitrogen-containing flame retardants, c2) the nitrogen- and phosphorus-containing flame retardants, c3) of the phosphorus-containing flame retardants, and mixtures of these. The use of the thermoplastic composition of the invention for producing fibers, foils, or moldings, and also to fibers, foils or moldings which comprise the composition of the invention. The use of the thermoplastic composition as coating compositions. | 2013-11-21 |
20130310495 | ELASTOMER COMPOSITE WITH IMPROVED DIELECTRIC PROPERTIES AND PRODUCTION METHOD THEREOF - Disclosed is an elastomer-conductive filler composite with improved dielectric properties. The composite includes conductive fillers and an ionic liquid dispersing the conductive fillers. The ionic liquid is used as a dispersant to effectively enhance the dispersion of the conductive fillers, achieving a high dielectric constant and a low dielectric loss of the composite without deteriorating the physical properties of the conductive fillers. The use of the ionic liquid can reduce the number of processing steps and the presence of the conductive fillers at a low concentration in the composite can minimize deterioration of the physical properties of the elastomer. Further disclosed is a method for producing the composite. | 2013-11-21 |
20130310496 | INK COMPOSITION FOR INKJET PRINTING - The invention provides an ink composition for ink-jet printing which does not cause clogging of nozzles of an ink-jet printer during printing, to thereby provide a print of desired printing quality; which ensures an appropriate drying rate of printed images; and which attains excellent color development. The ink composition for ink-jet printing, containing a pigment, a binder resin, a pigment dispersant, and a solvent, wherein the solvent is formed of (1) at least one glycol ether and at least one of a lactone compound and 2-pyrrolidone, or (2) at least one glycol ether acetate and at least one of cyclohexane and isophorone. | 2013-11-21 |
20130310497 | PHOTO-CURING POLYSILOXANE COMPOSITION AND APPLICATIONS THEREOF - A photo-curing polysiloxane composition for forming a protective film having superior chemical resistance and development resistance is disclosed. The photo-curing polysiloxane composition includes: a polysiloxane component including at least one polysiloxane having at least one alkenyl group; a quinonediazide compound; a fluorene derivative component including at least one fluorene derivative compound having at least one double-bond-containing group; and a solvent. | 2013-11-21 |
20130310498 | COMPOSITIONS AND ARTICLES OF MANUFACTURE CONTAINING BRANCHED POLYCARBONATE - Disclosed herein is a composition comprising: a flame retardant comprising a sulfonate salt and three polycarbonates. The first polycarbonate has a branching level of greater than or equal to 2%, a weight average molecular weight of 20,000 g/mole to 55,000 g/mole and a peak melt viscosity of greater than or equal to 25,000 poise. The second polycarbonate has a glass transition temperature greater than or equal to 170° C. The third polycarbonate has a branching level of 0 to less than 2% and a molecular weight of 17,000 to 40,000g/mol. The composition has a heat distortion temperature greater than or equal to 145° C., ductility greater than or equal to 90% at 23° C., multi-axial impact greater than or equal to 50 Joules per meter (J/m) at 23° C., and a molded article of the composition has a UL 94 V0 rating at a thickness of 1.5 mm. | 2013-11-21 |
20130310499 | EXFOLIATED GRAPHITE OXIDE DERIVATIVE, RESIN COMPOSITE MATERIAL THEREOF, AND PROCESS FOR PRODUCING SAID RESIN COMPOSITE MATERIAL - There are provided an exfoliated graphite oxide derivative excellent in dispersibility in a thermoplastic resin, a resin composite material of the exfoliated graphite oxide derivative and a thermoplastic resin, and a process for producing the resin composite material. The exfoliated graphite oxide derivative is obtained by reacting an exfoliated graphite oxide having a C/O ratio as determined by elemental analysis of 8 or less with a compound having a specific structure. | 2013-11-21 |
20130310500 | PROCESS ENHANCEMENT VIA STIMULI RESPONSIVE PARTICLE SURFACES - Methods for enhancing the processing of a polymer composite are provided herein. in some embodiments, a method for enhancing the processing of a polymer composite may include masking a at least one functional group on a surface of a particle by using a at least one protective group; mixing the particles into a polymer to form a composite; processing the composite; and applying a at least one stimulus to the composite during the processing of the composite or after processing of the composite is complete in order to remove the at least one protective group from the functional group. | 2013-11-21 |
20130310501 | TREATMENT OF PRE-HYDROPHOBATED SILICA IN SITU WITHIN A RUBBER COMPOSITION, THE RUBBER COMPOSITION AND TIRE WITH COMPONENT - The invention relates to treatment of a pre-hydrophobated precipitated silica in situ within a rubber composition. The invention relates to preparation of treated precipitated silica by treatment of pre-hydrophobated precipitated silica in situ within a rubber composition with a bis(3-trialkoxysilylalkyl) polysulfide. The invention further comprises the resultant rubber composition and a tire having a component thereof. | 2013-11-21 |
20130310502 | THERMOPLASTIC RESIN COMPOSITION AND MOLDED PRODUCT THEREOF - The present invention relates to a thermoplastic resin composition obtained by compounding phosphoric acid and/or monosodium phosphate (D) with a resin composition including a styrenebased resin (A), a graft copolymer (B), and an aliphatic polyester resin (C), wherein the thermoplastic resin composition is excellent in mechanical properties (e.g., impact resistance) and thermal stability, and, in addition, can be molded without any problem in terms of safety and hygiene. | 2013-11-21 |
20130310503 | POLYARYLENE SULFIDE FILM - It is aimed to provide a polyarylene sulfide film for an acoustic instrument vibrating plate excellent in heat resistance, molding processability, acoustic properties, and also heat moldability. Provided is a polyarylene sulfide film wherein the elongation at break in either a longitudinal direction or a width direction of the film is 100% or more and 250% or less, and the Young's modulus in either a longitudinal direction or a width direction of the film is 1.5 GPa or more and less than 4 GPa. | 2013-11-21 |
20130310504 | MEDIA SHEET COATINGS - A coating for a substrate is formed by milling cationic pigment particles in the presence of a water-soluble polymer, where the water-soluble polymer acts as a binder and a dispersant for the cationic pigment particles. | 2013-11-21 |
20130310505 | Flame Retardant Thermoplastic Polyurethane Compositions - The present invention relates to flame retardant thermoplastic polyurethane (TPU) compositions that are prepared by compounding certain TPU's and with a polyphosphonate homopolymer or copolymer, and more specifically TPU compositions that pass ASTM E84 Class 1 and UL94 V0 ratings. The invention also relates to compositions that further include an inherently dissipative polymer to provide a TPU composition that has flame retardant properties, electrostatic discharge performance, good clarity and/or transparency, or any combination thereof. | 2013-11-21 |
20130310506 | BIODEGRADABLE POLYMER COMPOSITE MATERIAL - The present invention relates to a biodegradable polymer composite material, and more particularly, to a technique for providing a polymer composite material comprising an acrylonitrile-butadiene-styrene (ABS) resin and a biodegradable resin, wherein said polymer composite material has superior impact resistance. | 2013-11-21 |
20130310507 | Adhesive for 3D Printing - In one aspect, adhesives for use with a 3D printer are described herein. In some embodiments, an adhesive for use with a 3D printer comprises a first polymeric component comprising a poly(vinyl alcohol) and a second polymeric component. The poly(vinyl alcohol), in some embodiments, comprises amorphous poly(vinyl alcohol). In some embodiments, the second polymeric component comprises a water-soluble polymer. Further, in some embodiments, an adhesive described herein further comprises a solvent, a surfactant, and/or a preservative. | 2013-11-21 |
20130310508 | Inverse Dispersion Comprising an Anionic or a Nonionic Polymer and a Stabilizing Agent - An inverse dispersion comprising
| 2013-11-21 |
20130310509 | OPTICALLY ABSORPTIVE HEAT ACTIVATED ADHESIVE MASS AND ADHESIVE TAPE COMPRISING SAID TYPE OF ADHESIVE MASS - Adhesive foil with at least one layer of a heat activated bondable adhesive mass comprising black pigments. | 2013-11-21 |
20130310510 | RAPID DRYING LACQUERS CONTAINING IMPROVED RHEOLOGY CONTROL ADDITIVE - This invention relates to rapid drying lacquers that are particularly useful for automotive OEM refinish applications. The lacquer includes a novel graft copolymer with segmented (or block) arms as a replacement material for all or part of the cellulose acetate butyrate binder component. This invention is also directed to a process for producing coatings from the rapid drying lacquers. These lacquers are especially useful in providing chip and humidity resistant coatings, especially metallic effect coatings, having excellent adhesion and down flop or metallic effect. | 2013-11-21 |
20130310511 | POLYMER MIXTURE - A mixture comprising at least one polymer and from 0.1 wt % to 1.5 wt %, based on the weight of the polymer, of at least one fumed silica, wherein the polymer comprises at least one semi-aromatic polyamide in an amount of more than 50 wt %, based on the weight of the polymer. The presence of the fumed silica in the semi-aromatic polyamide-based mixture allows notably for reducing the cycle time necessary for the manufacture of various shaped articles, such as mobile phone housings, by melt processing methods like injection molding. | 2013-11-21 |
20130310512 | RUBBER COMPOSITION AND PNEUMATIC TIRE - The present invention provides a rubber composition that can enhance the fuel economy, wet-grip performance, abrasion resistance, and processability in a balanced manner, and also provides a pneumatic tire using this rubber composition. The present invention relates to a rubber composition that contains a rubber component, silica, and a compound represented by formula (1) below, wherein the rubber component contains, based on 100% by mass of the rubber component, not less than 5% by mass of a conjugated diene polymer containing a constituent unit based on a conjugated diene and a constituent unit represented by formula (I) below, at least one terminal of the polymer being modified with a specific compound; and an amount of the silica is 5 to 150 parts by mass per 100 parts by mass of the rubber component. | 2013-11-21 |
20130310513 | RADIATION CURABLE COMPOSITIONS - The present invention relates to an ethylenically unsaturated hydroxyl-terminated polyurethane (I) obtained by reacting (i) at least one ethylenically unsaturated compound (A) containing at least two reactive groups capable of reacting with isocyanate groups and at least one ethylenically unsaturated group; with (ii) at least one saturated alcohol component (B) comprising: (iia) at least one saturated hydroxylated compound (B1) containing hydrophilic groups capable of rendering the polyurethane dispersible in aqueous medium either directly or after the reaction with a neutralizing agent to provide a salt, and, optionally, at least one compound (B2) that is selected from saturated polyester polyols (B21) and/or from saturated polycarbonate polyols (B22); and/or (iib) at least one compound (B3) that is selected from saturated polyester polyols (B31) containing compound (B1) moieties and/or from saturated polycarbonate polyols (B32) containing compound (B1) moieties; and, optionally, one or more of compounds (B1) and/or (B2); (iii) optionally, at least one ethylenically unsaturated compound (C) containing essentially one reactive group capable of reacting with isocyanate groups; with (iv) at least one polyisocyanate (D) selected from a tetramethylxylenediisocyanate. The present invention further relates to dispersions in water containing same, to their production and uses. | 2013-11-21 |
20130310514 | RESIST UNDERLAYER FILM-FORMING COMPOSITION - A resist underlayer film-forming composition includes a polymer including a repeating unit shown by a formula (1), and having a polystyrene-reduced weight average molecular weight of 3000 to 10,000, and a solvent. Each of R | 2013-11-21 |
20130310515 | DIENOPHILE-MODIFIED FATTY ACID COMPOSITION AND ADHESIVE - The present invention is directed to a dienophile-modified fatty acid composition and adhesive. The composition comprises a) a polycondensate of a1) a dimer of a fatty alcohol and/or a dimer of a fatty amine, and a2) a dimer of a fatty acid, said polycondensate having a weight average molecular weight of from 2,000 to 50,000 g/mol, and b) a fatty acid derivative as a cross-linking agent, wherein said fatty acid derivative is obtainable by reacting b1) a fatty acid ester comprising at least two double bonds, and b2) a dienophile comprising at least one functional group selected from a carboxylic acid, a carboxylic acid ester and a carboxylic acid anhydride, wherein the polycondensate and the cross-linking agent are capable of reacting with each other. | 2013-11-21 |
20130310516 | CURABLE COMPOSITION AND CURED MATERIAL OF THE SAME - The present invention provides a curable composition, wherein a cured material obtainable by curing the curable composition has excellent transparency, thermal durability and surface hardness and has a small Abbe number. In particular, the present invention provides a curable composition containing (a) silica fine particles; (b) a (meth)acrylate compound having two or more ethylenically unsaturated groups; (c) a (meth)allyl compound having two or more ethylenically unsaturated groups and having an aromatic ring structure; and (d) a polymerization initiator; wherein the surface of the silica fine particles (a) has been treated with a specified silane compound (e) and a specified silane compound (f). | 2013-11-21 |
20130310517 | METHODS FOR MANUFACTURING CURABLE INKS FOR DIGITAL OFFSET PRINTING APPLICATIONS AND THE INKS MADE THEREFROM - Methods for making pigmented, curable, liquid ink compositions, and the ink compositions prepared from the methods are disclosed. The method includes adding at least one monomer and a dispersant to mixing vessel, and metering into the mixing vessel at least one pigment over a period of time. The method further includes adding at least one initiator and at least one curing agent, and then milling the composition. The pigmented, curable, high viscosity liquid ink compositions are suitable for digital offset printing. | 2013-11-21 |
20130310518 | FREE RADICAL POLYMERISATION OF ETHYLENE INITIATED BY ORGANIC PEROXIDES WITH HIGH PRODUCTIVITY - A method for manufacturing polyethylene or an ethylene copolymer, including a step of free radical polymerisation or copolymerisation of the ethylene at an initiation temperature varying from 150° C. to 200° C., at a pressure varying from 500 to 3000 bar, in the presence of a peroxidic polymerisation initiator selected from among the peroxide compounds of formula (I) in which R1 and R8 are, separately, a C2-C6 alkyl group; R2, R3, R6 and R7 are, separately, a C1-C5 alkyl group; and R4 and R5 are, separately, a C1-C6 alkyl group. | 2013-11-21 |
20130310519 | CELLULOSE RESIN - A cellulose resin produced by binding cardanol or a derivative thereof, and a flexible component to cellulose or a derivative thereof. | 2013-11-21 |
20130310520 | HIGH MOLECULAR WEIGHT CASTOR OIL-BASED POLYOLS AND USES THEREOF - Castor oil-based polyol polymer compositions and their use in processes for preparing polyurethane compounds with modified properties (e.g. tensile strength, hydrolytic stability, and the like) are described. | 2013-11-21 |
20130310521 | RESIN COMPOSITE MATERIAL AND PROCESS FOR PRODUCING SAME - Disclosed herein are a resin composite material that has excellent mechanical strength and can be easily produced and a method for producing such a resin composite material. | 2013-11-21 |
20130310522 | COMPOSITE RESINOUS PARTICLES, METHOD OF PRODUCING COMPOSITE RESINOUS PARTICLES, COMPOSITE RESIN MOLDED BODY, AND METHOD OF PRODUCING SAME - A composite resin material particle is produced by a method including the steps of: forming a mixed slurry containing a resin material particle and carbon nanotubes; supplying the mixed slurry to a pressure vessel, followed by supplying carbon dioxide with stirring an inside of the pressure vessel; holding the inside of the pressure vessel at a temperature and at a pressure which allow the carbon dioxide to be maintained in a subcritical or supercritical state; and transferring the carbon dioxide to the outside of the pressure vessel. | 2013-11-21 |
20130310523 | Blends of Co-Precipitated Hydrogenated Ethylene-Dicyclopentadiene and Elastomeric Polymers to Provide Impact Modified Structural Polyolefins - Disclosed is the preparation of compositions which are blends of certain types of hydrogenated ethylene-dicyclopentadiene (E/DCPD) copolymers in combination with elastomeric polymers. An E/DCPD copolymer and an elastomeric polymer are co-dissolved in a common liquid reaction medium which is then subjected to hydrogenation conditions. These hydrogenation conditions serve to hydrogenate in-situ at least a portion of the residual double bonds of the E/DCPD copolymer component and possibly also eliminate any residual unsaturation which might be present in the elastomeric polymers. This combination of materials which has been hydrogenated in-situ can then be co-precipitated to form a polymer composition which can be molded into polyolefin materials of improved structural, thermal and mechanical properties with desirable impact resistance. | 2013-11-21 |
20130310524 | Polycarbonate Copolymers Via Controlled Radical Polymerization - In one aspect, the invention relates to relates to copolymer compositions comprising domains of polycarbonate and polyacrylate, and to methods of preparing the copolymers, wherein the method comprises reacting a polycarbonate macroinitator with a vinyl monomer by atom transfer radical polymerization. This abstract is intended as a scanning tool for purposes of searching in the particular art and is not intended to be limiting of the present invention. | 2013-11-21 |
20130310525 | INDUCED POLYMER ASSEMBLIES - The invention provides compositions and methods for inducing and enhancing order and nanostructures in block copolymers and surfactants by certain nonpolymeric additives, such as nanoparticles having an inorganic core and organic functional groups capable of hydrogen bonding. Various compositions having lattice order and nanostructures have been made from a variety of copolymers or surfactants that are mixed with nonpolymeric additives. Particularly, a variety of nanoparticles with an inorganic core and organic functional groups have been discovered to be effective in introducing or enhancing the degree of orders and nanostructures in diverse block copolymers and surfactants. | 2013-11-21 |
20130310526 | Process for Preparing Catalysts and Catalysts made thereby - A process for preparing a catalyst, and catalysts prepared thereby. The process includes selecting a catalyst support and mixing it with one or more chromium containing compounds oxidizable to a Cr | 2013-11-21 |
20130310527 | HIGHLY VISCOUS HIGHER ALPHAOLEFIN POLYMER AND METHOD FOR PRODUCING SAME - An α-olefin polymer has (A) a tacticity index(meso triad fraction)[mm] of 10 to 50 mol %, (B) a kinematic viscosity at 100° C. of 200 to 10,000 mm | 2013-11-21 |
20130310528 | Novel Catalysts and Methods of Use Thereof to Produce Vinyl Terminated Polymers - This invention relates to a homogenous process for making a vinyl terminated propylene polymer, wherein the process comprises: contacting, propylene, under polymerization conditions, with a catalyst system comprising an activator and at least one metallocene compound, where the metallocene compound is represented by the formula: | 2013-11-21 |
20130310529 | METAL COMPLEXES OF SALAN-TYPE LIGANDS AND USES THEREOF AS CATALYSTS FOR POLYMERIZATION OF ALPHA-OLEFINS - Use of homogeneous catalytic systems which include as a pre-catalyst a complex of a group 4 metal and a Salan ligand in the polymerization of alpha-olefins, is disclosed. The Salan ligand is characterized by a sequential diamino-containing skeleton unit which is non-symmetric, and the pre-catalysts can also be such that are devoid of a symmetry element. The disclosed polymerization results in alpha-olefin polymers such as polypropylene which are characterized by high levels of tacticity. Also disclosed are novel Salan ligands and novel complexes thereof with group 4 metals. | 2013-11-21 |
20130310530 | USE OF SILICONE METHACRYLATE PARTICLES IN COSMETIC FORMULATIONS - The present invention relates to cosmetic compositions comprising, as solid particles, silicone methacrylate particles which are obtainable by the steps a) producing an emulsion of water and an organic phase, where the organic phase comprises specifically organopolysiloxanes modified in the terminal and/or lateral position with methacrylate groups, or mixtures thereof, with the addition of at least one emulsifier and optionally one or more coemulsifiers, where the organic phase forms the internal phase of the emulsion, and fully polymerizing the internal phase in the presence of a radical initiator, which is added to the external phase (aqueous phase) in a concentration of from 0.1 to 40% by weight based on the internal phase, and also to corresponding cosmetic compositions. | 2013-11-21 |
20130310531 | TERMINAL-MODIFIED DIFUNCTIONAL SULFUR-CONTAINING POLYMERS, COMPOSITIONS THEREOF AND METHODS OF USE - Disclosed are terminal-modified difunctional sulfur-containing polymers that are the reaction products of a sulfur-containing diol, an aldehyde or a ketone, and a compound containing a functional group. Compositions comprising the terminal-modified difunctional sulfur-containing polymers useful as sealants are also disclosed. | 2013-11-21 |
20130310532 | Rotomolding Resin - Resins suitable for rotomolded articles comprise a bimodal polyethylene copolymer comprising from 0.1 to 5 weight % of one or more C | 2013-11-21 |
20130310533 | Temperature Controlled Sol-Gel Co-Condensation - Provided according to some embodiments of the invention are methods of making co-condensed macromolecules that include forming a reaction mixture by combining at leak one reactant and at least one reagent at a first temperature at which the at least one reactant is substantially unreactive in the presence of the at least one reagent; raising the temperature of the reaction mixture to a second temperature at which the at least one reactant is reactive in the presence of the at least one reagent, wherein the reaction of the at least one reactant in the presence of the at least one reagent produces co-condensed macromolecules such as co-condensed silica macromolecules. | 2013-11-21 |
20130310534 | Method of Preparing a Diorganodihalosilane - A method of preparing a diorganodihalosilane, the method comprising the following separate and consecutive steps: (i) treating a preformed metal silicide with a mixture comprising hydrogen gas and a silicon tetrahalide at a temperature from 300 to 1400° C. to form a treated metal silicide, wherein the preformed metal silicide comprises a metal selected from at least one of Ni, Pd, or Pt; and (ii) reacting the treated metal silicide with an organohalide according to the formula RX at a temperature from 250 to 700° C. to form a diorganodihalosilane, wherein R is C | 2013-11-21 |
20130310535 | POLYCARBONATE RESIN AND PROCESS FOR PRODUCTION THEREOF - The present invention provides a polycarbonate resin containing a structural unit represented by general formula (I). | 2013-11-21 |