38th week of 2014 patent applcation highlights part 160 |
Patent application number | Title | Published |
20140275197 | ALPHA-2 ADRENERGIC AGONIST FOR TREATING INTRAOCULAR PRESSURE AND OCULAR DISEASES THROUGH INTRAVITREAL AND INTRACAMERAL ROUTES - The present invention provides a method of lowering intraocular pressure which comprises administering a therapeutically effective amount of a pharmaceutical composition comprising 4-bromo-5-(2-imidazolin-2-ylamino)benzimidazole, or a salt thereof to the affected eye of a patient, as a single dose, wherein the affected eye has an intraocular pressure less than the baseline. | 2014-09-18 |
20140275198 | PHARMACEUTICAL COMPOSITION FOR PREVENTING OR TREATING DIABETES OR FATTY LIVER CONTAINING A CYP4A INHIBITOR AS AN ACTIVE INGREDIENT - The present invention relates to a pharmaceutical composition for preventing or treating diabetes or fatty liver, and more specifically relates to a pharmaceutical composition for preventing or treating diabetes or fatty liver containing a CYP4A (cytochrome P450A) inhibitor as an active ingredient. According to the present invention, the CYP4A inhibitor suppresses endoplasmic reticulum stress, reduces the blood insulin concentration and suppresses apoptosis of liver cells, and hence exhibits effects in preventing or treating diabetes or fatty liver. | 2014-09-18 |
20140275199 | SUBSTITUTED 3-(BIPHENYL-3-YL)-4-HYDROXY-8-METHOXY-1-AZASPIRO[4.5]DEC-3-EN-2-ONE - The invention relates to substituted 3-(biphenyl-3-yl)-4-hydroxy-8-methoxy-1-azaspiro[4.5]dec-3-en-2-ones, in particular for therapeutic purposes, to pharmaceutical compositions and to their use in therapy, in particular for the prophylaxis and therapy of neoplastic disorders. | 2014-09-18 |
20140275200 | INHIBITION OF NEOVASCULARIZATION BY SIMULTANEOUS INHIBITION OF PROSTANOID IP AND EP4 RECEPTORS - There are provided inter alia methods and compounds useful for decreasing neovascularization (e.g., choroidal neovascularization) in a subject in need thereof. | 2014-09-18 |
20140275201 | IDENTIFICATION OF CANCER STEM CELL MARKERS AND USE OF INHIBITORS THEREOF TO TREAT CANCER - The present invention provides biomarkers of cancer stem cells, as well as cells that have undergone EMT. In addition, the present invention provides methods of treating patients determined to comprise cancer stem cells with PDGFR-β inhibitors to eliminate the cancer stem cells. Methods of predicting sensitivity to PDGFR-β inhibitors, monitoring efficacy of treatment, and determining a prognosis are also provided. | 2014-09-18 |
20140275202 | INJECTABLE ROPINIROLE COMPOSITIONS AND METHODS FOR MAKING AND USING SAME - Compositions and methods are provided that utilize an injectable ropinirole having a therapeutically effective amount of ropinirole in an aqueous solvent, the composition having a pH of from about 3.0 to about 6.5. The compositions and methods provided contain less than 3% by weight of impurities and are suitable for administration by infusion pumps. In some embodiments, the compositions are made in an oxygen free environment and/or are made with an antioxidant to reduce impurities and improve stability. In some embodiments, the compositions provided are utilized to treat Parkinson's disease. | 2014-09-18 |
20140275203 | Method for Inhibiting Differentiation of Osteoclast and Pharmaceutical Composition Comprising Thereof - The present invention is for method of treating metabolic bone disease, new compounds and pharmaceutical compositions comprising the active ingredients having inhibition effects on osteoclast differentiation. The pharmaceutical composition comprising new compounds according to the present invention can be used as medicines for treating metabolic bone diseases such as bone metastatic cancer, solid cancer bone metastasis, musculoskeletal complication by solid cancer bone metastasis, hypercalcemia by malignant tumor, multiple myeloma, primary bone tumor, osteoporosis, rheumatoid arthritis, osteoarthritis, periodontal disease, inflammatory resorption of alveolar bone, inflammatory resorption of bone, and Paget's disease. | 2014-09-18 |
20140275204 | METHOD OF DOSING AND USE OF SOFT ANTICHOLINERGIC ESTERS - A method of treating hyperhidrosis in a mammalian subject comprising:
| 2014-09-18 |
20140275205 | PRODRUGS OF FUMARATES AND THEIR USE IN TREATING VARIOUS DISEASES - The present invention provides compounds of formula (I), | 2014-09-18 |
20140275206 | USE OF LEVO-OXIRACETAM AND OXIRACETAM IN PREPARATION OF MEDICINES FOR PREVENTING OR TREATING COMA - The present invention is to provide uses of the L-oxiracetam in preparation of medicines for preventing or treating coma. Experimental results show that L-oxiracetam wake-promoting effects of alcoholism-induced coma is obvious, and D-oxiracetam has basically no effect. The effect of the above wake-promoting effects of L-oxiracetam is 2 times greater than racemic oxiracetam. The wake-promoting effects of L-oxiracetam on trauma or anesthesia-induced coma are both significant. | 2014-09-18 |
20140275207 | ANTISENSE COMPOUNDS AND METHODS OF USE THEREOF - Disclosed herein are compounds, compositions and methods for modulating the expression of LMW-PTPase in a cell, tissue or animal. Also provided are methods of target validation. Also provided are uses of disclosed compounds and compositions in the manufacture of a medicament for treatment of diseases and disorders. Also provided are methods for the prevention, amelioration and/or treatment of diabetes, insulin resistance, insulin deficiency, hypercholesterolemia, hyperglycemia, dyslipidemia, hyperlipidemia, hypertriglyceridemia, and hyperfattyacidemia. In some embodiments, the diabetes is type II diabetes by administration of antisense compounds targeted to LMW-PTPase. | 2014-09-18 |
20140275208 | Compositions and Methods to Control Insect Pests - Methods and compositions are provided which employ a silencing element that, when ingested by a pest, such as a Coleopteran plant pest or a | 2014-09-18 |
20140275209 | WOUND HEALING COMPOSITIONS AND TREATMENTS - This invention concerns improved methods, uses, and kits for treating chronic wounds through the administration of anti-connexin agents, particularly anti-connexin 43 antisense polynucleotides. The methods, uses, and kits of the invention are based on the surprising and unexpected discovery that chronic wounds that do not increase or decrease in size by more than a pre-determined amount during a pre-treatment phase are more amenable to successful treatment than wounds whose size varies outside the target range during the pre-treatment phase. | 2014-09-18 |
20140275210 | Antisense Oligonucleotides Against Neutral Sphingomyelinase and Neutral Sphingomyelinase Inhibitor GW4869 for Degenerative Neurological Disorders - Alzheimer's disease (AD) is the most common human neurodegenerative disease of the CNS resulting in progressive neuronal death and memory loss. Despite intense investigations, no effective therapy is available to stop its onset or halt its progression. It was discovered that antisense oligonucleotide against neutral sphingomyelinase and GW4869, a chemical inhibitor of neutral sphingomyelinase, inhibit activation of glial cells and protect neurons in AD cell culture and animal models. These results suggest the following new treatment options for AD patients: Antisense oligonucleotide against neutral sphingomyelinase and GW4869. | 2014-09-18 |
20140275211 | ASSAYS AND METHODS FOR DETERMINING ACTIVITY OF A THERAPEUTIC AGENT IN A SUBJECT - The invention relates to methods and assays for determining the activity of a composition comprising a therapeutic gene administered to a subject. | 2014-09-18 |
20140275212 | MODULATION OF EXON RECOGNITION IN PRE-MRNA BY INTERFERING WITH THE SECONDARY RNA STRUCTURE - The invention relates to oligonucleotides for inducing skipping of exon 55 of the dystrophin gene. The invention also relates to methods of inducing exon 55 skipping using the oligonucleotides. | 2014-09-18 |
20140275213 | Methods and Compositions for Plant Pest Control - The present invention comprises methods and compositions for controlling nematode parasitism in host plant. The present invention comprises novel polynucleotides and polypeptides encoded by such polynucleotides comprising one or more nucleic acid sequences disclosed herein having a nucleotide sequence comprising any one of SEQ ID NOs: 1-142, a fragment or variant thereof, or a complement thereof, or a polypeptide sequence comprising any one of SEQ ID NOs: 143-159, a fragment or variant thereof. | 2014-09-18 |
20140275214 | CUSTIRSEN TREATMENT WITH REDUCED TOXICITY - The present invention provides a method for providing antisense therapy which reduces the expression of clusterin to provide therapeutic benefit in the treatment of cancer, comprising administering an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2′-O-methoxyethyl modifications, has nucleotides 5-17 which are 2′ deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19, to a human subject in need of treatment for the cancer, which human subject also receives at least one chemotherapeutic agent, hormone ablation therapy, or radiation therapy, wherein the anti-clusterin oligonucleotide is administered at least 3 times during a 5 to 9 day period, wherein at least 1 of the administrations is at a dose other than 640 mg. The present invention also provides a method for providing antisense therapy which reduces the expression of clusterin to provide therapeutic benefit in the treatment of myeloma. | 2014-09-18 |
20140275215 | ANTI-CLUSTERIN MONOTHERAPY FOR CANCER TREATMENT - The present invention provides a method of treating cancer in a subject afflicted with cancer comprising administering to the subject an anti-clusterin oligonucleotide as a monotherapy to treat the cancer. The present invention also provides compositions for treating cancer in a subject afflicted with cancer, comprising an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1). Additionally, the present invention provides pharmaceutical compositions for treating cancer in a subject afflicted with cancer, the composition comprising an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2′-O-methoxyethyl modifications, has nucleotides 5-17 which are 2′deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19. | 2014-09-18 |
20140275216 | ALTERATION OF NEURONAL GENE EXPRESSION BY SYNTHETIC piRNAs AND BY ALTERATION OF piRNA FUNCTION - Provided herein are compositions and methods for the alteration of neuronal methylation by synthetic piRNAs or by alteration of piRNA function. Such alterations find use in the regulation and control of neural gene expression and concomitant neural functions. Further provided herein are systems and methods for the identification of target sites for regulation by piRNAs. | 2014-09-18 |
20140275217 | COMPOSITIONS AND METHODS FOR TREATING CANCER - A method of treating a BORG expressing cancer includes administering a therapeutically effective amount of at least one BORG inhibiting agent to the BORG overexpressing cancer cells of the subject. | 2014-09-18 |
20140275218 | WOUND HEALING COMPOSITIONS AND TREATMENTS - This invention concerns improved methods, uses, and kits for treating chronic wounds through the administration of anti-connexin agents, particularly anti-connexin 43 antisense polynucleotides. The methods, uses, and kits of the invention are based on the surprising and unexpected discovery that chronic wounds that do not increase or decrease in size by more than a pre-determined amount during a pre-treatment phase are more amenable to successful treatment than wounds whose size varies outside the target range during the pre-treatment phase. | 2014-09-18 |
20140275219 | USES OF THE HUMAN ZFX GENE AND DRUGS ASSOCIATED WITH SAME - The present invention discloses uses of the human ZFX gene and drugs associated therewith. Also disclosed are uses of the human ZFX gene in tumor treatment, tumor diagnosis, and drug preparation. Further disclosed are small interfering RNA (siRNA), and nucleic acid and lentivirus encoding the siRNA to the human ZFX gene and uses thereof. The siRNA and nucleic acid and lentivirus encoding the siRNA provided by the present invention can specifically inhibit the expression of human ZFX gene. Lentiviruses in particular can efficiently infect target cells, inhibit ZFX expression in target cells, and inhibit the growth of tumor cells, thus promote tumor apoptosis and have great significance in tumor treatment. | 2014-09-18 |
20140275220 | THE miRNA-212/132 FAMILY AS A THERAPEUTIC TARGET - The present invention refers to inhibitors of microRNAs, particularly of microRNAs miR-212 and/or miR-132 for use in medicine, particularly in the diagnosis, treatment or prevention of cardiac disorders, e.g. cardiac hypertrophy-associated or autophagic disorders, and further refers to isolated nucleic acid molecules, particularly microRNAs miR-212 and/or miR-132 and related sequences, for use in medicine, particularly human medicine, more particularly in the diagnosis, treatment or prevention of disorders involving cardiac atrophy and/or dysfunctional autophagy, e.g. cardiac cachexia. | 2014-09-18 |
20140275221 | TARGETING OF MIRNA PRECURSORS - The present invention relates to a method of targeting mi RNA and/or premiRNA molecules in order to treat diseases that are linked with mi RNA expression, such as certain cancers. The present invention also provides modified sno RNA molecules for targeting mi RNA molecules for use in treating diseases that are linked with mi RNA expression, such as certain cancers. | 2014-09-18 |
20140275222 | ANTISENSE OLIGONUCLEOTIDE MODULATORS OF SEROTONIN RECEPTOR 2C AND USES THEREOF - The present invention provides, among other things, oligonucleotide modulators of human 5′-HT2C receptor (HTR2C) and improved methods and composition for treating HTR2C-related diseases, disorders or conditions based on such modulators. In particular, oligonucleotides modulators according to the invention target specific regions in the Exon V/Intron V junction of the human HTR2C pre-mRNA and drive expression of HTR2C Vb splice isoform, leading to increased generation of non-edited strong HTR2C receptor and enhanced serotonin receptor activity. | 2014-09-18 |
20140275223 | MicroRNA-BASED APPROACH TO TREATING MALIGNANT PLEURAL MESOTHELIOMA - The invention relates to microRNA mimics, corresponding to the miR-15/107 family, and to methodology for using microRNA mimics to treat malignant pleural mesothelioma (MPM) by restoring regulation of the expression of target genes of the miR-15/107 family in MPM tumor cells. | 2014-09-18 |
20140275224 | CYTOSINE DEAMINASE MODULATORS FOR ENHANCEMENT OF DNA TRANSFECTION - Compounds and methods are provided for enhancing or boosting the transfection rate or efficiency of mammalian cells by foreign DNA, such as bacterial plasmid DNA. Compounds, including natural products and inventive synthetic compounds can increase the effectiveness of uptake and incorporation of foreign DNA by mammalian cells, such as human cells, by suppression of DNA cytosine deamination, which is believed to be a mechanism by which these cells eliminate foreign DNA. Inhibition of the cytosine deaminase enzymes by compounds as described herein serves to provide more effective transfection of eukaryotic cells by plasmids including engineered gene sequences. Transfection can be used to study cellular processes, or to cure genetic diseases in human patients. The inventive materials and methods increase the efficiency and effectiveness of such transfection techniques. | 2014-09-18 |
20140275225 | MODULATORS OF PHARMACOLOGICAL AGENTS - The biological activity of nucleic acid ligand is regulated (i.e. enhanced or inhibited) in vivo to produce a desired biological effect. This is accomplished through the administration of a modulator, or regulator, that changes the binding of the nucleic acid ligand for its target or that degrades or otherwise cleaves, metabolizes or breaks down the nucleic acid ligand while the ligand is still exerting its effect. Modulators of the present invention can be administered in real time as needed based on various factors, including the progress of the patient, as well as the physician's discretion in how to achieve optimal therapy. Thus, this invention provides for the first time a regulatable therapeutic regime in the course of nucleic acid ligand therapy. | 2014-09-18 |
20140275226 | METHOD OF CONTROLLING COAGULATION - The present invention relates, in general, to methods of controlling coagulation, and in particular, to methods of effecting neutralizable rapid onset anticoagulation, and to compounds and compositions suitable for use in such methods. | 2014-09-18 |
20140275227 | COMPOSITIONS AND METHODS OF ALTERING CHOLESTEROL LEVELS - The present invention relates to compositions, methods and kits using polynucleotides, primary transcripts and mmRNA molecules. | 2014-09-18 |
20140275228 | METHODS FOR TREATING DENERVATION-INDUCED MUSCLE ATROPHY - The present invention provides methods for the treatment of denervation-induced skeletal muscle atrophy, and generally, denervation-induced skeletal muscle degeneration diseases using agents that decrease the activity of mammalian target of rapamycin and/or the activity of at least one of the Forkhead Box Transcription Factors 1, 3 and 4. | 2014-09-18 |
20140275229 | MODIFIED POLYNUCLEOTIDES ENCODING UDP GLUCURONOSYLTRANSFERASE 1 FAMILY, POLYPEPTIDE A1 - The invention relates to compositions and methods for the preparation, manufacture and therapeutic use of polynucleotides, primary transcripts and mmRNA molecules. | 2014-09-18 |
20140275230 | METHODS AND COMPOSITIONS FOR INCREASING SIALIC ACID PRODUCTION AND TREATING SIALIC RELATED DISEASE CONDITIONS - Disclosed herein are methods of expressing UDP-GlcNAc 2-Epimerase/ManNAc Kinase enzyme (GNE) peptide in a cell of a subject comprising: delivering into the cell of the subject an isolated nucleic acid expression construct that comprises a promoter operatively linked to a nucleic acid sequence encoding a GNE peptide or a therapeutically active fragment thereof, wherein the GNE peptide has the amino acid sequence of SEQ ID NO:3, wherein upon the delivering into the cell of the subject, the nucleic acid expression construct initiates expression of the GNE peptide or a therapeutically active fragment thereof. Also disclosed are methods of producing a GNE peptide in a cell comprising infecting the cell with an isolated nucleic acid construct that comprises a promoter operatively linked to a nucleic acid sequence encoding a GNE peptide or a therapeutically active fragment thereof, wherein the GNE peptide has the amino acid sequence of SEQ ID NO:3. | 2014-09-18 |
20140275231 | CHIMERIC PROMOTER FOR CONE PHOTORECEPTOR TARGETED GENE THERAPY - The subject invention concerns materials and methods for providing for cone cell specific expression of a polynucleotide in a human or animal. One aspect of the invention concerns a polynucleotide promoter sequence that directs expression of an operably linked polynucleotide in cone cells. In one embodiment, a polynucleotide of the invention comprises a nucleotide sequence of an interphotoreceptor retinoid-binding protein (IRBP) gene that is positioned upstream of a promoter nucleotide sequence of a cone transducin alpha-subunit (GNAT2) gene. Another aspect of the subject invention concerns methods for expressing a selected polynucleotide in cone cells. The selected polynucleotide can be provided in a polynucleotide of the invention wherein the selected polynucleotide is operably linked to a polynucleotide promoter sequence of the invention. In one embodiment, the selected polynucleotide sequence is provided in a polynucleotide vector of the invention. The vector comprising the selected polynucleotide is then introduced into a cell. The selected polynucleotide is expressed only in cone cells, with very little, if any, expression in rods or other cells. A selected polynucleotide can be one that encodes, for example, a therapeutic protein or a functional protein that is defective or underexpressed in the targeted cone cells. | 2014-09-18 |
20140275232 | SMALL MOLECULE ANTAGONISTS OF BACTERIAL QUORUM-SENSING RECEPTORS - A novel small molecule antagonizes two types of acyl homoserine lactone receptors: membrane-bound and cytoplasmic. A focused library of analogs and derivatives of the original antagonist was synthesized. Analog and derivative molecules harbor a range of activities. The novel small molecule and most potent antagonist protects the eukaryote | 2014-09-18 |
20140275233 | ACTIVATED SOY POD FIBER - The present invention provides, among other things, compositions and methods of manufacturing edible soy pod fiber comprising glyceollins. In some embodiments, methods of treating overweight, obesity, prediabetes, diabetes, or gastrointestinal dysbiosis in a subject are provided comprising orally administering a composition or food product comprising edible soy pod fiber comprising glyceollins. | 2014-09-18 |
20140275234 | COMPOSITIONS AND METHODS OF USING CRYSTALLINE FORMS OF WORTMANNIN ANALOGS - Provided herein are novel crystalline forms of Compound 1. Also provided herein are compositions and methods of uses for the crystalline forms of Compound 1. | 2014-09-18 |
20140275235 | Treatment of Proliferative Disorders - The present invention relates to a method and composition for treating safely (in a non-toxic way) disease or disorder exhibiting excessive cellular proliferation comprising administering to a patient needing such treatment, a composition comprising curcumin (derived from turmeric), epigallocatechin-3-gallate (EGCG, enriched in green tea), glucosinolates (enriched in cruciferous vegetables) and/or derivatives thereof, such as sulforaphane (SFN), alone or combined with a ketogenic diet or a modified ketogenic diet. Also the current invention relates to a composition comprising medium chain triglycerides, Epigallocatechin-3-gallate, curcumin, compositions comprising glucosinolates and/or derivatives thereof, such as sulforaphane (SFN). The invention provides that administering a composition comprising curcumin, EGCG, glucosinolates, alone or combined with a ketogenic diet or a modified ketogenic diet targets malignant cells leading to decrease cellular proliferation and increase survival of the subject treated with the current invention. | 2014-09-18 |
20140275236 | Novel anti-neurodegenerative natural compounds isolated from Alpiniae Oxyphyllae Fructus and their total synthesis - This invention is directed to novel compounds isolated or derived from Alpiniae oxyphyllae fructus, chemically synthesized novel compounds, methods of preparing the novel compounds and uses thereof as neuroprotectants or drugs for treating neurodegenerative diseases such as Parkinson's disease. | 2014-09-18 |
20140275237 | BERAPROST ISOMER AS AN AGENT FOR THE TREATMENT OF VIRAL INFECTION - In various embodiments the use of single isomer of beraprost as a therapeutic for the treatment of viral disease and other pathologies associated with the induction of a cytokine storm, such as influenza A viruses and the SARS-causing coronvirus and mutations thereof is provided. | 2014-09-18 |
20140275238 | INHIBITION OF NEOVASCULARIZATION BY INHIBITION OF PROSTANOID IP RECEPTORS - There are provided inter alia methods and compounds useful for decreasing choroidal neovascularization in a subject in need thereof. | 2014-09-18 |
20140275239 | Dronedarone Formulation - Dronedarone formulations. Formulations of dronedarone are disclosed that provide consistent release and absorption of dronedarone that is independent of food ingestion. The disclosed formulation achieves this result through the inclusion of rate-controlling polymers, such as cellulose derivatives, acrylic polymers, and natural polymers. The dosage form may be prepared through blending, dry granulation, or wet granulation, followed by compression into a tablet. | 2014-09-18 |
20140275240 | Suppression and prevention of tumors and treatment of viruses - Combinations of betaine and vitamin C are used to suppress or prevent malignant tumors or to treat viruses, e.g., by combining the two ingredients in a product consumed by a human, dog, or cat, such as an aqueous liquid such as grape juice, the ingredients being provided in containers with instructions for use, or in finished products, especially with support of tests demonstrating the effectiveness of the treatment for, e.g., preventing tumors in populations known to be at risk of developing tumors, or, treating existing cancers in combination with other cancer drugs such as anastrozole and/or fulvestrant and/or artemisinin either concurrently or sequentially to prevent the cancer from growing when the cancer drug is not being used, or in the treatment of viruses. | 2014-09-18 |
20140275241 | NEUROACTIVE SUBSTITUTED CYCLOPENT[a]ANTHRACENES AS MODULATORS FOR GABA TYPE-A RECEPTORS - The present disclosure is generally directed to neuroactive substituted cyclopent[a]anthracenes as referenced herein, and pharmaceutically acceptable salts thereof, for use as, for example, an anesthetic, and/or in the treatment of disorders relating to GABA function and activity. The present disclosure is further directed to pharmaceutical compositions comprising such compounds. | 2014-09-18 |
20140275242 | HOT MELT GRANULATION FORMULATIONS OF POORLY WATER-SOLUBLE ACTIVE AGENTS - The presently disclosed subject matter is directed to a granule, wherein the granule has an active agent and a wax dispersed therein, and the granule exhibits excellent friability when compressed to form a pharmaceutical composition. The subject matter disclosed herein is also directed to methods of preparing the granules and the pharmaceutical compositions comprising the granules. The compositions and methods disclosed provide granules and pharmaceutical compositions for immediate release of the active agent and do not substantially prolong the release of the active agent from the granule. | 2014-09-18 |
20140275243 | PHENYL CARBAMATE COMPOUNDS FOR USE IN PREVENTING OR TREATING PEDIATRIC EPILESY AND EPILESY-RELATED SYNDROMES - The present invention provides a pharmaceutical composition for preventing and/or treating a pediatric epilepsy or epilepsy-related syndrome comprising the phenyl carbamate compound as an active ingredient, and a use of the phenyl carbamate compound for preventing and/or treating pediatric epilepsy or pediatric epilepsy-related syndromes. | 2014-09-18 |
20140275244 | Treatment of Cataplexy - The present invention relates to a method of treating cataplexy in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of certain carbamate compounds. | 2014-09-18 |
20140275245 | BICYCLIC ANALGESIC COMPOUNDS - Analgesic compounds for treatment of pain or fever, comprising a bicyclopentane moiety linked to an amine, combinations of the compounds with opioid analgesic drugs, and methods for treating pain or fever by administering the compounds. | 2014-09-18 |
20140275246 | RACECADOTRIL LIPID COMPOSITIONS - A lipid composition comprising racecadotril, at least one surfactant and a lipid. | 2014-09-18 |
20140275247 | COMPOSITIONS AND METHODS FOR THE TREATMENT OF INFLAMMATION - The invention relates to novel resolvin compounds and pharmaceutical preparations thereof. The invention further relates to methods of treatment using the novel resolvin compounds of the invention. | 2014-09-18 |
20140275248 | TREATMENT OF MOLLUSCUM CONTAGIOSUM - Methods for treating molluscum contagiosum warts include identifying a human with one or more molluscum contagiosum warts and applying an anti-infective composition to the one or more warts. The anti-infective composition comprises at least one anti-infective agent in a liquid carrier, such as an organohalide. The liquid carrier includes a tissue penetrating component for rapid penetration of the anti-infective agent into the one or more molluscum contagiosum warts. Application of the anti-infective composition to molluscum contagiosum warts causes the warts to turn black and/or fall off the skin in less than about 5 days. | 2014-09-18 |
20140275249 | READY-TO-USE CO-SOLVENTS PHARMACEUTICAL COMPOSITION IN MODIFIED FLEXIBLE PLASTIC CONTAINER - A ready-to-use injectable, co-solvents (ternary mixture) pharmaceutical composition for the treatment of cardiac conditions and diagnosis applications, comprising methyl-3-[4-(2-hydroxy-3-isopropylamino) propoxy]phenylpropionate hydrochloride (Esmolol hydrochloride), a buffering agent, ethanol and propylene glycol which capable of been stored in modified flexible plastic container, heat-sterilized without deformation and/or integrity of the closure system been compromised, as well as method for its manufacture, is disclosed. | 2014-09-18 |
20140275250 | Methods of Administering Monomethyl Fumarate - Methods of therapeutic treatment using monomethyl fumarate are disclosed. | 2014-09-18 |
20140275251 | COMPOSITION FOR EXTERNAL USE ON SKIN FOR INFLAMMATORY DISEASES - [Problem] Provision of a composition for external use on skin that is safe to use and has an anti-inflammatory and anti-allergic actions. [Solution] A composition for external use on skin in the treatment of inflammatory disease which comprises dihomo-γ-linolenic acid (DGLA) as an active ingredient. The DGLA is preferably contained as a glyceride, a phospholipid, or an alkyl ester. The composition for external use contains DGLA in an amount of 0.1-50 wt %. | 2014-09-18 |
20140275252 | METHODS OF TREATING TRAUMATIC BRAIN INJURY - The present invention relates to, inter alia, pharmaceutical compositions comprising a polyunsaturated fatty acid and to methods of using the same to treat or prevent traumatic brain injuries. | 2014-09-18 |
20140275253 | COMPOSITIONS AND METHODS FOR TREATING OR PREVENTING OBESITY IN A SUBJECT IN NEED THEREOF - The present invention relates to, inter alia, pharmaceutical compositions comprising a polyunsaturated fatty acid and to methods of using the same to treat or prevent obesity. | 2014-09-18 |
20140275254 | PHARMACEUTICAL COMPOSITION FOR THE TREATMENT OF FUNGAL INFECTIONS - There is provided pharmaceutical compositions suitable for topical application to the nail for the treatment of nail diseases such as onychomycosis, comprising a urea-based component, a diol component, such as propylene glycol, an organic acid component, such as lactic acid, and a triol component, such a glycerol. There is further provided methods of improving the storage stability of a pharmaceutical composition suitable for topical application to the skin and/or nails comprising such urea-based components, diol components, organic acid components, and, optionally, an aqueous base, which method comprises adding a triol component, such a glycerol, to that composition prior to said storage. | 2014-09-18 |
20140275255 | ANTIVIRAL COMPOSITIONS AND METHODS FOR INACTIVATING NON-ENVELOPED VIRUSES USING ALKYL 2-HYDROXYCARBOXYLIC ACIDS - The present invention is directed to antiviral compositions that provide efficacy against non-envelope viruses such as noroviruses. The antiviral compositions comprise an alkyl 2-hydroxycarboxylic acid and an effective amount of a sulfonated surfactant. The composition may be used as a topical on human skin, as a hand sanitizer or as a hard surface cleaning composition. | 2014-09-18 |
20140275256 | Transepithelial Methods Of Using Gamma Aminobutyric Acid Compositions For Pain Relief - Disclosed are methods for alleviating, relieving, inhibiting, and eliminating acute or chronic pain in a patient suffering from such pain by contacting epithelial tissue of the patient with exogenous GABA (gamma-amino butyric acid). | 2014-09-18 |
20140275257 | N-ACETYL CYSTEINE COMPOSITIONS IN THE TREATMENT OF SYSTEMIC LUPUS ERYTHEMATOSUS - The described invention provides a method and kit for treating a lupus condition with N-acetyl-L-cysteine (NAC) compositions that improve lupus disease activity driven by a decrease in the activity of the mammalian target of rapamycin (mTOR). The compositions of the described invention is effective to: (1) reduce fatigue; (2) reduce cognitive/inattentive component of attention deficit and hyperactivity (ADHD) self-report scale (ASRS); (3) reduce inflammation, for example, as measured by the systemic lupus erythematosus disease activity index (SLEDAI), and the British Isles Lupus Assessment Group (BILAG) score; (4) modulate mitochondrial potential and (5) reduce T cell cycle dysfunction driven by a decrease in the activity of the mammalian target of rapamycin (mTOR) in patients suffering from systemic lupus erythematosus (SLE). | 2014-09-18 |
20140275258 | Chelation Suppository for Improved Drug Delivery - Described herein is a method of delivering drugs to the blood stream directly by absorption through cell membranes in the wall of the rectum from a rectal suppository comprising a glyceride based excipient More specifically, CaNa | 2014-09-18 |
20140275259 | Direct Lipid to Membrane Drug Delivery - Described herein is a method of delivering hydrophilic drugs directly from a hydrophobic carrier and/or excipient to absorbing cell membranes. More specifically, CaNa | 2014-09-18 |
20140275260 | Preparation Of Stable Pharmaceutical Dosage Forms - The invention provides a process for preparing stable, high API content, solid pharmaceutical dosage forms by direct compression or dry granulation, characterized in that the pharmaceutical tablets rapidly disintegrate in water or other aqueous solutions to produce a clear or almost clear solution. Also provided is a pharmaceutical carglumic acid tablet, which has improved manufacturing, dissolution, and stability properties, and is less expensive to produce, compared to the equivalent commercial product. | 2014-09-18 |
20140275261 | DICLOFENAC PARENTERAL COMPOSITIONS - The present application provides parenteral compositions of diclofenac or its pharmaceutically acceptable salt and methods for making and using such compositions. | 2014-09-18 |
20140275262 | SOLID FORMS OF TREPROSTINIL - There is provided individual polymorphic forms of treprostinil and pharmaceutical formulations comprising the same, methods of making and using the same | 2014-09-18 |
20140275263 | Microemulsion Topical Delivery Platform - Provided are pharmaceutical carriers suitable based on oil-in-water microemulsions and methods of making same. Also provided are pharmaceutical compositions comprising a carrier of the invention and a lipophilic active pharmaceutical ingredient (API), as well as methods for making same. The pharmaceutical compositions are particularly suitable for use in formulating lipophilic APIs for topical administration to the eye. Specifically included are pharmaceutical compositions comprising fenofibrate or fenofibric acid as API. Also provided is a method of treating a disease of the posterior segment of the eye. Also provided is a pharmaceutical composition comprising a compound represented by | 2014-09-18 |
20140275264 | SYNERGISTIC COMBINATIONS OF ORGANIC ACID USEFUL FOR CONTROLLING MICROOGANISMS IN INDUSTRIAL PROCESSES - The present invention provides a method of controlling bacterial contamination using synergistic interactions of antimicrobials. The invention utilizes a combination of organic acids where the combined antimicrobial effect is synergistic. | 2014-09-18 |
20140275265 | THERAPEUTIC CREAM FOR APPLICATION TO SKIN - A stable, efficacious therapeutic cream comprising a non-steroidal anti-inflammatory drug (NSAID) is disclosed. | 2014-09-18 |
20140275266 | PROSTANOID RECEPTOR AGONIST COMPOUNDS AND METHODS OF USE FOR SAME - Embodiments described herein are directed to prostanoid (IP) receptor agonist compounds, including cicaprost and certain prodrugs, and methods of preparation and use for the same. Certain embodiments are directed to the use of cicaprost and certain prodrugs in the treatment of topical and ocular conditions. | 2014-09-18 |
20140275267 | METHODS AND COMPOSITIONS FOR CLEANING AND DISINFECTING SURFACES - This application relates to methods and compositions for cleaning and disinfecting unclean surfaces that are contaminated, typically with bacteria, viruses, yeast and molds. Broadly speaking contaminated surfaces includes hard and soft surfaces such as those found in household environments, in industrial environments, and hospitals, as well as surfaces of food products such as fruits, vegetables and meat. Further, the compositions can be prepared with naturally occurring components that are classified as generally considered as safe (GRAS) by the US FDA and/or comply with National Organic Production (NOP) standards of the USDA and can therefore be used in situations where such a classification is required such as organic food production. | 2014-09-18 |
20140275268 | NOVEL SOLID FORMS OF TACEDINALINE - Novel solid forms of tacedinaline (4-(acetylamino)-N-(2-aminophenyl)benzamide), including crystalline tacedinaline Form B, a novel crystalline tacedinaline TFA salt, and amorphous tacedinaline, are disclosed. Pharmaceutical compositions comprising crystalline tacedinaline Form B, the novel crystalline tacedinaline TFA salt, and/or amorphous tacedinaline, and methods of treating various conditions by administering those novel solid forms, are also disclosed. | 2014-09-18 |
20140275269 | Composition of 5-Nitrobenzoate Derivatives as Anti-Metastatic Agent that Inhibits Tumor Cell-Induced Platelet Aggregation - Disclosed are 5-nitrobenzoate derivatives of Formula I, | 2014-09-18 |
20140275270 | Isolated Stereoisomeric Forms Of (S)2-N(3-O-(Propan 2-Ol)-1-Propyl-4-Hydroxybenzene)-3-Phenylpropylamide - Isolated stereoisomeric forms of the compound (S)2-N(3-O-(propan 2-ol)-1-propyl-4-hydroxybenzene)-3-phenylpropylamide and uses in the treatment of pain. | 2014-09-18 |
20140275271 | NOVEL MODIFIED CURCUMINS AND THEIR USES - This invention provides a compound having the structure | 2014-09-18 |
20140275272 | PROSTAMIDES FOR ENHANCEMENT OF LEPTIN PRODUCTION - Prostamides such as bimatoprost and its pro-drugs for enhancement of leptin production and appetite suppression. | 2014-09-18 |
20140275273 | N-Substituted Benzenepropanamide and Benzenepropenamide For Use in the Prevention or the Treatment of Affective Disorders - Compounds for use in the treatment or prophylaxis of an affective disorder, which compound is represented by formula I in which the dotted line represents a single or a double bond; and R | 2014-09-18 |
20140275274 | SYNERGISTIC OPHTHALMIC COMPOSITIONS FOR DISINFECTING CONTACT LENSES - Compositions and methods for disinfecting contact lenses using the compositions are disclosed. The compositions include a combination of alexidine and chlorhexidine, which surprisingly causes the composition to exhibit synergistic antimicrobial activity against | 2014-09-18 |
20140275275 | Chlorhexadine Antiseptic - A composition comprising a mixture of chlorohexidine, a surfactant, and a cationic quaternary ammonium compound is suitable for use as an antiseptic and is surprisingly effective against difficult-to-kill organisms such as | 2014-09-18 |
20140275276 | PHARMACEUTICAL COMPOSITION OF S-KETAMINE HYDROCHLORIDE - The present invention is directed to an aqueous formulation of S-ketamine hydrochloride, preferably for nasal administration, wherein the formulation does not contain an antimicrobial preservative. | 2014-09-18 |
20140275277 | PHARMACEUTICAL COMPOSITION OF S-KETAMINE HYDROCHLORIDE - The present invention is directed to an aqueous formulation of S-ketamine hydrochloride, preferably for nasal administration, wherein the formulation does not contain an antimicrobial preservative. | 2014-09-18 |
20140275278 | PHARMACEUTICAL COMPOSITION OF S-KETAMINE HYDROCHLORIDE - The present invention is directed to an aqueous formulation of S-ketamine hydrochloride, preferably for nasal administration, wherein the formulation does not contain an antimicrobial preservative. | 2014-09-18 |
20140275279 | CYSTEAMINE IN THE TREATMENT OF FIBROTIC DISEASE - Fibrotic diseases are characterized by the replacement of healthy tissue with scar tissue and extracellular matrix in response to tissue damage. Here we describe the reduction of extracellular matrix (ECM) deposition, interstitial fibroblasts, interstitial volume, expression of Collagen I mRNA and protein, expression of profibrotic cytokines and macrophage infiltration by Cysteamine treatment. | 2014-09-18 |
20140275280 | Therapeutic uses of geranylgeranyl acetone and derivatives thereof - Provide herein are methods of treating inflammatory bowel disease with geranylgeranyl acetone (GGA) and/or derivatives thereof. Also provided are methods of treating chronic liver disease (CLD) with geranylgeranyl acetone (GGA) and/or derivatives thereof. Still further are provided methods for treating other hepatic and cardiac disorders. | 2014-09-18 |
20140275281 | Geranylgeranyl acetone and derivatives thereof for intranasal administration - Provide herein are intranasal compositions which include geranylgeranyl acetone (GGA) and/or derivatives thereof and methods for treating a neural disease, disorder or condition with the same. | 2014-09-18 |
20140275282 | Treating osteopenia and related disorders with geranylgeranyl acetone and derivatives thereof - Provide herein are methods for treating osteopenia with geranylgeranyl acetone (GGA) and derivatives thereof and compositions useful for the same. | 2014-09-18 |
20140275283 | Product and Method for Improving Bioavailability of Therapeutic Compounds - Disclosed is a method for improving the bioavailability of a variety of compounds such as phenolic acids, polyphenols, hydroxyl-cinnamic acids, curcumin, curcumin analogs, curcuminoids, etc., using milk protein concentrate and/or similar milk protein products. | 2014-09-18 |
20140275284 | DIPHENYL SUBSTITUTED CYCLOHEXANE DERIVATIVES, USEFUL AS MODULATORS OF THE ESTROGEN RECEPTORS BETA - Disclosed herein are novel di-aromatic compounds of the general formula (I). Also pharmaceutical compositions comprising the novel compounds and the use of the novel compounds in treatment and prevention of diseases and disorders related to estrogen receptors are disclosed. Furthermore, methods for treating and preventing diseases and disorders related to estrogen receptors by administration of the novel compounds are disclosed. | 2014-09-18 |
20140275285 | METADICHOL.RTM. LIQUID AND GEL NANOPARTICLE FORMULATIONS - The present invention provides methods of regulating physiological and metabolic parameters and of treating diseases by administering metadichol to a subject in need of such regulation and/or treatment. Metadichol can be administered as a liquid or gel formulation. | 2014-09-18 |
20140275286 | RHEOLOGICAL MOLECULAR REBAR - In various embodiments a carbon nanotube molecular rebar formulation comprising a specific composition is disclosed. The composition comprises discrete carbon nanotubes that have at least a portion of the carbon nanotubes with a number average (ratio of number average contour length to end to end length) of greater than 1.1 and up to about 3. These discrete carbon nanotubes having the specified ratio of number average (tube contour length (TCL) to number average tube end-end length) ratio are not only discrete (separated) from one another, but are also controlled in their alignment such that processability and mechanical strength properties are both enhanced. Utility of the molecular rebar composition includes, but is not limited to improved composites, engineered materials, foams, sealants, coatings and adhesives, energy devices such as photovoltaics, batteries and capacitors, sensors and separation membranes. | 2014-09-18 |
20140275287 | Compositions and Methods for Hemostasis - The present invention relates to water soluble and completely absorbable and/or physiologically degradable hemostatic compositions having a wax or wax-like base effective for use in tamponade hemostasis of bone or cartilage. | 2014-09-18 |
20140275288 | PHOTOLABILE LATEX FOR THE RELEASE OF PERFUMES - The present invention relates to the field of perfumery. More particularly, it concerns co-polymeric latex particles derived from 2-oxo-2-(3- or 4-vinylphenyl)acetates capable of liberating an active molecule such as, for example, an aldehyde or ketone upon exposure to light. The present invention concerns also the use of said latex in perfumery as well as the perfuming compositions or perfumed articles comprising the invention's latex. | 2014-09-18 |
20140275289 | CONCENTRATE FOR FORMING WATER-GEL EMULSION MATRIX AND KIT INCLUDING SAME - A kit and method for using the kit to make a water-based consumer product containing oil-soluble materials. The kit includes an ampoule containing an anhydrous concentrate including a polymer dispersed with a binding agent containing a surfactant, and zero or more oil soluble ingredients. The polymer preparation preferably is between about 8% and about 50% by weight of the concentrate, and the polymer preparation is configured to be between preferably about 1% and about 5%, by weight, of the consumer product. The method may include the steps of opening the ampoule, depositing the contents of the ampoule into a container, adding a predetermined amount of water to the container, closing the container, and agitating the container for a predetermined amount of time. The ampoule preferably is airtight and opaque, preventing degradation of the active ingredients within the ampoule. | 2014-09-18 |
20140275290 | ECM IMPLANT COMPOSITIONS AND METHODS - Described our medical compositions and methods including a particulate extracellular matrix tissue in admixture with sugar. Such medical compositions, in dried forms, can demonstrate enhanced rehydration properties. Medical compositions and products as described herein find particular use in treating diseased and/or damaged tissue, such as wound repair. Related methods of manufacture and use are also described. | 2014-09-18 |
20140275291 | BIOCOMPATIBLE AND BIOABSORBABLE DERIVATIZED CHITOSAN COMPOSITIONS - The invention relates to biocompatible, bioabsorbable derivatized non-crosslinked chitosan compositions optionally crosslinked to gelatin/collagen by 1-ethyl-3-[3-dimethylaminopropyl]carbodiimide hydrochloride (EDC) for biomedical use and methods of making and testing such compositions, including a modified acute systemic toxicity test. The compositions comprise derivatized chitosan reacetylated to a degree of N-deacetylation (DDA) of between about 15% and 40%. The compositions are typically bioabsorbed in about 90 days or less and can be made to bioabsorb at differing rates of speed. The compositions are initially soluble in aqueous solution below pH 6.5. The compositions have an acid content that can be adjusted between about 0% (w/w) and about 8% (w/w) to customize the composition for uses that require and/or tolerate differing levels of cytotoxicity, adhesion, composition cohesion, and cell infiltration into the composition. | 2014-09-18 |
20140275292 | SYSTEMS AND METHODS EMPLOYING HUMAN STEM CELL MARKERS FOR DETECTION, DIAGNOSIS AND TREATMENT OF CIRCULATING TUMOR CELLS - The invention relates to systems and methods to detect circulating tumor cells in a blood sample obtained from a cancer patient. Further, this invention relates to systems and methods to determine a diagnosis or prognosis of aggressive and metastatic cancer by determining the presence and/or level of circulating tumor cells in a blood sample obtained from a cancer patient. The detection and diagnosis is based on the presence or absence of cells that express podocalyxin and/or TRA biomarkers. | 2014-09-18 |
20140275293 | MEASUREMENT AND ANALYSIS OF MOLECULAR INTERACTIONS - The present invention relates to methods for measuring molecular interactions in a viscoelastic material, as well as related products and kits. The methods involve, for instance, taking multiple pressure measurements in the viscoelastic material and calculating the complex modulus from the pressure measurements to produce the measurement of viscoelastic properties in the viscoelastic material. Also included in the invention are methods and systems for detecting molecular interactions in vivo. | 2014-09-18 |
20140275294 | DEVICES AND METHODS FOR BIOMARKER DETECTION PROCESS AND ASSAY OF LIVER INJURY - An in vitro diagnostic (IVD) device is used to detect the presence of and/or severity of liver injury in a subject. The IVD device relies on an immunoassay which identifies biomarkers that are diagnostic of liver injury in a biological sample, such as whole blood, plasma, serum. The inventive IVD device may measure one or more of several specific markers in a biological sample and output the results to a machine readable format wither to a display device or to a storage device internal or external to the IVD. | 2014-09-18 |
20140275295 | METHOD FOR TREATING TYPE I AND TYPE II DIABETES - The present disclosure relates generally to alpha-helix mimetic structures and specifically to alpha-helix mimetic structures that are inhibitors of β-catenin. The disclosure also relates to applications in the treatment of diabetes and diabetic conditions such as diabetic neuropathy, and pharmaceutical compositions comprising such alpha helix mimetic β-catenin inhibitors. | 2014-09-18 |
20140275296 | Method and Apparatus for conversion of Carbonaceous Materials to Liquid Fuel - Embodiments of the invention relates to conversion of hydrocarbon material including but not limited to coal and biomass to a synthetic liquid transportation fuel. The invention includes the integration of a non-catalytic first reaction scheme, which converts carbonaceous materials into a solid product that includes char and ash and a gaseous product; a non-catalytic second reaction scheme, which converts a portion of the gaseous product from the first reaction scheme to light olefins and liquid byproducts; a traditional gas-cleanup operations; and the third reaction scheme to combine the olefins from the second reaction scheme to produce a targeted fuel like liquid transportation fuels. | 2014-09-18 |