32nd week of 2015 patent applcation highlights part 25 |
Patent application number | Title | Published |
20150218507 | METHOD FOR FREEZE DRYING A BACTERIA-CONTAINING CONCENTRATE - The present invention relates to a process for freeze drying a bacteria-containing concentrate. Further, the present invention relates to the freeze dried concentrates per se. | 2015-08-06 |
20150218508 | BIOREFINERY SYSTEM, METHODS AND COMPOSITIONS THEREOF - The present disclosure relates to bioengineering approaches for producing biofuel and, in particular, to the use of a C | 2015-08-06 |
20150218509 | CELL CULTURE MEDIUM - A cell culture medium with high content of choline chloride is provided. The cell culture media further comprise only moderate amounts of amino acids, in particular the amount of glutamine in the cell culture media is limited. The cell culture media can be used for large scale production of polypeptides using cell cultures. The cell culture media with high content of choline chloride are particularly suitable for fed-batch cell culture whereby cell viabilities stay at a higher level for a longer time and high polypeptide titers although limited amounts of amino acids are used. | 2015-08-06 |
20150218510 | Electroactive Scaffold - A method of manufacturing and/or using a scaffold assembly for stem cell culture and tissue engineering applications is disclosed. The scaffold at least partially mimics a native biological environment by providing biochemical, topographical, mechanical and electrical cues by using an electroactive material. The assembly includes at least one layer of substantially aligned, electrospun polymer fiber having an operative connection for individual voltage application. A method of cell tissue engineering and/or stem cell differentiation that uses the assembly seeded with a sample of cells suspended in cell culture media, incubates and applies voltage to one or more layers, and thus produces cells and/or a tissue construct. In another aspect, the invention provides a method of manufacturing the assembly including the steps of providing a first pre-electroded substrate surface; electrospinning a first substantially aligned polymer fiber layer onto the first surface; providing a second pre-electroded substrate surface; electrospinning a second substantially aligned polymer fiber layer onto the second surface; and, retaining together the layered surfaces with a clamp and/or an adhesive compound. | 2015-08-06 |
20150218511 | METHOD FOR NON-FREEZE LOW-TEMPERATURE PRESERVATION OF MAMMALIAN EMBRYO OR FERTILIZED EGG - Disclosed is a novel means which enables satisfactory preservation of embryos and fertilized eggs in the non-frozen state for a longer period than conventional means, which novel means also achieves high hatching ability and a high conception rate of the embryos after the preservation. The method for preserving a mammalian embryo(s) or fertilized egg(s) of the present invention comprises immersing a mammalian embryo(s) or fertilized egg(s) in a medium containing 20 to 80% (v/v) serum and 10 to 100 mM Good's buffer, and storing the embryo(s) or fertilized egg(s) at non-freezing low temperature. The preservative solution for a mammalian embryo(s) or fertilized egg(s) of the present invention essentially consists of a medium containing 20 to 80% (v/v) serum and 10 to 100 mM Good's buffer. The Good's buffer is preferably HEPES. | 2015-08-06 |
20150218512 | MESODERM AND DEFINITIVE ENDODERM CELL POPULATIONS - The present invention provides cell populations that are enriched for mesendoderm and mesoderm, and cell populations that are enriched for endoderm. The cell populations of the invention are useful for generating cells for cell replacement therapy. | 2015-08-06 |
20150218513 | HEPATOCYTE PREPARATIONS - Methods for preparing a variety of cell (e.g., hepatocyte) preparations and preparations so prepared are described. Uses of such preparations are described. In one embodiment, centrifugal elutriation is used to separate hepatocytes with preferred characteristics. Such hepatocyte preparations may be used for cryopreservation, multiple cryopreservations, in vitro assays, plating and other methods for which preparations of hepatocytes are useful. | 2015-08-06 |
20150218514 | PROMOTER OF DIFFERENTIATION FROM HEPATIC PROGENITOR CELL INTO HEPATIC CELL, AND USE THEREOF - The present invention provides a promoter of differentiation from a hepatic progenitor cell into a hepatocyte, which contains a substance that suppresses expression of Dnmt-1 or a substance that inhibits the function of Dnmt-1 as an active ingredient, and a method of producing a hepatocyte (preferably hepatocyte with high maturity) from a hepatic progenitor cell. | 2015-08-06 |
20150218515 | METHOD FOR PRODUCING A LEUKOCYTE PREPARATION, AND LEUKOCYTE PREPARATION - A method for preparing a leukocyte preparation from a leukocyte fraction and a correspondingly prepared or obtainable leukocyte preparation and its use. The method includes: a) sedimenting the leukocyte fraction removing leukocyte supernatant from the sediment, wherein the leukocyte supernatant is collected or remains in a leukocyte container, b) sedimenting the leukocytes in the leukocyte container, c) washing the sediment in the leukocyte container with a saline solution, and d) resuspending the sediment in the leukocyte container in a storage solution. | 2015-08-06 |
20150218516 | COMPOSITIONS AND METHODS FOR ENHANCING IMMUNE RESPONSES MEDIATED BY ANTIGEN-PRESENTING CELLS - Molecular adjuvants are disclosed comprising an antigen presenting cell-targeting ligand linked to an immunogen, e.g. tumor associated antigens, bacterial or viral antigens. The ligand and the immunogen are linked via a cleavable linker such as a protease-sensitive oligopeptide, to facilitate processing of the adjuvant by the antigen presenting cell. Methods are disclosed for delivery of these molecular adjuvants to patients, resulting in the transduction of activating signals to the targeted antigen presenting cell, thereby enhancing the immune response to the co-delivered immunogen. | 2015-08-06 |
20150218517 | MEMBRANE SEPARATION DEVICES, SYSTEMS AND METHODS EMPLOYING SAME, AND DATA MANAGEMENT SYSTEMS AND METHODS - A membrane separation device is disclosed along with systems and methods employing the device in blood processing procedures. In one embodiment, a spinning membrane separator is provided in which at least two zones or regions are created in the gap between the spinning membrane and the shell, such that mixing of the fluid between the two regions is inhibited by a radial rib or ridge associated with the spinning membrane that decreases the gap between the spinning membrane and the shell to define two fluid regions, the ridge isolating the fluid in the two regions to minimize mixing between the two. Automated systems and methods are disclosed for separating a unit of previously-collected whole blood into selected blood components, such as concentrated red cells and plasma, for collecting red cells and plasma directly from a donor in a single pass, and for cell washing. Data management systems and methods and priming methods are also disclosed. | 2015-08-06 |
20150218518 | INDUSTRIAL PREPARATION OF NATURAL KILLER CELLS (NKS) AND INJECTION USING HUMAN ALLO-GENEIC KARYOCYTES - Disclosed is an industrial preparation of natural killer cells (NKs) and an injection using human allogeneic karyocytes comprising: using umbilical cord blood and peripheral blood from legitimate sources as raw materials, obtaining stem cells by a method for extracting and separating karyocytes, or using Ficoll or percoll density gradient centrifugation to isolate and screen out karyocytes; diluting the above-mentioned karyocytes with cell culture medium, adding interferon, interleukin, CD3 antibody, and human albumin, loading them together into a bioreactor for perfusion culture, and then performing multiplication culture; the passage number of natural killer cells from multiplication culture is no less than 8, and the culture time is no less than 4 weeks; the markers of the natural killer cells obtained after the multiplication culture are CD3 | 2015-08-06 |
20150218519 | STEM CELL CULTURE MEDIUM AND METHOD OF USING SAID MEDIUM AND THE CELLS - The present invention relates to methods and compositions concerning isolation of proliferating cells. In particular, the invention regards enrichment of stem cells in a mixture of stem cells and non-stem cells, wherein the non-stem cells may be differentiated cells. The invention exploits the non-adherent property of stem cells, as opposed to the adherent property of differentiating cells, by serially passaging the suspended cells in liquid media. | 2015-08-06 |
20150218520 | HAIR FOLLICLE MESENCHYMAL STEM CELLS AND USE THEREOF - The present invention relates to a method for isolating hair follicle mesenchymal stem cells and to the use thereof for therapy and prophylaxis as well as for cosmetic treatments. | 2015-08-06 |
20150218521 | HIGH-SAFETY PROCESS FOR THE PREPARATION OF PURIFIED STEM CELL FRACTIONS - A highly safe procedure for the preparation of purified stem cell fractions of lipid origin is herein described, in which the use of a specially designed single collecting device, reduces the number of passages and manipulations undergone by stem cell-containing material, reducing to a minimum the risks of contamination, material loss, and inadvertent exchange of samples, and further simplifying the interface and cooperation between personnel recovering the raw material and those expert in stem cell isolation. | 2015-08-06 |
20150218522 | SC-BETA CELLS AND COMPOSITIONS AND METHODS FOR GENERATING THE SAME - Disclosed herein are methods, compositions, kits, and agents useful for inducing β cell maturation, and isolated populations of SC-β cells for use in various applications, such as cell therapy. | 2015-08-06 |
20150218523 | MANUFACTURE OF VASCULAR SMOOTH MUSCLE CELLS AND THE USE - A method for preparing brain-specific vascular smooth muscle cells comprising the step of: (a) contacting a population of stem cells with a composition comprising a bone morphogenetic protein (BMP) antagonist, a fibroblast growth factor (FGF) and an activin or nodal inhibitor to produce a population of neural crest cells. | 2015-08-06 |
20150218524 | NANOPARTICLE SYNTHESIS USING PLANT EXTRACTS AND VIRUS - There is described a process for production of metal-coated virus particles or metallic nanoparticles, said process comprising admixing virus particles with plant material with reducing power and a metal salt, wherein the process can be provided in planta or ex planta and the virus particles aid the production of the metal-coated virus particles or metallic nanoparticles. | 2015-08-06 |
20150218525 | HUMAN EBOLA VIRUS SPECIES AND COMPOSITIONS AND METHODS THEREOF - Compositions and methods including and related to the Ebola | 2015-08-06 |
20150218526 | DOWN-REGULATION OF A POLYNUCLEOTIDE ENCODING A SOU2 SORBITOL UTILIZATION PROTEIN TO MODIFY LIPID PRODUCTION IN MICROBIAL CELLS - Recombinant microbial cells are disclosed herein that comprise (i) a down-regulation of an endogenous polynucleotide sequence encoding Sou2 sorbitol utilization protein, and (ii) a polyunsaturated fatty acid (PUFA) biosynthetic pathway. The down-regulation of the polynucleotide sequence encoding Sou2 sorbitol utilization protein can increase the lipid content of the microbial cells and/or decrease the total amount of sugar alcohols produced by the microbial cells. Also disclosed are methods of using the recombinant microbial cells to produce oil containing omega-3 polyunsaturated fatty acids such as EPA. | 2015-08-06 |
20150218527 | BIOCATALYSTS FOR EZETIMIBE SYNTHESIS - The present disclosure relates to non-naturally occurring polypeptides useful for preparing Ezetimibe, polynucleotides encoding the polypeptides, and methods of using the polypeptides. | 2015-08-06 |
20150218528 | USE OF THE REDUCTIVE GLYCINE PATHWAY FOR GENERATING FORMATOTROPHIC AND AUTOTROPHIC MICROORGANISMS - An isolated microorganism that expresses enzymes of the reductive glycine pathway is disclosed. The microorganism is capable of converting formate to pyruvate or glycerate via the formation of glycine and serine. Methods of generating same are further described. | 2015-08-06 |
20150218529 | Polypeptides Having Peroxygenase Activity - The present invention relates to isolated polypeptides having peroxygenase activity, and polynucleotides encoding the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the polynucleotides as well as methods of producing and using the polypeptides. A polynucleotide encoding a peroxygenase was isolated from | 2015-08-06 |
20150218530 | Compositions and Methods for Oxygenation of Nucleic Acids Containing 5-Methylpyrimidine - 5-methylpyrimidine oxygenases and their use in the modification of nucleic acids are described. | 2015-08-06 |
20150218531 | VARIANT LovD POLYPEPTIDE - The invention disclosed herein relates to methods and materials for producing simvastatin and related compounds such as huvastatin. In particular, the disclosure teaches that variants of the LovD acyltransferase polypeptide can be engineered to exhibit properties that facilitate their use in the production of simvastatin and/or huvastatin. The materials and processes disclosed herein are designed so that fermentation facilities currently producing lovastatin can be converted to producing simvastatin and related compounds with minimal modifications. | 2015-08-06 |
20150218532 | Modified Glucansucrase and Related Methods - Disclosed is a genetically modified enzyme belonging to glycosyltransferases type of glucansucrase comprising at least one mutation at position 654 of said enzyme, wherein modified enzyme is capable to producing a glucan polymer. | 2015-08-06 |
20150218533 | STEVIOL GLYCOSYLTRANSFERASE AND GENE ENCODING SAME - The present invention provides steviol glycosyltransferase and a method for producing a steviol glycoside using this enzyme. The present invention provides a transformant transformed with a gene for steviol glycosyltransferase and a method for preparing such a transformant. | 2015-08-06 |
20150218534 | MODIFIED DNA POLYMERASE - A modified DNA, polymerase belonging to family B that is not inhibited by dUTP is provided. | 2015-08-06 |
20150218535 | Recombinant Polymerases With Increased Phototolerance - Provided are compositions comprising recombinant DNA polymerases that include amino acid substitutions, insertions, deletions, and/or exogenous features that confer modified properties upon the polymerase for enhanced single molecule sequencing. Such properties include increased resistance to photodamage, and can also include enhanced metal ion coordination, reduced exonuclease activity, reduced reaction rates at one or more steps of the polymerase kinetic cycle, decreased branching fraction, altered cofactor selectivity, increased yield, increased thermostability, increased accuracy, increased speed, increased readlength, and the like. Also provided are nucleic acids which encode the polymerases with the aforementioned phenotypes, as well as methods of using such polymerases to make a DNA or to sequence a DNA template. | 2015-08-06 |
20150218536 | NUCLEIC ACID MODIFYING ENZYMES - This invention provides for an improved generation of novel nucleic acid modifying enzymes. The improvement is the fusion of a sequence-non-specific nucleic-acid-binding domain to the enzyme in a manner that enhances the ability of the enzyme to bind and catalytically modify the nucleic acid. | 2015-08-06 |
20150218537 | DNA POLYMERASES AND RELATED METHODS - Disclosed are mutant DNA polymerases having improved extension rates relative to a corresponding, unmodified polymerase. The mutant polymerases are useful in a variety of disclosed primer extension methods. Also disclosed are related compositions, including recombinant nucleic acids, vectors, and host cells, which are useful, e.g., for production of the mutant DNA polymerases. | 2015-08-06 |
20150218538 | Methods and Compositions for Modulating G-Alpha-Q Signaling - The present invention provides compositions and methods for modulating G-alpha-q activity and methods of screening of test substances for the ability to modulate G-alpha-q activity. | 2015-08-06 |
20150218539 | METHODS OF USING THE CALCINEURIN A VARIANT CNAB1 FOR THE TREATMENT OF CARDIAC HYPERTROPHY - The present invention relates to an activator of the calcineurin subunit A | 2015-08-06 |
20150218540 | METHODS AND COMPOSITIONS FOR TREATMENT OF MYOTUBULAR MYOPATHY USING CHIMERIC POLYPEPTIDES COMPRISING MYOTUBULARIN 1(MTM1) POLYPEPTIDES - The present invention provides chimeric polypeptides comprising myotubularin 1 (MTMI) polypeptides and an internalising moiety, wherein, the moiety can be an antibody, and is preferably monoclonal antibody 3E10, a functional variant or a fragment thereof. One aspect of the present invention provides compositions comprising these chimeric polypeptides together with a pharmaceutically acceptable carrier, and optionally, a further therapeutic agent. Another aspect of the present invention provides methods of treating Myotubular Myopathy comprising administering the polypeptides or compositions comprising the polypeptides to a subject in need. | 2015-08-06 |
20150218541 | VARIANT ENDOGLUCANASES AND RELATED POLYNUCLEOTIDES - The invention provides variants of the | 2015-08-06 |
20150218542 | Polypeptides Having Cellobiohydrolase I Activity and Polynucleotides Encoding Same - The present invention relates to polypeptides having cellobiohydrolase I activity and polynucleotides having a nucleotide sequence which encodes for the polypeptides. The invention also relates to nucleic acid constructs, vectors, and host cells comprising the nucleic acid constructs as well as methods for producing and using the polypeptides. | 2015-08-06 |
20150218543 | IONIC LIQUID-TOLERANT CELLULASE ENZYMES - The present invention provides ionic liquid-tolerant cellulases and method of producing and using such cellulases. The cellulases of the invention are useful in saccharification reactions using ionic liquid treated biomass. | 2015-08-06 |
20150218544 | COMPANION DIAGNOSTIC FOR ANTI-HYALURONAN AGENT THERAPY AND METHODS OF USE THEREOF - Methods and diagnostic agents for identification of subjects for cancer treatment with an anti-hyaluronan agent, such as a hyaluronan-degrading enzyme, are provided. Diagnostic agents for the detection and quantification of hyaluronan in a biological sample and monitoring cancer treatment with an anti-hyaluronan agent, for example a hyaluronan-degrading enzyme, are provided. Combinations and kits for use in practicing the methods also are provided. | 2015-08-06 |
20150218545 | Protease Variants - The present invention relates to proteases having at least 75% identity to a protease derived from | 2015-08-06 |
20150218546 | NOVEL PEPTIDES THAT BIND TO TYPES OF MHC CLASS II AND THEIR USE ON DIAGNOSIS AND TREATMENT - It is provided novel peptides from human alpha-enolase, collagen type II and vimentin that bind to types of MHC class II that is associated with rheumatoid arthritis. There is also provided novel therapies and methods for diagnosis of rheumatoid arthritis. | 2015-08-06 |
20150218547 | Cell Line, System and Method for Optical Control of Secondary Messengers - A variety of methods, devices and compositions are implemented for light-activated molecules. One such method is implemented for generating secondary messengers in a cell. A nucleotide sequence for expressing a chimeric light responsive membrane protein (e.g., rhodopsin) is modified with one or more heterologous receptor subunits {e.g., an adrenergic receptor (alpha1, Beta2)}. The light responsive membrane protein is expressed in a cell for producing a secondary messenger in response to light. | 2015-08-06 |
20150218548 | METHOD AND DEVICE FOR PLANKTON SEPARATION - Methods, devices and kits for the physical separation of plankton into its component parts utilizing phototactic behavior are described. The methods utilize positive phototactic behavior and negative contrast orientation of the zooplankton for maximal in situ separation of phytoplankton and zooplankton for use in further studies and evaluation of separation efficiency. The devices provide effective conditions for use in the separation of plankton into component parts. | 2015-08-06 |
20150218549 | ELECTROPHYSIOLOGICALLY MATURE CARDIOMYOCYTES AND METHODS FOR MAKING SAME - Methods to prepare electrophysiology mature cells from immature cells are provided, without the need for genetic manipulation. | 2015-08-06 |
20150218550 | METHOD FOR ISOLATING TOTAL RNA FROM CELLS - Provided herein are methods for isolating cellular ribonucleic acid (RNA) from cells. The method includes suspending cells in an extraction solution comprising formamide; incubating the cells and formamide mixture; and pelleting cell debris, DNA, and protein to form an RNA-containing supernatant. Also provided herein are kits for isolating RNA and solutions for extracting RNA from a cell. | 2015-08-06 |
20150218551 | ENHANCED RAPID IMMUNOGEN SELECTION METHOD FOR HIV GP120 VARIANTS - The invention relates to an enhanced method for rapid immunogen selection (RIS) based on the binding a library of recombinant viruses containing randomized variants of a surface polypeptide displayed to said neutralizing antibodies. The invention relates as well to the use of the immunogens isolated according to the RIS method of the invention in medicine for the treatment of diseases caused by a virus and in diagnosis for the identification of neutralizing antibodies in a patient. | 2015-08-06 |
20150218552 | RNAI BASED SELECTION SYSTEM - The present invention provides a novel RNAi based selection system for selecting host cells that have incorporated an expression vector. | 2015-08-06 |
20150218553 | Screening Polynucleotide Libraries For Variants That Encode Functional Proteins - The present invention provides methods based on screening expressed polynucleotide libraries for soluble proteins. | 2015-08-06 |
20150218554 | ARTIFICIAL NUCLEIC ACID MOLECULES FOR IMPROVED PROTEIN OR PEPTIDE EXPRESSION - The invention relates to an artificial nucleic acid molecule comprising at least one 5′UTR element which is derived from a TOP gene, at least one open reading frame, and preferably at least one histone stem-loop. Optionally the artificial nucleic acid molecule may further comprise, e.g. a poly(A)sequence, a poyladenylation signal, and/or a 3′UTR. The invention further relates to the use of such an artificial nucleic acid molecule in gene therapy and/or genetic vaccination. | 2015-08-06 |
20150218555 | SYNTHETIC PROMOTER FOR MODULATING GENE EXPRESSION - The present invention provides nucleic acid constructs, expression vectors, transgenic cell and methods of making and using the same, wherein the nucleic acid construct includes a synthetic promoter designed using selected PDX-1 activation sites such as those observed in the human insulin promoter (HIP). In illustrative working embodiments of the invention, an exogenous nucleic acid fragment encoding thymidine kinase is operably linked to the synthetic promoter which is then shown to regulate the expression of this polypeptide. | 2015-08-06 |
20150218556 | COMPOSITIONS AND METHODS FOR TREATING PERIPHERAL ARTERIAL DISEASE - The present application discloses roles for miR-93 in treating hypoxia and ischemia. Endothelial cells (HUVEC) and myocytes (C2C12) expressed miR-93 and up-regulated miR-93 in response to hypoxia and serum starvation. Over-expression of miR-93 in HUVECs promoted cell proliferation, prevented hypoxia-induced apoptosis, and enhanced endothelial cell tube formation. miR-93 knockdown in HUVECs resulted in increased hypoxia-induced apoptosis and decreased tube formation. Over-expression or knockdown of miR-93 in myocytes resulted in reduced or increased hypoxia-induced apoptosis, respectively. Down-regulation of miR-93 in C57BL/6 mice with antagomiR resulted in attenuated perfusion recovery (% non-ischemic leg at day-21: Scramble 85.22.9 vs. AntagomiR-93 67.96). Over-expression of miR-93 in BALB/C mice improved perfusion recovery (% non-ischemic leg at day 21: PremiR-93 757.5 vs. Scramble 59.62.5). The present invention encompasses the use of miR-93 and regulation of miR-93 to treat and prevent hypoxia, ischemia, and other injuries, diseases, disorders, and conditions associated with ischemia. | 2015-08-06 |
20150218557 | RNA SYNTHESIS-PHOSPHORAMIDITES FOR SYNTHETIC RNA IN THE REVERSE DIRECTION, AND APPLICATION IN CONVENIENT INTRODUCTION OF LIGANDS, CHROMOPHORES AND MODIFICATIONS OF SYNTHETIC RNA AT THE 3'-END - The present invention relates to novel phosphoramidites, A-n-bz, C-n-bz, C-n-ac, G-n-ac and U are produced with an HPLC purity of greater than 98% and | 2015-08-06 |
20150218558 | MICRORNA COMPOUNDS AND METHODS FOR MODULATING MIR-21 ACTIVITY - Described herein are compositions and methods for the inhibition of miR-21 activity. The compositions have certain nucleoside modification patterns that yield potent inhibitors of miR-21 activity. The compositions may be used to inhibit miR-21, and also to treat diseases associated with abnormal expression of miR-21, such as fibrosis and cancer. | 2015-08-06 |
20150218559 | MODULATION OF EXON RECOGNITION IN PRE-MRNA BY INTERFERING WITH THE SECONDARY RNA STRUCTURE - The invention relates to oligonucleotides for inducing skipping of exon 53 of the dystrophin gene. The invention also relates to methods of inducing exon 53 skipping using the oligonucleotides. | 2015-08-06 |
20150218560 | COMPOSITIONS FOR MODULATING GENE EXPRESSION - Aspects of the invention provide methods for selecting a candidate oligonucleotide for activating expression of a target gene. Further aspects of the invention provide methods of selecting a set of oligonucleotides that is enriched in oligonucleotides that activate expression of a target gene. Further aspects provide single stranded oligonucleotides that modulate gene expression and compositions and kits comprising the same. Methods for modulating gene expression using the single stranded oligonucleotides are also provided. | 2015-08-06 |
20150218561 | Antisense Oligonucleotides (ODN) Against SMAD7 and Uses Thereof in Medical Field - The invention relates to antisense oligonucleotidic sequences (ODN) against Smad7 suitably modified, and their uses in medical field as therapeutic biological agents, in particular in the treatment of chronic inflammatory bowel disease, such as Crohn's disease and ulcerative colitis. | 2015-08-06 |
20150218562 | WOUND TREATMENT - The present invention concerns an isolated polynucleotide comprising a nucleotide sequence having substantial homology to any of the following nucleotide sequences: catcgttatgggacta (SEQ ID NO: 2), cattcttgatccttcc (SEQ ID NO: 1), cttttcaatctgactg SEQ ID NO: atgaaaatactcataa (SEQ ID NO: 5), gtgataaaagaaccat (SEQ ID NO: 10), gggttcatgaaagtga (SEQ ID NO: 11), gatgaccctcttatcc (SEQ ID NO: 8), tggaaggaatgtctgg (SEQ ID NO: 4), gcatctgcttccaaca (SEQ ID NO: 3), catcgttaggctagctacaacgatgggacta (SEQ ID NO: 9), tccaccaaggctagctacaacgaccatcaaa (SEQ ID NO: 12), gtcaacaaggctagctacaacgatgagctca (SEQ ID NO: 13), and cttttcaaggctagctacaacgactgactgt (SEQ ID NO: 6), and their use in the treatment of wounds. | 2015-08-06 |
20150218563 | COMPOSITIONS AND METHODS FOR MODULATION OF RORGAMMAT FUNCTIONS - The present invention relates to expression of RORγt in cells and tissues and the effect of expression of this gene on proliferation of specific immune cells and in promotion of immune cell aggregates and in induction of IL17 producing cells. Furthermore, the invention relates to methods and agents that may decrease function of the gene product (the protein) or expression of this gene in individuals experiencing an inflammatory condition, an autoimmune disease or a food allergy, or any other condition whereby it is desirable to inhibit an immune response. In addition, methods and agents useful for enhancing the function of RORγt with agonists or expression of this gene are also considered for use whereby it is desirable to increase immunity to a pathogen or tumor cell, for example, for use in conjunction with a vaccine. Screening methods for identifying novel modulators (antagonists and agonists) of RORγt are also disclosed. | 2015-08-06 |
20150218564 | METHOD FOR EXPRESSION OF SMALL ANTIVIRAL RNA MOLECULES WITH REDUCED CYTOTOXICITY WITHIN A CELL - In one aspect, the invention provides methods and compositions for the expression of small RNA molecules within a cell using a retroviral vector (FIG. | 2015-08-06 |
20150218565 | LINEAR VECTORS, HOST CELLS AND CLONING METHODS - Linear vectors derived from bacteriophage of | 2015-08-06 |
20150218566 | PROMOTERS FOR INCREASED PROTEIN EXPRESSION IN MENINGOCOCCUS - New promoters are described to drive transcription in meningococcus e.g. for over-expression of protein antigens for retention in membrane vesicles. Modified porA promoters lack the wild-type poly-G sequence which can cause phase variation. Meningococcal rRNA-coding genes (e.g. for 16S rRNA) can be used to drive transcription of a protein-coding gene. These approaches can be used in combination. | 2015-08-06 |
20150218567 | Bacterial Mutants with Improved Transformation Efficiency - Provided herein are | 2015-08-06 |
20150218568 | MODIFIED BIOLOGICAL CONTROL AGENTS AND THEIR USES - Methods for improving the ability of a population of biological agents to compete and survive in a field setting are provided. By improving the population of biological agents, the modified population of agents is able to grow, compete with other microbial strains and fungi, and provide protection for plants from pathogens. In particular, modified biological agents and modified populations of such agents that are herbicide tolerant or resistant are selected or engineered. In this manner, the protection from disease-causing agents is enhanced. Such modified populations of biological agents can be added to soils to prevent fungal pathogens and the diseases they cause promoting plant growth. Therefore, the present invention is useful for enhancing the competitiveness of modified biological agents particularly over other microbial agents which are not herbicide resistant. Compositions of the invention include selected or engineered herbicide resistant biological agents and modified populations of biocontrol agents. These modified biological agents can be used as an inoculant or as a seed coating for plants and seeds. | 2015-08-06 |
20150218569 | METHOD OF INTRODUCING NUCLEIC ACID INTO PLANT CELLS - The object of the present invention is to provide a method of introducing a nucleic acid into plant cells, which is simple and widely applicable to various types of plant cells and nucleic acids. The present invention relates to a method of introducing a nucleic acid into a target plant cell, comprising a step of forming a complex by bringing a carrier peptide, wherein the carrier peptide comprises a cell-penetrating sequence and a polycationic sequence, into contact with a nucleic acid and a step of bringing the obtained complex into contact with a target plant cell. | 2015-08-06 |
20150218570 | PLANT TRANSFORMATION METHOD USING PLANT GROWTH INHIBITING HORMONE - This invention provides a method of plant transformation via | 2015-08-06 |
20150218571 | Compositions and Methods for Biofuel Crops - Using the natural variation of sweet and grain | 2015-08-06 |
20150218572 | NOVEL REGULATORY SYSTEM FOR CONTROLLING GENE EXPRESSION IN PLANTS - The present invention relates to the regulation of transgene expression in plants through a transactivation system which comprises the following: (1) a promoter comprising LexA binding sites; and (2) a fusion transactivator protein comprising a LexA DNA-binding domain and an activation domain, such as the transactivation domain of a C-repeat binding factor protein. | 2015-08-06 |
20150218573 | GENERATION OF HERITABLE CHIMERIC PLANT TRAITS - The present invention provides methods and compositions for targeting enzymes involved in lignin or xylan biosynthesis using genome editing nucleases to specifically reduce content in a desired plant cell type(s). | 2015-08-06 |
20150218574 | PLANT PROMOTERS AND USES THEREOF - The invention concerns tools, methods and compositions for modifying plants and/or protein expression in plants. The invention concerns in particular transcriptional promoters enabling specific expression in the trichomes, constructs containing said promoters, and their uses for genetically modifying cells, seeds or plants. The invention also concerns methods for producing transgenic plants expressing proteins or metabolites of interest. The invention is generally applicable to any plant having glandular trichomes, and to the expression of any protein of industrial interest, in particular therapeutic or phytosanitary. | 2015-08-06 |
20150218575 | INCREASING LEVELS OF NICOTINIC ALKALOIDS IN PLANTS - Four genes, A622, NBB1, PMT, and QPT, can be influenced for increasing nicotinic alkaloid levels in | 2015-08-06 |
20150218576 | GENETIC MUTATIONS THAT DISRUPT DHURRIN PRODUCTION IN SORGHUM - Embodiments of the present invention relate generally to new forage crops and methods of creating new forage crops. For example, chemical mutagenesis is used to create mutant crops having desirable forage characteristics. In some embodiments, a mutant | 2015-08-06 |
20150218577 | SUCROSE TRANSPORTER GENES FOR INCREASING PLANT SEED LIPIDS - This invention relates to polynucleotide sequences encoding SUT2 or SUT4 sucrose transporter genes. Methods for increasing seed oil content and evaluating increased oil content in a plant seed are described. The compositions and methods disclosed herein employ a variety of sequences that encode sucrose transporters and a variety of sequences that influence fatty acid accumulation, including for example, DGAT, Lec1 and ODP1 transcription factor. In specific embodiments, overexpression of SUT2 and/or SUT4 sucrose transporters in combination with DGAT genes further increase plant seed oil production compared to a high oil plant comprising recombinant DNA constructs that do not overexpress SUT2 or SUT4 transporters. | 2015-08-06 |
20150218578 | METHODS OF INCREASING TOLERANCE TO HEAT STRESS AND AMINO ACID CONTENT OF PLANTS - The present invention provides methods of increasing tolerance to high temperature or heat stress in a plant, plant part, or plant cell, the method comprising introducing one or more nucleic acids encoding (i) a glutamine synthetase 1;2 (GS 1;2), (ii) a glutamate decarboxylase 3 (GAD3), (iii) a class I glutamine amidotransferase (GAT1), (iv) a MYB55 polypeptide or any combination thereof into a plant, plant part or plant cell. Also provided are methods of increasing amino acid content in a plant, plant part, or plant cell, the method comprising introducing one or more nucleic acids encoding (i) a GS1;2, (ii) a GAD3, (iii) a GAT1, (iv) a MYB55 polypeptide or any combination thereof into a plant, plant part or plant cell. | 2015-08-06 |
20150218579 | INCREASING PROTEIN YIELD IN PLANTS - A method of increasing the yield, stability, or both of an acid sensitive protein in a plant is provided. The method comprises introducing a first nucleic acid and a second nucleic acid into the plant, or portion of the plant. The first nucleic acid comprises a first regulatory region active in the plant and operatively linked to a nucleotide sequence encoding the acid sensitive protein. The second nucleic acid comprises a second regulatory region active in the plant and operatively linked to a nucleotide sequence encoding a channel protein, for example but not limited to a proton channel protein. The plant or portion of the plant is incubated under conditions that permit the expression of the nucleic acids, thereby increasing the yield of the acid sensitive protein when compared to the yield of the acid sensitive protein produced in the plant or portion of the plant produced under the same conditions, and in the absence of the proton channel protein. | 2015-08-06 |
20150218580 | WILD ROCKET VARIETIES 'BELLEZIA' AND 'LETIZIA' - New wild rocket varieties designated ‘Bellezia’ and ‘Letizia’ are described. ‘Bellezia’ and ‘Letizia’ are wild rocket varieties exhibiting stability and uniformity. | 2015-08-06 |
20150218581 | Use of OXHS4 Gene in Controlling Rice Drought Resistance - Rice OXHS4 gene controlling root growth and conferring enhanced drought resistance, and use thereof in genetic improvement of rice drought resistance is provided. OXHS4 gene is cloned using candidate gene screening method. Drought stress experiments at seedling stage and adult plant stage shows that overexpression of OXHS4 gene can improve drought resistance of transgenic rice, while the oxhs4 mutant exhibits sensitivity to drought, showing the function of said gene and the use thereof. | 2015-08-06 |
20150218582 | Fungal Resistant Plants Expressing RLK1 - The present invention relates to a method of increasing resistance against fungal pathogens of the order Pucciniales, preferably the family Phacopsoraceae, in plants and/or plant cells. This is achieved by increasing the expression of an RLK1 protein or fragment thereof in a plant, plant part and/or plant cell in comparison to wild type plants, wild type plant parts and/or wild type plant cells. Furthermore, the invention relates to transgenic plants, plant parts, and/or plant cells having an increased resistance against fungal pathogens, in particular, pathogens of the order Pucciniales, preferably the family Phacopsoraceae, and to recombinant expression vectors comprising a sequence that is identical or homologous to a sequence encoding an RLK1 protein. | 2015-08-06 |
20150218583 | AXMI-234 AND AXMI-235 DELTA-ENDOTOXIN GENES AND METHODS FOR THEIR USE - Compositions and methods for conferring pesticidal activity to bacteria, plants, plant cells, tissues and seeds are provided. Compositions comprising a coding sequence for a toxin polypeptide are provided. The coding sequences can be used in DNA constructs or expression cassettes for transformation and expression in plants and bacteria. Compositions also comprise transformed bacteria, plants, plant cells, tissues, and seeds. In particular, isolated toxin nucleic acid molecules are provided. Additionally, amino acid sequences corresponding to the polynucleotides are encompassed, and antibodies specifically binding to those amino acid sequences. In particular, the present invention provides for isolated nucleic acid molecules comprising nucleotide sequences encoding the amino acid sequence shown in SEQ ID NO:3-6, or the nucleotide sequence set forth in SEQ ID NO:1 or 2, as well as variants and fragments thereof. | 2015-08-06 |
20150218584 | EXPRESSION VECTORS COMPRISING CHIMERIC CYTOMEGALOVIRUS PROMOTER AND ENHANCER SEQUENCES - The present invention relates to expression vectors for the heterologous expression of a nucleic acid sequence of interest in mammalian cells, the vectors comprising a chimeric promoter regulatory sequence being operably linked to a nucleic acid sequence to be expressed, wherein the chimeric promoter regulatory sequence comprises a cytomegalovirus promoter sequence derived from murine cytomegalovirus or from human cytomegalovirus and being operably linked to the transcriptional start site of the nucleic acid sequence to be expressed; and a cytomegalovirus upstream region and/or enhancer sequence derived from human and/or the simian cytomegalovirus, wherein the upstream region and/or enhancer sequence is located 5′ of and operably linked to the murine or the human promoter sequence, and wherein the chimeric promoter regulatory sequence comprises sequence elements being derived from at least two of the group consisting of murine cytomegalovirus, human cytomegalovirus and simian cytomegalovirus. In particular embodiments, the chimeric promoter regulatory sequence comprises sequence elements derived from the murine or the human cytomegalovirus IE1 promoter and from the human and/or the simian cytomegalovirus IE1 region. The invention also relates to mammalian host cells transfected with such expression vectors, a method for heterologous expression of a nucleic acid sequence in a mammalian host cell by employing such expression vectors, and the use of such expression vectors for the heterologous expression of a nucleic acid sequence. | 2015-08-06 |
20150218585 | GENERATION OF INDUCED PLURIPOTENT STEM (iPS) CELLS - The present invention relates to a method of generating an induced pluripotent stem (iPS) cell comprising the step of introducing into a target cell one or two coding sequences each giving rise upon transcription to a factor that contributes to the reprogramming of said target cell into an induced pluripotent stem cell and selected from Oct3/4 or a factor belonging to the Myc, Klf and Sox families of factors, wherein the target cell endogenously expresses at least the factors that are not encoded by the coding sequences to be introduced and selected from Oct3/4 or factors belonging to the Myc, Klf and Sox families of factors, and wherein the cell resulting from the introduction of the one or two coding sequences expresses the combination of factor Oct3/4 and at least one factor of each family of factors selected from the group of Myc, Klf and Sox. Furthermore, the present invention relates to an induced pluripotent stem cell generated by the method of the invention and a method of identifying a compound that contributes to the reprogramming of a target cell into an induced pluripotent stem cell. Also, a method of generating a transgenic non-human animal and a composition comprising an iPS cell generated by the method of the present invention for gene therapy, regenerative medicine, cell therapy or drug screening are envisaged. | 2015-08-06 |
20150218586 | MINICIRCLES WITH VIRAL EXPRESSION CASSETTES AND THEIR USE IN THE TRANSFORMATION OF CELLS FOR GENERATING RECOMBINANT VIRUS OR VIRAL GENE VECTORS - The invention relates to a minicircle transfer vector for producing viral vectors comprising a transfer sequence and specific packing signals flanking both sides of the transfer sequence for packaging of the transfer sequence into particles of a viral vector. The invention also relates to minicircle packaging vectors carrying support functions for producing viral vectors. The invention further relates to cells bearing the disclosed minicircles. The invention further relates to methods for producing viral vectors using such minicircles and viral vectors obtained thereby, as well as kits useful in performing the described methods. | 2015-08-06 |
20150218587 | Genetic Material Manipulation and Cell Line Creation Techniques and Products Thereof - The presently claimed invention applies to a genetic material processing, manipulation and transfection method and related product. The claimed invention relates to a method for changing the inherited characteristics of a cell through micro-beam chromosome modification. In one preferred embodiment, improvements to ‘genomic surgery’ are applied to modify source cell genetic material ( | 2015-08-06 |
20150218588 | CYTOCHROME P450 AND USE THEREOF FOR THE ENZYMATIC OXIDATION OF TERPENES - The present invention provides the nucleic acid and the amino acid sequences of a cytochrome P450 capable of oxidizing terpene molecules. It also provides a method of oxidizing terpene molecules comprising contacting the cytochrome P450 of the invention with the terpene molecule intended to be oxidized. In particular, said method may be carried out in vitro or in vivo to produce oxidized terpene molecules, which may be used in different technical fields such as for example perfumery and flavoring. The present invention also provides an expression vector containing the nucleic acid. A non-human host organism or a cell transformed with the nucleic acid is also an object of the invention. | 2015-08-06 |
20150218589 | RECOMBINANT CELL, AND METHOD FOR PRODUCING BETA-PHELLANDRENE - To provide a series of techniques for obtaining β-phellandrene with high purity and in a large quantity. | 2015-08-06 |
20150218590 | ENHANCED PRODUCTION OF ISOPRENE USING HOST CELLS HAVING DECREASED ISPA ACTIVITY - This invention relates to recombinant microorganisms capable of producing isoprene and isoprene production with the use of such recombinant microorganism with good efficiency. In this invention, functional activity of the ispA gene is altered to reduce the production of isoprenoid molecules in recombinant cells engineered to produce isoprene or in cells otherwise susceptible to isoprenoid accumulation during fermentation. This decreased ispA gene functional activity enables enhanced synthesis of isoprene in a host microorganism. | 2015-08-06 |
20150218591 | COMPARTMENTALIZED ANAEROBIC DIGESTERS - An anaerobic digestion device includes a digester body with an opening through which organic waste is received and a digester drum removably inserted into the digester body for receiving the organic waste. The digester drum is movable relative to the digester body to advance a slurry of the organic waste along a length of the digester body. A set of ports spaced along the digester body and arranged to vent biogas from the organic waste contained in the digester drum. A storage vessel is configured to receive and store biogas received from the digester body via the ports, and a heating system configured to heat the digester body. The heating system is fuelled by the biogas vented from the digester body. | 2015-08-06 |
20150218592 | Method For Producing Ethanol From Biomass - Provided is a method for efficiently producing ethanol by ethanol fermentation from xylose using a saccharified biomass, which contains various fermentation inhibitors. A method for producing ethanol from biomass of the present invention includes the step of culturing a xylose-utilizing yeast transformed so as to overexpress a gene for an acetic acid -responsive transcription factor in combination with a saccharified biomass. | 2015-08-06 |
20150218593 | Polypetide with Reinforced Beta-Glucosidase Activity at Low Temperature - The invention relates to a polypeptide which has enhanced beta-glucosidase activity at a temperature of between about 30° C. and about 35° C. | 2015-08-06 |
20150218594 | CELL-FREE AND MINIMIZED METABOLIC REACTION CASCADES FOR THE PRODUCTION OF CHEMICALS - Provided are enzymatic processes for the production of chemicals like ethanol from carbon sources like glucose, in particular, a process for the production of a target chemical is disclosed using a cell-free enzyme system that converts carbohydrate sources to the intermediate pyruvate and subsequently the intermediate pyruvate to the target chemical wherein a minimized number of enzymes and only one cofactor is employed. | 2015-08-06 |
20150218595 | FERMENTATIVE PRODUCTION OF ALCOHOLS - The invention relates to the development of microorganisms capable of producing fermentation products via an engineered pathway in the microorganisms. The invention also relates to microorganisms with improved cell viability and methods to improve cell viability and cell productivity of a microorganism. | 2015-08-06 |
20150218596 | Yeast Organism Producing Isobutanol at a High Yield - The present invention provides recombinant microorganisms comprising an isobutanol producing metabolic pathway and methods of using said recombinant microorganisms to produce isobutanol. In various aspects of the invention, the recombinant microorganisms may comprise a modification resulting in the reduction of pyruvate decarboxylase and/or glycerol-3-phosphate dehydrogenase activity. In various embodiments described herein, the recombinant microorganisms may be microorganisms of the | 2015-08-06 |
20150218597 | USE OF THIAMINE AND NICOTINE ADENINE DINUCLEOTIDE FOR BUTANOL PRODUCTION - The invention relates generally to the field of industrial microbiology and alcohol production. More specifically, the invention relates to the use of thiamine, biosynthetic precursors of thiamine, nicotinic acid, nicotinamid, nicotinic acid riboside, nicotinamid riboside, or other biosynthetic precursors of nicotine adenine dinucleotide (NAD) to improve butanol production. Butanol production can be improved by providing sufficient amounts of thiamine, biosynthetic precursors of thiamine, nicotinic acid, nicotinamid, nicotinic acid riboside, nicotinamid riboside, or other biosynthetic precursors of nicotine adenine dinucleotide (NAD) in the production media. | 2015-08-06 |
20150218598 | SELECTIVE MICROBIAL PRODUCTION OF XYLITOL FROM BIOMASS BASED SUGAR STREAM WITH ENRICHED PENTOSE COMPONENT - The present invention utilizes yeast | 2015-08-06 |
20150218599 | METHODS FOR PRODUCTION OF ALCOHOLS FROM CARBOXYLIC ACIDS VIA FERMENTATION - Methods for obtaining a product comprising a substituted or unsubstituted C | 2015-08-06 |
20150218600 | BIOTECHNOLOGICAL PREPARATION OF 3-HYDROXYISOBUTYRIC ACID - The invention relates to a method comprising the steps a) providing isobutyric acid, b) bringing isobutyric acid into contact with the combination of isobutyrate kinase and phosphotransisobutyrylase and/or isobutyryl-coenzyme A synthetase/ligase and/or isobutyrate-coenzyme A transferase, c) bringing the product from step a) into contact with isobutyryl-coenzyme A dehydrogenase, d) bringing the product from step b) into contact with methacrylyl-coenzyme A hydratase, and e) hydrolyzing the product from step d) to form 3-hydroxyisobutyric acid, where at least one of the enzymes is used in the form of a cell which, compared to its wildtype, comprises a reduced activity of a 3-hydroxyisobutyric acid dehydrogenase or a variant thereof, a cell which has at least one enzyme from the group comprising isobutyryl-coenzyme A synthetase/ligase, isobutyrate-coenzyme A transferase, isobutyrate kinase, phosphotransisobutyrylase, isobutyryl-coenzyme A dehydrogenase, methacrylyl-coenzyme A hydratase and 3-hydroxyisobutyryl-coenzyme A hydrolase and, compared to its wildtype, a reduced activity of a 3-hydroxyisobutyric acid dehydrogenase or a variant thereof, wherein the cell preferably has, in addition, a monooxygenase, more preferably a monooxygenase of the alkBGT type or a variant thereof and the use of such a cell for preparing 3-hydroxyisobutyric acid. | 2015-08-06 |
20150218601 | MICROBIOLOGICAL PRODUCTION OF 3-HYDROXYISOBUTYRIC ACID - The present invention relates to a cell which has been modified in comparison with its wild type in such a way that it is capable of forming more, by comparison with its wild, 3-hydroxyisobutyric acid or polyhydroxyalkanoates based on 3-hydroxyisobutyric acid via methylmalonate-semialdehyde or 3-hydroxybutyryl-coenzyme A as precursors. The invention also relates to a method of generating a genetically modified cell, to the genetically modified cell obtainable by these methods, to a method of producing 3-hydroxyisobutyric acid or polyhydroxyalkanoates based on 3-hydroxyisobutyric acid, to a method of producing methacrylic acid or methacrylic esters, and to a method of producing polymethacrylic acid or polymethacrylic esters. The present invention furthermore relates to an isolated DNA, to a vector, to the use of this vector for transforming a cell, to a transformed cell, and to a polypeptide. | 2015-08-06 |
20150218602 | PROCESS FOR PRODUCING OPTICALLY ACTIVE 2-ALKYL-1,1,3-TRIALKOXYCARBONYLPROPANE - A process for producing an optically active 2-alkyl-1,1,3-trialkoxycarbonylpropane (2), comprising a step of asymmetric hydrolysis of 2-alkyl-1,1,3-trialokoxycarbonylpropane (1) by using an enzyme capable of selectively hydrolyzing an ester moiety of either one enantiomer of 2-alkyl-1,1,3-trialkoxycarbonylpropane (1), or by using a culture of a microorganism capable of producing the enzyme or a treated object thereof. | 2015-08-06 |
20150218603 | EUKARYOTIC MICROORGANISMS FOR PRODUCING LIPIDS AND ANTIOXIDANTS - Disclosed are compositions and methods related to eukaryotic microorganisms that can produce unsaturated fatty acids which can be purified and used. | 2015-08-06 |
20150218604 | Renewable Chemical Production from Novel Fatty Acid Feedstocks - Disclosed herein are methods of manufacturing renewable chemicals through the manufacture of novel triglyceride oils followed by chemical modification of the oils. Methods such as transesterification, hydrogenation, hydrocracking, deoxygenation, isomerization, interesterification, hydroxylation, hydrolysis and saponification are disclosed. Novel oils containing fatty acid chain lengths of C8, C10, C12 or C14 are also disclosed and are useful as feedstocks in the methods of the invention. | 2015-08-06 |
20150218605 | Method for Producing L-Amino Acid - A method for producing an L-amino acid using a fatty acid as the carbon source is provided. An L-amino acid is produced by culturing a | 2015-08-06 |
20150218606 | METHOD OF USING ALPHA-AMYLASE FROM ASPERGILLUS CLAVATUS AND PULLULANASE FOR SACCHARIFICATION - A fungal alpha amylase is provided from | 2015-08-06 |