30th week of 2018 patent applcation highlights part 26 |
Patent application number | Title | Published |
20180208890 | HAPLOID HUMAN EMBRYONIC STEM CELL LINES AND SOMATIC CELL LINES AND METHODS OF MAKING THE SAME - Haploid human embryonic stem cells and cell lines, haploid multipotent human cells, and haploid differentiated human cells are provided. In addition, methods of making and using the haploid human cells are provided. | 2018-07-26 |
20180208891 | STORAGE METHOD AND BANKING SYSTEM OF NT CELL - Provided are a storage method and a banking system of cells prepared using somatic cell nuclear transfer (NT) technology with homozygous genotypes of genes of human leukocyte antigen (HLA)-A, HLA-B, HLA-DR, and the like. The banking of NT cell-derived stem cells may be applied to autologous or allogenic patients and can provide transplantable cells and tissue materials for the treatment of various diseases such as diabetes, osteoarthritis, Parkinson's disease, and the like. | 2018-07-26 |
20180208892 | GENERATION OF HEPATOCYTES FROM PLURIPOTENT STEM CELLS - Methods are provided for producing differentiated cells from stem cells, including producing hepatocytes. Compositions thereof are also provided, as are methods of treating a liver disorder. | 2018-07-26 |
20180208893 | METHOD FOR INDUCING VASCULAR ENDOTHELIAL CELLS - Provided is a method for producing vascular endothelial cells from pluripotent stem cells, the method comprising the following steps (i) to (iii): (i) a step of culturing pluripotent stem cells in a culture medium comprising a BMP, on a culture vessel coated with a first matrix, to produce mesodermal progenitor cells; (ii) a step of dissociating the resulting cells into single cells; and (iii) a step of culturing the resulting cells in a culture medium comprising VEGF, on a culture vessel coated with a second matrix selected from the group consisting of laminin-411 or a fragment thereof, laminin-511 or a fragment thereof, Matrigel, type IV collagen and fibronectin. | 2018-07-26 |
20180208895 | METHOD FOR GENERATING T-CELL PROGENITORS - The invention relates to the field of cell therapy and to an in vitro method for generating T-cell progenitors, comprising the step of exposing CD34+ cells in a medium containing a Notch ligand, a soluble domain of the Delta-like ligand 4, joined to an Fc region of a protein IgG, in the presence of a fragment of fibronectin comprising the motifs RGDS and CS-1 and a heparin-binding domain. | 2018-07-26 |
20180208896 | METHOD FOR IN SITU INHIBITION OF REGULATORY T CELLS - The present invention pertains to engineered T-cells, method for their preparation and their use as medicament, particularly for immunotherapy. The engineered T-cells of the invention are designed to express both a Chimeric Antigen Receptor (CAR) directed against at least one antigen expressed at the surface of a malignant or infected cell, and a secreted inhibitor of regulatory T-cells (Treg). Preferably, such secreted inhibitor is a peptide inhibitor of forkhead/winged helix transcription factor 3 (FoxP3), a specific factor involved into the differentiation of T-cells into regulatory T-cells. The engineered T-cells of the invention direct their immune activity towards specific malignant or infected cells, while at the same time will prevent neighbouring regulatory T-cells from modulating the immune response. The invention opens the way to standard and affordable adoptive immunotherapy strategies, especially for treating or preventing cancer, and bacterial or viral infections. | 2018-07-26 |
20180208897 | SYNTHETIC MEMBRANE-RECEIVER COMPLEXES - Compositions comprising synthetic membrane-receiver complexes, methods of generating synthetic membrane-receiver complexes, and methods of treating or preventing diseases, disorders or conditions therewith. | 2018-07-26 |
20180208898 | Three-Dimensional Co-Culture Method for Adipocytes and Macrophages - Provided herein is a three-dimensional co-culture of adipocytes and macrophages, wherein, in a hydrogel scaffold containing adipocytes and macrophages, the adipocytes and the macrophages are co-cultured to form a fat-like tissue, which can be then utilized in the studies and medicine development for treating metastatic diseases associated with adipose tissue. | 2018-07-26 |
20180208899 | EX VIVO PROLIFERATION OF EPITHELIAL CELLS - The technology relates in part to methods and compositions for ex vivo proliferation and expansion of epithelial cells. | 2018-07-26 |
20180208900 | EX VIVO PROLIFERATION OF EPITHELIAL CELLS - The technology relates in part to methods and compositions for ex vivo proliferation and expansion of epithelial cells. | 2018-07-26 |
20180208901 | METHOD FOR FACILITATING FUNCTIONS AND CHARACTERISTICS OF CORNEAL ENDOTHELIAL CELLS - The present disclosure discloses a method for facilitating functions and characteristics of corneal endothelial cells, comprising the following steps of: separating and culturing human orbital adipose-derived stem cells, and extracting a conditioned culture medium; separating and culturing primary human corneal endothelial cells; adding the conditioned culture medium in a basal culture medium for the human corneal endothelial cells, and culturing and proliferating the human corneal endothelial cells. In the present disclosure, the human corneal endothelial cells cultured by the conditioned culture medium extracted from human orbital adipose-derived stem cells have high adherence and proliferation capacities. Human corneal endothelial cells cultured in vitro can be sub-cultured over 10 generations. The proliferation multiple is higher and the morphology and functions of the human corneal endothelial cells can be maintained. Experiments on animals have proved that the human corneal endothelial cells cultured in vitro have excellent cell repair effects. | 2018-07-26 |
20180208902 | METHOD FOR CULTURING PLURIPOTENT STEM CELLS, METHOD FOR MANUFACTURING CULTURE VESSEL, CULTURE VESSEL, AND SCAFFOLD MATERIAL FOR CULTURING CELLS - Provided are a method for culturing pluripotent stem cells including a culturing process of bringing pluripotent stem cells into contact with a polypeptide which has cell adhesion activity and includes a first domain for binding bFGF and a second domain for adhering to a culture vessel and culturing the pluripotent stem cells, in which bFGF is bound to the first domain, and the second domain is adhered to the culture vessel; a method for culturing pluripotent stem cells including a culturing process of bringing bFGF, which is directly or indirectly adhered to a culture vessel, and a polypeptide, which has cell adhesion activity and is adhered to the culture vessel, into contact with pluripotent stem cells and culturing the pluripotent stem cells; and applications thereof. | 2018-07-26 |
20180208903 | GENERATION OF AIRWAY EPITHELIAL ORGANOIDS FROM HUMAN PLURIPOTENT STEM CELLS - The technology described herein relates to methods and kits for directed differentation of primordial NKX2-1+ lung progenitors along proximal differentiation pathways into functional airway epithelial cells and airway organoids (“bronchospheres”) or along distal lineage pathways using modulation of Wnt signaling. Other aspects relate cell lines, methods, assays and kits comprising airway epithelial cells, and assays for diagnosing a disease that affects swelling of the bronchospheres, and/or for assessing genetic lesions and/or drugs for treating the the disease, where the disease is cystic fibrosis. Other aspects relate to personalized medicine and methods of treatment of cystic fibrosis using the airway epithelial cells. | 2018-07-26 |
20180208904 | HOST REGULATORY FACTOR THAT ENHANCES REPLICATION AND/OR PROPAGATION OF VACCINIA VIRUS - It is an object of the present invention to provide utilization of a UCA1 gene that is a host regulatory factor that enhances replication and/or propagation of a vaccinia virus, in order to effectively carry out cancer virotherapy using the vaccinia virus. The present invention relates to: a method for predicting and evaluating the cancer therapeutic effects of a vaccinia virus, which comprises measuring the expression of a UCA1 gene in the cancer cells of a cancer patient, and then predicting that a vaccinia virus exhibits cancer therapeutic effects on the patient, when the UCA1 gene has been expressed therein; and a vaccinia virus into which a UCA1 gene has been expressibly introduced. | 2018-07-26 |
20180208905 | ORF7 DEFICIENT VARICELLA VIRUS, VACCINE COMPRISING THE VIRUS AND USE THEREOF - Provided are an ORF7 deficient varicella virus, an vaccine comprising the virus and use thereof, as well as a method for the production the virus. | 2018-07-26 |
20180208906 | ATTENUATION OF HUMAN RESPIRATORY SYNCYTIAL VIRUS BY GENOME SCALE CODON-PAIR DEOPTIMIZATION - Described herein are RSV polynucleotide sequences that make use of multiple codons that are containing silent nucleotide substitutions engineered in multiple locations in the genome, wherein the substitutions introduce a numerous synonymous codons into the genome. Due to the large number of defects involved, the attenuated viruses disclosed herein provide a means of producing attenuated, live vaccines against RSV. | 2018-07-26 |
20180208907 | METHOD FOR RAPID GENERATION OF AN INFECTIOUS RNA VIRUS - The present invention relates to a method for rapid generation of an infectious RNA virus that completely eliminates the need of constructing a full-length c DNA, which covers the entire viral genome, cloning and propagating such full length c DNA. | 2018-07-26 |
20180208908 | LIGHT-DRIVEN SYSTEM AND METHODS FOR CHEMICAL MODIFICATION OF AN ORGANIC SUBSTRATE - The present disclosure relates to alight-driven system which is able to chemically modify an organic substrate with high efficiency and in a cost-effective manner. Also provided are methods for chemically modifying an organic substrate using the present systems and methods for manufacturing such systems. | 2018-07-26 |
20180208909 | MICROORGANISM FOR PRODUCING PUTRESCINE OR ORNITHINE AND METHOD FOR PRODUCING PUTRESCINE OR ORNITHINE BY USING SAME - Disclosed is a modified microorganism producing putrescine or ornithine, and a method for producing putrescine or ornithine using the same. | 2018-07-26 |
20180208910 | Enzymatic Synthesis of L-Nucleic Acids - The present invention is related to a method for adding one or more L-nucleotides to the 3′ end of a first L-nucleic acid, wherein the method comprises the step of reacting the one or more L-nucleotides with the first L-nucleic acid in the presence of a protein comprising an enzymatic activity exhibiting moiety, wherein the enzymatic activity is capable of adding one or more L-nucleotides to the 3′ end of the first L-nucleic acid. | 2018-07-26 |
20180208911 | POLYMERIZING ENZYMES FOR SEQUENCING REACTIONS - Compositions comprising modified recombinant polymerizing enzymes are provided, along with nucleic acid molecules encoding the modified polymerizing enzymes. In some aspects, methods of using such polymerizing enzymes to synthesize a nucleic acid molecule or to sequence a nucleic acid template are provided. | 2018-07-26 |
20180208912 | Cell Penetrating Peptide, Conjugate Comprising Same, and Composition Comprising Conjugate - The present invention relates to a conjugate of cell penetrating peptide and an active ingredient; and its use. Specifically, a conjugate including a cell penetrating peptide which is a peptide comprising any one amino acid sequence of SEQ ID NO: 1 to SEQ ID NO: 156, a fragment of any one sequence of SEQ ID NO: 1 to SEQ ID NO: 156, or a peptide having above 80% homology with the above-mentioned sequence; and a composition comprising the same are disclosed. | 2018-07-26 |
20180208913 | Manufacture of Active Highly Phosphorylated Human Lysosomal Sulfatase Enzymes and Uses Thereof - This invention provides compositions of active highly phosphorylated lysosomal sulfatase enzymes, their pharmaceutical compositions, methods of producing and purifying such lysosomal sulfatase enzymes and compositions and their use in the diagnosis, prophylaxis, or treatment of diseases and conditions, including particularly lysosomal storage diseases that are caused by, or associated with, a deficiency in the lysosomal sulfatase enzyme. | 2018-07-26 |
20180208914 | LENTIVIRUS AND NON-INTEGRATING LENTIVIRUS AS VIRAL VECTOR TO DELIVER CRISPR THERAPEUTIC - A composition for treating a lysogenic virus, including a lentiviral vector encoding isolated nucleic acid encoding two or more gene editors chosen from gene editors that target viral DNA, gene editors that target viral RNA, and combinations thereof. A composition for treating a lytic virus, including a lentiviral vector encoding isolated nucleic acid encoding at least one gene editor that targets viral DNA and a viral RNA targeting composition. A composition for treating both lysogenic and lytic viruses, including a lentiviral vector encoding isolated nucleic acid encoding two or more gene editors that target viral RNA. A composition for treating lytic viruses. Methods of treating a lysogenic virus or a lytic virus, by administering the above compositions to an individual having a virus and inactivating the virus. | 2018-07-26 |
20180208915 | NOVEL ENDOS MUTANT ENZYME - The present invention provides an EndoS mutant enzyme having an amino acid sequence of EndoS D233Q and further having a particular additional mutation and exhibiting a reduced hydrolysis activity, in comparison with the activity of EndoS D233Q, to an N-linked sugar chain (N297-linked sugar chain) linked to Asn at position 297 in IgG and a gene encoding the same. | 2018-07-26 |
20180208916 | ALPHA-AMYLASE VARIANTS AND POLYNUCLEOTIDES ENCODING SAME - The present invention relates to an alpha-amylase variant, comprising a substitution at one or more positions corresponding to positions 59, 129, 177, 179, 208, 212, 220, 224, 254, and 284 of the polypeptide of SEQ ID NO: 1, wherein the variant has at least at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity to the mature polypeptide of SEQ ID NO: 1, and wherein the variant comprises at least one of the following combination of substitutions: V59A+E129V+K177L+R179E+H208Y+K220P+N224L+Q254S; V59A+E129V+K177L+R179E+Q254S+M284V; or V59A+E129V+K177L+R179E+V212T+Q254S+M284V (using SEQ ID NO: 1 for numbering); and wherein the variants have alpha-amylase activity. | 2018-07-26 |
20180208917 | POLYPEPTIDES HAVING PULLULANASE ACTIVITY SUITABLE FOR USE IN LIQUEFACTION - The present invention relates to a variant pullulanase, wherein the pullulanase comprises at least the following combination of substitutions: N368G+N393A+Q431E+L432F+A492A,S+N610R+G624S+T631S+S632C, and optionally further comprises N222P+Q252A+Q256R; wherein the variant has pullulanase activity, and wherein the variants have at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%, but less than 100% sequence identity to the polypeptide of SEQ ID NO: 3. Further aspect the present invention relates to a process for liquefying starch-containing material at a temperature above the initial gelatinization temperature using an alpha-amylase and a thermo-stable pullulanase of the invention. | 2018-07-26 |
20180208918 | NUCLEIC ACID MOLECULES ENCODING AUTOACTIVATING TYPE I PANCREATIC PROELASTASE PROTEINS - The present invention relates to methods for the manufacture, purification, formulation, and use of biologically active recombinant elastase proteins. Described are recombinant methods for producing therapeutically useful elastase proteins, as are pharmaceutical compositions comprising said elastase proteins. Novel recombinant elastase proteins and protein preparations are also disclosed. Methods are described for treating and preventing diseases of biological conduits using pharmaceutical compositions containing the elastase proteins of the invention. | 2018-07-26 |
20180208919 | MONOMERIC AND FUNCTIONAL ADENYLATE CYCLASE CyaA TOXIN - The present invention discloses a procedure to produce a monomeric and functional form of | 2018-07-26 |
20180208920 | MOLECULAR MACHINES - The present disclosure relates to isolated enzyme complexes comprising a tethered cofactor and at least two enzymes paired to catalyse an enzymatic reaction and recycle the cofactor. | 2018-07-26 |
20180208921 | Increasing Specificity for RNA-Guided Genome Editing - Methods for increasing specificity of RNA-guided genome editing, e.g., editing using CRISPR/Cas9 systems. | 2018-07-26 |
20180208922 | ALLELE-SPECIFIC CAPTURE OF NUCLEIC ACIDS - A method for separating a target allele from a mixture of nucleic acids by (a) providing a mixture of nucleic acids in fluidic contact with a stabilized ternary complex that is attached to a solid support, wherein the stabilized ternary complex includes a polymerase, primed nucleic acid template, and next correct nucleotide, wherein the template has a target allele, wherein the next correct nucleotide is a cognate nucleotide for the target allele, and wherein the stabilized ternary complex is attached to the solid support via a linkage between the polymerase and the solid support or via a linkage between the next correct nucleotide and the solid support; and (b) separating the solid support from the mixture of nucleic acids, thereby separating the target allele from the mixture of nucleic acids. | 2018-07-26 |
20180208923 | METHOD FOR THE SELECTIVE SIZE-FRACTIONATED SEPARATION AND ISOLATION OF NUCLEIC ACID MIXTURES - The invention relates to a method for size-fractionated isolation of nucleic acids, characterized by the following steps: —a first binding buffer, which contains at least one chaotropic salt and at least one substance that raises the pH of the binding buffer, is added—in the absence of aliphatic alcohols—to a volume of the mixture of nucleic acids, —binding on a solid phase and separation of the nucleic acids bound by step a), —a second binding buffer, which has a lower pH than the binding buffer under Point a), or a nonionic surfactant or an alcohol or a mixture of nonionic surfactant and alcohol is mixed with the filtrate from step a), —binding on a solid phase and separation of the nucleic acids bound by step c), —washing and elution, according to known methods, of the nucleic acid isolated after steps a) and c), with the result that the nucleic acids isolated after step a) not only have a larger number of base pairs than the nucleic acids isolated under step c), but also that, both after both step a) and after step c), individual, particular nucleic acid fractions with a particular number of base pairs are isolated that were not isolated in the respective other step. The size ratios of the nucleic acid fractions can be controlled by changing the pH. | 2018-07-26 |
20180208924 | METHOD FOR INTRODUCING SITE-DIRECTED RNA MUTATION, TARGET EDITING GUIDE RNA USED IN THE METHOD AND TARGET RNA-TARGET EDITING GUIDE RNA COMPLEX - A method for inducing a site-directed RNA mutation is provided. The method includes repairing an RNA mutation by converting target adenosine, which is located at a target editing site of a target RNA, into inosine. The method for inducing a site-directed RNA mutation involves reacting the target RNA having a target adenosine with a target editing guide, which has been constructed so as to form a complementary strand with target RNA, to form a double-stranded complex, and converting the target adenosine to inosine by causing ADAR to act on the double-stranded complex, inducing A-to-I editing capability. The converted inosine is further translated into guanosine. | 2018-07-26 |
20180208925 | INHIBITION OF MICRORNA-134 FOR THE TREATMENT OF SEIZURE-RELATED DISORDERS AND NEUROLOGIC INJURIES - A method for preventing or treating epilepsy or status epilepticus, or a brain-related disorder characterized by precipitation of seizures, in an individual, the method comprising the step of treating the individual with an agent capable of inhibiting the activity of miR-134 in the individual, wherein the agent is delivered to the brain of the individual. | 2018-07-26 |
20180208926 | ANTISENSE OLIGONUCLEOTIDE INHIBITING 2GPI EXPRESSION - The present invention aims to provide a novel nucleic acid capable of suppressing expression of β2GPI, as well as a pharmaceutical composition for the prophylaxis or treatment of diseases associated with β2GPI expression. The present invention solves the above-mentioned problem by providing an antisense oligonucleotide having a β2GPI expression suppressive activity, a pharmaceutical composition containing the antisense oligonucleotide, and a prophylactic or therapeutic drug for autoimmune diseases including APS, SLE and the like, and thrombosis in hemodialysis that contains the antisense oligonucleotide and suppresses β2GPI expression. | 2018-07-26 |
20180208927 | MULTI-TARGETED SINGLE ENTITY CONJUGATES - The present invention relates, in general to, compounds, compositions and methods useful for modulating gene expression of multiple target nucleic acids by a single chemical entity. | 2018-07-26 |
20180208928 | TOOLS AND METHODS USING MIRNA 182, 96 AND/OR 183 FOR TREATING PATHOLOGIES - The present inventions relates to isolated nucleic acid molecules comprising a nucleotide sequence coding for miRNA-182 (uuuggcaaugguagaacucacacu or ugguucuagacuugccaacua), miRNA-96 (uuuggcacuagcacauuuuugcu or aaucaugugcagugccaauaug) and/or miRNA-183 (uauggcacugguagaauucacu or gugaauuaccgaagggccauaa) for use in treating or ameliorating a ciliopathy and/or a photoreceptor dysfunction. | 2018-07-26 |
20180208929 | TREATMENT OF REPROGRAMMING FACTOR RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO A REPROGRAMMING FACTOR - The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of a Reprogramming factor, in particular, by targeting natural antisense polynucleotides of a Reprogramming factor. The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of Reprogramming factors. | 2018-07-26 |
20180208930 | TREATMENT OF LIPID TRANSPORT AND METABOLISM GENE RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO A LIPID TRANSPORT AND METABOLISM GENE - The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of a Lipid transport and metabolism gene, in particular, by targeting natural antisense polynucleotides of a Lipid transport and metabolism gene. The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of a Lipid transport and metabolism genes. | 2018-07-26 |
20180208931 | Methods and Compositions for RNA-Directed Target DNA Modification and for RNA-Directed Modulation of Transcription - The present disclosure provides a DNA-targeting RNA that comprises a targeting sequence and, together with a modifying polypeptide, provides for site-specific modification of a target DNA and/or a polypeptide associated with the target DNA. The present disclosure further provides site-specific modifying polypeptides. The present disclosure further provides methods of site-specific modification of a target DNA and/or a polypeptide associated with the target DNA The present disclosure provides methods of modulating transcription of a target nucleic acid in a target cell, generally involving contacting the target nucleic acid with an enzymatically inactive Cas9 polypeptide and a DNA-targeting RNA. Kits and compositions for carrying out the methods are also provided. The present disclosure provides genetically modified cells that produce Cas9; and Cas9 transgenic non-human multicellular organisms. | 2018-07-26 |
20180208932 | COMPOSITIONS AND METHODS FOR SILENCING HEPATITIS B VIRUS GENE EXPRESSION - The present invention provides compositions comprising therapeutic nucleic acids such as siRNA that target Hepatitis B virus (HBV) gene expression, lipid particles comprising one or more (e.g., a combination) of the therapeutic nucleic acids, and methods of delivering and/or administering the lipid particles (e.g., for treating HBV infection and/or HDV infection in humans). | 2018-07-26 |
20180208933 | BACTERIA WITH IMPROVED METABOLIC CAPACITY - bacteria comprising genetic modifications to enhance fermentability and production of protein and nucleic acids are provided. | 2018-07-26 |
20180208934 | BASE SEQUENCE FOR PROTEIN EXPRESSION AND METHOD FOR PRODUCING PROTEIN USING SAME - To provide a base sequence for protein expression that can increase the yield of protein such as diastatic enzyme by further activating a promoter of a particular gene. A base sequence | 2018-07-26 |
20180208935 | Sophorolipid Highly-Productive Mutant Strain - Provided is a microorganism having high sophorolipid production capability. Disclosed is a sophorolipid-producing yeast mutant strain, in which a polypeptide consisting of the amino acid sequence set forth in SEQ ID NO:2 or an amino acid sequence having at least 90% identity therewith, has been deleted or deactivated. | 2018-07-26 |
20180208936 | BASE SEQUENCE FOR PROTEIN EXPRESSION AND METHOD FOR PRODUCING PROTEIN USING SAME - To provide a base sequence for protein expression that can increase the yield of protein such as diastatic enzyme by further activating a promoter of a particular gene. A base sequence | 2018-07-26 |
20180208937 | HPPD VARIANTS AND METHODS OF USE - In the present invention, HPPD polypeptides and plants containing them showing a full tolerance against one or more HPPD inhibitor herbicides belonging to various chemical classes are described. | 2018-07-26 |
20180208938 | Compositions and Methods for Protecting Plants Against Bacterial Infections - A method of creating a genetically altered plant and parts thereof with a chimeric protein comprising a first domain, a second domain, and a third domain, wherein said first domain comprises either i) a recognition element comprising a Proteinase K sequence, or BPI/LBP sequence, or ii) a lysis element comprising a thionin sequence, said second domain comprises either i) a recognition element comprising a sequence selected from Proteinase K sequence, or BPI/LBP sequence, or ii) a lysis element comprising a thionin sequence wherein the second domain is an element that is different from the element of the first domain and said third domain comprises a linker; wherein said linker separates said first domain from said second domain such that said first domain and said second domain can each fold into its appropriate three-dimensional shape and retains its activity. | 2018-07-26 |
20180208939 | MODIFIED PLANTS - The present invention relates to conferring enhanced pathogen resistance in wheat plants using targeted genome modification. | 2018-07-26 |
20180208940 | Novel Insect Inhibitory Proteins - Pesticidal proteins exhibiting toxic activity against Coleopteran, Lepidopteran, Hemipteran, and Thysanopteran pest species are disclosed, and include, but are not limited to, TIC6280, TIC6281, TIC6282, TIC6283, TIC8808, TIC9480, TIC9257, TIC7106, TIC7017, TIC7107, TIC7108, TIC7109, TIC7110, TIC7111, TIC7589, TIC9258, and TIC9259. DNA constructs are provided which contain a recombinant nucleic acid sequence encoding the pesticidal proteins provided. Transgenic plants, plant cells, seed, and plant parts resistant to Lepidopteran, Coleopteran, Hemipteran and Thysanopteran infestation are provided which contain recombinant nucleic acid sequences encoding the disclosed pesticidal proteins. Methods for detecting the presence of the recombinant nucleic acid sequences or the protein of the present invention in a biological sample, and methods of controlling Coleopteran, Lepidopteran, Hemipteran, and Thysanopteran species pests using the disclosed pesticidal proteins are also provided. | 2018-07-26 |
20180208941 | Rice Mitochondrial Sterile Gene and Application Thereof - Provided is a rice mitochondrial sterile gene and the application thereof. A rice mitochondrial sterile gene and a coding sequence thereof are disclosed. A specific molecular marker was designed from said gene sequence and enables a rapid and effective screening and identification of D1-type cytoplasm from wild rice for breeding a new D1-type cytoplasm sterile line. A specific sequence in the mitochondria genome of D1-type cytoplasm sterile line was identified by comparative genomics. Sterility-related ORFs were identified from gene prediction and expression difference analysis. A plant transformation vector was constructed to transform maintainer line for verification and sterile function. | 2018-07-26 |
20180208942 | NR2E1 MINI-PROMOTERS - Isolated polynucleotides comprising a NR2E1 mini-promoters are provided. The mini-promoter may be operably linked to an expressible sequence, e.g. reporter genes, genes encoding a polypeptide of interest, regulatory RNA sequences such as miRNA, siRNA, anti-sense RNA, etc., and the like. In some embodiments a cell comprising a stable integrant of an expression vector is provided, which may be integrated in the genome of the cell. The promoter may also be provided in a vector, for example in combination with an expressible sequence. The polynucleotides find use in a method of expressing a sequence of interest, e.g. for identifying or labeling cells, monitoring or tracking the expression of cells, gene therapy, etc. | 2018-07-26 |
20180208943 | ADENO-ASSOCIATED VIRUSES ENGINEERED FOR SELECTABLE TROPISM - Methods to prepare recombinant adeno-associated virus (AAV) capsids with altered tropism and compositions having AAVs with altered tropism are provided. | 2018-07-26 |
20180208944 | ADENOVIRAL VECTOR ENCODING HUMAN ATONAL HOMOLOG-1 (HATH1) - The invention is directed to a replication-deficient adenoviral vector comprising a nucleic acid sequence encoding a human atonal homolog-1 (Hath1) protein operably linked to a human glial fibrillary acidic protein (GFAP) promoter. The invention also is directed to a composition and method utilizing the adenoviral vector to generate sensory cells in the inner ear of a human. | 2018-07-26 |
20180208945 | GENOME EDITING SYSTEMS AND METHODS OF USE - Compositions and methods are provided for genome editing at a target site in the genome of a filamentous fungal cell. The methods and compositions disclosed are drawn to a guide polynucleotide/Cas endonuclease system and donor polynucleotides with shorter homology arms (i.e., less than 500 bps) to a genomic locus of the fungal cell. | 2018-07-26 |
20180208946 | METHOD FOR PRODUCING FRAGRANT ALCOHOLS - This invention relates generally to methods and compositions for producing a sesquiterpene alcohol comprising contacting a sesquiterpene with a P450 polypeptide with monooxygenase activity. | 2018-07-26 |
20180208947 | PROCESS FOR PRODUCING ALKANES USING MICROORGANISMS COMBINED WITH KOLBE SYNTHESIS - The present invention relates to a method of producing at least one alkane, the method comprising, —producing at least one carboxylic acid from a carbon source using a genetically modified microorganism, and —performing Kolbe electrolysis on the carboxylic acid to produce the alkane, wherein the alkane comprises at least 6 carbon atoms and the carboxylic acid comprises at least 4 carbon atoms and wherein the carbon source is selected from the group consisting of ethanol, acetate, propionate, butyrate, isobutyrate, valerate, hexanoate and combinations thereof and the microorganism is capable of producing the carboxylic acid using ethanol-carboxylate fermentation. | 2018-07-26 |
20180208948 | DRIMENOL SYNTHASES I - The present invention relates to a method of producing drimenol and/or drimenol derivatives by contacting at least one polypeptide with farnesyl diphosphate. The method may be performed in vitro or in vivo. The present invention also provides amino acid sequences of polypeptides useful in the method of the invention and nucleic acid encoding the polypeptides of the invention. The method further provides host cells or organisms genetically modified to express the polypeptides of the invention and useful to produce drimenol and/or drimenol derivatives. | 2018-07-26 |
20180208949 | PROCESS FOR ENZYMATIC HYDROLYSIS OF LIGNOCELLULOSIC MATERIAL AND FERMENTATION OF SUGARS - The invention relates to a process for the preparation of a sugar product from ligno-cellulosic material, comprising the following steps:
| 2018-07-26 |
20180208950 | METHODS OF FACILITATING THE BIOCONVERSION OF CRUDE BIODIESEL-DERIVED GLYCEROL BY MICROORGANISMS - The present disclosure generally pertains to a method of facilitating the bioconversion of glycerol by microorganisms. In one embodiment, biodiesel derived crude glycerol is purified by removing fatty acids through acid precipitation. The fatty acid-free crude glycerol is then utilized as a carbon source for the culture of microorganisms and the production of value added substances. Additionally, the unsaturated fatty acids within the biodiesel-derived crude glycerol are converted to saturated fatty acids, allowing for fermentation behavior similar to that of pure glycerol. Both the cultured microorganisms and the culture media containing the purified crude glycerol may be analyzed for crude glycerol bioconversion products. The disclosure also relates to a method of increasing product yield through the addition of a second carbon source to the microorganism culture media. | 2018-07-26 |
20180208951 | PRODUCTION OF PROPANOLS, ALCOHOLS, AND POLYOLS IN CONSOLIDATED BIOPROCESSING ORGANISMS - The present in provides for novel metabolic pathways leading to propanol, alcohol or polyol formation in a consolidated bioprocessing system (CBP), where lignocellulosic biomass is efficiently converted to such products. More specifically, the invention provides for a recombinant microorganism, where the microorganism expresses one or more native and/or heterologous enzymes; where the one or more enzymes function in one or more engineered metabolic pathways to achieve: (1) conversion of a carbohydrate source to 1,2-propanediol, isopropropanol, ethanol and/or glycerol; (2) conversion of a carbohydrate source to n-propanol and isopropanol; (3) conversion of a carbohydrate source to isopropanol and methanol; or (4) conversion of a carbohydrate source to propanediol and acetone; wherein the one or more native and/or heterologous enzymes is activated, upregulated or downregulated. | 2018-07-26 |
20180208952 | GENETICALLY ENGINEERED BACTERIUM FOR THE PRODUCTION OF ISOBUTYLENE - The invention relates to a genetically engineered bacterium having an enzyme that converts 3-hydroxyisovaleryl-CoA to 3-hydroxyisovalerate and an enzyme that converts 3-hydroxyisovalerate to isobutylene. Typically, the bacterium is capable of producing isobutylene from a gaseous substrate containing CO, CO | 2018-07-26 |
20180208953 | THIOESTERASES AND CELLS FOR PRODUCTION OF TAILORED OILS - The invention features plant acyl-ACP thioesterase genes of the FatB class and proteins encoded by these genes. The genes are useful for constructing recombinant host cells having altered fatty acid profiles. Oleaginous microalga host cells with the new genes or previously identified FatB genes are disclosed. The microalgae cells produce triglycerides with useful fatty acid profiles. | 2018-07-26 |
20180208954 | METHOD OF MAKING LIPIDS WITH IMPROVED COLD FLOW PROPERTIES - Provided herein are methods of producing oils with reduced saturated fatty acids. The methods include culturing oil-producing microorganisms in a fermentation medium in the presence of one or more antifoaming agents under a controlled carbon consumption rate, wherein the culturing produces oils comprising fatty acids and wherein less than 35% of the fatty acids in the oil are saturated fatty acids. | 2018-07-26 |
20180208955 | Microbiological Process - A process for the microbial synthesis of migalastat, specifically a process for the production of migalastat comprising culturing a microorganism under conditions such that at least one imino sugar is produced and detecting and/or isolating an imino sugar produced by said microorganism, and the microorganisms used in this process. The invention also comprises migalastat produced according to the above method and pharmaceutical compositions and uses thereof. | 2018-07-26 |
20180208956 | Optimized Method For Producing A Composition Containing Isomaltulose - The present invention relates to a method for producing a composition containing isomaltulose from a substrate containing sucrose comprising the steps of: a) contacting the substrate containing sucrose with a particulate carrier-immobilized sucrose isomerase biomass and b) obtaining a composition containing isomaltulose, characterized in that the median particle size d(0.5) of the carrier-immobilized sucrose isomerase biomass is from 370 to 550 μm. The carrier can be an alginate or a polyvinyl alcohol carrier. | 2018-07-26 |
20180208957 | METHOD FOR IN VITRO TRANSCRIPTION USING AN IMMOBILIZED RESTRICTION ENZYME - The present invention relates to a method for in vitro transcription of a linear template DNA which is produced using an immobilized restriction endonuclease. The invention also relates to mutated restriction enzymes which are suitable for immobilization and a solid support to which these restriction enzymes are immobilized. Further, the present invention relates to an enzyme reactor containing said immobilized restriction endonuclease which enzyme reactor can be used for preparing linearized template DNA. Finally, the present invention relates to the use of said enzyme reactor for preparing a linear template DNA for in vitro transcription. In addition, the present invention relates to a kit comprising the immobilized restriction endonuclease. | 2018-07-26 |
20180208958 | METHOD FOR DETECTING A PRESENCE OR ABSENCE OF AT LEAST ONE FIRST ZONE OF INHIBITION - A method for detecting a presence or an absence of at least one zone of inhibition, the method including a step consisting in depositing a volume of the sample in liquid form along a deposition zone extending along an axis at the surface of the agar culture medium and a step consisting in depositing a determined amount of a chemical agent at the surface of the agar culture medium, the deposit defining a potential zone of inhibition, the axis of the zone of deposition of the sample intersecting the potential zone of inhibition. | 2018-07-26 |
20180208959 | QUICK SCREENING METHOD FOR MICROBIAL STRAINS AND CULTURE MEDIUM FOR THE SAME - A quick screening method for microbial strains includes the steps of: feeding a carrier worm with Styrofoam for a plurality of days; and sampling a digestive system of the carrier worm and placing the sampled digestive system of the carrier worm into a culture medium. The digestive system of the carrier worm includes at least one Styrofoam degrading microbial strain. The culture medium includes an emulsion formed by dissolving the Styrofoam with chloroform and adding a surfactant to the dissolved Styrofoam. A culture medium for fast culturing of the at least one microbial strain is also provided. | 2018-07-26 |
20180208960 | METHOD FOR DETERMINING WHETHER OR NOT TEST SAMPLE CONTAINS PHYTOPATHOGENIC FUNGUS - The present invention provides a method for determining whether or not a test sample contains at least one phytopathogenic fungus selected from the group consisting of | 2018-07-26 |
20180208961 | METHOD FOR DETERMINING WHETHER OR NOT TEST SAMPLE CONTAINS EXSEROHILUM PHYTOPATHOGENIC FUNGUS - The present invention provides a method for determining whether or not a test sample contains an | 2018-07-26 |
20180208962 | MEDICINAL OROBANCHEACE EXTRACTS - Pharmaceutical extracts from Egyptian broomrape have proven efficacy against HCV and NAFLD. Compositions and method of making and using same are provided. | 2018-07-26 |
20180208963 | CHEMILUMINESCENCE-BASED HAEMOSTASIS ASSAY - The present invention relates to a method for in vitro determining generation of a haemostasis factor such as thrombin and/or plasmin in a test sample using a chemiluminescent substrate specific for said blood clotting factor. Upon cleavage of the substrate, a luminescent signal is generated with the aid of a luciferase. The invention also relates to a kit for in vitro determining generation of a haemostasis factor in a test sample, and to novel chemiluminescent substrates for the determination of thrombin and plasmin. | 2018-07-26 |
20180208964 | COAGULOGEN-FREE CLARIFIED LIMULUS AMEBOCYTE LYSATE - The present invention is related to compositions comprising clarified limulus amebocyte lysate (LAL), wherein the LAL is substantially free of coagulogen and methods of making such compositions. The invention further relates to a method of detecting an endotoxin in a sample using a chromogenic assay, the method comprising: (a) contacting the sample with a reagent comprising clarified LAL and a chromogenic substrate; and (b) measuring a chromogenic effect resulting from a change in the chromogenic substrate in the presence of endotoxin in the sample, wherein the LAL is substantially free of coagulogen. The invention also relates to kits comprising clarified LAL substantially free of coagulogen, and methods of making such. | 2018-07-26 |
20180208965 | Devices and Formulations for Detecting, Screening and Monitoring Levels of Certain Constituents in Bodily Fluids and Method - A device is disclosed for conducting a non-invasive analysis of a bodily fluid to determine the presence and level of a certain constituent carried by the bodily fluid. An indicator formulation of the device changes color in response to exposure to the constituent to provide a visible indication of the presence and level of the constituent carried by the bodily fluid. A carrier substrate of the device is constructed of a material having voids providing a high void volume within the substrate. The device is made by applying a chromagen to the carrier substrate to create a chromagen-laden carrier member. Then, a selected reagent having a particular constituent-specific formulation is applied to the chromagen-laden member. The selected reagent then combines with the chromagen thereby establishing the indicator formulation within the carrier substrate in place for reception of a sample of the bodily fluid. | 2018-07-26 |
20180208966 | CLONING OF SINGLE-STRANDED NUCLEIC ACID - The present invention relates to an oligonucleotide comprising (a) a double-stranded portion, which double-stranded portion is DNA and 9 to 30 base in length; (b) a loop connecting the 3′ end of the first strand of said double-stranded portion with the 5′ end of the second strand of said double-stranded portion, said loop comprising, in 5′ to 3′ direction: (ba) a first DNA portion which is 4 to 20 nucleotides in length; (bb) a non-nucleic acid spacer which (i) does not interfere with the formation of a stem-loop by said oligonucleotide; and (ii) causes polymerases to cease; and (bc) a second DNA portion which is 4 to 20 nucleotides in length; wherein said first DNA portion and said second DNA portion are not complementary to each other; (c) a single-stranded overhang at its 5′ end, said overhang being 5 to 40 nucleotides in length, wherein (ca) the bond connecting said double-stranded portion with the nucleotide of said overhang which is directly adjacent to said double-stranded portion is cleavable under alkaline conditions; and (cb) said overhang optionally comprises a barcode sequence, said barcode sequence preferably being 5 to 10 nucleotides in length; and optionally (d) within one, more or all of (a), (b) and (c), one, more or all of the following: (da) one or more modified nucleotides; (db) one or more sequences conferring compatibility with nucleic acid sequencing kits, such compatibility being preferably the presence of regions within said oligonucleotide which are complementary to primers comprised in said sequence kits; and (dc) one or more random bases. | 2018-07-26 |
20180208967 | COMPOSITIONS AND METHODS OF RNA ANALYSIS - The present disclosure relates to compositions and methods of RNA analysis. In particular, the present disclosure provides a method of RNA analysis that includes obtaining a sample, applying one or more multi-partite probes to the sample, where each of the one or more multi-partite probes includes at least two sub-probes, annealing at least one of the applied one or more multi-partite probes to at least one target nucleic acid within the sample, and ligating the at least two sub-probes associated with the at least one annealed multi-partite probe to create a target nucleic acid proxy that can be detected. | 2018-07-26 |
20180208968 | METHODS FOR DEPLETING RNA FROM NUCLEIC ACID SAMPLES - The invention relates to methods of depleting RNA from a nucleic acid sample. The RNA may be any RNA, including, but not limited to, rRNA, tRNA, and mRNA. The method is useful for depleting RNA from a nucleic acid sample obtained from a fixed paraffin-embedded tissue (FPET) sample. The method may also be used to prepare cDNA, in particular, a cDNA library for further analysis or manipulation. | 2018-07-26 |
20180208969 | GENERIC MATRIX FOR CONTROL NUCLEIC ACIDS - The present invention belongs to the field of in-vitro diagnostics. Within this field, it particularly concerns the amplification of at least a first target nucleic acid that may be present in at least one fluid sample using an internal control nucleic acid for qualitative and/or quantitative purposes and at least one external control nucleic acid in an aqueous buffer. It further provides an analytical system comprising an internal control nucleic acid for qualitative and/or quantitative purposes and at least one external control nucleic acid in an aqueous buffer. | 2018-07-26 |
20180208970 | DIRECT QUANTITATIVE PCR DEVICE AND METHOD OF USE THEREOF - Provided herein are a direct quantitative PCR system, device, and method for analyzing a biological fluid sample. | 2018-07-26 |
20180208971 | DNA QUALITY CONTROLS - The present disclosure provides methods, arrays and kits for assessing the quality of genomic DNA samples, especially those obtained from formalin-fixed paraffin-embedded (FFPE) samples. The methods, arrays and kits provided herein use primer pairs specific to regions in the genomes of the organisms from which genomic DNA samples are obtained that have identical or nearly identical copies distributed across multiple chromosomes. | 2018-07-26 |
20180208972 | METHOD FOR THE DETECTION AND IDENTIFICATION OF METHICILLIN-RESISTANT STAPHYLOCOCCUS AUREUS - The present invention describes novel SCCmec right extremity junction sequences for the detection of methicillin-resistant | 2018-07-26 |
20180208973 | STREPTOCOCCUS PNEUMONIAE DETECTION IN BLOOD - A set of primers is for amplifying and detecting a | 2018-07-26 |
20180208974 | METHOD FOR GENOTYPING MYCOBACTERIUM TUBERCULOSIS - The present application provides a method for genotyping | 2018-07-26 |
20180208975 | ASSAY FOR SIMULTANEOUS GENOMIC AND PROTEOMIC ANALYSIS - The present invention is directed to a biochemical assay for simultaneous genomic and proteomic analysis. | 2018-07-26 |
20180208976 | METHODS AND COMPOSITIONS FOR DETECTING A TARGET RNA - The present disclosure provides methods for detecting a single-stranded target RNA. The present disclosure provides methods of cleaving a precursor C2c2 guide RNA array into two or more C2c2 guide RNAs. The present disclosure provides a kit for detecting a target RNA in a sample. | 2018-07-26 |
20180208977 | METHODS AND COMPOSITIONS FOR DETECTING A TARGET RNA - The present disclosure provides methods for detecting a single-stranded target RNA. The present disclosure provides methods of cleaving a precursor C2c2 guide RNA array into two or more C2c2 guide RNAs. The present disclosure provides a kit for detecting a target RNA in a sample. | 2018-07-26 |
20180208978 | MICROFLUIDIC PLATFORM FOR MULTIPLEXED DETECTION IN SINGLE CELLS AND METHODS THEREOF - The present invention relates to a microfluidic device and platform configured to conduct multiplexed analysis within the device. In particular, the device allows multiple targets to be detected on a single-cell level. Also provided are methods of performing multiplexed analyses to detect one or more target nucleic acids, proteins, and post-translational modifications. | 2018-07-26 |
20180208979 | Methods and Systems for PCR Quantitation - A method for quantifying nucleic acid is provided. The method includes determining a first reference threshold cycle for a first predetermined input quantity for a reference nucleic acid, determining a first target threshold cycle for the first predetermined input quantity for a target nucleic acid, determining a second reference threshold cycle for a second predetermined input quantity for the reference nucleic acid, and determining a second target threshold cycle, by the processor, for the second predetermined input quantity for the target nucleic acid. The method further includes receiving a sample threshold cycle, determining a sample input quantity based on the first and second reference threshold cycle and the first and second target threshold cycle, and displaying the sample input quantity to a user. | 2018-07-26 |
20180208980 | GENOTYPING BY POLYMERASE BINDING - A method for identifying target alleles, that includes steps of (a) forming a plurality of stabilized ternary complexes at a plurality of features on an array, wherein the stabilized ternary complexes each has a polymerase, a template nucleic acid having a target allele of a locus, a primer hybridized to the locus, and a next correct nucleotide having a cognate in the locus, wherein either (i) the primer is an allele-specific primer having a 3′ nucleotide that is a cognate nucleotide for the target allele, or (ii) the primer is a locus-specific primer and the next correct nucleotide hybridizes to the target allele; and (b) detecting stabilized ternary complexes at the features, thereby identifying the target alleles. | 2018-07-26 |
20180208981 | METHODS AND COMPOSITIONS FOR NUCLEIC ACID AMPLIFICATION - Compositions, reaction mixtures, and methods for performing an amplification reaction, including multiplex amplification reaction, wherein the method comprises using one or more amplification oligomer complexes comprising linked first and second amplification oligomer members. In one aspect, the amplification oligomer complex is hybridized to a target nucleic acid, the target nucleic acid with hybridized amplification oligomer complex is then captured, and other components are washed away. Target sequences of the target nucleic acids are pre-amplified to generate a first amplification product. The first amplification product is amplified in one or more secondary amplification reactions to generate second amplification products. | 2018-07-26 |
20180208982 | METHOD FOR EVALUATING PHYSICAL CONDITIONS, METHOD FOR PRESENTING INFORMATION, AND METHOD FOR SCREENING FOR SUBSTANCE CAPABLE OF IMPROVING OR PREVENTING PHYSICAL CONDITIONS - The purpose of the present invention is to provide: a method for evaluating various physical conditions accurately; a method for presenting information utilizing the aforementioned method; and a method of screening for a substance capable of improving or preventing physical conditions. A method for evaluating a physical condition of a subject comprises the steps of: determining the value of an abundance of a skin flora, which is collected from the surface of the skin of the subject, on the surface of the skin or the value of a parameter calculated on the basis of the abundance, wherein the reference values for the correlation between the abundance or the parameter with the physical condition has been produced; and then comparing the value with the reference values. | 2018-07-26 |
20180208983 | PROCESS FOR COGNATE NUCLEOTIDE DETECTION IN A NUCLEIC ACID SEQUENCING WORKFLOW - Method and composition for identifying cognate nucleotides in a Sequencing By Binding™ procedure, wherein one or more labeled nucleotides are detected in ternary complexes but never incorporated. Labeled nucleotides can be incorporable nucleotides that contact preformed blocked primed template nucleic acids. Alternatively, labeled nucleotides are labeled non-incorporable nucleotides. Labeled nucleotides, including labeled non-incorporable nucleotides, can be detected in ternary complexes in the same reaction mixture that incorporates a reversible terminator nucleotide to create a blocked primed template nucleic acid. Detection of ternary complexes can take place in the presence of a catalytic metal ion. | 2018-07-26 |
20180208984 | COMPOSITIONS AND METHODS FOR IMMUNE REPERTOIRE SEQUENCING - The present disclosure provides methods, compositions, kits, and systems useful in the determination and evaluation of the immune repertoire. In one aspect, target-specific primer panels provide for the effective amplification of sequences of T cell receptor and/or B cell receptor chains with improved sequencing accuracy and resolution over the repertoire. Variable regions associated with the immune cell receptor are resolved to effectively portray clonal diversity of a biological sample and/or differences associated with the immune cell repertoire of a biological sample. | 2018-07-26 |
20180208985 | SYSTEM, METHOD AND KIT FOR ANALYSIS OF CIRCULATING DIFFERENTIALLY METHYLATED DNA AS A BIOMARKER OF BETA-CELL LOSS - β-cell loss in In Type 1 diabetes is typically undetected until the development of hyperglycemia, at which point β-cell mass is significantly reduced. Methylation sensitive quantitative real time PCR (qRTPCR) of demethylated circulating free β-cell specific DNA can be used as a biomarker of β-cell death. Such DNA includes insulin gene and amylin gene DNA. Detection may be by determination of a gene demethylation index. Methylated and demethylated DNA may be distinguished by bisulfite treatment and use of specific PCR primers or probes to detect the different bisulfite treatment products. Detection of demethylated circulating free amylin DNA is useful in identifying β-cell death. The amylin DNA may be used in conjunction with other β-cell specific genes, such as insulin, to provide a multi-gene approach towards the detection of β-cell loss. | 2018-07-26 |
20180208986 | METHODS OF IDENTIFYING AGENTS HAVING NEUROPROTECTIVE OR ANTI-OXIDANT ACTIVITY FOR REGULATING MITOCHONDRIAL FUNCTION - A method for assessing whether a test substance or treatment is potentially neuroprotective or anti-oxidant, the method comprising the steps of exposing a cell to the test substance or treatment assessing the TSPO level in the cell, wherein a substance or treatment is considered to be potentially anti-oxidant and/or neuroprotective if the TSPO level is decreased. The method may comprise the step of assessing the level of mitophagy in the cell, wherein a substance or treatment is considered to be anti-oxidant or neuroprotective if the level or induction of mitophagy is increased and the TSPO level is decreased. | 2018-07-26 |
20180208987 | CYSTIC FIBROSIS TRANSMEMBRANE CONDUCTANCE REGULATOR GENE MUTATIONS - The present invention provides novel mutations of the CFTR gene related to cystic fibrosis or to conditions associated with cystic fibrosis. The mutations include duplication of exons including duplication of exons 6b through 10. Methods of identifying if an individual contains the exons 6b through 10 duplication are provided as well as nucleic acid fragments that contain the junction site of the duplicated segment. The detection of additional mutations in the CFTR gene are also provided. | 2018-07-26 |
20180208988 | METHODS OF DIAGNOSIS AND TREATMENT OF INFLAMMATORY BOWEL DISEASE - The present invention relates to methods of diagnosing and predicting susceptibility to Crohn's Diseaese and/or IBD, by determining the presence or absence of susceptibility to genetic variants, risk haplotypes and/or protective haplotypes. In an embodiment, the invention provides methods of diagnosing and/or predicting susceptibility to Crohn's Disease in an individual by determining the presence or absence of risk variants at the IL12RB1, IL12RB2, IL17A, IL17RA, IL17RD and/or IL23R locus. | 2018-07-26 |
20180208989 | BIOMARKERS FOR CANCER - The use of PHGDH as a biomarker for detecting the occurrence of epithelial-to-mesenchymal transition (EMT) in a subject, and the use of PHGDH modulators to treat cancer is disclosed herein. Also disclosed are various methods for detecting the occurrence of epithelial-to-mesenchymal transition (EMT) in a subject by measuring PHGDH expression and/or activity. | 2018-07-26 |
20180208990 | EPIGENETIC SILENCING OF NMT2 - The finding that multiple cancers lack one of two NMTs, while stromal and normal tissues do not, enables the treatment of NMT2-deficient cancer cells with an NMT inhibitor. It is shown herein that NMT2 expression is reduced or eliminated in certain cancers, and in one example lymphomas, via an epigenetic mechanism(s). Reduction or elimination of NMT2 expression renders the cancer sensitive inhibitors of NMT. | 2018-07-26 |