14th week of 2009 patent applcation highlights part 34 |
Patent application number | Title | Published |
20090087429 | IL-17 homologous polypeptides and therapeutic uses thereof - The present invention is directed to novel polypeptides having sequence identity with IL-17, IL-17 receptors and to nucleic acid molecules encoding those polypeptides. Also provided herein are vectors and host cells comprising those nucleic acid sequences, chimeric polypeptide molecules comprising the polypeptides of the present invention fused to heterologous polypeptide sequences, antibodies which bind to the polypeptides of the present invention and to methods for producing the polypeptides of the present invention. Further provided herein are methods for treating degenerative cartilaginous disorders and other inflammatory diseases. | 2009-04-02 |
20090087430 | SELECTIVE INHIBITION OF TOLL-LIKE RECEPTOR-2 - It has been found that Toll-like receptor 1 and Toll-like receptor 2 (TLR2) physically interact. Antibodies that specifically bind to TLR2 and selectively inhibit induction of cytokines are also described. The invention relates to specific antibodies that selectively bind to TLR2, and to methods of identifying compounds that selectively interfere with signaling through TLR1/TLR2 complexes. | 2009-04-02 |
20090087431 | METHODS OF TREATING BONE DISORDERS WITH MODULATORS OF AXL - The invention provides methods for treating or preventing bone and cartilage disorders comprising administering to a mammal an inhibitor of Axl gene expression or an inhibitor of Axl protein activity. | 2009-04-02 |
20090087432 | TREATING PROSTATE CANCER WITH ANTI-ErbB2 ANTIBODIES - The present application discloses treatment of prostate cancer with anti-ErbB2 antibodies. | 2009-04-02 |
20090087433 | ActRIIB Fusion Polypeptides and Uses Therefor - Methods and compositions for inhibiting growth and differentiation factor-8 (GDF-8) activity in vitro and in vivo are provided. The methods and composition can be used for diagnosing, preventing, or treating degenerative disorders of muscle, bone, or glucose homeostasis. | 2009-04-02 |
20090087434 | NFIA IN GLIAL FATE DETERMINATION, GLIOMA THERAPY AND ASTROCYTOMA TREATMENT - Disclosed herein are compositions comprising NFIA inhibitors, as well as methods of using the same to treat glioma and astrocytomas. | 2009-04-02 |
20090087435 | Isolated Chimeric Proteins Of Modified Lumazine Synthase - isolated chimeric proteins including up to ten copies of peptides, polypeptides or protein domains inserted in the amino termini of the | 2009-04-02 |
20090087436 | COMPOSITIONS AND METHODS FOR TREATING DISEASES - Protein complexes are provided comprising at least one interacting pair of proteins. The protein complexes are useful in screening assays for identifying compounds effective in modulating the protein complexes, and in treating and/or preventing diseases and disorders associated with the protein complexes and/or their constituent interacting members. | 2009-04-02 |
20090087437 | METHODS AND COMPOSITIONS RELATING TO THE REGULATION OF APOPTOSIS BY MUC1 AND BH3-CONTAINING PROAPOPTOTIC PROTEINS - This invention relates to regulation of cell signaling, cell growth, and more particularly to the regulation of cancer or immune cell growth. The invention provides methods of inhibiting interactions between MUC1 and BH3-containing proapoptotic proteins, methods of inhibiting MUC1 expression, and methods of promoting apoptosis. Also provided are screening methods for compounds that inhibit interactions between MUC1 and BH3-containing proapoptotic proteins and pharmaceutical compositions of the same. | 2009-04-02 |
20090087438 | ANTI-TSG101 ANTIBODIES AND THEIR USES FOR TREATMENT OF VIRAL INFECTIONS - The present invention provides methods of using antibodies that bind a TSG101 protein to inhibit or reduce viral production. The invention also provides methods of using the TSG101 antibodies for the treatment of viral infections, including HIV infection. The invention further provides methods of detecting viral infected cells using TSG101 antibodies. | 2009-04-02 |
20090087439 | Compositions and methods for diagnosing or treating psoriasis - In one aspect, the present invention provides isolated nucleic acid molecules that encode a CAN-1 polypeptide, or an STG polypeptide. In another aspect, the present invention also provides isolated STG polypeptides, isolated CAN-1 polypeptides, and isolated SEEK-1 polypeptides. In another aspect, the present invention provides isolated antibodies that bind specifically to a CAN-1, SEEK-1 or STG polypeptide. In another aspect, the present invention provides methods of diagnosing or predicting the susceptibility to psoriasis of an individual. In another aspect, the present invention provides methods for ameliorating the symptoms and/or progression of psoriasis. | 2009-04-02 |
20090087440 | Methods for Treating Cancer - Dendritic cells (DC) play a critical role in antigen-specific immune responses. Materials and Methods are provided for treating disease states, including cancer, by activating dendritic cells from the host which are rendered hypo-responsive to activation stimuli by the disease. In particular, methods are provided for treating cancer in a mammal comprising administering to said mammal an effective amount of a tumor-derived DC inhibitory factor antagonist in combination with an effective amount of a Toll-like receptor (TLR) agonist. | 2009-04-02 |
20090087441 | Wortmannin Analogs and Methods of Using Same in Combination with Chemotherapeutic Agents - Novel wortmannin analogs and their use in inhibiting PI-3-kinase activity in mammals and the treatment or prevention of cancer and tumor formation in a subject are described herein. Preferably, the wortmannin analogs may be administered with other chemotherapeutic agents in the treatment of cancer. | 2009-04-02 |
20090087442 | ANTIBODIES THAT RECOGNIZE HYPERPROLIFERATIVE CELLS AND METHODS OF MAKING AND USING SAME - The invention relates to antibodies that bind to antigens, such as antigens associated with hyperproliferating cells, and methods of treating hyperproliferative disorders. The invention antibodies are useful for treating hyperproliferative disorders, such as neoplasia. | 2009-04-02 |
20090087443 | Pharmacological Adjunctive Treatment Associated with Glaucoma Filtration Surgery - A composition for controlling or preventing progression of glaucoma comprises a material that reduces or inhibits production of a TGF-β isoform or a chemokine or cytokine that stimulates expression of a TGF-β isoform. The material can comprise a dissociated glucocorticoid receptor agonist (“DIGRA”), a prodrug thereof, a pharmaceutically acceptable salt thereof, or a pharmaceutically acceptable ester thereof. The composition can further comprise an antagonist to TGF-β. It is administered to a patient who has undergone glaucoma filtration surgery to ensure a functioning filtering bleb following such surgery. | 2009-04-02 |
20090087444 | PHARMACEUTICAL COMPOSITION COMPRISING POLYSACCHARIDES FROM ANGELICA GIGAS NAKAI FOR ACTIVATION OF DENDRITIC CELLS - The present invention relates to a pharmaceutical composition for activating dendritic cells having polysaccharides from | 2009-04-02 |
20090087445 | Method for the Redox Potential-Dependent Detection of Target Molecules by Interacting Polypeptides - The invention primarily relates to an amino acid sequence EKKEQKEKEK KEQEIKKKFK LTGPIQVIHL AKACCDVKGG KNELSFKQGE QIEIIRITDN PEGKWLGRTA RGSYGYIKTT AVEIDYDSLK LKKD (=SEQ ID NO 1), a protein recognition domain comprising said amino acid sequence, the use of said amino acid sequence or protein recognition domain for identifying redox-dependent protein-protein or protein-lipid interactions, and to a method for the redox potential dependent detection of target molecules; the invention also relates to the use of said amino acid sequence as a marker for measuring the redox potential in cells. | 2009-04-02 |
20090087446 | COMBINATION MOTIF IMMUNE STIMULATORY OLIGONUCLEOTIDES WITH IMPROVED ACTIVITY - Immunostimulatory oligonucleotides, which contain a CpG immunostimulatory motif and a second motif that is capable of forming secondary structure, including duplex and higher order structures in vitro and in vivo, are disclosed. They include nucleic acids, or pharmaceutically acceptable salts thereof, having base sequences that include 5′ TCGTCGTTTTCGGCGCGCGCCGT 3′ (SEQ ID NO: 1), in which each C is unmethylated and 3′ refers to the 3′ end of the nucleic acid. The oligonucleotides activate B cells and NK cells and induce expression of type I interferon and interferon-γ. The oligonucleotides are useful for treating a variety of disorders and conditions, including allergy, asthma, infection, and cancer. In addition to their use as single agents and as combination therapies, the disclosed oligonucleotides are useful as adjuvants in vaccines. | 2009-04-02 |
20090087447 | Novel HCV non-structural polypeptide - Polypeptides comprising a mutant non-structural Hepatitis C virus useful in diagnostic and/or immunogenic compositions are disclosed, in which the mutant is an N-terminal mutation that functionally disrupts the catalytic domain of NS3. Polynucleotides encoding these polypeptides, host cells transformed with polynucleotides and methods of using the polypeptides and polynucleotides are also disclosed. | 2009-04-02 |
20090087448 | Stable Immunoprophylactic and Therapeutic Compositions Derived From Transgenic Plant Cells and Methods for Production - The present invention generally relates to the field of immunology and provides immunoprotective compositions and methods for preparing such compositions from transgenic plant cells. The present invention also relates to the field of protein production (e.g., the recombinant production of enzymes, toxins, cell receptors, ligands, signal transducing agents, cytokines, or other proteins expressed in transgenic plant cell culture) and provides compositions comprising these proteins. | 2009-04-02 |
20090087449 | Novel Peptide Compositions and the Use Thereof, in Particular, in the Preparation of Active Pharmaceutical Compositions Against the Hepatitis C Virus - The invention relates to novel peptide compositions. In particular, the invention relates to a peptide composition comprising at least two peptides which are selected from among the following peptides: a peptide A having at least the amino acid sequence of SEQ ID NO 1, a peptide B having at least the amino acid sequence of SEQ ID NO 45, a peptide C having at least the amino acid sequence of SEQ ID NO 127, and a peptide D having at least the amino acid sequence of SEQ ID NO 174. The inventive compositions can be used, in particular, in the preparation of active pharmaceutical compositions against the hepatitis C virus. | 2009-04-02 |
20090087450 | Combination therapy of hybrid cells with BCG injection for treating Cancer Patients - The present invention relates to cancer treatment compositions and methods for a specific cancer patient population. In particular, the application describes methods of treating a patient with cancer, such as a neuroblastoma, with a hybrid cell preparation in combination with | 2009-04-02 |
20090087451 | Methods and Compositions for Vaccination - The invention provides kits, methods and compositions of matter which improve the safety of vaccination. By combining the administration of antiviral drugs, particularly ester derivatives of cidofovir, with the administration of viral vaccines, particularly the variola vaccine DryVax, side effects of the vaccine are diminished without significantly affecting the effectiveness of the vaccine. | 2009-04-02 |
20090087452 | METHODS AND APPARATUS FOR THE PRODUCTION OF VIRAL VACCINES - A viral vaccine in the dried state is described. Methods for drying viral vaccine in the liquid state into viral vaccine in the dried state are presented. The methods may include introducing the viral vaccine in the liquid state into a gas stream and recovering viral vaccine in the dried state from the gas stream. | 2009-04-02 |
20090087453 | Virosome particles comprising antigens from influenza virus and hepatitis b virus - The present invention provides a virosome comprising a virosomal membrane comprising at least one lipid and envelope proteins of an enveloped virus and of the virosome and attached to said envelope proteins. Furthermore, the invention provides a vaccine comprising the virosome of the invention and, a method for the production of a virosome of the invention. Moreover, the invention provides a use of a virosome of the invention for the preparation of a vaccine, e.g. for the prevention or alleviation of a disease related to an HBV infection, and a method for the vaccination of a subject. | 2009-04-02 |
20090087454 | Method for therapeutic, clinical and veterinary use Poly-ICLC - We disclose here a method for using Poly-ICLC to prevent and/or treat certain human and veterinary infectious, neoplastic and autoimmune disorders, as well as for regulating a broad variety of genes in humans, consisting of use of poly-ICLC repeatedly and at low doses, alone or in combination with other drugs or vaccines. As such it represents an example of broad spectrum host-targeted therapeutics, in contrast to conventional antibiotics, antiviral or antineoplastic agents that target specific organisms or tumors. | 2009-04-02 |
20090087455 | ADIPOGENIC ADENOVIRUSES AS A BIOMARKER FOR DISEASE - A vaccine may be administered to a subject to prevent-related disease due to an adipogenic adenovirus. The vaccine may stimulate the production of adipogenic adenovirus neutralizing antibodies in the subject such that the adipogenic adenovirus neutralizing antibodies prevent obesity-related disease due to an adipogenic adenovirus. | 2009-04-02 |
20090087456 | ADJUVANTED VACCINE - This invention relates to new immunogenic compositions and vaccines suitable for preventing or treating tularemia. | 2009-04-02 |
20090087457 | Compositions and Methods for Topical Application and Transdermal Delivery of Botulinum Toxins - Improved formulations for transdermal delivery of | 2009-04-02 |
20090087458 | ACTIVATABLE RECOMBINANT NEUROTOXINS - Compositions comprising activatable recombinant neurotoxins and polypeptides derived therefrom. The invention also comprises nucleic acids encoding such polypeptides, and methods of making such polypeptides and nucleic acids. | 2009-04-02 |
20090087459 | METHODS FOR TREATING EYE DISORDERS - The present invention provides methods of treating an eye disorder. The methods comprise a step of locally administering a Clostridial toxin to the eye of a patient to treat the disorder. The eye disorder may be associated with an inflammation of the eye, including for example, bacterial conjunctivitis, fungal conjunctivitis, viral conjunctivitis, uveitis, keratic precipitates, macular edema, and inflammation response after intra-ocular lens implantation. The Clostridial toxin may be produced by a Clostridial beratti, a Clostridia butyricum, a Clostridial tetani bacterium and/or a Clostridial botulinum. | 2009-04-02 |
20090087460 | SOLID COMPOSITION, MICROPARTICLES, MICROPARTICLE DISPERSION LIQUID, AND MANUFACTURING METHODS FOR THESE - In a dissolving step, in a container | 2009-04-02 |
20090087461 | ANTI-BACTERIAL PYROCATECHOLS AND RELATED METHODS - The invention includes a compound or an oral care composition comprising a compound represented by the structure (I): | 2009-04-02 |
20090087462 | Use of pyrimidine derivatives for cosmetic purposes - The present invention is directed to the use of certain pyrimidine derivatives for cosmetic purposes, i.e. for the preparation of a composition for providing a cosmetic effect. It was found that said pyrimidine derivatives are particularly useful for treating wrinkles but also for thickening the epidermis, for improving hair growth and for treating grey hair. The present invention is also directed to a composition containing said pyrimidine derivatives. In particular, said composition is a cosmetic preparation. | 2009-04-02 |
20090087463 | Cosmetic containing glass flakes - A cosmetic of the present invention contains glass flakes. The glass flakes have a composition including at least 52 mass % of silicon dioxide and 5 mass % or less of alkali metal oxides. The glass flakes have an average thickness of 0.1 to 1.0 μm, an average particle diameter of 1 to 100 μm, and an average aspect ratio of 10 or greater. The average aspect ratio is obtained by dividing the average particle diameter by the average thickness. The particle diameter distribution index of the glass flakes is 5.0 or less. The particle diameter distribution index is obtained by dividing D90 by D10, where in the particle size distribution of the glass flakes, D10 is a particle diameter at which the cumulative mass distribution of particle diameters reaches 10% when counted from the smaller side, and D90 is a particle diameter at which the cumulative mass distribution of particle diameters reaches 90% when counted from the smaller side. | 2009-04-02 |
20090087464 | Particle stabilised emulsion composition - The present invention relates to emulsifier system comprising food-grade gelled particles and the preparation of particle stabilised emulsions with this emulsifier. The emulsifier system can be used in any fields of applications, such as food products, home and personal care applications and pharmaceutical applications. | 2009-04-02 |
20090087465 | Saline nose wipe and methods of manufacture and use - The present invention generally relates to a wet wipe or sheet that is suitable for contacting the skin and removing mucus from the skin. More specifically, the present invention relates to a wet wipe having an aqueous saline component suitable for dissolving and removing mucus in combination with the fabric matrix of the wet wipe. Typically, the fabric matrix of the wet wipe has a capacity of about 125 grams of solution per square meter, and it is impregnated with the aqueous saline solution to a level at or below approximately 80% of the absorbent capacity of the matrix. | 2009-04-02 |
20090087466 | PROCESS FOR PROVIDING ANTIMICROBIAL SURFACES - Processes for providing durable antimicrobial surfaces are disclosed that comprise treating a polymer substrate surface with formaldehyde followed by treatment with an antimicrobial peptide. Further embodiments include articles, including medical devices, characterized by a durable antimicrobial surface provided by the processes of the invention. | 2009-04-02 |
20090087467 | SOLID FORMULATIONS OF HYDROGEN CYANAMIDE FOR AGRICULTURAL APPLICATIONS - Agricultural crops are protected from the growth of weeds and other undesirable organisms by the application of hydrogen cyanamide in a granular formulation. | 2009-04-02 |
20090087468 | Semi-Rigid Gel Article For Disinfecting A Surface - The present invention relates to a semi-rigid gel article which contains an antibacterial agent and can be used for disinfecting and/or cleaning a surface. More particularly, the article comprises water, a gelling agent, an antibacterial agent and wherein the article is capable of disinfecting a surface by contacting the surface with the article, rupturing the article by application of pressure and spreading the article on the surface to deliver the antimicrobial agent. The article is suitable to disinfect and/or clean an inanimate or animate surface with or without water. | 2009-04-02 |
20090087469 | ALGINATE-BASED NANOFIBERS AND RELATED SCAFFOLDS - Alginate nanofibers, scaffolds that include alginate nanofibers, implantable devices that include alginate nanofibers, and methods for making the alginate nanofibers by electrospinning. | 2009-04-02 |
20090087470 | CONTROLLED RELEASE FORMULATIONS OF OCTREOTIDE - A formulation of octreotide or pharmaceutically acceptable salts thereof, which provides controlled release of a therapeutically effective amount of octreotide for a period of at least about two months. Methods of treating acromegaly, decreasing growth hormone, decreasing IGF-1, and treating conditions associated with carcinoid tumors and VIPomas by administering a controlled release formulation of octreotide are provided herein. | 2009-04-02 |
20090087471 | METHOD OF TREATING TISSUE - In one embodiment, the method comprises providing tissue, preparing the tissue, and treating the tissue to improve remodeling characteristics of the tissue. The tissue may be, for example, cortical bone. Treating the tissue to improve remodeling characteristics may comprise heating the tissue, treating the tissue with a chemical, or other. Heating the tissue may be done in the absence of oxygen and may comprise heating the tissue in a vacuum, heating the tissue in an inert atmosphere, heating the tissue in a reducing atmosphere, coating the tissue with a protective coating and heating the tissue, or other. Further embodiments comprise treating the tissue in supercritical fluids, for example, to dry or virally inactivate the tissue. | 2009-04-02 |
20090087472 | CONTROLLED RELEASE OF BIOPHARMACEUTICAL GROWTH FACTORS FROM HYDROXYAPATITE COATING ON BIORESORBABLE INTERFERENCE SCREWS USED IN CRUCIATE LIGAMENT RECONSTRUCTION SURGERY - Controlled release of biopharmaceutical growth factors from a hydroxyapatite coating on a bioresorbable interference screw used in cruciate ligament reconstruction surgery on a human. Biologically active scaffolds, such as interference bone screws used for ligament fixation, made by growing calcium phosphate-based hydroxyapatite coatings on bioresorbable poly(α-hydroxy ester) scaffolds that provide controlled mineral dissolution and controlled release of bone morphogenetic protein-2. The biologically active scaffold provides improved bioavailability of BMP-2 growth factor that in turn provides enhanced graft-bone healing in the tibial bone tunnel. The coating method uses surface hydrolysis and modified simulated body fluid incubation which does not require solvent or heat and is conducted at room temperature. | 2009-04-02 |
20090087473 | Osteoinductive bone graft material and manufacturing method - In order to promote a bone regeneration, atelocollagen, collagen or metal to be utilized as a biomaterial is immersed in an organic solvent solution containing dissolved silanol polyhedral oligomeric silsesquioxane or silanol, then the immersed material is taken out of the solution and dried, and the dried silanol polyhedral oligomeric silsesquioxane or silanol is coated on the atelocollagen, collagen or metal, then the resultant compound is embedded in the bone defect. | 2009-04-02 |
20090087474 | Therapeutic use of growth factors,nsg29 and nsg31 - The present invention relates to the field of therapeutic use of proteins, genes and cells, in particular to the therapy based on secreted therapeutic proteins, NsG29 and NsG31. NsG29 and Ns31 are members of a newly identified family of growth factors with a specific cystein pattern and characterised by expression in the nervous system. The secreted growth factors have potential for the treatment of disorders of the nervous system. The invention also relates to bioactive NsG29 and NsG31 polypeptide fragments and the corresponding encoding DNA sequences. | 2009-04-02 |
20090087475 | Non-Wovens With High Interfacial Pore Size And Method Of Making Same - A Nonwoven fibrous structures with a high interfacial pore size and substrates made therefrom are provided. The substrates may be used, for example, in wipes. In one embodiment, the wipes include a hydromolded pattern on one side. The hydromolded pattern has an average pore-size of the interface between two stacked wipes that is greater than 180 microns in radius. In addition, a method for manufacturing nonwoven fibrous structures with high interfacial pore size is also provided. | 2009-04-02 |
20090087476 | PROSAPOSIN AS A NEUROTROPHIC FACTOR - Prosaposin, saposin C and various peptide fragments of saposin C stimulate neurite outgrowth in vitro. In addition, prosaposin and saposin C promote increased myelination ex vivo. Prosaposin is present in large neurons of the brain, including both upper and lower motor neurons. | 2009-04-02 |
20090087477 | METHODS FOR PREPARING REVERSE MICELLES BASED ON STEROLS AND ACYLGLYCEROLS FOR THE DELIVERY OF METAL IONS - The present invention relates to a method for the preparation of reverse micelles based on sterols, acylglycerols and metal salt and to reverse micelles obtained thereby. They are advantageously useful in the pharmaceutical and dietetic fields. | 2009-04-02 |
20090087478 | Orally Deliverable and Anti-Toxin Antibodies and Methods for Making and Using Them - The invention provides antibodies with superior therapeutic efficacy and related methods of engineering such antibodies to increase their stability and resistance to proteases, e.g., in the digestive tract. Protease cleavage motifs are identified and subsequently modified to reduce or eliminate cleavage at that site. Methods of employing these orally deliverable antibodies as therapeutic compositions, particularly against gastrointestinal pathogens are also provided herein. In one aspect, the invention provides combinations of monoclonal antibodies, e.g., “synthetic polyclonals,” that work synergistically to neutralize bacterial toxins, particularly enteric bacterial toxins such as | 2009-04-02 |
20090087479 | Orally bioavailable lipid-based constructs - The present invention is embodied by a composition capable of chaperoning a typically non-orally available therapeutic or diagnostic agent through the environment of the digestive tract such that the therapetucic or diagnostic agent is bioavailable. The composition may or may not be targeted to specific cellular receptors, such as hepatocytes. Therapeutic agents include, but are not limited to, insulin, calcitonin, serotonin, and other proteins. Targeting is accomplished with biotin or metal based targeting agents. | 2009-04-02 |
20090087480 | PHARMACEUTICAL COMPOSITION AND METHOD USING ANTIFUNGAL AGENT IN COMBINATION - A pharmaceutical composition containing one or more antifungal agents selected from an arylamidine derivative represented by the general formula: | 2009-04-02 |
20090087481 | METHODS OF TREATING NEUROLOGICAL CONDITIONS WITH HEMATOPOEITIC GROWTH FACTORS - The present invention relates to a method of treating a neurological condition in a mammal by administering at least one hematopoietic growth factor. | 2009-04-02 |
20090087482 | Temperature-Sensitive Liposomal Formulation - A liposome contains an active agent and has a gel-phase lipid bilayer membrane comprising phospholipid and a surface active agent. The phospholipids are the primary lipid source for the lipid bilayer membrane and the surface active agent is contained in the bilayer membrane in an amount sufficient to increase the percentage of active agent released at the phase transition temperature of the lipid bilayer, compared to that which would occur in the absence of the surface active agent. The surface active agent is present in the lipid bilayer membrane so as to not destabilize the membrane in the gel phase. | 2009-04-02 |
20090087483 | ORAL DOSAGE COMBINATION PHARMACEUTICAL PACKAGING - Pharmaceutical fixed dose combination products are formed by merging a fixed dose of a first pharmaceutical formulation from primary module, with a fixed dose of a second pharmaceutical formulation from a secondary module. In a preferred embodiment the first and second pharmaceutical formulations are separated from one another in a three piece capsule, a capsule-in-a-capsule or a tablet-in-a-capsule, and the primary and secondary modules are interchangeable. | 2009-04-02 |
20090087484 | Formulation and dosage form for increasing oral bioavailability of hydrophilic macromolecules - A formulation and dosage form for enhancing the bioavailability of orally administered hydrophilic macromolecules includes a permeation enhancer, a hydrophilic macromolecule, and a carrier such as a nonionic surfactant that exhibits in-situ gelling properties. The formulation is delivered within the GI tract as a liquid having at least some affinity for the surface of the GI mucosal membrane. Once released, it is believed that the liquid formulation spreads across one or more areas of the surface of the GI mucosal membrane, where the carrier of the formulation then transitions into a bioadhesive gel in-situ. As a bioadhesive gel, the formulation presents the hydrophilic macromolecule and the permeation enhancer at the surface of the GI mucosal membrane at concentrations sufficient to increase absorption of the hydrophilic macromolecule through the GI mucosal membrane over a period of time. A dosage form incorporates the formulation and may be designed to provide the controlled release of the formulation within the GI tract over a desired period of time. | 2009-04-02 |
20090087485 | Orally Disintegrating Tablets - The present invention describes a directly compressible composite excipient prepared by coating calcium silicate with a carbohydrate. The present invention further describes the incorporation of the composite excipient into a tablet formulation. The orally disintegrating tablets are of optimal mechanical strength and disintegrate within 60 seconds in the oral cavity. | 2009-04-02 |
20090087486 | Foam Wafer Containing a Polyvinyl Alcohol-Polyethyleneglycol-Graft Copolymer - Sheet-like dosage forms dissolving or disintegrating in an aqueous medium for releasing at least one active substance in a body orifice or body cavity. The sheet-like dosage forms comprise a polymer matrix in the form of a solidified foam containing spaces or cavities, as well as at least one pharmaceutical or cosmetic active substance. The polymer of the polymer matrix is a polyvinyl alcohol-polyethylene glycol graft copolymer. Methods for producing such dosage forms are also provided. | 2009-04-02 |
20090087487 | Paliperidone sustained release formulation - The present invention provides sustained release dosage forms comprising Paliperidone and processes for preparing the same. | 2009-04-02 |
20090087488 | GALANTAMINE-CONTAINING CONTROLLED RELEASE ORAL DOSAGE FORMS, PROCESSES FOR THE PREPARATION THEREOF AND USE OF THE MANUFACTURE OF A MEDICAMENT - The present invention relates to controlled release oral dosage forms of galantamine or acceptable salts thereof and processes for the preparation thereof. | 2009-04-02 |
20090087489 | IMATINIB COMPOSITIONS - The invention relates to a pharmaceutical composition, preferably a tablet, containing about 23-29% w/w imatinib and processes for its preparation. | 2009-04-02 |
20090087490 | EXTENDED RELEASE FORMULATION AND METHOD OF TREATING ADRENERGIC DYSREGULATION - A composition and method of treating adrenergic dysregulation by administering the composition is disclosed, wherein the composition comprises a α | 2009-04-02 |
20090087491 | METHOD FOR PREPARING PARTICLES FROM AN EMULSION IN SUPERCRITICAL OR LIQUID CO2 - The present invention relates to a method for preparing particles, notably particles encapsulating an active substance. It also relates to particles obtainable by this process, dispersion thereof, and their use as a vehicle for pharmaceutical, cosmetic, diagnostic, veterinary, phytosanitary active substances or processed foodstuff. | 2009-04-02 |
20090087492 | Processes and Apparatuses for the Production of Crystalline Organic Microparticle Compositions by Micro-Milling and Crystallization on Micro-Seed and Their Use - The present invention relates to a process, for the production of crystalline particles of an active organic compound The process includes the steps of generating a micro-seed by a wet-milling process and subjecting the micro-seed to a crystallization process. The resulting crystalline particles have a mean particle size of less than about 100 μm. The present invention also provides for a pharmaceutical composition which includes the crystalline particles produced by the method described herein and a pharmaceutically acceptable carrier. | 2009-04-02 |
20090087493 | Supramolecular Functionalization of Graphitic Nanoparticles for Drug Delivery - Disclosed are nanoparticles, such as carbon nanotubes or other materials having extended aromatic surfaces (e.g., graphene sheet or nanotube), which are used to deliver active agents such as drugs, labels or dyes (termed for convenience a “drug”) to the interior of cells. The nanoparticles are functionalized by a hydrophilic polymer to render them stable in suspension. This molecule may be covalently attached to the nanoparticle, or may be adsorbed thereto as an amphiphilic molecule. The nanoparticles are coupled to the drug through supramolecular bonding i.e., binding to the exterior of the nanoparticle through π-stacking. The drug may also be covalently bonded to the hydrophilic polymer, which is coupled to the nanoparticle through supramolecular bonding. The drug is therefore capable of release in the cell exterior. The drug is more rapidly released at lower pH, as found e.g., in tumor cells. The drug-coupled, functionalized nanoparticles may also be targeted to specific cells through modification of the hydrophilic polymer, e.g., by adding an RGD peptide, or an antibody, which is targeted to cells expressing integrins, or an antibody directed to a cell surface marker. The drug may also be linked to a branched chain hydrophilic polymer, so that each polymer molecule carries more than one drug bound by a cleavable linker. | 2009-04-02 |
20090087494 | Methods and Compositions for Targeted Delivery of Therapeutic Agents - Compositions and methods for targeted delivery of therapeutic agents, and particularly for mucosal, oral, nasal, or parenteral delivery of therapeutic agents. The compositions comprise carrier particles containing or encapsulating a therapeutic agent or agents, which have been modified on their surface to contain one or more targeting moieties that enable the enhanced uptake and transport of the therapeutic agent via receptor-mediated processes such as endocytosis or transcytosis. | 2009-04-02 |
20090087495 | Food for Improving Motor Function - A food for improving motor function comprising as effective components carnosine and/or anserine and a material for improving motor performance (a material for motor energy source, a material for promoting conversion into energy and/or an antioxidant) is provided. In the invention, by synergistic effect of these components, the motor function or stamina can be improved and recovery from fatigue can be promoted in humans and mammals. Further, any of the effective components of the food for improving motor function of the invention is a naturally occurring component, therefore, the food has a characteristic of high safety. | 2009-04-02 |
20090087496 | PROCESS FOR PREPARING MIXED METAL OXIDE POWDERS - Process for preparing a mixed metal oxide powder, in which oxidizable starting materials are evaporated and oxidized, the reaction mixture is cooled after the reaction and the pulverulent solids are removed from gaseous substances, wherein as starting materials, at least one pulverulent metal and at least one metal compound, the metal and the metal component of the metal compound being different and the proportion of metal being at least 80% by weight based on the sum of metal and metal component from metal compound, together with one or more combustion gases, are fed to an evaporation zone of a reactor, where metal and metal compound are evaporated completely under nonoxidizing conditions, subsequently, the mixture flowing out of the evaporation zone is reacted in the oxidation zone of this reactor with a stream of a supplied oxygen-containing gas whose oxygen content is at least sufficient to oxidize the starting materials and combustion gases completely. | 2009-04-02 |
20090087497 | Compositions and methods for treating symptoms of aging - Compositions and methods are provided that are based on a discovery that a combination of three compounds, doxycycline, selenium, and zinc, retards physiological age-related changes (for example cardiac aging and the decline in exercise capacity) and can also prolong survival. | 2009-04-02 |
20090087498 | Shampoo formulation for treatment of hair loss and method of use - A shampoo formulation comprising a shampoo, bicarbonate soda, and onion skins used alone or in combination with a conditioner comprising acetic acid for the treatment of hair loss and promotion of hair growth. | 2009-04-02 |
20090087499 | DEPILATORY PRODUCT - The invention comprises a depilatory product based on a complexing gel. The product will remove the hair via reduction and hydrolysis as do chemical depilatories. Despite the peeling nature of the product, the hair is not removed by pulling it out like a wax depilatory. The product is to be applied as a single step from a component that allows the mixing of two separate parts during application to the skin. The final gel is plastic and pliable but non-mobile similar to silicone rubber. The gel should possess strength so that it can be removed from the skin as a single piece without breaking or ripping. | 2009-04-02 |
20090087500 | GUAVA LEAF EXTRACT POWDER AND METHOD FOR PRODUCTION THEREOF - To provide a guava leaf extract powder which exhibits less deterioration in quality and functions after storage of the solution thereof for a long period of time. | 2009-04-02 |
20090087501 | Oral Compositions Containing Botanical Extracts - The disclosure provides oral compositions having at least two botanical active ingredients derived from plants. The oral composition also includes an orally acceptable vehicle to deliver an effective amount of the at least two active ingredients in vivo. The botanical active ingredients provide particularly efficacious antimicrobial (antibacterial, antiviral, and/or antifungal), antioxidant, anti-inflammatory, anti-ageing, and or healing properties to the oral compositions. | 2009-04-02 |
20090087502 | Non-toxic Antimicrobial Composition - Disclosed herein are non-toxic antimicrobial compositions for cleaning, reducing the bioburden and substantially killing gram negative and positive bacteria on hard surfaces. The antimicrobial compositions comprise about 0.01% to about 4.0% by weight of one or more oils selected from the group comprising rosemary oil, tea tree oil, spearmint oil, peppermint oil, clove oil, lemongrass oil, cedar oil, and cinnamon oil and about 0.1% to about 4.0% by weight of one or more acids selected from the group comprising carboxylic acids, ascorbic acid, glutamic acid, fumaric acid, oxalic acid and malonic acid. In an embodiment of the invention, an alkali base such as sodium hydroxide or potassium hydroxide is added to the above antimicrobial solution to increase the pH of the antimicrobial solution to a range of about 2.0 to about 4.0 to effect a rapid reduction of the bioburden on the hard surfaces within 5 minutes. | 2009-04-02 |
20090087503 | Use of anabolic agents, anti-catabolic agents, antioxidant agents and analgesics for protection, treatment and repair of connective tissues in humans and animals - The present invention relates to compositions for the protection, treatment and repair of connective tissues in humans and animals comprising any or all of anabolic, anti-catabolic, anti-oxidant and analgesic agents, including aminosugars, S-adenosylmethionine, arachadonic acid, GAGs, including pentosan, collagen type II, tetracyclines or tetracycline-like compounds, diacerin, super oxide dismutase, L-ergothionine, one or more avocado/soybean unsaponifiables, and an analgesic, e.g., acetaminophen, and to methods of treating humans and animals by administration of these novel compositions to humans and animals in need thereof. | 2009-04-02 |
20090087504 | METHOD FOR TREATING DIABETIC COMPLICATIONS - The present invention relates to a method for treating diabetic complications, which comprises administering an extract obtained by: crashing and drying any one selected from Euphorbiae radix, gingered | 2009-04-02 |
20090087505 | Injection molding machine - An injection molding machine is provided. Permanent magnets are attached to a planetary roller spindle and/or ball screw spindle or to the spindle nut of the injection molding machine. Thus, the permanent magnets are integrated into the planetary roller spindle and/or ball screw spindle or to the spindle nut of the injection molding machine. | 2009-04-02 |
20090087506 | BELT-SHAPED MOLD AND NANOIMPRINT SYSTEM USING THE BELT-SHAPED MOLD - There is provided a fine pattern transfer, belt-shaped mold, with which a fine structure having a high aspect ratio can be formed rapidly and stably using nanoimprinting, and a fine pattern transfer system (a nanoimprint system) that employs this mold. According to the present invention, a nanoimprint mold includes: a belt-shaped support member; a plurality of stampers, for each of which a fine convex-and-concave pattern, to be transferred, is formed on one surface; and an adhesive member, to which the belt-shaped support member and the stampers are to be securely adhered, wherein the adhesive member includes a porous member and adhesive layers, which are deposited on either face of the porous member, for impregnating one part of the porous member, and wherein, for the porous member, a porous area that is not impregnated with the adhesive layers, is provided and positioned so as to sandwich the porous member between portions impregnated with the adhesive layers. | 2009-04-02 |
20090087507 | MOLD BASE FOR A THERMOPLASTIC CONTAINER MANUFACTURING MOLD, AND MOLDING DEVICE EQUIPPED WITH AT LEAST ONE MOLD PROVIDED WITH SUCH A BASE - The invention concerns a mold base ( | 2009-04-02 |
20090087508 | PELLET TRANSFER APPRATUS AND METHOD - An apparatus for transferring a mold charge pellet to a molding machine having a mold with a mold cavity includes a hub rotated about an axis, at least one arm extending generally radially from the hub to rotate with the hub around the axis, and a cam system extending at least partially around the axis and operably coupled to the arm for moving the arm along a predetermined path with respect to the axis as the hub and the arm rotate around the axis. In one presently preferred embodiment, at least a portion of the arm traveling along a plane that is parallel to the axis during a portion of said path. | 2009-04-02 |
20090087509 | MULTI-GATE REACTION INJECTION ASSEMBLY FOR USE WITH A CLOSED MOLD FOR MIXING AND SETTING ISO AND POLY FLUID BASED POLYMERS & PLASTICS WITH ONE OR MORE AGGREGATE FILLER MATERIALS - The present invention discloses a multi-gate assembly for creating a composite article, typically including a mold including a closed interior cavity, a first mixing gate in communication with the mold, and at least one iso-based polymer material and at least one poly-based polymer material concurrently fed into the first mixing gate. At least one filler material is fed into a second gate in communication with the first gate, and a composite associated with the iso/poly/filler materials is communicated into the cavity for formation into a three-dimensional article. | 2009-04-02 |
20090087510 | Controller of injection molding machine - The present invention comprises a speed feedback control system for carrying out speed feedback control on the basis of a speed detected value Vd obtained by converting a position detected value Xd obtained from a screw position sensor | 2009-04-02 |
20090087511 | DEVICE FOR MOULDING MIXTURES - The invention relates to a device for moulding mixtures, preferably concrete mixtures for producing blocks. The device comprises a mould for receiving the concrete mixture, a table, to which the mould is coupled by means of brace elements, a vibration generation system, mounted on the table, for generating harmonic vibrations and for transmitting the latter to the table, a load in the form of a ram for exerting a force on the concrete mixture, first spring elements for elastically supporting the table and second spring elements for elastically supporting the load. A device of this type is equipped with at least eight rotating unbalanced shafts with parallel rotational axes in the vibration generation system. The unbalanced shafts are coupled in pairs for their rotational motion, each pair of unbalanced shafts having a common rotational axis and being driven independently of the other pairs. | 2009-04-02 |
20090087512 | Encapsulated fractions isolated or derived from hops - The invention provides an encapsulation composition comprising a fraction isolated or derived from hops encapsulated in a matrix selected from at least one of the group consisting of a phytosterol and a cyclodextrin. | 2009-04-02 |
20090087513 | Fiber and fatty acid composition and method of making same - The invention is a mixture of soluble dietary fibers in conjunction with omega three fatty acids designed to add soluble, heart healthy fibers and omega three fatty acids into a balanced diet by food manufacturers incorporating as part of the food matrix, or by end users. | 2009-04-02 |
20090087514 | Waterless coffee pouch - A waterless coffee pouch is presented. The waterless coffee pouch includes a piece of permeable material that allows fluids to pass through. A quantity of ground coffee beans is placed on the material where the material is folded to form a pouch to contain the ground coffee beans. The pouch is a suitable size for placement in a person's mouth. A means for sealing the pouch is provided such that the ground coffee beans remain contained within the pouch when the pouch is placed in a person's mouth and the coffee flavor is released into the person's mouth through the material so that the person using the pouch may enjoy the flavor and benefits of ground coffee beans without the use of water. | 2009-04-02 |
20090087515 | GENE ENCODING ACETOLACTATE SYNTHASE AND USE THEREOF - The present invention relates to an acetolactate synthase gene and use thereof, in particular, a brewery yeast for producing alcoholic beverages with superior flavor, alcoholic beverages produced with said yeast, and a method for producing said beverages. More particularly, the present invention relates to a yeast, whose capability of producing vicinal diketones, especially diacetyl, that are responsible for off-flavors in products, is reduced by repressing expression level of ILV2 gene encoding an acetolactate synthase (Ilv2p), especially non-ScILV2 gene specific to a lager brewing yeast, and to a method for producing alcoholic beverages with said yeast. | 2009-04-02 |
20090087516 | Dried meat product and method for making same - The present dried meat products and method for making dried meat products (dried meat product) does not add any preservative compounds containing nitrates and nitrites to preserve the meat product. The present dried meat product includes a meat tissue that is mixed with a marinade that contain cranberries, starter culture, and vegetable juice, in addition to other ingredients without the addition of nitrate or nitrite specific containing compounds. The marinated meat tissue is then fermented, dried, smoked, and preferably dried again. This process provides natural preservatives without the addition of nitrate or nitrite containing preservative compounds. | 2009-04-02 |
20090087517 | BACTERIAL GROWTH ENHANCER - We describe the production and use of an extract obtained from | 2009-04-02 |
20090087518 | Heteromorphic Lysine Feed Granules - A heteromorphic granule comprising lysine free base and a lysine salt is disclosed. A fertilizer composition is set forth having cores containing an acid salt of a basic amino acid and effective amounts of first and second layer coatings coated sequentially to the surface of each core. A method for using the heteromorphic granule as a fertilizer and/or an animal feed is provided. | 2009-04-02 |
20090087519 | Nutrition Products - The present invention provides a nutrition product comprising a first region comprising at least 10% by weight of said first region of one or more oxidisable materials containing monounsaturated and/or polyunsaturated fatty acids, and a second region comprising 0.002% to 1.0% by weight of said second region of one or more oxidising materials selected from chromium, manganese, iron, cobalt, nickel, copper, selenium and zinc and wherein the oxidisable materials and the oxidising materials in the nutrition product are comprised in different regions of the product. The nutrition products have good organoleptic properties and exhibit good stability, both physical and chemical, upon storage. They also provide a convenient way of incorporating the above-mentioned nutrients into the diet. | 2009-04-02 |
20090087520 | Advertising inserts for fortune cookies and methods for their dissemination - Methods for disseminating advertising messages to consumers of fortune cookies are provided for. The methods comprise providing novel inserts constructed in accordance with the subject invention. The novel inserts have imprinted thereon an advertising message which may be viewed by a consumer. Fortune cookies are produced with novel inserts carried therein, and the fortune cookies are distributed to consumer outlets, such as food service establishments, and thence to consumers associated with the consumer outlets. | 2009-04-02 |
20090087521 | PARTICULATE FILLED EDIBLE PRODUCT AND PROCESS FOR MAKING - The subject invention relates to a particulate filled edible product and a method of making the particulate filled edible product. The edible product comprises an edible shell of dough that defines an enclosed cavity having a cavity volume. At least one edible food particulate is disposed within the cavity. The food particulate has a particulate volume that is less than the cavity volume and the at least one food particulate moves freely in the cavity. | 2009-04-02 |
20090087522 | PACKAGED PROTEIN-ENRICHED FOOD PRODUCT - A protein-enriched food product having enhanced texture characteristics combined with ease of use, a method of its manufacture and a method of its packaging is disclosed. The protein-enriched food product comprises a coarsely granulated mixture of cereal pieces combined with a finely granulated high-protein powder mixture. The cereal mixture has a moisture level between 2% and 20% by weight, and comprises a edible fiber material so that fiber content is between 2% and 20% by weight. The protein powder mixture has a moisture level between 2% and 15% by weight, and includes about 50 to 95% by weight of protein. A novel method of manufacture and packaging disclosed permits a consistent blending of the coarsely granulated mixture of cereal pieces with the finely granulated protein powder mixture in a compact package, while maintaining the larger granularity of the cereal mixture. | 2009-04-02 |
20090087523 | SYSTEM AND METHOD FOR FLAKING GRAINS - A system and method are provided for flaking grains. The system and method provide for an automated system to minimize manual intervention, yet optimize a steam flaking process. A calibration technique may be included to assist in automatic adjustment of system parameters to account for less than optimal operating conditions. Control of the system may occur from a remote location wherein a user is provided an interface, and a user's computer communicates with an industrial controller such as a PLC, through the Internet or a private network. The PLC is typically located at the site where the grain is to be processed. The PLC may receive various system inputs and generate system control outputs in accordance with programs installed on the PLC, or through some selected manual intervention as controlled by the user at the remote location. | 2009-04-02 |
20090087524 | Foodstuff Processing - A method of processing food elements of plant tissue having a cellular structure with substantial starch content comprising arranging the food elements in an aqueous liquid and applying acoustic energy with a selected frequency energy and time profile to modify the cellular structure of a surface portion of the food elements by removing components from the cellular structure and establishing a pectin based and adapted to act as a barrier in a high temperature subsequent cooking process, the modified cellular structure providing for a relatively low moisture surface portion to be established and maintained and moisture to be substantially retained in the core portion after subsequent cooking processes. | 2009-04-02 |
20090087525 | MANUFACTURING OF POLYSACCHARIDE BASED NUTRITIONAL SUPPLEMENT - A polysaccharide based nutritional supplement is made of raw materials including agaricus powder, ganoderma powder, ganoderma lucidum natural mushroom powder, yeast, soy isoflavone, water, alcohol, minerals, vitamins, and milk sugar that are uniformly mixed with appropriate proportions and then mixed with a liquid mixture of water and alcohol in appropriate proportions to carry out mincing and mixing/stirring operation, followed by slow drying to convert the powders into dried pellets, which are then subjected to sizing/shaping operation to form uniformly-sized particles. The uniformly-sized particles are then coated with | 2009-04-02 |
20090087526 | Alcohol-dipped material, food or drink using the same and method of production thereof - The present invention provides a method of producing an alcohol-dipped material or a food or drink using the same which comprises the following steps: (a) freezing one or more fruits and/or vegetables employed as a raw material; (b) micro grinding the frozen matter; and (c) dipping the micro ground matter in an alcohol having a concentration at which one or more components of the raw material can be extracted (preferably a 15% to 100% alcohol). The alcohol-dipped material thus obtained can be suitably usable as a starting alcohol drink for producing a low-alcohol drink. According to the method of the invention, the alcohol-dipped material or the food or the drink thus obtained can contain a sufficient amount of an efficacious and effective component contained in the vegetable(s) and/or fruit(s), for example, vitamin P. | 2009-04-02 |
20090087527 | SHREDDED READY-TO-EAT CEREAL WITH OATS - A method of producing cooked cereal grains containing a high level of whole oats for a shredded ready-to-eat cereal. The method begins by disposing a whole grain oat into a mixer. The whole grain oat has an exposed first starch. Next, a second whole grain is disposed into the mixer. The second whole grain has an exposed second starch that is different from the first starch. A third starch is disposed into the mixer to act as a binder of the whole grain oat and second whole grain. Water is added to the mixer to form a mixture that is cooked to form cooked cereal grains containing high levels of whole oats. The cooked grains are shredded and layered to form a shredded wheat-like biscuit. | 2009-04-02 |
20090087528 | Method of Improving the Biocidal Efficacy of Dry Ice - A manufactured dry ice product containing ozone entrapped or absorbed on said dry ice. The dry ice product can be used to chill and preserve food products and provides the added benefit of ozonation of the food product to kill bacteria. Novel processes for ozonating liquid and solid CO | 2009-04-02 |