| Entries |
| Document | Title | Date |
|---|
| 20080213399 | Combination Therapies Using Hdac Inhibitors - The present invention pertains to a method for treating cancer, such as lung cancer, multiple myeloma, lymphoma, and epithelial ovarian cancer, comprising the administration to a patient in need thereof a first amount or dose of a histone deacetylase (HDAC) inhibitor, such as PXD-101, and a second amount or dose of another chemotherapeutic agent, such as dexamethasone or 5-fluorouracil, or an epidermal growth factor receptor (EGFR) inhibitor, such as TarcevaÚ, wherein the first and second amounts or doses together comprise a therapeutically effective amount. | 09-04-2008 |
| 20080220092 | Biosynchronous transdermal drug delivery for longevity, anti-aging, fatigue management, obesity, weight loss, weight management, delivery of nutraceuticals, and the treatment of hyperglycemia, alzheimer's disease, sleep disorders, parkinson's disease, aids, epilepsy, attention deficit disorder, nicotine addiction, cancer, headache and pain control, asthma, angina, hypertension, depression, cold, flu and the like - Systems and methods for longevity, anti-aging, fatigue management, obesity, weight loss, weight management, delivery of nutraceuticals, and treating hyperglycemia, Alzheimer's disease, sleep disorders, Parkinson's disease, Attention Deficit Disorder and nicotine addiction involve synchronizing and tailoring the administration of nutraceuticals, medications and other substances (for example, stimulants) in accordance with the body's natural circadian rhythms, meal times and other factors. Improved control of blood glucose levels, extended alertness, and weight control, and counteracting of disease symptoms when they are at their worst are possible. An automated, pre-programmable transdermal administration system is used to provide pulsed doses of medications, pharmaceuticals, hormones, neuropeptides, anorexigens, pro-drugs, stimulants, plant extracts, botanicals, nutraceuticals, cosmeceuticals, phytochemicals, phytonutrients, enzymes, antioxidants, essential oils, fatty acids, minerals, vitamins, amino acids, coenzymes, or other physiological active ingredient or precursor. The system can utilize a pump, pressurized reservoir, a system for removing depleted carrier solution, or other modulated dispensing actuator, in conjunction with porous membranes or micro-fabricated structures. | 09-11-2008 |
| 20080220093 | METHODS FOR PRODUCTION OF THE OXIDIZED GLUTATHIONE COMPOSITE WITH CIS-DIAMMINEDICHLOROPLATINUM AND PHARMACEUTICAL COMPOSITIONS BASED THEREOF REGULATING METABOLISM, PROLIFERATION, DIFFERENTIATION AND APOPTOTIC MECHANISMS FOR NORMAL AND TRANSFORMED CELLS - The present invention relates to a composite for the treatment of a variety of medical conditions, the composite comprising an oxidized gluthathione-based compound, which has a disulfide bond, and a metal material, in particular where the metal is either platinum or palladium. The oxidized glutathione-based compound and metal material can be present in a ratio of 3000 to 1 and preferably 1000 to 1. The oxidized glutathione-based compound can be oxidized glutathione itself or salts or derivatives. A feature of the invention is that the composite has a more stabilized disulfide bond than the oxidized glutathione-based compound itself. Methods for preparing the composite are provided, such methods being beneficial in that the composite is provided in high yields and at high purity. Methods for treating various medical conditions with the composites of the present invention are also disclosed. | 09-11-2008 |
| 20080226747 | PHARMACEUTICAL FORMULATIONS COMPRISING SALTS OF A PROTEIN KINASE INHIBITOR AND METHODS OF USING SAME - The present invention relates to pharmaceutical formulations comprising the protein kinase inhibitor, MP470, and methods of using same in treating conditions involving undesirable cell proliferation, such as cancer. | 09-18-2008 |
| 20080233208 | USE OF ERIANIN IN PREPARING PHARMACEUTICAL FOR TREATING TUMORS - This invention relates to a use of the compound of formula (I), Erianin, in preparing pharmaceutical for treating tumors | 09-25-2008 |
| 20080241274 | Indibulin therapy - The invention provides combination therapy, wherein one or more other therapeutic agents are administered with indibulin or a pharmaceutically acceptable salt thereof and the combination is synergistic. Another aspect of the invention relates to the treatment of cancer with indibulin as a single agent. Another aspect of the invention relates to dosing regimen for administration of oral dosage forms of indibulin. | 10-02-2008 |
| 20080248134 | Oral compositions, use and combinations of N-[2-(dimethylamino)ethyl]-2,6 dimethyl-1-oxo-1,2-dihydrobenzo[b]-1,6-naphthyridine-4-carboxamide and closely related analogues thereof - This invention relates to compositions including a compound of Formula I | 10-09-2008 |
| 20080254145 | Anti-tumor drug, medicament, composition, and use thereof - The present invention relates to an active polypeptide comprising the amino acid sequence of SEQ ID NO:3, or having at least 50%, preferably 70%, more preferably 90% identity with the amino acid sequence of SEQ ID NO:3, or fragments thereof having at least 21 contiguous amino acids, or peptides having at least 50%, preferably 70%, more preferably 90% identity with the amino acid sequence of the fragments, provided that the polypeptide is not SEQ ID NO:2. | 10-16-2008 |
| 20080268068 | Sparc Promoter Mutations Associated with Drug Resistance, and Methods, Oligonucleotides, Cells and Arrays Associated Therewith - The invention provides oligonucleotide or peptide nucleic acids, peptide nucleic acids, arrays, cells, methods and kits for determining the presence or absence of a SPARC promoter mutation indicative of a cancer's resistance or sensitivity to a therapeutic regimen. The method generally comprises determining presence or absence of a SPARC promoter mutation for a subject's cancer. The invention also provides for methods of identifying potential subjects having a resistant cancer for selection to administer an alternative therapy regimen. The invention also provides for methods of treating such subjects with a therapeutic regimen based on the subject's genotype. | 10-30-2008 |
| 20080286381 | Anti-tumor drug, medicament, composition, and use thereof - An active polypeptide includes the amino acid sequence of SEQ ID NO:3, or having at least 50%, preferably 70%, more preferably 90% identity with the amino acid sequence of SEQ ID NO:3, or fragments thereof having at least 20 contiguous amino acids, or peptides having at least 50%, preferably 70%, more preferably 90% identity with the amino acid sequence of the fragments, provided that the polypeptide is not SEQ ID NO:2. | 11-20-2008 |
| 20080311223 | INJECTABLE POLYMER-LIPID BLEND FOR LOCALIZED DRUG DELIVERY - An injectable polymer-lipid blend is provided as a localized drug delivery system for a pharmaceutically active agent. The blend may be prepared from a chitosan-based material, fatty acid and phospholipid. The chitosan-based material may be a water soluble chitosan derivative. The fatty acid may be a fatty acid or a fatty aldehyde, such as laurinaldehyde, having an acyl chain length of C8-C16. The rheological properties of the blend relates to the ratio of the components and to the acyl chain length of the fatty acid. The injectable system is well suited for the delayed release of pharmaceutically active agents in the treatment of cancer and other diseases requiring localized drug delivery. | 12-18-2008 |
| 20080317870 | Compositions and Mehtods for Treating and Preventing Cancer Using Analogs of Vitamin D - Disclosed are compositions and methods used to treat and/or prevent cancer and metabolic diseases, such as psoriasis. In one aspect, the present invention pertains to the use of cross-linking analogs of vitamin D and its metabolites employed for the treatment of prostate cancer. | 12-25-2008 |
| 20090004293 | Phosphorous Containing Compounds Including Triphenylmethylphosphonate Esters for the Treatment of Melanoma and Other Cancers - Compounds and related methods for synthesis, and the use of compounds and combination therapies for the treatment of cancer and modulation of apoptosis in cells are disclosed. Particularly disclosed are phosphonate esters. Compounds, methods of making the compounds, medicaments and method of manufacture of medicaments and therapeutic methods with applications against cancer including breast cancer, melanoma, colon cancer, leukemia and lymphoma, and other cancer cells are described. | 01-01-2009 |
| 20090004294 | PERSONAL LUBRICANT FORMULATIONS COMPRISING COLLOIDAL METALS AND METHODS OF USE - Lubricant compositions and methods are disclosed for aiding and enhancing massage or sexual activity, treating and preventing sexually transmitted diseases, and preventing pregnancy by administering a colloidal metal containing composition. Colloidal metal containing compositions that include metal flakes, sperm-function inhibitors, antimicrobial agents, analgesics, plant extracts, anti-oxidizing agents, and anti-inflammatory agents are also provided and may advantageously be used to in the methods of the invention. | 01-01-2009 |
| 20090011049 | Methylation Markers for Prognosis and Treatment of Cancers - Genes for thirteen DNA damage repair or DNA damage response enzymes can be epigenetically silenced in cancers. The silencing of nucleic acids encoding a DNA repair or DNA damage response enzyme can be used prognostically and for selecting treatments that are well tailored for an individual patient. Combinations of these markers can also be used to provide prognostic information. Kits for testing epigenetic silencing can be used to determine a prognosis or a therapeutic regimen. | 01-08-2009 |
| 20090022814 | CANCER TREATMENT METHOD - Invented is a method of treating cancer in a mammal, including a human, in need thereof which comprises the administration of an effective amount of a TPO cell cycle activator and a chemotherapeutic agent to such mammal. | 01-22-2009 |
| 20090035394 | USE OF DNA-PK INHIBITION TO SENSITISE ATM DEFICIENT CANCERS TO DNA-DAMAGING CANCER THERAPIES - This invention relates to the finding that inhibition of the catalytic subunit of DNA protein kinase (DNA-PKcs) increases the sensitivity of cancer cells that display an ATM deficient phenotype to DNA damaging therapies, such as irradiation or chemotherapy. Methods of treating cancers displaying an ATM deficient phenotype and methods of determining the susceptibility of a patient to such methods are provided. | 02-05-2009 |
| 20090047365 | Novel Concomitant Use of Sulfonamide Compound with Anti-Cancer Agent - The present invention relates to a pharmaceutical composition, a kit, a method of treating cancer and/or a method of inhibiting angiogenesis comprising a sulfonamide compound in combination with a platinum complex, a DNA-topoisomerase I inhibitor, an antimetabolite, a microtubule inhibitor or an antibiotic. | 02-19-2009 |
| 20090068286 | METHOD OF TREATING CANCER BY ADMINISTRATION OF 5-SUBSTITUTED NUCLEOSIDES - The invention relates to methods of administration of at least one overexpression inhibitor of DNA repair genes and/or oncogenes (e.g., (E)-5-(2-bromovinyl)-2′-deoxyuridine (BVDU), or a prodrug, or salt thereof) to increase the cytotoxic effect of a cytostatic or cytotoxic chemotherapeutic agent during and/or after chemotherapy, e.g., in the treatment of cancer. | 03-12-2009 |
| 20090074884 | FAMILY OF PFKFB3 INHIBITORS WITH ANTI-NEOPLASTIC ACTIVITIES - A methods and compounds for inhibiting 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase 3 (PFKFB3) are described. Also described are methods of inhibiting cell proliferation, treating cancer, and screening compounds to determine their ability to inhibit PFKFB3. | 03-19-2009 |
| 20090074885 | Reversible Hydrophobic Modification of Drugs for Improved Delivery to Cells - Described are drug formulations that increase regional delivery of the drugs to cells. Methods for reversibly increasing the hydrophobicity of a drug through hydrolytically labile attachment of a hydrophobic moiety and methods for delivering the modified drug to cells are described. Hydrophobic modification increases drug delivery, while lability minimizes entry of the drug into non-target cells. | 03-19-2009 |
| 20090092684 | SMALL MOLECULE ANTAGONISTS OF BCL-2 FAMILY PROTEINS - The present invention relates to naturally occurring and chemically synthesized small molecule antagonists of Bcl-2 family proteins. In particular, the present invention provides gossypol compounds (e.g., isomers, enantiomers, racemic compounds, metabolites, derivatives, pharmaceutically acceptable salts, in combination with acids or bases, and the like) and methods of using these compounds as antagonists of the anti-apoptotic effects of Bcl-2 family member proteins (e.g., Bcl-2, Bcl-X | 04-09-2009 |
| 20090098218 | Tetracyclic Lactame Derivatives - The present invention describes tetracyclic compounds of formula (IA) or (IB), | 04-16-2009 |
| 20090104285 | Methods and Compositions for Use in Treating Cancer - The invention provides methods and compositions for use in treating diseases associated with excessive cellular proliferation, such as cancer. | 04-23-2009 |
| 20090110753 | Enzyme-cleavable prodrug compounds - The prodrug of the invention is a modified form of a therapeutic agent and comprises a therapeutic agent, an oligopeptide, a stabilizing group and, optionally, a linker group. The prodrug is cleavable by the enzyme Thimet oligopeptidase, or TOP. Also disclosed are methods of designing prodrugs by utilizing TOP-cleavable sequences within the conjugate and methods of treating patients with prodrugs of the invention. | 04-30-2009 |
| 20090117204 | BENZOISOSELENAZOLE DERIVATIVES WITH ANTI-INFLAMMATION, ANTIVIRUS AND ANTITHROMBOSIS ACTIVITY AND THEIR USE - The present invention relates to new bisbenzisoselenazolonyl derivatives of the following general formulae (I), (II) or (III) and their pharmaceutically acceptable salts. The inventive derivatives have antineoplastic, anti-inflammatory and antithrombotic activities. | 05-07-2009 |
| 20090123567 | BISBENZISOSELENAZOLONYL DERIVATIVES HAVING ANTINEOPLASTIC, ANTI-INFLAMMATORY AND ANTITHROMBOTIC ACTIVITIES AS WELL AS THEIR USE - The present invention relates to new bisbenzisoselenazolonyl derivatives of the following general formula (I), wherein R is C | 05-14-2009 |
| 20090130228 | PHARMACEUTICAL COMBINATION FOR THE TREATMENT AND OR CHEMOSENSIBILIZATION OF REFRACTORY TUMORS TO ANTICANCER DRUGS - This invention is related to a pharmaceutical combination that contains a Casein kinase 2 (CK2) peptide inhibitor (termed P15) along with the standard chemotherapeutic drugs used in cancer treatment and which are administered together, separated or sequentially. The chemothearapeutic drugs include cisplatin, taxol, alkaloids from Vinca, 5-fluorouracil, doxorubicin, cyclophosphamide, etoposide, mitomicin C, imatinib, iressa and velcade (vortezomib). The synergism between the P15 peptide and the anticancer drugs achieves an efficient concentration of each cytostatic drug in the combination which is from 10- to 100-fold lower than that for each cytostatic drug alone. The pharmaceutical combination described in this invention exhibits lower toxicity compared to that reported by the anticancer therapeutics and therefore, it represents a crucial advantage for its use in cancer therapy. Furthermore, the sequential administration of this pharmaceutical combination through the pretreatment with the P15 peptide leads to the chemo sensibilization of refractory tumors to the anticancer therapeutics. | 05-21-2009 |
| 20090130229 | Antitumor uses of compound - The use of an arylidene 2-indolinone derivative for treating tumors involving Met, PDGF-R, FGF-RI, FGF-R3 or Kit tyrosine kinases, or a Ret oncoprotein which includes a MEN2-associated mutation is disclosed. | 05-21-2009 |
| 20090136595 | ANTI-WRINKLE COSMETIC COMPOSITION - The present invention relates to a composition for treating skin comprising an acylated short chain bioactive peptide and fulvic acid, and optionally colloidal gold. The invention further relates to a method for topically administering the composition in an amount therapeutically effective to reduce wrinkles by building the dermal fibroblast matrix. The invention further relates to a method of treating wrinkled skin by topically administering the composition to an individual in need of such treatment. | 05-28-2009 |
| 20090136596 | P38 INHIBITORS AND METHODS OF USE THEREOF - This invention relates to inhibitors of p38 and methods of utilizing the inhibitors and pharmaceutical compositions thereof in the treatment and prevention of various disorders mediated by p38. | 05-28-2009 |
| 20090142413 | Targeted short-lived drug delivery - An aspect of the disclosure includes a system for delivering therapeutic agents. In an embodiment, the system includes an implantable medical device comprising at least one reservoir that holds at least one therapeutic agent. Additionally the device includes a delivery mechanism that provides non-systemic in vivo delivery of the at least one therapeutic agent to a local area of an animal in a therapeutically-effective concentration, wherein the therapeutically-effective concentration is in excess of a concentration that would produce a toxic effect when administered systemically to the animal. Furthermore, the at least one therapeutic agent has short half-life. A further aspect of the disclosure includes a method of delivering a therapeutic agent in vivo at non-systemic high doses to a localized area of an animal. | 06-04-2009 |
| 20090162454 | Compositions and Methods for Effecting NAD+ Levels Using A Nicotinamide Phosphoribosyl Tranferase Inhibitor - The present invention relates to methods for decreasing cellular DNA repair in a target patient; decreasing cellular NAD | 06-25-2009 |
| 20090208590 | Analogs of Benzoquinone-Containing Ansamycins and Methods of Use Thereof - The present invention provides analogs of benzoquinone-containing ansamycins and uses thereof for treating and modulating disorders associated with hyperproliferation, such as cancer. The present invention provides analogs of benzoquinone-containing ansamycins where the benzoquinone is reduced to a hydroquinone and trapped by reaction with a suitable acid, preferably ones that increase the solubility and air stability of the resulting 17-ammonium hydroquinone ansamycin analog. | 08-20-2009 |
| 20090214669 | Combination anticancer therapy and pharmaceutical compositions therefore - This invention relates to anticancer therapy and more precisely to the immunological control of cancer. | 08-27-2009 |
| 20090214670 | Rhcc peptide and uses thereof - The present invention relates to different uses of an RHCC peptide and/or a fragment thereof. Said RHCC peptide and/or fragment thereof enables an uptake and association of a drug and/or a substance into a cavity of said peptide and/or fragment, for the delivery and release of such a substance and/or drug to a target site of interest, or for removal of a substance from a fluid or a non-fluid matter, such as from a bodily tissue or a bodily fluid. An RHCC peptide and/or a fragment thereof, may also in one context be used in the production of nanoparticles, or as a catalyst in a chemical reaction. In a preferred aspect, said RHCC peptide and/or fragment thereof, comprises a drug delivery system for the delivery of a drug to a site of interest in a living body. | 08-27-2009 |
| 20090214671 | Personalizing Cancer Chemotherapy Based on Methylation and Germ-Line Mutational Analysis of BRCA-1 - The present invention relates to a method for personalized diagnosing, prognosing, and treating of diseases, such as cancer, and in particular to a method for the personalized treatment of breast and/or ovarian cancer, based on a methylation and germ-line mutational analysis of the gene BRCA-1. | 08-27-2009 |
| 20090232906 | Treatment methods and compositions for lung cancer, adenocarcinoma, and other medical conditions - The present invention discloses and claims: (i) compositions, methods, and kits which lead to an increase in patient survival time in cancer patients receiving chemotherapy; (ii) compositions and methods which cause cytotoxic or apoptotic potentiation of the anti-cancer activity of chemotherapeutic agents; (iii) compositions and methods for maintaining or stimulating hematological function in patients in need thereof, including those patients suffering from cancer; (iv) compositions and methods for maintaining or stimulating erythropoietin function or synthesis in patients in need thereof, including those patients suffering from cancer; (v) compositions and methods for mitigating or preventing anemia in patients in need thereof, including those patients suffering from cancer; (vi) compositions and methods for maintaining or stimulating pluripotent, multipotent, and unipotent normal stem cell function or synthesis in patients in need thereof, including those patients suffering from cancer; (vii) compositions and methods which promote the arrest or retardation of tumor progression in those cancer patients receiving chemotherapy; (viii) compositions and methods for increasing patient survival and/or delaying tumor progression while maintaining or improving the quality of life in a cancer patient receiving chemotherapy; (ix) novel methods of the administration of taxane and/or platinum medicaments and a Formula (I) compound of the present invention to a cancer patient; and (x) kits to achieve one or more of the aforementioned physiological effects in a patient in need thereof, including those patients suffering from cancer. | 09-17-2009 |
| 20090232907 | Compositions and methods for treatment of esophageal cancer - Novel ureyl-substituted naphthalimide derivatives, pharmaceutically acceptable salts thereof and solvates thereof, are useful for making pharmaceutical compositions for the treatment of cell proliferative diseases such as cancer. The invention also provides methods of treating specific types of cancer such as prostate, esophageal, glioblastoma, gliosarcoma, NSCLC, head and neck, and breast with the compounds described herein alone and in combination with antineoplastic agents. | 09-17-2009 |
| 20090238896 | COMPOSITIONS AND METHODS FOR DIAGNOSING AND TREATING MELANOMA - Described herein are compositions and methods for the diagnosis, prognosis, prevention and treatment of melanoma or melanoma associated symptoms. The compositions are microRNA molecules associated with melanoma, as well as various nucleic acid molecules relating thereto or derived therefrom. | 09-24-2009 |
| 20090258089 | Chemo- and Radiation-sensitization of Cancer by Antisense TRPM-2 Oligodeoxynucleotides - Administration of antisense oligodeoxynucleotides (ODN) targeted against the testosterone-repressed prostate message-2 (TRPM-2) gene can reduce the amount of TRPM-2 in renal cell cancer (RCC) cells and other cancer cells, and as a result enhance chemosensitivity of these cells to chemotherapy agents and radiation. Thus, for example, the sensitivity of renal cell cancer cells to a chemotherapeutic agent can be increased by exposing renal cell cancer cells to a chemotherapeutic agent and an agent which reduces the amount of TRPM-2 in the renal cell cancer cells. This provides an improved method for treatment of renal cell cancer, which is generally resistant to treatment with known chemotherapy agents. | 10-15-2009 |
| 20090263504 | METHODS AND COMPOSITIONS FOR PROMOTING ACTIVITY OF ANTI-CANCER THERAPIES - The present invention relates to a method of inhibiting growth of a cancerous cell. The method includes the step of exposing the cancerous cell to an anti-cancer therapy and an effective amount of a steroid saponin. | 10-22-2009 |
| 20090269421 | COATING MATERIAL - It is an object of the present invention to provide a coating material for a biomedical material surface which can control cell adhesiveness/non-cell adhesiveness and improve the biocompatibility of a material surface. The present invention provides a coating material for a surface of a biomedical material, which comprises a recombinant gelatin. | 10-29-2009 |
| 20090269422 | METHODS FOR CONTROLLING ANGIOGENESIS AND CELL PROLIFERATION - The present invention relates generally to methods of inhibiting angiogenesis in a patient by administering an effective angiogenesis-inhibiting amount of a thrombin inhibitor, and to the treatment of disease states that result from uncontrolled cell proliferation by administering a thrombin inhibitor alone or co-administering a thrombin inhibitor with an anticancer or cytotoxic agent. Specifically, the thrombin inhibitors used in the methods of the present invention are hirudins. | 10-29-2009 |
| 20090274773 | ANTIPROLIFERATIVE COMBINATION COMPRISING CYC-682 AND A CYTOTOXIC AGENT - A first aspect of the invention relates to a combination comprising 2′-cyano-2′-deoxy-N4-palmitoyl-1-beta-D-arabi-nofuranosyl-cytosine, or a metabolite thereof, or a pharmaceutically acceptable salt thereof, and a cytotoxic agent selected from (a) a vinca alkaloid; (b) a taxane; (c) a cytosine analogue; (d) an anthracycline; and (e) a platinum antineoplastic agent. A second aspect of the invention relates to a pharmaceutical product comprising the above combination as a combined preparation for simultaneous, sequential or separate use in therapy. A third aspect of the invention relates to a method for treating a proliferative disorder, said method comprising simultaneously, sequentially or separately administering the above combination. | 11-05-2009 |
| 20090285908 | METHOD OF TREATING ENDOTHELIAL INJURY - The use of human erythropoietin (EPO) to prevent or treat endothelial injury due to chemotherapy, radiation therapy, mechanical trauma, or to a disease state which damages the endothelium (such as inflammation, heart disease or cancer) is described. The use of EPO in conjunction with the administration of chemotherapeutic agents is described. | 11-19-2009 |
| 20090304817 | Glycosylation Variants of Ricin-Like Proteins - The present invention provides glycosylation variants of recombinant proteins and nucleic acids that encode such recombinant proteins, which are useful as therapeutics against cancer, and viral, parasitic and fungal infections. The proteins and nucleic acids have A and B chains of ricin-like toxin linked by a linker sequence that is specifically cleaved and activated by proteases specific to disease-associated pathogens or cells. The invention also relates to methods of inhibiting or destroying cells affected by a disease, methods of treating a mammal with a disease, and pharmaceutical compositions using the recombinant proteins and nucleic acids of the invention. | 12-10-2009 |
| 20090311343 | Thiazole Compounds, and Compositions and Methods Using Same - The present invention provides, in part, compounds and compositions including a thiazole moiety, that may be useful, for example, for treating cancers, for example kidney cancer. | 12-17-2009 |
| 20090311344 | Dosing Regimen - The present invention provides a method for treating hematological disorders such as anemia and thrombocytopenia, whereby a TPO mimetic peptide compound is administered using a specified dosing regimen. The dosing regimen involves the administration of the TPO mimetic peptide compound within a specified time frame surrounding administration of a chemotherapeutic agent. The dosing regimen also involves monitoring subject response in order to determine future course of treatment. | 12-17-2009 |
| 20090311345 | NATURAL ORIENTAL MEDICINAL COMPOSITION FOR THE PROMOTION OF HAIR GROWTH AND METHOD OF PREPARING THE SAME - A natural oriental medicinal composition for the promotion of hair growth is provided. The oriental medicinal composition includes a black bean extract, a tangerine extract, a potato extract, a pine needle extract and a quartzite powder. Since the oriental medicinal composition includes crude drugs extracted from natural substances that can prevent hair loss, it is effective for hair growth and has ensured biostability. Particularly, the oriental medicinal composition allows newborn hair to grow in the form of stiff hair. | 12-17-2009 |
| 20090317489 | Combination Comprising an Iron Chelator and an Anti-Neoplastic Agent and Use Thereof - The present invention relates to a combination comprising a a substituted 3,5-diphenyl-1,2,4-triazole, e.g. 4-[3,5-bis(2-hydroxyphenyl)-[1,2,4]triazol-1-yl]benzoic acid and at least one anti-neoplastic agent and to the use of said combination for the preparation of a medicament for the treatment of proliferative diseases. | 12-24-2009 |
| 20090317490 | SUBSTITUTED CHROMAN DERIVATIVES, MEDICAMENTS AND USE IN THERAPY - Novel substituted chroman derivatives and intermediate compounds, compositions containing same, methods for their preparation and uses thereof as therapeutic agents particularly as anti-cancer and chemotherapeutic selective agents are described. | 12-24-2009 |
| 20090324741 | INJECTABLE POLYMER-LIPID BLEND - An injectable polymer-lipid blend is provided. The blend may provide a localized drug delivery system for a pharmaceutically active agent. The blend may be prepared from a chitosan-based material, fatty acid and phospholipid. The chitosan-based material may be a water soluble chitosan derivative. The fatty acid may be a fatty acid or a fatty aldehyde, such as laurinaldehyde, having an acyl chain length of C8-C16. The rheological properties of the blend relates to the ratio of the components and to the acyl chain length of the fatty acid. The injectable system is well suited for the delayed release of pharmaceutically active agents in the treatment of cancer and other diseases requiring localized drug delivery. | 12-31-2009 |
| 20090324742 | Peham dendrimers as excipients - The present invention concerns poly(etherhydroxylamine) PEHAM dendritic polymers wherein they function as excipients for the enhancement of water solubility of poorly water soluble (hydrophobic) Active Materials or enhancement of oil solubility of poorly oil soluble (hydrophilic) Active Materials. These dendritic polymers can have Active Materials associated with them by one or more of the following: (a) by adsorption onto the surface or (b) encapsulation into the interior of the dendritic polymers or (c) a mixture of both where these interactions are driven by one or more of the following (i) electrostatic attraction, (ii) hydrogen bonding between dendritic polymers and Active Material and (iii) hydrophobic or hydrophilic interactions or mixtures of these interactions. Additionally, these associated Active Materials can be associated with dendritic polymers through chemical bonding to the surface or to internal functionalities (IF) of PEHAM dendritic polymers or both. Such bonding is done either directly between PEHAM dendritic polymers and Active Material molecules or via a linker that can have a hydrolysable bond to the Active Material. In addition, a chemical entity with strong interaction to the Active Material and dendritic polymers can be associated with the dendritic polymer prior to adsorption or encapsulation of the Active Material or together with the Active Material. | 12-31-2009 |
| 20090324743 | PULMONARY DRUG DELIVERY - The present invention relates to formulations for delivery of drugs to the respiratory tract, especially the lungs, as well as improved methods of treating subjects suffering or predisposed to suffering from lung conditions/diseases. The invention is particularly directed to lung cancer treatment using, for example, cytotoxic platinum-based drugs. | 12-31-2009 |
| 20090324744 | Effective Antitumor Treatments - ET-743 is used in the preparation of a medicament for an effective treatment of a tumour by combination therapy employing ET-743 with another drug. | 12-31-2009 |
| 20100003346 | COMBINATION METHODS OF TREATING CANCER - The present invention relates to compositions and methods for treating cancer, by administering a combination comprising a jasmonate derivative (e.g., methyl jasmonate or a compound of any of formulae I through VII or any of the jasmonate derivatives exemplified by such formulae) and at least one other agent selected from a chemotherapeutic agent (e.g., a nitroso-urea, a platinum compound, a taxane derivative, an antitumor antibiotic) and an inhibitor of glycolysis (e.g., 2-deoxy-D-glucose). The jasmonate derivative and the at least one other agent together provide a therapeutic effect, which is preferably synergistic (cooperative). | 01-07-2010 |
| 20100009013 | METHOD OF DETERMINING A CHEMOTHERAPEUTIC REGIMEN FOR NON-SMALL-CELL LUNG CANCER BASED ON BRCA1 EXPRESSION - The present invention relates to a screening method for classifying patients and for selecting an effective chemotherapy for the treatment of a patient suffering from non-small-cell lung cancer (NSCLC), based on the use of his levels of BRCA1 expression to predict the outcome of chemotherapy. | 01-14-2010 |
| 20100015249 | Antitumor agent containing 6'-amidino-2'-naphthyl 4-guanidinobenzoate or salt thereof - It is an object of the present invention to provide novel antitumor agents which have a high therapeutic index while causing neither serious adverse effects nor drug resistance, both of which are the problems associated with existing antitumor agents. In particular, it is an object of the present invention to provide novel agents and therapies which are effective for pancreas cancer, for which no effective therapies and chemotherapeutic agents exist at this stage, and are also capable of inhibiting cancer metastasis and cancer filtration. The antitumor agents, more specifically the therapeutic agents for pancreas cancer and the cancer metastasis inhibitors, of the present invention contain as an active ingredient 6′-amidino-2′-naphthyl 4-guanidinobenzoate or a salt thereof or more specifically the mesylate thereof known as nafamostat mesilate (generic name; also referred to as “Futhan,” “FUT,” and “FUT175.”). Moreover, in another mode of the present invention, the above mentioned FUT is administered in combination with existing anticancer/antitumor agents, particularly preferably in combination with gemcitabine hydrochloride. | 01-21-2010 |
| 20100028460 | IMPROVEMENTS IN RELATION TO CANCER THERAPY - The present invention relates to an improved assay for identifying compounds that may be of use in conjunction with cancer chemotherapeutic agents and anti-proliferative agents, to improve efficacy of such agents and/or render effective compounds with relatively little therapeutic activity. There is also provided a class of compounds of formula (I) and retinoids identified by said assay which may be used in a combination therapy, with current and novel agents, to treat cancers and other diseases associated with abnormal host cell proliferation, such as psoriasis. | 02-04-2010 |
| 20100028461 | Gamma-butyrolactone compound and pharmaceutical composition thereof - A γ-butyrolactone compound as shown in Formula (I) and pharmaceutical composition thereof: | 02-04-2010 |
| 20100047368 | Compositions and methods for the treatment or prevention of chemoresistant neoplasia - The invention generally features compositions and methods useful for the treatment and diagnosis of a neoplasia in a subject. In particular, the invention provides therapeutic compositions that decrease the expression of an Nfr2 nucleic acid molecule or polypeptide for the treatment of a neoplasia, such as a chemoresistant neoplasia, in a subject. | 02-25-2010 |
| 20100047369 | ANTI-TUMOR DRUG, MEDICAMENT, COMPOSITION, AND USE THEREOF - An active polypeptide comprising the amino acid sequence of SEQ ID NO: 3, or having at least 50%, preferably 70%, more preferably 90% identity with the amino acid sequence of SEQ ID NO: 3, or fragments thereof having at least 21 contiguous amino acids, or peptides having at least 50%, preferably 70%, more preferably 90% identity with the amino acid sequence of the fragments, provided that the polypeptide is not SEQ ID NO: 2. A method for inhibiting cancer and/or tumour growth comprising administering to a subject in need thereof an effective amount of the active polypeptide. | 02-25-2010 |
| 20100062077 | PYRROLO[1,2-A]IMIDAZOLEDIONE EFFECTIVE IN THE TREATMENT OF PERIPHERAL NEUROTOXICITY INDUCED BY CHEMOTHERAPEUTIC AGENTS - The use of a compound of formula (I), is disclosed in treating and/or preventing 5 chemotherapy-induced peripheral neurotoxicity (CIPN). The invention includes pharmaceutical compositions wherein the compound of formula (I) is present in a mixture with anticancer agents. An improved anticancer treatment with reduced CIPN-related side effects is also provided. | 03-11-2010 |
| 20100062078 | PHARMACEUTICAL COMPOSITION FOR TREATING CANCER AND THE SIGNALING PATHWAY THEREOF - A pharmaceutical composition, composed of protoapigenone (formula I), for treating gynecological cancers, prostate cancer, urinary bladder cancer and hepatocarcinoma is provided. Protoapigenone has cytotoxicity on these cancers, and arrests the cell cycle at S and G2/M phases. In addition, protoapigenone regulates cell signaling pathways, such as caspase-3, PARP, p-38 MAPK and JNK½, to induce apoptosis. Protoapigenone significantly inhibits the xenograft tumor growth on nude mice, without major side effects. Co-treatment o protoapigenone of protoapigenone and cisplatin shows synergistic cytotoxicity of MDAH-2774 ovarian cancer cells. | 03-11-2010 |
| 20100062079 | POLYMORPHISMS PREDICTIVE OF PLATINUM-COORDINATING COMPLEX INDUCED OTOTOXICITY - Provided are methods, nucleic acids, and arrays for assessing the susceptibility of a subject to the development of ototoxicity in response to receiving one or more platinum-coordinating compounds, the method including determining the presence or absence of one or more polymorphisms, wherein the presence or absence of one or more such polymorphisms is indicative of susceptibility to the development of ototoxicity. | 03-11-2010 |
| 20100068302 | METHODS AND COMPOSITIONS FOR THE TREATMENT OF CANCER - The invention relates to compositions comprising an acid ceramidase inhibitor and a choline kinase inhibitor as well as to the uses thereof for the treatment of cancer. The invention also relates to methods for the selection of an individualised therapy of a cancer patient based on the detection of the acid ceramidase levels. Moreover, the invention also relates to compositions comprising a choline kinase inhibitor and an alkylating agent and uses thereof for the treatment of cancer. Finally, the invention also relates to compositions comprising a choline kinase inhibitor and an alkylating agent or a death receptor ligand and uses thereof for the treatment of cancer. | 03-18-2010 |
| 20100068303 | TREATMENT OF CANCER WITH BIO AND CHEMOTHERAPY - This invention relates to compositions and methods utilizing a chemotherapeutic drug and 6-bromoindirubin3′-oxime (BIO) for the treatment of cancer, including glioblastoma multiforme. The present invention demonstrates that BIO works synergistically with chemotherapeutic drugs to increase the cytotoxic effects of these drugs in glioma cells. | 03-18-2010 |
| 20100086622 | METHOD OF TREATING OR PREVENTING TISSUE DETERIORATION, INJURY OR DAMAGE DUE TO DISEASE OF MUCOSA - An immunomodulatory compound is utilized to treat mucosa disease. | 04-08-2010 |
| 20100092578 | PROTEIN KINASE C IOTA - The invention involves PKC | 04-15-2010 |
| 20100092579 | MEDICAMENT FOR TREATING LUNG CANCER - Lung cancer can be treated effectively by combination of amrubicin or a pharmaceutically acceptable salt thereof with cisplatin. | 04-15-2010 |
| 20100104659 | BENZOPYRANOPYRAZOLES - Compounds of a certain formula I, in which Ra, Rb and Rc have the meanings indicated in the description, are effective compounds with anti-proliferative and/or apoptosis inducing activity. | 04-29-2010 |
| 20100104660 | COMPOSITION AND METHOD FOR TREATING TUMOR - Methods for treating neoplasm, tumors and cancers, using one or more tumor treating drug carriers, haptens and anticancer drugs, alone or in combination with other antineoplastic agents or treatments, are provided. Also provided are compositions, and kits containing the composition for affecting the therapy. | 04-29-2010 |
| 20100104661 | DISCONTINUOUS METHODS OF TREATING CANCER - Disclosed are methods of treating taxane sensitive tumors (i.e., cancers treatable with taxanes) using a taxane and the discontinuous dosing of lonafarnib. | 04-29-2010 |
| 20100104662 | COMPOSITION AND METHODS FOR MODULATING CELL PROLIFERATION AND CELL DEATH - Described herein are compositions and methods for modulation of p53-dependent cell death and cell proliferation. The compositions are microRNAs and associated nucleic acids. | 04-29-2010 |
| 20100112089 | PEPTIDE COMPOUND AND USE THEREOF - The present invention provides a method for the prophylaxis or treatment of cancer in a mammal, comprising administering a therapeutically effective amount of CBP501, a prodrug thereof or a pharmaceutically acceptable salt thereof to the mammal, wherein CBP501, a prodrug thereof or a pharmaceutically acceptable salt thereof is administered simultaneously with or before administration of a nucleic acid damaging agent. | 05-06-2010 |
| 20100112090 | NITROGENATED FUSED RING DERIVATIVE, PHARMACEUTICAL COMPOSITION COMPRISING THE SAME, AND USE OF THE SAME FOR MEDICAL PURPOSES - [Purpose] The present invention provides compounds useful as agents for the prevention or treatment of a sex hormone-dependent disease or the like. | 05-06-2010 |
| 20100129469 | USE OF DIMIRACETAM IN THE TREATMENT OF CHRONIC PAIN - The use of dimiracetam in the treatment of chronic pain is disclosed. At doses higher than those previously disclosed in relation with its cognition enhancing activity (i.e. amelioration of learning and memory), dimiracetam was able to completely revert hyperalgesia or allodynia associated with several animal models of chronic pain. Dimiracetam showed high activity in iatrogenic neuropathies associated with antiviral and chemotherapeutic drug treatments and in painful conditions caused by osteoarthritis. In addition, dimiracetam was devoid of toxicity even at doses 10-fold higher than the highest therapeutic dose. The possibility of treating such debilitating pathologies with a highly effective and essentially non-toxic compound is therefore disclosed. | 05-27-2010 |
| 20100129470 | METHOD OF TREATING BRAIN CANCER - Disclosed is (4-Methoxy-phenyl)-methyl-(2-methyl-quinazolin-4-yl)-amine hydrochloride effective as a cytotoxic agent. (4-Methoxy-phenyl)-methyl-(2-methyl-quinazolin-4-yl)-amine hydrochloride is useful in the treatment of a variety of clinical conditions in which uncontrolled growth and spread of abnormal cells occurs, and in particular to its use in treating brain cancer. | 05-27-2010 |
| 20100129471 | ISO CA-4 AND ANALOGUES THEREOF AS POTENT CYTOTOXIC AGENTS INHIBITING TUBULINE POLYMERIZATION - The invention relates to a compound of the formula (I) in which: R | 05-27-2010 |
| 20100136136 | JAK-2 Modulators and Methods of Use - This invention relates to the field of protein tyrosine kinases and inhibitors thereof. In particular, the invention relates to inhibitors of JAK-2, pharmaceutical compositions of the compounds for inhibiting JAK-2, methods of inhibiting JAK-2 in a cell, comprising contacting a cell in which inhibition of JAK-2 is desired with a compound or pharmaceutical composition comprising a compound according to the invention. The also comprises methods of treating a disease or condition that involves JAK-2 comprising administering to a patient a pharmaceutical composition comprising a compound according to the invention. | 06-03-2010 |
| 20100136137 | THERAPEUTIC COMBINATION OF A PANHER/VEGFR2 KINASE INHIBITOR AND A PLATINUM COMPOUND - This invention relates to a synergistic therapeutic combination of anti-cancer compounds which comprises a) a panHER/VEGFR2 kinase inhibitor, and b) a platinum compound, and optionally at least one pharmaceutically acceptable carrier for simultaneous, separate or sequential use. The invention also relates to treating certain cancers utilizing the combination of the invention. | 06-03-2010 |
| 20100136138 | TREATMENT OF LUNG CANCER - Disclosed are methods of treating lung cancer by administering to a human in need thereof effective amounts of FTS, or various analogs thereof, or a pharmaceutically acceptable salt thereof, optionally, in combination with a chemotherapeutic agent. Chemotherapeutic agents, and combinations thereof, for use with FTS, its analogs, or its salts are also disclosed. | 06-03-2010 |
| 20100136139 | CANCER MARKER AND THERAPEUTIC AGENT FOR CANCER - A novel cancer marker is provided. A method for detecting cancer using a level of BMCC1 gene expression as an indication is provided, in which the cancer is selected from the group consisting of prostate cancer, lung cancer, gastric cancer, bladder cancer, and uterine cancer. | 06-03-2010 |
| 20100143499 | DIMERIC IAP INHIBITORS - Compounds, compositions, and methods of using such compounds to modulate apoptosis including IAP antagonists are provided herein. Compositions including mimetics of the invention and, optionally, secondary agents, may be used to treat proliferative disorders such as, cancer and autoimmune diseases. | 06-10-2010 |
| 20100151050 | Method for evaluation of compound using RSK1 - A method for evaluation of a compound comprising the steps of introducing an RSK1 gene into a cell to prepare a cell capable of expressing RSK1, contacting a compound to be evaluated with the cell, and detecting the specific binding of the compound to RSK1; and a compound given by the method. The compound can be used as a potentiator of cisplatin. The method enables to find a gene which acts specifically on a cell of cancer induced by the abnormality in p53 or enhanced MAPK pathway and to evaluate a compound by using the gene. | 06-17-2010 |
| 20100151051 | ANTI-TUMOR DRUG, MEDICAMENT, COMPOSITION, AND USE THEREOF - An active polypeptide comprising the amino acid sequence of SEQ ID NO:4, having an anti-tumour activity, and compositions and methods including the active polypeptide. | 06-17-2010 |
| 20100159030 | METHODS FOR DETECTING AND MODULATING THE SENSITIVITY OF TUMOR CELLS TO ANTI-MITOTIC AGENTS AND FOR MODULATING TURMORGENICITY - Provided herein is a method of screening a tumour cell for resistance to a tubulin-binding agent, the method comprising detecting the expression of any one or more of class II, class III and class IVb β-tubulin by the tumour cell, wherein the expression of any one or more of class II, class III and class IVb β-tubulin indicates that the tumour cell has resistance or potential resistance to the tubulin-binding agent. Also provided are methods of modulating the sensitivity of a tumour cell. Also provided is a method of modulating the tumorigenesis of a tumour cell. | 06-24-2010 |
| 20100166884 | POTENTIATION OF CANCER CHEMOTHERAPY BY 7-(2, 5- DIHYDRO- 4-IMIDAZO [1, 2-A] PYRIDINE-3-YL-2,5-DIOXO-IH-PYRROL-3-YL)-9-FLUORO-1,2,3,4 TETRAHYDRO -2-(1-PIPERIDINYL-CARBONYL)-PYRROLO [3,2,1-JK] [1,4] BENZODIAZEPINE - A method for treating gastric cancer, ovarian cancer, non-small cell lung cancer, or colorectal cancer in a patient is described, as well as pharmaceutical compositions comprising 7-(2,5-dihydro-4-imidazo[1,2-a]pyridine-3-yl-2,5-dioxo-IH-pyrrol-3-yl)-9-fluoro-1,2,3,4-tetrahydro-2-(1-piperidinyl-carbonyl)-pyrrolo[3,2,1-jk][1,4]benzodiazepine, useful for the method and a process for preparing said compositions. | 07-01-2010 |
| 20100173013 | TREATMENT OF NEOPLASTIC DISORDERS USING COMBINATION THERAPIES - The present application is generally directed to compounds, compositions and methods of combination therapy for the treatment of neoplastic disorders. | 07-08-2010 |
| 20100183742 | PHOSPHORAMIDATE ALKYLATOR PRODRUGS FOR THE TREATMENT OF CANCER - Compositions containing, and, methods administering, TH302, are useful in treatment of cancer and other hyper-proliferative diseases. | 07-22-2010 |
| 20100183743 | BENZTHIAZOLE INHIBITORS OF POLY(ADP-RIBOSE)POLYMERASE - Inhibitors of poly(ADP-ribose)polymerase having a structure of Formula (I), ways to make them and methods of treating patients using them are disclosed. | 07-22-2010 |
| 20100196509 | Methods for Diagnosis and Treatment of Endometrial Cancer - The present invention discloses methods of using endothelial membrane protein 2 (EMP2) as a biomarker for stratification of endometrial premalignancy, diagnosing, staging and imaging of endometrial neoplasia. Further, methods for identifying pharmaceutical/therapeutic modalities are described, including compositions which modulate glycolipid-enriched lipid raft microdomains (GEMs). | 08-05-2010 |
| 20100196510 | COMPOSITION AND TREATMENT - Disclosed are compositions for the treatment of neuropathy and in particular peripheral neuropathy. The compounds include low molecular weight glycosaminoglycans. The peripheral neuropathy may be due to cancer treatment drugs. | 08-05-2010 |
| 20100196511 | AXL INHIBITORS FOR USE IN COMBINATION THERAPY FOR PREVENTING, TREATING OR MANAGING METASTATIC CANCER - This invention is directed to methods of preventing, treating or managing cancer, preferably metastatic cancer, in a patient. The methods comprise administering an effective amount of an Axl inhibitor in combination with the administration of an effective amount of one or more chemotherapeutic agents. | 08-05-2010 |
| 20100203161 | STERILISATION AND CONSERVATION OF LIQUIDS - The invention relates to products, containing a solid biocide and a composite material ( | 08-12-2010 |
| 20100203162 | Method of preparing (+)-1,4-dihydro-7-[(3S,4S)-3-methoxy-4-(methylamino)-1-pyrrolidinyl]-4-ox- o-1-(2-thiazolyl)-1,8-naphthyridine-3-carboxylic acid - Methods of preparing (+)-1,4-dihydro-7-[(3S,4S)-3-methoxy-4-(methylamino)-1-pyrrolidinyl]-4-oxo-1-(2-thiazolyl)-1,8-naphthyridine-3-carboxylic acid are disclosed. Also provided are pharmaceutical compositions comprising (+)-1,4-dihydro-7-[(3S,4S)-3-methoxy-4-(methylamino)-1-pyrrolidinyl]-4-oxo-1-(2-thiazolyl)-1,8-naphthyridine-3-carboxylic acid, and methods of treatment using such compositions. | 08-12-2010 |
| 20100203163 | INJECTABLE POLYMER-LIPID BLEND FOR LOCALIZED DRUG DELIVERY - An injectable polymer-lipid blend is provided as a localized drug delivery system for a pharmaceutically active agent. The blend may be prepared from a chitosan-based material, fatty acid and phospholipid. The chitosan-based material may be a water soluble chitosan derivative. The fatty acid may be a fatty acid or a fatty aldehyde, such as laurinaldehyde, having an acyl chain length of C8-C16. The rheological properties of the blend relates to the ratio of the components and to the acyl chain length of the fatty acid. The injectable system is well suited for the delayed release of pharmaceutically active agents in the treatment of cancer and other diseases requiring localized drug delivery | 08-12-2010 |
| 20100203164 | Therapeutic Treatment of Cancer and Dysplasia of the Cervix or Vagina Using Estrogen Antagonists - A method for treatment of cervical or vaginal cancer and their associated dysplasia, including the steps of identifying a human cervical or vaginal cancer and/or dysplasia patient, administering an effective amount of an estrogen antagonist therapy to the patient, wherein the amount is effective to reduce cancer and dysplasia symptoms, and observing a reduction of cancer and dysplasia symptoms in the patient. | 08-12-2010 |
| 20100209537 | Metal complexes with anticancer activity - This inventive subject matter relates to novel transitional metal complexes of Quinoxalines, methods for making such compounds, and methods for using such compounds for treating diseases and disorders mediated by kinase activity. | 08-19-2010 |
| 20100215771 | USE OF SODIUM CHANNEL BLOCKERS FOR THE TREATMENT OF NEUROPATHIC PAIN DEVELOPING AS A CONSEQUENCE OF CHEMOTHERAPY - The present invention refers to the use of sodium channel blockers such as tetrodotoxin or saxitoxin, its analogues/derivatives as well as their acceptable salts, for the production of a medicament for the treatment of neuropathic pain resulting from chemotherapy. | 08-26-2010 |
| 20100215772 | AMINOPYRIMIDINES USEFUL AS KINASE INHIBITORS - The present invention relates to compounds useful as inhibitors of Aurora protein kinases. The invention also provides pharmaceutically acceptable compositions comprising those compounds and methods of using the compounds and compositions in the treatment of various disease, conditions, and disorders. The invention also provides processes for preparing compounds of the invention. | 08-26-2010 |
| 20100215773 | Use of Quinazoline Derivative ZD6474 Combined With Platinum Compounds and Optionally Ionising Radiation in the Treatment of Diseases Associated With Angiogenesis and/or Increased Vascular Permeability - The present invention relates to a method for the production of an antiangiogenic and/or vascular permeability reducing effect in a warm-blooded animal such as a human which is optionally being treated with ionising radiation, particularly a method for the treatment of a cancer, particularly a cancer involving a solid tumour, which comprises the administration of ZD6474 in combination with a platinum anti-tumour agent; to a pharmaceutical composition comprising ZD6474 and a platinum anti-tumour agent; to a combination product comprising ZD6474 and a platinum anti-tumour agent for use in a method of treatment of a human or animal body by therapy; to a kit comprising ZD6474 and a platinum anti-tumour agent; to the use of ZD6474 and a platinum anti-tumour agent in the manufacture of a medicament for use in the production of all antiangiogenic and/or vascular permeability reducing effect in a warm-blooded animal such as a human which is optionally being treated with ionising radiation. | 08-26-2010 |
| 20100233293 | PHOSPHAPLATINS AND THEIR USE IN THE TREATMENT OF CANCERS RESISTANT TO CISPLATIN AND CARBOPLATIN - The present invention provides phosphaplatins, stable isolated monomeric phosphato complexes of platinum (II) and (IV), and methods of use thereof for treating cancers, including cisplatin- and carboplatin-resistant cancers. Unlike cisplatin, these complexes do not readily undergo hydrolysis and are quite soluble and stable in aqueous solutions. Moreover, these complexes—unlike cisplatin, carboplatin, and related platinum-based anti-cancer agents—do not bind DNA. Rather, data suggests that phosphaplatins trigger overexpression of fas and fas-related transcription factors and some proapoptotic genes such as Bak and Bax. Nevertheless, the complexes exhibit tremendous cytotoxicity towards cancer cells. Thus, the present invention provides novel platinum anticancer agents that have a different molecular target than those in the art. | 09-16-2010 |
| 20100239688 | COMBINATION OF ANTI-ANGIOGENIC SUBSTANCE AND ANTI-TUMOR PLATINUM COMPLEX - The problems of the present invention are to find a pharmaceutical composition and a method for treating cancer that exhibit excellent anti-tumor effect. Excellent anti-tumor effect is achieved when 4-(3-chloro-4-(cyclopropylaminocarbonyl)aminophenoxy)-7-methoxy-6-quinolinecarboxamide or an analogous compound thereof, a pharmacologically acceptable salt thereof or a solvate thereof is used in combination with an anti-tumor platinum complex. | 09-23-2010 |
| 20100260868 | METHOD OF TREATMENT USING CHECKPOINT KINASE 1 INHIBITORS - Methods of treating cancer by administering a DNA damaging agent and a CHK1 Inhibitor on a dosing regimen are provided. | 10-14-2010 |
| 20100285149 | NOVEL TETRAHYDROPYRIDOTHIOPHENES - Compounds of a certain formula I, in which Ra and Rb have the meanings indicated in the description, are novel effective compounds with anti-proliferative and apoptosis inducing activity. | 11-11-2010 |
| 20100291236 | OSMIUM COMPOUNDS - The present invention relates to osmium compounds of formula (I), their preparation and use in methods of treatment, particularly for cancer treatment. | 11-18-2010 |
| 20100297262 | PHARMACEUTICALLY ACTIVE COMPOSITIONS COMPRISING OXIDATIVE STRESS MODULATORS (OSM), NEW CHEMICAL ENTITIES, COMPOSITIONS AND USES - Described herein are pharmaceutical compositions and medicaments, and methods of using such pharmaceutical compositions and medicaments in the treatment of inflammation and cancer. | 11-25-2010 |
| 20100303929 | Compounds and methods for treating cancer - The present invention provides a method of treating cancer involving administering an insulin-like growth factor-1 receptor (IGF-1 receptor) agonist and an anti-cancer chemotherapeutic agent. Also provided are compounds for treating cancer comprising an IGF-1-receptor ligand coupled to an anti-cancer chemotherapeutic agent. Also provided are compounds for treating cancer comprising an insulin-receptor ligand coupled to an anti-cancer chemotherapeutic agent. | 12-02-2010 |
| 20100310674 | NOVEL COMPOSITION FOR TREATING THE SIDE EFFECTS OF ANTICANCER TREATMENTS - The invention relates to novel compositions, particularly pharmaceutical, comprising, as active ingredients, at least one cytotoxic agent and at least one cholest-4-en-3-one oxime derivative. | 12-09-2010 |
| 20100310675 | AMINOPYRIMIDINES USEFUL AS KINASE INHIBITORS - The present invention relates to compounds useful as inhibitors of protein kinases. The invention also provides pharmaceutically acceptable compositions comprising those compounds and methods of using the compounds and compositions in the treatment of various disease, conditions, and disorders. The invention also provides processes for preparing compounds of the invention. | 12-09-2010 |
| 20100323033 | CANCER SENSITIZER COMPRISING CHLOROGENIC ACID - The present invention relates to a cancer sensitizer comprising chlorogenic acid or a derivative thereof. In particular, the present invention relates to a cancer sensitizer comprising chlorogenic acid or a derivative thereof, which can make cancer cells sensitive to anticancer agents to increase the therapeutic effect of anticancer agents. In addition, the present invention relates to a composition for inhibiting the chemo-resistance of cancer cells, comprising chlorogenic acid or a derivative thereof in combination with a pharmaceutically acceptable carrier, an anticancer composition comprising an anticancer agent in addition to the composition, and a method for disrupting the chemo-resistance of cancer cells, comprising administration of the cancer sensitizer. | 12-23-2010 |
| 20100323034 | METHOD FOR DETERMINATION OF SENSITIVITY TO ANTI-CANCER AGENT - Provided are an marker for determining sensitivity to an anticancer agent capable of distinguishing a therapeutic response of an individual patient and a novel means for a cancer therapy using the marker. The marker for determining sensitivity to an anticancer agent contains a calcium-binding protein S100A7, S100A8, or S100A10. | 12-23-2010 |
| 20100330200 | COMBINATION OF A RETINOID AND A PLATINUM ANTICANCER AGENT - A combination comprising an atypical retinoid compound, preferably E-4-(3-(1-adamantyl)-4-hydroxyphenyl)cinnamic acid and an anticancer drug of the platinum family, preferably cisuplatin, together with a pharmaceutical composition comprising it and a kit for its administration in unitary or in coordinated sequential form. The kit preferably comprises a first formulation of E-4-(3-(1-adamantyl)-4-hydroxyphenyl)cinnamic acid dissolved in a mixture of ethanol and cremophor, and susupended in a saline solution, and a second formulation of cisuplatin in saline solution. The combination is used for the preparation of a medicament to inhibit tumor growth and tumor migration, in particular for the treatment of ovarian tumor and/or carcinoma. | 12-30-2010 |
| 20110008465 | SESQUITERPENE FORMULATIONS, KITS AND METHODS OF USE THEREOF - A pharmaceutical composition comprising a water insoluble sesquiterpene, one or more antioxidants and one or more solubilizers selected from the group consisting of an oil, PEG400, a derivative of castor oil and ethylene oxide, and polysorbate 80, and methods of use thereof. | 01-13-2011 |
| 20110014302 | USE OF TRANSPLATIN TO PREVENT HEARING LOSS - Methods and compositions for treating and preventing toxic side effects of platinum-based chemotherapy agents are disclosed, in which transplatin is administered to a subject. Transplatin is shown to have protective effects against cisplatin-induced ototoxicity, nephotoxicity and neurotoxicity. Anti-inflammatory activity of transplatin is demonstrated and methods and compositions for treating and preventing inflammatory pain are described. | 01-20-2011 |
| 20110014303 | METHOD FOR THE TREATMENT OF CANCER - The invention is based on the surprising finding that treatment with a chemotherapeutic agent such as 5-fluorouracil (5-FU) and an autophagy inducer effectively inhibit the continued growth of, and prevent the recovery following drug withdrawal, of cancer cells. In vivo, drug resistance from a failure to adequately engage in apoptotic programmed cell death leads to a recurrence of cancer and tumours can remain dormant for periods of time before re-emerging as drug resistant metastases. It has been hypothesised that autophagy (Type II cell death) may help cancer cells survive in response to growth limiting conditions, such as nutrient depletion, hypoxia, absence of growth factor, or presence of cytotoxic drug. LiCl is a known autophagy inducer and accelerates cell survival to autophagic programmed cell death. | 01-20-2011 |
| 20110020469 | AMINOPYRIMIDINES USEFUL AS KINASE INHIBITORS - The present invention relates to compounds useful as inhibitors of Aurora protein kinases. The invention also provides pharmaceutically acceptable compositions comprising those compounds and methods of using the compounds and compositions in the treatment of various disease, conditions, and disorders. The invention also provides processes for preparing compounds of the invention. | 01-27-2011 |
| 20110020470 | METHODS AND COMPOSITIONS FOR TREATING CANCER - In one aspect the present invention provides methods for treating cancer in a mammal, including the step of administering to a mammal suffering from a cancer an amount of ebselen that is sufficient to inhibit the growth of the cancer. In another aspect, the present invention provides methods for enhancing the chemotherapeutic effect of a platinum-containing chemotherapeutic agent administered to a mammal suffering from cancer. | 01-27-2011 |
| 20110027389 | Low Viscosity Liquid Polymeric Delivery System - Low viscosity biodegradable polymer solutions of a liquid biodegradable polymer and biocompatible solvent and methods of using the compositions to form a biodegradable liquid polymer implant are provided. | 02-03-2011 |
| 20110027390 | Methods for Reducing Cisplatin Nephrotoxicity - The present invention provides compositions and methods to reduce renal damage caused by nephrotoxic drugs such as cisplatin. The invention provides compositions comprising a substituted cyclodextrin, cisplatin and a pharmaceutically acceptable carrier, where the cyclodextrin is present in an amount effective for substantially inhibiting the nephrotoxic effect of the cisplatin. | 02-03-2011 |
| 20110038951 | ANTI-TUMOR DRUG, MEDICAMENT, COMPOSITION, AND USE THEREOF - The present invention relates to an active polypeptide including the amino acid sequence of SEQ ID NO:3, or having at least 50%, preferably 70%, more preferably 90% identity with the amino acid sequence of SEQ ID NO:3, or fragments thereof having at least 21 contiguous amino acids, or peptides having at least 50%, preferably 70%, more preferably 90% identity with the amino acid sequence of the fragments, provided that the polypeptide is not SEQ ID NO:2, variants and antigenic fragments thereof, SEQ ID NO 16 or SEQ ID NO 17. | 02-17-2011 |
| 20110038952 | GAMBOGIC ACID GLYCOSIDE DERIVATIVES AND ANALOGS, THEIR PREPARATION METHODS AND APPLICATIONS - This invention relates with the gambogic acid glycoside derivatives and analogs of formula I: | 02-17-2011 |
| 20110045102 | Cancer chemotherapy compositions comprising PI3K pathway modulators and triptolide - The present invention provides compositions and methods for inhibiting growth of and/or killing cancer cells. The compositions include: an inhibitor of the PI3K signal transduction pathway, and additional agents, such as Triptolide. | 02-24-2011 |
| 20110052723 | USE OF COMPOUNDS BINDING TO THE SIGMA RECEPTOR LIGANDS FOR THE TREATMENT OF NEUROPATHIC PAIN DEVELOPING AS A CONSEQUENCE OF CHEMOTHERAPY - The present invention refers to the use of compounds binding to the sigma receptor for the treatment or prevention of neuropathic pain resulting from chemotherapy. | 03-03-2011 |
| 20110059187 | PEPTIDE DICER SUBSTRATE AGENTS AND METHODS FOR THEIR SPECIFIC INHIBITION OF GENE EXPRESSION - This invention relates to compounds, compositions, and methods useful for reducing a target RNA and protein levels via use of Dicer substrate siRNA (DsiRNA)-peptide conjugates. | 03-10-2011 |
| 20110064828 | TREATMENT OF METASTATIC TUMORS AND OTHER CONDITIONS - The present invention generally relates to pharmacology and, in particular, to the treatment of tumors and other conditions. In some aspects, the invention is directed to the treatment of subjects having tumors or cancers that are metastatic. Surprisingly, it has been found that certain compositions comprising oxidized glutathione-based compounds are able to effectively treat such cancers by inhibiting cell migration and/or invasion processes, and thus, inhibiting tumor cell metastases. Without being bound by any theory, it is believed that such compositions are effective since the compositions are able to suppress the activation of critical signaling pathways within cells that are used for cell migration, such as the ErbB2 and/or phosphoinositide-3 kinase (PI3K) pathways, including the downstream RhoA and AKT pathways. Such pathways are regulated by ERp5, which is a protein disulfide isomerase regulated using certain redox pathways, and those redox pathways are unusually sensitive to treatment using oxidized glutathione-based compounds. Thus, the composition of the instant invention, in some embodiments, are surprisingly effective at preventing tumor metastases. While other references have disclosed the treatment of cancers using oxidized glutathione-based compounds, no reference has suggested that signaling pathways used for cell migration, invasion and metastasis, such as the ErbB2, PI3K, RhoA, and AKT pathways, are highly susceptible to treatment by altering the redox state of the cell, e.g., by oxidized glutathione-based compounds. Accordingly, the use of such compositions to treat tumor metastases is surprising and could not be predicted given the teachings of the prior art. | 03-17-2011 |
| 20110070317 | PYRROLOPYRIDINES AS KINASE INHIBITORS - Compounds of Formula (I) are useful for inhibition of CHK1 and/or CHK2. Methods of using compounds of Formula (I) and stereoisomers and pharmaceutically acceptable salts thereof, for in vitro, in situ, and in vivo diagnosis, prevention or treatment of such disorders in mammalian cells, or associated pathological conditions are disclosed. | 03-24-2011 |
| 20110076342 | CANCER PEPTIDE THERAPEUTICS - Cell-permeable caPCNA-derived peptides and their variants serve as therapeutic compositions to reduce the proliferation of cancerous cells and also augment cytotoxic effects of chemotherapeutics. | 03-31-2011 |
| 20110076343 | Multiple Myeloma Treatments - Methods for treating cancer by using compound PM00104, in particular, for treating multiple myeloma are provided. | 03-31-2011 |
| 20110086110 | Analogs of Benzoquinone-Containing Ansamycins and Methods of Use Thereof - The present invention provides analogs of benzoquinone-containing ansamycins and uses thereof for treating and modulating disorders associated with hyperproliferation, such as cancer. The present invention provides analogs of benzoquinone-containing ansamycins where the benzoquinone is reduced to a hydroquinone and trapped by reaction with a suitable acid, preferably ones that increase the solubility and air stability of the resulting 17-ammonium hydroquinone ansamycin analog. | 04-14-2011 |
| 20110086111 | POLYMERIC SYSTEMS FOR THE DELIVERY OF ANTICANCER DRUGS - The present invention relates to compositions for the treatment of cancerous tissues in warm-blooded animals containing one or two anticancer agents attached to polymeric carriers having monomer units derived from one or more of N-(2-carboxypropyl)methacrylamide (2-CPMA), N-(3-carboxypropyl)methacrylamide (3-CPMA), N-(2-aminopropyl)methacrylamide (2-APMA) and/or N-(3-aminopropyl)methacrylamide (3-APMA) are also included. Anticancer agents in compositions can be attached to said polymeric carrier by side-chains which can be susceptible to hydrolysis by lysosomal enzymes intracellularly. Compositions can also include a targeting ligand attached to the polymeric carrier, optionally through a second linker. | 04-14-2011 |
| 20110086112 | PHARMACEUTICAL FORMULATIONS COMPRISING SALTS OF A PROTEIN KINASE INHIBITOR AND METHODS OF USING SAME - The present invention relates to pharmaceutical formulations comprising the protein kinase inhibitor, MP470, and methods of using same in treating conditions involving undesirable cell proliferation, such as cancer. | 04-14-2011 |
| 20110086113 | CANNABINOIDS IN COMBINATION WITH NON-CANNABINOID CHEMOTHERAPEUTIC AGENTS (E.G. SERM OR ALKYLATING AGENTS) - The invention relates to the use of one or more cannabinoids, particularly THC and/or CBD in combination with a non-cannabinoid chemotherapeutic agent in the manufacture of a medicament for use in the treatment of cancer. In particular the cancer to be treated is a brain tumour, more particularly a glioma, more particularly still a glioblastoma multiforme (GBM). The non-cannabinoid chemotherapeutic agent may be a selective estrogen receptor modulator or an alkylating agent. | 04-14-2011 |
| 20110091577 | DRUG RELEASE COATINGS ON CALCUIM PHOSPHATE AND USES THEREOF - The invention provides implantable drug releasing materials comprising a calcium phosphate composition, a biodegradable polymer adsorbed onto the calcium phosphate composition, wherein the polymer comprises acidic amino acid residues, and a drug adsorbed onto or reacted with the polymer. The invention is further directed to dental and bone implants and implantable medical devices comprising the implantable drug releasing material, methods for preparing the implantable drug releasing material, and methods for delivering the implantable drug releasing material to bone or teeth. | 04-21-2011 |
| 20110097423 | Gene Prognosis Predictor Signature for Colorectal Carcinoma - The present invention is drawn to methods of assessing colorectal cancer prognosis by examining the expression of particular genes disregulated in this disease state. Subjects exhibiting disregulation in one or more of these genes will have a higher risk of cancer recurrence and death. | 04-28-2011 |
| 20110104304 | O-Methylated Rapamycin Derivatives For Alleviation And Inhibition Of Lymphoproliferative Disorders - The present invention relates to methods of alleviating and inhibiting a lymphoproliferative disorder in a mammal, the method comprising administering one or more rapamycin derivatives (including rapamycin) to the mammal. Further, the invention provides a method for identifying agents which are useful for alleviating and inhibiting a lymphoproliferative disorders, as well as a method for identifying agents which are capable of inhibiting metastasis of lymphatic tumors in a mammal. | 05-05-2011 |
| 20110104305 | COMPOUNDS AND METHODS FOR THIOL-CONTAINING COMPOUND EFFLUX AND CANCER TREATMENT - Methods for therapy of cystic fibrosis and other conditions such as cancer are provided. The methods comprise one or more agents capable of increasing thiol-containing compound transport via a transporter system (i.e. ABC transporters such as MDR-1 or MRP-2) in cells. Other embodiments include the use of agents to modulate transport of thiol-containing compounds within the cell. Therapeutic methods involve the administration of such agents to a patient afflicted with cystic fibrosis, cancer and/or another condition responsive to stimulation of thiol-containing compound transport. | 05-05-2011 |
| 20110104306 | NOVEL COMPOSITIONS AND METHODS FOR THE IDENTIFICATION, ASSESSMENT, PREVENTION AND THERAPY OF HUMAN CANCERS - The present invention is directed to the identification of markers that can be used to determine whether tumors are sensitive or resistant to a therapeutic agent. The present invention is also directed to the identification of therapeutic targets. The invention features a number of “sensitivity markers.” These are markers that are expressed in most or all cell lines that are sensitive to treatment with an agent and which are not expressed (or are expressed at a rather low level) in cells that are resistant to treatment with that agent. The invention also features a number of “resistance markers.” These are markers that are expressed in most or all cell lines that are resistant to treatment with an agent and which are not expressed (or are expressed at a rather low level) in cells that are sensitive to treatment with that agent. The invention also features marker sets that can predict patients that are likely to respond or not to respond to an agent. | 05-05-2011 |
| 20110111056 | PEPTIDE DICER SUBSTRATE AGENTS AND METHODS FOR THEIR SPECIFIC INHIBITION OF GENE EXPRESSION - This invention relates to compounds, compositions, and methods useful for reducing a target RNA and protein levels via use of Dicer substrate siRNA (DsiRNA)-peptide conjugates. | 05-12-2011 |
| 20110111057 | Methods and Compounds Useful to Induce Apoptosis in Cancer Cells - The present invention provides a method for treating cancer in a mammal comprising contacting the cancer cells with a compound which is a apogossypol, derivative. | 05-12-2011 |
| 20110111058 | METHODS FOR INCREASING THE STABILIZATION OF HYPOXIA INDUCIBLE FACTOR-1 ALPHA - Disclosed herein are methods for controlling the activity of hypoxia-inducible transcription factor 1-alpha (HIF-1α) and diseases, conditions, or syndromes related thereto, inter alia, Peripheral Vascular Disease (PVD), Coronary Artery Disease (CAD), heart failure, ischemia, and anemia. Further disclosed are pharmaceutical compositions comprising HIF-1α prolyl hydroxylase inhibitors useful in treating diseases, conditions, and/or syndromes related thereto the activity of HIF-1α. | 05-12-2011 |
| 20110111059 | Compositions Comprising Quinazoline Derivatives, Preparation Methods and Uses Thereof - The present invention provides a pharmaceutical composition, useful for the treatment of diseases characterized by abnormal PTKs activity of erbB family in a mammal, comprising pharmaceutically acceptable salts of N-{4-[3-chloro-4-(3-fluoro-benzyloxy)phenylamino]quinazolin-6-yl}-acrylamide, optionally a pharmaceutically applicable carrier or diluent, and a stabilizer having a dispersing and/or protective effect on the active ingredient. The present invention further provides a pharmaceutical formulation comprising said composition, methods for preparation of said composition and said formulation, as well as use of said composition and said formulation for treating diseases characterized by abnormal PTKs activity of erbB family in a mammal. | 05-12-2011 |
| 20110117211 | Method of Treating or Preventing Tissue Deterioration, Injury or Damage Due to Disease of Mucosa - An immunomodulatory compound is utilized to treat mucosa disease. | 05-19-2011 |
| 20110117212 | THERAPEUTIC COMBINATION COMPRISING AN AURORA KINASE INHIBITOR AND AN ANTINEOPLASTIC AGENT - The present invention provides a therapeutic combination comprising (a) compound 1 of formula (A) as set forth in the specification and (b) one or more antineoplastic agents selected from the group consisting of platinum derivatives, antimetabolite agents, topoisomerase I inhibitors and antimicrotubule agents, wherein the active ingredients are present in each case in free form or in the form of a pharmaceutically acceptable salt or any hydrate thereof. | 05-19-2011 |
| 20110123644 | MACROCYCLIC COMPOUNDS AND METHODS OF TREATMENT - The instant invention describes macrocyclic compounds having therapeutic activity, and methods of treating disorders such as cancer, tumors and cell proliferation related disorders, and HDAC mediated disorders. | 05-26-2011 |
| 20110129549 | TRICYCLIC BENZO[5,6]CYCLOHEPTA[1,2-B]PYRIDINE DERIVATIVES AND USES THEREOF - This invention relates to deuterated lonafamib and pharmaceutically acceptable salts. This invention also provides compositions comprising a compound of this invention and the use of such compositions in methods of treating diseases and conditions that are beneficially treated by administering Lonafamib as an inhibitor of the enzyme farnesyl transferase; an inducer of cellular apoptosis (programmed cell death); and an inhibitor of cellular transduction pathways. | 06-02-2011 |
| 20110129550 | CANCER TREATMENT METHOD - Invented is a method of treating cancer or a pre-cancerous syndrome in a mammal, including a human, in need thereof which comprises the administration of an effective amount of a non-peptide thrombopoietin (TPO) receptor agonist or TPO cell cycle activator and a chemotherapeutic agent to such mammal, suitably a human. | 06-02-2011 |
| 20110135755 | Combination therapies for treating neoplastic disease - A method for treating neoplastic disease in a patient is described, which comprises administering to the patient: an antineoplastic platinum (II) complex; a physiologically acceptable source of assimilable copper; a physiologically acceptable source of assimilable manganese; a source of salicylic acid or a physiologically acceptable derivative thereof; and vitamin C. | 06-09-2011 |
| 20110135756 | COMPOSITIONS AND METHODS FOR PROTECTING SENSORY HAIR CELLS - The invention provides compounds, compositions and methods that can be used for the attenuation of damage to sensory hair cells and symptoms thereof. More particularly, the invention identifies drugs that can be used to protect sensory hair cells from ototoxic medications, noise-induced damage and age-related loss. | 06-09-2011 |
| 20110142961 | METHODS AND REAGENTS FOR PREDICTING CLINICAL OUTCOME AND CUSTOMIZING CHEMOTHERAPY IN LUNG CANCER PATIENTS - The invention relates to methods for the prediction of the clinical outcome of a patient suffering from cancer based on the relative expression levels of BRCA1 and RAP80 genes. The invention also relates to anticancer combination therapies comprising a platinum-based chemotherapeutic agent and an inhibitor of RAP80. | 06-16-2011 |
| 20110151023 | COMBINATION THERAPY WITH PARP INHIBITORS - The present invention describes benzimidazole derivatives of Formula (I) which constitute potent PARP inhibitors in combination with radiotherapy or in combination with other chemotherapeutic agents. | 06-23-2011 |
| 20110159111 | PHARMACEUTICAL COMBINATIONS - The invention provides combinations of an ancillary compound of the formula (0): and a compound of the formula (I′): Also provided are crystalline forms of the constituent compounds, methods for making them and their uses in treating cancers. | 06-30-2011 |
| 20110159112 | Recombinant alpha-fetoprotein and compositions thereof - Disclosed are pharmaceutical and synergistic compositions comprising human recombinant alpha-fetoprotein expressed in eucaryotic cells for preparation of therapeutic agents for use in oncology, immunotherapy, stem cell therapy and cosmetology and also for the diagnosis of cancer and embryonic pathologies. | 06-30-2011 |
| 20110159113 | HYPERBRANCHED POLYESTER AND A METHOD OF SYNTHESIZING A HYPERBRANCHED POLYESTER - The various embodiments herein provide a hyper branched polyester and a method of synthesizing the same. The embodiments herein also provide a method of encapsulating a drug into the void spaces of the polymer to act as a drug delivery system. The hyper branched polyester mer comprises an acidic moiety and an alcoholic moiety. The acidic moiety is citric acid monohydrate. The alcoholic moiety is glycerol. The acidic moiety and the alcoholic moiety are randomly arranged in the hyperbranched polymer. The method comprises of heating the mixture of citric acid and glycerol at temperatures of 90 to 150° C. by constant stirring for different time periods. In the method of encapsulation, the drug solution is drop-wise added to polymer solution at 37° C. by constant stirring for 24 h. | 06-30-2011 |
| 20110159114 | COMBINATION COMPRISING AN IRON CHELATOR AND AN ANTI-NEOPLASTIC AGENT AND USE THEREOF - The present invention relates to a combination comprising a a substituted 3,5-diphenyl-1,2,4-triazole, e.g. 4-[3,5-bis(2-hydroxyphenyl)-[1,2,4]triazol-1-yl]benzoic acid and at least one anti-neoplastic agent and to the use of said combination for the preparation of a medicament for the treatment of proliferative diseases. | 06-30-2011 |
| 20110165264 | USE OF CILASTATIN TO REDUCE NEPHROTATOXICITY OF VARIOUS COMPOUNDS - Use of cilastatin to reduce the nephrotoxicity of different compounds. The invention refers to use of cilastatin to prepare a medicinal product to reduce the nephrotoxicity of a nephrotoxic compound that enters the cells of the proximal tubule through cholesterol rafts. The invention is based on the discovery that a great number of nephrotoxic compounds, including drugs, enter the cells of the proximal tubule through the cholesterol rafts, and that cilastatin is able to interfere with this transport mechanism, decreasing the nephrotoxicity of such compounds to a variable extent. The nephroprotective effect is common to compounds of different chemical nature and solubility and is specific for the kidney, causing no interference with the effects of nephrotoxic drugs having their targets in other organs. Therefore, administration of cilastatin allows for decreasing the nephrotoxic effects of different drugs without reducing their therapeutic effects. | 07-07-2011 |
| 20110165265 | TRAIL VARIANTS FOR TREATING CANCER - The present invention relates to the use of a mutant TRAIL protein to treat various cancers in mammals. The invention provides a variant TRAIL protein, which has superior selectivity for the death receptor 5, for treating a mammal diagnosed with cancer. | 07-07-2011 |
| 20110171323 | METHODS AND KITS TO PREDICT PROGNOSTIC AND THERAPEUTIC OUTCOME IN SMALL CELL LUNG CANCER - Disclosed herein are methods used in the identification of cancer patients likely or unlikely to respond to systemic chemotherapy, methods of treating cancer patients based upon the identification, and kits that facilitate the identification. The methods and kits involve detecting the expression of specific microRNA. | 07-14-2011 |
| 20110189305 | TREATMENT OF LUNG CANCER - An immunomodulatory compound is administered to treat, prevent, inhibit, or reduce lung cancer in a subject. | 08-04-2011 |
| 20110195133 | DERMCIDIN-DERIVED PEPTIDES FOR LUNG CANCER DIAGNOSTICS - Methods for diagnosis of non-small cell lung cancers by detection of endogenous peptides in exhaled breath condensate (EBC) are provided. Diagnostic peptides derived from dermcidin (DCD) are provided. A specific dermcidin-derived peptide E-R11, having the sequence ENAGEDPGLAR, is provided. E-R11 peptide levels in EBC, as measured by mass spectrometry (MS), are highly diagnostic of non-small cell lung cancers. A method for inhibiting growth of lung cancer cells by inhibiting DCD expression by RNA interference also is provided. | 08-11-2011 |
| 20110236506 | PHARMACEUTICAL ASSOCIATION CONTAINING LIPOIC ACID AND HYDROXYCITRIC ACID AS ACTIVE INGREDIENTS - Pharmaceutical combination containing lipoic acid and hydroxycitric acid as active ingredients. The present invention relates to a novel pharmaceutical combination and to the use thereof for producing a medicament having an antitumor activity. According to the invention, this combination comprises, as active ingredients: lipoic acid or one of the pharmaceutically acceptable salts thereof; and hydroxycitric acid or one of the pharmaceutically acceptable salts thereof. Said active ingredients being formulated together or separately for a conjugated, simultaneous or separate use. | 09-29-2011 |
| 20110236507 | INHIBITION OF DNA POLYMERASES TO AUGMENT CHEMOTHERAPEUTIC AND ANTIMICROBIAL AGENTS - Disclosed herein is the identification of human DNA polymerase κ (pol κ) as the polymerase that mediates repair of DNA containing interstrand cros slinks (ICLs). The mechanism of action of a number of chemotherapeutic and antimicrobial agents is the induction of ICLs. Thus, provided herein is a method of enhancing the efficacy of a chemotherapeutic or antimicrobial agent in a subject, including selecting a subject in need of treatment with an ICL-inducing agent and administering to the subject an ICL-inducing agent and a therapeutically effective amount of an inhibitor of pol κ. Subjects in need of treatment with an ICL-inducing agent, include, for example, subjects diagnosed with a hyperproliferative disease, an autoimmune disease or an infectious disease. Also provided is a composition for treating a hyperproliferative disease, an autoimmune disease or an infectious disease, comprising an ICL-inducing agent and an amount of an inhibitor of pol κ sufficient to enhance the efficacy of the ICL-inducing agent. Further provided is a method of identifying a DNA polymerase inhibitor. | 09-29-2011 |
| 20110256240 | Combination Therapy - The present invention relates to a method for the production of an antiangiogenic and/or vascular permeability reducing effect in a warm-blooded animal such as a human which is optionally being treated with ionising radiation, particularly a method for the treatment of a cancer, particularly a cancer involving a solid tumour, which comprises the administration of AZD2171 in combination with a platinum anti-tumour agent; to a pharmaceutical composition comprising AZD2171 and a platinum anti-tumour agent; to a combination product comprising AZD2171 and a platinum anti-tumour agent for use in a method of treatment of a human or animal body by therapy; to a kit comprising AZD2171 and a platinum anti-tumour agent; to the use of AZD2171 and a platinum anti-tumour agent in the manufacture of a medicament for use in the production of an antiangiogenic and/or vascular permeability reducing effect in a warm-blooded animal such as a human which is optionally being treated with ionising radiation. | 10-20-2011 |
| 20110256241 | METHODS AND COMPOSITIONS FOR THE TREATMENT OF CANCER - The invention relates to compositions comprising an acid ceramidase inhibitor and a choline kinase inhibitor as well as to the uses thereof for the treatment of cancer. The invention also relates to methods for the selection of an individualised therapy of a cancer patient based on the detection of the acid ceramidase levels. Moreover, the invention also relates to compositions comprising a choline kinase inhibitor and a chemotherapeutic agent and uses thereof for the treatment of cancer. Finally, the invention also relates to compositions comprising a choline kinase inhibitor and a death receptor ligand and uses thereof for the treatment of cancer. | 10-20-2011 |
| 20110262561 | Protoilludance Norsesquiterpenoid Esters and Uses Thereof - Disclosed herein are novel protoilludane norsesquiterpenoid ester compounds isolated from mycelium of | 10-27-2011 |
| 20110280963 | COMBINATION THERAPY FOR THE TREATMENT OF CANCER - The present invention provides methods of sensitizing lung cancer cells to cisplatin and inhibiting the growth of lung cancer tumors by employing a modified eIF-4E antisense oligonucleotide and cisplatin in combination. | 11-17-2011 |
| 20110287110 | COMBINATION CANCER TREATMENT - Described herein are methods of inhibiting the proliferation of cancer cells and methods of treating cancer, by administering a combination of a copper chelator and a platinum-based chemotherapeutic. | 11-24-2011 |
| 20110287111 | SUBSTITUTED 6-(2-AMINOBENZYLAMINO)PURINE DERIVATIVES, THEIR USE AS MEDICAMENTS AND PREPARATIONS CONTAINING THESE COMPOUNDS - The invention relates to new substituted 6-(2-aminobenzylamino)purines, represented by the general formula I, which can be used in CDK inhibition, in particular, in the treatment of viral infections and diseases involving cell proliferation. The invention further includes pharmaceutical preparations containing substituted 6-(2-aminobenzylamino)purines. | 11-24-2011 |
| 20110287112 | PROSTATE CANCER PROGRESSION INHIBITOR AND PROGRESSION INHIBITION METHOD - A prostate cancer progression inhibitor comprises 4-(4-cyano-2-{[2-(4-fluoro-1-naphthyl)propanoyl]amino}phenyl)butyric acid, a salt thereof, a solvate thereof, or a prodrug thereof. 4-(4-Cyano-2-{[2-(4-fluoro-1-naphthyl)propanoyl]amino}phenyl)butyric acid is useful as a prostate cancer progression inhibitor because this butyric acid has, for example, a growth inhibiting effect and a hormone responsiveness recovering effect on prostate cancer that has acquired hormone resistance. | 11-24-2011 |
| 20110293744 | BENZOXAZOLE INHIBITORS OF POLY(ADP-RIBOSE)POLYMERASE - Inhibitors of poly(ADP-ribose)polymerase having a structure of Formula (I), ways to make them and methods of treating patients using them are disclosed. | 12-01-2011 |
| 20110293745 | AURORA KINASE INHIBITORS - The present invention provides Compound 1, solid forms thereof, compositions thereof, as Aurora kinase inhibitor for use as an oncology agent. The present invention also provides synthetic methods of preparing Compound 1 and intermediates thereto. | 12-01-2011 |
| 20110300234 | Methods of Treating Tumor Cells Using RHCC Protein, Fragment or Variant - Methods of treating tumor cells in an individual comprise administering to the individual a drug having anti-tumor effect, wherein the drug is delivered into the tumor cells via Right-Handed Coiled-Coil (RHCC) protein or a fragment or variant thereof. The drug may, for example, be a metal-containing compound, a protein or peptide drug, and/or an organic hydrophobic compound. | 12-08-2011 |
| 20110305777 | DIMERIC IAP ANTAGONISTS - Smac mimetics that inhibit IAPs. | 12-15-2011 |
| 20110311651 | CARDENOLIDES FOR THE TREATMENT OF OCULAR CANCER - The instant invention provides methods of using a class of compounds known as cardenolides in the treatment of proliferative diseases such as cancer. In particular, the instant invention provides methods of treating ocular cancer {e.g., retinoblastoma) using intraarterial infusion to administer cardenolides locally to the eye of a subject with an ocular cancer. | 12-22-2011 |
| 20110311652 | Novel Saponin Compounds, Methods of Preparation Thereof, Use Thereof and Pharmaceutical Compositions - This invention relates to novel saponin compounds of formula II wherein MBz denotes p-methoxybenzoyl, and R is selected from the group comprising C | 12-22-2011 |
| 20110318429 | Uses of an Immunomodulatory Protein (GMI) from Ganoderma Microsporum - The invention provides a method for inhibiting EGF receptor activity comprising contacting an EGF receptor with an immunomodulatory protein (GMI) from | 12-29-2011 |
| 20110318430 | TUMOR THERAPY WITH ANTITUMOR AGENTS IN COMBINATION WITH SINDBIS VIRUS-BASED VECTORS - A method for treating malignant tumors with Sindbis viral based vectors in combination with antitumor agents and pharmaceutical formulations for use in such treatment. | 12-29-2011 |
| 20120003327 | METHOD OF REDUCING MULTI-DRUG RESISTANCE USING INOSITOL TRIPYROPHOSPHATE - Inositol trisphosphate (ITPP) causes normalization of tumor vasculature and is a particularly effective cancer therapy when a second chemotherapeutic agent is administered following partial vascularization. ITPP also treats, alone or in combination, multi-drug resistant cancers. ITPP can also be used to reduce the amount of a second chemotherapeutic drug required for anticancer activity. In addition, ITPP enhances immune response and treats hyperproliferative disorders. | 01-05-2012 |
| 20120009277 | METHOD FOR SELECTION OF NOVEL ANTI-CANCER HERBS USING CHEMINFORMATIC TOOLS - The various embodiments herein provide a new method of selecting novel anti-cancer herbs using cheminformatics tools. The method involves collecting the herbs having synergistic activity with anti-cancer compounds and categorizing the herbs as synergistic plants (SP). The bioactive compounds are selected from the SP and categorized into synergistic compounds collection (SCC). A similarity search is performed using the selected bioactive compounds through available databases to select similar compounds that are categorized as similar synergistic compounds (SSC). A herbal source for the SSC is searched and categorized as similar herbal synergistic compounds (SHSC). The novelty of the SHSC in cancer treatment is confirmed. The novel herbs are categorized as novel candidate herbs (NCH). The synergistic activity of the resulted herbs (NCH) is confirmed by performing in vitro bioassay. | 01-12-2012 |
| 20120015049 | MICRORNA BIOMARKER IN CANCER - This invention provides compositions and methods for predicting and improving a chemotherapy response to treat an ovarian cancer. In one embodiment, the invention provides compositions and methods for detecting the expression level of Let-7i microRNA to predict a chemotherapy response. In another embodiment, the invention provides compositions and methods for enhancing the expression level of Let-7i microRNA to improve a chemotherapy response. | 01-19-2012 |
| 20120015050 | METHODS AND MATERIALS FOR ASSESSING LOSS OF HETEROZYGOSITY - This document provides methods and materials involved in assessing samples (e.g., cancer cells) for the presence of a loss of heterozygosity (LOH) signature. For example, methods and materials for determining whether or not a cell (e.g., a cancer cell) contains an LOH signature are provided. Materials and methods for identifying cells (e.g., cancer cells) having a deficiency in homology directed repair (HDR) as well as materials and methods for identifying cancer patients likely to respond to a particular cancer treatment regimen also are provided. | 01-19-2012 |
| 20120027873 | COMBINATION OF A CHEMOTHERAPEUTIC AGENT AND AN INHIBITOR OF THE TGF-BETA SYSTEM - Pharmaceutical composition comprising a chemotherapeutic agent and a TGF-beta antisense oligonucleotide, wherein the antisense oligonucleotide reduces the sensitivity and IC | 02-02-2012 |
| 20120027874 | COMPOUNDS USEFUL AS INHIBITORS OF ATR KINASE - The present invention relates to pyrazine and pyridine compounds useful as inhibitors of ATR protein kinase. The invention also relates to pharmaceutically acceptable compositions comprising the compounds of this invention; methods of treating various diseases, disorders, and conditions using the compounds of this invention; processes for preparing the compounds of this invention; intermediates for the preparation of the compounds of this invention; and methods of using the compounds in in vitro applications, such as the study of kinases in biological and pathological phenomena; the study of intracellular signal transduction pathways mediated by such kinases; and the comparative evaluation of new kinase inhibitors. | 02-02-2012 |
| 20120034317 | Prediction of Response to Platinum-Based Therapy - Method for determining whether a mammalian subject having a cancer belongs to a first or a second group, wherein subjects of the first group are more likely to respond to a platinum-based therapy than subjects of the second group, comprising the steps of: evaluating the amount of RBM3 protein or RBM3 mRNA present in at least part of a sample earlier obtained from said subject, and determining a sample value corresponding to said amount; comparing the sample value with a reference value; and, if said sample value is higher than said reference value, concluding that said subject belongs to a first group; and if said sample value is lower than or equal to said reference value, concluding that said subject belongs to a second group. There is further provided means useful in the establishment of a treatment prediction. | 02-09-2012 |
| 20120034318 | DIAGNOSTIC METHOD USING PALB2 - The present invention provides a method for detecting mutations in the PALB2 gene in pancreatic cancer patients and in individuals having a family history of pancreatic cancer. Methods are also provided for diagnosing a predisposition to pancreatic cancer, for predicting a patient's response to pancreatic cancer therapies, and for treating pancreatic cancer, based on presence of a PALB2 mutation or abberant PALB2 gene expression in a patient. | 02-09-2012 |
| 20120040020 | COMPOUNDS USEFUL AS INHIBITORS OF ATR KINASE - The present disclosure relates to pyrazine compounds of formula I: | 02-16-2012 |
| 20120040021 | METHODS AND COMPOSITIONS FOR THE TREATMENT OF CANCER - The invention relates to compositions comprising an acid ceramidase inhibitor and a choline kinase inhibitor as well as to the uses thereof for the treatment of cancer. The invention also relates to methods for the selection of an individualised therapy of a cancer patient based on the detection of the acid ceramidase levels. Moreover, the invention also relates to compositions comprising a choline kinase inhibitor and an alkylating agent and uses thereof for the treatment of cancer. Finally, the invention also relates to compositions comprising a choline kinase inhibitor and an alkylating agent or a death receptor ligand and uses thereof for the treatment of cancer. | 02-16-2012 |
| 20120045523 | COMBINATION OF A TLR3 LIGAND AND A CHEMOTHERAPY AGENT WHICH ACTS ON THE INTRINSIC "APOPTOSIS" PATHWAY IN THE TREATMENT OF CANCER - The present invention relates to a drug comprising separately or together (i) a TLR3 ligand and (ii) a chemotherapeutic agent that acts on the intrinsic apoptotic pathway, for simultaneous or sequential administration in the treatment of cancer, wherein the chemotherapeutic agent is selected from topoisomerase II inhibitors, platinum-derived alkylating agents and PI3 kinase inhibitors. | 02-23-2012 |
| 20120045524 | COMBINATION THERAPY WITH PARP INHIBITORS - The present invention describes benzimidazole derivatives of Formula (I) which constitute potent PARP inhibitors in combination with radiotherapy or in combination with other chemotherapeutic agents. | 02-23-2012 |
| 20120058202 | Means and Method for Ovarian Cancer Prognosis - There is provided a method for determining whether a mammalian subject having an ovarian cancer belongs to a first or a second group, wherein the prognosis of subjects of the first group is better than the prognosis of subjects of the second group, comprising the steps of: a) evaluating an amount of RBM3 protein in at least part of a sample earlier obtained from the subject and determining a sample value corresponding to the evaluated amount; b) comparing said sample value with a predetermined refer-ence value; and if said sample value is higher than said ref-erence value, c1) concluding that the subject belongs to the first group; and if said sample value is lower than or equal to said reference value, c2) concluding that the sub-ject belongs to the second group. Related peptides, affinity ligands, uses and further methods are also provided. | 03-08-2012 |
| 20120058203 | METHODS FOR TREATING CANCER AND OTHER PATHOLOGICAL PROLIFERATING DISORDERS BY INHIBITING MITOSIS USING PYRROLO[2,3-D]PYRIMIDINES - The present invention provides methods for treating cancer and other pathological proliferating conditions by inhibiting mitosis using at least one pyrrolo[2,3- | 03-08-2012 |
| 20120058204 | USE OF OVER EXPRESSION OF CYSTATHIONINE GAMMA LYASE AS A PROGNOSTIC, DIAGNOSTIC AND THERAPEUTIC TARGET FOR CANCER - The present invention relates to a method of identifying an expression level of cystathionine gamma lyase (CTH) in a sample from a subject. The present invention further discloses a method of diagnosing a subject with cancer having risk of resistance to a platinum-based drug. The present invention also discloses a method for improving efficacy of a platinum-based drug in a subject suffering a cancer. | 03-08-2012 |
| 20120064175 | HSP90 Inhibitors for Treating Non-Small Cell Lung Cancer in Wild-Type EGFR and/or KRAS Patients - Provided is a method for treating non-small cell lung cancer with wild-type EGFR gene and/or KRAS gene by administering to a subject in need thereof, an effective amount of a triazolone compound according to the following formula: | 03-15-2012 |
| 20120070512 | Substituted 6-(2-hydroxybenzylamino)purine Derivatives, Their Use as Medicaments and Compositions Containing These Derivatives - The invention relates to substituted 6-(2-hydroxybenzylamino)purines of general formula I, to their activity as cyclin-dependent kinases 2, 5, 7 and 9 inhibitors and to their use as medicaments, particularly in the treatment of disorders involving cell proliferation or inflammation. The invention further includes pharmaceutical compositions containing the substituted 6-(2-hydroxybenzylamino)purines. | 03-22-2012 |
| 20120076871 | METHOD FOR DETECTING, QUANTIFYING AND MAPPING DAMAGE AND/OR REPAIR OF DNA STRANDS - Methods and products for detecting in vitro the presence of damage on DNA or the presence of a biological response to damage on DNA at the molecular level. Molecular Combing or other nucleic acid stretching methods are employed together with compounds reacting with DNA, probes binding DNA, or nucleic acid monomers, especially labeled nucleic acid monomers. | 03-29-2012 |
| 20120082736 | Small-molecule TNF modulator to reduce the side effects of chemotherapy and radiotherapy - Cancer patients treated by chemotherapy and/or radiotherapy often suffer serious side effects. Currently, there is only one FDA approved and used as both a chemoprotector and a radioprotector, amifostine, which is associated with significant problems. Disclosed in the present invention are novel methods of using UTL-5g as both a chemoprotector and radioprotector for treating cancer patients in addition to other related methods. | 04-05-2012 |
| 20120087992 | miRNAS AS THERAPEUTIC TARGETS IN CANCER - Methods for modulating expression of a component of a cell, comprising contacting the cell with a nucleic acid comprising an miR-140 nucleic acid sequence in an amount sufficient to modulate the cellular component are provided. Overexpression of miR-140 inhibits cell proliferation in both U-2 OS (wt-p53) and HCT 116 (wt-p53) cell lines. Cells transfected with miR-140 are more resistant to chemotherapeutic agent methotrexate, mi-140 expression is related to HDAC4 protein expression. The claimed methods reduce the protein expression level of HDAC4 without degrading the target mRNA. | 04-12-2012 |
| 20120100227 | KINASE PROTEIN BINDING INHIBITORS - The invention relates to protein binding inhibitor compounds and methods of identifying and using them. The invention further relates to pharmaceutical compositions and methods for treating a variety of diseases and disorders, including cell proliferative disorders, especially cancer. | 04-26-2012 |
| 20120107417 | Effective Antitumor Treatments - ET-743 is used in the preparation of a medicament for an effective treatment of a tumour by combination therapy employing ET-743 with another drug. | 05-03-2012 |
| 20120114765 | ANTI-NEOPLASTIC COMPOUNDS, COMPOSITIONS AND METHODS - Disclosed are novel compounds which are useful as therapeutics, especially in anti-neoplastic therapy and in other therapeutic regimes where cysteine protease inhibition is implicated. | 05-10-2012 |
| 20120114766 | SUBSTITUTED CHROMAN DERIVATIVES, MEDICAMENTS AND USE IN THERAPY - Novel substituted chroman derivatives and intermediate compounds, compositions containing same, methods for their preparation and uses thereof as therapeutic agents particularly as anti-cancer and chemotherapeutic selective agents are described. | 05-10-2012 |
| 20120128793 | IMPLANTABLE OR INSERTABLE MEDICAL DEVICE RESISTANT TO MICROBIAL GROWTH AND BIOFILM FORMATION - Disclosed are implantable or insertable medical devices that provide resistance to microbial growth on and in the environment of the device and resistance to microbial adhesion and biofilm formation on the device. In particular, the invention discloses implantable or insertable medical devices that comprise at least one biocompatible matrix polymer region, an antimicrobial agent for providing resistance to microbial growth and a microbial adhesion/biofilm synthesis inhibitor for inhibiting the attachment of microbes and the synthesis and accumulation of biofilm on the surface of the medical device. Also disclosed are methods of manufacturing such devices under conditions that substantially prevent preferential partitioning of any of said bioactive agents to a surface of the biocompatible matrix polymer and substantially prevent chemical modification of said bioactive agents | 05-24-2012 |
| 20120135089 | E3 LIGASE INHIBITORS - The present invention provides, e.g., compounds having the structure of formula (I): The present invention also provides pharmaceutical compositions that include such compounds, and methods for modulating murine double minute 2 protein (Mdm2) E3 ligase activity, particularly the Mdm2-MdmX hetero-complex E3 ligase activity, using such compounds. | 05-31-2012 |
| 20120141603 | METHODS AND COMPOSITIONS FOR LUNG CANCER PROGNOSIS - Disclosed herein are methods and materials for prognosing survival of lung cancer patients, the methods comprising the detection of gains and losses of minimal common regions and/or genes associated with prognosis and benefit of chemotherapy. | 06-07-2012 |
| 20120141604 | NOVEL COMPOSITIONS AND METHODS FOR THE IDENTIFICATION, ASSESSMENT, PREVENTION AND THERAPY OF HUMAN CANCERS - The present invention is directed to the identification of markers that can be used to determine whether tumors are sensitive or resistant to a therapeutic agent. The present invention is also directed to the identification of therapeutic targets. The invention features a number of “sensitivity markers.” These are markers that are expressed in most or all cell lines that are sensitive to treatment with an agent and which are not expressed (or are expressed at a rather low level) in cells that are resistant to treatment with that agent. The invention also features a number of “resistance markers.” These are markers that are expressed in most or all cell lines that are resistant to treatment with an agent and which are not expressed (or are expressed at a rather low level) in cells that are sensitive to treatment with that agent. The invention also features marker sets that can predict patients that are likely to respond or not to respond to an agent. | 06-07-2012 |
| 20120141605 | PYRAZOLOANTHRONE AND DERIVATIVES THEREOF FOR TREATMENT OF CANCER AND EXCESS ANDROGEN STATES - Provided herein are pyrazoloanthrones or functional derivatives or analogues thereof to activate MIS receptor-mediated downstream effects in a cell. In particular, methods are provided to prevent and treat cancer that expresses MIS receptor type II (MISRII) by administering to a subject at least one pyrazoloanthrone or a functional derivative or analogue thereof. Also provided herein are methods to lower plasma androgen levels in a subject, and/or for the treatment of a subject with a disease characterized by excess androgen, whereby the subject is administered at least one pyrazoloanthrone or a functional derivative or analogue thereof. Also provided are methods to decrease the dose of a chemotherapeutic agent by administering the chemotherapeutic agent with a pyrazoloanthrone or a functional derivative or analogue thereof that lowers the effective dose of the chemotherapeutic agent. | 06-07-2012 |
| 20120141606 | SIGMA LIGANDS FOR THE PREVENTION OR TREATMENT OF PAIN INDUCED BY CHEMOTHERAPY - The invention refers to the use of a sigma ligand of formula (I) to prevent or treat pain induced by a chemotherapeutic agent, especially pain induced by taxanes, vinca alkaloids or platinum-containing chemotherapeutic drugs. | 06-07-2012 |
| 20120156310 | METHOD FOR PREDICTION OF THERAPEUTIC EFFECT OF CHEMOTHERAPY EMPLOYING EXPRESSION LEVEL OF DIHYDROPYRIMIDINE DEHYDROGENASE GENE AS MEASURE - The present invention provides an antitumor agent comprising cisplatin and a combination drug of tegafur/gimeracil/oteracil potassium that ensures an excellent life-prolongation effect in advanced gastric cancer patients that is superior to that of the standard therapy in Europe and the U.S. using an agent that contains 5-FU and does not contain a dihydropyrimidine dehydrogenase inhibitor, by way of selecting the patients based on dihydropyrimidine dehydrogenase. | 06-21-2012 |
| 20120156311 | COMBINATION THERAPY FOR CANCER COMPRISING A PLATINUM-BASED ANTINEOPLASTIC AGENT AND A BIOCOMPATIBLE ELECTRON DONOR - The combination of a biocompatible electron donor and a platinum-based antineoplastic agent exhibits improved efficacy in treating cancer This improved activity appears to be the result of electron transfer from the aforementioned donor compound to the platinum-based antineoplastic agent As the electron donor alone has no chemotherapeutic utility in treating cancer, the resulting combinations appear to be synergistic in nature In select preferred embodiments, the biocompatible electron donor is an amine (such as N,N,N′,N′-tetramethyl-p-phenylene diamine or indocyanine green), a phenolic compound (such as a flavanol or catechin), or a quinone (such as an aromatic quinone), while the antineoplastic is cisplatin. | 06-21-2012 |
| 20120156312 | Compositions for Inhibiting Growth of Cancer Stem Cells - The present invention is a biomarker of chemotherapeutic drug-resistant cancer stem cells and a method of inhibiting the growth of drug-resistant cancer stem cells. In one embodiment the cancer stem cells are testicular cancer germ cells. In another embodiment the present invention is a method of overcoming drug resistance in cancer treatment where the combination of low dose decitabine and administration of a chemotherapeutic drug to which cancer cells were resistant results in successful cancer treatment. | 06-21-2012 |
| 20120171304 | Stabilized Aptamers To Platelet Derived Growth Factor And Their Use As Oncology Therapeutics - Materials and methods are provided for producing and using aptamers useful as oncology therapeutics capable of binding to PDGF, PDGF isoforms, PDGF receptor, VEGF, and VEGF receptor or any combination thereof with great affinity and specificity. The compositions of the present invention are particularly useful in solid tumor therapy and can be used alone or in combination with known cytotoxic agents for the treatment of solid tumors. Also disclosed are aptamers having one or more CpG motifs embedded therein or appended thereto. | 07-05-2012 |
| 20120171305 | Response Prediction in Cancer Treatment Involving p53 Adapted Cancer Therapy - Methods for predicting negative consequences of a treatment of a patient with a therapy comprising determining the genetic status of the patient's tumor with respect to p53 by determining in a sample of body fluid or a tissue sample of the patient containing tumor cells or cell-free tumor DNA whether the whole p53 gene is present in native form or whether the p53 gene has one or more mutations. In further embodiments the patient is predicted to be a patient who will suffer negative consequences of a therapy interfering with the cell cycle if the whole p53 gene is present in native form and a patient who will suffer negative consequences of a therapy inducing p53 dependent apoptosis if the p53 gene has one or more mutations. Methods of treatment are also contemplated. | 07-05-2012 |
| 20120171306 | THERAPEUTIC TREATMENT OF CANCER AND DYSPLASIA OF THE CERVIX OR VAGINA USING ESTROGEN ANTAGONISTS - A method for treatment of cervical or vaginal cancer and their associated dysplasia, including the steps of identifying a human cervical or vaginal cancer and/or dysplasia patient, administering an effective amount of an estrogen antagonist therapy to the patient, wherein the amount is effective to reduce cancer and dysplasia symptoms, and observing a reduction of cancer and dysplasia symptoms in the patient. | 07-05-2012 |
| 20120177748 | COMPOUNDS USEFUL AS INHIBITORS OF ATR KINASE - The present invention relates to pyridine compounds useful as inhibitors of ATR protein kinase. The invention also relates to pharmaceutically acceptable compositions comprising the compounds of this invention; methods of treating various diseases, disorders, and conditions using the compounds of this invention; processes for preparing the compounds of this invention; intermediates for the preparation of the compounds of this invention; and methods of using the compounds in in vitro applications, such as the study of kinases in biological and pathological phenomena; the study of intracellular signal transduction pathways mediated by such kinases; and the comparative evaluation of new kinase inhibitors. | 07-12-2012 |
| 20120177749 | FAMILY OF PFKFB3 INHIBITORS WITH ANTI-NEOPLASTIC ACTIVITIES - A methods and compounds for inhibiting 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase 3 (PFKFB3) are described. Also described are methods of inhibiting cell proliferation, treating cancer, and screening compounds to determine their ability to inhibit PFKFB3. | 07-12-2012 |
| 20120183629 | LOW VISCOSITY LIQUID POLYMERIC DELIVERY SYSTEM - Low viscosity biodegradable polymer solutions of a liquid biodegradable polymer and biocompatible solvent and methods of using the compositions to form a biodegradable liquid polymer implant are provided. | 07-19-2012 |
| 20120189713 | MONOMERS AND PHASE-SEPARATED BIOCOMPATIBLE POLYMER COMPOSITIONS PREPARED THEREFROM FOR MEDICAL USES - The invention relates to novel monomers of Formula (I) useful for preparation of phase-separated biocompatible polymers or polymer compositions. These polymers or polymer compositions may be bioresorbable and/or biodegradable and have desirable mechanical properties, such as fracture and/or fatigue toughness, which have not been a primary design criteria for such polymers previously. The polymers or polymer compositions are useful in a variety of medical applications, such as in the fabrication of medical devices. Therefore, methods for preparing these polymers or polymer compositions and medical devices are also encompassed by this disclosure. | 07-26-2012 |
| 20120195977 | AURIC ACID ASSISTED SILICON NANOPARTICLE FORMATION METHOD - Embodiments of the invention provide, among other things, a method of preparing nanoparticles including silicon nanoparticles. A mixture is prepared that includes auric acid (HAuCl | 08-02-2012 |
| 20120195978 | CAPCNA PEPTIDE THERAPEUTICS FOR CANCER - Administration of compositions comprising cell-permeable caPCNA-derived peptides and their variants reduces the proliferation of cancer cells and also augments cytotoxic effects of chemotherapeutics. The compositions are effective in cells harboring mutations in DNA repair proteins. | 08-02-2012 |
| 20120207855 | CEPHALOTAXINE ALKALOID COMPOSITIONS AND USES THEREOF - A method of treatment of a host with a cellular proliferative disease, comprising contacting the host with a cephalotaxine and an antiproliferative agent, each in an amount sufficient to modulate said cellular proliferative disease, is described. In some embodiments, the cephalotaxine comprises homoharringtonine (cephalotaxine, 4-methyl-2-hydroxy-2-(4-hydroxy-4-methyl pentyl)butanediocate ester). Antiproliferative agents of the invention comprise alkylating agents, intercalating agents, metal coordination complexes, pyrimidine nucleosides, purine nucleosides, inhibitors of nucleic acid associated enzymes and proteins, and agents affecting structural proteins and cytoplasmic enzymes. | 08-16-2012 |
| 20120207856 | MSH3 Expression Status Determines the Responsiveness of Cancer Cells to the Chemotherapeutic Treatment with PARP Inhibitors and Platinum Drugs - Methods for treating a patient at risk for or diagnosed with colorectal cancer are disclosed herein. The method of the present invention determines the overall expression of MSH3 in cells suspected of being colorectal cancer cells from the patient and predicting the efficacy of therapy with a genotoxic anti-neoplastic agent for treating the patient, wherein a decrease in the overall expression of MSH3 in the patient cells when compared to the expression of MSH3 in normal colorectal cells indicates a predisposition to responsiveness to genotoxic anti-neoplastic agent therapy, wherein the therapy comprises administering an effective amount of the genotoxic anti-neoplastic agent therapy to patients. | 08-16-2012 |
| 20120207857 | Compositions and Methods for Potentiation of Cancer Agents - The present invention includes compositions and method to improve the therapeutic index of anti-cancer agents using a novel anti-cancer agent and a modulator or potentiator thereof | 08-16-2012 |
| 20120213867 | RAF INHIBITORS FOR THE TREATMENT OF THYROID CANCER - The invention relates to the use of an Raf inhibitor for the manufacture of pharmaceutical compositions for the treatment of thyroid cancer, more specifically papillary thyroid cancer (PTC); the use of a Raf inhibitor in the treatment of thyroid cancer, more specifically PTC; a method of treating warm-blooded animals including mammals, especially humans, suffering from thyroid cancer, more specifically PTC, by administering to a said animal in need of such treatment a dose effective against said disease of an Raf inhibitor. The invention also relates to the use of a Raf inhibitor in combination with a platin compound for the treatment of thyroid cancer, more specifically papillary thyroid cancer. | 08-23-2012 |
| 20120231090 | MOLECULAR BIOMARKER SET FOR EARLY DETECTION OF OVARIAN CANCER - Embodiments of the present invention concern methods and compositions related to detection of ovarian cancer, including detection of the stage of ovarian cancer, in some cases. In particular, the invention encompasses use of expression of TFAP2A and in some embodiments CA125 and/or E2F5 to identify ovarian cancer, including detecting mRNA and/or protein levels of the respective gene products. Kits for detection of ovarian cancer are also described. | 09-13-2012 |
| 20120237614 | PEPTIDE ABLE TO DISRUPT THE PROTEIN COMPLEX BETWEEN THE HIS273 MUTADED P53 PROTEIN AND THE ONCOSUPPRESSIVE P73 PROTEIN IN TUMOR CELLS AND THERAPEUTIC USES THEREOF - The present invention concerns a SIMP peptide (Short-interfering mutant p53 peptides) suitable to disrupt the protein complexes within tumour cells resulting from m-p53 and p73 proteins selectively in tumours wherein m-p53 contains His273 mutation. | 09-20-2012 |
| 20120237615 | PHARMACEUTICAL COMPOSITIONS OF O-NITRO COMPOUNDS - The present invention provides O-nitro compounds, pharmaceutical compositions of O-nitro compounds and methods of using O-nitro compounds and/or pharmaceutical compositions thereof to treat or prevent diseases or disorders characterized by abnormal cell proliferation, such as cancer, inflammation, cardiovascular disease and autoimmune disease. | 09-20-2012 |
| 20120244230 | POLYVALENT POLYNUCLEOTIDE NANOPARTICLE CONJUGATES AS DELIVERY VEHICLES FOR A CHEMOTHERAPEUTIC AGENT - The present invention is directed to compositions and methods of delivering a chemotherapeutic agent via a polynueleotide-functionalized nanoparticle (PN-NP). | 09-27-2012 |
| 20120251630 | REMISSION THERAPY OF CANCER WITH ISOFLAVONOIDS - Provided herein is a method of reducing incidences of cancer recurrence. The method involves administering to an individual in cancer remission an isoflavonoid. In specific instances, the treated individual is in remission from epithelial cancer, such as ovarian cancer or breast cancer. | 10-04-2012 |
| 20120258180 | PARP INHIBITORS FOR THE TREATMENT OF CIPN - The present invention relates to the method of treating chemotherapy-induced neuropathy in a subject in need thereof with the use of a poly(ADP-ribose)polymerase (PARP) inhibitor. | 10-11-2012 |
| 20120258181 | ANTICANCER COMBINATION OF ARTEMISININ-BASED DRUGS AND OTHER CHEMOTHERAPEUTIC AGENTS - The present invention relates to combinations between artemisinin-based potent anti-malarial agents, selected from the group consisting of ART, DHA and ARM, and a further chemotherapeutic drug selected from the group consisting of a camptothecin derivative, or a PARP-1 inhibitor, or an intercalating DNA agent, or an alkylating agent. Such combinations, showed medium to strong synergism in various models of cancer, in particular in NSCL. | 10-11-2012 |
| 20120263802 | Use of Quinazoline Derivative ZD6474 Combined With Platinum Compounds and Optionally Ionising Radiation in the Treatment of Diseases Associated With Angiogenesis and/or Increased Vascular Permeability - The present invention relates to a method for the production of an antiangiogenic and/or vascular permeability reducing effect in a warm-blooded animal which is optionally being treated with ionising radiation, which comprises the administration of ZD6474 in combination with a platinum anti-tumour agent; to a pharmaceutical composition comprising ZD6474 and a platinum anti-tumour agent; to a combination product comprising ZD6474 and a platinum anti-tumour agent for use in a method of treatment of a human or animal body by therapy; and to a kit comprising ZD6474 and a platinum anti-tumour agent. | 10-18-2012 |
| 20120269901 | Methods and Compounds Useful to Induce Apoptosis in Cancer Cells - The present invention provides a method for treating cancer in a mammal comprising contacting the cancer cells with a compound which is a apogossypol, derivative. | 10-25-2012 |
| 20120269902 | Thiazole Compounds, and Compositions and Methods Using Same - The present invention provides, in part, compounds and compositions including a thiazole moiety, that may be useful, for example, for treating cancers, for example kidney cancer. | 10-25-2012 |
| 20120269903 | NOVEL MANNOPYRANOSIDE DERIVATIVES WITH ANTICANCER ACTIVITY - The present invention relates to mannopyranoside-derived compounds and to the use thereof as medicaments, in particular in the treatment of cancer diseases, and also to the method for preparing same and to pharmaceutical compositions comprising such compounds. Medical devices surface-treated with mannopyranoside-derived compounds according to the invention also form part of the invention. | 10-25-2012 |
| 20120294956 | INHIBITION OF DYNAMIN RELATED PROTEIN 1 TO PROMOTE CELL DEATH - The present invention relates to compositions and methods for reducing cell proliferation and/or promoting cell death by inhibiting Drp1. It is based, at least in part, on the discoveries that (i) Drp1 disruption-induced mitochondrial hyperfusion is functionally linked to the cell cycle regulation apparatus, so that Drp1 inhibition results in a disruption of the cell cycle and DNA aberrancies; (ii) inhibition of both Drp1 and ATR are synthetic lethal causing increased DNA damage and apoptotic cell death; and (iii) even in resistant cell lines, Drp1 inhibitor (e.g., mdivi-1) together with a second antiproliferative agent (e.g., cisplatin or carboplatin) act synergistically to promote apoptosis. Accordingly, the present invention provides for novel anticancer strategies. | 11-22-2012 |
| 20120294957 | TREATMENT OF LUNG CANCER - Disclosed are methods of treating lung cancer by administering to a human in need thereof effective amounts of FTS, or various analogs thereof, or a pharmaceutically acceptable salt thereof, optionally, in combination with a chemotherapeutic agent. Chemotherapeutic agents, and combinations thereof, for use with FTS, its analogs, or its salts are also disclosed. | 11-22-2012 |
| 20120328714 | EARLY DETECTION AND TREATMENT OF LUNG CANCER - This document provides methods and materials involved in the early detection of lung cancer (e.g., small cell lung cancer). For example, this document provides methods and materials for assessing nucleic acid obtained from a blood sample of a human for a CpG methylation site profile that, at least in part, indicates that the human has lung cancer (e.g., small cell lung cancer). | 12-27-2012 |
| 20130004592 | PHARMACEUTICAL COMPOSITIONS FOR PARENTERAL ADMINISTRATION - The invention comprises various aqueous PEG-carbohydrate-lipid based formulations of pharmaceutical active ingredients including compositions for intravenous injections. This invention relates to methods and compositions for improving solubility and the safety profile of pharmaceutical compounds. More particularly, the present invention relates to employing PEG-carbohydrate-lipid conjugates for formulating drug compositions having increased solubility or dispersivity and enhanced stability. | 01-03-2013 |
| 20130011496 | CANCER TESTIS ANTIGENS AS BIOMARKERS IN NON-SMALL CELL LUNG CANCER - A cancer testis antigen biomarker useful to determine whether a non- small cell lung cancer tumor is likely to respond to neoadjuvant chemotherapy is provided. Methods of using the biomarker in the diagnosis, treatment and prognosis of non-small cell lung cancer also are provided. | 01-10-2013 |
| 20130011497 | METHOD OF TREATMENT AND SCREENING METHOD - A method for the treatment of a proliferative disease comprising providing a E2F-1 protein which is arginine-methylation defective or administering a substance which reduces the expression and/or activity of PRMT5. The invention also provides antibodies, screening methods and kits. | 01-10-2013 |
| 20130017272 | METHOD FOR TREATING NON-SMALL CELL LUNG CANCER - A method of treating a human patient afflicted with lung cancer comprising periodically administering to the human patient chemotherapy comprising an amount of a taxane and 640 mg of an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2′-O-methoxyethyl modifications, has nucleotides 5-17 which are 2′ deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19, thereby treating the human patient afflicted with cell lung cancer. | 01-17-2013 |
| 20130017273 | COMPOUNDS USEFUL AS INHIBITORS OF ATR KINASE - The present invention relates to pyrrolopyrazines compounds useful as inhibitors of ATR protein kinase. The invention also relates to pharmaceutically acceptable compositions comprising the compounds of this invention; methods of treating of various diseases, disorders, and conditions using the compounds of this invention; processes for preparing the compounds of this invention; intermediates for the preparation of the compounds of this invention; and methods of using the compounds in in vitro applications, such as the study of kinases in biological and pathological phenomena; the study of intracellular signal transduction pathways mediated by such kinases; and the comparative evaluation of new kinase inhibitors. | 01-17-2013 |
| 20130022688 | Use of Amisulpride as an Anti-Emetic - Amisulpride is used in the therapy of nausea, vomiting or retches. The therapy may utilize a novel injectable formulation, in unit dosage form, comprising less than 50 mg amisulpride. | 01-24-2013 |
| 20130022689 | Use of Amisulpride as an Anti-Emetic - Amisulpride is used in the therapy of nausea, vomiting or retches. The therapy may utilize a novel injectable formulation, in unit dosage form, comprising less than 50 mg amisulpride. | 01-24-2013 |
| 20130028989 | MATERIALS AND METHOD FOR INHIBITING REPLICATION PROTEIN A AND USES THEREOF - Targeting uncontrolled cell proliferation and resistance to DNA damaging chemotherapeutics with at least one reagent has significant potential in cancer treatment. Replication Protein A, the eukaryotic single-strand (ss) DNA binding protein, is essential for genomic maintenance and stability via roles in both DNA replication and repair. Reported herein are small molecules that inhibits the in vitro, in vivo, and cellular ssDNA binding activity of RPA, thereby disrupting the eukaryotic cell cycle, inducing cytotoxicity and increasing the efficacy of chemotherapeutic agents damage DNA, and/or disrupt its replication and/or function. These results provide new insights into the mechanism of RPA-ssDNA interactions in chromosome maintenance and stability. This represents a molecularly targeted eukaryotic DNA binding inhibitor and demonstrates the utility of targeting a protein-DNA interaction as a means of studying the cell cycle and providing a therapeutic strategy for cancer treatment. | 01-31-2013 |
| 20130034616 | COMPOUNDS USEFUL AS INHIBITORS OF ATR KINASE - The present invention relates to pyrrolopyrazines compounds useful as inhibitors of ATR protein kinase. The invention also relates to pharmaceutically acceptable compositions comprising the compounds of this invention; methods of treating of various diseases, disorders, and conditions using the compounds of this invention; processes for preparing the compounds of this invention; intermediates for the preparation of the compounds of this invention; and methods of using the compounds in in vitro applications, such as the study of kinases in biological and pathological phenomena; the study of intracellular signal transduction pathways mediated by such kinases; and the comparative evaluation of new kinase inhibitors. | 02-07-2013 |
| 20130039996 | POTENTIATION OF CANCER CHEMOTHERAPY BY 7-(2, 5- DIHYDRO- 4-IMIDAZO [1, 2-A] PYRIDINE-3-YL-2,5-DIOXO-IH-PYRROL-3-YL)-9-FLUORO-1,2,3,4 TETRAHYDRO -2-(1-PIPERIDINYL-CARBONYL)-PYRROLO [3,2,1-JK] [1,4] BENZODIAZEPINE - An improved method for treating gastric cancer, ovarian cancer, non-small cell lung cancer, or colorectal cancer in a patient is described, as well as pharmaceutical compositions useful for the method and a process for preparing said compositions. | 02-14-2013 |
| 20130045286 | PYRROLOPYRIDINES AS KINASE INHIBITORS - Compounds of Formula I are useful for inhibition of CHK1 and/or CHK2. Methods of using compounds of Formula I and stereoisomers and pharmaceutically acceptable salts thereof, for in vitro, in situ, and in vivo diagnosis, prevention or treatment of such disorders in mammalian cells, or associated pathological conditions are disclosed. | 02-21-2013 |
| 20130059015 | Human Cancer micro-RNA Expression Profiles Predictive of Chemo-Response - Disclosed are identified and successfully targeted microRNAs (miRNAs) associated with human cancer cell line response to a range of anti-cancer agents. The strategy of integrating in vitro miRNA expression and drug sensitivity data not only aid in the characterization of determinants of cytotoxic response, but also in the identification of novel therapeutic targets. | 03-07-2013 |
| 20130064901 | GENE EXPRESSION PROFILING FOR CLASSIFYING AND TREATING GASTRIC CANCER - The invention relates to methods for diagnosis and prognosis of gastric cancer. The approach described herein can distinguish intestinal-type gastric cancer (G-INT) from diffuse-type gastric cancer (G-DIF). The genomic expression signatures of G-INT and G-DIF define two major sets of genes. A diagnosis of gastric cancer G-INT and G-DIF can be made on the basis of the expression levels of these genes. This can lead to a better prognosis and treatment of gastric cancer. | 03-14-2013 |
| 20130064902 | PHOSPHAPLATINS AND THEIR USE FOR TREATMENT OF CANCERS - Stable monomeric phosphaplatins, namely, (pyrophosphato)platinum(II) or platinum(IV) complexes containing a cis-cyclohexanediamine ligand or enantiomerically enriched or enantiopure trans-cyclohexanediamine ligands, and synthesis of these complexes, are provided. Efficacies and toxicities of the phosphaplatin compounds are determined toward a variety of cancers, including sensitive and resistant ovarian cancers, head and neck, and colon cancers. Compositions comprising the platinum complexes, and methods for treatment of proliferative diseases or disorders by means of the complexes or the compositions comprising them are disclosed. | 03-14-2013 |
| 20130078319 | DETECTION OF OVARIAN CANCER - Among other things, the present disclosure provides a method including the steps of: obtaining a uterine sample; and detecting and/or characterizing in the uterine sample an ovarian cancer biomarker (e.g., CA125). | 03-28-2013 |
| 20130084345 | INDIBULIN THERAPY - The invention provides combination therapy, wherein one or more other therapeutic agents are administered with indibulin or a pharmaceutically acceptable salt thereof and the combination is synergistic. Another aspect of the invention relates to the treatment of cancer with indibulin as a single agent. Another aspect of the invention relates to dosing regimen for administration of oral dosage forms of indibulin. | 04-04-2013 |
| 20130089624 | Compounds Useful as Inhibitors of ATR Kinase - The present invention relates to compounds useful as inhibitors of ATR protein kinase. The invention also relates to pharmaceutically acceptable compositions comprising the compounds of this invention; methods of treating of various diseases, disorders, and conditions using the compounds of this invention; processes for preparing the compounds of this invention; intermediates for the preparation of the compounds of this invention; and methods of using the compounds in in vitro applications, such as the study of kinases in biological and pathological phenomena; the study of intracellular signal transduction pathways mediated by such kinases; and the comparative evaluation of new kinase inhibitors. | 04-11-2013 |
| 20130089625 | Compounds Useful as Inhibitors of ATR Kinase - The present invention relates to compounds useful as inhibitors of ATR protein kinase. The invention also relates to pharmaceutically acceptable compositions comprising the compounds of this invention; methods of treating of various diseases, disorders, and conditions using the compounds of this invention; processes for preparing the compounds of this invention; intermediates for the preparation of the compounds of this invention; solid forms of the compounds of this invention; and methods of using the compounds in in vitro applications, such as the study of kinases in biological and pathological phenomena; the study of intracellular signal transduction pathways mediated by such kinases; and the comparative evaluation of new kinase inhibitors. | 04-11-2013 |
| 20130089626 | Treating Cancer with ATR Inhibitors - This invention relates to methods and compositions for treating pancreatic cancer. More specifically, this invention relates to treating pancreatic cancer with certain ATR inhibitors in combination with gemcitabine and/or radiation therapy. This invention also relates to methods and compositions for treating non-small cell lung cancer. More specifically, this invention relates to treating non-small cell lung cancer with an ATR inhibitor in combination with cisplatin or carboplatin, etoposide, and ionizing radiation. | 04-11-2013 |
| 20130089627 | METHOD FOR TREATING A CANCER CAUSED BY CANCER STEM CELLS - This invention provides a method for treating a cancer caused by cancer stem cells in a subject in need thereof, comprising administering to the subject an effective amount of | 04-11-2013 |
| 20130095193 | COMPOUNDS USEFUL AS INHIBITORS OF ATR KINASE - The present invention relates to compounds useful as inhibitors of ATR protein kinase. The invention also relates to pharmaceutically acceptable compositions comprising the compounds of this invention; methods of treating of various diseases, disorders, and conditions using the compounds of this invention; processes for preparing the compounds of this invention; intermediates for the preparation of the compounds of this invention; and methods of using the compounds in in vitro applications, such as the study of kinases in biological and pathological phenomena; the study of intracellular signal transduction pathways mediated by such kinases; and the comparative evaluation of new kinase inhibitors. | 04-18-2013 |
| 20130101679 | CHOLESTANOL DERIVATIVE FOR COMBINED USE - The invention provides a cancer chemotherapeutic agent which has fewer side effects and excellent efficacy. The cancer chemotherapeutic agent of the invention includes a cholestanol derivative represented by formula (1): | 04-25-2013 |
| 20130101680 | RADIOTHERAPY ENHANCER - The present invention relates to a method of treating pancreatic cancer in a subject in need thereof by administering an effective amount of a composition containing (A) tegafur and (B) gimeracil in conjunction with radiotherapy. | 04-25-2013 |
| 20130108711 | METHODS FOR TREATING DISEASES OF THE LUNG | 05-02-2013 |
| 20130115309 | METHODS FOR IDENTIFYING AND USING INHIBITORS OF CASEIN KINASE 1 EPSILON ISOFORM FOR INHIBITING THE GROWTH AND/OR PROLIFERATION OF MYC-DRIVEN TUMOR CELLS - In one aspect, the invention provides a method for inhibiting the growth and/or proliferation of a myc-driven tumor cell comprising the step of contacting the tumor cells with a CSNK1ε inhibitor. In another aspect, the invention provides a method of treating a subject suffering from a tumor comprising myc-driven tumor cells, comprising administering to the subject an amount of a composition comprising a CSNK1ε inhibitor effective to inhibit the growth and/or proliferation of the tumor cells. | 05-09-2013 |
| 20130115310 | Compounds Useful as Inhibitors of ATR Kinase - The present invention relates to compounds useful as inhibitors of ATR protein kinase. The invention also relates to pharmaceutically acceptable compositions comprising the compounds of this invention; methods of treating of various diseases, disorders, and conditions using the compounds of this invention; processes for preparing the compounds of this invention; intermediates for the preparation of the compounds of this invention; and methods of using the compounds in in vitro applications, such as the study of kinases in biological and pathological phenomena; the study of intracellular signal transduction pathways mediated by such kinases; and the comparative evaluation of new kinase inhibitors. | 05-09-2013 |
| 20130115311 | Compounds Useful as Inhibitors of ATR Kinase - The present invention relates to compounds useful as inhibitors of ATR protein kinase. The invention also relates to pharmaceutically acceptable compositions comprising the compounds of this invention; methods of treating of various diseases, disorders, and conditions using the compounds of this invention; processes for preparing the compounds of this invention; intermediates for the preparation of the compounds of this invention; and methods of using the compounds in in vitro applications, such as the study of kinases in biological and pathological phenomena; the study of intracellular signal transduction pathways mediated by such kinases; and the comparative evaluation of new kinase inhibitors. | 05-09-2013 |
| 20130115312 | Compounds Useful as Inhibitors of ATR Kinase - The present invention relates to compounds useful as inhibitors of ATR protein kinase. The invention also relates to pharmaceutically acceptable compositions comprising the compounds of this invention; methods of treating of various diseases, disorders, and conditions using the compounds of this invention; processes for preparing the compounds of this invention; intermediates for the preparation of the compounds of this invention; and methods of using the compounds in in vitro applications, such as the study of kinases in biological and pathological phenomena; the study of intracellular signal transduction pathways mediated by such kinases; and the comparative evaluation of new kinase inhibitors. | 05-09-2013 |
| 20130115313 | Compounds Useful as Inhibitors of ATR Kinase - The present invention relates to compounds useful as inhibitors of ATR protein kinase. The invention also relates to pharmaceutically acceptable compositions comprising the compounds of this invention; methods of treating of various diseases, disorders, and conditions using the compounds of this invention; processes for preparing the compounds of this invention; intermediates for the preparation of the compounds of this invention; and methods of using the compounds in in vitro applications, such as the study of kinases in biological and pathological phenomena; the study of intracellular signal transduction pathways mediated by such kinases; and the comparative evaluation of new kinase inhibitors. | 05-09-2013 |
| 20130115314 | Compounds Useful as Inhibitors of ATR Kinase - The present invention relates to compounds useful as inhibitors of ATR protein kinase. The invention also relates to pharmaceutically acceptable compositions comprising the compounds of this invention; methods of treating of various diseases, disorders, and conditions using the compounds of this invention; processes for preparing the compounds of this invention; intermediates for the preparation of the compounds of this invention; and methods of using the compounds in in vitro applications, such as the study of kinases in biological and pathological phenomena; the study of intracellular signal transduction pathways mediated by such kinases; and the comparative evaluation of new kinase inhibitors. | 05-09-2013 |
| 20130122110 | ANTI-HUMAN UROTHELIAL CARCINOMA OF SUPERCRITICAL CARBON DIOXIDE EXTRACT OF CINNAMOMUM SUBAVENIUM, AND THE PREPARATION PROCESS AND USES - What is disclosed in the invention is a preparation method of a supercritical | 05-16-2013 |
| 20130122111 | METHOD FOR TREATMENT OF ADVANCED SOLID TUMORS - The present invention relates to the use of Volasertib or a salt thereof or a hydrate thereof in combination with Cisplatin or Carboplatin or a salt thereof or a hydrate thereof for treating patients suffering from advanced and/or metastatic solid tumours. | 05-16-2013 |
| 20130122112 | Derivatized Hyperbranched Polyglycerols - Herein are provided derivatized hyperbranched polyglycerols (“dHPGs”). The dHPG comprises a core comprising a hyperbranched polyglycerol derivatized with C | 05-16-2013 |
| 20130122113 | ANTITUMORAL COMBINATION COMPRISING OMBRABULIN, A TAXANE DERIVATIVE AND A PLATINUM DERIVATIVE - The invention concerns an antitumoral combination comprising ombrabulin, a taxane derivative and a platinum derivative and its use in the treatment of advanced solid tumors. | 05-16-2013 |
| 20130122114 | METHODS AND COMPOSITIONS FOR INHIBITING THE NUCLEAR FACTOR KAPPAB PATHWAY - The current invention provides therapeutic methods which include inhibition of nuclear factor κb pathway in a cell based on the discovery of an active fraction of a plant extract termed NUP or a composition which includes NUP. NUP is used in treating and managing different diseases such as cancer, inflammation, and virus infections. | 05-16-2013 |
| 20130129840 | COMBINATION THERAPY USING A RUTHENIUM COMPLEX - A combination therapy is disclosed for treating cancer. The method comprises administering to a cancer patient a therapeutically effective amount of trans-[tetrachlorobis(1H-indazole)ruthenate(III)] or a pharmaceutically acceptable salt thereof, and administering to the patient a therapeutically effective amount of one or more other anti-cancer agents as disclosed herein. | 05-23-2013 |
| 20130129841 | THERAPEUTIC COMBINATION COMPRISING A PARP-1 INHIBITOR AND AN ANTI-NEOPLASTIC AGENT - The present invention provides a therapeutic combination comprising (a) a compound of formula (I) as set forth in the specification and (b) one or more antineoplastic agents selected from the group consisting of an alkylating or alkylating-like agent, an antimetabolite agent, a topoisomerase I inhibitor, a topoisomerase II inhibitor, an antimitotic agent and radiation wherein the active ingredients are present in each case in free form or in the form of a pharmaceutically acceptable salt or any hydrate thereof. | 05-23-2013 |
| 20130136804 | Crystal Forms of Kinase Inhibitors - N-(4-{4-amino-7-[1-(2-hydroxyethyl)-1H-pyrazol-4-yl]thieno[3,2-c]pyridin-3-yl}phenyl)-N′-(3-fluorophenyl)urea free base and crystallines form thereof are suitable pharmaceutical ingredients for pharmaceutical compositions useful in the treatment of disease, for example, cancer. | 05-30-2013 |
| 20130142887 | USE OF HISTONE ACETYLTRANSFERASE INHIBITORS AS NOVEL ANTI-CANCER THERAPIES - The present invention provides methods for treating cancer comprising inhibiting the activity of p300/CBP histone acetyltransferase (HAT). Also provided are p300/CBP HAT inhibitors for treating a subject having cancer. In addition, the present invention includes biomarkers for p300/CBP HAT inhibition, which are used to i) monitor the effectiveness of cancer therapy, and ii) identify anti-cancer agents for use in combination therapy. | 06-06-2013 |
| 20130149392 | METHOD OF TREATING NON-SMALL CELL LUNG CANCER WITH BIS-(THIOHYDRAZIDE)AMIDE COMPOUNDS - The present invention is a method for treating non-small cell lung cancer in a subject in need thereof, comprising administering to the subject an effective amount of a bis(thiohydrazideamide) compound of formula (I): | 06-13-2013 |
| 20130149393 | MEDICAL COMPOSITIONS CONTAINING LIQUORICE EXTRACTS WITH SYNERGISTIC EFFECT - The invention provides drug compositions with synergistic effects, which includes alcohol-soluble and water-insoluble liquorices extracts and at least one kind of anti-tumor or glucose-and-lipid-lowering drug/eatable substance, and can be used to treat tumor or lower blood glucose and lipid. Besides, the invention also provides pharmaceutical preparation, pharmaceutical application, therapeutic and preparation methods, etc. related to this drug compositon. | 06-13-2013 |
| 20130164387 | NOVEL MANNOPYRANOSIDE DERIVATIVES WITH ANTICANCER ACTIVITY - The present invention relates to mannopyranoside-derived compounds and to the use thereof as medicaments, in particular in the treatment of cancer diseases, and also to the method for preparing same and to pharmaceutical compositions comprising such compounds. Medical devices surface-treated with mannopyranoside-derived compounds according to the invention also form part of the invention. | 06-27-2013 |
| 20130171268 | METHODS AND COMPOSITIONS FOR TREATMENT OF MITOCHONDRIAL TOXICITY - The present invention relates to compositions and methods for prophylactic and/or therapeutic treatment of conditions related to mitochondrial function. In various aspects, the present invention comprises administering one or more compounds selected from the group consisting of epicatechin, an epicatechin derivative, catechin, a catechin derivative, nicorandil, and a nicorandil derivative in an amount effective to ameliorate mitochondrial toxicity caused by administration of a chemical, food, or drug. | 07-04-2013 |
| 20130177660 | POTENTIATOR OF ACTIVITY OF ANTI-CANCER AGENT AND USE THEREOF, AND BIOMARKER FOR PREDICTION OF PROGNOSIS IN CANCER PATIENT AND USE THEREOF - Disclosed is a means for improving the clinical outcomes of cancer therapy. Specifically disclosed is an activity potentiator comprising a compound capable of inhibiting the expression of RFP (RET finger protein) gene or the activity of RFP as an active ingredient. The activity of an anti-cancer agent having an oxidative stress inducing ability can be potentiated by using the anti-cancer agent in combination with the activity potentiator. Further specifically disclosed are a biomarker useful for the recognition of prognosis in a cancer patient and use of the biomarker. | 07-11-2013 |
| 20130196000 | COMBINATION THERAPY INCLUDING ISOPHOSPHORAMIDE MUSTARD, ANALOGS, OR SALTS THEREOF - In one aspect, a method for treating a subject having a hyperproliferative disorder is disclosed, including administering to the subject a composition including: IPM, an IPM analog, or a pharmaceutically acceptable salt thereof in the dosage from about 70 mg/m | 08-01-2013 |
| 20130202716 | Treatment of Cancer Using Hypoxia Activated Prodrugs - Cancer can be treated by administration of a hypoxia-activated prodrug, such as TH-302, alone or in combination with other anticancer agents and/or radiation therapy. In combination therapy, the hypoxia-activated prodrug and another anti-cancer agent or radiation therapy may be administered within the same 24-hour period, and administration of the hypoxia-activated prodrug may be completed prior to beginning administration of the other anticancer agent or radiation therapy. | 08-08-2013 |
| 20130202717 | MATERIALS AND METHODS FOR DIAGNOSING AND PREDICTING THE COURSE OF PROSTATE CANCER - Expression of Forkhead-box protein A1 (FOXA1), a transcription factor important for the normal development of the prostate gland is thought to be controlled by steroid hormones and GATA-3. Expression of FOXA1, GATA-3 and androgen receptor (AR) was retrospectively analyzed by immunohistochemistry (IHC) in a series of 80 primary tumors and 28 metastatic prostate cancers including 15 matched paired samples. High nuclear FOXA1 expression was seen in 19% of primary tumors and 89% of metastatic tumors (p<0.0001). FOXA1 expression correlated positively with tumor size, extra-prostatic extension, angiolymphatic invasion, AR and metastasis but did not correlate with age, tumor stage, Gleason score, presence of PIN or multifocality, seminal vesicle or perineural invasion and status of surgical excision margins. Expression of GATA-3 was not seen in either normal epithelium or tumor. High FOXA1 expression is associated with development of metastatic prostate cancer. Accordingly, FOXA1 expression can be used to classify patients at higher risk for metastases. | 08-08-2013 |
| 20130202718 | MONITORING IMMUNOGLOBULIN HEAVY CHAIN EVOLUTION IN B-CELL ACUTE LYMPHOBLASTIC LEUKEMIA - The invention is directed to methods of monitoring B-cell lymphoid proliferative disorders, such as B-cell acute lymphoblastic leukemias, by measuring the presence, absence and/or levels of correlating, or index, clonotypes and related clonotypes that have evolved therefrom, for example, as part of the disease condition. In one aspect, such methods are implemented by generating sequencing-based clonotype profiles and determining frequencies of correlating, or index, clonotypes present, including new clonotypes that have evolved therefrom, particularly, in the case of B-cell ALL, by VH substitution. The invention also includes use of such monitoring information to modify treatment status of a patient. | 08-08-2013 |
| 20130209578 | Combinatory Cancer Treatment - The present invention relates to a pharmaceutical composition for treating a neoplasm, a preneoplasm, a proliferative disorder and/or a precancerous lesion, the use of such compositions for the treatment of the listed conditions, and methods of treating the listed conditions. The composition of the present invention comprises an inhibitor of eIF4E, a methltransferase inhibitor, and a pharmaceutically acceptable carrier. | 08-15-2013 |
| 20130209579 | THERAPEUTIC COMBINATION FOR THE TREATMENT OF CANCER - This invention relates to therapeutic combinations comprising a platinum-based anti-neoplastic agent, such as cisplatin, and an extract from a species of the genus | 08-15-2013 |
| 20130224311 | METHODS AND COMPOSITIONS FOR THE TREATMENT OF CANCER - Some embodiments of the present invention relate to methods and compositions for treating cancer. More embodiments include methods and compositions for modulating the activity of the Hedgehog pathway. | 08-29-2013 |
| 20130224312 | METHODS AND MATERIALS FOR ASSESSING RESPONSIVENESS TO PARP INHIBITORS AND PLATINATING AGENTS - This document provides methods and materials involved in assessing responsiveness to PARP inhibitors and platinating agents. For example, methods and materials for using levels of non-homologous end-joining pathway members (e.g., artemis mRNA or polypeptide levels, Ku80 mRNA or polypeptide levels, or DNA-PKcs mRNA or polypeptide levels) to determine if cancer cells that are homologous recombination-deficient are likely to be susceptible or resistant to PARP inhibitors and platinating agents are provided. | 08-29-2013 |
| 20130224313 | CANCER THERAPY METHOD - This invention describes a method for treating cancer by increasing the nuclear localization of the COMMD1 protein, which is associated with decreasing or blocking the proliferation of the cancer cell. The invention is also related to the use of agents that increase nuclear localization of the COMMD1 protein, in the manufacture of a medicament for cancer therapy. These agents can be peptides or proteins, among other compounds. The invention is also related to the optimization of a peptide, coming from the sequence HARIKPTFRRLKWKKYKGKFW, to increase the nuclear localization of the protein COMMD, and thus, to increase the antitumor effect of this peptide. | 08-29-2013 |
| 20130236567 | GENE EXPRESSION SIGNATURE AS A PREDICTOR OF CHEMOTHERAPEUTIC RESPONSE IN BREAST CANCER - Disclosed are methods and compositions for determining and/or predicting a response to a therapy, especially a cancer therapy, including chemotherapy. Specifically, the disclosure provides profiles of a set of marker genes in breast cancers from patients who were known to have responded or not responded to a chemotherapy for predicting response to the same therapy including different combination of chemotherapy in a patient diagnosed with breast cancer. The disclosure further provides computer complemented methods for the prediction based on genetic profiles as well as different clinical parameters. Furthermore, the disclosure provides kits for performing the method disclosed. | 09-12-2013 |
| 20130236568 | PHOSPHAPLATINS HAVING ANTI-ANGIOGENIC, ANTI-METASTATIC, AND PRO-APOPTOTIC PROPERTIES AND USES THEREOF - Provided are compositions and uses thereof in methods of inhibiting angiogenesis, metastasis, or both, wherein said compositions comprise phosphaplatins such as pyrodach-4. In some embodiments, provided are compositions and uses thereof in methods of treating sensitive and resistant cancers. | 09-12-2013 |
| 20130243886 | NOVEL USE - The present invention relates to the use of one or more compounds selected from the following classes of biologically active agents: an a-adrenergic antagonist, an anthelmintic agent, an antifungal agent, an antimalarial agent, an antineoplastic agent, an antipsychotic agent, an antioxidant, a vasodilator and/or a vitamin, or a pharmaceutically acceptable derivative thereof, for use in the treatment of a microbial infection and in particular for killing multiplying, non-multiplying and/or clinically latent microorganisms associated with such an infection. | 09-19-2013 |
| 20130251821 | VEGF-ACTIVATED FAS LIGANDS - The present invention provides fusion proteins comprising an extracellular domain of a VEGF receptor and a death ligand. The fusion proteins bind to VEGF and to death receptors on tumor cells thereby inhibiting VEGF activation of VEGF receptors and inducing apoptosis in the tumor cells. Fusion proteins of the present invention are useful for inducing apoptosis and cytotoxic effects in cells, treating cancer and diseases or disorders related to unregulated angiogenesis and/or vasculogenesis. Thus, this invention further provides methods for treating angiogenesis related diseases using the fusion proteins, polynucleotides encoding the fusion proteins, vectors containing the polynucleotides, pharmaceutical compositions and kits containing the fusion proteins or the polynucleotides encoding the fusion proteins. | 09-26-2013 |
| 20130266665 | NANOMECHANICAL BIOMARKERS FOR DISEASE THERAPY - A method of treating a patient having cancer includes: (1) providing a biological sample from the patient, the biological sample including multiple cells; (2) detecting a response of the biological sample to a probing element; (3) based on the response, determining test values for the biological sample, the test values being indicative of a nanomechanical characteristic of the cells; (4) deriving a test nanomechanical profile characterizing a distribution of the test values; and (5) based on the test nanomechanical profile, selecting a therapeutic agent to treat the patient. | 10-10-2013 |
| 20130266666 | Combination Therapy with an Antitumor Alkaloid - The present invention relates to the combination of PM01183 with several anticancer drugs, in particular other anticancer drugs selected from antitumor platinum coordination complexes, antimetabolites, mitotic inhibitors, anticancer antibiotics, topoisomerase I and/or II inhibitors, proteasome inhibitors, histone deacetylase inhibitors, nitrogen mustard alkylating agents, nitrosourea alkylating agents, nonclassical alkylating agents, estrogen antagonists, androgen antagonists, mTOR inhibitors, tyrosine kinase inhibitors, and other agents selected from aplidine, ET-743, PM02734 and PM00104, and the use of these combinations in the treatment of cancer. | 10-10-2013 |
| 20130273177 | ISOFLAVONOID COMPOSITIONS AND METHODS FOR THE TREATMENT OF CANCER - Provided herein is a pharmaceutical composition comprising an isoflavonoid derivative and a cyclodextrin. Also provided herein are methods of treating cancer, sensitizing cancer cells, and inducing apoptosis in cancer cells by administering such compositions. In specific instances, provided herein are intravenous compositions and therapies. | 10-17-2013 |
| 20130273178 | METHODS AND COMPOSITIONS FOR PROMOTING ACTIVITY OF ANTI-CANCER THERAPIES - The present invention relates to a method of inhibiting growth of a cancerous cell. The method includes the step of exposing the cancerous cell to an anti-cancer therapy and an effective amount of a steroid saponin. | 10-17-2013 |
| 20130295198 | METHODS OF SCREENING CHEMOTHERAPEUTIC AGENTS AND TREATING CANCER - Methods for selecting chemotherapeutic agents for treating a cancer are provided that include the steps of providing a cancer cell sample having a population of bulk cancer cells and a population of cancer stem-like cells, culturing a first portion of the cancer cell sample in a hydrodynamic focusing bioreactor under microgravity conditions and for a period of time to selectively enhance the population of cancer stem-like cells and selectively kill the population of bulk cancer cells, contacting the cancer stem-like cells with one or more chemotherapeutic agents, and then selecting the one or more chemotherapeutic agents for treating the cancer if there is an increase in an amount of cytotoxicity. Methods for treating a cancer are also provided in which the identified chemotherapeutic agents are administered to a subject. Further provided are methods for identifying a test compound useful for treating a cancer. | 11-07-2013 |
| 20130302441 | METHODS FOR THE TREATMENT OF SKIN NEOPLASMS - Methods of treating skin neoplasms using a monoamine oxidase inhibitor, e.g., a propynylaminoindan (such as rasagiline) are provided. Pharmaceutical compositions and kits comprising monoamine oxidase inhibitors are also provided. | 11-14-2013 |
| 20130309323 | COMPOSITIONS AND METHODS FOR THE TREATMENT OR PREVENTION OF CHEMORESISTANT NEOPLASIA - The invention generally features compositions and methods useful for the treatment and diagnosis of a neoplasia in a subject. In particular, the invention provides therapeutic compositions that decrease the expression of an Nfr2 nucleic acid molecule or polypeptide for the treatment of a neoplasia, such as a chemoresistant neoplasia, in a subject. | 11-21-2013 |
| 20130309324 | O-NITRO COMPOUNDS AND PHARMACEUTICAL COMPOSITIONS INCLUDING SAME - The present invention provides O-nitro compounds, pharmaceutical compositions of O-nitro compounds and methods of using O-nitro compounds and/or pharmaceutical compositions thereof to treat or prevent diseases or disorders characterized by abnormal cell proliferation, such as cancer, inflammation, cardiovascular disease and autoimmune disease. | 11-21-2013 |
| 20130330421 | COMBINATIONS OF THERAPEUTIC AGENTS FOR TREATING MELANOMA - The present disclosure relates to the field of oncology, more particularly to the field of melanoma. Provided are methods of treating melanoma, particularly advanced cutaneous melanoma, with a combination of pharmaceutical agents comprising MDM4-specific antagonists (such as an inhibitor of the MDM4-p53 interaction or a molecule that decreases MDM4 protein stability) or MDM4-MDM2 dual inhibitors (i.e., molecules that disrupt the interactions between p53 and MDM2 and p53 and MDM4) and one or more chemotherapeutic agents such as for example alkylating agents (i.e., Dacarbazine (DITC) or melphalan), alkylating-like agents (i.e., cisplatin or carboplatin) or mitotic inhibitors (taxanes docetaxel or paclitaxel) and PI3K-AKT, B-RAF and MEK inhibitors. Further provided are pharmaceutical formulations of MDM4-specific antagonists (be it an inhibitor of the MDM4-p53 interaction or a molecule that decreases MDM4 protein stability) or MDM4-MDM2 dual inhibitors (i.e., molecules that disrupt the interactions between p53 and MDM2 and p53 and MDM4) and a pharmaceutical formulation of one or more chemotherapeutic agents such as for example alkylating agents (i.e., Dacarbazine (DITC) or melphalan), alkylating-like agents (i.e., cisplatin or carboplatin) or mitotic inhibitors (taxanes docetaxel or paclitaxel) and B-RAF and MEK inhibitors. | 12-12-2013 |
| 20130344168 | Compositions and Methods APC, CREB, and BAD Pathways to Assess and Affect Cancer - Disclosed are compositions and methods for assessing the apoptosis and survival BAD phosphorylation pathway (BAD pathway); and/or (2) the cell cycle role of APC in cell cycle regulation pathway (APC pathway); and/or (3) the transcription CREB pathway (CREB pathway) and for using these pathways to assess, treat, monitor, prognose, diagnose, etc. subjects with cancer. Also disclosed are compositions and methods for identifying molecular pathways that are common to one or more chemotherapeutic agents for the treatment of an oncological disorder, for screening for compounds or agents that can be used to treat ovarian cancer, and for selecting for compounds or agents that can enhance the cytotoxic response of cisplatin, carboplatin, and/or paclitaxel against a cancer cell, such as an ovarian cancer cell or cell line. | 12-26-2013 |
| 20130344169 | GENE SIGNATURE FOR THE PREDICTION OF RADIATION THERAPY RESPONSE - Described are mathematical models and method, e.g., computer-implemented methods, for predicting tumor sensitivity to radiation therapy, which can be used, e.g., for selecting a treatment for a subject who has a tumor. | 12-26-2013 |
| 20130344170 | POLYMORPHISMS PREDICTIVE OF ANTHRACYCLINE- INDUCED CARDIOTOXICITY - Provided are methods, nucleic acids, and arrays for assessing the susceptibility of a subject to the development of cardiotoxicity in response to receiving one or more anthracycline compounds, the method including determining the presence or absence of one or more polymorphisms, wherein the presence or absence of one or more such polymorphisms is indicative of susceptibility to the development of cardiotoxicity. | 12-26-2013 |
| 20140023726 | POLYMORPHISMS PREDICTIVE OF PLATINUM-COORDINATING COMPLEX INDUCED OTOTOXICITY - Provided are methods, nucleic acids, and arrays for assessing the susceptibility of a subject to the development of ototoxicity in response to receiving one or more platinum-coordinating compounds, the method including determining the presence or absence of one or more polymorphisms, wherein the presence or absence of one or more such polymorphisms is indicative of susceptibility to the development of ototoxicity. | 01-23-2014 |
| 20140037754 | AMINOPYRIMIDINES USEFUL AS KINASE INHIBITORS - The present invention relates to compounds useful as inhibitors of Aurora protein kinases. The invention also provides pharmaceutically acceptable compositions comprising those compounds and methods of using the compounds and compositions in the treatment of various disease, conditions, and disorders. The invention also provides processes for preparing compounds of the invention. | 02-06-2014 |
| 20140037755 | Mapkap Kinase-2 as a Specific Target for Blocking Proliferation of P53-Defective Cells - The present invention relates to compounds and pharmaceutical compositions for treating cellular proliferative disorders, e.g., in patients having one or more p53-deficient cells, screening assays for identifying such compounds, and methods for treating such disorders. | 02-06-2014 |
| 20140044802 | COMPOUNDS USEFUL AS INHIBITORS OF ATR KINASEAND COMBINATION THERAPIES THEREOF - The present invention relates to compounds useful as inhibitors of ATR protein kinase and combination therapies thereof. The invention also relates to pharmaceutically acceptable compositions comprising the compounds of this invention; methods of treating of various diseases, disorders, and conditions using the compounds of this invention; processes for preparing the compounds of this invention; intermediates for the preparation of the compounds of this invention; and methods of using the compounds in in vitro applications, such as the study of kinases in biological and pathological phenomena; the study of intracellular signal transduction pathways mediated by such kinases; and the comparative evaluation of new kinase inhibitors. | 02-13-2014 |
| 20140050803 | COMPOSITIONS AND METHODS FOR TREATMENT OF MELANOMA - Described herein are compositions and methods for the prognosis, prevention and treatment of melanoma or melanoma associated symptoms. The compositions are microRNA molecules associated with melanoma or with melanoma brain tropism, as well as various nucleic acid molecules relating thereto or derived therefrom. | 02-20-2014 |
| 20140056995 | USE OF COMPOUNDS ISOLATED FROM EUPHORBIA NERIIFOLIA FOR TREATING CANCER AND/OR THROMBOCYTOPENIA - Novel Uses of small molecules, particularly, triterpenoids and ingol diterpenes isolated from | 02-27-2014 |
| 20140056996 | ANTITUMORAL COMBINATION COMPRISING CABAZITAXEL AND CISPLATIN - The present invention relates to a combination comprising cabazitaxel and cisplatin. The present invention relates also to a pharmaceutical composition containing such a combination and to a pharmaceutical kit comprising: (i) a first galenic formulation comprising cabazitaxel; and (ii) a second galenic formulation comprising cisplatin. The invention relates also to the use of this combination and/or pharmaceutical composition and/or pharmaceutical kit in the treatment of neoplastic diseases, more particularly in the treatment of cancer. | 02-27-2014 |
| 20140065243 | METHODS AND COMPOSITIONS FOR TREATING CANCER - This disclosure provides compositions and method useful for treating cell proliferative disorders including cancer. The disclosure provides cannabidiol derivatives and compositions thereof either alone or in combination with THC or a derivative thereof. | 03-06-2014 |
| 20140079812 | Disulfide Chemotherapeutic Agents and Methods of Use Thereof - Compositions and methods for the treatment of cancer are provided. | 03-20-2014 |
| 20140079813 | Genes Associated With Post Relapse Survival And Uses Thereof - Provided are methods, systems and kits for predicting post-relapse survival of a cancer patient and for identifying cancer genes predictive of the post-relapse survival of the patient. Values representing gene expression levels of a group of genes associated with survival of the cancer cells are determined using gene expression profiling platforms and a plurality of probe sets that hybridize to one or more of the genes in the group. A predictive model establishes a predictive value based on the weighted contribution of each gene associated with survival of the cancer cells to risk of death for the cancer patient and imports expression values of the genes in the group that is indicative of a risk of death for the relapsed patient. Using global gene expression profiling and statistical analysis, expression of cancer cell genes at baseline and at first relapse that are involved in interaction of cancer cells with cells in their microenvironment, can be used to identify genes that are predictive of post-relapse survival. | 03-20-2014 |
| 20140087005 | MODULATORS OF HSP70/DNAK FUNCTION AND METHODS OF USE THEREOF - Compositions and methods for modulating HSP70 function, particularly for the targeted killing of cancer cells, are disclosed. | 03-27-2014 |
| 20140087006 | USE OF TRANSPLATIN TO PREVENT HEARING LOSS - Methods and compositions for treating and preventing toxic side effects of platinum-based chemotherapy agents are disclosed, in which transplatin is administered to a subject. Transplatin is shown to have protective effects against cisplatin-induced ototoxicity, nephotoxicity and neurotoxicity. Anti-inflammatory activity of transplatin is demonstrated and methods and compositions for treating and preventing inflammatory pain are described. | 03-27-2014 |
| 20140093585 | PARP INHIBITORS FOR THE TREATMENT OF CIPN - The present invention relates to the method of treating chemotherapy-induced neuropathy in a subject in need thereof with the use of a poly(ADP-ribose)polymerase (PARP) inhibitor. | 04-03-2014 |
| 20140106004 | HEMOGLOBIN-BASED OXYGEN CARRIER-CONTAINING PHARMACEUTICAL COMPOSITION FOR CANCER TARGETING TREATMENT AND PREVENTION OF CANCER RECURRENCE - The present invention provides a pharmaceutical composition containing a hemoglobin-based oxygen carrier for treating cancer, preventing recurrence and metastasis of cancerous tumor. The composition can be used alone or in combination with at least one chemotherapeutic agent such as 5FU, Bortezomib, doxorubicin, cisplatin, or any combination thereof. The hemoglobin-based oxygen carrier in the composition is capable of targeting a surface receptor expressed on cancerous cells and facilitating the uptake of both hemoglobin-based oxygen carrier and the chemotherapeutic agent by the cancerous cells via a receptor-mediated mechanism. The hemoglobin-based oxygen carrier inhibits the expression of hypoxic response elements such as HIF1α, VEGF, ET1, VHL, etc. The pharmaceutical composition of the present invention is also useful for inducing the apoptosis or cell death of a type of self-renewing and tumor-initiating cells called cancer stem cells which are located in the hypoxic niche of a cancerous tumor. | 04-17-2014 |
| 20140106005 | Compositions And Methods Of Use Of Phorbol Esters In The Treatment Of Neoplasms - Methods and compositions containing a phorbol ester or a derivative of a phorbol ester are provided for the treatment of chronic and acute conditions. Such conditions may be caused by disease, be symptoms, treatments, or sequelae of disease. The phorbol esters described are particularly useful in the treatment of neoplastic diseases and/or managing the side effects of chemotherapeutic and radiotherapeutic treatments of neoplastic diseases. | 04-17-2014 |
| 20140113005 | COMPOUNDS USEFUL AS INHIBITORS OF ATR KINASE - The present disclosure relates to pyrazine compounds of formula I: | 04-24-2014 |
| 20140113006 | METHODS OF DETERMINING WHETHER THE WNT SIGNALING PATHWAY IS UPREGULATED IN A TUMOR - The invention demonstrates that canonical Wnt signaling is activated in certain primary tumors and tumor cell lines in the absence of ?-catenin or APC mutations and that inhibition of such activated canonical Wnt signaling in such tumor cells inhibits tumor growth and, at least in some cases, induces death of tumor cells. As further demonstrated herein, the activation of canonical Wnt signaling is associated with a higher rate of cancer recurrence in patients with Stage I Non-Small Cell Lung Cancer (NSCLC), which provides a new method for cancer prognosis, wherein activation of canonical Wnt signaling reflects a more aggressive tumor phenotype suggesting the need for a more aggressive therapy. | 04-24-2014 |
| 20140120181 | COMPOSITION COMPRISING PHOSPHATIDYLCHOLINE AS AN ACTIVE INGREDIENT FOR ATTENUATING TOXICITY OF ANTICANCER AGENT - The present invention relates to a new use of phosphatidylcholine, and more particularly to a composition for toxicity reduction of an anti-cancer agent, and an anti-cancer adjuvant, comprising phosphatidylcholine as an active ingredient. | 05-01-2014 |
| 20140127326 | Detection of Cancer by Volatile Organic Compounds From Breath - Provided are methods for detecting a cancer, such as an ovarian cancer. In certain aspects, the methods involve detecting or measuring one or more volatile organic compounds (VOCs) from the breath of a subject. Apparatuses for the collection of VOCs are provided. | 05-08-2014 |
| 20140134274 | SELECTIVE ANDROGEN RECEPTOR MODULATOR AND CHEMOTHERAPEUTIC AGENT FOR TREATING MUSCLE WASTING IN CANCER PATIENTS - This invention provides use of a SARM compound or a composition comprising the same in treating and preventing muscle wasting in patients with non-small cell lung cancer (NSCLC); treating pre-cachexia or early cachexia (preventing muscle wasting in a cancer patient); treating and preventing loss of physical function due to cancer or cancer therapy; increase of physical function; and increasing survival in a patient with NSCLC, wherein the patients are subjected to cancer therapy. | 05-15-2014 |
| 20140134275 | THERAPEUTIC COMBINATIONS FOR USE IN NEOPLASIA - The invention features compositions and methods that are useful for the treatment of neoplasia (e.g., pancreatic cancer, colon cancer, brain cancer) by increasing DNA damage, reducing nucleotide synthesis, and reducing base excision repair (BER). | 05-15-2014 |
| 20140134276 | ANTI-TUMOR DRUG, MEDICAMENT, COMPOSITION, AND USE THEREOF - A method for the treatment of cancers and/or tumors by administration of a polypeptide having the sequence SEQ ID NO:4 or a polypeptide having an amino acid SEQ ID NO Y which, when aligned with SEQ ID N: 4, has (a) a percentage of identical residues over SEQ ID NO: 4 length of at least 50%, and (b) a percentage of identical residues over a amino acid sequence SEQ ID NO Y length of at least 65% or fragments thereof having at least 20 contiguous amino acids. | 05-15-2014 |
| 20140141099 | DRUG DISCOVERY METHODS - The present invention relates to drug discovery methods, particularly methods for assaying compounds for activity as Aurora kinase inhibitors. This invention also relates to a pharmacophore describing compounds that are able to promote a conformational change in the protein AuroraB and whose binding constant for the two-step process is given as Ki*. Finally, this invention also relates to compounds having the features of the pharmacophore. | 05-22-2014 |
| 20140141100 | Compounds and Methods for Appetite Suppression and Weight Control - Disclosed is a method of treating obesity, reducing weight, preventing weight gain, and/or suppressing appetite in a subject in need thereof by administering topically a pharmaceutical compound having a chemotherapeutic agent to at least a surface of the subject's mouth. The method includes inhibiting taste cell reproduction on the surface of the subject's mouth with the compound and reducing sense of taste, appetite for food in the subject, or a combination thereof. | 05-22-2014 |
| 20140147516 | POLYMORPHISMS PREDICTIVE OF PLATINUM-COORDINATING COMPOUND-INDUCED OTOTOXICITY - Methods of determining a subject's ototoxicity risk from administration of a pharmacotherapeutic compound having an ototoxicity risk, methods of administering a pharmacotherapeutic compound having an ototoxicity risk and oligonucleotides, peptide nucleic acids, arrays, and addressable collections for performing embodiments of the methods are provided herein. | 05-29-2014 |
| 20140147517 | Use of Amisulpride as an Anti-Emetic - Amisulpride is used in the therapy of nausea, vomiting or retches. The therapy may utilize a novel injectable formulation, in unit dosage form, comprising less than 50 mg amisulpride. | 05-29-2014 |
| 20140154340 | METHODS TO TREAT CANCER USING CYCLOSPORINE AND CYCLOSPORINE DERIVATIVES - Methods to treat certain types of cancer with cyclophilin inhibitors. | 06-05-2014 |
| 20140161908 | CHROMAN DERIVATIVES, MEDICAMENTS AND USE IN THERAPY - Novel chroman derivatives and intermediate compounds, compostions containing same, methods for their preparation and uses thereof as therapeutic agents particularly as anti-cancer and chemotheraputic selective agents are described. | 06-12-2014 |
| 20140170239 | METHODS FOR SCREENING INHIBITORS OF TUMOR ASSOCIATED PROTEIN AGGREGATION - The disclosure relates to the fields of protein aggregation diseases including cancer. More specifically, it concerns a screening method for identifying compounds that inhibit or disrupt co-aggregation of one or more member proteins of a disease-related protein aggregome, in particular, a tumor-associated protein aggregome. Further, disclosed are agents and compounds identified by the screening method that can be applied to prevent or to treat protein aggregation diseases, such as cancer. | 06-19-2014 |
| 20140170240 | Phosphoramidate Alkylator Prodrugs - Phosphoramidate alkylator prodrugs can be used to treat cancer when administered alone or in combination with one or more anti-neoplastic agents. | 06-19-2014 |
| 20140170241 | COILED COIL HELIX CRISTAE MORPHOLOGY 1 (CHCM1) TUMOR MARKER AND CANCER THERAPEUTIC TARGET - Methods for diagnosing and treating a cancer or a tumor in a patient are provided. The methods can comprise the steps of obtaining a biological sample from the patient and analyzing the sample for the presence or absence of Coiled Coil Helix Cristae Morphology 1 protein (CHCM1). A patient is diagnosed with cancer or a tumor provided that CHCM1 is overexpressed. The diagnosed patient is treated by administering a cancer or tumor treatment. The methods can also comprise the steps of obtaining a sample of cancer or tumor cells from the patient, determining a level of CHCM1 expression in the sample of cancer or tumor cells, and administering to the patient a compound for reducing the expression of CHCM1 or for blocking or inhibiting function of CHCM1. | 06-19-2014 |
| 20140170242 | GENE SIGNATURES FOR LUNG CANCER PROGNOSIS AND THERAPY SELECTION - The invention provides for molecular classification of disease and, particularly, molecular markers for lung cancer prognosis and therapy selection and methods and systems of use thereof. | 06-19-2014 |
| 20140170243 | SUBSTITUTED CHROMAN DERIVATIVES, MEDICAMENTS AND USE IN THERAPY - Novel substituted chroman derivatives and intermediate compounds, compositions containing same, methods for their preparation and uses thereof as therapeutic agents particularly as anti-cancer and chemotherapeutic selective agents are described. | 06-19-2014 |
| 20140186468 | DIAGNOSING SUBSETS OF TRIPLE-NEGATIVE BREAST CANCER - The present invention provides a unique combination of biomarkers that identify triple-negative breast cancer (TNBC) patient subpopulations. Such subpopulations will have differential responses to therapies, and thus treatments can be tailored to particular patients. | 07-03-2014 |
| 20140186469 | PYRROLIDINE-1,2-DICARBOXAMIDE DERIVATIVES - The present invention relates to a compound of formula (I) | 07-03-2014 |
| 20140193519 | INDIBULIN THERAPY - The invention provides combination therapy, wherein one or more other therapeutic agents are administered with indibulin or a pharmaceutically acceptable salt thereof and the combination is synergistic. Another aspect of the invention relates to the treatment of cancer with indibulin as a single agent. Another aspect of the invention relates to dosing regimen for administration of oral dosage forms of indibulin. | 07-10-2014 |
| 20140199415 | PHARMACEUTICAL COMBINATION COMPRISING A CIP2A SILENCING AGENT FOR USE IN THE TREATMENT OF A HYPERPROLIFERATIVE DISORDER, PREFERABLY ONE WITH IMPAIRED P53 FUNCTION - The invention is based on a finding that silencing CIP2A (KI-AA1524) gene sensitizes cancer cells for apoptosis-inducing activity of certain small molecule chemotherapeutic agents. Thus, the invention is directed to a respective combination therapy, sensitization method and pharmaceutical compositions. The invention further relates to a method of selecting cancer therapy for a subject on the basis of CIP2A and p53 expression and/or protein activity in a sample obtained from said subject. | 07-17-2014 |
| 20140205679 | METHODS OF USING (+)-1,4-DIHYDRO-7-[(3S,4S)-3-METHOXY-4-(METHYLAMINO)-1-PYRROLIDINYL]-4-OX- O-1-(2-THIAZOLYL)-1,8-NAPHTHYRIDINE-3-CARBOXYLIC ACID IN COMBINATION THERAPY - Methods of treating, preventing or managing cancers are disclosed. The methods encompass the administration of SNS-595 in combination with a second active agent. In certain embodiments, the method of treatment comprise administering SNS-595 in combination with cisplatin, carboplatin, gemcitabine or a combination thereof. | 07-24-2014 |
| 20140205680 | METHODS OF USING (+)-1,4-DIHYDRO-7-[(3S,4S)-3-METHOXY-4-(METHYLAMINO)-1-PYRROLIDINYL]-4-OX- O-1-(2-THIAZOLYL)-1,8-NAPHTHYRIDINE-3-CARBOXYLIC ACID FOR TREATMENT OF CANCER - Methods of treating, preventing or managing cancer, including certain leukemias are disclosed. The methods encompass the administration of enantiomerically pure (+)-1,4-dihydro-7-[(3S,4S)-3-methoxy-4-(methylamino)-1-pyrrolidinyl]-4-oxo-1-(2-thiazolyl)-1,8-naphthyridine-3-carboxylic acid. Also provided are methods of treatment using this compound with chemotherapy, radiation therapy, hormonal therapy, biological therapy or immunotherapy. Pharmaceutical compositions and single unit dosage forms suitable for use in the methods are also disclosed. | 07-24-2014 |
| 20140205681 | HYDROGEN-BOND SURROGATE PEPTIDES AND PEPTIDOMIMETICS FOR p53 REACTIVATION - The present invention relates to peptidomimetics for reactivating p53. Methods of using the peptidomimetics are also disclosed. | 07-24-2014 |
| 20140212509 | INHIBITORS OF POLY(ADP-RIBOSE)POLYMERASE - Inhibitors of poly(ADP-ribose)polymerase, ways to make them and methods of treating patients using them are disclosed. | 07-31-2014 |
| 20140212510 | CAPCNA PEPTIDE THERAPEUTICS FOR CANCER - Administration of compositions comprising cell-permeable caPCNA-derived peptides and their variants reduces the proliferation of cancer cells and also augments cytotoxic effects of chemotherapeutics. The compositions are effective in cells harboring mutations in DNA repair proteins. | 07-31-2014 |
| 20140220159 | HYDROGEN-BOND SURROGATE PEPTIDES AND PEPTIDOMIMETICS FOR p53 REACTIVATION - The present invention relates to peptidomimetics for reactivating p53. Methods of using the peptidomimetics are also disclosed. | 08-07-2014 |
| 20140220160 | METHOD FOR DETECTING, QUANTIFYING AND MAPPING DAMAGE AND/OR REPAIR OF DNA STRANDS - Methods and products for detecting in vitro the presence of damage on DNA or the presence of a biological response to damage on DNA at the molecular level. Molecular Combing or other nucleic acid stretching methods are employed together with compounds reacting with DNA, probes binding DNA, or nucleic acid monomers, especially labeled nucleic acid monomers. | 08-07-2014 |
| 20140234439 | NOVEL NANO GOLD AND PROCESS FOR PREPARATION - This invention relates to bio synthesis of novel nano gold through environment friendly process with the aid of plant materials classified under the taxonomical genus | 08-21-2014 |
| 20140234440 | METHOD FOR ISOLATING A CHEMOTHERAPEUTIC AGENT RESISTANT CANCER CELL WITH STEM CELL PROPERTIES - The invention relates to the use of encapsulates of cancer cells, in agarose coated, agarose containing beads, for isolating chemotherapeutic resistant cells which have at least one stem cell property, such as expression of OCT4. The cells thus isolated are also a feature of the invention, as is a method for screening for potential therapeutic | 08-21-2014 |
| 20140242192 | Clusterin Antisense Therapy for Treatment of Cancer - A method for providing antisense therapy which reduces the expression of clusterin to provide therapeutic benefits in the treatment of cancer comprising administering from 40 to 640 mg anti-clusterin antisense oligonucleotide to a patient in need of treatment for a cancer expressing clusterin is provided. The method may include administering chemotherapeutic agent or agents, radiotherapy, and/or hormone ablation therapy. The invention also encompasses pharmaceutical compositions formulated to provide a dosage of 40 to 640 mg, and use of antisense in formulating a medicament. | 08-28-2014 |
| 20140248375 | Combination Therapy for Treating Proliferative Diseases - The present invention relates generally to new chemical combinations and methods for their use in the treatment of proliferative diseases and in particular cancer. | 09-04-2014 |
| 20140255513 | LYTIC DOMAIN FUSION CONSTRUCTS AND METHODS OF MAKING AND USING SAME - The invention relates to fusion constructs, methods of using fusion constructs and methods of treating undesirable or aberrant cell proliferation or hyperproliferative disorders, such as tumors, cancers, neoplasia and malignancies. | 09-11-2014 |
| 20140271922 | PIRENZEPINE AS AN AGENT IN CANCER TREATMENT - The present invention generally relates to the neuroprotective activity of condensed diazepinones, e.g. condensed benzodiazepinones such as pirenzepine or compounds which are metabolized to condensed benzodiazepinones such as olanzapine. These compounds are suitable as co-medicaments for the prevention and/or treatment of drug-induced neurotoxic effects in general and neurotoxic side effects during cancer treatments with cytostatic drugs such as platinum-derivatives, e.g. cis-, carbo- and oxaliplatin, taxanes, bleomycin, cyclophosphamide and vincristine etc. Further, these compounds have an intrinisic anti-cancer activity on their own due to PARP-1 inhibition, which prevents NADH depletion in oxidative metabolism of healthy cells thus preventing the shift to anoxygenic, glycolytic metabolism present in many types of tumour cells thus eliminating this crucial metabolic advantage favouring tumour growth. These results exploit the fact of differential PARP-1 expression between many cancer cells and healthy tissues. | 09-18-2014 |
| 20140287063 | DIAGNOSTIC METHODS AND KITS FOR MONITORING RESPONSE TO CHEMOTHERAPY IN OVARIAN CANCER - Provided are methods of determining a response to a chemotherapeutic agent in a subject with ovarian cancer, comprising: determining a RNA integrity value of a sample comprising ovarian cancer cell RNA from the subject after the subject has received one or more doses of the chemotherapeutic agent; wherein a low RNA integrity value and/or RNA degradation of the cancer cell RNA is indicative that the cancer is responding to the chemotherapeutic agent and/or a high RNA integrity value and/or stable RNA integrity of the ovarian cancer cell RNA is indicative that the cancer is resistant to the chemotherapeutic agent. | 09-25-2014 |
| 20140294993 | METHOD FOR TREATMENT OF MESOTHELIOMA - The present invention provides that Ras-like, estrogen-regulated, growth inhibitor (RERG) is a malignant mesothelioma biomarker of clinical course and treatment sensitivity and, itself a target for mesothelioma treatment. A low RERG level in a mesothelioma subject indicates poor prognosis. Analyzing RERG expression level along can help mesothelioma patients make treatment choices. Furthermore, mesothelioma can be treated by modulating RERG activity, for example, with treatment with estrogen or estrogen-like agents. | 10-02-2014 |
| 20140294994 | PHARMACEUTICAL COMPOSITION FOR ELIMINATION OF CANCER STEM CELLS - The preset invention relates to use of antipsychotic phenothiazine derivative for eliminating cancer stem cells (CSCs) and/or preventing a cancer. The invention also provides a pharmaceutical composition for treating a cancer, and/or preventing or delaying cancer recurrence comprising trifluoperazine and an anti-cancer drug, such as gefitinib or cisplatin. | 10-02-2014 |
| 20140302172 | MARKERS FOR SUSCEPTIBILITY TO AN INHIBITOR OF AN SRC-FAMILY KINASE - The present invention relates to a method for predicting the responsiveness of a mammalian tumor cell or cancer cell to an inhibitor of a kinase of the Src family, such as dasatinib, bosutinib, saracatinib or ponatinib. The present invention also provides for a method for predicting the responsiveness of an individual to an inhibitor of a kinase of the Src family, whereby the individual is suspected to suffer from cancer. These methods involve the evaluation of the status of integrin β4, wherein said status is indicative for the responsiveness to the inhibitor. Furthermore, a kit useful for carrying out the methods described herein as well as an oligo- or polynucleotide and/or antibodies capable of detecting the expression level of integrin β4 for predicting the responsiveness to the inhibitor are provided. | 10-09-2014 |
| 20140302173 | TREATMENT AGENT AND/OR PROPHYLACTIC AGENT FOR SIDE EFFECTS OF CANCER DRUGS - A method for treating side effects of anticancer agent includes administering to a subject in need thereof a prophylactic and/or therapeutic agent containing a therapeutically effective amount of a compound shown by the following Formula (1): | 10-09-2014 |
| 20140302174 | Combination Therapy for Ovarian Cancer - The present invention provides a method of treating ovarian cancer in a mammal in need of such treatment comprising administering an effective amount of a combination of gemcitabine, cisplatin or carboplatin, and 5-[2-tert-butyl-5-(4-fluoro-phenyl)-1H-imidazol-4-yl]-3-(2,2-dimethyl-propyl)-3H-imidazo[4,5-b]pyridin-2-ylamine. | 10-09-2014 |
| 20140308370 | MARKERS OF TUMOR CELL RESPONSE TO ANTI-CANCER THERAPY - Compositions and methods for determining circulating biomolecules before, during, and/or after treatment of a patient with an anti-cancer or anti-tumor drug (or putative drug) are described. Methods of treatments based on the compositions and methods described herein are also provided. Noninvasive methods and kits are provided for assessing the efficacy of an anti-cancer therapy for killing or damaging cancer cells. Embodiments are used to determine the cancer-killing efficacy of an anti-cancer drug in a patient, to optimize the selection of an anti-cancer drug for treatment of a patient, to adjust the dosage of an anti-cancer drug for treatment of a particular cancer in a patient and for identifying useful anti-cancer therapeutics for any one particular type of cancer. | 10-16-2014 |
| 20140314878 | COMPOSITIONS AND METHODS FOR DRUG-SENSITIZATION OR INHIBITION OF A CANCER CELL - The disclosure provides rifamycin and rifamycin derivative compositions, including rifabutin and rifabutin derivative compositions able to cause drug-sensitization in a cancer cell or inhibition of a cancer cell. The disclosure also provides methods of administering such compositions to cancer cells to sensitize them to drugs, such as chemotherapeutics, or directly inhibit them. The disclosure also provides methods of administering such compositions to increase reactive oxygen species (ROS), particularly superoxides, in cancer cells. The disclosure further provides methods of determining whether a cancer will respond to chemotherapeutics and whether to administer rifamycin or a rifamycin derivative based on ROS levels in cancer cells of a patient. | 10-23-2014 |
| 20140322354 | TISSUE & BLOOD-BASED MIRNA BIOMARKERS FOR THE DIAGNOSIS, PROGNOSIS AND METASTASIS-PREDICTIVE POTENTIAL IN COLORECTAL CANCER - Methods and compositions for the diagnosis, prognosis and classification of cancer, especially colorectal cancer, are provided. For example, in certain aspects methods for cancer prognosis using expression or methylation analysis of selected biomarkers are described. Particular aspects of the present invention may include methods and biomarkers for diagnosing or detecting colorectal cancer or metastasis in a subject by measuring a level of expression of biomarker miRNA such as miR-885-5p in the sample from the subject and evaluating the risk of developing cancer or metastasis in the subject. | 10-30-2014 |
| 20140322355 | HETEROCYCLIC MODULATORS OF LIPID SYNTHESIS - Compounds that are fatty acid synthesis modulators are provided. The compounds may be used to treat disorders characterized by disregulation of the fatty acid synthase function by modulating the function and/or the fatty acid synthase pathway. Methods are provided for treating such disorders including viral infections, such as hepatitis C infection, cancer and metabolic disorders. | 10-30-2014 |
| 20140322356 | CTC BIOMARKER ASSAY TO COMBAT BREAST CANCER BRAIN METASTASIS - Embodiments of the present invention concern methods related to treating, prognosticating and/or diagnosing at least brain metastatic breast cancer. Embodiments of the methods include characterizing circulating tumor cells for the presence or absence of EpCAM and, upon identification of EpCAM negative cells and identification of the status of other markers (such as heparanase and/or Notch1, for example), treating the individual based on the determination of the characterization. | 10-30-2014 |
| 20140328944 | USE OF CTBP1 siRNA FOR THE TREATMENT OF GASTRIC CANCER - This invention encompasses a novel composition comprising silenced CTBP-1 combined with a compound selected from among 5-FU, Cisplatin and Epirubicin. The invention further relates to a method of treating gastric cancer with a combination of siRNA silenced CTBP-1 and a compound selected from among 5-FU, Cisplatin and Epirubicin. | 11-06-2014 |
| 20140342019 | Preparation of Personal Care Substances - Methods preparing a personal care substance in fluid form from gemstones or gold. The gemstones or gold are comminuted and dissolved. Solvent is removed by distillation, leaving an oily residue usable in the personal care substance. The personal care substance may include fulvates and humates, or dissolved gold. The personal care substance may comprise an ozonated oil. | 11-20-2014 |
| 20140348950 | PYRROLIDINE- SUBSTITUTED FLAVONE DERIVATIVES FOR PREVENTION OR TREATMENT OF ORAL MUCOSITIS - The present invention relates to the pyrrolidine substituted with flavone derivatives, represented by the compounds of Formula (I) | 11-27-2014 |
| 20140356455 | PLURIPOTENT CELL LINES AND METHODS OF USE THEREOF - Methods of generating cell lines with a sequence variation or copy number variation of a gene of interest, methods of use thereof, and cell lines with a sequence variation or copy number variation of a gene of interest are provided. | 12-04-2014 |
| 20140356456 | TREATING CANCER WITH ATR INHIBITORS - This invention relates to methods and compositions for treating pancreatic cancer. More specifically, this invention relates to treating pancreatic cancer with certain ATR inhibitors in combination with gemcitabine and/or radiation therapy. This invention also relates to methods and compositions for treating non-small cell lung cancer. More specifically, this invention relates to treating non-small cell lung cancer with an ATR inhibitor in combination with cisplatin or carboplatin, etoposide, and ionizing radiation. | 12-04-2014 |
| 20140356457 | NOVEL MEANS AND METHODS FOR THE TREATMENT OF HEARING LOSS AND PHANTOM HEARING - This invention relates to a method of identifying a modulator of an NADPH oxidase, whereby said modulator is suitable as a lead compound and/or as a medicament for the treatment and/or prevention of hearing loss and/or phantom hearing, the method comprising the steps of (a) contacting a test compound with a protein, wherein said protein (i) comprises or consists of the amino acid sequence of any one of SEQ ID NO: 1, 3 or 5, or (ii) is encoded by a nucleic acid comprising or consisting of the sequence of any one of SEQ ID NO: 2, 4, 6, 23 or 24, or (iii) is a fragment of the protein according to (i) or (ii) and exhibits NADPH oxidase activity, or (iv) has a sequence at least 75% identical with the protein according to (i) or (ii) or with the fragment according to (iii) and exhibits NADPH oxidase activity, and optionally with one or more NADPH oxidase subunits, under conditions allowing binding of said test compound to said protein or, if present, said subunit(s); (b) optionally determining whether said test compound binds to said protein or, if present, said subunit(s); and (c) determining whether (ca) said test compound, upon contacting in step (a); or (cb) said test compound, upon binding in step (b) modulates the expression and/or activity of said protein or, if present, said subunit(s). Also provided are pharmaceutical compositions, medical uses and diagnostic uses of compounds of the invention. | 12-04-2014 |
| 20140356458 | TREATMENT OF SICKLE CELL DISEASE - The present invention includes embodiments for treatment and/or prevention of sickle cell disease that employ Hydroxyfasudil or Isocoronarin D alone or either in conjunction with each other or an inducer of HbF production. The compounds may act synergistically, and the compounds employed circumvent the side effects seen with Hydroxyurea. | 12-04-2014 |
| 20140356459 | MICRORNAS AND USES THEREOF - The invention relates to molecular targets and their use to counteract tumors. Naturally occurring microRNAs that regulate human oncogenes and methods of use thereof are described. Suitable nucleic acids for use in the methods and compositions described herein include, but are not limited to, pri-miRNA, pre-miRNA, mature miRNA or fragments of variants thereof that retain the biological activity of the mature miRNA and DNA encoding a pri-miRNA, pre-miRNA, mature miRNA, fragments or variants thereof, or regulatory elements of the miRNA. The here claimed approach is efficacious also on Cancer Stem Cells. | 12-04-2014 |
| 20140363521 | METHODS AND MATERIALS FOR ASSESSING HOMOLOGOUS RECOMBINATION DEFICIENCY - This document provides methods and materials involved in assessing samples (e.g., cancer cells) for the presence of homologous recombination deficiency (HRD) or an HRD signature. For example, methods and materials for determining whether or not a cell (e.g., a cancer cell) contains an HRD signature are provided. Materials and methods for identifying cells (e.g., cancer cells) having a deficiency in homology directed repair (HDR) as well as materials and methods for identifying cancer patients likely to respond to a particular cancer treatment regimen also are provided. | 12-11-2014 |
| 20140363522 | Compositions and Methods for Treating and/or Preventing Cancer by Inhibiting Fatty Acid Binding Proteins - The present invention concerns methods and compositions for the inhibition or reduction of the primary tumor and metastasis by inhibition of fatty acid binding proteins. | 12-11-2014 |
| 20140363523 | DEUTERATED ALPHA-LIPOIC ACID - The present invention provides a compound of Formula (I), wherein: each X is independently hydrogen or deuterium; and at least one X is deuterium. | 12-11-2014 |
| 20140370121 | MATERIALS AND METHOD FOR INHIBITING REPLICATION PROTEIN A AND USES THEREOF - Targeting uncontrolled cell proliferation and resistance to DNA damaging chemotherapeutics with at least one reagent has significant potential in cancer treatment. Replication Protein A, the eukaryotic single-strand (ss) DNA binding protein, is essential for genomic maintenance and stability via roles in both DNA replication and repair. Reported herein are small molecules that inhibits the in vitro, in vivo, and cellular ssDNA binding activity of RPA, thereby disrupting the eukaryotic cell cycle, inducing cytotoxicity and increasing the efficacy of chemotherapeutic agents damage DNA, and/or disrupt its replication and/or function. These results provide new insights into the mechanism of RPA-ssDNA interactions in chromosome maintenance and stability. This represents a molecularly targeted eukaryotic DNA binding inhibitor and demonstrates the utility of targeting a protein-DNA interaction as a means of studying the cell cycle and providing a therapeutic strategy for cancer treatment. | 12-18-2014 |
| 20140370122 | METHODS AND COMPOSITIONS FOR PROMOTING ACTIVITY OF ANTI-CANCER THERAPIES - The present invention relates to a method of inhibiting growth of a cancerous cell. The method includes the step of exposing the cancerous cell to an anti-cancer therapy and an effective amount of a steroid saponin. | 12-18-2014 |
| 20150010647 | Methods for Identifying Fragile Histidine Triad (FHIT) Interaction and Uses Thereof - Provided herein are methods and compositions for the diagnosis, prognosis and treatment of a cancer associated disorders using the Fhit gene. | 01-08-2015 |
| 20150017262 | INHIBITION OF DYNAMIN RELATED PROTEIN 1 TO PROMOTE CELL DEATH - The present invention relates to compositions and methods for reducing cell proliferation and/or promoting cell death by inhibiting Drp1. It is based, at least in part, on the discoveries that (i) Drp1 disruption-induced mitochondrial hyperfusion is functionally linked to the cell cycle regulation apparatus, so that Drp1 inhibition results in a disruption of the cell cycle and DNA aberrancies; (ii) inhibition of both Drp1 and ATR are synthetic lethal causing increased DNA damage and apoptotic cell death; and (iii) even in resistant cell lines, Drp1 inhibitor (e.g., mdivi-1) together with a second antiproliferative agent (e.g., cisplatin or carboplatin) act synergistically to promote apoptosis. Accordingly, the present invention provides for novel anticancer strategies. | 01-15-2015 |
| 20150017263 | FN14 ANTAGONISTS AND THERAPEUTIC USES THEREOF - The present disclosure is directed to methods of using fibroblast growth factor-inducible 14 (Fn14) antagonists to modulate activity at a TNF-like weak inducer of apoptosis (TWEAK) binding site on a cysteine-rich domain (CRD) of Fn14. The present disclosure also provides pharmaceutical compositions comprising synergistic combinations Fn14 antagonists and chemotherapeutic agents. | 01-15-2015 |
| 20150017264 | PROCASPASE 3 ACTIVATION BY COMBINATION THERAPY - The invention provides compositions and methods for the induction of cell death, for example, cancer cell death. Combinations of compounds and related methods of use are disclosed, including the use of compounds in therapy for the treatment of cancer and selective induction of apoptosis in cells. The disclosed drug combinations can have lower neurotoxicity effects than other compounds and combinations of compounds. | 01-15-2015 |
| 20150030699 | ANTI-TUMOR ADJUVANT THERAPY - The invention relates to a chimeric peptide construct comprising a cell penetrating peptide linked to a pro-apoptotic peptide, for use in treating a tumor in combination with an anti-tumor agent, preferably a chemotherapeutic agent. | 01-29-2015 |
| 20150030700 | PHARMACEUTICAL COMBINATION FOR THE TREATMENT AND/OR CHEMOSENSIBILIZATION OF REFRACTORY TUMORS TO ANTICANCER DRUGS - This invention is related to a pharmaceutical combination that contains a Casein kinase 2 (CK2) peptide inhibitor (termed P15) along with the standard chemotherapeutic drugs used in cancer treatment and which are administered together, separated or sequentially. The chemothearapeutic drugs include cisplatin, taxol, alkaloids from Vinca, 5-fluorouracil, doxorubicin, cyclophosphamide, etoposide, mitomycin C, imatinib, iressa and velcade (bortezomib). The synergism between the P15 peptide and the anticancer drugs achieves an efficient concentration of each cytostatic drug in the combination which is from 10- to 100-fold lower than that for each cytostatic drug alone. The pharmaceutical combination described in this invention exhibits lower toxicity compared to that reported by the anticancer therapeutics and therefore, it represents a crucial advantage for its use in cancer therapy. Furthermore, the sequential administration of this pharmaceutical combination through the pretreatment with the P15 peptide leads to the chemo sensibilization of refractory tumors to the anticancer therapeutics. | 01-29-2015 |
| 20150037437 | GLIOMA TREATMENT - A chemotherapy agent or a pharmaceutical composition including chemotherapy agent and artificial cerebrospinal fluid, wherein the chemotherapy agent at a concentration of between 0.01 mg/ml and 0.7 mg/ml for use in the treatment of brain cancer and a method of treating a glioma including administering a chemotherapy agent via convection enhanced delivery | 02-05-2015 |
| 20150050360 | PHARMACEUTICAL COMPOSITIONS FOR TREATING CANCER - The present invention relates to a pharmaceutical composition comprising an anti-cancer drug and an inhibitor of bone morphogenetic protein 4 (BMP-4) or its gene expression. The present invention also relates to methods of treating cancer and prognostic methods. | 02-19-2015 |
| 20150056300 | THERAPEUTIC NANOPARTICLES WITH HIGH MOLECULAR WEIGHT COPOLYMERS - The present disclosure generally relates to therapeutic nanoparticles. Exemplary nanoparticles disclosed herein may include about 0.1 to about 40 weight percent of a therapeutic agent and about 10 to about 90 weight percent a diblock poly(lactic) acid-poly(ethylene)glycol copolymer or a diblock poly(lactic)-co-poly(glycolic) acid-poly(ethylene)glycol copolymer, wherein the diblock poly(lactic) acid-poly(ethylene)glycol copolymer comprises poly(lactic) acid having a number average molecule weight of about 30 kDa to about 90 kDa or the diblock poly(lactic)-co-poly(glycolic) acid-poly(ethylene)glycol copolymer comprises poly(lactic)-co-poly(glycolic) acid having a number average molecule weight of about 30 kDa to about 90 kDa. | 02-26-2015 |
| 20150056301 | PEPTIDES AND PEPTIDOMIMETICS IN COMBINATION USES AND TREATMENTS FOR CANCER PATIENT SUBPOPULATIONS - This invention provides compounds including peptides and peptidomimetics that can be used to treat cell proliferative disorders, such as those associated with benign and malignant tumor cells. While the invention is not limited to any particular mechanism, the compounds of the invention appear to function at least in part by inhibiting G2 cell cycle checkpoint. Thus, invention compounds can be used to inhibit cell growth alone or be used in combination with a nucleic acid damaging treatment to inhibit cell growth. | 02-26-2015 |
| 20150064282 | USE OF NEU1 SIALIDASE INHIBITORS IN THE TREATMENT OF CANCER - Use of Neul sialidase inhibitors for the treatment of cancer as a monotherapy or in combination with known chemotherapeutics. Preferably, Neul sialidase inhibitors are oseltamivir phosphate or 2-deoxy-2,3-dehydro-N-acetylneuraminic acid (DANA) or analogues thereof. | 03-05-2015 |
| 20150064283 | PHARMACEUTICAL COMPOSITIONS FOR PARENTERAL ADMINISTRATION - The invention comprises various aqueous PEG-carbohydrate-lipid based formulations of pharmaceutical active ingredients including compositions for intravenous injections. This invention relates to methods and compositions for improving solubility and the safety profile of pharmaceutical compounds. More particularly, the present invention relates to employing PEG-carbohydrate-lipid conjugates for formulating drug compositions having increased solubility or dispersivity and enhanced stability. | 03-05-2015 |
| 20150072020 | Dexanabinol or a Derivative Thereof for Use in the Treatment of Cancer in Dose Ranges of 2-30 mg/kg - There is described a method of treating cancer in a patient wherein the method comprises the administration of dexanabinol, or a derivative thereof, in an amount of from about 2 mg/kg to about 30 mg/kg, based on the weight of the patient. | 03-12-2015 |
| 20150072021 | Methods and Kits for Predicting Outcome and Methods and Kits for Treating Breast Cancer with Radiation Therapy - The application describes methods and kits for screening subjects with breast cancer to determine if the breast cancer will be responsive to a post-mastectomy breast cancer therapy including radiation. The application further describes methods and kits for treating subjects with post-mastectomy breast cancer by screening them for the likelihood of the effectiveness of treating the cancer with a therapy including radiation and administering the therapy in subjects when it is found that radiation is likely to be effective. | 03-12-2015 |
| 20150104526 | SUBSTITUTED IMIDAZOPYRIDAZINES - The present invention relates to substituted imidazopyridazine compounds of general formula I in which R | 04-16-2015 |
| 20150118322 | BIOMEDICAL COMPOSITION - The disclosure provides a biomedical composition, including: a hyaluronic acid; a modified histidine; and a polymer or C | 04-30-2015 |
| 20150125549 | PEPTIDES AND USE THEREOF IN THE TREATMENT OF LARGE CELL LUNG CANCER - A method of treating large cell lung cancer in a subject in need thereof is provided. The method comprising administering to the subject a therapeutically effective amount of a peptide comprising an amino acid sequence as set forth in SEQ ID NO:1 or an analog or derivative thereof, thereby treating the large cell lung cancer in the subject. | 05-07-2015 |
| 20150125550 | APPLICATION OF 2,9-DI-SEC-BUTYL-1,10-PHENANTHROLINE AS A GLIOBLASTOMA TUMOR CHEMOTHERAPY - A method of inhibiting cancer cell growth is provided. In some versions, the method includes exposing lung cancer cells or glioma cells to 2,9-di-sec-butyl-1,10-phenanthroline (SBP) or derivatives of SBP in an amount effective to inhibit glioma cell growth. Also, a method of treating a lung cancer or a glioma tumor in a subject in need of such treatment is provided. The method includes administering SBP or derivatives of SBP to the subject in an amount effective to treat the lung cancer or glioma tumor. For either method, the method can further include exposing or administering pseudo five coordinate gold(III) complexes of SBP derivatives. | 05-07-2015 |
| 20150132408 | SORAFENIB DERIVATIVES AS P21 INHIBITORS - The present invention provides sorafenib analogs for use in a method of treating a disease mediated by p21, said method comprising administering to a subject in need thereof a therapeutically effective amount of a compound of formula I. The present invention also provides methods of inhibiting p21 in a cell comprising contacting the cell with an effective amount of a compound of formula I. | 05-14-2015 |
| 20150140122 | METHODS FOR DETECTING INACTIVATION OF THE HOMOLOGOUS RECOMBINATION PATHWAY (BRCA1/2) IN HUMAN TUMORS - The invention relates to methods for detecting inactivation of the DNA Homologous Recombination pathway in a patient, and in particular for detecting BRCA1 inactivation. | 05-21-2015 |
| 20150140123 | Protein expression analyses for identifying genotoxic compounds - The invention relates to a method for screening compounds with (pro-)genotoxic activity by providing a system being capable of expressing a panel of defined proteins, incubating at least a portion of the system with compounds to be screened, and comparing the expression of the proteins in the system with the protein expression in a control system, thereby detecting the (pro-)genotoxic activity. Another object of the invention concerns a method for monitoring the likelihood of developing a physiological and/or pathological condition, which is caused, mediated and/or propagated by the genetic deregulation of proliferation, differentiation and/or damage repair, in response to a compound administered to a mammal in need of such treatment by determining an expression level of defined proteins in a biological sample withdrawn from the mammal. The invention also relates to a kit for screening compounds with (pro-)genotoxic activity comprising antibodies that specifically bind to marker proteins. | 05-21-2015 |
| 20150140124 | METHOD OF DIAGNOSING, TREATING AND DETERMINING PROGRESSION AND SURVIVAL OF CANCER CELLS USING BCL-2 ANTAGONIST OF CELL DEATH (BAD) PATHWAY GENE SIGNATURE - The present invention relates to the BAD pathway's influence on development, progression, chemo-sensitivity, and overall survival for multiple human cancers and its potential as a therapeutic target to increase chemo-sensitivity. BAD pathway expression was associated with the development and/or progression of breast, colon, and endometrial cancers, relapse-free survival from breast cancer, and overall survival from ovarian, colon, and brain cancers. Expression was also associated with in vitro sensitivity to a range of cytotoxic agents. pBAD levels were higher in cancer versus immortalized normal cells and chemo-resistant versus—sensitive cancer cells and associated with increased cell proliferation. | 05-21-2015 |
| 20150140125 | SYNERGISTIC CANCER THERAPY DRUG COMBINATIONS - Synergistic cancer therapy drug combinations include therapeutically effective amounts of at least one chemotherapeutic drug or agent with a fortified decoction dosage form comprising from about 10 mg to about 6,000 mg each of β-sitosterol, isovanillin, and linolenic acid. The decoction dosage preferably includes plant extract(s) of the genus | 05-21-2015 |
| 20150290282 | ADMINISTRATION METHOD FOR ANTICANCER DRUGS - Disclosed is a method for providing information used for comparing restoration rates of damaged DNA, wherein information about a time period when Ataxia telangiectasia and Rad3 related (‘ATR’) activation is accelerated, on the basis of alternative information about an expression level of cryptochrome may be acquired, therefore, it can be determined that a restoration rate of damaged DNA is high at a time period when the expression level of cryptochrome is high. Accordingly, a time period when a restoration rate of DNA damaged by different causes is high, can be determined. Further, it is possible to estimate a time period when side effects occurring due to using an anticancer drug are minimized, and then, utilize the estimated result in determining the timing of administration of an anticancer drug. | 10-15-2015 |
| 20150291601 | COMPOUNDS USEFUL AS INHIBITORS OF ATR KINASE - The present invention relates to compounds useful as inhibitors of ATR protein kinase. The invention also relates to pharmaceutically acceptable compositions comprising the compounds of this invention; methods of treating of various diseases, disorders, and conditions using the compounds of this invention; processes for preparing the compounds of this invention; intermediates for the preparation of the compounds of this invention; and methods of using the compounds in in vitro applications, such as the study of kinases in biological and pathological phenomena; the study of intracellular signal transduction pathways mediated by such kinases; and the comparative evaluation of new kinase inhibitors. | 10-15-2015 |
| 20150292030 | METHODS OF CHARACTERIZING AND TREATING MOLECULAR SUBSET OF MUSCLE-INVASIVE BLADDER CANCER - The present application discloses a method of diagnostic testing of primary tumors, circulating tumor cells, serum, and urine to detect high-risk bladder cancers. These results have immediate implications for prognostication and the clinical management of muscle-invasive bladder cancer. | 10-15-2015 |
| 20150297514 | INHALATION-TYPE PHARMACEUTICAL COMPOSITION FOR THE TREATMENT OF LUNG CANCER AND PREPARATION METHOD THEREOF - The present invention provides an inhalation-type pharmaceutical composition for lung cancer and preparation method thereof, comprising a first gas and an atomized medicine. The first gas comprises hydrogen. The gas volume concentration of hydrogen in the inhalation-type pharmaceutical composition is between 2 to 96%. The atomized medicine is selected from a group comprising cisplatin, docetaxel, etoposide, gefitinib, erlotinib, and any combination thereof. The inhalation-type pharmaceutical composition of the present invention can remove harmful radicals in the body of the patient through the use of hydrogen while also increases the absorption effect of the medicine for the patient by using an atomized medicine. At the same time, because the use of the small amount of the vaporized pharmaceutical liquid can indirectly reduce the side effects on the user. | 10-22-2015 |
| 20150306086 | MODULATING CERTAIN TYROSINE KINASES - The present invention provides therapeutic and diagnostic modalities relevant to treating disorders associated with tyrosine kinase activity. | 10-29-2015 |
| 20150307728 | BIOPOLYMER-BASED INKS AND USE THEREOF - The present application discloses biopolymer-based ink formulations that are useful for inkjet printing and other applications. Related methods are also disclosed. | 10-29-2015 |
| 20150313922 | COMPOSITIONS AND METHODS FOR THE TREATMENT OF CANCERS ASSOCIATED WITH A DEFICIENCY IN THE MRE11/RAD50/NBS1 DNA DAMAGE REPAIR COMPLEX - Provided are compositions and methods for the identification and treatment of cancers exhibiting reduced MRE11/RAD50/NBS1 (MRN) complex formation and/or functionality as well as methods for the identification and use of cytotoxic agents, including clastogenic agents, for the treatment of cancers exhibiting reduced MRN complex formation and/or functionality. Also provided are methods for detecting and treating cancers, in particular breast cancers, such as hormone-negative breast cancers (HNBCs) and triple-negative breast cancers (TNBCs), colorectal cancers, urothelial cancers, and other cancers that exhibit reduced MRN complex formation and/or functionality and are correspondingly sensitive to growth and/or survival inhibition by one or more cytotoxic agents. | 11-05-2015 |
| 20150315244 | Peptides for Treating Cancer - The present disclosure relates to peptides for treating cancer, wherein the peptides suppress BRCA1-IRIS expression or activity. The peptides may include an amino acid sequence as set forth in SEQ ID NO: 1 and/or SEQ ID NO: 2. Further, the present disclosure provides methods for treating cancer, wherein the cancer may be breast or ovarian cancer, including administering one of said peptides to a subject in need thereof. | 11-05-2015 |
| 20150328227 | ARYLPYRIDINONE ITK INHIBITORS FOR TREATING INFLAMMATION AND CANCER - Disclosed herein are arylpyridinone compounds and compositions useful in the treatment of ITK mediated diseases, such as inflammation, having the structure of Formula (I): | 11-19-2015 |
| 20150342978 | METHOD OF INHIBITING ABCG2 AND RELATED TREATMENTS - Disclosed are methods of enhancing the chemotherapeutic treatment of tumor cells, reducing resistance of a cancer cell to a chemotherapeutic agent, a method of inhibiting ABCG2 or MRP1 in a mammal afflicted with cancer, and a method of increasing the bioavailability of an ABCG2 substrate drug in a mammal. The methods comprise administering peliomycin and other compounds described herein. | 12-03-2015 |
| 20150344968 | METHODS FOR DETERMINING PARP INHIBITOR AND PLATINUM RESISTANCE IN CANCER THERAPY - Systems and methods for determining whether a cancer patient may respond to PARP inhibitor and/or platinum chemotherapy based on identifying exon excision variants in the BRCA 1 gene are provided. Exon excision variants may encode a hypomorphic BRCA1 protein. The cancer patient may be a breast cancer patient or an ovarian cancer patient. The patient may have any cancer in which exon deficiency in the BRCA1 gene contributes to resistance to PARP inhibitor or platinum therapy. | 12-03-2015 |
| 20150355163 | T-TYPE CALCIUM CHANNEL INHIBITORS FOR TREATMENT OF CANCER - Presented herein are compounds that inhibit T-type Ca | 12-10-2015 |
| 20150359797 | METHOD FOR TREATING CANCER USING A COMBINATION OF CHK1 AND ATR INHIBITORS - The present invention relates to methods of treating cancer in a patient by administering a compound useful as an inhibitor of ATR protein kinase in combination with a compound useful as an inhibitor of Chk1 protein kinase. The aforementioned combination displays a surprising synergistic effect in treating cancer despite the targeted protein kinases being within the same biological pathway. Moreover, the present invention also relates to methods of treating cancer by administering a compound useful as an inhibitor of ATR protein kinase; administering a compound useful as an inhibitor of Chk1 protein kinase; as well as administering a DNA damaging agent to a patient. | 12-17-2015 |
| 20150361048 | Targeting Gli Proteins in Human Cancer by Small Molecules - The present disclosure provides compositions, pharmaceutical preparations and methods for the diagnosis and treatment of cancers expressing a GLI polypeptide. The disclosed compositions and pharmaceutical preparations may comprise one or more pyrazolyl-containing compounds, or an analog or derivative thereof. | 12-17-2015 |
| 20150374672 | PRE-SELECTION OF SUBJECTS FOR THERAPEUTIC TREATMENT WITH AN HSP90 INHIBITORY COMPOUND BASED ON CHEMOSENSITIVE STATUS - The present invention relates to the use of an Hsp90 inhibitor, alone or in combination with another chemotherapeutic agent, in treating cancer in subjects that are determined to be chemosensitive. In particular, the invention features a method of treating cancer in a subject, comprising administering a Hsp90 inhibitor to the subject, wherein the time since diagnosis of cancer in the subject is 6 months or greater. | 12-31-2015 |
| 20150376187 | COMPOUNDS USEFUL AS INHIBITORS OF ATR KINASE - The present invention relates to pyrrolopyrazines compounds useful as inhibitors of ATR protein kinase. The invention also relates to pharmaceutically acceptable compositions comprising the compounds of this invention; methods of treating of various diseases, disorders, and conditions using the compounds of this invention; processes for preparing the compounds of this invention; intermediates for the preparation of the compounds of this invention; and methods of using the compounds in in vitro applications, such as the study of kinases in biological and pathological phenomena; the study of intracellular signal transduction pathways mediated by such kinases; and the comparative evaluation of new kinase inhibitors. | 12-31-2015 |
| 20160000808 | ANDROGEN RECEPTOR DOWN-REGULATING AGENTS AND USES THEREOF - The present disclosure provides the design and synthesis of novel steroidal compounds that cause down-regulation of the androgen receptor (AR), both full length and splice variant. The compounds are potential agents for the treatment of all forms of prostate cancer and other diseases that depend on functional AR. | 01-07-2016 |
| 20160000818 | COMPOSITIONS INCLUDING TRICIRIBINE AND ONE OR MORE PLATINUM COMPOUNDS AND METHODS OF USE THEREOF - This application encompasses combination therapies including triciribine and related compounds and one or more platinum compounds and compositions with reduced toxicity for the treatment and prevention of tumors, cancer, and other disorders associated with abnormal cell proliferation. | 01-07-2016 |
| 20160024592 | SINGLE-CELL ANALYSIS AS A SENSITIVE AND SPECIFIC METHOD FOR EARLY PROSTATE CANCER DETECTION - Certain embodiments are directed to methods of measuring single cell levels of biomarkers associated with prostate cancer. | 01-28-2016 |
| 20160030324 | APPLICATIONS OF SURFACTIN IN EMULSIFYING COMPOSITION AND THEREOF - Surfactin is a biosurfactant produced by | 02-04-2016 |
| 20160030424 | COMPOUNDS USEFUL AS INHIBITORS OF ATR KINASE AND COMBINATION THERAPIES THEREOF - The present invention relates to compounds useful as inhibitors of ATR protein kinase and combination therapies thereof. The invention also relates to pharmaceutically acceptable compositions comprising the compounds of this invention; methods of treating of various diseases, disorders, and conditions using the compounds of this invention; processes for preparing the compounds of this invention; intermediates for the preparation of the compounds of this invention; and methods of using the compounds in in vitro applications, such as the study of kinases in biological and pathological phenomena; the study of intracellular signal transduction pathways mediated by such kinases; and the comparative evaluation of new kinase inhibitors. | 02-04-2016 |
| 20160040166 | OLIGONUCLEOTIDES FOR MODULATING GENE EXPRESSION AND USES THEREOF - The present invention regards oligonucleotides for modulating the expression of a gene, in particular for modulating a gene responsible for a pathology of genetic, tumoural or viral origin. Moreover, the present invention relates to the use of said oligonucleotides, possibly chemically modified, for the treatment and/or the diagnosis of said diseases. | 02-11-2016 |
| 20160053257 | METHOD FOR ASSAYING MICRORNA, CANCER THERAPEUTIC AGENT, AND MEDICINAL COMPOSITION CONTAINING SAME FOR CANCER THERAPY - The present inventors have found microRNAs which are strongly associated with stabilization of NRF2 in tumors, and an object of the present invention is to provide means for utilizing such miRNAs for the diagnosis and treatment of cancer. The inventors conducted screening of 470 microRNAs in a microRNA library by use of HeLa cells. As a result, 8 miRNAs each exhibiting a large decrease in miRNA activity as compared with a control miRNA, and 8 miRNAs each exhibiting a large increase in miRNA activity as compared with a control miRNA, were identified. The inventors have found that the NRF2 activation in the living body, in particular tumor cells, can be detected by use of the thus-identified miRNAs, whereby malignancy of a tumor, or the like can be differentiated. The inventors have also found that a nucleic acid including a miRNA sequence associated with reduction in the aforementioned ARE activity can be used as a cancer therapeutic agent. | 02-25-2016 |
| 20160054324 | ASRGL1 IN ENDOMETRIAL CANCER - There is provided a method for determining whether a mammalian subject having an endometrial cancer belongs to a first or a second group, wherein the prognosis of subjects of the first group is better than the prognosis of subjects of the second group, comprising the steps of: a) evaluating an amount of ASRGL1 in at least part of a sample earlier obtained from the subject and determining a sample value corresponding to the evaluated amount; b) comparing said sample value with a predetermined reference value; and if said sample value is higher than said reference value, c1) concluding that the subject belongs to the first group; and if said sample value is lower than or equal to said reference value, c2) concluding that the subject belongs to the second group. | 02-25-2016 |
| 20160058791 | USE OF TRANSPLATIN TO PREVENT HEARING LOSS - Methods and compositions for treating and preventing toxic side effects of platinum-based chemotherapy agents are disclosed, in which transplatin is administered to a subject. Transplatin is shown to have protective effects against cisplatin-induced ototoxicity, nephotoxicity and neurotoxicity. Anti-inflammatory activity of transplatin is demonstrated and methods and compositions for treating and preventing inflammatory pain are described. | 03-03-2016 |
| 20160060705 | MOLECULAR DIAGNOSTIC TEST FOR CANCER - Methods and compositions are provided for the identification of a molecular diagnostic test for cancer. The test defines a novel DNA damage repair deficient molecular subtype and enables classification of a patient within this subtype. The present invention can be used to determine whether patients with cancer are clinically responsive or non-responsive to a therapeutic regimen prior to administration of any chemotherapy. This test may be used in different cancer types and with different drugs that directly or indirectly affect DNA damage or repair, such as many of the standard cytotoxic chemotherapeutic drugs currently in use. In particular, the present invention is directed to the use of certain combinations of predictive markers, wherein the expression of the predictive markers correlates with responsiveness or non-responsiveness to a therapeutic regimen. | 03-03-2016 |
| 20160068566 | DERIVATIVES OF DOLASTATIN 10 AND AURISTATINS - The present invention concerns a compound of following formula (I): where: —R | 03-10-2016 |
| 20160068567 | DERIVATIVES OF DOLASTATIN 10 AND AURISTATINS - The present invention concerns a compound of following formula (I) where: —R | 03-10-2016 |
| 20160074390 | HUMAN DOSING OF PHOSPHATASE INHIBITOR - The present invention provides a method of inhibiting protein phosphatase 2A (PP2A) in a human subject in need thereof comprising administering to the subject an amount of from 0.1 mg/m | 03-17-2016 |
| 20160074404 | ADMINISTRATION OF NEDD8-ACTIVATING ENZYME INHIBITOR AND CHEMOTHERAPEUTIC AGENTS - Disclosed are methods for the treatment of various solid tumors in patients in need of such treatment. The methods comprise administering to such a patient an NEDD8-activating enzyme (NAE) inhibitor such as (1S,2S,4R)-4-4-(1S)-2,3-dihydro 1H-inden-1-ylamino)-7H-pyrrolo[2,3-d]-pyrimidin-7-yl)-2-hydroxycyclopentyl)methyl sulfamate (MLN4924) or a pharmaceutically acceptable salt in combination with one or more chemotherapeutic agents. Also disclosed are medicaments for use in the treatment of various solid tumors. | 03-17-2016 |
| 20160083420 | DERIVATIVES OF DOLASTATIN 10 AND AURISTATINS - The present invention concerns a compound of following formula (I) where: —R | 03-24-2016 |
| 20160102365 | ASSAYS, METHODS AND KITS FOR ANALYZING SENSITIVITY AND RESISTANCE TO ANTI-CANCER DRUGS, PREDICTING A CANCER PATIENT'S PROGNOSIS, AND PERSONALIZED TREATMENT STRATEGIES - Described herein are assays, methods and kits for analyzing sensitivity of a subject's cancerous tumor to a drug, predicting responses of cancerous tumors to drugs, determining the prognosis of a subject having a cancerous tumor, and developing a personalized therapy or treatment strategy for the subject. The assays, methods and kits involve analyzing gene and protein expression signatures or profiles of a subject's cancerous tumor, testing candidate drugs in cancerous cells from the subject's cancerous tumor, and classifying a subject's cancerous tumor based on ovarian cell and fallopian tube cell cell-of-origin gene expression signatures. Using these methods, a suitable drug (or drugs) is identified, the subject can be treated with that drug, and a personalized therapy can be developed for the subject. | 04-14-2016 |
| 20160113899 | Method of Treating Cancer That Overexpresses TopBP1 - The present invention provides a method of treating cancer that overexpresses TopBP1 by administering to a patient suffering from the cancer with an effective amount of a small molecule inhibitor that binds the BRCT7/8 domain of TopBP1. | 04-28-2016 |
| 20160114040 | Derivatized Hyperbranched Polyglycerols - Herein are provided derivatized hyperbranched polyglycerols (“dHPGs”). The dHPG comprises a core comprising a hyperbranched polyglycerol derivatized with C | 04-28-2016 |
| 20160114050 | Heparosan/Therapeutic Prodrug Complexes and Methods of Making and Using Same - Compositions, methods, and systems are disclosed for the development and use of heparosan, a natural polymer related to heparin, as a new therapeutic modifying agent or complexation vehicle which can modulate drug cargo pharmacokinetics and behavior within a mammalian patient. In certain non-limiting embodiments, the use of heparosan is complexed with anti-cancer drugs and the like, thus forming a prodrug for the purposes of increasing efficacy and reducing side effects compared to the parental drug alone. | 04-28-2016 |
| 20160120848 | SPECIFIC CANCER TREATMENT REGIMES WITH GANETESPIB - Methods of treating certain types of cancer with ganetespib are disclosed. Also provided are methods of treating certain types of cancer with ganetespib in combination with a taxane derivative, and a platinum-containing anticancer agent. Also provided are methods of treating certain types of cancer with p53 mutation by a combination of ganetespib with a taxane derivative, and a platinum-containing anticancer agent. Also provided are methods of treating certain types of cancer with ganetespib in combination with a platinum-containing anticancer agent, and an antimetabolite. Also provided are methods of treating certain types of cancer with ganetespib in combination with a taxane derivative, an anthracycline derivative, and an alkylating antineoplastic agent. Also provided is a pharmaceutical composition comprising ganetespib and one or more other anticancer agents as described above. | 05-05-2016 |
| 20160120876 | PHARMACEUTICAL COMPOSITION FOR TREATMENT OF CANCER USING PHENOTHIAZINE - The present invention relates to use of antipsychotic phenothiazine derivative for treatment of cancer. The invention also provides a use for manufacture a medicament, a pharmaceutical composition and a method for treating a cancer, and/or preventing or delaying cancer recurrence based on trifluoperazine. The invention further provides a use for manufacture a medicament, a pharmaceutical composition and a method for treating cancer based on thioridazine and its enantiomers. Additionally, the invention provides a use for manufacture a medicament, a pharmaceutical composition and a method for treating KRAS mutant NSCLC comprising thioridazine. | 05-05-2016 |
| 20160122827 | CANCER DIAGNOSIS, TREATMENT SELECTION AND TREATMENT - The present invention provides assays, methods and systems for selecting an effective therapy for a subset of cancer patients having cancer cells with increased expression of BML and FANCI genes and/or having copy number increase in chromosome location 15q26 in the cancer cells and for treatment of such patients with the effective therapy of cancer patients based on the personalized cancer cell expression profile. | 05-05-2016 |
| 20160128975 | ANTIFUGETACTIC AGENTS FOR THE TREATMENT OF LUNG CANCER - This invention provides methods and compositions for modulating movement of eukaryotic cells with migratory capacity. More specifically, the invention provides anti-fugetactic agents and methods for the use thereof in enhancing an immune response. | 05-12-2016 |
| 20160128976 | ANTIFUGETACTIC AGENTS FOR THE TREATMENT OF CANCERS - This invention provides methods and compositions for modulating movement of eukaryotic cells with migratory capacity. More specifically, the invention provides anti-fugetactic agents and methods for the use thereof in enhancing an immune response. | 05-12-2016 |
| 20160128988 | COMBINATIONS FOR THE TREATMENT OF CANCER COMPRISING A MPS-1 KINASE INHIBITOR AND A MITOTIC INHIBITOR - The present invention relates to a combination comprising an Mps-1 kinase inhibitor and a mitotic inhibitor. The present invention also relates to the use of said combination for the treatment of cancer, in particular of pancreatic cancer, glioblastoma, ovarian cancer, non-small cell lung carcinoma, breast cancer and/or gastric cancer. | 05-12-2016 |
| 20160130654 | SYSTEMS AND METHODS FOR DIAGNOSING AND TREATING CANCER - Embodiments of the invention provide a method detecting and treating cancer, such as lung cancer. In some aspects, the method may include detecting cancer in a subject, which may comprise assessing the expression of a marker in a sample from the subject. For example, the marker may comprise Mcl-1. In some embodiments, if the subject is diagnosed as having cancer, the method may further provide administering a therapeutically effective amount of a substance that reduces the expression level of Mcl-1 to the subject and then administering a treatment modality that is known to treat the cancer. | 05-12-2016 |
| 20160136121 | USE OF CILASTATIN TO REDUCE THE NEPHROTOXICITY OF DIFFERENT COMPOUNDS - Use of cilastatin to reduce the nephrotoxicity of different compounds. The invention refers to use of cilastatin to prepare a medicinal product to reduce the nephrotoxicity of a nephrotoxic compound that enters the cells of the proximal tubule through cholesterol rafts. The invention is based on the discovery that a great number of nephrotoxic compounds, including drugs, enter the cells of the proximal tubule through the cholesterol rafts, and that cilastatin is able to interfere with this transport mechanism, decreasing the nephrotoxicity of such compounds to a variable extent. The nephroprotective effect is common to compounds of different chemical nature and solubility and is specific for the kidney, causing no interference with the effects of nephrotoxic drugs having their targets in other organs. Therefore, administration of cilastatin allows for decreasing the nephrotoxic effects of different drugs without reducing their therapeutic effects. | 05-19-2016 |
| 20160136129 | CHROMAN DERIVATIVES, MEDICAMENTS AND USE IN THERAPY - Novel chroman derivatives and intermediate compounds, compositions containing same, methods for their preparation and uses thereof as therapeutic agents particularly as anti-cancer and chemotherapeutic selective agents are described. | 05-19-2016 |
| 20160136158 | PLATINUM COMPOUNDS THAT INHIBIT CONSTITUTIVE STAT3 SIGNALING AND INDUCE CELL CYCLE ARREST AND APOPTOSIS OF MALIGNANT CELLS - The subject invention concerns a compound and compositions having activity as an inhibitor of Stat3 protein and methods of using the compound and compositions. In one embodiment, a compound of the invention has the structure shown in formula I, formula II, or formula III. The subject invention also concerns methods of using the compounds and compositions of the invention. | 05-19-2016 |
| 20160143946 | COMBINATION THERAPIES FOR TREATING CANCER - Aspects described herein provide methods of treating cancer by administering a histone-deacetylase inhibitor with a chemotherapeutic. In some embodiments, the histone-deacetylase inhibitor is AR-42. In some embodiments, the chemotherapeutic is cisplatin. | 05-26-2016 |
| 20160143991 | METHODS FOR THE TREATMENT OF CANCER USING GLIADIN PEPTIDES - Kits and methods for treating cancer comprising administration of a gliadin peptide to a patient are disclosed herein. A kit according to the invention comprises a pharmaceutical composition comprising a gliadin peptide and instructions for administering the peptide to a patient. The kit may further comprise a pharmaceutical composition comprising at least one chemotherapeutic agent such as a receptor tyrosine kinase inhibitor and instructions for co-administering the compounds. A method of treating cancer according to the invention comprises administering a gliadin peptide to a patient and may further comprise co-administering at least one chemotherapeutic agent such as a receptor tyrosine kinase inhibitor. Co-administration of a gliadin peptide and receptor tyrosine kinase inhibitor to a patient with cancer is effective to decrease or prevent resistance of the cancer to the receptor tyrosine kinase inhibitor. | 05-26-2016 |
| 20160145250 | ANTI-CANCER COMPOUNDS - Provided are methods and compositions for the treatment of diseases such as cancer. In certain aspects, compounds which can inhibit Skp2 are provided. Specifically chromenone derivatives are disclosed that have the capability toward reducing differentiation of pluripotent, multipotent or totipotent cells and thus have therapeutic utility in the treatment of a proliferative disease such as cancer. | 05-26-2016 |
| 20160151388 | Methods and Compositions Related to Glucocorticoid Receptor Antagonism and Prostate Cancer | 06-02-2016 |
| 20160151435 | PHARMACEUTICAL COMPOSITION ADJUVANT TO CHEMOTHERAPY DRUGS AND APPLICATIONS THEREOF | 06-02-2016 |
| 20160166537 | ANTIFUGETACTIC AGENTS FOR THE TREATMENT OF BRAIN CANCERS | 06-16-2016 |
| 20160166538 | ANTIFUGETACTIC AGENTS FOR THE TREATMENT OF BREAST CANCER | 06-16-2016 |
| 20160168577 | Clusterin Antisense Therapy for Treatment of Cancer | 06-16-2016 |
| 20160175306 | COMBINATION OF A IMIDAZOPYRIDAZINE DERIVATIVE AND A MITOTIC AGENT FOR THE TREATMENT OF CANCER | 06-23-2016 |
| 20160175339 | METHODS FOR DETECTING AND MODULATING THE SENSITIVITY OF TUMOR CELLS TO ANTI-MITOTIC AGENTS AND FOR MODULATING TUMORIGENICITY | 06-23-2016 |
| 20160175351 | CANCER TREATMENT | 06-23-2016 |
| 20160184353 | ADMINISTRATION OF A THIOL-BASED CHEMOPROTECTANT COMPOUND - A method of administration of a thiol-based chemoprotectant agent including NAC (N-acetylcysteine) and STS (sodium thiosulfate) that markedly affects biodistribution and protects against injury from diagnostic or therapeutic intra-arterial procedures. A method for treating or mitigating the side effects of cytotoxic cancer therapy for tumors located in the head or neck and brain tumors. The thiol-based chemoprotectant agent is administered intra-arterially with rapid and first pass uptake in organs and tissues other than the liver. | 06-30-2016 |
| 20160199380 | Sigma Ligands For the Prevention or Treatment of Pain Induced by Chemotherapy | 07-14-2016 |
| 20160199381 | Inhibition of Thymine DNA Glycosylase in the Treatment of Cancer | 07-14-2016 |
| 20160250190 | N-METHYL PYRAZOLOANTHRONE FOR TREATMENT OF CANCER | 09-01-2016 |
| 20160250220 | TREATMENT FOR PANCREATIC CANCER | 09-01-2016 |
| 20160251350 | CRYSTALLINE FORMS OF A PYRROLOPYRIDINE COMPOUND | 09-01-2016 |
| 20160375107 | FRAGILE HISTIDINE TRIAD (FHIT) COMPOSITIONS AND USES THEREOF - Provided herein are methods and compositions for the diagnosis, prognosis and treatment of a cancer associated disorders using the Fhit gene. | 12-29-2016 |
| 20170232030 | COMBINATION THERAPY FOR TREATING CANCER | 08-17-2017 |
| 20170232037 | Compositions and Methods for Enhancing the Effectiveness of Systemic, HIPEC, IP, and Related Cancer Treatments | 08-17-2017 |
| 20180022743 | COMPOSITIONS OF KINASE INHIBITORS AND THEIR USE FOR TREATMENT OF CANCER AND OTHER DISEASES RELATED TO KINASES | 01-25-2018 |
| 20190142840 | USE OF SIGMA RECEPTOR LIGANDS IN CANCER | 05-16-2019 |
