| Entries |
| Document | Title | Date |
|---|
| 20080199526 | Composition With Tight Capsules Containing a Sunscreen Agent - The present invention provides a topical composition comprising a first sunscreen agent which is encapsulated and a second sunscreen agent which is different from the first sunscreen agent, characterized in that the first sunscreen agent is encapsulated in microcapsules having an average particle size D(v, 0.5) from 3 μm to 8 μm. The encapsulated sunscreen agent is preferably a cinnamic ester derivative. | 08-21-2008 |
| 20080213379 | Tumor environment-induced ligand-expressing nanocarrier system - Drug delivery compositions for specific delivery of a drug to a tumor are described. These compositions include a core for sequestering the drug and a shell to which a ligand is attached for delivery of a drug to target cells. Since normal cells may also be targeted by the ligand, the compositions embed the ligand in the shell until the localized conditions surrounding the tumor cause the ligand to be displayed on the surface of the shell. One composition exhibits shrinkage of the shell at tumor pH, whereas another composition exhibits extension of the ligand at tumor pH. Still another composition causes the ligand to be exhibited at an elevated temperature. | 09-04-2008 |
| 20080213380 | Process for the Preparation of Encapsulates Through Precipitation - A process for the preparation of encapsulates, employs: a pumpable emulsion having (i) a continuous phase containing a solvent and a matrix-forming solute dissolved in the solvent and (ii) a dispersed phase; an extractant including supercritical, subcritical or liquefied gas; the solvent being substantially more soluble in the extractant than the matrix-forming solute and the process including the successive steps of: a) combining the pumpable emulsion with the extractant under mixing conditions; b) allowing the formation of particulate encapsulates in which the dispersed phase is encased in a solid matrix of the matrix-forming solute; c) collecting the encapsulates and separating them from the extractant. The present processes is particularly suitable for producing particles containing active ingredients that are very sensitive, whose activity is adversely affected by exposure to oxygen, light, moisture, heat and/or friction. | 09-04-2008 |
| 20080220078 | Pharmaceutical Formulations - A pharmaceutical formulation for delivery in aerosol or spray form, comprising a liquefied propellant gas, a solid particulate pharmaceutically active agent and a dispersing agent, wherein the dispersing agent is fused to the surface of particles of the pharmaceutically active agent. | 09-11-2008 |
| 20080220079 | SUSTAINED RELEASE COMPOSITIONS USING WAX-LIKE MATERIALS - Sustained release spherical or non-spherical pellets comprising (a) an active ingredient (b) a wax-like agent, and (c) a spheronizing agent are provided. Oral dosage forms comprising said pellets and methods for preparing and using such pellets and dosage forms are also provided. | 09-11-2008 |
| 20080233197 | Pharmaceutical compositions - Provided herein is a pharmaceutical composition comprising an antagonist, an agonist, a seal coat, and a sequestering polymer, wherein the antagonist, agonist, seal coat and at least one sequestering polymer are all components of a single unit, and wherein the seal coat forms a layer physically separating the antagonist from the agonist from one another. Methods for manufacturing such a pharmaceutical composition are also provided. | 09-25-2008 |
| 20080233198 | Method for delivering a peptide to a subject at a modulated rate via microcapsules of lactic-co-glycolic copolymer containing said peptide - Micro-capsules for the slow release of drugs, consisting of a lactic-co-glycolic copolymer to which a plasticiser has been incorporated and which contain a drug of pharmaceutical interested within them. | 09-25-2008 |
| 20080241262 | Nanoshells and Discrete Polymer-Coated Nanoshells, Methods For Making and Using Same - Nano-structures are disclosed that are ideally suited for microelectronics, medical treatment, drug-delivery systems, targeted thermal absorption media, or other similar applications, where the nano-particles include metal oxide nano-particles and metallic nano-particles including a metallic nano-shell or metallic nano-rods deposited on the surface of the nano-particles or nano-shell nano-particles including metallic nano-rods deposited on the surface of the nano-particles and where the nano-structures have a plasmon resonance. For in vivo medical applications, the plasmon resonance is tuned to a tissue-transparent frequency range. Hydrogel-coated nanostructures are also disclosed, which are capable of transitioning between a non-collapsed hydrogel and a collapsed hydrogel via thermal activation induced by electromagnetic irradiation. | 10-02-2008 |
| 20080241263 | Oral and/or Topical Compositions Comprising Prebiotics and Sterols - Compositions for oral and/or topical administration of a prebiotic and a sterol or an ester thereof are disclosed. The compositions are disclosed as enhancing the body's population of beneficial microorganisms for improving health and well-being. | 10-02-2008 |
| 20080241264 | System and methods for collective nanorobotics for medical applications - The invention discloses the use of collectives of nanorobots (CNRs) for medical applications. CNRs are used (a) to map the human body, (b) to regulate the cardio-vascular system, (c) for insulin regulation, (d) for targeted drug delivery, (e) for diagnosis of cellular pathologies and (f) for destroying tumor cells. | 10-02-2008 |
| 20080241265 | Pharmaceutical Combinations Containing Lamivudine, Stavudine and Nevirapine - A pharmaceutical composition comprising 10-120 mg lamivudine, 1-30 mg stavudine and 50-170 mg nevirapine for pediatric treatment of viral infections. One particularly preferred composition comprises a tablet containing 12 mg stavudine, 60 mg lamivudine and 100 mg nevirapine. Another particularly preferred composition comprises a second tablet containing 6 mg stavudine, 30 mg lamivudine and 500 mg nevirapine. These compositions are suitable for treating children having a body weight from 5 to 30 kg. | 10-02-2008 |
| 20080248122 | Microencapsules Containing Surface-Modified Microparticles And Methods Of Forming And Using The Same - An encapsulated particle, comprising a plurality of preformed microparticles encapsulated in an amorphous matrix, wherein at least one of the preformed microparticles comprises a core microparticle and a monolayer associated with the outer surface of the core microparticle. The core microparticle comprises at least one active agent that is capable of being released from the encapsulated particle. | 10-09-2008 |
| 20080254131 | CONTROLLED-RELEASE GALANTAMINE FORMULATIONS - Controlled-release galantamine formulations, including controlled-release particles, pellets, granules, and spheres are described. Controlled-release particles, pellets, granules, and spheres with immediate release top-coat are also described. Method of preparing such formulations and method of treating a variety of disorders are also disclosed. | 10-16-2008 |
| 20080260842 | PERMEATION ENHANCING COMPOSITIONS FOR ANTICHOLINERGIC AGENTS - A transdermal or topical skin-friendly composition including anticholinergic agents, such as oxybutynin, a urea-containing compound and a carrier system. A method is disclosed for treating a subject for urinary incontinence while reducing the incidences of peak concentrations of drug and undesirable side effects associated with oral anticholinergics. | 10-23-2008 |
| 20080268061 | Nanoparticle/Active Ingredient Conjugates - The present invention relates to nanoparticles, wherein at least one therapeutically active substance is bound to said nanoparticle and wherein the separation of the at least one therapeutically active substance from the nanoparticle is caused or initiated by an alternating magnetic filed. Furthermore, the present invention relates to pharmaceutical compositions, in particular to injection solutions containing the nanoparticles as well as to the use thereof for the treatment of cancer. | 10-30-2008 |
| 20080268062 | STABILIZED PARTICLE DISPERSIONS CONTAINING SURFACE-MODIFIED INORGANIC NANOPARTICLES - This invention relates to particle-in-liquid dispersions containing surface-modified inorganic nanoparticles. | 10-30-2008 |
| 20080274200 | DOSE TITRATABLE LIQUID DOSAGE FORMS OF ACID LABILE DRUGS - Provided herein are pharmaceutical formulations comprising micro-granules and a liquid suspension vehicle having a pH less than 6.0 and a viscosity sufficient to suspend the micro-granules. The micro-granules typically contain a PPI which therefore makes the above formulation, as well as kits for making the above formulation, useful for alleviating the symptoms of gastrointestinal disorders or diseases. | 11-06-2008 |
| 20080274201 | GELS FOR ENCAPSULATION OF BIOLOGICAL MATERIALS - This invention provides novel methods for the formation of biocompatible membranes around biological materials using photopolymerization of water soluble molecules. The membranes can be used as a covering to encapsulate biological materials or biomedical devices, as a “glue” to cause more than one biological substance to adhere together, or as carriers for biologically active species. Several methods for forming these membranes are provided. Each of these methods utilizes a polymerization system containing water-soluble macromers, species, which are at once polymers and macromolecules capable of further polymerization. The macromers are polymerized using a photoinitiator (such as a dye), optionally a cocatalyst, optionally an accelerator, and radiation in the form of visible or long wavelength UV light. The reaction occurs either by suspension polymerization or by interfacial polymerization. The polymer membrane can be formed directly on the surface of the biological material, or it can be formed on material, which is already encapsulated. | 11-06-2008 |
| 20080279951 | Stable Oral Benzimidazole Compositions Prepared by Non-Aqueous Layering Process - The present invention relates to processes for the preparation of stable oral compositions of benzimidazole compounds prepared using a non-aqueous layering process. | 11-13-2008 |
| 20080279952 | Controlled-Release Flupirtine Compositions, Compacts, Kits and Methods of Making and Use Thereof - The present invention relates to compositions and compacts comprising flupirtine or a pharmaceutically acceptable salt thereof in which there is controlled-release of at least a portion of flupirtine or a pharmaceutically acceptable salt thereof. The invention further relates to kits comprising such compositions and compacts, and methods of making and using such compositions and compacts. | 11-13-2008 |
| 20080279953 | METHODS OF PRODUCING STABLE PANCREATIC ENZYME COMPOSITIONS - Compositions of the present invention, comprising at least one digestive enzyme (e.g., pancrelipase) are useful for treating or preventing disorders associated with digestive enzyme deficiencies. The compositions of the present invention can comprise a plurality of coated particles, each of which is comprised of a core coated with an enteric coating comprising at least one enteric polymer and 4-10% of at least one alkalinizing agent, or have moisture contents of about 3% or less, water activities of about 0.6 or less, or exhibit a loss of activity of no more than about 15% after six months of accelerated stability testing. | 11-13-2008 |
| 20080286369 | Process for Preparing Microcrystals - This invention relates in general to micron or sub-micron particles comprising one or more water-soluble crystals wherein the crystals have a surface coating comprising one or more bioactive molecules as well as efficient methods of forming such particles and rapid methods for screening preferred conditions to form such particles. The particles are suitable for pharmaceutical formulations. | 11-20-2008 |
| 20080286370 | Nanoscale Particles Used as Contrasting Agents in Magnetic Resonance Imaging - The invention relates to nanoscale particles as contrast agents for magnetic resonance imaging, consisting of a core having an inert matrix, one or more covalently bonded organic complexing agents in which one or more metal ions having unpaired electrons are bonded, and optionally one or more biomolecules covalently bonded to the surface of the cores, and to a process for the production of these nanoparticles. | 11-20-2008 |
| 20080292710 | Liquid Dosage Forms Of Acid Labile Drugs - Liquid formulations of acid-labile drugs are provided. The formulations generally comprise micro-granules comprising an acid-labile drug coated with an enteric coating and a liquid vehicle having a pH less than 6.0. The components of the formulation can separately provided in the form of kits. The formulations and kits may be used to treat patients suffering from disorders for which the acid labile drugs are indicated. | 11-27-2008 |
| 20080299208 | Anisometric Particles In The Form Of Nanofibers/Mesofibers,Nanopipes, Nanocables/Mesocables, Nanobands/Mesobands, And The Curved Or Branched Variations Thereof - The invention relates to novel anisometric mesoparticles and nanoparticles in the form of anisometric mesofibers/nanofibers, mesopipes/nanopipes, mesobands/nanobands, mesocables/nanocables, and the curved and branched or superimposed variations thereof as well as a novel method for the production thereof. The invention particularly relates to anisometric mesoparticles and nanoparticles which have an aerodynamic diameter <5 μm, the production thereof, loading thereof with active substances if the same cannot directly be utilized as an active substance, and the use thereof especially for producing medicaments against lung diseases or systemic diseases in humans and animals if the particles cannot directly be utilized as medicaments without carriers. | 12-04-2008 |
| 20080299209 | Novel Formulations of Fat-Soluble Active Ingredients with High Biovailability - The present invention relates to formulations of a pharmacological effective fat-soluble active ingredient with a high bioavailability of said fat-soluble active ingredient as well as to their manufacture and use as dietary supplement, food, feed, personal care product and/or pharmaceutical. Such formulations are those which when dissolved, dispersed or diluted in/with water have an extinction E 1/1 at a wavelength in the range of from 200 to 800 nm, preferably in the range of from 250 to 600 nm, more preferably in the range of from 250 to 500 nm, more preferably in the range of from 370 to 485 nm, of ≧380, preferably of ≧600, most preferably ≧900. In preferred embodiments of the formulations of the present invention such formulations show an extrusion loss of fat-soluble active ingredient of ≦30% when pressed to tablets. | 12-04-2008 |
| 20090004281 | MULTIPARTICULATE OSMOTIC DELIVERY SYSTEM - The present invention relates to a multiparticulate osmotic delivery system. The system is a modified release composition suitable for oral administration. The composition includes a core that includes at least one drug in combination with at least one pharmaceutically acceptable excipient. The composition further includes an osmotic subcoat surrounding the core, and a modified release overcoat surrounding the osmotic subcoated core. | 01-01-2009 |
| 20090004282 | Method of Particle Formation - A method of co-formulating two or more pharmaceutically active compounds into a particulate product including contacting a dense, supercritical or near-critical fluid With a suspension of a first active compound in a medium that is miscible with the dense fluid and a solution of a second active compound in a solvent that is miscible with the dense fluid. The product may be the first active agent coated with the second active agent. The method may use coaxial nozzles for the fluid, media or solvents. The method may be applied to production of dry powders for inhalation including beta-agonists and corticosteroids. Apparatus for use in the method comprising means for streams of solvents, media and dense fluids to enter a precipitation chamber at substantially the same point and means for collection of particles under gravity in one or more collection chambers. | 01-01-2009 |
| 20090004283 | Sustained Release Formulation Comprising Octreotide and Two or More Polylactide-Co-Glycolide Polymers - The present invention relates to sustained release formulations comprising as active ingredient octreotide or a pharmaceutically-acceptable salt thereof and two or more different polylactide-co-glycolide polymers (PLGAs). | 01-01-2009 |
| 20090011032 | METHODS FOR IMPROVED CRYO-CHEMOTHERAPY TISSUE ABLATION - The current invention relates to a process for increasing the efficacy of cancerous disease inhibiting therapeutic agents delivered to a treatment region of a tissue structure, such as a tumor. The multi-step procedure takes advantage of the resulting thermal stress response occurring as a result of exposure to the cold. Coordinating the thermal related stress response with the timing of cancerous disease inhibiting agent action provides a unique therapeutic regiment to treat tumors which provides a maximized effect on the tumor, protects normal cells, and activates local pro-inflammatory cells. | 01-08-2009 |
| 20090022807 | Drug formulations having inert sealed cores - A drug composition comprising a coated bead is used in the manufacture of immediate release and/or controlled release drug compositions. In a specific embodiment, the bead includes an inert core of a water-soluble or water-swellable material, which has been coated with a seal layer formed from a non-polymeric hydrophobic material. The immediate and/or controlled release beads may be used to form tablets or capsules. A method of making the beads by sequential deposition of multiple layers on the inert cores is also described. | 01-22-2009 |
| 20090041850 | Process for preparation of swellable and degradable microspheres - A process for producing microspheres was developed that provides microspheres that are swellable and degradable. The process is reliable and high yielding, and makes use of a low temperature azo initiator, a small molecule chlorinated solvent as the organic phase, and a heat treatment step, and is carried out in absence of a crosslinking agent. The microsphere preparation made using the process is particularly useful as a degradable embolic material. | 02-12-2009 |
| 20090068276 | Pharmaceutical compositions - The present invention relates to new pharmaceutical formulations comprising pharmaceutically active agents which can induce one or more involuntary coughs in a patient when administered as conventional formulations and/or via conventional routes. Formulations are provided comprising a cough-inducing pharmaceutically active agent, wherein the formulation may be administered by pulmonary inhalation without inducing a cough. Alternatively, formulations are provided for administering the cough-inducing active agent via an alternative route. | 03-12-2009 |
| 20090068277 | PHARMACEUTICAL COMPOSITION COMPRISING LIPASE INHIBITOR AND LIPOPHILIC OIL ABSORBENT AND ORAL FORMULATION PREPARED THEREFROM - This invention provides a pharmaceutical composition comprising a lipase inhibitor; a lipophilic oil absorbent selected from the group consisting of hydrogenated castor oil, hydrogenated vegetable oil, glyceryl behenate, glyceryl palmitostearate and a mixture thereof; and a pharmaceutically acceptable additive, an oral formulation of a lipase inhibitor prepared there from and a method for preparing said formulation. The formulation of the present invention can minimize side effects such as oily spotting, fatty/oily stool, abdominal distension and flatus, and thus it can be advantageously used for preventing or treating obesity and hyperlipaemia. | 03-12-2009 |
| 20090081304 | Composite pigment nanoparticles and processes to form organic-inorganic nanoparticle composite particles - Milling approaches provide for the efficient formation of composite particles having an inorganic nanoparticle core with an organic coating composition. The nanoparticles can additionally function as a milling media or distinct milling particles can be used and later separated from the product composite particles. In general, the milling is performed in the presence of a dispersing agent that facilitates dispersing of the composite particles in a carrier liquid. The processes described herein can be effectively used in the formation of composite particles comprising organic pigments. Similarly, the composite particles can be formed with other organic compounds, such as organic pharmaceutical compositions. | 03-26-2009 |
| 20090081305 | Compositions and Methods for Enhancing In-Vivo Uptake of Pharmaceutical Agents - Pharmaceutical compositions comprising liquid, nanostructures and pharmaceutical agents are provided. Methods of use such compositions are also provided. | 03-26-2009 |
| 20090087493 | Supramolecular Functionalization of Graphitic Nanoparticles for Drug Delivery - Disclosed are nanoparticles, such as carbon nanotubes or other materials having extended aromatic surfaces (e.g., graphene sheet or nanotube), which are used to deliver active agents such as drugs, labels or dyes (termed for convenience a “drug”) to the interior of cells. The nanoparticles are functionalized by a hydrophilic polymer to render them stable in suspension. This molecule may be covalently attached to the nanoparticle, or may be adsorbed thereto as an amphiphilic molecule. The nanoparticles are coupled to the drug through supramolecular bonding i.e., binding to the exterior of the nanoparticle through π-stacking. The drug may also be covalently bonded to the hydrophilic polymer, which is coupled to the nanoparticle through supramolecular bonding. The drug is therefore capable of release in the cell exterior. The drug is more rapidly released at lower pH, as found e.g., in tumor cells. The drug-coupled, functionalized nanoparticles may also be targeted to specific cells through modification of the hydrophilic polymer, e.g., by adding an RGD peptide, or an antibody, which is targeted to cells expressing integrins, or an antibody directed to a cell surface marker. The drug may also be linked to a branched chain hydrophilic polymer, so that each polymer molecule carries more than one drug bound by a cleavable linker. | 04-02-2009 |
| 20090092672 | ORALLY DISINTEGRATING TABLET COMPOSITIONS OF LAMOTRIGINE - The compositions of the present invention composition comprise a therapeutically effective amount of particles comprising lamotrigine, in combination with granules comprising a disintegrant, and a sugar alcohol and/or a saccharide. These compositions are useful in treating epilepsy and bipolar disorder, particularly for patients with dysphagia, and to improve compliance with bipolar patients. | 04-09-2009 |
| 20090092673 | Biocide - A two part biocide composition containing metal ions and bromine donor for killing microorganisms in a body of water and a method of killing microorganisms in a body of water by placing both metal ions and a bromine in the body of water to allow use of lower concentrations of bromine than if bromine were used alone as a biocide. | 04-09-2009 |
| 20090104274 | PROCESS OF MAKING MICROSPHERES - A process for the manufacture of free-flowing uniformly sized micro spheres for the sustained release of therapeutically active ingredient comprising: a) preparing a first dispersed phase comprising a therapeutically active ingredient, a biodegradable polymer and an organic solvent; b) mixing the first dispersed phase with a aqueous phase to form an emulsion; c) spraying the emulsion into a vessel ( | 04-23-2009 |
| 20090110738 | Loadable Polymeric Particles for Cosmetic and Reconstructive Tissue Augmentation Applications and Methods of Preparing and Using the Same - Particles are provided for use in therapeutic cosmetic and/or reconstructive procedures to augment defects in tissue to restore contours and/or function. The particles include poly[bis(trifluoroethoxy)phosphazene] and/or a derivatives thereof which may be present throughout the particles or within an outer coating of the particles. The particles may also include a core having a hydrogel formed from an acrylic-based polymer. Such particles may be provided to a user in various colors or with customized coloration to match desired tissues. Moreover, such particles may be loaded to provide localized treatment with an active component agent in specific clinical uses. Particles of the present invention may further be provided or used in conjunction with tissue adhesives or photoinitiator agents that may be activated by electromagnetic radiation or other energy sources to allow post-implantation cross-linking of the polymeric particles to cause their amalgamation to maintain their shape and location following implantation. | 04-30-2009 |
| 20090117194 | EUKARYOTIC MICROORGANISMS FOR PRODUCING LIPIDS AND ANTIOXIDANTS - Disclosed are compositions and methods related to eukaryotic microorganisms that can produce unsaturated fatty acids which can be purified and use. | 05-07-2009 |
| 20090123552 | SPHEROIDS PREPARED FROM AN ISOLATED ACTIVE PRINCIPLE OF VEGETABLE ORIGIN AND A SOLUTION OF VEGETABLE ORIGIN CONTAINING THE ACTIVE PRINCIPLE OR A PRECURSOR THEREOF - The invention relates to spheroids which are obtained using a method comprising the following steps consisting in: supplying an active principle of vegetable origin in an isolated form; supplying a solution of vegetable origin, containing the active principle or a precursor thereof; supplying an absorbing and adsorbing substance having plastic properties that are compatible with the method; mixing said different products and wetting the mixture with a wetting liquid; extruding the wet mixture; and forming spheroids through the spheronization of the extruded product. The invention also relates to sample applications such as artesunate-based antimalarial spheroids and aspring-based spheroids. | 05-14-2009 |
| 20090136582 | COLLOIDAL MAGNETIC NANOBIOPARTICLES FOR CYTOTOXICITY AND DRUG DELIVERY - The present invention provides systems that include magnetic colloidal particles of differing elemental compositions with differing morphologies. The colloidal particles comprise a magnetic material and a shell that surrounds the magnetic material. The colloidal particles can be inductively heated using a magnetic field. The present invention also provides applications of such colloidal particles, such as methods for cytotoxicity and for drug delivery. | 05-28-2009 |
| 20090155369 | PHARMACEUTICAL COMPOSITION CONTAINING LEVODOPA, ENTACAPONE AND CARBIDOPA - The present invention refers to a solid pharmaceutical composition of entacapone, levodopa and carbidopa or pharmaceutically acceptable salts thereof characterized in that entacapone is in the form of granules and it is added separately to levodopa and carbidopa. In addition, this invention provides the process for its preparation. | 06-18-2009 |
| 20090162447 | Spherically Shaped Substances - A particle having a rounded shape and characterized by a substantially smooth surface is disclosed. The particle can be made of a food substance (e.g., nutritional substance or nutraceutical substance), a pharmaceutical (pharmaceutically active ingredient or pharmaceutically acceptable carrier) or a cosmetic substance. | 06-25-2009 |
| 20090162448 | Metal Carbonate Particles and Methods of Making Thereof - Silver-containing particles, and methods of making silver-containing particles are disclosed. | 06-25-2009 |
| 20090169632 | SUSTAINED RELEASE COMPOSITION AND MANUFACTURING METHOD THEREOF - A sustained release composition comprising a polymer and manufacturing method thereof. The sustained release composition comprises a polymer, a bioactive agent, and a release rate determined agent, wherein the release rate determined agent is dispersed in the sustained release composition to control the release rate of the bioactive agent. The method comprises providing an oil phase comprising a bioactive agent, a polymer, and a release rate determined agent; providing an aqueous phase comprising a surfactant; mixing the oil phase with the aqueous phase to form the sustained release composition having a controlled release effect. | 07-02-2009 |
| 20090169633 | Oral particle including pseudoephedrine hydrochloride and cetirizine dihydrochloride - The present invention relates to an oral particle including pseudoephedrine hydrochloride and cetirizine dihydrochloride, which primarily includes a nucleus having a diameter ranging 25˜40 mesh, a pseudoephedrine-hydrochloride layer coated outside the nucleus with a coating solution composed of pseudoephedrine hydrochloride, a binder, a lubricant and pure water/alcohol, a release-control layer coated outside the pseudoephedrine-hydrochloride layer, and a cetirizine-dihydrochloride layer coated outside the release-control layer with a coating solution composed of cetirizine dihydrochloride, a binder, a lubricant and pure water/alcohol. Accordingly, by distributing pseudoephedrine hydrochloride and cetirizine dihydrochloride into hundreds of the particles and controlling the dissolution rate with the release-control layer, the particles can perform good absorption efficiency, and quick, stable and long-term medicinal effect. | 07-02-2009 |
| 20090175948 | AEROSOL METHOD FOR NANO SILVER-SILICA COMPOSITE ANTI-MICROBIAL AGENT - A method of forming and resulting nano-structured composite includes atomizing a mixture of an amount of each of aminopropyltriethoxysilane, AgNO | 07-09-2009 |
| 20090175949 | MICROPARTICLES FOR DELIVERY TO CELLS AND/OR TISSUES - Delivery of bioactive molecules (BAMs) to organelles, cells, tissues, or animals with high efficiency is desirable. Novel compositions for highly efficient delivery of bioactive molecules by biolistic methods are described. The novel compositions include novel microparticle cores, microparticle core/BAM complexes, microparticle core/nanoparticle complexes and multilayer-microparticle core/BAM complexes. Any one of these may be further modified to include targeting agents. | 07-09-2009 |
| 20090175950 | PHARMACEUTICAL SAFETY DOSAGE FORMS - Pharmaceutical safety dosage forms are provided which include a pharmaceutical and an antagonist to the pharmaceutical. The safety dosage forms are such that the antagonist has no significant bioavailability when the pharmaceutical safety dosage form is administered as intended. However, the antagonist is released and becomes bioavailable if the dosage form is disrupted. Methods of administering pharmaceuticals by providing pharmaceutical safety dosage forms are also provided. | 07-09-2009 |
| 20090186092 | SYSTEM AND METHOD FOR MANUFACTURING ORAL OSMOTIC DRUG DELIVERY DEVICES, AND METHODS OF ADMINISTERING SAME - A system and method for manufacturing oral osmotic drug delivery devices including the use of a mathematical model in deriving relationships between parameters used in manufacturing the devices for a desired release rate of the active drug substance contained therein. The derived relationship is then used to control the parameters so that the active substance within the device is delivered at a desired rate. Methods of administering the oral osmotic drug delivery devices are also provided. Use of a mathematical model in deriving relationships between parameters used in the drug granulation process for a desired range of percentage fines of the drug granulation substance. The derived relationship is then used to control the parameters in the drug granulation process so that the desired percentage fines are obtained in the drug granulation substance. | 07-23-2009 |
| 20090191274 | Pharmaceutical composition of amlodipine maleate having enhanced stability - The present invention relates to a coated particle of amlodipine maleate and a pharmaceutical composition for cardiovascular disease (CVD) comprising the coated particle of amlodipine maleate. The pharmaceutical composition of the present invention has stable bioavailability due to sufficient dissolution rate and prevents decomposition reaction of amlodipine to thereby being formulated with formulation-stability equal to or higher than amlodipine besylate under long storage. | 07-30-2009 |
| 20090191275 | VISCOUS BUDESONIDE FOR THE TREATMENT OF INFLAMMATORY DISEASES OF THE GASTROINTESTINAL TRACT - Provided herein are methods for preventing or alleviating the symptoms of and inflammation associated with inflammatory diseases and conditions of the gastrointestinal tract, for example, those involving the esophagus. Also provided herein are pharmaceutical compositions useful for the methods of the present invention. | 07-30-2009 |
| 20090202649 | FENOFIBRATE FORMULATIONS - The present invention relates to pharmaceutical formulations comprising fenofibrate. The invention also relates to stable and bioavailable pharmaceutical formulations comprising fenofibrate. Further the invention also relates to processes for preparing the compositions and/or formulations of fenofibrate and their methods of use, treatment and administration. | 08-13-2009 |
| 20090214660 | ENCAPSULATION SYSTEM - The present invention is directed to a composition comprising high mannuronic acid-containing alginate and a polycation having a polydispersity index of less than 1.5. The composition is particularly useful for making biocompatible microcapsules containing living cells for allo- or xeno-transplantation. Such microcapsules have enhanced durability and can maintain their structural and functional integrity over long periods of time compared to prior art alginate microcapsules. | 08-27-2009 |
| 20090214661 | PROCESS FOR THE PRODUCTION OF BEADLETS - A process for the production of cross-linked beadlets containing one or more active ingredients selected from the group of a fat-soluble vitamin active material, a carotenoid and a polyunsaturated fatty acid is provided. The process comprises treating a dry particulate form at a temperature in the range of from 90° C. to 140° C. for a time period of from 30 seconds to 30 minutes or from 1 minute to 10 minutes or from 3 minutes to 7 minutes. | 08-27-2009 |
| 20090232896 | Use of Magnesium Stearate Dihydrate for Lubrication of Solid Pharmaceutical Compositions - The invention provides lubricant compositions comprising magnesium stearate dihydrate. The lubricant compositions may be used to lubricate a variety of bioactive formulations including pharmaceutical compositions. | 09-17-2009 |
| 20090232897 | PHARMACEUTICAL COMPOSITIONS COMPRISING CONJUGATED ESTROGENS - Pre-mix compositions containing conjugated estrogens and a pharmaceutical carrier, and pharmaceutical formulations containing a pre-mix composition. Further, the invention includes processes for preparing the premix compositions and pharmaceutical formulations containing pre-mix compositions. | 09-17-2009 |
| 20090238883 | LIVER-SPECIFIC NANOCAPSULES AND METHODS OF USING - This disclosure describes liver-specific nanocapsules for specifically targeting liver cells. This disclosure also provides methods of using such liver-specific nanocapsules to deliver one or more cargo moieties to the liver cells. | 09-24-2009 |
| 20090238884 | COMPOSITIONS FOR SITE-SPECIFIC DELIVERY OF IMATINIB AND METHODS OF USE - The invention provides an oral formulation for administering to a subject comprising an imatinib compound and an enteric matrix or enteric coating or a combination thereof, whereby at least 80% of the imatinib compound is released in the small intestine of the subject. Methods of using such formulation is also provided. | 09-24-2009 |
| 20090246285 | MONODISPERSED ORGANIC MONOLAYER COATED CALCIUM-CONTAINING NANOPARTICLES - A method for the synthesis of monodispersed, organic-monolayer coated, calcium-containing nanoparticles is presented. A biphasic liquid system comprises an aqueous phase of bare particles and an organic phase containing organic molecules with carboxylic acid end group is mixed. The carboxylic acid group binds to the surface of the calcium-containing particles and the particles are coated with a monolayer of organic molecules. The exposed surface of the coated particles is more hydrophobic than the surface of the bare particle and the particles are extracted to the organic phase. The process changes the geometry of the particles and decreases the size distribution in a population of particles. | 10-01-2009 |
| 20090252805 | Film-Coated and/or Granulated Calcium-Containing Compounds and Use Thereof in Pharmaceutical Compositions - Calcium-containing compounds have been at least partly film-coated and/or granulated with a water-soluble substance and a water-soluble polymeric substance and use of such coated compounds in pharmaceutical compositions. The at least partly film-coated and/or granulated calcium-containing compounds have proved suitable for the preparation of tablets having a very high load of elemental calcium and a conveniently small size. A drug load of about 96% or more is obtained in tablets of the invention that have sufficient mechanical and organoleptic properties. | 10-08-2009 |
| 20090252806 | NANOPARTICULATE TACROLIMUS FORMULATIONS - The present invention is directed to nanoparticulate tacrolimus compositions. The composition comprising tacrolimus particles having an effective average particle size of less than about 2000 nm and at least one surface stabilizer. | 10-08-2009 |
| 20090258074 | MIXTURES OF TANNINS, THEIR PRODUCTION AND USE IN MEDICAMENTS OR AS DISINFECTANTS - The invention relates to a mixture comprising
| 10-15-2009 |
| 20090258075 | Respiratory Drug Condensation Aerosols and Methods of Making and Using Them - Described herein are respiratory drug condensation aerosols and methods of making and using them. Kits for delivering condensation aerosols are also described. The respiratory drug aerosols typically comprise respiratory drug condensation aerosol particles. In some variations the respiratory drug compound is selected from the group consisting of β-adrenergics, methylxanthines, anticholinergics, corticosteroids, mediator-release inhibitors, anti-leukotriene drugs, asthma inhibitors, asthma antagonists, anti-endothelin drugs, prostacyclin drugs, ion channel or pump inhibitors, enhancers, or modulators and pharmaceutically acceptable analogs, derivatives, and mixtures thereof. Methods of treating a respiratory ailment using the described aerosols are also described. In general, the methods typically comprise the step of administering a therapeutically effective amount of respiratory drug condensation aerosol to a person with a respiratory ailment. Methods of forming a respiratory drug condensation aerosol are also described. The methods comprise the steps of vaporizing and condensing a respiratory drug composition. | 10-15-2009 |
| 20090263489 | ANALGESIC AND ANTI-INFLAMMATORY COMPOSITIONS AND METHODS FOR REDUCING, PREVENTING OR TREATING PAIN AND INFLAMMATION - Effective treatments of acute pain and/or inflammation for extended periods of time are provided. Through the administration of an effective amount of sulfasalazine at or near a target site, one can relieve pain caused by diverse sources, including but not limited to spinal disc herniation (i.e. sciatica), spondilothesis, stenosis, discogenic back pain and joint pain as well as pain that is incidental to surgery. When appropriate formulations are provided within biodegradable polymers, this relief can be continued for at least three days. In some embodiments, the relief can be for at least twenty-five days, at least fifty days, at least one hundred days, at least one hundred and thirty-five days or at least one hundred and eighty days. | 10-22-2009 |
| 20090263490 | Microsphere beeswax for mammalian dietary fat mitigation - A device composed of a plurality of beeswax microspheres are contained within a digestible capsule intended for the alimentary tract of the mammal. A method in which the device is ingested orally into the digestive system. A method in which digestive enzymes remove the outside capsule and beeswax microspheres are then dispersed within the gastrointestinal tract. The beeswax microsphere is then able to come in contact with free fats, lipids, cholesterol and lipophillic toxins within the gut and absorb them into the lumen of the microsphere. The beeswax microsphere along with all the fats, lipids, cholesterol and lipophillic toxins contained within the microsphere transits through the remainder of the gut undigested and are eventually excreted from the rectum and bowel by fecal elimination. | 10-22-2009 |
| 20090269411 | MASKING THE TASTE OF POWDERS - Taste-masked powders that can be inhaled or administered orally, a simple method for the production thereof, and the use thereof for applying biologically active substances. | 10-29-2009 |
| 20090269412 | Pharmaceutical formulations for dry powder inhalers - A powder for use in a dry powder inhaler comprises: i) a fraction of fine particle size constituted by a mixture of physiologically acceptable excipient and an additive; ii) a fraction of coarse particles; and iii) at least one active ingredient. The powder is suitable for efficacious delivery of active ingredients into the low respiratory tract of patients suffering from pulmonary diseases such as asthma. In particular, the invention provides a formulation to be administered as dry powder for inhalation which is freely flowable, can be produced in a simple way, is physically and chemically stable and capable of delivering accurate doses and/or high fine particle fraction of low strength active ingredients by using a high- or medium resistance device. | 10-29-2009 |
| 20090274765 | Compositions and Methods for Drug Delivery - The present disclosure is directed to surface-modified particles and to methods of making and using the same. The surface-modified particles comprise a particle core and a coating associated with the particle core, wherein the particle core comprises an active agent, the coating comprises an opsonin, and the surface-modified particle has an average size from about 1 nm to about 2,000 nm. | 11-05-2009 |
| 20090285904 | ENHANCED ANTIMICROBIAL ACTIVITY OF PLANT ESSENTIAL OILS - Antimicrobial compositions based on a combination of plant essential oils of enhanced antimicrobial effectiveness are prepared by adding to the combination of at least two plant essential oils, a small but antimicrobial enhancing effective amount of an enhancer selected from the group consisting of polyionic organic enhancers and polyionic inorganic enhancers. One preferred composition it is a mixture of plant essential oils wherein at least one of the oils is oregano oil. | 11-19-2009 |
| 20090291145 | MICROSPHERE-BASED COMPOSITION FOR PREVENTING AND/OR REVERSING NEW-ONSET AUTOIMMUNE DIABETES - A method is provided that includes using an antisense approach to reverse and/or delay an autoimmune diabetes condition in vivo. The oligonucleotides are targeted to bind to primary transcripts CD40, CD80, CD86 and their combinations. | 11-26-2009 |
| 20090297613 | Nanoparticles Designed for Drug Delivery - The present invention is directed to a method of producing nanoparticles by the miniemulsion method, said nanoparticles being made by adding a defined amount of stabilizer to the reaction system. The present invention is further directed to nanoparticles made by this method and their use for the treatment of diseases and conditions, requiring a pharmaceutical agent to cross one or more physiological barriers, in particular the blood-brain barrier. | 12-03-2009 |
| 20090297614 | NANOPARTICLES FOR PROVIDING IMMUNE RESPONSES AGAINST INFECTIOUS AGENTS - Nanoparticles for providing immune responses for the treatment or prophylaxis of infection by infectious agents such as viruses, parasites, bacteria, prions and fungi are described which comprises a core including metal and/or semiconductor atoms, wherein the core is covalently linked to a plurality of ligands, the ligands including a carbohydrate residue capable of stimulating an innate immune response, a T cell helper peptide and a danger signal. This platform may then be adapted by including one or more further ligands capable of producing a specific response to a target infectious agent. | 12-03-2009 |
| 20090297615 | NANOPARTICLES, METHODS OF MAKING SAME AND CELL LABELING USING SAME - There are disclosed polyhedral superparamagnetic nanoparticles and methods for making and using the nanoparticles. There are also disclosed coated and functionalized forms of the nanoparticles, methods of using nanoparticles and methods of treatment using nanoparticles. | 12-03-2009 |
| 20090297616 | Wound Care Composition - The present invention relates to a wound care composition comprising petrolatum ointment and zinc oxide. The wound care composition is effective at accelerating the healing of a wound resulting from cutaneous surgery and for reducing the appearance of scars. The amount of zinc oxide in the wound care composition is preferably about 1% to about 10%, which produces effective wound healing properties as well as a cosmetically elegant composition having a pleasing feel on the skin. | 12-03-2009 |
| 20090297618 | COMPOSITION BENEFICIAL FOR VISUOGNOSIS PERSISTENCE AND USE THEREOF - The present invention provides a formula food comprising lutien, zeaxanthin, zinc, and selenium beneficial for eye health and its application. The formula food is not only applied for dietary supplement tablets and capsules, but also applied for various formula milk powders, various functional beverages, various baked food. The formula food is conducive to the human eye health, especially beneficial for the improvement of visuognosis persistence of human eyes, helpful for asthenopia remission and the improvement of eye consciousness symptoms. | 12-03-2009 |
| 20090297619 | NANOPARTICULATE ANTICONVULSANT AND IMMUNOSUPPRESSIVE COMPOSITIONS - Described are controlled release nanoparticulate formulations comprising a nanoparticulate agent to be administered and a rate-controlling polymer which functions to prolong the release of the agent following administration. The novel compositions release the agent following administration for a time period ranging from about 2 to about 24 hours or longer. | 12-03-2009 |
| 20090304800 | Dry Coating using Twin-Screw Kneader - An object of the present invention is to provide a dry coating process that can produce a dry-coated preparation in a large amount. A large amount of dry-coated preparation can be produced more efficiently, than by prior-art processes, by a process in which a material containing core particles and a dry binder (lauric acid, myristic acid, or the like) is kneaded in a twin-screw kneader to produce dry binder particles in which the surfaces of the core particles are dry-coated with the dry binder. Further, a dry coating particle production process in which a material containing core particles, a dry binder, and a coating powder is kneaded in a twin-screw kneader can also produce a large amount of dry-coated preparation more efficiently than prior-art processes. | 12-10-2009 |
| 20090311334 | MUCOSAL IMMUNOGENIC SUBSTANCES COMPRISING A POLYINOSINIC ACID - POLYCYTIDILIC ACID BASED ADJUVANT - The present invention provides a polynucleotide adjuvant (PICKCa) composition and methods of use in eliciting an immune response, in particular a mucosal immune response. The polynucleotide adjuvant comprises of a polyriboinosinic-polyri-bocytidylic acid (PIC), at least one antibiotic and at least one positive ion. The present invention also provides an immunogenic composition comprising the polynucleotide adjuvant composition together with other immunogenic compositions such as an antigen (e.g., as in a vaccine). The present invention further contemplates methods of use of such adjuvant compositions, particularly in eliciting an immune response, in particular a mucosal immune response to an antigenic compound. | 12-17-2009 |
| 20090324729 | USE OF SOLID CARRIER PARTICLES TO IMPROVE THE PROCESSABILITY OF A PHARMACEUTICAL AGENT - The invention provides a composition comprising, a compound of formula (I): | 12-31-2009 |
| 20090324730 | METHODS AND COMPOSITIONS FOR THE TREATMENT OF SYMPTOMS OF COMPLEX REGIONAL PAIN SYNDROME - A therapeutic composition for the treatment of the symptoms of complex regional pain syndrome and the method for preparing the therapeutic agents is disclosed. The therapeutic composition is a stable pharmaceutical composition comprising one or more digestive and/or pancreatic enzymes. The therapeutic composition may be manufactured by a variety of encapsulation technologies. Delivery of the therapeutic composition may be made orally, through injection, by adherence of a medicated patch or other method. Further, a method of using fecal chymotrypsin level as a biomarker for the presence of complex regional pain syndrome, or the likelihood of an individual to develop complex regional pain syndrome is disclosed. | 12-31-2009 |
| 20100003335 | MICROPARTICLES FOR DELIVERY TO CELLS AND/OR TISSUE - Delivery of bioactive molecules (BAMs) to organelles, cells, tissues, or animals with high efficiency is desirable. Novel compositions for highly efficient delivery of bioactive molecules by biolistic methods are described. The novel compositions include novel microparticle cores, microparticle core/BAM complexes, microparticle core/nanoparticle complexes and multilayer-microparticle core/BAM complexes. Any one of these may be further modified to include targeting agents. | 01-07-2010 |
| 20100009000 | GRANULE AND PREPARATION METHOD THEREOF - A pharmaceutical granule whose shape is spherical or sphere-like shape with a bulk density of 0.6-1.3 g/ml and a dissolution time of 0.5-5 minutes, which is prepared as follows: mother granules are filled into a fluidized-bed as bed charge; active pharmaceutical ingredients are prepared into a suspension or solution whose viscosity is adjusted to 6.0-9.8 Mpa·S with viscosity adjusting agent; then it is sprayed onto surface of said mother granule to obtain final granule. | 01-14-2010 |
| 20100009001 | NOVEL NANOPARTICLES - The invention provides a composition comprising core-shell nanoparticles, the nanoparticles comprising (a) cationic core material comprising polymer; and (b) a shell material comprising silica. Preferred core materials comprise diblock copolymer micelles comprising one block of dialkylaminoethyl methacrylate units which are partially or fully quaternised and one block of dialkylaminoethyl methacrylate units that remain non-quaternised. The invention also provides a method for the preparation of the said composition, the method involving (a) preparing a cationic core material comprising polymer; and (b) coating the core material with a shell comprising silica by treating the polymer with a silica precursor under ambient conditions. The invention also envisages a composition comprising core-shell nanoparticles which is adapted to facilitate controlled delivery of at least one active agent into a system in response to controlled changes in the pH of the system. | 01-14-2010 |
| 20100009002 | GUAVA TREE EXTRACT INSECT CONTROL - The invention relates to insect control compositions, and more particularly to repellent and attractant compositions that may be used to control insect populations from damaging citrus trees. It has been found that the Asian citrus psyllid, the vector that transmits citrus greening disease, or Huanglongbing (HLB), is attracted to certain compounds in guava tree extracts. The guava-based compounds may be used to attract psyllids to traps to monitor populations and disrupt breeding cycles. | 01-14-2010 |
| 20100009003 | PHARMACEUTICAL PREPARATION TO BE DISPERSED BEFORE ADMINISTRATION - The present invention provides a pharmaceutical preparation to be dispersed before administration which has an adequate viscosity and a suitable flowability even when dispersed in a small amount of water and can be easily administered through an NG tube is provided. Specifically, the pharmaceutical preparation to be dispersed before administration contains active granules containing a pharmaceutically active substance having an average particle diameter of 5 mm or less and a thickening agent, and can be administered through an NG tube by dispersing in water before administration. | 01-14-2010 |
| 20100009004 | INTRAORALLY RAPIDLY DISINTEGRATING TABLET - The present invention provides an intraorally rapidly disintegrating tablet that can be formed using an ordinary apparatus, that has hardness with no practical problem and that disintegrates rapidly with good feeling in the oral cavity. | 01-14-2010 |
| 20100028449 | FERMENTED MILK PRODUCT AND USE THEREOF - The present invention relates to an oral formulation comprising a microcapsule containing bacteria and a fermented milk carrier. There is also provided a method of medical treatment of an inflammatory gastrointestinal disease or disorder in a subject in need thereof, comprising detecting the presence of inflammatory gastrointestinal disease or disorder in the subject, wherein if inflammatory gastrointestinal disease or disorder is detected, then administering the formulation of the present invention to the subject. | 02-04-2010 |
| 20100034891 | TASTE-MASKING SOLID PREPARATION OF PIOGLITAZONE - A solid preparation sufficiently masking the unpleasant taste of pioglitazone or a salt thereof; a solid preparation sufficiently masking the unpleasant taste of pioglitazone or a salt thereof and having superior properties of superior disintegration property in the oral cavity, appropriate preparation strength, long-term preservation stability and the like is provided. The present invention provides a solid preparation comprising particles comprising (i) core particles comprising an excipient, and (ii) pioglitazone or a salt thereof and an acid-soluble polymer both coating the core particles. | 02-11-2010 |
| 20100034892 | TREATMENT FOR BONE FORMATION DISORDERS BY GROWTH FACTOR DELIVERY - It has been discovered that that certain growth factors can delay the ossification of a tissue site, such as a cranial suture, via the promotion of fibroblast differentiation and/or inhibition of osteoblast differentiation. Provided herein are methods for treating bone formation conditions or disorders, such as synostotic conditions, or ectopic mineralization conditions, via administration of compositions comprising connective tissue growth factor (CTGF), and optionally other growth factors or fibroblast or progenitor cells, to a tissue site of a subject in need thereof. | 02-11-2010 |
| 20100034893 | PARTICULATE UV PROTECTION AGENT - The present invention relates to particulate UV protection agents which are obtainable by hydrothermal treatment of a particulate metal oxide and subsequent application of a manganese oxide coating, and to the preparation and use thereof. The present invention furthermore relates to novel compositions, in particular for topical application, which are intended, in particular, for light protection of the skin and/or hair against UV radiation and free-radical-induced stress, and to the use thereof in the above-mentioned cosmetic application. | 02-11-2010 |
| 20100034894 | Use of Sucralose as a Granulating Agent - A method of making a granulation comprising the steps of (a) combining sucralose, a polar solvent, a wettable material and an active agent, thereby forming a mixture; and (b) drying the mixture, thereby forming the granulation. | 02-11-2010 |
| 20100040695 | METHODS FOR PROVIDING NUTRITIONAL PRODUCTS FOR CUSTOMIZED ENERGY INTAKE - Methods utilizing bite-size nutritional products for customized protein intake are provided. In a general embodiment, the present disclosure provides a method of providing nutrition to an athlete. The method comprises providing a bite-size protein-based product and providing personalized guidelines for consuming the bite-size protein-based product. The personalized guidelines provide the recommended amount of the bite-size protein-based product to consume before exercising, during exercising and/or during recovery after exercising based on one or more characteristics of the athlete and/or one or more training regimens of the athlete. | 02-18-2010 |
| 20100047355 | MAGNETIC RESONANCE-DETECTABLE, ULTRASOUND-DETECTABLE AND/OR RADIOPAQUE MICROCAPSULES AND USES THEREOF - The present invention provides a microcapsule for implantation into a mammalian body, comprising: a) at least one cell and/or bioactive agent; and b) a biocompatible semi-permeable membrane encapsulating the at least one cell, wherein the biocompatible semi-permeable membrane comprises: at least one polycationic polymer region, at least one alginate polymer region, and a paramagnetic or superparamagnetic metal that does not participate in the crosslinking of the alginate polymer. The present invention further provides methods of making the microcapsules of this invention and use of the microcapsules of this invention in methods of delivering cells and/or therapeutic agents to a subject and in methods of embolization. | 02-25-2010 |
| 20100047356 | Charge-assembled capsules for phototherapy - Novel phototherapeutic methods and compositions are described herein. Nanoparticle-assembled microcapsules as a new type of delivery vehicle for photosensitive compounds may be synthesized through a two-step assembly process. Charged polymer chains and counterions may be combined with a photosensitive compound to form photosensitive aggregates, and then nanoparticles may be combined with the aggregates to form the microcapsules. The shell may be composed of nanoparticles and/or polymer, and the core interior may contain the photosensitive compound. Formation occurs rapidly (on the order of seconds) and the conditions are very mild (at room temperature, in aqueous solution, and at neutral pH). The microcapsule synthesis is highly suitable as an encapsulation method, particularly for a charged photosensitive molecule like ICG. | 02-25-2010 |
| 20100047357 | COMPOSITIONS FOR TOPICAL APPLICATION COMPRISING A PEROXIDE AND RETINOID - The invention relates to a composition for topical application comprising as an active ingredient a peroxide and a retinoid wherein one of said peroxide and retinoid is in the form of first microparticles comprising a solid particulate matter of the active ingredient coated by a metal oxide layer and the other of said peroxide and retinoid is present in an uncoated free form or in a coated form of the active ingredient. The invention further relates to method for treating a surface condition in a subject using said composition, a method for preparing a composition exhibiting improved stability, and a kit comprising: (a) a first composition comprising a peroxide as a first active ingredient; and (b) a second composition comprising a retinoid as a second active ingredient; at least one of said first and said second active ingredient being coated by a metal oxide layer. | 02-25-2010 |
| 20100068289 | SPHERICAL MICROCAPSULES COMPRISING GLP-I PEPTIDES, THEIR PRODUCTION AND USE - The present invention provides spherical microcapsules comprising at least one surface coating and a core, wherein the at least one surface coating comprises cross-linked polymers, and wherein the core comprises cross-linked polymers and cells capable of expressing and secreting a GLP-1 peptide, a fragment or variant thereof or a fusion peptide comprising GLP-1 or a fragment or variant thereof. The present application is furthermore directed to methods for production of these spherical microcapsules and to the use of these microcapsules e.g. in the treatment of type 2 diabetes, weight disorders and diseases or conditions associated thereto, neurodegenerative disorders and diseases or conditions associated thereto, or for the treatment of disorders and diseases or conditions associated to apoptosis. | 03-18-2010 |
| 20100068290 | COATED PELLETS - Coated pellets which comprise an active pharmaceutical ingredient that is poorly soluble in water, release at least 80% of the active ingredient under in vitro conditions in phosphate buffer at pH 5.0 after 30 minutes and
| 03-18-2010 |
| 20100074960 | HIGH-LOADING, CONTROLLED-RELEASE MAGNESIUM ORAL DOSAGE FORMS AND METHODS OF MAKING AND USING SAME - Disclosed are high-loading, controlled-release dosage forms for oral administration of magnesium salts. For example, an oral dosage form can comprise from about 80% to about 95% magnesium lactate and one or more components. As another example, an oral dosage form can comprise at least about 50% magnesium salt and exhibit a controlled release dissolution profile. Also disclosed are methods for making controlled release dosage forms for oral administration of a therapeutically effective amount of magnesium salt to a mammal. Also disclosed are methods for treating a disorder characterized by magnesium deficiency and methods for preventing or alleviating low magnesium levels. This abstract is intended as a scanning tool for purposes of searching in the particular art and is not intended to be limiting of the present invention. | 03-25-2010 |
| 20100086610 | VAULT AND VAULT-LIKE CARRIER MOLECULES - A method of using vaults as carrier molecules to deliver one or more than one substance to an organism, or to a specific tissue or to specific cells, or to an environmental medium. A vault-like particle. A method of preventing damage by one or more than one substance to an organism, to a specific tissue, to specific cells, or to an environmental medium, by sequestering the one or more than one substance within a vault-like particle. A method of delivering one or more than one substance or a sensor to an organism, to a specific tissue, to specific cells, or to an environmental medium. According to another embodiment of the present invention, there is provided a method of making vault-like particles, and making vault-like particles comprising one or more than one substance, or one or more than one sensor. | 04-08-2010 |
| 20100086611 | Method for Treating Infectious Organisms Normally Considered to be Resistant to an Antimicrobial Drug - The present invention relates to compositions of submicron- to micron-size particles of antimicrobial agents. More particularly the invention relates to a composition of an antimicrobial agent that renders the agent potent against organisms normally considered to be resistant to the agent. The composition comprises an aqueous suspension of submicron- to micron-size particles containing the agent coated with at least one surfactant selected from the group consisting of: ionic surfactants, non-ionic surfactants, biologically derived surfactants, and amino acids and their derivatives. The particles have a volume-weighted mean particle size of less than 5 μm as measured by laser diffractometry. | 04-08-2010 |
| 20100086612 | COATED CARRIERS - The present invention relates to substantially free flowing powder products as well as preparation thereof. The powder product comprises coated carriers with excellent functional properties. The powder products can be produced in a simple and cost efficient way. | 04-08-2010 |
| 20100092569 | PRODUCT BASED ON CONJUGATED LINOLEIC ACID AND A METHOD FOR THE MANUFACTURE THEREOF - A product based on conjugated linoleic acid (CLA) comprises an inner core in which the conjugated linoleic acid is substantially concentrated as well as a coating for covering and protecting the inner core; the coating in turn comprises a fraction greater than 80% by weight relative to the coating of a lipid matrix formed by glycerides of C16, C18, C20 and C22 saturated fatty acids. | 04-15-2010 |
| 20100092570 | CONTROLLED RELEASE OXYCODONE COMPOSITIONS - A method for substantially reducing the range in daily dosages required to control pain in approximately 90% of patients is disclosed whereby an oral solid controlled release dosage formulation having from about 10 to about 40 mg of oxycodone or a salt thereof is administered to a patient. The formulation provides a mean maximum plasma concentration of oxycodone from about 6 to about 60 ng/ml from a mean of about 2 to about 4.5 hours after administration, and a mean minimum plasma concentration from about 3 to about 30 ng/ml from about 10 to about 14 hours after repeated “q12h” (i.e., every 12 hour) administration through steady-state conditions. Another embodiment is directed to a method for substantially reducing the range in daily dosages required to control pain in substantially all patients by administering an oral solid controlled release dosage formulation comprising up to about 160 mg of oxycodone or a salt thereof, such that a mean maximum plasma concentration of oxycodone up to about 240 ng/ml from a mean of up to about 2 to about 4.5 hours after administration, and a mean minimum plasma concentration up to about 120 ng/ml from about 10 to about 14 hours after repeated “q12h” (i.e., every 12 hour) administration through steady-state conditions are achieved. Controlled release oxycodone formulations for achieving the above are also disclosed. | 04-15-2010 |
| 20100092571 | MICROCAPSULES HAVING MULTIPLE SHELLS AND METHOD FOR THE PREPARATION THEREOF - Single-core and multi-core microcapsules are provided, having multiple shells, at least one of which is formed of a complex coacervate of two components of shell materials. The complex coacervate may be the same or different for each shell. Also provided are methods for making the microcapsules. | 04-15-2010 |
| 20100098769 | Synthetic Peptides Reducing or Removing Bags Formed Under the Lower Eye Contour and Their Use in Cosmetic or Dermopharmaceutical Compositions - The invention relates to peptides of general formula (I): | 04-22-2010 |
| 20100104652 | Use of advanced nanomaterials for increasing sepecific cell functions - Disclosed herein are methodologies and compositions for enhancing cellular functions, which can be used in a variety of biological applications. | 04-29-2010 |
| 20100104653 | Nanoparticle-Coated Medical Devices And Formulations For Treating Vascular Disease - Nanoparticle-coated medical devices, nanoparticle-containing formulations and methods of using for treating a vascular disease are disclosed. The method for treating a vascular disease includes providing a formulation comprising a plurality of nanoparticles having a density different from that of blood and further comprising one or more bioactive agents encapsulated within, adhered to a surface of or integrated into the structure of the nanoparticles; and administering a therapeutically effective amount of the formulation to a vascular disease locale in a patient. | 04-29-2010 |
| 20100112072 | Controllable Virus/Protein Assemblies and Methods of Making the Same - Methods of forming a bionanocomposite defining a shell and a core are generally provided along with the bionanocomposites themselves. The method includes non-covalently attaching biomacromolecules about a polymeric core such that the biomacromolecules cover at least about at least about 50% of the surface area of the polymeric core to form a shell. The polymeric core includes a polymer having pyridine functional groups. In one particular embodiment, the biomacromolecules can be attached to the polymeric core by combining an organic solution containing the polymer in an organic solvent with an aqueous solution containing the biomacromolecules to form an emulsion, mixing the emulsion, and removing the organic solvent. | 05-06-2010 |
| 20100119610 | PACKAGED PEGYLATED GOLD NANOPARTICLES - Gold nanoparticles conjugated to polyethylene glycol and active binding molecules such as antibodies, proteins, lectins and DNA are suspended in a water vehicle at concentration from 10 | 05-13-2010 |
| 20100124572 | MAGNETIC MICROSPHERE AND METHOD OF FORMING A MICROSPHERE - The microspheres have many possible applications including smart drug delivery, breaking and damper devices. In one arrangement, a microsphere comprises a shell | 05-20-2010 |
| 20100129458 | COMPOSITIONS AND METHODS FOR INHIBITING REPRODUCTION IN TADPOLE SHRIMP - Compositions, methods for forming compositions, and methods for using compositions for reducing tadpole shrimp populations in temporary pools using the hormone methyl farnesoate. Compositions can include a dry base having a bulk ingredient, a viscous additive having an oily compound, a saline solution, and preparation having an effective amount of phospholipid-encapsulated methyl farnesoate. The composition can be formed by combining the dry base and the viscous additive into a first mixture and adding all or a portion of the saline solution to form a crumbly consistency. Then, the methyl farnesoate preparation can be added. The composition may then be formed into a plurality of particles having shapes and sizes for consumption by the tadpole shrimp. In use, the particles may be dispensed prior to, or immediately after, the temporary pools are flooded with water. The particles may be formed such that they can withstand exposure to water for between about 4 to about 14 days. | 05-27-2010 |
| 20100136122 | Oral Preparation Comprising Pioglitazone - The present invention provides an oral preparation sufficiently masking the bitter taste of pioglitazone and a salt thereof. The present invention provides an oral preparation containing pioglitazone or a salt thereof and alkali metal chloride. | 06-03-2010 |
| 20100136123 | Microcapsule Sheet - In order to heighten the density of microcapsules and facilitate handling by the unit composed of microcapsules in a given amount smaller than in the whole sheet, a microcapsule sheet which comprises a substrate constituted of an edible film and microcapsules each obtained by surrounding a core layer with a first shell film and a second shell film, the microcapsules being arranged according to a given pattern so as to be arranged only in those regions of the substrate which are separated from each other. | 06-03-2010 |
| 20100136124 | NANOPARTICLE-COATED CAPSULE FORMULATION FOR DERMAL DRUG DELIVERY - A method and formulation for the delivery of an active substance to the skin (epidermis, including the stratum corneum and viable epidermis, and dermis) of a subject. The formulation comprises oil-based or aqueous droplets comprising the active substance within a coating of nanoparticles, particularly silica nanoparticles. The active substance may be suitable for the treatment of a disease or condition which is localised, or at least partially localised, to the skin (eg skin cancer, psoriasis, eczema, infections including bacterial and fungal infections, acne, dermatitis, inflammation, and rheumatoid arthritis). | 06-03-2010 |
| 20100143482 | METHOD OF PRODUCING MICROCAPSULES - It is intended to provide a method whereby various kinds of microcapsules, which are usable in, for example, a gene vector, can be produced in a small amount. This production method comprises: feeding a fluid containing a substance to be encapsulated into at lease one ( | 06-10-2010 |
| 20100143483 | PHARMACEUTICAL COMPOSITIONS - Provided herein is a pharmaceutical composition comprising an antagonist, an agonist, a seal coat, and a sequestering polymer, wherein the antagonist, agonist, seal coat and at least one sequestering polymer are all components of a single unit, and wherein the seal coat forms a layer physically separating the antagonist from the agonist from one another. Methods for manufacturing such a pharmaceutical composition are also provided. | 06-10-2010 |
| 20100151033 | OCTREOTIDE DEPOT FORMULATION WITH CONSTANTLY HIGH EXPOSURE LEVELS - The present invention relates to sustained release formulations comprising as active ingredient octreotide or a pharmaceutically-acceptable salt thereof and two different linear polylactide-co-glycolide polymers (PLGAs). | 06-17-2010 |
| 20100166870 | Method for Coating Nanoparticles - A method of coating nanoparticles comprising subjecting nanoparticles, a coating precursor and one or more reagents to shear, wherein the coating precursor and the one or more reagents react to provide a coating on the nanoparticles. | 07-01-2010 |
| 20100172998 | PROCESS FOR PREPARING MICROPARTICLES THROUGH PHASE INVERSION PHENOMENA - A process for preparing nanoparticles and microparticles is provided. The process involves forming a mixture of a polymer and a solvent, wherein the solvent is present in a continuous phase and introducing the mixture into an effective amount of a nonsolvent to cause the spontaneous formation of microparticles. | 07-08-2010 |
| 20100172999 | Polynuclear Microcapsules - A process is disclosed for preparing polynuclear microcapsules by polymerizing an alkoxysilane at the oil/water interface of a multiple phase emulsion to form a suspension of polynuclear microcapsules. Also disclosed are polynuclear micro-capsules optionally comprising a hydrophilic active and uses thereof. | 07-08-2010 |
| 20100173000 | Controlled release implantable dispensing device and method - A dispensing device having a polymer which is combined with a therapeutic agent in the form of a microparticle or nanoparticle which is “hyper-compressed” to form a controlled release dispensing device and methods of locally administering a therapeutic agent using said microparticles. | 07-08-2010 |
| 20100178351 | HYDROPHILIZED SUBSTRATE, DISPERSION, AND MAKING METHOD - A powder is hydrophilized by treating surfaces of particles with a hydrolyzable silyl group-containing acid anhydride compound, dispersing the surface treated particles in water, adding a base, and heating the dispersion for thereby hydrolyzing the acid anhydride moiety to open its ring and neutralizing the resultant carboxylic acid with the base. The hydrophilized powder is fully dispersible in aqueous media. | 07-15-2010 |
| 20100189797 | ORAL ANTIDEPRESSANT FORMULATION - Oral antidepressant formulation comprising a means for controlling the release of the pharmaceutically acceptable antidepressant active agent selected from the group consisting of SSRI agents, SNRIs (serotonin noradrenaline reuptake inhibitors), CRF antagonists, NK1 antagonists, NK2 antagonists, NK3 antagonists and combinations thereof, with respect to the release of the compound selected from the group consisting of acetylsalicylic acid, salts and esters of acetylsalicylic acid, diaspirin, and mixtures thereof. | 07-29-2010 |
| 20100189798 | CONTROL OF ERWINIA AMYLOVORA WITH VINYLGLYCINES AND BACTERIA THAT PRODUCE VINYLGLYCINES - This disclosure relates to methods of controlling | 07-29-2010 |
| 20100196491 | PROTEIN VACCINES AGAINST POXVIRUSES - The invention described here entails a protein vaccine against poxviruses which contains at least two purified recombinant monkeypox virus proteins or peptides. The proteins or peptides are encoded by the open reading frames of the monkeypox ortholog genes M1R, A35R, A29L B6R, and orthologs of these proteins or peptides having 90% identity. The invention also entails a vaccine protocol against poxvirus whereby a vaccine is vaccinated with a first vaccine made up of a nucleic acid vaccine of three or more poxvirus virus genes, and subsequently vaccinated with at least one other booster vaccine made up of two or more poxvirus virus proteins. | 08-05-2010 |
| 20100196492 | ELECTROSTATIC COATING OF PARTICLES FOR DRUG DELIVERY - A system for electrostatically coating particles is provided. The system is particularly well suited for coating charged drug delivery particles (e.g., nanoparticles, microparticles) with a coating of opposite charge. The coating may include a targeting moiety such as a small molecule ligand, peptide, protein, aptamer, etc. The coated particles are biodegradable and/or biocompatible, have a near neutral zeta (ξ) potential, and are stable in serum. The invention also provides pharmaceutical compositions and kits including the inventive coated particles. Methods of preparing and using the inventive particles are also included. | 08-05-2010 |
| 20100196493 | METHOD FOR PRODUCING STABLE POWDER COMPOSITIONS - The invention relates to the use of at least one viscous compound, the viscosity of which is greater than 5 Pa·s | 08-05-2010 |
| 20100196494 | ENHANCED ANTIMICROBIAL ACTIVITY COMPOSITIONS OF BLENDS OF PLANT ESSENTIAL OILS - Antimicrobial compositions based on a combination or blend of plant essential oils is of enhanced antimicrobial effectiveness; by adding to the combination of at least two plant essential oils, and preferably adds a small but antimicrobial enhancing effective amount of an enhancer selected from the group consisting of polyionic organic enhancers and polyionic inorganic enhancers. One preferred blended oil composition is a mixture of plant essential oils wherein at least one of the oils is oregano oil. The oil blend is used as a major component in the finished product anti-microbial. | 08-05-2010 |
| 20100203147 | Viruses for the Treatment of Cellular Proliferative Disorders - Methods for treating cell proliferative disorders by administering virus to proliferating cells having an activated Ras-pathway are disclosed. The virus is administered so that it ultimately directly contacts proliferating cells having an activated Ras-pathway. Proliferative disorders include but are not limited to neoplasms. The virus is selected from modified adenovirus, modified HSV, modified vaccinia virus and modified parapoxvirus orf virus. Also disclosed are methods for treating cell proliferative disorders by further administering an immunosuppressive agent. | 08-12-2010 |
| 20100209514 | Method of treating pain by administering 24 hour oral oploid formulations exhibiting rapid rate of initial rise of plasma drug level - Patients are treated with 24-hour oral sustained release opioid formulations which, upon administration, provide an initially rapid opioid absorption such that the minimum effective analgesic concentration of the opioid is more quickly achieved. These sustained release opioid formulations include an effective amount of at least one retardant material to cause said opioid analgesic to be released at a such a rate as to provide an analgesic effect after oral administration to a human patient for at least about 24 hours, and are characterized by providing an absorption half-life from 1 to about 8 hours. A method of titrating a human patient utilizing these sustained release opioid formulations is also disclosed. | 08-19-2010 |
| 20100209515 | ELECTRICITY-GENERATING PARTICULATES AND THE USE THEREOF - The invention features a galvanic particulate including a first conductive material and a second conductive material, wherein both the first conductive material and the second conductive material are exposed on the surface of the particulate, wherein the particle size of the particulate is from about 10 nanometers to about 100 micrometers, wherein the second conductive material comprises from about 0.01 percent to about 10 percent, by weight, of the total weight of the particulate, and wherein the difference of the standard potentials of the first conductive material and the second conductive material is at least about 0.2 V. | 08-19-2010 |
| 20100209516 | Triggered Drug Release Via Physiologically Responsive Polymers - A drug delivery system, product and method which effectuates delivery of appropriate amounts of a pharmaceutically active agent only upon stimulus of a physiological agent released during a disease event are described. A polymer that can bind to a specific biological stimulus and respond with a specific response is included. The response may be release of a pharmaceutical agent, an optical signal or a change in physical properties of the polymer. The design of associative polymers that are held together using temporary bonds which will dissolve, break apart or swell in the presence of the specific stimulus are described. One embodiment includes a reversible response to a biological stimulus. | 08-19-2010 |
| 20100209517 | ANALGESIC AND ANTI-INFLAMMATORY COMPOSITIONS COMPRISING DOMPERIDONE AND METHODS OF USING SAME - The present invention provides a method for eliciting an onset hastened analgesic and anti-inflammatory response and combating nausea in acute migraine attacks. This method comprises administering a pharmaceutical composition comprising more than one active ingredient, wherein said more than one active ingredient consist essentially of:
| 08-19-2010 |
| 20100215756 | PHARMACEUTICAL PREPARATIONS CONTAINING HIGHLY VOLATILE SILICONES - The subject of the present invention is a transdermal preparation containing pharmaceutically active ingredient, wherein the particles of the active ingredient are coated with highly volatile silicones or a mixture thereof, and these coated particles are dispersed in a gel or cream base. The volatile silicone component is hexamethyldisiloxane and/or octamethyltrisiloxane and/or decamethylpentacyclo-siloxane. A further subject of the present invention is a method for the preparation of such pharmaceutical compositions. | 08-26-2010 |
| 20100221349 | NUCLEIC ACID CONSTRUCTS - A nucleic acid construct comprising a chimeric promoter sequence and a cloning site for insertion of a coding sequence in operable linkage with the chimeric promoter, wherein the chimeric promoter sequence comprises: (a) a Hcmv immediate early promoter sequence; (b) exon 1 and at least a part of exon 2 of the hCMV major immediate early gene; and (c) a heterologous intron provided in place of the intron A region of the hCMV major immediate early gene. | 09-02-2010 |
| 20100221350 | DERMATOLOGICAL COMPOSITIONS COMPRISING VITAMIN D LIPID VESICLES - Dermatological/pharmaceutical compositions contain lipid vesicles dispersed in a hydrophilic phase, such vesicles including at least one vitamin D compound and particularly calcitriol, and are useful for the treatment of dermatological pathologies, notably psoriasis. | 09-02-2010 |
| 20100226994 | GRANULE, TABLET AND METHODS FOR PRODUCING THE SAME - A granule comprising a carrier composed of porous calcium silicate; a functional substance which is an oily liquid or a low-melting solid and a water-soluble antioxidizing agent, which are adsorbed on the carrier; and a granulating component. The problem to be solved is to improve storage stability of a powdered or tableted functional substance, for example, vitamin A to the level causing no problem in practical use. | 09-09-2010 |
| 20100233274 | MEANS AND METHODS FOR ENHANCING WEIGHT GAIN IN POULTRY - The present invention relates to means and methods for enhancing intestinal function in poultry, leading to an increase in food conversion ratio and in total weight gain. Particularly, the present invention relates to insulin-containing feed formulations enhancing intestinal function and weight gain in poultry. | 09-16-2010 |
| 20100233275 | PROCESS FOR PREPARING LIPID NANOPARTICLES - The present invention relates to a method for use in the preparation of nanocapsules which have a liquid lipid core and a solid lipid shell and which are loaded with at least one active agent, wherein said method comprises at least the steps consisting in providing a microemulsion formulated by phase inversion of an emulsion, providing a second composition, distinct from said microemulsion and completely or partly formed from at least one active agent, placing said microemulsion in the presence of said second composition under conditions suitable for the interaction of said active agent with said microemulsion and annealing said microemulsion having interacted with said active agent in such a way as to obtain said nanocapsules. The invention also relates to a corresponding kit. | 09-16-2010 |
| 20100239679 | ENHANCED RETENTION CAPABILITIES THROUGH METHODS COMPRISING SURFACE TREATMENT OF FUNCTIONAL PARTICULATE CARRIER MATERIALS, AND FUNCTIONAL PARTICULATE CARRIER MATERIALS MADE THEREFROM - Functional particulate carrier materials with enhanced retention capabilities are described. The materials comprise at least one functional particulate carrier material subjected to at least one surface treatment, and at least one active ingredient. The at least one surface treatment may be at least one physical surface treatment and/or at least one chemical surface treatment with at least one surface treating agent. The at least one active ingredient may be a biocide, a fungicide, a mildewcide, an antibiotic, an insecticide, a preservative, or an antimicrobial agent. Methods for enhancing the performance of plastics and liquid-based media, for example, coatings and paints, are also described by increasing the retention factors of active ingredients in those plastics and media through surface treatment of functional particulate carrier materials. | 09-23-2010 |
| 20100247659 | PHENYLPHTHALIMIDE ANALOGS FOR TREATING DIABETIC MACULAR EDEMA - Novel methods are provided to prevent blindness associated with diabetic macular edema by administration of a phenylphthalimide analog. Additionally, sustainability of the effect of administration of the phenylphthalimide analog is improved via encapsulation with poly(lactic-co-glycolic acid) nanoparticles. Finally, a novel method for synthesizing (2,6-diisopropylphenyl)-5-amino-1H-isoindole-1,3-dione is disclosed. | 09-30-2010 |
| 20100247660 | Microcapsules Containing Active Ingredients - The present invention relates to a microcapsule particle composition that is composed of a sol-gel material. The microcapsule particle composition is well suited for personal care and cleaning products. | 09-30-2010 |
| 20100247661 | Method of Drug Formulation Based on Increasing the Affinity of Active Agents for Crystalline Microparticle Surfaces - Methods are provided for promoting the adsorption of an active agent to microparticles by modifying the structural properties of the active agent in order to facilitate favorable association to the microparticle. | 09-30-2010 |
| 20100255107 | COMPOSITION EXHIBITING ENHANCED FORMULATION STABILITY AND DELIVERY OF TOPICAL ACTIVE INGREDIENTS - A therapeutic, cosmetic or cosmeceutic composition for topical application, capable of stabilizing an active ingredient and delivering the active ingredient, comprising a plurality of microcapsules having a core-shell structure. The microcapsules have a diameter of approximately 0.1 to 100 micron. The core of each microcapsule includes at least one active ingredient, and is encapsulated within a microcapsular shell. The shell is comprised of at least one inorganic polymer obtained by a sol-gel process, and the shell protects the active ingredient before topical application and is designed to release the active ingredient from the microcapsules following application. The composition is useful in encapsulating active ingredients, such as benzoyl peroxide, that are unstable in other formulation, or are irritating to the skin. | 10-07-2010 |
| 20100260856 | CORE PARTICLE FOR PHARMACEUTICAL PREPARATION - The present invention provides a core particle for a pharmaceutical preparation which features the requisite properties of a core particle, and which has enough chemical stability, and in which reactivity with the drug (an active pharmaceutical ingredient) is limited or prevented. More specifically, the present invention relates to a core particle wherein a film containing an active pharmaceutical ingredient can be formed on the surface thereof, and (1) the core particle comprises a pharmaceutically acceptable inorganic material, (2) the inorganic material is poorly soluble in water, and (3) pH of a solution of the inorganic material is 5 to 8. | 10-14-2010 |
| 20100266701 | ANTI-MISUSE MICROPARTICULATE ORAL DRUG FORM - The invention relates to solid microparticulate oral dosage forms having a composition that prevents the misuse of the active pharmaceutical ingredient (API) contained therein. The aim of the invention is to prevent the improper use of solid oral drugs for any use other than the therapeutic use(s) officially approved by the appropriate public health authorities. Another aim of the invention is to provide novel analgesic drugs which can be used to: prevent the misuse of, and addiction to certain analgesics and/or to control plasma concentration variability and/or to facilitate oral; administration; and/or to combine analgesics with one another and/or with one or more active ingredients in the same oral form. More specifically, the invention relates to a solid oral drug form comprising anti-misuse means and at least one active ingredient, which is characterized in that: at least part of the active ingredient is contained in microparticles; and the anti-misuse means comprise anti-crushing means (a) which enable the microparticles of the active ingredient to resist crushing, such as to prevent the misuse thereof. According to the invention, the drug form can also comprise means (b) for preventing the misuse of the active ingredient following a possible liquid extraction process. | 10-21-2010 |
| 20100266702 | Particles containing an active agent in the form of a co-precipitate - The invention relates to particles containing an active agent in the form of a co-precipitate to a method for producing said particles and to pharmaceutical forms containing said particles. | 10-21-2010 |
| 20100266703 | NOVEL POWDER AND ITS METHOD OF MANUFACTURE - The invention relates to a novel powder, it's method of manufacture and the use thereof in powder material processing, particularly in the manufacture of components formed from compacted powder e.g. discs, monoliths, layers or tablets. The powders comprise coated host particles wherein over 70% of the mass of the powder comprises coated particles smaller than 100 microns. The powders have particular application in the pharmaceutical industry and the technology described can be used to control the properties of active pharmaceutical ingredients. The powders ( | 10-21-2010 |
| 20100266704 | OCTREOTIDE DEPOT FORMULATION WITH CONSTANTLY HIGH EXPOSURE LEVELS - The present invention relates to sustained release formulations comprising as active ingredient octreotide or a pharmaceutically-acceptable salt thereof and two different linear polylactide-co-glycolide polymers (PLGAs). | 10-21-2010 |
| 20100272816 | MICROCAPSULES COMPRISING LIVER CELLS AND ERYTHROPOIETIN, METHODS FOR PREPARING SAID MICROCAPSULES AND METHODS FOR TREATING A PATIENT COMPRISING APPLYING SAID MICROCAPSULES TO THE PATIENT - Microcapsules containing a capsule shell encapsulating a suspension of a therapeutically effective amount of liver cells in physical contact to a liver cell stimulating amount of erythropoietin. | 10-28-2010 |
| 20100272817 | Compositions and Methods for Treating Atherosclerosis - Reverse peptides and mimetics of a mammalian serum amyloid A isoform 2.1 (SAA2.1) domain or a portion thereof and compositions and pharmaceutical compositions thereof are provided that enhance the effect on macrophage cholesterol ester hydrolase activity. Methods of using these reverse peptides, mimetics thereof and compositions in the treatment and/or prevention of atherosclerosis as well as coronary heart disease and cardiovascular disease are also provided. | 10-28-2010 |
| 20100278923 | Functional nanoparticle-based antibiotics and preparation method thereof - The present invention is related to a novel functional nanoparticle-based antibiotics and preparation method thereof, especially related to an antibiotics-modified nanoparticle. The functional nanoparticle-based antibiotics according to the present invention can be used as the affinity probes and the photothermal agents to effectively inhibit the cell growth of pathogenic bacteria under NIR irradiation. | 11-04-2010 |
| 20100285141 | COMPOSITIONS AND METHODS FOR ENHANCING THE ACTIVITY OF PODOPHYLLOTOXIN - A method of increasing an activity of a podophyllotoxin or a derivative thereof is disclosed. The method comprises contacting the podophyllotoxin or the derivative with a liquid composition having a liquid and nanostructures, each of the nanostructures comprising a core material of the nanometric size surrounded by an envelope of ordered fluid molecules, the core material and the envelope of ordered fluid molecules being in a steady physical state, thereby increasing the activity of the podophyllotoxin or the derivative. Pharmaceutical compositions comprising same and uses thereof are also disclosed. | 11-11-2010 |
| 20100310666 | Delivery of Functional Compounds - Functional ingredients including an esterified component and microencapsulated in an enteric matrix to increase the microencapsulation efficiency and reduce undesired organoleptic properties of the microencapsulated material while providing a desired release rate and ester hydrolysis rate, the process including forming an emulsion in water and titrating the emulsion with a precipitating agent to produce a particulate precipitate. | 12-09-2010 |
| 20100323023 | COMPOSITION FOR THE TREATMENT OF A DETACHED RETINA AND METHOD OF PRODUCTION THEREOF - The present invention relates to a composition for use in the treatment of a detached retina, comprising a dispersion of nanoparticles in a liquid, wherein the nanoparticles have a specific gravity which is higher than that of the liquid and the individual refractive indices of the nanoparticles and the liquid are substantially similar to one another. The present invention also relates to a composition for use in the treatment of a detached retina, comprising a dispersion of silica nanoparticles in a liquid, a method and kit of parts for producing the compositions and a method of treating a detached retina. | 12-23-2010 |
| 20100330187 | CAPSICUM FOOD ADDITIVE AND USES THEREOF - The invention relates to a food additive that includes, relative to the total weight thereof: about 3.5 wt % of | 12-30-2010 |
| 20110003002 | SUSTAINED RELEASE FORMULATION COMPRISING OCTREOTIDE AND THREE LINEAR POLYLACTIDE-CO-GLYCOLIDE POLYMERS - The present invention relates to sustained release formulations comprising as active ingredient octreotide or a pharmaceutically-acceptable salt thereof and three different linear polylactide-co-glycolide polymers (PLGAs). | 01-06-2011 |
| 20110003003 | MAGNETIC CELLS FOR LOCALIZING DELIVERY AND TISSUE REPAIR - Normal or genetically modified cell(s) having magnetic nanoparticle(s) bound (affixed) to their surfaces and methods of delivery to target tissues, e.g. for treatment of disease and or injury. | 01-06-2011 |
| 20110008449 | Human Specific Escherichia Coli Strains - The present invention relates to human specific | 01-13-2011 |
| 20110008450 | Slow Release Compositions - The present invention relates to the provision of micron or sub-micron sized particles formed from one or more water-soluble crystals comprising a surface coating comprising one or more bioactive molecules wherein the particles are prepared such that in use the release of the bioactive molecule(s) is/are delayed and/or continually released over a period of time. Processes for the preparation of said particles, as well as the particles themselves are described, as well as uses of the particles. | 01-13-2011 |
| 20110008451 | COMPOSITIONS AND METHODS FOR CONTROLLED DELIVERY OF INHIBITORY RIBONUCLEIC ACIDS - Polymeric nanoparticles encapsulating inhibitory ribonucleic acids (RNAs) and methods of their manufacture and use are provided. Advantageous properties of the nanoparticles include: 1) high encapsulation efficiency of inhibitory RNAs into the nanoparticles, 2) small size of the nanoparticles that increases cell internalization, and 3) sustained release of encapsulated inhibitory RNAs by the nanoparticles that allows for administration of an effective amount of inhibitory RNAs to cells or tissues over extended periods of time. Encapsulation efficiency of inhibitory RNAs into the nanoparticles is greatly increased by complexing the inhibitory RNAs to polycations prior to encapsulation. Methods of using the polymeric nanoparticles for treating or inhibiting diseases or disorders are provided. | 01-13-2011 |
| 20110014295 | METHOD OF DETERMINING THE WEIGHT OF THE COATING TO BE APPLIED TO FORM A CONTROLLED RELEASE DOSAGE FORM - A method of coating spherical particles of a beta blocker compound which is based on
| 01-20-2011 |
| 20110014296 | Drug Delivery Nanodevice, its Preparation Method and Uses Thereof - Nanodevice and method for in vivo monitoring and release of drugs are provided. The disclosed nanodevice is characterized in having a drug-loaded nanosphere that is capable of releasing the encapsulated drugs upon magnetically stimulation. The nanodevice may also be used as a contrast agent for in vivo imaging and monitoring the concentration and distribution of the released drugs and/or active compounds injected separately into a target site of a subject. | 01-20-2011 |
| 20110027373 | METHODS AND COMPOSITIONS FOR MODULATING SIALIC ACID PRODUCTION AND TREATING HEREDITARY INCLUSION BODY MYOPATHY - According to certain embodiments of the present invention, methods for modulating the production of sialic acid in a system are provided, which comprise providing the system with a wild-type GNE-encoding nucleic acid sequence. According to such embodiments, the system may comprise a cell, muscular tissue, or other desirable targets. Similarly, the present invention encompasses methods for producing wild-type GNE in a system that comprises a mutated endogenous GNE-encoding sequence. In other words, the present invention includes providing, for example, a cell or muscular tissue that harbors a mutated (defective) GNE-encoding sequence with a functional wild-type GNE encoding sequence. | 02-03-2011 |
| 20110027374 | CAPECITABINE RAPIDLY DISINTEGRATING TABLETS - There is provided a film coated pharmaceutical composition comprising 5′-deoxy-5-fluoro-N-[(pentyloxy)-carbonyl]-cytidine (capecitabine) and at least one disintegrant selected from the group comprising of crospovidone (particle size <15-400μ), croscarmellose sodium, sodium starch glycolate, low-substituted hydroxypropylcellulose, Ludiflash® or any combination of these, together with other pharmaceutically acceptable excipients to form a rapidly disintegrating tablet. | 02-03-2011 |
| 20110038939 | THERAPEUTIC STABLE NANOPARTICLES - Stable colloid nanoparticles comprising poorly soluble drugs are disclosed, as well as methods of making and methods of using such nanoparticles, e.g., as therapeutics and diagnostics. | 02-17-2011 |
| 20110045087 | POROUS BIOCOMPATIBLE POLYMER MATERIAL AND METHODS - Embodiments described include devices and methods for forming a porous polymer material. Devices disclosed and formed using the methods described include a spacer for spinal fusion, craniomaxillofacial (CMF) structures, and other structures for tissue implants. | 02-24-2011 |
| 20110045088 | INTRANASAL GRANISETRON AND NASAL APPLICATOR - Formulations and methods of manufacture are provided for granisetron dry powder compositions suitable for intranasal administration. Also provided are methods of use for preventing or controlling emesis and other diseases and disorders and devices, compositions, and methods for nasal delivery of therapeutic formulations. Devices for delivery of dry powder formulations are also provided. Devices can be single-use devices. | 02-24-2011 |
| 20110045089 | VITAMIN K3 DERIVATIVE / NSA FORMULATION - The present invention discloses highly stabilized nicotinamide (NA) formulated vitamin K3 derivative particles, whereby the NA forms a physical protective layer (both continuous and discontinuous) leading to highly stabilized vitamin K3 derivative particles, as well as a process for their production. | 02-24-2011 |
| 20110045090 | FORMULATIONS OF FLIBANSERIN - The present invention provides pharmaceutical release systems comprising an therapeutically effective amount of flibanserin. | 02-24-2011 |
| 20110045091 | ANTI-ANGIOGENESIS, ANTICANCER PROLIFERATION PROPERTIES OF LYMPHOCYTIC-DERIVED MICROPARTICLES - Recent studies have demonstrated that lymphocyte-derived microparticles (LMPs) impair endothelial cell function. The present invention concerns the use of LMPs in the regulation of angiogenesis or diseases such as cancer or retinopathy of prematurity (ROP). Having long been considered as cellular debris, microparticles constitute reliable markers of vascular damage. Released into biological fluids, microparticles are involved in the modulation of key functions including immunity, inflammation, vascular remodeling and angiogenesis. The present data demonstrates that LMPs have considerable impact on angiogenesis in vitro and in vivo. In view of this, LMPs may be important contributors to the pathogenesis of diseases that are accompanied by impaired angiogenesis and could thus influence vascular function (microvascular angiogenesis and vasopermeability of ischemic tissue, alerting the body for special attention and the need for emergency repair procedures. | 02-24-2011 |
| 20110052706 | Pancreatine pellets and method of producing same - In order to prevent impairment of the pharmacological effect of pancreatine through added auxiliary substances or binding agents a pancreatine pellet consists exclusively of pancreatine. | 03-03-2011 |
| 20110052707 | COMBINATION OF VITAMIN D AND 25-HYDROXYVITAMIN D 3 - We disclose compositions comprising Vitamin D (cholecalciferol and/or ergocalciferol) and 25-OH D3 (calcifediol), and use of those compositions to affect at least concentration, bioavailability, metabolism, or efficacy of vitamin D in a human. Forms and dosages of the composition, as well as processes for manufacturing a spray-dried formulation, are also disclosed. | 03-03-2011 |
| 20110059179 | CONTROLLED DELIVERY SYSTEM THAT PROVIDES MALODOR MANAGEMENT OVER A PROLONGED PERIOD OF TIME - The present invention relates to an improved controlled delivery system that can be incorporated into personal and household care products, such as deodorants, body wash, hair products, air refresher, fabric refresher, and other personal and household products, for the counteraction and management of malodor. The controlled delivery system of the present invention controls malodor by a dual action; it absorbs and neutralizes the malodor and it releases an odorous or non-odorous substance to counteract malodor in the environment over an extended period of time. The simultaneous dual action of the controlled delivery system of the present invention eliminates the malodor and can provide a long lasting pleasant odor over an extended period of time. | 03-10-2011 |
| 20110059180 | Method for Preparing Nanoparticles Based on Functional Amphiphilic Molecules or Macromolecules, and the Use Thereof - The invention relates to a method for preparing nanoparticles based on functional amphiphilic molecules or macromolecules, optionally in the presence of at least one colipide, enabling the encapsulation of therapeutic agents, especially anti-tumoral agents, and the use thereof for the transport and vectorisation of therapeutic agents, especially anti-tumoral agents. | 03-10-2011 |
| 20110064817 | CONTINUOUS MULTI-MICROENCAPSULATION PROCESS FOR IMPROVING THE STABILITY AND STORAGE LIFE OF BIOLOGICALLY ACTIVE INGREDIENTS - The invention relates to microcapsules, and a continuous micro-encapsulation water-in-oil-in-water microencapsulation process through in situ and interfacial polymerization of the emulsion. The formulation comprises a continuous water phase having a dispersion of microcapsules which contain oil drops and wherein the inside of each oil phase drop—containing optionally oil-soluble materials—there is a dispersion of water, or aqueous extract or water dispersible material or water soluble material. The oil drops are encapsulated with a polymerisable material of natural origin. Such microcapsules are appropriated for spray-dry processes, to be used as dry powder, lyophilised, self-emulsifiable powder, gel, cream and any liquid form. The active compounds included in the microcapsules are beneficial to the health and other biological purposes. Such formulations are appropriate to be incorporated in any class of food, especially for the production of nutraceuticals, as well as cosmetic products (such as rejuvenescence creams, anti-wrinkle creams, gels, bath and shower consumable products and sprays). The preparations are adequate to stabilise compounds added to the food, media for cultivating microbes and nutraceuticals, especially those which are easily degradable or oxidizable. | 03-17-2011 |
| 20110076335 | NOVEL LIPID FORMULATIONS FOR DELIVERY OF THERAPEUTIC AGENTS TO SOLID TUMORS - The present invention provides novel, serum-stable lipid particles comprising one or more active agents or therapeutic agents, methods of making the lipid particles, and methods of delivering and/or administering the lipid particles. More particularly, the present invention provides serum-stable nucleic acid-lipid particles (SNALP) comprising a nucleic acid (e.g., one or more interfering RNA molecules), methods of making the SNALP, and methods of delivering and/or administering the SNALP (e.g., for the treatment of cancer). In particular embodiments, the present invention provides tumor-directed lipid particles that preferentially target solid tumors. The tumor-directed formulations of the present invention are capable of preferentially delivering a payload such as a nucleic acid to cells of solid tumors compared to non-cancerous cells. | 03-31-2011 |
| 20110076336 | DRY POWDER PHARMACEUTICAL COMPOSITIONS FOR PULMONARY ADMINISTRATION, AND METHODS OF MANUFACTURING THEREOF - A method of making a dry powder pharmaceutical composition comprising: providing inactive ingredient particles; providing a micronized active ingredient; mixing the inactive ingredient particles with surface-modified nanoparticles to provide an inactive ingredient comprised of particles having surfaces with the surface-modified nanoparticles deposited on the surfaces; and/or mixing the micronized active ingredient with surface-modified nanoparticles to provide a micronized active ingredient comprised of particles having surfaces with the surface-modified nanoparticles deposited on the surfaces; and then mixing the micronized active ingredient with the inactive ingredient; the dry powder compositions made by the method; a use of said composition for the manufacture of a medicament for being delivered to the lungs of a mammal by administering a therapeutic amount of the dry powder pharmaceutical composition, and a dry powder inhalation device comprising a mouth piece, a powder containment system, and the dry powder pharmaceutical composition are disclosed. | 03-31-2011 |
| 20110081418 | TRANSDERMAL ABSORPTION ENHANCER - An object of the present invention is to provide a transdermal absorption enhancer by which various active ingredients are transdermally absorbed. In accordance with a transdermal absorption enhancer of the present invention which effective ingredient is lyotropic liquid crystal which has been utilized as a basic material for pharmaceutical preparations for external application and for cosmetics, transdermal absorption of a macromolecular substance and a water-soluble substance was able to be improved. | 04-07-2011 |
| 20110081419 | ION EXCHANGE RESIN TREATED TO CONTROL SWELLING - The present invention provides a method and composition for loading one or more drugs in a solution onto one or more ion exchange resin particles to form a drug-loaded resin particle. The drug-loaded resin particle is separated from the solution and dried before recombining the drug-loaded resin particle with the solution to load more drugs onto the drug-loaded resin particle from the solution. | 04-07-2011 |
| 20110097414 | PHARMACEUTICAL COMPOSITIONS COMPRISING ADSORBATE OF FENOFIBRATE - The present invention provides a pharmaceutical composition comprising adsorbate of fenofibrate or salt thereof or fenofibrate adsorbed on a pharmaceutically acceptable adsorbent and optionally one or more pharmaceutically acceptable excipients. The invention also relates to processes for the preparation of such compositions. | 04-28-2011 |
| 20110104291 | Formulation of Fine Particles Using Liquefied or Dense Gases - The invention provides a method for manipulating or formulating a solid substance which melts under pressure of a gas without degrading at a temperature lower than the melting point of the substance at atmospheric pressure including: applying to the substance a liquefied gas or dense gas to melt the substance without degrading the substance; then contacting the molten substance with a carrier fluid, which is at substantially the same pressure as the liquefied gas or dense gas, to form a solution or mixture of at least a part of the molten substance and the carrier fluid; and passing the solution or mixture into a vessel of lower pressure than the pressure of the liquefied gas or dense gas and carrier fluid to form particles of the substance; and particles formed by the method. | 05-05-2011 |
| 20110104292 | MEDICAL COMPOSITION AND MEDICAL KIT - In order to provide (i) a medical composition that has a strong angiogenic effect, has low invasiveness to a body of a patient, and is easy to administer to a living subject and (ii) a medical kit using a medical composition, the medical composition includes: a carrier in a particle form, the carrier having (a) a support made from a bioabsorbable polymer and (b) a surface layer made from hydroxyapatite and provided on the support; and cells provided on a surface of the carrier. | 05-05-2011 |
| 20110104293 | SYNERGISTIC INDUCTION OF HUMORAL AND CELLULAR IMMUNITY BY COMBINATORIAL ACTIVATION OF TOLL-LIKE RECEPTORS - Described herein are compositions that include a selected antigen, a TLR4 ligand and a TLR7/TLR8 ligand, wherein the antigen and TLR ligands are encapsulated in nanoparticles. Co-administration of both a TLR4 ligand and a TLR7/TLR8 ligand results in the synergistic induction of humor and cellular immunity as evidenced by an increase in pro-inflammatory cytokine production, an increase in the number of CD8 | 05-05-2011 |
| 20110111039 | Compositions and Methods for Inhibiting Gastric Acid Secretion - The present invention is related to novel oral compositions comprising an irreversible gastric H | 05-12-2011 |
| 20110117202 | UP AND DOWN CONVERSION SYSTEMS FOR PRODUCTION OF EMITTED LIGHT FROM VARIOUS ENERGY SOURCES INCLUDING RADIO FREQUENCY, MICROWAVE ENERGY AND MAGNETIC INDUCTION SOURCES FOR UPCONVERSION - Methods and systems for producing a change in a medium. A first method and system (1) place in a vicinity of the medium at least one upconverter including a gas for plasma ignition, with the upconverter being configured, upon exposure to initiation energy, to generate light for emission into the medium, and (2) apply the initiation energy from an energy source including the first wavelength λ | 05-19-2011 |
| 20110117203 | PHARMACEUTICAL COMPOSITION CONTAINING WATER SOLUBLE DRUG - The present invention is directed to a process of preparing beads coated with a water soluble drug for incorporation into a pharmaceutical composition comprising: (a) preparing a supersaturated drug solution containing a desired amount of drug, which is completely saturated at a first temperature but which is supersaturated at a second temperature which is below the first temperature; and (b) coating inert beads with the drug solution, said drug solution being maintained at or below the first temperature but above the second temperature, and said beads maintained at a second temperature, wherein the second temperature is less than the first temperature and wherein the solution containing the drug is supersaturated at the second temperature, as well as to the pharmaceutical compositions containing same. | 05-19-2011 |
| 20110123629 | TARGETING OF INNATE IMMUNE RESPONSE TO TUMOR SITE - The invention provides microparticles or nanoparticles for treatment of tumors comprising: (i) a targeting agent to the tumor or the tumor environment; and (ii) at least one inducer that stimulates a desired immune response in the tumor environment, leading to tumor apoptosis, wherein components (i) and (ii) are non-covalently or covalently attached to the surface of said microparticles or nanoparticles. The targeting agent is an agent that recognizes and binds to an antigen, a receptor or other molecules found on the surface of tumor cells or in the tumor environment and are preferably antibodies. | 05-26-2011 |
| 20110123630 | TOPICAL TREATMENT OF PERIPHERAL NEUROPATHY - A method and composition for the treatment of diabetic neuropathy is disclosed. A preferred embodiment of the invention relates to a topical composition for the treatment of systems related to diabetic neuropathy by application to the affected area. The composition provides relief of these symptoms and inhibits those factors that contribute to these systems, such as an aldose reductase inhibitor. A preferred embodiment of the invention relates to a method of treatment for diabetic neuropathy utilizing a regime of administrations of a topical composition in amounts effective to counter those areas of the body affected by peripheral Neuropathy. Yet another preferred embodiment of the invention relates to a method of improvement of those areas effected by diabetic peripheral neuropathy using a topical composition over an effective period of time. | 05-26-2011 |
| 20110123631 | ORAL COMPOSITIONS OF CLINDAMYCIN - A taste masked pharmaceutical composition of clindamycin, or a pharmaceutically acceptable salt(s), hydrate(s), solvate(s) and physiologically functional derivative(s) and precursors thereof, which includes all polymorphic forms, whether crystalline or amorphous comprising polyhydric alcohol(s); and one or more other pharmaceutically acceptable excipient(s). A process for preparation of a taste masked pharmaceutical composition of clindamycin or a pharmaceutically acceptable salt(s) thereof the said process comprising the steps of a) dry mixing clindamycin, polyhydric alcohol and other pharmaceutically acceptable excipient(s) to get a dry mixture; b) granulating the dry mixture above with a granulating liquid prepared by mixing the suitable pharmaceutically acceptable excipient(s) with aqueous/non-aqueous fluid to obtain a wet mass; c) drying the wet mass to obtain the discrete particles; d) lubricating the discrete particles obtained with a suitable lubricating agent and/or flavour(s). | 05-26-2011 |
| 20110129537 | FUNCTIONALIZED METAL-COATED ENERGY CONVERTING NANOPARTICLES, METHODS FOR PRODUCTION THEREOF AND METHODS FOR USE - A functionalized nanoparticle, having a core, optionally having a shell on at least a portion thereof, wherein the core contains a material that can convert applied X-ray energy into emitted UV energy and wherein the shell, when present, contains a plasmonics active material; wherein the nanoparticle has on a surface thereof at least one psoralen compound capable of activation by the emitted UV energy, and the use of the functionalized nanoparticle in a method of treating a cell proliferation disorder such as cancer. | 06-02-2011 |
| 20110135741 | SUSTAINED-RELEASE COMPOSITION AND METHOD FOR PRODUCING THE SAME - Sustained-release compositions wherein a water-soluble physiologically active peptide is substantially uniformly dispersed in a microcapsule comprised of a lactic acid polymer or a salt thereof, and the physiologically active substance is contained in an amount of 15 to 35 wt/wt % to the total microcapsules and weight-average molecular weight (Mw) of the lactic acid polymer is about 11,000 to about 27,000, which is characterized by having a high content of the physiologically active substance, and suppression of the initial excessive release within one day after the administration and a stable drug sustained-release over a long period of time, and method for producing the same. | 06-09-2011 |
| 20110142947 | NOVEL FORMULATIONS - Nanoparticles comprising T3 and their use in treating, e.g., cardiac conditions, for example cardiac arrest, are provided. Such nanoparticles provide improved delivery of T3 and allow for acute treatment and optionally for sustained release of T3 in a patient. | 06-16-2011 |
| 20110142948 | Nanoparticle Carrier Systems based on Human Serum Albumin for Photodynamic Therapy - Compositions, which are stable in storage, and a method of production of pharmaceutical based nanoparticulate formulations for photodynamic therapy comprising a hydrophobic photosensitizer, human serum albumin (HSA) and stabilizing agent are provided. These nanoparticulate formulations provide therapeutically effective amounts of photosensitizer (PS) for parenteral administration. In particular, tetrapyrrole derivatives can be used as photosensitizers whose efficacy and safety are enhanced by such nanoparticulate formulations. A method of preparing the HSA-based nanoparticles under sterile conditions is also provided. In one of the preferred embodiments of the present invention temoporfin, a hydrophobic PS, is formulated as a nanoparticle for parenteral administration. The formulations are useful for treating hyperplasic and neoplasic conditions, inflammatory problems, and more specifically to target tumor cells. | 06-16-2011 |
| 20110151011 | Decellularized Adipose Tissue - This invention provides a method for decellularizing adipose tissue, comprising subjecting the adipose tissue to one or more incubations in an enzymatic digestion solution containing one or more enzymes, and one or more solvent extractions, wherein decellularized adipose tissue comprising an extracellular matrix with well-preserved three-dimensional structure is obtained. The invention also provides a decellularized adipose tissue comprising an extracellular matrix with well-preserved three-dimensional architecture, and bioscaffolds, microcarrier beads, and coatings comprising the decellularized adipose tissue. | 06-23-2011 |
| 20110165254 | Drug Delivery Using Fine Fiber Encapsulation - The disclosure generally relates to a method of producing a handleable wafer of medicament powder (for example, aspirin powder) by utilizing a restraining envelope of fine water-soluble fibers, which are, upon use, quickly dissolved by bodily fluids. Such wafer would quickly provide sublingual or buccal cavity medications without significant excipients. Additional applications for such a wafer is in the prompt provision of a variety of medicaments to selected moist areas, such as, surgery or trauma sites, such as, a wound dressing. | 07-07-2011 |
| 20110182996 | SURFACE MODIFIED NANOPARTICLES, METHODS OF THEIR PREPARATION, AND USES THEREOF FOR GENE AND DRUG DELIVERY - A composition comprises a surface modified nanoparticle comprising a core comprising a material selected from the group consisting of organic materials, organometallic materials, inorganic materials, metals, metal oxides, and combinations thereof; and a surface branch covalently linked to the core having the general formula (3): | 07-28-2011 |
| 20110182997 | SUSPENSION FORMULATIONS - The present invention relates to suspension formulations, especially those for delivering a pharmaceutically active agent in aerosol form using a spray or aerosol device, such as a pressurised metered dose inhaler (pMDI). The formulations may be for pulmonary, nasal, buccal or topical administration, but are preferably for pulmonary inhalation. | 07-28-2011 |
| 20110212180 | METHOD OF PRODUCING MICROCAPSULES - A method of producing microcapsules of the type having a core and a coating encapsulating the core comprises the steps of providing a core-forming fluid stream and a coating-forming fluid stream, providing a two spray nozzle arrangement having a core nozzle disposed concentrically about a second nozzle, spraying the core-forming fluid stream from the core nozzle and the coat-forming fluid stream from the concentric nozzle to produce microcapsules, and solidifying the microcapsules upon formation in a suitable gas. Spray drying or spray chilling may be employed as the means of solidifying the microcapsules. Microcapsules having a core and a solid coat are also described. | 09-01-2011 |
| 20110229576 | HOLLOW SILICA NANOSPHERES AND METHODS OF MAKING SAME - The disclosure provide hollow nanospheres and methods of making and using the same. The methods and compositions of the disclosure are useful for drug delivery and gene transfer. | 09-22-2011 |
| 20110229577 | BIOLOGICALLY ACTIVE SILICIC ACID - The present invention relates to low-molar mass condensed derivatives of silicic acid of sub-nano particle size characterised by particular structure and specific biological activities. Preparation methods and applications are presented for the here disclosed sub-nano silicic acid (SNSA) which interact with bio-molecules and modify significantly their structure and biological function. Preferred field of application of the inventive silicic acid derivatives is to modulate the structure and biological function of proteins particularly of those involved in reversible phosphorylation within biological signal transduction or membrane transport processes. Structure of the substances, methods for the preparation and stabilization, as well as pharmaceutical compositions comprising the substances and methods of application in the prevention, diagnosis and therapy of diseases are disclosed. | 09-22-2011 |
| 20110229578 | MODAFINIL ORAL LYOPHILIZATE - The invention concerns an oral lyophilizate comprising modafinil particles having a median diameter of about 10 to about 1000 μm in association with an appropriate amount of at least one excipient selected from the group consisting of fatty acid esters of glycerol, cyclic oligosaccharides, sweeteners or mixtures thereof. | 09-22-2011 |
| 20110229579 | Support Having Nanostructured Titanium Dioxide Film And Uses Thereof - The present invention relates to supports for bioassays and the use thereof in cell culturing and in cell-based methods and assays. More precisely, the invention provides solid materials coated with films of nanostructured titanium dioxide suitable for the immobilisation of viruses and for cell-adhesion. The nanostructured TiO | 09-22-2011 |
| 20110236491 | TOPICAL ANTI-INFLAMMATORY COMPOSITION - Compositions and methods for treating inflammation in mammalian tissue are provided using substantially continuously, in situ generated, anti-inflammatory effective amounts of hydrogen peroxide. | 09-29-2011 |
| 20110236492 | DRY POWDER INHALER FORMULATIONS COMPRISING SURFACE-MODIFIED PARTICLES WITH ANTI-ADHERENT ADDITIVES - The present invention is concerned with a refinement of the processing of particles that are to form a dry powder formulation which is to be administered to the lung using a dry powder inhaler (DPI) device. In particular, the present invention provides the processing of particles of active material and particles of carrier material in the presence of additive material to provide a powder composition which exhibits excellent powder properties and which is economical to produce. | 09-29-2011 |
| 20110250279 | CONTROLLED-RELEASE COMPOSITION FOR PRODUCING SUSTAINED-RELEASE PREPARATION CONTAINING UDENAFIL - This invention relates to a controlled-release composition for producing a sustained-release preparation containing udenafil, including (A) udenafil and a pharmaceutically acceptable salt, (B) a solubility modulator, (C) an adsorbent, and (D) a hydrophilic polymer. This controlled-release composition for producing a sustained-release preparation containing udenafil releases drugs constantly regardless of the pH level in the gastrointestinal tract, and thus freely controls the drug release time within the range of 3˜24 hours, and reduces the variability in the effect of drugs among individuals. Also, this composition can be produced into a sustained-release preparation which has an optimum condition for expressing the effect of drugs in the treatment of diseases including pulmonary arterial hypertension, hepatic portal vein hypertension, benign prostatic hyperplasia, and the like, which can be treated by udenafil and which requires the long-term drug administration. Also, this composition can control the release of drugs in accordance with the time taken for the absorption thereof when the drugs are applied to a living body, and thus can be valuably used in preventing and treating erectile dysfunction. | 10-13-2011 |
| 20110250280 | MICROENCAPSULATION PROCESS OF SERTOLI CELLS, MICROCAPSULES OBTAINED AND THEIR USE FOR PREVENTION AND CURE OF TYPE I DIABETES MELLITUS - The invention relates to the use of Sertoli cells (SC) microencapsulated into hydrogel-based microcapsules, for the prevention and/or treatment of Type 1 diabetes mellitus (T1DM) and to a process for producing microcapsules, preferably shaped as microspheres. | 10-13-2011 |
| 20110256227 | CONTROLLED POLYPLEX ASSEMBLY - The present invention provides polymers, compositions thereof, and polyplexes comprising said polymers. In particular, polyplexes comprising polycations, polyanions, and polynucleotides are provided. The invention further provides methods of making and using said polyplexes. | 10-20-2011 |
| 20110262545 | Octreotide depot formulation with constantly high exposure levels - The present invention relates to sustained release formulations comprising as active ingredient octreotide or a pharmaceutically-acceptable salt thereof and two different linear polylactide-co-glycolide polymers (PLGAs). | 10-27-2011 |
| 20110268806 | ANTISOLVENT SOLIDIFICATION PROCESS - The present invention relates to a antisolvent solidification process wherein a liquid medium comprising at least one organic or inorganic compound which is to be solidified is forced through a membrane into one or more antisolvents, or wherein one or more antisolvents are forced through a membrane into a liquid medium comprising at least one organic or inorganic compound which is to be solidified, yielding a composition comprising solid particles comprising said organic and/or inorganic compound(s). | 11-03-2011 |
| 20110287103 | Sustained-release formulations of topiramate - Pharmaceutical compositions of topiramate for once-a-day oral administration are provided. The formulations comprise a sustained-release component and an optional immediate-release component, the compositions of which can be selectively adjusted, respectively, to release the active ingredient along a pre-determined release profile. Method of treating or preventing pathological disorders in mammalian subjects comprising the administration of the novel formulations disclosed herein is also provided. | 11-24-2011 |
| 20110293724 | Enzyme Treatment of Foodstuffs for Celiac Sprue - Administering an effective dose of glutenase to a Celiac or dermatitis herpetiformis patient reduces levels of toxic gluten oligopeptides, thereby attenuating or eliminating the damaging effects of gluten. | 12-01-2011 |
| 20110293725 | CHIMERIC THERAPEUTICS, COMPOSITIONS, AND METHODS FOR USING SAME - Chimeric therapeutics are disclosed that include a modified viral core protein and a nucleic acid bound to the modified viral core protein. The nucleic acid may be substantially homologous to a specific gene target. In some embodiments, the nucleic acid bound to the modified viral core protein is substantially non-immunogenic. Also disclosed are particles and compositions that include disclosec chimeric therapeutics. | 12-01-2011 |
| 20110293726 | CHIMERIC THERAPEUTICS, COMPOSITIONS, AND METHODS FOR USING SAME - Chimeric therapeutics are disclosed that include a modified viral core protein and a nucleic acid bound to the modified viral core protein. The nucleic acid may be substantially homologous to a specific gene target. In some embodiments, the nucleic acid bound to the modified viral core protein is substantially non-immunogenic. Also disclosed are particles and compositions that include disclosed chimeric therapeutics. | 12-01-2011 |
| 20110293727 | CHIMERIC THERAPEUTICS, COMPOSITIONS, AND METHODS FOR USING SAME - Chimeric therapeutics are disclosed that include a modified viral core protein and a nucleic acid bound to the modified viral core protein. The nucleic acid may be substantially homologous to a specific gene target. In some embodiments, the nucleic acid bound to the modified viral core protein is substantially non-immunogenic. Also disclosed are particles and compositions that include disclosec chimeric therapeutics. | 12-01-2011 |
| 20110300221 | Therapeutic Inhibitor of Vascular Smooth Muscle Cells - Methods are provided for inhibiting stenosis following vascular trauma or disease in a mammalian host, comprising administering to the host a therapeutically effective dosage of a therapeutic conjugate containing a vascular smooth muscle binding protein that associates in a specific manner with a cell surface of the vascular smooth muscle cell, coupled to a therapeutic agent dosage form that inhibits a cellular activity of the muscle cell. Methods are also provided for the direct and/or targeted delivery of therapeutic agents to vascular smooth muscle cells that cause a dilation and fixation of the vascular lumen by inhibiting smooth muscle cell contraction, thereby constituting a biological stent. | 12-08-2011 |
| 20110305764 | Use of a Mare's Milk Concentrate Dried on a Highly-Dispersed, Biologically Inert Matrix - The invention relates to the use of a mare's milk concentrate dried on a highly-dispersed, biologically inert matrix, for producing a preparation for the treatment of skin diseases, especially dry skin diseases. | 12-15-2011 |
| 20110311634 | FORMULATIONS FOR ANIMAL FEED COMPRISING BUTYRATE SALT - The present invention relates to formulations for animal feed comprising coated granules comprising butyrate salt; the butyrate salt is preferably the salt of sodium or calcium salt. The coated granules have a particle size of 0.1 mm or more, preferably 0.2 mm or more and about 2 mm or less, and preferably about 1 mm or less. The coated granules comprise a binder and a coating. Further, the butyrate salt can be combined with another active ingredient which may be chosen from the group consisting of plant extracts, prebiotic compounds, probiotics, yeast extracts, middle-length chain fatty acids, unsaturated long chain fatty acids, lactate salt, fat soluble vitamin, and toxin absorbing compound. | 12-22-2011 |
| 20110311635 | HOLLOW METAL OXIDE SPHERES AND NANOPARTICLES ENCAPSULATED THEREIN - A nanoparticle including a Group 3 atom-containing shell. In various embodiments, the nanoparticle includes a metal or metal catalyst-containing core, or a substantially metal-free core. In other embodiments, the nanoparticle shell is hollow. A method of preparing the nanoparticle and methods of using such particles are also provided. | 12-22-2011 |
| 20110311636 | METHODS AND MEDICAMENTS FOR ADMINISTRATION OF IBUPROFEN - A method for administration of ibuprofen to a subject in need of ibuprofen treatment is provided, in which an oral dosage form comprising a therapeutically effective amount of ibuprofen and a therapeutically effective amount of famotidine is administered three times per day. | 12-22-2011 |
| 20110311637 | METHODS AND MEDICAMENTS FOR ADMINISTRATION OF IBUPROFEN - A method for administration of ibuprofen to a subject in need of ibuprofen treatment is provided, in which an oral dosage form comprising a therapeutically effective amount of ibuprofen and a therapeutically effective amount of famotidine is administered three times per day. | 12-22-2011 |
| 20110311638 | NANOSILVER POROUS MATERIAL PARTICLES AND FABRICATING METHOD THEREOF - Nanosilver porous material particles and method for manufacturing the same are disclosed. The nanosilver porous material particles include nanosilver particles distributed on the surface thereof. First, a nanosilver precursor is dissolved in water and a proper quantity of a fixation agent is added to form a solution. Next, a proper quantity of the porous material particles is added into the solution and that is mixed well to form a suspension. Next, the suspension is allowed to stand for a predetermined period of time, and then the suspension is filtered to separate the porous material particles from the solution. Finally, the resulting porous material particles are baked and dried. | 12-22-2011 |
| 20110318421 | SURFACE FUNCTIONALIZED CERAMIC NANOPARTICLES - The present disclosure is directed to surface functionalized ceramic nanoparticles. The method for producing the surface functionalized ceramic nanoparticles generally includes at least four distinct steps: 1) synthesis of an amphiphilic surfactant having the desired surface functionality, 2) formation of mixed solvent microstructured solution with the surfactant, 3) synthesis of the desired ceramic within the microstructured solution, and 4) chemical attachment of the surfactant to the ceramic nanoparticle. The composition of the surface functionalized nanoparticle comprises a lipophilic component, a hydrophilic component, a chelating agent and a ceramic forming component. | 12-29-2011 |
| 20110318422 | TARGETED ACTIVE AGENT DELIVERY SYSTEM BASED ON CALCIUM PHOSPHATE NANOPARTICLES - Calcium phosphate nanoparticle active agent conjugates are described. Specifically, anticancer agent conjugates are prepared which are suitable for targeted active agent delivery to tumor cells and lymphatics for the treatment of cancer and the treatment or prevention of cancer metastasis. | 12-29-2011 |
| 20120003319 | COMPOSITIONS FOR SITE-SPECIFIC DELIVERY OF IMATINIB AND METHODS OF USE - The invention provides an oral formulation for administering to a subject comprising an imatinib compound and an enteric matrix or enteric coating or a combination thereof, whereby at least 80% of the imatinib compound is released in the small intestine of the subject. Methods of using such formulation is also provided. | 01-05-2012 |
| 20120009266 | COMPOSITION COMPRISING OCAPERIDONE - The present invention relates to a composition comprising ocaperidone as an active substance and an effective amount of water-soluble polymers to increase solubility of ocaperidone. The present invention further relates to a therapeutic system for ocaperidone with a compartment for the drug formulation comprising said composition, and to a process for the preparation thereof as well as to the therapeutic use of said composition as antipsychotic drug. The present invention also relates to the solubilisation of ocaperidone in an aqueous medium with the aid of water soluble swellable polymers. | 01-12-2012 |
| 20120015036 | Process For The Manufacture Of A Pharmaceutical Product - A process for the preparation of a pharmaceutical composition comprising a homogeneous or substantially homogeneous mixture of citric acid, magnesium oxide, potassium bicarbonate and sodium picosulphate and, optionally, saccharin sodium and/or orange flavor; products, intermediate products, and uses thereof. | 01-19-2012 |
| 20120021056 | Methods and Systems for Inducing Immunologic Tolerance to Non-Self Antigens - Described herein are methods and systems that can be used to induce immunologic tolerance to non-self antigens. The methods and systems comprise introducing a tolerogen comprising at least one immunogenic non-self antigen coupled to a carrier, wherein the immunogenic antigen can be a foreign or endogenous antigen or fragments thereof. The non-self antigen can be selected from the group consisting of carbohydrate antigens, full-length antigenic proteins, and fragments and combinations thereof, while the carrier can be selected from nanoparticles and stents. Tolerogen compositions are also provided and can be used to induce immunologic tolerance to non-self antigens. These methods, systems and compositions are particularly advantageous since they can be used to allow for the extension of the window of safety for immunologically-incompatible transplantations to patients who are growing past the age of infancy. | 01-26-2012 |
| 20120021057 | ONCE-DAILY ORAL IR/CR PRAMIPEXOLE FORMULATION - An oral once-daily pramipexole formulation, comprising an immediate-release component and a controlled-release component, is provided wherein in preferred embodiments, both the immediate-release component and the controlled-release component comprise pramipexole The formulation is preferably in the form of a coated bead A method of manufacturing said formulation is also provided. | 01-26-2012 |
| 20120027861 | Nano-carrier, complex of anticancer drug and nano-carrier, pharmaceutical composition thereof, method for manufacturing the complex, and method for treating cancer by using the pharmaceutical composition - The present invention relates to a nano-carrier for an anticancer drug, which comprises: a metal nanoparticle; and a polynucleotide for connecting with an anticancer drug having a pyrimidine group or a purine group, wherein the polynucleotide connects to a surface of the metal nanoparticle, and the anticancer drug binds to the polynucleotide through the pyrimidine group or the purine group. In addition, the present invention also provides a complex of an anticancer drug and a nano-carrier, a pharmaceutical composition thereof, a method for manufacturing the complex, and a method for treating a cancer by using the pharmaceutical composition. | 02-02-2012 |
| 20120027862 | Azelaic acid-comprising formulation with added pigment - The present patent application relates to an azelaic acid-comprising pharmaceutical composition, preferably an azelaic acid-comprising gel, with added pigment, which composition can be used, inter alia, for treating rosacea and acne, and also to a process for its preparation. | 02-02-2012 |
| 20120027863 | Pharmaceutical Compositions for Inhalation - The invention provides microparticles for use in a pharmaceutical composition for Pulmonary administration, each microparticle comprising a particle of an active substance having, on its surface, particles of a hydrophobic material suitable for delaying the dissolution of the active substance. The invention also provides a method for making the microparticles. | 02-02-2012 |
| 20120040005 | NANOSTRUCTURED CALCIUM-SILVER PHOSPHATE COMPOSITE POWDERS, PROCESS FOR OBTAINING THE POWDERS, AND BACTERICIDAL AND FUNGICIDAL APPLICATIONS THEREOF - Described in example embodiments are nanocomposite powders including calcium phosphate and silver nanoparticles on the surface of the calcium phosphate. Other example embodiments, describe methods of forming nanocomposite powders comprising a) preparing a nanometric calcium phosphate by a sol-gel processing route; and b) depositing silver nanoparticles on the calcium phosphate surface. Compositions including nanocomposite powders and uses of those compositions are also described. | 02-16-2012 |
| 20120040006 | Pharmaceutical Compositions Comprising Brivaracetam - The present invention relates to a pharmaceutical composition comprising brivaracetam as active ingredient, the invention relates specifically to a prolonged release formulation. | 02-16-2012 |
| 20120040007 | SERINE PALMITOYLTRANSFERASE INHIBITORS FOR PREVENTING AND DELAYING RETINITIS PIGMENTOSA - The method for preventing and delaying inherited retinal degenerations using serine palmitoyltransferase inhibitors, and compositions which contain them. | 02-16-2012 |
| 20120058189 | PROCESS FOR MAKING A CRYSTALLINE ZILPATEROL SALT - This invention generally relates to processes for making a crystalline zilpaterol salt, particularly zilpaterol hydrochloride. This invention also relates to methods of treatment using a crystalline zilpaterol salt prepared in accordance with this invention to increase the rate of weight gain, improve feed efficiency, and/or increase carcass leanness in livestock, poultry, and fish. | 03-08-2012 |
| 20120058190 | FOOD CONTAINING PROLACTIN - A nutritional Composition for a subject, comprising prolactin identical or similar or analogous to prolactin found in a natural food source, and at least one protective layer, wherein release of said prolactin from the composition in said subject is the result of an environmental event. | 03-08-2012 |
| 20120058191 | CARBON-BEARING NSP3 NANOPARTICLE AND ITS SYNTHESIS ROUTE - The invention relates to nanotechnology. The carbon-bearing nanoparticle consists of a cubical carbon monocrystal nucleus, the size of which is equal to or less than 4 nm, and a monocrystalline carbon shell having an SP | 03-08-2012 |
| 20120064166 | FORMULATION COMPRISING DROSPIRENONE FOR SUBCUTANEOUS OR INTRAMUSCULAR ADMINISTRATION - The present invention relates to a composition comprising Drospirenone dispersed in a liquid or semi-solid lipophilic vehicle. The present invention further relates to the use of such compositions as contraceptives and for treatment of diseases, disorders and symptoms associated with deficient endogenous levels of estrogen in women. | 03-15-2012 |
| 20120064167 | MODIFIED-RELEASE PHARMACEUTICAL DRUG COMPOSITION - The present invention provides compositions and methods for a modified-release pharmaceutical drug composition having a first charged active agent and a second charged active agent at least partially surrounded by a rate controlling membrane. The first charged active agent and the second charged active agent interact to form a modified release pharmaceutical complex within the rate controlling membrane and the modified release pharmaceutical complex has a release characteristic different from the release characteristic of the first active agent or the second active agent alone. | 03-15-2012 |
| 20120070499 | DELAYED-RELEASE GLUCOCORTICOID TREATMENT OF RHEUMATOID DISEASE - The present invention refers to the treatment of a rheumatic disease and/or osteoarthritis by administering a delayed-release dosage form of a glucocorticoid to a subject in need thereof. | 03-22-2012 |
| 20120070500 | Nanoparticles Of Cerium Oxide Targeted To An Amyloid-Beta Antigen Of Alzheimer's Disease And Associated Methods - Disclosed is a composition immunologically targeted to Alzheimer's disease (AD), the composition containing amine functionalized nanoparticles of Cerium oxide coated with polyethylene glycol and bearing an antibody specific for an amyloid-beta antigen associated with AD. The invention also includes a medication manufactured with the targeted nanoceria particles and methods of treatment by administering the targeted nanoceria particles to patients in need thereof. | 03-22-2012 |
| 20120070501 | Method and Formulation for Treating Resistance to Antihypertensives and Related Conditions - A method for the prevention or treatment of symptoms of hypertension in a patient who is resistant to antihypertensive effects of an antihypertensive compound administered in the absence of melatonin comprises administering to said patient melatonin in an amount effective to ameliorate or prevent symptoms of hypertension in said patient. | 03-22-2012 |
| 20120076861 | MATERIALS AND METHODS FOR THE TREATMENT OF CELIAC DISEASE - The present invention provides materials and methods for the treatment of celiac disease. In addition, the present invention provides materials and methods of monitoring the treatment of a subject having celiac disease. | 03-29-2012 |
| 20120082727 | USE OF MAGNESIUM STEARATE IN DRY POWDER FORMULATIONS FOR INHALATION - Addition of magnesium stearate to a powder formulation for inhalation comprising carrier particles and an active ingredient bearing a group susceptible to hydrolysis is useful for inhibiting or reducing the chemical degradation of the active ingredient. | 04-05-2012 |
| 20120087984 | STABILIZATION OF CHEMICAL COMPOUNDS USING NANOPARTICULATE FORMULATIONS - Methods for stabilizing chemical compounds, particularly pharmaceutical agents, using nanoparticulate compositions are described. The nanoparticulate compositions comprise a chemical compound, such as a pharmaceutical agent, and at least one surface stabilizer. The component chemical compound exhibits chemical stability, even following prolonged storage, repeated freezing-thawing cycles, exposure to elevated temperatures, or exposure to non-physiological pH conditions. | 04-12-2012 |
| 20120093934 | METHODS FOR TREATING AUTOIMMUNE DISEASE USING BIOCOMPATIBLE BIOABSORBABLE NANOSPHERES - The methods include selectively reducing or expanding T cells according to the antigenic specificity of the T cells using biocompatible bioabsorbable nanospheres. Therefore, the present invention can be used to reduce or eliminate pathogenic T cells that recognize autoantigens, such as beta cell specific T cells. As such, the present invention can be used to prevent, treat or ameliorate autoimmune diseases such as IDDM. Furthermore, the present invention can be used to expand desirable T cells, such as anti-pathogenic T cells to prevent, treat and/or ameliorate autoimmune diseases. | 04-19-2012 |
| 20120093935 | PARTICLES HAVING A LUMINESCENT INORGANIC SHELL, METHOD FOR COATING PARTICLES AND USE THEREOF - The invention relates to a method for coating particles with a luminescent inorganic shell. Furthermore, the invention relates to particles having a luminescent inorganic shell and also use thereof. | 04-19-2012 |
| 20120107405 | METHOD FOR THE DRY DISPERSION OF NANOPARTICLES AND THE PRODUCTION OF HIERARCHICAL STRUCTURES AND COATINGS - The invention relates to a method for the dispersion of synthetic or natural nanoparticles and nanocomposite materials and to the use thereof in different sectors including those of ceramics, coatings, polymers, construction, paints, catalysis, pharmaceuticals and powdered materials in general. | 05-03-2012 |
| 20120107406 | Dry Powder Formulations - A dry powder suitable for inhalation n a dry powder inhaler, the powder comprising a carrier, an active agent and at least 0.5% by weight of magnesium stearate, the powder being further characterized in that the less than 10% of the surface of the carrier material is covered with particles of magnesium stearate. The invention is also directed to a method of making dry powders by blending together the ingredients mentioned in a diffusion blender for a period of time that is less than 60 minutes. | 05-03-2012 |
| 20120114758 | BEVERAGE FOR PREGNANCY & LACTATION - The invention generally relates to nutrient enhanced beverages which include certain levels of the most current Daily Recommended Intakes of macronutrients and Micronutrients, and the rationale for increased allowances during pregnancy. The beverages of the invention generally comprise one or more macronutrients, vitamins and minerals recommended for consumption by pregnant or lactating women in an amount that is effective for enhancing the nutrition of pregnant and lactating women, and that is not harmful to developing fetuses or breast-feeding babies. In particular, the invention provides high doses of more easily absorbable iron to increase bioavailability of both iron and calcium which normally are not ingested in the needed doses, or are usually ingested via hard to swallow and digest prenatal, iron and calcium pills that can cause stomach cramps, diarrhea, constipation and other gastro-intestinal effects, that often lead to women not getting enough necessary nutrients. | 05-10-2012 |
| 20120121712 | CELLULAR ELECTRIC STIMULATION MEDIATED BY PIEZOELECTRIC NANOTUBES - Piezoelectric nanotransducers for use in an in vivo treatment of cell stimulation through electrical stimulation are described. The nanotransducers are localized in a target site, and an electrical stimulus is induced in the same site through external stimulation of the nanotransducers by ultrasonic waves. | 05-17-2012 |
| 20120121713 | CHIMERIC THERAPEUTICS, COMPOSITIONS, AND METHODS FOR USING SAME - Chimeric therapeutics are disclosed that include a modified viral core protein comprising at least one mutation or modification in an immunogenic epitope and a therapeutic agent. The therapeutic agent may be associated with the modified viral core protein and may be a nucleic acid, a protein, or a small molecule. Also disclosed are particles and compositions that include the disclosed chimeric therapeutics. | 05-17-2012 |
| 20120121714 | COMPOSITIONS WITH ANTIGENS ADSORBED TO CALCIUM PHOSPHATE - Calcium phosphate is used as an adjuvant, with a high degree of antigen adsorption to the adjuvant. The invention is particularly useful for adjuvanting conjugated capsular saccharide antigens. Buffers, such as phosphate or histidine buffers, can advantageously be used in combination with the calcium phosphate, and compositions may have a pH in the range of 5.5 to 7.5. | 05-17-2012 |
| 20120121715 | DNA Vaccine Comprising IL-6-Encoding DNA Construct and Applications Thereof - A DNA vaccine, which comprises a DNA construct comprising an expression vector which is expressible in a eukaryotic cell, and a nucleotide fragment which comprises an IL-6-encoding sequence and an HPV E7(detox)-encoding sequence. A pharmaceutical composition and a method for preventing or treating HPV-related (-induced) diseases are included. | 05-17-2012 |
| 20120128777 | COMPOSITIONS CONTAINING LIPID MICRO- OR NANOPARTICLES FOR THE ENHANCEMENT OF THE DERMAL ACTION OF SOLID PARTICLES - The invention is related to compositions which can be used as dermal formulations for supporting the skin to restore normal conditions in case of e.g. irritated skin, or to support medical therapy of skin with atopic dermatitis symptoms, atopic dermatitis, psoriasis or related diseases (e.g. accompanied by distorted barrier function of the skin and microbial load). The compositions of the invention can be used for dermo-cosmetic products but also for pharmaceutical/-medical products, depending on the composition and the additional actives incorporated (cosmetic actives or drugs). The invention is based on the synergistic effect of metallic particles, in particular silver particles (such as microsilver, nanosilver) and lipid particles (lipid nanoparticles or lipid microparticles). As alternatives to silver particles, other metallic particles (e.g. zinc, copper) or nanocrystalline actives can be incorporated (e.g. replacing the anti-oxidative silver by anti-oxidative nanocrystals of plant molecules such as hesperitin). This leads to combinations of lipid particles with nanocrystals for dermal use. | 05-24-2012 |
| 20120128778 | COMPOSITIONS AND METHODS FOR ONCE-DAILY ADMINISTRATION OF A TRILAYER OSMOTIC TABLET - A trilayer osmotic tablet is described. The tablet includes a core, a semi-permeable membrane disposed generally around the core, and an orifice in the semi-permeable membrane in fluid communication with the core. The core includes first, second, and third layers. The first layer is in fluid communication with the orifice. The second layer includes a therapeutically effective dose of a drug and is located adjacent to the first layer. The third layer is located adjacent the second layer. The tablet may include a coating having therapeutically effective doses of at least one additional drug disposed in the coating that generally surrounds the semi-permeable membrane. The at least one additional drug in the coating may be the same or different from the drug in the trilayer core. Methods for treating epilepsy, psychiatric disorders, asthma, and peptic ulcer disease by administering these compositions are also described. | 05-24-2012 |
| 20120135080 | Core-Shell Magnetic Particles and Related Methods - The invention provides core-shell magnetic particles comprising a magnetic core and a functional shell, methods for making same, methods of separation using same, methods for using same, and devices comprising same. The particles and methods of the invention are useful for targeting and removing substances of interest that may be found in complex mixtures. | 05-31-2012 |
| 20120141590 | Technology for the Preparation of Microparticles - Microspheres are produced by contacting a solution of a macromolecule or small molecule in a solvent with an antisolvent and a counterion, and chilling the solution. The microspheres are useful for preparing pharmaceuticals, nutraceuticals, cosmetic products and the like of defined dimensions. | 06-07-2012 |
| 20120141591 | Drug Delivery Nanocarriers Targeted by Landscape Phage - A targeted drug delivery nanocarrier and a method of forming the same is disclosed herein. The targeted drug delivery nanocarrier includes a plurality of amphipathic molecules forming a carrier particle having a plurality of drug molecules contained therein. A targeted landscape phage protein assembly is complexed to the carrier particle preferably using the unique method disclosed herein. The targeted landscape phage protein assembly displays a binding peptide that is selected to specifically and selectively bind to a target site. The method for forming targeted drug delivery nanocarriers includes the steps of obtaining a plurality of bacteriophage displaying a binding peptide for a desired target site, treating the bacteriophage with a denaturing agent, mixing the treated bacteriophage with a plurality of carrier particles and purifying the mixture to obtain a plurality of targeted drug delivery nanocarriers. | 06-07-2012 |
| 20120148677 | CONTROLLED RELEASE PARTICLES CONTAINING ACID FIBROBLAST GROWTH FACTOR - Disclosed herein is a controlled release particle comprising a therapeutically effective amount of acid fibroblast growth factor (aFGF), entrapped by a particle composed by a biocompatible anionic biopolymer capable of binding to aFGF, and a cationic polymer. The method for manufacturing the controlled release particle and the method of using the particle for treating nervous injury are also provided. | 06-14-2012 |
| 20120156301 | Methods and Compositions for Treating and Preventing Symptoms of Hormonal Variations - The present invention relates to methods, compositions, and kits for treating or preventing symptoms of hormonal variation. The method comprises the steps of administering an effective amount of Dextromethorphan or Dextrorphan, or a pharmaceutically acceptable salt thereof, to a subject having one or more symptoms of hormonal variations. | 06-21-2012 |
| 20120156302 | BIODEGRADABLE PARTICLE AND METHOD FOR PRODUCING THE SAME - The present invention aims to provide a biodegradable particle capable of being molded without an aggregation or cohesion of the particles, capable of being carried or injected without clogging by an aggregation in a micro diameter tube such as of a catheter, needle or syringe mainly used in pharmaceutical and medical applications of which inner diameter is smaller than the particle size or in a blood vessel and capable of being smoothly degraded in a specified period of time so that degraded component can finally be absorbed or discharged in vitro. As means for solving the problem, the present invention provides a biodegradable particle characterized in that a compressive modulus of the particle in water saturated state is 10 MPa or less. | 06-21-2012 |
| 20120164230 | Soluble Nanoparticles as Delivery Systems for Prodrugs - Compounds and methods are disclosed in which a prodrug can be delivered in an elevated oxidative state to cells by means of graphitic nanoparticles to which the prodrug is attached by a hydrophilic polymer and which have been made soluble by a hydrophilic polymer, such as PEG. The graphitic nanoparticle may be a single walled carbon nanotube (SWNT). The prodrug may be a DNA-binding metal-based drug. Exemplified is a platinum(IV) complex c,c,t-[Pt(NH | 06-28-2012 |
| 20120164231 | Synthesis Of Oxygen Carrying, Turbulence Resistant, High Density Submicron Particulates - An artificial oxygen carrier (AOC) for use in the body. A first gas permeable first shell encloses an oxygen carrying agent. The first shell has a second oxygen carrying agent surrounding it, and there is a second gas permeable shell enclosing the second agent. The concentric shells are not subject to turbulent breakup, or chemical decomposition, do not release the agents. | 06-28-2012 |
| 20120171291 | PEPTIDE-CARRYING NANOPARTICLES - Nanoparticles having a core and a corona of ligands covalently linked to the core, wherein peptides are bound to or associated with the nanoparticles. | 07-05-2012 |
| 20120171292 | LUMINESCENT POROUS SILICON NANOPARTICLES FOR TARGETED DELIVERY AND IMMUNIZATION - The disclosure relates to immunizing agents and devices. | 07-05-2012 |
| 20120171293 | GRANULATED MATERIAL MIXTURE COMPRISING TWO DIFFERENT GRANULATED MATERIALS FOR ARTIFICIAL CALLUS DISTRACTION - A granulate mixture suitable for regenerating a bone contains at least one expandable particle and at least one nondeformable particle. The at least one expandable particle contains a swelling agent. The swelling is enclosed by a biodegradable sheathing or be a biodegradable casing. Three-dimensional callus distraction may be accomplished by introducing the granulated mixture into a bone defect. | 07-05-2012 |
| 20120171294 | STARCH FOAM MICROPARTICLES FOR DELIVERY OF NON-AQUEOUS LIQUID TO BEES - The present invention relates to starch foam microparticles having a porous structure, and which typically have a diameter of less than or equal to about 50 microns. The present invention also relates to novel uses for the starch foam microparticles in beekeeping and in the pharmaceutical, plastics and fragrance industries. | 07-05-2012 |
| 20120177742 | NANOPARTICLE AND SURFACE-MODIFIED PARTICULATE COATINGS, COATED BALLOONS, AND METHODS THEREFORE - Devices, coatings, and methods therefore comprise a medical device for delivering nanoparticles of an active agent to a treatment site. A coating on the medical device comprises active agent nanoparticles, which delivers coating to the treatment site and releases active agent nanoparticles into the treatment site over at least one day. A coating may comprise a polymer, a surfactant, and the nanoparticles. The coating may be prepared by forming a nanoemulsion. A coating may comprise encapsulated active agent nanoparticles which comprise active agent nanoparticles encapsulated in a polymer. The coating may have a positive surface charge. The coating may deliver active agent nanoparticles into the treatment site over at least about one day. The coating may be formed of a surfactant and nanoparticles mixture. The active agent nanoparticles may be deposited on the medical device using electrostatic capture. | 07-12-2012 |
| 20120183619 | TRICLOSAN DERIVATIVES AND NANOPARTICLES COMPRISING SAME - The present invention is directed to triclosan derivatives and nanoparticles comprising said derivatives together with an organic or an inorganic carrier. The present invention is also directed to uses of the triclosan nanoparticles for preventing or inhibiting bacterial growth. | 07-19-2012 |
| 20120183620 | MESOPOROUS DRUG DELIVERY SYSTEM USING AN ELECTRICALLY CONDUCTIVE POLYMER - The present application relates to Nanoparticle bioengineering techniques were used to produce a non-toxic polypyrrole composition having two-dimensional and three-dimensional structures that can optionally be co-polymerized with carboxylic acid moieties to possess hydrophilicity. Likewise, such polypyrrole/carboxylic acid structures may be further modified with neural growth factors to create treatment surfaces that can promote growth an differentiation of cells such as neurons. | 07-19-2012 |
| 20120201892 | POROUS-WALL HOLLOW GLASS MICROSPHERES AS CARRIERS FOR BIOMOLECULES - The present invention includes compositions of porous-wall hollow glass microspheres and one or more biomolecules, wherein the one or more biomolecules are positioned within a void location within the hollow glass microsphere, and the use of such compositions for the diagnostic and/or therapeutic delivery of biomolecules. | 08-09-2012 |
| 20120201893 | Pellets Formulation - A process for preparing pellets by high shear granulation containing a pharmaceutical active ingredient with a pH dependent water solubility, the pellets obtained with said process and pharmaceutical oral dosage forms comprising said pellets. | 08-09-2012 |
| 20120207841 | FORMULATIONS OF 6-MERCAPTOPURINE - The present invention provides improved formulations of 6-mercaptopurine that exhibit better bioavailability and faster dissolution than previous formulations. | 08-16-2012 |
| 20120213855 | DOSAGE FORMS FOR WEAKLY IONIZABLE COMPOUNDS - This disclosure relates to dosage forms (e.g., solid dosage forms) comprising a drug-containing emulsion, a drug-containing microemulsion, a self-emulsifying oil composition, or a self-microemulsifying oil composition, wherein each comprises a weakly ionizable drug and a pH modifier. Also provided are pharmaceutical dosage forms (e.g., solid dosage forms) and methods of preparing the same. | 08-23-2012 |
| 20120213856 | Manufacturing Method of Microcapsule - A manufacture method of microcapsule, comprises a step of extraction, by extracting active substance from a sample of Chinese | 08-23-2012 |
| 20120213857 | Method for Producing Pancreatin Pellets - In order to avoid compromising the pharmacological effect of pancreatin caused by the addition of auxiliary materials or binding agents, a pancreatin pellet having a 100% pancreatin content consists exclusively of pancreatin with a residual moisture content of less than 3% by weight, preferably less than 1% by weight or less than 0.5% by weight. | 08-23-2012 |
| 20120219631 | MODIFIED RELEASE FORMULATION OF LACOSAMIDE - The present invention provides a modified release formulation of lacosamide. The modified release formulation of the present invention comprising lacosamide and modified release polymer provides modified release of lacosamide with minimal C | 08-30-2012 |
| 20120231080 | CONTROLLED RELEASE DOSAGE FORMS - The invention provides stable controlled release monolithic coating compositions for use in coating pharmaceutical oral dosage forms comprising a polyglycol having a melting point greater than 55° C. and an aqueous dispersion of a neutral ester copolymer lacking functional groups. | 09-13-2012 |
| 20120231081 | CONTROLLED RELEASE DOSAGE FORMS - The invention provides stable controlled release monolithic coating compositions for use in coating pharmaceutical oral dosage forms comprising a polyglycol having a melting point greater than 55° C. and an aqueous dispersion of a neutral ester copolymer lacking functional groups. | 09-13-2012 |
| 20120237604 | STABLE FAT-SOLUBLE ACTIVE PRINCIPLE PARTICLES - The invention relates to a method for producing fat-soluble active principles, in particular pharmaceutical and/or dietary fat-soluble active principles, in the form of particles. The invention is characterized in that said method comprises the following steps: a) preparation of an oil-in-water emulsion comprising, in weight per cent relative to the total weight of said emulsion: between 8 and 20%, preferably between 10 and 15%, of at least one protein, between 5 and 15%, preferably between 8 and 12%, of at least one sugar, between 0.5 and 3%, preferably between 2 and 3%, of at least one inorganic salt, between 10 and 22%, preferably between 15 and 20%, of at least one fat-soluble active principle in oily form and/or dissolved in an edible oil, and qs for % of water; b) formation of essentially spherical particles by the dispersion of the oil-in-water emulsion obtained at the end of step a) in a fluid; c) addition of at least one protein cross-linking agent to the dispersion obtained at the end of step b); and d) recovery of the active principles in the essentially spherical form. | 09-20-2012 |
| 20120244222 | OSMOTIC MEDIATED RELEASE SYNTHETIC NANOCARRIERS - This invention relates, at least in part, to osmotic mediated release barrier-free synthetic nanocarriers and methods of production and use. | 09-27-2012 |
| 20120244223 | ORALLY DISPERSIBLE TABLET - The present invention provides a preparation with improved disintegration property, a preparation showing improved bioavailability of a medicament, production methods thereof and the like. A rapidly disintegrating preparation comprising granules comprising a medicament coated with a coating layer containing sugar or sugar alcohol; and a disintegrant. A production method of a rapidly disintegrating preparation including a step of producing granules comprising a medicament, a step of forming a coating layer containing sugar or sugar alcohol on the obtained granules and a step of mixing the coated granules with a disintegrant and molding the mixture. | 09-27-2012 |
| 20120258175 | ENCAPSULATED BACTERIOPHAGE FORMULATION - An encapsulated bacteriophage formulation and a method for preparing encapsulated bacteriophage formulation is provided. The method for producing the encapsulated bacteriophage composition involves injection of a molten coating substance comprising stearic acid and palmitic acid present at a ratio of 50:50, into a granulator chamber containing immobilized bacteriophages. The immobilized bacteriophage are agitated by rotation of a base of the chamber and swept by a flow of air at a temperature of between 10° C. and 50° C. | 10-11-2012 |
| 20120263793 | BIO-NANO-PLASMONIC ELEMENTS AND PLATFORMS - The invention relates generally to the field of plasmonics, and more specifically, in one embodiment, it relates to fabricating elements in whole or in part using one or more self-assembling elements comprised of purified, synthetic and or recombinant protein molecule elements and or their accessory elements, and in particular, composed of at least one or more Clathrin and or Coatomer I/II protein molecules, forming one or more self-assembling structure and framework elements of one or more molecular weights, dimensions, geometries, symmetries, configurations and combinations. In another aspect, the invention relates to a method using one or more nanoscale metal surface elements that, when one or more appropriate types or forms of energies are applied to one or more types of metal elements, emit one or more preferred types or forms of surface-plasmon-enhanced electromagnetic radiation and energy. | 10-18-2012 |
| 20120269894 | Ophthalmic Depot Formulations for Periocular or Suconjunctival Administration - The present invention relates to ophthalmic depot formulations comprising an active agent, e.g. embedded in a pharmacologically acceptable biocompatible polymer or a lipid encapsulating agent, e.g. for periocular or subconjunctival administration. | 10-25-2012 |
| 20120276206 | METHOD FOR MANUFACTURING ACID PELLETS - The invention relates to an improved method of manufacturing substantially spherical/ball-shaped tartaric acid starter pellets which are suitable for preparing active substance-containing medicament formulations, as well as the pellets as such that may be obtained in this way, and their use as starting material for the preparation of active substance-containing medicament formulations. | 11-01-2012 |
| 20120276207 | METHODS FOR PREPARATION OF LIPID-ENCAPSULATED THERAPEUTIC AGENTS - Fully lipid-encapsulated therapeutic agent particles of a charged therapeutic agent are prepared by combining a lipid composition containing preformed lipid vesicles, a charged therapeutic agent, and a destabilizing agent to form a mixture of preformed vesicles and therapeutic agent in a destabilizing solvent. The destabilizing solvent is effective to destabilize the membrane of the preformed lipid vesicles without disrupting the vesicles. The resulting mixture is incubated for a period of time sufficient to allow the encapsulation of the therapeutic agent within the preformed lipid vesicles. The destabilizing agent is then removed to yield fully lipid-encapsulated therapeutic agent particles. The preformed lipid vesicles comprise a charged lipid which has a charge which is opposite to the charge of the charged therapeutic agent and a modified lipid having a steric barrier moiety for control of aggregation. | 11-01-2012 |
| 20120276208 | ACUTE COGNITIVE AND MOOD EFFECTS OF PLANT POLYSACCHARIDES IN ADULT HUMAN SUBJECTS - Compositions and methods to improve cognitive performance and mood in an adult human subject's are presented herein. The method of the present invention involved the administration of a dietary supplement comprising plant polysaccharides. The compositions disclosed herein have beneficial effects on memory performance and tasks of high cognitive demand independent of blood glucose responses and despite mental fatigue. | 11-01-2012 |
| 20120276209 | NUCLEIC ACID-CONTAINING LIPID PARTICLES AND RELATED METHODS - Lipid particles containing a nucleic acid, devices and methods for making the lipid particles, and methods for using the lipid particles. | 11-01-2012 |
| 20120308657 | MAGNETIC NANOSTRUCTURES AS THERANOSTIC AGENTS - The present invention relates to magnetic nanostructures as theranostic agents, which provide dual function as diagnostic and therapeutic agents. In particular, the present invention relates to compositions comprising magnetic nanostructures and their use as targeted therapeutic agents for cancers (e.g., medulloblastoma) and Alzheimer's disease and related diseases and conditions. | 12-06-2012 |
| 20120308658 | METHODS AND COMPOSITIONS TO TREAT HEMORRHAGIC CONDITIONS OF THE BRAIN - The described invention provides a nonhuman animal model system for hemorrhagic brain conditions, methods for evaluating a substance for treating the hemorrhagic brain condition in a mammal, methods for treating hematoma expansion or recurrent rebleeding resulting from hemorrhagic brain conditions in a mammal, and pharmaceutical compositions for administration into or at a distance proximal to the hemorrhagic brain condition. | 12-06-2012 |
| 20120308659 | PELLET FORMULATION FOR THE TREATMENT OF THE INTENSTINAL TRACT - An orally adminsterable pharmaceutical pellet formulation for the treatment of the intestinal tract is disclosed, which comprises a core and an enteric coating, the core including, as a pharmaceutical active compound, aminosalicylic acid or a pharmaceutically tolerable salt or a derivative thereof. | 12-06-2012 |
| 20120315334 | PHARMACEUTICAL OR NEUTRACEUTICAL FORMULATION - The invention relates to a pharmaceutical or nutraceutical formulation comprising a core, comprising an active pharmaceutical or nutraceutical ingredient, a penetration promoter and a bioavailability promoting agent, and a polymeric coating for the gastrointestinal targeted release of the active ingredient, characterized in that the bioavailability promoting agent is a pharmaceutically acceptable inhibitor of proteolytic enzymes, which increases the oral bioavailability of the active ingredient by a factor of at least five, compared to a corresponding formulation without the bioavailability promoting agent. | 12-13-2012 |
| 20120321716 | TECHNOLOGY FOR PREVENTING ABUSE OF SOLID DOSAGE FORMS - Abuse resistant pharmaceutical formulations are provided that contain one or more abusable drugs and one or more abuse deterrent components. The abuse deterrent component(s) prevent the abusable drug(s) from being removed/extracted to an appreciable extent and/or rate. The abuse deterrent component(s) may be in the form of pellets, beads, beadlets, granules, powders, or the like, and may comprise a core that contains a material that is both hydrophilic and hydrophobic, and optionally a pH-dependent coating. | 12-20-2012 |
| 20120321717 | DEVICES AND PHARMACEUTICAL COMPOSITIONS FOR ENHANCING DOSING EFFICIENCY - The present invention relates to enhancing the dosing efficiency of pharmaceutical dry powder formulations administered by pulmonary inhalation. In particular, the present invention relates to the provision of dry powder inhalers and dry powder compositions which reproducibly achieve a much higher delivered dose of the pharmaceutically active agent than currently achieved. | 12-20-2012 |
| 20120321718 | Method of Treating Lactose Intolerance Using Genetically Engineered Bacteria - The present invention relates to genetically engineered bacteria that are able to colonize the mammalian intestine and actively produce mammalian lactase (lactose-phlorizin hydrolase or LPH). This lactose-digesting enzyme is stable and active under the conditions normally found in the mammalian small intestine. Experimental subjects colonized with the genetically engineered bacteria show improved ability to digest lactose in dairy foods. | 12-20-2012 |
| 20120328701 | NANOPARTICLE COMPOSITIONS, FORMULATIONS THEREOF, AND USES THEREFOR - The present invention describes novel nanoparticle compositions, and systems and methods utilizing them for treating disorders and/or conditions. Methods generally involve administering nanoparticle compositions (e.g., nanoparticle compositions comprising at least one known therapeutic agent and/or independently active biologically active agent; and/or empty nanoparticle compositions) to a subject in need thereof. | 12-27-2012 |
| 20120328702 | NANOPARTICLE COMPOSITIONS - The present invention describes novel nanoparticle compositions, and systems and methods utilizing them for treating disorders and/or conditions associated with the epidermal and/or dermal level of the skin. Such disorders include acne, hyperhidrosis, bromhidrosis, chromhidrosis, rosacea, hair loss, dermal infection, actinic keratosis, facial wrinkles, muscle contracture, and headache. Methods generally involve administering nanoparticle compositions to the skin. | 12-27-2012 |
| 20130011481 | Pyrroloquinolinyl-Pyrrolidine-2,5-Dione Formulations and Methods for Preparing and Using Same - The present invention provides pyrroloquinolinyl-pyrrole-2,5-dione formulations and methods of treating a cell proliferative disorder, such as a cancer, by administering to a subject in need thereof a therapeutically effective amount of the formulations containing pyrroloquinolinyl-pyrrole-2,5-dione compounds. | 01-10-2013 |
| 20130011482 | DUAL COMPONENT MEDICAMENT DELIVERY SYSTEM - A medicament delivery system is disclosed. The system comprises a descending formulation for delivering the medicament and an ascending formulation to protect a patient being treated with the medicament from the side effects thereof. | 01-10-2013 |
| 20130011483 | FORMULATIONS OF MAZINDOL - Formulations of mazindol having superior stability and methods of administering same are provided. The formulations may be immediate, enhanced, or otherwise delayed release formulations of mazindol. | 01-10-2013 |
| 20130017265 | PARTICLES FOR MULTIPLE AGENT DELIVERY - Delivery compositions are provided that include two or more active agents, wherein at least one active agent is conjugated to a polymer. The delivery compositions allow for controlled release of multiple active agents, including active agents with varying solubility, charge, and/or molecular weight. | 01-17-2013 |
| 20130017266 | Radiation Therapy AgentAANM Ogino; ChiakiAACI Kobe-shiAACO JPAAGP Ogino; Chiaki Kobe-shi JPAANM Tanaka; TsutomuAACI Kobe-shiAACO JPAAGP Tanaka; Tsutomu Kobe-shi JPAANM Sasaki; RyoheiAACI Kobe-shiAACO JPAAGP Sasaki; Ryohei Kobe-shi JPAANM Kondo; AkihikoAACI Kobe-shiAACO JPAAGP Kondo; Akihiko Kobe-shi JP - Provided is a radiotherapeutic agent, including a composite particle, which is obtained by binding a molecule that specifically recognizes a target to a substrate particle including titanium peroxide, and which generates reactive oxygen through irradiation with a radiation. Further, because the radiotherapeutic agent contains the molecule that specifically recognizes a target, the radiotherapeutic agent has a function of accumulating in the target. The radiotherapeutic agent is capable of enhancing effects of radiotherapy, and is capable of reducing side effects on a living body to efficiently attack the target. | 01-17-2013 |
| 20130017267 | METHOD OF MAKING PARTICLES FOR USE IN A PHARMACEUTICAL COMPOSITION - The invention relates to a method for making composite active particles for use in a pharmaceutical composition for pulmonary administration, the method comprising a milling step in which particles of active material are milled in the presence of particles of an additive material which is suitable for the promotion of the dispersal of the composite active particles upon actuation of an inhaler. The invention also relates to compositions for inhalation prepared by the method. | 01-17-2013 |
| 20130022680 | Modalities for the treatment of degenerative diseases of the retina - This invention relates to methods for improved cell-based therapies for retinal degeneration and for differentiating human embryonic stem cells and human embryo-derived into retinal pigment epithelium (RPE) cells and other retinal progenitor cells. | 01-24-2013 |
| 20130022681 | GRANULES FOR PHARMACEUTICAL PREPARATIONS, METHODS AND APPARATUS FOR THEIR PRODUCTION - Disclosed are improved granular pharmaceutical preparations, together with improved methods and apparatus for preparation of granules for use in such preparations. Such methods are especially useful for making granules for solid oral dose pharmaceutical preparations, and are particularly suited to the production of granules comprising 5-aminosalicylic acid (5-ASA) for the treatment of inflammatory bowel disease. The granules exhibit a more sharply peaked length distribution, and hence aspect ratio distribution, and have a consequently much sharper dissolution profile after further processing. | 01-24-2013 |
| 20130028976 | SPRAY-DRIED CRYSTALLINE ACTIVE INGREDIENT - A process for preparing a spray-dried product for improving the rate of dissolution of the active ingredient. The process includes mixing a crystalline active ingredient, which has a dissolution rate in unstirred water at 25° C. of greater than 15 minutes at a concentration of 14 ppm of the active ingredient, with a starch derivative, a second carrier material, and optionally, xanthan gum, to form a suspension, dispersion or solution of the active ingredient; homogenizing the mixture at a pressure of at least 4000 psig (2.758×10 | 01-31-2013 |
| 20130028977 | PHARMACEUTICAL POWDER COMPOSITION FOR INHALATION - The present invention relates to a pharmaceutical powder composition for inhalation comprising an active ingredient and a pharmaceutically acceptable carrier, process for preparing such composition, and its use for the treatment of respiratory disorder in a subject. | 01-31-2013 |
| 20130039987 | METHOD FOR INCREASING THE SOLUBILITY OF A TRANSCRIPTASE INHIBITOR COMPOSITION - The invention provides a method for increasing the solubility of nevirapine, including the steps of rendering nevirapine in a gaseous phase; and rendering the gaseous phase in a relatively more soluble solid particulate form. The invention further provides for a crystalline Form-VI ( | 02-14-2013 |
| 20130039988 | ACTIVE PELLET EXCLUDING CHEMICAL ADDITIVES - Disclosed herein is an active pellet. The active pellet includes a body and interspaces. The body includes an active ingredient ranging from 50 to 100 wt %, free of chemical additives. | 02-14-2013 |
| 20130039989 | PHARMACEUTICAL COMPOSITIONS COMPRISING N-(4-(2-AMINO-3-CHLOROPYRIDIN-4-YLOXY)-3-FLUOROPHENYL)-4-ETHOXY-1-(4-FLUO- ROPHENYL)-2-OXO-1,2-DIHYDROPYRIDINE-3-CARBOXAMIDE - Disclosed are salts and crystalline forms of N-(4-(2-amino-3-chloropyridin-4-yloxy)-3-fluorophenyl)-4-ethoxy-1-(4-fluorophenyl)-2-oxo-1,2-dihydropyridine-3-carboxamide and salts thereof. Also disclosed are at least one pharmaceutical composition comprising at least one crystalline form of N-(4-(2-amino-3-chloropyridin-4-yloxy)-3-fluorophenyl)-4-ethoxy-1-(4-fluorophenyl)-2-oxo-1,2-dihydropyridine-3-carboxamide, at least one method of using at least one crystalline form of N-(4-(2-amino-3-chloropyridin-4-yloxy)-3-fluorophenyl)-4-ethoxy-1-(4-fluorophenyl)-2-oxo-1,2-dihydropyridine-3-carboxamide to treat cancer and/or other proliferative diseases, and processes to prepare crystalline forms of N-(4-(2-amino-3-chloropyridin-4-yloxy)-3-fluorophenyl)-4-ethoxy-1-(4-fluorophenyl)-2-oxo-1,2-dihydropyridine-3-carboxamide and salts thereof. | 02-14-2013 |
| 20130052267 | Methods of Inducing Tissue Regeneration - Methods are provided for producing cells within a lineage (lineage restricted cells) from post-mitotic differentiated cells of the same lineage ex vivo and in vivo, and for treating a subject in need of tissue regeneration therapy by employing these lineage-restricted cells. In addition, the production of lineage restricted cells from postmitotic tissues derived from patients with diseases allows for a characterization of pathways that have gone awry in these diseases and for screening of drugs that will ameliorate or correct the defects as a means of novel drug discovery. Also provided are kits for performing these methods. | 02-28-2013 |
| 20130052268 | COMPOSITIONS AND METHODS FOR TREATMENT OF PARKINSON'S DISEASE - The present invention relates to methods for producing neural cells from progenitor or stem cells by activating both the Wnt1-Lmx1a/Lmx1b and the SHH-FoxA2 signaling pathways by, for example, increasing the biological activity of one or more of Wnt1, Lmx1a, Lmx1b, Otx2 and Pitx3 and one or more of SHH, FoxA2 and Nurr1 in the progenitor or stem cells including embryonic stem cells and iPS cells. Such cells may be used for the treatment of Parkinson's disease. The invention further relates to methods for treating Parkinson's disease by increasing the biological activity of one or more of Wnt1, Lmx1b, Lmx1b, Otx2 and Pitx3 and one or more of SHH, FoxA2 and Nurr1 in the midbrain of a patient. In particular, the biological activity of the proteins can be increased by virtue of a cell penetrating peptide fused to the proteins or by transfecting RNAs encoding the proteins such that the host chromosomal DNAs remain intact. | 02-28-2013 |
| 20130059009 | COMPOSITIONS AND METHODS FOR PRODUCING ANTIGEN-SPECIFIC INDUCED TOLEROGENIC DENDRITIC CELLS WITH SYNTHETIC NANOCARRIERS - Disclosed are antigen-specific induced tolerogenic dendritic cells (itDCs) that are produced from combining itDCs with antigen in particulate form, as well as related compositions and methods. | 03-07-2013 |
| 20130071478 | RETINOID-LIPOSOMES FOR ENHANCING MODULATION OF HSP47 EXPRESSION - What is described are pharmaceutical compositions comprising a double-stranded nucleic acid molecule comprising a sense strand and an antisense strand wherein the sense and antisense strands are selected from the oligonucleotides described as SERPINH | 03-21-2013 |
| 20130078307 | NICOTINE-CONTAINING PHARMACEUTICAL COMPOSITION - A composition intended to be employed for therapeutic purposes incorporates a nicotinic compound, a sugar substitute, and a sugar alcohol syrup. Representative forms of nicotine include free base (e.g., as a mixture of nicotine and microcrystalline cellulose), a nicotine salt (e.g., as nicotine bitartrate) or nicotine polacrilex. The composition is useful for treatment of central nervous system conditions, diseases, and disorders, and as a nicotine replacement therapy. | 03-28-2013 |
| 20130084336 | ENHANCED NITRIC OXIDE DELIVERY AND USES THEREOF - Methods and compositions are disclosed that enhance delivery of nitric oxide (NO) by combining nitric oxide releasing nanoparticles (NO-np) with exogenous glutathione (GSH), as well as therapeutic uses of the methods and compositions. | 04-04-2013 |
| 20130084337 | PURE FILAMENTOUS BACTERIOPHAGE AND METHODS OF PRODUCING SAME - The invention relates to compositions of purified filamentous bacteriophage, as well as methods that allow reproducible purification of high concentrations of filamentous bacteriophage. | 04-04-2013 |
| 20130084338 | Method For Producing Solid Pigment-Containing Film Coating Compositions In The Form Of Granules Based On Enteric Film Formers For Pharmaceutical Dosage Forms - Method for producing pigment-containing granules for pharmaceutical applications based on film-forming enteric polymers, wherein the production of the granules takes place by a spraying process in which the enteric polymeric film formers are introduced as initial charge in a fluidized bed, and an aqueous pigment suspension, which comprises a plasticizer that is solid at 20° C., is sprayed onto the fluidized bed. | 04-04-2013 |
| 20130084339 | COMPOSITION COMPRISING ALUMINUM SILICATES AND SILVER NANOPARTICLES AS BACTERICIDES - The present invention relates to a composition comprising a nanocomposite or nanostructured powder which comprises an aluminium silicate and, distributed on the surface thereof, silver nanoparticles with sizes of less than 50 nm, to its use as a bactericide and to a process for obtaining said composition. | 04-04-2013 |
| 20130095184 | Metal-Containing Materials for Treatment of Bacterial Conditions - Metal-containing materials, as well as their preparation, formulations, and use are disclosed. | 04-18-2013 |
| 20130095185 | STABILIZED TOPICAL FORMULATIONS CONTAINING CORE-SHELL MICROCAPSULES - The present disclosure relates to compositions for topical application, where the compositions comprise microcapsules having a core that comprises benzoyl peroxide and a shell that comprises an inorganic polymer, microcapsules having a core that comprises a retinoid and a shell that comprises an inorganic polymer, and a stabilizing agent. The composition can be in a variety of forms, such as emulsion and gel. | 04-18-2013 |
| 20130108701 | Solid Dosage Forms of Antipsychotics | 05-02-2013 |
| 20130108702 | COPPER/SILICA NANOPARTICLES, METHODS OF MAKING, AND METHODS OF USE | 05-02-2013 |
| 20130115294 | STABLE LIQUID OILY READY-TO-USE FORMULATIONS, PREPARATION THEREOF AND USE THEREOF - The present invention relates to a stable liquid oily ready-to-use formulation comprising an active pharmaceutical ingredient, which has hydrophobic and/or lipophilic properties and/or which exhibits stability problems in aqueous environments. The present invention further relates to a method for preparing said formulation, and said formulation for use in the medical treatment of particular patient groups. | 05-09-2013 |
| 20130122098 | Method and composition to improve absorption of therapeutic agents - A tablet with an enhanced dissolution profile for a medicinally active ingredient such as aspirin and methods for making the tablet. The tablet comprises a blend of crystals of the medicinally active ingredient and a dissolution aid such as sodium or calcium carbonate or bicarbonate that coats the crystals upon co-milling. The blend is then compressed to form tablets that have an enhanced dissolution profile for the medicinally active ingredient. | 05-16-2013 |
| 20130122099 | POLYETHYLENE GLYCOL-COATED SODIUM CARBONATE AS A PHARMACEUTICAL EXCIPIENT AND COMPOSITIONS PRODUCED FROM THE SAME - Non-effervescent pharmaceutical compositions having at least one particle of carbonate coated by a layer of polyethylene glycol that substantially covers the at least one carbonate particle are described. Compositions are also described where the compositions include a weakly basic therapeutic agent, a first pH-modifying agent having at least one particle of carbonate coated by a layer of polyethylene glycol, and a second pH-modifying agent. The weakly basic therapeutic agent could be, but is not limited to, zolpidem or scopolamine. Compositions including zolpidem and scopolamine are used to treat insomnia and depression, respectively. | 05-16-2013 |
| 20130129828 | COMPOSITIONS AND METHODS FOR DELIVERY OF POORLY SOLUBLE DRUGS - Described herein are compositions comprising particles of poorly soluble drugs encapsulated by stabilizers. Further described are pharmaceutical compositions comprising such encapsulated compositions. Also described are methods of making such encapsulated particle compositions, and methods of making the corresponding pharmaceutical compositions. The encapsulated particle compositions described herein allow poorly soluble drugs to be administered with good bioavailability by routes that are non-invasive to patients, such as by oral administration. | 05-23-2013 |
| 20130142878 | PEPTIDE PARTICLE FORMULATION - A composition as disclosed is comprised of a plurality of groups of particles. The particles are comprised of a biocompatible polymer which may be a co-polymer such as PLGA combined with a peptide of a sequence of interest, e.g. a sequence which corresponds to a sequence presented on a surface of a cell infected with a virus. A plurality of different groups of particles are provided in the formulation wherein the particles within any single group include peptides of identical amino acid sequence. The particles are sized such that they are sufficiently large so as to prevent more than the contents of a single particle from being presented to a single immune system cell. | 06-06-2013 |
| 20130142879 | SUSPENSION FORMULATIONS - The present invention relates to suspension formulations, especially those for delivering a pharmaceutically active agent in aerosol form using a spray or aerosol device, such as a pressurised metered dose inhaler (pMDI). The formulations may be for pulmonary, nasal, buccal or topical administration, but are preferably for pulmonary inhalation. | 06-06-2013 |
| 20130149382 | LIQUID COMPOSITIONS COMPRISING A SUSTAINED RELEASE SYSTEM FOR INSECTICIDES - Liquid formulations for controlling arthropod infestation that comprise particles carrying chemical agents that have activity against arthropods, the particles being suspended within the liquid formulation, uses therefor, and methods of producing such liquid formulations. | 06-13-2013 |
| 20130149383 | SUSTAINED RELEASE PARTICLE FORMULATIONS OF GUAIFENESIN - Sustained release particle formulations formed from a hydrophobic wax matrix and guaifenesin. | 06-13-2013 |
| 20130149384 | THERMAL INACTIVATION OF ROTAVIRUS - Methods of thermally inactivating a rotavirus are provided according to the present invention which include exposing the rotavirus to a temperature in the range of about 50° C.-80° C., inclusive, for an incubation time sufficient to render the rotavirus incapable of replication or infection. The thermally inactivated rotavirus is antigenic and retains a substantially intact rotavirus particle structure. Vaccine compositions and methods of vaccinating a subject against rotavirus are provided which include generation and use of thermally inactivated rotavirus. | 06-13-2013 |
| 20130156857 | Pharmaceutical Compositions Containing Diacerein - A once-daily controlled-release formulation of diacerein for treating inflammatory or autoimmune diseases or their complications, with reduced adverse side effects and methods of treating such diseases are disclosed. | 06-20-2013 |
| 20130164379 | NANOPARTICLE MICELLE COATED COMPOSITIONS - Nanoparticle micelle coated compositions and methods for treating a subject having a solid tumor are disclosed. The compositions comprise thiostrepton and a micelle-forming lipid wherein the thiostrepton is encapsulated inside a nanoparticle comprising the micelle-forming lipid. Pharmaceutical compositions comprising a thiostrepton-micelle composition are also disclosed. | 06-27-2013 |
| 20130164380 | COMPOSITIONS AND METHODS FOR TREATING INFLAMMATORY CONDITIONS - The present invention provides methods and compositions for treating inflammatory bowel disease, including ulcerative colitis and Crohn's Disease, and other related conditions, by locally administering to the intestinal mucosa of a subject having inflammatory bowel disease a therapeutically effective amount of IL-27 or a therapeutic variant or fragment thereof. The invention further provides a method to treat inflammatory bowel disease comprising administering to the subject a recombinant microorganism capable of producing a therapeutically effective amount of IL-27 or a variant or fragment thereof in situ in the intestinal mucosa. | 06-27-2013 |
| 20130171259 | METHODS FOR PURIFYING TRANS-(-)-DELTA9-TETRAHYDROCANNABINOL AND TRANS-(+)-DELTA9-TETRAHYDROCANNABINOL - Methods for making trans-(−)-Δ | 07-04-2013 |
| 20130177649 | CO-PROCESSED TABLET EXCIPIENT COMPOSITION ITS PREPARATION AND USE - The invention pertains to a co-processed excipient composition suitable for tableting, said composition comprising at least one filler-binder, at least one disintegrant, and at least one lubricant which have been subjected to granulation together, and said composition partially or completely coated with lactose, preferably in crystalline form. The inventors have overcome the prejudice against the use of lubricants in tableting excipient compositions early in the tableting process. It was found that the alleged detrimental affects of the lubricant in terms of binding and disintegration could readily be controlled in a excipient composition wherein the lubricant is co-processed in the matrix, and the composition is provided with a lactose coat. | 07-11-2013 |
| 20130177650 | PELLET FORMULATION FOR THE TREATMENT OF THE INTESTINAL TRACT - An orally adminsterable pharmaceutical pellet formulation for the treatment of the intestinal tract is disclosed, which comprises a core and an enteric coating, the core including, as a pharmaceutical active compound, aminosalicylic acid or a pharmaceutically tolerable salt or a derivative thereof. | 07-11-2013 |
| 20130177651 | Pharmaceutical Composition Suitable for Use in a Dry Powder Inhaler - This invention relates to a pharmaceutical composition suitable for use in a dry powder inhaler comprising: (i) carrier particles; (ii) active particles on the surface of the carrier particles; and (iii) excipient on the surface of the carrier particles, wherein the excipient comprises phytosterol, phytosterol derivative, phytostanol, phytostanol derivative or combinations thereof. This invention relates to a method of applying the excipient particles onto the carrier particles. | 07-11-2013 |
| 20130183385 | PEPTIDE ANALOGS FOR TREATING DISEASES AND DISORDERS - A peptide having a sequence selected from SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17 and SEQ ID NO:18. Said peptide used for the treatment of type I diabetes, Type II diabetes, metabolic syndrome, or obesity, or of apetite suppression, or for mitigating insulin resistance, or for reducing an undesirably high fasting serum glucose level, or for reducing an undesirably high peak serum glucose level, or for reducing an undesirably high peak serum insulin level, or for reducing an undesirably large response to a glucose tolerance test. | 07-18-2013 |
| 20130189364 | COMPOSITIONS AND METHODS OF POTENTIATING ADJUVANT PHARMACEUTICALS TARGETING LATENT VIRAL INFECTIONS - A composition and method for potentiating, sensitizing, and/or amplifying at least one adjuvant pharmaceutical targeting at least one latent viral infection in a patient is provided. In one embodiment, the composition is administered to potentiate, sensitize and/or amplify an adjuvant pharmaceutical targeting at least one latent viral infection such as those which are currently being investigated for use with anti-HIV drugs/antiretrovirals HAART. | 07-25-2013 |
| 20130195979 | Core-Excited Nanoparticles and Methods of Their Use in the Diagnosis and Treatment of Disease - Core-excited nanoparticle thermotherapy (CENT) represents a new paradigm in thermotherapy. The CENT method employs core-shell nanoparticles. The core of the nanoparticles is formed from one or more core-exciting, energy absorbing materials which absorbs core-exciting energy, either from an external energy source or from an energy source within the nanoparticle core (e.g., one or more radionuclides which undergo decay). Upon excitation by the core-exciting energy, the one or more core-exciting, energy absorbing materials reemit energy. A shell surrounds the particle nanoparticle core. The energy reemitted by the one or more core-exciting, energy absorbing materials is absorbed by the nanoparticle shell, so as to heat the shell of the nanoparticle. The heated nanoparticle then heats the surrounding region, to a temperature sufficient to detect, affect, damage or destroy the targeted cell or material. These core-shell nanoparticles can be administered to a patient in need thereof to treat diseases or disorders, including cancer. CENT nanoparticles can be optionally be bound to targeting agents that deliver them to the region of the diseased cell. | 08-01-2013 |
| 20130195980 | METHOD FOR THE PREPARATION OF A PHARMACEUTICAL COMPOSITION COMPRISING 5-AMINOSALICYLIC ACID FOR USE IN TREATMENT OF ULCERATIVE COLITIS AND CROHN'S DISEASE - The present invention concerns a new method of preparing granules comprising 5-aminosalicylic acid and a new method of preparing a pharmaceutical composition for the treatment of ulcerative colitis or Crohn's disease by oral administration comprising as active ingredient 5-aminosalicylic acid. | 08-01-2013 |
| 20130209564 | Polysaccharide Particle Vaccines - Particle compositions are prepared for use as polysaccharide particle vaccines. | 08-15-2013 |
| 20130209565 | POSOLOGY AND ADMINISTRATION OF GLUCOCORTICOID BASED COMPOSITIONS - The present invention relates to an improved method of administration of glucocorticoid based compositions in glucocorticoid replacement therapies enabling an objectively based regimen for administration enabling correct individual dosing of glucocorticoids resulting in an optimised individual replacement therapy and thus an improved long-term outcome for patients with temporary or chronic adrenal insufficiency. | 08-15-2013 |
| 20130216622 | MODIFIED BETA-LACTAMASES AND METHODS AND USES RELATED THERETO - The present invention relates to pharmaceuticals and modified beta-lactamases. Specifically, the invention relates to novel recombinant beta-lactamases and pharmaceutical compositions comprising the beta-lactamases. Also, the present invention relates to methods for modifying a beta-lactamase, producing the beta-lactamase and treating or preventing beta-lactam antibiotic induced adverse effects. Furthermore, the present invention relates to the beta-lactamase for use as a medicament and to the use of the beta-lactamase in the manufacture of a medicament for treating or preventing beta-lactam antibiotics induced adverse effects. | 08-22-2013 |
| 20130216623 | APPARATUS AND FORMULATIONS FOR SUPRACHORIDAL DRUG DELIVERY - Drug formulations, devices and methods are provided to deliver biologically active substances to the eye. The formulations are delivered into scleral tissues adjacent to or into the suprachoroidal space without damage to the underlying choroid. One class of formulations is provided wherein the formulation is localized in the suprachoroidal space near the region into which it is administered. Another class of formulations is provided wherein the formulation can migrate to another region of the suprachoroidal space, thus allowing an injection in the anterior region of the eye in order to treat the posterior region. | 08-22-2013 |
| 20130224303 | PROCESS OF PRODUCING SHELF STABLE PROBIOTIC FOOD - The invention provides an ingredient containing shelf-stable probiotic microorganisms for use in preparing probiotic food products requiring long shelf-life. The ingredient is prepared by coating particles or an agglomeration thereof with a suspension of osmotically shocked probiotic microorganisms and drying the product. | 08-29-2013 |
| 20130236551 | COMBINATION COMPOSITION USEFUL FOR TREATING CARDIOVASCULAR DISEASES - It is described the use of a combination consisting of a microcapsule suspension comprising one or more statins in alkyl esters of n-3 PUFA in which the statins are isolated from contact with the alkyl ester of n-3 PUFA by means of a polymeric membrane that can be easily disintegrated in the gastrointestinal medium, for the treatment of cardiovascular diseases. | 09-12-2013 |
| 20130236552 | NANOTOPOGRAPHY-MEDIATED REVERSE UPTAKE PLATFORM FOR NUCLEIC ACID DELIVERY AND APPLICATIONS THEREOF - This application discloses a nanotopography-mediated reverse uptake (NanoRU) platform useful for intracellular delivery of nucleic acids into mammalian cells, in particular stem cells, as well as methods of preparation and applications thereof. In particular, this system can be used to deliver small interfering ribonucleic acids (siRNAs) into neural stem cells and enhance neuronal differentiation of the stem cells. | 09-12-2013 |
| 20130236553 | Compositions and Methods for the Delivery of Therapeutics - The present invention provides compositions and methods for the delivery of therapeutics to a cell or subject. | 09-12-2013 |
| 20130243864 | COMPOSITIONS AND THEIR USE TO TREAT COMPLICATIONS OF ANEURYSMAL SUBARACHNOID HEMORRHAGE - The described invention provides a method for treating an interruption of a cerebral artery in a subarachnoid space at risk of interruption caused by brain injury in a mammal, which reduces signs or symptoms of at least one delayed complication associated with brain injury using a flowable sustained release particulate composition. | 09-19-2013 |
| 20130243865 | Antidiabetic Solid Pharmaceutical Compositions - Provided are pharmaceutical compositions in solid form comprising a selective modulator of PPAR-Y suitable for oral dosage to treat subjects having PPAR-Y mediated conditions. Provided further are methods of manufacturing the compositions, and methods of treating a PPAR-Y mediated condition. | 09-19-2013 |
| 20130251809 | Polyamine Derivatives - Disclosed are compounds, compositions and methods for systemic and local delivery of biologically active molecules. | 09-26-2013 |
| 20130251810 | PROCESS FOR PREPARING ORALLY ADMINISTERED DABIGATRAN FORMULATIONS - The invention relates to an improved process for preparing a new medicament formulation of the active substance dabigatran etexilate of formula I | 09-26-2013 |
| 20130251811 | METHOD FOR MANUFACTURING MEDICINAL COMPOUNDS CONTAINING DABIGATRAN - The invention relates to an improved process for preparing a new medicament formulation of the active substance dabigatran etexilate of formula I | 09-26-2013 |
| 20130251813 | FORMULATION OF LACOSAMIDE - A modified release formulation of lacosamide. | 09-26-2013 |
| 20130266655 | PROCESS FOR PRODUCING A MARINE MINERAL CONCENTRATE MADE FROM LITHOTHAMNIUM SEAWEED, AND THE MARINE MINERAL CONCENTRATE OBTAINED THEREFROM - Various embodiments of the present invention refer to a new process for transforming | 10-10-2013 |
| 20130266656 | AMPHIPHILIC COMPOUNDS - Bringing membrane proteins into aqueous solution generally requires the use of detergents or other amphiphilic agents. The invention provides a new class of amphiphiles, each of which includes a multi-fused ring system as a lipophilic group. These new amphiphiles confer enhanced stability to a range of membrane proteins in solution relative to conventional detergents, leading to improved structural and functional stability of membrane proteins, including integral membrane proteins. Accordingly, the invention provides new amphiphiles for biochemical manipulations and characterization of membrane proteins. These amphiphiles display favorable behavior with membrane proteins and can be used to aid the solubilization, isolation, purification, stabilization, crystallization, and/or structural determination of membrane proteins. | 10-10-2013 |
| 20130266657 | MALODOR CONTROL COMPOSITIONS - The invention provides a malodor control composition including a porous material having (1) a porous structure having a surface area of from about 50 to about 1500 m2/g, (2) a pore diameter of from about 1 to about 200 nm, (3) a pore volume of from about 0.3 to about 1.5 cm3/g, and (4) a pronounced hydrophobicity with a surface contact angle greater than 100 degrees. The malodor control composition can be used as an animal litter or in conjunction with other animal litters to provide more effective control for removing odors resulting from animal waste. | 10-10-2013 |
| 20130266658 | Method of producing a PPI-containing pharmaceutical preparation - The present invention relates to a method of producing a pharmaceutical preparation that contains a proton pump inhibitor and optionally a non-steroidal anti-inflammatory drug in the form of pellets. The invention further relates to pharmaceutical preparations obtainable by said method, in particular those with a defined dissolution profile. | 10-10-2013 |
| 20130273168 | SOLID DOSAGE FORM COMPRISING PROTON PUMP INHIBITOR AND SUSPENSION MADE THEREOF - A solid, rapidly gelling oral pharmaceutical dosage form, as well as an aqueous formulation prepared thereof, comprising a) an acid sensitive proton pump inhibitor as active ingredient distributed in a multitude of enteric coated pellets, and b) a suspension modifying granulate. Furthermore, the invention relates to an improved process for the manufacture and the use of such formulation in medical treatment, including prevention of gastrointestinal disorders in humans. | 10-17-2013 |
| 20130280334 | Nanostructured Gels Capable of Controlled Release of Encapsulated Agents - Self-assembled gel compositions including a gelator, e.g., an enzyme-cleavable gelator, e.g., having a molecular weight of 2500 or less, are described. The self-assembled gel compositions can encapsulate one or more agents. Methods of making the self-assembled gel compositions, and methods of drug delivery using the self-assembled gel compositions are also described. | 10-24-2013 |
| 20130287856 | Drug Delivery Dispersion And Film Formed Therefrom - An active agent delivery dispersion includes water, 1 to 98 weight percent of a plurality of encapsulated particles dispersed in the water, and 0.1 to 20 weight percent of an active agent, each based on a total weight of the dispersion. The active agent is dispersed in the water independently from the plurality of encapsulated particles. Each of the particles includes a core and a layer including a silica disposed about the core. The plurality includes first and second populations of encapsulated particles. The core of the first population includes a first organopolysiloxane having at least two silicon-bonded alkenyl groups per molecule and a hydro-silylation catalyst. The core of the second population includes an organohydrogensiloxane having an average of greater than two silicon bonded hydrogen atoms per molecule and a second organopolysiloxane having at least two silicon-bonded alkenyl groups per molecule. | 10-31-2013 |
| 20130295186 | METHOD FOR COATING PARTICLES WITH CALCIUM PHOSPHATE AND PARTICLES, MICROPARTICLES AND NANOPARTICLES FORMED THEREOF - The present invention relates to a method for coating particles with calcium phosphate (CaP), wherein the particles are negatively charged. The method includes contacting the particles with a first solution containing calcium ions, removing the first solution to obtain a precipitate, and contacting the precipitate with a second solution containing phosphate ions to obtain CaP-coated particles. | 11-07-2013 |
| 20130302426 | Modalities for the treatment of degenerative diseases of the retina - This invention relates to methods for improved cell-based therapies for retinal degeneration and for differentiating human embryonic stem cells and human embryo-derived into retinal pigment epithelium (RPE) cells and other retinal progenitor cells. | 11-14-2013 |
| 20130302427 | MEDICAL DEVICE HAVING A SURFACE COMPRISING NANOPARTICLES - A medical device has a surface intended for contact with living tissue, wherein the surface comprises nanoparticles comprising a non-toxic post-transition metal such as gallium and/or bismuth, said nanoparticles having an average particle size of 500 nm or Less. The nanoparticles may provide an antimicrobial effect, and thus the risk for infection may be reduced. | 11-14-2013 |
| 20130302428 | PROCESS FOR PREPARING CARBON PROTECTED SUPERPARAMAGNETIC OR MAGNETIC NANOSPHERES - A process for the preparation of carbon protected superparamagnetic or magnetic nanospheres is claimed which comprises the steps: | 11-14-2013 |
| 20130302429 | METHOD FOR ENCAPSULATING PARTICLES - The present invention relates to a method for encapsulating particles of a water-insoluble material within a capsule of a water-insoluble polymer, comprising (a) dispersing particles of the water-insoluble material or a solution containing the water-insoluble material in a first aqueous phase containing a first surfactant to obtain a first dispersion; (b) collecting the particles of the water-insoluble material coated with the first surfactant; (c) washing the collected particles; (d) adding the washed surfactant-coated water-insoluble material particles to a polymer solution containing the water-insoluble polymer of the capsule to obtain a polymer mixture; and (e) dispersing the polymer mixture in a second aqueous phase containing a second surfactant to obtain a second dispersion comprising the particles of the water-insoluble material encapsulated within the capsule of the water-insoluble polymer. | 11-14-2013 |
| 20130309309 | CRYSTALLINE ANTI-HTNFALPHA ANTIBODIES - The present invention relates to a batch crystallization method for crystallizing an anti-hTNFalpha antibody which allows the production of said antibody on an industrial scale; antibody crystals as obtained according to said method; compositions containing said crystals as well as methods of use of said crystals and compositions. | 11-21-2013 |
| 20130309310 | Injectable Nanoparticulate Olanzapine Formulations - Described are injectable formulations of particulate olanzapine that produce a prolonged duration of action upon administration, and methods of making and using such formulations. The injectable formulations comprise particulate olanzapine. | 11-21-2013 |
| 20130309311 | PELLET FORMULATION FOR THE TREATMENT OF THE INTESTINAL TRACT - An orally administrable pharmaceutical pellet formulation for the treatment of the intestinal tract is disclosed, which comprises a core and an enteric coating, the core including, as a pharmaceutical active compound, aminosalicylic acid or a pharmaceutically tolerable salt or a derivative thereof. | 11-21-2013 |
| 20130309312 | DERMAL COMPOSITION COMPRISING POLYMERIC REVERSED MICELLE, AND METHOD FOR PRODUCING SAME - The present invention provides a dermal composition comprising a polymeric reversed micelle that allows a water-soluble drug to be efficiently encapsulated and that is superior in percutaneous absorptiveness and very safe, and provides a method that can produce the composition in simple steps. The dermal composition comprises a polymeric reversed micelle composed of an amphipathic polymer having a hydrophilic segment and a hydrophobic segment, wherein the polymeric reversed micelle has a configuration in which the hydrophilic segment is the core and the hydrophobic segment is the shell, and a water-soluble drug is encapsulated therein. The composition can be produced by blending an oil phase comprising the amphipathic polymer in an oily base agent with an aqueous phase comprising the water-soluble drug in an aqueous solvent, or by blending an oily base agent with an aqueous phase comprising the amphipathic polymer and the water-soluble drug in an aqueous solvent. | 11-21-2013 |
| 20130315999 | COMPOSITIONS AND METHODS COMPRISING ENERGY ABSORBING COMPOUNDFS FOR FOLLICULAR DELIVERY - The present invention provides compositions comprising energy (e.g., light) absorbing submicron particles (e.g., nanoparticles comprising a silica core and a gold shell) and methods for delivering such particles via topical application. This delivery is facilitated by application of mechanical agitation (e.g. massage), acoustic vibration in the range of 10 Hz-20 kHz, ultrasound, alternating suction and pressure, and microjets. | 11-28-2013 |
| 20130316000 | COMPOSITIONS AND METHODS FOR TREATMENT OF IRRITABLE BOWEL SYNDROME WITH 5-AMINOSALICYLATE - Embodiments are directed to compositions and related methods for treating gastrointestinal disorders with a granulated mesalamine formulation. In some embodiments, the gastrointestinal disorder being treated is irritable bowel syndrome (IBS). In some embodiments, the gastrointestinal disorder being treated is diarrhea-predominant IBS (d-IBS). | 11-28-2013 |
| 20130316001 | PARTICLES, COMPOSITIONS AND METHODS FOR OPHTHALMIC AND/OR OTHER APPLICATIONS - Particles, compositions, and methods that aid particle transport in mucus are provided. The particles, compositions, and methods may be used, in some instances, for ophthalmic and/or other applications. In some embodiments, the compositions and methods may involve modifying the surface coatings of particles, such as particles of pharmaceutical agents that have a low aqueous solubility. Such compositions and methods can be used to achieve efficient transport of particles of pharmaceutical agents though mucus barriers in the body for a wide spectrum of applications, including drug delivery, imaging, and diagnostic applications. In certain embodiments, a pharmaceutical composition including such particles is well-suited for ophthalmic applications, and may be used for delivering pharmaceutical agents to the front of the eye and/or the back of the eye. | 11-28-2013 |
| 20130316002 | COMPOSITIONS AND METHODS FOR TREATING GASTROINTESTINAL MOTILITY DYSFUNCTION - Extended release oral dosage forms for the treatment of gastrointestinal motility disorders are described. Active agents which are small molecules, peptides, peptide analogs, and peptide mimetics are formulated for optimal release in the GI tract of subjects with GI motility dysfunction. Methods of treatment using the dosage forms are also described. | 11-28-2013 |
| 20130316003 | CONTROLLED RELEASE PHARMACEUTICAL COMPOSITIONS COMPRISING A FUMARIC ACID ESTER - The invention features a method of treating a subject in need of treatment for multiple sclerosis. The method involves orally administering to the subject in need thereof a pharmaceutical composition in unit dosage form consisting essentially of (a) from about 120 mg to about 240 mg of dimethylfumarate formulated for delayed release, and (b) one or more pharmaceutically acceptable excipients, wherein following the orally administering of the unit dosage form monomethylfumarate appears in the plasma of the subject upon hydrolysis of dimethylfumarate and the Cmax of the monomethylfumarate in the plasma of the subject is between about 0.4 and about 2 mg/L, and wherein about 480 mg of dimethylfumarate per day is orally administered to the subject. | 11-28-2013 |
| 20130316004 | COMPOSITIONS AND METHODS FOR STABILIZING SUSCEPTIBLE COMPOUNDS - Methods for increasing the stability of, or protecting, labile components such as ethanolamine, growth factors, vitamins, etc., in compositions such as a cell culture medium. Stability of the labile compound is increased either, by derivatization of the labile compound with chemicals, or by sequestering the labile compound. Sequestering can be done either by encapsulation within a microcapsule, or by the use of sequestering agents. Encapsulation includes the encapsulation of dendrimers complexes of susceptible compounds within the microcapsule, thereby providing the controlled release of the susceptible compound that was protected. | 11-28-2013 |
| 20130316005 | COMBINATION AND COMPOSITION FOR TREATING OBESITY - The present invention relates to the pharmaceutical field, especially the field of combination and pharmaceutical compositions that comprise a lipase inhibitor and a phytoalexin and pharmaceutically acceptable vehicles or excipients; the present invention also relates to the method for manufacturing compositions containing the combination and the use of said composition in the treatment of conditions of excess weight, obesity and related health problems. | 11-28-2013 |
| 20130323308 | METHODS AND COMPOSITIONS FOR TREATING CONDITIONS RELATED TO LACK OF BLOOD SUPPLY, SHOCK AND NEURONAL INJURIES - A pharmaceutical composition comprising an amphiphilic emulsifier, a polar liquid carrier and, optionally, a lipid component. The amphiphilic emulsifier form free-moving, optionally lipid-carrying, micelles (LMs) in the polar liquid carrier. The pharmaceutical composition is free of hemoglobin and fluorocarbon and can be used for treating conditions related to lack of blood supply and to raise the blood pressure and correct hypovolemia. | 12-05-2013 |
| 20130323309 | Sustained Release Composition of Memantine - A sustained release pharmaceutical composition comprising; a core including memantine or its pharmaceutically acceptable salts and one or more pharmaceutical acceptable excipients, and a sustained release coating comprising a water insoluble substance and a water soluble substance where the ratio of the water insoluble substance to the water soluble substance is from about 1:0 to about 3:5:1, optionally containing an immediate release coating having memantine where the immediate release coating is applied over the sustained release coating. | 12-05-2013 |
| 20130330410 | Silica-Coated Calcium Salt Compositions - A composition including calcium salt and silica, wherein the silica is in the form of a silicate that is adsorbed onto the surface of the calcium salt, wherein the silica is not incorporated into the structure of the calcium salt, and wherein the composition is bioactive. | 12-12-2013 |
| 20130337069 | SILICON NANOPARTICLEFOR PHOTODYNAMIC CANCER TREATMENT UTILIZING QUANTUM DOT OPTICAL PROPERTIES - Quantum active sized silicon nanoparticles with a silicon core covered by a thin 0.5-1.5 nm oxide/nitride shell are described for light exposure in the 300-600 nm range for transforming atmospheric oxygen to singlet oxygen for causing cell apoptosis as a type of photodynamic cancer therapy. A method of use of the nanoparticle in a non-hydrophobic cream is also taught along with a blocking scheme for controlled reaction of the nanoparticle. | 12-19-2013 |
| 20130344154 | Immortal Unipotent Porcine PICM-19H and PICM-19B Stem Cell Lines - Two cell lines, PICM-19H and PICM-19B, were derived from the bipotent ARS-PICM-19 pig liver stem cell line. The unipotent porcine stem cell line PICM-19H differentiates exclusively into hepatocytes and can be induced to express CYP450 enzymes. The growth rate and cell density in culture, morphological features, and hepatocyte detoxification functions, i.e., inducible CYP450 activity, ammonia clearance, and urea production of the PICM-19H cells were evaluated for their application in artificial liver devices. PICM-19H cells contain numerous mitochondria, Golgi apparatus, smooth and rough endoplasmic reticulum, vesicular bodies and occasional lipid vacuoles and display inducible CYP450 activity, clear ammonia, and produce urea in a glutamine-free medium. The data indicate that both cell lines, either together or alone, may be useful as the cellular substrate for an artificial liver device. The results demonstrate the potential for the use of PICM-19H cells in drug biotransformation and toxicity testing. | 12-26-2013 |
| 20140004201 | Treatment of Vascular Diseases Using Encapsulated Cells Encoding and Secreting GLP-1, or a Fragment or Variant Thereof | 01-02-2014 |
| 20140004202 | GAMMA-HYDROXYBUTYRIC ACID GRANULES | 01-02-2014 |
| 20140010884 | DERMATOLOGICAL COMPOSITIONS COMPRISING RETINOIDS, DISPERSED BENZOYL PEROXIDE AND CARRAGEENANS - Dermatological compositions containing, in a physiologically acceptable medium, at least one retinoid, dispersed benzoyl peroxide and at least one gelling agent of the family of the carrageenans, are useful for treating dermatological conditions and afflictions linked to disorders of cell differentiation and/or proliferation and/or keratinization, notably for treating acne vulgaris. | 01-09-2014 |
| 20140017321 | METHODS AND MEDICAMENTS FOR ADMINISTRATION OF IBUPROFEN - A method for administration of ibuprofen to a subject in need of ibuprofen treatment is provided, in which an oral dosage form comprising a therapeutically effective amount of ibuprofen and a therapeutically effective amount of famotidine is administered three times per day. | 01-16-2014 |
| 20140017322 | SUPRAMOLECULAR FUNCTIONALIZATION OF GRAPHITIC NANOPARTICLES FOR DRUG DELIVERY - Disclosed are nanoparticles, such as carbon nanotubes or other graphitic sheet materials having extended aromatic surfaces, which are used to deliver active agents such as drugs, labels or dyes (termed for convenience a “drug”) to the interior of cells. The nanoparticles are functionalized by a hydrophilic polymer or adsorption of an amphiphilic molecule to render them stable in suspension. The drug is therefore capable of release in the cell exterior. The drug is more rapidly released at lower pH, as found e.g., in tumor cells. The drug may also be linked to a branched chain hydrophilic polymer, so that each polymer molecule carries more than one drug bound by a cleavable linker. | 01-16-2014 |
| 20140030344 | TARGETED SYNTHETIC NANOCARRIERS WITH PH SENSITIVE RELEASE OF IMMUNOSTIMULATORY AGENTS - This invention relates to compositions, and related methods, of synthetic nanocarriers that target sites of action in cells, such as antigen presenting cells (APCs), and comprise immunomodulatory agents that dissociate from the synthetic nanocarriers in a pH sensitive manner. Also disclosed are compositions and methods relating to synthetic nanocarriers that encapsulate labile immunomodulatory agents that dissociate from the synthetic nanocarriers in a pH sensitive manner. | 01-30-2014 |
| 20140030345 | Surface-Modified Heavy Metal Nanoparticles, Compositions And Uses Thereof - Surface-modified heavy metal nanoparticles, including a heavy metal core and a coating layer, the coating layer having at least one ligand, conjugated to polyethylene glycol, the at least one ligand is selected from N-acetyl cysteine, albumin, cysteine, methionine, glutathione, amino thiols, thio-carboxylic acids, ammonia, amines, diamines or any combination thereof. Compositions including surface-modified heavy metal nanoparticles and uses thereof in treatment and diagnosis of various conditions. | 01-30-2014 |
| 20140030346 | DISINTEGRABLE CORE PARTICLE FOR PHARMACEUTICAL PREPARATION - Provided is a core particle for a pharmaceutical preparation, capable of delivering a relatively large amount of a drug active ingredient, in particular, at a predetermined timing. This invention relates to a disintegrable core particle for a pharmaceutical preparation, which core particle is adapted for formation, on the particle surface, of a drug active ingredient-containing film, wherein (1) the core particle includes a pharmaceutically acceptable inorganic material and a disintegration promoting agent, (2) the inorganic material is poorly soluble in water, (3) the inorganic material has a content of from 50 to 95 wt %, and (4) the core particle has a bulk density of at least 0.6 g/mL. | 01-30-2014 |
| 20140037738 | TRANSDERMAL FORMULATION CONTAINING COX INHIBITORS - Disclosed are gel compositions suitable for the topical administration of an active compound having poor solubility and skin penetration, for example, of a COX-2 inhibitor compounds, processes of preparation thereof and methods of use thereof for the treatment of indications treatable by the active compound. | 02-06-2014 |
| 20140037739 | Method and System to Provide Personalized Pharmaceutical Compositions and Dosages - Provided is a method for assessing cardiovascular risk in Metabolic Syndrome and Type 2 Diabetes patients. The method involves obtaining data from a Type 2 diabetes patient or a Metabolic Syndrome patient and determining a Fayad/Schentag index which includes a Glucose Supply Index (S) to an Insulin Demand Index (D) ratio. The Fayad/Schentag index is used in scoring cardiovascular risks of Metabolic Syndrome patients and for recommending and implementing therapeutic interventions that can be shown to lower cardiovascular risk | 02-06-2014 |
| 20140037740 | CONTROLLED RELEASE PHARMACEUTICAL COMPOSITIONS COMPRISING A FUMARIC ACID ESTER - The invention features a delayed release composition wherein the active ingredient consists essentially of about 240 mg of dimethylfumarate and one or more pharmaceutically acceptable excipients. | 02-06-2014 |
| 20140037741 | NOVEL NANOPARTICLES - Methods for the preparation of polymer-templated core-shell nanoparticles include the steps of (a) preparing a cationic polymeric core material comprising polymeric micelles, and (b) coating the core material with a silica-comprising shell by depositing the shell onto the polymeric micelles from at least one silica precursor to form the core-shell nanoparticles. Compositions which include the core-shell nanoparticles are adapted to facilitate controlled delivery of at least one active agent into a system in response to controlled changes in the pH of the system. | 02-06-2014 |
| 20140050793 | Novel Compositions for Inhibiting Virus Entry and Promoting Virolysis, and Methods Thereof - The present invention includes a composition comprising a gold nanoparticle complexed with a cysteine-containing peptide. The invention also includes the method of preparing a composition comprising a gold nanoparticle complexed with a cysteine-containing peptide. The invention further includes a method of causing virolysis of a virus using the compositions described therein. | 02-20-2014 |
| 20140050794 | PHARMACEUTICAL COMPOSITION FOR USE AS A CONTRACEPTIVE - A pharmaceutical composition comprises, as a first active agent, 6β,7β;15β,16β-dimethene-3-oxo-17α-pregn-4-ene-21,17-carbolactone (drospirenone) in an amount corresponding to a daily dosage, on administration of the composition, of from about 2 mg to about 4 mg, and, as a second active agent, 17α-ethinylestradiol (ethinylestradiol) in an amount corresponding to a daily dosage of from about 0.01 mg to about 0.05 mg, together with one or more pharmaceutically acceptable carriers or excipients. | 02-20-2014 |
| 20140050795 | BINDER POWDERS - The present disclosure relates generally to binder powders for use in powder material processing and processes for their preparation. The disclosure further relates to binder powders for use in making solid powder compact forms, solid powder compact forms containing said binder powders and methods for making solid powder compact forms. | 02-20-2014 |
| 20140056983 | FOOD ADDITIVE FOR RUMINANTS BASED ON EUGENOL AND CINNAMALDEHYDE - The invention concerns a composition based on a mixture of eugenol and cinnamaldehyde, as food additive for feeding ruminants. The composition may be incorporated in a food additive or a salt block. The eugenol and the cinnamaldehyde may be natural or identical natural constituents. Administering the composition of the food additive increases meat production and milk production. | 02-27-2014 |
| 20140056984 | Modified Release Formulations Containing Drug-Ion Exchange Resin Complexes - An aqueous liquid suspension containing a coated drug-ion exchange resin complex comprising a core composed of an amphetamine complexed with a pharmaceutically acceptable ion-exchange resin and an uncoated amphetamine-ion exchange resin complex is provided. The coated amphetamine-ion exchange resin complex is in admixture with a polymer to form a matrix. Methods of making the coated complex and the liquid suspension are described. | 02-27-2014 |
| 20140056985 | METHOD FOR PRODUCTION OF PARTICLES OF PHARMACEUTICAL SUBSTANCES AND THE USE THEREOF - The invention relates to a method for producing particles with a length-width ratio of less than about 1.4 from a pharmaceutical substance, which method includes the following stages, that is: (a) provision of a melt of the pharmaceutical substance; (b) production of droplets of the melt by spraying into a processing chamber; (c) repeated guiding of solid particles past sprayed droplets in the processing chamber with the aid of a process gas jet which is guided in a defined way and whose temperature is fixed, depending on the solidification point of the melt, so that at least some of the droplets come into contact with particles and solidify thereon; (d) removal of particles from the processing chamber as a function of the particle size. The invention further relates to particles of pharmaceutical substances and the use thereof. | 02-27-2014 |
| 20140065226 | THERMO-RESPONSIVE HYDROGEL COMPOSITIONS - A thermo-responsive hydrogel, including a biocompatible monomer and/or polymer having a side chain-linked amino acid. The hydrogel is thermo-responsive at a physiological temperature, and can include, incorporate, or encapsulate a treatment agent, such as a drug composition, a biomolecule, and/or a nano-particle. The hydrogel is useful in delivering the treatment agent. The hydrogel is in a first physicochemical state for administration to a mammal. The hydrogel is thermo-responsive at a physiological temperature of the mammal, and changes to a second physicochemical state that is more solid than the first physicochemical state. In the second physicochemical state the thermo-responsive hydrogel releases the treatment agent. | 03-06-2014 |
| 20140065227 | NEURAL STEM CELLS DERIVED FROM INDUCED PLURIPOTENT STEM CELLS - The present invention provides novel populations of neural stem cells derived from induced pluripotent stem cells, and methods for making and using the same. | 03-06-2014 |
| 20140065228 | NOVEL LIPID FORMULATIONS FOR NUCLEIC ACID DELIVERY - The present invention provides novel, stable lipid particles comprising one or more active agents or therapeutic agents, methods of making the lipid particles, and methods of delivering and/or administering the lipid particles. More particularly, the present invention provides stable nucleic acid-lipid particles (SNALP) comprising a nucleic acid (such as one or more interfering RNA), methods of making the SNALP, and methods of delivering and/or administering the SNALP. | 03-06-2014 |
| 20140065229 | HYDROPHOBIC AND HYDROPHYLIC AEROGELS ENCAPSULATED WITH PEG HYDROGEL VIA SURFACE INITIATED PHOTOPOLYMERIZATION - A composite of silica aerogel and a hydrogel synthesized by and a method for the sequential formation thereof including the encapsulation of hydrophobic aerogels with PEG hydrogel via photoinitiated polymerization. The aerogel-hydrogel composite has two layers: the outer layer hydrogel layer is hydrophilic, whereas the inner aerogel core is hydrophobic. | 03-06-2014 |
| 20140065230 | MULTIPARTICULATE L-MENTHOL FORMULATIONS AND RELATED METHODS - A multiparticulate formulation includes a plurality of individual spheroidal enteric coated cores containing L-menthol from an at least 80% pure L-menthol source. A subcoat is beneath the enteric coat. The enteric coated cores have a diameter of not more than 3 mm. The multiparticulate formulation may be used to treat gastrointestinal disorders, such as irritable bowel syndrome. | 03-06-2014 |
| 20140065231 | CONTROLLED RELEASE COMPOSITIONS FOR TREATMENT OF COGNITIVE, EMOTIONAL AND MENTAL AILMENTS AND DISORDERS - A montelukast composition having a therapeutically effective amount of montelukast in a sustained release is disclosed. A montelukast composition having a therapeutically effective amount of montelukast in an immediate release and sustained release is also disclosed. | 03-06-2014 |
| 20140072637 | TREATMENT FOR BONE FORMATION DISORDERS BY GROWTH FACTOR DELIVERY - It has been discovered that that certain growth factors can delay the ossification of a tissue site, such as a cranial suture, via the promotion of fibroblast differentiation and/or inhibition of osteoblast differentiation. Provided herein are methods for treating bone formation conditions or disorders, such as synostotic conditions, or ectopic mineralization conditions, via administration of compositions comprising connective tissue growth factor (CTGF), and optionally other growth factors or fibroblast or progenitor cells, to a tissue site of a subject in need thereof. | 03-13-2014 |
| 20140072638 | BONE PASTE COMPOSITION - Bone paste compositions are described, which promote bone healing and remodeling by stimulating bone marrow elements using a combination of hemopoietic agents, angiogenic agents and a bone molecular signaling material. | 03-13-2014 |
| 20140072639 | NANOLIPIDIC PARTICLE ASSEMBLY POPULATIONS - Nanolipidic Particles (NLPs) having average mean diameters of 1 nm to 20 nm are made from a precursor solution. NLPs can be loaded with a desired passenger molecule. Assemblies of these particles, called NLP assemblies, result in a vehicle population of a desired size. Single application or multifunction NLP assemblies are made from the loaded NLPs and range in size from about 30 to about 200 nm. A method of using preloaded NLPs to make larger carrier vehicles or a mixed population provides increased encapsulation efficiency. NLPs have application in the cosmetics, pharmaceutical, and food and beverage industries. | 03-13-2014 |
| 20140072640 | Coating Method - A method of coating an article includes the steps of providing a powder comprising coated particles; and spray coating the powder onto a surface of the article to form a composite coating. The spray coating may be carried out by combustion spraying, gas plasma spraying, including vacuum plasma spraying (VPS), and cold spraying. The article may be an implant for surgical or dental use. The powder may include particles of metal coated calcium phosphates, especially metal coated hydroxyapatite. The particles may include bioactive agents. | 03-13-2014 |
| 20140072641 | METHOD FOR THE REALISATION OF A BIOMATERIAL COMPRISING CALCIUM PHOSPHATE SHAPED AS GRANULES AND/OR THEIR AGGLOMERATES AND BIOMATERIAL OBTAINED WITH THIS METHOD - Method for the realization of a calcium phosphate-based biomaterial in form of granules and/or agglomerates of re-absorbable granules which can be used in the biomedical industry as, e.g., bone fillers, for increasing the bone mass, as a sealing for the internal orthopaedic prosthesis, for releasing drugs and/or medicaments and/or other substances beneficial for the organism. A calcium phosphate-based biomaterial in form of granules and/or aggregates thereof obtained according to such method. | 03-13-2014 |
| 20140072642 | ENDOTHELIAL PROGENITOR CELLS LABELLED WITH SUPERPARAMAGNETIC IRON OXIDE MICRO AND NANOPARTICLES IN CEREBROVASCULAR DISORDERS, PROCESS FOR THEIR PREPARATION AND USES THEREOF - The invention relates to the use of endothelial progenitor cells (EPC) that comprises superparamagnetic particle aggregates which are able for the preparation of a medicament. Particular nanoparticle aggregates with a coating of compounds with net negative charge, and the method for obtaining them are also disclosed. | 03-13-2014 |
| 20140079786 | Fiber Spheres - The disclosure pertains generally to spheres made from a fiber source. These spheres may be used as cores for carrying other ingredients or may be used alone for applications in the food, pharmaceutical, nutraceutical, personal care, and industrial industries. In many embodiments the ingredients used in this invention are derived from a natural resource, and are safe to ingest. In some embodiments, the spheres are formed using a centrifugal tumbling-granulating-coating apparatus. | 03-20-2014 |
| 20140093573 | NON-ENTERIC COATED PHARMACEUTICAL COMPOSITION AND USE THEREOF - A non-enteric coated pharmaceutical composition having an enhanced bioavailability comprising an acid-labile active ingredient and a nanolized biocompatible polymer, wherein the acid-labile active ingredient is mixed with and trapped by the nanolized biocompatible polymer, and the acid-labile active ingredient is sustainably released from the nanolized biocompatible polymer. | 04-03-2014 |
| 20140093574 | Highly Compactable and Durable Direct Compression Excipients and Excipient Systems - The present invention relates to solid dispersions including, but not limited to, co-processed carbohydrates with different solubilities and concentrations, which have a microcrystalline plate structure. The solid dispersions, excipient systems and formulations of the present invention are highly compactable and durable and when compressed into solid dosage forms demonstrate uniform densification, low friability at low pressures, and and/or relatively constant low disintegration times at various hardnesses. The solid dosage forms of the present invention demonstrate superior organoleptics, disintegration, and/or robustness. | 04-03-2014 |
| 20140099377 | CONTINUOUS METHOD FOR PRODUCING NANOPARTICLES AND NANOPARTICLES OBTAINED BY MEANS OF SAID METHOD - The invention relates to a continuous method for producing inorganic or organic nanoparticles having multiple nuclei functionalised with proteins, using a T-type reactor that operates at high pressure, the primary particles that form the nuclei of the nanoparticles being smaller than 10 nm and said primary particles being immersed in a proteinaceous matrix that forms the nanoparticle in sizes of between 30 nm and 500 nm. The invention also relates to the nanoparticles produced by means of said method. | 04-10-2014 |
| 20140105988 | GRANULATED MATERIAL MIXTURE COMPRISING TWO DIFFERENT GRANULATED MATERIALS FOR ARTIFICIAL CALLUS DISTRACTION - A granulate mixture suitable for regenerating a bone contains at least one expandable particle and at least one nondeformable particle. The at least one expandable particle contains a swelling agent. The swelling is enclosed by a biodegradable sheathing or be a biodegradable casing. Three-dimensional callus distraction may be accomplished by introducing the granulated mixture into a bone defect. | 04-17-2014 |
| 20140105989 | Treatment Methods with Low-Dose, Longer-Acting Formulations of Local Anesthetics and Other Agents - Drug formulations that provide sustained action and/or reduced dosage requirements are provided. In the formulations the drugs (particularly local anesthetics) are associated with reversed cubic phase and reversed hexagonal phase lyotropic liquid crystalline material. | 04-17-2014 |
| 20140105990 | USE OF EPIDERMAL GROWTH FACTOR FOR THE MORPHOFUNCTIONAL RESTORATION OF PERIPHERAL NERVES IN DIABETIC NEUROPATHY - The present invention is relevant to human medicine, and, in particular, to the use of Epidermal Growth Factor (EGF) in a pharmaceutical composition, said composition is administered through infiltration at the periphery of nerve trunks and/or ganglia, for the morphofunctional restoration of peripheral nerves in painful, sensitive-motor neuropathy, as well as ischemic neuritis. It is also relevant to an EGF containing composition, where this molecule can be formulated together with anesthetic or analgesic drugs, or encapsulated in microspheres, and their use for the morphofunctional restoration of peripheral nerves in painful, sensitive-motor neuropathy, as well as in ischemic neuritis. | 04-17-2014 |
| 20140112994 | Method for Making Medical Devices Having Antimicrobial Coatings Thereon - The present invention provides a method for preparing a medical device, preferably a contact lens, having an antimicrobial metal-containing LbL coating on a medical device, wherein the antimicrobial metal-containing LbL coating comprises at least one layer of a negatively charged polyionic material having —COOAg groups and/or silver nanoparticles formed by reducing Ag | 04-24-2014 |
| 20140112995 | MULTI-LAYERED, MULTIPLE UNIT PHARMACEUTICAL COMPOSITIONS - The present invention relates to pharmaceutical compositions comprising multilayered multiple units and processes for the preparation thereof. | 04-24-2014 |
| 20140120167 | MULTIFUNCTIONAL CHEMO- AND MECHANICAL THERAPEUTICS - Methods of treating diseases through the intracellular enhancement and synergy of chemo- and radiation-therapies by employing cancer cell-specific on-demand mechanical intracellular impact. The methods, quadrapeutics, combines four clinically validated modalities: encapsulated drugs, colloidal gold nanoparticles (GNPs), near-infrared short laser pulses, and X-rays. | 05-01-2014 |
| 20140127305 | MULTIFUNCTIONAL NANOPARTICLE DESIGNS AND APPLICATIONS - Methods, structures, devices and systems are disclosed for fabricating and implementing nanoparticles with hollow core and sealable holes. In one aspect, a nanoparticle device can includes a shell structure including at least two layers including an internal layer and an external layer, the internal layer structured to enclose a hollow interior region and include one or more holes penetrating the internal layer, the external layer is of a porous material and formed around the internal layer and sealing the one or more holes, and a substance contained within the hollow interior region, the substance incapable of passing through the external layer. | 05-08-2014 |
| 20140127306 | Modified Release Formulations Containing Drug-Ion Exchange Resin Complexes - An aqueous liquid suspension containing a coated drug-ion exchange resin complex comprising a core composed of an amphetamine complexed with a pharmaceutically acceptable ion-exchange resin and an uncoated amphetamine-ion exchange resin complex is provided. The coated amphetamine-ion exchange resin complex is in admixture with a polymer to form a matrix. Methods of making the coated complex and the liquid suspension are described. | 05-08-2014 |
| 20140134256 | Drug Microparticles - Provided are microparticles of active pharmaceutical ingredients, drug delivery vehicles comprising same, and methods for making them. | 05-15-2014 |
| 20140141088 | Water-Soluble Anti-Inflammatory Cream with Natural Ingredients Base - A water-soluble anti-inflammatory cream is disclosed. The cream is a composition of between about 7.5% and about 30% by weight of a healing oil; between about 1% and about 6% by weight of an herbal extract; between about 0% and about 3.5% by weight of microencapsulated amino acids; and at least 39.4% by weight water. | 05-22-2014 |
| 20140154324 | AGGLOMERATING MAGNETIC ALKOXYSILANE-COATED NANOPARTICLES - The present invention relates to a method for producing a suspension of agglomerates of magnetic alkoxysilane-coated metal nanoparticles, wherein an aqueous suspension of magnetic metal nanoparticles is incubated with alkoxysilane, wherein the incubation is carried out essentially in the absence of an organic solvent. The present invention further relates to suspension of agglomerates of magnetic alkoxysilane-coated metal containing nanoparticles obtainable by the method of the present invention and to a composition comprising agglomerates of magnetic alkoxysilane-coated metal nanoparticles, wherein the agglomerates have an average size of 30 to 450 nm, preferably of 50 to 350 nm and especially of 70 to 300 nm as determined by light scattering. | 06-05-2014 |
| 20140154325 | IN VIVO PHOTODYNAMIC THERAPY OF CANCER VIA A NEAR INFRARED AGENT ENCAPSULATED IN CALCIUM PHOSPHATE NANOPARTICLES - Nano-encapsulated photosensitizers and their use in the treatment of tumors and/or imaging is described. Preferably, the photosensitizers are encapsulated in a calcium phosphate nanoparticle (CPNP). Encapsulating the PS in a CPNP increases the half-life of the PS, increases absorption of the PS into the target cell tissue, increases the photostability of the PS, increases the photoefficiency of the PS, increases in vivo retention of the PS, or combinations thereof, ultimately making it a highly efficacious agent for use in photodynamic therapy, imaging target tissues, vessels, or tumors, and/or detecting or locating tumors. | 06-05-2014 |
| 20140154326 | MICRO ORGAN COMPRISING MESENCHYMAL AND EPITHELIAL CELLS - The invention provides a micro-organ composite which comprises a core group of cells and an outer layer of cells, wherein the cells of the core group are mesenchymal cells and the cells of the outer layer are epithelial cells or wherein the cells of the core group are epithelial cells and the cells of the outer layer are mesenchymal cells, and wherein the core group of cells is at least partially encapsulated by the outer layer of cells. | 06-05-2014 |
| 20140161886 | MINERAL-COATED MICROSPHERES - Provided is a microsphere comprising a bead coated with a first calcium-containing mineral. Also provided is a method of producing a microsphere. Additionally, a method of administering a compound to a vertebrate is provided. | 06-12-2014 |
| 20140161887 | ADJUVANT COMPOSITIONS - Adjuvant compositions comprising type 1 interferon inducers, such as double-stranded RNA, in combination with antigen delivery systems and/or immunostimulatory molecules, such as immunostimulatory nucleic acid sequences, for enhancing the immune response of a coadministered antigen, are described. | 06-12-2014 |
| 20140161888 | FORMULATIONS OF 6-MERCAPTOPURINE - The present invention provides improved formulations of 6-mercaptopurine that exhibit better bioavailability and faster dissolution than previous formulations. | 06-12-2014 |
| 20140161889 | TRANSDERMAL FORMULATION CONTAINING COX INHIBITORS - Disclosed are gel compositions suitable for the topical administration of an active compound having poor solubility and skin penetration, for example, of a COX-2 inhibitor compounds, processes of preparation thereof and methods of use thereof for the treatment of indications treatable by the active compound. | 06-12-2014 |
| 20140161890 | MULTIFUNCTIONAL Fe3O4 CORED MAGNETIC-QUANTUM DOT FLUORESCENT NANOCOMPOSITES FOR RF NANO-HYPERTHERMIA OF CANCER CELLS - A magnetic oxide-quantum dot nanocomposite has at least one magnetic oxide nanoparticle coated with a silica (SiO | 06-12-2014 |
| 20140178480 | SAFETY OF PSUEDOEPHEDRINE DRUG PRODUCTS - Drug substances comprising a amine containing pharmaceutically active compound, and at least one of an alditol acetal and an aromatic organic acid as an addition salt or an additive. | 06-26-2014 |
| 20140178481 | Water-In-Oil Type Emulsion Sunscreen Cosmetics - The present invention provides water-in-oil type emulsion sunscreen cosmetics that achieve an excellent UV blocking effect, and have excellent effects in the prevention and inhibition of discoloration (discoloration to red). The water-in-oil emulsion sunscreen cosmetic according to the present invention is characterized by comprising: (a) octocrylene; (b) hydrophobized zinc oxide; (c) cationic surfactant; and (d) silica. | 06-26-2014 |
| 20140199400 | Active Agent Loaded Uniform, Rigid, Spherical, Nanoporous Calcium Phosphate Particles and Methods of Making and Using the Same - Uniform, rigid, spherical nanoporous calcium phosphate particles that define an internal space and an amount of active agent present in the internal space are provided. Also provided are topical delivery compositions that include the active agent loaded particles, as well as methods of making the particles and topical compositions. The particles and compositions thereof find use in a variety of different applications, including active agent delivery applications. | 07-17-2014 |
| 20140199401 | EXTENDED RELEASE PHARMACEUTICAL COMPOSITIONS OF FESOTERODINE - A stable extend release pharmaceutical composition is disclosed. The composition comprises particles of fesoterodine or salts thereof, one or more rate controlling polymers and one or more pharmaceutically acceptable excipients wherein at least 90% of the total amount of particles of fesoterodine or salts thereof by volume (D | 07-17-2014 |
| 20140199402 | NOVEL COMPOUNDS FOR THE TREATMENT OF INFLAMMATORY BOWEL DISEASE - The present invention relates to a nucleic acid molecule of up to 150 nucleotides comprising consecutively from 5′ to 3′ (a) a first part whose sequence is between 50% and 100% complementary to the sequence AAAAGCUGGGUUGAGAGGGCGA; (b) a second part capable of forming a loop between the first and the third part; and (c) a third part comprising or consisting of the sequence AAAAGCUGGGUUGAGAGGGCGA; for use as a medicament. The present invention further relates to a nucleic acid molecule of up to 25 nucleotides comprising the sequence AAAAGCUGGGUUGAGAGGGCGA, for use as a medicament. In another aspect, the present invention relates to a composition comprising at least one mature miRNA selected from the group consisting of hsa-miR-320a, ptr-miR-320a, ppy-miR-320a, bta-miR-320, cfa-miR-320, mmu-miR-320, rno-miR-320, and mml-miR-320, and/or one or more mir-RNA precursor(s) thereof, for use as a medicament. | 07-17-2014 |
| 20140205669 | dhS1P AND USE OF SAME AS AN ANTICANCER THERAPEUTIC AND IMMUNOMODULATOR - Use of dhS1P and/or PhotoImmunoNanoTherapy as a therapeutic agent is described. Administration of therapeutically effective amounts of dhS1P decrease the number of Myeloid Derived Suppressor Cells and immune suppression in cancer patients. Administration of therapeutically effective amounts of dhS1P can be used as an adjuvant to conventional cancer therapies including immunotherapies. Therapeutic results can be achieved by directly administering dhS1P and/or by indirectly increasing the amount of dhS1P at the tumor site. The therapy permits the patient's immune system to recognize and eliminate cancer cells reducing tumor size and extending patient survival. | 07-24-2014 |
| 20140205670 | STABLE SOLID PREPARATIONS - It is intended to provide a process for producing unstable amorphous benzimidazole compounds having a proton pump inhibitor function, and stable solid preparations for medicinal use containing these compounds which are produced by blending such an amorphous benzimidazole compound with a nontoxic base such as a basic inorganic salt, forming an intermediate coating layer on the layer containing the active ingredient and further forming an enteric coating layer or a release-controlling coating layer. | 07-24-2014 |
| 20140220143 | IMMUNE-STIMULATING PHOTOACTIVE HYBRID NANOPARTICLES - Provides is a therapeutic technology that combines the phototoxic and immune-stimulating ability of photodynamic therapy with the widespread effectiveness of the immune system to reduce the viability of such as cancer cells and tumors. The nanoparticle compositions of the disclosure combine an immunostimulant with a photosensitizer using a nanoparticle delivery platform. For example, zinc pthalocyanine, which is a long-wavelength absorbing photosensitizer, integrated into a polymeric nanoparticle core made up of poly(D,L-lactic-co-glycolic acid)-b-poly(ethylene glycol) (PLGA-b-PEG). The outside surface of the core can be coated with metallic nanoparticles, which are then modified with CpG-ODN. Metastatic mouse breast carcinoma cells showed significant photocytotoxicity of the hybrid after irradiation with a 660 nm LASER light and this activity was remarkably better than either treatment alone. Treatment of mouse bone marrow derived dendritic cells with the photodynamic therapy-killed 4T1 cell lysate showed that the combination of photodynamic therapy with a synergistic immunostimulant in a single nanoparticle system resulted in an immune response suitable for the treatment of such as a metastatic cancer. | 08-07-2014 |
| 20140220144 | ORALLY DISINTEGRATING TABLET COMPOSITIONS OF LAMOTRIGINE - The compositions of the present invention composition comprise a therapeutically effective amount of particles comprising lamotrigine, in combination with granules comprising a disintegrant, and a sugar alcohol and/or a saccharide. These compositions are useful in treating epilepsy and bipolar disorder, particularly for patients with dysphagia, and to improve compliance with bipolar patients. | 08-07-2014 |
| 20140220145 | METHOD FOR STIMULATING RETINAL RESPONSE USING PHOTOACTIVE DEVICES - An improved method for stimulating electrical activity in an eye is provided. Provided is a technique for implanting small, nanometer-sized photoactive devices into an eye to improve electrical activity within an eye or mitigate degradation of electrical response in damaged eyes. | 08-07-2014 |
| 20140234428 | TOPICAL DERMAL DELIVERY COMPOSITIONS USING SELF ASSEMBLING NANOPARTICLES WITH CETYLATED COMPONENTS - The invention, a transdermal delivery method, relates to penetration-enhancing pharmaceutical compositions comprising a novel, stable mixture of cetylated esters, cetyl or stearyl alcohols, polar solvents and surfactants, which, under appropriate conditions, combine into amphiphilic nanoparticles within a stabilized liquid dispersion for use in delivery of medicinal agents through the skin. The term cetosomes is used to describe these particles in order to differentiate them from other nanoparticles, such as niosomes, cerasomes, polymeric micelles, dendrimers, liposomes, lipoids, solid lipid nanoparticles and other particles. The self-assembling cetosomes, with both ionic and nonionic points of attraction, incorporate and concentrate a variety of different bioactive agents of interest and demonstrate stable properties with similarities to colloidal molecular structures. The compositions enhance topical transdermal fluxes of bioactives without permanently disrupting natural skin barrier function. | 08-21-2014 |
| 20140234429 | SUPER PARAMAGNETIC IRON OXIDE NANOPARTICLES WITH METALLIC COATINGS AND A METHOD OF SYHTHESIZING THE SAME - The various embodiments herein provide super paramagnetic iron oxide nanoparticles (SPIONs). The SPIONs have a plurality of metallic coatings and plurality of polymeric gaps. The embodiments herein also provide a method of synthesizing the SPIONs with metallic rings and polymeric gaps. The metallic coatings form a ring like structure on the outer surface of the SPION. The SPION has a size of 13 nm. The ring has a thickness of 2-3 nm. The rings are one or more in number. The polymeric gaps have a thickness of 3-5 nm. The polymeric gaps are one or more in number. The method involves mixing the SPIONs with a plurality of polymers and then forming a metallic ring on the outer surface of the SPIONs. The SPIONs have anti-bacterial properties and stop a growth of bacterial biofilms. The SPIONs also have SERS properties. | 08-21-2014 |
| 20140234430 | PHARMACEUTICAL METHODS AND TOPICAL COMPOSITIONS CONTAINING ACITRETIN - The present invention is directed to methods and compositions for topical administration of acitretin. More specifically, the present invention is related to methods and compositions for the treatment or prevention or reduction of symptoms or signs of dermatological conditions using acitretin in a topical administration. More specifically, the present invention is related to methods and compositions containing acitretin which are effective for the treatment or prevention or reduction of symptoms or signs of keratoses, in particular actinic keratosis. | 08-21-2014 |
| 20140242175 | NANO-ENCAPSULATED, CONTROLLED DRUG DELIVERY, MANUFACTURING PROCESS AND SYSTEM - A mixed dose of a nanosized drug wherein at least one portion of the mixed dose comprises a core nanosized drug encapsulated in at least one layer of a protective material having the same core drug or different core drug. A mixed dose of a nanosized drug wherein at least one portion of the mixed dose comprises a core nanosized drug encapsulated in at least one shell of a protective material with same drug concentration or different drug concentrations. A mixed dose of a nanosized drug wherein at least one portion of the mixed dose comprises a core nanosized drug encapsulated such that to have different release schedule than the other portions of the drug. Methods and systems for the manufacturing and the administration of nanosized encapsulated drugs are also provided. | 08-28-2014 |
| 20140242176 | COMPOSITIONS, METHODS, AND DEVICES FOR THE TREATMENT OF EYE STAIN - Embodiments provided herein relate to compositions, methods, and devices useful for treating eye stain. More particularly, compositions and devices are provided that include tylosin and a carrier suitable for ophthalmic application. Such compositions and devices can be used to treat eye stain in an animal, such as a dog or cat. | 08-28-2014 |
| 20140248363 | NANOPARTICULATE PHOSPHATE ADSORBENT ON THE BASIS OF MAGHEMITE OR MAGHEMITE/MAGNETITE, PRODUCTION AND USES THEREOF - The present invention relates to a phosphate adsorbent on the basis of maghemite or maghemite/magnetite comprising (i) an iron oxide core comprising a crystal structure of inverse spinel iron oxide, (ii) a coating selected from monomeric carbohydrates, in particular monosaccharides or disaccharides, alditols, or mixtures thereof, and/or (iii) a pharmaceutical excipient selected from polymeric carbohydrates, wherein the phosphate adsorbent has the form of nanoparticles with a particle size of the iron oxide core (i) of less than 20 nm. The present invention further relates to a method for the production of a phosphate adsorbent on the basis of maghemite or maghemite/magnetite, to pharmaceutical compositions comprising the phosphate adsorbent, and to medical uses thereof, especially for the prevention and/or treatment of hyperphosphatemia. | 09-04-2014 |
| 20140248364 | DIVALENT-METAL COATED NANOPARTICLES FOR DELIVERY OF COMPOSITIONS INTO THE CENTRAL NERVOUS SYSTEM BY NASAL INSUFFLATION - The compositions and methods of the disclosure particularly target the divalent metal transporter expressed on olfactory nerve terminals to transport divalent cation-coated or cation-containing nanoparticles to all regions of brain. It has been found that such divalent cation-containing nanoparticles, including those nanoparticles comprising manganese have affinity for the metal transport receptor proteins. Although this receptor has particular affinity for manganese, it is contemplated that other divalent ions, including magnesium, calcium, and the like may also be bound to such receptors leading to transport of the nanoparticles into the intracellular cytoplasm. Nanoparticles have been developed, therefore, as vehicles for parenteral delivery of genes, proteins and drugs. The present disclosure encompasses embodiments of nanoparticle-based compositions and methods for the use thereof for the delivery of genes, oligonucleotides, including but not limited to small interfering RNA, and other small molecule drugs, into the brain by nasal insufflation. | 09-04-2014 |
| 20140255500 | METHOD FOR PREPARING GRAPHENE - A method of preparing graphene includes supplying a gas on a metal catalyst, the gas including CO | 09-11-2014 |
| 20140255501 | Novel Preparation Of An Enteric Release System - Hydrophobic liquids are microencapsulated by an enteric matrix in an environment substantially free of organic solvents, the process including forming an emulsion of the enteric material and hydrophobic liquid in water, the emulsion titrated with an acid to form a particulate precipitate of the microencapsulated hydrophobic liquid in an enteric matrix. | 09-11-2014 |
| 20140271885 | COPOLYMERS FOR STABLE MICELLE FORMULATIONS - The present invention relates to the field of polymer chemistry and more particularly to multiblock copolymers and micelles comprising the same. Compositions herein are useful for drug-delivery applications. | 09-18-2014 |
| 20140271886 | Bioerodible Silicon-Based Compositions for Delivery of Therapeutic Agents - The invention comprises a composition comprising a bioerodible porous silicon-based carrier material wherein the carrier material carries at least one large molecule therapeutic agent and at least one amorphous sugar, optionally further comprising a crystallization inhibitor. The composition may be used in vitro or in vivo to deliver the therapeutic agent, preferably in a controlled fashion over an intended period of time such as over multiple days, weeks or months. The composition may be used for treating or preventing conditions of a patient such as chronic diseases. | 09-18-2014 |
| 20140271887 | ANTIEMETIC EXTENDED RELEASE SOLID DOSAGE FORMS - A solid oral dosage form includes a core comprising a non-ionic polymer matrix, a first amount of a first antiemetic drug or a pharmaceutically acceptable salt thereof dispersed within the matrix, and a salt dispersed within the matrix; a first seal coat of a non-ionic polymer matrix surrounding the core; and an immediate release drug layer surrounding the first seal coat, wherein the immediate release drug layer comprises a non-ionic polymer and a second amount of a second antiemetic drug or a pharmaceutically acceptable salt thereof dispersed therein, wherein the drug layer is sufficiently designed to release the second amount of the antiemetic drug over a period of at least 1 hour, wherein the solid oral dosage form is sufficiently designed to release the first amount of the first antiemetic drug and the second amount of the second antiemetic drug over a minimum period of 16 hours. | 09-18-2014 |
| 20140271888 | DIKETOPIPERAZINE MICROPARTICLES WITH DEFINED SPECIFIC SURFACE AREAS - Disclosed herein are diketopiperazine microparticles having a specific surface area of less than about 67 m | 09-18-2014 |
| 20140287050 | AMINO ACID CONJUGATES OF QUETIAPINE, PROCESS FOR MAKING AND USING THE SAME - The presently described technology provides a novel class of prodrugs of quetiapine that can be synthesized by chemically conjugating amino acids to quetiapine. The present technology also provides methods of treating patients, pharmaceutical compositions and methods of synthesizing conjugates of the present technology. | 09-25-2014 |
| 20140287051 | ORALLY ADMINISTERED CORTICOSTEROID COMPOSITIONS - The present invention is directed to orally administered corticosteroid compositions. The present invention also provides a method for treating a condition associated with inflammation of the gastrointestinal tract in an individual. The method comprises administering to an individual in need thereof a pharmaceutical composition of the present invention. | 09-25-2014 |
| 20140294978 | CATIONIC LIPID - The present invention provides a cationic lipid and the like. The cationic lipid is for delivering a medicament containing a cationic lipid which facilitates the introduction of a nucleic acid into a cell or the like, and is represented by formula (I). | 10-02-2014 |
| 20140294979 | METHODS AND PHARMACEUTICAL COMPOSITIONS FOR REGULATION OF G- AND/OR GC-RICH NUCLEIC ACID EXPRESSION - Methods and pharmaceutical compositions for regulations of Guanosine- (G-) and/or Guanosine-cytosine-rich (GC-rich) nucleic acid expressions are provided. The methods include a step of interacting the G- and/or GC-rich region of the nucleic acid with thalidomide, and the pharmaceutical compositions include the thalidomide and a pharmaceutical carrier. | 10-02-2014 |
| 20140294980 | SUSTAINED RELEASE PARTICLE FORMULATIONS - Particles for delivery of active ingredients formed from an active ingredient and a hydrophobic matrix, as well as methods for making such particles. | 10-02-2014 |
| 20140294981 | CARBON ENCAPSULATED TRANSITION METAL OXIDE NANOCOMPOSITE, A METHOD FOR ITS PREPARATION AND ITS USE IN LI-ION BATTERIES - A nanocomposite includes carbon-encapsulated transition metal oxide nanoparticles. The carbon-encapsulated transition metal oxide nanoparticles comprise a transition metal oxide core having a diameter of from 5 nm to 50 nm covered by a graphitic coating having a thickness of from 1 nm to 5 nm. | 10-02-2014 |
| 20140302152 | GRANULATES COMPRISING ESLICARBAZEPINE ACETATE - The invention relates to a solid pharmaceutical composition, the composition comprising eslicarbazepine acetate and one or more pharmaceutically acceptable excipients, wherein the composition is in the form of granules, and wherein at least 90% of the granules of the composition have a particle size of 90 μm or more, and/or wherein at least 50% of the granules of the composition have a particle size of 250 μm or more. The invention also relates to a process for producing a granular composition. Further, the invention relates to the use of the composition in therapy and, in particular, in the treatment or prevention a disorder selected from epilepsy, neuropathic pain, migraine, fibromyalgia an affective disorders. | 10-09-2014 |
| 20140302153 | METHODS AND TREATMENT FOR ALLERGIES AND INFLAMMATION ASSOCIATED WITH GASTROINTESTINAL DISEASES - Methods of the prophylaxis of the development of allergy in a patient at risk of sensitization to an antigen(s) or allergen(s) due to impaired gastrointestinal functions include administering a mast cell inhibitor, e.g., ketotifen, e.g., ketotifen fumarate. Methods for prophylactically treating, reducing, delaying or controlling gastrointestinal disorders include administering a mast cell stabilizer, e.g., ketotifen to a patient in need thereof. Pharmaceutical preparation, composition for use in methods described, are also disclosed. Also disclosed are methods of prophylaxis or treating gastrointestinal and esophageal inflammation, and methods for the prophylaxis of the development of additional allergies to a newly introduced substance in a patient with a preexisting allergy. Such methods include delivery of a mast cell stabilizer, e.g., ketotifen. Oral and topical administration are contemplated within the scope of the methods. | 10-09-2014 |
| 20140302154 | MAGNETIC TRANSDUCERS - Embodiments herein relate to the production of biocompatible magnetic nanoparticles with a high SAR-value which produce a large amount of heat when exposed to an alternating magnetic field. The produced heat can be used among others for therapeutic purposes, in particular for combating cancer. | 10-09-2014 |
| 20140302155 | PRODUCTION OF A HUMAN BETA CELL LINE FROM AN EARLY POST NATAL PANCREAS - The present invention relates to a method for preparing commercial scale quantities of human functional beta cells and to the establishment of cell lines from non-foetal pancreatic tissues. It also relates to a method of diagnosis using beta cell tumors or cells derived thereof. The method comprises sub-transplantation procedure to enrich the graft in proliferating beta cells, allowing to generate human Beta cell lines. Such lines express, produce and secrete insulin upon glucose stimulation. They have a gene expression profile that resembles to adult beta cells. In addition, the human beta cell lines are able to normalize glycemia of diabetic mice when transplanted, demonstrating their insulin secretion capabilities. | 10-09-2014 |
| 20140314854 | METHODS AND COMPOSITIONS FOR RNAi-BASED CANCER TREATMENT - The present invention generally concerns methods and nucleotide-based compositions for treating metastatic cancer that is associated with a primary tumor or a few tumors at the primary organ. | 10-23-2014 |
| 20140314855 | COATED MESOPOROUS NANOPARTICLES - Provided are methods for producing mesoporous nanoparticles that can, once loaded, retain small or large molecules (e.g., molecules having a molecular weight that is less or greater than about 900 Da) until release is desired, upon which time the mesoporous nanoparticles can release the loaded molecule in a controlled manner for a desired period of time, including an extended period of time. Also disclosed are methods for treating a subject comprising administering to the subject a mesoporous nanoparticle according to the present disclosure. | 10-23-2014 |
| 20140314856 | SUSTAINED RELEASE BEADS AND SUSPENSIONS INCLUDING THE SAME FOR SUSTAINED DELIVERY OF ACTIVE INGREDIENTS - Sustained-released beads providing active ingredients over an extended period of time to an individual orally ingesting the sustained release beads. The sustained-release beads can be part of a suspension wherein the sustained-release beads are suspended and evenly dispersed in the suspension. Binding agents are used to form the structural framework of the sustained released beads and retain the active ingredients without chemical or electrical bonding. The components of the dispersion medium are GRAS designated, making the suspension suitable for use as a food product. | 10-23-2014 |
| 20140314857 | FORMULATIONS FOR ENHANCED BIOAVAILABILITY OF ZANAMIVIR - In accordance with the present invention, there are provided compositions comprising zanamivir and at least one permeability enhancer. The compositions can increase the amount of zanamivir capable of being transported across a cell membrane (such as a Caco-2 cell membrane), and can increase this amount by at least 150% relative to the amount capable of being transported across the cell membrane in the absence of the permeability enhancer. Also provided are oral dosage forms of the compositions, which comprise a therapeutically effective amount of zanamivir and a permeability-enhancing amount of a permeability enhancer. The oral dosage forms can further comprise an enteric- or pH-sensitive coating or layer surrounding the composition. Also provided in accordance with the present invention are methods for treating or preventing influenza infection. | 10-23-2014 |
| 20140314858 | IPNV-ISAV BIVALENT VACCINE USING A VIRUS-LIKE PARTICLE-BASED PLATFORM AND METHODS OF USING THE SAME - The present invention provides bivalent oral vaccines against infectious pancreatic necrosis virus (IPNV) and infectious salmon anemia virus (ISAV). Yeast cells comprise an expression vector comprising (i) a polynucleotide sequence encoding a VP2 capsid protein of IPNV and (ii) a polynucleotide sequence encoding one or more antigenic epitopes of hemaglutinin of ISAV. The yeast cells express sub-viral particles (SVP) comprising a VP2 capsid protein of IPNV and one or more antigenic epitopes of hemaglutinin of ISAV. The yeast cells and SVP may be administered in an effective amount to increase the amount of antibodies against IPNV and ISAV in the fish, preferably Salmonidae. The yeast cells and SVP may be in the form of fish food for administering to the fish orally. | 10-23-2014 |
| 20140322339 | METHODS FOR CONTROLLING LEAF-CUTTING ANTS - Methods and compositions for controlling leaf-cutting ants. More particularly, methods and kits for controlling leaf-cutting ants by serially supplying different formulations, and a method for increasing production of conidia of the | 10-30-2014 |
| 20140328930 | Pharmaceutical Compositions - Provided herein is a pharmaceutical composition comprising an antagonist, an agonist, a seal coat, and a sequestering polymer, wherein the antagonist, agonist, seal coat and at least one sequestering polymer are all components of a single unit, and wherein the seal coat forms a layer physically separating the antagonist from the agonist from one another. Methods for manufacturing such a pharmaceutical composition are also provided. | 11-06-2014 |
| 20140328931 | NUCLEIC ACID PARTICLES, METHODS AND USE THEREOF - The present invention provides, among other things, a particle which includes a core comprised of self-assembled one or more nucleic acid molecules, the core being characterized by an ability to adopt at least two configurations: a first configuration having a first greatest dimension greater than 2 μm and; a second configuration having a second greatest dimension less than 500 nm, wherein addition of a film coating converts the core from its first configuration to its second configuration. Methods of making and using of provided particles are also disclosed. | 11-06-2014 |
| 20140328932 | COMPOSITION COMPRISING N-ACETYLCYSTEINE AND/OR MICROENCAPSULATED GASTROPROTECTED LYSOZYME IN ASSOCIATION WITH PROBIOTIC BACTERIA CAPABLE OF RESTORING THE STOMACH'S OWN BARRIER EFFECT WHICH IS LOST DURING THE PHARMACOLOGICAL TREATMENT OF GASTRIC HYPERACIDITY - The present disclosure refers to a composition with N-acetylcysteine and/or lysozyme; or N-acetylcysteine and microencapsulated gastroprotected lysozyme with pro biotic bacteria for use in the pharmacological treatment of gastric hyperacidity. Said composition is capable of restoring the stomach's own barrier effect, which is lost during the pharmacological treatment of gastric hyperacidity, and of minimising the secondary effects due to said pharmacological treatment. | 11-06-2014 |
| 20140335191 | COMPOSITIONS AND METHODS FOR ENHANCING BRAIN FUNCTION - Compositions and methods are provided that enhance cognition in a human to which the composition is orally administered. Remarkably, clinical studies have proven that contemplated compositions achieved the desired effects using a minimal number of active ingredients at or near threshold active dosages, wherein such compositions almost exclusively comprise huperzine A, vinpocetine or rhodiola, and acetyl-L-carnitine, and optionally further include alpha lipoic acid, rhodiola, and biotin. | 11-13-2014 |
| 20140342003 | ENZYMATIC SYNTHESIS OF POLY(AMINE-CO-ESTERS) AND METHODS OF USE THEREOF FOR GENE DELIVERY - Poly(amine-co-ester) polymers, methods of forming active agent-load nanoparticles therefrom, and methods of using the nanoparticles for drug delivery are disclosed. The nanoparticles can be coated with an agent that reduces surface charge, an agent that increases cell-specific targeting, or a combination thereof. Typically, the loaded nanoparticles are less toxic, more efficient at drug delivery, or a combination thereof compared to a control other transfection reagents. In some embodiments, the nanoparticles are suitable for in vivo delivery, and can be administered systemically to a subject to treat a disease or condition. | 11-20-2014 |
| 20140348931 | SUSTAINED-RELEASE TOPIRAMATE FORMULATIONS - The present invention relates to a sustained release pharmaceutical formulation comprising topiramate and one or more pharmaceutically acceptable excipients, wherein the formulation comprises two extended release (XR) components or a combination of an extended release (XR) component and immediate release (IR) component, wherein at least one component is in a matrix form. It also relates to method of preparing such formulations and using those formulations in the treatment of neurological and/or psychiatric condition. | 11-27-2014 |
| 20140348932 | IMMEDIATE RELEASE FORMULATIONS OF 1-AMINOCYCLOHEXANE COMPOUNDS, MEMANTINE AND NERAMEXANE - The present invention relates to an immediate release solid oral dosage form containing 1-aminocyclohexanes, preferably memantine or neramexane, and optionally a pharmaceutically acceptable coating, wherein the active ingredient exhibits dose proportionality and is released at a dissolution rate of more than about 80% within about the first 60 minutes following entry of said form into a use environment. The dosage form is direct compressed and has a hardness within the range of between about 3 and about 40 Kp, exhibits an average T | 11-27-2014 |
| 20140363512 | ORAL PHARMACEUTICAL COMPOSITION - The present invention provides an FTD and TPI-containing oral pharmaceutical composition which can be orally administered and is stable even under high humidity conditions. | 12-11-2014 |
| 20140363513 | Octreotide Depot Formulation with Constantly High Exposure Levels - The present invention relates to sustained release formulations comprising as active ingredient octreotide or a pharmaceutically-acceptable salt thereof and two different linear polylactide-co-glycolide polymers (PLGAs). | 12-11-2014 |
| 20140370104 | PHARMACEUTICAL FORMULATION AND METHOD FOR TREATING ACID CAUSED GASTROINTESTINAL DISORDERS - Pharmaceutical formulations in the form of a powder for suspension comprising at least one proton pump inhibitor in micronized form; at least one antacid; and at least one suspending agents are provided herein. Also provided herein are methods for making and using pharmaceutical formulations comprising at least one proton pump inhibitor and at least one antacid. | 12-18-2014 |
| 20140370105 | TREATMENT OF INFLAMMATORY BOWEL DISEASE WITH 6-MERCAPTOPURINE - Methods of administering a delayed release 6-mercaptopurine pharmaceutical composition to patients suffering from inflammatory bowel disease which provide for release of the 6-mercaptopurine after passage of the pharmaceutical composition through the stomach are disclosed. The methods result in significant clinical improvement despite leading to very little systemic absorption of 6-mercaptopurine and also result in very few undesirable side effects. | 12-18-2014 |
| 20140370106 | BEADLETS COMPRISING HOP ACID SALTS IN A PROTEIN MATRIX - The present invention relates a process of production of beadlets comprising at least one hop acid salt in a matrix comprising at least one protein, to such beadlets and to the use of such specific beadlets in feed as well as in feed premixes. | 12-18-2014 |
| 20140370107 | MULTILAYER MICROINCAPUSLATED PROBIOTIC BACTERIA - A multilayer microencapsulated lactic bacteria and bifidobacteria, preferably bacteria with probiotic activity, and the use thereof to prepare a food product, supplement product, medical device or pharmaceutical composition or water- and/or fruit-based beverage are described. A process for preparing multilayer microencapsulated lactic bacteria and bifidobacteria, preferably bacteria with probiotic activity is described. A food product is described selected from water, water- and/or fruit-based beverages, milk, fresh whole milk, partially skimmed milk, powdered milk, cheese, fresh cheese, aged cheese, grated cheese, butter, margarine, yogurt, cream, milk- and chocolate-based custards, custards for sweets, jams and oily suspensions having bacteria, preferably multilayer microencapsulated lactic bacteria and bifidobacteria with probiotic activity. | 12-18-2014 |
| 20140370108 | Pharmacokinetics of S-Adenosylmethionine Formulations - Compositions and methods to improve the pharmacokinetic profile of S-Adenosylmethionine (SAMe) are provided, as are methods of treating various disorders using SAMe formulations with improved pharmacokinetic profiles. More specifically, the invention is directed to methods of treating a disease or disorder in a subject and/or improving the nutritional status of a subject by administering formulations exhibiting improved pharmacokinetic profiles of exogenous SAMe. The method also includes the step of orally administering compositions of the invention to the subject once per day after overnight fast; that is prior to food intake in the morning. | 12-18-2014 |
| 20140370109 | Stabilized Granules Containing Glyceryl Trinitrate - Solid pharmaceutical preparation with the active substance glyceryl trinitrate for oromucosal or oral administration characterized in that it contains between 0.05 and 2 weight % glyceryl trinitrate, at least one carrier material, and at least one substance that reduces the volatility of the GTN, whereby this substance is a non-volatile ester stabilizer. | 12-18-2014 |
| 20140377364 | ACTIVE INGREDIENT DELIVERY SYSTEM - A spray-chilled particulate delivery system that has a crystalline matrix structure and comprises a volatile hydrophobic active ingredient and a carrier material selected from the group consisting of erythritol and mannitol and mixtures thereof wherein, relative to the total weight of the carrier material, 75% or more of the carrier material is in crystalline form. The process for preparing the delivery system comprises the steps of (i) forming a melt of a carrier material selected from the group consisting of erythritol and mannitol and mixtures thereof (ii) incorporating a volatile hydrophobic active ingredient into the melt (iii) forming a melt-mixture comprising an emulsion, dispersion or suspension of the volatile hydrophobic active ingredient in the melt (iv) forming discrete particles of the melt mixture, and (v) cooling the discrete particles, so as to form the crystalline delivery system. | 12-25-2014 |
| 20150010638 | Method for Improving Water Solubility of Slightly Soluble Substance - It is an object of the present invention to provide a method for improving the solubility of a poorly-soluble substance, which is capable of increasing the solubility of substantially all poorly-soluble substances. This is a method comprising coating the surface of a poorly-soluble substance particle with microparticles of a calcium compound such as calcium phosphate or calcium carbonate, and at least one selected from a pH adjuster and a surfactant, by applying mechanical energy thereto. | 01-08-2015 |
| 20150010639 | PHARMACEUTICAL OR DIETARY COMPOSITIONS BASED ON SHORT-CHAIN FATTY ACIDS AND COMPLEX SUGARS, FOR INTESTINAL DISORDERS - Pharmaceutical or dietary composition containing, as active ingredients, at least one short-chain fatty acid or salt, ester and/or amide thereof, in combination with a complex sugar and/or dietary fibre. The complex sugar and/or dietary fibre is selected from inulin, pectin, dextrin, maltodextrin or derivatives thereof and with one or more pharmacologically acceptable excipients. The composition has (a) a matrix consisting of lipophilic compounds with a melting point lower than 90° C. and optionally amphiphilic compounds in which the active ingredient are at least partially incorporated, (b) an amphiphilic matrix; and (c) an outer hydrophilic matrix in which the lipophilic matrix and the amphiphilic matrix are dispersed. | 01-08-2015 |
| 20150017246 | NOVEL CROSSLINKING REAGENTS, MACROMOLECULES, THERAPEUTIC BIOCONJUGATES, AND SYNTHETIC METHODS THEREOF - The invention provides novel chemical entities based on sugar alcohols. These new chemical entities are biocompatible and biodegradable. The molecules can be made in a single and pure form. The molecular weights of these molecules range from small (<1000 Da) to large (1000-120,000 Da). The sugar alcohol-based molecules can have functional groups throughout the molecule for crosslinking compounds, such as the preparation of antibody-drug conjugates, or to facilitate the delivery of therapeutic proteins, peptides, siRNA, and chemotherapeutic drugs. Also provided are new conjugate entities prepared through sugar alcohol molecules. Methods of synthesizing sugar alcohol-based molecules and conjugates are also within the scope of the invention. | 01-15-2015 |
| 20150017247 | COMPOSITIONS FOR PULMONARY DELIVERY OF LONG-ACTING B2 ADRENERGIC RECEPTOR AGONISTS AND ASSOCIATED METHODS AND SYSTEMS - Compositions, methods and systems are provided for pulmonary delivery of long-acting muscarinic antagonists and long-acting β | 01-15-2015 |
| 20150017248 | DRY POWDER FORMULATION COMPRISING AN ANTICHOLINERGIC, A CORTICOSTEROID AND A BETA-ADRENERGIC FOR ADMINISTRATION BY INHALATION - Dry powder formulations for inhalation comprising a combination of an anticholinergic, a long-acting beta | 01-15-2015 |
| 20150030679 | STABLE, DURABLE GRANULES WITH ACTIVE AGENTS - A stable, durable granule for feed compositions has a core, at least one active agent; and at least one coating. The active agent of the granule retains at least 50% activity, at least 60% activity, at least 70% activity, at least 80% activity after conditions selected from one or more of a) a feed pelleting process, b) a steam-heated feed pretreatment process, c) storage, d) storage as an ingredient in an unpelleted mixture, and e) storage as an ingredient in a feed base mix or a feed premix comprising at least one compound selected from trace minerals, organic acids, reducing sugars, vitamins, choline chloride, and compounds which result in an acidic or a basic feed base mix or feed premix. | 01-29-2015 |
| 20150030680 | ORAL PHARMACEUTICAL COMPOSITIONS OF DABIGATRAN ETEXILATE - Compositions comprising a mixture of at least two types of particles wherein a) the first type of particles comprise dabigatran etexilate in the form of the free base or in the form of pharmaceutically acceptable salts, polymorphs, solvates or hydrates thereof; and b) the second type of particles comprise at least one pharmaceutically acceptable organic acid, use of said compositions in the reduction of the risk of stroke and systemic embolism in patients with non-valvular atrial fibrillation and/or in the prevention of venous thromboembolic events in adult patients who have undergone elective total hip replacement surgery or total knee replacement surgery and processes for the preparation of said compositions. | 01-29-2015 |
| 20150037420 | Sustained Release Formulation Comprising Octreotide and Two or More Polyactide-co-glycolide Polymers - The present invention relates to sustained release formulations comprising as active ingredient octreotide or a pharmaceutically-acceptable salt thereof and two or more different polylactide-co-glycolide polymers (PLGAs). | 02-05-2015 |
| 20150044292 | BIPHASIC LIPID-VESICLE COMPOSITIONS AND METHODS FOR TREATING CERVICAL DYSPLASIA BY INTRAVAGINAL DELIVERY - This invention relates to biphasic lipid-vesicle compositions and methods for treating cervical displasia by intravaginal delivery. | 02-12-2015 |
| 20150044293 | RADIOPROTECTOR COMPOUNDS - Radioprotector compounds including 3,3′-diindolylmethane (DIM) analogs, are provided. Further provided are methods for their use in reducing or preventing radiation damage, killing a tumor cell and protecting a non-tumor cell, and treating cancer. | 02-12-2015 |
| 20150050348 | BIOMECHANICAL FORCE MITIGATION IN THE DELIVERY OF STEM CELL THERAPIES - A medical practitioner can specify certain parameters for a procedure that involves delivering a therapeutic agent, while leaving other parameters open. The therapeutic agent can be sensitive to biomechanical forces (or other influences) associated with delivery. The procedure can involve regenerative medicine, for example delivering progenitor or stem cells to a diseased heart using a catheter, whereby unbridled transport in the catheter may compromise efficacy. The open parameters can influence efficacy of the agent and thus therapeutic outcome. A computer-based system can apply stored information, such as from databases, to narrow the possible values of the open parameters. From the narrowed possibilities, an optimization routine can determine suitable or optimized values for the open parameters. The determined values can manage biomechanical forces incurred by the therapeutic agent, thereby promoting efficacy and healing. The optimized parameters can guide the practitioner in the procedure. | 02-19-2015 |
| 20150050349 | SYSTEMS AND METHODS FOR PARTICLE RADIATION ENHANCED DELIVERY OF THERAPY - Systems and methods for enhancing the selective targeting of agents for preferential action at a target with reduced action with healthy tissue distal the target tissue. One or more agents can be combined with nano scale structures/particles for delivery to the target tissue. Appropriate bombardment with accelerated particle radiation, such as proton radiation, induces the release of the agents at the target site. Nano carriers can be combined with therapeutic and/or imaging enhancement agents. Imaging of the target tissue can provide a verification of the delivered dose of particle radiation. Nanocarriers can be provided with an outer shell selected for biocompatibility and durability in the in vivo environment and further selected to provide a feedback mechanism in the treatment environment to accelerate the release of the agent and reduce a total radiation dose needed for that release. | 02-19-2015 |
| 20150050350 | PHARMACEUTICAL FORMULATIONS FOR DRY POWDER INHALERS - A powder for use in a dry powder inhaler comprises: i) a fraction of fine particle size constituted by a mixture of physiologically acceptable excipient and an additive; ii) a fraction of coarse particles; and iii) at least one active ingredient. The powder is suitable for efficacious delivery of active ingredients into the low respiratory tract of patients suffering from pulmonary diseases such as asthma. In particular, the invention provides a formulation to be administered as dry powder for inhalation which is freely flowable, can be produced in a simple way, is physically and chemically stable and capable of delivering accurate doses and/or high fine particle fraction of low strength active ingredients by using a high- or medium resistance device. | 02-19-2015 |
| 20150056288 | MODIFIED RELEASE LIQUID PHARMACEUTICAL COMPOSITION COMPRISING BROMOPHENIRAMINE, PSEUDOEPHEDRINE AND DEXTROMETHORPHAN - There is provided a modified release liquid pharmaceutical composition comprising combination of dextromethorphan, bromrpheniramine and pseudoephedrine or pharmaceutically acceptable salts thereof. The invention further provides process for preparation of such compositions. | 02-26-2015 |
| 20150056289 | BONE CEMENT COMPOSITION - The purpose of the present invention is to provide a bone cement composition which can have desired biological activity performance and desired radiolucency while enabling the strength of a cured product thereof to be kept. A titanium oxide coating is formed on radiolucent particles to thereby produce composite particles, and the composite particles are added to a bone cement composition. The bone cement composition thus produced can be used suitably for the filling of a bone defect portion and the fixation of an artificial joint and in percutaneous vertebroplasty. The shape of each of the radiolucent particles is preferably granular, and the titanium oxide is preferably of a rutile type. | 02-26-2015 |
| 20150072014 | Pharmaceutical Compositions of Sodium Picosulfate, Magnesium Oxide and Citric Acid - The present invention relates to pharmaceutical compositions of sodium picosulfate, magnesium oxide and citric acid. In particular, the invention relates to pharmaceutical compositions comprise granules having a layer of sodium picosulfate on neutral carrier/s. The invention also relates to processes for the preparation of such compositions and use thereof for bowel cleansing. | 03-12-2015 |
| 20150072015 | METHOD FOR PRODUCING GRANULES - In a production process of granules containing a biologically active substance, variation in the elation profile of the biologically active substance is reduced by heating the temperature of granules to about 50° C. or higher and maintaining the temperature for about 1 minute or longer. By setting the spray speed to about 90 mg/min or more per 1 g of cores when a spray agent fox a primary agent containing the biologically active substance is sprayed while spraying a binding liquid to the cores and setting the total feeding weight per unit area for a centrifugal fluidized bed coating granulation machine to about 1.5 g/cm | 03-12-2015 |
| 20150072016 | Microparticles with adsorbed polynucleotide-containing species - Microparticles with adsorbed polynucleotide-containing species, compositions containing the same, methods of making such microparticles, and uses thereof are disclosed. The microparticles comprise (a) a biodegradable polymer, such as a polyhydroxy butyric acid, a polycaprolactone, a polyorthoester, a polyanhydride, or a polycyanoacrylate, (b) a cationic surfactant such as cetyltrimethylammonium bromide, (c) and a polynucleotide-containing species adsorbed on the surface of the microparticles, wherein the polynucleotide-containing species constitutes at least 5 percent of the total weight of said microparticles. Examples of polynucleotide-containing species include polynucleotide-containing immunological adjuvants, such as CpG oligonucleotides, and polynucleotide-containing species that encode polypeptide-containing antigens, such as RNA and DNA vector constructs. Methods of delivering a therapeutic amount of a polynucleotide-containing species to a host animal, methods of stimulating an immune response, methods of treating a host animal having a pathogenic organism infection, methods of immunizing a host animal against infection by a pathogenic organism, and uses of the microparticle compositions for vaccines are also provided. | 03-12-2015 |
| 20150079183 | Lercanidipine Hydrochloride and Losartan Potassium Compound Preparation and Preparation Method Thereof - A lercanidipine hydrochloride and losartan potassium compound preparation. In terms of mass percentage, said compound preparation contains 0.5-40% lercanidipine hydrochloride and 6.25-50% losartan potassium. Also provided is a compound preparation which utilizes lercanidipine hydrochloride and losartan potassium as the main ingredient, lactose monohydrate, microcrystalline cellulose, A-type sodium starch glycolate, povidone K30, magnesium stearate, pregelatinized starch and colloidal silicon dioxide as excipients, and opadry white as a coating in the preparation of a tablet. Clinical tests show that compared with single-component preparations, said compound preparation markedly increases the effectiveness of treatment of light and moderate hypertension, markedly reduces the incidence of adverse effects, is tolerated well by patients, and has excellent clinical application prospects. | 03-19-2015 |
| 20150079184 | Sustained-Release Formulation - A substantially monodisperse assemblage of particles | 03-19-2015 |
| 20150079185 | METHOD OF MAKING PARTICLES FOR USE IN A PHARMACEUTICAL COMPOSITION - The invention relates to a method for making composite active particles for use in a pharmaceutical composition for pulmonary administration, the method comprising a milling step in which particles of active material are milled in the presence of particles of an additive material which is suitable for the promotion of the dispersal of the composite active particles upon actuation of an inhaler. The invention also relates to compositions for inhalation prepared by the method. | 03-19-2015 |
| 20150079186 | SOLID DOSAGE FORM COMPRISING PROTON PUMP INHIBITOR AND SUSPENSION MADE THEREOF - A solid, rapidly gelling oral pharmaceutical dosage form, as well as an aqueous formulation prepared thereof, comprising a) an acid sensitive proton pump inhibitor as active ingredient distributed in a multitude of enteric coated pellets, and b) a suspension modifying granulate. Furthermore, the invention relates to an improved process for the manufacture and the use of such formulation in medical treatment, including prevention of gastrointestinal disorders in humans. | 03-19-2015 |
| 20150086640 | PHARMACEUTICAL COMPOSITIONS FOR INHALATION - The invention provides microparticles for use in a pharmaceutical composition for pulmonary administration, each microparticle comprising a particle of an active substance having, on its surface, particles of a hydrophobic material suitable for delaying the dissolution of the active substance. The invention also provides a method for making the microparticles. | 03-26-2015 |
| 20150086641 | Orally Effective Methylphenidate Extended Release Powder and Aqueous Suspension Product - An oral methylphenidate powder which is reconstitutable into a final oral aqueous sustained release formulation containing at least about 50%, or at least about 80% by weight water based on the total weight of the suspension, is provided. The powder is a blend containing a combination of an uncoated methylphenidate-ion exchange resin complex, a barrier coated methylphenidate-ion exchange resin complex-matrix, and a water soluble buffering agent such that upon formed into an aqueous liquid formulation, the formulation has a pH in the range of about 3.5 to about 5, or about 4 to about 4.5. Following administration of a single dose of the oral aqueous methylphenidate suspension, a therapeutically effective amount of methylphenidate is reached in less than one hour and the composition provides a twelve-hour extended release profile. | 03-26-2015 |
| 20150099001 | Nanocell Drug Delivery System - Nanocells allow the sequential delivery of two different therapeutic agents with different modes of action or different pharmacokinetics. A nanocell is formed by encapsulating a nanocore with a first agent inside a lipid vesicle containing a second agent. The agent in the outer lipid compartment is released first and may exert its effect before the agent in the nanocore is released. The nanocell delivery system may be formulated in pharmaceutical composition for delivery to patients suffering from diseases such as cancer, inflammatory diseases such as asthma, autoimmune diseases such as rheumatoid arthritis, infectious diseases, and neurological diseases such as epilepsy. In treating cancer, a traditional antineoplastic agent is contained in the outer lipid vesicle of the nanocell, and an antiangiogenic agent is loaded into the nanocore. This arrangement allows the antineoplastic agent to be released first and delivered to the tumor before the tumor's blood supply is cut off by the antianiogenic agent. | 04-09-2015 |
| 20150104520 | Nanoparticle Formulations in Biomarker Detection - The present invention relates to compositions and methods of treatment of cancer patients with cytotoxic drugs in particular the use of cytotoxic drugs encapsulated in a diblock copolymer formulation where the composition is stable in protein free media and less stable in protein containing media such as serum, in particular the treatment of ovarian. | 04-16-2015 |
| 20150110880 | ORALLY DISINTEGRATING TABLET AND PRODUCTION PROCESS THEREFOR - Provided are an orally disintegrating tablet that quickly disintegrates when it is placed in the mouth or put into water, provides favorable taste, has a sufficient hardness in general production, transportation and use and is excellent in terms of storage stability, and a process for the production of the same which is excellent in terms of industrial production. An orally disintegrating tablet containing a drug, a crystalline cellulose having a bulk density of 0.23 g/cm | 04-23-2015 |
| 20150110881 | Pharmaceutical preparation and method for treatment of diabetes - A pharmaceutical composition for use in oral medication for the treatment of diabetes mellitus can include an antacid agent with an enteric coating, which permits the antacid agent to be delivered in the small intestine where it reduces acidity thereby causing a lowering of blood sugar levels. The pharmaceutical composition can be packaged in various tablet forms, including standard tablets and multiple pellet tablets. The pharmaceutical composition can further include a composition for treatment of diabetes, such as metformin, in enteric or non-enteric formulations. The pharmaceutical composition can further include an enteric-coated gastric acid secretion inhibitor. Also disclosed are methods for the treatment of diabetes mellitus, using the pharmaceutical composition and its variants. | 04-23-2015 |
| 20150118315 | AROMATIC-CATIONIC PEPTIDES AND USES OF SAME - A finished pharmaceutical product adapted for oral delivery of an aromatic-cationic peptide, wherein the product comprises a therapeutically effective amount of the peptide; at least one pharmaceutically acceptable pH-lowering agent; and at least one absorption enhancer effective to promote bioavailability of the active agent. The product is adapted for use in a method for enhancing the bioavailability of a therapeutic aromatic-cationic peptide delivered orally. | 04-30-2015 |
| 20150118316 | Nanoparticles of Cerium Oxide Targeted to an Amyloid Beta Antigen of Alzheimer's Disease and Associated Methods - Disclosed is a composition immunologically targeted to Alzheimer's disease (AD), the composition containing amine functionalized nanoparticles of Cerium oxide coated with polyethylene glycol and bearing an antibody specific for an amyloid-beta antigen associated with AD. The invention also includes a medication manufactured with the targeted nanoceria particles and methods of treatment by administering the targeted nanoceria particles to patients in need thereof. | 04-30-2015 |
| 20150125533 | SINGLE-DOMAIN ANTIBODIES AND GRAPHENE COATED MAGNETIC METAL NANOPARTICLES CONJUGATE AND METHODS FOR USING THE SAME - Single-domain antibodies and graphene coated magnetic metal nanoparticles conjugate and methods for using the same. In certain aspects, graphene coated nanoparticles comprise a targeting moiety, such as a nanobody, and may be used for various targeted therapies (e.g., diseased tissues and cancer). Methods for using magnetic nanoparticles for treatment of parasitic infections are also provided. | 05-07-2015 |
| 20150125534 | IMATINIB SOLID DOSAGE FORMS RECONSTITUTED JUST BEFORE USE - The present invention relates to the pharmaceutical formulations comprising imatinib in solid dosage form reconstituted with a diluent just before use; preparation processes and use thereof. | 05-07-2015 |
| 20150125535 | CRYSTALLINE FORMS OF THERAPEUTIC COMPOUNDS AND USES THEREOF - Described herein is certain crystalline forms of Compound 3, as well as pharmaceutical compositions employing the crystalline forms. Also provided are particles (e.g., nanoparticles) comprising such crystalline forms or pharmaceutical compositions. In certain examples, the particles are mucus penetrating particles (MPPs). The present invention further relates to methods of treating or preventing diseases using crystalline forms or pharmaceutical compositions. | 05-07-2015 |
| 20150132392 | INORGANIC COMPOSITE POWDER COATED WITH OCTYL METHOXYCINNAMATE, AND ULTRAVIOLET BLOCKING COSMETIC COMPOSITION USING SAME - Disclosed is an inorganic composite powder containing an inorganic ultraviolet filter, and a method for preparing the same. The present invention also relates to an SPF and PA which can be employed in the preparation of the inorganic composite powder using Octyl Methoxycinnamate (OMC) without loss of the OMC in the range of 0.1 to 60% and which have superior ultraviolet blocking effects. | 05-14-2015 |
| 20150132393 | NANOSTRUCTURE COATED WITH A TWIST-STRAINED DOUBLE-STRANDED CIRCULAR DEOXYRIBONUCLEIC|ACID (DNA), METHOD FOR MAKING AND USE - A SWCNT coated with a twist-strained double-stranded circular deoxyribonucleic acid (DNA) is provided, together with methods for preparing the coated SWCNT, for removing the DNA coating from the SWCNT, and for sorting SWCNTs using the DNA coating. | 05-14-2015 |
| 20150132394 | METHOD FOR PRODUCING MICROCAPSULE POWDER - A method for producing a microcapsule powder includes a concentration step. In the concentration step, an aqueous dispersion of a microcapsule is supplied into a cyclone, and the aqueous dispersion is then concentrated. The concentration step includes an aqueous dispersion-supplying step and a concentrated dispersion-recovering step. In the aqueous dispersion-supplying step, the aqueous dispersion is supplied into a cylindrical member inlet. In the concentrated dispersion-recovering step, a microcapsule dispersion is recovered. The microcapsule dispersion is discharged through a conical member outlet. | 05-14-2015 |
| 20150147400 | SOLID ORAL DOSAGE FORM FOR BREAST SYMPTOMS - The invention is a solid oral dosage form that is designed to deliver a supraphysiological dose of molecular iodine of 3 to 60 mg per day. The solid oral dosage form is designed to have a low risk of thyroid related adverse clinical events for patients with deficiencies of certain minerals. The solid oral dosage form includes a source of iodine, a reactive agent, and calcium or iron. The solid oral dosage form may include one or more of selenium, vitamin A, vitamin D, zinc, gamma-linolenic acid, vitamin B1, and magnesium. The solid dosage form may further comprise an enteric coating that coats ingredients that are absorbed predominantly from the intestines, such as vitamin A and D, and does not coat the source of iodine and the reactive agent. | 05-28-2015 |
| 20150147401 | CONTROLLED RELEASE OF BIOLOGICAL ENTITIES - A process is provided for releasably encapsulating a biological entity. The process comprises combining a solution of a surfactant in a non-polar solvent with a precursor material and the biological entity to form an emulsion. The emulsion comprises a polar phase dispersed in a non-polar phase, wherein the polar phase comprises the biological entity. The particles comprising the biological entity are then formed from the polar phase. | 05-28-2015 |
| 20150290133 | FORMULATIONS OF 6-MERCAPTOPURINE - The present invention provides improved formulations of 6-mercaptopurine that exhibit better bioavailability and faster dissolution than previous formulations. | 10-15-2015 |
| 20150290139 | Delayed Release Cysteamine Bead Formulation, and Methods of Making and Using Same - An enteric-coated bead dosage form of cysteamine, and related methods of manufacture and use, are disclosed. | 10-15-2015 |
| 20150290162 | COMPOSITION AND METHOD FOR CONTROL OF DIABETES - Correctly formulated enterically coated nutrient pellets are able to significantly to lower the blood sugar level of type two diabetics when administered with a normal meal. The inventive composition is effective at dosage levels of 10 g or less. Effective doses of the composition contribute 42 kcal or fewer to the patient's diet. A preferred form of the composition contains lauric acid coated for release in the distal bowel. When taken. with an ordinary meal, the effective dosage does not induce the ileal brake and is more than 50 times (often more than 100 times) as effective on per kilocalorie basis as an ordinary meal at eliciting increases in PYY and GLP-1. Thus, ordinary nutrients—as opposed to drugs—can be used to reduce blood sugar levels when administered at dosage levels that are not significant promoters of weight gain. | 10-15-2015 |
| 20150297587 | MIXED LINEAGE KINASE INHIBITORS FOR HIV/AIDS THERAPIES - Disclosed are methods for treating an individual infected with a retrovirus that comprise administering to the individual effective amounts of a mixed lineage kinase inhibitor and antiretroviral drug. In further aspects, disclosed are methods for treating an individual infected with a retrovirus that comprises administering an antiretroviral drug formulated into a crystalline nanoparticle comprising a surfactant, and a MLK inhibitor. Still further disclosed are methods for treating an individual infected with a retrovirus that comprises administering a composition comprising both an antiretroviral and MLK inhibitor formulated into a crystalline nanoparticle, which comprises a surfactant. Still further disclosed are compositions that comprise an antiretroviral drug, a MLK inhibitor, and a surfactant, wherein the composition is a crystalline nanoparticle. Compostions comprising MLK inhibitors with other drugs in nanoparticulate form, and methods of there use, are also disclosed. | 10-22-2015 |
| 20150306128 | COBALAMINS TO HELP MAINTAIN A NORMAL BODY WEIGHT AND A HEALTHY BODY MASS INDEX (BMI) IN UNDERWEIGHT, OVERWEIGHT AND OBESE HUMANS - The current invention discloses novel uses of orally ingested cobalamins for the maintenance of a healthy and normal body weight and body mass index (BMI). Cobalamins support mitochondrial conversion of carbohydrates into chemical energy called ATP. Cells in the body, especially energy-hungry muscle and brain cells, use ATP as an energy source for many types of cellular functions. Simply put, cobalamins are the natural nutrients needed for cellular metabolism and the burning of calories. In a phase III, placebo-controlled, nutritional study with a total of 1,551 human test subjects, on average those obese people who took cobalamins lost weight and BMI, while those obese people who took placebo gained weight and BMI. | 10-29-2015 |
| 20150306249 | REVERSIBLE IMMOBILIZATION AND/OR CONTROLLED RELEASE OF NUCLEIC ACID CONTAINING NANOPARTICLES BY (BIODEGRADABLE) POLYMER COATINGS - The present invention relates to nanoparticles comprising nucleic acids coated with a (biodegradable) polymer for reversible immobilization and/or controlled release of the nucleic acid comprising nanoparticles. Furthermore, the present invention is directed to medical or diagnostic devices, particularly stents and implants coated by a (biodegradable) polymer with the nucleic acid comprising nanoparticles for reversible immobilization and/or controlled release. Furthermore, the present invention is directed to the use of these nanoparticles coated with a (biodegradable) polymer and to the use of medical devices and implants coated by the (biodegradable) polymer with these nucleic acid comprising nanoparticles in the prophylactic or therapeutic treatment of diseases, particularly in the prevention or treatment of restenosis, calicification, foreign body reaction, or inflammation. Additionally, the present invention is directed to a method of preparing these nucleic acid comprising nanoparticles coated with a (biodegradable) polymer and to a method for coating nucleic acid comprising nanoparticles by a (biodegradable) polymer on medical or diagnostic devices. | 10-29-2015 |
| 20150320691 | USE OF MAGNESIUM STEARATE IN DRY POWDER FORMULATIONS FOR INHALATION - Addition of magnesium stearate to a powder formulation for inhalation comprising carrier particles and an active ingredient bearing a group susceptible to hydrolysis is useful for inhibiting or reducing the chemical degradation of the active ingredient. | 11-12-2015 |
| 20150328149 | Method for Administering an Antibiotic Dosage - A method of administering an antibiotic dosage by supplementing the antibiotic with anti-viral, mucosin, bacterial retardants, and other compounds, and delivering the compounds via direct methods to infection sites to allow lower dosage in localized areas with less effect on the rest of the body. | 11-19-2015 |
| 20150328167 | NOVEL MICROGRANULAR FORMULATION - A microgranule preparation for oral administration which is characterized in that an inert core coated with a drug layer is mixed with sugar or sugar alcohol is provided. | 11-19-2015 |
| 20150328241 | PRODUCT AND METHOD FOR TREATMENT OF A BIOFILM, INCLUDING CONTROL OF SUBSTRATE COLONIZATION AND TREATMENT OF INFECTION - An antimicrobial product and methods of use are provided. The antimicrobial product includes a water-soluble antimicrobial organosilane and various additional compound, including antibiotic and anti-inflammatory medications, antiseptics, and/or detergents. An example delivery system including a microcapsule encasing the product is also described. Methods of use include embedding a delivery system within an article, such as bandages, inserts or wound coverings, the microcapsule containing the product which is released by a mechanism and at a time particular to the intended use of the article. The methods include treating an infection on a substrate by disrupting an existing microbial colonization, penetrating existing biofilms, and/or killing existing microbes. | 11-19-2015 |
| 20150335013 | POTENTIATION OF FIXED COPPERS AND OTHER PESTICIDES CONTAING COPPER AND SUPPLEMENTING PLANT NUTRITION - A pesticide, fungicidal, bactericidal, anti-pathogen or biocidal composition includes at least one biologically inert carrier; and at least one doped component including at least one fixed copper compound doped with at least one compound selected from the group consisting of iron compounds, zinc compounds, magnesium compounds, calcium compounds, and combinations and/or mixtures thereof. In one embodiment, the doped component has a particle size of about 0.5 nm to about 30 microns. A method for the control of pests includes the step of applying to the pests or their growth habitat the aforementioned composition. The method also includes the control of disease in citrus plants caused by vectors such as Psyllid nymphs, by applying the aforementioned composition to their growth habitat in citrus groves. | 11-26-2015 |
| 20150335760 | STAR POLYMER NANOSHELLS AND METHODS OF PREPARATION THEREOF - A nanoshell is disclosed, comprising a star polymer occlusion complex comprising i) an amphiphilic unimolecular star polymer having a crosslinked core covalently linked to 6 or more independent polymer arms, and ii) a cargo material occluded in the star polymer; and a shell comprising an inorganic material in contact with a peripheral surface of the star polymer occlusion complex. | 11-26-2015 |
| 20150335763 | HMGB1-BINDING BEADS AND USES THEREOF - Disclosed are therapeutic beads comprising agents, such as nucleic acids, that bind to high mobility group box 1 (HMGB1) and methods of treating subjects with conditions that would benefit from reducing the deleterious effects of HMGB1, such as inflammatory bowel diseases, comprising administering the beads to the gastrointestinal tract of the subjects. | 11-26-2015 |
| 20150342872 | Use of Paclitaxel Particles - A method of administering a suspension of paclitaxel particles into the peritoneum is provided. A corresponding method of treating a disease, disorder or condition that is therapeutically responsive to paclitaxel is also provided. The methods provide improvements over comparator formulations containing an equivalent dose of paclitaxel. | 12-03-2015 |
| 20150342886 | PROCESS FOR PREPARING PRODUCTS COMPRISING STABILISED ACTIVES AND COMPOSITIONS COMPRISING SAME - The present invention broadly relates to a process for preparing products comprising active components, and in particular biological materials, wherein the active components are stabilised. The invention further relates to compositions comprising the products, and in particular compositions comprising therapeutic biological materials. | 12-03-2015 |
| 20150342893 | CELECOXIB FORMULATIONS USEFUL FOR TREATING COLORECTAL CANCER - An oral celecoxib formulation, the formulation being a multiple minibead formulation wherein the minibeads comprise a hydrogel-forming polymer matrix in which are distributed celecoxib, a polyoxyethylated non-ionic surfactant and an anionic surfactant, the minibeads when combined with water being capable of releasing self-assembly structures comprising surfactant and celecoxib. | 12-03-2015 |
| 20150342894 | DRUG DELIVERY SYSTEMS AND RELATED METHODS OF USE - The present disclosure relates generally to drug delivery systems and related methods of use. The drug delivery systems can include one or more particles, each of which can include a biologically active compound dispersed therein. The drug delivery systems can also be configured to exhibit zero-order or near-zero-order release of the biologically active compound. The particles can be cylindrical or rod-like in shape, and can include a polymeric inner matrix having a biologically active compound dispersed therein, and a polymeric outer layer disposed at least partially around the inner matrix. | 12-03-2015 |
| 20150352050 | BIODEGRADABLE MICROBEADS WITH IMPROVED ANTICANCER DRUG ADSORPTIVITY, CONTAINING ALBUMIN AND DEXTRAN SULFATE, AND PREPARATION METHOD THEREFOR - The present invention relates to: biodegradable microbeads with improved anticancer drug adsorptivity, containing albumin and dextran sulfate; a preparation method therefor; and a method for treating cancer using the same. The microbeads of the present invention is prepared from a biocompatible and biodegradable polymer so as to be safe to the human body, and can effectively inhibit the growth of a tumor by effectively blocking a blood vessel which supplies nutrition to a liver tumor and continuously releasing an anticancer drug adsorbed on surfaces of the beads. Therefore, the present invention can be useful for liver cancer chemoembolization. | 12-10-2015 |
| 20150359827 | BLUE-GREEN ALGAE EXTRACT MIXTURES AND METHODS OF USE - Disclosed herein are compositions including a mixture of an aqueous extract of | 12-17-2015 |
| 20150366807 | ORAL PHARMACEUTICAL COMPOSITION COMPRISING DABIGATRAN ETEXILATE - The present invention relates to an oral pharmaceutical composition comprising dabigatran etexilate or a pharmaceutically acceptable salt thereof, methods for preparing it and dosage forms for oral administration comprising said composition. The pharmaceutical composition is particularly useful as a medicament, especially as anticoagulant. | 12-24-2015 |
| 20150366826 | PHARMACEUTICAL FORMULATION FOR REDUCING BLADDER SPASMS AND METHOD OF USE THEREOF - Methods and compositions for reducing bladder spasms are disclosed. The methods comprise administering to a subject in need thereof a pharmaceutical composition comprising an effective amount of acetaminophen and an effective amount of at least one non-steroidal anti-inflammatory agent (NSAID). In another embodiment, a method for reducing bladder spasms comprising administering to a subject in need thereof a pharmaceutical composition comprising an effective amount of at least one prostaglandin (PG) pathway inhibitor, wherein the at least one PG pathway inhibitor is not acetaminophen or an NSAID. | 12-24-2015 |
| 20150366908 | SILICA-COATED CALCIUM SALT COMPOSITIONS - A composition including calcium salt and silica, wherein the silica is in the form of a silicate that is adsorbed onto the surface of the calcium salt, wherein the silica is not incorporated into the structure of the calcium salt, and wherein the composition is bioactive. | 12-24-2015 |
| 20150374639 | ENCAPSULATION OF HYDROPHILLIC ANTIRETROVIRAL DRUGS IN NANOCARRIERS - An encapsulated hydrophilic antiretroviral drug including a biodegradable polymeric nanoparticle and a process for fabricating biodegradable polymeric nanoparticles to encapsulate hydrophilic antiretroviral drugs are described. In an implementation, an encapsulated hydrophilic antiretroviral drug including a biodegradable polymeric nanoparticle includes a hydrophilic antiretroviral drug; and a biodegradable polymer polymeric nanoparticle that encapsulates the hydrophilic antiretroviral drug to form a nano-sized encapsulated hydrophilic antiretroviral drug. | 12-31-2015 |
| 20150374681 | CONTROLLED RELEASE COMPOSITIONS FOR TREATMENT OF COGNITIVE, EMOTIONAL AND MENTAL AILMENTS AND DISORDERS - A montelukast composition having a therapeutically effective amount of montelukast in a sustained release is disclosed. A montelukast composition having a therapeutically effective amount of montelukast in an immediate release and sustained release is also disclosed. | 12-31-2015 |
| 20150374849 | NANOPARTICLES FOR DRUG DELIVERY - The invention provides nanoparticles, methods for making nanoparticles, and methods for using nanoparticles. An important attribute of a drug delivery system is its ability to allow for spatial and temporal regulated drug release, thereby minimizing side effects and improving therapeutic efficacy of conventional pharmaceuticals. Iron oxide nanoparticles (NPs), specifically Fe304 nanoparticles, possess many appropriate qualities that make them a viable choice for drug delivery. | 12-31-2015 |
| 20160000709 | DRY POWDER INHALER FORMULATIONS COMPRISING SURFACE-MODIFIED PARTICLES WITH ANTI-ADHERENT ADDITIVES - The present invention is concerned with a refinement of the processing of particles that are to form a dry powder formulation which is to be administered to the lung using a dry powder inhaler (DPI) device. In particular, the present invention provides the processing of particles of active material and particles of carrier material in the presence of additive material to provide a powder composition which exhibits excellent powder properties and which is economical to produce. | 01-07-2016 |
| 20160000726 | PURIFIED THERAPEUTIC NANOPARTICLES AND PREPARATION METHODS THEREOF - Purified therapeutic nanoparticles are provided herein. Such nanoparticles comprise an active pharmaceutical ingredient and human serum albumin, wherein the weight ratio of human serum albumin to the active ingredient in the therapeutic nanoparticles is from 0.01:1 to 1:1, and wherein the nanoparticles are substantially free of free human serum albumin that is not incorporated in the nanoparticles. The present disclosure also provides pharmaceutical compositions that comprise the purified therapeutic nanoparticles and are also substantially free of free human serum albumin. Methods for preparing and using the purified therapeutic nanoparticles and compositions thereof are also provided. | 01-07-2016 |
| 20160000741 | Methods for Increasing Oral Osteogenesis Using Lipoxin A4 (LXA4) and Its Analogs - The invention provides methods for increasing oral osteogenesis using LXA | 01-07-2016 |
| 20160000878 | Treatment of Prior Disease With Oral Interferon Alpha - The present disclosure is directed to compositions and methods for treating prion diseases through oral administration of low doses of interferon-alpha. In one embodiment a composition is administered comprising interferon-alpha and trehalose. | 01-07-2016 |
| 20160001290 | APPARATUS AND METHODS FOR MAKING VESICLES - A microfluidic device includes a substrate and a microfluidic channel embedded in the substrate. The microfluidic channel includes a plurality of fluid inlets, at least one waste outlet, at least one vesicle outlet, a flow junction joining the at least one vesicle outlet and the at least one waste outlet in fluid communication, the flow junction having a fluid flow path that is orthogonal to the plane of the substrate, and at least one membrane between the at least one vesicle outlet and the at least one waste outlet configured to intercept a portion of the fluid flow path. | 01-07-2016 |
| 20160008292 | METHOD OF TREATING IRON DEFICIENCY | 01-14-2016 |
| 20160009643 | DISULFIDE COMPOUNDS FOR DELIVERY OF PHARMACEUTICAL AGENTS | 01-14-2016 |
| 20160015652 | HOLLOW NANOPARTICLES WITH HYBRID DOUBLE LAYERS - The present invention discloses the morphology of hollow, double-shelled submicrometer particles generated through a rapid aerosol-based process. The inner shell is an essentially hydrophobic carbon layer of nanoscale dimension (5-20 nm), and the outer shell is a hydrophilic silica layer of approximately 5-40 nm, with the shell thickness being a function of the particle size. The particles are synthesized by exploiting concepts of salt bridging to lock in a surfactant (CTAB) and carbon precursors together with iron species in the interior of a droplet. This deliberate negation of surfactant templating allows a silica shell to form extremely rapidly, sealing in the organic species in the particle interior. Subsequent pyrolysis results in a buildup of internal pressure, forcing carbonaceous species against the silica wall to form an inner shell of carbon. The incorporation of magnetic iron oxide into the shells opens up applications in external stimuli-responsive nanomaterials. | 01-21-2016 |
| 20160015661 | ASSEMBLY COMPRISING AN ABSORBER OF NEAR INFRARED (NIR) LIGHT COVALENTLY LINKED TO AN INHIBITOR OF CARBONIC ANHYDRASE - An assembly comprising an absorber of near infrared (NIR) light having an optical absorption cross section not lower than 100 nm2 covalently linked to an inhibitor of carbonic anhydrase (CA), process for its preparation and its use to hyperthermally target tumours or for treating other conditions in which the CA activity is involved is disclosed. | 01-21-2016 |
| 20160015691 | USE OF MTOR INHIBITORS FOR PREVENTION OF NEUROENDOCRINE TUMOR DEVELOPMENT AND GROWTH - Disclosed are methods and compositions for the prevention or inhibition of the growth of endocrine-related adenomas, neoplasia, or dysplasia in a patient who has been identified as being at risk for developing an endocrine tumor or endocrine cancer. The disclosed methods and compositions include rapamycin, a rapamycin analog, or another such inhibitor of the target of rapamycin (TOR). | 01-21-2016 |
| 20160015703 | NANO- MICRODELIVERY SYSTEMS FOR OROMUCOSAL DELIVERY OF AN ACTIVE INGREDIENT - A composition for oromucosal delivery of at least one active ingredient, more particularly a lipid nano-microdelivery system comprising a nicotine component and/or a flavour component, wherein the nicotine component may be delivered to the oral cavity via absorption through the mucosal membranes thereof and/or wherein the flavour component may be delivered to the oral mucosa by controlled release. | 01-21-2016 |
| 20160022818 | PHARMACEUTICAL FORMULATION COMPRISING LIPASE INHIBITOR HAVING INCREASED DISSOLUTION RATE AND REDUCED SIDE EFFECTS, AND METHOD FOR PREPARING SAME - The present invention provides a pharmaceutical formulation for increasing the dissolution rate of a lipase inhibitor and reducing side effects of the lipase inhibitor, including oily anal leakage, and a method for preparing the same, the pharmaceutical formulation comprising: a lipase inhibitor, and a porous adsorbent on which a thin film of the lipase inhibitor is formed. | 01-28-2016 |
| 20160030361 | CHOLESTOSOME VESICLES FOR INCORPORATION OF MOLECULES INTO CHYLOMICRONS - The present invention is directed to a cargo-loaded cholesteryl ester nanoparticle with a hollow compartment (“cholestosome”) consisting essentially of at least one non-ionic cholesteryl ester and one or more encapsulated active molecules which cannot appreciably pass through an enterocyte membrane in the absence of said molecule being loaded into said cholestosome, the cholestosome having a neutral surface and having the ability to pass into enterocytes in the manner of orally absorbed nutrient lipids using cell pathways to reach the golgi apparatus. Pursuant to the present invention, the novel cargo loaded cholestosomes according to the present invention are capable of depositing active molecules within cells of a patient or subject and effecting therapy or diagnosis of the patient or subject. | 02-04-2016 |
| 20160030514 | METHODS OF USING ZSCAN4 FOR REJUVENATING HUMAN CELLS - The present disclosure relates to methods for increasing telomere length in one or more human cells and/or increasing genome stability of one or more human cells, for example by contacting one or more human cells with an agent that increases expression of Zscan4 in the one or more human cells. Methods of treating a subject in need of telomere lengthening, treating a disease or condition associated with a genomic and/or chromosome abnormality, of rejuvenating one or more human cells, of rejuvenating tissues or organs, and of rejuvenating a subject in need thereof, for example by contacting one or more human cells in the subject with an agent that increases expression of Zscan4, or by administering to a subject in need thereof, an agent that increases expression of Zscan4 are also provided. | 02-04-2016 |
| 20160030590 | VECTORS FOR DELIVERY OF AGENTS ACROSS BIOLOGICAL MEMBRANES - The disclosure provides for peptide-based bolaamphiphile vectors that are capable of encapsulating a variety of agents, including peptides, proteins, nucleic acids, and drugs. The disclosure further provides for delivering these agents across biological membranes using the peptide-based bolaamphiphile vectors. | 02-04-2016 |
| 20160032316 | Purification and Purity Assessment of RNA Molecules Synthesized with Modified Nucleosides - This invention provides purified preparations of an RNA, oligoribonucleotide, or polyribonucleotide comprising a modified nucleoside, and methods of assessing purity of purified preparations of an RNA, oligoribonucleotide, or polyribonucleotide comprising a modified nucleoside. | 02-04-2016 |
| 20160045445 | COMBINATION THERAPEUTIC NANOPARTICLES - Nanoparticles that include a chemotherapeutic agent and an anti-inflammatory are particularly cytotoxic to prostate cancer cells. | 02-18-2016 |
| 20160045457 | EPINEPHRINE FINE PARTICLES AND METHODS FOR USE THEREOF FOR TREATMENT OF CONDITIONS RESPONSIVE TO EPINEPHRINE - The invention provides compositions including epinephrine fine particles, including epinephrine nanoparticles or nanocrystals and epinephrine microparticles or microcrystals, and methods for therapeutic use of the compositions for the treatment of conditions responsive to epinephrine such as a cardiac event or an allergic reaction, particularly anaphylaxis. The epinephrine fine particles can be incorporated into orally-disintegrating and fast-disintegrating tablet pharmaceutical formulations and can significantly increase the sublingual bioavailability of epinephrine, and thereby reduce the epinephrine dose required. | 02-18-2016 |
| 20160051659 | Gene optimized hantaan virus M segment DNA vaccine for hemorrhagic fever with renal syndrome - A synthetic, codon-optimized Hantaan virus (HTNV) full-length M gene open reading frame that consists of a unique nucleotide sequence encoding HTNV proteins. This synthetic gene was cloned into a plasmid to form the first optimized HTNV full-length M gene that elicits neutralizing antibodies in animals when delivered in combination with a similarly optimized Puumala virus (PUUV) DNA vaccine. The invention obviates the need for an extraneous gene sequence that was previously required for expression of the non-optimized HTNV gene. The synthetic gene is engineered into a molecular vaccine system to prevent hemorrhagic fever with renal syndrome (HFRS) caused by infection with HTNV, SEOV, or DOBV. Alternatively, it can be combined with the optimized PUUV DNA vaccine to protect against HFRS caused by any | 02-25-2016 |
| 20160051680 | Co-Processed Carbohydrate System as a Quick-Dissolve Matrix for Solid Dosage Forms - The present invention comprises a co-processed carbohydrate system, and formulations produced therefrom, which formulations are directly compressible into solid dosage forms, some of which rapidly and completely dissolve or disintegrate in the oral cavity within 60 seconds. The invention also comprises the solid dosage forms produced by directly compressing the co-processed carbohydrate system, some of which, when placed in the oral cavity, shall dissolve or disintegrate, preferably within about 60 seconds. | 02-25-2016 |
| 20160051728 | Decellularized Adipose Tissue - This invention provides a method for decellularizing adipose tissue, comprising subjecting the adipose tissue to one or more incubations in an enzymatic digestion solution containing one or more enzymes, and one or more solvent extractions, wherein decellularized adipose tissue comprising an extracellular matrix with well-preserved three-dimensional structure is obtained. The invention also provides a decellularized adipose tissue comprising an extracellular matrix with well-preserved three-dimensional architecture, and bioscaffolds, microcarrier beads, and coatings comprising the decellularized adipose tissue. | 02-25-2016 |
| 20160058706 | Therapeutic Nanoparticles and Related Compositions, Methods and Systems - Disclosed are targeted sub-50 nanometer nanoparticles suitable for delivering bioactive agents of interest, and related compositions, methods, and systems, which improve the manufacturing, stability, efficacy and other aspects of therapeutic nanoparticles. | 03-03-2016 |
| 20160058755 | Pharmaceutical Composition - Provided herein is a pharmaceutical composition comprising an antagonist, an agonist, a seal coat, and a sequestering polymer, wherein the antagonist, agonist, seal coat and at least one sequestering polymer are all components of a single unit, and wherein the seal coat forms a layer physically separating the antagonist from the agonist from one another. Methods for manufacturing such a pharmaceutical composition are also provided. Methods for treating pain using such compositions is also demonstrated. | 03-03-2016 |
| 20160058868 | SOLID DOSAGE FORM CONTAINING ARABINOGALACTAN - Provided is a dosage form for delivery of a therapeutic agent comprising a polymer matrix comprising arabinogalactan and a therapeutic agent uniformly dispersed in said polymer matrix. In some embodiments, the dosage form is selected from the group consisting of a microsphere, a nanosphere, a powder, a tablet, a film or a pellet enclosed in a capsule. Also provided are methods for preparing the dosage form. | 03-03-2016 |
| 20160058887 | NANODIAMOND PARTICLE COMPLEXES - The present invention provides various functionalized nanodiamond particles. In particular, the present invention provides soluble complexes of nanodiamond particles and therapeutic agents, for example insoluble therapeutics, anthracycline and/or tetracycline compounds, nucleic acids, proteins, etc. The present invention also provides materials and devices for the controlled release of therapeutics, and methods for uses thereof. | 03-03-2016 |
| 20160067187 | Methods for Treating or Preventing Migraines - The present invention provides a method for treating or preventing one or more types of migraines by administering a monoamine oxidase inhibitor, preferably Isocarboxazid, to a patient without invoking hypertensive crisis. | 03-10-2016 |
| 20160067191 | NANOSCALE COATINGS FOR ENCAPSULATION OF BIOLOGICAL ENTITIES - Methods, systems, and devices are disclosed for encapsulating biological entities with preservation of their biological activity. In one aspect, a method of encapsulating a biological entity includes templating a biocompatible material onto a biological structure to form a coating structure enclosing the biological structure, the coating structure having a size in the nanometer range, in which the coated biological structure preserves its biological activity within the coating structure. In some implementations of the method, the biological structure includes a virus and the biocompatible material includes silica. | 03-10-2016 |
| 20160067338 | METHOD FOR CARRYING THERAPEUTIC SUBSTANCES INTO CELLS - The present invention relates to compositions containing nanoparticies and uses of said composition for transferring therapeutically active substances into cells by means of specifically coated nanoparticles. The chemical design of the particles is such that a large amount thereof is absorbed into the cells. No direct bond between nanoparticle and the therapeutically active substance is required for the transfer into the cells. Thanks to said transfer, an increased efficacy of the substance and simultaneously reduced systemic toxicity is achieved, i.e. an increase in the efficacy while the side effects are reduced. | 03-10-2016 |
| 20160068540 | CRYSTAL FORMS OF (R)-N-METHYLNALTREXONE BROMIDE AND USES THEREOF - The present invention provides a new forms of (R)—N-methylnaltrexone, and compositions thereof, useful as a peripheral mu opioid receptor antagonist. | 03-10-2016 |
| 20160074362 | PHARMACEUTICAL AGENT - Provided is a composition for use in treating a skin condition, the composition comprising:
| 03-17-2016 |
| 20160076086 | NANO-PLASMONIC MOLECULAR PROBES AND METHODS OF USE - Plasmonics-active nanoprobes are provided for detection of target biomolecules including nucleic acids, proteins, and small molecules. The nucleic acids that can be detected include RNA, DNA, mRNA, microRNA, and small nucleotide polymorphisms (SNPs). The nanoproprobes can be used in vito in sensitive detection methods for diagnosis of diseases and disorders including cancer. Multiplexing can be performed using the nanoprobes such that multiple targets can be detected simultaneously in a single sample. The methods of use of the nanoprobes include detection by a visible color change. The nanoprobes can be used in vivo for treatment of undesireable cells in a subject. | 03-17-2016 |
| 20160081945 | A SOLID NANOPARTICLE WITH INORGANIC COATING - A nanoparticle having a solid core comprising a biologically active substance, said core being enclosed by an inorganic coating, a method for preparing the nanoparticle, and the use of the nanoparticle in therapy. A kit comprising the nanoparticle and a pharmaceutical composition comprising the nanoparticle. | 03-24-2016 |
| 20160082110 | BIOACTIVE TERPOLYMER COMPOSITIONS AND METHODS OF MAKING AND USING SAME - Described herein are terpolymer compositions, kits comprising the compositions, implant devices comprising the compositions, and methods of making and using same, including point of use methods. | 03-24-2016 |
| 20160089336 | Octreotide depot formulation with constantly high exposure levels - The present invention relates to sustained release formulations comprising as active ingredient octreotide or a pharmaceutically-acceptable salt thereof and two different linear polylactide-co-glycolide polymers (PLGAs). | 03-31-2016 |
| 20160089452 | MAGNETIC CELLS FOR LOCALIZING DELIVERY AND TISSUE REPAIR - Normal or genetically modified cell(s) having magnetic nanoparticle(s) bound (affixed) to their surfaces and methods of delivery to target tissues, e.g. For treatment of disease and/or injury. | 03-31-2016 |
| 20160095884 | METHOD FOR STABILISING SUSPENSIONS OF RED BLOOD CELLS ENCAPSULATING AN ACTIVE INGREDIENT, THE SUSPENSIONS OBTAINED - A method for obtaining a stabilised suspension of red blood cells encapsulating an active ingredient, from resealed RBCs incorporating the active ingredient, the method comprising the incubation of the resealed RBCs in an incubation solution at an osmolality of no less than 280 m Osmol/kg, for a time of 30 minutes or more, the incubation solution being a solution that does not contain an agent which is denaturating for the RBC membrane, the liquid medium is then removed from the incubated suspension and the RBCs obtained are placed in suspension in a solution allowing the injection of the suspension in a patient. The suspensions obtained are particularly characterized by an extracellular haemoglobin level maintained at 0.5 or lower, in particular 0.2 g/dl or lower and/or a haemolysis rate maintained at 2 or less, in particular 1% or less, at 72 h after placing in suspension in a preservation solution and at a temperature of between 2 and 8° C. | 04-07-2016 |
| 20160095906 | CONTROLLED RELEASE PHARMACEUTICAL COMPOSITIONS FOR ACID-LABILE DRUGS - An enteric-coated oral dosage form comprising an acid labile active pharmaceutical ingredient where the composition is substantially free of monomeric phthalic acid esters and synthetic oils is described herein. Also provided are methods for making and using the enteric-coated oral dosage form. The disclosed pharmaceutical compositions comprise an enteric coating which includes at least one plasticizer, at least one film-forming agent and optionally at least one anti-sticking agent. | 04-07-2016 |
| 20160101064 | PROCESS FOR PREPARING AN EMULSION OF AN ACTIVE INGREDIENT AND PARTICLES OBTAINED FROM THIS EMULSION - The invention concerns a method for preparing a double emulsion of a fat-soluble and hydrophobic active ingredient, which comprises the following steps:
| 04-14-2016 |
| 20160101083 | ANTI-PARASITIC METHODS AND COMPOSITIONS UTILIZING DIINDOLYLMETHANE-RELATED INDOLES - The present invention includes methods and compositions for the treatment and prevention of protozoal parasitic infections utilizing Diindolylmethane-related indoles. Additive and synergistic interaction of Diindolylmethane-related indoles with other known anti-parasitic and pro-apoptotic agents is believed to permit more effective therapy and prevention of protozoal parasitic infections. The methods and compositions described provide new treatment of protozoal parasitic diseases of mammals and birds including malaria, leishmaniasis, trypanosomiasis, trichomoniasis, neosporosis and coccidiosis. | 04-14-2016 |
| 20160101129 | Medicinal Clay Preparation - The present invention relates to a medicinal clay preparation containing 90-99.9% w/w medicinal clay and 0.1-10% w/w binders. It further relates to a method for producing said medicinal clay preparation, wherein first the binder(s) is/are dissolved or suspended in purified water and then the medicinal clay is mixed with the binder-water mixture and granulated by a conventional method. Optionally, a coating can also be subsequently applied. | 04-14-2016 |
| 20160101214 | METHOD FOR RESTORING A DAMAGED OR DEGENERATED INTERVERTEBRAL DISC - The present invention relates to a minimally-invasive method for restoring a damaged or degenerated intevertebral disc at an early stage. The method comprises the step of administering an injectable in situ setting formulation in the nucleus pulposus of the damaged or degenerated disc of the patient. The formulation once injected combines with nucleus matters and host cells, and becomes viscous or gels in situ within the annulus fibrosus of the disc for increasing the thickness and volume of the damaged or degenerated disc. The formulation is retained within the disc for providing restoration of the damaged or degenerated disc. | 04-14-2016 |
| 20160106882 | DEGRADABLE HAEMOSTAT COMPOSITION - The present invention relates to a haemostat composition that is able to safely gradually and fully degrade in a human or animal body within about 30 days and so can be utilised by physicians to stem a flow of blood and promote healing both after as well as during surgical procedures. | 04-21-2016 |
| 20160108389 | HIGH POTENCY PANCREATIN PHARMACEUTICAL COMPOSITIONS - The present disclosure provides high potency pharmaceutical compositions comprising high activity pancreatin enzymes. The invention is also directed to a process of producing HA-pancreatin enzymes and its compositions or dosage forms, and methods for their use. | 04-21-2016 |
| 20160120816 | LIGNIN MICROCAPSULE AND METHOD OF PRODUCING THE SAME - Disclosed are lignin microcapsules including lignin as a shell material and at least one of oil and a carbonaceous material as a core material. The lignin microcapsules may be formed by carried out polymerization in an oil-in-water emulsion including lignin, oil and water and further including a carbonaceous material. Since lignin has a phenol structure, the microcapsules including lignin may be formed to have antibacterial property. Thus, the lignin microcapsules may be used widely in various fields, such as additives for composite materials. | 05-05-2016 |
| 20160128986 | METHODS AND COMPOSITIONS RELATED TO THE USE OF LOW HLB SURFACTANTS IN THE PRODUCTION OF SYNTHETIC NANOCARRIERS COMPRISING A RAPALOG - Disclosed are compositions and methods related to synthetic nanocarriers comprising a hydrophobic carrier material, a rapalog, and a non-ionic surfactant with a hydrophilic-lipophilic balance (HLB) value less than or equal to 10. | 05-12-2016 |
| 20160128987 | METHODS AND COMPOSITIONS RELATED TO SYNTHETIC NANOCARRIERS WITH RAPAMYCIN IN A STABLE, SUPER-SATURATED STATE - Disclosed are compositions and methods that provide synthetic nanocarriers that comprise hydrophobic polyester carrier material and rapamycin that is in a stable, super-saturated amount. In some embodiments, the synthetic nanocarriers are also initially sterile filterable. In other embodiments, the rapamycin is present in the synthetic nanocarrier compositions in an amount that is less than 50 weight % rapamycin/hydrophobic polyester carrier material in the composition. | 05-12-2016 |
| 20160129148 | Nano-calcium phosphate-coated polymethylmethacrylate-based co-polymer and coating process of the same - The present invention relates to a method for coating polymethylmethacrylate (PMMA)-based co-polymer beads with nano-calcium phosphate. The method includes synthesizing the PMMA-based co-polymer beads containing hydroxyl pendant group, reacting the calcium salt and phosphate solution with the hydroxyl pendant group on the PMMA-based co-polymer beads, and thickening of the nano-calcium phosphate coating on the PMMA-based co-polymer beads. | 05-12-2016 |
| 20160143858 | Tamper Resistant Oral Dosage Forms - Disclosed in certain embodiments is a solid oral dosage form comprising: (a) an inert tamper resistant core; and (b) a coating surrounding the core, the coating comprising an active agent. | 05-26-2016 |
| 20160144023 | DRY SOLID ALUMINUM ADJUVANT-CONTAINING VACCINES AND RELATED METHODS THEREOF - Described herein are dry vaccine compositions and methods of freezing aluminum-containing vaccines such that when converted into a dried powder, the dry vaccine can be readily reconstituted to form a stable liquid vaccine without significant loss of activity. | 05-26-2016 |
| 20160145353 | TREATMENT OF FOOD INTOLERANCE AND FOOD ALLERGY WITH IgA - A process is provided for inhibiting symptoms of food allergy or food intolerance in a subject that includes the oral adminstration to the subject suffering from food allergy or food intolerance an IgM. When administered in a therapeutic quantity based on the subject characteristics and the type of IgM, symptoms of food allergy or food intolerance in that subject are inhibited. Even non-secretory forms of IgM are effective when administered orally. | 05-26-2016 |
| 20160151404 | Nucleic Acid Particles, Methods and Use Thereof | 06-02-2016 |
| 20160152664 | NOVEL a4B7 PEPTIDE MONOMER AND DIMER ANTAGONISTS | 06-02-2016 |
| 20160152968 | HIGH POTENCY PANCREATIN PHARMACEUTICAL COMPOSITIONS | 06-02-2016 |
| 20160158150 | Manufacture of Pharmaceutical Compositions - The present invention relates to particles and to methods of making particles. In particular, the invention relates to methods of making composite active particles comprising a pharmaceutically active material for pulmonary inhalation, the method comprising a jet milling process. | 06-09-2016 |
| 20160158281 | Surface-Modified Heavy Metal Nanoparticles, Compositions And Uses Thereof - Surface-modified heavy metal nanoparticles, including a heavy metal core and a coating layer, the coating layer having at least one ligand, conjugated to polyethylene glycol, the at least one ligand is selected from N-acetyl cysteine, albumin, cysteine, methionine, glutathione, amino thiols, thio-carboxylic acids, ammonia, amines, diamines or any combination thereof. Compositions including surface-modified heavy metal nanoparticles and uses thereof in treatment and diagnosis of various conditions. | 06-09-2016 |
| 20160159873 | RESEARCH BIO-NANOPARTICLE ELEMENTS AND PLATFORMS - The invention in suitable embodiments is directed to research bio-nanoparticle elements and research bio-nanoparticle platforms employing such research bio-nanoparticle elements. In one aspect, one or more elements of one or more types, formed from isolated, synthetic and or recombinant amino acid residues comprising in whole or in part one or more types of clathrin protein and/or non-clathrin coatomer proteins of one or more isoforms, execute one or more functions and or effect one or more ends, in vivo and or in vitro. | 06-09-2016 |
| 20160166504 | HYDROGEL DRUG DELIVERY IMPLANTS | 06-16-2016 |
| 20160166620 | ENCAPSULATED CELLS FOR HORMONE REPLACEMENT THERAPY | 06-16-2016 |
| 20160175254 | THE SYNTHESIS OF CORE-SHELL METAL-SEMICONDUCTOR NANOMATERIALS | 06-23-2016 |
| 20160175348 | ENHANCED NITRIC OXIDE DELIVERY AND USES THEREOF | 06-23-2016 |
| 20160183524 | RODENTICIDE - The present invention relates to rodenticides, methods of killing a rodent comprising administering to said rodent, a lethal dose of an isolated | 06-30-2016 |
| 20160184225 | PHARMACEUTICAL COMPOSITION, PREPARATION AND USES THEREOF - The present invention relates to a pharmaceutical composition comprising the combination of (i) a biocompatible nanoparticle and of (ii) a pharmaceutical compound of interest, to be administered to a subject in need of such a compound of interest, wherein the nanoparticle potentiates the compound of interest efficiency. The longest dimension of the biocompatible nanoparticle is typically between about 4 and about 500 nm, and its absolute surface charge value is of at least 10 mV (|10 mV|). The invention also relates to such a composition for use for administering the compound of interest in a subject in need thereof, wherein the nanoparticle and the compound of interest are to be administered in said subject between more than 5 minutes and about 72 hours one from each other. | 06-30-2016 |
| 20160184233 | COMPOSITIONS, DEVICES AND METHODS FOR MULTI-STAGE RELEASE OF CHEMOTHERAPEUTICS - In one aspect, the present disclosure provides microparticles that are configured to release a first drug over a first time period and to release a second drug over a second time period, wherein a lag period of substantially no drug release occurs between the first and second time periods. In other aspects, the present disclosure pertains to the use of such microparticles in delivery systems and methods of treatment. In another aspect, the present disclosure pertains to drug delivery systems that comprising a folded inflatable drug delivery balloon that comprises folds and microparticles positioned within the folds. | 06-30-2016 |
| 20160184384 | Tetrapeptides Derived from Human C-X-C Chemokines Useful for Treatment of Various Skin Conditions - Tetrapeptides consisting of (I or V)-X1-K-X2, where X1 can be selected from E, Q or K, and X2 can be selected from M, F, I, W, or V, exhibit diverse bioactivities. They are multi-functional effector molecules to stimulate keratinocytes migration; neutralize the proinflammatory effect of bacterial cell wall components such as lipoteichoic acids of the Gram-positive | 06-30-2016 |
| 20160186143 | METHODS FOR GENERATING STEM CELL-DERIVED BETA CELLS AND USES THEREOF - Disclosed herein are methods for generating SC-β cells, and isolated populations of SC-β cells for use in various applications, such as cell therapy. | 06-30-2016 |
| 20160199378 | LAYERED SUSTAINED-RELEASE MICROBEADS AND METHODS OF MAKING THE SAME | 07-14-2016 |
| 20160251477 | POLY(AMINE-CO-ESTER) NANOPARTICLES AND METHODS OF USE THEREOF | 09-01-2016 |
| 20160251681 | NON-LIPOSOMAL SYSTEMS FOR NUCLEIC ACID DELIVERY | 09-01-2016 |
| 20170231940 | Multiparticulate L-Carnitine And Nootropic Compositions And Related Methods | 08-17-2017 |
| 20180021297 | Use Of Croton- Or Calophyllum-Derived Proanthocyanidin Polymers Or Botanical Extracts In Combination With Rifaximin For The Treatment Of Diarrhea In Non-Human Animals | 01-25-2018 |
| 20180021455 | RECEPTOR-TARGETED NANOPARTICLES FOR ENHANCED TRANSCYTOSIS MEDIATED DRUG DELIVERY | 01-25-2018 |
| 20180021749 | LUTEIN MICROCAPSULE FORMULATION AND PREPARATION METHOD THEREOF | 01-25-2018 |
| 20180023052 | MODALITIES FOR THE TREATMENT OF DEGENERATIVE DISEASES OF THE RETINA | 01-25-2018 |
| 20190142753 | METHOD OF PREPARING PHARMACEUTICAL MICROSPHERE | 05-16-2019 |
| 20190142903 | Calcitonin Mimetics for Treating Diseases and Disorders | 05-16-2019 |
| 20190142936 | DRY SOLID ALUMINUM ADJUVANT-CONTAINING VACCINES AND RELATED METHODS THEREOF | 05-16-2019 |
| 20190142952 | MODIFIED RELEASE FORMULATIONS CONTAINING DRUG-ION EXCHANGE RESIN COMPLEXES | 05-16-2019 |
