Patent application title: METHODS FOR PRODUCING ISOBUTENE FROM 3-METHYLCROTONIC ACID
Inventors:
Mathieu Allard (Rigny-La-Nonneuse, FR)
Maria Anissimova (Nozay, FR)
Philippe Marlière (Luxembourg, LU)
Assignees:
GLOBAL BIOENERGIES
SCIENTIST OF FORTUNE SA
IPC8 Class: AC12P502FI
USPC Class:
1 1
Class name:
Publication date: 2021-12-30
Patent application number: 20210403956
Abstract:
Described are methods for the production of isobutene comprising the
enzymatic conversion of 3-methylcrotonic acid into isobutene wherein said
3-methylcrotonic acid is obtained by the enzymatic conversion of
3-methylcrotonyl-CoA into 3-methylcrotonic acid or wherein said
3-methylcrotonic acid is obtained by the enzymatic conversion of
3-hydroxyisovalerate (HIV) into 3-methylcrotonic acid. It is described
that the enzymatic conversion of 3-methylcrotonic acid into isobutene
can, e.g., be achieved by making use of a 3-methylcrotonic acid
decarboxylase, preferably an FMN-dependent decarboxylase associated with
an FMN prenyl transferase, an aconitate decarboxylase (EC 4.1.1.6), a
methylcrotonyl-CoA carboxylase (EC 6.4.1.4), or a geranoyl-CoA
carboxylase (EC 6.4.1.5).Claims:
1-36. (canceled)
37. A recombinant organism or microorganism capable of producing isobutene, wherein said microorganism expresses polypeptides comprising: a) at least one of: i. a CoA transferase (EC 2.8.3.-) and a thioester hydrolase (EC 3.1.2.-); or ii. (a) a phosphate butyryltransferase (EC 2.3.1.19) or a phosphate acetyltransferase (EC 2.3.1.8) and (b) a phosphotransferase with a carboxy group as acceptor (EC 2.7.2.-) and b) a 3-methylcrotonic acid decarboxylase selected from: i. an FMN-dependent decarboxylase associated with an FMN prenyl transferase (EC 2.5.1.-); ii. an aconitate decarboxylase (EC 4.1.1.6); iii. a methylcrotonyl-CoA carboxylase (EC 6.4.1.4); iv. a geranoyl-CoA carboxylase (EC 6.4.1.5); or v. a protocatechuate (PCA) decarboxylase (EC 4.1.1.63).
38. The recombinant organism or microorganism of claim 37, wherein the CoA transferase (EC 2.8.3.-) is selected from a propionate:acetate-CoA transferase (EC 2.8.3.1), an acetate CoA-transferase (EC 2.8.3.8) or a succinyl-CoA:acetate CoA-transferase (EC 2.8.3.18).
39. The recombinant organism or microorganism of claim 37, wherein the thioester hydrolase (EC 3.1.2.-) is selected from an acetyl-CoA hydrolase (EC 3.1.2.1), an ADP-dependent short-chain-acyl-CoA hydrolase (EC 3.1.2.18) or an acyl-CoA hydrolase (EC 3.1.2.20).
40. The recombinant organism or microorganism of claim 37, wherein the phosphotransferase with a carboxy group as acceptor (EC 2.7.2.-) is selected from a propionate kinase (EC 2.7.2.15), an acetate kinase (EC 2.7.2.1), a butyrate kinase (EC 2.7.2.7) or a branched-chain-fatty-acid kinase (EC 2.7.2.14).
41. The recombinant organism or microorganism of claim 37, wherein the recombinant organism or microorganism further expresses a polypeptide selected from a methylcrotonyl-CoA carboxylase (EC 6.4.1.4) or a geranoyl-CoA carboxylase (EC 6.4.1.5).
42. The recombinant organism or microorganism of claim 41, wherein the recombinant organism or microorganism further expresses a polypeptide selected from a 3-methylglutaconyl-coenzyme A hydratase (EC 4.2.1.18), a 3-hydroxyacyl-CoA dehydratase (EC 4.2.1.-) or an enoyl-CoA hydratase (EC 4.2.1.-).
43. The recombinant organism or microorganism of claim 42, wherein the recombinant organism or microorganism further expresses a polypeptide selected from a 3-hydroxy-3-methylglutaryl-CoA synthase.
44. The recombinant organism or microorganism of claim 37, wherein the 3-methylcrotonic acid decarboxylase is a FMN-dependent decarboxylase associated with an FMN prenyl transferase (EC 2.5.1.-).
45. The recombinant organism or microorganism of claim 38, wherein the 3-methylcrotonic acid decarboxylase is a FMN-dependent decarboxylase associated with an FMN prenyl transferase (EC 2.5.1.-).
46. The recombinant organism or microorganism of claim 39, wherein the 3-methylcrotonic acid decarboxylase is a FMN-dependent decarboxylase associated with an FMN prenyl transferase (EC 2.5.1.-).
47. The recombinant organism or microorganism of claim 46, wherein the thioester hydrolase (EC 3.1.2.-) is selected from an acetyl-CoA hydrolase (EC 3.1.2.1), an ADP-dependent short-chain-acyl-CoA hydrolase (EC 3.1.2.18) or an acyl-CoA hydrolase (EC 3.1.2.20).
48. The recombinant organism or microorganism of claim 40, wherein the 3-methylcrotonic acid decarboxylase is a FMN-dependent decarboxylase associated with an FMN prenyl transferase (EC 2.5.1.-).
49. The recombinant organism or microorganism of claim 48, wherein the thioester hydrolase (EC 3.1.2.-) is selected from an acetyl-CoA hydrolase (EC 3.1.2.1), an ADP-dependent short-chain-acyl-CoA hydrolase (EC 3.1.2.18) or an acyl-CoA hydrolase (EC 3.1.2.20).
50. The recombinant organism or microorganism of claim 41, wherein the 3-methylcrotonic acid decarboxylase is a FMN-dependent decarboxylase associated with an FMN prenyl transferase (EC 2.5.1.-).
51. The recombinant organism or microorganism of claim 50, wherein the thioester hydrolase (EC 3.1.2.-) is selected from an acetyl-CoA hydrolase (EC 3.1.2.1), an ADP-dependent short-chain-acyl-CoA hydrolase (EC 3.1.2.18) or an acyl-CoA hydrolase (EC 3.1.2.20).
52. The recombinant organism or microorganism of claim 42, wherein the 3-methylcrotonic acid decarboxylase is a FMN-dependent decarboxylase associated with an FMN prenyl transferase (EC 2.5.1.-).
53. The recombinant organism or microorganism of claim 52, wherein the thioester hydrolase (EC 3.1.2.-) is selected from an acetyl-CoA hydrolase (EC 3.1.2.1), an ADP-dependent short-chain-acyl-CoA hydrolase (EC 3.1.2.18) or an acyl-CoA hydrolase (EC 3.1.2.20).
54. The recombinant organism or microorganism of claim 43, wherein the 3-methylcrotonic acid decarboxylase is a FMN-dependent decarboxylase associated with an FMN prenyl transferase (EC 2.5.1.-).
55. The recombinant organism or microorganism of claim 54, wherein the thioester hydrolase (EC 3.1.2.-) is selected from an acetyl-CoA hydrolase (EC 3.1.2.1), an ADP-dependent short-chain-acyl-CoA hydrolase (EC 3.1.2.18) or an acyl-CoA hydrolase (EC 3.1.2.20).
56. The recombinant organism or microorganism of claim 44, wherein the 3-methylcrotonic acid decarboxylase is a FMN-dependent decarboxylase associated with an FMN prenyl transferase (EC 2.5.1.-).
57. The recombinant organism or microorganism of claim 56, wherein the thioester hydrolase (EC 3.1.2.-) is selected from an acetyl-CoA hydrolase (EC 3.1.2.1), an ADP-dependent short-chain-acyl-CoA hydrolase (EC 3.1.2.18) or an acyl-CoA hydrolase (EC 3.1.2.20).
58. The recombinant organism or microorganism of claim 45, wherein the 3-methylcrotonic acid decarboxylase is a FMN-dependent decarboxylase associated with an FMN prenyl transferase (EC 2.5.1.-).
59. The recombinant organism or microorganism of claim 58, wherein the thioester hydrolase (EC 3.1.2.-) is selected from an acetyl-CoA hydrolase (EC 3.1.2.1), an ADP-dependent short-chain-acyl-CoA hydrolase (EC 3.1.2.18) or an acyl-CoA hydrolase (EC 3.1.2.20).
Description:
[0001] The present invention relates to methods for the production of
isobutene comprising the enzymatic conversion of 3-methylcrotonic acid
into isobutene wherein said 3-methylcrotonic acid is obtained by the
enzymatic conversion of 3-methylcrotonyl-CoA into 3-methylcrotonic acid
or wherein said 3-methylcrotonic acid is obtained by the enzymatic
conversion of 3-hydroxyisovalerate (HIV) into 3-methylcrotonic acid. The
enzymatic conversion of 3-methylcrotonic acid into isobutene can, e.g.,
be achieved by making use of a 3-methylcrotonic acid decarboxylase,
preferably an FMN-dependent decarboxylase associated with an FMN prenyl
transferase, an aconitate decarboxylase (EC 4.1.1.6), a
methylcrotonyl-CoA carboxylase (EC 6.4.1.4), or a geranoyl-CoA
carboxylase (EC 6.4.1.5). Further, said 3-methylcrotonyl-CoA can be
obtained by the enzymatic conversion of 3-methylglutaconyl-CoA into
3-methylcrotonyl-CoA.
[0002] A large number of chemical compounds are currently derived from petrochemicals. Alkenes (such as ethylene, propylene, the different butenes, or else the pentenes, for example) are used in the plastics industry, for example for producing polypropylene or polyethylene, and in other areas of the chemical industry and that of fuels.
[0003] Butylene exists in four forms, one of which, isobutene (also referred to as isobutylene), enters into the composition of methyl-tert-butyl-ether (MTBE), an anti-knock additive for automobile fuel. Isobutene can also be used to produce isooctene, which in turn can be reduced to isooctane (2,2,4-trimethylpentane); the very high octane rating of isooctane makes it the best fuel for so-called "gasoline" engines. Alkenes such as isobutene are currently produced by catalytic cracking of petroleum products (or by a derivative of the Fischer-Tropsch process in the case of hexene, from coal or gas). The production costs are therefore tightly linked to the price of oil. Moreover, catalytic cracking is sometimes associated with considerable technical difficulties which increase process complexity and production costs.
[0004] The production by a biological pathway of alkenes such as isobutene is called for in the context of a sustainable industrial operation in harmony with geochemical cycles. The first generation of biofuels consisted in the fermentative production of ethanol, as fermentation and distillation processes already existed in the food processing industry. The production of second generation biofuels is in an exploratory phase, encompassing in particular the production of long chain alcohols (butanol and pentanol), terpenes, linear alkanes and fatty acids. Two recent reviews provide a general overview of research in this field: Ladygina et al. (Process Biochemistry 41 (2006), 1001) and Wackett (Current Opinions in Chemical Biology 21 (2008), 187).
[0005] The conversion of isovalerate to isobutene by the yeast Rhodotorula minuta has been described (Fujii et al. (Appl. Environ. Microbiol. 54 (1988), 583)), but the efficiency of this reaction, less than 1 millionth per minute, or about 1 for 1000 per day, is far from permitting an industrial application. The reaction mechanism was elucidated by Fukuda et al. (BBRC 201 (1994), 516) and involves a cytochrome P450 enzyme which decarboxylates isovalerate by reduction of an oxoferryl group Fe.sup.V=O. Large-scale biosynthesis of isobutene by this pathway seems highly unfavourable, since it would require the synthesis and degradation of one molecule of leucine to form one molecule of isobutene. Also, the enzyme catalyzing the reaction uses heme as cofactor, poorly lending itself to recombinant expression in bacteria and to improvement of enzyme parameters. For all these reasons, it appears very unlikely that this pathway can serve as a basis for industrial exploitation. Other microorganisms have been described as being marginally capable of naturally producing isobutene from isovalerate; the yields obtained are even lower than those obtained with Rhodotorula minuta (Fukuda et al. (Agric. Biol. Chem. 48 (1984), 1679)).
[0006] Gogerty et al. (Appl. Environm. Microbiol. 76 (2010), 8004-8010) and van Leeuwen et al. (Appl. Microbiol. Biotechnol. 93 (2012), 1377-1387) describe the production of isobutene from acetoacetyl-CoA by enzymatic conversions wherein the last step of the proposed pathway is the conversion of 3-hydroxy-3-methylbutyric acid (also referred to as 3-hydroxyisovalerate (HIV)) by making use of a mevalonate diphosphate decarboxylase. This reaction for the production of isobutene from 3-hydroxy-3-methylbutyric acid is also described in WO2010/001078. In Gogerty et al. (loc. cit.) and in van Leeuwen et al. (loc. cit.) the production of 3-hydroxy-3-methylbutyric acid is proposed to be achieved by the conversion of 3-methylcrotonyl-CoA via 3-hydroxy-3-methylbutyryl-CoA. In order to further improve the efficiency and variability of methods for producing isobutene from renewable resources, there is a need for alternative routes for the provision of isobutene and its precursors.
[0007] The present invention meets this demand by providing a method for the production of isobutene comprising the enzymatic conversion of 3-methylcrotonic acid (also termed 3-methyl-2-butenoic acid) into isubutene.
[0008] The enzymatic conversion of 3-methylcrotonic acid into isobutene is a decarboxylation reaction. A decarboxylation is a chemical reaction that removes a carboxyl group and releases carbon dioxide (CO.sub.2).
[0009] The decarboxylation of 3-methylcrotonic acid has already been suggested in US-A1-2009/0092975 while there is no experimental evidence for this conversion. In US-A1-2009/0092975, a nucleic acid sequence called PAD1 derived from Saccharomyces cerevisiae is described and is disclosed to encode a decarboxylation enzyme. This enzyme is suggested to be useful as a selectable marker in a recombinant organism while it is described that a "weak acid" may be used as the selecting agent. 3-methylcrotonic acid is mentioned, among many others, as a potential "weak acid".
[0010] However, it was only later found that the above PAD1, in reality, does not provide for the decarboxylase activity.
[0011] In fact, the bacterial ubiD and ubiX or the homologous eukaryotic fdc1 and pad1 genes have been implicated in the non-oxidative reversible decarboxylation. The combined action of phenylacrylic acid decarboxylase (PAD) and ferulic acid decarboxylase (FDC) is considered to be essential for the decarboxylation of phenylacrylic acid in Saccharomyces cerevisiae (J. Biosci. Bioeng. 109, (2010), 564-569; AMB Express, 5:12 (2015) 1-5; ACS Chem. Biol. 10 (2015), 1137-1144).
[0012] Recently, the above enzyme family described as phenylacrylic acid decarboxylase (PAD) was characterized as an FMN prenyl-transferase and no longer as a decarboxylase. It has been shown that Fdc1 (but not PAD) is solely responsible for the reversible decarboxylase activity and that it requires a new type of cofactor, namely a prenylated flavin synthesized by the associated UbiX (or Pad1) protein. Thus, the real enzymatic activity of this PAD enzyme has been identified as the transformation of a flavin mononucleotide (FMN) cofactor with a prenyl moiety (from di-methyl-allyl-phosphate or pyrophosphate called DMAP or DMAPP).
[0013] Accordingly, in contrast to the prior art's belief, the real decarboxylase is the ferulic acid decarboxylase (FDC) in association with the modified FMN (prenylated-FMN). This mechanism of the ferulic acid decarboxylase (FDC) in association with the modified FMN (prenylated-FMN) (the latter provided by the PAD enzyme) was recently described and involves a surprising enzymatic mechanism, i.e., an .alpha.,.beta.-unsaturated acid decarboxylation via a 1,3-dipolar cyclo-addition. Moreover, the structure of this FDC decarboxylase has recently been elucidated (Nature 522 (2015), 497-501; Nature, 522 (2015), 502-505; Appl. Environ. Microbiol. 81 (2015), 4216-4223).
[0014] The use of the above family of enzymes has previously been described for the conversion of .alpha.-.beta. unsaturated carboxylic acid into terminal alkenes in US-A1-2009/0092975 as mentioned above while WO2012/018624 is directed to microorganisms and methods for the biosynthesis of aromatics, 2,4-pentadienoate and 1,3-butadiene and WO2013/028519 is directed to microorganisms and methods for producing 2,4-pentadienoate, butadiene, propylene, 1,3-butanediol and related alcohols.
[0015] Moreover, WO2013/186215 describes a method for preparing a mono-unsaturated alkene comprising contacting an aliphatic mono-unsaturated carboxylic acid with an Fdc1 polypeptide and a Pad1 polypeptide. However, in WO2013/186215, both, the Fdc1 polypeptide and the Pad1 polypeptide are classified as enzymes having a decarboxylase activity.
[0016] In contrast, in the present invention, the above enzymes are artificially implemented in a pathway which ultimately leads to the production of isobutene. Thus, in a main aspect, the present invention relates to a method for the production of isobutene comprising the enzymatic conversion of 3-methylcrotonic acid into isobutene (step I as shown in FIG. 1),
[0017] wherein said method further comprises
[0018] (a) providing the 3-methylcrotonic acid by the enzymatic conversion of 3-methylcrotonyl-CoA into 3-methylcrotonic acid (steps VIa, VIb or VIc as shown in FIG. 1), or
[0019] (b) providing the 3-methylcrotonic acid by the enzymatic conversion of 3-hydroxyisovalerate (HIV) into 3-methylcrotonic acid (step II as shown in FIG. 1)
[0020] Preferably, the enzymatic conversion of 3-methylcrotonic acid into isobutene is achieved by making use of a 3-methylcrotonic acid decarboxylase.
[0021] The method for the production of isobutene from 3-methylcrotonyl-CoA via 3-methylcrotonic acid or from 3-hydroxyisovalerate (HIV) via 3-methylcrotonic acid may be embedded in a pathway for the production of isobutene starting from acetyl-CoA which is a central component and an important key molecule in metabolism used in many biochemical reactions. The corresponding reactions are schematically shown in FIG. 1.
[0022] Therefore, the present invention also relates to pathways starting from acetyl-CoA and leading to 3-methylcrotonic acid (which is then ultimately converted into isobutene) via two alternative pathways which are schematically shown in FIG. 1 and will be explained in more detail further below.
[0023] The Routes for the Enzymatic Conversion from Acetyl-CoA into Isobutene via Acetoacetyl-CoA and 3-Methylcrotonic Acid
[0024] The Enzymatic Conversion of 3-Methylcrotonic Acid into Isobutene: Step I as Shown in FIG. 1
[0025] The enzymatic conversion of 3-methylcrotonic acid into isobutene is schematically shown in FIG. 2B.
[0026] According to the present invention, the enzymatic conversion of 3-methylcrotonic acid (also termed 3-methyl-2-butenoic acid or 3,3-dimethyl-acrylic acid) into isobutene (also termed isobutylene or 2-methyl-propene) can be achieved by a decarboxylation. "Decarboxylation" is generally a chemical reaction that removes a carboxyl group and releases carbon dioxide (CO.sub.2).
[0027] The enzymatic conversion of 3-methylcrotonic acid into isobutene can preferably be achieved by making use of a 3-methylcrotonic acid decarboxylase. In accordance with the present invention, a 3-methylcrotonic acid decarboxylase is an enzyme which is capable of converting 3-methylcrotonic acid into isobutene in a decarboxylation reaction.
[0028] In preferred embodiments, the 3-methylcrotonic acid decarboxylase is selected from the group consisting of:
[0029] (i) an FMN-dependent decarboxylase associated with an FMN prenyl transferase; or
[0030] (ii) an aconitate decarboxylase (EC 4.1.1.6); or
[0031] (iii) a methylcrotonyl-CoA carboxylase (EC 6.4.1.4); or
[0032] (iv) a geranoyl-CoA carboxylase (EC 6.4.1.5).
[0033] Thus, according to one aspect, the enzymatic conversion of 3-methylcrotonic acid into isobutene can preferably be achieved by making use of a 3-methylcrotonic acid decarboxylase, wherein said 3-methylcrotonic acid decarboxylase is an FMN-dependent decarboxylase associated with an FMN prenyl transferase.
[0034] The enzymatic conversion of 3-methylcrotonic acid into isobutene utilizing an FMN-dependent decarboxylase associated with an FMN prenyl transferase relies on a reaction of two consecutive steps catalyzed by the two enzymes, i.e., the FMN-dependent decarboxylase (catalyzing the actual decarboxylation of 3-methylcrotonic acid into isobutene) with an associated FMN prenyl transferase which provides the modified flavin cofactor. The flavin cofactor may preferably be FMN or FAD. FMN (flavin mononucleotide; also termed riboflavin-5'-phosphate) is a biomolecule produced from riboflavin (vitamin B2) by the enzyme riboflavin kinase and functions as prosthetic group of various reactions. FAD (flavin adenine dinucleotide) is a redox cofactor, more specifically a prosthetic group, involved in several important reactions in metabolism.
[0035] Thus, in the conversion of 3-methylcrotonic acid into isobutene, in a first step, a flavin cofactor (FMN or FAD) is modified into a (modified) flavin-derived cofactor. This modification is catalyzed by said FMN prenyl transferase. FMN prenyl transferase prenylates the flavin ring of the flavin cofactor (FMN or FAD) into a (modified) prenylated flavin cofactor. This reaction is schematically illustrated in FIG. 2A.
[0036] In a second step, the actual conversion of 3-methylcrotonic acid into isobutene is catalyzed by said FMN-dependent decarboxylase via a 1,3-dipolar cycloaddition based mechanism wherein said FMN-dependent decarboxylase uses the prenylated flavin cofactor (FMN or FAD) provided by the associated FMN prenyl transferase. This reaction is schematically illustrated in FIG. 2B.
[0037] In a preferred embodiment, said FMN prenyl transferase which modifies the flavin cofactor (FMN or FAD) into a (modified) flavin-derived cofactor is a phenylacrylic acid decarboxylase (PAD)-type protein, or the closely related prokaryotic enzyme UbiX, an enzyme which is involved in ubiquinone biosynthesis in prokaryotes.
[0038] In Escherichia coli, the protein UbiX (also termed 3-octaprenyl-4-hydroxybenzoate carboxy-lyase) has been shown to be involved in the third step of ubiquinone biosynthesis.
[0039] It catalyses the reaction 3-octaprenyl-4-hydroxybenzoate2-octaprenylphenol+CO.sub.2.
[0040] Moreover, the knockout of the homologous protein in yeast (Pad1) has been shown to confer sensitivity to phenylacrylic acid, showing that this enzyme functions as a phenylacrylic acid decarboxylase. E. coli strains also contain, in addition to UbiX, a second paralogue named Pad1. Its amino acid sequence shows 52% identity to UbiX and slightly higher sequence identity to Saccharomyces cerevisiae phenylacrylic acid decarboxylase Pad1. Despite its higher sequence similarity with yeast Pad1, E. coli Pad1 does not seem to have phenylacrylic acid decarboxylase activity. Its function is unknown, Pad1 may remove the carboxylate group from derivatives of benzoic acid but not from substituted phenolic acids.
[0041] Thus, in a preferred embodiment, the modification of a flavin cofactor (FMN or FAD) into the corresponding (modified) flavin-derived cofactor is catalyzed by the FMN-containing protein phenylacrylic acid decarboxylase (PAD). The enzymes involved in the modification of the flavin cofactor (FMN or FAD) into the corresponding modified flavin-derived cofactor were initially annotated as decarboxylases (EC 4.1.1.-). Some phenylacrylic acid decarboxylases (PAD) are now annotated as flavin prenyl transferases as EC 2.5.1.-.
[0042] In a more preferred embodiment, the conversion of 3-methylcrotonic acid into isobutene makes use of a phenylacrylic acid decarboxylase (PAD)-type protein as the FMN prenyl transferase which modifies a flavin cofactor (FMN or FAD) into the corresponding (modified) flavin-derived cofactor wherein said phenylacrylic acid decarboxylase (PAD)-type protein is derived from Candida albicans (Uniprot accession number Q5A8L8), Aspergillus niger (Uniprot accession number A3F715), Saccharomyces cerevisiae (Uniprot accession number P33751) or Cryptococcus gattii (Uniprot accession number E6R9Z0).
[0043] In a preferred embodiment, the phenylacrylic acid decarboxylase (PAD)-type protein employed in the method of the present invention is a phenylacrylic acid decarboxylase (PAD)-type protein derived from Candida albicans (Uniprot accession number Q5A8L8; SEQ ID NO:40), Aspergillus niger (Uniprot accession number A3F715; SEQ ID NO:41), Saccharomyces cerevisiae (Uniprot accession number P33751; SEQ ID NO:42) or Cryptococcus gattii (Uniprot accession number E6R9Z0; SEQ ID NO:43) having the amino acid sequence as shown in SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42 and SEQ ID NO:43, respectively.
[0044] In a preferred embodiment of the present invention the phenylacrylic acid decarboxylase (PAD)-type protein is an enzyme comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 40 to 43 or a sequence which is at least n % identical to any of SEQ ID NOs: 40 to 43 with n being an integer between 10 and 100, preferably 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99 and wherein the enzyme has the enzymatic activity of modifying a flavin cofactor (FMN or FAD) into the corresponding (modified) flavin-derived cofactor.
[0045] As regards the determination of sequence identity, the following should apply: When the sequences which are compared do not have the same length, the degree of identity either refers to the percentage of amino acid residues in the shorter sequence which are identical to amino acid residues in the longer sequence or to the percentage of amino acid residues in the longer sequence which are identical to amino acid residues in the shorter sequence. Preferably, it refers to the percentage of amino acid residues in the shorter sequence which are identical to amino acid residues in the longer sequence. The degree of sequence identity can be determined according to methods well known in the art using preferably suitable computer algorithms such as CLUSTAL.
[0046] When using the Clustal analysis method to determine whether a particular sequence is, for instance, at least 60% identical to a reference sequence default settings may be used or the settings are preferably as follows: Matrix: blosum 30; Open gap penalty: 10.0; Extend gap penalty: 0.05; Delay divergent: 40; Gap separation distance: 8 for comparisons of amino acid sequences. For nucleotide sequence comparisons, the Extend gap penalty is preferably set to 5.0.
[0047] In a preferred embodiment ClustalW2 is used for the comparison of amino acid sequences. In the case of pairwise comparisons/alignments, the following settings are preferably chosen: Protein weight matrix: BLOSUM 62; gap open: 10; gap extension: 0.1. In the case of multiple comparisons/alignments, the following settings are preferably chosen: Protein weight matrix: BLOSUM 62; gap open: 10; gap extension: 0.2; gap distance: 5; no end gap.
[0048] Preferably, the degree of identity is calculated over the complete length of the sequence.
[0049] Amino acid residues located at a position corresponding to a position as indicated herein-below in the amino acid sequence shown in any one of SEQ ID NOs:40 to 43 can be identified by the skilled person by methods known in the art. For example, such amino acid residues can be identified by aligning the sequence in question with the sequence shown in any one of SEQ ID NOs:40 to 43 and by identifying the positions which correspond to the above indicated positions of any one of SEQ ID NOs:40 to 43. The alignment can be done with means and methods known to the skilled person, e.g. by using a known computer algorithm such as the Lipman-Pearson method (Science 227 (1985), 1435) or the CLUSTAL algorithm. It is preferred that in such an alignment maximum homology is assigned to conserved amino acid residues present in the amino acid sequences.
[0050] In a preferred embodiment ClustalW2 is used for the comparison of amino acid sequences. In the case of pairwise comparisons/alignments, the following settings are preferably chosen: Protein weight matrix: BLOSUM 62; gap open: 10; gap extension: 0.1. In the case of multiple comparisons/alignments, the following settings are preferably chosen: Protein weight matrix: BLOSUM 62; gap open: 10; gap extension: 0.2; gap distance: 5; no end gap.
[0051] Preferably, the degree of identity is calculated over the complete length of the sequence.
[0052] In another preferred embodiment, the modification of a flavin cofactor (FMN or FAD) into the corresponding (modified) flavin-derived cofactor is catalyzed by the FMN-containing protein 3-octaprenyl-4-hydroxybenzoate carboxy-lyase also termed UbiX (initially annotated EC 4.1.1.-). As mentioned above, the enzymes involved in the modification of the flavin cofactor (FMN or FAD) into the corresponding modified flavin-derived cofactor were initially annotated as decarboxylases. Some phenylacrylic acid decarboxylases (PAD) are now annotated as flavin prenyl transferases as EC 2.5.1.-.
[0053] In a more preferred embodiment, the conversion of 3-methylcrotonic acid into isobutene makes use of a 3-octaprenyl-4-hydroxybenzoate carboxy-lyase (also termed UbiX) as the FMN prenyl transferase which modifies the flavin cofactor (FMN or FAD) into the corresponding (modified) flavin-derived cofactor wherein said 3-octaprenyl-4-hydroxybenzoate carboxy-lyase (also termed UbiX) is derived from Escherichia coli (Uniprot accession number POAG03), Bacillus subtilis (Uniprot accession, number A0A086WXG4), Pseudomonas aeruginosa (Uniprot accession number A0A072ZCW8) or Enterobacter sp. DC4 (Uniprot accession number W7P6B1).
[0054] In an even more preferred embodiment, the 3-octaprenyl-4-hydroxybenzoate carboxy-lyase (also termed UbiX) employed in the method of the present invention is a 3-octaprenyl-4-hydroxybenzoate carboxy-lyase (also termed UbiX) derived from Escherichia coli (Uniprot accession number POAG03; SEQ ID NO:44), Bacillus subtilis (Uniprot accession, number A0A086WXG4; SEQ ID NO:45), Pseudomonas aeruginosa (Uniprot accession number A0A072ZCW8; SEQ ID NO:46) or Enterobacter sp. DC4 (Uniprot accession number W7P6B1; SEQ ID NO:47) having the amino acid sequence as shown in SEQ ID NO:44, SEQ ID NO:45, SEQ ID NO:46 and SEQ ID NO:47, respectively.
[0055] In a preferred embodiment of the present invention the 3-octaprenyl-4-hydroxybenzoate carboxy-lyase is an enzyme comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 44 to 47 or a sequence which is at least n % identical to any of SEQ ID NOs: 44 to 47 with n being an integer between 10 and 100, preferably 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99 and wherein the enzyme has the enzymatic activity of modifying a flavin cofactor (FMN or FAD) into the corresponding (modified) flavin-derived cofactor. As regards the determination of the sequence identity, the same applies as has been set forth above.
[0056] In another preferred embodiment, the modification of a flavin cofactor (FMN or FAD) into the corresponding (modified) flavin-derived cofactor is catalyzed by a flavin prenyl transferase.
[0057] As mentioned above, the actual decarboxylation, i.e., the conversion of 3-methylcrotonic acid into isobutene is catalyzed by an FMN-dependent decarboxylase via a 1,3-dipolar cycloaddition based mechanism wherein said FMN-dependent decarboxylase uses the prenylated flavin cofactor (FMN or FAD) provided by any of the above described associated FMN prenyl transferases.
[0058] In a preferred embodiment, said FMN-dependent decarboxylase catalyzing the decarboxylation of 3-methylcrotonic acid into isobutene is catalyzed by a ferulic acid decarboxylase (FDC). Ferulic acid decarboxylases (FDC) belong to the enzyme class EC 4.1.1.-.
[0059] In an even more preferred embodiment, the conversion of 3-methylcrotonic acid into isobutene makes use of a ferulic acid decarboxylases (FDC) which is derived from Saccharomyces cerevisiae (Uniprot accession number Q03034), Enterobacter sp. (Uniprot accession number V3P7U0), Bacillus pumilus (Uniprot accession number Q45361), Aspergillus niger (Uniprot accession number A2R0P7) or Candida dubliniensis (Uniprot accession number B9WJ66).
[0060] In a preferred embodiment, the ferulic acid decarboxylases (FDC) employed in the method of the present invention is a ferulic acid decarboxylases (FDC) derived from Saccharomyces cerevisiae (Uniprot accession number Q03034; SEQ ID NO:48), Enterobacter sp. (Uniprot accession number V3P7U0; SEQ ID NO:49), Bacillus pumilus (Uniprot accession number Q45361; SEQ ID NO:50), Aspergillus niger (Uniprot accession number A2ROP7; SEQ ID NO:51) or Candida dubliniensis (Uniprot accession number B9WJ66; SEQ ID NO:52) having the amino acid sequence as shown in SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51 and SEQ ID NO:52, respectively.
[0061] In another more preferred embodiment, the conversion of 3-methylcrotonic acid into isobutene makes use of a protocatechuate decarboxylase (EC 4.1.1.63).
[0062] Thus, in one preferred embodiment, the conversion of 3-methylcrotonic acid into isobutene is catalyzed by a protocatechuate (PCA) decarboxylase (EC 4.1.1.63). PCA decarboxylases (also termed AroY) are known to catalyze the following reaction, i.e., the enzymatic conversion of protocatechuate (PCA) into catechol (Johnson et al., Metabolic Engineering Communications 3 (2016), 111): 3,4-dihydroxybenzoatecatechol+CO.sub.2
[0063] This enzyme occurs in a variety of organisms and has, e.g., been described in Enterobacter aerogenes, Enterobacter cloacae, Rhodopseudomonas sp. and Sedimentibacter hydroxybenzoicus.
[0064] In a preferred embodiment of the present invention, the PCA decarboxylase employed in the method of the present invention is a PCA decarboxylase which is derived from Klebsiella pneumoniae (Uniprot accession number B9AM6), Leptolyngbya sp. (Uniprot accession number A0A0S3U6D8), or Phascolarctobacterium sp. (Uniprot accession number R611V6).
[0065] In a preferred embodiment, the PCA decarboxylase embloyed in the method of the present invention is an enzyme derived from Klebsiella pneumonia (SEQ ID NO:78), Leptolyngbya sp. (SEQ ID NO:80), or Phascolarctobacterium sp. (SEQ ID NO:81).
[0066] In a preferred embodiment of the present invention the PCA decarboxylase is an enzyme comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 78, 80 and 81 or a sequence which is at least n % identical to any of SEQ ID NOs: 78, 80 and 81 with n being an integer between 10 and 100, preferably 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99 and wherein the enzyme has the enzymatic activity of converting 3-methylcrotonic acid into isobutene. As regards the determination of the sequence identity, the same applies as has been set forth above.
[0067] In a preferred embodiment of the present invention the ferulic acid decarboxylase (FDC) is an enzyme comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 48 to 52 or a sequence which is at least n % identical to any of SEQ ID NOs: 48 to 52 with n being an integer between 10 and 100, preferably 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99 and wherein the enzyme has the enzymatic activity of converting 3-methylcrotonic acid into isobutene. As regards the determination of the sequence identity, the same applies as has been set forth above.
[0068] In another preferred embodiment, said FMN-dependent decarboxylase catalyzing the decarboxylation of 3-methylcrotonic acid into isobutene is an enzyme which is closely related to the above ferulic acid decarboxylase (FDC), namely a 3-polyprenyl-4-hydroxybenzoate decarboxylase (also termed UbiD). 3-polyprenyl-4-hydroxybenzoate decarboxylase belongs to the UbiD decarboxylase family classified as EC:4.1.1.-.
[0069] In a more preferred embodiment, the conversion of 3-methylcrotonic acid into isobutene makes use of a 3-polyprenyl-4-hydroxybenzoate decarboxylase (UbiD) which is derived from Hypocrea atroviridis (UniProt Accession number G9NLP8), Sphaerulina musiva (UniProt Accession number M3DF95), Penecillinum requeforti (UniProt Accession number W6QKP7), Fusarium oxysporum f. sp. lycopersici (UniProt Accession number W9LTH3), Saccharomyces kudriavzevii (UniProt Accession number J8TRN5), Saccaromyces cerevisiae, Aspergillus parasiticus, Candida albicans, Grosmannia clavigera, Escherichia coli (Uniprot accession number POAAB4), Bacillus megaterium (Uniprot accession number D5DTL4), Methanothermobacter sp. CaT2 (Uniprot accession number T2GKK5), Mycobacterium chelonae 1518 (Uniprot accession number X8EX86) or Enterobacter cloacae (Uniprot accessin number V3DX94).
[0070] In an even more preferred embodiment, the 3-polyprenyl-4-hydroxybenzoate decarboxylase (UbiD) employed in the method of the present invention is a 3-polyprenyl-4-hydroxybenzoate decarboxylase (UbiD) derived from Escherichia coli (Uniprot accession number POAAB4; SEQ ID NO:53), Bacillus megaterium (Uniprot accession number D5DTL4; SEQ ID NO:54), Methanothermobacter sp. CaT2 (Uniprot accession number T2GKK5; SEQ ID NO:55) Mycobacterium chelonae 1518 (Uniprot accession number X8EX86; SEQ ID NO:56), Hypocrea atroviridis (SEQ ID NO:57), Sphaerulina musiva (SEQ ID NO:58), Penecillinum requeforti (SEQ ID NO:59), Fusarium oxysporum f. sp. lycopersici (SEQ ID NO:60), Saccharomyces kudriavzevii (SEQ ID NO:61), Saccaromyces cerevisiae (SEQ ID NO:62), Aspergillus parasiticus (SEQ ID NO:63), Candida albicans (SEQ ID NO:64), Grosmannia clavigera (SEQ ID NO:65) or Enterobacter cloacae (SEQ ID NO:79) having the amino acid sequence as shown in SEQ ID NO:53, SEQ ID NO:54, SEQ ID NO:55, SEQ ID NO:56, SEQ ID NO:57, SEQ ID NO:58, SEQ ID NO:59, SEQ ID NO:60, SEQ ID NO:61, SEQ ID NO:62, SEQ ID NO:63, SEQ ID NO:64, SEQ ID NO:65, and SEQ ID NO:79, respectively.
[0071] In a preferred embodiment of the present invention the 3-polyprenyl-4-hydroxybenzoate decarboxylase (UbiD) is an enzyme comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 53 to 65 or a sequence which is at least n % identical to any of SEQ ID NOs: 53 to 65 and SEQ ID NO:79 with n being an integer between 10 and 100, preferably 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99 and wherein the enzyme has the enzymatic activity of converting 3-methylcrotonic acid into isobutene. As regards the determination of the sequence identity, the same applies as has been set forth above.
[0072] As mentioned above, in another aspect, the 3-methylcrotonic acid decarboxylase may preferably be an aconitate decarboxylase (EC 4.1.1.6). This decarboxylase does not require the association with an FMN prenyl transferase as it has been described for the above decarboxylases and, accordingly, does not require the provision of a prenylated cofactor.
[0073] Thus, in one preferred embodiment, the conversion of 3-methylcrotonic acid into isobutene is catalyzed by an aconitate decarboxylase (EC 4.1.1.6). Aconitate decarboxylases (EC 4.1.1.6) have been described to catalyze the following reaction: cis-aconitateitaconate+CO.sub.2
[0074] This enzyme occurs in a variety of organisms, and has, e.g., been described in Aspergillus itaconicus, Aspergillus terreus, Homo sapiens and Mus musculus. In a preferred embodiment, the aconitate decarboxylase (EC 4.1.1.6) employed in the method of the present invention in the conversion of 3-methylcrotonic acid into isobutene is the aconitase decarboxylase derived from Aspergillus terreus (UniProt accession number B31UN8), Homo sapiens (UniProt accession number A6NK06) or Mus musculus (UniProt accession number P54987).
[0075] In a preferred embodiment, the aconitate decarboxylase (EC 4.1.1.6) employed in the method of the present invention in the conversion of 3-methylcrotonic acid into isobutene is a aconitate decarboxylase derived from Aspergillus terreus (SEQ ID NO:66).
[0076] In a preferred embodiment of the present invention the aconitate decarboxylase is an enzyme comprising the amino acid sequence of SEQ ID NO: 66 or a sequence which is at least n % identical to SEQ ID NO: 66 with n being an integer between 10 and 100, preferably 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99 and wherein the enzyme has the enzymatic activity of converting 3-methylcrotonic acid into isobutene. As regards the determination of the sequence identity, the same applies as has been set forth above.
[0077] As mentioned above, in another aspect, the 3-methylcrotonic acid decarboxylase may preferably be a methylcrotonyl-CoA carboxylase (EC 6.4.1.4). This decarboxylase does not require the association with an FMN prenyl transferase as it has been described for the above decarboxylases and, accordingly, does not require the provision of a prenylated cofactor.
[0078] Thus, in one preferred embodiment, the conversion of 3-methylcrotonic acid into isobutene is catalyzed by a methylcrotonyl-CoA carboxylase (EC 6.4.1.4). Methylcrotonyl-CoA carboxylases have been described to catalyze the following reaction:
[0079] ATP+3-methylcrotonyl-CoA+HCO.sub.3.sup.-+H.sup.+ADP+phosphate+3-met- hylglutaconyl-CoA, i.e. the carboxylation, but they can also be used to catalyze the reaction of decarboxylation. Methylcrotonyl-CoA carboxylases occur in a variety of organisms, including eukaryotic and prokaryotic organisms, such as plants, animals, fungi and bacteria. The enzyme has, e.g., been described in Daucus carota, Glycine max, Hordeum vulgare, Pisum sativum, Solanum lycopersicum, Solanum tuberosum, Zea mays, Arabidopsis sp., Lens culinaris, Homo sapiens, Bos taurus, Rattus norvegicus, Mus musculus, Pagrus major, Emericella nidulans, Pseudomonas aeruginosa, Pseudomonas citronellolis, Pseudomonas amygdali, Acidaminococcus fermentans, Escherichia coli, Mycobacterium sp. and Achromobacter sp.
[0080] In a preferred embodiment, the methylcrotonyl-CoA carboxylase (EC 6.4.1.4) employed in the method of the present invention in the conversion of 3-methylcrotonic acid into isobutene is a methylcrotonyl-CoA carboxylase derived from Pseudomonas amygdali (SEQ ID NO:67).
[0081] In a preferred embodiment of the present invention the methylcrotonyl-CoA carboxylase is an enzyme comprising the amino acid sequence of SEQ ID NO: 67 or a sequence which is at least n % identical to SEQ ID NO: 67 with n being an integer between 10 and 100, preferably 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99 and wherein the enzyme has the enzymatic activity of converting 3-methylcrotonic acid into isobutene. As regards the determination of the sequence identity, the same applies as has been set forth above.
[0082] In another preferred embodiment, the methylcrotonyl-CoA carboxylase (EC 6.4.1.4) employed in the method of the present invention in the conversion of 3-methylcrotonic acid into isobutene is a methylcrotonyl-CoA carboxylase derived from Myxcoxoccus xanthus. In Myxococcus xanthus, the the liuB gene codes for an enzyme having the two subunits AibA and AibB (Li et al., Angew. Chem. Int. Ed. 52 (2013), 1304-1308). The methylcrotonyl-CoA carboxylase derived from Myxcoxoccus xanthus is a hetero-dimeric enzyme which are annotated as glutaconyl-CoA transferase subunits A and B (SEQ ID NOs: 100 and 101).
[0083] In a preferred embodiment of the present invention the methylcrotonyl-CoA carboxylase is an enzyme comprising the amino acid sequence of SEQ ID NO: 100 or 101 a sequence which is at least n % identical to SEQ ID NO: 100 or 101 with n being an integer between 10 and 100, preferably 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99 and wherein the enzyme has the enzymatic activity of converting 3-methylcrotonic acid into isobutene. As regards the determination of the sequence identity, the same applies as has been set forth above.
[0084] As mentioned above, in another aspect, the 3-methylcrotonic acid decarboxylase may preferably be a geranoyl-CoA carboxylase (EC 6.4.1.5). This decarboxylase does not require the association with an FMN prenyl transferase as it has been described for the above decarboxylases and, accordingly, does not require the provision of a prenylated cofactor.
[0085] Thus, in another preferred embodiment, the conversion of 3-methylcrotonic acid via decarboxylasion into isobutene is catalyzed by a geranoyl-CoA carboxylase (EC 6.4.1.5). Geranoyl-CoA carboxylases naturally catalyze the following reaction: ATP+geranoyl-CoA+HCO.sub.3.sup.-+H.sup.+ADP+phosphate+3-(4-methylpent-3-e- n-1-yl) pent-2-enedioyl-CoA
[0086] The enzyme occurs in eukaryotes and prokaryotes, such as plants and bacteria. The enzyme has, e.g., been described in Daucus carota, Glycine max, Zea mays, Pseudomonas sp., Pseudomonas aeruginosa, Pseudomonas citronellolis and Pseudomonas mendocina.
[0087] In another aspect, the 3-methylcrotonic acid decarboxylase may preferably be a 6-methylsalicylate decarboxylase (EC 4.1.1.52).
[0088] Thus, in another preferred embodiment, the conversion of 3-methylcrotonic acid via decarboxylasion into isobutene is catalyzed by a 6-methylsalicylate decarboxylase (EC 4.1.1.52). 6-methylsalicylate decarboxylases (EC 4.1.1.52) naturally catalyze the following reaction:
[0089] 6-methylsalicylate3-methylphenol+CO.sub.2
[0090] The enzyme occurs in a variety of organisms, in particular in eucaryotes and prokaryotes, such as bacteria and fungi. The enzyme has, e.g., been described in Aspergillus clavatus (UniProt Accession number T1PRE6), Penicillium griseofulvum and Valsa friesii.
[0091] In a preferred embodiment, the 6-methylsalicylate decarboxylase (EC 4.1.1.52) employed in the method of the present invention in the conversion 3-methylcrotonic acid via decarboxylasion into isobutene is a 6-methylsalicylate decarboxylase derived from Aspergillus clavatus (SEQ ID NO:68).
[0092] In a preferred embodiment of the present invention the 6-methylsalicylate decarboxylase is an enzyme comprising the amino acid sequence of SEQ ID NO: 68 or a sequence which is at least n % identical to SEQ ID NO: 68 with n being an integer between 10 and 100, preferably 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99 and wherein the enzyme has the enzymatic activity of converting 3-methylcrotonic acid via decarboxylasion into isobutene. As regards the determination of the sequence identity, the same applies as has been set forth above.
[0093] In another aspect, the 3-methylcrotonic acid decarboxylase may preferably be a 2-oxo-3-hexenedioate decarboxylase (EC 4.1.1.77).
[0094] Thus, in another preferred embodiment, the conversion of 3-methylcrotonic acid via decarboxylasion into isobutene is catalyzed by a 2-oxo-3-hexenedioate decarboxylase (EC 4.1.1.77). 2-oxo-3-hexenedioate decarboxylases (EC 4.1.1.77) naturally catalyze the following reaction:
[0095] (3E)-2-oxohex-3-enedioate2-oxopent-4-enoate+CO.sub.2
[0096] The enzyme occurs in a variety of organisms, in particular in prokaryotes, such as bacteria. The enzyme has, e.g., been described in Bordetella sp., Cupriavidus nexator, Geobacillus stearothermophilus (UniProt Accession number BOVXM8), Pseudomonas putida and Ralstonia pickettii.
[0097] In a preferred embodiment, the 2-oxo-3-hexenedioate decarboxylase (EC 4.1.1.77) employed in the method of the present invention in the conversion 3-methylcrotonic acid via decarboxylasion into isobutene is a 2-oxo-3-hexenedioate decarboxylase derived from Geobacillus stearothermophilus (SEQ ID NO:69).
[0098] In a preferred embodiment of the present invention the 2-oxo-3-hexenedioate decarboxylase is an enzyme comprising the amino acid sequence of SEQ ID NO: 69 or a sequence which is at least n % identical to SEQ ID NO: 69 with n being an integer between 10 and 100, preferably 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99 and wherein the enzyme has the enzymatic activity of converting 3-methylcrotonic acid via decarboxylasion into isobutene. As regards the determination of the sequence identity, the same applies as has been set forth above.
[0099] In another possibility, the 3-methylcrotonic acid decarboxylase may preferably be a 5-oxopent-3-ene-1,2,5-tricarboxylate decarboxylase (EC 4.1.1.68).
[0100] Thus, in another preferred embodiment, the conversion of 3-methylcrotonic acid via decarboxylasion into isobutene is catalyzed by a 5-oxopent-3-ene-1,2,5-tricarboxylate decarboxylase (EC 4.1.1.68). 5-oxopent-3-ene-1,2,5-tricarboxylate decarboxylases (EC 4.1.1.68) naturally catalyze the following reaction:
[0101] 5-oxopent-3-ene-1,2,5-tricarboxylate2-oxohept-3-enedioate+CO.sub.2
[0102] The enzyme has been described to occur in prokaryotes such as bacteria. The enzyme has, e.g., been described in E. coli and Salmonella dublin.
[0103] In a preferred embodiment, the 5-oxopent-3-ene-1,2,5-tricarboxylate decarboxylase (EC 4.1.1.68) employed in the method of the present invention in the conversion 3-methylcrotonic acid via decarboxylasion into isobutene is a 5-oxopent-3-ene-1,2,5-tricarboxylate decarboxylase derived from Salmonella dublin (SEQ ID NO:70).
[0104] In a preferred embodiment of the present invention the 5-oxopent-3-ene-1,2,5-tricarboxylate decarboxylase is an enzyme comprising the amino acid sequence of SEQ ID NO: 70 or a sequence which is at least n % identical to SEQ ID NO: 70 with n being an integer between 10 and 100, preferably 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99 and wherein the enzyme has the enzymatic activity of converting 3-methylcrotonic acid via decarboxylasion into isobutene. As regards the determination of the sequence identity, the same applies as has been set forth above.
[0105] The Enzymatic Conversion of 3-Hydroxyisovalerate (HIV) into 3-Methylcrotonic Acid: Step II as Shown in FIG. 1
[0106] The 3-methylcrotonic acid which is converted according to the method of the present invention into isobutene may itself be provided by an enzymatic reaction.
[0107] According to the present invention, the 3-methylcrotonic acid can be provided via different routes which are schematically shown in FIG. 1.
[0108] Thus, according to one option, the 3-methylcrotonic acid may itself be provided by the enzymatic conversion of 3-hydroxyisovalerate (HIV) into 3-methylcrotonic acid. The enzymatic conversion of 3-hydroxyisovalerate (HIV) into 3-methylcrotonic acid (step II as shown in FIG. 1) is schematically illustrated in FIG. 3.
[0109] According to the present invention, the enzymatic conversion of 3-hydroxyisovalerate (HIV) into said 3-methylcrotonic acid preferably makes use of an enzyme catalyzing the dehydration of a .beta.-hydroxy acid (i.e., e.g., 3-hydroxyisovalerate (HIV)) into an .alpha.,.beta.-unsaturated acid (i.e., e.g., 3-methylcrotonic acid). The term "dehydration" generally refers to a reaction involving the removal of H.sub.2O. Enzymes catalyzing 3-hydroxyisovalerate (HIV) dehydration are enzymes which catalyze the reaction as shown in FIG. 3. Preferably, such an enzyme belongs to the family of hydro-lyases (EC 4.2.-.-).
[0110] Preferred examples of such enzymes which are classified as EC 4.2.-.- (i.e., hydro-lyases) are:
[0111] aconitase (EC 4.2.1.3);
[0112] fumarase (EC 4.2.1.2); and
[0113] enoyl-CoA hydratase/dehydratease (EC 4.2.1.17).
[0114] Thus, in one preferred embodiment, the enzymatic conversion of 3-hydroxyisovalerate (HIV) into 3-methylcrotonic acid is achieved by the use of an aconitase (EC 4.2.1.3). Aconitases (EC 4.2.1.3) (also termed aconitase hydratases) are enzymes which catalyze the following reaction:
[0115] Citratecis-aconitate+H.sub.2O
[0116] The enzyme is known from a variety of organisms, including eukaryotic and prokaryotic organisms, such as plants, animals, fungi and bacteria. The enzyme has, e.g., been described in Acer pseudoplatanus, Advenella kashmirensis, Arabidopsis thaliana, Aspergillus niger, Bacillus cereus, Bacillus subtilis, Bacterioides fragilis, Bos taurus, Caenorhabditis elegans, Citrus elementina, Canis lupus familiaris, Corynebacterium glutamicum, Drosophila melanogaster, E. coli, Glycine max, Helobacter pylori, Homo sapiens, Mus musculus, Mycobacterium tuberculosis, Nicotiana benthamiana, Plasmodium falciparum, Pseudomonas aeruginosa, Rattus norvegicus, Rattus rattus, Saccharomyces cerevisiae, Saccharomycopsis lipolytica, Salmonella enterica, Sinapis alba, Sinorhizobium meliloti, Solanum tuberosum, Streptomyces aureus, Streptomyces viridochromogenes, Sulfolobus acidocaldarius, Sulfolobus solfataricus, Sus scorfa, Trametes sanguinea, Trypanosoma brucei, Xanthomonas campestris, Xanthomonas euvesicatoria, Yarrowia lipolytica and Zea mays.
[0117] In a preferred embodiment, the aconitase (EC 4.2.1.3) is from Advenella kashmirensis (TrEMBL accession number B3TZE0), Bacterioides fragilis (SwissProt accession number Q8RP87), Caenorhabditis elegans (SwissProt accession number Q23500), Citrus elementina (UniProt accession number D3GQLO, D3GQL1, or D3GQL2), Drosophila melanogaster (SwissProt accession number Q9NFX3 or Q9NFX2), E. coli (SwissProt accession number P36683 or UniProt accession number P25516), Homo sapiens (UniProt accession number P21399 or Q99798), Mus musculus (UniProt accession number P28271), Rattus norvegicus (UniProt accession number Q9ER34 or Q63270), Sus scorfa (UniProt accession number P16276) or Trypanosoma brucei (SwissProt accession number Q9NJQ8 or Q9NJQ9).
[0118] In a preferred embodiment, the aconitase (EC 4.2.1.3) employed in the method of the present invention in the conversion of 3-hydroxyisovalerate (HIV) into 3-methylcrotonic acid is an aconitase derived from E. coli (SEQ ID NO:71).
[0119] In a preferred embodiment of the present invention the aconitase is an enzyme comprising the amino acid sequence of SEQ ID NO: 71 or a sequence which is at least n % identical to SEQ ID NO: 71 with n being an integer between 10 and 100, preferably 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99 and wherein the enzyme has the enzymatic activity of converting 3-hydroxyisovalerate (HIV) into 3-methylcrotonic acid. As regards the determination of the sequence identity, the same applies as has been set forth above.
[0120] In another preferred embodiment, the enzymatic conversion of 3-hydroxyisovalerate (HIV) into 3-methylcrotonic acid is achieved by the use of a fumarase (EC 4.2.1.2). Fumarases (EC 4.2.1.2) (also termed fumarase hydratases) are enzymes which catalyze the following reaction:
[0121] (S)-malatefumarate+H.sub.2O
[0122] The enzyme is known from a variety of organisms, including eukaryotic and prokaryotic organisms, such as plants, animals, fungi and bacteria. The enzyme has, e.g., been described in Arabidopsis thaliana, Ascaris suum, Azotobacter vinelandii, Brevibacterium flavum, Campylobacter coli, Campylobacter fetus, Campylobacter jejuni, Corynebacterium ammoniagenes, Corynebacterium glutamicum, Erwinia sp., E. coli, Euglena gracilis, Geobacillus stearothermophilus, Gluconacetobacter diazotrophicus, Heliobacter pylori, Homo sapiens, Leishmania major, Mesembryanthemum crystallinum, Mycobacterium tuberculosis, Pelotomaculum thermopropionicum, Pisum sativum, Pseudomonas aeruginosa, Pseudomonas fluorescens, Pycobaculum neutrophilum, Rattus novegicus, Rhizopus oryzae, Rickettsia prowazekii, Saccharomyces bayanus, Sacchoromyces cerevisiae, Solanum lycopersicum, Solanum tuberosum, Streptomyces coelicolor, Streptomyces lividans, Streptomyces thermovulgaris, Sulfolobus solfataricus, Sus scrofa, Thermus sp., Thermus thermophilus and Zea mays.
[0123] In a preferred embodiment, the fumarase (EC 4.2.1.2) is from Arabidopsis thaliana (UniProt accession number P93033 or Q9FI53), Ascaris suum (SwissProt accession number Q8NRN8), Corynebacterium glutamicum (UniProt accession number P28271), E. coli (P05042), Homo sapiens (SwissProt accession number P07954), Mycobacterium tuberculosis (P9WN93), Pycobaculum neutrophilum (UniProt accession number B1Y931 or B1Y932), Rhizopus oryzae (UniProt accession number P55250), Rickettsia prowazekii (UniProt accession number Q9ZCQ4), Sacchoromyces cerevisiae (SwissProt accession number P08417), Streptomyces thermovulgaris (SwissProt accession number A5Y6J1) or Sulfolobus solfataricus (UniProt accession number P39461).
[0124] In a preferred embodiment, the fumarase (EC 4.2.1.2) employed in the method of the present invention in the conversion of 3-hydroxyisovalerate (HIV) into 3-methylcrotonic acid is a fumarase derived from E. coli (SEQ ID NO:72).
[0125] In a preferred embodiment of the present invention the fumarase is an enzyme comprising the amino acid sequence of SEQ ID NO: 72 or a sequence which is at least n % identical to SEQ ID NO: 72 with n being an integer between 10 and 100, preferably 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99 and wherein the enzyme has the enzymatic activity of converting 3-hydroxyisovalerate (HIV) into 3-methylcrotonic acid. As regards the determination of the sequence identity, the same applies as has been set forth above.
[0126] In another preferred embodiment, the enzymatic conversion of 3-hydroxyisovalerate (HIV) into 3-methylcrotonic acid is achieved by the use of an enoyl-CoA hydratase/dehydratase (EC 4.2.1.17). Enoyl-CoA hydratases/dehydratases (EC 4.2.1.17) catalyze the following reaction:
[0127] (3S)-3-hydroxyacyl-CoAtrans-2(or 3)-enoyl-CoA+H.sub.2O
[0128] Enoyl-CoA hydratase is an enzyme that normally hydrates the double bond between the second and third carbon atoms on acyl-CoA. However, it can also be employed to catalyze the reaction in the reverse direction.
[0129] Enoyl-CoA hydratases/dehydratases (EC 4.2.1.17) are also termed 3-hydroxyacyl-CoA dehydratases and enoyl-CoA hydratases. Both enzymes catalyze the same reaction while the name of one of these enzymes denotes one direction of the corresponding reaction while the other name denotes the reverse reaction. As the reaction is reversible, both enzyme names can be used.
[0130] This enzyme, also known as crotonase, is naturally involved in metabolizing fatty acids to produce both acetyl-CoA and energy. Enzymes belonging to this class have been described to occur, e.g. in rat (Rattus norvegicus), humans (Homo sapiens), mouse (Mus musculus), wild boar (Sus scrofa), Bos taurus, E. coli, Clostridium acetobutylicum and Clostridium aminobutyricum. Nucleotide and/or amino acid sequences for such enzymes have been determined, e.g. for rat, humans and Bacillus subtilis and Bacillus anthracis. In principle, any enoyl-CoA hydratase (EC 4.2.1.17) which can catalyze the conversion of 3-hydroxyisovalerate (HIV) into 3-methylcrotonic acid can be used in the context of the present invention. In a preferred embodiment the enoyl-CoA hydratase is an enoyl-CoA hydratase of Galactomyces reessii (Dhar et al., J. Ind. Microbiol. Biotechnol. 28 (2002), 81-87), an enoyl-CoA hydratase of Bacillus subtilis (Uniprot G4PBC3; SEQ ID NO: 38) or an enoyl-CoA hydratase of Bacillus anthracis (Uniprot Q81YG6; SEQ ID NO: 39).
[0131] In a preferred embodiment, the enoyl-CoA hydratase employed in the method of the invention has an amino acid sequence as shown in any one of SEQ ID NOs: 38 or 39 or shows an amino acid sequence which is at least x% homologous to any one of SEQ ID NOs: 38 or 39 and has the activity of an enoyl-CoA hydratase with x being an integer between 30 and 100, preferably 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99 wherein such an enzyme is capable of converting 3-hydroxyisovalerate (HIV) into 3-methylcrotonic acid as set forth herein above. As regards the determination of the degree of identity, the same applies as has been set forth herein above.
The Enzymatic Condensation of Acetone and Acetyl-CoA into 3-Hydroxyisovalerate (HIV): Step III as Shown in FIG. 1
[0132] The 3-hydroxyisovalerate (HIV) which is converted according to the method of the present invention into 3-methylcrotonic acid may itself be provided by an enzymatic reaction, namely the enzymatic condensation of acetone and acetyl-CoA into said 3-hydroxyisovalerate (HIV). The condensation of acetone and acetyl-CoA into said 3-hydroxyisovalerate (HIV) (step III as shown in FIG. 1) is schematically illustrated in FIG. 4.
[0133] Thus, the present invention also relates to a method for producing isobutene from acetone in which acetone is first condensed with acetyl-CoA into 3-hydroxyisovalerate (HIV) which is then converted into 3-methylcrotonic acid. Further, 3-methylcrotonic acid is then converted into isobutene as described herein above.
[0134] According to the present invention, the condensation of acetone and acetyl-CoA into 3-hydroxyisovalerate (HIV) preferably makes use of an enzyme which is capable of catalyzing the formation of a covalent bond between the carbon atom of the oxo (i.e., the C.dbd.O) group of acetone and acetyl-CoA, in particular the methyl group of acetyl-CoA. According to this reaction scheme, the oxo group of acetone reacts as an electrophile and the methyl group of acetyl-CoA reacts as a nucleophile. The general reaction of the conversion of acetone and acetyl-CoA is shown in FIG. 4. Enyzmes which are capable of enzymatically condensing acetone and acetyl-CoA into 3-hydroxyisovalerate (HIV) are known in the art and have, e.g., been described in WO 2011/032934.
[0135] Preferably, the enzyme employed in the enzymatic condensation of acetone and acetyl-CoA into 3-hydroxyisovalerate (HIV) is an enzyme with the activity of a HMG CoA synthase (EC 2.3.3.10) and/or a PksG protein and/or an enzyme with the activity of a C-C bond cleavage/condensation lyase, such as a HMG CoA lyase (EC 4.1.3.4). HMG CoA synthase has been described for various organisms.
[0136] Examples of HMG CoA synthases from different organisms are given in SEQ ID NO: 1 to 16. SEQ ID NO: 1 shows the sequence of the cytoplasmic HMG CoA synthase of Caenorhabditis elegans (P54871, gene bank F25B4.6), SEQ ID NO: 2 shows the sequence of the cytoplasmic HMG CoA synthase of Schizosaccharomyces pombe (fission yeast; P54874), SEQ ID NO: 3 shows the sequence of the cytoplasmic HMG CoA synthase of Saccharomyces cerevisiae (baker's yeast; P54839, gene bank CAA65437.1), SEQ ID NO: 4 shows the sequence of the cytoplasmic HMG CoA synthase of Arabidopsis thaliana (Mouse-ear cress; P54873), SEQ ID NO: 5 shows the sequence of the cytoplasmic HMG CoA synthase of Dictyostelium discoideum (Slime mold; P54872, gene bank L2114), SEQ ID NO: 6 shows the sequence of the cytoplasmic HMG CoA synthase of Blattella germanica (German cockroach; P54961, gene bank X73679), SEQ ID NO: 7 shows the sequence of the cytoplasmic HMG CoA synthase of Gallus gallus (Chicken; P23228, gene bank CHKHMGCOAS), SEQ ID NO: 8 shows the sequence of the cytoplasmic HMG CoA synthase of Homo sapiens (Human; Q01581, gene bank X66435), SEQ ID NO: 9 shows the sequence of the mitochondrial HMG CoA synthase of Homo sapiens (Human; P54868, gene bank X83618), SEQ ID NO: 10 shows the sequence of the mitochondrial HMG CoA synthase of Dictyostelium discoideum (Slime mold; Q86HL5, gene bank XM_638984), SEQ ID NO: 11 shows the sequence of the HMG CoA synthase of Staphylococcus epidermidis (Q9FD76), SEQ ID NO: 12 shows the sequence of the HMG CoA synthase of Lactobacillus fermentum (B2GBL1), SEQ ID NO: 13 shows the sequence of the HMG CoA synthase of Hyperthermus butylicus (A2BMY8), SEQ ID NO: 14 shows the sequence of the HMG CoA synthase of Chloroflexus aggregans (B8G795), SEQ ID NO: 15 shows the sequence of the HMG CoA synthase of Lactobacillus delbrueckii (Q1GAH5) and SEQ ID NO: 16 shows the sequence of the HMG CoA synthase of Staphylococcus haemolyticus Q4L958 (198>V difference compared to wild type protein).
[0137] In a preferred embodiment of the present invention the HMG CoA synthase is an enzyme comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 1 to 16 or a sequence which is at least n % identical to any of SEQ ID NOs: 1 to 16 and having the activity of a HMG CoA synthase with n being an integer between 10 and 100, preferably 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99.
[0138] As regards the determination of sequence identity, the same applies as has been set forth above.
[0139] Another example for a protein which can be used in the condensation of acetone and acetyl-CoA into 3-hydroxyisovalerate is a PksG protein. In the context of the present application the term "PksG protein" or "a protein/enzyme having the activity of a PksG protein" refers to any enzyme which is able to catalyze the reaction which is naturally catalyzed by the PksG protein, i.e., the transfer of --CH.sub.2COO.sup.- from acetyl-S-AcpK (Ac-S-AcpK) to a .beta.-ketothioester polyketide intermediate linked to one of the thiolation domains of the PksL protein. This is a reaction which is analogous to that catalyzed by HMG CoA synthase with the difference that the acetyl-thioester of the phosphopantetheyl moiety is attached to a carrier protein rather than to part of Coenzyme A. Although the PksG protein in the reaction which it naturally catalyzes transfers the acetyl group from acetyl-S-AcpK to an acceptor, it has been shown previously that the PksG protein can also effect the reaction which is normally catalyzed by HMG CoA synthase, i.e. the synthesis of HMG CoA starting from acetoacetyl CoA and acetyl CoA.
[0140] Examples of PksG proteins are given in SEQ ID NO: 17 and 18. Preferably, the PksG protein is an enzyme comprising an amino acid sequence which is at least n identical to SEQ ID NO: 17 or 18 and having the activity of a PksG protein with n being an integer between 10 and 100, preferably 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99.
[0141] SEQ ID NO: 17 shows the amino acid sequence of the PksG protein of Bacillus subtilis (P40830) and SEQ ID NO: 18 shows the amino acid sequence of the PksG protein of Mycobacterium marinum (B2HGT6).
[0142] As regards the determination of the degree of sequence identity the same applies as has been set forth above in connection with HMG CoA synthase.
[0143] Examples of "C--C bond cleavage/condensation lyases" in particular include enzymes which are classified as isopropylmalate synthase (EC 2.3.3.13), as homocitrate synthase (EC 2.3.3.14) or as 4-hydroxy-2-ketovalerate aldolase (EC 4.1.3.39). Isopropylmalate synthase catalyzes the following reaction: acetyl-CoA+3-methyl-2-oxobutanoate+H.sub.2O(2S)-2-isopropylmalate+CoA. Examples for such enzymes are the corresponding enzyme from Brucella abortus (strain 2308; Q2YRT1) and the corresponding enzyme from Hahella chejuensis (strain KCTC 2396; Q2SFA7).
[0144] A homocitrate synthase (EC 2.3.3.14) is an enzyme that catalyzes the chemical reaction acetyl-CoA+H.sub.2O+2-oxoglutarate (R)-2-hydroxybutane-1,2,4-tricarboxylate+CoA. The 4-hydroxy-2-ketovalerate aldolase catalyzes the chemical reaction 4-hydroxy-2-oxopentanoateacetaldehyde+pyruvate.
[0145] Examples for enzymes classified as "HMG CoA lyase" or "a protein/enzyme having the activity of a HMG CoA lyase" in the EC number EC 4.1.3.4, are given in SEQ ID NOs: 19 to 25. SEQ ID NO: 19 shows the sequence of the HMG CoA lyase of Zea mays (Accession number B6U7B9, gene bank ACG45252), SEQ ID NO: 20 shows the sequence of the HMG CoA lyase of Danio rerio (Brachydanio rerio; A8WG57, gene bank BC154587), SEQ ID NO: 21 shows the sequence of the HMG CoA lyase of Bos taurus (Uniprot accession number Q29448) and SEQ ID NO: 22 shows the sequence of the HMG CoA lyase of Homo sapiens (mitochondrial, Uniprot accession number P35914, gene bank HUMHYMEGLA), SEQ ID NO: 23 shows the sequence of the HMG CoA lyase of Pseudomonas putida (Q88H25), SEQ ID NO: 24 shows the sequence of the HMG CoA lyase of Acinetobacter baumannii (B7H4C6) and SEQ ID NO: 25 shows the sequence of the HMG CoA lyase of Thermus thermophilus (Q721H0).
[0146] In a preferred embodiment of the present invention the HMG CoA lyase is an enzyme comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 19 to 25 or a sequence which is at least n % identical to any of SEQ ID NOs: 19 to 25 and having the activity of a HMG CoA lyase with n being an integer between 10 and 100, preferably 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99.
[0147] As regards the determination of the degree of sequence identity the same applies as has been set forth above in connection with HMG CoA synthase.
[0148] The Enzymatic Conversion of Acetoacetate into Acetone: Step IV as Shown in FIG. 1
[0149] The acetone which is converted according to the method of the present invention into 3-hydroxyisovalerate (HIV) may itself be provided by an enzymatic reaction, namely the enzymatic conversion of acetoacetate into acetone. The conversion of acetoacetate into acetone (step IV as shown in FIG. 1) is schematically illustrated in FIG. 5. This reaction is a decarboxylation reaction and is a natural occurring reaction in organisms capable of producing acetone, i.e., organisms of the genus Clostridia.
[0150] Thus, the present invention also relates to a method for producing isobutene from acetoacetate in which acetoacetate is first converted into acetone which is then condensed with acetyl-CoA into 3-hydroxyisovalerate (HIV) which is then converted into 3-methylcrotonic acid as described herein above. Further, said 3-methylcrotonic acid is then converted into isobutene as described herein above.
[0151] According to the present invention, the conversion of acetoacetate into said acetone preferably makes use of an acetoacetate decarboxylase (EC 4.1.1.4). Nucleotide sequences from several organisms encoding this enzyme are known in the art, e.g. the adc gene from Clostridium acetobutylicum (Uniprot accession numbers P23670 and P23673), Clostridium beijerinckii (Clostridium MP; Q9RPK1), Clostridium pasteurianum (Uniprot accession number P81336), Bradyrhizobium sp. (strain BTAi1/ATCC BAA-1182; Uniprot accession number A5EBU7), Burkholderia mallei (ATCC 10399 A9LBSO), Burkholderia mallei (Uniprot accession number A3MAE3), Burkholderia mallei FMH A5XJB2, Burkholderia cenocepacia (Uniprot accession number A0B471), Burkholderia ambifaria (Uniprot accession number Q0b5P1), Burkholderia phytofirmans (Uniprot accession number B2T319), Burkholderia spec. (Uniprot accession number Q38ZU0), Clostridium botulinum (Uniprot accession number B2TLN8), Ralstonia pickettii (Uniprot accession number B2UIG7), Streptomyces nogalater (Uniprot accession number Q9EYI7), Streptomyces avermitilis (Uniprot accession number Q82NF4), Legionella pneumophila (Uniprot accession number Q5ZXQ9), Lactobacillus salivarius (Uniprot accession number Q1WVG5), Rhodococcus spec. (Uniprot accession number Q0S7W4), Lactobacillus plantarum (Uniprot accession number Q890G0), Rhizobium leguminosarum (Uniprot accession number Q1 M911), Lactobacillus casei (Uniprot accession number Q031366), Francisella tularensis (Uniprot accession number QOBLC9), Saccharopolyspora erythreae (Uniprot accession number A4FKR9), Korarchaeum cryptofilum (Uniprot accession number B1 L3N6), Bacillus amyloliquefaciens (Uniprot accession number A7Z8K8), Cochliobolus heterostrophus (Uniprot accession number Q8NJQ3), Sulfolobus islandicus (Uniprot accession number C3ML22) and Francisella tularensis subsp. holarctica (strain OSU18).
[0152] In a preferred embodiment, the acetoacetate decarboxylase employed in the method of the present invention in the conversion of acetoacetate into acetone is an acetoacetate decarboxylase (EC 4.1.1.4) derived from Clostridium acetobutylicum (Uniprot accession numbers P23670 and P23673).
[0153] The Enzymatic Conversion of Acetoacetyl-CoA into Acetoacetate: Step Va and Step Vb as Shown in FIG. 1
[0154] The acetoacetate which is converted according to the method of the present invention into acetone may itself be provided by an enzymatic reaction, namely the enzymatic conversion of acetoacetyl-CoA into acetoacetate. The conversion of acetoacetyl-CoA into acetoacetate can be achieved by two different routes. One possibility is the conversion of acetoacetyl-CoA into acetoacetate by hydrolysing the CoA thioester of acetoacetyl-CoA into acetoacetate. This reaction (step Va as shown in FIG. 1) is schematically illustrated in FIG. 6. In another, more preferred, aspect the CoA group of acetoacetyl-CoA is transferred on acetate, resulting in the formation of acetoacetate and acetyl-CoA. This reaction (step Vb as shown in FIG. 1) is schematically illustrated in FIG. 7.
[0155] Thus, the present invention also relates to a method for producing isobutene from acetoacetyl-CoA in which acetoacetyl-CoA is first converted into acetoacetate which is then converted into acetone which is then condensed with acetyl-CoA into 3-hydroxyisovalerate (HIV) which is then converted into 3-methylcrotonic acid as described herein above. Further, said 3-methylcrotonic acid is then converted into isobutene as described herein above.
[0156] As mentioned, in one aspect, the CoA thioester of acetoacetyl-CoA is hydrolyzed to result in acetoacetate. According to this aspect of the present invention, the enzymatic conversion of acetoacetyl-CoA into acetoacetate is achieved by preferably making use of an acetoacetyl-CoA hydrolase (EC 3.1.2.11) which naturally catalyzes this reaction.
[0157] Acetoacetyl-CoA hydrolases (EC 3.1.2.11) catalyse the following reaction:
[0158] acetoacetyl-CoA+H.sub.2OCoA+acetoacetate
[0159] This enzyme is known from various organisms and has, e.g., been described in eukaryotic organisms. The enzyme has, e.g., been described in Bos taurus, Columba livia, Gallus gallus, Homo sapiens, Mus musculus, Oncorhynchus mykiss, Oryctolagus cuniculus, or Rattus norvegicus. Thus, in a preferred embodiment, the enzyme is from the genus selected from the group consisting of Bos, Columba, Gallus, Mus, Oncorhynchus, Oryctolagus, and Rattus. In a more preferred embodiment, the enzyme is from the species selected from the group consisting of Bos taurus, Columba livia, Gallus gallus, Homo sapiens, Mus musculus, Oncorhynchus mykiss, Oryctolagus cuniculus, or Rattus norvegicus. Bos taurus, Columba livia, Gallus gallus, Homo sapiens, Mus musculus, Oncorhynchus mykiss, Oryctolagus cuniculus, and Rattus norvegicus.
[0160] As mentioned, in another, more preferred, possibility, the CoA group of acetoacetyl-CoA is transferred on acetate, resulting in the formation of acetoacetate and acetyl-CoA. According to this possibility of the present invention, the enzymatic conversion of acetoacetyl-CoA into acetoacetate is achieved by preferably making use of an enzyme which is capable of transferring the CoA group of acetoacetyl-CoA on acetate.
[0161] Preferably, such an enzyme capable of transferring the CoA group of acetoacetyl-CoA on acetate belongs to the family of CoA transferases (EC 2.8.3.-).
[0162] Thus, the present invention relates to a method for the enzymatic conversion of acetoacetyl-CoA into acetoacetate by making use of an enzyme capable of transferring the CoA group of acetoacetyl-CoA on acetate, preferably a CoA transferase (EC 2.8.3.-). A preferred example of an enzyme catalysing the conversion of acetoacetyl-CoA into acetoacetate which can be employed in the method of the present invention is an enzyme classified as an acetate CoA transferase (EC 2.8.3.8).
[0163] Acetate CoA transferases (EC 2.8.3.8) catalyse the following reaction:
[0164] acyl-CoA+acetatea fatty acid anion+acetyl-CoA
[0165] Acetate CoA transferases (EC 2.8.3.8) are known from various organisms, e.g., from E. coli in which it is encoded by the atoD gene atoA genes (UniProt accession numbers P76458 and P76459). An acetate CoA transferase is also known from Clostrtidium acetobutylicum in which it is encoded by the ctfAB gene. Thus, in a preferred embodiment, of the invention, an acetate CoA transferase (EC 2.8.3.8) is used for the conversion of acetoacetyl-CoA into acetoacetate which is derived from E. coli and which it is encoded by the atoD gene atoA genes (UniProt accession numbers P76458 and P76459) or which is derived from Clostrtidium acetobutylicum and which it is encoded by the ctfAB gene.
[0166] The Enzymatic Conversion of 3-Methylcrotonyl-CoA into 3-Methyicrotonic Acid: Step VI as Shown in FIG. 1
[0167] The 3-methylcrotonic acid can be provided by another possible route which is described in the following.
[0168] Thus, in another embodiment, the 3-methylcrotonic acid which is converted into isobutene may itself be provided by another enzymatic reaction, namely the enzymatic conversion of 3-methylcrotonyl-CoA into 3-methylcrotonic acid. The conversion of 3-methylcrotonyl-CoA into 3-methylcrotonic acid (step VI as shown in FIG. 1) is schematically illustrated in FIG. 8.
[0169] The conversion of 3-methylcrotonyl-CoA into 3-methylcrotonic acid can, e.g., be achieved in different ways, e.g., by three alternative enzymatic routes described in the following and as shown in FIG. 1 (step VIa, step VIb or step VIc as shown in FIG. 1).
[0170] Thus, the enzymatic conversion of 3-methylcrotonyl-CoA into 3-methylcrotonic acid may be achieved by
[0171] (a) a single enzymatic reaction in which 3-methylcrotonyl-CoA is directly converted into 3-methylcrotonic acid, preferably by making use of a CoA transferase (EC 2.8.3.-), preferably a propionate:acetate-CoA transferase (EC 2.8.3.1), an acetate CoA-transferase (EC 2.8.3.8) or a succinyl-CoA:acetate CoA-transferase (EC 2.8.3.18) (step VIa as shown in FIG. 1);
[0172] (b) a single enzymatic reaction in which 3-methylcrotonyl-CoA is directly converted into 3-methylcrotonic acid, preferably by making use of a thioester hydrolase (EC 3.1.2.-), preferably an acetyl-CoA hydrolase (EC 3.1.2.1), an ADP-dependent short-chain-acyl-CoA hydrolase (EC 3.1.2.18) or an acyl-CoA hydrolase (EC 3.1.2.20) (step VIb as shown in FIG. 1); or
[0173] (c) two enzymatic steps comprising
[0174] (i) first enzymatically converting 3-methylcrotonyl-CoA into 3-methylcrotonyl phosphate; and
[0175] (ii) then enzymatically converting the thus obtained 3-methylcrotonyl phosphate into said 3-methylcrotonic acid (step VIc as shown in FIG. 1).
[0176] Thus, one possibility is a two-step conversion from 3-methylcrotonyl-CoA via 3-methylcrotonyl phosphate into 3-methylcrotonic acid. Two other options involve a direct conversion of 3-methylcrotonyl-CoA into 3-methylcrotonic acid. These three options will be discussed in the following.
[0177] Accordingly, in one embodiment, the enzymatic conversion of 3-methylcrotonyl-CoA into 3-methylcrotonic acid is achieved by two enzymatic steps comprising (i) first enzymatically converting 3-methylcrotonyl-CoA into 3-methylcrotonyl phosphate; and (ii) then enzymatically converting the thus obtained 3-methylcrotonyl phosphate into said 3-methylcrotonic acid (as shown in step VIc of FIG. 1). The corresponding reaction is schematically shown in FIG. 11.
[0178] The conversion of 3-methylcrotonyl-CoA into 3-methylcrotonyl phosphate can, e.g., be achieved by the use of a phosphate butyryltransferase (EC 2.3.1.19) or a phosphate acetyltransferase (EC 2.3.1.8).
[0179] Phosphate butyryltransferase (EC 2.3.1.19) naturally catalyzes the following reaction Butyryl-CoA+H.sub.3PO.sub.4 butyryl phosphate+CoA
[0180] It has been described by Wiesenborn et al. (Appl. Environ. Microbiol. 55 (1989), 317-322) and by Ward et al. (J. Bacteriol. 181 (1999), 5433-5442) that phosphate butyryltransferases (EC 2.3.1.19) can use a number of substrates in addition to butyryl coenzyme A (butyryl-CoA), in particular acetyl-CoA, propionyl-CoA, isobutyryl-CoA, valeryl-CoA and isovaleryl-CoA.
[0181] The enzyme has been described to occur in a number of organisms, in particular in bacteria and in protozoae. In one embodiment the enzyme is from the protozoae Dasytricha ruminantium. In a preferred embodiment the phosphate butyryltransferase is a phosphate butyryltransferase from a bacterium, preferably from a bacterium of the genus Bacillus, Butyrivibrio, Enterococcus or Clostridium, more preferably Enterococcus or Clostridium, and even more preferably from Bacillus megaterium, Bacillus subtilis, Butyrivibrio fibrisolvens, Clostridium acetobutylicum, Clostridium beijerinckii, Clostridium butyricum, Clostridium kluyveri, Clostridium saccharoacetobutylicum, Clostridium sprorogenes or Enterococcus faecalis. Most preferably, the enzyme is from Clostridium acetobutylicum, in particular the enzyme encoded by the ptb gene (Uniprot Accession number F0K6W0; Wiesenborn et al. (Appl. Environ. Microbiol. 55 (1989), 317-322)) or from Enterococcus faecalis (Uniprot Accession number K4YRE8; Ward et al. (J. Bacteriol. 181 (1999), 5433-5442)).
[0182] In a preferred embodiment, the conversion of 3-methylcrotonyl-CoA into 3-methylcrotonyl phosphate is achieved by making use of a phosphate butyryltransferase from Clostridium acetobutylicum, preferably from Clostridium acetobutylicum strain ATCC 824. The amino acid sequence of said protein is shown in SEQ ID NO: 26.
[0183] It is, of course, not only possible to use an enzyme exactly showing this amino acid of SEQ ID NO:26. It is also possible to use an enzyme which comprises a sequence which is at least 60% identical to the amino acid sequence shown in SEQ ID NO: 26. Preferably, the sequence identity is at least 70%, more preferably at least 80%, 85% or 90%, even more preferably 91%, 92%, 93,%, 94%, 95%, 96%, 97%, 98% and particularly preferred at least 99% to SEQ ID NO:26 and the enzyme has the enzymatic activity of converting 3-methylcrotonyl-CoA into 3-methylcrotonyl phosphate. As regards the determination of the sequence identity, the same applies as has been set forth above.
[0184] In another preferred embodiment, the conversion of 3-methylcrotonyl-CoA into 3-methylcrotonyl phosphate is achieved by making use of a phosphate butyryltransferase from Bacillus subtilis, preferably from Bacillus subtilis having the UniProt Accession number P54530. The amino acid sequence of said protein is shown in SEQ ID NO: 73.
[0185] In a preferred embodiment of the present invention the phosphate butyryltransferase is an enzyme comprising the amino acid sequence of SEQ ID NO: 73 or a sequence which is at least n % identical to SEQ ID NO: 73 with n being an integer between 10 and 100, preferably 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99 and wherein the enzyme has the enzymatic activity of converting 3-methylcrotonyl-CoA into 3-methylcrotonyl phosphate. As regards the determination of the sequence identity, the same applies as has been set forth above.
[0186] In another preferred embodiment, the conversion of 3-methylcrotonyl-CoA into 3-methylcrotonyl phosphate is achieved by making use of a phosphate butyryltransferase from Enterococcus faecalis, preferably from Enterococcus faecalis having the UniProt Accession number S4BZL5. The amino acid sequence of said protein is shown in SEQ ID NO: 74.
[0187] In a preferred embodiment of the present invention the phosphate butyryltransferase is an enzyme comprising the amino acid sequence of SEQ ID NO: 74 or a sequence which is at least n % identical to SEQ ID NO: 74 with n being an integer between 10 and 100, preferably 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99 and wherein the enzyme has the enzymatic activity of converting 3-methylcrotonyl-CoA into 3-methylcrotonyl phosphate. As regards the determination of the sequence identity, the same applies as has been set forth above.
[0188] Phosphate acetyltransferase (EC 2.3.1.8) naturally catalyzes the following reaction
[0189] Acetyl-CoA+H.sub.3PO.sub.4acetyl phosphate+CoA
[0190] It has been described by Veit et al. (J. Biotechno1.140 (2009), 75-83) that phosphate acetyltransferase can also use as a substrate butyryl-CoA or propionyl-CoA.
[0191] The accession numbers for this enzyme family in InterPro database are IPR012147 and IPR002505, "http://www.ebi.ac.uk/interpro/entry/IPR002505"
[0192] (http://www.ebi.ac.uk/interpro/entry/IPR012147
[0193] http://www.ebi.ac.uk/interpro/entry/IPR002505)
[0194] See also http://pfam.sanger.ac.uk/family/PF01515
[0195] The enzyme has been described in a variety of organisms, in particular bacteria and fungi. Thus, in one preferred embodiment the enzyme is an enzyme from a bacterium, preferably of the genus Escherichia, Chlorogonium, Clostridium, Veillonella, Methanosarcina, Corynebacterium, Ruegeria, Salmonella, Azotobacter, Bradorhizobium, Lactobacillus, Moorella, Rhodopseudomonas, Sinorhizobium, Streptococcus, Thermotoga or Bacillus, more preferably of the species Escherichia coli, Chlorogonium elongatum, Clostridium kluyveri, Clostridium acetobutylicum, Clostridium acidurici, Veillonella parvula, Methanosarcina thermophila, Corynebacterium glutamicum, Ruegeria pomeroyi, Salmonella enterica, Azotobacter vinelandii, Bradyrhizobium japonicum, Lactobacillus fermentum, Lactobacillus sanfranciscensis, Moorella thermoacetica, Rhodopseudomonas palustris, Sinorhizobium meliloti, Streptococcus pyogenes, Thermotoga maritima or Bacillus subtilis. In another preferred embodiment the enzyme is an enzyme from a fungus, preferably from the genus Saccharomyces, more preferably of the species Saccharomyces cerevisiae.
[0196] In a preferred embodiment, the conversion of 3-methylcrotonyl-CoA into 3-methylcrotonyl phosphate is achieved by making use a phosphate acetyltransferase from Corynebacterium glutamicum, preferably from Corynebacterium glutamicum strain ATCC 13032. The amino acid sequence of said protein is shown in SEQ ID NO: 27.
[0197] It is, of course, not only possible to use an enzyme exactly showing this amino acid of SEQ ID NO:27. It is also possible to use an enzyme which comprises a sequence which is at least 60% identical to the amino acid sequence shown in SEQ ID NO: 27. Preferably, the sequence identity is at least 70%, more preferably at least 80%, 85% or 90%, even more preferably 91%, 92%, 93,%, 94%, 95%, 96%, 97%, 98% and particularly preferred at least 99% to SEQ ID NO:27 and the enzyme has the enzymatic activity of converting 3-methylcrotonyl-CoA into 3-methylcrotonyl phosphate. As regards the determination of the sequence identity, the same applies as has been set forth above.
[0198] The conversion of 3-methylcrotonyl phosphate into 3-methylcrotonic acid can, e.g., be achieved by making use of an enzyme which is classified as EC 2.7.2.-, i.e., a phosphotransferase. Such enzymes use a carboxy group as acceptor. Thus, the conversion of 3-methylcrotonyl phosphate into 3-methylcrotonic acid can, e.g., be achieved by making use of an enzyme with a carboxy group as acceptor (EC 2.7.2.-). In a preferred embodiment, the conversion of 3-methylcrotonyl phosphate into 3-methylcrotonic acid is achieved by the use of a propionate kinase (EC 2.7.2.15), an acetate kinase (EC 2.7.2.1), a butyrate kinase (EC 2.7.2.7) or a branched-chain-fatty-acid kinase (EC 2.7.2.14).
[0199] Butyrate kinases (EC 2.7.2.7) naturally catalyze the following reaction
[0200] Butyrate+ATPbutyryl phosphate+ADP
[0201] It has been described, e.g. by Hartmanis (J. Biol. Chem. 262 (1987), 617-621) that butyrate kinase can use a number of substrates in addition to butyrate, e.g. valerate, isobutyrate, isovalerate and vinyl acetate. The enzyme has been described in a variety of organisms, in particular bacteria. In one preferred embodiment the enzyme is from a bacterium, preferably from a bacterium of the genus Clostridium, Butyrivibrio, Thermotoga or Enterococcus. Preferred is Clostridium. More preferably the enzyme is from a bacterium of the species Clostridium acetobutylicum, Clostridium proteoclasticum, Clostridium tyrobutyricum, Clostridium butyricum, Clostridium pasteurianum, Clostridium tetanomorphum, Butyrivibrio firbrosolvens, Butyrivibrio hungatei, Thermotoga maritime or Enterococcus durans. Preferred is Clostridium acetobutylicum. For this organism two butyrate kinases have been described: butyrate kinase 1 (Uniprot Accession number: Q45829) and butyrate kinase II (Uniprot Accession number: 0971119).
[0202] In another preferred embodiment, the conversion of 3-methylcrotonyl phosphate into 3-methylcrotonic acid is achieved by making use of a butyrate kinase from Lactobacillus, preferably from Lactobacillus casei (UniProt Accession number K0N529) or a butyrate kinase from Geobacillus, preferably from Geobacillus sp. (UniProt Accession number L8A0E1). The amino acid sequence of these proteins are shown in SEQ ID NO:75 and SEQ ID NO:76, respectively.
[0203] In a preferred embodiment of the present invention the butyrate kinase is an enzyme comprising the amino acid sequence of SEQ ID NO: 75 or 76 or a sequence which is at least n % identical to SEQ ID NO: 75 or 76 with n being an integer between 10 and 100, preferably 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99 and wherein the enzyme has the enzymatic activity of converting 3-methylcrotonyl phosphate into 3-methylcrotonic acid. As regards the determination of the sequence identity, the same applies as has been set forth above.
[0204] Branched-chain-fatty-acid kinases (EC 2.7.2.14) naturally catalyze the following reaction
[0205] Alkyl carboxylic acid+ATPacyl phosphate+ADP
[0206] wherein "alkyl" may be 2-methylbutanoate, butanoate, isobutanoate, pentanoate or propionate. The latter reaction with propionate has been described for a branched-chain fatty acid kinase from a spirochaete (J. Bacteriol. 152 (1982), 246-54).
[0207] This enzyme has been described to occur in a number of bacteria. Thus, in one preferred embodiment the enzyme is an enzyme from a bacterium, preferably of the genus Spirochaeta or Thermotoga, more preferably Thermotoga maritime.
[0208] Propionate kinases (EC 2.7.2.15) naturally catalyze the following reactions
[0209] Propanoate+ATPpropanoyl phosphate+ADP
[0210] Acetate+ATPacetyl phosphate+ADP
[0211] This enzyme has been described to occur in a number of bacteria, in particular Enterobacteriacea. Thus, in one preferred embodiment the enzyme is an enzyme from a bacterium, preferably of the genus Salmonella or Escherichia, more preferably of the species Salmonella enterica, Salmonella typhimurium or Escherichia coli.
[0212] In a preferred embodiment, the conversion of 3-methylcrotonyl phosphate into 3-methylcrotonic acid is achieved by making use of a propionate kinase from Salmonella typhimurium, preferably from Salmonella typhimurium strain ATCC 700720. The amino acid sequence of said protein is shown in SEQ ID NO: 28.
[0213] It is, of course, not only possible to use an enzyme exactly showing this amino acid of SEQ ID NO:28. It is also possible to use an enzyme which comprises a sequence which is at least 60% identical to the amino acid sequence shown in SEQ ID NO: 28. Preferably, the sequence identity is at least 70%, more preferably at least 80%, 85% or 90%, even more preferably 91%, 92%, 93,%, 94%, 95%, 96%, 97%, 98% and particularly preferred at least 99% to SEQ ID NO:28 and the enzyme has the enzymatic activity of converting 3-methylcrotonyl phosphate into 3-methylcrotonic acid. As regards the determination of the sequence identity, the same applies as has been set forth above.
[0214] In another preferred embodiment, the conversion of 3-methylcrotonyl phosphate into 3-methylcrotonic acid is achieved by making use of a propionate kinase from Escherichia coli, preferably from Escherichia coli strain K12. The amino acid sequence of said protein is shown in SEQ ID NO: 29.
[0215] It is, of course, not only possible to use an enzyme exactly showing this amino acid of SEQ ID NO:29. It is also possible to use an enzyme which comprises a sequence which is at least 60% identical to the amino acid sequence shown in SEQ ID NO: 29. Preferably, the sequence identity is at least 70%, more preferably at least 80%, 85% or 90%, even more preferably 91%, 92%, 93,%, 94%, 95%, 96%, 97%, 98% and particularly preferred at least 99% to SEQ ID NO:29 and the enzyme has the enzymatic activity of converting 3-methylcrotonyl phosphate into 3-methylcrotonic acid. As regards the determination of the sequence identity, the same applies as has been set forth above.
[0216] Acetate kinases (EC 2.7.2.1) naturally catalyze the following reaction
[0217] Acetate+ATPacetyl phosphate+ADP
[0218] This enzyme has been described to occur in a number of organisms, in particular bacteria and eukaryotes. In one preferred embodiment the enzyme is from a bacterium, preferably from a bacterium of the genus Methanosarcina, Cryptococcus, Ethanoligenens, Propionibacterium, Roseovarius, Streptococcus, Salmonella, Acholeplasma, Acinetobacter, Ajellomyces, Bacillus, Borrelia, Chaetomium, Clostridium, Coccidioides, Coprinopsis, Cryptococcus, Cupriavidus, Desulfovibrio, Enterococcus, Escherichia, Ethanoligenes, Geobacillus, Helicobacter, Lactobacillus, Lactococcus, Listeria, Mesoplasma, Moorella, Mycoplasma, Oceanobacillus, Propionibacterium, Rhodospeudomonas, Roseovarius, Salmonella, Staphylococcus, Thermotoga or Veillonella, more preferably from a bacterium of the species Methanosarcina thermophila, Cryptococcus neoformans, Ethanoligenens harbinense, Propionibacterium acidipropionici, Streptococcus pneumoniae, Streptococcus enterica, Streptococcus pyogenes, Acholeplasma laidlawii, Acinetobacter calcoaceticus, Ajellomyces capsulatus, Bacillus subtilis, Borrelia burgdorferi, Chaetomium globosum, Clostridium acetobutylicum, Clostridium thermocellum, Coccidioides immitis, Coprinopsis cinerea, Cryptococcus neoformans, Cupriavidus necator, Desulfovibrio vulgaris, Enterococcus faecalis, Escherichia coli, Ethanoligenes harbinense, Geobacillus stearothermophilus, Helicobacter pylori, Lactobacillus delbrueckii, Lactobacillus acidophilus, Lactobacillus sanfranciscensis, Lactococcus lactis, Listeria monocytogenes, Mesoplasma florum, Methanosarcina acetivorans, Methanosarcina mazei, Moorella thermoacetica, Mycoplasma pneumoniae, Oceanobacillus iheyensis, Propionibacterium freudenreichii, Propionibacterium acidipropionici, Rhodospeudomonas palustris, Salmonella enteric, Staphylococcus aureus, Thermotoga maritime or Veillonella parvula.
[0219] In another preferred embodiment the enzyme is an enzyme from a fungus, preferably from a fungus of the genus Aspergillus, Gibberella, Hypocrea, Magnaporthe, Phaeosphaeria, Phanerochaete, Phytophthora, Sclerotinia, Uncinocarpus, Ustilago or Neurospora even more preferably from a fungus of the species Aspergillus fumigates, Aspergillus nidulans, Gibberella zeae, Hypocrea jecorina, Magnaporthe grisea, Phaeosphaeria nodorum, Phanerochaete chrysosporium, Phytophthora ramorum, Phytophthora sojae, Sclerotinia sclerotiorum, Uncinocarpus reesii, Ustilago maydis or Neurospora crassa.
[0220] In a further preferred embodiment the enzyme is an enzyme from a plant or an algae, preferably from the genus Chlamydomonas, even more preferably from the species Chlamydomonas reinhardtii.
[0221] In another embodiment the enzyme is from an organism of the genus Entamoeba, more preferably of the species Entamoeba histolytica.
[0222] The above mentioned enzyme families suitable for the conversion of 3-methylcrotonyl-CoA into 3-methylcrotonyl phosphate have been shown to be evolutionary related and contain common sequence signatures. Theses signatures are referenced and described in Prosite database:
[0223] http://prosite.expasy.org/cgi-bin/prosite/nicedoc.pl?PS01075
[0224] Gao et al. (FEMS Microbiol. Lett. 213 (2002), 59-65) already described genetically modified E. coli cells which have been transformed, inter alia, with the ptb gene and the buk gene from Clostridium acetobutylicum encoding a phosphate butyryltransferase (EC 2.3.1.19) and a butyrate kinase (EC 2.7.2.7), respectively. These E. coli cells have been shown to be able to produce D-(-)-3-hydroxybutyric acid (3HB).
[0225] As mentioned above, the conversion of 3-methylcrotonyl-CoA into 3-methylcrotonic acid can also be achieved by two alternative conversions wherein 3-methylcrotonyl-CoA is directly converted into 3-methylcrotonic acid.
[0226] Preferably, in one embodiment, 3-methylcrotonyl-CoA is directly converted into 3-methylcrotonic acid by hydrolyzing the thioester bond of 3-methylcrotonyl-CoA into 3-methylcrotonic acid by making use of an enzyme which belongs to the family of thioester hydrolases (in the following referred to as thioesterases (EC 3.1.2.-)). This reaction is schematically shown in FIG. 10.
[0227] Examples for preferred thioester hydrolases (EC 3.1.2.-) are an acetyl-CoA hydrolase (EC 3.1.2.1), an ADP-dependent short-chain-acyl-CoA hydrolase (EC 3.1.2.18) and an acyl-CoA hydrolase (EC 3.1.2.20) (step VIb as shown in FIG. 1).
[0228] In an alternative embodiment, 3-methylcrotonyl-CoA is directly converted into 3-methylcrotonic acid, preferably by making use of an enzyme which belongs to the family of CoA-transferases (EC 2.8.3.-). This reaction is schematically shown in FIG. 9.
[0229] Examples for preferred CoA transferases (EC 2.8.3.-) are a propionate:acetate-CoA transferase (EC 2.8.3.1), an acetate CoA-transferase (EC 2.8.3.8) and a succinyl-CoA:acetate CoA-transferase (EC 2.8.3.18) (step VIa as shown in FIG. 1).
[0230] Thioesterases (TEs; also referred to as thioester hydrolases) are enzymes which are classified as EC 3.1.2. Presently thioesterases are classified as EC 3.1.2.1 through EC 3.1.2.30 while TEs which are not yet classified/unclassified are grouped as enzymes belonging to EC 3.1.2.-. Cantu et al. (Protein Science 19 (2010), 1281-1295) describe that there are 23 families of thioesterases which are unrelated to each other as regards the primary structure. However, it is assumed that all members of the same family have essentially the same tertiary structure. Thioesterases hydrolyze the thioester bond between a carbonyl group and a sulfur atom.
[0231] In a preferred embodiment, a thioesterase employed in a method according to the present invention for converting 3-methylcrotonyl-CoA into 3-methylcrotonic acid is selected from the group consisting of:
[0232] acetyl-CoA hydrolase (EC 3.1.2.1);
[0233] palmitoyl-CoA hydrolase (EC 3.1.2.2);
[0234] 3-hydroxyisobutyryl-CoA hydrolase (EC 3.1.2.4);
[0235] oleoyl-[acyl-carrier-protein] hydrolase (EC 3.1.2.14);
[0236] ADP-dependent short-chain-acyl-CoA hydrolase (EC 3.1.2.18);
[0237] ADP-dependent medium-chain-acyl-CoA hydrolase (EC 3.1.2.19); and
[0238] acyl-CoA hydrolase (EC 3.1.2.20).
[0239] Thus, in one preferred embodiment the direct conversion of 3-methylcrotonyl-CoA into 3-methylcrotonic acid is achieved by making use of an acetyl-CoA hydrolase (EC 3.1.2.1). Acetyl-CoA hydrolases are enzymes which catalyze the following reaction:
[0240] Acetyl-CoA+H.sub.2O.fwdarw.acetate+CoA
[0241] This enzyme occurs in a variety of organism, including eukaryotic and prokaryotic organisms, such as plants, animals, fungi and bacteria. The enzyme has, e.g., been described in Rattus norvegicus (Uniprot Accession number: Q99NB7), Mus musculus, Sus scrofa, Bos taurus, Gallus gallus, Platyrrhini, Ovis aries, Mesocricetus auratus, Ascaris suum, Homo sapiens (Uniprot Accession number: Q8WYKO), Pisum sativum, Cucumis sativus, Panicus sp., Ricinus communis, Solanum tuberosum, Spinacia oleracea, Zea mays, Glycine max, Saccharomyces cerevisiae, Neurospora crassa, Candida albicans, Trypanosoma brucei brucei, Trypanosoma cruzi, Trypanosoma dionisii, Trypanosoma vespertilionis, Crithidia fasciculate, Clostridium aminovalericum, Acidaminococcus fermaentans, Bradyrhizobium japonicum and Methanosarcina barkeri.
[0242] In another preferred embodiment the direct conversion of 3-methylcrotonyl-CoA into 3-methylcrotonic acid is achieved by making use of a palmitoyl-CoA hydrolase (EC 3.1.2.2). Palmitoyl-CoA hydrolases are enzymes which catalyze the following reaction:
[0243] Palmitoyl-CoA+H.sub.2O.fwdarw.palmitate+CoA
[0244] This enzyme occurs in a variety of organism, including eukaryotic and prokaryotic organisms, such as plants, animals, fungi and bacteria. The enzyme has, e.g., been described in Arabidopsis thaliana (Uniprot Accession number: Q8GYW7), Pisum sativum, Spinacia oleracea, Bumilleriopsis filiformis, Eremosphaera viridis, Mougeotia scalaris, Euglena gracilis, Rhodotorula aurantiaca, Saccharaomyces cerevisiae, Candida rugosa, Caenorhabditis elegans, Mus musculus (Uniprot Accession number: P58137), Homo sapiens, Platyrrhini, Bos taurus, Canis lupus familiaris, Sus scrofa, Cavia procellus, Columba sp., Cricetulus griseus, Mesocricetus auratus, Drosophila melanogaster, Rattus norvegicus, Oryctolagus cuniculus, Gallus gallus, Anas platyrhynchos, Mycobacterium tuberculosis, Mycobacterium phlei, Mycobacterium smegmatis, Acinetobacter colcaceticus, Haemophilus influenza, Helicobacter pylori, Bacillus subtilis, Pseudomonas aeruginosa, Rhodobacter shpaeroides, Streptomyces coelicolor, Streptomyces venezuelae and E. coli.
[0245] In a further preferred embodiment the direct conversion of 3-methylcrotonyl-CoA into 3-methylcrotonic acid is achieved by making use of a 3-hydroxyisobutyryl-CoA hydrolase (EC 3.1.2.4). 3-hydroxyisobutyryl-CoA hydrolases are enzymes which catalyze the following reaction:
[0246] 3-hydroxyisobutyryl-CoA+H.sub.2O.fwdarw.3-hydroxyisobutyrate+CoA
[0247] This enzyme occurs in a variety of organism, including eukaryotic and prokaryotic organisms, such as plants, animals, fungi and bacteria. The enzyme has, e.g., been described in Arabidopsis thaliana, Homo sapiens, Canus lupus familiaris, Rattus norvegicus, Bacillus cereus, Pseudomonas fluorescens and Pseudomonas aeruginosa.
[0248] In yet another preferred embodiment the direct conversion of 3-methylcrotonyl-CoA into 3-methylcrotonic acid is achieved by making use of an oleoyl-[acyl-carrier-protein] hydrolase (EC 3.1.2.14). Oleoyl-[acyl-carrier-protein] hydrolases are enzymes which catalyze the following reaction:
[0249] oleoyl-[acyl-carrier-protein]+H.sub.2O.fwdarw.oleate+[acyl-carrier-- protein]
[0250] This enzyme occurs in a variety of plants and bacteria. The enzyme has, e.g., been described in Arabidopsis thaliana, Allium ampeloprasum, Curcurbita moschata, Cuphea calophylla, Cuphea hookeriana, Cuphea lanceolata, Cuphea wrightii, Umbellularia californica, Coriandrum sativum, Spinacia oleracea, Elaeis sp., Elaeis guineensis, Glycine max, Persea americana, Pisum sativum, Sinapis alba, Ulmus americana, Zea mays, Brassica juncea, Brassica napus, Brassica rapa subsp. campestris, Jatropha curcas, Ricinus communis, Cinnamomum camphorum, Macadamia tetraphylla, Magnifera indica, Madhuca longifolia, Populus tomentosa, Chimonanthus praecox, Gossypium hirsutum, Diploknema butyracea, Helianthus annuus and Streptococcus pyogenes.
[0251] In yet another preferred embodiment the direct conversion of 3-methylcrotonyl-CoA into 3-methylcrotonic acid is achieved by making use of an ADP-dependent short-chain-acyl-CoA hydrolase (EC 3.1.2.18). ADP-dependent short-chain-acyl-CoA hydrolases are enzymes which catalyze the following reaction:
[0252] an acyl-CoA+H.sub.2O a carboxylate+CoA
[0253] This enzyme occurs in a variety of animals and has, e.g., been described in Mus musculus, Rattus norvegicus and Mesocricetus auratus.
[0254] In yet another preferred embodiment the direct conversion of 3-methylcrotonyl-CoA into 3-methylcrotonic acid is achieved by making use of an ADP-dependent medium-chain-acyl-CoA hydrolase (EC 3.1.2.19). ADP-dependent medium-chain-acyl-CoA hydrolases are enzymes which catalyze the following reaction:
[0255] an acyl-CoA+H.sub.2O.fwdarw.a carboxylate+CoA
[0256] This enzyme occurs in a variety of animals and has, e.g., been described in Rattus norvegicus and Mesocricetus auratus.
[0257] In a further preferred embodiment the direct conversion of 3-methylcrotonyl-CoA into 3-methylcrotonic acid is achieved by making use of an acyl-CoA hydrolase (EC 3.1.2.20). Acyl-CoA hydrolases are enzymes which catalyze the following reaction:
[0258] an acyl-CoA+H.sub.2O.fwdarw.a carboxylate+CoA
[0259] This enzyme occurs in a variety of organism, including eukaryotic and prokaryotic organisms, such as plants, animals, fungi and bacteria. The enzyme has, e.g., been described in Arabidopsis thaliana, Rhodotorula aurantiaca, Bumilleriopsis filiformis, Eremosphaera viridis, Euglena gracilis, Mus musculus, Rattus norvegicus, Homo sapiens, Sus, scrofa, Bos taurus, Cais lupus familiaris, Cavia porcellus, Cricetus griseus, Drosophila melanogaster, Anas platyrhynchos, Gallus gallus, Caenorhabditis elegans, Saccharomyces cerevisia, Candida rugosa, Escherichia coli, Haemophilus influenzae, Xanthomonas campestris, Streptomyces sp., Streptomyces coelicolor, Alcaligenes faecalis, Pseudomonas aeruginosa, Pseudomonas putida, Amycolatopsis mediterranei, Acinetobacter calcoaceticus, Helicobacter pylori, Rhodobacter spaeroides and Mycobacterium phlei. In a preferred embodiment the acyl-CoA hydrolase is an enzyme from Escherichia coli, from Pseudomonas putida or from Haemophilus influenza, more preferably the YciA enzyme from E. coli or its closely related homolog H10827 from Haemophilus influenza (Zhuang et al., Biochemistry 47 (2008), 2789-2796). The YciA enzyme from Haemophilus influenza is described to catalyze the hydrolysis of propionyl-CoA into propionic acid (Zhuang et al., Biochemistry 47 (2008), 2789-2796). In another preferred embodiment the acetyl-CoA hydrolase is an enzyme from Homo sapiens (UniProt: Q9NPJ3) which is described to hydrolyze propionyl-CoA (Cao et al., Biochemistry 48 (2009), 1293-1304).
[0260] Particularly preferred enzymes are the above-described acyl-CoA hydrolase YciA enzyme from Haemophilus influenza strain R2866 (SEQ ID NO: 30) and the acetyl-CoA hydrolase enzyme from Homo sapiens (UniProt: Q9NPJ3; SEQ ID NO:31). Particularly preferred are also the enzymes acyl-CoA thioester hydrolase from E. coli (Uniprot POA8ZO; SEQ ID NO: 32), acyl-CoA thioesterase 2 from E. coli (Uniprot POAGG2; SEQ ID NO: 33) and acyl-CoA thioesterase II from Pseudomonas putida (Uniprot Q88DR1; SEQ ID NO: 34). Particularly preferred is the thioesterase TesB from E. coli K12 (uniprot :POAGG2), as this enzyme is already described to efficiently catalyze this reaction in E. coli for the biosynthesis of propionic acid (Tseng and Prather, P.N.A.S. 2012, 109(44),p17925-17930).
[0261] In another preferred embodiment, the acyl-CoA hydrolase is an enzyme derived from the family of 1,4-dihydroxy-2-naphthoyl-CoA hydrolases. Enzymes of this family of 1,4-dihydroxy-2-naphthoyl-CoA hydrolases are known to catalyze the following reaction:
[0262] 1,4-dihydroxy-2-naphthoyl-CoA+H.sub.2O.fwdarw.1,4-dihydroxy-2-napht- hoate+CoA
[0263] These enzymes are also often referred to as Ydil thioesterases. Enzymes of this family occur in a variety of organisms and have, e.g., been described in Escherichia coli and Salmonella enterica.
[0264] Thus, particularly preferred acyl-CoA hydrolases for the enzymatic conversion of 3-methylcrotonyl-CoA into 3-methylcrotonic acid of the present invention are enzymes which belong to the family of 1,4-dihydroxy-2-naphthoyl-CoA hydrolases, more preferably the 1,4-dihydroxy-2-naphthoyl-CoA hydrolase derived from Escherichia coli (SEQ ID NO:82) or the 1,4-dihydroxy-2-naphthoyl-CoA hydrolase derived from Salmonella enterica (SEQ ID NO:83).
[0265] In a particularly preferred embodiment, the acyl-CoA hydrolase employed in the method of the invention has an amino acid sequence as shown in any one of SEQ ID NOs: 30 to 34 and SEQ ID NOs:82 and 83 or shows an amino acid sequence which is at least x % homologous to any one of SEQ ID NOs: 30 to 34 and SEQ ID NOs:82 and 83 and has the activity of an acyl-CoA hydrolase with x being an integer between 30 and 100, preferably 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99 wherein such an enzyme is capable of catalyzing the conversion of 3-methylcrotonyl-CoA into 3-methylcrotonic acid. As regards the determination of the sequence identity, the same applies as has been set forth above.
[0266] As described above, the direct conversion of 3-methylcrotonyl-CoA into 3-methylcrotonic acid can also be achieved by making use of an enzyme which is classified as a CoA-transferase (EC 2.8.3.-) capable of transferring the CoA group of 3-methylcrotonyl-CoA to a carboxylic acid.
[0267] CoA-transferases are found in organisms from all lines of descent. Most of the CoA-transferases belong to two well-known enzyme families (referred to in the following as families I and II) and there exists a third family which had been identified in anaerobic metabolic pathways of bacteria. A review describing the different families can be found in Heider (FEBS Letters 509 (2001), 345-349).
[0268] Family I contains, e.g., the following CoA-transferases:
[0269] For 3-oxo acids: enzymes classified in EC 2.8.3.5 or EC 2.8.3.6;
[0270] For short chain fatty acids: enzymes classified in EC 2.8.3.8 or EC 2.8.3.9;
[0271] For succinate: succinyl-CoA:acetate CoA-transferases, i.e. enzymes classified in EC 2.8.3.18 (see also Mullins et al., Biochemistry 51(2012), 8422-34; Mullins et al., J. Bacteriol. 190 (2006), 4933-4940).
[0272] Most enzymes of family I naturally use succinyl-CoA or acetyl-CoA as CoA donors.
[0273] These enzymes contain two dissimilar subunits in different aggregation states. Two conserved amino acid sequence motives have been identified:
[0274] Prosites entry PS01273 (http://prosite.expasy.org/cgi-bin/prosite/prosite-search-ac?PDOC00980)
[0275] COA_TRANSF_1, PS01273; Coenzyme A transferases signature 1 (PATTERN)
[0276] Consensus pattern:
[0277] [DN]-[GN]-x(2)-[LIVMFA](3)-G-G-F-x(3)-G-x-P
[0278] and
[0279] Prosites entries PS01273 (http://prosite.expasy.org/cgi-bin/prosite/prosite-search-ac?PDOC00980)
[0280] COA_TRANSF_2, PS01274; Coenzyme A transferases signature 2 (PATTERN)
[0281] Consensus pattern:
[0282] [LF]-[HQ]-S-E-N-G-[LIVF](2)-[GA]
[0283] E (glutamic acid) is an active site residue.
[0284] The family II of CoA-transferases consists of the homodimeric a-subunits of citrate lyase (EC 2.8.3.10) and citramalate lyase (EC 2.8.3.11). These enzymes catalyse the transfer of acyl carrier protein (ACP) which contains a covalently bound CoA-derivative. It was shown that such enzymes also accept free CoA-thioester in vitro, such as acetyl-CoA, propionyl-CoA, butyryl-CoA in the case of citrate lyase (Dimroth et al., Eur. J. Biochem. 80 (1977), 479-488) and acetyl-CoA and succinyl-CoA in the case of citramalate lyase (Dimroth et al., Eur. J. Biochem. 80 (1977), 469-477).
[0285] According to Heider (loc. cit.) family III of CoA-transferases consists of formyl-CoA: oxalate CoA-transferase, succinyl-CoA:(R)-benzylsuccinate CoA-transferase, (E)-cinnamoyl-CoA:(R)-phenyllactate CoA-transferase and butyrobetainyl-CoA:(R)-carnitine CoA-transferase. A further member of family III is succinyl-CoA:L-malate CoA-transferase whose function in autrophic CO2 fixation of Chloroflexus aurantiacus is to activate L-malate to its CoA thioester with succinyl-CoA as the CoA donor (Friedman S. et al. J. Bacteriol. 188 (2006), 2646-2655). The amino acid sequences of the CoA-tranferase of this family show only a low degree of sequence identity to those of families I and II. These CoA-transferases occur in prokaryotes and eukaryotes.
[0286] In a preferred embodiment the CoA-transferase employed in a method according to the present invention is a CoA-transferase which belongs to family I or II as described herein-above.
[0287] Preferably, the CoA-transferase employed in a method according to the present invention for the direct conversion of 3-methylcrotonyl-CoA into 3-methylcrotonic acid is selected from the group consisting of:
[0288] propionate:acetate-CoA transferase (EC 2.8.3.1);
[0289] acetate CoA-transferase (EC 2.8.3.8); and
[0290] butyrate-acetoacetate CoA-transferase (EC 2.8.3.9).
[0291] Thus, in one preferred embodiment the direct conversion of 3-methylcrotonyl-CoA into 3-methylcrotonic acid is achieved by making use of an acetate CoA-transferase (EC 2.8.3.8). Acetate CoA-transferases are enzymes which catalyze the following reaction:
[0292] Acyl-CoA+acetatea fatty acid anion+acetyl-CoA
[0293] This enzyme occurs in a variety of bacteria and has, e.g., been described in Anaerostipes caccae, Eubacterium hallii, Faecalibacterium prausnitzii, Roseburia hominis, Roseburia intestinalis, Coprococcus sp. and Escherichia coli.
[0294] In another preferred embodiment the direct conversion of 3-methylcrotonyl-CoA into 3-methylcrotonic acid is achieved by making use of a butyrate-acetoacetate CoA-transferase (EC 2.8.3.9). Butyrate-acetoacetate CoA-transferase are enzymes which catalyze the following reaction:
[0295] Butanoyl-CoA+acetoacetatebutanoate+acetoacetyl-CoA
[0296] This enzyme occurs in a variety of organism, including eukaryotic and prokaryotic organisms, such as animals and bacteria. The enzyme has, e.g., been described in Bos taurus, Clostridium sp. and Escherichia coli.
[0297] In another preferred embodiment the direct conversion of 3-methylcrotonyl-CoA into 3-methylcrotonic acid is achieved by making use of a propionate:acetate-CoA transferase (EC 2.8.3.1). Propionate:acetate-CoA transferases are enzymes which catalyze the following reaction:
[0298] Acetyl-CoA+propanoateacetate+propanoyl-CoA
[0299] This enzyme occurs in a variety of organism including prokaryotic organisms and the enzyme has, e.g., been described in Clostridium kluyveri, Clostridium propionicum, Clostridium propionicum JCM1430, Cupriavidus necator and Emericella nidulans.
[0300] In another preferred embodiment the direct conversion of 3-methylcrotonyl-CoA into 3-methylcrotonic acid is achieved by making use of a succinyl-CoA:acetate-CoA transferase (EC 2.8.3.18). Succinyl-CoA:acetate CoA-transferases are enzymes which catalyze the following reaction:
[0301] Succinyl-CoA+acetateacetyl-CoA+succinate
[0302] This enzyme occurs in a variety of organism, including prokaryotic organisms, and the enzyme has, e.g., been described in Acetobacter aceti, Trichomonas vaginalis, Tritrichomonas foetus, Tritrichomonas foetus ATCC 30924 and Trypanosoma brucei.
[0303] In another preferred embodiment, the direct conversion of 3-methylcrotonyl-CoA into 3-methylcrotonic acid is achieved by making use of a CoA-transferase derived from Megasphaera sp. (Uniprot accession number S7HFR5), an enzyme which belongs to the of CoA-transferases (EC 2.8.3.-) as defined herein-above.
[0304] In a preferred embodiment, the CoA-transferase employed in the method of the present invention is a CoA-transferase derived from Megasphaera sp. (Uniprot accession number S7HFR5; SEQ ID NO:84).
[0305] In a preferred embodiment of the present invention the CoA-transferase is an enzyme comprising the amino acid sequence of SEQ ID NO: 84 or a sequence which is at least n % identical to SEQ ID NO: 84 with n being an integer between 10 and 100, preferably 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99 and wherein the enzyme has the enzymatic activity of directly converting 3-methylcrotonyl-CoA into 3-methylcrotonic acid. As regards the determination of the sequence identity, the same applies as has been set forth above.
[0306] The Enzymatic Conversion of 3-Methylcrotonyl-CoA into 3-Methylcrotonic Acid: an Alternative Route to the Above-Described Step VI
[0307] In another preferred embodiment, the conversion of 3-methylcrotonyl-CoA into 3-methylcrotonic acid is achieved by an alternative route wherein 3-methylcrotonyl-CoA is first enzymatically converted into 3-methylbutyryl-CoA which is then enzymatically converted into 3-methylbutyric acid which is then ultimately converted into 3-methylcrotonic acid. This alternative conversion of 3-methylcrotonyl-CoA into 3-methylcrotonic acid via 3-methylbutyryl-CoA and 3-methylbutyric acid is schematically illustrated in FIG. 32.
[0308] Accordingly, the present invention relates to a method for producing isobutene from 3-methylcrotonyl-CoA in which 3-methylcrotonyl-CoA is first enzymatically converted into 3-methylbutyryl-CoA which is then enzymatically converted into 3-methylbutyric acid which is then converted into 3-methylcrotonic acid which is then further converted into isobutene as described herein above.
[0309] The first enzymatic conversion, i.e., the conversion of 3-methylcrotonyl-CoA into 3-methylbutyryl-CoA, is a desaturation reaction, i.e., reduction of the double bond C.dbd.C of 3-methylcrotonyl-CoA into 3-methylbutyryl-CoA. The enzymatic conversion of 3-methylcrotonyl-CoA into 3-methylbutyryl-CoA, i.e. the reduction of the double bond in 3-methylcrotonyl-CoA, can, for example, be achieved by employing an enzyme classified as EC 1.3._._. Enzymes classified as EC 1.3._._ are oxidoreductases acting on the CH--CH group of a donor molecule. This subclass contains enzymes that reversibly catalyze the conversion of a carbon-carbon single bond to a carbon-carbon double bond between two carbon atoms. Sub-classes of EC 1.3 are classified depending on the acceptor. In one preferred embodiment the enzyme is an enzyme which is classified as EC 1.3._._ and which uses NADH or NADPH as co-factor. In one particularly preferred embodiment the enzyme is an enzyme which uses NADPH as a co-factor. In a preferred embodiment the enzyme is selected from the group consisting of:
[0310] acyl-CoA dehydrogenase (NADP+) (EC 1.3.1.8);
[0311] enoyl-[acyl-carrier-protein] reductase (NADPH, Si-specific) (EC 1.3.1.10);
[0312] cis-2-enoyl-CoA reductase (NADPH) (EC 1.3.1.37);
[0313] trans-2-enoyl-CoA reductase (NADPH) (EC 1.3.1.38);
[0314] enoyl-[acyl-carrier-protein] reductase (NADPH, Re-specific) (EC 1.3.1.39); and
[0315] crotonyl-CoA reductase (EC 1.3.1.86).
[0316] Thus, in one preferred embodiment the conversion of 3-methylcrotonyl-CoA into 3-methylbutyryl-CoA is achieved by making use of an acyl-CoA dehydrogenase (NADP+) (EC 1.3.1.8). Acyl-CoA dehydrogenases are enzymes which catalyze the following reaction:
[0317] Acyl-CoA+NADP.sup.+2,3-dehydroacyl-CoA+NADPH+H.sup.+
[0318] This enzyme occurs in a variety of organism, including eukaryotic and prokaryotic organisms, such as plants, animals, fungi and bacteria. The enzyme has, e.g., been described in Bos, taurus, Rattus novegicus, Mus musculus, Columba sp., Arabidopsis thaliana, Nicotiana benthamiana, Allium ampeloprasum, Euglena gracilis, Candida albicans, Streptococcus collinus, Rhodobacter sphaeroides and Mycobacterium smegmatis.
[0319] In a further preferred embodiment the conversion of 3-methylcrotonyl-CoA into 3-methylbutyryl-CoA is achieved by making use of an enoyl-[acyl-carrier-protein] reductase (NADPH, Si-specific) (EC 1.3.1.10). Enoyl-[acyl-carrier-protein] reductases (NADPH, Si-specific) are enzymes which catalyze the following reaction:
[0320] acyl-[acyl-carrier-protein]+NADP.sup.+trans-2,3-dehydroacyl-[acyl-c- arrier-protein]+NADPH+H.sup.+
[0321] This enzyme occurs in a variety of organism, including eukaryotic and prokaryotic organisms, such as plants, fungi and bacteria. The enzyme has, e.g., been described in Carthamus tinctorius, Candida tropicalis, Saccharomyces cerevisiae, Streptococcus collinus, Streptococcus pneumoniae, Staphylococcus aureus, Bacillus subtilis, Bacillus cereus, Porphyromonas gingivalis, Escherichia coli and Salmonella enterica.
[0322] In a further preferred embodiment the conversion of 3-methylcrotonyl-CoA into 3-methylbutyryl-CoA is achieved by making use of a cis-2-enoyl-CoA reductase (NADPH) (EC 1.3.1.37). Cis-2-enoyl-CoA reductases (NADPH) are enzymes which catalyze the following reaction:
[0323] Acyl-CoA+NADP.sup.+cis-2,3-dehydroacyl-CoA+NADPH+H.sup.+
[0324] This enzyme has been described to occur in Escherichia coli.
[0325] In a further preferred embodiment the conversion of 3-methylcrotonyl-CoA into 3-methylbutryryl-CoA is achieved by making use of a trans-2-enoyl-CoA reductase (NADPH) (EC 1.3.1.38). Trans-2-enoyl-CoA reductases (NADPH) are enzymes which catalyze the following reaction:
[0326] Acyl-CoA+NADP.sup.+trans-2,3-dehydroacyl-CoA+NADPH+H.sup.+
[0327] This enzyme occurs in a variety of organism, including eukaryotic and prokaryotic organisms, such as plants, animals and bacteria. The enzyme has, e.g., been described in Homo sapien, Rattus norvegicus, Mus musculus, Cavia porcellus, Caenorhabditis elegans, Phalaenopsis amabilis, Gossypium hirsutum, Mycobacterium tuberculosis, Streptococcus collinu and Escherichia coli.
[0328] In a further preferred embodiment the conversion of 3-methylcrotonyl-CoA into 3-methylbutyryl-CoA is achieved by making use of an enoyl-[acyl-carrier-protein] reductase (NADPH, Re-specific) (EC 1.3.1.39). Enoyl-[acyl-carrier-protein] reductases (NADPH, Re-specific) are enzymes which catalyze the following reaction: acyl-[acyl-carrier-protein]+NADP.sup.+trans-2,3-dehydroacyl-[acyl-carrier- -protein]+NADPH+H.sup.+
[0329] This enzyme occurs in a variety of organism, including eukaryotic and prokaryotic organisms, such as animals and bacteria. The enzyme has, e.g., been described in Gallus gallus, Pigeon, Rattus norvegicus, Cavia porcellus, Staphylococcus aureus, Bacillus subtilis and Porphyromonas gingivalis.
[0330] In a further preferred embodiment the conversion of 3-methylcrotonyl-CoA into 3-methylbutyryl-CoA is achieved by making use of a crotonyl-CoA reductase (EC 1.3.1.86). Crotonyl-CoA reductases are enzymes which catalyze the following reaction:
[0331] butanoyl-CoA+NADP.sup.+(E)-but-2-enoyl-CoA+NADPH+H.sup.+
[0332] This enzyme occurs in a variety of organism, including eukaryotic and prokaryotic organisms, such as animals, fungi and bacteria. The enzyme has, e.g., been described in Bos taurus, Salinospora tropica, Clostridium difficile, Streptomyces collinus, Streptomyces cinnamonensis and Streptomyces hygroscopicus.
[0333] The second enzymatic conversion, i.e., the conversion of 3-methylbutyryl-CoA into 3-methylbutyric acid, can be achieved by different enzymatic conversions. One possibility is the direct conversion via a hydrolysis reaction. Another possibility is the direct conversion via a reaction catalyzed by a CoA-transferase and a third possibility is a two-step conversion via 3-methylbutyryl phosphate.
[0334] Thus, according to the present invention, the enzymatic conversion of 3-methylbutyryl-CoA into 3-methylbutyric acid is achieved by
[0335] (a) a single enzymatic reaction in which 3-methylbutyryl-CoA is directly converted into 3-methylbutyric acid, preferably by making use of a CoA transferase (EC 2.8.3.-), preferably a propionate:acetate-CoA transferase (EC 2.8.3.1), an acetate CoA-transferase (EC 2.8.3.8) or a succinyl-CoA:acetate CoA-transferase (EC 2.8.3.18);
[0336] (b) a single enzymatic reaction in which 3-methylbutyryl-CoA is directly converted into 3-methylbutyric acid, preferably by making use of a thioester hydrolase (EC 3.1.2.-), preferably acetyl-CoA hydrolase (EC 3.1.2.1), an ADP-dependent short-chain-acyl-CoA hydrolase (EC 3.1.2.18) or an acyl-CoA hydrolase (EC 3.1.2.20); or
[0337] (c) two enzymatic steps comprising
[0338] (i) first enzymatically converting 3-methylbutyryl-CoA into 3-methylbutyryl phosphate; and
[0339] (ii) then enzymatically converting the thus obtained 3-methylbutyryl phosphate into said 3-methylbutyric acid.
[0340] As regards the preferred embodiments for the CoA transferase (EC 2.8.3.-), the propionate:acetate-CoA transferase (EC 2.8.3.1), the acetate CoA-transferase (EC 2.8.3.8) or a succinyl-CoA:acetate CoA-transferase (EC 2.8.3.18), the thioester hydrolase (EC 3.1.2.-), the acetyl-CoA hydrolase (EC 3.1.2.1), the ADP-dependent short-chain-acyl-CoA hydrolase (EC 3.1.2.18), the acyl-CoA hydrolase (EC 3.1.2.20), the enzyme capable of converting 3-methylbutyryl-CoA into 3-methylbutyryl phosphate and the enzyme capable of converting 3-methylbutyryl phosphate into said 3-methylbutyric acid, the same applies as has been set forth above in connection with the enzymatic conversion of step VIa, step VIb and step VIc according to the invention.
[0341] The third enzymatic conversion, i.e., the conversion of 3-methylbutyric acid into 3-methylcrotonic acid can, e.g., be achieved by a 2-enoate reductase (EC 1.3.1.31). 2-enoate reductases are enzymes which naturally catalyze the following reaction:
[0342] Butanoate+NAD.sup.+.sup.but-2-enoate+NADH+H.sup.+
[0343] This enzyme occurs in a variety of organism, including eukaryotic and prokaryotic organisms, such as animals, fungi and bacteria. The enzyme has, e.g., been described in Cichorium intybus, Marchantia polymorpha, Solanum lycopersicum, Absidia glauca, Kluyveromyces lactis, Penicillium citrinum; Rhodosporidium, Saccharomyces cerevisiae, Clostridium kluyveri, Clostridium bifermentans, Clostridium botulinum, Clostridium difficile, Clostridium ghonii, Clostridium mangenotii, Clostridium oceanicum, Clostridium sordellii, Clostridium sporogenes, Clostridium sticklandii, Clostridium tyrobutyricum, Achromobacter sp., Burkholderia sp., Gluconobacter oxydans, Lactobacillus casei, Pseudomonas putida, Shewanella sp., Yersinia bercovieri, Bacillus subtilis, Moorella thermoacetica and Peptostreptococcus anaerobius. The enoate reductase of Clostridiae has been described, e.g., in Tischler et al. (Eur. J. Bioche. 97 (1979), 103-112).
[0344] The Enzymatic Conversion of 3-Methylglutaconyl-CoA into 3-Methylcrotonyl-CoA: Step VII as Shown in FIG. 1
[0345] The 3-methylcrotonyl-CoA which is converted according to the method of the present invention into 3-methylcrotonic acid according to any of the above described methods (and further converted according to the method of the present invention into isobutene according to any of the above described methods) may itself be provided by an enzymatic reaction, namely the enzymatic conversion of 3-methylglutaconyl-CoA into 3-methylcrotonyl-CoA. The conversion of 3-methylglutaconyl-CoA into 3-methylcrotonyl-CoA is schematically illustrated in FIG. 12.
[0346] Accordingly, the present invention relates to a method for producing isobutene from 3-methylglutaconyl-CoA in which 3-methylglutaconyl-CoA is first converted into 3-methylcrotonyl-CoA which is then further converted into 3-methylcrotonic acid which is then further converted into isobutene as described herein above.
[0347] The conversion of 3-methylglutaconyl-CoA into 3-methylcrotonyl-CoA may be catalyzed by different enzymes. According to the present invention, the conversion of 3-methylglutaconyl-CoA into said 3-methylcrotonyl-CoA preferably makes use of (i) a methylcrotonyl-CoA carboxylase (EC 6.4.1.4); or (ii) a geranoyl-CoA carboxylase (EC 6.4.1.5) (as shown in step VII of FIG. 1).
[0348] Methylcrotonyl-CoA carboxylases (EC 6.4.1.4) and geranoyl-CoA carboxylases (EC 6.4.1.5) as well as preferred enzymes of these enzyme classes have already been described above. Accordingly, as regards these enzymes, the same applies to the conversion of 3-methylglutaconyl-CoA into 3-methylcrotonyl-CoA as has been set forth above.
[0349] In another preferred embodiment the conversion of 3-methylglutaconyl-CoA via decarboxylation into 3-methylcrotonyl-CoA is catalyzed by a 3-methylglutaconyl-CoA decarboxylase, e.g. a 3-methylglutaconyl-CoA decarboxylase of Myxococcus xanthus encoded by the liuB gene. This gene codes for an enzyme having the two subunits AibA and AibB (Li et al., Angew. Chem. Int. Ed. 52 (2013), 1304-1308).
[0350] This enzyme has already described above as a methylcrotonyl-CoA carboxylase derived from Myxcoxoccus xanthus in the context of conversion of 3-methylcrotonic acid into isobutene.
[0351] The same enzyme derived from Myxococcus xanthus encoded by the liuB gene having the two subunits AibA and AibB (Li et al., Angew. Chem. Int. Ed. 52 (2013), 1304-1308) has been described above with reference to SEQ ID NOs: 100 and 101 and can also be used for the conversion of 3-methylglutaconyl-CoA via decarboxylation into 3-methylcrotonyl-CoA.
[0352] In a preferred embodiment of the present invention the 3-methylglutaconyl-CoA decarboxylase is an enzyme comprising the amino acid sequence of SEQ ID NO: 100 or a sequence which is at least n % identical to SEQ ID NO: 100 with n being an integer between 10 and 100, preferably 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99 and wherein the enzyme has the enzymatic activity of converting 3-methylglutaconyl-CoA into 3-methylcrotonyl-CoA. As regards the determination of the sequence identity, the same applies as has been set forth above.ln another preferred embodiment of the present invention the 3-methylglutaconyl-CoA decarboxylase is an enzyme comprising the amino acid sequence of SEQ ID NO: 101 or a sequence which is at least n % identical to SEQ ID NO: 101 with n being an integer between 10 and 100, preferably 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99 and wherein the enzyme has the enzymatic activity of converting 3-methylglutaconyl-CoA into 3-methylcrotonyl-CoA. As regards the determination of the sequence identity, the same applies as has been set forth above.
[0353] In another preferred embodiment of the present invention the 3-methylglutaconyl-CoA decarboxylase is a heterodimeric enzyme comprising a combination of the amino acid sequence of SEQ ID NO: 100 and 101 or a sequence which is at least n identical to SEQ ID NO: 100 and 101 with n being an integer between 10 and 100, preferably 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99 and wherein the enzyme has the enzymatic activity of converting 3-methylglutaconyl-CoA into 3-methylcrotonyl-CoA. As regards the determination of the sequence identity, the same applies as has been set forth above.
[0354] The enzymatic conversion of 3-hydroxy-3-methylcilutaryl-CoA into 3-methylglutaconyl-CoA: step VIII as shown in FIG. 1
[0355] The 3-methylglutaconyl-CoA which is converted into 3-methylcrotonyl-CoA may itself be provided by an enzymatic reaction, namely the enzymatic conversion of 3-hydroxy-3-methylglutaryl-CoA into 3-methylglutaconyl-CoA; see FIG. 13.
[0356] Accordingly, the present invention also relates to a method for producing isobutene from 3-hydroxy-3-methylglutaryl-CoA in which 3-hydroxy-3-methylglutaryl-CoA is first converted into 3-methylglutaconyl-CoA which is then converted into 3-methylcrotonyl-CoA which is then further converted into 3-methylcrotonic acid which is then further converted into isobutene as described herein above.
[0357] According to the present invention, the enzymatic conversion of 3-hydroxy-3-methylglutaryl-CoA into 3-methylglutaconyl-CoA is an enzymatic dehydration reaction which occurs naturally, and which is catalyzed, e.g., by enzymes classified as 3-methylglutaconyl-coenzyme A hydratase (EC 4.2.1.18). Accordingly, the enzymatic conversion of 3-hydroxy-3-methylglutaryl-CoA into 3-methylglutaconyl-CoA preferably makes use of a 3-methylglutaconyl-coenzyme A hydratase (EC 4.2.1.18) (as shown in step VIII of FIG. 1).
[0358] 3-methylglutaconyl-coenzyme A hydratases are enzymes which catalyze the following reaction:
[0359] (S)-3-hydroxy-3-methylglutaryl-CoAtrans-3-methylglutaconyl-CoA+H.su- b.2O
[0360] This enzyme occurs in a variety of organisms, including eukaryotic and prokaryotic organisms, such as plants, animals and bacteria. The enzyme has, e.g., been described in Catharantus roseus, Homo sapiens, Bos taurus, Ovis aries, Acinetobacter sp., Myxococcus sp. and Pseudomonas putida. In a preferred embodiment the 3-methylglutaconyl-coenzyme A hydratase is an enzyme from Myxococcus sp., and even more preferably an enzyme which has an amino acid sequence as shown in SEQ ID NO: 35 or shows an amino acid sequence which is at least x % homologous to SEQ ID NO: 35 and has the activity of a 3-methylglutaconyl-coenzyme A hydratase with x being an integer between 30 and 100, preferably 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99 wherein such an enzyme is capable of converting 3-hydroxy-3-methylglutaryl-CoA into 3-methylglutaconyl-CoA as set forth herein above. As regards the determination of the degree of identity, the same applies as has been set forth herein above.
[0361] The conversion of 3-hydroxy-3-methylglutaryl-CoA into 3-methylglutaconyl-CoA can also be achieved by making use of a 3-hydroxy-3-methylglutaryl-coenzyme A dehydratase activity which has been identified, e.g., in Myxococcus xanthus and which is encoded by the liuC gene (Li et al., Angew. Chem. Int. Ed. 52 (2013), 1304-1308). The 3-hydroxy-3-methylglutaryl-coenzyme A dehydratase derived from Myxococcus xanthus has the Uniprot Accession number Q1 D5Y4. Thus, in a preferred embodiment, the 3-hydroxy-3-methylglutaryl-coenzyme A dehydratase employed in the method of the present invention is an enzyme derived from Myxococcus xanthus (Uniprot Accession number Q1 D5Y4; SEQ ID NO:98).
[0362] In a preferred embodiment of the present invention the 3-hydroxy-3-methylglutaryl-coenzyme A dehydratase is an enzyme comprising an amino acid sequence of SEQ ID NO:98 or a sequence which is at least n % identical to SEQ ID NO:98 with n being an integer between 10 and 100, preferably 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99 and wherein the enzyme has the enzymatic activity of converting 3-hydroxy-3-methylglutaryl-CoA into 3-methylglutaconyl-CoA. As regards the determination of the sequence identity, the same applies as has been set forth above.
[0363] The enzymatic conversion of 3-hydroxy-3-methylglutaryl-CoA into 3-methylglutaconyl-CoA can also be achieved by making use of a 3-hydroxyacyl-CoA dehydratase or an enoyl-CoA hydratase. 3-hydroxyacyl-CoA dehydratases and enoyl-CoA hydratases catalyze the same reaction while the name of one of these enzymes denotes one direction of the corresponding reaction while the other name denotes the reverse reaction. As the reaction is reversible, both enzyme names can be used.
[0364] 3-hydroxyacyl-CoA dehydratases and enoyl-CoA hydratases belong to enzymes classified as EC 4.2.1.-.
[0365] 3-hydroxyacyl-CoA dehydratases and enoyl-CoA hydratases have, e.g., been identified in Pseudomonas sp., Acinetobacter baumanii (Uniprot accession number A0A0D5YDD4), Pseudomonas aeruginosa (Uniprot accession number Q9HZV7), Marinobacter santoriniensis (Uniprot accession number M7CV63), Pseudomonas knackmussii, Pseudomonas pseudoalcaligenes (Uniprot accession number L8MQT6), Pseudomonas flexibilis and Alcanivorax dieselolei as well as in Ustilago maydis (Uniprot accession number Q4PEN0), Bacillus sp. GeD10 (Uniprot accession number N1LWG2) and in Labilithrix luteola (Uniprot accession number A0A0K1PN19).
[0366] In a preferred embodiment, the 3-hydroxyacyl-CoA dehydratase/enoyl-CoA hydratase employed in the method of the present invention for the conversion of 3-hydroxy-3-methylglutaryl-CoA into 3-methylglutaconyl-CoA is an enzyme derived from Pseudomonas sp. (SEQ ID NO:85), Acinetobacter baumanii (Uniprot accession number A0A0D5YDD4; SEQ ID NO:86), Pseudomonas aeruginosa (Uniprot accession number Q9HZV7; SEQ ID NO:87), Marinobacter santoriniensis (Uniprot accession number Q9HZV7; SEQ ID NO:88), Pseudomonas knackmussii (SEQ ID NO:89), Pseudomonas pseudoalcaligenes (Uniprot accession number L8MQT6; SEQ ID NO:90), Pseudomonas flexibilis (SEQ ID NO:91), Alcanivorax dieselolei (SEQ ID NO:92), Ustilago maydis (Uniprot accession number Q4PENO; SEQ ID NO:95), Bacillus sp. GeD10 (Uniprot accession number N1LWG2; SEQ ID NO:96) or Labilithrix luteola (Uniprot accession number A0A0K1PN19; SEQ ID NO:97).
[0367] In a preferred embodiment of the present invention the 3-hydroxyacyl-CoA dehydratase/enoyl-CoA hydratase is an enzyme comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 85 to 92 and SEQ ID NOs: 95 to 97 or a sequence which is at least n % identical to any of SEQ ID NOs: 85 to 92 and SEQ ID NOs: 95 to 97 with n being an integer between 10 and 100, preferably 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99 and wherein the enzyme has the enzymatic activity of converting 3-hydroxy-3-methylglutaryl-CoA into 3-methylglutaconyl-CoA. As regards the determination of the sequence identity, the same applies as has been set forth above.
[0368] The Enzymatic Conversion of Acetoacetyl-CoA into 3-Hydroxy-3-Methylglutaryl-CoA: Step IX as Shown in FIG. 1
[0369] The 3-hydroxy-3-methylglutaryl-CoA which is converted into 3-methylglutaconyl-CoA may itself be provided by an enzymatic reaction, namely the enzymatic condensation of acetoacetyl-CoA and acetyl-CoA into 3-hydroxy-3-methylglutaryl-CoA; see FIG. 14.
[0370] Accordingly, the present invention also relates to a method for producing isobutene from acetoacetyl-CoA and acetyl-CoA in which acetoacetyl-CoA and acetyl-CoA are first condensed into 3-hydroxy-3-methylglutaryl-CoA which is then converted into 3-methylglutaconyl-CoA which is then converted into 3-methylcrotonyl-CoA which is then further converted into 3-methylcrotonic acid which is then further converted into isobutene as described herein above.
[0371] According to the present invention, the enzymatic condensation of acetoacetyl-CoA and acetyl-CoA into 3-hydroxy-3-methylglutaryl-CoA makes preferably use of a 3-hydroxy-3-methylglutaryl-CoA synthase (see step IX of FIG. 1).
[0372] The condensation of acetyl-CoA and acetoacetyl-CoA is a reaction which is naturally catalyzed by the enzyme 3-hydroxy-3-methylglutaryl-CoA synthase (also referred to as HMG-CoA synthase). Thus, preferably, the condensation of acetyl-CoA and acetoacetyl-CoA into 3-hydroxy-3-methylglutaryl-CoA makes use of a 3-hydroxy-3-methylglutaryl-CoA synthase (also referred to as HMG-CoA synthase). HMG-CoA synthases are classified in EC 2.3.3.10 (formerly, HMG-CoA synthase has been classified as EC 4.1.3.5 but has been transferred to EC 2.3.3.10). The term "HMG-CoA synthase" refers to any enzyme which is able to catalyze the reaction where acetyl-CoA condenses with acetoacetyl-CoA to form 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA) (see FIG. 14). HMG-CoA synthase is part of the mevalonate pathway. Two pathways have been identified for the synthesis of isopentenyl pyrophosphate (IPP), i.e. the mevalonate pathway and the glyceraldehyde 3-phosphate-pyruvate pathway. HMG-CoA synthase catalyzes the biological Claisen condensation of acetyl-CoA with acetoacetyl-CoA and is a member of a superfamily of acyl-condensing enzymes that includes beta-ketothiolases, fatty acid synthases (beta-ketoacyl carrier protein synthase) and polyketide synthases.
[0373] HMG-CoA synthase has been described for various organisms. Also amino acid and nucleic acid sequences encoding HMG-CoA synthases from numerous sources are available. Generally, the sequences only share a low degree of overall sequence identity. For example, the enzymes from Staphylococcus or Streptococcus show only about 20% identity to those of human and avian HMG-CoA synthase. In some sources it is reported that the bacterial HMG-CoA synthases and their animal counterparts exhibit only about 10% overall sequence identity (Sutherlin et al., J. Bacteriol. 184 (2002), 4065-4070). However, the amino acid residues involved in the acetylation and condensation reactions are conserved among bacterial and eukaryotic HMG-CoA synthases (Campobasso et al., J. Biol. Chem. 279 (2004), 44883-44888). The three-dimensional structure of three HMG-CoA synthase enzymes has been determined and the amino acids crucial for the enzymatic reaction are in principle well characterized (Campobasso et al., loc. cit.; Chun et al., J. Biol. Chem. 275 (2000), 17946-17953; Nagegowda et al., Biochem. J. 383 (2004), 517-527; Hegardt, Biochem. J. 338 (1999), 569-582). In eukaryotes, there exist two forms of the HMG-CoA synthase, i.e. a cytosolic and a mitochondrial form. The cytosolic form plays a key role in the production of cholesterol and other isoprenoids and the mitochondrial form is involved in the production of ketone bodies.
[0374] In principle any HMG-CoA synthase enzyme can be used in the context of the present invention, in particular from prokaryotic or eukaryotic organisms.
[0375] Prokaryotic HMG-CoA synthases are described, e.g., from Staphylococcus aureus (Campobasso et al., loc. cit.; Uniprot accession number Q9FD87), Staphylococcus epidermidis (Uniprot accession number Q9FD76), Staphylococcus haemolyticus (Uniprot accession number Q9FD82), Enterococcus faecalis (Sutherlin et al., loc. cit.; Unirprot accession number Q9FD71; SEQ ID NO:99), Enterococcus faecium (Uniprot accession number Q9FD66), Streptococcus pneumonia (Uniprot accession number Q9FD56), Streptococcus pyogenes (Uniprot accession number Q9FD61) and Methanobacterium thermoautotrophicum (accession number AE000857), Borrelia burgdorferi (NCBI accession number BB0683). Further HMG-CoA synthases are, e.g., described in WO 2011/032934. A preferred HMG-CoA synthase is the enzyme from Schizosaccharomyces pombe (Uniprot P54874). In a particularly preferred embodiment, the HMG-CoA synthase employed in the method of the invention has an amino acid sequence as shown in SEQ ID NO: 36 or SEQ ID NO:99 or shows an amino acid sequence which is at least x % homologous to SEQ ID NO: 36 or SEQ ID NO:99 and has the activity of a HMG-CoA synthase with x being an integer between 30 and 100, preferably 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99 wherein such an enzyme is capable of catalyzing the condensation of acetyl-CoA and acetoacetyl-CoA into 3-hydroxy-3-methylglutaryl-CoA. As regards the determination of the degree of identity, the same applies as has been set forth herein above.
[0376] The Enzymatic Conversion of Acetyl-CoA into Acetoacetyl-CoA: Steps XIII, XIV and XV as Shown in FIG. 1
[0377] The acetoacetyl-CoA which is either converted into 3-hydroxy-3-methylglutaryl-CoA or which is converted into acetoacetate may itself be provided by an enzymatic reaction, namely the enzymatic conversion of acetyl-CoA into acetoacetyl-CoA.
[0378] According to the present invention, the conversion of acetyl-CoA into said acetoacetyl-CoA can be achieved by different routes. One possibility is to first convert acetyl-CoA into malonyl-CoA (step XIV as shown in FIG. 1) and then to further condense said malonyl-CoA and acetyl-CoA into acetoacetyl-CoA (step XV as shown in FIG. 1). Another possibility is to directly condense in a single enzymatic reaction two molecules of acetyl-CoA into acetoacetyl-CoA (step XIII as shown in FIG. 1). These reactions are schematically shown in FIG. 15 (step XIII), FIG. 16 (step XIV) and FIG. 17 (step XV), respectively.
[0379] Thus, the present invention also relates to a method for producing isobutene from acetyl-CoA in which acetyl-CoA is first converted into acetoacetyl-CoA by any of the above-mentioned routes which is then condensed with acetyl-CoA into 3-hydroxy-3-methylglutaryl-CoA which is then converted into 3-methylglutaconyl-CoA which is then converted into 3-methylcrotonyl-CoA which is then further converted into 3-methylcrotonic acid which is then further converted into isobutene as described herein above.
[0380] Moreover, the present invention also relates to a method for producing isobutene from acetyl-CoA in which acetyl-CoA is first converted into acetoacetyl-CoA by any of the above-mentioned routes by any of the above-mentioned routes which is then converted into acetoacetate which is then converted into acetone which is then condensed with acetyl-CoA into 3-hydroxyisovalerate (HIV) which is then converted into 3-methylcrotonic acid as described herein above. Further, said 3-methylcrotonic acid is then further converted into isobutene as described herein above.
[0381] According to the present invention, the enzymatic conversion of acetyl-CoA into malonyl-CoA preferably makes use of an acetyl-CoA carboxylase (EC 6.4.1.2) (step XIV as shown in FIG. 1). This naturally occurring reaction fixes CO.sub.2 on acetyl-CoA utilizing ATP resulting in malonyl-CoA. Enzymes classified as an acetyl-CoA carboxylases (EC 6.4.1.2) catalyze the following reaction:
[0382] Acetyl-CoA+ATP+CO.sub.2.fwdarw.Malonyl-CoA+ADP
[0383] Moreover, according to the present invention, the enzymatic condensation of malonyl-CoA and acetyl-CoA into said acetoacetyl-CoA preferably makes use of an acetoacetyl-CoA synthase (EC 2.3.1.194) (step XV as shown in FIG. 1). This is a natural occurring reaction and condenses malonyl-CoA and acetyl-CoA in a decarboxylation reaction. Enzymes classified as acetoacetyl-CoA synthases (EC 2.3.1.194) catalyze the enzymatic conversion of acetyl-CoA and malonyl-CoA into acetoacetyl-CoA according to the following reaction.
[0384] acetyl-CoA+malonyl-CoA.fwdarw.acetoacetyl-CoA+CoA+CO.sub.2
[0385] This reaction is catalyzed by an enzyme called acetoacetyl-CoA synthase (EC 2.3.1.194). The gene encoding this enzyme was identified in the mevalonate pathway gene cluster for terpenoid production in a soil-isolated Gram-positive Streptomyces sp. Strain CL190 (Okamura et al., PNAS USA 107 (2010), 11265-11270, 2010). Moreover a biosynthetic pathway using this enzyme for acetoacetyl-CoA production was recently developed in E. coli (Matsumoto K et al., Biosci. Biotechnol. Biochem, 75 (2011), 364-366).
[0386] Alternatively, the enzymatic conversion of acetyl-CoA into said acetoacetyl-CoA consists of a single enzymatic reaction in which acetyl-CoA is directly converted into acetoacetyl-CoA by the enzymatic condensation of two molecules of acetyl-CoA into acetoacetyl-CoA. Preferably, the enzymatic conversion of acetyl-CoA into acetoacetyl-CoA is achieved by making use of an acetyl-CoA acetyltransferase (EC 2.3.1.9).
[0387] Thus, acetoacetyl-CoA can be produced from acetyl-CoA as, e.g., described in WO 2013/057194. Therefore, according to the present invention, acetyl-CoA can, for example, be converted into acetoacetyl-CoA by the following reaction:
[0388] 2 acetyl-CoAacetoacetyl-CoA+CoA
[0389] This reaction is a naturally occurring reaction and is catalyzed by enzymes called acetyl-CoA C-acetyltransferases which are classified as EC 2.3.1.9. Enzymes belonging to this class and catalyzing the above shown conversion of two molecules of acetyl-CoA into acetoacetyl-CoA and CoA occur in organisms of all kingdoms, i.e. plants, animals, fungi, bacteria etc. and have extensively been described in the literature. Nucleotide and/or amino acid sequences for such enzymes have been determined for a variety of organisms, like Homo sapiens, Arabidopsis thaliana, E. coli, Bacillus subtilis, Clostridium acetobutylicum and Candida, to name just some examples. In principle, any acetyl-CoA C-acetyltransferase (EC 2.3.1.9) can be used in the context of the present invention. In one preferred embodiment the enzyme is an acetyl-CoA acetyltransferase from Clostridium acetobutylicum (Uniprot P45359). In a particularly preferred embodiment, the acetyl-CoA acetyltransferase employed in the method of the invention has an amino acid sequence as shown in SEQ ID NO: 37 or shows an amino acid sequence which is at least x % homologous to SEQ ID NO: 37 and has the activity of an acetyl-CoA acetyltransferase with x being an integer between 30 and 100, preferably 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99 wherein such an enzyme is capable of converting acetyl-CoA into acetoacetyl-CoA as set forth herein above.
[0390] As regards the determination of the degree of identity, the same applies as has been set forth herein above.
The Enzymatic Recycling of Metabolites Occurring in the Pathway of the Present Invention: Steps Xa, Xb, XI and XII as Shown in FIG. 1
[0391] The above-described method of the present invention for producing isobutene from acetyl-CoA may be supplemented by one or more of the following reactions as shown in step Xa, step Xb, step XI and step XII of FIG. 18.
[0392] These steps relate to alternative bioconversions which may occur concomitantly to any of the above-described methods for producing isobutene.
[0393] Thus, the present invention relates to any of the above-described methods for producing isobutene from 3-methylcrotonic acid (or from any of the above-described intermediates in the described pathways from acetyl-CoA into isobutene) wherein additionally
[0394] a) 3-hydroxyisovalerate (HIV) is enzymatically converted into 3-methylcrotonic acid with a concomitant transfer of CoA from 3-methylcrotonyl-CoA on 3-hydroxyisovalerate (HIV) to result in 3-hydroxyisovaleryl-CoA (step Xa as schematically shown in FIG. 19); and/or
[0395] b) 3-hydroxyisovalerate (HIV) is enzymatically converted into 3-hydroxyisovaleryl-CoA (step Xb as schematically shown in FIG. 20); and/or
[0396] c) 3-hydroxyisovaleryl-CoA is enzymatically converted into 3-methylcrotonyl-CoA (step XI as schematically shown in FIG. 21); and/or
[0397] d) 3-hydroxyisovalerate (HIV) is enzymatically converted into 3-hydroxyisovaleryl-CoA (step XII as schematically shown in FIG. 22).
[0398] These reactions which which will be described in more detail in the following, may occur concomitantly to any of the above-described methods for producing isobutene are beneficial for several reasons. First, it is known that the hydration of an enoyl-CoA (such as, e.g., 3-methylcrotonyl-CoA) is a favoured reaction in vivo in an aqueous medium. Accordingly, the above reactions represent possibilities which allow to drive the metabolic flux toward the precursor of isobutene, i.e., 3-methylcrotonic acid, even in case the pathway "leaks" into the direction of 3-hydroxyisovalerate (HIV) and/or 3-hydroxyisvaleryl-CoA. Second, the above conversions beneficially involve the conservation of energy into a thioester CoA bond via a transfer of a thioester group.
[0399] The enzymatic conversion of 3-hydroxyisovalerate (HIV) into 3-methylcrotonic acid with a concomitant transfer of CoA from 3-methylcrotonyl-CoA on 3-hydroxyisovalerate (HIV) to result in 3-hydroxyisovaleryl-CoA as shown in step Xa of FIG. 18
[0400] Thus, in a first aspect, the 3-methylcrotonic acid which is converted into isobutene may be provided by an enzymatic reaction wherein 3-hydroxyisovalerate (HIV) is enzymatically converted into 3-methylcrotonic acid with a concomitant transfer of CoA from 3-methylcrotonyl-CoA to 3-hydroxyisovalerate (HIV) to result in 3-hydroxyisovaleryl-CoA (step Xa as shown in FIG. 18). This reaction is schematically illustrated in FIG. 19.
[0401] Thus, the present invention also relates to a method for producing isobutene from 3-hydroxyisovalerate (HIV) wherein 3-hydroxyisovalerate (HIV) is enzymatically converted into 3-methylcrotonic acid with a concomitant transfer of CoA from 3-methylcrotonyl-CoA on 3-hydroxyisovalerate (HIV) to result in 3-hydroxyisovaleryl-CoA. Further, the thus produced 3-methylcrotonic acid is then enzymatically converted into isobutene as described herein above.
[0402] Moreover, the present invention also relates to a method for producing 3-methylcrotonic acid and 3-hydroxyisovaleryl-CoA from 3-hydroxyisovalerate (HIV) and from 3-methylcrotonyl-CoA wherein 3-hydroxyisovalerate (HIV) is enzymatically converted into 3-methylcrotonic acid with a concomitant transfer of CoA from 3-methylcrotonyl-CoA on 3-hydroxyisovalerate (HIV) to result in 3-hydroxyisovaleryl-CoA.
[0403] According to the present invention, the conversion of 3-hydroxyisovalerate (HIV) and 3-methylcrotonyl-CoA into 3-methylcrotonic acid and 3-hydroxyisovaleryl-CoA wherein 3-hydroxyisovalerate (HIV) is enzymatically converted into 3-methylcrotonic acid with a concomitant transfer of CoA from 3-methylcrotonyl-CoA on 3-hydroxyisovalerate (HIV) to result in 3-hydroxyisovaleryl-CoA preferably makes use of an enzyme which is classified as a CoA-transferase (EC 2.8.3.-) capable of transferring the CoA group of 3-methylcrotonyl-CoA to a carboxylic acid, i.e., 3-hydroxyisovalerate (HIV).
[0404] CoA-transferases (EC 2.8.3.-) as well as preferred enzymes of this enzyme class have already been described above. Accordingly, as regards these enzymes, the same applies to the conversion of 3-hydroxyisovalerate (HIV) and 3-methylcrotonyl-CoA into 3-methylcrotonic acid and 3-hydroxyisovaleryl-CoA as has been set forth above.
[0405] Preferably, the CoA-transferase employed in a method according to the present invention in the enzymatic conversion of 3-hydroxyisovalerate (HIV) into 3-methylcrotonic acid with a concomitant transfer of CoA from 3-methylcrotonyl-CoA on 3-hydroxyisovalerate (HIV) to result in 3-hydroxyisovaleryl-CoA is a CoA-transferase selected from the group consisting of:
[0406] propionate:acetate-CoA transferase (EC 2.8.3.1);
[0407] acetate CoA-transferase (EC 2.8.3.8); and
[0408] butyrate-acetoacetate CoA-transferase (EC 2.8.3.9).
[0409] Propionate:acetate-CoA transferases (EC 2.8.3.1), acetate CoA-transferases (EC 2.8.3.8) and butyrate-acetoacetate CoA-transferases (EC 2.8.3.9) as well as preferred enzymes of these enzyme classes have already been described above. Accordingly, as regards these enzymes, the same applies to the conversion of 3-hydroxyisovalerate (HIV) and 3-methylcrotonyl-CoA into 3-methylcrotonic acid and 3-hydroxyisovaleryl-CoA as has been set forth above.
[0410] The Enzymatic Conversion of 3-Hydroxyisovalerate (HIV) into 3-Hydroxyisovaleryl-CoA as Shown in step Xb of FIG. 18
[0411] In addition or in the alternative to the above-described methods (step Xa), the 3-hydroxyisovaleryl-CoA may also be provided by an enzymatic conversion of 3-hydroxyisovalerate into said 3-hydroxyisovaleryl-CoA (step Xb as shown in FIG. 18). In this reaction, 3-hydroxyisovalerate reacts with an acyl-CoA to result in 3-hydroxyisovaleryl-CoA and an acid. This reaction is schematically illustrated in FIG. 19.
[0412] Preferably, said acyl-CoA is acetyl-CoA.
[0413] Thus, the present invention also relates to a method for producing 3-hydroxyisovaleryl-CoA from 3-hydroxyisovalerate (HIV) wherein 3-hydroxyisovalerate reacts with an acyl-CoA, preferably with acetyl-CoA, to result in 3-hydroxyisovaleryl-CoA and a respective acid.
[0414] Preferably, this conversion is achieved by making use of an enzyme which is classified as a CoA-transferase (EC 2.8.3.-). As regards the preferred embodiments of said CoA-transferase (EC 2.8.3.-) in the context of step Xb, the same applies, mutatis mutandis, as has been set forth above with respect to the CoA-transferases (EC 2.8.3.-) in the enzymatic conversion of 3-hydroxyisovalerate (HIV) into 3-methylcrotonic acid with a concomitant transfer of CoA from 3-methylcrotonyl-CoA on 3-hydroxyisovalerate (HIV) to result in 3-hydroxyisovaleryl-CoA (step Xa as shown in FIG. 18).
[0415] The Enzymatic Conversion of 3-Hydroxyisovaleryl-CoA into 3-Methylcrotonyl-CoA as Shown in Step XI of FIG. 18
[0416] In addition or in the alternative to the above-described methods (step VII), the 3-methylcrotonyl-CoA may be provided by an enzymatic reaction wherein 3-hydroxyisovaleryl-CoA is enzymatically converted into 3-methylcrotonyl-CoA (step XI as shown in FIG. 18). This reversible reaction is a dehydration reaction wherein 3-hydroxyisovaleryl-CoA is dehydrated into 3-methylcrotonyl-CoA and is schematically illustrated in FIG. 21.
[0417] Thus, the present invention also relates to a method for producing isobutene from 3-hydroxyisovaleryl-CoA wherein 3-hydroxyisovaleryl-CoA is first enzymatically converted into 3-methylcrotonyl-CoA wherein 3-methylcrotonyl-CoA is further enzymatically converted into 3-methylcrotonic acid according to any of the above-described methods. Further, the thus produced 3-methylcrotonic acid is then enzymatically converted into isobutene as described herein above.
[0418] According to the present invention, the enzymatic conversion of 3-hydroxyisovaleryl-CoA into 3-methylcrotonyl-CoA preferably makes use of
[0419] (i) an enoyl-CoA hydratase (EC 4.2.1.17);
[0420] (ii) a long-chain-enoyl-CoA hydratase (EC 4.2.1.74);
[0421] (iii) a 3-hydroxypropionyl-CoA dehydratase (EC 4.2.1.116);
[0422] (iv) a 3-hydroxybutyryl-CoA dehydratase (EC 4.2.1.55);
[0423] (v) a 3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase (EC 4.2.1.59);
[0424] (vi) a crotonyl-[acyl-carrier-protein] hydratase (EC 4.2.1.58);
[0425] (vii) a 3-hydroxydecanoyl-[acyl-carrier-protein] dehydratase (EC 4.2.1.60);
[0426] (viii) a 3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase (EC 4.2.1.61); or
[0427] (ix) a 3-methylglutaconyl-CoA hydratase (EC 4.2.1.18).
[0428] In a preferred embodiment of the method according to the invention the conversion of 3-hydroxyisovaleryl-CoA into 3-methylcrotonyl-CoA is achieved by the use of an enoyl-CoA hydratase (EC 4.2.1.17). Enoyl-CoA hydratases (EC 4.2.1.17) as well as preferred enzymes of this enzyme class have already been described above. Accordingly, as regards these enzymes, the same applies to the conversion of 3-hydroxyisovaleryl-CoA into 3-methylcrotonyl-CoA as has been set forth above.
[0429] In another preferred embodiment of the method according to the invention the conversion of 3-hydroxyisovaleryl-CoA into 3-methylcrotonyl-CoA is achieved by the use of a long-chain-enoyl-CoA hydratase (EC 4.2.1.74). Long-chain-enoyl-CoA hydratases (EC 4.2.1.74) catalyze the following reaction:
[0430] (3S)-3-hydroxyacyl-CoAtrans-2-enoyl-CoA+H.sub.2O
[0431] This enzyme belongs to the family of lyases, specifically the hydro-lyases, which cleave carbon-oxygen bonds. The systematic name of this enzyme class is long-chain-(3S)-3-hydroxyacyl-CoA hydro-lyase. This enzyme is also called long-chain enoyl coenzyme A hydratase and it participates in fatty acid elongation in mitochondria and fatty acid metabolism. This enzyme occurs in a number of organisms, e.g., in Rattus norvegicus (Wu et al., Org. Lett. 10 (2008), 2235-2238), Sus scrofa and Cavia porcellus (Fong and Schulz, J. Biol. Chem. 252 (1977), 542-547; Schulz, Biol. Chem. 249 (1974), 2704-2709) and in principle any long-chain-enoyl-CoA hydratase which can catalyze the conversion of 3-hydroxyisovaleryl-CoA into 3-methylcrotonyl-CoA can be employed in the method of the invention.
[0432] The Enzymatic Conversion of 3-Hydroxyisovalerate (HIV) into 3-Hydroxyisovaleryl-CoA as Shown in Step XII of FIG. 18
[0433] In addition or in the alternative to the above-described methods (step Xa or step Xb), the 3-hydroxyisovaleryl-CoA may also be provided by an enzymatic conversion of 3-hydroxyisovalerate (HIV) into said 3-hydroxyisovaleryl-CoA (step XII as shown in FIG. 18). This general reaction wherein coenzyme A (CoASH) is fixed is schematically illustrated in FIG. 22.
[0434] Thus, the present invention also relates to a method for producing isobutene from 3-hydroxyisovalerate (HIV) in which 3-hydroxyisovalerate (HIV) is first converted into 3-hydroxyisovaleryl-CoA wherein 3-hydroxyisovaleryl-CoA is then enzymatically converted into 3-methylcrotonyl-CoA wherein 3-methylcrotonyl-CoA is further enzymatically converted into 3-methylcrotonic acid according to any of the above-described methods. Further, the thus produced 3-methylcrotonic acid is then enzymatically converted into isobutene as described herein above.
[0435] Moreover, the present invention also relates to a method for producing 3-hydroxyisovaleryl-CoA from 3-hydroxyisovalerate (HIV).
[0436] According to the present invention, the enzymatic conversion of 3-hydroxyisovalerate (HIV) into 3-hydroxyisovaleryl-CoA preferably makes use of an enzyme belonging to the family of ligases forming a carbon-sulfur bond (EC 6.2.1.-). The general reaction of the enzymatic conversion of 3-hydroxyisovalerate (HIV) into 3-hydroxyisovaleryl-CoA wherein coenzyme A (CoASH) is fixed can be catalyzed by an enzyme belonging to the family of ligases forming a carbon-sulfur bond (EC 6.2.1.-) via two alternative mechanisms. In a first alternative reaction, an acyl-AMP is generated as an intermediate before coenzyme A is fixed as schematically illustrated in FIG. 23.
[0437] In a second alternative reaction, an acyl phosphate is generated as an intermediate before coenzyme A is fixed as schematically illustrated in FIG. 24.
[0438] Enzymes which belong to the family of ligases forming a carbon-sulfur bond (EC 6.2.1.-) which are capable of enzymatically converting 3-hydroxyisovalerate (HIV) into 3-hydroxyisovaleryl-CoA wherein an acyl-AMP intermediate (i.e., the acyl adenylate intermediate 3-hydroxyisovaleryl-adenosine monophosphate) is generated before coenzyme A is fixed coenzyme A (CoASH) share common structural motifs which are referenced in the InterPro (InterPro44.0; Release Sep. 25, 2013) as InterPro IPR020845, AMP-binding, conserved site (http://www.ebi.ac.uk/interpro/entry/IPR020845) and I PR000873 (http://www.ebi.ac.uk/interpro/entry/IPR000873). The accession number for these enzymes in the Pfam database is PF00501.
[0439] As regards the first alternative reaction (wherein an acyl-AMP is generated as an intermediate before coenzyme A is fixed as schematically illustrated in FIG. 23), examples of enzymes which belong to the above family of ligases forming a carbon-sulfur bond (EC 6.2.1.-) which are capable of enzymatically converting 3-hydroxyisovalerate (HIV) into 3-hydroxyisovaleryl-CoA wherein an acyl-AMP intermediate (i.e., the acyl adenylate intermediate 3-hydroxyisovaleryl-adenosine monophosphate) is generated before coenzyme A is fixed coenzyme A (CoASH) and which may be used in the method for producing 3-hydroxyisovaleryl-CoA from 3-hydroxyisovalerate (HIV) are summarized in the following Table A:
TABLE-US-00001 TABLE A CoA ligases (EC 6.2.1.-) capable of enzymatically converting 3- hydroxyisovalerate (HIV) into 3-hydroxyisovaleryl-CoA involving an acyl-adenylate as an intermediate Enzyme name EC number Acetate-CoA ligase 6.2.1.1 Butyrate-CoA ligase 6.2.1.2 Long chain fatty-acid-CoA ligase 6.2.1.3 4-coumarate-CoA ligase 6.2.1.12 Arachidonate-CoA ligase 6.2.1.15 Propionate-CoA ligase 6.2.1.17 Phytanate-CoA ligase 6.2.1.24 o-succinylbenzoate-CoA ligase 6.2.1.26 3-alpha,7-alpha-dihydroxy-5- 6.2.1.28 beta-cholestanate-CoA ligase 2-furoate-CoA ligase 6.2.1.31 4-chlorobenzoate-CoA ligase 6.2.1.33 3-hydroxybenzoate-CoA ligase 6.2.1.37 4-hydroxybutyrate-CoA ligase 6.2.1.40 3-oxocholest-4-en-26-oate--CoA ligase 6.2.1.42 3-(methylthio)propionyl-CoA ligase 6.2.1.44 Cholate-CoA ligase 6.2.1.7 Oxalate-CoA ligase 6.2.1.8 Biotin-CoA ligase 6.2.1.11 6-carboxyhexanoate-CoA ligase 6.2.1.14 Acetoacetate-CoA ligase 6.2.1.16 Dicarboxylate-CoA ligase 6.2.1.23 Benzoate-CoA ligase 6.2.1.25 4-hydroxybenzoate-CoA ligase 6.2.1.27 Phenylacetate-CoA ligase 6.2.1.30 Anthranilate-CoA ligase 6.2.1.32 3-hydroxypropionyl-CoA synthase 6.2.1.36 (2,2,3-trimethy1-5-oxocyclopent-3- 6.2.1.38 enyl)acetyl-CoA synthase 3-((3aS,4S,7aS)-7a-methy1-1,5-dioxo- 6.2.1.41 octahydro-1H-inden-4-yl)propanoate- CoA ligase 2-hydroxy-7-methoxy-5-methyl- 6.2.1.43 1-naphthoate-CoA ligase Malonate-CoA ligase 6.2.1.n3
[0440] In a preferred embodiment, the enzymatic conversion of 3-hydroxyisovalerate (HIV) into 3-hydroxyisovaleryl-CoA via an acyl adenylate intermediate can, e.g., be achieved by the use of a butanoate:CoA ligase (AMP forming) (EC 6.2.1.2). Butanoate:CoA ligases are enzymes which catalyze the following reaction:
[0441] ATP+a carboxylate+CoA.fwdarw.AMP+diphosphate+an acyl-CoA
[0442] These enzymes participate in butanoate metabolism. The occurrence of these enzymes has been described for a large number of organisms, including prokaryotes and eukaryotes, in particular, bacteria, algae, fungi, plants and animals, e.g. for Methanobacterium formicum, Streptomyces coelicolor, Mycobacterium avium, Penicillium chrysogenum, Paecilomyces variotii, Pseudomonas aeruginosa, Dictyostelium discoideum, Cavia porcellus, Ovis aries, Sus scrofa, Bos taurus, Mus musculus, Rattus norvegicus, and Homo sapiens.
[0443] In a preferred embodiment, the enzymatic conversion of 3-hydroxyisovalerate (HIV) into 3-hydroxyisovaleryl-CoA via an acyl adenylate intermediate is achieved by making use of a butanoate:CoA ligase (AMP forming) (EC 6.2.1.2) derived from Methanobacterium formicum. The amino acid sequence of said protein is shown in SEQ ID NO: 77.
[0444] In a preferred embodiment of the present invention the butanoate:CoA ligase (AMP forming) is an enzyme comprising the amino acid sequence of SEQ ID NO: 77 or a sequence which is at least n % identical to SEQ ID NO: 77 with n being an integer between 10 and 100, preferably 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99 and wherein the enzyme has the enzymatic activity of converting 3-hydroxyisovalerate (HIV) into 3-hydroxyisovaleryl-CoA. As regards the determination of the sequence identity, the same applies as has been set forth above.
[0445] As regards the second alternative reaction (wherein an acyl phosphate is generated as an intermediate before coenzyme A is fixed as schematically illustrated in FIG. 24), examples of enzymes which belong to the above family of ligases forming a carbon-sulfur bond (EC 6.2.1.-) which are capable of enzymatically converting 3-hydroxyisovalerate (HIV) into 3-hydroxyisovaleryl-CoA wherein an acyl phosphate intermediate (i.e., the acyl phosphate intermediate 3-hydroxyisovaleryl phosphate) is generated before coenzyme A is fixed coenzyme A (CoASH) and which may be used in the method for producing 3-hydroxyisovaleryl-CoA from 3-hydroxyisovalerate (HIV) are summarized in the following Table B.
TABLE-US-00002 TABLE B CoA ligases (EC 6.2.1.-) capable of enzymatically converting 3- hydroxyisovalerate (HIV) into 3-hydroxyisovaleryl-CoA involving an acyl phosphate as an intermediate Enzyme name EC number Succinate-CoA ligase (GDP-forming) 6.2.1.4 Glutarate-CoA ligase 6.2.1.6 Acid-CoA ligase (GDP-forming) 6.2.1 .10 Citrate-CoA ligase 6.2.1 .18 Succinate-CoA ligase (ADP-forming) 6.2.1.5 Malate-CoA ligase 6.2.1.9 Acetate-CoA ligase (ADP-forming) 6.2.1 .13
[0446] The Alternative Route for the Enzymatic Conversion from Acetyl-CoA into Isobutene via 3-Methyl-3-Butenoyl-CoA and 3-Methyl-3-Butenoic Acid
[0447] In an alternative to the above, the present invention also relates to a method for the production of isobutene via an alternative route as also shown in FIG. 1 wherein isobutene is produced by the enzymatic conversion of 3-methyl-3-butenoic acid into isobutene. Thus, the present invention provides a method for the production of isobutene comprising the enzymatic conversion of 3-methyl-3-butenoic acid into isobutene. Preferably, the enzymatic conversion of 3-methyl-3-butenoic acid into isobutene is achieved by making use of an 3-methyl-3-butenoic acid decarboxylase.
[0448] In accordance with this alternative route, the present invention not only relates to a method for the production of isobutene from 3-methyl-3-butenoic acid. Rather, as will be outlined in more detail further below, this conversion is preferably embedded in a pathway for the production of isobutene starting from acetyl-CoA which is a central component and an important key molecule in metabolism used in many biochemical reactions.
[0449] Therefore, the present invention also relates to a pathway starting from acetyl-CoA wherein two acetyl-CoA molecules are enzymatically condensed into acetoacetyl-CoA. Alternatively, acetyl-CoA is enzymatically converted into malonyl-CoA which may then be converted into said acetoacetyl-CoA by the enzymatic condensation of malonyl-CoA and acetyl-CoA into said acetoacetyl-CoA.
[0450] Further, the thus produced acetoacetyl-CoA can enzymatically be converted into 3-methyl-3-butenoic acid (which is then ultimately converted into isobutene) via the following briefly summarized pathway.
[0451] In this pathway, the thus produced acetoacetyl-CoA can further enzymatically be converted into 3-hydroxy-3-methylglutaryl-CoA. Moreover, the thus produced 3-hydroxy-3-methylglutaryl-CoA can further enzymatically be converted into 3-methylglutaconyl-CoA. Further, the thus produced 3-methylglutaconyl-CoA can enzymatically be converted into 3-methyl-3-butenoyl-CoA. Further, the thus produced 3-methyl-3-butenoyl-CoA can further be converted in a subsequent enzymatic reaction into 3-methyl-3-butenoic acid (which can then ultimately be converted into isobutene as described above and further below).
[0452] The Enzymatic Conversion of 3-Methyl-3-Butenoic Acid into Isobutene: Step XVI as Shown in FIG. 1
[0453] According to the present invention, the enzymatic conversion of 3-methyl-3-butenoic acid into isobutene can be achieved by a decarboxylation. "Decarboxylation" is generally a chemical reaction that removes a carboxyl group and releases carbon dioxide (CO.sub.2); see FIG. 25.
[0454] The enzymatic conversion of 3-methyl-3-butenoic acid into isobutene can preferably be achieved by making use of an 3-methyl-3-butenoic acid decarboxylase. In accordance with the present invention, an 3-methyl-3-butenoic acid decarboxylase is an enzyme which is capable of converting 3-methyl-3-butenoic acid into isobutene. In preferred embodiments, the 3-methyl-3-butenoic acid decarboxylase is selected from the group consisting of:
[0455] (i) an FMN-dependent decarboxylase associated with an FMN prenyl transferase; or
[0456] (ii) an aconitate decarboxylase (EC 4.1 .1.6); or
[0457] (iii) a methylcrotonyl-CoA carboxylase (EC 6.4.1.4); or
[0458] (iv) a geranoyl-CoA carboxylase (EC 6.4.1.5); or
[0459] (v) a protocatechuate (PCA) decarboxylase (EC 4.1.1.63).
[0460] In other preferred embodiments, the 3-methyl-3-butenoic acid decarboxylase is selected from the group consisting of: 6-methylsalicylate decarboxylase (EC 4.1.1.52), 2-oxo-3-hexenedioate decarboxylase (EC 4.1.1 .77) and 5-oxopent-3-ene-1,2,5-tricarboxylate decarboxylase (EC 4.1.1.68).
[0461] As regards the afore-mentioned embodiment, for the FMN-dependent decarboxylase associated with an FMN prenyl transferase, the aconitate decarboxylase (EC 4.1.1.6), the methylcrotonyl-CoA carboxylase (EC 6.4.1.4), the geranoyl-CoA carboxylase (EC 6.4.1.5), the protocatechuate (PCA) decarboxylase (EC 4.1.1.63), the 6-methylsalicylate decarboxylase (EC 4.1.1.52), the 2-oxo-3-hexenedioate decarboxylase (EC 4.1.1.77) and the 5-oxopent-3-ene-1,2,5-tricarboxylate decarboxylase (EC 4.1.1.68), the same applies as has been set forth above in connection with other methods of the present invention.
[0462] The Enzymatic Conversion of 3-Methyl-3-Butenoyl-CoA into 3-Methyl-3-Butenoic Acid: Steps XVIIa, XVIIb or XVIIc as Shown in FIG. 1
[0463] The 3-methyl-3-butenoic acid may itself be provided by an enzymatic reaction, namely the enzymatic conversion of 3-methyl-3-butenoyl-CoA into 3-methyl-3-butenoic acid; see FIG. 26.
[0464] Accordingly, the present invention relates to a method for producing isobutene from 3-methyl-3-butenoyl-CoA in which 3-methyl-3-butenoyl-CoA is first converted into 3-methyl-3-butenoic acid which is then further converted into isobutene as described herein above.
[0465] According to the present invention, the conversion of 3-methyl-3-butenoyl-CoA into 3-methyl-3-butenoic acid can, e.g., be achieved by three different alternative enzymatic routes, i.e., by:
[0466] (a) a single enzymatic reaction (see FIG. 27) in which 3-methyl-3-butenoyl-CoA is directly converted into 3-methyl-3-butenoic acid, preferably by making use of a CoA transferase (EC 2.8.3.-), preferably a propionate:acetate-CoA transferase (EC 2.8.3.1), an acetate CoA-transferase (EC 2.8.3.8) or a succinyl-CoA:acetate CoA-transferase (EC 2.8.3.18);
[0467] (b) a single enzymatic reaction(see FIG. 28) in which 3-methyl-3-butenoyl-CoA is directly converted into 3-methyl-3-butenoic acid, preferably by making use of a thioester hydrolase (EC 3.1.2.-), preferably acetyl-CoA hydrolase (EC 3.1.2.1), an ADP-dependent short-chain-acyl-CoA hydrolase (EC 3.1.2.18) or an acyl-CoA hydrolase (EC 3.1.2.20); or
[0468] (c) two enzymatic steps (see FIG. 29) comprising
[0469] (i) first enzymatically converting 3-methyl-3-butenoyl-CoA into 3-methyl-3-butenoyl phosphate, preferably by making use of a phosphate butyryltransferase (EC 2.3.1.19) or a phosphate acetyltransferase (EC 2.3.1.8); and
[0470] (ii) then enzymatically converting the thus obtained 3-methyl-3-butenoyl phosphate into said 3-methyl-3-butenoic acid, preferably by making use of a phosphotransferase with a carboxy group as acceptor (EC 2.7.2.-), preferably a propionate kinase (EC 2.7.2.15), an acetate kinase (EC 2.7.2.1), a butyrate kinase (EC 2.7.2.7) or a branched-chain-fatty-acid kinase (EC 2.7.2.14).
[0471] As regards the aforementioned embodiments, for the CoA transferase (EC 2.8.3.-), the propionate:acetate-CoA transferase (EC 2.8.3.1), the acetate CoA-transferase (EC 2.8.3.8), the succinyl-CoA:acetate CoA-transferase (EC 2.8.3.18), the thioester hydrolase (EC 3.1.2.-), the acetyl-CoA hydrolase (EC 3.1.2.1), the ADP-dependent short-chain-acyl-CoA hydrolase (EC 3.1.2.18), the an acyl-CoA hydrolase (EC 3.1.2.20) the phosphate butyryltransferase (EC 2.3.1.19), the phosphate acetyltransferase (EC 2.3.1.8), the phosphotransferase with a carboxy group as acceptor (EC 2.7.2.-), the propionate kinase (EC 2.7.2.15), the acetate kinase (EC 2.7.2.1), the butyrate kinase (EC 2.7.2.7) and the branched-chain-fatty-acid kinase (EC 2.7.2.14), the same applies as has been set forth above in connection with the other methods of the present invention.
[0472] The Enzymatic Conversion of 3-Methylglutaconyl-CoA into 3-Methyl-3-Butenoyl-CoA: Step XVIII as Shown in FIG. 1
[0473] The 3-methyl-3-butenoyl-CoA may itself be provided by an enzymatic reaction, namely the enzymatic conversion of 3-methylglutaconyl-CoA into 3-methyl-3-butenoyl-CoA; see FIG. 30.
[0474] Accordingly, the present invention relates to a method for producing isobutene from 3-methyl-3-butenoyl-CoA in which 3-methylglutaconyl-CoA is first converted into 3-methyl-3-butenoyl-CoA which is then further converted into 3-methyl-3-butenoic acid which is then further converted into isobutene as described herein above.
[0475] Moreover, the present invention relates to a method for producing 3-methyl-3-butenoyl-CoA by converting 3-methylglutaconyl-CoA into 3-methyl-3-butenoyl-CoA.
[0476] According to the present invention, the conversion of 3-methylglutaconyl-CoA into 3-methyl-3-butenoyl-CoA can preferably be achieved by making use of
[0477] (a) (i) a methylcrotonyl-CoA carboxylase (EC 6.4.1.4); or (ii) a geranoyl-CoA carboxylase (EC 6.4.1.5),
[0478] (b) an N-terminal domain of CurF from Lynbya majuscula multifunctional protein or a 3-methylglutaconyl-CoA decarboxylase, preferably a 3-methylglutaconyl-CoA decarboxylase of Myxococcus xanthus encoded by the liuB gene; or
[0479] (c) an enzyme of the 4-oxalocrotonate decarboxylase family.
[0480] As regards the aforementioned embodiments, for the methylcrotonyl-CoA carboxylase (EC 6.4.1.4), the geranoyl-CoA carboxylase (EC 6.4.1.5) and the 3-methylglutaconyl-CoA decarboxylase, preferably the 3-methylglutaconyl-CoA decarboxylase of Myxococcus xanthus encoded by the liuB gene, the same applies as has been set forth above in connection with the other methods of the present invention.
[0481] In a preferred embodiment the conversion of 3-methylglutaconyl-CoA via decarboxylation into 3-methyl-3-butenoyl-CoA is catalyzed by an N-terminal domain of CurF from Lynbya majuscula multifunctional protein. The N-terminal domain of CurF from Lynbya majuscula multifunctional protein is a domain of a polyketide synthase (PKS)/non ribosomale peptide synthase (NRPS) of the CurF multifunctional protein from Lyngbya majuscula. This N-terminal domain of CurF has been classified as a protein belonging to the crotonase superfamily by studying the crystal structure and it naturally catalyzes the decarboxylation of 3-methylglutaconyl-ACP (Acyl Carrier Protein) into 3-methyl-crotonyl-ACP. ACP is similar to CoA as both molecules have a phosphopantetheine moiety in common (as shown in FIG. 31). Moreover, both ACP and CoA can form a thioester with a biological acid (J. Biol. Chem. 289: 35957-35963 (2007) and Chemistry & Biology 11:817-833 (2004)).
[0482] In another preferred embodiment the conversion of 3-methylglutaconyl-CoA via decarboxylation into 3-methyl-3-butenoyl-CoA is catalyzed by an enzyme of the 4-oxalocrotonate decarboxylase family (EC 4.1.1.77).
[0483] 4-oxalocrotonate decarboxylases (EC 4.1.1.77) catalyse the following reaction:
[0484] (3E)-2-oxohex-3-enedioate2-oxopent-4-enoate+CO2
[0485] This enzyme is known from various organisms and has, e.g., been described in Bortetella sp., Cupriavidus nector, Geobacillus stearothermophilus, Pseudomonas putida and Ralstonia pickettii. Thus, in a preferred embodiment, the 4-oxalocrotonate decarboxylase used for the conversion of 3-methylglutaconyl-CoA via decarboxylation into 3-methyl-3-butenoyl-CoA is a 4-oxalocrotonate decarboxylase derived from genus Bortetella, Cupriavidus, Geobacillus, Pseudomonas pr Ralstonia, more preferably from the species Bortetella sp., Cupriavidus nector, Geobacillus stearothermophilus, Pseudomonas putida or Ralstonia pickettii. In an even more preferred embodiment, the 4-oxalocrotonate decarboxylase used for the conversion of 3-methylglutaconyl-CoA via decarboxylation into 3-methyl-3-butenoyl-CoA is the 4-oxalocrotonate decarboxylase of Geobacillus stearothermophilus (UniProt Accession number BOVXM8).
[0486] In a preferred embodiment, the 4-oxalocrotonate decarboxylase employed in the method of the present invention in the conversion of 3-methylglutaconyl-CoA via decarboxylation into 3-methyl-3-butenoyl-CoA is derived from Geobacillus stearothermophilus and has an amino acid sequence as shown SEQ ID NO:69.
[0487] In a preferred embodiment of the present invention the 4-oxalocrotonate decarboxylase is an enzyme comprising the amino acid sequence of SEQ ID NO: 69 or a sequence which is at least n % identical to SEQ ID NO: 69 with n being an integer between 10 and 100, preferably 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98 or 99 and wherein the enzyme has the enzymatic activity of converting 3-methylglutaconyl-CoA via decarboxylation into 3-methyl-3-butenoyl-CoA. As regards the determination of the sequence identity, the same applies as has been set forth above.
[0488] The Enzymatic Conversion of 3-Hydroxy-3-Methylglutaryl-CoA into 3-Methylglutaconyl-CoA: Step VIII as Shown in FIG. 1
[0489] The 3-methylglutaconyl-CoA which can be converted into 3-methyl-3-butenoyl-CoA according to any of the above described methods may itself be provided by an enzymatic reaction, namely the enzymatic conversion of 3-hydroxy-3-methylglutaryl-CoA into 3-methylglutaconyl-CoA.
[0490] Accordingly, the present invention also relates to a method for producing isobutene from 3-hydroxy-3-methylglutaryl-CoA in which 3-hydroxy-3-methylglutaryl-CoA is first converted into 3-methylglutaconyl-CoA which is then converted into 3-methyl-3-butenoyl-CoA which is then further converted into 3-methyl-3-butenoic acid which is then further converted into isobutene as described herein above.
[0491] According to the present invention, the enzymatic conversion of 3-hydroxy-3-methylglutaryl-CoA into 3-methylglutaconyl-CoA is an enzymatic dehydration reaction which occurs naturally, and which is catalyzed, e.g., by enzymes classified as 3-methylglutaconyl-coenzyme A hydratase (EC 4.2.1.18). Accordingly, the enzymatic conversion of 3-hydroxy-3-methylglutaryl-CoA into 3-methylglutaconyl-CoA preferably makes use of a 3-methylglutaconyl-coenzyme A hydratase (EC 4.2.1.18).
[0492] As regards the afore-mentioned embodiment, for the enzymes classified as 3-methylglutaconyl-coenzyme A hydratase (EC 4.2.1.18), the same applies as has been set forth above in connection with the other methods of the present invention.
[0493] The Enzymatic Conversion of Acetoacetyl-CoA into 3-Hydroxy-3-Methylglutaryl-CoA: Step IX as Shown in FIG. 1
[0494] The 3-hydroxy-3-methylglutaryl-CoA may itself be provided by an enzymatic reaction, namely the enzymatic condensation of acetoacetyl-CoA and acetyl-CoA into 3-hydroxy-3-methylglutaryl-CoA which has already been described in detail above.
[0495] Accordingly, the present invention also relates to a method for producing isobutene from acetoacetyl-CoA and acetyl-CoA in which acetoacetyl-CoA and acetyl-CoA are first condensed into 3-hydroxy-3-methylglutaryl-CoA which is then converted into 3-methylglutaconyl-CoA which is then converted into 3-methyl-3-butenoyl-CoA which is then further converted into 3-methyl-3-butenoic acid which is then further converted into isobutene as described herein above.
[0496] The Enzymatic Conversion of Acetyl-CoA into Acetoacetyl-CoA: Step XIII, Step XIV and Step XV as Shown in FIG. 1
[0497] The acetoacetyl-CoA may itself be provided by an enzymatic reaction, namely the enzymatic conversion of acetyl-CoA into acetoacetyl-CoA via several different routes which have already been described in detail above.
[0498] Thus, the present invention also relates to a method for producing isobutene from acetyl-CoA in which acetyl-CoA is first converted into acetoacetyl-CoA by any of the above-mentioned routes which is then condensed with acetyl-CoA into 3-hydroxy-3-methylglutaryl-CoA which is then converted into 3-methylglutaconyl-CoA which is then converted into 3-methyl-3-butenoyl-CoA which is then further converted into 3-methyl-3-butenoic acid which is then further converted into isobutene as described herein above.
[0499] Summarizing the alternative route for the enzymatic conversion from acetyl-CoA into isobutene via 3-methyl-3-butenoyl-CoA and 3-methyl-3-butenoic acid as outlined above, the present invention also relates to the following embodiments as characterized by the following items 1 to 26:
[0500] 1. A method for the production of isobutene comprising the enzymatic conversion of 3-methyl-3-butenoic acid into isobutene.
[0501] 2. The method of item 1, wherein the enzymatic conversion of 3-methyl-3-butenoic acid into isobutene is achieved by making use of an 3-methyl-3-butenoic acid decarboxylase.
[0502] 3. The method of item 2, wherein the 3-methyl-3-butenoic acid decarboxylase is:
[0503] (i) an FMN-dependent decarboxylase associated with an FMN prenyl transferase; or
[0504] (ii) an aconitate decarboxylase (EC 4.1.1.6); or
[0505] (iii) a methylcrotonyl-CoA carboxylase (EC 6.4.1.4); or
[0506] (iv) a geranoyl-CoA carboxylase (EC 6.4.1.5); or
[0507] (v) a protocatechuate (PCA) decarboxylase (EC 4.1.1.63).
[0508] 4. The method of item 1 or 2, further comprising providing the 3-methyl-3-butenoic acid by the enzymatic conversion of 3-methyl-3-butenoyl-CoA into 3-methyl-3-butenoic acid.
[0509] 5. The method of item 4, wherein the enzymatic conversion of 3-methyl-3-butenoyl-CoA into 3-methyl-3-butenoic acid is achieved by
[0510] (a) a single enzymatic reaction in which 3-methyl-3-butenoyl-CoA is directly converted into 3-methyl-3-butenoic acid by making use of a CoA transferase (EC 2.8.3.-), preferably a propionate:acetate-CoA transferase (EC 2.8.3.1), an acetate CoA-transferase (EC 2.8.3.8) or a succinyl-CoA:acetate CoA-transferase (EC 2.8.3.18);
[0511] (b) a single enzymatic reaction in which 3-methyl-3-butenoyl-CoA is directly converted into 3-methyl-3-butenoic acid by making use of a thioester hydrolase (EC 3.1.2.-), preferably acetyl-CoA hydrolase (EC 3.1.2.1), an ADP-dependent short-chain-acyl-CoA hydrolase (EC 3.1.2.18) or an acyl-CoA hydrolase (EC 3.1.2.20);
[0512] (c) two enzymatic steps comprising
[0513] (i) first enzymatically converting 3-methyl-3-butenoyl-CoA into 3-methyl-3-butenoyl phosphate; and
[0514] (ii) then enzymatically converting the thus obtained 3-methyl-3-butenoyl phosphate into said 3-methyl-3-butenoic acid.
[0515] 6. The method of item 5(c), wherein the enzymatic conversion of said 3-methyl-3-butenoyl-CoA into 3-methyl-3-butenoyl phosphate is achieved by making use of a phosphate butyryltransferase (EC 2.3.1.19) or a phosphate acetyltransferase (EC 2.3.1.8) and the enzymatic conversion of said 3-methyl-3-butenoyl phosphate into said 3-methyl-3-butenoic acid is achieved by making use of a phosphotransferase with a carboxy group as acceptor (EC 2.7.2.-), preferably a propionate kinase (EC 2.7.2.15), an acetate kinase (EC 2.7.2.1), a butyrate kinase (EC 2.7.2.7) or a branched-chain-fatty-acid kinase (EC 2.7.2.14).
[0516] 7. The method of any one of items 1 to 4, further comprising providing the 3-methyl-3-butenoyl-CoA by the enzymatic conversion of 3-methylglutaconyl-CoA into 3-methyl-3-butenoyl-CoA.
[0517] 8. The method of item 7, wherein the enzymatic conversion of 3-methylglutaconyl-CoA into 3-methyl-3-butenoyl-CoA is achieved by making use of
[0518] (a) (i) a methylcrotonyl-CoA carboxylase (EC 6.4.1.4); or (ii) a geranoyl-CoA carboxylase (EC 6.4.1.5),
[0519] (b) an N-terminal domain of CurF from Lynbya majuscula multifunctional protein or a 3-methylglutaconyl-CoA decarboxylase, preferably a 3-methylglutaconyl-CoA decarboxylase of Myxococcus xanthus encoded by the liuB gene; or
[0520] (c) an enzyme of the 4-oxalocrotonate decarboxylase family.
[0521] 9. The method of any one of items 1 to 8, further comprising providing the 3-methylglutaconyl-CoA by the enzymatic conversion of 3-hydroxy-3-methylglutaryl-CoA into 3-methylglutaconyl-CoA.
[0522] 10. The method of item 9, wherein the enzymatic conversion of 3-hydroxy-3-methylglutaryl-CoA into 3-methylglutaconyl-CoA is achieved by making use of a 3-methylglutaconyl-coenzyme A hydratase (EC 4.2.1.18), a 3-hydroxyacyl-CoA dehydratase (EC 4.2.1.-) or an enoyl-CoA hydratase (EC 4.2.1.-).
[0523] 11. The method of any one of items 1 to 10, further comprising providing the 3-hydroxy-3-methylglutaryl-CoA by the enzymatic condensation of acetoacetyl-CoA and acetyl-CoA into 3-hydroxy-3-methylglutaryl-CoA.
[0524] 12. The method of item 11, wherein the enzymatic condensation of acetoacetyl-CoA and acetyl-CoA into 3-hydroxy-3-methylglutaryl-CoA is achieved by making use of a 3-hydroxy-3-methylglutaryl-CoA synthase.
[0525] 13. The method of any one of items 1 to 12, further comprising providing the acetoacetyl-CoA by the enzymatic conversion of acetyl-CoA into acetoacetyl-CoA comprising:
[0526] (a) two enzymatic steps comprising
[0527] (i) first the enzymatic conversion of acetyl-CoA into malonyl-CoA; and
[0528] (ii) then enzymatically condensing the thus obtained malonyl-CoA and acetyl-CoA into said acetoacetyl-CoA; or
[0529] (b) a single enzymatic reaction in which two molecules of acetyl-CoA are directly condensed into acetoacetyl-CoA.
[0530] 14. The method of item 13(a)(i), wherein the enzymatic conversion of acetyl-CoA into malonyl-CoA is achieved by making use of an acetyl-CoA carboxylase (EC 6.4.1.2).
[0531] 15. The method of item 13(a)(ii), wherein the enzymatic condensation of malonyl-CoA and acetyl-CoA into said acetoacetyl-CoA is achieved by making use of an acetoacetyl-CoA synthase (EC 2.3.1.194).
[0532] 16. The method of item 13(b), wherein the direct enzymatic condensation of two molecules of acetyl-CoA into acetoacetyl-CoA is achieved by making use of an acetyl-CoA C-acetyltransferase (EC 2.3.1.9).
[0533] 17. A recombinant organism or microorganism which expresses
[0534] (i) an enzyme as defined in any one of items 1 to 3; and
[0535] (ii) an enzyme as defined in any one of items 4 to 6.
[0536] 18. The recombinant organism or microorganism of item 17, further expressing an enzyme as defined in item 7 or 8.
[0537] 19. The recombinant organism or microorganism of item 18, further expressing an enzyme as defined in item 9 or 10.
[0538] 20. The recombinant organism or microorganism of item 19, further expressing an enzyme as defined in item 11 or 12.
[0539] 21. The recombinant organism or microorganism of item 20, further expressing an enzyme as defined in claim 13.
[0540] 22. The recombinant organism or microorganism of item 21, further expressing an enzyme as defined in any one of claims 14 to 16.
[0541] 23. Use of a recombinant organism or microorganism as defined in any one of items 17 to 22 for the production of isobutene.
[0542] 24. The use of a recombinant organism or microorganism of item 23, wherein said recombinant organism or microorganism expresses an enzyme catalyzing the enzymatic conversion of 3-methyl-3-butenoic acid into isobutene.
[0543] 25. Use of an enzyme catalyzing the enzymatic conversion of 3-methyl-3-butenoic acid into isobutene for the production of isobutene from 3-methyl-3-butenoic acid.
[0544] 26. A composition comprising 3-methyl-3-butenoic acid and a recombinant organism or microorganism as defined in any one of items 17 to 22; or 3-methyl-3-butenoic acid and an enzyme as defined in any one of items 1 to 16.
[0545] A method according to the present invention may be carried out in vitro or in vivo. An in vitro reaction is understood to be a reaction in which no cells are employed, i.e. an acellular reaction. Thus, in vitro preferably means in a cell-free system. The term "in vitro" in one embodiment means in the presence of isolated enzymes (or enzyme systems optionally comprising possibly required cofactors). In one embodiment, the enzymes employed in the method are used in purified form.
[0546] For carrying out the method in vitro the substrates for the reaction and the enzymes are incubated under conditions (buffer, temperature, cosubstrates, cofactors etc.) allowing the enzymes to be active and the enzymatic conversion to occur. The reaction is allowed to proceed for a time sufficient to produce the respective product. The production of the respective products can be measured by methods known in the art, such as gas chromatography possibly linked to mass spectrometry detection.
[0547] The enzymes may be in any suitable form allowing the enzymatic reaction to take place. They may be purified or partially purified or in the form of crude cellular extracts or partially purified extracts. It is also possible that the enzymes are immobilized on a suitable carrier.
[0548] In another embodiment the method according to the invention is carried out in culture, in the presence of an organism, preferably a microorganism, producing the enzymes described above for the conversions of the methods according to the present invention as described herein above. A method which employs a microorganism for carrying out a method according to the invention is referred to as an "in vivo" method. It is possible to use a microorganism which naturally produces the enzymes described above for the conversions of the methods according to the present invention or a microorganism which had been genetically modified so that it expresses (including overexpresses) one or more of such enzymes. Thus, the microorganism can be an engineered microorganism which expresses enzymes described above for the conversions of the methods according to the present invention, i.e. which has in its genome a nucleotide sequence encoding such enzymes and which has been modified to overexpress them. The expression may occur constitutively or in an induced or regulated manner.
[0549] In another embodiment the microorganism can be a microorganism which has been genetically modified by the introduction of one or more nucleic acid molecules containing nucleotide sequences encoding one or more enzymes described above for the conversions of the methods according to the present invention. The nucleic acid molecule can be stably integrated into the genome of the microorganism or may be present in an extrachromosomal manner, e.g. on a plasmid.
[0550] Such a genetically modified microorganism can, e.g., be a microorganism that does not naturally express enzymes described above for the conversions of the methods according to the present invention and which has been genetically modified to express such enzymes or a microorganism which naturally expresses such enzymes and which has been genetically modified, e.g. transformed with a nucleic acid, e.g. a vector, encoding the respective enzyme(s), and/or insertion of a promoter in front of the endogenous nucleotide sequence encoding the enzyme in order to increase the respective activity in said microorganism.
[0551] However, the invention preferably excludes naturally occurring microorganisms as found in nature expressing an enzyme as described above at levels as they exist in nature. Instead, the microorganism of the present invention and employed in a method of the present invention is preferably a non-naturally occurring microorganism, whether it has been genetically modified to express (including overexpression) an exogenous enzyme of the invention not normally existing in its genome or whether it has been engineered to overexpress an exogenous enzyme.
[0552] Thus, the enzymes and (micro)organisms employed in connection with the present invention are preferably non-naturally occurring enzymes or (micro)organisms, i.e. they are enzymes or (micro)organisms which differ significantly from naturally occurring enzymes or microorganism and which do not occur in nature. As regards the enzymes, they are preferably variants of naturally occurring enzymes which do not as such occur in nature. Such variants include, for example, mutants, in particular prepared by molecular biological methods, which show improved properties, such as a higher enzyme activity, higher substrate specificity, higher temperature resistance and the like. As regards the (micro)organisms, they are preferably genetically modified organisms as described herein above which differ from naturally occurring organisms due to a genetic modification. Genetically modified organisms are organisms which do not naturally occur, i.e., which cannot be found in nature, and which differ substantially from naturally occurring organisms due to the introduction of a foreign nucleic acid molecule.
[0553] By overexpressing an exogenous or endogenous enzyme as described herein above, the concentration of the enzyme is substantially higher than what is found in nature, which can then unexpectedly force the reaction of the present invention which uses a non-natural for the respective enzyme. Preferably, the concentration of the overexpressed enzyme is at least 5%, 10%, 20%, 30% or 40% of the total host cell protein.
[0554] A "non-natural" substrate is understood to be a molecule that is not acted upon by the respective enzyme in nature, even though it may actually coexist in the microorganism along with the endogenous enzyme. This "non-natural" substrate is not converted by the microorganism in nature as other substrates are preferred (e.g. the "natural substrate"). Thus, the present invention contemplates utilizing a non-natural substrate with the enzymes described above in an environment not found in nature.
[0555] Thus, it is also possible in the context of the present invention that the microorganism is a microorganism which naturally does not have the respective enzyme activity but which is genetically modified so as to comprise a nucleotide sequence allowing the expression of a corresponding enzyme. Similarly, the microorganism may also be a microorganism which naturally has the respective enzyme activity but which is genetically modified so as to enhance such an activity, e.g. by the introduction of an exogenous nucleotide sequence encoding a corresponding enzyme or by the introduction of a promoter for the endogenous gene encoding the enzyme to increase endogenous production to overexpressed (non-natural) levels.
[0556] If a microorganism is used which naturally expresses a corresponding enzyme, it is possible to modify such a microorganism so that the respective activity is overexpressed in the microorganism. This can, e.g., be achieved by effecting mutations in the promoter region of the corresponding gene or introduction of a high expressing promoter so as to lead to a promoter which ensures a higher expression of the gene. Alternatively, it is also possible to mutate the gene as such so as to lead to an enzyme showing a higher activity.
[0557] By using microorganisms which express enzymes described above for the conversions of the methods according to the present invention, it is possible to carry out the methods according to the invention directly in the culture medium, without the need to separate or purify the enzymes.
[0558] In one embodiment the organism employed in a method according to the invention is a microorganism which has been genetically modified to contain a foreign nucleic acid molecule encoding at least one enzyme described above for the conversions of the methods according to the present invention. The term "foreign" or "exogenous" in this context means that the nucleic acid molecule does not naturally occur in said microorganism. This means that it does not occur in the same structure or at the same location in the microorganism. In one preferred embodiment, the foreign nucleic acid molecule is a recombinant molecule comprising a promoter and a coding sequence encoding the respective enzyme in which the promoter driving expression of the coding sequence is heterologous with respect to the coding sequence. "Heterologous" in this context means that the promoter is not the promoter naturally driving the expression of said coding sequence but is a promoter naturally driving expression of a different coding sequence, i.e., it is derived from another gene, or is a synthetic promoter or a chimeric promoter. Preferably, the promoter is a promoter heterologous to the microorganism, i.e. a promoter which does naturally not occur in the respective microorganism. Even more preferably, the promoter is an inducible promoter. Promoters for driving expression in different types of organisms, in particular in microorganisms, are well known to the person skilled in the art.
[0559] In a further embodiment the nucleic acid molecule is foreign to the microorganism in that the encoded enzyme is not endogenous to the microorganism, i.e. is naturally not expressed by the microorganism when it is not genetically modified. In other words, the encoded enzyme is heterologous with respect to the microorganism. The foreign nucleic acid molecule may be present in the microorganism in extrachromosomal form, e.g. as a plasmid, or stably integrated in the chromosome. A stable integration is preferred. Thus, the genetic modification can consist, e.g. in integrating the corresponding gene(s) encoding the enzyme(s) into the chromosome, or in expressing the enzyme(s) from a plasmid containing a promoter upstream of the enzyme-coding sequence, the promoter and coding sequence preferably originating from different organisms, or any other method known to one of skill in the art.
[0560] The term "microorganism" in the context of the present invention refers to bacteria, as well as to fungi, such as yeasts, and also to algae and archaea. In one preferred embodiment, the microorganism is a bacterium. In principle any bacterium can be used. Preferred bacteria to be employed in the process according to the invention are bacteria of the genus Bacillus, Clostridium, Corynebacterium, Pseudomonas, Zymomonas or Escherichia. In a particularly preferred embodiment the bacterium belongs to the genus Escherichia and even more preferred to the species Escherichia coli. In another preferred embodiment the bacterium belongs to the species Pseudomonas putida or to the species Zymomonas mobilis or to the species Corynebacterium glutamicum or to the species Bacillus subtilis.
[0561] It is also possible to employ an extremophilic bacterium such as Thermus thermophilus, or anaerobic bacteria from the family Clostridiae.
[0562] In another preferred embodiment the microorganism is a fungus, more preferably a fungus of the genus Saccharomyces, Schizosaccharomyces, Aspergillus, Trichoderma, Kluyveromyces or Pichia and even more preferably of the species Saccharomyces cerevisiae, Schizosaccharomyces pombe, Aspergillus niger, Trichoderma reesei, Kluyveromyces marxianus, Kluyveromyces lactis, Pichia pastoris, Pichia torula or Pichia utilis.
[0563] In another embodiment, the method according to the invention makes use of a photosynthetic microorganism expressing at least one enzyme for the conversion according to the invention as described above. Preferably, the microorganism is a photosynthetic bacterium, or a microalgae. In a further embodiment the microorganism is an algae, more preferably an algae belonging to the diatomeae.
[0564] It is also conceivable to use in the method according to the invention a combination of microorganisms wherein different microorganisms express different enzymes as described above. The genetic modification of microorganisms to express an enzyme of interest will also be further described in detail below.
[0565] In a preferred embodiment, the method of the present invention makes use of an organism, preferably a microorganism, which is genetically modified in order to avoid the leakage of acetyl-CoA, thereby increasing the intracellular concentration of acetyl-CoA. Genetic modifications leading to an increase in the intracellular concentration of acetyl-CoA are known in the art. Without being bound to theory, such an organism, preferably a microorganism, may preferably be genetically modified by deleting or inactivating the following genes:
[0566] .DELTA.ackA (acetate kinase), .DELTA.ldh (lactate dehydrogenase), .DELTA.adhE (alcohol dehydrogenase), .DELTA.frdB and/or .DELTA.frdC (fumarate reductase and fumarate dehydrogenase).
[0567] Alternatively, or in addition to any of the above deletions, the organism or microorganism may genetically be modified by overexpressing the gene panK/coaA encoding Pantothenate kinase, thereby increasing the CoA/acetyl-CoA intracellular pool.
[0568] These modifications which avoid the leakage of acetyl-CoA are known in the art and corresponding modified organisms have been used in methods for the bioconversion of exogenous isoamyl alcohol into isoamyl acetate by an E. coli strain expressing ATF2 (Metab. Eng. 6 (2004), 294-309).
[0569] In another embodiment, the method of the invention comprises the step of providing the organism, preferably the microorganism carrying the respective enzyme activity or activities in the form of a (cell) culture, preferably in the form of a liquid cell culture, a subsequent step of cultivating the organism, preferably the microorganism in a fermenter (often also referred to a bioreactor) under suitable conditions allowing the expression of the respective enzyme and further comprising the step of effecting an enzymatic conversion of a method of the invention as described herein above. Suitable fermenter or bioreactor devices and fermentation conditions are known to the person skilled in the art. A bioreactor or a fermenter refers to any manufactured or engineered device or system known in the art that supports a biologically active environment. Thus, a bioreactor or a fermenter may be a vessel in which a chemical/biochemical like the method of the present invention is carried out which involves organisms, preferably microorganisms and/or biochemically active substances, i.e., the enzyme(s) described above derived from such organisms or organisms harbouring the above described enzyme(s). In a bioreactor or a fermenter, this process can either be aerobic or anaerobic. These bioreactors are commonly cylindrical, and may range in size from litres to cubic metres, and are often made of stainless steel. In this respect, without being bound by theory, the fermenter or bioreactor may be designed in a way that it is suitable to cultivate the organisms, preferably microorganisms, in, e.g., a batch-culture, feed-batch-culture, perfusion culture or chemostate-culture, all of which are generally known in the art.
[0570] The culture medium can be any culture medium suitable for cultivating the respective organism or microorganism.
[0571] In a preferred embodiment the method according to the present invention also comprises the step of recovering the isobutene produced by the method. For example, if the method according to the present invention is carried out in vivo by fermenting a corresponding microorganism expressing the necessary enzymes, the isobutene can be recovered from the fermentation off-gas by methods known to the person skilled in the art.
[0572] In a preferred embodiment, the present invention relates to a method as described herein above in which a microorganism as described herein above is employed, wherein the microorganism is capable of enzymatically converting 3-methylcrotonic acid into isobutene, wherein said method comprises culturing the microorganism in a culture medium.
[0573] The enzymes used in the method according to the invention can be naturally occurring enzymes or enzymes which are derived from a naturally occurring enzymes, e.g. by the introduction of mutations or other alterations which, e.g., alter or improve the enzymatic activity, the stability, etc.
[0574] Methods for modifying and/or improving the desired enzymatic activities of proteins are well-known to the person skilled in the art and include, e.g., random mutagenesis or site-directed mutagenesis and subsequent selection of enzymes having the desired properties or approaches of the so-called "directed evolution".
[0575] For example, for genetic modification in prokaryotic cells, a nucleic acid molecule encoding a corresponding enzyme can be introduced into plasmids which permit mutagenesis or sequence modification by recombination of DNA sequences. Standard methods (see Sambrook and Russell (2001), Molecular Cloning: A Laboratory Manual, CSH Press, Cold Spring Harbor, N.Y., USA) allow base exchanges to be performed or natural or synthetic sequences to be added. DNA fragments can be ligated by using adapters and linkers complementary to the fragments. Moreover, engineering measures which provide suitable restriction sites or remove surplus DNA or restriction sites can be used. In those cases, in which insertions, deletions or substitutions are possible, in vitro mutagenesis, "primer repair", restriction or ligation can be used. In general, a sequence analysis, restriction analysis and other methods of biochemistry and molecular biology are carried out as analysis methods. The resulting enzyme variants are then tested for the desired activity, e.g., enzymatic activity, with an assay as described above and in particular for their increased enzyme activity.
[0576] As described above, the microorganism employed in a method of the invention or contained in the composition of the invention may be a microorganism which has been genetically modified by the introduction of a nucleic acid molecule encoding a corresponding enzyme. Thus, in a preferred embodiment, the microorganism is a recombinant microorganism which has been genetically modified to have an increased activity of at least one enzyme described above for the conversions of the method according to the present invention. This can be achieved e.g. by transforming the microorganism with a nucleic acid encoding a corresponding enzyme. A detailed description of genetic modification of microorganisms will be given further below. Preferably, the nucleic acid molecule introduced into the microorganism is a nucleic acid molecule which is heterologous with respect to the microorganism, i.e. it does not naturally occur in said microorganism.
[0577] In the context of the present invention, an "increased activity" means that the expression and/or the activity of an enzyme in the genetically modified microorganism is at least 10%, preferably at least 20%, more preferably at least 30% or 50%, even more preferably at least 70% or 80% and particularly preferred at least 90% or 100% higher than in the corresponding non-modified microorganism. In even more preferred embodiments the increase in expression and/or activity may be at least 150%, at least 200% or at least 500%. In particularly preferred embodiments the expression is at least 10-fold, more preferably at least 100-fold and even more preferred at least 1000-fold higher than in the corresponding non-modified microorganism.
[0578] The term "increased" expression/activity also covers the situation in which the corresponding non-modified microorganism does not express a corresponding enzyme so that the corresponding expression/activity in the non-modified microorganism is zero. Preferably, the concentration of the overexpressed enzyme is at least 5%, 10%, 20%, 30%, or 40% of the total host cell protein.
[0579] Methods for measuring the level of expression of a given protein in a cell are well known to the person skilled in the art. In one embodiment, the measurement of the level of expression is done by measuring the amount of the corresponding protein. Corresponding methods are well known to the person skilled in the art and include Western Blot, ELISA etc. In another embodiment the measurement of the level of expression is done by measuring the amount of the corresponding RNA. Corresponding methods are well known to the person skilled in the art and include, e.g., Northern Blot.
[0580] In the context of the present invention the term "recombinant" means that the microorganism is genetically modified so as to contain a nucleic acid molecule encoding an enzyme as defined above as compared to a wild-type or non-modified microorganism. A nucleic acid molecule encoding an enzyme as defined above can be used alone or as part of a vector.
[0581] The nucleic acid molecules can further comprise expression control sequences operably linked to the polynucleotide comprised in the nucleic acid molecule. The term "operatively linked" or "operably linked", as used throughout the present description, refers to a linkage between one or more expression control sequences and the coding region in the polynucleotide to be expressed in such a way that expression is achieved under conditions compatible with the expression control sequence.
[0582] Expression comprises transcription of the heterologous DNA sequence, preferably into a translatable mRNA. Regulatory elements ensuring expression in fungi as well as in bacteria, are well known to those skilled in the art. They encompass promoters, enhancers, termination signals, targeting signals and the like. Examples are given further below in connection with explanations concerning vectors.
[0583] Promoters for use in connection with the nucleic acid molecule may be homologous or heterologous with regard to its origin and/or with regard to the gene to be expressed. Suitable promoters are for instance promoters which lend themselves to constitutive expression. However, promoters which are only activated at a point in time determined by external influences can also be used. Artificial and/or chemically inducible promoters may be used in this context.
[0584] The vectors can further comprise expression control sequences operably linked to said polynucleotides contained in the vectors. These expression control sequences may be suited to ensure transcription and synthesis of a translatable RNA in bacteria or fungi.
[0585] In addition, it is possible to insert different mutations into the polynucleotides by methods usual in molecular biology (see for instance Sambrook and Russell (2001), Molecular Cloning: A Laboratory Manual, CSH Press, Cold Spring Harbor, N.Y., USA), leading to the synthesis of polypeptides possibly having modified biological properties. The introduction of point mutations is conceivable at positions at which a modification of the amino acid sequence for instance influences the biological activity or the regulation of the polypeptide.
[0586] Moreover, mutants possessing a modified substrate or product specificity can be prepared. Preferably, such mutants show an increased activity. Alternatively, mutants can be prepared the catalytic activity of which is abolished without losing substrate binding activity.
[0587] Furthermore, the introduction of mutations into the polynucleotides encoding an enzyme as defined above allows the gene expression rate and/or the activity of the enzymes encoded by said polynucleotides to be reduced or increased.
[0588] For genetically modifying bacteria or fungi, the polynucleotides encoding an enzyme as defined above or parts of these molecules can be introduced into plasmids which permit mutagenesis or sequence modification by recombination of DNA sequences. Standard methods (see Sambrook and Russell (2001), Molecular Cloning: A Laboratory Manual, CSH Press, Cold Spring Harbor, N.Y., USA) allow base exchanges to be performed or natural or synthetic sequences to be added. DNA fragments can be connected to each other by applying adapters and linkers to the fragments. Moreover, engineering measures which provide suitable restriction sites or remove surplus DNA or restriction sites can be used. In those cases, in which insertions, deletions or substitutions are possible, in vitro mutagenesis, "primer repair", restriction or ligation can be used. In general, a sequence analysis, restriction analysis and other methods of biochemistry and molecular biology are carried out as analysis methods.
[0589] Thus, in accordance with the present invention a recombinant microorganism can be produced by genetically modifying fungi or bacteria comprising introducing the above-described polynucleotides, nucleic acid molecules or vectors into a fungus or bacterium.
[0590] The polynucleotide encoding the respective enzyme is expressed so as to lead to the production of a polypeptide having any of the activities described above. An overview of different expression systems is for instance contained in Methods in Enzymology 153 (1987), 385-516, in Bitter et al. (Methods in Enzymology 153 (1987), 516-544) and in Sawers et al. (Applied Microbiology and Biotechnology 46 (1996), 1-9), Billman-Jacobe (Current Opinion in Biotechnology 7 (1996), 500-4), Hockney (Trends in Biotechnology 12 (1994), 456-463), Griffiths et al., (Methods in Molecular Biology 75 (1997), 427-440). An overview of yeast expression systems is for instance given by Hensing et al. (Antonie van Leuwenhoek 67 (1995), 261-279), Bussineau et al. (Developments in Biological Standardization 83 (1994), 13-19), Gellissen et al. (Antonie van Leuwenhoek 62 (1992), 79-93, Fleer (Current Opinion in Biotechnology 3 (1992), 486-496), Vedvick (Current Opinion in Biotechnology 2 (1991), 742-745) and Buckholz (Bio/Technology 9 (1991), 1067-1072).
[0591] Expression vectors have been widely described in the literature. As a rule, they contain not only a selection marker gene and a replication-origin ensuring replication in the host selected, but also a bacterial or viral promoter, and in most cases a termination signal for transcription. Between the promoter and the termination signal there is in general at least one restriction site or a polylinker which enables the insertion of a coding DNA sequence. The DNA sequence naturally controlling the transcription of the corresponding gene can be used as the promoter sequence, if it is active in the selected host organism. However, this sequence can also be exchanged for other promoter sequences. It is possible to use promoters ensuring constitutive expression of the gene and inducible promoters which permit a deliberate control of the expression of the gene. Bacterial and viral promoter sequences possessing these properties are described in detail in the literature. Regulatory sequences for the expression in microorganisms (for instance E. coli, S. cerevisiae) are sufficiently described in the literature. Promoters permitting a particularly high expression of a downstream sequence are for instance the T7 promoter (Studier et al., Methods in Enzymology 185 (1990), 60-89), lacUV5, trp, trp-lacUV5 (DeBoer et al., in Rodriguez and Chamberlin (Eds), Promoters, Structure and Function; Praeger, New York, (1982), 462-481; DeBoer et al., Proc. Natl. Acad. Sci. USA (1983), 21-25), Ip1, rac (Boros et al., Gene 42 (1986), 97-100). Inducible promoters are preferably used for the synthesis of polypeptides. These promoters often lead to higher polypeptide yields than do constitutive promoters. In order to obtain an optimum amount of polypeptide, a two-stage process is often used. First, the host cells are cultured under optimum conditions up to a relatively high cell density. In the second step, transcription is induced depending on the type of promoter used. In this regard, a tac promoter is particularly suitable which can be induced by lactose or IPTG (=isopropyl-B-D-thiogalactopyranoside) (deBoer et al., Proc. Natl. Acad. Sci. USA 80 (1983), 21-25). Termination signals for transcription are also described in the literature.
[0592] The transformation of the host cell with a polynucleotide or vector as described above can be carried out by standard methods, as for instance described in Sambrook and Russell (2001), Molecular Cloning: A Laboratory Manual, CSH Press, Cold Spring Harbor, N.Y., USA; Methods in Yeast Genetics, A Laboratory Course Manual, Cold Spring Harbor Laboratory Press, 1990. The host cell is cultured in nutrient media meeting the requirements of the particular host cell used, in particular in respect of the pH value, temperature, salt concentration, aeration, antibiotics, vitamins, trace elements etc.
[0593] Recombinant Organisms or Microorganisms Expressing Enzymes of Step I and Step II, and Optionally Further Expressing Enzymes of Step III, Step IV and Step V as Well as Optionally Further Expressing Enzymes of Steps XIII, XIV and XV
[0594] The present invention also relates to a recombinant organism or microorganism which expresses (i) an enzyme capable of enzymatically converting 3-methylcrotonic acid into isobutene (step I as shown in FIG. 1); and (ii) an enzyme capable of enzymatically converting 3-hydroxyisovalerate (HIV) into 3-methylcrotonic acid (step II as shown in FIG. 1).
[0595] In a preferred embodiment, the enzyme capable of converting 3-methylcrotonic acid into isobutene is a 3-methylcrotonic acid decarboxylase as defined herein above. More preferably, the 3-methylcrotonic acid decarboxylase is
[0596] (i) an FMN-dependent decarboxylase associated with an FMN prenyl transferase; or
[0597] (ii) an aconitate decarboxylase (EC 4.1.1.6); or
[0598] (iii) a methylcrotonyl-CoA carboxylase (EC 6.4.1.4); or
[0599] (iv) a geranoyl-CoA carboxylase (EC 6.4.1.5); or
[0600] (v) a protocatechuate (PCA) decarboxylase (EC 4.1.1.63) as defined herein above.
[0601] In another preferred embodiment, this recombinant organism or microorganism is a recombinant organism or microorganism, wherein the 3-methylcrotonic acid decarboxylase is selected from the group consisting of: 6-methylsalicylate decarboxylase (EC 4.1.1.52), 2-oxo-3-hexenedioate decarboxylase (EC 4.1.1.77) and 5-oxopent-3-ene-1,2,5-tricarboxylate decarboxylase (EC 4.1.1.68).
[0602] As regards the 3-methylcrotonic acid decarboxylase, the FMN-dependent decarboxylase, the associated FMN prenyl transferase, the aconitate decarboxylase (EC 4.1.1.6), the methylcrotonyl-CoA carboxylase (EC 6.4.1.4), and the geranoyl-CoA carboxylase (EC 6.4.1.5) as well as preferred embodiments of said 3-methylcrotonic acid decarboxylase, said protocatechuate (PCA) decarboxylase (EC 4.1.1.63), said FMN-dependent decarboxylase, said associated FMN prenyl transferase, said aconitate decarboxylase (EC 4.1.1.6), said methylcrotonyl-CoA carboxylase (EC 6.4.1.4) and said geranoyl-CoA carboxylase (EC 6.4.1.5), as well as said 6-methylsalicylate decarboxylase (EC 4.1.1.52), 2-oxo-3-hexenedioate decarboxylase (EC 4.1.1.77) and 5-oxopent-3-ene-1,2,5-tricarboxylate decarboxylase (EC 4.1.1.68), the same applies to the recombinant organism or microorganism as has been set forth above for the methods according to the present invention.
[0603] In a preferred embodiment, the recombinant organism or microorganism which expresses (i) an enzyme capable of enzymatically converting 3-methylcrotonic acid into isobutene (step I as shown in FIG. 1); and (ii) an enzyme capable of enzymatically converting 3-hydroxyisovalerate (HIV) into 3-methylcrotonic acid (step II as shown in FIG. 1) is a recombinant organism or microorganism, wherein the enzyme capable of enzymatically converting 3-hydroxyisovalerate (HIV) into 3-methylcrotonic acid is a hydro-lyase (EC 4.2.-.-) as defined herein above, preferably an aconitase (EC 4.2.1.3), a fumarase (EC 4.2.1.2) or an enoyl-CoA hydratase/dehydratease (EC 4.2.1.17) as defined herein above.
[0604] As regards the hydro-lyase (EC 4.2.-.-), the aconitase (EC 4.2.1.3), the fumarase (EC 4.2.1.2) and the enoyl-CoA hydratase/dehydratease (EC 4.2.1.17) as well as the preferred embodiments of said hydro-lyase (EC 4.2.-.-), said aconitase (EC 4.2.1.3), said fumarase (EC 4.2.1.2) and said enoyl-CoA hydratase/dehydratease (EC 4.2.1.17) the same applies to the recombinant organism or microorganism as has been set forth above for the methods according to the present invention.
[0605] In a further aspect, the above recombinant organism or microorganism is an organism or microorganism which further expresses an enzyme capable of enzymatically condensing acetone and acetyl-CoA into 3-hydroxyisovalerate (HIV) (step III as shown in FIG. 1). In a preferred embodiment, the enzyme capable of enzymatically condensing acetone and acetyl-CoA into 3-hydroxyisovalerate (HIV) is a HMG CoA synthase (EC 2.3.3.10) or a PksG protein or an enzyme with the activity of a C-C bond cleavage/condensation lyase, such as a HMG CoA lyase (EC 4.1.3.4) as defined herein above.
[0606] As regards the HMG CoA synthase (EC 2.3.3.10), the PksG protein, the enzyme with the activity of a C-C bond cleavage/condensation lyase and the HMG CoA lyase (EC 4.1.3.4) as well as the preferred embodiments of said enzymes the same applies to the recombinant organism or microorganism as has been set forth above for the methods according to the present invention.
[0607] In a further aspect, the above recombinant organism or microorganism is an organism or microorganism which further expresses an enzyme capable of enzymatically converting acetoacetate into acetone (step IV as shown in FIG. 1), preferably an acetoacetate decarboxylase (EC 4.1.1.4) as described herein above.
[0608] As regards said enzyme capable of enzymatically converting acetoacetate into acetone and said acetoacetate decarboxylase (EC 4.1.1.4) as well as preferred embodiments of said enzymes, the same applies to the recombinant organism or microorganism as has been set forth above for the methods according to the present invention.
[0609] In a further aspect, the above recombinant organism or microorganism is an organism or microorganism which further expresses an enzyme capable of converting acetoacetyl-CoA into acetoacetate (step Va or Vb as shown in FIG. 1), preferably
[0610] (i) an acetoacetyl-CoA hydrolase (EC 3.1.2.11); or
[0611] (ii) an enzyme which is capable of transferring the CoA group of acetoacetyl-CoA on acetate
[0612] as described herein above.
[0613] In a preferred embodiment, the enzyme capable of transferring the CoA group of acetoacetyl-CoA on acetate is a CoA transferase (EC 2.8.3.-), preferably an acetate CoA transferase (EC 2.8.3.8) as described herein above.
[0614] As regards said enzyme which is capable of converting acetoacetyl-CoA into acetoacetate, said acetoacetyl-CoA hydrolase (EC 3.1.2.11), said enzyme which is capable of transferring the CoA group of acetoacetyl-CoA, the CoA transferase (EC 2.8.3.-) and said acetate CoA transferase (EC 2.8.3.8) as well as the preferred embodiments of said enzymes, the same applies to the recombinant organism or microorganism as has been set forth above for the methods according to the present invention.
[0615] In a further aspect, the above recombinant organism or microorganism is an organism or microorganism which further expresses an enzyme capable of enzymatically converting acetyl-CoA into acetoacetyl-CoA comprising
[0616] (a) (i) an enzyme capable of converting acetyl-CoA into malonyl-CoA (step XIV as shown in FIG. 1); and
[0617] (ii) an enzyme capable of condensing malonyl-CoA and acetyl-CoA into acetoacetyl-CoA (step XV as shown in FIG. 1); or
[0618] (b) an enzyme capable of directly condensing two molecules of acetyl-CoA into acetoacetyl-CoA (step XIII as shown in FIG. 1).
[0619] In a preferred embodiment, the enzyme capable of converting acetyl-CoA into malonyl-CoA is an acetyl-CoA carboxylase (EC 6.4.1.2) as described herein above.
[0620] In another preferred embodiment, the enzyme capable of condensing malonyl-CoA and acetyl-CoA into acetoacetyl-CoA is an acetoacetyl-CoA synthetase (EC 2.3.1.194) as described herein above.
[0621] In a preferred embodiment, the enzyme capable of directly condensing two molecules of acetyl-CoA into acetoacetyl-CoA is an acetyl-CoA C-acetyltransferase (EC 2.3.1.9) as described herein above.
[0622] As regards the enzyme which is capable of converting acetyl-CoA into malonyl-CoA, the enzyme capable of condensing malonyl-CoA and acetyl-CoA into acetoacetyl-CoA, the acetyl-CoA carboxylase (EC 6.4.1.2), the acetoacetyl-CoA synthetase (EC 2.3.1.194), the enzyme capable of directly condensing two molecules of acetyl-CoA into acetoacetyl-CoA and the acetyl-CoA C-acetyltransferase (EC 2.3.1.9) as well as the preferred embodiments of said enzymes, the same applies to the recombinant organism or microorganism as has been set forth above for the methods according to the present invention.
[0623] Recombinant Organisms or Microorganisms Expressing Enzymes of Step I and Step VI, and Optionally Further Expressing Enzymes of Step VII, Step VIII and Step IX as Well as Optionally Further Expressing Enzymes of Steps XIII, XIV and XV
[0624] The present invention also relates to a recombinant organism or microorganism which expresses (i) an enzyme capable of enzymatically converting 3-methylcrotonic acid into isobutene (step I as shown in FIG. 1); and (ii) an enzyme capable of enzymatically converting 3-methylcrotonyl-CoA into 3-methylcrotonic acid (step VIa, VIb or VIc as shown in FIG. 1).
[0625] In a preferred embodiment, the enzyme capable of converting 3-methylcrotonic acid into isobutene is a 3-methylcrotonic acid decarboxylase, preferably
[0626] (i) an FMN-dependent decarboxylase associated with an FMN prenyl transferase; or
[0627] (ii) an aconitate decarboxylase (EC 4.1.1.6); or
[0628] (iii) a methylcrotonyl-CoA carboxylase (EC 6.4.1.4); or
[0629] (iv) a geranoyl-CoA carboxylase (EC 6.4.1.5); or
[0630] (v) a protocatechuate (PCA) decarboxylase (EC 4.1.1.63) as defined herein above.
[0631] As regards the 3-methylcrotonic acid decarboxylase, the FMN-dependent decarboxylase, the associated FMN prenyl transferase, the aconitate decarboxylase (EC 4.1.1.6), the methylcrotonyl-CoA carboxylase (EC 6.4.1.4), the (v) protocatechuate (PCA) decarboxylase (EC 4.1.1.63) and the geranoyl-CoA carboxylase (EC 6.4.1.5) as well as preferred embodiments of said enzymes, the same applies to the recombinant organism or microorganism as has been set forth above for the methods according to the present invention.
[0632] In a preferred embodiment, the enzyme capable of enzymatically converting 3-methylcrotonyl-CoA into 3-methylcrotonic acid is
[0633] (a) an enzyme capable of directly converting 3-methylcrotonyl-CoA into 3-methylcrotonic acid wherein said enzyme capable of directly converting 3-methylcrotonyl-CoA into 3-methylcrotonic acid is a CoA transferase (EC 2.8.3.-), preferably a propionate:acetate-CoA transferase (EC 2.8.3.1), an acetate CoA-transferase (EC 2.8.3.8) or a succinyl-CoA:acetate CoA-transferase (EC 2.8.3.18) (step VIa as shown in FIG. 1) as described herein above; or
[0634] (b) an enzyme capable of directly converting 3-methylcrotonyl-CoA into 3-methylcrotonic acid wherein said enzyme capable of directly converting 3-methylcrotonyl-CoA into 3-methylcrotonic acid is a thioester hydrolase (EC 3.1.2.-), preferably acetyl-CoA hydrolase (EC 3.1.2.1), an ADP-dependent short-chain-acyl-CoA hydrolase (EC 3.1.2.18) or an acyl-CoA hydrolase (EC 3.1.2.20) (step VIb as shown in FIG. 1) as described herein above.
[0635] In another preferred embodiment, the recombinant organism or microorganism is a recombinant organism or microorganism which expresses the following two enzymes, namely
[0636] (c) (i) an enzyme capable of enzymatically converting 3-methylcrotonyl-CoA into 3-methylcrotonyl phosphate as described herein above; and
[0637] (ii) an enzyme capable of converting 3-methylcrotonyl phosphate into 3-methylcrotonic acid (step VIc as shown in FIG. 1) as described herein above.
[0638] In a preferred embodiment, the enzyme capable of converting 3-methylcrotonyl-CoA into 3-methylcrotonyl phosphate is a phosphate butyryltransferase (EC 2.3.1.19) or a phosphate acetyltransferase (EC 2.3.1.8) and the enzyme capable of converting 3-methylcrotonyl phosphate into 3-methylcrotonic acid is a phosphotransferase with a carboxy group as acceptor (EC 2.7.2.-), preferably a propionate kinase (EC 2.7.2.15), an acetate kinase (EC 2.7.2.1), a butyrate kinase (EC 2.7.2.7) or a branched-chain-fatty-acid kinase (EC 2.7.2.14) as described herein above.
[0639] As regards the above-mentioned enzymes, the same applies to the recombinant organism or microorganism as has been set forth above for the methods according to the present invention.
[0640] In a further aspect, the above recombinant organism or microorganism is an organism or microorganism which further expresses an enzyme capable of enzymatically converting 3-methylglutaconyl-CoA into 3-methylcrotonyl-CoA (step VII as shown in FIG. 1), preferably (i) a methylcrotonyl-CoA carboxylase (EC 6.4.1.4); or (ii) a geranoyl-CoA carboxylase (EC 6.4.1.5) as described herein above.
[0641] As regards said enzymes as well as preferred embodiments of said enzymes, the same applies to the recombinant organism or microorganism as has been set forth above for the methods according to the present invention.
[0642] In a further aspect, the above recombinant organism or microorganism is an organism or microorganism which further expresses an enzyme capable of enzymatically converting 3-hydroxy-3-methylglutaryl-CoA into 3-methylglutaconyl-CoA (step VIII as shown in FIG. 1), preferably a 3-methylglutaconyl-coenzyme A hydratase (EC 4.2.1.18), a 3-hydroxyacyl-CoA dehydratase (EC 4.2.1.-) or an enoyl-CoA hydratase (EC 4.2.1.-).
[0643] As regards said enzyme as well as preferred embodiments of said enzymes, the same applies to the recombinant organism or microorganism as has been set forth above for the methods according to the present invention.
[0644] In a further aspect, the above recombinant organism or microorganism is an organism or microorganism which further expresses an enzyme capable of enzymatically condensing acetoacetyl-CoA and acetyl-CoA into 3-hydroxy-3-methylglutaryl-CoA (step IX as shown in FIG. 1), preferably a 3-hydroxy-3-methylglutaryl-CoA synthase.
[0645] As regards said enzyme as well as preferred embodiments of said enzyme, the same applies to the recombinant organism or microorganism as has been set forth above for the methods according to the present invention.
[0646] In a further aspect, the above recombinant organism or microorganism which expresses (i) an enzyme capable of enzymatically converting 3-methylcrotonic acid into isobutene (step I as shown in FIG. 1); and (ii) an enzyme capable of enzymatically converting 3-methylcrotonyl-CoA into 3-methylcrotonic acid (step VIa, VIb or VIc as shown in FIG. 1) (and optionally further expressing an enzyme capable of enzymatically converting 3-methylglutaconyl-CoA into 3-methylcrotonyl-CoA and optionally further expressing an enzyme capable of enzymatically converting 3-hydroxy3-methylglutaryl-CoA into 3-methylgutaconyl-CoA and optionally further expressing an enzyme capable of enzymatically condensing acetoacetyl-CoA and acetyl-CoA into 3-hydroxy-3-methylglutaryl-CoA) is preferably an organism or microorganism which further expresses an enzyme capable of enzymatically converting acetyl-CoA into acetoacetyl-CoA comprising
[0647] an enzyme capable of directly condensing two molecules of acetyl-CoA into acetoacetyl-CoA (step XIII as shown in FIG. 1).
[0648] In another preferred embodiment, the recombinant organism or microorganism is a recombinant organism or microorganism which expresses the following two enzymes, namely
[0649] (i) an enzyme capable of converting acetyl-CoA into malonyl-CoA (step XIV as shown in FIG. 1); and
[0650] (ii) an enzyme capable of condensing malonyl-CoA and acetyl-CoA into acetoacetyl-CoA (step XV as shown in FIG. 1).
[0651] In a preferred embodiment, the enzyme capable of converting acetyl-CoA into malonyl-CoA is an acetyl-CoA carboxylase (EC 6.4.1.2) as described herein above.
[0652] In another preferred embodiment, the enzyme capable of condensing malonyl-CoA and acetyl-CoA into acetoacetyl-CoA is an acetoacetyl-CoA synthetase (EC 2.3.1.194) as described herein above.
[0653] In a preferred embodiment, the enzyme capable of directly condensing two molecules of acetyl-CoA into acetoacetyl-CoA is an acetyl-CoA C-acetyltransferase (EC 2.3.1.9) as described herein above.
[0654] As regards the above-mentioned enzymes as well as the preferred embodiments of said enzymes, the same applies to the recombinant organism or microorganism as has been set forth above for the methods according to the present invention.
[0655] Recombinant Organisms or Microorganisms of the Alternative Route for the Enzymatic Conversion from Acetyl-CoA into Isobutene via 3-Methyl-3-Butenovl-CoA and 3-Methyl-3-Butenoic Acid: Recombinant Organisms or Microorganisms Expressing Enzymes of Step XVI and Step XVII, and Optionally Further Expressing Enzymes of Step XVIII, Step VIII and Step IX as Well as Optionally Further Expressing Enzymes of Steps XIII, XIV and XV
[0656] As mentioned above, in an alternative to the above first route for the production of isobutene via 3-methylcrotonic acid, the present invention also relates to a method for the production of isobutene via an alternative route wherein isobutene is produced by the enzymatic conversion of 3-methyl-3-butenoic acid into isobutene. In the following, the recombinant organisms or microorganisms of this alternative route for the enzymatic conversion from acetyl-CoA into isobutene via 3-methyl-3-butenoyl-CoA and 3-methyl-3-butenoic acid are described.
[0657] The present invention also relates to a recombinant organism or microorganism which expresses (i) an enzyme capable of enzymatically converting 3-methyl-3-butenoic acid into isobutene (step XVI as shown in FIG. 1) and (ii) an enzyme capable of enzymatically converting 3-methyl-3-butenoyl-CoA into 3-methyl-3-butenoic acid (step XVII as shown in FIG. 1).
[0658] In a preferred embodiment, the enzyme capable of enzymatically converting 3-methyl-3-butenoic acid into isobutene is an 3-methyl-3-butenoic acid decarboxylase as described herein above, more preferably
[0659] (i) an FMN-dependent decarboxylase associated with an FMN prenyl transferase; or
[0660] (ii) an aconitate decarboxylase (EC 4.1.1.6); or
[0661] (iii) a methylcrotonyl-CoA carboxylase (EC 6.4.1.4); or
[0662] (iv) a geranoyl-CoA carboxylase (EC 6.4.1.5); or
[0663] (v) a protocatechuate (PCA) decarboxylase (EC 4.1.1.63) as described herein above.
[0664] In another preferred embodiment, the 3-methyl-3-butenoic acid decarboxylase is selected from the group consisting of 6-methylsalicylate decarboxylase (EC 4.1.1.52), 2-oxo-3-hexenedioate decarboxylase (EC 4.1.1.77) and 5-oxopent-3-ene-1,2,5-tricarboxylate decarboxylase (EC 4.1.1.68) as described herein above.
[0665] As regards the above-mentioned enzymes as well as preferred embodiments of said enzymes, the same applies to the recombinant organism or microorganism as has been set forth above for the methods according to the present invention.
[0666] In a preferred embodiment, the enzyme capable of enzymatically converting 3-methyl-3-butenoyl-CoA into 3-methyl-3-butenoic acid is
[0667] (a) an enzyme capable of directely converting 3-methyl-3-butenoyl-CoA into 3-methyl-3-butenoic acid, wherein said enzyme capable of directely converting 3-methyl-3-butenoyl-CoA into 3-methyl-3-butenoic acid is a CoA transferase (EC 2.8.3.-), preferably a propionate:acetate-CoA transferase (EC 2.8.3.1), an acetate CoA-transferase (EC 2.8.3.8) or a succinyl-CoA:acetate CoA-transferase (EC 2.8.3.18) (step XVIIa as shown in FIG. 1) as described herein above.
[0668] In another preferred embodiment, the recombinant organism or microorganism is a recombinant organism or microorganism which expresses the following two enzymes, namely
[0669] (b) an enzyme capable of directely converting 3-methyl-3-butenoyl-CoA into 3-methyl-3-butenoic acid, wherein said enzyme capable of directely converting 3-methyl-3-butenoyl-CoA into 3-methyl-3-butenoic acid is a thioester hydrolase (EC 3.1.2.-), preferably acetyl-CoA hydrolase (EC 3.1.2.1), an ADP-dependent short-chain-acyl-CoA hydrolase (EC 3.1.2.18) or an acyl-CoA hydrolase (EC 3.1.2.20) (step XVIIb as shown in FIG. 1) as described herein above; or
[0670] (c) (i) an enzyme capable of enzymatically converting 3-methyl-3-butenoyl-CoA into 3-methyl-3-butenoyl phosphate; and
[0671] (ii) an enzyme capable of enzymatically converting 3-methyl-3-butenoyl phosphate into said 3-methyl-3-butenoic acid(step XVIII as shown in FIG. 1) as described herein above.
[0672] In a preferred embodiment, the enzyme capable of enzymatically converting said 3-methyl-3-butenoyl-CoA into 3-methyl-3-butenoyl phosphate is a phosphate butyryltransferase (EC 2.3.1.19) or a phosphate acetyltransferase (EC 2.3.1.8) and the enzyme capable of enzymatically converting 3-methyl-3-butenoyl phosphate into 3-methyl-3-butenoic acid is a phosphotransferase with a carboxy group as acceptor (EC 2.7.2.-), preferably a propionate kinase (EC 2.7.2.15), an acetate kinase (EC 2.7.2.1), a butyrate kinase (EC 2.7.2.7) or a branched-chain-fatty-acid kinase (EC 2.7.2.14) as described herein above.
[0673] As regards the above-mentioned enzymes as well as preferred embodiments of said enzymes, the same applies to the recombinant organism or microorganism as has been set forth above for the methods according to the present invention.
[0674] In a further aspect, the above recombinant organism or microorganism is an organism or microorganism which further expresses an enzyme capable of enzymatically converting 3-methylglutaconyl-CoA into 3-methyl-3-butenoyl-CoA (step XVIII as shown in FIG. 1), preferably
[0675] (a) (i) a methylcrotonyl-CoA carboxylase (EC 6.4.1.4); or (ii) a geranoyl-CoA carboxylase (EC 6.4.1.5), or
[0676] (b) an N-terminal domain of CurF from Lynbya majuscula multifunctional protein or a 3-methylglutaconyl-CoA decarboxylase, preferably a 3-methylglutaconyl-CoA decarboxylase of Myxococcus xanthus encoded by the liuB gene; or
[0677] (c) an enzyme of the 4-oxalocrotonate decarboxylase family, as described herein above.
[0678] As regards the above-mentioned enzymes as well as preferred embodiments of said enzymes, the same applies to the recombinant organism or microorganism as has been set forth above for the methods according to the present invention.
[0679] In a further aspect, the above recombinant organism or microorganism is an organism or microorganism which further expresses an enzyme capable of enzymatically converting 3-hydroxy-3-methylglutaryl-CoA into 3-methylglutaconyl-CoA (step VIII as shown in FIG. 1),preferably a 3-methylglutaconyl-coenzyme A hydratase (EC 4.2.1.18), a 3-hydroxyacyl-CoA dehydratase (EC 4.2.1.-) or an enoyl-CoA hydratase (EC 4.2.1.-).
[0680] As regards the above-mentioned enzyme as well as preferred embodiments of said enzyme, the same applies to the recombinant organism or microorganism as has been set forth above for the methods according to the present invention.
[0681] In a further aspect, the above recombinant organism or microorganism is an organism or microorganism which further expresses an enzyme capable of enzymatically condensing acetoacetyl-CoA and acetyl-CoA into 3-hydroxy-3-methylglutaryl-CoA (step IX as shown in FIG. 1).
[0682] In a preferred embodiment, the enzyme capable of enzymatically condensing acetoacetyl-CoA and acetyl-CoA into 3-hydroxy-3-methylglutaryl-CoA is a 3-hydroxy-3-methylglutaryl-CoA synthase.
[0683] As regards the afore-mentioned enzyme as well as preferred embodiments of said enzyme, the same applies to the recombinant organism or microorganism as has been set forth above for the methods according to the present invention.
[0684] In a further aspect, the above recombinant organism or microorganism is an organism or microorganism which further expresses an enzyme or several enzymes capable of enzymatically converting acetyl-CoA into acetoacetyl-CoA.
[0685] In one preferred embodiment, the recombinant organism or microorganism expresses a combination of enzymes, namely
[0686] (i) an enzyme capable of converting acetyl-CoA into malonyl-CoA (step XIV as shown in FIG. 1); and
[0687] (ii) an enzyme capable of condensing malonyl-CoA and acetyl-CoA into acetoacetyl-CoA (step XV as shown in FIG. 1).
[0688] In an alternative embodiment, the recombinant organism or microorganism expresses an enzyme capable of directly condensing two molecules of acetyl-CoA into acetoacetyl-CoA (step XIII as shown in FIG. 1).
[0689] As regards the first above-mentioned embodiment, the enzyme capable of converting acetyl-CoA into malonyl-CoA is preferably an acetyl-CoA carboxylase (EC 6.4.1.2) as described herein above.
[0690] Moreover, the enzyme capable of condensing malonyl-CoA and acetyl-CoA into acetoacetyl-CoA is an acetoacetyl-CoA synthetase (EC 2.3.1.194) as described herein above.
[0691] As regards the second above-mentioned embodiment, the enzyme capable of directly condensing two molecules of acetyl-CoA into acetoacetyl-CoA is preferably an acetyl-CoA C-acetyltransferase (EC 2.3.1.9) as described herein above.
[0692] As regards the above-mentioned enzymes as well as the preferred embodiments of said enzymes, the same applies to the recombinant organism or microorganism as has been set forth above for the methods according to the present invention.
[0693] Recombinant Organisms or Microorganisms Expressing Enzymes of the Additional/Supplemental Pathways of Steps Xa, Xb, XI and XII
[0694] As mentioned above, the above-described methods of the present invention for producing isobutene from acetyl-CoA may be supplemented by one or more of the reactions as shown in step Xa, step Xb, step XI and step XII of FIG. 18 and as described in detail herein above.
[0695] Thus, in a further aspect, the present invention relates to any of the above-described recombinant organism or microorganism wherein the organism or microorganism which additionally further expresses
[0696] a) an enzyme capable of enzymatically converting 3-hydroxyisovalerate (HIV) into 3-methylcrotonic acid with a concomitant transfer of CoA from 3-methylcrotonyl-CoA on 3-hydroxyisovalerate (HIV) to result in 3-hydroxyisovaleryl-CoA (step Xa as schematically shown in FIG. 19); and/or
[0697] b) an enzyme capable of enzymatically converting 3-hydroxyisovalerate (HIV) into 3-hydroxyisovaleryl-CoA (step Xb as schematically shown in FIG. 20); and/or
[0698] c) an enzyme capable of enzymatically converting 3-hydroxyisovaleryl-CoA into 3-methylcrotonyl-CoA (step XI as schematically shown in FIG. 21); and/or
[0699] d) an enzyme capable of enzymatically converting 3-hydroxyisovalerate (HIV) into 3-hydroxyisovaleryl-CoA (step XII as schematically shown in FIG. 22) as described herein above.
[0700] As regards the above-mentioned enzymes as well as preferred embodiments of said enzymes, the same applies to the recombinant organism or microorganism as has been set forth above for the methods according to the present invention.
[0701] The above microorganism is preferably a bacterium, a yeast or a fungus. In another preferred embodiment, the organism is a plant or a non-human animal. As regards other preferred embodiments of the bacterium, recombinant organism or microorganism, the same applies as has been set forth above in connection with the methods according to the present invention.
[0702] The present invention also relates to the use of any of the above-described recombinant organisms or microorganisms for the production of isobutene. Thus, the present invention furthermore relates to the use of a recombinant organism or microorganism for the production of isobutene, wherein said recombinant organism or microorganism expresses (i) an enzyme capable of enzymatically converting 3-methylcrotonic acid into isobutene (step I as shown in FIG. 1); and (ii) an enzyme capable of enzymatically converting 3-hydroxyisovalerate (HIV) into 3-methylcrotonic acid (step II as shown in FIG. 1).
[0703] In another preferred embodiment, the present invention relates to the use of a recombinant organism or microorganism for the production of isobutene, wherein said recombinant organism or microorganism expresses (i) an enzyme capable of enzymatically converting 3-methylcrotonic acid into isobutene (step I as shown in FIG. 1); and (ii) an enzyme capable of enzymatically converting 3-hydroxyisovalerate (HIV) into 3-methylcrotonic acid (step II as shown in FIG. 1) which further expresses an enzyme capable of enzymatically condensing acetone and acetyl-CoA into 3-hydroxyisovalerate (HIV) (step III as shown in FIG. 1).
[0704] In another preferred embodiment, the present invention relates to the use of a recombinant organism or microorganism for the production of isobutene, wherein said recombinant organism or microorganism expresses (i) an enzyme capable of enzymatically converting 3-methylcrotonic acid into isobutene (step I as shown in FIG. 1); and (ii) an enzyme capable of enzymatically converting 3-hydroxyisovalerate (HIV) into 3-methylcrotonic acid (step II as shown in FIG. 1), which further expresses an enzyme capable of enzymatically condensing acetone and acetyl-CoA into 3-hydroxyisovalerate (HIV) (step III as shown in FIG. 1) and which further expresses an enzyme capable of enzymatically converting acetoacetate into acetone (step IV as shown in FIG. 1).
[0705] In another preferred embodiment, the present invention relates to the use of a recombinant organism or microorganism for the production of isobutene, wherein said recombinant organism or microorganism expresses (i) an enzyme capable of enzymatically converting 3-methylcrotonic acid into isobutene (step I as shown in FIG. 1); and (ii) an enzyme capable of enzymatically converting 3-hydroxyisovalerate (HIV) into 3-methylcrotonic acid (step II as shown in FIG. 1), which further expresses an enzyme capable of enzymatically condensing acetone and acetyl-CoA into 3-hydroxyisovalerate (HIV) (step III as shown in FIG. 1), which further expresses an enzyme capable of enzymatically converting acetoacetate into acetone (step IV as shown in FIG. 1) and which further expresses an enzyme capable of converting acetoacetyl-CoA into acetoacetate (step Va or Vb as shown in FIG. 1).
[0706] In another preferred embodiment, the present invention relates to the use of a recombinant organism or microorganism for the production of isobutene, wherein said recombinant organism or microorganism expresses (i) an enzyme capable of enzymatically converting 3-methylcrotonic acid into isobutene (step I as shown in FIG. 1); and (ii) an enzyme capable of enzymatically converting 3-hydroxyisovalerate (HIV) into 3-methylcrotonic acid (step II as shown in FIG. 1), which further expresses an enzyme capable of enzymatically condensing acetone and acetyl-CoA into 3-hydroxyisovalerate (HIV) (step III as shown in FIG. 1), which further expresses an enzyme capable of enzymatically converting acetoacetate into acetone (step IV as shown in FIG. 1), which further expresses an enzyme capable of converting acetoacetyl-CoA into acetoacetate (step Va or Vb as shown in FIG. 1) and which further expresses an enzyme capable of enzymatically converting acetyl-CoA into acetoacetyl-CoA comprising (a) (i) an enzyme capable of converting acetyl-CoA into malonyl-CoA (step XIV as shown in FIG. 1); and (ii) an enzyme capable of condensing malonyl-CoA and acetyl-CoA into acetoacetyl-CoA (step XV as shown in FIG. 1); or (b) an enzyme capable of directly condensing two molecules of acetyl-CoA into acetoacetyl-CoA (step XIII as shown in FIG. 1).
[0707] In a more preferred embodiment, the present invention relates to any of the above uses of a recombinant organisms or microorganisms for the production of isobutene wherein said recombinant organism or microorganism expresses an enzyme catalyzing the enzymatic conversion of 3-methylcrotonic acid into isobutene.
[0708] As regards the above-mentioned enzymes as well as preferred embodiments of said enzymes, the same applies to the use of the recombinant organism or microorganism for the production of isobutene as has been set forth above for the methods and recombinant organisms or microorganisms according to the present invention.
[0709] The present invention furthermore relates to the use of a recombinant organism or microorganism for the production of isobutene, wherein said recombinant organism or microorganism expresses (i) an enzyme capable of enzymatically converting 3-methylcrotonic acid into isobutene (step I as shown in FIG. 1); and (ii) an enzyme capable of enzymatically converting 3-methylcrotonyl-CoA into 3-methylcrotonic acid (step VIa, VIb or VIc as shown in FIG. 1).
[0710] In another preferred embodiment, the present invention relates to the use of a recombinant organism or microorganism for the production of isobutene, wherein said recombinant organism or microorganism expresses (i) an enzyme capable of enzymatically converting 3-methylcrotonic acid into isobutene (step I as shown in FIG. 1); and (ii) an enzyme capable of enzymatically converting 3-methylcrotonyl-CoA into 3-methylcrotonic acid (step VIa, VIb or VIc as shown in FIG. 1) and which further expresses an enzyme capable of enzymatically converting 3-methylglutaconyl-CoA into 3-methylcrotonyl-CoA (step VII as shown in FIG. 1).
[0711] In another preferred embodiment, the present invention relates to the use of a recombinant organism or microorganism for the production of isobutene, wherein said recombinant organism or microorganism expresses (i) an enzyme capable of enzymatically converting 3-methylcrotonic acid into isobutene (step I as shown in FIG. 1); and (ii) an enzyme capable of enzymatically converting 3-methylcrotonyl-CoA into 3-methylcrotonic acid (step VIa, VIb or VIc as shown in FIG. 1), which further expresses an enzyme capable of enzymatically converting 3-methylglutaconyl-CoA into 3-methylcrotonyl-CoA (step VII as shown in FIG. 1) and which further expresses an enzyme capable of enzymatically converting 3-hydroxy-3-methylglutaryl-CoA into 3-methylglutaconyl-CoA (step VIII as shown in FIG. 1).
[0712] In another preferred embodiment, the present invention relates to the use of a recombinant organism or microorganism for the production of isobutene, wherein said recombinant organism or microorganism expresses (i) an enzyme capable of enzymatically converting 3-methylcrotonic acid into isobutene (step I as shown in FIG. 1); and (ii) an enzyme capable of enzymatically converting 3-methylcrotonyl-CoA into 3-methylcrotonic acid (step VIa, VIb or VIc as shown in FIG. 1), which further expresses an enzyme capable of enzymatically converting 3-methylglutaconyl-CoA into 3-methylcrotonyl-CoA (step VII as shown in FIG. 1), which further expresses an enzyme capable of enzymatically converting 3-hydroxy-3-methylglutaryl-CoA into 3-methylglutaconyl-CoA (step VIII as shown in FIG. 1) and which further expresses an enzyme capable of enzymatically condensing acetoacetyl-CoA and acetyl-CoA into 3-hydroxy-3-methylglutaryl-CoA (step IX as shown in FIG. 1).
[0713] In another preferred embodiment, the present invention relates to the use of a recombinant organism or microorganism for the production of isobutene, wherein said recombinant organism or microorganism expresses (i) an enzyme capable of enzymatically converting 3-methylcrotonic acid into isobutene (step I as shown in FIG. 1); and (ii) an enzyme capable of enzymatically converting 3-methylcrotonyl-CoA into 3-methylcrotonic acid (step VIa, VIb or VIc as shown in FIG. 1), which further expresses an enzyme capable of enzymatically converting 3-methylglutaconyl-CoA into 3-methylcrotonyl-CoA (step VII as shown in FIG. 1), which further expresses an enzyme capable of enzymatically converting 3-hydroxy-3-methylglutaryl-CoA into 3-methylglutaconyl-CoA (step VIII as shown in FIG. 1), which further expresses an enzyme capable of enzymatically condensing acetoacetyl-CoA and acetyl-CoA into 3-hydroxy-3-methylglutaryl-CoA (step IX as shown in FIG. 1) and which further expresses an enzyme capable of enzymatically converting acetyl-CoA into acetoacetyl-CoA comprising (a) (i) an enzyme capable of converting acetyl-CoA into malonyl-CoA (step XIV as shown in FIG. 1); and (ii) an enzyme capable of condensing malonyl-CoA and acetyl-CoA into acetoacetyl-CoA (step XV as shown in FIG. 1); or (b) an enzyme capable of directly condensing two molecules of acetyl-CoA into acetoacetyl-CoA (step XIII as shown in FIG. 1).
[0714] In a more preferred embodiment, the present invention relates to any of the above uses of a recombinant organisms or microorganisms for the production of isobutene wherein said recombinant organism or microorganism expresses an enzyme catalyzing the enzymatic conversion of 3-methylcrotonic acid into isobutene.
[0715] As regards the above-mentioned enzymes as well as preferred embodiments of said enzymes, the same applies to the use of the recombinant organism or microorganism for the production of isobutene as has been set forth above for the mehtods and recombinant organisms or microorganisms according to the present invention.
[0716] The present invention furthermore relates to the use of a recombinant organism or microorganism for the production of isobutene, wherein said recombinant organism or microorganism expresses (i) an enzyme capable of enzymatically converting 3-methyl-3-butenoic acid into isobutene (step XVI as shown in FIG. 1) and (ii) an enzyme capable of enzymatically converting 3-methyl-3-butenoyl-CoA into 3-methyl-3-butenoic acid (step XVII as shown in FIG. 1).
[0717] In another preferred embodiment, the present invention relates to the use of a recombinant organism or microorganism for the production of isobutene, wherein said recombinant organism or microorganism expresses (i) an enzyme capable of enzymatically converting 3-methyl-3-butenoic acid into isobutene (step XVI as shown in FIG. 1) and (ii) an enzyme capable of enzymatically converting 3-methyl-3-butenoyl-CoA into 3-methyl-3-butenoic acid (step XVII as shown in FIG. 1) and which further expresses an enzyme capable of enzymatically converting 3-methylglutaconyl-CoA into 3-methyl-3-butenoyl-CoA (step XVIII as shown in FIG. 1).
[0718] In another preferred embodiment, the present invention relates to the use of a recombinant organism or microorganism for the production of isobutene, wherein said recombinant organism or microorganism expresses (i) an enzyme capable of enzymatically converting 3-methyl-3-butenoic acid into isobutene (step XVI as shown in FIG. 1) and (ii) an enzyme capable of enzymatically converting 3-methyl-3-butenoyl-CoA into 3-methyl-3-butenoic acid (step XVII as shown in FIG. 1), which further expresses an enzyme capable of enzymatically converting 3-methylglutaconyl-CoA into 3-methyl-3-butenoyl-CoA (step XVIII as shown in FIG. 1) and which further expresses an enzyme capable of enzymatically converting 3-hydroxy-3-methylglutaryl-CoA into 3-methylglutaconyl-CoA (step VIII as shown in FIG. 1).
[0719] In another preferred embodiment, the present invention relates to the use of a recombinant organism or microorganism for the production of isobutene, wherein said recombinant organism or microorganism expresses (i) an enzyme capable of enzymatically converting 3-methyl-3-butenoic acid into isobutene (step XVI as shown in FIG. 1) and (ii) an enzyme capable of enzymatically converting 3-methyl-3-butenoyl-CoA into 3-methyl-3-butenoic acid (step XVII as shown in FIG. 1), which further expresses an enzyme capable of enzymatically converting 3-methylglutaconyl-CoA into 3-methyl-3-butenoyl-CoA (step XVIII as shown in FIG. 1), which further expresses an enzyme capable of enzymatically converting 3-hydroxy-3-methylglutaryl-CoA into 3-methylglutaconyl-CoA (step VIII as shown in FIG. 1) and which further expresses an enzyme capable of enzymatically condensing acetoacetyl-CoA and acetyl-CoA into 3-hydroxy-3-methylglutaryl-CoA (step IX as shown in FIG. 1).
[0720] In another preferred embodiment, the present invention relates to the use of a recombinant organism or microorganism for the production of isobutene, wherein said recombinant organism or microorganism expresses (i) an enzyme capable of enzymatically converting 3-methyl-3-butenoic acid into isobutene (step XVI as shown in FIG. 1) and (ii) an enzyme capable of enzymatically converting 3-methyl-3-butenoyl-CoA into 3-methyl-3-butenoic acid (step XVII as shown in FIG. 1), which further expresses an enzyme capable of enzymatically converting 3-methylglutaconyl-CoA into 3-methyl-3-butenoyl-CoA (step XVIII as shown in FIG. 1), which further expresses an enzyme capable of enzymatically converting 3-hydroxy-3-methylglutaryl-CoA into 3-methylglutaconyl-CoA (step VIII as shown in FIG. 1), which further expresses an enzyme capable of enzymatically condensing acetoacetyl-CoA and acetyl-CoA into 3-hydroxy-3-methylglutaryl-CoA (step IX as shown in FIG. 1) and which further expresses an enzyme capable of enzymatically converting acetyl-CoA into acetoacetyl-CoA comprising (a) (i) an enzyme capable of converting acetyl-CoA into malonyl-CoA (step XIV as shown in FIG. 1); and (ii) an enzyme capable of condensing malonyl-CoA and acetyl-CoA into acetoacetyl-CoA (step XV as shown in FIG. 1); or (b) an enzyme capable of directly condensing two molecules of acetyl-CoA into acetoacetyl-CoA (step XIII as shown in FIG. 1).
[0721] In a more preferred embodiment, the present invention relates to any of the above uses of a recombinant organisms or microorganisms for the production of isobutene wherein said recombinant organism or microorganism expresses an enzyme catalyzing the enzymatic conversion of 3-methyl-3-butenoic acid into isobutene.
[0722] As regards the above-mentioned enzymes as well as preferred embodiments of said enzymes, the same applies to the use of the recombinant organism or microorganism for the production of isobutene as has been set forth above for the mehtods and recombinant organisms or microorganisms according to the present invention.
[0723] In a further aspect, the present invention relates to the use of any of the above-described recombinant organism or microorganism for the production of isobutene, wherein the organism or microorganism is an organism or microorganism which additionally further expresses
[0724] a) an enzyme capable of enzymatically converting 3-hydroxyisovalerate (HIV) into 3-methylcrotonic acid with a concomitant transfer of CoA from 3-methylcrotonyl-CoA on 3-hydroxyisovalerate (HIV) to result in 3-hydroxyisovaleryl-CoA (step Xa as schematically shown in FIG. 19); and/or
[0725] b) an enzyme capable of enzymatically converting 3-hydroxyisovalerate (HIV) into 3-hydroxyisovaleryl-CoA (step Xb as schematically shown in FIG. 20); and/or
[0726] c) an enzyme capable of enzymatically converting 3-hydroxyisovaleryl-CoA into 3-methylcrotonyl-CoA (step XI as schematically shown in FIG. 21); and/or
[0727] d) an enzyme capable of enzymatically converting 3-hydroxyisovalerate (HIV) into 3-hydroxyisovaleryl-CoA (step XII as schematically shown in FIG. 22)
[0728] as described herein above.
[0729] As regards the abvove-mentioned enzymes as well as preferred embodiments of said enzymes, the same applies to the recombinant organism or microorganism as has been set forth above for the methods according to the present invention.
[0730] The present invention furthermore relates to the use of an enzyme catalyzing the enzymatic conversion of 3-methylcrotonic acid into isobutene for the production of isobutene from 3-methylcrotonic acid.
[0731] The present invention furthermore relates to the use of (i) an enzyme capable of enzymatically converting 3-methylcrotonic acid into isobutene (step I as shown in FIG. 1); and (ii) an enzyme capable of enzymatically converting 3-hydroxyisovalerate (HIV) into 3-methylcrotonic acid (step II as shown in FIG. 1) for the production of isobutene.
[0732] In another preferred embodiment, the present invention relates to the use (i) an enzyme capable of enzymatically converting 3-methylcrotonic acid into isobutene (step I as shown in FIG. 1); and (ii) an enzyme capable of enzymatically converting 3-hydroxyisovalerate (HIV) into 3-methylcrotonic acid (step II as shown in FIG. 1) and an enzyme capable of enzymatically condensing acetone and acetyl-CoA into 3-hydroxyisovalerate (HIV) (step III as shown in FIG. 1) for the production of isobutene.
[0733] In another preferred embodiment, the present invention relates to the use of (i) an enzyme capable of enzymatically converting 3-methylcrotonic acid into isobutene (step I as shown in FIG. 1); and (ii) an enzyme capable of enzymatically converting 3-hydroxyisovalerate (HIV) into 3-methylcrotonic acid (step II as shown in FIG. 1), an enzyme capable of enzymatically condensing acetone and acetyl-CoA into 3-hydroxyisovalerate (HIV) (step III as shown in FIG. 1) and an enzyme capable of enzymatically converting acetoacetate into acetone (step IV as shown in FIG. 1) for the production of isobutene.
[0734] In another preferred embodiment, the present invention relates to the use of (i) an enzyme capable of enzymatically converting 3-methylcrotonic acid into isobutene (step I as shown in FIG. 1); and (ii) an enzyme capable of enzymatically converting 3-hydroxyisovalerate (HIV) into 3-methylcrotonic acid (step II as shown in FIG. 1); an enzyme capable of enzymatically condensing acetone and acetyl-CoA into 3-hydroxyisovalerate (HIV) (step III as shown in FIG. 1), an enzyme capable of enzymatically converting acetoacetate into acetone (step IV as shown in FIG. 1) and an enzyme capable of converting acetoacetyl-CoA into acetoacetate (step Va or Vb as shown in FIG. 1) for the production of isobutene.
[0735] In another preferred embodiment, the present invention relates to the use of (i) an enzyme capable of enzymatically converting 3-methylcrotonic acid into isobutene (step I as shown in FIG. 1); and (ii) an enzyme capable of enzymatically converting 3-hydroxyisovalerate (HIV) into 3-methylcrotonic acid (step II as shown in FIG. 1); an enzyme capable of enzymatically condensing acetone and acetyl-CoA into 3-hydroxyisovalerate (HIV) (step III as shown in FIG. 1), an enzyme capable of enzymatically converting acetoacetate into acetone (step IV as shown in FIG. 1), an enzyme capable of converting acetoacetyl-CoA into acetoacetate (step Va or Vb as shown in FIG. 1) and an enzyme capable of enzymatically converting acetyl-CoA into acetoacetyl-CoA comprising (a) (i) an enzyme capable of converting acetyl-CoA into malonyl-CoA (step XIV as shown in FIG. 1); and (ii) an enzyme capable of condensing malonyl-CoA and acetyl-CoA into acetoacetyl-CoA (step XV as shown in FIG. 1); or (b) an enzyme capable of directly condensing two molecules of acetyl-CoA into acetoacetyl-CoA (step XIII as shown in FIG. 1) for the production of isobutene.
[0736] As regards the above-mentioned enzymes as well as preferred embodiments of said enzymes, the same applies to the use of the recombinant organism or microorganism for the production of isobutene as has been set forth above for the methods and recombinant organisms or microorganisms according to the present invention.
[0737] The present invention furthermore relates to the use of (i) an enzyme capable of enzymatically converting 3-methylcrotonic acid into isobutene (step I as shown in FIG. 1); and (ii) an enzyme capable of enzymatically converting 3-methylcrotonyl-CoA into 3-methylcrotonic acid (step VIa, VIb or VIc as shown in FIG. 1) for the production of isobutene.
[0738] In another preferred embodiment, the present invention relates to the use of (i) an enzyme capable of enzymatically converting 3-methylcrotonic acid into isobutene (step I as shown in FIG. 1); and (ii) an enzyme capable of enzymatically converting 3-methylcrotonyl-CoA into 3-methylcrotonic acid (step VIa, VIb or VIc as shown in FIG. 1) and an enzyme capable of enzymatically converting 3-methylglutaconyl-CoA into 3-methylcrotonyl-CoA (step VII as shown in FIG. 1) for the production of isobutene.
[0739] In another preferred embodiment, the present invention relates to the use of (i) an enzyme capable of enzymatically converting 3-methylcrotonic acid into isobutene (step I as shown in FIG. 1); and (ii) an enzyme capable of enzymatically converting 3-methylcrotonyl-CoA into 3-methylcrotonic acid (step VIa, VIb or VIc as shown in FIG. 1); an enzyme capable of enzymatically converting 3-methylglutaconyl-CoA into 3-methylcrotonyl-CoA (step VII as shown in FIG. 1) and an enzyme capable of enzymatically converting 3-hydroxy-3-methylglutaryl-CoA into 3-methylglutaconyl-CoA (step VIII as shown in FIG. 1) for the production of isobutene.
[0740] In another preferred embodiment, the present invention relates to the use of (i) an enzyme capable of enzymatically converting 3-methylcrotonic acid into isobutene (step I as shown in FIG. 1); and (ii) an enzyme capable of enzymatically converting 3-methylcrotonyl-CoA into 3-methylcrotonic acid (step VIa, VIb or VIc as shown in FIG. 1); an enzyme capable of enzymatically converting 3-methylglutaconyl-CoA into 3-methylcrotonyl-CoA (step VII as shown in FIG. 1); an enzyme capable of enzymatically converting 3-hydroxy-3-methylglutaryl-CoA into 3-methylglutaconyl-CoA (step VIII as shown in FIG. 1) and an enzyme capable of enzymatically condensing acetoacetyl-CoA and acetyl-CoA into 3-hydroxy-3-methylglutaryl-CoA (step IX as shown in FIG. 1) for the production of isobutene.
[0741] In another preferred embodiment, the present invention relates to the use of (i) an enzyme capable of enzymatically converting 3-methylcrotonic acid into isobutene (step I as shown in FIG. 1); and (ii) an enzyme capable of enzymatically converting 3-methylcrotonyl-CoA into 3-methylcrotonic acid (step VIa, VIb or VIc as shown in FIG. 1); an enzyme capable of enzymatically converting 3-methylglutaconyl-CoA into 3-methylcrotonyl-CoA (step VII as shown in FIG. 1); an enzyme capable of enzymatically converting 3-hydroxy-3-methylglutaryl-CoA into 3-methylglutaconyl-CoA (step VIII as shown in FIG. 1); an enzyme capable of enzymatically condensing acetoacetyl-CoA and acetyl-CoA into 3-hydroxy-3-methylglutaryl-CoA (step IX as shown in FIG. 1) and an enzyme capable of enzymatically converting acetyl-CoA into acetoacetyl-CoA comprising (a) (i) an enzyme capable of converting acetyl-CoA into malonyl-CoA (step XIV as shown in FIG. 1); and (ii) an enzyme capable of condensing malonyl-CoA and acetyl-CoA into acetoacetyl-CoA (step XV as shown in FIG. 1); or (b) an enzyme capable of directly condensing two molecules of acetyl-CoA into acetoacetyl-CoA (step XIII as shown in FIG. 1) for the production of isobutene.
[0742] As regards the above-mentioned enzymes as well as preferred embodiments of said enzymes, the same applies to the use of the recombinant organism or microorganism for the production of isobutene as has been set forth above for the mehtods and recombinant organisms or microorganisms according to the present invention.
[0743] The present invention furthermore relates to the use of an enzyme catalyzing the enzymatic conversion of 3-methyl-3-butenoic acid into isobutene for the production of isobutene from 3-methyl-3-butenoic acid.
[0744] The present invention furthermore relates to the use of (i) an enzyme capable of enzymatically converting 3-methyl-3-butenoic acid into isobutene (step XVI as shown in FIG. 1) and (ii) an enzyme capable of enzymatically converting 3-methyl-3-butenoyl-CoA into 3-methyl-3-butenoic acid (step XVII as shown in FIG. 1) for the production of isobutene.
[0745] In another preferred embodiment, the present invention relates to the use of (i) an enzyme capable of enzymatically converting 3-methyl-3-butenoic acid into isobutene (step XVI as shown in FIG. 1) and (ii) an enzyme capable of enzymatically converting 3-methyl-3-butenoyl-CoA into 3-methyl-3-butenoic acid (step XVII as shown in FIG. 1) an enzyme capable of enzymatically converting 3-methylglutaconyl-CoA into 3-methyl-3-butenoyl-CoA (step XVIII as shown in FIG. 1) for the production of isobutene.
[0746] In another preferred embodiment, the present invention relates to the use of (i) an enzyme capable of enzymatically converting 3-methyl-3-butenoic acid into isobutene (step XVI as shown in FIG. 1) and (ii) an enzyme capable of enzymatically converting 3-methyl-3-butenoyl-CoA into 3-methyl-3-butenoic acid (step XVII as shown in FIG. 1), an enzyme capable of enzymatically converting 3-methylglutaconyl-CoA into 3-methyl-3-butenoyl-CoA (step XVIII as shown in FIG. 1) and an enzyme capable of enzymatically converting 3-hydroxy-3-methylglutaryl-CoA into 3-methylglutaconyl-CoA (step VIII as shown in FIG. 1) for the production of isobutene.
[0747] In another preferred embodiment, the present invention relates to the use of (i) an enzyme capable of enzymatically converting 3-methyl-3-butenoic acid into isobutene (step XVI as shown in FIG. 1) and (ii) an enzyme capable of enzymatically converting 3-methyl-3-butenoyl-CoA into 3-methyl-3-butenoic acid (step XVII as shown in FIG. 1); an enzyme capable of enzymatically converting 3-methylglutaconyl-CoA into 3-methyl-3-butenoyl-CoA (step XVIII as shown in FIG. 1); an enzyme capable of enzymatically converting 3-hydroxy-3-methylglutaryl-CoA into 3-methylglutaconyl-CoA (step VIII as shown in FIG. 1) and an enzyme capable of enzymatically condensing acetoacetyl-CoA and acetyl-CoA into 3-hydroxy-3-methylglutaryl-CoA (step IX as shown in FIG. 1) for the production of isobutene.
[0748] In another preferred embodiment, the present invention relates to the use of (i) an enzyme capable of enzymatically converting 3-methyl-3-butenoic acid into isobutene (step XVI as shown in FIG. 1) and (ii) an enzyme capable of enzymatically converting 3-methyl-3-butenoyl-CoA into 3-methyl-3-butenoic acid (step XVII as shown in FIG. 1); an enzyme capable of enzymatically converting 3-methylglutaconyl-CoA into 3-methyl-3-butenoyl-CoA (step XVIII as shown in FIG. 1); an enzyme capable of enzymatically converting 3-hydroxy-3-methylglutaryl-CoA into 3-methylglutaconyl-CoA (step VIII as shown in FIG. 1); an enzyme capable of enzymatically condensing acetoacetyl-CoA and acetyl-CoA into 3-hydroxy-3-methylglutaryl-CoA (step IX as shown in FIG. 1) and an enzyme capable of enzymatically converting acetyl-CoA into acetoacetyl-CoA comprising (a) (i) an enzyme capable of converting acetyl-CoA into malonyl-CoA (step XIV as shown in FIG. 1); and (ii) an enzyme capable of condensing malonyl-CoA and acetyl-CoA into acetoacetyl-CoA (step XV as shown in FIG. 1); or (b) an enzyme capable of directly condensing two molecules of acetyl-CoA into acetoacetyl-CoA (step XIII as shown in FIG. 1) for the production of isobutene.
[0749] As regards the above-mentioned enzymes as well as preferred embodiments of said enzymes, the same applies to the use of the recombinant organism or microorganism for the production of isobutene as has been set forth above for the mehtods and recombinant organisms or microorganisms according to the present invention.
[0750] In a further aspect, the present invention relates to any of the above uses of enzymes for the production of isobutene, wherein additionally
[0751] a) an enzyme capable of enzymatically converting 3-hydroxyisovalerate (HIV) into 3-methylcrotonic acid with a concomitant transfer of CoA from 3-methylcrotonyl-CoA on 3-hydroxyisovalerate (HIV) to result in 3-hydroxyisovaleryl-CoA (step Xa as schematically shown in FIG. 19); and/or
[0752] b) an enzyme capable of enzymatically converting 3-hydroxyisovalerate (HIV) into 3-hydroxyisovaleryl-CoA (step Xb as schematically shown in FIG. 20); and/or
[0753] c) an enzyme capable of enzymatically converting 3-hydroxyisovaleryl-CoA into 3-methylcrotonyl-CoA (step XI as schematically shown in FIG. 21); and/or
[0754] d) an enzyme capable of enzymatically converting 3-hydroxyisovalerate (HIV) into 3-hydroxyisovaleryl-CoA (step XII as schematically shown in FIG. 22)
[0755] as described herein above is used.
[0756] As regards the above-mentioned enzymes as well as preferred embodiments of said enzymes, the same applies to the recombinant organism or microorganism as has been set forth above for the methods according to the present invention.
[0757] Furthermore, the present invention relates to a composition comprising 3-methylcrotonic acid and a recombinant organism or microorganism, wherein said recombinant organism or microorganism expresses (i) an enzyme capable of enzymatically converting 3-methylcrotonic acid into isobutene (step I as shown in FIG. 1); and/or (ii) an enzyme capable of enzymatically converting 3-hydroxyisovalerate (HIV) into 3-methylcrotonic acid (step II as shown in FIG. 1), and/or which further expresses an enzyme capable of enzymatically condensing acetone and acetyl-CoA into 3-hydroxyisovalerate (HIV) (step III as shown in FIG. 1), and/or which further expresses an enzyme capable of enzymatically converting acetoacetate into acetone (step IV as shown in FIG. 1), and/or which further expresses an enzyme capable of converting acetoacetyl-CoA into acetoacetate (step Va or Vb as shown in FIG. 1) and/or which further expresses an enzyme capable of enzymatically converting acetyl-CoA into acetoacetyl-CoA comprising (a) (i) an enzyme capable of converting acetyl-CoA into malonyl-CoA (step XIV as shown in FIG. 1); and (ii) an enzyme capable of condensing malonyl-CoA and acetyl-CoA into acetoacetyl-CoA (step XV as shown in FIG. 1); or (b) an enzyme capable of directly condensing two molecules of acetyl-CoA into acetoacetyl-CoA (step XIII as shown in FIG. 1).
[0758] Furthermore, the present invention relates to a composition comprising 3-methylcrotonic acid (i) an enzyme capable of enzymatically converting 3-methylcrotonic acid into isobutene (step I as shown in FIG. 1); and/or (ii) an enzyme capable of enzymatically converting 3-hydroxyisovalerate (HIV) into 3-methylcrotonic acid (step II as shown in FIG. 1); and/or an enzyme capable of enzymatically condensing acetone and acetyl-CoA into 3-hydroxyisovalerate (HIV) (step III as shown in FIG. 1), and/or an enzyme capable of enzymatically converting acetoacetate into acetone (step IV as shown in FIG. 1), and/or an enzyme capable of converting acetoacetyl-CoA into acetoacetate (step Va or Vb as shown in FIG. 1) and/or an enzyme capable of enzymatically converting acetyl-CoA into acetoacetyl-CoA comprising (a) (i) an enzyme capable of converting acetyl-CoA into malonyl-CoA (step XIV as shown in FIG. 1); and (ii) an enzyme capable of condensing malonyl-CoA and acetyl-CoA into acetoacetyl-CoA (step XV as shown in FIG. 1); or (b) an enzyme capable of directly condensing two molecules of acetyl-CoA into acetoacetyl-CoA (step XIII as shown in FIG. 1).
[0759] As regards the above-mentioned enzymes as well as preferred embodiments of said enzymes, the same applies to the use of the recombinant organism or microorganism for the production of isobutene as has been set forth above for the methods and recombinant organisms or microorganisms according to the present invention.
[0760] Furthermore, the present invention relates to a composition comprising 3-methylcrotonic acid and a recombinant organism or microorganism, wherein said recombinant organism or microorganism expresses (i) an enzyme capable of enzymatically converting 3-methylcrotonic acid into isobutene (step I as shown in FIG. 1); and/or (ii) an enzyme capable of enzymatically converting 3-methylcrotonyl-CoA into 3-methylcrotonic acid (step VIa, VIb or VIc as shown in FIG. 1), and/or which further expresses an enzyme capable of enzymatically converting 3-methylglutaconyl-CoA into 3-methylcrotonyl-CoA (step VII as shown in FIG. 1), and/or which further expresses an enzyme capable of enzymatically converting 3-hydroxy-3-methylglutaryl-CoA into 3-methylglutaconyl-CoA (step VIII as shown in FIG. 1), and/or which further expresses an enzyme capable of enzymatically condensing acetoacetyl-CoA and acetyl-CoA into 3-hydroxy-3-methylglutaryl-CoA (step IX as shown in FIG. 1) and/or which further expresses an enzyme capable of enzymatically converting acetyl-CoA into acetoacetyl-CoA comprising (a) (i) an enzyme capable of converting acetyl-CoA into malonyl-CoA (step XIV as shown in FIG. 1); and (ii) an enzyme capable of condensing malonyl-CoA and acetyl-CoA into acetoacetyl-CoA (step XV as shown in FIG. 1); or (b) an enzyme capable of directly condensing two molecules of acetyl-CoA into acetoacetyl-CoA (step XIII as shown in FIG. 1).
[0761] Furthermore, the present invention relates to a composition comprising 3-methylcrotonic acid and (i) an enzyme capable of enzymatically converting 3-methylcrotonic acid into isobutene (step I as shown in FIG. 1); and/or (ii) an enzyme capable of enzymatically converting 3-methylcrotonyl-CoA into 3-methylcrotonic acid (step VIa, VIb or VIc as shown in FIG. 1); and/or an enzyme capable of enzymatically converting 3-methylglutaconyl-CoA into 3-methylcrotonyl-CoA (step VII as shown in FIG. 1); and/or an enzyme capable of enzymatically converting 3-hydroxy-3-methylglutaryl-CoA into 3-methylglutaconyl-CoA (step VIII as shown in FIG. 1); and/or an enzyme capable of enzymatically condensing acetoacetyl-CoA and acetyl-CoA into 3-hydroxy-3-methylglutaryl-CoA (step IX as shown in FIG. 1) and/or an enzyme capable of enzymatically converting acetyl-CoA into acetoacetyl-CoA comprising (a) (i) an enzyme capable of converting acetyl-CoA into malonyl-CoA (step XIV as shown in FIG. 1); and (ii) an enzyme capable of condensing malonyl-CoA and acetyl-CoA into acetoacetyl-CoA (step XV as shown in FIG. 1); or (b) an enzyme capable of directly condensing two molecules of acetyl-CoA into acetoacetyl-CoA (step XIII as shown in FIG. 1).
[0762] As regards the above-mentioned enzymes as well as preferred embodiments of said enzymes, the same applies to the use of the recombinant organism or microorganism for the production of isobutene as has been set forth above for the mehtods and recombinant organisms or microorganisms according to the present invention.
[0763] Furthermore, the present invention relates to a composition comprising 3-methyl-3-butenoic acid and a recombinant organism or microorganism, wherein said recombinant organism or microorganism expresses (i) an enzyme capable of enzymatically converting 3-methyl-3-butenoic acid into isobutene (step XVI as shown in FIG. 1) and/or (ii) an enzyme capable of enzymatically converting 3-methyl-3-butenoyl-CoA into 3-methyl-3-butenoic acid (step XVII as shown in FIG. 1), and/or which further expresses an enzyme capable of enzymatically converting 3-methylglutaconyl-CoA into 3-methyl-3-butenoyl-CoA (step XVIII as shown in FIG. 1), and/or which further expresses an enzyme capable of enzymatically converting 3-hydroxy-3-methylglutaryl-CoA into 3-methylglutaconyl-CoA (step VIII as shown in FIG. 1), and/or which further expresses an enzyme capable of enzymatically condensing acetoacetyl-CoA and acetyl-CoA into 3-hydroxy-3-methylglutaryl-CoA (step IX as shown in FIG. 1) and/or which further expresses an enzyme capable of enzymatically converting acetyl-CoA into acetoacetyl-CoA comprising (a) (i) an enzyme capable of converting acetyl-CoA into malonyl-CoA (step XIV as shown in FIG. 1); and (ii) an enzyme capable of condensing malonyl-CoA and acetyl-CoA into acetoacetyl-CoA (step XV as shown in FIG. 1); or (b) an enzyme capable of directly condensing two molecules of acetyl-CoA into acetoacetyl-CoA (step XIII as shown in FIG. 1).
[0764] Furthermore, the present invention relates to a composition comprising 3-methyl-3-butenoic acid and (i) an enzyme capable of enzymatically converting 3-methyl-3-butenoic acid into isobutene (step XVI as shown in FIG. 1) and/or (ii) an enzyme capable of enzymatically converting 3-methyl-3-butenoyl-CoA into 3-methyl-3-butenoic acid (step XVII as shown in FIG. 1); and/or an enzyme capable of enzymatically converting 3-methylglutaconyl-CoA into 3-methyl-3-butenoyl-CoA (step XVIII as shown in FIG. 1); and/or an enzyme capable of enzymatically converting 3-hydroxy-3-methylglutaryl-CoA into 3-methylglutaconyl-CoA (step VIII as shown in FIG. 1); and/or an enzyme capable of enzymatically condensing acetoacetyl-CoA and acetyl-CoA into 3-hydroxy-3-methylglutaryl-CoA (step IX as shown in FIG. 1) and/or an enzyme capable of enzymatically converting acetyl-CoA into acetoacetyl-CoA comprising (a) (i) an enzyme capable of converting acetyl-CoA into malonyl-CoA (step XIV as shown in FIG. 1); and (ii) an enzyme capable of condensing malonyl-CoA and acetyl-CoA into acetoacetyl-CoA (step XV as shown in FIG. 1); or (b) an enzyme capable of directly condensing two molecules of acetyl-CoA into acetoacetyl-CoA (step XIII as shown in FIG. 1) for the production of isobutene.
[0765] As regards the above-mentioned enzymes as well as preferred embodiments of said enzymes, the same applies to the use of the recombinant organism or microorganism for the production of isobutene as has been set forth above for the mehtods and recombinant organisms or microorganisms according to the present invention.
[0766] In a further aspect, the present invention relates to any of the above-described compositions, wherein the organism or microorganism is an organism or microorganism which additionally further expresses
[0767] a) an enzyme capable of enzymatically converting 3-hydroxyisovalerate (HIV) into 3-methylcrotonic acid with a concomitant transfer of CoA from 3-methylcrotonyl-CoA on 3-hydroxyisovalerate (HIV) to result in 3-hydroxyisovaleryl-CoA (step Xa as schematically shown in FIG. 19); and/or
[0768] b) an enzyme capable of enzymatically converting 3-hydroxyisovalerate (HIV) into 3-hydroxyisovaleryl-CoA (step Xb as schematically shown in FIG. 20); and/or
[0769] c) an enzyme capable of enzymatically converting 3-hydroxyisovaleryl-CoA into 3-methylcrotonyl-CoA (step XI as schematically shown in FIG. 21); and/or
[0770] d) an enzyme capable of enzymatically converting 3-hydroxyisovalerate (HIV) into 3-hydroxyisovaleryl-CoA (step XII as schematically shown in FIG. 22)
[0771] as described herein above.
[0772] In a further aspect, the present invention relates to any of the above-described compositions which further additionally comprises
[0773] a) an enzyme capable of enzymatically converting 3-hydroxyisovalerate (HIV) into 3-methylcrotonic acid with a concomitant transfer of CoA from 3-methylcrotonyl-CoA on 3-hydroxyisovalerate (HIV) to result in 3-hydroxyisovaleryl-CoA (step Xa as schematically shown in FIG. 19); and/or
[0774] b) and enzyme capable of enzymatically converting 3-hydroxyisovalerate (HIV) into 3-hydroxyisovaleryl-CoA (step Xb as schematically shown in FIG. 20); and/or
[0775] c) an enzyme capable of enzymatically converting 3-hydroxyisovaleryl-CoA into 3-methylcrotonyl-CoA (step XI as schematically shown in FIG. 21); and/or
[0776] d) an enzyme capable of enzymatically converting 3-hydroxyisovalerate (HIV) into 3-hydroxyisovaleryl-CoA (step XII as schematically shown in FIG. 22) as described herein above.
[0777] As regards the above-mentioned enzymes as well as preferred embodiments of said enzymes, the same applies to the recombinant organism or microorganism as has been set forth above for the methods according to the present invention.
[0778] FIG. 1: shows an artificial pathway for isobutene production from acetyl-CoA via 3-methylcrotonic acid. Moreover, enzymatic recycling of metabolites which may occur during the pathway are shown in steps Xa, Xb, XI and XII.
[0779] FIG. 2A: Schematic reaction of the enzymatic prenylation of a flavin mononucleotide (FMN) into the corresponding modified (prenylated) flavin cofactor.
[0780] FIG. 2B: Schematic reaction of the enzymatic conversion of 3-methylcrotonic acid into isobutene.
[0781] FIG. 3: Schematic reaction of the enzymatic conversion of 3-hydroxyisovalerate (HIV) into 3-methylcrotonic acid.
[0782] FIG. 4: Schematic reaction of the enzymatic condensation of acetyl-CoA and acetone into 3-hydroxyisovalerate.
[0783] FIG. 5: Schematic reaction of the enzymatic conversion of acetoacetate into acetone.
[0784] FIG. 6: Schematic reaction of the enzymatic conversion of acetoacetyl-CoA into acetoacetate by hydrolysing the CoA thioester of acetoacetyl-CoA resulting in acetoacetate.
[0785] FIG. 7: Schematic reaction of the enzymatic conversion of acetoacetyl-CoA into acetoacetate by transferring the CoA group of acetoacetyl-CoA on acetate, resulting in the formation of acetoacetate and acetyl-CoA.
[0786] FIG. 8: Schematic reaction of the enzymatic conversion of 3-methylcrotonyl-CoA into 3-methylcrotonic acid.
[0787] FIG. 9: Schematic reaction of the enzymatic conversion of 3-methylcrotonyl-CoA into 3-methylcrotonic acid via step VIa as shown in FIG. 1.
[0788] FIG. 10: Schematic reaction of the enzymatic conversion of 3-methylcrotonyl-CoA into 3-methylcrotonic acid via step VIb as shown in FIG. 1.
[0789] FIG. 11: Schematic reaction of the enzymatic conversion of 3-methylcrotonyl-CoA into 3-methylcrotonic acid via step VIc as shown in FIG. 1.
[0790] FIG. 12: Schematic reaction of the enzymatic conversion of 3-methylglutaconyl-CoA into 3-methylcrotonyl-CoA.
[0791] FIG. 13: Schematic reaction of the enzymatic conversion of 3-hydroxy-3-methylglutaryl-CoA into 3-methylglutaconyl-CoA.
[0792] FIG. 14: Schematic reaction of the enzymatic condensation of acetylCoA and acetoacetyl-CoA into 3-hydroxy-3-methylglutaryl-CoA.
[0793] FIG. 15: Schematic reaction of the enzymatic condensation of two molecules of acetyl-CoA into acetoacetyl-CoA.
[0794] FIG. 16: Schematic reaction of the enzymatic conversion of acetyl-CoA into malonyl-CoA.
[0795] FIG. 17: Schematic reaction of the enzymatic condensation of malonyl-CoA and acetyl-CoA into acetoacetyl-CoA.
[0796] FIG. 18: shows enzymatic recycling steps of metabolites (steps Xa, Xb, XI and XII as also shown in FIG. 1) which may occur during the pathway of isobutene production from acetyl-CoA via 3-methylcrotonic acid.
[0797] FIG. 19: Schematic reaction of the enzymatic conversion of 3-hydroxyisovalerate (HIV) into 3-methylcrotonic acid with a concomitant transfer of CoA from 3-methylcrotonyl-CoA on 3-hydroxyisovalerate (HIV) to result in 3-hydroxyisovaleryl-CoA.
[0798] FIG. 20: Schematic reaction of the enzymatic conversion of 3-hydroxyisovalerate (HIV) into 3-hydroxyisovaleryl-CoA.
[0799] FIG. 21: Schematic reaction of the enzymatic conversion of 3-hydroxyisovaleryl-CoA into 3-methylcrotonyl-CoA.
[0800] FIG. 22: Schematic reaction of the general enzymatic conversion of 3-hydroxyisovalerate (HIV) into 3-hydroxyisovaleryl-CoA.
[0801] FIG. 23: Schematic reaction of the enzymatic conversion of 3-hydroxyisovalerate (HIV) into 3-hydroxyisovaleryl-CoA via 3-hydroxyisovaleryl-adenosine monophosphate.
[0802] FIG. 24: Schematic reaction of the enzymatic conversion of 3-hydroxyisovalerate (HIV) into 3-hydroxyisovaleryl-CoA via 3-hydroxyisovaleryl phosphate.
[0803] FIG. 25: Schematic reaction of the enzymatic conversion of 3-methyl-3-butenoic acid into isobutene.
[0804] FIG. 26: Schematic reaction of the enzymatic conversion of 3-methyl-3-butenoyl-CoA into 3-methyl-3-butenoic acid.
[0805] FIG. 27: Schematic reaction of the enzymatic conversion of 3-methyl-3-butenoyl-CoA into 3-methyl-3-butenoic acid by making use of a CoA-transferase.
[0806] FIG. 28: Schematic reaction of the enzymatic conversion of 3-methyl-3-butenoyl-CoA into 3-methyl-3-butenoic acid by making use of a thioester hydrolase.
[0807] FIG. 29: Schematic reaction of the enzymatic conversion of 3-methyl-3-butenoyl-CoA into 3-methyl-3-butenoic acid in a two-step reaction via 3-methyl-3-butenoyl phosphate.
[0808] FIG. 30: Schematic reaction of the enzymatic conversion of 3-methylglutaconyl-CoA into 3-methyl-3-butenoyl-CoA.
[0809] FIG. 31: Structure of a phosphopantetheine moiety.
[0810] FIG. 32: Schematic illustration for the conversion of 3-methylcrotonyl-CoA into 3-methylcrotonic acid via 3-methylbutyryl-CoA and 3-methylbutyric acid.
[0811] FIG. 33: shows an overlay of typical GC-chromatograms obtained for the catalytic assay of UbiD protein from Saccharomyces cerevisiae with the corresponding controls as outlined in Example 2.
[0812] FIG. 34A: shows an overlay of typical HPLC-chromatograms (analysis of 3-methylcrotonyl-CoA, 3-methylcrotonic acid and CoA-SH) obtained for the "Enzymatic assay" (assay A, Example 3) and the "Enzyme-free assay" (assay H, Example 3). The consumption of 3-methylcrotonyl-CoA with simultaneous production of CoA-SH and 3-methylcrotonic acid was observed in the enzymatic assay combining phosphate butyryltransferase with butyrate kinase.
[0813] FIG. 34B: shows an overlay of typical HPLC-chromatograms (analysis of ADP and ATP) obtained for the "Enzymatic assay" (assay A, Example 3) and the "Enzyme-free assay" (assay H, Example 3). The consumption of ADP with simultaneous production of ATP was observed in the enzymatic assay combining phosphate butyryltransferase with butyrate kinase.
[0814] FIG. 35: shows the results of the production of 3-methylcrotonic acid and ATP in the enzymatic assays, comprising phosphate butyryltransferase from Bacillus subtilis combined with different butyrate kinases. Moreover, the production of 3-methylcrotonic acid and ATP in control assays is shown.
[0815] FIG. 36: shows the results of the production of 3-methylcrotonic acid and ATP in the enzymatic assays, comprising phosphate butyryltransferase from from Enterococcus faecalis combined with different butyrate kinases. Moreover, the production of 3-methylcrotonic acid and ATP in different control assays is shown.
[0816] FIG. 37: shows an example of typical HPLC-chromatogram obtained for the enzymatic assay with acyl-CoA thioesterase II from Pseudomonas putida as outlined in Example 5.
[0817] FIG. 38: shows an overlay of typical chromatograms obtained for the production of isobutene from 3-methylcrotonic in a recombinant E. coli strain overexpressing UbiD protein from Saccharomyces cerevisiae and UbiX protein from Escherichia coli (strain A) or overexpressing UbiD protein from Saccharomyces cerevisiae alone (strain B) or carrying an empty vector (negative control, strain C).
[0818] FIG. 39: shows an overlay of typical chromatograms obtained for the production of isobutene from 3-methylcrotonyl-CoA in the one pot enzymatic assay as outlined in Example 7, and the corresponding controls.
[0819] FIGS. 40A and 40B: shows chromatograms for enzymatic assays (FIG. 40A) and control assays (FIG. 40B). A significant quantity of acetyl-CoA and 3-methylcrotonic acid was produced from acetate and 3-methylcrotonyl-CoA in the presence of Co-A transferase (FIG. 40A) while no product was observed in the control assay without enzyme (FIG. 40B).
[0820] FIG. 41: shows 3-methylglutaconyl-CoA (MG-CoA) peak areas obtained from HPLC-based analysis.
[0821] FIG. 42: Metabolic pathway for the biosynthesis of isobutene from acetyl-CoA via 3-methycrotonic acid, implemented in Escherichia coli.
[0822] In this specification, a number of documents including patent applications are cited. The disclosure of these documents, while not considered relevant for the patentability of this invention, is herewith incorporated by reference in its entirety. More specifically, all referenced documents are incorporated by reference to the same extent as if each individual document was specifically and individually indicated to be incorporated by reference.
[0823] The invention will now be described by reference to the following examples which are merely illustrative and are not to be construed as a limitation of the scope of the present invention.
EXAMPLES
General Methods and Materials
[0824] All reagents and materials used in the experiences were obtained from Sigma-Aldrich Company (St. Louis, Mo.) unless otherwise specified. Materials and methods suitable for growth of bacterial cultures and protein expression are well known in the art.
Example 1
Gene Synthesis, Cloning and Expression of Recombinant Proteins
[0825] The sequences of the studied enzymes were generated by oligonucleotide concatenation to fit the codon usage of E. coli (genes were commercially synthesized by GeneArt.RTM.). A stretch of 6 histidine codons was inserted after the methionine initiation codon to provide an affinity tag for purification. The gene thus synthesized was cloned in a pET-25b (+) expression vector (vectors were constructed by GeneArt.RTM.). Vector pCAN contained gene coding for UbiX protein (3-octaprenyl-4-hydroxybenzoate carboxy-lyase partner protein) from Escherichia coli (Uniprot Accession Number: P0AG03) was purchased from NAIST (Nara Institute of Science and Technology, Japan, ASKA collection). Provided vector contained a stretch of 6 histidine codons after the methionine initiation codon.
[0826] Competent E. coli BL21 (DE3) cells (Novagen) were transformed with these vectors according to standard heat shock procedure. The transformed cells were grown with shaking (160 rpm) using ZYM-5052 auto-induction medium (Studier F W, Prot. Exp. Pur. 41, (2005), 207-234) for 6 h at 30.degree. C. and protein expression was continued at 18.degree. C. overnight (approximately 16 h). For the recombinant strain over-expressing UbiX from E. coli, 500 .mu.M of Flavin Mononucleotide (FMN) were added to the growth medium. The cells were collected by centrifugation at 4.degree. C., 10,000 rpm for 20 min and the pellets were stored at -80.degree. C.
[0827] Protein Purification and Concentration
[0828] The pellets from 200 ml of cultured cells were thawed on ice and resuspended in 6 ml of 50 mM Tris-HCl buffer pH 7.5 containing 100 mM NaCl in the case of the recombinant strain overexpressing UbiX protein and in 6 ml of 50 mM Tris-HCl buffer pH 7.5, 10 mM MgCl.sub.2, 10 mM imidazole and 5 mM DTT in the case of the recombinant strain overexpressing UbiD protein. Twenty microliters of lysonase (Novagen) were added. Cells were then incubated 10 min at room temperature, returned to ice for 20 min and the lysis was completed by sonication 3.times.15 seconds. The cellular lysate contained UbiX protein was reserved on ice. The bacterial extracts contained UbiD proteins were then clarified by centrifugation at 4.degree. C., 4000 rpm for 40 min. The clarified bacterial lysates were loaded onto a PROTINO-2000 Ni-TED column (Macherey-Nagel) allowing adsorption of 6-His tagged proteins. Columns were washed and the enzymes of interest were eluted with 6 ml of 100 mM Tris-HCl buffer pH 7.5 containing 100 mM NaCl and 250 mM imidazole. Eluates were then concentrated, desalted on Amicon Ultra-4 10 kDa filter unit (Millipore) and enzymes were resuspended in 50 mM Tris-HCl buffer pH 7.5, containing 50 mM NaCl and 5 mM DTT.
[0829] The purity of proteins thus purified varied from 80% to 90% as estimated by SDS-PAGE analysis. Protein concentration was determined by direct UV 280 nm measurement on the NanoDrop 1000 spectrophotometer (Thermo Scientific) and by Bradford assay (BioRad).
Example 2
In Vitro Decarboxylation of 3-Methylcrotonic Acid into Isobutene Catalyzed by an Association of Lysate, Containing UbiX Protein, with Purified UbiD Protein
[0830] 0.5 M stock solution of 3-methylcrotonic acid was prepared in water and adjusted to pH 7.0 with 10 M solution of NaOH.
[0831] Two UbiD proteins (Table C) were purified according to the procedure described in Example 1.
[0832] Enzymatic assays were carried out in 2 ml glass vials (Interchim) under the following conditions:
[0833] 50 mM Tris-HCl buffer pH 7.5
[0834] 20 mM NaCl
[0835] 10 mM MgCl.sub.2
[0836] 5 mM DTT
[0837] 50 mM 3-methylcrotonic acid
[0838] 1 mg/ml purified UbiD protein
[0839] 50 .mu.l lysate contained UbiX protein
[0840] Total volume of the assays were 300 .mu.l.
[0841] A series of control assays were performed in parallel (Table C).
[0842] The vials were sealed and incubated for 120 min at 30.degree. C. The assays were stopped by incubating for 2 min at 80.degree. C. and the isobutene formed in the reaction headspace was analysed by Gas Chromatography (GC) equipped with Flame Ionization Detector (FID).
[0843] For the GC analysis, one ml of the headspace gas was separated in a Bruker GC-450 system equipped with a GS-alumina column (30 m.times.0.53 mm) (Agilent) using isothermal mode at 130.degree. C. Nitrogen was used as carrier gas with a flow rate of 6 ml/min.
[0844] The enzymatic reaction product was identified by comparison with an isobutene standard. Under these GC conditions, the retention time of isobutene was 2.42 min.
[0845] A significant production of isobutene from 3-methylcrotonic acid was observed in the combined assays (UbiD protein+UbiX protein). Incubation of lysate containing UbIX protein alone did not result in isobutene production. These data indicate that the two enzymes present in the assays cooperated to perform the decarboxylation of 3-methylcrotonic acid into isobutene. A typical chromatogram obtained in the assay with UbiD protein from Saccharomyces cerevisiae is shown on FIG. 33.
TABLE-US-00003 TABLE C Isobutene production, arbitrary Assay composition units UbiD protein from C. dubliniensis 470 (Uniprot Acession Number: B9WJ66) + lysate contained UbiX protein from E. coli + substrate UbiD protein from C. dubliniensis (Uniprot 9.2 Acession Number: B9WJ66) + substrate UbiD protein from S. cervisiae (Uniprot 1923 Acession Number : Q03034) + lysate contained UbiX protein from E. coli + substrate UbiD protein from S. cerivisae (Uniprot 31 Acession Number: Q03034) + substrate Lysate contained UbiX protein 0 from E. coli + substrate "No substrate control": UbiD protein from 0 C. dubliniensis (Uniprot Acession Number: B9WJ66) + lysate contained UbiX protein from E. coli, without substrate "No substrate control": UbiD protein 0 from S. cervisiae (Uniprot Acession Number : Q03034) + lysate contained UbiX protein from E. coli, without substrate
Example 3
Conversion of 3-Methylcrotonyl-CoA and ADP into 3-Methylcrotonic Acid and ATP Catalysed by the Combined Action of Phosphate Butyryltransferase from Bacillus subtilis and Butyrate Kinase from Lactobacillus casei or Geobacillus sp
[0846] The corresponding enzymes were obtained and purified according to the procedure described in Example 1.
[0847] The enzymatic assays were conducted in a total reaction volume of 0.2 ml The standard reaction mixture contained:
[0848] 50 mM potassium phosphate buffer pH 7.5
[0849] 4 mM 3-methylcrotonyl-CoA
[0850] 4 mM ADP
[0851] 10 mM MgCl.sub.2
[0852] 10 mM NaCl
[0853] 0.2 mg/ml purified phosphate butyryltransferase from Bacillus subtilis (Uniprot Accession Number: P54530)
[0854] 0.2 mg/ml purified butyrate kinase from Lactobacillus casei (Uniprot Accession Number: K0N529) or Geobacillus sp. (Uniprot accession number: L8A0E1).
[0855] A series of controls were performed in parallel (Assays C-H Table D).
TABLE-US-00004 TABLE D Assay composition A B C D E F G H 3-methylcrotonyl-CoA + + + + + + + + ADP + + + + + + phosphate butyryltransferase + + + + + from Bacillus subtilis butyrate kinase from + + + Lactobacillus casei butyrate kinase from + + + Geobacillus sp
[0856] Assays were incubated for 20 min with shaking at 30.degree. C.
[0857] After an incubation period, the reactions were stopped by heating the reaction medium 4 min at 90.degree. C. The samples were centrifuged, filtered through a 0.22 .mu.m filter and the clarified supernatants were transferred into a clean vial for the further analysis. The consumption of ADP and 3-methylcrotonyl-CoA, and the formation of ATP, 3-methylcrotonic acid and free coenzyme A (CoA-SH) were followed by using HPLC-based methods.
[0858] HPLC-Based Analysis of ADP and ATP
[0859] HPLC analysis was performed using 1260 Inifinity LC System (Agilent), equipped with column heating module and RI detector. 2 .mu.l of samples were separated on Polaris C18-A column (150.times.4.6 mm, 5 .mu.m particle size, column temp. 30.degree. C.) with a mobile phase flow rate of 1.5 ml/min. The separation was performed using 8.4 mM sulfuric acid in H.sub.2O/MeOH mixed solution (99/1) (V/V). In these conditions, the retention time of ADP and ATP were 2.13 min and 2.33 min, respectively.
[0860] HPLC Based Analysis of 3-Methylcrotonyl-CoA, 3-Methylcrotonic Acid and Free Coenzyme A (CoA-SH)
[0861] HPLC analysis was performed using 1260 Inifinity LC System (Agilent), equipped with column heating module and UV detector (260 nm). 1 .mu.l of samples were separated on Zorbax SB-Aq column (250.times.4.6 mm, 5 .mu.m particle size, column temp. 30.degree. C.), with a mobile phase flow rate of 1.5 ml/min. The separation was performed using mixed A (H.sub.2O containing 8.4 mM sulfuric acid) and B (acetonitrile) solutions in a linear gradient (0% B at initial time 0 min.fwdarw.70% B at 8 min). In these conditions, the retention time of 3-methylcrotonyl-CoA, 3-methylcrotonic acid and free coenzyme A (CoA-SH) were 5.38 min, 5.73 min and 4.07 min, respectively.
[0862] Typical chromatograms obtained for the enzymatic assay A and enzyme-free assay H are shown on FIGS. 34A and 34B.
[0863] The results of HPLC analysis are summarized in FIG. 35.
[0864] The obtained data indicate that 3-methylcrotonyl-CoA was converted into 3-methylcrotonic acid with the concomitant generation of ATP from ADP in a two-step reaction, catalyzed respectively by two enzymes (assays A and B). Thus, the conversion occurred through the formation of the intermediate 3-methylcrotonyl phosphate followed by the transfer of phosphate group from this intermediate on ADP thereby releasing ATP.
[0865] A certain quantity of 3-methylcrotonic acid was produced without simultaneous generation of ATP, when phosphate butyryltransferase was used alone (assay E). This production is due to a spontaneous hydrolysis of 3-methylcrotonyl phosphate generated by the action of phosphate butyryltransferase.
[0866] The production of 3-methylcrotonic acid was observed in the same manner for the control assays without ADP (assays C and D). This production was also due to a hydrolysis of the 3-methylcrotonyl phosphate generated by the action of phosphate butyryltransferase.
Example 4
Conversion of 3-Methylcrotonyl-CoA and ADP into 3-Methylcrotonic Acid and ATP Catalysed by the Combined Action of the Phosphate Butyryltransferase from Enterococcus faecalis and Butyrate Kinase from Lactobacillus casei or Geobacillus sp
[0867] The corresponding enzymes were obtained and purified according to the procedure described in Example 1.
[0868] The enzymatic assays were conducted in a total reaction volume of 0.2 ml
[0869] The standard reaction mixture contained:
[0870] 50 mM potassium phosphate buffer pH 7.5
[0871] 4 mM 3-methylcrotonyl-CoA
[0872] 4 mM ADP
[0873] 10 mM MgCl.sub.2
[0874] 10 mM NaCl
[0875] 0.2 mg/ml purified phosphate butyryltransferase from Enterococcus faecalis (Uniprot Accession Number: S4BZL5)
[0876] 0.2 mg/ml purified butyrate kinase from Lactobacillus casei (Uniprot Accession Number: K0N529) or Geobacillus sp. (Uniprot Accession Number: L8A0E1)
[0877] A series of controls were performed in parallel (Assays C-H Table E).
TABLE-US-00005 TABLE E Assay composition A B C D E F G H 3-methylcrotonyl-CoA + + + + + + + + ADP + + + + + + phosphate + + + + + butyryltransferase from Enterococcus faecalis butyrate kinase from + + + Lactobacillus casei butyrate kinase from + + + Geobacillus sp
[0878] Assays were incubated for 20 min with shaking at 30.degree. C.
[0879] After an incubation period, the reactions were stopped by heating the reaction medium 4 min at 90.degree. C. The samples were centrifuged, filtered through a 0.22 .mu.m filter and the clarified supernatants were transferred into a clean vial for further analysis. The consumption of ADP and 3-methylcrotonyl-CoA, and the formation of ATP and 3-methylcrotonic acid and free coenzyme A (CoA-SH) were followed by HPLC analysis according to the methods described in Example 3.
[0880] The results of HPLC analysis are summarized in FIG. 36.
[0881] The obtained data indicate that 3-metylcrotonyl-CoA was converted into 3-methylcrotonic acid with the concomitant generation of ATP from ADP in a two-step reaction, catalyzed respectively by two enzymes (assays A and B). Thus, the conversion occurred through the formation of the intermediate 3-methylcrotonyl phosphate followed by transfer of phosphate group from this intermediate on ADP thereby releasing ATP.
[0882] A significant production of 3-methylcrotonic acid, without simultaneous generation of ATP, was observed when phosphate butyryltransferase was used alone (assay E). This production was due to a hydrolysis of 3-methylcrotonyl phosphate generated by the action of phosphate butyryltransferase.
[0883] The production of 3-methylcrotonic acid was observed in the same manner for the control assays without ADP (assays C and D). This production was also due to a hydrolysis of the 3-methylcrotonyl phosphate generated by the action of phosphate butyryltransferase.
Example 5
Enzyme-Catalyzed Hydrolysis of 3-Methylcrotonyl-CoA into 3-Methylcrotonic Acid and Free Coenzyme A
[0884] The gene coding for acyl-CoA thioesterase II from Pseudomonas putida was synthesized according to the procedure described in Example 1.
[0885] Vector pCAN contained gene encoding acyl-CoA thioesterase 2 (TesB) from Escherichia coli were purchased from NAIST (Nara Institute of Science and Technology, Japan, ASKA collection). Provided vector contained a stretch of 6 histidine codons after the methionine initiation codon. The corresponding enzymes were produced according to the procedure described in Example 1.
[0886] The enzymatic assays were conducted in a total reaction volume of 0.2 ml.
[0887] The standard reaction mixture contained:
[0888] 50 mM HEPES pH 7.0
[0889] 10 mM 3-methylcrotonyl-CoA
[0890] 20 mM MgCl2
[0891] 20 mM NaCl
[0892] 1 mg/ml purified recombinant thioesterase.
[0893] Control assays were performed in which either no enzyme was added, or no substrate was added.
[0894] The assays were incubated for 30 min with shaking at 30.degree. C., the reactions were stopped by the addition of 0.1 ml acetonitrile and the samples were then analysed by HPLC-based procedure.
[0895] HPLC based analysis of the consumption of 3-methylcrotonyl-CoA and the formation of 3-methylcrotonic acid and free coenzyme A (CoA-SH)
[0896] HPLC analysis was performed using 1260 Inifinity LC System (Agilent), equipped with column heating module and UV detector (210 nm). 5 .mu.l of samples were separated on Zorbax SB-Aq column (250.times.4.6 mm, 5 .mu.m particle size, column temp. 30.degree. C.), with a mobile phase flow rate of 1.5 ml/min. The separation was performed using mixed A (H.sub.2O containing 8.4 mM sulfuric acid) and B (acetonitrile) solutions in a linear gradient (0% B at initial time 0 min.fwdarw.70% B at 8 min). Commercial 3-methylcrotonyl-CoA, 3-methylcrotonic acid (Sigma-Aldrich) and CoA-SH (Sigma-Aldrich) were used as references. In these conditions, the retention time of free coenzyme A (CoA-SH), 3-methylcrotonyl-CoA and 3-methylcrotonic acid were 4.05, 5.38 and 5.83 min, respectively.
[0897] No 3-methylcrotonic acid signal was observed in control assays.
[0898] The both studied thioesterases catalyzed the hydrolysis of 3-methylcrotonyl-CoA with the formation of 3-methylcrotonic acid. An example of chromatogram obtained with acyl-CoA thioesterase II from Pseudomonas putida is shown on FIG. 37.
[0899] The production of 3-methylcrotonic acid observed in the enzymatic assays are shown in Table F.
TABLE-US-00006 TABLE F Uniprot Accession 3-methylcrotonic Gene name Organism Number acid produced, mM tesB Escherichia coli POAGG2 0.6 tesB Pseudomonas putida Q88DR1 3.1
Example 6
In Vivo Decarboxylation of 3-Methylcrotonic Acid Into Isobutene Catalyzed by an Association of UbiX Protein from Escherichia coli and UbiD Protein from Saccharomyces cerevisiae
[0900] The gene coding for UbiD protein from S. cerevisiae (Uniprot Accession Number: Q03034) was codon optimized for expression in E. coli and synthesized by GeneArt.RTM. (Life Technologies). This studied gene was then PCR amplified from the pMK-RQ vector (master plasmid provided by GeneArt) using forward primer with Ncol restriction site and a reverse primer, containing BamHl restriction site. The gene coding for UbiX protein from E. coli (Uniprot Accession Number: P0AG03) was amplified by PCR with a forward primer, containing Ndel restriction site and a reverse primer containing Kpnl restriction site. The previously described pCAN vector (Example 1) served as template for this PCR step. These two obtained PCR products (UbiD protein and UbiX protein) were cloned into pETDuet.TM.-1 co-expression vector (Novagen). The constructed recombinant plasmid was verified by sequencing. Competent E. coli BL21(DE3) cells (Novagen) were transformed with this vector according to standard heat shock procedure and plated out onto LB agar plates supplemented with ampicillin (0.1 mg/ml) (termed "strain A").
[0901] BL21(DE3) strain transformed with pET-25b(+) vector, carrying only the gene of UbiD protein from S. cerevisae was also used in this study (termed "strain B"). BL21(DE3) strain transformed with an empty pET-25b(+) vector was used as a negative control in the subsequent assays (termed "strain C").
[0902] Single transformants were used to inoculate LB medium, supplemented with ampicillin, followed by incubation at 30.degree. C. overnight. 1 ml of this overnight culture was used to inoculate 300 ml of ZYM-5052 auto-inducing media (Studier FW (2005), local citation). The cultures were grown for 20 hours at 30.degree. C. and 160 rpm shaking.
[0903] A volume of cultures corresponding to OD600 of 30 was removed and centrifuged. The pellet was resuspended in 30 ml of MS medium (Richaud C., Mengin-Leucreulx D., Pochet S., Johnson E J., Cohen G N. and MarHere P, The Journal of Biological Chemistry, 268, (1993), 26827-26835), containing glucose (45 g/L) and MgSO4 (1 mM) and supplemented with 10 mM 3-methylcrotonic acid. These cultures were then incubated in 160 ml bottles, sealed with a screw cap, at 30.degree. C. with shaking for 22 h. The pH value of the cultures was adjusted to 8.5 after 8 hours of incubation by using 30% NH.sub.4OH.
[0904] After an incubation period, the isobutene produced in the headspace was analysed by Gas Chromatography (GC) equipped Flame Ionization Detector (FID). One ml of the headspace gas phase was separated and analysed according to the method described in Example 2.
[0905] No isobutene was formed with the control strain C carrying an empty vector. The highest production of isobutene was observed for the strain A over-expressing the both genes, UbiD protein from S. cerevisiae and UbiX protein from E. coli. A significant production of isobutene was observed for the strain B over-expressing UbiD protein alone. Thus, endogenous UbiX of E. coli can probably contribute to activate UbiD protein from S. cerivisae (FIG. 38).
Example 7
One Pot Enzymatic Synthesis of Isobutene from 3-Methylcrotonyl-CoA Catalyzed by an Association of Phosphotransbutyrylase from Bacillus subtilis, Butyrate Kinase from Geobacillus sp. and UbiD Protein from Saccharomyces cerevisiae
[0906] A pETDuet.TM.-1 co-expression vector, carrying the UbiD gene from Saccharomyces cerevisiae (Uniprot Accession Number Q03034) and the UbiX gene from Escherichia coli (Uniprot Accession Number P0AG03) (Example 6), was used to produce and purify UbiD protein according to the protocol described in Example 1. The phosphotransbutyrylase from Bacillus subtilis and the butyrate kinase from Geobacillus sp. were purified as described in Example 4.
[0907] The enzymatic assays were conducted in a total reaction volume of 0.3 ml.
[0908] The standard reaction mixture contained:
[0909] 50 mM Tris-HCl pH 7.5
[0910] 10 mM 3-methylcrotonyl-CoA
[0911] 10 mM MgCl.sub.2
[0912] 10 mM NaCl
[0913] 10 mM potassium phosphate buffer pH 7.5.
[0914] 10 mM ADP
[0915] 0.02 mg/ml purified phosphotransbutyrylase from B. subtilis
[0916] 0.02 mg/ml purified butyrate kinase from Geobacillus sp.
[0917] 1 mg/ml purified UbiD from S. cerevisiae
[0918] Catalysis was conducted at 30.degree. C. during 18 h.
[0919] A series of control assays were performed in parallel in which either no UbiD protein (control A) or phosphotransbutyrylase (control B) or butyrate kinase (control C) were added or no substrate was added (control D). After the incubation period, the isobutene produced in the headspace was analysed by Gas Chromatography (GC) equipped Flame Ionization Detector (FID). One ml of the headspace gas phase was separated and analysed according to the method described in Example 2. An overlay of typical chromatogram obtained for the whole enzymatic assay, and the corresponding controls is shown on FIG. 39.
[0920] The highest production of isobutene was observed in the assay comprised phosphotransbutyrylase, butyrate kinase and UbiD protein. The control assay without phosphotransbutyrylase (control B) and control assay without butyrate kinase (control C) also showed a significant production of isobutene. These results could be explained by spontaneous hydrolysis of 3-methylcrotonyl-CoA into 3-methylcrotonic acid. Enzymatic production of isobutene from 3-methylcrotonyl-CoA can thus be achieved by three consecutive steps, through the formation of 3-methylcrotonyl phosphate and 3-methylcrotonic acid as intermediates.
Example 8
In Vitro Screening of the UbiD Proteins for the Decarboxylation of 3-Methylcrotonic Acid Into Isobutene
[0921] Several genes coding for UbiD protein were codon optimized for the expression in E. coli and synthesized by GeneArt.RTM. (Thermofisher). The corresponding enzymes were purified according to the procedure described in Example 1. The list of the studied enzymes is shown in Table G.
[0922] Enzymatic assays were carried out in 2 ml glass vials (Interchim) under the following conditions:
[0923] 50 mM Tris-HCl buffer pH 7.5
[0924] 20 mM NaCl
[0925] 10 mM MgCl2
[0926] 1 mM DTT
[0927] 50 mM 3-methylcrotonic acid
[0928] 1 mg/ml purified UbiD protein
[0929] 100 .mu.l lysate contained UbiX protein from E. coli
[0930] Total volume of the assays were 300 .mu.l.
[0931] A series of control assays were performed in parallel, in which either no UbiD protein was added, or no enzymes were added (Table G).
[0932] The vials were sealed and incubated for 60 min at 30.degree. C. The assays were stopped by incubating for 2 min at 80.degree. C. and the isobutene formed in the reaction headspace was analysed by Gas Chromatography (GC) equipped with Flame Ionization Detector (FID), according to the procedure described in Example 2.
[0933] The results of the GC analysis are shown in Table G. No isobutene production was observed in control reactions. These results show that all the UbiD proteins, studied under the conditions of this screening assay, were able to perform the decarboxylation of 3-methylcrotonic acid into isobutene in presence of E. coli cell lysate contained UbiX protein.
TABLE-US-00007 TABLE G Isobutene produced, Candidate UbiD protein Assay composition arbitrary units Saccharomyces cerevisae UbiD protein alone 9 (Uniprot Accession UbiD protein + Cell lysate 945 Number: Q03034) contained UbiX protein Sphaerulina musiva (Uniprot UbiD protein alone 70 Accession Number: M3DF95) UbiD protein + Cell lysate 3430 contained UbiX protein Penicillium roqueforti (Uniprot UbiD protein alone 34 Accession Number: W6QKP7) UbiD protein + Cell lysate 1890 contained UbiX protein Hypocrea atroviridis (Uniprot UbiD protein alone 60 Accession Number: G9NLP8) UbiD protein + Cell lysate 5200 contained UbiX protein Fusarium oxysporum sp. UbiD protein alone 13 lycopersici (Uniprot Accession UbiD protein + Cell lysate 1390 Number: W9LTH3) contained UbiX protein Saccharomyces kudriavzevii UbiD protein alone 10 (Uniprot Accession Number: UbiD protein + Cell lysate 920 J8TRN5) contained UbiX protein No UbiD control : Cell lysate contained UbiX protein alone 0 Control without any enzymes 0
Example 9
Conversion of 3-Methylcrotonyl-CoA and Acetate into 3-Methylcrotonic Acid and acetyl-CoA Catalysed by Coenzyme A Transferase from Megasphaera sp
[0934] The enzyme was produced and purified according to the procedure described in Example 1.
[0935] The enzymatic assays were conducted in a total reaction volume of 0.2 ml
[0936] The standard reaction mixture contained:
[0937] 50 mM Tris-HCl buffer pH 7.5
[0938] 5 mM 3-methylcrotonyl-CoA
[0939] 10 mM sodium acetate
[0940] 10 mM MgCl.sub.2
[0941] 10 mM NaCl
[0942] 3 mg/ml purified CoA-transferase from Megasphaera sp. (Uniprot Accession Number: S7HFR5).
[0943] Control assays were performed in which either no enzyme was added, or no 3-methylcrotonyl-CoA was added. The assays were incubated for 6 h at 30.degree. C. The assays were stopped by adding 100 .mu.l MeCN in the medium. The samples were centrifuged, filtered through a 0.22 .mu.m filter and the clarified supernatants were transferred into a clean vial for the HPLC-based analysis.
[0944] HPLC analysis was performed using 1260 Inifinity LC System (Agilent), equipped with a column heating module and UV detector (260 nm). 5 .mu.l of samples were separated on Zorbax SB-Aq column (250.times.4.6 mm, 5 .mu.m particle size, column temp. 30.degree. C.), with a mobile phase flow rate of 1.5 ml/min. The separation was performed using mixed A (H.sub.2O containing 8.4 mM sulfuric acid) and B (acetonitrile) solutions in a linear gradient (0% B at initial time 0 min.fwdarw.70% B at 8 min). In these conditions, the retention time of 3-methylcrotonyl-CoA, 3-methylcrotonic acid and acetyl-CoA were 5.22 min, 5.70 min and 4.25 min, respectively.
[0945] Significant amounts of acetyl-CoA and 3-methylcrotonic acid were observed in the enzyme assay while none of the two compounds was not observed in control Significant amounts of acetyl-CoA and 3-methylcrotonic acid were observed in the enzyme assay while none of these two compounds was formed in control assays.
[0946] Typical chromatograms for enzymatic and control assays are shown on FIG. 40.
Example 10
Enzymatic Decarboxylation of 3-Methylcrotonic Acid Into Isobutene Catalyzed in the Presence of a Lysate Containing UbiX Protein and with Purified Decarboxylase
[0947] 0.5 M stock solution of 3-methylcrotonic acid was prepared in water and adjusted to pH 7.0 with 10 M solution of NaOH.
[0948] Proteins encoded by the aroY gene and one protein annotated as UbiD protein were produced according to the procedure described in Example 1.
[0949] Enzymatic assays were carried out in 2 ml glass vials (Interchim) under the following conditions:
[0950] 50 mM potassium phosphate buffer pH 7.5
[0951] 20 mM NaCl
[0952] 10 mM MgCl.sub.2
[0953] 5 mM DTT
[0954] 50 mM 3-methylcrotonic acid
[0955] 1 mg/ml purified AroY or UbiD protein
[0956] 50 .mu.l lysate contained UbiX protein
[0957] Total volume of the assays were 300 .mu.l.
[0958] A series of control assays were performed in parallel (Table H).
[0959] The vials were sealed and incubated for 120 min at 30.degree. C. The assays were stopped by incubating for 2 min at 80.degree. C. and the isobutene formed in the reaction headspace was analysed by Gas Chromatography (GC) equipped with Flame Ionization Detector (FID).
[0960] For the GC analysis, one ml of the headspace gas was separated in a Bruker GC-450 system equipped with a GS-alumina column (30 m.times.0.53 mm) (Agilent) using isothermal mode at 130.degree. C. Nitrogen was used as carrier gas with a flow rate of 6 ml/min.
[0961] The enzymatic reaction product was identified by comparison with an isobutene standard. Under these GC conditions, the retention time of isobutene was 2.42 min.
[0962] A significant production of isobutene from 3-methylcrotonic acid was observed in the combined assays (AroY or UbiD protein+UbiX protein). Incubation of lysate containing UbiX protein alone did not result in isobutene production. These data indicate that the proteins encoded by aroY gene in association with UbiX protein can catalyze the decarboxylation of 3-methylcrotonic acid into isobutene.
TABLE-US-00008 TABLE H Isobutene production, Assay composition arbitrary units AroY protein from K. pneumoniae 10.5 (Uniprot Acession Number: B9A9M6) + lysate contained UbiX protein from E. coli + substrate AroY protein from K. pneumoniae 0 (Uniprot Acession Number: B9A9M6) + substrate UbiD protein from E. cloacae (Uniprot 8 Acession Number: V3DX94) + lysate, contained UbiX protein from E. coli + substrate UbiD protein from E. cloacae (Uniprot 0 Acession Number: V3DX94) + substrate AroY protein from Leptolyngbya sp. 5.5 (Uniprot Acession Number: A0A0S3U6D8) +lysate, contained UbiX protein from E. coli + substrate AroY protein from Leptolyngbya sp. 0 (Uniprot Acession Number: A0A0S3U6D8) + substrate AroY protein from Phascolarctobacterium 5.5 sp. (Uniprot Acession Number: R6I1V6) + lysate, contained UbiX protein from E. coli + substrate AroY protein from Phascolarctobacterium 0 sp. (Uniprot Acession Number: R6I1V6) + substrate Lysate contained UbiX protein from E. 0 coli + substrate
Example 11
Enzyme-Catalyzed Dehydration of 3-Hydroxy-3-Methylglutaryl-CoA into 3-Methylglutaconyl-CoA
[0963] The genes coding for 3-hydroxyacyl-CoA dehydratases (also termed enoyl-CoA hydratases, abbreviated in the following by ECH) (Table I) were synthesized and the corresponding enzymes were further produced according to the procedure described in Example 1. Stock solution of 20 mM 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA) was prepared in water. The enzymatic assays were conducted in total volume of 0.2 ml in the following conditions:
[0964] 50 mM Tris-HCl buffer pH 7.5
[0965] 100 mM NaCl
[0966] 2 mM of 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA)
[0967] 0.1 mg/ml purified 3-hydroxyacyl-CoA dehydratase.
[0968] Enzymatic assays were started by adding the 20 .mu.l of 20 mM substrate, were run for 10 min at 30.degree. C. run for and stopped by adding 100 .mu.L of acetonitrile in the reaction medium. All the enzymatic assays were
[0969] performed in duplicate. The samples were then centrifuged, filtered through a 0.22 .mu.m filter and the clarified supernatants were transferred into a clean vial for HPLC based analysis.
[0970] The analysis was performed using 1260 Inifinity LC System (Agilent), equipped with column heating module and UV detector (260 nm). 5 .mu.l of samples were separated on Zorbax SB-Aq column (250.times.4.6 mm, 5 .mu.m particle size, column temp. 30.degree. C.), with a mobile phase flow rate of 1.5 ml/min. The separation was performed using mixed A (H.sub.2O containing 8.4 mM sulfuric acid) and B (acetonitrile) solutions in a linear gradient (0% B at initial time 0 min.fwdarw.70% B at 8 min). In these conditions, the retention time of HMG-CoA, 3-methylglutaconyl-CoA (MG-CoA) and free coenzyme A were respectively 4.26 min, 4.76 min and 3.96 min. FIG. 41 shows 3-methylglutaconyl-CoA (MG-CoA) peak areas obtained from the HPLC-based analysis.
TABLE-US-00009 TABLE I Enzyme's abbreviation Source and Uniprot Accession Numbers LiuC 3-hydroxybutyryl-CoA dehydratase from Myxococcus xanthus (Q1D5Y4) ECH Um Putative enoyl-CoA hydratase from Ustilago maydis (Q4PEN0) ECH Bs Methylglutaconyl-CoA hydratase from Bacillus sp. GeD10 (N1LWG2) ECH LI Methylglutaconyl-CoA hydratase from Labilithrix luteola (A0A0K1PN19) ECH Pa Putative isohexenylglutaconyl-CoA hydratase from Pseudomonas aeruginosa (Q9HZV7) ECH Ms Enoyl-CoA hydratase from Marinobacter santoriniensis (M7CV63) ECH Ab Enoyl-CoA hydratase from Acinetobacter baumannii (A0A0D5YDD4) ECH Pp Isohexenylglutaconyl-CoA hydratase from Pseudomonas pseudoalcaligenes (L8MQT6)
Example 12
Microorganism for the Production of Isobutene from acetyl-CoA via 3-Methylcrotonic Acid
[0971] This example shows the direct production of isobutene by a recombinant E. coli strain which expresses exogenous genes, thereby constituting the isobutene pathway. Like most organisms, E. coli converts glucose to acetyl-CoA. The enzymes used in this study to convert acetyl-CoA into isobutene via 3-methylcrotonic acid (FIG. 42) are summarized in Table J.
TABLE-US-00010 TABLE J Uniprot Gene Accession Step Enzyme abbreviation NCB reference number XIII Acetyl-CoA thIA WP_ P45359 transferase from 010966157.1 Clostridium acetobulyticum (ThIA) IX Hydroxymethylglutaryl- mvaS WP_ Q9FD71 CoA synthase from 002357756.1 Enterococcus faecalis (MvaS) VIII Isohexenylglutaconyl- ppKF707_ WP_ L8MQT6 CoA hydratase from 3831 004422368.1 Pseudomonas pseudoalcaligenes KF707 (ECH) VII Glutaconate CoA- MXAN_ WP_ Q1D4I3 transferase from 4264 011554268.1 Myxococcus xanthus MXAN_ WP_ Q1D4I4 (AibA/B) 4265 011554267.1 VI Acyl-CoA tesB WP_ P0AGG2 thioesterase 2 from 000075876.1 Escherichia coli (TesB) I Ferulic acid FDC1 XP_ G9NLP8 decarboxylase 013946967.1 from Hypocrea atroviridis (UbiD) Flavin prenyl ubiX WP_ P0AG03 transferase from 000825700.1 Escherichia coli (UbiX)
[0972] Expression of Isobutene Biosynthetic Pathway in E. coli
[0973] All the corresponding genes were codon optimized for the expression in E. coli and synthesized by GeneArt.RTM. (Life Technologies), except the gene encoding for UbiX protein which was directly amplified from the genomic DNA of E. coli MG1655. The modified version of pUC18 (New England Biolabs), containing a modified Multiple Cloning Site (pUC18 MCS) (WO 2013/007786), was used for the overexpression of the ubiX gene. This plasmid conferred ampicillin resistance to the recombinant strain. The constructed vector was named pGB 5796 and the corresponding nucleotidic sequence is indicated in Table K.
TABLE-US-00011 TABLE K Plasmid name Nucleotidic sequence pGB 5796 tcgcgcgtttcggtgatgacggtgaaaacctctgacacatgcagctcccggagacggtcacagct- tgt ctgtaagcggatgccgggagcagacaagcccgtcagggcgcgtcagcgggtgttggcgggtgtcg gggctggcttaactatgcggcatcagagcagattgtactgagagtgcaccatatgcggtgtgaaata ccgcacagatgcgtaaggagaaaataccgcatcaggcgccattcgccattcaggctgcgcaactgt tgggaagggcgatcggtgcgggcctcttcgctattacgccagctggcgaaagggggatgtgctgca aggcgattaagttgggtaacgccagggttttcccagtcacgacgttgtaaaacgacggccagtgccA AGCTTGCGGCCGCGGGGTTAATTAATTTCTCCTCTTTAATAAAGCAA ATAAATTTTTTATGATTTGTTTAAACCTAGGCATGCCtctagaTTAttaTGC GCCCTGCCAGCGGGCAAAGAGATCTTCAGGAAGGGTTATCGCAAAC TGGTCAAGAACACGATTAACCGTCTGATTTATCACATCATCAAGGGA TTGCGGGCGATGATAAAACGCCGGAACGGGAGGCATAATCACCGCA CCGATTTCTGCCGCCTGAGTCATTAAACGCAGATGGCCTAAGTGCA ATGGTGTTTCACGCACGCAGAGCACCAACGGGCGACGCTCTTTCAG CACCACATCTGCCGCACGGGTCAGTAAGCCATCAGTATAGCTATGG ACAATGCCGGAAAGGGTTTTGATTGAACAGGGTAAAATCACCATCCC CAGCGTCTGGAAAGAACCGGAAGAGATGCTGGCGGCAATATCGCG CGCATCGTGCGTGACATCGGCTAATGCCTGCACTTCGCGCAGAGAA AAATCCGTTTCGAGGGATAAGGTCTGGCGCGCTGCCTGGCTCATCA CCAGATGCGTTTCGATATCTGTGACATCGCGCAGAACCTGTAATAAG CGCACGCCATAAATCGCGCCGCTGGCACCGCTGATGCCTACAATGA GTCGTTTcatAAAAAAAATGTATATCTCCTTCggtaccGAGCTCGAACCT GCAGGAATTCgtaatcatggtcatagctgtttcctgtgtgaaattgttatccgctcacaattccaca caacatacgagccggaagcataaagtgtaaagcctggggtgcctaatgagtgagctaactcacatt aattgcgttgcgctcactgcccgctttccagtcgggaaacctgtcgtgccagctgcattaatgaatcgg ccaacgcgcggggagaggcggtttgcgtattgggcgctcttccgcttcctcgctcactgactcgctgc gctcggtcgttcggctgcggcgagcggtatcagctcactcaaaggcggtaatacggttatccacaga atcaggggataacgcaggaaagaacatgtgagcaaaaggccagcaaaaggccaggaaccgta aaaaggccgcgttgctggcgtttttccataggctccgcccccctgacgagcatcacaaaaatcgacg ctcaagtcagaggtggcgaaacccgacaggactataaagataccaggcgtttccccctggaagctc cctcgtgcgctctcctgttccgaccctgccgcttaccggatacctgtccgcctttctcccttcgggaagcg tggcgctttctcatagctcacgctgtaggtatctcagttcggtgtaggtcgttcgctccaagctgggctgt gtgcacgaaccccccgttcagcccgaccgctgcgccttatccggtaactatcgtcttgagtccaaccc ggtaagacacgacttatcgccactggcagcagccactggtaacaggattagcagagcgaggtatgt aggcggtgctacagagttcttgaagtggtggcctaactacggctacactagaaggacagtatttggta tctgcgctctgctgaagccagttaccttcggaaaaagagttggtagctcttgatccggcaaacaaacc accgctggtagcggtggtttttttgtttgcaagcagcagattacgcgcagaaaaaaaggatctcaaga agatcctttgatcttttctacggggtctgacgctcagtggaacgaaaactcacgttaagggattttggtca tgagattatcaaaaaggatcttcacctagatccttttaaattaaaaatgaagttttaaatcaatctaaagt atatatgagtaaacttggtctgacagttaccaatgcttaatcagtgaggcacctatctcagcgatctgtct atttcgttcatccatagttgcctgactccccgtcgtgtagataactacgatacgggagggcttaccatctg gccccagtgctgcaatgataccgcgagacccacgctcaccggctccagatttatcagcaataaacc agccagccggaagggccgagcgcagaagtggtcctgcaactttatccgcctccatccagtctattaa ttgttgccgggaagctagagtaagtagttcgccagttaatagtttgcgcaacgttgttgccattgctaca ggcatcgtggtgtcacgctcgtcgtttggtatggcttcattcagctccggttcccaacgatcaaggcgag ttacatgatcccccatgttgtgcaaaaaagcggttagctccttcggtcctccgatcgttgtcagaagtaa gttggccgcagtgttatcactcatggttatggcagcactgcataattctcttactgtcatgccatccgtaa gatgcttttctgtgactggtgagtactcaaccaagtcattctgagaatagtgtatgcggcgaccgagttg ctcttgcccggcgtcaatacggg ataataccgcgccacatagcagaactttaaaagtgctcatcattg gaaaacgttcttcggggcgaaaactctcaaggatcttaccgctgttgagatccagttcgatgtaaccc actcgtgcacccaactgatcttcagcatcttttactttcaccagcgtttctgggtgagcaaaaacaggaa ggcaaaatgccgcaaaaaagggaataagggcgacacggaaatgttgaatactcatactcttcctttt tcaatattattgaagcatttatcagggttattgtctcatgagcggatacatatttgaatgtatttagaaaaat aaacaaataggggttccgcgcacatttccccgaaaagtgccacctgacgtctaagaaaccattatta tcatgacattaacctataaaaataggcgtatcacgaggccctttcgtc (SEQ ID NO: 93)
[0974] An expression vector containing the origin of replication pSC was used for the expression of the genes: thIA, MvaS, ppKF707_3831, MXAN_4264/MXAN_4265, FDC1. This plasmid conferred spectinomycin resistance to the recombinant strain. The constructing vector was named pGB 5771 and the corresponding nucleotidic sequence is indicated in Table L.
TABLE-US-00012 TABLE L Plasmid name Nucleotidic sequence pGB 5771 ctcactactttagtcagttccgcagtattacaaaaggatgtcgcaaacgctgtttgctcctctac- aaaac agaccttaaaaccctaaaggcttaagtagcaccctcgcaagctcgggcaaatcgctgaatattcctttt gtctccgaccatcaggcacctgagtcgctgtctttttcgtgacattcagttcgctgcgctcacggctctgg cagtgaatgggggtaaatggcactacaggcgccttttatggattcatgcaaggaaactacccataat acaagaaaagcccgtcacgcttctcagggcgttttatggcgggtctgctatgtggtgctatctgacttttt gctgttcagcagttcctgccctctgattttccagtctgaccctagtcaaggccttaagtgagtcgtattacg gactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcag cacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagtt gcgcagcctgaatggcgaatggcgcctgatgcggtattttctccttacgcatctgtgcggtatttcacac cgCCCGGGGAACTATAgtttaaacTTTTCAATGAATTCATTTaaGCGGCCG CatcaatTCTAGAatttaaatagtcaaaagcctccgaccggaggcttttgactgACCTATTG ACAATTAAAGGCTAAAATGCTATAATTCCACtaatagaaataattttgtttaacttta ggtctctatcgtaaGAAGGAGATATatgaaagaagtggtgattgccagcgcagttcgtaccgc aattggtagctatggtaaaagcctgaaagatgttccggcagttgatctgggtgcaaccgcaattaaag aagcagttaaaaaagccggtattaaaccggaagatgtgaacgaagttattctgggtaatgttctgcaa gcaggtctgggtcagaatccggcacgtcaggcctcgtttaaagcaggtctgccggttgaaattccgg caatgaccattaacaaagtttgtggtagcggtctgcgtaccgttagcctggcagcacagattatcaaa gccggtgatgcagatgttattattgccggtggtatggaaaatatgagccgtgcaccgtatctggcaaat aatgcacgttggggttatcgtatgggtaatgccaaatttgtggatgagatgattaccgatggtctgtggg atgcctttaatgattatcacatgggtattaccgcagagaatattgcagaacgttggaatattagccgtga agaacaggatgaatttgcactggcaagccagaaaaaagcagaagaagcaattaaaagcggtca gttcaaagatgaaattgtgccggttgttatcaaaggtcgtaaaggtgaaaccgttgttgataccgatga acatccgcgttttggtagcaccattgaaggtctggcaaaactgaaaccggcattcaaaaaagatggc accgttaccgcaggtaatgcaagcggtctgaatgattgtgcagcagttctggttattatgagcgcaga aaaagcaaaagaactgggtgttaaaccgctggcaaaaattgtgagctatggtagtgccggtgttgat ccggcaattatgggttatggtccgttttatgcaaccaaagcagcaattgaaaaagcaggttggaccgt tgatgaactggatctgattgaaagcaatgaagcatttgcagcacagagcctggcagttgcaaaaga cctgaaattcgatatgaataaagtgaatgtgaatggcggtgcaattgccctgggtcatccgattggtgc aagcggtgcacgtattctggttaccctggttcatgcaatgcagaaacgtgatgcaaaaaaaggtctg gccaccctgtgtattggtggtggtcagggcaccgcaattctgctggaaaaatgctaataagcttGAA GGAGATATAATGACCATTGGTATTGATAAAATCAGCTTTTTCGTGCCT CCGTACTATATTGATATGACCGCACTGGCCGAAGCACGTAATGTTGA TCCGGGTAAATTTCATATTGGTATTGGTCAGGATCAGATGGCCGTTA ATCCGATTAGCCAGGATATTGTTACCTTTGCAGCAAATGCAGCAGAA GCAATTCTGACCAAAGAAGATAAAGAGGCCATTGATATGGTTATTGT TGGCACCGAAAGCAGCATTGATGAAAGCAAAGCAGCAGCAGTTGTT CTGCATCGTCTGATGGGTATTCAGCCGTTTGCACGTAGCTTTGAAAT TAAAGAAGCATGTTACGGAGCAACCGCAGGTCTGCAACTGGCAAAA AATCATGTTGCACTGCATCCGGATAAAAAAGTTCTGGTTGTTGCAGC AGATATTGCCAAATATGGTCTGAATAGCGGTGGTGAACCGACCCAG GGTGCCGGTGCAGTTGCAATGCTGGTTGCAAGCGAACCGCGTATTC TGGCACTGAAAGAAGATAATGTTATGCTGACCCAGGATATTTATGAT TTTTGGCGTCCGACCGGTCATCCGTATCCGATGGTTGATGGTCCGC TGAGCAATGAAACCTATATTCAGAGCTTTGCACAGGTGTGGGATGAA CATAAAAAACGTACCGGTCTGGATTTCGCAGATTATGATGCACTGGC ATTTCATATCCCGTATACCAAAATGGGTAAAAAAGCACTGCTGGCCA AAATTAGCGATCAGACCGAAGCCGAACAAGAACGCATTCTGGCACG TTATGAAGAAAGCATTGTTTATAGCCGTCGTGTGGGTAATCTGTATA CCGGTAGCCTGTATCTGGGTCTGATTAGCCTGCTGGAAAATGCAAC CACCCTGACCGCAGGTAATCAGATTGGTCTGTTTAGCTATGGTAGC GGTGCCGTTGCAGAATTTTTCACAGGTGAACTGGTTGCAGGTTATCA GAATCATCTGCAAAAAGAAACCCATCTGGCACTGCTGGATAATCGTA CCGAACTGAGCATTGCAGAATATGAAGCAATGTTTGCAGAAACCCTG GATACCGATATTGATCAGACCCTGGAAGATGAACTGAAATATAGCAT TAGCGCCATTAATAACACCGTGCGTAGCTATCGTAACTAATAAggtaG AAGGAGATATACATatgagtcaggcgctaaaaaatttactgacattgttaaatctggaaaaa attgaggaaggactctttcgcggccagagtgaag atttaggtttacgccaggtgtttggcggccaggt cgtgggtcaggccttgtatgctgcaaaagagacGgtccctgaagaAcggctggtacattcgtttcac agctactttcttcgccctggcgatagtaagaagccgattatttatgatgtcgaaacgctgcgtgacggta acagcttcagcgcccgccgggttgctgctattcaaaacggcaaaccgattttttatatgactgcctctttc caggcaccagaagcgggtttcgaacatcaaaaaacaatgccgtccgcgccagcgcctgatggcct cccttcggaaacgcaaatcgcccaatcgctggcgcacctgctgccgccagtgctgaaagataaatt catctgcgatcgtccgctggaagtccgtccggtggagtttcataacccactgaaaggtcacgtcgcag aaccacatcgtcaggtgtggatTcgcgcaaatggtagcgtgccggatgacctgcgcgttcatcagta tctgctcggttacgcttctgatcttaacttcctgccggtagctctacagccgcacggcatcggttttctcga accggggattcagattgccaccattgaccattccatgtggttccatcgcccgtttaatttgaatgaatgg ctgctgtatagcgtggagagcacctcggcgtccagcgcacgtggctttgtgcgcggtgagttttatacc caagacggcgtactggttgcctcgaccgttcaggaaggggtgatgcgtaatcacaattaataag aac GAAGGAGATATAAtgAAAACCGCACGTTGGTGTAGCCTGGAAGAAGC AGTTGCAAGCATTCCGGATGGTGCAAGCCTGGCAACCGGTGGTTTT ATGCTGGGTCGTGCACCGATGGCACTGGTTATGGAACTGATTGCAC AGGGTAAACGTGATCTGGGTCTGATTAGCCTGCCGAATCCGCTGCC AGCAGAATTTCTGGTTGCCGGTGGTTGTCTGGCTCGTCTGGAAATT GCATTTGGTGCACTGAGTCTGCAAGGTCGTGTTCGTCCGATGCCGT GTCTGAAACGTGCAATGGAACAGGGCACCCTGGCATGGCGTGAACA TGATGGTTATCGTGTTGTTCAGCGTCTGCGTGCAGCAAGCATGGGT CTGCCGTTTATTCCGGCACCGGATGCAGATGTTAGCGGTCTGGCAC GTACCGAACCGCCTCCGACCGTTGAAGATCCGTTTACCGGTCTGCG TGTTGCAGTTGAACCGGCATTTTATCCGGATGTTGCACTGCTGCACG CACGTGCAGCCGATGAACGTGGTAATCTGTATATGGAAGATCCGAC CACCGATCTGCTGGTTGCGGGTGCAGCAAAACGTGTTATTGCAACC GTTGAAGAACGTGTTGCAAAACTGCCTCGTGCAACCCTGCCTGGTTT TCAGGTTGATCGTATTGTTCTGGCACCGGGTGGTGCACTGCCGACC GGTTGTGCAGGTCTGTATCCGCATGATGATGAAATGCTGGCACGTT ATCTGAGCCTGGCAGAAACCGGTCGTGAAGCCGAATTTCTGGAAAC CCTGCTGACCCGTCGTGCAGCATAATGAggatccGAAGGAGATATACA TAtgAGCGCAACCCTGGATATTACACCGGCAGAAACCGTTGTTAGCC TGCTGGCACGTCAGATTGATGATGGTGGTGTTGTTGCAACCGGTGT TGCAAGTCCGCTGGCAATTCTGGCCATTGCAGTTGCACGTGCCACC CATGCACCGGATCTGACCTATCTGGCATGTGTTGGTAGCCTGGACC CGGAAATTCCGACCCTGCTGCCGAGCAGCGAAGACCTGGGTTATCT GGATGGTCGTAGCGCAGAAATTACCATTCCGGACCTGTTTGATCATG CACGTCGTGGTCGTGTTGATACCGTTTTTTTTGGTGCAGCCGAAGTT GATGCCGAAGGTCGTACCAATATGACCGCAAGCGGTAGTCTGGATA AACCGCGTACCAAATTTCCGGGTGTTGCCGGTGCAGCCACCCTGCG TCAGTGGGTTCGTCGTCCGGTTCTGCTGGTTCCGCGTCAGAGCCGT CGTAATCTGGTTCCGGAAGTTCAGGTTGCAACCACCCGTGATCCGC GTCGTCCGGTGACCCTGATTAGCGATCTGGGTGTTTTTGAACTGGG TGCAAGCGGTGCACGTCTGCTGGCACGCCATCCGTGGGCAAGCGA AGAACATATTGCAGAACGTACCGGTTTTGCATTTCAGGTTAGCGAAG CACTGAGCGTTACCAGCCTGCCGGATGCACGTACCGTTGCAGCAAT TCGTGCAATTGATCCGCATGGCTATCGTGATGCACTGGTTGGTGCAT AATTAgtcagaaggagatataCATATGAGCCTGCCGCATTGTGAAACCCTG CTGCTGGAACCGATTGAAGGTGTTCTGCGTATTACCCTGAATCGTCC GCAGAGCCGTAATGCAATGAGCCTGGCAATGGTTGGTGAACTGCGT GCAGTTCTGGCAGCAGTTCGTGATGATCGTAGCGTTCGTGCACTGG TTCTGCGTGGTGCAGATGGTCATTTTTGTGCCGGTGGTGATATTAAA GATATGGCAGGCGCACGTGCAGCCGGTGCAGAAGCATATCGTACAC TGAATCGTGCATTTGGTAGCCTGCTGGAAGAAGCACAGGCAGCACC GCAGCTGCTGGTTGCACTGGTTGAAGGTGCCGTTCTGGGTGGTGGT TTTGGTCTGGCATGTGTTAGTGATGTTGCAATTGCAGCAGCAGATGC ACAGTTTGGTCTGCCGGAAACCAGCCTGGGTATTCTGCCTGCACAG ATTGCACCGTTTGTTGTTCGTCGTATTGGTCTGACCCAGGCACGTCG TCTGGCACTGACCGCAGCACGTTTTGATGGTCGTGAAGCACTGCGT CTGGGTCTGGTTCATTTTTGTGAAGCAGATGCAGATGCACTGGAACA GCGTCTGGAAGAAACCCTGGAACAGCTGCGTCGTTGTGCACCGAAT GCAAATGCAGCAACCAAAGCACTGCTGCTGGCAAGCGAAAGCGGTG AACTGGGTGCACTGCTGGATGATGCAGCACGTCAGTTTGCCGAAGC AGTTGGTGGTGCAGAAGGTAGCGAAGGCACCCTGGCATTTGTTCAG AAACGTAAACCGGTTTGGGCACAGTAATAAtgaaagagaccagcctgatacag attaaatcagaacgcagaagcggtctgataaaacagaatttgcctggcggcagtagcgcggtggtc ccacctgaccccatgccgaactcagaagtgaaacgccgtagcgccgatggtagtgtggggtcacc
ccatgcgagagtagggaactgccaggcatcaaataaaacgaaaggctcagtcgaaagactgggc ctttcgttttatctgttgtttgtcggtgaactACTAGAatttaaatagtcaaaagcctccgaccggaggc ttttgactgACCTATTGACAATTAAAGGCTAAAATGCTATAATTCCACtaatag aaataattttgtttaactttaggtctctatcgaccataaTTAATTAActttaagaaggagatataCAT atgAGCAGCACCACCTATAAAAGCGAAGCATTTGATCCGGAACCGCC TCATCTGAGCTTTCGTAGCTTTGTTGAAGCACTGCGTCAGGATAATG ATCTGGTGGATATTAATGAACCGGTTGATCCGGATCTGGAAGCAGC AGCAATTACCCGTCTGGTTTGTGAAACCGATGATAAAGCACCGCTGT TTAATAACGTGATTGGTGCAAAAGATGGTCTGTGGCGTATTCTGGGT GCACCGGCAAGCCTGCGTAGCAGCCCGAAAGAACGTTTTGGTCGTC TGGCACGTCATCTGGCACTGCCTCCGACCGCAAGCGCAAAAGATAT TCTGGATAAAATGCTGAGCGCCAATAGCATTCCGCCTATTGAACCGG TTATTGTTCCGACCGGTCCGGTTAAAGAAAATAGCATTGAAGGCGAA AACATTGATCTGGAAGCCCTGCCTGCACCGATGGTTCATCAGAGTG ATGGTGGCAAGTATATCCAGACCTATGGTATGCATGTTATCCAGAGT CCGGATGGTTGTTGGACCAATTGGAGCATTGCCCGTGCAATGGTTA GCGGTAAACGTACCCTGGCAGGTCTGGTTATTAGTCCGCAGCATAT TCGTAAAATTCAGGATCAGTGGCGTGCAATTGGTCAAGAAGAAATTC CTTGGGCACTGGCATTTGGTGTTCCGCCTACCGCAATTATGGCAAG CAGTATGCCGATTCCGGATGGTGTTAGCGAAGCAGGTTATGTTGGT GCAATTGCCGGTGAACCGATTAAACTGGTTAAATGCGATACCAACAA TCTGTATGTTCCGGCAAATAGCGAAATTGTTCTGGAAGGCACCCTGA GCACCACCAAAATGGCACCGGAAGGTCCGTTTGGTGAAATGCATGG TTATGTTTATCCGGGTGAAAGCCATCCGGGTCCGGTTTATACCGTTA ACAAAATTACCTATCGCAACAATGCAATTCTGCCGATGAGCGCATGT GGTCGTCTGACCGATGAAACCCAGACCATGATTGGCACCCTGGCAG CAGCAGAAATTCGTCAGCTGTGTCAGGATGCAGGTCTGCCGATTAC CGATGCATTTGCACCGTTTGTTGGTCAGGCAACCTGGGTTGCACTG AAAGTTGATACCAAACGTCTGCGTGCAATGAAAACCAATGGTAAAGC ATTTGCAAAACGTGTTGGTGATGTTGTGTTTACCCAGAAACCGGGTT TTACCATTCATCGTCTGATTCTGGTTGGTGATGATATTGATGTGTATG ACGATAAAGATGTGATGTGGGCATTTACCACCCGTTGTCGTCCGGG TACAGATGAAGTTTTTTTTGATGATGTTGTGGGCTTTCAGCTGATCCC GTATATGAGTCATGGTAATGCCGAAGCAATTAAAGGTGGTAAAGTTG TTAGTGATGCACTGCTGACCGCAGAATATACCACCGGTAAAGATTGG GAAAGCGCAGATTTCAAAAACAGCTATCCGAAAAGCATCCAGGATAA AGTTCTGAATAGCTGGGAACGCCTGGGTTTCAAAAAACTGGATTAAT AACCATGGttataagagagaccagcctGACTCCTGTTGATAGATCCAGTAAT GACCTCAGAACTCCATCTGGATTTGTTCAGAACGCTCGGTTGCCGC CGGGCGTTTTTTATTGGTGAGAATaactACTAGTtggcggGCGGCCGCtta gctCTGCAGatgagaaattcttgaagacgaaagggcctcgtgatacgcctatttttataggttaatg tcatgataataatggtttAAGCTTcttagaataGCTCTTCTATGaggtggcacttttcgggga aaGATATCcgcatatatggtgcactctcagtacaatctgctctgatgccgcatagttaagccagtat acactccgctatcgctacgtgactgggtcatggctgcgccccgacacccgccaacacccgctgacg cgccctgacgggcttgtctgctcccggcatccgcttacagacaagctgtgaccgtctccgggagctgc atgtgtcagaggttttcaccgtcatcaccgaaacgcgcgaggcagctgcggtaaagctcatcagcgt ggtcgtgaagcgattcacagatgtctgcctgttcatcGGTACCtttcatgatatatctcccaatttgtgt agggcttattatgcacgcttaaaaataataaaagcagacttgacctgatagtttggctgtgagcaattat gtgcttagtgcatctaacgcttgagttaagccgcgccgcgaagcggcgtcggcttgaacgaattgtta gacattatttgccgactaccttggtgatctcgcctttcacgtagtggacaaattcttccaactgatctgcgc gcgaggccaagcgatcttcttcttgtccaagataagcctgtctagcttcaagtatgacgggctgatact gggccggcaggcgctccattgcccagtcggcagcgacatccttcggcgcgattttgccggttactgc gctgtaccaaatgcgggacaacgtaagcactacatttcgctcatcgccagcccagtcgggcggcg a gttccatagcgttaaggtttcatttagcgcctcaaatagatcctgttcaggaaccggatcaaagagttcc tccgccgctggacctaccaaggcaacgctatgttctcttgcttttgtcagcaagatagccagatcaatgt cgatcgtggctggctcgaagatacctgcaagaatgtcattgcgctgccattctccaaattgcagttcgc gcttagctgg ataacgccacgg aatgatgtcgtcgtgcacaacaatggtgacttctacagcgcggag aatctcgctctctccaggggaagccgaagtttccaaaaggtcgttgatcaaagctcgccgcgttgtttc atcaagccttacggtcaccgtaaccagcaaatcaatatcactgtgtggcttcaggccgccatccactg cggagccgtacaaatgtacggccagcaacgtcggttcgagatggcgctcgatgacgccaactacct ctgatagttgagtcgatacttcggcgatcaccgcttccctcatgatgtttaactttgttttagggcgactgc cctgctgcgtaacatcgttgctgctccataacatcaaacatcgacccacggcgtaacgcgcttgctgct tggatgcccgaggcatagactgtaccccaaaaaaacagtcataacaagccatgaaaaccgccac GAGCTCctgtcagaccaagtttacgagctcgcttggactcctgttgatagatccagtaatgacctca gaactccatctggatttgttcagaacgctcggttgccgccgggcgttttttattggtgagaatccaagca ctagggacagtaagacgggtaagcctgttgatgataccgctgccttactgggtgcattagccagtctg aatgacctgtcacgggataatccgaagtggtcagactggaaaatcagagggcaggaactgctgaa cagcaaaaagtcagatagcaccacatagcagacccgccataaaacgccctgagaagcccgtga cgggcttttcttgtattatgggtagtttccttgcatgaatccataaaaggcgcctgtagtgccatttacccc cattcactgccagagccgtgagcgcagcgaactgaatgtcacgaaaaagacagcgactcaggtg cctgatggtcggagacaaaaggaatattcagcgatttgcccgagcttgcgagggtgctacttaagcct ttagggttttaaggtctgttttgtag aggagcaaacagcgtttgcgacatccttttgtaatactgcgg aact gactaaagtagtgagttatacacagggctgggatctattctttttatctttttttattctttctttattctat- aaatt ataaccacttgaatataaacaaaaaaaacacacaaaggtctagcggaatttacagagggtctagc agaatttacaagttttccagcaaaggtctagcagaatttacagatacccacaactcaaaggaaaag gacatgtaattatcattgactagcccatctcaattggtatagtgattaaaatcacctagaccaattgaga tgtatgtctgaattagttgttttcaaagcaaatgaactagcgattagtcgctatgacttaacggagcatga aaccaagctaattttatgctgtgtggcactactcaaccccacgattg aaaaccctacaaggaaagaa cggacggtatcgttcacttataaccaatacgctcagatgatgaacatcagtagggaaaatgcttatgg tgtattagctaaagcaaccagagagctgatgacgagaactgtggaaatcaggaatcctttggttaaa ggctttgagattttccagtggacaaactatgccaagttctcaagcg aaaaattagaattagtttttagtga agagatattgccttatcttttccagttaaaaaaattcataaaatataatctggaacatgttaagtcttttgaa aacaaatactctatgaggatttatgagtggttattaaaagaactaacacaaaagaaaactcacaagg caaatatagagattagccttgatgaatttaagttcatgttaatgcttgaaaataactaccatgagtttaaa aggcttaaccaatgggttttgaaaccaataagtaaagatttaaacacttacagcaatatgaaattggtg gttgataagcgaggccgcccgactgatacgttgattttccaagttgaactagatagacaaatggatctc gtaaccgaacttgagaacaaccagataaaaatgaatggtgacaaaataccaacaaccattacatc agattcctacctacgtaacggactaagaaaaacactacacgatgctttaactgcaaaaattcagctc accagttttgaggcaaaatttttgagtgacatgcaaagtaagcatg atctcaatggttcgttctcatggct cacgcaaaaacaacgaaccacactagagaacatactggctaaatacggaaggatctgaggttctt atggctcttgtatctatcagtgaagcatcaagactaacaaacaaaagtagaacaactgttcaccgtta gatatcaaagggaaaactgtccataagcacagatgaaaacggtgtaaaaaagatagatacatcag agcttttacgagtttttggtgcatttaaagctgttcaccatgaacagatcgacaatgtaacGCATGCa ccgagcgcagcgagtcagtgagcgaggaagcggaacagcgcctg (SEQ ID NO: 94)
[0975] These recombinant pGBE 5771 and pGBE5796 plasmids were verified by sequencing.
[0976] MG1655 E. coli strain was made electrocompetent and was transformed with pGBE5771 and pGBE5796 or with the corresponding empty vectors (pUC18 MCS and pGB2021) in order to create negative controls. The strains thus produced are summarized in Table M.
TABLE-US-00013 TABLE M Strain number Vectors Strain 1 (metabolic pUC18_MCS + pGB 2021 pathway-free control), containing the empty vectors. Strain 2, expressing only pGB 5796 + pGB 2021 UbiX protein Strain 3, expressing the pUC18_MCS + PGB 5771 whole metabolic pathway, without overexpression of UbiX protein on plasmid. Strain 4, expressing the pGB 5796 + pGB 5771 whole metabolic pathway, comprising overexpression of UbiX protein on plasmid.
[0977] The transformed cells were then plated on LB plates, supplied with ampicillin (100 .mu.g/ml) and spectinomycin (100 .mu.g/ml). Plates were incubated overnight at 30.degree. C. Isolated colonies were used to inoculate 1.4 ml of ZYM-5052 auto-inducing media (Studier FW, Prot. Exp. Pur. 41, (2005), 207-234) supplemented with ampicillin, spectinomycin and 0.5 mM flavin mononucleotide. These cultures were grown for 16 h at 30.degree. C. and 700 rpm shaking in 96 deep-well microplates. Then the cultures were centrifuged and the pellets were resuspended in 0.4 ml of MS medium (Richaud C., Mengin-Leucreulx D., Pochet S., Johnson E J., Cohen G N. and Marliere P, The Journal of Biological Chemistry, 268, (1993), 26827-26835) containing glucose (45 g/L), and MgSO.sub.4 (1 mM). The cultures were further incubated in 96 deep-well sealed microplates at 30.degree. C., 700 rpm shaking for 24 hours. The production of isobutene was stopped by incubating the microplates for 5 min at 80.degree. C. and the isobutene formed in the reaction headspace was analysed by Gas Chromatography (GC) equipped with Flame Ionization Detector (FID). 100 .mu.L of headspace gases from each enzymatic reaction are injected in a Brucker GC-450 system equipped with a Flame Ionization Detector (FID). Compounds present in samples were separated by chromatography using a GS-alumina column (30 m.times.0.53 mm) (Agilent) using isothermal mode at 130.degree. C. Nitrogen was used as carrier gas with a flow rate of 6 ml/min. Upon injection, peak areas of isobutene were calculated; Table N.
TABLE-US-00014 TABLE N IBN production, Strain number Vectors arbitrary units Strain 1 (metabolic pUC18_MCS + pGB 2021 950 pathway-free control), containing the empty vectors Strain 2, expressing only pGB 5796 + pGB 2021 710 UbiX proteine Strain 3, expressing the pUC18_MCS + PGB 5771 625 whole metabolic pathway, without overexpression of UbiX protein on plasmid Strain 4, expressing the pGB 5796 + pGB 5771 15192 whole metabolic pathway, comprising overexpression of UbiX protein on plasmid
Sequence CWU
1
1
1011462PRTCaenorhabditis elegans 1Met Ser Leu Gly Gln Leu Ser Tyr Thr Pro
Val Thr Asp Val Gly Ile1 5 10
15Gly Ala Ile Glu Leu Tyr Phe Pro Gln Asn Phe Val Asp Gln Asn Asp
20 25 30Leu Glu Lys Phe Asn Asn
Val Ser Ser Gly Lys Tyr Thr Ile Gly Leu 35 40
45Gly Gln Gln Gln Met Gly Phe Cys Ser Asp Asn Glu Asp Ile
Val Ser 50 55 60Ile Ser Leu Thr Val
Thr Arg Lys Leu Ile Glu Thr Tyr Lys Ile Ser65 70
75 80Thr Asp Ser Ile Gly Cys Leu Val Val Gly
Thr Glu Thr Met Ile Asp 85 90
95Lys Ser Lys Ser Val Lys Thr Ala Leu Met Asp Leu Phe Pro Gly Asn
100 105 110Ser Asp Ile Glu Gly
Val Asp Ile Lys Asn Ala Cys Phe Gly Gly Ala 115
120 125Gln Ala Leu Leu His Ala Ile Asp Trp Val Thr Val
Asn His Pro Leu 130 135 140Asp Lys Lys
Asn Ala Ile Val Val Val Ala Asp Ile Ala Ile Tyr Glu145
150 155 160Glu Gly Pro Ala Arg Cys Thr
Gly Gly Ala Gly Ala Ile Ala Phe Leu 165
170 175Ile Cys Pro Asp Ala Ser Ile Pro Ile Asp Arg Gln
Phe Ser Ala Cys 180 185 190His
Met Lys Asn Thr Trp Asp Phe Phe Lys Pro Ile Thr Pro Ile Pro 195
200 205Ser Glu Tyr Pro Val Val Asp Gly Ser
Leu Ser Leu Ser Ser Tyr Leu 210 215
220Glu Ala Val Arg Met Thr Tyr Thr Tyr Phe Ile Ser Lys Val Asn Arg225
230 235 240His Thr Thr Gly
Ile Asp Gly Leu Asn Ser Phe Asp Gly Val Phe Leu 245
250 255His Ser Pro Phe Thr Lys Met Val Gln Lys
Gly Leu Ala Val Met Asn 260 265
270Tyr Thr Asp Ser Gln Leu Arg His Lys Gln Leu Asn Gly Asn Gly Val
275 280 285Asp His Lys Leu Asp Glu Asn
Asp Arg Ala Gly Leu Ala Lys Met Ile 290 295
300Glu Leu Ser Ala Gln Val Trp Lys Glu Lys Thr Asp Pro Tyr Leu
Val305 310 315 320Phe Asn
Arg Arg Ile Gly Asn Met Tyr Thr Pro Ser Leu Phe Ala Gln
325 330 335Leu Leu Ala Tyr Leu Ala Ala
Asp Asp Cys Val Thr Gly Glu Lys Ser 340 345
350Ile Leu Phe Phe Ala Tyr Gly Ser Gly Leu Ala Ser Ala Ile
Phe Pro 355 360 365Gly Arg Val Arg
Gln Thr Ser Asn Leu Asp Lys Ile Arg Gln Val Ala 370
375 380Ile Arg Ala Ile Lys Arg Leu Asp Asp Arg Ile Gln
Phe Thr Pro Glu385 390 395
400Glu Phe Thr Glu Thr Leu Gln Lys Arg Glu Val Phe Leu Arg Ser Lys
405 410 415Glu Ile Pro Lys Ser
Pro Ser Glu Thr Ser Leu Phe Pro Asn Thr Tyr 420
425 430Phe Leu Asp Asn Met Asp Lys Leu Tyr Arg Arg Ser
Tyr Thr Leu His 435 440 445Glu Glu
Pro Asn Gly Val Gln Asn Gly Asn Gly Ile His His 450
455 4602447PRTSchizosaccharomyces pombe 2Met Ser Phe Asp
Arg Lys Asp Ile Gly Ile Lys Gly Leu Val Leu Tyr1 5
10 15Thr Pro Asn Gln Tyr Val Glu Gln Ala Ala
Leu Glu Ala His Asp Gly 20 25
30Val Ser Thr Gly Lys Tyr Thr Ile Gly Leu Gly Leu Thr Lys Met Ala
35 40 45Phe Val Asp Asp Arg Glu Asp Ile
Tyr Ser Phe Gly Leu Thr Ala Leu 50 55
60Ser Gln Leu Ile Lys Arg Tyr Gln Ile Asp Ile Ser Lys Ile Gly Arg65
70 75 80Leu Glu Val Gly Thr
Glu Thr Ile Ile Asp Lys Ser Lys Ser Val Lys 85
90 95Ser Val Leu Met Gln Leu Phe Gly Asp Asn His
Asn Val Glu Gly Ile 100 105
110Asp Cys Val Asn Ala Cys Tyr Gly Gly Val Asn Ala Leu Phe Asn Thr
115 120 125Ile Asp Trp Ile Glu Ser Ser
Ala Trp Asp Gly Arg Asp Gly Ile Val 130 135
140Val Ala Gly Asp Ile Ala Leu Tyr Ala Lys Gly Asn Ala Arg Pro
Thr145 150 155 160Gly Gly
Ala Gly Cys Val Ala Leu Leu Val Gly Pro Asn Ala Pro Ile
165 170 175Val Phe Glu Pro Gly Leu Arg
Gly Thr Tyr Met Gln His Ala Tyr Asp 180 185
190Phe Tyr Lys Pro Asp Leu Thr Ser Glu Tyr Pro Tyr Val Asp
Gly His 195 200 205Phe Ser Leu Glu
Cys Tyr Val Lys Ala Leu Asp Gly Ala Tyr Ala Asn 210
215 220Tyr Asn Val Arg Asp Val Ala Lys Asn Gly Lys Ser
Gln Gly Leu Gly225 230 235
240Leu Asp Arg Phe Asp Tyr Cys Ile Phe His Ala Pro Thr Cys Lys Gln
245 250 255Val Gln Lys Ala Tyr
Ala Arg Leu Leu Tyr Thr Asp Ser Ala Ala Glu 260
265 270Pro Ser Asn Pro Glu Leu Glu Gly Val Arg Glu Leu
Leu Ser Thr Leu 275 280 285Asp Ala
Lys Lys Ser Leu Thr Asp Lys Ala Leu Glu Lys Gly Leu Met 290
295 300Ala Ile Thr Lys Glu Arg Phe Asn Lys Arg Val
Ser Pro Ser Val Tyr305 310 315
320Ala Pro Thr Asn Cys Gly Asn Met Tyr Thr Ala Ser Ile Phe Ser Cys
325 330 335Leu Thr Ala Leu
Leu Ser Arg Val Pro Ala Asp Glu Leu Lys Gly Lys 340
345 350Arg Val Gly Ala Tyr Ser Tyr Gly Ser Gly Leu
Ala Ala Ser Phe Phe 355 360 365Ser
Phe Val Val Lys Gly Asp Val Ser Glu Ile Ala Lys Lys Thr Asn 370
375 380Leu Val Asn Asp Leu Asp Asn Arg His Cys
Leu Thr Pro Thr Gln Tyr385 390 395
400Glu Glu Ala Ile Glu Leu Arg His Gln Ala His Leu Lys Lys Asn
Phe 405 410 415Thr Pro Lys
Gly Ser Ile Glu Arg Leu Arg Ser Gly Thr Tyr Tyr Leu 420
425 430Thr Gly Ile Asp Asp Met Phe Arg Arg Ser
Tyr Ser Val Lys Pro 435 440
4453491PRTSaccharomyces cerevisiae 3Met Lys Leu Ser Thr Lys Leu Cys Trp
Cys Gly Ile Lys Gly Arg Leu1 5 10
15Arg Pro Gln Lys Gln Gln Gln Leu His Asn Thr Asn Leu Gln Met
Thr 20 25 30Glu Leu Lys Lys
Gln Lys Thr Ala Glu Gln Lys Thr Arg Pro Gln Asn 35
40 45Val Gly Ile Lys Gly Ile Gln Ile Tyr Ile Pro Thr
Gln Cys Val Asn 50 55 60Gln Ser Glu
Leu Glu Lys Phe Asp Gly Val Ser Gln Gly Lys Tyr Thr65 70
75 80Ile Gly Leu Gly Gln Thr Asn Met
Ser Phe Val Asn Asp Arg Glu Asp 85 90
95Ile Tyr Ser Met Ser Leu Thr Val Leu Ser Lys Leu Ile Lys
Ser Tyr 100 105 110Asn Ile Asp
Thr Asn Lys Ile Gly Arg Leu Glu Val Gly Thr Glu Thr 115
120 125Leu Ile Asp Lys Ser Lys Ser Val Lys Ser Val
Leu Met Gln Leu Phe 130 135 140Gly Glu
Asn Thr Asp Val Glu Gly Ile Asp Thr Leu Asn Ala Cys Tyr145
150 155 160Gly Gly Thr Asn Ala Leu Phe
Asn Ser Leu Asn Trp Ile Glu Ser Asn 165
170 175Ala Trp Asp Gly Arg Asp Ala Ile Val Val Cys Gly
Asp Ile Ala Ile 180 185 190Tyr
Asp Lys Gly Ala Ala Arg Pro Thr Gly Gly Ala Gly Thr Val Ala 195
200 205Met Trp Ile Gly Pro Asp Ala Pro Ile
Val Phe Asp Ser Val Arg Ala 210 215
220Ser Tyr Met Glu His Ala Tyr Asp Phe Tyr Lys Pro Asp Phe Thr Ser225
230 235 240Glu Tyr Pro Tyr
Val Asp Gly His Phe Ser Leu Thr Cys Tyr Val Lys 245
250 255Ala Leu Asp Gln Val Tyr Lys Ser Tyr Ser
Lys Lys Ala Ile Ser Lys 260 265
270Gly Leu Val Ser Asp Pro Ala Gly Ser Asp Ala Leu Asn Val Leu Lys
275 280 285Tyr Phe Asp Tyr Asn Val Phe
His Val Pro Thr Cys Lys Leu Val Thr 290 295
300Lys Ser Tyr Gly Arg Leu Leu Tyr Asn Asp Phe Arg Ala Asn Pro
Gln305 310 315 320Leu Phe
Pro Glu Val Asp Ala Glu Leu Ala Thr Arg Asp Tyr Asp Glu
325 330 335Ser Leu Thr Asp Lys Asn Ile
Glu Lys Thr Phe Val Asn Val Ala Lys 340 345
350Pro Phe His Lys Glu Arg Val Ala Gln Ser Leu Ile Val Pro
Thr Asn 355 360 365Thr Gly Asn Met
Tyr Thr Ala Ser Val Tyr Ala Ala Phe Ala Ser Leu 370
375 380Leu Asn Tyr Val Gly Ser Asp Asp Leu Gln Gly Lys
Arg Val Gly Leu385 390 395
400Phe Ser Tyr Gly Ser Gly Leu Ala Ala Ser Leu Tyr Ser Cys Lys Ile
405 410 415Val Gly Asp Val Gln
His Ile Ile Lys Glu Leu Asp Ile Thr Asn Lys 420
425 430Leu Ala Lys Arg Ile Thr Glu Thr Pro Lys Asp Tyr
Glu Ala Ala Ile 435 440 445Glu Leu
Arg Glu Asn Ala His Leu Lys Lys Asn Phe Lys Pro Gln Gly 450
455 460Ser Ile Glu His Leu Gln Ser Gly Val Tyr Tyr
Leu Thr Asn Ile Asp465 470 475
480Asp Lys Phe Arg Arg Ser Tyr Asp Val Lys Lys 485
4904461PRTArabidopsis thaliana 4Met Ala Lys Asn Val Gly Ile
Leu Ala Met Asp Ile Tyr Phe Pro Pro1 5 10
15Thr Cys Val Gln Gln Glu Ala Leu Glu Ala His Asp Gly
Ala Ser Lys 20 25 30Gly Lys
Tyr Thr Ile Gly Leu Gly Gln Asp Cys Leu Ala Phe Cys Thr 35
40 45Glu Leu Glu Asp Val Ile Ser Met Ser Phe
Asn Ala Val Thr Ser Leu 50 55 60Phe
Glu Lys Tyr Lys Ile Asp Pro Asn Gln Ile Gly Arg Leu Glu Val65
70 75 80Gly Ser Glu Thr Val Ile
Asp Lys Ser Lys Ser Ile Lys Thr Phe Leu 85
90 95Met Gln Leu Phe Glu Lys Cys Gly Asn Thr Asp Val
Glu Gly Val Asp 100 105 110Ser
Thr Asn Ala Cys Tyr Gly Gly Thr Ala Ala Leu Leu Asn Cys Val 115
120 125Asn Trp Val Glu Ser Asn Ser Trp Asp
Gly Arg Tyr Gly Leu Val Ile 130 135
140Cys Thr Asp Ser Ala Val Tyr Ala Glu Gly Pro Ala Arg Pro Thr Gly145
150 155 160Gly Ala Ala Ala
Ile Ala Met Leu Ile Gly Pro Asp Ala Pro Ile Val 165
170 175Phe Glu Ser Lys Leu Arg Ala Ser His Met
Ala His Val Tyr Asp Phe 180 185
190Tyr Lys Pro Asn Leu Ala Ser Glu Tyr Pro Val Val Asp Gly Lys Leu
195 200 205Ser Gln Thr Cys Tyr Leu Met
Ala Leu Asp Ser Cys Tyr Lys His Leu 210 215
220Cys Asn Lys Phe Glu Lys Ile Glu Gly Lys Glu Phe Ser Ile Asn
Asp225 230 235 240Ala Asp
Tyr Ile Val Phe His Ser Pro Tyr Asn Lys Leu Val Gln Lys
245 250 255Ser Phe Ala Arg Leu Leu Tyr
Asn Asp Phe Leu Arg Asn Ala Ser Ser 260 265
270Ile Asp Glu Ala Ala Lys Glu Lys Phe Thr Pro Tyr Ser Ser
Leu Thr 275 280 285Leu Asp Glu Ser
Tyr Gln Ser Arg Asp Leu Glu Lys Val Ser Gln Gln 290
295 300Ile Ser Lys Pro Phe Tyr Asp Ala Lys Val Gln Pro
Thr Thr Leu Ile305 310 315
320Pro Lys Glu Val Gly Asn Met Tyr Thr Ala Ser Leu Tyr Ala Ala Phe
325 330 335Ala Ser Leu Ile His
Asn Lys His Asn Asp Leu Ala Gly Lys Arg Val 340
345 350Val Met Phe Ser Tyr Gly Ser Gly Ser Thr Ala Thr
Met Phe Ser Leu 355 360 365Arg Leu
Asn Asp Asn Lys Pro Pro Phe Ser Ile Ser Asn Ile Ala Ser 370
375 380Val Met Asp Val Gly Gly Lys Leu Lys Ala Arg
His Glu Tyr Ala Pro385 390 395
400Glu Lys Phe Val Glu Thr Met Lys Leu Met Glu His Arg Tyr Gly Ala
405 410 415Lys Asp Phe Val
Thr Thr Lys Glu Gly Ile Ile Asp Leu Leu Ala Pro 420
425 430Gly Thr Tyr Tyr Leu Lys Glu Val Asp Ser Leu
Tyr Arg Arg Phe Tyr 435 440 445Gly
Lys Lys Gly Glu Asp Gly Ser Val Ala Asn Gly His 450
455 4605482PRTDictyostelium discoideum 5Met Thr Lys Pro
Glu Asn Ile Gly Ile His Gly Ile Glu Val Tyr Phe1 5
10 15Pro Ser Thr Tyr Val Ala Gln Glu Asp Leu
Glu Lys Phe Asp Gly Val 20 25
30Ser Gln Gly Lys Tyr Thr Leu Gly Leu Gly Gln Thr Asn Met Ala Phe
35 40 45Cys Gly Asp Arg Glu Asp Ile Tyr
Ser Leu Ser Leu Asn Ala Val Asn 50 55
60Asn Leu Met Asp Lys Phe Asn Val Asp Pro Asn Ser Ile Gly Arg Leu65
70 75 80Glu Val Gly Thr Glu
Thr Val Ile Asp Lys Ser Lys Ser Val Lys Thr 85
90 95Val Leu Met Asp Leu Phe Ala Lys His Gly Asn
Thr Ser Ile Asp Gly 100 105
110Ile Asp Thr Ile Asn Ala Cys Tyr Gly Gly Thr Ser Ala Leu His Asn
115 120 125Ala Leu Gln Trp Met Glu Ser
Ser Tyr Trp Asp Gly Arg Asn Ala Ile 130 135
140Val Val Ala Gly Asp Ile Ala Val Tyr Glu Lys Gly Pro Ala Arg
Pro145 150 155 160Thr Gly
Gly Ala Gly Val Val Ala Met Leu Ile Gly Pro Asn Ala Pro
165 170 175Ile Thr Phe Glu Ser Gly Leu
Arg Gly Val His Met Glu Asn Val Tyr 180 185
190Asp Phe Tyr Lys Pro Asp Met Asp Ser Glu Tyr Pro Arg Val
Asp Gly 195 200 205Lys Leu Ser Ile
Ser Cys Tyr Phe Arg Ala Ile Asp Asn Cys Tyr Asn 210
215 220Arg Tyr Ala Lys Ala Phe Glu Lys Lys Tyr Gly Lys
Ser Phe Ser Leu225 230 235
240Asp Gln Val Asp Phe Ala Leu Phe His Ser Pro Tyr Asn Lys Leu Val
245 250 255Gln Lys Ser Phe Gly
Arg Met Leu Tyr Asn Asp Phe Leu Asn Asn Pro 260
265 270Asn Asp Ser Arg Tyr Ala Ser Leu Glu Ala Tyr Lys
Asn Val Lys Pro 275 280 285Glu Asp
Thr Tyr Phe Asp Ser Val Leu Glu Lys Ala Leu Ser Ala Ile 290
295 300Thr Lys Asn Asp Tyr Ala Thr Lys Val Ala Pro
Thr Thr Leu Leu Ala305 310 315
320Lys Gln Leu Gly Asn Thr Tyr Cys Gly Ser Thr Tyr Ser Gly Leu Leu
325 330 335Ser Leu Leu Asp
Glu Lys Ser Asn Asp Leu Val Gly Lys Arg Val Leu 340
345 350Thr Phe Ser Tyr Gly Ser Gly Leu Ala Ala Ser
Ala Phe Ser Phe Lys 355 360 365Val
Glu Lys Pro Ile Asn His Ile Val Glu Lys Val Asp Leu Lys Asn 370
375 380Arg Leu Ala Lys Arg Val Arg Val Glu Pro
Glu Ile Phe Thr Glu Lys385 390 395
400Leu Ser Leu Arg Glu Thr Arg His Asn Leu Lys Asn Tyr Val Pro
Ser 405 410 415Asp Glu Thr
Thr Asn Met Phe Pro Gly Ser Phe Tyr Leu Ser Ser Val 420
425 430Asp Asn Ala Gly Ile Arg Lys Tyr Asp Arg
Thr Tyr Ser Thr Ser Ala 435 440
445Val Leu Gly Ala Phe Gln Arg Arg Gln Gln Ile Ser Gln Ser Thr Ile 450
455 460Lys Ser Leu Asn Leu Phe Arg Ala
Thr Lys Ser Val Leu Ser Ile Leu465 470
475 480Lys Lys6453PRTBlattella germanica 6Met Trp Pro Ser
Asp Val Gly Ile Val Ala Leu Glu Leu Ile Phe Pro1 5
10 15Ser Gln Tyr Val Asp Gln Val Asp Leu Glu
Val Tyr Asp Asn Val Ser 20 25
30Ala Gly Lys Tyr Thr Val Gly Leu Gly Gln Ala Arg Met Gly Phe Cys
35 40 45Thr Asp Arg Glu Asp Ile Asn Ser
Leu Cys Leu Thr Val Val Ser Arg 50 55
60Leu Met Glu Arg Trp Ser Ile Pro Tyr Ser Gln Ile Gly Arg Leu Glu65
70 75 80Val Gly Thr Glu Thr
Leu Leu Asp Lys Ser Lys Ser Val Lys Thr Val 85
90 95Leu Met Gln Leu Phe Lys Asp Asn Thr Asp Ile
Glu Gly Val Asp Thr 100 105
110Val Asn Ala Cys Tyr Gly Gly Thr Ser Ala Leu Phe Asn Ala Ile Ser
115 120 125Trp Val Glu Ser Ser Ser Trp
Asp Gly Arg Tyr Ala Leu Val Val Ala 130 135
140Gly Asp Ile Ala Val Tyr Ala Lys Gly Ser Ala Arg Pro Thr Gly
Gly145 150 155 160Ala Gly
Ala Val Ala Met Leu Val Gly Ala Asn Ala Pro Leu Val Phe
165 170 175Asp Arg Gly Val Arg Ser Ser
His Met Gln His Ala Tyr Asp Phe Tyr 180 185
190Lys Pro Asp Leu Ser Ser Leu Tyr Pro Thr Val Asp Gly Lys
Leu Ser 195 200 205Ile Gln Cys Tyr
Leu Ser Ala Leu Asp His Cys Tyr Gln Leu Tyr Cys 210
215 220Ser Lys Ile Gln Lys Gln Leu Gly Glu Lys Phe Asp
Ile Glu Arg Leu225 230 235
240Asp Ala Val Leu Phe His Ala Pro Tyr Cys Lys Leu Val Gln Lys Ser
245 250 255Leu Ala Arg Leu Val
Leu Asn Asp Phe Val Arg Ala Ser Glu Glu Glu 260
265 270Arg Thr Thr Lys Tyr Ser Ser Leu Glu Ala Leu Lys
Gly Val Lys Leu 275 280 285Glu Asp
Thr Tyr Phe Asp Arg Glu Val Glu Lys Ala Val Met Thr Tyr 290
295 300Ser Lys Asn Met Phe Glu Glu Lys Thr Lys Pro
Ser Leu Leu Leu Ala305 310 315
320Asn Gln Val Gly Asn Met Tyr Thr Pro Ser Leu Tyr Gly Gly Leu Val
325 330 335Ser Leu Leu Val
Ser Lys Ser Ala Gln Glu Leu Ala Gly Lys Arg Val 340
345 350Ala Leu Phe Ser Tyr Gly Ser Gly Leu Ala Ser
Ser Met Phe Ser Leu 355 360 365Arg
Ile Ser Ser Asp Ala Ser Ala Lys Ser Ser Leu Gln Arg Leu Val 370
375 380Ser Asn Leu Ser His Ile Lys Pro Gln Leu
Asp Leu Arg His Lys Val385 390 395
400Ser Pro Glu Glu Phe Ala Gln Thr Met Glu Thr Arg Glu His Asn
His 405 410 415His Lys Ala
Pro Tyr Thr Pro Glu Gly Ser Ile Asp Val Leu Phe Pro 420
425 430Gly Thr Trp Tyr Leu Glu Ser Val Asp Ser
Leu Tyr Arg Arg Ser Tyr 435 440
445Lys Gln Val Pro Gly 4507522PRTGallus gallus 7Met Pro Gly Ser Leu
Pro Val Asn Thr Glu Ser Cys Trp Pro Lys Asp1 5
10 15Val Gly Ile Val Ala Leu Glu Ile Tyr Phe Pro
Ser Gln Tyr Val Asp 20 25
30Gln Thr Glu Leu Glu Lys Tyr Asp Gly Val Asp Ala Gly Lys Tyr Thr
35 40 45Ile Gly Leu Gly Gln Ser Lys Met
Gly Phe Cys Ser Asp Arg Glu Asp 50 55
60Ile Asn Ser Leu Cys Leu Thr Val Val Gln Lys Leu Met Glu Arg Asn65
70 75 80Ser Leu Ser Tyr Asp
Cys Ile Gly Arg Leu Glu Val Gly Thr Glu Thr 85
90 95Ile Ile Asp Lys Ser Lys Ser Val Lys Thr Val
Leu Met Gln Leu Phe 100 105
110Glu Glu Ser Gly Asn Thr Asp Val Glu Gly Ile Asp Thr Thr Asn Ala
115 120 125Cys Tyr Gly Gly Thr Ala Ala
Leu Phe Asn Ala Ile Asn Trp Ile Glu 130 135
140Ser Ser Ser Trp Asp Gly Arg Tyr Ala Leu Val Val Ala Gly Asp
Ile145 150 155 160Ala Val
Tyr Ala Thr Gly Asn Ala Arg Pro Thr Gly Gly Ala Gly Ala
165 170 175Val Ala Met Leu Val Gly Ser
Asn Ala Pro Leu Ile Phe Glu Arg Gly 180 185
190Leu Arg Gly Thr His Met Gln His Ala Tyr Asp Phe Tyr Lys
Pro Asp 195 200 205Met Val Ser Glu
Tyr Pro Val Val Asp Gly Lys Leu Ser Ile Gln Cys 210
215 220Tyr Leu Ser Ala Leu Asp Arg Cys Tyr Ser Val Tyr
Arg Asn Lys Ile225 230 235
240His Ala Gln Trp Gln Lys Glu Gly Thr Asp Arg Gly Phe Thr Leu Asn
245 250 255Asp Phe Gly Phe Met
Ile Phe His Ser Pro Tyr Cys Lys Leu Val Gln 260
265 270Lys Ser Val Ala Arg Leu Leu Leu Asn Asp Phe Leu
Ser Asp Gln Asn 275 280 285Ala Glu
Thr Ala Asn Gly Val Phe Ser Gly Leu Glu Ala Phe Arg Asp 290
295 300Val Lys Leu Glu Asp Thr Tyr Phe Asp Arg Asp
Val Glu Lys Ala Phe305 310 315
320Met Lys Ala Ser Ala Glu Leu Phe Asn Gln Lys Thr Lys Ala Ser Leu
325 330 335Leu Val Ser Asn
Gln Asn Gly Asn Met Tyr Thr Pro Ser Val Tyr Gly 340
345 350Cys Leu Ala Ser Leu Leu Ala Gln Tyr Ser Pro
Glu His Leu Ala Gly 355 360 365Gln
Arg Ile Ser Glu Phe Ser Tyr Gly Ser Gly Phe Ala Ala Thr Leu 370
375 380Tyr Ser Ile Arg Val Thr Gln Asp Ala Thr
Pro Gly Ser Ala Leu Asp385 390 395
400Lys Ile Thr Ala Ser Leu Ser Asp Leu Lys Ala Arg Leu Asp Ser
Arg 405 410 415Lys Cys Ile
Ala Pro Asp Val Phe Ala Glu Asn Met Lys Ile Arg Gln 420
425 430Glu Thr His His Leu Ala Asn Tyr Ile Pro
Gln Cys Ser Val Glu Asp 435 440
445Leu Phe Glu Gly Thr Trp Tyr Leu Val Arg Val Asp Glu Lys His Arg 450
455 460Arg Thr Tyr Ala Arg Arg Pro Val
Met Gly Asp Gly Pro Leu Glu Ala465 470
475 480Gly Val Glu Val Val His Pro Gly Ile Val His Glu
His Ile Pro Ser 485 490
495Pro Ala Lys Lys Val Pro Arg Ile Pro Ala Thr Thr Glu Ser Glu Gly
500 505 510Val Thr Val Ala Ile Ser
Asn Gly Val His 515 5208520PRTHomo sapiens 8Met
Pro Gly Ser Leu Pro Leu Asn Ala Glu Ala Cys Trp Pro Lys Asp1
5 10 15Val Gly Ile Val Ala Leu Glu
Ile Tyr Phe Pro Ser Gln Tyr Val Asp 20 25
30Gln Ala Glu Leu Glu Lys Tyr Asp Gly Val Asp Ala Gly Lys
Tyr Thr 35 40 45Ile Gly Leu Gly
Gln Ala Lys Met Gly Phe Cys Thr Asp Arg Glu Asp 50 55
60Ile Asn Ser Leu Cys Met Thr Val Val Gln Asn Leu Met
Glu Arg Asn65 70 75
80Asn Leu Ser Tyr Asp Cys Ile Gly Arg Leu Glu Val Gly Thr Glu Thr
85 90 95Ile Ile Asp Lys Ser Lys
Ser Val Lys Thr Asn Leu Met Gln Leu Phe 100
105 110Glu Glu Ser Gly Asn Thr Asp Ile Glu Gly Ile Asp
Thr Thr Asn Ala 115 120 125Cys Tyr
Gly Gly Thr Ala Ala Val Phe Asn Ala Val Asn Trp Ile Glu 130
135 140Ser Ser Ser Trp Asp Gly Arg Tyr Ala Leu Val
Val Ala Gly Asp Ile145 150 155
160Ala Val Tyr Ala Thr Gly Asn Ala Arg Pro Thr Gly Gly Val Gly Ala
165 170 175Val Ala Leu Leu
Ile Gly Pro Asn Ala Pro Leu Ile Phe Glu Arg Gly 180
185 190Leu Arg Gly Thr His Met Gln His Ala Tyr Asp
Phe Tyr Lys Pro Asp 195 200 205Met
Leu Ser Glu Tyr Pro Ile Val Asp Gly Lys Leu Ser Ile Gln Cys 210
215 220Tyr Leu Ser Ala Leu Asp Arg Cys Tyr Ser
Val Tyr Cys Lys Lys Ile225 230 235
240His Ala Gln Trp Gln Lys Glu Gly Asn Asp Lys Asp Phe Thr Leu
Asn 245 250 255Asp Phe Gly
Phe Met Ile Phe His Ser Pro Tyr Cys Lys Leu Val Gln 260
265 270Lys Ser Leu Ala Arg Met Leu Leu Asn Asp
Phe Leu Asn Asp Gln Asn 275 280
285Arg Asp Lys Asn Ser Ile Tyr Ser Gly Leu Glu Ala Phe Gly Asp Val 290
295 300Lys Leu Glu Asp Thr Tyr Phe Asp
Arg Asp Val Glu Lys Ala Phe Met305 310
315 320Lys Ala Ser Ser Glu Leu Phe Ser Gln Lys Thr Lys
Ala Ser Leu Leu 325 330
335Val Ser Asn Gln Asn Gly Asn Met Tyr Thr Ser Ser Val Tyr Gly Ser
340 345 350Leu Ala Ser Val Leu Ala
Gln Tyr Ser Pro Gln Gln Leu Ala Gly Lys 355 360
365Arg Ile Gly Val Phe Ser Tyr Gly Ser Gly Leu Ala Ala Thr
Leu Tyr 370 375 380Ser Leu Lys Val Thr
Gln Asp Ala Thr Pro Gly Ser Ala Leu Asp Lys385 390
395 400Ile Thr Ala Ser Leu Cys Asp Leu Lys Ser
Arg Leu Asp Ser Arg Thr 405 410
415Gly Val Ala Pro Asp Val Phe Ala Glu Asn Met Lys Leu Arg Glu Asp
420 425 430Thr His His Leu Val
Asn Tyr Ile Pro Gln Gly Ser Ile Asp Ser Leu 435
440 445Phe Glu Gly Thr Trp Tyr Leu Val Arg Val Asp Glu
Lys His Arg Arg 450 455 460Thr Tyr Ala
Arg Arg Pro Thr Pro Asn Asp Asp Thr Leu Asp Glu Gly465
470 475 480Val Gly Leu Val His Ser Asn
Ile Ala Thr Glu His Ile Pro Ser Pro 485
490 495Ala Lys Lys Val Pro Arg Leu Pro Ala Thr Ala Ala
Glu Pro Glu Ala 500 505 510Ala
Val Ile Ser Asn Gly Val Trp 515 5209508PRTHomo
sapiens 9Met Gln Arg Leu Leu Thr Pro Val Lys Arg Ile Leu Gln Leu Thr Arg1
5 10 15Ala Val Gln Glu
Thr Ser Leu Thr Pro Ala Arg Leu Leu Pro Val Ala 20
25 30His Gln Arg Phe Ser Thr Ala Ser Ala Val Pro
Leu Ala Lys Thr Asp 35 40 45Thr
Trp Pro Lys Asp Val Gly Ile Leu Ala Leu Glu Val Tyr Phe Pro 50
55 60Ala Gln Tyr Val Asp Gln Thr Asp Leu Glu
Lys Tyr Asn Asn Val Glu65 70 75
80Ala Gly Lys Tyr Thr Val Gly Leu Gly Gln Thr Arg Met Gly Phe
Cys 85 90 95Ser Val Gln
Glu Asp Ile Asn Ser Leu Cys Leu Thr Val Val Gln Arg 100
105 110Leu Met Glu Arg Ile Gln Leu Pro Trp Asp
Ser Val Gly Arg Leu Glu 115 120
125Val Gly Thr Glu Thr Ile Ile Asp Lys Ser Lys Ala Val Lys Thr Val 130
135 140Leu Met Glu Leu Phe Gln Asp Ser
Gly Asn Thr Asp Ile Glu Gly Ile145 150
155 160Asp Thr Thr Asn Ala Cys Tyr Gly Gly Thr Ala Ser
Leu Phe Asn Ala 165 170
175Ala Asn Trp Met Glu Ser Ser Ser Trp Asp Gly Arg Tyr Ala Met Val
180 185 190Val Cys Gly Asp Ile Ala
Val Tyr Pro Ser Gly Asn Ala Arg Pro Thr 195 200
205Gly Gly Ala Gly Ala Val Ala Met Leu Ile Gly Pro Lys Ala
Pro Leu 210 215 220Ala Leu Glu Arg Gly
Leu Arg Gly Thr His Met Glu Asn Val Tyr Asp225 230
235 240Phe Tyr Lys Pro Asn Leu Ala Ser Glu Tyr
Pro Ile Val Asp Gly Lys 245 250
255Leu Ser Ile Gln Cys Tyr Leu Arg Ala Leu Asp Arg Cys Tyr Thr Ser
260 265 270Tyr Arg Lys Lys Ile
Gln Asn Gln Trp Lys Gln Ala Gly Ser Asp Arg 275
280 285Pro Phe Thr Leu Asp Asp Leu Gln Tyr Met Ile Phe
His Thr Pro Phe 290 295 300Cys Lys Met
Val Gln Lys Ser Leu Ala Arg Leu Met Phe Asn Asp Phe305
310 315 320Leu Ser Ala Ser Ser Asp Thr
Gln Thr Ser Leu Tyr Lys Gly Leu Glu 325
330 335Ala Phe Gly Gly Leu Lys Leu Glu Asp Thr Tyr Thr
Asn Lys Asp Leu 340 345 350Asp
Lys Ala Leu Leu Lys Ala Ser Gln Asp Met Phe Asp Lys Lys Thr 355
360 365Lys Ala Ser Leu Tyr Leu Ser Thr His
Asn Gly Asn Met Tyr Thr Ser 370 375
380Ser Leu Tyr Gly Cys Leu Ala Ser Leu Leu Ser His His Ser Ala Gln385
390 395 400Glu Leu Ala Gly
Ser Arg Ile Gly Ala Phe Ser Tyr Gly Ser Gly Leu 405
410 415Ala Ala Ser Phe Phe Ser Phe Arg Val Ser
Gln Asp Ala Ala Pro Gly 420 425
430Ser Pro Leu Asp Lys Leu Val Ser Ser Thr Ser Asp Leu Pro Lys Arg
435 440 445Leu Ala Ser Arg Lys Cys Val
Ser Pro Glu Glu Phe Thr Glu Ile Met 450 455
460Asn Gln Arg Glu Gln Phe Tyr His Lys Val Asn Phe Ser Pro Pro
Gly465 470 475 480Asp Thr
Asn Ser Leu Phe Pro Gly Thr Trp Tyr Leu Glu Arg Val Asp
485 490 495Glu Gln His Arg Arg Lys Tyr
Ala Arg Arg Pro Val 500
50510468PRTDictyostelium discoideum 10Met Lys Lys Thr Lys Asp Ile Gly Ile
Cys Ala Ile Asp Ile Tyr Phe1 5 10
15Pro Gln Thr Tyr Val Asn Gln Ser Glu Leu Lys Lys Tyr Asp Lys
Val 20 25 30Ser Asn Gly Lys
Tyr Thr Ile Gly Leu Gly Gln Thr Asn Met Ser Phe 35
40 45Val Gly Asp Arg Glu Asp Ile Val Ser Met Ala Met
Thr Ser Val Lys 50 55 60Met Met Met
Ser Lys Tyr Ser Ile Asp Tyr Gln Ser Ile Gly Arg Leu65 70
75 80Glu Val Gly Thr Glu Thr Ile Ile
Asp Lys Ser Lys Ser Val Lys Ser 85 90
95Ser Ile Met Ser Leu Phe Gln Glu Tyr Gly Asn Thr Ser Leu
Glu Gly 100 105 110Val Asp Thr
Leu Asn Ala Cys Tyr Gly Gly Thr Asn Ala Leu Phe Asn 115
120 125Ser Leu Gln Trp Ile Glu Ser Ser Tyr Trp Asp
Gly Arg Tyr Ala Leu 130 135 140Val Val
Thr Gly Asp Ile Ala Val Tyr Ser Lys Gly Ala Ala Arg Pro145
150 155 160Thr Gly Gly Ala Gly Val Val
Thr Met Leu Ile Gly Pro Asn Ala Thr 165
170 175Leu Ile Phe Asp Gln Ser Leu Arg Gly Thr His Met
Glu Asn Val Asn 180 185 190Asp
Phe Tyr Lys Pro Asp Leu Ser Ser Glu Tyr Pro Tyr Val Asp Gly 195
200 205Lys Leu Ser Ile Glu Cys Tyr Leu Arg
Ala Leu Asp Lys Cys Tyr Leu 210 215
220Glu Tyr Lys Lys Lys Phe Glu Ser Ile Asn Asp Asp Asn Lys Phe Ser225
230 235 240Met Asp Ser Phe
Asp Tyr Val Cys Phe His Ser Pro Tyr Asn Arg Leu 245
250 255Val Gln Lys Ser Tyr Ala Arg Leu Ile Tyr
Asn Asp Phe Leu Gln Asn 260 265
270Pro Asn Asn Pro Lys Tyr Gln Asp Leu Leu Pro Phe Lys Asp Leu Ser
275 280 285Thr Gly Lys Asp Ser Tyr Ile
Asn Ser Lys Leu Asp Gln Ile Thr Leu 290 295
300Lys Leu Ser Leu Asp Asp Phe Lys Thr Lys Val Asn Pro Ser Thr
Leu305 310 315 320Leu Ser
Lys Glu Cys Gly Asn Ser Tyr Cys Gly Ser Val Tyr Ser Gly
325 330 335Ile Leu Ser Leu Leu Ser Asn
Val Asn Asp Leu Asn Asn Lys Lys Val 340 345
350Leu Val Phe Ser Tyr Gly Ser Gly Leu Ala Ala Ser Leu Phe
Ser Phe 355 360 365Arg Ile Asn Asn
Asn Lys Asn Arg Asn Asn Asn Asn Asn Asn Asn Asn 370
375 380Cys Phe Phe Lys Thr Thr Asn Asp Ile Gly Lys Ile
Ser Asn Ile Lys385 390 395
400Glu Arg Leu Ser Asn Arg Val Lys Val Ser Pro Glu Glu Phe Thr Arg
405 410 415Ile Leu Asp Ile Arg
Glu Lys Ser His Gln Met Val Gly Ala Arg Thr 420
425 430Pro Ile Asp Thr Leu Asp Tyr Ile Ser Ala Gly Thr
Phe Tyr Leu Glu 435 440 445Lys Ile
Asp Glu Lys Leu Ile Arg His Tyr Lys Ser Lys Pro Ile Ile 450
455 460Ser Ser Lys Leu46511388PRTStaphylococcus
epidermidis 11Met Asn Ile Gly Ile Asp Lys Ile Ser Phe Tyr Val Pro Lys Tyr
Tyr1 5 10 15Val Asp Met
Ala Lys Leu Ala Glu Ala Arg Gln Val Asp Pro Asn Lys 20
25 30Phe Leu Ile Gly Ile Gly Gln Thr Glu Met
Thr Val Ser Pro Val Asn 35 40
45Gln Asp Ile Val Ser Met Gly Ala Asn Ala Ala Lys Asp Ile Ile Thr 50
55 60Glu Glu Asp Lys Lys Asn Ile Gly Met
Val Ile Val Ala Thr Glu Ser65 70 75
80Ala Ile Asp Asn Ala Lys Ala Ala Ala Val Gln Ile His His
Leu Leu 85 90 95Gly Ile
Gln Pro Phe Ala Arg Cys Phe Glu Met Lys Glu Ala Cys Tyr 100
105 110Ala Ala Thr Pro Ala Ile Gln Leu Ala
Lys Asp Tyr Leu Ala Gln Arg 115 120
125Pro Asn Glu Lys Val Leu Val Ile Ala Ser Asp Thr Ala Arg Tyr Gly
130 135 140Ile His Ser Gly Gly Glu Pro
Thr Gln Gly Ala Gly Ala Val Ala Met145 150
155 160Met Ile Ser His Asp Pro Ser Ile Leu Lys Leu Asn
Asp Asp Ala Val 165 170
175Ala Tyr Thr Glu Asp Val Tyr Asp Phe Trp Arg Pro Thr Gly His Gln
180 185 190Tyr Pro Leu Val Ala Gly
Ala Leu Ser Lys Asp Ala Tyr Ile Lys Ser 195 200
205Phe Gln Glu Ser Trp Asn Glu Tyr Ala Arg Arg His Asn Lys
Thr Leu 210 215 220Ala Asp Phe Ala Ser
Leu Cys Phe His Val Pro Phe Thr Lys Met Gly225 230
235 240Gln Lys Ala Leu Asp Ser Ile Ile Asn His
Ala Asp Glu Thr Thr Gln 245 250
255Asp Arg Leu Asn Ser Ser Tyr Gln Asp Ala Val Asp Tyr Asn Arg Tyr
260 265 270Val Gly Asn Ile Tyr
Thr Gly Ser Leu Tyr Leu Ser Leu Ile Ser Leu 275
280 285Leu Glu Thr Arg Asp Leu Lys Gly Gly Gln Thr Ile
Gly Leu Phe Ser 290 295 300Tyr Gly Ser
Gly Ser Val Gly Glu Phe Phe Ser Gly Thr Leu Val Asp305
310 315 320Gly Phe Lys Glu Gln Leu Asp
Val Glu Arg His Lys Ser Leu Leu Asn 325
330 335Asn Arg Ile Glu Val Ser Val Asp Glu Tyr Glu His
Phe Phe Lys Arg 340 345 350Phe
Asp Gln Leu Glu Leu Asn His Glu Leu Glu Lys Ser Asn Ala Asp 355
360 365Arg Asp Ile Phe Tyr Leu Lys Ser Ile
Asp Asn Asn Ile Arg Glu Tyr 370 375
380His Ile Ala Glu38512389PRTLactobacillus fermentum 12Met Lys Ile Gly
Ile Asp Lys Leu Ala Phe Ala Thr Thr Pro Tyr Tyr1 5
10 15Leu Ala Met Glu Asp Leu Ala Gln Gly Arg
Asn Val Asp Pro Asn Lys 20 25
30Tyr Leu Ile Gly Ile Gly Gln Ser Lys Gln Ala Val Val Pro Pro Thr
35 40 45Gln Asp Val Val Thr Leu Ala Ala
Ala Ala Ala Asp Lys Leu Leu Asp 50 55
60Pro Val Glu Arg Asp Gln Val Ser Thr Val Ile Val Ala Thr Glu Ser65
70 75 80Gly Ile Asp Asn Ser
Lys Ala Ala Ala Val Tyr Val Lys His Leu Leu 85
90 95Lys Leu Ser Asp Phe Thr Arg Ala Val Glu Val
Lys Glu Ala Cys Tyr 100 105
110Ser Ala Thr Ala Ala Leu Gln Phe Ala Arg Gly Leu Val Ala Leu Asn
115 120 125Pro Gln Glu Lys Ile Leu Val
Ile Ala Ser Asp Ile Ala Arg Tyr Gly 130 135
140Leu Glu Thr Gly Gly Glu Val Thr Gln Gly Ala Gly Ala Val Ala
Met145 150 155 160Leu Ile
Thr Ala Asn Pro Arg Val Leu Ala Ile Glu Pro Thr Ser Val
165 170 175Ala Tyr Thr Lys Asp Val Met
Asp Phe Trp Arg Pro Leu Tyr Ala Glu 180 185
190Glu Ala Leu Val Asn Gly Lys Tyr Ser Thr Asn Val Tyr Ile
Asp Phe 195 200 205Phe Lys Gln Cys
Trp Thr Arg Tyr Gln Gln Leu Ala Gly Tyr Gly Leu 210
215 220Glu Asp Phe Ala Ala Leu Ala Phe His Leu Pro Phe
Thr Lys Met Gly225 230 235
240Lys Lys Ala Leu Glu Ala Glu Leu Gly Asp Arg Asp Asp Gln Val Ala
245 250 255Thr Arg Leu Arg Ala
Asn Leu Thr Ala Gly Gln Glu Ala Cys Arg Gln 260
265 270Val Gly Asn Leu Tyr Thr Gly Ser Leu Tyr Leu Gly
Leu Met Ser Leu 275 280 285Leu Thr
Glu Gly Asp Val Lys Pro Gly Glu Arg Ile Gly Leu Phe Ser 290
295 300Tyr Gly Ser Gly Ala Glu Gly Glu Phe Phe Ala
Gly Ile Leu Gln Pro305 310 315
320Gly Tyr Gln Glu Gly Leu Gly Asp Leu Asn Glu Gln Leu Ala Ala Arg
325 330 335Thr Gln Val Ser
Leu Ala Glu Tyr Glu Asp Leu Phe Asn Gln Gln Leu 340
345 350Gly Leu Lys Glu Glu Asp Val Thr Phe Lys Thr
Pro Ala Ala Gly Gln 355 360 365Arg
Phe Val Leu Val Gly Gln Lys Asp His Gln Arg Gln Tyr Arg Asp 370
375 380Leu Ala Glu Arg
Asp38513351PRTHyperthermus butylicus 13Met Pro Arg Gly Ser Gly Ile Val
Gly Trp Gly Gly Tyr Val Pro Arg1 5 10
15Tyr Arg Ile Lys Ala Ala Glu Ile Val Arg Val Trp Gly Trp
Glu Pro 20 25 30Ser Val Pro
Ala Gly Leu Gly Val Lys Glu Lys Ala Val Glu Asn Val 35
40 45Asp Glu Asp Ser Val Thr Met Gly Tyr Glu Ala
Ala Arg Asn Ala Ile 50 55 60Ala Arg
Ala Asn Val Asp Pro Arg Glu Ile Lys Ala Val Phe Phe Gly65
70 75 80Thr Glu Ser Lys Pro Tyr Ala
Val Lys Pro Ser Ala Thr Ile Ile Ala 85 90
95Glu Ala Leu Gly Ile Thr Pro Glu Thr Met Ala Ser Asp
Leu Glu Phe 100 105 110Ala Cys
Arg Ala Ala Ser Glu Gly Leu Arg Ala Ser Leu Ala Leu Val 115
120 125Glu Ala Gly Tyr Met Lys Tyr Ala Leu Val
Val Ala Ser Asp Thr Ala 130 135 140Gln
Ala Asn Pro Gly Asp Val Leu Glu Phe Thr Ala Ala Ser Gly Ala145
150 155 160Ala Ala Phe Val Val Gly
Pro Ala Ser Glu Ser Val Ala Val Leu Glu 165
170 175Gly Val Tyr Thr Tyr Val Thr Asp Thr Pro Asp Phe
Trp Arg Gly Gln 180 185 190His
Ser Arg Tyr Pro Met His Gly Glu Ala Phe Thr Gly Glu Pro Ala 195
200 205Tyr Phe His His Ile Glu Ser Ala Val
Lys Gly Leu Met Glu Lys Leu 210 215
220Gly Leu Lys Pro Glu Asp Phe Asp Tyr Ala Val Phe His Gln Pro Asn225
230 235 240Gly Lys Phe Pro
Leu Arg Val Gly Ala Arg Leu Gly Phe Pro Lys Glu 245
250 255Lys Ile Leu Pro Gly Leu Leu Thr Pro Ile
Ile Gly Asn Thr Tyr Asn 260 265
270Ala Ser Ala Leu Leu Gly Phe Ala Arg Ile Leu Asp Gln Ala Lys Pro
275 280 285Gly Gln Arg Ile Leu Val Ala
Pro Phe Gly Ser Gly Ala Gly Ser Asp 290 295
300Ala Tyr Ser Phe Ile Val Thr Asp Arg Ile Glu Glu Ala Arg Asn
Arg305 310 315 320Ala Pro
Lys Val Asp Asp Tyr Val Asn Trp Lys Arg Tyr Ile Asp Tyr
325 330 335Ala Met His Ala Arg Met Arg
Lys Leu Tyr Asp Arg Arg Pro Val 340 345
35014349PRTChloroflexus aggregans 14Met Met Lys Pro Asn Gln Pro
Val Gly Ile Ile Gly Tyr Gly Val Tyr1 5 10
15Ile Pro Arg Tyr Arg Ile Ala Ala Arg Glu Ile Ala Arg
Ile Trp Thr 20 25 30Asp Gly
Gln Asn Gly Val Pro Val Glu Ala Lys Ser Val Pro Gly Pro 35
40 45Asp Glu Asp Thr Ile Thr Met Ala Ile Glu
Ala Ala Arg Asn Ala Leu 50 55 60Val
Arg Ala Asp Ile Pro Ala Ser Ala Leu Gly Ala Val Trp Ile Gly65
70 75 80Ser Glu Ser His Pro Tyr
Ser Val Lys Pro Ser Gly Thr Val Val Ala 85
90 95Asp Ala Leu Gly Ala Gly Pro Trp Val Ser Ala Ala
Asp Trp Glu Phe 100 105 110Ala
Cys Lys Ala Gly Ser Glu Ala Leu Thr Ala Ala Met Ala Leu Val 115
120 125Gly Ser Gly Met Gln Arg Tyr Ala Leu
Ala Ile Gly Ala Asp Thr Ala 130 135
140Gln Gly Arg Pro Gly Asp Ala Leu Glu Tyr Thr Ala Ser Ala Gly Ala145
150 155 160Ala Ala Leu Ile
Val Gly Pro Ala Thr Glu Ala Leu Ala Thr Ile Asp 165
170 175Ala Thr Val Ser Tyr Val Thr Asp Thr Pro
Asp Phe Tyr Arg Arg Ala 180 185
190Asp Arg Pro Tyr Pro Val His Gly Asn Arg Phe Thr Gly Glu Pro Ala
195 200 205Tyr Phe His Gln Ile Gln Ser
Ala Ala Ser Glu Leu Leu Arg Gln Leu 210 215
220Asn Arg Thr Ala Ala Asp Phe Thr Tyr Ala Val Phe His Gln Pro
Asn225 230 235 240Ala Lys
Phe Pro Gln Thr Val Ala Lys Arg Leu Gly Phe Thr Asp Ala
245 250 255Gln Ile Ala Pro Gly Leu Leu
Ser Pro Gln Ile Gly Asn Thr Tyr Ser 260 265
270Gly Ala Ala Leu Leu Gly Leu Cys Ala Ile Leu Asp Val Ala
Lys Pro 275 280 285Gly Asp Thr Ile
Phe Val Thr Ser Tyr Gly Ser Gly Ala Gly Ser Asp 290
295 300Ala Tyr Ala Leu Thr Val Thr Glu Ala Ile Val Glu
Arg Arg Glu Arg305 310 315
320Ala Pro Leu Thr Ala Ala Tyr Leu Ala Arg Lys Val Met Ile Asp Tyr
325 330 335Ala Met Tyr Ala Lys
Trp Arg Gly Lys Leu Val Met Gly 340
34515387PRTLactobacillus delbrueckii 15Met Asp Ile Gly Ile Asp Gln Ile
Gly Phe Tyr Thr Pro Asn Lys Phe1 5 10
15Val Asp Met Val Asp Leu Ala Asn Ala Arg Asn Gln Asp Pro
Asn Lys 20 25 30Phe Leu Ile
Gly Ile Gly Gln Asp Arg Met Ala Val Ala Asp Lys Thr 35
40 45Gln Asp Ala Val Ser Met Gly Ile Asn Ala Thr
Ala Glu Tyr Leu Asp 50 55 60Gln Val
Asp Leu Glu Gln Leu Gly Leu Leu Ile Phe Ala Thr Glu Ser65
70 75 80Gly Ile Asp Gln Ser Lys Ser
Ala Ser Leu Phe Val Lys Glu Ala Leu 85 90
95Asn Leu Pro Ala Arg Ile Arg Thr Phe Glu Ile Lys Glu
Ala Cys Phe 100 105 110Ala Leu
Thr Ala Ser Leu Gln Val Ala Arg Asp Tyr Val Arg Ala His 115
120 125Pro His His Ser Ala Met Ile Ile Gly Ser
Asp Ile Ala Arg Tyr Gly 130 135 140Leu
Ala Thr Ala Gly Glu Val Thr Gln Gly Ala Gly Ala Ile Ser Met145
150 155 160Leu Ile Lys Glu Asn Pro
Ala Ile Ile Ala Leu Glu Asp Gly His Thr 165
170 175Ser His Ser Glu Asn Ile Asn Asp Phe Trp Arg Pro
Asn Asn Leu Ala 180 185 190Thr
Ala Val Val Asp Gly His Tyr Ser Arg Asp Val Tyr Leu Asp Phe 195
200 205Phe Lys Ser Thr Phe Lys Pro Phe Leu
Ala Glu Lys Gln Leu Gln Val 210 215
220Ser Asp Phe Ala Gly Ile Cys Tyr His Leu Pro Tyr Thr Lys Met Gly225
230 235 240Tyr Lys Ala His
Lys Ile Ala Ile Glu Gly Gln Asp Asp Glu Thr Val 245
250 255Lys Arg Leu Ser Asp Asn Phe Gln Leu Ser
Ala Lys Tyr Ser Arg Gln 260 265
270Val Gly Asn Ile Tyr Thr Ala Ser Leu Tyr Met Ser Val Leu Ser Leu
275 280 285Leu Glu Asn Gly Asp Leu Glu
Ala Gly Asp Arg Ile Gly Phe Phe Ser 290 295
300Tyr Gly Ser Gly Ala Met Ala Glu Phe Phe Ser Gly Lys Val Val
Ala305 310 315 320Gly Tyr
Gln Lys Arg Leu Arg Pro Ala Leu His Ala Arg Met Leu Lys
325 330 335Glu Arg Ile Arg Leu Gly Val
Gly Gln Tyr Glu Asp Ile Phe Thr Glu 340 345
350Gly Leu Glu Ala Leu Pro Glu Asn Val Glu Phe Thr Ser Asp
Ala Asn 355 360 365His Gly Thr Trp
Tyr Leu Ala Gly Gln Glu Gly Tyr Val Arg Gln Tyr 370
375 380Lys Gln Lys38516388PRTStaphylococcus haemolyticus
16Met Ser Ile Gly Ile Asp Lys Ile Asn Phe Tyr Val Pro Lys Tyr Tyr1
5 10 15Val Asp Met Ala Lys Leu
Ala Glu Ala Arg Gln Val Asp Pro Asn Lys 20 25
30Phe Leu Ile Gly Ile Gly Gln Thr Gln Met Ala Val Ser
Pro Val Ser 35 40 45Gln Asp Ile
Val Ser Met Gly Ala Asn Ala Ala Lys Asp Ile Ile Thr 50
55 60Asp Asp Asp Lys Lys His Ile Gly Met Val Ile Val
Ala Thr Glu Ser65 70 75
80Ala Ile Asp Asn Ala Lys Ala Ala Ala Val Gln Ile His Asn Leu Leu
85 90 95Gly Val Gln Pro Phe Ala
Arg Cys Phe Glu Met Lys Glu Ala Cys Tyr 100
105 110Ala Ala Thr Pro Ala Ile Gln Leu Ala Lys Asp Tyr
Ile Glu Lys Arg 115 120 125Pro Asn
Glu Lys Val Leu Val Ile Ala Ser Asp Thr Ala Arg Tyr Gly 130
135 140Ile Gln Ser Gly Gly Glu Pro Thr Gln Gly Ala
Gly Ala Val Ala Met145 150 155
160Leu Ile Ser Asn Asn Pro Ser Ile Leu Glu Leu Asn Asp Asp Ala Val
165 170 175Ala Tyr Thr Glu
Asp Val Tyr Asp Phe Trp Arg Pro Thr Gly His Lys 180
185 190Tyr Pro Leu Val Ala Gly Ala Leu Ser Lys Asp
Ala Tyr Ile Lys Ser 195 200 205Phe
Gln Glu Ser Trp Asn Glu Tyr Ala Arg Arg Glu Asp Lys Thr Leu 210
215 220Ser Asp Phe Glu Ser Leu Cys Phe His Val
Pro Phe Thr Lys Met Gly225 230 235
240Lys Lys Ala Leu Asp Ser Ile Ile Asn Asp Ala Asp Glu Thr Thr
Gln 245 250 255Glu Arg Leu
Thr Ser Gly Tyr Glu Asp Ala Val Tyr Tyr Asn Arg Tyr 260
265 270Val Gly Asn Ile Tyr Thr Gly Ser Leu Tyr
Leu Ser Leu Ile Ser Leu 275 280
285Leu Glu Asn Arg Ser Leu Lys Gly Gly Gln Thr Ile Gly Leu Phe Ser 290
295 300Tyr Gly Ser Gly Ser Val Gly Glu
Phe Phe Ser Ala Thr Leu Val Glu305 310
315 320Gly Tyr Glu Lys Gln Leu Asp Ile Glu Gly His Lys
Ala Leu Leu Asn 325 330
335Glu Arg Gln Glu Val Ser Val Glu Asp Tyr Glu Ser Phe Phe Lys Arg
340 345 350Phe Asp Asp Leu Glu Phe
Asp His Ala Thr Glu Gln Thr Asp Asp Asp 355 360
365Lys Ser Ile Tyr Tyr Leu Glu Asn Ile Gln Asp Asp Ile Arg
Gln Tyr 370 375 380His Ile Pro
Lys38517420PRTBacillus subtilis 17Met Val Ser Ala Gly Ile Glu Ala Met Asn
Val Phe Gly Gly Thr Ala1 5 10
15Tyr Leu Asp Val Met Glu Leu Ala Lys Tyr Arg His Leu Asp Thr Ala
20 25 30Arg Phe Glu Asn Leu Leu
Met Lys Glu Lys Ala Val Ala Leu Pro Tyr 35 40
45Glu Asp Pro Val Thr Phe Gly Val Asn Ala Ala Lys Pro Ile
Ile Asp 50 55 60Ala Leu Ser Glu Ala
Glu Lys Asp Arg Ile Glu Leu Leu Ile Thr Cys65 70
75 80Ser Glu Ser Gly Ile Asp Phe Gly Lys Ser
Leu Ser Thr Tyr Ile His 85 90
95Glu Tyr Leu Gly Leu Asn Arg Asn Cys Arg Leu Phe Glu Val Lys Gln
100 105 110Ala Cys Tyr Ser Gly
Thr Ala Gly Phe Gln Met Ala Val Asn Phe Ile 115
120 125Leu Ser Gln Thr Ser Pro Gly Ala Lys Ala Leu Val
Ile Ala Ser Asp 130 135 140Ile Ser Arg
Phe Leu Ile Ala Glu Gly Gly Asp Ala Leu Ser Glu Asp145
150 155 160Trp Ser Tyr Ala Glu Pro Ser
Ala Gly Ala Gly Ala Val Ala Val Leu 165
170 175Val Gly Glu Asn Pro Glu Val Phe Gln Ile Asp Pro
Gly Ala Asn Gly 180 185 190Tyr
Tyr Gly Tyr Glu Val Met Asp Thr Cys Arg Pro Ile Pro Asp Ser 195
200 205Glu Ala Gly Asp Ser Asp Leu Ser Leu
Met Ser Tyr Leu Asp Cys Cys 210 215
220Glu Gln Thr Phe Leu Glu Tyr Gln Lys Arg Val Pro Gly Ala Asn Tyr225
230 235 240Gln Asp Thr Phe
Gln Tyr Leu Ala Tyr His Thr Pro Phe Gly Gly Met 245
250 255Val Lys Gly Ala His Arg Thr Met Met Arg
Lys Val Ala Lys Val Lys 260 265
270Thr Ser Gly Ile Glu Thr Asp Phe Leu Thr Arg Val Lys Pro Gly Leu
275 280 285Asn Tyr Cys Gln Arg Val Gly
Asn Ile Met Gly Ala Ala Leu Phe Leu 290 295
300Ala Leu Ala Ser Thr Ile Asp Gln Gly Arg Phe Asp Thr Pro Lys
Arg305 310 315 320Ile Gly
Cys Phe Ser Tyr Gly Ser Gly Cys Cys Ser Glu Phe Tyr Ser
325 330 335Gly Ile Thr Thr Pro Gln Gly
Gln Glu Arg Gln Arg Thr Phe Gly Ile 340 345
350Glu Lys His Leu Asp Arg Arg Tyr Gln Leu Ser Met Glu Glu
Tyr Glu 355 360 365Leu Leu Phe Lys
Gly Ser Gly Met Val Arg Phe Gly Thr Arg Asn Val 370
375 380Lys Leu Asp Phe Glu Met Ile Pro Gly Ile Met Gln
Ser Thr Gln Glu385 390 395
400Lys Pro Arg Leu Phe Leu Glu Glu Ile Ser Glu Phe His Arg Lys Tyr
405 410 415Arg Trp Ile Ser
42018388PRTMycobacterium marinum 18Met Val Ser Ile Gly Ile His Asp
Leu Ser Ile Ala Thr Ala His Tyr1 5 10
15Val Leu Asp His Ala Thr Leu Ala Glu His His Gly Val Asp
Val Asn 20 25 30Lys Tyr Leu
Ile Gly Leu Gly Gln Gln Gln Met Ser Ile Val Ala Pro 35
40 45Asp Glu Asp Ile Val Thr Leu Ala Ala Ala Ala
Ala Asp Pro Ile Ile 50 55 60Lys Arg
His Gly Ser Gln Lys Ile Arg Thr Ile Val Ile Gly Thr Glu65
70 75 80Thr Gly Val Asp Gln Ser Lys
Ser Ala Gly Ile Trp Val Ser Ser Leu 85 90
95Leu Gly Leu Pro Ser Ser Ala Arg Val Leu Glu Val Lys
Gln Ala Cys 100 105 110Tyr Gly
Ala Thr Gly Ala Leu Gln Leu Ala Leu Ala Leu Val His Arg 115
120 125Asp Pro Thr Gln Gln Val Leu Val Ile Ala
Ala Asp Val Ala Arg Tyr 130 135 140Asp
Leu Asp Ser Pro Gly Glu Pro Thr Gln Gly Ala Ala Ala Ala Ala145
150 155 160Met Leu Val Ser Ala Asp
Pro Ala Leu Leu Arg Leu Glu Glu Pro Thr 165
170 175Gly Ile Tyr Thr Ala Asp Ile Met Asp Phe Trp Arg
Pro Asn Tyr Arg 180 185 190Ser
Thr Ala Leu Val Asp Gly Lys Ala Ser Val Thr Ala Tyr Met Glu 195
200 205Ala Ala Ser Gly Ala Trp Lys Asp Tyr
Thr Glu Arg Gly Gly Arg Ala 210 215
220Phe Gly Glu Phe Ala Ala Phe Cys Tyr His Gln Pro Phe Thr Lys Met225
230 235 240Ala Tyr Lys Ala
His Lys Gln Leu Ala Ala Glu Ala Gly Glu Asp Ala 245
250 255Ser Gly Ala Ala Val Gln Ala Ala Val Gly
Asn Thr Val Glu Tyr Asn 260 265
270Arg Arg Ile Gly Asn Ser Tyr Thr Ala Ser Leu Tyr Leu Ala Leu Ala
275 280 285Ala Leu Leu Asp Gln Ala Asp
Asp Leu Ser Asp Gln Pro Ile Ala Met 290 295
300Leu Ser Tyr Gly Ser Gly Cys Val Ala Glu Leu Phe Ala Gly Thr
Val305 310 315 320Thr Pro
Gly Tyr Gln Gln His Leu Arg Thr Asp Gln His Arg Ala Ala
325 330 335Leu Glu Thr Arg Ile Pro Leu
Ser Tyr Glu His Tyr Arg Arg Leu His 340 345
350Asn Leu Thr Leu Pro Thr Asn Gly Asn His His Ser Leu Pro
Val Glu 355 360 365Thr Ser Arg Pro
Phe Arg Leu Thr Ala Ile Ser Glu His Lys Arg Met 370
375 380Tyr Gly Ala Val38519435PRTZea mays 19Met Leu Ala
Ala Ser Thr Lys Val Gly Ser Arg Leu Ala Ser Pro His1 5
10 15Ala Ser Leu Ser Ala Gly Ala Ala Ala
Ala Ala Leu Ala Ser Ser Pro 20 25
30Val Leu Gly Ser Gly Met Leu Pro Gly Ala Gly Phe Gly Glu Thr Gly
35 40 45Asn His His Ala Ala Asp Ala
Pro Pro Pro Leu Pro Cys Ser Ser Ser 50 55
60Gly Asp Ser Arg Glu Tyr Tyr Gln Trp Lys Arg Leu Val Asn Gln Arg65
70 75 80Gln Ser Thr Leu
His Val Gly Glu Val Pro Ala Ala Leu Gly His His 85
90 95Val Phe Gly Ala Gly Cys Ser Ser Arg Lys
Gln His Ile Tyr Arg Tyr 100 105
110Phe Ser Ser Ser Ser His Gln Gly Ser Ile Trp Ala Arg Ser Lys Ile
115 120 125Leu His Asp Leu Pro Gly Tyr
Val Lys Ile Val Glu Val Gly Pro Arg 130 135
140Asp Gly Leu Gln Asn Glu Lys Asp Ile Val Pro Thr Pro Val Lys
Val145 150 155 160Glu Leu
Ile Arg Arg Leu Ala Thr Ser Gly Leu Pro Val Val Glu Ala
165 170 175Thr Ser Phe Val Ser Pro Lys
Trp Val Pro Gln Leu Ala Asp Ala Lys 180 185
190Asp Val Met Glu Ala Val Arg Thr Ile Gly Gly Val Arg Phe
Pro Val 195 200 205Leu Thr Pro Asn
Leu Lys Gly Phe Glu Ala Ala Ile Ala Ala Gly Ala 210
215 220Lys Glu Ile Ala Ile Phe Ala Ser Ala Ser Glu Gly
Phe Ser Lys Ser225 230 235
240Asn Ile Asn Cys Thr Ile Lys Glu Ser Ile Ala Arg Tyr Asn Asp Val
245 250 255Ala Leu Ala Ala Lys
Glu Lys Glu Ile Pro Val Arg Gly Tyr Val Ser 260
265 270Cys Val Val Gly Cys Pro Val Asp Gly Pro Val Pro
Pro Ser Asn Val 275 280 285Ala Tyr
Val Ala Lys Glu Leu Tyr Asp Met Gly Cys Tyr Glu Val Ser 290
295 300Leu Gly Asp Thr Ile Gly Val Gly Thr Pro Gly
Thr Val Val Pro Met305 310 315
320Leu Glu Ala Ala Ile Ser Val Val Pro Val Glu Lys Leu Ala Val His
325 330 335Phe His Asp Thr
Tyr Gly Gln Ser Leu Ser Asn Ile Leu Ile Ser Leu 340
345 350Gln Met Gly Val Ser Val Val Asp Ser Ser Val
Ala Gly Leu Gly Gly 355 360 365Cys
Pro Tyr Ala Lys Gly Ala Ser Gly Asn Val Ala Thr Glu Asp Val 370
375 380Val Tyr Met Leu Asn Gly Leu Gly Val Lys
Thr Gly Val Asp Leu Gly385 390 395
400Lys Val Met Ala Ala Gly Glu Phe Ile Cys Arg His Leu Gly Arg
Gln 405 410 415Ser Gly Ser
Lys Ala Ala Thr Ala Leu Ser Lys Val Thr Ala Asn Ala 420
425 430Ser Lys Leu 43520335PRTDanio
rerioDanio rerio (Brachydanio rerio) 20Met Gly Asn Val Ser Ser Ala Val
Lys His Cys Leu Ser Tyr Glu Thr1 5 10
15Phe Leu Arg Asp Tyr Pro Trp Leu Pro Arg Leu Leu Trp Glu
Glu Lys 20 25 30Cys Ser Glu
Leu Pro Lys Leu Pro Val Tyr Val Lys Ile Val Glu Val 35
40 45Gly Pro Arg Asp Gly Leu Gln Asn Glu Lys Glu
Ile Val Pro Thr Glu 50 55 60Val Lys
Ile Gln Leu Ile Asp Leu Leu Ser Gln Thr Gly Leu Pro Val65
70 75 80Ile Glu Ala Thr Ser Phe Val
Ser Ser Lys Trp Val Ala Gln Met Ala 85 90
95Asp His Thr Ala Val Leu Lys Gly Ile Lys Arg Ser Pro
Asp Val Arg 100 105 110Tyr Pro
Val Leu Thr Pro Asn Ile Gln Gly Phe Gln Ala Ala Val Ala 115
120 125Ala Gly Ala Asn Glu Val Ala Val Phe Gly
Ser Ala Ser Glu Thr Phe 130 135 140Ser
Arg Lys Asn Ile Asn Cys Ser Ile Glu Glu Ser Leu Gln Arg Phe145
150 155 160Glu Gln Val Val Ser Ala
Ala Lys Gln Glu Gly Ile Pro Val Arg Gly 165
170 175Tyr Val Ser Cys Ala Leu Gly Cys Pro Tyr Glu Gly
Gln Val Lys Pro 180 185 190Ser
Gln Val Thr Lys Val Ala Lys Arg Leu Phe Glu Leu Gly Cys Tyr 195
200 205Glu Val Ser Leu Gly Asp Thr Ile Gly
Val Gly Thr Ala Gly Ser Met 210 215
220Ala Glu Met Leu Ser Asp Val Leu Thr Glu Val Pro Ala Gly Ala Leu225
230 235 240Ala Val His Cys
His Asp Thr Tyr Gly Gln Ala Leu Pro Asn Ile Leu 245
250 255Ile Ala Leu Gln Met Gly Val Ser Val Val
Asp Ala Ser Val Ala Gly 260 265
270Leu Gly Gly Cys Pro Phe Ala Lys Gly Ala Ser Gly Asn Val Ser Thr
275 280 285Glu Asp Leu Leu Tyr Met Leu
His Gly Leu Gly Ile Glu Thr Gly Val 290 295
300Asp Leu Leu Lys Val Met Glu Ala Gly Asp Phe Ile Cys Lys Ala
Leu305 310 315 320Asn Arg
Lys Thr Asn Ser Lys Val Ser Gln Ala Thr Arg Asn Asn 325
330 33521325PRTBos taurus 21Met Ala Thr Val
Lys Lys Val Leu Pro Arg Arg Leu Val Gly Leu Ala1 5
10 15Thr Leu Arg Ala Val Ser Thr Ser Ser Val
Gly Thr Phe Pro Lys Gln 20 25
30Val Lys Ile Val Glu Val Gly Pro Arg Asp Gly Leu Gln Asn Glu Lys
35 40 45Asn Ile Val Pro Thr Pro Val Lys
Ile Lys Leu Ile Asp Met Leu Ser 50 55
60Glu Ala Gly Leu Pro Val Val Glu Ala Thr Ser Phe Val Ser Pro Lys65
70 75 80Trp Val Pro Gln Met
Ala Asp His Ala Glu Val Leu Lys Gly Ile Gln 85
90 95Lys Phe Pro Gly Val Asn Tyr Pro Val Leu Thr
Pro Asn Phe Lys Gly 100 105
110Phe Gln Ala Ala Val Ala Ala Gly Ala Lys Glu Val Ala Ile Phe Gly
115 120 125Ala Ala Ser Glu Leu Phe Thr
Lys Lys Asn Ile Asn Cys Ser Ile Asp 130 135
140Glu Ser Leu Gln Arg Phe Asp Glu Ile Leu Lys Ala Ala Arg Ala
Ala145 150 155 160Gly Ile
Ser Val Arg Gly Tyr Val Ser Cys Val Leu Gly Cys Pro Tyr
165 170 175Glu Gly Lys Ile Ser Pro Ala
Lys Val Ala Glu Val Thr Lys Lys Leu 180 185
190Tyr Ser Met Gly Cys Tyr Glu Ile Ser Leu Gly Asp Thr Ile
Gly Val 195 200 205Gly Thr Pro Gly
Ala Met Lys Asp Met Leu Ser Ala Val Leu Gln Glu 210
215 220Val Pro Val Thr Ala Leu Ala Val His Cys His Asp
Thr Tyr Gly Gln225 230 235
240Ala Leu Ala Asn Thr Leu Thr Ala Leu Gln Met Gly Val Ser Val Met
245 250 255Asp Ser Ser Val Ala
Gly Leu Gly Gly Cys Pro Tyr Ala Gln Gly Ala 260
265 270Ser Gly Asn Leu Ala Thr Glu Asp Leu Val Tyr Met
Leu Ala Gly Leu 275 280 285Gly Ile
His Thr Gly Val Asn Leu Gln Lys Leu Leu Glu Ala Gly Ala 290
295 300Phe Ile Cys Gln Ala Leu Asn Arg Arg Thr Asn
Ser Lys Val Ala Gln305 310 315
320Ala Thr Cys Lys Leu 32522325PRTHomo sapiens 22Met
Ala Ala Met Arg Lys Ala Leu Pro Arg Arg Leu Val Gly Leu Ala1
5 10 15Ser Leu Arg Ala Val Ser Thr
Ser Ser Met Gly Thr Leu Pro Lys Arg 20 25
30Val Lys Ile Val Glu Val Gly Pro Arg Asp Gly Leu Gln Asn
Glu Lys 35 40 45Asn Ile Val Ser
Thr Pro Val Lys Ile Lys Leu Ile Asp Met Leu Ser 50 55
60Glu Ala Gly Leu Ser Val Ile Glu Thr Thr Ser Phe Val
Ser Pro Lys65 70 75
80Trp Val Pro Gln Met Gly Asp His Thr Glu Val Leu Lys Gly Ile Gln
85 90 95Lys Phe Pro Gly Ile Asn
Tyr Pro Val Leu Thr Pro Asn Leu Lys Gly 100
105 110Phe Glu Ala Ala Val Ala Ala Gly Ala Lys Glu Val
Val Ile Phe Gly 115 120 125Ala Ala
Ser Glu Leu Phe Thr Lys Lys Asn Ile Asn Cys Ser Ile Glu 130
135 140Glu Ser Phe Gln Arg Phe Asp Ala Ile Leu Lys
Ala Ala Gln Ser Ala145 150 155
160Asn Ile Ser Val Arg Gly Tyr Val Ser Cys Ala Leu Gly Cys Pro Tyr
165 170 175Glu Gly Lys Ile
Ser Pro Ala Lys Val Ala Glu Val Thr Lys Lys Phe 180
185 190Tyr Ser Met Gly Cys Tyr Glu Ile Ser Leu Gly
Asp Thr Ile Gly Val 195 200 205Gly
Thr Pro Gly Ile Met Lys Asp Met Leu Ser Ala Val Met Gln Glu 210
215 220Val Pro Leu Ala Ala Leu Ala Val His Cys
His Asp Thr Tyr Gly Gln225 230 235
240Ala Leu Thr Asn Thr Leu Met Ala Leu Gln Met Gly Val Ser Val
Val 245 250 255Asp Ser Ser
Val Ala Gly Leu Gly Gly Cys Pro Tyr Ala Gln Gly Ala 260
265 270Ser Gly Asn Leu Ala Thr Glu Asp Leu Val
Tyr Met Leu Glu Gly Leu 275 280
285Gly Ile His Thr Gly Val Asn Leu Gln Lys Leu Leu Glu Ala Gly Asn 290
295 300Phe Ile Cys Gln Ala Leu Asn Arg
Lys Thr Ser Ser Lys Val Ala Gln305 310
315 320Ala Thr Cys Lys Leu
32523299PRTPseudomonas putidaPseudomonas putida Q88H25 23Met Ser Leu Pro
Lys His Val Arg Leu Val Glu Val Gly Pro Arg Asp1 5
10 15Gly Leu Gln Asn Glu Ala Gln Pro Ile Ser
Val Ala Asp Lys Val Arg 20 25
30Leu Val Asn Asp Leu Thr Glu Ala Gly Leu Ala Tyr Ile Glu Val Gly
35 40 45Ser Phe Val Ser Pro Lys Trp Val
Pro Gln Met Ala Gly Ser Ala Glu 50 55
60Val Phe Ala Gly Ile Gln Gln Arg Pro Gly Val Thr Tyr Ala Ala Leu65
70 75 80Ala Pro Asn Leu Arg
Gly Phe Glu Asp Ala Leu Ala Ala Gly Val Lys 85
90 95Glu Val Ala Val Phe Ala Ala Ala Ser Glu Ala
Phe Ser Gln Arg Asn 100 105
110Ile Asn Cys Ser Ile Ser Glu Ser Leu Lys Arg Phe Glu Pro Ile Met
115 120 125Asp Ala Ala Arg Ser His Gly
Met Arg Val Arg Gly Tyr Val Ser Cys 130 135
140Val Leu Gly Cys Pro Tyr Glu Gly Lys Val Ser Ala Glu Gln Val
Ala145 150 155 160Pro Val
Ala Arg Ala Leu His Asp Met Gly Cys Tyr Glu Val Ser Leu
165 170 175Gly Asp Thr Ile Gly Thr Gly
Thr Ala Gly Asp Thr Arg Arg Leu Phe 180 185
190Glu Val Val Ser Ala Gln Val Pro Arg Glu Gln Leu Ala Gly
His Phe 195 200 205His Asp Thr Tyr
Gly Gln Ala Leu Ala Asn Val Tyr Ala Ser Leu Leu 210
215 220Glu Gly Ile Ser Val Phe Asp Ser Ser Val Ala Gly
Leu Gly Gly Cys225 230 235
240Pro Tyr Ala Lys Gly Ala Thr Gly Asn Ile Ala Ser Glu Asp Val Val
245 250 255Tyr Leu Leu Gln Gly
Leu Gly Ile Glu Thr Gly Ile Asp Leu Gly Leu 260
265 270Leu Ile Ala Ala Gly Gln Arg Ile Ser Gly Val Leu
Gly Arg Asp Asn 275 280 285Gly Ser
Arg Val Ala Arg Ala Cys Ser Ala Gln 290
29524312PRTAcinetobacter baumanniiAcinetobacter baumannii B7H4C6 24Met
Thr Ala Phe Ser Asp Leu Leu Val Val Gln Glu Val Ser Pro Arg1
5 10 15Asp Gly Leu Gln Ile Glu Pro
Thr Trp Val Pro Thr Asp Lys Lys Ile 20 25
30Asp Leu Ile Asn Gln Leu Ser Thr Met Gly Phe Ser Arg Ile
Glu Ala 35 40 45Gly Ser Phe Val
Ser Pro Lys Ala Ile Pro Asn Leu Arg Asp Gly Glu 50 55
60Glu Val Phe Thr Gly Ile Thr Arg His Lys Asp Ile Ile
Tyr Val Gly65 70 75
80Leu Ile Pro Asn Leu Lys Gly Ala Leu Arg Ala Val Glu Ala Asn Ala
85 90 95Asn Glu Leu Asn Leu Val
Leu Ser Ala Ser Gln Thr His Asn Leu Ala 100
105 110Asn Met Arg Met Thr Lys Ala Gln Ser Phe Ala Gly
Phe Thr Glu Ile 115 120 125Val Glu
Gln Leu Gln Gly Lys Thr Gln Phe Asn Gly Thr Val Ala Thr 130
135 140Thr Phe Gly Cys Pro Phe Glu Gly Lys Ile Ser
Glu Arg Glu Val Phe145 150 155
160Ser Leu Val Glu His Tyr Leu Lys Leu Gly Ile His Asn Ile Thr Leu
165 170 175Ala Asp Thr Thr
Gly Met Ala Asn Pro Val Gln Val Lys Arg Ile Val 180
185 190Ser His Val Leu Ser Leu Ile Ser Pro Glu Gln
Leu Thr Leu His Phe 195 200 205His
Asn Thr Arg Gly Leu Gly Leu Thr Asn Val Leu Ala Ala Tyr Glu 210
215 220Val Gly Ala Arg Arg Phe Asp Ala Ala Leu
Gly Gly Leu Gly Gly Cys225 230 235
240Pro Phe Ala Pro Gly Ala Ser Gly Asn Ile Cys Thr Glu Asp Leu
Val 245 250 255Asn Met Cys
Glu Glu Ile Gly Ile Pro Thr Thr Ile Asp Leu Asp Ala 260
265 270Leu Ile Gln Leu Ser Arg Thr Leu Pro Ala
Leu Leu Gly His Asp Thr 275 280
285Pro Ser Gln Leu Ala Lys Ala Gly Arg Asn Thr Asp Leu His Pro Ile 290
295 300Pro Asp Tyr Ile Lys Ser Leu Asn305
31025286PRTThermus thermophilusThermus thermophilus
Q72IH0 25Met Lys Ala Ser Val Arg Trp Val Glu Cys Pro Arg Asp Ala Trp Gln1
5 10 15Gly Phe Ser Arg
Phe Ile Pro Thr Glu Glu Lys Val Ala Phe Leu Asn 20
25 30Glu Leu Leu Glu Ala Gly Phe Ala His Leu Asp
Leu Thr Ser Phe Val 35 40 45Ser
Pro Lys Trp Val Pro Gln Met Gln Asp Ala Glu Glu Val Leu Lys 50
55 60Ala Leu Pro Pro Pro Asn Gly Arg Thr Tyr
Leu Ala Ile Val Ala Asn65 70 75
80Glu Lys Gly Leu Glu Arg Ala Leu Ala Ala Pro Asn Leu Thr His
Val 85 90 95Gly Tyr Pro
Phe Ser Leu Ser Glu Thr Phe Gln Gln Arg Asn Thr Asn 100
105 110Arg Ser Ile Glu Ala Ser Trp Pro Leu Val
Gly Ala Met Val Glu Arg 115 120
125Thr Glu Gly Arg Leu Gly Leu Val Val Tyr Leu Ser Met Ala Phe Gly 130
135 140Asn Pro Tyr Gly Asp Pro Trp Ser
Val Glu Ala Val Leu Glu Ala Leu145 150
155 160Ala Arg Leu Lys Glu Met Gly Val Arg Glu Ile Ala
Leu Ala Asp Thr 165 170
175Tyr Gly Val Ala Glu Pro Glu Arg Ile His Glu Val Leu Lys Ala Ala
180 185 190Val Ala Arg Phe Gly Pro
Glu Gly Leu Gly Ala His Leu His Ala Arg 195 200
205Pro Glu Gly Ala Leu Ala Lys Val Glu Ala Val Leu Ala Ala
Gly Val 210 215 220Thr Trp Leu Glu Gly
Ala Leu Ala Gly Val Gly Gly Cys Pro Phe Ala225 230
235 240Gly Asp Glu Leu Val Gly Asn Leu Pro Thr
Glu Val Val Leu Pro His 245 250
255Leu Glu Lys Arg Gly Leu Ala Thr Gly Val Asp Leu Ser Arg Leu Pro
260 265 270Leu Leu Ala Glu Glu
Ala Ala Arg Leu Lys Ala Leu Tyr Ala 275 280
28526301PRTClostridium acetobutylicumPhosphate
butyryltransferaseClostridium acetobutylicum ATCC 824 26Met Ile Lys Ser
Phe Asn Glu Ile Ile Met Lys Val Lys Ser Lys Glu1 5
10 15Met Lys Lys Val Ala Val Ala Val Ala Gln
Asp Glu Pro Val Leu Glu 20 25
30Ala Val Arg Asp Ala Lys Lys Asn Gly Ile Ala Asp Ala Ile Leu Val
35 40 45Gly Asp His Asp Glu Ile Val Ser
Ile Ala Leu Lys Ile Gly Met Asp 50 55
60Val Asn Asp Phe Glu Ile Val Asn Glu Pro Asn Val Lys Lys Ala Ala65
70 75 80Leu Lys Ala Val Glu
Leu Val Ser Thr Gly Lys Ala Asp Met Val Met 85
90 95Lys Gly Leu Val Asn Thr Ala Thr Phe Leu Arg
Ser Val Leu Asn Lys 100 105
110Glu Val Gly Leu Arg Thr Gly Lys Thr Met Ser His Val Ala Val Phe
115 120 125Glu Thr Glu Lys Phe Asp Arg
Leu Leu Phe Leu Thr Asp Val Ala Phe 130 135
140Asn Thr Tyr Pro Glu Leu Lys Glu Lys Ile Asp Ile Val Asn Asn
Ser145 150 155 160Val Lys
Val Ala His Ala Ile Gly Ile Glu Asn Pro Lys Val Ala Pro
165 170 175Ile Cys Ala Val Glu Val Ile
Asn Pro Lys Met Pro Ser Thr Leu Asp 180 185
190Ala Ala Met Leu Ser Lys Met Ser Asp Arg Gly Gln Ile Lys
Gly Cys 195 200 205Val Val Asp Gly
Pro Leu Ala Leu Asp Ile Ala Leu Ser Glu Glu Ala 210
215 220Ala His His Lys Gly Val Thr Gly Glu Val Ala Gly
Lys Ala Asp Ile225 230 235
240Phe Leu Met Pro Asn Ile Glu Thr Gly Asn Val Met Tyr Lys Thr Leu
245 250 255Thr Tyr Thr Thr Asp
Ser Lys Asn Gly Gly Ile Leu Val Gly Thr Ser 260
265 270Ala Pro Val Val Leu Thr Ser Arg Ala Asp Ser His
Glu Thr Lys Met 275 280 285Asn Ser
Ile Ala Leu Ala Ala Leu Val Ala Gly Asn Lys 290 295
30027329PRTCorynebacterium glutamicumPhosphate
acetyltransferaseCorynebacterium glutamicum ATCC 13032 27Met Ser Ala Glu
Leu Phe Glu Asn Trp Leu Leu Lys Arg Ala Arg Ala1 5
10 15Glu His Ser His Ile Val Leu Pro Glu Gly
Asp Asp Asp Arg Ile Leu 20 25
30Met Ala Ala His Gln Leu Leu Asp Gln Asp Ile Cys Asp Ile Thr Ile
35 40 45Leu Gly Asp Pro Val Lys Ile Lys
Glu Arg Ala Thr Glu Leu Gly Leu 50 55
60His Leu Asn Thr Ala Tyr Leu Val Asn Pro Leu Thr Asp Pro Arg Leu65
70 75 80Glu Glu Phe Ala Glu
Gln Phe Ala Glu Leu Arg Lys Ser Lys Ser Val 85
90 95Thr Ile Asp Glu Ala Arg Glu Ile Met Lys Asp
Ile Ser Tyr Phe Gly 100 105
110Thr Met Met Val His Asn Gly Asp Ala Asp Gly Met Val Ser Gly Ala
115 120 125Ala Asn Thr Thr Ala His Thr
Ile Lys Pro Ser Phe Gln Ile Ile Lys 130 135
140Thr Val Pro Glu Ala Ser Val Val Ser Ser Ile Phe Leu Met Val
Leu145 150 155 160Arg Gly
Arg Leu Trp Ala Phe Gly Asp Cys Ala Val Asn Pro Asn Pro
165 170 175Thr Ala Glu Gln Leu Gly Glu
Ile Ala Val Val Ser Ala Lys Thr Ala 180 185
190Ala Gln Phe Gly Ile Asp Pro Arg Val Ala Ile Leu Ser Tyr
Ser Thr 195 200 205Gly Asn Ser Gly
Gly Gly Ser Asp Val Asp Arg Ala Ile Asp Ala Leu 210
215 220Ala Glu Ala Arg Arg Leu Asn Pro Glu Leu Cys Val
Asp Gly Pro Leu225 230 235
240Gln Phe Asp Ala Ala Val Asp Pro Gly Val Ala Arg Lys Lys Met Pro
245 250 255Asp Ser Asp Val Ala
Gly Gln Ala Asn Val Phe Ile Phe Pro Asp Leu 260
265 270Glu Ala Gly Asn Ile Gly Tyr Lys Thr Ala Gln Arg
Thr Gly His Ala 275 280 285Leu Ala
Val Gly Pro Ile Leu Gln Gly Leu Asn Lys Pro Val Asn Asp 290
295 300Leu Ser Arg Gly Ala Thr Val Pro Asp Ile Val
Asn Thr Val Ala Ile305 310 315
320Thr Ala Ile Gln Ala Gly Gly Arg Ser
32528402PRTSalmonella entericaSalty propionate kinasesubsp. enterica
serovar Typhimurium str. LT2 28Met Asn Glu Phe Pro Val Val Leu Val Ile
Asn Cys Gly Ser Ser Ser1 5 10
15Ile Lys Phe Ser Val Leu Asp Val Ala Thr Cys Asp Val Leu Met Ala
20 25 30Gly Ile Ala Asp Gly Met
Asn Thr Glu Asn Ala Phe Leu Ser Ile Asn 35 40
45Gly Asp Lys Pro Ile Asn Leu Ala His Ser Asn Tyr Glu Asp
Ala Leu 50 55 60Lys Ala Ile Ala Phe
Glu Leu Glu Lys Arg Asp Leu Thr Asp Ser Val65 70
75 80Ala Leu Ile Gly His Arg Ile Ala His Gly
Gly Glu Leu Phe Thr Gln 85 90
95Ser Val Ile Ile Thr Asp Glu Ile Ile Asp Asn Ile Arg Arg Val Ser
100 105 110Pro Leu Ala Pro Leu
His Asn Tyr Ala Asn Leu Ser Gly Ile Asp Ala 115
120 125Ala Arg His Leu Phe Pro Ala Val Arg Gln Val Ala
Val Phe Asp Thr 130 135 140Ser Phe His
Gln Thr Leu Ala Pro Glu Ala Tyr Leu Tyr Gly Leu Pro145
150 155 160Trp Glu Tyr Phe Ser Ser Leu
Gly Val Arg Arg Tyr Gly Phe His Gly 165
170 175Thr Ser His Arg Tyr Val Ser Arg Arg Ala Tyr Glu
Leu Leu Asp Leu 180 185 190Asp
Glu Lys Asp Ser Gly Leu Ile Val Ala His Leu Gly Asn Gly Ala 195
200 205Ser Ile Cys Ala Val Arg Asn Gly Gln
Ser Val Asp Thr Ser Met Gly 210 215
220Met Thr Pro Leu Glu Gly Leu Met Met Gly Thr Arg Ser Gly Asp Val225
230 235 240Asp Phe Gly Ala
Met Ala Trp Ile Ala Lys Glu Thr Gly Gln Thr Leu 245
250 255Ser Asp Leu Glu Arg Val Val Asn Lys Glu
Ser Gly Leu Leu Gly Ile 260 265
270Ser Gly Leu Ser Ser Asp Leu Arg Val Leu Glu Lys Ala Trp His Glu
275 280 285Gly His Glu Arg Ala Arg Leu
Ala Ile Lys Thr Phe Val His Arg Ile 290 295
300Ala Arg His Ile Ala Gly His Ala Ala Ser Leu His Arg Leu Asp
Gly305 310 315 320Ile Ile
Phe Thr Gly Gly Ile Gly Glu Asn Ser Val Leu Ile Arg Gln
325 330 335Leu Val Ile Glu His Leu Gly
Val Leu Gly Leu Thr Leu Asp Val Glu 340 345
350Met Asn Lys Gln Pro Asn Ser His Gly Glu Arg Ile Ile Ser
Ala Asn 355 360 365Pro Ser Gln Val
Ile Cys Ala Val Ile Pro Thr Asn Glu Glu Lys Met 370
375 380Ile Ala Leu Asp Ala Ile His Leu Gly Asn Val Lys
Ala Pro Val Glu385 390 395
400Phe Ala29402PRTEscherichia coliPropionate kinaseEscherichia coli K-12
29Met Asn Glu Phe Pro Val Val Leu Val Ile Asn Cys Gly Ser Ser Ser1
5 10 15Ile Lys Phe Ser Val Leu
Asp Ala Ser Asp Cys Glu Val Leu Met Ser 20 25
30Gly Ile Ala Asp Gly Ile Asn Ser Glu Asn Ala Phe Leu
Ser Val Asn 35 40 45Gly Gly Glu
Pro Ala Pro Leu Ala His His Ser Tyr Glu Gly Ala Leu 50
55 60Lys Ala Ile Ala Phe Glu Leu Glu Lys Arg Asn Leu
Asn Asp Ser Val65 70 75
80Ala Leu Ile Gly His Arg Ile Ala His Gly Gly Ser Ile Phe Thr Glu
85 90 95Ser Ala Ile Ile Thr Asp
Glu Val Ile Asp Asn Ile Arg Arg Val Ser 100
105 110Pro Leu Ala Pro Leu His Asn Tyr Ala Asn Leu Ser
Gly Ile Glu Ser 115 120 125Ala Gln
Gln Leu Phe Pro Gly Val Thr Gln Val Ala Val Phe Asp Thr 130
135 140Ser Phe His Gln Thr Met Ala Pro Glu Ala Tyr
Leu Tyr Gly Leu Pro145 150 155
160Trp Lys Tyr Tyr Glu Glu Leu Gly Val Arg Arg Tyr Gly Phe His Gly
165 170 175Thr Ser His Arg
Tyr Val Ser Gln Arg Ala His Ser Leu Leu Asn Leu 180
185 190Ala Glu Asp Asp Ser Gly Leu Val Val Ala His
Leu Gly Asn Gly Ala 195 200 205Ser
Ile Cys Ala Val Arg Asn Gly Gln Ser Val Asp Thr Ser Met Gly 210
215 220Met Thr Pro Leu Glu Gly Leu Met Met Gly
Thr Arg Ser Gly Asp Val225 230 235
240Asp Phe Gly Ala Met Ser Trp Val Ala Ser Gln Thr Asn Gln Ser
Leu 245 250 255Gly Asp Leu
Glu Arg Val Val Asn Lys Glu Ser Gly Leu Leu Gly Ile 260
265 270Ser Gly Leu Ser Ser Asp Leu Arg Val Leu
Glu Lys Ala Trp His Glu 275 280
285Gly His Glu Arg Ala Gln Leu Ala Ile Lys Thr Phe Val His Arg Ile 290
295 300Ala Arg His Ile Ala Gly His Ala
Ala Ser Leu Arg Arg Leu Asp Gly305 310
315 320Ile Ile Phe Thr Gly Gly Ile Gly Glu Asn Ser Ser
Leu Ile Arg Arg 325 330
335Leu Val Met Glu His Leu Ala Val Leu Gly Leu Glu Ile Asp Thr Glu
340 345 350Met Asn Asn Arg Ser Asn
Ser Cys Gly Glu Arg Ile Val Ser Ser Glu 355 360
365Asn Ala Arg Val Ile Cys Ala Val Ile Pro Thr Asn Glu Glu
Lys Met 370 375 380Ile Ala Leu Asp Ala
Ile His Leu Gly Lys Val Asn Ala Pro Ala Glu385 390
395 400Phe Ala30154PRTHaemophilus
influenzaeAcyl-CoA thioesterase YciAHaemophilus influenzae R2866 30Met
Ser Ala Asn Phe Thr Asp Lys Asn Gly Arg Gln Ser Lys Gly Val1
5 10 15Leu Leu Leu Arg Thr Leu Ala
Met Pro Ser Asp Thr Asn Ala Asn Gly 20 25
30Asp Ile Phe Gly Gly Trp Ile Met Ser Gln Met Asp Met Gly
Gly Ala 35 40 45Ile Leu Ala Lys
Glu Ile Ala His Gly Arg Val Val Thr Val Ala Val 50 55
60Glu Ser Met Asn Phe Ile Lys Pro Ile Ser Val Gly Asp
Val Val Cys65 70 75
80Cys Tyr Gly Glu Cys Leu Lys Val Gly Arg Ser Ser Ile Lys Ile Lys
85 90 95Val Glu Val Trp Val Lys
Lys Val Ala Ser Glu Pro Ile Gly Glu Arg 100
105 110Tyr Cys Val Thr Asp Ala Val Phe Thr Phe Val Ala
Val Asp Asn Asn 115 120 125Gly Arg
Ser Arg Thr Ile Pro Arg Glu Asn Asn Gln Glu Leu Glu Lys 130
135 140Ala Leu Ala Leu Ile Ser Glu Gln Pro Leu145
15031140PRTHomo sapiensAcyl-coenzyme A thioesterase 31Met
Thr Ser Met Thr Gln Ser Leu Arg Glu Val Ile Lys Ala Met Thr1
5 10 15Lys Ala Arg Asn Phe Glu Arg
Val Leu Gly Lys Ile Thr Leu Val Ser 20 25
30Ala Ala Pro Gly Lys Val Ile Cys Glu Met Lys Val Glu Glu
Glu His 35 40 45Thr Asn Ala Ile
Gly Thr Leu His Gly Gly Leu Thr Ala Thr Leu Val 50 55
60Asp Asn Ile Ser Thr Met Ala Leu Leu Cys Thr Glu Arg
Gly Ala Pro65 70 75
80Gly Val Ser Val Asp Met Asn Ile Thr Tyr Met Ser Pro Ala Lys Leu
85 90 95Gly Glu Asp Ile Val Ile
Thr Ala His Val Leu Lys Gln Gly Lys Thr 100
105 110Leu Ala Phe Thr Ser Val Asp Leu Thr Asn Lys Ala
Thr Gly Lys Leu 115 120 125Ile Ala
Gln Gly Arg His Thr Lys His Leu Gly Asn 130 135
14032132PRTEscherichia coliEscherichia coli K-12 32Met Ser Thr
Thr His Asn Val Pro Gln Gly Asp Leu Val Leu Arg Thr1 5
10 15Leu Ala Met Pro Ala Asp Thr Asn Ala
Asn Gly Asp Ile Phe Gly Gly 20 25
30Trp Leu Met Ser Gln Met Asp Ile Gly Gly Ala Ile Leu Ala Lys Glu
35 40 45Ile Ala His Gly Arg Val Val
Thr Val Arg Val Glu Gly Met Thr Phe 50 55
60Leu Arg Pro Val Ala Val Gly Asp Val Val Cys Cys Tyr Ala Arg Cys65
70 75 80Val Gln Lys Gly
Thr Thr Ser Val Ser Ile Asn Ile Glu Val Trp Val 85
90 95Lys Lys Val Ala Ser Glu Pro Ile Gly Gln
Arg Tyr Lys Ala Thr Glu 100 105
110Ala Leu Phe Lys Tyr Val Ala Val Asp Pro Glu Gly Lys Pro Arg Ala
115 120 125Leu Pro Val Glu
13033286PRTEscherichia coliEscherichia coli K-12 33Met Ser Gln Ala Leu
Lys Asn Leu Leu Thr Leu Leu Asn Leu Glu Lys1 5
10 15Ile Glu Glu Gly Leu Phe Arg Gly Gln Ser Glu
Asp Leu Gly Leu Arg 20 25
30Gln Val Phe Gly Gly Gln Val Val Gly Gln Ala Leu Tyr Ala Ala Lys
35 40 45Glu Thr Val Pro Glu Glu Arg Leu
Val His Ser Phe His Ser Tyr Phe 50 55
60Leu Arg Pro Gly Asp Ser Lys Lys Pro Ile Ile Tyr Asp Val Glu Thr65
70 75 80Leu Arg Asp Gly Asn
Ser Phe Ser Ala Arg Arg Val Ala Ala Ile Gln 85
90 95Asn Gly Lys Pro Ile Phe Tyr Met Thr Ala Ser
Phe Gln Ala Pro Glu 100 105
110Ala Gly Phe Glu His Gln Lys Thr Met Pro Ser Ala Pro Ala Pro Asp
115 120 125Gly Leu Pro Ser Glu Thr Gln
Ile Ala Gln Ser Leu Ala His Leu Leu 130 135
140Pro Pro Val Leu Lys Asp Lys Phe Ile Cys Asp Arg Pro Leu Glu
Val145 150 155 160Arg Pro
Val Glu Phe His Asn Pro Leu Lys Gly His Val Ala Glu Pro
165 170 175His Arg Gln Val Trp Ile Arg
Ala Asn Gly Ser Val Pro Asp Asp Leu 180 185
190Arg Val His Gln Tyr Leu Leu Gly Tyr Ala Ser Asp Leu Asn
Phe Leu 195 200 205Pro Val Ala Leu
Gln Pro His Gly Ile Gly Phe Leu Glu Pro Gly Ile 210
215 220Gln Ile Ala Thr Ile Asp His Ser Met Trp Phe His
Arg Pro Phe Asn225 230 235
240Leu Asn Glu Trp Leu Leu Tyr Ser Val Glu Ser Thr Ser Ala Ser Ser
245 250 255Ala Arg Gly Phe Val
Arg Gly Glu Phe Tyr Thr Gln Asp Gly Val Leu 260
265 270Val Ala Ser Thr Val Gln Glu Gly Val Met Arg Asn
His Asn 275 280
28534289PRTPseudomonas putida 34Met Ser His Val Leu Asp Asp Leu Val Asp
Leu Leu Ser Leu Glu Ser1 5 10
15Ile Glu Glu Asn Leu Phe Arg Gly Arg Ser Gln Asp Leu Gly Phe Arg
20 25 30Gln Leu Tyr Gly Gly Gln
Val Leu Gly Gln Ser Leu Ser Ala Ala Ser 35 40
45Gln Thr Val Glu Asp Ala Arg His Val His Ser Leu His Gly
Tyr Phe 50 55 60Leu Arg Pro Gly Asp
Ala Ser Leu Pro Val Val Tyr Ser Val Asp Arg65 70
75 80Val Arg Asp Gly Gly Ser Phe Ser Thr Arg
Arg Val Thr Ala Ile Gln 85 90
95Lys Gly Gln Thr Ile Phe Thr Cys Ser Ala Ser Phe Gln Tyr Asp Glu
100 105 110Glu Gly Phe Glu His
Gln Ala Gln Met Pro Asp Val Val Gly Pro Glu 115
120 125Asn Leu Pro Thr Glu Val Glu Leu Ala His Ala Met
Ala Asp Gln Leu 130 135 140Pro Glu Arg
Ile Arg Asp Lys Val Leu Cys Ala Lys Pro Ile Glu Ile145
150 155 160Arg Pro Val Thr Glu Arg Asp
Pro Phe Asn Pro Lys Pro Gly Asp Pro 165
170 175Val Lys Tyr Ala Trp Phe Arg Ala Asp Gly Asn Leu
Pro Asp Val Pro 180 185 190Ala
Leu His Lys Tyr Met Leu Ala Tyr Ala Ser Asp Phe Gly Leu Leu 195
200 205Thr Thr Ala Leu Leu Pro His Gly Lys
Ser Val Trp Gln Arg Asp Met 210 215
220Gln Ile Ala Ser Leu Asp His Ser Leu Trp Phe His Gly Asn Leu Arg225
230 235 240Ala Asp Gln Trp
Leu Leu Tyr Ala Thr Asp Ser Pro Trp Ala Gly Asn 245
250 255Ser Arg Gly Phe Cys Arg Gly Ser Ile Phe
Asn Gln Ala Gly Gln Leu 260 265
270Val Ala Ser Ser Ser Gln Glu Gly Leu Ile Arg His Arg Lys Asp Trp
275 280 285Ala35258PRTUnknownMyxococcus
species 35Met Pro Glu Phe Lys Val Asp Ala Arg Gly Pro Ile Glu Ile Trp
Thr1 5 10 15Ile Asp Gly
Glu Ser Arg Arg Asn Ala Ile Ser Arg Ala Met Leu Gln 20
25 30Glu Leu Gly Glu Met Val Thr Arg Val Ser
Ser Ser Arg Glu Val Arg 35 40
45Ala Val Val Ile Thr Gly Ala Gly Asp Lys Ala Phe Cys Ala Gly Ala 50
55 60Asp Leu Lys Glu Arg Ala Thr Met Ala
Glu Asp Glu Val Arg Ala Phe65 70 75
80Leu Asp Gly Leu Arg Arg Thr Phe Arg Ala Leu Glu Lys Ser
Asp Cys 85 90 95Val Phe
Ile Ala Ala Ile Asn Gly Ala Ala Phe Gly Gly Gly Thr Glu 100
105 110Leu Ala Leu Ala Cys Asp Leu Arg Val
Ala Ala Pro Ala Ala Glu Leu 115 120
125Gly Leu Thr Glu Val Lys Leu Gly Ile Ile Pro Gly Gly Gly Gly Thr
130 135 140Gln Arg Leu Thr Arg Leu Val
Gly Pro Gly Arg Ala Lys Asp Leu Ile145 150
155 160Leu Thr Ala Arg Arg Ile Asn Ala Ala Glu Ala Phe
Ser Val Gly Leu 165 170
175Val Asn Arg Leu Ala Pro Glu Gly His Leu Leu Ala Val Ala Tyr Gly
180 185 190Leu Ala Glu Ser Val Val
Glu Asn Ala Pro Ile Ala Val Ala Thr Ala 195 200
205Lys His Ala Ile Asp Glu Gly Thr Gly Leu Glu Leu Asp Asp
Ala Leu 210 215 220Ala Leu Glu Leu Arg
Lys Tyr Glu Glu Ile Leu Lys Thr Glu Asp Arg225 230
235 240Leu Glu Gly Leu Arg Ala Phe Ala Glu Lys
Arg Ala Pro Val Tyr Lys 245 250
255Gly Arg36447PRTSchizosaccharomyces pombeSchizosaccharomyces pombe
(strain 972 / ATCC 24843) 36Met Ser Phe Asp Arg Lys Asp Ile Gly Ile
Lys Gly Leu Val Leu Tyr1 5 10
15Thr Pro Asn Gln Tyr Val Glu Gln Ala Ala Leu Glu Ala His Asp Gly
20 25 30Val Ser Thr Gly Lys Tyr
Thr Ile Gly Leu Gly Leu Thr Lys Met Ala 35 40
45Phe Val Asp Asp Arg Glu Asp Ile Tyr Ser Phe Gly Leu Thr
Ala Leu 50 55 60Ser Gln Leu Ile Lys
Arg Tyr Gln Ile Asp Ile Ser Lys Ile Gly Arg65 70
75 80Leu Glu Val Gly Thr Glu Thr Ile Ile Asp
Lys Ser Lys Ser Val Lys 85 90
95Ser Val Leu Met Gln Leu Phe Gly Asp Asn His Asn Val Glu Gly Ile
100 105 110Asp Cys Val Asn Ala
Cys Tyr Gly Gly Val Asn Ala Leu Phe Asn Thr 115
120 125Ile Asp Trp Ile Glu Ser Ser Ala Trp Asp Gly Arg
Asp Gly Ile Val 130 135 140Val Ala Gly
Asp Ile Ala Leu Tyr Ala Lys Gly Asn Ala Arg Pro Thr145
150 155 160Gly Gly Ala Gly Cys Val Ala
Leu Leu Val Gly Pro Asn Ala Pro Ile 165
170 175Val Phe Glu Pro Gly Leu Arg Gly Thr Tyr Met Gln
His Ala Tyr Asp 180 185 190Phe
Tyr Lys Pro Asp Leu Thr Ser Glu Tyr Pro Tyr Val Asp Gly His 195
200 205Phe Ser Leu Glu Cys Tyr Val Lys Ala
Leu Asp Gly Ala Tyr Ala Asn 210 215
220Tyr Asn Val Arg Asp Val Ala Lys Asn Gly Lys Ser Gln Gly Leu Gly225
230 235 240Leu Asp Arg Phe
Asp Tyr Cys Ile Phe His Ala Pro Thr Cys Lys Gln 245
250 255Val Gln Lys Ala Tyr Ala Arg Leu Leu Tyr
Thr Asp Ser Ala Ala Glu 260 265
270Pro Ser Asn Pro Glu Leu Glu Gly Val Arg Glu Leu Leu Ser Thr Leu
275 280 285Asp Ala Lys Lys Ser Leu Thr
Asp Lys Ala Leu Glu Lys Gly Leu Met 290 295
300Ala Ile Thr Lys Glu Arg Phe Asn Lys Arg Val Ser Pro Ser Val
Tyr305 310 315 320Ala Pro
Thr Asn Cys Gly Asn Met Tyr Thr Ala Ser Ile Phe Ser Cys
325 330 335Leu Thr Ala Leu Leu Ser Arg
Val Pro Ala Asp Glu Leu Lys Gly Lys 340 345
350Arg Val Gly Ala Tyr Ser Tyr Gly Ser Gly Leu Ala Ala Ser
Phe Phe 355 360 365Ser Phe Val Val
Lys Gly Asp Val Ser Glu Ile Ala Lys Lys Thr Asn 370
375 380Leu Val Asn Asp Leu Asp Asn Arg His Cys Leu Thr
Pro Thr Gln Tyr385 390 395
400Glu Glu Ala Ile Glu Leu Arg His Gln Ala His Leu Lys Lys Asn Phe
405 410 415Thr Pro Lys Gly Ser
Ile Glu Arg Leu Arg Ser Gly Thr Tyr Tyr Leu 420
425 430Thr Gly Ile Asp Asp Met Phe Arg Arg Ser Tyr Ser
Val Lys Pro 435 440
44537392PRTClostridium acetobutylicumClostridium acetobutylicum ATCC 824
37Met Lys Glu Val Val Ile Ala Ser Ala Val Arg Thr Ala Ile Gly Ser1
5 10 15Tyr Gly Lys Ser Leu Lys
Asp Val Pro Ala Val Asp Leu Gly Ala Thr 20 25
30Ala Ile Lys Glu Ala Val Lys Lys Ala Gly Ile Lys Pro
Glu Asp Val 35 40 45Asn Glu Val
Ile Leu Gly Asn Val Leu Gln Ala Gly Leu Gly Gln Asn 50
55 60Pro Ala Arg Gln Ala Ser Phe Lys Ala Gly Leu Pro
Val Glu Ile Pro65 70 75
80Ala Met Thr Ile Asn Lys Val Cys Gly Ser Gly Leu Arg Thr Val Ser
85 90 95Leu Ala Ala Gln Ile Ile
Lys Ala Gly Asp Ala Asp Val Ile Ile Ala 100
105 110Gly Gly Met Glu Asn Met Ser Arg Ala Pro Tyr Leu
Ala Asn Asn Ala 115 120 125Arg Trp
Gly Tyr Arg Met Gly Asn Ala Lys Phe Val Asp Glu Met Ile 130
135 140Thr Asp Gly Leu Trp Asp Ala Phe Asn Asp Tyr
His Met Gly Ile Thr145 150 155
160Ala Glu Asn Ile Ala Glu Arg Trp Asn Ile Ser Arg Glu Glu Gln Asp
165 170 175Glu Phe Ala Leu
Ala Ser Gln Lys Lys Ala Glu Glu Ala Ile Lys Ser 180
185 190Gly Gln Phe Lys Asp Glu Ile Val Pro Val Val
Ile Lys Gly Arg Lys 195 200 205Gly
Glu Thr Val Val Asp Thr Asp Glu His Pro Arg Phe Gly Ser Thr 210
215 220Ile Glu Gly Leu Ala Lys Leu Lys Pro Ala
Phe Lys Lys Asp Gly Thr225 230 235
240Val Thr Ala Gly Asn Ala Ser Gly Leu Asn Asp Cys Ala Ala Val
Leu 245 250 255Val Ile Met
Ser Ala Glu Lys Ala Lys Glu Leu Gly Val Lys Pro Leu 260
265 270Ala Lys Ile Val Ser Tyr Gly Ser Ala Gly
Val Asp Pro Ala Ile Met 275 280
285Gly Tyr Gly Pro Phe Tyr Ala Thr Lys Ala Ala Ile Glu Lys Ala Gly 290
295 300Trp Thr Val Asp Glu Leu Asp Leu
Ile Glu Ser Asn Glu Ala Phe Ala305 310
315 320Ala Gln Ser Leu Ala Val Ala Lys Asp Leu Lys Phe
Asp Met Asn Lys 325 330
335Val Asn Val Asn Gly Gly Ala Ile Ala Leu Gly His Pro Ile Gly Ala
340 345 350Ser Gly Ala Arg Ile Leu
Val Thr Leu Val His Ala Met Gln Lys Arg 355 360
365Asp Ala Lys Lys Gly Leu Ala Thr Leu Cys Ile Gly Gly Gly
Gln Gly 370 375 380Thr Ala Ile Leu Leu
Glu Lys Cys385 39038258PRTBacillus subtilissubsp.
subtilis str. RO-NN-1 38Met Asn Ala Ile Ser Leu Ala Val Asp Gln Phe Val
Ala Val Leu Thr1 5 10
15Ile His Asn Pro Pro Ala Asn Ala Leu Ser Ser Arg Ile Leu Glu Glu
20 25 30Leu Ser Ser Cys Leu Asp Gln
Cys Glu Thr Asp Ala Gly Val Arg Ser 35 40
45Ile Ile Ile His Gly Glu Gly Arg Phe Phe Ser Ala Gly Ala Asp
Ile 50 55 60Lys Glu Phe Thr Ser Leu
Lys Gly Asn Glu Asp Phe Ser Leu Leu Ala65 70
75 80Glu Arg Gly Gln Gln Leu Met Glu Arg Ile Glu
Ser Phe Pro Lys Pro 85 90
95Ile Ile Ala Ala Ile His Gly Ala Ala Leu Gly Gly Gly Leu Glu Leu
100 105 110Ala Met Ala Cys His Ile
Arg Ile Ala Ala Asp Asp Ala Lys Leu Gly 115 120
125Leu Pro Glu Leu Asn Leu Gly Ile Ile Pro Gly Phe Ala Gly
Thr Gln 130 135 140Arg Leu Pro Arg Tyr
Val Gly Thr Ala Lys Ala Leu Glu Leu Ile Gly145 150
155 160Ser Gly Glu Pro Ile Ser Gly Lys Glu Ala
Leu Asp Leu Gly Leu Val 165 170
175Ser Ile Gly Ala Lys Asp Glu Ala Glu Val Ile Glu Lys Ala Lys Ala
180 185 190Leu Ala Ala Lys Phe
Ala Glu Lys Ser Pro Gln Thr Leu Ala Ser Leu 195
200 205Leu Glu Leu Leu Tyr Ser Asn Lys Val Tyr Ser Tyr
Glu Gly Ser Leu 210 215 220Lys Leu Glu
Ala Lys Arg Phe Gly Glu Ala Phe Glu Ser Glu Asp Ala225
230 235 240Lys Glu Gly Ile Gln Ala Phe
Leu Glu Lys Arg Lys Pro Gln Phe Lys 245
250 255Gly Glu39263PRTBacillus anthracis 39Met Lys Asn
Glu Arg Leu Val Ile Cys Ser Lys Lys Gly Ser Ser Ala1 5
10 15Val Ile Thr Ile Gln Asn Pro Pro Val
Asn Ala Leu Ser Leu Glu Val 20 25
30Val Gln Gln Leu Ile Asn Val Leu Glu Glu Ile Glu Met Asp Asp Asp
35 40 45Ile Ala Val Val Ile Ile Thr
Gly Ile Gly Gly Lys Ala Phe Val Ala 50 55
60Gly Gly Asp Ile Lys Glu Phe Pro Gly Trp Ile Gly Lys Gly Glu Lys65
70 75 80Tyr Ala Glu Met
Lys Ser Ile Glu Leu Gln Arg Pro Leu Asn Gln Leu 85
90 95Glu Asn Leu Ser Lys Pro Thr Ile Ala Ala
Ile Asn Gly Leu Ala Leu 100 105
110Gly Gly Gly Cys Glu Leu Ala Leu Ala Cys Asp Leu Arg Val Ile Glu
115 120 125Glu Gln Ala Leu Ile Gly Leu
Pro Glu Ile Thr Leu Gly Leu Phe Pro 130 135
140Gly Ala Gly Gly Thr Gln Arg Leu Pro Arg Leu Ile Gly Glu Gly
Lys145 150 155 160Ala Lys
Glu Met Met Phe Thr Gly Lys Pro Ile Thr Ala Lys Glu Ala
165 170 175Lys Glu Ile Asn Leu Val Asn
Tyr Ile Thr Ser Arg Gly Glu Ala Leu 180 185
190Asn Lys Ala Lys Glu Ile Ala Lys Asp Ile Ser Glu Phe Ser
Leu Pro 195 200 205Ala Leu Ser Tyr
Met Lys Leu Ala Ile Arg Glu Gly Leu Ala Val Pro 210
215 220Leu Gln Glu Gly Leu Gln Ile Glu Ala Arg Tyr Phe
Gly Lys Val Phe225 230 235
240Gln Thr Glu Asp Val Lys Glu Gly Val Lys Ala Phe Ile Glu Lys Arg
245 250 255Val Pro Arg Phe Thr
Asn Lys 26040229PRTCandida albicansCandida albicans (strain
SC5314 / ATCC MYA- 2876) 40Met Ile Ala Arg Val Cys Leu Arg Arg Ser
Asn Val Leu Pro Ile Phe1 5 10
15Gln Ile Pro Ser Arg Lys Tyr Ser Ile Asn Tyr Glu Lys Val Asn Asn
20 25 30Ser Ile Tyr Asn Asn Val
Ile Lys Pro Lys Arg Ile Val Leu Ala Ile 35 40
45Thr Gly Ala Thr Gly Thr Gln Ile Gly Val Arg Leu Leu Glu
Ile Leu 50 55 60Lys Glu Leu Gly Val
Glu Thr His Leu Val Met Ser Lys Trp Gly Ile65 70
75 80Ala Thr Leu Lys Tyr Glu Thr Asp Tyr Gln
Val Asp Tyr Val Thr Ser 85 90
95Leu Ala Thr Lys Thr Tyr Ser Ala Arg Asp Val Thr Ala Pro Ile Ser
100 105 110Ser Gly Ser Phe Val
His Asp Gly Met Ile Val Ala Pro Cys Ser Met 115
120 125Lys Ser Leu Ser Ala Ile Arg Thr Gly Phe Thr Glu
Asp Leu Ile Val 130 135 140Arg Ala Ala
Asp Val Ser Leu Lys Glu Arg Arg Lys Leu Leu Leu Val145
150 155 160Ala Arg Glu Thr Pro Leu Ser
Asp Ile His Leu Asp Asn Met Leu Tyr 165
170 175Leu Ser Arg Met Gly Val Thr Ile Phe Pro Pro Val
Pro Ala Phe Tyr 180 185 190Thr
Lys Pro Lys Thr Ile Asp Asp Ile Val Glu Gln Thr Cys Gly Arg 195
200 205Ile Leu Asp Asn Phe Gly Ile Asn Ile
Asp Thr Phe Glu Arg Trp Asp 210 215
220Gly Ile Asn His Arg22541227PRTAspergillus niger 41Met Phe Asn Ser Leu
Leu Ser Gly Thr Thr Thr Pro Asn Ser Gly Arg1 5
10 15Ala Ser Pro Pro Ala Ser Glu Met Pro Ile Asp
Asn Asp His Val Ala 20 25
30Val Ala Arg Pro Ala Pro Arg Arg Arg Arg Ile Val Val Ala Met Thr
35 40 45Gly Ala Thr Gly Ala Met Leu Gly
Ile Lys Val Leu Ile Ala Leu Arg 50 55
60Arg Leu Asn Val Glu Thr His Leu Val Met Ser Lys Trp Ala Glu Ala65
70 75 80Thr Ile Lys Tyr Glu
Thr Asp Tyr His Pro Ser Asn Val Arg Ala Leu 85
90 95Ala Asp Tyr Val His Asn Ile Asn Asp Met Ala
Ala Pro Val Ser Ser 100 105
110Gly Ser Phe Arg Ala Asp Gly Met Ile Val Val Pro Cys Ser Met Lys
115 120 125Thr Leu Ala Ala Ile His Ser
Gly Phe Cys Asp Asp Leu Ile Ser Arg 130 135
140Thr Ala Asp Val Met Leu Lys Glu Arg Arg Arg Leu Val Leu Val
Ala145 150 155 160Arg Glu
Thr Pro Leu Ser Glu Ile His Leu Arg Asn Met Leu Glu Val
165 170 175Thr Arg Ala Gly Ala Val Ile
Phe Pro Pro Val Pro Ala Phe Tyr Ile 180 185
190Lys Ala Gly Ser Ile Glu Asp Leu Ile Asp Gln Ser Val Gly
Arg Met 195 200 205Leu Asp Leu Phe
Asp Leu Asp Thr Gly Asp Phe Glu Arg Trp Asn Gly 210
215 220Trp Glu Lys22542242PRTSaccharomyces
cerevisiaeSaccharomyces cerevisiae S288c 42Met Leu Leu Phe Pro Arg Arg
Thr Asn Ile Ala Phe Phe Lys Thr Thr1 5 10
15Gly Ile Phe Ala Asn Phe Pro Leu Leu Gly Arg Thr Ile
Thr Thr Ser 20 25 30Pro Ser
Phe Leu Thr His Lys Leu Ser Lys Glu Val Thr Arg Ala Ser 35
40 45Thr Ser Pro Pro Arg Pro Lys Arg Ile Val
Val Ala Ile Thr Gly Ala 50 55 60Thr
Gly Val Ala Leu Gly Ile Arg Leu Leu Gln Val Leu Lys Glu Leu65
70 75 80Ser Val Glu Thr His Leu
Val Ile Ser Lys Trp Gly Ala Ala Thr Met 85
90 95Lys Tyr Glu Thr Asp Trp Glu Pro His Asp Val Ala
Ala Leu Ala Thr 100 105 110Lys
Thr Tyr Ser Val Arg Asp Val Ser Ala Cys Ile Ser Ser Gly Ser 115
120 125Phe Gln His Asp Gly Met Ile Val Val
Pro Cys Ser Met Lys Ser Leu 130 135
140Ala Ala Ile Arg Ile Gly Phe Thr Glu Asp Leu Ile Thr Arg Ala Ala145
150 155 160Asp Val Ser Ile
Lys Glu Asn Arg Lys Leu Leu Leu Val Thr Arg Glu 165
170 175Thr Pro Leu Ser Ser Ile His Leu Glu Asn
Met Leu Ser Leu Cys Arg 180 185
190Ala Gly Val Ile Ile Phe Pro Pro Val Pro Ala Phe Tyr Thr Arg Pro
195 200 205Lys Ser Leu His Asp Leu Leu
Glu Gln Ser Val Gly Arg Ile Leu Asp 210 215
220Cys Phe Gly Ile His Ala Asp Thr Phe Pro Arg Trp Glu Gly Ile
Lys225 230 235 240Ser
Lys43180PRTCryptococcus gattiiserotype BCryptococcus gattii WM276 43Met
Arg Arg Lys Arg Tyr Val Val Ala Val Thr Gly Ala Thr Gly Ala1
5 10 15Thr Leu Ala Ile Arg Leu Leu
Gln Ala Leu Arg Ala Leu Asp Ile Glu 20 25
30Thr His Leu Ile Ile Ser Lys Trp Ala Val Lys Thr Leu Lys
Tyr Glu 35 40 45Thr Asp Met Ile
Glu Arg Glu Leu Lys Asp Leu Ala Asp Tyr Ser Tyr 50 55
60Ser Asn Ser Asp Leu Ala Ala Pro Pro Ser Ser Gly Ser
Phe Ile His65 70 75
80Asp Gly Met Phe Ile Ile Pro Cys Ser Met Lys Thr Leu Ala Ala Val
85 90 95Arg Ile Gly Leu Gly Asp
Glu Leu Ile Ser Arg Ser Ala Asp Val Cys 100
105 110Leu Lys Glu Gly Arg Lys Leu Met Leu Val Val Arg
Glu Thr Pro Leu 115 120 125Asn Asp
Ile His Leu Glu Asn Met Leu Phe Leu Arg Arg Ala Gly Ala 130
135 140Ile Ile Phe Pro Pro Val Pro Ala Tyr Tyr Ile
Arg Pro Gln Thr Ile145 150 155
160Asp Asp Leu Thr Asn Gln Thr Val Gly Arg Ile Leu Asp Ser Ser Lys
165 170 175Cys Ser Gln Lys
18044189PRTEscherichia coliEscherichia coli K-12 44Met Lys Arg
Leu Ile Val Gly Ile Ser Gly Ala Ser Gly Ala Ile Tyr1 5
10 15Gly Val Arg Leu Leu Gln Val Leu Arg
Asp Val Thr Asp Ile Glu Thr 20 25
30His Leu Val Met Ser Gln Ala Ala Arg Gln Thr Leu Ser Leu Glu Thr
35 40 45Asp Phe Ser Leu Arg Glu Val
Gln Ala Leu Ala Asp Val Thr His Asp 50 55
60Ala Arg Asp Ile Ala Ala Ser Ile Ser Ser Gly Ser Phe Gln Thr Leu65
70 75 80Gly Met Val Ile
Leu Pro Cys Ser Ile Lys Thr Leu Ser Gly Ile Val 85
90 95His Ser Tyr Thr Asp Gly Leu Leu Thr Arg
Ala Ala Asp Val Val Leu 100 105
110Lys Glu Arg Arg Pro Leu Val Leu Cys Val Arg Glu Thr Pro Leu His
115 120 125Leu Gly His Leu Arg Leu Met
Thr Gln Ala Ala Glu Ile Gly Ala Val 130 135
140Ile Met Pro Pro Val Pro Ala Phe Tyr His Arg Pro Gln Ser Leu
Asp145 150 155 160Asp Val
Ile Asn Gln Thr Val Asn Arg Val Leu Asp Gln Phe Ala Ile
165 170 175Thr Leu Pro Glu Asp Leu Phe
Ala Arg Trp Gln Gly Ala 180
18545192PRTBacillus subtilis 45Met Lys Leu Val Ile Gly Met Thr Gly Ala
Thr Gly Ala Ile Phe Gly1 5 10
15Ile Arg Leu Leu Glu Tyr Leu Lys Ala Ala Glu Ile Glu Thr His Leu
20 25 30Val Val Ser Pro Trp Ala
Asn Val Thr Ile Thr His Glu Thr Asp Tyr 35 40
45Thr Leu Lys Asp Val Glu Lys Leu Ala Ser Tyr Thr Tyr Ser
His Lys 50 55 60Asp Gln Ala Ala Ala
Ile Ser Ser Gly Ser Phe Glu Thr Asp Gly Met65 70
75 80Ile Ile Ala Pro Cys Ser Met Lys Ser Leu
Ala Ser Ile Arg Thr Gly 85 90
95Met Ala Asp Asn Leu Leu Thr Arg Ala Ala Asp Val Ile Leu Lys Glu
100 105 110Arg Lys Lys Leu Val
Leu Leu Thr Arg Glu Thr Pro Leu Ser Gln Ile 115
120 125His Leu Glu Asn Met Leu Ala Leu Thr Lys Met Gly
Ser Val Ile Leu 130 135 140Pro Pro Met
Pro Ala Phe Tyr Asn Lys Pro Ala Asp Met Asp Glu Leu145
150 155 160Ile Asp His Ile Val Phe Arg
Thr Leu Asp Gln Phe Gly Ile Arg Leu 165
170 175Pro Glu Ala Lys Arg Trp Tyr Gly Ile Glu Lys Gln
Lys Gly Gly Ile 180 185
19046209PRTPseudomonas aeruginosa 46Met Ser Gly Pro Glu Arg Ile Thr Leu
Ala Met Thr Gly Ala Ser Gly1 5 10
15Ala Gln Tyr Gly Leu Arg Leu Leu Asp Cys Leu Val Gln Glu Glu
Arg 20 25 30Glu Val His Phe
Leu Ile Ser Lys Ala Ala Gln Leu Val Met Ala Thr 35
40 45Glu Thr Asp Val Ala Leu Pro Ala Lys Pro Gln Ala
Met Gln Ala Phe 50 55 60Leu Thr Glu
Tyr Cys Gly Ala Ala Ala Gly Gln Ile Arg Val Phe Gly65 70
75 80Gln Asn Asp Trp Met Ala Pro Pro
Ala Ser Gly Ser Ser Ala Pro Asn 85 90
95Ala Met Val Ile Cys Pro Cys Ser Thr Gly Thr Leu Ser Ala
Val Ala 100 105 110Thr Gly Ala
Cys Asn Asn Leu Ile Glu Arg Ala Ala Asp Val Ala Leu 115
120 125Lys Glu Arg Arg Pro Leu Val Leu Val Pro Arg
Glu Ala Pro Phe Ser 130 135 140Ser Ile
His Leu Glu Asn Met Leu Lys Leu Ser Asn Leu Gly Ala Val145
150 155 160Ile Leu Pro Ala Ala Pro Gly
Phe Tyr His Gln Pro Gln Ser Val Glu 165
170 175Asp Leu Val Asp Phe Val Val Ala Arg Ile Leu Asn
Thr Leu Gly Ile 180 185 190Pro
Gln Asp Met Leu Pro Arg Trp Gly Glu Gln His Leu Val Ser Asp 195
200 205Glu47219PRTUnknownEnterobacter
species DC4 47Met Leu Arg Gln Val Arg Ala Asn Ala Leu Thr Cys Asn Ser Pro
Gln1 5 10 15Asn Pro Ala
Gln Ser Ala Leu Lys Ser Val Arg Ala Lys Ile Met Lys 20
25 30Arg Leu Ile Val Gly Leu Ser Gly Ala Ser
Gly Ala Ile Tyr Gly Val 35 40
45Arg Leu Leu Gln Val Leu Arg Asn Val Ala Glu Val Glu Thr His Leu 50
55 60Val Met Ser Gln Ala Ala Arg Gln Thr
Leu Ser Leu Glu Thr Asp Leu65 70 75
80Ser Leu Arg Asp Val Gln Ala Leu Ala Asp Val Val His Asp
Ala Arg 85 90 95Asp Ile
Ala Ala Ser Ile Ser Ser Gly Ser Phe Lys Thr Ala Gly Met 100
105 110Val Ile Leu Pro Cys Ser Ile Lys Thr
Leu Ser Gly Ile Val Asn Ser 115 120
125Tyr Thr Asp Thr Leu Val Thr Arg Ala Ala Asp Val Val Leu Lys Glu
130 135 140Arg Arg Pro Leu Val Leu Cys
Val Arg Glu Thr Pro Leu His Leu Gly145 150
155 160His Leu Arg Leu Met Thr Gln Ala Ala Glu Leu Gly
Ala Ile Ile Met 165 170
175Pro Pro Val Pro Ala Phe Tyr His Arg Pro Thr Ser Leu Asp Asp Val
180 185 190Ile Asn Gln Thr Val Asn
Arg Val Leu Asp Gln Phe Asp Ile Asp Leu 195 200
205Pro Glu Asp Leu Phe Thr Arg Trp Gln Gly Ala 210
21548503PRTSaccharomyces cerevisiaeSaccharomyces cerevisiae
S288c 48Met Arg Lys Leu Asn Pro Ala Leu Glu Phe Arg Asp Phe Ile Gln Val1
5 10 15Leu Lys Asp Glu
Asp Asp Leu Ile Glu Ile Thr Glu Glu Ile Asp Pro 20
25 30Asn Leu Glu Val Gly Ala Ile Met Arg Lys Ala
Tyr Glu Ser His Leu 35 40 45Pro
Ala Pro Leu Phe Lys Asn Leu Lys Gly Ala Ser Lys Asp Leu Phe 50
55 60Ser Ile Leu Gly Cys Pro Ala Gly Leu Arg
Ser Lys Glu Lys Gly Asp65 70 75
80His Gly Arg Ile Ala His His Leu Gly Leu Asp Pro Lys Thr Thr
Ile 85 90 95Lys Glu Ile
Ile Asp Tyr Leu Leu Glu Cys Lys Glu Lys Glu Pro Leu 100
105 110Pro Pro Ile Thr Val Pro Val Ser Ser Ala
Pro Cys Lys Thr His Ile 115 120
125Leu Ser Glu Glu Lys Ile His Leu Gln Ser Leu Pro Thr Pro Tyr Leu 130
135 140His Val Ser Asp Gly Gly Lys Tyr
Leu Gln Thr Tyr Gly Met Trp Ile145 150
155 160Leu Gln Thr Pro Asp Lys Lys Trp Thr Asn Trp Ser
Ile Ala Arg Gly 165 170
175Met Val Val Asp Asp Lys His Ile Thr Gly Leu Val Ile Lys Pro Gln
180 185 190His Ile Arg Gln Ile Ala
Asp Ser Trp Ala Ala Ile Gly Lys Ala Asn 195 200
205Glu Ile Pro Phe Ala Leu Cys Phe Gly Val Pro Pro Ala Ala
Ile Leu 210 215 220Val Ser Ser Met Pro
Ile Pro Glu Gly Val Ser Glu Ser Asp Tyr Val225 230
235 240Gly Ala Ile Leu Gly Glu Ser Val Pro Val
Val Lys Cys Glu Thr Asn 245 250
255Asp Leu Met Val Pro Ala Thr Ser Glu Met Val Phe Glu Gly Thr Leu
260 265 270Ser Leu Thr Asp Thr
His Leu Glu Gly Pro Phe Gly Glu Met His Gly 275
280 285Tyr Val Phe Lys Ser Gln Gly His Pro Cys Pro Leu
Tyr Thr Val Lys 290 295 300Ala Met Ser
Tyr Arg Asp Asn Ala Ile Leu Pro Val Ser Asn Pro Gly305
310 315 320Leu Cys Thr Asp Glu Thr His
Thr Leu Ile Gly Ser Leu Val Ala Thr 325
330 335Glu Ala Lys Glu Leu Ala Ile Glu Ser Gly Leu Pro
Ile Leu Asp Ala 340 345 350Phe
Met Pro Tyr Glu Ala Gln Ala Leu Trp Leu Ile Leu Lys Val Asp 355
360 365Leu Lys Gly Leu Gln Ala Leu Lys Thr
Thr Pro Glu Glu Phe Cys Lys 370 375
380Lys Val Gly Asp Ile Tyr Phe Arg Thr Lys Val Gly Phe Ile Val His385
390 395 400Glu Ile Ile Leu
Val Ala Asp Asp Ile Asp Ile Phe Asn Phe Lys Glu 405
410 415Val Ile Trp Ala Tyr Val Thr Arg His Thr
Pro Val Ala Asp Gln Met 420 425
430Ala Phe Asp Asp Val Thr Ser Phe Pro Leu Ala Pro Phe Val Ser Gln
435 440 445Ser Ser Arg Ser Lys Thr Met
Lys Gly Gly Lys Cys Val Thr Asn Cys 450 455
460Ile Phe Arg Gln Gln Tyr Glu Arg Ser Phe Asp Tyr Ile Thr Cys
Asn465 470 475 480Phe Glu
Lys Gly Tyr Pro Lys Gly Leu Val Asp Lys Val Asn Glu Asn
485 490 495Trp Lys Arg Tyr Gly Tyr Lys
50049168PRTUnknownEnterobacter species MGH 24 49Met Ser Thr Phe
Asp Lys His Asp Leu Ser Gly Phe Val Gly Lys His1 5
10 15Leu Val Tyr Thr Tyr Asp Asn Gly Trp Asn
Tyr Glu Ile Tyr Val Lys 20 25
30Asn Glu Thr Thr Leu Asp Tyr Arg Ile His Ser Gly Leu Val Ala Asn
35 40 45Arg Trp Val Lys Asp Gln Gln Ala
Tyr Ile Val Arg Val Gly Glu Ser 50 55
60Ile Tyr Lys Ile Ser Trp Thr Glu Pro Thr Gly Thr Asp Val Ser Leu65
70 75 80Ile Val Asn Leu Gly
Asp Lys Leu Phe His Gly Thr Ile Phe Phe Pro 85
90 95Arg Trp Val Met Asn Asn Pro Glu Lys Thr Val
Cys Phe Gln Asn Asp 100 105
110His Ile Pro Leu Met Asn Ser Tyr Arg Asp Ala Gly Pro Ala Tyr Pro
115 120 125Thr Glu Val Ile Asp Glu Phe
Ala Thr Ile Thr Phe Val Arg Asp Cys 130 135
140Gly Ala Asn Asn Glu Ser Val Ile Ala Cys Ala Ala Ser Glu Leu
Pro145 150 155 160Asn Asp
Phe Pro Ala Asn Leu Asn 16550161PRTBacillus pumilus 50Met
Asp Gln Phe Val Gly Leu His Met Ile Tyr Thr Tyr Glu Asn Gly1
5 10 15Trp Glu Tyr Glu Ile Tyr Ile
Lys Asn Asp His Thr Ile Asp Tyr Arg 20 25
30Ile His Ser Gly Met Val Gly Gly Arg Trp Val Arg Asp Gln
Glu Val 35 40 45Asn Ile Val Lys
Leu Thr Lys Gly Val Tyr Lys Val Ser Trp Thr Glu 50 55
60Pro Thr Gly Thr Asp Val Ser Leu Asn Phe Met Pro Glu
Glu Lys Arg65 70 75
80Met His Gly Val Ile Phe Phe Pro Lys Trp Val His Glu Arg Pro Asp
85 90 95Ile Thr Val Cys Tyr Gln
Asn Asp Tyr Ile Asp Leu Met Lys Glu Ser 100
105 110Arg Glu Lys Tyr Glu Thr Tyr Pro Lys Tyr Val Val
Pro Glu Phe Ala 115 120 125Asp Ile
Thr Tyr Ile His His Ala Gly Val Asn Asp Glu Thr Ile Ile 130
135 140Ala Glu Ala Pro Tyr Glu Gly Met Thr Asp Glu
Ile Arg Ala Gly Arg145 150 155
160Lys51534PRTAspergillus nigerAspergillus niger CBS 513.88 51Met
Leu Arg Met Leu Arg Pro Gly Arg Arg Ile Pro Thr His Pro Ser1
5 10 15Arg Ser Phe Ser Thr Thr Pro
His Arg Ser Asn Asp Ser Pro Ala Leu 20 25
30Asn Phe Arg Ser Leu Leu Ser Ala Leu Arg Ala Gln Asp Asp
Leu Val 35 40 45Asp Ile Thr Gln
Pro Ala Ser Pro Asp Leu Glu Ile Ala Ala Leu Thr 50 55
60Arg Arg Val Tyr Glu Ser His Ser Pro Ala Pro Leu Phe
His Asn Val65 70 75
80Thr Asp Thr Asp Pro Glu Thr Gly Leu Phe Lys Ile Leu Gly Ala Pro
85 90 95Val Gly Leu Arg Ala Asp
Pro Ala Thr Arg Phe Gly Arg Leu Ala Ile 100
105 110Gln Leu Gly Leu Pro Gln Asn Ala Thr Pro Leu Asp
Ile Leu Glu Lys 115 120 125Leu Ile
Ala Ala Lys His Ser Thr Pro Leu Pro Pro Thr Pro Val Pro 130
135 140Ala Ser Ser Ala Pro Cys Lys Glu Asn Ile Leu
His Gly Ser Gln Ile145 150 155
160Asp Met Thr Lys Trp Pro Ile Pro Arg Leu His Pro Leu Asp Gly Gly
165 170 175Asn Tyr Leu Ala
Thr Tyr Gly Phe His Ile Leu Gln Ser Pro Asp Lys 180
185 190Ala Trp Thr Ser Trp Ser Ile Ser Arg Thr Met
His Val Ala Asn Thr 195 200 205Pro
Arg Thr Ile Val Ala Pro Ile Met Pro Gly Gln His Ile Ala Gln 210
215 220Val His Gln Met Trp Ala Asp Gln Gly Ala
Lys Asp Thr Pro Trp Ala225 230 235
240Leu Val Leu Gly Gly Pro Pro Ala Ala Ala Phe Val Gly Gly Met
Pro 245 250 255Leu Pro Ala
Phe Val Ser Glu Asp Gly Tyr Ile Gly Ala Leu Cys Gly 260
265 270Glu Ala Met Asp Val Val Lys Cys Glu Thr
Asn Asp Leu Tyr Val Pro 275 280
285Ala Asn Ala Glu Ile Val Leu Glu Gly Arg Ile Ser Thr Thr Glu Lys 290
295 300Val Gly Glu Gly Pro Met Gly Glu
Tyr His Gly Tyr Met Phe Gln Asp305 310
315 320Lys Ala Val Pro Glu Pro Arg Ile Glu Val Asp Cys
Val Thr Tyr Arg 325 330
335Arg Asp Pro Val Val Pro Ile Cys Val Ala Gly Leu Ala Pro Asp Glu
340 345 350Thr His Thr Val Trp Gly
Ala Ala Ile Ser Ala Glu Ile Leu Asp Ala 355 360
365Leu Arg Gly Ala Glu Leu Pro Val Lys Met Ala Trp Met Pro
Tyr Glu 370 375 380Ala Gln Cys Cys Trp
Val Val Val Ser Val Asp Val Glu Arg Leu Gly385 390
395 400Arg Met Gly Ile Lys Lys Glu Glu Leu Ser
Arg Arg Val Gly Glu Val 405 410
415Val Phe Gly Thr His Ala Gly Trp Glu Ala Pro Lys Val Phe Val Val
420 425 430Gly Asp Asp Val Asp
Val Thr Asp Ile Gly Gln Phe Val Trp Ala Leu 435
440 445Ala Thr Arg Tyr Arg Pro Gly Ala Asp Glu Leu Val
Phe Glu Glu Ala 450 455 460Asp Gly Leu
Pro Met Ile Pro Tyr Met Thr Arg Ala Ser Arg Arg Glu465
470 475 480Val Pro Asn Pro Gly Lys Gly
Gly Lys Ser Val Val Asn Leu Leu Leu 485
490 495Pro Ser Glu Phe Glu Gly Lys Arg Pro Trp Val Pro
Gly Ser Phe Glu 500 505 510Gly
Leu Tyr Ser Glu Glu Leu Lys Gln Lys Val Leu Gly Arg Trp Gly 515
520 525Glu Leu Phe Glu Lys Lys
53052513PRTCandida dubliniensisCandida dubliniensis CD36 52Met Ser Leu
Asn Pro Ala Leu Lys Phe Arg Asp Phe Ile Gln Val Leu1 5
10 15Lys Asn Glu Gly Asp Leu Ile Glu Ile
Asp Thr Glu Val Asp Pro Asn 20 25
30Leu Glu Val Gly Ala Ile Thr Arg Lys Ala Tyr Glu Asn Lys Leu Ala
35 40 45Ala Pro Leu Phe Asn Asn Leu
Lys Gln Asp Pro Glu Asn Ile Asp Pro 50 55
60Lys Asn Leu Phe Arg Ile Leu Gly Cys Pro Gly Gly Leu Arg Gly Phe65
70 75 80Gly Asn Asp His
Ala Arg Ile Ala Leu His Leu Gly Leu Asp Ser Gln 85
90 95Thr Pro Met Lys Glu Ile Ile Asp Phe Leu
Val Ala Asn Arg Asn Pro 100 105
110Lys Lys Tyr Ile Pro Pro Val Leu Val Pro Asn Asp Gln Ser Pro His
115 120 125Lys Lys His His Leu Thr Lys
Glu Gln Ile Asp Leu Thr Lys Leu Pro 130 135
140Val Pro Leu Leu His His Gly Asp Gly Gly Lys Phe Ile Gln Thr
Tyr145 150 155 160Gly Met
Trp Val Leu Gln Thr Pro Asp Lys Ser Trp Thr Asn Trp Ser
165 170 175Ile Ala Arg Gly Met Val His
Asp Ser Lys Ser Ile Thr Gly Leu Val 180 185
190Ile Asn Pro Gln His Val Lys Gln Val Ser Asp Ala Trp Val
Ala Ala 195 200 205Gly Lys Gly Asp
Lys Ile Pro Phe Ala Leu Cys Phe Gly Val Pro Pro 210
215 220Ala Ala Ile Leu Val Ser Ser Met Pro Ile Pro Asp
Gly Ala Thr Glu225 230 235
240Ala Glu Tyr Ile Gly Gly Leu Cys Asn Gln Ala Val Pro Val Val Lys
245 250 255Cys Glu Thr Asn Asp
Leu Glu Val Pro Ala Asp Cys Glu Met Val Phe 260
265 270Glu Gly Tyr Leu Asp Arg Asp Thr Leu Val Arg Glu
Gly Pro Phe Gly 275 280 285Glu Met
His Gly Tyr Cys Phe Pro Lys Asp His His Thr Gln Pro Leu 290
295 300Tyr Arg Val Asn His Ile Ser Tyr Arg Asp Gln
Ala Ile Met Pro Ile305 310 315
320Ser Asn Pro Gly Leu Cys Thr Asp Glu Thr His Thr Leu Ile Gly Gly
325 330 335Leu Val Ser Ala
Glu Thr Lys Tyr Leu Ile Ser Gln His Pro Val Leu 340
345 350Ser Lys Ile Val Glu Asp Val Phe Thr Pro Tyr
Glu Ala Gln Ala Leu 355 360 365Trp
Leu Ala Val Lys Ile Asn Thr His Glu Leu Val Lys Leu Lys Thr 370
375 380Asn Ala Lys Glu Leu Ser Asn Leu Val Gly
Asp Phe Leu Phe Arg Ser385 390 395
400Lys Glu Cys Tyr Lys Val Cys Ser Ile Leu His Glu Ile Ile Leu
Val 405 410 415Gly Asp Asp
Ile Asp Ile Phe Asp Phe Lys Gln Leu Ile Trp Ala Tyr 420
425 430Thr Thr Arg His Thr Pro Val Gln Asp Gln
Leu Tyr Phe Asp Asp Val 435 440
445Lys Pro Phe Ala Leu Ala Pro Phe Ala Ser Gln Gly Pro Leu Ile Lys 450
455 460Thr Arg Gln Gly Gly Lys Cys Val
Thr Thr Cys Ile Phe Pro Lys Gln465 470
475 480Phe Thr Asp Pro Asp Phe Glu Phe Val Thr Cys Asn
Phe Asn Gly Tyr 485 490
495Pro Glu Glu Val Lys Asn Lys Ile Ser Gln Asn Trp Asp Lys Tyr Tyr
500 505 510Lys53497PRTEscherichia
coliEscherichia coli K-12 53Met Asp Ala Met Lys Tyr Asn Asp Leu Arg Asp
Phe Leu Thr Leu Leu1 5 10
15Glu Gln Gln Gly Glu Leu Lys Arg Ile Thr Leu Pro Val Asp Pro His
20 25 30Leu Glu Ile Thr Glu Ile Ala
Asp Arg Thr Leu Arg Ala Gly Gly Pro 35 40
45Ala Leu Leu Phe Glu Asn Pro Lys Gly Tyr Ser Met Pro Val Leu
Cys 50 55 60Asn Leu Phe Gly Thr Pro
Lys Arg Val Ala Met Gly Met Gly Gln Glu65 70
75 80Asp Val Ser Ala Leu Arg Glu Val Gly Lys Leu
Leu Ala Phe Leu Lys 85 90
95Glu Pro Glu Pro Pro Lys Gly Phe Arg Asp Leu Phe Asp Lys Leu Pro
100 105 110Gln Phe Lys Gln Val Leu
Asn Met Pro Thr Lys Arg Leu Arg Gly Ala 115 120
125Pro Cys Gln Gln Lys Ile Val Ser Gly Asp Asp Val Asp Leu
Asn Arg 130 135 140Ile Pro Ile Met Thr
Cys Trp Pro Glu Asp Ala Ala Pro Leu Ile Thr145 150
155 160Trp Gly Leu Thr Val Thr Arg Gly Pro His
Lys Glu Arg Gln Asn Leu 165 170
175Gly Ile Tyr Arg Gln Gln Leu Ile Gly Lys Asn Lys Leu Ile Met Arg
180 185 190Trp Leu Ser His Arg
Gly Gly Ala Leu Asp Tyr Gln Glu Trp Cys Ala 195
200 205Ala His Pro Gly Glu Arg Phe Pro Val Ser Val Ala
Leu Gly Ala Asp 210 215 220Pro Ala Thr
Ile Leu Gly Ala Val Thr Pro Val Pro Asp Thr Leu Ser225
230 235 240Glu Tyr Ala Phe Ala Gly Leu
Leu Arg Gly Thr Lys Thr Glu Val Val 245
250 255Lys Cys Ile Ser Asn Asp Leu Glu Val Pro Ala Ser
Ala Glu Ile Val 260 265 270Leu
Glu Gly Tyr Ile Glu Gln Gly Glu Thr Ala Pro Glu Gly Pro Tyr 275
280 285Gly Asp His Thr Gly Tyr Tyr Asn Glu
Val Asp Ser Phe Pro Val Phe 290 295
300Thr Val Thr His Ile Thr Gln Arg Glu Asp Ala Ile Tyr His Ser Thr305
310 315 320Tyr Thr Gly Arg
Pro Pro Asp Glu Pro Ala Val Leu Gly Val Ala Leu 325
330 335Asn Glu Val Phe Val Pro Ile Leu Gln Lys
Gln Phe Pro Glu Ile Val 340 345
350Asp Phe Tyr Leu Pro Pro Glu Gly Cys Ser Tyr Arg Leu Ala Val Val
355 360 365Thr Ile Lys Lys Gln Tyr Ala
Gly His Ala Lys Arg Val Met Met Gly 370 375
380Val Trp Ser Phe Leu Arg Gln Phe Met Tyr Thr Lys Phe Val Ile
Val385 390 395 400Cys Asp
Asp Asp Val Asn Ala Arg Asp Trp Asn Asp Val Ile Trp Ala
405 410 415Ile Thr Thr Arg Met Asp Pro
Ala Arg Asp Thr Val Leu Val Glu Asn 420 425
430Thr Pro Ile Asp Tyr Leu Asp Phe Ala Ser Pro Val Ser Gly
Leu Gly 435 440 445Ser Lys Met Gly
Leu Asp Ala Thr Asn Lys Trp Pro Gly Glu Thr Gln 450
455 460Arg Glu Trp Gly Arg Pro Ile Lys Lys Asp Pro Asp
Val Val Ala His465 470 475
480Ile Asp Ala Ile Trp Asp Glu Leu Ala Ile Phe Asn Asn Gly Lys Ser
485 490 495Ala54473PRTBacillus
megateriumBacillus megaterium QM B1551 54Met Ala Tyr Lys Asp Phe Arg Asp
Phe Leu Asn Thr Leu His Lys Glu1 5 10
15Gly Gln Leu Leu Thr Val Thr Asp Glu Val Gln Pro Asp Pro
Asp Leu 20 25 30Gly Ser Ala
Gly Gln Ala Ile Ser Asn Leu Gly Asp Gln Thr Pro Gly 35
40 45Leu Leu Phe Thr Asn Ile Tyr Gly Tyr Asn Asn
Ala Lys Val Ala Leu 50 55 60Asn Val
Met Gly Ser Trp Ser Asn His Ala Leu Met Met Gly Leu Pro65
70 75 80Lys Ser Thr Pro Val Lys Glu
Gln Phe Phe Glu Phe Ala Arg Arg Tyr 85 90
95Glu Lys Phe Pro Val Lys Val Lys Arg Glu Glu Thr Ala
Pro Phe His 100 105 110Glu Cys
Glu Ile Lys Asp Asp Ile Asn Leu Phe Asp Leu Leu Pro Leu 115
120 125Phe Arg Leu Asn Gln Gly Asp Gly Gly Tyr
Tyr Leu Asp Lys Ala Cys 130 135 140Val
Ile Ser Arg Asp Gln His Asp Lys Glu Asn Phe Gly Lys Gln Asn145
150 155 160Val Gly Ile Tyr Arg Met
Gln Val Lys Gly Lys Asp Arg Leu Gly Ile 165
170 175Gln Pro Val Pro Gln His Asp Ile Ala Ile His Leu
Lys Gln Ala Glu 180 185 190Glu
Lys Gly Glu Asn Leu Pro Val Ser Ile Ala Leu Gly Cys Glu Pro 195
200 205Ala Ile Val Thr Ala Ala Ala Thr Pro
Leu His Tyr Asp Gln Ser Glu 210 215
220Tyr Glu Met Ala Gly Ala Ile Gln Gly Glu Pro Tyr Arg Ile Val Lys225
230 235 240Ser Gln Leu Ser
Asp Leu Asp Val Pro Trp Gly Ala Glu Val Ile Leu 245
250 255Glu Gly Glu Ile Leu Ala Gly Glu Arg Glu
Tyr Glu Gly Pro Phe Gly 260 265
270Glu Phe Thr Gly His Tyr Ser Gly Gly Arg Ser Met Pro Val Ile Lys
275 280 285Ile Asn Arg Val Tyr His Arg
Lys Asp Pro Ile Phe Glu Ser Leu Tyr 290 295
300Ile Gly Met Pro Trp Thr Glu Thr Asp Tyr Leu Ile Gly Ile Asn
Thr305 310 315 320Ser Val
Pro Leu Tyr Gln Gln Leu Lys Glu Ala Tyr Pro Glu Glu Ile
325 330 335Glu Ala Val Asn Ala Met Tyr
Thr His Gly Leu Val Ala Ile Val Ser 340 345
350Thr Lys Ser Arg Tyr Gly Gly Phe Ala Lys Ala Val Gly Met
Arg Ala 355 360 365Leu Thr Thr Pro
His Gly Leu Gly Tyr Cys Lys Leu Val Ile Leu Val 370
375 380Asp Glu Asp Val Asp Pro Phe Asn Leu Pro Gln Val
Met Trp Ala Leu385 390 395
400Ser Thr Lys Met His Pro Lys His Asp Val Ile Thr Val Pro Asn Leu
405 410 415Ser Val Leu Pro Leu
Asp Pro Gly Ser Glu Pro Ala Gly Ile Thr Asp 420
425 430Lys Met Ile Leu Asp Ala Thr Thr Pro Val Ala Pro
Glu Thr Arg Gly 435 440 445His Tyr
Ser Gln Pro Leu Asp Thr Pro Leu Glu Thr Glu Lys Trp Glu 450
455 460Lys Ile Leu Thr Asn Met Met Gln Lys465
47055423PRTUnknownMethanothermobacter sp. CaT2 55Met Arg Asn Phe
Leu Asp Lys Ile Gly Glu Glu Ala Leu Val Val Glu1 5
10 15Asp Glu Val Ser Thr Ser Phe Glu Ala Ala
Ser Ile Leu Arg Glu His 20 25
30Pro Arg Asp Leu Val Ile Leu Lys Asn Leu Lys Glu Ser Asp Ile Pro
35 40 45Val Ile Ser Gly Leu Cys Asn Thr
Arg Glu Lys Ile Ala Leu Ser Leu 50 55
60Asn Cys Arg Val His Glu Ile Thr His Arg Ile Val Glu Ala Met Glu65
70 75 80Asn Pro Thr Pro Ile
Ser Ser Val Gly Gly Leu Asp Gly Tyr Arg Ser 85
90 95Gly Arg Ala Asp Leu Ser Glu Leu Pro Ile Leu
Arg His Tyr Arg Arg 100 105
110Asp Gly Gly Pro Tyr Ile Thr Ala Gly Val Ile Phe Ala Arg Asp Pro
115 120 125Asp Thr Gly Val Arg Asn Ala
Ser Ile His Arg Met Met Val Ile Gly 130 135
140Asp Asp Arg Leu Ala Val Arg Ile Val Pro Arg His Leu Tyr Thr
Tyr145 150 155 160Leu Gln
Lys Ala Glu Glu Arg Gly Glu Asp Leu Glu Ile Ala Ile Ala
165 170 175Ile Gly Met Asp Pro Ala Thr
Leu Leu Ala Thr Thr Thr Ser Ile Pro 180 185
190Ile Asp Ala Asp Glu Met Glu Val Ala Asn Thr Phe His Glu
Gly Glu 195 200 205Leu Glu Leu Val
Arg Cys Glu Gly Val Asp Met Glu Val Pro Pro Ala 210
215 220Glu Ile Ile Leu Glu Gly Arg Ile Leu Cys Gly Val
Arg Glu Arg Glu225 230 235
240Gly Pro Phe Val Asp Leu Thr Asp Thr Tyr Asp Val Val Arg Asp Glu
245 250 255Pro Val Ile Ser Leu
Glu Arg Met His Ile Arg Lys Asp Ala Met Tyr 260
265 270His Ala Ile Leu Pro Ala Gly Phe Glu His Arg Leu
Leu Gln Gly Leu 275 280 285Pro Gln
Glu Pro Arg Ile Tyr Arg Ala Val Lys Asn Thr Val Pro Thr 290
295 300Val Arg Asn Val Val Leu Thr Glu Gly Gly Cys
Cys Trp Leu His Ala305 310 315
320Ala Val Ser Ile Lys Lys Gln Thr Glu Gly Asp Gly Lys Asn Val Ile
325 330 335Met Ala Ala Leu
Ala Ala His Pro Ser Leu Lys His Val Val Val Val 340
345 350Asp Glu Asp Ile Asp Val Leu Asp Pro Glu Glu
Ile Glu Tyr Ala Ile 355 360 365Ala
Thr Arg Val Lys Gly Asp Asp Asp Ile Leu Ile Val Pro Gly Ala 370
375 380Arg Gly Ser Ser Leu Asp Pro Ala Ala Leu
Pro Asp Gly Thr Thr Thr385 390 395
400Lys Val Gly Val Asp Ala Thr Ala Pro Leu Ala Ser Ala Glu Lys
Phe 405 410 415Gln Arg Val
Ser Arg Ser Glu 42056494PRTMycobacterium chelonaeMycobacterium
chelonae 1518 56Met Ala Phe Asn Asp Leu Arg Arg Tyr Leu Ala Asp Leu Glu
Ala His1 5 10 15Gly Glu
Leu Arg Thr Ile Lys Thr Pro Val Ser Thr Glu Ile Gln Leu 20
25 30Gly Ala Ile Ala Arg Leu Ala Cys Glu
Thr Tyr Gly Pro Ala Ala Leu 35 40
45Phe Glu Asn Leu Val Gly Tyr Pro Thr Phe Arg Gly Leu Ala Ala Phe 50
55 60Glu Thr Tyr Ser Gly Asn Pro Asp Asn
Arg Ala Trp Arg Leu Ala Arg65 70 75
80Ala Leu Gly Leu Ser Asp Asp Thr Thr Gly Asp Gln Ile Val
Asp Phe 85 90 95Leu Ala
Gly Phe Arg Asp Thr Ala Gly Val Ala Pro Val Leu Val Glu 100
105 110Thr Gly Pro Val His Glu Asn Ile Val
Arg Asp Arg Gly Glu Leu Leu 115 120
125Asp Tyr Leu Pro Ile Pro His Leu His Pro Gly Asp Gly Gly Pro Tyr
130 135 140Val Asn Thr Ile Gly Phe Phe
Val Leu Glu Ser Pro Asp Arg Ser Trp145 150
155 160Val Asn Trp Ala Val Ala Arg Cys Met Lys Leu Asp
Gly Asp Arg Met 165 170
175Val Gly Met Thr Ala Val Met Gln His Ile Gly Met Leu Arg Arg Glu
180 185 190Trp Asp Lys Ile Gly Thr
Ser Val Pro Phe Ala Leu Val Leu Gly Ala 195 200
205Asp Pro Ile Thr Thr Leu Ile Ser Gly Gly Pro Leu Ala Lys
Phe Gly 210 215 220Ala Ser Glu Gly Asp
Ile Ile Gly Ala Ile Arg Gly Glu Pro Leu Glu225 230
235 240Val Val Glu Cys Val Thr Ser Ser Leu Arg
Val Pro Ala His Ala Glu 245 250
255Ile Val Ile Glu Gly Tyr Ile Asp Leu Thr Glu Ser Ala Asp Glu Gly
260 265 270Pro Met Ala Glu Tyr
His Gly Tyr Ile Asp Lys Ala Lys Asn Thr Thr 275
280 285Gly Ala Pro Asp Phe Gly Val Tyr His Ile Thr Ala
Val Thr His Arg 290 295 300Asn Asp Ala
Ile Tyr Pro Ser Thr Cys Ala Gly Lys Pro Val Asp Glu305
310 315 320Asp His Thr Ile Thr Gly Pro
Gly Val Ala Ala Ala Ser Leu Asn Ala 325
330 335Leu Arg Ala Ala Ser Leu Pro Val Glu Lys Ala Trp
Met Val Pro Glu 340 345 350Ser
Ala Ser His Val Leu Ala Val Thr Val Ser Asp Gly Trp Ser Gly 355
360 365Glu Phe Pro Asp Ala Asn Glu Leu Cys
Arg Lys Ile Gly Asn Ala Val 370 375
380Lys Thr Met Asp His Ser Ala Tyr Trp Val Gln Arg Ile Leu Val Thr385
390 395 400Asp Asn Asp Ile
Asp Pro Thr Ser Pro Ser Asp Leu Trp Trp Ala Tyr 405
410 415Ala Thr Arg Cys Arg Pro Gly Asp Asp Ser
Ile Ile Leu Glu Asp Val 420 425
430Pro Ile Met Ala Leu Ser Pro Ile Val Asn Thr Arg Glu Glu Arg Thr
435 440 445Lys Thr Arg Gly Arg Val Glu
Val Leu Asn Cys Leu Ile Pro Pro Tyr 450 455
460Ala Asp Asp Leu Ser Val Thr Ser Ala Ala Leu Arg Gln Ala Tyr
Pro465 470 475 480His Asp
Ala Ile Ala Phe Ala Glu Arg Thr Tyr Leu Gly Glu 485
49057512PRTHypocrea atroviridisHypocrea atroviridis (strain ATCC
20476) 57Met Ser Ser Thr Thr Tyr Lys Ser Glu Ala Phe Asp Pro Glu Pro Pro1
5 10 15His Leu Ser Phe
Arg Ser Phe Val Glu Ala Leu Arg Gln Asp Asn Asp 20
25 30Leu Val Asp Ile Asn Glu Pro Val Asp Pro Asp
Leu Glu Ala Ala Ala 35 40 45Ile
Thr Arg Leu Val Cys Glu Thr Asp Asp Lys Ala Pro Leu Phe Asn 50
55 60Asn Val Ile Gly Ala Lys Asp Gly Leu Trp
Arg Ile Leu Gly Ala Pro65 70 75
80Ala Ser Leu Arg Ser Ser Pro Lys Glu Arg Phe Gly Arg Leu Ala
Arg 85 90 95His Leu Ala
Leu Pro Pro Thr Ala Ser Ala Lys Asp Ile Leu Asp Lys 100
105 110Met Leu Ser Ala Asn Ser Ile Pro Pro Ile
Glu Pro Val Ile Val Pro 115 120
125Thr Gly Pro Val Lys Glu Asn Ser Ile Glu Gly Glu Asn Ile Asp Leu 130
135 140Glu Ala Leu Pro Ala Pro Met Val
His Gln Ser Asp Gly Gly Lys Tyr145 150
155 160Ile Gln Thr Tyr Gly Met His Val Ile Gln Ser Pro
Asp Gly Cys Trp 165 170
175Thr Asn Trp Ser Ile Ala Arg Ala Met Val Ser Gly Lys Arg Thr Leu
180 185 190Ala Gly Leu Val Ile Ser
Pro Gln His Ile Arg Lys Ile Gln Asp Gln 195 200
205Trp Arg Ala Ile Gly Gln Glu Glu Ile Pro Trp Ala Leu Ala
Phe Gly 210 215 220Val Pro Pro Thr Ala
Ile Met Ala Ser Ser Met Pro Ile Pro Asp Gly225 230
235 240Val Ser Glu Ala Gly Tyr Val Gly Ala Ile
Ala Gly Glu Pro Ile Lys 245 250
255Leu Val Lys Cys Asp Thr Asn Asn Leu Tyr Val Pro Ala Asn Ser Glu
260 265 270Ile Val Leu Glu Gly
Thr Leu Ser Thr Thr Lys Met Ala Pro Glu Gly 275
280 285Pro Phe Gly Glu Met His Gly Tyr Val Tyr Pro Gly
Glu Ser His Pro 290 295 300Gly Pro Val
Tyr Thr Val Asn Lys Ile Thr Tyr Arg Asn Asn Ala Ile305
310 315 320Leu Pro Met Ser Ala Cys Gly
Arg Leu Thr Asp Glu Thr Gln Thr Met 325
330 335Ile Gly Thr Leu Ala Ala Ala Glu Ile Arg Gln Leu
Cys Gln Asp Ala 340 345 350Gly
Leu Pro Ile Thr Asp Ala Phe Ala Pro Phe Val Gly Gln Ala Thr 355
360 365Trp Val Ala Leu Lys Val Asp Thr Lys
Arg Leu Arg Ala Met Lys Thr 370 375
380Asn Gly Lys Ala Phe Ala Lys Arg Val Gly Asp Val Val Phe Thr Gln385
390 395 400Lys Pro Gly Phe
Thr Ile His Arg Leu Ile Leu Val Gly Asp Asp Ile 405
410 415Asp Val Tyr Asp Asp Lys Asp Val Met Trp
Ala Phe Thr Thr Arg Cys 420 425
430Arg Pro Gly Thr Asp Glu Val Phe Phe Asp Asp Val Val Gly Phe Gln
435 440 445Leu Ile Pro Tyr Met Ser His
Gly Asn Ala Glu Ala Ile Lys Gly Gly 450 455
460Lys Val Val Ser Asp Ala Leu Leu Thr Ala Glu Tyr Thr Thr Gly
Lys465 470 475 480Asp Trp
Glu Ser Ala Asp Phe Lys Asn Ser Tyr Pro Lys Ser Ile Gln
485 490 495Asp Lys Val Leu Asn Ser Trp
Glu Arg Leu Gly Phe Lys Lys Leu Asp 500 505
51058508PRTSphaerulina musivaSphaerulina musiva (strain
SO2202) 58Met Ser Ser Ser Lys Gln Gln His Leu Ser His Ala Asn Gln Glu
Leu1 5 10 15Pro His Leu
Asn Phe Arg Ser Phe Val Gln Ala Leu Lys Asp Asp Gly 20
25 30Asp Leu Ile Glu Ile Asp Asp Glu Ile Asp
Pro His Leu Glu Ala Gly 35 40
45Ala Ile Ile Arg Arg Ala Cys Glu Thr Asp Gly Lys Ala Pro Leu Leu 50
55 60Asn Asn Leu Lys Gly Ala Lys Asp Gly
Leu Trp Arg Ile Leu Gly Ala65 70 75
80Pro Ala Ser Leu Arg Ser Asp Pro Ser Gln Lys Tyr Gly Arg
Val Ala 85 90 95Arg His
Leu Ala Leu Pro Pro Thr Ala Thr Met Lys Asp Ile Leu Asp 100
105 110Lys Met Leu Ser Ala Ala His Ala Glu
Pro Ile Pro Pro Asn Ile Val 115 120
125Glu Ser Gly Pro Val Lys Glu Asn Lys Leu Val Asp Gly Glu Phe Asp
130 135 140Leu Ser Thr Leu Pro Ala Pro
Trp Leu His Gln Ala Asp Gly Gly Lys145 150
155 160Tyr Ile Gln Thr Tyr Gly Met His Ile Val Gln Ser
Pro Asp Gly Lys 165 170
175Trp Thr Asn Trp Ser Ile Ala Arg Ala Met Val His Asp Lys Asn His
180 185 190Leu Thr Gly Leu Val Ile
Glu Pro Gln His Ile Trp Gln Ile His Gln 195 200
205Gln Trp Lys Lys Val Gly Lys Asp Val Pro Trp Ala Leu Ala
Phe Gly 210 215 220Val Pro Pro Ala Ala
Ile Met Ala Ala Ser Met Pro Ile Pro Asp Gly225 230
235 240Val Thr Glu Ala Gly Tyr Ile Gly Ala Met
Thr Gly Ser Ala Leu Asp 245 250
255Val Val Lys Cys Glu Thr Asn Gly Met Tyr Val Pro Ala Asn Ala Glu
260 265 270Ile Val Leu Glu Gly
Thr Leu Ser Ile Thr Glu Thr Ala Pro Glu Gly 275
280 285Pro Phe Gly Glu Met His Gly Tyr Val Phe Pro Gly
Asp Thr His Pro 290 295 300Trp Pro Lys
Tyr Lys Val Asp Ala Ile Thr Tyr Arg Asn Gly Ala Ile305
310 315 320Leu Pro Val Ser Asn Cys Gly
Arg Ile Thr Asp Glu Thr His Thr Leu 325
330 335Ile Gly Pro Leu Ala Ala Ala Gln Ile Arg Gln Leu
Cys Gln Asp Ala 340 345 350Gly
Leu Pro Ile Thr Asp Ala Phe Ala Pro Phe His Thr Gln Val Thr 355
360 365Trp Val Ala Leu Lys Val Asp Ile Glu
Lys Leu Gly Lys Met Asn Thr 370 375
380Thr Pro Glu Ala Phe Arg Lys Gln Val Gly Asp Leu Val Phe Asn His385
390 395 400Lys Ala Gly Tyr
Thr Ile His Arg Leu Val Leu Cys Gly Ser Asp Ile 405
410 415Asp Val Tyr Glu Trp Asp Asp Ile Ala Phe
Ala Phe Ser Thr Arg Cys 420 425
430Arg Pro Asn Lys Asp Glu Thr Phe Tyr Glu Asp Cys Gln Gly Phe Pro
435 440 445Leu Ile Pro Tyr Met Ser His
Gly Thr Gly Ser Pro Ile Lys Gly Gly 450 455
460Lys Val Ile Ser Asp Ala Leu Met Pro Ser Glu Tyr Arg Gly Gln
Gln465 470 475 480Asp Trp
Gln Gln Ala Ser Phe Lys His Ser Tyr Pro Glu Ser Leu Gln
485 490 495Lys Ser Val Ile Glu Arg Trp
Ala Ser Trp Gly Phe 500 50559498PRTPenicillium
roqueforti 59Met Ala Asn Ile Glu Pro His Leu Cys Phe Arg Ser Phe Val Glu
Ala1 5 10 15Leu Lys Ala
Asp Asn Asp Leu Val Glu Ile Asp Thr Pro Ile Asp Pro 20
25 30Asn Leu Glu Ala Ala Ala Ile Thr Arg Leu
Val Cys Glu Thr Asn Asp 35 40
45Lys Ala Pro Leu Phe Asn Asn Ile Ile Gly Thr Glu Lys Gly Leu Phe 50
55 60Arg Ile Leu Gly Ala Pro Ala Ser Leu
Arg Asn Ser Ser Lys Asp Arg65 70 75
80Tyr Gly Arg Leu Ala Arg His Leu Ala Leu Pro Pro Thr Ala
Ser Met 85 90 95Arg Asp
Ile Leu Asp Lys Met Leu Ser Ala Gly Thr Pro Ile Pro Pro 100
105 110Asn Ile Val Ser Thr Gly Pro Cys Lys
Glu Asn Phe Leu Glu Glu Ser 115 120
125Gln Ile Asp Leu Thr Lys Leu Pro Ala Pro Leu Ile His Gln Ala Asp
130 135 140Gly Gly Lys Tyr Ile Gln Thr
Tyr Gly Met His Ile Val Gln Ser Pro145 150
155 160Asp Gly Ser Trp Thr Asn Trp Ser Ile Ala Arg Ala
Met Val Ser Asp 165 170
175Asp Lys His Leu Thr Gly Leu Val Ile Glu Pro Gln His Leu Trp Gln
180 185 190Ile His Gln Met Trp Lys
Lys Glu Gly Arg Asp Ala Pro Trp Ala Leu 195 200
205Ala Phe Gly Val Pro Pro Ala Ala Ile Met Ala Ser Ser Met
Pro Ile 210 215 220Pro Asp Gly Val Ser
Glu Ala Gly Tyr Val Gly Ser Met Thr Gly Ser225 230
235 240Ala Leu Asp Leu Val Lys Cys Asp Thr Asn
Asp Leu Tyr Val Pro Ala 245 250
255Thr Ser Glu Ile Val Phe Glu Gly Thr Leu Ser Ile Thr Glu Lys Gly
260 265 270Pro Glu Gly Pro Phe
Gly Glu Met His Gly Tyr Val Phe Pro Gly Asp 275
280 285Val His Leu Cys Pro Lys Tyr Lys Val Asn Arg Ile
Thr Tyr Arg Asn 290 295 300Asp Pro Ile
Met Pro Met Ser Ser Cys Gly Arg Leu Thr Asp Glu Thr305
310 315 320His Thr Met Ile Gly Ser Leu
Ala Ala Ala Val Ile Arg Lys Ile Cys 325
330 335Gln Gln Ala Gly Leu Pro Val Asn Asp Ala Phe Ala
Pro Phe Glu Ser 340 345 350Gln
Val Thr Trp Val Ala Leu Arg Ile Asp Thr Ala Lys Leu Arg Glu 355
360 365Met Lys Thr Thr Pro Lys Glu Phe Ser
Lys Lys Val Gly Glu Leu Ile 370 375
380Phe Asn Ser Lys Ala Gly Tyr Thr Ile His Arg Leu Val Leu Cys Gly385
390 395 400Asp Asp Ile Asp
Val Tyr Asn Gly Lys Asp Val Met Trp Ala Phe Ser 405
410 415Thr Arg Cys Arg Pro Asn Leu Asp Glu Ile
Phe Phe Glu Asp Val Pro 420 425
430Gly Phe Pro Leu Ile Pro Tyr Met Ser His Gly Asn Gly Ser Pro Val
435 440 445Lys Gly Gly Lys Val Val Ser
Asp Ala Leu Leu Pro Cys Glu Tyr Thr 450 455
460Thr Gly Lys Asn Trp Glu Ala Ala Asp Phe Glu Ser Ser Tyr Pro
Glu465 470 475 480Ala Val
Lys Gln Lys Val Leu Ala Asn Trp Thr Lys Met Gly Phe Arg
485 490 495Glu Glu60503PRTFusarium
oxysporumFusarium oxysporum f. sp. lycopersici 60Met Pro Ser Lys Thr Leu
Pro His Met Asp Phe Arg Ser Tyr Val Glu1 5
10 15Ala Leu Glu Ala Asp Gly Asp Leu Val Ser Ile Thr
Glu Glu Cys Asp 20 25 30Pro
His Leu Glu Val Gly Ala Ile Ile Arg Lys Val Val Glu Asn Asn 35
40 45Asp Lys Ala Pro Leu Phe Asn Lys Leu
Lys Gly Gln Asp Glu Asn Gly 50 55
60Phe Trp Arg Ile Leu Gly Ala Pro Asn Ser Leu Arg Ser Asp Pro Lys65
70 75 80Gln Arg Tyr Gly Arg
Leu Ala Arg His Leu Gly Leu Pro Thr Asp Ser 85
90 95Ser Met Lys Val Ile Leu Asp Lys Met Ile Ala
Ala Lys Thr Thr Pro 100 105
110Pro Ile Pro Pro Thr Val Val Glu Thr Gly Pro Cys Lys Glu His Ile
115 120 125Leu Thr Pro Asp Gln Phe Asp
Leu Thr Lys Leu Pro Ala Pro Leu Leu 130 135
140His Gln Ser Asp Gly Gly Lys Tyr Ile Gln Thr Tyr Gly Met His
Ile145 150 155 160Val Gln
Ser Pro Asp Gly Lys Trp Thr Asn Trp Ser Ile Ala Arg Ala
165 170 175Met Val Tyr Asp Arg Asn His
Leu Ala Gly Leu Val Ile Lys Pro Gln 180 185
190His Leu Tyr Gln Ile His Glu Met Trp Lys Lys Glu Gly Arg
Asp Met 195 200 205Pro Trp Ala Leu
Ala Phe Gly Val Pro Pro Ala Ala Ile Met Ala Ser 210
215 220Ser Met Pro Leu Pro Asp Gly Leu Ser Glu Ala Glu
Tyr Ile Gly Ser225 230 235
240Leu Val Gly Ser Ser Leu Asp Val Ile Lys Cys Glu Thr Asn Gly Leu
245 250 255Tyr Val Pro Ala Asn
Ser Glu Ile Val Phe Glu Gly Thr Cys Ser Ile 260
265 270Thr Glu Thr Ala Pro Glu Gly Pro Phe Gly Glu Met
His Gly Tyr Val 275 280 285Phe Pro
Gly Asp Ala His Pro Trp Pro Lys Tyr Thr Val Asp Leu Ile 290
295 300Thr His Arg Lys Asp Ala Ile Leu Pro Val Ser
Asn Cys Gly Arg Leu305 310 315
320Thr Asp Glu Thr His Thr Met Ile Gly Pro Leu Ala Ala Ala Glu Ile
325 330 335Gly Phe Leu Leu
Lys Ser Lys Gly Leu Pro Ile Lys Glu Ala Phe Ser 340
345 350Pro Phe Glu Ser Gln Val Thr Trp Val Ala Leu
Gln Val Asp Thr Gln 355 360 365Lys
Leu Arg Glu Met Lys Thr Thr Ser Glu Lys Phe Cys Arg Glu Ile 370
375 380Gly Asp Ile Ile Phe Asn His Lys Val Gly
Tyr Thr Ile His Arg Leu385 390 395
400Val Ile Val Gly Asp Asp Ile Asn Val Tyr Asp Phe Lys Asp Val
Ile 405 410 415Trp Ala Phe
Cys Thr Arg Cys Arg Pro Gly Thr Asp Glu Tyr Phe Phe 420
425 430Glu Asp Val Ala Gly Phe Pro Leu Ile Pro
Tyr Met Ser His Gly Asn 435 440
445Gly Ala Pro Asn Arg Gly Gly Lys Val Val Ser Asp Ser Leu Leu Pro 450
455 460Val Glu Tyr Thr Thr Gly Lys Asn
Trp Glu Ala Ala Asp Phe Glu Asn465 470
475 480Ser Phe Pro Glu Glu Ile Lys Asp Arg Val Cys Ser
Arg Trp Gln Thr 485 490
495Leu Gly Phe Ser Ser Ala Lys 50061503PRTSaccharomyces
kudriavzeviiSaccharomyces kudriavzevii (strain ATCC MYA- 4449) 61Met
Ser Ala Leu Asn Pro Ala Leu Gln Phe Arg Asp Phe Ile Gln Val1
5 10 15Leu Lys Asp Glu Asp Asp Leu
Ile Glu Ile Thr Lys Glu Val Asp Pro 20 25
30Asn Leu Glu Val Gly Ala Ile Met Arg Lys Ala Tyr Glu Ser
Lys Leu 35 40 45Pro Ala Pro Phe
Phe Lys Asn Ile Lys Gly Ala Ser Lys Asp Leu Phe 50 55
60Asn Ile Leu Gly Cys Pro Ala Gly Leu Arg Asn Lys Lys
Lys Gly Asp65 70 75
80His Gly Arg Ile Ala His His Leu Gly Leu Asp Pro Lys Thr Thr Ile
85 90 95Lys Glu Ile Ile Asp Tyr
Leu Leu Glu Cys Lys Asn Lys Lys Pro Leu 100
105 110Pro Pro Ser Ser Ile Ser Ala Ser Ser Ala Pro Cys
Lys Ala His Val 115 120 125Leu Ser
Glu Glu Glu Ile His Leu Glu Ser Leu Pro Thr Pro Tyr Leu 130
135 140His Thr Ser Asp Gly Gly Asn Tyr Leu Gln Thr
Tyr Gly Met Trp Ile145 150 155
160Leu Gln Thr Pro Asp Lys Lys Trp Thr Asn Trp Ser Ile Ala Arg Gly
165 170 175Met Val Val Asp
Asp Lys His Ile Thr Gly Leu Val Ile Lys Pro Gln 180
185 190His Ile Arg Gln Ile Ala Asp Ala Trp Gly Ala
Ile Gly Lys Gly Asn 195 200 205Lys
Ile Pro Phe Ala Leu Cys Phe Gly Val Pro Pro Ala Ala Ile Leu 210
215 220Val Ser Ser Met Pro Ile Pro Glu Gly Val
Ser Glu Ser Asp Tyr Val225 230 235
240Gly Ala Ile Leu Gly Lys Pro Val Pro Val Val Lys Cys Glu Thr
Asn 245 250 255Asp Leu Met
Val Pro Ala Thr Ser Glu Ile Val Phe Glu Gly Thr Leu 260
265 270Ser Leu Thr Asp Thr His Ala Glu Gly Pro
Phe Gly Glu Met His Gly 275 280
285Tyr Val Phe Gly Gly Gln Gly His Pro Cys Pro Leu Tyr Thr Val Lys 290
295 300Ala Met Thr His Arg Asp Asn Ala
Ile Leu Pro Val Ser Asn Pro Gly305 310
315 320Leu Cys Thr Asp Glu Thr His Thr Leu Ile Gly Ser
Leu Val Ala Thr 325 330
335Glu Ala Lys Glu Leu Ala Ile Lys Ser Gly Leu Pro Val Leu Asp Ala
340 345 350Phe Thr Pro Tyr Glu Ala
Gln Ala Leu Trp Leu Val Leu Lys Val Asp 355 360
365Leu Lys Arg Leu Gln Ala Leu Lys Thr Thr Pro Glu Glu Phe
Ser Lys 370 375 380Lys Val Gly Asp Ile
Tyr Phe Arg Thr Lys Val Gly Phe Ile Ile His385 390
395 400Glu Ile Val Leu Val Ala Asp Asp Ile Asp
Ile Phe Asn Phe Lys Glu 405 410
415Val Phe Trp Ala Tyr Val Thr Arg His Thr Pro Val Ala Asp Gln Thr
420 425 430Ala Phe Asp Asp Val
Thr Ser Phe Pro Leu Ala Pro Phe Val Ser Gln 435
440 445Ser Pro Arg Ser Lys Thr Met Lys Gly Gly Lys Cys
Val Thr Asn Cys 450 455 460Ile Phe Arg
Gln Gln Tyr Glu Arg Asp Phe Asp Tyr Val Thr Cys Ser465
470 475 480Phe Glu Lys Gly Tyr Ser Lys
Glu Leu Val Asp Arg Ile Asn Glu Asn 485
490 495Trp Arg Glu Tyr Gly Tyr Lys
50062503PRTSaccharomyces cerevisiaeSaccharomyces cerevisiae S288c 62Met
Arg Lys Leu Asn Pro Ala Leu Glu Phe Arg Asp Phe Ile Gln Val1
5 10 15Leu Lys Asp Glu Asp Asp Leu
Ile Glu Ile Thr Glu Glu Ile Asp Pro 20 25
30Asn Leu Glu Val Gly Ala Ile Met Arg Lys Ala Tyr Glu Ser
His Leu 35 40 45Pro Ala Pro Leu
Phe Lys Asn Leu Lys Gly Ala Ser Lys Asp Leu Phe 50 55
60Ser Ile Leu Gly Cys Pro Ala Gly Leu Arg Ser Lys Glu
Lys Gly Asp65 70 75
80His Gly Arg Ile Ala His His Leu Gly Leu Asp Pro Lys Thr Thr Ile
85 90 95Lys Glu Ile Ile Asp Tyr
Leu Leu Glu Cys Lys Glu Lys Glu Pro Leu 100
105 110Pro Pro Ile Thr Val Pro Val Ser Ser Ala Pro Cys
Lys Thr His Ile 115 120 125Leu Ser
Glu Glu Lys Ile His Leu Gln Ser Leu Pro Thr Pro Tyr Leu 130
135 140His Val Ser Asp Gly Gly Lys Tyr Leu Gln Thr
Tyr Gly Met Trp Ile145 150 155
160Leu Gln Thr Pro Asp Lys Lys Trp Thr Asn Trp Ser Ile Ala Arg Gly
165 170 175Met Val Val Asp
Asp Lys His Ile Thr Gly Leu Val Ile Lys Pro Gln 180
185 190His Ile Arg Gln Ile Ala Asp Ser Trp Ala Ala
Ile Gly Lys Ala Asn 195 200 205Glu
Ile Pro Phe Ala Leu Cys Phe Gly Val Pro Pro Ala Ala Ile Leu 210
215 220Val Ser Ser Met Pro Ile Pro Glu Gly Val
Ser Glu Ser Asp Tyr Val225 230 235
240Gly Ala Ile Leu Gly Glu Ser Val Pro Val Val Lys Cys Glu Thr
Asn 245 250 255Asp Leu Met
Val Pro Ala Thr Ser Glu Met Val Phe Glu Gly Thr Leu 260
265 270Ser Leu Thr Asp Thr His Leu Glu Gly Pro
Phe Gly Glu Met His Gly 275 280
285Tyr Val Phe Lys Ser Gln Gly His Pro Cys Pro Leu Tyr Thr Val Lys 290
295 300Ala Met Ser Tyr Arg Asp Asn Ala
Ile Leu Pro Val Ser Asn Pro Gly305 310
315 320Leu Cys Thr Asp Glu Thr His Thr Leu Ile Gly Ser
Leu Val Ala Thr 325 330
335Glu Ala Lys Glu Leu Ala Ile Glu Ser Gly Leu Pro Ile Leu Asp Ala
340 345 350Phe Met Pro Tyr Glu Ala
Gln Ala Leu Trp Leu Ile Leu Lys Val Asp 355 360
365Leu Lys Gly Leu Gln Ala Leu Lys Thr Thr Pro Glu Glu Phe
Cys Lys 370 375 380Lys Val Gly Asp Ile
Tyr Phe Arg Thr Lys Val Gly Phe Ile Val His385 390
395 400Glu Ile Ile Leu Val Ala Asp Asp Ile Asp
Ile Phe Asn Phe Lys Glu 405 410
415Val Ile Trp Ala Tyr Val Thr Arg His Thr Pro Val Ala Asp Gln Met
420 425 430Ala Phe Asp Asp Val
Thr Ser Phe Pro Leu Ala Pro Phe Val Ser Gln 435
440 445Ser Ser Arg Ser Lys Thr Met Lys Gly Gly Lys Cys
Val Thr Asn Cys 450 455 460Ile Phe Arg
Gln Gln Tyr Glu Arg Ser Phe Asp Tyr Ile Thr Cys Asn465
470 475 480Phe Glu Lys Gly Tyr Pro Lys
Gly Leu Val Asp Lys Val Asn Glu Asn 485
490 495Trp Lys Arg Tyr Gly Tyr Lys
50063503PRTAspergillus parasiticus 63Met Ala Ala Ile Ser Glu Val Asp His
Ser Phe Arg Ala Phe Val Glu1 5 10
15Ala Leu Lys Ala Asp Asp Asp Leu Val Glu Ile Asn Thr Glu Ile
Asp 20 25 30Ser Asn Leu Glu
Ala Ala Ala Ile Thr Arg Leu Val Cys Glu Thr Asp 35
40 45Asp Lys Ala Pro Leu Phe Asn Asn Leu Lys Gly Met
Gly Lys Asn Gly 50 55 60Leu Phe Arg
Ile Leu Gly Ala Pro Gly Ser Leu Arg Lys Ser Lys Arg65 70
75 80Asp Arg Tyr Gly Arg Leu Ala Arg
His Leu Ala Leu Pro Pro Thr Ala 85 90
95Ser Met Lys Glu Ile Leu Asp Lys Met Leu Ser Ala Ser Gln
Leu Pro 100 105 110Pro Ile Asp
Pro Lys Ile Val Glu Thr Gly Pro Val Lys Glu Asn Ser 115
120 125Leu Glu Gly Asp Glu Ile Asp Leu Thr Ala Leu
Pro Val Pro Met Val 130 135 140His Lys
Ser Asp Gly Gly Lys Tyr Leu Gln Thr Tyr Gly Met His Ile145
150 155 160Val Gln Ser Pro Asp Gly Lys
Trp Thr Asn Trp Ser Ile Ala Arg Ala 165
170 175Met Val Lys Asp Lys Asn His Leu Thr Gly Leu Val
Ile Glu Pro Gln 180 185 190His
Ile Trp Gln Ile His Gln Met Trp Lys Lys Glu Gly Lys Asp Val 195
200 205Pro Trp Ala Leu Cys Phe Gly Val Pro
Pro Ala Ala Ile Met Ala Ser 210 215
220Ser Met Pro Ile Pro Asp Gly Val Thr Glu Ala Gly Tyr Val Gly Ala225
230 235 240Met Thr Gly Arg
Ala Leu Glu Leu Val Lys Cys Asp Thr Asn His Leu 245
250 255Tyr Val Pro Ala Asn Ala Glu Ile Val Leu
Glu Gly Thr Leu Ser Ile 260 265
270Thr Glu Thr Ala Asp Glu Gly Pro Phe Gly Glu Met His Gly Tyr Val
275 280 285Phe Pro Gly Asp Ser His Lys
Cys Pro Val Tyr Lys Val Asn Lys Ile 290 295
300Thr Tyr Arg Thr Asp Ala Ile Leu Pro Met Ser Ala Cys Gly Arg
Leu305 310 315 320Thr Asp
Glu Thr His Thr Met Ile Gly Ser Leu Ala Ala Ala Glu Ile
325 330 335Arg Lys Ile Cys Gln Leu Ala
Gly Leu Pro Ile Thr Asp Thr Phe Ser 340 345
350Pro Phe Glu Ala Gln Val Thr Trp Val Ala Leu Lys Val Asp
Thr Ala 355 360 365Lys Leu Arg Gln
Met Asn Leu Thr Pro Lys Glu Leu Gln Lys Trp Val 370
375 380Gly Asp Val Val Phe Asn His Lys Ala Gly Tyr Thr
Ile His Arg Leu385 390 395
400Val Leu Val Gly Asp Asp Ile Asp Pro Tyr Glu Trp Lys Asp Val Met
405 410 415Trp Ala Phe Ala Thr
Arg Cys Arg Pro Asn Ala Asp Glu Met Phe Phe 420
425 430Glu Asp Val Arg Gly Phe Pro Leu Ile Pro Tyr Met
Gly His Gly Thr 435 440 445Gly Ser
Pro Thr Lys Gly Gly Lys Val Val Ser Asp Ala Leu Met Pro 450
455 460Thr Glu Tyr Thr Thr Gly Ala Asp Trp Glu Ala
Ala Asp Phe Glu His465 470 475
480Ser Tyr Pro Glu Glu Ile Lys Ala Lys Val Arg Ala Gln Trp Gln Ala
485 490 495Leu Gly Phe Arg
Lys Gln Glu 50064513PRTCandida albicans 64Met Ser Leu Asn Pro
Ala Leu Lys Phe Arg Asp Phe Ile Gln Val Leu1 5
10 15Lys Asn Glu Gly Asp Leu Val Glu Ile Asp Thr
Glu Val Asp Pro Asn 20 25
30Leu Glu Val Gly Ala Ile Thr Arg Lys Ala Tyr Glu Asn Lys Leu Ala
35 40 45Ala Pro Leu Phe Asn Asn Leu Lys
Gln Asp Pro Gly Asn Val Asp Pro 50 55
60Lys Asn Leu Phe Arg Ile Leu Gly Cys Pro Gly Gly Leu Arg Gly Phe65
70 75 80Gly Asn Asp His Ala
Arg Ile Ala Leu His Leu Gly Leu Asp Ser Gln 85
90 95Thr Pro Met Lys Glu Ile Val Asp Phe Leu Val
Ala Asn Arg Asn Pro 100 105
110Lys Lys Phe Ile Pro Pro Val Leu Val Pro Asn Glu Lys Ser Pro His
115 120 125Lys Lys His His Leu Thr His
Glu Gln Ile Asp Leu Thr Lys Leu Pro 130 135
140Val Pro Leu Leu His His Gly Asp Gly Gly Lys Phe Ile Gln Thr
Tyr145 150 155 160Gly Met
Trp Val Leu Gln Thr Pro Asp Lys Ser Trp Thr Asn Trp Ser
165 170 175Ile Ala Arg Gly Met Val His
Asp Ser Lys Ser Ile Thr Gly Leu Val 180 185
190Ile Asn Pro Gln His Val Lys Gln Val Ser Asp Ala Trp Val
Ala Ala 195 200 205Gly Lys Gly Asp
Lys Ile Pro Phe Ala Leu Cys Phe Gly Val Pro Pro 210
215 220Ala Ala Ile Leu Val Ser Ser Met Pro Ile Pro Asp
Gly Ala Thr Glu225 230 235
240Ala Glu Tyr Ile Gly Gly Leu Cys Asn Gln Ala Val Pro Val Val Lys
245 250 255Cys Glu Thr Asn Asp
Leu Glu Val Pro Ala Asp Cys Glu Met Val Phe 260
265 270Glu Gly Tyr Leu Asp Arg Asp Thr Leu Val Thr Glu
Gly Pro Phe Gly 275 280 285Glu Met
His Gly Tyr Cys Phe Pro Gln Asp His His Thr Gln Pro Leu 290
295 300Tyr Arg Val Asn His Ile Ser Tyr Arg Asp Glu
Ala Ile Met Pro Ile305 310 315
320Ser Asn Pro Gly Leu Cys Thr Asp Glu Thr His Thr Leu Ile Gly Gly
325 330 335Leu Val Ser Ala
Glu Thr Lys Tyr Leu Ile Ser Gln His Leu Val Leu 340
345 350Ser Lys Ile Val Glu Asp Val Phe Thr Pro Tyr
Glu Ala Gln Ala Leu 355 360 365Trp
Leu Ala Val Lys Ile Asn Ile Gln Glu Leu Ile Lys Leu Lys Thr 370
375 380Asn Ala Lys Glu Leu Ser Asn Leu Val Gly
Asp Phe Leu Phe Lys Ser385 390 395
400Lys Glu Cys Tyr Lys Val Cys Ser Ile Leu His Glu Val Ile Leu
Val 405 410 415Gly Asp Asp
Ile Asp Ile Phe Asp Phe Lys Gln Leu Ile Trp Ala Tyr 420
425 430Thr Thr Arg His Thr Pro Val Gln Asp Gln
Val Tyr Phe Asp Asp Val 435 440
445Lys Pro Phe Pro Leu Ala Pro Phe Ile Ser Gln Gly Ser Leu Ile Lys 450
455 460Thr Arg Gln Gly Gly Lys Cys Val
Thr Ser Cys Ile Phe Pro Lys Gln465 470
475 480Phe Thr Asp Pro Asp Phe Lys Phe Val Thr Cys Asn
Phe Asp Gly Tyr 485 490
495Pro Glu Glu Val Lys Asn Lys Val Ser Gln Asn Trp Glu Lys Tyr Tyr
500 505 510Lys65500PRTGrosmannia
clavigeraGrosmannia clavigera kw1407 65Met Ala Ser Ser Gln Asp Leu Pro
His Met Ser Phe Arg Ala Phe Val1 5 10
15Asp Glu Leu Arg Ala Asp Gly Asp Ile Val Glu Ile Asn Asp
Glu Cys 20 25 30Asp Ala Asp
Leu Glu Val Gly Ala Ile Ile Arg Leu Ala Cys Glu Thr 35
40 45Asp Ala Lys Ala Pro Leu Phe Asn Lys Leu Lys
Gly Met Asp Gly Asn 50 55 60Gly Leu
Trp Arg Ile Leu Gly Ala Pro Asn Ser Leu Arg Ala Asp Pro65
70 75 80Ala Gln Arg Phe Gly Arg Leu
Ala Arg His Ile Asn Leu Pro Pro Thr 85 90
95Ala Ser Met Lys Glu Ile Leu Asp Lys Met Gly Ala Ala
Lys Ser Thr 100 105 110Pro Pro
Ile Pro Pro Lys Thr Val Pro Thr Gly Ser Cys Lys Glu Val 115
120 125Lys Leu Thr Pro Asp Gln Phe Asp Leu Thr
Thr Leu Pro Ser Pro Gln 130 135 140Leu
His Lys Ser Asp Gly Gly Lys Tyr Val Gln Thr Tyr Gly Met His145
150 155 160Ile Val Gln Thr Pro Asp
Gly Lys Trp Thr Asn Trp Ser Ile Ala Arg 165
170 175Ala Met Val His Asp Arg Asn His Leu Val Gly Leu
Val Ile Pro Pro 180 185 190Gln
His Ile Trp Lys Val Gln Gln Glu Trp Lys Lys Ile Gly Lys Asp 195
200 205Met Pro Trp Ala Leu Val Phe Gly Val
Pro Pro Ala Ala Ile Met Ala 210 215
220Ala Ser Met Pro Leu Pro Asp Gly Leu Ser Glu Ala Glu Tyr Ile Gly225
230 235 240Ser Leu Val Gly
Thr Ala Leu Glu Val Thr Lys Cys Asp Thr Asn Asp 245
250 255Leu Leu Val Pro Ala Asn Ser Glu Ile Val
Phe Glu Gly Phe Met Ser 260 265
270Ser Thr Glu Thr Ala Pro Glu Gly Pro Phe Gly Glu Met His Gly Tyr
275 280 285Val Phe Pro Gly Asp Ala His
Pro Gln Pro Leu Tyr Thr Val Asn Met 290 295
300Ile Thr His Arg Lys Asp Ala Ile Leu Pro Val Ser Asn Cys Gly
Arg305 310 315 320Leu Thr
Asp Glu Thr His Thr Met Ile Gly Pro Leu Val Ala Val Glu
325 330 335Ile Asn Val Met Leu Lys Ala
Ala Gly Leu Pro Ile Thr Asp Ala Tyr 340 345
350Thr Pro Phe Glu Ser Gln Val Thr Trp Cys Ala Val Lys Val
Asp Thr 355 360 365Ala Lys Leu Arg
Glu Leu Lys Thr Thr Pro Lys Glu Phe Cys Arg Lys 370
375 380Ile Gly Asp Leu Ile Phe Asn Thr Lys Val Gly Ser
Thr Ile His Arg385 390 395
400Ile Ala Val Val Gly Asp Asp Ile Asp Ile Phe Asn Phe Lys Asp Val
405 410 415Ile Trp Ala Phe Cys
Thr Arg Cys Arg Pro Gly Met Asp Glu Tyr Leu 420
425 430Phe Glu Asp Val Pro Gly Phe Pro Leu Ile Pro Tyr
Met Ser His Gly 435 440 445Asn Gly
Pro Ala Asn Arg Gly Gly Lys Val Val Ser Asp Cys Leu Leu 450
455 460Pro Lys Glu Tyr Thr Thr Gly Lys Asn Trp Glu
Ala Ala Ser Phe Lys465 470 475
480Glu Ser Ile Pro Glu Ser Val Gln Ala Lys Val Leu Gly Asn Trp Lys
485 490 495Ala Trp Gly Phe
50066490PRTAspergillus terreus 66Met Thr Lys Gln Ser Ala Asp Ser
Asn Ala Lys Ser Gly Val Thr Ser1 5 10
15Glu Ile Cys His Trp Ala Ser Asn Leu Ala Thr Asp Asp Ile
Pro Ser 20 25 30Asp Val Leu
Glu Arg Ala Lys Tyr Leu Ile Leu Asp Gly Ile Ala Cys 35
40 45Ala Trp Val Gly Ala Arg Val Pro Trp Ser Glu
Lys Tyr Val Gln Ala 50 55 60Thr Met
Ser Phe Glu Pro Pro Gly Ala Cys Arg Val Ile Gly Tyr Gly65
70 75 80Gln Lys Leu Gly Pro Val Ala
Ala Ala Met Thr Asn Ser Ala Phe Ile 85 90
95Gln Ala Thr Glu Leu Asp Asp Tyr His Ser Glu Ala Pro
Leu His Ser 100 105 110Ala Ser
Ile Val Leu Pro Ala Val Phe Ala Ala Ser Glu Val Leu Ala 115
120 125Glu Gln Gly Lys Thr Ile Ser Gly Ile Asp
Val Ile Leu Ala Ala Ile 130 135 140Val
Gly Phe Glu Ser Gly Pro Arg Ile Gly Lys Ala Ile Tyr Gly Ser145
150 155 160Asp Leu Leu Asn Asn Gly
Trp His Cys Gly Ala Val Tyr Gly Ala Pro 165
170 175Ala Gly Ala Leu Ala Thr Gly Lys Leu Leu Gly Leu
Thr Pro Asp Ser 180 185 190Met
Glu Asp Ala Leu Gly Ile Ala Cys Thr Gln Ala Cys Gly Leu Met 195
200 205Ser Ala Gln Tyr Gly Gly Met Val Lys
Arg Val Gln His Gly Phe Ala 210 215
220Ala Arg Asn Gly Leu Leu Gly Gly Leu Leu Ala His Gly Gly Tyr Glu225
230 235 240Ala Met Lys Gly
Val Leu Glu Arg Ser Tyr Gly Gly Phe Leu Lys Met 245
250 255Phe Thr Lys Gly Asn Gly Arg Glu Pro Pro
Tyr Lys Glu Glu Glu Val 260 265
270Val Ala Gly Leu Gly Ser Phe Trp His Thr Phe Thr Ile Arg Ile Lys
275 280 285Leu Tyr Ala Cys Cys Gly Leu
Val His Gly Pro Val Glu Ala Ile Glu 290 295
300Asn Leu Gln Gly Arg Tyr Pro Glu Leu Leu Asn Arg Ala Asn Leu
Ser305 310 315 320Asn Ile
Arg His Val His Val Gln Leu Ser Thr Ala Ser Asn Ser His
325 330 335Cys Gly Trp Ile Pro Glu Glu
Arg Pro Ile Ser Ser Ile Ala Gly Gln 340 345
350Met Ser Val Ala Tyr Ile Leu Ala Val Gln Leu Val Asp Gln
Gln Cys 355 360 365Leu Leu Ser Gln
Phe Ser Glu Phe Asp Asp Asn Leu Glu Arg Pro Glu 370
375 380Val Trp Asp Leu Ala Arg Lys Val Thr Ser Ser Gln
Ser Glu Glu Phe385 390 395
400Asp Gln Asp Gly Asn Cys Leu Ser Ala Gly Arg Val Arg Ile Glu Phe
405 410 415Asn Asp Gly Ser Ser
Ile Thr Glu Ser Val Glu Lys Pro Leu Gly Val 420
425 430Lys Glu Pro Met Pro Asn Glu Arg Ile Leu His Lys
Tyr Arg Thr Leu 435 440 445Ala Gly
Ser Val Thr Asp Glu Ser Arg Val Lys Glu Ile Glu Asp Leu 450
455 460Val Leu Gly Leu Asp Arg Leu Thr Asp Ile Ser
Pro Leu Leu Glu Leu465 470 475
480Leu Asn Cys Pro Val Lys Ser Pro Leu Val 485
49067649PRTPseudomonas amygdaliPseudomonas amygdali pv. tabaci
str. ATCC 11528 67Met Ser Thr Pro Glu Leu Thr Thr Leu Leu Ile Ala Asn Arg
Gly Glu1 5 10 15Ile Ala
Cys Arg Ile Met Arg Thr Ala Lys Thr Met Gly Leu Thr Thr 20
25 30Val Ala Val His Ser Ala Ile Asp Arg
Asp Ala Arg His Ser Arg Glu 35 40
45Ala Asp Ile Arg Val Asp Leu Gly Gly Ser Lys Ala Ala Glu Ser Tyr 50
55 60Leu Ala Ile Asp Lys Leu Ile Asp Ala
Ala Arg Ala Ser Gly Ala Gln65 70 75
80Ala Ile His Pro Gly Tyr Gly Phe Leu Ser Glu Asn Ala Asp
Phe Ala 85 90 95Arg Ala
Ile Glu Glu Ala Gly Leu Ile Phe Leu Gly Pro Pro Ala Ser 100
105 110Ala Ile Asp Ala Met Gly Ser Lys Ser
Ala Ala Lys Ser Leu Met Glu 115 120
125Gln Ala Gly Val Pro Leu Val Pro Gly Tyr His Gly Asp Ala Gln Asp
130 135 140Ile Glu Thr Phe Arg Ser Ala
Ala Glu Arg Ile Gly Tyr Pro Val Leu145 150
155 160Leu Lys Ala Thr Ala Gly Gly Gly Gly Lys Gly Met
Lys Val Val Glu 165 170
175His Ser Gly Glu Leu Ala Glu Ala Leu Ala Ser Ala Gln Arg Glu Ala
180 185 190Leu Ser Ser Phe Gly Asp
Ala Arg Met Leu Val Glu Lys Tyr Val Leu 195 200
205Thr Pro Arg His Val Glu Ile Gln Val Phe Ala Asp Arg His
Gly His 210 215 220Cys Leu Tyr Leu Asn
Glu Arg Asp Cys Ser Ile Gln Arg Arg His Gln225 230
235 240Lys Val Val Glu Glu Ala Pro Ala Pro Gly
Leu Thr Pro Glu Leu Arg 245 250
255Lys Ala Met Gly Glu Ala Ala Val Lys Ala Ala Gln Ala Ile Gly Tyr
260 265 270Val Gly Ala Gly Thr
Val Glu Phe Leu Leu Asp Ala Arg Gly Glu Phe 275
280 285Phe Phe Met Glu Met Asn Thr Arg Leu Gln Val Glu
His Pro Val Thr 290 295 300Glu Tyr Ile
Thr Gly Leu Asp Leu Val Glu Trp Gln Ile Arg Val Ala305
310 315 320Arg Gly Glu Pro Leu Pro Ile
Thr Gln Glu Gln Val Pro Leu Ile Gly 325
330 335His Ala Ile Glu Val Arg Leu Tyr Ala Glu Asp Pro
Ala Asn Asp Phe 340 345 350Leu
Pro Ala Thr Gly Thr Leu Glu Leu Tyr Arg Glu Ser Ala Ser Gly 355
360 365Pro Gly Lys Arg Val Asp Ser Gly Val
Ser Glu Gly Asp Asn Ile Ser 370 375
380Pro Phe Tyr Asp Pro Met Leu Gly Lys Leu Ile Ala Trp Gly Glu Asn385
390 395 400Arg Glu Gln Ala
Arg Leu Arg Leu Leu Ala Met Leu Asp Glu Phe Ala 405
410 415Val Gly Gly Val Arg Thr Asn Leu Ala Phe
Leu Arg Arg Ile Ile Ala 420 425
430His Pro Ala Phe Ala Ala Ala Glu Leu Asp Thr Gly Phe Ile Pro Arg
435 440 445Tyr Gln Asp Lys Leu Leu Pro
Gln Thr Gly Glu Leu Cys Glu Glu Leu 450 455
460Trp Gln Ala Ala Ala Glu Ala Phe Ser Gln Ser Glu Pro Ala Arg
Val465 470 475 480Asp Gln
Ala Asp Leu His Ser Pro Trp Ala Val Thr Ala Gly Phe Arg
485 490 495Ala Gly Leu Pro Ala Glu Arg
Asp Leu Arg Leu Ser Cys Asn Gly Gln 500 505
510Thr Arg Thr Val Tyr Leu Arg Asn Ser Ser Asp Ser Pro Phe
Lys Leu 515 520 525Ser Asn Glu His
Leu Thr Val Glu His Asn Gly Val Arg Arg Ser His 530
535 540Leu Ala Ile Arg Arg Gly Gly Thr Leu Tyr Leu Lys
Trp Gln Gly Asp545 550 555
560Leu His Thr Ile Thr Arg Leu Asp Pro Ile Ala Gln Ala Asp Val Ser
565 570 575Asp Ser Gln His Gly
Gly Leu Thr Ala Pro Met Asn Gly Ser Ile Val 580
585 590Arg Val Leu Val Glu Val Gly Gln Ala Val Glu Ser
Gly Ala Gln Leu 595 600 605Met Val
Leu Glu Ala Met Lys Met Glu His Ser Ile Arg Ala Ala Ser 610
615 620Ala Gly Val Val Thr Ala Leu Tyr Cys His Glu
Gly Glu Met Val Asn625 630 635
640Glu Gly Ala Val Leu Val Glu Leu Thr
64568325PRTAspergillus clavatus 68Met Ala Lys Ile Asp Val His His His Phe
Tyr Pro Gln Ala Met Arg1 5 10
15Glu Ala Leu Glu Arg Ala Gly Gly Asp Pro Ser Gly Trp Tyr Ile Pro
20 25 30Pro Trp Thr Leu Asp Leu
Asp Lys Glu Ile Ser Arg Val Leu Lys Val 35 40
45Gln Thr Thr Ile Leu Ser Val Thr Ala Pro Gly Pro Gly Ile
Glu Thr 50 55 60Asp Pro Gly Lys Ala
Ala Ala Leu Ala Arg Leu Cys Asn Glu Glu Ala65 70
75 80Ala Ala Ile Arg Asp Ala His Pro Leu Gln
Tyr Gly Phe Phe Ala Ser 85 90
95Val Pro Ser Leu Phe Asp Thr Ala Ala Val Leu Ala Glu Ile Glu His
100 105 110Ala Phe Thr Asn Leu
His Ala Asp Gly Val Thr Leu Tyr Thr Arg Tyr 115
120 125Gly Ala Gly His Ser Tyr Leu Gly Asp Glu Arg Phe
Arg Pro Val Trp 130 135 140Ala Glu Leu
Ser Lys Arg Arg Ala Val Val Phe Ile His Pro Thr His145
150 155 160Ala Val Asp Thr Gln Leu Ile
Asn Ser Trp Met Pro Gln Pro Met Phe 165
170 175Asp Tyr Pro His Glu Thr Gly Arg Thr Ala Met Asp
Leu Leu Thr Arg 180 185 190Gly
Val Ile Arg Asp Tyr Pro Gly Cys Lys Ile Ile Leu Ser His Ala 195
200 205Gly Gly Thr Leu Pro Tyr Leu Ile His
Arg Ala Ala Thr Met Leu Pro 210 215
220Phe Met Pro Arg Asn Leu Gly Met Ser Arg Glu Glu Ile Val Glu Ala225
230 235 240Ala Arg Thr Leu
Tyr Phe Asp Thr Ala Ile Ser Ala Asn Pro Val Thr 245
250 255Leu Lys Ala Leu Leu Glu Phe Ala Lys Pro
Gly His Val Leu Phe Gly 260 265
270Ser Asp Phe Pro Asn Ala Pro Arg Gly Ala Ile Thr His Phe Thr Ser
275 280 285Phe Leu Glu Gly Tyr Asp Asn
Met Ser Glu Glu Thr Arg Arg Leu Val 290 295
300Glu Arg Glu Ala Ala Leu Glu Leu Phe Pro Arg Leu Arg Gly Gln
Ser305 310 315 320Thr Arg
Ala Cys Leu 32569267PRTGeobacillus stearothermophilus
69Met Ala Leu Thr Val Lys Val Ser Leu Tyr Arg Lys Phe Ala Glu Leu1
5 10 15Leu Asn Glu Ala Glu Arg
Glu Lys Arg Glu Val Ala Arg Ile Thr Glu 20 25
30Glu Val Pro Asp Leu Ser Ala Glu Glu Ala Tyr Lys Ile
Gln Glu Glu 35 40 45Leu Ile Lys
Ile Lys Thr Asn Ser Gly His Arg Ile Ile Gly Pro Lys 50
55 60Met Gly Leu Thr Ser Gln Ala Lys Met Ala Gln Met
Lys Val Lys Glu65 70 75
80Pro Ile Tyr Gly Tyr Leu Phe Asp Tyr Met Phe Val Pro Ser Gly Gly
85 90 95Ala Ile His Met Ser Glu
Leu Ile His Pro Lys Val Glu Val Glu Ile 100
105 110Ala Phe Ile Leu Gly Glu Asp Leu Glu Gly Pro His
Val Thr Ser Thr 115 120 125Gln Val
Leu Ser Ala Thr Lys Tyr Val Ala Pro Ala Leu Glu Ile Ile 130
135 140Asp Ser Arg Tyr Gln Asp Phe Thr Phe Thr Leu
Pro Asp Val Ile Ala145 150 155
160Asp Asn Ala Ser Ser Ser Arg Val Val Ile Gly Asn Thr Met Thr Pro
165 170 175Ile His Ser Leu
Lys Thr Asp Leu Asp Leu Ile Gly Ala Ala Leu Tyr 180
185 190Ile Asn Gly Glu Leu Lys Ala Cys Gly Ala Gly
Ala Ala Val Phe Asn 195 200 205His
Pro Ala Asn Ser Val Ala Val Leu Ala Asn Met Leu Ala Arg Lys 210
215 220Gly Glu Arg Leu Lys Ala Gly Asp Ile Ile
Leu Thr Gly Gly Ile Thr225 230 235
240Glu Ala Ile Gln Leu Ser Ala Gly Asp Thr Val Ile Gly Gln Leu
Asp 245 250 255Gln Leu Gly
Asp Val Ser Leu Ser Val Lys Glu 260
26570429PRTSalmonella entericaSalmonella enterica subsp. enterica serovar
Dublin 70Met Lys Gly Thr Val Phe Ala Val Ala Leu Asn His Arg Ser Gln
Leu1 5 10 15Asp Ala Trp
Gln Glu Ala Phe Ser Gln Pro Pro Tyr Asn Ala Pro Pro 20
25 30Lys Thr Ala Val Trp Phe Ile Lys Pro Arg
Asn Thr Val Ile Arg His 35 40
45Gly Glu Pro Ile Leu Tyr Pro Gln Gly Glu Lys Val Leu Ser Gly Ala 50
55 60Thr Val Ala Leu Ile Val Gly Lys Thr
Ala Ser Arg Lys Arg Ser Glu65 70 75
80Ala Ala Ala Glu Tyr Ile Ala Gly Tyr Ala Leu Ala Asn Glu
Val Ser 85 90 95Leu Pro
Glu Glu Ser Phe Tyr Arg Pro Ala Ile Lys Ala Lys Cys Arg 100
105 110Asp Gly Phe Cys Pro Leu Gly Glu Met
Ala Pro Leu Ser Asp Val Asp 115 120
125Asn Leu Thr Ile Ile Thr Glu Ile Asn Gly Arg Glu Ala Asp His Trp
130 135 140Asn Thr Ala Asp Leu Gln Arg
Ser Ala Ala Gln Leu Leu Ser Ala Leu145 150
155 160Ser Glu Phe Ala Thr Leu Asn Pro Gly Asp Ala Ile
Leu Leu Gly Thr 165 170
175Pro Gln Asn Arg Val Ala Leu Arg Pro Gly Asp Arg Val Arg Ile Leu
180 185 190Ala Lys Gly Leu Pro Ala
Leu Glu Asn Pro Val Val Ala Glu Asp Glu 195 200
205Phe Ala Arg Asn Gln Thr Phe Thr Trp Pro Leu Ser Ala Thr
Gly Thr 210 215 220Leu Phe Ala Leu Gly
Leu Asn Tyr Ala Asp His Ala Ser Glu Leu Ala225 230
235 240Phe Thr Pro Pro Lys Glu Pro Leu Val Phe
Ile Lys Ala Pro Asn Thr 245 250
255Phe Thr Glu His His Gln Thr Ser Val Arg Pro Asn Asn Val Glu Tyr
260 265 270Met His Tyr Glu Ala
Glu Leu Val Val Val Ile Gly Lys Thr Ala Arg 275
280 285Lys Val Ser Glu Ala Glu Ala Met Glu Tyr Val Ala
Gly Tyr Thr Val 290 295 300Cys Asn Asp
Tyr Ala Ile Arg Asp Tyr Leu Glu Asn Tyr Tyr Arg Pro305
310 315 320Asn Leu Arg Val Lys Ser Arg
Asp Gly Leu Thr Pro Ile Gly Pro Trp 325
330 335Ile Val Asp Lys Glu Ala Val Ser Asp Pro His Asn
Leu Thr Leu Arg 340 345 350Thr
Phe Val Asn Gly Glu Leu Arg Gln Glu Gly Thr Thr Ala Asp Leu 355
360 365Ile Phe Ser Ile Pro Phe Leu Ile Ser
Tyr Leu Ser Glu Phe Met Thr 370 375
380Leu Gln Pro Gly Asp Met Ile Ala Thr Gly Thr Pro Lys Gly Leu Ser385
390 395 400Asp Val Val Pro
Gly Asp Glu Val Val Leu Glu Ile Lys Gly Val Gly 405
410 415Arg Leu Val Asn Gln Ile Val Cys Glu Glu
Ser Ala Asn 420 42571891PRTEscherichia
coliEscherichia coli K-12 71Met Ser Ser Thr Leu Arg Glu Ala Ser Lys Asp
Thr Leu Gln Ala Lys1 5 10
15Asp Lys Thr Tyr His Tyr Tyr Ser Leu Pro Leu Ala Ala Lys Ser Leu
20 25 30Gly Asp Ile Thr Arg Leu Pro
Lys Ser Leu Lys Val Leu Leu Glu Asn 35 40
45Leu Leu Arg Trp Gln Asp Gly Asn Ser Val Thr Glu Glu Asp Ile
His 50 55 60Ala Leu Ala Gly Trp Leu
Lys Asn Ala His Ala Asp Arg Glu Ile Ala65 70
75 80Tyr Arg Pro Ala Arg Val Leu Met Gln Asp Phe
Thr Gly Val Pro Ala 85 90
95Val Val Asp Leu Ala Ala Met Arg Glu Ala Val Lys Arg Leu Gly Gly
100 105 110Asp Thr Ala Lys Val Asn
Pro Leu Ser Pro Val Asp Leu Val Ile Asp 115 120
125His Ser Val Thr Val Asp Arg Phe Gly Asp Asp Glu Ala Phe
Glu Glu 130 135 140Asn Val Arg Leu Glu
Met Glu Arg Asn His Glu Arg Tyr Val Phe Leu145 150
155 160Lys Trp Gly Lys Gln Ala Phe Ser Arg Phe
Ser Val Val Pro Pro Gly 165 170
175Thr Gly Ile Cys His Gln Val Asn Leu Glu Tyr Leu Gly Lys Ala Val
180 185 190Trp Ser Glu Leu Gln
Asp Gly Glu Trp Ile Ala Tyr Pro Asp Thr Leu 195
200 205Val Gly Thr Asp Ser His Thr Thr Met Ile Asn Gly
Leu Gly Val Leu 210 215 220Gly Trp Gly
Val Gly Gly Ile Glu Ala Glu Ala Ala Met Leu Gly Gln225
230 235 240Pro Val Ser Met Leu Ile Pro
Asp Val Val Gly Phe Lys Leu Thr Gly 245
250 255Lys Leu Arg Glu Gly Ile Thr Ala Thr Asp Leu Val
Leu Thr Val Thr 260 265 270Gln
Met Leu Arg Lys His Gly Val Val Gly Lys Phe Val Glu Phe Tyr 275
280 285Gly Asp Gly Leu Asp Ser Leu Pro Leu
Ala Asp Arg Ala Thr Ile Ala 290 295
300Asn Met Ser Pro Glu Tyr Gly Ala Thr Cys Gly Phe Phe Pro Ile Asp305
310 315 320Ala Val Thr Leu
Asp Tyr Met Arg Leu Ser Gly Arg Ser Glu Asp Gln 325
330 335Val Glu Leu Val Glu Lys Tyr Ala Lys Ala
Gln Gly Met Trp Arg Asn 340 345
350Pro Gly Asp Glu Pro Ile Phe Thr Ser Thr Leu Glu Leu Asp Met Asn
355 360 365Asp Val Glu Ala Ser Leu Ala
Gly Pro Lys Arg Pro Gln Asp Arg Val 370 375
380Ala Leu Pro Asp Val Pro Lys Ala Phe Ala Ala Ser Asn Glu Leu
Glu385 390 395 400Val Asn
Ala Thr His Lys Asp Arg Gln Pro Val Asp Tyr Val Met Asn
405 410 415Gly His Gln Tyr Gln Leu Pro
Asp Gly Ala Val Val Ile Ala Ala Ile 420 425
430Thr Ser Cys Thr Asn Thr Ser Asn Pro Ser Val Leu Met Ala
Ala Gly 435 440 445Leu Leu Ala Lys
Lys Ala Val Thr Leu Gly Leu Lys Arg Gln Pro Trp 450
455 460Val Lys Ala Ser Leu Ala Pro Gly Ser Lys Val Val
Ser Asp Tyr Leu465 470 475
480Ala Lys Ala Lys Leu Thr Pro Tyr Leu Asp Glu Leu Gly Phe Asn Leu
485 490 495Val Gly Tyr Gly Cys
Thr Thr Cys Ile Gly Asn Ser Gly Pro Leu Pro 500
505 510Asp Pro Ile Glu Thr Ala Ile Lys Lys Ser Asp Leu
Thr Val Gly Ala 515 520 525Val Leu
Ser Gly Asn Arg Asn Phe Glu Gly Arg Ile His Pro Leu Val 530
535 540Lys Thr Asn Trp Leu Ala Ser Pro Pro Leu Val
Val Ala Tyr Ala Leu545 550 555
560Ala Gly Asn Met Asn Ile Asn Leu Ala Ser Glu Pro Ile Gly His Asp
565 570 575Arg Lys Gly Asp
Pro Val Tyr Leu Lys Asp Ile Trp Pro Ser Ala Gln 580
585 590Glu Ile Ala Arg Ala Val Glu Gln Val Ser Thr
Glu Met Phe Arg Lys 595 600 605Glu
Tyr Ala Glu Val Phe Glu Gly Thr Ala Glu Trp Lys Gly Ile Asn 610
615 620Val Thr Arg Ser Asp Thr Tyr Gly Trp Gln
Glu Asp Ser Thr Tyr Ile625 630 635
640Arg Leu Ser Pro Phe Phe Asp Glu Met Gln Ala Thr Pro Ala Pro
Val 645 650 655Glu Asp Ile
His Gly Ala Arg Ile Leu Ala Met Leu Gly Asp Ser Val 660
665 670Thr Thr Asp His Ile Ser Pro Ala Gly Ser
Ile Lys Pro Asp Ser Pro 675 680
685Ala Gly Arg Tyr Leu Gln Gly Arg Gly Val Glu Arg Lys Asp Phe Asn 690
695 700Ser Tyr Gly Ser Arg Arg Gly Asn
His Glu Val Met Met Arg Gly Thr705 710
715 720Phe Ala Asn Ile Arg Ile Arg Asn Glu Met Val Pro
Gly Val Glu Gly 725 730
735Gly Met Thr Arg His Leu Pro Asp Ser Asp Val Val Ser Ile Tyr Asp
740 745 750Ala Ala Met Arg Tyr Lys
Gln Glu Gln Thr Pro Leu Ala Val Ile Ala 755 760
765Gly Lys Glu Tyr Gly Ser Gly Ser Ser Arg Asp Trp Ala Ala
Lys Gly 770 775 780Pro Arg Leu Leu Gly
Ile Arg Val Val Ile Ala Glu Ser Phe Glu Arg785 790
795 800Ile His Arg Ser Asn Leu Ile Gly Met Gly
Ile Leu Pro Leu Glu Phe 805 810
815Pro Gln Gly Val Thr Arg Lys Thr Leu Gly Leu Thr Gly Glu Glu Lys
820 825 830Ile Asp Ile Gly Asp
Leu Gln Asn Leu Gln Pro Gly Ala Thr Val Pro 835
840 845Val Thr Leu Thr Arg Ala Asp Gly Ser Gln Glu Val
Val Pro Cys Arg 850 855 860Cys Arg Ile
Asp Thr Ala Thr Glu Leu Thr Tyr Tyr Gln Asn Asp Gly865
870 875 880Ile Leu His Tyr Val Ile Arg
Asn Met Leu Lys 885 89072467PRTEscherichia
coliEscherichia coli K-12 72Met Asn Thr Val Arg Ser Glu Lys Asp Ser Met
Gly Ala Ile Asp Val1 5 10
15Pro Ala Asp Lys Leu Trp Gly Ala Gln Thr Gln Arg Ser Leu Glu His
20 25 30Phe Arg Ile Ser Thr Glu Lys
Met Pro Thr Ser Leu Ile His Ala Leu 35 40
45Ala Leu Thr Lys Arg Ala Ala Ala Lys Val Asn Glu Asp Leu Gly
Leu 50 55 60Leu Ser Glu Glu Lys Ala
Ser Ala Ile Arg Gln Ala Ala Asp Glu Val65 70
75 80Leu Ala Gly Gln His Asp Asp Glu Phe Pro Leu
Ala Ile Trp Gln Thr 85 90
95Gly Ser Gly Thr Gln Ser Asn Met Asn Met Asn Glu Val Leu Ala Asn
100 105 110Arg Ala Ser Glu Leu Leu
Gly Gly Val Arg Gly Met Glu Arg Lys Val 115 120
125His Pro Asn Asp Asp Val Asn Lys Ser Gln Ser Ser Asn Asp
Val Phe 130 135 140Pro Thr Ala Met His
Val Ala Ala Leu Leu Ala Leu Arg Lys Gln Leu145 150
155 160Ile Pro Gln Leu Lys Thr Leu Thr Gln Thr
Leu Asn Glu Lys Ser Arg 165 170
175Ala Phe Ala Asp Ile Val Lys Ile Gly Arg Thr His Leu Gln Asp Ala
180 185 190Thr Pro Leu Thr Leu
Gly Gln Glu Ile Ser Gly Trp Val Ala Met Leu 195
200 205Glu His Asn Leu Lys His Ile Glu Tyr Ser Leu Pro
His Val Ala Glu 210 215 220Leu Ala Leu
Gly Gly Thr Ala Val Gly Thr Gly Leu Asn Thr His Pro225
230 235 240Glu Tyr Ala Arg Arg Val Ala
Asp Glu Leu Ala Val Ile Thr Cys Ala 245
250 255Pro Phe Val Thr Ala Pro Asn Lys Phe Glu Ala Leu
Ala Thr Cys Asp 260 265 270Ala
Leu Val Gln Ala His Gly Ala Leu Lys Gly Leu Ala Ala Ser Leu 275
280 285Met Lys Ile Ala Asn Asp Val Arg Trp
Leu Ala Ser Gly Pro Arg Cys 290 295
300Gly Ile Gly Glu Ile Ser Ile Pro Glu Asn Glu Pro Gly Ser Ser Ile305
310 315 320Met Pro Gly Lys
Val Asn Pro Thr Gln Cys Glu Ala Leu Thr Met Leu 325
330 335Cys Cys Gln Val Met Gly Asn Asp Val Ala
Ile Asn Met Gly Gly Ala 340 345
350Ser Gly Asn Phe Glu Leu Asn Val Phe Arg Pro Met Val Ile His Asn
355 360 365Phe Leu Gln Ser Val Arg Leu
Leu Ala Asp Gly Met Glu Ser Phe Asn 370 375
380Lys His Cys Ala Val Gly Ile Glu Pro Asn Arg Glu Arg Ile Asn
Gln385 390 395 400Leu Leu
Asn Glu Ser Leu Met Leu Val Thr Ala Leu Asn Thr His Ile
405 410 415Gly Tyr Asp Lys Ala Ala Glu
Ile Ala Lys Lys Ala His Lys Glu Gly 420 425
430Leu Thr Leu Lys Ala Ala Ala Leu Ala Leu Gly Tyr Leu Ser
Glu Ala 435 440 445Glu Phe Asp Ser
Trp Val Arg Pro Glu Gln Met Val Gly Ser Met Lys 450
455 460Ala Gly Arg46573299PRTBacillus subtilisBacillus
subtilis subsp. subtilis str. 168 73Met Lys Leu Lys Asp Leu Ile Gly Lys
Ala Ser Ile His Lys Asn Lys1 5 10
15Thr Ile Ala Val Ala His Ala Glu Asp Glu Glu Val Ile Arg Ala
Val 20 25 30Lys Leu Ala Ala
Glu His Leu Ser Ala Arg Phe Leu Leu Thr Gly Asp 35
40 45Ser Lys Lys Leu Asn Glu Leu Thr Ser Ser Met Gln
Gly His Gln Val 50 55 60Glu Ile Val
His Ala Asn Thr Pro Glu Glu Ser Ala Lys Leu Ala Val65 70
75 80Arg Ala Val His His Lys Thr Ala
Asp Val Leu Met Lys Gly Asn Val 85 90
95Pro Thr Ser Val Leu Leu Lys Ala Val Leu Asn Arg Gln Glu
Gly Leu 100 105 110Arg Ser Ala
Ser Val Leu Ser His Val Ala Val Phe Asp Ile Pro Asp 115
120 125Phe Asp Arg Leu Met Phe Val Thr Asp Ser Ala
Met Asn Ile Ala Pro 130 135 140Ser Leu
Glu Glu Leu Arg Gln Ile Leu Gln Asn Ala Val His Val Ala145
150 155 160His Ala Val Gly Asn Asn Met
Pro Lys Ala Ala Ala Leu Ala Ala Val 165
170 175Glu Thr Val Asn Pro Lys Met Glu Ala Thr Val Asn
Ala Ala Ala Leu 180 185 190Ala
Gln Met Tyr Lys Arg Gly Gln Ile Lys Gly Cys Ile Val Asp Gly 195
200 205Pro Leu Ala Leu Asp Asn Ala Val Ser
Gln Ile Ala Ala Ala Gln Lys 210 215
220Lys Ile Ser Gly Asp Val Ala Gly Asn Ala Asp Ile Leu Leu Val Pro225
230 235 240Thr Ile Glu Ala
Gly Asn Ile Leu Tyr Lys Ser Leu Ile Tyr Phe Ala 245
250 255Lys Ala Ser Val Ala Ala Val Ile Thr Gly
Ala Lys Ala Pro Ile Ala 260 265
270Leu Thr Ser Arg Ala Asp Ser Ala Glu Asn Lys Leu Tyr Ser Ile Ala
275 280 285Leu Ala Ile Cys Ala Ser Glu
Glu Tyr Thr His 290 29574273PRTEnterococcus faecalis
74Met Ile Thr Val Ser Ile Ala Gly Gly Ser Gln Pro Glu Ile Leu Gln1
5 10 15Leu Val Lys Lys Ala Leu
Lys Glu Ala Glu Gln Pro Leu Gln Phe Ile 20 25
30Val Phe Asp Thr Asn Glu Asn Leu Asp Thr Glu Asn Leu
Trp Lys Tyr 35 40 45Val His Cys
Ser Asp Glu Ala Thr Val Ala Gln Glu Ala Val Ser Leu 50
55 60Val Ala Thr Gly Gln Ala Gln Ile Leu Leu Lys Gly
Ile Ile Gln Thr65 70 75
80His Thr Leu Leu Lys Glu Met Leu Lys Ser Glu His Gln Leu Lys Asn
85 90 95Lys Pro Ile Leu Ser His
Val Ala Met Val Glu Leu Pro Ala Gly Lys 100
105 110Thr Phe Leu Leu Thr Asp Cys Ala Met Asn Ile Ala
Pro Thr Gln Ala 115 120 125Thr Leu
Ile Glu Ile Val Glu Asn Ala Lys Glu Val Ala Gln Lys Leu 130
135 140Gly Leu His His Pro Lys Ile Ala Leu Leu Ser
Ala Ala Glu Asn Phe145 150 155
160Asn Pro Lys Met Pro Ser Ser Val Leu Ala Lys Glu Val Thr Ala His
165 170 175Phe Asn Gly Gln
Gln Glu Ala Thr Val Phe Gly Pro Leu Ser Leu Asp 180
185 190Leu Ala Thr Ser Glu Glu Ala Val Ala His Lys
Arg Tyr Ser Gly Pro 195 200 205Ile
Met Gly Asp Ala Asp Ile Leu Val Val Pro Thr Ile Asp Val Gly 210
215 220Asn Cys Leu Tyr Lys Ser Leu Thr Leu Phe
Gly His Ala Lys Val Gly225 230 235
240Gly Thr Ile Val Gly Thr Lys Val Pro Val Val Leu Thr Ser Arg
Ser 245 250 255Asp Ser Thr
Glu Ser Lys Phe His Ser Leu Arg Phe Ala Met Arg Gln 260
265 270Val75384PRTLactobacillus
caseiLactobacillus casei W56 75Met Arg Asp Cys Thr Thr Glu Arg Arg Cys
Leu Met Thr Met His Pro1 5 10
15Lys Arg Asp Val Val Ile Val Ile Asn Pro Gly Ser Thr Ser Ser Lys
20 25 30Ile Ala Leu Phe Lys Ala
Gly Lys Met Val Ala Glu Arg Thr Leu Asn 35 40
45His Ser Leu Ala Glu Leu Ser Gln Phe Asp Ser Val Ile Ala
Gln Lys 50 55 60Asp Phe Arg Met Gln
Ala Ile Gln Glu Phe Leu Ala Asp Gln Asp Phe65 70
75 80Ser Ala Ser Glu Val Leu Ala Val Ala Gly
Arg Gly Gly Leu Leu Lys 85 90
95Pro Ile Pro Gly Gly Thr Tyr Ala Val Asn Glu Ala Met Leu Asp Asp
100 105 110Leu Thr Ala Ala Lys
Arg Asn Glu His Ala Ser Asn Leu Gly Ala Gly 115
120 125Leu Ala Gln Gln Val Ala Asp Gln Tyr Gly Val Lys
Ala Tyr Val Val 130 135 140Asp Pro Pro
Val Val Asp Glu Leu Gln Pro Leu Ala Arg Ile Ser Gly145
150 155 160Leu Lys Gly Ile Glu Arg His
Ser Ala Ala His Val Leu Asn Gln Lys 165
170 175Ala Met Ala Arg Gln Val Leu Ala Thr Met Gly Lys
Thr Tyr Ala Thr 180 185 190Ser
Arg Val Ile Val Ala His Ile Gly Gly Gly Leu Ser Ile His Ala 195
200 205His Glu Asn Gly Arg Met Ile Asp Gly
Asn Asn Gly Ile Asp Gly Glu 210 215
220Gly Pro Tyr Ser Pro Glu Arg Ala Gly Ser Leu Pro Leu Val Asp Phe225
230 235 240Val Ala Lys Val
Leu Ala Glu Arg Leu Thr Leu Asp Gln Val Lys Lys 245
250 255Leu Leu Ala Ser Gln Ser Gly Leu Arg Ser
Tyr Leu Asn Asp Ile Ser 260 265
270Ile Lys Asn Ile Val Thr Arg Ile Ala Glu Gly Asp Glu Thr Ala Lys
275 280 285Phe Tyr Leu Asp Gly Met Ile
Tyr Gln Ile Lys Lys Gln Ile Ala Glu 290 295
300Met Ala Gly Val Leu Asn Gly Gln Val Asp Val Ile Ile Leu Thr
Gly305 310 315 320Gly Ala
Ala Tyr Ala Thr Ala Val Thr Val Pro Leu Gln His Asp Leu
325 330 335Ala Trp Ile Ala Pro Val Val
Val Arg Pro Gly Glu Met Glu Met Gln 340 345
350Ala Leu Tyr Glu Gly Val Met Arg Val Leu Asn His Glu Glu
Pro Val 355 360 365Arg Val Tyr Gln
Ser Asp Ala Ser Thr Ile Lys Gly Gly Thr Gly Arg 370
375 38076370PRTUnknownGeobacillus sp. GHH01 76Met Glu Glu
Gln Lys Phe Arg Ile Leu Thr Ile Asn Pro Gly Ser Thr1 5
10 15Ser Thr Lys Ile Gly Val Phe Glu Asn
Glu Arg Pro Leu Leu Glu Lys 20 25
30Thr Ile Arg His Glu Ala Asp Val Leu Arg Gln Tyr Lys Thr Ile Ala
35 40 45Asp Gln Tyr Glu Phe Arg Lys
Gln Thr Ile Leu Gln Ala Leu Asp Glu 50 55
60Glu Gly Ile Asn Leu Ser Lys Leu Ser Ala Val Cys Gly Arg Gly Gly65
70 75 80Leu Leu Arg Pro
Ile Glu Gly Gly Thr Tyr Arg Val Asn Glu Ala Met 85
90 95Leu Glu Asp Leu Arg Arg Gly Tyr Ser Gly
Gln His Ala Ser Asn Leu 100 105
110Gly Gly Ile Leu Ala His Glu Ile Ala Ser Ala Leu Asn Ile Pro Ala
115 120 125Phe Ile Val Asp Pro Val Val
Val Asp Glu Leu Asp Pro Ile Ala Arg 130 135
140Ile Ser Gly Phe Pro Leu Ile Glu Arg Arg Ser Ile Phe His Ala
Leu145 150 155 160Asn Gln
Lys Ala Val Ala Arg Arg Val Ala Lys Gln Leu Gly Lys Arg
165 170 175Tyr Asp Glu Leu Asn Leu Ile
Val Ala His Met Gly Gly Gly Ile Thr 180 185
190Val Gly Ala His Lys Gln Gly Arg Val Val Asp Val Asn Asn
Gly Leu 195 200 205Asp Gly Glu Gly
Pro Phe Ser Pro Glu Arg Ala Gly Thr Val Pro Ala 210
215 220Gly Asp Leu Val Ala Leu Cys Phe Ser Gly Glu Tyr
Tyr Arg Glu Glu225 230 235
240Ile Met Asn Met Leu Val Gly Gly Gly Gly Leu Val Gly Tyr Leu Gly
245 250 255Thr Asn Asp Ala Val
Lys Val Glu Asn Met Ile Glu Ala Gly Asp Glu 260
265 270Lys Ala Lys Leu Val Tyr Glu Ala Met Ala Tyr Gln
Val Ala Lys Glu 275 280 285Ile Gly
Ala Ala Ser Ala Val Leu Ser Gly Lys Val Asp Ala Ile Ile 290
295 300Leu Thr Gly Gly Leu Ala Tyr Gly Lys Ser Phe
Val Glu Gln Ile Thr305 310 315
320Arg Arg Val Gln Trp Ile Ala Asp Val Ile Val His Pro Gly Glu Asn
325 330 335Glu Leu Gln Ala
Leu Ala Glu Gly Ala Leu Arg Val Leu Arg Gly Glu 340
345 350Glu Glu Glu Lys Val Tyr Pro Gly Glu Ala Val
Ser Pro Ile Pro Ala 355 360 365Arg
Arg 37077556PRTMethanobacterium formicicumMethanobacterium formicicum
DSM 3637 77Met Ser Ser Leu Leu Glu Lys Phe Val Ser Gln Val Asn Phe Glu
Ser1 5 10 15Tyr Pro Asp
Phe Lys Asp Asn Phe Arg Ile Lys Ile Pro Glu Asn Phe 20
25 30Asn Phe Ala Tyr Asp Val Val Asp Glu Tyr
Ala Arg Leu Tyr Pro Glu 35 40
45Lys Val Ala Met Val Trp Cys Asn Asp Asp Thr Asp Arg Ile Phe Thr 50
55 60Phe Lys Thr Leu Lys Glu Tyr Ser Asp
Arg Ala Ala Asn Phe Phe Ala65 70 75
80Gln Gln Gly Ile Lys Lys Gly Asp Arg Val Met Leu Thr Leu
Lys Ser 85 90 95Arg Tyr
Glu Phe Trp Phe Cys Ile Leu Ala Leu His Lys Leu Gly Ala 100
105 110Ile Thr Ile Pro Ala Thr His Met Leu
Lys Thr Arg Asp Ile Val Tyr 115 120
125Arg Ile Lys Asn Ala Gly Ile Lys Met Val Val Cys Ile Ala Glu Asp
130 135 140Gly Val Pro Gly Tyr Phe Asp
Glu Ala His Leu Gln Leu Asp Asp Ala145 150
155 160Pro Phe Val Lys Ala Leu Val Gly Asp Glu Asp Arg
Glu Gly Trp Phe 165 170
175Asn Phe Arg Lys Glu Leu Glu Asn Ala Ser Pro Glu Leu Gln Arg Pro
180 185 190Ser Gly Glu Glu Gly Thr
Gln Asn Asp Asp Val Ala Leu Ile Tyr Phe 195 200
205Ser Ser Gly Thr Thr Gly Leu Pro Lys Met Ile Met His Asp
Tyr Thr 210 215 220Tyr Pro Leu Gly His
Ile Ile Thr Ala Lys Tyr Trp Gln Asn Val Val225 230
235 240Glu Asp Gly Leu His Tyr Thr Val Ala Asp
Thr Gly Trp Ala Lys Ala 245 250
255Met Trp Gly Gln Ile Tyr Gly Gln Trp Ile Ser Gly Thr Ala Ile Phe
260 265 270Val Tyr Asp Tyr Glu
Arg Phe Asp Ala Ala Lys Met Leu Asp Lys Ala 275
280 285Ser His His Gly Val Thr Thr Phe Cys Ala Pro Pro
Thr Ile Tyr Arg 290 295 300Phe Leu Ile
Lys Glu Asp Leu Ser Gln Tyr Asp Phe Ser Thr Leu Lys305
310 315 320Tyr Ala Val Thr Ala Gly Glu
Pro Leu Asn Pro Glu Val Tyr Asn Lys 325
330 335Phe Tyr Glu Phe Thr Gly Leu Arg Leu Arg Glu Gly
Phe Gly Gln Thr 340 345 350Glu
Cys Val Val Cys Ile Ala Asn Phe Pro Trp Ile Glu Pro Arg Pro 355
360 365Gly Ser Met Gly Lys Ser Ala Pro Glu
Tyr Asp Ile Gln Ile Met Asp 370 375
380Lys Glu Gly Lys Gln Cys Asp Val Gly Glu Glu Gly Glu Ile Val Ile385
390 395 400Lys Thr Ala Asp
Gly Lys Pro Pro Gly Leu Phe Cys Gly Tyr Tyr Lys 405
410 415Glu Asp Asn Lys Thr Glu Ala Ala Trp Phe
Asp Gly Tyr Tyr His Thr 420 425
430Gly Asp Thr Ala Trp Lys Asp Glu Asp Gly Tyr Leu Trp Phe Val Gly
435 440 445Arg Asn Asp Asp Met Ile Lys
Ser Ser Gly Tyr Arg Ile Gly Pro Phe 450 455
460Glu Val Glu Ser Ala Val Ile Ser His Gln Ala Val Leu Glu Cys
Ala465 470 475 480Ile Thr
Gly Val Pro His Pro Val Arg Gly Gln Val Ile Lys Ala Thr
485 490 495Ile Val Leu Thr Gly Asp Tyr
Glu Pro Ser Pro Glu Leu Ala Lys Glu 500 505
510Ile Gln Asn His Val Lys Gln Val Thr Ala Pro Tyr Lys Tyr
Pro Arg 515 520 525Val Val Glu Phe
Val Asp Glu Leu Pro Lys Thr Ile Ser Gly Lys Ile 530
535 540Arg Arg Val Glu Ile Arg Glu Lys Asp Glu Lys Glu545
550 55578502PRTKlebsiella pneumoniae
78Met Thr Ala Pro Ile Gln Asp Leu Arg Asp Ala Ile Ala Leu Leu Gln1
5 10 15Gln His Asp Asn Gln Tyr
Leu Glu Thr Asp His Pro Val Asp Pro Asn 20 25
30Ala Glu Leu Ala Gly Val Tyr Arg His Ile Gly Ala Gly
Gly Thr Val 35 40 45Lys Arg Pro
Thr Arg Ile Gly Pro Ala Met Met Phe Asn Asn Ile Lys 50
55 60Gly Tyr Pro His Ser Arg Ile Leu Val Gly Met His
Ala Ser Arg Gln65 70 75
80Arg Ala Ala Leu Leu Leu Gly Cys Glu Ala Ser Gln Leu Ala Leu Glu
85 90 95Val Gly Lys Ala Val Lys
Lys Pro Val Ala Pro Val Val Val Pro Ala 100
105 110Ser Ser Ala Pro Cys Gln Glu Gln Ile Phe Leu Ala
Asp Asp Pro Asp 115 120 125Phe Asp
Leu Arg Thr Leu Leu Pro Ala Pro Thr Asn Thr Pro Ile Asp 130
135 140Ala Gly Pro Phe Phe Cys Leu Gly Leu Ala Leu
Ala Ser Asp Pro Val145 150 155
160Asp Ala Ser Leu Thr Asp Val Thr Ile His Arg Leu Cys Val Gln Gly
165 170 175Arg Asp Glu Leu
Ser Met Phe Leu Ala Ala Gly Arg His Ile Glu Val 180
185 190Phe Arg Gln Lys Ala Glu Ala Ala Gly Lys Pro
Leu Pro Ile Thr Ile 195 200 205Asn
Met Gly Leu Asp Pro Ala Ile Tyr Ile Gly Ala Cys Phe Glu Ala 210
215 220Pro Thr Thr Pro Phe Gly Tyr Asn Glu Leu
Gly Val Ala Gly Ala Leu225 230 235
240Arg Gln Arg Pro Val Glu Leu Val Gln Gly Val Ser Val Pro Glu
Lys 245 250 255Ala Ile Ala
Arg Ala Glu Ile Val Ile Glu Gly Glu Leu Leu Pro Gly 260
265 270Val Arg Val Arg Glu Asp Gln His Thr Asn
Ser Gly His Ala Met Pro 275 280
285Glu Phe Pro Gly Tyr Cys Gly Gly Ala Asn Pro Ser Leu Pro Val Ile 290
295 300Lys Val Lys Ala Val Thr Met Arg
Asn Asn Ala Ile Leu Gln Thr Leu305 310
315 320Val Gly Pro Gly Glu Glu His Thr Thr Leu Ala Gly
Leu Pro Thr Glu 325 330
335Ala Ser Ile Trp Asn Ala Val Glu Ala Ala Ile Pro Gly Phe Leu Gln
340 345 350Asn Val Tyr Ala His Thr
Ala Gly Gly Gly Lys Phe Leu Gly Ile Leu 355 360
365Gln Val Lys Lys Arg Gln Pro Ala Asp Glu Gly Arg Gln Gly
Gln Ala 370 375 380Ala Leu Leu Ala Leu
Ala Thr Tyr Ser Glu Leu Lys Asn Ile Ile Leu385 390
395 400Val Asp Glu Asp Val Asp Ile Phe Asp Ser
Asp Asp Ile Leu Trp Ala 405 410
415Met Thr Thr Arg Met Gln Gly Asp Val Ser Ile Thr Thr Ile Pro Gly
420 425 430Ile Arg Gly His Gln
Leu Asp Pro Ser Gln Thr Pro Glu Tyr Ser Pro 435
440 445Ser Ile Arg Gly Asn Gly Ile Ser Cys Lys Thr Ile
Phe Asp Cys Thr 450 455 460Val Pro Trp
Ala Leu Lys Ser His Phe Glu Arg Ala Pro Phe Ala Asp465
470 475 480Val Asp Pro Arg Pro Phe Ala
Pro Glu Tyr Phe Ala Arg Leu Glu Lys 485
490 495Asn Gln Gly Ser Ala Lys
50079496PRTEnterobacter cloacae 79Met Glu Asn Gln Ile Asn Asp Leu Arg Ser
Ala Ile Ala Leu Leu Gln1 5 10
15Arg His Glu Gly Gln Tyr Ile Glu Thr Asp Arg Pro Val Asp Pro Asn
20 25 30Ala Glu Leu Ala Gly Val
Tyr Arg His Ile Gly Ala Gly Gly Thr Val 35 40
45Lys Arg Pro Thr Arg Thr Gly Pro Ala Met Met Phe Asn Ser
Ile Lys 50 55 60Gly Tyr Pro His Ser
Arg Ile Leu Val Gly Met His Ala Ser Arg Glu65 70
75 80Arg Ala Ala Leu Leu Leu Gly Cys Glu Pro
Ser Glu Leu Ala Lys His 85 90
95Val Gly Gln Ala Val Lys Lys Pro Val Ala Pro Val Val Val Pro Ala
100 105 110Ser Gln Ala Pro Cys
Gln Glu Gln Val Phe Tyr Ala Asp Asp Pro Asp 115
120 125Phe Asp Leu Arg Lys Leu Leu Pro Ala Pro Thr Asn
Thr Pro Ile Asp 130 135 140Ala Gly Pro
Phe Phe Cys Leu Gly Leu Val Leu Ala Ser Asp Pro Glu145
150 155 160Asp Ser Ser Leu Thr Asp Val
Thr Ile His Arg Leu Cys Val Gln Glu 165
170 175Arg Asp Glu Leu Ser Met Phe Leu Ala Ala Gly Arg
His Ile Glu Val 180 185 190Phe
Arg Lys Lys Ala Glu Asp Ala Gly Lys Pro Leu Pro Val Thr Ile 195
200 205Asn Met Gly Leu Asp Pro Ala Ile Tyr
Ile Gly Ala Cys Phe Glu Ala 210 215
220Pro Thr Thr Pro Phe Gly Tyr Asn Glu Leu Gly Val Ala Gly Ala Leu225
230 235 240Arg Gln Gln Pro
Val Glu Leu Val Gln Gly Val Ala Val Lys Glu Lys 245
250 255Ala Ile Ala Arg Ala Glu Ile Ile Ile Glu
Gly Glu Leu Leu Pro Gly 260 265
270Val Arg Val Arg Glu Asp Gln His Thr Asn Thr Gly His Ala Met Pro
275 280 285Glu Phe Pro Gly Tyr Cys Gly
Glu Ala Asn Pro Ser Leu Pro Val Ile 290 295
300Lys Val Lys Ala Val Thr Met Arg Asn His Ala Ile Leu Gln Thr
Leu305 310 315 320Val Gly
Pro Gly Glu Glu His Thr Thr Leu Ala Gly Leu Pro Thr Glu
325 330 335Ala Ser Ile Arg Asn Ala Val
Glu Glu Ala Ile Pro Gly Phe Leu Gln 340 345
350Asn Val Tyr Ala His Thr Ala Gly Gly Gly Lys Phe Leu Gly
Ile Leu 355 360 365Gln Val Lys Lys
Arg Gln Pro Ser Asp Glu Gly Arg Gln Gly Gln Ala 370
375 380Ala Leu Ile Ala Leu Ala Thr Tyr Ser Glu Leu Lys
Asn Ile Ile Leu385 390 395
400Val Asp Glu Asp Val Asp Ile Phe Asp Ser Asp Asp Ile Leu Trp Ala
405 410 415Met Thr Thr Arg Met
Gln Gly Asp Val Ser Ile Thr Asn Ile Pro Gly 420
425 430Ile Arg Gly His Gln Leu Asp Pro Ser Gln Ser Pro
Asp Tyr Ser Thr 435 440 445Ser Ile
Arg Gly Asn Gly Ile Ser Cys Lys Thr Ile Phe Asp Cys Thr 450
455 460Val Pro Trp Ala Leu Lys Asp Arg Phe Glu Arg
Ala Pro Phe Met Glu465 470 475
480Val Asp Pro Arg Pro Trp Ala Pro Glu Leu Phe Ala Asp Asn Thr Lys
485 490
49580510PRTUnknownLeptolyngbya species 80Met Leu Ile Asp Gln Glu Gln Ala
Lys Thr Asp His Pro Leu Gly Trp1 5 10
15Asn Val Pro Asp Ile Asn Asp Leu Arg Ala Ala Ile Ala His
Leu Lys 20 25 30Lys Phe Lys
Gly Gln Tyr Ile Glu Thr Asp His Pro Val Asp Pro Ile 35
40 45Ala Glu Leu Ala Gly Val Tyr Arg Tyr Ile Gly
Ala Gly Gly Thr Val 50 55 60Met Arg
Pro Thr Arg Ile Gly Pro Ala Met Thr Phe Asn Asn Val Lys65
70 75 80Gly Tyr Pro Asn Ser Arg Val
Leu Val Gly Met Met Ala Ser Arg Glu 85 90
95Arg Val Ser Ile Leu Leu Gly Ala Pro Thr Arg Glu Leu
Gly Met Gln 100 105 110Met Gly
Lys Ala Val Lys Thr Ile Val Pro Pro Ala Thr Ile Asp Ala 115
120 125Lys Asp Ala Pro Cys Gln Glu Glu Ile Tyr
Arg Ala Asp Asp Pro Thr 130 135 140Phe
Asp Leu Arg Lys Leu Leu Pro Ala Pro Thr Asn Thr Glu Glu Asp145
150 155 160Ala Gly Pro Tyr Phe Cys
Met Gly Leu Val Leu Gly Ser Asp Pro Asp 165
170 175Asp Glu Thr Asn Thr Asp Val Thr Ile His Arg Leu
Cys Val Gln Ser 180 185 190Arg
Asp Glu Met Ser Ile Phe Phe Ala Pro Gly Arg His Ile Asp Ala 195
200 205Tyr Arg Gln Lys Ala Glu Ala Ala Gly
Lys Pro Leu Pro Ile Ser Val 210 215
220Asn Met Gly Leu Asp Pro Ala Ile His Ile Gly Ala Cys Phe Glu Ala225
230 235 240Pro Thr Thr Pro
Phe Gly Phe Asp Glu Leu Cys Val Ala Gly Gly Leu 245
250 255Arg Gly Lys Pro Val Glu Leu Val Asn Cys
Val Thr Val Gln Gln Lys 260 265
270Ala Ile Ala Arg Ala Glu Ile Val Ile Glu Gly Glu Val Leu Pro Asn
275 280 285Val Arg Val Ala Glu Asp Gln
Asn Thr His Thr Gly Tyr Ala Met Pro 290 295
300Glu Phe Pro Gly Tyr Thr Gly Pro Ala Asn Pro Ser Leu Pro Val
Ile305 310 315 320Lys Val
Thr Ala Val Thr Met Arg His Asn Ala Ile Leu Gln Thr Leu
325 330 335Val Gly Pro Gly Glu Glu His
Val Asn Leu Ala Gly Ile Pro Thr Glu 340 345
350Ala Ser Ile Tyr Asn Ala Val Glu Leu Ala Leu Pro Gly Leu
Leu Gln 355 360 365Asn Val Tyr Ser
His Ser Ser Gly Gly Gly Lys Phe Leu Ala Ile Leu 370
375 380Gln Ile Lys Lys Arg Val Ala Gly Asp Asp Gly Ser
Ala Arg Gln Ala385 390 395
400Ala Leu Ile Ala Leu Ala Val Tyr Arg Glu Val Lys Asn Ile Ile Leu
405 410 415Val Asp Glu Asp Val
Asp Leu Phe Asp Ser Asp Asp Val Leu Trp Ala 420
425 430Met Gln Thr Arg Tyr Gln Gly Asp Thr Gly Thr Ile
Val Val Pro Gly 435 440 445Ile Thr
Gly His Val Leu Asp Pro Ser Gln Ile Pro Glu Tyr Ser Pro 450
455 460Ser Ile His Thr Lys Gly Ser Thr Cys Lys Thr
Ile Phe Asp Cys Thr465 470 475
480Val Pro Phe Ala Leu Lys Glu His Phe Lys Arg Ala Gln Phe Arg Glu
485 490 495Leu Asp Pro Arg
Pro Phe Ala Pro Glu Leu Phe Asn Glu Pro 500
505 51081492PRTUnknownPhascolarctobacterium species 81Met
Thr Thr Lys Ile Asn Asp Leu Arg Ser Ala Leu Asp Tyr Leu Arg1
5 10 15Thr Ile Pro Gly Gln Leu Val
Glu Thr Asn Val Glu Ala Asp Pro Arg 20 25
30Ala Glu Ile Ser Gly Ile Tyr Arg Tyr Val Gly Ala Lys Gly
Thr Val 35 40 45Lys Arg Pro Thr
Arg Leu Gly Pro Ala Met Ile Phe Asn Asn Val Lys 50 55
60Gly His Pro Gly Ala Lys Val Ala Ile Gly Val Leu Ser
Ser Arg Ala65 70 75
80Arg Val Gly Tyr Leu Leu Gly Cys Glu Pro Glu Lys Leu Gly Phe Leu
85 90 95Leu Lys Asp Ser Val Ser
Thr Pro Ile Ala Pro Val Val Val Ser Ala 100
105 110Asp Gln Ala Pro Cys Gln Glu Val Val His Leu Ala
Thr Glu Glu Gly 115 120 125Phe Asp
Ile Arg Lys Leu Ile Pro Ala Pro Thr Asn Thr Glu Glu Asp 130
135 140Ala Gly Pro Tyr Val Thr Met Gly Leu Cys Tyr
Gly Thr Asp Pro Glu145 150 155
160Thr Gly Asp Thr Asp Ile Thr Ile His Arg Leu Cys Leu Gln Gly Lys
165 170 175Asp Glu Ile Ser
Met Tyr Phe Val Pro Gly Arg His Leu Asp Val Phe 180
185 190Arg Gln Lys Tyr Glu Lys Ala Gly Lys Pro Met
Pro Ile Ser Ile Ser 195 200 205Ile
Gly Val Asp Pro Ala Ile Glu Ile Ala Ala Cys Phe Glu Pro Pro 210
215 220Thr Thr Pro Leu Gly Phe Asn Glu Leu Ser
Ile Ala Gly Ser Ile Arg225 230 235
240Gly Glu Gly Val Gln Met Val Gln Cys Lys Thr Ile Asn Glu Lys
Ala 245 250 255Ile Ala Arg
Ala Glu Tyr Val Ile Glu Gly Glu Leu Leu Pro Asp Val 260
265 270Arg Val Arg Glu Asp Gln Asn Ser Asn Thr
Gly Lys Ala Met Pro Glu 275 280
285Phe Pro Gly Tyr Thr Gly Ala Met Lys Pro Ala Ile Pro Leu Ile Lys 290
295 300Val Lys Ala Val Thr His Arg Arg
Asp Pro Ile Met Gln Ser Cys Ile305 310
315 320Gly Pro Ser Glu Glu His Val Asn Met Ala Gly Ile
Pro Thr Glu Ala 325 330
335Ser Ile Leu Gly Met Thr Glu Lys Ala Leu Pro Gly Asn Val Lys Asn
340 345 350Val Tyr Ala His Cys Ser
Gly Gly Gly Lys Tyr Met Ala Val Ile Gln 355 360
365Phe Val Lys Lys Ala Pro Pro Asp Glu Gly Arg Gln Arg Gln
Ala Ala 370 375 380Leu Leu Ala Phe Ser
Ala Phe Ser Glu Leu Lys His Val Ile Leu Val385 390
395 400Asp Asp Asp Val Asp Leu Phe Asp Thr Asp
Asp Val Leu Trp Ala Leu 405 410
415Asn Thr Arg Phe Gln Gly Asp Val Asp Val Ile Thr Ile Pro Gly Val
420 425 430Arg Cys His Pro Leu
Asp Pro Ser Gln Ser Pro Glu Phe Ser Pro Ser 435
440 445Ile Arg Asp Val Gly Ile Ser Cys Lys Thr Ile Phe
Asp Cys Thr Val 450 455 460Pro Phe Gly
Leu Lys Glu His Phe Gln Arg Ser Lys Phe Lys Glu Val465
470 475 480Asn Pro Ala Lys Trp Val Pro
Glu Leu Phe Lys Lys 485
49082136PRTEscherichia coliEscherichia coli K-12 82Met Ile Trp Lys Arg
Lys Ile Thr Leu Glu Ala Leu Asn Ala Met Gly1 5
10 15Glu Gly Asn Met Val Gly Phe Leu Asp Ile Arg
Phe Glu His Ile Gly 20 25
30Asp Asp Thr Leu Glu Ala Thr Met Pro Val Asp Ser Arg Thr Lys Gln
35 40 45Pro Phe Gly Leu Leu His Gly Gly
Ala Ser Val Val Leu Ala Glu Ser 50 55
60Ile Gly Ser Val Ala Gly Tyr Leu Cys Thr Glu Gly Glu Gln Lys Val65
70 75 80Val Gly Leu Glu Ile
Asn Ala Asn His Val Arg Ser Ala Arg Glu Gly 85
90 95Arg Val Arg Gly Val Cys Lys Pro Leu His Leu
Gly Ser Arg His Gln 100 105
110Val Trp Gln Ile Glu Ile Phe Asp Glu Lys Gly Arg Leu Cys Cys Ser
115 120 125Ser Arg Leu Thr Thr Ala Ile
Leu 130 13583136PRTSalmonella enterica 83Met Ile Trp
Lys Arg Glu Val Thr Leu Asp Ala Leu Asn Ala Met Gly1 5
10 15Glu Gly Asn Met Val Gly Leu Leu Asp
Ile Arg Phe Glu Arg Ile Gly 20 25
30Asp Asp Thr Leu Glu Ala Thr Met Pro Val Asp His Arg Thr Lys Gln
35 40 45Pro Phe Gly Leu Leu His Gly
Gly Ala Ser Val Val Leu Ala Glu Ser 50 55
60Ile Gly Ser Val Ala Gly Tyr Leu Cys Thr Gln Gly Glu Gln Lys Val65
70 75 80Val Gly Leu Glu
Val Asn Ala Asn His Val Arg Ser Ala Arg Gln Gly 85
90 95Arg Val Arg Gly Val Cys Lys Ala Leu His
Thr Gly Ala Arg His Gln 100 105
110Val Trp Gln Ile Glu Ile Phe Asp Glu Gln Gly Arg Leu Cys Cys Ser
115 120 125Ser Arg Leu Thr Thr Ala Ile
Val 130 13584517PRTMegasphaera sp. 84Met Arg Lys Val
Glu Ile Ile Thr Ala Glu Gln Ala Ala Gln Leu Val1 5
10 15Lys Asp Asn Asp Thr Ile Thr Ser Ile Gly
Phe Val Ser Ser Ala His 20 25
30Pro Glu Ala Leu Thr Lys Ala Leu Glu Lys Arg Phe Leu Asp Thr Asn
35 40 45Thr Pro Gln Asn Leu Thr Tyr Ile
Tyr Ala Gly Ser Gln Gly Lys Arg 50 55
60Asp Gly Arg Ala Ala Glu His Leu Ala His Thr Gly Leu Leu Lys Arg65
70 75 80Ala Ile Ile Gly His
Trp Gln Thr Val Pro Ala Ile Gly Lys Leu Ala 85
90 95Val Glu Asn Lys Ile Glu Ala Tyr Asn Phe Ser
Gln Gly Thr Leu Val 100 105
110His Trp Phe Arg Ala Leu Ala Gly His Lys Leu Gly Val Phe Thr Asp
115 120 125Ile Gly Leu Glu Thr Phe Leu
Asp Pro Arg Gln Leu Gly Gly Lys Leu 130 135
140Asn Asp Val Thr Lys Glu Asp Leu Val Lys Leu Ile Glu Val Asp
Gly145 150 155 160His Glu
Gln Leu Phe Tyr Pro Thr Phe Pro Val Asn Val Ala Phe Leu
165 170 175Arg Gly Thr Tyr Ala Asp Glu
Ser Gly Asn Ile Thr Met Asp Glu Glu 180 185
190Ile Gly Pro Phe Glu Ser Thr Ser Val Ala Gln Ala Val His
Asn Cys 195 200 205Gly Gly Lys Val
Val Val Gln Val Lys Asp Val Val Ala His Gly Ser 210
215 220Leu Asp Pro Arg Met Val Lys Ile Pro Gly Ile Tyr
Val Asp Tyr Val225 230 235
240Val Val Ala Ala Pro Glu Asp His Gln Gln Thr Tyr Asp Cys Glu Tyr
245 250 255Asp Pro Ser Leu Ser
Gly Glu His Arg Ala Pro Glu Gly Ala Ala Asp 260
265 270Ala Ala Leu Pro Met Ser Ala Lys Lys Ile Ile Gly
Arg Arg Gly Ala 275 280 285Leu Glu
Leu Thr Glu Asn Ala Val Val Asn Leu Gly Val Gly Ala Pro 290
295 300Glu Tyr Val Ala Ser Val Ala Gly Glu Glu Gly
Ile Ala Asp Thr Ile305 310 315
320Thr Leu Thr Val Glu Gly Gly Ala Ile Gly Gly Val Pro Gln Gly Gly
325 330 335Ala Arg Phe Gly
Ser Ser Arg Asn Ala Asp Ala Ile Ile Asp His Thr 340
345 350Tyr Gln Phe Asp Phe Tyr Asp Gly Gly Gly Leu
Asp Ile Ala Tyr Leu 355 360 365Gly
Leu Ala Gln Cys Asp Gly Ser Gly Asn Ile Asn Val Ser Lys Phe 370
375 380Gly Thr Asn Val Ala Gly Cys Gly Gly Phe
Pro Asn Ile Ser Gln Gln385 390 395
400Thr Pro Asn Val Tyr Phe Cys Gly Thr Phe Thr Ala Gly Gly Leu
Lys 405 410 415Ile Ala Val
Glu Asp Gly Lys Val Lys Ile Leu Gln Glu Gly Lys Ala 420
425 430Lys Lys Phe Ile Lys Ala Val Asp Gln Ile
Thr Phe Asn Gly Ser Tyr 435 440
445Ala Ala Arg Asn Gly Lys His Val Leu Tyr Ile Thr Glu Arg Cys Val 450
455 460Phe Glu Leu Thr Lys Glu Gly Leu
Lys Leu Ile Glu Val Ala Pro Gly465 470
475 480Ile Asp Ile Glu Lys Asp Ile Leu Ala His Met Asp
Phe Lys Pro Ile 485 490
495Ile Asp Asn Pro Lys Leu Met Asp Ala Arg Leu Phe Gln Asp Gly Pro
500 505 510Met Gly Leu Lys Lys
51585265PRTUnknownPseudomonas species 85Met Asn Asn Leu Pro Val Cys Gln
Thr Leu Leu Leu Glu Leu His Asn1 5 10
15Gly Val Leu His Val Thr Leu Asn Arg Pro Glu Cys Arg Asn
Ala Met 20 25 30Ser Ser Gln
Met Val Ala Glu Leu Arg Ser Val Leu Ala Ala Val Arg 35
40 45Asp Lys Pro Gly Val Arg Ala Leu Val Ile Gly
Gly Val Gly Gly His 50 55 60Phe Cys
Ala Gly Gly Asp Ile Lys Asp Met Ala Asn Ala Arg Ala Gln65
70 75 80Gly Pro Thr Ala His Arg Asp
Leu Asn Arg Val Phe Gly Ala Leu Leu 85 90
95Gln Glu Val Gln His Ala Pro Gln Val Val Ile Thr Val
Leu Gln Gly 100 105 110Ala Val
Leu Gly Gly Gly Leu Gly Leu Ala Cys Val Ser Asp Ile Ala 115
120 125Leu Ala Asp His Gln Ala Gln Phe Gly Leu
Pro Glu Thr Ser Leu Gly 130 135 140Leu
Leu Pro Ala Gln Ile Ala Pro Phe Val Val Gln Arg Ile Gly Leu145
150 155 160Thr Glu Ala Arg Arg Leu
Ala Leu Thr Ala Ala Arg Phe Asp Gly His 165
170 175Gln Ala Arg Arg Met Gly Leu Val His Phe Val Glu
His Asp Pro Gln 180 185 190Ala
Leu Ala Glu Arg Leu Asp Glu Val Leu Ala His Val Leu Cys Cys 195
200 205Ala Pro Gly Ala Asn Ala Ala Thr Lys
Lys Leu Leu Leu Ala Ser Ala 210 215
220Gly Gln Pro Ser Asp Glu Leu Leu Asp Gln Ala Ala Glu Trp Phe Ser225
230 235 240Glu Ala Val Thr
Gly Ala Glu Gly Val Glu Gly Thr Met Ala Phe Val 245
250 255Gln Lys Arg Lys Pro Gly Trp Ala Ser
260 26586277PRTAcinetobacter baumannii 86Met Thr Leu
Ser Ala Ser Leu His Ile Asp Ile Asp Asp Ser Ile Gln1 5
10 15Leu Glu Gln Asp Gly Ser Ile Leu Tyr
Leu Trp Leu Asn Arg Pro Glu 20 25
30Ser Arg Asn Ala Met Asn Leu Asn Met Val Asn Ala Ile Gln Gln Val
35 40 45Phe Thr Ala Ile Arg Asp Asp
Leu Ser Ile Arg Ala Val Ile Ile Arg 50 55
60Gly Glu Gly Gly Thr Phe Cys Ala Gly Gly Asp Ile Lys Asp Met Ala65
70 75 80Ala Leu Arg Val
Glu Ala Thr Asn Val Gly Ser Leu Gln Pro Tyr Thr 85
90 95Asn Phe Asn Arg Arg Phe Gly Ala Met Leu
Glu Gln Val Glu Ala Ala 100 105
110Pro Gln Thr Val Val Val Ile Leu Glu Ser Ala Val Leu Gly Gly Gly
115 120 125Phe Gly Leu Ala Cys Val Ser
Asp Val Ala Ile Ser Arg Asp Asn Ala 130 135
140Gln Phe Gly Leu Pro Glu Thr Gly Leu Gly Val Ile Pro Ala Gln
Ile145 150 155 160Ala Pro
Phe Val Val Lys Arg Ile Gly Leu Thr Gln Ala Arg Arg Leu
165 170 175Ala Leu Leu Gly Met Arg Phe
Glu Gly His Thr Ala Leu Ser Val Gly 180 185
190Val Val His Gln Ile Ala His Asn Glu Ile Glu Leu Glu Gln
Ala Leu 195 200 205Gln Glu Thr Ile
Gln Gln Ile Lys Arg Ala Ala Pro Gln Ala Ser Arg 210
215 220Val Thr Lys Ala Leu Leu His Arg Thr Leu Asn Glu
Pro Leu Asn Gln225 230 235
240Leu Leu Asp Asp Ala Ala Gln Gln Phe Ala Gln Ala Val Gly Ser Ala
245 250 255Glu Gly Gln Glu Gly
Thr Met Ala Phe Ile Gln Lys Arg Leu Pro Asn 260
265 270Trp Ala Asp Glu Thr 27587264PRTPseudomonas
aeruginosa 87Met Ser Leu Pro His Cys Glu Thr Leu Leu Leu Glu Pro Ile Glu
Gly1 5 10 15Val Leu Arg
Ile Thr Leu Asn Arg Pro Gln Ser Arg Asn Ala Met Ser 20
25 30Leu Ala Met Val Gly Glu Leu Arg Ala Val
Leu Ala Ala Val Arg Asp 35 40
45Asp Arg Ser Val Arg Ala Leu Val Leu Arg Gly Ala Asp Gly His Phe 50
55 60Cys Ala Gly Gly Asp Ile Lys Asp Met
Ala Gly Ala Arg Ala Ala Gly65 70 75
80Ala Glu Ala Tyr Arg Thr Leu Asn Arg Ala Phe Gly Ser Leu
Leu Glu 85 90 95Glu Ala
Gln Ala Ala Pro Gln Leu Leu Val Ala Leu Val Glu Gly Ala 100
105 110Val Leu Gly Gly Gly Phe Gly Leu Ala
Cys Val Ser Asp Val Ala Ile 115 120
125Ala Ala Ala Asp Ala Gln Phe Gly Leu Pro Glu Thr Ser Leu Gly Ile
130 135 140Leu Pro Ala Gln Ile Ala Pro
Phe Val Val Arg Arg Ile Gly Leu Thr145 150
155 160Gln Ala Arg Arg Leu Ala Leu Thr Ala Ala Arg Phe
Asp Gly Arg Glu 165 170
175Ala Leu Arg Leu Gly Leu Val His Phe Cys Glu Ala Asp Ala Asp Ala
180 185 190Leu Glu Gln Arg Leu Glu
Glu Thr Leu Glu Gln Leu Arg Arg Cys Ala 195 200
205Pro Asn Ala Asn Ala Ala Thr Lys Ala Leu Leu Leu Ala Ser
Glu Ser 210 215 220Gly Glu Leu Gly Ala
Leu Leu Asp Asp Ala Ala Arg Gln Phe Ala Glu225 230
235 240Ala Val Gly Gly Ala Glu Gly Ser Glu Gly
Thr Leu Ala Phe Val Gln 245 250
255Lys Arg Lys Pro Val Trp Ala Gln
26088273PRTMarinobacter santoriniensis 88Met Glu Gln Leu Pro His Cys Glu
Thr Leu Leu Leu Glu Lys His Gly1 5 10
15Pro Ala Leu Phe Leu Thr Ile Asn Arg Pro Asp Val Arg Asn
Ala Met 20 25 30Ser Leu Gln
Met Val Ala Glu Leu Ser Thr Ile Phe Asn Gln Ile Glu 35
40 45Gln Asp Asn Thr Ile Arg Ala Val Val Ile Arg
Gly Lys Asp Gly His 50 55 60Phe Cys
Ala Gly Gly Asp Ile Lys Asp Met Ala Gly Ala Arg Gly Gln65
70 75 80Lys Ala Asp Glu Gly Gln His
Asp Pro Phe Tyr Lys Leu Asn Arg Ala 85 90
95Phe Gly His Met Ile Gln Gln Val Asn Glu Ser Ser Lys
Val Val Ile 100 105 110Ala Val
Thr Glu Gly Ala Val Met Gly Gly Gly Phe Gly Leu Ala Cys 115
120 125Val Ser Asp Val Ala Ile Ala Gly Pro Thr
Ala Arg Phe Gly Met Pro 130 135 140Glu
Thr Ser Leu Gly Val Ile Pro Ala Gln Ile Ala Pro Phe Val Val145
150 155 160Glu Arg Ile Gly Leu Thr
Gln Ala Arg Arg Leu Ala Leu Leu Gly Leu 165
170 175Arg Ile Asp Ala Arg Glu Ala Cys Ala Leu Gly Ile
Val His Gln Ala 180 185 190Ala
Asp Ser Glu Thr Gln Leu Glu Glu Leu Leu Gln Ala Thr Leu Glu 195
200 205Arg Val Arg Leu Cys Ala Pro Asn Ala
Thr Ala Glu Thr Lys Ala Leu 210 215
220Leu His Arg Val Gly His Glu Pro Met Asn Lys Leu Leu Asp Ser Ala225
230 235 240Ala Glu Thr Phe
Ala Glu Ala Ile Arg Gly Pro Glu Gly Ala Glu Gly 245
250 255Thr Met Ala Phe Met Gln Lys Arg Glu Pro
Lys Trp Ala Asp Asp Ser 260 265
270Asn89265PRTPseudomonas knackmussii 89Met Ser Glu Leu Pro Asn Cys Glu
Thr Leu Leu Leu Glu Arg Asp Gly1 5 10
15Gly Val Leu His Val Thr Leu Asn Arg Pro Asp Ser Arg Asn
Ala Met 20 25 30Ser Leu Ala
Met Val Gly Glu Leu Arg Ala Val Leu Ala Ala Val Arg 35
40 45Asp Asp Arg Ala Val Arg Ala Ile Val Leu Arg
Gly Ala Gly Gly His 50 55 60Phe Cys
Ala Gly Gly Asp Ile Lys Asp Met Ala Gly Ala Arg Ala Ala65
70 75 80Gly Thr Asp Ala Tyr Ala Lys
Leu Asn Arg Ala Phe Gly Ser Leu Leu 85 90
95Glu Glu Ala Gln Ala Gln Pro Gln Val Leu Val Ala Val
Leu Glu Gly 100 105 110Ala Val
Leu Gly Gly Gly Phe Gly Leu Ala Cys Val Ser Asp Ile Ala 115
120 125Ile Ala Ala Asp Gly Ala Gln Phe Gly Leu
Pro Glu Thr Thr Leu Gly 130 135 140Ile
Leu Pro Ala Gln Ile Ala Pro Phe Val Ala Lys Arg Val Gly Leu145
150 155 160Thr Gln Ala Arg Arg Leu
Ala Leu Thr Ala Ala Arg Phe Asp Gly Arg 165
170 175Glu Ala Leu Arg Leu Gly Leu Val His Phe Ser Glu
Ala Asp Ala Asp 180 185 190Ala
Leu Gly Gln Arg Leu Ala Asp Cys Leu Glu Gln Val Arg Arg Cys 195
200 205Ala Pro Gly Ala Asn Ala Ala Thr Lys
Ala Leu Leu Leu Ala Thr Glu 210 215
220Arg Glu Glu Leu Gly Ser Leu Leu Asp Gly Ala Ala Arg Gln Phe Ala225
230 235 240Glu Ala Val Thr
Gly Ser Glu Gly Ala Glu Gly Thr Met Ala Phe Val 245
250 255Gln Lys Arg Lys Pro Asn Trp Ala Gln
260 26590264PRTPseudomonas pseudoalcaligenes 90Met
Glu Leu Pro Lys Thr Glu Thr Leu Leu Leu Glu His Ala Asp Gly1
5 10 15Leu Leu Arg Ile Thr Leu Asn
Arg Pro Glu Ser Arg Asn Ala Met Ser 20 25
30Leu Ala Met Val Glu Glu Leu Arg Ala Val Leu Ala Ala Ala
Arg Arg 35 40 45Ala Pro Glu Val
Arg Val Leu Ala Leu Arg Gly Ala Gly Gly His Phe 50 55
60Cys Ala Gly Gly Asp Ile Lys Asp Met Ala Ser Ala Arg
Ala Thr Gly65 70 75
80Gly Glu Ala Tyr Gln Arg Leu Asn Arg Ala Phe Gly Arg Leu Leu Glu
85 90 95Glu Ala Gln Ala Gln Pro
Gln Val Val Ile Ala Val Leu Glu Gly Ala 100
105 110Val Leu Gly Gly Gly Phe Gly Leu Ala Cys Val Ser
Asp Ile Ala Leu 115 120 125Ala Ala
Glu Ser Ala Gln Phe Gly Leu Pro Glu Thr Ser Leu Gly Ile 130
135 140Leu Pro Ala Gln Ile Ala Pro Phe Val Val Lys
Arg Val Gly Leu Thr145 150 155
160Gln Ala Arg Arg Leu Ala Leu Thr Ala Ala Arg Phe Asp Gly Thr Glu
165 170 175Ala Leu Arg Leu
Gly Leu Val His Phe Thr Glu Ala Asp Asp Ala Ala 180
185 190Leu Asp Ala Arg Leu Ala Ala Thr Leu Asp Gln
Val Arg Arg Cys Ala 195 200 205Pro
Gly Ala Asn Ala Arg Thr Lys Ala Leu Leu Leu Ala Thr Glu Glu 210
215 220Arg Glu Leu Gly Pro Leu Leu Asp Asp Ala
Ala Ala Trp Phe Ala Glu225 230 235
240Ala Val Thr Ser Ala Glu Gly Thr Glu Gly Thr Leu Ala Phe Val
Gln 245 250 255Lys Arg Lys
Pro Thr Trp Ala Gln 26091264PRTPseudomonas flexibilis 91Met
Ala Asp Leu Pro His Cys Asp Thr Leu Leu Leu Asn Leu Asp Ala1
5 10 15Gly Val Leu His Ile Thr Leu
Asn Arg Pro Asp Ser Arg Asn Ala Met 20 25
30Ser Leu Ala Met Val His Glu Leu Arg Ala Val Leu Glu Ser
Val Arg 35 40 45Asn Asp Pro Ala
Val Arg Ala Leu Val Leu Arg Gly Ala Gly Gly His 50 55
60Phe Cys Ala Gly Gly Asp Ile Lys Asp Met Ala Gly Ala
Arg Ala Lys65 70 75
80Gly His Asp Ala Tyr Arg Asp Leu Asn Arg Ala Phe Gly Ala Leu Leu
85 90 95Glu Glu Ala Gln Ala Ala
Pro Gln Val Val Val Ala Val Leu Glu Gly 100
105 110Ala Val Leu Gly Gly Gly Phe Gly Leu Ala Cys Val
Ser Asp Ile Ala 115 120 125Ile Ala
Ala Glu Gly Cys Lys Phe Gly Leu Pro Glu Thr Thr Leu Gly 130
135 140Ile Leu Pro Ala Gln Ile Ala Pro Phe Val Val
Lys Arg Val Gly Leu145 150 155
160Thr Gln Ala Arg Arg Leu Ala Leu Thr Ala Ala Arg Phe Asp Gly Ala
165 170 175Glu Ala Leu Arg
Leu Gly Leu Val His Tyr Cys Glu Ala Ala Asp Arg 180
185 190Leu Asp Ser Arg Leu Ala Glu Val Ile Gln Gln
Val Arg Gln Cys Ala 195 200 205Pro
Gln Ala Asn Ala Gln Thr Lys Ala Leu Leu Leu Ala Ser Glu Thr 210
215 220Glu Ala Met Asn Ser Leu Leu Asp Arg Ala
Ala Glu Gln Phe Ala Ala225 230 235
240Ala Val Thr Gly Ala Glu Gly Val Glu Gly Thr Met Ala Phe Val
Gln 245 250 255Lys Arg Ala
Pro Lys Trp Ala Gln 26092271PRTAlcanivorax dieselolei 92Met
Thr Leu Pro Glu Thr Glu Thr Ile Thr Leu His Arg Asp Gly Thr1
5 10 15Thr Leu Ser Val Thr Leu Asn
Arg Pro Gln Ser Arg Asn Ala Met Ser 20 25
30Leu Ile Met Val Asp Glu Leu Met Ala Val Phe Asp Trp Val
Glu Ala 35 40 45Asn Pro Asp Val
Arg Ala Val Val Leu Arg Gly Ala Gly Gly His Phe 50 55
60Cys Ala Gly Gly Asp Ile Lys Asp Met Ala Gly Ala Arg
Gln Gln Ala65 70 75
80Ala Ala Gly Asp Asp Gln Ala Phe Phe Thr Leu Asn Arg Arg Phe Gly
85 90 95Ala Met Val Ser Arg Ala
Glu Arg Leu Pro Ala Val Leu Val Cys Val 100
105 110Leu Glu Gly Ala Val Leu Gly Gly Gly Phe Gly Leu
Ala Cys Val Ser 115 120 125Asp Val
Ala Leu Ala Ala Gly Asp Ala Arg Phe Gly Leu Pro Glu Thr 130
135 140Gly Leu Gly Val Ile Pro Ala Gln Ile Ala Pro
Phe Val Val Arg Arg145 150 155
160Ile Gly Leu Thr Gln Ala Arg Arg Leu Ala Leu Thr Gly Gly Arg Phe
165 170 175Asp Gly His Gly
Ala Gln Ala Leu Gly Val Val His Glu Val Ala Asp 180
185 190Ser Thr Glu Glu Leu Glu Gln Arg Leu Arg Gln
Val Leu Glu Gln Ile 195 200 205Arg
Arg Cys Ala Pro His Ala Asn Arg Val Thr Lys Gln Leu Val Leu 210
215 220Ser Val Asp Glu Gln Pro Leu Asp Ala Val
Leu Asp Gln Ala Ala Arg225 230 235
240Asp Phe Ala Asn Ala Val Thr Ser Glu Glu Gly Gln Glu Gly Thr
Leu 245 250 255Ala Phe Val
Gln Lys Arg Ala Pro Ser Trp Ser Thr Asp Lys Glu 260
265 270933343DNAArtificial SequencePlasmid name pGB
5796 93tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca
60cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg
120ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc
180accatatgcg gtgtgaaata ccgcacagat gcgtaaggag aaaataccgc atcaggcgcc
240attcgccatt caggctgcgc aactgttggg aagggcgatc ggtgcgggcc tcttcgctat
300tacgccagct ggcgaaaggg ggatgtgctg caaggcgatt aagttgggta acgccagggt
360tttcccagtc acgacgttgt aaaacgacgg ccagtgccaa gcttgcggcc gcggggttaa
420ttaatttctc ctctttaata aagcaaataa attttttatg atttgtttaa acctaggcat
480gcctctagat tattatgcgc cctgccagcg ggcaaagaga tcttcaggaa gggttatcgc
540aaactggtca agaacacgat taaccgtctg atttatcaca tcatcaaggg attgcgggcg
600atgataaaac gccggaacgg gaggcataat caccgcaccg atttctgccg cctgagtcat
660taaacgcaga tggcctaagt gcaatggtgt ttcacgcacg cagagcacca acgggcgacg
720ctctttcagc accacatctg ccgcacgggt cagtaagcca tcagtatagc tatggacaat
780gccggaaagg gttttgattg aacagggtaa aatcaccatc cccagcgtct ggaaagaacc
840ggaagagatg ctggcggcaa tatcgcgcgc atcgtgcgtg acatcggcta atgcctgcac
900ttcgcgcaga gaaaaatccg tttcgaggga taaggtctgg cgcgctgcct ggctcatcac
960cagatgcgtt tcgatatctg tgacatcgcg cagaacctgt aataagcgca cgccataaat
1020cgcgccgctg gcaccgctga tgcctacaat gagtcgtttc ataaaaaaaa tgtatatctc
1080cttcggtacc gagctcgaac ctgcaggaat tcgtaatcat ggtcatagct gtttcctgtg
1140tgaaattgtt atccgctcac aattccacac aacatacgag ccggaagcat aaagtgtaaa
1200gcctggggtg cctaatgagt gagctaactc acattaattg cgttgcgctc actgcccgct
1260ttccagtcgg gaaacctgtc gtgccagctg cattaatgaa tcggccaacg cgcggggaga
1320ggcggtttgc gtattgggcg ctcttccgct tcctcgctca ctgactcgct gcgctcggtc
1380gttcggctgc ggcgagcggt atcagctcac tcaaaggcgg taatacggtt atccacagaa
1440tcaggggata acgcaggaaa gaacatgtga gcaaaaggcc agcaaaaggc caggaaccgt
1500aaaaaggccg cgttgctggc gtttttccat aggctccgcc cccctgacga gcatcacaaa
1560aatcgacgct caagtcagag gtggcgaaac ccgacaggac tataaagata ccaggcgttt
1620ccccctggaa gctccctcgt gcgctctcct gttccgaccc tgccgcttac cggatacctg
1680tccgcctttc tcccttcggg aagcgtggcg ctttctcata gctcacgctg taggtatctc
1740agttcggtgt aggtcgttcg ctccaagctg ggctgtgtgc acgaaccccc cgttcagccc
1800gaccgctgcg ccttatccgg taactatcgt cttgagtcca acccggtaag acacgactta
1860tcgccactgg cagcagccac tggtaacagg attagcagag cgaggtatgt aggcggtgct
1920acagagttct tgaagtggtg gcctaactac ggctacacta gaaggacagt atttggtatc
1980tgcgctctgc tgaagccagt taccttcgga aaaagagttg gtagctcttg atccggcaaa
2040caaaccaccg ctggtagcgg tggttttttt gtttgcaagc agcagattac gcgcagaaaa
2100aaaggatctc aagaagatcc tttgatcttt tctacggggt ctgacgctca gtggaacgaa
2160aactcacgtt aagggatttt ggtcatgaga ttatcaaaaa ggatcttcac ctagatcctt
2220ttaaattaaa aatgaagttt taaatcaatc taaagtatat atgagtaaac ttggtctgac
2280agttaccaat gcttaatcag tgaggcacct atctcagcga tctgtctatt tcgttcatcc
2340atagttgcct gactccccgt cgtgtagata actacgatac gggagggctt accatctggc
2400cccagtgctg caatgatacc gcgagaccca cgctcaccgg ctccagattt atcagcaata
2460aaccagccag ccggaagggc cgagcgcaga agtggtcctg caactttatc cgcctccatc
2520cagtctatta attgttgccg ggaagctaga gtaagtagtt cgccagttaa tagtttgcgc
2580aacgttgttg ccattgctac aggcatcgtg gtgtcacgct cgtcgtttgg tatggcttca
2640ttcagctccg gttcccaacg atcaaggcga gttacatgat cccccatgtt gtgcaaaaaa
2700gcggttagct ccttcggtcc tccgatcgtt gtcagaagta agttggccgc agtgttatca
2760ctcatggtta tggcagcact gcataattct cttactgtca tgccatccgt aagatgcttt
2820tctgtgactg gtgagtactc aaccaagtca ttctgagaat agtgtatgcg gcgaccgagt
2880tgctcttgcc cggcgtcaat acgggataat accgcgccac atagcagaac tttaaaagtg
2940ctcatcattg gaaaacgttc ttcggggcga aaactctcaa ggatcttacc gctgttgaga
3000tccagttcga tgtaacccac tcgtgcaccc aactgatctt cagcatcttt tactttcacc
3060agcgtttctg ggtgagcaaa aacaggaagg caaaatgccg caaaaaaggg aataagggcg
3120acacggaaat gttgaatact catactcttc ctttttcaat attattgaag catttatcag
3180ggttattgtc tcatgagcgg atacatattt gaatgtattt agaaaaataa acaaataggg
3240gttccgcgca catttccccg aaaagtgcca cctgacgtct aagaaaccat tattatcatg
3300acattaacct ataaaaatag gcgtatcacg aggccctttc gtc
33439412214DNAArtificial SequencePlasmid name pGB 5771 94ctcactactt
tagtcagttc cgcagtatta caaaaggatg tcgcaaacgc tgtttgctcc 60tctacaaaac
agaccttaaa accctaaagg cttaagtagc accctcgcaa gctcgggcaa 120atcgctgaat
attccttttg tctccgacca tcaggcacct gagtcgctgt ctttttcgtg 180acattcagtt
cgctgcgctc acggctctgg cagtgaatgg gggtaaatgg cactacaggc 240gccttttatg
gattcatgca aggaaactac ccataataca agaaaagccc gtcacgcttc 300tcagggcgtt
ttatggcggg tctgctatgt ggtgctatct gactttttgc tgttcagcag 360ttcctgccct
ctgattttcc agtctgaccc tagtcaaggc cttaagtgag tcgtattacg 420gactggccgt
cgttttacaa cgtcgtgact gggaaaaccc tggcgttacc caacttaatc 480gccttgcagc
acatccccct ttcgccagct ggcgtaatag cgaagaggcc cgcaccgatc 540gcccttccca
acagttgcgc agcctgaatg gcgaatggcg cctgatgcgg tattttctcc 600ttacgcatct
gtgcggtatt tcacaccgcc cggggaacta tagtttaaac ttttcaatga 660attcatttaa
gcggccgcat caattctaga atttaaatag tcaaaagcct ccgaccggag 720gcttttgact
gacctattga caattaaagg ctaaaatgct ataattccac taatagaaat 780aattttgttt
aactttaggt ctctatcgta agaaggagat atatgaaaga agtggtgatt 840gccagcgcag
ttcgtaccgc aattggtagc tatggtaaaa gcctgaaaga tgttccggca 900gttgatctgg
gtgcaaccgc aattaaagaa gcagttaaaa aagccggtat taaaccggaa 960gatgtgaacg
aagttattct gggtaatgtt ctgcaagcag gtctgggtca gaatccggca 1020cgtcaggcct
cgtttaaagc aggtctgccg gttgaaattc cggcaatgac cattaacaaa 1080gtttgtggta
gcggtctgcg taccgttagc ctggcagcac agattatcaa agccggtgat 1140gcagatgtta
ttattgccgg tggtatggaa aatatgagcc gtgcaccgta tctggcaaat 1200aatgcacgtt
ggggttatcg tatgggtaat gccaaatttg tggatgagat gattaccgat 1260ggtctgtggg
atgcctttaa tgattatcac atgggtatta ccgcagagaa tattgcagaa 1320cgttggaata
ttagccgtga agaacaggat gaatttgcac tggcaagcca gaaaaaagca 1380gaagaagcaa
ttaaaagcgg tcagttcaaa gatgaaattg tgccggttgt tatcaaaggt 1440cgtaaaggtg
aaaccgttgt tgataccgat gaacatccgc gttttggtag caccattgaa 1500ggtctggcaa
aactgaaacc ggcattcaaa aaagatggca ccgttaccgc aggtaatgca 1560agcggtctga
atgattgtgc agcagttctg gttattatga gcgcagaaaa agcaaaagaa 1620ctgggtgtta
aaccgctggc aaaaattgtg agctatggta gtgccggtgt tgatccggca 1680attatgggtt
atggtccgtt ttatgcaacc aaagcagcaa ttgaaaaagc aggttggacc 1740gttgatgaac
tggatctgat tgaaagcaat gaagcatttg cagcacagag cctggcagtt 1800gcaaaagacc
tgaaattcga tatgaataaa gtgaatgtga atggcggtgc aattgccctg 1860ggtcatccga
ttggtgcaag cggtgcacgt attctggtta ccctggttca tgcaatgcag 1920aaacgtgatg
caaaaaaagg tctggccacc ctgtgtattg gtggtggtca gggcaccgca 1980attctgctgg
aaaaatgcta ataagcttga aggagatata atgaccattg gtattgataa 2040aatcagcttt
ttcgtgcctc cgtactatat tgatatgacc gcactggccg aagcacgtaa 2100tgttgatccg
ggtaaatttc atattggtat tggtcaggat cagatggccg ttaatccgat 2160tagccaggat
attgttacct ttgcagcaaa tgcagcagaa gcaattctga ccaaagaaga 2220taaagaggcc
attgatatgg ttattgttgg caccgaaagc agcattgatg aaagcaaagc 2280agcagcagtt
gttctgcatc gtctgatggg tattcagccg tttgcacgta gctttgaaat 2340taaagaagca
tgttacggag caaccgcagg tctgcaactg gcaaaaaatc atgttgcact 2400gcatccggat
aaaaaagttc tggttgttgc agcagatatt gccaaatatg gtctgaatag 2460cggtggtgaa
ccgacccagg gtgccggtgc agttgcaatg ctggttgcaa gcgaaccgcg 2520tattctggca
ctgaaagaag ataatgttat gctgacccag gatatttatg atttttggcg 2580tccgaccggt
catccgtatc cgatggttga tggtccgctg agcaatgaaa cctatattca 2640gagctttgca
caggtgtggg atgaacataa aaaacgtacc ggtctggatt tcgcagatta 2700tgatgcactg
gcatttcata tcccgtatac caaaatgggt aaaaaagcac tgctggccaa 2760aattagcgat
cagaccgaag ccgaacaaga acgcattctg gcacgttatg aagaaagcat 2820tgtttatagc
cgtcgtgtgg gtaatctgta taccggtagc ctgtatctgg gtctgattag 2880cctgctggaa
aatgcaacca ccctgaccgc aggtaatcag attggtctgt ttagctatgg 2940tagcggtgcc
gttgcagaat ttttcacagg tgaactggtt gcaggttatc agaatcatct 3000gcaaaaagaa
acccatctgg cactgctgga taatcgtacc gaactgagca ttgcagaata 3060tgaagcaatg
tttgcagaaa ccctggatac cgatattgat cagaccctgg aagatgaact 3120gaaatatagc
attagcgcca ttaataacac cgtgcgtagc tatcgtaact aataaggtag 3180aaggagatat
acatatgagt caggcgctaa aaaatttact gacattgtta aatctggaaa 3240aaattgagga
aggactcttt cgcggccaga gtgaagattt aggtttacgc caggtgtttg 3300gcggccaggt
cgtgggtcag gccttgtatg ctgcaaaaga gacggtccct gaagaacggc 3360tggtacattc
gtttcacagc tactttcttc gccctggcga tagtaagaag ccgattattt 3420atgatgtcga
aacgctgcgt gacggtaaca gcttcagcgc ccgccgggtt gctgctattc 3480aaaacggcaa
accgattttt tatatgactg cctctttcca ggcaccagaa gcgggtttcg 3540aacatcaaaa
aacaatgccg tccgcgccag cgcctgatgg cctcccttcg gaaacgcaaa 3600tcgcccaatc
gctggcgcac ctgctgccgc cagtgctgaa agataaattc atctgcgatc 3660gtccgctgga
agtccgtccg gtggagtttc ataacccact gaaaggtcac gtcgcagaac 3720cacatcgtca
ggtgtggatt cgcgcaaatg gtagcgtgcc ggatgacctg cgcgttcatc 3780agtatctgct
cggttacgct tctgatctta acttcctgcc ggtagctcta cagccgcacg 3840gcatcggttt
tctcgaaccg gggattcaga ttgccaccat tgaccattcc atgtggttcc 3900atcgcccgtt
taatttgaat gaatggctgc tgtatagcgt ggagagcacc tcggcgtcca 3960gcgcacgtgg
ctttgtgcgc ggtgagtttt atacccaaga cggcgtactg gttgcctcga 4020ccgttcagga
aggggtgatg cgtaatcaca attaataaga acgaaggaga tataatgaaa 4080accgcacgtt
ggtgtagcct ggaagaagca gttgcaagca ttccggatgg tgcaagcctg 4140gcaaccggtg
gttttatgct gggtcgtgca ccgatggcac tggttatgga actgattgca 4200cagggtaaac
gtgatctggg tctgattagc ctgccgaatc cgctgccagc agaatttctg 4260gttgccggtg
gttgtctggc tcgtctggaa attgcatttg gtgcactgag tctgcaaggt 4320cgtgttcgtc
cgatgccgtg tctgaaacgt gcaatggaac agggcaccct ggcatggcgt 4380gaacatgatg
gttatcgtgt tgttcagcgt ctgcgtgcag caagcatggg tctgccgttt 4440attccggcac
cggatgcaga tgttagcggt ctggcacgta ccgaaccgcc tccgaccgtt 4500gaagatccgt
ttaccggtct gcgtgttgca gttgaaccgg cattttatcc ggatgttgca 4560ctgctgcacg
cacgtgcagc cgatgaacgt ggtaatctgt atatggaaga tccgaccacc 4620gatctgctgg
ttgcgggtgc agcaaaacgt gttattgcaa ccgttgaaga acgtgttgca 4680aaactgcctc
gtgcaaccct gcctggtttt caggttgatc gtattgttct ggcaccgggt 4740ggtgcactgc
cgaccggttg tgcaggtctg tatccgcatg atgatgaaat gctggcacgt 4800tatctgagcc
tggcagaaac cggtcgtgaa gccgaatttc tggaaaccct gctgacccgt 4860cgtgcagcat
aatgaggatc cgaaggagat atacatatga gcgcaaccct ggatattaca 4920ccggcagaaa
ccgttgttag cctgctggca cgtcagattg atgatggtgg tgttgttgca 4980accggtgttg
caagtccgct ggcaattctg gccattgcag ttgcacgtgc cacccatgca 5040ccggatctga
cctatctggc atgtgttggt agcctggacc cggaaattcc gaccctgctg 5100ccgagcagcg
aagacctggg ttatctggat ggtcgtagcg cagaaattac cattccggac 5160ctgtttgatc
atgcacgtcg tggtcgtgtt gataccgttt tttttggtgc agccgaagtt 5220gatgccgaag
gtcgtaccaa tatgaccgca agcggtagtc tggataaacc gcgtaccaaa 5280tttccgggtg
ttgccggtgc agccaccctg cgtcagtggg ttcgtcgtcc ggttctgctg 5340gttccgcgtc
agagccgtcg taatctggtt ccggaagttc aggttgcaac cacccgtgat 5400ccgcgtcgtc
cggtgaccct gattagcgat ctgggtgttt ttgaactggg tgcaagcggt 5460gcacgtctgc
tggcacgcca tccgtgggca agcgaagaac atattgcaga acgtaccggt 5520tttgcatttc
aggttagcga agcactgagc gttaccagcc tgccggatgc acgtaccgtt 5580gcagcaattc
gtgcaattga tccgcatggc tatcgtgatg cactggttgg tgcataatta 5640gtcagaagga
gatatacata tgagcctgcc gcattgtgaa accctgctgc tggaaccgat 5700tgaaggtgtt
ctgcgtatta ccctgaatcg tccgcagagc cgtaatgcaa tgagcctggc 5760aatggttggt
gaactgcgtg cagttctggc agcagttcgt gatgatcgta gcgttcgtgc 5820actggttctg
cgtggtgcag atggtcattt ttgtgccggt ggtgatatta aagatatggc 5880aggcgcacgt
gcagccggtg cagaagcata tcgtacactg aatcgtgcat ttggtagcct 5940gctggaagaa
gcacaggcag caccgcagct gctggttgca ctggttgaag gtgccgttct 6000gggtggtggt
tttggtctgg catgtgttag tgatgttgca attgcagcag cagatgcaca 6060gtttggtctg
ccggaaacca gcctgggtat tctgcctgca cagattgcac cgtttgttgt 6120tcgtcgtatt
ggtctgaccc aggcacgtcg tctggcactg accgcagcac gttttgatgg 6180tcgtgaagca
ctgcgtctgg gtctggttca tttttgtgaa gcagatgcag atgcactgga 6240acagcgtctg
gaagaaaccc tggaacagct gcgtcgttgt gcaccgaatg caaatgcagc 6300aaccaaagca
ctgctgctgg caagcgaaag cggtgaactg ggtgcactgc tggatgatgc 6360agcacgtcag
tttgccgaag cagttggtgg tgcagaaggt agcgaaggca ccctggcatt 6420tgttcagaaa
cgtaaaccgg tttgggcaca gtaataatga aagagaccag cctgatacag 6480attaaatcag
aacgcagaag cggtctgata aaacagaatt tgcctggcgg cagtagcgcg 6540gtggtcccac
ctgaccccat gccgaactca gaagtgaaac gccgtagcgc cgatggtagt 6600gtggggtcac
cccatgcgag agtagggaac tgccaggcat caaataaaac gaaaggctca 6660gtcgaaagac
tgggcctttc gttttatctg ttgtttgtcg gtgaactact agaatttaaa 6720tagtcaaaag
cctccgaccg gaggcttttg actgacctat tgacaattaa aggctaaaat 6780gctataattc
cactaataga aataattttg tttaacttta ggtctctatc gaccataatt 6840aattaacttt
aagaaggaga tatacatatg agcagcacca cctataaaag cgaagcattt 6900gatccggaac
cgcctcatct gagctttcgt agctttgttg aagcactgcg tcaggataat 6960gatctggtgg
atattaatga accggttgat ccggatctgg aagcagcagc aattacccgt 7020ctggtttgtg
aaaccgatga taaagcaccg ctgtttaata acgtgattgg tgcaaaagat 7080ggtctgtggc
gtattctggg tgcaccggca agcctgcgta gcagcccgaa agaacgtttt 7140ggtcgtctgg
cacgtcatct ggcactgcct ccgaccgcaa gcgcaaaaga tattctggat 7200aaaatgctga
gcgccaatag cattccgcct attgaaccgg ttattgttcc gaccggtccg 7260gttaaagaaa
atagcattga aggcgaaaac attgatctgg aagccctgcc tgcaccgatg 7320gttcatcaga
gtgatggtgg caagtatatc cagacctatg gtatgcatgt tatccagagt 7380ccggatggtt
gttggaccaa ttggagcatt gcccgtgcaa tggttagcgg taaacgtacc 7440ctggcaggtc
tggttattag tccgcagcat attcgtaaaa ttcaggatca gtggcgtgca 7500attggtcaag
aagaaattcc ttgggcactg gcatttggtg ttccgcctac cgcaattatg 7560gcaagcagta
tgccgattcc ggatggtgtt agcgaagcag gttatgttgg tgcaattgcc 7620ggtgaaccga
ttaaactggt taaatgcgat accaacaatc tgtatgttcc ggcaaatagc 7680gaaattgttc
tggaaggcac cctgagcacc accaaaatgg caccggaagg tccgtttggt 7740gaaatgcatg
gttatgttta tccgggtgaa agccatccgg gtccggttta taccgttaac 7800aaaattacct
atcgcaacaa tgcaattctg ccgatgagcg catgtggtcg tctgaccgat 7860gaaacccaga
ccatgattgg caccctggca gcagcagaaa ttcgtcagct gtgtcaggat 7920gcaggtctgc
cgattaccga tgcatttgca ccgtttgttg gtcaggcaac ctgggttgca 7980ctgaaagttg
ataccaaacg tctgcgtgca atgaaaacca atggtaaagc atttgcaaaa 8040cgtgttggtg
atgttgtgtt tacccagaaa ccgggtttta ccattcatcg tctgattctg 8100gttggtgatg
atattgatgt gtatgacgat aaagatgtga tgtgggcatt taccacccgt 8160tgtcgtccgg
gtacagatga agtttttttt gatgatgttg tgggctttca gctgatcccg 8220tatatgagtc
atggtaatgc cgaagcaatt aaaggtggta aagttgttag tgatgcactg 8280ctgaccgcag
aatataccac cggtaaagat tgggaaagcg cagatttcaa aaacagctat 8340ccgaaaagca
tccaggataa agttctgaat agctgggaac gcctgggttt caaaaaactg 8400gattaataac
catggttata agagagacca gcctgactcc tgttgataga tccagtaatg 8460acctcagaac
tccatctgga tttgttcaga acgctcggtt gccgccgggc gttttttatt 8520ggtgagaata
actactagtt ggcgggcggc cgcttagctc tgcagatgag aaattcttga 8580agacgaaagg
gcctcgtgat acgcctattt ttataggtta atgtcatgat aataatggtt 8640taagcttctt
agaatagctc ttctatgagg tggcactttt cggggaaaga tatccgcata 8700tatggtgcac
tctcagtaca atctgctctg atgccgcata gttaagccag tatacactcc 8760gctatcgcta
cgtgactggg tcatggctgc gccccgacac ccgccaacac ccgctgacgc 8820gccctgacgg
gcttgtctgc tcccggcatc cgcttacaga caagctgtga ccgtctccgg 8880gagctgcatg
tgtcagaggt tttcaccgtc atcaccgaaa cgcgcgaggc agctgcggta 8940aagctcatca
gcgtggtcgt gaagcgattc acagatgtct gcctgttcat cggtaccttt 9000catgatatat
ctcccaattt gtgtagggct tattatgcac gcttaaaaat aataaaagca 9060gacttgacct
gatagtttgg ctgtgagcaa ttatgtgctt agtgcatcta acgcttgagt 9120taagccgcgc
cgcgaagcgg cgtcggcttg aacgaattgt tagacattat ttgccgacta 9180ccttggtgat
ctcgcctttc acgtagtgga caaattcttc caactgatct gcgcgcgagg 9240ccaagcgatc
ttcttcttgt ccaagataag cctgtctagc ttcaagtatg acgggctgat 9300actgggccgg
caggcgctcc attgcccagt cggcagcgac atccttcggc gcgattttgc 9360cggttactgc
gctgtaccaa atgcgggaca acgtaagcac tacatttcgc tcatcgccag 9420cccagtcggg
cggcgagttc catagcgtta aggtttcatt tagcgcctca aatagatcct 9480gttcaggaac
cggatcaaag agttcctccg ccgctggacc taccaaggca acgctatgtt 9540ctcttgcttt
tgtcagcaag atagccagat caatgtcgat cgtggctggc tcgaagatac 9600ctgcaagaat
gtcattgcgc tgccattctc caaattgcag ttcgcgctta gctggataac 9660gccacggaat
gatgtcgtcg tgcacaacaa tggtgacttc tacagcgcgg agaatctcgc 9720tctctccagg
ggaagccgaa gtttccaaaa ggtcgttgat caaagctcgc cgcgttgttt 9780catcaagcct
tacggtcacc gtaaccagca aatcaatatc actgtgtggc ttcaggccgc 9840catccactgc
ggagccgtac aaatgtacgg ccagcaacgt cggttcgaga tggcgctcga 9900tgacgccaac
tacctctgat agttgagtcg atacttcggc gatcaccgct tccctcatga 9960tgtttaactt
tgttttaggg cgactgccct gctgcgtaac atcgttgctg ctccataaca 10020tcaaacatcg
acccacggcg taacgcgctt gctgcttgga tgcccgaggc atagactgta 10080ccccaaaaaa
acagtcataa caagccatga aaaccgccac gagctcctgt cagaccaagt 10140ttacgagctc
gcttggactc ctgttgatag atccagtaat gacctcagaa ctccatctgg 10200atttgttcag
aacgctcggt tgccgccggg cgttttttat tggtgagaat ccaagcacta 10260gggacagtaa
gacgggtaag cctgttgatg ataccgctgc cttactgggt gcattagcca 10320gtctgaatga
cctgtcacgg gataatccga agtggtcaga ctggaaaatc agagggcagg 10380aactgctgaa
cagcaaaaag tcagatagca ccacatagca gacccgccat aaaacgccct 10440gagaagcccg
tgacgggctt ttcttgtatt atgggtagtt tccttgcatg aatccataaa 10500aggcgcctgt
agtgccattt acccccattc actgccagag ccgtgagcgc agcgaactga 10560atgtcacgaa
aaagacagcg actcaggtgc ctgatggtcg gagacaaaag gaatattcag 10620cgatttgccc
gagcttgcga gggtgctact taagccttta gggttttaag gtctgttttg 10680tagaggagca
aacagcgttt gcgacatcct tttgtaatac tgcggaactg actaaagtag 10740tgagttatac
acagggctgg gatctattct ttttatcttt ttttattctt tctttattct 10800ataaattata
accacttgaa tataaacaaa aaaaacacac aaaggtctag cggaatttac 10860agagggtcta
gcagaattta caagttttcc agcaaaggtc tagcagaatt tacagatacc 10920cacaactcaa
aggaaaagga catgtaatta tcattgacta gcccatctca attggtatag 10980tgattaaaat
cacctagacc aattgagatg tatgtctgaa ttagttgttt tcaaagcaaa 11040tgaactagcg
attagtcgct atgacttaac ggagcatgaa accaagctaa ttttatgctg 11100tgtggcacta
ctcaacccca cgattgaaaa ccctacaagg aaagaacgga cggtatcgtt 11160cacttataac
caatacgctc agatgatgaa catcagtagg gaaaatgctt atggtgtatt 11220agctaaagca
accagagagc tgatgacgag aactgtggaa atcaggaatc ctttggttaa 11280aggctttgag
attttccagt ggacaaacta tgccaagttc tcaagcgaaa aattagaatt 11340agtttttagt
gaagagatat tgccttatct tttccagtta aaaaaattca taaaatataa 11400tctggaacat
gttaagtctt ttgaaaacaa atactctatg aggatttatg agtggttatt 11460aaaagaacta
acacaaaaga aaactcacaa ggcaaatata gagattagcc ttgatgaatt 11520taagttcatg
ttaatgcttg aaaataacta ccatgagttt aaaaggctta accaatgggt 11580tttgaaacca
ataagtaaag atttaaacac ttacagcaat atgaaattgg tggttgataa 11640gcgaggccgc
ccgactgata cgttgatttt ccaagttgaa ctagatagac aaatggatct 11700cgtaaccgaa
cttgagaaca accagataaa aatgaatggt gacaaaatac caacaaccat 11760tacatcagat
tcctacctac gtaacggact aagaaaaaca ctacacgatg ctttaactgc 11820aaaaattcag
ctcaccagtt ttgaggcaaa atttttgagt gacatgcaaa gtaagcatga 11880tctcaatggt
tcgttctcat ggctcacgca aaaacaacga accacactag agaacatact 11940ggctaaatac
ggaaggatct gaggttctta tggctcttgt atctatcagt gaagcatcaa 12000gactaacaaa
caaaagtaga acaactgttc accgttagat atcaaaggga aaactgtcca 12060taagcacaga
tgaaaacggt gtaaaaaaga tagatacatc agagctttta cgagtttttg 12120gtgcatttaa
agctgttcac catgaacaga tcgacaatgt aacgcatgca ccgagcgcag 12180cgagtcagtg
agcgaggaag cggaacagcg cctg
1221495274PRTUstilago maydis 95Met Thr Ala Ser Ala Leu Ala Tyr Leu Glu
Pro Asp Ser Ser Ala Glu1 5 10
15Leu Thr Gly Val Tyr His Leu Val Leu Asp Arg Pro Glu Ala Arg Asn
20 25 30Ala Ile Ser Arg Ser Leu
Leu Gln Asp Val Leu Gln Cys Leu Gln Val 35 40
45Leu Val Cys Lys Ile Thr Gln Pro Lys Gln Asp Glu Pro Leu
Pro Arg 50 55 60Val Leu Ile Leu Arg
Ala Asn Gly Pro Cys Phe Cys Ala Gly Ala Asp65 70
75 80Leu Lys Glu Arg Arg Glu Met Ser Glu Ala
Glu Val Ile Glu Phe Leu 85 90
95Gln Asp Leu Arg His Met Leu Glu Gln Val Glu Lys Leu Pro Ile Pro
100 105 110Thr Leu Ala Ala Ile
Asp Gly Pro Ala Leu Gly Gly Gly Leu Glu Leu 115
120 125Ala Leu Ala Cys Asp Phe Arg Ile Ala Ala Glu Thr
Val Ser Lys Ile 130 135 140Gly Phe Pro
Glu Val Lys Leu Gly Ile Ile Pro Gly Ala Gly Gly Thr145
150 155 160Gln Arg Ala Pro Arg Ile Ile
Gly Met Gln Arg Ala Lys Glu Leu Ile 165
170 175Tyr Thr Gly Thr Gln Leu Asn Ala Thr Gln Ala Lys
Asp Leu Gly Leu 180 185 190Ile
Asp His Val Ala Pro Gly Ser Thr Cys Leu Lys Leu Cys Gln Glu 195
200 205Leu Ala Gln Gln Met Met Pro Ser Ala
Pro Leu Ala Leu Arg Ala Ala 210 215
220Lys Met Ala Ile Ser Met Gly Ala Asn Val Glu Leu Ala Arg Gly Leu225
230 235 240Asp Leu Glu Trp
Ala Cys Tyr Glu Pro Leu Leu Glu Ser Lys Asp Arg 245
250 255Arg Glu Ala Leu Asp Ala Phe Gln Gln Lys
Arg Lys Pro Ile Phe Thr 260 265
270Gly Lys96262PRTUnknownBacillus sp. GeD10 96Met Leu Gln Leu Gln Asn
Ile Ser Val Asp Tyr Val Thr Pro His Val1 5
10 15Val Lys Ile Ser Leu Tyr Arg Glu Arg Gln Ala Asn
Ser Leu Ser Leu 20 25 30Ala
Leu Leu Glu Glu Leu Gln Asn Ile Leu Thr Gln Ile Ser Glu Glu 35
40 45Ser Asn Thr Arg Val Val Ile Leu Thr
Gly Ala Gly Glu Lys Ala Phe 50 55
60Cys Ala Gly Ala Asp Leu Lys Glu Arg Ala Gly Met Asn Glu Glu Gln65
70 75 80Val Arg His Ala Val
Ser Met Ile Arg Thr Thr Met Glu Met Val Glu 85
90 95Gln Leu Pro Gln Pro Val Ile Ala Ala Ile Asn
Gly Ile Ala Leu Gly 100 105
110Gly Gly Thr Glu Leu Ser Leu Ala Cys Asp Phe Arg Ile Ala Ala Glu
115 120 125Ser Ala Ser Leu Gly Leu Thr
Glu Thr Thr Leu Ala Ile Ile Pro Gly 130 135
140Ala Gly Gly Thr Gln Arg Leu Pro Arg Leu Ile Gly Val Gly Arg
Ala145 150 155 160Lys Glu
Leu Ile Tyr Thr Gly Arg Arg Ile Ser Ala Gln Glu Ala Lys
165 170 175Glu Tyr Gly Leu Val Glu Phe
Val Val Pro Ala Asn Leu Leu Glu Glu 180 185
190Lys Ala Ile Glu Ile Ala Glu Lys Ile Ala Ser Asn Gly Pro
Ile Ala 195 200 205Val Arg Leu Ala
Lys Glu Ala Ile Ser Asn Gly Ile Gln Val Asp Leu 210
215 220His Thr Gly Leu Gln Met Glu Lys Gln Ala Tyr Glu
Gly Val Ile His225 230 235
240Thr Lys Asp Arg Leu Glu Gly Leu Gln Ala Phe Lys Glu Lys Arg Thr
245 250 255Pro Thr Tyr Lys Gly
Glu 26097263PRTLabilithrix luteola 97Met Ala Asp Glu Ser Phe
Pro Val Glu Val Glu Gln Arg Gly Asn Val1 5
10 15Val Ile Trp Thr Ile Asp Arg Glu Ser Arg Met Asn
Ser Leu Ser Arg 20 25 30Ala
Thr Leu Phe Ala Leu Gly Lys Leu Thr Arg Glu Ala Val Ser Asn 35
40 45Pro Ser Val Arg Ala Ile Val Ile Thr
Gly Arg Gly Glu Lys Ala Phe 50 55
60Cys Ala Gly Ala Asp Leu Lys Glu Arg Gln Gly Met Thr Glu Asn Asp65
70 75 80Ile Arg Val Gln Val
Glu Leu Tyr Arg Ser Glu Leu Gly Pro Leu Asp 85
90 95Arg Ser Pro Lys Pro Val Ile Ala Ala Leu Asn
Gly Val Ala Phe Gly 100 105
110Gly Gly Leu Glu Leu Ala Leu Val Cys Asp Met Arg Val Ala Ala Ser
115 120 125His Ala Leu Ile Gly Leu Pro
Glu Thr Thr Leu Gly Ile Ile Pro Gly 130 135
140Ala Gly Gly Thr Gln Arg Leu Pro Arg Ile Val Gly Glu Ala Arg
Ala145 150 155 160Lys Glu
Met Ile Leu Leu Gly Arg Lys Leu Ser Ala Thr Glu Ala His
165 170 175Ala Trp Gly Leu Val Asn Arg
Val Thr Pro Glu Gly Ala Asn Val Val 180 185
190Glu Asp Thr Leu Ala Phe Ile Asp Pro Ile Ala Asn Gly Ala
Pro Ile 195 200 205Ala Gln Ala Ala
Ala Leu Glu Ala Ile Asp Arg Ser Phe Asp Thr Thr 210
215 220Leu Glu Leu Gly Leu Glu Leu Glu Lys Val Ser Tyr
Asp Lys Val Leu225 230 235
240Val Ser Glu Asp Arg Arg Glu Ala Leu Ala Ala Phe Ala Glu Lys Arg
245 250 255Lys Pro Gln Phe Lys
Gly Arg 26098258PRTMyxococcus xanthus 98Met Pro Glu Phe Lys
Val Asp Ala Arg Gly Pro Ile Glu Ile Trp Thr1 5
10 15Ile Asp Gly Glu Ser Arg Arg Asn Ala Ile Ser
Arg Ala Met Leu Lys 20 25
30Glu Leu Gly Glu Leu Val Thr Arg Val Ser Ser Ser Arg Asp Val Arg
35 40 45Ala Val Val Ile Thr Gly Ala Gly
Asp Lys Ala Phe Cys Ala Gly Ala 50 55
60Asp Leu Lys Glu Arg Ala Thr Met Ala Glu Asp Glu Val Arg Ala Phe65
70 75 80Leu Asp Gly Leu Arg
Arg Thr Phe Arg Ala Ile Glu Lys Ser Asp Cys 85
90 95Val Phe Ile Ala Ala Ile Asn Gly Ala Ala Leu
Gly Gly Gly Thr Glu 100 105
110Leu Ala Leu Ala Cys Asp Leu Arg Val Ala Ala Pro Ala Ala Glu Leu
115 120 125Gly Leu Thr Glu Val Lys Leu
Gly Ile Ile Pro Gly Gly Gly Gly Thr 130 135
140Gln Arg Leu Ala Arg Leu Val Gly Pro Gly Arg Ala Lys Asp Leu
Ile145 150 155 160Leu Thr
Ala Arg Arg Ile Asn Ala Ala Glu Ala Phe Ser Val Gly Leu
165 170 175Ala Asn Arg Leu Ala Pro Glu
Gly His Leu Leu Ala Val Ala Tyr Gly 180 185
190Leu Ala Glu Ser Val Val Glu Asn Ala Pro Ile Ala Val Ala
Thr Ala 195 200 205Lys His Ala Ile
Asp Glu Gly Thr Gly Leu Glu Leu Asp Asp Ala Leu 210
215 220Ala Leu Glu Leu Arg Lys Tyr Glu Glu Ile Leu Lys
Thr Glu Asp Arg225 230 235
240Leu Glu Gly Leu Arg Ala Phe Ala Glu Lys Arg Ala Pro Val Tyr Lys
245 250 255Gly
Arg99383PRTEnterococcus faecalis 99Met Thr Ile Gly Ile Asp Lys Ile Ser
Phe Phe Val Pro Pro Tyr Tyr1 5 10
15Ile Asp Met Thr Ala Leu Ala Glu Ala Arg Asn Val Asp Pro Gly
Lys 20 25 30Phe His Ile Gly
Ile Gly Gln Asp Gln Met Ala Val Asn Pro Ile Ser 35
40 45Gln Asp Ile Val Thr Phe Ala Ala Asn Ala Ala Glu
Ala Ile Leu Thr 50 55 60Lys Glu Asp
Lys Glu Ala Ile Asp Met Val Ile Val Gly Thr Glu Ser65 70
75 80Ser Ile Asp Glu Ser Lys Ala Ala
Ala Val Val Leu His Arg Leu Met 85 90
95Gly Ile Gln Pro Phe Ala Arg Ser Phe Glu Ile Lys Glu Ala
Cys Tyr 100 105 110Gly Ala Thr
Ala Gly Leu Gln Leu Ala Lys Asn His Val Ala Leu His 115
120 125Pro Asp Lys Lys Val Leu Val Val Ala Ala Asp
Ile Ala Lys Tyr Gly 130 135 140Leu Asn
Ser Gly Gly Glu Pro Thr Gln Gly Ala Gly Ala Val Ala Met145
150 155 160Leu Val Ala Ser Glu Pro Arg
Ile Leu Ala Leu Lys Glu Asp Asn Val 165
170 175Met Leu Thr Gln Asp Ile Tyr Asp Phe Trp Arg Pro
Thr Gly His Pro 180 185 190Tyr
Pro Met Val Asp Gly Pro Leu Ser Asn Glu Thr Tyr Ile Gln Ser 195
200 205Phe Ala Gln Val Trp Asp Glu His Lys
Lys Arg Thr Gly Leu Asp Phe 210 215
220Ala Asp Tyr Asp Ala Leu Ala Phe His Ile Pro Tyr Thr Lys Met Gly225
230 235 240Lys Lys Ala Leu
Leu Ala Lys Ile Ser Asp Gln Thr Glu Ala Glu Gln 245
250 255Glu Arg Ile Leu Ala Arg Tyr Glu Glu Ser
Ile Ile Tyr Ser Arg Arg 260 265
270Val Gly Asn Leu Tyr Thr Gly Ser Leu Tyr Leu Gly Leu Ile Ser Leu
275 280 285Leu Glu Asn Ala Thr Thr Leu
Thr Ala Gly Asn Gln Ile Gly Leu Phe 290 295
300Ser Tyr Gly Ser Gly Ala Val Ala Glu Phe Phe Thr Gly Glu Leu
Val305 310 315 320Ala Gly
Tyr Gln Asn His Leu Gln Lys Glu Thr His Leu Ala Leu Leu
325 330 335Asp Asn Arg Thr Glu Leu Ser
Ile Ala Glu Tyr Glu Ala Met Phe Ala 340 345
350Glu Thr Leu Asp Thr Asp Ile Asp Gln Thr Leu Glu Asp Glu
Leu Lys 355 360 365Tyr Ser Ile Ser
Ala Ile Asn Asn Thr Val Arg Ser Tyr Arg Asn 370 375
380100265PRTMyxococcus xanthus 100Met Lys Thr Ala Arg Trp
Cys Ser Leu Glu Glu Ala Val Ala Ser Ile1 5
10 15Pro Asp Gly Ala Ser Leu Ala Thr Gly Gly Phe Met
Leu Gly Arg Ala 20 25 30Pro
Met Ala Leu Val Met Glu Leu Ile Ala Gln Gly Lys Arg Asp Leu 35
40 45Gly Leu Ile Ser Leu Pro Asn Pro Leu
Pro Ala Glu Phe Leu Val Ala 50 55
60Gly Gly Cys Leu Ala Arg Leu Glu Ile Ala Phe Gly Ala Leu Ser Leu65
70 75 80Gln Gly Arg Val Arg
Pro Met Pro Cys Leu Lys Arg Ala Met Glu Gln 85
90 95Gly Thr Leu Ala Trp Arg Glu His Asp Gly Tyr
Arg Val Val Gln Arg 100 105
110Leu Arg Ala Ala Ser Met Gly Leu Pro Phe Ile Pro Ala Pro Asp Ala
115 120 125Asp Val Ser Gly Leu Ala Arg
Thr Glu Pro Pro Pro Thr Val Glu Asp 130 135
140Pro Phe Thr Gly Leu Arg Val Ala Val Glu Pro Ala Phe Tyr Pro
Asp145 150 155 160Val Ala
Leu Leu His Ala Arg Ala Ala Asp Glu Arg Gly Asn Leu Tyr
165 170 175Met Glu Asp Pro Thr Thr Asp
Leu Leu Val Ala Gly Ala Ala Lys Arg 180 185
190Val Ile Ala Thr Val Glu Glu Arg Val Ala Lys Leu Pro Arg
Ala Thr 195 200 205Leu Pro Gly Phe
Gln Val Asp Arg Ile Val Leu Ala Pro Gly Gly Ala 210
215 220Leu Pro Thr Gly Cys Ala Gly Leu Tyr Pro His Asp
Asp Glu Met Leu225 230 235
240Ala Arg Tyr Leu Ser Leu Ala Glu Thr Gly Arg Glu Ala Glu Phe Leu
245 250 255Glu Thr Leu Leu Thr
Arg Arg Ala Ala 260 265101246PRTMyxococcus
xanthus 101Met Ser Ala Thr Leu Asp Ile Thr Pro Ala Glu Thr Val Val Ser
Leu1 5 10 15Leu Ala Arg
Gln Ile Asp Asp Gly Gly Val Val Ala Thr Gly Val Ala 20
25 30Ser Pro Leu Ala Ile Leu Ala Ile Ala Val
Ala Arg Ala Thr His Ala 35 40
45Pro Asp Leu Thr Tyr Leu Ala Cys Val Gly Ser Leu Asp Pro Glu Ile 50
55 60Pro Thr Leu Leu Pro Ser Ser Glu Asp
Leu Gly Tyr Leu Asp Gly Arg65 70 75
80Ser Ala Glu Ile Thr Ile Pro Asp Leu Phe Asp His Ala Arg
Arg Gly 85 90 95Arg Val
Asp Thr Val Phe Phe Gly Ala Ala Glu Val Asp Ala Glu Gly 100
105 110Arg Thr Asn Met Thr Ala Ser Gly Ser
Leu Asp Lys Pro Arg Thr Lys 115 120
125Phe Pro Gly Val Ala Gly Ala Ala Thr Leu Arg Gln Trp Val Arg Arg
130 135 140Pro Val Leu Leu Val Pro Arg
Gln Ser Arg Arg Asn Leu Val Pro Glu145 150
155 160Val Gln Val Ala Thr Thr Arg Asp Pro Arg Arg Pro
Val Thr Leu Ile 165 170
175Ser Asp Leu Gly Val Phe Glu Leu Gly Ala Ser Gly Ala Arg Leu Leu
180 185 190Ala Arg His Pro Trp Ala
Ser Glu Glu His Ile Ala Glu Arg Thr Gly 195 200
205Phe Ala Phe Gln Val Ser Glu Ala Leu Ser Val Thr Ser Leu
Pro Asp 210 215 220Ala Arg Thr Val Ala
Ala Ile Arg Ala Ile Asp Pro His Gly Tyr Arg225 230
235 240Asp Ala Leu Val Gly Ala
245
User Contributions:
Comment about this patent or add new information about this topic: