Patent application title: MYCOPLASMA VACCINES AND USES THEREOF
Inventors:
IPC8 Class: AA61K3902FI
USPC Class:
1 1
Class name:
Publication date: 2019-01-31
Patent application number: 20190030153
Abstract:
Immunogenic proteins comprising Mycoplasma mycoides subsp. mycoides and
M. mycoides subsp. capri proteins, encoding polynucleotides, a method for
producing said proteins, and use of compositions to prevent M. mycoides
subsp. mycoides infections are disclosed.Claims:
1. An immunogenic protein selected from: (a) a fusion protein comprising
two or more Mycoplasma mycoides proteins selected from M. mycoides subsp.
mycoides (Mmm) and M. mycoides subsp. capri (Mmc) proteins; (b) an Mmm or
Mmc protein or fusion protein conjugated with an immunogenic carrier; (c)
variants of the proteins of (a) and (b); or (d) a protein corresponding
to (a) or (b) from another Mycoplasma strain, species or subspecies.
2. The immunogenic protein of claim 1, wherein the Mmm or Mmc protein or fusion protein comprises an Mmm and/or Mmc protein listed in Table 1 or Table 4, variants thereof, or the corresponding proteins from another Mycoplasma strain, species or subspecies.
3. The immunogenic protein of claim 1, wherein the Mmm or Mmc protein or fusion protein comprises (a) a protein comprising the amino acid sequence of SEQ ID NOS:2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26 or 28; (b) an Mmm protein present in the fusion of SEQ ID NO:75; (c) an Mmm protein present in the fusion of SEQ ID NO:77; (d) variants of (a), (b) and (c); or (e) the corresponding protein from another Mycoplasma strain, species or subspecies.
4. The immunogenic protein of claim 1, wherein the fusion protein is selected from: (a) a protein comprising the amino acid sequence of SEQ ID NO:51; (b) a protein comprising the amino acid sequence of SEQ ID NO:53; (c) a protein comprising amino acids 927-1421 of SEQ ID NO:75; (d) a protein comprising amino acids 927-1468 of SEQ ID NO:77; (e) variants of (a), (b), (c) and (d); or (f) a fusion protein comprising proteins corresponding to (a), (b), (c) and (d) from another Mycoplasma strain, species or subspecies.
5. The immunogenic protein of claim 1, wherein the Mmm or Mmc protein conjugated with a carrier comprises the amino acid sequence of an Mmm or Mmc protein listed in Table 4.
6. The immunogenic protein of claim 1, wherein the carrier is an RTX toxin.
7. The immunogenic protein of claim 6, wherein the carrier is a detoxified leukotoxin molecule.
8. The immunogenic protein of claim 7, wherein the amino acid sequence of the protein conjugate comprises the amino acid sequence of SEQ ID NOS:55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79 or 81, or a variant thereof.
9. A composition comprising at least one immunogenic protein according to claim 1, and a pharmaceutically acceptable excipient.
10. A composition comprising at least two immunogenic Mycoplasma mycoides subspecies mycoides (Mmm) and/or Mycoplasma mycoides subspecies capri (Mmc) proteins selected from the Mmm and Mmc proteins listed in Tables 1 and 4, immunogenic fragments or variants thereof, or the corresponding Mycoplasma proteins from another Mycoplasma strain, species or subspecies, and a pharmaceutically acceptable excipient.
11. The composition of claim 10, wherein the Mycoplasma proteins are selected from two or more proteins comprising the amino acid sequences of SEQ ID NOS:2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28; a protein comprising amino acids 927-1421 of SEQ ID NO:75; a protein comprising amino acids 927-1468 of SEQ ID NO:77; or variants thereof.
12. The composition of claim 10, comprising three to five Mycoplasma proteins.
13. The composition of claim 10, comprising four or five Mycoplasma proteins.
14. The composition of claim 10, wherein at least one of the proteins is selected from SEQ ID NOS:2, 4, 6, 8 or 10.
15. The composition of claim 10, wherein at least one of the proteins is selected from SEQ ID NOS:12, 14, 16, 18 or 20.
16. The composition of claim 10, wherein at least one of the proteins is selected from SEQ ID NOS:22, 24, 26 or 28.
17. The composition of claim 10, wherein the two or more proteins are provided as a fusion protein.
18. The composition of claim 10, wherein one or more of the proteins comprises an amino acid sequence with at least 90% sequence identity to SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26 or 28.
19. The composition of claim 10, further comprising an immunological adjuvant.
20. The composition of claim 19, wherein the immunological adjuvant comprises (a) a polyphosphazine; (b) a CpG oligonucleotide or a poly (I:C); and (c) a host defense peptide.
21. A DNA molecule modified for expression in E. coli selected from: SEQ ID NOS:1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25 or 27; or a DNA sequence that comprises a nucleotide sequence encoding an Mmm protein, wherein the DNA sequence is present in SEQ ID NOS: 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80.
22. A recombinant vector comprising: (a) one or more DNA molecules according to claim 21; and (b) control elements that are operably linked to said molecule whereby a coding sequence in said molecule can be transcribed and translated in a host cell.
23. A host cell transformed with the recombinant vector of claim 22.
24. A method of producing a Mycoplasma protein comprising: (a) providing a population of host cells according to claim 23; and (b) culturing said population of cells under conditions whereby the protein encoded by the DNA molecule present in said recombinant vector is expressed.
25. A method of treating or preventing a Mycoplasma infection in a vertebrate subject comprising administering a therapeutic amount of the composition of claim 9, to the subject.
26. The method of claim 25, wherein the subject is a bovine subject.
27. The method of claim 26, wherein the Mycoplasma infection is contagious bovine pleuropneumonia.
28-30. (canceled)
Description:
TECHNICAL FIELD
[0001] The present invention pertains generally to immunogenic compositions and methods for treating and/or preventing Mycoplasma infection. In particular, the invention relates to the use of multiple Mycoplasma antigens in subunit vaccine compositions to elicit immune responses against Mycoplasma infections such as contagious bovine pleuropneumonia.
BACKGROUND
[0002] Mycoplasma, belonging to the class Mollicutes, is a bacterium that lacks a cell wall and causes a number of diseases in humans, livestock, domestic animals and birds. Mycoplasma diseases cause serious illness in humans and other animals and also result in severe economic losses to the food industry.
[0003] For example, contagious bovine pleuropneumonia (CBPP) is a highly communicable lung disease in cattle caused by Mycoplasma mycoides subsp. mycoides (Mmm), previously specified as biotype small colony (Mmm SC) (Manso-Silvan et al., International Journal of Systematic and Evolutionary Microbiology (2009) 59:1353-1358). Currently, the disease is a major constraint to cattle production in Africa causing severe socio-economic consequences. For example, CBPP is included in the Office International des Epizooties (O.I.E.) reportable diseases and hence affected countries are excluded from international trade of live animals and embryos.
[0004] Many countries have successfully eradicated the disease by employing a combination of test, slaughter and vaccination. Historically CBPP was eradicated by eliminating the whole cattle herd wherever the disease was detected i.e. stamping-out. This strategy, however, does not prove realistic in some countries where it is considered too costly and logistically difficult to apply. Stamping-out is also problematic because CBPP occurs among pastoral communities where movement control is difficult to implement. Therefore, extensive vaccination programs remain the only viable option for CBPP control in Africa (Windsor, R. S., Annals of the New York Academy of Science, (2000) 916:326-332; March, J. B., Vaccine (2004) 22:4358-4364).
[0005] Vaccines against CBPP have included live attenuated strains of Mmm, such as V5, KH3J, T1/44 and its streptomycin-resistant derivative T1/SR. Although these vaccines confer some level of protection, they are constrained by low potency and efficacy (Karst, O., Research in Veterinary Science (1971) 12:18-22; Masiga et al., Reviews of Science and Technology Office of International Epizootics (1995) 14:611-620; Tulasne et al., Reviews of Science and Technology Office of International Epizootics (1996) 15:1373-1396; Nicholas et al., Veterinary Bulletin (2000) 70:827-838; Thiaucourt et al., Annals of the New York Academy of Science (2000) 916:71-80). Additionally, these vaccines are known to cause severe adverse effects post-vaccination (Daleel, E. E., Bulletin of Epizootic Diseases in Africa (1971) 20:199-202; Revell, S. G., Tropical Animal Health and Production (1973) 5:246-52; Provost et al., Reviews of Science and Technology Office of International Epizootics (1987) 6:625-679) and induce short-term immunity, one year or less (Egwu et al., Veterinary Bulletin (1996) 66:875-888. Thus, annual vaccination is necessary to achieve a sufficient level of protection (Thiaucourt et al., Annals of the New York Academy of Science (2000) 916:71-80).
[0006] A number of recombinant proteins from Mmm have been tested for their capacity to induce protection. It is known that variable surface proteins may enhance colonization of lung and may be differentially expressed between cultured or in vivo organisms. However, a combination of five variable surface proteins from Mmm did not provide protection against CBPP (Hamsten et al., Clinical and Vaccine Immunology (2010) 17:853-86). Another membrane protein, trans-membrane L-.alpha.-glycerol-3-phosphate oxidase (GlpO) was used to immunize cattle, but no protection was observed (Mulongo et al., Vaccine (2013) 31:5020-5025). Similarly, animals immunized against Lipoprotein Q (LppQ) were not protected, but exhibited significantly enhanced post-challenge pathology (Mulongo et al., Infect. Immun. (2015) 83:1992-2000).
[0007] However, the use of Mycoplasma proteins and nucleic acids as described herein in vaccine compositions has not heretofore been suggested. It is clear there remains an urgent need for the development of effective strategies for the treatment and prevention of Mycoplasma infection.
SUMMARY OF THE INVENTION
[0008] The present invention is based on the discovery of Mycoplasma proteins for use in subunit vaccine compositions that stimulate humoral, cellular and/or protective immune responses in animals and humans. A systematic approach was used to identify such proteins. In particular, reverse vaccinology was employed in which M. mycoides proteins were prioritized for their likelihood to protect against disease using bioinformatics and reactivity with antisera from infected cattle. The prioritized proteins were then tested for their capacity to induce antibody and proliferation reactions. A multitude of recombinant proteins that were identified as most likely to be immunogenic were used to immunize animals and humoral and cellular immune responses were quantified. Additionally, animals were challenged with the M. mycoides proteins to reveal protective antigens against contagious bovine pleuropneumonia (CBPP).
[0009] Thus, the Mycoplasma compositions described herein are useful for the treatment and/or prevention of various Mycoplasma infections, including CBPP. Such compositions can reduce the prevalence of Mycoplasma diseases which can lead to life threatening infections in humans and non-human animals and provide safer and more effective subunit vaccines.
[0010] Accordingly, the invention is directed to isolated, immunogenic Mycoplasma proteins, fusions of one or more of these proteins, or conjugates of these proteins with immunogenic carriers and compositions comprising the same.
[0011] In one embodiment, the immunogenic Mycoplasma protein is selected from: (a) a fusion protein comprising two or more M. mycoides proteins selected from M. mycoides subsp. mycoides (Mmm) and M. mycoides subsp. capri (Mmc) proteins (b) an Mmm or Mmc protein or fusion protein conjugated with an immunogenic carrier; (c) variants of the proteins of (a) and (b); or (d) a protein corresponding to (a) or (b) from another Mycoplasma strain, species or subspecies. In certain embodiments, the Mmm and Mmc protein or fusion protein comprises an Mmm and/or an Mmc protein listed in Table 1 or Table 4, variants thereof, or the corresponding proteins from another Mycoplasma strain, species or subspecies.
[0012] In additional embodiments, the immunogenic protein or fusion protein comprises (a) a protein comprising the amino acid sequence of SEQ ID NOS:2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26 or 28; (b) an Mmm protein present in the fusion of SEQ ID NO:75; (c) an Mmm protein present in the fusion of SEQ ID NO:77; (d) variants of (a), (b) and (c); or (e) the corresponding protein from another Mycoplasma strain, species or subspecies.
[0013] In certain embodiments, the fusion protein is selected from: (a) a protein comprising the amino acid sequence of SEQ ID NO:51; (b) a protein comprising the amino acid sequence of SEQ ID NO:53; (c) a protein comprising amino acids 927-1421 of SEQ ID NO:75; (d) a protein comprising amino acids 927-1468 of SEQ ID NO:77; (e) variants of (a), (b), (c) and (d); or (f) a fusion protein comprising proteins corresponding to (a), (b), (c) and (d) from another Mycoplasma strain, species or subspecies.
[0014] In additional embodiments, the Mmm or Mmc protein conjugated with a carrier comprises the amino acid sequence of an Mmm or Mmc protein listed in Table 4. In certain embodiments, the carrier is an RTX toxin, such as a detoxified leukotoxin molecule. In certain embodiments, the amino acid sequence of the protein conjugate comprises the amino acid sequence of SEQ ID NOS:55, 57, 59, 61, 63, 65, 67, 69, 71, 73, 75, 77, 79 or 81, or a variant thereof.
[0015] In further embodiments, a composition is provided that comprises at least one immunogenic protein as described above, and a pharmaceutically acceptable excipient.
[0016] In other embodiments, a composition is provided that comprises at least two immunogenic Mmm and/or Mmc proteins selected from the Mmm and Mmc proteins listed in Tables 1 and 4, immunogenic fragments or variants thereof, or the corresponding Mycoplasma proteins from another Mycoplasma strain, species or subspecies, and a pharmaceutically acceptable excipient.
[0017] In certain embodiments, the Mycoplasma proteins of the composition are selected from two or more proteins comprising the amino acid sequences of SEQ ID NOS:2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28; a protein comprising amino acids 927-1421 of SEQ ID NO:75; a protein comprising amino acids 927-1468 of SEQ ID NO:77; or variants thereof.
[0018] In additional embodiments, the composition comprises three to five Mycoplasma proteins, such as four or five Mycoplasma proteins. In certain embodiments, at least one of the proteins is selected from SEQ ID NOS:2, 4, 6, 8 or 10; or SEQ ID NOS:12, 14, 16, 18 or 20; or SEQ ID NOS:22, 24, 26 or 28.
[0019] In further embodiments, the two or more proteins in the composition are provided as a fusion protein.
[0020] In yet additional embodiments, the one or more of the proteins comprises an amino acid sequence with at least 90% sequence identity to SEQ ID NOS: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26 or 28.
[0021] In additional embodiments, the composition further comprises an immunological adjuvant, such as an adjuvant that comprises (a) a polyphosphazine; (b) a CpG oligonucleotide or a poly (I:C); and (c) a host defense peptide.
[0022] In further embodiments, a DNA molecule is provided. The DNA molecule is modified for expression in E. coli and is selected from: SEQ ID NOS:1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25 or 27; or a DNA sequence that comprises a nucleotide sequence encoding an Mmm protein, wherein the DNA sequence is present in SEQ ID NOS: 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80.
[0023] In additional embodiments, a recombinant vector is provided. The vector comprises (a) one or more DNA molecules as described above; and (b) control elements that are operably linked to the molecule whereby a coding sequence in the molecule can be transcribed and translated in a host cell.
[0024] Also provided is a host cell transformed with the recombinant vector, as well as a method of producing a Mycoplasma protein comprising: (a) providing a population of such host cells; and (b) culturing said population of cells under conditions whereby the protein encoded by the DNA molecule present in said recombinant vector is expressed.
[0025] In further embodiments, a method of treating or preventing a Mycoplasma infection in a vertebrate subject is provided. The method comprises administering a therapeutic amount of any one of the compositions described above, to the subject. In certain embodiments, the subject is a bovine subject and the Mycoplasma infection is contagious bovine pleuropneumonia.
[0026] In additional embodiments, the invention is directed to a use of an immunogenic composition as described above, for treating or preventing a Mycoplasma infection in a vertebrate subject. In certain embodiments, the subject is a bovine subject. In additional embodiments, the Mycoplasma infection is contagious bovine pleuropneumonia or an M. bovis infection.
[0027] These and other embodiments of the subject invention will readily occur to those of skill in the art in view of the disclosure herein.
BRIEF DESCRIPTION OF THE FIGURES
[0028] FIGS. 1A-1E show serum IgG1 immune responses to recombinant proteins used in trial 1 as described in the examples. For clarity purposes, only the responses at days 0 (Black circles) and 35 (White circles) in the vaccinated and placebo (P) groups are shown. The groups are listed on the side of each panel. The X-axis indicates the recombinant proteins used for each group (names shortened for clarity purposes). The bars across the symbols show the median of the values. Significant differences between the day 0 and day 35 titres for each antigen are shown by asterisks, *=P<0.05; and **=P<0.01. Significant differences between the day 35 titres of the vaccinated and placebo group for each protein are shown by a=P<0.05, b=P<0.01. Differences between the day 35 IgG1 titres between proteins in the same group are shown by #=P<0.05 and &=P<0.01.
[0029] FIGS. 2A-2E show serum IgG2 responses against the recombinant proteins used in trial 1 as described in the examples. For clarity purposes, only the responses at days 0 (Black circles) and 35 (White circles) in the vaccinated and placebo (P) groups are shown. The groups are listed on the side of each panel. The X-axis indicates the recombinant proteins used for each group. The protein name followed by (P) indicates the placebo group. The bars across the symbols show the median of the values. Significant differences between the titres in vaccinate and placebo groups are shown by asterisks, *=P<0.05; and **=P<0.01. Significant differences between the day 35 titres of the vaccinated and placebo group for each protein are shown by a=P<0.05, b=P<0.01. Differences between the day 35 IgG2 titres between proteins are shown by #=P<0.05 and &=P<0.01.
[0030] FIGS. 3A-3E show serum IgG1 responses against the recombinant proteins used in trial 2 as described in the examples. For clarity purposes, only the responses at days 0 (Black circles) and 35 (White circles) in the vaccinated and placebo (P) groups are shown. The groups are listed on the side of each panel. The X-axis indicates the recombinant proteins used for each group (Names shortened for clarity purposes). The bars across the symbols show the median of the values. Significant differences between the day 0 and day 35 titres for each antigen are shown by asterisks, *=P<0.05; and **=P<0.01. Significant differences between the day 35 titres of the vaccinated and placebo group for each protein are shown by a=P<0.05, b=P<0.01. Differences between the day 35 IgG1 titres between proteins in the same group are shown by #=P<0.05 and &=P<0.01.
[0031] FIGS. 4A-4E show serum IgG2 responses against the recombinant proteins used in trial 2 as described in the examples. For clarity purposes, only the responses at days 0 (Black circles) and 35 (White circles) in the vaccinated and placebo (P) groups are shown. The groups are listed on the side of each panel. The X-axis indicates the recombinant proteins used for each group. The protein name followed by (P) indicates the placebo group. The bars across the symbols show the median of the values. Significant differences between the titres in the vaccinated and placebo groups are shown by asterisks; *=P<0.05; and **=P<0.01. Significant differences between the day 35 titres of the vaccinated and placebo group for each protein are shown by a=P<0.05, b=P<0.01. Differences between the day 35 IgG2 titres between proteins are shown by #=P<0.05 and &=P<0.01.
[0032] FIGS. 5A-5D show serum IgG1 responses against the recombinant proteins used in trial 3 as described in the examples. For clarity purposes, only the responses at days 0 (Black circles) and 35 (White circles) in the vaccinated and placebo (P) groups are shown. The groups are listed on the side of each panel. The X-axis indicates the recombinant proteins used for each group (Names shortened for clarity purposes). The bars across the symbols show the median of the values. Significant differences between the day 0 and day 35 titres for each antigen are shown by asterisks, *=P<0.05; and **=P<0.01. Significant differences between the day 35 titres of the vaccinated and placebo group for each protein are shown by a=P<0.05, b=P<0.01. Differences between the day 35 IgG1 titres between proteins in the same group are shown by #=P<0.05 and &=P<0.01.
[0033] FIGS. 6A-6D show serum IgG2 responses against the recombinant proteins used in trial 3 as described in the examples. For clarity purposes, only the responses at days 0 (Black circles) and 35 (White circles) in the vaccinated and placebo (P) groups are shown. The groups are listed on the side of each panel. The X-axis indicates the recombinant proteins used for each group. The protein name followed by (P) indicates the placebo group. The bars across the symbols show the median of the values. Significant differences between the titres in the vaccinated and placebo groups are shown by asterisks; *=P<0.05; and **=P<0.01. Significant differences between the day 35 titres of the vaccinated and placebo group for each protein are shown by a=P<0.05, b=P<0.01. Differences between the day 35 IgG2 titres between proteins are shown by #=P<0.05 and &=P<0.01.
[0034] FIGS. 7A-7E show PBMC proliferative responses in trial 1 after incubation with the recall antigens as described in the examples. The groups are listed on the top of each panel. The mean and standard deviation of the stimulation indexes (Si) at day 35 (Two weeks after the boost) for the vaccinated (Black circles) and placebo (Black triangles) groups are shown. The X-axis shows the positive control (ConA) and the recall antigens used in each group. There were no significant differences between the vaccinated and placebo Si for each of the recall antigens and no differences between the Si of any of the antigens in the vaccinated groups.
[0035] FIGS. 8A-8E show PBMC proliferative responses in trial 2 after incubation with the recall antigens as described in the examples. The groups are listed on the top of each panel. The mean and standard deviation of the stimulation indexes (Si) at day 35 (Two weeks after the boost) for the vaccinated (Black circles) and placebo (Black triangles) groups are shown. The X-axis shows the positive control (ConA) and the recall antigens used in each group. There were no significant differences between the vaccinated and placebo Si for each of the recall antigens and no differences between the Si of any of the antigens in the vaccinated groups.
[0036] FIGS. 9A-9D show PBMC proliferative responses in trial 3 after incubation with the recall antigens as described in the examples. The groups are listed on the top of each panel. The mean and standard deviation of the stimulation indexes (Si) at day 35 (Two weeks after the boost) for the vaccinated (Black circles) and placebo (Black triangles) groups are shown. The X-axis shows the positive control (ConA) and the recall antigens used in each group. There were no significant differences between the vaccinated and placebo Si for each of the recall antigens and no differences between the Si of any of the antigens in the vaccinated groups.
[0037] FIGS. 10A-10C show serum TGF-.beta. levels in the three trials as described in the examples. The day 0 and day 35 serum TGF-.beta. levels for trials 1, 2 and 3 are shown in A, B, and C respectively. The black circles indicate the levels at day 0 while white circles show the levels at day 35. The groups including the placebo groups F, L, and Q are indicated on the X-axis. In trials 1 and 2, there were no significant differences between day 0 and day 35 TGF-(3 levels. The TGF-.beta. levels at day 35 were significantly lower (P<0.05) than the day 0 values in the groups M and P of the third trial.
[0038] FIGS. 11A-11B (SEQ ID NOS:1 and 2) show the modified nucleotide sequence of MSC_0136 (SEQ ID NO: 1) and the amino acid sequence of the protein antigen MSC_0136 (SEQ ID NO:2) used in the examples. The sequences differ from those reported in NCBI in that the DNA sequence has been modified for expression in E. coli; and the protein sequence lacks the first 24 amino acids (the signal sequence).
[0039] FIGS. 12A-12B (SEQ ID NOS:3 and 4) show the modified nucleotide sequence of MSC_0957 (SEQ ID NO:3) and the amino acid sequence of the protein antigen MSC_0957 (SEQ ID NO:4) used in the examples. The sequences differ from those reported in NCBI in that the DNA sequence has been modified for expression in E. coli; and the protein sequence lacks the first 23 amino acids (the signal sequence).
[0040] FIGS. 13A-13B (SEQ ID NOS:5 and 6) show the modified nucleotide sequence of MSC_0499 (SEQ ID NO:5) and amino acid sequence of the protein antigen MSC_0499 (SEQ ID NO:6) used in the examples. The sequences differ from those reported in NCBI in that the DNA sequence has been modified for expression in E. coli; and the protein sequence lacks the first 23 amino acids (the signal sequence).
[0041] FIGS. 14A-14B (SEQ ID NOS:7 and 8) show the modified nucleotide sequence of MSC_0431 (SEQ ID NO:7) and amino acid sequence of the protein antigen MSC_0431 (SEQ ID NO:8) used in the examples. The sequences differ from those reported in NCBI in that the DNA sequence has been modified for expression in E. coli; and the protein sequence lacks the first 26 amino acids (the signal sequence).
[0042] FIGS. 15A-15B (SEQ ID NOS:9 and 10) show the modified nucleotide sequence of MSC_0776 (SEQ ID NO:9) and amino acid sequence of the protein antigen MSC_0776 (SEQ ID NO: 10) used in the examples. The sequences differ from those reported in NCBI in that the DNA sequence has been modified for expression in E. coli; and the protein sequence lacks the first 27 amino acids (the signal sequence).
[0043] FIGS. 16A-16B (SEQ ID NOS: 11 and 12) show the nucleotide sequence, modified for expression in E. coli, of YP_004400559.1 (SEQ ID NO:11) and amino acid sequence of the protein antigen YP_004400559.1 (SEQ ID NO: 12) used in the examples. The amino acid sequence differs from that reported in NCBI in that the sequence lacks the first 24 amino acids (the signal sequence) and includes an N-terminal methionine.
[0044] FIGS. 17A-17B (SEQ ID NOS: 13 and 14) show the nucleotide sequence, modified for expression in E. coli, of YP_004399807.1 (SEQ ID NO:13) and amino acid sequence of the protein antigen YP_004399807.1 (SEQ ID NO: 14) used in the examples. The amino acid sequence differs from that reported in NCBI in that the sequence lacks the first 24 amino acids (the signal sequence) and includes an N-terminal methionine.
[0045] FIGS. 18A-18B (SEQ ID NOS:15 and 16) show the modified nucleotide sequence of MSC_0816 (SEQ ID NO:15) and amino acid sequence of the protein antigen MSC_0816 (SEQ ID NO: 16) used in the examples. The sequences differ from those reported in NCBI in that the DNA sequence has been modified for expression in E. coli; and the protein sequence lacks the first 23 amino acids (the signal sequence).
[0046] FIGS. 19A-19B (SEQ ID NOS:17 and 18) show the modified nucleotide sequence of MSC_0160 (SEQ ID NO: 17) and amino acid sequence of the protein antigen MSC_0160 (SEQ ID NO:18) used in the examples. The DNA sequence differs from that reported in NCBI in that the DNA sequence has been modified for expression in E. coli.
[0047] FIGS. 20A-20B (SEQ ID NOS:19 and 20) show the modified nucleotide sequence of MSC_0775 (SEQ ID NO: 19) and amino acid sequence of the protein antigen MSC_0775 (SEQ ID NO:20) used in the examples. The sequences differ from those reported in NCBI in that the DNA sequence has been modified for expression in E. coli; and the protein sequence lacks the first 25 amino acids (the signal sequence).
[0048] FIGS. 21A-21B (SEQ ID NOS:21 and 22) show the nucleotide sequence, modified for expression in E. coli, of YP_004400127.1 (SEQ ID NO:21) and amino acid sequence of the protein antigen YP_004400127.1 (SEQ ID NO:22) used in the examples. The amino acid sequence differs from that reported in NCBI in that it lacks the first 23 amino acids (the signal sequence) and includes an N-terminal methionine.
[0049] FIGS. 22A-22B (SEQ ID NOS:23 and 24) show the nucleotide sequence, modified for expression in E. coli, of YP_004399790.1 (SEQ ID NO:23) and amino acid sequence of the protein antigen YP_004399790.1 (SEQ ID NO:24) used in the examples.
[0050] FIGS. 23A-23B (SEQ ID NOS:25 and 26) show the nucleotide sequence, modified for expression in E. coli, of YP_004400580.1 (SEQ ID NO:25) and amino acid sequence of the protein antigen YP_004400580.1 (SEQ ID NO:26) used in the examples. The amino acid sequence differs from that reported in NCBI in that it lacks 15 amino acids from the C-terminus.
[0051] FIGS. 24A-24B (SEQ ID NOS:27 and 28) show the nucleotide sequence, modified for expression in E. coli, of YP_004400610.1 (SEQ ID NO:27) and amino acid sequence of the protein antigen YP_004400610.1 (SEQ ID NO:28) used in the examples. The amino acid sequence differs from that reported in NCBI in that the sequence lacks the first 24 amino acids (the signal sequence) and includes an N-terminal methionine.
[0052] FIGS. 25A-25B (SEQ ID NOS:50 and 51) show the nucleotide sequence, modified for expression in E. coli, of a fusion (SEQ ID NO:50) between YP_004400127.1 and YP_004399790.1 and the amino acid sequence of the protein fusion (SEQ ID NO:51) used in the examples. The YP_004400127.1 sequence occurs at positions 1-214 of the protein and the YP_004399790.1 sequence is present at positions 221-532 of the protein. The two sequences are linked by a Gly.sub.6 linker, bolded in the figure.
[0053] FIGS. 26A-26B (SEQ ID NOS:52 and 53) show the nucleotide sequence, modified for expression in E. coli, of a fusion (SEQ ID NO:52) between sequences derived from YP_004400610.1 and YP_00400580.1 and the amino acid sequence of the protein fusion (SEQ ID NO:53) used in the examples. The YP_004400610.1 sequence occurs at positions 1-189 of the protein and the sequence derived from YP_004399790.1 is present at positions 195-557 of the protein. The YP_00400580.1 sequence in the fusion lacks the first 20 amino acids present in the YP_00400580.1 sequence shown in SEQ ID NO:26. The two sequences are linked by a Gly.sub.5 linker, bolded in the figure.
[0054] FIGS. 27A-27B (SEQ ID NOS:54 and 55) show the nucleotide sequence, modified for expression in E. coli, (SEQ ID NO:54) and amino acid sequence (SEQ ID NO:55) of pAA352-YP_004400127.1-YP_004399790.1 used in the examples. The leukotoxin 352 carrier, (also termed "LKT 352" and "LtxA" herein) occurs at positions 1-926 of the amino acid sequence and is bolded in SEQ ID NO:55; The YP_004400127.1 sequence occurs at positions 927-1140 of SEQ ID NO:55; the YP_004399790.1 sequence is present at positions 1147-1458 of SEQ ID NO:55. The two sequences are linked by a Gly.sub.6 linker, bolded in the figure.
[0055] FIGS. 28A-28B (SEQ ID NOS:56 and 57) show the nucleotide sequence, modified for expression in E. coli, (SEQ ID NO:56) and amino acid sequence (SEQ ID NO:57) of pAA352-YP_004400610.1-YP_00400580.1 used in the examples. The leukotoxin 352 carrier, (also termed "LKT 352" and "LtxA" herein) occurs at positions 1-926 of the amino acid sequence and is bolded in SEQ ID NO:57; The YP_004400610.1 sequence occurs at positions 927-1115 of SEQ ID NO:57; the YP_00400580.1 sequence is present at positions 1121-1483 of SEQ ID NO:57. The YP_00400580.1 sequence in the fusion lacks the first 20 amino acids present in the YP_00400580.1 sequence shown in SEQ ID NO:26. The two sequences are linked by a Gly.sub.5 linker, bolded in the figure.
[0056] FIGS. 29A-29B (SEQ ID NOS:58 and 59) show the nucleotide sequence, modified for expression in E. coli, (SEQ ID NO:58) and amino acid sequence (SEQ ID NO:59) of pAA352-MSC_0160 used in the examples. The leukotoxin 352 carrier, (also termed "LKT 352" and "LtxA" herein) occurs at positions 1-926 of the amino acid sequence and is bolded in SEQ ID NO:59; The MSC_0160 sequence occurs at positions 927-1320 of SEQ ID NO:59. The MSC_0160 sequence lacks the N-terminal methionine shown in SEQ ID NO:18.
[0057] FIGS. 30A-30B (SEQ ID NOS:60 and 61) show the nucleotide sequence, modified for expression in E. coli, (SEQ ID NO:60) and amino acid sequence (SEQ ID NO:61) of pAA352-MSC_0136 used in the examples. The leukotoxin 352 carrier, (also termed "LKT 352" and "LtxA" herein) occurs at positions 1-926 of the amino acid sequence and is bolded in SEQ ID NO:61; the MSC_0136 sequence occurs at positions 927-1224 of SEQ ID NO:61.
[0058] FIGS. 31A-31B (SEQ ID NOS:62 and 63) show the nucleotide sequence, modified for expression in E. coli, (SEQ ID NO:62) and amino acid sequence (SEQ ID NO:63) of pAA352-MSC_0431 used in the examples. The leukotoxin 352 carrier, (also termed "LKT 352" and "LtxA" herein) occurs at positions 1-926 of the amino acid sequence and is bolded in SEQ ID NO:63; the MSC_0431 sequence occurs at positions 927-1256 of SEQ ID NO:63.
[0059] FIGS. 32A-32B (SEQ ID NOS:64 and 65) show the nucleotide sequence, modified for expression in E. coli, (SEQ ID NO:64) and amino acid sequence (SEQ ID NO:65) of pAA352-MSC_0499 used in the examples. The leukotoxin 352 carrier, (also termed "LKT 352" and "LtxA" herein) occurs at positions 1-926 of the amino acid sequence and is bolded in SEQ ID NO:65; the MSC_0499 sequence occurs at positions 927-1620 of SEQ ID NO:65.
[0060] FIGS. 33A-33B (SEQ ID NOS:66 and 67) show the nucleotide sequence, modified for expression in E. coli, (SEQ ID NO:66) and amino acid sequence (SEQ ID NO:67) of pAA352-MSC_0775 used in the examples. The leukotoxin 352 carrier, (also termed "LKT 352" and "LtxA" herein) occurs at positions 1-926 of the amino acid sequence and is bolded in SEQ ID NO:67; the MSC_0775 sequence occurs at positions 927-1608 of SEQ ID NO:67. The MSC_0775 sequence lacks the first 20 amino acids shown in SEQ ID NO:20.
[0061] FIGS. 34A-34B (SEQ ID NOS:68 and 69) show the nucleotide sequence, modified for expression in E. coli, (SEQ ID NO:68) and amino acid sequence (SEQ ID NO:69) of pAA352-MSC_0776 used in the examples. The leukotoxin 352 carrier, (also termed "LKT 352" and "LtxA" herein) occurs at positions 1-926 of the amino acid sequence and is bolded in SEQ ID NO:69; the MSC_0776 sequence occurs at positions 927-1681 of SEQ ID NO:69.
[0062] FIGS. 35A-35B (SEQ ID NOS:70 and 71) show the nucleotide sequence, modified for expression in E. coli, (SEQ ID NO:70) and amino acid sequence (SEQ ID NO:71) of pAA352-MSC_0816 used in the examples. The leukotoxin 352 carrier, (also termed "LKT 352" and "LtxA" herein) occurs at positions 1-926 of the amino acid sequence and is bolded in SEQ ID NO:71; the MSC_0816 sequence occurs at positions 927-1308 of SEQ ID NO:71.
[0063] FIGS. 36A-36B (SEQ ID NOS:72 and 73) show the nucleotide sequence, modified for expression in E. coli, (SEQ ID NO:72) and amino acid sequence (SEQ ID NO:73) of pAA352-MSC_0957 used in the examples. The leukotoxin 352 carrier, (also termed "LKT 352" and "LtxA" herein) occurs at positions 1-926 of the amino acid sequence and is bolded in SEQ ID NO:73; the MSC_0957 sequence occurs at positions 927-1336 of SEQ ID NO:73.
[0064] FIGS. 37A-37B (SEQ ID NOS:74 and 75) show the nucleotide sequence, modified for expression in E. coli, (SEQ ID NO:74) and amino acid sequence (SEQ ID NO:75) of pAA352-MSC_0466-MSC_0117 used in the examples. The leukotoxin 352 carrier, (also termed "LKT 352" and "LtxA" herein) occurs at positions 1-926 of the amino acid sequence and is bolded in SEQ ID NO:75; The MSC_0466 sequence occurs at positions 927-1180 of SEQ ID NO:75; the MSC_0117 sequence is present at positions 1184-1421 of SEQ ID NO:75. The two sequences are linked by a Gly.sub.3 linker, bolded in the figure.
[0065] FIGS. 38A-38B (SEQ ID NOS:76 and 77) show the nucleotide sequence, modified for expression in E. coli, (SEQ ID NO:76) and amino acid sequence (SEQ ID NO:77) of pAA352-MSC_0922-MSC_1058 used in the examples. The leukotoxin 352 carrier, (also termed "LKT 352" and "LtxA" herein) occurs at positions 1-926 of the amino acid sequence and is bolded in SEQ ID NO:77; The MSC_0922 sequence occurs at positions 927-1325 of SEQ ID NO:77; the MSC_1058 sequence is present at positions 1329-1468 of SEQ ID NO:77. The two sequences are linked by a Gly.sub.3 linker, bolded in the figure.
[0066] FIGS. 39A-39B (SEQ ID NOS:78 and 79) show the nucleotide sequence, modified for expression in E. coli, (SEQ ID NO:78) and amino acid sequence (SEQ ID NO:79) of pAA352-YP_004399807.1 used in the examples. The leukotoxin 352 carrier, (also termed "LKT 352" and "LtxA" herein) occurs at positions 1-926 of the amino acid sequence and is bolded in SEQ ID NO:79; the YP_004399807.1 sequence occurs at positions 927-1273 of SEQ ID NO:79. The YP_004399807.1 sequence lacks the N-terminal methionine shown in SEQ ID NO: 14.
[0067] FIGS. 40A-40B (SEQ ID NOS:80 and 81) show the nucleotide sequence, modified for expression in E. coli, (SEQ ID NO:80) and amino acid sequence (SEQ ID NO:81) of pAA352-YP_00400559.1 used in the examples. The leukotoxin 352 carrier, (also termed "LKT 352" and "LtxA" herein) occurs at positions 1-926 of the amino acid sequence and is bolded in SEQ ID NO:81; the YP_00400559.1 sequence occurs at positions 927-1061 of SEQ ID NO:81. The YP_00400559.1 sequence lacks the N-terminal methionine shown in SEQ ID NO:12.
[0068] FIG. 41 (SEQ ID NOS:82 and 83) shows the nucleotide sequence (SEQ ID NO:82) and amino acid sequence (SEQ ID NO:83) of a representative leukotoxin 352 (LKT 352) from plasmid pAA352. The first 10 N-terminal amino acids and last 2 C-terminal amino acids depicted in the figure are flanking sequences from plasmid pAA352. The remaining amino acids are leukotoxin sequences. LKT 352 is a detoxified mutant of leukotoxin.
DETAILED DESCRIPTION OF THE INVENTION
[0069] The practice of the present invention will employ, unless otherwise indicated, conventional methods of virology, chemistry, biochemistry, recombinant DNA techniques and immunology, within the skill of the art. Such techniques are explained fully in the literature. See, e.g., Fundamental Virology, Current Edition, vol. I & II (B. N. Fields and D. M. Knipe, eds.); Handbook of Experimental Immunology, Vols. I-IV (D. M. Weir and C. C. Blackwell eds., Blackwell Scientific Publications); T. E. Creighton, Proteins. Structures and Molecular Properties (W.H. Freeman and Company); A. L. Lehninger, Biochemistry (Worth Publishers, Inc., current edition); Sambrook, et al., Molecular Cloning: A Laboratory Manual (current edition); Methods In Enzymology (S. Colowick and N. Kaplan eds., Academic Press, Inc.).
[0070] All publications, patents and patent applications cited herein, whether supra or infra, are hereby incorporated by reference in their entireties.
[0071] The following amino acid abbreviations are used throughout the text:
TABLE-US-00001 Alanine: Ala (A) Arginine: Arg (R) Asparagine: Asn (N) Aspartic acid: Asp (D) Cysteine: Cys (C) Glutamine: Gln (Q) Glutamic acid: Glu (E) Glycine: Gly (G) Histidine: His (H) Isoleucine: Ile (I) Leucine: Leu (L) Lysine: Lys (K) Methionine: Met (M) Phenylalanine: Phe (F) Proline: Pro (P) Serine: Ser (S) Threonine: Thr (T) Tryptophan: Trp (W) Tyrosine: Tyr (Y) Valine: Val (V)
1. DEFINITIONS
[0072] In describing the present invention, the following terms will be employed, and are intended to be defined as indicated below.
[0073] It must be noted that, as used in this specification and the appended claims, the singular forms "a", "an" and "the" include plural referents unless the content clearly dictates otherwise. Thus, for example, reference to "an antigen" includes a mixture of two or more such antigens, and the like.
[0074] As used herein, the term "Mycoplasma" refers to bacteria belonging to the class Mollicutes and the genus Mycoplasma. The term intends any species and subspecies of the genus Mycoplasma, which is capable of causing disease in an animal or human subject. Such species are described below.
[0075] As used herein, the term "Mycoplasma mycoides" or "M. mycoides" refers to any of the species and subspecies from the Mycoplasma mycoides cluster, a group of closely related infectious mycoplasmas. The cluster contains several species and subspecies including M. mycoides subsp. mycoides biotype Small Colony (MmmSC); M. mycoides subsp. mycoides biotype Large Colony (MmmLC); M. mycoides subsp. capri (Mmc); M. capricolum subsp. capricolum (Mcc); M. capricolum subsp. capripneumoniae (Mccp); and Mycoplasma sp. `bovine group 7` (MBG7).
[0076] The term "derived from" is used herein to identify the original source of a molecule but is not meant to limit the method by which the molecule is made which can be, for example, by chemical synthesis or recombinant means.
[0077] A "Mycoplasma molecule" is a molecule derived from Mycoplasma, including, without limitation, polypeptide, protein, antigen, polynucleotide, oligonucleotide, and nucleic acid molecules, as defined herein, from any of the various Mycoplasma species and subspecies. The molecule need not be physically derived from the particular bacterium in question, but may be synthetically or recombinantly produced. Nucleic acid and polypeptide sequences for a number of Mycoplasma species are known and/or described herein. Representative Mycoplasma sequences for use in treating and/or preventing M. mycoides infection, such as CBPP, are presented in Tables 1 and 4 and FIGS. 11-40 herein. It is to be understood that while Table 4 and several figures describe M. mycoides fusion proteins, as well as conjugates of the fusions, the individual M. mycoides proteins in the fusions and the conjugates are also intended. The boundaries of the individual M. mycoides proteins present in the fusions, as well as the M. mycoides proteins present in the conjugates, are described above.
[0078] Additional representative sequences found in various species are listed in the National Center for Biotechnology Information (NCBI) database. However, a Mycoplasma molecule, such as an antigen, as defined herein, is not limited to those shown and described in Tables 1 and 4 and FIGS. 11-40, as various isolates are known and variations in sequences may occur between them.
[0079] By "Mycoplasma disease" is meant a disease caused in whole or in part by a Mycoplasma bacterium. For example, Mycoplasma bacteria cause a number of diseases in animals, such as but not limited to pneumonia, e.g., contagious bovine pleuropneumonia, mastitis, arthritis, otitis, keratoconjunctivitis, synovitis, and reproductive disorders. In humans such diseases include pneumonia and other respiratory problems such as tracheobronchitis, bronchiolitis, pharyngitis and croup; pelvic inflammatory disease; and cancer.
[0080] The terms "polypeptide" and "protein" refer to a polymer of amino acid residues and are not limited to a minimum length of the product. Thus, peptides, oligopeptides, dimers, multimers, and the like, are included within the definition. Both full-length proteins and fragments thereof are encompassed by the definition. The terms also include postexpression modifications of the polypeptide, for example, glycosylation, acetylation, phosphorylation and the like. Furthermore, for purposes of the present invention, a "polypeptide" refers to a protein which includes modifications, such as deletions, additions and substitutions, to the native sequence, so long as the protein maintains the desired activity. These modifications may be deliberate, as through site-directed mutagenesis, or may be accidental, such as through mutations of hosts which produce the proteins or errors due to PCR amplification.
[0081] The term "peptide" as used herein refers to a fragment of a polypeptide. Thus, a peptide can include a C-terminal deletion, an N-terminal deletion and/or an internal deletion of the native polypeptide, so long as the entire protein sequence is not present. A peptide will generally include at least about 3-10 contiguous amino acid residues of the full-length molecule, and can include at least about 15-25 contiguous amino acid residues of the full-length molecule, or at least about 20-50 or more contiguous amino acid residues of the full-length molecule, or any integer between 3 amino acids and the number of amino acids in the full-length sequence, provided that the peptide in question retains the ability to elicit the desired biological response.
[0082] By "immunogenic" protein, polypeptide or peptide is meant a molecule which includes one or more epitopes and thus can modulate an immune response. Such peptides can be identified using any number of epitope mapping techniques, well known in the art. See, e.g., Epitope Mapping Protocols in Methods in Molecular Biology, Vol. 66 (Glenn E. Morris, Ed., 1996) Humana Press, Totowa, N.J. For example, linear epitopes may be determined by e.g., concurrently synthesizing large numbers of peptides on solid supports, the peptides corresponding to portions of the protein molecule, and reacting the peptides with antibodies while the peptides are still attached to the supports. Such techniques are known in the art and described in, e.g., U.S. Pat. No. 4,708,871; Geysen et al. (1984) Proc. Natl. Acad. Sci. USA 81:3998-4002; Geysen et al. (1986) Molec. Immunol. 23:709-715, all incorporated herein by reference in their entireties. Similarly, conformational epitopes are readily identified by determining spatial conformation of amino acids such as by, e.g., x-ray crystallography and 2-dimensional nuclear magnetic resonance. See, e.g., Epitope Mapping Protocols, supra. Antigenic regions of proteins can also be identified using standard antigenicity and hydropathy plots, such as those calculated using, e.g., the Omiga version 1.0 software program available from the Oxford Molecular Group. This computer program employs the Hopp/Woods method, Hopp et al., Proc. Natl. Acad. Sci USA (1981) 78:3824-3828 for determining antigenicity profiles, and the Kyte-Doolittle technique, Kyte et al., J. Mol. Biol. (1982) 157:105-132 for hydropathy plots.
[0083] Immunogenic molecules, for purposes of the present invention, will usually be at least about 5 amino acids in length, such as at least about 10 to about 15 amino acids in length. There is no critical upper limit to the length of the molecule, which can comprise the full-length of the protein sequence, or even a fusion protein comprising two or more epitopes, proteins, antigens, etc.
[0084] As used herein, the term "epitope" generally refers to the site on an antigen which is recognized by a T-cell receptor and/or an antibody. Several different epitopes may be carried by a single antigenic molecule. The term "epitope" also includes modified sequences of amino acids which stimulate responses which recognize the whole organism. The epitope can be generated from knowledge of the amino acid and corresponding DNA sequences of the polypeptide, as well as from the nature of particular amino acids (e.g., size, charge, etc.) and the codon dictionary, without undue experimentation. See, e.g., Ivan Roitt, Essential Immunology; Janis Kuby, Immunology.
[0085] An "immunological response" to an antigen or composition is the development in a subject of a humoral and/or a cellular immune response to an antigen present in the composition of interest. For purposes of the present invention, a "humoral immune response" refers to an immune response mediated by antibody molecules, while a "cellular immune response" is one mediated by T-lymphocytes and/or other white blood cells. One important aspect of cellular immunity involves an antigen-specific response by cytolytic T-cells ("CTL"s). CTLs have specificity for peptide antigens that are presented in association with proteins encoded by the major histocompatibility complex (MHC) and expressed on the surfaces of cells. CTLs help induce and promote the destruction of intracellular microbes, or the lysis of cells infected with such microbes. Another aspect of cellular immunity involves an antigen-specific response by helper T-cells. Helper T-cells act to help stimulate the function, and focus the activity of, nonspecific effector cells against cells displaying peptide antigens in association with MHC molecules on their surface. A "cellular immune response" also refers to the production of cytokines, chemokines and other such molecules produced by activated T-cells and/or other white blood cells, including those derived from CD4+ and CD8+ T-cells.
[0086] Thus, an immunological response as used herein may be one that stimulates the production of antibodies. The antigen of interest may also elicit production of CTLs. Hence, an immunological response may include one or more of the following effects: the production of antibodies by B-cells; and/or the activation of suppressor T-cells and/or memory/effector T-cells directed specifically to an antigen or antigens present in the composition or vaccine of interest. These responses may serve to neutralize infectivity, and/or mediate antibody-complement, or antibody dependent cell cytotoxicity (ADCC) to provide protection to an immunized host. Such responses can be determined using standard immunoassays and neutralization assays, well known in the art. (See, e.g., Montefiori et al. (1988) J. Clin Microbiol. 26:231-235; Dreyer et al. (1999) AIDS Res Hum Retroviruses (1999) 15(17): 1563-1571). The innate immune system of mammals also recognizes and responds to molecular features of pathogenic organisms via activation of Toll-like receptors and similar receptor molecules on immune cells. Upon activation of the innate immune system, various non-adaptive immune response cells. are activated to, e.g., produce various cytokines, lymphokines and chemokines. Cells activated by an innate immune response include immature and mature Dendritic cells of the monocyte and plasmacytoid lineage (MDC, PDC), as well as gamma, delta, alpha and beta T cells and B cells and the like. Thus, the present invention also contemplates an immune response wherein the immune response involves both an innate and adaptive response.
[0087] An "immunogenic composition" is a composition that comprises an immunogenic molecule where administration of the composition to a subject results in the development in the subject of a humoral and/or a cellular immune response to the molecule of interest.
[0088] An "antigen" refers to a molecule, such as a protein, polypeptide, or fragment thereof, containing one or more epitopes (either linear, conformational or both) that will stimulate a host's immune-system to make a humoral and/or cellular antigen-specific response. The term is used interchangeably with the term "immunogen." Antibodies such as anti-idiotype antibodies, or fragments thereof, and synthetic peptide mimotopes, which can mimic an antigen or antigenic determinant, are also captured under the definition of antigen as used herein. Similarly, an oligonucleotide or polynucleotide which expresses an antigen or antigenic determinant in vivo, such as in DNA immunization applications, is also included in the definition of antigen herein.
[0089] By "subunit vaccine" is meant a vaccine composition that includes one or more selected antigens but not all antigens, derived from or homologous to, an antigen from a pathogen of interest. Such a composition is substantially free of intact pathogen cells or pathogenic particles, or the lysate of such cells or particles. Thus, a "subunit vaccine" can be prepared from at least partially purified (preferably substantially purified) immunogenic molecules from the pathogen, or analogs thereof. The method of obtaining an antigen included in the subunit vaccine can thus include standard purification techniques, recombinant production, or synthetic production.
[0090] By "carrier" is meant any molecule which when associated with an antigen of interest, imparts enhanced immunogenicity to the antigen.
[0091] The term "RTX" toxin, as used herein refers to a protein belonging to the family of molecules characterized by the carboxy-terminus consensus amino acid sequence Gly-Gly-X-Gly-X-Asp (SEQ ID NO:78, Highlander et al., DNA (1989) 8:15-28), where X is Lys, Asp, Val or Asn. Such proteins include, among others, leukotoxins derived from P. haemolytica and Actinobacillus pleuropneumoniae, as well as E. coli alpha hemolysin (Strathdee et al., Infect. Immun. (1987) 55:3233-3236; Lo, Can. J. Vet. Res. (1990) 54:S33-S35; Welch, Mol. Microbiol. (1991) 5:521-528). This family of toxins is known as the "RTX" family of toxins (Lo, Can. J. Vet. Res. (1990) 54:S33-S35). In addition, the term "RTX toxin" refers to a member of the RTX family which is chemically synthesized, isolated from an organism expressing the same, or recombinantly produced. Furthermore, the term intends an immunogenic protein having an amino acid sequence substantially homologous to a contiguous amino acid sequence found in the particular native RTX molecule. Thus, the term includes both full-length and partial sequences, as well as analogues. Although native full-length RTX toxins display cytotoxic activity, the term "RTX toxin" also intends molecules which remain immunogenic yet lack the cytotoxic character of native molecules. In the chimeras produced according to the present invention, a selected RTX polypeptide sequence imparts enhanced immunogenicity to a fused Mycoplasma protein or fusion proteins comprising more than one Mycoplasma protein or antigen.
[0092] The term "leukotoxin polypeptide" or "LKT polypeptide" intends an RTX toxin derived from P. haemolytica, Actinobacillus pleuropneumoniae, among others, as defined above. The nucleotide sequences and corresponding amino acid sequences for several leukotoxins are known. See, e.g., U.S. Pat. Nos. 4,957,739 and 5,055,400; Lo et al., Infect. Immun. (1985) 50:667-67; Lo et al., Infect. Immun. (1987) 55:1987-1996; Strathdee et al., Infect. Immun. (1987) 55:3233-3236; Highlander et al., DNA (1989) 8:15-28; Welch, Mol. Microbiol. (1991) 5:521-528. A selected leukotoxin polypeptide sequence imparts enhanced immunogenicity to a fused Mycoplasma protein or fusion proteins comprising more than one Mycoplasma protein or antigen.
[0093] "Substantially purified" generally refers to isolation of a substance such that the substance comprises the majority percent of the sample in which it resides. Typically in a sample, a substantially purified component comprises 50%, preferably 80%-85%, more preferably 90-95% of the sample. Techniques for purifying molecules of interest are well-known in the art and include, for example, ion-exchange chromatography, affinity chromatography and sedimentation according to density.
[0094] By "isolated" is meant that the indicated molecule is separate and discrete from the whole organism with which the molecule is found in nature or is present in the substantial absence of other biological macromolecules of the same type.
[0095] An "antibody" intends a molecule that "recognizes," i.e., specifically binds to an epitope of interest present in an antigen. By "specifically binds" is meant that the antibody interacts with the epitope in a "lock and key" type of interaction to form a complex between the antigen and antibody, as opposed to non-specific binding that might occur between the antibody and, for instance, components in a mixture that includes the test substance with which the antibody is reacted. The term "antibody" as used herein includes antibodies obtained from both polyclonal and monoclonal preparations, as well as, the following: hybrid (chimeric) antibody molecules (see, for example, Winter et al., Nature (1991) 349:293-299; and U.S. Pat. No. 4,816,567); F(ab')2 and F(ab) fragments; Fv molecules (non-covalent heterodimers, see, for example, Inbar et al., Proc Natl Acad Sci USA (1972) 69:2659-2662; and Ehrlich et al., Biochem (1980) 19:4091-4096); single-chain Fv molecules (sFv) (see, for example, Huston et al., Proc Natl Acad Sci USA (1988) 85:5879-5883); dimeric and trimeric antibody fragment constructs; minibodies (see, e.g., Pack et al., Biochem (1992) 31:1579-1584; Cumber et al., J Immunology (1992) 149B:120-126); humanized antibody molecules (see, for example, Riechmann et al., Nature (1988) 332:323-327; Verhoeyan et al., Science (1988) 239:1534-1536; and U.K. Patent Publication No. GB 2,276,169, published 21 Sep. 1994); and, any functional fragments obtained from such molecules, wherein such fragments retain immunological binding properties of the parent antibody molecule.
[0096] As used herein, the term "monoclonal antibody" refers to an antibody composition having a homogeneous antibody population. The term is not limited regarding the species or source of the antibody, nor is it intended to be limited by the manner in which it is made. The term encompasses whole immunoglobulins as well as fragments such as Fab, F(ab').sub.2, Fv, and other fragments, as well as chimeric and humanized homogeneous antibody populations, that exhibit immunological binding properties of the parent monoclonal antibody molecule.
[0097] "Homology" refers to the percent identity between two polynucleotide or two polypeptide moieties. Two nucleic acid, or two polypeptide sequences are "substantially homologous" to each other when the sequences exhibit at least about 50% sequence identity, preferably at least about 75% sequence identity, more preferably at least about 80%-85% sequence identity, more preferably at least about 90% sequence identity, and most preferably at least about 95%-98% sequence identity over a defined length of the molecules. As used herein, substantially homologous also refers to sequences showing complete identity to the specified sequence.
[0098] In general, "identity" refers to an exact nucleotide-to-nucleotide or amino acid-to-amino acid correspondence of two polynucleotides or polypeptide sequences, respectively. Percent identity can be determined by a direct comparison of the sequence information between two molecules by aligning the sequences, counting the exact number of matches between the two aligned sequences, dividing by the length of the shorter sequence, and multiplying the result by 100. Readily available computer programs can be used to aid in the analysis, such as ALIGN, Dayhoff, M. O. in Atlas of Protein Sequence and Structure M. O. Dayhoff ed., 5 Suppl. 3:353-358, National biomedical Research Foundation, Washington, D.C., which adapts the local homology algorithm of Smith and Waterman Advances in Appl. Math. 2:482-489, 1981 for peptide analysis. Programs for determining nucleotide sequence identity are available in the Wisconsin Sequence Analysis Package, Version 8 (available from Genetics Computer Group, Madison, Wis.) for example, the BESTFIT, FASTA and GAP programs, which also rely on the Smith and Waterman algorithm. These programs are readily utilized with the default parameters recommended by the manufacturer and described in the Wisconsin Sequence Analysis Package referred to above. For example, percent identity of a particular nucleotide sequence to a reference sequence can be determined using the homology algorithm of Smith and Waterman with a default scoring table and a gap penalty of six nucleotide positions.
[0099] Another method of establishing percent identity in the context of the present invention is to use the MPSRCH package of programs copyrighted by the University of Edinburgh, developed by John F. Collins and Shane S. Sturrok, and distributed by IntelliGenetics, Inc. (Mountain View, Calif.). From this suite of packages the Smith-Waterman algorithm can be employed where default parameters are used for the scoring table (for example, gap open penalty of 12, gap extension penalty of one, and a gap of six). From the data generated the "Match" value reflects "sequence identity." Other suitable programs for calculating the percent identity or similarity between sequences are generally known in the art, for example, another alignment program is BLAST, used with default parameters. For example, BLASTN and BLASTP can be used using the following default parameters: genetic code=standard; filter=none; strand=both; cutoff=60; expect=10; Matrix=BLOSUM62; Descriptions=50 sequences; sort by=HIGH SCORE; Databases=non-redundant, GenBank+EMBL+DDBJ+PDB+GenBank CDS translations+Swiss protein+Spupdate+PIR. Details of these programs are readily available.
[0100] Alternatively, homology can be determined by hybridization of polynucleotides under conditions which form stable duplexes between homologous regions, followed by digestion with single-stranded-specific nuclease(s), and size determination of the digested fragments. DNA sequences that are substantially homologous can be identified in a Southern hybridization experiment under, for example, stringent conditions, as defined for that particular system. Defining appropriate hybridization conditions is within the skill of the art. See, e.g., Sambrook et al., supra; DNA Cloning, supra; Nucleic Acid Hybridization, supra.
[0101] The terms "polynucleotide," "oligonucleotide," "nucleic acid" and "nucleic acid molecule" are used herein to include a polymeric form of nucleotides of any length, either ribonucleotides or deoxyribonucleotides. This term refers only to the primary structure of the molecule. Thus, the term includes triple-, double- and single-stranded DNA, as well as triple-, double- and single-stranded RNA. It also includes modifications, such as by methylation and/or by capping, and unmodified forms of the polynucleotide. More particularly, the terms "polynucleotide," "oligonucleotide," "nucleic acid" and "nucleic acid molecule" include polydeoxyribonucleotides (containing 2-deoxy-D-ribose), polyribonucleotides (containing D-ribose), any other type of polynucleotide which is an N- or C-glycoside of a purine or pyrimidine base, and other polymers containing nonnucleotidic backbones, for example, polyamide (e.g., peptide nucleic acids (PNAs)) and polymorpholino (commercially available from the Anti-Virals, Inc., Corvallis, Oreg., as Neugene) polymers, and other synthetic sequence-specific nucleic acid polymers providing that the polymers contain nucleobases in a configuration which allows for base pairing and base stacking, such as is found in DNA and RNA. There is no intended distinction in length between the terms "polynucleotide," "oligonucleotide," "nucleic acid" and "nucleic acid molecule," and these terms will be used interchangeably. Thus, these terms include, for example, 3'-deoxy-2',5'-DNA, oligodeoxyribonucleotide N3' P5' phosphoramidates, 2'-O-alkyl-substituted RNA, double- and single-stranded DNA, as well as double- and single-stranded RNA, DNA:RNA hybrids, and hybrids between PNAs and DNA or RNA, and also include known types of modifications, for example, labels which are known in the art, methylation, "caps," substitution of one or more of the naturally occurring nucleotides with an analog, internucleotide modifications such as, for example, those with uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoramidates, carbamates, etc.), with negatively charged linkages (e.g., phosphorothioates, phosphorodithioates, etc.), and with positively charged linkages (e.g., aminoalklyphosphoramidates, aminoalkylphosphotriesters), those containing pendant moieties, such as, for example, proteins (including nucleases, toxins, antibodies, signal peptides, poly-L-lysine, etc.), those with intercalators (e.g., acridine, psoralen, etc.), those containing chelators (e.g., metals, radioactive metals, boron, oxidative metals, etc.), those containing alkylators, those with modified linkages (e.g., alpha anomeric nucleic acids, etc.), as well as unmodified forms of the polynucleotide or oligonucleotide. In particular, DNA is deoxyribonucleic acid.
[0102] "Recombinant" as used herein to describe a nucleic acid molecule means a polynucleotide of genomic, cDNA, viral, semisynthetic, or synthetic origin which, by virtue of its origin or manipulation is not associated with all or a portion of the polynucleotide with which it is associated in nature. The term "recombinant" as used with respect to a protein or polypeptide means a polypeptide produced by expression of a recombinant polynucleotide. In general, the gene of interest is cloned and then expressed in transformed organisms, as described further below. The host organism expresses the foreign gene to produce the protein under expression conditions.
[0103] "Recombinant host cells", "host cells," "cells", "cell lines," "cell cultures", and other such terms denoting microorganisms or higher eukaryotic cell lines cultured as unicellular entities refer to cells which can be, or have been, used as recipients for recombinant vector or other transferred DNA, and include the original progeny of the original cell which has been transfected.
[0104] A "coding sequence" or a sequence which "encodes" a selected polypeptide, is a nucleic acid molecule which is transcribed (in the case of DNA) and translated (in the case of mRNA) into a polypeptide in vitro or in vivo when placed under the control of appropriate regulatory sequences (or "control elements"). The boundaries of the coding sequence can be determined by a start codon at the 5' (amino) terminus and a translation stop codon at the 3' (carboxy) terminus. A coding sequence can include, but is not limited to, cDNA from viral, procaryotic or eucaryotic mRNA, genomic DNA sequences from viral or procaryotic DNA, and even synthetic DNA sequences. A transcription termination sequence may be located 3' to the coding sequence.
[0105] Typical "control elements," include, but are not limited to, transcription promoters, transcription enhancer elements, transcription termination signals, polyadenylation sequences (located 3' to the translation stop codon), sequences for optimization of initiation of translation (located 5' to the coding sequence), and translation termination sequences. "Operably linked" refers to an arrangement of elements wherein the components so described are configured so as to perform their usual function. Thus, a given promoter operably linked to a coding sequence is capable of effecting the expression of the coding sequence when the proper enzymes are present. The promoter need not be contiguous with the coding sequence, so long as it functions to direct the expression thereof. Thus, for example, intervening untranslated yet transcribed sequences can be present between the promoter sequence and the coding sequence and the promoter sequence can still be considered "operably linked" to the coding sequence.
[0106] "Expression cassette" or "expression construct" refers to an assembly which is capable of directing the expression of the sequence(s) or gene(s) of interest. An expression cassette generally includes control elements, as described above, such as a promoter which is operably linked to (so as to direct transcription of) the sequence(s) or gene(s) of interest, and often includes a polyadenylation sequence as well. Within certain embodiments of the invention, the expression cassette described herein may be contained within a plasmid construct. In addition to the components of the expression cassette, the plasmid construct may also include, one or more selectable markers, a signal which allows the plasmid construct to exist as single-stranded DNA (e.g., a M13 origin of replication), at least one multiple cloning site, and a "mammalian" origin of replication (e.g., a SV40 or adenovirus origin of replication).
[0107] The term "transfection" is used to refer to the uptake of foreign DNA by a cell. A cell has been "transfected" when exogenous DNA has been introduced inside the cell membrane. A number of transfection techniques are generally known in the art. See, e.g., Graham et al. (1973) Virology, 52:456, Sambrook et al., Molecular Cloning, a laboratory manual, Cold Spring Harbor Laboratories, New York, Davis et al. Basic Methods in Molecular Biology, Elsevier. Such techniques can be used to introduce one or more exogenous DNA moieties into suitable host cells. The term refers to both stable and transient uptake of the genetic material, and includes uptake of peptide- or antibody-linked DNAs.
[0108] A "vector" is capable of transferring nucleic acid sequences to target cells (e.g., viral vectors, non-viral vectors, particulate carriers, and liposomes). Typically, "vector construct," "expression vector," and "gene transfer vector," mean any nucleic acid construct capable of directing the expression of a nucleic acid of interest and which can transfer nucleic acid sequences to target cells. Thus, the term includes cloning and expression vehicles, as well as viral vectors.
[0109] "Gene transfer" or "gene delivery" refers to methods or systems for reliably inserting DNA or RNA of interest into a host cell. Such methods can result in transient expression of non-integrated transferred DNA, extrachromosomal replication and expression of transferred replicons (e.g., episomes), or integration of transferred genetic material into the genomic DNA of host cells. Gene delivery expression vectors include, but are not limited to, vectors derived from bacterial plasmid vectors, viral vectors, non-viral vectors, alphaviruses, pox viruses and vaccinia viruses. When used for immunization, such gene delivery expression vectors may be referred to as vaccines or vaccine vectors.
[0110] By "vertebrate subject" is meant any member of the subphylum chordata, including, without limitation, humans and other primates, including non-human primates such as chimpanzees and other apes and monkey species; farm animals such as cattle, sheep, pigs, goats and horses; domestic mammals such as dogs and cats; non-domestic animals such as elk, deer, mink and feral cats; laboratory animals including rodents such as mice, rats and guinea pigs; birds, including domestic, wild and game birds such as chickens, turkeys and other gallinaceous birds, ducks, geese, pheasant, emu, ostrich and the like. The term does not denote a particular age. Thus, both adult and newborn individuals are intended to be covered.
[0111] By "therapeutically effective amount" in the context of the immunogenic compositions described herein is meant an amount of an immunogen which will induce an immunological response, either for antibody production or for treatment or prevention of infection.
[0112] As used herein, "treatment" refers to any of (i) the prevention of infection or reinfection, as in a traditional vaccine, or (ii) the reduction or elimination of symptoms from an infected individual. Treatment may be effected prophylactically (prior to infection) or therapeutically (following infection). Additionally, prevention or treatment in the context of the present invention can be a reduction of the amount of bacteria present in the subject of interest.
2. MODES OF CARRYING OUT THE INVENTION
[0113] Before describing the present invention in detail, it is to be understood that this invention is not limited to particular formulations or process parameters as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments of the invention only, and is not intended to be limiting.
[0114] Although a number of methods and materials similar or equivalent to those described herein can be used in the practice of the present invention, the preferred materials and methods are described herein.
[0115] The present invention is based in part on the discovery of immunogenic Mycoplasma molecules and formulations comprising combinations of Mycoplasma antigens that stimulate an immune response in a subject of interest. These molecules can be provided in an isolated form, as discrete components or as fusion proteins, and may be conjugated to a carrier that enhances immunogenicity of the antigens. The antigens can be incorporated into a pharmaceutical composition, such as a vaccine composition.
[0116] In particular, the inventors herein have identified numerous protein antigens in Mycoplasma mycoides subsp. mycoides (Mmm) and Mycoplasma mycoides subsp. capri (Mmc) as described in the examples. Immunization of cattle with subunit vaccines comprising several M. mycoides antigens elicited significant humoral responses and conferred protection against contagious bovine pleuropneumonia using an Mmm experimental challenge in cattle.
[0117] The present invention thus provides immunological compositions and methods for treating and/or preventing Mycoplasma disease. Immunization can be achieved by any of the methods known in the art including, but not limited to, use of vaccines containing one or more isolated Mycoplasma antigens or fusion proteins comprising multiple antigens, or by passive immunization using antibodies directed against the antigens. Such methods are described in detail below. Moreover, the antigens and antibodies described herein can be used for detecting the presence of Mycoplasma bacteria, for example in a biological sample.
[0118] The vaccines are useful in vertebrate subj ects that are susceptible to Mycoplasma infection, including without limitation, animals such as farm animals, including cattle, sheep, pigs, goats and horses; domestic mammals such as dogs and cats; non-domestic animals such as elk, deer, mink and feral cats; humans; avian species, and other species that are raised for meat or egg production such as, but not limited to, chickens, turkeys, geese, ducks, pheasant, emu and ostrich.
[0119] In order to further an understanding of the invention, a more detailed discussion is provided below regarding Mycoplasma antigens, production thereof, compositions comprising the same, and methods of using such compositions in the treatment or prevention of infection, as well as in the diagnosis of infection.
A. Mycoplasma Antigens
[0120] Antigens for use in the subject compositions can be derived from any of the several Mycoplasma species and subspecies that cause infection, including without limitation, M. gallisepticum; M. genitalium; M. haemofelis; M. hominis; M. hyopneumoniae; M. laboratorium; M. ovipneumoniae; M. pneumoniae; M. fermentans; M. hyorhinis; M. bovis; M. pulmonis; M. penetrans; M. arthritidis; M. hyponeumoniae; M. agalactiea; M. mycoides; M. arginini; M. adleri; M. agassizii; M. alkalesens; M. alligatoris; M. amphoriforme; M. anatis; M. anseris; M. auris; M. bovigenitalium; M. bovirhinis; M. bovoculi; M. buccale; M. buteonis; M. californicum; M. canadense; M. canis; M. capricolum; M. caviae; M. cavipharyngis; M. citelli; M. cloacale; M. coccoides; M. collis; M. columbinasale; M. columbinum; M. columborale; M. conjunctivae; M. corogypsi; M. cottewii; M. cricetuli; M. crocodyli; M. cynos; M. dispar; M. edwardii; M. elephantis; M. ellychniae; M. equigenitalium; M. equirhinis; M. falconis; M. fastidiosum; M. faucium; M. felifacium; M. feliminutum; M. flocculare; M. gallinaceum; M. gallinarum; M. gallopavonis; M. gaeteae; M. glycophilium; M gypis; M. haemocanis; M. haemofelis; M. haemomuris; M. haemosuis; M. hypopharyngis; M hyosynoviae; M. iguanae; M. imitans; M. indiense; M. iners; M. iowae; M. lacutcae; M. lagogenitalium; M. leachii; M. leonicptivi; M. leopharyngis; M. lipofaciens; M. lipophilum; M. lucivorax; M. luminosum; M. maculosum; M. melaleucae; M. meleagridis; M. microti; M. moatsii; M. mobile; M. molare; M. muscosicanis; M. muris; M. mustelae; M. neophronis; M. neurolyticvum; M. opalescens; M. orale; M. ovipneumoniae; M. ovis; M. oxoniensis; M. phocae; M. phocicerebrale; M. phocidae; M. phocirhinis; M. pirum; M. primatum; M. pullorum; M. putrefaciens; M. salivarium; M. simbae; M. spermatophilum; M. spumans; M. sturni; M. sualvi; M. subdolum; M. suis; M. synoviae; M. testudineum; M. testudinis; M. verecunum; M. wenyonii; M. yeatsii.
[0121] The following species use humans as a primary host: M. amphoriforme; M. buccale; M. faucium; M. fermentans; M. genitalium; M. hominis; M. lipophilum\M. orale; M. penetrans; M. pirum; M. pneumoniae; M. primatum; M. salivarium; M. spermatophilum Several species of Mycoplasma are frequently detected in different types of cancer cells, including without limitation M. fermentans; M. genitalium; M. hyorhinis; M and penetrans. M. pneumoniae is the etiologic agent of primary atypical pneumonia and is also responsible for many respiratory tract infections, such as tracheobronchitis, bronchiolitis, pharyngitis and croup, especially in older children and young adults and in elderly populations. M. genitalium, is believed to be involved in pelvic inflammatory diseases.
[0122] M. mycoides is found in cows and goats, and causes lung disease, such as contagious bovine pleuropneumonia (CBPP). M. mycoides is part of the Mycoplasma mycoides cluster, a group of closely related infectious mycoplasmas. The cluster comprises several species and subspecies including M. mycoides subsp. mycoides biotype Small Colony (MmmSC); M. mycoides subsp. mycoides biotype Large Colony (MmmLC); M. mycoides subsp. capri (Mmc); M. capricolum subsp. capricolum (Mcc); M. capricolum subsp. capripneumoniae (Mccp); and Mycoplasma sp. `bovine group 7` (MBG7).
[0123] M. bovis is also found in cows and can cause pneumonia, mastitis, and arthritis in cattle. Its etiological role has also been associated with otitis, keratoconjunctivitis, synovitis, and reproductive disorders in cows and bulls. Animals infected with M. bovis have depressed immune responses and can exhibit signs of infection such as fever, depression, anorexia, labored breathing, nasal and ocular discharge, coughing, sneezing, gasping, grunting, lameness and swollen joints, mastitis, middle ear infections, abortions, recumbence and death.
[0124] M. hyopneumoniae causes enzootic pneumonia, an economically important and highly prevalent disease in pigs. M. hyosynoviae lives in the upper respiratory track of pigs and invades the joints and tendon sheaths of susceptible animals and causes lameness and swelling (arthritis).
[0125] M. ovipneumoniae causes respiratory infections in sheep and M. cynos causes canine infectious respiratory disease (CIRD) in dogs. M. canis, M. spumans, and M. maculosum can cause mycoplasmosis in dogs and M. haemofelis causes infections in cats. M. gallisepticum (MG) is an infectious respiratory pathogen of gallinaceous birds such as chicken and turkey.
[0126] Although the following discussion is with respect to antigens derived from Mmm and Mmc, the corresponding antigens from any of the above species that cause disease can also be used in immunogenic compositions to treat Mycoplasma infection as it is readily apparent from the discussion herein that Mycoplasma causes a wide variety of disorders in a number of animals.
[0127] Table 1 and Table 4 show antigens for stimulating immune responses against M. mycoides, and in particular, against Mmm and Mmc. In the tables, Mmm proteins are indicated as MSC_xxxx and Mmc proteins are indicated as YP_0044xxxxxxxx. 1. Table 1 shows individual Mmm and Mmc proteins, while Table 4 shows Mmm and Mmc fusion proteins, as well as conjugates of the fusions and individual Mmm and Mmc proteins with an immunogenic carrier. It is to be understood that when referring to an Mmm or an Mmc protein from Table 4, the individual Mmm and Mmc proteins in the fusions and the conjugates are intended. In this regard, the boundaries of the individual Mmm and Mmc proteins present in the fusions, as well as the Mmm and Mmc proteins present in the conjugates, are described above.
[0128] The subject compositions can include one or more of these antigens, such as 2, 3, 4, 5, 6, 7, 8, 9, 10, etc., or antigens from other Mycoplasma species and subspecies that correspond to the Mmm and Mmc antigens listed in Tables 1 and 4. Moreover, the antigens present in the compositions can include the full-length amino acid sequences, or fragments or variants of these sequences so long as the antigens stimulate an immunological response, preferably, a protective immune response. Thus, the antigens can be provided with deletions from the N-terminus, including deletions of the native signal sequence, or can include a heterologous signal sequence, no signal sequence at all, or only a portion of the signal sequence. For example, the amino acid sequences for MSC_0136 (SEQ ID NO:2, FIG. 11B); MSC_0957 (SEQ ID NO:4, FIG. 12B); MSC_0499 (SEQ ID NO:6, FIG. 13B); MSC_0431 (SEQ ID NO:8, FIG. 14B); MSC_0776 (SEQ ID NO:10, FIG. 15B); YP_004400559.1 (SEQ ID NO: 10, FIG. 16B); YP_004399807.1 (SEQ ID NO:14, FIG. 17B); MSC_0816 (SEQ ID NO:16, FIG. 18B); MSC_0775 (SEQ ID NO:20, FIG. 20B); YP_004400127.1 (SEQ ID NO:22, FIG. 21B) and in the fusion depicted in FIG. 25B (SEQ ID NO:51) and FIG. 27B (SEQ ID NO:55); and YP_004400610.1 (SEQ ID NO:28, FIG. 24B) and the fusion depicted in FIG. 26B (SEQ ID NO:53) and FIG. 28B (SEQ ID NO:57), lack all or a portion of the N-terminal signal sequence. Similarly, the amino acid sequences for YP_00400580.1 in the fusion depicted in FIG. 26B (SEQ ID NO:53) and in FIG. 28B (SEQ ID NO:57); and the MSC_0775 in the fusion depicted in FIG. 33B (SEQ ID NO:67), lack an additional N-terminal truncation of 20 amino acids as compared to the YP_00400580.1 and MSC_0775 sequences shown in SEQ ID NO:26 and SEQ ID NO:20, respectively.
[0129] Additionally, the antigens can include deletions from the C-terminal portion of the molecule, such as deletions of all or a portion of the transmembrane and cytoplasmic domains, if present. For example, YP_004400580.1 (SEQ ID NO:26, FIG. 23B) includes a deletion of approximately 15 amino acids from the C-terminus.
[0130] Furthermore, internal deletions can be present so long as the molecule remains immunogenic. Moreover, the molecules optionally include an N-terminal methionine. In this regard, YP_004400559.1 (SEQ ID NO:12, FIG. 16B); YP_004399807.1 (SEQ ID NO:14, FIG. 17B); YP_004400127.1 (SEQ ID NO:22, FIG. 21B); YP_004399790.1 (SEQ ID NO:24, FIG. 22B); YP_004400580.1 (SEQ ID NO:26, FIG. 23B); YP_004400610.1 (SEQ ID NO:28, FIG. 24B) include an N-terminal methionine; while MSC_0136 (SEQ ID NO:2, FIG. 11B); MSC_0957 (SEQ ID NO:4, FIG. 12B); MSC_0499 (SEQ ID NO:6, FIG. 13B); MSC_0431 (SEQ ID NO:8, FIG. 14B); MSC_0776 (SEQ ID NO:10, FIG. 15B); MSC_0816 (SEQ ID NO:16, FIG. 18B); MSC_0160 (SEQ ID NO:18, FIG. 19B); MSC_0775 (SEQ ID NO:20, FIG. 20B); YP_004399790.1 (SEQ ID NO:24, FIG. 22B); YP_004400580.1 (SEQ ID NO:26, FIG. 23B) lack an N-terminal methionine.
[0131] As explained above, any of the M. mycoides antigens listed in Tables 1 and 4, as well as variants thereof, such as proteins with substantial sequence identity thereto, e.g., sequences that exhibit at least about 50% sequence identity, such as at least about 75% sequence identity, e.g., at least about 80%-85% sequence identity, for example at least about 90% sequence identity, such as at least about 95%-99% sequence identity or more, over a defined length of the molecules, or any integer within these values, will find use herein. Additionally, the corresponding antigens from a different species or subspecies, can be used in combination in the immunogenic compositions described herein, to provide protection against a broad range of Mycoplasma bacteria.
[0132] The compositions can include Mycoplasma antigens from more than one species or subspecies. For instance, the compositions can include one or more Mmm antigens, one or more Mmc antigens, both Mmm and Mmc antigens, along with one or more Mycoplasma antigens from any of the other species/subspecies listed above. Thus, each of the components of a subunit composition or fusion protein can be obtained from the same Mycoplasma species, or from different Mycoplasma species.
[0133] Moreover, if Mmm and/or Mmc antigens are present, they can include various combinations from any of the vaccine groups listed in Table 1, such as from Groups A, B, C, D, E, G, H, I, J, K, M, N, O and/or P. In some embodiments, two or more antigens selected from Group A (SEQ ID NOS:2, 4, 6, 8, 10), Group C (SEQ ID NOS:12, 14, 16, 18, 20) and/or Group N (SEQ ID NOS:22, 24, 26, 28) are present.
[0134] The immunogenic compositions can include discrete antigens, i.e., isolated and purified antigens provided separately, or can include fusions of the desired antigens. The fusions will include two or more immunogenic Mycoplasma proteins, such as 2, 3, 4, 5, 6, 7, 8, 9, 10, etc., e.g., two or more antigens listed in Tables 1 and 4, or antigens from other Mycoplasma species and subspecies that correspond to the Mmm and Mmc antigens listed in Tables 1 and 4. Moreover, as explained above, the antigens present in the fusions can include the full-length amino acid sequences, or fragments or variants of these sequences so long as the antigens stimulate an immunological response, preferably, a protective immune response. In any event, at least one epitope from these antigens will be present. In some embodiments, the fusions will include repeats of desired epitopes. As explained above, the antigens present in fusions can be derived from the same Mycoplasma species or subspecies, or from different species or subspecies, to provide increased protection against a broad range of Mycoplasma bacteria.
[0135] In certain embodiments, the fusions include multiple antigens, such as more than one epitope from a particular Mycoplasma antigen, and/or epitopes from more than one Mycoplasma antigen. The epitopes can be provided in the full-length antigen sequence, or in a partial sequence that includes the epitope. The epitopes can be from the same Mycoplasma species and subspecies, or different Mycoplasma species and subspecies. Additionally, the epitopes can be derived from the same Mycoplasma protein or from different Mycoplasma proteins from the same or different Mycoplasma species and subspecies.
[0136] More particularly, the fusions (also termed "chimeras" herein) may comprise multiple epitopes, a number of different Mycoplasma proteins from the same or different species and subspecies, as well as multiple or tandem repeats of selected Mycoplasma sequences, multiple or tandem repeats of selected Mycoplasma epitopes, or any combination thereof. Epitopes may be identified using techniques as described above, or fragments of Mycoplasma proteins may be tested for immunogenicity and active fragments used in compositions in lieu of the entire polypeptide. Fusions may also include the full-length sequence.
[0137] The antigen sequences present in the fusions may be separated by spacers. A selected spacer sequence may encode a wide variety of moieties of one or more amino acids in length. Selected spacer groups may also provide enzyme cleavage sites so that the expressed chimera can be processed by proteolytic enzymes in vivo to yield a number of peptides.
[0138] For example, amino acids can be used as spacer sequences. Such spacers will typically include from 1-500 amino acids, such as 1-100 amino acids, e.g., 1-50 amino acids, such as 1-25 amino acids, 1-10 amino acids, 1-3, 1-4, 1-5, 1-6, amino acids, or any integer between 1-500. The spacer amino acids may be the same or different between the various antigens. Particularly preferred amino acids for use as spacers are amino acids with small side groups, such as serine, alanine, glycine and valine, various combinations of amino acids or repeats of the same amino acid. For example, linker sequences including a particular amino acid or combination of amino acids, such as glycine, or glycine-serine, etc. may include 2, 3, 4, 5, 6, 7, 8, 9, 10 . . . 20 . . . 25 . . . 30, etc. of such repeats.
[0139] Although particular fusions are exemplified herein which include spacer sequences, it is also to be understood that one or more of the antigens present in the fusion constructs can be directly adjacent to another antigen, without an intervening spacer sequence.
[0140] Specific Mycoplasma fusion proteins include, but are not limited to, those listed in Table 4. The nucleotide and amino acid sequences of these particular Mycoplasma fusion proteins are shown in FIGS. 25A-25B (SEQ ID NOS:50 and 51); FIGS. 26A-26B (SEQ ID NOS:52 and 53); FIGS. 27A-27B (SEQ ID NOS:54 and 55); FIGS. 28A-28B (SEQ ID NOS:56 and 57); FIGS. 37A-37B (SEQ ID NOS:74 and 74); and FIGS. 38A-38B (SEQ ID NOS:76 and 77). However, it is to be understood that fusion proteins for use herein can be derived from any number of Mycoplasma antigens.
[0141] In order to enhance immunogenicity of the Mycoplasma proteins and fusions of multiple antigen molecules, they may be conjugated with a carrier. By "conjugated" is meant that the protein and fusions of interest may be linked to the carrier via non-covalent interactions, such as by electrostatic forces, or by covalent bonds, and the like. Thus, the carrier may be linked to the protein of interest via recombinant production, or the protein may be synthetically or chemically linked to a carrier after or during production. By "carrier" is meant any molecule which when associated with an antigen of interest, imparts immunogenicity to the antigen. Examples of suitable carriers include large, slowly metabolized macromolecules such as: proteins; polysaccharides, such as sepharose, agarose, cellulose, cellulose beads and the like; polymeric amino acids such as polyglutamic acid, polylysine, and the like; amino acid copolymers; inactive virus particles; bacterial toxins such as tetanus toxoid, serum albumins, keyhole limpet hemocyanin, thyroglobulin, ovalbumin, sperm whale myoglobin, and other proteins well known to those skilled in the art. Other suitable carriers for the antigens of the present invention include VP6 polypeptides of rotaviruses, or functional fragments thereof, as disclosed in U.S. Pat. No. 5,071,651.
[0142] These carriers may be used in their native form or their functional group content may be modified by, for example, succinylation of lysine residues or reaction with Cys-thiolactone. A sulfhydryl group may also be incorporated into the carrier (or antigen) by, for example, reaction of amino functions with 2-iminothiolane or the N-hydroxysuccinimide ester of 3-(4-dithiopyridyl propionate. Suitable carriers may also be modified to incorporate spacer arms (such as hexamethylene diamine or other bifunctional molecules of similar size) for attachment of peptides.
[0143] Mycoplasma proteins and multiple antigen fusion molecules can also be conjugated with a member of the RTX family of toxins, such as a Pasteurella haemolytica leukotoxin (LKT) polypeptide. See, e.g., International Publication No. WO 93/08290, published 29 Apr. 1993, as well as U.S. Pat. Nos. 5,238,823, 5,273,889, 5,723,129, 5,837,268, 5,422,110,5,708,155, 5,969,126, 6,022,960, 6,521,746 and 6,797,272, all incorporated herein by reference in their entireties.
[0144] Leukotoxin polypeptide carriers are derived from proteins belonging to the family of RTX molecules characterized by the carboxy-terminus consensus amino acid sequence Gly-Gly-X-Gly-X-Asp (SEQ ID NO:78, Highlander et al., DNA (1989) 8:15-28), where X is Lys, Asp, Val or Asn. Such proteins include, among others, leukotoxins derived from P. haemolytica and Actinobacillus pleuropneumoniae, as well as E. coli alpha hemolysin (Strathdee et al., Infect. Immun. (1987) 55:3233-3236; Lo, Can. J. Vet. Res. (1990) 54:S33-S35; Welch, Mol. Microbiol. (1991) 5:521-528). This family of toxins is known as the "RTX" family of toxins (Lo, Can. J. Vet. Res. (1990) 54:S33-S35). The nucleotide sequences and corresponding amino acid sequences for several leukotoxins are known. See, e.g., U.S. Pat. Nos. 4,957,739 and 5,055,400; Lo et al., Infect. Immun. (1985) 50:667-67; Lo et al., Infect. Immun. (1987) 55:1987-1996; Strathdee et al., Infect. Immun. (1987) 55:3233-3236; Highlander et al., DNA (1989) 8:15-28; Welch, Mol. Microbiol. (1991) 5:521-528. Particular examples of immunogenic leukotoxin polypeptides for use herein include LKT 342, LKT 352, LKT 111, LKT 326 and LKT 101 which are described in greater detail below.
[0145] By "LKT 352" is meant a protein derived from the lktA gene present in plasmid pAA352 and described in U.S. Pat. No. 5,476,657, incorporated herein by reference in its entirety. LKT 352, also termed "LtxA" herein, has an N-terminal truncation of the native P. haemolytica leukotoxin full-length sequence. Thus, the gene in plasmid pAA352 encodes a truncated leukotoxin, having 914 amino acids which lacks the cytotoxic portion of the molecule. The nucleotide and amino acid sequences of LKT 352 are shown in FIG. 41 (SEQ ID NOS:82 and 83). Note that the amino acid sequence depicted in FIG. 41 includes 10 amino acids from vector pAA352 on the 5'-end and two amino acids from vector pAA352 on the 3'-end. These flanking sequences can be included in the carrier molecule or deleted and the term "LKT 352" refers to both forms.
[0146] By "LKT 111" is meant a leukotoxin polypeptide which is derived from the lktA gene present in plasmid pCB111. The plasmid and nucleotide sequence of this gene and the corresponding amino acid sequence are described in U.S. Pat. Nos. 5,723,129 and 5,969,126, incorporated herein by reference in their entireties. The gene encodes a shortened version of leukotoxin which was developed from the recombinant leukotoxin gene present in plasmid pAA352 by removal of an internal DNA fragment of approximately 1300 bp in length. The LKT 111 polypeptide has an estimated molecular weight of 52 kDa (as compared to the 99 kDa LKT 352 polypeptide), retains the ability to act as a carrier molecule, and contains convenient restriction sites for use in producing the fusion proteins of the present invention.
[0147] By "LKT 101" is meant a leukotoxin polypeptide which is derived from the lktA gene present in plasmid pAA101. The plasmid and sequence of LKT 101 is described in U.S. Pat. No. 5,476,657 (see FIG. 3 therein), incorporated herein by reference in its entirety. The LKT 101 polypeptide is expressed from a C-terminally truncated form of the lktA gene which contains the 5' end of the gene up to the unique Pst1 restriction endonuclease site. Thus, LKT 101 includes the first 377 amino acids of native, full-length, P. haemolytica leukotoxin.
[0148] By "LKT 342" is meant a leukotoxin polypeptide which is derived from the lktA gene present in plasmid pAA342, described in U.S. Pat. No. 5,476,657, incorporated herein in its entirety. LKT 342 has an N-terminal and C-terminal truncation of the native leukotoxin sequence and includes amino acids 38-334 of native leukotoxin.
[0149] The various LKT molecules described above are representative and other leukotoxin and RTX molecules that enhance the immunogenicity of the Mycoplasma proteins and fusions will also find use herein. Moreover, the carrier molecules need not be physically derived from the sequence present in the corresponding plasmids but may be generated in any manner, including for example, by chemical synthesis or recombinant production, as described below.
[0150] Additionally, the Mycoplasma proteins and multiple antigen fusion molecules can be fused to either the carboxyl or amino terminals or both of the carrier molecule, or at sites internal to the carrier.
[0151] As explained above, carriers can be physically conjugated to the proteins of interest, using standard coupling reactions. Alternatively, chimeric molecules can be prepared recombinantly for use in the present invention, such as by fusing a gene encoding a suitable polypeptide carrier to one or more copies of a gene, or fragment thereof, encoding for selected Mycoplasma proteins or Mycoplasma multiple antigen fusion molecules.
[0152] Specific leukotoxin/M. mycoides conjugates are exemplified herein. However, is to be understood that Mycoplasma antigens and fusions of these antigens can be conjugated with any suitable carrier molecule if desired. The nucleotide and amino acid sequences of exemplary conjugates between M. mycoides constructs and a leukotoxin carrier are shown in FIGS. 27A-27B (SEQ ID NOS:54 and 55); FIGS. 28A-28B (SEQ ID NOS:56 and 57); FIGS. 29A-29B (SEQ ID NOS:58 and 59); FIGS. 30A-30B (SEQ ID NOS:60 and 61); FIGS. 31A-31B (SEQ ID NOS:62 and 63); FIGS. 32A-32B (SEQ ID NOS:64 and 65); FIGS. 33A-33B (SEQ ID NOS:66 and 67); FIGS. 34A-34B (SEQ ID NOS:68 and 69); FIGS. 35A-35B (SEQ ID NOS:70 and 71); FIGS. 36A-36B (SEQ ID NOS:72 and 73); FIGS. 37A-37B (SEQ ID NOS:74 and 75); FIGS. 38A-38B (SEQ ID NOS:76 and 77); FIGS. 39A-39B (SEQ ID NOS:78 and 79); and FIGS. 40A-40B (SEQ ID NOS:80 and 81).
[0153] Preferably, the above-described antigens and fusions, are produced recombinantly. A polynucleotide encoding these proteins can be introduced into an expression vector which can be expressed in a suitable expression system. A variety of bacterial, yeast, mammalian and insect expression systems are available in the art and any such expression system can be used. Optionally, a polynucleotide encoding these proteins can be translated in a cell-free translation system. Such methods are well known in the art. The proteins also can be constructed by solid phase protein synthesis.
[0154] If desired, the fusion proteins, or the individual components of these proteins, also can contain other amino acid sequences, such as amino acid linkers or signal sequences, either native or heterologous, as well as ligands useful in protein purification, such as glutathione-S-transferase and staphylococcal protein A.
B. Mycoplasma Polynucleotides
[0155] Mycoplasma polynucleotides encoding the Mycoplasma antigens, fusions of these antigens or epitopes therefrom, as well as conjugates of these antigens and fusions with carrier molecules, for use in the subject compositions, can be derived from any of the Mycoplasma species and subspecies described above. Although the following discussion is with respect to polynucleotides encoding antigens derived from Mmm and Mmc, the corresponding polynucleotides from any of the above species that cause disease can also be used to produce antigens for use in immunogenic compositions to treat Mycoplasma infection as it is readily apparent from the discussion herein that Mycoplasma causes a wide variety of disorders in a number of animals.
[0156] Tables 1 and 4 show polynucleotides encoding antigens, fusions and conjugates for stimulating immune responses against Mmm and Mmc. The polynucleotides described in Tables 1 and 4 have been modified for expression in E. coli and thus differ from previously reported and naturally occurring Mmm and Mmc polynucleotide sequences. Additionally, several genomic sequences for various Mycoplasma strains, species and subspecies, including Mmm and Mmc are known and reported in the NCBI database, including, but not limited to NCBI accession nos. NC_005364.2; BX293980.2; CP002107.1; CP010267.1; NC_021025.1; NZ_LAEW01000001.1; CP00162.1; CP001668.1; NC 015431.1; FQ377874.1; NZ_CP00162.1; CP002027.1; FR668087.1; FM864216.2; CP001872.1; AE015450.2; NZ_CP012387.1; CP001668.1; NZ_CP00162.1; NC_015431.1; FQ_3777874.1, and sequences from these species and subspecies that correspond to the Mmm and Mmc antigens described herein can be derived therefrom.
[0157] The polynucleotide sequences encoding Mycoplasma antigens will encode the full-length amino acid sequences, or fragments or variants of these sequences so long as the resulting antigens stimulate an immunological response, preferably, a protective immune response. Thus, the polynucleotides can encode antigens with deletions from the N-terminus, including deletions of the native signal sequence, or antigens with a heterologous signal sequence, no signal sequence at all, or only a portion of the signal sequence. Moreover, the polynucleotides can encode antigens with deletions from the C-terminal portion of the molecule, such as deletions of all or a portion of the transmembrane and cytoplasmic domains, if present, as well as internal deletions, so long as the molecule remains immunogenic. The encoded molecules optionally include an N-terminal methionine. Such molecules are described in detail above.
[0158] Preferably, the antigens, fusions and conjugates described above are produced recombinantly using these polynucleotides. Accordingly, once coding sequences for the desired antigens have been isolated or synthesized, they can be cloned into any suitable vector or replicon for expression. Numerous cloning vectors are known to those of skill in the art, and the selection of an appropriate cloning vector is a matter of choice. A variety of bacterial, yeast, plant, mammalian and insect expression systems are available in the art and any such expression system can be used. Optionally, a polynucleotide encoding these proteins can be translated in a cell-free translation system. Such methods are well known in the art.
[0159] Examples of recombinant DNA vectors for cloning and host cells which they can transform include the bacteriophage .lamda. (E. coli), pBR322 (E. coli), pACYC177 (E. coli), pKT230 (gram-negative bacteria), pGV1106 (gram-negative bacteria), pLAFR1 (gram-negative bacteria), pME290 (non-E. coli gram-negative bacteria), pHV14 (E. coli and Bacillus subtilis), pBD9 (Bacillus), pIJ61 (Streptomyces), pUC6 (Streptomyces), YIp5 (Saccharomyces), YCpl9 (Saccharomyces) and bovine papilloma virus (mammalian cells). See, generally, DNA Cloning: Vols. I & II, supra; Sambrook et al., supra; B. Perbal, supra.
[0160] Insect cell expression systems, such as baculovirus systems, can also be used and are known to those of skill in the art and described in, e.g., Summers and Smith, Texas Agricultural Experiment Station Bulletin No. 1555 (1987). Plant expression systems can also be used to produce the immunogenic proteins. Generally, such systems use virus-based vectors to transfect plant cells with heterologous genes. For a description of such systems see, e.g., Porta et al., Mol. Biotech. (1996) 5:209-221; and Hackiand et al., Arch. Virol. (1994) 139:1-22.
[0161] Viral systems, such as a vaccinia based infection/transfection system, as described in Tomei et al., J. Virol. (1993) 67:4017-4026 and Selby et al., J. Gen. Virol. (1993) 74:1103-1113, will also find use with the present invention. In this system, cells are first transfected in vitro with a vaccinia virus recombinant that encodes the bacteriophage T7 RNA polymerase. This polymerase displays exquisite specificity in that it only transcribes templates bearing T7 promoters. Following infection, cells are transfected with the DNA of interest, driven by a T7 promoter. The polymerase expressed in the cytoplasm from the vaccinia virus recombinant transcribes the transfected DNA into RNA which is then translated into protein by the host translational machinery. The method provides for high level, transient, cytoplasmic production of large quantities of RNA and its translation product(s).
[0162] The coding sequence can be placed under the control of a promoter, ribosome binding site (for bacterial expression) and, optionally, an operator (collectively referred to herein as "control elements"), so that the DNA sequence encoding the desired antigen is transcribed into RNA in the host cell transformed by a vector containing this expression construction. The coding sequence may or may not contain a signal peptide or leader sequence. Leader sequences can be removed by the host in post-translational processing. See, e.g., U.S. Pat. Nos. 4,431,739; 4,425,437; 4,338,397.
[0163] Other regulatory sequences may also be desirable which allow for regulation of expression of the protein sequences relative to the growth of the host cell. Such regulatory sequences are known to those of skill in the art, and examples include those which cause the expression of a gene to be turned on or off in response to a chemical or physical stimulus, including the presence of a regulatory compound. Other types of regulatory elements may also be present in the vector, for example, enhancer sequences.
[0164] The control sequences and other regulatory sequences may be ligated to the coding sequence prior to insertion into a vector. Alternatively, the coding sequence can be cloned directly into an expression vector which already contains the control sequences and an appropriate restriction site.
[0165] In some cases it may be necessary to modify the coding sequence so that it may be attached to the control sequences with the appropriate orientation; i.e., to maintain the proper reading frame. It may also be desirable to produce mutants or analogs of the immunogenic proteins. Mutants or analogs may be prepared by the deletion of a portion of the sequence encoding the protein, by insertion of a sequence, and/or by substitution of one or more nucleotides within the sequence. Techniques for modifying nucleotide sequences, such as site-directed mutagenesis, are well known to those skilled in the art. See, e.g., Sambrook et al., supra; DNA Cloning, Vols. I and II, supra; Nucleic Acid Hybridization, supra.
[0166] The expression vector is then used to transform an appropriate host cell. A number of mammalian cell lines are known in the art and include immortalized cell lines available from the American Type Culture Collection (ATCC), such as, but not limited to, Chinese hamster ovary (CHO) cells, HeLa cells, baby hamster kidney (BHK) cells, monkey kidney cells (COS), human hepatocellular carcinoma cells (e.g., Hep G2), as well as others. Similarly, bacterial hosts such as E. coli, Bacillus subtilis, and Streptococcus spp., will find use with the present expression constructs. Yeast hosts useful in the present invention include inter alia, Saccharomyces cerevisiae, Candida albicans, Candida maltosa, Hansenula polymorpha, Kluyveromyces fragilis, Kluyveromyces lactis, Pichia guillerimondii, Pichia pastoris, Schizosaccharomyces pombe and Yarrowia lipolytica. Insect cells for use with baculovirus expression vectors include, inter alia, Aedes aegypti, Autographa californica, Bombyx mori, Drosophila melanogaster, Spodoptera frugiperda, and Trichoplusia ni.
[0167] Depending on the expression system and host selected, the proteins of the present invention are produced by growing host cells transformed by an expression vector described above under conditions whereby the protein of interest is expressed. The selection of the appropriate growth conditions is within the skill of the art. If the proteins are not secreted, the cells are then disrupted, using chemical, physical or mechanical means, which lyse the cells yet keep the proteins substantially intact. Following disruption of the cells, cellular debris is removed, generally by centrifugation. Whether produced intracellularly or secreted, the protein can be further purified, using standard purification techniques such as but not limited to, column chromatography, ion-exchange chromatography, size-exclusion chromatography, electrophoresis, HPLC, immunoadsorbent techniques, affinity chromatography, immunoprecipitation, and the like.
C. Antibodies
[0168] The antigens of the present invention can be used to produce antibodies for therapeutic (e.g., passive immunization), diagnostic and purification purposes. These antibodies may be polyclonal or monoclonal antibody preparations, monospecific antisera, or may be hybrid or chimeric antibodies, such as humanized antibodies, altered antibodies, F(ab').sub.2 fragments, F(ab) fragments, Fv fragments, single-domain antibodies, dimeric or trimeric antibody fragment constructs, minibodies, or functional fragments thereof which bind to the antigen in question. Antibodies are produced using techniques well known to those of skill in the art and disclosed in, for example, U.S. Pat. Nos. 4,011,308; 4,722,890; 4,016,043; 3,876,504; 3,770,380; and 4,372,745.
[0169] For subjects known to have a Mycoplasma-related disease, an anti-Mycoplasma-antigen antibody may have therapeutic benefit and can be used to confer passive immunity to the subject in question. Alternatively, antibodies can be used in diagnostic applications, described further below, as well as for purification of the antigen of interest.
D. Compositions
[0170] The Mycoplasma antigens or antibodies, can be formulated into compositions for delivery to subjects for eliciting an immune response, such as for inhibiting infection. Compositions of the invention may comprise or be co-administered with non-Mycoplasma antigens or with a combination of Mycoplasma antigens, as described above. Methods of preparing such formulations are described in, e.g., Remington's Pharmaceutical Sciences, Mack Publishing Company, Easton, Pa., 18 Edition, 1990. The compositions of the present invention can be prepared as injectables, either as liquid solutions or suspensions. Solid forms suitable for solution in or suspension in liquid vehicles prior to injection may also be prepared. The preparation may also be emulsified or the active ingredient encapsulated in liposome vehicles. The active immunogenic ingredient is generally mixed with a compatible pharmaceutical vehicle, such as, for example, water, saline, dextrose, glycerol, ethanol, or the like, and combinations thereof. In addition, if desired, the vehicle may contain minor amounts of auxiliary substances such as wetting or emulsifying agents and pH buffering agents.
[0171] Adjuvants which enhance the effectiveness of the composition may also be added to the formulation. Such adjuvants include any compound or combination of compounds that act to increase an immune response to a Mycoplasma antigen or combination of antigens, thus reducing the quantity of antigen necessary in the vaccine, and/or the frequency of injection necessary in order to generate an adequate immune response. Adjuvants may include for example, muramyl dipeptides, AVRIDINE, aqueous adjuvants such as aluminum hydroxide, dimethyldioctadecyl ammonium bromide (DDA), oils, oil-in-water emulsions, water-in-oil emulsions, such as described in U.S. Pat. No. 7,279,163, incorporated herein by reference in its entirety, saponins, cytokines.
[0172] Also useful herein is a triple adjuvant formulation as described in, e.g., U.S. Pat. No. 9,061,001, incorporated herein by reference in its entirety. The triple adjuvant formulation includes a host defense peptide, in combination with a polyanionic polymer such as a polyphosphazene, and a nucleic acid sequence possessing immunostimulatory properties (ISS), such as an oligodeoxynucleotide molecule with or without a CpG motif (a cytosine followed by guanosine and linked by a phosphate bond) or the synthetic dsRNA analog poly(I:C).
[0173] Examples of host defense peptides for use in the combination adjuvant, as well as individually with the antigen include, without limitation, HH2 (VQLRIRVAVIRA, SEQ ID NO:30); 1002 (VQRWLIVWRIRK, SEQ ID NO:31); 1018 (VRLIVAVRIWRR, SEQ ID NO:32); Indolicidin (ILPWKWPWWPWRR, SEQ ID NO:33); HH111 (ILKWKWPWWPWRR, SEQ ID NO:34); HH113 (ILPWKKPWWPWRR, SEQ ID NO:35); HH970 (ILKWKWPWWKWRR, SEQ ID NO:36); HH1010 (ILRWKWRWWRWRR, SEQ ID NO:37); Nisin Z (Ile-Dhb-Ala-Ile-Dha-Leu-Ala-Abu-Pro-Gly-Ala-Lys-Abu-Gly-Ala-Leu-Met-Gly-- Ala-Asn-Met-Lys-Abu-Ala-Abu-Ala-Asn-Ala-Ser-Ile-Asn-Val-Dha-Lys, SEQ ID NO:38); JK1 (VFLRRIRVIVIR; SEQ ID NO:39); JK2 (VFWRRIRVWVIR; SEQ ID NO:40); JK3 (VQLRAIRVRVIR; SEQ ID NO:41); JK4 (VQLRRIRVWVIR; SEQ ID NO:42); JK5 (VQWRAIRVRVIR; SEQ ID NO:43); and JK6 (VQWRRIRVWVIR; SEQ ID NO:44). Any of the above peptides, as well as fragments and analogs thereof, that display the appropriate biological activity, such as the ability to modulate an immune response, such as to enhance an immune response to a co-delivered antigen, will find use herein.
[0174] Exemplary, non-limiting examples of ISSs for use in the triple adjuvant composition, or individually include, CpG oligonucleotides or non-CpG molecules. By "CpG oligonucleotide" or "CpG ODN" is meant an immunostimulatory nucleic acid containing at least one cytosine-guanine dinucleotide sequence (i.e., a 5' cytidine followed by 3' guanosine and linked by a phosphate bond) and which activates the immune system. An "unmethylated CpG oligonucleotide" is a nucleic acid molecule which contains an unmethylated cytosine-guanine dinucleotide sequence (i.e., an unmethylated 5' cytidine followed by 3' guanosine and linked by a phosphate bond) and which activates the immune system. A "methylated CpG oligonucleotide" is a nucleic acid which contains a methylated cytosine-guanine dinucleotide sequence (i.e., a methylated 5' cytidine followed by a 3' guanosine and linked by a phosphate bond) and which activates the immune system. CpG oligonucleotides are well known in the art and described in, e.g., U.S. Pat. Nos. 6,194,388; 6,207,646; 6,214,806; 6,218,371; 6,239,116; and 6,339,068; PCT Publication No. WO 01/22990; PCT Publication No. WO 03/015711; US Publication No. 20030139364, which patents and publications are incorporated herein by reference in their entireties.
[0175] Examples of such CpG oligonucleotides include, without limitation, 5'TCCATGACGTTCCTGACGTT3' (SEQ ID NO:45), termed CpG ODN 1826, a Class B CpG; 5'TCGTCGTTGTCGTTTTGTCGTT3' (SEQ ID NO:29), termed CpG ODN 2007, a Class B CpG; 5'TCGTCGTTTTGTCGTTTTGTCGTT3' (SEQ ID NO:46), also termed CPG 7909 or 10103, a Class B CpG; 5' GGGGACGACGTCGTGGGGGGG 3' (SEQ ID NO:47), termed CpG 8954, a Class A CpG; and 5'TCGTCGTTTTCGGCGCGCGCCG 3' (SEQ ID NO:48), also termed CpG 2395 or CpG 10101, a Class C CpG. All of the foregoing class B and C molecules are fully phosphorothioated.
[0176] Non-CpG oligonucleotides for use in the present composition include the double stranded polyriboinosinic acid:polyribocytidylic acid, also termed poly(I:C); and a non-CpG oligonucleotide 5'AAAAAAGGTACCTAAATAGTATGTTTCTGAAA3' (SEQ ID NO:49).
[0177] Polyanionic polymers for use in the triple combination adjuvants or alone include polyphosphazines. Typically, polyphosphazenes for use with the present adjuvant compositions will either take the form of a polymer in aqueous solution or a polymer microparticle, with or without encapsulated or adsorbed substances such as antigens or other adjuvants. For example, the polyphosphazene can be a soluble polyphosphazene, such as a polyphosphazene polyelectrolyte with ionized or ionizable pendant groups that contain, for example, carboxylic acid, sulfonic acid or hydroxyl moieties, and pendant groups that are susceptible to hydrolysis under conditions of use to impart biodegradable properties to the polymer. Such polyphosphazene polyelectrolytes are well known and described in, for example, U.S. Pat. Nos. 5,494,673; 5,562,909; 5,855,895; 6,015,563; and 6,261,573, incorporated herein by reference in their entireties. Alternatively, polyphosphazene polymers in the form of cross-linked microparticles will also find use herein. Such cross-linked polyphosphazene polymer microparticles are well known in the art and described in, e.g., U.S. Pat. Nos. 5,053,451; 5,149,543; 5,308,701; 5,494,682; 5,529,777; 5,807,757; 5,985,354; and 6,207,171, incorporated herein by reference in their entireties.
[0178] Examples of particular polyphosphazene polymers for use herein include poly[di(sodium carboxylatophenoxy)phosphazene] (PCPP) and poly(di-4-oxyphenylproprionate)phosphazene (PCEP), in various forms, such as the sodium salt, or acidic forms, as well as a polymer composed of varying percentages of PCPP or PCEP copolymer with hydroxyl groups, such as 90:10 PCPP/OH. Methods for synthesizing these compounds are known and described in the patents referenced above, as well as in Andrianov et al., Biomacromolecules (2004) 5:1999; Andrianov et al., Macromolecules (2004) 37:414; Mutwiri et al., Vaccine (2007) 25:1204.
[0179] Additional adjuvants include chitosan-based adjuvants, and any of the various saponins, oils, and other substances known in the art, such as AMPHIGEN.TM. which comprises de-oiled lecithin dissolved in an oil, usually light liquid paraffin. In vaccine preparations AMPHIGEN.TM. is dispersed in an aqueous solution or suspension of the immunizing antigen as an oil-in-water emulsion. Other adjuvants are LPS, bacterial cell wall extracts, bacterial DNA, synthetic oligonucleotides and combinations thereof (Schijns et al., Curr. Opi. Immunol. (2000) 12:456), Mycobacterial phlei (M. phlei) cell wall extract (MCWE) (U.S. Pat. No. 4,744,984), M. phlei DNA (M-DNA), M-DNA-M. phlei cell wall complex (MCC). For example, compounds which may serve as emulsifiers herein include natural and synthetic emulsifying agents, as well as anionic, cationic and nonionic compounds. Among the synthetic compounds, anionic emulsifying agents include, for example, the potassium, sodium and ammonium salts of lauric and oleic acid, the calcium, magnesium and aluminum salts of fatty acids (i.e., metallic soaps), and organic sulfonates such as sodium lauryl sulfate. Synthetic cationic agents include, for example, cetyltrimethylammonium bromide, while synthetic nonionic agents are exemplified by glyceryl esters (e.g., glyceryl monostearate), polyoxyethylene glycol esters and ethers, and the sorbitan fatty acid esters (e.g., sorbitan monopalmitate) and their polyoxyethylene derivatives (e.g., polyoxyethylene sorbitan monopalmitate). Natural emulsifying agents include acacia, gelatin, lecithin and cholesterol.
[0180] Other suitable adjuvants can be formed with an oil component, such as a single oil, a mixture of oils, a water-in-oil emulsion, or an oil-in-water emulsion. The oil may be a mineral oil, a vegetable oil, or an animal oil. Mineral oil, or oil-in-water emulsions in which the oil component is mineral oil are preferred. Another oil component is the oil-in-water emulsion sold under the trade name of EMULSIGEN.TM., such as but not limited to EMULSIGEN PLUS.TM., comprising a light mineral oil as well as 0.05% formalin, and 30 .mu.g/mL gentamicin as preservatives), available from MVP Laboratories, Ralston, Nebr. Also of use herein is an adjuvant known as "VSA3" which is a modified form of EMULSIGEN PLUS.TM. which includes DDA (see, U.S. Pat. No. 5,951,988, incorporated herein by reference in its entirety). Suitable animal oils include, for example, cod liver oil, halibut oil, menhaden oil, orange roughy oil and shark liver oil, all of which are available commercially. Suitable vegetable oils, include, without limitation, canola oil, almond oil, cottonseed oil, corn oil, olive oil, peanut oil, safflower oil, sesame oil, soybean oil, and the like.
[0181] Alternatively, a number of aliphatic nitrogenous bases can be used as adjuvants with the vaccine formulations. For example, known immunologic adjuvants include amines, quaternary ammonium compounds, guanidines, benzamidines and thiouroniums (Gall, D. (1966) Immunology 11:369 386). Specific compounds include dimethyldioctadecylammonium bromide (DDA) (available from Kodak) and N,N-dioctadecyl-N,N-bis(2-hydroxyethyl)propanediamine ("AVRIDINE"). The use of DDA as an immunologic adjuvant has been described; see, e.g., the Kodak Laboratory Chemicals Bulletin 56(1):1 5 (1986); Adv. Drug Deliv. Rev. 5(3):163 187 (1990); J. Controlled Release 7:123 132 (1988); Clin. Exp. Immunol. 78(2):256 262 (1989); J. Immunol. Methods 97(2):159 164 (1987); Immunology 58(2):245 250 (1986); and Int. Arch. Allergy Appl. Immunol. 68(3):201 208 (1982). AVRIDINE is also a well-known adjuvant. See, e.g., U.S. Pat. No. 4,310,550, incorporated herein by reference in its entirety, which describes the use of N,N-higher alkyl-N',N'-bis(2-hydroxyethyl)propane diamines in general, and AVRIDINE in particular, as vaccine adjuvants. U.S. Pat. No. 5,151,267 to Babiuk, incorporarted herein by reference in its entirety, and Babiuk et al. (1986) Virology 159:57 66, also relate to the use of AVRIDINE as a vaccine adjuvant.
[0182] Moreover, the antigens may be conjugated to a carrier protein in order to enhance the immunogenicity thereof. The carrier molecule may be covalently conjugated to the antigen directly or via a linker. Such carriers and linkers are described in detail above. Any suitable conjugation reaction can be used, with any suitable linker where desired.
[0183] Once prepared, the formulations will contain a "pharmaceutically effective amount" of the active ingredient, that is, an amount capable of achieving the desired response in a subject to which the composition is administered. In the treatment and prevention of a Mycoplasma disease, a "pharmaceutically effective amount" would preferably be an amount which prevents, reduces or ameliorates the symptoms of the disease in question. The exact amount is readily determined by one skilled in the art using standard tests. The active ingredient will typically range from about 1% to about 95% (w/w) of the composition, or even higher or lower if appropriate. With the present formulations, 1 .mu.g to 2 mg, such as 10 .mu.g to 1 mg, e.g., g to 0.5 mg, 50 .mu.g to 200 .mu.g, or any values between these ranges of active ingredient per ml of injected solution should be adequate to treat or prevent infection when a dose of 1 to 5 ml per subject is administered. The quantity to be administered depends on the subject to be treated, the capacity of the subject's immune system to synthesize antibodies, and the degree of protection desired. Effective dosages can be readily established by one of ordinary skill in the art through routine trials establishing dose response curves.
[0184] The composition can be administered parenterally, e.g., by intratracheal, intramuscular, subcutaneous, intraperitoneal, intravenous injection, or by delivery directly to the lungs, such as through aerosol administration. The subject is administered at least one dose of the composition. Moreover, the subject may be administered as many doses as is required to bring about the desired biological effect.
[0185] Additional formulations which are suitable for other modes of administration include suppositories and, in some cases, aerosol, intranasal, oral formulations, and sustained release formulations. For suppositories, the vehicle composition will include traditional binders and carriers, such as, polyalkaline glycols, or triglycerides. Such suppositories may be formed from mixtures containing the active ingredient in the range of about 0.5% to about 10% (w/w), preferably about 1% to about 2%. Oral vehicles include such normally employed excipients as, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium, stearate, sodium saccharin cellulose, magnesium carbonate, and the like. These oral vaccine compositions may be taken in the form of solutions, suspensions, tablets, pills, capsules, sustained release formulations, or powders, and contain from about 10% to about 95% of the active ingredient, preferably about 25% to about 70%.
[0186] Intranasal formulations will usually include vehicles that neither cause irritation to the nasal mucosa nor significantly disturb ciliary function. Diluents such as water, aqueous saline or other known substances can be employed with the subject invention. The nasal formulations may also contain preservatives such as, but not limited to, chlorobutanol and benzalkonium chloride. A surfactant may be present to enhance absorption of the subject antigens by the nasal mucosa.
[0187] Controlled or sustained release formulations are made by incorporating the antigen into carriers or vehicles such as liposomes, nonresorbable impermeable polymers such as ethylenevinyl acetate copolymers and HYTREL copolymers, swellable polymers such as hydrogels, resorbable polymers such as collagen and certain polyacids or polyesters such as those used to make resorbable sutures, polyphosphazenes, alginate, microparticles, gelatin nanospheres, chitosan nanoparticles, and the like. The antigens described herein can also be delivered using implanted mini-pumps, well known in the art.
[0188] Prime-boost methods can be employed where one or more compositions are delivered in a "priming" step and, subsequently, one or more compositions are delivered in a "boosting" step. In certain embodiments, priming and boosting with one or more compositions described herein is followed by additional boosting. The compositions delivered can include the same antigens, or different antigens, given in any order and via any administration route.
E. Tests to Determine the Efficacy of an Immune Response
[0189] One way of assessing efficacy of therapeutic treatment involves monitoring infection after administration of a composition of the invention. One way of assessing efficacy of prophylactic treatment involves monitoring immune responses against the Mycoplasma antigens in the compositions of the invention after administration of the composition. Another way of assessing the immunogenicity of the immunogenic compositions of the present invention is to screen the subject's sera by immunoblot. A positive reaction indicates that the subject has previously mounted an immune response to the Mycoplasma antigens, that is, the Mycoplasma protein is an immunogen. This method may also be used to identify epitopes.
[0190] Another way of checking efficacy of therapeutic treatment involves monitoring infection after administration of the compositions of the invention. One way of checking efficacy of prophylactic treatment involves monitoring immune responses both systemically (such as monitoring the level of IgG1 and IgG2a production) and mucosally (such as monitoring the level of IgA production) against the antigens in the compositions of the invention after administration of the composition. Typically, serum-specific antibody responses are determined post-immunization but pre-challenge whereas mucosal specific antibody body responses are determined post-immunization and post-challenge. The immunogenic compositions of the present invention can be evaluated in in vitro and in vivo animal models prior to host administration.
[0191] The efficacy of immunogenic compositions of the invention can also be determined in vivo by challenging animal models of infection with the immunogenic compositions. The immunogenic compositions may or may not be derived from the same strains as the challenge strains. Preferably the immunogenic compositions are derivable from the same strains as the challenge strains.
[0192] The immune response may be one or both of a TH1 immune response and a TH2 response. The immune response may be an improved or an enhanced or an altered immune response. The immune response may be one or both of a systemic and a mucosal immune response. An enhanced systemic and/or mucosal immunity is reflected in an enhanced TH1 and/or TH2 immune response. Preferably, the enhanced immune response includes an increase in the production of IgG1 and/or IgG2a and/or IgA. Preferably the mucosal immune response is a TH2 immune response. Preferably, the mucosal immune response includes an increase in the production of IgA.
[0193] Activated TH2 cells enhance antibody production and are therefore of value in responding to extracellular infections. Activated TH2 cells may secrete one or more of IL-4, IL-5, IL-6, and IL-10. A TH2 immune response may result in the production of IgG1, IgE, IgA and memory B cells for future protection.
[0194] A TH2 immune response may include one or more of an increase in one or more of the cytokines associated with a TH2 immune response (such as IL-4, IL-5, IL-6 and IL-10), or an increase in the production of IgG1, IgE, IgA and memory B cells. Preferably, the enhanced TH2 immune response will include an increase in IgG1 production.
[0195] A TH1 immune response may include one or more of an increase in CTLs, an increase in one or more of the cytokines associated with a TH1 immune response (such as IL-2, IFN.gamma., and TNF.beta.), an increase in activated macrophages, an increase in NK activity, or an increase in the production of IgG2a. Preferably, the enhanced TH1 immune response will include an increase in IgG2a production.
[0196] The immunogenic compositions of the invention will preferably induce long lasting immunity that can quickly respond upon exposure to one or more infectious antigens.
F. Kits
[0197] The invention also provides kits comprising one or more containers of compositions of the invention. Compositions can be in liquid form or can be lyophilized, as can individual antigens. Suitable containers for the compositions include, for example, bottles, vials, syringes, and test tubes. Containers can be formed from a variety of materials, including glass or plastic. A container may have a sterile access port (for example, the container may be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle).
[0198] The kit can further comprise a second container comprising a pharmaceutically-acceptable buffer, such as phosphate-buffered saline, Ringer's solution, or dextrose solution. It can also contain other materials useful to the end-user, including other pharmaceutically acceptable formulating solutions such as buffers, diluents, filters, needles, and syringes or other delivery device. The kit may further include a third component comprising an adjuvant.
[0199] The kit can also comprise a package insert containing written instructions for methods of inducing immunity or for treating infections. The package insert can be an unapproved draft package insert or can be a package insert approved by the Food and Drug Administration (FDA) or other regulatory body.
[0200] The invention also provides a delivery device pre-filled with the immunogenic compositions of the invention.
[0201] Similarly, antibodies can be provided in kits, with suitable instructions and other necessary reagents. The kit can also contain, depending on if the antibodies are to be used in immunoassays, suitable labels and other packaged reagents and materials (i.e. wash buffers and the like). Standard immunoassays can be conducted using these kits.
3. EXPERIMENTAL
[0202] Below are examples of specific embodiments for carrying out the present invention. The examples are offered for illustrative purposes only, and are not intended to limit the scope of the present invention in any way.
[0203] Efforts have been made to ensure accuracy with respect to numbers used (e.g., amounts, temperatures, etc.), but some experimental error and deviation should, of course, be allowed for.
Example 1
Analysis of Immune Responses to Recombinant Proteins from Mycoplasma mycoides
1.1 Materials and Methods
[0204] Identification of M. mycoides Protein Antigens
[0205] The complete genome sequences of M. mycoides subsp. mycoides PG1 (Accession number BX293980, Westberg et al., Genome Res. (2004) 14:221-227); Gladysdale (Accession number CP002107, Wise et al., J Bacteriol. (2012) 194:4448-4449); and partial sequences of strains IS22, 138/5, 9809 (Accession numbers JQ307942 to JQ308103, Churchward et al., Vet Microbiol. (2012) 159:257-259; and 8676/93 (Accession number AJ515918.1, Botehlo et al. direct submission) were obtained from the NCBI Genome database for analysis.
[0206] A reverse-vaccinology pipeline was assembled and applied for M. mycoides antigen prediction. PSORTb 3.0 was used to identify non-cytoplasmic proteins, including extracellular, transmembrane and unknown-location ones (Yu et al., Nucleic Acids Res. (2011) 39:D241-244; Yu et al., Bioinformatics (2010) 26:1608-1615). The transmembrane and unknown-location proteins were further analyzed for their potential transmembrane topology with TMHMM 2.0 (cbs.dtu.dk/services/TMHMM; Krogh et al., J. Molec. Biol. (2001) 305:567-580) and in-house Perl scripts. The extracellular proteins predicted by PSORTb 3.0, and the extracellular proteins, 1-TM (transmembrane domain) proteins and the extracellular peptide fragments between TMs with lengths no shorter than 100 amino acids predicted by TMHMM 2.0, were further analyzed by SPAAN to estimate their adhesion probability (Krogh et al., J Mol Biol. (2001) 305:567-580). Those with an adhesin probability of more than or equal to 0.5 were selected for vaccine candidate prediction using Vaxign (He et al., J Biomed Biotechnol. (2010) 2010:297505). Those proteins with a Vaxign score of >0.4 were selected. Finally, the possible host self-antigens were removed by filtering the homologs of cattle proteins. The candidate antigenic proteins were compared among different M. mycoides strains to observe their conservation in M. mycoides.
[0207] Alternatively, after retrieving genome sequences from NCBI, potential lipoproteins were identified using LipoP 1.0 (Juncker et al., Protein Sci. (2003) 12:1652-1662 and homologies to other Mycoplasma species were investigated using BLASTP (Altschul et al., J Mol. Biol. (1990) 215:403-410. Where applicable, the homologous protein sequences were provided from Mmm strain Shawawa, a recent African outbreak strain. For expression of lipoproteins, the N-terminal signal sequences (SpII) were removed and not included in the synthetic gene sequences. Moreover, eight predicted surface proteins that have been described elsewhere were included (Hamsten et al., Mol. Cell Proteomics (2009) 8:2544-2554; Hamsten et al., Microbiology (2008) 154:539-549).
[0208] In total, 69 proteins were selected for initial use in vaccine trials. 38 of these proteins were Mmm proteins (those indicated as MSC_xxxx in Table 1) and 28 of these proteins were encoded by M. mycoides subsp. capri (Mmc, indicated as YP_0044xxxxxxxx. 1 in Table 1).
[0209] Construction of Genes Encoding M. mycoides Proteins
[0210] The 69 gene sequences identified above were analyzed in silico for codon usage bias, GC content, CpG dinucleotide content, mRNA secondary structure, cryptic splicing sites, premature PolyA sites, internal chi sites and ribosomal binding sites, negative CpG islands, RNA instability motif (ARE), repeat sequences (direct repeat, reverse repeat, and Dyad repeat). Restriction sites that might interfere with cloning were excluded. The genes were codon-optimized for Escherichia coli expression, synthesized and subcloned into the expression plasmids pSG21a or pET-15b (Novagen) containing a histidine-tag for purification of the proteins by metal-chelate affinity chromatography.
[0211] Purification of Recombinant M. mycoides Proteins
[0212] The plasmids encoding the recombinant M. mycoides proteins were used to transform E. coli BL21 STAR (Life Technologies, Invitrogen.TM., Burlington ON, CA). The transformed strains were grown in LB medium containing 50 .mu.g/ml carbenicillin to mid-exponential phase and induced with 0.2 mM IPTG for 2 hours. The bacterial cells (4.5 g/wet weight) were collected by centrifugation (4,000.times.g, 20 minutes) and suspended in lysis buffer (50 mM Na.sub.2HPO.sub.4, 300 mM NaCl, and 10 mM imidazole, pH 8.0) containing 1 mg/ml lysozyme. The cells were disrupted on ice by sonication (9 cycles of 10 seconds each with 10 second cooling intervals between each sonication). The cell debris was removed by centrifugation at 4.degree. C. and the supernatant (cleared lysate) collected. The cleared lysates were incubated with the Ni-NTA resin (Qiagen) and the histidine-tagged proteins were allowed to bind to the matrix for 1 hour at 4.degree. C. The mix was packed in columns, the unbound fraction collected, and the columns washed four times each with 4 ml of wash buffer (50 mM Na.sub.2HPO.sub.4, 300 mM NaCl, and 40 mM imidazole, pH 8.0). The bound proteins were eluted in elution buffer (50 mM Na.sub.2HPO.sub.4, 300 mM NaCl, and 250 mM imidazole, pH 8.0), buffer exchanged into 0.1 M PBS, pH 7.2, by repetitive washes using Ultrafree centrifugal filter devices (Millipore, Bedford, Mass.) with a cutoff size of 10 kDa. Contaminating LPS was removed by affinity chromatography using Detoxi-Gel.TM. (Pierce Biotechnology, Fisher Sci. ON, CA) and the purified proteins were stored at 4.degree. C. for further use.
[0213] Development of Multiplex Assays
[0214] Purified recombinant proteins were coupled to BioRad MaxPlex C.TM. microsphere beads (BioRad Laboratories Mississauga, ON) using the BioRad BioPlex.TM. amine coupling kit following manufacturer's instructions. For the coupling of cytokines MaxPlex C.TM. beads were primed in sulfo-NHS and EDC before coupling the antibodies against the cytokines. IL-1, IL-10 and IL-12 antibodies were purchased from AbD Serotec (Cedarlane Laboratories LTD. Burlington, ON); IL-6 and IL-17 antibodies from Kingfisher (Cedarlane Laboratories LTD. Burlington, ON), while antibodies against IFN-.alpha., IFN-.gamma., and TNF-.alpha. were produced internally. Finally, antibodies against TGF-.beta. were obtained from R&D (Cedarlane Laboratories LTD. Burlington, ON). Twenty micrograms of each antibody were coupled to the primed MaxPlex.TM. beads in 100 .mu.l of 100 mM MES pH6 buffer for 2 hours at room temperature, shaking at 600 rpm. Tubes containing the beads were placed on the magnetic separator for 1 minute after which the supernatant was removed. Tubes were removed from the separator and suspended in 100 .mu.l of PBS-BN (PBS, 1% BSA, 0.05% azide, pH 7.4) using vortex and a sonicator bath. The beads were incubated for 30 minutes at room temperature with shaking after which the tubes were placed in the magnetic separator for 1 minute. The supernatant was removed and beads were washed in 200 .mu.l PBST three times. Beads were suspended in 75 .mu.l of TE and stored at 4.degree. C. until use.
[0215] Ranking of M. mycoides Antigens
[0216] The proteins were individually tested against 35 CBPP-positive and 15 CBPP-negative bovine sera by a multiplex ELISA assay as follows: Labeled beads (50 .mu.l) suspended in PBS-T at a concentration of 10,000 beads/ml were applied to each well of a 96-well plate. Beads were washed in PBS and 50 .mu.l of serial dilutions of test serum was applied to each well. The mix was incubated for 30 minutes at room temperature on a shaker at 750 rpm. After washing in PBS, the beads were incubated with 50 .mu.l/well of anti-bovine IgG1, IgG2 or IgA coupled to biotin at a 1/5000 dilution and incubated for 30 minutes at room temperature on a shaker at 750 rpm. The beads were washed with PBS and 50 .mu.l of a 1/2000 dilution of Strepavidin-Phycoerythrin (SA-PE) per well was added and incubated at room temperature for 10 minutes with shaking at 750 rpm. The beads were washed in PBS after which, 125 .mu.l of PBS was added to each well followed by shaking for 3 minutes at 750 rpm. The fluorescence on the beads was read on a BioRad BioPlex 200.TM. reader (BioRad Laboratories Mississauga, ON; 100 .mu.l volume, 50 beads per region). The titres were calculated by the intersection of least-square regression of A.sub.405 versus the logarithm of the serum dilution. The proteins were ranked according to the IgG1 titres of the 35-positive animals, i.e. the higher the titres, the higher the rank.
[0217] Vaccine Trials
[0218] 170 male naive Boran cattle (Bos indicus) aged 2-3 years were used. Prior to use, animals were screened for anti-Mmm antibodies using CFT. No positive animals were detected. Due to the large number of animals used, the trials were divided into three. In total, seventeen groups of 5 animals per group were used. The first trial consisted of 60 cattle placed into five test groups (designated Groups A-E) and a placebo group (Group F). The second trial consisted of 60 cattle also placed into five test groups (designated Groups G-K) and a placebo group (Group L). The third trial consisted of 50 cattle placed into four test groups (Groups M-P) and a placebo group (Group Q).
[0219] The proteins were assembled into pools for vaccine formulations according to their ranking order, i.e. the first five proteins were included in group A, the second five in group B and so on. See Table 1. In Table 1,
[0220] Vaccines for the first and second trials were composed of five proteins while the vaccines for the third trial included four proteins, as shown in Table 1. The proteins were combined with CpG-ODN 2007 (5'TCGTCGTTGTCGTTTTGTCGTT3'; SEQ ID NO:29) and 30% Emulsigen.TM. (MVP Laboratories, Ralston, Nebr.).
[0221] Animals were inoculated subcutaneously on the right neck with 2 ml of the vaccine formulation (50 .mu.g of each antigen was present per innoculation) and a booster given 21 days later to the left neck. Rectal temperatures and other clinical signs were recorded daily. Blood was collected weekly for storage of serum and at three time points (pre-vaccination, post-vaccination and post-challenge) for preparation of peripheral blood mononuclear cell (PBMC) for use in proliferation assays. Samples collected on the day of primary vaccination represented day 0 of the trial.
[0222] ELISA and PBMC Proliferation Assays
[0223] ELISA tests were carried out on proteins coupled to magnetic beads as described above. The 66 recombinant proteins were tested for IgG1, IgG2, and IgA antibody responses on pre-vaccination (Day 0), pre-boost (Day 21) and post-boost (Day 35) serum samples as described above. Serum cytokine levels were measured on the same serum samples and on supernatants of PBMC cultures stimulated with the recall antigens by a multiplex ELISA assay. The cytokines tested were IL-1, IL-6, IL-10, L-12, IL-17, IFN-.alpha., IFN-.gamma., TNF-.alpha., and TFG-.beta.. After incubation of the beads with undiluted serum samples, beads were washed and biotinylated cytokine detection secondary antibodies were added and tubes incubated for 30 minutes at room temperature with shaking at 750 rpm. After washes, 50 .mu.l of a 1/2000 dilution of Strepavidin-Phycoerythrin (SA-PE) per well was added and incubated at room temperature for 10 minutes with shaking at 750 rpm. The beads were washed in PBS after which 125 .mu.l of PBS was added to each well followed by shaking for 3 minutes at 750 rpm. The fluorescence on the beads was read on a BioRad BioPlex 200.TM. reader (100 .mu.l volume, 50 beads per region). The cytokine concentrations were calculated by comparing the fluorescence value to that of beads incubated with purified cytokines used as standards.
[0224] For the proliferation assays, blood samples (20 ml from each animal) were collected in Vacutainer.TM. tubes containing sodium EDTA. The PBMC were separated by centrifugation (2500.times.g for 20 minutes) and the PBMCs (buffy coat) removed and transferred to Ficoll.TM. gradients (GE Healthcare, Mississauga, ON). The PBMCs were collected from the gradient, washed three times with PBSA (137 mM NaCl, 2.7 mM KCl, 7 mM Na.sub.3PO.sub.4 and 1.5 mM KH.sub.2PO.sub.4) containing EDTA and suspended in tissue culture media (MEM) to 1.times.10.sup.7 cells/ml. The proliferation of PBMCs after stimulation with Concanavalin A (ConA) (Sigma-Aldrich, Oakville, ON) and/or recombinant proteins was determined by seeding 96-well Nunclon Delta Surface plates (Fisher Thermo Sci., NY, USA) at a concentration of 3.times.10.sup.5 PBMCs/well. Cells were incubated at 37.degree. C. in 5% CO.sub.2 in the presence of 1 .mu.g/ml of ConA and/or recombinant proteins for 72 h in triplicate. A solution containing 0.4 .mu.Ci/well of .sup.3H-thymidine (GE Healthcare, Mississauga, ON) was added and the cells incubated for 18 hours. Cells were harvested (Packard, Filtermate Harvester) and the amount of incorporated .sup.3H-thymidine was determined in a scintillation counter (Packard, Top Count NXT.TM.) and the stimulation index determined by dividing the treated cell counts by media counts.
[0225] Statistical Analyses
[0226] The immune responses to the antigens between day 0, 21, and 35 titers for each antigen and between day 35 titres in the same group were analyzed using non-parametric Kruskal-Wallis with Dunn's multiple comparison tests. The day 35 responses between vaccinated and placebo group for each antigen were analyzed by Mann-Whitney test. For the statistical analyses Prism version 6 for Mac OS X was used. GraphPad Software, San Diego Calif. USA. Data was considered statistically different if the P value was 0.05 or less.
1.2 Humoral Immune Responses to the Recombinant Proteins
[0227] Candidate antigens were identified by reverse vaccinology as described above and are listed in Table 1. The genes coding for these putative antigens were cloned and expressed in E. coli and 66 recombinant proteins were tested against CBPP-positive and CBPP-negative sera from infected Kenyan animals. The proteins were ranked based on their respective antibody titres in sera from immune, but not naive animals. Before using these proteins to vaccinate African cattle breeds, Canadian crossbreed cattle were vaccinated to evaluate the magnitude and quality of immune responses. Due to the large number of animals and vaccine groups, Three animal trials were conducted as described above, with each trial composed of a placebo group and either five (trials 1 and 2) or four test groups (trial 3). The vaccine groups and treatments are shown in Table 1. For each group (including the respective placebo group) pre- and post-vaccination serum IgG1 and IgG2 responses were tested to the cognate recombinant proteins.
[0228] In the first trial, recombinant proteins ranked 1.sup.st to 25.sup.th were tested and the results are shown in FIGS. 1A-1E. Compared to the day 0 levels, at day 35 the IgG1 titres against the proteins from each group were significantly higher in groups A to E with P values ranging from <0.05 to <0.01, FIGS. 1A-1E). The day 35 IgG1 titres in the vaccinated groups were also compared to the placebo titres and the results are also shown in FIGS. 1A-1E. For all the proteins in this trial, the IgG1 titres in the vaccinated groups were significantly different than the placebo groups with P values ranging from <0.05 to <0.01, FIGS. 1A-1E). Finally, the day 35 titres for each protein in the each of the vaccinated groups were compared to each other and with the exception of YP_004400559.1 (SEQ ID NO:12) to YP_004399807.1 (SEQ ID NO:14) and MSC_0816 (SEQ ID NO:16), there were no significant differences between the IgG1 levels (FIG. 1C, group C).
[0229] The IgG2 titres were also determined in this trial and the results are shown in FIGS. 2A-2E. Like IgG1, in all the groups there were significant differences between the day 0 and 35 IgG2 titres, between the vaccinated and placebo groups at day 35 and also the IgG2 titres to YP_004400559.1 (SEQ ID NO:12) were significantly lower than MSC_0816 (SEQ ID NO:16) and MSC_0160 (SEQ ID NO:18) (FIG. 2C, group C).
[0230] In the second trial, humoral responses to the recombinant proteins ranked 26.sup.st to 50.sup.th were tested and the results are shown in FIGS. 3A-3E. Compared to the day 0 levels, at day 35 the IgG1 titres against the proteins from each group were significantly higher in groups G to K with P values ranging from <0.05 to <0.01 (FIGS. 3A-3E, groups G to K). As in trial 1, the day 35 IgG1 titres in the vaccinated groups were significantly different to the placebo groups with P values ranging from <0.05 to <0.01 (FIG. 2). With the exception of MSC_0453 (FIG. 3B, group H), and YP_004400226.1 (FIG. 3E, group K), the day 35 IgG1 titres to the proteins in each group were not significantly different between each other (FIGS. 3A-3E).
[0231] The IgG2 titres were measured and the results are shown in FIG. 4A-4E. Like the IgG1 titres, all the IgG2 levels were significantly different between days 0 and 35 in all the groups with the exception of YP_004400226.1 (FIG. 4E, group K). When the day 35 titres for each protein in the same group were compared, some of these were significantly lower MSC_0782 (FIG. 4A, group G); MSC_0453 (FIG. 4B, group H); YP_004400602.1 and YP_004400291.1 (FIG. 4C, group I); YP_004400622.1 and YP_004400371.1 (FIG. 4E, group K).
[0232] In the third trial, humoral responses to the recombinant proteins ranked 51.sup.st to 66.sup.th were tested and the results are shown in FIGS. 5A-5D. Compared to the day 0 levels, at day 35 the IgG1 titres against the proteins from each group were significantly higher in groups M to P with P values ranging from <0.05 to <0.01 (FIGS. 5A-5D, groups M to P). Serum IgG1 titres at day 35 in the vaccinated groups were significantly different than the placebo groups with P values ranging from <0.05 to <0.01 (FIGS. 5A-5D). With the exception of YP_004400171.1 (FIG. 5C, group O), there were no significant differences between the day 35 titres in the proteins from the same group.
[0233] The IgG2 titres were measured and like the IgG1 levels, most titres were significantly different between day 0 and 35 (FIGS. 6A-6D) with the exception of YP_004400399927.1 (FIG. 6D, group P). Most proteins showed significant differences in the day 35 titres between vaccinated and placebo groups with the exception of YP_0044004399927.1.1 (FIG. 6D, group P). When the day 35 titres for each protein in the same group were compared, some of these were significantly lower YP_004400581.1 (FIG. 6A, group M); MSC_0453 (FIG. 6B, group N); YP_004400446.1 and YP_004399927.1 (FIG. 6D, group P).
1.3 Cell-Mediated Immune Responses
[0234] Cell-mediated immune responses in each group were determined by measuring proliferation of bovine PBMC collected at days 0 and 35 in response to the cognate recall antigens. At day 0, there were no significant differences between the stimulation indexes (Si) of the placebo and vaccinated groups for all the antigens in all the trials. In the first trial, there were no significant differences between the stimulation indexes of PBMC collected at day 35 and incubated with the recall antigens in groups A, B, C, D, and E (FIGS. 7A-7E).
[0235] Similar results were observed for the second and third trials. In the second trial, there were no significant differences between the stimulation indexes of PBMC collected at day 35 and incubated with the recall antigens used on groups G, H, I, J, and K (FIGS. 8A-8E). Finally, there were no significant differences between the stimulation indexes of PBMC collected at day 35 and incubated with the recall antigens used on groups M, N, O and P (FIGS. 9A-9D).
1.4 Cytokine Levels
[0236] The presence of cytokines on the supernatants of PBMC stimulated with the recall antigens was determined. Cytokines (mostly TGF-.beta.) were detected in only a few of the supernatant tests. The assays were repeated on serum samples and out of all the cytokines tested, TGF-.beta. was consistently detected, however pre- and post-vaccination levels did not significantly differ in animals of the first and second trial (FIGS. 10A and 10B, respectively). In the third trial, the TGF-.beta. pre-vaccination levels were higher than the post vaccination levels with significant differences in groups M and P (FIG. 10C).
[0237] In sum, the serum IgG1 responses to all 66 proteins were significantly different at day 35 compared to day zero (FIGS. 1, 3 and 5). Similar results for most of the proteins were observed for the IgG2 titres with the exception of YP_004400226.1 that failed to elicit significant IgG2 responses (FIG. 4C, group I); YP_004400581.1, YP_0043999851.1, YP_004399914.1 (FIG. 6A, group M); YP_004399927.1 and YP_004400204.1 (FIG. 6D, group P). These results indicate that most of the proteins tested were able to elicit IgG1 and IgG2 responses and thus could be part of a panel of vaccine molecules to be tested in immunization and challenge experiments as detailed below. The proteins identified in this study included 15 lipoproteins, 15 hypothetical proteins, 6 transmembrane proteins and 4 transport proteins (Table 1). These proteins represent new vaccine targets.
[0238] The approach of first selecting antigens by reverse vaccinology, followed by ranking them in order of strong antibody responses, therefore proved to be successful in identifying several targets for a protective vaccine against CBPP.
TABLE-US-00002 TABLE 1 Proteins and Vaccine Groups Name (NCBI Vaccine Accession #) Description Size group.sup.a MSC_0136 Hypothetical lipoprotein 66 kDa A MSC_0957 Prolipoprotein 79 kDa MSC_0499 Prolipoprotein 111 kDa MSC_0431 Prolipoprotein 70 kDa MSC_0776 Prolipoprotein 120 kDa MSC_0519 Prolipoprotein 99 kDa B MSC_0500 Hypothetical lipoprotein 138 kDa MSC_0575 Hypothetical lipoprotein 69 kDa MSC_0653 Prolipoprotein 75 kDa MSC_0397 Prolipoprotein 45 kDa YP_004400559.1 Hypothetical protein 18 kDa C YP_004399807.1 Hypothetical protein 41 kDa MSC_0816 Variable surface 76 kDa lipoprotein MSC_0160 Translation elongation 75 kDa factor Tu MSC_0775 Prolipoprotein 81 kDa MSC_0013 Prolipoprotein 92 kDa D MSC_0610 DnaK 64 kDa MSC_0265 Pyruvate dehydrogenase .alpha.- 74 kDa chain MSC_0052 Hypothetical lipoprotein 111 kDa MSC_0240 Immunodomiant protein 94 kDa P72 MSC_0014 Prolipoprotein A/P72 91 kDa E MSC_0011 Ribose-galactose ABC 91 kDa transporter YP_004400534.1 Transmembrane protein 229 kDa MSC_0813 Variable surface protein 88 kDa MSC_0184 Oligopeptide ABC 149 kDa transporter substrate- binding component MSC_0782 Prolipoprotein 101 kDa G MSC_0401 Prolipoprotein 34 kDa MMS_A0381 Conserved hypothetical 100 kDa lipoprotein MSC_1058 Variable prolipoprotein 45 kDa MSC_0790 Alkyl-phosphonate ABC 85 kDa transporter substrate- binding protein MSC_0453 FKBP-type peptidyl-prolyl 81 kDa H isomerase MMS_A0108 Putative lipoprotein 71 kDa MSC_0798 Prolipoprotein 107 kDa MSC_0266 Pyruvate dehydrogenase .beta.- 68 kDa chain MSC_0456 Prolipoprotein 125 kDa YP_004400602.1 Transmembrane protein 15 kDa I YP_004400291.1 Transmembrane protein 82 kDa YP_004400300.1 Lipoprotein 98 kDa YP_004400620.1 Hypothetical protein 24 kDa MSC_1005 Variable surface 77 kDa prolipoprotein YP_004400616.1 Hypothetical protein 18 kDa J YP_004400615.1 Hypothetical protein 23 kDa MMS_A0415 Putative lipoprotein 45 kDa MSC_0927 Hypothetical lipoprotein 45 kDa MSC_0804 ABC transporter substrate- 83 kDa binding component YP_004400622.1 Hypothetical protein 24 kDa K YP_004400371.1 Permease 84 kDa YP_004400226.1 Hypothetical protein 15 kDa YP_004400021.1 PTS transporter 36 kDa MSC_0163 Leucyl aminopeptidase 82 kDa YP_004400581.1 Transmembrane protein 52 kDa M YP_004400296.1 Lipoprotein 101 kDa YP_004399851.1 PTS transporter 19 kDa YP_004399914.1 Hypothetical protein 16 kDa YP_004400127.1 Hypothetical protein 27 kDa N YP_004399790.1 Hypothetical protein 38 kDa YP_004400580.1 Lipoprotein 49 kDa YP_004400610.1 Hypothetical protein 23 kDa YP_004400171.1 ABC transporter 41 kDa O MSC_0139 Fructose-bisphosphate 65 kDa aldolase class II YP_004399939.1 Transmembrane protein 55 kDa YP_004400004.1 Transmembrane protein 41 kDa YP_004400446.1 Hypothetical protein 20 kDa P YP_004399927.1 Hypothetical protein 41 kDa YP_004400204.1 Hypothetical protein 149 kDa YP_004400368.1 Hypothetical protein 105 kDa References for all proteins in Table 1 are provided in Perez-Cascal et al., Vet. Immunol. Immunopathol. (2015) 168: 103-110. .sup.aIn addition to these vaccine groups, three placebo groups were included (groups F, L, and Q). Vaccines were formulated with 50 .mu.g of each antigen per dose. In all the groups, the vaccines were adjuvanted with 30% Emulsigen and 250 .mu.g CpG 2007 per dose.
Example 2
Protective Immune Responses to Recombinant Proteins from M. mycoides Against CBPP
2.1 Materials and Methods
[0239] M. mycoides Protein Antigens, Vaccines and Administration
[0240] M. mycoides protein antigens were identified, ranked and produced as described in Example 1. Cattle were grouped and vaccines were prepared and administered to cattle as described above. As explained, three challenge trials (comprising 60 cattle each for trials 1 and 2 and 50 for trial 3) were conducted, with each trial having vaccinated groups of 10 cattle each and a placebo group as indicated in Table 1. Each group of animals was immunized with a pool of five proteins as described above.
[0241] Mmm Strain and Growth Conditions
[0242] The Mmm Afade strain was grown in Gourlay's medium (Gourlay, R. N, Research in Veterinary Science (1964) 5:473-482) containing 20% heat-inactivated pig serum, 0.25 mg penicillin/ml, 0.025% thallous acetate. The medium was stored at 4.degree. C. and used within 14 days.
[0243] For the culture of Mmm, 1 ml aliquot of the master seed culture was thawed for 30 minutes at room temperature and inoculated into bijou bottles containing fresh Gourlay broth pre-warmed at 37.degree. C. Ten-fold dilutions were made into bijou bottles containing the broth and a portion of these dilutions was streaked on Gourlay agar plates. These were then incubated at 37.degree. C. in humidified incubator containing 5% CO.sub.2 for 48 hours. Colonies were screened for the typical fried egg appearance of Mmm. Cultures were upscaled every 24 hours, ensuring that Mycoplasma were always kept in log phase. The cultures were pooled and aliquoted in samples of 50 ml (around 10.sup.10 CFU/ml) and stored at -80.degree. C. to provide a standardized source of inocula.
[0244] Animal Challenge
[0245] Two weeks post-boost administration, cattle were challenged by introducing the Mmm Afade strain into the lungs, as previously described (Nkando et al., Tropical Animal Health and Production (2010) 42:1743-1747). Briefly, all cattle were sedated with 0.05 mg/kg body weight of xylazine hydrochloride (Rompun.TM.) intramuscularly. In a standing position, a lubricated endotracheal rubber tube was introduced through the nostrils to the larynx and down to the distal trachea. Using a syringe, 100 ml of the Mmm culture containing approximately 10.sup.10 CFU/ml was deposited, followed by 15 ml of pre-warmed 1.5% low temperature melting agar (Sigma, UK), suspended in sterile distilled water. This was followed by 30 ml of PBS to flush down the suspension to the target site.
[0246] Preparation of Cell Samples for Proliferative Assay
[0247] Blood was collected by venepuncture into a syringe containing an equal volume of Alsever's solution and mixed gently. PBMC were separated from whole blood by density gradient centrifugation over Ficoll-Paque.TM. PLUS solution (GE Healthcare Bio-Sciences AB, Sweden). In brief, 10 ml of Ficoll-paque solution was placed in a centrifuge tube and blood was layered on top. This was centrifuged at 400.times.g for 30 minutes at room temperature. The layer containing PBMCs was aspirated from the interface and transferred into another sterile centrifuge tube and washed with Alsever's solution by centrifuging at 200.times.g for 15 minutes at room temperature. The pellet was suspended in 2 ml of pre-warmed lysis buffer (Tris-buffered ammonium chloride solution: 0.16M NH.sub.4Cl and 0.17M Tris HCL, pH 7.2) and incubated at room temperature for 10 minutes with gentle shaking. A second wash was performed with Alsever's solution by centrifuging at 200.times.g for 10 minutes at room temperature. The resulting pellet was suspended in RPMI 1640 medium containing 10% fetal bovine serum (FBS) (Sigma-Aldrich), 20 mM HEPES, 2-mercaptoethanol at 1.times.10.sup.5, 2 mM L-Glutamine and Gentamicin 50 .mu.g/ml. An aliquot of the cell suspension was taken and cells counted on an automated hematology analyzer (Nihon Kohden Corporation, Japan).
[0248] Cell Stimulation Assays
[0249] The PBMC at a cell density of 3.5.times.10.sup.6 cells/ml were distributed into each well (100 ml/well) of a 96-well round-bottomed microtitre plate in triplicates. Cells were left untreated (negative control; RPMI 1640 with 10% FBS) or were stimulated with either mitogen Concanavalin A (ConA at 2 .mu.g/ml; Sigma-Aldrich) or Mmm antigen (at a concentration of 10 .mu.g/ml). These were incubated for 72 hours at 37.degree. C. in a humidified 5% CO.sub.2 incubator. Tritiated [.sup.3H] thymidine (25 .mu.l, 0.5 .mu.Ci per well) was added and the plates were returned to the CO.sub.2 incubator to pulse for 18 to 24 hours. Cells were harvested onto glass fiber filter mats using a semi-automated cell harvester (Perkin Elmer, Inc.). The samples were analyzed in a scintillation counter (Perkin Elmer, Inc.) and data was expressed as the mean of the triplicate cultures. Results were presented as stimulation indices (calculated as counts obtained with cells cultured in presence of antigen divided by counts obtained with cells cultured in medium alone).
[0250] Clinical Examination
[0251] Animals were observed daily and clinical findings suggestive of CBPP were recorded over the whole period of the trial (Nkando et al., Research in Veterinary Science (2012) 93:568-573). These included rectal temperatures, cough, nasal discharge, dyspnea, anorexia, weight-loss and eye discharges.
[0252] Serological Examination
[0253] Animals were bled weekly during the whole period of the trial. Blood samples were collected via jugular venepuncture into Vacutainer.RTM. tubes and allowed to clot at room temperature. Serum was thereafter separated and aliquoted into sterile vials, labeled, packed and stored at -20.degree. C. until the end of the trial. Samples from each animal were tested serially for the presence of Mmm antibodies using CFT and indirect ELISA (iELISA). The CFT was carried out according to the method of Campbell and Turner (Campbell et al., Australian Veterinary Journal (1953) 29:154-163), with some modifications. The ELISA tests were carried out on proteins coupled to magnetic beads as described in Example 1. Briefly, purified recombinant proteins were coupled to BioRad MaxPlex-C microsphere beads using the BioRad BioPlex amine coupling kit following manufacturer's instructions. Labeled beads (50 .mu.l) suspended in PBS-T at a concentration of 10,000 beads/ml were applied on each well of a 96-well plate. Beads were washed in PBS and 50 .mu.l of serial dilutions of test serum were applied to each well. The mix was incubated for 30 minutes at room temperature on a shaker at 750 rpm. After washing in PBS, the beads were incubated with 50 .mu.l/well of anti-bovine IgG1, IgG2 or IgA coupled to biotin at a 1/5000 dilution and incubated for 30 minutes at room temperature on a shaker at 750 rpm. The beads were washed with PBS and 50 .mu.l of a 1/2000 dilution of Strepavidin-Phycoerythrin (SA-PE) per well were added and incubated at room temperature for 10 minutes with shaking at 750 rpm. The beads were washed in PBS after which, 125 .mu.l of PBS was added to each well followed by shaking for 3 minutes at 750 rpm. The fluorescence on the beads was read on a BioRad BioPlex 200 reader (100 .mu.l volume, 50 beads per region). The titres were calculated by the intersection of least-square regression of A.sub.405 versus the logarithm of the serum dilution.
[0254] Postmortem Examination
[0255] At six weeks post-challenge, cattle were euthanized. Blood for serum was collected in Vacutainer.RTM. tubes. Upon opening the carcass, pleural fluid, where present, was aspirated into a 10 ml syringe and immediately stored in a cool box. The lungs were then examined for CBPP lesions. Lesions type and size (diameter in cm) were recorded. Pieces of lung from an area between the lesion and the grossly normal tissue were cut and placed in sterile polyethylene bags, transferred to a cool box and transported to the laboratory where they were processed and cultured for isolation of Mycoplasma organisms.
[0256] Lesion Scoring and Protection Rates
[0257] To determine severity of the disease in individual animals, the size of lung lesions was recorded and lung pathology scored according to the system described by Hudson and Turner (Hudson et al., Australian Veterinary Journal (1963) 39:373-385), in which the score is a combination of the type, the size of lesions, and the isolation of Mmm from tissues. Briefly, the presence of only encapsulated, resolving or fibrous lesions or pleural adhesions only, was rated one (1). The presence of other types of lesions such as consolidation, necrosis or sequestration was rated two (2). If in addition Mmm was isolated, a two (2) was added to the above rating. The resulting score was then multiplied by a factor depending on the lesion size i.e., multiplied by factor 1 if the lesion size was under 5 cm in diameter, by factor 2 if the size was over 5 cm and under 20 cm, and by factor 3 if the size was over 20 cm in diameter. Hence, the maximum pathology score was (2+2)3=12. Protection rate (defined as the percentage reduction in lung pathology brought about by vaccination) was calculated from the lesion scores of control and vaccinated animals, according to Hudson and Turner (Hudson et al., Australian Veterinary Journal (1963) 39:373-385), using the formula (NV-V).times.100/NV, where NV is the score of the non-vaccinated group and V is the score of the vaccinated group.
[0258] Bacteriological Examination
[0259] Lung tissue samples were sliced into small pieces using sterile scalpels and immersed in bijou bottles containing pre-warmed Gourlay's medium containing 20% heat-inactivated pig serum, 0.25 mg penicillin/ml, 0.025% thallous acetate and phenol red indicator. Pleural fluid was inoculated directly into the broth medium. The bijou bottles were incubated at 37.degree. C. in a humidified 5% CO.sub.2 incubator. The following day, 1 ml of the supernatant was diluted using a 10-fold dilution series and returned in the same incubator under the same conditions for 3 days. From these dilutions, 0.2 ml was streaked onto agar plates containing Gourlay's solid medium. The remaining (0.8 ml) broth cultures and the agar plates were incubated at 37.degree. C. in a humidified 5% CO.sub.2 incubator. These were examined daily for ten days for evidence of growth, indicated by color change from pink to yellow, and in some cases by filamentous growth or turbidity with a whitish deposit at the bottom of the bottles. The plates were examined under inverted microscope for Mycoplasma microcolonies at day 1, 5 and 10, respectively. Growth on solid medium was characterized by the presence of microcolonies with the classical fried egg appearance.
2.2 Post-Inoculation Clinical Response (Safety) and Serological Response to Proteins
[0260] Following vaccination (and before challenge) seroconversion by CFT was not observed in any cattle in trial 1. However, seroconversion was detected seven days post-vaccination in trial 2 (15 out of 50 immunized animals) and 3 (7 out of 40 immunized animals), but none of the cattle exceeded titres of 1/10, and as expected, no serocoversion was observed in the control group. By the time of challenge however, no titres were detected in any of these cattle.
2.3 Clinical and Serological Findings Post-Challenge
[0261] Table 2 shows highest temperature recorded (clinical) and serological (CFT and iELISA) findings. In all three trials, almost every animal that contracted CBPP, as assessed post-mortem, from either the vaccinated or the control group presented clinical signs typical of the disease that included fever, cough, nasal discharge, dyspnoea and disinclination to move and adopt postures, suggestive of oxygen deficiency. Clinical signs commenced six days post-infection (dpi) for trials 1 and 2 but the first case in trial 3 was observed on day 9 post-infection (p.i.). In all trials, the signs peaked between days 16 and 21 p.i. Fever (in this study considered to be >39.5.degree. C.) was intermittent and ranged between 39.5 and 40.5.degree. C. in the three trials. The first febrile reaction was observed on day 20 p.i. in trial 1, on day 9 and 21 p.i in trial 2 and 3, respectively. Out of the eleven cattle in trial 1 that exhibited fever, two were from the control group whereas the rest were from the vaccinated groups.
[0262] In trial 2, fever was observed in seven animals in the vaccinated groups and none in the control group. The number of cattle showing fever was highest in trial 3 where 37 cases were observed. Out of these, four were from the control group. Some animals manifested severe clinical symptoms and had to be euthanized before the planned end of the experiment. These included five from trial 1 (two from group E and one from group A and B, and control, respectively). Three animals, all from the vaccinated groups in trial 2, were euthanized. None of the animals in trial 3 was euthanized before the planned end of trial.
[0263] In all trials, CFT titres were detected 2 weeks post challenge and ranged between 1/10 and 1/640. Trial 1 had 17/60 cattle seroconverting including 4/10 from the control group, 2/10 from group A and C, respectively, and 4/10 from group B and E, respectively. Group D had one cattle seroconverting. More than half of the cattle (35/60) in trial 2 had serum CFT titres. Out of these, three were from the control group while group G, J and K had each 8 cattle seroconverting, and group H and I had 4 cases each. In trial 3, 10/50 cattle comprising 4/10 and 1/10, in group M and N, respectively, developed CFT titres. Groups O and P each had 2/10 while the control group had only one animal seroconverting.
2.4 Cell Stimulation Indices
[0264] Mmm-specific recall proliferation was detected in cattle following vaccination at varying magnitudes. Some animals demonstrated marginal responses in the assays performed before vaccination. However, following vaccination, responses were detected in all vaccinates indicating this was as a result of vaccination. The results of lymphocyte stimulation to the immunized antigens are shown in Table 3. The stimulation indices shown are compared to a medium-only value of 1.
[0265] In trial 1, SI values for the vaccinated groups were all above the pre-immunization value except one antigen in group E (MSC_0813). The values in the control group were all within the pre-immunization values except for two proteins (MSC_0775 and MSC_0500) which showed a relatively higher value post vaccination. In general, the responses detected in group A (group average of 4.2) post-vaccination were higher than in other vaccinated groups and lowest in group E. The strongest responses post vaccination were observed in presence of proteins MSC_0957, MSC_0500 and MSC_0775 which were in groups A, B and C, respectively.
[0266] In trial 2, the reactivity detected in group H was higher than in other groups following vaccination and lowest in group K.
[0267] In trial 3, there was no reactivity detected in any of the groups following vaccination.
[0268] Following challenge, the responses detected in all groups in trial 1 were weak and almost comparable to those of day 0 (pre-vaccination). This was in contrast to the control group where the values were slightly higher than those observed pre-vaccination.
[0269] In trial 2, the reactivity detected following challenge increased in all vaccinated groups with groups J and G triggering the strongest and weakest responses, respectively. Proteins MSC_0456 and MMS_A0415 triggered the strongest responses as compared to the other proteins. There were no responses observed in the control group.
[0270] In trial 3, following challenge, the responses in the vaccinated groups increased marginally.
2.5 Necropsy and Bacteriological Findings
[0271] Table 2 shows the number of animals with lesions and those from which Mmm was isolated in each group. Post-mortem examination revealed gross pathological lesions characteristic of CBPP including: consolidation of the lung parenchyma and pleuritis, hepatization and marbling appearance, well-developed sequestra that were either unilateral or bilateral. In all trials, extension and lesion severity were variable among the cattle within the groups. Some cattle displayed large sequestra encompassing the whole lung lobe while others had multiple sequestra ranging between 2 and 46 cm in diameter. In some cases, the pleural cavity contained copious amounts of clear amber-colored fluid (up to 6 liters) with fibrinous flecks. Fibrous adhesions of the parietal and visceral pleurae were observed in those with sequestra.
[0272] In trial 1, lung lesions were observed in 28/60 cattle. Out of these, nine were from the control group whereas 19 were from the vaccinated groups. With the exception of group E, the occurrence of lung lesions in other vaccinated groups was 2-4 times less frequent as compared to the control group. The mean pathology scores in the vaccinated groups was also about 2-6 times lower than that of the control group, except for groups B and E. Apart from group C, Mmm was isolated from the lung samples of the other groups.
[0273] In trial 2, lung lesions were observed in 29/60 cattle. Out of these, four were from the control group whereas 25 were from the vaccinated groups. The occurrence of lung lesions in the vaccinated groups was comparable to the control group, although mean pathology indices were higher in the vaccinated groups as compared to the control group. Isolation of Mmm was also higher in the vaccinated groups as compared to the control group.
[0274] In trial 3, lung lesions were observed in 27/50 cattle. Out of these, 19 were vaccinates (4/10, 4/10, 5/10, and 6/10, in groups M, N, O and P, respectively) and 8 were controls. With the exception of group N, all other groups had at least one animal harboring sequestra. The occurrence of lung lesions in vaccinated groups (Group M and N) was 2 times less frequent as compared to the control group. However, the lung lesions exhibited by the 4 animals in Group N were very mild and of a resolved nature as compared to those that were exhibited by the 4 animals in group M. which were severe. Average scores for lesion size were extremely low in Group N as compared to the other groups. The average score in Group N was about 4 times lower than that of the control group. A score of 0.4 and 1.5 was recorded in Group N and the control, respectively. At the time of necropsy, Mmm was not recovered from any cattle in group N.
2.6 Protection Rates
[0275] The protection rates in the different groups of cattle, defined as the percentage reduction in lung pathology brought about by vaccination, are illustrated in Table 2. In trial 1, protection was observed in Groups A, C and D, with the rates of 79.2%, 83.0%, 84.9%, respectively. Protection was not observed in any group in trial 2, and pathology was significantly higher than in the non-immunized animals. In trial 3, however, protection of 73.3% was observed in group N, the other had a higher pathology.
TABLE-US-00003 TABLE 2 Pathology and protection rates for the various pools of the prototype vaccines No. with No. of No. with Mmm Protection Group cattle lung lesions isolation rate Trial 1 A 10 2 2 79.2% B 10 4 5 37.7% C 10 3 0 83.0% D 10 2 3 84.9% E 10 8 4 20.8% F, placebo 10 9 4 0% Trial 2 G 10 5 5 -47.6% H 10 6 7 -38.1% I 10 6 7 -52.4% J 10 5 4 -57.1% K 10 4 6 -61.9% L, placebo 10 5 4 0% Trial 3 M 10 4 6 -153.3% N 10 4 0 73.3% O 10 5 4 -66.7% P 10 6 2 -73.3% Q, placebo 10 8 1 0%
TABLE-US-00004 TABLE 3 Stimulation index (average and standard deviation for each group of 10 animals) for each protein pre-vaccination and at two weeks post vaccination and two weeks after challenge AVERAGE STIMULATION INDICES Vaccinated groups Placebo groups Pre- Post Post Pre- Post Post vaccination vaccination challenge vaccination vaccination challenge Trial 1 Group A Group F MSC_0136 1.0 .+-. 0.5 3.9 .+-. 5.8 0.9 .+-. 0.2 0.8 .+-. 0.1 1.0 .+-. 0.3 1.3 .+-. 0.8 MSC_0957 1.4 .+-. 0.7 6.1 .+-. 4.2 0.9 .+-. 0.3 0.7 .+-. 0.2 1.3 .+-. 0.4 1.5 .+-. 0.8 MSC_0499 1.5 .+-. 1.1 3.6 .+-. 3.3 0.9 .+-. 0.3 0.7 .+-. 0.2 1.5 .+-. 0.4 1.6 .+-. 0.8 MSC_0431 1.7 .+-. 1.1 2.7 .+-. 2.0 0.9 .+-. 0.3 0.6 .+-. 0.1 1.3 .+-. 0.3 1.7 .+-. 1.1 MSC_0776 1.5 .+-. 1.1 4.6 .+-. 4.7 1.1 .+-. 0.4 0.6 .+-. 0.1 1.4 .+-. 0.3 2.0 .+-. 1.4 Group B MSC_0519 1.0 .+-. 0.3 1.2 .+-. 1.1 0.9 .+-. 0.3 0.7 .+-. 0.1 1.8 .+-. 0.9 1.7 .+-. 1.3 MSC_0500 0.9 .+-. 0.3 6.1 .+-. 5.7 1.1 .+-. 0.4 0.7 .+-. 0.2 4.1 .+-. 2.3 1.9 .+-. 1.5 MSC_0575 1.0 .+-. 0.3 2.3 .+-. 2.0 1.0 .+-. 0.4 0.7 .+-. 0.2 1.3 .+-. 0.3 1.4 .+-. 0.4 MSC_0653 1.1 .+-. 0.5 2.3 .+-. 1.8 1.2 .+-. 0.5 0.7 .+-. 0.2 1.0 .+-. 0.3 1.5 .+-. 0.6 MSC_0397 1.1 .+-. 0.2 1.8 .+-. 1.3 1.4 .+-. 0.8 0.7 .+-. 0.1 1.2 .+-. 0.3 1.6 .+-. 0.9 Group C YP_004400559 1.0 .+-. 0.3 2.5 .+-. 3.3 1.0 .+-. 0.3 0.8 .+-. 0.3 1.4 .+-. 0.4 2.1 .+-. 1.5 YP_004399807 1.1 .+-. 0.3 1.8 .+-. 1.0 1.4 .+-. 0.5 0.7 .+-. 0.2 1.4 .+-. 0.5 2.1 .+-. 1.5 MSC_0816 1.2 .+-. 0.3 2.7 .+-. 1.0 1.7 .+-. 1.4 0.8 .+-. 0.2 1.6 .+-. 0.6 2.1 .+-. 1.7 MSC_0160 1.1 .+-. 0.3 1.8 .+-. 1.0 2.0 .+-. 1.8 0.8 .+-. 0.4 1.7 .+-. 0.8 1.9 .+-. 1.7 MSC_0775 1.1 .+-. 0.5 6.2 .+-. 4.7 2.2 .+-. 2.1 0.7 .+-. 0.2 2.4 .+-. 1.7 1.8 .+-. 1.7 Group D MSC_0013 0.9 .+-. 0.2 1.4 .+-. 1.0 1.0 .+-. 0.4 0.7 .+-. 0.1 1.5 .+-. 0.4 2.0 .+-. 1.3 MSC_0610 0.9 .+-. 0.2 1.7 .+-. 1.4 1.3 .+-. 0.4 0.7 .+-. 0.1 1.4 .+-. 0.3 1.6 .+-. 0.8 MSC_0265 1.0 .+-. 0.3 1.6 .+-. 1.1 1.2 .+-. 0.6 0.6 .+-. 0.2 1.1 .+-. 0.5 1.8 .+-. 1.1 MSC_0052 1.3 .+-. 0.4 2.4 .+-. 1.5 1.6 .+-. 0.9 0.8 .+-. 0.1 1.9 .+-. 0.9 2.2 .+-. 2.0 MSC_0240 1.4 .+-. 0.4 3.2 .+-. 3.6 1.7 .+-. 1.0 0.9 .+-. 0.5 1.7 .+-. 0.8 2.0 .+-. 1.2 Group E MSC_0014 1.0 .+-. 0.5 1.2 .+-. 0.8 0.9 .+-. 0.4 1.0 .+-. 0.9 2.0 .+-. 0.6 2.0 .+-. 1.6 MSC_0011 1.0 .+-. 0.3 1.2 .+-. 1.0 0.9 .+-. 0.3 0.7 .+-. 0.2 1.7 .+-. 0.6 2.1 .+-. 1.7 YP_004400534 1.1 .+-. 0.4 1.9 .+-. 1.6 0.9 .+-. 0.2 0.7 .+-. 0.2 1.5 .+-. 0.5 1.9 .+-. 1.5 MSC_0813 1.0 .+-. 0.2 0.8 .+-. 0.2 0.8 .+-. 0.2 0.8 .+-. 0.3 1.4 .+-. 0.7 1.8 .+-. 1.5 MSC_0184 0.9 .+-. 0.3 1.2 .+-. 0.7 0.8 .+-. 0.2 0.7 .+-. 0.1 1.1 .+-. 0.3 1.7 .+-. 1.4 Trial 2 Group G Group L MSC_0782 0.7 .+-. 0.4 0.7 .+-. 0.2 0.9 .+-. 0.3 0.5 .+-. 0.4 0.9 .+-. 0.3 0.8 .+-. 0.4 MSC_0401 0.9 .+-. 0.2 1.4 .+-. 0.8 1.4 .+-. 0.7 0.6 .+-. 0.3 1.3 .+-. 0.5 1.2 .+-. 0.8 MMS_A0381 0.9 .+-. 0.2 1.4 .+-. 0.9 1.7 .+-. 0.9 0.7 .+-. 0.5 1.3 .+-. 0.5 1.1 .+-. 0.2 MSC_1058 0.9 .+-. 0.3 1.4 .+-. 0.7 1.8 .+-. 1.4 1.1 .+-. 1.4 1.5 .+-. 0.7 1.1 .+-. 0.4 MSC_0790 1.0 .+-. 0.4 2.9 .+-. 2.3 2.6 .+-. 1.9 1.0 .+-. 0.8 1.9 .+-. 0.7 1.4 .+-. 0.4 Group H MSC_0453 1.3 .+-. 0.5 1.7 .+-. 0.9 4.3 .+-. 4.8 1.0 .+-. 0.6 2.1 .+-. 0.6 1.2 .+-. 0.5 MMS_A0108 1.2 .+-. 0.7 1.7 .+-. 1.0 3.5 .+-. 4.3 1.2 .+-. 0.8 2.1 .+-. 0.5 1.5 .+-. 0.9 MSC_0798 1.2 .+-. 0.9 1.3 .+-. 0.4 1.6 .+-. 0.6 0.6 .+-. 0.3 1.4 .+-. 0.2 0.9 .+-. 0.2 MSC_0266 0.9 .+-. 0.2 1.2 .+-. 0.3 1.3 .+-. 0.3 0.3 .+-. 0.3 1.2 .+-. 0.4 1.0 .+-. 0.4 MSC_0456 1.2 .+-. 0.4 3.2 .+-. 0.7 11.6 .+-. 11.4 0.8 .+-. 0.7 1.7 .+-. 0.5 1.8 .+-. 1.9 Group I YP_004400602 1.0 .+-. 0.3 1.0 .+-. 0.3 2.0 .+-. 0.8 0.5 .+-. 0.3 1.8 .+-. 0.8 1.0 .+-. 0.2 YP_004400291 1.1 .+-. 0.3 1.6 .+-. 0.9 4.4 .+-. 3.2 0.9 .+-. 1.1 1.9 .+-. 0.7 1.7 .+-. 0.6 YP_004400300 1.0 .+-. 0.2 1.0 .+-. 0.4 3.0 .+-. 3.0 0.8 .+-. 0.7 1.5 .+-. 0.6 0.9 .+-. 0.2 YP_004400620 1.0 .+-. 0.2 1.3 .+-. 0.5 8.7 .+-. 17.9 0.8 .+-. 0.8 1.8 .+-. 0.7 1.5 .+-. 1.1 MSC_1005 1.0 .+-. 0.2 1.2 .+-. 0.4 5.7 .+-. 10.1 1.0 .+-. 0.8 2.0 .+-. 0.5 1.2 .+-. 0.4 Group J YP_004400616 1.0 .+-. 0.4 0.9 .+-. 0.2 5.6 .+-. 7.9 0.6 .+-. 0.3 1.3 .+-. 0.4 0.8 .+-. 0.2 YP_004400615 0.9 .+-. 0.2 0.9 .+-. 0.3 6.4 .+-. 8.3 0.6 .+-. 0.3 1.4 .+-. 0.3 1.1 .+-. 0.3 MMS_A0415 1.3 .+-. 0.5 1.2 .+-. 0.4 16.6 .+-. 15.3 0.6 .+-. 0.3 1.6 .+-. 0.5 1.1 .+-. 0.3 MSC_0927 1.2 .+-. 0.5 1.1 .+-. 0.5 6.3 .+-. 4.6 0.7 .+-. 0.5 1.7 .+-. 0.6 1.0 .+-. 0.3 MSC_0804 1.1 .+-. 0.4 1.2 .+-. 0.5 7.6 .+-. 5.0 0.8 .+-. 0.7 1.5 .+-. 0.6 1.1 .+-. 0.3 Group K YP_004400622 0.8 .+-. 0.2 0.9 .+-. 0.3 3.8 .+-. 4.1 0.9 .+-. 0.7 1.6 .+-. 0.6 1.4 .+-. 0.7 YP_004400371 0.9 .+-. 0.3 1.1 .+-. 0.5 3.6 .+-. 3.2 0.7 .+-. 0.5 1.8 .+-. 0.6 1.4 .+-. 0.5 YP_004400226 1.0 .+-. 0.3 0.8 .+-. 0.2 3.3 .+-. 3.2 1.3 .+-. 0.6 2.0 .+-. 0.5 1.3 .+-. 0.3 YP_004400021 0.8 .+-. 0.2 1.0 .+-. 0.4 5.3 .+-. 4.1 0.7 .+-. 0.3 1.7 .+-. 0.7 1.1 .+-. 0.4 MSC_0163 0.8 .+-. 0.2 1.0 .+-. 0.3 3.9 .+-. 3.0 0.5 .+-. 0.3 1.4 .+-. 0.5 1.2 .+-. 0.4 Trial 3 Group M Group Q YP_004400581 1.1 .+-. 0.6 0.8 .+-. 0.2 1.1 .+-. 0.4 1.1 .+-. 0.2 0.5 .+-. 0.3 0.6 .+-. 0.4 YP_004400296 1.3 .+-. 0.7 0.9 .+-. 0.2 1.0 .+-. 0.1 0.8 .+-. 0.5 0.6 .+-. 0.4 0.6 .+-. 0.3 YP_004399851 1.5 .+-. 1.1 1.0 .+-. 0.3 1.2 .+-. 0.3 1.3 .+-. 1.2 0.8 .+-. 1.1 0.6 .+-. 0.3 YP_004399914 1.2 .+-. 0.5 0.8 .+-. 0.2 1.1 .+-. 0.3 1.0 .+-. 0.8 0.6 .+-. 0.5 0.6 .+-. 0.2 Group N YP_004400127 1.5 .+-. 0.9 0.6 .+-. 0.2 1.0 .+-. 0.4 0.9 .+-. 0.6 0.9 .+-. 0.9 0.6 .+-. 0.2 YP_004399790 2.3 .+-. 2.8 1.2 .+-. 0.8 1.4 .+-. 0.5 1.4 .+-. 1.1 1.3 .+-. 1.2 0.7 .+-. 0.5 YP_004400580 1.4 .+-. 0.7 0.6 .+-. 0.2 1.2 .+-. 0.4 1.2 .+-. 0.5 1.3 .+-. 1.2 0.9 .+-. 0.5 YP_004400610 1.7 .+-. 1.9 0.7 .+-. 0.2 1.4 .+-. 0.6 0.8 .+-. 0.5 0.8 .+-. 0.3 0.6 .+-. 0.2 Group O YP_004400171 0.8 .+-. 0.5 0.8 .+-. 0.3 1.0 .+-. 0.3 1.0 .+-. 0.8 0.6 .+-. 0.3 0.6 .+-. 0.2 MSC_0139 0.9 .+-. 0.6 0.9 .+-. 0.3 0.9 .+-. 0.4 0.9 .+-. 0.5 0.7 .+-. 0.4 0.6 .+-. 0.3 YP_004399939 0.9 .+-. 0.4 0.8 .+-. 0.3 1.1 .+-. 0.5 1.3 .+-. 1.4 0.9 .+-. 0.5 0.8 .+-. 0.4 YP_004400004 1.0 .+-. 0.6 0.8 .+-. 0.3 1.2 .+-. 0.6 1.4 .+-. 1.6 0.6 .+-. 0.2 0.9 .+-. 0.6 Group P YP_004400446 0.7 .+-. 0.3 0.8 .+-. 0.3 2.3 .+-. 2.7 0.8 .+-. 0.6 1.0 .+-. 1.2 0.6 .+-. 0.3 YP_004399927 0.7 .+-. 0.3 1.0 .+-. 0.4 1.7 .+-. 1.9 1.4 .+-. 1.7 0.9 .+-. 0.6 0.9 .+-. 0.5 YP_004400204 0.6 .+-. 0.3 0.6 .+-. 0.1 1.3 .+-. 1.1 1.3 .+-. 1.1 1.2 .+-. 0.8 0.9 .+-. 0.7 YO-004400368 0.7 .+-. 0.4 0.7 .+-. 0.3 1.8 .+-. 2.6 1.1 .+-. 1.3 0.9 .+-. 0.5 1.0 .+-. 0.9
[0276] To summarize, pools of five recombinant M. mycoides proteins were administered per animal to test for their capacity to protect cattle from CBPP. Proteins had previously been ranked according to their likelihood of being protective after analyzing their surface expression and possible exposure to antibodies and their reactivity with sera from CBPP-positive cattle that are accepted to be immune (see, Example 1). Three trials were carried out, with three groups of cattle receiving a placebo while 14 groups were immunized with pools of recombinant proteins in order of their rank. The cattle were challenged by intubation with Mmm of the virulent strain Afade.
[0277] The results showed protection against CBPP in several groups of immunized cattle. In the first trial, at least three groups (A, C and D) showed a reduction of approximately 80% in the pathology score compared to the control group with non-immunized cattle. This level of reduction is similar to what has been reported in experiments with a live vaccine and can be considered very significant. Group B also showed protection, albeit weaker than those above (just under 40%). Reduction in pathology in group E was not significant.
[0278] From the data, it is clear that proteins that were highly ranked in the priority list also contain the most antigens that had a protective effect, suggesting that the criteria used in the priority ranking were appropriate for selecting protective antigens. Although classified with lower priority, group N, immunized with four heretofore unknown proteins, also conferred a significant protection of over 70%.
Example 3
Production of M. mycoides Antigen Fusions and Conjugates with Leukotoxin Carrier Protein
[0279] The M. mycoides genes used in the fusions and LtxA conjugates were codon-optimized for E. coli expression, synthesized and cloned, as described above. For fusions, the genes were designed such that the resulting fusion protein included amino acid linkers between the two proteins. Fusions constructed included YP_004400127.1-YP_004399790.1; YP_004400610.1-YP_004400580.1; MSC_0446-MSC_0117; and MSC_0922-MSC_1058. As shown in the Figures, the YP_004400127.1-YP_004399790.1 fusion includes a Gly.sub.6 amino acid linker between the YP_004400127.1 and YP_004399790.1 proteins (see, FIGS. 25B and 27B); the YP_004400610.1-YP_004400580.1 fusion includes a Gly.sub.5 linker between the two proteins (see, FIGS. 26B and 28B); the MSC_0446-MSC_0117 fusion includes a Gly.sub.3 linker between the proteins (See FIG. 37B); and the MSC_0922-MSC_1058 fusion includes a Gly.sub.3 linker between the proteins (See FIG. 38B).
[0280] To produce conjugates with leukotoxin, sequences encoding the desired fusions or individual antigens described in Table 4 were subcloned into plasmid pAA352, to be expressed as C-terminal fusions to the LKT protein, as described in U.S. Pat. Nos. 5,476,657; 5,422,110; 5,723,129 and 5,837,268, incorporated herein by reference in their entireties. Plasmid pAA352 expresses LKT 352, the sequence of which is depicted in FIG. 41. As explained above, LKT 352 is derived from the lktA gene of Pasteurella haemolytica leukotoxin and is a truncated leukotoxin molecule which lacks the cytotoxic portion of the molecule. The highly immunogenic leukotoxin carrier has been shown to be effective for inducing antibody responses against numerous proteins. See, e.g., U.S. Pat. Nos. 6,521,746, 6,022,960, 5,969,126, 5,837,268 and 5,723,129 incorporated herein in their entireties) and (Hedlin et al., Vaccine (2010) 28:981-988).
[0281] The expression vectors were transformed into BL21(DE3) followed by growth and IPTG induction by standard protocols. The recombinant proteins were produced as inclusion bodies and resolubilized in 4M Guanidine-HCl as described previously (Hedlin et al., Vaccine (2010):28:981-988; Gupta et al., Vet. Microbiol. (2005) 108:207-214; and U.S. Pat. No. 6,100,066, incorporated herein by reference in its entirety).
[0282] The nucleotide sequences and amino acid sequences of the M. mycoides antigens, fusions and conjugates are indicated in Table 4 and shown in the figures.
TABLE-US-00005 TABLE 4 Antigen Fusions and Carrier Conjugates DNA sequences of antigen Protein sequences of antigen fusions and conjugates with SEQ ID fusions and conjugates with SEQ ID leukotoxin NO: leukotoxin NO: YP_004400127.1- 50 YP_004400127.1- 51 YP_004399790.1 YP_004399790.1 YP_004400610.1- 52 YP_004400580.1- 53 YP_004400580.1 YP_004400610.1 pAA352-YP_004400127.1- 54 LtxA-YP_004400127.1- 55 YP_004399790.1 YP_004399790.1 pAA352-YP_004400610.1- 56 LtxA-YP_004400610.1- 57 YP_004400580.1 YP_004400580.1 pAA352-YP_004400559.1 80 LtxA-YP_004400559.1 81 pAA352-MSC_0776 68 LtxA-MSC_0776 69 pAA352-MSC_0499 64 LtxA-MSC_0499 65 pAA352-MSC_0160 58 LtxA-MSC_0160 59 pAA352-MSC_0816 70 LtxA-MSC_0816 71 pAA352-MSC_0431 62 LtxA-MSC_0431 63 pAA352-YP_004399807.1 78 LtxA-YP_004399807.1 79 pAA352-MSC_0957 72 LtxA-MSC_0957 73 pAA352-MSC_0775 66 LtxA-MSC_0775 67 pAA352-MSC_0136 60 LtxA-MSC_0136 61 pAA352-MSC_0446- 74 LtxA-MSC_0446-MSC_0117 75 MSC_0117 pAA352-MSC_0922- 76 LtxA-MSC_0922-MSC_1058 77 MSC_1058
Example 4
Immune Responses to Recombinant M. mycoides Proteins, and LKT 352 M. mycoides Protein Conjugates
[0283] Immune responses to individual M. mycoides antigens, M. mycoides fusions conjugated to an LKT 352 (LtxA) carrier and a representative individual Mmm antigen (MSC_0160) fused to the LtxA carrier were studied. The individual antigens and conjugates used in this study are shown in the Table 5. The individual antigens were recombinantly produced as described in Example 1. As explained in Example 1, the individual antigens contained a histidine-tag for purification of the proteins by metal-chelate affinity chromatography. The fusions and conjugates with LKT 352 were produced as described in Example 3.
TABLE-US-00006 TABLE 5 GROUP ANTIGENS (50 .mu.g/dose) A YP_004400127.1 YP_004399790.1 YP_004400580.1 YP_004400610.1 MSC_0160 LtxA B LtxA-YP_004400127.1-YP_004399790.1 LtxA-YP_004400610.1-YP_004400580.1 LtxA-MSC_0160
[0284] 16 animals were divided into two groups (Groups A and B) of eight animals and vaccinated using vaccines including the proteins described in Table 5. The proteins were combined with 250 .mu.g CpG-ODN 2007 (5'TCGTCGTTGTCGTTTTGTCGTT3'; SEQ ID NO:29) and 30% Emulsigen.TM. (MVP Laboratories, Ralston, Nebr.). Animals were inoculated subcutaneously with 2 ml of the vaccine formulation (50 .mu.g of each antigen was present per inoculation) and a booster given 28 days later. Serum and nasal IgG1, IgG2 and IgA levels were determined against each antigen at days 0, 28 and 56. Cell-mediated immune responses were determined by PBMC proliferation assays (described above) at days 0 and 56 using the proteins as recall antigens.
[0285] Compared to day 0, serum IgG1 and IgG2 responses at day 56 were significant for all proteins. Compared to day 0, serum IgA titers significantly increased at day 56 for LtxA-YP_004400127.1-YP_004399790.1 (Group A); His-YP_004400610.1 (Group A); His-YP_004400580.1 (group A); and LtxA-MSC_0160 (Group A).
[0286] Compared to day 0, nasal IgG1 titers significantly increased at day 56 for his-YP_004400127.1 (Group A); LtxA (Group A); LtxA-YP_004400127-1-YP_004399790.1 (Group B); his-YP_004400580.1 (Group A); his-YP_004400610.1 (Group A); LtxA-YP_004400610.1-YP_004400580.1 (Groups A and B); his-MSC_0160 (Groups A and B); and LtxA-MSC_0160 (Group B).
[0287] Compared to day 0, nasal IgG2 titers significantly increased at day 56 for his-YP_004400127.1 (Groups A and B); LtxA-YP_004400127.1-YP_004399790.1 (Groups A and B); LtxA (Groups A and B); his-YP_004400610.1 (Group A); LtxA-YP_004400610.1-YP_004400580.1 (Groups A and B); and LtxA-MSC_0160 (Groups A and B).
[0288] Compared to day 0, nasal IgA responses at day 56 were significant for all proteins. The median of the proliferative responses were slightly higher at day 56 but the differences were not statistically significant.
[0289] Overall, the antibody titers of animals vaccinated with the individual proteins and animals that received the chimeric proteins were similar.
[0290] A more balanced immune response (serum IgG1/IgG2 ratios near 1) was observed for the proteins that contained the LtxA carrier.
[0291] Thus, immunogenic compositions and methods of making and using the same for treating and preventing Mycoplasma infection using pools of Mycoplasma recombinant antigens are described. Although preferred embodiments of the subject invention have been described in some detail, it is understood that obvious variations can be made without departing from the spirit and the scope of the invention as defined by the appended claims.
Sequence CWU
1
1
841894DNAArtificial SequenceNucleotide sequence encoding MSC_0136 shown in
SEQ ID NO2, modified for expression in E. coli 1aaaaacgaaa
accatttcaa catcaactac aaaatgaaaa tggaaatgaa aacccagaaa 60acggaacaac
cgcacaaata taaagaaggc gatcgtaccg aaattgtgca gatcggcttt 120tacaaacgcg
gtaacgaaat cacgatcaaa caaatcccgt actacgttaa aaaagtcccg 180gataaactgc
cggacgaaat ccagtccctg tatcgtgcat ttgctcatcg ctacaaagat 240caaaaccacc
cgaccgtcac gggcttcgaa aaatgggaca ccagcaaaat caaaaacatg 300tcttatgtgt
tttacgataa ccagctgatc gatgcggacc tgtcagaatg gaaaacctcg 360aatgttacga
acatggacgg catgttcaaa aacgccatca aattcaacaa caaagaaaaa 420ccgctgaaat
ggaacaccga aaaagtcgaa agtatggaat ccatgtttga tggcgcagaa 480tcttttaaac
agaacctgaa agattggaaa gtggacaaag ttaccaaaaa caaaaacttc 540tcacgtgctt
cgggtatttt cgaacatatc gataaaaaac cgtcatggaa aatcaccgaa 600cacaacgacc
cgattatcaa aaaaccggaa tcgacggaac cgaaagtgat tatccatccg 660agcccgtctc
gcccgaaaca gaccattccg ctgacgaaac tgatcaatcc gattatcaaa 720agcaccccga
actctaatca aaacctgggc atcccgaaaa cgaacctgag caccacgccg 780cagcaaagta
aaaaactgtc caccccggca attgttggca tcgtggttgg tagtcaggtc 840gtgctgacgt
ccctggcagc aggtattccg tacctgatca aacgtttcaa aaaa
8942298PRTArtificial SequenceAmino acid sequence of MSC_0136 from M.
mycoides subsp. mycoides (Mmm), lacking the signal sequence 2Lys Asn Glu
Asn His Phe Asn Ile Asn Tyr Lys Met Lys Met Glu Met 1 5
10 15 Lys Thr Gln Lys Thr Glu Gln Pro
His Lys Tyr Lys Glu Gly Asp Arg 20 25
30 Thr Glu Ile Val Gln Ile Gly Phe Tyr Lys Arg Gly Asn
Glu Ile Thr 35 40 45
Ile Lys Gln Ile Pro Tyr Tyr Val Lys Lys Val Pro Asp Lys Leu Pro 50
55 60 Asp Glu Ile Gln
Ser Leu Tyr Arg Ala Phe Ala His Arg Tyr Lys Asp 65 70
75 80 Gln Asn His Pro Thr Val Thr Gly Phe
Glu Lys Trp Asp Thr Ser Lys 85 90
95 Ile Lys Asn Met Ser Tyr Val Phe Tyr Asp Asn Gln Leu Ile
Asp Ala 100 105 110
Asp Leu Ser Glu Trp Lys Thr Ser Asn Val Thr Asn Met Asp Gly Met
115 120 125 Phe Lys Asn Ala
Ile Lys Phe Asn Asn Lys Glu Lys Pro Leu Lys Trp 130
135 140 Asn Thr Glu Lys Val Glu Ser Met
Glu Ser Met Phe Asp Gly Ala Glu 145 150
155 160 Ser Phe Lys Gln Asn Leu Lys Asp Trp Lys Val Asp
Lys Val Thr Lys 165 170
175 Asn Lys Asn Phe Ser Arg Ala Ser Gly Ile Phe Glu His Ile Asp Lys
180 185 190 Lys Pro Ser
Trp Lys Ile Thr Glu His Asn Asp Pro Ile Ile Lys Lys 195
200 205 Pro Glu Ser Thr Glu Pro Lys Val
Ile Ile His Pro Ser Pro Ser Arg 210 215
220 Pro Lys Gln Thr Ile Pro Leu Thr Lys Leu Ile Asn Pro
Ile Ile Lys 225 230 235
240 Ser Thr Pro Asn Ser Asn Gln Asn Leu Gly Ile Pro Lys Thr Asn Leu
245 250 255 Ser Thr Thr Pro
Gln Gln Ser Lys Lys Leu Ser Thr Pro Ala Ile Val 260
265 270 Gly Ile Val Val Gly Ser Gln Val Val
Leu Thr Ser Leu Ala Ala Gly 275 280
285 Ile Pro Tyr Leu Ile Lys Arg Phe Lys Lys 290
295 31230DNAArtificial SequenceNucleotide sequence
encoding MSC_0957 shown in SEQ ID NO4, modified for expression in E.
coli 3tgcagtacca cgattaccca tacgatcaaa acgtccttta acgataacgt taaagtcgaa
60aaattcacct gggacggcaa taaatatacc tccaaagaac agtcaacgaa cattcaagat
120atcaccaata gcctgaacgg taccacgaat gcatactcta aaaccattac ggacgtgctg
180aacctgttta cccgtaatat ccaggaagtt cgcaacctga aagaaagcta tgacctgttt
240cgtggcaaag cagaaaatac gtcggtggtt ggctattaca ccggtgctaa cagtcagcgc
300caaaaaatct cccagcaaga tttctacaaa aaactggatg acagtgacac ccacatcagc
360tctctgaaag gtctgctgca gctgcgtgaa ttcgttaacg ataacaaaaa caaaaccacg
420gtcgaaccgt ggaaaaatag cctgaaaacg gatgcggacg aagttaaaaa atggtctgat
480gaattcacca aaaatctgga caacattgtc aacagttcca tcgataacaa aatcaaaaac
540atcaaactgg tgtctaaagt tagtaaaacg tcatcgagct ttgccacctt cgaacaggac
600gtgaaaacca gcccgacggg ctctagtatt aacctgacgg aacgcaacaa tgaaaccgtc
660gtgggcgata tcaaaaacct gaaagaccat aatccgtatg tctttggtac cagtccggtg
720aatgatccgt tcggcatgaa cgtgattggt gaaaataaag atccggacat taaaaacctg
780aaaccgacca tcaaatattc caccgaaaaa ctgacgaaaa aagatgactc atacattaat
840ctgtcgaaca atggtaacaa caacaaccag ttcgtttaca acatcaacca aaaatgggaa
900ctgtcctcag cacataattt ctattacatg agcaaagatc cggaaacgct ggaactgcag
960attacccaca gcatcgaaaa caaatctttt accttctacg tccaatttgg cggtctgcgt
1020aaaatttata ccccgatcgt ggaatcttac accccgaaaa atacgaactc agcggataaa
1080cgttattcgt ttgtgggctg ggccttcaat tcgtaccgct ttagcgatga cttctctaag
1140ggtaactcga gcccgtacaa attcaaagat attagtctga aaatctccca gaacgctttc
1200accacgaata ccggcagcgt taacggtaaa
12304410PRTArtificial SequenceAmino acid sequence of MSC_0957 from M.
mycoides subsp. mycoides (Mmm), lacking the signal sequence 4Cys Ser Thr
Thr Ile Thr His Thr Ile Lys Thr Ser Phe Asn Asp Asn 1 5
10 15 Val Lys Val Glu Lys Phe Thr Trp
Asp Gly Asn Lys Tyr Thr Ser Lys 20 25
30 Glu Gln Ser Thr Asn Ile Gln Asp Ile Thr Asn Ser Leu
Asn Gly Thr 35 40 45
Thr Asn Ala Tyr Ser Lys Thr Ile Thr Asp Val Leu Asn Leu Phe Thr 50
55 60 Arg Asn Ile Gln
Glu Val Arg Asn Leu Lys Glu Ser Tyr Asp Leu Phe 65 70
75 80 Arg Gly Lys Ala Glu Asn Thr Ser Val
Val Gly Tyr Tyr Thr Gly Ala 85 90
95 Asn Ser Gln Arg Gln Lys Ile Ser Gln Gln Asp Phe Tyr Lys
Lys Leu 100 105 110
Asp Asp Ser Asp Thr His Ile Ser Ser Leu Lys Gly Leu Leu Gln Leu
115 120 125 Arg Glu Phe Val
Asn Asp Asn Lys Asn Lys Thr Thr Val Glu Pro Trp 130
135 140 Lys Asn Ser Leu Lys Thr Asp Ala
Asp Glu Val Lys Lys Trp Ser Asp 145 150
155 160 Glu Phe Thr Lys Asn Leu Asp Asn Ile Val Asn Ser
Ser Ile Asp Asn 165 170
175 Lys Ile Lys Asn Ile Lys Leu Val Ser Lys Val Ser Lys Thr Ser Ser
180 185 190 Ser Phe Ala
Thr Phe Glu Gln Asp Val Lys Thr Ser Pro Thr Gly Ser 195
200 205 Ser Ile Asn Leu Thr Glu Arg Asn
Asn Glu Thr Val Val Gly Asp Ile 210 215
220 Lys Asn Leu Lys Asp His Asn Pro Tyr Val Phe Gly Thr
Ser Pro Val 225 230 235
240 Asn Asp Pro Phe Gly Met Asn Val Ile Gly Glu Asn Lys Asp Pro Asp
245 250 255 Ile Lys Asn Leu
Lys Pro Thr Ile Lys Tyr Ser Thr Glu Lys Leu Thr 260
265 270 Lys Lys Asp Asp Ser Tyr Ile Asn Leu
Ser Asn Asn Gly Asn Asn Asn 275 280
285 Asn Gln Phe Val Tyr Asn Ile Asn Gln Lys Trp Glu Leu Ser
Ser Ala 290 295 300
His Asn Phe Tyr Tyr Met Ser Lys Asp Pro Glu Thr Leu Glu Leu Gln 305
310 315 320 Ile Thr His Ser Ile
Glu Asn Lys Ser Phe Thr Phe Tyr Val Gln Phe 325
330 335 Gly Gly Leu Arg Lys Ile Tyr Thr Pro Ile
Val Glu Ser Tyr Thr Pro 340 345
350 Lys Asn Thr Asn Ser Ala Asp Lys Arg Tyr Ser Phe Val Gly Trp
Ala 355 360 365 Phe
Asn Ser Tyr Arg Phe Ser Asp Asp Phe Ser Lys Gly Asn Ser Ser 370
375 380 Pro Tyr Lys Phe Lys Asp
Ile Ser Leu Lys Ile Ser Gln Asn Ala Phe 385 390
395 400 Thr Thr Asn Thr Gly Ser Val Asn Gly Lys
405 410 52082DNAArtificial SequenceNucleotide
sequence encoding MSC_0499 shown in SEQ ID NO6, modified for
expression in E. coli 5tgcaccacga aaaacgataa attcaacaaa ccgttcatca
ccgacgaact ggcgcagaaa 60attatctcag gtctgaaact gtcggatgac tttaatttca
ccacgggcga acgtttcagt 120aaactggatt acaaatccct gattctggac atgatcaacg
aaatcatctc caaaaacaaa 180tacaccgata actggaacaa cctgagcaaa aaatttggtc
tggaaattga acaggcgaaa 240gaattcggca acaaaaaagc cgaaaacgtt ctgaaaaacc
tgagcaccat caaactgttc 300gcagattata cgtctaaacg cgcttttgaa gaagatttcg
acagtgtgga tctgagttat 360tccgaaaatt acccgctgaa tccgtataac ctggaaagca
aaaacggtca gaaagataaa 420accgtttacg cgatctacta caaaaacaac aacggcggta
gctctagtgg ttcctcatcg 480aatggcggtg gcaccaacgg tgaagcaacg tggctgcgtt
ggcagaccac gggtgaattt 540gataatattg acaacccgat cccgtcaacc ccgcaactgc
cgaatatctc gctgctgacc 600gatacgagct ctaaaaactt ccgcattgcc aaactgtcca
aaccgaaaga tcaggaatat 660atcaccaata cggcaagtgt taaagaagac ggtaaagcta
ccaataacgg caataacgaa 720tttgtcgaat ggtacaaaaa cagttccgac aaattcgaaa
ccgatggtca gggcatcatg 780caataccgtt tcatgtacca tttcaaaacg aaaatcgaag
cgaaactgtt taatgatctg 840ctgggtcacg cctatattga cagcaacctg ttcgtggata
aaaacgacaa caaatcagca 900tcgaacaaga aaattatcct gaacaacgtc agtaaactga
tttccgatat ccagagcaat 960tattctcaag tggacaaaac cattagtaac gtgaaaatgg
tttgggcatt tagcctggat 1020aaacagaaag tctctgaagt gaacggtgct atcaatcaat
atgtcaaccc ggatggcagc 1080ctgaccaatg aagacaacaa gaaaaccctg aaaaacgtgt
tcgataaaat caaatacaaa 1140gcgaccaacg aatcaaaaca gggtacggat tcgctgctga
gcatttctgg tttcaacggc 1200ttcgttaaaa acaaagataa caacatcgaa agtctgtccg
gcgacctgaa actgaccgaa 1260gaagcgaaaa aagcggtcgc ccgcgtgaat gttccgtctc
tgctgacgaa taacaataac 1320ggctttgcca gtgaaaactc caataacgtg gattatgtct
ttgtgctgcc gatttacctg 1380aatgacctgt ttagctcgaa cgacatgcag atcaaacgtg
aaaccgaaag ctctggtggc 1440gccggttcaa atggctcgaa ctatgaactg aatgttctgg
aaaacacctg ggtcaacctg 1500aatgacaaat ttagcctgga taatcgctac ttcgacaacc
tgacgatcaa aaaagtggaa 1560tctcaaaata acggtgaagc actggtggct aacaacaacg
ataaatggta cgttagcctg 1620aaaaacggca atgacaacaa aaaagttgaa gtcacctaca
gcgatgacag caagaaaatt 1680atcacgctga aaaaagttga taaaaacaac atcaaaaccc
tggacttcac gtacaaactg 1740tcacagtcgg atttcaacaa acagctgttc aaacaaaacc
cgaccgcaaa catcacgtat 1800gatatcaacc tgaaaaacta cgataacatc aaagacaaac
agaacgatgc ttatatctgg 1860aaaaacgatc cgaaaaaatc taacgatatc caagacctgt
ccgcggccaa aaaacaggtg 1920ctgctggatc aactggaagc gatcaccgcc aaaaatccgg
acgttcagaa cgcagctaaa 1980accgaactgt attcggcata tctgtacacg gatggtatct
actacaaatc actgttcgac 2040gaaatcagca aatacatcga atctgaaaaa ccgaccctgg
at 20826694PRTArtificial SequenceAmino acid sequence
of MSC_0499 from M. mycoides subsp. mycoides (Mmm), lacking the
signal sequence 6Cys Thr Thr Lys Asn Asp Lys Phe Asn Lys Pro Phe Ile Thr
Asp Glu 1 5 10 15
Leu Ala Gln Lys Ile Ile Ser Gly Leu Lys Leu Ser Asp Asp Phe Asn
20 25 30 Phe Thr Thr Gly Glu
Arg Phe Ser Lys Leu Asp Tyr Lys Ser Leu Ile 35
40 45 Leu Asp Met Ile Asn Glu Ile Ile Ser
Lys Asn Lys Tyr Thr Asp Asn 50 55
60 Trp Asn Asn Leu Ser Lys Lys Phe Gly Leu Glu Ile Glu
Gln Ala Lys 65 70 75
80 Glu Phe Gly Asn Lys Lys Ala Glu Asn Val Leu Lys Asn Leu Ser Thr
85 90 95 Ile Lys Leu Phe
Ala Asp Tyr Thr Ser Lys Arg Ala Phe Glu Glu Asp 100
105 110 Phe Asp Ser Val Asp Leu Ser Tyr Ser
Glu Asn Tyr Pro Leu Asn Pro 115 120
125 Tyr Asn Leu Glu Ser Lys Asn Gly Gln Lys Asp Lys Thr Val
Tyr Ala 130 135 140
Ile Tyr Tyr Lys Asn Asn Asn Gly Gly Ser Ser Ser Gly Ser Ser Ser 145
150 155 160 Asn Gly Gly Gly Thr
Asn Gly Glu Ala Thr Trp Leu Arg Trp Gln Thr 165
170 175 Thr Gly Glu Phe Asp Asn Ile Asp Asn Pro
Ile Pro Ser Thr Pro Gln 180 185
190 Leu Pro Asn Ile Ser Leu Leu Thr Asp Thr Ser Ser Lys Asn Phe
Arg 195 200 205 Ile
Ala Lys Leu Ser Lys Pro Lys Asp Gln Glu Tyr Ile Thr Asn Thr 210
215 220 Ala Ser Val Lys Glu Asp
Gly Lys Ala Thr Asn Asn Gly Asn Asn Glu 225 230
235 240 Phe Val Glu Trp Tyr Lys Asn Ser Ser Asp Lys
Phe Glu Thr Asp Gly 245 250
255 Gln Gly Ile Met Gln Tyr Arg Phe Met Tyr His Phe Lys Thr Lys Ile
260 265 270 Glu Ala
Lys Leu Phe Asn Asp Leu Leu Gly His Ala Tyr Ile Asp Ser 275
280 285 Asn Leu Phe Val Asp Lys Asn
Asp Asn Lys Ser Ala Ser Asn Lys Lys 290 295
300 Ile Ile Leu Asn Asn Val Ser Lys Leu Ile Ser Asp
Ile Gln Ser Asn 305 310 315
320 Tyr Ser Gln Val Asp Lys Thr Ile Ser Asn Val Lys Met Val Trp Ala
325 330 335 Phe Ser Leu
Asp Lys Gln Lys Val Ser Glu Val Asn Gly Ala Ile Asn 340
345 350 Gln Tyr Val Asn Pro Asp Gly Ser
Leu Thr Asn Glu Asp Asn Lys Lys 355 360
365 Thr Leu Lys Asn Val Phe Asp Lys Ile Lys Tyr Lys Ala
Thr Asn Glu 370 375 380
Ser Lys Gln Gly Thr Asp Ser Leu Leu Ser Ile Ser Gly Phe Asn Gly 385
390 395 400 Phe Val Lys Asn
Lys Asp Asn Asn Ile Glu Ser Leu Ser Gly Asp Leu 405
410 415 Lys Leu Thr Glu Glu Ala Lys Lys Ala
Val Ala Arg Val Asn Val Pro 420 425
430 Ser Leu Leu Thr Asn Asn Asn Asn Gly Phe Ala Ser Glu Asn
Ser Asn 435 440 445
Asn Val Asp Tyr Val Phe Val Leu Pro Ile Tyr Leu Asn Asp Leu Phe 450
455 460 Ser Ser Asn Asp Met
Gln Ile Lys Arg Glu Thr Glu Ser Ser Gly Gly 465 470
475 480 Ala Gly Ser Asn Gly Ser Asn Tyr Glu Leu
Asn Val Leu Glu Asn Thr 485 490
495 Trp Val Asn Leu Asn Asp Lys Phe Ser Leu Asp Asn Arg Tyr Phe
Asp 500 505 510 Asn
Leu Thr Ile Lys Lys Val Glu Ser Gln Asn Asn Gly Glu Ala Leu 515
520 525 Val Ala Asn Asn Asn Asp
Lys Trp Tyr Val Ser Leu Lys Asn Gly Asn 530 535
540 Asp Asn Lys Lys Val Glu Val Thr Tyr Ser Asp
Asp Ser Lys Lys Ile 545 550 555
560 Ile Thr Leu Lys Lys Val Asp Lys Asn Asn Ile Lys Thr Leu Asp Phe
565 570 575 Thr Tyr
Lys Leu Ser Gln Ser Asp Phe Asn Lys Gln Leu Phe Lys Gln 580
585 590 Asn Pro Thr Ala Asn Ile Thr
Tyr Asp Ile Asn Leu Lys Asn Tyr Asp 595 600
605 Asn Ile Lys Asp Lys Gln Asn Asp Ala Tyr Ile Trp
Lys Asn Asp Pro 610 615 620
Lys Lys Ser Asn Asp Ile Gln Asp Leu Ser Ala Ala Lys Lys Gln Val 625
630 635 640 Leu Leu Asp
Gln Leu Glu Ala Ile Thr Ala Lys Asn Pro Asp Val Gln 645
650 655 Asn Ala Ala Lys Thr Glu Leu Tyr
Ser Ala Tyr Leu Tyr Thr Asp Gly 660 665
670 Ile Tyr Tyr Lys Ser Leu Phe Asp Glu Ile Ser Lys Tyr
Ile Glu Ser 675 680 685
Glu Lys Pro Thr Leu Asp 690 7990DNAArtificial
SequenceNucleotide sequence encoding MSC_0431 shown in SEQ ID NO8,
modified for expression in E. coli 7tgcgcaaaca tcgaaatgtc aaaaaacaaa
aaagataaag acaaagatct gaaatcggac 60aaaaacaaag atcagaacaa caaattcgac
aaaagcaaag ataaaaacca aaactctaaa 120ccgaacaaca acgatcagaa tagtaaatcc
aaccaagaca aaacctcacc gaaagataat 180ccgtcgacgc agtcagaatc ggaaaaacag
gaaaactcca aacaatatga cctggataaa 240ctgatcacga acaaattcat cagcatcgac
ggctctggta ccggcgatgg taaactggct 300aaactgccgc agaacctgca agaatatctg
gatctgatca aaaaacagaa cccgaaattc 360accctgacgc tgaataacgt cagtttcaat
gtggaagaaa atgataactc cggctacaaa 420aaagtcagcg tgtctacgaa gggtaactct
aaaaacccgg ttatcgtcta cttctacaaa 480gaccgtcatg ataccgttta tgaaggcgag
aaaaaagaag tggttaaaga aatcggttgg 540agtaaatcca cctacagtac ggacatcctg
cacttcgatg aacagacgaa agaagtcccg 600gaaaacctgc cgccgtttat caccagcctg
gaaggcgcgt tccgcaacaa catccaagaa 660accatcaaaa acctggacaa atgggatacg
agcaacatcg aattcatgaa cgaaaccttc 720tacgaagcga aaaattttaa ccaggatatc
tctggttgga aaaccaataa cgttagtaac 780atggattcca tgttttatgg cgccagctct
ttcgaccgta atctgagcgg ttggaacgtg 840gataaagtta ttacctacat cgaattcaac
aaagattcaa aaatctcgga acgtaacaaa 900ccgaaattca aagaactgaa acgcattcat
cagggccaag gtgcaaccaa aatcctgcac 960aatcgcggct ttctgaataa aatgaacctg
9908330PRTArtificial SequenceAmino acid
sequence of MSC_0431 from M. mycoides subsp. mycoides (Mmm), lacking
the signal sequence 8Cys Ala Asn Ile Glu Met Ser Lys Asn Lys Lys Asp Lys
Asp Lys Asp 1 5 10 15
Leu Lys Ser Asp Lys Asn Lys Asp Gln Asn Asn Lys Phe Asp Lys Ser
20 25 30 Lys Asp Lys Asn
Gln Asn Ser Lys Pro Asn Asn Asn Asp Gln Asn Ser 35
40 45 Lys Ser Asn Gln Asp Lys Thr Ser Pro
Lys Asp Asn Pro Ser Thr Gln 50 55
60 Ser Glu Ser Glu Lys Gln Glu Asn Ser Lys Gln Tyr Asp
Leu Asp Lys 65 70 75
80 Leu Ile Thr Asn Lys Phe Ile Ser Ile Asp Gly Ser Gly Thr Gly Asp
85 90 95 Gly Lys Leu Ala
Lys Leu Pro Gln Asn Leu Gln Glu Tyr Leu Asp Leu 100
105 110 Ile Lys Lys Gln Asn Pro Lys Phe Thr
Leu Thr Leu Asn Asn Val Ser 115 120
125 Phe Asn Val Glu Glu Asn Asp Asn Ser Gly Tyr Lys Lys Val
Ser Val 130 135 140
Ser Thr Lys Gly Asn Ser Lys Asn Pro Val Ile Val Tyr Phe Tyr Lys 145
150 155 160 Asp Arg His Asp Thr
Val Tyr Glu Gly Glu Lys Lys Glu Val Val Lys 165
170 175 Glu Ile Gly Trp Ser Lys Ser Thr Tyr Ser
Thr Asp Ile Leu His Phe 180 185
190 Asp Glu Gln Thr Lys Glu Val Pro Glu Asn Leu Pro Pro Phe Ile
Thr 195 200 205 Ser
Leu Glu Gly Ala Phe Arg Asn Asn Ile Gln Glu Thr Ile Lys Asn 210
215 220 Leu Asp Lys Trp Asp Thr
Ser Asn Ile Glu Phe Met Asn Glu Thr Phe 225 230
235 240 Tyr Glu Ala Lys Asn Phe Asn Gln Asp Ile Ser
Gly Trp Lys Thr Asn 245 250
255 Asn Val Ser Asn Met Asp Ser Met Phe Tyr Gly Ala Ser Ser Phe Asp
260 265 270 Arg Asn
Leu Ser Gly Trp Asn Val Asp Lys Val Ile Thr Tyr Ile Glu 275
280 285 Phe Asn Lys Asp Ser Lys Ile
Ser Glu Arg Asn Lys Pro Lys Phe Lys 290 295
300 Glu Leu Lys Arg Ile His Gln Gly Gln Gly Ala Thr
Lys Ile Leu His 305 310 315
320 Asn Arg Gly Phe Leu Asn Lys Met Asn Leu 325
330 92265DNAArtificial SequenceNucleotide sequence encoding
MSC_0776 shown in SEQ ID NO10, modified for expression in E. coli
9tgtaaaacga cgcaaaatca acagggcatc tataaaattg tggacttcga aaaagaaaat
60caaatcaaca ttctgagcga aatcaaccag tttttcgaaa aacatgattt caacgaacag
120ctggttcaat tcgtcaacaa agatagccac aattatatta ccctggactc tctgatgaaa
180aacaattatg cggccaaata cgtgaaattt gataaagaca aattcaaaca gatcatcaaa
240aaagaattca acctgagtga tgcatacctg aataaactgg aaatcgaagt tgactatacc
300aacattgatc gcgactactc caacaatttt gatattgtct tcccgattcg tatcaaacgc
360cagctggaaa atcataaaaa agcgagctat caaccgggcc tgtttacgga acagattatc
420aaattccgcc tgaaaaacgt gaaaagctct ccgtcggaag catttttcgc tgaagaactg
480aaagatgttt tcaacaaact gaaagaactg aaatacgata acttcaccgc gcgtctgaaa
540acgaacatca gtaacgaact gaaaaaacag atcgatcaat ggaacatcaa cgaactggac
600agtacccaac tgtccaacat cttcgaaatc aacatctccg aattcgatca gctgaaaacc
660aacaatccga attttgtgtt caaaagtacg atctttggtg ttgatttctc cgacaaaaac
720ctggcgctga atgaaggcta tctgaaagtg cgttttgccg ttaaagaagg tttcgatagt
780aaagacaaaa ccaaacagat caacctgatc aacaaagaaa tcaacgaact gatcgtgaaa
840aaagaaaacc tggaaaaaac caacaactca gattcgaaca aaacggaaat cgacaaactg
900atccagatca tcaaacaaaa aagcgcgcag ctgaccaaaa ttaaacaaaa agccctgccg
960gcggaagccg gcatcacgaa actgatcaaa ttcaaattcg attggaacga ccagttttgg
1020aaaaacatca aactgaacga agtgatcaaa atcgatacca tcaaatatgg tatcagcaat
1080accgatttcc tgtctctgac gaaagacaac ctgattgtta aaatcctgaa caaagatgtg
1140cgtaacgttg acattaagaa aattgaaaaa accaacgatt tccgcaacgc gaaactggtc
1200ctggatgtgc tgctgaaaga caacaaaaaa ctggaactga acaagaaaat tggcgtgggt
1260aaatatagcc tgctgtacga aaatgatttc atcaaaaaca acatccaggc cccgtatttc
1320accacggaac gtctgaccca agaaaacctg cagtctgtta ataaagattt ctttcgccag
1380tttgactcag aactgttctc gggcggttat gcaagttccc gtggctttta cgctccgaaa
1440attaccacgc cgatcttcat gcacattggt gaagattata ttgcgaatga ctttcaggcc
1500gtgctgatgc cgtatgatgg cgaaattatc gcagcttacg aactgagcac caacgtcccg
1560ttcgcaggcg tgggtacggt ggttgtcgtg aaaattaaag tttctgatct ggactggacc
1620ccgaaagaaa aagaaatcta tctgaacaac aacaaagatc atatctacat gtcatttctg
1680cacctggacg catcgcgcac gctgaataac cagaaactgg gttggtcagc tgaaaaagtt
1740gtcctgaata acaatcgtac cattcaagtg gttaaatcgc tgacgccgga aaaaccgcag
1800aaagtcgcca aaaataccat tatcggctat ctgggtaaca atgcaagtaa cggcggttgg
1860atgtcccatg ctcacgttaa cctgtacacc aatcgcccgt catatctgtc ggaaaactac
1920tttagcacga aatctaatca aggcctgagc gaagatcgta tcaaacagta ccatcaaaac
1980atcaacggta aagaaacctg gcgtcagttt ggcaatattg gtctgcacca gtctccgcaa
2040cgtccgccgt acaccatcaa cgaagttgat caaattacgg gcgtcgaaaa actggacgaa
2100aacaaaaaga aaattgtcgt gaaaaacgaa caggcgctgt ttctgccgaa cctgagcatg
2160tctctgttcg aaaaacgcct gggttatgcc aacccgaatc tggtctaccg tctgcgcgat
2220aataaaaccg tgagtttttc cgttaaagaa gtcaacaaac tgacg
226510755PRTArtificial SequenceAmino acid sequence of MSC_0776 from M.
mycoides subsp. mycoides (Mmm), lacking the signal sequence 10Cys Lys
Thr Thr Gln Asn Gln Gln Gly Ile Tyr Lys Ile Val Asp Phe 1 5
10 15 Glu Lys Glu Asn Gln Ile Asn
Ile Leu Ser Glu Ile Asn Gln Phe Phe 20 25
30 Glu Lys His Asp Phe Asn Glu Gln Leu Val Gln Phe
Val Asn Lys Asp 35 40 45
Ser His Asn Tyr Ile Thr Leu Asp Ser Leu Met Lys Asn Asn Tyr Ala
50 55 60 Ala Lys Tyr
Val Lys Phe Asp Lys Asp Lys Phe Lys Gln Ile Ile Lys 65
70 75 80 Lys Glu Phe Asn Leu Ser Asp
Ala Tyr Leu Asn Lys Leu Glu Ile Glu 85
90 95 Val Asp Tyr Thr Asn Ile Asp Arg Asp Tyr Ser
Asn Asn Phe Asp Ile 100 105
110 Val Phe Pro Ile Arg Ile Lys Arg Gln Leu Glu Asn His Lys Lys
Ala 115 120 125 Ser
Tyr Gln Pro Gly Leu Phe Thr Glu Gln Ile Ile Lys Phe Arg Leu 130
135 140 Lys Asn Val Lys Ser Ser
Pro Ser Glu Ala Phe Phe Ala Glu Glu Leu 145 150
155 160 Lys Asp Val Phe Asn Lys Leu Lys Glu Leu Lys
Tyr Asp Asn Phe Thr 165 170
175 Ala Arg Leu Lys Thr Asn Ile Ser Asn Glu Leu Lys Lys Gln Ile Asp
180 185 190 Gln Trp
Asn Ile Asn Glu Leu Asp Ser Thr Gln Leu Ser Asn Ile Phe 195
200 205 Glu Ile Asn Ile Ser Glu Phe
Asp Gln Leu Lys Thr Asn Asn Pro Asn 210 215
220 Phe Val Phe Lys Ser Thr Ile Phe Gly Val Asp Phe
Ser Asp Lys Asn 225 230 235
240 Leu Ala Leu Asn Glu Gly Tyr Leu Lys Val Arg Phe Ala Val Lys Glu
245 250 255 Gly Phe Asp
Ser Lys Asp Lys Thr Lys Gln Ile Asn Leu Ile Asn Lys 260
265 270 Glu Ile Asn Glu Leu Ile Val Lys
Lys Glu Asn Leu Glu Lys Thr Asn 275 280
285 Asn Ser Asp Ser Asn Lys Thr Glu Ile Asp Lys Leu Ile
Gln Ile Ile 290 295 300
Lys Gln Lys Ser Ala Gln Leu Thr Lys Ile Lys Gln Lys Ala Leu Pro 305
310 315 320 Ala Glu Ala Gly
Ile Thr Lys Leu Ile Lys Phe Lys Phe Asp Trp Asn 325
330 335 Asp Gln Phe Trp Lys Asn Ile Lys Leu
Asn Glu Val Ile Lys Ile Asp 340 345
350 Thr Ile Lys Tyr Gly Ile Ser Asn Thr Asp Phe Leu Ser Leu
Thr Lys 355 360 365
Asp Asn Leu Ile Val Lys Ile Leu Asn Lys Asp Val Arg Asn Val Asp 370
375 380 Ile Lys Lys Ile Glu
Lys Thr Asn Asp Phe Arg Asn Ala Lys Leu Val 385 390
395 400 Leu Asp Val Leu Leu Lys Asp Asn Lys Lys
Leu Glu Leu Asn Lys Lys 405 410
415 Ile Gly Val Gly Lys Tyr Ser Leu Leu Tyr Glu Asn Asp Phe Ile
Lys 420 425 430 Asn
Asn Ile Gln Ala Pro Tyr Phe Thr Thr Glu Arg Leu Thr Gln Glu 435
440 445 Asn Leu Gln Ser Val Asn
Lys Asp Phe Phe Arg Gln Phe Asp Ser Glu 450 455
460 Leu Phe Ser Gly Gly Tyr Ala Ser Ser Arg Gly
Phe Tyr Ala Pro Lys 465 470 475
480 Ile Thr Thr Pro Ile Phe Met His Ile Gly Glu Asp Tyr Ile Ala Asn
485 490 495 Asp Phe
Gln Ala Val Leu Met Pro Tyr Asp Gly Glu Ile Ile Ala Ala 500
505 510 Tyr Glu Leu Ser Thr Asn Val
Pro Phe Ala Gly Val Gly Thr Val Val 515 520
525 Val Val Lys Ile Lys Val Ser Asp Leu Asp Trp Thr
Pro Lys Glu Lys 530 535 540
Glu Ile Tyr Leu Asn Asn Asn Lys Asp His Ile Tyr Met Ser Phe Leu 545
550 555 560 His Leu Asp
Ala Ser Arg Thr Leu Asn Asn Gln Lys Leu Gly Trp Ser 565
570 575 Ala Glu Lys Val Val Leu Asn Asn
Asn Arg Thr Ile Gln Val Val Lys 580 585
590 Ser Leu Thr Pro Glu Lys Pro Gln Lys Val Ala Lys Asn
Thr Ile Ile 595 600 605
Gly Tyr Leu Gly Asn Asn Ala Ser Asn Gly Gly Trp Met Ser His Ala 610
615 620 His Val Asn Leu
Tyr Thr Asn Arg Pro Ser Tyr Leu Ser Glu Asn Tyr 625 630
635 640 Phe Ser Thr Lys Ser Asn Gln Gly Leu
Ser Glu Asp Arg Ile Lys Gln 645 650
655 Tyr His Gln Asn Ile Asn Gly Lys Glu Thr Trp Arg Gln Phe
Gly Asn 660 665 670
Ile Gly Leu His Gln Ser Pro Gln Arg Pro Pro Tyr Thr Ile Asn Glu
675 680 685 Val Asp Gln Ile
Thr Gly Val Glu Lys Leu Asp Glu Asn Lys Lys Lys 690
695 700 Ile Val Val Lys Asn Glu Gln Ala
Leu Phe Leu Pro Asn Leu Ser Met 705 710
715 720 Ser Leu Phe Glu Lys Arg Leu Gly Tyr Ala Asn Pro
Asn Leu Val Tyr 725 730
735 Arg Leu Arg Asp Asn Lys Thr Val Ser Phe Ser Val Lys Glu Val Asn
740 745 750 Lys Leu Thr
755 11408DNAArtificial SequenceNucleotide sequence encoding
YP_004400559.1 shown in SEQ ID NO12, modified for expression in E.
coli 11atgagcaaca acaacaaaaa agaagaaaag caatcaaagg aaatgaataa aaatcaaacc
60tctaactcca cgagcaccaa tatgaacaac acgcagggca gcaatagctc taccacgacc
120aacattacct ctaacccgat caatagtgtc acgtccatgg cgacccaacc gaaaaacgaa
180acctttttca ataaggaacc gctgatcttt tcagaactgg attatgtgtc ggaatacttc
240aagcgtaagg aacatattgc gcgcaccagc gaactgatcc tggaaaactc tgaaggcatt
300aaacgtcgta tgcagaatag tacggttgaa acgacccacc gtgattccct ggccgaaacc
360caagacctga ttctggaaaa cagcaacggt gtggttaact tcaagaag
40812136PRTArtificial SequenceAmino acid sequence of YP_004400559.1 from
M. mycoides subsp. capri (Mmc), lacking the signal sequence and
including an N-terminal methionine 12Met Ser Asn Asn Asn Lys Lys Glu Glu
Lys Gln Ser Lys Glu Met Asn 1 5 10
15 Lys Asn Gln Thr Ser Asn Ser Thr Ser Thr Asn Met Asn Asn
Thr Gln 20 25 30
Gly Ser Asn Ser Ser Thr Thr Thr Asn Ile Thr Ser Asn Pro Ile Asn
35 40 45 Ser Val Thr Ser
Met Ala Thr Gln Pro Lys Asn Glu Thr Phe Phe Asn 50
55 60 Lys Glu Pro Leu Ile Phe Ser Glu
Leu Asp Tyr Val Ser Glu Tyr Phe 65 70
75 80 Lys Arg Lys Glu His Ile Ala Arg Thr Ser Glu Leu
Ile Leu Glu Asn 85 90
95 Ser Glu Gly Ile Lys Arg Arg Met Gln Asn Ser Thr Val Glu Thr Thr
100 105 110 His Arg Asp
Ser Leu Ala Glu Thr Gln Asp Leu Ile Leu Glu Asn Ser 115
120 125 Asn Gly Val Val Asn Phe Lys Lys
130 135 131044DNAArtificial SequenceNucleotide
sequence encoding YP_004399807.1 shown in SEQ ID NO14, modified for
expression in E. coli 13atgagcagca aagttcaggt tatcaacaag ttcgatgaca
ttacgtccat taaaaacacg 60ggtgcgttca aaaacaatca ggcattcatt tcccgttcag
aactgaaaga aatcgtcagc 120tctaacaata ccacgatttc taataccacg agttccaccg
cagtgatgac ctcgacgagc 180accacgtcta tcggcaccca gacgaacaat aacaatgacc
tgaagaacgc gagtgaacgc 240ctgaaagccc tggcggccaa caacttcacc aagaacaaga
agcaggcatg ggattccctg 300caaaacgctt caatgacctt ctataaaaag gtgcagccga
ccgcggtcaa tgtgctgggt 360tacgaacaaa ttaccaaaga caacgttgaa aaactggata
aggaactgaa aaccgttttt 420ctggtcttca aggacaatac caaagaaacg gaaaagctgg
aagtggaact gctgccggaa 480attaacaatg gcaacaaagt tatcgacaat ggtaacctgt
atctggatct gctggaaaaa 540ccggaaaatc tgaagctggc gaaccagaaa agcattatcg
aagtgctgcg tccggaaatt 600accaaaatca aggtggttct gcaaaatacc aaaaacaata
actccacgaa caaagaagat 660atcaagaaca ccgaagtttt caacctgctg attaaacagc
tgagcatcta tctggcaaat 720gctgtcaaat actttaactc tgaaagtggc attatcacca
cgaatccgac cttctcgtat 780aaaacgcgca gcaatcaaat ctacgactac atcgttaaga
acaagaagga tgaactgtac 840aagaagctgg aaaccgcgtt tacgtcagaa ttcaacaaga
tcaacttcat cgatatcttc 900aaagacttcc agttcgatga aaacaacagt aacgataaca
aaaagattat caccaagatt 960atcaaatcat cgacgaatag ctctgccagt tcctcaaact
cgagcaccac gaccacgacc 1020gaactgtcta gtacgaccac gcgt
104414348PRTArtificial SequenceAmino acid sequence
of YP_004399807.1 from M. mycoides subsp. capri (Mmc), lacking the
signal sequence and including an N-terminal methionine 14Met Ser Ser
Lys Val Gln Val Ile Asn Lys Phe Asp Asp Ile Thr Ser 1 5
10 15 Ile Lys Asn Thr Gly Ala Phe Lys
Asn Asn Gln Ala Phe Ile Ser Arg 20 25
30 Ser Glu Leu Lys Glu Ile Val Ser Ser Asn Asn Thr Thr
Ile Ser Asn 35 40 45
Thr Thr Ser Ser Thr Ala Val Met Thr Ser Thr Ser Thr Thr Ser Ile 50
55 60 Gly Thr Gln Thr
Asn Asn Asn Asn Asp Leu Lys Asn Ala Ser Glu Arg 65 70
75 80 Leu Lys Ala Leu Ala Ala Asn Asn Phe
Thr Lys Asn Lys Lys Gln Ala 85 90
95 Trp Asp Ser Leu Gln Asn Ala Ser Met Thr Phe Tyr Lys Lys
Val Gln 100 105 110
Pro Thr Ala Val Asn Val Leu Gly Tyr Glu Gln Ile Thr Lys Asp Asn
115 120 125 Val Glu Lys Leu
Asp Lys Glu Leu Lys Thr Val Phe Leu Val Phe Lys 130
135 140 Asp Asn Thr Lys Glu Thr Glu Lys
Leu Glu Val Glu Leu Leu Pro Glu 145 150
155 160 Ile Asn Asn Gly Asn Lys Val Ile Asp Asn Gly Asn
Leu Tyr Leu Asp 165 170
175 Leu Leu Glu Lys Pro Glu Asn Leu Lys Leu Ala Asn Gln Lys Ser Ile
180 185 190 Ile Glu Val
Leu Arg Pro Glu Ile Thr Lys Ile Lys Val Val Leu Gln 195
200 205 Asn Thr Lys Asn Asn Asn Ser Thr
Asn Lys Glu Asp Ile Lys Asn Thr 210 215
220 Glu Val Phe Asn Leu Leu Ile Lys Gln Leu Ser Ile Tyr
Leu Ala Asn 225 230 235
240 Ala Val Lys Tyr Phe Asn Ser Glu Ser Gly Ile Ile Thr Thr Asn Pro
245 250 255 Thr Phe Ser Tyr
Lys Thr Arg Ser Asn Gln Ile Tyr Asp Tyr Ile Val 260
265 270 Lys Asn Lys Lys Asp Glu Leu Tyr Lys
Lys Leu Glu Thr Ala Phe Thr 275 280
285 Ser Glu Phe Asn Lys Ile Asn Phe Ile Asp Ile Phe Lys Asp
Phe Gln 290 295 300
Phe Asp Glu Asn Asn Ser Asn Asp Asn Lys Lys Ile Ile Thr Lys Ile 305
310 315 320 Ile Lys Ser Ser Thr
Asn Ser Ser Ala Ser Ser Ser Asn Ser Ser Thr 325
330 335 Thr Thr Thr Thr Glu Leu Ser Ser Thr Thr
Thr Arg 340 345
151146DNAArtificial SequenceNucleotide sequence encoding MSC_0816 shown
in SEQ ID NO16, modified for expression in E. coli 15gcaaacaaaa
actctgtcga aaacaacatc tatatcagta aacagattca acgcaaaccg 60cataaaatcg
aaggcgataa actgattgaa atcggttatt actgggattc tcacgaccgt 120caggtgcgca
ttatgcgtat cccgccgacc gtgaaagtta tcgcggccca gctgccgccg 180attatcacga
gtctgaaagg cgcatttcaa gctcgcatta acgacgttat ctggcatgtc 240ccgtgggata
ccaaaaacat cacgaacatg aacagcatgt tctacaacaa tatttggttc 300aacagctcta
gtatcctgga atgggatacc tccaatgtta cggacatggg tgaaatgttt 360ggccgtaccg
gtagcttcaa ccaggatctg tccaaatggg acgtctcaaa agtgaaaaac 420ttcaagaaaa
tgttctacaa cgcgaaaaaa tacaacaaca acgataaacc gctgaaatgg 480aacgacaaac
tgaaatctgc agtcaatatg gaagatatgt ttcaaggcgc tagtgacttc 540aaacatagtc
tgtccgattg gaaactggaa accgaaatca acaacaaaaa cttcggtctg 600ctggaagatc
gccacccgaa atggaaagaa aaactgatta aaccgtcctc accgatctcg 660agctctaatt
ccctgagttc caataacatc aatgatcgct cagatgacaa ccagattaat 720cgtaactcat
cgaccccgac gaatagcaac accatctcta cgaatccgag taacgatctg 780agctctaata
ccacgaataa cgaaaacatt tcggaaagtt ccatgagcaa taacatgctg 840gaaattccga
tcaatagcga aaacaaaccg gaaaacccga aaaacaacga aaacatcaac 900tacaaaatcc
tgccgaaagt ggacaaaacc aaaaaacaga gcgaagcgaa aaacaaaatc 960ccggttgaaa
aaggcgaact gtcgaaagat gaaaatcaaa ccacgaaaac cagcaacgcc 1020atcaaagaca
aagaaaactc atcgatcaaa tcagattcgc tgtacaaaat tccgccgaaa 1080ccgaacacca
ttatcagcaa actgagctct ccgaatgcgg gcattatcac gggtgccgtg 1140tttcgt
114616382PRTArtificial SequenceAmino acid sequence of MSC_0816 from M.
mycoides subsp. mycoides (Mmm), lacking the signal sequence 16Ala Asn
Lys Asn Ser Val Glu Asn Asn Ile Tyr Ile Ser Lys Gln Ile 1 5
10 15 Gln Arg Lys Pro His Lys Ile
Glu Gly Asp Lys Leu Ile Glu Ile Gly 20 25
30 Tyr Tyr Trp Asp Ser His Asp Arg Gln Val Arg Ile
Met Arg Ile Pro 35 40 45
Pro Thr Val Lys Val Ile Ala Ala Gln Leu Pro Pro Ile Ile Thr Ser
50 55 60 Leu Lys Gly
Ala Phe Gln Ala Arg Ile Asn Asp Val Ile Trp His Val 65
70 75 80 Pro Trp Asp Thr Lys Asn Ile
Thr Asn Met Asn Ser Met Phe Tyr Asn 85
90 95 Asn Ile Trp Phe Asn Ser Ser Ser Ile Leu Glu
Trp Asp Thr Ser Asn 100 105
110 Val Thr Asp Met Gly Glu Met Phe Gly Arg Thr Gly Ser Phe Asn
Gln 115 120 125 Asp
Leu Ser Lys Trp Asp Val Ser Lys Val Lys Asn Phe Lys Lys Met 130
135 140 Phe Tyr Asn Ala Lys Lys
Tyr Asn Asn Asn Asp Lys Pro Leu Lys Trp 145 150
155 160 Asn Asp Lys Leu Lys Ser Ala Val Asn Met Glu
Asp Met Phe Gln Gly 165 170
175 Ala Ser Asp Phe Lys His Ser Leu Ser Asp Trp Lys Leu Glu Thr Glu
180 185 190 Ile Asn
Asn Lys Asn Phe Gly Leu Leu Glu Asp Arg His Pro Lys Trp 195
200 205 Lys Glu Lys Leu Ile Lys Pro
Ser Ser Pro Ile Ser Ser Ser Asn Ser 210 215
220 Leu Ser Ser Asn Asn Ile Asn Asp Arg Ser Asp Asp
Asn Gln Ile Asn 225 230 235
240 Arg Asn Ser Ser Thr Pro Thr Asn Ser Asn Thr Ile Ser Thr Asn Pro
245 250 255 Ser Asn Asp
Leu Ser Ser Asn Thr Thr Asn Asn Glu Asn Ile Ser Glu 260
265 270 Ser Ser Met Ser Asn Asn Met Leu
Glu Ile Pro Ile Asn Ser Glu Asn 275 280
285 Lys Pro Glu Asn Pro Lys Asn Asn Glu Asn Ile Asn Tyr
Lys Ile Leu 290 295 300
Pro Lys Val Asp Lys Thr Lys Lys Gln Ser Glu Ala Lys Asn Lys Ile 305
310 315 320 Pro Val Glu Lys
Gly Glu Leu Ser Lys Asp Glu Asn Gln Thr Thr Lys 325
330 335 Thr Ser Asn Ala Ile Lys Asp Lys Glu
Asn Ser Ser Ile Lys Ser Asp 340 345
350 Ser Leu Tyr Lys Ile Pro Pro Lys Pro Asn Thr Ile Ile Ser
Lys Leu 355 360 365
Ser Ser Pro Asn Ala Gly Ile Ile Thr Gly Ala Val Phe Arg 370
375 380 171185DNAArtificial
SequenceNucleotide sequence encoding MSC_0160 shown in SEQ ID NO18,
modified for expression in E. coli 17atggcgaaag aacagtttga tcgtagcctg
ccgcatgtga acattggcac catcggtcat 60gttgaccacg gcaaaaccac gctgaccgcg
gccattacga aagttctgtc tgaacagggt 120aacgcagaat tcaaagatta cgcaaacatc
gacaatgctc cggaagaacg tgaacgcggc 180attaccatca acacggcgca tgtggaatat
aaaaccgcga atcgccatta cgcccacgtc 240gattgcccgg gtcacgcaga ctacgtgaaa
aacatgatta cgggtgcagc tcagatggat 300ggcgctatcc tggtggttgc agcaaccgac
ggtccgatgc cgcagacgcg tgaacacatt 360ctgctgtccc gccaagtggg tgttccgaaa
atcgtcgtgt ttctgaacaa atgtgatatg 420gttgaagatg acgaaatgat tgatctggtg
gaaatggaaa tccgtgacct gctgaccgaa 480tatgatttcg acggcgaagg tgccccggtt
attcgtggca gcgcactggg tgctctgaac 540ggtgattcta aatggaccgg cgcgattaat
gaactgatgg cagctgtgga tgaatacatc 600ccgaccccgc agcgtgatgc cgacaaaacg
tttctgatgc cggtggaaga tgttttcacc 660atcacgggtc gtggtaccgt tgcaacgggt
cgtgtcgaac gcggcaccgt caaagtgaac 720gaagaagttg aaattatcgg cctgaaagaa
gaaccgacca aaacggttgt cacgggtctg 780gaaatgtttc gtaaactgct ggatttcgcg
gtggccggtg acaatgttgg tgcactgctg 840cgtggtgtcg atcgtcattc agtggaacgc
ggtcaggttc tggccaaacc gggcaccatt 900aaaccgcaca cggtcctgaa agcgtcggtg
tatgccctga cccaggaaga aggcggtcgt 960cataaaccgt ttttcaacaa atatcgtccg
caattttact tccgcaccac ggatgtcacc 1020ggtgaagtga cgctgccgga aggcaccgat
atggttatgc cgggtgacaa tgtcgaaatg 1080gaaattcaac tgatcaaacc ggttgcagtc
gaagaaggta ccaaatttag tattcgtgaa 1140ggcggtcgta ccatcggtgc tggtacggtg
atttccatcg aaaaa 118518395PRTMycoplasma mycoides 18Met
Ala Lys Glu Gln Phe Asp Arg Ser Leu Pro His Val Asn Ile Gly 1
5 10 15 Thr Ile Gly His Val Asp
His Gly Lys Thr Thr Leu Thr Ala Ala Ile 20
25 30 Thr Lys Val Leu Ser Glu Gln Gly Asn Ala
Glu Phe Lys Asp Tyr Ala 35 40
45 Asn Ile Asp Asn Ala Pro Glu Glu Arg Glu Arg Gly Ile Thr
Ile Asn 50 55 60
Thr Ala His Val Glu Tyr Lys Thr Ala Asn Arg His Tyr Ala His Val 65
70 75 80 Asp Cys Pro Gly His
Ala Asp Tyr Val Lys Asn Met Ile Thr Gly Ala 85
90 95 Ala Gln Met Asp Gly Ala Ile Leu Val Val
Ala Ala Thr Asp Gly Pro 100 105
110 Met Pro Gln Thr Arg Glu His Ile Leu Leu Ser Arg Gln Val Gly
Val 115 120 125 Pro
Lys Ile Val Val Phe Leu Asn Lys Cys Asp Met Val Glu Asp Asp 130
135 140 Glu Met Ile Asp Leu Val
Glu Met Glu Ile Arg Asp Leu Leu Thr Glu 145 150
155 160 Tyr Asp Phe Asp Gly Glu Gly Ala Pro Val Ile
Arg Gly Ser Ala Leu 165 170
175 Gly Ala Leu Asn Gly Asp Ser Lys Trp Thr Gly Ala Ile Asn Glu Leu
180 185 190 Met Ala
Ala Val Asp Glu Tyr Ile Pro Thr Pro Gln Arg Asp Ala Asp 195
200 205 Lys Thr Phe Leu Met Pro Val
Glu Asp Val Phe Thr Ile Thr Gly Arg 210 215
220 Gly Thr Val Ala Thr Gly Arg Val Glu Arg Gly Thr
Val Lys Val Asn 225 230 235
240 Glu Glu Val Glu Ile Ile Gly Leu Lys Glu Glu Pro Thr Lys Thr Val
245 250 255 Val Thr Gly
Leu Glu Met Phe Arg Lys Leu Leu Asp Phe Ala Val Ala 260
265 270 Gly Asp Asn Val Gly Ala Leu Leu
Arg Gly Val Asp Arg His Ser Val 275 280
285 Glu Arg Gly Gln Val Leu Ala Lys Pro Gly Thr Ile Lys
Pro His Thr 290 295 300
Val Leu Lys Ala Ser Val Tyr Ala Leu Thr Gln Glu Glu Gly Gly Arg 305
310 315 320 His Lys Pro Phe
Phe Asn Lys Tyr Arg Pro Gln Phe Tyr Phe Arg Thr 325
330 335 Thr Asp Val Thr Gly Glu Val Thr Leu
Pro Glu Gly Thr Asp Met Val 340 345
350 Met Pro Gly Asp Asn Val Glu Met Glu Ile Gln Leu Ile Lys
Pro Val 355 360 365
Ala Val Glu Glu Gly Thr Lys Phe Ser Ile Arg Glu Gly Gly Arg Thr 370
375 380 Ile Gly Ala Gly Thr
Val Ile Ser Ile Glu Lys 385 390 395
192106DNAArtificial SequenceNucleotide sequence encoding MSC_0775 shown
in SEQ ID NO20, modified for expression in E. coli 19tgtaaaaacc
cgctgttcaa tcaatcactg agcgaaaaaa tctacctgaa ctacaatctg 60caaacggaaa
aagacaaaca agaatttgaa aactataatc agattaacat gctgagcgaa 120atcaatcaat
acttcaccaa acatgatcac aacaaagacc tggtgaaatt taccacggat 180ggcgcgtccg
gtgacaccgt tgaattcaac aacatcatga aaaacaacta tgcctcaaaa 240tacatcaaat
tcgatcagga caaattcaaa gaaatcatca aaaaagaatt caatctgtca 300gattcgttcc
tgaaacgtct ggaattcgaa gtcgactaca acaacatctc gcgcgattac 360ggcaacaatt
ttgacgttat tttcccgatc cgtgttaaac tgccgctggt cagccataac 420aatttcaaat
atcagcaagg cctgtttatt gaacagacct ttaaattccg catcaaaaac 480gtcaaagcga
gcggttctga aaaaatcgat gtgtctaaaa tcaaagacat ctacaacgaa 540ctggtgaaac
tgaaagataa aaacaacttc acggccagtg tgaaaaccgt tacggaagaa 600accaaaaaac
tggttgatga atggggtatt catgaactga acagcacgca actgagctct 660atcttcgata
tcaaaaccga agaattcgat aacctgatca aagacaaaaa agaagtggaa 720cacaaagtta
ccatcacgga tgtggacctg agtgatccgt ccctggcgat taacgaaggc 780ctgctgaaac
tgcgtctggg cgttaaaatc aagggtaaag aaaccgaaac gggtgtcaac 840gtgtggatca
aattcaactt cgatcagaaa gacacctttt ggaaagaact gaaaatcagt 900gaatccatca
aagtcaacac ggtgaaattc agtgaaacca atacggattt taccaaactg 960atgaacgaca
acctgatcat caaatcaaaa tcgaaattca tcaaaaacat caaactgagt 1020tccatcgata
aaaccacgga ctatcgtaat tccggcgtcc tgctggaagt gctgaccaac 1080gaatcaaaag
ataacgtgat caaactgcat aaaaaaccgg gcgttggtaa atataccgat 1140ctgtactccg
cagacttcac gaaaaacaat atccacgcgc cgaattttgc caccgaaaaa 1200ctgacgcagg
aaaacctgaa atctatcaac aaagatttct ttcgccaatt tgactcagaa 1260ctgttctcgg
gcggttatgc tcgttcacgc ggcttctact cggaaaaagt gaaaagcccg 1320aaattcatgc
atatcggtga agattacatc gcaaacgact ttcaggctgt tctgatgccg 1380tatgatggtg
aaattatcgc ggcctacgaa ctgagcacca atgtgccgtt cgcaggcgtt 1440ggtacggttc
tggtcgctaa agtgccgatc accagcctgc cgtggtctcc gaaacagaaa 1500gaaatcgaac
tgaacgataa caaaacgcat atctacatca gctttctgca cctggatgcc 1560caacgcaccc
tgaacaatga caaactgggc tgggtggcag aaaccgctaa actgaaaaaa 1620gataaaacgg
ttaaagtggt taaaagtgtc accccgtcca cgccgaaaaa agtcagcaaa 1680ggtaccgtga
tcggctatct gggtgatcac tcatcgaacg gcggttggat gtctcatgca 1740cacattaatc
tgtacacgaa ccgtccgaat tatctgagtg aaaactactt tagctctaaa 1800accattcgtg
cgcagctgga tgacaaacgc gccaaaggct ataaaagttc cgtgtctaac 1860aatgatttca
gtgccattgg caatatcggt gttgaacgca aaattgatac gaaaatctat 1920caggtcgacc
cgaaaaccgg cattgaagat aaacaaaaag caatttcgga cgaaatcccg 1980ctgtacttca
acggcctgag catgctgggt tttgaaaaaa ccaaaggtta tgctaacccg 2040aatctgatgt
acaaactgcg tgatgaacgc accgtgagct tttctgttaa agaagtcaat 2100aaactg
210620702PRTArtificial SequenceAmino acid sequence of MSC_0775 from M.
mycoides subsp. mycoides (Mmm), lacking the signal sequence 20Cys Lys
Asn Pro Leu Phe Asn Gln Ser Leu Ser Glu Lys Ile Tyr Leu 1 5
10 15 Asn Tyr Asn Leu Gln Thr Glu
Lys Asp Lys Gln Glu Phe Glu Asn Tyr 20 25
30 Asn Gln Ile Asn Met Leu Ser Glu Ile Asn Gln Tyr
Phe Thr Lys His 35 40 45
Asp His Asn Lys Asp Leu Val Lys Phe Thr Thr Asp Gly Ala Ser Gly
50 55 60 Asp Thr Val
Glu Phe Asn Asn Ile Met Lys Asn Asn Tyr Ala Ser Lys 65
70 75 80 Tyr Ile Lys Phe Asp Gln Asp
Lys Phe Lys Glu Ile Ile Lys Lys Glu 85
90 95 Phe Asn Leu Ser Asp Ser Phe Leu Lys Arg Leu
Glu Phe Glu Val Asp 100 105
110 Tyr Asn Asn Ile Ser Arg Asp Tyr Gly Asn Asn Phe Asp Val Ile
Phe 115 120 125 Pro
Ile Arg Val Lys Leu Pro Leu Val Ser His Asn Asn Phe Lys Tyr 130
135 140 Gln Gln Gly Leu Phe Ile
Glu Gln Thr Phe Lys Phe Arg Ile Lys Asn 145 150
155 160 Val Lys Ala Ser Gly Ser Glu Lys Ile Asp Val
Ser Lys Ile Lys Asp 165 170
175 Ile Tyr Asn Glu Leu Val Lys Leu Lys Asp Lys Asn Asn Phe Thr Ala
180 185 190 Ser Val
Lys Thr Val Thr Glu Glu Thr Lys Lys Leu Val Asp Glu Trp 195
200 205 Gly Ile His Glu Leu Asn Ser
Thr Gln Leu Ser Ser Ile Phe Asp Ile 210 215
220 Lys Thr Glu Glu Phe Asp Asn Leu Ile Lys Asp Lys
Lys Glu Val Glu 225 230 235
240 His Lys Val Thr Ile Thr Asp Val Asp Leu Ser Asp Pro Ser Leu Ala
245 250 255 Ile Asn Glu
Gly Leu Leu Lys Leu Arg Leu Gly Val Lys Ile Lys Gly 260
265 270 Lys Glu Thr Glu Thr Gly Val Asn
Val Trp Ile Lys Phe Asn Phe Asp 275 280
285 Gln Lys Asp Thr Phe Trp Lys Glu Leu Lys Ile Ser Glu
Ser Ile Lys 290 295 300
Val Asn Thr Val Lys Phe Ser Glu Thr Asn Thr Asp Phe Thr Lys Leu 305
310 315 320 Met Asn Asp Asn
Leu Ile Ile Lys Ser Lys Ser Lys Phe Ile Lys Asn 325
330 335 Ile Lys Leu Ser Ser Ile Asp Lys Thr
Thr Asp Tyr Arg Asn Ser Gly 340 345
350 Val Leu Leu Glu Val Leu Thr Asn Glu Ser Lys Asp Asn Val
Ile Lys 355 360 365
Leu His Lys Lys Pro Gly Val Gly Lys Tyr Thr Asp Leu Tyr Ser Ala 370
375 380 Asp Phe Thr Lys Asn
Asn Ile His Ala Pro Asn Phe Ala Thr Glu Lys 385 390
395 400 Leu Thr Gln Glu Asn Leu Lys Ser Ile Asn
Lys Asp Phe Phe Arg Gln 405 410
415 Phe Asp Ser Glu Leu Phe Ser Gly Gly Tyr Ala Arg Ser Arg Gly
Phe 420 425 430 Tyr
Ser Glu Lys Val Lys Ser Pro Lys Phe Met His Ile Gly Glu Asp 435
440 445 Tyr Ile Ala Asn Asp Phe
Gln Ala Val Leu Met Pro Tyr Asp Gly Glu 450 455
460 Ile Ile Ala Ala Tyr Glu Leu Ser Thr Asn Val
Pro Phe Ala Gly Val 465 470 475
480 Gly Thr Val Leu Val Ala Lys Val Pro Ile Thr Ser Leu Pro Trp Ser
485 490 495 Pro Lys
Gln Lys Glu Ile Glu Leu Asn Asp Asn Lys Thr His Ile Tyr 500
505 510 Ile Ser Phe Leu His Leu Asp
Ala Gln Arg Thr Leu Asn Asn Asp Lys 515 520
525 Leu Gly Trp Val Ala Glu Thr Ala Lys Leu Lys Lys
Asp Lys Thr Val 530 535 540
Lys Val Val Lys Ser Val Thr Pro Ser Thr Pro Lys Lys Val Ser Lys 545
550 555 560 Gly Thr Val
Ile Gly Tyr Leu Gly Asp His Ser Ser Asn Gly Gly Trp 565
570 575 Met Ser His Ala His Ile Asn Leu
Tyr Thr Asn Arg Pro Asn Tyr Leu 580 585
590 Ser Glu Asn Tyr Phe Ser Ser Lys Thr Ile Arg Ala Gln
Leu Asp Asp 595 600 605
Lys Arg Ala Lys Gly Tyr Lys Ser Ser Val Ser Asn Asn Asp Phe Ser 610
615 620 Ala Ile Gly Asn
Ile Gly Val Glu Arg Lys Ile Asp Thr Lys Ile Tyr 625 630
635 640 Gln Val Asp Pro Lys Thr Gly Ile Glu
Asp Lys Gln Lys Ala Ile Ser 645 650
655 Asp Glu Ile Pro Leu Tyr Phe Asn Gly Leu Ser Met Leu Gly
Phe Glu 660 665 670
Lys Thr Lys Gly Tyr Ala Asn Pro Asn Leu Met Tyr Lys Leu Arg Asp
675 680 685 Glu Arg Thr Val
Ser Phe Ser Val Lys Glu Val Asn Lys Leu 690 695
700 21642DNAArtificial SequenceNucleotide sequence
encoding YP_004400127.1 shown in SEQ ID NO22, modified for
expression in E. coli 21atgaagacgg acaacacgaa ccaaaaaatc aaggaaaagg
acaacgaaac gggtagtaaa 60gacaaggaca aaccgaataa taacctgaac agctctgaac
aggatctgcc gaaagaccaa 120ccgattacca aaaaggaaaa agatgaaaag acggacagct
ttgcggataa actgaaaaag 180gatctgaaaa agatcctgga caagaaggaa gatctgaaga
tccgtgaata cagcaccaaa 240ctgatctcta aatacttcca gaaaagttcc gaaaaacaac
tgctgaaaga ttggttcgac 300ctggaaaaga aaattaaaaa atggttcgac gaatctgaac
tgaacgaaat caaaaaggaa 360atcaccatcc tgttttcaga atcgctggat aacaatagta
acaatcagga atcccgcaaa 420ctgaaggatc tgctggacaa agtgacgaag gataacaaag
aaggcattct ggaagaagtt 480aaaaacctgt ttggtcagaa gatctcaaaa gaactggaag
aaaaactgaa gtcggaaacc 540gatggcatca acaatctgct gtcaaaaaag caatacgaaa
ccatcaagac gaagctgttc 600gatatcgtgg ataaaacggc cgaactggaa aagaacatca
aa 64222214PRTArtificial SequenceAmino acid
sequence of YP_004400127.1 from M. mycoides subsp. capri (Mmc),
lacking the signal sequence and including an N-terminal methionine
22Met Lys Thr Asp Asn Thr Asn Gln Lys Ile Lys Glu Lys Asp Asn Glu 1
5 10 15 Thr Gly Ser Lys
Asp Lys Asp Lys Pro Asn Asn Asn Leu Asn Ser Ser 20
25 30 Glu Gln Asp Leu Pro Lys Asp Gln Pro
Ile Thr Lys Lys Glu Lys Asp 35 40
45 Glu Lys Thr Asp Ser Phe Ala Asp Lys Leu Lys Lys Asp Leu
Lys Lys 50 55 60
Ile Leu Asp Lys Lys Glu Asp Leu Lys Ile Arg Glu Tyr Ser Thr Lys 65
70 75 80 Leu Ile Ser Lys Tyr
Phe Gln Lys Ser Ser Glu Lys Gln Leu Leu Lys 85
90 95 Asp Trp Phe Asp Leu Glu Lys Lys Ile Lys
Lys Trp Phe Asp Glu Ser 100 105
110 Glu Leu Asn Glu Ile Lys Lys Glu Ile Thr Ile Leu Phe Ser Glu
Ser 115 120 125 Leu
Asp Asn Asn Ser Asn Asn Gln Glu Ser Arg Lys Leu Lys Asp Leu 130
135 140 Leu Asp Lys Val Thr Lys
Asp Asn Lys Glu Gly Ile Leu Glu Glu Val 145 150
155 160 Lys Asn Leu Phe Gly Gln Lys Ile Ser Lys Glu
Leu Glu Glu Lys Leu 165 170
175 Lys Ser Glu Thr Asp Gly Ile Asn Asn Leu Leu Ser Lys Lys Gln Tyr
180 185 190 Glu Thr
Ile Lys Thr Lys Leu Phe Asp Ile Val Asp Lys Thr Ala Glu 195
200 205 Leu Glu Lys Asn Ile Lys
210 23936DNAArtificial SequenceNucleotide sequence
encoding YP_004399790.1 shown in SEQ ID NO24, modified for
expression in E. coli 23atgaaaaaac tgctggcgat tctgggcacg atggctatct
cctccaccgg cgcttccctg 60gttattgctt gcgacaaccc gacgaaaaac gatagcaaaa
agccggaaac caaaccggaa 120accccgacga attccggctc aaacgaaacg tccaatcagg
gctcaaacga aggttcgaat 180aaagaaaagg ataattcgga accgagcaag ccgaccaaac
cggtgaagcc ggcatcaggc 240accgcttctc tggttagcaa aacggatatc tcagcatgga
gcagcatttt tatggactcg 300atcaccggtg aagatattca agaccattct gtggaagaaa
aagaaaaggc ggataaagcc 360aagaacaaag aattcgtgga agttctggac gaaatcaaca
aactgacccc gacgctggaa 420aatgaactga aacagctggc acaaaagttc aaggaaatca
aggaaaaact ggctaaggaa 480aaggaactga aggatcagaa gaacaacaag gaattcgtcg
aagtgctgga tgaaattaac 540aaactgagtg tgacctttga aaaggaactg aaagccctgt
tcaaaaagat tggtgaaaac 600gaactggaaa aggaacgtct gtacaaggaa ttcaccacga
gttcctcaaa tgcgaccaaa 660tattacttcg aagccctgga tacgaaaaag gaagttagcg
aatggaattt tgaacgtggc 720cgcctggtcg aactgatttc gagcatcgac cgccaggtga
aggaactgaa atctagtggc 780aaggatatca aaagcgttat cgacaccgtc aaatctaacc
tggaaaacta caagaacagt 840atcaaggaac ataagaactc caaggttttc tggaagtacg
aaatgtggac ccactggctg 900gaagatgtcc tgacgaatct gaaaaaccag aatcaa
93624312PRTMycoplasma mycoides 24Met Lys Lys Leu
Leu Ala Ile Leu Gly Thr Met Ala Ile Ser Ser Thr 1 5
10 15 Gly Ala Ser Leu Val Ile Ala Cys Asp
Asn Pro Thr Lys Asn Asp Ser 20 25
30 Lys Lys Pro Glu Thr Lys Pro Glu Thr Pro Thr Asn Ser Gly
Ser Asn 35 40 45
Glu Thr Ser Asn Gln Gly Ser Asn Glu Gly Ser Asn Lys Glu Lys Asp 50
55 60 Asn Ser Glu Pro Ser
Lys Pro Thr Lys Pro Val Lys Pro Ala Ser Gly 65 70
75 80 Thr Ala Ser Leu Val Ser Lys Thr Asp Ile
Ser Ala Trp Ser Ser Ile 85 90
95 Phe Met Asp Ser Ile Thr Gly Glu Asp Ile Gln Asp His Ser Val
Glu 100 105 110 Glu
Lys Glu Lys Ala Asp Lys Ala Lys Asn Lys Glu Phe Val Glu Val 115
120 125 Leu Asp Glu Ile Asn Lys
Leu Thr Pro Thr Leu Glu Asn Glu Leu Lys 130 135
140 Gln Leu Ala Gln Lys Phe Lys Glu Ile Lys Glu
Lys Leu Ala Lys Glu 145 150 155
160 Lys Glu Leu Lys Asp Gln Lys Asn Asn Lys Glu Phe Val Glu Val Leu
165 170 175 Asp Glu
Ile Asn Lys Leu Ser Val Thr Phe Glu Lys Glu Leu Lys Ala 180
185 190 Leu Phe Lys Lys Ile Gly Glu
Asn Glu Leu Glu Lys Glu Arg Leu Tyr 195 200
205 Lys Glu Phe Thr Thr Ser Ser Ser Asn Ala Thr Lys
Tyr Tyr Phe Glu 210 215 220
Ala Leu Asp Thr Lys Lys Glu Val Ser Glu Trp Asn Phe Glu Arg Gly 225
230 235 240 Arg Leu Val
Glu Leu Ile Ser Ser Ile Asp Arg Gln Val Lys Glu Leu 245
250 255 Lys Ser Ser Gly Lys Asp Ile Lys
Ser Val Ile Asp Thr Val Lys Ser 260 265
270 Asn Leu Glu Asn Tyr Lys Asn Ser Ile Lys Glu His Lys
Asn Ser Lys 275 280 285
Val Phe Trp Lys Tyr Glu Met Trp Thr His Trp Leu Glu Asp Val Leu 290
295 300 Thr Asn Leu Lys
Asn Gln Asn Gln 305 310 251146DNAArtificial
SequenceNucleotide sequence encoding YP_004400580.1 shown in SEQ ID
NO26, modified for expression in E. coli 25atgaagaagc tgctgattgg
ttttagtagt atttttgcgt tcctgaccgt ctcgtgttcc 60attagtaccc cgaagattaa
cccgacgatc aacaagaacg aaaacaagct gtacaagaat 120aaatacgtga gcgaactgct
gaacctgtat ctgtcagact cgaaactgcg tgatagttac 180atcaatgacc aggaaaacgt
tagcgattct aaattttccg aactgaagta tggcctgacc 240ttttacccga ttttcatcca
tcgttcactg gattatcata ttggtcagca ctaccgcgtt 300attatccaaa agtcgaaaaa
tgctctggaa cagacgctga aaaacgattg gtattgggtc 360ctggacaaca tcaccaactt
caagtacaac ttcaacccgt atggcgatct gtacaacgat 420ttcgacaagg atgaaaacct
gtttaaccag ctggaaaaag acctgggttc tctgattagc 480tctgtcaaga acaagaacgt
gcaaaagatc atcaagatca acctggatga agtggttaac 540gaaaagatca aagatgacta
tctgaaaaag gaagccctgt acctgatctt cgataacaac 600aaggcaatca agatctggaa
gtacgaaaac cagaataaaa ccgaattcct gatgaccacg 660gacctgttta tcttcaaaga
cacgaacaac ctggaaaacc aaatcaagga actggaaaac 720accatcttcg aaaagcgtaa
ggtcgaatac aacaacaacc tggaaaacat caacaagaac 780atcgaagcta ccaaaaagcg
caaggaaaaa gcgcagcaag aaatccagga tctgaaggaa 840aagatcaaaa agctggaaaa
gacgaacacc acgaccacga ccccgctggc actgaccagt 900tccgccattc tgctgagcgc
accgaaaaac gataaaaaga aagaaccgac gctggaagaa 960ctgaagaaag atctggaaaa
gaaagaaaaa cagagccagc aattcgacga aaacgttaag 1020aaatacgaaa agaacatcga
agatctgccg cagaagtcta acgacaagaa gttcctggaa 1080ttccacgcaa ccgatcaata
caacgaacgc ctgaaagaaa gtctgaatga aatcaacaaa 1140gacggc
114626382PRTArtificial
SequenceAmino acid sequence of YP_004400580.1 from M. mycoides
subsp. capri (Mmc), lacking 15 amino acids from the C-terminus 26Met
Lys Lys Leu Leu Ile Gly Phe Ser Ser Ile Phe Ala Phe Leu Thr 1
5 10 15 Val Ser Cys Ser Ile Ser
Thr Pro Lys Ile Asn Pro Thr Ile Asn Lys 20
25 30 Asn Glu Asn Lys Leu Tyr Lys Asn Lys Tyr
Val Ser Glu Leu Leu Asn 35 40
45 Leu Tyr Leu Ser Asp Ser Lys Leu Arg Asp Ser Tyr Ile Asn
Asp Gln 50 55 60
Glu Asn Val Ser Asp Ser Lys Phe Ser Glu Leu Lys Tyr Gly Leu Thr 65
70 75 80 Phe Tyr Pro Ile Phe
Ile His Arg Ser Leu Asp Tyr His Ile Gly Gln 85
90 95 His Tyr Arg Val Ile Ile Gln Lys Ser Lys
Asn Ala Leu Glu Gln Thr 100 105
110 Leu Lys Asn Asp Trp Tyr Trp Val Leu Asp Asn Ile Thr Asn Phe
Lys 115 120 125 Tyr
Asn Phe Asn Pro Tyr Gly Asp Leu Tyr Asn Asp Phe Asp Lys Asp 130
135 140 Glu Asn Leu Phe Asn Gln
Leu Glu Lys Asp Leu Gly Ser Leu Ile Ser 145 150
155 160 Ser Val Lys Asn Lys Asn Val Gln Lys Ile Ile
Lys Ile Asn Leu Asp 165 170
175 Glu Val Val Asn Glu Lys Ile Lys Asp Asp Tyr Leu Lys Lys Glu Ala
180 185 190 Leu Tyr
Leu Ile Phe Asp Asn Asn Lys Ala Ile Lys Ile Trp Lys Tyr 195
200 205 Glu Asn Gln Asn Lys Thr Glu
Phe Leu Met Thr Thr Asp Leu Phe Ile 210 215
220 Phe Lys Asp Thr Asn Asn Leu Glu Asn Gln Ile Lys
Glu Leu Glu Asn 225 230 235
240 Thr Ile Phe Glu Lys Arg Lys Val Glu Tyr Asn Asn Asn Leu Glu Asn
245 250 255 Ile Asn Lys
Asn Ile Glu Ala Thr Lys Lys Arg Lys Glu Lys Ala Gln 260
265 270 Gln Glu Ile Gln Asp Leu Lys Glu
Lys Ile Lys Lys Leu Glu Lys Thr 275 280
285 Asn Thr Thr Thr Thr Thr Pro Leu Ala Leu Thr Ser Ser
Ala Ile Leu 290 295 300
Leu Ser Ala Pro Lys Asn Asp Lys Lys Lys Glu Pro Thr Leu Glu Glu 305
310 315 320 Leu Lys Lys Asp
Leu Glu Lys Lys Glu Lys Gln Ser Gln Gln Phe Asp 325
330 335 Glu Asn Val Lys Lys Tyr Glu Lys Asn
Ile Glu Asp Leu Pro Gln Lys 340 345
350 Ser Asn Asp Lys Lys Phe Leu Glu Phe His Ala Thr Asp Gln
Tyr Asn 355 360 365
Glu Arg Leu Lys Glu Ser Leu Asn Glu Ile Asn Lys Asp Gly 370
375 380 27567DNAArtificial
SequenceNucleotide sequence encoding YP_004400610.1 shown in SEQ ID
NO28, modified for expression in E. coli 27atgggtgacc gtgccccgag
tgcgaaatct gcggaaaagg tggaaaacaa ggaaaaaacg 60aagccgagcg aagcgccgaa
gaaaggtgaa aagagtgaag aaaaggaaaa cgaaaaggat 120aaggaactga aggcagtgtt
ttcaaaagtt gagggtcaga acattggcaa cttccaaccg 180aacaacaaga acatcgttag
ccagggtgat atcaaaaagg aactggcgaa taaactgggt 240gtcagcgaat ctgacctgca
aggcctgaag ctgaactatg atgacaaatc cggtgaagtc 300accctgccga agttcaacaa
caagaacctg aagttcaagt tcaccacgtt ctaccagctg 360ggcaaaatta agacgtcaaa
aatcgataac gtgctgtttc tgtcgcaact ggacattaaa 420aaggaactgg ccaacaaact
gaaggttaaa gaaagcgatc tgcaagaact gaaaaccgac 480tctacgaacg gcatcggtgc
cggcagtgtc cgttccaaaa ccttcgtggg cattctggaa 540tttaaattcg aaatcgatga
aaataaa 56728189PRTArtificial
SequenceAmino acid sequence of YP_004400610.1 from M. mycoides
subsp. capri (Mmc), lacking the signal sequence and including an
N-terminal methionine 28Met Gly Asp Arg Ala Pro Ser Ala Lys Ser Ala Glu
Lys Val Glu Asn 1 5 10
15 Lys Glu Lys Thr Lys Pro Ser Glu Ala Pro Lys Lys Gly Glu Lys Ser
20 25 30 Glu Glu Lys
Glu Asn Glu Lys Asp Lys Glu Leu Lys Ala Val Phe Ser 35
40 45 Lys Val Glu Gly Gln Asn Ile Gly
Asn Phe Gln Pro Asn Asn Lys Asn 50 55
60 Ile Val Ser Gln Gly Asp Ile Lys Lys Glu Leu Ala Asn
Lys Leu Gly 65 70 75
80 Val Ser Glu Ser Asp Leu Gln Gly Leu Lys Leu Asn Tyr Asp Asp Lys
85 90 95 Ser Gly Glu Val
Thr Leu Pro Lys Phe Asn Asn Lys Asn Leu Lys Phe 100
105 110 Lys Phe Thr Thr Phe Tyr Gln Leu Gly
Lys Ile Lys Thr Ser Lys Ile 115 120
125 Asp Asn Val Leu Phe Leu Ser Gln Leu Asp Ile Lys Lys Glu
Leu Ala 130 135 140
Asn Lys Leu Lys Val Lys Glu Ser Asp Leu Gln Glu Leu Lys Thr Asp 145
150 155 160 Ser Thr Asn Gly Ile
Gly Ala Gly Ser Val Arg Ser Lys Thr Phe Val 165
170 175 Gly Ile Leu Glu Phe Lys Phe Glu Ile Asp
Glu Asn Lys 180 185
2922DNAArtificial SequenceCpG ODN 2007, a Class B CpG, phosphorothioated
29tcgtcgttgt cgttttgtcg tt
223012PRTArtificial Sequencehost defense peptide HH2 30Val Gln Leu Arg
Ile Arg Val Ala Val Ile Arg Ala 1 5 10
3112PRTArtificial Sequencehost defense peptide 1002 31Val Gln Arg
Trp Leu Ile Val Trp Arg Ile Arg Lys 1 5
10 3212PRTArtificial Sequencehost defense peptide 1018 32Val Arg
Leu Ile Val Ala Val Arg Ile Trp Arg Arg 1 5
10 3313PRTArtificial Sequencehost defense peptide Indolicidin
33Ile Leu Pro Trp Lys Trp Pro Trp Trp Pro Trp Arg Arg 1 5
10 3413PRTArtificial Sequencehost defense
peptide HH111 34Ile Leu Lys Trp Lys Trp Pro Trp Trp Pro Trp Arg Arg 1
5 10 3513PRTArtificial
Sequencehost defense peptide HH113 35Ile Leu Pro Trp Lys Lys Pro Trp Trp
Pro Trp Arg Arg 1 5 10
3613PRTArtificial Sequencehost defense peptide HH970 36Ile Leu Lys Trp
Lys Trp Pro Trp Trp Lys Trp Arg Arg 1 5
10 3713PRTArtificial Sequencehost defense peptide HH1010
37Ile Leu Arg Trp Lys Trp Arg Trp Trp Arg Trp Arg Arg 1 5
10 3834PRTArtificial SequenceHost defence
peptide Nisin ZVariant(2)..(2)Xaa is didehydroaminobutyric
acidVariant(5)..(5)Xaa is didehydroalanineVariant(8)..(8)Xaa is
AbuVariant(13)..(13)Xaa is AbuVariant(23)..(23)Xaa is
AbuVariant(25)..(25)Xaa is AbuVariant(33)..(33)Xaa is didehydroalanine
38Ile Xaa Ala Ile Xaa Leu Ala Xaa Pro Gly Ala Lys Xaa Gly Ala Leu 1
5 10 15 Met Gly Ala Asn
Met Lys Xaa Ala Xaa Ala Asn Ala Ser Ile Asn Val 20
25 30 Xaa Lys 3912PRTArtificial
Sequencehost defense peptide JK1 39Val Phe Leu Arg Arg Ile Arg Val Ile
Val Ile Arg 1 5 10
4012PRTArtificial Sequencehost defense peptide JK2 40Val Phe Trp Arg Arg
Ile Arg Val Trp Val Ile Arg 1 5 10
4112PRTArtificial Sequencehost defense peptide JK3 41Val Gln Leu Arg
Ala Ile Arg Val Arg Val Ile Arg 1 5 10
4212PRTArtificial Sequencehost defense peptide JK4 42Val Gln Leu
Arg Arg Ile Arg Val Trp Val Ile Arg 1 5
10 4312PRTArtificial Sequencehost defense peptide JK5 43Val Gln
Trp Arg Ala Ile Arg Val Arg Val Ile Arg 1 5
10 4412PRTArtificial Sequencehost defense peptide JK6 44Val
Gln Trp Arg Arg Ile Arg Val Trp Val Ile Arg 1 5
10 4520DNAArtificial SequenceCpG ODN 1826, a Class B CpG,
phosphorothioated 45tccatgacgt tcctgacgtt
204624DNAArtificial SequenceCpG 7907 or 10103, a Class B
CpG, phosphorothioated 46tcgtcgtttt gtcgttttgt cgtt
244721DNAArtificial SequenceCpG 8954, a Class A
CpG 47ggggacgacg tcgtgggggg g
214822DNAArtificial SequenceCpG 2395 or CpG 10101, a Class C CpG,
phosphorothioated 48tcgtcgtttt cggcgcgcgc cg
224932DNAArtificial Sequencea non-CpG oligonucleotide
49aaaaaaggta cctaaatagt atgtttctga aa
32501608DNAArtificial SequenceNucleotide sequence encoding fusion between
YP_004400127.1 and YP_004399790.1 shown in SEQ ID NO51, modified
for expression in E. coli 50catatgaaaa cggacaatac caaccaaaaa atcaaagaaa
aagacaacga aacgggcagt 60aaagacaaag acaaaccgaa caataacctg aatagctctg
aacaggatct gccgaaagac 120caaccgatca ccaagaaaga aaaagatgaa aaaacggaca
gctttgcaga taaactgaag 180aaagatctga agaaaattct ggacaagaaa gaagatctga
aaatccgtga atacagtacc 240aaactgatct ccaaatactt ccagaaaagt tccgaaaaac
aactgctgaa agattggttc 300gacctggaaa agaaaattaa aaaatggttc gacgaaagcg
aactgaacga aattaagaaa 360gaaatcacca tcctgttttc cgaatcactg gataacaatt
caaacaatca ggaatcgcgc 420aaactgaaag atctgctgga caaagttacc aaagataaca
aagaaggcat cctggaagaa 480gtcaaaaacc tgtttggtca gaaaatctca aaagaactgg
aagaaaaact gaaatcggaa 540accgatggca tcaacaatct gctgagcaaa aaacaatacg
aaaccatcaa aacgaaactg 600ttcgatattg tggacaaaac ggccgaactg gagaaaaaca
tcaaaggcgg tggcggtggc 660ggtatgaaaa aactgctggc aatcctgggc accatggcta
tttcatcgac gggtgcgagt 720ctggttattg cctgcgacaa tccgaccaaa aacgattcca
aaaaaccgga aacgaaaccg 780gaaaccccga cgaattcggg tagcaacgaa acctcgaatc
agggcagcaa cgaaggttct 840aacaaagaaa aagataactc tgaaccgagt aaaccgacga
aaccggtgaa accggcaagc 900ggcaccgctt ccctggtttc aaaaacggac attagcgcgt
ggagctctat ttttatggat 960tctatcaccg gtgaagatat tcaagaccat tctgtggaag
aaaaagaaaa agcggacaaa 1020gccaaaaata aagaattcgt ggaagttctg gatgaaatca
acaaactgac cccgacgctg 1080gaaaatgaac tgaaacagct ggcacaaaaa ttcaaagaaa
tcaaagaaaa actggctaaa 1140gaaaaagaac tgaaagacca gaaaaacaac aaagaattcg
tcgaagtgct ggacgaaatt 1200aacaaactga gtgtcacctt tgaaaaagaa ctgaaagccc
tgttcaagaa aattggcgaa 1260aacgaactgg aaaaagaacg tctgtacaaa gaattcacca
cgagttcctc aaatgcgacc 1320aaatattact tcgaagccct ggataccaag aaagaagtga
gcgaatggaa ctttgaacgt 1380ggccgcctgg tcgaactgat ttcgagcatc gatcgccagg
tgaaagaact gaaatctagt 1440ggtaaagaca tcaaaagcgt tatcgatacc gtcaaatcta
acctggaaaa ttacaaaaac 1500agtatcaaag aacacaaaaa ttccaaagtt ttctggaaat
acgaaatgtg gacgcactgg 1560ctggaagatg ttctgaccaa cctgaaaaat caaaatcaat
aaggatcc 160851532PRTArtificial SequenceAmino acid
sequence of fusion between YP_004400127.1 and YP_004399790.1 from M.
mycoides subsp. capri (Mmc), including a Gly6 linker 51Met Lys Thr
Asp Asn Thr Asn Gln Lys Ile Lys Glu Lys Asp Asn Glu 1 5
10 15 Thr Gly Ser Lys Asp Lys Asp Lys
Pro Asn Asn Asn Leu Asn Ser Ser 20 25
30 Glu Gln Asp Leu Pro Lys Asp Gln Pro Ile Thr Lys Lys
Glu Lys Asp 35 40 45
Glu Lys Thr Asp Ser Phe Ala Asp Lys Leu Lys Lys Asp Leu Lys Lys 50
55 60 Ile Leu Asp Lys
Lys Glu Asp Leu Lys Ile Arg Glu Tyr Ser Thr Lys 65 70
75 80 Leu Ile Ser Lys Tyr Phe Gln Lys Ser
Ser Glu Lys Gln Leu Leu Lys 85 90
95 Asp Trp Phe Asp Leu Glu Lys Lys Ile Lys Lys Trp Phe Asp
Glu Ser 100 105 110
Glu Leu Asn Glu Ile Lys Lys Glu Ile Thr Ile Leu Phe Ser Glu Ser
115 120 125 Leu Asp Asn Asn
Ser Asn Asn Gln Glu Ser Arg Lys Leu Lys Asp Leu 130
135 140 Leu Asp Lys Val Thr Lys Asp Asn
Lys Glu Gly Ile Leu Glu Glu Val 145 150
155 160 Lys Asn Leu Phe Gly Gln Lys Ile Ser Lys Glu Leu
Glu Glu Lys Leu 165 170
175 Lys Ser Glu Thr Asp Gly Ile Asn Asn Leu Leu Ser Lys Lys Gln Tyr
180 185 190 Glu Thr Ile
Lys Thr Lys Leu Phe Asp Ile Val Asp Lys Thr Ala Glu 195
200 205 Leu Glu Lys Asn Ile Lys Gly Gly
Gly Gly Gly Gly Met Lys Lys Leu 210 215
220 Leu Ala Ile Leu Gly Thr Met Ala Ile Ser Ser Thr Gly
Ala Ser Leu 225 230 235
240 Val Ile Ala Cys Asp Asn Pro Thr Lys Asn Asp Ser Lys Lys Pro Glu
245 250 255 Thr Lys Pro Glu
Thr Pro Thr Asn Ser Gly Ser Asn Glu Thr Ser Asn 260
265 270 Gln Gly Ser Asn Glu Gly Ser Asn Lys
Glu Lys Asp Asn Ser Glu Pro 275 280
285 Ser Lys Pro Thr Lys Pro Val Lys Pro Ala Ser Gly Thr Ala
Ser Leu 290 295 300
Val Ser Lys Thr Asp Ile Ser Ala Trp Ser Ser Ile Phe Met Asp Ser 305
310 315 320 Ile Thr Gly Glu Asp
Ile Gln Asp His Ser Val Glu Glu Lys Glu Lys 325
330 335 Ala Asp Lys Ala Lys Asn Lys Glu Phe Val
Glu Val Leu Asp Glu Ile 340 345
350 Asn Lys Leu Thr Pro Thr Leu Glu Asn Glu Leu Lys Gln Leu Ala
Gln 355 360 365 Lys
Phe Lys Glu Ile Lys Glu Lys Leu Ala Lys Glu Lys Glu Leu Lys 370
375 380 Asp Gln Lys Asn Asn Lys
Glu Phe Val Glu Val Leu Asp Glu Ile Asn 385 390
395 400 Lys Leu Ser Val Thr Phe Glu Lys Glu Leu Lys
Ala Leu Phe Lys Lys 405 410
415 Ile Gly Glu Asn Glu Leu Glu Lys Glu Arg Leu Tyr Lys Glu Phe Thr
420 425 430 Thr Ser
Ser Ser Asn Ala Thr Lys Tyr Tyr Phe Glu Ala Leu Asp Thr 435
440 445 Lys Lys Glu Val Ser Glu Trp
Asn Phe Glu Arg Gly Arg Leu Val Glu 450 455
460 Leu Ile Ser Ser Ile Asp Arg Gln Val Lys Glu Leu
Lys Ser Ser Gly 465 470 475
480 Lys Asp Ile Lys Ser Val Ile Asp Thr Val Lys Ser Asn Leu Glu Asn
485 490 495 Tyr Lys Asn
Ser Ile Lys Glu His Lys Asn Ser Lys Val Phe Trp Lys 500
505 510 Tyr Glu Met Trp Thr His Trp Leu
Glu Asp Val Leu Thr Asn Leu Lys 515 520
525 Asn Gln Asn Gln 530 521642DNAArtificial
SequenceNucleotide sequence encoding fusion between YP_004400610.1
and YP_00400580.1 shown in SEQ ID NO53, modified for expression in
E. coli 52catatgggcg accgtgcccc gtccgcaaaa tccgcagaaa aagtggaaaa
taaagaaaaa 60accaaaccga gtgaagcccc gaagaagggc gaaaagagtg aagaaaagga
aaacgaaaag 120gataaagaac tgaaagccgt cttttccaaa gtggaaggcc agaatattgg
taacttccaa 180ccgaacaaca aaaacatcgt ctcccagggc gatattaaga aagaactggc
aaacaaactg 240ggcgtgtcag aatcggacct gcaaggtctg aaactgaatt atgatgacaa
aagcggcgaa 300gtgacgctgc cgaaattcaa caacaaaaac ctgaaattca aattcaccac
gttctaccag 360ctgggtaaaa tcaaaaccag taaaatcgat aacgttctgt ttctgtccca
actggacatt 420aagaaagaac tggctaacaa actgaaagtc aaagaatcag atctgcagga
actgaaaacg 480gactcgacca acggtatcgg cgcgggtagc gtgcgttcta aaaccttcgt
tggtattctg 540gaattcaaat tcgaaatcga tgaaaacaaa ggcggtggcg gtggcagcat
ttctacgccg 600aaaattaacc cgaccatcaa caaaaacgaa aacaaactgt acaaaaacaa
atacgtctca 660gaactgctga acctgtatct gagtgactcc aaactgcgcg atagctacat
caatgaccag 720gaaaacgttt cagattcgaa attctctgaa ctgaaatatg gcctgacctt
ttacccgatt 780ttcatccatc gttcactgga ttatcatatt ggtcagcact accgcgtgat
tatccaaaaa 840tcgaaaaatg cgctggaaca gacgctgaaa aacgattggt attgggttct
ggacaacatc 900accaacttca aatacaactt caacccgtat ggcgatctgt acaacgattt
cgacaaagat 960gaaaacctgt ttaaccagct ggaaaaagac ctgggtagtc tgatcagctc
tgttaaaaac 1020aaaaacgtcc aaaaaatcat caaaatcaac ctggatgaag tggttaacga
aaaaatcaaa 1080gatgactacc tgaagaaaga agcgctgtac ctgatcttcg ataacaacaa
agcaatcaaa 1140atctggaaat acgaaaacca gaacaaaacc gaattcctga tgaccacgga
cctgtttatc 1200ttcaaagaca cgaacaatct ggaaaatcag attaaagaac tggaaaacac
catcttcgaa 1260aaacgtaaag tggaatacaa caacaacctg gaaaacatca acaaaaacat
cgaagctacc 1320aaaaaacgca aagaaaaagc gcagcaagaa atccaggatc tgaaagaaaa
aatcaaaaaa 1380ctggaaaaaa cgaataccac caccaccacc ccgctggccc tgaccagttc
cgccattctg 1440ctgtctgcac cgaaaaacga taaaaagaaa gaaccgacgc tggaagaact
gaagaaagat 1500ctggaaaaga aagaaaaaca gagccagcaa tttgacgaaa acgttaaaaa
atacgagaaa 1560aacatcgaag atctgccgca gaaatctaac gacaaaaaat tcctggaatt
ccacgcgacc 1620gatcaataca atgaacgtct ga
164253557PRTArtificial SequenceAmino acid sequence of fusion
between YP_004400610.1 and YP_00400580.1 from M. mycoides subsp.
capri (Mmc), the YP_00400580.1 sequence lacking the first 20 amino
acids, and the fusion including a Gly5 linker 53Met Gly Asp Arg Ala
Pro Ser Ala Lys Ser Ala Glu Lys Val Glu Asn 1 5
10 15 Lys Glu Lys Thr Lys Pro Ser Glu Ala Pro
Lys Lys Gly Glu Lys Ser 20 25
30 Glu Glu Lys Glu Asn Glu Lys Asp Lys Glu Leu Lys Ala Val Phe
Ser 35 40 45 Lys
Val Glu Gly Gln Asn Ile Gly Asn Phe Gln Pro Asn Asn Lys Asn 50
55 60 Ile Val Ser Gln Gly Asp
Ile Lys Lys Glu Leu Ala Asn Lys Leu Gly 65 70
75 80 Val Ser Glu Ser Asp Leu Gln Gly Leu Lys Leu
Asn Tyr Asp Asp Lys 85 90
95 Ser Gly Glu Val Thr Leu Pro Lys Phe Asn Asn Lys Asn Leu Lys Phe
100 105 110 Lys Phe
Thr Thr Phe Tyr Gln Leu Gly Lys Ile Lys Thr Ser Lys Ile 115
120 125 Asp Asn Val Leu Phe Leu Ser
Gln Leu Asp Ile Lys Lys Glu Leu Ala 130 135
140 Asn Lys Leu Lys Val Lys Glu Ser Asp Leu Gln Glu
Leu Lys Thr Asp 145 150 155
160 Ser Thr Asn Gly Ile Gly Ala Gly Ser Val Arg Ser Lys Thr Phe Val
165 170 175 Gly Ile Leu
Glu Phe Lys Phe Glu Ile Asp Glu Asn Lys Gly Gly Gly 180
185 190 Gly Gly Ser Ile Ser Thr Pro Lys
Ile Asn Pro Thr Ile Asn Lys Asn 195 200
205 Glu Asn Lys Leu Tyr Lys Asn Lys Tyr Val Ser Glu Leu
Leu Asn Leu 210 215 220
Tyr Leu Ser Asp Ser Lys Leu Arg Asp Ser Tyr Ile Asn Asp Gln Glu 225
230 235 240 Asn Val Ser Asp
Ser Lys Phe Ser Glu Leu Lys Tyr Gly Leu Thr Phe 245
250 255 Tyr Pro Ile Phe Ile His Arg Ser Leu
Asp Tyr His Ile Gly Gln His 260 265
270 Tyr Arg Val Ile Ile Gln Lys Ser Lys Asn Ala Leu Glu Gln
Thr Leu 275 280 285
Lys Asn Asp Trp Tyr Trp Val Leu Asp Asn Ile Thr Asn Phe Lys Tyr 290
295 300 Asn Phe Asn Pro Tyr
Gly Asp Leu Tyr Asn Asp Phe Asp Lys Asp Glu 305 310
315 320 Asn Leu Phe Asn Gln Leu Glu Lys Asp Leu
Gly Ser Leu Ile Ser Ser 325 330
335 Val Lys Asn Lys Asn Val Gln Lys Ile Ile Lys Ile Asn Leu Asp
Glu 340 345 350 Val
Val Asn Glu Lys Ile Lys Asp Asp Tyr Leu Lys Lys Glu Ala Leu 355
360 365 Tyr Leu Ile Phe Asp Asn
Asn Lys Ala Ile Lys Ile Trp Lys Tyr Glu 370 375
380 Asn Gln Asn Lys Thr Glu Phe Leu Met Thr Thr
Asp Leu Phe Ile Phe 385 390 395
400 Lys Asp Thr Asn Asn Leu Glu Asn Gln Ile Lys Glu Leu Glu Asn Thr
405 410 415 Ile Phe
Glu Lys Arg Lys Val Glu Tyr Asn Asn Asn Leu Glu Asn Ile 420
425 430 Asn Lys Asn Ile Glu Ala Thr
Lys Lys Arg Lys Glu Lys Ala Gln Gln 435 440
445 Glu Ile Gln Asp Leu Lys Glu Lys Ile Lys Lys Leu
Glu Lys Thr Asn 450 455 460
Thr Thr Thr Thr Thr Pro Leu Ala Leu Thr Ser Ser Ala Ile Leu Leu 465
470 475 480 Ser Ala Pro
Lys Asn Asp Lys Lys Lys Glu Pro Thr Leu Glu Glu Leu 485
490 495 Lys Lys Asp Leu Glu Lys Lys Glu
Lys Gln Ser Gln Gln Phe Asp Glu 500 505
510 Asn Val Lys Lys Tyr Glu Lys Asn Ile Glu Asp Leu Pro
Gln Lys Ser 515 520 525
Asn Asp Lys Lys Phe Leu Glu Phe His Ala Thr Asp Gln Tyr Asn Glu 530
535 540 Arg Leu Lys Glu
Ser Leu Asn Glu Ile Asn Lys Asp Gly 545 550
555 544377DNAArtificial
SequencepAA352-YP_004400127.1-YP_004399790.1 fusion DNA 54atggctactg
ttatagatct aagcttccca aaaactgggg caaaaaaaat tatcctctat 60attccccaaa
attaccaata tgatactgaa caaggtaatg gtttacagga tttagtcaaa 120gcggccgaag
agttggggat tgaggtacaa agagaagaac gcaataatat tgcaacagct 180caaaccagtt
taggcacgat tcaaaccgct attggcttaa ctgagcgtgg cattgtgtta 240tccgctccac
aaattgataa attgctacag aaaactaaag caggccaagc attaggttct 300gccgaaagca
ttgtacaaaa tgcaaataaa gccaaaactg tattatctgg cattcaatct 360attttaggct
cagtattggc tggaatggat ttagatgagg ccttacagaa taacagcaac 420caacatgctc
ttgctaaagc tggcttggag ctaacaaatt cattaattga aaatattgct 480aattcagtaa
aaacacttga cgaatttggt gagcaaatta gtcaatttgg ttcaaaacta 540caaaatatca
aaggcttagg gactttagga gacaaactca aaaatatcgg tggacttgat 600aaagctggcc
ttggtttaga tgttatctca gggctattat cgggcgcaac agctgcactt 660gtacttgcag
ataaaaatgc ttcaacagct aaaaaagtgg gtgcgggttt tgaattggca 720aaccaagttg
ttggtaatat taccaaagcc gtttcttctt acattttagc ccaacgtgtt 780gcagcaggtt
tatcttcaac tgggcctgtg gctgctttaa ttgcttctac tgtttctctt 840gcgattagcc
cattagcatt tgccggtatt gccgataaat ttaatcatgc aaaaagttta 900gagagttatg
ccgaacgctt taaaaaatta ggctatgacg gagataattt attagcagaa 960tatcagcggg
gaacagggac tattgatgca tcggttactg caattaatac cgcattggcc 1020gctattgctg
gtggtgtgtc tgctgctgca gccggctcgg ttattgcttc accgattgcc 1080ttattagtat
ctgggattac cggtgtaatt tctacgattc tgcaatattc taaacaagca 1140atgtttgagc
acgttgcaaa taaaattcat aacaaaattg tagaatggga aaaaaataat 1200cacggtaaga
actactttga aaatggttac gatgcccgtt atcttgcgaa tttacaagat 1260aatatgaaat
tcttactgaa cttaaacaaa gagttacagg cagaacgtgt catcgctatt 1320actcagcagc
aatgggataa caacattggt gatttagctg gtattagccg tttaggtgaa 1380aaagtcctta
gtggtaaagc ctatgtggat gcgtttgaag aaggcaaaca cattaaagcc 1440gataaattag
tacagttgga ttcggcaaac ggtattattg atgtgagtaa ttcgggtaaa 1500gcgaaaactc
agcatatctt attcagaacg ccattattga cgccgggaac agagcatcgt 1560gaacgcgtac
aaacaggtaa atatgaatat attaccaagc tcaatattaa ccgtgtagat 1620agctggaaaa
ttacagatgg tgcagcaagt tctacctttg atttaactaa cgttgttcag 1680cgtattggta
ttgaattaga caatgctgga aatgtaacta aaaccaaaga aacaaaaatt 1740attgccaaac
ttggtgaagg tgatgacaac gtatttgttg gttctggtac gacggaaatt 1800gatggcggtg
aaggttacga ccgagttcac tatagccgtg gaaactatgg tgctttaact 1860attgatgcaa
ccaaagagac cgagcaaggt agttataccg taaatcgttt cgtagaaacc 1920ggtaaagcac
tacacgaagt gacttcaacc cataccgcat tagtgggcaa ccgtgaagaa 1980aaaatagaat
atcgtcatag caataaccag caccatgccg gttattacac caaagatacc 2040ttgaaagctg
ttgaagaaat tatcggtaca tcacataacg atatctttaa aggtagtaag 2100ttcaatgatg
cctttaacgg tggtgatggt gtcgatacta ttgacggtaa cgacggcaat 2160gaccgcttat
ttggtggtaa aggcgatgat attctcgatg gtggaaatgg tgatgatttt 2220atcgatggcg
gtaaaggcaa cgacctatta cacggtggca agggcgatga tattttcgtt 2280caccgtaaag
gcgatggtaa tgatattatt accgattctg acggcaatga taaattatca 2340ttctctgatt
cgaacttaaa agatttaaca tttgaaaaag ttaaacataa tcttgtcatc 2400acgaatagca
aaaaagagaa agtgaccatt caaaactggt tccgagaggc tgattttgct 2460aaagaagtgc
ctaattataa agcaactaaa gatgagaaaa tcgaagaaat catcggtcaa 2520aatggcgagc
ggatcacctc aaagcaagtt gatgatctta tcgcaaaagg taacggcaaa 2580attacccaag
atgagctatc aaaagttgtt gataactatg aattgctcaa acatagcaaa 2640aatgtgacaa
acagcttaga taagttaatc tcatctgtaa gtgcatttac ctcgtctaat 2700gattcgagaa
atgtattagt ggctccaact tcaatgttgg atcaaagttt atcttctctt 2760caatttgcta
ggggatccat gaaaacggac aataccaacc aaaaaatcaa agaaaaagac 2820aacgaaacgg
gcagtaaaga caaagacaaa ccgaacaata acctgaatag ctctgaacag 2880gatctgccga
aagaccaacc gatcaccaag aaagaaaaag atgaaaaaac ggacagcttt 2940gcagataaac
tgaagaaaga tctgaagaaa attctggaca agaaagaaga tctgaaaatc 3000cgtgaataca
gtaccaaact gatctccaaa tacttccaga aaagttccga aaaacaactg 3060ctgaaagatt
ggttcgacct ggaaaagaaa attaaaaaat ggttcgacga aagcgaactg 3120aacgaaatta
agaaagaaat caccatcctg ttttccgaat cactggataa caattcaaac 3180aatcaggaat
cgcgcaaact gaaagatctg ctggacaaag ttaccaaaga taacaaagaa 3240ggcatcctgg
aagaagtcaa aaacctgttt ggtcagaaaa tctcaaaaga actggaagaa 3300aaactgaaat
cggaaaccga tggcatcaac aatctgctga gcaaaaaaca atacgaaacc 3360atcaaaacga
aactgttcga tattgtggac aaaacggccg aactggagaa aaacatcaaa 3420ggcggtggcg
gtggcggtat gaaaaaactg ctggcaatcc tgggcaccat ggctatttca 3480tcgacgggtg
cgagtctggt tattgcctgc gacaatccga ccaaaaacga ttccaaaaaa 3540ccggaaacga
aaccggaaac cccgacgaat tcgggtagca acgaaacctc gaatcagggc 3600agcaacgaag
gttctaacaa agaaaaagat aactctgaac cgagtaaacc gacgaaaccg 3660gtgaaaccgg
caagcggcac cgcttccctg gtttcaaaaa cggacattag cgcgtggagc 3720tctattttta
tggattctat caccggtgaa gatattcaag accattctgt ggaagaaaaa 3780gaaaaagcgg
acaaagccaa aaataaagaa ttcgtggaag ttctggatga aatcaacaaa 3840ctgaccccga
cgctggaaaa tgaactgaaa cagctggcac aaaaattcaa agaaatcaaa 3900gaaaaactgg
ctaaagaaaa agaactgaaa gaccagaaaa acaacaaaga attcgtcgaa 3960gtgctggacg
aaattaacaa actgagtgtc acctttgaaa aagaactgaa agccctgttc 4020aagaaaattg
gcgaaaacga actggaaaaa gaacgtctgt acaaagaatt caccacgagt 4080tcctcaaatg
cgaccaaata ttacttcgaa gccctggata ccaagaaaga agtgagcgaa 4140tggaactttg
aacgtggccg cctggtcgaa ctgatttcga gcatcgatcg ccaggtgaaa 4200gaactgaaat
ctagtggtaa agacatcaaa agcgttatcg ataccgtcaa atctaacctg 4260gaaaattaca
aaaacagtat caaagaacac aaaaattcca aagttttctg gaaatacgaa 4320atgtggacgc
actggctgga agatgttctg accaacctga aaaatcaaaa tcaataa
4377551458PRTArtificial SequenceLtkA-YP_004400127.1-YP_004399790.1 fusion
protein 55Met Ala Thr Val Ile Asp Leu Ser Phe Pro Lys Thr Gly Ala
Lys Lys 1 5 10 15
Ile Ile Leu Tyr Ile Pro Gln Asn Tyr Gln Tyr Asp Thr Glu Gln Gly
20 25 30 Asn Gly Leu Gln Asp
Leu Val Lys Ala Ala Glu Glu Leu Gly Ile Glu 35
40 45 Val Gln Arg Glu Glu Arg Asn Asn Ile
Ala Thr Ala Gln Thr Ser Leu 50 55
60 Gly Thr Ile Gln Thr Ala Ile Gly Leu Thr Glu Arg Gly
Ile Val Leu 65 70 75
80 Ser Ala Pro Gln Ile Asp Lys Leu Leu Gln Lys Thr Lys Ala Gly Gln
85 90 95 Ala Leu Gly Ser
Ala Glu Ser Ile Val Gln Asn Ala Asn Lys Ala Lys 100
105 110 Thr Val Leu Ser Gly Ile Gln Ser Ile
Leu Gly Ser Val Leu Ala Gly 115 120
125 Met Asp Leu Asp Glu Ala Leu Gln Asn Asn Ser Asn Gln His
Ala Leu 130 135 140
Ala Lys Ala Gly Leu Glu Leu Thr Asn Ser Leu Ile Glu Asn Ile Ala 145
150 155 160 Asn Ser Val Lys Thr
Leu Asp Glu Phe Gly Glu Gln Ile Ser Gln Phe 165
170 175 Gly Ser Lys Leu Gln Asn Ile Lys Gly Leu
Gly Thr Leu Gly Asp Lys 180 185
190 Leu Lys Asn Ile Gly Gly Leu Asp Lys Ala Gly Leu Gly Leu Asp
Val 195 200 205 Ile
Ser Gly Leu Leu Ser Gly Ala Thr Ala Ala Leu Val Leu Ala Asp 210
215 220 Lys Asn Ala Ser Thr Ala
Lys Lys Val Gly Ala Gly Phe Glu Leu Ala 225 230
235 240 Asn Gln Val Val Gly Asn Ile Thr Lys Ala Val
Ser Ser Tyr Ile Leu 245 250
255 Ala Gln Arg Val Ala Ala Gly Leu Ser Ser Thr Gly Pro Val Ala Ala
260 265 270 Leu Ile
Ala Ser Thr Val Ser Leu Ala Ile Ser Pro Leu Ala Phe Ala 275
280 285 Gly Ile Ala Asp Lys Phe Asn
His Ala Lys Ser Leu Glu Ser Tyr Ala 290 295
300 Glu Arg Phe Lys Lys Leu Gly Tyr Asp Gly Asp Asn
Leu Leu Ala Glu 305 310 315
320 Tyr Gln Arg Gly Thr Gly Thr Ile Asp Ala Ser Val Thr Ala Ile Asn
325 330 335 Thr Ala Leu
Ala Ala Ile Ala Gly Gly Val Ser Ala Ala Ala Ala Gly 340
345 350 Ser Val Ile Ala Ser Pro Ile Ala
Leu Leu Val Ser Gly Ile Thr Gly 355 360
365 Val Ile Ser Thr Ile Leu Gln Tyr Ser Lys Gln Ala Met
Phe Glu His 370 375 380
Val Ala Asn Lys Ile His Asn Lys Ile Val Glu Trp Glu Lys Asn Asn 385
390 395 400 His Gly Lys Asn
Tyr Phe Glu Asn Gly Tyr Asp Ala Arg Tyr Leu Ala 405
410 415 Asn Leu Gln Asp Asn Met Lys Phe Leu
Leu Asn Leu Asn Lys Glu Leu 420 425
430 Gln Ala Glu Arg Val Ile Ala Ile Thr Gln Gln Gln Trp Asp
Asn Asn 435 440 445
Ile Gly Asp Leu Ala Gly Ile Ser Arg Leu Gly Glu Lys Val Leu Ser 450
455 460 Gly Lys Ala Tyr Val
Asp Ala Phe Glu Glu Gly Lys His Ile Lys Ala 465 470
475 480 Asp Lys Leu Val Gln Leu Asp Ser Ala Asn
Gly Ile Ile Asp Val Ser 485 490
495 Asn Ser Gly Lys Ala Lys Thr Gln His Ile Leu Phe Arg Thr Pro
Leu 500 505 510 Leu
Thr Pro Gly Thr Glu His Arg Glu Arg Val Gln Thr Gly Lys Tyr 515
520 525 Glu Tyr Ile Thr Lys Leu
Asn Ile Asn Arg Val Asp Ser Trp Lys Ile 530 535
540 Thr Asp Gly Ala Ala Ser Ser Thr Phe Asp Leu
Thr Asn Val Val Gln 545 550 555
560 Arg Ile Gly Ile Glu Leu Asp Asn Ala Gly Asn Val Thr Lys Thr Lys
565 570 575 Glu Thr
Lys Ile Ile Ala Lys Leu Gly Glu Gly Asp Asp Asn Val Phe 580
585 590 Val Gly Ser Gly Thr Thr Glu
Ile Asp Gly Gly Glu Gly Tyr Asp Arg 595 600
605 Val His Tyr Ser Arg Gly Asn Tyr Gly Ala Leu Thr
Ile Asp Ala Thr 610 615 620
Lys Glu Thr Glu Gln Gly Ser Tyr Thr Val Asn Arg Phe Val Glu Thr 625
630 635 640 Gly Lys Ala
Leu His Glu Val Thr Ser Thr His Thr Ala Leu Val Gly 645
650 655 Asn Arg Glu Glu Lys Ile Glu Tyr
Arg His Ser Asn Asn Gln His His 660 665
670 Ala Gly Tyr Tyr Thr Lys Asp Thr Leu Lys Ala Val Glu
Glu Ile Ile 675 680 685
Gly Thr Ser His Asn Asp Ile Phe Lys Gly Ser Lys Phe Asn Asp Ala 690
695 700 Phe Asn Gly Gly
Asp Gly Val Asp Thr Ile Asp Gly Asn Asp Gly Asn 705 710
715 720 Asp Arg Leu Phe Gly Gly Lys Gly Asp
Asp Ile Leu Asp Gly Gly Asn 725 730
735 Gly Asp Asp Phe Ile Asp Gly Gly Lys Gly Asn Asp Leu Leu
His Gly 740 745 750
Gly Lys Gly Asp Asp Ile Phe Val His Arg Lys Gly Asp Gly Asn Asp
755 760 765 Ile Ile Thr Asp
Ser Asp Gly Asn Asp Lys Leu Ser Phe Ser Asp Ser 770
775 780 Asn Leu Lys Asp Leu Thr Phe Glu
Lys Val Lys His Asn Leu Val Ile 785 790
795 800 Thr Asn Ser Lys Lys Glu Lys Val Thr Ile Gln Asn
Trp Phe Arg Glu 805 810
815 Ala Asp Phe Ala Lys Glu Val Pro Asn Tyr Lys Ala Thr Lys Asp Glu
820 825 830 Lys Ile Glu
Glu Ile Ile Gly Gln Asn Gly Glu Arg Ile Thr Ser Lys 835
840 845 Gln Val Asp Asp Leu Ile Ala Lys
Gly Asn Gly Lys Ile Thr Gln Asp 850 855
860 Glu Leu Ser Lys Val Val Asp Asn Tyr Glu Leu Leu Lys
His Ser Lys 865 870 875
880 Asn Val Thr Asn Ser Leu Asp Lys Leu Ile Ser Ser Val Ser Ala Phe
885 890 895 Thr Ser Ser Asn
Asp Ser Arg Asn Val Leu Val Ala Pro Thr Ser Met 900
905 910 Leu Asp Gln Ser Leu Ser Ser Leu Gln
Phe Ala Arg Gly Ser Met Lys 915 920
925 Thr Asp Asn Thr Asn Gln Lys Ile Lys Glu Lys Asp Asn Glu
Thr Gly 930 935 940
Ser Lys Asp Lys Asp Lys Pro Asn Asn Asn Leu Asn Ser Ser Glu Gln 945
950 955 960 Asp Leu Pro Lys Asp
Gln Pro Ile Thr Lys Lys Glu Lys Asp Glu Lys 965
970 975 Thr Asp Ser Phe Ala Asp Lys Leu Lys Lys
Asp Leu Lys Lys Ile Leu 980 985
990 Asp Lys Lys Glu Asp Leu Lys Ile Arg Glu Tyr Ser Thr Lys
Leu Ile 995 1000 1005
Ser Lys Tyr Phe Gln Lys Ser Ser Glu Lys Gln Leu Leu Lys Asp 1010
1015 1020 Trp Phe Asp Leu Glu
Lys Lys Ile Lys Lys Trp Phe Asp Glu Ser 1025 1030
1035 Glu Leu Asn Glu Ile Lys Lys Glu Ile Thr
Ile Leu Phe Ser Glu 1040 1045 1050
Ser Leu Asp Asn Asn Ser Asn Asn Gln Glu Ser Arg Lys Leu Lys
1055 1060 1065 Asp Leu
Leu Asp Lys Val Thr Lys Asp Asn Lys Glu Gly Ile Leu 1070
1075 1080 Glu Glu Val Lys Asn Leu Phe
Gly Gln Lys Ile Ser Lys Glu Leu 1085 1090
1095 Glu Glu Lys Leu Lys Ser Glu Thr Asp Gly Ile Asn
Asn Leu Leu 1100 1105 1110
Ser Lys Lys Gln Tyr Glu Thr Ile Lys Thr Lys Leu Phe Asp Ile 1115
1120 1125 Val Asp Lys Thr Ala
Glu Leu Glu Lys Asn Ile Lys Gly Gly Gly 1130 1135
1140 Gly Gly Gly Met Lys Lys Leu Leu Ala Ile
Leu Gly Thr Met Ala 1145 1150 1155
Ile Ser Ser Thr Gly Ala Ser Leu Val Ile Ala Cys Asp Asn Pro
1160 1165 1170 Thr Lys
Asn Asp Ser Lys Lys Pro Glu Thr Lys Pro Glu Thr Pro 1175
1180 1185 Thr Asn Ser Gly Ser Asn Glu
Thr Ser Asn Gln Gly Ser Asn Glu 1190 1195
1200 Gly Ser Asn Lys Glu Lys Asp Asn Ser Glu Pro Ser
Lys Pro Thr 1205 1210 1215
Lys Pro Val Lys Pro Ala Ser Gly Thr Ala Ser Leu Val Ser Lys 1220
1225 1230 Thr Asp Ile Ser Ala
Trp Ser Ser Ile Phe Met Asp Ser Ile Thr 1235 1240
1245 Gly Glu Asp Ile Gln Asp His Ser Val Glu
Glu Lys Glu Lys Ala 1250 1255 1260
Asp Lys Ala Lys Asn Lys Glu Phe Val Glu Val Leu Asp Glu Ile
1265 1270 1275 Asn Lys
Leu Thr Pro Thr Leu Glu Asn Glu Leu Lys Gln Leu Ala 1280
1285 1290 Gln Lys Phe Lys Glu Ile Lys
Glu Lys Leu Ala Lys Glu Lys Glu 1295 1300
1305 Leu Lys Asp Gln Lys Asn Asn Lys Glu Phe Val Glu
Val Leu Asp 1310 1315 1320
Glu Ile Asn Lys Leu Ser Val Thr Phe Glu Lys Glu Leu Lys Ala 1325
1330 1335 Leu Phe Lys Lys Ile
Gly Glu Asn Glu Leu Glu Lys Glu Arg Leu 1340 1345
1350 Tyr Lys Glu Phe Thr Thr Ser Ser Ser Asn
Ala Thr Lys Tyr Tyr 1355 1360 1365
Phe Glu Ala Leu Asp Thr Lys Lys Glu Val Ser Glu Trp Asn Phe
1370 1375 1380 Glu Arg
Gly Arg Leu Val Glu Leu Ile Ser Ser Ile Asp Arg Gln 1385
1390 1395 Val Lys Glu Leu Lys Ser Ser
Gly Lys Asp Ile Lys Ser Val Ile 1400 1405
1410 Asp Thr Val Lys Ser Asn Leu Glu Asn Tyr Lys Asn
Ser Ile Lys 1415 1420 1425
Glu His Lys Asn Ser Lys Val Phe Trp Lys Tyr Glu Met Trp Thr 1430
1435 1440 His Trp Leu Glu Asp
Val Leu Thr Asn Leu Lys Asn Gln Asn Gln 1445 1450
1455 564417DNAArtificial
SequencepAA352-YP_004400610.1-YP_004400580.1 fusion DNA 56atggctactg
ttatagatct aagcttccca aaaactgggg caaaaaaaat tatcctctat 60attccccaaa
attaccaata tgatactgaa caaggtaatg gtttacagga tttagtcaaa 120gcggccgaag
agttggggat tgaggtacaa agagaagaac gcaataatat tgcaacagct 180caaaccagtt
taggcacgat tcaaaccgct attggcttaa ctgagcgtgg cattgtgtta 240tccgctccac
aaattgataa attgctacag aaaactaaag caggccaagc attaggttct 300gccgaaagca
ttgtacaaaa tgcaaataaa gccaaaactg tattatctgg cattcaatct 360attttaggct
cagtattggc tggaatggat ttagatgagg ccttacagaa taacagcaac 420caacatgctc
ttgctaaagc tggcttggag ctaacaaatt cattaattga aaatattgct 480aattcagtaa
aaacacttga cgaatttggt gagcaaatta gtcaatttgg ttcaaaacta 540caaaatatca
aaggcttagg gactttagga gacaaactca aaaatatcgg tggacttgat 600aaagctggcc
ttggtttaga tgttatctca gggctattat cgggcgcaac agctgcactt 660gtacttgcag
ataaaaatgc ttcaacagct aaaaaagtgg gtgcgggttt tgaattggca 720aaccaagttg
ttggtaatat taccaaagcc gtttcttctt acattttagc ccaacgtgtt 780gcagcaggtt
tatcttcaac tgggcctgtg gctgctttaa ttgcttctac tgtttctctt 840gcgattagcc
cattagcatt tgccggtatt gccgataaat ttaatcatgc aaaaagttta 900gagagttatg
ccgaacgctt taaaaaatta ggctatgacg gagataattt attagcagaa 960tatcagcggg
gaacagggac tattgatgca tcggttactg caattaatac cgcattggcc 1020gctattgctg
gtggtgtgtc tgctgctgca gccggctcgg ttattgcttc accgattgcc 1080ttattagtat
ctgggattac cggtgtaatt tctacgattc tgcaatattc taaacaagca 1140atgtttgagc
acgttgcaaa taaaattcat aacaaaattg tagaatggga aaaaaataat 1200cacggtaaga
actactttga aaatggttac gatgcccgtt atcttgcgaa tttacaagat 1260aatatgaaat
tcttactgaa cttaaacaaa gagttacagg cagaacgtgt catcgctatt 1320actcagcagc
aatgggataa caacattggt gatttagctg gtattagccg tttaggtgaa 1380aaagtcctta
gtggtaaagc ctatgtggat gcgtttgaag aaggcaaaca cattaaagcc 1440gataaattag
tacagttgga ttcggcaaac ggtattattg atgtgagtaa ttcgggtaaa 1500gcgaaaactc
agcatatctt attcagaacg ccattattga cgccgggaac agagcatcgt 1560gaacgcgtac
aaacaggtaa atatgaatat attaccaagc tcaatattaa ccgtgtagat 1620agctggaaaa
ttacagatgg tgcagcaagt tctacctttg atttaactaa cgttgttcag 1680cgtattggta
ttgaattaga caatgctgga aatgtaacta aaaccaaaga aacaaaaatt 1740attgccaaac
ttggtgaagg tgatgacaac gtatttgttg gttctggtac gacggaaatt 1800gatggcggtg
aaggttacga ccgagttcac tatagccgtg gaaactatgg tgctttaact 1860attgatgcaa
ccaaagagac cgagcaaggt agttataccg taaatcgttt cgtagaaacc 1920ggtaaagcac
tacacgaagt gacttcaacc cataccgcat tagtgggcaa ccgtgaagaa 1980aaaatagaat
atcgtcatag caataaccag caccatgccg gttattacac caaagatacc 2040ttgaaagctg
ttgaagaaat tatcggtaca tcacataacg atatctttaa aggtagtaag 2100ttcaatgatg
cctttaacgg tggtgatggt gtcgatacta ttgacggtaa cgacggcaat 2160gaccgcttat
ttggtggtaa aggcgatgat attctcgatg gtggaaatgg tgatgatttt 2220atcgatggcg
gtaaaggcaa cgacctatta cacggtggca agggcgatga tattttcgtt 2280caccgtaaag
gcgatggtaa tgatattatt accgattctg acggcaatga taaattatca 2340ttctctgatt
cgaacttaaa agatttaaca tttgaaaaag ttaaacataa tcttgtcatc 2400acgaatagca
aaaaagagaa agtgaccatt caaaactggt tccgagaggc tgattttgct 2460aaagaagtgc
ctaattataa agcaactaaa gatgagaaaa tcgaagaaat catcggtcaa 2520aatggcgagc
ggatcacctc aaagcaagtt gatgatctta tcgcaaaagg taacggcaaa 2580attacccaag
atgagctatc aaaagttgtt gataactatg aattgctcaa acatagcaaa 2640aatgtgacaa
acagcttaga taagttaatc tcatctgtaa gtgcatttac ctcgtctaat 2700gattcgagaa
atgtattagt ggctccaact tcaatgttgg atcaaagttt atcttctctt 2760caatttgcta
ggggatccat gggcgaccgt gccccgtccg caaaatccgc agaaaaagtg 2820gaaaataaag
aaaaaaccaa accgagtgaa gccccgaaga agggcgaaaa gagtgaagaa 2880aaggaaaacg
aaaaggataa agaactgaaa gccgtctttt ccaaagtgga aggccagaat 2940attggtaact
tccaaccgaa caacaaaaac atcgtctccc agggcgatat taagaaagaa 3000ctggcaaaca
aactgggcgt gtcagaatcg gacctgcaag gtctgaaact gaattatgat 3060gacaaaagcg
gcgaagtgac gctgccgaaa ttcaacaaca aaaacctgaa attcaaattc 3120accacgttct
accagctggg taaaatcaaa accagtaaaa tcgataacgt tctgtttctg 3180tcccaactgg
acattaagaa agaactggct aacaaactga aagtcaaaga atcagatctg 3240caggaactga
aaacggactc gaccaacggt atcggcgcgg gtagcgtgcg ttctaaaacc 3300ttcgttggta
ttctggaatt caaattcgaa atcgatgaaa acaaaggcgg tggcggtggc 3360agcatttcta
cgccgaaaat taacccgacc atcaacaaaa acgaaaacaa actgtacaaa 3420aacaaatacg
tctcagaact gctgaacctg tatctgagtg actccaaact gcgcgatagc 3480tacatcaatg
accaggaaaa cgtttcagat tcgaaattct ctgaactgaa atatggcctg 3540accttttacc
cgattttcat ccatcgttca ctggattatc atattggtca gcactaccgc 3600gtgattatcc
aaaaatcgaa aaatgcgctg gaacagacgc tgaaaaacga ttggtattgg 3660gttctggaca
acatcaccaa cttcaaatac aacttcaacc cgtatggcga tctgtacaac 3720gatttcgaca
aagatgaaaa cctgtttaac cagctggaaa aagacctggg tagtctgatc 3780agctctgtta
aaaacaaaaa cgtccaaaaa atcatcaaaa tcaacctgga tgaagtggtt 3840aacgaaaaaa
tcaaagatga ctacctgaag aaagaagcgc tgtacctgat cttcgataac 3900aacaaagcaa
tcaaaatctg gaaatacgaa aaccagaaca aaaccgaatt cctgatgacc 3960acggacctgt
ttatcttcaa agacacgaac aatctggaaa atcagattaa agaactggaa 4020aacaccatct
tcgaaaaacg taaagtggaa tacaacaaca acctggaaaa catcaacaaa 4080aacatcgaag
ctaccaaaaa acgcaaagaa aaagcgcagc aagaaatcca ggatctgaaa 4140gaaaaaatca
aaaaactgga aaaaacgaat accaccacca ccaccccgct ggccctgacc 4200agttccgcca
ttctgctgtc tgcaccgaaa aacgataaaa agaaagaacc gacgctggaa 4260gaactgaaga
aagatctgga aaagaaagaa aaacagagcc agcaatttga cgaaaacgtt 4320aaaaaatacg
agaaaaacat cgaagatctg ccgcagaaat ctaacgacaa aaaattcctg 4380gaattccacg
cgaccgatca atacaatgaa cgtctga
4417571483PRTArtificial SequenceLtkA-YP_004400610.1-YP_004400580.1 fusion
protein 57Met Ala Thr Val Ile Asp Leu Ser Phe Pro Lys Thr Gly Ala
Lys Lys 1 5 10 15
Ile Ile Leu Tyr Ile Pro Gln Asn Tyr Gln Tyr Asp Thr Glu Gln Gly
20 25 30 Asn Gly Leu Gln Asp
Leu Val Lys Ala Ala Glu Glu Leu Gly Ile Glu 35
40 45 Val Gln Arg Glu Glu Arg Asn Asn Ile
Ala Thr Ala Gln Thr Ser Leu 50 55
60 Gly Thr Ile Gln Thr Ala Ile Gly Leu Thr Glu Arg Gly
Ile Val Leu 65 70 75
80 Ser Ala Pro Gln Ile Asp Lys Leu Leu Gln Lys Thr Lys Ala Gly Gln
85 90 95 Ala Leu Gly Ser
Ala Glu Ser Ile Val Gln Asn Ala Asn Lys Ala Lys 100
105 110 Thr Val Leu Ser Gly Ile Gln Ser Ile
Leu Gly Ser Val Leu Ala Gly 115 120
125 Met Asp Leu Asp Glu Ala Leu Gln Asn Asn Ser Asn Gln His
Ala Leu 130 135 140
Ala Lys Ala Gly Leu Glu Leu Thr Asn Ser Leu Ile Glu Asn Ile Ala 145
150 155 160 Asn Ser Val Lys Thr
Leu Asp Glu Phe Gly Glu Gln Ile Ser Gln Phe 165
170 175 Gly Ser Lys Leu Gln Asn Ile Lys Gly Leu
Gly Thr Leu Gly Asp Lys 180 185
190 Leu Lys Asn Ile Gly Gly Leu Asp Lys Ala Gly Leu Gly Leu Asp
Val 195 200 205 Ile
Ser Gly Leu Leu Ser Gly Ala Thr Ala Ala Leu Val Leu Ala Asp 210
215 220 Lys Asn Ala Ser Thr Ala
Lys Lys Val Gly Ala Gly Phe Glu Leu Ala 225 230
235 240 Asn Gln Val Val Gly Asn Ile Thr Lys Ala Val
Ser Ser Tyr Ile Leu 245 250
255 Ala Gln Arg Val Ala Ala Gly Leu Ser Ser Thr Gly Pro Val Ala Ala
260 265 270 Leu Ile
Ala Ser Thr Val Ser Leu Ala Ile Ser Pro Leu Ala Phe Ala 275
280 285 Gly Ile Ala Asp Lys Phe Asn
His Ala Lys Ser Leu Glu Ser Tyr Ala 290 295
300 Glu Arg Phe Lys Lys Leu Gly Tyr Asp Gly Asp Asn
Leu Leu Ala Glu 305 310 315
320 Tyr Gln Arg Gly Thr Gly Thr Ile Asp Ala Ser Val Thr Ala Ile Asn
325 330 335 Thr Ala Leu
Ala Ala Ile Ala Gly Gly Val Ser Ala Ala Ala Ala Gly 340
345 350 Ser Val Ile Ala Ser Pro Ile Ala
Leu Leu Val Ser Gly Ile Thr Gly 355 360
365 Val Ile Ser Thr Ile Leu Gln Tyr Ser Lys Gln Ala Met
Phe Glu His 370 375 380
Val Ala Asn Lys Ile His Asn Lys Ile Val Glu Trp Glu Lys Asn Asn 385
390 395 400 His Gly Lys Asn
Tyr Phe Glu Asn Gly Tyr Asp Ala Arg Tyr Leu Ala 405
410 415 Asn Leu Gln Asp Asn Met Lys Phe Leu
Leu Asn Leu Asn Lys Glu Leu 420 425
430 Gln Ala Glu Arg Val Ile Ala Ile Thr Gln Gln Gln Trp Asp
Asn Asn 435 440 445
Ile Gly Asp Leu Ala Gly Ile Ser Arg Leu Gly Glu Lys Val Leu Ser 450
455 460 Gly Lys Ala Tyr Val
Asp Ala Phe Glu Glu Gly Lys His Ile Lys Ala 465 470
475 480 Asp Lys Leu Val Gln Leu Asp Ser Ala Asn
Gly Ile Ile Asp Val Ser 485 490
495 Asn Ser Gly Lys Ala Lys Thr Gln His Ile Leu Phe Arg Thr Pro
Leu 500 505 510 Leu
Thr Pro Gly Thr Glu His Arg Glu Arg Val Gln Thr Gly Lys Tyr 515
520 525 Glu Tyr Ile Thr Lys Leu
Asn Ile Asn Arg Val Asp Ser Trp Lys Ile 530 535
540 Thr Asp Gly Ala Ala Ser Ser Thr Phe Asp Leu
Thr Asn Val Val Gln 545 550 555
560 Arg Ile Gly Ile Glu Leu Asp Asn Ala Gly Asn Val Thr Lys Thr Lys
565 570 575 Glu Thr
Lys Ile Ile Ala Lys Leu Gly Glu Gly Asp Asp Asn Val Phe 580
585 590 Val Gly Ser Gly Thr Thr Glu
Ile Asp Gly Gly Glu Gly Tyr Asp Arg 595 600
605 Val His Tyr Ser Arg Gly Asn Tyr Gly Ala Leu Thr
Ile Asp Ala Thr 610 615 620
Lys Glu Thr Glu Gln Gly Ser Tyr Thr Val Asn Arg Phe Val Glu Thr 625
630 635 640 Gly Lys Ala
Leu His Glu Val Thr Ser Thr His Thr Ala Leu Val Gly 645
650 655 Asn Arg Glu Glu Lys Ile Glu Tyr
Arg His Ser Asn Asn Gln His His 660 665
670 Ala Gly Tyr Tyr Thr Lys Asp Thr Leu Lys Ala Val Glu
Glu Ile Ile 675 680 685
Gly Thr Ser His Asn Asp Ile Phe Lys Gly Ser Lys Phe Asn Asp Ala 690
695 700 Phe Asn Gly Gly
Asp Gly Val Asp Thr Ile Asp Gly Asn Asp Gly Asn 705 710
715 720 Asp Arg Leu Phe Gly Gly Lys Gly Asp
Asp Ile Leu Asp Gly Gly Asn 725 730
735 Gly Asp Asp Phe Ile Asp Gly Gly Lys Gly Asn Asp Leu Leu
His Gly 740 745 750
Gly Lys Gly Asp Asp Ile Phe Val His Arg Lys Gly Asp Gly Asn Asp
755 760 765 Ile Ile Thr Asp
Ser Asp Gly Asn Asp Lys Leu Ser Phe Ser Asp Ser 770
775 780 Asn Leu Lys Asp Leu Thr Phe Glu
Lys Val Lys His Asn Leu Val Ile 785 790
795 800 Thr Asn Ser Lys Lys Glu Lys Val Thr Ile Gln Asn
Trp Phe Arg Glu 805 810
815 Ala Asp Phe Ala Lys Glu Val Pro Asn Tyr Lys Ala Thr Lys Asp Glu
820 825 830 Lys Ile Glu
Glu Ile Ile Gly Gln Asn Gly Glu Arg Ile Thr Ser Lys 835
840 845 Gln Val Asp Asp Leu Ile Ala Lys
Gly Asn Gly Lys Ile Thr Gln Asp 850 855
860 Glu Leu Ser Lys Val Val Asp Asn Tyr Glu Leu Leu Lys
His Ser Lys 865 870 875
880 Asn Val Thr Asn Ser Leu Asp Lys Leu Ile Ser Ser Val Ser Ala Phe
885 890 895 Thr Ser Ser Asn
Asp Ser Arg Asn Val Leu Val Ala Pro Thr Ser Met 900
905 910 Leu Asp Gln Ser Leu Ser Ser Leu Gln
Phe Ala Arg Gly Ser Met Gly 915 920
925 Asp Arg Ala Pro Ser Ala Lys Ser Ala Glu Lys Val Glu Asn
Lys Glu 930 935 940
Lys Thr Lys Pro Ser Glu Ala Pro Lys Lys Gly Glu Lys Ser Glu Glu 945
950 955 960 Lys Glu Asn Glu Lys
Asp Lys Glu Leu Lys Ala Val Phe Ser Lys Val 965
970 975 Glu Gly Gln Asn Ile Gly Asn Phe Gln Pro
Asn Asn Lys Asn Ile Val 980 985
990 Ser Gln Gly Asp Ile Lys Lys Glu Leu Ala Asn Lys Leu Gly
Val Ser 995 1000 1005
Glu Ser Asp Leu Gln Gly Leu Lys Leu Asn Tyr Asp Asp Lys Ser 1010
1015 1020 Gly Glu Val Thr Leu
Pro Lys Phe Asn Asn Lys Asn Leu Lys Phe 1025 1030
1035 Lys Phe Thr Thr Phe Tyr Gln Leu Gly Lys
Ile Lys Thr Ser Lys 1040 1045 1050
Ile Asp Asn Val Leu Phe Leu Ser Gln Leu Asp Ile Lys Lys Glu
1055 1060 1065 Leu Ala
Asn Lys Leu Lys Val Lys Glu Ser Asp Leu Gln Glu Leu 1070
1075 1080 Lys Thr Asp Ser Thr Asn Gly
Ile Gly Ala Gly Ser Val Arg Ser 1085 1090
1095 Lys Thr Phe Val Gly Ile Leu Glu Phe Lys Phe Glu
Ile Asp Glu 1100 1105 1110
Asn Lys Gly Gly Gly Gly Gly Ser Ile Ser Thr Pro Lys Ile Asn 1115
1120 1125 Pro Thr Ile Asn Lys
Asn Glu Asn Lys Leu Tyr Lys Asn Lys Tyr 1130 1135
1140 Val Ser Glu Leu Leu Asn Leu Tyr Leu Ser
Asp Ser Lys Leu Arg 1145 1150 1155
Asp Ser Tyr Ile Asn Asp Gln Glu Asn Val Ser Asp Ser Lys Phe
1160 1165 1170 Ser Glu
Leu Lys Tyr Gly Leu Thr Phe Tyr Pro Ile Phe Ile His 1175
1180 1185 Arg Ser Leu Asp Tyr His Ile
Gly Gln His Tyr Arg Val Ile Ile 1190 1195
1200 Gln Lys Ser Lys Asn Ala Leu Glu Gln Thr Leu Lys
Asn Asp Trp 1205 1210 1215
Tyr Trp Val Leu Asp Asn Ile Thr Asn Phe Lys Tyr Asn Phe Asn 1220
1225 1230 Pro Tyr Gly Asp Leu
Tyr Asn Asp Phe Asp Lys Asp Glu Asn Leu 1235 1240
1245 Phe Asn Gln Leu Glu Lys Asp Leu Gly Ser
Leu Ile Ser Ser Val 1250 1255 1260
Lys Asn Lys Asn Val Gln Lys Ile Ile Lys Ile Asn Leu Asp Glu
1265 1270 1275 Val Val
Asn Glu Lys Ile Lys Asp Asp Tyr Leu Lys Lys Glu Ala 1280
1285 1290 Leu Tyr Leu Ile Phe Asp Asn
Asn Lys Ala Ile Lys Ile Trp Lys 1295 1300
1305 Tyr Glu Asn Gln Asn Lys Thr Glu Phe Leu Met Thr
Thr Asp Leu 1310 1315 1320
Phe Ile Phe Lys Asp Thr Asn Asn Leu Glu Asn Gln Ile Lys Glu 1325
1330 1335 Leu Glu Asn Thr Ile
Phe Glu Lys Arg Lys Val Glu Tyr Asn Asn 1340 1345
1350 Asn Leu Glu Asn Ile Asn Lys Asn Ile Glu
Ala Thr Lys Lys Arg 1355 1360 1365
Lys Glu Lys Ala Gln Gln Glu Ile Gln Asp Leu Lys Glu Lys Ile
1370 1375 1380 Lys Lys
Leu Glu Lys Thr Asn Thr Thr Thr Thr Thr Pro Leu Ala 1385
1390 1395 Leu Thr Ser Ser Ala Ile Leu
Leu Ser Ala Pro Lys Asn Asp Lys 1400 1405
1410 Lys Lys Glu Pro Thr Leu Glu Glu Leu Lys Lys Asp
Leu Glu Lys 1415 1420 1425
Lys Glu Lys Gln Ser Gln Gln Phe Asp Glu Asn Val Lys Lys Tyr 1430
1435 1440 Glu Lys Asn Ile Glu
Asp Leu Pro Gln Lys Ser Asn Asp Lys Lys 1445 1450
1455 Phe Leu Glu Phe His Ala Thr Asp Gln Tyr
Asn Glu Arg Leu Lys 1460 1465 1470
Glu Ser Leu Asn Glu Ile Asn Lys Asp Gly 1475
1480 583963DNAArtificial SequencepAA352-MSC_0160 fusion
DNA 58atggctactg ttatagatct aagcttccca aaaactgggg caaaaaaaat tatcctctat
60attccccaaa attaccaata tgatactgaa caaggtaatg gtttacagga tttagtcaaa
120gcggccgaag agttggggat tgaggtacaa agagaagaac gcaataatat tgcaacagct
180caaaccagtt taggcacgat tcaaaccgct attggcttaa ctgagcgtgg cattgtgtta
240tccgctccac aaattgataa attgctacag aaaactaaag caggccaagc attaggttct
300gccgaaagca ttgtacaaaa tgcaaataaa gccaaaactg tattatctgg cattcaatct
360attttaggct cagtattggc tggaatggat ttagatgagg ccttacagaa taacagcaac
420caacatgctc ttgctaaagc tggcttggag ctaacaaatt cattaattga aaatattgct
480aattcagtaa aaacacttga cgaatttggt gagcaaatta gtcaatttgg ttcaaaacta
540caaaatatca aaggcttagg gactttagga gacaaactca aaaatatcgg tggacttgat
600aaagctggcc ttggtttaga tgttatctca gggctattat cgggcgcaac agctgcactt
660gtacttgcag ataaaaatgc ttcaacagct aaaaaagtgg gtgcgggttt tgaattggca
720aaccaagttg ttggtaatat taccaaagcc gtttcttctt acattttagc ccaacgtgtt
780gcagcaggtt tatcttcaac tgggcctgtg gctgctttaa ttgcttctac tgtttctctt
840gcgattagcc cattagcatt tgccggtatt gccgataaat ttaatcatgc aaaaagttta
900gagagttatg ccgaacgctt taaaaaatta ggctatgacg gagataattt attagcagaa
960tatcagcggg gaacagggac tattgatgca tcggttactg caattaatac cgcattggcc
1020gctattgctg gtggtgtgtc tgctgctgca gccggctcgg ttattgcttc accgattgcc
1080ttattagtat ctgggattac cggtgtaatt tctacgattc tgcaatattc taaacaagca
1140atgtttgagc acgttgcaaa taaaattcat aacaaaattg tagaatggga aaaaaataat
1200cacggtaaga actactttga aaatggttac gatgcccgtt atcttgcgaa tttacaagat
1260aatatgaaat tcttactgaa cttaaacaaa gagttacagg cagaacgtgt catcgctatt
1320actcagcagc aatgggataa caacattggt gatttagctg gtattagccg tttaggtgaa
1380aaagtcctta gtggtaaagc ctatgtggat gcgtttgaag aaggcaaaca cattaaagcc
1440gataaattag tacagttgga ttcggcaaac ggtattattg atgtgagtaa ttcgggtaaa
1500gcgaaaactc agcatatctt attcagaacg ccattattga cgccgggaac agagcatcgt
1560gaacgcgtac aaacaggtaa atatgaatat attaccaagc tcaatattaa ccgtgtagat
1620agctggaaaa ttacagatgg tgcagcaagt tctacctttg atttaactaa cgttgttcag
1680cgtattggta ttgaattaga caatgctgga aatgtaacta aaaccaaaga aacaaaaatt
1740attgccaaac ttggtgaagg tgatgacaac gtatttgttg gttctggtac gacggaaatt
1800gatggcggtg aaggttacga ccgagttcac tatagccgtg gaaactatgg tgctttaact
1860attgatgcaa ccaaagagac cgagcaaggt agttataccg taaatcgttt cgtagaaacc
1920ggtaaagcac tacacgaagt gacttcaacc cataccgcat tagtgggcaa ccgtgaagaa
1980aaaatagaat atcgtcatag caataaccag caccatgccg gttattacac caaagatacc
2040ttgaaagctg ttgaagaaat tatcggtaca tcacataacg atatctttaa aggtagtaag
2100ttcaatgatg cctttaacgg tggtgatggt gtcgatacta ttgacggtaa cgacggcaat
2160gaccgcttat ttggtggtaa aggcgatgat attctcgatg gtggaaatgg tgatgatttt
2220atcgatggcg gtaaaggcaa cgacctatta cacggtggca agggcgatga tattttcgtt
2280caccgtaaag gcgatggtaa tgatattatt accgattctg acggcaatga taaattatca
2340ttctctgatt cgaacttaaa agatttaaca tttgaaaaag ttaaacataa tcttgtcatc
2400acgaatagca aaaaagagaa agtgaccatt caaaactggt tccgagaggc tgattttgct
2460aaagaagtgc ctaattataa agcaactaaa gatgagaaaa tcgaagaaat catcggtcaa
2520aatggcgagc ggatcacctc aaagcaagtt gatgatctta tcgcaaaagg taacggcaaa
2580attacccaag atgagctatc aaaagttgtt gataactatg aattgctcaa acatagcaaa
2640aatgtgacaa acagcttaga taagttaatc tcatctgtaa gtgcatttac ctcgtctaat
2700gattcgagaa atgtattagt ggctccaact tcaatgttgg atcaaagttt atcttctctt
2760caatttgcta ggggatccgc gaaagaacag tttgatcgta gcctgccgca tgtgaacatt
2820ggcaccatcg gtcatgttga ccacggcaaa accacgctga ccgcggccat tacgaaagtt
2880ctgtctgaac agggtaacgc agaattcaaa gattacgcaa acatcgacaa tgctccggaa
2940gaacgtgaac gcggcattac catcaacacg gcgcatgtgg aatataaaac cgcgaatcgc
3000cattacgccc acgtcgattg cccgggtcac gcagactacg tgaaaaacat gattacgggt
3060gcagctcaga tggatggcgc tatcctggtg gttgcagcaa ccgacggtcc gatgccgcag
3120acgcgtgaac acattctgct gtcccgccaa gtgggtgttc cgaaaatcgt cgtgtttctg
3180aacaaatgtg atatggttga agatgacgaa atgattgatc tggtggaaat ggaaatccgt
3240gacctgctga ccgaatatga tttcgacggc gaaggtgccc cggttattcg tggcagcgca
3300ctgggtgctc tgaacggtga ttctaaatgg accggcgcga ttaatgaact gatggcagct
3360gtggatgaat acatcccgac cccgcagcgt gatgccgaca aaacgtttct gatgccggtg
3420gaagatgttt tcaccatcac gggtcgtggt accgttgcaa cgggtcgtgt cgaacgcggc
3480accgtcaaag tgaacgaaga agttgaaatt atcggcctga aagaagaacc gaccaaaacg
3540gttgtcacgg gtctggaaat gtttcgtaaa ctgctggatt tcgcggtggc cggtgacaat
3600gttggtgcac tgctgcgtgg tgtcgatcgt cattcagtgg aacgcggtca ggttctggcc
3660aaaccgggca ccattaaacc gcacacggtc ctgaaagcgt cggtgtatgc cctgacccag
3720gaagaaggcg gtcgtcataa accgtttttc aacaaatatc gtccgcaatt ttacttccgc
3780accacggatg tcaccggtga agtgacgctg ccggaaggca ccgatatggt tatgccgggt
3840gacaatgtcg aaatggaaat tcaactgatc aaaccggttg cagtcgaaga aggtaccaaa
3900tttagtattc gtgaaggcgg tcgtaccatc ggtgctggta cggtgatttc catcgaaaaa
3960taa
3963591320PRTArtificial SequenceLtkA-MSC_0160 fusion protein 59Met Ala
Thr Val Ile Asp Leu Ser Phe Pro Lys Thr Gly Ala Lys Lys 1 5
10 15 Ile Ile Leu Tyr Ile Pro Gln
Asn Tyr Gln Tyr Asp Thr Glu Gln Gly 20 25
30 Asn Gly Leu Gln Asp Leu Val Lys Ala Ala Glu Glu
Leu Gly Ile Glu 35 40 45
Val Gln Arg Glu Glu Arg Asn Asn Ile Ala Thr Ala Gln Thr Ser Leu
50 55 60 Gly Thr Ile
Gln Thr Ala Ile Gly Leu Thr Glu Arg Gly Ile Val Leu 65
70 75 80 Ser Ala Pro Gln Ile Asp Lys
Leu Leu Gln Lys Thr Lys Ala Gly Gln 85
90 95 Ala Leu Gly Ser Ala Glu Ser Ile Val Gln Asn
Ala Asn Lys Ala Lys 100 105
110 Thr Val Leu Ser Gly Ile Gln Ser Ile Leu Gly Ser Val Leu Ala
Gly 115 120 125 Met
Asp Leu Asp Glu Ala Leu Gln Asn Asn Ser Asn Gln His Ala Leu 130
135 140 Ala Lys Ala Gly Leu Glu
Leu Thr Asn Ser Leu Ile Glu Asn Ile Ala 145 150
155 160 Asn Ser Val Lys Thr Leu Asp Glu Phe Gly Glu
Gln Ile Ser Gln Phe 165 170
175 Gly Ser Lys Leu Gln Asn Ile Lys Gly Leu Gly Thr Leu Gly Asp Lys
180 185 190 Leu Lys
Asn Ile Gly Gly Leu Asp Lys Ala Gly Leu Gly Leu Asp Val 195
200 205 Ile Ser Gly Leu Leu Ser Gly
Ala Thr Ala Ala Leu Val Leu Ala Asp 210 215
220 Lys Asn Ala Ser Thr Ala Lys Lys Val Gly Ala Gly
Phe Glu Leu Ala 225 230 235
240 Asn Gln Val Val Gly Asn Ile Thr Lys Ala Val Ser Ser Tyr Ile Leu
245 250 255 Ala Gln Arg
Val Ala Ala Gly Leu Ser Ser Thr Gly Pro Val Ala Ala 260
265 270 Leu Ile Ala Ser Thr Val Ser Leu
Ala Ile Ser Pro Leu Ala Phe Ala 275 280
285 Gly Ile Ala Asp Lys Phe Asn His Ala Lys Ser Leu Glu
Ser Tyr Ala 290 295 300
Glu Arg Phe Lys Lys Leu Gly Tyr Asp Gly Asp Asn Leu Leu Ala Glu 305
310 315 320 Tyr Gln Arg Gly
Thr Gly Thr Ile Asp Ala Ser Val Thr Ala Ile Asn 325
330 335 Thr Ala Leu Ala Ala Ile Ala Gly Gly
Val Ser Ala Ala Ala Ala Gly 340 345
350 Ser Val Ile Ala Ser Pro Ile Ala Leu Leu Val Ser Gly Ile
Thr Gly 355 360 365
Val Ile Ser Thr Ile Leu Gln Tyr Ser Lys Gln Ala Met Phe Glu His 370
375 380 Val Ala Asn Lys Ile
His Asn Lys Ile Val Glu Trp Glu Lys Asn Asn 385 390
395 400 His Gly Lys Asn Tyr Phe Glu Asn Gly Tyr
Asp Ala Arg Tyr Leu Ala 405 410
415 Asn Leu Gln Asp Asn Met Lys Phe Leu Leu Asn Leu Asn Lys Glu
Leu 420 425 430 Gln
Ala Glu Arg Val Ile Ala Ile Thr Gln Gln Gln Trp Asp Asn Asn 435
440 445 Ile Gly Asp Leu Ala Gly
Ile Ser Arg Leu Gly Glu Lys Val Leu Ser 450 455
460 Gly Lys Ala Tyr Val Asp Ala Phe Glu Glu Gly
Lys His Ile Lys Ala 465 470 475
480 Asp Lys Leu Val Gln Leu Asp Ser Ala Asn Gly Ile Ile Asp Val Ser
485 490 495 Asn Ser
Gly Lys Ala Lys Thr Gln His Ile Leu Phe Arg Thr Pro Leu 500
505 510 Leu Thr Pro Gly Thr Glu His
Arg Glu Arg Val Gln Thr Gly Lys Tyr 515 520
525 Glu Tyr Ile Thr Lys Leu Asn Ile Asn Arg Val Asp
Ser Trp Lys Ile 530 535 540
Thr Asp Gly Ala Ala Ser Ser Thr Phe Asp Leu Thr Asn Val Val Gln 545
550 555 560 Arg Ile Gly
Ile Glu Leu Asp Asn Ala Gly Asn Val Thr Lys Thr Lys 565
570 575 Glu Thr Lys Ile Ile Ala Lys Leu
Gly Glu Gly Asp Asp Asn Val Phe 580 585
590 Val Gly Ser Gly Thr Thr Glu Ile Asp Gly Gly Glu Gly
Tyr Asp Arg 595 600 605
Val His Tyr Ser Arg Gly Asn Tyr Gly Ala Leu Thr Ile Asp Ala Thr 610
615 620 Lys Glu Thr Glu
Gln Gly Ser Tyr Thr Val Asn Arg Phe Val Glu Thr 625 630
635 640 Gly Lys Ala Leu His Glu Val Thr Ser
Thr His Thr Ala Leu Val Gly 645 650
655 Asn Arg Glu Glu Lys Ile Glu Tyr Arg His Ser Asn Asn Gln
His His 660 665 670
Ala Gly Tyr Tyr Thr Lys Asp Thr Leu Lys Ala Val Glu Glu Ile Ile
675 680 685 Gly Thr Ser His
Asn Asp Ile Phe Lys Gly Ser Lys Phe Asn Asp Ala 690
695 700 Phe Asn Gly Gly Asp Gly Val Asp
Thr Ile Asp Gly Asn Asp Gly Asn 705 710
715 720 Asp Arg Leu Phe Gly Gly Lys Gly Asp Asp Ile Leu
Asp Gly Gly Asn 725 730
735 Gly Asp Asp Phe Ile Asp Gly Gly Lys Gly Asn Asp Leu Leu His Gly
740 745 750 Gly Lys Gly
Asp Asp Ile Phe Val His Arg Lys Gly Asp Gly Asn Asp 755
760 765 Ile Ile Thr Asp Ser Asp Gly Asn
Asp Lys Leu Ser Phe Ser Asp Ser 770 775
780 Asn Leu Lys Asp Leu Thr Phe Glu Lys Val Lys His Asn
Leu Val Ile 785 790 795
800 Thr Asn Ser Lys Lys Glu Lys Val Thr Ile Gln Asn Trp Phe Arg Glu
805 810 815 Ala Asp Phe Ala
Lys Glu Val Pro Asn Tyr Lys Ala Thr Lys Asp Glu 820
825 830 Lys Ile Glu Glu Ile Ile Gly Gln Asn
Gly Glu Arg Ile Thr Ser Lys 835 840
845 Gln Val Asp Asp Leu Ile Ala Lys Gly Asn Gly Lys Ile Thr
Gln Asp 850 855 860
Glu Leu Ser Lys Val Val Asp Asn Tyr Glu Leu Leu Lys His Ser Lys 865
870 875 880 Asn Val Thr Asn Ser
Leu Asp Lys Leu Ile Ser Ser Val Ser Ala Phe 885
890 895 Thr Ser Ser Asn Asp Ser Arg Asn Val Leu
Val Ala Pro Thr Ser Met 900 905
910 Leu Asp Gln Ser Leu Ser Ser Leu Gln Phe Ala Arg Gly Ser Ala
Lys 915 920 925 Glu
Gln Phe Asp Arg Ser Leu Pro His Val Asn Ile Gly Thr Ile Gly 930
935 940 His Val Asp His Gly Lys
Thr Thr Leu Thr Ala Ala Ile Thr Lys Val 945 950
955 960 Leu Ser Glu Gln Gly Asn Ala Glu Phe Lys Asp
Tyr Ala Asn Ile Asp 965 970
975 Asn Ala Pro Glu Glu Arg Glu Arg Gly Ile Thr Ile Asn Thr Ala His
980 985 990 Val Glu
Tyr Lys Thr Ala Asn Arg His Tyr Ala His Val Asp Cys Pro 995
1000 1005 Gly His Ala Asp Tyr
Val Lys Asn Met Ile Thr Gly Ala Ala Gln 1010 1015
1020 Met Asp Gly Ala Ile Leu Val Val Ala Ala
Thr Asp Gly Pro Met 1025 1030 1035
Pro Gln Thr Arg Glu His Ile Leu Leu Ser Arg Gln Val Gly Val
1040 1045 1050 Pro Lys
Ile Val Val Phe Leu Asn Lys Cys Asp Met Val Glu Asp 1055
1060 1065 Asp Glu Met Ile Asp Leu Val
Glu Met Glu Ile Arg Asp Leu Leu 1070 1075
1080 Thr Glu Tyr Asp Phe Asp Gly Glu Gly Ala Pro Val
Ile Arg Gly 1085 1090 1095
Ser Ala Leu Gly Ala Leu Asn Gly Asp Ser Lys Trp Thr Gly Ala 1100
1105 1110 Ile Asn Glu Leu Met
Ala Ala Val Asp Glu Tyr Ile Pro Thr Pro 1115 1120
1125 Gln Arg Asp Ala Asp Lys Thr Phe Leu Met
Pro Val Glu Asp Val 1130 1135 1140
Phe Thr Ile Thr Gly Arg Gly Thr Val Ala Thr Gly Arg Val Glu
1145 1150 1155 Arg Gly
Thr Val Lys Val Asn Glu Glu Val Glu Ile Ile Gly Leu 1160
1165 1170 Lys Glu Glu Pro Thr Lys Thr
Val Val Thr Gly Leu Glu Met Phe 1175 1180
1185 Arg Lys Leu Leu Asp Phe Ala Val Ala Gly Asp Asn
Val Gly Ala 1190 1195 1200
Leu Leu Arg Gly Val Asp Arg His Ser Val Glu Arg Gly Gln Val 1205
1210 1215 Leu Ala Lys Pro Gly
Thr Ile Lys Pro His Thr Val Leu Lys Ala 1220 1225
1230 Ser Val Tyr Ala Leu Thr Gln Glu Glu Gly
Gly Arg His Lys Pro 1235 1240 1245
Phe Phe Asn Lys Tyr Arg Pro Gln Phe Tyr Phe Arg Thr Thr Asp
1250 1255 1260 Val Thr
Gly Glu Val Thr Leu Pro Glu Gly Thr Asp Met Val Met 1265
1270 1275 Pro Gly Asp Asn Val Glu Met
Glu Ile Gln Leu Ile Lys Pro Val 1280 1285
1290 Ala Val Glu Glu Gly Thr Lys Phe Ser Ile Arg Glu
Gly Gly Arg 1295 1300 1305
Thr Ile Gly Ala Gly Thr Val Ile Ser Ile Glu Lys 1310
1315 1320 603675DNAArtificial SequencepAA352-MSC_0136
fusion DNA 60atggctactg ttatagatct aagcttccca aaaactgggg caaaaaaaat
tatcctctat 60attccccaaa attaccaata tgatactgaa caaggtaatg gtttacagga
tttagtcaaa 120gcggccgaag agttggggat tgaggtacaa agagaagaac gcaataatat
tgcaacagct 180caaaccagtt taggcacgat tcaaaccgct attggcttaa ctgagcgtgg
cattgtgtta 240tccgctccac aaattgataa attgctacag aaaactaaag caggccaagc
attaggttct 300gccgaaagca ttgtacaaaa tgcaaataaa gccaaaactg tattatctgg
cattcaatct 360attttaggct cagtattggc tggaatggat ttagatgagg ccttacagaa
taacagcaac 420caacatgctc ttgctaaagc tggcttggag ctaacaaatt cattaattga
aaatattgct 480aattcagtaa aaacacttga cgaatttggt gagcaaatta gtcaatttgg
ttcaaaacta 540caaaatatca aaggcttagg gactttagga gacaaactca aaaatatcgg
tggacttgat 600aaagctggcc ttggtttaga tgttatctca gggctattat cgggcgcaac
agctgcactt 660gtacttgcag ataaaaatgc ttcaacagct aaaaaagtgg gtgcgggttt
tgaattggca 720aaccaagttg ttggtaatat taccaaagcc gtttcttctt acattttagc
ccaacgtgtt 780gcagcaggtt tatcttcaac tgggcctgtg gctgctttaa ttgcttctac
tgtttctctt 840gcgattagcc cattagcatt tgccggtatt gccgataaat ttaatcatgc
aaaaagttta 900gagagttatg ccgaacgctt taaaaaatta ggctatgacg gagataattt
attagcagaa 960tatcagcggg gaacagggac tattgatgca tcggttactg caattaatac
cgcattggcc 1020gctattgctg gtggtgtgtc tgctgctgca gccggctcgg ttattgcttc
accgattgcc 1080ttattagtat ctgggattac cggtgtaatt tctacgattc tgcaatattc
taaacaagca 1140atgtttgagc acgttgcaaa taaaattcat aacaaaattg tagaatggga
aaaaaataat 1200cacggtaaga actactttga aaatggttac gatgcccgtt atcttgcgaa
tttacaagat 1260aatatgaaat tcttactgaa cttaaacaaa gagttacagg cagaacgtgt
catcgctatt 1320actcagcagc aatgggataa caacattggt gatttagctg gtattagccg
tttaggtgaa 1380aaagtcctta gtggtaaagc ctatgtggat gcgtttgaag aaggcaaaca
cattaaagcc 1440gataaattag tacagttgga ttcggcaaac ggtattattg atgtgagtaa
ttcgggtaaa 1500gcgaaaactc agcatatctt attcagaacg ccattattga cgccgggaac
agagcatcgt 1560gaacgcgtac aaacaggtaa atatgaatat attaccaagc tcaatattaa
ccgtgtagat 1620agctggaaaa ttacagatgg tgcagcaagt tctacctttg atttaactaa
cgttgttcag 1680cgtattggta ttgaattaga caatgctgga aatgtaacta aaaccaaaga
aacaaaaatt 1740attgccaaac ttggtgaagg tgatgacaac gtatttgttg gttctggtac
gacggaaatt 1800gatggcggtg aaggttacga ccgagttcac tatagccgtg gaaactatgg
tgctttaact 1860attgatgcaa ccaaagagac cgagcaaggt agttataccg taaatcgttt
cgtagaaacc 1920ggtaaagcac tacacgaagt gacttcaacc cataccgcat tagtgggcaa
ccgtgaagaa 1980aaaatagaat atcgtcatag caataaccag caccatgccg gttattacac
caaagatacc 2040ttgaaagctg ttgaagaaat tatcggtaca tcacataacg atatctttaa
aggtagtaag 2100ttcaatgatg cctttaacgg tggtgatggt gtcgatacta ttgacggtaa
cgacggcaat 2160gaccgcttat ttggtggtaa aggcgatgat attctcgatg gtggaaatgg
tgatgatttt 2220atcgatggcg gtaaaggcaa cgacctatta cacggtggca agggcgatga
tattttcgtt 2280caccgtaaag gcgatggtaa tgatattatt accgattctg acggcaatga
taaattatca 2340ttctctgatt cgaacttaaa agatttaaca tttgaaaaag ttaaacataa
tcttgtcatc 2400acgaatagca aaaaagagaa agtgaccatt caaaactggt tccgagaggc
tgattttgct 2460aaagaagtgc ctaattataa agcaactaaa gatgagaaaa tcgaagaaat
catcggtcaa 2520aatggcgagc ggatcacctc aaagcaagtt gatgatctta tcgcaaaagg
taacggcaaa 2580attacccaag atgagctatc aaaagttgtt gataactatg aattgctcaa
acatagcaaa 2640aatgtgacaa acagcttaga taagttaatc tcatctgtaa gtgcatttac
ctcgtctaat 2700gattcgagaa atgtattagt ggctccaact tcaatgttgg atcaaagttt
atcttctctt 2760caatttgcta ggggatccaa aaacgaaaac catttcaaca tcaactacaa
aatgaaaatg 2820gaaatgaaaa cccagaaaac ggaacaaccg cacaaatata aagaaggcga
tcgtaccgaa 2880attgtgcaga tcggctttta caaacgcggt aacgaaatca cgatcaaaca
aatcccgtac 2940tacgttaaaa aagtcccgga taaactgccg gacgaaatcc agtccctgta
tcgtgcattt 3000gctcatcgct acaaagatca aaaccacccg accgtcacgg gcttcgaaaa
atgggacacc 3060agcaaaatca aaaacatgtc ttatgtgttt tacgataacc agctgatcga
tgcggacctg 3120tcagaatgga aaacctcgaa tgttacgaac atggacggca tgttcaaaaa
cgccatcaaa 3180ttcaacaaca aagaaaaacc gctgaaatgg aacaccgaaa aagtcgaaag
tatggaatcc 3240atgtttgatg gcgcagaatc ttttaaacag aacctgaaag attggaaagt
ggacaaagtt 3300accaaaaaca aaaacttctc acgtgcttcg ggtattttcg aacatatcga
taaaaaaccg 3360tcatggaaaa tcaccgaaca caacgacccg attatcaaaa aaccggaatc
gacggaaccg 3420aaagtgatta tccatccgag cccgtctcgc ccgaaacaga ccattccgct
gacgaaactg 3480atcaatccga ttatcaaaag caccccgaac tctaatcaaa acctgggcat
cccgaaaacg 3540aacctgagca ccacgccgca gcaaagtaaa aaactgtcca ccccggcaat
tgttggcatc 3600gtggttggta gtcaggtcgt gctgacgtcc ctggcagcag gtattccgta
cctgatcaaa 3660cgtttcaaaa aataa
3675611224PRTArtificial SequenceLtkA-MSC_0136 fusion protein
61Met Ala Thr Val Ile Asp Leu Ser Phe Pro Lys Thr Gly Ala Lys Lys 1
5 10 15 Ile Ile Leu Tyr
Ile Pro Gln Asn Tyr Gln Tyr Asp Thr Glu Gln Gly 20
25 30 Asn Gly Leu Gln Asp Leu Val Lys Ala
Ala Glu Glu Leu Gly Ile Glu 35 40
45 Val Gln Arg Glu Glu Arg Asn Asn Ile Ala Thr Ala Gln Thr
Ser Leu 50 55 60
Gly Thr Ile Gln Thr Ala Ile Gly Leu Thr Glu Arg Gly Ile Val Leu 65
70 75 80 Ser Ala Pro Gln Ile
Asp Lys Leu Leu Gln Lys Thr Lys Ala Gly Gln 85
90 95 Ala Leu Gly Ser Ala Glu Ser Ile Val Gln
Asn Ala Asn Lys Ala Lys 100 105
110 Thr Val Leu Ser Gly Ile Gln Ser Ile Leu Gly Ser Val Leu Ala
Gly 115 120 125 Met
Asp Leu Asp Glu Ala Leu Gln Asn Asn Ser Asn Gln His Ala Leu 130
135 140 Ala Lys Ala Gly Leu Glu
Leu Thr Asn Ser Leu Ile Glu Asn Ile Ala 145 150
155 160 Asn Ser Val Lys Thr Leu Asp Glu Phe Gly Glu
Gln Ile Ser Gln Phe 165 170
175 Gly Ser Lys Leu Gln Asn Ile Lys Gly Leu Gly Thr Leu Gly Asp Lys
180 185 190 Leu Lys
Asn Ile Gly Gly Leu Asp Lys Ala Gly Leu Gly Leu Asp Val 195
200 205 Ile Ser Gly Leu Leu Ser Gly
Ala Thr Ala Ala Leu Val Leu Ala Asp 210 215
220 Lys Asn Ala Ser Thr Ala Lys Lys Val Gly Ala Gly
Phe Glu Leu Ala 225 230 235
240 Asn Gln Val Val Gly Asn Ile Thr Lys Ala Val Ser Ser Tyr Ile Leu
245 250 255 Ala Gln Arg
Val Ala Ala Gly Leu Ser Ser Thr Gly Pro Val Ala Ala 260
265 270 Leu Ile Ala Ser Thr Val Ser Leu
Ala Ile Ser Pro Leu Ala Phe Ala 275 280
285 Gly Ile Ala Asp Lys Phe Asn His Ala Lys Ser Leu Glu
Ser Tyr Ala 290 295 300
Glu Arg Phe Lys Lys Leu Gly Tyr Asp Gly Asp Asn Leu Leu Ala Glu 305
310 315 320 Tyr Gln Arg Gly
Thr Gly Thr Ile Asp Ala Ser Val Thr Ala Ile Asn 325
330 335 Thr Ala Leu Ala Ala Ile Ala Gly Gly
Val Ser Ala Ala Ala Ala Gly 340 345
350 Ser Val Ile Ala Ser Pro Ile Ala Leu Leu Val Ser Gly Ile
Thr Gly 355 360 365
Val Ile Ser Thr Ile Leu Gln Tyr Ser Lys Gln Ala Met Phe Glu His 370
375 380 Val Ala Asn Lys Ile
His Asn Lys Ile Val Glu Trp Glu Lys Asn Asn 385 390
395 400 His Gly Lys Asn Tyr Phe Glu Asn Gly Tyr
Asp Ala Arg Tyr Leu Ala 405 410
415 Asn Leu Gln Asp Asn Met Lys Phe Leu Leu Asn Leu Asn Lys Glu
Leu 420 425 430 Gln
Ala Glu Arg Val Ile Ala Ile Thr Gln Gln Gln Trp Asp Asn Asn 435
440 445 Ile Gly Asp Leu Ala Gly
Ile Ser Arg Leu Gly Glu Lys Val Leu Ser 450 455
460 Gly Lys Ala Tyr Val Asp Ala Phe Glu Glu Gly
Lys His Ile Lys Ala 465 470 475
480 Asp Lys Leu Val Gln Leu Asp Ser Ala Asn Gly Ile Ile Asp Val Ser
485 490 495 Asn Ser
Gly Lys Ala Lys Thr Gln His Ile Leu Phe Arg Thr Pro Leu 500
505 510 Leu Thr Pro Gly Thr Glu His
Arg Glu Arg Val Gln Thr Gly Lys Tyr 515 520
525 Glu Tyr Ile Thr Lys Leu Asn Ile Asn Arg Val Asp
Ser Trp Lys Ile 530 535 540
Thr Asp Gly Ala Ala Ser Ser Thr Phe Asp Leu Thr Asn Val Val Gln 545
550 555 560 Arg Ile Gly
Ile Glu Leu Asp Asn Ala Gly Asn Val Thr Lys Thr Lys 565
570 575 Glu Thr Lys Ile Ile Ala Lys Leu
Gly Glu Gly Asp Asp Asn Val Phe 580 585
590 Val Gly Ser Gly Thr Thr Glu Ile Asp Gly Gly Glu Gly
Tyr Asp Arg 595 600 605
Val His Tyr Ser Arg Gly Asn Tyr Gly Ala Leu Thr Ile Asp Ala Thr 610
615 620 Lys Glu Thr Glu
Gln Gly Ser Tyr Thr Val Asn Arg Phe Val Glu Thr 625 630
635 640 Gly Lys Ala Leu His Glu Val Thr Ser
Thr His Thr Ala Leu Val Gly 645 650
655 Asn Arg Glu Glu Lys Ile Glu Tyr Arg His Ser Asn Asn Gln
His His 660 665 670
Ala Gly Tyr Tyr Thr Lys Asp Thr Leu Lys Ala Val Glu Glu Ile Ile
675 680 685 Gly Thr Ser His
Asn Asp Ile Phe Lys Gly Ser Lys Phe Asn Asp Ala 690
695 700 Phe Asn Gly Gly Asp Gly Val Asp
Thr Ile Asp Gly Asn Asp Gly Asn 705 710
715 720 Asp Arg Leu Phe Gly Gly Lys Gly Asp Asp Ile Leu
Asp Gly Gly Asn 725 730
735 Gly Asp Asp Phe Ile Asp Gly Gly Lys Gly Asn Asp Leu Leu His Gly
740 745 750 Gly Lys Gly
Asp Asp Ile Phe Val His Arg Lys Gly Asp Gly Asn Asp 755
760 765 Ile Ile Thr Asp Ser Asp Gly Asn
Asp Lys Leu Ser Phe Ser Asp Ser 770 775
780 Asn Leu Lys Asp Leu Thr Phe Glu Lys Val Lys His Asn
Leu Val Ile 785 790 795
800 Thr Asn Ser Lys Lys Glu Lys Val Thr Ile Gln Asn Trp Phe Arg Glu
805 810 815 Ala Asp Phe Ala
Lys Glu Val Pro Asn Tyr Lys Ala Thr Lys Asp Glu 820
825 830 Lys Ile Glu Glu Ile Ile Gly Gln Asn
Gly Glu Arg Ile Thr Ser Lys 835 840
845 Gln Val Asp Asp Leu Ile Ala Lys Gly Asn Gly Lys Ile Thr
Gln Asp 850 855 860
Glu Leu Ser Lys Val Val Asp Asn Tyr Glu Leu Leu Lys His Ser Lys 865
870 875 880 Asn Val Thr Asn Ser
Leu Asp Lys Leu Ile Ser Ser Val Ser Ala Phe 885
890 895 Thr Ser Ser Asn Asp Ser Arg Asn Val Leu
Val Ala Pro Thr Ser Met 900 905
910 Leu Asp Gln Ser Leu Ser Ser Leu Gln Phe Ala Arg Gly Ser Lys
Asn 915 920 925 Glu
Asn His Phe Asn Ile Asn Tyr Lys Met Lys Met Glu Met Lys Thr 930
935 940 Gln Lys Thr Glu Gln Pro
His Lys Tyr Lys Glu Gly Asp Arg Thr Glu 945 950
955 960 Ile Val Gln Ile Gly Phe Tyr Lys Arg Gly Asn
Glu Ile Thr Ile Lys 965 970
975 Gln Ile Pro Tyr Tyr Val Lys Lys Val Pro Asp Lys Leu Pro Asp Glu
980 985 990 Ile Gln
Ser Leu Tyr Arg Ala Phe Ala His Arg Tyr Lys Asp Gln Asn 995
1000 1005 His Pro Thr Val Thr
Gly Phe Glu Lys Trp Asp Thr Ser Lys Ile 1010 1015
1020 Lys Asn Met Ser Tyr Val Phe Tyr Asp Asn
Gln Leu Ile Asp Ala 1025 1030 1035
Asp Leu Ser Glu Trp Lys Thr Ser Asn Val Thr Asn Met Asp Gly
1040 1045 1050 Met Phe
Lys Asn Ala Ile Lys Phe Asn Asn Lys Glu Lys Pro Leu 1055
1060 1065 Lys Trp Asn Thr Glu Lys Val
Glu Ser Met Glu Ser Met Phe Asp 1070 1075
1080 Gly Ala Glu Ser Phe Lys Gln Asn Leu Lys Asp Trp
Lys Val Asp 1085 1090 1095
Lys Val Thr Lys Asn Lys Asn Phe Ser Arg Ala Ser Gly Ile Phe 1100
1105 1110 Glu His Ile Asp Lys
Lys Pro Ser Trp Lys Ile Thr Glu His Asn 1115 1120
1125 Asp Pro Ile Ile Lys Lys Pro Glu Ser Thr
Glu Pro Lys Val Ile 1130 1135 1140
Ile His Pro Ser Pro Ser Arg Pro Lys Gln Thr Ile Pro Leu Thr
1145 1150 1155 Lys Leu
Ile Asn Pro Ile Ile Lys Ser Thr Pro Asn Ser Asn Gln 1160
1165 1170 Asn Leu Gly Ile Pro Lys Thr
Asn Leu Ser Thr Thr Pro Gln Gln 1175 1180
1185 Ser Lys Lys Leu Ser Thr Pro Ala Ile Val Gly Ile
Val Val Gly 1190 1195 1200
Ser Gln Val Val Leu Thr Ser Leu Ala Ala Gly Ile Pro Tyr Leu 1205
1210 1215 Ile Lys Arg Phe Lys
Lys 1220 623771DNAArtificial SequencepAA352-MSC_0431
fusion DNA 62atggctactg ttatagatct aagcttccca aaaactgggg caaaaaaaat
tatcctctat 60attccccaaa attaccaata tgatactgaa caaggtaatg gtttacagga
tttagtcaaa 120gcggccgaag agttggggat tgaggtacaa agagaagaac gcaataatat
tgcaacagct 180caaaccagtt taggcacgat tcaaaccgct attggcttaa ctgagcgtgg
cattgtgtta 240tccgctccac aaattgataa attgctacag aaaactaaag caggccaagc
attaggttct 300gccgaaagca ttgtacaaaa tgcaaataaa gccaaaactg tattatctgg
cattcaatct 360attttaggct cagtattggc tggaatggat ttagatgagg ccttacagaa
taacagcaac 420caacatgctc ttgctaaagc tggcttggag ctaacaaatt cattaattga
aaatattgct 480aattcagtaa aaacacttga cgaatttggt gagcaaatta gtcaatttgg
ttcaaaacta 540caaaatatca aaggcttagg gactttagga gacaaactca aaaatatcgg
tggacttgat 600aaagctggcc ttggtttaga tgttatctca gggctattat cgggcgcaac
agctgcactt 660gtacttgcag ataaaaatgc ttcaacagct aaaaaagtgg gtgcgggttt
tgaattggca 720aaccaagttg ttggtaatat taccaaagcc gtttcttctt acattttagc
ccaacgtgtt 780gcagcaggtt tatcttcaac tgggcctgtg gctgctttaa ttgcttctac
tgtttctctt 840gcgattagcc cattagcatt tgccggtatt gccgataaat ttaatcatgc
aaaaagttta 900gagagttatg ccgaacgctt taaaaaatta ggctatgacg gagataattt
attagcagaa 960tatcagcggg gaacagggac tattgatgca tcggttactg caattaatac
cgcattggcc 1020gctattgctg gtggtgtgtc tgctgctgca gccggctcgg ttattgcttc
accgattgcc 1080ttattagtat ctgggattac cggtgtaatt tctacgattc tgcaatattc
taaacaagca 1140atgtttgagc acgttgcaaa taaaattcat aacaaaattg tagaatggga
aaaaaataat 1200cacggtaaga actactttga aaatggttac gatgcccgtt atcttgcgaa
tttacaagat 1260aatatgaaat tcttactgaa cttaaacaaa gagttacagg cagaacgtgt
catcgctatt 1320actcagcagc aatgggataa caacattggt gatttagctg gtattagccg
tttaggtgaa 1380aaagtcctta gtggtaaagc ctatgtggat gcgtttgaag aaggcaaaca
cattaaagcc 1440gataaattag tacagttgga ttcggcaaac ggtattattg atgtgagtaa
ttcgggtaaa 1500gcgaaaactc agcatatctt attcagaacg ccattattga cgccgggaac
agagcatcgt 1560gaacgcgtac aaacaggtaa atatgaatat attaccaagc tcaatattaa
ccgtgtagat 1620agctggaaaa ttacagatgg tgcagcaagt tctacctttg atttaactaa
cgttgttcag 1680cgtattggta ttgaattaga caatgctgga aatgtaacta aaaccaaaga
aacaaaaatt 1740attgccaaac ttggtgaagg tgatgacaac gtatttgttg gttctggtac
gacggaaatt 1800gatggcggtg aaggttacga ccgagttcac tatagccgtg gaaactatgg
tgctttaact 1860attgatgcaa ccaaagagac cgagcaaggt agttataccg taaatcgttt
cgtagaaacc 1920ggtaaagcac tacacgaagt gacttcaacc cataccgcat tagtgggcaa
ccgtgaagaa 1980aaaatagaat atcgtcatag caataaccag caccatgccg gttattacac
caaagatacc 2040ttgaaagctg ttgaagaaat tatcggtaca tcacataacg atatctttaa
aggtagtaag 2100ttcaatgatg cctttaacgg tggtgatggt gtcgatacta ttgacggtaa
cgacggcaat 2160gaccgcttat ttggtggtaa aggcgatgat attctcgatg gtggaaatgg
tgatgatttt 2220atcgatggcg gtaaaggcaa cgacctatta cacggtggca agggcgatga
tattttcgtt 2280caccgtaaag gcgatggtaa tgatattatt accgattctg acggcaatga
taaattatca 2340ttctctgatt cgaacttaaa agatttaaca tttgaaaaag ttaaacataa
tcttgtcatc 2400acgaatagca aaaaagagaa agtgaccatt caaaactggt tccgagaggc
tgattttgct 2460aaagaagtgc ctaattataa agcaactaaa gatgagaaaa tcgaagaaat
catcggtcaa 2520aatggcgagc ggatcacctc aaagcaagtt gatgatctta tcgcaaaagg
taacggcaaa 2580attacccaag atgagctatc aaaagttgtt gataactatg aattgctcaa
acatagcaaa 2640aatgtgacaa acagcttaga taagttaatc tcatctgtaa gtgcatttac
ctcgtctaat 2700gattcgagaa atgtattagt ggctccaact tcaatgttgg atcaaagttt
atcttctctt 2760caatttgcta ggggatcctg cgcaaacatc gaaatgtcaa aaaacaaaaa
agataaagac 2820aaagatctga aatcggacaa aaacaaagat cagaacaaca aattcgacaa
aagcaaagat 2880aaaaaccaaa actctaaacc gaacaacaac gatcagaata gtaaatccaa
ccaagacaaa 2940acctcaccga aagataatcc gtcgacgcag tcagaatcgg aaaaacagga
aaactccaaa 3000caatatgacc tggataaact gatcacgaac aaattcatca gcatcgacgg
ctctggtacc 3060ggcgatggta aactggctaa actgccgcag aacctgcaag aatatctgga
tctgatcaaa 3120aaacagaacc cgaaattcac cctgacgctg aataacgtca gtttcaatgt
ggaagaaaat 3180gataactccg gctacaaaaa agtcagcgtg tctacgaagg gtaactctaa
aaacccggtt 3240atcgtctact tctacaaaga ccgtcatgat accgtttatg aaggcgagaa
aaaagaagtg 3300gttaaagaaa tcggttggag taaatccacc tacagtacgg acatcctgca
cttcgatgaa 3360cagacgaaag aagtcccgga aaacctgccg ccgtttatca ccagcctgga
aggcgcgttc 3420cgcaacaaca tccaagaaac catcaaaaac ctggacaaat gggatacgag
caacatcgaa 3480ttcatgaacg aaaccttcta cgaagcgaaa aattttaacc aggatatctc
tggttggaaa 3540accaataacg ttagtaacat ggattccatg ttttatggcg ccagctcttt
cgaccgtaat 3600ctgagcggtt ggaacgtgga taaagttatt acctacatcg aattcaacaa
agattcaaaa 3660atctcggaac gtaacaaacc gaaattcaaa gaactgaaac gcattcatca
gggccaaggt 3720gcaaccaaaa tcctgcacaa tcgcggcttt ctgaataaaa tgaacctgta a
3771631256PRTArtificial SequenceLtkA-MSC_0431 fusion protein
63Met Ala Thr Val Ile Asp Leu Ser Phe Pro Lys Thr Gly Ala Lys Lys 1
5 10 15 Ile Ile Leu Tyr
Ile Pro Gln Asn Tyr Gln Tyr Asp Thr Glu Gln Gly 20
25 30 Asn Gly Leu Gln Asp Leu Val Lys Ala
Ala Glu Glu Leu Gly Ile Glu 35 40
45 Val Gln Arg Glu Glu Arg Asn Asn Ile Ala Thr Ala Gln Thr
Ser Leu 50 55 60
Gly Thr Ile Gln Thr Ala Ile Gly Leu Thr Glu Arg Gly Ile Val Leu 65
70 75 80 Ser Ala Pro Gln Ile
Asp Lys Leu Leu Gln Lys Thr Lys Ala Gly Gln 85
90 95 Ala Leu Gly Ser Ala Glu Ser Ile Val Gln
Asn Ala Asn Lys Ala Lys 100 105
110 Thr Val Leu Ser Gly Ile Gln Ser Ile Leu Gly Ser Val Leu Ala
Gly 115 120 125 Met
Asp Leu Asp Glu Ala Leu Gln Asn Asn Ser Asn Gln His Ala Leu 130
135 140 Ala Lys Ala Gly Leu Glu
Leu Thr Asn Ser Leu Ile Glu Asn Ile Ala 145 150
155 160 Asn Ser Val Lys Thr Leu Asp Glu Phe Gly Glu
Gln Ile Ser Gln Phe 165 170
175 Gly Ser Lys Leu Gln Asn Ile Lys Gly Leu Gly Thr Leu Gly Asp Lys
180 185 190 Leu Lys
Asn Ile Gly Gly Leu Asp Lys Ala Gly Leu Gly Leu Asp Val 195
200 205 Ile Ser Gly Leu Leu Ser Gly
Ala Thr Ala Ala Leu Val Leu Ala Asp 210 215
220 Lys Asn Ala Ser Thr Ala Lys Lys Val Gly Ala Gly
Phe Glu Leu Ala 225 230 235
240 Asn Gln Val Val Gly Asn Ile Thr Lys Ala Val Ser Ser Tyr Ile Leu
245 250 255 Ala Gln Arg
Val Ala Ala Gly Leu Ser Ser Thr Gly Pro Val Ala Ala 260
265 270 Leu Ile Ala Ser Thr Val Ser Leu
Ala Ile Ser Pro Leu Ala Phe Ala 275 280
285 Gly Ile Ala Asp Lys Phe Asn His Ala Lys Ser Leu Glu
Ser Tyr Ala 290 295 300
Glu Arg Phe Lys Lys Leu Gly Tyr Asp Gly Asp Asn Leu Leu Ala Glu 305
310 315 320 Tyr Gln Arg Gly
Thr Gly Thr Ile Asp Ala Ser Val Thr Ala Ile Asn 325
330 335 Thr Ala Leu Ala Ala Ile Ala Gly Gly
Val Ser Ala Ala Ala Ala Gly 340 345
350 Ser Val Ile Ala Ser Pro Ile Ala Leu Leu Val Ser Gly Ile
Thr Gly 355 360 365
Val Ile Ser Thr Ile Leu Gln Tyr Ser Lys Gln Ala Met Phe Glu His 370
375 380 Val Ala Asn Lys Ile
His Asn Lys Ile Val Glu Trp Glu Lys Asn Asn 385 390
395 400 His Gly Lys Asn Tyr Phe Glu Asn Gly Tyr
Asp Ala Arg Tyr Leu Ala 405 410
415 Asn Leu Gln Asp Asn Met Lys Phe Leu Leu Asn Leu Asn Lys Glu
Leu 420 425 430 Gln
Ala Glu Arg Val Ile Ala Ile Thr Gln Gln Gln Trp Asp Asn Asn 435
440 445 Ile Gly Asp Leu Ala Gly
Ile Ser Arg Leu Gly Glu Lys Val Leu Ser 450 455
460 Gly Lys Ala Tyr Val Asp Ala Phe Glu Glu Gly
Lys His Ile Lys Ala 465 470 475
480 Asp Lys Leu Val Gln Leu Asp Ser Ala Asn Gly Ile Ile Asp Val Ser
485 490 495 Asn Ser
Gly Lys Ala Lys Thr Gln His Ile Leu Phe Arg Thr Pro Leu 500
505 510 Leu Thr Pro Gly Thr Glu His
Arg Glu Arg Val Gln Thr Gly Lys Tyr 515 520
525 Glu Tyr Ile Thr Lys Leu Asn Ile Asn Arg Val Asp
Ser Trp Lys Ile 530 535 540
Thr Asp Gly Ala Ala Ser Ser Thr Phe Asp Leu Thr Asn Val Val Gln 545
550 555 560 Arg Ile Gly
Ile Glu Leu Asp Asn Ala Gly Asn Val Thr Lys Thr Lys 565
570 575 Glu Thr Lys Ile Ile Ala Lys Leu
Gly Glu Gly Asp Asp Asn Val Phe 580 585
590 Val Gly Ser Gly Thr Thr Glu Ile Asp Gly Gly Glu Gly
Tyr Asp Arg 595 600 605
Val His Tyr Ser Arg Gly Asn Tyr Gly Ala Leu Thr Ile Asp Ala Thr 610
615 620 Lys Glu Thr Glu
Gln Gly Ser Tyr Thr Val Asn Arg Phe Val Glu Thr 625 630
635 640 Gly Lys Ala Leu His Glu Val Thr Ser
Thr His Thr Ala Leu Val Gly 645 650
655 Asn Arg Glu Glu Lys Ile Glu Tyr Arg His Ser Asn Asn Gln
His His 660 665 670
Ala Gly Tyr Tyr Thr Lys Asp Thr Leu Lys Ala Val Glu Glu Ile Ile
675 680 685 Gly Thr Ser His
Asn Asp Ile Phe Lys Gly Ser Lys Phe Asn Asp Ala 690
695 700 Phe Asn Gly Gly Asp Gly Val Asp
Thr Ile Asp Gly Asn Asp Gly Asn 705 710
715 720 Asp Arg Leu Phe Gly Gly Lys Gly Asp Asp Ile Leu
Asp Gly Gly Asn 725 730
735 Gly Asp Asp Phe Ile Asp Gly Gly Lys Gly Asn Asp Leu Leu His Gly
740 745 750 Gly Lys Gly
Asp Asp Ile Phe Val His Arg Lys Gly Asp Gly Asn Asp 755
760 765 Ile Ile Thr Asp Ser Asp Gly Asn
Asp Lys Leu Ser Phe Ser Asp Ser 770 775
780 Asn Leu Lys Asp Leu Thr Phe Glu Lys Val Lys His Asn
Leu Val Ile 785 790 795
800 Thr Asn Ser Lys Lys Glu Lys Val Thr Ile Gln Asn Trp Phe Arg Glu
805 810 815 Ala Asp Phe Ala
Lys Glu Val Pro Asn Tyr Lys Ala Thr Lys Asp Glu 820
825 830 Lys Ile Glu Glu Ile Ile Gly Gln Asn
Gly Glu Arg Ile Thr Ser Lys 835 840
845 Gln Val Asp Asp Leu Ile Ala Lys Gly Asn Gly Lys Ile Thr
Gln Asp 850 855 860
Glu Leu Ser Lys Val Val Asp Asn Tyr Glu Leu Leu Lys His Ser Lys 865
870 875 880 Asn Val Thr Asn Ser
Leu Asp Lys Leu Ile Ser Ser Val Ser Ala Phe 885
890 895 Thr Ser Ser Asn Asp Ser Arg Asn Val Leu
Val Ala Pro Thr Ser Met 900 905
910 Leu Asp Gln Ser Leu Ser Ser Leu Gln Phe Ala Arg Gly Ser Cys
Ala 915 920 925 Asn
Ile Glu Met Ser Lys Asn Lys Lys Asp Lys Asp Lys Asp Leu Lys 930
935 940 Ser Asp Lys Asn Lys Asp
Gln Asn Asn Lys Phe Asp Lys Ser Lys Asp 945 950
955 960 Lys Asn Gln Asn Ser Lys Pro Asn Asn Asn Asp
Gln Asn Ser Lys Ser 965 970
975 Asn Gln Asp Lys Thr Ser Pro Lys Asp Asn Pro Ser Thr Gln Ser Glu
980 985 990 Ser Glu
Lys Gln Glu Asn Ser Lys Gln Tyr Asp Leu Asp Lys Leu Ile 995
1000 1005 Thr Asn Lys Phe Ile
Ser Ile Asp Gly Ser Gly Thr Gly Asp Gly 1010 1015
1020 Lys Leu Ala Lys Leu Pro Gln Asn Leu Gln
Glu Tyr Leu Asp Leu 1025 1030 1035
Ile Lys Lys Gln Asn Pro Lys Phe Thr Leu Thr Leu Asn Asn Val
1040 1045 1050 Ser Phe
Asn Val Glu Glu Asn Asp Asn Ser Gly Tyr Lys Lys Val 1055
1060 1065 Ser Val Ser Thr Lys Gly Asn
Ser Lys Asn Pro Val Ile Val Tyr 1070 1075
1080 Phe Tyr Lys Asp Arg His Asp Thr Val Tyr Glu Gly
Glu Lys Lys 1085 1090 1095
Glu Val Val Lys Glu Ile Gly Trp Ser Lys Ser Thr Tyr Ser Thr 1100
1105 1110 Asp Ile Leu His Phe
Asp Glu Gln Thr Lys Glu Val Pro Glu Asn 1115 1120
1125 Leu Pro Pro Phe Ile Thr Ser Leu Glu Gly
Ala Phe Arg Asn Asn 1130 1135 1140
Ile Gln Glu Thr Ile Lys Asn Leu Asp Lys Trp Asp Thr Ser Asn
1145 1150 1155 Ile Glu
Phe Met Asn Glu Thr Phe Tyr Glu Ala Lys Asn Phe Asn 1160
1165 1170 Gln Asp Ile Ser Gly Trp Lys
Thr Asn Asn Val Ser Asn Met Asp 1175 1180
1185 Ser Met Phe Tyr Gly Ala Ser Ser Phe Asp Arg Asn
Leu Ser Gly 1190 1195 1200
Trp Asn Val Asp Lys Val Ile Thr Tyr Ile Glu Phe Asn Lys Asp 1205
1210 1215 Ser Lys Ile Ser Glu
Arg Asn Lys Pro Lys Phe Lys Glu Leu Lys 1220 1225
1230 Arg Ile His Gln Gly Gln Gly Ala Thr Lys
Ile Leu His Asn Arg 1235 1240 1245
Gly Phe Leu Asn Lys Met Asn Leu 1250 1255
644863DNAArtificial SequencepAA352-MSC_0499 fusion DNA 64atggctactg
ttatagatct aagcttccca aaaactgggg caaaaaaaat tatcctctat 60attccccaaa
attaccaata tgatactgaa caaggtaatg gtttacagga tttagtcaaa 120gcggccgaag
agttggggat tgaggtacaa agagaagaac gcaataatat tgcaacagct 180caaaccagtt
taggcacgat tcaaaccgct attggcttaa ctgagcgtgg cattgtgtta 240tccgctccac
aaattgataa attgctacag aaaactaaag caggccaagc attaggttct 300gccgaaagca
ttgtacaaaa tgcaaataaa gccaaaactg tattatctgg cattcaatct 360attttaggct
cagtattggc tggaatggat ttagatgagg ccttacagaa taacagcaac 420caacatgctc
ttgctaaagc tggcttggag ctaacaaatt cattaattga aaatattgct 480aattcagtaa
aaacacttga cgaatttggt gagcaaatta gtcaatttgg ttcaaaacta 540caaaatatca
aaggcttagg gactttagga gacaaactca aaaatatcgg tggacttgat 600aaagctggcc
ttggtttaga tgttatctca gggctattat cgggcgcaac agctgcactt 660gtacttgcag
ataaaaatgc ttcaacagct aaaaaagtgg gtgcgggttt tgaattggca 720aaccaagttg
ttggtaatat taccaaagcc gtttcttctt acattttagc ccaacgtgtt 780gcagcaggtt
tatcttcaac tgggcctgtg gctgctttaa ttgcttctac tgtttctctt 840gcgattagcc
cattagcatt tgccggtatt gccgataaat ttaatcatgc aaaaagttta 900gagagttatg
ccgaacgctt taaaaaatta ggctatgacg gagataattt attagcagaa 960tatcagcggg
gaacagggac tattgatgca tcggttactg caattaatac cgcattggcc 1020gctattgctg
gtggtgtgtc tgctgctgca gccggctcgg ttattgcttc accgattgcc 1080ttattagtat
ctgggattac cggtgtaatt tctacgattc tgcaatattc taaacaagca 1140atgtttgagc
acgttgcaaa taaaattcat aacaaaattg tagaatggga aaaaaataat 1200cacggtaaga
actactttga aaatggttac gatgcccgtt atcttgcgaa tttacaagat 1260aatatgaaat
tcttactgaa cttaaacaaa gagttacagg cagaacgtgt catcgctatt 1320actcagcagc
aatgggataa caacattggt gatttagctg gtattagccg tttaggtgaa 1380aaagtcctta
gtggtaaagc ctatgtggat gcgtttgaag aaggcaaaca cattaaagcc 1440gataaattag
tacagttgga ttcggcaaac ggtattattg atgtgagtaa ttcgggtaaa 1500gcgaaaactc
agcatatctt attcagaacg ccattattga cgccgggaac agagcatcgt 1560gaacgcgtac
aaacaggtaa atatgaatat attaccaagc tcaatattaa ccgtgtagat 1620agctggaaaa
ttacagatgg tgcagcaagt tctacctttg atttaactaa cgttgttcag 1680cgtattggta
ttgaattaga caatgctgga aatgtaacta aaaccaaaga aacaaaaatt 1740attgccaaac
ttggtgaagg tgatgacaac gtatttgttg gttctggtac gacggaaatt 1800gatggcggtg
aaggttacga ccgagttcac tatagccgtg gaaactatgg tgctttaact 1860attgatgcaa
ccaaagagac cgagcaaggt agttataccg taaatcgttt cgtagaaacc 1920ggtaaagcac
tacacgaagt gacttcaacc cataccgcat tagtgggcaa ccgtgaagaa 1980aaaatagaat
atcgtcatag caataaccag caccatgccg gttattacac caaagatacc 2040ttgaaagctg
ttgaagaaat tatcggtaca tcacataacg atatctttaa aggtagtaag 2100ttcaatgatg
cctttaacgg tggtgatggt gtcgatacta ttgacggtaa cgacggcaat 2160gaccgcttat
ttggtggtaa aggcgatgat attctcgatg gtggaaatgg tgatgatttt 2220atcgatggcg
gtaaaggcaa cgacctatta cacggtggca agggcgatga tattttcgtt 2280caccgtaaag
gcgatggtaa tgatattatt accgattctg acggcaatga taaattatca 2340ttctctgatt
cgaacttaaa agatttaaca tttgaaaaag ttaaacataa tcttgtcatc 2400acgaatagca
aaaaagagaa agtgaccatt caaaactggt tccgagaggc tgattttgct 2460aaagaagtgc
ctaattataa agcaactaaa gatgagaaaa tcgaagaaat catcggtcaa 2520aatggcgagc
ggatcacctc aaagcaagtt gatgatctta tcgcaaaagg taacggcaaa 2580attacccaag
atgagctatc aaaagttgtt gataactatg aattgctcaa acatagcaaa 2640aatgtgacaa
acagcttaga taagttaatc tcatctgtaa gtgcatttac ctcgtctaat 2700gattcgagaa
atgtattagt ggctccaact tcaatgttgg atcaaagttt atcttctctt 2760caatttgcta
ggggatcctg caccacgaaa aacgataaat tcaacaaacc gttcatcacc 2820gacgaactgg
cgcagaaaat tatctcaggt ctgaaactgt cggatgactt taatttcacc 2880acgggcgaac
gtttcagtaa actggattac aaatccctga ttctggacat gatcaacgaa 2940atcatctcca
aaaacaaata caccgataac tggaacaacc tgagcaaaaa atttggtctg 3000gaaattgaac
aggcgaaaga attcggcaac aaaaaagccg aaaacgttct gaaaaacctg 3060agcaccatca
aactgttcgc agattatacg tctaaacgcg cttttgaaga agatttcgac 3120agtgtggatc
tgagttattc cgaaaattac ccgctgaatc cgtataacct ggaaagcaaa 3180aacggtcaga
aagataaaac cgtttacgcg atctactaca aaaacaacaa cggcggtagc 3240tctagtggtt
cctcatcgaa tggcggtggc accaacggtg aagcaacgtg gctgcgttgg 3300cagaccacgg
gtgaatttga taatattgac aacccgatcc cgtcaacccc gcaactgccg 3360aatatctcgc
tgctgaccga tacgagctct aaaaacttcc gcattgccaa actgtccaaa 3420ccgaaagatc
aggaatatat caccaatacg gcaagtgtta aagaagacgg taaagctacc 3480aataacggca
ataacgaatt tgtcgaatgg tacaaaaaca gttccgacaa attcgaaacc 3540gatggtcagg
gcatcatgca ataccgtttc atgtaccatt tcaaaacgaa aatcgaagcg 3600aaactgttta
atgatctgct gggtcacgcc tatattgaca gcaacctgtt cgtggataaa 3660aacgacaaca
aatcagcatc gaacaagaaa attatcctga acaacgtcag taaactgatt 3720tccgatatcc
agagcaatta ttctcaagtg gacaaaacca ttagtaacgt gaaaatggtt 3780tgggcattta
gcctggataa acagaaagtc tctgaagtga acggtgctat caatcaatat 3840gtcaacccgg
atggcagcct gaccaatgaa gacaacaaga aaaccctgaa aaacgtgttc 3900gataaaatca
aatacaaagc gaccaacgaa tcaaaacagg gtacggattc gctgctgagc 3960atttctggtt
tcaacggctt cgttaaaaac aaagataaca acatcgaaag tctgtccggc 4020gacctgaaac
tgaccgaaga agcgaaaaaa gcggtcgccc gcgtgaatgt tccgtctctg 4080ctgacgaata
acaataacgg ctttgccagt gaaaactcca ataacgtgga ttatgtcttt 4140gtgctgccga
tttacctgaa tgacctgttt agctcgaacg acatgcagat caaacgtgaa 4200accgaaagct
ctggtggcgc cggttcaaat ggctcgaact atgaactgaa tgttctggaa 4260aacacctggg
tcaacctgaa tgacaaattt agcctggata atcgctactt cgacaacctg 4320acgatcaaaa
aagtggaatc tcaaaataac ggtgaagcac tggtggctaa caacaacgat 4380aaatggtacg
ttagcctgaa aaacggcaat gacaacaaaa aagttgaagt cacctacagc 4440gatgacagca
agaaaattat cacgctgaaa aaagttgata aaaacaacat caaaaccctg 4500gacttcacgt
acaaactgtc acagtcggat ttcaacaaac agctgttcaa acaaaacccg 4560accgcaaaca
tcacgtatga tatcaacctg aaaaactacg ataacatcaa agacaaacag 4620aacgatgctt
atatctggaa aaacgatccg aaaaaatcta acgatatcca agacctgtcc 4680gcggccaaaa
aacaggtgct gctggatcaa ctggaagcga tcaccgccaa aaatccggac 4740gttcagaacg
cagctaaaac cgaactgtat tcggcatatc tgtacacgga tggtatctac 4800tacaaatcac
tgttcgacga aatcagcaaa tacatcgaat ctgaaaaacc gaccctggat 4860taa
4863651620PRTArtificial SequenceLtkA-MSC_0499 fusion protein 65Met Ala
Thr Val Ile Asp Leu Ser Phe Pro Lys Thr Gly Ala Lys Lys 1 5
10 15 Ile Ile Leu Tyr Ile Pro Gln
Asn Tyr Gln Tyr Asp Thr Glu Gln Gly 20 25
30 Asn Gly Leu Gln Asp Leu Val Lys Ala Ala Glu Glu
Leu Gly Ile Glu 35 40 45
Val Gln Arg Glu Glu Arg Asn Asn Ile Ala Thr Ala Gln Thr Ser Leu
50 55 60 Gly Thr Ile
Gln Thr Ala Ile Gly Leu Thr Glu Arg Gly Ile Val Leu 65
70 75 80 Ser Ala Pro Gln Ile Asp Lys
Leu Leu Gln Lys Thr Lys Ala Gly Gln 85
90 95 Ala Leu Gly Ser Ala Glu Ser Ile Val Gln Asn
Ala Asn Lys Ala Lys 100 105
110 Thr Val Leu Ser Gly Ile Gln Ser Ile Leu Gly Ser Val Leu Ala
Gly 115 120 125 Met
Asp Leu Asp Glu Ala Leu Gln Asn Asn Ser Asn Gln His Ala Leu 130
135 140 Ala Lys Ala Gly Leu Glu
Leu Thr Asn Ser Leu Ile Glu Asn Ile Ala 145 150
155 160 Asn Ser Val Lys Thr Leu Asp Glu Phe Gly Glu
Gln Ile Ser Gln Phe 165 170
175 Gly Ser Lys Leu Gln Asn Ile Lys Gly Leu Gly Thr Leu Gly Asp Lys
180 185 190 Leu Lys
Asn Ile Gly Gly Leu Asp Lys Ala Gly Leu Gly Leu Asp Val 195
200 205 Ile Ser Gly Leu Leu Ser Gly
Ala Thr Ala Ala Leu Val Leu Ala Asp 210 215
220 Lys Asn Ala Ser Thr Ala Lys Lys Val Gly Ala Gly
Phe Glu Leu Ala 225 230 235
240 Asn Gln Val Val Gly Asn Ile Thr Lys Ala Val Ser Ser Tyr Ile Leu
245 250 255 Ala Gln Arg
Val Ala Ala Gly Leu Ser Ser Thr Gly Pro Val Ala Ala 260
265 270 Leu Ile Ala Ser Thr Val Ser Leu
Ala Ile Ser Pro Leu Ala Phe Ala 275 280
285 Gly Ile Ala Asp Lys Phe Asn His Ala Lys Ser Leu Glu
Ser Tyr Ala 290 295 300
Glu Arg Phe Lys Lys Leu Gly Tyr Asp Gly Asp Asn Leu Leu Ala Glu 305
310 315 320 Tyr Gln Arg Gly
Thr Gly Thr Ile Asp Ala Ser Val Thr Ala Ile Asn 325
330 335 Thr Ala Leu Ala Ala Ile Ala Gly Gly
Val Ser Ala Ala Ala Ala Gly 340 345
350 Ser Val Ile Ala Ser Pro Ile Ala Leu Leu Val Ser Gly Ile
Thr Gly 355 360 365
Val Ile Ser Thr Ile Leu Gln Tyr Ser Lys Gln Ala Met Phe Glu His 370
375 380 Val Ala Asn Lys Ile
His Asn Lys Ile Val Glu Trp Glu Lys Asn Asn 385 390
395 400 His Gly Lys Asn Tyr Phe Glu Asn Gly Tyr
Asp Ala Arg Tyr Leu Ala 405 410
415 Asn Leu Gln Asp Asn Met Lys Phe Leu Leu Asn Leu Asn Lys Glu
Leu 420 425 430 Gln
Ala Glu Arg Val Ile Ala Ile Thr Gln Gln Gln Trp Asp Asn Asn 435
440 445 Ile Gly Asp Leu Ala Gly
Ile Ser Arg Leu Gly Glu Lys Val Leu Ser 450 455
460 Gly Lys Ala Tyr Val Asp Ala Phe Glu Glu Gly
Lys His Ile Lys Ala 465 470 475
480 Asp Lys Leu Val Gln Leu Asp Ser Ala Asn Gly Ile Ile Asp Val Ser
485 490 495 Asn Ser
Gly Lys Ala Lys Thr Gln His Ile Leu Phe Arg Thr Pro Leu 500
505 510 Leu Thr Pro Gly Thr Glu His
Arg Glu Arg Val Gln Thr Gly Lys Tyr 515 520
525 Glu Tyr Ile Thr Lys Leu Asn Ile Asn Arg Val Asp
Ser Trp Lys Ile 530 535 540
Thr Asp Gly Ala Ala Ser Ser Thr Phe Asp Leu Thr Asn Val Val Gln 545
550 555 560 Arg Ile Gly
Ile Glu Leu Asp Asn Ala Gly Asn Val Thr Lys Thr Lys 565
570 575 Glu Thr Lys Ile Ile Ala Lys Leu
Gly Glu Gly Asp Asp Asn Val Phe 580 585
590 Val Gly Ser Gly Thr Thr Glu Ile Asp Gly Gly Glu Gly
Tyr Asp Arg 595 600 605
Val His Tyr Ser Arg Gly Asn Tyr Gly Ala Leu Thr Ile Asp Ala Thr 610
615 620 Lys Glu Thr Glu
Gln Gly Ser Tyr Thr Val Asn Arg Phe Val Glu Thr 625 630
635 640 Gly Lys Ala Leu His Glu Val Thr Ser
Thr His Thr Ala Leu Val Gly 645 650
655 Asn Arg Glu Glu Lys Ile Glu Tyr Arg His Ser Asn Asn Gln
His His 660 665 670
Ala Gly Tyr Tyr Thr Lys Asp Thr Leu Lys Ala Val Glu Glu Ile Ile
675 680 685 Gly Thr Ser His
Asn Asp Ile Phe Lys Gly Ser Lys Phe Asn Asp Ala 690
695 700 Phe Asn Gly Gly Asp Gly Val Asp
Thr Ile Asp Gly Asn Asp Gly Asn 705 710
715 720 Asp Arg Leu Phe Gly Gly Lys Gly Asp Asp Ile Leu
Asp Gly Gly Asn 725 730
735 Gly Asp Asp Phe Ile Asp Gly Gly Lys Gly Asn Asp Leu Leu His Gly
740 745 750 Gly Lys Gly
Asp Asp Ile Phe Val His Arg Lys Gly Asp Gly Asn Asp 755
760 765 Ile Ile Thr Asp Ser Asp Gly Asn
Asp Lys Leu Ser Phe Ser Asp Ser 770 775
780 Asn Leu Lys Asp Leu Thr Phe Glu Lys Val Lys His Asn
Leu Val Ile 785 790 795
800 Thr Asn Ser Lys Lys Glu Lys Val Thr Ile Gln Asn Trp Phe Arg Glu
805 810 815 Ala Asp Phe Ala
Lys Glu Val Pro Asn Tyr Lys Ala Thr Lys Asp Glu 820
825 830 Lys Ile Glu Glu Ile Ile Gly Gln Asn
Gly Glu Arg Ile Thr Ser Lys 835 840
845 Gln Val Asp Asp Leu Ile Ala Lys Gly Asn Gly Lys Ile Thr
Gln Asp 850 855 860
Glu Leu Ser Lys Val Val Asp Asn Tyr Glu Leu Leu Lys His Ser Lys 865
870 875 880 Asn Val Thr Asn Ser
Leu Asp Lys Leu Ile Ser Ser Val Ser Ala Phe 885
890 895 Thr Ser Ser Asn Asp Ser Arg Asn Val Leu
Val Ala Pro Thr Ser Met 900 905
910 Leu Asp Gln Ser Leu Ser Ser Leu Gln Phe Ala Arg Gly Ser Cys
Thr 915 920 925 Thr
Lys Asn Asp Lys Phe Asn Lys Pro Phe Ile Thr Asp Glu Leu Ala 930
935 940 Gln Lys Ile Ile Ser Gly
Leu Lys Leu Ser Asp Asp Phe Asn Phe Thr 945 950
955 960 Thr Gly Glu Arg Phe Ser Lys Leu Asp Tyr Lys
Ser Leu Ile Leu Asp 965 970
975 Met Ile Asn Glu Ile Ile Ser Lys Asn Lys Tyr Thr Asp Asn Trp Asn
980 985 990 Asn Leu
Ser Lys Lys Phe Gly Leu Glu Ile Glu Gln Ala Lys Glu Phe 995
1000 1005 Gly Asn Lys Lys Ala
Glu Asn Val Leu Lys Asn Leu Ser Thr Ile 1010 1015
1020 Lys Leu Phe Ala Asp Tyr Thr Ser Lys Arg
Ala Phe Glu Glu Asp 1025 1030 1035
Phe Asp Ser Val Asp Leu Ser Tyr Ser Glu Asn Tyr Pro Leu Asn
1040 1045 1050 Pro Tyr
Asn Leu Glu Ser Lys Asn Gly Gln Lys Asp Lys Thr Val 1055
1060 1065 Tyr Ala Ile Tyr Tyr Lys Asn
Asn Asn Gly Gly Ser Ser Ser Gly 1070 1075
1080 Ser Ser Ser Asn Gly Gly Gly Thr Asn Gly Glu Ala
Thr Trp Leu 1085 1090 1095
Arg Trp Gln Thr Thr Gly Glu Phe Asp Asn Ile Asp Asn Pro Ile 1100
1105 1110 Pro Ser Thr Pro Gln
Leu Pro Asn Ile Ser Leu Leu Thr Asp Thr 1115 1120
1125 Ser Ser Lys Asn Phe Arg Ile Ala Lys Leu
Ser Lys Pro Lys Asp 1130 1135 1140
Gln Glu Tyr Ile Thr Asn Thr Ala Ser Val Lys Glu Asp Gly Lys
1145 1150 1155 Ala Thr
Asn Asn Gly Asn Asn Glu Phe Val Glu Trp Tyr Lys Asn 1160
1165 1170 Ser Ser Asp Lys Phe Glu Thr
Asp Gly Gln Gly Ile Met Gln Tyr 1175 1180
1185 Arg Phe Met Tyr His Phe Lys Thr Lys Ile Glu Ala
Lys Leu Phe 1190 1195 1200
Asn Asp Leu Leu Gly His Ala Tyr Ile Asp Ser Asn Leu Phe Val 1205
1210 1215 Asp Lys Asn Asp Asn
Lys Ser Ala Ser Asn Lys Lys Ile Ile Leu 1220 1225
1230 Asn Asn Val Ser Lys Leu Ile Ser Asp Ile
Gln Ser Asn Tyr Ser 1235 1240 1245
Gln Val Asp Lys Thr Ile Ser Asn Val Lys Met Val Trp Ala Phe
1250 1255 1260 Ser Leu
Asp Lys Gln Lys Val Ser Glu Val Asn Gly Ala Ile Asn 1265
1270 1275 Gln Tyr Val Asn Pro Asp Gly
Ser Leu Thr Asn Glu Asp Asn Lys 1280 1285
1290 Lys Thr Leu Lys Asn Val Phe Asp Lys Ile Lys Tyr
Lys Ala Thr 1295 1300 1305
Asn Glu Ser Lys Gln Gly Thr Asp Ser Leu Leu Ser Ile Ser Gly 1310
1315 1320 Phe Asn Gly Phe Val
Lys Asn Lys Asp Asn Asn Ile Glu Ser Leu 1325 1330
1335 Ser Gly Asp Leu Lys Leu Thr Glu Glu Ala
Lys Lys Ala Val Ala 1340 1345 1350
Arg Val Asn Val Pro Ser Leu Leu Thr Asn Asn Asn Asn Gly Phe
1355 1360 1365 Ala Ser
Glu Asn Ser Asn Asn Val Asp Tyr Val Phe Val Leu Pro 1370
1375 1380 Ile Tyr Leu Asn Asp Leu Phe
Ser Ser Asn Asp Met Gln Ile Lys 1385 1390
1395 Arg Glu Thr Glu Ser Ser Gly Gly Ala Gly Ser Asn
Gly Ser Asn 1400 1405 1410
Tyr Glu Leu Asn Val Leu Glu Asn Thr Trp Val Asn Leu Asn Asp 1415
1420 1425 Lys Phe Ser Leu Asp
Asn Arg Tyr Phe Asp Asn Leu Thr Ile Lys 1430 1435
1440 Lys Val Glu Ser Gln Asn Asn Gly Glu Ala
Leu Val Ala Asn Asn 1445 1450 1455
Asn Asp Lys Trp Tyr Val Ser Leu Lys Asn Gly Asn Asp Asn Lys
1460 1465 1470 Lys Val
Glu Val Thr Tyr Ser Asp Asp Ser Lys Lys Ile Ile Thr 1475
1480 1485 Leu Lys Lys Val Asp Lys Asn
Asn Ile Lys Thr Leu Asp Phe Thr 1490 1495
1500 Tyr Lys Leu Ser Gln Ser Asp Phe Asn Lys Gln Leu
Phe Lys Gln 1505 1510 1515
Asn Pro Thr Ala Asn Ile Thr Tyr Asp Ile Asn Leu Lys Asn Tyr 1520
1525 1530 Asp Asn Ile Lys Asp
Lys Gln Asn Asp Ala Tyr Ile Trp Lys Asn 1535 1540
1545 Asp Pro Lys Lys Ser Asn Asp Ile Gln Asp
Leu Ser Ala Ala Lys 1550 1555 1560
Lys Gln Val Leu Leu Asp Gln Leu Glu Ala Ile Thr Ala Lys Asn
1565 1570 1575 Pro Asp
Val Gln Asn Ala Ala Lys Thr Glu Leu Tyr Ser Ala Tyr 1580
1585 1590 Leu Tyr Thr Asp Gly Ile Tyr
Tyr Lys Ser Leu Phe Asp Glu Ile 1595 1600
1605 Ser Lys Tyr Ile Glu Ser Glu Lys Pro Thr Leu Asp
1610 1615 1620 664827DNAArtificial
SequencepAA352-MSC_0775 fusion DNA 66atggctactg ttatagatct aagcttccca
aaaactgggg caaaaaaaat tatcctctat 60attccccaaa attaccaata tgatactgaa
caaggtaatg gtttacagga tttagtcaaa 120gcggccgaag agttggggat tgaggtacaa
agagaagaac gcaataatat tgcaacagct 180caaaccagtt taggcacgat tcaaaccgct
attggcttaa ctgagcgtgg cattgtgtta 240tccgctccac aaattgataa attgctacag
aaaactaaag caggccaagc attaggttct 300gccgaaagca ttgtacaaaa tgcaaataaa
gccaaaactg tattatctgg cattcaatct 360attttaggct cagtattggc tggaatggat
ttagatgagg ccttacagaa taacagcaac 420caacatgctc ttgctaaagc tggcttggag
ctaacaaatt cattaattga aaatattgct 480aattcagtaa aaacacttga cgaatttggt
gagcaaatta gtcaatttgg ttcaaaacta 540caaaatatca aaggcttagg gactttagga
gacaaactca aaaatatcgg tggacttgat 600aaagctggcc ttggtttaga tgttatctca
gggctattat cgggcgcaac agctgcactt 660gtacttgcag ataaaaatgc ttcaacagct
aaaaaagtgg gtgcgggttt tgaattggca 720aaccaagttg ttggtaatat taccaaagcc
gtttcttctt acattttagc ccaacgtgtt 780gcagcaggtt tatcttcaac tgggcctgtg
gctgctttaa ttgcttctac tgtttctctt 840gcgattagcc cattagcatt tgccggtatt
gccgataaat ttaatcatgc aaaaagttta 900gagagttatg ccgaacgctt taaaaaatta
ggctatgacg gagataattt attagcagaa 960tatcagcggg gaacagggac tattgatgca
tcggttactg caattaatac cgcattggcc 1020gctattgctg gtggtgtgtc tgctgctgca
gccggctcgg ttattgcttc accgattgcc 1080ttattagtat ctgggattac cggtgtaatt
tctacgattc tgcaatattc taaacaagca 1140atgtttgagc acgttgcaaa taaaattcat
aacaaaattg tagaatggga aaaaaataat 1200cacggtaaga actactttga aaatggttac
gatgcccgtt atcttgcgaa tttacaagat 1260aatatgaaat tcttactgaa cttaaacaaa
gagttacagg cagaacgtgt catcgctatt 1320actcagcagc aatgggataa caacattggt
gatttagctg gtattagccg tttaggtgaa 1380aaagtcctta gtggtaaagc ctatgtggat
gcgtttgaag aaggcaaaca cattaaagcc 1440gataaattag tacagttgga ttcggcaaac
ggtattattg atgtgagtaa ttcgggtaaa 1500gcgaaaactc agcatatctt attcagaacg
ccattattga cgccgggaac agagcatcgt 1560gaacgcgtac aaacaggtaa atatgaatat
attaccaagc tcaatattaa ccgtgtagat 1620agctggaaaa ttacagatgg tgcagcaagt
tctacctttg atttaactaa cgttgttcag 1680cgtattggta ttgaattaga caatgctgga
aatgtaacta aaaccaaaga aacaaaaatt 1740attgccaaac ttggtgaagg tgatgacaac
gtatttgttg gttctggtac gacggaaatt 1800gatggcggtg aaggttacga ccgagttcac
tatagccgtg gaaactatgg tgctttaact 1860attgatgcaa ccaaagagac cgagcaaggt
agttataccg taaatcgttt cgtagaaacc 1920ggtaaagcac tacacgaagt gacttcaacc
cataccgcat tagtgggcaa ccgtgaagaa 1980aaaatagaat atcgtcatag caataaccag
caccatgccg gttattacac caaagatacc 2040ttgaaagctg ttgaagaaat tatcggtaca
tcacataacg atatctttaa aggtagtaag 2100ttcaatgatg cctttaacgg tggtgatggt
gtcgatacta ttgacggtaa cgacggcaat 2160gaccgcttat ttggtggtaa aggcgatgat
attctcgatg gtggaaatgg tgatgatttt 2220atcgatggcg gtaaaggcaa cgacctatta
cacggtggca agggcgatga tattttcgtt 2280caccgtaaag gcgatggtaa tgatattatt
accgattctg acggcaatga taaattatca 2340ttctctgatt cgaacttaaa agatttaaca
tttgaaaaag ttaaacataa tcttgtcatc 2400acgaatagca aaaaagagaa agtgaccatt
caaaactggt tccgagaggc tgattttgct 2460aaagaagtgc ctaattataa agcaactaaa
gatgagaaaa tcgaagaaat catcggtcaa 2520aatggcgagc ggatcacctc aaagcaagtt
gatgatctta tcgcaaaagg taacggcaaa 2580attacccaag atgagctatc aaaagttgtt
gataactatg aattgctcaa acatagcaaa 2640aatgtgacaa acagcttaga taagttaatc
tcatctgtaa gtgcatttac ctcgtctaat 2700gattcgagaa atgtattagt ggctccaact
tcaatgttgg atcaaagttt atcttctctt 2760caatttgcta ggggatccca aacggaaaaa
gacaaacaag aatttgaaaa ctataatcag 2820attaacatgc tgagcgaaat caatcaatac
ttcaccaaac atgatcacaa caaagacctg 2880gtgaaattta ccacggatgg cgcgtccggt
gacaccgttg aattcaacaa catcatgaaa 2940aacaactatg cctcaaaata catcaaattc
gatcaggaca aattcaaaga aatcatcaaa 3000aaagaattca atctgtcaga ttcgttcctg
aaacgtctgg aattcgaagt cgactacaac 3060aacatctcgc gcgattacgg caacaatttt
gacgttattt tcccgatccg tgttaaactg 3120ccgctggtca gccataacaa tttcaaatat
cagcaaggcc tgtttattga acagaccttt 3180aaattccgca tcaaaaacgt caaagcgagc
ggttctgaaa aaatcgatgt gtctaaaatc 3240aaagacatct acaacgaact ggtgaaactg
aaagataaaa acaacttcac ggccagtgtg 3300aaaaccgtta cggaagaaac caaaaaactg
gttgatgaat ggggtattca tgaactgaac 3360agcacgcaac tgagctctat cttcgatatc
aaaaccgaag aattcgataa cctgatcaaa 3420gacaaaaaag aagtggaaca caaagttacc
atcacggatg tggacctgag tgatccgtcc 3480ctggcgatta acgaaggcct gctgaaactg
cgtctgggcg ttaaaatcaa gggtaaagaa 3540accgaaacgg gtgtcaacgt gtggatcaaa
ttcaacttcg atcagaaaga caccttttgg 3600aaagaactga aaatcagtga atccatcaaa
gtcaacacgg tgaaattcag tgaaaccaat 3660acggatttta ccaaactgat gaacgacaac
ctgatcatca aatcaaaatc gaaattcatc 3720aaaaacatca aactgagttc catcgataaa
accacggact atcgtaattc cggcgtcctg 3780ctggaagtgc tgaccaacga atcaaaagat
aacgtgatca aactgcataa aaaaccgggc 3840gttggtaaat ataccgatct gtactccgca
gacttcacga aaaacaatat ccacgcgccg 3900aattttgcca ccgaaaaact gacgcaggaa
aacctgaaat ctatcaacaa agatttcttt 3960cgccaatttg actcagaact gttctcgggc
ggttatgctc gttcacgcgg cttctactcg 4020gaaaaagtga aaagcccgaa attcatgcat
atcggtgaag attacatcgc aaacgacttt 4080caggctgttc tgatgccgta tgatggtgaa
attatcgcgg cctacgaact gagcaccaat 4140gtgccgttcg caggcgttgg tacggttctg
gtcgctaaag tgccgatcac cagcctgccg 4200tggtctccga aacagaaaga aatcgaactg
aacgataaca aaacgcatat ctacatcagc 4260tttctgcacc tggatgccca acgcaccctg
aacaatgaca aactgggctg ggtggcagaa 4320accgctaaac tgaaaaaaga taaaacggtt
aaagtggtta aaagtgtcac cccgtccacg 4380ccgaaaaaag tcagcaaagg taccgtgatc
ggctatctgg gtgatcactc atcgaacggc 4440ggttggatgt ctcatgcaca cattaatctg
tacacgaacc gtccgaatta tctgagtgaa 4500aactacttta gctctaaaac cattcgtgcg
cagctggatg acaaacgcgc caaaggctat 4560aaaagttccg tgtctaacaa tgatttcagt
gccattggca atatcggtgt tgaacgcaaa 4620attgatacga aaatctatca ggtcgacccg
aaaaccggca ttgaagataa acaaaaagca 4680atttcggacg aaatcccgct gtacttcaac
ggcctgagca tgctgggttt tgaaaaaacc 4740aaaggttatg ctaacccgaa tctgatgtac
aaactgcgtg atgaacgcac cgtgagcttt 4800tctgttaaag aagtcaataa actgtaa
4827671608PRTArtificial
SequenceLtkA-MSC_0775 fusion protein 67Met Ala Thr Val Ile Asp Leu Ser
Phe Pro Lys Thr Gly Ala Lys Lys 1 5 10
15 Ile Ile Leu Tyr Ile Pro Gln Asn Tyr Gln Tyr Asp Thr
Glu Gln Gly 20 25 30
Asn Gly Leu Gln Asp Leu Val Lys Ala Ala Glu Glu Leu Gly Ile Glu
35 40 45 Val Gln Arg Glu
Glu Arg Asn Asn Ile Ala Thr Ala Gln Thr Ser Leu 50
55 60 Gly Thr Ile Gln Thr Ala Ile Gly
Leu Thr Glu Arg Gly Ile Val Leu 65 70
75 80 Ser Ala Pro Gln Ile Asp Lys Leu Leu Gln Lys Thr
Lys Ala Gly Gln 85 90
95 Ala Leu Gly Ser Ala Glu Ser Ile Val Gln Asn Ala Asn Lys Ala Lys
100 105 110 Thr Val Leu
Ser Gly Ile Gln Ser Ile Leu Gly Ser Val Leu Ala Gly 115
120 125 Met Asp Leu Asp Glu Ala Leu Gln
Asn Asn Ser Asn Gln His Ala Leu 130 135
140 Ala Lys Ala Gly Leu Glu Leu Thr Asn Ser Leu Ile Glu
Asn Ile Ala 145 150 155
160 Asn Ser Val Lys Thr Leu Asp Glu Phe Gly Glu Gln Ile Ser Gln Phe
165 170 175 Gly Ser Lys Leu
Gln Asn Ile Lys Gly Leu Gly Thr Leu Gly Asp Lys 180
185 190 Leu Lys Asn Ile Gly Gly Leu Asp Lys
Ala Gly Leu Gly Leu Asp Val 195 200
205 Ile Ser Gly Leu Leu Ser Gly Ala Thr Ala Ala Leu Val Leu
Ala Asp 210 215 220
Lys Asn Ala Ser Thr Ala Lys Lys Val Gly Ala Gly Phe Glu Leu Ala 225
230 235 240 Asn Gln Val Val Gly
Asn Ile Thr Lys Ala Val Ser Ser Tyr Ile Leu 245
250 255 Ala Gln Arg Val Ala Ala Gly Leu Ser Ser
Thr Gly Pro Val Ala Ala 260 265
270 Leu Ile Ala Ser Thr Val Ser Leu Ala Ile Ser Pro Leu Ala Phe
Ala 275 280 285 Gly
Ile Ala Asp Lys Phe Asn His Ala Lys Ser Leu Glu Ser Tyr Ala 290
295 300 Glu Arg Phe Lys Lys Leu
Gly Tyr Asp Gly Asp Asn Leu Leu Ala Glu 305 310
315 320 Tyr Gln Arg Gly Thr Gly Thr Ile Asp Ala Ser
Val Thr Ala Ile Asn 325 330
335 Thr Ala Leu Ala Ala Ile Ala Gly Gly Val Ser Ala Ala Ala Ala Gly
340 345 350 Ser Val
Ile Ala Ser Pro Ile Ala Leu Leu Val Ser Gly Ile Thr Gly 355
360 365 Val Ile Ser Thr Ile Leu Gln
Tyr Ser Lys Gln Ala Met Phe Glu His 370 375
380 Val Ala Asn Lys Ile His Asn Lys Ile Val Glu Trp
Glu Lys Asn Asn 385 390 395
400 His Gly Lys Asn Tyr Phe Glu Asn Gly Tyr Asp Ala Arg Tyr Leu Ala
405 410 415 Asn Leu Gln
Asp Asn Met Lys Phe Leu Leu Asn Leu Asn Lys Glu Leu 420
425 430 Gln Ala Glu Arg Val Ile Ala Ile
Thr Gln Gln Gln Trp Asp Asn Asn 435 440
445 Ile Gly Asp Leu Ala Gly Ile Ser Arg Leu Gly Glu Lys
Val Leu Ser 450 455 460
Gly Lys Ala Tyr Val Asp Ala Phe Glu Glu Gly Lys His Ile Lys Ala 465
470 475 480 Asp Lys Leu Val
Gln Leu Asp Ser Ala Asn Gly Ile Ile Asp Val Ser 485
490 495 Asn Ser Gly Lys Ala Lys Thr Gln His
Ile Leu Phe Arg Thr Pro Leu 500 505
510 Leu Thr Pro Gly Thr Glu His Arg Glu Arg Val Gln Thr Gly
Lys Tyr 515 520 525
Glu Tyr Ile Thr Lys Leu Asn Ile Asn Arg Val Asp Ser Trp Lys Ile 530
535 540 Thr Asp Gly Ala Ala
Ser Ser Thr Phe Asp Leu Thr Asn Val Val Gln 545 550
555 560 Arg Ile Gly Ile Glu Leu Asp Asn Ala Gly
Asn Val Thr Lys Thr Lys 565 570
575 Glu Thr Lys Ile Ile Ala Lys Leu Gly Glu Gly Asp Asp Asn Val
Phe 580 585 590 Val
Gly Ser Gly Thr Thr Glu Ile Asp Gly Gly Glu Gly Tyr Asp Arg 595
600 605 Val His Tyr Ser Arg Gly
Asn Tyr Gly Ala Leu Thr Ile Asp Ala Thr 610 615
620 Lys Glu Thr Glu Gln Gly Ser Tyr Thr Val Asn
Arg Phe Val Glu Thr 625 630 635
640 Gly Lys Ala Leu His Glu Val Thr Ser Thr His Thr Ala Leu Val Gly
645 650 655 Asn Arg
Glu Glu Lys Ile Glu Tyr Arg His Ser Asn Asn Gln His His 660
665 670 Ala Gly Tyr Tyr Thr Lys Asp
Thr Leu Lys Ala Val Glu Glu Ile Ile 675 680
685 Gly Thr Ser His Asn Asp Ile Phe Lys Gly Ser Lys
Phe Asn Asp Ala 690 695 700
Phe Asn Gly Gly Asp Gly Val Asp Thr Ile Asp Gly Asn Asp Gly Asn 705
710 715 720 Asp Arg Leu
Phe Gly Gly Lys Gly Asp Asp Ile Leu Asp Gly Gly Asn 725
730 735 Gly Asp Asp Phe Ile Asp Gly Gly
Lys Gly Asn Asp Leu Leu His Gly 740 745
750 Gly Lys Gly Asp Asp Ile Phe Val His Arg Lys Gly Asp
Gly Asn Asp 755 760 765
Ile Ile Thr Asp Ser Asp Gly Asn Asp Lys Leu Ser Phe Ser Asp Ser 770
775 780 Asn Leu Lys Asp
Leu Thr Phe Glu Lys Val Lys His Asn Leu Val Ile 785 790
795 800 Thr Asn Ser Lys Lys Glu Lys Val Thr
Ile Gln Asn Trp Phe Arg Glu 805 810
815 Ala Asp Phe Ala Lys Glu Val Pro Asn Tyr Lys Ala Thr Lys
Asp Glu 820 825 830
Lys Ile Glu Glu Ile Ile Gly Gln Asn Gly Glu Arg Ile Thr Ser Lys
835 840 845 Gln Val Asp Asp
Leu Ile Ala Lys Gly Asn Gly Lys Ile Thr Gln Asp 850
855 860 Glu Leu Ser Lys Val Val Asp Asn
Tyr Glu Leu Leu Lys His Ser Lys 865 870
875 880 Asn Val Thr Asn Ser Leu Asp Lys Leu Ile Ser Ser
Val Ser Ala Phe 885 890
895 Thr Ser Ser Asn Asp Ser Arg Asn Val Leu Val Ala Pro Thr Ser Met
900 905 910 Leu Asp Gln
Ser Leu Ser Ser Leu Gln Phe Ala Arg Gly Ser Gln Thr 915
920 925 Glu Lys Asp Lys Gln Glu Phe Glu
Asn Tyr Asn Gln Ile Asn Met Leu 930 935
940 Ser Glu Ile Asn Gln Tyr Phe Thr Lys His Asp His Asn
Lys Asp Leu 945 950 955
960 Val Lys Phe Thr Thr Asp Gly Ala Ser Gly Asp Thr Val Glu Phe Asn
965 970 975 Asn Ile Met Lys
Asn Asn Tyr Ala Ser Lys Tyr Ile Lys Phe Asp Gln 980
985 990 Asp Lys Phe Lys Glu Ile Ile Lys
Lys Glu Phe Asn Leu Ser Asp Ser 995 1000
1005 Phe Leu Lys Arg Leu Glu Phe Glu Val Asp Tyr
Asn Asn Ile Ser 1010 1015 1020
Arg Asp Tyr Gly Asn Asn Phe Asp Val Ile Phe Pro Ile Arg Val
1025 1030 1035 Lys Leu Pro
Leu Val Ser His Asn Asn Phe Lys Tyr Gln Gln Gly 1040
1045 1050 Leu Phe Ile Glu Gln Thr Phe Lys
Phe Arg Ile Lys Asn Val Lys 1055 1060
1065 Ala Ser Gly Ser Glu Lys Ile Asp Val Ser Lys Ile Lys
Asp Ile 1070 1075 1080
Tyr Asn Glu Leu Val Lys Leu Lys Asp Lys Asn Asn Phe Thr Ala 1085
1090 1095 Ser Val Lys Thr Val
Thr Glu Glu Thr Lys Lys Leu Val Asp Glu 1100 1105
1110 Trp Gly Ile His Glu Leu Asn Ser Thr Gln
Leu Ser Ser Ile Phe 1115 1120 1125
Asp Ile Lys Thr Glu Glu Phe Asp Asn Leu Ile Lys Asp Lys Lys
1130 1135 1140 Glu Val
Glu His Lys Val Thr Ile Thr Asp Val Asp Leu Ser Asp 1145
1150 1155 Pro Ser Leu Ala Ile Asn Glu
Gly Leu Leu Lys Leu Arg Leu Gly 1160 1165
1170 Val Lys Ile Lys Gly Lys Glu Thr Glu Thr Gly Val
Asn Val Trp 1175 1180 1185
Ile Lys Phe Asn Phe Asp Gln Lys Asp Thr Phe Trp Lys Glu Leu 1190
1195 1200 Lys Ile Ser Glu Ser
Ile Lys Val Asn Thr Val Lys Phe Ser Glu 1205 1210
1215 Thr Asn Thr Asp Phe Thr Lys Leu Met Asn
Asp Asn Leu Ile Ile 1220 1225 1230
Lys Ser Lys Ser Lys Phe Ile Lys Asn Ile Lys Leu Ser Ser Ile
1235 1240 1245 Asp Lys
Thr Thr Asp Tyr Arg Asn Ser Gly Val Leu Leu Glu Val 1250
1255 1260 Leu Thr Asn Glu Ser Lys Asp
Asn Val Ile Lys Leu His Lys Lys 1265 1270
1275 Pro Gly Val Gly Lys Tyr Thr Asp Leu Tyr Ser Ala
Asp Phe Thr 1280 1285 1290
Lys Asn Asn Ile His Ala Pro Asn Phe Ala Thr Glu Lys Leu Thr 1295
1300 1305 Gln Glu Asn Leu Lys
Ser Ile Asn Lys Asp Phe Phe Arg Gln Phe 1310 1315
1320 Asp Ser Glu Leu Phe Ser Gly Gly Tyr Ala
Arg Ser Arg Gly Phe 1325 1330 1335
Tyr Ser Glu Lys Val Lys Ser Pro Lys Phe Met His Ile Gly Glu
1340 1345 1350 Asp Tyr
Ile Ala Asn Asp Phe Gln Ala Val Leu Met Pro Tyr Asp 1355
1360 1365 Gly Glu Ile Ile Ala Ala Tyr
Glu Leu Ser Thr Asn Val Pro Phe 1370 1375
1380 Ala Gly Val Gly Thr Val Leu Val Ala Lys Val Pro
Ile Thr Ser 1385 1390 1395
Leu Pro Trp Ser Pro Lys Gln Lys Glu Ile Glu Leu Asn Asp Asn 1400
1405 1410 Lys Thr His Ile Tyr
Ile Ser Phe Leu His Leu Asp Ala Gln Arg 1415 1420
1425 Thr Leu Asn Asn Asp Lys Leu Gly Trp Val
Ala Glu Thr Ala Lys 1430 1435 1440
Leu Lys Lys Asp Lys Thr Val Lys Val Val Lys Ser Val Thr Pro
1445 1450 1455 Ser Thr
Pro Lys Lys Val Ser Lys Gly Thr Val Ile Gly Tyr Leu 1460
1465 1470 Gly Asp His Ser Ser Asn Gly
Gly Trp Met Ser His Ala His Ile 1475 1480
1485 Asn Leu Tyr Thr Asn Arg Pro Asn Tyr Leu Ser Glu
Asn Tyr Phe 1490 1495 1500
Ser Ser Lys Thr Ile Arg Ala Gln Leu Asp Asp Lys Arg Ala Lys 1505
1510 1515 Gly Tyr Lys Ser Ser
Val Ser Asn Asn Asp Phe Ser Ala Ile Gly 1520 1525
1530 Asn Ile Gly Val Glu Arg Lys Ile Asp Thr
Lys Ile Tyr Gln Val 1535 1540 1545
Asp Pro Lys Thr Gly Ile Glu Asp Lys Gln Lys Ala Ile Ser Asp
1550 1555 1560 Glu Ile
Pro Leu Tyr Phe Asn Gly Leu Ser Met Leu Gly Phe Glu 1565
1570 1575 Lys Thr Lys Gly Tyr Ala Asn
Pro Asn Leu Met Tyr Lys Leu Arg 1580 1585
1590 Asp Glu Arg Thr Val Ser Phe Ser Val Lys Glu Val
Asn Lys Leu 1595 1600 1605
685046DNAArtificial SequencepAA352-MSC_0776 fusion DNA 68atggctactg
ttatagatct aagcttccca aaaactgggg caaaaaaaat tatcctctat 60attccccaaa
attaccaata tgatactgaa caaggtaatg gtttacagga tttagtcaaa 120gcggccgaag
agttggggat tgaggtacaa agagaagaac gcaataatat tgcaacagct 180caaaccagtt
taggcacgat tcaaaccgct attggcttaa ctgagcgtgg cattgtgtta 240tccgctccac
aaattgataa attgctacag aaaactaaag caggccaagc attaggttct 300gccgaaagca
ttgtacaaaa tgcaaataaa gccaaaactg tattatctgg cattcaatct 360attttaggct
cagtattggc tggaatggat ttagatgagg ccttacagaa taacagcaac 420caacatgctc
ttgctaaagc tggcttggag ctaacaaatt cattaattga aaatattgct 480aattcagtaa
aaacacttga cgaatttggt gagcaaatta gtcaatttgg ttcaaaacta 540caaaatatca
aaggcttagg gactttagga gacaaactca aaaatatcgg tggacttgat 600aaagctggcc
ttggtttaga tgttatctca gggctattat cgggcgcaac agctgcactt 660gtacttgcag
ataaaaatgc ttcaacagct aaaaaagtgg gtgcgggttt tgaattggca 720aaccaagttg
ttggtaatat taccaaagcc gtttcttctt acattttagc ccaacgtgtt 780gcagcaggtt
tatcttcaac tgggcctgtg gctgctttaa ttgcttctac tgtttctctt 840gcgattagcc
cattagcatt tgccggtatt gccgataaat ttaatcatgc aaaaagttta 900gagagttatg
ccgaacgctt taaaaaatta ggctatgacg gagataattt attagcagaa 960tatcagcggg
gaacagggac tattgatgca tcggttactg caattaatac cgcattggcc 1020gctattgctg
gtggtgtgtc tgctgctgca gccggctcgg ttattgcttc accgattgcc 1080ttattagtat
ctgggattac cggtgtaatt tctacgattc tgcaatattc taaacaagca 1140atgtttgagc
acgttgcaaa taaaattcat aacaaaattg tagaatggga aaaaaataat 1200cacggtaaga
actactttga aaatggttac gatgcccgtt atcttgcgaa tttacaagat 1260aatatgaaat
tcttactgaa cttaaacaaa gagttacagg cagaacgtgt catcgctatt 1320actcagcagc
aatgggataa caacattggt gatttagctg gtattagccg tttaggtgaa 1380aaagtcctta
gtggtaaagc ctatgtggat gcgtttgaag aaggcaaaca cattaaagcc 1440gataaattag
tacagttgga ttcggcaaac ggtattattg atgtgagtaa ttcgggtaaa 1500gcgaaaactc
agcatatctt attcagaacg ccattattga cgccgggaac agagcatcgt 1560gaacgcgtac
aaacaggtaa atatgaatat attaccaagc tcaatattaa ccgtgtagat 1620agctggaaaa
ttacagatgg tgcagcaagt tctacctttg atttaactaa cgttgttcag 1680cgtattggta
ttgaattaga caatgctgga aatgtaacta aaaccaaaga aacaaaaatt 1740attgccaaac
ttggtgaagg tgatgacaac gtatttgttg gttctggtac gacggaaatt 1800gatggcggtg
aaggttacga ccgagttcac tatagccgtg gaaactatgg tgctttaact 1860attgatgcaa
ccaaagagac cgagcaaggt agttataccg taaatcgttt cgtagaaacc 1920ggtaaagcac
tacacgaagt gacttcaacc cataccgcat tagtgggcaa ccgtgaagaa 1980aaaatagaat
atcgtcatag caataaccag caccatgccg gttattacac caaagatacc 2040ttgaaagctg
ttgaagaaat tatcggtaca tcacataacg atatctttaa aggtagtaag 2100ttcaatgatg
cctttaacgg tggtgatggt gtcgatacta ttgacggtaa cgacggcaat 2160gaccgcttat
ttggtggtaa aggcgatgat attctcgatg gtggaaatgg tgatgatttt 2220atcgatggcg
gtaaaggcaa cgacctatta cacggtggca agggcgatga tattttcgtt 2280caccgtaaag
gcgatggtaa tgatattatt accgattctg acggcaatga taaattatca 2340ttctctgatt
cgaacttaaa agatttaaca tttgaaaaag ttaaacataa tcttgtcatc 2400acgaatagca
aaaaagagaa agtgaccatt caaaactggt tccgagaggc tgattttgct 2460aaagaagtgc
ctaattataa agcaactaaa gatgagaaaa tcgaagaaat catcggtcaa 2520aatggcgagc
ggatcacctc aaagcaagtt gatgatctta tcgcaaaagg taacggcaaa 2580attacccaag
atgagctatc aaaagttgtt gataactatg aattgctcaa acatagcaaa 2640aatgtgacaa
acagcttaga taagttaatc tcatctgtaa gtgcatttac ctcgtctaat 2700gattcgagaa
atgtattagt ggctccaact tcaatgttgg atcaaagttt atcttctctt 2760caatttgcta
ggggatcctg taaaacgacg caaaatcaac agggcatcta taaaattgtg 2820gacttcgaaa
aagaaaatca aatcaacatt ctgagcgaaa tcaaccagtt tttcgaaaaa 2880catgatttca
acgaacagct ggttcaattc gtcaacaaag atagccacaa ttatattacc 2940ctggactctc
tgatgaaaaa caattatgcg gccaaatacg tgaaatttga taaagacaaa 3000ttcaaacaga
tcatcaaaaa agaattcaac ctgagtgatg catacctgaa taaactggaa 3060atcgaagttg
actataccaa cattgatcgc gactactcca acaattttga tattgtcttc 3120ccgattcgta
tcaaacgcca gctggaaaat cataaaaaag cgagctatca accgggcctg 3180tttacggaac
agattatcaa attccgcctg aaaaacgtga aaagctctcc gtcggaagca 3240tttttcgctg
aagaactgaa agatgttttc aacaaactga aagaactgaa atacgataac 3300ttcaccgcgc
gtctgaaaac gaacatcagt aacgaactga aaaaacagat cgatcaatgg 3360aacatcaacg
aactggacag tacccaactg tccaacatct tcgaaatcaa catctccgaa 3420ttcgatcagc
tgaaaaccaa caatccgaat tttgtgttca aaagtacgat ctttggtgtt 3480gatttctccg
acaaaaacct ggcgctgaat gaaggctatc tgaaagtgcg ttttgccgtt 3540aaagaaggtt
tcgatagtaa agacaaaacc aaacagatca acctgatcaa caaagaaatc 3600aacgaactga
tcgtgaaaaa agaaaacctg gaaaaaacca acaactcaga ttcgaacaaa 3660acggaaatcg
acaaactgat ccagatcatc aaacaaaaaa gcgcgcagct gaccaaaatt 3720aaacaaaaag
ccctgccggc ggaagccggc atcacgaaac tgatcaaatt caaattcgat 3780tggaacgacc
agttttggaa aaacatcaaa ctgaacgaag tgatcaaaat cgataccatc 3840aaatatggta
tcagcaatac cgatttcctg tctctgacga aagacaacct gattgttaaa 3900atcctgaaca
aagatgtgcg taacgttgac attaagaaaa ttgaaaaaac caacgatttc 3960cgcaacgcga
aactggtcct ggatgtgctg ctgaaagaca acaaaaaact ggaactgaac 4020aagaaaattg
gcgtgggtaa atatagcctg ctgtacgaaa atgatttcat caaaaacaac 4080atccaggccc
cgtatttcac cacggaacgt ctgacccaag aaaacctgca gtctgttaat 4140aaagatttct
ttcgccagtt tgactcagaa ctgttctcgg gcggttatgc aagttcccgt 4200ggcttttacg
ctccgaaaat taccacgccg atcttcatgc acattggtga agattatatt 4260gcgaatgact
ttcaggccgt gctgatgccg tatgatggcg aaattatcgc agcttacgaa 4320ctgagcacca
acgtcccgtt cgcaggcgtg ggtacggtgg ttgtcgtgaa aattaaagtt 4380tctgatctgg
actggacccc gaaagaaaaa gaaatctatc tgaacaacaa caaagatcat 4440atctacatgt
catttctgca cctggacgca tcgcgcacgc tgaataacca gaaactgggt 4500tggtcagctg
aaaaagttgt cctgaataac aatcgtacca ttcaagtggt taaatcgctg 4560acgccggaaa
aaccgcagaa agtcgccaaa aataccatta tcggctatct gggtaacaat 4620gcaagtaacg
gcggttggat gtcccatgct cacgttaacc tgtacaccaa tcgcccgtca 4680tatctgtcgg
aaaactactt tagcacgaaa tctaatcaag gcctgagcga agatcgtatc 4740aaacagtacc
atcaaaacat caacggtaaa gaaacctggc gtcagtttgg caatattggt 4800ctgcaccagt
ctccgcaacg tccgccgtac accatcaacg aagttgatca aattacgggc 4860gtcgaaaaac
tggacgaaaa caaaaagaaa attgtcgtga aaaacgaaca ggcgctgttt 4920ctgccgaacc
tgagcatgtc tctgttcgaa aaacgcctgg gttatgccaa cccgaatctg 4980gtctaccgtc
tgcgcgataa taaaaccgtg agtttttccg ttaaagaagt caacaaactg 5040acgtaa
5046691681PRTArtificial SequenceLtkA-MSC_0776 fusion protein 69Met Ala
Thr Val Ile Asp Leu Ser Phe Pro Lys Thr Gly Ala Lys Lys 1 5
10 15 Ile Ile Leu Tyr Ile Pro Gln
Asn Tyr Gln Tyr Asp Thr Glu Gln Gly 20 25
30 Asn Gly Leu Gln Asp Leu Val Lys Ala Ala Glu Glu
Leu Gly Ile Glu 35 40 45
Val Gln Arg Glu Glu Arg Asn Asn Ile Ala Thr Ala Gln Thr Ser Leu
50 55 60 Gly Thr Ile
Gln Thr Ala Ile Gly Leu Thr Glu Arg Gly Ile Val Leu 65
70 75 80 Ser Ala Pro Gln Ile Asp Lys
Leu Leu Gln Lys Thr Lys Ala Gly Gln 85
90 95 Ala Leu Gly Ser Ala Glu Ser Ile Val Gln Asn
Ala Asn Lys Ala Lys 100 105
110 Thr Val Leu Ser Gly Ile Gln Ser Ile Leu Gly Ser Val Leu Ala
Gly 115 120 125 Met
Asp Leu Asp Glu Ala Leu Gln Asn Asn Ser Asn Gln His Ala Leu 130
135 140 Ala Lys Ala Gly Leu Glu
Leu Thr Asn Ser Leu Ile Glu Asn Ile Ala 145 150
155 160 Asn Ser Val Lys Thr Leu Asp Glu Phe Gly Glu
Gln Ile Ser Gln Phe 165 170
175 Gly Ser Lys Leu Gln Asn Ile Lys Gly Leu Gly Thr Leu Gly Asp Lys
180 185 190 Leu Lys
Asn Ile Gly Gly Leu Asp Lys Ala Gly Leu Gly Leu Asp Val 195
200 205 Ile Ser Gly Leu Leu Ser Gly
Ala Thr Ala Ala Leu Val Leu Ala Asp 210 215
220 Lys Asn Ala Ser Thr Ala Lys Lys Val Gly Ala Gly
Phe Glu Leu Ala 225 230 235
240 Asn Gln Val Val Gly Asn Ile Thr Lys Ala Val Ser Ser Tyr Ile Leu
245 250 255 Ala Gln Arg
Val Ala Ala Gly Leu Ser Ser Thr Gly Pro Val Ala Ala 260
265 270 Leu Ile Ala Ser Thr Val Ser Leu
Ala Ile Ser Pro Leu Ala Phe Ala 275 280
285 Gly Ile Ala Asp Lys Phe Asn His Ala Lys Ser Leu Glu
Ser Tyr Ala 290 295 300
Glu Arg Phe Lys Lys Leu Gly Tyr Asp Gly Asp Asn Leu Leu Ala Glu 305
310 315 320 Tyr Gln Arg Gly
Thr Gly Thr Ile Asp Ala Ser Val Thr Ala Ile Asn 325
330 335 Thr Ala Leu Ala Ala Ile Ala Gly Gly
Val Ser Ala Ala Ala Ala Gly 340 345
350 Ser Val Ile Ala Ser Pro Ile Ala Leu Leu Val Ser Gly Ile
Thr Gly 355 360 365
Val Ile Ser Thr Ile Leu Gln Tyr Ser Lys Gln Ala Met Phe Glu His 370
375 380 Val Ala Asn Lys Ile
His Asn Lys Ile Val Glu Trp Glu Lys Asn Asn 385 390
395 400 His Gly Lys Asn Tyr Phe Glu Asn Gly Tyr
Asp Ala Arg Tyr Leu Ala 405 410
415 Asn Leu Gln Asp Asn Met Lys Phe Leu Leu Asn Leu Asn Lys Glu
Leu 420 425 430 Gln
Ala Glu Arg Val Ile Ala Ile Thr Gln Gln Gln Trp Asp Asn Asn 435
440 445 Ile Gly Asp Leu Ala Gly
Ile Ser Arg Leu Gly Glu Lys Val Leu Ser 450 455
460 Gly Lys Ala Tyr Val Asp Ala Phe Glu Glu Gly
Lys His Ile Lys Ala 465 470 475
480 Asp Lys Leu Val Gln Leu Asp Ser Ala Asn Gly Ile Ile Asp Val Ser
485 490 495 Asn Ser
Gly Lys Ala Lys Thr Gln His Ile Leu Phe Arg Thr Pro Leu 500
505 510 Leu Thr Pro Gly Thr Glu His
Arg Glu Arg Val Gln Thr Gly Lys Tyr 515 520
525 Glu Tyr Ile Thr Lys Leu Asn Ile Asn Arg Val Asp
Ser Trp Lys Ile 530 535 540
Thr Asp Gly Ala Ala Ser Ser Thr Phe Asp Leu Thr Asn Val Val Gln 545
550 555 560 Arg Ile Gly
Ile Glu Leu Asp Asn Ala Gly Asn Val Thr Lys Thr Lys 565
570 575 Glu Thr Lys Ile Ile Ala Lys Leu
Gly Glu Gly Asp Asp Asn Val Phe 580 585
590 Val Gly Ser Gly Thr Thr Glu Ile Asp Gly Gly Glu Gly
Tyr Asp Arg 595 600 605
Val His Tyr Ser Arg Gly Asn Tyr Gly Ala Leu Thr Ile Asp Ala Thr 610
615 620 Lys Glu Thr Glu
Gln Gly Ser Tyr Thr Val Asn Arg Phe Val Glu Thr 625 630
635 640 Gly Lys Ala Leu His Glu Val Thr Ser
Thr His Thr Ala Leu Val Gly 645 650
655 Asn Arg Glu Glu Lys Ile Glu Tyr Arg His Ser Asn Asn Gln
His His 660 665 670
Ala Gly Tyr Tyr Thr Lys Asp Thr Leu Lys Ala Val Glu Glu Ile Ile
675 680 685 Gly Thr Ser His
Asn Asp Ile Phe Lys Gly Ser Lys Phe Asn Asp Ala 690
695 700 Phe Asn Gly Gly Asp Gly Val Asp
Thr Ile Asp Gly Asn Asp Gly Asn 705 710
715 720 Asp Arg Leu Phe Gly Gly Lys Gly Asp Asp Ile Leu
Asp Gly Gly Asn 725 730
735 Gly Asp Asp Phe Ile Asp Gly Gly Lys Gly Asn Asp Leu Leu His Gly
740 745 750 Gly Lys Gly
Asp Asp Ile Phe Val His Arg Lys Gly Asp Gly Asn Asp 755
760 765 Ile Ile Thr Asp Ser Asp Gly Asn
Asp Lys Leu Ser Phe Ser Asp Ser 770 775
780 Asn Leu Lys Asp Leu Thr Phe Glu Lys Val Lys His Asn
Leu Val Ile 785 790 795
800 Thr Asn Ser Lys Lys Glu Lys Val Thr Ile Gln Asn Trp Phe Arg Glu
805 810 815 Ala Asp Phe Ala
Lys Glu Val Pro Asn Tyr Lys Ala Thr Lys Asp Glu 820
825 830 Lys Ile Glu Glu Ile Ile Gly Gln Asn
Gly Glu Arg Ile Thr Ser Lys 835 840
845 Gln Val Asp Asp Leu Ile Ala Lys Gly Asn Gly Lys Ile Thr
Gln Asp 850 855 860
Glu Leu Ser Lys Val Val Asp Asn Tyr Glu Leu Leu Lys His Ser Lys 865
870 875 880 Asn Val Thr Asn Ser
Leu Asp Lys Leu Ile Ser Ser Val Ser Ala Phe 885
890 895 Thr Ser Ser Asn Asp Ser Arg Asn Val Leu
Val Ala Pro Thr Ser Met 900 905
910 Leu Asp Gln Ser Leu Ser Ser Leu Gln Phe Ala Arg Gly Ser Cys
Lys 915 920 925 Thr
Thr Gln Asn Gln Gln Gly Ile Tyr Lys Ile Val Asp Phe Glu Lys 930
935 940 Glu Asn Gln Ile Asn Ile
Leu Ser Glu Ile Asn Gln Phe Phe Glu Lys 945 950
955 960 His Asp Phe Asn Glu Gln Leu Val Gln Phe Val
Asn Lys Asp Ser His 965 970
975 Asn Tyr Ile Thr Leu Asp Ser Leu Met Lys Asn Asn Tyr Ala Ala Lys
980 985 990 Tyr Val
Lys Phe Asp Lys Asp Lys Phe Lys Gln Ile Ile Lys Lys Glu 995
1000 1005 Phe Asn Leu Ser Asp
Ala Tyr Leu Asn Lys Leu Glu Ile Glu Val 1010 1015
1020 Asp Tyr Thr Asn Ile Asp Arg Asp Tyr Ser
Asn Asn Phe Asp Ile 1025 1030 1035
Val Phe Pro Ile Arg Ile Lys Arg Gln Leu Glu Asn His Lys Lys
1040 1045 1050 Ala Ser
Tyr Gln Pro Gly Leu Phe Thr Glu Gln Ile Ile Lys Phe 1055
1060 1065 Arg Leu Lys Asn Val Lys Ser
Ser Pro Ser Glu Ala Phe Phe Ala 1070 1075
1080 Glu Glu Leu Lys Asp Val Phe Asn Lys Leu Lys Glu
Leu Lys Tyr 1085 1090 1095
Asp Asn Phe Thr Ala Arg Leu Lys Thr Asn Ile Ser Asn Glu Leu 1100
1105 1110 Lys Lys Gln Ile Asp
Gln Trp Asn Ile Asn Glu Leu Asp Ser Thr 1115 1120
1125 Gln Leu Ser Asn Ile Phe Glu Ile Asn Ile
Ser Glu Phe Asp Gln 1130 1135 1140
Leu Lys Thr Asn Asn Pro Asn Phe Val Phe Lys Ser Thr Ile Phe
1145 1150 1155 Gly Val
Asp Phe Ser Asp Lys Asn Leu Ala Leu Asn Glu Gly Tyr 1160
1165 1170 Leu Lys Val Arg Phe Ala Val
Lys Glu Gly Phe Asp Ser Lys Asp 1175 1180
1185 Lys Thr Lys Gln Ile Asn Leu Ile Asn Lys Glu Ile
Asn Glu Leu 1190 1195 1200
Ile Val Lys Lys Glu Asn Leu Glu Lys Thr Asn Asn Ser Asp Ser 1205
1210 1215 Asn Lys Thr Glu Ile
Asp Lys Leu Ile Gln Ile Ile Lys Gln Lys 1220 1225
1230 Ser Ala Gln Leu Thr Lys Ile Lys Gln Lys
Ala Leu Pro Ala Glu 1235 1240 1245
Ala Gly Ile Thr Lys Leu Ile Lys Phe Lys Phe Asp Trp Asn Asp
1250 1255 1260 Gln Phe
Trp Lys Asn Ile Lys Leu Asn Glu Val Ile Lys Ile Asp 1265
1270 1275 Thr Ile Lys Tyr Gly Ile Ser
Asn Thr Asp Phe Leu Ser Leu Thr 1280 1285
1290 Lys Asp Asn Leu Ile Val Lys Ile Leu Asn Lys Asp
Val Arg Asn 1295 1300 1305
Val Asp Ile Lys Lys Ile Glu Lys Thr Asn Asp Phe Arg Asn Ala 1310
1315 1320 Lys Leu Val Leu Asp
Val Leu Leu Lys Asp Asn Lys Lys Leu Glu 1325 1330
1335 Leu Asn Lys Lys Ile Gly Val Gly Lys Tyr
Ser Leu Leu Tyr Glu 1340 1345 1350
Asn Asp Phe Ile Lys Asn Asn Ile Gln Ala Pro Tyr Phe Thr Thr
1355 1360 1365 Glu Arg
Leu Thr Gln Glu Asn Leu Gln Ser Val Asn Lys Asp Phe 1370
1375 1380 Phe Arg Gln Phe Asp Ser Glu
Leu Phe Ser Gly Gly Tyr Ala Ser 1385 1390
1395 Ser Arg Gly Phe Tyr Ala Pro Lys Ile Thr Thr Pro
Ile Phe Met 1400 1405 1410
His Ile Gly Glu Asp Tyr Ile Ala Asn Asp Phe Gln Ala Val Leu 1415
1420 1425 Met Pro Tyr Asp Gly
Glu Ile Ile Ala Ala Tyr Glu Leu Ser Thr 1430 1435
1440 Asn Val Pro Phe Ala Gly Val Gly Thr Val
Val Val Val Lys Ile 1445 1450 1455
Lys Val Ser Asp Leu Asp Trp Thr Pro Lys Glu Lys Glu Ile Tyr
1460 1465 1470 Leu Asn
Asn Asn Lys Asp His Ile Tyr Met Ser Phe Leu His Leu 1475
1480 1485 Asp Ala Ser Arg Thr Leu Asn
Asn Gln Lys Leu Gly Trp Ser Ala 1490 1495
1500 Glu Lys Val Val Leu Asn Asn Asn Arg Thr Ile Gln
Val Val Lys 1505 1510 1515
Ser Leu Thr Pro Glu Lys Pro Gln Lys Val Ala Lys Asn Thr Ile 1520
1525 1530 Ile Gly Tyr Leu Gly
Asn Asn Ala Ser Asn Gly Gly Trp Met Ser 1535 1540
1545 His Ala His Val Asn Leu Tyr Thr Asn Arg
Pro Ser Tyr Leu Ser 1550 1555 1560
Glu Asn Tyr Phe Ser Thr Lys Ser Asn Gln Gly Leu Ser Glu Asp
1565 1570 1575 Arg Ile
Lys Gln Tyr His Gln Asn Ile Asn Gly Lys Glu Thr Trp 1580
1585 1590 Arg Gln Phe Gly Asn Ile Gly
Leu His Gln Ser Pro Gln Arg Pro 1595 1600
1605 Pro Tyr Thr Ile Asn Glu Val Asp Gln Ile Thr Gly
Val Glu Lys 1610 1615 1620
Leu Asp Glu Asn Lys Lys Lys Ile Val Val Lys Asn Glu Gln Ala 1625
1630 1635 Leu Phe Leu Pro Asn
Leu Ser Met Ser Leu Phe Glu Lys Arg Leu 1640 1645
1650 Gly Tyr Ala Asn Pro Asn Leu Val Tyr Arg
Leu Arg Asp Asn Lys 1655 1660 1665
Thr Val Ser Phe Ser Val Lys Glu Val Asn Lys Leu Thr 1670
1675 1680 703927DNAArtificial
SequencepAA352-MSC_0816 fusion DNA 70atggctactg ttatagatct aagcttccca
aaaactgggg caaaaaaaat tatcctctat 60attccccaaa attaccaata tgatactgaa
caaggtaatg gtttacagga tttagtcaaa 120gcggccgaag agttggggat tgaggtacaa
agagaagaac gcaataatat tgcaacagct 180caaaccagtt taggcacgat tcaaaccgct
attggcttaa ctgagcgtgg cattgtgtta 240tccgctccac aaattgataa attgctacag
aaaactaaag caggccaagc attaggttct 300gccgaaagca ttgtacaaaa tgcaaataaa
gccaaaactg tattatctgg cattcaatct 360attttaggct cagtattggc tggaatggat
ttagatgagg ccttacagaa taacagcaac 420caacatgctc ttgctaaagc tggcttggag
ctaacaaatt cattaattga aaatattgct 480aattcagtaa aaacacttga cgaatttggt
gagcaaatta gtcaatttgg ttcaaaacta 540caaaatatca aaggcttagg gactttagga
gacaaactca aaaatatcgg tggacttgat 600aaagctggcc ttggtttaga tgttatctca
gggctattat cgggcgcaac agctgcactt 660gtacttgcag ataaaaatgc ttcaacagct
aaaaaagtgg gtgcgggttt tgaattggca 720aaccaagttg ttggtaatat taccaaagcc
gtttcttctt acattttagc ccaacgtgtt 780gcagcaggtt tatcttcaac tgggcctgtg
gctgctttaa ttgcttctac tgtttctctt 840gcgattagcc cattagcatt tgccggtatt
gccgataaat ttaatcatgc aaaaagttta 900gagagttatg ccgaacgctt taaaaaatta
ggctatgacg gagataattt attagcagaa 960tatcagcggg gaacagggac tattgatgca
tcggttactg caattaatac cgcattggcc 1020gctattgctg gtggtgtgtc tgctgctgca
gccggctcgg ttattgcttc accgattgcc 1080ttattagtat ctgggattac cggtgtaatt
tctacgattc tgcaatattc taaacaagca 1140atgtttgagc acgttgcaaa taaaattcat
aacaaaattg tagaatggga aaaaaataat 1200cacggtaaga actactttga aaatggttac
gatgcccgtt atcttgcgaa tttacaagat 1260aatatgaaat tcttactgaa cttaaacaaa
gagttacagg cagaacgtgt catcgctatt 1320actcagcagc aatgggataa caacattggt
gatttagctg gtattagccg tttaggtgaa 1380aaagtcctta gtggtaaagc ctatgtggat
gcgtttgaag aaggcaaaca cattaaagcc 1440gataaattag tacagttgga ttcggcaaac
ggtattattg atgtgagtaa ttcgggtaaa 1500gcgaaaactc agcatatctt attcagaacg
ccattattga cgccgggaac agagcatcgt 1560gaacgcgtac aaacaggtaa atatgaatat
attaccaagc tcaatattaa ccgtgtagat 1620agctggaaaa ttacagatgg tgcagcaagt
tctacctttg atttaactaa cgttgttcag 1680cgtattggta ttgaattaga caatgctgga
aatgtaacta aaaccaaaga aacaaaaatt 1740attgccaaac ttggtgaagg tgatgacaac
gtatttgttg gttctggtac gacggaaatt 1800gatggcggtg aaggttacga ccgagttcac
tatagccgtg gaaactatgg tgctttaact 1860attgatgcaa ccaaagagac cgagcaaggt
agttataccg taaatcgttt cgtagaaacc 1920ggtaaagcac tacacgaagt gacttcaacc
cataccgcat tagtgggcaa ccgtgaagaa 1980aaaatagaat atcgtcatag caataaccag
caccatgccg gttattacac caaagatacc 2040ttgaaagctg ttgaagaaat tatcggtaca
tcacataacg atatctttaa aggtagtaag 2100ttcaatgatg cctttaacgg tggtgatggt
gtcgatacta ttgacggtaa cgacggcaat 2160gaccgcttat ttggtggtaa aggcgatgat
attctcgatg gtggaaatgg tgatgatttt 2220atcgatggcg gtaaaggcaa cgacctatta
cacggtggca agggcgatga tattttcgtt 2280caccgtaaag gcgatggtaa tgatattatt
accgattctg acggcaatga taaattatca 2340ttctctgatt cgaacttaaa agatttaaca
tttgaaaaag ttaaacataa tcttgtcatc 2400acgaatagca aaaaagagaa agtgaccatt
caaaactggt tccgagaggc tgattttgct 2460aaagaagtgc ctaattataa agcaactaaa
gatgagaaaa tcgaagaaat catcggtcaa 2520aatggcgagc ggatcacctc aaagcaagtt
gatgatctta tcgcaaaagg taacggcaaa 2580attacccaag atgagctatc aaaagttgtt
gataactatg aattgctcaa acatagcaaa 2640aatgtgacaa acagcttaga taagttaatc
tcatctgtaa gtgcatttac ctcgtctaat 2700gattcgagaa atgtattagt ggctccaact
tcaatgttgg atcaaagttt atcttctctt 2760caatttgcta ggggatccgc aaacaaaaac
tctgtcgaaa acaacatcta tatcagtaaa 2820cagattcaac gcaaaccgca taaaatcgaa
ggcgataaac tgattgaaat cggttattac 2880tgggattctc acgaccgtca ggtgcgcatt
atgcgtatcc cgccgaccgt gaaagttatc 2940gcggcccagc tgccgccgat tatcacgagt
ctgaaaggcg catttcaagc tcgcattaac 3000gacgttatct ggcatgtccc gtgggatacc
aaaaacatca cgaacatgaa cagcatgttc 3060tacaacaata tttggttcaa cagctctagt
atcctggaat gggatacctc caatgttacg 3120gacatgggtg aaatgtttgg ccgtaccggt
agcttcaacc aggatctgtc caaatgggac 3180gtctcaaaag tgaaaaactt caagaaaatg
ttctacaacg cgaaaaaata caacaacaac 3240gataaaccgc tgaaatggaa cgacaaactg
aaatctgcag tcaatatgga agatatgttt 3300caaggcgcta gtgacttcaa acatagtctg
tccgattgga aactggaaac cgaaatcaac 3360aacaaaaact tcggtctgct ggaagatcgc
cacccgaaat ggaaagaaaa actgattaaa 3420ccgtcctcac cgatctcgag ctctaattcc
ctgagttcca ataacatcaa tgatcgctca 3480gatgacaacc agattaatcg taactcatcg
accccgacga atagcaacac catctctacg 3540aatccgagta acgatctgag ctctaatacc
acgaataacg aaaacatttc ggaaagttcc 3600atgagcaata acatgctgga aattccgatc
aatagcgaaa acaaaccgga aaacccgaaa 3660aacaacgaaa acatcaacta caaaatcctg
ccgaaagtgg acaaaaccaa aaaacagagc 3720gaagcgaaaa acaaaatccc ggttgaaaaa
ggcgaactgt cgaaagatga aaatcaaacc 3780acgaaaacca gcaacgccat caaagacaaa
gaaaactcat cgatcaaatc agattcgctg 3840tacaaaattc cgccgaaacc gaacaccatt
atcagcaaac tgagctctcc gaatgcgggc 3900attatcacgg gtgccgtgtt tcgttaa
3927711308PRTArtificial
SequenceLtkA-MSC_0816 fusion protein 71Met Ala Thr Val Ile Asp Leu Ser
Phe Pro Lys Thr Gly Ala Lys Lys 1 5 10
15 Ile Ile Leu Tyr Ile Pro Gln Asn Tyr Gln Tyr Asp Thr
Glu Gln Gly 20 25 30
Asn Gly Leu Gln Asp Leu Val Lys Ala Ala Glu Glu Leu Gly Ile Glu
35 40 45 Val Gln Arg Glu
Glu Arg Asn Asn Ile Ala Thr Ala Gln Thr Ser Leu 50
55 60 Gly Thr Ile Gln Thr Ala Ile Gly
Leu Thr Glu Arg Gly Ile Val Leu 65 70
75 80 Ser Ala Pro Gln Ile Asp Lys Leu Leu Gln Lys Thr
Lys Ala Gly Gln 85 90
95 Ala Leu Gly Ser Ala Glu Ser Ile Val Gln Asn Ala Asn Lys Ala Lys
100 105 110 Thr Val Leu
Ser Gly Ile Gln Ser Ile Leu Gly Ser Val Leu Ala Gly 115
120 125 Met Asp Leu Asp Glu Ala Leu Gln
Asn Asn Ser Asn Gln His Ala Leu 130 135
140 Ala Lys Ala Gly Leu Glu Leu Thr Asn Ser Leu Ile Glu
Asn Ile Ala 145 150 155
160 Asn Ser Val Lys Thr Leu Asp Glu Phe Gly Glu Gln Ile Ser Gln Phe
165 170 175 Gly Ser Lys Leu
Gln Asn Ile Lys Gly Leu Gly Thr Leu Gly Asp Lys 180
185 190 Leu Lys Asn Ile Gly Gly Leu Asp Lys
Ala Gly Leu Gly Leu Asp Val 195 200
205 Ile Ser Gly Leu Leu Ser Gly Ala Thr Ala Ala Leu Val Leu
Ala Asp 210 215 220
Lys Asn Ala Ser Thr Ala Lys Lys Val Gly Ala Gly Phe Glu Leu Ala 225
230 235 240 Asn Gln Val Val Gly
Asn Ile Thr Lys Ala Val Ser Ser Tyr Ile Leu 245
250 255 Ala Gln Arg Val Ala Ala Gly Leu Ser Ser
Thr Gly Pro Val Ala Ala 260 265
270 Leu Ile Ala Ser Thr Val Ser Leu Ala Ile Ser Pro Leu Ala Phe
Ala 275 280 285 Gly
Ile Ala Asp Lys Phe Asn His Ala Lys Ser Leu Glu Ser Tyr Ala 290
295 300 Glu Arg Phe Lys Lys Leu
Gly Tyr Asp Gly Asp Asn Leu Leu Ala Glu 305 310
315 320 Tyr Gln Arg Gly Thr Gly Thr Ile Asp Ala Ser
Val Thr Ala Ile Asn 325 330
335 Thr Ala Leu Ala Ala Ile Ala Gly Gly Val Ser Ala Ala Ala Ala Gly
340 345 350 Ser Val
Ile Ala Ser Pro Ile Ala Leu Leu Val Ser Gly Ile Thr Gly 355
360 365 Val Ile Ser Thr Ile Leu Gln
Tyr Ser Lys Gln Ala Met Phe Glu His 370 375
380 Val Ala Asn Lys Ile His Asn Lys Ile Val Glu Trp
Glu Lys Asn Asn 385 390 395
400 His Gly Lys Asn Tyr Phe Glu Asn Gly Tyr Asp Ala Arg Tyr Leu Ala
405 410 415 Asn Leu Gln
Asp Asn Met Lys Phe Leu Leu Asn Leu Asn Lys Glu Leu 420
425 430 Gln Ala Glu Arg Val Ile Ala Ile
Thr Gln Gln Gln Trp Asp Asn Asn 435 440
445 Ile Gly Asp Leu Ala Gly Ile Ser Arg Leu Gly Glu Lys
Val Leu Ser 450 455 460
Gly Lys Ala Tyr Val Asp Ala Phe Glu Glu Gly Lys His Ile Lys Ala 465
470 475 480 Asp Lys Leu Val
Gln Leu Asp Ser Ala Asn Gly Ile Ile Asp Val Ser 485
490 495 Asn Ser Gly Lys Ala Lys Thr Gln His
Ile Leu Phe Arg Thr Pro Leu 500 505
510 Leu Thr Pro Gly Thr Glu His Arg Glu Arg Val Gln Thr Gly
Lys Tyr 515 520 525
Glu Tyr Ile Thr Lys Leu Asn Ile Asn Arg Val Asp Ser Trp Lys Ile 530
535 540 Thr Asp Gly Ala Ala
Ser Ser Thr Phe Asp Leu Thr Asn Val Val Gln 545 550
555 560 Arg Ile Gly Ile Glu Leu Asp Asn Ala Gly
Asn Val Thr Lys Thr Lys 565 570
575 Glu Thr Lys Ile Ile Ala Lys Leu Gly Glu Gly Asp Asp Asn Val
Phe 580 585 590 Val
Gly Ser Gly Thr Thr Glu Ile Asp Gly Gly Glu Gly Tyr Asp Arg 595
600 605 Val His Tyr Ser Arg Gly
Asn Tyr Gly Ala Leu Thr Ile Asp Ala Thr 610 615
620 Lys Glu Thr Glu Gln Gly Ser Tyr Thr Val Asn
Arg Phe Val Glu Thr 625 630 635
640 Gly Lys Ala Leu His Glu Val Thr Ser Thr His Thr Ala Leu Val Gly
645 650 655 Asn Arg
Glu Glu Lys Ile Glu Tyr Arg His Ser Asn Asn Gln His His 660
665 670 Ala Gly Tyr Tyr Thr Lys Asp
Thr Leu Lys Ala Val Glu Glu Ile Ile 675 680
685 Gly Thr Ser His Asn Asp Ile Phe Lys Gly Ser Lys
Phe Asn Asp Ala 690 695 700
Phe Asn Gly Gly Asp Gly Val Asp Thr Ile Asp Gly Asn Asp Gly Asn 705
710 715 720 Asp Arg Leu
Phe Gly Gly Lys Gly Asp Asp Ile Leu Asp Gly Gly Asn 725
730 735 Gly Asp Asp Phe Ile Asp Gly Gly
Lys Gly Asn Asp Leu Leu His Gly 740 745
750 Gly Lys Gly Asp Asp Ile Phe Val His Arg Lys Gly Asp
Gly Asn Asp 755 760 765
Ile Ile Thr Asp Ser Asp Gly Asn Asp Lys Leu Ser Phe Ser Asp Ser 770
775 780 Asn Leu Lys Asp
Leu Thr Phe Glu Lys Val Lys His Asn Leu Val Ile 785 790
795 800 Thr Asn Ser Lys Lys Glu Lys Val Thr
Ile Gln Asn Trp Phe Arg Glu 805 810
815 Ala Asp Phe Ala Lys Glu Val Pro Asn Tyr Lys Ala Thr Lys
Asp Glu 820 825 830
Lys Ile Glu Glu Ile Ile Gly Gln Asn Gly Glu Arg Ile Thr Ser Lys
835 840 845 Gln Val Asp Asp
Leu Ile Ala Lys Gly Asn Gly Lys Ile Thr Gln Asp 850
855 860 Glu Leu Ser Lys Val Val Asp Asn
Tyr Glu Leu Leu Lys His Ser Lys 865 870
875 880 Asn Val Thr Asn Ser Leu Asp Lys Leu Ile Ser Ser
Val Ser Ala Phe 885 890
895 Thr Ser Ser Asn Asp Ser Arg Asn Val Leu Val Ala Pro Thr Ser Met
900 905 910 Leu Asp Gln
Ser Leu Ser Ser Leu Gln Phe Ala Arg Gly Ser Ala Asn 915
920 925 Lys Asn Ser Val Glu Asn Asn Ile
Tyr Ile Ser Lys Gln Ile Gln Arg 930 935
940 Lys Pro His Lys Ile Glu Gly Asp Lys Leu Ile Glu Ile
Gly Tyr Tyr 945 950 955
960 Trp Asp Ser His Asp Arg Gln Val Arg Ile Met Arg Ile Pro Pro Thr
965 970 975 Val Lys Val Ile
Ala Ala Gln Leu Pro Pro Ile Ile Thr Ser Leu Lys 980
985 990 Gly Ala Phe Gln Ala Arg Ile Asn
Asp Val Ile Trp His Val Pro Trp 995 1000
1005 Asp Thr Lys Asn Ile Thr Asn Met Asn Ser Met
Phe Tyr Asn Asn 1010 1015 1020
Ile Trp Phe Asn Ser Ser Ser Ile Leu Glu Trp Asp Thr Ser Asn
1025 1030 1035 Val Thr Asp
Met Gly Glu Met Phe Gly Arg Thr Gly Ser Phe Asn 1040
1045 1050 Gln Asp Leu Ser Lys Trp Asp Val
Ser Lys Val Lys Asn Phe Lys 1055 1060
1065 Lys Met Phe Tyr Asn Ala Lys Lys Tyr Asn Asn Asn Asp
Lys Pro 1070 1075 1080
Leu Lys Trp Asn Asp Lys Leu Lys Ser Ala Val Asn Met Glu Asp 1085
1090 1095 Met Phe Gln Gly Ala
Ser Asp Phe Lys His Ser Leu Ser Asp Trp 1100 1105
1110 Lys Leu Glu Thr Glu Ile Asn Asn Lys Asn
Phe Gly Leu Leu Glu 1115 1120 1125
Asp Arg His Pro Lys Trp Lys Glu Lys Leu Ile Lys Pro Ser Ser
1130 1135 1140 Pro Ile
Ser Ser Ser Asn Ser Leu Ser Ser Asn Asn Ile Asn Asp 1145
1150 1155 Arg Ser Asp Asp Asn Gln Ile
Asn Arg Asn Ser Ser Thr Pro Thr 1160 1165
1170 Asn Ser Asn Thr Ile Ser Thr Asn Pro Ser Asn Asp
Leu Ser Ser 1175 1180 1185
Asn Thr Thr Asn Asn Glu Asn Ile Ser Glu Ser Ser Met Ser Asn 1190
1195 1200 Asn Met Leu Glu Ile
Pro Ile Asn Ser Glu Asn Lys Pro Glu Asn 1205 1210
1215 Pro Lys Asn Asn Glu Asn Ile Asn Tyr Lys
Ile Leu Pro Lys Val 1220 1225 1230
Asp Lys Thr Lys Lys Gln Ser Glu Ala Lys Asn Lys Ile Pro Val
1235 1240 1245 Glu Lys
Gly Glu Leu Ser Lys Asp Glu Asn Gln Thr Thr Lys Thr 1250
1255 1260 Ser Asn Ala Ile Lys Asp Lys
Glu Asn Ser Ser Ile Lys Ser Asp 1265 1270
1275 Ser Leu Tyr Lys Ile Pro Pro Lys Pro Asn Thr Ile
Ile Ser Lys 1280 1285 1290
Leu Ser Ser Pro Asn Ala Gly Ile Ile Thr Gly Ala Val Phe Arg 1295
1300 1305 724011DNAArtificial
SequencepAA352-MSC_0957 fusion DNA 72atggctactg ttatagatct aagcttccca
aaaactgggg caaaaaaaat tatcctctat 60attccccaaa attaccaata tgatactgaa
caaggtaatg gtttacagga tttagtcaaa 120gcggccgaag agttggggat tgaggtacaa
agagaagaac gcaataatat tgcaacagct 180caaaccagtt taggcacgat tcaaaccgct
attggcttaa ctgagcgtgg cattgtgtta 240tccgctccac aaattgataa attgctacag
aaaactaaag caggccaagc attaggttct 300gccgaaagca ttgtacaaaa tgcaaataaa
gccaaaactg tattatctgg cattcaatct 360attttaggct cagtattggc tggaatggat
ttagatgagg ccttacagaa taacagcaac 420caacatgctc ttgctaaagc tggcttggag
ctaacaaatt cattaattga aaatattgct 480aattcagtaa aaacacttga cgaatttggt
gagcaaatta gtcaatttgg ttcaaaacta 540caaaatatca aaggcttagg gactttagga
gacaaactca aaaatatcgg tggacttgat 600aaagctggcc ttggtttaga tgttatctca
gggctattat cgggcgcaac agctgcactt 660gtacttgcag ataaaaatgc ttcaacagct
aaaaaagtgg gtgcgggttt tgaattggca 720aaccaagttg ttggtaatat taccaaagcc
gtttcttctt acattttagc ccaacgtgtt 780gcagcaggtt tatcttcaac tgggcctgtg
gctgctttaa ttgcttctac tgtttctctt 840gcgattagcc cattagcatt tgccggtatt
gccgataaat ttaatcatgc aaaaagttta 900gagagttatg ccgaacgctt taaaaaatta
ggctatgacg gagataattt attagcagaa 960tatcagcggg gaacagggac tattgatgca
tcggttactg caattaatac cgcattggcc 1020gctattgctg gtggtgtgtc tgctgctgca
gccggctcgg ttattgcttc accgattgcc 1080ttattagtat ctgggattac cggtgtaatt
tctacgattc tgcaatattc taaacaagca 1140atgtttgagc acgttgcaaa taaaattcat
aacaaaattg tagaatggga aaaaaataat 1200cacggtaaga actactttga aaatggttac
gatgcccgtt atcttgcgaa tttacaagat 1260aatatgaaat tcttactgaa cttaaacaaa
gagttacagg cagaacgtgt catcgctatt 1320actcagcagc aatgggataa caacattggt
gatttagctg gtattagccg tttaggtgaa 1380aaagtcctta gtggtaaagc ctatgtggat
gcgtttgaag aaggcaaaca cattaaagcc 1440gataaattag tacagttgga ttcggcaaac
ggtattattg atgtgagtaa ttcgggtaaa 1500gcgaaaactc agcatatctt attcagaacg
ccattattga cgccgggaac agagcatcgt 1560gaacgcgtac aaacaggtaa atatgaatat
attaccaagc tcaatattaa ccgtgtagat 1620agctggaaaa ttacagatgg tgcagcaagt
tctacctttg atttaactaa cgttgttcag 1680cgtattggta ttgaattaga caatgctgga
aatgtaacta aaaccaaaga aacaaaaatt 1740attgccaaac ttggtgaagg tgatgacaac
gtatttgttg gttctggtac gacggaaatt 1800gatggcggtg aaggttacga ccgagttcac
tatagccgtg gaaactatgg tgctttaact 1860attgatgcaa ccaaagagac cgagcaaggt
agttataccg taaatcgttt cgtagaaacc 1920ggtaaagcac tacacgaagt gacttcaacc
cataccgcat tagtgggcaa ccgtgaagaa 1980aaaatagaat atcgtcatag caataaccag
caccatgccg gttattacac caaagatacc 2040ttgaaagctg ttgaagaaat tatcggtaca
tcacataacg atatctttaa aggtagtaag 2100ttcaatgatg cctttaacgg tggtgatggt
gtcgatacta ttgacggtaa cgacggcaat 2160gaccgcttat ttggtggtaa aggcgatgat
attctcgatg gtggaaatgg tgatgatttt 2220atcgatggcg gtaaaggcaa cgacctatta
cacggtggca agggcgatga tattttcgtt 2280caccgtaaag gcgatggtaa tgatattatt
accgattctg acggcaatga taaattatca 2340ttctctgatt cgaacttaaa agatttaaca
tttgaaaaag ttaaacataa tcttgtcatc 2400acgaatagca aaaaagagaa agtgaccatt
caaaactggt tccgagaggc tgattttgct 2460aaagaagtgc ctaattataa agcaactaaa
gatgagaaaa tcgaagaaat catcggtcaa 2520aatggcgagc ggatcacctc aaagcaagtt
gatgatctta tcgcaaaagg taacggcaaa 2580attacccaag atgagctatc aaaagttgtt
gataactatg aattgctcaa acatagcaaa 2640aatgtgacaa acagcttaga taagttaatc
tcatctgtaa gtgcatttac ctcgtctaat 2700gattcgagaa atgtattagt ggctccaact
tcaatgttgg atcaaagttt atcttctctt 2760caatttgcta ggggatcctg cagtaccacg
attacccata cgatcaaaac gtcctttaac 2820gataacgtta aagtcgaaaa attcacctgg
gacggcaata aatatacctc caaagaacag 2880tcaacgaaca ttcaagatat caccaatagc
ctgaacggta ccacgaatgc atactctaaa 2940accattacgg acgtgctgaa cctgtttacc
cgtaatatcc aggaagttcg caacctgaaa 3000gaaagctatg acctgtttcg tggcaaagca
gaaaatacgt cggtggttgg ctattacacc 3060ggtgctaaca gtcagcgcca aaaaatctcc
cagcaagatt tctacaaaaa actggatgac 3120agtgacaccc acatcagctc tctgaaaggt
ctgctgcagc tgcgtgaatt cgttaacgat 3180aacaaaaaca aaaccacggt cgaaccgtgg
aaaaatagcc tgaaaacgga tgcggacgaa 3240gttaaaaaat ggtctgatga attcaccaaa
aatctggaca acattgtcaa cagttccatc 3300gataacaaaa tcaaaaacat caaactggtg
tctaaagtta gtaaaacgtc atcgagcttt 3360gccaccttcg aacaggacgt gaaaaccagc
ccgacgggct ctagtattaa cctgacggaa 3420cgcaacaatg aaaccgtcgt gggcgatatc
aaaaacctga aagaccataa tccgtatgtc 3480tttggtacca gtccggtgaa tgatccgttc
ggcatgaacg tgattggtga aaataaagat 3540ccggacatta aaaacctgaa accgaccatc
aaatattcca ccgaaaaact gacgaaaaaa 3600gatgactcat acattaatct gtcgaacaat
ggtaacaaca acaaccagtt cgtttacaac 3660atcaaccaaa aatgggaact gtcctcagca
cataatttct attacatgag caaagatccg 3720gaaacgctgg aactgcagat tacccacagc
atcgaaaaca aatcttttac cttctacgtc 3780caatttggcg gtctgcgtaa aatttatacc
ccgatcgtgg aatcttacac cccgaaaaat 3840acgaactcag cggataaacg ttattcgttt
gtgggctggg ccttcaattc gtaccgcttt 3900agcgatgact tctctaaggg taactcgagc
ccgtacaaat tcaaagatat tagtctgaaa 3960atctcccaga acgctttcac cacgaatacc
ggcagcgtta acggtaaata a 4011731336PRTArtificial
SequenceLtkA-MSC_0957 fusion protein 73Met Ala Thr Val Ile Asp Leu Ser
Phe Pro Lys Thr Gly Ala Lys Lys 1 5 10
15 Ile Ile Leu Tyr Ile Pro Gln Asn Tyr Gln Tyr Asp Thr
Glu Gln Gly 20 25 30
Asn Gly Leu Gln Asp Leu Val Lys Ala Ala Glu Glu Leu Gly Ile Glu
35 40 45 Val Gln Arg Glu
Glu Arg Asn Asn Ile Ala Thr Ala Gln Thr Ser Leu 50
55 60 Gly Thr Ile Gln Thr Ala Ile Gly
Leu Thr Glu Arg Gly Ile Val Leu 65 70
75 80 Ser Ala Pro Gln Ile Asp Lys Leu Leu Gln Lys Thr
Lys Ala Gly Gln 85 90
95 Ala Leu Gly Ser Ala Glu Ser Ile Val Gln Asn Ala Asn Lys Ala Lys
100 105 110 Thr Val Leu
Ser Gly Ile Gln Ser Ile Leu Gly Ser Val Leu Ala Gly 115
120 125 Met Asp Leu Asp Glu Ala Leu Gln
Asn Asn Ser Asn Gln His Ala Leu 130 135
140 Ala Lys Ala Gly Leu Glu Leu Thr Asn Ser Leu Ile Glu
Asn Ile Ala 145 150 155
160 Asn Ser Val Lys Thr Leu Asp Glu Phe Gly Glu Gln Ile Ser Gln Phe
165 170 175 Gly Ser Lys Leu
Gln Asn Ile Lys Gly Leu Gly Thr Leu Gly Asp Lys 180
185 190 Leu Lys Asn Ile Gly Gly Leu Asp Lys
Ala Gly Leu Gly Leu Asp Val 195 200
205 Ile Ser Gly Leu Leu Ser Gly Ala Thr Ala Ala Leu Val Leu
Ala Asp 210 215 220
Lys Asn Ala Ser Thr Ala Lys Lys Val Gly Ala Gly Phe Glu Leu Ala 225
230 235 240 Asn Gln Val Val Gly
Asn Ile Thr Lys Ala Val Ser Ser Tyr Ile Leu 245
250 255 Ala Gln Arg Val Ala Ala Gly Leu Ser Ser
Thr Gly Pro Val Ala Ala 260 265
270 Leu Ile Ala Ser Thr Val Ser Leu Ala Ile Ser Pro Leu Ala Phe
Ala 275 280 285 Gly
Ile Ala Asp Lys Phe Asn His Ala Lys Ser Leu Glu Ser Tyr Ala 290
295 300 Glu Arg Phe Lys Lys Leu
Gly Tyr Asp Gly Asp Asn Leu Leu Ala Glu 305 310
315 320 Tyr Gln Arg Gly Thr Gly Thr Ile Asp Ala Ser
Val Thr Ala Ile Asn 325 330
335 Thr Ala Leu Ala Ala Ile Ala Gly Gly Val Ser Ala Ala Ala Ala Gly
340 345 350 Ser Val
Ile Ala Ser Pro Ile Ala Leu Leu Val Ser Gly Ile Thr Gly 355
360 365 Val Ile Ser Thr Ile Leu Gln
Tyr Ser Lys Gln Ala Met Phe Glu His 370 375
380 Val Ala Asn Lys Ile His Asn Lys Ile Val Glu Trp
Glu Lys Asn Asn 385 390 395
400 His Gly Lys Asn Tyr Phe Glu Asn Gly Tyr Asp Ala Arg Tyr Leu Ala
405 410 415 Asn Leu Gln
Asp Asn Met Lys Phe Leu Leu Asn Leu Asn Lys Glu Leu 420
425 430 Gln Ala Glu Arg Val Ile Ala Ile
Thr Gln Gln Gln Trp Asp Asn Asn 435 440
445 Ile Gly Asp Leu Ala Gly Ile Ser Arg Leu Gly Glu Lys
Val Leu Ser 450 455 460
Gly Lys Ala Tyr Val Asp Ala Phe Glu Glu Gly Lys His Ile Lys Ala 465
470 475 480 Asp Lys Leu Val
Gln Leu Asp Ser Ala Asn Gly Ile Ile Asp Val Ser 485
490 495 Asn Ser Gly Lys Ala Lys Thr Gln His
Ile Leu Phe Arg Thr Pro Leu 500 505
510 Leu Thr Pro Gly Thr Glu His Arg Glu Arg Val Gln Thr Gly
Lys Tyr 515 520 525
Glu Tyr Ile Thr Lys Leu Asn Ile Asn Arg Val Asp Ser Trp Lys Ile 530
535 540 Thr Asp Gly Ala Ala
Ser Ser Thr Phe Asp Leu Thr Asn Val Val Gln 545 550
555 560 Arg Ile Gly Ile Glu Leu Asp Asn Ala Gly
Asn Val Thr Lys Thr Lys 565 570
575 Glu Thr Lys Ile Ile Ala Lys Leu Gly Glu Gly Asp Asp Asn Val
Phe 580 585 590 Val
Gly Ser Gly Thr Thr Glu Ile Asp Gly Gly Glu Gly Tyr Asp Arg 595
600 605 Val His Tyr Ser Arg Gly
Asn Tyr Gly Ala Leu Thr Ile Asp Ala Thr 610 615
620 Lys Glu Thr Glu Gln Gly Ser Tyr Thr Val Asn
Arg Phe Val Glu Thr 625 630 635
640 Gly Lys Ala Leu His Glu Val Thr Ser Thr His Thr Ala Leu Val Gly
645 650 655 Asn Arg
Glu Glu Lys Ile Glu Tyr Arg His Ser Asn Asn Gln His His 660
665 670 Ala Gly Tyr Tyr Thr Lys Asp
Thr Leu Lys Ala Val Glu Glu Ile Ile 675 680
685 Gly Thr Ser His Asn Asp Ile Phe Lys Gly Ser Lys
Phe Asn Asp Ala 690 695 700
Phe Asn Gly Gly Asp Gly Val Asp Thr Ile Asp Gly Asn Asp Gly Asn 705
710 715 720 Asp Arg Leu
Phe Gly Gly Lys Gly Asp Asp Ile Leu Asp Gly Gly Asn 725
730 735 Gly Asp Asp Phe Ile Asp Gly Gly
Lys Gly Asn Asp Leu Leu His Gly 740 745
750 Gly Lys Gly Asp Asp Ile Phe Val His Arg Lys Gly Asp
Gly Asn Asp 755 760 765
Ile Ile Thr Asp Ser Asp Gly Asn Asp Lys Leu Ser Phe Ser Asp Ser 770
775 780 Asn Leu Lys Asp
Leu Thr Phe Glu Lys Val Lys His Asn Leu Val Ile 785 790
795 800 Thr Asn Ser Lys Lys Glu Lys Val Thr
Ile Gln Asn Trp Phe Arg Glu 805 810
815 Ala Asp Phe Ala Lys Glu Val Pro Asn Tyr Lys Ala Thr Lys
Asp Glu 820 825 830
Lys Ile Glu Glu Ile Ile Gly Gln Asn Gly Glu Arg Ile Thr Ser Lys
835 840 845 Gln Val Asp Asp
Leu Ile Ala Lys Gly Asn Gly Lys Ile Thr Gln Asp 850
855 860 Glu Leu Ser Lys Val Val Asp Asn
Tyr Glu Leu Leu Lys His Ser Lys 865 870
875 880 Asn Val Thr Asn Ser Leu Asp Lys Leu Ile Ser Ser
Val Ser Ala Phe 885 890
895 Thr Ser Ser Asn Asp Ser Arg Asn Val Leu Val Ala Pro Thr Ser Met
900 905 910 Leu Asp Gln
Ser Leu Ser Ser Leu Gln Phe Ala Arg Gly Ser Cys Ser 915
920 925 Thr Thr Ile Thr His Thr Ile Lys
Thr Ser Phe Asn Asp Asn Val Lys 930 935
940 Val Glu Lys Phe Thr Trp Asp Gly Asn Lys Tyr Thr Ser
Lys Glu Gln 945 950 955
960 Ser Thr Asn Ile Gln Asp Ile Thr Asn Ser Leu Asn Gly Thr Thr Asn
965 970 975 Ala Tyr Ser Lys
Thr Ile Thr Asp Val Leu Asn Leu Phe Thr Arg Asn 980
985 990 Ile Gln Glu Val Arg Asn Leu Lys
Glu Ser Tyr Asp Leu Phe Arg Gly 995 1000
1005 Lys Ala Glu Asn Thr Ser Val Val Gly Tyr Tyr
Thr Gly Ala Asn 1010 1015 1020
Ser Gln Arg Gln Lys Ile Ser Gln Gln Asp Phe Tyr Lys Lys Leu
1025 1030 1035 Asp Asp Ser
Asp Thr His Ile Ser Ser Leu Lys Gly Leu Leu Gln 1040
1045 1050 Leu Arg Glu Phe Val Asn Asp Asn
Lys Asn Lys Thr Thr Val Glu 1055 1060
1065 Pro Trp Lys Asn Ser Leu Lys Thr Asp Ala Asp Glu Val
Lys Lys 1070 1075 1080
Trp Ser Asp Glu Phe Thr Lys Asn Leu Asp Asn Ile Val Asn Ser 1085
1090 1095 Ser Ile Asp Asn Lys
Ile Lys Asn Ile Lys Leu Val Ser Lys Val 1100 1105
1110 Ser Lys Thr Ser Ser Ser Phe Ala Thr Phe
Glu Gln Asp Val Lys 1115 1120 1125
Thr Ser Pro Thr Gly Ser Ser Ile Asn Leu Thr Glu Arg Asn Asn
1130 1135 1140 Glu Thr
Val Val Gly Asp Ile Lys Asn Leu Lys Asp His Asn Pro 1145
1150 1155 Tyr Val Phe Gly Thr Ser Pro
Val Asn Asp Pro Phe Gly Met Asn 1160 1165
1170 Val Ile Gly Glu Asn Lys Asp Pro Asp Ile Lys Asn
Leu Lys Pro 1175 1180 1185
Thr Ile Lys Tyr Ser Thr Glu Lys Leu Thr Lys Lys Asp Asp Ser 1190
1195 1200 Tyr Ile Asn Leu Ser
Asn Asn Gly Asn Asn Asn Asn Gln Phe Val 1205 1210
1215 Tyr Asn Ile Asn Gln Lys Trp Glu Leu Ser
Ser Ala His Asn Phe 1220 1225 1230
Tyr Tyr Met Ser Lys Asp Pro Glu Thr Leu Glu Leu Gln Ile Thr
1235 1240 1245 His Ser
Ile Glu Asn Lys Ser Phe Thr Phe Tyr Val Gln Phe Gly 1250
1255 1260 Gly Leu Arg Lys Ile Tyr Thr
Pro Ile Val Glu Ser Tyr Thr Pro 1265 1270
1275 Lys Asn Thr Asn Ser Ala Asp Lys Arg Tyr Ser Phe
Val Gly Trp 1280 1285 1290
Ala Phe Asn Ser Tyr Arg Phe Ser Asp Asp Phe Ser Lys Gly Asn 1295
1300 1305 Ser Ser Pro Tyr Lys
Phe Lys Asp Ile Ser Leu Lys Ile Ser Gln 1310 1315
1320 Asn Ala Phe Thr Thr Asn Thr Gly Ser Val
Asn Gly Lys 1325 1330 1335
744377DNAArtificial SequencepAA352-MSC_0446-MSC_0117 fusion DNA
74atggctactg ttatagatct aagcttccca aaaactgggg caaaaaaaat tatcctctat
60attccccaaa attaccaata tgatactgaa caaggtaatg gtttacagga tttagtcaaa
120gcggccgaag agttggggat tgaggtacaa agagaagaac gcaataatat tgcaacagct
180caaaccagtt taggcacgat tcaaaccgct attggcttaa ctgagcgtgg cattgtgtta
240tccgctccac aaattgataa attgctacag aaaactaaag caggccaagc attaggttct
300gccgaaagca ttgtacaaaa tgcaaataaa gccaaaactg tattatctgg cattcaatct
360attttaggct cagtattggc tggaatggat ttagatgagg ccttacagaa taacagcaac
420caacatgctc ttgctaaagc tggcttggag ctaacaaatt cattaattga aaatattgct
480aattcagtaa aaacacttga cgaatttggt gagcaaatta gtcaatttgg ttcaaaacta
540caaaatatca aaggcttagg gactttagga gacaaactca aaaatatcgg tggacttgat
600aaagctggcc ttggtttaga tgttatctca gggctattat cgggcgcaac agctgcactt
660gtacttgcag ataaaaatgc ttcaacagct aaaaaagtgg gtgcgggttt tgaattggca
720aaccaagttg ttggtaatat taccaaagcc gtttcttctt acattttagc ccaacgtgtt
780gcagcaggtt tatcttcaac tgggcctgtg gctgctttaa ttgcttctac tgtttctctt
840gcgattagcc cattagcatt tgccggtatt gccgataaat ttaatcatgc aaaaagttta
900gagagttatg ccgaacgctt taaaaaatta ggctatgacg gagataattt attagcagaa
960tatcagcggg gaacagggac tattgatgca tcggttactg caattaatac cgcattggcc
1020gctattgctg gtggtgtgtc tgctgctgca gccggctcgg ttattgcttc accgattgcc
1080ttattagtat ctgggattac cggtgtaatt tctacgattc tgcaatattc taaacaagca
1140atgtttgagc acgttgcaaa taaaattcat aacaaaattg tagaatggga aaaaaataat
1200cacggtaaga actactttga aaatggttac gatgcccgtt atcttgcgaa tttacaagat
1260aatatgaaat tcttactgaa cttaaacaaa gagttacagg cagaacgtgt catcgctatt
1320actcagcagc aatgggataa caacattggt gatttagctg gtattagccg tttaggtgaa
1380aaagtcctta gtggtaaagc ctatgtggat gcgtttgaag aaggcaaaca cattaaagcc
1440gataaattag tacagttgga ttcggcaaac ggtattattg atgtgagtaa ttcgggtaaa
1500gcgaaaactc agcatatctt attcagaacg ccattattga cgccgggaac agagcatcgt
1560gaacgcgtac aaacaggtaa atatgaatat attaccaagc tcaatattaa ccgtgtagat
1620agctggaaaa ttacagatgg tgcagcaagt tctacctttg atttaactaa cgttgttcag
1680cgtattggta ttgaattaga caatgctgga aatgtaacta aaaccaaaga aacaaaaatt
1740attgccaaac ttggtgaagg tgatgacaac gtatttgttg gttctggtac gacggaaatt
1800gatggcggtg aaggttacga ccgagttcac tatagccgtg gaaactatgg tgctttaact
1860attgatgcaa ccaaagagac cgagcaaggt agttataccg taaatcgttt cgtagaaacc
1920ggtaaagcac tacacgaagt gacttcaacc cataccgcat tagtgggcaa ccgtgaagaa
1980aaaatagaat atcgtcatag caataaccag caccatgccg gttattacac caaagatacc
2040ttgaaagctg ttgaagaaat tatcggtaca tcacataacg atatctttaa aggtagtaag
2100ttcaatgatg cctttaacgg tggtgatggt gtcgatacta ttgacggtaa cgacggcaat
2160gaccgcttat ttggtggtaa aggcgatgat attctcgatg gtggaaatgg tgatgatttt
2220atcgatggcg gtaaaggcaa cgacctatta cacggtggca agggcgatga tattttcgtt
2280caccgtaaag gcgatggtaa tgatattatt accgattctg acggcaatga taaattatca
2340ttctctgatt cgaacttaaa agatttaaca tttgaaaaag ttaaacataa tcttgtcatc
2400acgaatagca aaaaagagaa agtgaccatt caaaactggt tccgagaggc tgattttgct
2460aaagaagtgc ctaattataa agcaactaaa gatgagaaaa tcgaagaaat catcggtcaa
2520aatggcgagc ggatcacctc aaagcaagtt gatgatctta tcgcaaaagg taacggcaaa
2580attacccaag atgagctatc aaaagttgtt gataactatg aattgctcaa acatagcaaa
2640aatgtgacaa acagcttaga taagttaatc tcatctgtaa gtgcatttac ctcgtctaat
2700gattcgagaa atgtattagt ggctccaact tcaatgttgg atcaaagttt atcttctctt
2760caatttgcta ggggatccct gctgttcctg gtgaagaaaa ccaccatcaa ccagattagc
2820gacaacaaca acaacagcag caccaacaag caggacaaga acaaacaaga tcacagcaac
2880aacgagaaaa tgggtgaaaa caccaaaaac gacagcgata agatcaacac cgagaaaacc
2940ctggacaacg atcgtatgaa caaccagagc gaccaaccgc gtgaggaaag caccccgcgt
3000aacaacgata gcaaagagaa cgtttggagc cgtggcatta agaaacgtat cctggaaagc
3060ctgaacagca ccaacctgga ctacctgaag accctgagca acagcctgat ccaggagaag
3120gaaaaaaccc tgattagcaa caacatcgac aagaaaaccc tggagtataa gaccaaactg
3180accaagttca gcagcgaact gaagttcgat gagattaaga aagaactgat cagcagcctg
3240gaggaaagca ttaagaaaaa caagaacaac cagcaccaac acaaactgct gctgcaccaa
3300ttcaaggacc gtcagctgga gaaacaacac atcagcgaaa ttaccaagct gatcattgac
3360atctaccgta gcaacctgct gaacgaactg tataaagagc tggatgaaaa aattcagaag
3420gagaaccgtg aattcgagga aatcttcaag cgtaagaaca agaacgagat caagaacaag
3480ctgtttgacc tggtggataa gatcgttgat ctgcaagaag cgctgaaaaa catgagcgtg
3540ggtggcggta tgagcattaa aagcctgctg accatcctga gcagcctgat gattagcgcg
3600agcggtgttg gcctggtggt tgcgtgcacc aagaccgaca gcacccaggc gccgagcacc
3660aaccaaaaca aagacaagga taagaaagat ggtaacggca agagcgagga aaaaccgaag
3720gtgatcagca aaagccagtg gagcgacgcg tttcgtgata gcattaccgg ttgggacatc
3780gagaactacg atttcagcaa accgaacaac aaccagaacc tgccgaaatt tccgaagcaa
3840aacatcgaag tgggcaccta tagcaagaaa caagttctgg acaacagcgc gctgcacagc
3900agcattaaga aaaagatcga tgagatcctg aagatcgagg agaagagcct gaaggtggag
3960aacgtttact tcgacgatga aagcggcaag gcgatcgtta aaagcaccaa gttcagcgac
4020accctgaagg tgacctttct ggttaaagag aacctggaac tgggcgcgta taccaaggac
4080cagatcctgg ataacagcaa gttccacagc accattaaaa agaaaattgc ggagatcctg
4140aaggtggatg aaagcaccct gaccgtgctg gacgtttact atgaagataa aaccggcggt
4200ggcgtggtta aaagcaccaa gctgccgaac gagattaagt tcatctttag cgttaaagaa
4260aagtgaccat ggcatcacag tatcgtgatg acagaggcag ggagtgggac aaaattgaaa
4320tcaaataatg attttatttt gactgatagt gacctgttcg ttgcaacaaa ttgataa
4377751421PRTArtificial SequenceLtkA- MSC_0446-MSC_0117 fusion protein
75Met Ala Thr Val Ile Asp Leu Ser Phe Pro Lys Thr Gly Ala Lys Lys 1
5 10 15 Ile Ile Leu Tyr
Ile Pro Gln Asn Tyr Gln Tyr Asp Thr Glu Gln Gly 20
25 30 Asn Gly Leu Gln Asp Leu Val Lys Ala
Ala Glu Glu Leu Gly Ile Glu 35 40
45 Val Gln Arg Glu Glu Arg Asn Asn Ile Ala Thr Ala Gln Thr
Ser Leu 50 55 60
Gly Thr Ile Gln Thr Ala Ile Gly Leu Thr Glu Arg Gly Ile Val Leu 65
70 75 80 Ser Ala Pro Gln Ile
Asp Lys Leu Leu Gln Lys Thr Lys Ala Gly Gln 85
90 95 Ala Leu Gly Ser Ala Glu Ser Ile Val Gln
Asn Ala Asn Lys Ala Lys 100 105
110 Thr Val Leu Ser Gly Ile Gln Ser Ile Leu Gly Ser Val Leu Ala
Gly 115 120 125 Met
Asp Leu Asp Glu Ala Leu Gln Asn Asn Ser Asn Gln His Ala Leu 130
135 140 Ala Lys Ala Gly Leu Glu
Leu Thr Asn Ser Leu Ile Glu Asn Ile Ala 145 150
155 160 Asn Ser Val Lys Thr Leu Asp Glu Phe Gly Glu
Gln Ile Ser Gln Phe 165 170
175 Gly Ser Lys Leu Gln Asn Ile Lys Gly Leu Gly Thr Leu Gly Asp Lys
180 185 190 Leu Lys
Asn Ile Gly Gly Leu Asp Lys Ala Gly Leu Gly Leu Asp Val 195
200 205 Ile Ser Gly Leu Leu Ser Gly
Ala Thr Ala Ala Leu Val Leu Ala Asp 210 215
220 Lys Asn Ala Ser Thr Ala Lys Lys Val Gly Ala Gly
Phe Glu Leu Ala 225 230 235
240 Asn Gln Val Val Gly Asn Ile Thr Lys Ala Val Ser Ser Tyr Ile Leu
245 250 255 Ala Gln Arg
Val Ala Ala Gly Leu Ser Ser Thr Gly Pro Val Ala Ala 260
265 270 Leu Ile Ala Ser Thr Val Ser Leu
Ala Ile Ser Pro Leu Ala Phe Ala 275 280
285 Gly Ile Ala Asp Lys Phe Asn His Ala Lys Ser Leu Glu
Ser Tyr Ala 290 295 300
Glu Arg Phe Lys Lys Leu Gly Tyr Asp Gly Asp Asn Leu Leu Ala Glu 305
310 315 320 Tyr Gln Arg Gly
Thr Gly Thr Ile Asp Ala Ser Val Thr Ala Ile Asn 325
330 335 Thr Ala Leu Ala Ala Ile Ala Gly Gly
Val Ser Ala Ala Ala Ala Gly 340 345
350 Ser Val Ile Ala Ser Pro Ile Ala Leu Leu Val Ser Gly Ile
Thr Gly 355 360 365
Val Ile Ser Thr Ile Leu Gln Tyr Ser Lys Gln Ala Met Phe Glu His 370
375 380 Val Ala Asn Lys Ile
His Asn Lys Ile Val Glu Trp Glu Lys Asn Asn 385 390
395 400 His Gly Lys Asn Tyr Phe Glu Asn Gly Tyr
Asp Ala Arg Tyr Leu Ala 405 410
415 Asn Leu Gln Asp Asn Met Lys Phe Leu Leu Asn Leu Asn Lys Glu
Leu 420 425 430 Gln
Ala Glu Arg Val Ile Ala Ile Thr Gln Gln Gln Trp Asp Asn Asn 435
440 445 Ile Gly Asp Leu Ala Gly
Ile Ser Arg Leu Gly Glu Lys Val Leu Ser 450 455
460 Gly Lys Ala Tyr Val Asp Ala Phe Glu Glu Gly
Lys His Ile Lys Ala 465 470 475
480 Asp Lys Leu Val Gln Leu Asp Ser Ala Asn Gly Ile Ile Asp Val Ser
485 490 495 Asn Ser
Gly Lys Ala Lys Thr Gln His Ile Leu Phe Arg Thr Pro Leu 500
505 510 Leu Thr Pro Gly Thr Glu His
Arg Glu Arg Val Gln Thr Gly Lys Tyr 515 520
525 Glu Tyr Ile Thr Lys Leu Asn Ile Asn Arg Val Asp
Ser Trp Lys Ile 530 535 540
Thr Asp Gly Ala Ala Ser Ser Thr Phe Asp Leu Thr Asn Val Val Gln 545
550 555 560 Arg Ile Gly
Ile Glu Leu Asp Asn Ala Gly Asn Val Thr Lys Thr Lys 565
570 575 Glu Thr Lys Ile Ile Ala Lys Leu
Gly Glu Gly Asp Asp Asn Val Phe 580 585
590 Val Gly Ser Gly Thr Thr Glu Ile Asp Gly Gly Glu Gly
Tyr Asp Arg 595 600 605
Val His Tyr Ser Arg Gly Asn Tyr Gly Ala Leu Thr Ile Asp Ala Thr 610
615 620 Lys Glu Thr Glu
Gln Gly Ser Tyr Thr Val Asn Arg Phe Val Glu Thr 625 630
635 640 Gly Lys Ala Leu His Glu Val Thr Ser
Thr His Thr Ala Leu Val Gly 645 650
655 Asn Arg Glu Glu Lys Ile Glu Tyr Arg His Ser Asn Asn Gln
His His 660 665 670
Ala Gly Tyr Tyr Thr Lys Asp Thr Leu Lys Ala Val Glu Glu Ile Ile
675 680 685 Gly Thr Ser His
Asn Asp Ile Phe Lys Gly Ser Lys Phe Asn Asp Ala 690
695 700 Phe Asn Gly Gly Asp Gly Val Asp
Thr Ile Asp Gly Asn Asp Gly Asn 705 710
715 720 Asp Arg Leu Phe Gly Gly Lys Gly Asp Asp Ile Leu
Asp Gly Gly Asn 725 730
735 Gly Asp Asp Phe Ile Asp Gly Gly Lys Gly Asn Asp Leu Leu His Gly
740 745 750 Gly Lys Gly
Asp Asp Ile Phe Val His Arg Lys Gly Asp Gly Asn Asp 755
760 765 Ile Ile Thr Asp Ser Asp Gly Asn
Asp Lys Leu Ser Phe Ser Asp Ser 770 775
780 Asn Leu Lys Asp Leu Thr Phe Glu Lys Val Lys His Asn
Leu Val Ile 785 790 795
800 Thr Asn Ser Lys Lys Glu Lys Val Thr Ile Gln Asn Trp Phe Arg Glu
805 810 815 Ala Asp Phe Ala
Lys Glu Val Pro Asn Tyr Lys Ala Thr Lys Asp Glu 820
825 830 Lys Ile Glu Glu Ile Ile Gly Gln Asn
Gly Glu Arg Ile Thr Ser Lys 835 840
845 Gln Val Asp Asp Leu Ile Ala Lys Gly Asn Gly Lys Ile Thr
Gln Asp 850 855 860
Glu Leu Ser Lys Val Val Asp Asn Tyr Glu Leu Leu Lys His Ser Lys 865
870 875 880 Asn Val Thr Asn Ser
Leu Asp Lys Leu Ile Ser Ser Val Ser Ala Phe 885
890 895 Thr Ser Ser Asn Asp Ser Arg Asn Val Leu
Val Ala Pro Thr Ser Met 900 905
910 Leu Asp Gln Ser Leu Ser Ser Leu Gln Phe Ala Arg Gly Ser Leu
Leu 915 920 925 Phe
Leu Val Lys Lys Thr Thr Ile Asn Gln Ile Ser Asp Asn Asn Asn 930
935 940 Asn Ser Ser Thr Asn Lys
Gln Asp Lys Asn Lys Gln Asp His Ser Asn 945 950
955 960 Asn Glu Lys Met Gly Glu Asn Thr Lys Asn Asp
Ser Asp Lys Ile Asn 965 970
975 Thr Glu Lys Thr Leu Asp Asn Asp Arg Met Asn Asn Gln Ser Asp Gln
980 985 990 Pro Arg
Glu Glu Ser Thr Pro Arg Asn Asn Asp Ser Lys Glu Asn Val 995
1000 1005 Trp Ser Arg Gly Ile
Lys Lys Arg Ile Leu Glu Ser Leu Asn Ser 1010 1015
1020 Thr Asn Leu Asp Tyr Leu Lys Thr Leu Ser
Asn Ser Leu Ile Gln 1025 1030 1035
Glu Lys Glu Lys Thr Leu Ile Ser Asn Asn Ile Asp Lys Lys Thr
1040 1045 1050 Leu Glu
Tyr Lys Thr Lys Leu Thr Lys Phe Ser Ser Glu Leu Lys 1055
1060 1065 Phe Asp Glu Ile Lys Lys Glu
Leu Ile Ser Ser Leu Glu Glu Ser 1070 1075
1080 Ile Lys Lys Asn Lys Asn Asn Gln His Gln His Lys
Leu Leu Leu 1085 1090 1095
His Gln Phe Lys Asp Arg Gln Leu Glu Lys Gln His Ile Ser Glu 1100
1105 1110 Ile Thr Lys Leu Ile
Ile Asp Ile Tyr Arg Ser Asn Leu Leu Asn 1115 1120
1125 Glu Leu Tyr Lys Glu Leu Asp Glu Lys Ile
Gln Lys Glu Asn Arg 1130 1135 1140
Glu Phe Glu Glu Ile Phe Lys Arg Lys Asn Lys Asn Glu Ile Lys
1145 1150 1155 Asn Lys
Leu Phe Asp Leu Val Asp Lys Ile Val Asp Leu Gln Glu 1160
1165 1170 Ala Leu Lys Asn Met Ser Val
Gly Gly Gly Met Ser Ile Lys Ser 1175 1180
1185 Leu Leu Thr Ile Leu Ser Ser Leu Met Ile Ser Ala
Ser Gly Val 1190 1195 1200
Gly Leu Val Val Ala Cys Thr Lys Thr Asp Ser Thr Gln Ala Pro 1205
1210 1215 Ser Thr Asn Gln Asn
Lys Asp Lys Asp Lys Lys Asp Gly Asn Gly 1220 1225
1230 Lys Ser Glu Glu Lys Pro Lys Val Ile Ser
Lys Ser Gln Trp Ser 1235 1240 1245
Asp Ala Phe Arg Asp Ser Ile Thr Gly Trp Asp Ile Glu Asn Tyr
1250 1255 1260 Asp Phe
Ser Lys Pro Asn Asn Asn Gln Asn Leu Pro Lys Phe Pro 1265
1270 1275 Lys Gln Asn Ile Glu Val Gly
Thr Tyr Ser Lys Lys Gln Val Leu 1280 1285
1290 Asp Asn Ser Ala Leu His Ser Ser Ile Lys Lys Lys
Ile Asp Glu 1295 1300 1305
Ile Leu Lys Ile Glu Glu Lys Ser Leu Lys Val Glu Asn Val Tyr 1310
1315 1320 Phe Asp Asp Glu Ser
Gly Lys Ala Ile Val Lys Ser Thr Lys Phe 1325 1330
1335 Ser Asp Thr Leu Lys Val Thr Phe Leu Val
Lys Glu Asn Leu Glu 1340 1345 1350
Leu Gly Ala Tyr Thr Lys Asp Gln Ile Leu Asp Asn Ser Lys Phe
1355 1360 1365 His Ser
Thr Ile Lys Lys Lys Ile Ala Glu Ile Leu Lys Val Asp 1370
1375 1380 Glu Ser Thr Leu Thr Val Leu
Asp Val Tyr Tyr Glu Asp Lys Thr 1385 1390
1395 Gly Gly Gly Val Val Lys Ser Thr Lys Leu Pro Asn
Glu Ile Lys 1400 1405 1410
Phe Ile Phe Ser Val Lys Glu Lys 1415 1420
764518DNAArtificial SequencepAA352-MSC 0922-MSC_1058 fusion DNA
76atggctactg ttatagatct aagcttccca aaaactgggg caaaaaaaat tatcctctat
60attccccaaa attaccaata tgatactgaa caaggtaatg gtttacagga tttagtcaaa
120gcggccgaag agttggggat tgaggtacaa agagaagaac gcaataatat tgcaacagct
180caaaccagtt taggcacgat tcaaaccgct attggcttaa ctgagcgtgg cattgtgtta
240tccgctccac aaattgataa attgctacag aaaactaaag caggccaagc attaggttct
300gccgaaagca ttgtacaaaa tgcaaataaa gccaaaactg tattatctgg cattcaatct
360attttaggct cagtattggc tggaatggat ttagatgagg ccttacagaa taacagcaac
420caacatgctc ttgctaaagc tggcttggag ctaacaaatt cattaattga aaatattgct
480aattcagtaa aaacacttga cgaatttggt gagcaaatta gtcaatttgg ttcaaaacta
540caaaatatca aaggcttagg gactttagga gacaaactca aaaatatcgg tggacttgat
600aaagctggcc ttggtttaga tgttatctca gggctattat cgggcgcaac agctgcactt
660gtacttgcag ataaaaatgc ttcaacagct aaaaaagtgg gtgcgggttt tgaattggca
720aaccaagttg ttggtaatat taccaaagcc gtttcttctt acattttagc ccaacgtgtt
780gcagcaggtt tatcttcaac tgggcctgtg gctgctttaa ttgcttctac tgtttctctt
840gcgattagcc cattagcatt tgccggtatt gccgataaat ttaatcatgc aaaaagttta
900gagagttatg ccgaacgctt taaaaaatta ggctatgacg gagataattt attagcagaa
960tatcagcggg gaacagggac tattgatgca tcggttactg caattaatac cgcattggcc
1020gctattgctg gtggtgtgtc tgctgctgca gccggctcgg ttattgcttc accgattgcc
1080ttattagtat ctgggattac cggtgtaatt tctacgattc tgcaatattc taaacaagca
1140atgtttgagc acgttgcaaa taaaattcat aacaaaattg tagaatggga aaaaaataat
1200cacggtaaga actactttga aaatggttac gatgcccgtt atcttgcgaa tttacaagat
1260aatatgaaat tcttactgaa cttaaacaaa gagttacagg cagaacgtgt catcgctatt
1320actcagcagc aatgggataa caacattggt gatttagctg gtattagccg tttaggtgaa
1380aaagtcctta gtggtaaagc ctatgtggat gcgtttgaag aaggcaaaca cattaaagcc
1440gataaattag tacagttgga ttcggcaaac ggtattattg atgtgagtaa ttcgggtaaa
1500gcgaaaactc agcatatctt attcagaacg ccattattga cgccgggaac agagcatcgt
1560gaacgcgtac aaacaggtaa atatgaatat attaccaagc tcaatattaa ccgtgtagat
1620agctggaaaa ttacagatgg tgcagcaagt tctacctttg atttaactaa cgttgttcag
1680cgtattggta ttgaattaga caatgctgga aatgtaacta aaaccaaaga aacaaaaatt
1740attgccaaac ttggtgaagg tgatgacaac gtatttgttg gttctggtac gacggaaatt
1800gatggcggtg aaggttacga ccgagttcac tatagccgtg gaaactatgg tgctttaact
1860attgatgcaa ccaaagagac cgagcaaggt agttataccg taaatcgttt cgtagaaacc
1920ggtaaagcac tacacgaagt gacttcaacc cataccgcat tagtgggcaa ccgtgaagaa
1980aaaatagaat atcgtcatag caataaccag caccatgccg gttattacac caaagatacc
2040ttgaaagctg ttgaagaaat tatcggtaca tcacataacg atatctttaa aggtagtaag
2100ttcaatgatg cctttaacgg tggtgatggt gtcgatacta ttgacggtaa cgacggcaat
2160gaccgcttat ttggtggtaa aggcgatgat attctcgatg gtggaaatgg tgatgatttt
2220atcgatggcg gtaaaggcaa cgacctatta cacggtggca agggcgatga tattttcgtt
2280caccgtaaag gcgatggtaa tgatattatt accgattctg acggcaatga taaattatca
2340ttctctgatt cgaacttaaa agatttaaca tttgaaaaag ttaaacataa tcttgtcatc
2400acgaatagca aaaaagagaa agtgaccatt caaaactggt tccgagaggc tgattttgct
2460aaagaagtgc ctaattataa agcaactaaa gatgagaaaa tcgaagaaat catcggtcaa
2520aatggcgagc ggatcacctc aaagcaagtt gatgatctta tcgcaaaagg taacggcaaa
2580attacccaag atgagctatc aaaagttgtt gataactatg aattgctcaa acatagcaaa
2640aatgtgacaa acagcttaga taagttaatc tcatctgtaa gtgcatttac ctcgtctaat
2700gattcgagaa atgtattagt ggctccaact tcaatgttgg atcaaagttt atcttctctt
2760caatttgcta ggggatccaa gaaactgctg atcggcttca gcagcatttt cgcgtttctg
2820accgtgagct gcagcaccag caccccgaag gttaacccga ccatcaacaa gaacgagaac
2880aaactgtaca aaaacaagta tgtgagcaag ctgctgaacc tgtacctgag cgacagcaaa
2940ctgcgtgata gctatattaa cgaccaggag aacgttagcg atagcaagtt tagcgaactg
3000aaatacggcc tgaccttcta tccgatcttt attcaccgta gcctggacta ctatgtgggt
3060cagcactacc gtgttatcat tcaaaaagcg aagaacagcc tggagcaaac cctgcgtaac
3120gattggtact gggtgctgga caacatcacc aacttcaagt ataactttaa cccgtacggc
3180gatctgtata acgaattcaa caaagacgag gacctgttca agcaggttga aaaagacctg
3240ggtagcctga tcagcagcat caagaacaag aacgtgcaaa acatcatccg tgttaacctg
3300aacaacagca tcaacgagaa aattaaggac gattacctga agaaagaagc gctgtatctg
3360gtgttcgata acaacaaagc gatcaagatc tggaagtacg aatacaagaa caagatcgag
3420ttcctgatga ccagcgacct gttcgttttt aaggacgcga acaacctgga gaaccagatc
3480gagcaactgg aaaacaccat tttcgaaaaa cgtaaaagcg agtacaacaa caacctggaa
3540agcatcaaca aaagcattga gaccaccaag aaacgtaaag aaaagaccca gcaagagatc
3600caggaactga aagagaagat tgaaaagctg gagaaagaaa ccaacaccac caccaccgcg
3660ccgctggcgc tggcgctgga tacccgtacc attgcgccgg gcgtgctgaa gaacgacaag
3720aaaaaggagc cgaccattga ggaactgaaa aaggatctgg agaaaaagga aaaacagctg
3780gagcaattcg acgaaaacgt taaaaagtac gagaaggaca tcgaagatct gccgcagaaa
3840agcaacgata aaaagttcct ggaatttcac gcgaagaacc aatataacga gcgtctgaaa
3900gaaagcctga acgagatcaa caaggacggc tggaaaattg tgcgttttag catgcgtggt
3960atctacgagc aggaaggtgg cggtaaaaag ctgctgacca ttctgggcag cgtgggtctg
4020gttgcgacca ccagcgcggc ggttattgcg tgcggtgata agaccagcca aaaaaccccg
4080gacaccaagc cgaccgagga aacccgtaaa gaggacaaag aggaaccgaa aaaggacgat
4140gaaaaaacca ccgaggacaa aaagaaagag gaagcgttca gcaaggtgga aaaacagatc
4200attggcaact ttagcccgaa caacaacaac gcggtgccgc agagcaacat caagaaaaag
4260ctggcggagc tgctgaaggt tcaagagagc gaactgaccg acctgaacgt ggattatgaa
4320aacaacaccg gtaccgttaa aatcaaggac agcagcaaag cgattgagtt caagtttagc
4380gttaaagaga agaagatcaa caactgacca tggcatcaca gtatcgtgat gacagaggca
4440gggagtggga caaaattgaa atcaaataat gattttattt tgactgatag tgacctgttc
4500gttgcaacaa attgataa
4518771468PRTArtificial SequenceLtkA-MSC_0922-MSC_1058 fusion protein
77Met Ala Thr Val Ile Asp Leu Ser Phe Pro Lys Thr Gly Ala Lys Lys 1
5 10 15 Ile Ile Leu Tyr
Ile Pro Gln Asn Tyr Gln Tyr Asp Thr Glu Gln Gly 20
25 30 Asn Gly Leu Gln Asp Leu Val Lys Ala
Ala Glu Glu Leu Gly Ile Glu 35 40
45 Val Gln Arg Glu Glu Arg Asn Asn Ile Ala Thr Ala Gln Thr
Ser Leu 50 55 60
Gly Thr Ile Gln Thr Ala Ile Gly Leu Thr Glu Arg Gly Ile Val Leu 65
70 75 80 Ser Ala Pro Gln Ile
Asp Lys Leu Leu Gln Lys Thr Lys Ala Gly Gln 85
90 95 Ala Leu Gly Ser Ala Glu Ser Ile Val Gln
Asn Ala Asn Lys Ala Lys 100 105
110 Thr Val Leu Ser Gly Ile Gln Ser Ile Leu Gly Ser Val Leu Ala
Gly 115 120 125 Met
Asp Leu Asp Glu Ala Leu Gln Asn Asn Ser Asn Gln His Ala Leu 130
135 140 Ala Lys Ala Gly Leu Glu
Leu Thr Asn Ser Leu Ile Glu Asn Ile Ala 145 150
155 160 Asn Ser Val Lys Thr Leu Asp Glu Phe Gly Glu
Gln Ile Ser Gln Phe 165 170
175 Gly Ser Lys Leu Gln Asn Ile Lys Gly Leu Gly Thr Leu Gly Asp Lys
180 185 190 Leu Lys
Asn Ile Gly Gly Leu Asp Lys Ala Gly Leu Gly Leu Asp Val 195
200 205 Ile Ser Gly Leu Leu Ser Gly
Ala Thr Ala Ala Leu Val Leu Ala Asp 210 215
220 Lys Asn Ala Ser Thr Ala Lys Lys Val Gly Ala Gly
Phe Glu Leu Ala 225 230 235
240 Asn Gln Val Val Gly Asn Ile Thr Lys Ala Val Ser Ser Tyr Ile Leu
245 250 255 Ala Gln Arg
Val Ala Ala Gly Leu Ser Ser Thr Gly Pro Val Ala Ala 260
265 270 Leu Ile Ala Ser Thr Val Ser Leu
Ala Ile Ser Pro Leu Ala Phe Ala 275 280
285 Gly Ile Ala Asp Lys Phe Asn His Ala Lys Ser Leu Glu
Ser Tyr Ala 290 295 300
Glu Arg Phe Lys Lys Leu Gly Tyr Asp Gly Asp Asn Leu Leu Ala Glu 305
310 315 320 Tyr Gln Arg Gly
Thr Gly Thr Ile Asp Ala Ser Val Thr Ala Ile Asn 325
330 335 Thr Ala Leu Ala Ala Ile Ala Gly Gly
Val Ser Ala Ala Ala Ala Gly 340 345
350 Ser Val Ile Ala Ser Pro Ile Ala Leu Leu Val Ser Gly Ile
Thr Gly 355 360 365
Val Ile Ser Thr Ile Leu Gln Tyr Ser Lys Gln Ala Met Phe Glu His 370
375 380 Val Ala Asn Lys Ile
His Asn Lys Ile Val Glu Trp Glu Lys Asn Asn 385 390
395 400 His Gly Lys Asn Tyr Phe Glu Asn Gly Tyr
Asp Ala Arg Tyr Leu Ala 405 410
415 Asn Leu Gln Asp Asn Met Lys Phe Leu Leu Asn Leu Asn Lys Glu
Leu 420 425 430 Gln
Ala Glu Arg Val Ile Ala Ile Thr Gln Gln Gln Trp Asp Asn Asn 435
440 445 Ile Gly Asp Leu Ala Gly
Ile Ser Arg Leu Gly Glu Lys Val Leu Ser 450 455
460 Gly Lys Ala Tyr Val Asp Ala Phe Glu Glu Gly
Lys His Ile Lys Ala 465 470 475
480 Asp Lys Leu Val Gln Leu Asp Ser Ala Asn Gly Ile Ile Asp Val Ser
485 490 495 Asn Ser
Gly Lys Ala Lys Thr Gln His Ile Leu Phe Arg Thr Pro Leu 500
505 510 Leu Thr Pro Gly Thr Glu His
Arg Glu Arg Val Gln Thr Gly Lys Tyr 515 520
525 Glu Tyr Ile Thr Lys Leu Asn Ile Asn Arg Val Asp
Ser Trp Lys Ile 530 535 540
Thr Asp Gly Ala Ala Ser Ser Thr Phe Asp Leu Thr Asn Val Val Gln 545
550 555 560 Arg Ile Gly
Ile Glu Leu Asp Asn Ala Gly Asn Val Thr Lys Thr Lys 565
570 575 Glu Thr Lys Ile Ile Ala Lys Leu
Gly Glu Gly Asp Asp Asn Val Phe 580 585
590 Val Gly Ser Gly Thr Thr Glu Ile Asp Gly Gly Glu Gly
Tyr Asp Arg 595 600 605
Val His Tyr Ser Arg Gly Asn Tyr Gly Ala Leu Thr Ile Asp Ala Thr 610
615 620 Lys Glu Thr Glu
Gln Gly Ser Tyr Thr Val Asn Arg Phe Val Glu Thr 625 630
635 640 Gly Lys Ala Leu His Glu Val Thr Ser
Thr His Thr Ala Leu Val Gly 645 650
655 Asn Arg Glu Glu Lys Ile Glu Tyr Arg His Ser Asn Asn Gln
His His 660 665 670
Ala Gly Tyr Tyr Thr Lys Asp Thr Leu Lys Ala Val Glu Glu Ile Ile
675 680 685 Gly Thr Ser His
Asn Asp Ile Phe Lys Gly Ser Lys Phe Asn Asp Ala 690
695 700 Phe Asn Gly Gly Asp Gly Val Asp
Thr Ile Asp Gly Asn Asp Gly Asn 705 710
715 720 Asp Arg Leu Phe Gly Gly Lys Gly Asp Asp Ile Leu
Asp Gly Gly Asn 725 730
735 Gly Asp Asp Phe Ile Asp Gly Gly Lys Gly Asn Asp Leu Leu His Gly
740 745 750 Gly Lys Gly
Asp Asp Ile Phe Val His Arg Lys Gly Asp Gly Asn Asp 755
760 765 Ile Ile Thr Asp Ser Asp Gly Asn
Asp Lys Leu Ser Phe Ser Asp Ser 770 775
780 Asn Leu Lys Asp Leu Thr Phe Glu Lys Val Lys His Asn
Leu Val Ile 785 790 795
800 Thr Asn Ser Lys Lys Glu Lys Val Thr Ile Gln Asn Trp Phe Arg Glu
805 810 815 Ala Asp Phe Ala
Lys Glu Val Pro Asn Tyr Lys Ala Thr Lys Asp Glu 820
825 830 Lys Ile Glu Glu Ile Ile Gly Gln Asn
Gly Glu Arg Ile Thr Ser Lys 835 840
845 Gln Val Asp Asp Leu Ile Ala Lys Gly Asn Gly Lys Ile Thr
Gln Asp 850 855 860
Glu Leu Ser Lys Val Val Asp Asn Tyr Glu Leu Leu Lys His Ser Lys 865
870 875 880 Asn Val Thr Asn Ser
Leu Asp Lys Leu Ile Ser Ser Val Ser Ala Phe 885
890 895 Thr Ser Ser Asn Asp Ser Arg Asn Val Leu
Val Ala Pro Thr Ser Met 900 905
910 Leu Asp Gln Ser Leu Ser Ser Leu Gln Phe Ala Arg Gly Ser Lys
Lys 915 920 925 Leu
Leu Ile Gly Phe Ser Ser Ile Phe Ala Phe Leu Thr Val Ser Cys 930
935 940 Ser Thr Ser Thr Pro Lys
Val Asn Pro Thr Ile Asn Lys Asn Glu Asn 945 950
955 960 Lys Leu Tyr Lys Asn Lys Tyr Val Ser Lys Leu
Leu Asn Leu Tyr Leu 965 970
975 Ser Asp Ser Lys Leu Arg Asp Ser Tyr Ile Asn Asp Gln Glu Asn Val
980 985 990 Ser Asp
Ser Lys Phe Ser Glu Leu Lys Tyr Gly Leu Thr Phe Tyr Pro 995
1000 1005 Ile Phe Ile His Arg
Ser Leu Asp Tyr Tyr Val Gly Gln His Tyr 1010 1015
1020 Arg Val Ile Ile Gln Lys Ala Lys Asn Ser
Leu Glu Gln Thr Leu 1025 1030 1035
Arg Asn Asp Trp Tyr Trp Val Leu Asp Asn Ile Thr Asn Phe Lys
1040 1045 1050 Tyr Asn
Phe Asn Pro Tyr Gly Asp Leu Tyr Asn Glu Phe Asn Lys 1055
1060 1065 Asp Glu Asp Leu Phe Lys Gln
Val Glu Lys Asp Leu Gly Ser Leu 1070 1075
1080 Ile Ser Ser Ile Lys Asn Lys Asn Val Gln Asn Ile
Ile Arg Val 1085 1090 1095
Asn Leu Asn Asn Ser Ile Asn Glu Lys Ile Lys Asp Asp Tyr Leu 1100
1105 1110 Lys Lys Glu Ala Leu
Tyr Leu Val Phe Asp Asn Asn Lys Ala Ile 1115 1120
1125 Lys Ile Trp Lys Tyr Glu Tyr Lys Asn Lys
Ile Glu Phe Leu Met 1130 1135 1140
Thr Ser Asp Leu Phe Val Phe Lys Asp Ala Asn Asn Leu Glu Asn
1145 1150 1155 Gln Ile
Glu Gln Leu Glu Asn Thr Ile Phe Glu Lys Arg Lys Ser 1160
1165 1170 Glu Tyr Asn Asn Asn Leu Glu
Ser Ile Asn Lys Ser Ile Glu Thr 1175 1180
1185 Thr Lys Lys Arg Lys Glu Lys Thr Gln Gln Glu Ile
Gln Glu Leu 1190 1195 1200
Lys Glu Lys Ile Glu Lys Leu Glu Lys Glu Thr Asn Thr Thr Thr 1205
1210 1215 Thr Ala Pro Leu Ala
Leu Ala Leu Asp Thr Arg Thr Ile Ala Pro 1220 1225
1230 Gly Val Leu Lys Asn Asp Lys Lys Lys Glu
Pro Thr Ile Glu Glu 1235 1240 1245
Leu Lys Lys Asp Leu Glu Lys Lys Glu Lys Gln Leu Glu Gln Phe
1250 1255 1260 Asp Glu
Asn Val Lys Lys Tyr Glu Lys Asp Ile Glu Asp Leu Pro 1265
1270 1275 Gln Lys Ser Asn Asp Lys Lys
Phe Leu Glu Phe His Ala Lys Asn 1280 1285
1290 Gln Tyr Asn Glu Arg Leu Lys Glu Ser Leu Asn Glu
Ile Asn Lys 1295 1300 1305
Asp Gly Trp Lys Ile Val Arg Phe Ser Met Arg Gly Ile Tyr Glu 1310
1315 1320 Gln Glu Gly Gly Gly
Lys Lys Leu Leu Thr Ile Leu Gly Ser Val 1325 1330
1335 Gly Leu Val Ala Thr Thr Ser Ala Ala Val
Ile Ala Cys Gly Asp 1340 1345 1350
Lys Thr Ser Gln Lys Thr Pro Asp Thr Lys Pro Thr Glu Glu Thr
1355 1360 1365 Arg Lys
Glu Asp Lys Glu Glu Pro Lys Lys Asp Asp Glu Lys Thr 1370
1375 1380 Thr Glu Asp Lys Lys Lys Glu
Glu Ala Phe Ser Lys Val Glu Lys 1385 1390
1395 Gln Ile Ile Gly Asn Phe Ser Pro Asn Asn Asn Asn
Ala Val Pro 1400 1405 1410
Gln Ser Asn Ile Lys Lys Lys Leu Ala Glu Leu Leu Lys Val Gln 1415
1420 1425 Glu Ser Glu Leu Thr
Asp Leu Asn Val Asp Tyr Glu Asn Asn Thr 1430 1435
1440 Gly Thr Val Lys Ile Lys Asp Ser Ser Lys
Ala Ile Glu Phe Lys 1445 1450 1455
Phe Ser Val Lys Glu Lys Lys Ile Asn Asn 1460
1465 783822DNAArtificial SequencepAA352-YP_004399807.1
fusion DNA 78atggctactg ttatagatct aagcttccca aaaactgggg caaaaaaaat
tatcctctat 60attccccaaa attaccaata tgatactgaa caaggtaatg gtttacagga
tttagtcaaa 120gcggccgaag agttggggat tgaggtacaa agagaagaac gcaataatat
tgcaacagct 180caaaccagtt taggcacgat tcaaaccgct attggcttaa ctgagcgtgg
cattgtgtta 240tccgctccac aaattgataa attgctacag aaaactaaag caggccaagc
attaggttct 300gccgaaagca ttgtacaaaa tgcaaataaa gccaaaactg tattatctgg
cattcaatct 360attttaggct cagtattggc tggaatggat ttagatgagg ccttacagaa
taacagcaac 420caacatgctc ttgctaaagc tggcttggag ctaacaaatt cattaattga
aaatattgct 480aattcagtaa aaacacttga cgaatttggt gagcaaatta gtcaatttgg
ttcaaaacta 540caaaatatca aaggcttagg gactttagga gacaaactca aaaatatcgg
tggacttgat 600aaagctggcc ttggtttaga tgttatctca gggctattat cgggcgcaac
agctgcactt 660gtacttgcag ataaaaatgc ttcaacagct aaaaaagtgg gtgcgggttt
tgaattggca 720aaccaagttg ttggtaatat taccaaagcc gtttcttctt acattttagc
ccaacgtgtt 780gcagcaggtt tatcttcaac tgggcctgtg gctgctttaa ttgcttctac
tgtttctctt 840gcgattagcc cattagcatt tgccggtatt gccgataaat ttaatcatgc
aaaaagttta 900gagagttatg ccgaacgctt taaaaaatta ggctatgacg gagataattt
attagcagaa 960tatcagcggg gaacagggac tattgatgca tcggttactg caattaatac
cgcattggcc 1020gctattgctg gtggtgtgtc tgctgctgca gccggctcgg ttattgcttc
accgattgcc 1080ttattagtat ctgggattac cggtgtaatt tctacgattc tgcaatattc
taaacaagca 1140atgtttgagc acgttgcaaa taaaattcat aacaaaattg tagaatggga
aaaaaataat 1200cacggtaaga actactttga aaatggttac gatgcccgtt atcttgcgaa
tttacaagat 1260aatatgaaat tcttactgaa cttaaacaaa gagttacagg cagaacgtgt
catcgctatt 1320actcagcagc aatgggataa caacattggt gatttagctg gtattagccg
tttaggtgaa 1380aaagtcctta gtggtaaagc ctatgtggat gcgtttgaag aaggcaaaca
cattaaagcc 1440gataaattag tacagttgga ttcggcaaac ggtattattg atgtgagtaa
ttcgggtaaa 1500gcgaaaactc agcatatctt attcagaacg ccattattga cgccgggaac
agagcatcgt 1560gaacgcgtac aaacaggtaa atatgaatat attaccaagc tcaatattaa
ccgtgtagat 1620agctggaaaa ttacagatgg tgcagcaagt tctacctttg atttaactaa
cgttgttcag 1680cgtattggta ttgaattaga caatgctgga aatgtaacta aaaccaaaga
aacaaaaatt 1740attgccaaac ttggtgaagg tgatgacaac gtatttgttg gttctggtac
gacggaaatt 1800gatggcggtg aaggttacga ccgagttcac tatagccgtg gaaactatgg
tgctttaact 1860attgatgcaa ccaaagagac cgagcaaggt agttataccg taaatcgttt
cgtagaaacc 1920ggtaaagcac tacacgaagt gacttcaacc cataccgcat tagtgggcaa
ccgtgaagaa 1980aaaatagaat atcgtcatag caataaccag caccatgccg gttattacac
caaagatacc 2040ttgaaagctg ttgaagaaat tatcggtaca tcacataacg atatctttaa
aggtagtaag 2100ttcaatgatg cctttaacgg tggtgatggt gtcgatacta ttgacggtaa
cgacggcaat 2160gaccgcttat ttggtggtaa aggcgatgat attctcgatg gtggaaatgg
tgatgatttt 2220atcgatggcg gtaaaggcaa cgacctatta cacggtggca agggcgatga
tattttcgtt 2280caccgtaaag gcgatggtaa tgatattatt accgattctg acggcaatga
taaattatca 2340ttctctgatt cgaacttaaa agatttaaca tttgaaaaag ttaaacataa
tcttgtcatc 2400acgaatagca aaaaagagaa agtgaccatt caaaactggt tccgagaggc
tgattttgct 2460aaagaagtgc ctaattataa agcaactaaa gatgagaaaa tcgaagaaat
catcggtcaa 2520aatggcgagc ggatcacctc aaagcaagtt gatgatctta tcgcaaaagg
taacggcaaa 2580attacccaag atgagctatc aaaagttgtt gataactatg aattgctcaa
acatagcaaa 2640aatgtgacaa acagcttaga taagttaatc tcatctgtaa gtgcatttac
ctcgtctaat 2700gattcgagaa atgtattagt ggctccaact tcaatgttgg atcaaagttt
atcttctctt 2760caatttgcta ggggatccag cagcaaagtt caggttatca acaagttcga
tgacattacg 2820tccattaaaa acacgggtgc gttcaaaaac aatcaggcat tcatttcccg
ttcagaactg 2880aaagaaatcg tcagctctaa caataccacg atttctaata ccacgagttc
caccgcagtg 2940atgacctcga cgagcaccac gtctatcggc acccagacga acaataacaa
tgacctgaag 3000aacgcgagtg aacgcctgaa agccctggcg gccaacaact tcaccaagaa
caagaagcag 3060gcatgggatt ccctgcaaaa cgcttcaatg accttctata aaaaggtgca
gccgaccgcg 3120gtcaatgtgc tgggttacga acaaattacc aaagacaacg ttgaaaaact
ggataaggaa 3180ctgaaaaccg tttttctggt cttcaaggac aataccaaag aaacggaaaa
gctggaagtg 3240gaactgctgc cggaaattaa caatggcaac aaagttatcg acaatggtaa
cctgtatctg 3300gatctgctgg aaaaaccgga aaatctgaag ctggcgaacc agaaaagcat
tatcgaagtg 3360ctgcgtccgg aaattaccaa aatcaaggtg gttctgcaaa ataccaaaaa
caataactcc 3420acgaacaaag aagatatcaa gaacaccgaa gttttcaacc tgctgattaa
acagctgagc 3480atctatctgg caaatgctgt caaatacttt aactctgaaa gtggcattat
caccacgaat 3540ccgaccttct cgtataaaac gcgcagcaat caaatctacg actacatcgt
taagaacaag 3600aaggatgaac tgtacaagaa gctggaaacc gcgtttacgt cagaattcaa
caagatcaac 3660ttcatcgata tcttcaaaga cttccagttc gatgaaaaca acagtaacga
taacaaaaag 3720attatcacca agattatcaa atcatcgacg aatagctctg ccagttcctc
aaactcgagc 3780accacgacca cgaccgaact gtctagtacg accacgcgtt aa
3822791273PRTArtificial SequenceLtkA-YP_004399807.1 fusion
protein 79Met Ala Thr Val Ile Asp Leu Ser Phe Pro Lys Thr Gly Ala Lys Lys
1 5 10 15 Ile Ile
Leu Tyr Ile Pro Gln Asn Tyr Gln Tyr Asp Thr Glu Gln Gly 20
25 30 Asn Gly Leu Gln Asp Leu Val
Lys Ala Ala Glu Glu Leu Gly Ile Glu 35 40
45 Val Gln Arg Glu Glu Arg Asn Asn Ile Ala Thr Ala
Gln Thr Ser Leu 50 55 60
Gly Thr Ile Gln Thr Ala Ile Gly Leu Thr Glu Arg Gly Ile Val Leu 65
70 75 80 Ser Ala Pro
Gln Ile Asp Lys Leu Leu Gln Lys Thr Lys Ala Gly Gln 85
90 95 Ala Leu Gly Ser Ala Glu Ser Ile
Val Gln Asn Ala Asn Lys Ala Lys 100 105
110 Thr Val Leu Ser Gly Ile Gln Ser Ile Leu Gly Ser Val
Leu Ala Gly 115 120 125
Met Asp Leu Asp Glu Ala Leu Gln Asn Asn Ser Asn Gln His Ala Leu 130
135 140 Ala Lys Ala Gly
Leu Glu Leu Thr Asn Ser Leu Ile Glu Asn Ile Ala 145 150
155 160 Asn Ser Val Lys Thr Leu Asp Glu Phe
Gly Glu Gln Ile Ser Gln Phe 165 170
175 Gly Ser Lys Leu Gln Asn Ile Lys Gly Leu Gly Thr Leu Gly
Asp Lys 180 185 190
Leu Lys Asn Ile Gly Gly Leu Asp Lys Ala Gly Leu Gly Leu Asp Val
195 200 205 Ile Ser Gly Leu
Leu Ser Gly Ala Thr Ala Ala Leu Val Leu Ala Asp 210
215 220 Lys Asn Ala Ser Thr Ala Lys Lys
Val Gly Ala Gly Phe Glu Leu Ala 225 230
235 240 Asn Gln Val Val Gly Asn Ile Thr Lys Ala Val Ser
Ser Tyr Ile Leu 245 250
255 Ala Gln Arg Val Ala Ala Gly Leu Ser Ser Thr Gly Pro Val Ala Ala
260 265 270 Leu Ile Ala
Ser Thr Val Ser Leu Ala Ile Ser Pro Leu Ala Phe Ala 275
280 285 Gly Ile Ala Asp Lys Phe Asn His
Ala Lys Ser Leu Glu Ser Tyr Ala 290 295
300 Glu Arg Phe Lys Lys Leu Gly Tyr Asp Gly Asp Asn Leu
Leu Ala Glu 305 310 315
320 Tyr Gln Arg Gly Thr Gly Thr Ile Asp Ala Ser Val Thr Ala Ile Asn
325 330 335 Thr Ala Leu Ala
Ala Ile Ala Gly Gly Val Ser Ala Ala Ala Ala Gly 340
345 350 Ser Val Ile Ala Ser Pro Ile Ala Leu
Leu Val Ser Gly Ile Thr Gly 355 360
365 Val Ile Ser Thr Ile Leu Gln Tyr Ser Lys Gln Ala Met Phe
Glu His 370 375 380
Val Ala Asn Lys Ile His Asn Lys Ile Val Glu Trp Glu Lys Asn Asn 385
390 395 400 His Gly Lys Asn Tyr
Phe Glu Asn Gly Tyr Asp Ala Arg Tyr Leu Ala 405
410 415 Asn Leu Gln Asp Asn Met Lys Phe Leu Leu
Asn Leu Asn Lys Glu Leu 420 425
430 Gln Ala Glu Arg Val Ile Ala Ile Thr Gln Gln Gln Trp Asp Asn
Asn 435 440 445 Ile
Gly Asp Leu Ala Gly Ile Ser Arg Leu Gly Glu Lys Val Leu Ser 450
455 460 Gly Lys Ala Tyr Val Asp
Ala Phe Glu Glu Gly Lys His Ile Lys Ala 465 470
475 480 Asp Lys Leu Val Gln Leu Asp Ser Ala Asn Gly
Ile Ile Asp Val Ser 485 490
495 Asn Ser Gly Lys Ala Lys Thr Gln His Ile Leu Phe Arg Thr Pro Leu
500 505 510 Leu Thr
Pro Gly Thr Glu His Arg Glu Arg Val Gln Thr Gly Lys Tyr 515
520 525 Glu Tyr Ile Thr Lys Leu Asn
Ile Asn Arg Val Asp Ser Trp Lys Ile 530 535
540 Thr Asp Gly Ala Ala Ser Ser Thr Phe Asp Leu Thr
Asn Val Val Gln 545 550 555
560 Arg Ile Gly Ile Glu Leu Asp Asn Ala Gly Asn Val Thr Lys Thr Lys
565 570 575 Glu Thr Lys
Ile Ile Ala Lys Leu Gly Glu Gly Asp Asp Asn Val Phe 580
585 590 Val Gly Ser Gly Thr Thr Glu Ile
Asp Gly Gly Glu Gly Tyr Asp Arg 595 600
605 Val His Tyr Ser Arg Gly Asn Tyr Gly Ala Leu Thr Ile
Asp Ala Thr 610 615 620
Lys Glu Thr Glu Gln Gly Ser Tyr Thr Val Asn Arg Phe Val Glu Thr 625
630 635 640 Gly Lys Ala Leu
His Glu Val Thr Ser Thr His Thr Ala Leu Val Gly 645
650 655 Asn Arg Glu Glu Lys Ile Glu Tyr Arg
His Ser Asn Asn Gln His His 660 665
670 Ala Gly Tyr Tyr Thr Lys Asp Thr Leu Lys Ala Val Glu Glu
Ile Ile 675 680 685
Gly Thr Ser His Asn Asp Ile Phe Lys Gly Ser Lys Phe Asn Asp Ala 690
695 700 Phe Asn Gly Gly Asp
Gly Val Asp Thr Ile Asp Gly Asn Asp Gly Asn 705 710
715 720 Asp Arg Leu Phe Gly Gly Lys Gly Asp Asp
Ile Leu Asp Gly Gly Asn 725 730
735 Gly Asp Asp Phe Ile Asp Gly Gly Lys Gly Asn Asp Leu Leu His
Gly 740 745 750 Gly
Lys Gly Asp Asp Ile Phe Val His Arg Lys Gly Asp Gly Asn Asp 755
760 765 Ile Ile Thr Asp Ser Asp
Gly Asn Asp Lys Leu Ser Phe Ser Asp Ser 770 775
780 Asn Leu Lys Asp Leu Thr Phe Glu Lys Val Lys
His Asn Leu Val Ile 785 790 795
800 Thr Asn Ser Lys Lys Glu Lys Val Thr Ile Gln Asn Trp Phe Arg Glu
805 810 815 Ala Asp
Phe Ala Lys Glu Val Pro Asn Tyr Lys Ala Thr Lys Asp Glu 820
825 830 Lys Ile Glu Glu Ile Ile Gly
Gln Asn Gly Glu Arg Ile Thr Ser Lys 835 840
845 Gln Val Asp Asp Leu Ile Ala Lys Gly Asn Gly Lys
Ile Thr Gln Asp 850 855 860
Glu Leu Ser Lys Val Val Asp Asn Tyr Glu Leu Leu Lys His Ser Lys 865
870 875 880 Asn Val Thr
Asn Ser Leu Asp Lys Leu Ile Ser Ser Val Ser Ala Phe 885
890 895 Thr Ser Ser Asn Asp Ser Arg Asn
Val Leu Val Ala Pro Thr Ser Met 900 905
910 Leu Asp Gln Ser Leu Ser Ser Leu Gln Phe Ala Arg Gly
Ser Ser Ser 915 920 925
Lys Val Gln Val Ile Asn Lys Phe Asp Asp Ile Thr Ser Ile Lys Asn 930
935 940 Thr Gly Ala Phe
Lys Asn Asn Gln Ala Phe Ile Ser Arg Ser Glu Leu 945 950
955 960 Lys Glu Ile Val Ser Ser Asn Asn Thr
Thr Ile Ser Asn Thr Thr Ser 965 970
975 Ser Thr Ala Val Met Thr Ser Thr Ser Thr Thr Ser Ile Gly
Thr Gln 980 985 990
Thr Asn Asn Asn Asn Asp Leu Lys Asn Ala Ser Glu Arg Leu Lys Ala
995 1000 1005 Leu Ala Ala
Asn Asn Phe Thr Lys Asn Lys Lys Gln Ala Trp Asp 1010
1015 1020 Ser Leu Gln Asn Ala Ser Met Thr
Phe Tyr Lys Lys Val Gln Pro 1025 1030
1035 Thr Ala Val Asn Val Leu Gly Tyr Glu Gln Ile Thr Lys
Asp Asn 1040 1045 1050
Val Glu Lys Leu Asp Lys Glu Leu Lys Thr Val Phe Leu Val Phe 1055
1060 1065 Lys Asp Asn Thr Lys
Glu Thr Glu Lys Leu Glu Val Glu Leu Leu 1070 1075
1080 Pro Glu Ile Asn Asn Gly Asn Lys Val Ile
Asp Asn Gly Asn Leu 1085 1090 1095
Tyr Leu Asp Leu Leu Glu Lys Pro Glu Asn Leu Lys Leu Ala Asn
1100 1105 1110 Gln Lys
Ser Ile Ile Glu Val Leu Arg Pro Glu Ile Thr Lys Ile 1115
1120 1125 Lys Val Val Leu Gln Asn Thr
Lys Asn Asn Asn Ser Thr Asn Lys 1130 1135
1140 Glu Asp Ile Lys Asn Thr Glu Val Phe Asn Leu Leu
Ile Lys Gln 1145 1150 1155
Leu Ser Ile Tyr Leu Ala Asn Ala Val Lys Tyr Phe Asn Ser Glu 1160
1165 1170 Ser Gly Ile Ile Thr
Thr Asn Pro Thr Phe Ser Tyr Lys Thr Arg 1175 1180
1185 Ser Asn Gln Ile Tyr Asp Tyr Ile Val Lys
Asn Lys Lys Asp Glu 1190 1195 1200
Leu Tyr Lys Lys Leu Glu Thr Ala Phe Thr Ser Glu Phe Asn Lys
1205 1210 1215 Ile Asn
Phe Ile Asp Ile Phe Lys Asp Phe Gln Phe Asp Glu Asn 1220
1225 1230 Asn Ser Asn Asp Asn Lys Lys
Ile Ile Thr Lys Ile Ile Lys Ser 1235 1240
1245 Ser Thr Asn Ser Ser Ala Ser Ser Ser Asn Ser Ser
Thr Thr Thr 1250 1255 1260
Thr Thr Glu Leu Ser Ser Thr Thr Thr Arg 1265 1270
803186DNAArtificial SequencepAA352-YP_004400559.1 fusion DNA
80atggctactg ttatagatct aagcttccca aaaactgggg caaaaaaaat tatcctctat
60attccccaaa attaccaata tgatactgaa caaggtaatg gtttacagga tttagtcaaa
120gcggccgaag agttggggat tgaggtacaa agagaagaac gcaataatat tgcaacagct
180caaaccagtt taggcacgat tcaaaccgct attggcttaa ctgagcgtgg cattgtgtta
240tccgctccac aaattgataa attgctacag aaaactaaag caggccaagc attaggttct
300gccgaaagca ttgtacaaaa tgcaaataaa gccaaaactg tattatctgg cattcaatct
360attttaggct cagtattggc tggaatggat ttagatgagg ccttacagaa taacagcaac
420caacatgctc ttgctaaagc tggcttggag ctaacaaatt cattaattga aaatattgct
480aattcagtaa aaacacttga cgaatttggt gagcaaatta gtcaatttgg ttcaaaacta
540caaaatatca aaggcttagg gactttagga gacaaactca aaaatatcgg tggacttgat
600aaagctggcc ttggtttaga tgttatctca gggctattat cgggcgcaac agctgcactt
660gtacttgcag ataaaaatgc ttcaacagct aaaaaagtgg gtgcgggttt tgaattggca
720aaccaagttg ttggtaatat taccaaagcc gtttcttctt acattttagc ccaacgtgtt
780gcagcaggtt tatcttcaac tgggcctgtg gctgctttaa ttgcttctac tgtttctctt
840gcgattagcc cattagcatt tgccggtatt gccgataaat ttaatcatgc aaaaagttta
900gagagttatg ccgaacgctt taaaaaatta ggctatgacg gagataattt attagcagaa
960tatcagcggg gaacagggac tattgatgca tcggttactg caattaatac cgcattggcc
1020gctattgctg gtggtgtgtc tgctgctgca gccggctcgg ttattgcttc accgattgcc
1080ttattagtat ctgggattac cggtgtaatt tctacgattc tgcaatattc taaacaagca
1140atgtttgagc acgttgcaaa taaaattcat aacaaaattg tagaatggga aaaaaataat
1200cacggtaaga actactttga aaatggttac gatgcccgtt atcttgcgaa tttacaagat
1260aatatgaaat tcttactgaa cttaaacaaa gagttacagg cagaacgtgt catcgctatt
1320actcagcagc aatgggataa caacattggt gatttagctg gtattagccg tttaggtgaa
1380aaagtcctta gtggtaaagc ctatgtggat gcgtttgaag aaggcaaaca cattaaagcc
1440gataaattag tacagttgga ttcggcaaac ggtattattg atgtgagtaa ttcgggtaaa
1500gcgaaaactc agcatatctt attcagaacg ccattattga cgccgggaac agagcatcgt
1560gaacgcgtac aaacaggtaa atatgaatat attaccaagc tcaatattaa ccgtgtagat
1620agctggaaaa ttacagatgg tgcagcaagt tctacctttg atttaactaa cgttgttcag
1680cgtattggta ttgaattaga caatgctgga aatgtaacta aaaccaaaga aacaaaaatt
1740attgccaaac ttggtgaagg tgatgacaac gtatttgttg gttctggtac gacggaaatt
1800gatggcggtg aaggttacga ccgagttcac tatagccgtg gaaactatgg tgctttaact
1860attgatgcaa ccaaagagac cgagcaaggt agttataccg taaatcgttt cgtagaaacc
1920ggtaaagcac tacacgaagt gacttcaacc cataccgcat tagtgggcaa ccgtgaagaa
1980aaaatagaat atcgtcatag caataaccag caccatgccg gttattacac caaagatacc
2040ttgaaagctg ttgaagaaat tatcggtaca tcacataacg atatctttaa aggtagtaag
2100ttcaatgatg cctttaacgg tggtgatggt gtcgatacta ttgacggtaa cgacggcaat
2160gaccgcttat ttggtggtaa aggcgatgat attctcgatg gtggaaatgg tgatgatttt
2220atcgatggcg gtaaaggcaa cgacctatta cacggtggca agggcgatga tattttcgtt
2280caccgtaaag gcgatggtaa tgatattatt accgattctg acggcaatga taaattatca
2340ttctctgatt cgaacttaaa agatttaaca tttgaaaaag ttaaacataa tcttgtcatc
2400acgaatagca aaaaagagaa agtgaccatt caaaactggt tccgagaggc tgattttgct
2460aaagaagtgc ctaattataa agcaactaaa gatgagaaaa tcgaagaaat catcggtcaa
2520aatggcgagc ggatcacctc aaagcaagtt gatgatctta tcgcaaaagg taacggcaaa
2580attacccaag atgagctatc aaaagttgtt gataactatg aattgctcaa acatagcaaa
2640aatgtgacaa acagcttaga taagttaatc tcatctgtaa gtgcatttac ctcgtctaat
2700gattcgagaa atgtattagt ggctccaact tcaatgttgg atcaaagttt atcttctctt
2760caatttgcta ggggatccag caacaacaac aaaaaagaag aaaagcaatc aaaggaaatg
2820aataaaaatc aaacctctaa ctccacgagc accaatatga acaacacgca gggcagcaat
2880agctctacca cgaccaacat tacctctaac ccgatcaata gtgtcacgtc catggcgacc
2940caaccgaaaa acgaaacctt tttcaataag gaaccgctga tcttttcaga actggattat
3000gtgtcggaat acttcaagcg taaggaacat attgcgcgca ccagcgaact gatcctggaa
3060aactctgaag gcattaaacg tcgtatgcag aatagtacgg ttgaaacgac ccaccgtgat
3120tccctggccg aaacccaaga cctgattctg gaaaacagca acggtgtggt taacttcaag
3180aagtaa
3186811061PRTArtificial SequenceLtkA-YP_004400559.1 fusion protein 81Met
Ala Thr Val Ile Asp Leu Ser Phe Pro Lys Thr Gly Ala Lys Lys 1
5 10 15 Ile Ile Leu Tyr Ile Pro
Gln Asn Tyr Gln Tyr Asp Thr Glu Gln Gly 20
25 30 Asn Gly Leu Gln Asp Leu Val Lys Ala Ala
Glu Glu Leu Gly Ile Glu 35 40
45 Val Gln Arg Glu Glu Arg Asn Asn Ile Ala Thr Ala Gln Thr
Ser Leu 50 55 60
Gly Thr Ile Gln Thr Ala Ile Gly Leu Thr Glu Arg Gly Ile Val Leu 65
70 75 80 Ser Ala Pro Gln Ile
Asp Lys Leu Leu Gln Lys Thr Lys Ala Gly Gln 85
90 95 Ala Leu Gly Ser Ala Glu Ser Ile Val Gln
Asn Ala Asn Lys Ala Lys 100 105
110 Thr Val Leu Ser Gly Ile Gln Ser Ile Leu Gly Ser Val Leu Ala
Gly 115 120 125 Met
Asp Leu Asp Glu Ala Leu Gln Asn Asn Ser Asn Gln His Ala Leu 130
135 140 Ala Lys Ala Gly Leu Glu
Leu Thr Asn Ser Leu Ile Glu Asn Ile Ala 145 150
155 160 Asn Ser Val Lys Thr Leu Asp Glu Phe Gly Glu
Gln Ile Ser Gln Phe 165 170
175 Gly Ser Lys Leu Gln Asn Ile Lys Gly Leu Gly Thr Leu Gly Asp Lys
180 185 190 Leu Lys
Asn Ile Gly Gly Leu Asp Lys Ala Gly Leu Gly Leu Asp Val 195
200 205 Ile Ser Gly Leu Leu Ser Gly
Ala Thr Ala Ala Leu Val Leu Ala Asp 210 215
220 Lys Asn Ala Ser Thr Ala Lys Lys Val Gly Ala Gly
Phe Glu Leu Ala 225 230 235
240 Asn Gln Val Val Gly Asn Ile Thr Lys Ala Val Ser Ser Tyr Ile Leu
245 250 255 Ala Gln Arg
Val Ala Ala Gly Leu Ser Ser Thr Gly Pro Val Ala Ala 260
265 270 Leu Ile Ala Ser Thr Val Ser Leu
Ala Ile Ser Pro Leu Ala Phe Ala 275 280
285 Gly Ile Ala Asp Lys Phe Asn His Ala Lys Ser Leu Glu
Ser Tyr Ala 290 295 300
Glu Arg Phe Lys Lys Leu Gly Tyr Asp Gly Asp Asn Leu Leu Ala Glu 305
310 315 320 Tyr Gln Arg Gly
Thr Gly Thr Ile Asp Ala Ser Val Thr Ala Ile Asn 325
330 335 Thr Ala Leu Ala Ala Ile Ala Gly Gly
Val Ser Ala Ala Ala Ala Gly 340 345
350 Ser Val Ile Ala Ser Pro Ile Ala Leu Leu Val Ser Gly Ile
Thr Gly 355 360 365
Val Ile Ser Thr Ile Leu Gln Tyr Ser Lys Gln Ala Met Phe Glu His 370
375 380 Val Ala Asn Lys Ile
His Asn Lys Ile Val Glu Trp Glu Lys Asn Asn 385 390
395 400 His Gly Lys Asn Tyr Phe Glu Asn Gly Tyr
Asp Ala Arg Tyr Leu Ala 405 410
415 Asn Leu Gln Asp Asn Met Lys Phe Leu Leu Asn Leu Asn Lys Glu
Leu 420 425 430 Gln
Ala Glu Arg Val Ile Ala Ile Thr Gln Gln Gln Trp Asp Asn Asn 435
440 445 Ile Gly Asp Leu Ala Gly
Ile Ser Arg Leu Gly Glu Lys Val Leu Ser 450 455
460 Gly Lys Ala Tyr Val Asp Ala Phe Glu Glu Gly
Lys His Ile Lys Ala 465 470 475
480 Asp Lys Leu Val Gln Leu Asp Ser Ala Asn Gly Ile Ile Asp Val Ser
485 490 495 Asn Ser
Gly Lys Ala Lys Thr Gln His Ile Leu Phe Arg Thr Pro Leu 500
505 510 Leu Thr Pro Gly Thr Glu His
Arg Glu Arg Val Gln Thr Gly Lys Tyr 515 520
525 Glu Tyr Ile Thr Lys Leu Asn Ile Asn Arg Val Asp
Ser Trp Lys Ile 530 535 540
Thr Asp Gly Ala Ala Ser Ser Thr Phe Asp Leu Thr Asn Val Val Gln 545
550 555 560 Arg Ile Gly
Ile Glu Leu Asp Asn Ala Gly Asn Val Thr Lys Thr Lys 565
570 575 Glu Thr Lys Ile Ile Ala Lys Leu
Gly Glu Gly Asp Asp Asn Val Phe 580 585
590 Val Gly Ser Gly Thr Thr Glu Ile Asp Gly Gly Glu Gly
Tyr Asp Arg 595 600 605
Val His Tyr Ser Arg Gly Asn Tyr Gly Ala Leu Thr Ile Asp Ala Thr 610
615 620 Lys Glu Thr Glu
Gln Gly Ser Tyr Thr Val Asn Arg Phe Val Glu Thr 625 630
635 640 Gly Lys Ala Leu His Glu Val Thr Ser
Thr His Thr Ala Leu Val Gly 645 650
655 Asn Arg Glu Glu Lys Ile Glu Tyr Arg His Ser Asn Asn Gln
His His 660 665 670
Ala Gly Tyr Tyr Thr Lys Asp Thr Leu Lys Ala Val Glu Glu Ile Ile
675 680 685 Gly Thr Ser His
Asn Asp Ile Phe Lys Gly Ser Lys Phe Asn Asp Ala 690
695 700 Phe Asn Gly Gly Asp Gly Val Asp
Thr Ile Asp Gly Asn Asp Gly Asn 705 710
715 720 Asp Arg Leu Phe Gly Gly Lys Gly Asp Asp Ile Leu
Asp Gly Gly Asn 725 730
735 Gly Asp Asp Phe Ile Asp Gly Gly Lys Gly Asn Asp Leu Leu His Gly
740 745 750 Gly Lys Gly
Asp Asp Ile Phe Val His Arg Lys Gly Asp Gly Asn Asp 755
760 765 Ile Ile Thr Asp Ser Asp Gly Asn
Asp Lys Leu Ser Phe Ser Asp Ser 770 775
780 Asn Leu Lys Asp Leu Thr Phe Glu Lys Val Lys His Asn
Leu Val Ile 785 790 795
800 Thr Asn Ser Lys Lys Glu Lys Val Thr Ile Gln Asn Trp Phe Arg Glu
805 810 815 Ala Asp Phe Ala
Lys Glu Val Pro Asn Tyr Lys Ala Thr Lys Asp Glu 820
825 830 Lys Ile Glu Glu Ile Ile Gly Gln Asn
Gly Glu Arg Ile Thr Ser Lys 835 840
845 Gln Val Asp Asp Leu Ile Ala Lys Gly Asn Gly Lys Ile Thr
Gln Asp 850 855 860
Glu Leu Ser Lys Val Val Asp Asn Tyr Glu Leu Leu Lys His Ser Lys 865
870 875 880 Asn Val Thr Asn Ser
Leu Asp Lys Leu Ile Ser Ser Val Ser Ala Phe 885
890 895 Thr Ser Ser Asn Asp Ser Arg Asn Val Leu
Val Ala Pro Thr Ser Met 900 905
910 Leu Asp Gln Ser Leu Ser Ser Leu Gln Phe Ala Arg Gly Ser Ser
Asn 915 920 925 Asn
Asn Lys Lys Glu Glu Lys Gln Ser Lys Glu Met Asn Lys Asn Gln 930
935 940 Thr Ser Asn Ser Thr Ser
Thr Asn Met Asn Asn Thr Gln Gly Ser Asn 945 950
955 960 Ser Ser Thr Thr Thr Asn Ile Thr Ser Asn Pro
Ile Asn Ser Val Thr 965 970
975 Ser Met Ala Thr Gln Pro Lys Asn Glu Thr Phe Phe Asn Lys Glu Pro
980 985 990 Leu Ile
Phe Ser Glu Leu Asp Tyr Val Ser Glu Tyr Phe Lys Arg Lys 995
1000 1005 Glu His Ile Ala Arg
Thr Ser Glu Leu Ile Leu Glu Asn Ser Glu 1010 1015
1020 Gly Ile Lys Arg Arg Met Gln Asn Ser Thr
Val Glu Thr Thr His 1025 1030 1035
Arg Asp Ser Leu Ala Glu Thr Gln Asp Leu Ile Leu Glu Asn Ser
1040 1045 1050 Asn Gly
Val Val Asn Phe Lys Lys 1055 1060
822778DNAArtificial Sequencenucleotide sequence encoding a representative
leukotoxin 352 from plasmid pAA352 82atggctactg ttatagatct
aagcttccca aaaactgggg caaaaaaaat tatcctctat 60attccccaaa attaccaata
tgatactgaa caaggtaatg gtttacagga tttagtcaaa 120gcggccgaag agttggggat
tgaggtacaa agagaagaac gcaataatat tgcaacagct 180caaaccagtt taggcacgat
tcaaaccgct attggcttaa ctgagcgtgg cattgtgtta 240tccgctccac aaattgataa
attgctacag aaaactaaag caggccaagc attaggttct 300gccgaaagca ttgtacaaaa
tgcaaataaa gccaaaactg tattatctgg cattcaatct 360attttaggct cagtattggc
tggaatggat ttagatgagg ccttacagaa taacagcaac 420caacatgctc ttgctaaagc
tggcttggag ctaacaaatt cattaattga aaatattgct 480aattcagtaa aaacacttga
cgaatttggt gagcaaatta gtcaatttgg ttcaaaacta 540caaaatatca aaggcttagg
gactttagga gacaaactca aaaatatcgg tggacttgat 600aaagctggcc ttggtttaga
tgttatctca gggctattat cgggcgcaac agctgcactt 660gtacttgcag ataaaaatgc
ttcaacagct aaaaaagtgg gtgcgggttt tgaattggca 720aaccaagttg ttggtaatat
taccaaagcc gtttcttctt acattttagc ccaacgtgtt 780gcagcaggtt tatcttcaac
tgggcctgtg gctgctttaa ttgcttctac tgtttctctt 840gcgattagcc cattagcatt
tgccggtatt gccgataaat ttaatcatgc aaaaagttta 900gagagttatg ccgaacgctt
taaaaaatta ggctatgacg gagataattt attagcagaa 960tatcagcggg gaacagggac
tattgatgca tcggttactg caattaatac cgcattggcc 1020gctattgctg gtggtgtgtc
tgctgctgca gccggctcgg ttattgcttc accgattgcc 1080ttattagtat ctgggattac
cggtgtaatt tctacgattc tgcaatattc taaacaagca 1140atgtttgagc acgttgcaaa
taaaattcat aacaaaattg tagaatggga aaaaaataat 1200cacggtaaga actactttga
aaatggttac gatgcccgtt atcttgcgaa tttacaagat 1260aatatgaaat tcttactgaa
cttaaacaaa gagttacagg cagaacgtgt catcgctatt 1320actcagcagc aatgggataa
caacattggt gatttagctg gtattagccg tttaggtgaa 1380aaagtcctta gtggtaaagc
ctatgtggat gcgtttgaag aaggcaaaca cattaaagcc 1440gataaattag tacagttgga
ttcggcaaac ggtattattg atgtgagtaa ttcgggtaaa 1500gcgaaaactc agcatatctt
attcagaacg ccattattga cgccgggaac agagcatcgt 1560gaacgcgtac aaacaggtaa
atatgaatat attaccaagc tcaatattaa ccgtgtagat 1620agctggaaaa ttacagatgg
tgcagcaagt tctacctttg atttaactaa cgttgttcag 1680cgtattggta ttgaattaga
caatgctgga aatgtaacta aaaccaaaga aacaaaaatt 1740attgccaaac ttggtgaagg
tgatgacaac gtatttgttg gttctggtac gacggaaatt 1800gatggcggtg aaggttacga
ccgagttcac tatagccgtg gaaactatgg tgctttaact 1860attgatgcaa ccaaagagac
cgagcaaggt agttataccg taaatcgttt cgtagaaacc 1920ggtaaagcac tacacgaagt
gacttcaacc cataccgcat tagtgggcaa ccgtgaagaa 1980aaaatagaat atcgtcatag
caataaccag caccatgccg gttattacac caaagatacc 2040ttgaaagctg ttgaagaaat
tatcggtaca tcacataacg atatctttaa aggtagtaag 2100ttcaatgatg cctttaacgg
tggtgatggt gtcgatacta ttgacggtaa cgacggcaat 2160gaccgcttat ttggtggtaa
aggcgatgat attctcgatg gtggaaatgg tgatgatttt 2220atcgatggcg gtaaaggcaa
cgacctatta cacggtggca agggcgatga tattttcgtt 2280caccgtaaag gcgatggtaa
tgatattatt accgattctg acggcaatga taaattatca 2340ttctctgatt cgaacttaaa
agatttaaca tttgaaaaag ttaaacataa tcttgtcatc 2400acgaatagca aaaaagagaa
agtgaccatt caaaactggt tccgagaggc tgattttgct 2460aaagaagtgc ctaattataa
agcaactaaa gatgagaaaa tcgaagaaat catcggtcaa 2520aatggcgagc ggatcacctc
aaagcaagtt gatgatctta tcgcaaaagg taacggcaaa 2580attacccaag atgagctatc
aaaagttgtt gataactatg aattgctcaa acatagcaaa 2640aatgtgacaa acagcttaga
taagttaatc tcatctgtaa gtgcatttac ctcgtctaat 2700gattcgagaa atgtattagt
ggctccaact tcaatgttgg atcaaagttt atcttctctt 2760caatttgcta ggggatcc
277883926PRTArtificial
Sequenceamino acid sequence of a representative leukotoxin 352 from
plasmid pAA352 with flanking sequences from plasmid 83Met Ala Thr
Val Ile Asp Leu Ser Phe Pro Lys Thr Gly Ala Lys Lys 1 5
10 15 Ile Ile Leu Tyr Ile Pro Gln Asn
Tyr Gln Tyr Asp Thr Glu Gln Gly 20 25
30 Asn Gly Leu Gln Asp Leu Val Lys Ala Ala Glu Glu Leu
Gly Ile Glu 35 40 45
Val Gln Arg Glu Glu Arg Asn Asn Ile Ala Thr Ala Gln Thr Ser Leu 50
55 60 Gly Thr Ile Gln
Thr Ala Ile Gly Leu Thr Glu Arg Gly Ile Val Leu 65 70
75 80 Ser Ala Pro Gln Ile Asp Lys Leu Leu
Gln Lys Thr Lys Ala Gly Gln 85 90
95 Ala Leu Gly Ser Ala Glu Ser Ile Val Gln Asn Ala Asn Lys
Ala Lys 100 105 110
Thr Val Leu Ser Gly Ile Gln Ser Ile Leu Gly Ser Val Leu Ala Gly
115 120 125 Met Asp Leu Asp
Glu Ala Leu Gln Asn Asn Ser Asn Gln His Ala Leu 130
135 140 Ala Lys Ala Gly Leu Glu Leu Thr
Asn Ser Leu Ile Glu Asn Ile Ala 145 150
155 160 Asn Ser Val Lys Thr Leu Asp Glu Phe Gly Glu Gln
Ile Ser Gln Phe 165 170
175 Gly Ser Lys Leu Gln Asn Ile Lys Gly Leu Gly Thr Leu Gly Asp Lys
180 185 190 Leu Lys Asn
Ile Gly Gly Leu Asp Lys Ala Gly Leu Gly Leu Asp Val 195
200 205 Ile Ser Gly Leu Leu Ser Gly Ala
Thr Ala Ala Leu Val Leu Ala Asp 210 215
220 Lys Asn Ala Ser Thr Ala Lys Lys Val Gly Ala Gly Phe
Glu Leu Ala 225 230 235
240 Asn Gln Val Val Gly Asn Ile Thr Lys Ala Val Ser Ser Tyr Ile Leu
245 250 255 Ala Gln Arg Val
Ala Ala Gly Leu Ser Ser Thr Gly Pro Val Ala Ala 260
265 270 Leu Ile Ala Ser Thr Val Ser Leu Ala
Ile Ser Pro Leu Ala Phe Ala 275 280
285 Gly Ile Ala Asp Lys Phe Asn His Ala Lys Ser Leu Glu Ser
Tyr Ala 290 295 300
Glu Arg Phe Lys Lys Leu Gly Tyr Asp Gly Asp Asn Leu Leu Ala Glu 305
310 315 320 Tyr Gln Arg Gly Thr
Gly Thr Ile Asp Ala Ser Val Thr Ala Ile Asn 325
330 335 Thr Ala Leu Ala Ala Ile Ala Gly Gly Val
Ser Ala Ala Ala Ala Gly 340 345
350 Ser Val Ile Ala Ser Pro Ile Ala Leu Leu Val Ser Gly Ile Thr
Gly 355 360 365 Val
Ile Ser Thr Ile Leu Gln Tyr Ser Lys Gln Ala Met Phe Glu His 370
375 380 Val Ala Asn Lys Ile His
Asn Lys Ile Val Glu Trp Glu Lys Asn Asn 385 390
395 400 His Gly Lys Asn Tyr Phe Glu Asn Gly Tyr Asp
Ala Arg Tyr Leu Ala 405 410
415 Asn Leu Gln Asp Asn Met Lys Phe Leu Leu Asn Leu Asn Lys Glu Leu
420 425 430 Gln Ala
Glu Arg Val Ile Ala Ile Thr Gln Gln Gln Trp Asp Asn Asn 435
440 445 Ile Gly Asp Leu Ala Gly Ile
Ser Arg Leu Gly Glu Lys Val Leu Ser 450 455
460 Gly Lys Ala Tyr Val Asp Ala Phe Glu Glu Gly Lys
His Ile Lys Ala 465 470 475
480 Asp Lys Leu Val Gln Leu Asp Ser Ala Asn Gly Ile Ile Asp Val Ser
485 490 495 Asn Ser Gly
Lys Ala Lys Thr Gln His Ile Leu Phe Arg Thr Pro Leu 500
505 510 Leu Thr Pro Gly Thr Glu His Arg
Glu Arg Val Gln Thr Gly Lys Tyr 515 520
525 Glu Tyr Ile Thr Lys Leu Asn Ile Asn Arg Val Asp Ser
Trp Lys Ile 530 535 540
Thr Asp Gly Ala Ala Ser Ser Thr Phe Asp Leu Thr Asn Val Val Gln 545
550 555 560 Arg Ile Gly Ile
Glu Leu Asp Asn Ala Gly Asn Val Thr Lys Thr Lys 565
570 575 Glu Thr Lys Ile Ile Ala Lys Leu Gly
Glu Gly Asp Asp Asn Val Phe 580 585
590 Val Gly Ser Gly Thr Thr Glu Ile Asp Gly Gly Glu Gly Tyr
Asp Arg 595 600 605
Val His Tyr Ser Arg Gly Asn Tyr Gly Ala Leu Thr Ile Asp Ala Thr 610
615 620 Lys Glu Thr Glu Gln
Gly Ser Tyr Thr Val Asn Arg Phe Val Glu Thr 625 630
635 640 Gly Lys Ala Leu His Glu Val Thr Ser Thr
His Thr Ala Leu Val Gly 645 650
655 Asn Arg Glu Glu Lys Ile Glu Tyr Arg His Ser Asn Asn Gln His
His 660 665 670 Ala
Gly Tyr Tyr Thr Lys Asp Thr Leu Lys Ala Val Glu Glu Ile Ile 675
680 685 Gly Thr Ser His Asn Asp
Ile Phe Lys Gly Ser Lys Phe Asn Asp Ala 690 695
700 Phe Asn Gly Gly Asp Gly Val Asp Thr Ile Asp
Gly Asn Asp Gly Asn 705 710 715
720 Asp Arg Leu Phe Gly Gly Lys Gly Asp Asp Ile Leu Asp Gly Gly Asn
725 730 735 Gly Asp
Asp Phe Ile Asp Gly Gly Lys Gly Asn Asp Leu Leu His Gly 740
745 750 Gly Lys Gly Asp Asp Ile Phe
Val His Arg Lys Gly Asp Gly Asn Asp 755 760
765 Ile Ile Thr Asp Ser Asp Gly Asn Asp Lys Leu Ser
Phe Ser Asp Ser 770 775 780
Asn Leu Lys Asp Leu Thr Phe Glu Lys Val Lys His Asn Leu Val Ile 785
790 795 800 Thr Asn Ser
Lys Lys Glu Lys Val Thr Ile Gln Asn Trp Phe Arg Glu 805
810 815 Ala Asp Phe Ala Lys Glu Val Pro
Asn Tyr Lys Ala Thr Lys Asp Glu 820 825
830 Lys Ile Glu Glu Ile Ile Gly Gln Asn Gly Glu Arg Ile
Thr Ser Lys 835 840 845
Gln Val Asp Asp Leu Ile Ala Lys Gly Asn Gly Lys Ile Thr Gln Asp 850
855 860 Glu Leu Ser Lys
Val Val Asp Asn Tyr Glu Leu Leu Lys His Ser Lys 865 870
875 880 Asn Val Thr Asn Ser Leu Asp Lys Leu
Ile Ser Ser Val Ser Ala Phe 885 890
895 Thr Ser Ser Asn Asp Ser Arg Asn Val Leu Val Ala Pro Thr
Ser Met 900 905 910
Leu Asp Gln Ser Leu Ser Ser Leu Gln Phe Ala Arg Gly Ser 915
920 925 846PRTArtificial SequenceSynthetic
ConstructVARIANT3, 5Xaa = Lys, Asp, Val or Asn 84Gly Gly Xaa Gly Xaa Ala1
5
User Contributions:
Comment about this patent or add new information about this topic: