Patent application title: CHOLERA TOXIN CHIMERA AND ITS USE AS A STAPH VACCINE
Inventors:
IPC8 Class: AA61K39085FI
USPC Class:
1 1
Class name:
Publication date: 2018-02-01
Patent application number: 20180028638
Abstract:
The present invention relates to chimeric protein vaccines and methods of
use thereof in the treatment of Staphylococcus aureus. One embodiment of
the present invention provides a method of generating an immune response
in a mammal, that includes administering to the mammal, a composition
having a chimeric protein having at least one of: a portion of a cholera
toxin, a portion of a heat-labile toxin, and a portion of a shiga toxin;
and an antigen having at least one of: an antigenic material from S.
aureus and an antigenic material from a S. aureus-specific polypeptide.Claims:
1. An S. aureus specific polypeptide antigen comprising a truncated
iron-regulated surface determinant A (IsdA).
2. The S. aureus specific polypeptide antigen of claim 1 having a sequence of SEQ ID NO:4 or a protein with 90% homology thereto.
3. The protein of claim 1, wherein said (IsdA) protein comprises the amino acid sequence as set forth in SEQ ID NO: 5 or SEQ ID NO: 6.
4. A chimeric protein comprising the antigen of claim 1 and an adjuvant protein.
5. The chimeric protein of claim 4 comprising SEQ ID NO:4 or a protein with 90% homology thereto.
6. The chimeric protein of claim 5 wherein said adjuvant is selected form the group consisting of: a portion of cholera toxin, a portion of heat labile toxin, or a portion of shiga toxin.
7. The chimeric protein of claim 6 wherein said adjuvant is cholera toxin subunit A or B, heat labile toxin subunit B, or Shiga toxin subunit B.
8. The chimeric protein of claim 7 wherein said adjuvant is cholera toxin adjuvant protein is CTA.sub.2 or CTB.
9. The chimeric protein of claim 5 wherein the chimeric protein is assembled from a first polypeptide and a second polypeptide that are non-covalently linked.
10. The chimeric protein of claim 5 wherein the chimeric protein is a fusion protein.
11. The chimeric protein of claim 8 comprising a sequence of SEQ ID NO: 2, 3, 5, or 6, or a sequence with 90% homology thereto.
12. An immunogenic composition comprising the chimeric protein of claim 1 and a carrier.
13. The immunogenic composition of claim 12 further comprising an adjuvant protein.
14. The immunogenic composition of claim 13 wherein said adjuvant is selected form the group consisting of: a portion of cholera toxin, a portion of heat labile toxin, or a portion of shiga toxin.
15. The immunogenic composition of claim 14 wherein said adjuvant is cholera toxin subunit A or B, heat labile toxin subunit B, or Shiga toxin subunit B.
16. The immunogenic composition of claim 15 wherein said adjuvant is cholera toxin adjuvant protein is CTA.sub.2 or CTB.
17. The immunogenic composition of claim 16 wherein said cholera toxin adjuvant has a sequence of SEQ ID NO: 2 or 3 or a sequence with 90% homology thereto.
18. The immunogenic composition of claim 13 wherein the chimeric protein is assembled from a first polypeptide and a second polypeptide that are non-covalently linked.
19. The immunogenic composition of claim 13 wherein the chimeric protein is a fusion protein.
20. The immunogenic composition of claim 13 having a sequence of SEQ ID NO: 5 or SEQ H) NO: 6, or a sequence with 90% homology thereto.
Description:
SEQUENCE LISTING
[0002] The instant application contains a Sequence Listing which was the only Sequence Listing filed in the parent case U.S. application Ser. No. 13/328,686 (now U.S. Pat. No. 8,834,898), filed Jun. 20, 2013. The Sequence Listing was compliant with 37 CFR 1.821-1.825, and is used as the computer readable form for the present application, in accordance with 37 CFR 1.821(e).
BACKGROUND
[0003] The present invention relates to infectious diseases and, more particularly, to chimeric protein vaccines and methods of use thereof in the treatment of Staphylococcus aureus.
[0004] Staphylococcus aureus (S. aureus) is a common cause of hospital-acquired infections and represents an important public health threat. S. aureus can cause nosocomial (hospital) and community-acquired infections including impetigo, cellulitis, food poisoning, toxic shock syndrome, invasive necrotizing pneumonia, and endocarditis. S. aureus is also the most common species of staphylococci to cause Staph infections. Currently, it is one of the top causes of infectious disease deaths in the United States.
[0005] S. aureus also causes mastitis, which is a major problem in dairy cows with considerable economic implications. For example, mastitis in dairy cows is most commonly caused by S. aureus and is one of the most common diseases infecting dairy cattle in the United States. S. aureus causes a persistent, inflammatory reaction of the udder tissue that can lead to chronic infections that result in the cow being culled from the herd. Milk from cows with mastitis also typically have higher somatic cell count, which generally lowers the milk quality. It is estimated that mastitis may cost the dairy industry billions of dollars per year in economic losses.
[0006] A growing concern in the treatment of S. aureus is that the bacterium is often resistant to multiple antibiotics. Roughly half of the nosocomial isolates in the United States are methicillin-resistant S. aureus (MRSA). Methicillin-resistant S. aureus is also sometimes referred to as "multidrug-resistant" S. aureus or "oxacillin-resistant S. aureus." MRSA bacterium is generally resistant to beta-lactam antibiotics, which include the penicillins (e.g., methicillin, dicloxacillin, nafcillin, oxacillin, etc.) and cephalosporins. Currently, a vaccine that prevents staphylococcal disease is unavailable.
[0007] A possible approach for staphylococcal vaccine development is to target virulence factors such as toxins, enzymes, polysaccharide capsules, adhesive factors, and the like. A key to the possible vaccine approach may be that the anterior nares of humans are known to be an important niche for S. aureus. It is believed that nasal carriage is a major risk factor for invasive infection.
[0008] One potential S. aureus virulence factor is the iron-regulated surface determinant A (IsdA). IsdA is an S. aureus surface adhesin protein that may be immunogenic in certain organisms. IsdA can bind to human desquamated nasal epithelial cells and is believed to play a critical role in nasal colonization.
[0009] However, a major obstacle in vaccine development of S. aureus is the lack of immunostimulatory adjuvants that can function from mucosal surfaces. While certain toxins (e.g., cholera toxin and heat-labile toxin) have the ability to induce mucosal and systemic immune responses to co-administered antigens, these bacterial proteins are generally too toxic for human use.
SUMMARY OF THE INVENTION
[0010] The present invention relates to infectious diseases and, more particularly, to chimeric protein vaccines and methods of use thereof in the treatment of Staphylococcus aureus.
[0011] In some embodiments, the present invention provides methods of generating an immune response in a mammal comprising: administering to the mammal a composition comprising: a chimeric protein comprising at least one of: a portion of a cholera toxin, a portion of a heat-labile toxin, and a portion of a shiga toxin; and an antigen comprising at least one of: an antigenic material from S. aureus and an antigenic material from an S. aureus-specific polypeptide.
[0012] In other embodiments, the present invention provides methods of vaccinating a cow comprising: administering to the cow a chimeric protein comprising: an adjuvant selected from the group consisting of: a portion of a cholera toxin, a portion of a heat-labile toxin, a portion of a shiga toxin, and any combination thereof; and an antigen selected from the group consisting of: an antigenic material from S. aureus, an antigenic material from a S. aureus-specific polypeptide, and any combination thereof.
[0013] The features and advantages of the present invention will be readily apparent to those skilled in the art upon a reading of the description of the preferred embodiments that follows.
BRIEF DESCRIPTION OF THE DRAWINGS
[0014] The following figures are included to illustrate certain aspects of the present invention, and should not be viewed as exclusive embodiments. The subject matter disclosed is capable of considerable modification, alteration, and equivalents in form and function, as will occur to those skilled in the art and having the benefit of this disclosure.
[0015] FIGS. 1A-1C show ribbon diagrams illustrating structures of cholera toxin, IsdA, and chimeric protein according to some embodiments.
[0016] FIG. 2 shows a diagram illustrating a plasmid that encodes a chimeric protein according to some embodiments.
[0017] FIGS. 3A-3B illustrate expression and purification of a chimeric protein according to some embodiments.
[0018] FIG. 4 shows a plot showing the results of a receptor binding affinity assay according to some embodiments.
[0019] FIGS. 5A-5D show confocal images of chimeric protein binding to Vero and DC2.4 cells stained with fluorescent dyes according to some embodiments.
[0020] FIG. 6 shows a plot showing in vivo systemic antibody response to chimeric protein according to some embodiments.
[0021] FIG. 7 shows a plot illustrating in vivo mucosal antibody response to chimeric protein according to some embodiments.
[0022] FIGS. 8A-8D show plots showing the results of flow cytometry experiments on the proliferation of T lymphocytes from mice immunized with chimeric protein according to some embodiments.
[0023] FIG. 9 shows a plot summarizing the flow cytometry results shown in FIGS. 8A-8D according to some embodiments.
[0024] FIG. 10 shows a plot showing the results of Resazurin assay of splenocytes from mice immunized with chimeric protein according to some embodiments.
[0025] FIG. 11 shows a plot showing IL-4 and IN-.quadrature. levels of antigen-stimulated splenocytes from mice immunized with chimeric protein according to some embodiments.
[0026] FIG. 12 shows a plot showing the results of IsdA-specific ELISA titrations of systemic antibody subtypes according to some embodiments.
[0027] FIGS. 13A-13B show a plot showing the effects of immune serum on S. aureus adhesion to human epithelial cells according to some embodiments.
[0028] FIG. 14 shows a plot showing milk anti-IsdA IgA titers in cows.
DETAILED DESCRIPTION
[0029] The present invention relates to infectious diseases and, more particularly, to chimeric protein vaccines and methods of use thereof in the treatment of Staphylococcus aureus.
[0030] There are a number of advantages related to the present invention. The present invention provides compositions (in some embodiments, chimeric proteins) that may be useful as vaccines against various strains of S. aureus and related bacteria in various organisms (e.g., mammals such as humans, cows, etc.).
[0031] As used herein, the term "chimeric protein" generally refers to any protein comprised of a first amino acid sequence derived from a first source, bonded, covalently or non-covalently (e.g., hydrogen bonding, van der Waals force, hydrophobic interaction, etc.), to a second amino acid sequence derived from a second source, wherein the first and second source are not the same. A first source and a second source that are not the same can include two different biological entities, or two different proteins from the same biological entity, or a biological entity and a non-biological entity. A chimeric protein can include for example, a protein derived from at least 2 different biological sources. A biological source can include any non-synthetically produced nucleic acid or amino acid sequence (e.g., a genomic or cDNA sequence, a plasmid or viral vector, a native virion or a mutant or analog, as further described herein, of any of the above). A synthetic source can include a protein or nucleic acid sequence produced chemically and not by a biological system (e.g., solid phase synthesis of amino acid sequences). A chimeric protein can also include a protein derived from at least 2 different synthetic sources or a protein derived from at least one biological source and at least one synthetic source. For the purposes of this disclosure, a chimeric protein may or may not be a single polypeptide (i.e., a fusion protein).
[0032] In some embodiments, the vaccines may be prophylactic and may be administered before the onset of S. aureus related infections. It is believed that the vaccines of the present invention can activate humoral responses, stimulate protection, and block the promotion of oral tolerance against S. aureus. Currently, there are no known vaccines that can prevent Staphylococcal infection.
[0033] The present invention provides compositions that comprise a first amino acid sequence derived from a suitable adjuvant source and a second amino acid sequence derived from a suitable antigen source. In some embodiments, the composition may have multiple functions. For example, the first amino acid sequence may act as an adjuvant while the second amino acid sequence may act as an antigen. As used herein, the term "amino acid sequence" does not necessarily imply a single polypeptide. In other words, the amino acid sequence derived from a suitable adjuvant source may not necessarily be confined to a single polypeptide. For example, a portion of the amino acid sequence may be in one polypeptide while the remaining portion of the amino acid sequence may reside in another polypeptide.
[0034] In some embodiments, the composition may be a single polypeptide (e.g., a fusion protein). In other embodiments, the composition may be assembled from two or more polypeptides. In certain embodiments having two or more polypeptides, one or more polypeptide may be chimeric. In certain embodiments, the two or more polypeptides may fold or assemble together within a suitable expression system (e.g., E. coli) or by any other suitable method (e.g., by the use of chaperone molecules).
[0035] The adjuvants typically used to construct the chimeric proteins of the present invention may be non-toxigenic or less toxigenic than full-length or non-chimeric toxins and yet retain their potent adjuvant characteristics. In some embodiments, the adjuvant may have been modified from a toxigenic adjuvant source with a modification that renders the adjuvant non-toxigenic or less toxigenic and likely suitable for mucosal surfaces. Such modifications may include, but are not limited to, mutation of amino acid, removal of toxigenic subunits, and the like.
[0036] As used herein, an "adjuvant" generally refers to a pharmacological or an immunological agent that modifies the effect of other agents (e.g., drug or vaccine), while having few if any direct effects when given by itself. An immunological adjuvant is often included in vaccines to enhances the recipient's immune response to the antigen, while keeping the injection of foreign material to a minimum. For the purposes of this disclosure, an adjuvant may be linked covalently or non-covalently to the antigen.
[0037] While cholera toxin is an example of a potent adjuvant, it remains mostly unsuitable for use in humans. Specifically, there are safety concerns with the mucosal administration of cholera toxin and other similar toxins such as heat-labile toxin and shiga toxin. It is believed that such administration can redirect antigens to the central nervous system through GM1-dependent binding to olfactory epithelium. It has been previously difficult to separate the toxigenicity and adjuvanticity of cholera toxin, heat-labile toxin, and/or shiga toxin.
[0038] In some embodiments, the adjuvant source may be a toxin. The adjuvant may be coupled, assembled, folded, fused, or otherwise associated with an antigen to form a composition that further enhances the immunogenic effects of the antigen. Examples of suitable toxins include, but are not limited to, cholera toxin (CT), shiga toxin (ST1, ST2, etc.), heat-labile toxin (LT, LT-IIa, LT-IIb, etc.) from E. coli. In some preferred embodiments, the toxins are modified to be non-toxigenic while remaining potent immunostimulatory molecules that can bind to and target immune effector cells at mucosal site. It is believed that both shiga toxin and heat-labile toxin are structurally similar or analogous to cholera toxin.
[0039] In particular, cholera toxin is a protein secreted by the bacterium Vibrio cholerae and is generally responsible for the massive, watery diarrhea characteristic of cholera infection. Structurally, cholera toxin is an oligomeric complex made up of six protein subunits: a single copy of the A subunit (part A, enzymatic), and five copies of the B subunit (part B, receptor binding). The A subunit has two important segments: the A1 domain (CTA.sub.1), which is toxigenic and the A2 domain (CTA.sub.2), which forms an extended alpha helix that sits snugly in the central pore of the B subunit ring.
[0040] FIG. 1A shows a ribbon diagram of the cholera toxin crystal structure showing the CTA.sub.1 domain (SEQ ID NO: 1) and connecting CTA.sub.2 domain (SEQ ID NO:2), and the B subunit (SEQ ID NO: 3).
[0041] It is believed that cholera toxin immunomodulation may be involved in the activation of antigen-presenting cells, promotion of B-cell isotype switching, and upregulation of costimulatory and major histocompability complex (MHC) class II expression. Many of these responses result from the interaction of the cholera toxin B (CTB) subunit with the ganglioside GM1 receptor on effector cells, such as dendritic cells, that promote antigen uptake, presentation, and cellular activation. Thus, suitably modified non-toxigenic forms of cholera toxin by itself may act as an antigen carrier and be highly immunostimulatory. Without being limited by theory, it is believed that heat-labile toxin and shiga toxin are structurally and functionally similar (e.g., adjuvanticity) to the cholera toxin. For example, heat-labile toxin has an A.sub.1 domain (SEQ ID NO: 7), A.sub.2 domain (SEQ ID NO: 8), B domain (SEQ ID NO: 9) analogous to the A.sub.1, A.sub.2, and B domains of cholera toxin. An IsdA-LTA.sub.2/B chimeric protein may have a sequence shown in SEQ ID NO: 10.
[0042] An antigen is generally any substance that causes the production of antibodies against it. An antigen may be a foreign substance from the environment or it may also be formed within the environment, such as bacterial toxins or tissue cells. Examples of a suitable antigen source include, but are not limited to, iron-regulated surface determinant A, iron-regulated surface determinant B (IsdB), clumping factor A (ClfA), clumping factor B (ClfB), fibronectin-binding protein (FnBP), penicillin binding protein 2a (PBP2A), serine-aspartate rich fibrinogen sialoprotein binding protein (SrdE), and the like.
[0043] In particular, the N-terminal near iron transporter (NEAT) domain of IsdA is capable of binding to a broad spectrum of human ligands, including transferring heme, fibrinogen, fibronectin, and corneocyte envelope proteins to mediate adherence and dissemination of S. aureus. The C-terminal domain of IsdA defends S. aureus against human skin bactericidal fatty acids and antimicrobial peptides by making the cell surface hydrophilic.
[0044] FIG. 1B shows a ribbon diagram of IsdA antigen (SEQ ID NO: 4) that is replacing the toxigenic CTA.sub.1 domain (SEQ ID NO: 1) to construct a chimeric protein that comprises an antigen and a non-toxigenic adjuvant. FIG. 1C shows a ribbon diagram of one preferred chimeric protein, IsdA-CTA.sub.2/B (SEQ ID NO: 5).
[0045] Some embodiments provide compositions comprising: a chimeric protein comprising at least one of: a portion of a cholera toxin, a portion of a heat-labile toxin, and a portion of a shiga toxin; and an antigen comprising at least one of: an antigenic material from S. aureus and an antigenic material from a S. aureus-specific polypeptide.
[0046] In some embodiments, the composition is a fusion protein. In certain embodiments, the composition is a single polypeptide.
[0047] Some embodiments provide a chimeric protein comprising: an adjuvant and an antigen. The adjuvant may be selected from the group consisting of: a portion of a cholera toxin, a portion of a heat-labile toxin, a portion of a shiga toxin, and combinations thereof. The antigen may be selected from the group consisting of: an antigenic material from S. aureus (e.g., carbohydrates, peptides, etc.), an antigenic material from an S. aureus-specific polypeptide, and combinations thereof.
[0048] In some embodiments, the adjuvant is one of: CTA.sub.2/B, LTA.sub.2/B, or STA.sub.2/B. In one or more embodiments, the adjuvant further includes at least one additional cholera toxin B subunit, heat-labile toxin B subunit, or shiga toxin B subunit. In one or more embodiments, the adjuvant further comprises at least one additional cholera toxin A.sub.2 subunit, heat-labile toxin A.sub.2 subunit, or shiga toxin A.sub.2 subunit.
[0049] While some preferred embodiments of the domain and chimeric protein sequences have been provided, the present invention may be practiced using any number of alternative embodiments. For example, it is well known in the relevant arts that protein or polypeptide variants typically retain their function as long as they are have sufficient sequence identity with their native sequences.
[0050] In some embodiments, the composition has at least about 80% sequence identity to SEQ ID NO: 5, 10, or 15. In some preferred embodiments, the composition has at least about 90% sequence identity to SEQ ID NO: 5, 10, or 15. In certain embodiments, the antigen portion of the composition has at least about 80% sequence identity to SEQ ID NO: 4. In some preferred embodiments, the antigen portion of the composition has at least about 90% sequence identity to SEQ ID NO: 4. In some embodiments, the composition is assembled from a first polypeptide and a second polypeptide that are non-covalently linked. In one or more of these embodiments, the first polypeptide has at least about 80% sequence identity to SEQ ID NO: 6, 11, or 16. In some preferred embodiments, the first polypeptide has at least about 90% sequence identity to SEQ ID NO: 6, 11, or 16. In some embodiments, the second polypeptide has at least about 80% sequence identity to SEQ ID NO: 3, 9, or 14. In some preferred embodiments, the second polypeptide has at least about 80% sequence identity to SEQ ID NO: 3, 9, or 14.
[0051] Generally, a chimeric protein will be comprised of a single A.sub.2 subunit and a B subunit (from cholera toxin, heat-labile toxin, or shiga toxin). In some optional embodiments, the chimeric protein may further comprise at least one additional B subunit. In some optional embodiments, the chimeric protein may further comprise at least one additional A.sub.2 subunit. In some embodiments, the subunits may be linked by a disulfide bond. In some embodiments, the disulfide bond may be engineered. In some embodiments, the antigen has a disulfide bond with the adjuvant. In some embodiments, the antigen is associated non-covalently with the adjuvant.
[0052] In some embodiments, the antigen comprises a sequence that has at least about 80% sequence identity to iron-regulated surface determinant A, iron-regulated surface determinant B (IsdB), clumping factor A (ClfA), clumping factor B (ClfB), fibronectin-binding protein (FnBP), fibronectin-binding protein (FnBP), penicillin binding protein 2a (PBP2A), or serine-aspartate rich fibrinogen sialoprotein binding protein (SrdE). In some preferred embodiments, the sequence identity is at least about 90%.
[0053] In some exemplary embodiments, the chimeric protein is IsdA-CTA.sub.2/B (SEQ ID NO: 5). As used herein, "IsdA-CTA.sub.2/B" generally refers to a chimeric protein that comprises an IsdA antigen domain, a CTA.sub.2 subunit, and a CTB subunit. In some embodiments, each of the IsdA antigen domain (SEQ ID NO: 4), the CTA.sub.2 domain (SEQ ID NO: 2) and the CTB domain (SEQ ID NO: 3) may be bonded covalently (e.g., peptide bonds, disulfide bonds, etc.) or non-covalently to at least one other domain. In some embodiments, the bond may be an engineered disulfide bond.
[0054] In some embodiments, the chimeric protein is IsdA-LTA.sub.2/B (SEQ ID NO: 10). As used herein, "IsdA-LTA.sub.2/B" generally refers to a chimeric protein that comprises an IsdA antigen domain, a LTA.sub.2 subunit, and a LTB subunit. In some embodiments, each of the IsdA antigen domain (SEQ ID NO: 4), the LTA.sub.2 subunit (SEQ ID NO: 8) and the CTB subunit (SEQ ID NO: 9) may be bonded covalently (e.g., peptide bonds, disulfide bonds, etc.) or non-covalently to at least one other domain. In some embodiments, the bond may be an engineered disulfide bond.
[0055] In some embodiments, the chimeric protein is IsdA-STA.sub.2/B (SEQ ID NO: 15). As used herein, "IsdA-STA.sub.2/B" generally refers to a chimeric protein that comprises an IsdA antigen domain, a STA.sub.2 subunit, and a STB subunit. In some embodiments, each of the IsdA antigen domain (SEQ ID NO: 4), the STA.sub.2 subunit (SEQ ID NO: 13) and the STB subunit (SEQ ID NO: 14) may be bonded covalently (e.g., peptide bonds, disulfide bonds, etc.) or non-covalently to at least one other domain. In some embodiments, the bond may be an engineered disulfide bond.
[0056] In some embodiments, the chimeric protein may further comprise modifications that enhance at least one of: solubility of the chimeric protein, specificity for S. aureus, specificity for GM1, expression of the chimeric protein, and immunogenicity of the chimeric protein.
[0057] Some embodiments provide methods for generating an immune response in a mammal comprising: administering to the mammal a composition (e.g., chimeric protein) according to one or more embodiments described herein.
[0058] In some embodiments, the mammal is selected from the group consisting of: a human, a cow, a dog, a cat, and a horse.
[0059] In some embodiments, the administration of the composition is by intranasal administration, oral administration, intramuscular administration, peritoneal administration, sublingual administration, transcutaneous administration, subcutaneous administration, intravaginal administration, or intrarectal administration. The administered dosage of the composition may generally be an amount suitable to elicit the desired immune response. In some embodiments, the administering to the mammal comprises: administering the composition to at least one cell from the mammal in vitro or in vivo.
[0060] Some embodiments provide methods for vaccinating a cow comprising: administering to the cow, a chimeric protein according to one or more embodiments described herein.
[0061] To facilitate a better understanding of the present invention, the following examples of preferred embodiments are given. In no way should the following examples be read to limit, or to define, the scope of the invention.
Example 1
[0062] To direct the IsdA-CTA.sub.2 and CTB peptides of the chimera to the E. coli periplasm for proper assembly, pBA001 (FIG. 2) was constructed from pARLDR19, which utilizes the E. coli LTIIb N-terminal leader sequence. Induction of pBA001 and purification from the periplasm of E. coli resulted in efficient IsdA-CTA.sub.2/B production (3 to 4 mg from 1 liter of starting culture). SDS-PAGE analysis of the purification of IsdA-CTA.sub.2/B and immunoblotting using antibodies against CTA and CTB (FIG. 3A) confirm that IsdA-CTA.sub.2 (.about.38 kDa) was copurified with CTB (.about.11 kDa) on D-galactose agarose, which is indicative of proper chimera folding. Referring to FIG. 3A, the SDS-PAGE analysis shows flowthrough (FT), washes (W1 and W2) and elution (E) of IsdA-CTA.sub.2/B from D-galactose affinity purification and anti-CTA/B Western blot of purified IsdA-CTA.sub.2/B (.about.38 and 11 kDA).
[0063] IsdA alone was also purified using a six-histidine tag. FIG. 3B shows an SDS-polyacrylamide gel of all resulting proteins used in animal studies, as well as immunoblotting of purified IsdA with anti-His6 (.about.37 kDa): ISdA-CTA.sub.2/B (G1), IsdA plus CTA.sub.2/B mixed (G2), and IsdA (G3).
[0064] The following protocol was followed in order to obtain the chimeric proteins.
[0065] MRSA252 strain was used for IsdA isolation. MRSA USA300 (pvl mutant) strain was used in adhesion assays. E. coli TE1, a .quadrature.endA derivative of TX1, and BL21(DE3)/pLysS strains were used for protein expression. All bacterial strains were cultured using Luria-Bertani (LB) agar or broth at 37.degree. C. with chloramphenicol (35 .quadrature.g/ml), ampicillin (100 .quadrature.g/m), and/or kanamycin (50 .quadrature.g/m).
[0066] To construct pBA001 plasmid (FIG. 2) for the expression of IsdA-CTA.sub.2/B, IsdA was PCR amplified from MRSA252 with primers that add 5' SphI GCTACTGGCATGCGGCAACAGAAGCTACGAAC (SEQ ID NO: 17) and 3' ClaI GTGCATGATCGATTTTGGTAATTCTTTAGC (SEQ ID NO: 18) sites (in boldface) and cloned into pARLDR19 between the LTIIb leader sequence and CTXA.sub.2. CTB was also expressed from this vector. To make His6-IsdA, IsdA was amplified from MRSA252 with primers that add 5' BamHI GCTACTGGATCCGCGGCAACAGAAGCTACGAAC (SEQ ID NO: 19) or GTGCATAAGCTTTCAAGTTTTTGGTAATTCTTTAGC (SEQ ID NO: 20) and 3' HindIII GTGCATGATCGATTTTGGTAATTCTTTAGC (SEQ ID NO: 21) sites (in boldface) and cloned into pTrcHisA (Invitrogen, Carlsbad, Calif.) or pET-40b+, yielding pBA009A and pBA015. pARLDR19 was used to express CTA.sub.2/B for the mixed preparation. Plasmids were transformed into E. coli TE1 (pBA001, pBA009A, and pARLDR19) or BL21(DE3)/pLysS (pBA015) and sequenced.
[0067] To express IsdA-CTA.sub.2/B and CTA.sub.2/B, cultures with pBA001 or pARLDR19 were grown to an optical density at 600 nm (OD600) of 0.9 and induced for 15 h with 0.2% L-arabinose. Proteins were purified from the periplasmic extract using immobilized D-galactose. For mock cultures, E. coli TE1 without plasmid was induced, and the periplasmic extract was purified. IsdA was isolated from the cytosol of cultures containing pBA009A and purified by cobalt affinity chromatography under denaturing conditions. IsdA was also purified from periplasmic extracts of cultures containing pBA015 over Talon resin under native conditions. All proteins were dialyzed against phosphate-buffered saline (PBS), reduced to <0.125 endotoxin units (EU)/ml lipopolysaccharide by passage through an endotoxin removal column, and quantified by bicinchoninic acid assay prior to the addition of 5% glycerol.
[0068] Proteins resolved by SDS-12% PAGE were stained with Coomassie.RTM. or transferred to nitrocellulose membranes. Membranes were blocked overnight with 5% skim milk in PBS plus 0.05% Tween.RTM. 20 (PBS-T), incubated with polyclonal anti-CTA (1:2,500) and anti-CTB (1:5,000) or anti-His6 (1:2,500), followed by horseradish peroxidase (HRP)-conjugated anti-rabbit IgG (1:5,000) and developed with IMMOBILON WESTERN HRP SUBSTRATE commercially available from Millipore, Billerica, Mass.
Example 2
[0069] To compare the receptor binding affinity of purified IsdA-CTA.sub.2/B chimera with native CT, ganglioside GM1 ELISA assays using anti-CTA and anti-CTB antibodies were performed.
[0070] GM1 enzyme-linked immunosorbent assays (ELISA) were performed by coating microtiter plates with 0.15 .quadrature.M GM1 for 15 h at 20.degree. C., blocking with 10% bovine serum albumin, and incubating with IsdA-CTA.sub.2/B or CT for 1 h at 37.degree. C. Ganglioside GM1 is found ubiquitously on mammalian cells and acts as the site of binding for both cholera toxin and heat-labile toxin. Plates were washed with PBS-T and incubated with anti-CTA (1:2,000) or anti-CTB (1:5,000) followed by HRP-conjugated anti-rabbit IgG, both for 1 h at 37.degree. C. The reaction was developed with o-phenylenediamine dihydrochloride (A.sub.450).
[0071] The ELISA results indicate that the B subunit of IsdA-CTA.sub.2/B has GM1 binding affinity similar to that of CT (FIG. 4). Low anti-CTA response from IsdA-CTA.sub.2/B was an expected result from this fusion that contains only 46 bp of full-length CTA.
[0072] Confocal microscopy was used to further confirm receptor binding and internalization of IsdA-CTA.sub.2/B into epithelial and dendritic cells (DC) in vitro. Immune effector cells, such as dendritic cells, have a uniquely high affinity for CT and non-toxigenic CTB. FIGS. 5A-5D show anti-CT FITC-labeled IsdA-CTA.sub.2/B bound to the surface of cells (Vero epithelial cells in FIG. 5A-5B; DC cells in FIG. 5C-5D) at 4.degree. C. and internalization after 45 min at 37.degree. C., indicating that, at a minimum, the CTB subunit of the chimera were efficiently imported into the cell. These images obtained using polyclonal anti-CT and anti-rabbit-FITC with DAPI suggest that IsdA-CTA.sub.2/B was binding and transporting into Vero and DC2.4 cells. Cells were incubated with IsdA-CTA.sub.2/B for 45 minutes at 4.degree. C. to inhibit, or at 37.degree. C. to promote cellular uptake.
Example 3
[0073] The chimeric proteins were tested for their specific humoral response.
[0074] BALB/c mice were mock immunized or immunized intranasally with IsdA-CTA.sub.2/B, IsdA plus CTA.sub.2/B mixed, or IsdA on day 0 and boosted on day 10 (Table 1 below). FIG. 6 shows systemic antibody response to IsdA-CTA.sub.2/B in vivo. Referring to FIG. 6, sera collected on days 0, 10, 14, and 45 were pooled by treatment group at each time point and tested for recognition of IsdA by IgG ELISA. IsdA-specific serum IgG endpoint titers from mice immunized with IsdA-CTA.sub.2/B were significantly higher than those of mock-immunized mice on day 10, than those of all control groups on day 14, and than those of mice immunized with IsdA alone and mock-immunized mice on day 45. As used herein, "*" denotes statistical significance (P<0.05) between mice immunized with IsdA-CTA.sub.2/B versus controls. Nasal, intestinal, and vaginal washes were collected on day 45, pooled by treatment group, and tested for recognition of IsdA by IgA ELISA.
[0075] FIG. 7 shows mucosal antibody response to IsdA-CTA.sub.2/B in vivo. Referring to FIG. 7, the percentage of IsdA-IgA out of total IgA was significantly higher in nasal and vaginal washes from mice immunized with IsdA-CTA.sub.2/B than from mock-immunized mice, mice immunized with IsdA plus CTA.sub.2/B, or mice immunized with IsdA alone. In addition, intestinal IsdA-IgA was significantly higher in IsdA-CTA.sub.2/B-immunized mice than in IsdA- and mock-immunized mice (FIG. 7). Together, these results suggest that IsdA specific systemic and mucosal humoral immunity can be stimulated after intranasal vaccination with the IsdA-CTA.sub.2/B chimera.
TABLE-US-00001 TABLE 1 Immunization Strategy. Days of sampling Mucosal Dose per Days of secretions Antigen/ vaccination intranasal and spleen adjuvant (.quadrature. g) n.sup.b vaccination Sera (n) IsdA-CTA.sub.2/B 50 8 0, 10 0, 10, 14, 45 14 (2), 45 (6) chimera IsdA + 17 + 33.sup.a 8 0, 10 0, 10, 14, 45 14 (2), 45 (6) CTA.sub.2/B IsdA 17 8 0, 10 0, 10, 14, 45 14 (2), 45 (6) Mock NA.sup.c 8 0, 10 0, 10, 14, 45 14 (2), 45 (6) .sup.aConcentrations are according to equimolar to equimolar amounts of IsdA .sup.bn, number of mice .sup.cNA, not applicable
Example 4
[0076] Cellular proliferation of IsdA-stimulated splenocytes was assessed using flow cytometry and a resazurin-based fluorescent dye assay. CFSE-based flow cytometric results suggest that day 45 splenocytes derived from mice immunized with IsdA-CTA.sub.2/B showed significant proliferation of IsdA-specific CD3+ T lymphocytes compared with mixed and IsdA control groups (FIGS. 8A-8D and 9). Referring to FIGS. 8A-8D, CFSE-labeled splenocytes were cultured in vitro for 84 h with IsdA and stained with anti-CD3-PE-Cy5. Referring to FIG. 9, percent proliferation of IsdA-specific CD3+ T lymphocytes from individual mice on day 45 was determined by flow cytometry. Mock samples contained low numbers of CD3+ T lymphocytes.
[0077] FIG. 10 shows the result of a resazurin assay of splenocytes from days 14 and 45 cultured in vitro for 84 h with IsdA. The resazurin assays revealed that in vitro stimulation of splenocytes from IsdA-CTA.sub.2/B-immunized mice induced significant proliferation compared with IsdA plus CTA.sub.2/B, IsdA, and mock groups on day 45 (FIG. 10). With the low sample size (n=2 per group) on day 14, no significance was observed between groups. Error bars are based on n=2 (day 14) or n=6 (day 45). Stimulation was observed for the positive control, ConA. These results suggest that intranasal administration of IsdA-CTA.sub.2/B can induce a cellular activation response.
Example 5
[0078] The levels of IL-4 and IFN-.quadrature..quadrature. in supernatants of splenocytes stimulated with IsdA in vitro were determined by ELISA. Referring to FIG. 11, IL-4 and IFN-.quadrature..quadrature. levels in culture supernatants from splenocytes, pooled by immunization group (n=6), were stimulated in vitro for 84 h with IsdA and measured by ELISA. The splenocytes obtained from mice immunized with IsdA-CTA.sub.2/B secreted high levels of IL-4, and these levels were significantly higher than levels of all controls (FIG. 11). Although the level of IFN-.quadrature..quadrature. was slightly higher in IsdA-CTA.sub.2/B-immune splenocytes, low levels of IFN-.quadrature..quadrature., near the detection limit for the assay, were found in all groups (FIG. 11).
[0079] FIG. 12 shows IsdA-specific IgG1 and IgG2a ELISA titrations from day 45 sera pooled by immunization group (n=6). Titrations of IgG1 and IgG2a revealed that immunization with IsdA-CTA.sub.2/B drove isotype switching primarily to the IgG1 subclass although minute IgG2a levels were also detected. These results suggest that immunization with IsdA-CTA.sub.2/B promotes a Th2-type immune response.
Example 6
[0080] Pooled sera from commonly immunized mice were used to investigate the ability of immune serum to functionally block adherence of S. aureus to human epithelial cells (HeLa). FIGS. 13A-13B shows the effect of immune serum on S. aureus adhesion to human epithelial cells in vitro. Referring to FIG. 13A, sera (1:100; day 45) was pooled by immunization group and incubated with MRSA252 (5.times.10.sup.7 CFU) for 1 h at 37.degree. C. and then added to confluent HeLa cells. After washing and lysis, the number of internalized and cell-bound bacteria was enumerated. Preincubation of the S. aureus strain used for vaccination (MRSA252) with day 45 sera from IsdA-CTA.sub.2/B-immunized mice significantly reduced bacterial adhesion to epithelial cells compared to all control groups (FIG. 13A).
[0081] FIG. 13B shows the result of similar tests performed with MRSA USA300 (5.times.10.sup.9 CFU). Referring to FIG. 13B, there was a significant reduction in bacterial adhesion to human epithelial cells after a different strain of S. aureus (MRSA USA300) was preincubated with day 45 sera from mice immunized with IsdA-CTA.sub.2/B (FIG. 13B).
[0082] These examples suggest that the chimeric proteins of the present invention can bind and transport into epithelial and dendritic cells as consistent with the uptake of CT involving retrograde movement to the perinuclear domain of the Golgi apparatus and endoplasmic reticulum. It is believed that the ability of the chimeric proteins to bind to GM1 and trigger internalization leads to the activation of immune effector cells by the CTB subunit and promotes antigen presentation on MHC molecules.
[0083] Moreover, the ELISAs of IsdA-specific responses from the sera and nasal, intestinal, and vaginal fluids of intranasally immunized mice verifies that the chimeric proteins can induce antigen-specific systemic and mucosal immunity in mice. As expected, IgG titers were highest on day 14 after the boost and began to diminish by day 45.
[0084] These results also suggest the characteristic ability of CT to induce systemic IgG to antigens co-administered with CT at mucosal sites. The presence of IsdA-specific IgA in nasal, intestinal, and vaginal fluids after intranasal immunization with IsdA-CTA.sub.2/B suggests that IgA blasts migrated from the nasal-associated lymphoid tissue into distal mucosal effector sites in the nasal passage and gastrointestinal and genital tracts. Thus, it is believed that CT and CT derivatives promote more of a Th2-type response, which is typically characterized by secretion of IL-4 leading to induction of antibody class switching to non-complement-activating IgG1. In vitro functional assays of antibodies revealed a significant reduction in internalized and cell-bound bacteria on human epithelial cells after preincubation of IsdA-CTA.sub.2/B immune serum with the S. aureus isolate used for vaccination, MRSA252. Additionally, antibodies were able to prevent adhesion of MRSA USA300.
[0085] IsdA from MRSA252 and MRSA USA300 has 92% amino acid identity with the majority of differences present within the C terminus, which suggests that antibodies against IsdA are functional in vitro and may protect against multiple serotypes in vivo.
[0086] The results also suggest that the humoral and cellular responses induced by IsdA-CTA.sub.2/B are superior to those stimulated by a mixed preparation of antigen and adjuvant (IsdA plus CTA.sub.2/B). Thus, the structure of the IsdA-CTA.sub.2/B chimera is optimal for the induction of antigen-specific humoral responses and potentially for presentation on MHC molecules.
Example 7
[0087] Milk anti-IsdA IgA titer levels were measured in cows treated with a chimeric protein according to one or more embodiments of the present invention. Six (1-6 in FIG. 14) clinically healthy Holstein dairy cows were vaccinated intranasally on day 0 with 300 .quadrature.g of IsdA-CTA2/B chimera (cows 4-6) or an equivalent concentration of IsdA alone (cows 1-3). Cows were boosted on day 14 with the same concentration. Milk was collected on days 0, 14 and 28 and analyzed by IsdA-specific IgA ELISA.
[0088] FIG. 14 shows a summary of the titer results. The titer values were calculated as the reciprocal of the milk dilution that was 0.1 O.D. above background. Referring to FIG. 14, cows 1 (2296), 2 (2299) and 3 (2403) represent controls of the experiment while cows 4 (2319), 5 (2340) and 6 (2472) were vaccinated (labeled *) with a chimeric protein. Cows 4-6 all displayed increases in the titer on days 14 and 28 as compared to cows 1-3.
[0089] Therefore, the present invention is well adapted to attain the ends and advantages mentioned as well as those that are inherent therein. The particular embodiments disclosed above are illustrative only, as the present invention may be modified and practiced in different but equivalent manners apparent to those skilled in the art having the benefit of the teachings herein. Furthermore, no limitations are intended to the details of construction or design herein shown, other than as described in the claims below. It is therefore evident that the particular illustrative embodiments disclosed above may be altered, combined, or modified and all such variations are considered within the scope and spirit of the present invention. The invention illustratively disclosed herein suitably may be practiced in the absence of any element that is not specifically disclosed herein and/or any optional element disclosed herein. While compositions and methods are described in terms of "comprising," "containing," or "including" various components or steps, the compositions and methods can also "consist essentially of" or "consist of" the various components and steps. All numbers and ranges disclosed above may vary by some amount. Whenever a numerical range with a lower limit and an upper limit is disclosed, any number and any included range falling within the range is specifically disclosed. In particular, every range of values (of the form, "from about a to about b," or, equivalently, "from approximately a to b," or, equivalently, "from approximately a-b") disclosed herein is to be understood to set forth every number and range encompassed within the broader range of values. Also, the terms in the claims have their plain, ordinary meaning unless otherwise explicitly and clearly defined by the patentee. Moreover, the indefinite articles "a" or "an," as used in the claims, are defined herein to mean one or more than one of the element that it introduces. If there is any conflict in the usages of a word or term in this specification and one or more patent or other documents that may be incorporated herein by reference, the definitions that are consistent with this specification should be adopted.
Sequence CWU
1
1
211193PRTVibrio cholerae 1Asn Asp Asp Lys Leu Tyr Arg Ala Asp Ser Arg Pro
Pro Asp Glu Ile 1 5 10
15 Lys Gln Ser Gly Gly Leu Met Pro Arg Gly Gln Ser Glu Tyr Phe Asp
20 25 30 Arg Gly Thr
Gln Met Asn Ile Asn Leu Tyr Asp His Ala Arg Gly Thr 35
40 45 Gln Thr Gly Phe Val Arg His Asp
Asp Gly Tyr Val Ser Thr Ser Ile 50 55
60 Ser Leu Arg Ser Ala His Leu Val Gly Gln Thr Ile Leu
Ser Gly His 65 70 75
80 Ser Thr Tyr Tyr Ile Tyr Val Ile Ala Thr Ala Pro Asn Met Phe Asn
85 90 95 Val Asn Asp Val
Leu Gly Ala Tyr Ser Pro His Pro Asp Glu Gln Glu 100
105 110 Val Ser Ala Leu Gly Gly Ile Pro Tyr
Ser Gln Ile Tyr Gly Trp Tyr 115 120
125 Arg Val His Phe Gly Val Leu Asp Glu Gln Leu His Arg Asn
Arg Gly 130 135 140
Tyr Arg Asp Arg Tyr Tyr Ser Asn Leu Asp Ile Ala Pro Ala Ala Asp 145
150 155 160 Gly Tyr Gly Leu Ala
Gly Phe Pro Pro Glu His Arg Ala Trp Arg Glu 165
170 175 Glu Pro Trp Ile His His Ala Pro Pro Gly
Cys Gly Asn Ala Pro Arg 180 185
190 Ser 247PRTVibrio cholerae 2Ser Met Ser Asn Thr Ser Asp Glu
Lys Thr Gln Ser Leu Gly Val Lys 1 5 10
15 Phe Leu Asp Glu Tyr Gln Ser Lys Val Lys Arg Gln Ile
Phe Ser Gly 20 25 30
Tyr Gln Ser Asp Ile Asp Thr His Asn Arg Ile Lys Asp Glu Leu 35
40 45 3103PRTVibrio cholerae
3Thr Pro Gln Asn Ile Thr Asp Leu Cys Ala Glu Tyr His Asn Thr Gln 1
5 10 15 Ile His Thr Leu
Asn Asp Lys Ile Phe Ser Tyr Thr Glu Ser Leu Ala 20
25 30 Gly Lys Arg Glu Met Ala Ile Ile Thr
Phe Lys Asn Gly Ala Thr Phe 35 40
45 Gln Val Glu Val Pro Gly Ser Gln His Ile Asp Ser Gln Lys
Lys Ala 50 55 60
Ile Glu Arg Met Lys Asp Thr Leu Arg Ile Ala Tyr Leu Thr Glu Ala 65
70 75 80 Lys Val Glu Lys Leu
Cys Val Trp Asn Asn Lys Thr Pro His Ala Ile 85
90 95 Ala Ala Ile Ser Met Ala Asn
100 4273PRTStaphylococcus aureus 4Ala Thr Glu Ala Thr Asn Ala
Thr Asn Asn Gln Ser Thr Gln Val Ser 1 5
10 15 Gln Ala Thr Ser Gln Pro Ile Asn Phe Gln Val
Gln Lys Asp Gly Ser 20 25
30 Ser Glu Lys Ser His Met Asp Asp Tyr Met Gln His Pro Gly Lys
Val 35 40 45 Ile
Lys Gln Asn Asn Lys Tyr Tyr Phe Gln Ala Val Leu Asn Asn Ala 50
55 60 Ser Phe Trp Lys Glu Tyr
Lys Phe Tyr Asn Ala Asn Asn Gln Glu Leu 65 70
75 80 Ala Thr Thr Val Val Asn Asp Asp Lys Lys Ala
Asp Thr Arg Thr Ile 85 90
95 Asn Val Ala Val Glu Pro Gly Tyr Lys Ser Leu Thr Thr Lys Val His
100 105 110 Ile Val
Val Pro Gln Ile Asn Tyr Asn His Arg Tyr Thr Thr His Leu 115
120 125 Glu Phe Glu Lys Ala Ile Pro
Thr Leu Ala Asp Ala Ala Lys Pro Asn 130 135
140 Asn Val Lys Pro Val Gln Pro Lys Pro Ala Gln Pro
Lys Thr Pro Thr 145 150 155
160 Glu Gln Thr Lys Pro Val Gln Pro Lys Val Glu Lys Val Lys Pro Ala
165 170 175 Val Thr Ala
Pro Ser Lys Asn Glu Asn Arg Gln Thr Thr Lys Val Val 180
185 190 Ser Ser Glu Ala Thr Lys Asp Gln
Ser Gln Thr Gln Ser Ala Arg Thr 195 200
205 Val Lys Thr Thr Gln Thr Ala Gln Asp Gln Asn Lys Val
Gln Thr Pro 210 215 220
Val Lys Asp Val Ala Thr Ala Lys Ser Glu Ser Asn Asn Gln Ala Val 225
230 235 240 Ser Asp Asn Lys
Ser Gln Gln Thr Asn Lys Val Thr Lys Gln Asn Glu 245
250 255 Val His Lys Gln Gly Pro Ser Lys Asp
Ser Lys Ala Lys Glu Leu Pro 260 265
270 Lys 5423PRTArtificial SequenceChimeric Protein
IsdA-CTA2/B 5Ala Thr Glu Ala Thr Asn Ala Thr Asn Asn Gln Ser Thr Gln Val
Ser 1 5 10 15 Gln
Ala Thr Ser Gln Pro Ile Asn Phe Gln Val Gln Lys Asp Gly Ser
20 25 30 Ser Glu Lys Ser His
Met Asp Asp Tyr Met Gln His Pro Gly Lys Val 35
40 45 Ile Lys Gln Asn Asn Lys Tyr Tyr Phe
Gln Ala Val Leu Asn Asn Ala 50 55
60 Ser Phe Trp Lys Glu Tyr Lys Phe Tyr Asn Ala Asn Asn
Gln Glu Leu 65 70 75
80 Ala Thr Thr Val Val Asn Asp Asp Lys Lys Ala Asp Thr Arg Thr Ile
85 90 95 Asn Val Ala Val
Glu Pro Gly Tyr Lys Ser Leu Thr Thr Lys Val His 100
105 110 Ile Val Val Pro Gln Ile Asn Tyr Asn
His Arg Tyr Thr Thr His Leu 115 120
125 Glu Phe Glu Lys Ala Ile Pro Thr Leu Ala Asp Ala Ala Lys
Pro Asn 130 135 140
Asn Val Lys Pro Val Gln Pro Lys Pro Ala Gln Pro Lys Thr Pro Thr 145
150 155 160 Glu Gln Thr Lys Pro
Val Gln Pro Lys Val Glu Lys Val Lys Pro Ala 165
170 175 Val Thr Ala Pro Ser Lys Asn Glu Asn Arg
Gln Thr Thr Lys Val Val 180 185
190 Ser Ser Glu Ala Thr Lys Asp Gln Ser Gln Thr Gln Ser Ala Arg
Thr 195 200 205 Val
Lys Thr Thr Gln Thr Ala Gln Asp Gln Asn Lys Val Gln Thr Pro 210
215 220 Val Lys Asp Val Ala Thr
Ala Lys Ser Glu Ser Asn Asn Gln Ala Val 225 230
235 240 Ser Asp Asn Lys Ser Gln Gln Thr Asn Lys Val
Thr Lys Gln Asn Glu 245 250
255 Val His Lys Gln Gly Pro Ser Lys Asp Ser Lys Ala Lys Glu Leu Pro
260 265 270 Lys Ser
Met Ser Asn Thr Ser Asp Glu Lys Thr Gln Ser Leu Gly Val 275
280 285 Lys Phe Leu Asp Glu Tyr Gln
Ser Lys Val Lys Arg Gln Ile Phe Ser 290 295
300 Gly Tyr Gln Ser Asp Ile Asp Thr His Asn Arg Ile
Lys Asp Glu Leu 305 310 315
320 Thr Pro Gln Asn Ile Thr Asp Leu Cys Ala Glu Tyr His Asn Thr Gln
325 330 335 Ile His Thr
Leu Asn Asp Lys Ile Phe Ser Tyr Thr Glu Ser Leu Ala 340
345 350 Gly Lys Arg Glu Met Ala Ile Ile
Thr Phe Lys Asn Gly Ala Thr Phe 355 360
365 Gln Val Glu Val Pro Gly Ser Gln His Ile Asp Ser Gln
Lys Lys Ala 370 375 380
Ile Glu Arg Met Lys Asp Thr Leu Arg Ile Ala Tyr Leu Thr Glu Ala 385
390 395 400 Lys Val Glu Lys
Leu Cys Val Trp Asn Asn Lys Thr Pro His Ala Ile 405
410 415 Ala Ala Ile Ser Met Ala Asn
420 6320PRTArtificial SequenceChimeric Protein Isda-CTA2
6Ala Thr Glu Ala Thr Asn Ala Thr Asn Asn Gln Ser Thr Gln Val Ser 1
5 10 15 Gln Ala Thr Ser
Gln Pro Ile Asn Phe Gln Val Gln Lys Asp Gly Ser 20
25 30 Ser Glu Lys Ser His Met Asp Asp Tyr
Met Gln His Pro Gly Lys Val 35 40
45 Ile Lys Gln Asn Asn Lys Tyr Tyr Phe Gln Ala Val Leu Asn
Asn Ala 50 55 60
Ser Phe Trp Lys Glu Tyr Lys Phe Tyr Asn Ala Asn Asn Gln Glu Leu 65
70 75 80 Ala Thr Thr Val Val
Asn Asp Asp Lys Lys Ala Asp Thr Arg Thr Ile 85
90 95 Asn Val Ala Val Glu Pro Gly Tyr Lys Ser
Leu Thr Thr Lys Val His 100 105
110 Ile Val Val Pro Gln Ile Asn Tyr Asn His Arg Tyr Thr Thr His
Leu 115 120 125 Glu
Phe Glu Lys Ala Ile Pro Thr Leu Ala Asp Ala Ala Lys Pro Asn 130
135 140 Asn Val Lys Pro Val Gln
Pro Lys Pro Ala Gln Pro Lys Thr Pro Thr 145 150
155 160 Glu Gln Thr Lys Pro Val Gln Pro Lys Val Glu
Lys Val Lys Pro Ala 165 170
175 Val Thr Ala Pro Ser Lys Asn Glu Asn Arg Gln Thr Thr Lys Val Val
180 185 190 Ser Ser
Glu Ala Thr Lys Asp Gln Ser Gln Thr Gln Ser Ala Arg Thr 195
200 205 Val Lys Thr Thr Gln Thr Ala
Gln Asp Gln Asn Lys Val Gln Thr Pro 210 215
220 Val Lys Asp Val Ala Thr Ala Lys Ser Glu Ser Asn
Asn Gln Ala Val 225 230 235
240 Ser Asp Asn Lys Ser Gln Gln Thr Asn Lys Val Thr Lys Gln Asn Glu
245 250 255 Val His Lys
Gln Gly Pro Ser Lys Asp Ser Lys Ala Lys Glu Leu Pro 260
265 270 Lys Ser Met Ser Asn Thr Ser Asp
Glu Lys Thr Gln Ser Leu Gly Val 275 280
285 Lys Phe Leu Asp Glu Tyr Gln Ser Lys Val Lys Arg Gln
Ile Phe Ser 290 295 300
Gly Tyr Gln Ser Asp Ile Asp Thr His Asn Arg Ile Lys Asp Glu Leu 305
310 315 320
7193PRTEscherichia coli 7Asn Gly Asp Lys Leu Tyr Arg Ala Asp Ser Arg Pro
Pro Asp Glu Ile 1 5 10
15 Lys Arg Ser Gly Gly Leu Met Pro Arg Gly His Asn Glu Tyr Phe Asp
20 25 30 Arg Gly Thr
Gln Met Asn Ile Asn Leu Tyr Asp His Ala Arg Gly Thr 35
40 45 Gln Thr Gly Phe Val Arg Tyr Asp
Asp Gly Tyr Val Ser Thr Ser Leu 50 55
60 Ser Leu Arg Ser Ala His Leu Ala Gly Gln Ser Ile Leu
Ser Gly Tyr 65 70 75
80 Ser Thr Tyr Tyr Ile Tyr Val Ile Ala Thr Ala Pro Asn Met Phe Asn
85 90 95 Val Asn Asp Val
Leu Gly Val Tyr Ser Pro His Pro Tyr Glu Gln Glu 100
105 110 Val Ser Ala Leu Gly Gly Ile Pro Tyr
Ser Gln Ile Tyr Gly Trp Tyr 115 120
125 Arg Val Asn Phe Gly Val Ile Asp Glu Arg Leu His Arg Asn
Arg Glu 130 135 140
Tyr Arg Asp Arg Tyr Tyr Arg Asn Leu Asn Ile Ala Pro Ala Glu Asp 145
150 155 160 Gly Tyr Arg Leu Ala
Gly Phe Pro Pro Asp His Gln Ala Trp Arg Glu 165
170 175 Glu Pro Trp Ile His His Ala Pro Gln Gly
Cys Gly Asn Ser Ser Arg 180 185
190 Thr 847PRTEscherichia coli 8Ile Thr Gly Asp Thr Cys Asn
Glu Glu Thr Gln Asn Leu Ser Thr Ile 1 5
10 15 Tyr Leu Arg Lys Tyr Gln Ser Lys Val Lys Arg
Gln Ile Phe Ser Asp 20 25
30 Tyr Gln Ser Glu Val Asp Ile Tyr Asn Arg Ile Arg Asn Glu Leu
35 40 45
9103PRTEscherichia coli 9Ala Pro Gln Ser Ile Thr Glu Leu Cys Ser Glu Tyr
His Asn Thr Gln 1 5 10
15 Ile Tyr Thr Ile Asn Asp Lys Ile Leu Ser Tyr Thr Glu Ser Met Ala
20 25 30 Gly Lys Arg
Glu Met Val Ile Ile Thr Phe Lys Ser Gly Ala Thr Phe 35
40 45 Gln Val Glu Val Pro Gly Ser Gln
His Ile Asp Ser Gln Lys Lys Ala 50 55
60 Ile Glu Arg Met Lys Asp Thr Leu Arg Ile Thr Tyr Leu
Thr Glu Thr 65 70 75
80 Lys Ile Asp Lys Leu Cys Val Trp Asn Asn Lys Thr Pro Asn Ser Ile
85 90 95 Ala Ala Ile Ser
Met Glu Asn 100 10423PRTArtificial
SequenceChimeric Protein IsdA-LTA2/B 10Ala Thr Glu Ala Thr Asn Ala Thr
Asn Asn Gln Ser Thr Gln Val Ser 1 5 10
15 Gln Ala Thr Ser Gln Pro Ile Asn Phe Gln Val Gln Lys
Asp Gly Ser 20 25 30
Ser Glu Lys Ser His Met Asp Asp Tyr Met Gln His Pro Gly Lys Val
35 40 45 Ile Lys Gln Asn
Asn Lys Tyr Tyr Phe Gln Ala Val Leu Asn Asn Ala 50
55 60 Ser Phe Trp Lys Glu Tyr Lys Phe
Tyr Asn Ala Asn Asn Gln Glu Leu 65 70
75 80 Ala Thr Thr Val Val Asn Asp Asp Lys Lys Ala Asp
Thr Arg Thr Ile 85 90
95 Asn Val Ala Val Glu Pro Gly Tyr Lys Ser Leu Thr Thr Lys Val His
100 105 110 Ile Val Val
Pro Gln Ile Asn Tyr Asn His Arg Tyr Thr Thr His Leu 115
120 125 Glu Phe Glu Lys Ala Ile Pro Thr
Leu Ala Asp Ala Ala Lys Pro Asn 130 135
140 Asn Val Lys Pro Val Gln Pro Lys Pro Ala Gln Pro Lys
Thr Pro Thr 145 150 155
160 Glu Gln Thr Lys Pro Val Gln Pro Lys Val Glu Lys Val Lys Pro Ala
165 170 175 Val Thr Ala Pro
Ser Lys Asn Glu Asn Arg Gln Thr Thr Lys Val Val 180
185 190 Ser Ser Glu Ala Thr Lys Asp Gln Ser
Gln Thr Gln Ser Ala Arg Thr 195 200
205 Val Lys Thr Thr Gln Thr Ala Gln Asp Gln Asn Lys Val Gln
Thr Pro 210 215 220
Val Lys Asp Val Ala Thr Ala Lys Ser Glu Ser Asn Asn Gln Ala Val 225
230 235 240 Ser Asp Asn Lys Ser
Gln Gln Thr Asn Lys Val Thr Lys Gln Asn Glu 245
250 255 Val His Lys Gln Gly Pro Ser Lys Asp Ser
Lys Ala Lys Glu Leu Pro 260 265
270 Lys Ile Thr Gly Asp Thr Cys Asn Glu Glu Thr Gln Asn Leu Ser
Thr 275 280 285 Ile
Tyr Leu Arg Lys Tyr Gln Ser Lys Val Lys Arg Gln Ile Phe Ser 290
295 300 Asp Tyr Gln Ser Glu Val
Asp Ile Tyr Asn Arg Ile Arg Asn Glu Leu 305 310
315 320 Ala Pro Gln Ser Ile Thr Glu Leu Cys Ser Glu
Tyr His Asn Thr Gln 325 330
335 Ile Tyr Thr Ile Asn Asp Lys Ile Leu Ser Tyr Thr Glu Ser Met Ala
340 345 350 Gly Lys
Arg Glu Met Val Ile Ile Thr Phe Lys Ser Gly Ala Thr Phe 355
360 365 Gln Val Glu Val Pro Gly Ser
Gln His Ile Asp Ser Gln Lys Lys Ala 370 375
380 Ile Glu Arg Met Lys Asp Thr Leu Arg Ile Thr Tyr
Leu Thr Glu Thr 385 390 395
400 Lys Ile Asp Lys Leu Cys Val Trp Asn Asn Lys Thr Pro Asn Ser Ile
405 410 415 Ala Ala Ile
Ser Met Glu Asn 420 11320PRTArtificial
SequenceChimeric Protein IsdA-LTA2 11Ala Thr Glu Ala Thr Asn Ala Thr Asn
Asn Gln Ser Thr Gln Val Ser 1 5 10
15 Gln Ala Thr Ser Gln Pro Ile Asn Phe Gln Val Gln Lys Asp
Gly Ser 20 25 30
Ser Glu Lys Ser His Met Asp Asp Tyr Met Gln His Pro Gly Lys Val
35 40 45 Ile Lys Gln Asn
Asn Lys Tyr Tyr Phe Gln Ala Val Leu Asn Asn Ala 50
55 60 Ser Phe Trp Lys Glu Tyr Lys Phe
Tyr Asn Ala Asn Asn Gln Glu Leu 65 70
75 80 Ala Thr Thr Val Val Asn Asp Asp Lys Lys Ala Asp
Thr Arg Thr Ile 85 90
95 Asn Val Ala Val Glu Pro Gly Tyr Lys Ser Leu Thr Thr Lys Val His
100 105 110 Ile Val Val
Pro Gln Ile Asn Tyr Asn His Arg Tyr Thr Thr His Leu 115
120 125 Glu Phe Glu Lys Ala Ile Pro Thr
Leu Ala Asp Ala Ala Lys Pro Asn 130 135
140 Asn Val Lys Pro Val Gln Pro Lys Pro Ala Gln Pro Lys
Thr Pro Thr 145 150 155
160 Glu Gln Thr Lys Pro Val Gln Pro Lys Val Glu Lys Val Lys Pro Ala
165 170 175 Val Thr Ala Pro
Ser Lys Asn Glu Asn Arg Gln Thr Thr Lys Val Val 180
185 190 Ser Ser Glu Ala Thr Lys Asp Gln Ser
Gln Thr Gln Ser Ala Arg Thr 195 200
205 Val Lys Thr Thr Gln Thr Ala Gln Asp Gln Asn Lys Val Gln
Thr Pro 210 215 220
Val Lys Asp Val Ala Thr Ala Lys Ser Glu Ser Asn Asn Gln Ala Val 225
230 235 240 Ser Asp Asn Lys Ser
Gln Gln Thr Asn Lys Val Thr Lys Gln Asn Glu 245
250 255 Val His Lys Gln Gly Pro Ser Lys Asp Ser
Lys Ala Lys Glu Leu Pro 260 265
270 Lys Ile Thr Gly Asp Thr Cys Asn Glu Glu Thr Gln Asn Leu Ser
Thr 275 280 285 Ile
Tyr Leu Arg Lys Tyr Gln Ser Lys Val Lys Arg Gln Ile Phe Ser 290
295 300 Asp Tyr Gln Ser Glu Val
Asp Ile Tyr Asn Arg Ile Arg Asn Glu Leu 305 310
315 320 12250PRTEscherichia coli 12Glu Phe Thr Leu
Asp Phe Ser Thr Ala Lys Thr Tyr Val Asp Ser Leu 1 5
10 15 Asn Val Ile Arg Ser Ala Ile Gly Thr
Pro Leu Gln Thr Ile Ser Ser 20 25
30 Gly Gly Thr Ser Leu Leu Met Ile Asp Ser Gly Thr Gly Asp
Asn Leu 35 40 45
Phe Ala Val Asp Val Arg Gly Ile Asp Pro Glu Glu Gly Arg Phe Asn 50
55 60 Asn Leu Arg Leu Ile
Val Glu Arg Asn Asn Leu Tyr Val Thr Gly Phe 65 70
75 80 Val Asn Arg Thr Asn Asn Val Phe Tyr Arg
Phe Ala Asp Phe Ser His 85 90
95 Val Thr Phe Pro Gly Thr Thr Ala Val Thr Leu Ser Gly Asp Ser
Ser 100 105 110 Tyr
Thr Thr Leu Gln Arg Val Ala Gly Ile Ser Arg Thr Gly Met Gln 115
120 125 Ile Asn Arg His Ser Leu
Thr Thr Ser Tyr Leu Asp Leu Met Ser His 130 135
140 Ser Gly Thr Ser Leu Thr Gln Ser Val Ala Arg
Ala Met Leu Arg Phe 145 150 155
160 Val Thr Val Thr Ala Glu Ala Leu Arg Phe Arg Gln Ile Gln Arg Gly
165 170 175 Phe Arg
Thr Thr Leu Asp Asp Leu Ser Gly Arg Ser Tyr Val Met Thr 180
185 190 Ala Glu Asp Val Asp Leu Thr
Leu Asn Trp Gly Arg Leu Ser Ser Val 195 200
205 Leu Pro Asp Tyr His Gly Gln Asp Ser Val Arg Val
Gly Arg Ile Ser 210 215 220
Phe Gly Ser Ile Asn Ala Ile Leu Gly Ser Val Ala Leu Ile Leu Asn 225
230 235 240 Cys His His
His Ala Ser Arg Val Ala Arg 245 250
1342PRTEscherichia coli 13Met Ala Ser Asp Glu Phe Pro Ser Met Cys Pro Ala
Asp Gly Arg Val 1 5 10
15 Arg Gly Ile Thr His Asn Lys Ile Leu Trp Asp Ser Ser Thr Leu Gly
20 25 30 Ala Ile Leu
Met Arg Arg Thr Ile Ser Ser 35 40
1469PRTEscherichia coli 14Thr Pro Asp Cys Val Thr Gly Lys Val Glu Tyr Thr
Lys Tyr Asn Asp 1 5 10
15 Asp Asp Thr Phe Thr Val Lys Val Gly Asp Lys Glu Leu Phe Thr Asn
20 25 30 Arg Trp Asn
Leu Gln Ser Leu Leu Leu Ser Ala Gln Ile Thr Gly Met 35
40 45 Thr Val Thr Ile Lys Thr Asn Ala
Cys His Asn Gly Gly Gly Phe Ser 50 55
60 Glu Val Ile Phe Arg 65
15384PRTArtificial SequenceChimeric Protein IsdA-STA2/B 15Ala Thr Glu Ala
Thr Asn Ala Thr Asn Asn Gln Ser Thr Gln Val Ser 1 5
10 15 Gln Ala Thr Ser Gln Pro Ile Asn Phe
Gln Val Gln Lys Asp Gly Ser 20 25
30 Ser Glu Lys Ser His Met Asp Asp Tyr Met Gln His Pro Gly
Lys Val 35 40 45
Ile Lys Gln Asn Asn Lys Tyr Tyr Phe Gln Ala Val Leu Asn Asn Ala 50
55 60 Ser Phe Trp Lys Glu
Tyr Lys Phe Tyr Asn Ala Asn Asn Gln Glu Leu 65 70
75 80 Ala Thr Thr Val Val Asn Asp Asp Lys Lys
Ala Asp Thr Arg Thr Ile 85 90
95 Asn Val Ala Val Glu Pro Gly Tyr Lys Ser Leu Thr Thr Lys Val
His 100 105 110 Ile
Val Val Pro Gln Ile Asn Tyr Asn His Arg Tyr Thr Thr His Leu 115
120 125 Glu Phe Glu Lys Ala Ile
Pro Thr Leu Ala Asp Ala Ala Lys Pro Asn 130 135
140 Asn Val Lys Pro Val Gln Pro Lys Pro Ala Gln
Pro Lys Thr Pro Thr 145 150 155
160 Glu Gln Thr Lys Pro Val Gln Pro Lys Val Glu Lys Val Lys Pro Ala
165 170 175 Val Thr
Ala Pro Ser Lys Asn Glu Asn Arg Gln Thr Thr Lys Val Val 180
185 190 Ser Ser Glu Ala Thr Lys Asp
Gln Ser Gln Thr Gln Ser Ala Arg Thr 195 200
205 Val Lys Thr Thr Gln Thr Ala Gln Asp Gln Asn Lys
Val Gln Thr Pro 210 215 220
Val Lys Asp Val Ala Thr Ala Lys Ser Glu Ser Asn Asn Gln Ala Val 225
230 235 240 Ser Asp Asn
Lys Ser Gln Gln Thr Asn Lys Val Thr Lys Gln Asn Glu 245
250 255 Val His Lys Gln Gly Pro Ser Lys
Asp Ser Lys Ala Lys Glu Leu Pro 260 265
270 Lys Met Ala Ser Asp Glu Phe Pro Ser Met Cys Pro Ala
Asp Gly Arg 275 280 285
Val Arg Gly Ile Thr His Asn Lys Ile Leu Trp Asp Ser Ser Thr Leu 290
295 300 Gly Ala Ile Leu
Met Arg Arg Thr Ile Ser Ser Thr Pro Asp Cys Val 305 310
315 320 Thr Gly Lys Val Glu Tyr Thr Lys Tyr
Asn Asp Asp Asp Thr Phe Thr 325 330
335 Val Lys Val Gly Asp Lys Glu Leu Phe Thr Asn Arg Trp Asn
Leu Gln 340 345 350
Ser Leu Leu Leu Ser Ala Gln Ile Thr Gly Met Thr Val Thr Ile Lys
355 360 365 Thr Asn Ala Cys
His Asn Gly Gly Gly Phe Ser Glu Val Ile Phe Arg 370
375 380 16315PRTArtificial
SequenceChimeric Protein IsdA-STA2 16Ala Thr Glu Ala Thr Asn Ala Thr Asn
Asn Gln Ser Thr Gln Val Ser 1 5 10
15 Gln Ala Thr Ser Gln Pro Ile Asn Phe Gln Val Gln Lys Asp
Gly Ser 20 25 30
Ser Glu Lys Ser His Met Asp Asp Tyr Met Gln His Pro Gly Lys Val
35 40 45 Ile Lys Gln Asn
Asn Lys Tyr Tyr Phe Gln Ala Val Leu Asn Asn Ala 50
55 60 Ser Phe Trp Lys Glu Tyr Lys Phe
Tyr Asn Ala Asn Asn Gln Glu Leu 65 70
75 80 Ala Thr Thr Val Val Asn Asp Asp Lys Lys Ala Asp
Thr Arg Thr Ile 85 90
95 Asn Val Ala Val Glu Pro Gly Tyr Lys Ser Leu Thr Thr Lys Val His
100 105 110 Ile Val Val
Pro Gln Ile Asn Tyr Asn His Arg Tyr Thr Thr His Leu 115
120 125 Glu Phe Glu Lys Ala Ile Pro Thr
Leu Ala Asp Ala Ala Lys Pro Asn 130 135
140 Asn Val Lys Pro Val Gln Pro Lys Pro Ala Gln Pro Lys
Thr Pro Thr 145 150 155
160 Glu Gln Thr Lys Pro Val Gln Pro Lys Val Glu Lys Val Lys Pro Ala
165 170 175 Val Thr Ala Pro
Ser Lys Asn Glu Asn Arg Gln Thr Thr Lys Val Val 180
185 190 Ser Ser Glu Ala Thr Lys Asp Gln Ser
Gln Thr Gln Ser Ala Arg Thr 195 200
205 Val Lys Thr Thr Gln Thr Ala Gln Asp Gln Asn Lys Val Gln
Thr Pro 210 215 220
Val Lys Asp Val Ala Thr Ala Lys Ser Glu Ser Asn Asn Gln Ala Val 225
230 235 240 Ser Asp Asn Lys Ser
Gln Gln Thr Asn Lys Val Thr Lys Gln Asn Glu 245
250 255 Val His Lys Gln Gly Pro Ser Lys Asp Ser
Lys Ala Lys Glu Leu Pro 260 265
270 Lys Met Ala Ser Asp Glu Phe Pro Ser Met Cys Pro Ala Asp Gly
Arg 275 280 285 Val
Arg Gly Ile Thr His Asn Lys Ile Leu Trp Asp Ser Ser Thr Leu 290
295 300 Gly Ala Ile Leu Met Arg
Arg Thr Ile Ser Ser 305 310 315
1732DNAArtificial Sequence5' SphI PCR primer 17gctactggca tgcggcaaca
gaagctacga ac 321830DNAArtificial
Sequence3' ClaI Primer 18gtgcatgatc gattttggta attctttagc
301933DNAArtificial Sequence5' BamHI Primer
19gctactggat ccgcggcaac agaagctacg aac
332036DNAArtificial Sequence5' BamHI alternative primer 20gtgcataagc
tttcaagttt ttggtaattc tttagc
362130DNAArtificial Sequence3' HindIII Primer 21gtgcatgatc gattttggta
attctttagc 30
User Contributions:
Comment about this patent or add new information about this topic:
People who visited this patent also read: | |
Patent application number | Title |
---|---|
20190076858 | REVERSING MECHANISM FOR AN IRRIGATION SPRINKLER WITH A REVERSING GEAR DRIVE |
20190076857 | SIMPLIFIED AIRLESS SPRAY GUN |
20190076855 | SHOWER DEVICE |
20190076854 | FLUID PERMEABLE MEMBER |
20190076853 | ELECTROSTATIC AIR CLEANER |