Patent application title: ALDOLASE, ALDOLASE MUTANT, AND METHOD AND COMPOSITION FOR PRODUCING TAGATOSE BY USING SAME
Inventors:
IPC8 Class: AC12N988FI
USPC Class:
435148
Class name: Preparing oxygen-containing organic compound containing carbonyl group ketone
Publication date: 2018-01-25
Patent application number: 20180023073
Abstract:
There are provided aldolase, an aldolase mutant, a method for producing
tagatose, and a composition for producing tagatose using the same. The
technical feature of the present invention is environment-friendly due to
the use of an enzyme acquired from microorganisms, requires only a simple
process of enzyme-immobilization, uses a low-cost substrate compared with
that of a conventional method for producing tagatose, and has a
remarkably high yield, thereby greatly reducing production cost while
maximizing production effect.Claims:
1. A method of producing tagatose from fructose, the method comprising:
reacting fructose 6-phosphate with tagatose 6-phosphate epimerase or a
mutant thereof to obtain tagatose 6-phosphate; and converting the
tagatose 6-phosphate to tagatose.
2. The method of claim 1, wherein the tagatose 6-phosphate epimerase catalyzes the conversion of fructose 6-phosphate to tagatose-6-phosphate.
3. The method of claim 1, wherein the tagatose 6-phosphate epimerase is SEQ ID NOS: 1.
4. The method of claim 1, wherein the tagatose 6-phosphate epimerase is SEQ ID NOS: 2.
5. The method of claim 1, wherein the tagatose 6-phosphate epimerase is SEQ ID NOS: 3.
6. The method of claim 1, wherein the tagatose 6-phosphate epimerase is SEQ ID NOS: 4.
7. The method of claim 1, wherein the mutant comprises at least one amino acid substitution of SEQ ID NO: 1 selected from the group consisting of: i) a substitution of arginine residue with glutamine at a position corresponding to position 332, ii) a substitution of glutamine residue with alanine at a position corresponding to position 314, iii) a substitution of histidine residue with alanine at a position corresponding to position 227, and iv) a substitution of serine residue with alanine at a position corresponding to position 62.
8. The method of claim 1, wherein the fructose 6-phosphate is obtained by treating fructose or a fructose-containing material with hexokinase.
9. The method of claim 1, wherein the tagatose is obtained by treating the tagatose 6-phosphate with phytase.
10. The method of claim 1, wherein the reaction of the fructose 6-phosphate with the tagatose 6-phosphate epimerase is performed at a pH from 7.0 to 9.0.
11. The method of claim 1, wherein the reaction of the fructose 6-phosphate with the tagatose 6-phosphate epimerase is performed at a temperature from 30 .degree. C. to 70 .degree. C.
Description:
CROSS-REFERENCE TO RELATED APPLICATION
[0001] This application is a divisional application of U.S. patent application Ser. No. 14/908,469 filed on Jan. 28, 2016, which is a National Stage application of PCT/KR2014/006850 filed on Jul. 25, 2014, which claims priority to, and the benefit, Korean Patent Application No. 10-2013-0089588 filed on Jul. 29, 2013, Korean Patent Application No. 10-2014-0001709 filed on Jan. 7, 2014, and Korean Patent Application No. 10-2014-0093443 filed on Jul. 23, 2014 in the Korea Intellectual Property Office, the entire contents of which are incorporated herein by reference.
TECHNICAL FIELD
[0002] The present invention relates to aldolase, an aldolase mutant, and a method for producing tagatose and a composition for producing tagatose using the same.
BACKGROUND ART
[0003] Generally, tagatose (D-tagatose) is a C.sub.4 epimer of fructose (D-fructose) and has a sugar content of 92% relative to sugar but it is a low-calorie sweetener having a calorie of 1.5 kcal/g, which is about 30% of sugar. Additionally, tagatose is a non-caloric sweetener which is hardly metabolized during the in-vivo absorption process. About 15% to 20% of the amount of tagatose ingested is absorbed into the body but this absorption is due to the decomposition by the microorganisms in the large intestine not by self-digestion capability in humans, and it thus does not affect the blood glucose levels. Accordingly, it is expected to provide a blood glucose level-controlling effect to diabetic patients, and is known to provide foods for enteric microorganisms, and thereby helps with excretion activity by microorganisms. Tagatose has the functional characteristics of not causing tooth decay and thus it is a healthy sweetener to be safely included in chocolate, gums, bread, candies, and the like, which are favored by children, instead of sugar so that children can intake without worries and has been highlighted as a material which can contribute to the prevention of diseases due to excess sugar intake. Additionally, tagatose has a boiling point of 134.degree. C. and a pH of 2 to 7, and is thus highly stable against heat and pH. Therefore, tagatose is not readily destroyed, unlike most artificial sweeteners, but has physical and chemical properties most similar to that of sugar, and when it is heated, the characteristic of browning reaction is ketose, which is similar to that of fructose, and thus has an important characteristic as a sugar substitute.
[0004] For these reasons, tagatose has been highlighted as a food supplement and a diet sweetener in food industry, and there is a growing need for the development of a method for efficiently producing tagatose. This is because tagatose is a rare sugar included in dairy products or a few plants in a small amount and it cannot be synthesized by a chemical method. At present, tagatose is being produced by isomerization of galactose via a bioconversion method using L-arabinose isomerase. However, the supply of galactose is unstable and its supply price varies greatly depending on the change in the market of dairy products thus raising a difficulty in securing a steady and large amount of product.
[0005] Accordingly, to solve these problems, studies have actively focused on developing a method of producing tagatose using an enzyme based on substrates such as glucose or fructose, which has a low price and can be steadily supplied.
[0006] Until now, a single enzyme reaction that can produce tagatose from fructose by a single enzyme reaction is not known. In the case of a single enzyme, conversion can hardly occur by the mechanisms of enzymes for epimerization known so far and the production yield obtained therefrom is significantly low and is thus not sufficient for its industrialization.
Prior Art Patent Document
Korean Patent Application No. 10-2001-0080711
DISCLOSURE
Technical Problem
[0007] The present invention was made based on the above-described necessities, and an object of the present invention is to provide an enzyme used in a method for preparing tagatose with high yield using fructose as a substrate.
[0008] Another object of the present invention is to provide a method of preparing tagatose with high yield using fructose as a substrate.
[0009] A further object of the present invention is to provide a composition for preparing tagatose with high yield using fructose as a substrate.
Technical Solution
[0010] In order to achieve the above objects, the present invention provides a composition that can mediate epimerization at C.sub.4 of a monosaccharide including fructose 1,6-diphosphate aldolase as an active ingredient.
[0011] In an exemplary embodiment of the present invention, the fructose 1,6-diphosphate aldolase is preferably one of the enzymes represented by the amino acid sequences of SEQ ID NOS: 1 to 4, but any fructose 1,6-diphosphate aldolase that can achieve the objects of the present invention by one or more mutation in these amino acid sequences, such as substitution, deletion, inversion, and translocation, or mediate the epimerization of the C.sub.4 of a different monosaccharide can also belong to the scope of the present invention.
[0012] Additionally, the present invention provides a method of epimerizing the C.sub.4 of a monosaccharide by treating with fructose 1,6-diphosphate aldolase.
[0013] Additionally, the present invention provides a composition for producing tagatose including fructose 1,6-diphosphate aldolase as an active ingredient.
[0014] In an exemplary embodiment of the present invention, the the fructose 1,6-diphosphate aldolase is preferably one of the enzymes represented by the amino acid sequences of SEQ ID NOS: 1 to 4, but any fructose 1,6-diphosphate aldolase that can achieve the objects of the present invention by one or more mutation in these amino acid sequences, such as substitution, deletion, inversion, and translocation, or other fructose 1,6-diphosphate aldolase capable of producing tagatose can also belong to the scope of the present invention.
[0015] Additionally, the present invention provides a method of producing tagatose from fructose including reacting fructose 6-phosphate by adding aldolase thereto.
[0016] Additionally, the present invention provides a composition including tagatose produced by the production method of the present invention as an active ingredient.
[0017] Additionally, the present invention provides a food composition including tagatose, which can be produced using tagatose 6-phosphate produced by the method of the present invention, as an active ingredient.
[0018] In an exemplary embodiment of the present invention, the food is preferably beverages, chocolate, gums, bread, candies, dairy products, animal products, and the like, but is not limited thereto.
[0019] The present invention provides proteins represented by amino acid sequences of SEQ ID NOS: 1, 2, 3, and 4 which possess the activity of epimerization of fructose 6-phosphate.
[0020] Additionally, to achieve another object of the present invention, the present invention provides a gene encoding proteins having the activity of epimerization of fructose 6-phosphate, represented by amino acid sequences of SEQ ID NOS: 1, 2, 3, and 4.
[0021] Additionally, to achieve still another object of the present invention, the present invention provides a recombinant expression vector including the above gene.
[0022] Furthermore, the present invention provides a method for producing tagatose by providing a method for producing tagatose 6-phosphate, which is characterized by reacting a protein with fructose 6-phosphate.
[0023] Additionally, the present invention provides a composition for producing tagatose including a mutant of fructose 1,6-bisphosphate aldolase as an active ingredient.
[0024] In an exemplary embodiment of the present invention, the fructose 1,6-bisphosphate aldolase is preferably an enzyme selected from the enzymes consisting of the amino acids represented by SEQ ID NOS: 1 to 4, but is not limited thereto.
[0025] In another exemplary embodiment of the present invention, the mutant is preferably a substitution one or more residues at positions of 332, 314, 227, and 62 of fructose aldolased enzyme comprised of SEQ ID NO: 1, wherein the residue at position 332 is substituted from arginine to glutamine, the residue at position 314 is substituted from glutamine to alanine, the residue at position 227 is substituted from histidine to alanine, and the residue at position 62 is substituted from serine to alanine.
[0026] However, all mutants with an increased activity of the corresponding enzyme compared with that of the wild-type enzyme, by inducing a mutation in other wild-type enzyme of fructose 1,6-bisphosphate aldolase, can belong to the protective scope of the present invention. For example, the mutant with an increased activity of the corresponding enzyme compared with that of the wild-type enzyme, by inducing a mutation in any one of the enzymes represented by SEQ ID NOS: 2 to 4 certainly belongs to the protective scope of the present invention.
[0027] In still another exemplary embodiment of the present invention, the above composition is preferably further includes hexokinase and phytase, but is not limited thereto.
[0028] Additionally, the present invention provides a method for producing tagatose including treating a mutant of the fructose 1,6-bisphosphate aldolase of the present invention with fructose-6-phosphate.
[0029] In an exemplary embodiment of the present invention, the fructose-6-phosphate is preferably obtained by treating fructose or a fructose-containing material with hexokinase, but when it is provided by other chemical syntheses it will also belong to the scope of the present invention.
[0030] In another exemplary embodiment of the present invention, the method preferably further includes converting the tagatose 6-phosphate into tagatose by acting phytase thereon, but the tagatose 6-phosphate may be removed of its phosphate group by a different enzyme or chemical method.
[0031] Additionally, the present invention provides an enzyme for a mutant enzyme of fructose 1,6-bisphosphate aldolase, one of the enzymes selected from the enzymes consisting of the amino acids represented by SEQ ID NOS: 1 to 4.
[0032] Additionally, the present invention provides a gene encoding a mutant of the present invention.
[0033] In an exemplary embodiment of the present invention, hexokinase may be represented by the amino acid sequence of SEQ ID NO: 5 or 6, but all corresponding enzymes having the effect to be achieved in the present invention belong to the protective scope of the present invention.
[0034] According to the present invention, the productivity of tagatose was increased using the enzyme for epimerizing the C.sub.4 of phosphate sugar, and the resolution of the problems, which occur when fermentation was performed using the producing method through the enzyme reaction of the cell itself, was prepared. In particular, there has been no precedent example of producing tagatose from fructose, and the first such production was attempted in the present invention. Additionally, when a yield close to 80% of tagatose can be obtained from fructose by a cocktail reaction.
[0035] The present invention will be described in details herein below.
[0036] In particular, the technical terms and scientific terms as used herein, will refer to those which are commonly understood by a skilled person in the art, unless defined otherwise.
[0037] Additionally, repeated explanations on the technical constitutions and actions equivalent to those of the conventional ones will be omitted herein below.
[0038] The characteristics of fructose 1,6-bisphosphate aldolase were confirmed by cloning a gene corresponding to the fructose 1,6-bisphosphate aldolased enzyme or protein derived from E. coli K-12, whose characteristics have not yet been confirmed in substrates other than the natural substrate, i.e., fructose 1,6-bisphosphate, culturing a microorganism transformed with an expression vector including the gene, followed by overexpression of the fructose 1,6-bisphosphate aldolase.
[0039] As a result, the present invention confirmed that the enzyme has the substrate specificity of epimerizing the C.sub.4 of the fructose 6-phosphate, and thus the present invention relates to producing tagatose 6-phosphate using the above enzyme and then treating with a commercial phytase to thereby produce tagatose.
[0040] More specifically, the gene for the known enzyme, fructose 1,6-bisphosphate aldolase, is already known, but those bacteria, such as Escherichia coli K-12, Bacillus subtilis, Caldicellulosiruptor saccharolyticus, and Kluyveromyces lactis, which have not been confirmed of their characteristics of epimerizing C.sub.4 using fructose 6-phosphate, were used, and the present invention is the first in the world to confirm that all these enzymes have the activity of converting fructose 6-phosphate into tagatose 6-phosphate.
[0041] In particular, for the confirmation of the characteristics of the enzyme, the present invention preferably uses an enzyme obtained by: acquiring the gene for fructose 1,6-bisphosphate aldolase in a large amount by polymerase chain reaction (PCR) from a bacterial strain including the gene for the known fructose 1,6-bisphosphate aldolase, which has been evaluated based on its nucleotide sequence by the previous experiment and named accordingly without confirming the functional characteristics at all; inserting the gene into an appropriate expression vector to construct a recombinant vector including the fructose 1.6-bisphosphate aldolase gene; culturing a transformed bacteria, which was prepared by transforming the recombinant vector into an appropriate microorganism, in a fermentation medium and overexpressing the enzyme; and purifying.
[0042] Additionally, the method of producing tagatose of the present invention consists of three steps of obtaining fructose 6-phosphate by treating fructose 1,6-bisphosphate aldolase, which was commonly called fructose 1,6-bisphosphate aldolased enzyme, with hexokinase; obtaining tagatose 6-phosphate by reacting the fructose 6-phosphate with a substrate; and obtaining tagatose by treating the tagatose 6-phosphate with phytase.
[0043] Additionally, the fructose 1,6-bisphosphate aldolased enzyme used in producing tagatose of the present invention is not limited to the amino acid sequences represented by SEQ ID NOS: 1 to 4, but any amino acid sequence as long as it can convert fructose 6-phosphate into tagatose 6-phosphate, and in particular, even when there is substitution, insertion, deletion in a part of the amino acid sequences described in these SEQ ID NOS.
[0044] Additionally, in the method of producing tagatose in the present invention, the expression vector to be used in cloning the gene for fructose 1,6-bisphosphate aldolase may be any vector including RSF Duet-1 that has been used in gene recombination, and as the bacterial strain to be transformed with the recombinant vector, it is preferable to use E. coli BL21(DE3), but any bacterial strain, which can produce an active protein via overexpression of a desired gene after being transformed with a gene recombinant vector, may be used
[0045] More specifically, regarding the cultivation of a microorganism in the present invention, E. coli BL21(DE3) [Escherichia coli BL21(DE3)] was used as the recombinant bacterial strain to obtain fructose 1,6-bisphosphate aldolase, and LB was used as a culture medium for producing the microorganism, and a medium including 10 g/L of glycerol, 1 g/L of peptone, 30 g/L of yeast extract, 0.14 g/L potassium diphosphate, and 1 g/L of monosodium phosphate was used as the medium for producing the enzyme. For the large-scale production of fructose 1,6-bisphosphate aldolase, it is preferable to inoculate the frozen-stored strain BL21(DE3) into a 250 mL flask including 50 mL of an LB medium, culture the bacterial strain in a shaking water bath at 37.degree. C. until the absorbance at 600 nm reaches 2.0, add the culture into a 7 L fermenter (Biotron, Korea) including a 5L of a fermentation medium and culture until the absorbance at 600 nm reaches 2.0, add with 1 mM IPTG to induce the production of the overexpressing enzyme, while maintaining the stirring speed at 500 rpm, aeration of 1.0 vvm, and the culture temperature at 37.degree. C., during the process.
[0046] Additionally, for the purification of the fructose 1,6-bisphosphate aldolase produced by overexpression, the purified enzyme of the present invention is preferably obtained by the following process of centrifuging the culture of the transformed bacterial strain at 6,000.times.g at 4.degree. C. for 30 minutes; washing the resulting cells twice with 0.85% NaCl, adding the cells in a cell lysate buffer solution (50 mM NaH.sub.2PO.sub.4, 300 mM NaCl, pH 8.0) including 1 mg/mL of lysozyme, and placing in ice for 30 minutes; and crushing the cells in the solution by a French press at 15,000 lb/in.sup.2 and removing the cell lysate by centrifugation at 13,000.times.g at 4.degree. C. for 20 minutes, while purifying the supernatant by filtering through a 0.45 .mu.m filter paper. In particular, the purification process is performed in a low-temperature room via fast protein liquid chromatography (FPLC), in which the filtrate is applied to a HisTrap HP column equilibrated with a 50 mM Tris-HCl buffer solution including 300 mM NaCl (pH 8.0) and 10 mM imidazole, and preferably, the enzyme attached to the column after washing the column with the same buffer solution is eluted by flowing a solution, which includes imidazole at a concentration with a gradient from 10 mM to 200 mM, at a rate of 1 mL/min Preferably, a fraction of the thus-eluted enzyme with an activity is added into a HiPrep 16/60 desalting resin column equilibrated with a 50 mM Tris-HCl buffer solution (pH 8.5), the added protein is washed at a rate of 6 mL/min, the accumulated enzyme solution is added into a Sephacryl S-100 HR column equilibrated with 50 mM Tris-HCl buffer solution including 0.15 M sodium chloride (pH 8.5) to elute the accumulated enzyme at a rate of 6.6 mL/min, and the eluted solution is finally dialyzed in a 50 mM Tris-HCl buffer solution to be used.
[0047] Additionally, the thus-obtained fructose 1,6-bisphosphate aldolase according to the present invention is a monomer having a molecular weight of 78 kDa, and is a metalloenzyme whose activation is controlled by metal ions.
[0048] In particular, it is preferable that the fructose 1,6-bisphosphate aldolase and fructose 6-phosphate are reacted at a ratio of 55% to 75% (w/w) at 50.degree. C. (pH 8.5) considering the production yield of tagatose 6-phosphate. This is because the production yield of tagatose 6-phosphate was excellent when the concentration of the substrate for fructose was in the range from 55% to 75% (w/w), and the above pH and the temperature were the optimum conditions for the fructose 1,6-bisphosphate aldolased enzyme.
[0049] Meanwhile, the cocktail reaction of the present invention is a method for producing tagatose in a large-scale by reacting fructose within a cell using hexokinase, fructose 1,6-bisphosphate aldolased enzyme, and phytase, and it is preferable to use kinase and fructose 1,6-bisphosphate aldolase expressed in a large amount by overexpressing them within a cell. This is because the intracellular environment enables to maintain the activity of an overexpressed enzyme for a long period of time and regenerate cofactors necessary for reactions, and the E. coli that can be used in the present invention may be any E. coli as long as it can overexpress enzymes.
[0050] Since the method of producing tagatose according to the present invention uses enzymes obtained from microorganisms it is environment-friendly, requires only a simple enzyme-fixing process, and can convert the production of tagatose from fructose in a method which has not been done previously, greatly reduce production cost, and maximize the production effect.
[0051] Additionally, the tagatose produced in a large-scale method as described above may be effectively used by being added into functional foods and pharmaceutical drugs.
[0052] Hereinafter, the present invention will be explained in more details by the exemplary embodiments. However, it should be obvious to a skilled person in the art that the exemplary embodiments disclosed herein should not be construed as limiting the scope of the present invention but covering various alternatives and modifications as well as the exemplary embodiments within the ideas and scope of the present invention. Accordingly, the appended claims should be appropriately interpreted to comply with the spirit and scope of the present invention.
EFFECT
[0053] As described above, the characterization of novel enzymes according to the present invention can provide an advantage in that the enzymes can be used after selection to be suitable for various production environment based on the similarities in characteristics between enzymes and the identity and conversion rate possessed by each enzyme.
[0054] Additionally, the method of producing tagatose of the present invention is environment-friendly because only the enzymes obtained from microorganism are used, requires only a simply enzyme-fixing process, and compared with the conventional methods of producing tagatose production, the method of the present invention uses only low-cost substrates while having a significantly higher yield, and it thus can markedly reduce production cost and maximize production effect.
DESCRIPTION OF DRAWINGS
[0055] FIG. 1 is a schematic diagram illustrating the production of tagatose from fructose by a cocktail reaction introduced in the present invention.
[0056] FIGS. 2 to 4 illustrate the comparison results of phylogenetic trees and amino acid sequences with fructose 1,6-diphosphate aldolased enzyme derived from Escherichia coli K-12, regarding the selection of fructose 1,6-diphosphate aldolase of Streptococcus thermophilus, Caldicellulosiruptor saccharolyticus, and Kluyveromyceslactis introduced in the present invention.
[0057] FIG. 5 is a graph illustrating the relative activities of fructose 1,6-diphosphate aldolased enzyme derived from Escherichia coli K-12 and fructose 1,6-diphosphate aldolased enzyme of fructose 1,6-diphosphate aldolase of Streptococcus thermophilus, Caldicellulosiruptor saccharolyticus, and Kluyveromyceslactis after reacting with 5 mM fructose 6-phosphate at pH 8.5 at 50.degree. C. for 1 hour.
[0058] FIG. 6 is a graph illustrating comparison results of the metal specificity of fructose 1,6-diphosphate aldolases of the present invention.
[0059] FIGS. 7 to 9 are graphs illustrating the relative activity and conversion (FIG. 9) of tagatose 6-phosphate in fructose 6-phosphate according to an enzyme optimum pH (FIG. 7) and optimum temperature (FIG. 8) for fructose 1,6-diphosphate aldolase of Streptococcus thermophilus, respectively.
[0060] FIGS. 10 to 12 are graphs illustrating the relative activity and conversion (FIG. 12) of tagatose 6-phosphate in fructose 6-phosphate according to an enzyme optimum pH (FIG. 10) and optimum temperature (FIG. 11) for fructose 1,6-diphosphate aldolase of Caldicellulosiruptor saccharolyticus, respectively.
[0061] FIGS. 13 to 15 are graphs illustrating the relative activity and conversion (FIG. 15) of tagatose 6-phosphate in fructose 6-phosphate according to an enzyme optimum pH (FIG. 13) and optimum temperature (FIG. 14) for fructose 1,6-diphosphate aldolase of Kluyveromyces lactis, respectively.
[0062] FIG. 16 is a graph illustrating the results of the conversion of fructose 6-phosphate into tagatose 6-phosphate using each of the fructose 1,6-diphosphate aldolases used in the present invention. The fructose 1,6-diphosphate aldolase of Kluyveromyces lactis exhibited an activity similar to that of the enzyme derived from Escherichia coli K-12, and the enzyme derived from Streptococcus thermophilus exhibited a fast initial conversion but exhibited a slower conversion of 71%. The enzyme derived from Caldicellulosiruptor saccharolyticus exhibited a conversion of about 80%, similar to that of the enzyme derived from Escherichia coli K-12, and a fast initial conversion.
[0063] FIG. 17 is a schematic diagram of RSF Duet-1 vector system used in the present invention, and this system aims at cloning other enzymes along with fructose 1,6-diphosphate aldolase.
[0064] FIG. 18 is a graph illustrating the production activity obtained by reacting hexokinase derived from Saccharomyces cerevisiae with fructose in a concentration from 5 mM to 50 mM for 1 hour.
[0065] FIGS. 19 to 22 illustrate the metal specificity of fructose 1,6-diphosphate aldolase of Escherichia coli of the present invention (FIG. 19), the conversion from fructose 6-phosphate into tagatose 6-phosphate according to an optimum pH for fructose 1,6-diphosphate aldolase of Escherichia coli (FIG. 20), the conversion according to an optimum temperature (FIG. 21), respectively. FIG. 22 is a graph illustrating the result of converting 10 mM fructose 6-phosphate into tagatose 6-phosphate under the optimum conditions confirmed in the results of FIGS. 19 to 21.
[0066] FIG. 23 lists the conversion into tagatose according to the concentration of phytase when reacting the tagatose 6-phosphate, which was converted in the present invention, with phytase.
[0067] FIG. 24 is a graph illustrating the comparison result of enzyme activity between gene-mutating enzymes constructed in the present invention and a wild-type enzyme, in which increased conversion rate and improved productivity are obtained by a faster conversion rate.
BEST MODE
[0068] Hereinafter, the present invention will be described in detail with reference to Examples. However, the scope of right of the present invention is not limited by these Examples.
EXAMPLE 1
Large-Scale Production of Fructose 1,6-diphosphate aldolased Enzyme
[0069] Regarding fructose 1,6-diphosphate aldolase genes, DNA from Escherichia coli strain K-12, and each strain of Streptococcus thermophilus, Caldicellulosiruptor saccharolyticus, and Kluyveromyces lactis were suggested as genes for fructose 1,6-diphosphate aldolase, but they were obtained in a large-scale by performing PCR amplification after designing primers (see Table 2) based on the nucleotide sequence of DNA of genes, which have never been identified, inserting the PCR product into an RSF Duet-1 vector [Novagen] using restriction enzymes, Sal I and Not I to construct a recombinant vector, RSF Duet-1/fructose 1,6-diphosphate aldolase, followed by transforming the recombinant vector into E. coli BL21(DE3) by a conventional transformation method. Additionally, the E. coli BL21 strain was stored in liquid nitrogen prior to cultivation for a large-scale production.
[0070] Then, for a large-scale production of fructose 1,6-diphosphate aldolase, first, the frozen-stored BL21(DE3) strain was inoculated into a 250 mL flask including 50 mL of LB and seed-cultured in a shaking water bath maintained at 37.degree. C. until the absorbance at 600 nm reached 2.0, and the seed-cultured culture broth was subjected to a main cultivation by adding it into a 7 L fermentor (Biotron, Korea) including a 5 L of a fermentation medium (10 g/L of glycerol, 1 g/L of peptone, 30 g/L of yeast extract, 0.14 g/L potassium diphosphate, and 1 g/L of monosodium phosphate). In particular, the large-scale production of fructose 1,6-diphosphate aldolase was induced by adding 1 mM ITPG when the absorbance at 600 nm reached 2.0. Specifically, the stirring speed at 500 rpm, aeration of 1.0 vvm, and the culture temperature at 37.degree. C. were maintained during the above process.
EXAMPLE 2
Purification of Fructose 1,6-diphosphate aldolase
[0071] In order to accurately identify the characteristics of fructose 1,6-diphosphate aldolase,
the enzyme was purified using affinity HisTrap HP column, desalting HiPrep 16/60, and gel filtration Sephacryl S-100 HR column.
EXAMPLE 3
Metal Specificity of fructose 1,6-diphosphate aldolase
[0072] According to previous reports, fructose 1,6-diphosphate aldolase is involved in the conversion of 1,6-diphosphate substrate into dihydroxyacetone phosphate and glyceraldehyde 3-phosphate by metal zinc and improve titer. However, the present invention confirmed that a metal salt effect does not affect to increase titer when fructose 6-phosphate was applied as a substrate. In order to examine the metal salt effect, the enzyme activity was measured after treating with EDTA or adding 1 mM metal ions, as illustrated in figures below, and in particular, the reaction was performed in a 50 mM PIPES buffer solution (pH 8.5) including 0.15% fructose and 0.05 U/mL at 50.degree. C. for 30 minutes, and the enzyme activity was measured after stopping the reaction with 0.2 M HCl.
[0073] As a result, it was confirmed that the fructose 1,6-diphosphate aldolase of the present invention exhibited no change in its activity by metal ions, and unlike as disclosed in previous reports, zinc ions were exhibited to be a metal enzyme that can significantly inhibit enzyme activity.
EXAMPLE 4
Activity of fructose 1,6-diphosphate aldolase According to Changes in pH and Temperature
[0074] In the present Example, in order to examine the activity of fructose 1,6-diphosphate aldolase according to changes in pH and temperature, the enzyme and the substrate were reacted at various pH and temperatures to compare the enzyme activity. In particular, to examine the effect of pH, the reaction was performed in a 50 mM Trizma base buffer solution including 0.15% fructose 6-phosphate and 0.05 U/mL of the enzyme at a pH from 7.0 to 9.0. Specifically, the reaction was performed at 50.degree. C. for 1 hour. Then, 0.2 M HCl was added to stop the reaction and the enzyme activity was measured. The results are illustrated in each figure.
[0075] Additionally, in order to examine the effect of temperature, the reaction was performed in a 50 mM Trizma base buffer solution (pH 8.5) including 0.15% fructose 6-phosphate and 0.05 U/mL of the enzyme at a temperature from 30.degree. C. to 70.degree. C. for 1 hour. Specifically, 0.2 M HCl was added to stop the reaction and the enzyme activity was measured. The results are illustrated in each figure. As a result, the optimum pH was exhibited to be 8.5, being similar in both Streptococcus thermophilus and Kluyveromyceslactis, and their activities were exhibited to be independent of pH. The optimum temperature for each of the enzymes was exhibited to be 50.degree. C., and Streptococcus thermophiles also showed 91% of relative activity at 30.degree. C.
[0076] Based on the above results, it was confirmed that the conversion of fructose 6-phosphate into tagatose 6-phosphate at optimum temperature and pH according to time zone could reach from 70% to 80%, and the results are illustrated in figures. However, regarding the above reaction, any reaction in any range according to the desired yield or reaction conditions may be applied without defining particular pH or temperature.
EXAMPLE 5
Activity of Conversion from Fructose to fructose 6-phosphate by Hexokinase
[0077] For the production of tagatose at high concentration, as the first step, to produce fructose 6-phosphate by reacting fructose at a concentration of from 5 mM to 50 mM with an equal amount of adenosine triphosphate (ATP) and hexokinase derived from Saccharomyces cerevisiae, reacted with 250 U/mL of the enzyme included in a 50 mM Tris buffer solution (pH 7.5) at 30.degree. C. for 60 minutes. Then, the enzyme activity was measured. The amount of fructose 6-phosphate production according to enzyme concentration is illustrated in FIG. 18. As a result, fructose 6-phosphate at a concentration of from 5 mM to 50 mM was produced, and this corresponds to 90% or higher of conversion.
[0078] The hexokinase used in this Example was lyophilized powder, H4502 Type F-300 purchased from Sigma Aldrich (130 U/mg protein (biuret), Sigma) and the phytase was Genophos 10000G purchased from Genofocus, Inc.
EXAMPLE 6
Large-Scale Production of fructose 1,6-bisphosphate aldolased Enzyme
[0079] Fructose 1,6-diphosphate aldolase gene was obtained in a large-scale by performing PCR amplification after designing primers based on the nucleotide sequence of DNA of Escherichia coli strain K-12 substrain MG1655, inserting the PCR product into an RSF Duet-1 vector [Novagen] using restriction enzymes, Sal I and Not I to construct a recombinant vector, RSF Duet-1/fructose 1,6-diphosphate aldolase (FIG. 17), followed by transforming the recombinant vector into E. coli BL21(DE3) by a conventional transformation method. Additionally, the recombinant E. coli strain was stored in liquid nitrogen prior to cultivation for a large-scale production.
[0080] For a large-scale production of fructose 1,6-diphosphate aldolase, the frozen-stored BL21(DE3) strain was inoculated into a 250 mL flask including 50 mL of LB and seed-cultured in a shaking water bath maintained at 37.degree. C. until the absorbance at 600 nm reached 2.0, and the seed-cultured culture broth was subjected to a main cultivation by adding it into a 7 L fermentor (Biotron, Korea) including a 5L of a fermentation medium (10 g/L of glycerol, 1 g/L of peptone, 30 g/L of yeast extract, 0.14 g/L potassium diphosphate, and 1 g/L of monosodium phosphate). In particular, the large-scale production of fructose 1,6-diphosphate aldolase was induced by adding 1 mM ITPG when the absorbance at 600 nm reached 2.0. Specifically, the stirring speed at 500 rpm, aeration of 1.0 vvm, and the culture temperature at 37.degree. C. were maintained during the above process.
EXAMPLE 7
Production of Tagatose from tagatose 6-phosphate using Phytase
[0081] For the production of tagatose at high concentration, 10 mM tagatose 6-phosphate converted from fructose 6-phosphate was reacted with 10 to 50 U/mL of phytase in a 50 mM pH 7.5 Trizma buffer solution (pH 5.5) at 60.degree. C. for 60 minutes. Then, the enzyme activity was measured. The amount of tagatose production according to enzyme concentration is listed in FIG. 23.
[0082] As a result, 9 mM of tagatose was produced for 50 U/mL of cultivation time, and this corresponds to 90% of conversion yield.
Example 8
Production of Tagatose from Fructose by a Cocktail Reaction of Hexokinase, Aldolase, and Phytase
[0083] Tagatose was produced from fructose by a cocktail reaction of hexokinase, aldolase, and phytase based on the Examples above. Fructose 6-phosphate was produced by reacting 5 mM fructose with an equal amount of adenosine triphosphate (ATP) and 250 U/mL of hexokinase derived from Saccharomyces cerevisiae in a 50 mM Trizma buffer solution (pH 7.5) at 30.degree. C. for 60 minutes, and as a result, 100% of the 5 mM fructose was converted into 5 mM fructose 6-phosphate. As a serial reaction, when a 50 mM Trizma base buffer solution including 0.5 U/mL of fructose 1,6-bisphosphate aldolase was reacted at pH 8.5 for 30 minutes, 93% of the 5 mM fructose 6-phosphate was converted into 4.65 mM tagatose 6-phosphate. Then, when the reaction was performed in a 50 mM Trizma base buffer solution (pH 5.5) including 50 U/mL of the enzyme at 60.degree. C. for 60 minutes, 100% of the 4.65 mM tagatose 6-phosphate was converted into 4.65 mM tagatose. Conclusively, as a result of the cocktail reaction of hexokinase, aldolase, and phytase using 5 mM fructose, 93% was successfully converted into 4.65 mM tagatose.
EXAMPLE 9
Change in Activity of Gene Mutant Enzyme According to Amino Acid Substitution of Aldolase
[0084] For the production of tagatose at high concentration of the present invention, in order to increase the activity of aldolase, an amino acid substitution was caused by manipulating basic gene sequence and the change in activity of the enzyme was observed. As a result, a gene mutant enzyme, which can exhibit a fast conversion effect through a faster initial reaction speed, was successfully constructed. The gene sequences encoding the amino acids to be mutated were mutated with site directed mutation and thereby a gene mutant enzyme was constructed. Site directed mutation was performed using the Muta-Direct.TM. Site Directed Mutagenesis Kit, and primers, in which the genes encoding 332R, 314Q, 227H, and 62S, i.e., the amino acids to be mutated, were substituted to encode glutamic acid or alanine (see sequences in Table 1), were constructed to amplify a recombinant plasmid, which was sequenced after transformation, and the strains having substituted mutant enzymes were selected via screening. The selected gene mutant enzymes were subjected to purification in the same manner as in wild-type strain according to Example 2, and reacted in a 50 mM Trizma base buffer solution (pH 8.5) including 1.0% fructose 6-phosphate and 0.04 U/mL of the enzyme for 10 minutes, for comparison of activities. In particular, the reaction was stopped by adding 0.2 M HCl, the amount of the converted tagatose 6-phosphate and the fructose 6-phosphate was analyzed, the enzyme activity was measured by converting the activity of the wild-type enzyme into relative activity 100%, and the results are illustrated in FIG. 24. As a result, the R332Q mutant showed an increase of about 140%, the Q314A showed an increase of about 250%, the H227A mutant showed an increase of about 230%, and the S62A mutant showed an increase of about 150%, relative to that of the wild-type enzyme, respectively.
TABLE-US-00001 TABLE 1 Name Nucleotide sequence 5 to 3' S62A GGTTATCGTTCAGTTCGCCAACGGTGGTGCTTC (SEQ ID NO: 7) S62A anti GAAGCACCACCGTTGGCGAACTGAACGATAACC (SEQ ID NO: 8) H227A GCGTCCTTCGGTAACGTAGCCGGTGTTTACAAG (SEQ ID NO: 9) H227A anti CTTGTAAACACCGGCTACGTTACCGAAGGACGC (SEQ ID NO: 10) Q314A CTTATCTGCAGGGTGCGCTGGGTAACC (SEQ ID NO: 11) Q314A anti GGTTACCCAGCGCACCCTGCAGATAAG (SEQ ID NO: 12) R331Q TACGATCCGCAGGTATGGCTGCGTGCCG (SEQ ID NO: 13) R331Q anti CGGCACGCAGCCATACCTGCGGATCGTA (SEQ ID NO: 14)
[0085] Table 1 lists information on primers used in constructing mutants of fructose 1,6-bisphosphate aldolase.
TABLE-US-00002 TABLE 2 Escherichia coli Sal I GTCGACTCTAAGATTTTTGATTTCGTAAAACC (SEQ (strain K12) ID NO: 15) Not I GCGGCCGCTTACAGAACGTCGATCGCGTT (SEQ ID NO: 16) Streptococcus Sal I GTCGAC GCAATCGTTTCAGCAGAAAAATTTG (SEQ thermophilus ID NO: 17) Not I GCGGCCGC TTAAGCTTTGTTTGCTGAACC (SEQ ID NO: 18) Caldicellulosiruptor Sal I GTCGAC CCACTTGTAACAACCAAAGAG (SEQ ID saccharolyticus NO: 19) Not I GCGGCCGCTTAGCCTCTGTTCTTCTTAATCTC (SEQ ID NO: 20) Kluyveromyces Sal I GTCGAC CCAGCTCAAGACGTATTGACCAG (SEQ ID lactis NO: 21) No tI GCGGCCGC TTATTCCAAAGCACCCTTAGTAC (SEQ ID NO: 22)
[0086] Table 2 lists information on primers used in the present invention for each of fructose 1,6-diphosphate aldolase gene.
Sequence CWU
1
SEQUENCE LISTING
<160> NUMBER OF SEQ ID NOS: 22
<210> SEQ ID NO 1
<211> LENGTH: 359
<212> TYPE: PRT
<213> ORGANISM: Escherichia coli (strain K12)
<400> SEQUENCE: 1
Met Ser Lys Ile Phe Asp Phe Val Lys Pro Gly Val Ile Thr Gly Asp
1 5 10 15
Asp Val Gln Lys Val Phe Gln Val Ala Lys Glu Asn Asn Phe Ala Leu
20 25 30
Pro Ala Val Asn Cys Val Gly Thr Asp Ser Ile Asn Ala Val Leu Glu
35 40 45
Thr Ala Ala Lys Val Lys Ala Pro Val Ile Val Gln Phe Ser Asn Gly
50 55 60
Gly Ala Ser Phe Ile Ala Gly Lys Gly Val Lys Ser Asp Val Pro Gln
65 70 75 80
Gly Ala Ala Ile Leu Gly Ala Ile Ser Gly Ala His His Val His Gln
85 90 95
Met Ala Glu His Tyr Gly Val Pro Val Ile Leu His Thr Asp His Cys
100 105 110
Ala Lys Lys Leu Leu Pro Trp Ile Asp Gly Leu Leu Asp Ala Gly Glu
115 120 125
Lys His Phe Ala Ala Thr Gly Lys Pro Leu Phe Ser Ser His Met Ile
130 135 140
Asp Leu Ser Glu Glu Ser Leu Gln Glu Asn Ile Glu Ile Cys Ser Lys
145 150 155 160
Tyr Leu Glu Arg Met Ser Lys Ile Gly Met Thr Leu Glu Ile Glu Leu
165 170 175
Gly Cys Thr Gly Gly Glu Glu Asp Gly Val Asp Asn Ser His Met Asp
180 185 190
Ala Ser Ala Leu Tyr Thr Gln Pro Glu Asp Val Asp Tyr Ala Tyr Thr
195 200 205
Glu Leu Ser Lys Ile Ser Pro Arg Phe Thr Ile Ala Ala Ser Phe Gly
210 215 220
Asn Val His Gly Val Tyr Lys Pro Gly Asn Val Val Leu Thr Pro Thr
225 230 235 240
Ile Leu Arg Asp Ser Gln Glu Tyr Val Ser Lys Lys His Asn Leu Pro
245 250 255
His Asn Ser Leu Asn Phe Val Phe His Gly Gly Ser Gly Ser Thr Ala
260 265 270
Gln Glu Ile Lys Asp Ser Val Ser Tyr Gly Val Val Lys Met Asn Ile
275 280 285
Asp Thr Asp Thr Gln Trp Ala Thr Trp Glu Gly Val Leu Asn Tyr Tyr
290 295 300
Lys Ala Asn Glu Ala Tyr Leu Gln Gly Gln Leu Gly Asn Pro Lys Gly
305 310 315 320
Glu Asp Gln Pro Asn Lys Lys Tyr Tyr Asp Pro Arg Val Trp Leu Arg
325 330 335
Ala Gly Gln Thr Ser Met Ile Ala Arg Leu Glu Lys Ala Phe Gln Glu
340 345 350
Leu Asn Ala Ile Asp Val Leu
355
<210> SEQ ID NO 2
<211> LENGTH: 293
<212> TYPE: PRT
<213> ORGANISM: Streptococcus thermophilus
<400> SEQUENCE: 2
Met Ala Ile Val Ser Ala Glu Lys Phe Val Gln Ser Ala Arg Asp Asn
1 5 10 15
Gly Tyr Ala Leu Gly Gly Phe Asn Thr Asn Asn Leu Glu Trp Thr Gln
20 25 30
Ala Ile Leu Arg Ala Ala Glu Ala Lys Lys Ala Pro Val Leu Ile Gln
35 40 45
Thr Ser Met Gly Ala Ala Lys Tyr Met Gly Gly Tyr Lys Leu Cys Lys
50 55 60
Ala Leu Ile Glu Glu Leu Val Glu Ser Met Gly Ile Thr Val Pro Val
65 70 75 80
Ala Ile His Leu Asp His Gly His Tyr Asp Asp Ala Leu Glu Cys Ile
85 90 95
Glu Val Gly Tyr Thr Ser Ile Met Phe Asp Gly Ser His Leu Pro Ile
100 105 110
Glu Glu Asn Leu Lys Leu Ala Lys Glu Val Val Glu Lys Ala His Ala
115 120 125
Lys Gly Ile Ser Val Glu Ala Glu Val Gly Thr Ile Gly Gly Glu Glu
130 135 140
Asp Gly Ile Val Gly Arg Gly Glu Leu Ala Pro Ile Glu Asp Ala Lys
145 150 155 160
Ala Met Val Ala Thr Gly Val Asp Phe Leu Ala Ala Gly Ile Gly Asn
165 170 175
Ile His Gly Pro Tyr Pro Glu Asn Trp Glu Gly Leu Asp Leu Asp His
180 185 190
Leu Gln Lys Leu Thr Glu Ala Ile Pro Gly Phe Pro Ile Val Leu His
195 200 205
Gly Gly Ser Gly Ile Pro Asp Asp Gln Ile Gln Glu Ala Ile Lys Leu
210 215 220
Gly Val Ala Lys Val Asn Val Asn Thr Glu Cys Gln Ile Ala Phe Ala
225 230 235 240
Asn Ala Thr Arg Lys Phe Val Ala Glu Tyr Glu Ala Asn Glu Ala Glu
245 250 255
Tyr Asp Lys Lys Lys Leu Phe Asp Pro Arg Lys Phe Leu Lys Pro Gly
260 265 270
Phe Glu Ala Ile Thr Glu Ala Val Glu Glu Arg Ile Asp Val Phe Gly
275 280 285
Ser Ala Asn Lys Ala
290
<210> SEQ ID NO 3
<211> LENGTH: 323
<212> TYPE: PRT
<213> ORGANISM: Caldicellulosiruptor saccharolyticus (strain ATCC
43494/DSM 8903)
<400> SEQUENCE: 3
Met Pro Leu Val Thr Thr Lys Glu Met Phe Lys Lys Ala Ala Glu Gly
1 5 10 15
Lys Tyr Ala Ile Gly Ala Phe Asn Val Asn Asn Met Glu Ile Ile Gln
20 25 30
Gly Ile Val Glu Ala Ala Lys Glu Glu Gln Ala Pro Leu Ile Leu Gln
35 40 45
Val Ser Ala Gly Ala Arg Lys Tyr Ala Lys His Val Tyr Leu Val Lys
50 55 60
Leu Val Glu Ala Ala Leu Glu Asp Ser Gly Asp Leu Pro Ile Ala Leu
65 70 75 80
His Leu Asp His Gly Glu Asp Phe Glu Ile Cys Lys Ala Cys Ile Asp
85 90 95
Gly Gly Phe Thr Ser Val Met Ile Asp Gly Ser Arg Leu Pro Phe Glu
100 105 110
Glu Asn Ile Ala Leu Thr Lys Lys Val Val Glu Tyr Ala His Glu Arg
115 120 125
Gly Val Val Val Glu Ala Glu Leu Gly Lys Leu Ala Gly Ile Glu Asp
130 135 140
Asn Val Lys Val Ala Glu His Glu Ala Ala Phe Thr Asp Pro Asp Gln
145 150 155 160
Ala Ala Glu Phe Val Glu Arg Thr Gly Val Asp Ser Leu Ala Val Ala
165 170 175
Ile Gly Thr Ser His Gly Ala Tyr Lys Phe Lys Gly Glu Pro Arg Leu
180 185 190
Asp Phe Glu Arg Leu Gln Arg Ile Val Glu Lys Leu Pro Lys Gly Phe
195 200 205
Pro Ile Val Leu His Gly Ala Ser Ser Val Leu Pro Glu Phe Val Glu
210 215 220
Met Cys Asn Lys Tyr Gly Gly Asn Ile Pro Gly Ala Lys Gly Val Pro
225 230 235 240
Glu Asp Met Leu Arg Lys Ala Ala Glu Leu Gly Val Arg Lys Ile Asn
245 250 255
Ile Asp Thr Asp Leu Arg Leu Ala Met Thr Ala Ala Ile Arg Lys His
260 265 270
Leu Ala Glu His Pro Asp His Phe Asp Pro Arg Gln Tyr Leu Lys Asp
275 280 285
Gly Arg Glu Ala Ile Lys Glu Met Val Lys His Lys Leu Arg Asn Val
290 295 300
Leu Gly Cys Ser Gly Lys Ala Pro Glu Ile Leu Glu Glu Ile Lys Lys
305 310 315 320
Asn Arg Gly
<210> SEQ ID NO 4
<211> LENGTH: 361
<212> TYPE: PRT
<213> ORGANISM: Kluyveromyces lactis NRRL Y-1140
<400> SEQUENCE: 4
Met Pro Ala Gln Asp Val Leu Thr Arg Lys Thr Gly Val Ile Val Gly
1 5 10 15
Asp Asp Val Lys Ala Leu Phe Asp Tyr Ala Lys Glu His Lys Phe Ala
20 25 30
Ile Pro Ala Ile Asn Val Thr Ser Ser Ser Thr Val Val Ala Ala Leu
35 40 45
Glu Ala Ala Arg Asp Asn Lys Ser Pro Ile Ile Leu Gln Thr Ser Asn
50 55 60
Gly Gly Ala Ala Tyr Phe Ala Gly Lys Gly Val Ser Asn Glu Gly Gln
65 70 75 80
Asn Ala Ser Ile Arg Gly Ser Ile Ala Ala Ala His Tyr Ile Arg Ser
85 90 95
Ile Ala Pro Ala Tyr Gly Ile Pro Val Val Leu His Thr Asp His Cys
100 105 110
Ala Lys Lys Leu Leu Pro Trp Phe Asp Gly Met Leu Lys Ala Asp Glu
115 120 125
Glu Tyr Phe Ala Lys His Gly Glu Pro Leu Phe Ser Ser His Met Leu
130 135 140
Asp Leu Ser Glu Glu Thr Asp Glu Glu Asn Ile Gly Leu Cys Val Lys
145 150 155 160
Tyr Phe Thr Arg Met Ala Lys Ile His Gln Trp Leu Glu Met Glu Ile
165 170 175
Gly Ile Thr Gly Gly Glu Glu Asp Gly Val Asn Asn Glu Gly Thr Ser
180 185 190
Asn Asp Lys Leu Tyr Thr Thr Pro Glu Thr Val Phe Ser Val His Glu
195 200 205
Ala Leu Ser Lys Ile Ser Pro Asn Phe Ser Ile Ala Ser Ala Phe Gly
210 215 220
Asn Val His Gly Val Tyr Lys Ile Ala Ala Ala Leu Lys Pro Glu Leu
225 230 235 240
Leu Gly Thr Phe Gln Asp Tyr Ala Ala Lys Gln Leu Asn Lys Lys Ala
245 250 255
Glu Asp Lys Pro Leu Tyr Leu Val Phe His Gly Gly Ser Gly Ser Ser
260 265 270
Thr Lys Asp Phe His Thr Ala Ile Asp Phe Gly Val Val Lys Val Asn
275 280 285
Leu Asp Thr Asp Cys Gln Phe Ala Tyr Leu Ser Gly Ile Arg Asp Tyr
290 295 300
Val Leu Asn Lys Lys Asp Tyr Leu Met Thr Pro Val Gly Asn Pro Thr
305 310 315 320
Gly Glu Asp Ser Pro Asn Lys Lys Tyr Tyr Asp Pro Arg Val Trp Val
325 330 335
Arg Glu Gly Glu Lys Thr Met Ser Lys Arg Ile Thr Gln Ala Leu Glu
340 345 350
Ile Phe Arg Thr Lys Gly Ala Leu Glu
355 360
<210> SEQ ID NO 5
<211> LENGTH: 485
<212> TYPE: PRT
<213> ORGANISM: Saccharomyces cerevisiae (strain ATCC 204508/S288c)
<400> SEQUENCE: 5
Met Val His Leu Gly Pro Lys Lys Pro Gln Ala Arg Lys Gly Ser Met
1 5 10 15
Ala Asp Val Pro Lys Glu Leu Met Asp Glu Ile His Gln Leu Glu Asp
20 25 30
Met Phe Thr Val Asp Ser Glu Thr Leu Arg Lys Val Val Lys His Phe
35 40 45
Ile Asp Glu Leu Asn Lys Gly Leu Thr Lys Lys Gly Gly Asn Ile Pro
50 55 60
Met Ile Pro Gly Trp Val Met Glu Phe Pro Thr Gly Lys Glu Ser Gly
65 70 75 80
Asn Tyr Leu Ala Ile Asp Leu Gly Gly Thr Asn Leu Arg Val Val Leu
85 90 95
Val Lys Leu Ser Gly Asn His Thr Phe Asp Thr Thr Gln Ser Lys Tyr
100 105 110
Lys Leu Pro His Asp Met Arg Thr Thr Lys His Gln Glu Glu Leu Trp
115 120 125
Ser Phe Ile Ala Asp Ser Leu Lys Asp Phe Met Val Glu Gln Glu Leu
130 135 140
Leu Asn Thr Lys Asp Thr Leu Pro Leu Gly Phe Thr Phe Ser Tyr Pro
145 150 155 160
Ala Ser Gln Asn Lys Ile Asn Glu Gly Ile Leu Gln Arg Trp Thr Lys
165 170 175
Gly Phe Asp Ile Pro Asn Val Glu Gly His Asp Val Val Pro Leu Leu
180 185 190
Gln Asn Glu Ile Ser Lys Arg Glu Leu Pro Ile Glu Ile Val Ala Leu
195 200 205
Ile Asn Asp Thr Val Gly Thr Leu Ile Ala Ser Tyr Tyr Thr Asp Pro
210 215 220
Glu Thr Lys Met Gly Val Ile Phe Gly Thr Gly Val Asn Gly Ala Phe
225 230 235 240
Tyr Asp Val Val Ser Asp Ile Glu Lys Leu Glu Gly Lys Leu Ala Asp
245 250 255
Asp Ile Pro Ser Asn Ser Pro Met Ala Ile Asn Cys Glu Tyr Gly Ser
260 265 270
Phe Asp Asn Glu His Leu Val Leu Pro Arg Thr Lys Tyr Asp Val Ala
275 280 285
Val Asp Glu Gln Ser Pro Arg Pro Gly Gln Gln Ala Phe Glu Lys Met
290 295 300
Thr Ser Gly Tyr Tyr Leu Gly Glu Leu Leu Arg Leu Val Leu Leu Glu
305 310 315 320
Leu Asn Glu Lys Gly Leu Met Leu Lys Asp Gln Asp Leu Ser Lys Leu
325 330 335
Lys Gln Pro Tyr Ile Met Asp Thr Ser Tyr Pro Ala Arg Ile Glu Asp
340 345 350
Asp Pro Phe Glu Asn Leu Glu Asp Thr Asp Asp Ile Phe Gln Lys Asp
355 360 365
Phe Gly Val Lys Thr Thr Leu Pro Glu Arg Lys Leu Ile Arg Arg Leu
370 375 380
Cys Glu Leu Ile Gly Thr Arg Ala Ala Arg Leu Ala Val Cys Gly Ile
385 390 395 400
Ala Ala Ile Cys Gln Lys Arg Gly Tyr Lys Thr Gly His Ile Ala Ala
405 410 415
Asp Gly Ser Val Tyr Asn Lys Tyr Pro Gly Phe Lys Glu Ala Ala Ala
420 425 430
Lys Gly Leu Arg Asp Ile Tyr Gly Trp Thr Gly Asp Ala Ser Lys Asp
435 440 445
Pro Ile Thr Ile Val Pro Ala Glu Asp Gly Ser Gly Ala Gly Ala Ala
450 455 460
Val Ile Ala Ala Leu Ser Glu Lys Arg Ile Ala Glu Gly Lys Ser Leu
465 470 475 480
Gly Ile Ile Gly Ala
485
<210> SEQ ID NO 6
<211> LENGTH: 486
<212> TYPE: PRT
<213> ORGANISM: Saccharomyces cerevisiae (strain ATCC 204508/S288c)
<400> SEQUENCE: 6
Met Val His Leu Gly Pro Lys Lys Pro Gln Ala Arg Lys Gly Ser Met
1 5 10 15
Ala Asp Val Pro Lys Glu Leu Met Gln Gln Ile Glu Asn Phe Glu Lys
20 25 30
Ile Phe Thr Val Pro Thr Glu Thr Leu Gln Ala Val Thr Lys His Phe
35 40 45
Ile Ser Glu Leu Glu Lys Gly Leu Ser Lys Lys Gly Gly Asn Ile Pro
50 55 60
Met Ile Pro Gly Trp Val Met Asp Phe Pro Thr Gly Lys Glu Ser Gly
65 70 75 80
Asp Phe Leu Ala Ile Asp Leu Gly Gly Thr Asn Leu Arg Val Val Leu
85 90 95
Val Lys Leu Gly Gly Asp Arg Thr Phe Asp Thr Thr Gln Ser Lys Tyr
100 105 110
Arg Leu Pro Asp Ala Met Arg Thr Thr Gln Asn Pro Asp Glu Leu Trp
115 120 125
Glu Phe Ile Ala Asp Ser Leu Lys Ala Phe Ile Asp Glu Gln Phe Pro
130 135 140
Gln Gly Ile Ser Glu Pro Ile Pro Leu Gly Phe Thr Phe Ser Phe Pro
145 150 155 160
Ala Ser Gln Asn Lys Ile Asn Glu Gly Ile Leu Gln Arg Trp Thr Lys
165 170 175
Gly Phe Asp Ile Pro Asn Ile Glu Asn His Asp Val Val Pro Met Leu
180 185 190
Gln Lys Gln Ile Thr Lys Arg Asn Ile Pro Ile Glu Val Val Ala Leu
195 200 205
Ile Asn Asp Thr Thr Gly Thr Leu Val Ala Ser Tyr Tyr Thr Asp Pro
210 215 220
Glu Thr Lys Met Gly Val Ile Phe Gly Thr Gly Val Asn Gly Ala Tyr
225 230 235 240
Tyr Asp Val Cys Ser Asp Ile Glu Lys Leu Gln Gly Lys Leu Ser Asp
245 250 255
Asp Ile Pro Pro Ser Ala Pro Met Ala Ile Asn Cys Glu Tyr Gly Ser
260 265 270
Phe Asp Asn Glu His Val Val Leu Pro Arg Thr Lys Tyr Asp Ile Thr
275 280 285
Ile Asp Glu Glu Ser Pro Arg Pro Gly Gln Gln Thr Phe Glu Lys Met
290 295 300
Ser Ser Gly Tyr Tyr Leu Gly Glu Ile Leu Arg Leu Ala Leu Met Asp
305 310 315 320
Met Tyr Lys Gln Gly Phe Ile Phe Lys Asn Gln Asp Leu Ser Lys Phe
325 330 335
Asp Lys Pro Phe Val Met Asp Thr Ser Tyr Pro Ala Arg Ile Glu Glu
340 345 350
Asp Pro Phe Glu Asn Leu Glu Asp Thr Asp Asp Leu Phe Gln Asn Glu
355 360 365
Phe Gly Ile Asn Thr Thr Val Gln Glu Arg Lys Leu Ile Arg Arg Leu
370 375 380
Ser Glu Leu Ile Gly Ala Arg Ala Ala Arg Leu Ser Val Cys Gly Ile
385 390 395 400
Ala Ala Ile Cys Gln Lys Arg Gly Tyr Lys Thr Gly His Ile Ala Ala
405 410 415
Asp Gly Ser Val Tyr Asn Arg Tyr Pro Gly Phe Lys Glu Lys Ala Ala
420 425 430
Asn Ala Leu Lys Asp Ile Tyr Gly Trp Thr Gln Thr Ser Leu Asp Asp
435 440 445
Tyr Pro Ile Lys Ile Val Pro Ala Glu Asp Gly Ser Gly Ala Gly Ala
450 455 460
Ala Val Ile Ala Ala Leu Ala Gln Lys Arg Ile Ala Glu Gly Lys Ser
465 470 475 480
Val Gly Ile Ile Gly Ala
485
<210> SEQ ID NO 7
<211> LENGTH: 33
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Primer
<400> SEQUENCE: 7
ggttatcgtt cagttcgcca acggtggtgc ttc 33
<210> SEQ ID NO 8
<211> LENGTH: 33
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Primer
<400> SEQUENCE: 8
gaagcaccac cgttggcgaa ctgaacgata acc 33
<210> SEQ ID NO 9
<211> LENGTH: 33
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Primer
<400> SEQUENCE: 9
gcgtccttcg gtaacgtagc cggtgtttac aag 33
<210> SEQ ID NO 10
<211> LENGTH: 33
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Primer
<400> SEQUENCE: 10
cttgtaaaca ccggctacgt taccgaagga cgc 33
<210> SEQ ID NO 11
<211> LENGTH: 27
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Primer
<400> SEQUENCE: 11
cttatctgca gggtgcgctg ggtaacc 27
<210> SEQ ID NO 12
<211> LENGTH: 27
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Primer
<400> SEQUENCE: 12
ggttacccag cgcaccctgc agataag 27
<210> SEQ ID NO 13
<211> LENGTH: 28
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Primer
<400> SEQUENCE: 13
tacgatccgc aggtatggct gcgtgccg 28
<210> SEQ ID NO 14
<211> LENGTH: 28
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Primer
<400> SEQUENCE: 14
cggcacgcag ccatacctgc ggatcgta 28
<210> SEQ ID NO 15
<211> LENGTH: 32
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Primer
<400> SEQUENCE: 15
gtcgactcta agatttttga tttcgtaaaa cc 32
<210> SEQ ID NO 16
<211> LENGTH: 29
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Primer
<400> SEQUENCE: 16
gcggccgctt acagaacgtc gatcgcgtt 29
<210> SEQ ID NO 17
<211> LENGTH: 31
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Primer
<400> SEQUENCE: 17
gtcgacgcaa tcgtttcagc agaaaaattt g 31
<210> SEQ ID NO 18
<211> LENGTH: 29
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Primer
<400> SEQUENCE: 18
gcggccgctt aagctttgtt tgctgaacc 29
<210> SEQ ID NO 19
<211> LENGTH: 27
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Primer
<400> SEQUENCE: 19
gtcgacccac ttgtaacaac caaagag 27
<210> SEQ ID NO 20
<211> LENGTH: 32
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Primer
<400> SEQUENCE: 20
gcggccgctt agcctctgtt cttcttaatc tc 32
<210> SEQ ID NO 21
<211> LENGTH: 29
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Primer
<400> SEQUENCE: 21
gtcgacccag ctcaagacgt attgaccag 29
<210> SEQ ID NO 22
<211> LENGTH: 31
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Primer
<400> SEQUENCE: 22
gcggccgctt attccaaagc acccttagta c 31
1
SEQUENCE LISTING
<160> NUMBER OF SEQ ID NOS: 22
<210> SEQ ID NO 1
<211> LENGTH: 359
<212> TYPE: PRT
<213> ORGANISM: Escherichia coli (strain K12)
<400> SEQUENCE: 1
Met Ser Lys Ile Phe Asp Phe Val Lys Pro Gly Val Ile Thr Gly Asp
1 5 10 15
Asp Val Gln Lys Val Phe Gln Val Ala Lys Glu Asn Asn Phe Ala Leu
20 25 30
Pro Ala Val Asn Cys Val Gly Thr Asp Ser Ile Asn Ala Val Leu Glu
35 40 45
Thr Ala Ala Lys Val Lys Ala Pro Val Ile Val Gln Phe Ser Asn Gly
50 55 60
Gly Ala Ser Phe Ile Ala Gly Lys Gly Val Lys Ser Asp Val Pro Gln
65 70 75 80
Gly Ala Ala Ile Leu Gly Ala Ile Ser Gly Ala His His Val His Gln
85 90 95
Met Ala Glu His Tyr Gly Val Pro Val Ile Leu His Thr Asp His Cys
100 105 110
Ala Lys Lys Leu Leu Pro Trp Ile Asp Gly Leu Leu Asp Ala Gly Glu
115 120 125
Lys His Phe Ala Ala Thr Gly Lys Pro Leu Phe Ser Ser His Met Ile
130 135 140
Asp Leu Ser Glu Glu Ser Leu Gln Glu Asn Ile Glu Ile Cys Ser Lys
145 150 155 160
Tyr Leu Glu Arg Met Ser Lys Ile Gly Met Thr Leu Glu Ile Glu Leu
165 170 175
Gly Cys Thr Gly Gly Glu Glu Asp Gly Val Asp Asn Ser His Met Asp
180 185 190
Ala Ser Ala Leu Tyr Thr Gln Pro Glu Asp Val Asp Tyr Ala Tyr Thr
195 200 205
Glu Leu Ser Lys Ile Ser Pro Arg Phe Thr Ile Ala Ala Ser Phe Gly
210 215 220
Asn Val His Gly Val Tyr Lys Pro Gly Asn Val Val Leu Thr Pro Thr
225 230 235 240
Ile Leu Arg Asp Ser Gln Glu Tyr Val Ser Lys Lys His Asn Leu Pro
245 250 255
His Asn Ser Leu Asn Phe Val Phe His Gly Gly Ser Gly Ser Thr Ala
260 265 270
Gln Glu Ile Lys Asp Ser Val Ser Tyr Gly Val Val Lys Met Asn Ile
275 280 285
Asp Thr Asp Thr Gln Trp Ala Thr Trp Glu Gly Val Leu Asn Tyr Tyr
290 295 300
Lys Ala Asn Glu Ala Tyr Leu Gln Gly Gln Leu Gly Asn Pro Lys Gly
305 310 315 320
Glu Asp Gln Pro Asn Lys Lys Tyr Tyr Asp Pro Arg Val Trp Leu Arg
325 330 335
Ala Gly Gln Thr Ser Met Ile Ala Arg Leu Glu Lys Ala Phe Gln Glu
340 345 350
Leu Asn Ala Ile Asp Val Leu
355
<210> SEQ ID NO 2
<211> LENGTH: 293
<212> TYPE: PRT
<213> ORGANISM: Streptococcus thermophilus
<400> SEQUENCE: 2
Met Ala Ile Val Ser Ala Glu Lys Phe Val Gln Ser Ala Arg Asp Asn
1 5 10 15
Gly Tyr Ala Leu Gly Gly Phe Asn Thr Asn Asn Leu Glu Trp Thr Gln
20 25 30
Ala Ile Leu Arg Ala Ala Glu Ala Lys Lys Ala Pro Val Leu Ile Gln
35 40 45
Thr Ser Met Gly Ala Ala Lys Tyr Met Gly Gly Tyr Lys Leu Cys Lys
50 55 60
Ala Leu Ile Glu Glu Leu Val Glu Ser Met Gly Ile Thr Val Pro Val
65 70 75 80
Ala Ile His Leu Asp His Gly His Tyr Asp Asp Ala Leu Glu Cys Ile
85 90 95
Glu Val Gly Tyr Thr Ser Ile Met Phe Asp Gly Ser His Leu Pro Ile
100 105 110
Glu Glu Asn Leu Lys Leu Ala Lys Glu Val Val Glu Lys Ala His Ala
115 120 125
Lys Gly Ile Ser Val Glu Ala Glu Val Gly Thr Ile Gly Gly Glu Glu
130 135 140
Asp Gly Ile Val Gly Arg Gly Glu Leu Ala Pro Ile Glu Asp Ala Lys
145 150 155 160
Ala Met Val Ala Thr Gly Val Asp Phe Leu Ala Ala Gly Ile Gly Asn
165 170 175
Ile His Gly Pro Tyr Pro Glu Asn Trp Glu Gly Leu Asp Leu Asp His
180 185 190
Leu Gln Lys Leu Thr Glu Ala Ile Pro Gly Phe Pro Ile Val Leu His
195 200 205
Gly Gly Ser Gly Ile Pro Asp Asp Gln Ile Gln Glu Ala Ile Lys Leu
210 215 220
Gly Val Ala Lys Val Asn Val Asn Thr Glu Cys Gln Ile Ala Phe Ala
225 230 235 240
Asn Ala Thr Arg Lys Phe Val Ala Glu Tyr Glu Ala Asn Glu Ala Glu
245 250 255
Tyr Asp Lys Lys Lys Leu Phe Asp Pro Arg Lys Phe Leu Lys Pro Gly
260 265 270
Phe Glu Ala Ile Thr Glu Ala Val Glu Glu Arg Ile Asp Val Phe Gly
275 280 285
Ser Ala Asn Lys Ala
290
<210> SEQ ID NO 3
<211> LENGTH: 323
<212> TYPE: PRT
<213> ORGANISM: Caldicellulosiruptor saccharolyticus (strain ATCC
43494/DSM 8903)
<400> SEQUENCE: 3
Met Pro Leu Val Thr Thr Lys Glu Met Phe Lys Lys Ala Ala Glu Gly
1 5 10 15
Lys Tyr Ala Ile Gly Ala Phe Asn Val Asn Asn Met Glu Ile Ile Gln
20 25 30
Gly Ile Val Glu Ala Ala Lys Glu Glu Gln Ala Pro Leu Ile Leu Gln
35 40 45
Val Ser Ala Gly Ala Arg Lys Tyr Ala Lys His Val Tyr Leu Val Lys
50 55 60
Leu Val Glu Ala Ala Leu Glu Asp Ser Gly Asp Leu Pro Ile Ala Leu
65 70 75 80
His Leu Asp His Gly Glu Asp Phe Glu Ile Cys Lys Ala Cys Ile Asp
85 90 95
Gly Gly Phe Thr Ser Val Met Ile Asp Gly Ser Arg Leu Pro Phe Glu
100 105 110
Glu Asn Ile Ala Leu Thr Lys Lys Val Val Glu Tyr Ala His Glu Arg
115 120 125
Gly Val Val Val Glu Ala Glu Leu Gly Lys Leu Ala Gly Ile Glu Asp
130 135 140
Asn Val Lys Val Ala Glu His Glu Ala Ala Phe Thr Asp Pro Asp Gln
145 150 155 160
Ala Ala Glu Phe Val Glu Arg Thr Gly Val Asp Ser Leu Ala Val Ala
165 170 175
Ile Gly Thr Ser His Gly Ala Tyr Lys Phe Lys Gly Glu Pro Arg Leu
180 185 190
Asp Phe Glu Arg Leu Gln Arg Ile Val Glu Lys Leu Pro Lys Gly Phe
195 200 205
Pro Ile Val Leu His Gly Ala Ser Ser Val Leu Pro Glu Phe Val Glu
210 215 220
Met Cys Asn Lys Tyr Gly Gly Asn Ile Pro Gly Ala Lys Gly Val Pro
225 230 235 240
Glu Asp Met Leu Arg Lys Ala Ala Glu Leu Gly Val Arg Lys Ile Asn
245 250 255
Ile Asp Thr Asp Leu Arg Leu Ala Met Thr Ala Ala Ile Arg Lys His
260 265 270
Leu Ala Glu His Pro Asp His Phe Asp Pro Arg Gln Tyr Leu Lys Asp
275 280 285
Gly Arg Glu Ala Ile Lys Glu Met Val Lys His Lys Leu Arg Asn Val
290 295 300
Leu Gly Cys Ser Gly Lys Ala Pro Glu Ile Leu Glu Glu Ile Lys Lys
305 310 315 320
Asn Arg Gly
<210> SEQ ID NO 4
<211> LENGTH: 361
<212> TYPE: PRT
<213> ORGANISM: Kluyveromyces lactis NRRL Y-1140
<400> SEQUENCE: 4
Met Pro Ala Gln Asp Val Leu Thr Arg Lys Thr Gly Val Ile Val Gly
1 5 10 15
Asp Asp Val Lys Ala Leu Phe Asp Tyr Ala Lys Glu His Lys Phe Ala
20 25 30
Ile Pro Ala Ile Asn Val Thr Ser Ser Ser Thr Val Val Ala Ala Leu
35 40 45
Glu Ala Ala Arg Asp Asn Lys Ser Pro Ile Ile Leu Gln Thr Ser Asn
50 55 60
Gly Gly Ala Ala Tyr Phe Ala Gly Lys Gly Val Ser Asn Glu Gly Gln
65 70 75 80
Asn Ala Ser Ile Arg Gly Ser Ile Ala Ala Ala His Tyr Ile Arg Ser
85 90 95
Ile Ala Pro Ala Tyr Gly Ile Pro Val Val Leu His Thr Asp His Cys
100 105 110
Ala Lys Lys Leu Leu Pro Trp Phe Asp Gly Met Leu Lys Ala Asp Glu
115 120 125
Glu Tyr Phe Ala Lys His Gly Glu Pro Leu Phe Ser Ser His Met Leu
130 135 140
Asp Leu Ser Glu Glu Thr Asp Glu Glu Asn Ile Gly Leu Cys Val Lys
145 150 155 160
Tyr Phe Thr Arg Met Ala Lys Ile His Gln Trp Leu Glu Met Glu Ile
165 170 175
Gly Ile Thr Gly Gly Glu Glu Asp Gly Val Asn Asn Glu Gly Thr Ser
180 185 190
Asn Asp Lys Leu Tyr Thr Thr Pro Glu Thr Val Phe Ser Val His Glu
195 200 205
Ala Leu Ser Lys Ile Ser Pro Asn Phe Ser Ile Ala Ser Ala Phe Gly
210 215 220
Asn Val His Gly Val Tyr Lys Ile Ala Ala Ala Leu Lys Pro Glu Leu
225 230 235 240
Leu Gly Thr Phe Gln Asp Tyr Ala Ala Lys Gln Leu Asn Lys Lys Ala
245 250 255
Glu Asp Lys Pro Leu Tyr Leu Val Phe His Gly Gly Ser Gly Ser Ser
260 265 270
Thr Lys Asp Phe His Thr Ala Ile Asp Phe Gly Val Val Lys Val Asn
275 280 285
Leu Asp Thr Asp Cys Gln Phe Ala Tyr Leu Ser Gly Ile Arg Asp Tyr
290 295 300
Val Leu Asn Lys Lys Asp Tyr Leu Met Thr Pro Val Gly Asn Pro Thr
305 310 315 320
Gly Glu Asp Ser Pro Asn Lys Lys Tyr Tyr Asp Pro Arg Val Trp Val
325 330 335
Arg Glu Gly Glu Lys Thr Met Ser Lys Arg Ile Thr Gln Ala Leu Glu
340 345 350
Ile Phe Arg Thr Lys Gly Ala Leu Glu
355 360
<210> SEQ ID NO 5
<211> LENGTH: 485
<212> TYPE: PRT
<213> ORGANISM: Saccharomyces cerevisiae (strain ATCC 204508/S288c)
<400> SEQUENCE: 5
Met Val His Leu Gly Pro Lys Lys Pro Gln Ala Arg Lys Gly Ser Met
1 5 10 15
Ala Asp Val Pro Lys Glu Leu Met Asp Glu Ile His Gln Leu Glu Asp
20 25 30
Met Phe Thr Val Asp Ser Glu Thr Leu Arg Lys Val Val Lys His Phe
35 40 45
Ile Asp Glu Leu Asn Lys Gly Leu Thr Lys Lys Gly Gly Asn Ile Pro
50 55 60
Met Ile Pro Gly Trp Val Met Glu Phe Pro Thr Gly Lys Glu Ser Gly
65 70 75 80
Asn Tyr Leu Ala Ile Asp Leu Gly Gly Thr Asn Leu Arg Val Val Leu
85 90 95
Val Lys Leu Ser Gly Asn His Thr Phe Asp Thr Thr Gln Ser Lys Tyr
100 105 110
Lys Leu Pro His Asp Met Arg Thr Thr Lys His Gln Glu Glu Leu Trp
115 120 125
Ser Phe Ile Ala Asp Ser Leu Lys Asp Phe Met Val Glu Gln Glu Leu
130 135 140
Leu Asn Thr Lys Asp Thr Leu Pro Leu Gly Phe Thr Phe Ser Tyr Pro
145 150 155 160
Ala Ser Gln Asn Lys Ile Asn Glu Gly Ile Leu Gln Arg Trp Thr Lys
165 170 175
Gly Phe Asp Ile Pro Asn Val Glu Gly His Asp Val Val Pro Leu Leu
180 185 190
Gln Asn Glu Ile Ser Lys Arg Glu Leu Pro Ile Glu Ile Val Ala Leu
195 200 205
Ile Asn Asp Thr Val Gly Thr Leu Ile Ala Ser Tyr Tyr Thr Asp Pro
210 215 220
Glu Thr Lys Met Gly Val Ile Phe Gly Thr Gly Val Asn Gly Ala Phe
225 230 235 240
Tyr Asp Val Val Ser Asp Ile Glu Lys Leu Glu Gly Lys Leu Ala Asp
245 250 255
Asp Ile Pro Ser Asn Ser Pro Met Ala Ile Asn Cys Glu Tyr Gly Ser
260 265 270
Phe Asp Asn Glu His Leu Val Leu Pro Arg Thr Lys Tyr Asp Val Ala
275 280 285
Val Asp Glu Gln Ser Pro Arg Pro Gly Gln Gln Ala Phe Glu Lys Met
290 295 300
Thr Ser Gly Tyr Tyr Leu Gly Glu Leu Leu Arg Leu Val Leu Leu Glu
305 310 315 320
Leu Asn Glu Lys Gly Leu Met Leu Lys Asp Gln Asp Leu Ser Lys Leu
325 330 335
Lys Gln Pro Tyr Ile Met Asp Thr Ser Tyr Pro Ala Arg Ile Glu Asp
340 345 350
Asp Pro Phe Glu Asn Leu Glu Asp Thr Asp Asp Ile Phe Gln Lys Asp
355 360 365
Phe Gly Val Lys Thr Thr Leu Pro Glu Arg Lys Leu Ile Arg Arg Leu
370 375 380
Cys Glu Leu Ile Gly Thr Arg Ala Ala Arg Leu Ala Val Cys Gly Ile
385 390 395 400
Ala Ala Ile Cys Gln Lys Arg Gly Tyr Lys Thr Gly His Ile Ala Ala
405 410 415
Asp Gly Ser Val Tyr Asn Lys Tyr Pro Gly Phe Lys Glu Ala Ala Ala
420 425 430
Lys Gly Leu Arg Asp Ile Tyr Gly Trp Thr Gly Asp Ala Ser Lys Asp
435 440 445
Pro Ile Thr Ile Val Pro Ala Glu Asp Gly Ser Gly Ala Gly Ala Ala
450 455 460
Val Ile Ala Ala Leu Ser Glu Lys Arg Ile Ala Glu Gly Lys Ser Leu
465 470 475 480
Gly Ile Ile Gly Ala
485
<210> SEQ ID NO 6
<211> LENGTH: 486
<212> TYPE: PRT
<213> ORGANISM: Saccharomyces cerevisiae (strain ATCC 204508/S288c)
<400> SEQUENCE: 6
Met Val His Leu Gly Pro Lys Lys Pro Gln Ala Arg Lys Gly Ser Met
1 5 10 15
Ala Asp Val Pro Lys Glu Leu Met Gln Gln Ile Glu Asn Phe Glu Lys
20 25 30
Ile Phe Thr Val Pro Thr Glu Thr Leu Gln Ala Val Thr Lys His Phe
35 40 45
Ile Ser Glu Leu Glu Lys Gly Leu Ser Lys Lys Gly Gly Asn Ile Pro
50 55 60
Met Ile Pro Gly Trp Val Met Asp Phe Pro Thr Gly Lys Glu Ser Gly
65 70 75 80
Asp Phe Leu Ala Ile Asp Leu Gly Gly Thr Asn Leu Arg Val Val Leu
85 90 95
Val Lys Leu Gly Gly Asp Arg Thr Phe Asp Thr Thr Gln Ser Lys Tyr
100 105 110
Arg Leu Pro Asp Ala Met Arg Thr Thr Gln Asn Pro Asp Glu Leu Trp
115 120 125
Glu Phe Ile Ala Asp Ser Leu Lys Ala Phe Ile Asp Glu Gln Phe Pro
130 135 140
Gln Gly Ile Ser Glu Pro Ile Pro Leu Gly Phe Thr Phe Ser Phe Pro
145 150 155 160
Ala Ser Gln Asn Lys Ile Asn Glu Gly Ile Leu Gln Arg Trp Thr Lys
165 170 175
Gly Phe Asp Ile Pro Asn Ile Glu Asn His Asp Val Val Pro Met Leu
180 185 190
Gln Lys Gln Ile Thr Lys Arg Asn Ile Pro Ile Glu Val Val Ala Leu
195 200 205
Ile Asn Asp Thr Thr Gly Thr Leu Val Ala Ser Tyr Tyr Thr Asp Pro
210 215 220
Glu Thr Lys Met Gly Val Ile Phe Gly Thr Gly Val Asn Gly Ala Tyr
225 230 235 240
Tyr Asp Val Cys Ser Asp Ile Glu Lys Leu Gln Gly Lys Leu Ser Asp
245 250 255
Asp Ile Pro Pro Ser Ala Pro Met Ala Ile Asn Cys Glu Tyr Gly Ser
260 265 270
Phe Asp Asn Glu His Val Val Leu Pro Arg Thr Lys Tyr Asp Ile Thr
275 280 285
Ile Asp Glu Glu Ser Pro Arg Pro Gly Gln Gln Thr Phe Glu Lys Met
290 295 300
Ser Ser Gly Tyr Tyr Leu Gly Glu Ile Leu Arg Leu Ala Leu Met Asp
305 310 315 320
Met Tyr Lys Gln Gly Phe Ile Phe Lys Asn Gln Asp Leu Ser Lys Phe
325 330 335
Asp Lys Pro Phe Val Met Asp Thr Ser Tyr Pro Ala Arg Ile Glu Glu
340 345 350
Asp Pro Phe Glu Asn Leu Glu Asp Thr Asp Asp Leu Phe Gln Asn Glu
355 360 365
Phe Gly Ile Asn Thr Thr Val Gln Glu Arg Lys Leu Ile Arg Arg Leu
370 375 380
Ser Glu Leu Ile Gly Ala Arg Ala Ala Arg Leu Ser Val Cys Gly Ile
385 390 395 400
Ala Ala Ile Cys Gln Lys Arg Gly Tyr Lys Thr Gly His Ile Ala Ala
405 410 415
Asp Gly Ser Val Tyr Asn Arg Tyr Pro Gly Phe Lys Glu Lys Ala Ala
420 425 430
Asn Ala Leu Lys Asp Ile Tyr Gly Trp Thr Gln Thr Ser Leu Asp Asp
435 440 445
Tyr Pro Ile Lys Ile Val Pro Ala Glu Asp Gly Ser Gly Ala Gly Ala
450 455 460
Ala Val Ile Ala Ala Leu Ala Gln Lys Arg Ile Ala Glu Gly Lys Ser
465 470 475 480
Val Gly Ile Ile Gly Ala
485
<210> SEQ ID NO 7
<211> LENGTH: 33
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Primer
<400> SEQUENCE: 7
ggttatcgtt cagttcgcca acggtggtgc ttc 33
<210> SEQ ID NO 8
<211> LENGTH: 33
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Primer
<400> SEQUENCE: 8
gaagcaccac cgttggcgaa ctgaacgata acc 33
<210> SEQ ID NO 9
<211> LENGTH: 33
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Primer
<400> SEQUENCE: 9
gcgtccttcg gtaacgtagc cggtgtttac aag 33
<210> SEQ ID NO 10
<211> LENGTH: 33
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Primer
<400> SEQUENCE: 10
cttgtaaaca ccggctacgt taccgaagga cgc 33
<210> SEQ ID NO 11
<211> LENGTH: 27
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Primer
<400> SEQUENCE: 11
cttatctgca gggtgcgctg ggtaacc 27
<210> SEQ ID NO 12
<211> LENGTH: 27
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Primer
<400> SEQUENCE: 12
ggttacccag cgcaccctgc agataag 27
<210> SEQ ID NO 13
<211> LENGTH: 28
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Primer
<400> SEQUENCE: 13
tacgatccgc aggtatggct gcgtgccg 28
<210> SEQ ID NO 14
<211> LENGTH: 28
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Primer
<400> SEQUENCE: 14
cggcacgcag ccatacctgc ggatcgta 28
<210> SEQ ID NO 15
<211> LENGTH: 32
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Primer
<400> SEQUENCE: 15
gtcgactcta agatttttga tttcgtaaaa cc 32
<210> SEQ ID NO 16
<211> LENGTH: 29
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Primer
<400> SEQUENCE: 16
gcggccgctt acagaacgtc gatcgcgtt 29
<210> SEQ ID NO 17
<211> LENGTH: 31
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Primer
<400> SEQUENCE: 17
gtcgacgcaa tcgtttcagc agaaaaattt g 31
<210> SEQ ID NO 18
<211> LENGTH: 29
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Primer
<400> SEQUENCE: 18
gcggccgctt aagctttgtt tgctgaacc 29
<210> SEQ ID NO 19
<211> LENGTH: 27
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Primer
<400> SEQUENCE: 19
gtcgacccac ttgtaacaac caaagag 27
<210> SEQ ID NO 20
<211> LENGTH: 32
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Primer
<400> SEQUENCE: 20
gcggccgctt agcctctgtt cttcttaatc tc 32
<210> SEQ ID NO 21
<211> LENGTH: 29
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Primer
<400> SEQUENCE: 21
gtcgacccag ctcaagacgt attgaccag 29
<210> SEQ ID NO 22
<211> LENGTH: 31
<212> TYPE: DNA
<213> ORGANISM: Artificial Sequence
<220> FEATURE:
<223> OTHER INFORMATION: Primer
<400> SEQUENCE: 22
gcggccgctt attccaaagc acccttagta c 31
User Contributions:
Comment about this patent or add new information about this topic: