METHOD AND COMPOSITION FOR DIAGNOSIS OF AGGRESSIVE PROSTATE CANCER

Abstract

Techniques for diagnosis of aggressive prostate cancer include determining a level of expression of each of the genes encoding (FOXM1) Forkhead box protein M1 and Centromere protein F (CENPF) in a test sample. If the level of expression of each of the FOXM1 and CENPF genes in the test sample is at least 35% higher than the corresponding level in a control sample, then it is determined that the subject has an aggressive form of prostate cancer or has a high risk of prostate cancer progressing to an aggressive form. Alternatively, if at least 50% of prostate cancer cells in the sample express both FOXM1 protein and CENPF protein at a composite score of at least 100 for each, then the above diagnosis is made. Composite score is calculated by multiplying a percent staining value by a staining intensity value.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims benefit of Provisional Appln. 61/966,271, filed Feb. 19, 2014 under 35 U.S.C. .sctn.119(e).

BACKGROUND

[0003] Cancer is not a single entity but rather a highly individualized spectrum of diseases characterized by a number of genetic and genomic alterations (Hanahan and Weinberg, 2011). Distinguishing molecular alterations that constitute true drivers of cancer phenotypes from the multitude that are simply de-regulated has proven to be a daunting task, which is further exacerbated by the complexity of elucidating how such drivers interact synergistically to elicit cancer phenotypes. Prostate cancer is particularly challenging because its notorious heterogeneity, combined with a relative paucity of recurrent gene mutations, has made prostate cancer especially difficult to identify molecularly distinct subtypes with known clinical outcomes (Baca et al., 2013; Schoenborn et al., 2013; Shen and Abate-Shen, 2010). Additionally, while early-stage prostate tumors are readily treatable (Cooperberg et al., 2007), advanced prostate cancer frequently progresses to castration-resistant disease, which is often metastatic and nearly always fatal (Ryan and Tindall, 2011; Scher and Sawyers, 2005).

[0004] It should be noted that several factors, including an increase in the aging population and widespread screening for prostate specific antigen (PSA), have contributed to a substantial rise in diagnoses of prostate cancer. The primary means of determining the appropriate treatment course for men diagnosed with prostate cancer still relies on Gleason grading, a histopathological evaluation that lacks a precise molecular correlate. While patients with high Gleason score (Gleason .gtoreq.8) tumors are recommended to undergo immediate treatment, the appropriate treatment for those with low (Gleason 6) or intermediate (Gleason 7) Gleason score tumors remains more ambiguous. Indeed, although the majority of Gleason grade 6 tumors, as well as many Gleason grade 7 tumors, are likely to remain indolent (i.e., low-risk, non-aggressive or non-invasive), a minority (.about.10%) will progress to aggressive disease.

[0005] Indeed, the current lack of reliable and reproducible assays to identify tumors destined to remain indolent versus those that are aggressive, has resulted in substantial overtreatment of patients that would not die of the disease if left untreated. Consequently, "active surveillance" has emerged as an alternative for monitoring men with indolent prostate cancer, with the goal of avoiding treatment unless there is evidence of disease progression. The obvious advantage of active surveillance is that it avoids overtreatment; however, the potential concern is that it may miss the opportunity for early intervention for patients with aggressive tumors. Therefore, better methods with a molecular correlate for diagnosing aggressive prostate cancer have great value.

SUMMARY

[0006] Applicants have determined that there is a need to identify molecular determinants of cancers, including but not limited to, aggressive prostate cancer subtypes, a need to identify other prognostic biomarkers of disease outcome, and a need to treat such cancers. The subject matter disclosed herein addresses this need.

[0007] In a first set of embodiments, a method includes obtaining a test prostate cancer sample from a subject having prostate cancer and determining a level of expression of each of the genes encoding (FOXM1) Forkhead box protein M1 and Centromere protein F (CENPF) in the test sample and a control sample. The method also includes comparing the level of expression of each of the FOXM1 and CENPF genes in the test sample to the corresponding level in the control sample. The method further includes determining that the subject has an aggressive form of prostate cancer or has a high risk of prostate cancer progressing to an aggressive form, if the level of expression of each of the FOXM1 and CENPF genes in the test sample is at least 35% higher than the corresponding level in the control sample.

[0008] In a second set of embodiments, a method includes obtaining a prostate cancer sample from a subject having prostate cancer, and determining a level of expression of FOXM1 protein and CENPF protein in the prostate cancer sample by immunostaining with a first antibody that specifically binds to FOXM1 and a second antibody that specifically binds to CENPF. The method further includes determining that the subject has an aggressive form of prostate cancer or has a high risk of prostate cancer progressing to an aggressive form, if at least 50% of prostate cancer cells in the prostate cancer sample express both FOXM1 protein and CENPF protein at a composite score of at least 100 for each protein. The composite score is calculated by multiplying a percent staining value by a staining intensity value.

[0009] In a third set of embodiments, a method includes obtaining a prostate cancer sample from a subject having prostate cancer (or at risk of developing prostate cancer). The method also includes applying a first antibody that specifically binds to FOXM1 protein in the sample, wherein presence of FOXM1 creates an antibody-FOXM1 complex; and applying a second antibody that specifically binds to CENPF in the sample, wherein presence of the CENPF creates an antibody-CENPF complex. The method further includes applying a first detection agent that detects the antibody-FOXM1 complex; and a second detection agent that detects the antibody-CENPF complex. The method still further includes then determining that the subject has an aggressive form of prostate cancer or has a high risk of prostate cancer progressing to an aggressive form, if at least 50% of prostate cancer cells in the sample express both FOXM1 protein and CENPF protein at a composite score of at least 100 for each protein.

[0010] In a fourth set of embodiments, a diagnostic kit for detecting an expression level of an mRNA or a protein encoding FOXM1 or CENPF or both in a biological sample includes oligonucleotides that specifically hybridize to each of the respective mRNAs or one or more agents that specifically bind to each of the respective proteins, or both.

[0011] In a fifth set of embodiments, a microarray includes a plurality of oligonucleotides that specifically hybridize to an mRNA encoded by each of the FOXM1 or CENPF genes, which oligonucleotides are fixed on the microarray.

[0012] In a sixth set of embodiments, a microarray includes a plurality of antibodies or antibody fragments that specifically bind to either or both of FOXM1 protein or CENPF protein or biologically active fragment thereof, which antibodies or antibody fragments are fixed on the microarray.

[0013] Still other aspects, features, and advantages of the invention are readily apparent from the following detailed description, simply by illustrating a number of particular embodiments and implementations, including the best mode contemplated for carrying out the invention. The invention is also capable of other and different embodiments, and its several details can be modified in various obvious respects, all without departing from the spirit and scope of the invention. Accordingly, the drawings and description are to be regarded as illustrative in nature, and not as restrictive.

BRIEF DESCRIPTION OF THE DRAWINGS

[0014] The present invention is illustrated by way of example, and not by way of limitation, in the figures of the accompanying drawings and in which like reference numerals refer to similar elements and in which:

[0015] FIG. 1A is a block diagram and graph that illustrate example gene profiling data for multiple human subjects with various stages of prostate cancer, according to an embodiment;

[0016] FIG. 1B is a block diagram and graph that illustrate example gene profiling data for multiple mouse models for prostate cancer, according to an embodiment;

[0017] FIG. 1C is a block diagram and graph that illustrate example effects on gene profiling data for mouse models in response to various perturbagens, according to an embodiment;

[0018] FIG. 2A is a block diagram and graph that illustrate example interactomes for human and mouse models with prostate cancer, according to an embodiment;

[0019] FIG. 2B is a graph that illustrates example percentage of the interactomes that are conserved between human and mouse models with prostate cancer, according to an embodiment;

[0020] FIG. 3A is a Venn diagram and table that illustrate example selection of a subset of master regulators from a full set determined by available automated computer processes, according to an embodiment;

[0021] FIG. 3B is a diagram that illustrates example ranking of master regulators for their impacts on prostate cancer, according to an embodiment;

[0022] FIG. 3C is a table that illustrates example ranking of master regulators for their impacts on prostate cancer by various available algorithms, according to an embodiment;

[0023] FIG. 4 is a table that illustrates example predicted synergy of FOXM1 And CENPF among the subset of master regulators using available algorithms, according to an embodiment;

[0024] FIG. 5 is a table that illustrates example clinical datasets used to determine whether synergistic master regulators FOXM1 and CENPF are prognostic biomarkers of prostate cancer outcomes, according to an embodiment;

[0025] FIG. 6A is an image that illustrates example micrographs of FOXM1 and CENPF stained tissues showing enhanced concentrations of both in aggressive prostate cancer tumors compared to other prostate tumors, according to an embodiment;

[0026] FIG. 6B is an image that illustrates example micrographs of FOXM1 and CENPF stained tissues showing enhanced concentrations of both in metastasized lung and liver tumors, according to an embodiment;

[0027] FIG. 6C through FIG. 6E are graphs that illustrate example Kaplan-Meier survival analysis based on protein expression levels of FOXM1 and CENPF with respect to time to biochemical recurrence, time to prostate cancer-specific death, or time to metastatic progression, respectively, according to an embodiment;

[0028] FIG. 6F and FIG. 6G are graphs that illustrate example Kaplan-Meier survival analysis based on the interactome-inferred activity levels of FOXM1 and CENPF with respect to time to biochemical recurrence, or time to prostate cancer-specific death, respectively, according to an embodiment;

[0029] FIG. 7 is a table that illustrates example prognostic power of co-expression of protein levels of FOXM1 and CENPF, with death due to prostate cancer and time to metastasis as evaluation endpoints, according to an embodiment;

[0030] FIG. 8 is a flow chart that illustrates an example diagnostic method for determining whether a subjects is at risk based on coexpression of the synergistic master regulators FOXM1 and CENPF, according to an embodiment;

[0031] FIG. 9A is a graph that illustrates example resulting relative mRNA expression levels for the shared targets of FOXM1 and CENPF in the indicated cell lines following individual or co-silencing of FOXM1 and CENPF, according to an embodiment;

[0032] FIG. 9B is a graph that illustrates example enrichment of FOXM1 binding normalized to input with and without silencing of CENPF, according to an embodiment;

[0033] FIG. 9C is an image of micrographs that illustrate example changes in subcellular localization of FOXM1 and CENPF proteins in prostate cancer cells after silencing either, according to an embodiment; and

[0034] FIG. 10 is a flow chart that illustrates an example method for determining coexpression of the synergistic master regulators FOXM1 and CENPF, according to an embodiment.

DEFINITIONS

[0035] Unless defined otherwise, technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The practice of the present invention will employ, unless indicated specifically to the contrary, conventional methods of molecular biology and recombinant DNA techniques within the skill of the art, many of which are described below for the purpose of illustration. Such techniques are fully explained in the literature. See, e.g., Singleton et al., Dictionary of Microbiology and Molecular Biology 3rd.sup.ed., J. Wiley & Sons (2001); March, Advanced Organic Chemistry Reactions, Mechanisms and Structure 5th.sup.ed., J. Wiley & Sons (2001); Sambrook & Russell, eds., Molecular Cloning: A Laboratory Manual 3rd ed., Cold Spring Harbor Laboratory Press (2001); Glover, ed., DNA Cloning: A Practical Approach, vol. I & II (2002); Gait, ed., Oligonucleotide Synthesis: A practical approach, Oxford University Press (1984); Herdewijn, ed., Oligonucleotide Synthesis: Methods and Applications, Humana Press (2005); Hames & Higgins, eds., Nucleic Acid Hybridisation: A Practical Approach, IRL Press (1985); Buzdin & Lukyanov, eds., Nucleic Acid Hybridization: Modern Applications, Springer (2007); Hames & Higgins, eds., Transcription and Translation: A Practical Approach, IRL Press (1984); Freshney, ed., Animal Cell Culture, Oxford UP (1986); Freshney, Culture of Animal Cells: A Manual of Basic Technique and Specialized Applications, 6th ed., John Wiley & Sons (2010); Perbal, A Practical Guide to Molecular Cloning, 3rd ed., Wiley-Liss (2014); Farrell, RNA Methodologies: A Laboratory Guide for Isolation and Characterization, 3rd ed., Elsevier/Focal Press (2005); Lilley & Dahlberg, eds., Methods in Enzymology: DNA Structures, Part A: Synthesis and Physical Analysis of DNA, Academic Press (1992); Harlow & Lane, Using Antibodies: A Laboratory Manual: Portable Protocol no. 1, Cold Spring Harbor Laboratory Press (1999); Harlow & Lane, eds., Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press (1988); Seethala & Fernandes, eds., Handbook of Drug Screening, Marcel Dekker (2001); and Roskams & Rodgers, eds., Lab Ref: A Handbook of Recipes, Reagents, and Other Reference Tools for Use at the Bench, Cold Spring Harbor Laboratory (2002) provide one skilled in the art with a general guide to many of the terms used in the present application.

[0036] One skilled in the art will recognize many methods and materials similar or equivalent to those described herein, which could be used in the practice of the present invention. Other features and advantages of the invention will become apparent from the following detailed description, taken in conjunction with the accompanying drawings, which illustrate, by way of example, various features of embodiments of the invention. Indeed, the present invention is in no way limited to the methods and materials described. For convenience, certain terms employed herein in the specification, examples and appended claims are collected here.

[0037] Unless stated otherwise, or implicit from context, the following terms and phrases include the meanings provided below. Unless explicitly stated otherwise, or apparent from context, the terms and phrases below do not exclude the meaning that the term or phrase has acquired in the art to which it pertains. The definitions are provided to aid in describing particular embodiments, and are not intended to limit the claimed invention, because the scope of the invention is limited only by the claims. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0038] The term "nucleic acid" as used herein refers to any natural and synthetic linear and sequential arrays of nucleotides and nucleosides, cDNA, genomic DNA, mRNA, oligonucleotides and derivatives thereof. The term "nucleic acid" further includes modified or derivatized nucleotides.

[0039] An "isolated" nucleic acid molecule is one which is separated from other nucleic acid molecules which are present in the natural source of the nucleic acid molecule, namely cancerous or noncancerous biological samples. An "isolated" nucleic acid molecule, such as a cDNA molecule, can be substantially free of other cellular material or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized.

[0040] As used herein "oligonucleotide" refers to an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or mimetics thereof. This term includes oligonucleotides composed of naturally-occurring nucleobases, sugars and covalent internucleoside (backbone) linkages as well as oligonucleotides having non-naturally-occurring portions which function similarly. Such modified or substituted oligonucleotides are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for nucleic acid target and increased stability in the presence of nucleases.

[0041] As used herein an "inhibitory oligonucleotide" includes antisense, siRNA, shRNA, ribozymes and MIRs or other oligonucleotide that reduces the expression of a targeted FOXM1 or CENPF gene or protein.

[0042] "Biological sample" refers to a sample of prostate cells. The sample can be prostate cancer cells, for example, those taken from a prostate biopsy from a subject having prostate cancer, or of normal prostate cells either taken from a normal control subject or in some embodiments from a noncancerous area of the prostate of the subject having prostate cancer. In other embodiments, the biological sample comprises circulating prostate cancer cells isolated from the blood, cerebrospinal fluid (CSF) or serum of a subject having prostate cancer or exosomes derived from prostate cancer cells.

[0043] "Indolent prostate cancer" means low-risk, non-aggressive or non-invasive prostate cancers which would not lead to subject death if left untreated.

[0044] "Aggressive prostate cancer" means prostate cancer that leads to a shortened life expectancy of the subject or an increased occurrence of metastasis to other tissue cancers.

[0045] "At high risk of progressing to aggressive prostate cancer" means that the subject has prostate cancer that, more likely than not, is or will become aggressive prostate cancer.

[0046] A "subject" is a mammal, typically a human, but optionally a mammalian animal of veterinary importance, including but not limited to horses, cattle, sheep, dogs, and cats. In some embodiments a "subject" refers to either one who has been previously diagnosed with or identified as suffering from prostate cancer or to one who does not have prostate cancer, i.e., a normal or control subject.

[0047] As used herein, the term "diagnosis" includes the detection, typing, monitoring, dosing, and comparison at various stages of prostate cancer in a subject. Diagnosis includes the assessment of a predisposition or risk of developing an aggressive form of prostate cancer.

[0048] As used herein, the terms "treat," "treatment," "treating," or "amelioration" when used in reference to prostate cancer refer to therapeutic treatments for the prostate cancer, wherein the object is to reverse, alleviate, ameliorate, inhibit, slow down or stop the progression of the prostate cancer to an aggressive form, or reduce the severity of a symptom or condition. The term "treating" includes reducing or alleviating at least one adverse effect or symptom of a condition. Treatment is generally "effective" if one or more symptoms or clinical markers such as prostate-specific antigen (PSA) are reduced.

[0049] "FOXM1" as used herein refers to Forkhead box protein M1 is a protein that in humans is encoded by the FOXM1 gene. The protein encoded by this gene is a member of the FOX family of transcription factors. FOXM1 is also referred to as FKHL16; FOXM1B; HFH-11; HFH11; HNF-3; INS-1; MPHOSPH2; MPP-2; MPP2; PIG29; TGT3; TRIDENT. The human and mouse reference mRNA sequences are NM_001243088 (SEQ ID NO: 49) and NM_008021 (SEQ ID NO: 51), respectively. The human and mouse protein sequences are NP_001230017 (SEQ ID NO: 50) and NP_032047 (SEQ ID NO: 52), respectively. For the purpose of the methods and compositions of the invention, "FOXM1 protein" includes orthologs (analogs in different species).

[0050] "CENPF" as used herein refers to centromere protein F, a protein that in humans is encoded by the CENPF gene. The CENPF protein associates with the centromere-kinetochore complex. The protein is a component of the nuclear matrix during the G2 phase of interphase. CENPF is also referred to as CENF; PRO1779; hcp-1. The human and mouse reference mRNA sequences are NM_016343 (SEQ ID NO: 53) and NM_001081363 (SEQ ID NO: 55) respectively; and the human and mouse protein sequences are NP_057427 (SEQ ID NO: 54) and NP_001074832 (SEQ ID NO: 56), respectively. For the purpose of the methods and compositions of the invention, "CENPF protein" includes orthologs (analogs in different species).

[0051] "Protein expression" refers to expression of protein as measured quantitatively by methods including without limitation Western blot, 2-dimensional SDS-PAGE and mass spectrometry.

[0052] "mRNA expression" refers to the expression of mRNA that can be measured quantitatively by methods including but not limited to nuclease protection assays, northern blots, real time quantitative PCR, and in-situ hybridization.

[0053] "Control level" and "normal level of expression" as used herein refer to a level or range of levels of FOXM1 or CENPF expressed in normal prostate tissue or indolent prostate cancer tumors.

[0054] "Threshold" or "threshold level" as used herein refers to a level or range of levels that separate normal level of expression of FOXM1 and CENPF from a pattern, level or ranges of levels of expression of FOXM1 and CENPF that indicate a high risk of aggressive prostate cancer. When the levels of expression of FOXM1 and CENPF are equal to or greater than the threshold level then it is determined that the subject is at high risk of developing aggressive prostate cancer or has aggressive prostate cancer, and vice versa.

[0055] "Protein" as used herein is a generic term referring to and used interchangeably with biologically active native protein, fragments, peptides, or analogs thereof.

[0056] "Subcellular localization of FOXM1 and CENPF" as used herein refers to the presence of FOXM1 and CENPF inside a cell. "Colocalization" means that both FOXM1 and CENPF are present in the same cell or if so designated, in the same subcellular compartment, for example colocalization in the nucleus or cytoplasm.

[0057] "Master regulator" as used herein refers to a protein that acts to drive any intermediary proteins in a key signaling pathway for a phenotype transition, such as a transition from indolent prostate cancer cell to an aggressive prostate cancer cell.

[0058] "Synergistic master regulator" as used herein refers to multiple master regulators that together have a measured effect greater than a predicted sum of their individual measured effects.

[0059] "Cross-species computational analysis" as used herein refers to automatically searching molecular interaction networks ("interactomes") of two or more species, such as human and mouse models for human cells, using a computer system to discover interactions present ("conserved") in both species.

[0060] The term "probe" refers to any molecule which is capable of selectively binding to a specifically intended target molecule, for example, an oligonucleotide probe that specifically hybridizes to a prognostic biomarker mRNA such as CENPF or FOXM1, or an antibody that specifically binds CENPF or FOXM1. Probes can be either synthesized by one skilled in the art, or derived from appropriate biological preparations. For purposes of detection of the target molecule, probes may be specifically designed to be labeled, as described herein. Examples of molecules that can be utilized as probes include, but are not limited to RNA, DNA, RNA/DNA chimeras, proteins, antibodies, and organic molecules.

[0061] Unless otherwise specified, the terms "antibody" and "antibodies" broadly encompass naturally-occurring forms of antibodies (e.g., IgG, IgA, IgM, IgE) and recombinant antibodies such as single-chain antibodies, chimeric and humanized antibodies and multi-specific antibodies, as well as fragments and derivatives of all of the foregoing, which fragments and derivatives have at least an antigenic binding site. Antibody derivatives may comprise a protein or chemical moiety conjugated to an antibody moiety.

DETAILED DESCRIPTION

[0062] A method, composition of matter, article of manufacture and apparatus are described for discovery of synergistic master regulators and the diagnosis of aggressive prostate cancer. In the following description, for the purposes of explanation, numerous specific details are set forth in order to provide a thorough understanding of the present invention. It will be apparent, however, to one skilled in the art that the present invention may be practiced without these specific details. In other instances, well-known structures and devices are shown in block diagram form in order to avoid unnecessarily obscuring the present invention.

[0063] It has been discovered that the genes encoding FOXM1 and CENPF are prognostic biomarkers that are synergistic master regulators of aggressive prostate cancer in humans. Significantly elevated co-expression of both FOXM1 and CENPF genes in a prostate cancer sample at levels at least 35% above control levels is diagnostic of aggressive prostate cancer or of a high risk of developing aggressive prostate cancer, as is described in sample embodiments. Gene expression can be determined by mRNA or protein expression or combinations thereof. Regulatory drivers of prostate cancer malignancy were identified by assembling genome-wide regulatory networks (interactomes) for both human and mouse prostate cancer from expression profiling datasets of human tumors and genetically engineered mouse models, respectively. Cross-species computational analysis of these interactomes identified FOXM1 and CENPF as synergistic master regulators of prostate cancer malignancy that promote tumor growth by coordinated regulation of target gene expression and activation of key signaling pathways associated with prostate cancer malignancy. Thus, co-expression of FOXM1 and CENPF was identified for the first time as a robust prognostic indicator of aggressive prostate cancer with poor survival and metastasis.

[0064] Based on the data described herein, certain embodiments of the invention are directed to methods for diagnosing aggressive prostate cancer or a high risk of prostate cancer progressing to an aggressive form if the level of mRNA or protein expression for each of FOXM1 and CENPF in a prostate cancer sample from a subject is at least 35% higher than the corresponding level in a control prostate sample. In another embodiment aggressive prostate cancer is diagnosed if at least 50% of the cells in the prostate cancer sample from a subject express elevated levels of both FOXM1 protein and CENPF protein.

1. OVERVIEW

[0065] While both FOXM1 and CENPF have been implicated in various cancers, the current work has uncovered a novel synergistic interaction that had not been previously anticipated. FOXM1 encodes a Forkhead domain transcription factor that is frequently over-expressed in many different types of cancer, including prostate, see (Alvarez-Fernandez and Medema, 2013; Halasi and Gartel, 2013a; Kalin et al., 2011; Koo et al., 2012), for reviews. Many previous studies have established a role for FOXM1 expression and activity in the regulation of cellular proliferation, DNA damage, genomic stability, drug resistance, and metastasis, and have shown that FOXM1 interacts with other key regulators such as .beta.-Catenin and MYB (Lefebvre et al., 2010; Zhang et al., 2011). In particular, the relevance of FOXM1 for prostate cancer has been shown by its gain- or loss-of-function in vivo, which elicit modest effects on tumor growth (Cai et al., 2013; Kalin et al., 2006).

[0066] CENPF (also known as mitosin or LEK1 in mouse), a known target of FOXM1, has also been implicated in various cancers, although not previously in prostate, and in some cases has been shown to undergo gene amplification and be associated with disease outcome (see Ma et al., 2006; Varis et al., 2006 for reviews). However, the actual functional role of CENPF has been more elusive and difficult to reconcile. In particular, while CENPF is named for its association with the centromere-kinetochore protein complex, such association is only transient. In fact, CENPF has been shown to have other functions, including regulation of mitosis and cellular proliferation (Bomont et al., 2005; Feng et al., 2006; Holt et al., 2005), which are mediated in part by protein interactions, including with members of the Retinoblastoma gene family as well as with the ATF transcription factor (see Ma et al., 2006; Varis et al., 2006 for reviews).

2. CROSS SPECIES DISCOVERY OF REGULATORY GENES FOR AGGRESSIVE PROSTATE CANCER

[0067] To assemble a human prostate cancer interactome, gene expression profile data reported in (Taylor et al., 2010) was analyzed, which is ideally suited because: (i) it is relatively large (n=185) and diverse, including gene expression profiles from primary prostate tumors, adjacent normal prostate tissue, metastases, and cell lines; (ii) its primary tumors encompass the full range of pathological Gleason scores and have well-annotated clinical outcome data; and (iii) it displays extensive genetic diversity and tumor heterogeneity, as shown by t-Distributed Stochastic Neighbor Embedding (t-SNE) analysis. Several characteristics of this dataset are described below with reference to FIG. 5. Notably, interactomes assembled from three alternative human prostate cancer datasets, also characterized in FIG. 5, were neither as complete nor as extensive. FIG. 1A is a block diagram and graph that illustrate example gene profiling data for multiple human subjects with various stages of prostate cancer, according to an embodiment. Details are set forth in Example 2.

[0068] Analysis of genetically engineered mouse models (GEMMs) can circumvent challenges associated with the inherent complexity of the more heterogeneous human cancer phenotypes. Investigations of mouse models of prostate cancer have contributed to characterization of disease-specific pathways, led to the identification of biomarkers of disease progression, and provided useful preclinical models for prevention and therapy (Irshad and Abate-Shen, 2013; Ittmann et al., 2013). Following the description of the first transgenic model of prostate cancer nearly 20 years ago, there are now numerous GEMMs that collectively model key molecular pathways de-regulated in human prostate cancer, and recapitulate the various stages of disease progression including pre-invasive lesions (prostate intraepithelial neoplasia, PIN), adenocarcinoma, castration-resistance, and metastasis (Irshad and Abate-Shen, 2013; Ittmann et al., 2013).

[0069] Inherent species differences often hinder direct comparative analyses of mouse models and human cancer. As described herein, a novel combination of computational approaches were applied to enable accurate cross-species integration of regulatory information from mouse to man in the context of prostate cancer. Recent advances in systems biology have led to the reverse engineering of regulatory networks (interactomes) that integrate large-scale datasets encompassing gene expression profiles, protein-protein interactions, genomic alterations, and epigenetic changes associated with cancer and other diseases (see Lefebvre et al., 2012 for a review). While individual analyses of human and murine interactomes led to relevant biological discoveries, cross-species interactome-based interrogation strategies have not been systematically implemented until now.

[0070] The results described here are based on an approach for accurate cross-species analysis of conserved cancer pathways based on reverse engineering and interrogation of genome-wide regulatory networks (i.e., interactomes) representing both human and mouse prostate cancer. To accomplish this, the first regulatory network obtained from in vivo perturbation of a repertoire of mouse cancer models was introduced, as well as its comparative analysis with a complementary regulatory network generated from human prostate cancer samples. Cross-species computational interrogation of these paired interactomes followed by experimental validation thus elucidated the synergistic interaction of FOXM1 and CENPF as a driver of aggressive prostate cancer malignancy.

[0071] To assemble a corresponding mouse prostate cancer interactome, it was first necessary to generate an appropriately sized gene expression profile dataset representing sufficient expression variability. To address this challenge, 13 distinct GEMMs were first selected, which together represent the full spectrum of prostate cancer phenotypes, including normal epithelium (wild-type), low-grade PIN (Nkx3.1 and APT), high-grade PIN and adenocarcinoma (APT-P, APC, Hi-Myc, NP, Erg-R, and NP53), castration-resistant prostate cancer (NP-AI), and metastatic prostate cancer (NPB, NPK, and TRAMP). FIG. 1B is a block diagram and graph that illustrate example gene profiling data for multiple mouse models for prostate cancer, according to an embodiment. The diagram groups the mouse models by phenotype listed above. The graph plots the t-SNE analysis showing relative distribution of the GEMMs. More detail is set forth in Example 2.

[0072] To generate a sufficient number of samples, while further increasing the variability of the corresponding expression profiles, a controlled set of exogenous perturbations was introduced by in vivo administration of 13 different small-molecule perturbagens to each GEMM. Perturbagens were selected for their clinical relevance and/or ability to modulate key prostate cancer pathways, including: hormone signaling (testosterone, calcitriol, or enzalutamide); PI3 kinase activity (MK2206, LY294002, and rapamycin); MAP kinase activity (PD035901); tyrosine kinase activity (imatinib, dasatinib, and sorafenib); NF1B signaling (BAY 11-7082); JAK/STAT activity (WP1066); and chemotherapy (docetaxel). Following pilot studies to define the appropriate dose and schedule that produced the broadest range of gene expression changes, a universal schedule was adopted of 1 treatment per day for 5 days with dosage determined independently for each perturbagen, as described below in an experimental procedures section.

[0073] The resulting dataset contained 384 gene expression profiles, corresponding to the 13 GEMMs each treated with the 13 perturbagens or vehicles. The t-SNE analysis revealed that the resulting mouse dataset represented an extensive range of gene expression variability, as requisite for ARACNe. Specifically, while expression profiles from the same GEMMs and perturbagens clustered together, suggesting their effect was highly replicable, the diverse GEMMs and perturbagens provided independent and highly effective axes of expression heterogeneity. FIG. 1C is a block diagram and graph that illustrate example effects on gene profiling data for mouse models in response to various perturbagens, according to an embodiment. The schematic diagram depicts perturbagens used to treat the GEMMs. The graph plots the t-SNE analysis showing the relative distribution of perturbagens for a representative GEMM (i.e., the NP model).

[0074] Regulatory networks (interactomes) for human and mouse prostate cancer were generated using the Algorithm for the Reconstruction of Accurate Cellular Networks. FIG. 2A is a block diagram and graph that illustrates example interactomes for human and mouse models with prostate cancer, according to an embodiment. The suitability of these mouse and human interactomes for cross-species interrogation was next evaluated by developing a novel computational approach to assess the global conservation of their transcriptional programs described in detail in Example 2. Notably, conserved transcriptional regulators included many genes known to play important roles in prostate cancer, such as AR, ETS1, ETV4, ETV5, STAT3, MYC, BRCA1, and NKX3.1. In particular, AR displayed extensive correlation of its transcriptional activity between the human and mouse interactomes, consistent with its known role as a key regulator of prostate development and prostate tumorigenesis

[0075] The Master Regulator Inference algorithm (MARINa) (Carro et al., 2010; Lefebvre et al., 2010) was used to infer candidate master regulators (MRs) that act individually or synergistically to drive malignant prostate cancer in the conserved interactomes. MARINa estimates differential activity (DA) based on enrichment (differential expression, DE) of their activated and repressed targets in the malignancy signature. More specifically, MARINa identified candidate MRs based on the concerted differential expression of their ARACNe-inferred targets (i.e., their differential activity, DA). Specifically, "activated" MRs have positively-regulated and repressed targets significantly enriched among upregulated and downregulated genes, respectively, while "repressed" MRs have the converse. To interrogate the human prostate cancer interactome, a gene signature was used representing prostate cancer malignancy from the Taylor dataset, which compares aggressive prostate tumors (Gleason score .gtoreq.8 with rapid biochemical recurrence; sample size n=10) versus indolent ones (Gleason score 6 tumors with no biochemical recurrence; sample size n=39). The resulting independent lists of human and mouse MRs were then integrated to produce a ranked list of 20 conserved MRs, including 7 activated and 13 repressed (joint p-value: p.ltoreq.0.0074 by Stouffer's method). Notably, these conserved MRs were more likely to be associated with disease outcome than the non-conserved ones, and were also more likely to be differentially expressed in aggressive prostate tumors (metastatic versus non-metastatic; 100% versus 60%). FIG. 3C is a table that illustrates example ranking of master regulators for their impact on prostate cancer by various available algorithms. Using the ARACNe method to analyze all possible pairs among the conserved activated MRs, the only pair that was found to be statistically significant was FOXM1 and CENPF. Both FOXM1 and CENPF were differentially co-expressed at significantly elevated levels in aggressive prostate tumors and were predicted to be significantly associated with disease outcome. Thus, subsequent analyses were focused on this pair of cross-species conserved, synergistic MRs.

3. METHOD OF DIAGNOSIS

FOXM1 and CENPF are Prognostic Biomarkers of Aggressive Prostate Cancer

[0076] Analysis of high-density tissue microarrays (TMAs) revealed that the co-expression of FOXM1 and CENPF constituted a highly informative biomarker of poor disease outcome. FIG. 5 is a table that illustrates example clinical datasets used to determine whether synergistic master regulators FOXM1 and CENPF are prognostic biomarkers of prostate cancer outcomes, according to an embodiment. The datasets are listed along the top row, with their use in this study grouped by primary dataset (Taylor et al., 2010); secondary datasets; RNA gene expression datasets (Sboner et al., 2010; Glinsky et al., 2004); and protein immunohistochemistry tissue microarray (TMA) datasets (Outcome TMA from MSKCC, and Metastasis TMA from Michigan). The categories of data in each dataset are given by the rows, as applicable. One row breaks down the number of samples for each cell type; one row gives the median age of the subjects. The next rows give the Pathology T stage; the clinical T stage; the Pathology N stage; the Pathology Gleason score; the biopsy Gleason score; the survival index (SVI); the extracapsular extension percentage; the biochemical recurrence (BCR) median time in months; the median overall survival in months; and the median time to metastasis in months.

[0077] Analysis of protein expression of FOXM1 and CENPF was performed using high-density tissue primary tumor microarray (TMAs) (Donovan et al., 2008) and a metastasis TMA (Shah et al., 2004). Available clinico-pathological features of these cohorts as well as independent human datasets used for clinical validation are summarized in the Table of FIG. 5.

[0078] In particular, a high-density TMA containing primary tumors from a large cohort of subjects (sample size n=916) that had undergone prostatectomy at Memorial Sloan-Kettering Cancer Center from 1985 to 2003 (Donovan et al., 2008) was analyzed. These cases have extensive clinical follow-up data for up to 20 years, including time to biochemical recurrence, prostate-cancer specific survival, and time to metastasis. A second TMA was evaluated from the rapid autopsy program at the University of Michigan containing prostate cancer metastases (sample size n=60), including 6 lung, 11 liver, 22 lymph node, and 14 other sites (Shah et al., 2004). Immunostaining for FOXM1 or CENPF was performed on adjacent sections of each TMA slide and staining intensity was evaluated (see experimental procedures section, below).

[0079] FIG. 6A is an image that illustrates example micrographs of FOXM1 and CENPF stained tissues showing enhanced concentrations of both in aggressive prostate cancer tumors compared to other prostate tumors, according to an embodiment. These micrographs are based on the MSKCC prostatectomy TMA; and, analysis revealed that FOXM1 and CENPF were over-expressed in 33% and 37% of all cases, respectively (sample size n=821 informative cases), with a trend toward increased expression in tumors with higher Gleason scores. Spearman rank correlation coefficient of FOXM1 and CENPF protein expression levels was 0.57 with p value <2.2.times.10.sup.-16, indicating the coexpression relationship is highly significant.

[0080] FIG. 6B is an image that illustrates example micrographs of FOXM1- and CENPF-stained tissues showing enhanced concentrations of both in prostate cancer that metastasized to lung and liver tumors. These micrographs are based on the Michigan metastasis TMA; and, analysis revealed that FOXM1 and CENPF were coexpressed in most of the prostate cancer metastases (88% and 90%, respectively, sample size n=53 informative cases) at significantly elevated levels. Spearman rank correlation coefficient of FOXM1 and CENPF protein expression levels was 0.43 with p value <0.001, indicating the coexpression is significant.

[0081] Thus, co-expression of FOXM1 and CENPF at above-threshold levels, particularly their nuclear colocalization, as described in more detail below, was well correlated in both the MSKCC prostatectomy TMA and the Michigan metastasis TMA. Additionally, both FOXM1 and CENPF were overexpressed at the mRNA level and their co-expression was well-correlated in advanced prostate cancer and metastases from independent cohorts of human prostate cancer.

[0082] To determine whether expression of FOXM1 and/or CENPF is associated with disease outcome on the MSKCC TMA, 4 groups of subjects were defined based on their expression levels: (i) low/normal expression of both FOXM1 and CENPF (sample size n=418); (ii) high expression of FOXM1 and low/normal expression of CENPF (sample size n=97); (iii) high expression of CENPF and low/normal expression of FOXM1 (sample size n=133); and (iv) high expression of both FOXM1 and CENPF (sample size n=173). FIG. 6C through FIG. 6E are graphs that illustrate example Kaplan-Meier survival analysis based on protein expression levels of FOXM1 and CENPF with respect to time to biochemical recurrence, time to prostate cancer-specific death, or time to metastatic progression, respectively, according to an embodiment.

[0083] Kaplan-Meier survival analysis of these subject groups revealed that those having elevated expression of both FOXM1 and CENPF were associated with the worst outcome with high significance (low values of p) for three independent clinical endpoints, namely, time to biochemical-free recurrence (p.ltoreq.4.4.times.10.sup.6), death due to prostate cancer (p.ltoreq.5.9.times.10.sup.-9), and time to metastasis (p.ltoreq.1.0.times.10.sup.-16). The p-values correspond to a log-rank test and indicate the statistical significance of the association with outcome for each indicated branch compared to control (i.e., subjects with low protein expression of both FOXM1 and CENPF). Notably, co-subcellular localization of FOXM1 and CENPF in prostate tumors was also associated with the worst outcome for all three independent clinical endpoints, as described in more detail below. In contrast, elevated expression of only FOXM1 or CENPF was either not significant or marginally significant for biochemical recurrence and prostate-specific survival (p.ltoreq.0.053 and p.ltoreq.0.011 for FOXM1, respectively; p.ltoreq.0.078 and p.ltoreq.0.402 for CENPF, respectively), and was 10 to 13 orders of magnitude less significant, respectively, than co-expression for time to metastasis (p.ltoreq.0.001 for FOXM1 and p.ltoreq.3.1.times.10.sup.-6 for CENPF, respectively).

[0084] Association of FOXM1 and CENPF with disease outcome was independently corroborated in two independent human prostate cancer datasets that had not been used for training purposes elsewhere in this study; namely, the Glinsky dataset, in which biochemical recurrence is the clinical endpoint (Glinsky et al., 2004), and the Sboner dataset, in which the clinical endpoint is prostate cancer-specific overall survival (Sboner et al., 2010). Using these independent cohorts, the mRNA expression levels of FOXM1 and CENPF was evaluated as well as their MARINa-inferred activity. Kaplan-Meier survival analysis was then performed on 4 subject groups: (i) those with low inferred activity or expression for FOXM1 and CENPF; (ii) those with high inferred activity or expression only for FOXM1; (iii) those with high inferred activity or expression only for CENPF; and (iv) those with high inferred activity or expression for both FOXM1 and CENPF. FIG. 6F and FIG. 6G are graphs that illustrate example Kaplan-Meier survival analysis based on the interactome-inferred activity levels of FOXM1 and CENPF with respect to time to biochemical recurrence, or time to prostate cancer-specific death, respectively, according to an embodiment.

[0085] Similar to the analysis of protein expression on the TMA, subjects with high inferred activity or mRNA expression for both CENPF and FOXM1 were associated with the worst outcome in both cohorts, as measured by biochemical recurrence (p.ltoreq.6.5.times.10.sup.-5) and prostate cancer-specific survival (p.ltoreq.4.0.times.10.sup.-5). The ARACNe-inferred activities levels were assessed for each subject sample in both cohorts. The p-values correspond to a log-rank test and indicate the statistical significance of the association with outcome for each indicated branch compared to control (i.e., subjects with low activity levels of both FOXM1 and CENPF). Notably, these findings reveal that their ARACNe-inferred activities are well-correlated with the actual expression of FOXM1 and CENPF proteins on the TMA, and further demonstrate the striking association of their co-expression/co-activity with poor disease outcome.

[0086] FIG. 7 is a table that illustrates example prognostic power of co-expression of protein levels of FOXM1 and CENPF, with death due to prostate cancer and time to metastasis as evaluation endpoints, according to an embodiment. C-statistics give the proportion of pairs in which the predicted event probability (e.g., probability of survival from prostate cancer) is higher for the subject who experienced the event of interest (e.g., coexpression of FOXM1 and CENPF) than that of the subject who did not experience the event. Analysis of co-expression of FOXM1 and CENPF on the MSKCC prostatectomy TMA using C-statistics revealed their robust prognostic value for disease-specific survival (C=0.71; confidence interval=0.59-0.84, p.ltoreq.2.4.times.10.sup.-4), as well as time to metastasis (C=0.77; confidence interval=0.71-0.83, p.ltoreq.3.0.times.10.sup.-19). Notably, co-expression of FOXM1 and CENPF proteins as diagnostic markers of aggressive prostate cancer dramatically improved the prognostic value compared to Gleason score alone, for both disease-specific survival (C=0.86; confidence interval=. 0.80-0.93, p.ltoreq.1.0.times.10.sup.-30; p value for improvement, p.ltoreq.2.0.times.10.sup.-4) and time to metastasis (C=0.86; confidence interval=0.81-0.89, p.ltoreq.6.5.times.10.sup.-58; p value for improvement, p.ltoreq.5.3.times.10.sup.-13). In certain embodiments of the invention, diagnosis of aggressive prostate cancer further includes determining, in addition to elevated coexpression of both FOXM1 and CENPF, high Gleason scores of score .gtoreq.8.

[0087] Taken together, these analyses of independent clinical cohorts using distinct statistical models demonstrate that elevated levels of co-expression of FOXM1 and CENPF is a good predictor of disease outcome. In an embodiment FOXM1 and CENPF are prognostic for aggressive prostate cancer or of prostate cancer progressing to an aggressive form when they are coexpressed at elevated levels of at least 35% compared to the levels expressed in control prostate tissue. Based on the results, certain embodiments are directed to a method for diagnosing aggressive prostate cancer or of identifying subjects with prostate cancer that is at high risk of progressing to an aggressive form by a) obtaining a test prostate cancer sample from a subject having prostate cancer, and a control prostate tissue sample,

b) determining a level of expression of the prognostic genes (FOXM1) Forkhead box protein M1 and Centromere, protein F (CENPF) in the test and control samples, c) comparing the level of expression of prognostic genes FOXM1 and CENPF in the test sample to the corresponding level in the control sample, and d) if the level of expression of both of the prognostic genes FOXM1 and CENPF in the test sample is at least 35% higher than the corresponding level in the control sample, then determining that the subject has an aggressive form of prostate cancer or is at high risk of developing an aggressive form of prostate cancer.

[0088] In certain embodiments the level of expression of FOXM1 and CENPF is determined by the level of mRNA encoding FOXM1 and CENPF, respectively; or by the level of FOXM1 protein and CENPF protein in the sample or combinations thereof. In another embodiment, a diagnosis of aggressive prostate cancer is reached by a) obtaining a prostate cancer sample from a subject having prostate cancer, b) determining a level of expression of FOXM1 protein and CENPF protein expression in the cancer cells in the sample by immunostaining with a first antibody that specifically binds to FOXM1 and a second antibody that specifically binds to CENPF, and c) diagnosing aggressive prostate cancer if at least 50% of the cells in the test sample express both FOXM1 protein and CENPF protein at a composite score of at least 100 for each protein, wherein the composite score is calculated by multiplying the percent staining value by the staining intensity value. Any other method for determining that at least 50% of the cells in a prostate cancer sample coexpress both FOXM1 and CENPF proteins at levels of at least 35% above levels in control prostate tissue can be used, these include flow cytometry with differential florescent labeling of both proteins.

[0089] FIG. 8 is a flow chart that illustrates an example diagnostic method 800 for determining whether a subject has or is at high risk of undergoing a specific phenotypic transition based on coexpression of at least two synergistic master regulators, such as FOXM1 and CENPF for aggressive prostate cancer, according to an embodiment. Although steps are depicted in FIG. 8, and in subsequent flowchart FIG. 10, as integral steps in a particular order for purposes of illustration, in other embodiments, one or more steps, or portions thereof, are performed in a different order, or overlapping in time, in series or in parallel, or are omitted, or one or more additional steps are added, or the method is changed in some combination of ways.

[0090] In step 810, a subject is identified who has or is at high risk of producing the phenotype transition of interest, here development of aggressive prostate cancer from a prostate tumor or nodule detected in a subject. In step 803 a sample is taken from the identified subject, such as a biopsy of the prostate tumor or nodule. Biological samples for use in the present embodiments also include circulating prostate cancer cells or prostate tumor cells which can be detected using a variety of methods known in the art that select cells based on surface markers for example using antibodies against the surface markers, or expression of other prostate cancer markers. In some embodiments the prostate cancer cells can be selected by size. Biological samples for use in the present embodiments also include exosomes derived from prostate cancer cells, which are cell-derived vesicles that are present in many and perhaps all biological fluids, including blood. The reported diameter of exosomes is between 30 and 100 nm.

[0091] In step 805, the pattern of coexpression of synergistic master regulators, such as FOXM1 and CENPF, for the phenotype transition, such as to aggressive prostate cancer, is determined. For example, the pattern of certain genes' expression is determined by determining the relative level of coexpression of mRNA coding for the master regulators, or the intensity of immunostaining of polypeptides encoded by the master regulators. Step 805 is described in more detail below with reference to FIG. 10.

[0092] In step 807, it is determined whether the synergistic master regulators are coexpressed at significantly elevated (or reduced) levels above (below) some threshold level, or otherwise have different patterns than, determined in control prostate tissue. For diagnosis of aggressive prostate cancer or the risk of a tumor progressing to an aggressive form, it is determined whether FOXM1 and CENPF levels are both above corresponding threshold control levels, which are the levels seen in normal prostate tissue or indolent prostate cancer tumors. The threshold or pattern depends on the measurement type as described in more detail below with reference to FIG. 10.

[0093] If it is determined in step 807, that the synergistic master regulators are coexpressed at some elevated (or reduced) level or other different pattern, then control passes to step 811. Otherwise control passes to step 821.

[0094] In step 811, it is determined that the subject is at risk for developing the phenotype transition, or in fact is undergoing, or has undergone, the phenotype transition. In some embodiments the phenotype transition is to aggressive prostate cancer. Control then passes to step 817 to treat the subject based on this risk or diagnosis.

[0095] In step 821, it is determined that the subject does not have or is at low risk or no risk for developing the phenotype transition, e.g., aggressive prostate cancer; and, the process ends, or is repeated with the same subject at a later time or with another subject.

[0096] More information on the secondary effects of elevated co-expression of FOXM1 and CENPF was obtained by experiments that were performed to validate synergistic interactions of master regulators and elucidate underlying mechanisms, as well as to evaluate their relevance for clinical outcome. FIG. 9A is a graph shows relative mRNA expression levels for the indicated genes in the indicated cell lines following individual or co-silencing (i.e., silencing both) of FOXM1 and CENPF. The p-values (indicated by one or two *) show the significance of the predicted additive effect versus actual observed effect on gene expression (*=p<0.01; **=p<0.001). Silencing was performed using lentivirus vectors for shRNA for each or both of the two genes FOXM1 and CENPF, as described in more detail below. The ARACNe-inferred common target genes include BRCA1, BUB1, KI67, CYCLIN A, TIMELESS, CDC25, TRIP13, PLK1, HHMR, MYBL2, BIRC5, AURKA, AURKB.

[0097] Although target gene expression was somewhat reduced by their individual silencing, as shown in FIG. 9A, co-silencing of FOXM1 and CENPF produced a significantly greater reduction for the majority of targets, consistent with the synergistic regulation of target gene expression by FOXM1 and CENPF. Notably, these findings were observed in each cell line that express both FOXM1 and CENPF, but not in LNCaP cells which do not express CENPF.

[0098] In addition, analyses of genomic binding of FOXM1 to its known target sites using chromatin immunoprecipitation (ChIP) was followed by quantitative PCR analyses. FIG. 9B is a graph that illustrates example enrichment of FOXM1 binding normalized to input with and without silencing of CENPF, according to an embodiment. Cells were infected with a lentivirus expressing a V5-tagged FOXM1 plus shRNA CENPF (or a control) and ChIP was done using an anti-V5 antibody. Data are expressed as fold of enrichment of FOXM1 binding normalized to input. This revealed that FOXM1 binding to its targets was abrogated by silencing CENPF, therefore suggesting that CENPF is required for appropriate genomic binding by FOXM1.

[0099] Interestingly, although a direct protein-protein interaction of FOXM1 and CENPF in co-immunoprecipitation assays was not observed, it was observed that FOXM1 and CENPF were co-localized in the nucleus of prostate cancer cells and that their subcellular colocalization was mutually dependent. FIG. 9C is an image of micrographs that illustrate example changes in subcellular localization of FOXM1 and CENPF proteins in prostate cancer cells after silencing either, according to an embodiment. Shown are microphotographs of immunofluorescence staining for FOXM1 or CENPF in the control or silenced cells as indicated. Arrows indicate subcellular localization or the shift in localization following silencing.

[0100] In particular, silencing of CENPF resulted in the redistribution of FOXM1 to the cytoplasm as well the nucleus, and conversely silencing of FOXM1 resulted in the accumulation of CENPF at the nuclear periphery. Notably, subcellular co-localization of FOXM1 and CENPF was also observed in human prostate tumors and associated with disease outcome. Taken together, these findings show that FOXM1 and CENPF synergistically regulate expression of mutual target genes, which mediated in part through their subcellular colocalization in prostate cancer cells.

Determining Co-Expression of the Synergistic Master Regulators FOXM1 and CENPF

[0101] FIG. 10 is a flow chart that illustrates an example method 1000 for determining coexpression of the synergistic master regulators such as FOXM1 and CENPF, according to an embodiment. Method 1000 is a particular embodiment of step 805, described above. In step 1051 it is determined whether to use expression of the genes for the synergistic master regulators, or expression of the master regulator proteins (e.g., polypeptides included), or expression of the genes or polypeptides of one or more the targets in the signaling pathways of the master regulators, or combinations thereof.

[0102] In step 1053, it is determined whether the gene expression or polypeptide expression is to be evaluated. If the gene expression is to be determined, control passes to step 1061. Otherwise control passes to step 1071.

[0103] In step 1061, the normalized level of mRNA is determined for FOXM1 and CENPF in the prostate sample. Certain methods and primers for determining the relative or normalized levels of mRNA for FOXM1 and CENPF compared to other genes are also described in the experimental procedures section, below, with primer sequences listed in Table 1 in that later section. In an example, total RNA was isolated from a subject sample of prostate tissues/tumors using a MagMAX-96 total RNA isolation kit and biotin-labeled using the Illumina TotalPrep RNA Amplification Kit (Life Technologies). Slides were scanned using an iScan (Illumina) and the resulting files were uploaded and background-corrected in BeadStudio 3.1.3.0 (Illumina, Inc.). Expression profiling data were normalized using standard variance stabilizing transformation (VST) and robust spline normalization (RSN) with lumiT and lumiN functions from lumi library, in R-system v2.14.0 (The R Foundation for Statistical Computing, ISBN 3-900051-07-0).

[0104] In step 1063, the threshold for significantly elevated coexpression is determined, e.g., retrieved from data storage. An mRNA level in the subject prostate cancer sample that is at least 35% higher than the level expressed in normal prostate tissue for each gene is considered elevated. In other embodiments other thresholds are used. In some embodiments, the threshold for each to be considered elevated is selected in a range from about 35% to about 100% or more. In some embodiments the threshold is at least 50%; and in other embodiments the threshold is at least 75%. Control then passes to step 807 of FIG. 8, described above, to determine if the measured level exceeds the threshold.

[0105] In step 1071, the level of immunostaining is determined for FOXM1 and CENPF proteins. Certain antibodies for immunostaining FOXM1 and CENPF are identified in the experimental procedures section below and listed in Table 2, and procedures for quantifying the intensity levels are also described. Any antibody that selectively binds to either FOXM1 or CENPF can be used. Protein levels were determined by percent of staining (e.g., from 0 to 100%) and intensity level of staining (e.g., 0, 1, 2, or 3) in each tumor sample. A composite protein level is determined by multiplying percent of staining and its intensity level for each tumor sample, for FOXM1 or CENPF. In some embodiments, step 1071 includes determining the relative amounts of FOXM1 and CENPF inside the membrane of the nucleus of the cells where the staining is observed in the top row of FIG. 9C when both FOXM1 and CENPF are expressed. In various embodiments, this determination of the relative amount within the nucleus is done in addition to, or instead of, determining the composite protein level.

[0106] In step 1073, the threshold for elevated coexpression is determined, e.g., retrieved from data storage. Composite protein level exceeding 100 for each protein was considered elevated. Thus, in some embodiments, FOXM1 and CENPF are considered to be co-expressed if the determined composite protein level in the subject prostate tumor sample for each is above about 100.

[0107] In some embodiments, the pattern of coexpression is determined by the relative amount of the total FOXM1 and CENPF that is inside the same cell, or in a particular subcellular compartment, such as inside of the nuclear membrane. For example, if at least 50% of the cells in the test sample express both FOXM1 protein and CENPF protein at a composite score of at least 100 for each protein, then determining that coexpression is elevated.

[0108] Control then passes to step 807 of FIG. 8, described above, to determine if the measured level exceeds the threshold.

Method for Detecting mRNA Expression

[0109] In some embodiments, the methods described herein comprise detecting the presence of FOXM1 or CENPF RNA expression (e.g., mRNA expression), including detecting of the absolute or relative quantity of the RNA, the half-life of the RNA, a splicing or processing of the RNA, the nuclear export of the RNA or the sub-cellular location of the RNA. Such detection can be by various techniques known in the art, including by sequencing all or part of the FOXM1 or CENPF RNA or by selective hybridization or selective amplification of all or part of the FOXM1 or CENPF RNA. As described herein, there exist many suitable methods for detecting the presence and level of a nucleic acid encoding a FOXM1 polypeptide or a CENPF polypeptide, including, but not limited to genotyping a sample, for example via gene sequencing, selective hybridization, amplification, gene expression analysis (e.g. microarray analysis), oligonucleotide ligation assay, a confirmation based assay, a hybridization assay, a sequencing assay, an allele-specific amplification assay, a microsequencing assay, a melting curve analysis, a denaturing high performance liquid chromatography (DHPLC) assay (for example, see Jones et al., 2000), or a combination thereof. Sequencing can be carried out using techniques well known in the art, using automatic sequencers. The sequencing can be performed on the complete gene or on specific domains thereof, such as those known or suspected to carry deleterious mutations or other alterations. Other suitable methods include allele-specific oligonucleotide (ASO), oligonucleotide ligation, allele-specific amplification, Southern blot (for DNAs), Northern blot (for RNAs), single-stranded conformation analysis (SSCA), PFGE, fluorescent in situ hybridization (FISH), gel migration, clamped denaturing gel electrophoresis, denaturing HLPC, melting curve analysis, heteroduplex analysis, RNase protection, chemical or enzymatic mismatch cleavage, ELISA, radio-immunoassays (RIA) and immuno-enzymatic assays (IEMA). Some other approaches are based on specific hybridization between nucleic acids from the subject and a probe specific for wild type gene or RNA. The probe can be in suspension or immobilized on a substrate. The probe can be labeled to facilitate detection of hybrids. Some of these approaches are suited for assessing a polypeptide sequence or expression level, such as Northern blot, ELISA and RIA. These latter require the use of a ligand-specific for the polypeptide, for example, the use of a specific antibody.

[0110] In certain embodiments, detection or quantification of a nucleic acid encoding a nucleic acid encoding a FOXM1 polypeptide or a CENPF polypeptide (or a fragment thereof) can be by hybridization based methods. In certain embodiments, hybridization-based detection methods can employ a step of forming specific hybrids between complementary nucleic acid sequences that serve to detect nucleic acid sequences. Microarrays are a suitable hybridization based detection technique that can be used in connection with the methods described herein. Microarrays employ nucleic acid probes specific for wild type gene or RNA and can be used to investigate the expression of a nucleic acid encoding a FOXM1 polypeptide or a CENPF polypeptide in samples from patients in a diagnostic context. In general, microarrays comprise a two dimensional arrangement of nucleic acid or polypeptide probes which comprises an intentionally created collection of nucleic acid or polypeptide probes of any length spotted onto a substrate/solid support. The array itself can have different formats, e.g. libraries of soluble probes or libraries of probes tethered to resin beads, silica chips, or other solid supports. The process of microarray fabrication is well-known to the person skilled in the art. The process can comprise preparing a glass (or other) slide (e.g., chemical treatment of the glass to enhance binding of the nucleic acid probes to the glass surface), obtaining DNA sequences representing genes of a genome of interest, and spotting sequences these sequences of interest onto glass slide. Sequences of interest can be obtained via creating a cDNA library from an mRNA source or by using publicly available databases, such as GeneBank, to annotate the sequence information of custom cDNA libraries or to identify cDNA clones from previously prepared libraries. Generally, it is recommendable to amplify obtained sequences by PCR in order to have sufficient amounts of DNA to print on the array. The liquid containing the amplified probes can be deposited on the array by using a set of microspotting pins. Ideally, the amount deposited should be uniform. The process can further include UV-crosslinking in order to enhance immobilization of the probes on the array. Microarray chips suitable for use with the methods described herein are well known to those of skill in the art (see, e.g., U.S. Pat. Nos. 6,308,170; 6,183,698; 6,306,643; 6,297,018; 6,287,850; 6,291,183, each incorporated herein by reference). These are exemplary patents that disclose nucleic acid microarrays and those of skill in the art are aware of numerous other methods and compositions for producing microarrays. A microarray composition of the present invention can be employed for the diagnosis and treatment of any condition or disease in which the expression of FOXM1 and/or CENPF is implicated. The microarray-based methods can be used for large scale genetic or gene expression analysis of a large number of target sequences, including nucleic acids encoding a FOXM1 polypeptide or nucleic acids encoding a CENPF polypeptide. The microarray can also be used in the diagnosis of diseases and in the monitoring of treatments. Further, microarrays can also be employed to investigate an individual's predisposition to a disease. Furthermore, the microarrays can be employed to investigate cellular responses to infection, drug treatment, and the like.

[0111] When microarrays are used in connection with the methods described herein, the formation of a plurality of detectable complexes between probes and target nucleic acid sequences can be assessed. The expression profiles can show unique expression patterns that are characteristic of the presence or absence of a disease or condition, such as a malignant prostate cancer. In certain embodiments where expression profiles are examined using microarray technology, complexes can be formed by hybridization of one or more probes having complementarity to a nucleic acid encoding a FOXM1 polypeptide or a nucleic acid encoding a CENPF polypeptide. Such a microarray can be employed in several applications including diagnostics, prognostics and treatment regimens, drug discovery and development, toxicological and carcinogenicity studies, forensics, pharmacogenomics, and the like. The probe can be in suspension or immobilized on a substrate or support (for example, as in nucleic acid array or chips technologies). For example, a sample from the subject can be contacted with a nucleic acid probe specific for a nucleic acid encoding a FOXM1 polypeptide or a nucleic acid encoding CENPF polypeptide.

[0112] In certain embodiments, the expression profile can be used to a nucleic acid encoding a FOXM1 polypeptide or a nucleic acid encoding CENPF polypeptide infer changes in the expression of target genes implicated in disease wherein the expression of such target genes is upregulated or downregulated by FOXM1, CENPF, or by the concerted action of FOXM1 and CENPF. Example probes and primers useful for obtaining gene expression profiles in normal and malignant cells, and comparing the gene expression in malignant and corresponding normal cells are known in the art (Okabe et al., 2001; Kitahara et al., 2001; Lin et al., 2002; Hasegawa et al., 2002).

[0113] In certain embodiments, microarray-based detection and/or quantification of a nucleic acid encoding FOXM1 polypeptide and/or a nucleic acid encoding or a CENPF polypeptide can comprise steps of providing a biological sample from a person suspected of having a cancer (e.g. a malignant prostate cancer), and determining the level of expression of a nucleic acid encoding FOXM1 polypeptide and/or a nucleic acid encoding or a CENPF polypeptide in the cells of the biological sample. In particular, such embodiments of the methods described herein can comprises comprising the following steps: (a) contacting a cell sample nucleic acid with a microarray under conditions suitable for hybridization; (b) providing hybridization conditions suitable for hybrid formation between the cell sample nucleic acid and a polynucleotide of the microarray; (c) detecting the hybridization; and (d) diagnosing the disorder condition based on the results of detecting the hybridization.

[0114] For example, methods of purification of nucleic acids are described in Tijssen Laboratory Techniques in Biochemistry and Molecular Biology: Hybridization With Nucleic Acid Probes, Part I. Theory and Nucleic Acid Preparation, Elsevier, New York, 1993. In one case, total RNA is isolated using the TRIZOL reagent (Life Technologies, Gaithersburg Md.), and mRNA is isolated using oligo d (T) column chromatography or glass beads. Alternatively, when target polynucleotides are derived from an mRNA, the target polynucleotides can be a cDNA reverse transcribed from an mRNA, an RNA transcribed from that cDNA, a DNA amplified from that cDNA, an RNA transcribed from the amplified DNA, and the like. When the target polynucleotide is derived from DNA, the target polynucleotide can be DNA amplified from DNA or RNA reverse transcribed from DNA. In yet another alternative, the targets are target polynucleotides prepared by more than one method.

[0115] When target polynucleotides are amplified, it is desirable to amplify the nucleic acid sample and maintain the relative abundances of the original sample, including low abundance transcripts. Total mRNA can be amplified by reverse transcription using a reverse transcriptase and a primer consisting of oligo d(T) and a sequence encoding the phage T7 promoter to provide a single stranded DNA template. The second DNA strand is polymerized using a DNA polymerase and a RNAse which assists in breaking up the DNA/RNA hybrid. After synthesis of the double stranded DNA, T7 RNA polymerase can be added, and RNA transcribed from the second DNA strand template (Van Gelder et al. U.S. Pat. No. 5,545,522). RNA can be amplified in vitro, in situ or in vivo (see Eberwine, U.S. Pat. No. 5,514,545).

[0116] The sequence of the probes and primers suitable for use with hybridization or amplification based detection methods described herein can be derived from the sequences of a nucleic acid encoding a FOXM1 polypeptide or a CENPF polypeptide. According to the invention, a probe can be a polynucleotide sequence which is complementary to and specifically hybridizes with a, or a target portion of a nucleic acid encoding a FOXM1 polypeptide or a CENPF polypeptide, such as a DNA or RNA molecule encoding such polypeptides. Probes and primers suitable for use with the methods described herein include those that are complementary to a nucleic acid encoding a FOXM1 polypeptide or a CENPF polypeptide, can comprise single-stranded nucleic acids of between 8 to 1000 nucleotides in length, for instance between 10 and 800, between 15 and 700, or between 20 and 500. Exemplary probes and primers may be 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or more 100 nucleotides in length. In one embodiment, a useful probe or primers of the invention is a single stranded nucleic acid molecule of between 8 to 500 nucleotides in length, which can specifically hybridize to a region of a nucleic acid encoding a FOXM1 polypeptide or a CENPF polypeptide. Longer polynucleotides encoding 250, 500, or 1000 bases and longer are contemplated as well. Such oligonucleotides will find use, for example, as probes in Southern and Northern blots and as primers in amplification reactions.

[0117] Conditions can be selected for hybridization where an exactly complementary target and probes can hybridize, i.e., each base pair must interact with its complementary base pair. Alternatively, conditions can be selected where a target and probes have mismatches but are still able to hybridize. Suitable conditions can be selected, for example, by varying the concentrations of salt in the prehybridization, hybridization and wash solutions, by varying the hybridization and wash temperatures, or by varying the polarity of the prehybridization, hybridization or wash solutions.

[0118] Suitable hybridization conditions for the diagnostic methods are those conditions that allow the detection of gene expression from identifiable expression units such as genes. Exemplary stringent hybridization conditions include but are not limited to hybridization at 42.degree. C. in a solution (i.e., a hybridization solution) comprising 50% formamide, 1% SDS, 1 M NaCl, 10% dextran sulfate, and washing twice for 30 minutes at 60.degree. C. in a wash solution comprising 0.1.times.SSC and 1% SDS. Hybridization can be performed at low stringency with buffers, such as 6.times.SSPE with 0.005% Triton X-100 at 37.degree. C., which permits hybridization between target and probes that contain some mismatches to form target polynucleotide/probe complexes. Subsequent washes are performed at higher stringency with buffers, such as 0.5.times.SSPE with 0.005% Triton X-100 at 50.degree. C., to retain hybridization of only those target/probe complexes that contain exactly complementary sequences. Alternatively, hybridization can be performed with buffers, such as 5.times.SSC/0.2% SDS at 60.degree. C. and washes are performed in 2.times.SSC/0.2% SDS and then in 0.1.times.SSC. Background signals can be reduced by the use of detergent, such as sodium dodecyl sulfate, Sarcosyl or Triton X-100, or a blocking agent, such as salmon sperm DNA. It is understood in the art that conditions of stringency can be achieved through variation of temperature and buffer, or salt concentration, as described in Ausubel et al., eds., Protocols in Molecular Biology, John Wiley & Sons (1994), pp. 6.0.3 to 6.4.10. After hybridization, the microarray can be washed to remove nonhybridized nucleic acids, and complex formation between the hybridizable array elements and the target polynucleotides is detected. Modifications in hybridization conditions can be empirically determined or precisely calculated based on the length and the percentage of guanosine/cytosine (GC) base pairing of the probe. The hybridization conditions can be calculated as described in Sambrook et al., eds., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press: Cold Spring Harbor, N.Y. (1989), pp. 9.47 to 9.51.

[0119] Detection of hybridization can be achieved by labeling probes or target polynucleotides (e.g. a nucleic acid encoding a FOXM1 polypeptide or a nucleic acid encoding a CENPF polypeptide with one or more labeling moieties. In one embodiment, the target polynucleotides are labeled with a fluorescent label, and measurement of levels and patterns of fluorescence indicative of complex formation is accomplished by fluorescence microscopy (e.g. confocal fluorescence microscopy). The labeling moieties can include compositions that can be detected by spectroscopic, photochemical, biochemical, bioelectronic, immunochemical, electrical, optical or chemical means. The labeling moieties include radioisotopes, such as 3H, 14C, 32P, 33P or 35S, chemiluminescent compounds, labeled binding proteins, heavy metal atoms, spectroscopic markers, such as fluorescent markers and dyes, magnetic labels, linked enzymes, mass spectrometry tags, spin labels, electron transfer donors and acceptors, and the like. Exemplary dyes include quinoline dyes, triarylmethane dyes, phthaleins, azo dyes, cyanine dyes, and the like. Fluorescent markers that emit light at wavelengths at least greater than 10 nm above the wavelength of the light absorbed can be used in some embodiments. Exemplary fluorescent markers include, but are not limited to, fluorescein, phycoerythrin, rhodamine, lissamine, and C3 and C5 available from Amersham Pharmacia Biotech (Piscataway N.J.). Labeling can also be carried out during an amplification reaction, such as polymerase chain reactions and in vitro transcription reactions, or by nick translation or 5' or 3'-end-labeling reactions. When the label may be incorporated after or without an amplification step, the label is incorporated by using terminal transferase or by phosphorylating the 5' end of the target polynucleotide using, e.g., a kinase and then incubating overnight with a labeled oligonucleotide in the presence of T4 RNA ligase. Alternatively, the labeling moiety can be incorporated after hybridization once a probe/target complex has formed. Nucleotide substitutions can be performed, as well as chemical modifications of the probe. Such chemical modifications can be accomplished to increase the stability of hybrids (e.g., intercalating groups) or to label the probe. Some examples of labels include, without limitation, radioactivity, fluorescence, luminescence, and enzymatic labeling.

[0120] In embodiments where amplification used to detect the presence of a nucleic acid encoding a FOXM1 polypeptide or nucleic acid encoding a CENPF polypeptide, such methods can be based on the formation of specific hybrids between primers nucleic acid sequences having complete or partial complementarity to portions of a nucleic acid encoding a FOXM1 polypeptide or to portions of a nucleic acid encoding a CENPF polypeptide, wherein the primer sequences serve to initiate nucleic acid reproduction though, for example, PCR based methodologies. Numerous nucleic acid amplification techniques known in the art, including traditional polymerase chain reaction (PCR), quantitative PCR (qPCR), ligase chain reaction (LCR), strand displacement amplification (SDA) and nucleic acid sequence based amplification (NASBA). These techniques can be performed using commercially available reagents and protocols. Useful techniques in the art encompass real-time PCR, allele-specific PCR, or PCR-SSCP. Nucleic acid primers useful for amplifying a nucleic acid encoding a FOXM1 polypeptide or nucleic acid encoding a CENPF polypeptide include, but are not limited to primers that specifically hybridize with a DNA encoding a FOXM1 polypeptide or nucleic acid encoding a CENPF polypeptide, or an RNA encoding a FOXM1 polypeptide or nucleic acid encoding a CENPF polypeptide.

[0121] In some embodiments, the detection is performed by sequencing all or part of a nucleic acid encoding a FOXM1 polypeptide or a CENPF polypeptide or by selective hybridization or amplification of all or part of a nucleic acid encoding a FOXM1 polypeptide or a CENPF polypeptide. In one embodiment, the sample can comprise prostate tissue sample from a subject.

[0122] Thus, in certain aspects, the diagnostic methods described herein comprise the use of a nucleic acid primer, wherein the primer can be complementary to and hybridize specifically to a portion of a coding sequence (e.g., gene or RNA) of a nucleic acid encoding FOXM1 or CENPF present in a sample form a subject having or at risk of developing a cancer, such as a prostate cancer, or a malignant prostate cancer. Primers suitable for use with the methods described herein include those that are specific for a nucleic acid encoding FOXM1 or CENPF. By using such primers, the detection of an amplification product indicates the presence of a nucleic acid encoding FOXM1 or CENPF or the absence of such. The use of such primers can also be employed to quantify the relative or absolute amount of a nucleic acid encoding FOXM1 or CENPF in a sample.

[0123] Primers suitable for use with the methods described herein, include, but are not limited to those having the sequence of SEQ ID NOs: 5, 6, 19 and 20. In certain embodiments, amplification of a FOXM1 nucleic acid sequence can be performed using a primer pair of SEQ ID NO: 5 and 19. In certain embodiments, amplification of a CENPF nucleic acid sequence can be performed using a primer pair of SEQ ID NO: 6 and 20. One of skill in the art will readily be able to design and synthesize primers suitable for amplifying FOXM1 or CENPF nucleic acid sequences.

[0124] Examples of primers of this invention can be single-stranded nucleic acid molecules of about 5 to 100 nucleotides in length, or about 8 to about 25 nucleotides in length. Exemplary primers may be 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100 or more contiguous base pairs from the above sequences will be used, although others are contemplated. Primers suitable for use with the methods described herein can be labelled according to any method known in the art, including those described for use in labeling the probes and oligonucleotides suitable for use with the methods described herein. Labeling of primers can also be limited to labeling methods that do not interfere with the ability of the primer to be used for amplification purposes.

[0125] The sequence of a primer suitable for use with the methods described herein can be derived directly from a nucleic acid encoding FOXM1 or CENPF. Perfect complementarity is useful, to ensure high specificity. However, certain mismatch can be tolerated. For example, a nucleic acid primer or a pair of nucleic acid primers as described herein can be used in a method for detecting the presence of or a predisposition to prostate cancer in a subject.

[0126] Amplification methods include, e.g., polymerase chain reaction, PCR (PCR Protocols: A Guide to Methods and Applications, Innis, ed., Academic Press, N.Y., 1990 and PCR Strategies, Innis, ed., Academic Press, Inc., N.Y., 1995; ligase chain reaction (LCR) see, e.g., Wu and Wallace, 1989; Landegren et al., 1988; Barringer et al., 1990); transcription amplification (see, e.g., Kwoh et al., 1989); and self-sustained sequence replication (see, e.g., Guatelli et al., 1990); Q Beta replicase amplification (see, e.g., Smith et al., 1997), automated Q-beta replicase amplification assay (see, e.g., Burg et al., 1996) and other RNA polymerase mediated techniques (e.g., NASBA, Cangene, Mississauga, Ontario); see also Berger et al., 1987; Sambrook; Ausubel; U.S. Pat. Nos. 4,683,195 and 4,683,202; Sooknanan and Malek, 1995. All the references stated above are incorporated by reference in their entireties.

Methods for Determining Protein Expression

[0127] According to the methods described herein, the coexpression of FOXM1 and CENPF protein is defined as being elevated to a diagnostic level if the amount of FOXM1 polypeptide and CENPF polypeptide expressed or present in a sample exceeds a defined composite score threshold. For example, in certain embodiments, a sample can be deemed to have elevated expression of FOXM1 and CENPF by investigating immunochemical staining (e.g. immunochemical staining using antibodies specific to FOXM1 or CENPF) of a sample from a subject, determining the percentage of the sample that is stained and assigning a percent staining value for the sample between 0% and 100%, determining an intensity for the staining and assigning a staining intensity value for the sample on a scale of 0, 1, 2, or 3, and calculating a score by multiplying the percent staining value by the staining intensity value, wherein a score exceeding 100% indicates that the FOXM1 polypeptide and CENPF polypeptide present or expressed in the sample is at an elevated level. Thus, in certain aspects, the invention described herein related to the finding that a composite score based on (a) the percentage of a sample that is stained with immunochemical (e.g. an antibody, or a composition comprising an antibody), and (b) the intensity of the stain, can be used to diagnose a subject as having an aggressive or malignant prostate cancer, having a risk of dying from a prostate cancer, and having a risk of a prostate cancer undergoing metastasis. One of skill in the art will readily appreciate that the scoring scales described herein need not be limited to integers and may include fractional values. One of skill in the art will also understand that many variants of the composite scoring scale can be envisioned. For example, staining intensity can be ranked on a scale of 0 to 7 while retaining the fidelity of the method. Similarly, staining intensity can be ranked on a scale of 0 to 10 while retaining the fidelity of the system.

[0128] Detection of a polypeptide in accordance with the methods described herein can comprise detecting the presence of FOXM1 or CENPF polypeptide sequences in samples. In certain embodiments, detection of a polypeptide can comprise assaying for the presence of an elevated quantity FOXM1 or CENPF polypeptide in a subject prostate cancer sample as compared to a control (noncancerous or indolent cancer) sample. In certain embodiments, detection of a polypeptide can comprise detecting the subcellular localization of a quantity FOXM1 or CENPF polypeptide, and/or detection of colocalization of FOXM1 and CENPF polypeptide within a cell.

[0129] A variety of methods may be used to measure FOXM1 or CENPF protein levels including, but not limited to, immunologically based methods such as standard ELISA, immuno-polymerase chain reaction (immuno-PCR) (Sano et al., 1992), immunodetection amplified by T7 RNA polymerase (IDAT) (Zhang et al., 2001), radioimmunoassay, immunoblotting, etc. Other approaches include two-dimensional gel electrophoresis, mass spectrometry, and proximity ligation (Fredriksson et al., 2002).

[0130] In embodiments where detection of FOXM1 and CENPF is at the level of polypeptide expression, different types of ligands can be used, such as antibodies that specifically recognize FOXM1 or CENPF polypeptides. Thus, in certain embodiments where the methods described herein involve detection of a FOXM1 or a CENPF polypeptide, a test sample can be contacted with an antibody specific for a FOXM1 or a CENPF polypeptide and the formation of an immune complex can be subsequently determined to determine the presence or location of the polypeptide. Various methods for detecting an immune complex can be used, such as ELISA, radioimmunoassays (RIA) and immuno-enzymatic assays (IEMA).

[0131] Antibodies suitable for use with the methods described herein can be polyclonal antibodies, a monoclonal antibodies, as well as fragments or derivatives thereof having substantially the same antigen specificity. Fragments of antibodies that are suitable for use with the methods described herein include Fab, Fab'2, or CDR regions. Derivatives of antibodies that are suitable for use with the methods described herein include single-chain antibodies, humanized antibodies, or poly-functional antibodies. An antibody specific for a FOXM1 polypeptide or a CENPF polypeptide can be an antibody that selectively binds to FOXM1 or CENPF, namely, an antibody raised against FOXM1 or CENPF polypeptide or an epitope-containing fragment of either polypeptide. Although non-specific binding towards other antigens can occur, binding to the target polypeptide occurs with a higher affinity and can be reliably discriminated from non-specific binding. One of skill in the art will appreciate that many methods exist for labeling antibodies for microscopic detection in samples. Exemplary labeling methods include, but are not limited fluorescent labeling, radioactive labeling, and quantum dots.

[0132] The diagnostic methods described herein can be performed on any suitable sample which contains nucleic acids or polypeptides, including in vitro, ex vivo, or in vivo samples. Examples of samples suitable for use with the methods described herein include prostate tissue samples, especially samples of prostate tumor or cancerous prostate cells from tissue biopsies taken from a subject having prostate cancer or at risk of developing it. In one embodiment, the sample comprises a tumor tissue. In one embodiment, the sample comprises prostate tissue. In another embodiment, the sample is an isolated population of prostate stem cells. The sample can be collected according to conventional techniques and used directly for diagnosis or stored. The sample can be treated prior to performing the method, in order to render or improve availability of nucleic acids or polypeptides for testing. Treatments include, for instance, lysis (e.g., mechanical, physical, or chemical), and centrifugation. Also, the nucleic acids and/or polypeptides can be pre-purified or enriched by conventional techniques, and/or reduced in complexity. Nucleic acids and polypeptides can also be treated with enzymes or other chemical or physical treatments to produce fragments thereof. In one embodiment, the sample is contacted with reagents, such as probes, primers, or ligands, in order to assess the presence of FOXM1 or CENPF polypeptides or nucleic acids. Contacting can be performed in any suitable device, such as a plate, tube, well, or glass. In specific embodiments, the contacting is performed on a substrate coated with the reagent, such as a nucleic acid array or a specific ligand array. The substrate can be a solid or semi-solid substrate such as any support comprising glass, plastic, nylon, paper, metal, or polymers. The substrate can be of various forms and sizes, such as a slide, a membrane, a bead, a column, or a gel. The contacting can be made under any condition suitable for a complex to be formed between the reagent and the nucleic acids or polypeptides of the sample.

Diagnostic Kits

[0133] The invention also provides for diagnostic kits comprising products and reagents for detecting in a sample from a subject the presence of a FOXM1 or CENPF polypeptides or nucleic acids or FOXM1 or CENPF activity. The kits can be useful for determining whether a sample from a subject expresses significantly elevated levels of FOXM1 or CENF compared to the level expressed in normal prostate tissue. For example, the diagnostic kit according to the present invention comprises any primer, any pair of primers, any nucleic acid probe and/or any ligand, suitable for use with the methods described herein. The diagnostic kits according to the present invention can further comprise reagents and/or protocols for performing a hybridization, amplification or antigen-antibody immune reaction. In certain embodiments, the kits can comprise nucleic acid primers that specifically hybridize to and can prime a polymerase reaction from a nucleic acid encoding FOXM1 or a nucleic acid encoding CENPF. In some kits nucleic acids that specifically hybridize to a nucleic acid encoding FOXM1 or a nucleic acid encoding CENPF wherein in an embodiment the nucleic acid is affixed to a microarray support.

[0134] Some kits include anti-FOXM1 and/or anti-CENPF antibodies or fragments thereof, including monoclonal and polyclonal antibodies, and secondary antibodies that are labeled for easy detection for example with a fluorophore or horseradish peroxidase enzyme. The labeling moieties can include compositions that can be detected by spectroscopic, photochemical, biochemical, bioelectronic, immunochemical, electrical, optical or chemical means as described herein. For example, in certain embodiments, elevated nuclear colocalization of FOXM1 and CENPF can be microscopic immunofluorescent colocalization, wherein the extent of colocalization of FOXM1 and CENPF is determined using a Pearson colocalization co-efficient, a Spearman colocalization coefficient, or the like. In certain embodiments, an amount of nuclear colocalization yielding a Spearman colocalization coefficient P value of less than about 1.3.times.10-11 indicates that the sample is from a subject having a prostate cancer that has undergone, or is at risk of undergoing metastasis. In certain embodiments, an amount of nuclear colocalization yielding a Spearman colocalization coefficient P value of less than about 6.2.times.10-10 indicates that the sample is from a subject having a prostate cancer that has undergone, or is at risk of undergoing metastasis. In certain embodiments, an amount of nuclear colocalization yielding a Spearman colocalization coefficient P value of less than about 2.2.times.10-6 indicates that the sample is from a subject at risk of dying from a prostate cancer. In certain embodiments, an amount of nuclear colocalization yielding a Spearman colocalization coefficient P value of less than about 3.5.times.10-5 indicates that the sample is from a subject at risk of dying from a prostate cancer

4. EXAMPLES

4.1 Example 1

Experimental Procedures

[0135] Pilate perturbagen studies were performed to evaluate optimal dosage and scheduling. As an example, rapamycin treatment of NP mice involved treating mice for 1, 2, or 5 days and concentrations varied from 10, 25 and 50 mg/kg. Following treatment, expression profiling was done on prostate tumors to evaluate the dose and schedule that produced the optimal range of gene expression changes. The number of differentially expressed genes at different p-value thresholds (0.01 or 0.05) with or without a 1.5 fold change (FC) cut-off was determined. The perturbagen studies were used for assembly of the mouse prostate cancer interactome.

[0136] The primary gene expression profile dataset used for ARACNe-based reverse engineering was Taylor et al (GSE21034), which consists of primary human prostatectomy samples, adjacent normal tissue, and metastases arrayed on a Affymetrix human Exon 1.0 ST microarray platform (Taylor et al., 2010). Additional expression profile datasets used were: (i) Yu et al (GSE6919): primary human prostatectomy samples and adjacent normal tissue arrayed on a Affymetrix U95a, U95b and U95c microarray platforms; (ii) Wang et al (a) (GSE17951): primary human prostatectomy samples, prostate biopsies, and normal prostate arrayed on a Affymetrix U133Plus2.0 platform; (iii) Wang et al (b) (GSE8218): primary human prostatectomy samples and normal prostate on a Affymetrix U133A platform; and (iv) Balk (GSE32269): biopsies of primary tumors from subjects with hormone-naive prostate cancer and of bone marrow with confirmed tumor content from subjects with metastatic castration resistant prostate cancer (CRPC) on Affymetrix U133A platform. Available clinico-pathological information is provided in the table of FIG. 5.

[0137] For expression profiling analyses, prostate tumors were macrodissected, and the content of tumor/cellular atypia was verified by H&E analyses. Total RNA was isolated from prostate tissues/tumors using a MagMAX-96 total RNA isolation kit and biotin-labeled using the Illumina TotalPrep RNA Amplification Kit (Life Technologies). The resulting cRNA was hybridized on mouseWG-6 v2 BeadArrays (Illumina). Slides were scanned using an iScan (Illumina) and the resulting files were uploaded and background-corrected in BeadStudio 3.1.3.0 (Illumina, Inc.). Expression profiling data were normalized using standard variance stabilizing transformation (VST) and robust spline normalization (RSN) with lumiT and lumiN functions from lumi library, in R-system v2.14.0 (The R Foundation for Statistical Computing, ISBN 3-900051-07-0). The raw and normalized data files are deposited in Gene Expression Omnibus (GEO), accession number GSE53202

[0138] Immunostaining was performed as described in Irshad et al., 2013, Immunostaining for FOXM1 or CENPF was performed on adjacent sections of each TMA slide. For immunofluorescent staining on cells in culture, 1.times.10.sup.5 cells infected with the experimental or control shRNA were seeded in triplicate and grown in culture slides (BD Biosciences) for three days in the presence of 0.5 .mu.g/ml of doxycycline. Cells were washed with PBS, fixed in ice cold acetone and permeabilized in 0.25% Triton X-100 in PBS and stained with antibodies for FOXM1 and CENPF (see Table 2, below). Images of the cellular localization of FOXM1 and CENPF were obtained using a Leica TCS SP5 spectral confocal microscope. Protein levels were determined by percent of staining (i.e. from 0 to 100%) and intensity level of staining (i.e., 0, 1, 2, or 3) in each tumor sample. We defined a composite protein level by multiplying percent of staining and its intensity level for each tumor sample, for FOXM1 or CENPF. Composite protein level exceeding 100 were considered elevated.

[0139] Statistical analysis was performed with survcomp package using R v2.14.0. Cox proportional hazard model was estimated with the sury and coxph functions. Kaplan-Meier survival analysis was performed using surv, survfit, and survdiff functions. Concordance indexes (c-index) were estimated and compared using coxp and concordance.index (counting ties) and cindex.comp functions.

[0140] Predicting additive effects by extrapolating individual effects of silencing FOXM1 or CENPF was evaluated as follows. To quantitatively evaluate synergy versus additivity of the tumor growth rate, an estimate of an "additive" effect was projected using a log-linear regression model, which assumes that the silencing of either master regulator individually induces a fractional reduction in tumor growth from that of control mice. The difference between the projected "additive" model versus the actual observed consequence of co-silencing was calculated using a one sample t-test

[0141] MARINa was used to estimate the activity levels of FOXM1 and CENPF, based on their ARACNe-inferred transcriptional targets, for each sample (i.e., each subject) in the Sboner and Glinsky human prostate cancer datasets (FIG. 5) (Glinsky et al., 2004; Sboner et al., 2010). The activity was defined as elevated if activated targets were positively enriched in the sample signature (i.e., positive NES) and at the same time repressed targets were negatively enriched in the sample signature (i.e., negative NES) and these enrichment scores fell into the upper/lower 35% percentile of NES distribution. Subjects were then divided into four groups: (i) those with non-elevated inferred activity for FOXM1 and CENPF; (ii) those with elevated inferred activity only for FOXM1; (iii) those with elevated inferred activity only for CENPF; and (iv) those with elevated inferred activity for both FOXM1 and CENPF. For these and all subsequent analyses, association with disease outcome was evaluated using Kaplan-Meier survival analysis calculated along with the log-rank p value using Surv, survfit, and survdiff functions from survcomp package in R v 2.14.0.

[0142] Gene silencing of FOXM1 and CENPF as well as forced expression of FOXM1 were done using lentiviral shRNAs or expression vectors (Open Biosystems and CCSB Human ORFeome Library, respectively). Functional studies were done in four independent human cancer cell lines, which were obtained from ATCC. All experiments using animals were performed according to protocols approved by the Institutional Animal Care and Use Committee (IACUC) at Columbia University Medical Center.

[0143] Silencing was performed using the pTRIPZ lentiviral vector (Open Biosystems), which express an shRNAmir (microRNA-adapted shRNA, hereafter referred to as shRNA) and, for functional analysis, a tRFP fluorescent reporter under the control of a tetracycline responsive element (TRE) promoter such that expression of the shRNA can be induced by addition of doxycycline (0.5 .mu.g/ml). For two-color fluorescence analyses, which were used for selection of cells expressing two different shRNA, the pTRIPZ vector was engineered to express eGFP using the AgeI and ClaI sites to replace the tRFP cassette. Following induction with doxycycline, cells infected with the pTRIPZ-RFP virus are detected by RFP expression (red), those infected with the pTRIPZ-GFP virus by GFP expression (green), and those infected with both pTRIPZ-RFP/pTRIPZ-GFP virus by expression of both tRFP and the eGFP (yellow). The shRNAs used to silence FOXM1 and CENPF were purchased from Open Biosystems; sequences are provided in Table 1. Unless otherwise indicated, analyses were done using two alternative shRNA and co-silencing was done using each combination of the experimental or control shRNA lentivirus.

TABLE-US-00001 TABLE 1 Sequences of shRNA and Primers used for this study Purpose and Sequence name SEQ shRNA Clone ID ID Mature antisense FOXM1 shRNA#1 V3THS_283849 1 ATAATTAGAGGATAATTTG FOXM1 shRNA#2 V3THS_396941 2 TGATGGTCATGTTCCGGCG CENPF shRNA#1 V2THS_115502 3 ATCTGATTCACTCAGTCTG CENPF shRNA#2 V2THS_115504 4 TTTCTTCCAACAGTAACTG Scramble shRNA RHS4743 N/A SEQ SEQ ID Forward ID Reverse Real Time qPCR FOXM1 5 CGTCGGCCACTGATTCTCAAA 19 GGCAGGGGATCTCTTAGGTTC CENPF 6 CTCTCCCGTCAACAGCGTTC 20 GTTGTGCATATTCTTGGCTTGC BRCA1 7 GCTCGTGGAAGATTTCGGTGT 21 TCATCAATCACGGACGTATCATC BUB1 8 AAATGACCCTCTGGATGTTTGG 22 GCATAAACGCCCTAATTTAAGCC KI67 9 GGGCCAATCCTGTCGCTTAAT 23 GTTATGCGCTTGCGAACCT CYCLIN 10 CGCTGGCGGTACTGAAGTC 24 GAGGAACGGTGACATGCTCAT TIMELESS 11 TCTGATCCGCTATTTGAGGCA 25 GGCAGAAGGTCGCTCTGTAG CDC25 12 ACGCACCTATCCCTGTCTC 26 CTGGAAGCGTCTGATGGCAA TRIP13 13 ACTGTTGCACTTCACATTTTCC 27 TCGAGGAGATGGGATTTGACT PLK1 14 AAAGAGATCCCGGAGGTCCTA 28 GGCTGCGGTGAATGGATATTTC HMMR 15 ATGATGGCTAAGCAAGAAGGC 29 TTTCCCTTGAGACTCTTCGAGA MYBL2 16 CCGGAGCAGAGGGATAGCA 30 CAGTGCGGTTAGGGAAGTGG ACTIN 17 GTCTGCCTTGGTAGTGGATAATG 31 TCGAGGACGCCCTATCATGG GAPDH 18 TGTGGGCATCAATGGATTTGG 32 ACACCATGTATTCCGGGTCAAT ChIP FOXM1 33 CCGGAGCTTTCAGTTTGTTC 41 CGGAATGCCGAGACAAGG CENPF 34 CACCTCCAGTAGAGGGGCTTG 42 TACCTCCACGCCTATTGGTC AURKA 35 AGGACAAGGGCCTTCTTAGG 43 TAGTGGGTGGGGAGACAGAC AURKB 36 GGGGTCCAAGGCACTGCTAC 44 GGGGCGGGAGATTTGAAAAG BIRC5 37 CCATTAACCGCCAGATTTGA 45 TGTAGAGATGCGGTGGTCCT CDC25 38 AAGAGCCCATCAGTTCCGCTTG 46 CCCATTTTACAGACCTGGACGC PLK1 39 CCAGAGGGAGAAGATGTCCA 47 GTCGTTGTCCTCGAAAAAGC CYCLIN B2 40 TCCTTTGCCGAAAGCTAGAG 48 GCAACTGCCAATCTGAAAAAG

[0144] Lentiviral particles were made using the 2nd generation packaging vectors, psPAX2 and pMD2.G (Addgene) in HEK-293T cells (ATCC), and concentrated using the Lenti-X Concentrator reagent (Clonetech). Human prostate cancer cells used in this study were DU145, PC3, LNCaP, and 22Rv1 (ATCC). Following infection with the lentiviruses, cells were selected using 4 .mu.g/ml of puromycin for three days, following which shRNA expression was induced by addition of 0.5 .mu.g/ml of doxycycline. The optimal time-point for silencing was determined to be 72 h following induction and used for all analyses, unless otherwise indicated. For enrichment of shRNA-expression, single-cell suspensions of the induced cells were FACS sorted on a BD-FACSAria cell sorter (BD biosciences) using the FITC (emission wavelength 525 nm, GFP positive) and/or PE-A (627-702 nm emission wavelength, RFP positive) channels and cells having the 20% highest-level expression were collected and used for analyses. Silencing of FOXM1 and CENPF RNA and protein were confirmed by qPCR and western blot analyses, respectively. Sequences of primers used for real time PCR are provided above in Table 1; antibodies are described in Table 2, with antibodies for immunohistochemistry indicated by the initials IHC.

TABLE-US-00002 TABLE 2 Antibodies used in this study Description Source Type Dilution Use FOXM1 Abcam, Ab550066 Mouse 1:1000 Western (human) monoclonal blot, IF FOXM1 Abcam, Ab550066 Mouse 1:400 IHC (human) monoclonal CENPF Abcam, Ab5 Rabbit 1:200 Western (human) polyclonal blot, IF CENPF Abcam, Ab90 Mouse 1:400 IHC (human) monoclonal pAKT Cell Signaling #9271 Rabbit 1:1000 Western polyclonal blot pERK Cell Signaling #9101 Rabbit 1:500 Western polyclonal blot pS6 Cell Signaling #2211 Rabbit 1:1000 Western polyclonal blot Actin Cell Signaling 4970 Rabbit 1:2000 Western polyclonal blot PARP Cell Signaling #9542 Rabbit 1:1000 Western polyclonal blot V5 Invitrogen #R96025 Mouse 1:5000 Western monoclonal blot, ChIP V5 Sigma #A7345 Mouse 0.2 .mu.g IP monoclonal

[0145] Determining mRNA expression of FOXM1 or CENPF or both, total RNA was isolated from lentiviral-infected cells using TRIZOL and hybridized on Illumina Human HT-12 v4 Expression BeadChip Arrays. Hybridization and expression data processing were done as described above. Differential gene expression analysis was estimated with student t-test using p<0.05 as significant.

4.2 Example 2

Method of Discovery

Gene Profiling

[0146] The t-Distributed Stochastic Neighbor Embedding (t-SNE) is a machine learning algorithm for dimensionality reduction. It is a nonlinear dimensionality reduction technique that is particularly well suited for embedding high-dimensional data into a space of two or three dimensions, which can then be visualized in a scatter plot. Specifically, it models each high-dimensional object by a two- or three-dimensional point in such a way that similar objects are modeled by nearby points and dissimilar objects are modeled by distant points. In the illustrated embodiment, the gene expression data is reduced to the two dimensions V1 and V2. The gene expression data was divided into 6 classes associated with normal cells adjacent to a tumor (AdjN), four Gleason scores (G6, G7, G8, and G9 or more), and metastasized (met). This analysis was done to evaluate the relative heterogeneity of human and mouse datasets used to assemble the prostate cancer interactomes. FIG. 1A depicts t-SNE analysis of the Taylor dataset relative to Gleason score. Each point is the two dimensional representation of the relative expression of many genes. The 26,445 genes are considered in the t-SNE analysis. Each point is the two dimensional representation of the similarity and divergence between the data sample (i.e., gene expression profile) and all other data samples.

Interactomes

[0147] Regulatory networks (interactomes) for human and mouse prostate cancer were generated using the Algorithm for the Reconstruction of Accurate Cellular Networks (ARACNe) (Basso et al., 2005; Margolin et al., 2006b).

ARACNe is an unbiased algorithm that infers transcriptional interactions by computing the mutual information between each transcriptional regulator (transcription factors and co-factors) and its potential targets, and then by removing indirect interactions using the Data Processing Inequality (DPI). For optimal analysis, ARACNe requires large datasets of gene expression profiles (.gtoreq.100) having significant endogenous (i.e., genetic) and/or exogenous (i.e., perturbation-induced) heterogeneity. Thus ARACNe analysis was performed on the Taylor data set.

[0148] ARACNe was run independently on the human and mouse datasets using a conservative mutual information threshold (p.ltoreq.1.0.times.10.sup.-9, e.g., p.ltoreq.0.05, Bonferroni corrected for all candidate interactions). This resulted in highly robust regulatory networks in which the human interactome represented 249,896 interactions between 2,681 transcriptional regulators and their inferred target genes, while the mouse interactome represented 222,787 interactions for 2,072 transcriptional regulators.

[0149] FIG. 2A is a block diagram and graph that illustrates example interactomes for human and mouse models with prostate cancer, according to an embodiment. ARACNE sub-networks from the human and the mouse prostate cancer interactomes highlight selected conserved transcriptional regulators. The scaled size of the transcriptional regulator nodes (filled circles) indicates the level of conservation while the relative distance between them approximates the strength of their association.

[0150] The suitability of these mouse and human interactomes for cross-species interrogation was next evaluated by developing a novel computational approach to assess the global conservation of their transcriptional programs.

[0151] A quantitative metric was developed to compare conservation of the human and mouse interactomes. In particular, a modification of the MARINa algorithm was developed that allows for single-sample analysis to infer the differential activity of 2028 transcriptional regulators represented in both interactomes on a sample-by-sample basis, from the expression of their interactome-specific targets. The analysis was performed on 1009 expression profiles representing 4 human datasets listed in the Table of FIG. 5, as well as across the mouse datasets, to determine whether the activity of each regulator, inferred either from the expression of its human interactome targets or its murine interactome targets, was significantly correlated (p.ltoreq.0.05), indicating that the murine and human regulatory programs were therefore conserved. The accuracy of this metric was demonstrated by comparing two equivalent same-species interactomes from the human and mouse datasets (i.e., positive control), in which virtually all transcriptional regulators were conserved (>90%), contrasting with randomized interactomes (i.e., negative control) that had virtually no conservation. Histogram (density plots) showed the distribution of the correlation coefficients of activity profiles of transcriptional regulators for randomized interactomes (negative control) and the positive control interactomes for human and mouse. The degree of correlations was measured by the Z-score, and the Spearman correlation coefficient. The Z-score, also called the standard score, is the (signed) number of standard deviations an observation or datum is above the mean; and, is useful in comparing different populations. The Spearman's rank correlation coefficient, also called Spearman's rho, is a nonparametric measure of statistical dependence between two variables. It assesses how well the relationship between two variables can be described using a monotonic function. If there are no repeated data values, a perfect Spearman correlation of +1 or -1 occurs when each of the variables is a perfect monotone function of the other.

[0152] Using these metrics, it was found that 70% of the transcriptional regulators in the human and mouse prostate cancer interactomes regulate statistically conserved programs (p.ltoreq.0.05). FIG. 2B is a graph that illustrates example percentage of the interactomes that are conserved between human and mouse models with prostate cancer, according to an embodiment. This histogram shows the distribution of the Z-scores for conservation of activity profiles between the human and mouse interactomes at p.ltoreq.0.05. Comparison of the androgen receptor (AR) activity levels in each sample from Taylor et al and the mouse dataset was performed using the Spearman correlation coefficient.

[0153] Notably, conserved transcriptional regulators included many genes known to play important roles in prostate cancer, such as AR, ETS1, ETV4, ETV5, STAT3, MYC, BRCA1, and NKX3.1. In particular, AR displayed extensive correlation of its transcriptional activity between the human and mouse interactomes, consistent with its known role as a key regulator of prostate development and prostate tumorigenesis.

Master Regulators

[0154] The Master Regulator Inference algorithm (MARINa) (Carro et al., 2010; Lefebvre et al., 2010) was then used to infer candidate master regulators (MRs) that act individually or synergistically to drive malignant prostate cancer in the conserved interactomes. MARINa estimates differential activity (DA) based on enrichment (differential expression, DE) of their activated and repressed targets in the malignancy signature. More specifically, MARINa identified candidate MRs based on the concerted differential expression of their ARACNe-inferred targets (i.e., their differential activity, DA). Specifically, "activated" MRs have positively-regulated and repressed targets significantly enriched among upregulated and downregulated genes, respectively, while "repressed" MRs have the converse.

[0155] To interrogate the human prostate cancer interactome, a gene signature was used representing prostate cancer malignancy from the Taylor dataset, which compares aggressive prostate tumors (Gleason score .gtoreq.8 with rapid biochemical recurrence; sample size n=10) versus indolent ones (Gleason score 6 tumors with no biochemical recurrence; sample size n=39). These analyses identified 175 candidate MRs, including 49 activated and 126 repressed (p.ltoreq.0.05).

[0156] To investigate the robustness of these MRs, MARINa was performed using a second, independent malignancy signature from the Balk dataset (see the table of FIG. 5), which compares lethal CRPC (sample size n=29) with indolent, hormone-naive prostate cancer (sample size n=22). These independent MR analyses significantly overlapped with those identified from the Taylor malignancy signature (36 MRs in common; Fisher exact test p<0.0001). The Fisher exact test was used to compare two populations with the same number of members and determine the probability p that deviations from the null hypothesis, here that the two distributions are the same could be explained by random events. Furthermore, MARINa analyses of 15 independent interactomes using the Taylor human prostate cancer malignancy signature showed that the inferred MRs were highly overlapping with those inferred from two additional independent prostate cancer interactomes (p<7.times.10.sup.9 and p<8.times.10.sup.-20, Fisher exact test) but not with MRs inferred from non-prostate cancer specific interactomes (13 orders of magnitude different in significance). Thus, inference of master regulators of human prostate cancer malignancy required a prostate cancer-specific interactome but was independent of the specific dataset used for its interrogation.

[0157] To identify a corresponding mouse malignancy signature, MARINa was performed on four independent GEMM signatures, which are associated with prostate cancer malignancy and represent the diverse range of prostate cancer phenotypes represented among the GEMMs, including the NPK, NPB, NP, NP-AI, Myc, and NP53 mouse models. Meta-analyses of independent MR lists from these four independent GEMM signatures led to the identification of 229 candidate mouse MRs, including 110 activated and 119 repressed MRs (p.ltoreq.0.001).

Conserved MRs were More Likely to be Associated with Disease Outcome than the Non-Conserved Ones

[0158] The resulting independent lists of human and mouse MRs were then integrated to produce a ranked list of 20 conserved MRs, including 7 activated and 13 repressed (joint p-value: p.ltoreq.0.0074 by Stouffer's method). FIG. 3A is a Venn diagram and table that illustrates example selection of a subset of master regulators from a full set determined by available automated computer processes, according to an embodiment. Notably, these conserved MRs were more likely to be associated with disease outcome than the non-conserved ones, as assessed by a univariate COX proportional hazard regression model (43% versus 21%; p.ltoreq.0.05), and were also more likely to be differentially expressed in aggressive prostate tumors (metastatic versus non-metastatic; 100% versus 60%).

[0159] Subsequent analysis focused on the subset of activated conserved MRs, each of which has been associated with cancer-related biological processes: CHAF1A (chromatin activity); TRIB3 (regulation of cell signaling in transcriptional control); FOXM1 (cell cycle progression); CENPF (mitosis); PSRC1 (growth control); TSFM (translational elongation); and ASF1B (regulation of nucleosome assembly). FIG. 3B is a diagram that illustrates example ranking of activated master regulators for their impacts on prostate cancer, according to an embodiment. Conserved activated MRs are shown for the human (left) and mouse (right) malignancy signatures, depicting the different positive (activated; upper bars) and negative (repressed; lower bars) targets. The ranks of differential activity (DA) and differential expression (DE) are shown by the shaded boxes; the numbers indicate the rank of the DE in the signature. Differential expression is defined by comparing expression levels of a gene between two groups of samples (here, aggressive and indolent prostate cancer samples) using the t-test. Genes ranked (i.e., sorted from the most over-expressed to the most under-expressed) by their differential expression define a signature. For example, 411 represents a higher position in the signature and thus a stronger differential expression, compared to 13323.

[0160] FIG. 3C is a table that illustrates example ranking of master regulators for their impact on prostate cancer by various available algorithms, according to an embodiment. In this summary of conserved MRs are shown: joint p-value from human and mouse MARINa analysis, calculated using Stouffer's method; p-value for COX proportional hazard regression model applied to mRNA expression levels and predicted MR activity; and average p-values for differential expression of MRs in metastatic versus non-metastatic primary tumors. Smaller p values means that the deviations from the null hypothesis, that the regulator is not important, are less likely due to chance and thus the corresponding regulator is more significant contributors. FOXM1 and CENPF are significant (p<0.05) for all measures.

Synergistic Master Regulators FOXM1 and CENPF are Differentially Expressed in Aggressive Prostate Tumors

[0161] These MRs were further prioritized by computationally evaluating their potential synergistic interactions. By these criteria, any pair of MRs was considered "synergistic" if their co-regulated ARACNe-inferred targets were significantly more enriched in the malignancy signature than their individual targets (p.ltoreq.0.001) (Carro et al., 2010; Lefebvre et al., 2010). Using this computational approach to analyze all 21 possible pairs among the conserved activated MRs, the only pair that was found to be statistically significant was FOXM1 and CENPF.

[0162] FIG. 4 is a table that illustrates example predicted synergy of FOXM1 and CENPF among other pairs in the subset of master regulators using available algorithms, according to an embodiment. Shown are synergy p-values (i.e., enrichment of shared versus non-shared targets in the malignancy signature) for conserved MRs, inferred by MARINa. Clearly, the synergy of FOXM1 and CENPF is least likely to be random (p<0.001), and thus most significant.

5. ALTERNATIVES AND EXTENSIONS

[0163] In the foregoing specification, the invention has been described with reference to specific embodiments thereof. It will, however, be evident that various modifications and changes may be made thereto without departing from the broader spirit and scope of the invention. The specification and drawings are, accordingly, to be regarded in an illustrative rather than a restrictive sense. Throughout this specification and the claims, unless the context requires otherwise, the word "comprise" and its variations, such as "comprises" and "comprising," will be understood to imply the inclusion of a stated item, element or step or group of items, elements or steps but not the exclusion of any other item, element or step or group of items, elements or steps. Furthermore, the indefinite article "a" or "an" is meant to indicate one or more of the item, element or step modified by the article.

6. REFERENCES

[0164] Reference to the following publications can be found herein.

[0165] Akavia, U. D., Litvin, O., Kim, J., Sanchez-Garcia, F., Kotliar, D., Causton, H. C., Pochanard, P., Mozes, E., Garraway, L. A., and Pe'er, D. (2010). An integrated approach to uncover drivers of cancer. Cell 143, 1005-1017.

[0166] Alvarez-Fernandez, M., and Medema, R. H. (2013). Novel functions of FoxM1: from molecular mechanisms to cancer therapy. Frontiers in oncology 3, 30.

[0167] Aytes, A., Mitrofanova, A., Kinkade, C. W., Lefebvre, C., Lei, M., Phelan, V., LeKaye, H. C., Koutcher, J. A., Cardiff, R. D., and Califano, A. (2013). ETV4 promotes metastasis in response to activation of PI3-kinase and Ras signaling in a mouse model of advanced prostate cancer. Proc Natl Acad Sci USA 110, E3506-3515.

[0168] Baca, S. C., Prandi, D., Lawrence, M. S., Mosquera, J. M., Romanel, A., Drier, Y., Park, K., Kitabayashi, N., MacDonald, T. Y., and Ghandi, M. (2013). Punctuated evolution of prostate cancer genomes. Cell 153, 666-677.

[0169] Barringer, K., Orgel, L., Wahl, G., and Gingeras, T. R. (1990). Blunt-end and single-strand ligations by Escherichia coli ligase: influence on an in vitro amplication scheme. Gene 89:117-122.

[0170] Basso, K., Margolin, A. A., Stolovitzky, G., Klein, U., Dalla-Favera, R., and Califano, A. (2005). Reverse engineering of regulatory networks in human B cells. Nat Genet 37, 382-390.

[0171] Berger, S., Kimmel, A., Abelson, J., and Simon, M. (1987). Methods in Enzymology 152:307-316.

[0172] Bomont, P., Maddox, P., Shah, J. V., Desai, A. B., and Cleveland, D. W. (2005). Unstable microtubule capture at kinetochores depleted of the centromere-associated protein CENP-F. EMBO J 24, 3927-3939.

[0173] Burg, L. J., Juffras, A. M., Wu, Y., Blomquist, C. L., and Du, Y. (1996). Single molecule detection of RNA reporter probes by amplification with Q.beta. replicase. Mol. Cell. Probes 10:257-271.

[0174] Cai, Y., Balli, D., Ustiyan, V., Fulford, L. A., Hiller, A., Misetic, V., Zhang, Y., Paluch, A. M., Waltz, S. E., Kasper, S., and Kahn, T. V. (2013). Foxml Expression in Prostate Epithelial Cells is Essential for Prostate Carcinogenesis. J Biol Chem 288, 22527-22541.

[0175] Carro, M. S., Lim, W. K., Alvarez, M. J., Bollo, R. J., Zhao, X., Snyder, E. Y., Sulman, E. P., Anne, S. L., Doetsch, F., and Colman, H. (2010). The transcriptional network for mesenchymal transformation of brain tumours. Nature 463, 318-325.

[0176] Donovan, M. J., Hamann, S., Clayton, M., Khan, F. M., Sapir, M., Bayer-Zubek, V., Fernandez, G., Mesa-Tejada, R., Teverovskiy, M., and Reuter, V. E. (2008). Systems pathology approach for the prediction of prostate cancer progression after radical prostatectomy. J Clin Oncol 26, 3923-3929.

[0177] Faith, J. J., Hayete, B., Thaden, J. T., Mogno, I., Wierzbowski, J., Cottarel, G., Kasif, S., Collins, J. J., and Gardner, T. S. (2007). Large-scale mapping and validation of Escherichia coli transcriptional regulation from a compendium of expression profiles. PLoS Biol 5, e8.

[0178] Feng, J., Huang, H., and Yen, T. J. (2006). CENP-F is a novel microtubule-binding protein that is essential for kinetochore attachments and affects the duration of the mitotic checkpoint delay. Chromosoma 115, 320-329.

[0179] Fredriksson, S., Gullberg, M., Jarvius, J., Olsson, C., Pietras, K., Gustafsdottir, S. M., Ostman, A., and Landegren, U. (2002). Protein detection using proximity-dependent DNA ligation assays. Nat. Biotechnol. 20, 473-477.

[0180] Glinsky, G. V., Glinskii, A. B., Stephenson, A. J., Hoffman, R. M., and Gerald, W. L. (2004). Gene expression profiling predicts clinical outcome of prostate cancer. J Clin Invest 113, 913-923.

[0181] Guatelli, J. C., Whitfield, K. M., Kwoh, D. Y., Barringer, K. J., Richman, D. D., and Gingeras, T. R. (1990). Isothermal, in vitro amplification of nucleic acids by a multienzyme reaction modeled after retroviral replication. Proc. Natl. Acad. Sci. USA 87:1874-78.

[0182] Halasi, M., and Gartel, A. L. (2013a). FOX(M1) news--it is cancer. Mol Cancer Ther 12, 245-254.

[0183] Halasi, M., and Gartel, A. L. (2013b). Targeting FOXM1 in cancer. Biochemical pharmacology 85, 644-652.

[0184] Hanahan, D., and Weinberg, R. A. (2011). Hallmarks of cancer: the next generation. Cell 144, 646-67.

[0185] Hasegawa, S., Furukawa, Y., Li, M., Satoh, S., Kato, T., Watanabe, T., Katagiri, T., Tsunoda, T., Yamaoka, Y., and Nakamura, Y. (2002). Genome-Wide Analysis of Gene Expression in Intestinal-Type Gastric Cancers Using a Complementary DNA Microarray Representing 23,040 Genes. Cancer Res 62:7012-7.

[0186] Holt, S. V., Vergnolle, M. A., Hussein, D., Wozniak, M. J., Allan, V. J., and Taylor, S. S. (2005). Silencing Cenp-F weakens centromeric cohesion, prevents chromosome alignment and activates the spindle checkpoint. J Cell Sci 118, 4889-4900.

[0187] Irshad, S., and Abate-Shen, C. (2013). Modeling prostate cancer in mice: something old, something new, something premalignant, something metastatic. Cancer metastasis reviews 32, 109-122.

[0188] Ittmann, M., Huang, J., Radaelli, E., Martin, P., Signoretti, S., Sullivan, R., Simons, B. W., Ward, J. M., Robinson, B. D., and Chu, G. C. (2013). Animal models of human prostate cancer: the consensus report of the New York meeting of the Mouse Models of Human Cancers Consortium Prostate Pathology Committee. Cancer Res 73, 2718-2736.

[0189] Jones, A. C., Sampson, J. R., Hoogendoorn, B., Cohen, D., and Cheadle, J. P. (2000). Application and evaluation of denaturing HPLC for molecular genetic analysis in tuberous sclerosis. Hum Genet., 106(6):663-8.

[0190] Kalin, T. V., Ustiyan, V., and Kalinichenko, V. V. (2011). Multiple faces of FoxM1 transcription factor: lessons from transgenic mouse models. Cell Cycle 10, 396-405.

[0191] Kalin, T. V., Wang, I. C., Ackerson, T. J., Major, M. L., Detrisac, C. J., Kalinichenko, V. V., Lyubimov, A., and Costa, R. H. (2006). Increased levels of the FoxM1 transcription factor accelerate development and progression of prostate carcinomas in both TRAMP and LADY transgenic mice. Cancer Res 66, 1712-1720.

[0192] Kitahara, O., Furukawa, Y., Tanaka, T., Kihara, C., Ono, K., Yanagawa, R., Nita, M., Takagi, T., Nakamura, Y., and Tsunoda, T. (2001). Alterations of Gene Expression during Colorectal Carcinogenesis Revealed by cDNA Microarrays after Laser-Capture Microdissection of Tumor Tissues and Normal Epithelia. Cancer Res 61: 3544-9.

[0193] Koo, C. Y., Muir, K. W., and Lam, E. W. (2012). FOXM1: From cancer initiation to progression and treatment. Biochim Biophys Acta 1819, 28-37.

[0194] Kwoh, D. Y., Davis, G. R., Whitfield, K. M., Chappelle, H. L., DiMichele, L. J., and Gingeras, T. R. (1989). Proc. Natl. Acad. Sci. USA 86:1173-77.

[0195] Landegren, U., Kaiser, R., Sanders, J., and Hood, L. (1988). A ligase-mediated gene detection technique. Science 241:1077-80.

[0196] Lefebvre, C., Rajbhandari, P., Alvarez, M. J., Bandaru, P., Lim, W. K., Sato, M., Wang, K., Sumazin, P., Kustagi, M., and Bisikirska, B. C. (2010). A human B-cell interactome identifies MYB and FOXM1 as master regulators of proliferation in germinal centers. Mol Syst Biol 6, 377.

[0197] Lefebvre, C., Rieckhof, G., and Califano, A. (2012). Reverse-engineering human regulatory networks. Wiley interdisciplinary reviews Systems biology and medicine 4, 311-325.

[0198] Lin, Y-M., Furukawa, Y., Tsunoda, T., Yue, C.-T., Yang, K.-C., and Nakamura, Y. (2002). Molecular diagnosis of colorectal tumors by expression profiles of 50 genes expressed differentially in adenomas and carcinomas. Oncogene 21:4120-8.

[0199] Ma, L., Zhao, X., and Zhu, X. (2006). Mitosin/CENP-F in mitosis, transcriptional control, and differentiation. Journal of biomedical science 13, 205-213.

[0200] Margolin, A. A., Nemenman, I., Basso, K., Wiggins, C., Stolovitzky, G., Dalla Favera, R., and Califano, A. (2006a). ARACNE: an algorithm for the reconstruction of gene regulatory networks in a mammalian cellular context. BMC Bioinformatics 7 Suppl 1, S7.

[0201] Margolin, A. A., Wang, K., Lim, W. K., Kustagi, M., Nemenman, I., and Califano, A. (2006b). Reverse engineering cellular networks. Nat Protoc 1, 662-671.

[0202] Okabe, H., Satoh, S., Kato, T., Kitahara, O., Yanagawa, R., Yamaoka, Y., Tsunoda, T., Furukawa, Y., and Nakamura, Y. (2001). Genome-wide Analysis of Gene Expression in Human Hepatocellular Carcinomas Using cDNA Microarray: Identification of Genes Involved in Viral Carcinogenesis and Tumor Progression. Cancer Res 61:2129-37.

[0203] Pan, J., and Yeung, S. C. (2005). Recent advances in understanding the antineoplastic mechanisms of farnesyltransferase inhibitors. Cancer Res 65, 9109-9112.

[0204] Radhakrishnan, S. K., Bhat, U. G., Hughes, D. E., Wang, I. C., Costa, R. H., and Gartel, A. L. (2006). Identification of a chemical inhibitor of the oncogenic transcription factor forkhead box M1. Cancer Res 66, 9731-9735.

[0205] Ryan, C. J., and Tindall, D. J. (2011). Androgen receptor rediscovered: the new biology and targeting the androgen receptor therapeutically. J Clin Oncol 29, 3651-3658.

[0206] Sano, T., Smith, C. L., and Cantor, C. R. (1992). Immuno-PCR: Very sensitive antigen detection by means of specific antibody-DNA conjugates. Science 258, 120-122.

[0207] Sboner, A., Demichelis, F., Calza, S., Pawitan, Y., Setlur, S. R., Hoshida, Y., Perner, S., Adami, H. O., Fall, K., and Mucci, L. A. (2010). Molecular sampling of prostate cancer: a dilemma for predicting disease progression. BMC Med Genomics 3, 8.

[0208] Scher, H. I., and Sawyers, C. L. (2005). Biology of progressive, castration-resistant prostate cancer: directed therapies targeting the androgen-receptor signaling axis. J Clin Oncol 23, 8253-8261.

[0209] Schoenborn, J. R., Nelson, P., and Fang, M. (2013). Genomic profiling defines subtypes of prostate cancer with the potential for therapeutic stratification. Clin Cancer Res 19, 4058-4066.

[0210] Shah, R. B., Mehra, R., Chinnaiyan, A. M., Shen, R., Ghosh, D., Zhou, M., Macvicar, G. R., Varambally, S., Harwood, J., and Bismar, T. A. (2004). Androgen-independent prostate cancer is a heterogeneous group of diseases: lessons from a rapid autopsy program. Cancer Res 64, 9209-9216.

[0211] Shen, M. M., and Abate-Shen, C. (2010). Molecular genetics of prostate cancer: new prospects for old challenges. Genes Dev 24, 1967-2000.

[0212] Smith, J. H., Radcliffe, D., Rigmy, S., Mahan, D., Lane, D. J., and Klinger, J. D. (1997). Performance of an automated Q-beta replicase amplification assay for Mycobacterium tuberculosis in a clinical trial. Clin. Microbiol. 35:1477-1491.

[0213] Sooknanan, R., and Malek, L. T. (1995). A detection and amplification system uniquely suited for RNA. Nature Biotechnology 13:563-564.

[0214] Taylor, B. S., Schultz, N., Hieronymus, H., Gopalan, A., Xiao, Y., Carver, B. S., Arora, V. K., Kaushik, P., Cerami, E., and Reva, B. (2010). Integrative genomic profiling of human prostate cancer. Cancer Cell 18, 11-22.

[0215] Varis, A., Salmela, A. L., and Kallio, M. J. (2006). Cenp-F (mitosin) is more than a mitotic marker. Chromosoma 115, 288-295.

[0216] Wu, D. Y., and Wallace, R. B. (1989). The ligation amplification reaction (LAR)--amplification of specific DNA sequences using sequential rounds of template-dependent ligation. Genomics 4:560-569.

[0217] Zhang, H. T., Kacharmina, J. E., Miyashiro, K., Greene, M. I., and Eberwine, J. (2001). Protein quantification from complex protein mixtures using a proteomics methodology with single-cell resolution. J. Proc. Natl. Acad. Sci. USA 98, 5497-5502.

[0218] Zhang, N., Wei, P., Gong, A., Chiu, W. T., Lee, H. T., Colman, H., Huang, H., Xue, J., Liu, M., and Wang, Y. (2011). FoxM1 promotes beta-catenin nuclear localization and controls Wnt target-gene expression and glioma tumorigenesis. Cancer Cell 20, 427-442.

[0219] Zhang, Q. C., Petrey, D., Deng, L., Qiang, L., Shi, Y., Thu, C. A., Bisikirska, B., Lefebvre, C., Accili, D., and Hunter, T. (2012). Structure-based prediction of protein-protein interactions on a genome-wide scale. Nature 490, 556-560.

Sequence CWU 1

1

56119DNAArtificial SequenceSynthetic FOXM1 shRNA#1 1ataattagag gataatttg 19219DNAArtificial SequenceSynthetic FOXM1 shRNA#2 2tgatggtcat gttccggcg 19319DNAArtificial SequenceSynthetic CENPFshRNA#1 3atctgattca ctcagtctg 19419DNAArtificial SequenceSynthetic CENPF shRNA#2 4tttcttccaa cagtaactg 19521DNAArtificial SequenceSynthetic FOXM1 forward primer 5cgtcggccac tgattctcaa a 21620DNAArtificial SequenceSynthetic CENPF forward primer 6ctctcccgtc aacagcgttc 20721DNAArtificial SequenceSynthetic BRCA1 forward primer 7gctcgtggaa gatttcggtg t 21822DNAArtificial SequenceSynthetic BUB1 forward primer 8aaatgaccct ctggatgttt gg 22921DNAArtificial SequenceSynthetic KI67 forward primer 9gggccaatcc tgtcgcttaa t 211019DNAArtificial SequenceSynthetic CYCLIN A2 forward primer 10cgctggcggt actgaagtc 191121DNAArtificial SequenceSynthetic TIMELESS forward primer 11tctgatccgc tatttgaggc a 211219DNAArtificial SequenceSynthetic CDC25 forward primer 12acgcacctat ccctgtctc 191322DNAArtificial SequenceSynthetic TRIP13 forward primer 13actgttgcac ttcacatttt cc 221421DNAArtificial SequenceSynthetic PLK1 forward primer 14aaagagatcc cggaggtcct a 211521DNAArtificial SequenceSynthetic HMMR forward primer 15atgatggcta agcaagaagg c 211619DNAArtificial SequenceSynthetic MYBL2 forward primer 16ccggagcaga gggatagca 191723DNAArtificial SequenceSynthetic ACTIN forward primer 17gtctgccttg gtagtggata atg 231821DNAArtificial SequenceSynthetic GAPDH forward primer 18tgtgggcatc aatggatttg g 211921DNAArtificial SequenceSynthetic FOXM1 reverse primer 19ggcaggggat ctcttaggtt c 212022DNAArtificial SequenceSynthetic CENPF reverse primer 20gttgtgcata ttcttggctt gc 222123DNAArtificial SequenceSynthetic BRCA1 reverse primer 21tcatcaatca cggacgtatc atc 232223DNAArtificial SequenceSynthetic BUB1 reverse primer 22gcataaacgc cctaatttaa gcc 232319DNAArtificial SequenceSynthetic KI67 reverse primer 23gttatgcgct tgcgaacct 192421DNAArtificial SequenceSynthetic CYCLIN A2 reverse primer 24gaggaacggt gacatgctca t 212520DNAArtificial SequenceSynthetic TIMELESS reverse primer 25ggcagaaggt cgctctgtag 202620DNAArtificial SequenceSynthetic CDC25 reverse primer 26ctggaagcgt ctgatggcaa 202721DNAArtificial SequenceSynthetic TRIP13 reverse primer 27tcgaggagat gggatttgac t 212822DNAArtificial SequenceSynthetic PLK1 reverse primer 28ggctgcggtg aatggatatt tc 222922DNAArtificial SequenceSynthetic HMMR reverse primer 29tttcccttga gactcttcga ga 223020DNAArtificial SequenceSynthetic MYBL2 reverse primer 30cagtgcggtt agggaagtgg 203120DNAArtificial SequenceSynthetic ACTIN reverse primer 31tcgaggacgc cctatcatgg 203222DNAArtificial SequenceSynthetic GAPDH reverse primer 32acaccatgta ttccgggtca at 223320DNAArtificial SequenceSynthetic FOXM1 forward primer 33ccggagcttt cagtttgttc 203421DNAArtificial SequenceSynthetic CENPF forward primer 34cacctccagt agaggggctt g 213520DNAArtificial SequenceSynthetic AURKA forward primer 35aggacaaggg ccttcttagg 203620DNAArtificial SequenceSynthetic AURKB forward primer 36ggggtccaag gcactgctac 203720DNAArtificial SequenceSynthetic BIRC5 forward primer 37ccattaaccg ccagatttga 203822DNAArtificial SequenceSynthetic CDC25 forward primer 38aagagcccat cagttccgct tg 223920DNAArtificial SequenceSynthetic PLK1 forward primer 39ccagagggag aagatgtcca 204020DNAArtificial SequenceSynthetic CYCLIN B2 forward primer 40tcctttgccg aaagctagag 204118DNAArtificial SequenceSynthetic FOXM1 reverse primer 41cggaatgccg agacaagg 184220DNAArtificial SequenceSynthetic CENPF reverse primer 42tacctccacg cctattggtc 204320DNAArtificial SequenceSynthetic AURKA reverse primer 43tagtgggtgg ggagacagac 204420DNAArtificial SequenceSynthetic AURKB reverse primer 44ggggcgggag atttgaaaag 204520DNAArtificial SequenceSynthetic BIRC5 reverse primer 45tgtagagatg cggtggtcct 204622DNAArtificial SequenceSynthetic CDC25 reverse primer 46cccattttac agacctggac gc 224720DNAArtificial SequenceSynthetic PLK1 reverse primer 47gtcgttgtcc tcgaaaaagc 204821DNAArtificial SequenceSynthetic CYCLIN B2 reverse primer 48gcaactgcca atctgaaaaa g 21493506DNAHomo sapiensmisc_featureHuman nucleic acid sequence of forkhead box M1 (FOXM1) 49tttcaaacag cggaacaaac tgaaagctcc ggtgccagac cccacccccg gccccggccc 60gggaccccct cccctcccgg gatcccccgg ggttcccacc ccgcccgcac cgccggggac 120ccggccggtc cggcgcgagc ccccgtccgg ggccctggct cggcccccag gttggaggag 180cccggagccc gccttcggag ctacggccta acggcggcgg cgactgcagt ctggagggtc 240cacacttgtg attctcaatg gagagtgaaa acgcagattc ataatgaaaa ctagcccccg 300tcggccactg attctcaaaa gacggaggct gccccttcct gttcaaaatg ccccaagtga 360aacatcagag gaggaaccta agagatcccc tgcccaacag gagtctaatc aagcagaggc 420ctccaaggaa gtggcagagt ccaactcttg caagtttcca gctgggatca agattattaa 480ccaccccacc atgcccaaca cgcaagtagt ggccatcccc aacaatgcta atattcacag 540catcatcaca gcactgactg ccaagggaaa agagagtggc agtagtgggc ccaacaaatt 600catcctcatc agctgtgggg gagccccaac tcagcctcca ggactccggc ctcaaaccca 660aaccagctat gatgccaaaa ggacagaagt gaccctggag accttgggac caaaacctgc 720agctagggat gtgaatcttc ctagaccacc tggagccctt tgcgagcaga aacgggagac 780ctgtgatggt gaggcagcag gctgcactat caacaatagc ctatccaaca tccagtggct 840tcgaaagatg agttctgatg gactgggctc ccgcagcatc aagcaagaga tggaggaaaa 900ggagaattgt cacctggagc agcgacaggt taaggttgag gagccttcga gaccatcagc 960gtcctggcag aactctgtgt ctgagcggcc accctactct tacatggcca tgatacaatt 1020cgccatcaac agcactgaga ggaagcgcat gactttgaaa gacatctata cgtggattga 1080ggaccacttt ccctacttta agcacattgc caagccaggc tggaagaact ccatccgcca 1140caacctttcc ctgcacgaca tgtttgtccg ggagacgtct gccaatggca aggtctcctt 1200ctggaccatt caccccagtg ccaaccgcta cttgacattg gaccaggtgt ttaagcagca 1260gcagaaacga ccgaatccag agctccgccg gaacatgacc atcaaaaccg aactccccct 1320gggcgcacgg cggaagatga agccactgct accacgggtc agctcatacc tggtacctat 1380ccagttcccg gtgaaccagt cactggtgtt gcagccctcg gtgaaggtgc cattgcccct 1440ggcggcttcc ctcatgagct cagagcttgc ccgccatagc aagcgagtcc gcattgcccc 1500caaggtgctg ctagctgagg aggggatagc tcctctttct tctgcaggac cagggaaaga 1560ggagaaactc ctgtttggag aagggttttc tcctttgctt ccagttcaga ctatcaagga 1620ggaagaaatc cagcctgggg aggaaatgcc acacttagcg agacccatca aagtggagag 1680ccctcccttg gaagagtggc cctccccggc cccatctttc aaagaggaat catctcactc 1740ctgggaggat tcgtcccaat ctcccacccc aagacccaag aagtcctaca gtgggcttag 1800gtccccaacc cggtgtgtct cggaaatgct tgtgattcaa cacagggaga ggagggagag 1860gagccggtct cggaggaaac agcatctact gcctccctgt gtggatgagc cggagctgct 1920cttctcagag gggcccagta cttcccgctg ggccgcagag ctcccgttcc cagcagactc 1980ctctgaccct gcctcccagc tcagctactc ccaggaagtg ggaggacctt ttaagacacc 2040cattaaggaa acgctgccca tctcctccac cccgagcaaa tctgtcctcc ccagaacccc 2100tgaatcctgg aggctcacgc ccccagccaa agtaggggga ctggatttca gcccagtaca 2160aacctcccag ggtgcctctg accccttgcc tgaccccctg gggctgatgg atctcagcac 2220cactcccttg caaagtgctc ccccccttga atcaccgcaa aggctcctca gttcagaacc 2280cttagacctc atctccgtcc cctttggcaa ctcttctccc tcagatatag acgtccccaa 2340gccaggctcc ccggagccac aggtttctgg ccttgcagcc aatcgttctc tgacagaagg 2400cctggtcctg gacacaatga atgacagcct cagcaagatc ctgctggaca tcagctttcc 2460tggcctggac gaggacccac tgggccctga caacatcaac tggtcccagt ttattcctga 2520gctacagtag agccctgccc ttgcccctgt gctcaagctg tccaccatcc cgggcactcc 2580aaggctcagt gcaccccaag cctctgagtg aggacagcag gcagggactg ttctgctcct 2640catagctccc tgctgcctga ttatgcaaaa gtagcagtca caccctagcc actgctggga 2700ccttgtgttc cccaagagta tctgattcct ctgctgtccc tgccaggagc tgaagggtgg 2760gaacaacaaa ggcaatggtg aaaagagatt aggaaccccc cagcctgttt ccattctctg 2820cccagcagtc tcttaccttc cctgatcttt gcagggtggt ccgtgtaaat agtataaatt 2880ctccaaatta tcctctaatt ataaatgtaa gcttatttcc ttagatcatt atccagagac 2940tgccagaagg tgggtaggat gacctggggt ttcaattgac ttctgttcct tgcttttagt 3000tttgatagaa gggaagacct gcagtgcacg gtttcttcca ggctgaggta cctggatctt 3060gggttcttca ctgcagggac ccagacaagt ggatctgctt gccagagtcc tttttgcccc 3120tccctgccac ctccccgtgt ttccaagtca gctttcctgc aagaagaaat cctggttaaa 3180aaagtctttt gtattgggtc aggagttgaa tttggggtgg gaggatggat gcaactgaag 3240cagagtgtgg gtgcccagat gtgcgctatt agatgtttct ctgataatgt ccccaatcat 3300accagggaga ctggcattga cgagaactca ggtggaggct tgagaaggcc gaaagggccc 3360ctgacctgcc tggcttcctt agcttgcccc tcagctttgc aaagagccac cctaggcccc 3420agctgaccgc atgggtgtga gccagcttga gaacactaac tactcaataa aagcgaaggt 3480ggacatgaaa aaaaaaaaaa aaaaaa 350650748PRTHomo sapiensmisc_featureHuman forkhead box protein M1 isoform 4 50Met Lys Thr Ser Pro Arg Arg Pro Leu Ile Leu Lys Arg Arg Arg Leu 1 5 10 15 Pro Leu Pro Val Gln Asn Ala Pro Ser Glu Thr Ser Glu Glu Glu Pro 20 25 30 Lys Arg Ser Pro Ala Gln Gln Glu Ser Asn Gln Ala Glu Ala Ser Lys 35 40 45 Glu Val Ala Glu Ser Asn Ser Cys Lys Phe Pro Ala Gly Ile Lys Ile 50 55 60 Ile Asn His Pro Thr Met Pro Asn Thr Gln Val Val Ala Ile Pro Asn 65 70 75 80 Asn Ala Asn Ile His Ser Ile Ile Thr Ala Leu Thr Ala Lys Gly Lys 85 90 95 Glu Ser Gly Ser Ser Gly Pro Asn Lys Phe Ile Leu Ile Ser Cys Gly 100 105 110 Gly Ala Pro Thr Gln Pro Pro Gly Leu Arg Pro Gln Thr Gln Thr Ser 115 120 125 Tyr Asp Ala Lys Arg Thr Glu Val Thr Leu Glu Thr Leu Gly Pro Lys 130 135 140 Pro Ala Ala Arg Asp Val Asn Leu Pro Arg Pro Pro Gly Ala Leu Cys 145 150 155 160 Glu Gln Lys Arg Glu Thr Cys Asp Gly Glu Ala Ala Gly Cys Thr Ile 165 170 175 Asn Asn Ser Leu Ser Asn Ile Gln Trp Leu Arg Lys Met Ser Ser Asp 180 185 190 Gly Leu Gly Ser Arg Ser Ile Lys Gln Glu Met Glu Glu Lys Glu Asn 195 200 205 Cys His Leu Glu Gln Arg Gln Val Lys Val Glu Glu Pro Ser Arg Pro 210 215 220 Ser Ala Ser Trp Gln Asn Ser Val Ser Glu Arg Pro Pro Tyr Ser Tyr 225 230 235 240 Met Ala Met Ile Gln Phe Ala Ile Asn Ser Thr Glu Arg Lys Arg Met 245 250 255 Thr Leu Lys Asp Ile Tyr Thr Trp Ile Glu Asp His Phe Pro Tyr Phe 260 265 270 Lys His Ile Ala Lys Pro Gly Trp Lys Asn Ser Ile Arg His Asn Leu 275 280 285 Ser Leu His Asp Met Phe Val Arg Glu Thr Ser Ala Asn Gly Lys Val 290 295 300 Ser Phe Trp Thr Ile His Pro Ser Ala Asn Arg Tyr Leu Thr Leu Asp 305 310 315 320 Gln Val Phe Lys Gln Gln Gln Lys Arg Pro Asn Pro Glu Leu Arg Arg 325 330 335 Asn Met Thr Ile Lys Thr Glu Leu Pro Leu Gly Ala Arg Arg Lys Met 340 345 350 Lys Pro Leu Leu Pro Arg Val Ser Ser Tyr Leu Val Pro Ile Gln Phe 355 360 365 Pro Val Asn Gln Ser Leu Val Leu Gln Pro Ser Val Lys Val Pro Leu 370 375 380 Pro Leu Ala Ala Ser Leu Met Ser Ser Glu Leu Ala Arg His Ser Lys 385 390 395 400 Arg Val Arg Ile Ala Pro Lys Val Leu Leu Ala Glu Glu Gly Ile Ala 405 410 415 Pro Leu Ser Ser Ala Gly Pro Gly Lys Glu Glu Lys Leu Leu Phe Gly 420 425 430 Glu Gly Phe Ser Pro Leu Leu Pro Val Gln Thr Ile Lys Glu Glu Glu 435 440 445 Ile Gln Pro Gly Glu Glu Met Pro His Leu Ala Arg Pro Ile Lys Val 450 455 460 Glu Ser Pro Pro Leu Glu Glu Trp Pro Ser Pro Ala Pro Ser Phe Lys 465 470 475 480 Glu Glu Ser Ser His Ser Trp Glu Asp Ser Ser Gln Ser Pro Thr Pro 485 490 495 Arg Pro Lys Lys Ser Tyr Ser Gly Leu Arg Ser Pro Thr Arg Cys Val 500 505 510 Ser Glu Met Leu Val Ile Gln His Arg Glu Arg Arg Glu Arg Ser Arg 515 520 525 Ser Arg Arg Lys Gln His Leu Leu Pro Pro Cys Val Asp Glu Pro Glu 530 535 540 Leu Leu Phe Ser Glu Gly Pro Ser Thr Ser Arg Trp Ala Ala Glu Leu 545 550 555 560 Pro Phe Pro Ala Asp Ser Ser Asp Pro Ala Ser Gln Leu Ser Tyr Ser 565 570 575 Gln Glu Val Gly Gly Pro Phe Lys Thr Pro Ile Lys Glu Thr Leu Pro 580 585 590 Ile Ser Ser Thr Pro Ser Lys Ser Val Leu Pro Arg Thr Pro Glu Ser 595 600 605 Trp Arg Leu Thr Pro Pro Ala Lys Val Gly Gly Leu Asp Phe Ser Pro 610 615 620 Val Gln Thr Ser Gln Gly Ala Ser Asp Pro Leu Pro Asp Pro Leu Gly 625 630 635 640 Leu Met Asp Leu Ser Thr Thr Pro Leu Gln Ser Ala Pro Pro Leu Glu 645 650 655 Ser Pro Gln Arg Leu Leu Ser Ser Glu Pro Leu Asp Leu Ile Ser Val 660 665 670 Pro Phe Gly Asn Ser Ser Pro Ser Asp Ile Asp Val Pro Lys Pro Gly 675 680 685 Ser Pro Glu Pro Gln Val Ser Gly Leu Ala Ala Asn Arg Ser Leu Thr 690 695 700 Glu Gly Leu Val Leu Asp Thr Met Asn Asp Ser Leu Ser Lys Ile Leu 705 710 715 720 Leu Asp Ile Ser Phe Pro Gly Leu Asp Glu Asp Pro Leu Gly Pro Asp 725 730 735 Asn Ile Asn Trp Ser Gln Phe Ile Pro Glu Leu Gln 740 745 514391DNAMus musculusmisc_featureMus musculus forkhead box M1 (Foxm1), mRNA 51gcgggaccca cccccggccc gggctccccc gtcaccccgc cccgggctcc caccccggcc 60gtcccgccgg gacccgccgc ccgggcccgg ctcggccccg cgtggagcag acgcggcctg 120tgagggtcaa agcttgcgat tctcgatgga gagcgaaagc acagcctcac gatgagaacc 180agcccccgcc ggccactgat tctcaaaaga cggaggctgc cccttcctgt ccagaatgcc 240ccgagtgaaa catcagagga agaagcaaag aggtcccctg cccagccgga gcctgctcca 300gcacaggcct cccaagaggt ggcagagtcc agctcttgca aatttccagc cggaatcaag 360attatcaacc accccaccac gcccaacaca caagtggtgg ccatccccag caacgctgat 420atccagagca tcatcacagc gctaactgcc aaagggaagg agagcggcag cagcgggccc 480aaccggttca tcctcatcag ctctgggggg ccctcctctc acccttccca gcctcaagcc 540cacagcagcc gggattccaa gagagcagag gtgatcacgg agacgttggg accgaagcca 600gcagctaagg gtgtgcctgt tcccaagcct cctggagccc ctccaaggca aagacaggag 660agctatgctg gtggtgaggc ggcaggctgc acgctggaca

acagcttaac caatatccag 720tggcttggaa agatgagttc tgacgggctg ggcccctgca gcgttaagca ggaactggaa 780gagaaggaga attgtcacct ggagcagaat cgggttaagg ttgaggagcc ctcaggagtg 840tcaacatctt ggcaggactc tgtgtctgag aggccaccct actcttatat ggccatgata 900cagtttgcca tcaacagcac tgagagaaag cgcatgacct tgaaggacat ctacacttgg 960attgaggacc acttccctta ctttaagcac attgccaagc caggctggaa gaactctatt 1020cgtcacaacc tttctctcca tgacatgttt gttcgagaga catctgccaa tggcaaggtc 1080tccttctgga ccattcaccc aagtgccaat cgctacttga cattggacca agtgtttaag 1140ccactggaac cagggtctcc acaatcgccc gagcacttgg aatcacagca gaaacgaccc 1200aatcctgagc tccatagaaa tgtgaccatc aaaactgaaa tcccactggg cgcacggcga 1260aagatgaagc ctctgctccc tcgggttagc tcatacctgg tgcccatcca gttcccagtg 1320aaccagtccc tggtgttaca gccctcagtg aaggttccct tgcctctggc agcatcgctt 1380atgagctcag agctcgcccg tcatagcaag cgagtccgca ttgcacccaa ggtgttgcta 1440tccagtgaag gaatagcccc gcttcctgcc acagaaccac cgaaggagga gaaacccctg 1500cttggagggg aagggctgtt gcctttactt cctattcagt ccattaagga agaagaaatg 1560cagcctgagg aggacatagc acacttagag aggcctatca aagtggagag ccctcccttg 1620gaagagtggc cctctccgtg tgcatcgctc aaagaggagc tatccaactc ctgggaagat 1680tcttcctgct ctcctacccc aaagcccaag aagtcctact gtgggctcaa gtccccaacg 1740cgctgtgtct cagaaatgct ggtgactaag cgaagagaga aaagggaggt gagccgatcc 1800cggaggaaac agcaccttca gcccccctgt ctggatgagc ctgacctgtt cttctcagag 1860gactccagca catttcggcc agccgtggag ctcctggcgg agtcttccga gcctgcaccc 1920cacctcagct gccctcagga agagggagga cctttcaaga cccccatcaa ggagacattg 1980cctgtctcct ccactcctag caagtctgtg ctctctagag accctgagtc ctggaggctc 2040acacctccag ccaaagttgg ggggttagat ttcagcccag tacgaacccc ccagggtgcc 2100tttggccttc tgcctgactc actggggttg atggagctga ataccacccc tttgaaaagt 2160ggtcctctct ttgactcgcc ccgggagctc ctcaactcag agccctttga cctggcctct 2220gaccccttcg gcagccctcc accaccacat gtggaaggcc ccaagcctgg ctcccccgag 2280ctgcagattc ccagcctttc agccaaccgt tctctcacag aaggccttgt cctggacaca 2340atgaatgata gcctcagcaa gatccttcta gacatcagtt tccctggcct ggaggaggac 2400cctctgggcc ctgacaacat caactggtct cagttcatcc cttagctgcg atagaggcaa 2460ggccttgccc ctgccactca agccgcctgc tatcctggca cttgtgtggc tcagggtacc 2520ccaagccgtc tgagggaagc tagcaggcaa gggctgagct gtgccctttg acctaattat 2580gtcaagatga tagccgcatc taagccacac caggacctat gcaagcagta ggatccccca 2640gagtccgagt cctccactcc ctgctggcaa gtgaagtggg tgtgacgagc catgaggacc 2700aggaagtgcc cattagtcac tcggtgctcc tggcagggta acccttataa atggtgtcag 2760ctccccaagt tgtcctgtaa ctataaatgt aagcgtattt ccttagctca ttatccagag 2820atggccagga tggggagagg gacggggttg cactttgctt ctgcttgtgg cctctggggg 2880aaggacctgc agtgcagtct ctccacactg tgggttctgc tataggcttc tagagataca 2940ggttgccgtg ccaggatcct gcttactgcc ctttcctcgc agctccccaa gtctccaagt 3000cagtggtact gcatgaagaa atcctgctgt gaaagcctat tggattcggg tgtagggaga 3060tgggtgtgcc tgaagcaaaa gcatgggtac tcacaggagt cctattaggt gtttctctga 3120tagtgttccc aatcatgcca gggagtctac cactgagatc tcaggctgag gcctgagaag 3180gagaaagtga cccctcactt gcctggcttc cttagcttgc tcctgagctt tgcaaaaaac 3240caccctagac cccactctac aagctacaga acaacactac tgtaactacc tactaaataa 3300agcccgtggc actggtcttg gaattgagcg agaggtggag cctgggggtg atgggcaagg 3360cctgcccctg ctgcatgggc cttccacaga tgctctctcc cgcacccttc ttggactctg 3420aggttgccag ctttgtctgt tgcgatgatt catatctata atctcagcct ttgagaggta 3480gaggctggag gatcagccct ctatgctaca tgagatcctg ccaacagagt ccagttccca 3540ctgttccctg ccctgcccac ctcttccttg ccaccccaga ccttgttcca tgggaccaga 3600ctctgactta ggtccttgtt gatcccttgg taacaacagc agttatagtc ctccaattcc 3660ctcccattcc attcagtatt caggcctgaa agccgaaact gttgtaggtg tctcattacc 3720acctctatcc cagctccaag cccaggagcc agcccccttc ctgctcctga gccttcccag 3780gcaaggctct cgctcagcag ctcctgttac caagtttgta accagaactg acagcgaaaa 3840gcatcaggga ctgaggagcc tcccaggaca ggcaagggcc tcctcccagc agcaccagtc 3900aggaagcatc accatagcaa ccctagcagc aaacaatggt accagaaagg gctttcctcc 3960aaagccgcct ctcctggctc tgtggctcag aggaagaatg gccaacatcc cgaagaaaac 4020atccctccaa aagtcaagcc tgagccaagt atctcgtacc agggagcctt tcctgaaggt 4080agagtggggc ccaacaacgc agccagcctt tcaggttgtc ctgagcagta gtctctggta 4140cataagccag tttctgcttt catcctgtgg taccctaagt tggagctcag aacagaaagg 4200agaagcctgg gcaacaggtt gaagaggcct tatctaaagg acttgggatc agaaatgtgc 4260ttagctttgg gatttacttt tggattttgg agtatgtgta tgtatgtcaa actatgttgg 4320gcaaggaccc caaacttaat ataaaattcc tttgtttcat atgtaaaaaa aaaaaaaaaa 4380aaaaaaaaaa a 439152757PRTMus musculusmisc_featureMus musculus forkhead box protein M1 52Met Arg Thr Ser Pro Arg Arg Pro Leu Ile Leu Lys Arg Arg Arg Leu 1 5 10 15 Pro Leu Pro Val Gln Asn Ala Pro Ser Glu Thr Ser Glu Glu Glu Ala 20 25 30 Lys Arg Ser Pro Ala Gln Pro Glu Pro Ala Pro Ala Gln Ala Ser Gln 35 40 45 Glu Val Ala Glu Ser Ser Ser Cys Lys Phe Pro Ala Gly Ile Lys Ile 50 55 60 Ile Asn His Pro Thr Thr Pro Asn Thr Gln Val Val Ala Ile Pro Ser 65 70 75 80 Asn Ala Asp Ile Gln Ser Ile Ile Thr Ala Leu Thr Ala Lys Gly Lys 85 90 95 Glu Ser Gly Ser Ser Gly Pro Asn Arg Phe Ile Leu Ile Ser Ser Gly 100 105 110 Gly Pro Ser Ser His Pro Ser Gln Pro Gln Ala His Ser Ser Arg Asp 115 120 125 Ser Lys Arg Ala Glu Val Ile Thr Glu Thr Leu Gly Pro Lys Pro Ala 130 135 140 Ala Lys Gly Val Pro Val Pro Lys Pro Pro Gly Ala Pro Pro Arg Gln 145 150 155 160 Arg Gln Glu Ser Tyr Ala Gly Gly Glu Ala Ala Gly Cys Thr Leu Asp 165 170 175 Asn Ser Leu Thr Asn Ile Gln Trp Leu Gly Lys Met Ser Ser Asp Gly 180 185 190 Leu Gly Pro Cys Ser Val Lys Gln Glu Leu Glu Glu Lys Glu Asn Cys 195 200 205 His Leu Glu Gln Asn Arg Val Lys Val Glu Glu Pro Ser Gly Val Ser 210 215 220 Thr Ser Trp Gln Asp Ser Val Ser Glu Arg Pro Pro Tyr Ser Tyr Met 225 230 235 240 Ala Met Ile Gln Phe Ala Ile Asn Ser Thr Glu Arg Lys Arg Met Thr 245 250 255 Leu Lys Asp Ile Tyr Thr Trp Ile Glu Asp His Phe Pro Tyr Phe Lys 260 265 270 His Ile Ala Lys Pro Gly Trp Lys Asn Ser Ile Arg His Asn Leu Ser 275 280 285 Leu His Asp Met Phe Val Arg Glu Thr Ser Ala Asn Gly Lys Val Ser 290 295 300 Phe Trp Thr Ile His Pro Ser Ala Asn Arg Tyr Leu Thr Leu Asp Gln 305 310 315 320 Val Phe Lys Pro Leu Glu Pro Gly Ser Pro Gln Ser Pro Glu His Leu 325 330 335 Glu Ser Gln Gln Lys Arg Pro Asn Pro Glu Leu His Arg Asn Val Thr 340 345 350 Ile Lys Thr Glu Ile Pro Leu Gly Ala Arg Arg Lys Met Lys Pro Leu 355 360 365 Leu Pro Arg Val Ser Ser Tyr Leu Val Pro Ile Gln Phe Pro Val Asn 370 375 380 Gln Ser Leu Val Leu Gln Pro Ser Val Lys Val Pro Leu Pro Leu Ala 385 390 395 400 Ala Ser Leu Met Ser Ser Glu Leu Ala Arg His Ser Lys Arg Val Arg 405 410 415 Ile Ala Pro Lys Val Leu Leu Ser Ser Glu Gly Ile Ala Pro Leu Pro 420 425 430 Ala Thr Glu Pro Pro Lys Glu Glu Lys Pro Leu Leu Gly Gly Glu Gly 435 440 445 Leu Leu Pro Leu Leu Pro Ile Gln Ser Ile Lys Glu Glu Glu Met Gln 450 455 460 Pro Glu Glu Asp Ile Ala His Leu Glu Arg Pro Ile Lys Val Glu Ser 465 470 475 480 Pro Pro Leu Glu Glu Trp Pro Ser Pro Cys Ala Ser Leu Lys Glu Glu 485 490 495 Leu Ser Asn Ser Trp Glu Asp Ser Ser Cys Ser Pro Thr Pro Lys Pro 500 505 510 Lys Lys Ser Tyr Cys Gly Leu Lys Ser Pro Thr Arg Cys Val Ser Glu 515 520 525 Met Leu Val Thr Lys Arg Arg Glu Lys Arg Glu Val Ser Arg Ser Arg 530 535 540 Arg Lys Gln His Leu Gln Pro Pro Cys Leu Asp Glu Pro Asp Leu Phe 545 550 555 560 Phe Ser Glu Asp Ser Ser Thr Phe Arg Pro Ala Val Glu Leu Leu Ala 565 570 575 Glu Ser Ser Glu Pro Ala Pro His Leu Ser Cys Pro Gln Glu Glu Gly 580 585 590 Gly Pro Phe Lys Thr Pro Ile Lys Glu Thr Leu Pro Val Ser Ser Thr 595 600 605 Pro Ser Lys Ser Val Leu Ser Arg Asp Pro Glu Ser Trp Arg Leu Thr 610 615 620 Pro Pro Ala Lys Val Gly Gly Leu Asp Phe Ser Pro Val Arg Thr Pro 625 630 635 640 Gln Gly Ala Phe Gly Leu Leu Pro Asp Ser Leu Gly Leu Met Glu Leu 645 650 655 Asn Thr Thr Pro Leu Lys Ser Gly Pro Leu Phe Asp Ser Pro Arg Glu 660 665 670 Leu Leu Asn Ser Glu Pro Phe Asp Leu Ala Ser Asp Pro Phe Gly Ser 675 680 685 Pro Pro Pro Pro His Val Glu Gly Pro Lys Pro Gly Ser Pro Glu Leu 690 695 700 Gln Ile Pro Ser Leu Ser Ala Asn Arg Ser Leu Thr Glu Gly Leu Val 705 710 715 720 Leu Asp Thr Met Asn Asp Ser Leu Ser Lys Ile Leu Leu Asp Ile Ser 725 730 735 Phe Pro Gly Leu Glu Glu Asp Pro Leu Gly Pro Asp Asn Ile Asn Trp 740 745 750 Ser Gln Phe Ile Pro 755 5310316DNAHomo sapiensmisc_featureHuman centromere protein F (CENPF), mRNA 53gagaccagaa gcgggcgaat tgggcaccgg tggcggctgc gggcagtttg aattagactc 60tgggctccag cccgccgaag ccgcgccaga actgtactct ccgagaggtc gttttcccgt 120ccccgagagc aagtttattt acaaatgttg gagtaataaa gaaggcagaa caaaatgagc 180tgggctttgg aagaatggaa agaagggctg cctacaagag ctcttcagaa aattcaagag 240cttgaaggac agcttgacaa actgaagaag gaaaagcagc aaaggcagtt tcagcttgac 300agtctcgagg ctgcgctgca gaagcaaaaa cagaaggttg aaaatgaaaa aaccgagggt 360acaaacctga aaagggagaa tcaaagattg atggaaatat gtgaaagtct ggagaaaact 420aagcagaaga tttctcatga acttcaagtc aaggagtcac aagtgaattt ccaggaagga 480caactgaatt caggcaaaaa acaaatagaa aaactggaac aggaacttaa aaggtgtaaa 540tctgagcttg aaagaagcca acaagctgcg cagtctgcag atgtctctct gaatccatgc 600aatacaccac aaaaaatttt tacaactcca ctaacaccaa gtcaatatta tagtggttcc 660aagtatgaag atctaaaaga aaaatataat aaagaggttg aagaacgaaa aagattagag 720gcagaggtta aagccttgca ggctaaaaaa gcaagccaga ctcttccaca agccaccatg 780aatcaccgcg acattgcccg gcatcaggct tcatcatctg tgttctcatg gcagcaagag 840aagaccccaa gtcatctttc atctaattct caaagaactc caattaggag agatttctct 900gcatcttact tttctgggga acaagaggtg actccaagtc gatcaacttt gcaaataggg 960aaaagagatg ctaatagcag tttctttgac aattctagca gtcctcatct tttggatcaa 1020ttaaaagcgc agaatcaaga gctaagaaac aagattaatg agttggaact acgcctgcaa 1080ggacatgaaa aagaaatgaa aggccaagtg aataagtttc aagaactcca actccaactg 1140gagaaagcaa aagtggaatt aattgaaaaa gagaaagttt tgaacaaatg tagggatgaa 1200ctagtgagaa caacagcaca atacgaccag gcgtcaacca agtatactgc attggaacaa 1260aaactgaaaa aattgacgga agatttgagt tgtcagcgac aaaatgcaga aagtgccaga 1320tgttctctgg aacagaaaat taaggaaaaa gaaaaggagt ttcaagagga gctctcccgt 1380caacagcgtt ctttccaaac actggaccag gagtgcatcc agatgaaggc cagactcacc 1440caggagttac agcaagccaa gaatatgcac aacgtcctgc aggctgaact ggataaactc 1500acatcagtaa agcaacagct agaaaacaat ttggaagagt ttaagcaaaa gttgtgcaga 1560gctgaacagg cgttccaggc gagtcagatc aaggagaatg agctgaggag aagcatggag 1620gaaatgaaga aggaaaacaa cctccttaag agtcactctg agcaaaaggc cagagaagtc 1680tgccacctgg aggcagaact caagaacatc aaacagtgtt taaatcagag ccagaatttt 1740gcagaagaaa tgaaagcgaa gaatacctct caggaaacca tgttaagaga tcttcaagaa 1800aaaataaatc agcaagaaaa ctccttgact ttagaaaaac tgaagcttgc tgtggctgat 1860ctggaaaagc agcgagattg ttctcaagac cttttgaaga aaagagaaca tcacattgaa 1920caacttaatg ataagttaag caagacagag aaagagtcca aagccttgct gagtgcttta 1980gagttaaaaa agaaagaata tgaagaattg aaagaagaga aaactctgtt ttcttgttgg 2040aaaagtgaaa acgaaaaact tttaactcag atggaatcag aaaaggaaaa cttgcagagt 2100aaaattaatc acttggaaac ttgtctgaag acacagcaaa taaaaagtca tgaatacaac 2160gagagagtaa gaacgctgga gatggacaga gaaaacctaa gtgtcgagat cagaaacctt 2220cacaacgtgt tagacagtaa gtcagtggag gtagagaccc agaaactagc ttatatggag 2280ctacagcaga aagctgagtt ctcagatcag aaacatcaga aggaaataga aaatatgtgt 2340ttgaagactt ctcagcttac tgggcaagtt gaagatctag aacacaagct tcagttactg 2400tcaaatgaaa taatggacaa agaccggtgt taccaagact tgcatgccga atatgagagc 2460ctcagggatc tgctaaaatc caaagatgct tctctggtga caaatgaaga tcatcagaga 2520agtcttttgg cttttgatca gcagcctgcc atgcatcatt cctttgcaaa tataattgga 2580gaacaaggaa gcatgccttc agagaggagt gaatgtcgtt tagaagcaga ccaaagtccg 2640aaaaattctg ccatcctaca aaatagagtt gattcacttg aattttcatt agagtctcaa 2700aaacagatga actcagacct gcaaaagcag tgtgaagagt tggtgcaaat caaaggagaa 2760atagaagaaa atctcatgaa agcagaacag atgcatcaaa gttttgtggc tgaaacaagt 2820cagcgcatta gtaagttaca ggaagacact tctgctcacc agaatgttgt tgctgaaacc 2880ttaagtgccc ttgagaacaa ggaaaaagag ctgcaacttt taaatgataa ggtagaaact 2940gagcaggcag agattcaaga attaaaaaag agcaaccatc tacttgaaga ctctctaaag 3000gagctacaac ttttatccga aaccctaagc ttggagaaga aagaaatgag ttccatcatt 3060tctctaaata aaagggaaat tgaagagctg acccaagaga atgggactct taaggaaatt 3120aatgcatcct taaatcaaga gaagatgaac ttaatccaga aaagtgagag ttttgcaaac 3180tatatagatg aaagggagaa aagcatttca gagttatctg atcagtacaa gcaagaaaaa 3240cttattttac tacaaagatg tgaagaaacc ggaaatgcat atgaggatct tagtcaaaaa 3300tacaaagcag cacaggaaaa gaattctaaa ttagaatgct tgctaaatga atgcactagt 3360ctttgtgaaa ataggaaaaa tgagttggaa cagctaaagg aagcatttgc aaaggaacac 3420caagaattct taacaaaatt agcatttgct gaagaaagaa atcagaatct gatgctagag 3480ttggagacag tgcagcaagc tctgagatct gagatgacag ataaccaaaa caattctaag 3540agcgaggctg gtggtttaaa gcaagaaatc atgactttaa aggaagaaca aaacaaaatg 3600caaaaggaag ttaatgactt attacaagag aatgaacagc tgatgaaggt aatgaagact 3660aaacatgaat gtcaaaatct agaatcagaa ccaattagga actctgtgaa agaaagagag 3720agtgagagaa atcaatgtaa ttttaaacct cagatggatc ttgaagttaa agaaatttct 3780ctagatagtt ataatgcgca gttggtgcaa ttagaagcta tgctaagaaa taaggaatta 3840aaacttcagg aaagtgagaa ggagaaggag tgcctgcagc atgaattaca gacaattaga 3900ggagatcttg aaaccagcaa tttgcaagac atgcagtcac aagaaattag tggccttaaa 3960gactgtgaaa tagatgcgga agaaaagtat atttcagggc ctcatgagtt gtcaacaagt 4020caaaacgaca atgcacacct tcagtgctct ctgcaaacaa caatgaacaa gctgaatgag 4080ctagagaaaa tatgtgaaat actgcaggct gaaaagtatg aactcgtaac tgagctgaat 4140gattcaaggt cagaatgtat cacagcaact aggaaaatgg cagaagaggt agggaaacta 4200ctaaatgaag ttaaaatatt aaatgatgac agtggtcttc tccatggtga gttagtggaa 4260gacataccag gaggtgaatt tggtgaacaa ccaaatgaac agcaccctgt gtctttggct 4320ccattggacg agagtaattc ctacgagcac ttgacattgt cagacaaaga agttcaaatg 4380cactttgccg aattgcaaga gaaattctta tctttacaaa gtgaacacaa aattttacat 4440gatcagcact gtcagatgag ctctaaaatg tcagagctgc agacctatgt tgactcatta 4500aaggccgaaa atttggtctt gtcaacgaat ctgagaaact ttcaaggtga cttggtgaag 4560gagatgcagc tgggcttgga ggaggggctc gttccatccc tgtcatcctc ttgtgtgcct 4620gacagctcta gtcttagcag tttgggagac tcctcctttt acagagctct tttagaacag 4680acaggagata tgtctctttt gagtaattta gaaggggctg tttcagcaaa ccagtgcagt 4740gtagatgaag tattttgcag cagtctgcag gaggagaatc tgaccaggaa agaaacccct 4800tcggccccag cgaagggtgt tgaagagctt gagtccctct gtgaggtgta ccggcagtcc 4860ctcgagaagc tagaagagaa aatggaaagt caagggatta tgaaaaataa ggaaattcaa 4920gagctcgagc agttattaag ttctgaaagg caagagcttg actgccttag gaagcagtat 4980ttgtcagaaa atgaacagtg gcaacagaag ctgacaagcg tgactctgga gatggagtcc 5040aagttggcgg cagaaaagaa acagacggaa caactgtcac ttgagctgga agtagcacga 5100ctccagctac aaggtctgga cttaagttct cggtctttgc ttggcatcga cacagaagat 5160gctattcaag gccgaaatga gagctgtgac atatcaaaag aacatacttc agaaactaca 5220gaaagaacac caaagcatga tgttcatcag atttgtgata aagatgctca gcaggacctc 5280aatctagaca ttgagaaaat aactgagact ggtgcagtga aacccacagg agagtgctct 5340ggggaacagt ccccagatac caattatgag cctccagggg aagataaaac ccagggctct 5400tcagaatgca tttctgaatt gtcattttct ggtcctaatg ctttggtacc tatggatttc 5460ctggggaatc aggaagatat ccataatctt caactgcggg taaaagagac atcaaatgag 5520aatttgagat tacttcatgt gatagaggac cgtgacagaa aagttgaaag tttgctaaat 5580gaaatgaaag aattagactc aaaactccat ttacaggagg tacaactaat gaccaaaatt 5640gaagcatgca tagaattgga aaaaatagtt ggggaactta agaaagaaaa ctcagattta 5700agtgaaaaat tggaatattt ttcttgtgat caccaggagt tactccagag agtagaaact 5760tctgaaggcc tcaattctga tttagaaatg catgcagata aatcatcacg tgaagatatt 5820ggagataatg tggccaaggt gaatgacagc tggaaggaga gatttcttga tgtggaaaat 5880gagctgagta ggatcagatc ggagaaagct agcattgagc atgaagccct ctacctggag 5940gctgacttag aggtagttca aacagagaag ctatgtttag aaaaagacaa tgaaaataag 6000cagaaggtta ttgtctgcct tgaagaagaa ctctcagtgg tcacaagtga gagaaaccag 6060cttcgtggag aattagatac tatgtcaaaa aaaaccacgg cactggatca gttgtctgaa 6120aaaatgaagg agaaaacaca agagcttgag tctcatcaaa gtgagtgtct ccattgcatt 6180caggtggcag aggcagaggt gaaggaaaag acggaactcc ttcagacttt gtcctctgat 6240gtgagtgagc

tgttaaaaga caaaactcat ctccaggaaa agctgcagag tttggaaaag 6300gactcacagg cactgtcttt gacaaaatgt gagctggaaa accaaattgc acaactgaat 6360aaagagaaag aattgcttgt caaggaatct gaaagcctgc aggccagact gagtgaatca 6420gattatgaaa agctgaatgt ctccaaggcc ttggaggccg cactggtgga gaaaggtgag 6480ttcgcattga ggctgagctc aacacaggag gaagtgcatc agctgagaag aggcatcgag 6540aaactgagag ttcgcattga ggccgatgaa aagaagcagc tgcacatcgc agagaaactg 6600aaagaacgcg agcgggagaa tgattcactt aaggataaag ttgagaacct tgaaagggaa 6660ttgcagatgt cagaagaaaa ccaggagcta gtgattcttg atgccgagaa ttccaaagca 6720gaagtagaga ctctaaaaac acaaatagaa gagatggcca gaagcctgaa agtttttgaa 6780ttagaccttg tcacgttaag gtctgaaaaa gaaaatctga caaaacaaat acaagaaaaa 6840caaggtcagt tgtcagaact agacaagtta ctctcttcat ttaaaagtct gttagaagaa 6900aaggagcaag cagagataca gatcaaagaa gaatctaaaa ctgcagtgga gatgcttcag 6960aatcagttaa aggagctaaa tgaggcagta gcagccttgt gtggtgacca agaaattatg 7020aaggccacag aacagagtct agacccacca atagaggaag agcatcagct gagaaatagc 7080attgaaaagc tgagagcccg cctagaagct gatgaaaaga agcagctctg tgtcttacaa 7140caactgaagg aaagtgagca tcatgcagat ttacttaagg gtagagtgga gaaccttgaa 7200agagagctag agatagccag gacaaaccaa gagcatgcag ctcttgaggc agagaattcc 7260aaaggagagg tagagaccct aaaagcaaaa atagaaggga tgacccaaag tctgagaggt 7320ctggaattag atgttgttac tataaggtca gaaaaagaaa atctgacaaa tgaattacaa 7380aaagagcaag agcgaatatc tgaattagaa ataataaatt catcatttga aaatattttg 7440caagaaaaag agcaagagaa agtacagatg aaagaaaaat caagcactgc catggagatg 7500cttcaaacac aattaaaaga gctcaatgag agagtggcag ccctgcataa tgaccaagaa 7560gcctgtaagg ccaaagagca gaatcttagt agtcaagtag agtgtcttga acttgagaag 7620gctcagttgc tacaaggcct tgatgaggcc aaaaataatt atattgtttt gcaatcttca 7680gtgaatggcc tcattcaaga agtagaagat ggcaagcaga aactggagaa gaaggatgaa 7740gaaatcagta gactgaaaaa tcaaattcaa gaccaagagc agcttgtctc taaactgtcc 7800caggtggaag gagagcacca actttggaag gagcaaaact tagaactgag aaatctgaca 7860gtggaattgg agcagaagat ccaagtgcta caatccaaaa atgcctcttt gcaggacaca 7920ttagaagtgc tgcagagttc ttacaagaat ctagagaatg agcttgaatt gacaaaaatg 7980gacaaaatgt cctttgttga aaaagtaaac aaaatgactg caaaggaaac tgagctgcag 8040agggaaatgc atgagatggc acagaaaaca gcagagctgc aagaagaact cagtggagag 8100aaaaataggc tagctggaga gttgcagtta ctgttggaag aaataaagag cagcaaagat 8160caattgaagg agctcacact agaaaatagt gaattgaaga agagcctaga ttgcatgcac 8220aaagaccagg tggaaaagga agggaaagtg agagaggaaa tagctgaata tcagctacgg 8280cttcatgaag ctgaaaagaa acaccaggct ttgcttttgg acacaaacaa acagtatgaa 8340gtagaaatcc agacataccg agagaaattg acttctaaag aagaatgtct cagttcacag 8400aagctggaga tagacctttt aaagtctagt aaagaagagc tcaataattc attgaaagct 8460actactcaga ttttggaaga attgaagaaa accaagatgg acaatctaaa atatgtaaat 8520cagttgaaga aggaaaatga acgtgcccag gggaaaatga agttgttgat caaatcctgt 8580aaacagctgg aagaggaaaa ggagatactg cagaaagaac tctctcaact tcaagctgca 8640caggagaagc agaaaacagg tactgttatg gataccaagg tcgatgaatt aacaactgag 8700atcaaagaac tgaaagaaac tcttgaagaa aaaaccaagg aggcagatga atacttggat 8760aagtactgtt ccttgcttat aagccatgaa aagttagaga aagctaaaga gatgttagag 8820acacaagtgg cccatctgtg ttcacagcaa tctaaacaag attcccgagg gtctcctttg 8880ctaggtccag ttgttccagg accatctcca atcccttctg ttactgaaaa gaggttatca 8940tctggccaaa ataaagcttc aggcaagagg caaagatcca gtggaatatg ggagaatggt 9000agaggaccaa cacctgctac cccagagagc ttttctaaaa aaagcaagaa agcagtcatg 9060agtggtattc accctgcaga agacacggaa ggtactgagt ttgagccaga gggacttcca 9120gaagttgtaa agaaagggtt tgctgacatc ccgacaggaa agactagccc atatatcctg 9180cgaagaacaa ccatggcaac tcggaccagc ccccgcctgg ctgcacagaa gttagcgcta 9240tccccactga gtctcggcaa agaaaatctt gcagagtcct ccaaaccaac agctggtggc 9300agcagatcac aaaaggtcaa agttgctcag cggagcccag tagattcagg caccatcctc 9360cgagaaccca ccacgaaatc cgtcccagtc aataatcttc ctgagagaag tccgactgac 9420agccccagag agggcctgag ggtcaagcga ggccgacttg tccccagccc caaagctgga 9480ctggagtcca acggcagtga gaactgtaag gtccagtgaa ggcactttgt gtgtcagtac 9540ccctgggagg tgccagtcat tgaatagata aggctgtgcc tacaggactt ctctttagtc 9600agggcatgct ttattagtga ggagaaaaca attccttaga agtcttaaat atattgtact 9660ctttagatct cccatgtgta ggtattgaaa aagtttggaa gcactgatca cctgttagca 9720ttgccattcc tctactgcaa tgtaaatagt ataaagctat gtatataaag ctttttggta 9780atatgttaca attaaaatga caagcactat atcacaatct ctgtttgtat gtgggtttta 9840cactaaaaaa atgcaaaaca cattttattc ttctaattaa cagctcctag gaaaatgtag 9900acttttgctt tatgatattc tatctgtagt atgaggcatg gaatagtttt gtatcgggaa 9960tttctcagag ctgagtaaaa tgaaggaaaa gcatgttatg tgtttttaag gaaaatgtgc 10020acacatatac atgtaggagt gtttatcttt ctcttacaat ctgttttaga catctttgct 10080tatgaaacct gtacatatgt gtgtgtgggt atgtgtttat ttccagtgag ggctgcaggc 10140ttcctagagg tgtgctatac catgcgtctg tcgttgtgct tttttctgtt tttagaccaa 10200ttttttacag ttctttggta agcattgtcg tatctggtga tggattaaca tatagccttt 10260gttttctaat aaaatagtcg ccttcgtttt ctgtaaaaaa aaaaaaaaaa aaaaaa 10316543114PRTHomo sapiensmisc_featureHuman centromere protein F 54Met Ser Trp Ala Leu Glu Glu Trp Lys Glu Gly Leu Pro Thr Arg Ala 1 5 10 15 Leu Gln Lys Ile Gln Glu Leu Glu Gly Gln Leu Asp Lys Leu Lys Lys 20 25 30 Glu Lys Gln Gln Arg Gln Phe Gln Leu Asp Ser Leu Glu Ala Ala Leu 35 40 45 Gln Lys Gln Lys Gln Lys Val Glu Asn Glu Lys Thr Glu Gly Thr Asn 50 55 60 Leu Lys Arg Glu Asn Gln Arg Leu Met Glu Ile Cys Glu Ser Leu Glu 65 70 75 80 Lys Thr Lys Gln Lys Ile Ser His Glu Leu Gln Val Lys Glu Ser Gln 85 90 95 Val Asn Phe Gln Glu Gly Gln Leu Asn Ser Gly Lys Lys Gln Ile Glu 100 105 110 Lys Leu Glu Gln Glu Leu Lys Arg Cys Lys Ser Glu Leu Glu Arg Ser 115 120 125 Gln Gln Ala Ala Gln Ser Ala Asp Val Ser Leu Asn Pro Cys Asn Thr 130 135 140 Pro Gln Lys Ile Phe Thr Thr Pro Leu Thr Pro Ser Gln Tyr Tyr Ser 145 150 155 160 Gly Ser Lys Tyr Glu Asp Leu Lys Glu Lys Tyr Asn Lys Glu Val Glu 165 170 175 Glu Arg Lys Arg Leu Glu Ala Glu Val Lys Ala Leu Gln Ala Lys Lys 180 185 190 Ala Ser Gln Thr Leu Pro Gln Ala Thr Met Asn His Arg Asp Ile Ala 195 200 205 Arg His Gln Ala Ser Ser Ser Val Phe Ser Trp Gln Gln Glu Lys Thr 210 215 220 Pro Ser His Leu Ser Ser Asn Ser Gln Arg Thr Pro Ile Arg Arg Asp 225 230 235 240 Phe Ser Ala Ser Tyr Phe Ser Gly Glu Gln Glu Val Thr Pro Ser Arg 245 250 255 Ser Thr Leu Gln Ile Gly Lys Arg Asp Ala Asn Ser Ser Phe Phe Asp 260 265 270 Asn Ser Ser Ser Pro His Leu Leu Asp Gln Leu Lys Ala Gln Asn Gln 275 280 285 Glu Leu Arg Asn Lys Ile Asn Glu Leu Glu Leu Arg Leu Gln Gly His 290 295 300 Glu Lys Glu Met Lys Gly Gln Val Asn Lys Phe Gln Glu Leu Gln Leu 305 310 315 320 Gln Leu Glu Lys Ala Lys Val Glu Leu Ile Glu Lys Glu Lys Val Leu 325 330 335 Asn Lys Cys Arg Asp Glu Leu Val Arg Thr Thr Ala Gln Tyr Asp Gln 340 345 350 Ala Ser Thr Lys Tyr Thr Ala Leu Glu Gln Lys Leu Lys Lys Leu Thr 355 360 365 Glu Asp Leu Ser Cys Gln Arg Gln Asn Ala Glu Ser Ala Arg Cys Ser 370 375 380 Leu Glu Gln Lys Ile Lys Glu Lys Glu Lys Glu Phe Gln Glu Glu Leu 385 390 395 400 Ser Arg Gln Gln Arg Ser Phe Gln Thr Leu Asp Gln Glu Cys Ile Gln 405 410 415 Met Lys Ala Arg Leu Thr Gln Glu Leu Gln Gln Ala Lys Asn Met His 420 425 430 Asn Val Leu Gln Ala Glu Leu Asp Lys Leu Thr Ser Val Lys Gln Gln 435 440 445 Leu Glu Asn Asn Leu Glu Glu Phe Lys Gln Lys Leu Cys Arg Ala Glu 450 455 460 Gln Ala Phe Gln Ala Ser Gln Ile Lys Glu Asn Glu Leu Arg Arg Ser 465 470 475 480 Met Glu Glu Met Lys Lys Glu Asn Asn Leu Leu Lys Ser His Ser Glu 485 490 495 Gln Lys Ala Arg Glu Val Cys His Leu Glu Ala Glu Leu Lys Asn Ile 500 505 510 Lys Gln Cys Leu Asn Gln Ser Gln Asn Phe Ala Glu Glu Met Lys Ala 515 520 525 Lys Asn Thr Ser Gln Glu Thr Met Leu Arg Asp Leu Gln Glu Lys Ile 530 535 540 Asn Gln Gln Glu Asn Ser Leu Thr Leu Glu Lys Leu Lys Leu Ala Val 545 550 555 560 Ala Asp Leu Glu Lys Gln Arg Asp Cys Ser Gln Asp Leu Leu Lys Lys 565 570 575 Arg Glu His His Ile Glu Gln Leu Asn Asp Lys Leu Ser Lys Thr Glu 580 585 590 Lys Glu Ser Lys Ala Leu Leu Ser Ala Leu Glu Leu Lys Lys Lys Glu 595 600 605 Tyr Glu Glu Leu Lys Glu Glu Lys Thr Leu Phe Ser Cys Trp Lys Ser 610 615 620 Glu Asn Glu Lys Leu Leu Thr Gln Met Glu Ser Glu Lys Glu Asn Leu 625 630 635 640 Gln Ser Lys Ile Asn His Leu Glu Thr Cys Leu Lys Thr Gln Gln Ile 645 650 655 Lys Ser His Glu Tyr Asn Glu Arg Val Arg Thr Leu Glu Met Asp Arg 660 665 670 Glu Asn Leu Ser Val Glu Ile Arg Asn Leu His Asn Val Leu Asp Ser 675 680 685 Lys Ser Val Glu Val Glu Thr Gln Lys Leu Ala Tyr Met Glu Leu Gln 690 695 700 Gln Lys Ala Glu Phe Ser Asp Gln Lys His Gln Lys Glu Ile Glu Asn 705 710 715 720 Met Cys Leu Lys Thr Ser Gln Leu Thr Gly Gln Val Glu Asp Leu Glu 725 730 735 His Lys Leu Gln Leu Leu Ser Asn Glu Ile Met Asp Lys Asp Arg Cys 740 745 750 Tyr Gln Asp Leu His Ala Glu Tyr Glu Ser Leu Arg Asp Leu Leu Lys 755 760 765 Ser Lys Asp Ala Ser Leu Val Thr Asn Glu Asp His Gln Arg Ser Leu 770 775 780 Leu Ala Phe Asp Gln Gln Pro Ala Met His His Ser Phe Ala Asn Ile 785 790 795 800 Ile Gly Glu Gln Gly Ser Met Pro Ser Glu Arg Ser Glu Cys Arg Leu 805 810 815 Glu Ala Asp Gln Ser Pro Lys Asn Ser Ala Ile Leu Gln Asn Arg Val 820 825 830 Asp Ser Leu Glu Phe Ser Leu Glu Ser Gln Lys Gln Met Asn Ser Asp 835 840 845 Leu Gln Lys Gln Cys Glu Glu Leu Val Gln Ile Lys Gly Glu Ile Glu 850 855 860 Glu Asn Leu Met Lys Ala Glu Gln Met His Gln Ser Phe Val Ala Glu 865 870 875 880 Thr Ser Gln Arg Ile Ser Lys Leu Gln Glu Asp Thr Ser Ala His Gln 885 890 895 Asn Val Val Ala Glu Thr Leu Ser Ala Leu Glu Asn Lys Glu Lys Glu 900 905 910 Leu Gln Leu Leu Asn Asp Lys Val Glu Thr Glu Gln Ala Glu Ile Gln 915 920 925 Glu Leu Lys Lys Ser Asn His Leu Leu Glu Asp Ser Leu Lys Glu Leu 930 935 940 Gln Leu Leu Ser Glu Thr Leu Ser Leu Glu Lys Lys Glu Met Ser Ser 945 950 955 960 Ile Ile Ser Leu Asn Lys Arg Glu Ile Glu Glu Leu Thr Gln Glu Asn 965 970 975 Gly Thr Leu Lys Glu Ile Asn Ala Ser Leu Asn Gln Glu Lys Met Asn 980 985 990 Leu Ile Gln Lys Ser Glu Ser Phe Ala Asn Tyr Ile Asp Glu Arg Glu 995 1000 1005 Lys Ser Ile Ser Glu Leu Ser Asp Gln Tyr Lys Gln Glu Lys Leu 1010 1015 1020 Ile Leu Leu Gln Arg Cys Glu Glu Thr Gly Asn Ala Tyr Glu Asp 1025 1030 1035 Leu Ser Gln Lys Tyr Lys Ala Ala Gln Glu Lys Asn Ser Lys Leu 1040 1045 1050 Glu Cys Leu Leu Asn Glu Cys Thr Ser Leu Cys Glu Asn Arg Lys 1055 1060 1065 Asn Glu Leu Glu Gln Leu Lys Glu Ala Phe Ala Lys Glu His Gln 1070 1075 1080 Glu Phe Leu Thr Lys Leu Ala Phe Ala Glu Glu Arg Asn Gln Asn 1085 1090 1095 Leu Met Leu Glu Leu Glu Thr Val Gln Gln Ala Leu Arg Ser Glu 1100 1105 1110 Met Thr Asp Asn Gln Asn Asn Ser Lys Ser Glu Ala Gly Gly Leu 1115 1120 1125 Lys Gln Glu Ile Met Thr Leu Lys Glu Glu Gln Asn Lys Met Gln 1130 1135 1140 Lys Glu Val Asn Asp Leu Leu Gln Glu Asn Glu Gln Leu Met Lys 1145 1150 1155 Val Met Lys Thr Lys His Glu Cys Gln Asn Leu Glu Ser Glu Pro 1160 1165 1170 Ile Arg Asn Ser Val Lys Glu Arg Glu Ser Glu Arg Asn Gln Cys 1175 1180 1185 Asn Phe Lys Pro Gln Met Asp Leu Glu Val Lys Glu Ile Ser Leu 1190 1195 1200 Asp Ser Tyr Asn Ala Gln Leu Val Gln Leu Glu Ala Met Leu Arg 1205 1210 1215 Asn Lys Glu Leu Lys Leu Gln Glu Ser Glu Lys Glu Lys Glu Cys 1220 1225 1230 Leu Gln His Glu Leu Gln Thr Ile Arg Gly Asp Leu Glu Thr Ser 1235 1240 1245 Asn Leu Gln Asp Met Gln Ser Gln Glu Ile Ser Gly Leu Lys Asp 1250 1255 1260 Cys Glu Ile Asp Ala Glu Glu Lys Tyr Ile Ser Gly Pro His Glu 1265 1270 1275 Leu Ser Thr Ser Gln Asn Asp Asn Ala His Leu Gln Cys Ser Leu 1280 1285 1290 Gln Thr Thr Met Asn Lys Leu Asn Glu Leu Glu Lys Ile Cys Glu 1295 1300 1305 Ile Leu Gln Ala Glu Lys Tyr Glu Leu Val Thr Glu Leu Asn Asp 1310 1315 1320 Ser Arg Ser Glu Cys Ile Thr Ala Thr Arg Lys Met Ala Glu Glu 1325 1330 1335 Val Gly Lys Leu Leu Asn Glu Val Lys Ile Leu Asn Asp Asp Ser 1340 1345 1350 Gly Leu Leu His Gly Glu Leu Val Glu Asp Ile Pro Gly Gly Glu 1355 1360 1365 Phe Gly Glu Gln Pro Asn Glu Gln His Pro Val Ser Leu Ala Pro 1370 1375 1380 Leu Asp Glu Ser Asn Ser Tyr Glu His Leu Thr Leu Ser Asp Lys 1385 1390 1395 Glu Val Gln Met His Phe Ala Glu Leu Gln Glu Lys Phe Leu Ser 1400 1405 1410 Leu Gln Ser Glu His Lys Ile Leu His Asp Gln His Cys Gln Met 1415 1420 1425 Ser Ser Lys Met Ser Glu Leu Gln Thr Tyr Val Asp Ser Leu Lys 1430 1435 1440 Ala Glu Asn Leu Val Leu Ser Thr Asn Leu Arg Asn Phe Gln Gly 1445 1450 1455 Asp Leu Val Lys Glu Met Gln Leu Gly Leu Glu Glu Gly Leu Val 1460 1465 1470 Pro Ser Leu Ser Ser Ser Cys Val Pro Asp Ser Ser Ser Leu Ser 1475 1480 1485 Ser Leu Gly Asp Ser Ser Phe Tyr Arg Ala Leu Leu Glu Gln Thr 1490 1495 1500 Gly Asp Met Ser Leu Leu Ser Asn Leu Glu Gly Ala Val Ser Ala 1505 1510 1515 Asn Gln Cys Ser Val Asp Glu Val Phe Cys Ser Ser Leu Gln Glu 1520 1525 1530 Glu Asn Leu Thr Arg Lys Glu Thr Pro Ser Ala Pro Ala Lys Gly 1535 1540 1545 Val Glu Glu Leu Glu Ser Leu Cys Glu Val Tyr Arg Gln Ser Leu 1550 1555 1560 Glu Lys Leu Glu Glu Lys Met Glu Ser Gln Gly Ile Met Lys Asn 1565 1570 1575 Lys Glu Ile Gln Glu Leu Glu Gln Leu Leu Ser Ser Glu Arg Gln 1580 1585 1590 Glu Leu Asp Cys Leu Arg Lys Gln Tyr Leu Ser Glu Asn Glu Gln 1595 1600 1605 Trp Gln Gln Lys Leu Thr Ser Val Thr Leu Glu Met Glu Ser Lys 1610 1615 1620 Leu Ala Ala Glu Lys Lys Gln Thr Glu Gln Leu Ser Leu Glu Leu 1625 1630 1635 Glu Val Ala Arg Leu

Gln Leu Gln Gly Leu Asp Leu Ser Ser Arg 1640 1645 1650 Ser Leu Leu Gly Ile Asp Thr Glu Asp Ala Ile Gln Gly Arg Asn 1655 1660 1665 Glu Ser Cys Asp Ile Ser Lys Glu His Thr Ser Glu Thr Thr Glu 1670 1675 1680 Arg Thr Pro Lys His Asp Val His Gln Ile Cys Asp Lys Asp Ala 1685 1690 1695 Gln Gln Asp Leu Asn Leu Asp Ile Glu Lys Ile Thr Glu Thr Gly 1700 1705 1710 Ala Val Lys Pro Thr Gly Glu Cys Ser Gly Glu Gln Ser Pro Asp 1715 1720 1725 Thr Asn Tyr Glu Pro Pro Gly Glu Asp Lys Thr Gln Gly Ser Ser 1730 1735 1740 Glu Cys Ile Ser Glu Leu Ser Phe Ser Gly Pro Asn Ala Leu Val 1745 1750 1755 Pro Met Asp Phe Leu Gly Asn Gln Glu Asp Ile His Asn Leu Gln 1760 1765 1770 Leu Arg Val Lys Glu Thr Ser Asn Glu Asn Leu Arg Leu Leu His 1775 1780 1785 Val Ile Glu Asp Arg Asp Arg Lys Val Glu Ser Leu Leu Asn Glu 1790 1795 1800 Met Lys Glu Leu Asp Ser Lys Leu His Leu Gln Glu Val Gln Leu 1805 1810 1815 Met Thr Lys Ile Glu Ala Cys Ile Glu Leu Glu Lys Ile Val Gly 1820 1825 1830 Glu Leu Lys Lys Glu Asn Ser Asp Leu Ser Glu Lys Leu Glu Tyr 1835 1840 1845 Phe Ser Cys Asp His Gln Glu Leu Leu Gln Arg Val Glu Thr Ser 1850 1855 1860 Glu Gly Leu Asn Ser Asp Leu Glu Met His Ala Asp Lys Ser Ser 1865 1870 1875 Arg Glu Asp Ile Gly Asp Asn Val Ala Lys Val Asn Asp Ser Trp 1880 1885 1890 Lys Glu Arg Phe Leu Asp Val Glu Asn Glu Leu Ser Arg Ile Arg 1895 1900 1905 Ser Glu Lys Ala Ser Ile Glu His Glu Ala Leu Tyr Leu Glu Ala 1910 1915 1920 Asp Leu Glu Val Val Gln Thr Glu Lys Leu Cys Leu Glu Lys Asp 1925 1930 1935 Asn Glu Asn Lys Gln Lys Val Ile Val Cys Leu Glu Glu Glu Leu 1940 1945 1950 Ser Val Val Thr Ser Glu Arg Asn Gln Leu Arg Gly Glu Leu Asp 1955 1960 1965 Thr Met Ser Lys Lys Thr Thr Ala Leu Asp Gln Leu Ser Glu Lys 1970 1975 1980 Met Lys Glu Lys Thr Gln Glu Leu Glu Ser His Gln Ser Glu Cys 1985 1990 1995 Leu His Cys Ile Gln Val Ala Glu Ala Glu Val Lys Glu Lys Thr 2000 2005 2010 Glu Leu Leu Gln Thr Leu Ser Ser Asp Val Ser Glu Leu Leu Lys 2015 2020 2025 Asp Lys Thr His Leu Gln Glu Lys Leu Gln Ser Leu Glu Lys Asp 2030 2035 2040 Ser Gln Ala Leu Ser Leu Thr Lys Cys Glu Leu Glu Asn Gln Ile 2045 2050 2055 Ala Gln Leu Asn Lys Glu Lys Glu Leu Leu Val Lys Glu Ser Glu 2060 2065 2070 Ser Leu Gln Ala Arg Leu Ser Glu Ser Asp Tyr Glu Lys Leu Asn 2075 2080 2085 Val Ser Lys Ala Leu Glu Ala Ala Leu Val Glu Lys Gly Glu Phe 2090 2095 2100 Ala Leu Arg Leu Ser Ser Thr Gln Glu Glu Val His Gln Leu Arg 2105 2110 2115 Arg Gly Ile Glu Lys Leu Arg Val Arg Ile Glu Ala Asp Glu Lys 2120 2125 2130 Lys Gln Leu His Ile Ala Glu Lys Leu Lys Glu Arg Glu Arg Glu 2135 2140 2145 Asn Asp Ser Leu Lys Asp Lys Val Glu Asn Leu Glu Arg Glu Leu 2150 2155 2160 Gln Met Ser Glu Glu Asn Gln Glu Leu Val Ile Leu Asp Ala Glu 2165 2170 2175 Asn Ser Lys Ala Glu Val Glu Thr Leu Lys Thr Gln Ile Glu Glu 2180 2185 2190 Met Ala Arg Ser Leu Lys Val Phe Glu Leu Asp Leu Val Thr Leu 2195 2200 2205 Arg Ser Glu Lys Glu Asn Leu Thr Lys Gln Ile Gln Glu Lys Gln 2210 2215 2220 Gly Gln Leu Ser Glu Leu Asp Lys Leu Leu Ser Ser Phe Lys Ser 2225 2230 2235 Leu Leu Glu Glu Lys Glu Gln Ala Glu Ile Gln Ile Lys Glu Glu 2240 2245 2250 Ser Lys Thr Ala Val Glu Met Leu Gln Asn Gln Leu Lys Glu Leu 2255 2260 2265 Asn Glu Ala Val Ala Ala Leu Cys Gly Asp Gln Glu Ile Met Lys 2270 2275 2280 Ala Thr Glu Gln Ser Leu Asp Pro Pro Ile Glu Glu Glu His Gln 2285 2290 2295 Leu Arg Asn Ser Ile Glu Lys Leu Arg Ala Arg Leu Glu Ala Asp 2300 2305 2310 Glu Lys Lys Gln Leu Cys Val Leu Gln Gln Leu Lys Glu Ser Glu 2315 2320 2325 His His Ala Asp Leu Leu Lys Gly Arg Val Glu Asn Leu Glu Arg 2330 2335 2340 Glu Leu Glu Ile Ala Arg Thr Asn Gln Glu His Ala Ala Leu Glu 2345 2350 2355 Ala Glu Asn Ser Lys Gly Glu Val Glu Thr Leu Lys Ala Lys Ile 2360 2365 2370 Glu Gly Met Thr Gln Ser Leu Arg Gly Leu Glu Leu Asp Val Val 2375 2380 2385 Thr Ile Arg Ser Glu Lys Glu Asn Leu Thr Asn Glu Leu Gln Lys 2390 2395 2400 Glu Gln Glu Arg Ile Ser Glu Leu Glu Ile Ile Asn Ser Ser Phe 2405 2410 2415 Glu Asn Ile Leu Gln Glu Lys Glu Gln Glu Lys Val Gln Met Lys 2420 2425 2430 Glu Lys Ser Ser Thr Ala Met Glu Met Leu Gln Thr Gln Leu Lys 2435 2440 2445 Glu Leu Asn Glu Arg Val Ala Ala Leu His Asn Asp Gln Glu Ala 2450 2455 2460 Cys Lys Ala Lys Glu Gln Asn Leu Ser Ser Gln Val Glu Cys Leu 2465 2470 2475 Glu Leu Glu Lys Ala Gln Leu Leu Gln Gly Leu Asp Glu Ala Lys 2480 2485 2490 Asn Asn Tyr Ile Val Leu Gln Ser Ser Val Asn Gly Leu Ile Gln 2495 2500 2505 Glu Val Glu Asp Gly Lys Gln Lys Leu Glu Lys Lys Asp Glu Glu 2510 2515 2520 Ile Ser Arg Leu Lys Asn Gln Ile Gln Asp Gln Glu Gln Leu Val 2525 2530 2535 Ser Lys Leu Ser Gln Val Glu Gly Glu His Gln Leu Trp Lys Glu 2540 2545 2550 Gln Asn Leu Glu Leu Arg Asn Leu Thr Val Glu Leu Glu Gln Lys 2555 2560 2565 Ile Gln Val Leu Gln Ser Lys Asn Ala Ser Leu Gln Asp Thr Leu 2570 2575 2580 Glu Val Leu Gln Ser Ser Tyr Lys Asn Leu Glu Asn Glu Leu Glu 2585 2590 2595 Leu Thr Lys Met Asp Lys Met Ser Phe Val Glu Lys Val Asn Lys 2600 2605 2610 Met Thr Ala Lys Glu Thr Glu Leu Gln Arg Glu Met His Glu Met 2615 2620 2625 Ala Gln Lys Thr Ala Glu Leu Gln Glu Glu Leu Ser Gly Glu Lys 2630 2635 2640 Asn Arg Leu Ala Gly Glu Leu Gln Leu Leu Leu Glu Glu Ile Lys 2645 2650 2655 Ser Ser Lys Asp Gln Leu Lys Glu Leu Thr Leu Glu Asn Ser Glu 2660 2665 2670 Leu Lys Lys Ser Leu Asp Cys Met His Lys Asp Gln Val Glu Lys 2675 2680 2685 Glu Gly Lys Val Arg Glu Glu Ile Ala Glu Tyr Gln Leu Arg Leu 2690 2695 2700 His Glu Ala Glu Lys Lys His Gln Ala Leu Leu Leu Asp Thr Asn 2705 2710 2715 Lys Gln Tyr Glu Val Glu Ile Gln Thr Tyr Arg Glu Lys Leu Thr 2720 2725 2730 Ser Lys Glu Glu Cys Leu Ser Ser Gln Lys Leu Glu Ile Asp Leu 2735 2740 2745 Leu Lys Ser Ser Lys Glu Glu Leu Asn Asn Ser Leu Lys Ala Thr 2750 2755 2760 Thr Gln Ile Leu Glu Glu Leu Lys Lys Thr Lys Met Asp Asn Leu 2765 2770 2775 Lys Tyr Val Asn Gln Leu Lys Lys Glu Asn Glu Arg Ala Gln Gly 2780 2785 2790 Lys Met Lys Leu Leu Ile Lys Ser Cys Lys Gln Leu Glu Glu Glu 2795 2800 2805 Lys Glu Ile Leu Gln Lys Glu Leu Ser Gln Leu Gln Ala Ala Gln 2810 2815 2820 Glu Lys Gln Lys Thr Gly Thr Val Met Asp Thr Lys Val Asp Glu 2825 2830 2835 Leu Thr Thr Glu Ile Lys Glu Leu Lys Glu Thr Leu Glu Glu Lys 2840 2845 2850 Thr Lys Glu Ala Asp Glu Tyr Leu Asp Lys Tyr Cys Ser Leu Leu 2855 2860 2865 Ile Ser His Glu Lys Leu Glu Lys Ala Lys Glu Met Leu Glu Thr 2870 2875 2880 Gln Val Ala His Leu Cys Ser Gln Gln Ser Lys Gln Asp Ser Arg 2885 2890 2895 Gly Ser Pro Leu Leu Gly Pro Val Val Pro Gly Pro Ser Pro Ile 2900 2905 2910 Pro Ser Val Thr Glu Lys Arg Leu Ser Ser Gly Gln Asn Lys Ala 2915 2920 2925 Ser Gly Lys Arg Gln Arg Ser Ser Gly Ile Trp Glu Asn Gly Arg 2930 2935 2940 Gly Pro Thr Pro Ala Thr Pro Glu Ser Phe Ser Lys Lys Ser Lys 2945 2950 2955 Lys Ala Val Met Ser Gly Ile His Pro Ala Glu Asp Thr Glu Gly 2960 2965 2970 Thr Glu Phe Glu Pro Glu Gly Leu Pro Glu Val Val Lys Lys Gly 2975 2980 2985 Phe Ala Asp Ile Pro Thr Gly Lys Thr Ser Pro Tyr Ile Leu Arg 2990 2995 3000 Arg Thr Thr Met Ala Thr Arg Thr Ser Pro Arg Leu Ala Ala Gln 3005 3010 3015 Lys Leu Ala Leu Ser Pro Leu Ser Leu Gly Lys Glu Asn Leu Ala 3020 3025 3030 Glu Ser Ser Lys Pro Thr Ala Gly Gly Ser Arg Ser Gln Lys Val 3035 3040 3045 Lys Val Ala Gln Arg Ser Pro Val Asp Ser Gly Thr Ile Leu Arg 3050 3055 3060 Glu Pro Thr Thr Lys Ser Val Pro Val Asn Asn Leu Pro Glu Arg 3065 3070 3075 Ser Pro Thr Asp Ser Pro Arg Glu Gly Leu Arg Val Lys Arg Gly 3080 3085 3090 Arg Leu Val Pro Ser Pro Lys Ala Gly Leu Glu Ser Asn Gly Ser 3095 3100 3105 Glu Asn Cys Lys Val Gln 3110 5511130DNAMus musculusmisc_featureMouse centromere protein F (Cenpf), mRNA 55agtttgaatc gctcgtgctg gtcggggagg aacggtgcgc tgtgtgagga gctcggcggt 60gaggaactcg gggctcgcag agcccggagc caggttctgt gaggagctca gtttacttct 120aaatgcttta aaaataaaac aagatgagct gggccctgga agaatggaag gaaggtctcc 180cctccagagc tcttcagaag atccaagagc ttgaaggaca gctggagaag ctgaagaagg 240agaaacaaca gaggcagttc cagctggact ctctcgaagc tgcgctgcag aagcagaagc 300agaaggttga agacggaaag actgagggtg cagacctgaa aagggaaaat caaaggttga 360tggagatatg cgaacatttg gagaagtcaa ggcagaagct gtctcatgaa cttcaagtta 420aggagtcaca agtgaatctc caagagagcc aactgagctc atgcaaaaag caaatagaaa 480aactggaaca ggaacttaag cggtgtaaat ctgaatttga aagaagccaa caagttgcac 540aatcggcaga tgtttctctg aatccatgca gtacaccaca gaaactcttt gcaactccac 600tcacaccgag ttccacatac gaagatctga aagaaaaata taataaagaa gttgaagaac 660ggaagaggtt agaggaagag gttaaagctt tgcatgcaaa aaaagtgagc ctgcctgttt 720cccaagccac catgaaccac cgggacattg cgagacatca ggcttcctca tcagtgtttc 780cttggcaaca ggaaaatacc ccaagtcgcc tttcatcgga tgctctgaaa accccactga 840ggagagacgg ctctgctgct cactttttgg gggaagaagt gagtcctaac aaatcaagta 900tgaagacagg gagaggagac tgcagcagcc tccctggtga gcctcacagc gctcagcttt 960tgcaccaggc caaagcccag aatcaagacc taaaaagcaa gatgactgag ttagaactac 1020gcctgcaagg gcaagaaaag gaaatgagaa gccaagtgaa taaatgtcaa gacttacagc 1080tacagctgga gaagacgaaa gtggaattga ttgaaaagga gagaattttg aataaaacca 1140gagatgaagt agtgagaagc acagcacagt atgaccaggc cgcagccaag tgtactacct 1200tggaacaaaa gctgaaaact ttgactgagg agttgagttg tcaccgacag aacgcagaga 1260gtgctaaacg ttctctggaa cagaggatta aggagaaaga aaaggagctt caagaggagc 1320tgtcccgaca gcatcaatct ttccaagctc tggacagtga gtacactcag atgaaaacca 1380gacttaccca ggagttacag caagtcaagc atttgcacag caccctccag ctggaactgg 1440agaaggtcac atcagtgaag cagcagttag aaaggaattt ggaagaaatt aggcttaagt 1500tgagcagagc agaacaagct cttcaggcaa gtcaggtcgc agaaaacgag ctgaggagaa 1560gcagtgagga aatgaagaag gagaacagtc tcattaggag tcagtctgag cagaggacca 1620gagaagtctg ccacctggag gaagaacttg gtaaagtcaa agtgtctttg agtaagagcc 1680agaattttgc agaagaaatg aaggctaaga atacctctca ggaaatcatg ttacgagatc 1740ttcaggaaaa actaaatcag caagaaaact cactaacttt agagaagctg aaacttgccc 1800tagctgatct ggaaagacag cgaaactgtt ctcaagatct cttgaagaaa agggaacatc 1860acattgatca actgaataat aagttaaata agatagagaa agagtttgaa actttgctga 1920gtgctttgga attaaaaaag aaagaatgtg aagaattgaa agaagagaaa aatcagattt 1980ctttttggaa aattgatagt gaaaaactca taaatcagat agaatcagaa aaagaaatct 2040tattgggtaa aattaaccac ttagagacca gcctcaagac acaacaagta agtcctgact 2100ctaatgagag aataagaaca ctggagatgg aaagagaaaa ctttactgtg gagattaaaa 2160accttcaaag tatgttagac agcaagatgg tagagatcaa gacacagaaa caagcttact 2220tggaactgca gcagaaatcc gaatcctcgg accaaaagca tcagaaggag atagagaata 2280tgtgcttgaa agcaaataag ctcactgggc aagttgaaag tttggaatgt aagcttcagt 2340tattgtcaag tgaagtagtg accaaagacc agcagtacca agacttgcgt atggaatatg 2400agacactgag ggatttgctc aagtccagag gatcttctct ggtgacaaat gaggataatc 2460agcgaagttc tgaggataat cagagaagtt ctgaggataa tcagagaggc tctttggctt 2520ttgaacagca gcctgcagtg agtgattcct ttgcaaatgt aatggggaga aaaggaagca 2580taaattcaga aaggagtgac tgctctgtag atgggggccg aagtccagaa catatagcca 2640tcttacaaaa tagagtcact tcacttgaaa gttccttgga gtctcaaaac cagatgaatt 2700cagatttgca aatgcggtgt gaagagttgc tacaaatcaa aggggaagta gaagaaaacc 2760tcagtaaagc agagcagatt catcagaatt ttgtggctga aacaaatcaa tgtattagta 2820aattgcagga agatgctgca gttcatcaga atattgttgc tgagacttta gcaacccttg 2880agagtaagga aaaagagtta cagcttttga aagaaaaatt agaagctcag caaacagagg 2940ttcaaaagtt aaataagaat aactgtcttc ttgaaggtac tctgaaggag ctacagcttt 3000tatctgacac tctgagctca gagaagaagg aaatgaattc tatcatctca ttaagtaaaa 3060aaaacattga agagttaacc caagcaaacg aggctctcaa ggaagttaat gaggccttag 3120agcaggagaa aatgaattta ctccaaaagc atgagaagat tacaagctgt atagcagaac 3180aagagagaag cattgcagag ctgtctgatc agtacaagca agaaagactt caattattac 3240aacggtgtga agaaacagaa gctgtgttgg aagatctcag gggaaactac aaaacagcac 3300aagaaaacaa tgctaagtta gaatgcatgc tcagcgagtg cactgctctt tgtgaaaata 3360gaaaaaatga actggagcag ttaaaggaaa catttgcaaa ggaacagcaa gaattcttaa 3420caaaattagc tttcgctgaa gagcaaaaca ggaaactaat gctagagttg gagatagagc 3480aacaaactgt gagatccgag attacaaaca ccaacaagca ttccatgagt gcgactgatg 3540gcttaaggca agaatgcttg actttaaacg aagagcaaaa tgagcagcaa aacgaagtta 3600gcaacttaac acatgagaat gagcaactga tggagttaac acagaccaaa catgattctt 3660atctcgcagt agagccagtt gagaactctg taaaagcaac cgaagatgag ataggtaaga 3720gtagttccca gtaccagatg gatatcgaca ctaaagacat ttctctagat agttataagg 3780cacagctggt acatctagaa gctttggtaa gaattctgga agtacagctt gaccaaagtg 3840aggaggagaa caagaagctg catctggaat tacagacgat tagagaggag ctagaaacca 3900agagttcaca ggacccccag tcacaggcaa ggactgggct taaagactgt gacacagcag 3960aagaaaagta tgtgtccatg ctacaggagt tgtcagcaag tcaaaacgag aatgcacact 4020tacagtgctc tctacagaca gcagtgaaca aactgaatga gctagggaaa atgtgtgacg 4080tattgagagt tgaaaagtta cagctagagt ctgagctgaa tgactcacgg acagagtgta 4140tcacggcaac tagtcagatg acggcagagg tcgagaagct agtgagtgaa atgaaaatgc 4200taaaccacga gagtgctctg tcccagaatg agctgatgaa ggacacctca ggtggtgaat 4260ttcatgataa agcaaaccac agttctgtgt tcttgactcc tttggacagt agcaatttct 4320gtgaacagat gaccttgtca agcaaagagg tccgagtgca ctttgctgaa ttacaggaga 4380aattctcctg tttacaaagt gaacacaaaa ttttacatga tcagcactgt gaggtgagct 4440ctaagatgtc agcactgcgt tcctacgtgg acacattaaa agctgaaaat tctgccttgt 4500caatgagtct gagaaccttg cagggtgact tggtaaagga gggggagcct gcagctgagg 4560gtgggcatgg tctgccactg tcgttctgtg gggcagacag cccgtctctg acaaattttg 4620gagaaacgtc cttttacaaa gacgttttag aacaaactgg agacacatgt catctaagtt 4680tagaagggaa cgcttcagca aattcttgtg acttggatga agagttctcc agcagtctgg 4740aggaggagac tctgactgag aaggaaagcc cacctgcccc tgggaggact gttgagggac 4800ttgaagtcct atgccaggtg tacttgcagt ccctcaagaa tctagaggag aaaactgaga 4860gccaaaggat tatgaaaaat aaagaaattg

aaaagcttga gcagttactg agttctgaga 4920ggaaagagct aagctgcctt aggaagcagt atttgtcaga aaaggagcaa tggcagcaga 4980agctaacaag tgtcactttg gaaatggagt ccaagttagc agaggagaag cagcagacca 5040agactctgtc ccttgaactt gaggtagcac gacttcagtt acaggagctg gacctgagct 5100ccaggtcttt gcttggcact gacttggaaa gtgttgttcg gtgccaaaac gataattatg 5160atataaaaga atcagaagta tatatttcag agactacaga gaaaacacca aagcaggaca 5220ctgaccaaac ttgtgataaa gatattcagc aggaccttgg tctggaaact tcagtcactg 5280agagtgagac taccaggctc acaggagagg ggtgtgaaga gcagcctccg aagaccaatt 5340gtgaggcacc agcggaggac aaaacccagg actgctcaga atgcatttct gaattgtgtt 5400ctagttccaa tgttttggtg cccatggatg ttctggaaga tcaggggtct atccagaatc 5460tccagttgca gaaagacacc ttaaatgaga atttgagatt acttcctgaa gtagaggact 5520gggacaaaaa agttgaaagt ttgctaaatg aaattatgga ggcagattca aaactgagtt 5580tacaggaagt acagctcaag atgaagattg caacatgcat acaattggaa aaaatagtca 5640aggacctcag aaaggaaaaa gctgacttaa gtgaaaagtt ggaatccctt ccatgtaacc 5700aggaggtatg tctgagagta gaaaggtcag aagaagatct tggttttaat ttagatatgg 5760gagcaaatga gttgttaagt aaatctacta aagataatgc aaccaacaca gaagacaatt 5820ataaggagaa gtttcttgat atggaaagag aactgaccag aattaagtct gagaaagcta 5880atattgagca tcacatccta tctgtggaaa ctaacttaga ggtggttcaa gcagagaagc 5940tctgtttgga aagagacact gaaagtaagc aaaaggttat tattgacctt aaagaagaac 6000tatttacagt tataagtgag agaaacagac ttcgggaaga attagataat gtgtcaaaag 6060aaagcaaagc actggatcag atgtctaaaa agatgaaaga gaaaatagaa gagctggagt 6120ctcaccaaag ggagagcctc cgtcacattg gggcagtaga gtctgaggtc aaggacaaag 6180cagatcttat tcagactctg tcctttaatg tgggtgagct aacaaaagac aaagctcatc 6240tccaggagca gctgcagaat ttgcagaatg actcacaaga attatctttg gcgattggtg 6300agctggaaat acaaattgga caactgaata aagagaaaga atcactggtc aaggagtctc 6360agaacttcca gatcaagctg actgagtcag agtgtgaaaa gcagacgatc tctaaggcct 6420tggaggtggc actcaaggag aaaggtgagt ttgcagtgca gctgagctca gcccaggagg 6480aggtgcatca gctgagacga ggcattgaga aactgagcgt ccgcattgag gccgatgaga 6540agaagcacct cagtgctgtg gcgaagctga aagaaagcca gcgtgaaagc gactcattga 6600aggatacagt ggagactctg gagcgggaac tggagaggtc agaagaaaac caagagctgg 6660caattcttga ttctgagaat ttgaaagcag aggtggagac ccttaaggca caaaaggatg 6720aaatgaccaa aagcctgaga attttcgaat tagaccttgt tacagttagg actgaaagag 6780aaaatctagc aaagcagcta caagagaaac aaagtcgagt gtcagaatta gatgaacggt 6840gctcttcctt gagaagactg ttggaagaga aggagcaagc aagagtacag atggaagaag 6900actctaagtc tgcaatgctg atgcttcaga tgcagttaaa agaactcagg gaggaagtgg 6960cagccttgtg taatgaccaa gaaaccttga aggcccaaga acagagtcta gaccaaccag 7020gggaggaagt gcatcatttg aaaagtagca ttcgaaagct caaagttcac atagatgctg 7080atgaaaagaa gcatcaaaac atcctagaac aactgaagga aagtaagcac catgcagact 7140tgcttaagga ccgagttgag aaccttgaac aagaattgat actatcagag aaaaacatga 7200ttttccaagc tgaaaagtcc aaagcagaga tacagacttt aaaatcagaa attcaaagaa 7260tggcccaaaa cctccaagac ttgcagttag aacttattag tacaaggtca gaaaatgaaa 7320atctcatgaa agaattaaaa aaagagcaag agcgagtatc tgacttagaa acaataaatt 7380cttctattga aaacttactg aaagataaag agcaagaaaa agtacagatg aaagaggaag 7440ccaaaataac agtggagatg cttcaaactc aattaaagga gctaaacgag acagtggttt 7500ccttgtgcaa tgaccaagag gtctctaaga ccaaagaaca gaatctgggt agtcaagtac 7560aaactcttga acttgagaag gctcagctgc tacaggacct tggtgaggcc aagaataaat 7620atattatttt tcagtcatct gtaaatgccc tcactcaaga agtagaagct ggcaaacaga 7680aactagagaa gggggagaaa gagatcagga cactgaaaga gcaacttaaa agtcaggagc 7740agcttgtgtg taaacttgcc caagtggaag gagagcagca actctggcag aagcagaaac 7800tagagctgag aaatgtgact atggcactgg agcagaaggt ccaagtgctg caatctgaaa 7860acaacacgtt gcagagcacc tatgaagcac tgcagaattc ccacaagagt ttagagagtg 7920aacttggatt gataaagttg gagaaagtag cgcttgttga aagagttagc acaatatctg 7980ggaaggaagc agagctgcag agggagctgc gagatatgct acagaaaaca acacagctga 8040gcgaagacta caataaagag aaaaacaggc taacagaaga agtggaagtg ctgcgtgaag 8100aactgcagaa caccaaagca gcgcacctga aatctgtgaa tcaacttgag aaggaacttc 8160agcgtgctca ggggaaaata aagttgatgc tcaaatcctg tagacagctg gaaggagaaa 8220aggagatgct gcagaaggag ctctcccagc ttgaagctgc acagcagcag agagcaggtt 8280ctcttgtaga cagtaacgta gatgaagtaa tgactgagaa caaagcgctg aaagagactc 8340tggaagaaaa agtcaaggaa gcagataagt acttggataa gtactgttcc ctgctgataa 8400gccacgagga gctcgagaaa gccaaggaga tattagaaat agaagttgct cggctgaagt 8460cacggcagtc cagacaggat ctccagagtt ctcctttgct taattcttcc attccaggac 8520cgtctccaaa tacttctgtt agtgagatga agtcagcatc tggccaaaat aaagcttcag 8580gcaagaggca aaggtccagt gggatttggg agcatggtaa acgggcagca ccttctacag 8640cagagacatt ttctaagaaa agcaggaagt cggacagtaa gagcactcgc cctgctgagc 8700acgagcagga aaccgagttt gagccagaag gcctcccaga agtcgttaaa aaagggtttg 8760ctgacatccc aactggaaag acaagcccat atatccttcg gagaacaacc atggcaacca 8820ggaccagccc ccgctttgct acacagaagt tagtgggatc ttccccatct ctgggcaaag 8880aaaatgttgt agagtcctcc aaaccaacag ctggtggcag cagatcacaa aaggtcaagg 8940ttgttcagga gagctcagcg gattcacaca ctgccttcca agaactccca gcaaaatctc 9000tcacagccag taatattcct gggagaaact ctacagagag ccccagggag ggcctgaggg 9060ccaagcgggc ctaccctgcc tccagcccag ctgctgggcc tgatcccacg aacaacgaaa 9120actgccgggt ccagtgaagt gtccactcag ggttctggaa ggtggcatta ctcaaaggag 9180cctgcctgtg gggacttgtc ttgagccaag gacacattat gtatcactag agaatacctg 9240agtctttatg ctgtgtgtgt ggtgctcagg tctcccatat gtaagactgc aaacgttgaa 9300agcacccatt acctagtagt cctaatcctt aaccctaagt gtaaatagca gtggatagag 9360cgagagcatt tgctgcagtt aaatgggaag cgccatgatt tgtatgtgca ttttacactt 9420gctactgcag tgatttgatt aggatcttcc tgtgtagatt gttaggcatc aaatcgttgt 9480agatcaagag ttggagctga gttaagtgag gacagcctgt gtgcacagtg tgtggtatgg 9540tcctcctttc tgtgtgtttc ataacttcct gcttctctga cctgtccata gcgtgtgggg 9600agtttgcagt gtgcacttac tactagttag tctgattgtt tcatacactt ttgtggtggt 9660gtagatcatg tttactgtca ctgttttcct gtcatcatag ttcttttggt atatatttct 9720gtgtctggtg atatattaaa gtatgtcctt gtaaactttt ttgtaaaagt tatttcctaa 9780atataaaaac attatgacta gcaccactat gtcttcttaa ctaaaaccac ctcccataaa 9840agtaaaaatg tttgaacaaa tgatacatgt ctttgaatgt gtgatactag tatacttact 9900gaacgtgaga catactgtag aatgttggtc atacagatgg tttgagaata tggatatatt 9960aaactagtat cttgtgctca ttaaatacta ttagcaaagg tacaagaatg ttcccatctg 10020tctgttgata atagggcttg aaaagatgaa ggcattttga ctcaataaca aatgaaaaca 10080cttgactaag cctctgtgcc gttgaataaa ggtgaaaggt tttccggctt taagttagta 10140gtagatgatc tgttcttggc tttcatttca gattggtatc aaatgttcac aaacacagtc 10200attttagatt tgaaaactgt ctcctgctgg tggtttcact gttggaatat aaaccactcc 10260atcccctgag agcgatgctc tactctctca ggttgctcct gtcccaaggc caccatgtgc 10320tccagcgctg aggtcaggcc agcagcttta agggatgcca caagagatgg aaagatccca 10380tgccagggtg tcaccaagta ctttccagcg tccttaggaa tggcgtcctc ttcttgtagg 10440ccatagctcc tctgtgacat gggatacttg cattcccaga agcaatggac tcatcttttg 10500gttgcgtgcc aagctgaggg taaagaatgg cttgtttgtt gctgcaaatg aggaatatgt 10560agacgatggt ccttggagag cagtatctga atagaaagca aaaggctttc attggtgaaa 10620taccaggcat catgtgtgga cacatttctg aacatgttct gtgtggggtg agaaggtaat 10680gacaggttca ttgtgtagcc tggctgccac aggtctcatc tgcctgcatc tgtctcccag 10740gtcctgggat taaatgcgta taccaccaag cttgcaggtc agtgtttgaa ctttaatatt 10800tataatccct tttcacatga gactctgtac ctggtatata atacaaatca gatgtgtact 10860gataaattga aagtttattt tagactgaga atgtgactca gtgttcaagt attgtgtagt 10920atgctcaaga acaggctttg aggggctggt gagatggctc agtgggtaag agcacctgac 10980tgctcttctg aaggtccgga gttcaaatcc cagcaaccac atggtggctc acaaccatct 11040gtaacgaaat ctggcaccct cttctggagt gactgaagac agctacagtg tacttacata 11100taataaataa ataaatcttt aaaaaaaaaa 11130562997PRTMus musculusmisc_featureMouse centromere protein F 56Met Ser Trp Ala Leu Glu Glu Trp Lys Glu Gly Leu Pro Ser Arg Ala 1 5 10 15 Leu Gln Lys Ile Gln Glu Leu Glu Gly Gln Leu Glu Lys Leu Lys Lys 20 25 30 Glu Lys Gln Gln Arg Gln Phe Gln Leu Asp Ser Leu Glu Ala Ala Leu 35 40 45 Gln Lys Gln Lys Gln Lys Val Glu Asp Gly Lys Thr Glu Gly Ala Asp 50 55 60 Leu Lys Arg Glu Asn Gln Arg Leu Met Glu Ile Cys Glu His Leu Glu 65 70 75 80 Lys Ser Arg Gln Lys Leu Ser His Glu Leu Gln Val Lys Glu Ser Gln 85 90 95 Val Asn Leu Gln Glu Ser Gln Leu Ser Ser Cys Lys Lys Gln Ile Glu 100 105 110 Lys Leu Glu Gln Glu Leu Lys Arg Cys Lys Ser Glu Phe Glu Arg Ser 115 120 125 Gln Gln Val Ala Gln Ser Ala Asp Val Ser Leu Asn Pro Cys Ser Thr 130 135 140 Pro Gln Lys Leu Phe Ala Thr Pro Leu Thr Pro Ser Ser Thr Tyr Glu 145 150 155 160 Asp Leu Lys Glu Lys Tyr Asn Lys Glu Val Glu Glu Arg Lys Arg Leu 165 170 175 Glu Glu Glu Val Lys Ala Leu His Ala Lys Lys Val Ser Leu Pro Val 180 185 190 Ser Gln Ala Thr Met Asn His Arg Asp Ile Ala Arg His Gln Ala Ser 195 200 205 Ser Ser Val Phe Pro Trp Gln Gln Glu Asn Thr Pro Ser Arg Leu Ser 210 215 220 Ser Asp Ala Leu Lys Thr Pro Leu Arg Arg Asp Gly Ser Ala Ala His 225 230 235 240 Phe Leu Gly Glu Glu Val Ser Pro Asn Lys Ser Ser Met Lys Thr Gly 245 250 255 Arg Gly Asp Cys Ser Ser Leu Pro Gly Glu Pro His Ser Ala Gln Leu 260 265 270 Leu His Gln Ala Lys Ala Gln Asn Gln Asp Leu Lys Ser Lys Met Thr 275 280 285 Glu Leu Glu Leu Arg Leu Gln Gly Gln Glu Lys Glu Met Arg Ser Gln 290 295 300 Val Asn Lys Cys Gln Asp Leu Gln Leu Gln Leu Glu Lys Thr Lys Val 305 310 315 320 Glu Leu Ile Glu Lys Glu Arg Ile Leu Asn Lys Thr Arg Asp Glu Val 325 330 335 Val Arg Ser Thr Ala Gln Tyr Asp Gln Ala Ala Ala Lys Cys Thr Thr 340 345 350 Leu Glu Gln Lys Leu Lys Thr Leu Thr Glu Glu Leu Ser Cys His Arg 355 360 365 Gln Asn Ala Glu Ser Ala Lys Arg Ser Leu Glu Gln Arg Ile Lys Glu 370 375 380 Lys Glu Lys Glu Leu Gln Glu Glu Leu Ser Arg Gln His Gln Ser Phe 385 390 395 400 Gln Ala Leu Asp Ser Glu Tyr Thr Gln Met Lys Thr Arg Leu Thr Gln 405 410 415 Glu Leu Gln Gln Val Lys His Leu His Ser Thr Leu Gln Leu Glu Leu 420 425 430 Glu Lys Val Thr Ser Val Lys Gln Gln Leu Glu Arg Asn Leu Glu Glu 435 440 445 Ile Arg Leu Lys Leu Ser Arg Ala Glu Gln Ala Leu Gln Ala Ser Gln 450 455 460 Val Ala Glu Asn Glu Leu Arg Arg Ser Ser Glu Glu Met Lys Lys Glu 465 470 475 480 Asn Ser Leu Ile Arg Ser Gln Ser Glu Gln Arg Thr Arg Glu Val Cys 485 490 495 His Leu Glu Glu Glu Leu Gly Lys Val Lys Val Ser Leu Ser Lys Ser 500 505 510 Gln Asn Phe Ala Glu Glu Met Lys Ala Lys Asn Thr Ser Gln Glu Ile 515 520 525 Met Leu Arg Asp Leu Gln Glu Lys Leu Asn Gln Gln Glu Asn Ser Leu 530 535 540 Thr Leu Glu Lys Leu Lys Leu Ala Leu Ala Asp Leu Glu Arg Gln Arg 545 550 555 560 Asn Cys Ser Gln Asp Leu Leu Lys Lys Arg Glu His His Ile Asp Gln 565 570 575 Leu Asn Asn Lys Leu Asn Lys Ile Glu Lys Glu Phe Glu Thr Leu Leu 580 585 590 Ser Ala Leu Glu Leu Lys Lys Lys Glu Cys Glu Glu Leu Lys Glu Glu 595 600 605 Lys Asn Gln Ile Ser Phe Trp Lys Ile Asp Ser Glu Lys Leu Ile Asn 610 615 620 Gln Ile Glu Ser Glu Lys Glu Ile Leu Leu Gly Lys Ile Asn His Leu 625 630 635 640 Glu Thr Ser Leu Lys Thr Gln Gln Val Ser Pro Asp Ser Asn Glu Arg 645 650 655 Ile Arg Thr Leu Glu Met Glu Arg Glu Asn Phe Thr Val Glu Ile Lys 660 665 670 Asn Leu Gln Ser Met Leu Asp Ser Lys Met Val Glu Ile Lys Thr Gln 675 680 685 Lys Gln Ala Tyr Leu Glu Leu Gln Gln Lys Ser Glu Ser Ser Asp Gln 690 695 700 Lys His Gln Lys Glu Ile Glu Asn Met Cys Leu Lys Ala Asn Lys Leu 705 710 715 720 Thr Gly Gln Val Glu Ser Leu Glu Cys Lys Leu Gln Leu Leu Ser Ser 725 730 735 Glu Val Val Thr Lys Asp Gln Gln Tyr Gln Asp Leu Arg Met Glu Tyr 740 745 750 Glu Thr Leu Arg Asp Leu Leu Lys Ser Arg Gly Ser Ser Leu Val Thr 755 760 765 Asn Glu Asp Asn Gln Arg Ser Ser Glu Asp Asn Gln Arg Ser Ser Glu 770 775 780 Asp Asn Gln Arg Gly Ser Leu Ala Phe Glu Gln Gln Pro Ala Val Ser 785 790 795 800 Asp Ser Phe Ala Asn Val Met Gly Arg Lys Gly Ser Ile Asn Ser Glu 805 810 815 Arg Ser Asp Cys Ser Val Asp Gly Gly Arg Ser Pro Glu His Ile Ala 820 825 830 Ile Leu Gln Asn Arg Val Thr Ser Leu Glu Ser Ser Leu Glu Ser Gln 835 840 845 Asn Gln Met Asn Ser Asp Leu Gln Met Arg Cys Glu Glu Leu Leu Gln 850 855 860 Ile Lys Gly Glu Val Glu Glu Asn Leu Ser Lys Ala Glu Gln Ile His 865 870 875 880 Gln Asn Phe Val Ala Glu Thr Asn Gln Cys Ile Ser Lys Leu Gln Glu 885 890 895 Asp Ala Ala Val His Gln Asn Ile Val Ala Glu Thr Leu Ala Thr Leu 900 905 910 Glu Ser Lys Glu Lys Glu Leu Gln Leu Leu Lys Glu Lys Leu Glu Ala 915 920 925 Gln Gln Thr Glu Val Gln Lys Leu Asn Lys Asn Asn Cys Leu Leu Glu 930 935 940 Gly Thr Leu Lys Glu Leu Gln Leu Leu Ser Asp Thr Leu Ser Ser Glu 945 950 955 960 Lys Lys Glu Met Asn Ser Ile Ile Ser Leu Ser Lys Lys Asn Ile Glu 965 970 975 Glu Leu Thr Gln Ala Asn Glu Ala Leu Lys Glu Val Asn Glu Ala Leu 980 985 990 Glu Gln Glu Lys Met Asn Leu Leu Gln Lys His Glu Lys Ile Thr Ser 995 1000 1005 Cys Ile Ala Glu Gln Glu Arg Ser Ile Ala Glu Leu Ser Asp Gln 1010 1015 1020 Tyr Lys Gln Glu Arg Leu Gln Leu Leu Gln Arg Cys Glu Glu Thr 1025 1030 1035 Glu Ala Val Leu Glu Asp Leu Arg Gly Asn Tyr Lys Thr Ala Gln 1040 1045 1050 Glu Asn Asn Ala Lys Leu Glu Cys Met Leu Ser Glu Cys Thr Ala 1055 1060 1065 Leu Cys Glu Asn Arg Lys Asn Glu Leu Glu Gln Leu Lys Glu Thr 1070 1075 1080 Phe Ala Lys Glu Gln Gln Glu Phe Leu Thr Lys Leu Ala Phe Ala 1085 1090 1095 Glu Glu Gln Asn Arg Lys Leu Met Leu Glu Leu Glu Ile Glu Gln 1100 1105 1110 Gln Thr Val Arg Ser Glu Ile Thr Asn Thr Asn Lys His Ser Met 1115 1120 1125 Ser Ala Thr Asp Gly Leu Arg Gln Glu Cys Leu Thr Leu Asn Glu 1130 1135 1140 Glu Gln Asn Glu Gln Gln Asn Glu Val Ser Asn Leu Thr His Glu 1145 1150 1155 Asn Glu Gln Leu Met Glu Leu Thr Gln Thr Lys His Asp Ser Tyr 1160 1165 1170 Leu Ala Val Glu Pro Val Glu Asn Ser Val Lys Ala Thr Glu Asp 1175 1180 1185 Glu Ile Gly Lys Ser Ser Ser Gln Tyr Gln Met Asp Ile Asp Thr 1190 1195 1200 Lys Asp Ile Ser Leu Asp Ser Tyr Lys Ala Gln Leu Val His Leu 1205 1210 1215 Glu Ala Leu Val Arg Ile Leu Glu Val Gln Leu Asp Gln Ser Glu 1220 1225 1230 Glu Glu Asn Lys Lys Leu His Leu Glu Leu Gln Thr Ile Arg Glu 1235 1240 1245 Glu Leu Glu Thr Lys Ser Ser Gln Asp Pro Gln Ser Gln Ala Arg 1250 1255 1260 Thr Gly Leu Lys Asp Cys Asp Thr Ala Glu Glu Lys Tyr Val Ser 1265 1270 1275 Met Leu Gln Glu Leu Ser Ala Ser Gln Asn Glu Asn Ala His Leu 1280 1285 1290 Gln Cys Ser Leu Gln Thr Ala Val Asn Lys Leu Asn Glu Leu Gly 1295 1300 1305 Lys Met Cys Asp Val Leu Arg Val Glu Lys Leu Gln Leu Glu Ser 1310 1315

1320 Glu Leu Asn Asp Ser Arg Thr Glu Cys Ile Thr Ala Thr Ser Gln 1325 1330 1335 Met Thr Ala Glu Val Glu Lys Leu Val Ser Glu Met Lys Met Leu 1340 1345 1350 Asn His Glu Ser Ala Leu Ser Gln Asn Glu Leu Met Lys Asp Thr 1355 1360 1365 Ser Gly Gly Glu Phe His Asp Lys Ala Asn His Ser Ser Val Phe 1370 1375 1380 Leu Thr Pro Leu Asp Ser Ser Asn Phe Cys Glu Gln Met Thr Leu 1385 1390 1395 Ser Ser Lys Glu Val Arg Val His Phe Ala Glu Leu Gln Glu Lys 1400 1405 1410 Phe Ser Cys Leu Gln Ser Glu His Lys Ile Leu His Asp Gln His 1415 1420 1425 Cys Glu Val Ser Ser Lys Met Ser Ala Leu Arg Ser Tyr Val Asp 1430 1435 1440 Thr Leu Lys Ala Glu Asn Ser Ala Leu Ser Met Ser Leu Arg Thr 1445 1450 1455 Leu Gln Gly Asp Leu Val Lys Glu Gly Glu Pro Ala Ala Glu Gly 1460 1465 1470 Gly His Gly Leu Pro Leu Ser Phe Cys Gly Ala Asp Ser Pro Ser 1475 1480 1485 Leu Thr Asn Phe Gly Glu Thr Ser Phe Tyr Lys Asp Val Leu Glu 1490 1495 1500 Gln Thr Gly Asp Thr Cys His Leu Ser Leu Glu Gly Asn Ala Ser 1505 1510 1515 Ala Asn Ser Cys Asp Leu Asp Glu Glu Phe Ser Ser Ser Leu Glu 1520 1525 1530 Glu Glu Thr Leu Thr Glu Lys Glu Ser Pro Pro Ala Pro Gly Arg 1535 1540 1545 Thr Val Glu Gly Leu Glu Val Leu Cys Gln Val Tyr Leu Gln Ser 1550 1555 1560 Leu Lys Asn Leu Glu Glu Lys Thr Glu Ser Gln Arg Ile Met Lys 1565 1570 1575 Asn Lys Glu Ile Glu Lys Leu Glu Gln Leu Leu Ser Ser Glu Arg 1580 1585 1590 Lys Glu Leu Ser Cys Leu Arg Lys Gln Tyr Leu Ser Glu Lys Glu 1595 1600 1605 Gln Trp Gln Gln Lys Leu Thr Ser Val Thr Leu Glu Met Glu Ser 1610 1615 1620 Lys Leu Ala Glu Glu Lys Gln Gln Thr Lys Thr Leu Ser Leu Glu 1625 1630 1635 Leu Glu Val Ala Arg Leu Gln Leu Gln Glu Leu Asp Leu Ser Ser 1640 1645 1650 Arg Ser Leu Leu Gly Thr Asp Leu Glu Ser Val Val Arg Cys Gln 1655 1660 1665 Asn Asp Asn Tyr Asp Ile Lys Glu Ser Glu Val Tyr Ile Ser Glu 1670 1675 1680 Thr Thr Glu Lys Thr Pro Lys Gln Asp Thr Asp Gln Thr Cys Asp 1685 1690 1695 Lys Asp Ile Gln Gln Asp Leu Gly Leu Glu Thr Ser Val Thr Glu 1700 1705 1710 Ser Glu Thr Thr Arg Leu Thr Gly Glu Gly Cys Glu Glu Gln Pro 1715 1720 1725 Pro Lys Thr Asn Cys Glu Ala Pro Ala Glu Asp Lys Thr Gln Asp 1730 1735 1740 Cys Ser Glu Cys Ile Ser Glu Leu Cys Ser Ser Ser Asn Val Leu 1745 1750 1755 Val Pro Met Asp Val Leu Glu Asp Gln Gly Ser Ile Gln Asn Leu 1760 1765 1770 Gln Leu Gln Lys Asp Thr Leu Asn Glu Asn Leu Arg Leu Leu Pro 1775 1780 1785 Glu Val Glu Asp Trp Asp Lys Lys Val Glu Ser Leu Leu Asn Glu 1790 1795 1800 Ile Met Glu Ala Asp Ser Lys Leu Ser Leu Gln Glu Val Gln Leu 1805 1810 1815 Lys Met Lys Ile Ala Thr Cys Ile Gln Leu Glu Lys Ile Val Lys 1820 1825 1830 Asp Leu Arg Lys Glu Lys Ala Asp Leu Ser Glu Lys Leu Glu Ser 1835 1840 1845 Leu Pro Cys Asn Gln Glu Val Cys Leu Arg Val Glu Arg Ser Glu 1850 1855 1860 Glu Asp Leu Gly Phe Asn Leu Asp Met Gly Ala Asn Glu Leu Leu 1865 1870 1875 Ser Lys Ser Thr Lys Asp Asn Ala Thr Asn Thr Glu Asp Asn Tyr 1880 1885 1890 Lys Glu Lys Phe Leu Asp Met Glu Arg Glu Leu Thr Arg Ile Lys 1895 1900 1905 Ser Glu Lys Ala Asn Ile Glu His His Ile Leu Ser Val Glu Thr 1910 1915 1920 Asn Leu Glu Val Val Gln Ala Glu Lys Leu Cys Leu Glu Arg Asp 1925 1930 1935 Thr Glu Ser Lys Gln Lys Val Ile Ile Asp Leu Lys Glu Glu Leu 1940 1945 1950 Phe Thr Val Ile Ser Glu Arg Asn Arg Leu Arg Glu Glu Leu Asp 1955 1960 1965 Asn Val Ser Lys Glu Ser Lys Ala Leu Asp Gln Met Ser Lys Lys 1970 1975 1980 Met Lys Glu Lys Ile Glu Glu Leu Glu Ser His Gln Arg Glu Ser 1985 1990 1995 Leu Arg His Ile Gly Ala Val Glu Ser Glu Val Lys Asp Lys Ala 2000 2005 2010 Asp Leu Ile Gln Thr Leu Ser Phe Asn Val Gly Glu Leu Thr Lys 2015 2020 2025 Asp Lys Ala His Leu Gln Glu Gln Leu Gln Asn Leu Gln Asn Asp 2030 2035 2040 Ser Gln Glu Leu Ser Leu Ala Ile Gly Glu Leu Glu Ile Gln Ile 2045 2050 2055 Gly Gln Leu Asn Lys Glu Lys Glu Ser Leu Val Lys Glu Ser Gln 2060 2065 2070 Asn Phe Gln Ile Lys Leu Thr Glu Ser Glu Cys Glu Lys Gln Thr 2075 2080 2085 Ile Ser Lys Ala Leu Glu Val Ala Leu Lys Glu Lys Gly Glu Phe 2090 2095 2100 Ala Val Gln Leu Ser Ser Ala Gln Glu Glu Val His Gln Leu Arg 2105 2110 2115 Arg Gly Ile Glu Lys Leu Ser Val Arg Ile Glu Ala Asp Glu Lys 2120 2125 2130 Lys His Leu Ser Ala Val Ala Lys Leu Lys Glu Ser Gln Arg Glu 2135 2140 2145 Ser Asp Ser Leu Lys Asp Thr Val Glu Thr Leu Glu Arg Glu Leu 2150 2155 2160 Glu Arg Ser Glu Glu Asn Gln Glu Leu Ala Ile Leu Asp Ser Glu 2165 2170 2175 Asn Leu Lys Ala Glu Val Glu Thr Leu Lys Ala Gln Lys Asp Glu 2180 2185 2190 Met Thr Lys Ser Leu Arg Ile Phe Glu Leu Asp Leu Val Thr Val 2195 2200 2205 Arg Thr Glu Arg Glu Asn Leu Ala Lys Gln Leu Gln Glu Lys Gln 2210 2215 2220 Ser Arg Val Ser Glu Leu Asp Glu Arg Cys Ser Ser Leu Arg Arg 2225 2230 2235 Leu Leu Glu Glu Lys Glu Gln Ala Arg Val Gln Met Glu Glu Asp 2240 2245 2250 Ser Lys Ser Ala Met Leu Met Leu Gln Met Gln Leu Lys Glu Leu 2255 2260 2265 Arg Glu Glu Val Ala Ala Leu Cys Asn Asp Gln Glu Thr Leu Lys 2270 2275 2280 Ala Gln Glu Gln Ser Leu Asp Gln Pro Gly Glu Glu Val His His 2285 2290 2295 Leu Lys Ser Ser Ile Arg Lys Leu Lys Val His Ile Asp Ala Asp 2300 2305 2310 Glu Lys Lys His Gln Asn Ile Leu Glu Gln Leu Lys Glu Ser Lys 2315 2320 2325 His His Ala Asp Leu Leu Lys Asp Arg Val Glu Asn Leu Glu Gln 2330 2335 2340 Glu Leu Ile Leu Ser Glu Lys Asn Met Ile Phe Gln Ala Glu Lys 2345 2350 2355 Ser Lys Ala Glu Ile Gln Thr Leu Lys Ser Glu Ile Gln Arg Met 2360 2365 2370 Ala Gln Asn Leu Gln Asp Leu Gln Leu Glu Leu Ile Ser Thr Arg 2375 2380 2385 Ser Glu Asn Glu Asn Leu Met Lys Glu Leu Lys Lys Glu Gln Glu 2390 2395 2400 Arg Val Ser Asp Leu Glu Thr Ile Asn Ser Ser Ile Glu Asn Leu 2405 2410 2415 Leu Lys Asp Lys Glu Gln Glu Lys Val Gln Met Lys Glu Glu Ala 2420 2425 2430 Lys Ile Thr Val Glu Met Leu Gln Thr Gln Leu Lys Glu Leu Asn 2435 2440 2445 Glu Thr Val Val Ser Leu Cys Asn Asp Gln Glu Val Ser Lys Thr 2450 2455 2460 Lys Glu Gln Asn Leu Gly Ser Gln Val Gln Thr Leu Glu Leu Glu 2465 2470 2475 Lys Ala Gln Leu Leu Gln Asp Leu Gly Glu Ala Lys Asn Lys Tyr 2480 2485 2490 Ile Ile Phe Gln Ser Ser Val Asn Ala Leu Thr Gln Glu Val Glu 2495 2500 2505 Ala Gly Lys Gln Lys Leu Glu Lys Gly Glu Lys Glu Ile Arg Thr 2510 2515 2520 Leu Lys Glu Gln Leu Lys Ser Gln Glu Gln Leu Val Cys Lys Leu 2525 2530 2535 Ala Gln Val Glu Gly Glu Gln Gln Leu Trp Gln Lys Gln Lys Leu 2540 2545 2550 Glu Leu Arg Asn Val Thr Met Ala Leu Glu Gln Lys Val Gln Val 2555 2560 2565 Leu Gln Ser Glu Asn Asn Thr Leu Gln Ser Thr Tyr Glu Ala Leu 2570 2575 2580 Gln Asn Ser His Lys Ser Leu Glu Ser Glu Leu Gly Leu Ile Lys 2585 2590 2595 Leu Glu Lys Val Ala Leu Val Glu Arg Val Ser Thr Ile Ser Gly 2600 2605 2610 Lys Glu Ala Glu Leu Gln Arg Glu Leu Arg Asp Met Leu Gln Lys 2615 2620 2625 Thr Thr Gln Leu Ser Glu Asp Tyr Asn Lys Glu Lys Asn Arg Leu 2630 2635 2640 Thr Glu Glu Val Glu Val Leu Arg Glu Glu Leu Gln Asn Thr Lys 2645 2650 2655 Ala Ala His Leu Lys Ser Val Asn Gln Leu Glu Lys Glu Leu Gln 2660 2665 2670 Arg Ala Gln Gly Lys Ile Lys Leu Met Leu Lys Ser Cys Arg Gln 2675 2680 2685 Leu Glu Gly Glu Lys Glu Met Leu Gln Lys Glu Leu Ser Gln Leu 2690 2695 2700 Glu Ala Ala Gln Gln Gln Arg Ala Gly Ser Leu Val Asp Ser Asn 2705 2710 2715 Val Asp Glu Val Met Thr Glu Asn Lys Ala Leu Lys Glu Thr Leu 2720 2725 2730 Glu Glu Lys Val Lys Glu Ala Asp Lys Tyr Leu Asp Lys Tyr Cys 2735 2740 2745 Ser Leu Leu Ile Ser His Glu Glu Leu Glu Lys Ala Lys Glu Ile 2750 2755 2760 Leu Glu Ile Glu Val Ala Arg Leu Lys Ser Arg Gln Ser Arg Gln 2765 2770 2775 Asp Leu Gln Ser Ser Pro Leu Leu Asn Ser Ser Ile Pro Gly Pro 2780 2785 2790 Ser Pro Asn Thr Ser Val Ser Glu Met Lys Ser Ala Ser Gly Gln 2795 2800 2805 Asn Lys Ala Ser Gly Lys Arg Gln Arg Ser Ser Gly Ile Trp Glu 2810 2815 2820 His Gly Lys Arg Ala Ala Pro Ser Thr Ala Glu Thr Phe Ser Lys 2825 2830 2835 Lys Ser Arg Lys Ser Asp Ser Lys Ser Thr Arg Pro Ala Glu His 2840 2845 2850 Glu Gln Glu Thr Glu Phe Glu Pro Glu Gly Leu Pro Glu Val Val 2855 2860 2865 Lys Lys Gly Phe Ala Asp Ile Pro Thr Gly Lys Thr Ser Pro Tyr 2870 2875 2880 Ile Leu Arg Arg Thr Thr Met Ala Thr Arg Thr Ser Pro Arg Phe 2885 2890 2895 Ala Thr Gln Lys Leu Val Gly Ser Ser Pro Ser Leu Gly Lys Glu 2900 2905 2910 Asn Val Val Glu Ser Ser Lys Pro Thr Ala Gly Gly Ser Arg Ser 2915 2920 2925 Gln Lys Val Lys Val Val Gln Glu Ser Ser Ala Asp Ser His Thr 2930 2935 2940 Ala Phe Gln Glu Leu Pro Ala Lys Ser Leu Thr Ala Ser Asn Ile 2945 2950 2955 Pro Gly Arg Asn Ser Thr Glu Ser Pro Arg Glu Gly Leu Arg Ala 2960 2965 2970 Lys Arg Ala Tyr Pro Ala Ser Ser Pro Ala Ala Gly Pro Asp Pro 2975 2980 2985 Thr Asn Asn Glu Asn Cys Arg Val Gln 2990 2995

Claims

1. A method comprising: a) obtaining a test prostate cancer sample from a subject having prostate cancer; b) determining a level of expression of each of the genes encoding (FOXM1) Forkhead box protein M1 and Centromere protein F (CENPF) in the test sample and a control sample; c) comparing the level of expression of each of the FOXM1 and CENPF genes in the test sample to the corresponding level in the control sample; and d) if the level of expression of each of the FOXM1 and CENPF genes in the test sample is at least 35% higher than the corresponding level in the control sample, then determining that the subject has an aggressive form of prostate cancer or has a high risk of prostate cancer progressing to an aggressive form.

2. The method of claim 1, wherein determining the level of expression of the prognostic genes FOXM1 and CENPF comprises determining a level of mRNA encoding FOXM1 and CENPF in the sample, respectively, using a method selected from the group consisting of nuclease protection assays, northern blots, real time quantitative PCR, and in-situ hybridization.

3. The method of claim 1, wherein determining the level of expression of the prognostic genes FOXM1 and CENPF comprises determining a level of FOXM1 protein or CENPF protein in the sample, respectively, using a method selected from the group consisting western blots, 2-dimensional SDS-PAGE, and mass spectrometry.

4. A method comprising: a) obtaining a prostate cancer sample from a subject having prostate cancer; b) determining a level of expression of FOXM1 protein and CENPF protein in the prostate cancer sample by immunostaining with a first antibody that specifically binds to FOXM1 and a second antibody that specifically binds to CENPF; and c) if at least 50% of prostate cancer cells in the prostate cancer sample express both FOXM1 protein and CENPF protein at a composite score of at least 100 for each protein, wherein the composite score is calculated by multiplying a percent staining value by a staining intensity value, then determining that the subject has an aggressive form of prostate cancer or has a high risk of prostate cancer progressing to an aggressive form.

5. The method of claim 4, wherein both FOXM1 protein and CENPF protein are colocalized in the nucleus of at least 50% of prostate cancer cells in the sample.

6. The method of one of claims 1 and 4, wherein the prostate cancer sample comprises circulating prostate cancer cells that have been isolated.

7. A method comprising: a) obtaining a prostate cancer sample from a subject having prostate cancer (or at risk of developing prostate cancer), b) applying a first antibody that specifically binds to FOXM1 protein in the sample, wherein presence of FOXM1 creates an antibody-FOXM1 complex; and applying a second antibody that specifically binds to CENPF in the sample, wherein presence of the CENPF creates an antibody-CENPF complex, c) applying a first detection agent that detects the antibody-FOXM1 complex; and a second detection agent that detects the antibody-CENPF complex, and d) if at least 50% of prostate cancer cells in the sample express both FOXM1 protein and CENPF protein at a composite score of at least 100 for each protein, wherein the composite score is calculated by multiplying a percent staining value by a staining intensity value, then determining that the subject has an aggressive form of prostate cancer or has a high risk of prostate cancer progressing to an aggressive form.

8. The method as in claim 1, 4 or 7, further comprising treating the subject for aggressive prostate cancer if a determination is made that the cancer is aggressive prostate cancer.

9. The method as in claim 1, 4 or 7, wherein the control prostate tissue sample comes from a normal subject that does not have cancer or from a noncancerous area of the subject's prostate.

10. A diagnostic kit for detecting an expression level of an mRNA or a protein encoding FOXM1 or CENPF or both in a biological sample, the kit comprising oligonucleotides that specifically hybridize to each of the respective mRNAs or one or more agents that specifically bind to each of the respective proteins, or both.

11. The diagnostic kit of claim 10, further comprising a forward primer and a reverse primer specific for each mRNA encoding FOXM1 or CENPF for use in a qRT-PCR assay to specifically quantify the expression level of each mRNA.

12. The diagnostic kit of claim 10, wherein the agents comprise one or more antibodies or antibody fragments that specifically bind to each of the respective FOXM1 or CENPF protein.

13. A microarray comprising a plurality of oligonucleotides that specifically hybridize to an mRNA encoded by each of the FOXM1 or CENPF genes, which oligonucleotides are fixed on the microarray.

14. The microarray of claim 13, wherein the oligonucleotides are labeled to facilitate detection of hybridization to the mRNAs.

15. The microarray of claim 14, wherein the oligonucleotides are radio-labeled, or biotin-labeled.

16. The microarray of claim 13, wherein the oligonucleotides are cDNAs.

17. A microarray comprising a plurality of antibodies or antibody fragments that specifically bind to either or both of FOXM1 protein or CENPF protein or biologically active fragment thereof, which antibodies or antibody fragments are fixed on the microarray.

18. The microarray of claim 17, wherein the antibodies or antibody fragments are labeled to facilitate detection of binding to the protein.

19. The microarray of claim 18, wherein the antibodies or antibody fragments are radio-labeled, biotin-labeled, chromophore-labeled, fluorophore-labeled, or enzyme-labeled.

Images