Lysosomal Targeting Peptides and Uses Thereof

Abstract

The present invention provides further improved compositions and methods for efficient lysosomal targeting based on the GILT technology. Among other things, the present invention provides methods and compositions for targeting lysosomal enzymes to lysosomes using furin-resistant lysosomal targeting peptides. The present invention also provides methods and compositions for targeting lysosomal enzymes to lysosomes using a lysosomal targeting peptide that has reduced or diminished binding affinity for the insulin receptor.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This is a continuation of U.S. patent application Ser. No. 14/535,505 filed Nov. 7, 2014, which is a continuation of U.S. patent application Ser. No. 12/991,104 filed Apr. 25, 2011, which is the National Stage Entry of PCT/US2009/43207 filed May 7, 2009, which claims the benefit of priority under 35 U.S.C. .sctn.119(e) of U.S. Provisional Patent Application No. 61/051,336 filed May 7, 2008 and U.S. Provisional Patent Application No. 61/144,106 filed Jan. 12, 2009, the contents of each of which are hereby incorporated by reference in their entireties.

[0002] This application contains, as a separate part of the disclosure, a sequence listing in computer-readable form (Filename: 40017C_SeqListing.txt; Size: 96,324 bytes; Created: Sep. 22, 2016), which is incorporated by reference in its entirety.

BACKGROUND

[0003] Normally, mammalian lysosomal enzymes are synthesized in the cytosol and traverse the ER where they are glycosylated with N-linked, high mannose type carbohydrate. In the golgi, the high mannose carbohydrate is modified on lysosomal proteins by the addition of mannose-6-phosphate (M6P) which targets these proteins to the lysosome. The M6P-modified proteins are delivered to the lysosome via interaction with either of two M6P receptors. The most favorable form of modification is when two M6Ps are added to a high mannose carbohydrate.

[0004] More than forty lysosomal storage diseases (LSDs) are caused, directly or indirectly, by the absence of one or more lysosomal enzymes in the lysosome. Enzyme replacement therapy for LSDs is being actively pursued. Therapy generally requires that LSD proteins be taken up and delivered to the lysosomes of a variety of cell types in an M6P-dependent fashion. One possible approach involves purifying an LSD protein and modifying it to incorporate a carbohydrate moiety with M6P. This modified material may be taken up by the cells more efficiently than unmodified LSD proteins due to interaction with M6P receptors on the cell surface.

[0005] The inventors of the present application have previously developed a peptide-based targeting technology that allows more efficient delivery of therapeutic enzymes to the lysosomes. This proprietary technology is termed Glycosylation Independent Lysosomal Targeting (GILT) because a peptide tag replaces M6P as the moiety targeting the lysosomes. Details of the GILT technology are described in U.S. Application Publication No.s 2003-0082176, 2004-0006008, 2003-0072761, 2005-0281805, 2005-0244400, and international publications WO 03/032913, WO 03/032727, WO 02/087510, WO 03/102583, WO 2005/078077, the disclosures of all of which are hereby incorporated by reference.

SUMMARY OF THE INVENTION

[0006] The present invention provides further improved compositions and methods for efficient lysosomal targeting based on the GILT technology. Among other things, the present invention provides methods and compositions for targeting lysosomal enzymes to lysosomes using furin-resistant lysosomal targeting peptides. The present invention also provides methods and compositions for targeting lysosomal enzymes to lysosomes using a lysosomal targeting peptide that has reduced or diminished binding affinity for the insulin receptor. The present invention encompasses unexpected discovery that furin-resistant lysosomal targeting peptides according to the invention have reduced binding affinity for the insulin receptor.

[0007] In some embodiments, the present invention provides a furin-resistant IGF-II mutein. In some embodiments, the present invention provides a furin-resistant IGF-II mutein having an amino acid sequence at least 70% identical to mature human IGF-II (SEQ ID NO:1) and a mutation that abolishes at least one furin protease cleavage site.

[0008] In some embodiments, the present invention provides an IGF-II mutein comprising an amino acid sequence at least 70% identical to mature human IGF-II (SEQ ID NO:1) and a mutation that reduces or diminishes the binding affinity for the insulin receptor as compared to the wild-type human IGF-II.

[0009] In some embodiments, the furin-resistant IGF-II mutein has diminished binding affinity for the IGF-I receptor relative to the affinity of naturally-occurring human IGF-II for the IGF-I receptor.

[0010] In some embodiments, the present invention provides a targeted therapeutic fusion protein containing a lysosomal enzyme; and an IGF-II mutein having an amino acid sequence at least 70% identical to mature human IGF-II (SEQ ID NO:1), wherein the IGF-II mutein is resistant to furin cleavage and binds to the human cation-independent mannose-6-phosphate receptor in a mannose-6-phosphate-independent manner.

[0011] In some embodiments, the present invention provides a targeted therapeutic fusion protein containing a lysosomal enzyme; and an IGF-II mutein having an amino acid sequence at least 70% identical to mature human IGF-II (SEQ ID NO:1), and having diminished binding affinity for the insulin receptor relative to the affinity of naturally-occurring human IGF-II for the insulin receptor; wherein the IGF-II mutein binds to the human cation-independent mannose-6-phosphate receptor in a mannose-6-phosphate-independent manner.

[0012] In some embodiments, the present invention provides a targeted therapeutic fusion protein containing a lysosomal enzyme; and an IGF-II mutein having an amino acid sequence at least 70% identical to mature human IGF-II (SEQ ID NO:1), and having diminished binding affinity for the insulin receptor relative to the affinity of naturally-occurring human IGF-II for the insulin receptor; wherein the IGF-II mutein is resistant to furin cleavage and binds to the human cation-independent mannose-6-phosphate receptor in a mannose-6-phosphate-independent manner.

[0013] In some embodiments, an IGF-II mutein suitable for the invention includes a mutation within a region corresponding to amino acids 30-40 of SEQ ID NO:1. In some embodiments, an IGF-II mutein suitable for the invention includes a mutation within a region corresponding to amino acids 34-40 of SEQ ID NO:1 such that the mutation abolishes at least one furin protease cleavage site. In some embodiments, a suitable mutation is an amino acid substitution, deletion and/or insertion. In some embodiments, the mutation is an amino acid substitution at a position corresponding to Arg37 or Arg40 of SEQ ID NO:1. In some embodiments, the amino acid substitution is a Lys or Ala substitution.

[0014] In some embodiments, a suitable mutation is a deletion or replacement of amino acid residues corresponding to positions selected from the group consisting of 31-40, 32-40, 33-40, 34-40, 30-39, 31-39, 32-39, 34-37, 32-39, 33-39, 34-39, 35-39, 36-39, 37-40, 34-40 of SEQ ID NO:1, and combinations thereof.

[0015] In some embodiments, an IGF-II mutein according to the invention further contains a deletion or a replacement of amino acids corresponding to positions 2-7 of SEQ ID NO:1. In some embodiments, an IGF-II mutein according to the invention further includes a deletion or a replacement of amino acids corresponding to positions 1-7 of SEQ ID NO:1. In some embodiments, an IGF-II mutein according to the invention further contains a deletion or a replacement of amino acids corresponding to positions 62-67 of SEQ ID NO:1. In some embodiments, an IGF-II mutein according to the invention further contains an amino acid substitution at a position corresponding to Tyr27, Leu43, or Ser26 of SEQ ID NO:1. In some embodiments, an IGF-II mutein according to the invention contains at least an amino acid substitution selected from the group consisting of Tyr27Leu, Leu43Val, Ser26Phe and combinations thereof. In some embodiments, an IGF-II mutein according to the invention contains amino acids corresponding to positions 48-55 of SEQ ID NO:1. In some embodiments, an IGF-II mutein according to the invention contains at least three amino acids selected from the group consisting of amino acids corresponding to positions 8, 48, 49, 50, 54, and 55 of SEQ ID NO:1. In some embodiments, an IGF-11 mutein of the invention contains, at positions corresponding to positions 54 and 55 of SEQ ID NO:1, amino acids each of which is uncharged or negatively charged at pH 7.4. In some embodiments, the IGF-II mutein has diminished binding affinity for the IGF-I receptor relative to the affinity of naturally-occurring human IGF-II for the IGF-I receptor.

[0016] In some embodiments, a lysosomal enzyme suitable for the invention is human acid alpha-glucosidase (GAA), or a functional variant thereof. In some embodiments, a lysosomal enzyme suitable for the invention includes amino acids 70-952 of human GAA.

[0017] In some embodiments, a targeted therapeutic fusion protein of the invention further includes a spacer between the lysosomal enzyme and the furin-resistant IGF-II mutein. In some embodiments, the spacer contains an amino acid sequence Gly-Ala-Pro.

[0018] The present invention also provides nucleic acids encoding the IGF-II mutein or the targeted therapeutic fusion protein as described in various embodiments above. The present invention further provides various cells containing the nucleic acid of the invention.

[0019] The present invention provides pharmaceutical compositions suitable for treating lysosomal storage disease containing a therapeutically effective amount of a targeted therapeutic fusion protein of the invention. The invention further provides methods of treating lysosomal storage diseases comprising administering to a subject in need of treatment a targeted therapeutic fusion protein according to the invention. In some embodiments, the lysosomal storage disease is Pompe Disease. In some embodiments, the lysosomal storage disease is Fabry Disease. In some embodiments, the lysosomal storage disease is Gaucher Disease.

[0020] In another aspect, the present invention provides a method of producing a targeted therapeutic fusion protein including a step of culturing mammalian cells in a cell culture medium, wherein the mammalian cells carry the nucleic acid of the invention, in particular, as described in various embodiments herein; and the culturing is performed under conditions that permit expression of the targeted therapeutic fusion protein.

[0021] In yet another aspect, the present invention provides a method of producing a targeted therapeutic fusion protein including a step of culturing furin-deficient cells (e.g., furin-deficient mammalian cells) in a cell culture medium, wherein the furin-deficient cells carry a nucleic acid encoding a fusion protein comprising a lysosomal enzyme and an IGF-II mutein having an amino acid sequence at least 70% identical to mature human IGF-II (SEQ ID NO:1), wherein the IGF-II mutein binds to the human cation-independent mannose-6-phosphate receptor in a mannose-6-phosphate-independent manner; and wherein the culturing is performed under conditions that permit expression of the targeted therapeutic fusion protein.

[0022] Other features, objects, and advantages of the present invention are apparent in the detailed description that follows. It should be understood, however, that the detailed description, while indicating embodiments of the present invention, is given by way of illustration only, not limitation. Various changes and modifications within the scope of the invention will become apparent to those skilled in the art from the detailed description.

BRIEF DESCRIPTION OF THE DRAWINGS

[0023] The drawings are for illustration purposes only, not for limitation.

[0024] FIG. 1 illustrates a map of N-terminus of ZC-701. Two amino acid residues boxed are sites of cleavage events. The first is the site of signal peptide cleavage, the second is the site of a furin cleavage.

[0025] FIG. 2 illustrates an exemplary SDS-PAGE analysis of ZC-701 after treatment with PNGase F. The lane on the right has been additionally treated with furin.

[0026] FIG. 3 Left: Schematic illustration of exemplary ZC-701 mutants in which furin cleavage site is modified. Center: Exemplary SDS-PAGE analysis of PNGase treated mutants after 3-7 days of cell culture. Right: Exemplary SDS-PAGE analysis of PNGase-treated mutants treated with furin.

[0027] FIG. 4 illustrates exemplary competitive IGF-II receptor binding results.

[0028] FIG. 5 illustrates additional exemplary competitive IGF-II receptor binding results.

[0029] FIG. 6 illustrates exemplary insulin receptor competition assay results.

[0030] FIG. 7 illustrates exemplary IGF-I receptor competition assay results.

[0031] FIG. 8 illustrates exemplary results of certain insulin receptor binding assay.

[0032] FIG. 9 illustrates exemplary results of certain insulin receptor binding assay.

[0033] FIG. 10 illustrates exemplary analysis of partially purified GILT-tagged GAA from transient transfections. HEK293 cells were transfected with constructs 1479, 1487 or ZC-701. After harvest, culture supernatants were partially purified by Hydrophobic Interaction Chromatography (HIC). All samples were treated with PNGase prior to electrophoresis. Left panels: SDS-PAGE of partially purified proteins. Purified ZC-701 B12 is shown as a control. Right panels: Immunoblot analysis of the partially purified proteins. The indicated primary antibody was used. Bottom panels were additionally treated with exogenous furin. The protein encoded by construct 1487 is identical in sequence to that encoded by construct 1461 (R37A). The protein encoded by construct 1479 is identical to that encoded by construct 1459 (R37K).

[0034] FIG. 11 illustrates exemplary uptake results of exemplary furin resistant GILT-tagged GAA into rat L6 myoblasts. K.sub.uptakes for protein 1479, 1487, ZC-701, and purified ZC-701 are 4.5 nM, 4.4 nM, 5.0 nM and 2.6 nM respectively. The protein encoded by construct 1487 is identical in sequence to that encoded by construct 1461 in FIG. 3 (R37A). The protein encoded by construct 1479 is identical to that encoded by construct 1459 in FIG. 3 (R37K).

DEFINITIONS

[0035] Amelioration: As used herein, the term "amelioration" is meant the prevention, reduction or palliation of a state, or improvement of the state of a subject. Amelioration includes, but does not require complete recovery or complete prevention of a disease condition. In some embodiments, amelioration includes reduction of accumulated materials inside lysosomes of relevant diseases tissues.

[0036] Furin-resistant IGF-II mutein: As used herein, the term "furin-resistant IGF-II mutein" refers to an IGF-II-based peptide containing an altered amino acid sequence that abolishes at least one native furin protease cleavage site or changes a sequence close or adjacent to a native furin protease cleavage site such that the furin cleavage is prevented, inhibited, reduced, or slowed down as compared to a wild-type human IGF-II peptide. As used herein, a furin-resistant IGF-II mutein is also referred to as an IGF-II mutein that is resistant to furin.

[0037] Furin protease cleavage site: As used herein, the term "furin protease cleavage site" (also referred to as "furin cleavage site" or "furin cleavage sequence") refers to the amino acid sequence of a peptide or protein that serves as a recognition sequence for enzymatic protease cleavage by furin or furin-like proteases. Typically, a furin protease cleavage site has a consensus sequence Arg-X-X-Arg (SEQ ID NO: 2), X is any amino acid. The cleavage site is positioned after the carboxy-terminal arginine (Arg) residue in the sequence. In some embodiments, a furin cleavage site may have a consensus sequence Lys/Arg-X-X-X-Lys/Arg-Arg (SEQ ID NO: 3), X is any amino acid. The cleavage site is positioned after the carboxy-terminal arginine (Arg) residue in the sequence.

[0038] Furin: As used herein, the term "furin" refers to any protease that can recognize and cleave the furin protease cleavage site as defined herein, including furin or furin-like protease. Furin is also known as paired basic amino acid cleaving enzyme (PACE). Furin belongs to the subtilisin-like proprotein convertase family. The gene encoding furin was known as FUR (FES Upstream Region).

[0039] Furin-deficient cells: As used herein, the term "furin-deficient cells" refers to any cells whose furin protease activity is inhibited, reduced or eliminated. Furin-deficient cells include both mammalian and non-mammalian cells that do not produce furin or produce reduced amount of furin or defective furin protease.

[0040] Glycosylation Independent Lysosomal Targeting: As used herein, the term "glycosylation independent lysosomal targeting" (also referred to as "GILT") refer to lysosomal targeting that is mannose-6-phosphate-independent.

[0041] Human acid alpha-glucosidase: As used herein, the term "human acid alpha-glucosidase" (also referred to as "GAA") refers to precursor wild-type form of human GAA or a functional variant that is capable of reducing glycogen levels in mammalian lysosomes or that can rescue or ameliorate one or more Pompe disease symptoms.

[0042] Improve, increase, or reduce: As used herein, the terms "improve," "increase" or "reduce," or grammatical equivalents, indicate values that are relative to a baseline measurement, such as a measurement in the same individual prior to initiation of the treatment described herein, or a measurement in a control individual (or multiple control individuals) in the absence of the treatment described herein. A "control individual" is an individual afflicted with the same form of lysosomal storage disease (e.g., Pompe disease) as the individual being treated, who is about the same age as the individual being treated (to ensure that the stages of the disease in the treated individual and the control individual(s) are comparable).

[0043] Individual, subject, patient: As used herein, the terms "subject," "individual" or "patient" refer to a human or a non-human mammalian subject. The individual (also referred to as "patient" or "subject") being treated is an individual (fetus, infant, child, adolescent, or adult human) suffering from a lysosomal storage disease, for example, Pompe disease (i.e., either infantile-, juvenile-, or adult-onset Pompe disease) or having the potential to develop a lysosomal storage disease (e.g., Pompe disease).

[0044] Lysosomal storage diseases: As used herein, "lysosomal storage diseases" refer to a group of genetic disorders that result from deficiency in at least one of the enzymes (e.g., acid hydrolases) that are required to break macromolecules down to peptides, amino acids, monosaccharides, nucleic acids and fatty acids in lysosomes. As a result, individuals suffering from lysosomal storage diseases have accumulated materials in lysosomes. Exemplary lysosomal storage diseases are listed in Table 1.

[0045] Lysosomal enzyme: As used herein, the term "lysosomal enzyme" refers to any enzyme that is capable of reducing accumulated materials in mammalian lysosomes or that can rescue or ameliorate one or more lysosomal storage disease symptoms. Lysosomal enzymes suitable for the invention include both wild-type or modified lysosomal enzymes and can be produced using recombinant and synthetic methods or purified from nature sources. Exemplary lysosomal enzymes are listed in Table 1.

[0046] Spacer: As used herein, the term "spacer" (also referred to as "linker") refers to a peptide sequence between two protein moieties in a fusion protein. A spacer is generally designed to be flexible or to interpose a structure, such as an alpha-helix, between the two protein moieties. A spacer can be relatively short, such as the sequence Gly-Ala-Pro (SEQ ID NO: 4) or Gly-Gly-Gly-Gly-Gly-Pro (SEQ ID NO: 5), or can be longer, such as, for example, 10-25 amino acids in length.

[0047] Therapeutically effective amount: As used herein, the term "therapeutically effective amount" refers to an amount of a targeted therapeutic fusion protein which confers a therapeutic effect on the treated subject, at a reasonable benefit/risk ratio applicable to any medical treatment. The therapeutic effect may be objective (i.e., measurable by some test or marker) or subjective (i.e., subject gives an indication of or feels an effect). In particular, the "therapeutically effective amount" refers to an amount of a therapeutic fusion protein or composition effective to treat, ameliorate, or prevent a desired disease or condition, or to exhibit a detectable therapeutic or preventative effect, such as by ameliorating symptoms associated with the disease, preventing or delaying the onset of the disease, and/or also lessening the severity or frequency of symptoms of the disease. A therapeutically effective amount is commonly administered in a dosing regimen that may comprise multiple unit doses. For any particular therapeutic fusion protein, a therapeutically effective amount (and/or an appropriate unit dose within an effective dosing regimen) may vary, for example, depending on route of administration, on combination with other pharmaceutical agents. Also, the specific therapeutically effective amount (and/or unit dose) for any particular patient may depend upon a variety of factors including the disorder being treated and the severity of the disorder; the activity of the specific pharmaceutical agent employed; the specific composition employed; the age, body weight, general health, sex and diet of the patient; the time of administration, route of administration, and/or rate of excretion or metabolism of the specific fusion protein employed; the duration of the treatment; and like factors as is well known in the medical arts.

[0048] Treatment: As used herein, the term "treatment" (also "treat" or "treating") refers to any administration of a therapeutic fusion protein that partially or completely alleviates, ameliorates, relieves, inhibits, delays onset of, reduces severity of and/or reduces incidence of one or more symptoms or features of a particular disease, disorder, and/or condition. Such treatment may be of a subject who does not exhibit signs of the relevant disease, disorder and/or condition and/or of a subject who exhibits only early signs of the disease, disorder, and/or condition. Alternatively or additionally, such treatment may be of a subject who exhibits one or more established signs of the relevant disease, disorder and/or condition. For example, treatment can refer to improvement of cardiac status (e.g., increase of end-diastolic and/or end-systolic volumes, or reduction, amelioration or prevention of the progressive cardiomyopathy that is typically found in Pompe disease) or of pulmonary function (e.g., increase in crying vital capacity over baseline capacity, and/or normalization of oxygen desaturation during crying); improvement in neurodevelopment and/or motor skills (e.g., increase in AIMS score); reduction of glycogen levels in tissue of the individual affected by the disease; or any combination of these effects. In some embodiments, treatment includes improvement of glycogen clearance, particularly in reduction or prevention of Pompe disease-associated cardiomyopathy.

[0049] As used in this application, the terms "about" and "approximately" are used as equivalents. Any numerals used in this application with or without about/approximately are meant to cover any normal fluctuations appreciated by one of ordinary skill in the relevant art.

DETAILED DESCRIPTION OF THE INVENTION

[0050] The present invention provides improved methods and compositions for targeting lysosomal enzymes based on the glycosylation-independent lysosomal targeting (GILT) technology. Among other things, the present invention provides IGF-II muteins that are resistant to furin and/or has reduced or diminished binding affinity for the insulin receptor and targeted therapeutic fusion proteins containing an IGF-II mutein of the invention. The present invention also provides methods of making and using the same.

[0051] Various aspects of the invention are described in detail in the following sections. The use of sections is not meant to limit the invention. Each section can apply to any aspect of the invention. In this application, the use of "or" means "and/or" unless stated otherwise.

Lysosomal Enzymes

[0052] A lysosomal enzyme suitable for the invention includes any enzyme that is capable of reducing accumulated materials in mammalian lysosomes or that can rescue or ameliorate one or more lysosomal storage disease symptoms. Suitable lysosomal enzymes include both wild-type or modified lysosomal enzymes and can be produced using recombinant or synthetic methods or purified from nature sources. Exemplary lysosomal enzymes are listed in Table 1.

TABLE-US-00001 TABLE 1 Lysosomal Storage Diseases and associated enzyme defects Substance Disease Name Enzyme Defect Stored A. Glycogenosis Disorders Pompe Disease Acid-a1,4- Glycogen .alpha.1-4 linked Glucosidase Oligosaccharides B. Glycolipidosis Disorders GM1 Gangliodsidosis .beta.-Galactosidase GM.sub.1 Gangliosides Tay-Sachs Disease .beta.-Hexosaminidase A GM.sub.2 Ganglioside GM2 Gangliosidosis: GM.sub.2 Activator GM.sub.2 Ganglioside AB Variant Protein Sandhoff Disease .beta.-Hexosaminidase GM.sub.2 Ganglioside A&B Fabry Disease .alpha.-Galactosidase A Globosides Gaucher Disease Glucocerebrosidase Glucosylceramide Metachromatic Arylsulfatase A Sulphatides Leukodystrophy Krabbe Disease Galactosylceramidase Galactocerebroside Niemann-Pick, Types Acid Sphingomyelin A and B Sphingomyelinase Niemann-Pick, Type C Cholesterol Sphingomyelin Esterification Defect Niemann-Pick, Type D Unknown Sphingomyelin Farber Disease Acid Ceramidase Ceramide Wolman Disease Acid Lipase Cholesteryl Esters C. Mucopolysaccharide Disorders Hurler Syndrome .alpha.-L-Iduronidase Heparan & (MPS IH) Dermatan Sulfates Scheie Syndrome .alpha.-L-Iduronidase Heparan & (MPS IS) Dermatan, Sulfates Hurler-Scheie .alpha.-L-Iduronidase Heparan & (MPS IH/S) Dermatan Sulfates Hunter Syndrome Iduronate Sulfatase Heparan & (MPS II) Dermatan Sulfates Sanfilippo A Heparan N-Sulfatase Heparan (MPS IIIA) Sulfate Sanfilippo B .alpha.-N- Heparan (MPS IIIB) Acetylglucosaminidase Sulfate Sanfilippo C Acetyl-CoA- Heparan (MPS IIIC) Glucosaminide Sulfate Acetyltransferase Sanfilippo D N-Acetylglucosamine- Heparan (MPS IIID) 6-Sulfatase Sulfate Morquio A Galactosamine-6- Keratan (MPS IVA) Sulfatase Sulfate Morquio B .beta.-Galactosidase Keratan (MPS IVB) Sulfate Maroteaux-Lamy Arylsulfatase B Dermatan (MPS VI) Sulfate Sly Syndrome .beta.-Glucuronidase (MPS VII) D. Oligosaccharide/Glycoprotein Disorders .alpha.-Mannosidosis .alpha.-Mannosidase Mannose/ Oligosaccharides .beta.-Mannosidosis .beta.-Mannosidase Mannose/ Oligosaccharides Fucosidosis .alpha.-L-Fucosidase Fucosyl Oligosaccharides Aspartylglucosaminuria N-Aspartyl-.beta.- Aspartylglucosamine Glucosaminidase Asparagines Sialidosis .alpha.-Neuraminidase Sialyloligosaccharides (Mucolipidosis I) Galactosialidosis Lysosomal Protective Sialyloligosaccharides (Goldberg Syndrome) Protein Deficiency Schindler Disease .alpha.-N-Acetyl- Galactosaminidase E. Lysosomal Enzyme Transport Disorders Mucolipidosis II (I- N-Acetylglucosamine- Heparan Sulfate Cell Disease) 1-Phosphotransferase Mucolipidosis III Same as ML II (Pseudo-Hurler Polydystrophy) F. Lysosomal Membrane Transport Disorders Cystinosis Cystine Transport Free Cystine Protein Salla Disease Sialic Acid Transport Free Sialic Acid and Protein Glucuronic Acid Infantile Sialic Acid Sialic Acid Transport Free Sialic Acid and Storage Disease Protein Glucuronic Acid G. Other Batten Disease Unknown Lipofuscins (Juvenile Neuronal Ceroid Lipofuscinosis) Infantile Neuronal Palmitoyl-Protein Lipofuscins Ceroid Lipofuscinosis Thioesterase Mucolipidosis IV Unknown Gangliosides & Hyaluronic Acid Prosaposin Saposins A, B, C or D

[0053] In some embodiments, a lysosomal enzyme suitable for the invention includes a polypeptide sequence having 50-100%, including 50, 55, 60, 65, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 and 100%, sequence identity to the naturally-occurring polynucleotide sequence of a human enzyme shown in Tables 1, while still encoding a protein that is capable of reducing accumulated materials in mammalian lysosomes or that can rescue or ameliorate one or more lysosomal storage disease symptoms.

[0054] "Percent (%) amino acid sequence identity" with respect to the lysosomal enzyme sequences is defined as the percentage of amino acid residues in a candidate sequence that are identical with the amino acid residues in the naturally-occurring human enzyme sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Alignment for purposes of determining percent amino acid sequence identity can be achieved in various ways that are within the skill in the art, for instance, using publicly available computer software such as BLAST, ALIGN or Megalign (DNASTAR) software. Those skilled in the art can determine appropriate parameters for measuring alignment, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. Preferably, the WU-BLAST-2 software is used to determine amino acid sequence identity (Altschul et al., Methods in Enzymology 266, 460-480 (1996); http://blast.wustl/edu/blast/README.html). WU-BLAST-2 uses several search parameters, most of which are set to the default values. The adjustable parameters are set with the following values: overlap span=1, overlap fraction=0.125, world threshold (T)=11. HSP score (S) and HSP S2 parameters are dynamic values and are established by the program itself, depending upon the composition of the particular sequence, however, the minimum values may be adjusted and are set as indicated above.

Pompe Disease

[0055] One exemplary lysosomal storage disease is Pompe disease. Pompe disease is a rare genetic disorder caused by a deficiency in the enzyme acid alpha-glucosidase (GAA), which is needed to break down glycogen, a stored form of sugar used for energy. Pompe disease is also known as glycogen storage disease type II, GSD II, type II glycogen storage disease, glycogenosis type II, acid maltase deficiency, alpha-1,4-glucosidase deficiency, cardiomegalia glycogenic diffusa, and cardiac form of generalized glycogenosis. The build-up of glycogen causes progressive muscle weakness (myopathy) throughout the body and affects various body tissues, particularly in the heart, skeletal muscles, liver, respiratory and nervous system.

[0056] The presenting clinical manifestations of Pompe disease can vary widely depending on the age of disease onset and residual GAA activity. Residual GAA activity correlates with both the amount and tissue distribution of glycogen accumulation as well as the severity of the disease. Infantile-onset Pompe disease (less than 1% of normal GAA activity) is the most severe form and is characterized by hypotonia, generalized muscle weakness, and hypertrophic cardiomyopathy, and massive glycogen accumulation in cardiac and other muscle tissues. Death usually occurs within one year of birth due to cardiorespiratory failure. Hirschhorn et al. (2001) "Glycogen Storage Disease Type II: Acid Alpha-glucosidase (Acid Maltase) Deficiency," in Scriver et al., eds., The Metabolic and Molecular Basis of Inherited Disease, 8th Ed., New York: McGraw-Hill, 3389-3420. Juvenile-onset (1-10% of normal GAA activity) and adult-onset (10-40% of normal GAA activity) Pompe disease are more clinically heterogeneous, with greater variation in age of onset, clinical presentation, and disease progression. Juvenile- and adult-onset Pompe disease are generally characterized by lack of severe cardiac involvement, later age of onset, and slower disease progression, but eventual respiratory or limb muscle involvement results in significant morbidity and mortality. While life expectancy can vary, death generally occurs due to respiratory failure. Hirschhorn et al. (2001) "Glycogen Storage Disease Type II: Acid Alpha-glucosidase (Acid Maltase) Deficiency," in Scriver et al., eds., The Metabolic and Molecular Basis of Inherited Disease, 8th Ed., New York: McGraw-Hill, 3389-3420.

[0057] A GAA enzyme suitable for treating Pompe disease includes a wild-type human GAA, or a fragment or sequence variant thereof which retains the ability to cleave a 1-4 linkages in linear oligosaccharides.

Enzyme Replacement Therapy

[0058] Enzyme replacement therapy (ERT) is a therapeutic strategy to correct an enzyme deficiency by infusing the missing enzyme into the bloodstream. As the blood perfuses patient tissues, enzyme is taken up by cells and transported to the lysosome, where the enzyme acts to eliminate material that has accumulated in the lysosomes due to the enzyme deficiency. For lysosomal enzyme replacement therapy to be effective, the therapeutic enzyme must be delivered to lysosomes in the appropriate cells in tissues where the storage defect is manifest. Conventional lysosomal enzyme replacement therapeutics are delivered using carbohydrates naturally attached to the protein to engage specific receptors on the surface of the target cells. One receptor, the cation-independent M6P receptor (CI-MPR), is particularly useful for targeting replacement lysosomal enzymes because the CI-MPR is present on the surface of most cell types.

[0059] The terms "cation-independent mannose-6-phosphate receptor (CI-MPR)," "M6P/IGF-II receptor," "CI-MPR/IGF-II receptor," "IGF-II receptor" or "IGF2 Receptor," or abbreviations thereof, are used interchangeably herein, referring to the cellular receptor which binds both M6P and IGF-II.

Glycosylation Independent Lysosomal Targeting

[0060] We have developed a Glycosylation Independent Lysosomal Targeting (GILT) technology to target therapeutic enzymes to lysosomes. Specifically, the GILT technology uses a peptide tag instead of M6P to engage the CI-MPR for lysosomal targeting. Typically, a GILT tag is a protein, peptide, or other moiety that binds the CI-MPR in a mannose-6-phosphate-independent manner. Advantageously, this technology mimics the normal biological mechanism for uptake of lysosomal enzymes, yet does so in a manner independent of mannose-6-phosphate.

[0061] A preferred GILT tag is derived from human insulin-like growth factor II (IGF-II). Human IGF-II is a high affinity ligand for the CI-MPR, which is also referred to as IGF-II receptor. Binding of GILT-tagged therapeutic enzymes to the M6P/IGF-II receptor targets the protein to the lysosome via the endocytic pathway. This method has numerous advantages over methods involving glycosylation including simplicity and cost effectiveness, because once the protein is isolated, no further modifications need be made.

[0062] Detailed description of the GILT technology and GILT tag can be found in U.S. Publication Nos. 20030082176, 20040006008, 20040005309, and 20050281805, the teachings of all of which are hereby incorporated by references in their entireties.

Furin-Resistant GILT Tag

[0063] During the course of development of GILT-tagged lysosomal enzymes for treating lysosomal storage disease, it has become apparent that the IGF-II derived GILT tag may be subjected to proteolytic cleavage by furin during production in mammalian cells (see the examples section). Furin protease typically recognizes and cleaves a cleavage site having a consensus sequence Arg-X-X-Arg (SEQ ID NO: 2), X is any amino acid. The cleavage site is positioned after the carboxy-terminal arginine (Arg) residue in the sequence. In some embodiments, a furin cleavage site has a consensus sequence Lys/Arg-X-X-X-Lys/Arg-Arg (SEQ ID NO: 3), X is any amino acid. The cleavage site is positioned after the carboxy-terminal arginine (Arg) residue in the sequence. As used herein, the term "furin" refers to any protease that can recognize and cleave the furin protease cleavage site as defined herein, including furin or furin-like protease. Furin is also known as paired basic amino acid cleaving enzyme (PACE). Furin belongs to the subtilisin-like proprotein convertase family that includes PC3, a protease responsible for maturation of proinsulin in pancreatic islet cells. The gene encoding furin was known as FUR (FES Upstream Region).

[0064] The mature human IGF-II peptide sequence is shown below.

##STR00001##

[0065] As can be seen, the mature human IGF-II contains two potential overlapping furin cleavage sites between residues 34-40 (bolded and underlined). Arrows point to two potential furin cleavage positions.

[0066] We have developed modified GILT tags that are resistant to cleavage by furin and still retain ability to bind to the CI-MPR in a mannose-6-phosphate-independent manner. Specifically, furin-resistant GILT tags can be designed by mutating the amino acid sequence at one or more furin cleavage sites such that the mutation abolishes at least one furin cleavage site. Thus, in some embodiments, a furin-resistant GILT tag is a furin-resistant IGF-II mutein containing a mutation that abolishes at least one furin protease cleavage site or changes a sequence adjacent to the furin protease cleavage site such that the furin cleavage is prevented, inhibited, reduced or slowed down as compared to a wild-type IGF-II peptide (e.g., wild-type human mature IGF-II). Typically, a suitable mutation does not impact the ability of the furin-resistant GILT tag to bind to the human cation-independent mannose-6-phosphate receptor. In particular, a furin-resistant IGF-II mutein suitable for the invention binds to the human cation-independent mannose-6-phosphate receptor in a mannose-6-phosphate-independent manner with a dissociation constant of 10.sup.-7 M or less (e.g., 10.sup.-8, 10.sup.-9, 10.sup.-10, 10.sup.-11, or less) at pH 7.4. In some embodiments, a furin-resistant IGF-II mutein contains a mutation within a region corresponding to amino acids 30-40 (e.g., 31-40, 32-40, 33-40, 34-40, 30-39, 31-39, 32-39, 34-37, 32-39, 33-39, 34-39, 35-39, 36-39, 37-40, 34-40) of SEQ ID NO: 1. In some embodiments, a suitable mutation abolishes at least one furin protease cleavage site. A mutation can be amino acid substitutions, deletions, insertions. For example, any one amino acid within the region corresponding to residues 30-40 (e.g., 31-40, 32-40, 33-40, 34-40, 30-39, 31-39, 32-39, 34-37, 32-39, 33-39, 34-39, 35-39, 36-39, 37-40, 34-40) of SEQ ID NO:1 can be substituted with any other amino acid or deleted. For example, substitutions at position 34 may affect furin recognition of the first cleavage site. Insertion of one or more additional amino acids within each recognition site may abolish one or both furin cleavage sites. Deletion of one or more of the residues in the degenerate positions may also abolish both furin cleavage sites.

[0067] In some embodiments, a furin-resistant IGF-II mutein contains amino acid substitutions at positions corresponding to Arg37 or Arg40 of SEQ ID NO:1. In some embodiments, a furin-resistant IGF-II mutein contains a Lys or Ala substitution at positions Arg37 or Arg40. Other substitutions are possible, including combinations of Lys and/or Ala mutations at both positions 37 and 40, or substitutions of amino acids other than Lys or Ala.

[0068] In some embodiments, the furin-resistant IGF-II mutein suitable for the invention may contain additional mutations. For example, up to 30% or more of the residues of SEQ ID NO:1 may be changed (e.g., up to 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30% or more residues may be changed). Thus, a furin-resistant IGF-II mutein suitable for the invention may have an amino acid sequence at least 70%, including at least 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99%, identical to SEQ ID NO:1.

[0069] In some embodiments, a furin-resistant IGF-II mutein suitable for the invention is targeted specifically to the CI-MPR. Particularly useful are mutations in the IGF-II polypeptide that result in a protein that binds the CI-MPR with high affinity (e.g., with a dissociation constant of 10.sup.-7M or less at pH 7.4) while binding other receptors known to be bound by IGF-II with reduced affinity relative to native IGF-II. For example, a furin-resistant IGF-II mutein suitable for the invention can be modified to have diminished binding affinity for the IGF-I receptor relative to the affinity of naturally-occurring human IGF-II for the IGF-I receptor. For example, substitution of IGF-II residues Tyr 27 with Leu, Leu 43 with Val or Ser 26 with Phe diminishes the affinity of IGF-II for the IGF-I receptor by 94-, 56-, and 4-fold respectively (Torres et al. (1995) J. Mol. Biol. 248(2):385-401). Deletion of residues 1-7 of human IGF-II resulted in a 30-fold decrease in affinity for the human IGF-I receptor and a concomitant 12 fold increase in affinity for the rat IGF-II receptor (Hashimoto et al. (1995) J. Biol. Chem. 270(30):18013-8). The NMR structure of IGF-II shows that Thr 7 is located near residues 48 Phe and 50 Ser as well as near the 9 Cys-47 Cys disulfide bridge. It is thought that interaction of Thr 7 with these residues can stabilize the flexible N-terminal hexapeptide required for IGF-I receptor binding (Terasawa et al. (1994) EMBO J. 13(23)5590-7). At the same time this interaction can modulate binding to the IGF-II receptor. Truncation of the C-terminus of IGF-II (residues 62-67) also appear to lower the affinity of IGF-II for the IGF-I receptor by 5 fold (Roth et al. (1991) Biochem. Biophys. Res. Commun. 181(2):907-14).

[0070] The binding surfaces for the IGF-I and cation-independent M6P receptors are on separate faces of IGF-II. Based on structural and mutational data, functional cation-independent M6P binding domains can be constructed that are substantially smaller than human IGF-II. For example, the amino terminal amino acids (e.g., 1-7 or 2-7) and/or the carboxy terminal residues 62-67 can be deleted or replaced. Additionally, amino acids 29-40 can likely be eliminated or replaced without altering the folding of the remainder of the polypeptide or binding to the cation-independent M6P receptor. Thus, a targeting moiety including amino acids 8-28 and 41-61 can be constructed. These stretches of amino acids could perhaps be joined directly or separated by a linker. Alternatively, amino acids 8-28 and 41-61 can be provided on separate polypeptide chains. Comparable domains of insulin, which is homologous to IGF-II and has a tertiary structure closely related to the structure of IGF-II, have sufficient structural information to permit proper refolding into the appropriate tertiary structure, even when present in separate polypeptide chains (Wang et al. (1991) Trends Biochem. Sci. 279-281). Thus, for example, amino acids 8-28, or a conservative substitution variant thereof, could be fused to a lysosomal enzyme; the resulting fusion protein could be admixed with amino acids 41-61, or a conservative substitution variant thereof, and administered to a patient.

[0071] IGF-IT can also be modified to minimize binding to serum TGF-binding proteins (Baxter (2000) Am. J. Physiol Endocrinol Metab. 278(6):967-76) to avoid sequestration of IGF-II/GILT constructs. A number of studies have localized residues in IGF-II necessary for binding to IGF-binding proteins. Constructs with mutations at these residues can be screened for retention of high affinity binding to the M6P/IGF-II receptor and for reduced affinity for IGF-binding proteins. For example, replacing Phe 26 of IGF-II with Ser is reported to reduce affinity of IGF-II for IGFBP-1 and -6 with no effect on binding to the M6P/IGF-II receptor (Bach et al. (1993) J. Biol. Chem. 268(13):9246-54). Other substitutions, such as Lys for Glu 9, can also be advantageous. The analogous mutations, separately or in combination, in a region of IGF-I that is highly conserved with IGF-II result in large decreases in IGF-BP binding (Magee et al. (1999) Biochemistry 38(48):15863-70).

[0072] An alternate approach is to identify minimal regions of IGF-II that can bind with high affinity to the M6P/IGF-II receptor. The residues that have been implicated in IGF-II binding to the M6P/IGF-II receptor mostly cluster on one face of IGF-II (Terasawa et al. (1994) EMBO J. 13(23):5590-7). Although IGF-II tertiary structure is normally maintained by three intramolecular disulfide bonds, a peptide incorporating the amino acid sequence on the M6P/IGF-II receptor binding surface of IGF-II can be designed to fold properly and have binding activity. Such a minimal binding peptide is a highly preferred lysosomal targeting domain. For example, a preferred lysosomal targeting domain is amino acids 8-67 of human IGF-II. Designed peptides, based on the region around amino acids 48-55, which bind to the M6P/IGF-II receptor, are also desirable lysosomal targeting domains. Alternatively, a random library of peptides can be screened for the ability to bind the M6P/IGF-II receptor either via a yeast two hybrid assay, or via a phage display type assay.

Binding Affinity for the Insulin Receptor

[0073] The inventors of the present application discovered unexpectedly that many furin-resistant IGF-II muteins described herein have reduced or diminished binding affinity for the insulin receptor. Thus, in some embodiments, a peptide tag suitable for the invention has reduced or diminished binding affinity for the insulin receptor relative to the affinity of naturally-occurring human IGF-II for the insulin receptor. In some embodiments, peptide tags with reduced or diminished binding affinity for the insulin receptor suitable for the invention include peptide tags having a binding affinity for the insulin receptor that is more than 1.5-fold, 2-fold, 3-fold, 4-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 12-fold, 14-fold, 16-fold, 18-fold, 20-fold, 50-fold, 100-fold less than that of the wild-type mature human IGF-II. The binding affinity for the insulin receptor can be measured using various in vitro and in vivo assays known in the art. Exemplary binding assays are described in the Examples section.

Mutagenesis

[0074] IGF-II muteins can be prepared by introducing appropriate nucleotide changes into the IGF-II DNA, or by synthesis of the desired IGF-II polypeptide. Variations in the IGF-II sequence can be made, for example, using any of the techniques and guidelines for conservative and non-conservative mutations set forth, for instance, in U.S. Pat. No. 5,364,934. Variations may be a substitution, deletion or insertion of one or more codons encoding IGF-II that results in a change in the amino acid sequence of IGF-II as compared with a naturally-occurring sequence of mature human IGF-II. Amino acid substitutions can be the result of replacing one amino acid with another amino acid having similar structural and/or chemical properties, such as the replacement of a leucine with a serine, i.e., conservative amino acid replacements. Amino acid substitutions can also be the result of replacing one amino acid with another amino acid having dis-similar structural and/or chemical properties, i.e., non-conservative amino acid replacements. Insertions or deletions may optionally be in the range of 1 to 5 amino acids. The variation allowed may be determined by systematically making insertions, deletions or substitutions of amino acids in the sequence and testing the resulting variants for activity in the in vivo or in vitro assays known in the art (such as binding assays to the CI-MPR or furin cleavage assays).

[0075] Scanning amino acid analysis can also be employed to identify one or more amino acids along a contiguous sequence. Among the preferred scanning amino acids are relatively small, neutral amino acids. Such amino acids include alanine, glycine, serine, and cysteine. Alanine is typically a preferred scanning amino acid among this group because it eliminates the side-chain beyond the beta-carbon and is less likely to alter the main-chain conformation of the variant. Alanine is also typically preferred because it is the most common amino acid. Further, it is frequently found in both buried and exposed positions [Creighton, The Proteins, (W. H. Freeman & Co., N.Y.); Chothia, J. Mol. Biol., 150:1 (1976)]. If alanine substitution does not yield adequate amounts of variant, an isoteric amino acid can be used.

[0076] The variations can be made using methods known in the art such as oligonucleotide-mediated (site-directed) mutagenesis, alanine scanning, and PCR mutagenesis. Site-directed mutagenesis [Carter et al., Nucl. Acids Res., 13:4331 (1986); Zoller et al., Nucl. Acids Res., 10:6487 (1987)], cassette mutagenesis [Wells et al., Gene, 34:315 (1985)], restriction selection mutagenesis [Wells et al., Philos. Trans. R. Soc. London SerA, 317:415 (1986)] or other known techniques can be performed on the cloned DNA to produce IGF-II muteins.

Spacer

[0077] A furin-resistant GILT tag can be fused to the N-terminus or C-terminus of a polypeptide encoding a lysosomal enzyme. The GILT tag can be fused directly to the lysosomal enzyme polypeptide or can be separated from the lysosomal enzyme polypeptide by a linker or a spacer. An amino acid linker or spacer is generally designed to be flexible or to interpose a structure, such as an alpha-helix, between the two protein moieties. A linker or spacer can be relatively short, such as the sequence Gly-Ala-Pro (SEQ ID NO: 4) or Gly-Gly-Gly-Gly-Gly-Pro (SEQ ID NO: 5), or can be longer, such as, for example, 10-25 amino acids in length. The site of a fusion junction should be selected with care to promote proper folding and activity of both fusion partners and to prevent premature separation of a peptide tag from a GAA polypeptide. In a preferred embodiment, the linker sequence is Gly-Ala-Pro (SEQ ID NO: 4).

[0078] Additional constructs of GILT-tagged GAA proteins that can be used in the methods and compositions of the present invention were described in detail in U.S. Publication No. 20050244400, the entire disclosure of which is incorporated herein by reference.

Cells

[0079] Any mammalian cell or cell type susceptible to cell culture, and to expression of polypeptides, may be utilized in accordance with the present invention, such as, for example, human embryonic kidney (HEK) 293, Chinese hamster ovary (CHO), monkey kidney (COS), HT1080, C10, HeLa, baby hamster kidney (BHK), 3T3, C127, CV-1, HaK, NS/0, and L-929 cells. Non-limiting examples of mammalian cells that may be used in accordance with the present invention include, but are not limited to, BALB/c mouse myeloma line (NSO/l, ECACC No: 85110503); human retinoblasts (PER.C6 (CruCell, Leiden, The Netherlands)); monkey kidney CV1 line transformed by SV40 (COS-7, ATCC CRL 1651); human embryonic kidney line (293 or 293 cells subcloned for growth in suspension culture, Graham et al., J. Gen Virol., 36:59 (1977)); baby hamster kidney cells (BHK, ATCC CCL 10); Chinese hamster ovary cells +/-DHFR (CHO, Urlaub and Chasin, Proc. Natl. Acad. Sci. USA, 77:4216 (1980)); mouse sertoli cells (TM4, Mather, Biol. Reprod., 23:243-251 (1980)); monkey kidney cells (CV1 ATCC CCL 70); African green monkey kidney cells (VERO-76, ATCC CRL-1 587); human cervical carcinoma cells (HeLa, ATCC CCL 2); canine kidney cells (MDCK, ATCC CCL 34); buffalo rat liver cells (BRL 3A, ATCC CRL 1442); human lung cells (W138, ATCC CCL 75); human liver cells (Hep G2, HB 8065); mouse mammary tumor (MMT 060562, ATCC CCL51); TRI cells (Mather et al., Annals N.Y. Acad. Sci., 383:44-68 (1982)); MRC 5 cells; FS4 cells; and a human hepatoma line (Hep G2). In some embodiments, the fusion protein of the present invention is produced from CHO cell lines.

[0080] The fusion protein of the invention can also be expressed in a variety of non-mammalian host cells such as, for example, insect (e.g., Sf-9, Sf-21, Hi5), plant (e.g., Leguminosa, cereal, or tobacco), yeast (e.g., S. cerivisae, P. pastoris), prokaryote (e.g., E. Coli, B. subtilis and other Bacillus spp., Pseudomonas spp., Streptomyces spp), or fungus.

[0081] In some embodiments, a fusion protein with or without a furin-resistant GILT tag can be produced in furin-deficient cells. As used herein, the term "furin-deficient cells" refers to any cells whose furin protease activity is inhibited, reduced or eliminated. Furin-deficient cells include both mammalian and non-mammalian cells that do not produce furin or produce reduced amount or defective furin protease. Exemplary furin deficient cells that are known and available to the skilled artisan, including but not limited to FD11 cells (Gordon et al (1997) Infection and Immunity 65(8):3370 3375), and those mutant cells described in Moebring and Moehring (1983) Infection and Immunity 41(3):998 1009. Alternatively, a furin deficient cell may be obtained by exposing the above-described mammalian and non-mammalian cells to mutagenesis treatment, e.g., irradiation, ethidium bromide, bromidated uridine (BrdU) and others, preferably chemical mutagenesis, and more preferred ethyl methane sulfonate mutagenesis, recovering the cells which survive the treatment and selecting for those cells which are found to be resistant to the toxicity of Pseudomonas exotoxin A (see Moehring and Moehrin (1983) Infection and Immunity 41(3):998 1009).

Underglycosylation

[0082] Targeted therapeutic proteins of the invention can be underglycosylated, that is, one or more carbohydrate structures that would normally be present on a naturally-occurring human protein is preferably omitted, removed, modified, or masked. Without wishing to be bound by any theories, it is contemplated that an underglycosylated protein may extend the half-life of the protein in a mammal. Underglycosylation can be achieved in many ways. In some embodiments, the targeted fusion protein of the invention can be produced using a secretory signal peptide to facilitate secretion of the fusion protein. For example, the fusion protein can be produced using an IGF-II signal peptide. In general, the fusion protein produced using an IGF-II signal peptide has reduced mannose-6-phosphate (M6P) level on the surface of the protein compared to wild-type enzyme. In some embodiments, a protein may be completely underglycosylated (as when synthesized in E. coli), partially unglycosylated (as when synthesized in a mammalian system after disruption of one or more glycosylation sites by site-directed mutagenesis), or may have a non-mammalian glycosylation pattern. For example, underglycosylated fusion proteins may be generated by modifying, substituting or eliminating one or more glycosylation sites by site-directed mutagenesis. For example, wild-type GAA typically have seven sites that match the canonical recognition sequence for N-linked glycosylation, Asn-Xaa-Thr/Ser (SEQ ID NO: 7) (Xaa can be any residue except Pro), namely, Asn-140, -233, -390, -470, -652, -882 and -925 (Hoefsloot et al., 1988; Martiniuk et al., 1990b). One or more Asn at the above described positions may be changed or eliminated to generated underglycosylated GAA. In some embodiments, Asn may be changed to Gln.

[0083] In some embodiments, a therapeutic fusion protein can be deglycosylated after synthesis. For example, deglycosylation can be through chemical or enzymatic treatments, and may lead to complete deglycosylation or, if only a portion of the carbohydrate structure is removed, partial deglycosylation.

[0084] In some embodiments, glycosylation of a lysosomal enzyme is modified, e.g., by oxidation and reduction, to reduce clearance of the therapeutic protein from the blood. For example, a lysosomal enzyme can be deglycosylated by periodate treatment. In particular, treatment with periodate and a reducing agent such as sodium borohydride is effective to modify the carbohydrate structure of most glycoproteins. Periodate treatment oxidizes vicinal diols, cleaving the carbon-carbon bond and replacing the hydroxyl groups with aldehyde groups; borohydride reduces the aldehydes to hydroxyls. For example, at 1 mM concentration, periodate exclusively oxidizes sialic acid groups and at or above 10 mM all available vicinal diols are converted to aldehydes (Hermanson, G. T. 1996, Bioconjugate techniques. Academic press). Once formed, aldehyde groups are highly reactive and may form Schiff's base linkages with primary amino groups in the protein resulting intramolecular linkages. Therefore, aldehyde groups formed ought to be reduced to alcohol groups. A commonly used reducing agent is NaBH.sub.4 and the reaction is best run under alkaline conditions. Many sugar residues including vicinal diols, therefore, are cleaved by this treatment. Nevertheless, while this treatment converts cyclic carbohydrates into linear carbohydrates, it does not completely remove the carbohydrate, minimizing risks of exposing potentially protease-sensitive or antigenic polypeptide sites.

[0085] Grubb, J. H., et al (Grubb et al, 2008, PNAS 105:2616) report treatment of human .beta.-glucuronidase with sodium metaperiodate followed by sodium borohydride reduction. The modified beta-glucuronidase retained 90% of activity, but lost both mannose and mannose-6-phosphate dependent receptor uptake activity. The alkaline pH condition used in the reduction due to sodium borohydride reagent as described by Grubb et al is not suitable for all lysosomal enzymes, many of which are labile under alkaline conditions.

[0086] Therefore, in some embodiments, sodium cyanoborohydride is used as reducing agent. While the rate of reduction of aldehydes by cyanoborohydride is negligible at neutral pH and above, the rate of reaction becomes rapid at acidic pH (Borch, et al. 1971, JACS 93:2897). For example, regimens using sodium metaperiodate and cyanoborohydride at pH 3.5-4 can be used.

[0087] For example, treatment of GAA or alpha galactosidase A, the enzymes deficient in Pompe and Fabry diseases respectively, with periodate and cyanoborohydride at pH 5.6 resulted in good recovery of enzyme activity. Enzyme was incubated with equal volume mixture containing 20 mM sodium metaperiodate and 40 mM sodium cyanoborohydride in 0.1 M Na acetate, pH 5.6 for 60 min on ice. The unreacted periodate was quenched with glycerol (10% final concentration) for 15 min on ice. The proteins were finally exchanged into phosphate buffered saline, pH 6.2 by diafiltration using Amicon centrifugal filter devices. Other reducing reagents for example, dimethylamine borane, may also be useful to reduce aldehydes generated by sodium metaperiodate oxidation of glycoproteins such as GAA under acidic conditions.

[0088] Thus, in some embodiments, the reduction of sodium metaperiodate treated GAA involves use of sodium cyanoborohydride at acidic pH from pH 3.0 to pH 6. Optimal conditions for the chemical modification can be readily determined by using two assays: loss of binding to ConA sepharose, and diminished uptake into J774E macrophage.

[0089] For example, the ability of periodate/borohydride modified .beta.-glucuronidase to bind to ConA-sepharose was compared to that of untreated .beta.-glucuronidase. The enzymes were incubated with 50 .mu.l ConA beads in 20 mM Tris-HCl, pH 6.8, 0.5 M NaCl for 15 min at room temperature. Beads were centrifuged at maximum speed for 15 sec. Supernatant (flow through) was carefully withdrawn, assayed for GUS activity and analyzed by SD S/PAGE. When we treated GUS exactly as reported in Grubb et al., 60% ConA binding activity was lost and unbound GUS was present only in the flow through of periodate treated and subsequently sodium borohydride reduced sample.

Administration of Therapeutic Proteins

[0090] In accordance of the invention, a therapeutic protein of the invention is typically administered to the individual alone, or in compositions or medicaments comprising the therapeutic protein (e.g., in the manufacture of a medicament for the treatment of the disease), as described herein. The compositions can be formulated with a physiologically acceptable carrier or excipient to prepare a pharmaceutical composition. The carrier and composition can be sterile. The formulation should suit the mode of administration.

[0091] Suitable pharmaceutically acceptable carriers include but are not limited to water, salt solutions (e.g., NaCl), saline, buffered saline, alcohols, glycerol, ethanol, gum arabic, vegetable oils, benzyl alcohols, polyethylene glycols, gelatin, carbohydrates such as lactose, amylose or starch, sugars such as mannitol, sucrose, or others, dextrose, magnesium stearate, talc, silicic acid, viscous paraffin, perfume oil, fatty acid esters, hydroxymethylcellulose, polyvinyl pyrolidone, etc., as well as combinations thereof. The pharmaceutical preparations can, if desired, be mixed with auxiliary agents (e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, coloring, flavoring and/or aromatic substances and the like) which do not deleteriously react with the active compounds or interference with their activity. In a preferred embodiment, a water-soluble carrier suitable for intravenous administration is used.

[0092] The composition or medicament, if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents. The composition can be a liquid solution, suspension, emulsion, tablet, pill, capsule, sustained release formulation, or powder. The composition can also be formulated as a suppository, with traditional binders and carriers such as triglycerides. Oral formulation can include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, polyvinyl pyrollidone, sodium saccharine, cellulose, magnesium carbonate, etc.

[0093] The composition or medicament can be formulated in accordance with the routine procedures as a pharmaceutical composition adapted for administration to human beings. For example, in a preferred embodiment, a composition for intravenous administration typically is a solution in sterile isotonic aqueous buffer. Where necessary, the composition may also include a solubilizing agent and a local anesthetic to ease pain at the site of the injection. Generally, the ingredients are supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or water free concentrate in a hermetically sealed container such as an ampule or sachette indicating the quantity of active agent. Where the composition is to be administered by infusion, it can be dispensed with an infusion bottle containing sterile pharmaceutical grade water, saline or dextrose/water. Where the composition is administered by injection, an ampule of sterile water for injection or saline can be provided so that the ingredients may be mixed prior to administration.

[0094] The therapeutic protein can be formulated as neutral or salt forms. Pharmaceutically acceptable salts include those formed with free amino groups such as those derived from hydrochloric, phosphoric, acetic, oxalic, tartaric acids, etc., and those formed with free carboxyl groups such as those derived from sodium, potassium, ammonium, calcium, ferric hydroxides, isopropylamine, triethylamine, 2-ethylamino ethanol, histidine, procaine, etc.

[0095] A therapeutic protein (or a composition or medicament containing a therapeutic protein) is administered by any appropriate route. In a preferred embodiment, a therapeutic protein is administered intravenously. In other embodiments, a therapeutic protein is administered by direct administration to a target tissue, such as heart or muscle (e.g., intramuscular), or nervous system (e.g., direct injection into the brain; intraventricularly; intrathecally). Alternatively, a therapeutic protein (or a composition or medicament containing a therapeutic protein) can be administered parenterally, transdermally, or transmucosally (e.g., orally or nasally). More than one route can be used concurrently, if desired.

[0096] A therapeutic protein (or a composition or medicament containing a therapeutic protein) can be administered alone, or in conjunction with other agents, such as antihistamines (e.g., diphenhydramine) or immunosuppressants or other immunotherapeutic agents which counteract anti-GILT-tagged lysosomal enzyme antibodies. The term, "in conjunction with," indicates that the agent is administered prior to, at about the same time as, or following the therapeutic protein (or a composition or medicament containing the therapeutic protein). For example, the agent can be mixed into a composition containing the therapeutic protein, and thereby administered contemporaneously with the therapeutic protein; alternatively, the agent can be administered contemporaneously, without mixing (e.g., by "piggybacking" delivery of the agent on the intravenous line by which the therapeutic protein is also administered, or vice versa). In another example, the agent can be administered separately (e.g., not admixed), but within a short time frame (e.g., within 24 hours) of administration of the therapeutic protein.

[0097] The therapeutic protein (or composition or medicament containing the therapeutic protein) is administered in a therapeutically effective amount (i.e., a dosage amount that, when administered at regular intervals, is sufficient to treat the disease, such as by ameliorating symptoms associated with the disease, preventing or delaying the onset of the disease, and/or also lessening the severity or frequency of symptoms of the disease, as described above). The dose which will be therapeutically effective for the treatment of the disease will depend on the nature and extent of the disease's effects, and can be determined by standard clinical techniques. In addition, in vitro or in vivo assays may optionally be employed to help identify optimal dosage ranges using methods known in the art. The precise dose to be employed will also depend on the route of administration, and the seriousness of the disease, and should be decided according to the judgment of a practitioner and each patient's circumstances. Effective doses may be extrapolated from dose-response curves derived from in vitro or animal model test systems. The therapeutically effective dosage amount can be, for example, about 0.1-1 mg/kg, about 1-5 mg/kg, about 5-20 mg/kg, about 20-50 mg/kg, or 20-100 mg/kg. The effective dose for a particular individual can be varied (e.g., increased or decreased) over time, depending on the needs of the individual. For example, in times of physical illness or stress, or if disease symptoms worsen, the dosage amount can be increased.

[0098] The therapeutically effective amount of the therapeutic protein (or composition or medicament containing the therapeutic protein) is administered at regular intervals, depending on the nature and extent of the disease's effects, and on an ongoing basis. Administration at an "interval," as used herein, indicates that the therapeutically effective amount is administered periodically (as distinguished from a one-time dose). The interval can be determined by standard clinical techniques. In some embodiments, the therapeutic protein is administered bimonthly, monthly, twice monthly, triweekly, biweekly, weekly, twice weekly, thrice weekly, or daily. The administration interval for a single individual need not be a fixed interval, but can be varied over time, depending on the needs of the individual. For example, in times of physical illness or stress, or if disease symptoms worsen, the interval between doses can be decreased.

[0099] As used herein, the term "bimonthly" means administration once per two months (i.e., once every two months); the term "monthly" means administration once per month; the term "triweekly" means administration once per three weeks (i.e., once every three weeks); the term "biweekly" means administration once per two weeks (i.e., once every two weeks); the term "weekly" means administration once per week; and the term "daily" means administration once per day.

[0100] The invention additionally pertains to a pharmaceutical composition comprising a therapeutic protein, as described herein, in a container (e.g., a vial, bottle, bag for intravenous administration, syringe, etc.) with a label containing instructions for administration of the composition for treatment of Pompe disease, such as by the methods described herein.

[0101] The invention will be further and more specifically described by the following examples. Examples, however, are included for illustration purposes, not for limitation.

EXAMPLES

Example 1

Furin Cleaves an IGF-II Based GILT Tag

[0102] ZC-701 has been developed for the treatment of Pompe disease. ZC-701 is a chimeric protein that contains an N-terminal IGF-II based GILT tag fused via a three amino acid spacer to residues 70-952 of human acid-.alpha.-glucosidase (hGAA). Specifically, ZC-701 includes amino acids 1 and 8-67 of human IGF-II (i.e., .DELTA.2-7 of mature human IGF-II), the spacer sequence Gly-Ala-Pro, and amino acids 70-952 of human GAA. The full length amino acid sequence is shown below. The spacer sequence is bolded. The sequence N-terminal to the spacer sequence reflects amino acids 1 and 8-67 of human IGF-II and the sequence C-terminal to the spacer sequence reflects amino acids 70-952 of human GAA. The two potential overlapping furin cleavage sites within the IGF-II tag sequence is bolded and underlined. Arrows point to two potential furin cleavage positions.

##STR00002##

[0103] During the course of development of ZC-701, it has become apparent that the IGF-II derived GILT tag on a fraction of the ZC-701 molecules is subjected to proteolytic cleavage by furin during production in CHO cells. N-terminal analysis of ZC-701 batch 10-2-F45-54 revealed the presence of two n-terminal sequences. One conformed to the predicted n-terminus of ZC-701 indicating the presence of the predicted ZC-701 protein. The other n-terminal sequence aligned with sequence within the tag portion of ZC-701 indicating the presence of a derivative of ZC-701 consistent with an endoproteolytic cleavage at amino acid residue 34 of ZC-701. Based on the estimated molar ratios of the two n-termini, this batch of ZC-701 was found to have about a 1:1 ratio of intact and cleaved species.

[0104] Upon receipt of this result, each of the other batches of ZC-701 were subjected to n-terminal sequencing. All of the batches displayed the same two n-termini with the cleaved species ranging from 20-50% of the total compound. One batch, previously shown to have low uptake activity, displayed a set of n-termini indicative of additional proteolysis. We concluded that the proteolytic event responsible for the second species in all of our batches of ZC-701 was perpetrated by furin or a furin-like protease.

[0105] FIG. 1 shows a map of the amino terminus of ZC-701. The two amino acid boxed residues are the sites of n-termini mapped in all of the ZC-701 batches. The first of the N-termini is the site of signal peptide cleavage, which yields the predicted n-terminus of ZC-701. The second boxed residue is the site of an undesired proteolytic cleavage event. The amino acid sequence proximal to the cleavage site is Arg-Arg-Ser-Arg (SEQ ID NO: 9). This matches the canonical cleavage site of a protease present in CHO cells called furin, which cleaves after Arg-X-X-Arg (SEQ ID NO: 10). Furin is a member of a family of prohormone convertases that includes PC3, a protease responsible for maturation of proinsulin in pancreatic islet cells. In fact the PC3 cleavage site in proinsulin is conserved and identical to the site at which furin cleaves the IGF-II tag.

[0106] The Furin cleaved ZC-701 differs in molecular weight from intact ZC-701 by about 3000 daltons, which represents less than a 3% difference in molecular weight. Due to the heterogeneity of the oligosaccharide in the protein, the presence of the cleaved ZC-701 was not previously detected by SDS-PAGE. However, if ZC-701 is first deglycosylated by treatment with Peptide N-Glycosidase F (PNGase F), then the cleaved protein can be resolved from the intact ZC-701 by SDS-PAGE.

[0107] As shown in FIG. 2, lane 1 of the SDS-PAGE gel shows the electrophoretic pattern of deglycosylated purified ZC-701. Two bands are evident. The upper band is believed to be intact ZC-701 and the lower band is believed to be furin cleaved ZC-701. To prove that the lower band is indeed Furin cleaved ZC-701, same proteins loaded in lane 1 were first treated with furin and then loaded in lane 2. As shown in FIG. 2, all of the proteins in lane 2 co-migrates with the lower band in lane 1 indicating that the lower band is in fact furin cleaved ZC-701.

[0108] We have estimated the proportion of ZC-701 that has been cleaved with furin in a number of batches of ZC-701 by quantification of the band intensity in SDS-PAGE and by quantification of amino acids released in N-terminal sequencing experiments. As discussed above, the fraction of cleaved ZC-701 has ranged from 20% to 50% in different batches.

Example 2

Targeted Fusion Proteins Containing a Furin-Resistant IGF-II Based GILT Tag

[0109] We can design around the problem of furin cleavage by altering the amino acid sequence of IGF-II such that the amino acid alteration abolishes at least one furin cleavage site. A series of mutant versions of ZC-701 were generated and assayed for resistance to cleavage by furin. Exemplary mutant versions of ZC-701 were generated as described below.

ZC-701

[0110] The GILT.DELTA.2-7-GAA70-952 cassette below was cloned using the Asp718 and NotI sites of the cassette and vector pCEP4 to produce pCEP-GILT.DELTA.2-7-GAA70-952 (Plasmid p701). Restriction sites for cloning are in lowercase bold. The spacer amino acid sequence Gly, Ala, Pro (underlined sequence) separate the GAA gene and GILT.DELTA.2-7 tag (upper case sequence). The spacer and tag are placed upstream of GAA residue Ala70.

TABLE-US-00002 (SEQ ID NO: 11) ggtaccagctgctagcaagctaattcacaccaATGGGAATCCCAATGGG GAAGTCGATGCTGGTGCTTCTCACCTTCTTGGCCTTCGCCTCGTGCTGC ATTGCTGCTCTGTGCGGCGGGGAGCTGGTGGACACCCTCCAGTTCGTCT GTGGGGACCGCGGCTTCTACTTCAGCAGGCCCGCAAGCCGTGTGAGCCG TCGCAGCCGTGGCATCGTTGAGGAGTGCTGTTTCCGCAGCTGTGACCTG GCCCTCCTGGAGACGTACTGTGCTACCCCCGCCAAGTCCGAGGGCGCGC CGgcacaccccggccgtcccagagcagtgcccacacagtgcgacgtccc ccccaacagccgcttcgattgcgcccctgacaaggccatcacccaggaa cagtgcgaggcccgcggctgctgctacatccctgcaaagcaggggctgc agggagcccagatggggcagccctggtgcttcttcccacccagctaccc cagctacaagctggagaacctgagctcctctgaaatgggctacacggcc accctgacccgtaccacccccaccttcttccccaaggacatcctgaccc tgcggctggacgtgatgatggagactgagaaccgcctccacttcacgat caaagatccagctaacaggcgctacgaggtgcccttggagaccccgcgt gtccacagccgggcaccgtccccactctacagcgtggagttctctgagg agccatcggggtgatcgtgcaccggcagctggacggccgcgtgctgctg aacacgacggtggcgcccctgttctttgcggaccagttccttcagctgt ccacctcgctgccctcgcagtatatcacaggcctcgccgagcacctcag tcccctgatgctcagcaccagctggaccaggatcaccctgtggaaccgg gaccttgcgcccacgcccggtgcgaacctctacgggtctcaccctttct acctggcgctggaggacggcgggtcggcacacggggtgttcctgctaaa cagcaatgccatggatgtggtcctgcagccgagccctgcccttagctgg aggtcgacaggtgggatcctggatgtctacatcttcctgggcccagagc ccaagagcgtggtgcagcagtacctggacgagtgggatacccgttcatg ccgccatactggggcctgggcttccacctgtgccgctggggctactcct ccaccgctatcacccgccaggtggtggagaacatgaccagggcccactt ccccctggacgtccaatggaacgacctggactacatggactcccggagg gacttcacgttcaacaaggatggcttccgggacttcccggccatggtgc aggagctgcaccagggcggccggcgctacatgatgatcgtggatcctgc catcagcagctcgggccctgccgggagctacaggccctacgacgagggt ctgcggaggggggttttcatcaccaacgagaccggccagccgctgattg ggaaggtatggcccgggtccactgccttccccgacttcaccaaccccac agccctggcctggtgggaggacatggtggctgagttccatgaccaggtg cccttcgacggcatgtggattgacatgaacgagccttccaacttcatca ggggctctgaggacggctgccccaacaatgagctggagaacccacccta cgtgcctggggtggttggggggaccctccaggcggcaaccatctgtgcc tccagccaccagtactctccacacactacaacctgcacaacctctacgg cctgaccgaagccatcgcctcccacagggcgctggtgaaggctcggggg acacgcccatttgtgatctcccgctcgacctttgctggccacggccgat acgccggccactggacgggggacgtgtggagctcctgggagcagctcgc ctcctccgtgccagaaatcctgcagtttaacctgctgggggtgcctctg gtcggggccgacgtctgcggcttcctgggcaacacctcagaggagctgt gtgtgcgctggacccagctgggggccttctaccccttcatgcggaacca caacagcctgctcagtctgccccaggagccgtacagatcagcgagccgg cccagcaggccatgaggaaggccctcaccctgcgctacgcactcctccc ccacctctacacgctgaccaccaggcccacgtcgcgggggagaccgtgg cccggcccctcttcctggagttccccaaggactctagcacctggactgt ggaccaccagctcctgtggggggaggccctgctcatcaccccagtgacc aggccgggaaggccgaagtgactggctacttccccttgggcacatggta cgacctgcagacggtgccaatagaggcccttggcagcctcccaccccca cctgcagctccccgtgagccagccatccacagcgaggggcagtgggtga cgctgccggcccccctggacaccatcaacgtccacctccgggctgggta catcatccccctgcagggccctggcctcacaaccacagagtcccgccag cagcccatggccctggctgtggccctgaccaagggtggagaggcccgag gggagctgttctgggacgatggagagagcctggaagtgctggagcgagg ggcctacacacaggtcatcttcctggccaggaataacacgatcgtgaat gagaggtacgtgtgaccagtgagggagctggcctgcagagcagaaggtg actgtcctgggcgtggccacggcgccccagcaggtcctaccaacggtgt ccctgtctccaacttcacctacagccccgacaccaaggtcctggacatc tgtgtctcgctgttgatgggagagcagtttacgtcagctggtgttagtc tagagcttgctagcggccgc

Construct 1459

[0111] The GILT.DELTA.2-7/K37-GAA70-952 cassette below was cloned using the Asp718 and NotI sites of the cassette and vector pCEP4 to produce pCEP-GILT.DELTA.2-7/K37-GAA70-952 (Plasmid p1459). Restriction sites for cloning are in lowercase bold. The spacer amino acid sequence Gly, Ala, Pro (underlined sequence) separate the GAA gene and GILT.DELTA.2-7/K37 tag (upper case sequence). The spacer and tag are placed upstream of GAA residue Ala70. The GILT.DELTA.2-7/K37 cassette contains an Arg to Lys substitution at amino acid 37 of the human IGF-II sequence (uppercase bold).

TABLE-US-00003 (SEQ ID NO: 12) ggtaccagctgctagcaagctaattcacaccaATGGGAATCCCAATGGG GAAGTCGATGCTGGTGCTTCTCACCTTCTTGGCCTTCGCCTCGTGCTGC ATTGCTGCTCTGTGCGGCGGGGAGCTGGTGGACACCCTCCAGTTCGTCT GTGGGGACCGCGGCTTCTACTTCAGCAGGCCCGCAAGCCGTGTGAGCAA GCGCAGCCGTGGCATCGTTGAGGAGTGCTGTTTCCGCAGCTGTGACCTG GCCCTCCTGGAGACGTACTGTGCTACCCCCGCCAAGTCCGAGGGCGCGC CGgcacaccccggccgtcccagagcagtgcccacacagtgcgacgtccc ccccaacagccgcttcgattgcgcccctgacaaggccatcacccaggaa cagtgcgaggcccgcggctgctgctacatccctgcaaagcaggggctgc agggagcccagatggggcagccctggtgcttcttcccacccagctaccc cagctacaagctggagaacctgagctcctctgaaatgggctacacggcc accctgacccgtaccacccccaccttcttccccaaggacatcctgaccc tgcggctggacgtgatgatggagactgagaaccgcctccacttcacgat caaagatccagctaacaggcgctacgaggtgcccaggagaccccgcgtg tccacagccgggcaccgtccccactctacagcgtggagttctctgagga gcccttcggggtgatcgtgcaccggcagctggacggccgcgtgctgctg aacacgacggtggcgcccctgttctttgcggaccagttccttcagctgt ccacctcgctgccctcgcagtatatcacaggcctcgccgagcacctcag tcccctgatgctcagcaccagctggaccaggatcaccctgtggaaccgg gaccttgcgcccacgcccggtgcgaacctctacgggtctcaccctttct acctggcgctggaggacggcgggtcggcacacggggtgttcctgctaaa cagcaatgccatggatgtggtcctgcagccgagccctgcccttagctgg aggtcgacaggtgggatcctggatgtctacatcttcctgggcccagagc ccaagagcgtggtgcagcagtacctggacgttgtgggatacccgttcat gccgccatactggggcctgggatccacctgtgccgctggggctactcct ccaccgctatcacccgccaggtggtggagaacatgaccagggcccactt ccccctggacgtccaatggaacgacctggactacatggactcccggagg gacttcacgttcaacaaggatggcttccgggacttcccggccatggtgc aggagctgcaccagggcggccggcgctacatgatgatcgtggatcctgc catcagcagctcgggccctgccgggagctacaggccctacgacgagggt ctgcggaggggggttttcatcaccaacgagaccggccagccgctgattg ggaaggtatggcccgggtccactgccaccccgacttcaccaaccccaca gccctggcctggtgggaggacatggtggctgagttccatgaccaggtgc catcgacggcatgtggattgacatgaacgagccttccaacttcatcagg ggctctgaggacggctgccccaacaatgagctggagaacccaccctacg tgcctggggtggttggggggaccctccaggcggcaaccatctgtgcacc agccaccagtactctccacacactacaacctgcacaacctctacggcct gaccgaagccatcgcctcccacagggcgctggtgaaggctcgggggaca cgcccatttgtgatctcccgctcgacctttgctggccacggccgatacg ccggccactggacgggggacgtgtggagctcctgggagcagctcgcctc ctccgtgccagaaatcctgcagtttaacctgctgggggtgcctctggtc ggggccgacgtctgcggatcctgggcaacacctcagaggagctgtgtgt gcgctggacccagctgggggccttctacccatcatgcggaaccacaaca gcctgctcagtctgccccaggagccgtacagatcagcgagccggcccag caggccatgaggaaggccacaccctgcgctacgcactcctcccccacct ctacacgctgttccaccaggcccacgtcgcgggggagaccgtggcccgg cccctcttcctggagttccccaaggactctagcacctggactgtggacc accagacctgtggggggaggccctgacatcaccccagtgaccaggccgg gaaggccgaagtgactggctacttcccatgggcacatggtacgacctgc agacggtgccaatagaggcccttggcagcctcccacccccacctgcagc tccccgtgagccagccatccacagcgaggggcagtgggtgacgctgccg gcccccctggacaccatcaacgtccacctccgggctgggtacatcatcc ccctgcagggccctggcctcacaaccacagagtcccgccagcagcccat ggccctggctgtggccctgaccaagggtggagaggcccgaggggagctg ttctgggacgatggagagagcctggaagtgctggagcgaggggcctaca cacaggtcatcttcctggccaggaataacacgatcgtgaatgagctggt acgtgtgaccagtgagggagaggcctgcagctgcagaaggtgactgtcc tgggcgtggccacggcgccccagcaggtcctctccaacggtgtccctgt accaacttcacctacagccccgacaccaaggtcctggacatagtgtctc gctgttgatgggagagcagtttctcgtcagctggtgttagtctagagct tgctagcggccgc

Construct 1460

[0112] The GILT.DELTA.2-7/K40-GAA70-952 cassette below was cloned using the Asp718 and NotI sites of the cassette and vector pCEP4 to produce pCEP-GILT.DELTA.2-7/K40-GAA70-952 (Plasmid p1460). Restriction sites for cloning are in lowercase bold. The spacer amino acid sequence Gly, Ala, Pro (underlined sequence) separate the GAA gene and GILT.DELTA.2-7/K40 tag (upper case sequence). The spacer and tag are placed upstream of GAA residue Ala70. The GILT.DELTA.2-7/K40 cassette contains an Arg to Lys substitution at amino acid 40 of the human IGF-II sequence (uppercase bold).

TABLE-US-00004 (SEQ ID NO: 13) ggtaccagctgctagcaagctaattcacaccaATGGGAATCCCAATGGG GAAGTCGATGCTGGTGCTTCTCACCTTCTTGGCCTTCGCCTCGTGCTGC ATTGCTGCTCTGTGCGGCGGGGAGCTGGTGGACACCCTCCAGTTCGTCT GTGGGGACCGCGGCTTCTACTTCAGCAGGCCCGCAAGCCGTGTGAGCCG TCGCAGCAAGGGCATCGTTGAGGAGTGCTGTTTCCGCAGCTGTGACCTG GCCCTCCTGGAGACGTACTGTGCTACCCCCGCCAAGTCCGAGGGCGCGC CGgcacaccccggccgtcccagagcagtgcccacacagtgcgacgtccc ccccaacagccgcttcgattgcgcccctgacaaggccatcacccaggaa cagtgcgaggcccgcggctgctgctacatccctgcaaagcaggggctgc agggagcccagatggggcagccctggtgcttcttcccacccagctaccc cagctacaagctggagaacctgagctcctctgaaatgggctacacggcc accctgacccgtaccacccccaccttcttccccaaggacatcctgaccc tgcggctggacgtgatgatggagactgagaaccgcctccacttcacgat caaagatccagctaacaggcgctacgaggtgcccttggagaccccgcgt gtccacagccgggcaccgtccccactctacagcgtggagttctctgagg agcccttcggggtgatcgtgcaccggcagctggacggccgcgtgctgct gaacacgacggtggcgcccctgttctagcggaccagttccttcagctgt ccacctcgctgccctcgcagtatatcacaggcctcgccgagcacctcag tcccctgatgctcagcaccagctggaccaggatcaccctgtggaaccgg gaccttgcgcccacgcccggtgcgaacctctacgggtctcaccctttct acctggcgctggaggacggcgggtcggcacacggggtgttcctgctaaa cagcaatgccatggatgtggtcctgcagccgagccctgcccttagctgg aggtcgacaggtgggatcctggatgtctacatcttcctgggcccagagc ccaagagcgtggtgcagcagtacctggacgttgtgggatacccgttcat gccgccatactggggcctgggcttccacctgtgccgctggggctactcc tccaccgctatcacccgccaggtggtggagaacatgaccagggcccact tccccctggacgtccaatggaacgacctggactacatggactcccggag ggacttcacgttcaacaaggatggcttccgggacttcccggccatggtg caggagctgcaccagggcggccggcgctacatgatgatcgtggatcctg ccatcagcagacgggccctgccgggagctacaggccctacgacgagggt ctgcggaggggggttttcatcaccaacgagaccggccagccgctgattg ggaaggtatggcccgggtccactgccttccccgacttcaccaaccccac agccctggcctggtgggaggacatggtggctgagttccatgaccaggtg ccatcgacggcatgtggattgacatgaacgagccttccaacttcatcag gggactgaggacggctgccccaacaatgagaggagaacccaccctacgt gcctggggtggttggggggaccctccaggcggcaaccatctgtgcctcc agccaccagtttctctccacacactacaacctgcacaacctctacggcc tgaccgaagccatcgcctcccacagggcgctggtgaaggctcgggggac acgcccatttgtgatctcccgctcgacctttgctggccacggccgatac gccggccactggacgggggacgtgtggagacctgggagcagctcgcctc ctccgtgccagaaatcctgcagtttaacctgctgggggtgcctctggtc ggggccgacgtctgcggcttcctgggcaacacctcagaggagctgtgtg tgcgctggacccagctgggggccttctaccccttcatgcggaaccacaa cagcctgctcagtctgccccaggagccgtacagcttcagcgagccggcc cagcaggccatgaggaaggccctcaccctgcgctacgcactcctccccc acctctacacgctgaccaccaggcccacgtcgcgggggagaccgtggcc cggcccctatcctggagttccccaaggactctagcacctggactgtgga ccaccagacctgtggggggaggccctgctcatcaccccagtgctccagg ccgggaaggccgaagtgactggctacttccccttgggcacatggtacga cctgcagacggtgccaatagaggccatggcagcctcccacccccacctg cagctccccgtgagccagccatccacagcgaggggcagtgggtgacgct gccggcccccctggacaccatcaacgtccacctccgggctgggtacatc atccccctgcagggccctggcctcacaaccacagagtcccgccagcagc ccatggccctggctgtggccctgaccaagggtggagaggcccgagggga gctgttctgggacgatggagagagcctggaagtgctggagcgaggggcc tacacacaggtcatcttcctggccaggaataacacgatcgtgaatgaga ggtacgtgtgaccagtgagggagaggcctgcagagcagaaggtgactgt cctgggcgtggccacggcgccccagcaggtcctctccaacggtgtccct gtaccaacttcacctacagccccgacaccaaggtcctggacatagtgtc tcgctgttgatgggagagcagtttctcgtcagctggtgttagtctagag cttgctagcggccgc

Construct 1461

[0113] The GILT.DELTA.2-7/A37-GAA70-952 cassette below was cloned using the Asp718 and NotI sites of the cassette and vector pCEP4 to produce pCEP-GILT.DELTA.2-7/A37-GAA70-952 (Plasmid p1461). Restriction sites for cloning are in lowercase bold. The spacer amino acid sequence Gly, Ala, Pro (underlined sequence) separate the GAA gene and GILT.DELTA.2-7/A37 tag (upper case sequence). The spacer and tag are placed upstream of GAA residue Ala70. The GILT.DELTA.2-7/A37 cassette contains an Arg to Ala substitution at amino acid 37 of the human IGF-II sequence (uppercase bold).

TABLE-US-00005 (SEQ ID NO: 14) ggtaccagctgctagcaagctaattcacaccaATGGGAATCCCAATGGGG AAGTCGATGCTGGTGCTTCTCACCTTCTTGGCCTTCGCCTCGTGCTGCAT TGCTGCTCTGTGCGGCGGGGAGCTGGTGGACACCCTCCAGTTCGTCTGTG GGGACCGCGGCTTCTACTTCAGCAGGCCCGCAAGCCGTGTGAGCGCTCGC AGCCGTGGCATCGTTGAGGAGTGCTGTTTCCGCAGCTGTGACCTGGCCCT CCTGGAGACGTACTGTGCTACCCCCGCCAAGTCCGAGGGCGCGCCGgcac accccggccgtcccagagcagtgcccacacagtgcgacgtcccccccaac agccgcttcgattgcgcccctgacaaggccatcacccaggaacagtgcga ggcccgcggctgctgctacatccctgcaaagcaggggctgcagggagccc agatggggcagccctggtgcttcttcccacccagctaccccagctacaag ctggagaacctgagctcctctgaaatgggctacacggccaccctgacccg taccacccccaccttcttccccaaggacatcctgaccctgcggctggacg tgatgatggagactgagaaccgcctccacttcacgatcaaagatccagct aacaggcgctacgaggtgcccttggagaccccgcgtgtccacagccgggc accgtccccactctacagcgtggagttctctgaggagcccttcggggtga tcgtgcaccggcagctggacggccgcgtgctgctgaacacgacggtggcg cccctgttctttgcggaccagttccttcagctgtccacctcgctgccctc gcagtatatcacaggcctcgccgagcacctcagtcccctgatgctcagca ccagctggaccaggatcaccctgtggaaccgggaccttgcgcccacgccc ggtgcgaacctctacgggtctcaccattctacctggcgctggaggacggc gggtcggcacacggggtgttcctgctaaacagcaatgccatggatgtggt cctgcagccgagccctgcccttagctggaggtcgacaggtgggatcctgg atgtctacatcttcctgggcccagagcccaagagcgtggtgcagcagtac ctggacgttgtgggatacccgttcatgccgccatactggggcctgggctt ccacctgtgccgctggggctactcctccaccgctatcacccgccaggtgg tggagaacatgaccagggcccacttccccctggacgtccaatggaacgac ctggactacatggactcccggagggacttcacgttcaacaaggatggctt ccgggacttcccggccatggtgcaggagctgcaccagggcggccggcgct acatgatgatcgtggatcctgccatcagcagctcgggccctgccgggagc tacaggccctacgacgagggtctgcggaggggggttttcatcaccaacga gaccggccagccgctgattgggaaggtatggcccgggtccactgcatccc cgacttcaccaaccccacagccctggcctggtgggaggacatggtggctg agttccatgaccaggtgccatcgacggcatgtggattgacatgaacgagc cttccaacttcatcaggggactgaggacggctgccccaacaatgagctgg agaacccaccctacgtgcctggggtggttggggggaccaccaggcggcaa ccatctgtgcctccagccaccagtttactccacacactacaacctgcaca acctctacggcctgaccgaagccatcgcctcccacagggcgctggtgaag gctcgggggacacgcccatttgtgatctcccgctcgacctttgctggcca cggccgatacgccggccactggacgggggacgtgtggagacctgggagca gctcgcctcctccgtgccagaaatcctgcagtttaacctgctgggggtgc ctctggtcggggccgacgtctgcggcttcctgggcaacacctcagaggag agtgtgtgcgctggacccagctgggggccttctaccccttcatgcggaac cacaacagcctgacagtagccccaggagccgtacagcttcagcgagccgg cccagcaggccatgaggaaggccctcaccctgcgctacgcactcctcccc cacctctacacgctgttccaccaggcccacgtcgcgggggagaccgtggc ccggcccctcttcctggagttccccaaggactctagcacctggactgtgg accaccagctcctgtggggggaggccctgctcatcaccccagtgctccag gccgggaaggccgaagtgactggctacttccccttgggcacatggtacga cctgcagacggtgccaatagaggcccttggcagcctcccacccccacctg cagctccccgtgagccagccatccacagcgaggggcagtgggtgacgctg ccggcccccctggacaccatcaacgtccacctccgggctgggtacatcat ccccctgcagggccaggcctcacaaccacagagtcccgccagcagcccat ggccaggctgtggccctgaccaagggtggagaggcccgaggggagagttc tgggacgatggagagagcctggaagtgctggagcgaggggcctacacaca ggtcatcttcctggccaggaataacacgatcgtgaatgagaggtacgtgt gaccagtgagggagaggcctgcagctgcagaaggtgactgtcctgggcgt ggccacggcgccccagcaggtcctaccaacggtgtccctgtctccaactt cacctacagccccgacaccaaggtcctggacatctgtgtctcgctgttga tgggagagcagtttctcgtcagctggtgttagtctagagcttgctagcgg ccgc

Construct 1463

[0114] The GILT.DELTA.2-7/A40-GAA70-952 cassette below was cloned using the Asp718 and NotI sites of the cassette and vector pCEP4 to produce pCEP-GILT.DELTA.2-7/A40-GAA70-952 (Plasmid p1463). Restriction sites for cloning are in lowercase bold. The spacer amino acid sequence Gly, Ala, Pro (underlined sequence) separate the GAA gene and GILT.DELTA.2-7/A40 tag (upper case sequence). The spacer and tag are placed upstream of GAA residue Ala70. The GILT.DELTA.2-7/A40 cassette contains an Arg to Ala substitution at amino acid 40 of the human IGF2 sequence (uppercase bold).

TABLE-US-00006 (SEQ ID NO: 15) ggtaccagctgctagcaagctaattcacaccaATGGGAATCCCAATGGG GAAGTCGATGCTGGTGCTTCTCACCTTCTTGGCCTTCGCCTCGTGCTGC ATTGCTGCTCTGTGCGGCGGGGAGCTGGTGGACACCCTCCAGTTCGTCT GTGGGGACCGCGGCTTCTACTTCAGCAGGCCCGCAAGCCGTGTGAGCCG TCGCAGCGCTGGCATCGTTGAGGAGTGCTGTTTCCGCAGCTGTGACCTG GCCCTCCTGGAGACGTACTGTGCTACCCCCGCCAAGTCCGAGGGCGCGC CGgcacaccccggccgtcccagagcagtgcccacacagtgcgacgtccc ccccaacagccgcttcgattgcgcccctgacaaggccatcacccaggaa cagtgcgaggcccgcggctgctgctacatccctgcaaagcaggggctgc agggagcccagatggggcagccctggtgcttcttcccacccagctaccc cagctacaagctggagaacctgagctcctctgaaatgggctacacggcc accctgacccgtaccacccccaccttcttccccaaggacatcctgaccc tgcggctggacgtgatgatggagactgagaaccgcctccacttcacgat caaagatccagctaacaggcgctacgaggtgcccttggagaccccgcgt gtccacagccgggcaccgtccccactctacagcgtggagttctctgagg agcccttcggggtgatcgtgcaccggcagctggacggccgcgtgctgct gaacacgacggtggcgcccctgttctttgcggaccagttccttcagctg tccacctcgctgccctcgcagtatatcacaggcctcgccgagcacctca gtcccctgatgctcagcaccagctggaccaggatcaccctgtggaaccg ggaccttgcgcccacgcccggtgcgaacctctacgggtctcaccattct acctggcgctggaggacggcgggtcggcacacggggtgttcctgctaaa cagcaatgccatggatgtggtcctgcagccgagccctgcccttagctgg aggtcgacaggtgggatcctggatgtctacatcttcctgggcccagagc ccaagagcgtggtgcagcagtacctggacgttgtgggatacccgttcat gccgccatactggggcctgggcttccacctgtgccgctggggctactcc tccaccgctatcacccgccaggtggtggagaacatgaccagggcccact tccccctggacgtccaatggaacgacctggactacatggactcccggag ggacttcacgttcaacaaggatggcttccgggacttcccggccatggtg caggagctgcaccagggcggccggcgctacatgatgatcgtggatcctg ccatcagcagctcgggccctgccgggagctacaggccctacgacgaggg tctgcggaggggggttttcatcaccaacgagaccggccagccgctgatt gggaaggtatggcccgggtccactgccttccccgacttcaccaacccca cagccctggcctggtgggaggacatggtggctgagttccatgaccaggt gcccttcgacggcatgtggattgacatgaacgagccttccaacttcatc aggggactgaggacggctgccccaacaatgagaggagaacccaccctac gtgcctggggtggttggggggaccaccaggcggcaaccatctgtgcctc cagccaccagtttctctccacacactacaacctgcacaacctctacggc ctgaccgaagccatcgcctcccacagggcgctggtgaaggctcggggga cacgcccatttgtgatctcccgctcgacctttgctggccacggccgata cgccggccactggacgggggacgtgtggagctcctgggagcagctcgcc tcctccgtgccagaaatcctgcagtttaacctgctgggggtgcctaggt cggggccgacgtctgcggcttcctgggcaacacctcagaggagctgtgt gtgcgctggacccagctgggggccttctaccccttcatgcggaaccaca acagcctgctcagtctgccccaggagccgtacagcttcagcgagccggc ccagcaggccatgaggaaggccctcaccctgcgctacgcactcctcccc cacctctacacgctgttccaccaggcccacgtcgcgggggagaccgtgg cccggcccctcttcctggagttccccaaggactctagcacctggactgt ggaccaccagctcctgtggggggaggccagctcatcaccccagtgctcc aggccgggaaggccgaagtgactggctacttccccttgggcacatggta cgacctgcagacggtgccaatagaggcccttggcagcctcccaccccca cctgcagctccccgtgagccagccatccacagcgaggggcagtgggtga cgctgccggcccccctggacaccatcaacgtccacctccgggctgggta catcatccccctgcagggccaggcctcacaaccacagagtcccgccagc agcccatggccctggctgtggccctgaccaagggtggagaggcccgagg ggagctgttctgggacgatggagagagcctggaagtgctggagcgaggg gcctacacacaggtcatcttcctggccaggaataacacgatcgtgaatg agctggtacgtgtgaccagtgagggagctggcctgcagctgcagaaggt gactgtcctgggcgtggccacggcgccccagcaggtcctctccaacggt gtccagtctccaacttcacctacagccccgacaccaaggtcctggacat ctgtgtctcgctgttgatgggagagcagtttctcgtcagaggtgttagt ctagagcttgctagcggccgc

Construct 1479

[0115] The GILT.DELTA.2-7M1/K37-GAA70-952 cassette below was cloned using the Asp718 and NotI sites of the cassette and vector pCEP4 to produce pCEP-GILT.DELTA.2-7M1/K37-GAA70-952 (Plasmid p1479). Restriction sites for cloning are in lowercase bold. The spacer amino acid sequence Gly, Ala, Pro (underlined sequence) separate the GAA gene and GILT.DELTA.2-7M1/K37 tag (upper case sequence). The spacer and tag are placed upstream of GAA residue Ala70. The GILT.DELTA.2-7M1/K37 cassette contains an Arg to Lys substitution at amino acid 37 of the human IGF-II sequence (uppercase bold).

TABLE-US-00007 (SEQ ID NO: 16) ggtaccaagcttgccATGGGAATCCCAATGGGCAAGTCGATGCTGGTGC TGCTCACCTTCTTGGCCTTTGCCTCGTGCTGCATTGCCGCTCTGTGCGG CGGGGAACTGGTGGACACCCTCCAATTCGTCTGTGGGGACCGGGGCTTC TACTTCAGCAGACCCGCAAGCCGTGTGAGTAAGCGCAGCCGTGGCATTG TTGAGGAGTGCTGTTTTCGCAGCTGTGACCTGGCTCTCCTGGAGACGTA CTGCGCTACCCCCGCCAAGTCTGAGGGCGCGCCGgcacaccccggccgt cccagagcagtgcccacacagtgcgacgtcccccccaacagccgcttcg attgcgcccctgacaaggccatcacccaggaacagtgcgaggcccgcgg ctgctgctacatccctgcaaagcaggggctgcagggagcccagatgggg cagccctggtgcttcttcccacccagctaccccagctacaagctggaga acctgagctcctctgaaatgggctacacggccaccctgacccgtaccac ccccaccttcttccccaaggacatcctgaccctgcggctggacgtgatg atggagactgagaaccgcctccacttcacgatcaaagatccagctaaca ggcgctacgaggtgcccttggagaccccgcgtgtccacagccgggcacc gtccccactctacagcgtggagttctctgaggagcccttcggggtgatc gtgcaccggcagctggacggccgcgtgctgctgaacacgacggtggcgc ccctgttctttgcggaccagttccttcagctgtccacctcgctgccctc gcagtatatcacaggcctcgccgagcacctcagtcccctgatgctcagc accagctggaccaggatcaccctgtggaaccgggaccttgcgcccacgc ccggtgcgaacctctacgggtctcaccctttctacctggcgctggagga cggcgggtcggcacacggggtgttcctgctaaacagcaatgccatggat gtggtcctgcagccgagccctgccatagaggaggtcgacaggtgggatc ctggatgtctacatcttcctgggcccagagcccaagagcgtggtgcagc agtacctggacgttgtgggatacccgttcatgccgccatactggggcct gggcttccacctgtgccgctggggctactcctccaccgctatcacccgc caggtggtggagaacatgaccagggcccacttccccctggacgtccaat ggaacgacctggactacatggactcccggagggacttcacgttcaacaa ggatggcttccgggacttcccggccatggtgcaggagctgcaccagggc ggccggcgctacatgatgatcgtggatcctgccatcagcagctcgggcc agccgggagctacaggccctacgacgagggtctgcggaggggggttttc atcaccaacgagaccggccagccgctgattgggaaggtatggcccgggt ccactgccttccccgacttcaccaaccccacagccaggcctggtgggag gacatggtggctgagttccatgaccaggtgcccttcgacggcatgtgga ttgacatgaacgagccttccaacttcatcaggggctctgaggacggctg ccccaacaatgagaggagaacccaccctacgtgcctggggtggttgggg ggaccctccaggcggcaaccatctgtgcctccagccaccagtttctctc cacacactacaacctgcacaacctctacggcctgaccgaagccatcgcc tcccacagggcgaggtgaaggctcgggggacacgcccatttgtgatctc ccgctcgacctttgaggccacggccgatacgccggccactggacggggg acgtgtggagctcctgggagcagctcgcctcctccgtgccagaaatcct gcagtttaacctgctgggggtgcctctggtcggggccgacgtctgcggc ttcctgggcaacacctcagaggagagtgtgtgcgctggacccagctggg ggccttctaccccttcatgcggaaccacaacagcctgctcagtagcccc aggagccgtacagcttcagcgagccggcccagcaggccatgaggaaggc cctcaccctgcgctacgcactcctcccccacctctacacgctgttccac caggcccacgtcgcgggggagaccgtggcccggcccctcttcctggagt tccccaaggactctagcacctggactgtggaccaccagctcctgtgggg ggaggccctgctcatcaccccagtgctccaggccgggaaggccgaagtg actggctacttccccttgggcacatggtacgacctgcagacggtgccaa tagaggcccttggcagcctcccacccccacctgcagctccccgtgagcc agccatccacagcgaggggcagtgggtgacgctgccggcccccctggac accatcaacgtccacctccgggctgggtacatcatccccctgcagggcc aggcctcacaaccacagagtcccgccagcagcccatggccctggctgtg gccctgaccaagggtggagaggcccgaggggagagttctgggacgatgg agagagcctggaagtgctggagcgaggggcctacacacaggtcatcttc ctggccaggaataacacgatcgtgaatgagctggtacgtgtgaccagtg agggagctggcctgcagctgcagaaggtgactgtcctgggcgtggccac ggcgccccagcaggtcctctccaacggtgtccctgtctccaacttcacc tacagccccgacaccaaggtcctggacatctgtgtctcgctgttgatgg gagagcagtttctcgtcagctggtgttagtctagagcttgctagcggcc gc

Construct 1487

[0116] The GILT.DELTA.2-7M1/A37-GAA70-952 cassette below was cloned using the Asp718 and NotI sites of the cassette and vector pCEP4 to produce pCEP-GILT.DELTA.2-7M1/A37-GAA70-952 (Plasmid p1487). Restriction sites for cloning are in lowercase bold. The spacer amino acid sequence Gly, Ala, Pro (underlined sequence) separate the GAA gene and GILT.DELTA.2-7M1/A37 tag (upper case sequence). The spacer and tag are placed upstream of GAA residue Ala70. The GILT.DELTA.2-7M1/A37 cassette contains an Arg to Ala substitution at amino acid 37 of the human IGF-II sequence (uppercase bold).

TABLE-US-00008 (SEQ ID NO: 17) ggtaccaagcttgccATGGGAATCCCAATGGGCAAGTCGATGCTGGTGCT GCTCACCTTCTTGGCCTTTGCCTCGTGCTGCATTGCCGCTCTGTGCGGCG GGGAACTGGTGGACACCCTCCAATTCGTCTGTGGGGACCGGGGCTTCTAC TTCAGCAGACCCGCAAGCCGTGTGAGTGCTCGCAGCCGTGGCATTGTTGA GGAGTGCTGTTTTCGCAGCTGTGACCTGGCTCTCCTGGAGACGTACTGCG CTACCCCCGCCAAGTCTGAGGGCGCGCCGgcacaccccggccgtcccaga gcagtgcccacacagtgcgacgtcccccccaacagccgcttcgattgcgc ccctgacaaggccatcacccaggaacagtgcgaggcccgcggctgctgct acatccctgcaaagcaggggctgcagggagcccagatggggcagccctgg tgcttcttcccacccagctaccccagctacaagctggagaacctgagctc ctctgaaatgggctacacggccaccctgacccgtaccacccccaccttct tccccaaggacatcctgaccctgcggctggacgtgatgatggagactgag aaccgcctccacttcacgatcaaagatccagctaacaggcgctacgaggt gcccttggagaccccgcgtgtccacagccgggcaccgtccccactctaca gcgtggagttctagaggagccatcggggtgatcgtgcaccggcagctgga cggccgcgtgctgctgaacacgacggtggcgcccctgactttgcggacca gaccttcagctgtccacctcgctgccacgcagtatatcacaggcctcgcc gagcacctcagtcccctgatgctcagcaccagctggaccaggatcaccag tggaaccgggaccttgcgcccacgcccggtgcgaacctctacgggtctca ccctttctacctggcgctggaggacggcgggtcggcacacggggtgacct gctaaacagcaatgccatggatgtggtcctgcagccgagccctgccctta gaggaggtcgacaggtgggatcctggatgtctacatcttcctgggcccag agcccaagagcgtggtgcagcagtacctggacgttgtgggatacccgttc atgccgccatactggggcctgggcttccacctgtgccgctggggctactc accaccgctatcacccgccaggtggtggagaacatgaccagggcccactt ccccctggacgtccaatggaacgacctggactacatggactcccggaggg acttcacgttcaacaaggatggcttccgggacttcccggccatggtgcag gagctgcaccagggcggccggcgctacatgatgatcgtggatcctgccat cagcagacgggccctgccgggagctacaggccctacgacgagggtctgcg gaggggggttttcatcaccaacgagaccggccagccgctgattgggaagg tatggcccgggtccactgccttccccgacttcaccaaccccacagccctg gcctggtgggaggacatggtggctgagaccatgaccaggtgccatcgacg gcatgtggattgacatgaacgagccttccaacttcatcaggggctctgag gacggctgccccaacaatgagctggagaacccaccctacgtgcctggggt ggttggggggaccctccaggcggcaaccatctgtgcctccagccaccagt ttactccacacactacaacctgcacaacctctacggcctgaccgaagcca tcgcctcccacagggcgctggtgaaggctcgggggacacgcccatttgtg atctcccgctcgacctttgctggccacggccgatacgccggccactggac gggggacgtgtggagctcctgggagcagctcgcctcctccgtgccagaaa tcctgcagtttaacctgctgggggtgcctctggtcggggccgacgtctgc ggcttcctgggcaacacctcagaggagagtgtgtgcgaggacccagaggg ggccttctaccccttcatgcggaaccacaacagcctgctcagtctgcccc aggagccgtacagcttcagcgagccggcccagcaggccatgaggaaggcc ctcaccagcgctacgcactcctcccccacctctacacgctgttccaccag gcccacgtcgcgggggagaccgtggcccggcccctcttcctggagttccc caaggactctagcacctggactgtggaccaccagacctgtggggggaggc cagctcatcaccccagtgctccaggccgggaaggccgaagtgactggcta cttcccatgggcacatggtacgacctgcagacggtgccaatagaggccat ggcagcctcccacccccacctgcagctccccgtgagccagccatccacag cgaggggcagtgggtgacgctgccggcccccctggacaccatcaacgtcc acctccgggctgggtacatcatccccctgcagggccaggcctcacaacca cagagtcccgccagcagcccatggccaggctgtggccctgaccaagggtg gagaggcccgaggggagctgttctgggacgatggagagagcctggaagtg ctggagcgaggggcctacacacaggtcatatcctggccaggaataacacg atcgtgaatgagaggtacgtgtgaccagtgagggagctggcctgcagctg cagaaggtgactgtcctgggcgtggccacggcgccccagcaggtcctctc caacggtgtccagtaccaacttcacctacagccccgacaccaaggtcctg gacatctgtgtacgctgttgatgggagagcagtttctcgtcagctggtgt tagtctagagatgctagcggccgc

[0117] As shown in FIG. 3, three exemplary mutants (i.e., constructs 1459, 1460 and 1461) in which alanine or lysine has been substituted for one of the canonical arginine residues were expressed without detectable cleavage by furin. As also shown in FIG. 3 (right panel), construct 1461 containing a R37A substitution is additionally resistant to addition of exogenous furin.

Construct 1726

[0118] The GILT.DELTA.2-7.DELTA.30-39-GAA70-952 cassette below was cloned using the Asp718 and NotI sites of the cassette and vector pCEP4 to produce pCEP-GILT.DELTA.2-7.DELTA.30-39-GAA70-952 (Plasmid 1726). Restriction sites for cloning are in lowercase bold. The spacer amino acid sequence Gly, Ala, Pro (underlined sequence) separate the GAA gene and GILT.DELTA.2-7.DELTA.30-39 tag (upper case sequence). The spacer and tag are placed upstream of GAA residue Ala70. The GILT.DELTA.2-7.DELTA.30-39 cassette contains a deletion of amino acid residues 30-39 (Arg-Pro-Ala-Ser-Arg-Val-Ser-Arg-Arg-Ser) from the human IGF-II sequence.

TABLE-US-00009 (SEQ ID NO: 18) ggtaccagctgctagcaagctaattcacaccaATGGGAATCCCAATGGGG AAGTCGATGCTGGTGCTTCTCACCTTCTTGGCCTTCGCCTCGTGCTGCAT TGCTGCTCTGTGCGGCGGGGAGCTGGTGGACACCCTCCAGTTCGTCTGTG GGGACCGCGGCTTCTACTTCAGCCGTGGCATCGTTGAGGAGTGCTGTTT CCGCAGCTGTGACCTGGCCCTCCTGGAGACGTACTGTGCTACCCCCGCCA AGTCCGAGGGCGCGCCGgcacaccccggccgtcccagagcagtgcccaca cagtgcgacgtcccccccaacagccgcttcgattgcgcccctgacaaggc catcacccaggaacagtgcgaggcccgcggctgctgctacatccctgcaa agcaggggctgcagggagcccagatggggcagccctggtgcttcttccca cccagctaccccagctacaagctggagaacctgagctcctctgaaatggg ctacacggccaccctgacccgtaccacccccaccttcttccccaaggaca tcctgaccctgcggctggacgtgatgatggagactgagaaccgcctccac ttcacgatcaaagatccagctaacaggcgctacgaggtgcccttggagac cccgcgtgtccacagccgggcaccgtccccactctacagcgtggagttct ctgaggagcccttcggggtgatcgtgcaccggcagctggacggccgcgtg ctgctgaacacgacggtggcgcccctgttattgcggaccagaccttcagc tgtccacctcgctgccctcgcagtatatcacaggcctcgccgagcacctc agtcccctgatgctcagcaccagaggaccaggatcaccctgtggaaccgg gaccttgcgcccacgcccggtgcgaacctctacgggtctcaccctttcta cctggcgctggaggacggcgggtcggcacacggggtgttcctgctaaaca gcaatgccatggatgtggtcctgcagccgagccctgcccttagctggagg tcgacaggtgggatcctggatgtctacatcttcctgggcccagagcccaa gagcgtggtgcagcagtacctggacgttgtgggatacccgttcatgccgc catactggggcctgggatccacctgtgccgctggggctactcctccaccg ctatcacccgccaggtggtggagaacatgaccagggcccacttccccctg gacgtccaatggaacgacctggactacatggactcccggagggacttcac gttcaacaaggatggcttccgggacttcccggccatggtgcaggagagca ccagggcggccggcgctacatgatgatcgtggatcctgccatcagcagac gggccagccgggagctacaggccctacgacgagggtagcggaggggggat tcatcaccaacgagaccggccagccgctgattgggaaggtatggcccggg tccactgccttccccgacttcaccaaccccacagccaggcctggtgggag gacatggtggctgagttccatgaccaggtgcccttcgacggcatgtggat tgacatgaacgagccttccaacttcatcaggggctctgaggacggctgcc ccaacaatgagctggagaacccaccctacgtgcctggggtggttgggggg accctccaggcggcaaccatctgtgcctccagccaccagtttctctccac acactacaacctgcacaacctctacggcctgaccgaagccatcgcctccc acagggcgctggtgaaggctcgggggacacgcccatttgtgatctcccgc tcgacctttgctggccacggccgatacgccggccactggacgggggacgt gtggagctcctgggagcagctcgcctcctccgtgccagaaatcctgcagt ttaacctgctgggggtgcctaggtcggggccgacgtctgcggcttcctgg gcaacacctcagaggagctgtgtgtgcgctggacccagctgggggccttc taccccttcatgcggaaccacaacagcctgctcagtctgccccaggagcc gtacagcttcagcgagccggcccagcaggccatgaggaaggccctcaccd gcgctacgcactcctcccccacctctacacgctgttccaccaggcccacg tcgcgggggagaccgtggcccggcccctatcctggagttccccaaggact ctagcacctggactgtggaccaccagctcctgtggggggaggccagctca tcaccccagtgctccaggccgggaaggccgaagtgactggctacttcccc ttgggcacatggtacgacctgcagacggtgccaatagaggcccttggcag cctcccacccccacctgcagctccccgtgagccagccatccacagcgagg ggcagtgggtgacgctgccggcccccctggacaccatcaacgtccacctc cgggctgggtacatcatccccctgcagggccctggcctcacaaccacaga gtcccgccagcagcccatggccctggctgtggccctgaccaagggtggag aggcccgaggggagctgttctgggacgatggagagagcctggaagtgctg gagcgaggggcctacacacaggtcatcttcctggccaggaataacacgat cgtgaatgagctggtacgtgtgaccagtgagggagctggcctgcagctgc agaaggtgactgtcctgggcgtggccacggcgccccagcaggtcctctcc aacggtgtcctttgtaccaacttcacctacagccccgacaccaaggtcct ggacatctgtgtacgctgttgatgggagagcagtttctcgtcagctggtg ttagtctagagcttgctagcggccgc

Construct 1749

[0119] The GILT.DELTA.2-7.DELTA.31-39-GAA70-952 cassette below was cloned using the Asp718 and NotI sites of the cassette and vector pCEP4 to produce pCEP-GILT.DELTA.2-7.DELTA.31-39-GAA70-952 (Plasmid 1749). Restriction sites for cloning are in lowercase bold. The spacer amino acid sequence Gly, Ala, Pro (underlined sequence) separate the GAA gene and GILT.DELTA.2-7.DELTA.31-39 tag (upper case sequence). The spacer and tag are placed upstream of GAA residue Ala70. The GILT.DELTA.2-7.DELTA.31-39 cassette contains a deletion of amino acid residues 31-39 (Pro-Ala-Ser-Arg-Val-Ser-Arg-Arg-Ser) from the human IGF-II sequence.

TABLE-US-00010 (SEQ ID NO: 19) ggtaccagagctagcaagctaattcacaccaATGGGAATCCCAATGGGGA AGTCGATGCTGGTGCTTCTCACCTTCTTGGCCTTCGCCTCGTGCTGCATT GCTGCTCTGTGCGGCGGGGAGCTGGTGGACACCCTCCAGTTCGTCTGTGG GGACCGCGGCTTCTACTTCAGCAGGCGTGGCATCGTTGAGGAGTGCTGTT TCCGCAGCTGTGACCTGGCCCTCCTGGAGACGTACTGTGCTACCCCCGCC AAGTCCGAGGGCGCGCCGgcacaccccggccgtcccagagcagtgcccac acagtgcgacgtcccccccaacagccgcttcgattgcgcccctgacaagg ccatcacccaggaacagtgcgaggcccgcggctgctgctacatccctgca aagcaggggctgcagggagcccagatggggcagccctggtgcttatccca cccagctaccccagctacaagaggagaacctgagctcctctgaaatgggc tacacggccaccctgacccgtaccacccccaccttatccccaaggacatc ctgaccctgcggctggacgtgatgatggagactgagaaccgcctccactt cacgatcaaagatccagctaacaggcgctacgaggtgcccttggagaccc cgcgtgtccacagccgggcaccgtccccactctacagcgtggagttctct gaggagccatcggggtgatcgtgcaccggcagctggacggccgcgtgctg ctgaacacgacggtggcgcccctgttctttgcggaccagttccttcagct gtccacctcgctgccctcgcagtatatcacaggcctcgccgagcacctca gtcccctgatgacagcaccagctggaccaggatcaccagtggaaccggga ccttgcgcccacgcccggtgcgaacctctacgggtctcaccctttctacc tggcgctggaggacggcgggtcggcacacggggtgttcctgctaaacagc aatgccatggatgtggtcctgcagccgagccctgcccttagctggaggtc gacaggtgggatcctggatgtctacatcttcctgggcccagagcccaaga gcgtggtgcagcagtacctggacgagtgggatacccgttcatgccgccat actggggcctgggcttccacctgtgccgctggggctactcctccaccgct atcacccgccaggtggtggagaacatgaccagggcccacttccccctgga cgtccaatggaacgacctggactacatggactcccggagggacttcacgt tcaacaaggatggatccgggacttcccggccatggtgcaggagagcacca gggcggccggcgctacatgatgatcgtggatcctgccatcagcagctcgg gccctgccgggagctacaggccctacgacgagggtctgcggaggggggtt ttcatcaccaacgagaccggccagccgctgattgggaaggtatggcccgg gtccactgccttccccgacttcaccaaccccacagccctggcctggtggg aggacatggtggctgagttccatgaccaggtgcccttcgacggcatgtgg attgacatgaacgagccttccaacttcatcaggggctctgaggacggctg ccccaacaatgagaggagaacccaccctacgtgcctggggtggttggggg gaccaccaggcggcaaccatctgtgcctccagccaccagtttactccaca cactacaacctgcacaacctctacggcctgaccgaagccatcgcctccca cagggcgctggtgaaggctcgggggacacgcccatttgtgatctcccgct cgacctttgctggccacggccgatacgccggccactggacgggggacgtg tggagctcctgggagcagctcgcctcctccgtgccagaaatcctgcagtt taacctgctgggggtgcctctggtcggggccgacgtctgcggcttcctgg gcaacacctcagaggagctgtgtgtgcgctggacccagctgggggccttc taccccttcatgcggaaccacaacagcctgctcagtctgccccaggagcc gtacagcttcagcgagccggcccagcaggccatgaggaaggccacaccct gcgctacgcactcctcccccacctctacacgctgttccaccaggcccacg tcgcgggggagaccgtggcccggcccctcttcctggagttccccaaggac tctagcacctggactgtggaccaccagctcctgtggggggaggccctgct catcaccccagtgctccaggccgggaaggccgaagtgactggctacttcc ccttgggcacatggtacgacctgcagacggtgccaatagaggcccttggc agcctcccacccccacctgcagctccccgtgagccagccatccacagcga ggggcagtgggtgacgctgccggcccccctggacaccatcaacgtccacc tccgggctgggtacatcatccccctgcagggccaggcctcacaaccacag agtcccgccagcagcccatggccaggctgtggccctgaccaagggtggag aggcccgaggggagctgttctgggacgatggagagagcctggaagtgctg gagcgaggggcctacacacaggtcatcttcctggccaggaataacacgat cgtgaatgagaggtacgtgtgaccagtgagggagaggcctgcagctgcag aaggtgactgtcctgggcgtggccacggcgccccagcaggtcctctccaa cggtgtccctgtaccaacttcacctacagccccgacaccaaggtcctgga catctgtgtctcgctgttgatgggagagcagtttctcgtcagaggtgtta gtctagagcttgctagcggccgc

Construct 1746

[0120] The GILT.DELTA.2-7.DELTA.32-39-GAA70-952 cassette below was cloned using the Asp718 and NotI sites of the cassette and vector pCEP4 to produce pCEP-GILT.DELTA.2-7.DELTA.32-39-GAA70-952 (Plasmid 1746). Restriction sites for cloning are in lowercase bold. The spacer amino acid sequence Gly, Ala, Pro (underlined sequence) separate the GAA gene and GILT.DELTA.2-7.DELTA.32-39 tag (upper case sequence). The spacer and tag are placed upstream of GAA residue Ala70. The GILT.DELTA.2-7.DELTA.32-39 cassette contains a deletion of amino acid residues 32-39 (Ala-Ser-Arg-Val-Ser-Arg-Arg-Ser) from the human IGF-II sequence.

TABLE-US-00011 (SEQ ID NO: 20) ggtaccagctgctagcaagctaattcacaccaATGGGAATCCCAATGGGG AAGTCGATGCTGGTGCTTCTCACCTTCTTGGCCTTCGCCTCGTGCTGCAT TGCTGCTCTGTGCGGCGGGGAGCTGGTGGACACCCTCCAGTTCGTCTGTG GGGACCGCGGCTTCTACTTCAGCAGGCCCCGTGGCATCGTTGAGGAGTGC TGTTTCCGCAGCTGTGACCTGGCCCTCCTGGAGACGTACTGTGCTACCCC CGCCAAGTCCGAGGGCGCGCCGgcacaccccggccgtcccagagcagtgc ccacacagtgcgacgtcccccccaacagccgcttcgattgcgcccctgac aaggccatcacccaggaacagtgcgaggcccgcggctgctgctacatccc tgcaaagcaggggctgcagggagcccagatggggcagccctggtgcttct tcccacccagctaccccagctacaagctggagaacctgagctcctctgaa atgggctacacggccaccctgacccgtaccacccccaccttcttccccaa ggacatcctgaccctgcggctggacgtgatgatggagactgagaaccgcc tccacttcacgatcaaagatccagctaacaggcgctacgaggtgcccttg gagaccccgcgtgtccacagccgggcaccgtccccactctacagcgtgga gttctctgaggagcccttcggggtgatcgtgcaccggcagctggacggcc gcgtgctgctgaacacgacggtggcgcccctgttctttgcggaccagttc cttcagctgtccacctcgctgccctcgcagtatatcacaggcctcgccga gcacctcagtcccctgatgctcagcaccagctggaccaggatcaccctgt ggaaccgggaccttgcgcccacgcccggtgcgaacctctacgggtctcac cctactacctggcgctggaggacggcgggtcggcacacggggtgttcctg ctaaacagcaatgccatggatgtggtcctgcagccgagccctgccatagc tggaggtcgacaggtgggatcctggatgtctacatcttcctgggcccaga gcccaagagcgtggtgcagcagtacctggacgttgtgggatacccgttca tgccgccatactggggcctgggcaccacctgtgccgctggggctactcct ccaccgctatcacccgccaggtggtggagaacatgaccagggcccacttc cccctggacgtccaatggaacgacctggactacatggactcccggaggga cttcacgttcaacaaggatggcttccgggacttcccggccatggtgcagg agctgcaccagggcggccggcgctacatgatgatcgtggatcctgccatc agcagctcgggccctgccgggagctacaggccctacgacgagggtctgcg gaggggggttttcatcaccaacgagaccggccagccgctgattgggaagg tatggcccgggtccactgccttccccgacttcaccaaccccacagccctg gcctggtgggaggacatggtggctgagttccatgaccaggtgccatcgac ggcatgtggattgacatgaacgagccttccaacttcatcaggggctctga ggacggctgccccaacaatgagaggagaacccaccctacgtgcctggggt ggaggggggaccctccaggcggcaaccatctgtgcctccagccaccagtt tctctccacacactacaacctgcacaacctctacggcctgaccgaagcca tcgcctcccacagggcgctggtgaaggctcgggggacacgcccatttgtg atctcccgctcgacctttgaggccacggccgatacgccggccactggacg ggggacgtgtggagctcctgggagcagctcgcctcctccgtgccagaaat cctgcagtttaacctgctgggggtgcctaggtcggggccgacgtctgcgg cttcctgggcaacacctcagaggagagtgtgtgcgctggacccagctggg ggccttctaccccttcatgcggaaccacaacagcctgacagtctgcccca ggagccgtacagatcagcgagccggcccagcaggccatgaggaaggccct caccctgcgctacgcactcctcccccacctctacacgctgttccaccagg cccacgtcgcgggggagaccgtggcccggcccctcttcctggagttcccc aaggactctagcacctggactgtggaccaccagctcctgtggggggaggc cctgacatcaccccagtgaccaggccgggaaggccgaagtgactggctac ttccccttgggcacatggtacgacctgcagacggtgccaatagaggccct tggcagcctcccacccccacctgcagctccccgtgagccagccatccaca gcgaggggcagtgggtgacgctgccggcccccctggacaccatcaacgtc cacctccgggagggtacatcatccccctgcagggccctggcctcacaacc acagagtcccgccagcagcccatggccctggagtggccctgaccaagggt ggagaggcccgaggggagagttctgggacgatggagagagcctggaagtg ctggagcgaggggcctacacacaggtcatatcctggccaggaataacacg atcgtgaatgagaggtacgtgtgaccagtgagggagaggcctgcagagca gaaggtgactgtcctgggcgtggccacggcgccccagcaggtcctctcca acggtgtccctgtctccaacttcacctacagccccgacaccaaggtcctg gacatctgtgtctcgctgttgatgggagagcagtactcgtcagctggtgt tagtctagagcttgctagcggccgc

Construct 1747

[0121] The GILT.DELTA.2-7.DELTA.33-39-GAA70-952 cassette below was cloned using the Asp718 and NotI sites of the cassette and vector pCEP4 to produce pCEP-GILT.DELTA.2-7.DELTA.33-39-GAA70-952 (Plasmid 1747). Restriction sites for cloning are in lowercase bold. The spacer amino acid sequence Gly, Ala, Pro (underlined sequence) separate the GAA gene and GILT.DELTA.2-7.DELTA.33-39 tag (upper case sequence). The spacer and tag are placed upstream of GAA residue Ala70. The GILT.DELTA.2-7.DELTA.33-39 cassette contains a deletion of amino acid residues 33-39 (Ser-Arg-Val-Ser-Arg-Arg-Ser) from the human IGF-II sequence.

TABLE-US-00012 (SEQ ID NO: 21) ggtaccagagctagcaagctaattcacaccaATGGGAATCCCAATGGGGA AGTCGATGCTGGTGCTTCTCACCTTCTTGGCCTTCGCCTCGTGCTGCATT GCTGCTCTGTGCGGCGGGGAGCTGGTGGACACCCTCCAGTTCGTCTGTGG GGACCGCGGCTTCTACTTCAGCAGGCCCGCACGTGGCATCGTTGAGGAGT GCTGTTTCCGCAGCTGTGACCTGGCCCTCCTGGAGACGTACTGTGCTACC CCCGCCAAGTCCGAGGGCGCGCCGgcacaccccggccgteccagagcagt gcccacacagtgcgacgtcccccccaacagccgcttcgattgcgcccaga caaggccatcacccaggaacagtgcgaggcccgcggctgctgctacatcc ctgcaaagcaggggctgcagggagcccagatggggcagccctggtgatat cccacccagctaccccagctacaagaggagaacctgagctcctagaaatg ggctacacggccaccagacccgtaccacccccaccttcttccccaaggac atcctgaccctgcggctggacgtgatgatggagactgagaaccgcctcca cttcacgatcaaagatccagctaacaggcgctacgaggtgcccttggaga ccccgcgtgtccacagccgggcaccgtccccactctacagcgtggagttc tctgaggagcccttcggggtgatcgtgcaccggcagctggacggccgcgt gctgctgaacacgacggtggcgcccctgttctttgcggaccagttccttc agctgtccacctcgctgccctcgcagtatatcacaggcctcgccgagcac ctcagtcccctgatgctcagcaccagctggaccaggatcaccctgtggaa ccgggaccttgcgcccacgcccggtgcgaacctctacgggtctcaccctt tctacctggcgctggaggacggcgggtcggcacacggggtgttcctgcta aacagcaatgccatggatgtggtcctgcagccgagccctgcccttagagg aggtcgacaggtgggatcctggatgtctacatcttcctgggcccagagcc caagagcgtggtgcagcagtacctggacgttgtgggatacccgttcatgc cgccatactggggcctgggatccacctgtgccgctggggctactcctcca ccgctatcacccgccaggtggtggagaacatgaccagggcccacttcccc ctggacgtccaatggaacgacctggactacatggactcccggagggactt cacgttcaacaaggatggcttccgggacttcccggccatggtgcaggaga gcaccagggcggccggcgctacatgatgatcgtggatcctgccatcagca gacgggccctgccgggagctacaggccctacgacgagggtagcggagggg ggtatcatcaccaacgagaccggccagccgctgattgggaaggtatggcc cgggtccactgccttccccgacttcaccaaccccacagccaggcctggtg ggaggacatggtggctgagttccatgaccaggtgcccttcgacggcatgt ggattgacatgaacgagccttccaacttcatcaggggctctgaggacggc tgccccaacaatgagctggagaacccaccctacgtgcctggggtggttgg ggggaccaccaggcggcaaccatctgtgcctccagccaccagtactctcc acacactacaacctgcacaacctctacggcctgaccgaagccatcgcctc ccacagggcgctggtgaaggctcgggggacacgcccatttgtgatctccc gctcgacattgctggccacggccgatacgccggccactggacgggggacg tgtggagacctgggagcagctcgcctcctccgtgccagaaatcctgcagt ttaacctgagggggtgcctctggtcggggccgacgtctgcggatcctggg caacacctcagaggagagtgtgtgcgctggacccagctgggggccttcta cccatcatgcggaaccacaacagcctgctcagtctgccccaggagccgta cagatcagcgagccggcccagcaggccatgaggaaggccacaccagcgct acgcactcctcccccacctctacacgctgttccaccaggcccacgtcgcg ggggagaccgtggcccggcccctcttcctggagttccccaaggactctag cacctggactgtggaccaccagctcctgtggggggaggccctgctcatca ccccagtgctccaggccgggaaggccgaagtgactggctacttccccttg ggcacatggtacgacctgcagacggtgccaatagaggcccttggcagcct cccacccccacctgcagctccccgtgagccagccatccacagcgaggggc agtgggtgacgctgccggcccccaggacaccatcaacgtccacctccggg agggtacatcatccccctgcagggccctggcctcacaaccacagagtccc gccagcagcccatggccctggctgtggccctgaccaagggtggagaggcc cgaggggagctgttctgggacgatggagagagcctggaagtgctggagcg aggggcctacacacaggtcatcttcctggccaggaataacacgatcgtga atgagctggtacgtgtgaccagtgagggagctggcctgcagctgcagaag gtgactgtcctgggcgtggccacggcgccccagcaggtcctctccaacgg tgtccagtctccaacttcacctacagccccgacaccaaggtcctggacat ctgtgtctcgctgttgatgggagagcagtttctcgtcagctggtgttagt ctagagcttgctagcggccgc

Construct 1758

[0122] The GILT.DELTA.2-7.DELTA.34-39-GAA70-952 cassette below was cloned using the Asp718 and NotI sites of the cassette and vector pCEP4 to produce pCEP-GILT.DELTA.2-7.DELTA.34-39-GAA70-952 (Plasmid 1758). Restriction sites for cloning are in lowercase bold. The spacer amino acid sequence Gly, Ala, Pro (underlined sequence) separate the GAA gene and GILT.DELTA.2-7.DELTA.34-39 tag (upper case sequence). The spacer and tag are placed upstream of GAA residue Ala70. The GILT.DELTA.2-7.DELTA.34-39 cassette contains a deletion of amino acid residues 34-39 (Arg-Val-Ser-Arg-Arg-Ser) from the human IGF-II sequence.

TABLE-US-00013 (SEQ ID NO: 22) ggtaccagctgctagcaagctaattcacaccaATGGGAATCCCAATGGGG AAGTCGATGCTGGTGCTTCTCACCTTCTTGGCCTTCGCCTCGTGCTGCAT TGCTGCTCTGTGCGGCGGGGAGCTGGTGGACACCCTCCAGTTCGTCTGTG GGGACCGCGGCTTCTACTTCAGCAGGCCCGCAAGCCGTGGCATCGTTGAG GAGTGCTGTTTCCGCAGCTGTGACCTGGCCCTCCTGGAGACGTACTGTGC TACCCCCGCCAAGTCCGAGGGCGCGCCGgcacaccccggccgtcccagag cagtgcccacacagtgcgacgtcccccccaacagccgcttcgattgcgcc cctgacaaggccatcacccaggaacagtgcgaggcccgcggctgctgcta catccctgcaaagcaggggctgcagggagcccagatggggcagccctggt gcttcttcccacccagctaccccagctacaagctggagaacctgagctcc tctgaaatgggctacacggccaccctgacccgtaccacccccaccttctt ccccaaggacatcctgaccctgcggctggacgtgatgatggagactgaga accgcctccacttcacgatcaaagatccagctaacaggcgctacgaggtg cccttggagaccccgcgtgtccacagccgggcaccgtccccactctacag cgtggagttctctgaggagcccttcggggtgatcgtgcaccggcagctgg acggccgcgtgctgctgaacacgacggtggcgcccctgactttgcggacc agaccttcagctgtccacctcgctgccctcgcagtatatcacaggcctcg ccgagcacctcagtcccctgatgctcagcaccagctggaccaggatcacc ctgtggaaccgggaccttgcgcccacgcccggtgcgaacctctacgggtc tcaccattctacctggcgctggaggacggcgggtcggcacacggggtgtt cctgctaaacagcaatgccatggatgtggtcctgcagccgagccctgcca tagctggaggtcgacaggtgggatcctggatgtctacatcttcctgggcc cagagcccaagagcgtggtgcagcagtacctggacgttgtgggatacccg ttcatgccgccatactggggcctgggcttccacctgtgccgctggggcta ctcctccaccgctatcacccgccaggtggtggagaacatgaccagggccc acttccccctggacgtccaatggaacgacctggactacatggactcccgg agggacttcacgttcaacaaggatggatccgggacttcccggccatggtg caggagctgcaccagggcggccggcgctacatgatgatcgtggatcctgc catcagcagctcgggccctgccgggagctacaggccctacgacgagggtc tgcggaggggggttttcatcaccaacgagaccggccagccgctgattggg aaggtatggcccgggtccactgccttccccgacttcaccaaccccacagc cctggcctggtgggaggacatggtggctgagttccatgaccaggtgccat cgacggcatgtggattgacatgaacgagccttccaacttcatcaggggct ctgaggacggctgccccaacaatgagctggagaacccaccctacgtgcct ggggtggttggggggaccctccaggcggcaaccatctgtgcctccagcca ccagtactctccacacactacaacctgcacaacctctacggcctgaccga agccatcgcctcccacagggcgctggtgaaggctcgggggacacgcccat ttgtgatctcccgctcgacctttgctggccacggccgatacgccggccac tggacgggggacgtgtggagctcctgggagcagctcgcctcctccgtgcc agaaatcctgcagtttaacctgctgggggtgcctctggtcggggccgacg tctgcggcttcctgggcaacacctcagaggagctgtgtgtgcgctggacc cagctgggggccttctaccccttcatgcggaaccacaacagcctgctcag tctgccccaggagccgtacagatcagcgagccggcccagcaggccatgag gaaggccctcaccctgcgctacgcactcctcccccacctctacacgctgt tccaccaggcccacgtcgcgggggagaccgtggcccggcccctcttcctg gagttccccaaggactctagcacctggactgtggaccaccagctcctgtg gggggaggccctgctcatcaccccagtgctccaggccgggaaggccgaag tgactggctacttccccttgggcacatggtacgacctgcagacggtgcca atagaggccatggcagcctcccacccccacctgcagctccccgtgagcca gccatccacagcgaggggcagtgggtgacgctgccggcccccctggacac catcaacgtccacctccgggctgggtacatcatccccctgcagggccctg gcctcacaaccacagagtcccgccagcagcccatggccctggctgtggcc ctgaccaagggtggagaggcccgaggggagctgttctgggacgatggaga gagcctggaagtgctggagcgaggggcctacacacaggtcatcttcctgg ccaggaataacacgatcgtgaatgagctggtacgtgtgaccagtgaggga gctggcctgcagctgcagaaggtgactgtcctgggcgtggccacggcgcc ccagcaggtcctctccaacggtgtccctgtctccaacttcacctacagcc ccgacaccaaggtcctggacatctgtgtctcgctgttgatgggagagcag tttctcgtcagctggtgttagtctagagcttgctagcggccgc

Construct 1750

[0123] The GILT.DELTA.2-7.DELTA.35-39-GAA70-952 cassette below was cloned using the Asp718 and NotI sites of the cassette and vector pCEP4 to produce pCEP-GILT.DELTA.2-7.DELTA.35-39-GAA70-952 (Plasmid 1750). Restriction sites for cloning are in lowercase bold. The spacer amino acid sequence Gly, Ala, Pro (underlined sequence) separate the GAA gene and GILT.DELTA.2-7.DELTA.35-39 tag (upper case sequence). The spacer and tag are placed upstream of GAA residue Ala70. The GILT.DELTA.2-7.DELTA.35-39 cassette contains a deletion of amino acid residues 35-39 (Val-Ser-Arg-Arg-Ser) from the human IGF-II sequence.

TABLE-US-00014 (SEQ ID NO: 23) ggtaccagagctagcaagctaattcacaccaATGGGAATCCCAATGGGGA AGTCGATGCTGGTGCTTCTCACCTTCTTGGCCTTCGCCTCGTGCTGCATT GCTGCTCTGTGCGGCGGGGAGCTGGTGGACACCCTCCAGTTCGTCTGTGG GGACCGCGGCTTCTACTTCAGCAGGCCCGCAAGCCGTCGTGGCATCGTTG AGGAGTGCTGTTTCCGCAGCTGTGACCTGGCCCTCCTGGAGACGTACTGT GCTACCCCCGCCAAGTCCGAGGGCGCGCCGgcacaccccggccgtcccag agcagtgcccacacagtgcgacgtcccccccaacagccgatcgattgcgc ccagacaaggccatcacccaggaacagtgcgaggcccgcggctgctgcta catccctgcaaagcaggggctgcagggagcccagatggggcagccctggt gcttatcccacccagctaccccagctacaagctggagaacctgagctcct agaaatgggctacacggccaccctgacccgtaccacccccaccttatccc caaggacatcctgaccctgcggctggacgtgatgatggagactgagaacc gcctccacttcacgatcaaagatccagctaacaggcgctacgaggtgccc ttggagaccccgcgtgtccacagccgggcaccgtccccactctacagcgt ggagactctgaggagcccttcggggtgatcgtgcaccggcagctggacgg ccgcgtgctgctgaacacgacggtggcgcccctgttattgcggaccagtt ccttcagagtccacctcgctgccctcgcagtatatcacaggcctcgccga gcacctcagtcccctgatgacagcaccagaggaccaggatcaccctgtgg aaccgggaccttgcgcccacgcccggtgcgaacctctacgggtctcacca ttctacctggcgctggaggacggcgggtcggcacacggggtgacctgcta aacagcaatgccatggatgtggtcctgcagccgagccctgcccttagctg gaggtcgacaggtgggatcctggatgtctacatatcctgggcccagagcc caagagcgtggtgcagcagtacctggacgttgtgggatacccgttcatgc cgccatactggggcctgggcttccacctgtgccgctggggctactcctcc accgctatcacccgccaggtggtggagaacatgaccagggcccacttccc cctggacgtccaatggaacgacctggactacatggactcccggagggact tcacgttcaacaaggatggatccgggacttcccggccatggtgcaggaga gcaccagggcggccggcgctacatgatgatcgtggatcctgccatcagca gctcgggccctgccgggagctacaggccctacgacgagggtctgcggagg ggggttttcatcaccaacgagaccggccagccgctgattgggaaggtatg gcccgggtccactgccttccccgacttcaccaaccccacagccctggcct ggtgggaggacatggtggctgagttccatgaccaggtgcccttcgacggc atgtggattgacatgaacgagccttccaacttcatcaggggctctgagga cggctgccccaacaatgagctggagaacccaccctacgtgcctggggtgg ttggggggaccaccaggcggcaaccatagtgcctccagccaccagtttct accacacactacaacctgcacaacctctacggcctgaccgaagccatcgc ctcccacagggcgctggtgaaggctcgggggacacgcccatttgtgatct cccgctcgacctagctggccacggccgatacgccggccactggacggggg acgtgtggagctcctgggagcagctcgcctcctccgtgccagaaatcctg cagtttaacctgctgggggtgcctaggtcggggccgacgtctgcggcttc ctgggcaacacctcagaggagctgtgtgtgcgctggacccagagggggcc ttctacccatcatgcggaaccacaacagcctgctcagtagccccaggagc cgtacagcttcagcgagccggcccagcaggccatgaggaaggccctcacc ctgcgctacgcactcctcccccacctctacacgctgttccaccaggccca cgtcgcgggggagaccgtggcccggcccctcttcctggagttccccaagg actctagcacctggactgtggaccaccaptcctgtggggggaggccagct catcaccccagtgaccaggccgggaaggccgaagtgactggctacttccc cttgggcacatggtacgacctgcagacggtgccaatagaggcccttggca gcctcccacccccacctgcagctccccgtgagccagccatccacagcgag gggcagtgggtgacgctgccggcccccctggacaccatcaacgtccacct ccgggctgggtacatcatccccctgcagggccctggcctcacaaccacag agtcccgccagcagcccatggccaggctgtggccctgaccaagggtggag aggcccgaggggagctgttctgggacgatggagagagcctggaagtgctg gagcgaggggcctacacacaggtcatcttcctggccaggaataacacgat cgtgaatgagaggtacgtgtgaccagtgagggagctggcctgcagctgca gaaggtgactgtcctgggcgtggccacggcgccccagcaggtcctctcca acggtgtccctgtctccaacttcacctacapcccgacaccaaggtcctgg acatctgtgtctcgagttgatgggagagcagtttctcgtcagctggtgtt agtctagagcttgctagcggccgc

Construct 1748

[0124] The GILT.DELTA.2-7.DELTA.36-39-GAA70-952 cassette below was cloned using the Asp718 and NotI sites of the cassette and vector pCEP4 to produce pCEP-GILT.DELTA.2-7.DELTA.36-39-GAA70-952 (Plasmid 1748). Restriction sites for cloning are in lowercase bold. The spacer amino acid sequence Gly, Ala, Pro (underlined sequence) separate the GAA gene and GILT.DELTA.2-7.DELTA.36-39 tag (upper case sequence). The spacer and tag are placed upstream of GAA residue Ala70. The GILT.DELTA.2-7.DELTA.36-39 cassette contains a deletion of amino acid residues 36-39 (Ser-Arg-Arg-Ser) from the human IGF-II sequence.

TABLE-US-00015 (SEQ ID NO: 24) ggtaccagctgctagcaagctaattcacaccaATGGGAATCCCAATGGGG AAGTCGATGCTGGTGCTTCTCACCTTCTTGGCCTTCGCCTCGTGCTGCAT TGCTGCTCTGTGCGGCGGGGAGCTGGTGGACACCCTCCAGTTCGTCTGTG GGGACCGCGGCTTCTACTTCAGCAGGCCCGCAAGCCGTGTGCGTGGCATC GTTGAGGAGTGCTGTTTCCGCAGCTGTGACCTGGCCCTCCTGGAGACGTA CTGTGCTACCCCCGCCAAGTCCGAGGGCGCGCCGgcacaccccggccgtc ccagagcagtgcccacacagtgcgacgtcccccccaacagccgatcgatt gcgcccctgacaaggccatcacccaggaacagtgcgaggcccgcggctgc tgctacatccctgcaaagcaggggctgcagggagcccagatggggcagcc ctggtgatcttcccacccagctaccccagctacaagaggagaacctgagc tcactgaaatgggctacacggccaccagacccgtaccacccccaccttct tccccaaggacatcctgaccagcggaggacgtgatgatggagactgagaa ccgcctccacttcacgatcaaagatccagctaacaggcgctacgaggtgc ccttggagaccccgcgtgtccacagccgggcaccgtccccactctacagc gtggagttactgaggagcccttcggggtgatcgtgcaccggcagctggac ggccgcgtgagctgaacacgacggtggcgcccctgttattgcggaccagt tcatcagagtccacctcgctgccctcgcagtatatcacaggcctcgccga gcacctcagtcccctgatgctcagcaccagctggaccaggatcaccctgt ggaaccgggaccttgcgcccacgcccggtgcgaacctctacgggtctcac cctttctacctggcgctggaggacggcgggtcggcacacggggtgttcct gctaaacagcaatgccatggatgtggtcctgcagccgagccagcccttag ctggaggtcgacaggtgggatcctggatgtctacatcttcctgggcccag agcccaagagcgtggtgcagcagtacctggacgagtgggatacccgttca tgccgccatactggggcctgggcttccacctgtgccgctggggctactcc tccaccgctatcacccgccaggtggtggagaacatgaccagggcccactt ccccctggacgtccaatggaacgacctggactacatggactcccggaggg acttcacgttcaacaaggatggcttccgggacttcccggccatggtgcag gagctgcaccagggcggccggcgctacatgatgatcgtggatcctgccat cagcagacgggccagccgggagctacaggccctacgacgagggtctgcgg aggggggattcatcaccaacgagaccggccagccgctgattgggaaggta tggcccgggtccactgccttccccgacttcaccaaccccacagccctggc ctggtgggaggacatggtggctgagttccatgaccaggtgcccttcgacg gcatgtggattgacatgaacgagccttccaacttcatcaggggctctgag gacggctgccccaacaatgagctggagaacccaccctacgtgcctggggt ggttggggggaccctccaggcggcaaccatagtgcctccagccaccagtt tactccacacactacaacctgcacaacctctacggcctgaccgaagccat cgcctcccacagggcgctggtgaaggctcgggggacacgcccatttgtga tctcccgctcgacctttgctggccacggccgatacgccggccactggacg ggggacgtgtggagctcctgggagcagctcgcctcctccgtgccagaaat cctgcagtttaacctgctgggggtgcctctggtcggggccgacgtctgcg gcttcctgggcaacacctcagaggagagtgtgtgcgctggacccagctgg gggccttctacccatcatgcggaaccacaacagcctgctcagtagcccca ggagccgtacagatcagcgagccggcccagcaggccatgaggaaggccac accctgcgctacgcactcctcccccacctctacacgctgttccaccaggc ccacgtcgcgggggagaccgtggcccggcccctcttcctggagttcccca aggactctagcacctggactgtggaccaccagacctgtggggggaggccc tgctcatcaccccaggctccaggccgggaaggccgaagtgactggctact tccccttgggcacatggtacgacctgcagacggtgccaatagaggccatg gcagcctcccacccccacctgcagctccccgtgagccagccatccacagc gaggggcagtgggtgacgctgccggcccccctggacaccatcaacgtcca cctccgggagggtacatcatccccctgcagggccctggcctcacaaccac agagtcccgccagcagcccatggccctggctgtggccctgaccaagggtg gagaggcccgaggggagagttctgggacgatggagagagcctggaagtga ggagcgaggggcctacacacaggtcatcttcctggccaggaataacacga tcgtgaatgagctggtacgtgtgaccagtgagggagctggcctgcagctg cagaaggtgactgtcctgggcgtggccacggcgccccagcaggtcctctc caacggtgtccctgtctccaacttcacctacagccccgacaccaaggtcc tggacatctgtgtctcgctgttgatgggagagcagtttctcgtcagctgg tgttagtctagagcttgctagcggccgc

Construct 1751

[0125] The GILT.DELTA.2-7.DELTA.29-40-GAA70-952 cassette below was cloned using the Asp718 and NotI sites of the cassette and vector pCEP4 to produce pCEP-GILT.DELTA.2-7.DELTA.29-40-GAA70-952 (Plasmid 1751). Restriction sites for cloning are in lowercase bold. The spacer amino acid sequence Gly, Ala, Pro (underlined sequence) separate the GAA gene and GILT.DELTA.2-7.DELTA.29-40 tag (upper case sequence). The spacer and tag are placed upstream of GAA residue Ala70. The GILT.DELTA.2-7.DELTA.29-40 cassette contains a deletion of amino acid residues 29-40 (Ser-Arg-Pro-Ala-Ser-Arg-Val-Ser-Arg-Arg-Ser-Arg) from the human IGF-II sequence.

TABLE-US-00016 (SEQ ID NO: 25) ggtaccagtgctagcaagctaattcacaccaATGGGAATCCCAATGGGGA AGTCGATGCTGGTGCTTCTCACCTTCTTGGCCTTCGCCTCGTGCTGCATT GCTGCTCTGTGCGGCGGGGAGCTGGTGGACACCCTCCAGTTCGTCTGTGG GGACCGCGGCTTCTACTTCGGCATCGTTGAGGAGTGCTGTTTCCGCAGCT GTGACCTGGCCCTCCTGGAGACGTACTGTGCTACCCCCGCCAAGTCCGAG GGCGCGCCGgcacaccccggccgtcccagagcagtgcccacacagtgcga cgtcccccccaacagccgcttcgattgcgcccctgacaaggccatcaccc aggaacagtgcgaggcccgcggctgctgctacatccctgcaaagcagggg ctgcagggagcccagatggggcagccaggtgcttcttcccacccagctac cccagctacaagctggagaacctgagctcctctgaaatgggctacacggc caccctgacccgtaccacccccaccacttccccaaggacatcctgaccag cggctggacgtgatgatggagactgagaaccgcctccacttcacgatcaa agatccagctaacaggcgctacgaggtgcccttggagaccccgcgtgtcc acagccgggcaccgtccccactctacagcgtggagttctctgaggagccc ttcggggtgatcgtgcaccggcagctggacggccgcgtgctgctgaacac gacggtggcgcccctgttctttgcggaccagttccttcagagtccacctc gctgccctcgcagtatatcacaggcctcgccgagcacctcagtcccctga tgctcagcaccagctggaccaggatcaccctgtggaaccgggaccttgcg cccacgcccggtgcgaacctctacgggtctcaccctttctacctggcgct ggaggacggcgggtcggcacacggggtgttcctgctaaacagcaatgcca tggatgtggtcctgcagccgagccctgcccttagctggaggtcgacaggt gggatcctggatgtctacatcttcctgggcccagagcccaagagcgtggt gcagcagtacctggacgttgtgggatacccgttcatgccgccatactggg gcctgggcttccacctgtgccgctggggctactcctccaccgctatcacc cgccaggtggtggagaacatgaccagggcccacttccccctggacgtcca atggaacgacctggactacatggactcccggagggacttcacgttcaaca aggatggcttccgggacttcccggccatggtgcaggagctgcaccagggc ggccggcgctacatgatgatcgtggatcctgccatcagcagctcgggccc tgccgggagctacaggccctacgacgagggtagcggaggggggttttcat caccaacgagaccggccagccgctgattgggaaggtatggcccgggtcca ctgccttccccgacttcaccaaccccacagccctggcctggtgggaggac atggtggctgagttccatgaccaggtgcccttcgacggcatgtggattga catgaacgagcatccaacttcatcaggggctctgaggacggctgccccaa caatgagctggagaacccaccctacgtgcctggggtggttggggggacca ccaggcggcaaccatctgtgcctccagccaccagtttctaccacacacta caacctgcacaacctctacggcctgaccgaagccatcgcctcccacaggg cgctggtgaaggctcgggggacacgcccatttgtgatctcccgctcgaca ttgctggccacggccgatacgccggccactggacgggggacgtgtggagc tcctgggagcagctcgcctcctccgtgccagaaatcctgcagtttaacct gctgggggtgcctaggtcggggccgacgtctgcggcttcctgggcaacac ctcagaggagctgtgtgtgcgctggacccagctgggggccttctacccct tcatgcggaaccacaacagcctgacagtagccccaggagccgtacagctt cagcgagccggcccagcaggccatgaggaaggccctcaccctgcgctacg cactcctcccccacctctacacgctgttccaccaggcccacgtcgcgggg gagaccgtggcccggcccctatcctggagttccccaaggactctagcacc tggactgtggaccaccagctcctgtggggggaggccagacatcaccccag tgctccaggccgggaaggccgaagtgactggctacttcccatgggcacat ggtacgacctgcagacggtgccaatagaggcccttggcagcctcccaccc ccacctgcagctccccgtgagccagccatccacagcgaggggcagtgggt gacgctgccggcccccctggacaccatcaacgtccacctccgggctgggt acatcatccccctgcagggccctggcctcacaaccacagagtcccgccag cagcccatggccctggctgtggccagaccaagggtggagaggcccgaggg gagctgttctgggacgatggagagagcctggaagtgctggagcgaggggc ctacacacaggtcatatcctggccaggaataacacgatcgtgaatgagct ggtacgtgtgaccagtgagggagaggcctgcagctgcagaaggtgactgt cctgggcgtggccacggcgccccagcaggtcctaccaacggtgtccctgt ctccaacttcacctacagccccgacaccaaggtcctggacatctgtgtac gctgttgatgggagagcagtttctcgtcagctggtgttagtctagagctt gctagcggccgc

Construct 1752

[0126] The GILT.DELTA.2-7.DELTA.30-40-GAA70-952 cassette below was cloned using the Asp718 and NotI sites of the cassette and vector pCEP4 to produce pCEP-GILT.DELTA.2-7.DELTA.30-40-GAA70-952 (Plasmid 1752). Restriction sites for cloning are in lowercase bold. The spacer amino acid sequence Gly, Ala, Pro (underlined sequence) separate the GAA gene and GILT.DELTA.2-7.DELTA.30-40 tag (upper case sequence). The spacer and tag are placed upstream of GAA residue Ala70. The GILT.DELTA.2-7.DELTA.30-40 cassette contains a deletion of amino acid residues 30-40 (Arg-Pro-Ala-Ser-Arg-Val-Ser-Arg-Arg-Ser-Arg) from the human IGF-II sequence.

TABLE-US-00017 (SEQ ID NO: 26) ggtaccagctgctagcaagctaattcacaccaATGGGAATCCCAATGGGG AAGTCGATGCTGGTGCTTCTCACCTTCTTGGCCTTCGCCTCGTGCTGCAT TGCTGCTCTGTGCGGCGGGGAGCTGGTGGACACCCTCCAGTTCGTCTGTG GGGACCGCGGCTTCTACTTCAGCGGCATCGTTGAGGAGTGCTGTTTCCGC AGCTGTGACCTGGCCCTCCTGGAGACGTACTGTGCTACCCCCGCCAAGTC CGAGGGCGCGCCGgcacaccccggccgtcccagagcagtgcccacacagt gcgacgtcccccccaacagccttttcgattgcgcccctgacaaggccatc acccaggaacagtgcgaggcccgcggctgctgctacatccctgcaaagca ggggctgcagggagcccagatggggcagccaggtgcttatcccacccagc taccccagctacaagaggagaacctgagctcctagaaatgggctacacgg ccaccctgacccgtaccacccccaccttatccccaaggacatcctgacca gcggctggacgtgatgatggagactgagaaccgcctccacttcacgatca aagatccagctaacaggcgctacgaggtgcccttggagaccccgcgtgtc cacagccgggcaccgtccccactctacagcgtggagttctctgaggagcc cttcggggtgatcgtgcaccggcagaggacggccgcgtgctgctgaacac gacggtggcgcccagttctttgcggaccagttccttcagctgtccacctc gctgccacgcagtatatcacaggcctcgccgagcacctcagtcccctgat gctcagcaccagctggaccaggatcaccctgtggaaccgggaccttgcgc ccacgcccggtgcgaacctctacgggtctcaccctttctacctggcgctg gaggacggcgggtcggcacacggggtgttcctgctaaacagcaatgccat ggatgtggtcctgcagccgagccctgcccttagctggaggtcgacaggtg ggatcctggatgtctacatcttcctgggcccagagcccaagagcgtggtg cagcagtacctggacgttgtgggatacccgttcatgccgccatactgggg cctgggatccacctgtgccgctggggctactcctccaccgctatcacccg ccaggtggtggagaacatgaccagggcccacttccccctggacgtccaat ggaacgacctggactacatggactcccggagggacttcacgttcaacaag gatggatccgggacttcccggccatggtgcaggagagcaccagggcggcc ggcgctacatgatgatcgtggatcctgccatcagcaggctcgggccctgc cgggagctacaggccctacgacgagggtctgcggaggggggttttcatca ccaacgagaccggccagccgctgattgggaaggtatggcccgggtccact gcatccccgacttcaccaaccccacagccctggcctggtgggaggacatg gtggctgagttccatgaccaggtgccatcgacggcatgtggattgacatg aacgagccttccaacttcatcaggggctctgaggacggctgccccaacaa tgagctggagaacccaccctacgtgcctggggtggttggggggaccctcc aggcggcaaccatctgtgcctccagccaccagtttctctccacacactac aacctgcacaacctctacggcctgaccgaagccatcgcctcccacagggc gctggtgaaggctcgggggacacgcccatttgtgatacccgctcgacatt gctggccacggccgatacgccggccactggacgggggacgtgtggagctc ctgggagcagctcgcctcctccgtgccagaaatcctgcagtttaacctgc tgggggtgcctctggtcggggccgacgtctgcggcttcctgggcaacacc tcagaggagctgtgtgtgcgctggacccagctgggggccttctacccctt catgcggaaccacaacagcctgctcagtctgccccaggagccgtacagct tcagcgagccggcccagcaggccatgaggaaggccctcaccctgcgctac gcactcctcccccacctctacacgctgttccaccaggcccacgtcgcggg ggagaccgtggcccggcccctcttcctggagttccccaaggactctagca cctggactgtggaccaccagctcctgtggggggaggccagacatcacccc agtgctccaggccgggaaggccgaagtgactggctacttccccttgggca catggtacgacctgcagacggtgccaatagaggcccttggcagcctccca cccccacctgcagaccccgtgagccagccatccacagcgaggggcagtgg gtgacgctgccggcccccctggacaccatcaacgtccacctccgggctgg gtacatcatccccctgcagggccctggcctcacaaccacagagtcccgcc agcagcccatggccctggctgtggccagaccaagggtggagaggcccgag gggagctgttctgggacgatggagagagcctggaagtgctggagcgaggg gcctacacacaggtcatatcctggccaggaataacacgatcgtgaatgag ctggtacgtgtgaccagtgagggagctggcctgcagctgcagaaggtgac tgtcctgggcgtggccacggcgccccagcaggtcctctccaacggtgtcc ctgtctccaacttcacctacagccccgacaccaaggtcctggacatctgt gtctcgctgttgatgggagagcagtttctcgtcagctggtgttagtctag agcttgctagcggccgc

Construct 1753

[0127] The GILT.DELTA.2-7.DELTA.31-40-GAA70-952 cassette below was cloned using the Asp718 and NotI sites of the cassette and vector pCEP4 to produce pCEP-GILT.DELTA.2-7.DELTA.31-40-GAA70-952 (Plasmid 1753). Restriction sites for cloning are in lowercase bold. The spacer amino acid sequence Gly, Ala, Pro (underlined sequence) separate the GAA gene and GILT.DELTA.2-7.DELTA.31-40 tag (upper case sequence). The spacer and tag are placed upstream of GAA residue Ala70. The GILT.DELTA.2-7.DELTA.31-40 cassette contains a deletion of amino acid residues 31-40 (Pro-Ala-Ser-Arg-Val-Ser-Arg-Arg-Ser-Arg) from the human IGF-II sequence.

TABLE-US-00018 (SEQ ID NO: 27) ggtaccagctgctagcaagctaattcacaccaATGGGAATCCCAATGGGGA AGTCGATGCTGGTGCTTCTCACCTTCTTGGCCTTCGCCTCGTGCTGCATTG CTGCTCTGTGCGGCGGGGAGCTGGTGGACACCCTCCAGTTCGTCTGTGGGG ACCGCGGCTTCTACTTCAGCAGGGGCATCGTTGAGGAGTGCTGTTTCCGCA GCTGTGACCTGGCCCTCCTGGAGACGTACTGTGCTACCCCCGCCAAGTCCG AGGGCGCGCCGgcacaccccggccgtcccagagcagtgcccacacagtgcg acgtcccccccaacagccgcttcgattgcgcccctgacaaggccatcaccc aggaacagtgcgaggcccgcggctgctgctacatccctgcaaagcaggggc tgcagggagcccagatggggcagccctggtgcttcttcccacccagctacc ccagctacaagctggagaacctgagctcctctgaaatgggctacacggcca ccctgacccgtaccacccccaccttcttccccaaggacatcctgaccctgc ggctggacgtgatgatggagactgagaaccgcctccacttcacgatcaaag atccagctaacaggcgctacgaggtgcccttggagaccccgcgtgtccaca gccgggcaccgtccccactctacagcgtggagttactgaggagccatcggg gtgatcgtgcaccggcagctggacggccgcgtgctgctgaacacgacggtg gcgcccctgttctttgcggaccagttccttcagctgtccacctcgctgccc tcgcagtatatcacaggcctcgccgagcacctcagtcccctgatgctcagc accagctggaccaggatcaccctgtggaaccgggaccttgcgcccacgccc ggtgcgaacctctacgggtctcaccctttctacctggcgctggaggacggc gggtcggcacacggggtgttcctgctaaacagcaatgccatggatgtggtc ctgcagccgagccctgcccttagctggaggtcgacaggtgggatcctggat gtctacatcttcctgggcccagagcccaagagcgtggtgcagcagtacctg gacgagtgggatacccgttcatgccgccatactggggcctgggcttccacc tgtgccgctggggctactcctccaccgctatcacccgccaggtggtggaga acatgaccagggcccacttccccctggacgtccaatggaacgacctggact acatggactcccggagggacttcacgttcaacaaggatggcttccgggact tcccggccatggtgcaggagctgcaccagggcggccggcgctacatgatga tcgtggatcctgccatcagcagctcgggccctgccgggagctacaggccct acgacgagggtctgcggaggggggttttcatcaccaacgagaccggccagc cgctgattgggaaggtatggcccgggtccactgccttccccgacttcacca accccacagccctggcctggtgggaggacatggtggctgagttccatgacc aggtgccatcgacggcatgtggattgacatgaacgagccttccaacttcat caggggctctgaggacggctgccccaacaatgagctggagaacccacccta cgtgcctggggtggttggggggaccctccaggcggcaaccatctgtgcctc cagccaccagtttctctccacacactacaacctgcacaacctctacggcct gaccgaagccatcgcctcccacagggcgctggtgaaggctcgggggacacg cccatttgtgatctcccgctcgacctttgctggccacggccgatacgccgg ccactggacgggggacgtgtggagctcctgggagcagctcgcctcctccgt gccagaaatcctgcagtttaacctgctgggggtgcctctggtcggggccgc gtctgcggcttcctgggcaacacctcagaggagctgtgtgtgcgctggacc cagctgggggccttctaccccttcatgcggaaccacaacagcctgctcagt ctgccccaggagccgtacagcttcagcgagccggcccagcaggccatgagg aaggccctcaccctgcgctacgcactcctcccccacctctacacgctgacc accaggcccacgtcgcgggggagaccgtggcccggcccctcttcctggagt tccccaaggactctagcacctggactgtggaccaccagctcctgtgggggg aggccctgctcatcaccccagtgctccaggccgggaaggccgaagtgactg gctacttccccttgggcacatggtacgacctgcagacggtgccaatagagg ccatggcagcctcccacccccacctgcagctccccgtgagccagccatcca cagcgaggggcagtgggtgacgctgccggcccccctggacaccatcaacgt ccacctccgggctgggtacatcatccccctgcagggccctggcctcacaac cacagagtcccgccagcagcccatggccctggctgtggccctgaccaaggg tggagaggcccgaggggagctgttctgggacgatggagagagcctggaagt gctggagcgaggggcctacacacaggtcatcttcctggccaggaataacac gatcgtgaatgagctggtacgtgtgaccagtgagggagctggcctgcagct gcagaaggtgactgtcctgggcgtggccacggcgccccagcaggtcctctc caacggtgtccctgtctccaacttcacctacagccccgacaccaaggtcct ggacatctgtgtctcgctgttgatgggagagcagtttctcgtcagctggtg ttagtctagagcttgctagcggccgc

Construct 1754

[0128] The GILT.DELTA.2-7.DELTA.32-40-GAA70-952 cassette below was cloned using the Asp718 and NotI sites of the cassette and vector pCEP4 to produce pCEP-GILT.DELTA.2-7.DELTA.32-40-GAA70-952 (Plasmid 1754). Restriction sites for cloning are in lowercase bold. The spacer amino acid sequence Gly, Ala, Pro (underlined sequence) separate the GAA gene and GILT.DELTA.2-7.DELTA.32-40 tag (upper case sequence). The spacer and tag are placed upstream of GAA residue Ala70. The GILT.DELTA.2-7.DELTA.32-40 cassette contains a deletion of amino acid residues 32-40 (Ala-Ser-Arg-Val-Ser-Arg-Arg-Ser-Arg) from the human IGF-II sequence.

TABLE-US-00019 (SEQ ID NO: 28) ggtaccagctgctagcaagctaattcacaccaATGGGAATCCCAATGGGG AAGTCGATGCTGGTGCTTCTCACCTTCTTGGCCTTCGCCTCGTGCTGCAT TGCTGCTCTGTGCGGCGGGGAGCTGGTGGACACCCTCCAGTTCGTCTGTG GGGACCGCGGCTTCTACTTCAGCAGGCCCGGCATCGTTGAGGAGTGCTGT TTCCGCAGCTGTGACCTGGCCCTCCTGGAGACGTACTGTGCTACCCCCGC CAAGTCCGAGGGCGCGCCGgcacaccccggccgtcccagagcagtgccca cacagtgcgacgtcccccccaacagccgcttcgattgcgcccctgacaag gccatcacccaggaacagtgcgaggcccgcggctgctgctacatccctgc aaagcaggggctgcagggagcccagatggggcagccctggtgatcttccc acccagctaccccagctacaagctggagaacctgagctcctctgaaatgg gctacacggccaccctgacccgtaccacccccaccttcttccccaaggac atcctgaccctgcggctggacgtgatgatggagactgagaaccgcctcca cttcacgatcaaagatccagctaacaggcgctacgaggtgcccttggaga ccccgcgtgtccacagccgggcaccgtccccactctacagcgtggagttc tctgaggagccatcggggtgatcgtgcaccggcagctggacggccgcgtg ctgctgaacacgacggtggcgcccctgttctttgcggaccagttccttca gctgtccacctcgctgccctcgcagtatatcacaggcctcgccgagcacc tcagtcccctgatgctcagcaccagctggaccaggatcaccctgtggaac cgggaccttgcgcccacgcccggtgcgaacctctacgggtctcaccattc tacctggcgctggaggacggcgggtcggcacacggggtgttcctgctaaa cagcaatgccatggatgtggtcctgcagccgagccctgcccttagctgga ggtcgacaggtgggatcctggatgtctacatcttcctgggcccagagccc aagagcgtggtgcagcagtacctggacgttgtgggatacccgttcatgcc gccatactggggcctgggcttccacctgtgccgctggggctactcctcca ccgctatcacccgccaggtggtggagaacatgaccagggcccacttcccc ctggacgtccaatggaacgacctggactacatggactcccggagggactt cacgttcaacaaggatggcttccgggacttcccggccatggtgcaggagc tgcaccagggcggccggcgctacatgatgatcgtggatcctgccatcagc agctcgggccctgccgggagctacaggccctacgacgagggtctgcggag gggggttttcatcaccaacgagaccggccagccgctgattgggaaggtat ggcccgggtccactgccttccccgacttcaccaaccccacagccctggcc tggtgggaggacatggtggctgagttccatgaccaggtgcccttcgacgg catgtggattgacatgaacgagccttccaacttcatcaggggctctgagg acggctgccccaacaatgagctggagaacccaccctacgtgcctggggtg gttggggggaccctccaggcggcaaccatctgtgcctccagccaccagtt tctctccacacactacaacctgcacaacctctacggcctgaccgaagcca tcgcctcccacagggcgctggtgaaggctcgggggacacgcccatttgtg atctcccgctcgacctttgctggccacggccgatacgccggccactggac gggggacgtgtggagctcctgggagcagctcgcctcctccgtgccagaaa tcctgcagtttaacctgctgggggtgcctctggtcggggccgacgtctgc ggcttcctgggcaacacctcagaggagagtgtgtgcgctggacccagctg ggggccttctacccatcatgcggaaccacaacagcctgctcagtctgccc caggagccgtacagcttcagcgagccggcccagcaggccatgaggaaggc cctcaccctgcgctacgcactcctcccccacctctacacgctgttccacc aggcccacgtcgcgggggagaccgtggcccggcccctcttcctggagttc cccaaggactctagcacctggactgtggaccaccagctcctgtgggggga ggccctgctcatcaccccagtgctccaggccgggaaggccgaagtgactg gctacttccccttgggcacatggtacgacctgcagacggtgccaatagag gccatggcagcctcccacccccacctgcagctccccgtgagccagccatc cacagcgaggggcagtgggtgacgctgccggcccccctggacaccatcaa cgtccacctccgggctgggtacatcatccccctgcagggccctggcctca caaccacagagtcccgccagcagcccatggccctggctgtggccctgacc aagggtggagaggcccgaggggagctgttctgggacgatggagagagcct ggaagtgctggagcgaggggcctacacacaggtcatcttcctggccagga ataacacgatcgtgaatgagctggtacgtgtgaccagtgagggagctggc ctgcagctgcagaaggtgactgtcctgggcgtggccacggcgccccagca ggtcctctccaacggtgtccctgtctccaacttcacctacagccccgaca ccaaggtcctggacatctgtgtctcgctgttgatgggagagcagtttctc gtcagctggtgttagtctagagcttgctagcggccgc

Construct 1755

[0129] The GILT.DELTA.2-7.DELTA.33-40-GAA70-952 cassette below was cloned using the Asp718 and NotI sites of the cassette and vector pCEP4 to produce pCEP-GILT.DELTA.2-7.DELTA.33-40-GAA70-952 (Plasmid 1755). Restriction sites for cloning are in lowercase bold. The spacer amino acid sequence Gly, Ala, Pro (underlined sequence) separate the GAA gene and GILT.DELTA.2-7.DELTA.33-40 tag (upper case sequence). The spacer and tag are placed upstream of GAA residue Ala70. The GILT.DELTA.2-7.DELTA.33-40 cassette contains a deletion of amino acid residues 33-40 (Ser-Arg-Val-Ser-Arg-Arg-Ser-Arg) from the human IGF-II sequence.

TABLE-US-00020 (SEQ ID NO: 29) ggtaccagctgctagcaagctaattcacaccaATGGGAATCCCAATGGG GAAGTCGATGCTGGTGCTTCTCACCTTCTTGGCCTTCGCCTCGTGCTGC ATTGCTGCTCTGTGCGGCGGGGAGCTGGTGGACACCCTCCAGTTCGTCT GTGGGGACCGCGGCTTCTACTTCAGCAGGCCCGCAGGCATCGTTGAGGA GTGCTGTTTCCGCAGCTGTGACCTGGCCCTCCTGGAGACGTACTGTGCT ACCCCCGCCAAGTCCGAGGGCGCGCCGgcacaccccggccgtcccagag cagtgcccacacagtgcgacgtcccccccaacagccgcttcgattgcgc ccctgacaaggccatcacccaggaacagtgcgaggcccgcggctgctgc tacatccctgcaaagcaggggctgcagggagcccagatggggcagccct ggtgcttcttcccacccagctaccccagctacaagctggagaacctgag ctcctctgaaatgggctacacggccaccctgacccgtaccacccccacc ttcttccccaaggacatcctgaccctgcggctggacgtgatgatggaga ctgagaaccgcctccacttcacgatcaaagatccagctaacaggcgcta cgaggtgccatggagaccccgcgtgtccacagccgggcaccgtccccac tctacagcgtggagttctctgaggagcccttcggggtgatcgtgcaccg gcagctggacggccgcgtgctgctgaacacgacggtggcgcccctgtta ttgcggaccagttccttcagctgtccacctcgctgccctcgcagtatat cacaggcctcgccgagcacctcagtcccctgatgctcagcaccagctgg accaggatcaccctgtggaaccgggaccttgcgcccacgcccggtgcga acctctacgggtctcaccctttctacctggcgctggaggacggcgggtc ggcacacggggtgttcctgctaaacagcaatgccatggatgtggtcctg cagccgagccctgccatagctggaggtcgacaggtgggatcctggatgt ctacatcttcctgggcccagagcccaagagcgtggtgcagcagtacctg gacgttgtgggatacccgttcatgccgccatactggggcctgggatcca cctgtgccgctggggctactcctccaccgctatcacccgccaggtggtg gagaacatgaccagggcccacttccccctggacgtccaatggaacgacc tggactacatggactcccggagggacttcacgttcaacaaggatggatc cgggacttcccggccatggtgcaggagctgcaccagggcggccggcgct acatgatgatcgtggatcctgccatcagcagctcgggccctgccgggag ctacaggccctacgacgagggtctgcggaggggggttttcatcaccaac gagaccggccagccgctgattgggaaggtatggcccgggtccactgcct tccccgacttcaccaaccccacagccctggcctggtgggaggacatggt ggctgagaccatgaccaggtgccatcgacggcatgtggattgacatgaa cgagccttccaacttcatcaggggctctgaggacggctgccccaacaat gagctggagaacccaccctacgtgcctggggtggttggggggaccctcc aggcggcaaccatctgtgcctccagccaccagtttctctccacacacta caacctgcacaacctctacggcctgaccgaagccatcgcctcccacagg gcgctggtgaaggctcgggggacacgcccatttgtgatctcccgctcga cctttgctggccacggccgatacgccggccactggacgggggacgtgtg gagctcctgggagcagctcgcctcctccgtgccagaaatcctgcagttt aacctgctgggggtgcctctggtcggggccgacgtctgcggcttcctgg gcaacacctcagaggagctgtgtgtgcgctggacccagctgggggcctt ctaccccttcatgcggaaccacaacagcctgctcagtctgccccaggag ccgtacagcttcagcgagccggcccagcaggccatgaggaaggccctca ccctgcgctacgcactcctcccccacctctacacgctgttccaccaggc ccacgtcgcgggggagaccgtggcccggcccctcttcctggagttcccc aaggactctagcacctggactgtggaccaccagctcctgtggggggagg ccctgctcatcaccccagtgctccaggccgggaaggccgaagtgactgg ctacttccccttgggcacatggtacgacctgcagacggtgccaatagag gcccttggcagcctcccacccccacctgcagctccccgtgagccagcca tccacagcgaggggcagtgggtgacgctgccggcccccctggacaccat caacgtccacctccgggctgggtacatcatccccctgcagggccaggcc tcacaaccacagagtcccgccagcagcccatggccctggctgtggccct gaccaagggtggagaggcccgaggggagctgttctgggacgatggagag agcctggaagtgctggagcgaggggcctacacacaggtcatcttcctgg ccaggaataacacgatcgtgaatgagctggtacgtgtgaccagtgaggg agctggcctgcagctgcagaaggtgactgtcctgggcgtggccacggcg ccccagcaggtcctctccaacggtgtccctgtctccaacttcacctaca gccccgacaccaaggtcctggacatctgtgtctcgctgttgatgggaga gcagtttctcgtcagaggtgttagtctagagcttgctagcggccgc

Construct 1756

[0130] The GILT.DELTA.2-7.DELTA.34-40-GAA70-952 cassette below was cloned using the Asp718 and NotI sites of the cassette and vector pCEP4 to produce pCEP-GILT.DELTA.2-7.DELTA.34-40-GAA70-952 (Plasmid 1756). Restriction sites for cloning are in lowercase bold. The spacer amino acid sequence Gly, Ala, Pro (underlined sequence) separate the GAA gene and GILT.DELTA.2-7.DELTA.34-40 tag (upper case sequence). The spacer and tag are placed upstream of GAA residue Ala70. The GILT.DELTA.2-7.DELTA.34-40 cassette contains a deletion of amino acid residues 34-40 (Arg-Val-Ser-Arg-Arg-Ser-Arg) from the human IGF-II sequence.

TABLE-US-00021 (SEQ ID NO: 30) ggtaccagctgctagcaagctaattcacaccaATGGGAATCCCAATGGG GAAGTCGATGCTGGTGCTTCTCACCTTCTTGGCCTTCGCCTCGTGCTGC ATTGCTGCTCTGTGCGGCGGGGAGCTGGTGGACACCCTCCAGTTCGTCT GTGGGGACCGCGGCTTCTACTTCAGCAGGCCCGCAAGCGGCATCGTTGA GGAGTGCTGTTTCCGCAGCTGTGACCTGGCCCTCCTGGAGACGTACTGT GCTACCCCCGCCAAGTCCGAGGGCGCGCCGgcacaccccggccgtccca gagcagtgcccacacagtgcgacgtcccccccaacagccgcttcgattg cgcccctgacaaggccatcacccaggaacagtgcgaggcccgcggagct gctacatccctgcaaagcaggggctgcagggagcccagatggggcagcc aggtgatatcccacccagctaccccagctacaagctggagaacctgagc tcctctgaaatgggctacacggccaccctgacccgtaccacccccacct tcttccccaaggacatcctgaccctgcggctggacgtgatgatggagac tgagaaccgcctccacttcacgatcaaagatccagctaacaggcgctac gaggtgccatggagaccccgcgtgtccacagccgggcaccgtccccact ctacagcgtggagttactgaggagccatcggggtgatcgtgcaccggca gaggacggccgcgtgctgctgaacacgacggtggcgcccctgttctttg cggaccagttccttcagctgtccacctcgctgccctcgcagtatatcac aggcctcgccgagcacctcagtcccctgatgctcagcaccagctggacc aggatcaccctgtggaaccgggaccttgcgcccacgcccggtgcgaacc tctacgggtctcaccctttctacctggcgctggaggacggcgggtcggc acacggggtgttcctgctaaacagcaatgccatggatgtggtcctgcag ccgagccagcccttagctggaggtcgacaggtgggatcctggatgtcta catcttcctgggcccagagcccaagagcgtggtgcagcagtacctggac gttgtgggatacccgttcatgccgccatactggggcctgggcttccacc tgtgccgctggggctactcctccaccgctatcacccgccaggtggtgga gaacatgaccagggcccacttccccctggacgtccaatggaacgacctg gactacatggactcccggagggacttcacgttcaacaaggatggcttcc gggacttcccggccatggtgcaggagctgcaccagggcggccggcgcta catgatgatcgtggatcctgccatcagcagctcgggccctgccgggagc tacaggccctacgacgagggtctgcggaggggggttttcatcaccaacg agaccggccagccgctgattgggaaggtatggcccgggtccactgcatc cccgacttcaccaaccccacagccctggcctggtgggaggacatggtgg ctgagttccatgaccaggtgcccttcgacggcatgtggattgacatgaa cgagccttccaacttcatcaggggctctgaggacggctgccccaacaat gagctggagaacccaccctacgtgcctggggtggttggggggaccctcc aggcggcaaccatctgtgcctccagccaccagtttctctccacacacta caacctgcacaacctctacggcctgaccgaagccatcgcctcccacagg gcgctggtgaaggctcgggggacacgcccatttgtgatctcccgctcga cctttgctggccacggccgatacgccggccactggacgggggacgtgtg gagctcctgggagcagctcgcctcctccgtgccagaaatcctgcagttt aacctgctgggggtgcctaggtcggggccgacgtctgcggcttcctggg caacacctcagaggagagtgtgtgcgctggacccagagggggccttcta ccccttcatgcggaaccacaacagcctgctcagtagccccaggagccgt acagatcagcgagccggcccagcaggccatgaggaaggccacaccctgc gctacgcactcctcccccacctctacacgctgttccaccaggcccacgt cgcgggggagaccgtggcccggcccctatcctggagttccccaaggact ctagcacctggactgtggaccaccagctcagtggggggaggccctgctc atcaccccagtgctccaggccgggaaggccgaagtgactggctacttcc catgggcacatggtacgacctgcagacggtgccaatagaggcccttggc agcctcccacccccacctgcagctccccgtgagccagccatccacagcg aggggcagtgggtgacgctgccggcccccctggacaccatcaacgtcca cctccgggctgggtacatcatccccctgcagggccctggcctcacaacc acagagtcccgccagcagcccatggccaggctgtggccctgaccaaggg tggagaggcccgaggggagagttctgggacgatggagagagcctggaag tgctggagcgaggggcctacacacaggtcatcttcctggccaggaataa cacgatcgtgaatgagctggtacgtgtgaccagtgagggagctggcctg cagagcagaaggtgactgtcagggcgtggccacggcgccccagcaggtc ctctccaacggtgtccctgtctccaacttcacctacagccccgacacca aggtcctggacatctgtgtctcgagttgatgggagagcagtttctcgtc agctggtgttagtctagagcttgctagcggccgc

Construct 1763

[0131] The GILT.DELTA.2-7M1/L27A37-GAA70-952 cassette below was cloned using the Asp718 and NotI sites of the cassette and vector pCEP4 to produce pCEP-GILT.DELTA.2-7M1/L27A37-GAA70-952 (Plasmid 1763). Restriction sites for cloning are in lowercase bold. The spacer amino acid sequence Gly, Ala, Pro (underlined sequence) separate the GAA gene and GILT.DELTA.2-7M1/L27A37 tag (upper case sequence). The spacer and tag are placed upstream of GAA residue Ala70. The GILT.DELTA.2-7M1/L27A37 cassette contains Y27L and R37A substitutions in the human IGFII sequence. The DNA sequence of the GILT cassette differs from the human DNA sequence at every 6.sup.th codon.

TABLE-US-00022 (SEQ ID NO: 31) ggtaccaagcttgccATGGGAATCCCAATGGGCAAGTCGATGCTGGTGC TGCTCACCTTCTTGGCCTTTGCCTCGTGCTGCATTGCCGCTCTGTGCGG CGGGGAACTGGTGGACACCCTCCAATTCGTCTGTGGGGACCGGGGCTTC CTGTTCAGCAGACCCGCAAGCCGTGTGAGTGCTCGCAGCCGTGGCATTG TTGAGGAGTGCTGTTTTCGCAGCTGTGACCTGGCTCTCCTGGAGACGTA CTGCGCTACCCCCGCCAAGTCTGAGGGCGCGCCGgcacaccccggccgt cccagagcagtgcccacacagtgcgacgtcccccccaacagccgcttcg attgcgcccctgacaaggccatcacccaggaacagtgcgaggcccgcgg ctgctgctacatccctgcaaagcaggggctgcagggagcccagatgggg cagccaggtgcttatcccacccagctaccccagctacaagaggagaacc tgagacctagaaatgggctacacggccaccagacccgtaccacccccac cttatccccaaggacatcctgaccctgcggaggacgtgatgatggagac tgagaaccgcctccacttcacgatcaaagatccagctaacaggcgctac gaggtgcccttggagaccccgcgtgtccacagccgggcaccgtccccac tctacagcgtggagttctctgaggagccatcggggtgatcgtgcaccgg cagctggacggccgcgtgctgctgaacacgacggtggcgcccagttctt tgcggaccagttccttcagagtccacctcgctgccctcgcagtatatca caggcctcgccgagcacctcagtcccctgatgctcagcaccagaggacc aggatcaccagtggaaccgggaccttgcgcccacgcccggtgcgaacct ctacgggtctcaccattctacctggcgctggaggacggcgggtcggcac acggggtgttcctgctaaacagcaatgccatggatgtggtcctgcagcc gagccctgccatagaggaggtcgacaggtgggatcctggatgtctacat atcctgggcccagagcccaagagcgtggtgcagcagtacctggacgttg tgggatacccgttcatgccgccatactggggcagggcttccacctgtgc cgctggggctactcaccaccgctatcacccgccaggtggtggagaacat gaccagggcccacttccccctggacgtccaatggaacgacctggactac atggactcccggagggacttcacgttcaacaaggatggcttccgggact tcccggccatggtgcaggagctgcaccagggcggccggcgctacatgat gatcgtggatcctgccatcagcagctcgggccctgccgggagctacagg ccctacgacgagggtctgcggaggggggttttcatcaccaacgagaccg gccagccgctgattgggaaggtatggcccgggtccactgccttccccga cttcaccaaccccacagccctggcctggtgggaggacatggtggctgag ttccatgaccaggtgcccttcgacggcatgtggattgacatgaacgagc cttccaacttcatcaggggctctgaggacggctgccccaacaatgagct ggagaacccaccctacgtgcctggggtggttggggggaccctccaggcg gcaaccatctgtgcctccagccaccagtttctctccacacactacaacc tgcacaacctctacggcctgaccgaagccatcgcctcccacagggcgct ggtgaaggctcgggggacacgcccatttgtgatctcccgctcgaccttt gctggccacggccgatacgccggccactggacgggggacgtgtggagct cctgggagcagctcgcctcaccgtgccagaaatcctgcagtttaacctg ctgggggtgcctctggtcggggccgacgtagcggcttcctgggcaacac ctcagaggagctgtgtgtgcgaggacccagctgggggccttctacccct tcatgcggaaccacaacagcctgctcagtagccccaggagccgtacagc ttcagcgagccggcccagcaggccatgaggaaggccctcaccctgcgct acgcactcctcccccacctctacacgctgttccaccaggcccacgtcgc gggggagaccgtggcccggcccacttcctggagttccccaaggactcta gcacctggactgtggaccaccagctcctgtggggggaggccagctcatc accccagtgctccaggccgggaaggccgaagtgactggctacttcccct tgggcacatggtacgacctgcagacggtgccaatagaggcccttggcag cctcccacccccacctgcagctccccgtgagccagccatccacagcgag gggcagtgggtgacgctgccggcccccctggacaccatcaacgtccacc tccgggctgggtacatcatccccagcagggccaggcctcacaaccacag agtcccgccagcagcccatggccaggctgtggccctgaccaagggtgga gaggcccgaggggagctgttctgggacgatggagagagcctggaagtgc tggagcgaggggcctacacacaggtcatcttcctggccaggaataacac gatcgtgaatgagaggtacgtgtgaccagtgagggagctggcctgcaga gcagaaggtgactgtcctgggcgtggccacggcgccccagcaggtcctc tccaacggtgtccctgtctccaacttcacctacagccccgacaccaagg tcctggacatctgtgtctcgctgttgatgggagagcagtttctcgtcag ctggtgttagtctagagcttgctagcggccgc

Example 3

Expression and Purification of GILT-Tagged GAA Enzymes

Tissue Culture

[0132] GILT-tagged GAA plasmids were each transfected into suspension FreeStyle 293-F cells as described by the manufacturer (Invitrogen). Briefly, cells were grown in Opti-MEM I media (Invitrogen) in polycarbonate shaker flasks on an orbital shaker at 37.degree. C. and 8% CO.sub.2. Cells were adjusted to a concentration of 1.times.10.sup.6 cells/ml, then transfected with a 1:1:1 ratio of ml cells:.mu.g DNA:.mu.l 293 fectin. Culture aliquots were harvested 5-7 days post-transfection and centrifuged at 5,000.times.g for 5 minutes. Supernatants were stored frozen at -80.degree. C.

Protein Purification and Concentration

[0133] Starting material was mammalian cell culture supernatant, as described above, thawed from storage at -80.degree. C. Citric acid was added to reach pH 6.0, then ammonium sulfate was added to reach a final concentration of 1M. The material was passed through a 0.2 .mu.m Supor-Mach filter (Nalgene).

[0134] The filtered material was loaded onto a Phenyl-Sepharose.TM. 6 Low-Sub Fast-Flow (GE Healthcare) column prepared with HIC Load Buffer (50 mM citrate pH 6.0, 1M AmSO.sub.4). The column was washed with 10 column volumes of HIC Wash Buffer (50 mM citrate pH 6.0, 0.8M AmSO.sub.4), and eluted with 5 column volumes of HIC Elution Buffer (50 mM citrate pH 6.0). Samples from the elution peaks were pooled and buffer was exchanged into phosphate buffered saline (145.15 mM NaCl, 2.33 mM KCl, 10 mM Na.sub.2HPO.sub.4, 2 mM KH.sub.2PO.sub.4, pH 6.2) using centricon spin concentrators (Amicon) and Bio-Spin-6 de-salting columns (Bio-Rad).

Enzyme Activity

[0135] GAA expression was determined by a para-nitrophenol (PNP) enzymatic assay. GAA enzyme was incubated in 50 al reaction mixture containing 100 mM sodium acetate pH 4.2 and 10 mM Para-Nitrophenol (PNP) .alpha.-glucoside substrate (Sigma N1377). Reactions were incubated at 37.degree. C. for 20 minutes and stopped with 300 .mu.l of 100 mM sodium carbonate. Absorbance at 405 nm was measured in 96-well microtiter plates and compared to standard curves derived from p-nitrophenol (Sigma N7660). 1 GAA PNP unit is defined as 1 nmole PNP hydrolyzed/hour.

Example 4

Competitive Receptor Binding Assays

[0136] The affinity of GILT-tagged proteins for the IGF2 receptor (IGF2R), IGF1 receptor (IGF1R) and the insulin receptor (IR) was examined in competitive binding experiments performed in a 96-well plate format. Receptors were coated at room temperature overnight onto Reacti-bind white plates (Pierce, Cat#437111) in Coating Buffer (0.05M Carbonate buffer, pH 9.6) at a concentration of either 0.5 .mu.g/well (IGF2R) or 1 .mu.g/well (IGF1R, IR). Plates were washed with wash buffer (Phosphate Buffered Saline plus 0.05% Tween-20), then blocked in Super Blocking Buffer (Pierce, Cat#37516) for 1 hour. After another plate washing, biotinylated ligands (Cell Sciences) were added to wells; IGF2R wells received 8 nM IGF2-biotin, IGF1R wells received 30 nM IGF1-biotin, and IR wells received 20 nM insulin-biotin. Along with the biotinylated ligands, wells also contained serial dilutions of the GILT-tagged GAA protein samples or non-biotinylated control ligands to act as binding inhibitors for the biotinylated ligands. Following a two-hour rocking incubation, plates were washed and bound biotinylated ligands were detected with a streptavidin-HRP incubation (R&D, Cat#890803, 1:200 dilution in blocking buffer, 30 minutes), followed by a Super Elisa Pico Chemiluminescent Substrate incubation (Pierce, Cat#37070, 5 minutes). The chemiluminescent signal was measured at 425 nm.

[0137] The percent bound biotinylated ligand was calculated for each competitor concentration in the IGF2R binding competition assay and the IC.sub.50 values were determined (FIG. 4). Protein 1752 with a deletion of IGF2 residues 30-40 displayed a similar IC.sub.50 value as the GILT-tagged ZC-701 (FIG. 4), indicating that deletion of these residues in the IGF2 loop region does not appear to effect IGF2R binding. Protein 1751 with a deletion of IGF2 residues 29-40 displayed a higher IC.sub.50 value (FIG. 4), indicating that it does not compete as well for binding to the IGF2R.

[0138] On a separate IGF2R assay plate, comparison of ZC-701 and protein 1763 yielded IC.sub.50 values that differed by 35% (See FIG. 5).

[0139] In an assay measuring the competition of biotinylated insulin binding to plate-bound insulin, 1751 and 1752 proteins were not as effective as inhibitors compared to 701 or IGF-II (See FIG. 6). This indicates that the 1751 and 1752 proteins, with deletions in the loop region corresponding to amino acids 30-40 of the GILT tag, had a reduced affinity for the insulin receptor compared to the intact GILT tag on 701 or IGF-II.

[0140] In an assay measuring the competition of biotinylated IGF-I binding to plate-bound IGF1R, 1763 protein was not as effective as an inhibitor compared to 701, IGF-II or IGF-I (See FIG. 7). This indicates that the 1763 protein, with A2-7, Y27L and R37A mutations in the GILT tag, had a reduced affinity for the IGF1 receptor compared to ZC-701 or IGF-II.

Example 4

Additional Insulin Receptor Binding Assay

[0141] Protein ZC-1487 was tested from its binding affinity for the insulin receptor. Protein ZC-1487 contains the GILTD2-7M1/A37 cassette contains with and Arg to Ala substitution at amino acid 37 of the human IGF2 sequence and is resistant to proteolysis by furin. Two different batches of this protein purified from CHO cells, ZC-1487-B26 and ZC-1487-B28 were analyzed in an assay measuring the competition of biotinylated insulin binding to plate-bound insulin.

[0142] An insulin receptor binding assay was conducted by competing insulin, IGF-II, ZC710B20 and ZC1487B26 or ZC-1487-B28 with Biotinylated-insulin binding to the insulin receptor (Insulin-R).

[0143] Specifically, white Reacti-Bind.TM. plates were coated with Insulin-R at a concentration of 1 ug/well/100 ul (38.4 nM). The coated plates were incubate over night at room temperature, then washed 3.times. with washing buffer (300 ul/well). The plates were then blocked with blocking buffer (300 ul/well) for 1 hour. The washing steps were repeated and any trace of solution in the plates was taken out.

[0144] Biotinylated-insulin was mixed at 20 nM with different concentrations of insulin, IGF-II, ZC701B20, B26 and B28 by serial dilutions (final concentrations are shown in Table 2). 100 ul of diluted Insulin, IGF-II, ZC710B20, ZC1487B26, and ZC1487B28 in 20 nM Insulin-biotin were added into the coated plates and the plates were incubated at room temperature for 2 hours. The plates were then washed 3 times with washing buffer. 100 ul of strepavidin-HRP working solution (50 ul strepavidin-HRP in 10 ml blocking buffer) was added into the plates and the plates were incubated at room temperature for 30 minutes. 100 ul of Elisa-Pico working solution containing Elisa-Pico chemiluminescent substrate was added and the chemiluminescence was measured at 425 nm. Exemplary results are shown in Table 2, FIG. 8, and FIG. 9. Both batches of ZC-1487 were not as effective as inhibitors compared to ZC-701 or the insulin control. As can be seen from Table 2 and FIG. 8, furin resistant peptide ZC-1487B26 binds to the insulin receptor more than 10-fold less avidly than does ZC-701 and more than 20-fold less than does the wild-type IGF-II

[0145] This indicates that the 1487 protein had a reduced affinity for the insulin receptor compared to the GILT tag on ZC-701.

TABLE-US-00023 TABLE 2 Insulin-Receptor Binding Activity - Chemiluminescence Intensity Insulin-B (nM) 2000 1000 500 250 125 62.5 31.25 15.625 7.8125 3.90625 1.95313 0 Insulin (nM) 20 nM 38.00 43.00 66.00 102.00 243.00 479.00 750.00 780.00 503 1175 1046 2180 20 nM 13.00 25.00 57.00 141.00 229.00 517.00 517.00 885.00 1003 1344 1462 1694 ave 25.5 34.0 61.5 121.5 236.0 498.0 633.5 832.5 753.0 1259.5 1254.0 1937.0 IFG-II (nM) 20 nM 70.00 268.00 356.00 644.00 828.00 991.00 1189.00 1492.00 1478 1478 1410 1874 20 nM 140.00 176.00 379.00 566.00 919.00 1224.00 1447.00 1377.00 1483 1370 1249 1959 ave 105.0 222.0 367.5 605.0 873.5 1107.5 1318.0 1434.5 1480.5 1424.0 1329.5 1916.5 Insulin-B (nM) 4000 2000 1000 500 250 125 62.5 31.25 15.625 7.8125 3.90625 0 ZC701B20 (nM) 20 nM 191.00 387.00 526.00 715.00 800.00 1284.00 1116.00 1248.00 1474 1241 1450 1790 20 nM 250.00 329.00 483.00 774.00 767.00 1071.00 1024.00 968.00 1471 1118 1234 1886 ave 220.5 358.0 504.5 744.5 783.5 1177.5 1070.0 1108.0 1472.5 1179.5 1342.0 1838.0 ZC1487B26 (nM) 20 nM 967.00 1190.00 1334.00 1210.00 1294.00 1462.00 1402.00 1281.00 1323 1612 1173 1952 20 nM 962.00 1189.00 1395.00 1379.00 1612.00 1396.00 1221.00 1013.00 1326 1182 1102 2069 ave 964.5 1189.5 1364.5 1294.5 1453.0 1429.0 1311.5 1147.0 1324.5 1397.0 1137.5 2010.5 2000 1000 500 250 125 62.5 31.25 5.625 7.8125 3.90625 1.95313 0 (4000) (2000) (1000) (500) (250) (125) (62.5) (31.25) (15.625) (7.8125) (3.90625)

Example 5

Uptake Assays

[0146] Some mutants were tested for retention of uptake activity. HEK293 cells were transfected with constructs 1479 (R37K), 1487 (R37A) or ZC-701. After harvest, culture supernatants were partially purified by HIC chromatography. All samples were treated with PNGase prior to electrophoresis.

[0147] FIG. 10 shows partially purified preparations of targeted fusion proteins containing a furin-resistant IGF-II mutein tag analyzed by SDS-PAGE and immunoblotting. As can be seen, the fusion protein encoded by construct 1487 containing R37A mutation is resistant to exogenous furin.

[0148] FIG. 11 illustrates exemplary uptake results of furin resistant GILT-tagged GAA into rat L6 myoblasts. As shown in FIG. 11, exemplary K.sub.uptakes for proteins 1479, 1487, ZC-701, and purified ZC-701 are 4.5 nM, 4.4 nM, 5.0 nM and 2.6 nM, respectively, which indicates that the proteins encoded by constructs 1487 (R37A) and 1479 (R37K) retain the ability for efficient uptake into rat L6 myoblasts. The efficient uptake of fusion proteins containing a furin-resistant GILT tag also indicates that the furin-resistant tag retains high affinity for the CI-MPR.

EQUIVALENTS

[0149] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. The scope of the present invention is not intended to be limited to the above Description, but rather is as set forth in the appended claims. The articles "a", "an", and "the" as used herein in the specification and in the claims, unless clearly indicated to the contrary, should be understood to include the plural referents. Claims or descriptions that include "or" between one or more members of a group are considered satisfied if one, more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process unless indicated to the contrary or otherwise evident from the context. The invention includes embodiments in which exactly one member of the group is present in, employed in, or otherwise relevant to a given product or process. The invention also includes embodiments in which more than one, or all of the group members are present in, employed in, or otherwise relevant to a given product or process. Furthermore, it is to be understood that the invention encompasses variations, combinations, and permutations in which one or more limitations, elements, clauses, descriptive terms, etc., from one or more of the claims is introduced into another claim dependent on the same base claim (or, as relevant, any other claim) unless otherwise indicated or unless it would be evident to one of ordinary skill in the art that a contradiction or inconsistency would arise. Where elements are presented as lists, e.g., in Markush group or similar format, it is to be understood that each subgroup of the elements is also disclosed, and any element(s) can be removed from the group. It should it be understood that, in general, where the invention, or aspects of the invention, is/are referred to as comprising particular elements, features, etc., certain embodiments of the invention or aspects of the invention consist, or consist essentially of, such elements, features, etc. For purposes of simplicity those embodiments have not in every case been specifically set forth herein. It should also be understood that any embodiment of the invention, e.g., any embodiment found within the prior art, can be explicitly excluded from the claims, regardless of whether the specific exclusion is recited in the specification.

[0150] It should also be understood that, unless clearly indicated to the contrary, in any methods claimed herein that include more than one act, the order of the acts of the method is not necessarily limited to the order in which the acts of the method are recited, but the invention includes embodiments in which the order is so limited. Furthermore, where the claims recite a composition, the invention encompasses methods of using the composition and methods of making the composition. Where the claims recite a composition, it should be understood that the invention encompasses methods of using the composition and methods of making the composition.

INCORPORATION OF REFERENCES

[0151] All publications and patent documents cited in this application are incorporated by reference in their entirety to the same extent as if the contents of each individual publication or patent document were incorporated herein.

Sequence CWU 1

1

35167PRTHomo sapiens 1Ala Tyr Arg Pro Ser Glu Thr Leu Cys Gly Gly Glu Leu Val Asp Thr 1 5 10 15 Leu Gln Phe Val Cys Gly Asp Arg Gly Phe Tyr Phe Ser Arg Pro Ala 20 25 30 Ser Arg Val Ser Arg Arg Ser Arg Gly Ile Val Glu Glu Cys Cys Phe 35 40 45 Arg Ser Cys Asp Leu Ala Leu Leu Glu Thr Tyr Cys Ala Thr Pro Ala 50 55 60 Lys Ser Glu 65 24PRTArtificial SequenceFurin protease recognition sequence 2Arg Xaa Xaa Arg 1 36PRTArtificial SequenceFurin protease recognition sequence 3Xaa Xaa Xaa Xaa Xaa Arg 1 5 43PRTArtificial Sequencesynthetic linker sequence 4Gly Ala Pro 1 56PRTArtificial Sequencesynthetic linker sequence 5Gly Gly Gly Gly Gly Pro 1 5 68PRTArtificial SequenceFurin cleavage site - p1463 A40 6Arg Val Ser Arg Arg Ser Ala Gly 1 5 73PRTArtificial Sequencesynthetic linker sequence 7Asn Xaa Xaa 1 8948PRTArtificial Sequencesynthetic ZC-701 construct 8Ala Ala Leu Cys Gly Gly Glu Leu Val Asp Thr Leu Gln Phe Val Cys 1 5 10 15 Gly Asp Arg Gly Phe Tyr Phe Ser Arg Pro Ala Ser Arg Val Ser Arg 20 25 30 Arg Ser Arg Gly Ile Val Glu Glu Cys Cys Phe Arg Ser Cys Asp Leu 35 40 45 Ala Leu Leu Glu Thr Tyr Cys Ala Thr Pro Ala Lys Ser Glu Gly Ala 50 55 60 Pro Ala His Pro Gly Arg Pro Arg Ala Val Pro Thr Gln Cys Asp Val 65 70 75 80 Pro Pro Asn Ser Arg Phe Asp Cys Ala Pro Asp Lys Ala Ile Thr Gln 85 90 95 Glu Gln Cys Glu Ala Arg Gly Cys Cys Tyr Ile Pro Ala Lys Gln Gly 100 105 110 Leu Gln Gly Ala Gln Met Gly Gln Pro Trp Cys Phe Phe Pro Pro Ser 115 120 125 Tyr Pro Ser Tyr Lys Leu Glu Asn Leu Ser Ser Ser Glu Met Gly Tyr 130 135 140 Thr Ala Thr Leu Thr Arg Thr Thr Pro Thr Phe Phe Pro Lys Asp Ile 145 150 155 160 Leu Thr Leu Arg Leu Asp Val Met Met Glu Thr Glu Asn Arg Leu His 165 170 175 Phe Thr Ile Lys Asp Pro Ala Asn Arg Arg Tyr Glu Val Pro Leu Glu 180 185 190 Thr Pro Arg Val His Ser Arg Ala Pro Ser Pro Leu Tyr Ser Val Glu 195 200 205 Phe Ser Glu Glu Pro Phe Gly Val Ile Val His Arg Gln Leu Asp Gly 210 215 220 Arg Val Leu Leu Asn Thr Thr Val Ala Pro Leu Phe Phe Ala Asp Gln 225 230 235 240 Phe Leu Gln Leu Ser Thr Ser Leu Pro Ser Gln Tyr Ile Thr Gly Leu 245 250 255 Ala Glu His Leu Ser Pro Leu Met Leu Ser Thr Ser Trp Thr Arg Ile 260 265 270 Thr Leu Trp Asn Arg Asp Leu Ala Pro Thr Pro Gly Ala Asn Leu Tyr 275 280 285 Gly Ser His Pro Phe Tyr Leu Ala Leu Glu Asp Gly Gly Ser Ala His 290 295 300 Gly Val Phe Leu Leu Asn Ser Asn Ala Met Asp Val Val Leu Gln Pro 305 310 315 320 Ser Pro Ala Leu Ser Trp Arg Ser Thr Gly Gly Ile Leu Asp Val Tyr 325 330 335 Ile Phe Leu Gly Pro Glu Pro Lys Ser Val Val Gln Gln Tyr Leu Asp 340 345 350 Val Val Gly Tyr Pro Phe Met Pro Pro Tyr Trp Gly Leu Gly Phe His 355 360 365 Leu Cys Arg Trp Gly Tyr Ser Ser Thr Ala Ile Thr Arg Gln Val Val 370 375 380 Glu Asn Met Thr Arg Ala His Phe Pro Leu Asp Val Gln Trp Asn Asp 385 390 395 400 Leu Asp Tyr Met Asp Ser Arg Arg Asp Phe Thr Phe Asn Lys Asp Gly 405 410 415 Phe Arg Asp Phe Pro Ala Met Val Gln Glu Leu His Gln Gly Gly Arg 420 425 430 Arg Tyr Met Met Ile Val Asp Pro Ala Ile Ser Ser Ser Gly Pro Ala 435 440 445 Gly Ser Tyr Arg Pro Tyr Asp Glu Gly Leu Arg Arg Gly Val Phe Ile 450 455 460 Thr Asn Glu Thr Gly Gln Pro Leu Ile Gly Lys Val Trp Pro Gly Ser 465 470 475 480 Thr Ala Phe Pro Asp Phe Thr Asn Pro Thr Ala Leu Ala Trp Trp Glu 485 490 495 Asp Met Val Ala Glu Phe His Asp Gln Val Pro Phe Asp Gly Met Trp 500 505 510 Ile Asp Met Asn Glu Pro Ser Asn Phe Ile Arg Gly Ser Glu Asp Gly 515 520 525 Cys Pro Asn Asn Glu Leu Glu Asn Pro Pro Tyr Val Pro Gly Val Val 530 535 540 Gly Gly Thr Leu Gln Ala Ala Thr Ile Cys Ala Ser Ser His Gln Phe 545 550 555 560 Leu Ser Thr His Tyr Asn Leu His Asn Leu Tyr Gly Leu Thr Glu Ala 565 570 575 Ile Ala Ser His Arg Ala Leu Val Lys Ala Arg Gly Thr Arg Pro Phe 580 585 590 Val Ile Ser Arg Ser Thr Phe Ala Gly His Gly Arg Tyr Ala Gly His 595 600 605 Trp Thr Gly Asp Val Trp Ser Ser Trp Glu Gln Leu Ala Ser Ser Val 610 615 620 Pro Glu Ile Leu Gln Phe Asn Leu Leu Gly Val Pro Leu Val Gly Ala 625 630 635 640 Asp Val Cys Gly Phe Leu Gly Asn Thr Ser Glu Glu Leu Cys Val Arg 645 650 655 Trp Thr Gln Leu Gly Ala Phe Tyr Pro Phe Met Arg Asn His Asn Ser 660 665 670 Leu Leu Ser Leu Pro Gln Glu Pro Tyr Ser Phe Ser Glu Pro Ala Gln 675 680 685 Gln Ala Met Arg Lys Ala Leu Thr Leu Arg Tyr Ala Leu Leu Pro His 690 695 700 Leu Tyr Thr Leu Phe His Gln Ala His Val Ala Gly Glu Thr Val Ala 705 710 715 720 Arg Pro Leu Phe Leu Glu Phe Pro Lys Asp Ser Ser Thr Trp Thr Val 725 730 735 Asp His Gln Leu Leu Trp Gly Glu Ala Leu Leu Ile Thr Pro Val Leu 740 745 750 Gln Ala Gly Lys Ala Glu Val Thr Gly Tyr Phe Pro Leu Gly Thr Trp 755 760 765 Tyr Asp Leu Gln Thr Val Pro Ile Glu Ala Leu Gly Ser Leu Pro Pro 770 775 780 Pro Pro Ala Ala Pro Arg Glu Pro Ala Ile His Ser Glu Gly Gln Trp 785 790 795 800 Val Thr Leu Pro Ala Pro Leu Asp Thr Ile Asn Val His Leu Arg Ala 805 810 815 Gly Tyr Ile Ile Pro Leu Gln Gly Pro Gly Leu Thr Thr Thr Glu Ser 820 825 830 Arg Gln Gln Pro Met Ala Leu Ala Val Ala Leu Thr Lys Gly Gly Glu 835 840 845 Ala Arg Gly Glu Leu Phe Trp Asp Asp Gly Glu Ser Leu Glu Val Leu 850 855 860 Glu Arg Gly Ala Tyr Thr Gln Val Ile Phe Leu Ala Arg Asn Asn Thr 865 870 875 880 Ile Val Asn Glu Leu Val Arg Val Thr Ser Glu Gly Ala Gly Leu Gln 885 890 895 Leu Gln Lys Val Thr Val Leu Gly Val Ala Thr Ala Pro Gln Gln Val 900 905 910 Leu Ser Asn Gly Val Pro Val Ser Asn Phe Thr Tyr Ser Pro Asp Thr 915 920 925 Lys Val Leu Asp Ile Cys Val Ser Leu Leu Met Gly Glu Gln Phe Leu 930 935 940 Val Ser Trp Cys 945 94PRTArtificial Sequencesequence proximal to ZC-701 cleavage site 9Arg Arg Ser Arg 1 104PRTArtificial SequenceFurin protease recognition sequence 10Arg Xaa Xaa Arg 1 112970DNAArtificial SequenceGILTd2-7-GAA70-952 cassette 11ggtaccagct gctagcaagc taattcacac caatgggaat cccaatgggg aagtcgatgc 60tggtgcttct caccttcttg gccttcgcct cgtgctgcat tgctgctctg tgcggcgggg 120agctggtgga caccctccag ttcgtctgtg gggaccgcgg cttctacttc agcaggcccg 180caagccgtgt gagccgtcgc agccgtggca tcgttgagga gtgctgtttc cgcagctgtg 240acctggccct cctggagacg tactgtgcta cccccgccaa gtccgagggc gcgccggcac 300accccggccg tcccagagca gtgcccacac agtgcgacgt cccccccaac agccgcttcg 360attgcgcccc tgacaaggcc atcacccagg aacagtgcga ggcccgcggc tgctgctaca 420tccctgcaaa gcaggggctg cagggagccc agatggggca gccctggtgc ttcttcccac 480ccagctaccc cagctacaag ctggagaacc tgagctcctc tgaaatgggc tacacggcca 540ccctgacccg taccaccccc accttcttcc ccaaggacat cctgaccctg cggctggacg 600tgatgatgga gactgagaac cgcctccact tcacgatcaa agatccagct aacaggcgct 660acgaggtgcc cttggagacc ccgcgtgtcc acagccgggc accgtcccca ctctacagcg 720tggagttctc tgaggagccc ttcggggtga tcgtgcaccg gcagctggac ggccgcgtgc 780tgctgaacac gacggtggcg cccctgttct ttgcggacca gttccttcag ctgtccacct 840cgctgccctc gcagtatatc acaggcctcg ccgagcacct cagtcccctg atgctcagca 900ccagctggac caggatcacc ctgtggaacc gggaccttgc gcccacgccc ggtgcgaacc 960tctacgggtc tcaccctttc tacctggcgc tggaggacgg cgggtcggca cacggggtgt 1020tcctgctaaa cagcaatgcc atggatgtgg tcctgcagcc gagccctgcc cttagctgga 1080ggtcgacagg tgggatcctg gatgtctaca tcttcctggg cccagagccc aagagcgtgg 1140tgcagcagta cctggacgtt gtgggatacc cgttcatgcc gccatactgg ggcctgggct 1200tccacctgtg ccgctggggc tactcctcca ccgctatcac ccgccaggtg gtggagaaca 1260tgaccagggc ccacttcccc ctggacgtcc aatggaacga cctggactac atggactccc 1320ggagggactt cacgttcaac aaggatggct tccgggactt cccggccatg gtgcaggagc 1380tgcaccaggg cggccggcgc tacatgatga tcgtggatcc tgccatcagc agctcgggcc 1440ctgccgggag ctacaggccc tacgacgagg gtctgcggag gggggttttc atcaccaacg 1500agaccggcca gccgctgatt gggaaggtat ggcccgggtc cactgccttc cccgacttca 1560ccaaccccac agccctggcc tggtgggagg acatggtggc tgagttccat gaccaggtgc 1620ccttcgacgg catgtggatt gacatgaacg agccttccaa cttcatcagg ggctctgagg 1680acggctgccc caacaatgag ctggagaacc caccctacgt gcctggggtg gttgggggga 1740ccctccaggc ggcaaccatc tgtgcctcca gccaccagtt tctctccaca cactacaacc 1800tgcacaacct ctacggcctg accgaagcca tcgcctccca cagggcgctg gtgaaggctc 1860gggggacacg cccatttgtg atctcccgct cgacctttgc tggccacggc cgatacgccg 1920gccactggac gggggacgtg tggagctcct gggagcagct cgcctcctcc gtgccagaaa 1980tcctgcagtt taacctgctg ggggtgcctc tggtcggggc cgacgtctgc ggcttcctgg 2040gcaacacctc agaggagctg tgtgtgcgct ggacccagct gggggccttc taccccttca 2100tgcggaacca caacagcctg ctcagtctgc cccaggagcc gtacagcttc agcgagccgg 2160cccagcaggc catgaggaag gccctcaccc tgcgctacgc actcctcccc cacctctaca 2220cgctgttcca ccaggcccac gtcgcggggg agaccgtggc ccggcccctc ttcctggagt 2280tccccaagga ctctagcacc tggactgtgg accaccagct cctgtggggg gaggccctgc 2340tcatcacccc agtgctccag gccgggaagg ccgaagtgac tggctacttc cccttgggca 2400catggtacga cctgcagacg gtgccaatag aggcccttgg cagcctccca cccccacctg 2460cagctccccg tgagccagcc atccacagcg aggggcagtg ggtgacgctg ccggcccccc 2520tggacaccat caacgtccac ctccgggctg ggtacatcat ccccctgcag ggccctggcc 2580tcacaaccac agagtcccgc cagcagccca tggccctggc tgtggccctg accaagggtg 2640gagaggcccg aggggagctg ttctgggacg atggagagag cctggaagtg ctggagcgag 2700gggcctacac acaggtcatc ttcctggcca ggaataacac gatcgtgaat gagctggtac 2760gtgtgaccag tgagggagct ggcctgcagc tgcagaaggt gactgtcctg ggcgtggcca 2820cggcgcccca gcaggtcctc tccaacggtg tccctgtctc caacttcacc tacagccccg 2880acaccaaggt cctggacatc tgtgtctcgc tgttgatggg agagcagttt ctcgtcagct 2940ggtgttagtc tagagcttgc tagcggccgc 2970122970DNAArtificial SequenceGILTd2-7/K37-GAA70-952 cassette 12ggtaccagct gctagcaagc taattcacac caatgggaat cccaatgggg aagtcgatgc 60tggtgcttct caccttcttg gccttcgcct cgtgctgcat tgctgctctg tgcggcgggg 120agctggtgga caccctccag ttcgtctgtg gggaccgcgg cttctacttc agcaggcccg 180caagccgtgt gagcaagcgc agccgtggca tcgttgagga gtgctgtttc cgcagctgtg 240acctggccct cctggagacg tactgtgcta cccccgccaa gtccgagggc gcgccggcac 300accccggccg tcccagagca gtgcccacac agtgcgacgt cccccccaac agccgcttcg 360attgcgcccc tgacaaggcc atcacccagg aacagtgcga ggcccgcggc tgctgctaca 420tccctgcaaa gcaggggctg cagggagccc agatggggca gccctggtgc ttcttcccac 480ccagctaccc cagctacaag ctggagaacc tgagctcctc tgaaatgggc tacacggcca 540ccctgacccg taccaccccc accttcttcc ccaaggacat cctgaccctg cggctggacg 600tgatgatgga gactgagaac cgcctccact tcacgatcaa agatccagct aacaggcgct 660acgaggtgcc cttggagacc ccgcgtgtcc acagccgggc accgtcccca ctctacagcg 720tggagttctc tgaggagccc ttcggggtga tcgtgcaccg gcagctggac ggccgcgtgc 780tgctgaacac gacggtggcg cccctgttct ttgcggacca gttccttcag ctgtccacct 840cgctgccctc gcagtatatc acaggcctcg ccgagcacct cagtcccctg atgctcagca 900ccagctggac caggatcacc ctgtggaacc gggaccttgc gcccacgccc ggtgcgaacc 960tctacgggtc tcaccctttc tacctggcgc tggaggacgg cgggtcggca cacggggtgt 1020tcctgctaaa cagcaatgcc atggatgtgg tcctgcagcc gagccctgcc cttagctgga 1080ggtcgacagg tgggatcctg gatgtctaca tcttcctggg cccagagccc aagagcgtgg 1140tgcagcagta cctggacgtt gtgggatacc cgttcatgcc gccatactgg ggcctgggct 1200tccacctgtg ccgctggggc tactcctcca ccgctatcac ccgccaggtg gtggagaaca 1260tgaccagggc ccacttcccc ctggacgtcc aatggaacga cctggactac atggactccc 1320ggagggactt cacgttcaac aaggatggct tccgggactt cccggccatg gtgcaggagc 1380tgcaccaggg cggccggcgc tacatgatga tcgtggatcc tgccatcagc agctcgggcc 1440ctgccgggag ctacaggccc tacgacgagg gtctgcggag gggggttttc atcaccaacg 1500agaccggcca gccgctgatt gggaaggtat ggcccgggtc cactgccttc cccgacttca 1560ccaaccccac agccctggcc tggtgggagg acatggtggc tgagttccat gaccaggtgc 1620ccttcgacgg catgtggatt gacatgaacg agccttccaa cttcatcagg ggctctgagg 1680acggctgccc caacaatgag ctggagaacc caccctacgt gcctggggtg gttgggggga 1740ccctccaggc ggcaaccatc tgtgcctcca gccaccagtt tctctccaca cactacaacc 1800tgcacaacct ctacggcctg accgaagcca tcgcctccca cagggcgctg gtgaaggctc 1860gggggacacg cccatttgtg atctcccgct cgacctttgc tggccacggc cgatacgccg 1920gccactggac gggggacgtg tggagctcct gggagcagct cgcctcctcc gtgccagaaa 1980tcctgcagtt taacctgctg ggggtgcctc tggtcggggc cgacgtctgc ggcttcctgg 2040gcaacacctc agaggagctg tgtgtgcgct ggacccagct gggggccttc taccccttca 2100tgcggaacca caacagcctg ctcagtctgc cccaggagcc gtacagcttc agcgagccgg 2160cccagcaggc catgaggaag gccctcaccc tgcgctacgc actcctcccc cacctctaca 2220cgctgttcca ccaggcccac gtcgcggggg agaccgtggc ccggcccctc ttcctggagt 2280tccccaagga ctctagcacc tggactgtgg accaccagct cctgtggggg gaggccctgc 2340tcatcacccc agtgctccag gccgggaagg ccgaagtgac tggctacttc cccttgggca 2400catggtacga cctgcagacg gtgccaatag aggcccttgg cagcctccca cccccacctg 2460cagctccccg tgagccagcc atccacagcg aggggcagtg ggtgacgctg ccggcccccc 2520tggacaccat caacgtccac ctccgggctg ggtacatcat ccccctgcag ggccctggcc 2580tcacaaccac agagtcccgc cagcagccca tggccctggc tgtggccctg accaagggtg 2640gagaggcccg aggggagctg ttctgggacg atggagagag cctggaagtg ctggagcgag 2700gggcctacac acaggtcatc ttcctggcca ggaataacac gatcgtgaat gagctggtac 2760gtgtgaccag tgagggagct ggcctgcagc tgcagaaggt gactgtcctg ggcgtggcca 2820cggcgcccca gcaggtcctc tccaacggtg tccctgtctc caacttcacc tacagccccg 2880acaccaaggt cctggacatc tgtgtctcgc tgttgatggg agagcagttt ctcgtcagct 2940ggtgttagtc tagagcttgc tagcggccgc 2970132970DNAArtificial SequenceGILTd2-7/K40-GAA70-952 cassette 13ggtaccagct gctagcaagc taattcacac caatgggaat cccaatgggg aagtcgatgc 60tggtgcttct caccttcttg gccttcgcct cgtgctgcat tgctgctctg tgcggcgggg 120agctggtgga caccctccag ttcgtctgtg gggaccgcgg cttctacttc agcaggcccg 180caagccgtgt gagccgtcgc agcaagggca tcgttgagga gtgctgtttc cgcagctgtg 240acctggccct cctggagacg tactgtgcta cccccgccaa gtccgagggc gcgccggcac 300accccggccg tcccagagca gtgcccacac agtgcgacgt cccccccaac agccgcttcg 360attgcgcccc tgacaaggcc atcacccagg aacagtgcga ggcccgcggc tgctgctaca 420tccctgcaaa gcaggggctg cagggagccc agatggggca gccctggtgc ttcttcccac 480ccagctaccc cagctacaag ctggagaacc tgagctcctc tgaaatgggc tacacggcca 540ccctgacccg taccaccccc accttcttcc ccaaggacat cctgaccctg cggctggacg 600tgatgatgga gactgagaac cgcctccact tcacgatcaa agatccagct aacaggcgct 660acgaggtgcc cttggagacc ccgcgtgtcc acagccgggc accgtcccca ctctacagcg 720tggagttctc tgaggagccc ttcggggtga tcgtgcaccg gcagctggac ggccgcgtgc 780tgctgaacac gacggtggcg cccctgttct ttgcggacca gttccttcag ctgtccacct 840cgctgccctc gcagtatatc acaggcctcg ccgagcacct cagtcccctg atgctcagca 900ccagctggac caggatcacc ctgtggaacc gggaccttgc gcccacgccc ggtgcgaacc 960tctacgggtc tcaccctttc tacctggcgc tggaggacgg cgggtcggca cacggggtgt 1020tcctgctaaa cagcaatgcc atggatgtgg tcctgcagcc gagccctgcc cttagctgga 1080ggtcgacagg tgggatcctg gatgtctaca tcttcctggg cccagagccc aagagcgtgg 1140tgcagcagta cctggacgtt gtgggatacc cgttcatgcc gccatactgg ggcctgggct 1200tccacctgtg ccgctggggc tactcctcca ccgctatcac ccgccaggtg gtggagaaca 1260tgaccagggc ccacttcccc ctggacgtcc aatggaacga cctggactac atggactccc 1320ggagggactt cacgttcaac aaggatggct tccgggactt cccggccatg gtgcaggagc 1380tgcaccaggg cggccggcgc tacatgatga tcgtggatcc tgccatcagc agctcgggcc 1440ctgccgggag ctacaggccc tacgacgagg gtctgcggag gggggttttc atcaccaacg 1500agaccggcca gccgctgatt

gggaaggtat ggcccgggtc cactgccttc cccgacttca 1560ccaaccccac agccctggcc tggtgggagg acatggtggc tgagttccat gaccaggtgc 1620ccttcgacgg catgtggatt gacatgaacg agccttccaa cttcatcagg ggctctgagg 1680acggctgccc caacaatgag ctggagaacc caccctacgt gcctggggtg gttgggggga 1740ccctccaggc ggcaaccatc tgtgcctcca gccaccagtt tctctccaca cactacaacc 1800tgcacaacct ctacggcctg accgaagcca tcgcctccca cagggcgctg gtgaaggctc 1860gggggacacg cccatttgtg atctcccgct cgacctttgc tggccacggc cgatacgccg 1920gccactggac gggggacgtg tggagctcct gggagcagct cgcctcctcc gtgccagaaa 1980tcctgcagtt taacctgctg ggggtgcctc tggtcggggc cgacgtctgc ggcttcctgg 2040gcaacacctc agaggagctg tgtgtgcgct ggacccagct gggggccttc taccccttca 2100tgcggaacca caacagcctg ctcagtctgc cccaggagcc gtacagcttc agcgagccgg 2160cccagcaggc catgaggaag gccctcaccc tgcgctacgc actcctcccc cacctctaca 2220cgctgttcca ccaggcccac gtcgcggggg agaccgtggc ccggcccctc ttcctggagt 2280tccccaagga ctctagcacc tggactgtgg accaccagct cctgtggggg gaggccctgc 2340tcatcacccc agtgctccag gccgggaagg ccgaagtgac tggctacttc cccttgggca 2400catggtacga cctgcagacg gtgccaatag aggcccttgg cagcctccca cccccacctg 2460cagctccccg tgagccagcc atccacagcg aggggcagtg ggtgacgctg ccggcccccc 2520tggacaccat caacgtccac ctccgggctg ggtacatcat ccccctgcag ggccctggcc 2580tcacaaccac agagtcccgc cagcagccca tggccctggc tgtggccctg accaagggtg 2640gagaggcccg aggggagctg ttctgggacg atggagagag cctggaagtg ctggagcgag 2700gggcctacac acaggtcatc ttcctggcca ggaataacac gatcgtgaat gagctggtac 2760gtgtgaccag tgagggagct ggcctgcagc tgcagaaggt gactgtcctg ggcgtggcca 2820cggcgcccca gcaggtcctc tccaacggtg tccctgtctc caacttcacc tacagccccg 2880acaccaaggt cctggacatc tgtgtctcgc tgttgatggg agagcagttt ctcgtcagct 2940ggtgttagtc tagagcttgc tagcggccgc 2970142970DNAArtificial SequenceGILTd2-7/A37-GAA70-952 cassette 14ggtaccagct gctagcaagc taattcacac caatgggaat cccaatgggg aagtcgatgc 60tggtgcttct caccttcttg gccttcgcct cgtgctgcat tgctgctctg tgcggcgggg 120agctggtgga caccctccag ttcgtctgtg gggaccgcgg cttctacttc agcaggcccg 180caagccgtgt gagcgctcgc agccgtggca tcgttgagga gtgctgtttc cgcagctgtg 240acctggccct cctggagacg tactgtgcta cccccgccaa gtccgagggc gcgccggcac 300accccggccg tcccagagca gtgcccacac agtgcgacgt cccccccaac agccgcttcg 360attgcgcccc tgacaaggcc atcacccagg aacagtgcga ggcccgcggc tgctgctaca 420tccctgcaaa gcaggggctg cagggagccc agatggggca gccctggtgc ttcttcccac 480ccagctaccc cagctacaag ctggagaacc tgagctcctc tgaaatgggc tacacggcca 540ccctgacccg taccaccccc accttcttcc ccaaggacat cctgaccctg cggctggacg 600tgatgatgga gactgagaac cgcctccact tcacgatcaa agatccagct aacaggcgct 660acgaggtgcc cttggagacc ccgcgtgtcc acagccgggc accgtcccca ctctacagcg 720tggagttctc tgaggagccc ttcggggtga tcgtgcaccg gcagctggac ggccgcgtgc 780tgctgaacac gacggtggcg cccctgttct ttgcggacca gttccttcag ctgtccacct 840cgctgccctc gcagtatatc acaggcctcg ccgagcacct cagtcccctg atgctcagca 900ccagctggac caggatcacc ctgtggaacc gggaccttgc gcccacgccc ggtgcgaacc 960tctacgggtc tcaccctttc tacctggcgc tggaggacgg cgggtcggca cacggggtgt 1020tcctgctaaa cagcaatgcc atggatgtgg tcctgcagcc gagccctgcc cttagctgga 1080ggtcgacagg tgggatcctg gatgtctaca tcttcctggg cccagagccc aagagcgtgg 1140tgcagcagta cctggacgtt gtgggatacc cgttcatgcc gccatactgg ggcctgggct 1200tccacctgtg ccgctggggc tactcctcca ccgctatcac ccgccaggtg gtggagaaca 1260tgaccagggc ccacttcccc ctggacgtcc aatggaacga cctggactac atggactccc 1320ggagggactt cacgttcaac aaggatggct tccgggactt cccggccatg gtgcaggagc 1380tgcaccaggg cggccggcgc tacatgatga tcgtggatcc tgccatcagc agctcgggcc 1440ctgccgggag ctacaggccc tacgacgagg gtctgcggag gggggttttc atcaccaacg 1500agaccggcca gccgctgatt gggaaggtat ggcccgggtc cactgccttc cccgacttca 1560ccaaccccac agccctggcc tggtgggagg acatggtggc tgagttccat gaccaggtgc 1620ccttcgacgg catgtggatt gacatgaacg agccttccaa cttcatcagg ggctctgagg 1680acggctgccc caacaatgag ctggagaacc caccctacgt gcctggggtg gttgggggga 1740ccctccaggc ggcaaccatc tgtgcctcca gccaccagtt tctctccaca cactacaacc 1800tgcacaacct ctacggcctg accgaagcca tcgcctccca cagggcgctg gtgaaggctc 1860gggggacacg cccatttgtg atctcccgct cgacctttgc tggccacggc cgatacgccg 1920gccactggac gggggacgtg tggagctcct gggagcagct cgcctcctcc gtgccagaaa 1980tcctgcagtt taacctgctg ggggtgcctc tggtcggggc cgacgtctgc ggcttcctgg 2040gcaacacctc agaggagctg tgtgtgcgct ggacccagct gggggccttc taccccttca 2100tgcggaacca caacagcctg ctcagtctgc cccaggagcc gtacagcttc agcgagccgg 2160cccagcaggc catgaggaag gccctcaccc tgcgctacgc actcctcccc cacctctaca 2220cgctgttcca ccaggcccac gtcgcggggg agaccgtggc ccggcccctc ttcctggagt 2280tccccaagga ctctagcacc tggactgtgg accaccagct cctgtggggg gaggccctgc 2340tcatcacccc agtgctccag gccgggaagg ccgaagtgac tggctacttc cccttgggca 2400catggtacga cctgcagacg gtgccaatag aggcccttgg cagcctccca cccccacctg 2460cagctccccg tgagccagcc atccacagcg aggggcagtg ggtgacgctg ccggcccccc 2520tggacaccat caacgtccac ctccgggctg ggtacatcat ccccctgcag ggccctggcc 2580tcacaaccac agagtcccgc cagcagccca tggccctggc tgtggccctg accaagggtg 2640gagaggcccg aggggagctg ttctgggacg atggagagag cctggaagtg ctggagcgag 2700gggcctacac acaggtcatc ttcctggcca ggaataacac gatcgtgaat gagctggtac 2760gtgtgaccag tgagggagct ggcctgcagc tgcagaaggt gactgtcctg ggcgtggcca 2820cggcgcccca gcaggtcctc tccaacggtg tccctgtctc caacttcacc tacagccccg 2880acaccaaggt cctggacatc tgtgtctcgc tgttgatggg agagcagttt ctcgtcagct 2940ggtgttagtc tagagcttgc tagcggccgc 2970152970DNAArtificial SequenceGILTd2-7/A40-GAA70-952 cassette 15ggtaccagct gctagcaagc taattcacac caatgggaat cccaatgggg aagtcgatgc 60tggtgcttct caccttcttg gccttcgcct cgtgctgcat tgctgctctg tgcggcgggg 120agctggtgga caccctccag ttcgtctgtg gggaccgcgg cttctacttc agcaggcccg 180caagccgtgt gagccgtcgc agcgctggca tcgttgagga gtgctgtttc cgcagctgtg 240acctggccct cctggagacg tactgtgcta cccccgccaa gtccgagggc gcgccggcac 300accccggccg tcccagagca gtgcccacac agtgcgacgt cccccccaac agccgcttcg 360attgcgcccc tgacaaggcc atcacccagg aacagtgcga ggcccgcggc tgctgctaca 420tccctgcaaa gcaggggctg cagggagccc agatggggca gccctggtgc ttcttcccac 480ccagctaccc cagctacaag ctggagaacc tgagctcctc tgaaatgggc tacacggcca 540ccctgacccg taccaccccc accttcttcc ccaaggacat cctgaccctg cggctggacg 600tgatgatgga gactgagaac cgcctccact tcacgatcaa agatccagct aacaggcgct 660acgaggtgcc cttggagacc ccgcgtgtcc acagccgggc accgtcccca ctctacagcg 720tggagttctc tgaggagccc ttcggggtga tcgtgcaccg gcagctggac ggccgcgtgc 780tgctgaacac gacggtggcg cccctgttct ttgcggacca gttccttcag ctgtccacct 840cgctgccctc gcagtatatc acaggcctcg ccgagcacct cagtcccctg atgctcagca 900ccagctggac caggatcacc ctgtggaacc gggaccttgc gcccacgccc ggtgcgaacc 960tctacgggtc tcaccctttc tacctggcgc tggaggacgg cgggtcggca cacggggtgt 1020tcctgctaaa cagcaatgcc atggatgtgg tcctgcagcc gagccctgcc cttagctgga 1080ggtcgacagg tgggatcctg gatgtctaca tcttcctggg cccagagccc aagagcgtgg 1140tgcagcagta cctggacgtt gtgggatacc cgttcatgcc gccatactgg ggcctgggct 1200tccacctgtg ccgctggggc tactcctcca ccgctatcac ccgccaggtg gtggagaaca 1260tgaccagggc ccacttcccc ctggacgtcc aatggaacga cctggactac atggactccc 1320ggagggactt cacgttcaac aaggatggct tccgggactt cccggccatg gtgcaggagc 1380tgcaccaggg cggccggcgc tacatgatga tcgtggatcc tgccatcagc agctcgggcc 1440ctgccgggag ctacaggccc tacgacgagg gtctgcggag gggggttttc atcaccaacg 1500agaccggcca gccgctgatt gggaaggtat ggcccgggtc cactgccttc cccgacttca 1560ccaaccccac agccctggcc tggtgggagg acatggtggc tgagttccat gaccaggtgc 1620ccttcgacgg catgtggatt gacatgaacg agccttccaa cttcatcagg ggctctgagg 1680acggctgccc caacaatgag ctggagaacc caccctacgt gcctggggtg gttgggggga 1740ccctccaggc ggcaaccatc tgtgcctcca gccaccagtt tctctccaca cactacaacc 1800tgcacaacct ctacggcctg accgaagcca tcgcctccca cagggcgctg gtgaaggctc 1860gggggacacg cccatttgtg atctcccgct cgacctttgc tggccacggc cgatacgccg 1920gccactggac gggggacgtg tggagctcct gggagcagct cgcctcctcc gtgccagaaa 1980tcctgcagtt taacctgctg ggggtgcctc tggtcggggc cgacgtctgc ggcttcctgg 2040gcaacacctc agaggagctg tgtgtgcgct ggacccagct gggggccttc taccccttca 2100tgcggaacca caacagcctg ctcagtctgc cccaggagcc gtacagcttc agcgagccgg 2160cccagcaggc catgaggaag gccctcaccc tgcgctacgc actcctcccc cacctctaca 2220cgctgttcca ccaggcccac gtcgcggggg agaccgtggc ccggcccctc ttcctggagt 2280tccccaagga ctctagcacc tggactgtgg accaccagct cctgtggggg gaggccctgc 2340tcatcacccc agtgctccag gccgggaagg ccgaagtgac tggctacttc cccttgggca 2400catggtacga cctgcagacg gtgccaatag aggcccttgg cagcctccca cccccacctg 2460cagctccccg tgagccagcc atccacagcg aggggcagtg ggtgacgctg ccggcccccc 2520tggacaccat caacgtccac ctccgggctg ggtacatcat ccccctgcag ggccctggcc 2580tcacaaccac agagtcccgc cagcagccca tggccctggc tgtggccctg accaagggtg 2640gagaggcccg aggggagctg ttctgggacg atggagagag cctggaagtg ctggagcgag 2700gggcctacac acaggtcatc ttcctggcca ggaataacac gatcgtgaat gagctggtac 2760gtgtgaccag tgagggagct ggcctgcagc tgcagaaggt gactgtcctg ggcgtggcca 2820cggcgcccca gcaggtcctc tccaacggtg tccctgtctc caacttcacc tacagccccg 2880acaccaaggt cctggacatc tgtgtctcgc tgttgatggg agagcagttt ctcgtcagct 2940ggtgttagtc tagagcttgc tagcggccgc 2970162953DNAArtificial SequenceGILTd2-7M1/K37-GAA70-952 cassette 16ggtaccaagc ttgccatggg aatcccaatg ggcaagtcga tgctggtgct gctcaccttc 60ttggcctttg cctcgtgctg cattgccgct ctgtgcggcg gggaactggt ggacaccctc 120caattcgtct gtggggaccg gggcttctac ttcagcagac ccgcaagccg tgtgagtaag 180cgcagccgtg gcattgttga ggagtgctgt tttcgcagct gtgacctggc tctcctggag 240acgtactgcg ctacccccgc caagtctgag ggcgcgccgg cacaccccgg ccgtcccaga 300gcagtgccca cacagtgcga cgtccccccc aacagccgct tcgattgcgc ccctgacaag 360gccatcaccc aggaacagtg cgaggcccgc ggctgctgct acatccctgc aaagcagggg 420ctgcagggag cccagatggg gcagccctgg tgcttcttcc cacccagcta ccccagctac 480aagctggaga acctgagctc ctctgaaatg ggctacacgg ccaccctgac ccgtaccacc 540cccaccttct tccccaagga catcctgacc ctgcggctgg acgtgatgat ggagactgag 600aaccgcctcc acttcacgat caaagatcca gctaacaggc gctacgaggt gcccttggag 660accccgcgtg tccacagccg ggcaccgtcc ccactctaca gcgtggagtt ctctgaggag 720cccttcgggg tgatcgtgca ccggcagctg gacggccgcg tgctgctgaa cacgacggtg 780gcgcccctgt tctttgcgga ccagttcctt cagctgtcca cctcgctgcc ctcgcagtat 840atcacaggcc tcgccgagca cctcagtccc ctgatgctca gcaccagctg gaccaggatc 900accctgtgga accgggacct tgcgcccacg cccggtgcga acctctacgg gtctcaccct 960ttctacctgg cgctggagga cggcgggtcg gcacacgggg tgttcctgct aaacagcaat 1020gccatggatg tggtcctgca gccgagccct gcccttagct ggaggtcgac aggtgggatc 1080ctggatgtct acatcttcct gggcccagag cccaagagcg tggtgcagca gtacctggac 1140gttgtgggat acccgttcat gccgccatac tggggcctgg gcttccacct gtgccgctgg 1200ggctactcct ccaccgctat cacccgccag gtggtggaga acatgaccag ggcccacttc 1260cccctggacg tccaatggaa cgacctggac tacatggact cccggaggga cttcacgttc 1320aacaaggatg gcttccggga cttcccggcc atggtgcagg agctgcacca gggcggccgg 1380cgctacatga tgatcgtgga tcctgccatc agcagctcgg gccctgccgg gagctacagg 1440ccctacgacg agggtctgcg gaggggggtt ttcatcacca acgagaccgg ccagccgctg 1500attgggaagg tatggcccgg gtccactgcc ttccccgact tcaccaaccc cacagccctg 1560gcctggtggg aggacatggt ggctgagttc catgaccagg tgcccttcga cggcatgtgg 1620attgacatga acgagccttc caacttcatc aggggctctg aggacggctg ccccaacaat 1680gagctggaga acccacccta cgtgcctggg gtggttgggg ggaccctcca ggcggcaacc 1740atctgtgcct ccagccacca gtttctctcc acacactaca acctgcacaa cctctacggc 1800ctgaccgaag ccatcgcctc ccacagggcg ctggtgaagg ctcgggggac acgcccattt 1860gtgatctccc gctcgacctt tgctggccac ggccgatacg ccggccactg gacgggggac 1920gtgtggagct cctgggagca gctcgcctcc tccgtgccag aaatcctgca gtttaacctg 1980ctgggggtgc ctctggtcgg ggccgacgtc tgcggcttcc tgggcaacac ctcagaggag 2040ctgtgtgtgc gctggaccca gctgggggcc ttctacccct tcatgcggaa ccacaacagc 2100ctgctcagtc tgccccagga gccgtacagc ttcagcgagc cggcccagca ggccatgagg 2160aaggccctca ccctgcgcta cgcactcctc ccccacctct acacgctgtt ccaccaggcc 2220cacgtcgcgg gggagaccgt ggcccggccc ctcttcctgg agttccccaa ggactctagc 2280acctggactg tggaccacca gctcctgtgg ggggaggccc tgctcatcac cccagtgctc 2340caggccggga aggccgaagt gactggctac ttccccttgg gcacatggta cgacctgcag 2400acggtgccaa tagaggccct tggcagcctc ccacccccac ctgcagctcc ccgtgagcca 2460gccatccaca gcgaggggca gtgggtgacg ctgccggccc ccctggacac catcaacgtc 2520cacctccggg ctgggtacat catccccctg cagggccctg gcctcacaac cacagagtcc 2580cgccagcagc ccatggccct ggctgtggcc ctgaccaagg gtggagaggc ccgaggggag 2640ctgttctggg acgatggaga gagcctggaa gtgctggagc gaggggccta cacacaggtc 2700atcttcctgg ccaggaataa cacgatcgtg aatgagctgg tacgtgtgac cagtgaggga 2760gctggcctgc agctgcagaa ggtgactgtc ctgggcgtgg ccacggcgcc ccagcaggtc 2820ctctccaacg gtgtccctgt ctccaacttc acctacagcc ccgacaccaa ggtcctggac 2880atctgtgtct cgctgttgat gggagagcag tttctcgtca gctggtgtta gtctagagct 2940tgctagcggc cgc 2953172953DNAArtificial SequenceGILTd2-7M1/A37-GAA70-952 cassette 17ggtaccaagc ttgccatggg aatcccaatg ggcaagtcga tgctggtgct gctcaccttc 60ttggcctttg cctcgtgctg cattgccgct ctgtgcggcg gggaactggt ggacaccctc 120caattcgtct gtggggaccg gggcttctac ttcagcagac ccgcaagccg tgtgagtgct 180cgcagccgtg gcattgttga ggagtgctgt tttcgcagct gtgacctggc tctcctggag 240acgtactgcg ctacccccgc caagtctgag ggcgcgccgg cacaccccgg ccgtcccaga 300gcagtgccca cacagtgcga cgtccccccc aacagccgct tcgattgcgc ccctgacaag 360gccatcaccc aggaacagtg cgaggcccgc ggctgctgct acatccctgc aaagcagggg 420ctgcagggag cccagatggg gcagccctgg tgcttcttcc cacccagcta ccccagctac 480aagctggaga acctgagctc ctctgaaatg ggctacacgg ccaccctgac ccgtaccacc 540cccaccttct tccccaagga catcctgacc ctgcggctgg acgtgatgat ggagactgag 600aaccgcctcc acttcacgat caaagatcca gctaacaggc gctacgaggt gcccttggag 660accccgcgtg tccacagccg ggcaccgtcc ccactctaca gcgtggagtt ctctgaggag 720cccttcgggg tgatcgtgca ccggcagctg gacggccgcg tgctgctgaa cacgacggtg 780gcgcccctgt tctttgcgga ccagttcctt cagctgtcca cctcgctgcc ctcgcagtat 840atcacaggcc tcgccgagca cctcagtccc ctgatgctca gcaccagctg gaccaggatc 900accctgtgga accgggacct tgcgcccacg cccggtgcga acctctacgg gtctcaccct 960ttctacctgg cgctggagga cggcgggtcg gcacacgggg tgttcctgct aaacagcaat 1020gccatggatg tggtcctgca gccgagccct gcccttagct ggaggtcgac aggtgggatc 1080ctggatgtct acatcttcct gggcccagag cccaagagcg tggtgcagca gtacctggac 1140gttgtgggat acccgttcat gccgccatac tggggcctgg gcttccacct gtgccgctgg 1200ggctactcct ccaccgctat cacccgccag gtggtggaga acatgaccag ggcccacttc 1260cccctggacg tccaatggaa cgacctggac tacatggact cccggaggga cttcacgttc 1320aacaaggatg gcttccggga cttcccggcc atggtgcagg agctgcacca gggcggccgg 1380cgctacatga tgatcgtgga tcctgccatc agcagctcgg gccctgccgg gagctacagg 1440ccctacgacg agggtctgcg gaggggggtt ttcatcacca acgagaccgg ccagccgctg 1500attgggaagg tatggcccgg gtccactgcc ttccccgact tcaccaaccc cacagccctg 1560gcctggtggg aggacatggt ggctgagttc catgaccagg tgcccttcga cggcatgtgg 1620attgacatga acgagccttc caacttcatc aggggctctg aggacggctg ccccaacaat 1680gagctggaga acccacccta cgtgcctggg gtggttgggg ggaccctcca ggcggcaacc 1740atctgtgcct ccagccacca gtttctctcc acacactaca acctgcacaa cctctacggc 1800ctgaccgaag ccatcgcctc ccacagggcg ctggtgaagg ctcgggggac acgcccattt 1860gtgatctccc gctcgacctt tgctggccac ggccgatacg ccggccactg gacgggggac 1920gtgtggagct cctgggagca gctcgcctcc tccgtgccag aaatcctgca gtttaacctg 1980ctgggggtgc ctctggtcgg ggccgacgtc tgcggcttcc tgggcaacac ctcagaggag 2040ctgtgtgtgc gctggaccca gctgggggcc ttctacccct tcatgcggaa ccacaacagc 2100ctgctcagtc tgccccagga gccgtacagc ttcagcgagc cggcccagca ggccatgagg 2160aaggccctca ccctgcgcta cgcactcctc ccccacctct acacgctgtt ccaccaggcc 2220cacgtcgcgg gggagaccgt ggcccggccc ctcttcctgg agttccccaa ggactctagc 2280acctggactg tggaccacca gctcctgtgg ggggaggccc tgctcatcac cccagtgctc 2340caggccggga aggccgaagt gactggctac ttccccttgg gcacatggta cgacctgcag 2400acggtgccaa tagaggccct tggcagcctc ccacccccac ctgcagctcc ccgtgagcca 2460gccatccaca gcgaggggca gtgggtgacg ctgccggccc ccctggacac catcaacgtc 2520cacctccggg ctgggtacat catccccctg cagggccctg gcctcacaac cacagagtcc 2580cgccagcagc ccatggccct ggctgtggcc ctgaccaagg gtggagaggc ccgaggggag 2640ctgttctggg acgatggaga gagcctggaa gtgctggagc gaggggccta cacacaggtc 2700atcttcctgg ccaggaataa cacgatcgtg aatgagctgg tacgtgtgac cagtgaggga 2760gctggcctgc agctgcagaa ggtgactgtc ctgggcgtgg ccacggcgcc ccagcaggtc 2820ctctccaacg gtgtccctgt ctccaacttc acctacagcc ccgacaccaa ggtcctggac 2880atctgtgtct cgctgttgat gggagagcag tttctcgtca gctggtgtta gtctagagct 2940tgctagcggc cgc 2953182940DNAArtificial SequenceGILTd2-7d30-39-GAA70-952 cassette 18ggtaccagct gctagcaagc taattcacac caatgggaat cccaatgggg aagtcgatgc 60tggtgcttct caccttcttg gccttcgcct cgtgctgcat tgctgctctg tgcggcgggg 120agctggtgga caccctccag ttcgtctgtg gggaccgcgg cttctacttc agccgtggca 180tcgttgagga gtgctgtttc cgcagctgtg acctggccct cctggagacg tactgtgcta 240cccccgccaa gtccgagggc gcgccggcac accccggccg tcccagagca gtgcccacac 300agtgcgacgt cccccccaac agccgcttcg attgcgcccc tgacaaggcc atcacccagg 360aacagtgcga ggcccgcggc tgctgctaca tccctgcaaa gcaggggctg cagggagccc 420agatggggca gccctggtgc ttcttcccac ccagctaccc cagctacaag ctggagaacc 480tgagctcctc tgaaatgggc tacacggcca ccctgacccg taccaccccc accttcttcc 540ccaaggacat cctgaccctg cggctggacg tgatgatgga gactgagaac cgcctccact 600tcacgatcaa agatccagct aacaggcgct acgaggtgcc cttggagacc ccgcgtgtcc 660acagccgggc accgtcccca ctctacagcg tggagttctc tgaggagccc ttcggggtga 720tcgtgcaccg gcagctggac ggccgcgtgc tgctgaacac gacggtggcg cccctgttct 780ttgcggacca gttccttcag ctgtccacct cgctgccctc gcagtatatc acaggcctcg 840ccgagcacct cagtcccctg atgctcagca ccagctggac caggatcacc ctgtggaacc 900gggaccttgc gcccacgccc ggtgcgaacc tctacgggtc tcaccctttc tacctggcgc 960tggaggacgg cgggtcggca cacggggtgt tcctgctaaa cagcaatgcc atggatgtgg 1020tcctgcagcc gagccctgcc cttagctgga ggtcgacagg tgggatcctg gatgtctaca 1080tcttcctggg cccagagccc aagagcgtgg tgcagcagta cctggacgtt gtgggatacc 1140cgttcatgcc gccatactgg ggcctgggct tccacctgtg ccgctggggc tactcctcca 1200ccgctatcac ccgccaggtg gtggagaaca tgaccagggc ccacttcccc ctggacgtcc 1260aatggaacga cctggactac

atggactccc ggagggactt cacgttcaac aaggatggct 1320tccgggactt cccggccatg gtgcaggagc tgcaccaggg cggccggcgc tacatgatga 1380tcgtggatcc tgccatcagc agctcgggcc ctgccgggag ctacaggccc tacgacgagg 1440gtctgcggag gggggttttc atcaccaacg agaccggcca gccgctgatt gggaaggtat 1500ggcccgggtc cactgccttc cccgacttca ccaaccccac agccctggcc tggtgggagg 1560acatggtggc tgagttccat gaccaggtgc ccttcgacgg catgtggatt gacatgaacg 1620agccttccaa cttcatcagg ggctctgagg acggctgccc caacaatgag ctggagaacc 1680caccctacgt gcctggggtg gttgggggga ccctccaggc ggcaaccatc tgtgcctcca 1740gccaccagtt tctctccaca cactacaacc tgcacaacct ctacggcctg accgaagcca 1800tcgcctccca cagggcgctg gtgaaggctc gggggacacg cccatttgtg atctcccgct 1860cgacctttgc tggccacggc cgatacgccg gccactggac gggggacgtg tggagctcct 1920gggagcagct cgcctcctcc gtgccagaaa tcctgcagtt taacctgctg ggggtgcctc 1980tggtcggggc cgacgtctgc ggcttcctgg gcaacacctc agaggagctg tgtgtgcgct 2040ggacccagct gggggccttc taccccttca tgcggaacca caacagcctg ctcagtctgc 2100cccaggagcc gtacagcttc agcgagccgg cccagcaggc catgaggaag gccctcaccc 2160tgcgctacgc actcctcccc cacctctaca cgctgttcca ccaggcccac gtcgcggggg 2220agaccgtggc ccggcccctc ttcctggagt tccccaagga ctctagcacc tggactgtgg 2280accaccagct cctgtggggg gaggccctgc tcatcacccc agtgctccag gccgggaagg 2340ccgaagtgac tggctacttc cccttgggca catggtacga cctgcagacg gtgccaatag 2400aggcccttgg cagcctccca cccccacctg cagctccccg tgagccagcc atccacagcg 2460aggggcagtg ggtgacgctg ccggcccccc tggacaccat caacgtccac ctccgggctg 2520ggtacatcat ccccctgcag ggccctggcc tcacaaccac agagtcccgc cagcagccca 2580tggccctggc tgtggccctg accaagggtg gagaggcccg aggggagctg ttctgggacg 2640atggagagag cctggaagtg ctggagcgag gggcctacac acaggtcatc ttcctggcca 2700ggaataacac gatcgtgaat gagctggtac gtgtgaccag tgagggagct ggcctgcagc 2760tgcagaaggt gactgtcctg ggcgtggcca cggcgcccca gcaggtcctc tccaacggtg 2820tccctgtctc caacttcacc tacagccccg acaccaaggt cctggacatc tgtgtctcgc 2880tgttgatggg agagcagttt ctcgtcagct ggtgttagtc tagagcttgc tagcggccgc 2940192943DNAArtificial SequenceGILTd2-7d31-39-GAA70-952 cassette 19ggtaccagct gctagcaagc taattcacac caatgggaat cccaatgggg aagtcgatgc 60tggtgcttct caccttcttg gccttcgcct cgtgctgcat tgctgctctg tgcggcgggg 120agctggtgga caccctccag ttcgtctgtg gggaccgcgg cttctacttc agcaggcgtg 180gcatcgttga ggagtgctgt ttccgcagct gtgacctggc cctcctggag acgtactgtg 240ctacccccgc caagtccgag ggcgcgccgg cacaccccgg ccgtcccaga gcagtgccca 300cacagtgcga cgtccccccc aacagccgct tcgattgcgc ccctgacaag gccatcaccc 360aggaacagtg cgaggcccgc ggctgctgct acatccctgc aaagcagggg ctgcagggag 420cccagatggg gcagccctgg tgcttcttcc cacccagcta ccccagctac aagctggaga 480acctgagctc ctctgaaatg ggctacacgg ccaccctgac ccgtaccacc cccaccttct 540tccccaagga catcctgacc ctgcggctgg acgtgatgat ggagactgag aaccgcctcc 600acttcacgat caaagatcca gctaacaggc gctacgaggt gcccttggag accccgcgtg 660tccacagccg ggcaccgtcc ccactctaca gcgtggagtt ctctgaggag cccttcgggg 720tgatcgtgca ccggcagctg gacggccgcg tgctgctgaa cacgacggtg gcgcccctgt 780tctttgcgga ccagttcctt cagctgtcca cctcgctgcc ctcgcagtat atcacaggcc 840tcgccgagca cctcagtccc ctgatgctca gcaccagctg gaccaggatc accctgtgga 900accgggacct tgcgcccacg cccggtgcga acctctacgg gtctcaccct ttctacctgg 960cgctggagga cggcgggtcg gcacacgggg tgttcctgct aaacagcaat gccatggatg 1020tggtcctgca gccgagccct gcccttagct ggaggtcgac aggtgggatc ctggatgtct 1080acatcttcct gggcccagag cccaagagcg tggtgcagca gtacctggac gttgtgggat 1140acccgttcat gccgccatac tggggcctgg gcttccacct gtgccgctgg ggctactcct 1200ccaccgctat cacccgccag gtggtggaga acatgaccag ggcccacttc cccctggacg 1260tccaatggaa cgacctggac tacatggact cccggaggga cttcacgttc aacaaggatg 1320gcttccggga cttcccggcc atggtgcagg agctgcacca gggcggccgg cgctacatga 1380tgatcgtgga tcctgccatc agcagctcgg gccctgccgg gagctacagg ccctacgacg 1440agggtctgcg gaggggggtt ttcatcacca acgagaccgg ccagccgctg attgggaagg 1500tatggcccgg gtccactgcc ttccccgact tcaccaaccc cacagccctg gcctggtggg 1560aggacatggt ggctgagttc catgaccagg tgcccttcga cggcatgtgg attgacatga 1620acgagccttc caacttcatc aggggctctg aggacggctg ccccaacaat gagctggaga 1680acccacccta cgtgcctggg gtggttgggg ggaccctcca ggcggcaacc atctgtgcct 1740ccagccacca gtttctctcc acacactaca acctgcacaa cctctacggc ctgaccgaag 1800ccatcgcctc ccacagggcg ctggtgaagg ctcgggggac acgcccattt gtgatctccc 1860gctcgacctt tgctggccac ggccgatacg ccggccactg gacgggggac gtgtggagct 1920cctgggagca gctcgcctcc tccgtgccag aaatcctgca gtttaacctg ctgggggtgc 1980ctctggtcgg ggccgacgtc tgcggcttcc tgggcaacac ctcagaggag ctgtgtgtgc 2040gctggaccca gctgggggcc ttctacccct tcatgcggaa ccacaacagc ctgctcagtc 2100tgccccagga gccgtacagc ttcagcgagc cggcccagca ggccatgagg aaggccctca 2160ccctgcgcta cgcactcctc ccccacctct acacgctgtt ccaccaggcc cacgtcgcgg 2220gggagaccgt ggcccggccc ctcttcctgg agttccccaa ggactctagc acctggactg 2280tggaccacca gctcctgtgg ggggaggccc tgctcatcac cccagtgctc caggccggga 2340aggccgaagt gactggctac ttccccttgg gcacatggta cgacctgcag acggtgccaa 2400tagaggccct tggcagcctc ccacccccac ctgcagctcc ccgtgagcca gccatccaca 2460gcgaggggca gtgggtgacg ctgccggccc ccctggacac catcaacgtc cacctccggg 2520ctgggtacat catccccctg cagggccctg gcctcacaac cacagagtcc cgccagcagc 2580ccatggccct ggctgtggcc ctgaccaagg gtggagaggc ccgaggggag ctgttctggg 2640acgatggaga gagcctggaa gtgctggagc gaggggccta cacacaggtc atcttcctgg 2700ccaggaataa cacgatcgtg aatgagctgg tacgtgtgac cagtgaggga gctggcctgc 2760agctgcagaa ggtgactgtc ctgggcgtgg ccacggcgcc ccagcaggtc ctctccaacg 2820gtgtccctgt ctccaacttc acctacagcc ccgacaccaa ggtcctggac atctgtgtct 2880cgctgttgat gggagagcag tttctcgtca gctggtgtta gtctagagct tgctagcggc 2940cgc 2943202946DNAArtificial SequenceGILTd2-7d32-39-GAA70-952 cassette 20ggtaccagct gctagcaagc taattcacac caatgggaat cccaatgggg aagtcgatgc 60tggtgcttct caccttcttg gccttcgcct cgtgctgcat tgctgctctg tgcggcgggg 120agctggtgga caccctccag ttcgtctgtg gggaccgcgg cttctacttc agcaggcccc 180gtggcatcgt tgaggagtgc tgtttccgca gctgtgacct ggccctcctg gagacgtact 240gtgctacccc cgccaagtcc gagggcgcgc cggcacaccc cggccgtccc agagcagtgc 300ccacacagtg cgacgtcccc cccaacagcc gcttcgattg cgcccctgac aaggccatca 360cccaggaaca gtgcgaggcc cgcggctgct gctacatccc tgcaaagcag gggctgcagg 420gagcccagat ggggcagccc tggtgcttct tcccacccag ctaccccagc tacaagctgg 480agaacctgag ctcctctgaa atgggctaca cggccaccct gacccgtacc acccccacct 540tcttccccaa ggacatcctg accctgcggc tggacgtgat gatggagact gagaaccgcc 600tccacttcac gatcaaagat ccagctaaca ggcgctacga ggtgcccttg gagaccccgc 660gtgtccacag ccgggcaccg tccccactct acagcgtgga gttctctgag gagcccttcg 720gggtgatcgt gcaccggcag ctggacggcc gcgtgctgct gaacacgacg gtggcgcccc 780tgttctttgc ggaccagttc cttcagctgt ccacctcgct gccctcgcag tatatcacag 840gcctcgccga gcacctcagt cccctgatgc tcagcaccag ctggaccagg atcaccctgt 900ggaaccggga ccttgcgccc acgcccggtg cgaacctcta cgggtctcac cctttctacc 960tggcgctgga ggacggcggg tcggcacacg gggtgttcct gctaaacagc aatgccatgg 1020atgtggtcct gcagccgagc cctgccctta gctggaggtc gacaggtggg atcctggatg 1080tctacatctt cctgggccca gagcccaaga gcgtggtgca gcagtacctg gacgttgtgg 1140gatacccgtt catgccgcca tactggggcc tgggcttcca cctgtgccgc tggggctact 1200cctccaccgc tatcacccgc caggtggtgg agaacatgac cagggcccac ttccccctgg 1260acgtccaatg gaacgacctg gactacatgg actcccggag ggacttcacg ttcaacaagg 1320atggcttccg ggacttcccg gccatggtgc aggagctgca ccagggcggc cggcgctaca 1380tgatgatcgt ggatcctgcc atcagcagct cgggccctgc cgggagctac aggccctacg 1440acgagggtct gcggaggggg gttttcatca ccaacgagac cggccagccg ctgattggga 1500aggtatggcc cgggtccact gccttccccg acttcaccaa ccccacagcc ctggcctggt 1560gggaggacat ggtggctgag ttccatgacc aggtgccctt cgacggcatg tggattgaca 1620tgaacgagcc ttccaacttc atcaggggct ctgaggacgg ctgccccaac aatgagctgg 1680agaacccacc ctacgtgcct ggggtggttg gggggaccct ccaggcggca accatctgtg 1740cctccagcca ccagtttctc tccacacact acaacctgca caacctctac ggcctgaccg 1800aagccatcgc ctcccacagg gcgctggtga aggctcgggg gacacgccca tttgtgatct 1860cccgctcgac ctttgctggc cacggccgat acgccggcca ctggacgggg gacgtgtgga 1920gctcctggga gcagctcgcc tcctccgtgc cagaaatcct gcagtttaac ctgctggggg 1980tgcctctggt cggggccgac gtctgcggct tcctgggcaa cacctcagag gagctgtgtg 2040tgcgctggac ccagctgggg gccttctacc ccttcatgcg gaaccacaac agcctgctca 2100gtctgcccca ggagccgtac agcttcagcg agccggccca gcaggccatg aggaaggccc 2160tcaccctgcg ctacgcactc ctcccccacc tctacacgct gttccaccag gcccacgtcg 2220cgggggagac cgtggcccgg cccctcttcc tggagttccc caaggactct agcacctgga 2280ctgtggacca ccagctcctg tggggggagg ccctgctcat caccccagtg ctccaggccg 2340ggaaggccga agtgactggc tacttcccct tgggcacatg gtacgacctg cagacggtgc 2400caatagaggc ccttggcagc ctcccacccc cacctgcagc tccccgtgag ccagccatcc 2460acagcgaggg gcagtgggtg acgctgccgg cccccctgga caccatcaac gtccacctcc 2520gggctgggta catcatcccc ctgcagggcc ctggcctcac aaccacagag tcccgccagc 2580agcccatggc cctggctgtg gccctgacca agggtggaga ggcccgaggg gagctgttct 2640gggacgatgg agagagcctg gaagtgctgg agcgaggggc ctacacacag gtcatcttcc 2700tggccaggaa taacacgatc gtgaatgagc tggtacgtgt gaccagtgag ggagctggcc 2760tgcagctgca gaaggtgact gtcctgggcg tggccacggc gccccagcag gtcctctcca 2820acggtgtccc tgtctccaac ttcacctaca gccccgacac caaggtcctg gacatctgtg 2880tctcgctgtt gatgggagag cagtttctcg tcagctggtg ttagtctaga gcttgctagc 2940ggccgc 2946212949DNAArtificial SequenceGILTd2-7d33-39-GAA70-952 cassette 21ggtaccagct gctagcaagc taattcacac caatgggaat cccaatgggg aagtcgatgc 60tggtgcttct caccttcttg gccttcgcct cgtgctgcat tgctgctctg tgcggcgggg 120agctggtgga caccctccag ttcgtctgtg gggaccgcgg cttctacttc agcaggcccg 180cacgtggcat cgttgaggag tgctgtttcc gcagctgtga cctggccctc ctggagacgt 240actgtgctac ccccgccaag tccgagggcg cgccggcaca ccccggccgt cccagagcag 300tgcccacaca gtgcgacgtc ccccccaaca gccgcttcga ttgcgcccct gacaaggcca 360tcacccagga acagtgcgag gcccgcggct gctgctacat ccctgcaaag caggggctgc 420agggagccca gatggggcag ccctggtgct tcttcccacc cagctacccc agctacaagc 480tggagaacct gagctcctct gaaatgggct acacggccac cctgacccgt accaccccca 540ccttcttccc caaggacatc ctgaccctgc ggctggacgt gatgatggag actgagaacc 600gcctccactt cacgatcaaa gatccagcta acaggcgcta cgaggtgccc ttggagaccc 660cgcgtgtcca cagccgggca ccgtccccac tctacagcgt ggagttctct gaggagccct 720tcggggtgat cgtgcaccgg cagctggacg gccgcgtgct gctgaacacg acggtggcgc 780ccctgttctt tgcggaccag ttccttcagc tgtccacctc gctgccctcg cagtatatca 840caggcctcgc cgagcacctc agtcccctga tgctcagcac cagctggacc aggatcaccc 900tgtggaaccg ggaccttgcg cccacgcccg gtgcgaacct ctacgggtct caccctttct 960acctggcgct ggaggacggc gggtcggcac acggggtgtt cctgctaaac agcaatgcca 1020tggatgtggt cctgcagccg agccctgccc ttagctggag gtcgacaggt gggatcctgg 1080atgtctacat cttcctgggc ccagagccca agagcgtggt gcagcagtac ctggacgttg 1140tgggataccc gttcatgccg ccatactggg gcctgggctt ccacctgtgc cgctggggct 1200actcctccac cgctatcacc cgccaggtgg tggagaacat gaccagggcc cacttccccc 1260tggacgtcca atggaacgac ctggactaca tggactcccg gagggacttc acgttcaaca 1320aggatggctt ccgggacttc ccggccatgg tgcaggagct gcaccagggc ggccggcgct 1380acatgatgat cgtggatcct gccatcagca gctcgggccc tgccgggagc tacaggccct 1440acgacgaggg tctgcggagg ggggttttca tcaccaacga gaccggccag ccgctgattg 1500ggaaggtatg gcccgggtcc actgccttcc ccgacttcac caaccccaca gccctggcct 1560ggtgggagga catggtggct gagttccatg accaggtgcc cttcgacggc atgtggattg 1620acatgaacga gccttccaac ttcatcaggg gctctgagga cggctgcccc aacaatgagc 1680tggagaaccc accctacgtg cctggggtgg ttggggggac cctccaggcg gcaaccatct 1740gtgcctccag ccaccagttt ctctccacac actacaacct gcacaacctc tacggcctga 1800ccgaagccat cgcctcccac agggcgctgg tgaaggctcg ggggacacgc ccatttgtga 1860tctcccgctc gacctttgct ggccacggcc gatacgccgg ccactggacg ggggacgtgt 1920ggagctcctg ggagcagctc gcctcctccg tgccagaaat cctgcagttt aacctgctgg 1980gggtgcctct ggtcggggcc gacgtctgcg gcttcctggg caacacctca gaggagctgt 2040gtgtgcgctg gacccagctg ggggccttct accccttcat gcggaaccac aacagcctgc 2100tcagtctgcc ccaggagccg tacagcttca gcgagccggc ccagcaggcc atgaggaagg 2160ccctcaccct gcgctacgca ctcctccccc acctctacac gctgttccac caggcccacg 2220tcgcggggga gaccgtggcc cggcccctct tcctggagtt ccccaaggac tctagcacct 2280ggactgtgga ccaccagctc ctgtgggggg aggccctgct catcacccca gtgctccagg 2340ccgggaaggc cgaagtgact ggctacttcc ccttgggcac atggtacgac ctgcagacgg 2400tgccaataga ggcccttggc agcctcccac ccccacctgc agctccccgt gagccagcca 2460tccacagcga ggggcagtgg gtgacgctgc cggcccccct ggacaccatc aacgtccacc 2520tccgggctgg gtacatcatc cccctgcagg gccctggcct cacaaccaca gagtcccgcc 2580agcagcccat ggccctggct gtggccctga ccaagggtgg agaggcccga ggggagctgt 2640tctgggacga tggagagagc ctggaagtgc tggagcgagg ggcctacaca caggtcatct 2700tcctggccag gaataacacg atcgtgaatg agctggtacg tgtgaccagt gagggagctg 2760gcctgcagct gcagaaggtg actgtcctgg gcgtggccac ggcgccccag caggtcctct 2820ccaacggtgt ccctgtctcc aacttcacct acagccccga caccaaggtc ctggacatct 2880gtgtctcgct gttgatggga gagcagtttc tcgtcagctg gtgttagtct agagcttgct 2940agcggccgc 2949222952DNAArtificial SequenceGILTd2-7d34-39-GAA70-952 cassette 22ggtaccagct gctagcaagc taattcacac caatgggaat cccaatgggg aagtcgatgc 60tggtgcttct caccttcttg gccttcgcct cgtgctgcat tgctgctctg tgcggcgggg 120agctggtgga caccctccag ttcgtctgtg gggaccgcgg cttctacttc agcaggcccg 180caagccgtgg catcgttgag gagtgctgtt tccgcagctg tgacctggcc ctcctggaga 240cgtactgtgc tacccccgcc aagtccgagg gcgcgccggc acaccccggc cgtcccagag 300cagtgcccac acagtgcgac gtccccccca acagccgctt cgattgcgcc cctgacaagg 360ccatcaccca ggaacagtgc gaggcccgcg gctgctgcta catccctgca aagcaggggc 420tgcagggagc ccagatgggg cagccctggt gcttcttccc acccagctac cccagctaca 480agctggagaa cctgagctcc tctgaaatgg gctacacggc caccctgacc cgtaccaccc 540ccaccttctt ccccaaggac atcctgaccc tgcggctgga cgtgatgatg gagactgaga 600accgcctcca cttcacgatc aaagatccag ctaacaggcg ctacgaggtg cccttggaga 660ccccgcgtgt ccacagccgg gcaccgtccc cactctacag cgtggagttc tctgaggagc 720ccttcggggt gatcgtgcac cggcagctgg acggccgcgt gctgctgaac acgacggtgg 780cgcccctgtt ctttgcggac cagttccttc agctgtccac ctcgctgccc tcgcagtata 840tcacaggcct cgccgagcac ctcagtcccc tgatgctcag caccagctgg accaggatca 900ccctgtggaa ccgggacctt gcgcccacgc ccggtgcgaa cctctacggg tctcaccctt 960tctacctggc gctggaggac ggcgggtcgg cacacggggt gttcctgcta aacagcaatg 1020ccatggatgt ggtcctgcag ccgagccctg cccttagctg gaggtcgaca ggtgggatcc 1080tggatgtcta catcttcctg ggcccagagc ccaagagcgt ggtgcagcag tacctggacg 1140ttgtgggata cccgttcatg ccgccatact ggggcctggg cttccacctg tgccgctggg 1200gctactcctc caccgctatc acccgccagg tggtggagaa catgaccagg gcccacttcc 1260ccctggacgt ccaatggaac gacctggact acatggactc ccggagggac ttcacgttca 1320acaaggatgg cttccgggac ttcccggcca tggtgcagga gctgcaccag ggcggccggc 1380gctacatgat gatcgtggat cctgccatca gcagctcggg ccctgccggg agctacaggc 1440cctacgacga gggtctgcgg aggggggttt tcatcaccaa cgagaccggc cagccgctga 1500ttgggaaggt atggcccggg tccactgcct tccccgactt caccaacccc acagccctgg 1560cctggtggga ggacatggtg gctgagttcc atgaccaggt gcccttcgac ggcatgtgga 1620ttgacatgaa cgagccttcc aacttcatca ggggctctga ggacggctgc cccaacaatg 1680agctggagaa cccaccctac gtgcctgggg tggttggggg gaccctccag gcggcaacca 1740tctgtgcctc cagccaccag tttctctcca cacactacaa cctgcacaac ctctacggcc 1800tgaccgaagc catcgcctcc cacagggcgc tggtgaaggc tcgggggaca cgcccatttg 1860tgatctcccg ctcgaccttt gctggccacg gccgatacgc cggccactgg acgggggacg 1920tgtggagctc ctgggagcag ctcgcctcct ccgtgccaga aatcctgcag tttaacctgc 1980tgggggtgcc tctggtcggg gccgacgtct gcggcttcct gggcaacacc tcagaggagc 2040tgtgtgtgcg ctggacccag ctgggggcct tctacccctt catgcggaac cacaacagcc 2100tgctcagtct gccccaggag ccgtacagct tcagcgagcc ggcccagcag gccatgagga 2160aggccctcac cctgcgctac gcactcctcc cccacctcta cacgctgttc caccaggccc 2220acgtcgcggg ggagaccgtg gcccggcccc tcttcctgga gttccccaag gactctagca 2280cctggactgt ggaccaccag ctcctgtggg gggaggccct gctcatcacc ccagtgctcc 2340aggccgggaa ggccgaagtg actggctact tccccttggg cacatggtac gacctgcaga 2400cggtgccaat agaggccctt ggcagcctcc cacccccacc tgcagctccc cgtgagccag 2460ccatccacag cgaggggcag tgggtgacgc tgccggcccc cctggacacc atcaacgtcc 2520acctccgggc tgggtacatc atccccctgc agggccctgg cctcacaacc acagagtccc 2580gccagcagcc catggccctg gctgtggccc tgaccaaggg tggagaggcc cgaggggagc 2640tgttctggga cgatggagag agcctggaag tgctggagcg aggggcctac acacaggtca 2700tcttcctggc caggaataac acgatcgtga atgagctggt acgtgtgacc agtgagggag 2760ctggcctgca gctgcagaag gtgactgtcc tgggcgtggc cacggcgccc cagcaggtcc 2820tctccaacgg tgtccctgtc tccaacttca cctacagccc cgacaccaag gtcctggaca 2880tctgtgtctc gctgttgatg ggagagcagt ttctcgtcag ctggtgttag tctagagctt 2940gctagcggcc gc 2952232955DNAArtificial SequenceGILTd2-7d35-39-GAA70-952 cassette 23ggtaccagct gctagcaagc taattcacac caatgggaat cccaatgggg aagtcgatgc 60tggtgcttct caccttcttg gccttcgcct cgtgctgcat tgctgctctg tgcggcgggg 120agctggtgga caccctccag ttcgtctgtg gggaccgcgg cttctacttc agcaggcccg 180caagccgtcg tggcatcgtt gaggagtgct gtttccgcag ctgtgacctg gccctcctgg 240agacgtactg tgctaccccc gccaagtccg agggcgcgcc ggcacacccc ggccgtccca 300gagcagtgcc cacacagtgc gacgtccccc ccaacagccg cttcgattgc gcccctgaca 360aggccatcac ccaggaacag tgcgaggccc gcggctgctg ctacatccct gcaaagcagg 420ggctgcaggg agcccagatg gggcagccct ggtgcttctt cccacccagc taccccagct 480acaagctgga gaacctgagc tcctctgaaa tgggctacac ggccaccctg acccgtacca 540cccccacctt cttccccaag gacatcctga ccctgcggct ggacgtgatg atggagactg 600agaaccgcct ccacttcacg atcaaagatc cagctaacag gcgctacgag gtgcccttgg 660agaccccgcg tgtccacagc cgggcaccgt ccccactcta cagcgtggag ttctctgagg 720agcccttcgg ggtgatcgtg caccggcagc tggacggccg cgtgctgctg aacacgacgg 780tggcgcccct gttctttgcg gaccagttcc ttcagctgtc cacctcgctg ccctcgcagt 840atatcacagg cctcgccgag cacctcagtc ccctgatgct cagcaccagc tggaccagga 900tcaccctgtg gaaccgggac cttgcgccca cgcccggtgc gaacctctac gggtctcacc 960ctttctacct ggcgctggag gacggcgggt cggcacacgg ggtgttcctg ctaaacagca 1020atgccatgga tgtggtcctg cagccgagcc ctgcccttag ctggaggtcg acaggtggga 1080tcctggatgt ctacatcttc

ctgggcccag agcccaagag cgtggtgcag cagtacctgg 1140acgttgtggg atacccgttc atgccgccat actggggcct gggcttccac ctgtgccgct 1200ggggctactc ctccaccgct atcacccgcc aggtggtgga gaacatgacc agggcccact 1260tccccctgga cgtccaatgg aacgacctgg actacatgga ctcccggagg gacttcacgt 1320tcaacaagga tggcttccgg gacttcccgg ccatggtgca ggagctgcac cagggcggcc 1380ggcgctacat gatgatcgtg gatcctgcca tcagcagctc gggccctgcc gggagctaca 1440ggccctacga cgagggtctg cggagggggg ttttcatcac caacgagacc ggccagccgc 1500tgattgggaa ggtatggccc gggtccactg ccttccccga cttcaccaac cccacagccc 1560tggcctggtg ggaggacatg gtggctgagt tccatgacca ggtgcccttc gacggcatgt 1620ggattgacat gaacgagcct tccaacttca tcaggggctc tgaggacggc tgccccaaca 1680atgagctgga gaacccaccc tacgtgcctg gggtggttgg ggggaccctc caggcggcaa 1740ccatctgtgc ctccagccac cagtttctct ccacacacta caacctgcac aacctctacg 1800gcctgaccga agccatcgcc tcccacaggg cgctggtgaa ggctcggggg acacgcccat 1860ttgtgatctc ccgctcgacc tttgctggcc acggccgata cgccggccac tggacggggg 1920acgtgtggag ctcctgggag cagctcgcct cctccgtgcc agaaatcctg cagtttaacc 1980tgctgggggt gcctctggtc ggggccgacg tctgcggctt cctgggcaac acctcagagg 2040agctgtgtgt gcgctggacc cagctggggg ccttctaccc cttcatgcgg aaccacaaca 2100gcctgctcag tctgccccag gagccgtaca gcttcagcga gccggcccag caggccatga 2160ggaaggccct caccctgcgc tacgcactcc tcccccacct ctacacgctg ttccaccagg 2220cccacgtcgc gggggagacc gtggcccggc ccctcttcct ggagttcccc aaggactcta 2280gcacctggac tgtggaccac cagctcctgt ggggggaggc cctgctcatc accccagtgc 2340tccaggccgg gaaggccgaa gtgactggct acttcccctt gggcacatgg tacgacctgc 2400agacggtgcc aatagaggcc cttggcagcc tcccaccccc acctgcagct ccccgtgagc 2460cagccatcca cagcgagggg cagtgggtga cgctgccggc ccccctggac accatcaacg 2520tccacctccg ggctgggtac atcatccccc tgcagggccc tggcctcaca accacagagt 2580cccgccagca gcccatggcc ctggctgtgg ccctgaccaa gggtggagag gcccgagggg 2640agctgttctg ggacgatgga gagagcctgg aagtgctgga gcgaggggcc tacacacagg 2700tcatcttcct ggccaggaat aacacgatcg tgaatgagct ggtacgtgtg accagtgagg 2760gagctggcct gcagctgcag aaggtgactg tcctgggcgt ggccacggcg ccccagcagg 2820tcctctccaa cggtgtccct gtctccaact tcacctacag ccccgacacc aaggtcctgg 2880acatctgtgt ctcgctgttg atgggagagc agtttctcgt cagctggtgt tagtctagag 2940cttgctagcg gccgc 2955242958DNAArtificial SequenceGILTd2-7d36-39-GAA70-952 cassette 24ggtaccagct gctagcaagc taattcacac caatgggaat cccaatgggg aagtcgatgc 60tggtgcttct caccttcttg gccttcgcct cgtgctgcat tgctgctctg tgcggcgggg 120agctggtgga caccctccag ttcgtctgtg gggaccgcgg cttctacttc agcaggcccg 180caagccgtgt gcgtggcatc gttgaggagt gctgtttccg cagctgtgac ctggccctcc 240tggagacgta ctgtgctacc cccgccaagt ccgagggcgc gccggcacac cccggccgtc 300ccagagcagt gcccacacag tgcgacgtcc cccccaacag ccgcttcgat tgcgcccctg 360acaaggccat cacccaggaa cagtgcgagg cccgcggctg ctgctacatc cctgcaaagc 420aggggctgca gggagcccag atggggcagc cctggtgctt cttcccaccc agctacccca 480gctacaagct ggagaacctg agctcctctg aaatgggcta cacggccacc ctgacccgta 540ccacccccac cttcttcccc aaggacatcc tgaccctgcg gctggacgtg atgatggaga 600ctgagaaccg cctccacttc acgatcaaag atccagctaa caggcgctac gaggtgccct 660tggagacccc gcgtgtccac agccgggcac cgtccccact ctacagcgtg gagttctctg 720aggagccctt cggggtgatc gtgcaccggc agctggacgg ccgcgtgctg ctgaacacga 780cggtggcgcc cctgttcttt gcggaccagt tccttcagct gtccacctcg ctgccctcgc 840agtatatcac aggcctcgcc gagcacctca gtcccctgat gctcagcacc agctggacca 900ggatcaccct gtggaaccgg gaccttgcgc ccacgcccgg tgcgaacctc tacgggtctc 960accctttcta cctggcgctg gaggacggcg ggtcggcaca cggggtgttc ctgctaaaca 1020gcaatgccat ggatgtggtc ctgcagccga gccctgccct tagctggagg tcgacaggtg 1080ggatcctgga tgtctacatc ttcctgggcc cagagcccaa gagcgtggtg cagcagtacc 1140tggacgttgt gggatacccg ttcatgccgc catactgggg cctgggcttc cacctgtgcc 1200gctggggcta ctcctccacc gctatcaccc gccaggtggt ggagaacatg accagggccc 1260acttccccct ggacgtccaa tggaacgacc tggactacat ggactcccgg agggacttca 1320cgttcaacaa ggatggcttc cgggacttcc cggccatggt gcaggagctg caccagggcg 1380gccggcgcta catgatgatc gtggatcctg ccatcagcag ctcgggccct gccgggagct 1440acaggcccta cgacgagggt ctgcggaggg gggttttcat caccaacgag accggccagc 1500cgctgattgg gaaggtatgg cccgggtcca ctgccttccc cgacttcacc aaccccacag 1560ccctggcctg gtgggaggac atggtggctg agttccatga ccaggtgccc ttcgacggca 1620tgtggattga catgaacgag ccttccaact tcatcagggg ctctgaggac ggctgcccca 1680acaatgagct ggagaaccca ccctacgtgc ctggggtggt tggggggacc ctccaggcgg 1740caaccatctg tgcctccagc caccagtttc tctccacaca ctacaacctg cacaacctct 1800acggcctgac cgaagccatc gcctcccaca gggcgctggt gaaggctcgg gggacacgcc 1860catttgtgat ctcccgctcg acctttgctg gccacggccg atacgccggc cactggacgg 1920gggacgtgtg gagctcctgg gagcagctcg cctcctccgt gccagaaatc ctgcagttta 1980acctgctggg ggtgcctctg gtcggggccg acgtctgcgg cttcctgggc aacacctcag 2040aggagctgtg tgtgcgctgg acccagctgg gggccttcta ccccttcatg cggaaccaca 2100acagcctgct cagtctgccc caggagccgt acagcttcag cgagccggcc cagcaggcca 2160tgaggaaggc cctcaccctg cgctacgcac tcctccccca cctctacacg ctgttccacc 2220aggcccacgt cgcgggggag accgtggccc ggcccctctt cctggagttc cccaaggact 2280ctagcacctg gactgtggac caccagctcc tgtgggggga ggccctgctc atcaccccag 2340tgctccaggc cgggaaggcc gaagtgactg gctacttccc cttgggcaca tggtacgacc 2400tgcagacggt gccaatagag gcccttggca gcctcccacc cccacctgca gctccccgtg 2460agccagccat ccacagcgag gggcagtggg tgacgctgcc ggcccccctg gacaccatca 2520acgtccacct ccgggctggg tacatcatcc ccctgcaggg ccctggcctc acaaccacag 2580agtcccgcca gcagcccatg gccctggctg tggccctgac caagggtgga gaggcccgag 2640gggagctgtt ctgggacgat ggagagagcc tggaagtgct ggagcgaggg gcctacacac 2700aggtcatctt cctggccagg aataacacga tcgtgaatga gctggtacgt gtgaccagtg 2760agggagctgg cctgcagctg cagaaggtga ctgtcctggg cgtggccacg gcgccccagc 2820aggtcctctc caacggtgtc cctgtctcca acttcaccta cagccccgac accaaggtcc 2880tggacatctg tgtctcgctg ttgatgggag agcagtttct cgtcagctgg tgttagtcta 2940gagcttgcta gcggccgc 2958252934DNAArtificial SequenceGILTd2-7d29-40-GAA70-952 cassette 25ggtaccagct gctagcaagc taattcacac caatgggaat cccaatgggg aagtcgatgc 60tggtgcttct caccttcttg gccttcgcct cgtgctgcat tgctgctctg tgcggcgggg 120agctggtgga caccctccag ttcgtctgtg gggaccgcgg cttctacttc ggcatcgttg 180aggagtgctg tttccgcagc tgtgacctgg ccctcctgga gacgtactgt gctacccccg 240ccaagtccga gggcgcgccg gcacaccccg gccgtcccag agcagtgccc acacagtgcg 300acgtcccccc caacagccgc ttcgattgcg cccctgacaa ggccatcacc caggaacagt 360gcgaggcccg cggctgctgc tacatccctg caaagcaggg gctgcaggga gcccagatgg 420ggcagccctg gtgcttcttc ccacccagct accccagcta caagctggag aacctgagct 480cctctgaaat gggctacacg gccaccctga cccgtaccac ccccaccttc ttccccaagg 540acatcctgac cctgcggctg gacgtgatga tggagactga gaaccgcctc cacttcacga 600tcaaagatcc agctaacagg cgctacgagg tgcccttgga gaccccgcgt gtccacagcc 660gggcaccgtc cccactctac agcgtggagt tctctgagga gcccttcggg gtgatcgtgc 720accggcagct ggacggccgc gtgctgctga acacgacggt ggcgcccctg ttctttgcgg 780accagttcct tcagctgtcc acctcgctgc cctcgcagta tatcacaggc ctcgccgagc 840acctcagtcc cctgatgctc agcaccagct ggaccaggat caccctgtgg aaccgggacc 900ttgcgcccac gcccggtgcg aacctctacg ggtctcaccc tttctacctg gcgctggagg 960acggcgggtc ggcacacggg gtgttcctgc taaacagcaa tgccatggat gtggtcctgc 1020agccgagccc tgcccttagc tggaggtcga caggtgggat cctggatgtc tacatcttcc 1080tgggcccaga gcccaagagc gtggtgcagc agtacctgga cgttgtggga tacccgttca 1140tgccgccata ctggggcctg ggcttccacc tgtgccgctg gggctactcc tccaccgcta 1200tcacccgcca ggtggtggag aacatgacca gggcccactt ccccctggac gtccaatgga 1260acgacctgga ctacatggac tcccggaggg acttcacgtt caacaaggat ggcttccggg 1320acttcccggc catggtgcag gagctgcacc agggcggccg gcgctacatg atgatcgtgg 1380atcctgccat cagcagctcg ggccctgccg ggagctacag gccctacgac gagggtctgc 1440ggaggggggt tttcatcacc aacgagaccg gccagccgct gattgggaag gtatggcccg 1500ggtccactgc cttccccgac ttcaccaacc ccacagccct ggcctggtgg gaggacatgg 1560tggctgagtt ccatgaccag gtgcccttcg acggcatgtg gattgacatg aacgagcctt 1620ccaacttcat caggggctct gaggacggct gccccaacaa tgagctggag aacccaccct 1680acgtgcctgg ggtggttggg gggaccctcc aggcggcaac catctgtgcc tccagccacc 1740agtttctctc cacacactac aacctgcaca acctctacgg cctgaccgaa gccatcgcct 1800cccacagggc gctggtgaag gctcggggga cacgcccatt tgtgatctcc cgctcgacct 1860ttgctggcca cggccgatac gccggccact ggacggggga cgtgtggagc tcctgggagc 1920agctcgcctc ctccgtgcca gaaatcctgc agtttaacct gctgggggtg cctctggtcg 1980gggccgacgt ctgcggcttc ctgggcaaca cctcagagga gctgtgtgtg cgctggaccc 2040agctgggggc cttctacccc ttcatgcgga accacaacag cctgctcagt ctgccccagg 2100agccgtacag cttcagcgag ccggcccagc aggccatgag gaaggccctc accctgcgct 2160acgcactcct cccccacctc tacacgctgt tccaccaggc ccacgtcgcg ggggagaccg 2220tggcccggcc cctcttcctg gagttcccca aggactctag cacctggact gtggaccacc 2280agctcctgtg gggggaggcc ctgctcatca ccccagtgct ccaggccggg aaggccgaag 2340tgactggcta cttccccttg ggcacatggt acgacctgca gacggtgcca atagaggccc 2400ttggcagcct cccaccccca cctgcagctc cccgtgagcc agccatccac agcgaggggc 2460agtgggtgac gctgccggcc cccctggaca ccatcaacgt ccacctccgg gctgggtaca 2520tcatccccct gcagggccct ggcctcacaa ccacagagtc ccgccagcag cccatggccc 2580tggctgtggc cctgaccaag ggtggagagg cccgagggga gctgttctgg gacgatggag 2640agagcctgga agtgctggag cgaggggcct acacacaggt catcttcctg gccaggaata 2700acacgatcgt gaatgagctg gtacgtgtga ccagtgaggg agctggcctg cagctgcaga 2760aggtgactgt cctgggcgtg gccacggcgc cccagcaggt cctctccaac ggtgtccctg 2820tctccaactt cacctacagc cccgacacca aggtcctgga catctgtgtc tcgctgttga 2880tgggagagca gtttctcgtc agctggtgtt agtctagagc ttgctagcgg ccgc 2934262937DNAArtificial SequenceGILTd2-7d30-40-GAA70-952 cassette 26ggtaccagct gctagcaagc taattcacac caatgggaat cccaatgggg aagtcgatgc 60tggtgcttct caccttcttg gccttcgcct cgtgctgcat tgctgctctg tgcggcgggg 120agctggtgga caccctccag ttcgtctgtg gggaccgcgg cttctacttc agcggcatcg 180ttgaggagtg ctgtttccgc agctgtgacc tggccctcct ggagacgtac tgtgctaccc 240ccgccaagtc cgagggcgcg ccggcacacc ccggccgtcc cagagcagtg cccacacagt 300gcgacgtccc ccccaacagc cgcttcgatt gcgcccctga caaggccatc acccaggaac 360agtgcgaggc ccgcggctgc tgctacatcc ctgcaaagca ggggctgcag ggagcccaga 420tggggcagcc ctggtgcttc ttcccaccca gctaccccag ctacaagctg gagaacctga 480gctcctctga aatgggctac acggccaccc tgacccgtac cacccccacc ttcttcccca 540aggacatcct gaccctgcgg ctggacgtga tgatggagac tgagaaccgc ctccacttca 600cgatcaaaga tccagctaac aggcgctacg aggtgccctt ggagaccccg cgtgtccaca 660gccgggcacc gtccccactc tacagcgtgg agttctctga ggagcccttc ggggtgatcg 720tgcaccggca gctggacggc cgcgtgctgc tgaacacgac ggtggcgccc ctgttctttg 780cggaccagtt ccttcagctg tccacctcgc tgccctcgca gtatatcaca ggcctcgccg 840agcacctcag tcccctgatg ctcagcacca gctggaccag gatcaccctg tggaaccggg 900accttgcgcc cacgcccggt gcgaacctct acgggtctca ccctttctac ctggcgctgg 960aggacggcgg gtcggcacac ggggtgttcc tgctaaacag caatgccatg gatgtggtcc 1020tgcagccgag ccctgccctt agctggaggt cgacaggtgg gatcctggat gtctacatct 1080tcctgggccc agagcccaag agcgtggtgc agcagtacct ggacgttgtg ggatacccgt 1140tcatgccgcc atactggggc ctgggcttcc acctgtgccg ctggggctac tcctccaccg 1200ctatcacccg ccaggtggtg gagaacatga ccagggccca cttccccctg gacgtccaat 1260ggaacgacct ggactacatg gactcccgga gggacttcac gttcaacaag gatggcttcc 1320gggacttccc ggccatggtg caggagctgc accagggcgg ccggcgctac atgatgatcg 1380tggatcctgc catcagcagc tcgggccctg ccgggagcta caggccctac gacgagggtc 1440tgcggagggg ggttttcatc accaacgaga ccggccagcc gctgattggg aaggtatggc 1500ccgggtccac tgccttcccc gacttcacca accccacagc cctggcctgg tgggaggaca 1560tggtggctga gttccatgac caggtgccct tcgacggcat gtggattgac atgaacgagc 1620cttccaactt catcaggggc tctgaggacg gctgccccaa caatgagctg gagaacccac 1680cctacgtgcc tggggtggtt ggggggaccc tccaggcggc aaccatctgt gcctccagcc 1740accagtttct ctccacacac tacaacctgc acaacctcta cggcctgacc gaagccatcg 1800cctcccacag ggcgctggtg aaggctcggg ggacacgccc atttgtgatc tcccgctcga 1860cctttgctgg ccacggccga tacgccggcc actggacggg ggacgtgtgg agctcctggg 1920agcagctcgc ctcctccgtg ccagaaatcc tgcagtttaa cctgctgggg gtgcctctgg 1980tcggggccga cgtctgcggc ttcctgggca acacctcaga ggagctgtgt gtgcgctgga 2040cccagctggg ggccttctac cccttcatgc ggaaccacaa cagcctgctc agtctgcccc 2100aggagccgta cagcttcagc gagccggccc agcaggccat gaggaaggcc ctcaccctgc 2160gctacgcact cctcccccac ctctacacgc tgttccacca ggcccacgtc gcgggggaga 2220ccgtggcccg gcccctcttc ctggagttcc ccaaggactc tagcacctgg actgtggacc 2280accagctcct gtggggggag gccctgctca tcaccccagt gctccaggcc gggaaggccg 2340aagtgactgg ctacttcccc ttgggcacat ggtacgacct gcagacggtg ccaatagagg 2400cccttggcag cctcccaccc ccacctgcag ctccccgtga gccagccatc cacagcgagg 2460ggcagtgggt gacgctgccg gcccccctgg acaccatcaa cgtccacctc cgggctgggt 2520acatcatccc cctgcagggc cctggcctca caaccacaga gtcccgccag cagcccatgg 2580ccctggctgt ggccctgacc aagggtggag aggcccgagg ggagctgttc tgggacgatg 2640gagagagcct ggaagtgctg gagcgagggg cctacacaca ggtcatcttc ctggccagga 2700ataacacgat cgtgaatgag ctggtacgtg tgaccagtga gggagctggc ctgcagctgc 2760agaaggtgac tgtcctgggc gtggccacgg cgccccagca ggtcctctcc aacggtgtcc 2820ctgtctccaa cttcacctac agccccgaca ccaaggtcct ggacatctgt gtctcgctgt 2880tgatgggaga gcagtttctc gtcagctggt gttagtctag agcttgctag cggccgc 2937272940DNAArtificial SequenceGILTd2-7d31-40-GAA70-952 cassette 27ggtaccagct gctagcaagc taattcacac caatgggaat cccaatgggg aagtcgatgc 60tggtgcttct caccttcttg gccttcgcct cgtgctgcat tgctgctctg tgcggcgggg 120agctggtgga caccctccag ttcgtctgtg gggaccgcgg cttctacttc agcaggggca 180tcgttgagga gtgctgtttc cgcagctgtg acctggccct cctggagacg tactgtgcta 240cccccgccaa gtccgagggc gcgccggcac accccggccg tcccagagca gtgcccacac 300agtgcgacgt cccccccaac agccgcttcg attgcgcccc tgacaaggcc atcacccagg 360aacagtgcga ggcccgcggc tgctgctaca tccctgcaaa gcaggggctg cagggagccc 420agatggggca gccctggtgc ttcttcccac ccagctaccc cagctacaag ctggagaacc 480tgagctcctc tgaaatgggc tacacggcca ccctgacccg taccaccccc accttcttcc 540ccaaggacat cctgaccctg cggctggacg tgatgatgga gactgagaac cgcctccact 600tcacgatcaa agatccagct aacaggcgct acgaggtgcc cttggagacc ccgcgtgtcc 660acagccgggc accgtcccca ctctacagcg tggagttctc tgaggagccc ttcggggtga 720tcgtgcaccg gcagctggac ggccgcgtgc tgctgaacac gacggtggcg cccctgttct 780ttgcggacca gttccttcag ctgtccacct cgctgccctc gcagtatatc acaggcctcg 840ccgagcacct cagtcccctg atgctcagca ccagctggac caggatcacc ctgtggaacc 900gggaccttgc gcccacgccc ggtgcgaacc tctacgggtc tcaccctttc tacctggcgc 960tggaggacgg cgggtcggca cacggggtgt tcctgctaaa cagcaatgcc atggatgtgg 1020tcctgcagcc gagccctgcc cttagctgga ggtcgacagg tgggatcctg gatgtctaca 1080tcttcctggg cccagagccc aagagcgtgg tgcagcagta cctggacgtt gtgggatacc 1140cgttcatgcc gccatactgg ggcctgggct tccacctgtg ccgctggggc tactcctcca 1200ccgctatcac ccgccaggtg gtggagaaca tgaccagggc ccacttcccc ctggacgtcc 1260aatggaacga cctggactac atggactccc ggagggactt cacgttcaac aaggatggct 1320tccgggactt cccggccatg gtgcaggagc tgcaccaggg cggccggcgc tacatgatga 1380tcgtggatcc tgccatcagc agctcgggcc ctgccgggag ctacaggccc tacgacgagg 1440gtctgcggag gggggttttc atcaccaacg agaccggcca gccgctgatt gggaaggtat 1500ggcccgggtc cactgccttc cccgacttca ccaaccccac agccctggcc tggtgggagg 1560acatggtggc tgagttccat gaccaggtgc ccttcgacgg catgtggatt gacatgaacg 1620agccttccaa cttcatcagg ggctctgagg acggctgccc caacaatgag ctggagaacc 1680caccctacgt gcctggggtg gttgggggga ccctccaggc ggcaaccatc tgtgcctcca 1740gccaccagtt tctctccaca cactacaacc tgcacaacct ctacggcctg accgaagcca 1800tcgcctccca cagggcgctg gtgaaggctc gggggacacg cccatttgtg atctcccgct 1860cgacctttgc tggccacggc cgatacgccg gccactggac gggggacgtg tggagctcct 1920gggagcagct cgcctcctcc gtgccagaaa tcctgcagtt taacctgctg ggggtgcctc 1980tggtcggggc cgacgtctgc ggcttcctgg gcaacacctc agaggagctg tgtgtgcgct 2040ggacccagct gggggccttc taccccttca tgcggaacca caacagcctg ctcagtctgc 2100cccaggagcc gtacagcttc agcgagccgg cccagcaggc catgaggaag gccctcaccc 2160tgcgctacgc actcctcccc cacctctaca cgctgttcca ccaggcccac gtcgcggggg 2220agaccgtggc ccggcccctc ttcctggagt tccccaagga ctctagcacc tggactgtgg 2280accaccagct cctgtggggg gaggccctgc tcatcacccc agtgctccag gccgggaagg 2340ccgaagtgac tggctacttc cccttgggca catggtacga cctgcagacg gtgccaatag 2400aggcccttgg cagcctccca cccccacctg cagctccccg tgagccagcc atccacagcg 2460aggggcagtg ggtgacgctg ccggcccccc tggacaccat caacgtccac ctccgggctg 2520ggtacatcat ccccctgcag ggccctggcc tcacaaccac agagtcccgc cagcagccca 2580tggccctggc tgtggccctg accaagggtg gagaggcccg aggggagctg ttctgggacg 2640atggagagag cctggaagtg ctggagcgag gggcctacac acaggtcatc ttcctggcca 2700ggaataacac gatcgtgaat gagctggtac gtgtgaccag tgagggagct ggcctgcagc 2760tgcagaaggt gactgtcctg ggcgtggcca cggcgcccca gcaggtcctc tccaacggtg 2820tccctgtctc caacttcacc tacagccccg acaccaaggt cctggacatc tgtgtctcgc 2880tgttgatggg agagcagttt ctcgtcagct ggtgttagtc tagagcttgc tagcggccgc 2940282943DNAArtificial SequenceGILTd2-7d32-40-GAA70-952 cassette 28ggtaccagct gctagcaagc taattcacac caatgggaat cccaatgggg aagtcgatgc 60tggtgcttct caccttcttg gccttcgcct cgtgctgcat tgctgctctg tgcggcgggg 120agctggtgga caccctccag ttcgtctgtg gggaccgcgg cttctacttc agcaggcccg 180gcatcgttga ggagtgctgt ttccgcagct gtgacctggc cctcctggag acgtactgtg 240ctacccccgc caagtccgag ggcgcgccgg cacaccccgg ccgtcccaga gcagtgccca 300cacagtgcga cgtccccccc aacagccgct tcgattgcgc ccctgacaag gccatcaccc 360aggaacagtg cgaggcccgc ggctgctgct acatccctgc aaagcagggg ctgcagggag 420cccagatggg gcagccctgg tgcttcttcc cacccagcta ccccagctac aagctggaga 480acctgagctc ctctgaaatg ggctacacgg ccaccctgac ccgtaccacc cccaccttct 540tccccaagga catcctgacc ctgcggctgg acgtgatgat ggagactgag aaccgcctcc 600acttcacgat caaagatcca gctaacaggc gctacgaggt gcccttggag accccgcgtg 660tccacagccg ggcaccgtcc ccactctaca gcgtggagtt ctctgaggag cccttcgggg 720tgatcgtgca ccggcagctg gacggccgcg tgctgctgaa cacgacggtg gcgcccctgt 780tctttgcgga ccagttcctt cagctgtcca cctcgctgcc ctcgcagtat atcacaggcc 840tcgccgagca cctcagtccc ctgatgctca gcaccagctg gaccaggatc accctgtgga 900accgggacct tgcgcccacg cccggtgcga acctctacgg gtctcaccct ttctacctgg 960cgctggagga cggcgggtcg gcacacgggg tgttcctgct aaacagcaat gccatggatg 1020tggtcctgca gccgagccct

gcccttagct ggaggtcgac aggtgggatc ctggatgtct 1080acatcttcct gggcccagag cccaagagcg tggtgcagca gtacctggac gttgtgggat 1140acccgttcat gccgccatac tggggcctgg gcttccacct gtgccgctgg ggctactcct 1200ccaccgctat cacccgccag gtggtggaga acatgaccag ggcccacttc cccctggacg 1260tccaatggaa cgacctggac tacatggact cccggaggga cttcacgttc aacaaggatg 1320gcttccggga cttcccggcc atggtgcagg agctgcacca gggcggccgg cgctacatga 1380tgatcgtgga tcctgccatc agcagctcgg gccctgccgg gagctacagg ccctacgacg 1440agggtctgcg gaggggggtt ttcatcacca acgagaccgg ccagccgctg attgggaagg 1500tatggcccgg gtccactgcc ttccccgact tcaccaaccc cacagccctg gcctggtggg 1560aggacatggt ggctgagttc catgaccagg tgcccttcga cggcatgtgg attgacatga 1620acgagccttc caacttcatc aggggctctg aggacggctg ccccaacaat gagctggaga 1680acccacccta cgtgcctggg gtggttgggg ggaccctcca ggcggcaacc atctgtgcct 1740ccagccacca gtttctctcc acacactaca acctgcacaa cctctacggc ctgaccgaag 1800ccatcgcctc ccacagggcg ctggtgaagg ctcgggggac acgcccattt gtgatctccc 1860gctcgacctt tgctggccac ggccgatacg ccggccactg gacgggggac gtgtggagct 1920cctgggagca gctcgcctcc tccgtgccag aaatcctgca gtttaacctg ctgggggtgc 1980ctctggtcgg ggccgacgtc tgcggcttcc tgggcaacac ctcagaggag ctgtgtgtgc 2040gctggaccca gctgggggcc ttctacccct tcatgcggaa ccacaacagc ctgctcagtc 2100tgccccagga gccgtacagc ttcagcgagc cggcccagca ggccatgagg aaggccctca 2160ccctgcgcta cgcactcctc ccccacctct acacgctgtt ccaccaggcc cacgtcgcgg 2220gggagaccgt ggcccggccc ctcttcctgg agttccccaa ggactctagc acctggactg 2280tggaccacca gctcctgtgg ggggaggccc tgctcatcac cccagtgctc caggccggga 2340aggccgaagt gactggctac ttccccttgg gcacatggta cgacctgcag acggtgccaa 2400tagaggccct tggcagcctc ccacccccac ctgcagctcc ccgtgagcca gccatccaca 2460gcgaggggca gtgggtgacg ctgccggccc ccctggacac catcaacgtc cacctccggg 2520ctgggtacat catccccctg cagggccctg gcctcacaac cacagagtcc cgccagcagc 2580ccatggccct ggctgtggcc ctgaccaagg gtggagaggc ccgaggggag ctgttctggg 2640acgatggaga gagcctggaa gtgctggagc gaggggccta cacacaggtc atcttcctgg 2700ccaggaataa cacgatcgtg aatgagctgg tacgtgtgac cagtgaggga gctggcctgc 2760agctgcagaa ggtgactgtc ctgggcgtgg ccacggcgcc ccagcaggtc ctctccaacg 2820gtgtccctgt ctccaacttc acctacagcc ccgacaccaa ggtcctggac atctgtgtct 2880cgctgttgat gggagagcag tttctcgtca gctggtgtta gtctagagct tgctagcggc 2940cgc 2943292946DNAArtificial SequenceGILTd2-7d33-40-GAA70-952 cassette 29ggtaccagct gctagcaagc taattcacac caatgggaat cccaatgggg aagtcgatgc 60tggtgcttct caccttcttg gccttcgcct cgtgctgcat tgctgctctg tgcggcgggg 120agctggtgga caccctccag ttcgtctgtg gggaccgcgg cttctacttc agcaggcccg 180caggcatcgt tgaggagtgc tgtttccgca gctgtgacct ggccctcctg gagacgtact 240gtgctacccc cgccaagtcc gagggcgcgc cggcacaccc cggccgtccc agagcagtgc 300ccacacagtg cgacgtcccc cccaacagcc gcttcgattg cgcccctgac aaggccatca 360cccaggaaca gtgcgaggcc cgcggctgct gctacatccc tgcaaagcag gggctgcagg 420gagcccagat ggggcagccc tggtgcttct tcccacccag ctaccccagc tacaagctgg 480agaacctgag ctcctctgaa atgggctaca cggccaccct gacccgtacc acccccacct 540tcttccccaa ggacatcctg accctgcggc tggacgtgat gatggagact gagaaccgcc 600tccacttcac gatcaaagat ccagctaaca ggcgctacga ggtgcccttg gagaccccgc 660gtgtccacag ccgggcaccg tccccactct acagcgtgga gttctctgag gagcccttcg 720gggtgatcgt gcaccggcag ctggacggcc gcgtgctgct gaacacgacg gtggcgcccc 780tgttctttgc ggaccagttc cttcagctgt ccacctcgct gccctcgcag tatatcacag 840gcctcgccga gcacctcagt cccctgatgc tcagcaccag ctggaccagg atcaccctgt 900ggaaccggga ccttgcgccc acgcccggtg cgaacctcta cgggtctcac cctttctacc 960tggcgctgga ggacggcggg tcggcacacg gggtgttcct gctaaacagc aatgccatgg 1020atgtggtcct gcagccgagc cctgccctta gctggaggtc gacaggtggg atcctggatg 1080tctacatctt cctgggccca gagcccaaga gcgtggtgca gcagtacctg gacgttgtgg 1140gatacccgtt catgccgcca tactggggcc tgggcttcca cctgtgccgc tggggctact 1200cctccaccgc tatcacccgc caggtggtgg agaacatgac cagggcccac ttccccctgg 1260acgtccaatg gaacgacctg gactacatgg actcccggag ggacttcacg ttcaacaagg 1320atggcttccg ggacttcccg gccatggtgc aggagctgca ccagggcggc cggcgctaca 1380tgatgatcgt ggatcctgcc atcagcagct cgggccctgc cgggagctac aggccctacg 1440acgagggtct gcggaggggg gttttcatca ccaacgagac cggccagccg ctgattggga 1500aggtatggcc cgggtccact gccttccccg acttcaccaa ccccacagcc ctggcctggt 1560gggaggacat ggtggctgag ttccatgacc aggtgccctt cgacggcatg tggattgaca 1620tgaacgagcc ttccaacttc atcaggggct ctgaggacgg ctgccccaac aatgagctgg 1680agaacccacc ctacgtgcct ggggtggttg gggggaccct ccaggcggca accatctgtg 1740cctccagcca ccagtttctc tccacacact acaacctgca caacctctac ggcctgaccg 1800aagccatcgc ctcccacagg gcgctggtga aggctcgggg gacacgccca tttgtgatct 1860cccgctcgac ctttgctggc cacggccgat acgccggcca ctggacgggg gacgtgtgga 1920gctcctggga gcagctcgcc tcctccgtgc cagaaatcct gcagtttaac ctgctggggg 1980tgcctctggt cggggccgac gtctgcggct tcctgggcaa cacctcagag gagctgtgtg 2040tgcgctggac ccagctgggg gccttctacc ccttcatgcg gaaccacaac agcctgctca 2100gtctgcccca ggagccgtac agcttcagcg agccggccca gcaggccatg aggaaggccc 2160tcaccctgcg ctacgcactc ctcccccacc tctacacgct gttccaccag gcccacgtcg 2220cgggggagac cgtggcccgg cccctcttcc tggagttccc caaggactct agcacctgga 2280ctgtggacca ccagctcctg tggggggagg ccctgctcat caccccagtg ctccaggccg 2340ggaaggccga agtgactggc tacttcccct tgggcacatg gtacgacctg cagacggtgc 2400caatagaggc ccttggcagc ctcccacccc cacctgcagc tccccgtgag ccagccatcc 2460acagcgaggg gcagtgggtg acgctgccgg cccccctgga caccatcaac gtccacctcc 2520gggctgggta catcatcccc ctgcagggcc ctggcctcac aaccacagag tcccgccagc 2580agcccatggc cctggctgtg gccctgacca agggtggaga ggcccgaggg gagctgttct 2640gggacgatgg agagagcctg gaagtgctgg agcgaggggc ctacacacag gtcatcttcc 2700tggccaggaa taacacgatc gtgaatgagc tggtacgtgt gaccagtgag ggagctggcc 2760tgcagctgca gaaggtgact gtcctgggcg tggccacggc gccccagcag gtcctctcca 2820acggtgtccc tgtctccaac ttcacctaca gccccgacac caaggtcctg gacatctgtg 2880tctcgctgtt gatgggagag cagtttctcg tcagctggtg ttagtctaga gcttgctagc 2940ggccgc 2946302949DNAArtificial SequenceGILTd2-7d34-40-GAA70-952 cassette 30ggtaccagct gctagcaagc taattcacac caatgggaat cccaatgggg aagtcgatgc 60tggtgcttct caccttcttg gccttcgcct cgtgctgcat tgctgctctg tgcggcgggg 120agctggtgga caccctccag ttcgtctgtg gggaccgcgg cttctacttc agcaggcccg 180caagcggcat cgttgaggag tgctgtttcc gcagctgtga cctggccctc ctggagacgt 240actgtgctac ccccgccaag tccgagggcg cgccggcaca ccccggccgt cccagagcag 300tgcccacaca gtgcgacgtc ccccccaaca gccgcttcga ttgcgcccct gacaaggcca 360tcacccagga acagtgcgag gcccgcggct gctgctacat ccctgcaaag caggggctgc 420agggagccca gatggggcag ccctggtgct tcttcccacc cagctacccc agctacaagc 480tggagaacct gagctcctct gaaatgggct acacggccac cctgacccgt accaccccca 540ccttcttccc caaggacatc ctgaccctgc ggctggacgt gatgatggag actgagaacc 600gcctccactt cacgatcaaa gatccagcta acaggcgcta cgaggtgccc ttggagaccc 660cgcgtgtcca cagccgggca ccgtccccac tctacagcgt ggagttctct gaggagccct 720tcggggtgat cgtgcaccgg cagctggacg gccgcgtgct gctgaacacg acggtggcgc 780ccctgttctt tgcggaccag ttccttcagc tgtccacctc gctgccctcg cagtatatca 840caggcctcgc cgagcacctc agtcccctga tgctcagcac cagctggacc aggatcaccc 900tgtggaaccg ggaccttgcg cccacgcccg gtgcgaacct ctacgggtct caccctttct 960acctggcgct ggaggacggc gggtcggcac acggggtgtt cctgctaaac agcaatgcca 1020tggatgtggt cctgcagccg agccctgccc ttagctggag gtcgacaggt gggatcctgg 1080atgtctacat cttcctgggc ccagagccca agagcgtggt gcagcagtac ctggacgttg 1140tgggataccc gttcatgccg ccatactggg gcctgggctt ccacctgtgc cgctggggct 1200actcctccac cgctatcacc cgccaggtgg tggagaacat gaccagggcc cacttccccc 1260tggacgtcca atggaacgac ctggactaca tggactcccg gagggacttc acgttcaaca 1320aggatggctt ccgggacttc ccggccatgg tgcaggagct gcaccagggc ggccggcgct 1380acatgatgat cgtggatcct gccatcagca gctcgggccc tgccgggagc tacaggccct 1440acgacgaggg tctgcggagg ggggttttca tcaccaacga gaccggccag ccgctgattg 1500ggaaggtatg gcccgggtcc actgccttcc ccgacttcac caaccccaca gccctggcct 1560ggtgggagga catggtggct gagttccatg accaggtgcc cttcgacggc atgtggattg 1620acatgaacga gccttccaac ttcatcaggg gctctgagga cggctgcccc aacaatgagc 1680tggagaaccc accctacgtg cctggggtgg ttggggggac cctccaggcg gcaaccatct 1740gtgcctccag ccaccagttt ctctccacac actacaacct gcacaacctc tacggcctga 1800ccgaagccat cgcctcccac agggcgctgg tgaaggctcg ggggacacgc ccatttgtga 1860tctcccgctc gacctttgct ggccacggcc gatacgccgg ccactggacg ggggacgtgt 1920ggagctcctg ggagcagctc gcctcctccg tgccagaaat cctgcagttt aacctgctgg 1980gggtgcctct ggtcggggcc gacgtctgcg gcttcctggg caacacctca gaggagctgt 2040gtgtgcgctg gacccagctg ggggccttct accccttcat gcggaaccac aacagcctgc 2100tcagtctgcc ccaggagccg tacagcttca gcgagccggc ccagcaggcc atgaggaagg 2160ccctcaccct gcgctacgca ctcctccccc acctctacac gctgttccac caggcccacg 2220tcgcggggga gaccgtggcc cggcccctct tcctggagtt ccccaaggac tctagcacct 2280ggactgtgga ccaccagctc ctgtgggggg aggccctgct catcacccca gtgctccagg 2340ccgggaaggc cgaagtgact ggctacttcc ccttgggcac atggtacgac ctgcagacgg 2400tgccaataga ggcccttggc agcctcccac ccccacctgc agctccccgt gagccagcca 2460tccacagcga ggggcagtgg gtgacgctgc cggcccccct ggacaccatc aacgtccacc 2520tccgggctgg gtacatcatc cccctgcagg gccctggcct cacaaccaca gagtcccgcc 2580agcagcccat ggccctggct gtggccctga ccaagggtgg agaggcccga ggggagctgt 2640tctgggacga tggagagagc ctggaagtgc tggagcgagg ggcctacaca caggtcatct 2700tcctggccag gaataacacg atcgtgaatg agctggtacg tgtgaccagt gagggagctg 2760gcctgcagct gcagaaggtg actgtcctgg gcgtggccac ggcgccccag caggtcctct 2820ccaacggtgt ccctgtctcc aacttcacct acagccccga caccaaggtc ctggacatct 2880gtgtctcgct gttgatggga gagcagtttc tcgtcagctg gtgttagtct agagcttgct 2940agcggccgc 2949312953DNAArtificial SequenceGILTd2-7M1/L27A37-GAA70-952 cassette 31ggtaccaagc ttgccatggg aatcccaatg ggcaagtcga tgctggtgct gctcaccttc 60ttggcctttg cctcgtgctg cattgccgct ctgtgcggcg gggaactggt ggacaccctc 120caattcgtct gtggggaccg gggcttcctg ttcagcagac ccgcaagccg tgtgagtgct 180cgcagccgtg gcattgttga ggagtgctgt tttcgcagct gtgacctggc tctcctggag 240acgtactgcg ctacccccgc caagtctgag ggcgcgccgg cacaccccgg ccgtcccaga 300gcagtgccca cacagtgcga cgtccccccc aacagccgct tcgattgcgc ccctgacaag 360gccatcaccc aggaacagtg cgaggcccgc ggctgctgct acatccctgc aaagcagggg 420ctgcagggag cccagatggg gcagccctgg tgcttcttcc cacccagcta ccccagctac 480aagctggaga acctgagctc ctctgaaatg ggctacacgg ccaccctgac ccgtaccacc 540cccaccttct tccccaagga catcctgacc ctgcggctgg acgtgatgat ggagactgag 600aaccgcctcc acttcacgat caaagatcca gctaacaggc gctacgaggt gcccttggag 660accccgcgtg tccacagccg ggcaccgtcc ccactctaca gcgtggagtt ctctgaggag 720cccttcgggg tgatcgtgca ccggcagctg gacggccgcg tgctgctgaa cacgacggtg 780gcgcccctgt tctttgcgga ccagttcctt cagctgtcca cctcgctgcc ctcgcagtat 840atcacaggcc tcgccgagca cctcagtccc ctgatgctca gcaccagctg gaccaggatc 900accctgtgga accgggacct tgcgcccacg cccggtgcga acctctacgg gtctcaccct 960ttctacctgg cgctggagga cggcgggtcg gcacacgggg tgttcctgct aaacagcaat 1020gccatggatg tggtcctgca gccgagccct gcccttagct ggaggtcgac aggtgggatc 1080ctggatgtct acatcttcct gggcccagag cccaagagcg tggtgcagca gtacctggac 1140gttgtgggat acccgttcat gccgccatac tggggcctgg gcttccacct gtgccgctgg 1200ggctactcct ccaccgctat cacccgccag gtggtggaga acatgaccag ggcccacttc 1260cccctggacg tccaatggaa cgacctggac tacatggact cccggaggga cttcacgttc 1320aacaaggatg gcttccggga cttcccggcc atggtgcagg agctgcacca gggcggccgg 1380cgctacatga tgatcgtgga tcctgccatc agcagctcgg gccctgccgg gagctacagg 1440ccctacgacg agggtctgcg gaggggggtt ttcatcacca acgagaccgg ccagccgctg 1500attgggaagg tatggcccgg gtccactgcc ttccccgact tcaccaaccc cacagccctg 1560gcctggtggg aggacatggt ggctgagttc catgaccagg tgcccttcga cggcatgtgg 1620attgacatga acgagccttc caacttcatc aggggctctg aggacggctg ccccaacaat 1680gagctggaga acccacccta cgtgcctggg gtggttgggg ggaccctcca ggcggcaacc 1740atctgtgcct ccagccacca gtttctctcc acacactaca acctgcacaa cctctacggc 1800ctgaccgaag ccatcgcctc ccacagggcg ctggtgaagg ctcgggggac acgcccattt 1860gtgatctccc gctcgacctt tgctggccac ggccgatacg ccggccactg gacgggggac 1920gtgtggagct cctgggagca gctcgcctcc tccgtgccag aaatcctgca gtttaacctg 1980ctgggggtgc ctctggtcgg ggccgacgtc tgcggcttcc tgggcaacac ctcagaggag 2040ctgtgtgtgc gctggaccca gctgggggcc ttctacccct tcatgcggaa ccacaacagc 2100ctgctcagtc tgccccagga gccgtacagc ttcagcgagc cggcccagca ggccatgagg 2160aaggccctca ccctgcgcta cgcactcctc ccccacctct acacgctgtt ccaccaggcc 2220cacgtcgcgg gggagaccgt ggcccggccc ctcttcctgg agttccccaa ggactctagc 2280acctggactg tggaccacca gctcctgtgg ggggaggccc tgctcatcac cccagtgctc 2340caggccggga aggccgaagt gactggctac ttccccttgg gcacatggta cgacctgcag 2400acggtgccaa tagaggccct tggcagcctc ccacccccac ctgcagctcc ccgtgagcca 2460gccatccaca gcgaggggca gtgggtgacg ctgccggccc ccctggacac catcaacgtc 2520cacctccggg ctgggtacat catccccctg cagggccctg gcctcacaac cacagagtcc 2580cgccagcagc ccatggccct ggctgtggcc ctgaccaagg gtggagaggc ccgaggggag 2640ctgttctggg acgatggaga gagcctggaa gtgctggagc gaggggccta cacacaggtc 2700atcttcctgg ccaggaataa cacgatcgtg aatgagctgg tacgtgtgac cagtgaggga 2760gctggcctgc agctgcagaa ggtgactgtc ctgggcgtgg ccacggcgcc ccagcaggtc 2820ctctccaacg gtgtccctgt ctccaacttc acctacagcc ccgacaccaa ggtcctggac 2880atctgtgtct cgctgttgat gggagagcag tttctcgtca gctggtgtta gtctagagct 2940tgctagcggc cgc 2953328PRTArtificial SequenceFurin cleavage site - ZC-701 32Arg Val Ser Arg Arg Ser Arg Gly 1 5 338PRTArtificial SequenceFurin cleavage site - p1459 K37 33Arg Val Ser Lys Arg Ser Arg Gly 1 5 348PRTArtificial SequenceFurin cleavage site - p1460 K40 34Arg Val Ser Arg Arg Ser Lys Gly 1 5 358PRTArtificial SequenceFurin cleavage site - p1461 A37 35Arg Val Ser Ala Arg Ser Arg Gly 1 5

Claims

1. A method of treating Sanfilippo B disease (MPS IIIB) comprising administering to a subject in need of treatment a targeted therapeutic fusion protein comprising: a lysosomal enzyme which is .alpha.-N-Acetylglucosaminidase (Naglu); an IGF-II mutein comprising amino acids 8-67 of SEQ ID NO: 1 and an Ala substitution at position Arg37 of SEQ ID NO:1, wherein the IGF-II mutein (i) has diminished binding affinity for the insulin receptor relative to the affinity of naturally-occurring human IGF-II for the insulin receptor, (ii) is resistant to furin cleavage and (iii) binds to the human cation-independent mannose-6-phosphate receptor in a mannose-6-phosphate-independent manner; and a spacer between the lysosomal enzyme and the IGF-II mutein, wherein the spacer comprises the amino acid sequence Gly-Ala-Pro.

2. The method of claim 1, wherein the IGF-II mutein is fused via the spacer to the C-terminus of the lysosomal enzyme.

3. The method of claim 1, wherein the IGF-II mutein is fused via the spacer to the N-terminus of the lysosomal enzyme.

4. The method of claim 1, wherein the IGF-II mutein consists of amino acids 8-67 of SEQ ID NO:1 having an Ala substitution at position Arg37 of SEQ ID NO:1.

5. The method of claim 1, comprising administering the targeted therapeutic fusion protein to the nervous system.

6. The method of claim 5, comprising administering the targeted therapeutic fusion protein intraventricularly and/or intrathecally.

7. The method of claim 1, comprising administering the targeted therapeutic fusion protein in an amount effective to reduce the severity or frequency, or delay the onset of, at least one symptom or feature of MPS IIIB.

8. The method of claim 7, comprising administering the targeted therapeutic fusion protein in an amount effective to decrease accumulated heparan sulfate in lysosomes.

9. The method of claim 1, comprising administering the targeted therapeutic fusion protein at an interval selected from daily, thrice weekly, twice weekly, weekly, biweekly, triweekly, monthly, and bimonthly.

10. The method of claim 1, comprising administering the targeted therapeutic fusion protein in a pharmaceutical composition comprising a water-soluble carrier.

11. A method of ameliorating the symptoms of Sanfilippo B disease (MPS IIIB) comprising administering to a subject in need of treatment a targeted therapeutic fusion protein comprising: a lysosomal enzyme which is .alpha.-N-Acetylglucosaminidase (Naglu); an IGF-II mutein comprising amino acids 8-67 of SEQ ID NO: 1 and an Ala substitution at position Arg37 of SEQ ID NO:1, wherein the IGF-II mutein (i) has diminished binding affinity for the insulin receptor relative to the affinity of naturally-occurring human IGF-II for the insulin receptor, (ii) is resistant to furin cleavage and (iii) binds to the human cation-independent mannose-6-phosphate receptor in a mannose-6-phosphate-independent manner; and a spacer between the lysosomal enzyme and the IGF-II mutein, wherein the spacer comprises the amino acid sequence Gly-Ala-Pro.

12. The method of claim 11, wherein the IGF-II mutein is fused via the spacer to the C-terminus of the lysosomal enzyme.

13. The method of claim 11, wherein the IGF-II mutein is fused via the spacer to the N-terminus of the lysosomal enzyme.

14. The method of claim 11, wherein the IGF-II mutein consists of amino acids 8-67 of SEQ ID NO:1 having an Ala substitution at position Arg37 of SEQ ID NO:1.

15. A method of delivering .alpha.-N-Acetylglucosaminidase (Naglu) enzyme activity to a cell deficient in Naglu enzyme activity comprising contacting the cell with a fusion protein comprising: a lysosomal enzyme which is .alpha.-N-Acetylglucosaminidase (Naglu); an IGF-II mutein comprising amino acids 8-67 of SEQ ID NO: 1 and an Ala substitution at position Arg37 of SEQ ID NO:1, wherein the IGF-II mutein (i) has diminished binding affinity for the insulin receptor relative to the affinity of naturally-occurring human IGF-II for the insulin receptor, (ii) is resistant to furin cleavage and (iii) binds to the human cation-independent mannose-6-phosphate receptor in a mannose-6-phosphate-independent manner; and a spacer between the lysosomal enzyme and the IGF-II mutein, wherein the spacer comprises the amino acid sequence Gly-Ala-Pro.

16. The method of claim 15, wherein the cell is a nerve cell.