Patent application title: COMPOSITIONS AND METHODS FOR DETECTING CANCER METASTASIS
Inventors:
IPC8 Class: AC12Q168FI
USPC Class:
1 1
Class name:
Publication date: 2016-12-15
Patent application number: 20160362750
Abstract:
The present invention encompasses compositions and methods for detecting
cancer metastasis.Claims:
1. A method for determining the risk of melanoma metastasis in a subject,
the method comprising: (a) analyzing BAP1 nucleic acid from a cell in a
sample obtained from a subject, (b) detecting the presence of a
truncating in the BAP1 nucleic acid mutation using multiplex
ligation-dependent probe amplification, wherein the mutation is selected
from the group consisting of: i. a nonsense mutation selected from the
group consisting of Q36X, W196X and Q253X of BAP1; ii. an insertion or
deletion mutation in exon 2, 4, 5, 6, 7, 8, 9, 11, 12, 13 or 17 of BAP1;
and iii. a splice acceptor mutation in exon 16 of BAP1; and (c)
identifying the subject as having an increased risk for metastasis when a
mutation is detected.
2. The method of claim 1, wherein the melanoma is uveal melanoma.
3. The method of claim 1, wherein the sample is a tumor sample.
4. The method of claim 3, wherein the sample is collected from a primary tumor or from a circulating tumor cell.
5. The method of claim 4, wherein the circulating tumor cell is collected from a bodily fluid.
6. A method for prognosing melanoma in a subject, the method comprising: (a) analyzing BAP1 nucleic acid from a cell in a sample obtained from a subject, (b) detecting the presence of a truncating mutation in the BAP1 nucleic acid mutation using multiplex ligation-dependent probe amplification, wherein the mutation is selected from the group consisting of: i. a nonsense mutation selected from the group consisting of Q36X, W196X and Q253X of BAP1; and ii. an insertion or deletion mutation in exon 2, 4, 5, 6, 7, 8 or 9 of BAP1; and (c) identifying the subject as having poor prognosis when a mutation is detected.
7. The method of claim 6, wherein the melanoma is uveal melanoma.
8. The method of claim 6, wherein the sample is a tumor sample.
9. The method of claim 8, wherein the sample is collected from a primary tumor or from a circulating tumor cell.
10. The method of claim 9, wherein the circulating tumor cell is collected from a bodily fluid.
Description:
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a continuation of U.S. Ser. No. 14/811,560, filed Jul. 28, 2015, which is a continuation of U.S. Ser. No. 13/243,572, filed Sep. 23, 2011, now U.S. Pat. No. 9,133,523, which claims the priority of U.S. provisional application No. 61/385,696, filed Sep. 23, 2010, each of the disclosure of which are hereby incorporated by reference in their entirety.
REFERENCE TO SEQUENCE LISTING
[0003] A paper copy of the sequence listing and a computer readable form of the same sequence listing are appended below and herein incorporated by reference. The information recorded in computer readable form is identical to the written sequence listing, according to 37 C.F.R. 1.821 (f).
FIELD OF THE INVENTION
[0004] The invention encompasses compositions and methods for detecting cancer metastasis.
BACKGROUND OF THE INVENTION
[0005] Once a primary tumor has metastasized and is clinically detectable by current diagnostic measures, treatment of the tumor becomes more complicated, and generally speaking, survival rates decrease. Consequently, it is advantageous to determine which tumors are more likely to metastasize and to advance the time to detection of metastasis, so that appropriate treatment may be started as soon as possible. Many different types of tumors are capable of metastasizing. Melanomas, in particular, are capable of aggressive metastasis.
[0006] Melanoma is a malignant tumor of melanocytes, and may occur in the eye (uveal melanoma), on the skin, or on mucosal tissues. Uveal melanoma is the most common intraocular malignancy. The incidence of this tumor increases with age and reaches a maximum between the 6.sup.th and 7.sup.th decade of life. Approximately 50% of patients die of metastases, a proportion that, despite all efforts to improve treatment, has remained constant during the last century. The average life expectancy after diagnosis of metastases is 7 months.
[0007] Around 160,000 new cases of melanoma of the skin are diagnosed worldwide each year, and according to the WHO Report about 48,000 melanoma related deaths occur worldwide per annum, which accounts for 75 percent of all deaths associated with skin cancer. Similar to uveal melanoma, when there is distant metastasis, the cancer is generally considered incurable. The five-year survival rate is less than 10%, with a median survival time of 6 to 12 months. Additionally, specific to uveal melanoma and cutaneous melanoma and generally considered for carcinoma, earlier treatment of malignancies is associated with improved progression-free and overall survival.
[0008] Due to the aggressive nature of these malignancies, there is a need in the art for methods of predicting the risk of metastasis and for earlier detection of metastatic disease, so that treatment may begin as early as possible.
SUMMARY OF THE INVENTION
[0009] One aspect of the present invention encompasses a method for determining the risk of metastasis in a subject. Generally speaking, the method comprises collecting a sample from a subject, analyzing the BAP1 nucleotide and/or BAP1 amino acid sequence from a cell in the sample, and identifying the presence of a mutation in the BAP1 nucleotide and/or BAP1 amino acid sequence. The presence of the mutation indicates an increased risk for metastasis in the subject.
[0010] Another aspect of the invention encompasses a method for determining the risk of metastasis in a subject, where the method comprises determining the level of BAP1 activity in a sample from a subject, wherein in decreased BAP1 activity indicates an increased risk for metastasis in the subject.
[0011] Still another aspect of the present invention encompasses a method for detecting the presence of metastatic cancer. Generally speaking, the method comprises collecting a sample from a subject, analyzing the BAP1 nucleotide and/or BAP1 amino acid sequence in the sample, and determining the presence of a mutation in the BAP1 nucleotide and/or BAP1 amino acid sequence. The presence of the mutation indicates the presence of metastatic melanoma.
[0012] Yet another aspect of the present invention encompasses a method for detecting the presence of metastatic cancer, the method comprising determining the level of BAP1 activity in a sample from a subject, wherein decreased BAP1 activity indicates the presence of metastatic cancer in the subject.
[0013] Still yet another aspect of the present invention encompasses a method for detecting the presence of a biomarker for metastatic cancer in a subject. The method may encompass a method for determining the risk of metastasis in a subject. Generally speaking, the method comprises analyzing the BAP1 gene nucleotide sequence and/or the BAP1 protein amino acid sequence from a tumor cell in a sample obtained from the subject, and identifying the presence of a mutation in the BAP1 nucleotide sequence and/or BAP1 protein sequence. The presence or absence of a mutation is as compared to the gene and/or protein sequence from a non-tumor cell from the same subject. For example, the gene nucleotide and/or protein amino acid sequence from a non-tumor cell may be SEQ ID NOs:3 and 1, respectively. Comparison may also be made between cDNA obtained from mRNA from a tumor cell and cDNA obtained from mRNA from a non-tumor cell, which may have BAP1 nucleotide sequence SEQ ID NO:2. The presence of a mutation, particularly an inactivating mutation as defined elsewhere herein, indicates an increased risk for metastasis in the subject.
[0014] The biomarker may be decreased BAP1 activity in a tumor cell from a subject, as compared to the activity in a non-tumor cell from the same subject. Decreased BAP1 activity may be indicative of an increased risk of metastasis in the subject and/or of the presence of metastatic cancer.
[0015] Certain aspects of the present invention encompass a method for detecting the presence of metastatic cancer. Generally speaking, the assay comprises analyzing the BAP1 gene nucleotide sequence or the BAP1 protein amino acid sequence in a tumor sample obtained from the subject, and detecting the presence of a mutation in the BAP1 nucleotide sequence or BAP1 protein sequence, as compared to the sequence in a non-tumor sample from the subject, as mentioned above. The presence of the mutation indicates the presence of metastatic melanoma.
[0016] Several aspects of the present invention encompasses a metastatic cancer biomarker, which may be detected in a tumor sample obtained from a subject. The biomarker typically comprises a BAP1 nucleotide sequence comprising at least one mutation, as compared to the BAP1 sequence in a non-tumor sample from the subject. The biomarker may also comprise a BAP1 amino acid sequence comprising at least one mutation. Such a biomarker may be detectable, for example, by use of an antibody which specifically recognizes the biomarker and such antibodies are also encompassed by the present invention. The biomarker may be detected by detecting reduced BAP1 activity in a cell from tumor sample from a subject, as compared to the activity in a cell from a non-tumor sample from the same subject.
[0017] Other aspects and iterations of the invention are described more thoroughly below.
BRIEF DESCRIPTION OF THE FIGURES
[0018] The application file contains at least one photograph executed in color. Copies of this patent application publication with color photographs will be provided by the Office upon request and payment of the necessary fee.
[0019] FIG. 1A, FIG. 1B, FIG. 1C and FIG. 1D illustrate that inactivating mutations in BAP1 occur frequently in uveal melanomas. (FIG. 1A) Sanger sequence traces of MM 056 and MM 070 at the sites of the mutations. Location of mutated base in MM 056 and the start of the deletion of MM 070 are indicated (arrows). The non-coding BAP1 strand is shown for MM 070. (SEQ ID NO:s 44-47) (FIG. 1B) Map of BAP1 gene and location of BAP1 mutations. BAP1 contains 17 exons (shaded boxes) that encode a 728 amino acid protein. Introns are not to scale. Mutations are shown below the gene figure as indicated. The UCH domain (aa. 1-188) and UCH37-like domain (ULD) (aa. 635-693) are indicated (12, 13). The critical Q, C, H and D residues of the active site (Gln85, Cys91, His169 and Asp184) are indicated with asterisks. The catalytic cysteine is indicated with a circle. Also shown are: the NHNY consensus sequence for interaction with HCFC1 (aa. 363-365, exon 11), nuclear localization signals (NLS) at aa. 656-661 (exon 15) and aa. 717-722 (exon 17), the BARD1 binding domain within the region bounded by aa. 182-240 (13), and the BRCA1 binding domain within aa. 598-729 (11). (FIG. 1C) Location of BAP1 gene missense mutations in the UCH domain aligned to the crystal structure of UCH-L3 (21). Three-dimensional structure of UCH-L3 was visualized with MMDB software (22). The small molecule near C91W, H169Q and S172R represents a suicide inhibitor, illustrating the critical location of these mutations for catalytic activity. (FIG. 1D) Conservation of BAP1 in regions containing mutated amino acids. Alignments of segments of BAP1 homologs harboring mutated amino acids (missense or in-frame deletions) are shown for the indicated species. (SEQ ID NO:48-60) Amino acid numbering is on the basis of human BAP1 (SEQ ID NO:1). Positions of mutated amino acids are indicated with asterisks.
[0020] FIG. 2 depicts Sanger sequence trace of one end of the mutated region of NB101. The breakpoint at one end of the insertion/deletion is indicated with an arrow. Wild type sequence is indicated below the NB101 sequence. (SEQ ID NO:61-62)
[0021] FIG. 3A and FIG. 3B depict bar graphs of BAP1 mRNA levels. (FIG. 3A) is a graph of BAP1 mRNA levels measured by quantitative RT-PCR in 9 non-metastasizing class 1 UMs and 28 metastasizing class 2 Ums, and (FIG. 3B) is a graph showing the relationship between BAP1 mRNA levels (measured by quantitative RT-PCR) and type of BAP1 mutation in 9 UMs with nonsense mutations, 10 UMs with missense mutations (including small in-frame deletions, splice acceptor, and stop codon read-through mutations), and 4 class 2 UMs in which no BAP1 mutations were detected.
[0022] FIG. 4 depicts a series of photographs illustrating that BAP1 mutations disrupt BAP1 protein expression in human uveal melanoma samples. Immunofluorescence analysis of BAP1 protein expression was performed on archival tumor specimens from uveal melanomas of known class and BAP1 mutation status, as indicated. All images were captured at 40.times. and are represented at the same magnification. Scale bar, 10 microns. No BAP1 expression is seen in the Class 2 metastasizing UM cells (MM100, MM071, MM135, MM091) whereas expression is seen in the class 1 non-metastasizing UM cells (MM050, MM085).
[0023] FIG. 5 depicts a series of micrographs illustrating that UM cells depleted of BAP1 acquire properties that are typical of metastasizing class 2 tumor cells. Phase contrast photomicrographs of 92.1 uveal melanoma cells transfected with BAP1 or control siRNA at the indicated days. Bottom panels show representative examples of class 1 and class 2 uveal melanoma cells obtained from patient biopsy samples (Papanicolaou stain). Scale bars, 10 microns.
[0024] FIG. 6 depicts a gene expression heatmap of the top class 1 versus class 2 discriminating transcripts in 92.1 uveal melanoma cells transfected with control versus BAP1 siRNAs.
[0025] FIG. 7A, FIG. 7B and FIG. 7C depict a diagram, a Western blot, and a bar graph, respectively, showing the effects of BAP1 depletion by siRNA. 92.1 cells transfected with BAP1 siRNA and evaluated after five days. (FIG. 7A) BAP1 protein levels were efficiently depleted to less than 95% of control levels (see Western blot). Upper panel depicts principal component analysis to show effect of BAP1 knockdown on gene expression signature. The small spheres represent the training set of known class 1 (blue) and class 2 (red) tumors. Large spheres represent the control-transfected (gray) and BAP1 siRNA transfected (red) cells. Lower panel depicts mRNA levels measured by quantitative RT-PCR of a panel of melanocyte lineage genes, presented as fold change in BAP1 siRNA/control siRNA transfected cells. Results are representative of three independent experiments. (FIG. 7B) mRNA levels of mRNAs of a panel of melanocyte lineage genes measured by quantitative RT-PCR, presented as fold change in BAP1 siRNA/control siRNA transfected cells. (FIG. 7C) RNAi mediated depletion of BAP1 in 92.1 and Mel290 UM cell lines using two independent siRNAs that target BAP1. Duplicate experiments of each cell line and siRNA are shown.
[0026] FIG. 8A, FIG. 8B, FIG. 8C and FIG. 8D depict a bar plot (FIG. 8A), a Western blot (FIG. 8B), and two micrographs showing BAP1 levels in shGFP (FIG. 8C) and shBAP1 (FIG. 8D) cells.
[0027] FIG. 9A and FIG. 9B depict Western blots showing increased ubiquitination of histone H2A in siBAP1 (FIG. 9A) and shBAP1 (FIG. 9B) cells compared to controls. FIG. 9C and FIG. 9D depict fluorescence immunohistochemical micrographs showing increased ubiquitination of histone H2A in shBAP1 (FIG. 9D) cells compared to control cells (FIG. 9C).
[0028] FIG. 10A and FIG. 10B depict bar plots from two experiments showing decreased RNA levels of melanocyte differentiation genes in BAP1 stable knockdown cells.
[0029] FIG. 11A, FIG. 11B and FIG. 11C depict plots showing that transient knockdown of BAP1 using siRNA (FIG. 11A) leads to a decrease in cell proliferation. Transient knockdown of BAP1 using shRNA did not alter cell proliferation (FIG. 11B and FIG. 11C).
[0030] FIG. 12A and FIG. 12B depict micrographs (FIG. 12A) and a bar plot (FIG. 12B) showing that loss of BAP1 in culture leads to decreased cell motility.
[0031] FIG. 13A, FIG. 13B and FIG. 13C depict images of shGFP (FIG. 13A) or shBAP1 (FIG. 13B) culture plates and a bar plot (FIG. 13C) showing that loss of BAP1 leads to decreased growth in soft agar.
[0032] FIG. 14A, FIG. 14B, FIG. 14C and FIG. 14 D depict bar plots from four experiments showing that loss of BAP1 leads to an increased ability to grow in clonegenic assays.
[0033] FIG. 15 depicts a bar plot showing that loss of BAP1 leads to increased migration towards a serum attractant.
[0034] FIG. 16A, FIG. 16B, FIG. 16C, FIG. 16D, FIG. 16E and FIG. 16F depict plots showing that loss of BAP1 in culture leads to decreased tumor growth in the mouse flank. FIG. 16A and FIG. 16D depict a decrease in weight of the tumor with loss of BAP1. FIG. 16B and FIG. 16E depict a decrease in volume of the tumor with loss of BAP1. FIG. 16C and FIG. 16F depict a decrease of BAP1 RNA expression in the presence of BAP1 shRNA.
[0035] FIG. 17A, FIG. 17B, FIG. 17C and FIG. 17D depict plots showing that loss of BAP1 in culture leads to decreased tumor growth in the mouse after tail vein injection.
[0036] FIG. 18 depicts an illustration of a family with germline BAP1 mutations.
[0037] FIG. 19A, FIG. 19B, FIG. 19C, FIG. 19D, FIG. 19E and FIG. 19F depict the genomic sequence of BAP1. Exons are bolded, and select mutations are highlighted (see Table 2).
DETAILED DESCRIPTION OF THE INVENTION
[0038] The present invention provides a method for determining the risk of tumor metastasis in a subject. Additionally, the invention provides a method for detecting the presence of a tumor metastasis in a subject. The invention further provides a method for detection of a metastatic cancer biomarker in a subject, wherein detection of the biomarker comprises identifying a mutation in a BAP1 nucleotide sequence, identifying a mutation in a BAP1 protein sequence, or identifying a decrease in BAP1 activity in a sample obtained from the subject. Advantageously, such methods may allow a physician to determine the severity of an oncogenic disease in a subject and to make appropriate, timely, treatment decisions based on this information.
I. Method for Determining the Risk of Tumor Metastasis
[0039] One aspect of the present invention encompasses a method for determining the risk of tumor metastasis in a subject. In one embodiment, the method comprises collecting a sample from a subject, analyzing the BAP1 nucleotide and/or BAP1 amino acid sequence from a cell in the sample, and identifying the presence of a mutation in the BAP1 nucleotide sequence and/or the BAP1 amino acid sequence. In this context, "a mutation in the BAP1 nucleotide sequence," refers to a mutation in an exon of BAP1, an intron of BAP1, the promoter of BAP1, the 5' untranslated region of BAP1, the 3' untranslated region of BAP1, or any other regulatory region for the BAP1 gene, such that the mutation decreases the expression of BAP1 mRNA, synthesis of BAP1 protein, or enzymatic activity of BAP1 when compared to the sequence of BAP1 from a non-tumor cell of the same individual. The presence of such a BAP1 mutation indicates an increased risk for metastasis in the subject. Nucleotide and amino acid sequence mutations in tumor cells are detected by comparison with the equivalent sequences from non-tumor cells from the same subject and/or by comparison to human wild type sequences SEQ ID NO:3 (genomic nucleotide sequence) and SEQ ID NO:1 (amino acid sequence). A mutation may also be identified by comparing cDNA sequences obtained from mRNA in a tumor and non-tumor cell. "Wild type" cDNA may have the sequence SEQ ID NO:2.
[0040] In another embodiment, the method comprises collecting a sample from a subject, and analyzing the level of BAP1 activity in the sample, where a decrease in BAP1 activity indicates an increased risk for metastasis in the subject.
[0041] Each of these embodiments are discussed in more detail below.
(a) Analyzing the BAP1 Sequence to Determine Risk of Tumor Metastasis
[0042] One embodiment comprises analyzing the BAP1 nucleotide sequence and/or BAP1 amino acid sequence of a sample collected from a subject as described in section (c) below. Typically, analyzing the BAP1 nucleotide sequence may comprise identifying a mutation in the BAP1 nucleotide sequence. As detailed above, "a mutation in the BAP1 sequence," refers to a mutation in an exon of BAP1, an intron of BAP1, the promoter of BAP1, the 5' untranslated region of BAP1, the 3' untranslated region of BAP1, or any other regulatory region for the BAP1 gene (e.g. a splice acceptor site), such that the mutation decreases the expression of BAP1 mRNA, synthesis of BAP1 protein, or enzymatic activity of BAP1 when compared to the sequence of BAP1 from a non-tumor cell of the same individual. Such a mutation may be a point mutation, a deletion mutation, or an insertion mutation. The mutation may be a missense or nonsense mutation. For instance, in one embodiment, the mutation may cause a premature truncation of BAP1. Alternatively, the mutation may affect a conserved amino acid in the ubiquitin carboxy-terminal hydrolase (UCH) domain or the UCH37-like domain (ULD) (for instance, see FIG. 1B). Such a mutation may be identified using methods commonly known in the art. For instance, see the Examples. Generally speaking, all or a portion of the BAP1 nucleic acid sequence may be sequenced and compared to the wild-type genomic sequence (SEQ ID NO:3) to identify a mutation. Alternatively or additionally, all or a portion of the BAP1 amino acid sequence may be compared to the wild-type amino acid sequence (SEQ ID NO:1) to identify a mutation. Alternatively or additionally, all or a portion of cDNA obtained from BAP1 mRNA may be compared to the cDNA nucleotide sequence (RefSeq #NM_004656; SEQ ID NO:2).
[0043] However, with the knowledge of the mutations provided herein, it is a routine matter to design detection means such as primers and/or probes that would be able to detect and/or identify mutated sequences, such as mutated nucleotide sequences which differ from the wild-type SEQ ID NO:3 (or SEQ ID NO:2, if cDNA is being examined), or mutated nucleotide sequences which differ from the BAP1 nucleotide sequence from a non-tumor cell of the subject. Possible techniques which might be utilized are well-established in the prior art and their use is readily adaptable by the skilled person for the purposes of detecting the BAP1 gene and/or BAP1 protein mutations disclosed herein. For example, amplification techniques may be used. Non-limiting examples of amplification techniques may include polymerase chain reaction, ligase chain reaction, nucleic acid sequence based amplification (NASBA), strand displacement amplification (SDA), transcription mediated amplification (TMA), Loop-Mediated Isothermal Amplification (LAMP), Q-beta replicase, Rolling circle amplification, 3SR, ramification amplification (Zhang et al. (2001) Molecular Diagnosis 6 p 141-150), multiplex ligation-dependent probe amplification (Schouten et al. (2002) Nucl. Ac. Res. 30 e57). Other related techniques for detecting mutations such as SNPs may include restriction fragment length polymorphism (RFLP), single strand conformation polymorphism (SSCP) and denaturing high performance liquid chromatography (DHPLC). A summary of many of these techniques can be found in "DNA Amplification: Current technologies and applications" (Eds. Demidov & Broude (2004) Pub. Horizon Bioscience, ISBN:0-9545232-9-6) and other current textbooks.
[0044] A mutation of BAP1 may be an inactivating mutation, i.e., expression levels of BAP1 mRNA and/or synthesis of BAP1 protein are reduced and/or BAP1 protein activity is reduced in cells from a tumor sample from a subject, compared to expression level and/or synthesis level and/or activity in cells from a non-tumor sample from the same subject. BAP1 protein activity may be, for example, ubiquitin carboxy-terminal hydrolase activity.
[0045] In one embodiment, a mutation of BAP1 may be found in exon 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 of the BAP1 nucleotide sequence. In another embodiment, a mutation of BAP1 may be found in the promoter of BAP1. In yet another embodiment, a mutation of BAP1 may be found in the 5' untranslated region. In still another embodiment, a mutation of BAP1 may be found in the 3' untranslated region. In a certain embodiment, a mutation of BAP1 may be found in a splice acceptor site.
[0046] In particular embodiments, a mutation may be selected from one or more of: deletion of the nucleotides equivalent to positions 3025-3074 of SEQ ID NO:3; deletion of the nucleotides equivalent to positions 2026-2028 of SEQ ID NO:2; substitution of the nucleotide cytosine with the nucleotide guanine at the position equivalent to position 622 of SEQ ID NO:2; substitution of the nucleotide guanine with the nucleotide adenine at the position equivalent to position 703 of SEQ ID NO:2; substitution of the nucleotide cytosine with the nucleotide thymine at the position equivalent to position 872 of SEQ ID NO:2; deletion of the nucleotides equivalent to positions 960-968 of SEQ ID NO:2; deletion of the nucleotides equivalent to positions 1083-1093 of SEQ ID NO:2; substitution of the nucleotide adenine with the nucleotide guanine at the position equivalent to position 2130 of SEQ ID NO:2; deletion of the nucleotides equivalent to positions 3313-3335 of SEQ ID NO:3; deletion of the nucleotides equivalent to positions 736-751 of SEQ ID NO:2; insertion of the nucleotide adenine between positions equivalent to positions 1318 and 1319 of SEQ ID NO:2; deletion of the nucleotides equivalent to positions 468-487 of SEQ ID NO:2 and insertion of the nucleotide adenine; deletion of nucleotide adenine at the position equivalent to position 874 of SEQ ID NO:2; deletion of the nucleotides equivalent to positions 726-759 of SEQ ID NO:3; substitution of the nucleotide thymine with the nucleotide adenine at the position equivalent to position 2303 of SEQ ID NO:2; deletion of the nucleotides equivalent to positions 1829-1833 of SEQ ID NO:2; deletion of nucleotide cytosine at the position equivalent to position 259 of SEQ ID NO:2; substitution of the nucleotide guanine with the nucleotide cytosine at the position equivalent to position 497 of SEQ ID NO:2; substitution of the nucleotide cytosine with the nucleotide guanine at the position equivalent to position 622 of SEQ ID NO:2; deletion of the nucleotides equivalent to positions 2112-2120 of SEQ ID NO:2; substitution of the nucleotide thymine with the nucleotide guanine at the position equivalent to position 388 of SEQ ID NO:2; deletion of the nucleotides equivalent to positions 2006-2017 of SEQ ID NO:2; deletion of the nucleotides equivalent to positions 610-634 of SEQ ID NO:2; deletion of the nucleotides equivalent to positions 739-776 of SEQ ID NO:3; substitution of the nucleotide guanine with the nucleotide thymine at the position equivalent to position 7819 of SEQ ID NO:3; substitution of the nucleotide cytosine with the nucleotide guanine at the position equivalent to position 631 of SEQ ID NO:2; deletion of the nucleotides equivalent to positions 2195-2220 of SEQ ID NO:2; substitution of the nucleotide cytosine with the nucleotide thymine at the position equivalent to position 221 of SEQ ID NO:2. As outlined above, nucleotide numbering is by reference to the human wild-type sequences, for example, as represented by SEQ ID NO:3 when comparing genomic DNA or SEQ ID NO:2 when comparing cDNA.
[0047] In a particular embodiment, a mutation may be a truncating mutation in exon 2, 3, 4, 5, 6, 7, 8, 9, 11, 13, 16 or 17 of BAP1, a missense mutation in exon 5, 6, 7 or 16, an in-frame deletion in exon 10, 15 or 16, or a termination read-through in exon 17. In another particular embodiment, a BAP1 mutation may be a nonsense mutation in a BAP1 protein encoded by the BAP1 nucleotide sequence, selected from Q36X, W196X, and Q253X. In yet another particular embodiment, a BAP1 mutation may be a missense mutation selected from C91W, G128R, H169Q, S172R or D672G. In still another particular embodiment, an in-frame deletion may be selected from the group E283-S285del, E631-A634del or R666-H669del. Amino acid numbering is by reference to the human wild type sequences, for example, as represented by SEQ ID NO:1.
(b) Analyzing the Level of BAP1 Activity
[0048] In other embodiments of the invention, the level of BAP1 activity in a sample is analyzed. The "level of BAP1 activity" may refer to the level of expression of BAP1 mRNA, the level of synthesis of BAP1 protein, or the level of enzymatic activity of BAP1 in a sample.
[0049] In one embodiment, the level of BAP1 activity may refer to the level of expression of BAP1 mRNA in a sample. Generally speaking, if a sample has a decreased level of expression of BAP1 mRNA, then the subject has an increased risk of metastasis. In certain embodiments, the level of BAP1 activity is decreased about 50% to about 100% compared to a non-tumor cell from the same individual. In other embodiments, the level of BAP1 activity is decreased from about 60% to about 100% compared to a non-tumor cell from the same individual. In still other embodiments, the level of BAP1 activity is decreased from about 70% to about 95% compared to a non-tumor cell from the same individual. In certain embodiments, the level of BAP1 activity is decreased about 100, 99, 98, 97, 96, 95, 94, 93, 92, 91, 90, 89, 88, 87, 86, 85, 84, 83, 82, 81, 80, 79, 78, 77, 76, 75, 74, 73, 72, 71, 70, 69, 68, 67, 66, 65, 64, 63, 62, 61, 60, 59, 58, 57, 56, 55, 54, 53, 52, 51, or 50% compared to a non-tumor cell from the same individual.
[0050] Determining the level of expression of a BAP1 nucleic acid sequence, comprises, in part, measuring the level of BAP1 mRNA expression in a tumor sample. Methods of measuring the level of mRNA in a tumor sample for a particular nucleic acid sequence, or several sequences, are known in the art. For instance, in one embodiment, the level of mRNA expression may be determined using a nucleic acid microarray. Methods of using a nucleic acid microarray are well and widely known in the art. In another embodiment, the level of mRNA expression may be determined using PCR. In these embodiments, the mRNA is typically reverse transcribed into cDNA using methods known in the art. The cDNA may, for example, have nucleotide sequence SEQ ID NO:2 when derived from mRNA obtained from a non tumor cell. Methods of PCR are well and widely known in the art, and may include quantitative PCR, semi-quantitative PCR, multi-plex PCR, or any combination thereof. Other nucleic acid amplification techniques and methods are suggested above. In yet another embodiment, the level of mRNA expression may be determined using a TLDA (TaqMan low density array) card manufactured by Applied Biosciences, or a similar assay. The level of mRNA expression may be measured by measuring an entire mRNA transcript for a nucleic acid sequence, or measuring a portion of the mRNA transcript for a nucleic acid sequence. For instance, if a nucleic acid array is utilized to measure the level of mRNA expression, the array may comprise a probe for a portion of the mRNA of the nucleic acid sequence of interest, or the array may comprise a probe for the full mRNA of the nucleic acid sequence of interest. Similarly, in a PCR reaction, the primers may be designed to amplify the entire cDNA sequence of the nucleic acid sequence of interest, or a portion of the cDNA sequence. One of skill in the art will recognize that there is more than one set of primers that may be used to amplify either the entire cDNA or a portion of the cDNA for a nucleic acid sequence of interest. Methods of designing primers are known in the art.
[0051] Methods of extracting RNA from a tumor sample are known in the art. For instance, see Examples 1 and 2 of PCT/US09/041436, herein incorporated by reference in its entirety.
[0052] The level of expression may or may not be normalized to the level of a control gene. Such a control gene should have a constant expression in a tumor sample, regardless of the risk for metastasis of the tumor. This allows comparisons between assays that are performed on different occasions.
[0053] In another embodiment, the level of BAP1 activity may refer to the level of BAP1 protein synthesis in a sample. Generally speaking, a decreased level of BAP1 synthesis in a sample indicates an increased risk of metastasis in the subject. Methods of measuring the synthesis of BAP1 are known in the art. For instance, immunofluorescence may be used, as described in the Examples.
[0054] In yet another embodiment, the level of BAP1 activity may refer to the level of BAP1 enzymatic activity in a sample. Generally speaking, a decreased level of BAP1 enzymatic activity indicates an increased risk of metastasis in a subject. BAP1 has ubiquitin carboxy-terminal hydrolase activity. Such activity may be measured using methods well known in the art. See, for instance, Scheuermann J C, et al: Histone H2A deubiquitinase activity of the Polycomb repressive complex PR-DUB, Nature 2010, 465:243-247 (the measurement of histone H2A monoubiquitination); Machida Y J, et al: The deubiquitinating enzyme BAP1 regulates cell growth via interaction with HCF-1, J Biol Chem 2009, 284:34179-34188 (the measurement of HCFC1 deubiquitination); Russell N S, Wilkinson K D. Deubiquitinating enzyme purification, assay inhibitors, and characterization. Methods Mol Biol 2005; 301:207-19 (other strategies for measurement of deubiquitinating enzymatic activity using substrates that can be monitored, such as described in Russell et al.).
(c) Collecting a Sample from a Subject
[0055] A method of the invention comprises, in part, collecting a sample from a subject. Suitable samples comprise one or more tumor cells, either from a primary tumor or a metastasis. In one embodiment, a suitable sample comprises a melanoma cell. In another embodiment, a suitable sample comprises a carcinoma cell. In yet another embodiment, a suitable sample comprises a sarcoma cell. In an exemplary embodiment, a suitable sample comprises a uveal melanoma cell. In another exemplary embodiment, a suitable sample comprises a cutaneous melanoma cell. In some embodiments, a suitable sample may be a circulating tumor cell. Circulating tumor cells may be found in a bodily fluid (e.g. plasma, sputum, urine, etc.) or other excrement (e.g. feces).
[0056] Methods of collecting tumor samples are well known in the art. For instance, a tumor sample may be obtained from a surgically resected tumor. In uveal melanoma, for example, a tumor sample may be obtained from an enucleation procedure. Alternatively, the tumor sample may be obtained from a biopsy. This is advantageous when the tumor is small enough to not require resection. In an exemplary embodiment, the tumor sample may be obtained from a fine needle biopsy, also known as a needle aspiration biopsy (NAB), a fine needle aspiration cytology (FNAC), a fine needle aspiration biopsy (FNAB) or a fine needle aspiration (FNA). A tumor sample may be fresh or otherwise stored so as to reduce nucleic acid degradation. For instance, a tumor sample may be a fresh frozen tumor sample or a formalin-fixed paraffin embedded tumor sample.
[0057] In certain embodiments, the method of the invention may be performed with a tumor sample comprising about five cells or less. In one embodiment, the tumor sample may comprise about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15 or more cells. In another embodiment, the tumor sample may comprise 20, 25, 30, 35, 40 or more cells.
(d) Determining the Risk of Metastasis
[0058] A method of the invention further comprises determining the risk of metastasis. The level of risk is a measure of the probability of a metastasis occurring in a given individual. If a mutation is identified, as described in section (a) above, in a sample from a subject, then the subject is at a higher risk (i.e., there is an increased probability) of developing metastases then a subject without a mutation in a BAP1 nucleotide sequence and/or BAP1 amino acid sequence. Alternatively, if the level of BAP1 activity is decreased, as described in section (b) above, then the subject is at a higher risk of developing metastases then a subject with out a decreased level of BAP1 activity. For instance, the risk may be greater than about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%. In some embodiments, the risk may be greater than about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95%. In particular embodiments, the risk may continue to increase over time. For example, the risk may be about 50% at five years after initial cancer diagnosis and 90% for ten years.
[0059] Alternatively, if a mutation in not identified (i.e. the BAP1 nucleotide and corresponding amino acid sequence is wild-type) in a sample from a subject, then the subject is at lower risk of developing metastases. Similarly, if the level of BAP1 activity is not decreased, then the subject is at a lower risk of developing metastasis. For instance, the risk may be less than about 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, or 5%. In some embodiments, the risk may be less than about 20%, 15%, 10%, or 5%. In particular embodiments, the risk may be low, but may still increase over time. For example, the risk may be about 5% at five years and 10% at ten years.
[0060] Increased or decreased "risk" or "probability" may be determined, for example, by comparison to the average risk or probability of an individual cancer patient within a defined population developing metastasis. For example, by way of illustration, for a given cancer the overall proportion of patients who are diagnosed with a metastasis within 5 years of initial cancer diagnosis may be 50%. In this theoretical context, an increased risk for an individual will mean that they are more than 50% likely to develop a metastasis within 5 years, whereas a reduced risk will mean that they are less than 50% likely to develop a metastasis. Such comparisons may, in some circumstances, be made within patient populations limited or grouped using other factors such as age, ethnicity, and/or the presence or absence of other risk factors.
(e) Combination of Methods
[0061] In certain embodiments, a method of the invention may be used in conjunction with a method as described in PCT/US09/041436, herein incorporated by reference in its entirety, to determine the risk of metastasis in a subject.
II. Method for Detecting a Metastasis
[0062] Another aspect of the present invention is a method for detecting the presence of a metastasis. In one embodiment, the method generally comprises collecting a sample from a subject, analyzing the BAP1 nucleotide and/or BAP1 amino acid sequence in the sample, and determining the presence of a mutation in the BAP1 sequence. The presence of the mutation indicates the presence of a metastasis. As outlined above, the presence of a mutation may be determined by comparison of a sequence from a tumor cell with a sequence from a non-tumor cell from the same subject and/or by comparison to SEQ ID NO:1 (wild type amino acid sequence) or SEQ ID NO:3 (wild type genomic DNA sequence). It may also be determined by obtaining cDNA from BAP1 mRNA in the cell and comparing the sequence to SEQ ID NO:2.
[0063] In another embodiment, the method comprises collecting a sample from a subject, and analyzing the level of BAP1 activity in the sample, where a decrease in BAP1 activity indicates the presence of a metastasis in the subject. Suitable samples, methods of analyzing a BAP1 nucleotide sequence and/or BAP1 amino acid sequence, and methods of determining the level of BAP1 activity in a sample are described in section I above.
III. Biomarker for Metastasis
[0064] Yet another aspect of the invention encompasses a biomarker for tumor metastasis. In one embodiment, a biomarker of the invention comprises a mutation in a BAP1 nucleotide sequence and/or BAP1 amino acid sequence, as described in section I(a) above. In another embodiment, a biomarker of the invention comprises a decreased level of BAP1 activity, as described in section I(b) above. This may include a decrease in BAP1 protein synthesis. Where the biomarker is a BAP1 amino acid sequence comprising a mutation, the presence of the biomarker may be detected by use of an antibody which specifically binds to the biomarker. Such antibodies are encompassed within the scope of the present invention, as well as kits comprising the antibody and methods of use thereof. In each of the above embodiments, a tumor may be a melanoma, carcinoma, or sarcoma. In an exemplary embodiment, the tumor is a melanoma. In a further exemplary embodiment, the tumor is a uveal melanoma. In yet another exemplary embodiment, the tumor is a cutaneous melanoma.
DEFINITIONS
[0065] As used herein, "carcinoma" refers to a malignant tumor derived from an epithelial cell. Non-limiting examples of carcinoma may include epithelial neoplasms, squamous cell neoplasms, squamous cell carcinoma, basal cell neoplasms, basal cell carcinoma, transitional cell carcinomas, adnexal and skin appendage neoplasms, mucoepidermoid neoplasms, cystic, mucinous and serous neoplasms, ductal, lobular and medullary neoplasms, acinar cell neoplasms, complex epithelial neoplasms, squamous cell carcinoma, adenosquamous carcinoma, anaplastic carcinoma, large cell carcinoma, small cell carcinoma, and adenocarcinomas such as adenocarcinoma, linitis plastica, vipoma, cholangiocarcinoma, hepatocellular carcinoma, adenoid cystic carcinoma, and grawitz tumor.
[0066] As used herein, "melanoma" refers to a malignant tumor of a melanocyte. In one embodiment, the melanoma may be a uveal melanoma. In another embodiment, the melanoma may be a cutaneous melanoma. In another embodiment, the melanoma may be a mucosal melanoma.
[0067] As used herein, "regulatory region" refers to a nucleic acid sequence operably linked to a nucleic acid encoding BAP1 such that the regulatory region modulates the transcription of BAP1 mRNA.
[0068] As used herein, "sarcoma" refers to a malignant tumor derived from connective tissue. Non limiting examples of a sarcoma may include Askin's Tumor, botryoid sarcoma, chondrosarcoma, Ewing's sarcoma, primitive neuroectodermal tumor (PNET), malignant hemangioendothelioma, malignant peripheral nerve sheath tumor (malignant schwannoma), osteosarcoma and soft tissue sarcomas such as alveolar soft part sarcoma, angiosarcoma, cystosarcoma phyllodes, dermatofibrosarcoma, desmoid Tumor, desmoplastic small round cell tumor, epithelioid sarcoma, extraskeletal chondrosarcoma, extraskeletal osteosarcoma, fibrosarcoma, hemangiopericytoma, hemangiosarcoma, Kaposi's sarcoma, leiomyosarcoma, liposarcoma. Lymphangiosarcoma, lymphosarcoma, malignant fibrous histiocytoma, neurofibrosarcoma, rhabdomyosarcoma, and synovial sarcoma.
[0069] As used herein, "subject" refers to a mammal capable of being afflicted with a carcinoma, melanoma, or sarcoma, and that expresses a homolog to BAP1. In addition to having a substantially similar biological function, a homolog of BAP1 will also typically share substantial sequence similarity with the nucleic acid sequence of BAP1. For example, suitable homologs preferably share at least 30% sequence homology, more preferably, 50%, and even more preferably, are greater than about 75% homologous in sequence. In determining whether a sequence is homologous to BAP1, sequence similarity may be determined by conventional algorithms, which typically allow introduction of a small number of gaps in order to achieve the best fit. In particular, "percent homology" of two polypeptides or two nucleic acid sequences may be determined using the algorithm of Karlin and Altschul [(Proc. Natl. Acad. Sci. USA 87, 2264 (1993)]. Such an algorithm is incorporated into the NBLAST and XBLAST programs of Altschul, et al. (J. Mol. Biol. 215, 403 (1990)). BLAST nucleotide searches may be performed with the NBLAST program to obtain nucleotide sequences homologous to a nucleic acid molecule of the invention. Equally, BLAST protein searches may be performed with the XBLAST program to obtain amino acid sequences that are homologous to a polypeptide of the invention. To obtain gapped alignments for comparison purposes, Gapped BLAST is utilized as described in Altschul, et al. (Nucleic Acids Res. 25, 3389 (1997)). When utilizing BLAST and Gapped BLAST programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) are employed. See www.ncbi.nlm.nih.gov for more details. In an exemplary embodiment, the subject is human. In certain embodiments, the subject may have a carcinoma, sarcoma, or melanoma. In other embodiments, the subject may be suspected of having a carcinoma, sarcoma, or melanoma.
[0070] The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples that follow represent techniques discovered by the inventors to function well in the practice of the invention. Those of skill in the art should, however, in light of the present disclosure, appreciate that may changes can be made in the specific embodiments that are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention, therefore all matter set forth or shown in the accompanying drawings is to be interpreted as illustrative and not in a limiting sense.
Examples
[0071] The following examples illustrate various iterations of the invention.
Example 1
BAP1 Mutations and Uveal Melanoma Metastasis
[0072] Uveal melanoma (UM) is the most common primary cancer of the eye and has a strong propensity for fatal metastasis (1). UMs are divided into class 1 (low metastatic risk) and class 2 (high metastatic risk) based on a validated multi-gene clinical prognostic assay included in the TNM classification system (2, 3). However, the genetic basis of metastasis remains unclear. Oncogenic mutations in the G.alpha..sub.q stimulatory subunit GNAQ are common in UM (4), but these mutations occur early in tumorigenesis and are not correlated with molecular class or metastasis (5, 6). On the other hand, class 2 tumors are strongly associated with monosomy 3 (7), suggesting that loss of one copy of chromosome 3 may unmask a mutant gene on the remaining copy which promotes metastasis.
[0073] Using exome capture followed by massively parallel sequencing (8, 9), we analyzed two class 2 tumors that were monosomic for chromosome 3 (MM56 and MM70) and matching normal DNA from peripheral blood lymphocytes. Both tumors contained inactivating mutations in BAP1, located at chromosome 3p21.1 (FIG. 1A). MM56 contained a C/G to T/A transition that created a premature termination codon (p.W196X). MM70 contained a deletion of 11 bp in exon 11, leading to a frameshift and premature termination of the BAP1 protein (p.Q322fsX100). The matched normal DNA samples did not contain these mutations, indicating that they were likely to be somatic in origin. No gene on chromosome 3 other than BAP1 contained deleterious somatic mutations that were present in both tumors (Table 1).
TABLE-US-00001 TABLE 1 Summary of DNA sequence alterations identified by exome capture and massively parallel sequencing of tumor DNA and matching normal peripheral blood lymphocyte DNA from uveal melanomas MM056 and MM070 Present on Chr 3 Ref. New Sanger location Indel End Reference Amino New Amino Ref base Read sequence (hg19) Tumor (hg19) Gene Codon Acid Codon Acid (hg19) Consensus Depth validation.sup.2 20,216,514 MM56 SGOL1 GGA G GTA V C M 16 No 43,641,970 MM70 AN010 CTA L CTG L T Y 77 Not done 44,488,382 MM56 ZNF445 AGC S AGA R G K 14 Not done 44,636,130 MM70 ZNF660 CTT L ATT I C M 9 No 45,715,863 MM56 LIMD1 TCC S TAC Y C M 53 No 46,008,495 MM70 FYCO1 CAG Q CAT H C M 19 Not done 48,457,135 MM56 PLXNB1 TGT C TGC C A R 11 Not done 48,630,022 MM56 COL7A1 GTG V GTT V C M 9 Not done 49,690,418 MM56 BSN CCT P CCA P T W 11 No 49,699,662 MM56 BSN TGG W GGG G T K 21 No 52,439,264 MM70* 52,439,274 BAP1 deletion CCCC deleted 19 Yes ATCC CAC (SEQ ID NO: 5) 52,439,264 MM70* BAP1 CAC H CAG Q G Q 15 Yes 52,439,266 MM70* BAP1 CAC H AAC N G N 13 Yes 52,440,916 MM56 BAP1 TGG W TGA X C X 27 Yes 52,814,305 MM56 ITIH1 GAG E GAT D G K 15 No 56,650,054 MM70 CCDC66 TCT S CCT P T Y 13 No 123,695,755 MM70 ROPN1 CGG R TGG W G R 39 Yes (germline) 135,825,122 MM70 PPP2R3A ACG T ATG M C Y 33 Yes (somatic) 172,351,305 MM56 NCEH1 ACT T AAT N G K 20 No 180,327,975 MM70 TTC14 GGA G GAA E G K 22 No 183,041,104 MM56 MCF2L2 GGC G GGA G G K 25 Not done 194,062,926 MM56 CPN2 ACC T AAC N G K 24 No 194,408,437 MM56 FAM43A GAG E GAT D G K 9 No 195,306,227 MM70 APOD AAT N GAT D T Y 21 Not done .sup.1In the case of Insertion/Deletions (InDels) that were detected with Novoalign, column 1 defInes the start and column 3 defines the end. The BAP1 mutations reported in the current manuscript are asterisked and were incorrectly detected as base substitutions in the case of the InDel in MM70, in addition to being correctly detected as an InDel with Novoalign. This is why several substitutions are reported in MM70 for this gene, although they correspond to a single mutational event. We detected 20 additional putative somatic mutations in genes on chromosome 3. The predicted codon and amino acid changes for the appropriate strand are indicated where applicable, along with the base in the hg19 reference sequence and the base change reported as a consensus using IUPAC nomenclature. Reference bases and reference base changes are reported for the plus strand. Depth refers to the read depth of the altered base in the tumor sample. Sanger resequencing was performed to validate each variant detected in the tumor but not the germline. .sup.2In the case of one mutation residing in ROPN1 the mutation was confirmed in the tumor and was also seen in the blood. This had been missed with exome capture. In the case of one mutation residing in PPP2R3A in tumor MM070 the mutation was confirmed to be a somatic alteration.
[0074] BAP1 encodes a nuclear ubiquitin carboxy-terminal hydrolase (UCH), one of several classes of deubiquitinating enzymes (10). In addition to the UCH catalytic domain, BAP1 contains a UCH37-like domain (ULD) (11), binding domains for BRCA1 and BARD1, which form a tumor suppressor heterodimeric complex (12), and a binding domain for HCFC1, which interacts with histone-modifying complexes during cell division (11, 13, 14). BAP1 also interacts with ASXL1 to form the Polycomb group repressive deubiquitinase complex (PR-DUB), which is involved in stem cell pluripotency and other developmental processes (15, 16). BAP1 exhibits tumor suppressor activity in cancer cells (10, 12), and BAP1 mutations have been reported in a small number of breast and lung cancer samples (10, 17).
[0075] To further investigate BAP1, genomic DNA from 29 additional class 2 UMs, and 26 class 1 UMs were subjected to Sanger re-sequencing of all BAP1 exons. Altogether, BAP1 mutations were identified in 26 of 31 (84%) class 2 tumors, including 13 out-of-frame deletions and two nonsense mutation leading to premature protein termination, six missense mutations, four in-frame deletions, and one mutation predicted to produce an abnormally extended BAP1 polypeptide (FIG. 1A-C). Three of the missense mutations affected catalytic residues of the UCH active site (C91 and H169), two occurred elsewhere in the UCH domain, and one affected the ULD (FIG. 1B-C). All BAP1 missense mutations and in-frame deletions affected phylogenetically conserved amino acids (FIG. 1D). Only one of 26 class 1 tumors contained a BAP1 mutation (NB101). This case may represent a transition state in which the tumor has sustained a BAP1 mutation but has not yet converted to class 2, suggesting that BAP1 mutations may precede the emergence of the class 2 signature. Somatic BAP1 mutations were also detected in two of three metastatic tumors. The summary of genetic data on uveal melanoma tumor samples are presented in Tables 2 and 3.
TABLE-US-00002 TABLE 2 Summary genetic data on uveal melanoma tumor samples in the study BAP1 muta- BAP1 BAP1 tion Muta- Exon Source of Gene Loss In tion With Predicted Tumor tumor expression of normal In Mutation in cDNA of muta- Protein effect on Number analyzed class Chr 3 DNA tumor gDNA (hg19) tion change protein MM 010 Primary Class 1 No No No MM 016 Primary Class 1 No No No MM 018 Primary Class 1 No No No MM 050 Primary Class 1 No No No MM 074 Primary Class 1 No No No MM 086 Primary Class 1 No No No MM 089 Primary Class 1 No No No MM 092 Primary Class 1 No No No MM 101 Primary Class 1 No No No MM 109 Primary Class 1 No No No MM 113 Primary Class 1 No No No MM 122 Primary Class 1 Yes No No NB 092 Primary Class 1 Yes No No NB 096 Primary Class 1 No No No NB 099 Primary Class 1 No No No NB 101 Primary Class 1 No No Yes g chr3.52,441,485 - 6 Unknown Loss of splice 52,441,436delTCCCCGT acceptor of AGAGCAAAGGATATGC exon 6 and GATTGGCAATGCCCCG potential GAGTTGGCAA cryptic splice (SEQ ID NO: 4) leading to out of frame peptide and premature termination NB 102 Primary Class 1 No No No NB 104 Primary Class 1 Yes No No NB 107 Primary Class 1 No No No NB 108 Primary Class 1 No No No NB 109 Primary Class 1 No No No NB 112 Primary Class 1 No No No NB 113 Primary Class 1 No No No NB 116 Primary Class 1 Yes No No NB 119 Primary Class 1 No No No NB 126 Primary Class 1 No No No MM 046 Primary Class 2 Yes No Yes C 2026-2028delGTG 15 PK637_ Deletion of C638delinsN K637 and C638 and substitution of N MM 054 Primary Class 2 Yes No Yes G chr3 52,441,434 - 6 Unknown Loss of splice 52,441,483de1 acceptor of exon 6 and potential cryptic splice leading to out of frame peptide and premature termination MM 055 Primary Class 2 Yes No Yes c 622C > G 7 pH169Q UCH active site mutated MM 056 Primary Class 2 Yes No Yes c 703G > A 8 pW196X Premature termination MM 060 Primary Class 2 Yes No Yes c 872C > T 9 pQ253X Premature termination MM 066 Primary Class 2 Yes No Yes c 960- 10 P. E283- In-frame 968delCTGAGGAGT S285del deletion between BARD1 and HCFC1 binding domains MM 070 Primary Class 2 Yes No Yes c 1083- 11 PQ322fsx100 Premature 1093delCCCCatCCCAC termination (SEQ ID NO: 5) MM 071 Primary Class 2 Yes No Yes c 2130A > G 16 Pd72G AA change in ULD domain MM 080 Primary Class 2 Yes No No MM 081 Primary Class 2 Yes No Yes g chr3.52441197 - 7 unknown Loss of splice 52441174delTGACCATG acceptor of GTAGGCACCATGAGC exon 7 and (SEQ ID NO: 6) potential cryptic splice leading to out of frame peptide and premature termination MM 083 Primary Class 2 Yes No Yes c 736- 8 pR207fsX32 Premature 751delCGGGTCATCATG termination GAG (SEQ ID NO: 7) MM 087 Primary Class 2 Yes Yes Yes c 1318-1319insA 12 pE402fsX2 Premature termination MM 090 Primary Class 2 Yes No Yes c 468-487delinsA 5 p.F118X Premature termination MM 091 Primary Class 2 Yes No Yes c 874delG 9 pQ253fs Premature termination MM 100 Primary Class 2 Yes No Yes g chr3 52,443,784 - 2 Unknown Los of splice 42,443,750del acceptor of CCCCTCCTCTTGTCGC exon 2 and CCCACCCAGGCCTCTT potential CAC cryptic splice (SEQ ID NO: 8) leading to out of frame peptide and premature termination MM 103 Primary Class 2 Yes No Yes c 2303T > A 17 pTer729R Read through termintion codon MM 110 Primary Class 2 Yes NO Yes c 1829-1833delCCCCT 13 ps571fsX25 Premature termination MM 120 Primary Class 2 Yes No Yes C 259delC 4 pF48fsX22 Premature termination MM 121 Primary Class 2 Yes No Yes c 497G > C 6 pG128R Missense MM 125 Primary Class 2 Yes No Yes c 622C > G 7 pH169Q* UCH active site mutated MM 127 Primary Class 2 No No No MM128 Primary Class 2 Yes No Yes c 2112-2120del 9 16 R666- RRTH GAAGGACCC H669delinsN deletion in ULD domain MM 133 Primary Class 2 No No No MM 134 Primary Class 2 No No No MM 135 Primary Class 2 Yes No Yes c 388T > G 5 p.C91W UCH active site mutated (active site) NB 185 Primary Class 2 No No Yes c 2006-2017 15 p E631- Internal in- delGAGCTGCTGGCA A634del frame (SEQ ID NO: 9) deletion in ULD domain NB 191 Primary Class 2 No No Yes C 610-634 7 PM166fsX12 Premature delGGAGGCGTTCCACT termination TTGTCAGCTAT (SEQ ID NO: 10) NB 195 Primary Class 2 No No Yes g chr3 52,443,771 - 2 Unknown Loss of splice 52,443,734 acceptor of delCGCCCCACCCAGGC exon 2 and CTCTTCACCCTGCTCG potential TGGAAGAT cryptic splice (SEQ ID NO: 11) leading to out of frame peptide and premature termination NB 199 Primary Class 2 No No Yes chr3: 52,436,691G > T 16 Unknown Unknown, Splice acceptor AG to likely AT premature termination NB 200 Primary Class 2 No No Yes c 631C > G 7 pS172R Missense NB 214 Primary Class 2 No No No MM 152M Metastasis NO NO No Yes C 2195-2220 17 PE693fsX13 Premature delCAGAACCATCTCCG termination TGCGGCGGCGCCA (SEQ ID NO: 12) NB 071M Metastasis Class 2 Yes No Yes c 221C > T 3 Q36* Premature termination PV L8 Metastasis No No No No
TABLE-US-00003 TABLE 3 BAP1 Source muta- BAP1 of tion muta- Predicted Tumor tumor GEP normal tion Mutation in gDNA BAP1 Mutant Protein Predicted effectn Number analyzed class LOH3 DNA tumor (hg19) cDNA exon change protein MM 133 Primary/ 2 ? NA No NA NA NA fresh frozen MM 134 Primary/ 2 ? NA No NA NA NA fresh frozen MM 137 Primary/ 2 ? No Yes g.chr3:52443889 - c.82- 1 premature deletes first two aa fresh 52443927delATTC 121del truncation (MN) and 33 bp from frozen ATCTTCCCGCGG 5'UTR GGCGGCCCCTC (ATTCATCTTCCCGCG AGCGCCATGTCC GGGCGGCCCCTCAG (SEQ ID NO: 13) CGCCATGTCC) (SEQ ID NO: 13) MM 138 Primary/ 2 ? NA No NA NA NA fresh frozen MM 144 Primary/ 2 ? No Yes c.265delC; c. 4 premature fresh g.chr3: 265delC truncation frozen 52442595delC (p.F50LfsX22) MM 150 Primary/ 2 ? NA No NA NA NA fresh frozen MM 151A Primary/ 2 ? No Yes g.chr3: 52440925 - 8 Deletion of delete AG splice fresh 52440918delAGG exon 6 donor of exon 8 frozen GCCCT and then deletion of 6 bp in exon 6- leaves 48 bp. Might be exon skipping. Mouse ? NA Yes g.chr3: 52440925 - 8 Deletion of 204 52440918delAGG exon 6 (MM151A GCCCT met) MM 161 Primary/ 2 ? ? Yes c.1013-1014delAG; 10 premature Premature fresh g.chr3: 52439814 - truncation termination frozen 52439813delAG MM 162 Primary/ 2 ? ? Yes g.chr3: 13 premature Splice mutation, fresh 52437431G > C truncation deletion of A frozen and chr3: 52437433delA OP-11- Primary/ ? ? Yes g.chr3: 52442086 - 10 premature 953 paraffin 52442106delGGTA truncation (Emory) embedded TCAGCTGTGAAA CCAAG (SEQ ID NO: 14) MM 131T Primary/ 1b ? NA No NA fresh frozen MM 159T Primary/ 2 ? NA No NA NA NA fresh frozen NA: Not applicable
[0076] One copy of chromosome 3 was missing in all 17 BAP1-mutant class 2 tumors for which cytogenetic data were available, consistent with chromosome 3 loss uncovering recessive BAP1 mutations. Normal DNA from 20 patients with BAP1-mutant class 2 primary tumors and the two with metastatic tumors was available and did not contain a BAP1 mutation, indicating that the mutations were somatic in origin. However, we detected one germline mutation (p.E402fsX2; c.1318-1319insA) in the patient with the class 1 tumor NB101 (Table 2), and this case was particularly interesting. Re-sequencing of this tumor revealed a deletion of a segment of exon 6 of BAP1, including its splice acceptor. This mutation is predicted to result in a premature truncation of the encoded protein (Table 2). However, the wildtype allele was present at levels similar to the mutant allele, indicating that it was disomic for chromosome 3 (FIG. 2). Hence, this case may represent a transition state in which the tumor is still class 1 but has sustained a BAP1 mutation. This might suggest that the BAP1 mutations precede loss of chromosome 3 and the emergence of the class 2 signature during tumor progression. Thus, germline alterations in BAP1 can predispose to UM.
[0077] Other germline (blood) mutations in exon 13 (g.chr3:52437465insT; pE566X; c.1695-1696insT leading to premature protein termination) in FUM1-01 and FUM-02 were also detected (see FIG. 18).
[0078] GNAQ mutation status was available in 15 cases. GNAQ mutations were present in 4/9 BAP1 mutant tumors and 3/6 BAP1 wildtype tumors, indicating that there was no correlation between GNAQ and BAP1 mutation status.
[0079] UM usually metastasizes to the liver, where it is difficult to obtain specimens for research. However, we were able to obtain sufficient DNA from three UM liver metastases for analysis. BAP1 mutations were detected in two of the three metastatic tumors, supporting the hypothesis that cells mutant for BAP1 are indeed the ones responsible for metastasis (Table 2). NB071 M contained a nonsense mutation (Q36X), and MM152M contained an out-of-frame deletion (p.E693fsX13). Both mutations are predicted to cause premature protein truncation. Primary tumor DNA on either case was unavailable.
[0080] Quantitative RT-PCR showed that BAP1 mRNA levels were significantly lower in class 2 tumors compared to class 1 tumors (P<0.0001) (FIG. 3A). Truncating mutations were associated with significantly lower mRNA levels than missense mutations (P=0.001) (FIG. 3B), consistent with nonsense mediated mRNA decay in the former group. Class 2 tumors in which BAP1 mutations were not identified expressed very low levels of BAP1 mRNA (FIG. 3B).
[0081] To determine whether the low BAP1 mRNA levels in class 2 tumors without detectable BAP1 mutations may be explained by DNA methylation, we performed a preliminary analysis of DNA methylation of BAP1. This did not reveal a convincing difference between class 1 and class 2 tumors. However, analysis of the BAP1 promoter was limited by an unusually complex CpG island that will require further work to resolve. Thus, we cannot rule out a role for methylation in class 2 tumors in which BAP1 mutations were not found. However, with almost 85% of class 2 tumors harboring mutations, we do not expect that methylation will be a major mechanism of BAP1 inactivation. An alternative explanation is that these tumors may contain very large deletions of the BAP1 locus or other mutations not detectable by our sequencing method.
[0082] Immunofluorescence revealed abundant nuclear BAP1 protein in two class 1 tumors but virtually none in four BAP1 mutant class 2 tumors (FIG. 4). This was expected for the two tumors with mutations expected to cause premature protein terminations (MM 091 and MM 100), but it was surprising for the two tumors with missense mutations (MM 071 and MM 135) and suggests that these mutations lead to protein instability.
[0083] RNAi-mediated knock down of BAP1 in 92.1 UM cells, which did not harbor a detectable BAP1 mutation, recapitulated many characteristics of the de-differentiated class 2 UM phenotype (18). Cells transfected with control siRNA exhibited typical melanocytic morphology, including dendritic projections and cytoplasmic melanosomes (FIG. 5), whereas cells transfected with BAP1 siRNA lost these features, developed a rounded epithelioid morphology and grew as multicellular non-adherent spheroids, strikingly similar to the features of class 2 clinical biopsy samples (FIG. 5). Microarray gene expression profiling of 92.1 UM cells transfected with control versus BAP1 siRNA showed that most of the top genes that discriminate between class 1 and class 2 tumors shifted in the class 2 direction in BAP1 depleted cells compared to control cells (FIG. 6). Similarly, depletion of BAP1 shifted the gene expression profile of the multi-gene clinical prognostic assay towards the class 2 signature (FIG. 7A). BAP1 depletion caused a reduction in mRNA levels of neural crest migration genes (ROBO1), melanocyte differentiation genes (CTNNB1, EDNRB and SOX10) and other genes that are down-regulated in class 2 tumors (LMCD1 and LTA4H) (18). In contrast, BAP1 depletion caused an increase in mRNA levels of CDH1 and the proto-oncogene KIT, which are highly expressed in class 2 tumors (19). Similarly, mRNA transcripts of KIT, MITF and PAX3, whose protein products are associated with proliferation of pre-terminally differentiated melanocytes and have oncogenic effects when overactive in melanoma (20-22), were significantly up-regulated by BAP1 depletion (FIG. 7B). Similar results were seen in other UM cell lines and with an independent BAP1 siRNA (FIG. 7C).
[0084] GNAQ mutations occur early in UM and are not sufficient for malignant transformation (4), but they may create a dependency of the tumor cells on constitutive GNAQ activity. In contrast, BAP1 mutations occur later in UM progression and coincide with the onset of metastatic behavior. Thus, simultaneous targeting of both genetic alterations might have synergistic therapeutic effects. One potential strategy to counteract the effects of BAP1 mutation would be to inhibit the RING1 ubiquinating activity that normally opposes the deubiquinating activity BAP1 (16). Our findings strongly implicate mutational inactivation of BAP1 as a key event in the acquisition of metastatic competence in UM, and they dramatically expand the role of BAP1 and other deubiquitinating enzymes as potential therapeutic targets in cancer.
Materials and Methods for Example 1.
Patient Materials:
[0085] Acquisition of patient material (matched tumor and normal samples) has been described elsewhere (25) (Table 4). This study was approved by the Human Studies Committee at Washington University (St. Louis, Mo.), and informed consent was obtained from each subject. Tumor tissue was obtained immediately after eye removal, snap frozen, and prepared for RNA and DNA analysis. UM metastases were collected from liver biopsies at the time of metastatic diagnosis. All samples were histopathologically verified. Genomic DNA from tumors was prepared using the Wizard Genomic DNA Purification kit (Promega, Madison, Wis.). DNA from blood was isolated using the Quick Gene DNA whole blood kit S (Fugifilm, Tokyo, Japan). RNA was isolated using the PicoPure kit (including the optional DNase step). All RNA samples were converted to cDNA using the High Capacity cDNA Reverse Transcription kit from Applied Biosystems (Applied Biosystems Inc., Foster City, Calif.) following the manufacturer's protocol.
TABLE-US-00004 TABLE 4 Summary of clinical and pathologic data on uveal melanoma patients in the study Age at primary Tumor Tumor Pathologic Source tumor diameter thickness Ciliary cell type of Treatment Mons Tumor of tumor diag- of primary of primary body primary of primary follow- Number analyzed nosis Gender tumor tumor involvement tumor tumor up Metastasis MM 010 Primary 41 Male 17 9.9 No Mixed Enucleation 131.2 Yes MM 016 Primary 24 Female 24 12.6 Yes Spindle Enucleation 87.8 Yes MM 018 Primary 55 Male 12 9.2 No Epithelioid Enucleation 67.4 No MM 050 Primary 50 Female 19 8.9 Yes Epithelioid Enucleation 71.4 No MM 074 Primary 77 Male N/A 22.0 N/A Mixed Enucleation 24.4 No MM 086 Primary 47 Male 14 14.0 No Spindle Enucleation 17.7 No MM 089 Primary 74 Male 18 8.1 Yes Spindle Enucleation 8.1 Yes MM 092 Primary 61 Male 20 13.4 Yes Epithelioid Enucleation 8.0 No MM 101 Primary 66 Female 15 6.4 No Spindle Enucleation 10.8 No MM 109 Primary 56 Male 15 12.7 Yes Spindle Enucleation 8.8 No MM 113 Primary 54 Male 14 11.0 No Mixed Enucleation 8.0 No MM 122 Primary 52 Male N/A N/A Yes Epithelioid Enucleation 1.0 No NB 092 Primary 53 Male 11 4.4 No Mixed Brachytherapy 25.2 No NB 096 Primary 55 Female 15 3.8 No Spindle Brachylerapy 24.1 No NB 099 Primary 76 Male N/A N/A No Other Biopsy 1.0 No NB 101 Primary 57 Female 14 2.6 Yes Other Brachytherapy 23.2 No NB 102 Primary 83 Female 13 2.4 No Epithelioid Brachytherapy 27.5 No NB 104 Primary 62 Male 13 5.5 No Epithelioid Brachytherapy 24.1 No NB 107 Primary 58 Male 15 10.0 Yes Epithelioid Brachytherapy 19.9 No NB 108 Primary 66 Female 10 2.6 No Other Brachytherapy 17.8 No NB 109 Primary 76 Male 18 8.4 Yes Spindle Brachytherapy 9.1 No NB 112 Primary 53 Male 12 6.1 No Other Brachytherapy 21.4 No NB 113 Primary 70 Male 14 3.2 Yes Spindle Brachytherapy 13.2 No NB 116 Primary 85 Female 17 7.1 Yes Spindle Brachytherapy 13.4 No NB 119 Primary 69 Female 16 5.9 Yes Spindle Brachytherapy 21.8 No NB 126 Primary 34 Female 17 8.1 No Spindle Brachyterhapy 22.4 No MM 046 Primary 69 Female 22 9.0 Yes Epithelioid Enucleation 32.6 Yes MM 054 Primary 80 Female 15 6.7 No Mixed Enucleation 34.6 Yes MM 055 Primary 82 Female 19 8.6 Yes Epithelioid Enucleation 81.3 Yes MM 056 Primary 63 Male 18 11.7 Ye Epithelioid Enucleation 16.3 No MM 060 Primary 67 Male 14 9.5 Yes Epithelioid Enucleation 37.0 Yes MM 066 Primary 47 Male 22 9.2 Yes Mixed Enucleation 52.5 No MM 070 Primary 62 Male 24 15.6 Yes Epithelioid Enucleation 31.5 Yes MM 071 Primary 63 Female N/A 12.5 N/A Spindle Enucleation 46.3 No MM 080 Primary 37 Male N/A 11.3 Yes Epithelioid Enucleation 31.5 Yes MM 081 Primary 65 Male 18 11.3 Yes Epithelioid Enucleation 28.2 Yes MM 083 Primary 43 Male 5 3.7 Yes Epithelioid Enucleation 51.1 Yes MM 087 Primary 53 Female 16 5.8 No Epithelioid Enucleation 17.5 Yes MM 090 Primary 72 Female 19 14.0 Yes Mixed Enucleation 27.5 No MM 091 Primary 64 Male 17 10.2 Yes Mixed Enucleation 26.4 Yes MM 100 Primary 68 Male 18 12.3 Yes Epithelioid Enucleation 16.2 No MM 103 Primary 63 Male 15 12.7 Yes Mixed Enucleation 33.4 Yes MM 110 Primary 48 Female 15 8.0 No Epithelioid Enucleation 37.4 No MM 120 Primary 68 Female 20 10.4 Yes Spindle Enucleation 26.7 Yes MM 121 Primary 52 Female 17 5.8 Yes Spindle Enucleation 32.3 Yes MM 125 Primary 79 Female 18 3.9 No Mixed Enucleation 7. Yes MM 127 Primary 78 Male N/A N/A N/A Epithelioid Enucleation 20.0 No MM 128 Primary 69 Female 8 2.4 No Mixed Enucleation 21.1 Yes MM 133 Primary 54 Female 20 15.0 No Epitheliod Enucleation 4.5 No MM 134 Primary 57 Female 19 9.1 Yes Mixed Enucleation 6.5 No MM 135 Primary 36 Female 20 NA Yes Mixed Enucleation 7.1 No NB 185 Primary 85 Male 15 6.9 Yes Epithelioid Brachytherapy 3.8 No NB 191 Primary 60 Female 9 2.7 No Spindle Brachytehrapy 3.4 No NB 195 Primary 74 Male 18 9.0 Yes Mixed Biopsy 3.1 No NB 199 Primary 71 Female 13 8.7 Yes Mixed Brachytherapy 1.8 No NB 200 Primary 61 Femlae 18 4.4 Yes Spindle Brachytherapy 6.9 No NB 214 Primary 86 Male 15 4.5 No Epithelioid Brachytherapy 3.4 No MM Metastasis 68 Male 19 15.3 N/A Epitheliod Unknown 4.2 Yes 152M NB 071M Metastasis 51 Male 18 8.6 Yes Epitheliod Brachytherapy 36.5 Yes PVLB Metastasis 43 Female 18 9.0 N/A Epithelioid Unknown 64.4 Yes
Cell Culture:
[0086] 92.1 (generous gift from Dr. Martine Jager) and Mel290 (generous gift of Dr. Bruce Ksander) human UM cells were grown in RPMI-1640 (Lonza, Walkersville, Md.) supplemented with 10% fetal bovine serum (Invitrogen, Carlsbad, Calif.) and antibiotics. Transfections were performed with HiPerFect (Qiagen, Valencia, Calif.) and Silencer.RTM. Select BAP1 (s15820 and s15822) or Control #1 siRNA (Ambion, Austin, Tex.). Knockdown of BAP1 protein levels was confirmed by western blot with antibodies that recognize the BAP1 protein (Santa Cruz, Santa Cruz, Calif.) and alpha-tubulin (Sigma-Aldrich, St. Louis, Mo.). Cell morphology data were collected by digital imaging of phase contrasted cells at 200.times. magnification. After five days, transfected cells were harvested for RNA and protein analyses.
RNA and Protein Analysis:
[0087] All RNA samples were converted to cDNA using the High Capacity cDNA Reverse Transcription kit (Applied Biosystems Inc., Foster City, Calif.) and then pre-amplified for 14 cycles with pooled probes and TaqMan Pre-Amp Master Mix following manufacturer's protocol. Expression of mRNA for individual genes was quantified using the 7900HT Real-Time PCR System with either custom-made primers and iQ SYBRGreen SuperMix (Bio-Rad Laboratories Inc, Hercules, Calif.) for CTNNB1, EDNRB, KIT, SOX10 and UBC (endogenous control) or TaqMan.RTM. Gene Expression Assays and Gene Expression Master Mix (Applied Biosystems Inc., Foster City, Calif.) for BAP1, CDH1, LTA4H, LMCD1 and ROBO1. The 15-gene prognostic assay for assignment of tumors to class 1 or class 2 was performed as described elsewhere (26). Staining with BAP1 antibody (201C, the generous gift of Dr. Richard Baer) was performed on 4 .mu.m sections obtained from paraffin-embedded tissue blocks. Statistical significance was assessed using Student's t-test with Medcalc software version 10.4.0.0.
Exome Capture and DNA Sequencing:
[0088] gDNA libraries were prepared using the Illumina Pair-End Genomic DNA Sample Prep Kit (Cat # PE-102-1001) according to the manufacturer's instructions. Each paired-end library was enriched for exomic sequence using the Roche-Nimblegen SeqCap EZ Exome kit (Cat #5977215001). The captured genomic DNA fragments were sequenced with the Illumina Genome Analyzer II (GAIIx) for 76-cycles (one lane per sample).
Sequence Analysis:
[0089] Illumina Solexa 76 cycle paired-end sequencing data was received as compressed raw reads exported from the Illumina software pipeline (.gtoreq.1.3). Raw reads were parsed into FASTQ format, and the original raw reads were archived. The FASTQ files were aligned to the hg19 version of the human reference sequence using bowtie. The Bowtie software (v0.12.3) was compiled with g++ (v4.3.3) using the additional compilation switches "--O3-mtune=amdfam10" with pthreads enabled. Mapped reads were directed to a SAM format file for downstream analysis, and unmapped reads were exported to a separate file.
[0090] Variant bases were extracted with the samtools software (v0.1.7) with the additional samtools.pl VarFilter switch "-D 1000", and only positions with at least 8 reads and a SNP quality score of at least 20 were considered for further analysis. Filtered variants were stored in a relational database table (MySQL v5.0.75). Known SNPs (dbSNP130 on hg19; exact location known, single base changes) and variants found in 8 HapMap samples (27) were filtered from our variant lists using database queries.
[0091] Candidate variants in coding sequence of genes mapping to chromosome 3 were identified and manually annotated for amino acid changes. The 30 base pairs around coding variants were used to query genomic sequence (hg19) to determine if the sequence mapped to multiple genomic locations. Regions with multiple identical mappings were removed. This included the removal of sequences mapping to pseudogenes.
HapMap Variants:
[0092] FASTQ files for 8 HapMap individual's exomes (NA19240, NA19129, NA18956, NA18555, NA18517, NA18507, NA12878, NA12156) were downloaded from the NCBI Short Read Archive (3) (accession SRP000910). All reads for each individual were aligned to hg19 (see above). Multiple sequencing runs were merged into one SAM formatted file. Variants were extracted with samtools (see above) and stored in a relational database table.
Sequence Validation:
[0093] Oligonucleotide primers were designed from intronic sequences to amplify all coding sequence of BAP1 with the PCR (Table 5). Genomic DNA of tumor and blood from the same patient were subjected to PCR amplification with routine approaches. Sanger DNA sequencing was performed with routine methods to validate variants found with NextGen sequencing, and to query all tumor and matched normal samples for all coding sequences of BAP1. Oligonucleotide primer sequences are available upon request.
TABLE-US-00005 TABLE 5 Sequencing primers PCR product Primers Seq. Exon size Location (hg19) BAP1-e1-3-F2 SEQ ID NO. 15: 1 566 bp chr3: 52443441 + 52444006 AGGCTGCTGCTTTCTGTGAG BAP1-e1-3-R2 SEQ ID NO. 16: 1 CGTTGTCTGTGTGTGGGAC BAP1-e4-F SEQ ID NO. 17: 4 261 bp chr3: 52442418 - 52442678 ATGCTGATTGTCTTCTCCCC BAP1-e4-R SEQ ID NO. 18: 4 CTCCATTTCCACTTCCCAAG BAP1-e5-F SEQ ID NO. 19: 5 255 bp chr3: 52441894 - 52442148 CTTGGGGCTTGCAGTGAG BAP1-e5-R SEQ ID NO. 20: 5 ATGTGGTAGCATTCCCAGTG BAP1E8L SEQ ID NO. 21: 8 250 bp chr3: 52440750 + 52440999 GGCCTTGCAATTTACAAATCA BAP1E8R SEQ ID NO. 22: 8 TGTCTTCCTTCCCACTCCTG BAP1-e9-F SEQ ID NO. 23: 9 256 bp chr3: 52440207 - 52440462 GGATATCTGCCTCAACCTGATG BAP1-e9-R SEQ ID NO. 24: 9 GAAGGGAGGAGGAATGCAG BAP1-e10-F SEQ ID NO. 25: 10 287 bp chr3: 52439727 - 52440013 TTCCTTTAGGTCCTCAGCCC BAP1-e10-nest SEQ ID NO. 26: 10 This is a nested CTGAGGTCCACAAGAGGTCC primer used for sequencing BAP1-e10-R SEQ ID NO. 27: 10 CAGACATTAGCGGGTGGC BAP1E11L SEQ ID NO. 28: 11 227 bp chr3: 52439107 + 52439333 AAGGGTGCTCCCAGCTTAC BAP1E11R SEQ ID NO. 29: 11 CCTGTGTTCTTGCCCTGTCT BAP1-e12-F SEQ ID NO. 30: 12 270 bp chr3: 52438402 - 52438671 GCTGTGAGTGTCTAGGCTCAG BAP1-e12-R SEQ ID NO. 31: 12 AGACTGAGATATTCAGGATGGG BAP1-e14-F SEQ ID NO. 32: 14 275 bp chr3: 52437098 - 52437372 CCAAGTGACCACAAAGTGTCC BAP1-e14-R SEQ ID NO. 33: 14 AGCTCAGGCCTTACCCTCTG BAP1-e17-F2 SEQ ID NO. 34: 17 496 bp chr3: 52436103 + 52436598 CTGAGCACTATGGGGCTGAT BAP1-e17-R2 SEQ ID NO. 35: 17 TCTTAACTGGAATGCCCTGC BAP1-e13A-F2 SEQ ID NO. 36: 13A 567 bp chr3: 52437269 + 52437835 CTGCCTTGGATTGGTCTGAT BAP1-e13A-R2 SEQ ID NO. 37: 13A CAACACCATCAACGTCTTGG BAP1-e13B-F2 SEQ ID NO. 38: 13B 595 bp chr3: 52437489 + 52438083 TGATGACAGGACCCAGATCA BAP1-e13B-R2 SEQ ID NO. 39: 13B GCTGTCAGAACTTGATGCCA BAP1-e15-16-F SEQ ID NO. 40: 15-16 409 bp chr3: 52436552 - 52436960 CTAGCTGCCTATTGCTCGTG BAP1-e15-16-R SEQ ID NO. 41: 15-16 GAGGGGAGCTGAAGGACAC BAP1-e6-7-F SEQ ID NO. 42: 6-7 412 bp chr3: 52441134 - 52441545 TTTGCCTTCCACCCATAGTC BAP1-e6-7-R SEQ ID NO. 43: 6-7 AGCTCCCTAGGAGGTAGGC
DNA Methylation Analysis:
[0094] Following bisulfite treatment and amplification of genomic DNA from region chr3:52,442,270-52,442,651 (hg19) with bisulfite specific primers, methylation of this region was evaluated with Sequenom's MassARRAY Epityper technology in our core facility (hg.wustl.edu/gtcore/methylation.html). Controls for 0% and 100% methylation were also included. Nine class 1 tumors and ten class 2 tumors were analyzed.
Molecular Classification:
[0095] Gene expression data from custom TaqMan Low-Density Arrays were used to determine tumor class assignment, as previously described (26). Briefly, molecular class assignments were made by entering the 12 .DELTA.C.sub.t values of each sample into the machine learning algorithm GIST 2.3 Support Vector Machine (SVM) (bioinformatics.ubc.ca/svm). SVM was trained using a set of 28 well-characterized uveal melanomas of known molecular class and clinical outcome. SVM creates a hyperplane between the training sample groups (here, class 1 and class 2), then places unknown samples on one or the other side of the hyperplane based upon their gene expression profiles. Confidence is measured by discriminant score, which is inversely proportional to the proximity of the sample to the hyperplane.
[0096] Loss of heterozygosity for chromosome 3 was determined using 35 SNPs with minor allele frequencies >0.4 at approximate intervals of 6 megabases across the euchromatic regions of chromosome 3 using the MassARRAY system (Sequenom Inc, San Diego, Calif.), as previously described (25).
Microarray Gene Expression Profiling
[0097] Expression data, received as flat files exported from the Illumina software, were analyzed in R (v2.10.1) using Bioconductor packages (Biobase v2.6.1). Non-normalized data were imported into the R environment using the beadarray package (v1.14.0). Expression values were quantile normalized and log 2 transformed using limma (v3.2.3). Each of three independent siRNA knockdown experiments as well as each of three siRNA control experiments was treated as biological replicates. Linear models were fitted to the expression values and expression differences calculated using a contrast comparing the difference in knockdown/control experiments. For each gene log 2 fold change, average expression, and moderated t-statistics were calculated for the defined contrast using the "ebayes" function of the limma package. Nominal p-values were corrected for multiple comparisons using the Benjamini and Hochberg false discovery rate method. Heatmaps were generated using the heatmap function of the R base stats package. Quantile normalized data were filtered down to 29 known discriminating genes plus BAP1. Heatmap colors were generated using the maPalette function of the marray Bioconductor package (v1.24.0), specifying green as low, red as high, and black as mid color values with 20 colors in the palette.
Example 2
Indirect Methods for Detecting BAP1 Loss
[0098] BAP1 loss leads to biochemical changes in the cell, such as histone H2A ubiquitination, that may be easier to detect and monitor than direct BAP1 activity.
[0099] BAP1 stable knockdown cells were produced using lentiviral vectors expressing a short hairpin RNA (shRNA) against BAP1 (FIG. 8). Both transient and stable knockdown of BAP1 lead to increased ubiquitination of histone H2A (FIG. 9). Thus, the measurement of histone H2A ubiquitination levels could be used as a surrogate indicator of BAP1 loss.
[0100] Stable knockdown of BAP1 also leads to a decrease in the RNA levels of melanocyte differentiation genes (FIG. 10). Transient knockdown of BAP1 leads to a decrease in proliferation (FIG. 11) as measured using a BrdU assay. In addition, loss of BAP1 in culture leads to decreased cell motility (FIG. 12) and a decreased growth in soft agar (FIG. 13). On the other hand, loss of BAP1 leads to an increased ability to grow in clonegenic assays (FIG. 14) and increased migration towards a serum attractant (FIG. 15).
Example 3
Loss of BAP1 and Tumor Behavior in Mouse
[0101] Uveal melanoma cells stably knocked down for BAP1 using lentiviral expression of shRNA against BAP1 were implanted into mouse flank. Cells deficient for BAP1 grew less rapidly in the mouse flank compared to control cells infected with lentiviral vector expression shRNA against GFP (FIG. 16). After injection into the tail vein of mice, knockdown BAP1 cells exhibited decreased tumor growth (FIG. 17). These findings, coupled with the cell culture experiments above, indicate that the major effect of BAP1 loss in uveal melanoma is not increased proliferation, migration, motility or tumorigenicity upon flank injection.
Example 4
BAP1 Mutations in Cutaneous Melanoma
[0102] BAP1 mutations may also be analyzed in cutaneous melanoma tumors as described in the examples and materials and methods above. Cutaneous melanoma tumors analyzed may be atypical moles (Dysplastic Nevus), basal cell carcinomas, blue nevi, cherry hemangiomas, dermatofibromas, halo nevi, keloid and hypertrophic scars, keratoacanthomas, lentigos, metastatic carcinomas of the skin, nevi of ota and ito, melanocytic nevi, seborrheic keratosis, spitz nevi, squamous cell carcinomas, and vitiligos.
[0103] Cutaneous melanoma samples and matching normal DNA from peripheral tissue may be analyzed for inactivating mutations in BAP1 using exome capture followed by massively parallel sequencing. Sanger re-sequencing of all BAP1 exons may also be used to further investigate BAP1 mutations. Normal DNA from patients with cutaneous melanoma may be analyzed to determine if BAP1 mutations are somatic or germline in origin. Germline alterations in BAP1 may predispose to cutaneous melanoma.
[0104] Mutation status of other genes may also be analyzed in the cutaneous melanoma samples. For example, GNAQ, BRAF, KIT or NRAS mutation status may be determined, and compared to the results obtained for uveal melanoma samples described above.
[0105] BAP1 mRNA levels may be analyzed using quantitative RT-PCR. If BAP1 mRNA levels are lower in cutaneous melanoma samples than in normal samples, DNA methylation of the BAP1 locus may be analyzed to determine if the lower mRNA levels may be explained by DNA methylation. BAP1 protein levels in various tumor and normal samples may also be analyzed using immunofluorescence.
[0106] BAP1 may be knocked down in cell culture using RNAi. BAP1 mRNA and protein expression levels, cell morphology, and gene expression profiling using microarrays may be used to characterize cell cultures after knock down of BAP1 expression.
Example 5
BAP1 Mutations in the Germline
[0107] BAP1 mutations may be detected in germline DNA as a means of detection of affected family members in hereditary syndromes. Germline DNA may be any normal patient DNA such as DNA extracted from peripheral blood lymphocytes or buccal swabs. Standard Sanger sequencing may be used as described in Example 1 above.
[0108] For instance, FIG. 18 illustrates a family with stomach cancer, bone cancer, breast cancer, bladder cancer, uveal melanoma, and cutaneous melanoma. The individuals labeled FUM1-01, FUM1-02, FUM1-03, and FUM1-04 were positive for germline BAP1 mutations. These data support the conclusion that germline BAP1 mutations may be used to detect affected family members in hereditary cancers and/or syndromes.
Example 6
BAP1 as a Marker of Circulating Tumors
[0109] BAP1 mutations may be detected in peripheral blood as a marker of circulating tumor cells. This may be performed using targeted capture and deep sequencing of BAP1 in blood samples from patients. Targeted capture may be used in combination with NexGen sequencing to provide a very powerful approach for rapidly sequencing genomic regions of interest. The Agilent SureSelect enrichment system is one such method that allows enrichment for genomic regions from a sample of total human genomic DNA. The Agilent system also supports multiplexing of samples in the sequencing reaction, reducing the overall cost of the procedure.
[0110] A 1-2 Mb genomic region harboring BAP1 may be captured. This may allow detection of deletions of several exons or the entire gene, as well as the smaller mutations identified in the examples above. Targeted capture with Agilent's SureSelect system starts with querying their eArray web site for a region of interest. This is designed to identify an overlapping set of oligonucleotides (120 mers) over a particular region, but without regions containing repeat (which confound the selection procedure). Agilent synthesizes biotinylated cRNA oligonucleotides and provides them in solution (the probe). 1-3 mg of genomic DNA (the driver) may then be sheared to .about.200 bp, end-repaired, A-tailed and ligated to adaptors for Illumina paired-end sequencing. Libraries may be amplified for 6-8 cycles to produce at least 500 ng of product. The product may be hybridized to the oligonucleotide baits to enrich for targeted regions then the resultant hybrids may be captured onto streptavidin-labeled magnetic beads. This may be followed by washing and digestion of the RNA bait. Resultant selection products may be subjected to PCR for 12-14 cycles. At this stage, unique oligonucleotide identifiers may be incorporated into the selected DNAs and their concentrations are determined. These are then adjusted it to a final concentration of 15 pM for sequencing. In this way multiple samples may be loaded onto one flow cell lane on the Sequencer. Currently, 12 samples may be run in a single lane of an Illumina HiSeq2000. Illumina and Nimblegen are also developing similar technologies that could be used for targeted capture. This technology was originally developed by Dr. Michael Lovett (Bashiardes et al. 2005), and instead of oligonucleotides, bacterial artificial chromosomes (BACs) were used as probes. Hence, there are a variety of ways of identifying the genomic target of interest.
[0111] Sequences obtained from targeted capture may be analyzed in a similar manner to those obtained from exome-capture and as described elsewhere.
[0112] This may potentially be used for (1) non-invasive determination of patients with class 2 high risk uveal melanomas, (2) assessment of circulating tumor burden for uveal, cutaneous or other BAP1 mutant cancer, and (3) to monitor response to therapy.
REFERENCES
[0113] 1. Landreville S, Agapova O A, Harbour J W. Future Oncol. 2008; 4:629.
[0114] 2. Onken M D, Worley L A, Tuscan M D, Harbour J W. J Mol Diagn. 2010; 12:461.
[0115] 3. Finger P T. Arch Pathol Lab Med. 2009; 133:1197.
[0116] 4. Van Raamsdonk C D, et al. Nature. 2009; 457:599.
[0117] 5. Onken M D, et al. Invest Ophthalmol Vis Sci. 2008; 49:5230.
[0118] 6. Bauer J, et al. Br J Cancer. 2009; 101:813.
[0119] 7. Worley L A, et al. Clin Cancer Res. 2007; 13:1466.
[0120] 8. Bashiardes S, et al. Nat Methods. 2005; 2:63.
[0121] 9. Ng S B, et al. Nat Genet. 2010; 42:30.
[0122] 10. Jensen D E, et al. Oncogene. 1998; 16:1097.
[0123] 11. Misaghi S, et al. Mol Cell Biol. 2009; 29:2181.
[0124] 12. Nishikawa H, et al. Cancer Res. 2009; 69:111.
[0125] 13. Machida Y J, Machida Y, Vashisht A A, Wohlschlegel J A, Dutta A. J Biol Chem. 2009; 284:34179.
[0126] 14. Tyagi S, Chabes A L, Wysocka J, Herr W. Mol Cell. 2007; 27:107.
[0127] 15. Gaytan de Ayala Alonso A, et al. Genetics. 2007; 176:2099.
[0128] 16. Scheuermann J C, et al. Nature. 2010; 465:243.
[0129] 17. Wood L D, et al. Science. 2007; 318:1108.
[0130] 18. Onken M D, et al. Cancer Res. 2006; 66:4602.
[0131] 19. Onken M D, Worley L A, Ehlers J P, Harbour J W. Cancer Res. 2004; 64:7205.
[0132] 20. D. Lang et al., Nature 433, 884 (Feb. 24, 2005).
[0133] 21. L. A. Garraway et al., Nature 436, 117 (Jul. 7, 2005).
[0134] 22. T. J. Hemesath, E. R. Price, C. Takemoto, T. Badalian, D. E. Fisher, Nature 391, 298 (Jan. 15, 1998).
[0135] 23. Misaghi S, et al. Journal of Biological Chemistry. 2005; 280:1512.
[0136] 24. Wang Y, et al. Nucleic Acids Res. 2007; 35:D298.
[0137] 25. M. D. Onken et al., Clin Cancer Res 13, 2923 (2007).
[0138] 26. M. D. Onken, L. A. Worley, M. D. Tuscan, J. W. Harbour, J Mol Diagn 12, 461 (2010).
[0139] 27. S. B. Ng et al., Nature 461, 272 (2009).
Sequence CWU
1
1
621729PRTHomo sapiens 1Met Asn Lys Gly Trp Leu Glu Leu Glu Ser Asp Pro Gly
Leu Phe Thr 1 5 10 15
Leu Leu Val Glu Asp Phe Gly Val Lys Gly Val Gln Val Glu Glu Ile
20 25 30 Tyr Asp Leu Gln
Ser Lys Cys Gln Gly Pro Val Tyr Gly Phe Ile Phe 35
40 45 Leu Phe Lys Trp Ile Glu Glu Arg Arg
Ser Arg Arg Lys Val Ser Thr 50 55
60 Leu Val Asp Asp Thr Ser Val Ile Asp Asp Asp Ile Val
Asn Asn Met 65 70 75
80 Phe Phe Ala His Gln Leu Ile Pro Asn Ser Cys Ala Thr His Ala Leu
85 90 95 Leu Ser Val Leu
Leu Asn Cys Ser Ser Val Asp Leu Gly Pro Thr Leu 100
105 110 Ser Arg Met Lys Asp Phe Thr Lys Gly
Phe Ser Pro Glu Ser Lys Gly 115 120
125 Tyr Ala Ile Gly Asn Ala Pro Glu Leu Ala Lys Ala His Asn
Ser His 130 135 140
Ala Arg Pro Glu Pro Arg His Leu Pro Glu Lys Gln Asn Gly Leu Ser 145
150 155 160 Ala Val Arg Thr Met
Glu Ala Phe His Phe Val Ser Tyr Val Pro Ile 165
170 175 Thr Gly Arg Leu Phe Glu Leu Asp Gly Leu
Lys Val Tyr Pro Ile Asp 180 185
190 His Gly Pro Trp Gly Glu Asp Glu Glu Trp Thr Asp Lys Ala Arg
Arg 195 200 205 Val
Ile Met Glu Arg Ile Gly Leu Ala Thr Ala Gly Glu Pro Tyr His 210
215 220 Asp Ile Arg Phe Asn Leu
Met Ala Val Val Pro Asp Arg Arg Ile Lys 225 230
235 240 Tyr Glu Ala Arg Leu His Val Leu Lys Val Asn
Arg Gln Thr Val Leu 245 250
255 Glu Ala Leu Gln Gln Leu Ile Arg Val Thr Gln Pro Glu Leu Ile Gln
260 265 270 Thr His
Lys Ser Gln Glu Ser Gln Leu Pro Glu Glu Ser Lys Ser Ala 275
280 285 Ser Asn Lys Ser Pro Leu Val
Leu Glu Ala Asn Arg Ala Pro Ala Ala 290 295
300 Ser Glu Gly Asn His Thr Asp Gly Ala Glu Glu Ala
Ala Gly Ser Cys 305 310 315
320 Ala Gln Ala Pro Ser His Ser Pro Pro Asn Lys Pro Lys Leu Val Val
325 330 335 Lys Pro Pro
Gly Ser Ser Leu Asn Gly Val His Pro Asn Pro Thr Pro 340
345 350 Ile Val Gln Arg Leu Pro Ala Phe
Leu Asp Asn His Asn Tyr Ala Lys 355 360
365 Ser Pro Met Gln Glu Glu Glu Asp Leu Ala Ala Gly Val
Gly Arg Ser 370 375 380
Arg Val Pro Val Arg Pro Pro Gln Gln Tyr Ser Asp Asp Glu Asp Asp 385
390 395 400 Tyr Glu Asp Asp
Glu Glu Asp Asp Val Gln Asn Thr Asn Ser Ala Leu 405
410 415 Arg Tyr Lys Gly Lys Gly Thr Gly Lys
Pro Gly Ala Leu Ser Gly Ser 420 425
430 Ala Asp Gly Gln Leu Ser Val Leu Gln Pro Asn Thr Ile Asn
Val Leu 435 440 445
Ala Glu Lys Leu Lys Glu Ser Gln Lys Asp Leu Ser Ile Pro Leu Ser 450
455 460 Ile Lys Thr Ser Ser
Gly Ala Gly Ser Pro Ala Val Ala Val Pro Thr 465 470
475 480 His Ser Gln Pro Ser Pro Thr Pro Ser Asn
Glu Ser Thr Asp Thr Ala 485 490
495 Ser Glu Ile Gly Ser Ala Phe Asn Ser Pro Leu Arg Ser Pro Ile
Arg 500 505 510 Ser
Ala Asn Pro Thr Arg Pro Ser Ser Pro Val Thr Ser His Ile Ser 515
520 525 Lys Val Leu Phe Gly Glu
Asp Asp Ser Leu Leu Arg Val Asp Cys Ile 530 535
540 Arg Tyr Asn Arg Ala Val Arg Asp Leu Gly Pro
Val Ile Ser Thr Gly 545 550 555
560 Leu Leu His Leu Ala Glu Asp Gly Val Leu Ser Pro Leu Ala Leu Thr
565 570 575 Glu Gly
Gly Lys Gly Ser Ser Pro Ser Ile Arg Pro Ile Gln Gly Ser 580
585 590 Gln Gly Ser Ser Ser Pro Val
Glu Lys Glu Val Val Glu Ala Thr Asp 595 600
605 Ser Arg Glu Lys Thr Gly Met Val Arg Pro Gly Glu
Pro Leu Ser Gly 610 615 620
Glu Lys Tyr Ser Pro Lys Glu Leu Leu Ala Leu Leu Lys Cys Val Glu 625
630 635 640 Ala Glu Ile
Ala Asn Tyr Glu Ala Cys Leu Lys Glu Glu Val Glu Lys 645
650 655 Arg Lys Lys Phe Lys Ile Asp Asp
Gln Arg Arg Thr His Asn Tyr Asp 660 665
670 Glu Phe Ile Cys Thr Phe Ile Ser Met Leu Ala Gln Glu
Gly Met Leu 675 680 685
Ala Asn Leu Val Glu Gln Asn Ile Ser Val Arg Arg Arg Gln Gly Val 690
695 700 Ser Ile Gly Arg
Leu His Lys Gln Arg Lys Pro Asp Arg Arg Lys Arg 705 710
715 720 Ser Arg Pro Tyr Lys Ala Lys Arg Gln
725 23599DNAHomo sapiens 2gcccgttgtc
tgtgtgtggg actgaggggc cccgggggcg gtgggggctc ccggtggggg 60cagcggtggg
gagggagggc ctggacatgg cgctgagggg ccgccccgcg ggaagatgaa 120taagggctgg
ctggagctgg agagcgaccc aggcctcttc accctgctcg tggaagattt 180cggtgtcaag
ggggtgcaag tggaggagat ctacgacctt cagagcaaat gtcagggccc 240tgtatatgga
tttatcttcc tgttcaaatg gatcgaagag cgccggtccc ggcgaaaggt 300ctctaccttg
gtggatgata cgtccgtgat tgatgatgat attgtgaata acatgttctt 360tgcccaccag
ctgataccca actcttgtgc aactcatgcc ttgctgagcg tgctcctgaa 420ctgcagcagc
gtggacctgg gacccaccct gagtcgcatg aaggacttca ccaagggttt 480cagccctgag
agcaaaggat atgcgattgg caatgccccg gagttggcca aggcccataa 540tagccatgcc
aggcccgagc cacgccacct ccctgagaag cagaatggcc ttagtgcagt 600gcggaccatg
gaggcgttcc actttgtcag ctatgtgcct atcacaggcc ggctctttga 660gctggatggg
ctgaaggtct accccattga ccatgggccc tggggggagg acgaggagtg 720gacagacaag
gcccggcggg tcatcatgga gcgtatcggc ctcgccactg caggggagcc 780ctaccacgac
atccgcttca acctgatggc agtggtgccc gaccgcagga tcaagtatga 840ggccaggctg
catgtgctga aggtgaaccg tcagacagta ctagaggctc tgcagcagct 900gataagagta
acacagccag agctgattca gacccacaag tctcaagagt cacagctgcc 960tgaggagtcc
aagtcagcca gcaacaagtc cccgctggtg ctggaagcaa acagggcccc 1020tgcagcctct
gagggcaacc acacagatgg tgcagaggag gcggctggtt catgcgcaca 1080agccccatcc
cacagccctc ccaacaaacc caagctagtg gtgaagcctc caggcagcag 1140cctcaatggg
gttcacccca accccactcc cattgtccag cggctgccgg cctttctaga 1200caatcacaat
tatgccaagt cccccatgca ggaggaagaa gacctggcgg caggtgtggg 1260ccgcagccga
gttccagtcc gcccacccca gcagtactca gatgatgagg atgactatga 1320ggatgacgag
gaggatgacg tgcagaacac caactctgcc cttaggtata aggggaaggg 1380aacagggaag
ccaggggcat tgagcggttc tgctgatggg caactgtcag tgctgcagcc 1440caacaccatc
aacgtcttgg ctgagaagct caaagagtcc cagaaggacc tctcaattcc 1500tctgtccatc
aagactagca gcggggctgg gagtccggct gtggcagtgc ccacacactc 1560gcagccctca
cccaccccca gcaatgagag tacagacacg gcctctgaga tcggcagtgc 1620tttcaactcg
ccactgcgct cgcctatccg ctcagccaac ccgacgcggc cctccagccc 1680tgtcacctcc
cacatctcca aggtgctttt tggagaggat gacagcctgc tgcgtgttga 1740ctgcatacgc
tacaaccgtg ctgtccgtga tctgggtcct gtcatcagca caggcctgct 1800gcacctggct
gaggatgggg tgctgagtcc cctggcgctg acagagggtg ggaagggttc 1860ctcgccctcc
atcagaccaa tccaaggcag ccaggggtcc agcagcccag tggagaagga 1920ggtcgtggaa
gccacggaca gcagagagaa gacggggatg gtgaggcctg gcgagccctt 1980gagtggggag
aaatactcac ccaaggagct gctggcactg ctgaagtgtg tggaggctga 2040gattgcaaac
tatgaggcgt gcctcaagga ggaggtagag aagaggaaga agttcaagat 2100tgatgaccag
agaaggaccc acaactacga tgagttcatc tgcaccttta tctccatgct 2160ggctcaggaa
ggcatgctgg ccaacctagt ggagcagaac atctccgtgc ggcggcgcca 2220aggggtcagc
atcggccggc tccacaagca gcggaagcct gaccggcgga aacgctctcg 2280cccctacaag
gccaagcgcc agtgaggact gctggccctg actctgcagc ccactcttgc 2340cgtgtggccc
tcaccagggt ccttccctgc cccacttccc cttttcccag tattactgaa 2400tagtcccagc
tggagagtcc aggccctggg aatgggagga accaggccac attccttcca 2460tcgtgccctg
aggcctgaca cggcagatca gccccatagt gctcaggagg cagcatctgg 2520agttggggca
cagcgaggta ctgcagcttc ctccacagcc ggctgtggag cagcaggacc 2580tggcccttct
gcctgggcag cagaatatat attttaccta tcagagacat ctatttttct 2640gggctccaac
ccaacatgcc accatgttga cataagttcc tacctgacta tgctttctct 2700cctaggagct
gtcctggtgg gcccaggtcc ttgtatcatg ccacggtccc aactacaggg 2760tcctagctgg
gggcctgggt gggccctggg ctctgggccc tgctgctcta gccccagcca 2820ccagcctgtc
cctgttgtaa ggaagccagg tcttctctct tcattcctct taggagagtg 2880ccaaactcag
ggacccagca ctgggctggg ttgggagtag ggtgtcccag tggggttggg 2940gtgagcaggc
tgctgggatc ccatggcctg agcagagcat gtgggaactg ttcagtggcc 3000tgtgaactgt
cttccttgtt ctagccaggc tgttcaagac tgctctccat agcaaggttc 3060tagggctctt
cgccttcagt gttgtggccc tagctatggg cctaaattgg gctctaggtc 3120tctgtccctg
gcgcttgagg ctcagaagag cctctgtcca gcccctcagt attaccatgt 3180ctccctctca
ggggtagcag agacagggtt gcttatagga agctggcacc actcagctct 3240tcctgctact
ccagtttcct cagcctctgc aaggcactca gggtggggga cagcaggatc 3300aagacaaccc
gttggagccc ctgtgttcca gaggacctga tgccaagggg taatgggccc 3360agcagtgcct
ctggagccca ggccccaaca cagccccatg gcctctgcca gatggctttg 3420aaaaaggtga
tccaagcagg cccctttatc tgtacatagt gactgagtgg ggggtgctgg 3480caagtgtggc
agctgcctct gggctgagca cagcttgacc cctctagccc ctgtaaatac 3540tggatcaatg
aatgaataaa actctcctaa gaatctcctg agaaaaaaaa aaaaaaaaa 359939983DNAHomo
sapiens 3ccgttcgccg ccccgccccg tccctcctct cccaccatcc gcgcccagcc
ccgcccatcc 60ccgccttttc ccctagcctg ccccgcccct cctctcgccc cacctgcgcc
cagcacttcc 120cggccccgcc ttttcccctc gcccgctccg cccctcccct cgcagcaccc
gggcctagta 180ctgcccgtcc cgcccctcct ctcgagcctc agcgctcagc atcgcccgga
ccccctcttc 240ccttcgcccg cctcgtcccg accctcccct tcgcccccgt cccgccccgc
ccctcccctt 300cgcccccgtc ccgtcccgcc ccgcccctcc ccttcgcccc cgtccctccc
cttcgccccc 360gtccctccgc gcgtgcgcgt tcgccttcga gcgcatgccc gcatctgctg
tccgacaggc 420ggaagacgag cccagaggcg gagcagggcc gtcgcgcctt ggtgacgtct
gccgccggcg 480cgggcgggtg acgcgactgg gcccgttgtc tgtgtgtggg actgaggggc
cccgggggcg 540gtgggggctc ccggtggggg cagcggtggg gagggagggc ctggacatgg
cgctgagggg 600ccgccccgcg ggaagatgaa taagggctgg ctggagctgg agagcgaccc
aggtgaggag 660gggaccggga gggccagggg ctggggaggc cggatgggcc cgggacgcgc
ctgcctgacc 720atcaccccct cctcttgtcg ccccacccag gcctcttcac cctgctcgtg
gaagatttcg 780gtaagagcct tttctccctg ccggaccggg gctgtggcgg cccacccctg
cgccctcact 840catcaggggc tgtccttccc tactgctttc ctttcctcat cgcaggtgtc
aagggggtgc 900aagtggagga gatctacgac cttcagagca aatgtcaggg gtgagtggct
gtacaccagg 960gctgcccctt acacccagag tgctggggaa ggtcccagag aacagggccc
cttagggaag 1020acagtgccag gaaccctacg ttgtaaaatc tcacagaaag cagcagcctt
gctctctgag 1080tgcccgctcc tgatcaaact gatactttct tttctcccaa actttcctta
gcgcttccct 1140ttttgtagca gccccctccc cacccctaag catcctttgg ttcagctgct
ttcctggcct 1200tgcagcggga agaccccggt cacacaatgt cttttgtgca gttgtgtaat
gtattaattt 1260tagtgtgccc atgtgtcctt ggctttaatc ctgacacaaa gtcatcctgt
attgattggt 1320tggggtgaca aggcccctcc tgggtgccca cacttagagt cttttcccag
tggtcctgca 1380gaatagatgt gtaagagagt agcaacagta gcaaccgtga ctgaaccaag
aagtctactt 1440taatttcctg gaacaaaaga gactggtgtg ggtgttcatt tgctttcctg
actgcattgg 1500ggcccacaag tgagaaggag tgcctcagtt cctcatcaga gtttttgttc
ttgtcttact 1560ttgtgttcct accctgtccc atccttggcc ctcagttcca gcttttcttc
tcttacccag 1620aactatagac ttcataagga gactgggtgg actcctggag catcacagtc
agaggcttat 1680gctttgctct gcctgtggca ggcctttggt gtgtgagggc acaaggccac
ttcagacaca 1740gtgttgggaa gaagccaggg gagagggggg atcacagcaa ggacacctga
gtgatgacgc 1800agtgcaaagg attaatggga gaaagaaggg aatgctgatt gtcttctccc
ctttggctga 1860tctggctctg ccccttactt cccccagccc tgtatatgga tttatcttcc
tgttcaaatg 1920gatcgaagag cgccggtccc ggcgaaaggt ctctaccttg gtggatgata
cgtccgtgat 1980tgatgatgat attgtgaata acatgttctt tgcccaccag gtctgctgga
ctctgtgctt 2040tgtttggagg gtgggatgct gccatgtttt tgcttgggaa gtggaaatgg
aggaagacag 2100gaggaggaga taggcagatt ctaggggtgg tagctacaga aatcctctgg
cagaacgaac 2160tgaactctta attcattaaa gggaacagct ttagagtagg agggtgtctg
agtccactct 2220ctgtgtcctc agatatccag tgggtatttg gtaggtgctt gttaaatgaa
taaacattag 2280gcaaagatga aaggagctga gaaggggagt tgtccagata tgactgacct
gctctggatc 2340cccattcttg atgtatatgg gcttggggct tgcagtgagg ggtgctgtgt
atgggtgact 2400attcttggtt tcacagctga tacccaactc ttgtgcaact catgccttgc
tgagcgtgct 2460cctgaactgc agcagcgtgg acctgggacc caccctgagt cgcatgaagg
acttcaccaa 2520gggtttcagc cctgaggtag gctgcagtgc cttcatcctg gctcacagcc
aactgggcag 2580atctgaccct gagggccact gggaatgcta ccacatgata ttgggtacta
ttaggctgtt 2640tctttttcaa atgattgttt atgttacatt tgactcttaa ataaattgtg
taaggccatt 2700gtttttagat gcagttgcgg ggaaaggaca caggcctagg gagggaggag
agtttcctta 2760agtcagacca tgtcagaacc ttctctgtca ggacttttcc tctcaggcca
tgttgcttcc 2820tagtgtccac taattaccat gcaaggccag cacagtccat ctctttgggg
ctccagagct 2880cttttctgcc cccaccagcc ttttaagaaa gttcgtctgt gttccttccg
attcctggaa 2940tgcctccagg ctgctctctg aagctttgcc ttccacccat agtcctacct
gaggagaaat 3000tattctgata cggccttatt ttcttccccg tagagcaaag gatatgcgat
tggcaatgcc 3060ccggagttgg ccaaggccca taatagccat gccaggtgtg tgggagctgt
gggagctgat 3120gtggggtggg agtaggggga gtatcatttt ttgggccctg actctgtttt
tccccaggcc 3180cgagccacgc cacctccctg agaagcagaa tggccttagt gcagtgcgga
ccatggaggc 3240gttccacttt gtcagctatg tgcctatcac aggccggctc tttgagctgg
atgggctgaa 3300ggtctacccc attgaccatg gtaggcacca tgagctggag gcctgttggg
tgtctctgcc 3360tacctcctag ggagctgggg ctcagggccc tctggtatgt ggtacccagt
ggcaggggtt 3420gtcggtaccg acacccggct ctggctgggg tttcacccta caccatattg
cccgaccagc 3480tcctgattcc ctggctcaac tgctcttctc tgtcttcctt cccactcctg
gcctgcccaa 3540actcagggtt tccttctcgc tgattccttg tcttggtctc cactagggcc
ctggggggag 3600gacgaggagt ggacagacaa ggcccggcgg gtcatcatgg agcgtatcgg
cctcgccact 3660gcagggtaag ggccctgtgc ctgccctgtt ctactctctg gagctgtacc
tactttggga 3720gggacagaga gtatccaggt gatttgtaaa ttgcaaggcc atatggtgaa
tctggcaaga 3780tcaggcttag atcatgggtt ctcaacttgt tgtcttattt cctgcctggg
ctgcctgtgg 3840cctgctcctg ggtgggctgg gggaggggca ggcctcagtg gagccttagg
cagcccaggt 3900ctgctggttc acttccagat aggcccctca tacagcttgt tggaaggtac
cagctcaggt 3960gcctggcatg tatggctagt cgctgcctgc ctgttggggt ggggcctata
cctacagctg 4020caggtgtgac tgcagggagc cctgccagga tatctgcctc aacctgatgg
cggggccggg 4080gcgggagctg ctctcacggc tgcggctgtg actgcaggga gccctaccac
gacatccgct 4140tcaacctgat ggcagtggtg cccgaccgca ggatcaagta tgaggccagg
ctgcatgtgc 4200tgaaggtgaa ccgtcagaca gtactagagg ctctgcagca ggtaggtgcc
ctttcttcct 4260ggcctctgcc cagcccaacc ctccctgcat tcctcctccc ttcccccaca
gcatttgtct 4320ctgattcgtg aacatactct cttgtagatc tgggcttcag ctaaccacat
cttttctttg 4380cccccattgt gggaaaggtg ggacttggag tggggaggga gaatagcttc
taaaaggaag 4440tttgggtttg ggtgttttat ttccctgtga gtgaatgggt agagccaagg
ccattattcc 4500tttaggtcct cagcccttag ctatttaagg tagaagcccg ggtctaccct
ttctcctctg 4560agccctggat tctgttgtta gctgataaga gtaacacagc cagagctgat
tcagacccac 4620aagtctcaag agtcacagct gcctgaggag tccaagtcag ccagcaacaa
gtccccgctg 4680gtgctggaag caaacagggc ccctgcagcc tctgagggca accacacagg
tactgggggg 4740tttgggacct cttgtggacc tcagagccac ccgctaatgt ctgacatggg
aggcctaaac 4800agggaaagtc tttttctggg gatgtccttg ggcagtgttc ttcccccgtc
agaaggtaga 4860gggagagcag tccttcccta aagaaaggca cctgtaaagg gccgctgtta
ccacaggccc 4920ctgggccctt ctctgtaatg tacactccct ttcttgtttt ctctagaggc
ggtttttttt 4980tttttttttt tttttttttt tcttcctgct tcttttttcc catctcattc
tttgccctgt 5040ctcattgcgg gatcatgact tagagcttgc tgactcccat tgcaccagct
ggctgggctg 5100ttcttctctg ggaagtgctg gttcacaggg ccggggagac tgtgagcttt
tcttggagat 5160cctactggag gtcctgcctg tgttcttgcc ctgtctcaga tggtgcagag
gaggcggctg 5220gttcatgcgc acaagcccca tcccacagcc ctcccaacaa acccaagcta
gtggtgaagc 5280ctccaggcag cagcctcaat ggggttcacc ccaaccccac tcccattgtc
cagcggctgc 5340cggcctttct agacaatcac aattatgcca agtcccccat gcaggtaagc
tgggagcacc 5400cttgcaggat tctctacttg attctcttga gaggctgcaa caggcaattt
tcccatgtgg 5460ttccttggtg ttcatccttg gcatggctgg gtcaagctgc ctgggcctgg
gttgctaggt 5520tcctctgcct gatatgaaaa ggcccccaca acagcaggag cttagggagg
cagggagagc 5580tcctttgaat ttaatctagt tacgtggctg tgggattaaa tgtttaggtc
acgctccttg 5640gtacaacttc atgggttggg ttttactggc aaaataaagg catgtgtttc
agggcactct 5700gtttctctta aaacccctcc gtggggttct atccagtgta agtgggtggc
agcctcccca 5760caagccaagg acaggccatg gaacagctgg aggggttccg ctgactcagt
ctggaaaacc 5820atgttggctt tctctctggc tgtgagtgtc taggctcagc ctgggccgag
cagcacttgt 5880ttgtaactgc cctggtcttt gtcccaggag gaagaagacc tggcggcagg
tgtgggccgc 5940agccgagttc cagtccgccc accccagcag tactcagatg atgaggatga
ctatgaggat 6000gacgaggagg atgacgtgca gaacaccaac tctgccctta ggtcagccca
gctttctaag 6060gctaccaggt tctaggtgct tcggatccca tcctgaatat ctcagtctgt
gtctgagaat 6120gccctgcagc agataatgtt gagcacctgc ggagtttggg gccctggggg
aggctggcat 6180gatggggctg accccaggtc cccaggaagt ttttggtggg ctggggggta
aggctgagca 6240cgtaagctta tatcatgtcc tattggaagt ggccttttag ccaggccttg
aaggattggt 6300tggggcaggg atggaggaga tgtgggtggt ggggaggcag ctttgctgga
acacagggca 6360ttggcaaaag gccaggagtg ggatggctgg aatagaggaa gtgtcttttg
aggacacttg 6420gctgcagctg tcagaacttg atgccaggct tagcatggct agttcaagtt
gcttggacca 6480agtataagga gttttagggt cagcccctgg aggtcgggat gtatttaagc
cattctgggt 6540actgctgggt atggtcacct ggcccgttcc cttgcttcac atcttctcgg
gccccacagg 6600tataagggga agggaacagg gaagccaggg gcattgagcg gttctgctga
tgggcaactg 6660tcagtgctgc agcccaacac catcaacgtc ttggctgaga agctcaaaga
gtcccagaag 6720gacctctcaa ttcctctgtc catcaagact agcagcgggg ctgggagtcc
ggctgtggca 6780gtgcccacac actcgcagcc ctcacccacc cccagcaatg agagtacaga
cacggcctct 6840gagatcggca gtgctttcaa ctcgccactg cgctcgccta tccgctcagc
caacccgacg 6900cggccctcca gccctgtcac ctcccacatc tccaaggtgc tttttggaga
ggatgacagc 6960ctgctgcgtg ttgactgcat acgctacaac cgtgctgtcc gtgatctggg
tcctgtcatc 7020agcacaggcc tgctgcacct ggctgaggat ggggtgctga gtcccctggc
gctgacaggt 7080gggccttgga ctggctcact ggccacttgg tgcacccagg agggaggagg
gaagtggcca 7140agtgaccaca aagtgtcctg cactctgatg attttcttgt gacctctctt
cccagagggt 7200gggaagggtt cctcgccctc catcagacca atccaaggca gccaggggtc
cagcagccca 7260gtggagaagg aggtcgtgga agccacggac agcagagaga agacggggat
ggtgaggcct 7320ggcgagccct tgagtgggga gaaatactca cccaaggtga gcctccgttg
tggttttctc 7380ctttaatcct ggcagagggt aaggcctgag ctcctcctgc ccaggtgcca
agttcttgat 7440tggaactttg gtgtgaagat tggtggctgg agccatgtgc cagaagactt
tctgggttgg 7500gtggtggcag gggccttgat aggcatggac tcgctgctca tccttgcctc
tagctgccta 7560ttgctcgtgg ggctttgttg ctggcccgcc ccgatcagag gtgcaatgct
gggttttggc 7620aggagctgct ggcactgctg aagtgtgtgg aggctgagat tgcaaactat
gaggcgtgcc 7680tcaaggagga ggtagagaag aggaagaagt tcaaggtggg tgatttctcc
agttgcctga 7740tctggcctct cccgaggtcc actggtggct gctctggcaa gattggctcc
agtgctctca 7800gtcttcttct ctcctacaga ttgatgacca gagaaggacc cacaactacg
atgagttcat 7860ctgcaccttt atctccatgc tggctcagga aggtgagggg atgcgctgct
gtcttaactg 7920gaatgccctg ctgagggccg tgtccttcag ctcccctccc ctggcctctc
ctgaggcttg 7980agcagacctt ggggcacagg gagggccatg agagcctcag ctcctggcct
gaggcagcca 8040gcacctgctc aagggtctct acctcttcgc aggcatgctg gccaacctag
tggagcagaa 8100catctccgtg cggcggcgcc aaggggtcag catcggccgg ctccacaagc
agcggaagcc 8160tgaccggcgg aaacgctctc gcccctacaa ggccaagcgc cagtgaggac
tgctggccct 8220gactctgcag cccactcttg ccgtgtggcc ctcaccaggg tccttccctg
ccccacttcc 8280ccttttccca gtattactga atagtcccag ctggagagtc caggccctgg
gaatgggagg 8340aaccaggcca cattccttcc atcgtgccct gaggcctgac acggcagatc
agccccatag 8400tgctcaggag gcagcatctg gagttggggc acagcgaggt actgcagctt
cctccacagc 8460cggctgtgga gcagcaggac ctggcccttc tgcctgggca gcagaatata
tattttacct 8520atcagagaca tctatttttc tgggctccaa cccaacatgc caccatgttg
acataagttc 8580ctacctgact atgctttctc tcctaggagc tgtcctggtg ggcccaggtc
cttgtatcat 8640gccacggtcc caactacagg gtcctagctg ggggcctggg tgggccctgg
gctctgggcc 8700ctgctgctct agccccagcc accagcctgt ccctgttgta aggaagccag
gtcttctctc 8760ttcattcctc ttaggagagt gccaaactca gggacccagc actgggctgg
gttgggagta 8820gggtgtccca gtggggttgg ggtgagcagg ctgctgggat cccatggcct
gagcagagca 8880tgtgggaact gttcagtggc ctgtgaactg tcttccttgt tctagccagg
ctgttcaaga 8940ctgctctcca tagcaaggtt ctagggctct tcgccttcag tgttgtggcc
ctagctatgg 9000gcctaaattg ggctctaggt ctctgtccct ggcgcttgag gctcagaaga
gcctctgtcc 9060agcccctcag tattaccatg tctccctctc aggggtagca gagacagggt
tgcttatagg 9120aagctggcac cactcagctc ttcctgctac tccagtttcc tcagcctctg
caaggcactc 9180agggtggggg acagcaggat caagacaacc cgttggagcc cctgtgttcc
agaggacctg 9240atgccaaggg gtaatgggcc cagcagtgcc tctggagccc aggccccaac
acagccccat 9300ggcctctgcc agatggcttt gaaaaaggtg atccaagcag gcccctttat
ctgtacatag 9360tgactgagtg gggggtgctg gcaagtgtgg cagctgcctc tgggctgagc
acagcttgac 9420ccctctagcc cctgtaaata ctggatcaat gaatgaataa aactctccta
agaatctcct 9480gagaaatgaa ccctcctgtg gttgctggcc tgagatatgg aggctgggcc
ttactagacc 9540tcatgggcct agggccctgg gaccagaaag gtaagaagta tatgatcctt
gagtgtccag 9600ctgtcttggg ccagagatcc ttggaatcct aggcctggga tttaggacct
gagctgagga 9660gggacttcag gtggactgta gacagggtgc actttctggg gagagggcca
tggctttcac 9720caaatctgtg gctttgcagc ctggagaggt gctgggactg tgggtcaaag
aggcggggct 9780gcctctaatc taatctcgcc tggtgtgttc tccctgggag ggcgctgggc
atctcttcct 9840tgttgctttt ggacaggtaa agcaggtcaa agctgccgcc tctgtcccgc
tctcctctgc 9900cgactgcatc gtctgctgag gctgctgcag cccctcacca gccccctggc
agtgagtcct 9960gcagaggggt cctcatgcaa gca
9983449DNAHomo sapiens 4tccccgtaga gcaaaggata tgcgattggc
aatgccccgg agttggcaa 49511DNAHomo sapiens 5ccccatccca c
11623DNAHomo
sapiens 6tgaccatggt aggcaccatg agc
23715DNAHomo sapiens 7cgggtcatca tggag
15835DNAHomo sapiens 8cccctcctct tgtcgcccca
cccaggcctc ttcac 35912DNAHomo sapiens
9gagctgctgg ca
121025DNAHomo sapiens 10ggaggcgttc cactttgtca gctat
251138DNAHomo sapiens 11atcttccacg agcagggtga
agaggcctgg gtggggcg 381227DNAHomo sapiens
12cagaaccatc tccgtgcggc ggcgcca
271339DNAHomo sapiens 13attcatcttc ccgcggggcg gcccctcagc gccatgtcc
391421DNAHomo sapiens 14ggtatcagct gtgaaaccaa g
211520DNAHomo sapiens
15aggctgctgc tttctgtgag
201619DNAHomo sapiens 16cgttgtctgt gtgtgggac
191720DNAHomo sapiens 17atgctgattg tcttctcccc
201820DNAHomo sapiens
18ctccatttcc acttcccaag
201918DNAHomo sapiens 19cttggggctt gcagtgag
182020DNAHomo sapiens 20atgtggtagc attcccagtg
202121DNAHomo sapiens
21ggccttgcaa tttacaaatc a
212220DNAHomo sapiens 22tgtcttcctt cccactcctg
202322DNAHomo sapiens 23ggatatctgc ctcaacctga tg
222419DNAHomo sapiens
24gaagggagga ggaatgcag
192520DNAHomo sapiens 25ttcctttagg tcctcagccc
202620DNAHomo sapiens 26ctgaggtcca caagaggtcc
202718DNAHomo sapiens
27cagacattag cgggtggc
182819DNAHomo sapiens 28aagggtgctc ccagcttac
192920DNAHomo sapiens 29cctgtgttct tgccctgtct
203021DNAHomo sapiens
30gctgtgagtg tctaggctca g
213122DNAHomo sapiens 31agactgagat attcaggatg gg
223221DNAHomo sapiens 32ccaagtgacc acaaagtgtc c
213320DNAHomo sapiens
33agctcaggcc ttaccctctg
203420DNAHomo sapiens 34ctgagcacta tggggctgat
203520DNAHomo sapiens 35tcttaactgg aatgccctgc
203620DNAHomo sapiens
36ctgccttgga ttggtctgat
203720DNAHomo sapiens 37caacaccatc aacgtcttgg
203820DNAHomo sapiens 38tgatgacagg acccagatca
203920DNAHomo sapiens
39gctgtcagaa cttgatgcca
204020DNAHomo sapiens 40ctagctgcct attgctcgtg
204119DNAHomo sapiens 41gaggggagct gaaggacac
194220DNAHomo sapiens
42tttgccttcc acccatagtc
204319DNAHomo sapiens 43agctccctag gaggtaggc
194412DNAHomo sapiens 44gggctgtggg at
124512DNAHomo sapiens
45gggctcttgt gc
124614DNAHomo sapiens 46gggccctggg ggga
144714DNAHomo sapiens 47gggccctgag ggga
1448170PRTHomo sapiens 48Leu Ile
Pro Asn Ser Cys Ala Thr His Ala Leu Leu Ser Val Leu Leu 1 5
10 15 Asn Cys Ser Ser Val Asp Leu
Gly Pro Thr Leu Ser Arg Met Lys Asp 20 25
30 Phe Thr Lys Gly Phe Ser Pro Glu Ser Lys Gly Tyr
Ala Ile Gly Asn 35 40 45
Ala Pro Glu Leu Ala Lys Ala His Asn Ser His Ala Arg Pro Glu Pro
50 55 60 Arg His Leu
Pro Glu Lys Gln Asn Gly Leu Ser Ala Val Arg Thr Met 65
70 75 80 Glu Ala Phe His Phe Val Ser
Tyr Val Pro Ile Thr Gly Arg Leu Phe 85
90 95 Glu Leu Asp Gly Leu Lys Val Tyr Pro Ile Asp
His Gly Gln Glu Ser 100 105
110 Gln Leu Pro Glu Glu Ser Lys Ser Ala Ser Asn Lys Ser Pro Leu
Val 115 120 125 Leu
Gly Glu Lys Tyr Ser Pro Lys Glu Leu Leu Ala Leu Leu Lys Cys 130
135 140 Val Glu Ala Glu Ile Ala
Ile Asp Asp Gln Arg Arg Thr His Asn Tyr 145 150
155 160 Asp Glu Phe Ile Cys Thr Phe Ile Ser Met
165 170 49170PRTPan troglodytes 49 Leu Ile
Pro Asn Ser Cys Ala Thr His Ala Leu Leu Ser Val Leu Leu 1 5
10 15 Asn Cys Ser Asn Val Asp Leu
Gly Pro Thr Leu Ser Arg Met Lys Asp 20 25
30 Phe Thr Lys Gly Phe Ser Pro Glu Ser Lys Gly Tyr
Ala Ile Gly Asn 35 40 45
Ala Pro Glu Leu Ala Lys Ala His Asn Ser His Ala Arg Pro Glu Pro
50 55 60 Arg His Leu
Pro Glu Lys Gln Asn Gly Leu Ser Ala Val Arg Thr Met 65
70 75 80 Glu Ala Phe His Phe Val Ser
Tyr Val Pro Ile Thr Gly Arg Leu Phe 85
90 95 Glu Leu Asp Gly Leu Lys Val Tyr Pro Ile Asp
His Gly Gln Glu Ser 100 105
110 Gln Leu Pro Glu Glu Ser Lys Ser Ala Ser Asn Lys Ser Pro Leu
Val 115 120 125 Leu
Gly Glu Lys Tyr Ser Pro Lys Glu Leu Leu Ala Leu Leu Lys Cys 130
135 140 Val Glu Ala Glu Ile Ala
Ile Asp Asp Gln Arg Arg Thr His Asn Tyr 145 150
155 160 Asp Glu Phe Ile Cys Thr Phe Ile Ser Met
165 170 50170PRTMacaca mulatta 50Leu Ile Pro
Asn Ser Cys Ala Thr His Ala Leu Leu Ser Val Leu Leu 1 5
10 15 Asn Cys Ser Asn Val Asp Leu Gly
Pro Thr Leu Ser Arg Met Lys Asp 20 25
30 Phe Thr Lys Gly Phe Ser Pro Glu Ser Lys Gly Tyr Ala
Ile Gly Asn 35 40 45
Ala Pro Glu Leu Ala Lys Ala His Asn Ser His Ala Arg Pro Glu Pro 50
55 60 Arg His Leu Pro
Glu Lys Gln Asn Gly Leu Ser Ala Val Arg Thr Met 65 70
75 80 Glu Ala Phe His Phe Val Ser Tyr Val
Pro Ile Thr Gly Arg Leu Phe 85 90
95 Glu Leu Asp Gly Leu Lys Val Tyr Pro Ile Asp His Gly Gln
Glu Ser 100 105 110
Gln Leu Pro Glu Glu Ser Lys Ser Ala Ser Asn Lys Ser Pro Leu Val
115 120 125 Leu Gly Glu Lys
Tyr Ser Pro Lys Glu Leu Leu Ala Leu Leu Lys Cys 130
135 140 Val Glu Ala Glu Ile Ala Ile Asp
Asp Gln Arg Arg Thr His Asn Tyr 145 150
155 160 Asp Glu Phe Ile Cys Thr Phe Ile Ser Met
165 170 51170PRTMus musculus 51Leu Ile Pro Asn Ser
Cys Ala Thr His Ala Leu Leu Ser Val Leu Leu 1 5
10 15 Asn Cys Ser Asn Val Asp Leu Gly Pro Thr
Leu Ser Arg Met Lys Asp 20 25
30 Phe Thr Lys Gly Phe Ser Pro Glu Ser Lys Gly Tyr Ala Ile Gly
Asn 35 40 45 Ala
Pro Glu Leu Ala Lys Ala His Asn Ser His Ala Arg Pro Glu Pro 50
55 60 Arg His Leu Pro Glu Lys
Gln Asn Gly Leu Ser Ala Val Arg Thr Met 65 70
75 80 Glu Ala Phe His Phe Val Ser Tyr Val Pro Ile
Thr Gly Arg Leu Phe 85 90
95 Glu Leu Asp Gly Leu Lys Val Tyr Pro Ile Asp His Gly Gln Glu Ser
100 105 110 Gln Leu
Pro Glu Glu Ser Lys Pro Ala Ser Ser Lys Ser Pro Leu Gly 115
120 125 Leu Gly Glu Lys Tyr Ser Pro
Lys Glu Leu Leu Ala Leu Leu Lys Cys 130 135
140 Val Glu Ala Glu Ile Ala Ile Asp Asp Gln Arg Arg
Thr His Asn Tyr 145 150 155
160 Asp Glu Phe Ile Cys Thr Phe Ile Ser Met 165
170 52170PRTRattus norvegicus 52Leu Ile Pro Asn Ser Cys Ala Thr
His Ala Leu Leu Ser Val Leu Leu 1 5 10
15 Asn Cys Ser Asn Val Asp Leu Gly Pro Thr Leu Ser Arg
Met Lys Asp 20 25 30
Phe Thr Lys Gly Phe Ser Pro Glu Ser Lys Gly Tyr Ala Ile Gly Asn
35 40 45 Ala Pro Glu Leu
Ala Lys Ala His Asn Ser His Ala Arg Pro Glu Pro 50
55 60 Arg His Leu Pro Glu Lys Gln Asn
Gly Leu Ser Ala Val Arg Thr Met 65 70
75 80 Glu Ala Phe His Phe Val Ser Tyr Val Pro Ile Thr
Gly Arg Leu Phe 85 90
95 Glu Leu Asp Gly Leu Lys Val Tyr Pro Ile Asp His Gly Gln Glu Ser
100 105 110 Gln Leu Pro
Glu Glu Ser Lys Pro Ala Ser Ser Lys Ser Pro Phe Gly 115
120 125 Leu Gly Glu Lys Tyr Ser Pro Lys
Glu Leu Leu Ala Leu Leu Lys Cys 130 135
140 Val Glu Ala Glu Ile Ala Ile Asp Asp Gln Arg Arg Thr
His Asn Tyr 145 150 155
160 Asp Glu Phe Ile Cys Thr Phe Ile Ser Met 165
170 53170PRTBos taurus 53Leu Ile Pro Asn Ser Cys Ala Thr His Ala
Leu Leu Ser Val Leu Leu 1 5 10
15 Asn Cys Ser Asn Val Asp Leu Gly Pro Thr Leu Ser Arg Met Lys
Asp 20 25 30 Phe
Thr Lys Gly Phe Ser Pro Glu Ser Lys Gly Tyr Ala Ile Gly Asn 35
40 45 Ala Pro Glu Leu Ala Lys
Ala His Asn Ser His Ala Arg Pro Glu Pro 50 55
60 Arg His Leu Pro Glu Lys Gln Asn Gly Leu Ser
Ala Val Arg Thr Met 65 70 75
80 Glu Ala Phe His Phe Val Ser Tyr Val Pro Ile Thr Gly Arg Leu Phe
85 90 95 Glu Leu
Asp Gly Leu Lys Val Tyr Pro Ile Asp His Gly Gln Glu Ser 100
105 110 Gln Leu Pro Glu Glu Ser Lys
Pro Ala Ser Ser Lys Ser Pro Leu Ala 115 120
125 Leu Gly Glu Lys Tyr Ser Pro Lys Glu Leu Leu Ala
Leu Leu Lys Cys 130 135 140
Val Glu Ala Glu Ile Ala Ile Asp Asp Gln Arg Arg Thr His Asn Tyr 145
150 155 160 Asp Glu Phe
Ile Cys Thr Phe Ile Ser Met 165 170
54170PRTDidelphis virginiana 54Leu Ile Pro Asn Ser Cys Ala Thr His Ala
Leu Leu Ser Val Leu Leu 1 5 10
15 Asn Cys Ser Asn Val Asp Leu Gly Pro Thr Leu Ser Arg Met Lys
Asp 20 25 30 Phe
Thr Lys Gly Phe Ser Pro Glu Ser Lys Gly Tyr Ala Ile Gly Asn 35
40 45 Ala Pro Glu Leu Ala Lys
Ala His Asn Ser His Ala Arg Pro Glu Pro 50 55
60 Arg His Leu Pro Glu Lys Gln Asn Gly Ile Ser
Ala Val Arg Thr Met 65 70 75
80 Glu Ala Phe His Phe Val Ser Tyr Val Pro Ile Lys Gly Arg Leu Phe
85 90 95 Glu Leu
Asp Gly Leu Lys Val Tyr Pro Ile Asp His Gly Gln Glu Ser 100
105 110 Gln Pro Pro Glu Asp Ser Lys
Pro Ala Ser Cys Lys Pro Ser Leu Val 115 120
125 Leu Gly Glu Lys Tyr Ser Pro Lys Glu Leu Leu Ala
Leu Leu Lys Cys 130 135 140
Val Glu Ala Glu Ile Ala Ile Asp Asp Gln Arg Arg Thr His Asn Tyr 145
150 155 160 Asp Glu Phe
Ile Cys Thr Phe Ile Ser Met 165 170
55167PRTGallus gallus 55Leu Ile Pro Asn Ser Cys Ala Thr His Ala Leu Leu
Ser Val Leu Leu 1 5 10
15 Asn Cys Asn Asn Val Asp Leu Gly Pro Thr Leu Ser Arg Met Lys Asp
20 25 30 Phe Thr Lys
Gly Phe Ser Pro Glu Ser Lys Gly Tyr Ala Ile Gly Asn 35
40 45 Ala Pro Glu Leu Ala Lys Ala Arg
Asn Ser His Ala Arg Pro Glu Pro 50 55
60 Arg His Leu Pro Glu Lys Gln Asn Gly Ile Ser Ala Val
Arg Thr Met 65 70 75
80 Glu Ala Phe His Phe Val Ser Tyr Val Pro Ile Lys Gly Arg Leu Phe
85 90 95 Glu Leu Asp Gly
Leu Lys Val Tyr Pro Ile Asp His Gly Gln Glu Ser 100
105 110 Gln Ser Pro Glu Glu Ala Lys Pro Ala
Asn Ser Lys Thr Leu Gly Glu 115 120
125 Lys Tyr Ser Pro Lys Glu Leu Leu Ala Leu Leu Lys Cys Val
Glu Ala 130 135 140
Glu Ile Ala Ile Asp Asp Gln Arg Arg Thr His Asn Tyr Asp Glu Phe 145
150 155 160 Ile Cys Thr Phe Ile
Ser Met 165 56166PRTTaeniopygia guttata 56Leu Ile
Pro Asn Ser Cys Ala Thr His Ala Leu Leu Ser Val Leu Leu 1 5
10 15 Asn Cys Asn Asn Val Asp Leu
Gly Pro Thr Leu Ser Arg Met Lys Asp 20 25
30 Phe Thr Lys Gly Phe Ser Pro Glu Ser Lys Gly Tyr
Ala Ile Gly Asn 35 40 45
Ala Pro Glu Leu Ala Lys Ala His Asn Ser His Ala Arg Pro Glu Pro
50 55 60 Arg His Leu
Pro Glu Lys Gln Asn Gly Ile Ser Ala Val Arg Thr Met 65
70 75 80 Glu Ala Phe His Phe Val Ser
Tyr Val Pro Ile Lys Gly Arg Leu Phe 85
90 95 Glu Leu Asp Gly Leu Lys Val Tyr Pro Ile Asp
His Gly Gln Glu Ser 100 105
110 Gln Pro Gly Glu Glu Ala Lys Pro Ala Ser Ser Lys Thr Gly Glu
Lys 115 120 125 Tyr
Ser Pro Lys Glu Leu Leu Ala Leu Leu Lys Cys Val Glu Ala Glu 130
135 140 Ile Ala Ile Asp Asp Gln
Arg Arg Thr His Asn Tyr Asp Glu Phe Ile 145 150
155 160 Cys Thr Phe Ile Ser Met 165
57170PRTXenopus Tropicalis 57Leu Ile Pro Asn Ser Cys Ala Thr His Ala
Leu Leu Ser Val Leu Leu 1 5 10
15 Asn Cys Ser Gly Val His Leu Gly Pro Thr Leu Ser Arg Ile Lys
Glu 20 25 30 Phe
Thr Lys Gly Phe Ser Pro Glu Ser Lys Gly Tyr Ala Ile Gly Asn 35
40 45 Ala Pro Glu Leu Ala Lys
Ala His Asn Ser His Ala Arg Pro Glu Pro 50 55
60 Arg His Leu Pro Glu Lys Gln Asn Gly Ile Ser
Ala Val Arg Thr Met 65 70 75
80 Glu Ala Phe His Phe Val Ser Tyr Val Pro Ile Lys Gly Arg Leu Phe
85 90 95 Glu Leu
Asp Gly Leu Lys Val Tyr Pro Ile Asp His Gly Thr Glu Gly 100
105 110 Gln Ser Thr Glu Glu Thr Lys
Ser Ala Ala Leu Lys Ala Pro Val Ser 115 120
125 Gln Gly Glu Lys Phe Ser Pro Lys Glu Leu Leu Ala
Leu Leu Lys Cys 130 135 140
Val Glu Ala Glu Ile Ser Ile Asp Asp Gln Arg Arg Thr His Asn Tyr 145
150 155 160 Asp Glu Phe
Ile Cys Ala Phe Ile Ser Met 165 170
58163PRTDanio rerio 58Leu Ile Pro Asn Ser Cys Ala Thr His Ala Leu Leu Ser
Val Leu Leu 1 5 10 15
Asn Cys Ser Gly Val Glu Leu Gly Met Thr Leu Ser Arg Met Lys Ala
20 25 30 Phe Thr Lys Gly
Phe Asn Pro Glu Ser Lys Gly Tyr Ala Ile Gly Asn 35
40 45 Ala Pro Glu Leu Ala Lys Ala His Asn
Ser His Ala Arg Pro Glu Pro 50 55
60 Arg His Leu Pro Glu Lys Gln Asn Gly Ile Ser Ala Val
Arg Thr Met 65 70 75
80 Glu Ala Phe His Phe Val Ser Tyr Val Pro Ile Lys Asp Arg Leu Phe
85 90 95 Glu Leu Asp Gly
Leu Lys Ala Tyr Pro Ile Asp His Gly Gln Asp Ser 100
105 110 Ser Ser Ser Glu Asp Thr Pro Pro Val
Leu Gly Glu Lys Tyr Thr Pro 115 120
125 Lys Glu Leu Leu Ala Leu Leu Lys Tyr Val Glu Ala Asp Ile
Ala Ile 130 135 140
Asp Asp Gln Arg Arg Thr His Asn Tyr Asp Glu Phe Ile Cys Thr Phe 145
150 155 160 Ile Ser Met
59154PRTDrosophila melanogaster 59Val Val Pro Asn Ser Cys Ala Thr His Ala
Leu Leu Ser Val Leu Leu 1 5 10
15 Asn Cys Asn Glu Asn Asn Leu Gln Leu Gly Asp Thr Leu Ser Arg
Leu 20 25 30 Lys
Thr His Thr Lys Gly Met Ser Pro Glu Asn Lys Gly Leu Ala Ile 35
40 45 Gly Asn Thr Pro Glu Leu
Ala Cys Ala His Asn Ser His Ala Met Pro 50 55
60 Gln Ala Arg Arg Arg Leu Glu Arg Thr Gly Ala
Gly Val Ser Ser Cys 65 70 75
80 Arg Phe Thr Gly Glu Ala Phe His Phe Val Ser Phe Val Pro Ile Asn
85 90 95 Gly Gln
Leu Phe Glu Leu Asp Gly Leu Lys Pro Tyr Pro Met Asn His 100
105 110 Gly Pro Ser Ala Phe Thr Ala
Arg Asp Leu Gln Ser Leu Leu Lys Asn 115 120
125 Leu Asp Thr Glu Ile Ala Val Asp Ala Ser Arg Arg
Thr His Asn Tyr 130 135 140
Asp Lys Phe Ile Cys Thr Phe Leu Ser Met 145 150
60152PRTCaenorhabditis elegans 60Thr Ile Gln Asn Ala Cys Ala
Thr Gln Ala Leu Ile Asn Leu Leu Met 1 5
10 15 Asn Val Glu Asp Thr Asp Val Lys Leu Gly Asn
Ile Leu Asn Gln Tyr 20 25
30 Lys Glu Phe Ala Ile Asp Leu Asp Pro Asn Thr Arg Gly His Cys
Leu 35 40 45 Ser
Asn Ser Glu Glu Ile Arg Thr Val His Asn Ser Phe Ser Arg Gln 50
55 60 Thr Leu Phe Glu Leu Asp
Ile Lys Gly Gly Glu Ser Glu Asp Asn Tyr 65 70
75 80 His Phe Val Thr Tyr Val Pro Ile Gly Asn Lys
Val Tyr Glu Leu Asp 85 90
95 Gly Leu Arg Glu Leu Pro Leu Glu Val Ala Met Glu Met Tyr Arg Lys
100 105 110 Glu Asn
Asn Arg Arg Arg His Asn Tyr Thr Pro Phe Val Ile Leu Glu 115
120 125 Glu Gln Ile Ala Lys Glu Asn
Asn Arg Arg Arg His Asn Tyr Thr Pro 130 135
140 Phe Val Ile Glu Leu Met Lys Ile 145
150 6119DNAHomo sapiens 61ttatgggcca gaaaataag
196219DNAHomo sapiens 62ttatgggcct
tggccaact 19
User Contributions:
Comment about this patent or add new information about this topic: