Patent application title: ASSAY AND MEDICAMENT
Inventors:
Nigel J. Dimmock (Coventry, Warwickshire, GB)
Andrew J. Easton (Coventry, Warwickshire, GB)
IPC8 Class: AC12N700FI
USPC Class:
1 1
Class name:
Publication date: 2016-11-17
Patent application number: 20160333321
Abstract:
The invention relates to defective interfering viruses and defective
interfering virus RNAs that are effective as antiviral agents. The
invention also relates to methods for identifying defective interfering
virus RNAs that can be used as effective antiviral agents.Claims:
1. A defective interfering virus RNA, wherein the RNA is mutated to
prevent expression of any encoded protein.
2. The DI virus RNA of claim 1, wherein one or more AUG initiation codons are mutated.
3. The DI virus RNA of claim 2, wherein all the AUG initiation codons are mutated.
4. The DI virus RNA of claim 2, wherein one or more AUG are mutated to AUC.
5. The DI virus RNA of claim 1, wherein the DI virus is 1/244.
6. A DI virus which comprises the DI virus RNA claim 1.
7. A method of treating or prophylaxis of influenza A infection, comprising administering to the patient a therapeutically effective amount of the DI virus according to claim 6.
8. A method to identify an antiviral agent comprising monitoring for the production of RNA from segments 1, 2 and 3 of influenza A virus in the presence of a test defective interfering influenza virus RNA, wherein a defective interfering virus RNA that interferes with production of RNA from each of segment 1, 2 and 3 is identified as an antiviral agent.
9. The method of claim 8, wherein the method is conducted in a host cell.
10. The method of claim 9, wherein the host cell is transfected with nucleic acid comprising segments 1, 2 and 3 of influenza virus.
11. The method of claim 10, wherein each of said segments 1, 2 and 3 is provided on a separate plasmid.
12. The method of claim 8, wherein RNA production from each of segments 1, 2 and 3 is monitored in a separate assay.
13. The method of claim 8, wherein the RNA comprises cRNA, mRNA and/or vRNA.
14. The method of claim 13, wherein both cRNA and mRNA production are monitored.
15. The method according to claim 8, wherein one or more of segments 1, 2 or 3 is provided as a construct with an encoded reporter gene, such that a reduction in production of RNA from the segment reduces expression of the reporter gene.
16. An antiviral agent identified by the method of claim 8 for use in a method of treatment or prophylaxis of influenza A infection.
17. A cloned or recombinant defective interfering influenza A virus comprising RNA derived from segment 1, 2 or 3, wherein said RNA comprises: (a) an RNA of between 300 to 600 nucleotides in length; (b) at least 100 nucleotides from the 5' and 3' ends of segment 1, 2 or 3; (c) a central deletion of nucleotides of said segment; wherein said defective interfering influenza virus is capable of interfering with RNA production from segments 1, 2 and 3 of influenza A.
18. The defective interfering virus of claim 17, wherein the DI virus is not 1/244.
19. The defective interfering virus of claim 17, for use in a method of treatment or prophylaxis of influenza A infection.
Description:
FIELD OF THE INVENTION
[0001] The present invention relates to methods for identifying an antiviral agent, and in particular, to methods for assaying a defective interfering virus RNA to identify an antiviral agent. The invention also relates to new defective interfering viruses that are effective as antiviral agents.
BACKGROUND OF THE INVENTION
[0002] The influenza A genome comprises 8 segments of single stranded negative-sense RNA (vRNA) in the form of ribonucleoprotein (RNP) complexes. Inclusion of one copy of each of the 8 segments is required to make an infectious virus particle.
[0003] During the course of viral replication, progeny genomes can be generated that contain extensive deletions. At least some of such truncated genomes contain the signals necessary for packaging the nucleic acid into virus particles. However, the truncated genomes themselves are unable to generate infectious virus particles and are thus functionally defective. Some defective genomes are capable of interfering with the growth of the parental virus from which they were derived. The ability of such defective interfering (DI) genomes to interfere with virus replication had led to the suggestion that they can be used as the basis for a new approach to antiviral therapy.
[0004] Influenza virus infections can generate small DI RNA segments which can interfere with virus replication. Most influenza DI RNAs have a major (approximately 80%) internal deletion, and retain the cis-acting signals required for replication and packaging into virus particles. DI RNA is incorporated into a DI virus particle but the resulting DI virus particle cannot replicate autonomously since the deleted RNA is unable to synthesize the protein normally encoded by the full length segment. Hence, replication of a DI virus requires complementation by infectious virus.
[0005] Influenza virus genome replication commences with synthesis of positive-sense (cRNA) copies of the vRNA segments of the infecting virus, and these in turn are used as templates for synthesis of new vRNAs. vRNAs are also used as the template for mRNA transcription. Unlike cRNA synthesis, mRNA synthesis is initiated using a primer cleaved from the capped 5' end of host mRNA and its synthesis terminates before the end of the template vRNA, prior to polyadenylation. Thus the mRNA differs from cRNA in having the primer-derived 5'-extension, and in being truncated and polyadenylated at the 3' end. The non-coding termini of each segment are crucial for RNA synthesis, and contain conserved, approximately 12 nucleotide (nt) sequences at the 5' ends which are almost exactly complemented at the 3' ends.
[0006] The synthesis of influenza virus RNA is carried out by a virus-encoded RNA-dependent RNA polymerase present within each RNP complex that consists of the vRNA or cRNA strongly associated with the virus nucleoprotein (NP). The viral RNA polymerase comprises a heterotrimer of PB1, PB2 and PA proteins, which are encoded by vRNA segments 2, 1 and 3, respectively.
[0007] Little progress has been made towards understanding the mechanism of interference by DI viruses generated by deletion. For DI RNAs generated by a central deletion, interference with RNA synthesis could involve specific competition between the DI RNA from which it is derived and genomic RNA for a limiting viral or host factor(s), and/or the much shorter DI RNA may have a more rapid rate of synthesis than its cognate genomic RNA giving it a competitive advantage, although there is little experimental evidence to support this.
[0008] Most studies of DI influenza virus-mediated interference to date have been carried out with naturally occurring preparations, and are compromised by the presence of mixtures of several different defective RNA sequences. This problem has been solved recently using reverse genetics to generate virus stocks containing a molecularly defined DI RNA (Dimmock et al. 2008). One such DI RNA is 1/317, derived from segment 1 of an avian H7N7 influenza A virus. This was present in a non-cloned virus that interfered with RNA packaging but had no discernible effect on viral RNA synthesis (Duhaut and McCauley 1996). Although the cloned 1/317 DI RNA, delivered intranasally as an influenza virus particle, has protective activity in mice, it was 100-fold less active than 1/244 DI RNA, derived from segment 1 of a human H1N1 virus, in the same delivery system (Dimmock et al. 2008). Inoculation of mice with 1/244 DI virus conferred complete protection from a lethal challenge with several different subtypes of influenza A virus (homologous protection) (Dimmock et al. 2008). However, the molecular basis of protection by 1/244 DI virus is not known. In addition to protection from influenza A viruses, 1/244 DI virus also protects from the heterologous influenza B virus and a murine paramyxovirus in a dose-dependent manner (Easton et al. 2011; Scott et al. 2011). Heterologous (but not homologous) protection is dependent on interferon type I.
SUMMARY OF THE INVENTION
[0009] The present invention has identified that the effectiveness of a DI influenza A virus to interfere with influenza A virus replication can be attributed to the ability of the DI virus RNA to interfere with production of RNA not only from the segment from which the DI virus RNA is derived, but also to interfere with production of RNA from all of segments 1, 2 and 3. As such, the present invention provides new methods for identifying defective interfering viruses that can be used as effective antiviral agents. Also, we provide novel defective interfering viruses.
[0010] The present invention has also identified that protein production from the DI virus RNA is not required for interfering activity. Accordingly, the present invention is also directed to a DI virus RNA in which the deleted segment RNA is further mutated to prevent expression of protein, for example, by deletion or mutation of one or more initiation codons AUG.
[0011] In accordance with one aspect the invention provides A method to identify an antiviral agent comprises monitoring for the production of RNA from segments 1, 2 and 3 of influenza A virus in the presence of a test defective interfering influenza virus RNA, wherein a defective interfering virus RNA that interferes with production of RNA from each of segment 1, 2 and 3 is identified as an antiviral agent.
[0012] In accordance with another aspect, the invention provides a cloned or recombinant defective interfering influenza A virus comprising RNA derived from segment 1, 2 or 3, wherein said RNA comprises:
[0013] (a) an RNA of between 300 to 600 nucleotides in length;
[0014] (b) at least 100 nucleotides from the 5' and 3' ends of segment 1, 2 or 3;
[0015] (c) a central deletion of nucleotides of said segment;
[0016] wherein said defective interfering influenza virus is capable of interfering with RNA production from segments 1, 2 and 3 of influenza A.
[0017] An antiviral agent identified in accordance with the present invention, or a defective interfering virus of the invention is also provided for use in a method of treatment or prophylaxis of influenza A infection.
[0018] In another aspect, the present invention provides a defective interfering virus RNA, wherein the RNA is mutated to prevent expression of any encoded protein, for example, wherein one or more AUG initiation codons are mutated. Such a DI virus may be used in a method of treatment or prophylaxis of influenza A infection.
DESCRIPTION OF THE FIGURES
[0019] FIG. 1. Schematic diagram of influenza DI RNA 1/244 and other RNAs expressed from plasmids. Numbers indicate the nucleotide positions of the various breakpoints in the deleted genome RNAs used in the study (positive-sense, 5' to 3'). Solid arrows indicate the primers used in the primer extension assays for cRNA and mRNA analyses and dashed arrows indicate primers used for vRNA analyses. The black box in segment 1-GFP RNA indicates the position of the reporter GFP gene.
[0020] FIG. 2. Northern blot analysis of influenza viral RNAs produced in the absence of and in the presence of influenza DI RNA. 293T cells were transfected with increasing amounts of the 1/244 DI PolI plasmid (0, 0.1, 0.5 and 1.0 .mu.g) and a constant amount of the plasmids needed for the expression of infectious A/WSN virus (see text). After transfection, cells were co-cultivated with MDCK cells. RNA was extracted from co-cultured cells and from influenza virus particles purified from culture fluids. (a) RNA extracted from cell lysates (top panel) and virus particles from supernatants (lower panel) at 1, 2 and 3 days post co-cultivation was analysed with probes specific for segment 1 RNA and 1/244 DI RNA, and for segment 7 vRNA. The sizes of RNA markers are shown on the left and the identity of each RNA species is shown on the right. (b) A/WSN infectivity in cell supernatants measured by microplaque assay. The infectivities on 1 (.box-solid.), 2 (.tangle-solidup.) and 3 ( ) days after co-cultivation are shown. Data show the mean of 2 independent experiments with the bar representing the range. (c) Cell lysate RNA and virion RNA extracted on day 3 were also analysed with probes specific for segment 2 and segment 7 RNA. (d) Comparison of the ratio of segment 1 RNA in virions:transfected cells on days 2 (.box-solid.) and 3 ( ), and of segment 2 RNA in virions:transfected cells on day 3 (). Data were normalized against levels of segment 7 and expressed as a fraction of the virion:cellular RNA ratio in the absence of 1/244 DI RNA.
[0021] FIG. 3. Fluorescence assay for determining the expression of influenza segment 1 in the presence of influenza DI RNAs or other full-length influenza RNAs. 293T cells were transfected with the segment 1-GFP plasmid, plasmids expressing PB1, PB2, PA and NP proteins, and increasing amounts of an additional PolI plasmid expressing a DI RNA (1/244, 2/265 or 3/262) or a full-length vRNA (segment 4 or 6). At two days post transfection, cells were examined for fluorescence. (a) Pairs of cell monolayer images taken by phase-contrast (left) and epifluorescence microscopy (right). The amount of each plasmid expressing the various RNAs used as putative inhibitors is shown on the left. Control cells (top) were transfected with an empty vector (1 .mu.g). (b) Quantitation of fluorescence in cells generated in the presence of transfected plasmids expressing 1/244 RNA (black columns) and segment 6 RNA (white columns). Columns show the mean of 3 independent experiments, and bars are standard errors of the mean. Statistical analyses were done using a two-tailed Student t test and the p values for specific comparisons are shown.
[0022] FIG. 4. Analysis of influenza segment 1-directed RNA synthesis by primer extension in the presence of influenza DI RNAs or segment 6 RNA. Transfections were carried out as described for FIG. 3. Primer extension analysis of viral RNA levels directed by segment 1-GFP in the absence or in the presence of increasing amount of plasmids encoding 1/244 DI RNA (a) or genome segment 6 vRNA (c). 5S rRNA detected from the same RNA preparations is also shown and were used as an internal control. The primer extension products are identified on the left of each panel. Quantitation of viral RNA levels from three independent experiments by phosphorimaging analysis is shown in (b) and (d). The values of band intensities were normalised against the relevant 5S rRNA and are expressed as a percentage of the maximum value for each RNA analysed. Basal levels of vRNA generated from the target plasmid were subtracted from the total. The error bars represent the standard error of the mean of at least 3 replicates. vRNA (.box-solid.), mRNA (.tangle-solidup.) and cRNA ().
[0023] FIG. 5. Analysis of influenza segment 6-directed RNA synthesis by primer extension in the presence of influenza 1/244 DI RNA. (a) Analysis of levels of RNA transcribed from genome segment 6 in the absence or presence of increasing amount of 1/244 DI RNA. Quantitation of viral RNA levels from three independent experiments by phosphorimaging analysis is shown in (b). The values of band intensities were normalised against the relevant 5S rRNA and are expressed as a percentage of the maximum value for each RNA analysed. Basal levels of vRNA generated from the target plasmid were subtracted from the total. The error bars represent the standard error of the mean from 3 independent experiments. vRNA (.box-solid.), mRNA (.tangle-solidup.) and cRNA ().
[0024] FIG. 6. The effect of influenza 1/244 DI RNA on the level of RNA transcribed from influenza genome segments 2 and 3. Analysis of RNA derived from segment 2 (panel a) and segment 3 (panel c) in the presence of increasing amounts of 1/244 DI RNA was carried out as described for FIG. 4. Quantitation of viral RNA levels from two independent experiments is shown in (b) and (d). The error bars represent the range of data for two experiments. vRNA (.box-solid.), mRNA (.tangle-solidup.) and cRNA ().
[0025] FIG. 7. The effect of 1/244 DI RNA on its own RNA levels in the presence or absence of segment 1-GFP. Analysis of levels of RNA transcribed from 1/244 DI RNA in the presence of 1.0 .mu.g segment 1-GFP (a) or in the absence of any other genome RNA (c) was carried out as described for FIG. 4. The faint band indicated by (*) is the extension product from the pcDNAPB2 expression plasmid used in the transfection. Quantitation of viral RNA levels from three independent experiments or the range of two replicates for transfections with no added segment 1-GFP plasmid is shown in (b) and (d). The error bars represent the standard error of the mean (b) or range (d). vRNA (.box-solid.), positive-sense RNA (cRNA+mRNA) (.tangle-solidup.).
[0026] FIG. 8. Schematic of the specific inhibition of RNA synthesis effected by full-length segments 1 or 2 or 3 by defective interfering influenza RNAs derived from segments 1 or 2 or 3. RNA synthesis carried out by full-length segment 4 (not shown) or 6 was not inhibited. The solid boxes on DI RNAs 1, 2 and 3 represent the common interacting element, and the open boxes on full-length segments 1, 2 and 3 represent its counterpart. The latter is absent from full-length RNA 6.
[0027] FIG. 9. (a) Diagram showing the relationship of influenza genome segment 1 RNA and the segment 1 244 DI RNA. Numbers indicate nucleotide positions based on the sequence of positive sense influenza PR8 genome segment 1. The nucleotide positions of the breakpoints in the DI RNA genome are shown. Numbers below the RNAs indicate the nucleotide positions of the first nucleotide of the initiation and termination codons for the amino acids encoded by the mRNA transcribed from the full length segment 1 and 244 DI RNAs. The gray shading indicates PB2 coding sequence and the black shading indicates a new reading frame accessed following the breakpoint in 244 DI RNA. (b) Sequence of 244 DI RNA in cRNA sense indicating the open reading frame, and the predicted protein sequence in single letter amino acid code. The 35 residue PB1 binding domain of PB2 is indicated by the dark grey box, and the 22 residue mitochondrial interaction domain of PB2 is indicated by the light grey box. The boxed amino acid sequence appeared de novo downstream from the central deletion that gave rise to 244 DI RNA. This sequence did not arise from the PB2 ORF. The three G.fwdarw.C mutations at nucleotide positions 30, 60 and 111 used to mutate the in-frame AUG initiation codons are shown in bold and underlined.
[0028] FIG. 10. A. Northern blot of RNA extracted from cells infected with 244 DI virus to detect positive sense influenza RNA transcribed from genome segment 1. Lane 1 contains total cellular RNA. Lane 2 contains non-polyadenylated RNA. Lane 3 contains polyadenylated mRNA. The positions of size markers (nt) are indicated. B. Viral RNAs synthesised by 244 AUG knock-out DI RNA and 244 DI RNA. 48 h after transfection of plasmids, RNA was extracted from cells with Trizol and primer extension analysis carried. Transcription products were resolved on a 6% (w/v) polyacrylamide gel containing 7 M urea in TBE buffer and detected by phosphor imaging. Lane 1 shows a 100 nt size ladder, lane 2 shows RNA made in the presence of 244 DI RNA and lane 3 shows RNA made in the presence of 244 AUG knockout DI RNA. The positions of vRNA and mRNA are indicated. 5S ribosomal RNA was used as a control to confirm similar amounts of total RNA were used.
[0029] FIG. 11. Assay for the interfering activity of 244 AUG knock-out DI RNA and 244 DI RNA based on the inhibition of expression of fluorescence by an influenza segment 1 RNA expressing GFP. (a) 293T cells were transfected with plasmids expressing the segment 1-GFP RNA, plasmids expressing PB1, PB2, PA and NP proteins, and increasing amounts of plasmids expressing 244 AUG knock-out DI RNA or 244 DI RNA. Cells were examined for fluorescence at 2 days post transfection. (a) Cell monolayer images were recorded by phase-contrast microscopy (left of each column) and epifluorescence microscopy (right). The amount of plasmid expressing the DI RNA is shown on the left. Control cells (top) were transfected with an empty DI vector (1 .mu.g). (b) Quantitation of fluorescence generated in cells in the presence of transfected plasmids expressing the 244 AUG knock-out DI RNA (grey) and the parental wild type (wt) 244 DI RNA (white). The range of two independent experiments is shown.
[0030] FIG. 12. Protection of mice from influenza by treatment with 244 AUG knock-out DI virus or 244 DI virus (1 .mu.g each). Mice were inoculated intranasally with A/WSN alone (10 LD.sub.50, 1000 ffu), A/WSN+244 AUG knock-out DI virus, A/WSN+244 DI virus, A/WSN+inactivated 244 AUG knock-out DI virus, A/WSN+inactivated 244 DI virus, or saline alone (panels a, b). Three weeks after infection mice were challenged with a high dose of A/WSN (10,000 LD.sub.50) to determine their immune status (panels c, d). Panels (a), (c), mean clinical score; panels (b), (d), mean weight change. In (a) 244 DI+A/WSN, knock-out DI only, 244 DI only, and mock are all hidden under knock-out DI+A/WSN with a clinical score of 1.
DETAILED DESCRIPTION OF THE INVENTION
[0031] The invention has identified that the effectiveness of a DI influenza A virus to interfere with virus replication can be attributed to the ability of the DI virus RNA to interfere with production of RNA from each of segments 1, 2 and 3 of influenza A virus. Accordingly, the present invention provides methods for identifying DI viruses that are effective as antiviral agents. Thus, the present invention provides a method to identify an antiviral agent by determining whether the defective interfering influenza RNA can interfere with the production of RNA from each of segments 1, 2 and 3 of influenza A virus. A defective interfering influenza virus RNA which is able to interfere with the production of RNA from each of segments 1, 2 and 3 is identified for incorporation in an antiviral agent.
[0032] The methods of the present invention can be conducted using any suitable format for the assay which allows for the analysis of the production of RNA from each of segments 1, 2 and 3 of influenza A virus. In accordance with the methods of the present invention, the assays can be conducted in a single assay to monitor for production of RNA from each of segments 1, 2 and 3. Alternatively, multiple assays can be conducted to monitor RNA production from each of segments 1, 2 and 3 separately, or in any combination thereof. For example, the assays can comprise a first assay to monitor for production of RNA from segments 1 and 2 with a separate assay being conducted to monitor RNA production from segment 3. Similarly, production of RNA from segments 2 and 3 can be assayed together, with production of RNA from segment 1 being assayed separately, or production of RNA from segments 1 and 3 can be assayed together, with production of RNA from segment 2 being assayed separately. Typically, a cell is transfected with one or more plasmids that express vRNA from the segments to be analysed, for example using plasmids that express vRNA from segments 1, 2 and 3.
[0033] The assays are conducted in the presence of the relevant viral and/or host cell machinery to allow production of RNA from segments 1, 2 and 3. Typically, the methods of the present invention are carried out using a host cell. The host cell is provided with the components necessary to allow viral RNA synthesis. Typically, this can be achieved by transfecting the cell with suitable vectors or plasmids expressing the influenza A polymerase proteins and virus nucleoprotein, and in particular, PB1, PB2, PA and NP proteins of influenza A. As described above, the cell is typically transfected with additional plasmids expressing vRNA from segments 1, 2 and 3.
[0034] Where the structural proteins of influenza A are not encoded or provided, virus particles will not be produced. However, levels of production of RNA from the segments can readily be monitored. This can be done through direct detection of vRNA, cRNA or mRNA associated with each segment. Alternatively, reporter constructs can be provided, for example, encoding negative-sense target RNA can be provided such as a segment-reporter gene construct, encoding a reporter such as green fluorescent protein. Where segments 1, 2 and 3 are assessed in combination such that two or more segments are monitored at the same time, and reporter genes are used, preferably, different reporter genes are used for each segment. Where reporter genes are used, the assays comprise monitoring for expression of the reporter gene. A reduction in reporter gene expression, for example demonstrated by a reduction in fluorescence indicates that production of RNA from the segment-reporter construct has been reduced.
[0035] Defective interfering virus RNA for analysis in the assays of the present invention are typically defective interfering virus RNA derived from influenza A. Typically, the DI virus RNA is derived from segment 1, 2 or 3 of influenza A. In one aspect of the present invention, DI virus RNA is introduced into the cells, for example by providing a vector or plasmid encoding DI virus RNA. In an alternative aspect, the assay can be conducted by infecting the cells with DI virus particles. In preferred aspects of the present invention, the DI viruses assayed in accordance with the present invention are cloned DI viruses. Alternatively the method may be used to assay a heterogeneous population of DI viruses, to identify pool(s) containing DI viruses of interest, for subsequent cloning and analysis.
[0036] References to inhibition typically refer to at least 10% reduction in production of viral RNA, cRNA or mRNA from each segment, typically at least 20%, 30%, 40% or 50% reduction in viral RNA, cRNA or mRNA production, preferably at least 60%, 70%, 80% or 90%, preferably at least 95%, 97%, 98% or 99% reduction in viral RNA, cRNA or mRNA production. Defective interfering virus RNA showing the highest levels of inhibition of viral synthesis are most preferably used as antiviral agents.
[0037] In accordance with another aspect of the present invention, there is provided a defective interfering virus for use as an antiviral agent. The defective interfering virus RNAs of the present invention are derived from influenza A. The defective interfering influenza A RNA may be derived from segment 1, 2 or 3. SEQ ID NOs: 2, 3 and 4 set out the sequences of influenza A virus segment 1 for strains A/Puerto Rico/8/34(H1N1), A/New York/463/2005(H3N2) and A/Netherlands/178/1995(H3N2) respectively. SEQ ID NOs 5, 6 and 7 represent influenza A virus segment 2 of A/Puerto Rico/8/34(H1N1), A/New York/463/2005(H3N2) and A/Netherlands/178/1995(H3N2) respectively. SEQ ID NOs: 8, 9 and 10 represent sequences of influenza A virus segment 3 of A/Puerto Rico/8/34(H1N1), A/New York/463/2005(H3N2) and A/Netherlands/178/1995(H3N2) respectively. In all cases, these sequences are presented in the positive (antigenome sense) from 5' to 3'. The sequences are also represented as DNA.
[0038] The sequences of SEQ ID NOs: 2 to 10 provide representative sequences for segments 1, 2 and 3 that can be used to produce the DI RNA in accordance with the present invention. Deletions are introduced into the segments as discussed in more detail above. There is a high degree of sequence identity between the segments of each strain. Segment 1, 2 or 3 from any influenza A strain can be used to design and produce a DI virus. Segment 1 for use in accordance with the present invention to produce a DI virus may have a variant sequence which has at least 80%, 85%, 90% or 95% homology to SEQ ID NO: 2, 3 or 4 based on nucleotide identity over the entire sequence. A segment 2 for use in accordance with the present invention to produce a DI virus may have at least 80%, 85%, 90% or 95% homology to SEQ ID NO: 5, 6 or 7 based on nucleotide identity over the entire sequence. A segment 3 for use in accordance with the present invention to produce a DI virus may have at least 80%, 85%, 90% or 95% homology to SEQ ID NO: 8, 9 or 10 based on nucleotide identity over the entire sequence.
[0039] Standard methods in the art may be used to determine homology. For example the UWGCG Package provides the BESTFIT program which can be used to calculate homology, for example used on its default settings (Devereux et al. (1984) Nucleic Acids Research 12, p 387-395). The PILEUP and BLAST algorithms can be used to calculate homology or line up sequences (such as identifying equivalent residues or corresponding sequences (typically on their default settings)), for example as described in Altschul S. F. (1993) J Mol Evol 36:290-300; Altschul, S. F et al. (1990) J Mol Biol 215: 403-10.
[0040] Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/). This algorithm involves first identifying high scoring sequence pair (HSPs) by identifying short words of length W in the query sequence that either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighbourhood word score threshold (Altschul et al., supra). These initial neighbourhood word hits act as seeds for initiating searches to find HSP's containing them. The word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Extensions for the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T and X determine the sensitivity and speed of the alignment. The BLAST program uses as defaults a word length (W) of 11, the BLOSUM62 scoring matrix (see Henikoff and Henikoff (1992) Proc. Natl. Acad. Sci. USA 89: 10915-10919) alignments (B) of 50, expectation (E) of 10, M=5, N=4, and a comparison of both strands.
[0041] The BLAST algorithm performs a statistical analysis of the similarity between two sequences; see e.g., Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90: 5873-5787. One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two amino acid sequences would occur by chance. For example, a sequence is considered similar to another sequence if the smallest sum probability in comparison of the first sequence to the second sequence is less than about 1, preferably less than about 0.1, more preferably less than about 0.01, and most preferably less than about 0.001.
[0042] The defective interfering influenza virus RNA comprises sequences from segment 1, 2 or 3 comprising at least a portion of the 5' region and a portion of 3' region of the segment, and having one or more deletions in the central portion of the segment. The sequences in the 5' end and 3' end of the segment are preferably intact, that is represent contiguous sequences from the 5' and 3' ends of the segment. The regions from the 5' end and 3' end are selected to retain cis-acting signals required for replication and packaging into virus particles. Typically, the defective interfering virus RNA will include at least 100 nucleotides up to 500 nucleotides in length from the 5' end of the segment, preferably up to 400 nucleotides in length, preferably up to 300 nucleotides in length, preferably up to 250 nucleotides in length, such as between 100 to 250 nucleotides in length, 100 to 220 nucleotides in length or 120 to 220 nucleotides in length, say 150 to 220 nucleotides in length from the 5' end of the segment.
[0043] Similarly, typically the defective interfering virus RNA comprises the 3' terminus of the segment comprising a contiguous sequence from the 3' terminus, typically comprising at least 100 nucleotides up to 500 nucleotides of the 3' end of the segment, preferably 150 nucleotides up to 400 nucleotides, such as 150 nucleotides up to 280 nucleotides of the 3' end of the segment. The deletion comprises deletion of a central portion of the segment, typically up to 2,000 nucleotides in length, typically at least 1,000 nucleotides in length, at least 1,500 nucleotides in length, 1,800 nucleotides in length, 2,000 nucleotides in length.
[0044] Thus, the defective interfering virus RNA according to the present invention typically has a total length of between 300 nucleotides and 600 nucleotides, typically 300 nucleotides up to 500 nucleotides, preferably between 380 nucleotides up to 480 nucleotides in length.
[0045] The defective interfering viruses in accordance with the present invention are characterised by their ability to interfere with production of RNA from segments 1, 2 and 3 of influenza A virus. Assays for the activity of the virus can be conducted in accordance with the methods described herein.
[0046] Typically, the defective interfering virus RNA for incorporation into the virus particle is produced by recombinant means. Standard recombinant techniques can be used to introduce deletions into segments 1, 2 or 3 RNA.
[0047] Alternatively, the defective interfering virus of the present application may be cloned or recombinant viruses, for example, to provide a cloned or recombinant preparation based on a naturally occurring defective interfering virus. For example, samples can be taken from infected individuals, animals or to identify cells for the presence of defective interfering virus particles. Such DI viruses can be screened to identify the presence of defective interfering viruses which inhibit viral replication from each of segments 1, 2 and 3. The DI RNA of the viruses are then isolated and cloned by recombinant techniques to provide a cloned preparation of defective interfering virus having the characteristics as now claimed.
[0048] The DI virus RNA as described herein can be incorporated into a viral particle in order to produce a DI virus for use as an antiviral agent. Such virus particles can be produced by transfecting a cell with a plasmid or vector expressing the DI virus RNA and plasmids or vectors which in combination express RNA segments 1 to 8 of an influenza A. RNA and protein expression can be used in order to generate viral particles comprising the DI virus RNA. Methods of generating cloned DI influenza virus are described for example in WO2007/135420.
[0049] In accordance with a preferred aspect of the present invention, the DI virus of the present application is not 1/244.
[0050] A DI virus identified as an antiviral agent, or a DI virus in accordance with the present invention may be used in a method to treat a viral infection in a subject, and in particular to treat influenza A infection in a subject. The invention also provides a method of preventing or treating influenza A infection in a subject, comprising administering to the subject an effective amount of a DI virus identified in accordance with the invention, or an DI virus of the invention as described above.
[0051] The invention also provides a DI virus identified in accordance with the invention, or of the invention for use in a method of preventing or treating influenza A infection. The invention further provides use of a DI virus identified in accordance with the invention, or of the invention in the manufacture of a medicament for preventing or treating influenza A infection.
[0052] DI viruses derived from influenza A have also been demonstrated to be effective in the treatment of virus infections caused by other viruses, in particular, respiratory virus infections. Thus, a DI virus in accordance with the present invention may also be used for the treatment of other respiratory virus infections, including virus infections caused by viruses of the paramyxoviridae, such as pneumovirus or metanpeurovirus, and viruses caused by viruses of the orthomyoviridae. Examples of respiratory viruses that can be treated in accordance with the present invention include human respiratory syncytial virus, human metapneumovirus, influenza B or influenza C virus.
[0053] Typically, the individual is human. The subject is typically a patient, but may also be an individual at risk of infection.
[0054] The DI virus of the invention may be used for treating influenza A infection. In the case of treating, the subject typically has an influenza A infection, i.e. has been diagnosed as having an influenza A infection, or is suspected as having an influenza A infection, i.e. shows the symptoms of an influenza A infection. The individual may also be at risk of infection, and the DI virus is used prophylactically to prevent or treat infection by administration up to 2 weeks, typically up to 1 week before exposure to influenza A. The subject is typically symptomatic but may also be asymptomatic. As used herein, the term "treating" includes any of following: the prevention of an influenza A infection or of one or more symptoms associated with an influenza A infection; a reduction or prevention of the development or progression of the influenza A infection or symptoms; and the reduction or elimination of an existing influenza A infection or symptoms.
[0055] Therapy and prevention includes, but is not limited to, alleviating, reducing, curing or at least partially arresting symptoms and/or complications resulting from or associated with an influenza A infection. When provided therapeutically, the therapy is typically provided at or shortly after the onset of a symptom of an influenza A infection. Such therapeutic administration is typically to prevent or ameliorate the progression of, or a symptom of the infection or to reduce the severity of such a symptom or infection. When provided prophylactically, the treatment is typically provided before the onset of a symptom of an influenza A infection. Such prophylactic administration is typically to prevent the onset of symptoms of the infection. The DI viruses identified in accordance with the present invention or of the present invention may be administered to treat or prevent infection, before an individual is infected, but where the individual is suspected or likely to come into contact with influenza A virus. For example, the DI virus of the present invention may be administered 1 day, 3 days, 1 week or up to 2 weeks before exposure to influenza A.
[0056] Specific routes, dosages and methods of administration of the DI virus identified in accordance with the invention, or of the invention may be routinely determined by the medical practitioner. These are discussed in more detail below. Typically, a therapeutically effective or a prophylactically effective amount of the DI virus of the invention is administered to the subject. A prophylactically effective amount is an amount which prevents the influenza A infection and/or the onset of one or more symptoms of the influenza A infection. A therapeutically effective amount is an amount effective to ameliorate one or more symptoms of the influenza A infection. A therapeutically effective amount preferably abolishes one or more symptoms of the disease. Typically, such an amount reduces the influenza A infection or viral titre in the subject.
[0057] The DI virus of the invention may be used in combination with one or more other therapies intended to treat the same subject. By a combination is meant that the therapies may be administered simultaneously, in a combined or separate form, to a subject. The therapies may be administered separately or sequentially to a subject as part of the same therapeutic or prophylactic regimen. For example, the DI virus of the invention may be used in combination with another therapy intended to inhibit influenza A infection or manage a symptom thereof. The other therapy may be a general therapy aimed at treating or improving the condition of a subject with an influenza A infection.
[0058] The DI virus identified in accordance with the invention or of the invention can be administered to the subject by any suitable means. Typically the DI virus is administered to the respiratory airways, typically by intranasal or intrabuccal administration, inhalation or instillation.
[0059] The DI virus of the invention can be formulated into pharmaceutical compositions. These compositions may comprise, in addition to one of the above DI viruses, a pharmaceutically acceptable carrier or diluent. Such compositions may also comprise other excipients, buffers, stabilisers or other materials well known to those skilled in the art. Such materials should be non-toxic and should not interfere with the efficacy of the DI virus. The precise nature of the carrier or diluent may depend on the route of administration, e.g. oral, intravenous, cutaneous or subcutaneous, nasal, intramuscular, intraperitoneal routes.
[0060] Oral formulations include such normally employed excipients as, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, and the like. These compositions take the form of solutions, suspensions, tablets, pills, capsules, sustained release formulations or powders and contain 10% to 95% of active ingredient, preferably 25% to 70%. Where the pharmaceutical composition is lyophilised, the lyophilised material may be reconstituted prior to administration, e.g. a suspension. Reconstitution is preferably effected in water. Typically the formulations are suitable for intranasal delivery and may be provided in the form of a nasal spray, nasal drops, gel or powder.
[0061] An effective amount, such as a therapeutically or prophylactically effective amount, of the DI virus is administered. The dose may be determined according to various parameters, especially according to the DI virus used; the age, weight and condition of the subject to be treated; the route of administration; and the required regimen. Again, a physician will be able to determine the required route of administration and dosage for any particular subject.
[0062] In another aspect of the present invention, a DI virus is provided in which the DI virus RNA is not able to produce a protein. Typically, this is achieved by mutating DI virus RNA to remove signalling sequences required for protein expression. In one aspect of the present invention, this is done by deletion or substitution of one or more AUG initiation codons. For example, the initiation codon may be mutated at one or more positions. In one aspect, we describe mutation of one or more initiation codons to AUC, and typically all initiation codons are mutated to AUC.
[0063] The DI virus RNA of the invention may be a known DI virus. In one preferred aspect of the present invention, with DI virus RNA is 1/244 which incorporates a mutation of AUG initiation codons. The DI virus may include one or more mutations to mutate one, more than one or all AUG initiation codons in the DI virus. In the case of 244 DI RNA, mutations are introduced in the AUG initiation codons present at positions 28 to 30, 58 to 60 and 109 to 111. Suitable mutations include mutation of G to C for example at positions 30, 60 and 111 of 244 DI RNA.
[0064] Similar mutations can be incorporated in other DI RNA, particularly, DI RNA derived from influenza A virus. Such DI RNA can be that as described above. In particular, the defective interfering influenza A RNA may be derived from segment 1, 2 or 3. SEQ ID NOs: 2, 3 and 4 set out the sequences of influenza A virus segment 1 for strains A/Puerto Rico/8/34(H1N1), A/New York/463/2005(H3N2) and A/Netherlands/178/1995(H3N2) respectively. SEQ ID NOs 5, 6 and 7 represent influenza A virus segment 2 of A/Puerto Rico/8/34(H1N1), A/New York/463/2005(H3N2) and A/Netherlands/178/1995(H3N2) respectively. SEQ ID NOs: 8, 9 and 10 represent sequences of influenza A virus segment 3 of A/Puerto Rico/8/34(H1N1), A/New York/463/2005(H3N2) and A/Netherlands/178/1995(H3N2) respectively. In all cases, these sequences are presented in the positive (antigenome sense) from 5' to 3'. The sequences are also represented as DNA.
[0065] The sequences of SEQ ID NOs: 2 to 10 provide representative sequences for segments 1, 2 and 3 that can be used to produce the DI RNA in accordance with the present invention. Deletions are introduced into the segments as discussed in more detail above. There is a high degree of sequence identity between the segments of each strain. Segment 1, 2 or 3 from any influenza A strain can be used to design and produce a DI virus. Segment 1 for use in accordance with the present invention to produce a DI virus may have a variant sequence which has at least 80%, 85%, 90% or 95% homology to SEQ ID NO: 2, 3 or 4 based on nucleotide identity over the entire sequence. A segment 2 for use in accordance with the present invention to produce a DI virus may have at least 80%, 85%, 90% or 95% homology to SEQ ID NO: 5, 6 or 7 based on nucleotide identity over the entire sequence. A segment 3 for use in accordance with the present invention to produce a DI virus may have at least 80%, 85%, 90% or 95% homology to SEQ ID NO: 8, 9 or 10 based on nucleotide identity over the entire sequence.
[0066] Standard methods in the art may be used to determine homology. For example the UWGCG Package provides the BESTFIT program which can be used to calculate homology, for example used on its default settings (Devereux et al. (1984) Nucleic Acids Research 12, p 387-395). The PILEUP and BLAST algorithms can be used to calculate homology or line up sequences (such as identifying equivalent residues or corresponding sequences (typically on their default settings)), for example as described in Altschul S. F. (1993) J Mol Evol 36:290-300; Altschul, S. F et al. (1990) J Mol Biol 215: 403-10.
[0067] Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/). This algorithm involves first identifying high scoring sequence pair (HSPs) by identifying short words of length W in the query sequence that either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighbourhood word score threshold (Altschul et al., supra). These initial neighbourhood word hits act as seeds for initiating searches to find HSP's containing them. The word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Extensions for the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T and X determine the sensitivity and speed of the alignment. The BLAST program uses as defaults a word length (W) of 11, the BLOSUM62 scoring matrix (see Henikoff and Henikoff (1992) Proc. Natl. Acad. Sci. USA 89: 10915-10919) alignments (B) of 50, expectation (E) of 10, M=5, N=4, and a comparison of both strands.
[0068] The BLAST algorithm performs a statistical analysis of the similarity between two sequences; see e.g., Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90: 5873-5787. One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two amino acid sequences would occur by chance. For example, a sequence is considered similar to another sequence if the smallest sum probability in comparison of the first sequence to the second sequence is less than about 1, preferably less than about 0.1, more preferably less than about 0.01, and most preferably less than about 0.001.
[0069] The defective interfering influenza virus RNA comprises sequences from segment 1, 2 or 3 comprising at least a portion of the 5' region and a portion of 3' region of the segment, and having one or more deletions in the central portion of the segment. The sequences in the 5' end and 3' end of the segment are preferably intact, that is represent contiguous sequences from the 5' and 3' ends of the segment. The regions from the 5' end and 3' end are selected to retain cis-acting signals required for replication and packaging into virus particles. Typically, the defective interfering virus RNA will include at least 100 nucleotides up to 500 nucleotides in length from the 5' end of the segment, preferably up to 400 nucleotides in length, preferably up to 300 nucleotides in length, preferably up to 250 nucleotides in length, such as between 100 to 250 nucleotides in length, 100 to 220 nucleotides in length or 120 to 220 nucleotides in length, say 150 to 220 nucleotides in length from the 5' end of the segment.
[0070] Similarly, typically the defective interfering virus RNA comprises the 3' terminus of the segment comprising a contiguous sequence from the 3' terminus, typically comprising at least 100 nucleotides up to 500 nucleotides of the 3' end of the segment, preferably 150 nucleotides up to 400 nucleotides, such as 150 nucleotides up to 280 nucleotides of the 3' end of the segment. The deletion comprises deletion of a central portion of the segment, typically up to 2,000 nucleotides in length, typically at least 1,000 nucleotides in length, at least 1,500 nucleotides in length, 1,800 nucleotides in length, 2,000 nucleotides in length.
[0071] Thus, the defective interfering virus RNA according to the present invention typically has a total length of between 300 nucleotides and 600 nucleotides, typically 300 nucleotides up to 500 nucleotides, preferably between 380 nucleotides up to 480 nucleotides in length.
[0072] Typically, the defective interfering virus RNA for incorporation into the virus particle is produced by recombinant means. Standard recombinant techniques can be used to introduce deletions into segments 1, 2 or 3 RNA, together with further mutations to one or more of the initiation codons as described above.
[0073] The DI virus RNA as described herein can be incorporated into a viral particle in order to produce a DI virus for use as an antiviral agent. Such virus particles can be produced by transfecting a cell with a plasmid or vector expressing the DI virus RNA and plasmids or vectors which in combination express RNA segments 1 to 8 of an influenza A. RNA and protein expression can be used in order to generate viral particles comprising the DI virus RNA.
[0074] A DI virus in accordance with this aspect of the present invention may be used in a method to treat a viral infection in a subject, for example to treat influenza A infection in a subject. The invention also provides a method of preventing or treating influenza A infection in a subject, comprising administering to the subject an effective amount of a DI virus of the invention as described herein. The DI virus in accordance with this aspect of the invention may also be used to treat other viral infections.
[0075] The invention also provides a DI virus of this aspect of the invention for use in a method of preventing or treating influenza A infection. The invention further provides use of a DI virus of this aspect of the invention in the manufacture of a medicament for preventing or treating influenza A infection.
[0076] DI viruses derived from influenza A have also been demonstrated to be effective in the treatment of virus infections caused by other viruses, in particular, respiratory virus infections. Thus, a DI virus in accordance with the present invention may also be used for the treatment of other respiratory virus infections, including virus infections caused by viruses of the paramyxoviridae, such as pneumovirus or metanpeurovirus, and viruses caused by viruses of the orthomyoviridae. Examples of respiratory viruses that can be treated in accordance with the present invention include human respiratory syncytial virus, human metapneumovirus, influenza B or influenza C virus.
[0077] Typically, the individual is human. The subject is typically a patient, but may also be an individual at risk of infection.
[0078] The DI virus of the invention may be used for treating influenza A infection. In the case of treating, the subject typically has an influenza A infection, i.e. has been diagnosed as having an influenza A infection, or is suspected as having an influenza A infection, i.e. shows the symptoms of an influenza A infection. The individual may also be at risk of infection, and the DI virus is used prophylactically to prevent or treat infection by administration up to 2 weeks, typically up to 1 week before exposure to influenza A. The subject is typically symptomatic but may also be asymptomatic. As used herein, the term "treating" includes any of following: the prevention of an influenza A infection or of one or more symptoms associated with an influenza A infection; a reduction or prevention of the development or progression of the influenza A infection or symptoms; and the reduction or elimination of an existing influenza A infection or symptoms.
[0079] Therapy and prevention includes, but is not limited to, alleviating, reducing, curing or at least partially arresting symptoms and/or complications resulting from or associated with an influenza A infection. When provided therapeutically, the therapy is typically provided at or shortly after the onset of a symptom of an influenza A infection. Such therapeutic administration is typically to prevent or ameliorate the progression of, or a symptom of the infection or to reduce the severity of such a symptom or infection. When provided prophylactically, the treatment is typically provided before the onset of a symptom of an influenza A infection. Such prophylactic administration is typically to prevent the onset of symptoms of the infection. The DI viruses identified in accordance with the present invention or of the present invention may be administered to treat or prevent infection, before an individual is infected, but where the individual is suspected or likely to come into contact with influenza A virus. For example, the DI virus of the present invention may be administered 1 day, 3 days, 1 week or up to 2 weeks before exposure to influenza A.
[0080] Specific routes, dosages and methods of administration of the DI virus identified in accordance with the invention, or of the invention may be routinely determined by the medical practitioner. These are discussed in more detail below. Typically, a therapeutically effective or a prophylactically effective amount of the DI virus of the invention is administered to the subject. A prophylactically effective amount is an amount which prevents the influenza A infection and/or the onset of one or more symptoms of the influenza A infection. A therapeutically effective amount is an amount effective to ameliorate one or more symptoms of the influenza A infection. A therapeutically effective amount preferably abolishes one or more symptoms of the disease. Typically, such an amount reduces the influenza A infection or viral titre in the subject.
[0081] The DI virus of the invention may be used in combination with one or more other therapies intended to treat the same subject. By a combination is meant that the therapies may be administered simultaneously, in a combined or separate form, to a subject. The therapies may be administered separately or sequentially to a subject as part of the same therapeutic or prophylactic regimen. For example, the DI virus of the invention may be used in combination with another therapy intended to inhibit influenza A infection or manage a symptom thereof. The other therapy may be a general therapy aimed at treating or improving the condition of a subject with an influenza A infection.
[0082] The DI virus of the invention can be administered to the subject by any suitable means. Typically the DI virus is administered to the respiratory airways, typically by intranasal or intrabuccal administration, inhalation or instillation.
[0083] The DI virus of the invention can be formulated into pharmaceutical compositions. These compositions may comprise, in addition to one of the above DI viruses, a pharmaceutically acceptable carrier or diluent. Such compositions may also comprise other excipients, buffers, stabilisers or other materials well known to those skilled in the art. Such materials should be non-toxic and should not interfere with the efficacy of the DI virus. The precise nature of the carrier or diluent may depend on the route of administration, e.g. oral, intravenous, cutaneous or subcutaneous, nasal, intramuscular, intraperitoneal routes.
[0084] Oral formulations include such normally employed excipients as, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, and the like. These compositions take the form of solutions, suspensions, tablets, pills, capsules, sustained release formulations or powders and contain 10% to 95% of active ingredient, preferably 25% to 70%. Where the pharmaceutical composition is lyophilised, the lyophilised material may be reconstituted prior to administration, e.g. a suspension. Reconstitution is preferably effected in water. Typically the formulations are suitable for intranasal delivery and may be provided in the form of a nasal spray, nasal drops, gel or powder.
[0085] An effective amount, such as a therapeutically or prophylactically effective amount, of the DI virus is administered. The dose may be determined according to various parameters, especially according to the DI virus used; the age, weight and condition of the subject to be treated; the route of administration; and the required regimen. Again, a physician will be able to determine the required route of administration and dosage for any particular subject.
EXAMPLES
Example 1
DI RNA Inhibits RNA Production from Segments 1, 2 and 3
Materials and Methods
Plasmids
[0086] The plasmids encoding the 8 gene segments of the A/WSN strain of A/WS/33 and plasmids expressing the polymerase proteins and NP (Neumann et al. 1999), and the vector expressing 1/244 DI RNA (FIG. 1) were as previously described (Duhaut and Dimmock 2002; Dimmock et al. 2008). 1/244 RNA comprises 395 nt and was derived from segment 1 of A/Puerto Rico/8/34 (H1N1). The segment 1 target, segment 1-GFP, was created by amplifying the GFP ORF by PCR from pEGFP-N1 (Clontech) using primers 5'ATGGTCTCTACTGATGGTGAGCAAGGGCGAG and 5'ATGAAGACAATCTCTTACTTGTACAGCTCGTCCA. The product was inserted between the BpiI and Eco31I sites of pPolI-220 (Duhaut and Dimmock 2000) such that the GFP ORF is in-frame with the PB2 ORF, giving plasmid seg 1-GFP which expresses segment 1-GFP RNA (FIG. 1). The GFP reporter retains the exact 5' (220 nt) and 3' (48 nt) terminus of segment 1 and is cognate for 1/244 DI RNA. A segment 2 DI (2/265; comprising 452 nt in total with 265 nt from the 5' end and 187 nt from the 3' end of the negative-sense cognate RNA) was isolated from a DI A/equine/Newmarket/7339/79 (H3N8) virus preparation (FIG. 1) (Mann et al. 2006) by RT-PCR amplification, and subsequently cloned into a pPolI-SapIT expression vector (Subbarao et al. 2003). A segment 3 DI RNA (3/262; comprising 469 nt in total with 262 nt from the 5' end and 207 nt from 3' end of the negative-sense cognate RNA) was isolated from a DI A/WSN preparation, and was amplified and cloned as above (FIG. 1). The DI RNAs encoded by the various plasmids retain the exact nucleotide sequences from the termini of the genome segments of the viruses from which they were derived and do not contain any mutations in positions known to have an effect on replication or packaging.
Transfection
[0087] Human 293T cells were transfected as previously described (Dimmock et al. 2008). Briefly, for northern blot analysis, a well of 70% confluent 293T cells in a 12-well plate was transfected using TransIT LT1 transfection reagent (Minis) with 8 PolI expression plasmids encoding viral sense RNA and cDNA plasmids for expression of PB2, PB1, PA and NP proteins, with or without pPolI-244. The transfected cells were then incubated at 37.degree. C. overnight before co-culture with MDCK cells in a 25 cm.sup.2 flask. Total cellular RNA was extracted with 2 ml Trizol reagent per sample (Invitrogen) on days 1, 2 and 3 after co-culture while tissue culture fluid was collected for virus titration and RNA extraction. Virions were purified by ultracentrifugation. RNA was extracted with phenol/chloroform, and then ethanol precipitated. For transfections, each well of a 6 well plate containing 70% confluent 293T cells was transfected with 1 .mu.g each of the PB2, PB1, PA and NP cDNA expression plasmids plus various amounts of a DI plasmid or pPolI-NA together with 1 .mu.g of target plasmid. After two days' incubation at 37.degree. C. the supernatant was discarded and RNA was extracted with Trizol.
Infectivity Assay
[0088] MDCK cell monolayers in 96-well plates were infected with supernatant containing rescued A/WSN as described previously (Scott et al. 2011). After 1 hour for attachment of virus, the monolayer was washed with PBS, and incubated in maintenance medium overnight at 33.degree. C. Cells were then fixed with 4% (v/v) formaldehyde, washed and blocked with 5% (w/v) milk powder in PBS. The infected cells were probed with a monoclonal antibody specific for the HA of A/WSN in PBS containing 0.1% Tween 20. After washing, goat anti-mouse IgG-alkaline phosphatase conjugate (Sigma) in TBS containing 0.1% Tween 20 was added, and infected cells detected with nitrotetrazolium blue chloride/BCIP (Sigma) in Tris-buffered magnesium chloride and sodium chloride (0.1 M, pH 9.5). The infectivity titre was determined by counting at least 50 positively stained cells (foci) at an appropriate dilution in each of the triplicate wells. The mean number of counts was determined to give a titre in focus-forming units (f.f.u.) ml.sup.-1.
Primer Extension
[0089] Total cellular RNA was extracted from cells with Trizol at 48 h post-transfection and used for primer extension analysis (Rehwinkel et al. 2010). Two .mu.g of total RNA was mixed with [.sup.32P]5'-end labelled primers and dNTP in a total volume of 13 .mu.l. The mixture was heated at 65.degree. C. for 5 min and placed on ice for 1 min. 2.times.first Strand Buffer, 20 mM DTT, and 100 U SuperScript III reverse transcriptase (Invitrogen) were added and further incubated at 55.degree. C. for 1 h. The reaction was terminated by heating at 95.degree. C. for 5 min with gel loading dye II (Ambion). The transcription products were resolved on a 6% (w/v) polyacrylamide gel containing 7 M urea in TBE buffer and detected by phosphor imaging. The primers used are shown in Table 1 and the positions of these on the various target RNAs are demonstrated in FIG. 1.
TABLE-US-00001 TABLE 1 Sequences of the primers used in this study. The primers containing mixed nucleotides were designed for detection of both A/PR8 and A/WSN-derived RNAs. Primers indicated with an asterisk were taken from (Rehwinkel et al. 2010). Primer Target RNA specificity Primer sequence Segment 1- c/mRNA GGACACGCTGAACTTGTGG GFP vRNA AGATAAGAGGATAATGGAAATG DI 1/244 c/mRNA ATATGGTCCACKGTGGTTTTTG vRNA GGAGAAGACTGAGGGGATTC Segment 2 c/mRNA* TCCATGGTGTATCCTGTTCC (PB1) vRNA* TGATTTCGAATCTGGAAGGA Segment 3 c/mRNA* TGAGTGCATATTGCTGCAAAT (PA) vRNA* TTCTTATCGTTCAGGCTCTT Segment 6 c/mRNA* TCCAGTATGGTTTTGAYTTCCR (NA) vRNA* TGGACTAGTGSGAGCATSAT 5S rRNA* TCCCAGGCGGTCTCCCATCC
Northern Blotting
[0090] Ten .mu.g of total cellular RNA or 50% of the yield of purified virion RNA from each sample was used for glyoxal-agarose gel electrophoresis. The RNA was transferred onto Hybond-N membrane (GE Healthcare) overnight using 20.times.SSC. The membrane was then baked at 80.degree. C. for 2 h and hybridized with digoxigenin (DIG)-labelled probes overnight. The full-length positive-sense DIG-labelled segment 1, segment 2 and segment 7 probes were transcribed in vitro in the presence of DIG-UTP (Roche) from PCR products containing a T7 promoter. The Roche system with a digoxigenin-specific alkaline phosphatase conjugated FAb antibody fragment and the chemiluminescent CSPD substrate was used for detection. Blots were exposed to Fuji X-ray film until the desired density was achieved and bands were quantified by densitometry using ImageJ (NIH).
Quantitation of GFP-Expressing Cells
[0091] 293T cells were transfected with the segment 1-GFP RNA expressing plasmid, plasmids expressing PB1, PB2, PA and NP proteins, and increasing amounts of an additional PolI plasmid expressing a DI RNA (1/244, 2/265 and 3/262) or a full-length RNA (segment 4 or 6). At two days post-transfection, the cultures were examined for GFP expression. Digital images of the cell monolayers were taken by phase-contrast and epifluorescence microscopy. Five field fluorescence images were randomly selected and analysed for the proportion of the visualised area expressing GFP using the HClmage software (Hamamatsu). The visualisation detects cells expressing a range of GFP levels to include those that may have been transfected with different levels of the reporter plasmids. A mean was calculated to give the percentage of the GFP positive area per monolayer.
Results
[0092] 1/244 DI RNA Interferes with Packaging of Segment 1
[0093] We have used a plasmid rescue system to generate a preparation of influenza virus in which 1/244 DI RNA was the only DI RNA present (Dimmock et al. 2008). The derivation of DI RNA 1/244 from segment 1 is shown in FIG. 1. This was used to investigate the effect of increasing amounts of 1/244 DI DNA on the levels of segment 1, 2 and 7 vRNAs in infected cells and purified virus particles at days 1-3 post-coculture. It was previously shown that influenza vRNAs are only detectable when all of the virus RNA polymerase components are present, demonstrating that the vRNAs are generated by the virus polymerase (Duhaut and Dimmock 2002). The 1/244 DI RNA (395 nt) was observed only in cultures transfected with the 1/244 plasmid, confirming that no other segment 1 DI RNA sequences were generated during the experiment (FIG. 2a). As the amount of 1/244 DI plasmid DNA in the transfection increased there was a progressive reduction in the level of segment 7 vRNA detected in the cells on each of the three days examined. The reduction in virus infectivity titre observed with increasing 1/244 plasmid on each of the 3 days confirmed that 1/244 DI RNA-mediated interference was taking place (FIG. 2b). As the input of 1/244 DI plasmid increased, the level of segment 1 vRNA within virus particles decreased dramatically, and was undetectable when 1 .mu.g 1/244 plasmid was transfected (FIG. 2a, lower panel). Quantitation showed that in the presence of 1/244 RNA, the ratio of segment 1:segment 7 vRNAs was considerably lower in virions than it was in cell extracts (FIG. 2d). This established that 1/244 DI RNA (derived from segment 1) acts, at least in part, by selectively excluding full-length segment 1 vRNA from progeny virus particles. The segment 2 vRNA content of virions was not reduced in the presence of increasing amounts of transfected 1/244 plasmid (FIG. 2c, d), confirming that inhibition of packaging of segment 1 by 1/244 RNA was specific, and did not extend to other polymerase component-encoding RNA segments.
Segment 1, 2 or 3 DI RNAs Inhibit Gene Expression from Segment 1
[0094] To separate the possible effects of DI RNA on viral RNA synthesis from RNA packaging, we devised a GFP expression assay in which transcription and replication of a GFP-encoding negative-sense target RNA (segment 1-GFP; FIG. 1) were enabled by co-transfection of plasmids expressing PB1, PB2, PA and NP proteins. This system allows viral RNA synthesis but not virus particle formation as plasmids encoding key structural proteins (HA, NA, M1 and M2) were omitted. The effects of co-transfected DI RNA-encoding plasmids were assessed by monitoring GFP fluorescence. In the absence of the plasmid encoding the PB2 protein no GFP expression was detected (data not shown). FIG. 3a shows that the 1/244 DI plasmid strongly inhibited fluorescence in a dose-dependent manner compared with a culture transfected with 1 .mu.g of empty control vector. Inhibition was far less marked when cells were transfected with plasmids that synthesised full-length segment 4 or segment 6 vRNAs. Quantitation showed that 0.1 .mu.g of 1/244 DI plasmid inhibited GFP fluorescence by 70%, whereas approximately 10-fold more of the segment 6 plasmid was required to produce a similar level of inhibition (61-69%) (FIG. 3b). Statistical analysis showed that the inhibitory effect of 1/244 DI RNA was highly significantly different to the effects of segment 6 RNA (FIG. 3b). Thus 1/244 DI RNA strongly inhibits the expression from a segment 1 target RNA. Further assays showed that a segment 2-derived DI RNA (2/265) and a segment 3-derived DI RNA (3/262) also strongly inhibited GFP fluorescence from the segment 1-derived target, whereas a full-length segment 4 vRNA, like segment 6 vRNA was only weakly inhibitory (FIG. 3a). At the highest concentration of plasmid DNA used (1 .mu.g), segment 4 vRNA reduced segment 1-derived gene expression to 75% of the control level, while 2/265 and 3/262 DI RNAs reduced expression to 2% and 6% of the control, respectively.
1/244 DI RNA Differentially Inhibits Positive Sense RNA Synthesis from Genome Segment 1, 2 and 3 but not Segment 6
[0095] Expression of GFP from the segment 1-GFP PolI plasmid is dependent on transcription of the negative-sense vRNA into mRNA. However, vRNA is also template for cRNA, which in turn acts as template for the production of more vRNA. Influenza virus mRNA has a 5'-extension of approximately 12 nt cleaved from the host mRNA (Palese and Shaw 2007) so the mRNA and cRNA products can be distinguished by size. Using a primer extension assay which detects levels of vRNA, mRNA and cRNA, we identified the stage of target RNA synthesis with which 1/244 DI RNA interferes (FIG. 4a, c). The basal levels of vRNAs synthesised directly from the transfected plasmid DNA were subtracted from the values presented in the data shown in FIG. 4 panels b and d. Taken together, the data in FIG. 3 and FIG. 4 show that the reduction in the level of segment 1-GFP-encoded mRNA in the presence of increasing amounts of DI RNA was strongly positively correlated with the reduction in GFP fluorescence (R.sup.2=0.90; data not shown), confirming that fluorescence was a faithful marker of mRNA synthesis. Quantitation of these data showed that mRNA and cRNA levels were considerably more affected than vRNA in the presence of 0.1 .mu.g to 0.5 .mu.g of 1/244 plasmid DNA (FIG. 4b). Addition of 0.1 .mu.g of 1/244 plasmid DNA reduced mRNA and cRNA levels to 13% and 10% of the control, respectively, while the level of vRNA was only reduced to 61%. However, with 1 .mu.g 1/244 DI RNA, levels of all de novo RNAs synthesised from segment 1 were reduced by >99%. Thus 1/244 DI RNA has a profound effect on all RNAs synthesised from the segment 1 target but differentially affects the levels of positive-strand and negative-strand RNAs.
[0096] To control for the specificity of action of the inhibiting RNA, we transfected a segment 6 plasmid (encoding the NA gene) in the place of the DI RNA plasmid. FIGS. 4c and 4d show that segment 6 RNA was significantly less effective at inhibiting mRNA, cRNA and vRNA expression by the segment 1 target than 1/244 RNA. This is consistent with the lower level of fluorescence inhibition achieved by the segment 6 RNA (FIG. 3a). Thus, 1/244 DI RNA specifically reduced mRNA, cRNA and vRNA levels, but segment 6 did not.
[0097] To determine how the target RNA affects the specificity of DI RNA-mediated inhibition of RNA synthesis and accumulation we used segment 6 as target. FIG. 5a shows that mRNA production by segment 6 was unaffected by 1/244 DI RNA even at the highest amount of 1/244 DI plasmid transfected (1 .mu.g), while cRNA and vRNA levels were reduced. Quantitation of 3 separate assays showed that 0.5 .mu.g 1/244 DI RNA decreased segment 6-encoded vRNA to 23% and cRNA to 32% of the control value (FIG. 5b).
[0098] The data described above demonstrate that the segment 1-derived 1/244 DI RNA differentially affected the levels of RNAs produced from genome segment 1 and segment 6. Since there was also cross-segment interference between the DI RNAs 2/265 or 3/262 and expression of GFP by segment 1-GFP (FIG. 3a), we investigated the effects of 1/244 DI RNA on the RNA levels transcribed from segments 2 and 3. Cells were transfected with different amounts of 1/244 DI plasmid DNA, the helper plasmids encoding the virus polymerase and NP proteins and a plasmid directing the synthesis of either full-length segment 2 or segment 3 vRNAs. FIGS. 6 (a) and (c) show that 1/244 DI RNA reduced the levels of all three RNAs synthesized by segment 2 or 3. Inhibition of segment 2-derived RNAs more closely resembled that seen with the segment 1 target (FIG. 4a) than with the segment 6 target RNA (FIG. 5a). There was a greater reduction in segment 2 cRNA and mRNA levels than in its vRNA level. However, four-fold more 1/244 plasmid DNA was required to reduce the segment 2 mRNA level to 13% of the control than was needed with the segment 1 target RNA. There was a less pronounced reduction of mRNA, cRNA and vRNA levels with the segment 3 target. The data clearly show that 1/244 DI RNA reduces levels of mRNA synthesized from segments 1, 2 and 3.
1/244 DI RNA Inhibits Synthesis of its Own Negative Sense vRNA but not its Own Positive Sense RNA
[0099] In light of the ability of 1/244 DI RNA to differentially reduce the level of segment 1-encoded RNAs, we investigated whether or not the levels of the positive and negative-sense RNAs synthesised from the 1/244 DI RNA in the same system were also affected. The gels used to analyse these RNAs could not separate the cRNA and mRNA which co-migrated. FIGS. 7(a) and (b) show that in the presence of the segment 1-GFP target, 1/244 DI positive-sense RNA levels increased as amounts of transfected 1/244 DI plasmid were increased. Thus these were maximal in the samples in which the segment 1-GFP mRNA and cRNA levels were at a minimum (FIG. 4a, b). This shows clearly that 1/244 DI RNA does not inhibit all influenza polymerase-directed transcription. However, the level of 1/244 DI-specific vRNA was reproducibly maximal with 0.1 .mu.g 1/244 plasmid DNA, and decreased to 13% of the maximum value with 0.5 .mu.g plasmid and to 4% with 1 .mu.g plasmid (FIG. 7b) demonstrating that a high concentration of 1/244 DI RNA reduces the level of its own de novo produced vRNA. When 1/244 plasmid DNA was titrated in cells in the absence of any target RNA the resulting levels of 1/244 positive-sense RNA and vRNA were similar to those in the presence of segment 1 target RNA (FIG. 7c, d).
DISCUSSION
[0100] Despite the many years spent investigating DI influenza viruses, understanding of the mechanism of action of interference in vitro, and protection from disease in vivo remains elusive. A commonly held hypothesis is that the small size of the DI RNA allows it to outcompete the full-length genome due to a faster replication rate, and that the proportion of virus particles containing DI genomes simply reflects the relative levels of DI and intact genomes present within infected cells (Roux et al. 1991; Marriott and Dimmock 2010). A second hypothesis is that DI RNA has an advantage in competing for a limiting viral or host factor. However, there is little experimental evidence to support either of these hypotheses with DI genomes in general, and none for influenza DI virus. More recently, a third hypothesis suggested that the influenza virus DI RNA interferes at the level of packaging of genomic RNAs into virions (Duhaut and McCauley 1996). Further, underlying this was the suspicion that different influenza DI sequences have different biological properties (Duhaut 1998; Dimmock et al. 2008). Understanding the interference process has the potential to provide new approaches for the development of novel antivirals based on DI genomes and the discussion below indicates how the data presented in this report have advanced our understanding of DI influenza viruses.
1/244 DI RNA Interferes with Packaging of the Cognate Segment 1 Virion RNA
[0101] FIG. 2 shows that 1/244 DI RNA interferes specifically with packaging of its cognate full-length segment 1 RNA into nascent virions. Thus, 1/244 DI RNA acts in a segment-specific manner similar to that reported for the segment 1-derived 317 DI RNA in a non-cloned virus population enriched by limit dilution passage (Duhaut and McCauley 1996), or for cloned 317 DI virus (Duhaut and Dimmock 2002). This is consistent with current models suggesting that packaging of influenza virus genome segments requires the formation of arrays or complexes consisting of a single copy of each genome segment and that these arrays act as a single structure which becomes packaged into new virus particles (Harris et al. 2006; Noda et al. 2006). Our data indicate that competition for packaging with the cognate full-length genomic RNA is likely to be a common feature of all influenza virus DI RNAs, and demonstrates that preferential packaging of DI RNA enriches the population of DI virus particles at the expense of infectious virus.
1/244 DI RNA Interferes with Expression of the Cognate Segment 1, with Segments 2 and 3 Virion RNAs
[0102] Analysis of the effect of the DI genome on mRNA synthesis from a segment 1 target genome RNA in the absence of virus particle synthesis, measured directly or by monitoring expression of a reporter gene showed that 1/244 DI RNA interfered with the RNA synthesis directed by a segment 1-derived target (FIG. 3a, b). The considerably weaker level of inhibition mediated by full-length segment 4 (FIG. 3a) or segment 6 vRNAs (FIG. 3a, b) confirmed that this effect is specific to DI RNA. The inhibition seen with increasing levels of plasmid DNA expressing genome segments 4 and 6 may be due to high levels of these RNAs competing for a limiting factor such as the virus polymerase complex in the transfected cells. Thus influenza DI RNAs can interfere by mechanism(s) other than, and in addition to, segment-specific packaging.
DI RNA can Differentially Affect the Steady State Levels of the Different RNAs Expressed by the Target RNA
[0103] The synthesis of positive (mRNA and cRNA) and negative-sense (vRNA) virus RNA are distinct processes as evidenced by the effect of specific mutants abolishing the function of one or the other (Jorba et al. 2009; Yuan et al. 2009), and the data presented here show that 1/244 DI RNA differentially affects the steady state levels of the different RNA products expressed by its target. Increasing amounts of transfected 1/244 DI RNA led to a dramatic reduction in full-length segment 1-derived mRNA and cRNA levels with a lesser effect on vRNA levels; four-fold more plasmid DNA was required to reduce vRNA to the same levels as mRNA and cRNA (FIG. 4a, b). Thus, the segment 1-derived 1/244 DI RNA specifically and preferentially reduced the level of positive-sense RNA made from a cognate target, with considerably less effect on negative-sense vRNA. This differs from an earlier report that the segment 1-derived 317 DI virus did not inhibit RNA synthesis, although this study did not use molecularly cloned DI virus (Duhaut and McCauley 1996). Surprisingly, 1/244 DI RNA also strongly inhibited mRNA synthesis from segments 2 and 3 (FIG. 6) suggesting that genome segments 1-3 (encoding components of the virus RNA polymerase) share common feature(s) that permit the inhibitory action of segment 1 DI RNAs. This appeared to be reciprocal as DI RNAs 2/265 and 3/262 also inhibited GFP expression from the segment 1 target (FIG. 3a). This is the first demonstration that an influenza DI RNA can dramatically affect gene expression from a genome segment other than that from which it arose. At levels of 1/244 DI RNA which strongly reduced the level of target mRNA from segment 1, its own positive-sense RNA levels were maximal (FIG. 7a, b). Thus, in a dose-dependent manner 1/244 DI RNA preferentially allows transcription from itself while suppressing synthesis from the target segment 1 RNA.
[0104] Data in FIGS. 4 and 7 provide the first evidence for enrichment of DI RNA. As the amount of transfected 1/244 DNA was increased there was a proportionate decrease in all three RNAs synthesised by the segment 1 target RNA (FIG. 4), whereas with transfection of 0.1 .mu.g 1/244 DNA all RNAs transcribed from the 1/244 DI RNA template increased (FIG. 7). However, the situation is complicated as higher levels of plasmid cause a reduction in the amount of DI vRNA. This reduction appears to be a feature of factors that we do not yet understand. The observed decline in DI vRNA levels with increasing input of DI plasmid suggests there could be an imbalance in the synthesis of the three DI RNAs in which vRNA, which is templated by, and therefore dependent on, DI cRNA, loses out. This appears to be a self-limiting phenomenon which has not previously been described for DI virus systems. Overall these data show an inverse relationship in the levels of full-length and DI RNAs and begin to provide an explanation for the process by which DI virus becomes dominant over infectious virus.
[0105] The reduction of mRNA levels by 1/244 DI RNA was not observed when segments 4 or 6 were used as the target, indicating that 1/244 DI RNA does not interfere with all genome segments and acts selectively on the synthesis of positive-sense RNA from segments 1, 2 and 3 (FIGS. 3a and 5a). Segments 1, 2 and 3 direct the synthesis of considerably lower levels of mRNA relative to vRNA compared with other genome segments. Additionally, it has been suggested that segments 1-3 mRNAs are produced by primary transcription rather than from newly synthesised vRNA (Smith and Hay 1982; Hatada et al. 1989). Thus transcription from the three largest genome segments appears to differ from transcription from the other segments, and the data presented here suggest that DI RNAs derived from segments 1, 2 or 3 may suppress transcription from all three segments by affecting this different transcription process. Large quantities of short RNA molecules referred to as svRNA or leRNA are produced during influenza infection (Perez et al. 2010; Umbach et al. 2010), and these may play a role in the switch from transcription to replication (Perez et al. 2010). If correct, this raises the possibility that a DI RNA may serve as the template for the production of svRNAs, which in turn modulate the production of the replication products vRNA, cRNA, and mRNA. The mechanism(s) by which these different synthetic processes in segments 1, 2 and 3 are affected is not known, and it will be of interest to investigate if the ability to regulate replication products is common to all DI RNAs or if it is a property only of specific DI RNAs. This may mean that the huge number of DI RNAs that can be produced during an influenza virus infection, vary in their efficiency of interference. Further exploration will provide insights into the differential regulation of transcription of influenza genome segments.
A Model for Interference by 1/244 DI RNA
[0106] DI mRNAs that retain the AUG initiation codon of the major open reading frame have the potential to be translated into truncated PB2 peptides, as demonstrated for some segment 1-derived DI RNAs (Akkina et al. 1984), and similar short polypeptides containing the PA protein binding domain of the PB1 strongly inhibited the virus RNA polymerase activity (Wunderlich et al. 2009; Manz et al. 2011). Thus in principle, a truncated PB2-related polypeptide derived from 1/244 DI RNA could also exert a dominant negative effect on the virus polymerase activity. However, we excluded this possibility by generating a form of 1/244 DI RNA in which the AUG initiation codon for PB2 and two further downstream in-frame AUG codons that could direct synthesis of a short polypeptide from the PB2 ORF were mutated (Meng et al., submitted for publication). We confirmed that this 1/244 AUG knock-out DI RNA was indistinguishable in action from that of the parental 1/244 DI RNA. It generated vRNA and mRNA to similar levels as 1/244 DI RNA, and inhibited GFP expression from segment 1 as seen with 1/244 DI RNA. Further, DI virus containing the 1/244 AUG knockout RNA protected mice from disease following challenge with influenza virus in a similar manner to 1/244 DI virus. These data show that the activity of 1/244 DI is solely an RNA-based phenomenon.
[0107] The ability of influenza virus DI RNAs to supplant their cognate genome segment during the packaging process explains their amplification in virus preparations. However, the data above exclude the widely held view that the interference mechanism within cells results solely from the ability of the DI RNA to be replicated faster than the longer, cognate full-length RNA. Rather the DI RNAs also specifically target virus RNA synthesis. The data shown here indicate that the primary consequence of 1/244 DI RNA-mediated interference within the cell is the targeted inhibition of RNA synthesis directed by full-length RNA segments 1, 2 and 3, and that DI RNAs derived from segments 2 and 3 also inhibit RNA synthesis from full-length segment 1.
Example 2
Protein Expression Encoded by DI RNA is not Required for Interference
Material and Methods
Plasmids and Production of Infectious Virus by Reverse Genetics
[0108] Plasmids encoding the 8 gene segments of the A/WSN strain of A/WS/33 and plasmids expressing the polymerase and NP proteins (Neumann et al. 1999), and the vector expressing 244 DI RNA from PolI promoters have been previously described (Dimmock et al. 2008; Duhaut and Dimmock 2002). 244 RNA is 395 nucleotides and was derived from segment 1 of A/Puerto Rico/8/34 (H1N1). The segment 1 target, segment 1-GFP, was created by amplifying the GFP ORF by PCR and inserting this into pPolI-220 (Duhaut and Dimmock, 2000) such that the GFP ORF was in frame with the PB2 ORF, giving plasmid seg 1-GFP which expresses segment 1-GFP RNA (Meng et al. 2012). The GFP reporter plasmid retains the exact 5' (220 nt) and 3' (48 nt) terminus of segment 1. Human 293T cells were transfected with plasmids as previously described (Dimmock et al. 2008). Briefly, 70% confluent 293T cells in a 12-well plate were transfected using TransIT LT1 transfection reagent (Minis) with 8 PolI expression plasmids encoding viral sense RNA and cDNA plasmids for expression of PB2, PB1, PA and NP proteins, with or without pPolI-244 or pPolI-244 knock-out. The transfected cells were then incubated at 37.degree. C. overnight before co-culture with MDCK cells in a 25 cm.sup.2 flask. Finally virus in tissue culture fluids was passaged once in embryonated chicken's eggs and allantoic fluids harvested to produce a stock of virus (Dimmock et al. 2008).
[0109] The virus produced in embryonated chicken's eggs is a mixture of 244 DI virus or 244 AUG knock-out DI virus packaged in A/WSN virion proteins and infectious helper A/WSN virus. These were purified by differential centrifugation through sucrose, and resuspended in PBS. Stocks were standardized according to their haemagglutination titre and stored in liquid nitrogen. The DI virus stock was UV-irradiated to remove helper virus infectivity using a short burst (40 seconds) of UV irradiation at 253.7 nm (0.64 mW/cm.sup.2). This is `active DI virus`. The UV target is viral RNA, but UV has relatively little effect on the DI RNA because of its small target size, 395 nt compared with 13,600 nt for infectious virus. Longer UV irradiation (8 minutes) inactivates protecting activity for mice, but does not affect haemagglutinin or neuraminidase activities, and so controls for any immune system-stimulating or receptor-blocking effects of 244 DI virus particles (inactivated DI virus'). The yield of 244 AUG knock-out DI A/WSN virus and its behaviour on purification were very similar to 244 DI A/WSN virus (data not shown).
Mutation
[0110] Two sequential steps of site-directed mutagenesis were carried out to mutate the three start codons in the 244 DI RNA. A pair of primers were used for site-directed mutagenesis to convert the first AUG to AUC using a pPolI-244 plasmid as template and pfu DNA polymerase (Promega). The mutation was confirmed by sequencing. The second round of site-directed mutagenesis was done using primers which altered the second and third start codons of AUG to AUC using the construct produced from the first round of mutagenesis. The resulting construct was again confirmed by sequencing.
Northern Blot Analysis
[0111] Total cellular RNA was isolated from DI infected cells using Trizol. Poly A containing mRNA was selected using a GenElute Direct mRNA preparation kit (Sigma) according to the manufacturer's instructions. Non-polyadenylated RNA that did not bind to the column during mRNA preparation was retained. Aliquots of total RNA, mRNA and non-polyadenylated RNA were separated by glyoxal-agarose gel electrophoresis. After electrophoresis, the RNA was transferred onto Hybond-N membrane (GE Healthcare) overnight using 20.times.SSC. The membrane was then baked at 80.degree. C. for 2 h. A full length negative sense segment 1 probe was prepared by in vitro transcription in the presence of DIG-UTP (Roche) from a PCR product containing a bacteriophage T7 promoter. The membrane was hybridized with the DIG-labelled probe overnight and the signal was detected using a digoxigenin-specific AP FAb antibody fragment and CSPD substrate (Roche).
Primer Extension Analysis
[0112] Primer extension analysis was carried out on total cellular RNA (Rehwinkel et al. 2010). Total RNA (2 .mu.g) was mixed with [.sup.32P]5'-end labelled primers and dNTP in a total volume of 13 .mu.l. The mixture was heated at 65.degree. C. for 5 min and placed on ice for 1 min. 2.times.first Strand Buffer, 20 mM DTT, and 100 U SuperScript III reverse transcriptase (Invitrogen) were added and further incubated at 55.degree. C. for 1 h. The reaction was terminated by heating at 95.degree. C. for 5 min with gel loading dye II (Ambion). The transcription products were resolved on a 6% (w/v) polyacrylamide gel containing 7 M urea in TBE buffer and detected by phosphor imaging.
Interference Measured by the Inhibition of GFP
[0113] 293T cells were transfected with the segment 1-GFP RNA expressing plasmid, plasmids expressing PB1, PB2, PA and NP proteins, and increasing amounts of an additional PolI plasmid expressing a 244 DI or 244 AUG knock-out DI RNA. At 2 days post-transfection, the cultures were examined for GFP expression. Digital images of the cell monolayers were taken by phase-contrast and epifluorescence microscopy. Five field fluorescence images were randomly selected and analysed for the proportion of the visualised area expressing GFP using the HClmage software (Hamamatsu). The visualisation detects cells expressing a range of GFP levels to include those that may have been transfected with different levels of the reporter plasmids. A mean was calculated to give the percentage of the GFP positive area per monolayer.
Protection of Mice from Influenza with DI Virus
[0114] In order to assess the degree of protection afforded by DI virus, C3H/He-mg mice were inoculated intranasally under light ether anaesthesia with A/WSN alone (10 LD.sub.50 or 1000 ffu), a mixture of A/WSN+active DI virus, or A/WSN+inactivated DI virus. Mice were subsequently monitored for clinical disease according to our standard protocol and for weight loss as previously described (Dimmock et al. 2008). Surviving mice were challenged 3 weeks after infection with a high dose of A/WSN (10,000 LD.sub.50) to determine their immune status.
Results
Coding Potential of 244 DI RNA
[0115] 244 DI RNA, a molecule of 395 nucleotides, arose from segment 1 of PR8 as a result of one or more deletion events that left 244 nucleotides at the 3' end and 151 nucleotides at the 5' end of the positive sense RNA (Dimmock et al. 2008). 244 RNA retains the signals at the terminus of the genome segment that direct transcription of mRNA (FIG. 1a). During replication influenza virus makes two forms of positive sense RNA. Replication involves synthesis of positive-sense (cRNA) copies of the genome vRNAs of the infecting virus, which in turn are used as templates for synthesis of new vRNAs (Palese and Shaw, 2007). Influenza virus mRNA synthesis is initiated using a primer cleaved from the capped 5' end of host mRNA and its synthesis terminates before the end of the template vRNA, prior to polyadenylation (Dias et al. 2009; Fechter et al. 2003; Guilligay et al. 2008; Plotch et al. 1981). Thus the mRNA differs from the positive sense replication intermediate cRNA in having the primer-derived 5'-extension, and in being truncated and polyadenylated at the 3' end. To confirm that 244 DI RNA can direct the synthesis of mRNA the RNAs present in cells infected with 244 DI virus were investigated. Northern blot analysis using a segment 1 specific probe to detect positive sense RNA identified two polyadenylated virus mRNAs in infected cells (FIG. 2a). The larger mRNA of approximately 2.3 kb is consistent with mRNA derived from the full length genome segment 1 provided by the helper virus. The smaller mRNA of approximately 500 bases indicates that the 244 DI RNA directs the synthesis of mRNA. The positive sense RNA seen in the non-polyadenylated RNA fraction is cRNA and as expected this can be seen to be slightly smaller than the 244 DI-derived mRNA. The mRNA transcribed by 244 DI RNA contains the translation start codon of the PB2 open reading frame 1 (ORF-1) giving the 244 DI RNA capacity to encode a protein comprising the first 41 amino acid residues of PB2 fused to 21 amino acid residues translated from a different reading frame generated as a result of the deletion, making a protein of 62 residues in total (FIG. 9b). This putative protein contains the entire PB1-binding domain of residues 1-35 (Sugiyama et al. 2009) and the mitochondrial localisation domain of residues 1-22 (Carr et al. 2006). The PB2 ORF has three possible AUG start codons. The sequence context for the first AUG (the authentic start codon for PB2) is very good, while the second and third are poor. However, to be sure there could be no translation initiation we mutated all three possible start codons (to AUC); the sequence was then confirmed. The new RNA is known as 244 AUG knock-out DI RNA.
244 AUG Knock-Out DI RNA and 244 DI RNA Interfere with the Expression of a Segment 1 RNA in Cell Culture to a Similar Extent
[0116] RNAs were harvested 2 days after 293 T cells were transfected with plasmid encoding either the 244 DI RNA or the 244 AUG knock-out DI RNA together with plasmids expressing the PB2, PB1, PA and NP proteins. Primer extension analysis showed that similar amounts of mRNA and vRNA were synthesized by the 244 and 244 AUG knock-out DI RNAs confirming that transcription was unaffected by the mutations in the 244 AUG knock-out DI RNA (FIG. 10b).
[0117] To investigate the interfering ability of 244 AUG knock-out RNA, we used a GFP expression assay in which transcription and replication of a segment 1 RNA in which most of the PB2 coding region had been replaced with GFP (segment 1-GFP) were enabled by co-transfection of plasmids expressing PB1, PB2, PA and NP proteins into 293T cells. This system permits viral RNA synthesis but not virus particle formation as plasmids encoding key structural proteins (HA, NA, M1 and M2) were not included. The effects of co-transfected DI RNA-encoding plasmids were assessed by monitoring GFP fluorescence. FIG. 11a compares the expression of fluorescence in a positive control culture in the absence of either DI RNA with cultures transfected with various amounts of 244 plasmid or 244 AUG knock-out plasmid. This showed that both plasmids strongly inhibited fluorescence in a dose-dependent manner, for example 0.5 .mu.g of 244 plasmid or 244 AUG knock-out plasmid both inhibited GFP fluorescence by over 90% (FIG. 11b).
244 AUG Knock-Out DI Virus Protects Mice from a Lethal Influenza a Virus Challenge
[0118] We compared the protection activity of 244 DI and 244 AUG knock-out DI RNA in our C3H/He-mg mouse model using A/WSN as the challenge virus (Dimmock et al. 2008). Mice were infected intranasally under light anaesthesia with A/WSN alone, or with A/WSN+244 DI virus, or A/WSN+244 AUG knock-out DI virus. Other infected groups received DI virus which had been UV-irradiated for 8 minutes to destroy DI protecting activity and to control for any non-specific effects of the DI virus inoculum. Mice were monitored for clinical disease and weight loss. FIG. 12a, b show that the virus-infected control mice all became seriously ill with substantial weight loss, and had to be culled. In contrast none of the mice treated with 244 DI virus or 244 AUG knock-out DI virus developed any sign of clinical disease. Mice treated with 244 DI virus and 244 AUG knock-out DI virus both showed a transient drop in weight (FIG. 12b). Weight loss is the more sensitive criterion of disease and it is not uncommon to see this range of variation in the absence of any clinical disease. As expected from earlier data (Dimmock et al. 2008), mice treated with UV-inactivated DI virus were not protected. We have shown previously that animals treated with 244 DI virus simultaneously with infectious virus generate protective immunity that prevents disease following subsequent challenge with a high dose of the same virus in the absence of further treatment with DI virus (Dimmock et al. 2008). Animals treated with the 244 knock-out DI virus were solidly immune to further challenge with a high dose of A/WSN showing that they had been infected even though they developed no sign of clinical disease (FIG. 12c, d).
DISCUSSION
[0119] Although DI influenza viruses have been known for over 60 years, there has been little indication of the molecular mechanisms by which their in vitro interfering activity or in vivo protecting activity operate. Initially the problem was insoluble as natural DI virus preparations contain a diversity of defective RNA sequences and thus the biological properties of individual DI sequences could not be analysed. However, the use of cloned DI viruses generated using reverse genetics has allowed us to address this problem. Our recent work has shown that 244 DI RNA which is derived from genome segment 1 interferes in three ways: competition with the cognate full-length segment for packaging, interference with the synthesis and/or accumulation of the polymerase encoding full-length virion RNA segments 1, 2 and 3, and stimulation of type I interferon in vivo. Here, we have shown that influenza 244 DI RNA directs the synthesis of polyadenylated mRNA (FIG. 10a). The mRNA is larger than the positive sense cRNA as expected for all influenza virus mRNAs indicating that the DI RNA is a template for transcription. The mRNA produced from 244 DI RNA will therefore contain a 5' cap and poly A tail and potentially be available for translation into protein. The sequence of the 244 DI RNA predicts that DI mRNA can be translated into a protein that shares the amino terminal 41 amino acid residues of PB2. This region of PB2 has been shown to bind to the PB1 protein of the polymerase complex and also be localised in the host cell mitochondria (Carr et al. 2006; Sugiyama et al. 2009).
[0120] A mutant 244 DI RNA in which all three in-frame AUG translation initiation codons from the PB2 ORF were converted to AUC, and which was therefore unable to express the PB2-related protein, retained the properties of the original 244 DI RNA. The 244 AUG knockout DI RNA was able to interfere with gene expression from influenza virus segment 1 in vitro to the same extent as seen with 244 DI RNA (FIG. 10b and FIG. 11). Most importantly 244 AUG knockout DI RNA retained the ability to protect mice from a disease following administration of a lethal dose of influenza virus (FIG. 12). Thus the mutation had no effect on interference in vitro and protection in vivo by 244 DI RNA.
[0121] We conclude that in vitro interference and in vivo protection against influenza virus disease are not mediated by the truncated PB2 peptide that is encoded, and may be synthesized by 244 DI RNA, and that these processes are therefore controlled by the DI RNA molecule itself.
Sequence CWU
1
1
251395DNAInfluenza virus 1agcgaaagca ggtcaaatat attcaatatg gaaagaataa
aagaactaag aaatctaatg 60tcgcagtctc gcacccgcga gatactcaca aaaaccaccg
tggaccatat ggccataatc 120aagaagtaca catcaggaag acaggagaag actgagggga
ttcctcattc tgggcaaaga 180ggacaagaga tatgggccag cactaagcat caatgaactg
agcaaccttg cgaaaggaga 240gaaggctaat gtgctaattg ggcaagggga tgtggtgttg
gtaatgaaac ggaaacggga 300ctctagcata cttactgaca gccagacagc gaccaaaaga
attcggatgg ccatcaatta 360gtgtcgaata gtttaaaaac gaccttgttt ctact
39522341DNAInfluenza virus 2agcgaaagca ggtcaattat
attcaatatg gaaagaataa aagaactaag aaatctaatg 60tcgcagtctc gcacccgcga
gatactcaca aaaaccaccg tggaccatat ggccataatc 120aagaagtaca catcaggaag
acaggagaag aacccagcac ttaggatgaa atggatgatg 180gcaatgaaat atccaattac
agcagacaag aggataacgg aaatgattcc tgagagaaat 240gagcaaggac aaactttatg
gagtaaaatg aatgatgccg gatcagaccg agtgatggta 300tcacctctgg ctgtgacatg
gtggaatagg aatggaccaa tgacaaatac agttcattat 360ccaaaaatct acaaaactta
ttttgaaaga gtcgaaaggc taaagcatgg aacctttggc 420cctgtccatt ttagaaacca
agtcaaaata cgtcggagag ttgacataaa tcctggtcat 480gcagatctca gtgccaagga
ggcacaggat gtaatcatgg aagttgtttt ccctaacgaa 540gtgggagcca ggatactaac
atcggaatcg caactaacga taaccaaaga gaagaaagaa 600gaactccagg attgcaaaat
ttctcctttg atggttgcat acatgttgga gagagaactg 660gtccgcaaaa cgagattcct
cccagtggct ggtggaacaa gcagtgtgta cattgaagtg 720ttgcatttga ctcaaggaac
atgctgggaa cagatgtata ctccaggagg ggaagtgaag 780aatgatgatg ttgatcaaag
cttgattatt gctgctagga acatagtgag aagagctgca 840gtatcagcag acccactagc
atctttattg gagatgtgcc acagcacaca gattggtgga 900attaggatgg tagacatcct
taagcagaac ccaacagaag agcaagccgt gggtatatgc 960aaggctgcaa tgggactgag
aattagctca tccttcagtt ttggtggatt cacatttaag 1020agaacaagcg gatcatcagt
caagagagag gaagaggtgc ttacgggcaa tcttcaaaca 1080ttgaagataa gagtgcatga
gggatatgaa gagttcacaa tggttgggag aagagcaaca 1140gccatactca gaaaagcaac
caggagattg attcagctga tagtgagtgg gagagacgaa 1200cagtcgattg ccgaagcaat
aattgtggcc atggtatttt cacaagagga ttgtatgata 1260aaagcagtta gaggtgatct
gaatttcgtc aatagggcga atcagcgact gaatcctatg 1320catcaacttt taagacattt
tcagaaggat gcgaaagtgc tttttcaaaa ttggggagtt 1380gaacctatcg acaatgtgat
gggaatgatt gggatattgc ccgacatgac tccaagcatc 1440gagatgtcaa tgagaggagt
gagaatcagc aaaatgggtg tagatgagta ctccagcacg 1500gagagggtag tggtgagcat
tgaccggttc ttgagagtcc gggaccaacg aggaaatgta 1560ctactgtctc ccgaggaggt
cagtgaaaca cagggaacag agaaactgac aataacttac 1620tcatcgtcaa tgatgtggga
gattaatggt cctgaatcag tgttggtcaa tacctatcaa 1680tggatcatca gaaactggga
aactgttaaa attcagtggt cccagaaccc tacaatgcta 1740tacaataaaa tggaatttga
accatttcag tctttagtac ctaaggccat tagaggccaa 1800tacagtgggt ttgtgagaac
tctgttccaa caaatgaggg atgtgcttgg gacatttgat 1860accgcacaga taataaaact
tcttcccttc gcagccgctc caccaaagca aagtagaatg 1920cagttctcct catttactgt
gaatgtgagg ggatcaggaa tgagaatact tgtaaggggc 1980aattctcctg tattcaacta
caacaaggcc acgaagagac tcacagttct cggaaaggat 2040gctggcactt taaccgaaga
cccagatgaa ggcacagctg gagtggagtc cgctgttctg 2100aggggattcc tcattctggg
caaagaagac aggagatatg ggccagcatt aagcatcaat 2160gaactgagca accttgcgaa
aggagagaag gctaatgtgc taattgggca aggagacgtg 2220gtgttggtaa tgaaacgaaa
acgggactct agcatactta ctgacagcca gacagcgacc 2280aaaagaattc ggatggccat
caattagtgt cgaatagttt aaaaacgacc ttgtttctac 2340t
234132341DNAInfluenza virus
3agcaaaagca ggtcaattat attcagtatg gaaagaataa aagaactacg gaatctgatg
60tcgcagtctc gcactcgcga gatactgaca aaaaccacag tggaccatat ggccataatt
120aaaaagtaca catcggggag acaggaaaag aacccgtcac ttaggatgaa atggatgatg
180gcaatgaaat acccaatcac tgctgacaaa aggataacag aaatggttcc ggagagaaat
240gaacaaggac aaactctatg gagtaaaatg agtgatgctg gatcagatcg agtgatggta
300tcacctttgg ctgtaacatg gtggaataga aatggacccg tgacaagtac ggtccattac
360ccaaaagtat acaagactta ttttgacaaa gtcgaaaggt taaaacatgg aacctttggc
420cctgttcatt ttagaaatca agtcaagata cgcagaagag tagacataaa ccctggtcat
480gcagacctca gtgccaaaga ggcacaagat gtaattatgg aagttgtttt tcccaatgaa
540gtgggagcca ggatactaac atcagaatcg caattaacaa taactaaaga gaaaaaagaa
600gaactccgag attgcaaaat ttctcccttg atggttgcat acatgttaga gagagaactt
660gtacggaaaa caagatttct cccagttgct ggcggaacaa gcagtatata cattgaagtt
720ttacatttga ctcaaggaac gtgttgggaa caaatgtaca ctccaggtgg agaagtgagg
780aatgacgata ttgaccaaag cctaattatt gcggccagga acatagtaag aagagccgca
840gtatcagcag atccactagc atctttattg gagatgtgcc acagcacaca aattggcggg
900acaaggatgg tggacattct tagacagaac ccaactgaag aacaagctgt ggatatatgc
960aaggctgcaa tgggattgag aatcagctca tccttcagct ttggtgggtt tacatttaaa
1020agaacaagcg ggtcatcagt caaaaaagag gaagaagtgc ttacaggcaa tctccaaaca
1080ttgaagataa gagtacatga ggggtatgag gagttcacaa tggtggggaa aagagcaaca
1140gctatactaa gaaaagcaac cagaagattg gttcagctca tagtgagtgg aagagacgaa
1200cagtcaatag ccgaagcaat aatcgtggcc atggtgtttt cacaagagga ttgcatgata
1260aaagcagtta gaggtgacct gaatttcgtc aacagagcaa atcagcggtt gaaccccatg
1320catcagcttt taaggcattt tcagaaagat gcgaaagtgc tttttcaaaa ttggggaatt
1380gaacacatcg acagtgtgat gggaatgatt ggagtattac cagatatgac tccaagcaca
1440gagatgtcaa tgagaggaat aagagtcagc aaaatgggtg tggatgaata ctccagtaca
1500gagagggtgg tggttagcat tgatcggttt ttgagagttc gagaccaacg tgggaatgta
1560ttattatctc ctgaggaggt cagtgaaaca cagggaactg agagactgac aataacttat
1620tcatcgtcga tgatgtggga gattaacggt cctgagtcgg ttttggtcaa tacctatcaa
1680tggatcatca gaaattggga agctgtcaaa attcaatggt ctcagaatcc tgcaatgttg
1740tacaacaaaa tggaatttga accatttcaa tctttagtcc ccaaggccat tagaagccaa
1800tacagtgggt ttgtcagaac tctattccaa caaatgagag acgtacttgg gacatttgac
1860accacccaga taataaagct tctccctttt gcagccgctc caccaaagca aagcagaatg
1920cagttctctt cactgactgt aaatgtgagg ggatcaggga tgagaatact tgtaaggggc
1980aattctcctg tattcaacta caacaagacc actaaaagac taacaattct cggaaaagat
2040gccggcactt taattgaaga cccagatgaa agcacatccg gagtggagtc cgccgtcttg
2100agagggtttc tcattatagg taaggaagac agaagatacg gaccagcatt aagcatcaat
2160gaactgagta accttgcaaa aggggaaaag gctaatgtgc taatcgggca aggagacgtg
2220gtgttggtaa tgaaacgaaa acgggactct agcatactta ctgacagcca gacagcgacc
2280aaaagaattc ggatggccat caattaatgt tgaatagttt aaaaacgacc ttgtttctac
2340t
234142341DNAInfluenza virus 4agcaaaagca ggtcaattat attcagtatg gaaagaataa
aagaactacg gaacctgatg 60tcgcagtctc gcactcgcga gatactaaca aaaaccacag
tggaccatat ggccataatt 120aagaagtaca catcagggag acaggaaaag aacccgtcac
ttaggatgaa atggatgatg 180gcaatgaaat atccaatcac tgctgacaaa aggataacag
aaatggttcc ggagagaaat 240gaacaaggac aaactctatg gagtaaaatg agtgatgctg
ggtcagatcg agtgatggta 300tcacctttgg ctgtgacatg gtggaataga aatggacctg
tgacaaatac ggttcactat 360ccaaaagtat acaagactta ttttgacaaa gtcgaaaggt
taaaacatgg aacctttggc 420cctgttcatt ttagaaatca agtcaagata cgccgaagag
tggacataaa ccctggtcat 480gcagacctca gtgccaagga ggcacaagat gtaattatgg
aagttgtttt ccccaatgaa 540gtgggagcca ggatactaac atcagaatca caattaacaa
taaccaaaga gaaaaaagaa 600gaactccgag attgcaaaat ttctcctttg atggttgcat
acatgttaga gagggaactt 660gtccgaaaaa cgagatttct cccagttgct ggcggaacaa
gcagtatata cattgaagtt 720ttacatttga ctcaaggaac gtgttgggaa caaatgtaca
ctccaggtgg agaagtgagg 780aatgacgatg ttgaccaaag cctaattatt gcagccagga
acatagtgag aagagccgca 840gtatcagcag atccactagc atctttattg gagatgtgcc
acagcacaca aattggcggg 900acaaggatgg tggacattct taggcagaac ccgacggaag
aacaagctgt ggatatatgc 960aaggctgcaa tgggattgag aatcagctca tccttcagct
ttggtgggtt tacatttaaa 1020agaacaagcg ggtcatcagt caaaagagag gaagaagtgc
ttacaggcaa tctccaaaca 1080ttgaaaataa gagtacatga ggggtacgag gagttcacaa
tggtggggaa aagagcaaca 1140gctatactca gaaaagcaac caggagattg gttcaactca
tagtgagtgg aagggacgaa 1200cagtcaatag ccgaagcaat aatcgtggcc atggtgtttt
cacaagagga ttgcatgata 1260aaagcagtta gaggtgacct gaatttcgtt aacagggcaa
atcagcggtt gaaccccatg 1320catcagcttt taaggcattt tcagaaagat gcgaaggtgc
tttttcagaa ttggggaatt 1380gaacacatcg acagtgtgat gggaatggtt ggagtattac
cagatatgac tccaagcaca 1440gagatgtcaa tgagaggaat aagagtcagc aaaatgggcg
tggatgaata ctccagcaca 1500gagagggtgg tggttagcat tgatcggttt ttgagagttc
gagaccaacg tgggaatgta 1560ttattatctc ctgaggaggt cagtgaaaca cagggaacag
agagactgac aataacttac 1620tcatcgtcaa tgatgtggga gattaacggt cctgagtcgg
ttttggtcaa tacctatcaa 1680tgggtcatca gaaattggga aactgtcaaa attcaatggt
ctcagaatcc tgcaatgttg 1740tacaacaaaa tggaatttga accatttcaa tctttagttc
ctaaggccat tagaggccaa 1800tacagtggat ttgtcagaac tctattccaa caaatgagag
atgtacttgg gacatttgat 1860accatccaga taataaagct tctccctttt gcagccgctc
caccaaagca aagcagaatg 1920cagttctctt cattgactgt aaatgtgagg ggatcaggga
tgagaatact tgtaaggggc 1980aattctcctg tattcaacta caacaagacc actaaaagac
taacaattct cggaaaagat 2040gccggcactt taattgaaga cccagatgaa agcacatccg
gagtggagtc cgctgtcttg 2100agaggatttc tcattctagg taaggaagac agaagatacg
gaccagcatt aagcatcaat 2160gaactgagta accttgcaaa aggggaaaag gctaatgtgc
taattgggca aggagacgtg 2220gtgttggtaa tgaaacgaaa acgggactct agcatactta
ctgacagcca gacagcgacc 2280aaaagaattc ggatggccat caattaatgt tgaatagttt
aaaaacgacc ttgtttctac 2340t
234152341DNAInfluenza virus 5agcgaaagca ggcaaaccat
ttgaatggat gtcaatccga ccttactttt cttaaaagtg 60ccagcacaaa atgctataag
cacaactttc ccttataccg gagaccctcc ttacagccat 120gggacaggaa caggatacac
catggatact gtcaacagga cacatcagta ctcagaaaag 180gcaagatgga caacaaacac
cgaaactgga gcaccgcaac tcaacccgat tgatgggcca 240ctgccagaag acaatgaacc
aagtggttat gcccaaacag attgtgtatt ggaagcaatg 300gctttccttg aggaatccca
tcctggtatt tttgaaaact cgtgtattga aacgatggag 360gttgttcagc aaacacgagt
agacaagctg acacaaggcc gacagaccta tgactggact 420ttaaatagaa accagcctgc
tgcaacagca ttggccaaca caatagaagt gttcagatca 480aatggcctca cggccaatga
gtctggaagg ctcatagact tccttaagga tgtaatggag 540tcaatgaaaa aagaagaaat
ggggatcaca actcattttc agagaaagag acgggtgaga 600gacaatatga ctaagaaaat
gataacacag agaacaatag gtaaaaggaa acagagattg 660aacaaaagga gttatctaat
tagagcattg accctgaaca caatgaccaa agatgctgag 720agagggaagc taaaacggag
agcaattgca accccaggga tgcaaataag ggggtttgta 780tactttgttg agacactggc
aaggagtata tgtgagaaac ttgaacaatc agggttgcca 840gttggaggca atgagaagaa
agcaaagttg gcaaatgttg taaggaagat gatgaccaat 900tctcaggaca ccgaactttc
tttgaccatc actggagata acaccaaatg gaacgaaaat 960cagaatcctc ggatgttttt
ggccatgatc acatatatga ccagaaatca gcccgaatgg 1020ttcagaaatg ttctaagtat
tgctccaata atgttctcaa acaaaatggc gagactggga 1080aaagggtata tgtttgagag
caagagtatg aaacttagaa ctcaaatacc tgcagaaatg 1140ctagcaagca ttgatttgaa
atatttcaat gattcaacaa gaaagaagat tgaaaaaatc 1200cgaccgctct taatagaggg
gactgcatca ttgagccctg gaatgatgat gggcatgttc 1260aatatgttaa gcactgtatt
aggcgtctcc atcctgaatc ttggacaaaa gagatacacc 1320aagactactt actggtggga
tggtcttcaa tcctctgacg attttgctct gattgtgaat 1380gcacccaatc atgaagggat
tcaagccgga gtcgacaggt tttatcgaac ctgtaagcta 1440catggaatca atatgagcaa
gaaaaagtct tacataaaca gaacaggtac atttgaattc 1500acaagttttt tctatcgtta
tgggtttgtt gccaatttca gcatggagct tcccagtttt 1560ggtgtgtctg ggagcaacga
gtcagcggac atgagtattg gagttactgt catcaaaaac 1620aatatgataa acaatgatct
tggtccagca acagctcaaa tggcccttca gttgttcatc 1680aaagattaca ggtacacgta
ccgatgccat agaggtgaca cacaaataca aacccgaaga 1740tcatttgaaa taaagaaact
gtgggagcaa acccgttcca aagctggact gctggtctcc 1800gacggaggcc caaatttata
caacattaga aatctccaca ttcctgaagt ctgcctaaaa 1860tgggaattga tggatgagga
ttaccagggg cgtttatgca acccactgaa cccatttgtc 1920agccataaag aaattgaatc
aatgaacaat gcagtgatga tgccagcaca tggtccagcc 1980aaaaacatgg agtatgatgc
tgttgcaaca acacactcct ggatccccaa aagaaatcga 2040tccatcttga atacaagtca
aagaggagta cttgaagatg aacaaatgta ccaaaggtgc 2100tgcaatttat ttgaaaaatt
cttccccagc agttcataca gaagaccagt cgggatatcc 2160agtatggtgg aggctatggt
ttccagagcc cgaattgatg cacggattga tttcgaatct 2220ggaaggataa agaaagaaga
gttcactgag atcatgaaga tctgttccac cattgaagag 2280ctcagacggc aaaaatagtg
aatttagctt gtccttcatg aaaaaatgcc ttgttcctac 2340t
234162341DNAInfluenza virus
6agcaaaagca ggcaaaccat ttgaatggat gtcaatccga ctctactgtt cctaaaggtt
60ccagcgcaaa atgccataag caccacattc ccttatactg gggatcctcc atacagccat
120ggaacaggaa cagggtacac catggacaca gtcaacagaa cacaccaata ttcagagaag
180gggaagtgga cgacaaatac agaaactggg gcaccccaac tcaacccaat tgatggacca
240ctacctgagg ataatgagcc aagtggatat gcacaaacag actgtgtcct ggaggctatg
300gccttccttg aagaatccca cccaggtatc tttgagaact catgccttga aacaatggaa
360gtcgttcaac aaacaagggt ggacaaacta actcaaggtc gccagactta tgattggaca
420ttaaacagaa atcaaccagc agcaactgca ttagccaaca ccatagaagt ttttagatcg
480aatggactaa cagctaatga atcaggaagg ctaatagatt tcctcaagga tgtgatggaa
540tcaatggata aagaggaaat ggagataaca acacactttc aaagaaaaag gagagtaaga
600gacaacatga ccaagaaaat ggtcacacaa agaacaatag ggaagaaaaa acaaagagtg
660gataagagag gctatctaat aagagctttg acattgaaca cgatgaccaa agatgcagag
720agaggtaaat taaaaagaag ggctattgca acacccggga tgcaaattag agggttcgtg
780tacttcgttg aaactttagc tagaagcatt tgcgaaaagc ttgaacagtc tggactcccg
840gttgggggta atgaaaagaa ggccaaactg gcaaatgttg tgagaaaaat gatgactaat
900tcacaagaca ctgagctttc tttcacaatc actggggaca acactaagtg gaatgaaaat
960caaaaccctc gaatgttttt ggcgatgatt acatatatca caaaaaatca acctgagtgg
1020ttcagaaaca tcctgagcat cgcaccaata atgttctcaa acaaaatggc aagactagga
1080aaaggataca tgttcgagag taagaggatg aagctccgaa cacaaatacc cgcagaaatg
1140ctagcaagca ttgacctgaa gtatttcaat gaatcaacaa ggaagaaaat tgagaaaata
1200aggcctcttc taatagatgg cacagcatca ttgagccctg ggatgatgat gggcatgttc
1260aacatgctaa gtacggtttt aggagtctcg atactgaatc ttgggcaaaa gaaatacacc
1320aagacaacat actggtggga tgggctccaa tcctccgacg attttgccct catagtgaat
1380gcaccaaatc atgagggaat acaagcagga gtggatagat tctacaggac ctgcaagtta
1440gtgggaatca acatgagcaa aaagaagtcc tatataaata aaacagggac atttgaattc
1500acaagctttt tttatcgata tggatttgtg gctaatttta gcatggagct tcccagtttt
1560ggagtgtctg gaataaacga gtcagctgat atgagcattg gagtaacagt gataaagaac
1620aacatgataa acaatgacct tggaccagca acagcccaga tggctctcca attgttcatc
1680aaagactaca gatatacata taggtgccat agaggagaca cacaaattca gacgagaaga
1740tcattcgagc taaagaagct gtgggatcaa acccaatcaa gggcaggact attggtatca
1800gatgggggac caaacttata caatatccgg aaccttcaca tccctgaagt ctgcttaaag
1860tgggagctaa tggatgagaa ttatcaggga agactttgta accccctgaa tccctttgtc
1920agccataaag aaattgagtc tgtaaacaat gctgtagtga tgccagccca tggtccagcc
1980aaaagtatgg aatatgatgc cgttgcaact acacactcct ggattcccaa gaggaaccgc
2040tctattctca acacaagcca aaggggaatt cttgaggatg aacagatgta ccaaaagtgc
2100tgcaacttgt ttgagaaatt tttccctagt agttcatata ggagaccgat tggaatttct
2160agcatggtgg aggccatggt gtctagggcc cggattgatg ccagaattga cttcgagtct
2220ggacggatta agaaggaaga gttctctgag atcatgaaga tctgttccac cattgaagaa
2280ctcagacggc aaaaataatg aatttagctt gtccttcatg aaaaaatgcc ttgtttctac
2340t
234172341DNAInfluenza virus 7agcaaaagca ggcaaaccat ttgaatggat gtcaatccga
ctctactttt cctaaaggtt 60ccagcgcaaa atgccataag caccacattc ccctatactg
gagatcctcc atacagccat 120ggaacaggaa caggatacac catggacaca gtcaacagaa
cgcaccaata ttcagaaaaa 180gggaagtgga cgacaaacac agaaactggg gcaccccaac
tcaacccgat tgatggacca 240ctacctgagg ataatgagcc aagtggatat gcacaaacag
actgtgttct ggaggccatg 300gctttccttg aagaatccca cccagggatc tttgagaact
catgccttga aacaatggaa 360gttgttcagc aaacaagggt ggataaacta actcaaggtc
gccagactta tgattggaca 420ttaaacagaa atcaaccggc agcaactgca ttagccaaca
ccatagaagt ctttagatcg 480aatggtctaa cagctaatga gtcaggaagg ctaatagatt
tcctaaagga tgtgatggaa 540tcaatggata aagaggaaat agagataaca acacactttc
aaagaaaaag gagagtaaga 600gacaacatga ccaagaaaat ggtcacacaa agaacaatag
gaaagaaaaa acaaagagtg 660aataagagag gctatttaat aagagcactg acattgaata
cgatgaccaa agatgcagag 720agaggcaaat taaaaagaag ggctattgca acacccggga
tgcaaatgag agggttcgtg 780tactttgttg aaactttagc taggagcatt tgcgaaaagc
ttgaacagtc tggacttcca 840gttgggggta atgaaaagaa ggccaaattg gcaaatgttg
tgagaaagat gatgactaat 900tcacaagaca cagagctttc tttcacaatc actggggaca
acactaagtg gaatgaaaat 960caaaatcctc gaatgttcct ggcgatgatt acatatatca
caaaaaatca acctgagtgg 1020ttcagaaaca tcctgagcat cgcacccata atgttctcaa
acaaaatggc aagactagga 1080aaagggtaca tgttcgagag taaaagaatg aagctccgaa
cacaaatacc agcagaaatg 1140ctagcaagca ttgacctgaa atatttcaat gaatcaacaa
ggaagaaaat tgagaaaata 1200aggcctcttc taatagatgg cacagcatca ttgagccctg
gaatgatgat gggcatgttc 1260aacatgctaa gtacggtttt gggagtctcg atactgaatc
ttggacaaaa gaaatacacc 1320aagacaacat actggtggga tgggctccaa tcctccgacg
attttgccct catagtgaat 1380gcaccaaatc atgagggaat acaagcagga gtggatagat
tttacaggac ctgcaagtta 1440gtgggaatca acatgagcaa aaagaagtcc tatataaata
agacagggac atttgaattc 1500acaagctttt tttatcgcta tggatttgtg gctaatttta
gcatggagct gcccagtttt 1560ggagtgtctg gaataaatga atcagctgat atgagcattg
gagtaacagt gataaagaac 1620aacatgataa acaatgacct tggaccagca acagcccaga
tggcccttca attgttcatc 1680aaagactaca gatatacata tagatgccat agaggagaca
cacaaattca gacgagaaga 1740tcattcgagc taaagaagct gtgggatcaa acccaatcaa
aggcaggact attagtgtca 1800gatggaggac caaacttata caatatccgg aatcttcaca
ttcctgaagt ctgcttaaaa 1860tgggagctaa tggatgagga ttatcgggga agactttgta
atcccctgaa tccctttgtc 1920agccataaag agattgagtc tgtaaacaat gctgtggtga
tgccagccca tggtccagcc 1980aaaagcatgg aatatgatgc cgttgcaact acacactcct
ggattcccaa gaggaaccgc 2040tctattctca acacaagcca aaggggaatt cttgaggatg
aacagatgta ccagaagtgc 2100tgcaacctgt tcgagaaatt tttccccagt agttcataca
ggagaccggt tggaatttct 2160agcatggtgg aggccatggt gtctagggcc cggattgatg
ccagaattga cttcgagtct 2220ggaaggatta agaaagaaga gttctctgag atcatgaaga
tctgttccac cattgaagaa 2280ctcagacggc aaaaataatg aatttagctt gtccttcatg
aaaaaatgcc ttgtttctac 2340t
234182233DNAInfluenza virus 8agcgaaagca ggtactgatc
caaaatggaa gattttgtgc gacaatgctt caatccgatg 60attgtcgagc ttgcggaaaa
aacaatgaaa gagtatgggg aggacctgaa aatcgaaaca 120aacaaatttg cagcaatatg
cactcacttg gaagtatgct tcatgtattc agattttcac 180ttcatcaatg agcaaggcga
gtcaataatc gtagaacttg gtgatccaaa tgcacttttg 240aagcacagat ttgaaataat
cgagggaaga gatcgcacaa tggcctggac agtagtaaac 300agtatttgca acactacagg
ggctgagaaa ccaaagtttc taccagattt gtatgattac 360aaggagaata gattcatcga
aattggagta acaaggagag aagttcacat atactatctg 420gaaaaggcca ataaaattaa
atctgagaaa acacacatcc acattttctc gttcactggg 480gaagaaatgg ccacaaaggc
agactacact ctcgatgaag aaagcagggc taggatcaaa 540accagactat tcaccataag
acaagaaatg gccagcagag gcctctggga ttcctttcgt 600cagtccgaga gaggagaaga
gacaattgaa gaaaggtttg aaatcacagg aacaatgcgc 660aagcttgccg accaaagtct
cccgccgaac ttctccagcc ttgaaaattt tagagcctat 720gtggatggat tcgaaccgaa
cggctacatt gagggcaagc tgtctcaaat gtccaaagaa 780gtaaatgcta gaattgaacc
ttttttgaaa acaacaccac gaccacttag acttccgaat 840gggcctccct gttctcagcg
gtccaaattc ctgctgatgg atgccttaaa attaagcatt 900gaggacccaa gtcatgaagg
agagggaata ccgctatatg atgcaatcaa atgcatgaga 960acattctttg gatggaagga
acccaatgtt gttaaaccac acgaaaaggg aataaatcca 1020aattatcttc tgtcatggaa
gcaagtactg gcagaactgc aggacattga gaatgaggag 1080aaaattccaa agactaaaaa
tatgaagaaa acaagtcagc taaagtgggc acttggtgag 1140aacatggcac cagaaaaggt
agactttgac gactgtaaag atgtaggtga tttgaagcaa 1200tatgatagtg atgaaccaga
attgaggtcg ctagcaagtt ggattcagaa tgagtttaac 1260aaggcatgcg aactgacaga
ttcaagctgg atagagctcg atgagattgg agaagatgtg 1320gctccaattg aacacattgc
aagcatgaga aggaattatt tcacatcaga ggtgtctcac 1380tgcagagcca cagaatacat
aatgaagggg gtgtacatca atactgcctt gcttaatgca 1440tcttgtgcag caatggatga
tttccaatta attccaatga taagcaagtg tagaactaag 1500gagggaaggc gaaagaccaa
cttgtatggt ttcatcataa aaggaagatc ccacttaagg 1560aatgacaccg acgtggtaaa
ctttgtgagc atggagtttt ctctcactga cccaagactt 1620gaaccacata aatgggagaa
gtactgtgtt cttgagatag gagatatgct tataagaagt 1680gccataggcc aggtttcaag
gcccatgttc ttgtatgtga gaacaaatgg aacctcaaaa 1740attaaaatga aatggggaat
ggagatgagg cgttgcctcc tccagtcact tcaacaaatt 1800gagagtatga ttgaagctga
gtcctctgtc aaagagaaag acatgaccaa agagttcttt 1860gagaacaaat cagaaacatg
gcccattgga gagtccccca aaggagtgga ggaaagttcc 1920attgggaagg tctgcaggac
tttattagca aagtcggtat tcaacagctt gtatgcatct 1980ccacaactag aaggattttc
agctgaatca agaaaactgc ttcttatcgt tcaggctctt 2040agggacaacc ttgaacctgg
gacctttgat cttggggggc tatatgaagc aattgaggag 2100tgcctgatta atgatccctg
ggttttgctt aatgcttctt ggttcaactc cttccttaca 2160catgcattga gttagttgtg
gcagtgctac tatttgctat ccatactgtc caaaaaagta 2220ccttgtttct act
223392233DNAInfluenza virus
9agcaaaagca ggtactgatt cgaaatggaa gattttgtgc gacaatgctt caacccgatg
60attgtcgaac ttgcagaaaa aacaatgaaa gagtatggag aggatctgaa aattgaaaca
120aacaaatttg cagcaatatg cacccacttg gaggtatgtt tcatgtattc agattttcat
180ttcatcaatg aacaaggcga atcaataatg gtagaacttg atgatccaaa tgcactgtta
240aagcacagat tcgaaataat cgaggggaga gacagaacaa tggcctggac agtagtaaac
300agtatctgca acactactgg agctgaaaaa ccgaagtttc taccagattt gtatgattac
360aaggagaaca gattcatcga aattggagtg acaagaagag aagtccacat atattacctt
420gaaaaggcca ctaaaattaa atctgagaac acacacattc acattttctc attcactggg
480gaggaaatgg ccacaaaggc agactacact ctcgacgagg aaagcagggc taggattaaa
540accaggctat ttaccataag acaagaaatg gccaacagag gcctctggga ttcctttcgt
600cagtccgaaa gaggcgaaga aacaattgaa gaaaaatttg aaatctcagg aactatgcgt
660aggcttgccg accaaagtct cccaccgaac ttctcctgcc ttgagaattt tagagcctat
720gtggatggat tcgaaccgaa cggctgcatt gagggcaagc tttctcaaat gtccaaagaa
780gtgaatgcca aaattgaacc ttttctgaag acaacaccaa gaccaatcaa acttcctaat
840ggacctcctt gttatcagcg gtccaaattc ctcctgatgg atgctttgaa attgagcatt
900gaagacccaa gtcacgaagg agaagggatt ccattatatg atgcgatcaa gtgcataaaa
960acattctttg gatggaaaga accttatata gtcaaaccac acgaaaaggg aataaattca
1020aattacctgc tgtcatggaa gcaagtattg tcagaattgc aggacattga aaatgaggag
1080aagatcccaa ggactaaaaa catgaagaaa acgagtcaac taaagtgggc tcttggtgaa
1140aacatggcac cagagaaagt agactttgac aactgcagag acataagcga tttgaagcaa
1200tatgatagtg acgaacctga attaaggtca ctttcaagct ggatacagaa tgagttcaac
1260aaggcctgcg agctaactga ttcaatctgg atagagctcg atgaaattgg agaggacgta
1320gccccaattg agtacattgc aagcatgagg aggaattatt tcacagcaga ggtgtcccat
1380tgtagagcca ctgagtacat aatgaagggg gtatacatta atactgccct gctcaatgca
1440tcctgtgcag caatggacga ttttcaatta atccccatga taagcaagtg cagaactaaa
1500gagggaaggc gaaaaaccaa tttatatgga ttcatcataa agggaagatc tcatttaagg
1560aatgacacag atgtggtaaa ctttgtgagc atggaatttt ctctcactga cccgagacta
1620gagccacata aatgggagaa atactgtgtc cttgagatag gagatatgtt actaagaagt
1680gccataggcc aaatttcaag gcctatgttc ttgtatgtta ggacaaacgg aacatcaaag
1740gtcaaaatga aatggggaat ggagatgaga cgttgcctcc ttcagtcact ccagcagatc
1800gagagcatga ttgaagccga gtcctcgatt aaagagaaag acatgaccaa agagtttttt
1860gagaataaat cagaagcgtg gcccattggg gagtccccca agggagtgga agaaggttcc
1920attgggaaag tctgtaggac tctattggct aagtcagtgt tcaatagcct gtatgcatca
1980ccacaattgg aaggattttc agcggagtca agaaaactgc ttcttgttgt tcaggctctt
2040agggacaacc tcgaacctgg gacctttgat ctcggggggc tatatgaagc aattgaggag
2100tgcctgatta atgatccctg ggttttgctc aatgcatctt ggttcaactc cttcctgaca
2160catgcattaa aatagttatg gcagtgctac tatttgttat ccgtactgtc caaaaaagta
2220ccttgtttct act
2233102233DNAInfluenza virus 10agcaaaagca ggtactgatt cgaaatggaa
gattttgtgc gacaatgctt caacccgatg 60attgtcgaac ttgcagaaaa ggcaatgaaa
gagtatggag aggatctgaa aattgaaaca 120aacaaatttg cagcaatatg cactcacttg
gaggtatgtt tcatgtattc agattttcat 180ttcatcaatg aacaaggtga atcaatagtg
gtagaacttg acgatccaaa tgcactgtta 240aagcacagat ttgaaataat agaggggaga
gacagaacga tggcctggac agtagtaaac 300agtatctgca acactactgg agctgagaaa
ccgaagtttc tgccagattt gtatgattac 360aaggagaaca gattcatcga aattggagta
acaaggagag aagtccacat atattacctt 420gaaaaggcca ataaaattaa atctgagaat
acacacatcc acattttctc attcactggg 480gaggaaatgg ccacaaaggc agactacact
ctcgacgagg aaagcagggc taggattaag 540accaggctat ttaccataag acaagaaatg
gccaacagag gcctctggga ttcctttcgt 600cagtccgaaa gaggcgaaga gacaattgaa
gaaaaatttg aaatctcagg aactatgcgc 660aggcttgccg accaaagcct cccgccgaac
ttctcctgcc ttgagaattt tagagcctat 720gtagatggat tcgaaccgaa cggctgcatt
gagggcaagc tttctcaaat gtccaaagaa 780gtgaatgcca aaattgaacc ttttctgaag
acaacaccaa gaccaatcaa acttccgaat 840ggacctcctt gttatcagcg gtccaaattc
cttctgatgg atgctttaaa attaagcatt 900gaagacccaa gtcatgaagg agaagggata
ccactatatg atgcgatcaa gtgcataaga 960acattctttg gatggaaaga accctatata
gtcaaaccac acgaaaaggg aataaattca 1020aattacctgc tgtcatggaa gcaagtactg
gcagaattgc aggacattga aactgaggag 1080aagattccaa gaactaaaaa catgaagaaa
acgagtcaac taaagtgggc tcttggtgaa 1140aacatggcac cagagaaagt agactttgac
aactgcagag acataagcga tttgaagcaa 1200tatgatagtg acgaacctga attgaggtca
ctttcaagct ggatacagaa tgagttcaac 1260aaggcatgcg agctgactga ttcaatctgg
atagagctcg atgaaattgg agaagacata 1320gccccaattg agtacattgc aagcatgagg
aggaattatt tcacagcaga ggtgtcccac 1380tgcagagcca ctgagtacat aatgaagggg
gtatacatta atactgcctt gctcaatgca 1440tcctgtgcag caatggacga ttttcaacta
attcccatga taagcaagtg cagaacaaaa 1500gagggaaggc gaaaaaccaa tttatatgga
ttcatcataa aagggagatc tcacttaagg 1560aatgacacag atgtggtaaa ctttgtgagc
atggagtttt ctctcactga cccgaggctt 1620gagccacata aatgggagaa atactgtgtc
cttgagatag gagatatgtt actaagaagt 1680gccataggcc aaatgtcaag gcctatgttc
ttgtatgtga ggacaaatgg aacatcaaag 1740atcaaaatga aatggggaat ggagatgaga
cgttgcctcc ttcagtcact ccagcagatc 1800gagagcatga ttgaagccga gtcctcggtt
aaagagaaag acatgaccaa agagtttttt 1860gagaataaat cagaagcatg gcccattggg
gagtccccca agggagtgga agaaggttcc 1920attgggaaag tttgtaggac tttgttggct
aagtcggtgt tcaatagcct gtatgcatct 1980ccacaattag aaggattttc agcggagtca
agaaaactgc tccttgttgt tcaggctctt 2040agggacaacc ttgaacctgg gacctttgat
cttggggggc tatatgaagc aattgaggag 2100tgcctgatta atgatccctg ggttttgctc
aatgcgtctt ggttcaactc cttcctgaaa 2160catgcattaa aatagttatg gcagtgctac
tatttgttat ccatactgtc caaaaaagta 2220ccttgtttct act
22331131DNAArtificial SequencePrimer
11atggtctcta ctgatggtga gcaagggcga g
311234DNAArtificial SequencePrimer 12atgaagacaa tctcttactt gtacagctcg
tcca 341319DNAArtificial SequencePrimer
13ggacacgctg aacttgtgg
191422DNAArtificial SequencePrimer 14agataagagg ataatggaaa tg
221522DNAArtificial SequencePrimer
15atatggtcca ckgtggtttt tg
221620DNAArtificial SequencePrimer 16ggagaagact gaggggattc
201720DNAArtificial SequencePrimer
17tccatggtgt atcctgttcc
201820DNAArtificial SequencePrimer 18tgatttcgaa tctggaagga
201921DNAArtificial SequencePrimer
19tgagtgcata ttgctgcaaa t
212020DNAArtificial SequencePrimer 20ttcttatcgt tcaggctctt
202122DNAArtificial SequencePrimer
21tccagtatgg ttttgayttc cr
222220DNAArtificial SequencePrimer 22tggactagtg sgagcatsat
202320DNAArtificial SequencePrimer
23tcccaggcgg tctcccatcc
2024395RNAInfluenza virus 24agcgaaagca ggucaaauau auucaauaug gaaagaauaa
aagaacuaag aaaucuaaug 60ucgcagucuc gcacccgcga gauacucaca aaaaccaccg
uggaccauau ggccauaauc 120aagaaguaca caucaggaag acaggagaag acugagggga
uuccucauuc ugggcaaaga 180ggacaagaga uaugggccag cacuaagcau caaugaacug
agcaaccuug cgaaaggaga 240gaaggcuaau gugcuaauug ggcaagggga ugugguguug
guaaugaaac ggaaacggga 300cucuagcaua cuuacugaca gccagacagc gaccaaaaga
auucggaugg ccaucaauua 360gugucgaaua guuuaaaaac gaccuuguuu cuacu
3952562PRTInfluenza virus 25Met Glu Arg Ile Lys
Glu Leu Arg Asn Leu Met Ser Gln Ser Arg Thr 1 5
10 15 Arg Glu Ile Leu Thr Lys Thr Thr Val Asp
His Met Ala Ile Ile Lys 20 25
30 Lys Tyr Thr Ser Gly Arg Gln Glu Lys Thr Glu Gly Ile Pro His
Ser 35 40 45 Gly
Gln Arg Gly Gln Glu Ile Trp Ala Ser Thr Lys His Gln 50
55 60
User Contributions:
Comment about this patent or add new information about this topic: