Patent application title: MEANS AND METHODS FOR COUNTERACTING MUSCLE DISORDERS
Inventors:
IPC8 Class: AC12N15113FI
USPC Class:
1 1
Class name:
Publication date: 2016-10-20
Patent application number: 20160304864
Abstract:
The invention provides means and methods for alleviating one or more
symptom(s) of Duchenne Muscular Dystrophy and/or Becker Muscular
Dystrophy. Therapies using compounds for providing patients with
functional muscle proteins are combined with at least one adjunct
compound for reducing inflammation, preferably for reducing muscle tissue
inflammation, and/or at least one adjunct compound for improving muscle
fiber function, integrity and/or survival.Claims:
1. A composition comprising: a first compound that increases the level of
a functional dystrophin protein produced in a muscle cell of a Duchenne
Muscular Dystrophy (DMD) or Becker Muscular Dystrophy (BMD) individual,
wherein said first compound is an antisense oligonucleotide that induces
skipping of an exon of human dystrophin pre-mRNA of said individual; and
a second compound comprising a steroid; wherein, upon administration to a
DMD or BMD patient, the composition increases the ratio of said
dystrophin to laminin-.alpha.2 in muscle tissue of said patient as
compared to the ratio of said dystrophin to laminin-.alpha.2 in muscle
tissue of a patient administered with said first compound and not said
second compound; and wherein said antisense oligonucleotide is
complementary to a portion of said exon selected from the group
consisting of: exon 2, exon 8, exon 43, exon 44, exon 45, exon 46, exon
50, exon 52, exon 53 and exon 55, that is 13 to 50 nucleotides in length
and wherein said oligonucleotide comprises a non-naturally occurring
modification
2. The composition of claim 1, wherein said antisense oligonucleotide is complementary to a portion of the exon that is 14 to 25 nucleotides in length.
3. The composition of claim 1, wherein said antisense oligonucleotide is complementary to a portion of the exon that is 20 to 25 nucleotides in length.
4. The composition of claim 1, wherein said antisense oligonucleotide comprises one or more ribonucleotides, and wherein a said ribonucleotide contains a modification.
5. The composition of claim 4, wherein said modification is a 2'-O-methyl modified ribose.
6. The composition of claim 1, wherein said modification is selected from the group consisting of at least one of a peptide nucleic acid, a locked nucleic acid, and morpholino phosphorodiamidate.
7. A method for alleviating one or more symptom(s) of Duchenne Muscular Dystrophy or Becker Muscular Dystrophy in an individual, the method comprising administering to a DMD or BMD patient: a first compound that increases the level of a functional dystrophin protein produced in a muscle cell of said individual in said individual, wherein said first compound is an antisense oligonucleotide that induces skipping of an exon selected from the group consisting of: exon 2, exon 8, exon 43, exon 44, exon 45, exon 46, exon 50, exon 52, exon 53 and exon 55 of the dystrophin pre-mRNA of said individual, and a second compound, comprising a steroid; wherein, upon administration to a DMD or BMD patient, the composition increases the ratio of said dystrophin to laminin-.alpha.2 in muscle tissue of said patient as compared to the ratio of said dystrophin to laminin-.alpha.2 in muscle tissue of a patient administered with said first compound and not said second compound; and wherein said antisense oligonucleotide is complementary to a portion of the exon that is 13 to 50 nucleotides in length and wherein said oligonucleotide comprises a non-naturally occurring modification.
8. The method of claim 7, wherein said oligonucleotide comprises one or more ribonucleotides and wherein a said ribonucleotide contains a modification.
9. The method of claim 8, wherein said modification is selected from the group consisting of a 2'-O-methyl modified ribose.
10. The method of claim 7, wherein said modification is selected from the group consisting of at least one of a peptide nucleic acid, a locked nucleic acid, and morpholino phosphorodiamidate.
11. A method for increasing the production of a functional dystrophin protein in a cell, said cell comprising pre-mRNA of a dystrophin gene encoding an aberrant dystrophin protein comprising: providing said cell with a first compound for inhibiting inclusion of an exon selected from the group consisting of: exon 2, exon 8, exon 43, exon 44, exon 45, exon 46, exon 50, exon 52, exon 53 and exon 55 into mRNA produced from splicing of said dystrophin pre-mRNA, wherein said first compound is an antisense oligonucleotide that induces the skipping of the exon of the human dystrophin pre-mRNA, and providing said cell with a second compound comprising a steroid, said method further comprising allowing translation of mRNA produced from splicing of said pre-mRNA; wherein, upon administration to a DMD or BMD patient, the composition increases the ratio of said dystrophin to laminin-.alpha.2 in muscle tissue of said patient as compared to the ratio of said dystrophin to laminin-.alpha.2 in muscle tissue of a patient administered with said first compound and not said second compound; and wherein said antisense oligonucleotide is complementary to a portion of the exon that is 13 to 50 nucleotides in length and wherein said oligonucleotide comprises a non-naturally occurring modification.
12. A pharmaceutical preparation comprising: said first compound according to claim 1, said second compound according to claim 1, comprising a steroid, and a pharmaceutically acceptable carrier, adjuvant, diluent and/or excipient.
13. A kit comprising: said first compound according to claim 1, and said second compound according to claim 1.
14. The kit of claim 13, further comprising a pharmaceutically acceptable carrier, adjuvant, diluent and/or excipient.
15. The kit of claim 13, further comprising packaging means thereof.
16. The composition according to claim 1, wherein the oligonucleotide comprises a phosphorothioate internucleotide linkage, a 2'-O-methyl ribose and/or a LNA.
17. The kit according to claim 13, wherein the oligonucleotide comprises a phosphorothioate internucleotide linkage, a 2'-O-methyl ribose and/or a LNA.
18. A pharmaceutical composition comprising the composition of claim 1 and a pharmaceutically acceptable carrier, adjuvant, diluent, and/or excipient.
19. The method of claim 7 wherein said steroid is a glucocorticosteroid.
20. The method of claim 19 wherein said glucocorticosteroid is selected from a group consisting of prednisone, dexamethasone, prednizolone and deflazacort.
21. The method of claim 20 wherein said prednisone is present at a dosage of 0.5-1.0 mg/kg.
22. The method of claim 20 wherein said deflazacort is present at a dosage of 0.4-1.4 mg/kg
Description:
[0001] This application is a continuation application of and claims
priority to PCT/NL2008/050673 filed Oct. 27, 2008, EPO Application No.
07119351.0 filed Oct. 26, 2007, and U.S. Provisional Application No.
61/000,670 filed Oct. 26, 2007, the contents of which are hereby
incorporated in their entirety by this reference.
[0002] The invention relates to the fields of molecular biology and medicine. A muscle disorder is a disease that usually has a significant impact on the life of an individual. A muscle disorder can either have a genetic cause or a non-genetic cause. An important group of muscle diseases with a genetic cause are Becker Muscular Dystrophy (BMD) and Duchenne Muscular Dystrophy (DMD). These disorders are caused by defects in a gene for a muscle protein.
[0003] Becker Muscular Dystrophy and Duchenne Muscular Dystrophy are genetic muscular dystrophies with a relatively high incidence. In both Duchenne and Becker muscular dystrophy the muscle protein dystrophin is affected. In Duchenne dystrophin is absent, whereas in Becker some dystrophin is present but its production is most often not sufficient and/or the dystrophin present is abnormally formed. Both diseases are associated with recessive X-linked inheritance. DMD results from a frameshift mutation in the DMD gene. The frameshift in the DMD gene results in the production of a truncated non-functional dystrophin protein, resulting in progressive muscle wasting and weakness. BMD occurs as a mutation does not cause a frame-shift in the DMD gene. As in BMD some dystrophin is present in contrast to DMD where dystrophin is absent, BMD has less severe symptoms then DMD. The onset of DMD is earlier than BMD. DMD usually manifests itself in early childhood, BMD in the teens or in early adulthood. The progression of BMD is slower and less predictable than DMD. Patients with BMD can survive into mid to late adulthood. Patients with DMD rarely survive beyond their thirties.
[0004] Dystrophin plays an important structural role in the muscle fiber, connecting the extracellular matrix and the cytoskeleton. The N-terminal region binds actin, whereas the C-terminal end is part of the dystrophin glycoprotein complex (DGC), which spans the sarcolemma. In the absence of dystrophin, mechanical stress leads to sarcolemmal ruptures, causing an uncontrolled influx of calcium into the muscle fiber interior, thereby triggering calcium-activated proteases and fiber necrosis.
[0005] For most genetic muscular dystrophies no clinically applicable and effective therapies are currently available. Exon skipping techniques are nowadays explored in order to combat genetic muscular dystrophies. Promising results have recently been reported by us and others on a genetic therapy aimed at restoring the reading frame of the dystrophin pre-mRNA in cells from the mdx mouse and DMD patients.sup.1-11. By the targeted skipping of a specific exon, a DMD phenotype (lacking dystrophin) is converted into a milder BMD phenotype (partly to largely functional dystrophin). The skipping of an exon is preferably induced by the binding of antisense oligoribonucleotides (AONs) targeting either one or both of the splice sites, or exon-internal sequences. Since an exon will only be included in the mRNA when both the splice sites are recognised by the spliceosome complex, splice sites are obvious targets for AONs. Alternatively, or additionally, one or more AONs are used which are specific for at least part of one or more exonic sequences. Using exon-internal AONs specific for an exon 46 sequence, we were previously able to modulate the splicing pattern in cultured myotubes from two different DMD patients with an exon 45 deletion.sup.11. Following AON treatment, exon 46 was skipped, which resulted in a restored reading frame and the induction of dystrophin synthesis in at least 75% of the cells. We have recently shown that exon skipping can also efficiently be induced in human control and patient muscle cells for 39 different DMD exons using exon-internal AONs.sup.1, 2, 11-15.
[0006] Hence, exon skipping techniques applied on the dystrophin gene result in the generation of at least partially functional--albeit shorter--dystrophin protein in DMD patients. Since DMD is caused by a dysfunctional dystrophin protein, it would be expected that the symptoms of DMD are sufficiently alleviated once a DMD patient has been provided with functional dystrophin protein. However, the present invention provides the insight that, even though exon skipping techniques are capable of inducing dystrophin synthesis. DMD symptom(s) is/are still further alleviated by administering to a DMD patient an adjunct compound for reducing inflammation, preferably for reducing muscle tissue inflammation, and/or an adjunct compound for improving muscle fiber function, integrity and/or survival. According to the present invention, even when a dystrophin protein deficiency has been restored in a DMD patient, the presence of tissue inflammation and damaged muscle cells still continues to contribute to the symptoms of DMD. Hence, even though the cause of DMD--i.e. a dysfunctional dystrophin protein--is alleviated, treatment of DMD is still further improved by additionally using an adjunct therapy according to the present invention. Furthermore, the present invention provides the insight that a reduction of inflammation does not result in significant reduction of AON uptake by muscle cells. This is surprising because, in general, inflammation enhances the trafficking of cells, blood and other compounds. As a result, AON uptake/delivery is also enhanced during inflammation. Hence, before the present invention it would be expected that an adjunct therapy counteracting inflammation involves the risk of negatively influencing AON therapy. This, however, appears not to be the case.
[0007] The present invention therefore provides a method for alleviating one or more symptom(s) of Duchenne Muscular Dystrophy or Becker Muscular Dystrophy in an individual, the method comprising:
[0008] administering to said individual a compound for providing said individual with a (at least partially) functional dystrophin protein, and
[0009] administering to said individual an adjunct compound for reducing inflammation, preferably for reducing muscle tissue inflammation, and/or an adjunct compound for improving muscle fiber function, integrity and/or survival.
[0010] In another preferred embodiment the method for alleviating one or more symptom(s) of Duchenne Muscular Dystrophy or Becker Muscular Dystrophy in an individual comprises administering to said individual an adjunct compound for reducing inflammation, preferably for reducing muscle tissue inflammation, and/or an adjunct compound for improving muscle fiber function, integrity and/or survival.
[0011] It has surprisingly been found that the skipping frequency of a dystrophin exon from a pre-MRNA comprising said exon, when using an oligonucleotide directed toward the exon or to one or both splice sites of said exon, is enhanced if cells expressing said pre-mRNA are also provided with an adjunct compound for reducing inflammation, preferably for reducing muscle tissue inflammation, and/or an adjunct compound for improving muscle fiber function, integrity and/or survival. The enhanced skipping frequency also increases the level of functional dystrophin protein produced in a muscle cell of a DMD or BMD individual.
[0012] The present invention further provides a method for enhancing skipping of an exon from a dystrophin pre-mRNA in cells expressing said pre-mRNA, said method comprising
[0013] contacting said pre-mRNA in said cells with an oligonucleotide for skipping said exon and,
[0014] contacting said cells with an adjunct compound for reducing inflammation. preferably for reducing muscle tissue inflammation, and/or an adjunct compound for improving muscle fiber function, integrity and/or survival.
[0015] As Duchenne and Becker muscular dystrophy have a pronounced phenotype in muscle cells, it is preferred that said cells are muscle cells. Preferably said cells comprise a gene encoding a mutant dystrophin protein. Preferably said cells are cells of an individual suffering from DMD or BMD.
[0016] The present invention further provides a method for enhancing skipping of an exon from a dystrophin pre-mRNA in cells expressing said pre-mRNA in an individual suffering from Duchenne Muscular Dystrophy or Becker Muscular Dystrophy, the method comprising:
[0017] administering to said individual a compound for providing said individual with a (at least partially) functional dystrophin protein, and
[0018] administering to said individual an adjunct compound for reducing inflammation, preferably for reducing muscle tissue inflammation, and/or an adjunct compound for improving muscle fiber function, integrity and/or survival
[0019] An individual is provided with a functional dystrophin protein in various ways. In one embodiment an exon skipping technique is applied. However, alternative methods are available, such as for instance stop codon suppression by gentamycin or PTC124.sup.16, 17 (also known as 3-(5-(2-fluorophenyl)-1,2,4-oxadiazol-3-yl)benzoic acid), and/or adeno-associated virus (AAV)-mediated gene delivery of a functional mini- or micro-dystrophin gene.sup.18-20. PTC124.TM. is a registered trademark of PTC Therapeutics, Inc. South Plainfield, N.J.
[0020] As defined herein, a functional dystrophin is preferably a wild type dystrophin corresponding to a protein having the amino acid sequence as identified in SEQ ID NO: 1. A functional dystrophin is preferably a dystrophin, which has an actin binding domain in its N terminal part (first 240 amino acids at the N terminus), a cystein-rich domain (amino acid 3361 till 3685) and a C terminal domain (last 325 amino acids at the C terminus) each of these domains being present in a wild type dystrophin as known to the skilled person. The amino acids indicated herein correspond to amino acids of the wild type dystrophin being represented by SEQ ID NO: 1. In other words, a functional dystrophin is a dystrophin which exhibits at least to some extent an activity of a wild type dystrophin. "At least to some extent" preferably means at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 100% of a corresponding activity of a wild type functional dystrophin. In this context, an activity of a functional dystrophin is preferably binding to actin and to the dystrophin-associated glycoprotein complex (DGC).sup.56. Binding of dystrophin to actin and to the DGC complex may be visualized by either co-immunoprecipitation using total protein extracts or immunofluorescence analysis of cross-sections, from a biopsy of a muscle suspected to be dystrophic, as known to the skilled person.
[0021] Individuals suffering from Duchenne muscular dystrophy typically have a mutation in the gene encoding dystrophin that prevent synthesis of the complete protein, i.e of a premature stop prevents the synthesis of the C-terminus. In Becker muscular dystrophy the dystrophin gene also comprises a mutation compared tot the wild type but the mutation does typically not include a premature stop and the C-terminus is typically synthesized. As a result a functional dystrophin protein is synthesized that has at least the same activity in kind as the wild type protein, not although not necessarily the same amount of activity. The genome of a BMD individual typically encodes a dystrophin protein comprising the N terminal part (first 240 amino acids at the N terminus), a cystein-rich domain (amino acid 3361 till 3685) and a C terminal domain (last 325 amino acids at the C terminus) but its central rod shaped domain may be shorter than the one of a wild type dystrophin.sup.56. Exon-skipping for the treatment of DMD is typically directed to overcome a premature stop in the pre-mRNA by skipping an exon in the rod-domain shaped domain to correct the reading frame and allow synthesis of remainder of the dystrophin protein including the C-terminus, albeit that the protein is somewhat smaller as a result of a smaller rod domain. In a preferred embodiment, an individual having DMD and being treated by a method as defined herein will be provided a dystrophin which exhibits at least to some extent an activity of a wild type dystrophin. More preferably, if said individual is a Duchennes patient or is suspected to be a Duchennes patient, a functional dystrophin is a dystrophin of an individual having BMD: typically said dystrophin is able to interact with both actin and the DGC, but its central rod shaped domain may be shorter than the one of a wild type dystrophin (Aartsma-Rus et al (2006, ref 56). The central rod domain of wild type dystrophin comprises 24 spectrin-like repeats.sup.56. For example, a central rod shaped domain of a dystrophin as provided herein may comprise 5 to 23, 10 to 22 or 12 to 18 spectrin-like repeats as long as it can bind to actin and to DGC.
[0022] Alleviating one or more symptom(s) of Duchenne Muscular Dystrophy or Becker Muscular Dystrophy in an individual in a method of the invention may be assessed by any of the following assays: prolongation of time to loss of walking, improvement of muscle strength, improvement of the ability to lift weight, improvement of the time taken to rise from the floor, improvement in the nine-meter walking time, improvement in the time taken for four-stairs climbing, improvement of the leg function grade. improvement of the pulmonary function, improvement of cardiac function, improvement of the quality of life. Each of these assays is known to the skilled person. As an example, the publication of Manzur at al (2008, ref 58) gives an extensive explanation of each of these assays. For each of these assays, as soon as a detectable improvement or prolongation of a parameter measured in an assay has been found, it will preferably mean that one or more symptoms of Duchenne Muscular Dystrophy or Becker Muscular Dystrophy has been alleviated in an individual using a method of the invention Detectable improvement or prolongation is preferably a statistically significant improvement or prolongation as described in Hodgetts et al (2006, ref 57). Alternatively, the alleviation of one or more symptom(s) of Duchenne Muscular Dystrophy or Becker Muscular Dystrophy may be assessed by measuring an improvement of a muscle fiber function, integrity and/or survival as later defined herein.
[0023] An adjunct compound for reducing inflammation comprises any therapy which is capable of at least in part reducing inflammation, preferably inflammation caused by damaged muscle cells. Said adjunct compound is most preferably capable of reducing muscle tissue inflammation. Inflammation is preferably assessed by detecting an increase in the number of infiltrating immune cells such as neutrophils and/or mast cells and/or dendritic cells and/or lymphocytes in muscle tissue suspected to be dystrophic. This assessment is preferably carried out in cross-sections of a biopsy.sup.57 of muscle tissue suspected to be dystrophic after having specifically stained immune cells as identified above. The quantification is preferably carried out under the microscope. Reducing inflammation is therefore preferably assessed by detecting a decrease in the number of immune cells in a cross-section of muscle tissue suspected to be dystrophic. Detecting a decrease preferably means that the number of at least one sort of immune cells as identified above is decreased of at least 1%, 2%, 3%, 5%, 7%, 10%, 12%, 15%, 17%, 20%, 30%, 40%, 50%, 60%, 70%, 80% 90% or more compared to the number of a corresponding immune cell in a same individual before treatment. Most preferably, no infiltrating immune cells are detected in cross-sections of said biopsy.
[0024] An adjunct compound for improving muscle fiber function, integrity and/or survival comprises any therapy which is capable of measurably enhancing muscle fiber function, integrity and/or survival as compared to an otherwise similar situation wherein said adjunct compound is not present. The improvement of muscle fiber function, integrity and/or survival may be assessed using at least one of the following assays: a detectable decrease of creatine kinase in blood, a detectable decrease of necrosis of muscle fibers in a biopsy cross-section of a muscle suspected to be dystrophic, and/or a detectable increase of the homogeneity of the diameter of muscle fibers in a biopsy cross-section of a muscle suspected to be dystrophic. Each of these assays is known to the skilled person.
[0025] Creatine kinase may be detected in blood as described in 57. A detectable decrease in creatine kinase may mean a decrease of 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more compared to the concentration of creatine kinase in a same individual before treatment.
[0026] A detectable decrease of necrosis of muscle fibers is preferably assessed in a muscle biopsy, more preferably as described in 57 using biopsy cross-sections. A detectable decrease of necrosis may be a decrease of 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%. 80%, 90% or more of the area wherein necrosis has been identified using biopsy cross-sections. The decrease is measured by comparison to the necrosis as assessed in a same individual before treatment.
[0027] A detectable increase of the homogeneity of the diameter of a muscle fiber is preferably assessed in a muscle biopsy cross-section, more preferably as described in 57.
[0028] A treatment in a method according to the invention is about at least one week, about at least one month, about at least several months, about at least one year, about at least 2, 3, 4, 5, 6 years or more.
[0029] In one embodiment an adjunct compound for increasing turnover of damaged muscle cells is used. An adjunct compound for increasing turnover of damaged muscle cells comprises any therapy which is capable of at least in part inducing and/or increasing turnover of damaged muscle cells. Damaged muscle cells are muscle cells which have significantly less clinically measurable functionality than a healthy, intact muscle cell. In the absence of dystrophin, mechanical stress leads to sarcolemmal ruptures, causing an uncontrolled influx of calcium into the muscle fiber interior, thereby triggering calcium-activated proteases and fiber necrosis, resulting in damaged muscle cells. Increasing turnover of damaged muscle cells means that damaged muscle cells are more quickly broken down and/or removed as compared to a situation wherein turnover of damaged muscle cells is not increased. Turnover of damaged muscle cells is preferably assessed in a muscle biopsy, more preferably as described in 57 using a cross-section of a biopsy. A detectable increase of turnover may be an increase of 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more of the area wherein turnover has been identified using a biopsy cross-section. The increase is measured by comparison to the turnover as assessed in a same individual before treatment.
[0030] Without wishing to be bound to theory, it is believed that increasing turnover of muscle cells is preferred because this reduces inflammatory responses.
[0031] According to the present invention, a combination of a therapy for providing an individual with a functional dystrophin protein, together with an adjunct therapy for reducing inflammation, preferably for reducing muscle tissue inflammation in an individual, is particularly suitable for use as a medicament. Such combination is even better capable of alleviating one or more symptom(s) of Duchenne Muscular Dystrophy or Becker Muscular Dystrophy as compared to a sole therapy for providing an individual with a functional dystrophin protein. This embodiment also enhances the skipping frequency of a dystrophin exon from a pre-MRNA comprising said exon, when using an oligonucleotide directed toward the exon or to one or both splice sites of said exon. The enhanced skipping frequency also increases the level of functional dystrophin protein produced in a muscle cell of a DMD or BMD individual.
[0032] Further provided is therefore a combination of a compound for providing an individual with a functional dystrophin protein, and an adjunct compound for reducing inflammation, preferably for reducing muscle tissue inflammation in said individual, for use as a medicament. Since said combination is particularly suitable for counteracting DMD, the invention also provides a use of a compound for providing an individual with a functional dystrophin protein, and an adjunct compound for reducing inflammation, preferably for reducing muscle tissue inflammation in said individual, for the preparation of a medicament for alleviating one or more symptom(s) of Duchenne Muscular Dystrophy. In one embodiment, said combination is used in order to alleviate one or more symptom(s) of a severe form of BMD wherein a very short dystrophin protein is formed which is not sufficiently functional.
[0033] Preferred adjunct compound for reducing inflammation include a steroid, a TNF.quadrature. inhibitor, a source of mIGF-1 and/or an antioxidant. However, any other compound able to reduce inflammation as defined herein is also encompassed within the present invention. Each of these compounds is later on extensively presented. Each of the compounds extensively presented may be used separately or in combination with each other and/or in combination with one or more of the adjunct compounds used for improving muscle fiber function, integrity and/or survival.
[0034] Furthermore, a combination of a therapy for providing an individual with a functional dystrophin protein. together with an adjunct therapy for improving muscle fiber function, integrity and/or survival in an individual is particularly suitable for use as a medicament. Such combination is even better capable of alleviating one or more symptom(s) of Duchenne Muscular Dystrophy as compared to a sole therapy for providing an individual with a functional dystrophin protein.
[0035] Further provided is therefore a combination of a compound for providing an individual with a functional dystrophin protein, and an adjunct compound for improving muscle fiber function, integrity and/or survival in said individual, for use as a medicament. This combination is also particularly suitable for counteracting DMD. A use of a compound for providing an individual with a functional dystrophin protein, and an adjunct compound for improving muscle fiber function, integrity and/or survival in said individual, for the preparation of a medicament for alleviating one or more symptom(s) of Duchenne Muscular Dystrophy is therefore also provided. In one embodiment, said combination is used in order to alleviate one or more symptom(s) of a severe form of BMD wherein a very short dystrophin protein is formed which is not sufficiently functional.
[0036] Preferred adjunct compounds for improving muscle fiber function, integrity and/or survival include a ion channel inhibitor, a protease inhibitor, L-arginine and/or an angiotensin II type I receptor blocker. However, any other compound able to improving muscle fiber function, integrity and/or survival as defined herein is also encompassed within the present invention. Each of these compounds is later on extensively presented. Each of the compounds extensively presented may be used separately or in combination with each other and/or in combination with one or more of the adjunct compounds used for reducing inflammation.
[0037] In one embodiment a pharmaceutical preparation is made which comprises at least one of the above mentioned combinations comprising a compound for providing an individual with a functional dystrophin protein together with an adjunct compound according to the invention. Further provided is therefore a pharmaceutical preparation comprising:
[0038] a compound for providing an individual with a functional dystrophin protein, and
[0039] an adjunct compound for reducing inflammation, preferably for reducing muscle tissue inflammation in said individual, and/or an adjunct compound for improving muscle fiber function, integrity and/or survival in said individual, and
[0040] a pharmaceutically acceptable carrier, adjuvant, diluent and/or excipient. Examples of suitable carriers and adjuvants are well known in the art and for instance comprise a saline solution. Dose ranges of compounds used in a pharmaceutical preparation according to the invention are designed on the basis of rising dose studies in clinical trials for which rigorous protocol requirements exist.
[0041] In a particularly preferred embodiment, a compound for providing an individual with a functional dystrophin protein is combined with a steroid. As shown in the Examples, such combination results in significant alleviation of DMD symptoms. One preferred embodiment of the present invention therefore provides a method for alleviating one or more symptom(s) of Duchenne Muscular Dystrophy in an individual, the method comprising administering to said individual a steroid and a compound for providing said individual with a functional dystrophin protein. A combination of a steroid and a compound for providing an individual with a functional dystrophin protein for use as a medicament is also provided, as well as a use of a steroid and a compound for providing an individual with a functional dystrophin protein for the preparation of a medicament for alleviating one or more symptom(s) of DMD. This embodiment also enhances the skipping frequency of a dystrophin exon from a pre-MRNA comprising said exon, when using an oligonucleotide directed toward the exon or to one or both splice sites of said exon. The enhanced skipping frequency also increases the level of functional dystrophin protein produced in a muscle cell of a DMD or BMD individual.
[0042] In one embodiment, said combination is used in order to alleviate one or more symptom(s) of a severe form of BMD wherein a very short dystrophin protein is formed which is not sufficiently functional.
[0043] A steroid is a terpenoid lipid characterized by a carbon skeleton with four fused rings, generally arranged in a 6-6-6-5 fashion. Steroids vary by the functional groups attached to these rings and the oxidation state of the rings. Steroids include hormones and drugs which are usually used to relieve swelling and inflammation, such as for instance prednisone, dexamethasone and vitamin D.
[0044] According to the present invention, supplemental effects of adjunct steroid therapy in DMD patients include reduction of tissue inflammation, suppression of cytotoxic cells, and improved calcium homeostasis. Most positive results are obtained in younger boys. Preferably the steroid is a corticosteroid (glucocorticosteroid). Preferably, prednisone steroids (such as prednisone, prednizolone or deflazacort) are used in a method according to the invention.sup.21. Dose ranges of (glucocortico)steroids to be used in the therapeutic applications as described herein are designed on the basis of rising dose studies in clinical trials for which rigorous protocol requirements exist. The usual doses are about 0.5-1.0 mg/kg/day, preferably about 0.75 mg/kg/day for prednisone and prednisolone, and about 0.4-1.4 mg/kg/day, preferably about 0.9 mg/kg/day for deflazacort.
[0045] In one embodiment, a steroid is administered to said individual prior to administering a compound for providing an individual with a functional dystrophin protein. In this embodiment, it is preferred that said steroid is administered at least one day, more preferred at least one week, more preferred at least two weeks, more preferred at least three weeks prior to administering a compound for providing said individual with a functional dystrophin protein.
[0046] In another preferred embodiment, a compound for providing an individual with a functional dystrophin protein is combined with a tumour necrosis factor-alpha (TNF.alpha.) inhibitor. Tumour necrosis factor-alpha (TNF.alpha.) is a pro-inflammatory cytokine that stimulates the inflammatory response. Pharmacological blockade of TNF.alpha. activity with the neutralising antibody infliximab (Remicade) is highly effective clinically at reducing symptoms of inflammatory diseases. In mdx mice, both infliximab and etanercept delay and reduce the necrosis of dystrophic muscle.sup.24, 25, with additional physiological benefits on muscle strength. chloride channel function and reduced CK levels being demonstrated in chronically treated exercised adult mdx mice.sup.26. Such highly specific anti-inflammatory drugs designed for use in other clinical conditions, are attractive alternatives to the use of steroids for DMD. In one embodiment, the use of a TNF.alpha. inhibitor is limited to periods of intensive muscle growth in boys when muscle damage and deterioration are especially pronounced.
[0047] One aspect of the present invention thus provides a method for alleviating one or more symptom(s) of Duchenne Muscular Dystrophy in an individual, the method comprising administering to said individual a TNF.alpha. inhibitor and a compound for providing said individual with a functional dystrophin protein. A combination of a TNF.alpha. inhibitor and a compound for providing an individual with a functional dystrophin protein for use as a medicament is also provided, as well as a use of a TNF.alpha. inhibitor and a compound for providing an individual with a functional dystrophin protein for the preparation of a medicament for alleviating one or more symptom(s) of DMD. In one embodiment, said combination is used in order to alleviate one or more symptom(s) of a severe form of BMD wherein a very short dystrophin protein is formed which is not sufficiently functional. A preferred TNF.alpha. inhibitor is a dimeric fusion protein consisting of the extracellular ligand-binding domain of the human p75 receptor of TNF.alpha. linked to the Fc portion of human IgG1. A more preferred TNF.alpha. inhibitor is ethanercept (Amgen, America).sup.26. The usual doses of ethanercept is about 0.2 mg/kg, preferably about 0.5 mg/kg twice a week. The administration is preferably subcutaneous.
[0048] In another preferred embodiment, a compound for providing an individual with a functional dystrophin protein is combined with a source of mIGF-1. As defined herein, a source of IGF-1 preferably encompasses mIGF-1 itself, a compound able of enhancing mIGF-1 expression and/or activity. Enhancing is herein synonymous with increasing. Expression of mIGF-1 is synonymous with amount of mIGF-1. mIGF-1 promotes regeneration of muscles through increase in satellite cell activity, and reduces inflammation and fibrosis.sup.27. Local injury of muscle results in increased mIGF-1 expression. In transgenic mice with extra IGF-1 genes, muscle hypertrophy and enlarged muscle fibers are observed.sup.27. Similarly, transgenic mdx mice show reduced muscle fiber degeneration.sup.28. Upregulation of the mIGF-1 gene and/or administration of extra amounts of mIGF-1 protein or a functional equivalent thereof (especially the mIGF-1 Ea isoform [as described in 27, human homolog IGF-1 isoform 4: SEQ ID NO: 2]) thus promotes the effect of other, preferably genetic, therapies for DMD, including antisense-induced exon skipping. The additional mIGF-1 levels in the above mentioned transgenic mice do not induce cardiac problems nor promote cancer, and have no pathological side effects. One aspect of the present invention thus provides a method for alleviating one or more symptom(s) of Duchenne Muscular Dystrophy in an individual, the method comprising administering to said individual a compound for providing said individual with a functional dystrophin protein, and providing said individual with a source of mIGF-1, preferably mIGF-1 itself, a compound able of increasing mIGF-1 expression and/or activity. As stated before, the amount of mIGF-1 is for instance increased by enhancing expression of the mIGF-1 gene and/or by administration of mIGF-1 protein and/or a functional equivalent thereof (especially the mIGF-1 Ea isoform [as described in 27, human homolog IGF-1 isoform 4: SEQ ID NO: 2]). A combination of mIGF-1, or a compound capable of enhancing mIGF-1 expression or an mIGF-1 activity, and a compound for providing an individual with a functional dystrophin protein for use as a medicament is also provided, as well as a use of mIGF-1, or a compound capable of enhancing mIGF-1 expression or mIGF-1 activity, and a compound for providing an individual with a functional dystrophin protein for the preparation of a medicament for alleviating one or more symptom(s) of DMD. In one embodiment, such combination is used in order to alleviate one or more symptom(s) of a severe form of BMD wherein a very short dystrophin protein is formed which is not sufficiently functional.
[0049] Within the context of the invention, an increased amount or activity of mIGF-1 may be reached by increasing the gene expression level of an IGF-1 gene, by increasing the amount of a corresponding IGF-1 protein and/or by increasing an activity of an IGF1-protein. A preferred mIGF-1 protein has been earlier defined herein. An increase of an activity of said protein is herein understood to mean any detectable change in a biological activity exerted by said protein or in the steady state level of said protein as compared to said activity or steady-state in a individual who has not been treated. Increased amount or activity of mIGF-1 is preferably assessed by detection of increased expression of muscle hypertrophy biomarker GATA-2 (as described in 27).
[0050] Gene expression level is preferably assessed using classical molecular biology techniques such as (real time) PCR, arrays or Northern analysis. A steady state level of a protein is determined directly by quantifying the amount of a protein. Quantifying a protein amount may be carried out by any known technique such as Western blotting or immunoassay using an antibody raised against a protein. The skilled person will understand that alternatively or in combination with the quantification of a gene expression level and/or a corresponding protein, the quantification of a substrate of a corresponding protein or of any compound known to be associated with a function or activity of a corresponding protein or the quantification of said function or activity of a corresponding protein using a specific assay may be used to assess the alteration of an activity or steady state level of a protein.
[0051] In a method of the invention, an activity or steady-state level of a said protein may be altered at the level of the protein itself, e.g. by providing a protein to a cell from an exogenous source.
[0052] Preferably, an increase or an upregulation of the expression level of a said gene means an increase of at least 5% of the expression level of said gene using arrays. More preferably, an increase of the expression level of said gene means an increase of at least 10%, even more preferably at least 20%, at least 30%, at least 40%, at least 50%, at least 70%, at least 90%, at least 150% or more. In another preferred embodiment, an increase of the expression level of said protein means an increase of at least 5% of the expression level of said protein using western blotting and/or using ELISA or a suitable assay. More preferably, an increase of the expression level of a protein means an increase of at least 10%, even more preferably at least 20%, at least 30%, at least 40%. at least 50%, at least 70%, at least 90%, at least 150% or more.
[0053] In another preferred embodiment, an increase of a polypeptide activity means an increase of at least 5% of a polypeptide activity using a suitable assay. More preferably, an increase of a polypeptide activity means an increase of at least 10%, even more preferably at least 20%, at least 30%, at least 40%, at least 50%, at least 70%, at least 90%, at least 150% or more. The increase is preferably assessed by comparison to corresponding activity in the individual before treatment.
[0054] A preferred way of providing a source of mIGF1 is to introduce a transgene encoding mIGF1, preferably an mIGF-1 Ea isoform (as described in 27, human homolog IGF-1 isoform 4: SEQ ID NO: 2), more preferably in an AAV vector as later defined herein. Such source of mIGF1 is specifically expressed in muscle tissue as described in mice in 27.
[0055] In another preferred embodiment, a compound for providing an individual with a functional dystrophin protein is combined with an antioxidant. Oxidative stress is an important factor in the progression of DMD and promotes chronic inflammation and fibrosis.sup.29. The most prevalent products of oxidative stress, the peroxidized lipids, are increased by an average of 35% in Duchenne boys. Increased levels of the enzymes superoxide dismutase and catalase reduce the excessive amount of free radicals causing these effects. In fact, a dietary supplement Protandim.RTM. (LifeVantage) was clinically tested and found to increase levels of superoxide dismutase (up to 30%) and catalase (up to 54%), which indeed significantly inhibited the peroxidation of lipids in 29 healthy persons.sup.30. Such effective management of oxidative stress thus preserves muscle quality and so promotes the positive effect of DMD therapy. Idebenone is another potent antioxidant with a chemical structure derived from natural coenzyme Q10. It protects mitochondria where adenosine triphosphate, ATP, is generated by oxidative phosphorylation. The absence of dystrophin in DMD negatively affects this process in the heart, and probably also in skeletal muscle. Idebenone was recently applied in clinical trials in the US and Europe demonstrating efficacy on neurological aspects of Friedreich's Ataxia.sup.31. A phase-IIa double-blind, placebo-controlled randomized clinical trial with Idebenone has recently been started in Belgium, including 21 Duchenne boys at 8 to 16 years of age. The primary objective of this study is to determine the effect of Idebenone on heart muscle function. In addition several different tests will be performed to detect the possible functional benefit on muscle strength in the patients. When effective, Idebenone is a preferred adjunct compound for use in a method according to the present invention in order to enhance the therapeutic effect of DMD therapy, especially in the heart. One aspect of the present invention thus provides a method for alleviating one or more symptom(s) of Duchenne Muscular Dystrophy in an individual, the method comprising administering to said individual an antioxidant and a compound for providing said individual with a functional dystrophin protein. A combination of an antioxidant and a compound for providing an individual with a functional dystrophin protein for use as a medicament is also provided, as well as a use of an antioxidant and a compound for providing an individual with a functional dystrophin protein for the preparation of a medicament for alleviating one or more symptom(s) of DMD. In one embodiment, said combination is used in order to alleviate one or more symptom(s) of a severe form of BMD wherein a very short dystrophin protein is formed which is not sufficiently functional. Depending on the identity of the antioxidant, the skilled person will know which quantities are preferably used. An antioxidant may include bacoside, silymarin, curcumin, a polyphenol, preferably epigallocatechin-3-gallate (EGCG). Preferably, an antioxidant is a mixture of antioxidants as the dietary supplement Protandim.RTM. (LifeVantage). A daily capsule of 675 mg of Protandim.RTM. comprises 150 mg of B. monniera (45% bacosides), 225 mg of S. marianum (70-80% silymarin), 150 mg of W. somnifera powder, 75 mg green tea (98% polyphenols wherein 45% EGCG) and 75 mg turmeric (95% curcumin).
[0056] In another preferred embodiment, a compound for providing an individual with a functional dystrophin protein is combined with an ion channel inhibitor. The presence of damaged muscle membranes in DMD disturbs the passage of calcium ions into the myofibers, and the consequently disrupted calcium homeostasis activates many enzymes, e.g. proteases, that cause additional damage and muscle necrosis. Ion channels that directly contribute to the pathological accumulation of calcium in dystrophic muscle are potential targets for adjunct compounds to treat DMD. There is evidence that some drugs, such as pentoxifylline, block exercise-sensitive calcium channels.sup.32 and antibiotics that block stretch activated channels reduce myofibre necrosis in mdx mice and CK levels in DMD boys.sup.33. One embodiment thus provides a method for alleviating one or more symptom(s) of Duchenne Muscular Dystrophy in an individual, the method comprising administering to said individual an ion channel inhibitor and a compound for providing said individual with a functional dystrophin protein. A combination of an ion channel inhibitor and a compound for providing an individual with a functional dystrophin protein for use as a medicament is also provided, as well as a use of an ion channel inhibitor and a compound for providing an individual with a functional dystrophin protein for the preparation of a medicament for alleviating one or more symptom(s) of DMD. In one embodiment, said combination is used in order to alleviate one or more symptom(s) of a severe form of BMD wherein a very short dystrophin protein is formed which is not sufficiently functional.
[0057] Preferably, ion channel inhibitors of the class of xanthines are used. More preferably, said xanthines are derivatives of methylxanthines, and most preferably, said methylxanthine derivates are chosen from the group consisting of pentoxifylline, furafylline, lisofylline, propentofylline, pentifylline, theophylline, torbafylline, albifylline. enprofylline and derivatives thereof. Most preferred is the use of pentoxifylline. Ion channel inhibitors of the class of xanthines enhance the skipping frequency of a dystrophin exon from a pre-MRNA comprising said exon, when using an oligonucleotide directed toward the exon or to one or both splice sites of said exon. The enhanced skipping frequency also increases the level of functional dystrophin protein produced in a muscle cell of a DMD or BMD individual.
[0058] Depending on the identity of the ion channel inhibitor, the skilled person will know which quantities are preferably used. Suitable dosages of pentoxifylline are between about 1 mg/kg/day to about 100 mg/kg/day. preferred dosages are between about 10 mg/kg/day to 50 mg/kg/day. Typical dosages used in humans are 20 mg/kg/day.
[0059] In one embodiment, an ion channel inhibitor is administered to said individual prior to administering a compound for providing an individual with a functional dystrophin protein. In this embodiment, it is preferred that said ion channel inhibitor is administered at least one day, more preferred at least one week, more preferred at least two weeks, more preferred at least three weeks prior to administering a compound for providing said individual with a functional dystrophin protein.
[0060] In another preferred embodiment, a compound for providing an individual with a functional dystrophin protein is combined with a protease inhibitor. Calpains are calcium activated proteases that are increased in dystrophic muscle and account for myofiber degeneration. Calpain inhibitors such as calpastatin, leupeptin.sup.34, calpeptin, calpain inhibitor III, or PD150606 are therefore applied to reduce the degeneration process. A new compound, BN 82270 (Ipsen) that has dual action as both a calpain inhibitor and an antioxidant increased muscle strength, decreased serum CK and reduced fibrosis of the mdx diaphragm, indicating a therapeutic effect with this new compound.sup.35. Another compound of Leupeptin/Carnitine (Myodur) has recently been proposed for clinical trials in DMD patients.
[0061] MG132 is another proteasomal inhibitor that has shown to reduce muscle membrane damage, and to ameliorate the histopathological signs of muscular dystrophy.sup.36. MG-132 (CBZ-leucyl-leucyl-leucinal) is a cell-permeable, proteasomal inhibitor (Ki=4 nM), which inhibits NFkappaB activation by preventing IkappaB degradation (IC50=3 .quadrature.M). In addition, it is a peptide aldehyde that inhibits ubiquitin-mediated proteolysis by binding to and inactivating 20S and 26S proteasomes. MG-132 has shown to inhibit the proteasomal degradation of dystrophin-associated proteins in the dystrophic mdx mouse model.sup.36. This compound is thus also suitable for use as an adjunct pharmacological compound for DMD. Further provided is therefore a method for alleviating one or more symptom(s) of Duchenne Muscular Dystrophy in an individual, the method comprising administering to said individual a protease inhibitor and a compound for providing said individual with a functional dystrophin protein. A combination of a protease inhibitor and a compound for providing an individual with a functional dystrophin protein for use as a medicament is also provided, as well as a use of a protease inhibitor and a compound for providing an individual with a functional dystrophin protein for the preparation of a medicament for alleviating one or more symptom(s) of DMD. In one embodiment, said combination is used in order to alleviate one or more symptom(s) of a severe form of BMD wherein a very short dystrophin protein is formed which is not sufficiently functional. Depending on the identity of the protease inhibitor, the skilled person will know which quantities are preferably used.
[0062] In another preferred embodiment, a compound for providing an individual with a functional dystrophin protein is combined with L-arginine. Dystrophin-deficiency is associated with the loss of the DGC-complex at the fiber membranes, including neuronal nitric oxide synthase (nNOS). Expression of a nNOS transgene in mdx mice greatly reduced muscle membrane damage. Similarly, administration of L-arginine (the substrate for nitric oxide synthase) increased NO production and upregulated utrophin expression in mdx mice. Six weeks of L-arginine treatment improved muscle pathology and decreased serum CK in mdx mice.sup.37. The use of L-arginine as an adjunct therapy in combination with a compound for providing said individual with a functional dystrophin protein has not been disclosed.
[0063] Further provided is therefore a method for alleviating one or more symptom(s) of Duchenne Muscular Dystrophy in an individual, the method comprising administering to said individual L-arginine and a compound for providing said individual with a functional dystrophin protein. A combination of L-arginine and a compound for providing an individual with a functional dystrophin protein for use as a medicament is also provided, as well as a use of L-arginine and a compound for providing an individual with a functional dystrophin protein for the preparation of a medicament for alleviating one or more symptom(s) of DMD. In one embodiment, said combination is used in order to alleviate one or more symptom(s) of a severe form of BMD wherein a very short dystrophin protein is formed which is not sufficiently functional.
[0064] In another preferred embodiment, a compound for providing an individual with a functional dystrophin protein is combined with angiotensin II type 1 receptor blocker Losartan which normalizes muscle architecture, repair and function, as shown in the dystrophin-deficient mdx mouse model.sup.23. One aspect of the present invention thus provides a method for alleviating one or more symptom(s) of Duchenne Muscular Dystrophy in an individual, the method comprising administering to said individual angiotensin II type 1 receptor blocker Losartan, and a compound for providing said individual with a functional dystrophin protein. A combination of angiotensin II type 1 receptor blocker Losartan and a compound for providing an individual with a functional dystrophin protein for use as a medicament is also provided, as well as a use of angiotensin II type I receptor blocker Losartan and a compound for providing an individual with a functional dystrophin protein for the preparation of a medicament for alleviating one or more symptom(s) of DMD. In one embodiment, said combination is used in order to alleviate one or more symptom(s) of a severe form of BMD wherein a very short dystrophin protein is formed which is not sufficiently functional. Depending on the identity of the angiotensin II type 1 receptor blocker, the skilled person will know which quantities are preferably used.
[0065] In another preferred embodiment, a compound for providing an individual with a functional dystrophin protein is combined with an angiotensin-converting enzyme (ACE) inhibitor, preferably perindopril. ACE inhibitors are capable of lowering blood pressure. Early initiation of treatment with perindopril is associated with a lower mortality in DMD patients.sup.22. One aspect of the present invention thus provides a method for alleviating one or more symptom(s) of Duchenne Muscular Dystrophy in an individual, the method comprising administering to said individual an ACE inhibitor, preferably perindopril, and a compound for providing said individual with a functional dystrophin protein. A combination of an ACE inhibitor, preferably perindopril, and a compound for providing an individual with a functional dystrophin protein for use as a medicament is also provided, as well as a use of an ACE inhibitor, preferably perindopril, and a compound for providing an individual with a functional dystrophin protein for the preparation of a medicament for alleviating one or more symptom(s) of DMD. In one embodiment, said combination is used in order to alleviate one or more symptom(s) of a severe form of BMD wherein a very short dystrophin protein is formed which is not sufficiently functional. The usual doses of an ACE inhibitor, preferably perindopril are about 2 to 4 mg/day.sup.22.
[0066] In a more preferred embodiment, an ACE inhibitor is combined with at least one of the previously identified adjunct compounds.
[0067] In another preferred embodiment, a compound for providing an individual with a functional dystrophin protein is combined with a compound which is capable of enhancing exon skipping and/or inhibiting spliceosome assembly and/or splicing Small chemical compounds, such as for instance specific indole derivatives, have been shown to selectively inhibit spliceosome assembly and splicing.sup.38, for instance by interfering with the binding of serine- and arginine-rich (SR) proteins to their cognate splicing enhancers (ISEs or ESEs) and/or by interfering with the binding of splicing repressors to silencer sequences (ESSs or ISSs). These compounds are therefore suitable for applying as adjunct compounds that enhance exon skipping.
[0068] Further provided is therefore a method for alleviating one or more symptom(s) of Duchenne Muscular Dystrophy in an individual, the method comprising administering to said individual a compound for enhancing exon skipping and/or inhibiting spliceosome assembly and/or splicing, and a compound for providing said individual with a functional dystrophin protein. A combination of a compound for enhancing exon skipping and/or inhibiting spliceosome assembly and/or splicing and a compound for providing an individual with a functional dystrophin protein for use as a medicament is also provided, as well as a use of a compound for enhancing exon skipping and/or inhibiting spliceosome assembly and/or splicing and a compound for providing an individual with a functional dystrophin protein for the preparation of a medicament for alleviating one or more symptom(s) of DMD. In one embodiment, said combination is used in order to alleviate one or more symptom(s) of a severe form of BMD wherein a very short dystrophin protein is formed which is not sufficiently functional. Depending on the identity of the compound which is capable of enhancing exon skipping and/or inhibiting spliceosome assembly and/or splicing, the skilled person will know which quantities are preferably used. In a more preferred embodiment, a compound for enhancing exon skipping and/or inhibiting spliceosome assembly and/or splicing is combined with a ACE inhibitor and/or with any adjunct compounds as identified earlier herein.
[0069] A pharmaceutical preparation comprising a compound for providing an individual with a functional dystrophin protein, any of the above mentioned adjunct compounds, and a pharmaceutically acceptable carrier, filler, preservative, adjuvant, solubilizer, diluent and/or excipient is also provided. Such pharmaceutically acceptable carrier, filler, preservative, adjuvant, solubilizer, diluent and/or excipient may for instance be found in Remington: The Science and Practice of Pharmacy, 20th Edition. Baltimore, Md.: Lippincott Williams & Wilkins, 2000.
[0070] The invention thus provides a method, combination, use or pharmaceutical preparation according to the invention, wherein said adjunct compound comprises a steroid, an ACE inhibitor (preferably perindopril), angiotensin 11 type 1 receptor blocker Losartan, a tumour necrosis factor-alpha (TNF.alpha.) inhibitor, a source of mIGF-1, preferably mIGF-1, a compound for enhancing mIGF-1 expression, a compound for enhancing mIGF-1 activity, an antioxidant, an ion channel inhibitor, a protease inhibitor, L-arginine and/or a compound for enhancing exon skipping and/or inhibiting spliceosome assembly and/or splicing.
[0071] As described herein before, an individual is provided with a functional dystrophin protein in various ways, for instance by stop codon suppression by gentamycin or PTC124.sup.16, 17, or by adeno-associated virus (AAV)-mediated gene delivery of a functional mini- or micro-dystrophin gene.sup.18-20.
[0072] Preferably, however, said compound for providing said individual with a functional dystrophin protein comprises an oligonucleotide, or a functional equivalent thereof, for at least in part decreasing the production of an aberrant dystrophin protein in said individual. Decreasing the production of an aberrant dystrophin mRNA, or aberrant dystrophin protein, preferably means that 90%, 80%, 70%, 60%, 50%, 40%, 30%. 20%, 10%, 5% or less of the initial amount of aberrant dystrophin mRNA, or aberrant dystrophin protein, is still detectable by RT PCR (mRNA) or immunofluorescence or western blot analysis (protein). An aberrant dystrophin mRNA or protein is also referred to herein as a non-functional dystrophin mRNA or protein. A non functional dystrophin protein is preferably a dystrophin protein which is not able to bind actin and/or members of the DGC protein complex. A non-functional dystrophin protein or dystrophin mRNA does typically not have, or does not encode a dystrophin protein with an intact C-terminus of the protein. Said oligonucleotide preferably comprises an antisense oligoribonucleotide. In a preferred embodiment an exon skipping technique is applied. Exon skipping interferes with the natural splicing processes occurring within a eukaryotic cell. In higher eukaryotes the genetic information for proteins in the DNA of the cell is encoded in exons which are separated from each other by intronic sequences. These introns are in some cases very long. The transcription machinery of eukaryotes generates a pre-mRNA which contains both exons and introns, while the splicing machinery, often already during the production of the pre-mRNA, generates the actual coding region for the protein by splicing together the exons present in the pre-mRNA.
[0073] Exon-skipping results in mature mRNA that lacks at least one skipped exon. Thus, when said exon codes for amino acids, exon skipping leads to the expression of an altered product. Technology for exon-skipping is currently directed towards the use of antisense oligonucleotides (AONs). Much of this work is done in the mdx mouse model for Duchenne muscular dystrophy. The mdx mouse, which carries a nonsense mutation in exon 23 of the dystrophin gene, has been used as an animal model of DMD. Despite the mdx mutation, which should preclude the synthesis of a functional dystrophin protein, rare, naturally occurring dystrophin positive fibers have been observed in mdx muscle tissue. These dystrophin-positive fibers are thought to have arisen from an apparently naturally occurring exon-skipping mechanism, either due to somatic mutations or through alternative splicing. AONs directed to. respectively, the 3' and/or 5' splice sites of introns 22 and 23 in dystrophin pre-mRNA, have been shown to interfere with factors normally involved in removal of intron 23 so that also exon 23 was removed from the mRNA.sup.3, 5, 6, 39, 40.
[0074] By the targeted skipping of a specific exon, a DMD phenotype is converted into a milder BMD phenotype. The skipping of an exon is preferably induced by the binding of AONs targeting either one or both of the splice sites, or exon-internal sequences. An oligonucleotide directed toward an exon internal sequence typically exhibits no overlap with non-exon sequences. It preferably does not overlap with the splice sites at least not insofar as these are present in the intron. An oligonucleotide directed toward an exon internal sequence preferably does not contain a sequence complementary to an adjacent intron. Further provided is thus a method, combination, use or pharmaceutical preparation according to the invention, wherein said compound for providing said individual with a functional dystrophin protein comprises an oligonucleotide, or a functional equivalent thereof, for inhibiting inclusion of an exon of a dystrophin pre-mRNA into mRNA produced from splicing of said pre-mRNA. An exon skipping technique is preferably applied such that the absence of an exon from mRNA produced from dystrophin pre-mRNA generates a coding region for a functional--albeit shorter--dystrophin protein. In this context, inhibiting inclusion of an exon preferably means that the detection of the original, aberrant dystrophin mRNA is decreased of at least about 10% as assessed by RT-PCR or that a corresponding aberrant dystrophin protein is decreased of at least about 10% as assessed by immunofluorescence or western blot analysis. The decrease is preferably of at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100%.
[0075] Once a DMD patient is provided with a functional dystrophin protein, the cause of DMD is taken away. Hence, it would then be expected that the symptoms of DMD are sufficiently alleviated. However, as already described before, the present invention provides the insight that, even though exon skipping techniques are capable of providing a functional dystrophin protein, a symptom of DMD is still further alleviated by administering to a DMD patient an adjunct compound for reducing inflammation, preferably for reducing muscle tissue inflammation, and/or an adjunct compound for improving muscle fiber function, integrity and/or survival. Moreover, the present invention provides the insight that an adjunct therapy counteracting inflammation does not negatively influence AON therapy. The present invention further provides the insight that the skipping frequency of a dystrophin exon from a pre-MRNA comprising said exon is enhanced, when using an oligonucleotide directed toward the exon or to one or both splice sites of said exon. The enhanced skipping frequency also increases the level of functional dystrophin protein produced in a muscle cell of a DMD or BMD individual.
[0076] Since an exon of a dystrophin pre-mRNA will only be included into the resulting mRNA when both the splice sites are recognised by the spliceosome complex, splice sites are obvious targets for AONs. One embodiment therefore provides a method, combination, use or pharmaceutical preparation according to the invention, wherein said compound for providing said individual with a functional dystrophin protein comprises an oligonucleotide, or a functional equivalent thereof, comprising a sequence which is complementary to a non-exon region of a dystrophin pre mRNA. In one embodiment an AON is used which is solely complementary to a non-exon region of a dystrophin pre mRNA. This is however not necessary: it is also possible to use an AON which comprises an intron-specific sequence as well as exon-specific sequence. Such AON comprises a sequence which is complementary to a non-exon region of a dystrophin pre mRNA, as well as a sequence which is complementary to an exon region of a dystrophin pre mRNA. Of course, an AON is not necessarily complementary to the entire sequence of a dystrophin exon or intron. AONs which are complementary to a part of such exon or intron are preferred. An AON is preferably complementary to at least part of a dystrohin exon and/or intron, said part having at least 13 nucleotides.
[0077] Splicing of a dystrophin pre-mRNA occurs via two sequential transesterification reactions. First, the 2'OH of a specific branch-point nucleotide within the intron that is defined during spliceosome assembly performs a nucleophilic attack on the first nucleotide of the intron at the 5' splice site forming the lariat intermediate. Second, the 3'OH of the released 5' exon then performs a nucleophilic attack at the last nucleotide of the intron at the 3' splice site thus joining the exons and releasing the intron lariat. The branch point and splice sites of an intron are thus involved in a splicing event. Hence, an oligonucleotide comprising a sequence which is complementary to such branch point and/or splice site is preferably used for exon skipping. Further provided is therefore a method, combination, use or pharmaceutical preparation according to the invention, wherein said compound for providing said individual with a functional dystrophin protein comprises an oligonucleotide, or a functional equivalent thereof, comprising a sequence which is complementary to a splice site and/or branch point of a dystrophin pre mRNA.
[0078] Since splice sites contain consensus sequences, the use of an oligonucleotide or a functional equivalent thereof (herein also called an AON) comprising a sequence which is complementary of a splice site involves the risk of promiscuous hybridization. Hybridization of AONs to other splice sites than the sites of the exon to be skipped could easily interfere with the accuracy of the splicing process. To overcome these and other potential problems related to the use of AONs which are complementary to an intron sequence, one preferred embodiment provides a method, combination, use or pharmaceutical preparation according to the invention, wherein said compound for providing said individual with a functional dystrophin protein comprises an oligonucleotide, or a functional equivalent thereof, comprising a sequence which is complementary to a dystrophin pre-mRNA exon. Preferably, said AON is capable of specifically inhibiting an exon inclusion signal of at least one exon in said dystrophin pre-mRNA. Interfering with an exon inclusion signal (EIS) has the advantage that such elements are located within the exon. By providing an AON for the interior of the exon to be skipped, it is possible to interfere with the exon inclusion signal thereby effectively masking the exon from the splicing apparatus. The failure of the splicing apparatus to recognize the exon to be skipped thus leads to exclusion of the exon from the final mRNA. This embodiment does not interfere directly with the enzymatic process of the splicing machinery (the joining of the exons). It is thought that this allows the method to be more specific and/or reliable. It is thought that an EIS is a particular structure of an exon that allows splice acceptor and donor to assume a particular spatial conformation. In this concept it is the particular spatial conformation that enables the splicing machinery to recognize the exon. However, the invention is certainly not limited to this model. It has been found that agents capable of binding to an exon are capable of inhibiting an EIS. An AON may specifically contact said exon at any point and still be able to specifically inhibit said EIS.
[0079] Using exon-internal AONs specific for an exon 46 sequence, we were previously able to modulate the splicing pattern in cultured myotubes from two different DMD patients with an exon 45 deletion.sup.11. Following AON treatment, exon 46 was skipped, which resulted in a restored reading frame and the induction of dystrophin synthesis in at least 75% of the cells. We have recently shown that exon skipping can also efficiently be induced in human control and series of patients with different mutations, including deletions, duplications and point mutations, for 39 different DMD exons using exon-internal AONs.sup.1, 2, 11-15.
[0080] Within the context of the invention, a functional equivalent of an oligonucleotide preferably means an oligonucleotide as defined herein wherein one or more nucleotides have been substituted and wherein an activity of said functional equivalent is retained to at least some extent. Preferably, an activity of said functional equivalent is providing a functional dystrophin protein. Said activity of said functional equivalent is therefore preferably assessed by quantifying the amount of a functional dystrophin protein. A functional dystrophin is herein preferably defined as being a dystrophin able to bind actin and members of the DGC protein complex. The assessment of said activity of an oligonucleotide is preferably done by RT-PCR or by immunofluorescence or Western blot analyses. Said activity is preferably retained to at least some extent when it represents at least 50%, or at least 60%, or at least 70% or at least 80% or at least 90% or at least 95% or more of corresponding activity of said oligonucleotide the functional equivalent derives from. Throughout this application, when the word oligonucleotide is used it may be replaced by a functional equivalent thereof as defined herein.
[0081] Hence, the use of an oligonucleotide, or a functional equivalent thereof, comprising or consisting of a sequence which is complementary to a dystrophin pre-mRNA exon provides good anti-DMD results. In one preferred embodiment an oligonucleotide, or a functional equivalent thereof, is used which comprises or consists of a sequence which is complementary to at least part of dystrophin pre-mRNA exon 2, 8, 9, 17, 19, 29, 40-46, 48-53, 55 or 59, said part having at least 13 nucleotides. However, said part may also have at least 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 nucleotides.
[0082] Most preferably an AON is used which comprises or consists of a sequence which is complementary to at least part of dystrophin pre-mRNA exon 51, 44, 45, 53, 46, 43, 2, 8, 50 and/or 52, said part having at least 13 nucleotides. However, said part may also have at least 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 nucleotides. Most preferred oligonucleotides are identified by each of the following sequences SEQ ID NO: 3 to SEQ ID NO: 284. Accordingly, a most preferred oligonucleotide as used herein is represented by a sequence from SEQ ID NO:3 to SEQ ID NO:284. A most preferred oligonucleotide as used herein is selected from the group consisting of SEQ ID NO:3 to NO:284.
[0083] Said exons are listed in decreasing order of patient population applicability. Hence, the use of an AON comprising a sequence which is complementary to at least part of dystrophin pre-mRNA exon 51 is suitable for use in a larger part of the DMD patient population as compared to an AON comprising a sequence which is complementary to dystrophin pre-mRNA exon 44, et cetera.
[0084] In a preferred embodiment, an oligonucleotide of the invention which comprises a sequence that is complementary to part of dystrophin pre-mRNA is such that the complementary part is at least 50% of the length of the oligonucleotide of the invention. more preferably at least 60%, even more preferably at least 70%, even more preferably at least 80%, even more preferably at least 90% or even more preferably at least 95%, or even more preferably 98% or more. In a most preferred embodiment, the oligonucleotide of the invention consists of a sequence that is complementary to part of dystrophin pre-mRNA as defined herein. For example, an oligonucleotide may comprise a sequence that is complementary to part of dystrophin pre-mRNA as defined herein and additional flanking sequences. In a more preferred embodiment, the length of said complementary part of said oligonucleotide is of at least 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30 nucleotides. Preferably, additional flanking sequences are used to modify the binding of a protein to the oligonucleotide, or to modify a thermodynamic property of the oligonucleotide, more preferably to modify target RNA binding affinity.
[0085] One preferred embodiment provides a method, combination. use or pharmaceutical preparation according to the invention, wherein said compound for providing said individual with a functional dystrophin protein comprises an oligonucleotide, or a functional equivalent thereof, which comprises:
[0086] a sequence which is complementary to a region of a dystrophin pre-mRNA exon that is hybridized to another part of a dystrophin pre-mRNA exon (closed structure), and
[0087] a sequence which is complementary to a region of a dystrophin pre-mRNA exon that is not hybridized in said dystrophin pre-mRNA (open structure).
[0088] For this embodiment, reference is made to our WO 2004/083432 patent application. RNA molecules exhibit strong secondary structures, mostly due to base pairing of complementary or partly complementary stretches within the same RNA. It has long since been thought that structures in the RNA play a role in the function of the RNA. Without being bound by theory, it is believed that the secondary structure of the RNA of an exon plays a role in structuring the splicing process. Through its structure, an exon is recognized as a part that needs to be included in the mRNA. Herein this signalling function is referred to as an exon inclusion signal. A complementary oligonucleotide of this embodiment is capable of interfering with the structure of the exon and thereby capable of interfering with the exon inclusion signal of the exon. It has been found that many complementary oligonucleotides indeed comprise this capacity, some more efficient than others. Oligonucleotides of this preferred embodiment, i.e. those with the said overlap directed towards open and closed structures in the native exon RNA, are a selection from all possible oligonucleotides. The selection encompasses oligonucleotides that can efficiently interfere with an exon inclusion signal. Without being bound by theory it is thought that the overlap with an open structure improves the invasion efficiency of the oligonucleotide (i.e. increases the efficiency with which the oligonucleotide can enter the structure), whereas the overlap with the closed structure subsequently increases the efficiency of interfering with the secondary structure of the RNA of the exon, and thereby interfere with the exon inclusion signal. It is found that the length of the partial complementarity to both the closed and the open structure is not extremely restricted. We have observed high efficiencies with oligonucleotides with variable lengths of complementarity in either structure. The term complementarity is used herein to refer to a stretch of nucleic acids that can hybridise to another stretch of nucleic acids under physiological conditions. It is thus not absolutely required that all the bases in the region of complementarity are capable of pairing with bases in the opposing strand. For instance, when designing the oligonucleotide one may want to incorporate for instance a residue that does not base pair with the base on the complementary strand. Mismatches may to some extent be allowed, if under the circumstances in the cell, the stretch of nucleotides is capable of hybridising to the complementary part. In a preferred embodiment a complementary part (either to said open or to said closed structure) comprises at least 3, and more preferably at least 4 consecutive nucleotides. The complementary regions are preferably designed such that, when combined, they are specific for the exon in the pre-mRNA. Such specificity may be created with various lengths of complementary regions as this depends on the actual sequences in other (pre-)mRNA in the system. The risk that also one or more other pre-mRNA will be able to hybridise to the oligonucleotide decreases with increasing size of the oligonucleotide. It is clear that oligonucleotides comprising mismatches in the region of complementarity but that retain the capacity to hybridise to the targeted region(s) in the pre-mRNA. can be used in the present invention. However, preferably at least the complementary parts do not comprise such mismatches as these typically have a higher efficiency and a higher specificity, than oligonucleotides having such mismatches in one or more complementary regions. It is thought that higher hybridisation strengths, (i.e. increasing number of interactions with the opposing strand) are favourable in increasing the efficiency of the process of interfering with the splicing machinery of the system. Preferably, the complementarity is between 90 and 100%. In general this allows for approximately 1 or 2 mismatch(es) in an oligonucleotide of around 20 nucleotides
[0089] The secondary structure is best analysed in the context of the pre-mRNA wherein the exon resides. Such structure may be analysed in the actual RNA. However, it is currently possible to predict the secondary structure of an RNA molecule (at lowest energy costs) quite well using structure-modelling programs. A non-limiting example of a suitable program is RNA mfold version 3.1 server.sup.41. A person skilled in the art will be able to predict, with suitable reproducibility, a likely structure of the exon, given the nucleotide sequence. Best predictions are obtained when providing such modelling programs with both the exon and flanking intron sequences. It is typically not necessary to model the structure of the entire pre-mRNA.
[0090] The open and closed structure to which the oligonucleotide is directed, are preferably adjacent to one another. It is thought that in this way the annealing of the oligonucleotide to the open structure induces opening of the closed structure whereupon annealing progresses into this closed structure. Through this action the previously closed structure assumes a different conformation. The different conformation results in the disruption of the exon inclusion signal. However, when potential (cryptic) splice acceptor and/or donor sequences are present within the targeted exon, occasionally a new exon inclusion signal is generated defining a different (neo) exon, i.e. with a different 5' end, a different 3' end, or both. This type of activity is within the scope of the present invention as the targeted exon is excluded from the mRNA. The presence of a new exon, containing part of the targeted exon, in the mRNA does not alter the fact that the targeted exon, as such, is excluded. The inclusion of a neo-exon can be seen as a side effect which occurs only occasionally. There are two possibilities when exon skipping is used to restore (part of) an open reading frame of dystrophin that is disrupted as a result of a mutation. One is that the neo-exon is functional in the restoration of the reading frame, whereas in the other case the reading frame is not restored. When selecting oligonucleotides for restoring dystrophin reading frames by means of exon-skipping it is of course clear that under these conditions only those oligonucleotides are selected that indeed result in exon-skipping that restores the dystrophin open reading frame, with or without a neo-exon.
[0091] Further provided is a method, combination, use or pharmaceutical preparation according to the invention, wherein said compound for providing said individual with a functional dystrophin protein comprises an oligonucleotide, or a functional equivalent thereof, which comprises a sequence that is complementary to a binding site for a serine-arginine (SR) protein in RNA of an exon of a dystrophin pre-mRNA. In our WO 2006/112705 patent application we have disclosed the presence of a correlation between the effectivity of an exon-internal antisense oligonucleotide (AON) in inducing exon skipping and the presence of a (for example by ESEfinder) predicted SR binding site in the target pre-mRNA site of said AON. Therefore, in one embodiment an oligonucleotide is generated comprising determining a (putative) binding site for an SR (Ser-Arg) protein in RNA of a dystrophin exon and producing an oligonucleotide that is complementary to said RNA and that at least partly overlaps said (putative) binding site. The term "at least partly overlaps" is defined herein as to comprise an overlap of only a single nucleotide of an SR binding site as well as multiple nucleotides of said binding site as well as a complete overlap of said binding site. This embodiment preferably further comprises determining from a secondary structure of said RNA, a region that is hybridised to another part of said RNA (closed structure) and a region that is not hybridised in said structure (open structure), and subsequently generating an oligonucleotide that at least partly overlaps said (putative) binding site and that overlaps at least part of said closed structure and overlaps at least part of said open structure. In this way we increase the chance of obtaining an oligonucleotide that is capable of interfering with the exon inclusion from the pre-mRNA into mRNA. It is possible that a first selected SR-binding region does not have the requested open-closed structure in which case another (second) SR protein binding site is selected which is then subsequently tested for the presence of an open-closed structure. This process is continued until a sequence is identified which contains an SR protein binding site as well as a(n) (partly overlapping) open-closed structure. This sequence is then used to design an oligonucleotide which is complementary to said sequence.
[0092] Such a method for generating an oligonucleotide is also performed by reversing the described order. i.e. first generating an oligonucleotide comprising determining, from a secondary structure of RNA from a dystrophin exon, a region that assumes a structure that is hybridised to another part of said RNA (closed structure) and a region that is not hybridised in said structure (open structure), and subsequently generating an oligonucleotide, of which at least a part of said oligonucleotide is complementary to said closed structure and of which at least another part of said oligonucleotide is complementary to said open structure. This is then followed by determining whether an SR protein binding site at least overlaps with said open/closed structure. In this way the method of WO 2004/083432 is improved. In yet another embodiment the selections are performed simultaneously.
[0093] Without wishing to be bound by any theory it is currently thought that use of an oligonucleotide directed to an SR protein binding site results in (at least partly) impairing the binding of an SR protein to the binding site of an SR protein which results in disrupted or impaired splicing.
[0094] Preferably, an open/closed structure and an SR protein binding site partly overlap and even more preferred an open/closed structure completely overlaps an SR protein binding site or an SR protein binding site completely overlaps an open/closed structure. This allows for an improved disruption of exon inclusion.
[0095] Besides consensus splice sites sequences, many (if not all) exons contain splicing regulatory sequences such as exonic splicing enhancer (ESE) sequences to facilitate the recognition of genuine splice sites by the spliceosome.sup.42, 43. A subgroup of splicing factors, called the SR proteins, can bind to these ESEs and recruit other splicing factors, such as U1 and U2AF to (weakly defined) splice sites. The binding sites of the four most abundant SR proteins (SF2/ASF, SC35, SRp40 and SRp55) have been analyzed in detail and these results are implemented in ESEfinder, a web source that predicts potential binding sites for these SR proteins.sup.42, 43. There is a correlation between the effectiveness of an AON and the presence/absence of an SF2/ASF, SC35 and SRp4O binding site. In a preferred embodiment, the invention thus provides a method, combination, use or pharmaceutical preparation as described above, wherein said SR protein is SF2/ASF or SC35 or SRp40.
[0096] In one embodiment a DMD patient is provided with a functional dystrophin protein by using an oligonucleotide, or a functional equivalent thereof, which is capable of specifically binding a regulatory RNA sequence which is required for the correct splicing of a dystrophin exon in a transcript. Several cis-acting RNA sequences are required for the correct splicing of exons in a transcript. In particular, supplementary elements such as intronic or exonic splicing enhancers (ISEs and ESEs) or silencers (ISSs and ESEs) are identified to regulate specific and efficient splicing of constitutive and alternative exons. Using sequence-specific antisense oligonucleotides (AONs) that bind to the elements, their regulatory function is disturbed so that the exon is skipped, as shown for DMD. Hence, in one preferred embodiment an oligonucleotide or functional equivalent thereof is used which is complementary to an intronic splicing enhancer (ISE), an exonic splicing enhancer (ESE), an intronic splicing silencer (ISS) and/or an exonic splicing silencer (ESS). As already described herein before, a dystrophin exon is in one preferred embodiment skipped by an agent capable of specifically inhibiting an exon inclusion signal of said exon, so that said exon is not recognized by the splicing machinery as a part that needs to be included in the mRNA. As a result, a mRNA without said exon is formed.
[0097] An AON used in a method of the invention is preferably complementary to a consecutive part of between 13 and 50 nucleotides of dystrophin exon RNA or dystrophin intron RNA. In one embodiment an AON used in a method of the invention is complementary to a consecutive part of between 16 and 50 nucleotides of a dystrophin exon RNA or dystrophin intron RNA. Preferably, said AON is complementary to a consecutive part of between 15 and 25 nucleotides of said exon RNA. More preferably, an AON is used which comprises a sequence which is complementary to a consecutive part of between 20 and 25 nucleotides of a dystrophin exon RNA or a dystrophin intron RNA.
[0098] Different types of nucleic acid may be used to generate the oligonucleotide. Preferably, said oligonucleotide comprises RNA, as RNA/RNA hybrids are very stable. Since one of the aims of the exon skipping technique is to direct splicing in subjects it is preferred that the oligonucleotide RNA comprises a modification providing the RNA with an additional property, for instance resistance to endonucleases and RNaseH, additional hybridisation strength, increased stability (for instance in a bodily fluid), increased or decreased flexibility, reduced toxicity, increased intracellular transport, tissue-specificity, etc. Preferably said modification comprises a 2'-O-methyl-phosphorothioate oligoribonucleotide modification. Preferably said modification comprises a 2'-O-methyl-phosphorothioate oligodeoxyribonucleotide modification. One embodiment thus provides a method, combination, use or pharmaceutical preparation according to the invention, wherein an oligonucleotide is used which comprises RNA which contains a modification. preferably a 2'-O-methyl modified ribose (RNA) or deoxyribose (DNA) modification.
[0099] In one embodiment the invention provides a hybrid oligonucleotide comprising an oligonucleotide comprising a 2'-O-methyl-phosphorothioate oligo(deoxy)ribonucleotide modification and locked nucleic acid. This particular combination comprises better sequence specificity compared to an equivalent consisting of locked nucleic acid, and comprises improved effectivity when compared with an oligonucleotide consisting of 2'-O-methyl-phosphorothioate oligo(deoxy)ribonucleotide modification.
[0100] With the advent of nucleic acid mimicking technology it has become possible to generate molecules that have a similar, preferably the same hybridisation characteristics in kind not necessarily in amount as nucleic acid itself. Such functional equivalents are of course also suitable for use in a method of the invention. Preferred examples of functional equivalents of an oligonucleotide are peptide nucleic acid and/or locked nucleic acid. Most preferably, a morpholino phosphorodiamidate is used. Suitable but non-limiting examples of equivalents of oligonucleotides of the invention can be found in.sup.44-50. Hybrids between one or more of the equivalents among each other and/or together with nucleic acid are of course also suitable. In a preferred embodiment locked nucleic acid is used as a functional equivalent of an oligonucleotide, as locked nucleic acid displays a higher target affinity and reduced toxicity and therefore shows a higher efficiency of exon skipping.
[0101] In one embodiment an oligonucleotide, or a functional equivalent thereof, which is capable of inhibiting inclusion of a dystrophin exon into dystrophin mRNA is combined with at least one other oligonucleotide, or functional equivalent thereof, that is capable of inhibiting inclusion of another dystrophin exon into dystrophin mRNA. This way, inclusion of two or more exons of a dystrophin pre-mRNA in mRNA produced from this pre-mRNA is prevented. This embodiment is further referred to as double- or multi-exon skipping.sup.2, 15. In most cases double-exon skipping results in the exclusion of only the two targeted exons from the dystrophin pre-mRNA. However, in other cases it was found that the targeted exons and the entire region in between said exons in said pre-mRNA were not present in the produced mRNA even when other exons (intervening exons) were present in such region. This multi-skipping was notably so for the combination of oligonucleotides derived from the DMD gene, wherein one oligonucleotide for exon 45 and one oligonucleotide for exon 51 was added to a cell transcribing the DMD gene. Such a set-up resulted in mRNA being produced that did not contain exons 45 to 51. Apparently, the structure of the pre-mRNA in the presence of the mentioned oligonucleotides was such that the splicing machinery was stimulated to connect exons 44 and 52 to each other.
[0102] Further provided is therefore a method, combination, use or pharmaceutical preparation according to the invention, wherein a nucleotide sequence is used which comprises at least 8, preferably between 16 to 80, consecutive nucleotides that are complementary to a first exon of a dystrophin pre-mRNA and wherein a nucleotide sequence is used which comprises at least 8, preferably between 16 to 80, consecutive nucleotides that are complementary to a second exon of said dystrophin pre-mRNA.
[0103] In one preferred embodiment said first and said second exon are separated in said dystrophin pre-mRNA by at least one exon to which said oligonucleotide is not complementary.
[0104] It is possible to specifically promote the skipping of also the intervening exons by providing a linkage between the two complementary oligonucleotides. Hence, in one embodiment stretches of nucleotides complementary to at least two dystrophin exons are separated by a linking moiety. The at least two stretches of nucleotides are thus linked in this embodiment so as to form a single molecule. Further provided is therefore a method, combination, use or pharmaceutical preparation according to the invention wherein said oligonucleotide, or functional equivalent thereof, for providing said individual with a functional dystrophin protein is complementary to at least two exons in a dystrophin pre-mRNA, said oligonucleotide or functional equivalent comprising at least two parts wherein a first part comprises an oligonucleotide having at least 8, preferably between 16 to 80, consecutive nucleotides that are complementary to a first of said at least two exons and wherein a second part comprises an oligonucleotide having at least 8, preferably between 16 to 80, consecutive nucleotides that are complementary to a second exon in said dystrophin pre-mRNA. The linkage may be through any means but is preferably accomplished through a nucleotide linkage. In the latter case the number of nucleotides that do not contain an overlap between one or the other complementary exon can be zero, but is preferably between 4 to 40 nucleotides. The linking moiety can be any type of moiety capable of linking oligonucleotides. Preferably, said linking moiety comprises at least 4 uracil nucleotides. Currently, many different compounds are available that mimic hybridisation characteristics of oligonucleotides. Such a compound, called herein a functional equivalent of an oligonucleotide, is also suitable for the present invention if such equivalent comprises similar hybridisation characteristics in kind not necessarily in amount. Suitable functional equivalents are mentioned earlier in this description. As mentioned, oligonucleotides of the invention do not have to consist of only oligonucleotides that contribute to hybridisation to the targeted exon. There may be additional material and/or nucleotides added.
[0105] The DMD gene is a large gene, with many different exons. Considering that the gene is located on the X-chromosome. it is mostly boys that are affected, although girls can also be affected by the disease, as they may receive a bad copy of the gene from both parents, or are suffering from a particularly biased inactivation of the functional allele due to a particularly biased X chromosome inactivation in their muscle cells. The protein is encoded by a plurality of exons (79) over a range of at least 2.6 Mb. Defects may occur in any part of the DMD gene. Skipping of a particular exon or particular exons can, very often, result in a restructured mRNA that encodes a shorter than normal but at least partially functional dystrophin protein. A practical problem in the development of a medicament based on exon-skipping technology is the plurality of mutations that may result in a deficiency in functional dystrophin protein in the cell. Despite the fact that already multiple different mutations can be corrected for by the skipping of a single exon. this plurality of mutations, requires the generation of a large number of different pharmaceuticals as for different mutations different exons need to be skipped. An advantage of a compound capable of inducing skipping of two or more exons, is that more than one exon can be skipped with a single pharmaceutical. This property is not only practically very useful in that only a limited number of pharmaceuticals need to be generated for treating many different DMD or particular, severe BMD mutations. Another option now open to the person skilled in the art is to select particularly functional restructured dystrophin proteins and produce compounds capable of generating these preferred dystrophin proteins. Such preferred end results are further referred to as mild phenotype dystrophins.
[0106] Each compound, an oligonucleotide and/or an adjunct compound as defined herein for use according to the invention may be suitable for direct administration to a cell, tissue and/or an organ in vivo of individuals affected by or at risk of developing DMD or BMD, and may be administered directly in vivo, ex vivo or in vitro.
[0107] Alternatively, suitable means for providing cells with an oligonucleotide or equivalent thereof are present in the art. An oligonucleotide or functional equivalent thereof may for example be provided to a cell in the form of an expression vector wherein the expression vector encodes a transcript comprising said oligonucleotide. The expression vector is preferably introduced into the cell via a gene delivery vehicle. A preferred delivery vehicle is a viral vector such as an adeno-associated virus vector (AAV), or a retroviral vector such as a lentivirus vector.sup.4, 51, 52 and the like. Also plasmids, artificial chromosomes, plasmids suitable for targeted homologous recombination and integration in the human genome of cells may be suitably applied for delivery of an oligonucleotide as defined herein. Preferred for the current invention are those vectors wherein transcription is driven from PolIII promoters, and/or wherein transcripts are in the form fusions with U I or U7 transcripts, which yield good results for delivering small transcripts. It is within the skill of the artisan to design suitable transcripts. Preferred are PolIII driven transcripts. Preferably in the form of a fusion transcript with an U1 or U7 transcript.sup.4, 51, 52. Such fusions may be generated as described.sup.53, 54. The oligonucleotide may be delivered as is. However, the oligonucleotide may also be encoded by the viral vector. Typically this is in the form of an RNA transcript that comprises the sequence of the oligonucleotide in a part of the transcript.
[0108] Improvements in means for providing cells with an oligonucleotide or equivalent thereof, are anticipated considering the progress that has already thus far been achieved. Such future improvements may of course be incorporated to achieve the mentioned effect on restructuring of mRNA using a method of the invention. The oligonucleotide or equivalent thereof can be delivered as is to the cells. When administering the oligonucleotide or equivalent thereof to an individual, it is preferred that the oligonucleotide is dissolved in a solution that is compatible with the delivery method. For intravenous, subcutaneous, intramuscular, intrathecal and/or intraventricular administration it is preferred that the solution is a physiological salt solution. Particularly preferred for a method of the invention is the use of an excipient that will aid in delivery of a compound as defined herein, preferably an oligonucleotide and optionally together with an adjunct compound to a cell and into a cell, preferably a muscle cell. Preferred are excipients capable of forming complexes, vesicles and/or liposomes that deliver such a compound as defined herein, preferably an oligonucleotide and optionally together with an adjunct compound complexed or trapped in a vesicle or liposome through a cell membrane. Many of these excipients are known in the art. Suitable excipients comprise polyethylenimine (PEI), or similar cationic polymers, including polypropyleneimine or polyethylenimine copolymers (PECs) and derivatives, ExGen 500, synthetic amphiphils (SAINT-18), Lipofectin.TM., DOTAP and/or viral capsid proteins that are capable of self assembly into particles that can deliver such compounds, preferably an oligonucleotide and optionally together with an adjunct compound as defined herein to a cell, preferably a muscle cell. Such excipients have been shown to efficiently deliver (oligonucleotide such as antisense) nucleic acids to a wide variety of cultured cells, including muscle cells. Their high transfection potential is combined with an excepted low to moderate toxicity in terms of overall cell survival. The ease of structural modification can be used to allow further modifications and the analysis of their further (in vivo) nucleic acid transfer characteristics and toxicity.
[0109] Lipofectin represents an example of a liposomal transfection agent. It consists of two lipid components, a cationic lipid N-[1-(2,3 dioleoyloxy)propyl]-N,N,N-trimethylammonium chloride (DOTMA) (cp. DOTAP which is the methylsulfate salt) and a neutral lipid dioleoylphosphatidylethanolamine (DOPE). The neutral component mediates the intracellular release. Another group of delivery systems are polymeric nanoparticles.
[0110] Polycations such like diethylaminoethylaminoethyl (DEAE)-dextran, which are well known as DNA transfection reagent can be combined with butylcyanoacrylate (PBCA) and hexylcyanoacrylate (PHCA) to formulate cationic nanoparticles that can deliver a compound as defined herein, preferably an oligonucleotide and optionally together with an adjunct compound across cell membranes into cells.
[0111] In addition to these common nanoparticle materials, the cationic peptide protamine offers an alternative approach to formulate a compound as defined herein, preferably an oligonucleotide and optionally together with an adjunct compound as colloids. This colloidal nanoparticle system can form so called proticles, which can be prepared by a simple self-assembly process to package and mediate intracellular release of a compound as defined herein, preferably an oligonucleotide and optionally together with an adjunct compound. The skilled person may select and adapt any of the above or other commercially available alternative excipients and delivery systems to package and deliver a compound as defined herein, preferably an oligonucleotide and optionally together with an adjunct compound for use in the current invention to deliver said compound for the treatment of Duchenne Muscular Dystrophy or Becker Muscular Dystrophy in humans.
[0112] In addition, a compound as defined herein, preferably an oligonucleotide and optionally together with an adjunct compound could be covalently or non-covalently linked to a targeting ligand specifically designed to facilitate the uptake in to the cell, cytoplasm and/or its nucleus. Such ligand could comprise (i) a compound (including but not limited to peptide(-like) structures) recognising cell, tissue or organ specific elements facilitating cellular uptake and/or (ii) a chemical compound able to facilitate the uptake in to cells and/or the intracellular release of an a compound as defined herein, preferably an oligonucleotide and optionally together with an adjunct compound from vesicles, e.g. endosomes or lysosomes.
[0113] Therefore, in a preferred embodiment, a compound as defined herein, preferably an oligonucleotide and optionally together with an adjunct compound are formulated in a medicament which is provided with at least an excipient and/or a targeting ligand for delivery and/or a delivery device of said compound to a cell and/or enhancing its intracellular delivery. Accordingly, the invention also encompasses a pharmaceutically acceptable composition comprising a compound as defined herein, preferably an oligonucleotide and optionally together with an adjunct compound and further comprising at least one excipient and/or a targeting ligand for delivery and/or a delivery device of said compound to a cell and/or enhancing its intracellular delivery.
[0114] It is to be understood that an oligonucleotide and an adjunct compound may not be formulated in one single composition or preparation. Depending on their identity, the skilled person will know which type of formulation is the most appropriate for each compound.
[0115] In a preferred embodiment the invention provides a kit of parts comprising a compound for providing an individual with a functional dystrophin protein and an adjunct compound for reducing inflammation, preferably for reducing muscle tissue inflammation, and/or an adjunct compound for improving muscle fiber function, integrity and/or survival.
[0116] In a preferred embodiment, a concentration of an oligonucleotide as defined herein, which is ranged between about 0.1 nM and about 1 .mu.M is used. More preferably, the concentration used is ranged between about 0.3 to about 400 nM, even more preferably between about 1 to about 200 nM. If several oligonucleotides are used, this concentration may refer to the total concentration of oligonucleotides or the concentration of each oligonucleotide added. The ranges of concentration of oligonucleotide(s) as given above are preferred concentrations for in vitro or ex vivo uses. The skilled person will understand that depending on the oligonucleotide(s) used, the target cell to be treated, the gene target and its expression levels, the medium used and the transfection and incubation conditions, the concentration of oligonucleotide(s) used may further vary and may need to be optimised any further.
[0117] More preferably, a compound preferably an oligonucleotide and an adjunct compound to be used in the invention to prevent, treat DMD or BMD are synthetically produced and administered directly to a cell, a tissue, an organ and/or patients in formulated form in a pharmaceutically acceptable composition or preparation. The delivery of a pharmaceutical composition to the subject is preferably carried out by one or more parenteral injections, e.g. intravenous and/or subcutaneous and/or intramuscular and/or intrathecal and/or intraventricular administrations, preferably injections, at one or at multiple sites in the human body.
[0118] Besides exon skipping, it is also possible to provide a DMD patient with a functional dystrophin protein with a therapy based on read-through of stopcodons. Compounds capable of suppressing stopcodons are particularly suitable for a subgroup of DMD patients which is affected by nonsense mutations (.about.7%) resulting in the formation of a stop codon within their dystrophin gene. In one embodiment said compound capable of suppressing stopcodons comprises the antibiotic gentamicin. In a recent study in mdx mice, gentamicin treatment induced novel dystrophin expression up to 20% of normal level. albeit with variability among animals. Human trials with gentamicin have however been inconclusive.sup.55. PTC124 belongs to a new class of small molecules that mimics at lower concentrations the readthrough activity of gentamicin. Administration of PTC124 resulted in the production of full-length and functionally active dystrophin both in vitro and in mdx mice.sup.16. Phase I/II trials with PTC124 are currently ongoing, not only for application in DMD but also for cystric fibrosis.sup.16, 17. The references 16 and 17 also describe preferred dosages of the PCT124 compound for use in the present invention. Further provided is therefore a method, combination, use or pharmaceutical preparation according to the invention, wherein said compound for providing said individual with a functional dystrophin protein comprises a compound for suppressing stop codons. Said compound for suppressing stop codons preferably comprises gentamicin, PTC124 or a functional equivalent thereof. Most preferably, said compound comprises PTC124.
[0119] In one embodiment an individual is provided with a functional dystrophin protein using a vector, preferably a viral vector, comprising a micro-mini-dystrophin gene. Most preferably, a recombinant adeno-associated viral (rAAV) vector is used. AAV is a single-stranded DNA parvovirus that is non-pathogenic and shows a helper-dependent life cycle. In contrast to other viruses (adenovirus, retrovirus, and herpes simplex virus). rAAV vectors have demonstrated to be very efficient in transducing mature skeletal muscle. Application of rAAV in classical DMD "gene addition" studies has been hindered by its restricted packaging limits (<5 kb). Therefore, rAAV is preferably applied for the efficient delivery of a much smaller micro- or mini-dystrophin gene. Administration of such micro- or mini-dystrophin gene results in the presence of a at least partially functional dystrophin protein. Reference is made to.sup.18-20.
[0120] A compound for providing an individual with a functional dystrophin protein and at least one adjunct compound according to the invention can be administered to an individual in any order. In one embodiment, said compound for providing an individual with a functional dystrophin protein and said at least one adjunct compound are administered simultaneously (meaning that said compounds are administered within 10 hours, preferably within one hour). This is however not necessary. In one embodiment at least one adjunct compound is administered to an individual in need thereof before administration of a compound for providing an individual with a functional dystrophin protein. Further provided is therefore a method according to the invention, comprising:
[0121] administering to an individual in need thereof an adjunct compound for reducing inflammation, preferably for reducing muscle tissue inflammation, and/or administering to said individual an adjunct compound for improving muscle fiber function, integrity and/or survival, and, subsequently,
[0122] administering to said individual a compound for providing said individual with a functional dystrophin protein.
[0123] In yet another embodiment, said compound for providing an individual with a functional dystrophin protein is administered before administration of said at least one adjunct compound.
[0124] Further provided is a method for at least in part increasing the production of a functional dystrophin protein in a cell, said cell comprising pre-mRNA of a dystrophin gene encoding aberrant dystrophin protein, the method comprising:
[0125] providing said cell with a compound for inhibiting inclusion of an exon into mRNA produced from splicing of said dystrophin pre-mRNA, and
[0126] providing said cell with an adjunct compound for reducing inflammation, preferably for reducing muscle tissue inflammation, and/or providing said cell with an adjunct compound for improving muscle fiber function, integrity and/or survival, the method further comprising allowing translation of mRNA produced from splicing of said pre-mRNA. In one embodiment said method is performed in vitro, for instance using a cell culture.
[0127] In this context, increasing the production of a functional dystrophin protein has been earlier defined herein.
[0128] Unless otherwise indicated each embodiment as described herein may be combined with another embodiment as described herein.
[0129] In this document and in its claims, the verb "to comprise" and its conjugations is used in its non-limiting sense to mean that items following the word are included, but items not specifically mentioned are not excluded. In addition the verb "to consist" may be replaced by "to consist essentially of" meaning that a compound or adjunct compound as defined herein may comprise additional component(s) than the ones specifically identified, said additional component(s) not altering the unique characteristic of the invention.
[0130] In addition, reference to an element by the indefinite article "a" or "an" does not exclude the possibility that more than one of the element is present, unless the context clearly requires that there be one and only one of the elements. The indefinite article "a" or "an" thus usually means "at least one".
[0131] The word "approximately" or "about" when used in association with a numerical value (approximately 10, about 10) preferably means that the value may be the given value of 10 more or less 1% of the value.
[0132] All patent and literature references cited in the present specification are hereby incorporated by reference in their entirety.
[0133] The invention is further explained in the following examples. These examples do not limit the scope of the invention, but merely serve to clarify the invention.
BRIEF DESCRIPTION OF THE DRAWINGS
[0134] FIGS. 1A-1B. Schematic Representation of Exon Skipping.
[0135] In a patient with Duchenne's muscular dystrophy who has a deletion of exon 50, an out-of-frame transcript is generated in which exon 49 is spliced to exon 51 (A). As a result, a stop codon is generated in exon 51, which prematurely aborts dystrophin synthesis. The sequence-specific binding of the exon-internal antisense oligonucleotide PRO051 interferes with the correct inclusion of exon 51 during splicing so that the exon is actually skipped (B). This restores the open reading frame of the transcript and allows the synthesis of a dystrophin similar to that in patients with Becker's muscular dystrophy (BMD).
[0136] FIGS. 2A-2E. Prescreening Studies of the Four Patients.
[0137] Magnetic resonance images of the lower legs of the four patients (the left leg of Patient 3 and right legs of the other three patients) show the adequate condition of the tibialis anterior muscle (less than 50% fat infiltration and fibrosis) (A). The diagnosis of Duchenne's muscular dystrophy in these patients was confirmed by diaminobenzidine tetrahydrochloride staining of cross sections of biopsy specimens obtained previously from the quadriceps muscle (B). No dystrophin expression was observed, with the exception of one dystrophin-positive, or revertant, fiber in Patient 2 (arrow). Reverse-transcriptase-polymerasechain-reaction (RT-PCR) analysis of the transcript region flanking the patients' mutations and exon 51 confirmed both the individual mutations in nontreated myotubes (NT) and the positive response to PRO051 (i.e., exon 51 skipping) in treated myotubes (T) on the
[0138] RNA level (Panel C). The efficiencies of exon skipping were 49% for Patient 1, 84% for Patient 2, 58% for Patient 3, and 90% for Patient 4. A cryptic splice site within exon 51 is sometimes activated by PRO051 in cell culture, resulting in an extra aberrant splicing product, as seen in the treated sample from Patient 4. Lane M shows a 100-bp size marker, and lane C RNA from healthy control muscle. Sequence analysis of the
[0139] RT-PCR fragments from treated and untreated myotubes identified the precise skipping of exon 51 for each patient (Panel D). The new in-frame transcripts led to substantial dystrophin synthesis, as detected by immunofluorescence analysis of treated myotubes with the use of monoclonal antibody NCL-DYS2 (Panel E).
[0140] No dystrophin was detected before treatment.
[0141] FIG. 3. RT-PCR Analysis of RNA Isolated from Serial Sections of Biopsy Specimens from the Patients.
[0142] After treatment with PRO051, reverse-transcriptase-polymerase-chain-reaction (RT-PCR) analysis shows novel, shorter transcript fragments for each patient. Both the size and sequence of these fragments confirm the precise skipping of exon 51. No additional splice variants were observed. At 28 days. still significant in-frame RNA transcripts were detected, suggesting prolonged persistence of PRO051 in muscle. Owing to the small amount of section material, high-sensitivity PCR conditions were used; this process precluded the accurate quantification of skipping efficiencies and the meaningful correlation between levels of RNA and protein. M denotes size marker, and C control.
[0143] FIGS. 4A-4B. Dystrophin-Restoring Effect of a Single Intramuscular Dose of PRO051.
[0144] Immunofluorescence analysis with the use of the dystrophin antibody MANDYS106 clearly shows dystrophin expression at the membranes of the majority of fibers throughout the biopsy specimen obtained from each patient (B). Western blot analysis of total protein extracts isolated from the patients' biopsy specimens with the use of NCL-DYS1 antibody show restored dystrophin expression in all patients (A).
[0145] FIG. 5. Exon 23 skipping levels on RNA level in different muscle groups (Q: quadriceps muscle; TA: tibialis anterior muscle: DIA: diaphragm muscle) in mdx mice (two mice per group) treated with PS49 alone (group 3) or with PS49 and prednisolone (group4).
[0146] FIGS. 6A-6B. In muscle cells, DMD gene exon 44 (A) or exon 45 (B) skipping levels are enhanced with increasing concentrations of pentoxyfilline (from 0 to 0.5 mg/ml).
[0147] FIG. 6C Exon 23 skipping levels on RNA level in different muscle groups (Q: quadriceps muscle; TA: tibialis anterior muscle; Tri: triceps muscle; HRT: heart muscle) in mdx mice (two mice per group) treated with PS49 alone (group 3) or with PS49 and pentoxyfilline (group_4).
[0148] FIGS. 7A-7B. Dystrophin (DMD) gene amino acid sequence
[0149] FIG. 8. Human IGF-1 Isoform 4 amino acid sequence.
[0150] FIGS. 9A-9M. Various oligonucleotides directed against the indicated exons of the dystrophin (DMD)-gene.
EXAMPLES
Example 1
[0151] In a recent clinical study the local safety, tolerability, and dystrophin-restoring effect of antisense compound PRO051 was assessed. The clinical study was recently published. The content of the publication is reproduced herein under example 1A. In brief, PRO051 is a synthetic, modified RNA molecule with sequence 5'-UCA AGG AAG AUG GCA UUU CU-3', and designed to specifically induce exon 51 skipping.sup.59. It carries full-length 2'-O-methyl substituted ribose moieties and phosphorothioate internucleotide linkages. Four DMD patients with different specific DMD gene deletions correctible by exon 51 skipping were included. At day 0, a series of safety parameters was assessed. The patient's leg (i.e. tibialis anterior muscle) was fixed with a tailor-made plastic mould and its position was carefully recorded. A topical anesthetic (EMLA) was used to numb the skin. Four injections of PRO051 were given along a line of 1.5 cm between two small skin tattoos, using a 2.5 cm electromyographic needle (MyoJect Disposable Hypodermic Needle Electrode, TECA Accessories) to ensure intramuscular delivery. Each injection volume was 200 .mu.l, containing 200 .mu.g PRO051, dispersed in equal portions at angles of approximately 30 degrees. At day 28, the same series of safety parameters was assessed again. The leg was positioned using the patient's own mould, and a semi-open muscle biopsy was taken between the tattoos under local anesthesia using a forceps with two sharp-edged jaws (Blakesley Conchotoma, DK Instruments). The biopsy was snap-frozen in liquid nitrogen-cooled 2-methylbutane. Patients were treated sequentially. At the time of study, two patients (nr. 1 and 2) were also on corticosteroids (prednisone or deflazacort), one had just stopped steroid treatment (nr. 4) and one patient never used steroids (nr. 3) (see Table 1). This latter patient was also the one who lost ambulance at the youngest age when compared to the other three patients. The biopsy was analysed, for detection of specific exon skipping on RNA level (RT-PCR analysis, not shown) and novel expression of dystrophin on protein level (immunofluorescence and western blot analyses, summarized in Table 1). Assessment of the series of safety parameters (routine plasma and urine parameters for renal and liver function, electrolyte levels, blood cell counts, hemoglobin. aPTT, AP50 and CH50 values) before and after treatment, indicated that the PRO051 compound was locally safe and well tolerated. For immunofluorescence analysis, acetone-fixed cross-sections of the biopsy were incubated for 90 minutes with monoclonal antibodies against the central rod domain (MANDYS106, Dr. G. Morris, UK, 1:60), the C-terminal domain (NCL-DYS2, Novocastra Laboratories Ltd., 1:30) or, as reference, laminin-.alpha.2 (Chemicon International, Inc, 1:150), followed by Alexa Fluor 488 goat anti-mouse IgG (H+L) (Molecular Probes, Inc, 1:250) antibody for one hour. Sections were mounted with Vectashield Mounting Medium (Vector Laboratories Inc.). For quantitative image analysis the ImageJ software (W. Rasband, NIH, USA; http://rsb.info.nih.gov/ij) was used as described.sup.60,61. Entire cross-sections were subdivided into series of 6-10 adjacent images, depending on section size. To ensure reliable measurements, staining of the sections and recording of all images was performed in one session, using fixed exposure settings, and avoiding pixel saturation. The lower intensity threshold was set at Duchenne muscular dystrophy background, and positive fluorescence was quantified for each section (area percentage), both for dystrophin and laminin-.alpha.2. Western blot analysis was performed as described.sup.1, using pooled homogenates from sets of four serial 50 .mu.m sections throughout the biopsy. For the patients 30 and 60 .mu.g total protein was applied and for the control sample 3 .mu.g. The blot was incubated overnight with dystrophin monoclonal antibody NCL-DYS1 (Novocastra Laboratories, 1:125). followed by goat anti-mouse IgG-HRP (Santa Cruz Biotechnology, 1:10.000) for one hour. Immuno-reactive bands were visualized using the ECL Plus Western Blotting Detection System (GE Healthcare) and Hyperfilm ECL (Amersham, Biosciences). Signal intensities were measured using ImageJ. Novel dystrophin protein expression at the sarcolemma was detected in the majority of muscle fibers in the treated area in all four patients. The fibers in each section were manually counted after staining for laminin-.alpha.2, a basal lamina protein unaffected by dystrophin deficiency. The individual numbers varied, consistent with the biopsy size and the quality of the patients' muscles. In the largest sections, patient 2 had 726 fibers, of which 620 were dystrophin-positive, while patient 3 had 120 fibers, of which 117 were dystrophin-positive. The dystrophin intensities were typically lower than those in a healthy muscle biopsy. Western blot analysis confirmed the presence of dystrophin in varying amounts. The dystrophin signals were scanned and correlated to the control (per .mu.g total protein). The amounts varied from 3% in patient 3 with the most dystrophic muscle, to 12% in patient 2 with the best preserved muscle. Since such comparison based on total protein does not correct for the varying amounts of fibrotic and adipose tissue in Duchenne muscular dystrophy patients, we also quantified the dystrophin fluorescence signal relative to that of the similarly-located laminin-.alpha.2 in each section, by ImageJ analysis. When this dystrophin/laminin-.alpha.2 ratio was set at 100% for the control section, the two patients that were co-treated with corticosteroids showed the highest percentages of dystrophin, 32% in patient 1 and 35% in patient 2 (Table 1). The lowest percentage of dystrophin was detected in patient 3, 17%. In patient 4 an intermediate percentage of 25% was observed. These percentages correlated to the relative quality of the target muscle, which was best in patients nr. 1 and 2, and worst in patient nr. 3.
TABLE-US-00001 TABLE 1 Patient 1 Patient 2 Patient 3 Patient 4 Age (yrs) 10 13 13 11 Age at Loss of 9 11 7 10 Ambulation (yrs) Steroid Treatment Yes Yes Never Until January 2006 Ratio Dystrophin/ 32% 35% 17% 25% laminin-alpha2
Conclusion: the effect of the PRO051 antisense compound was more prominent in those patients that were also subjected to corticosteroids.
Example 1A
[0152] Reproduced from Van Deutekom J C et al, (2007) Antisense Oligonucleotide PRO051 Restores Local Dystrophin in DMD Patients. N Engl J Med., 357(26): 2677-86.
Methods
Patients and Study Design
[0153] Patients with Duchenne's muscular dystrophy who were between the ages of 8 and 16 years were eligible to participate in the study. All patients had deletions that were correctable by exon-51 skipping and had no evidence of dystrophin on previous diagnostic muscle biopsy. Concurrent glucocorticoid treatment was allowed. Written informed consent was obtained from the patients or their parents, as appropriate. During the prescreening period (up to 60 days), each patient's mutational status and positive exon-skipping response to PRO051 in vitro were confirmed, and the condition of the tibialis anterior muscle was determined by T.sub.1-weighted magnetic resonance imaging (MRI)..sup.62 For patients to be included in the study, fibrotic and adipose tissue could make up no more than 50% of their target muscle.
[0154] During the baseline visit, safety measures were assessed. In each patient, the leg that was to be injected was fixed with a tailor-made plastic mold and its position was recorded. A topical eutectic mixture of local anesthetics (EMLA) was used to numb the skin. Four injections of PRO051 were given along a line measuring 1.5 cm running between two small skin tattoos with the use of a 2.5-cm electromyographic needle (MyoJect Disposable Hypodermic Needle Electrode, TECA Accessories) to ensure intramuscular delivery. The volume of each injection was 200 .mu.l containing 200 .mu.g of PRO051, which was dispersed in equal portions at angles of approximately 30 degrees.
[0155] At day 28, safety measures were assessed again. The leg that had been injected was positioned with the use of the patient's own mold, and a semiopen muscle biopsy was performed between the tattoos under local anesthesia with a forceps with two sharp-edged jaws (Blakesley Conchotoma, DK Instruments)..sup.63 The biopsy specimen was snap-frozen in 2-methylbutane cooled in liquid nitrogen.
[0156] Patients were treated sequentially from May 2006 through March 2007 and in compliance with Good Clinical Practice guidelines and the provisions of the Declaration of Helsinki. The study was approved by the Dutch Central Committee on Research Involving Human Subjects and by the local institutional review board at Leiden University Medical Center. All authors contributed to the study design, participated in the collection and analysis of the data. had complete and free access to the data. jointly wrote the manuscript, and vouch for the completeness and accuracy of the data and analyses presented.
Description of PRO051
[0157] PRO051 is a synthetic, modified RNA molecule with sequence 5'-UCAAGGAAGAUGGCAUUUCU-3'..sup.12 It carries full-length 2'-O-methyl-substituted ribose molecules and phosphorothioate internucleotide linkages. The drug was provided by Prosensa B.V. in vials of 1 mg of freeze-dried material with no excipient. It was dissolved and administered in sterile, unpreserved saline (0.9% sodium chloride). PRO051 was not found to be mutagenic by bacterial Ames testing. In regulatory Good Laboratory Practice safety studies, rats that received a single administration of up to 8 mg per kilogram of body weight intramuscularly and 50 mg per kilogram intravenously showed no adverse effects: monkeys receiving PRO051 for 1 month appeared to tolerate doses up to 16 mg per kilogram per week when the drug was administered by intravenous 1-hour infusion or by subcutaneous injection, without clinically relevant adverse effects.
In Vitro Prescreening
[0158] A preexisting primary myoblast culture.sup.1 was used for the prescreening of Patient 4. For the other three patients, fibroblasts were converted into myogenic cells after infection with an adenoviral vector containing the gene for the myogenic transcription factor (MyoD) as described previously..sup.1, 64, 65 Myotube cultures were transfected with PRO051 (100 nM) and polyethylenimine (2 .mu.l per microgram of PRO051), according to the manufacturer's instructions for ExGen500 (MBI Fermentas). RNA was isolated after 48 hours. Reverse transcriptase-polymerase chain reaction (RT-PCR), immunofluorescence, and Western blot analyses were performed as reported previously.sup.1,12 PCR fragments were analyzed with the use of the 2100 Bioanalyzer (Agilent) and isolated for sequencing by the Leiden Genome Technology Center.
Safety Assessment
[0159] At baseline and at 2 hours, 1 day, and 28 days after injection, all patients received a full physical examination (including the measurement of vital signs) and underwent electrocardiography. In addition, plasma and urine were obtained to determine renal and liver function, electrolyte levels, complete cell counts, the activated partial-thromboplastin time, and complement activity values in the classical (CH50) and alternative (AP50) routes. The use of concomitant medications was recorded. At baseline and on day 28, the strength of the tibialis anterior muscle was assessed with the use of the Medical Research Council scale.sup.66 to evaluate whether the procedures had affected muscle performance. (On this scale, a score of 0 indicates no movement and a score of 5 indicates normal muscle strength.) Since only a small area of the muscle was treated, clinical benefit in terms of increased muscle strength was not expected. At each visit, adverse events were recorded.
RNA Assessment
[0160] Serial sections (50 .mu.m) of the frozen muscle-biopsy specimen were homogenized in RNA-Bee solution (Campro Scientific) and MagNA Lyser Green Beads (Roche Diagnostics). Total RNA was isolated and purified according to the manufacturer's instructions. For complementary DNA, synthesis was accomplished with Transcriptor reverse transcriptase (Roche Diagnostics) with the use of 500 ng of RNA in a 20-.mu.l reaction at 55.degree. C. for 30 minutes with human exon 53 or 54 specific reverse primers. PCR analyses were performed as described previously..sup.1,12 Products were analyzed on 2% agarose gels and sequenced. In addition, RT-PCR with the use of a primer set for the protein-truncation test.sup.67 was used to rapidly screen for a specific aberrant splicing events throughout the DMD gene.
Assessment of Protein Level
[0161] For immunofluorescence analysis, acetone-fixed sections were incubated for 90 minutes with monoclonal antibodies against the central rod domain (MANDYS106, Dr. G. Morris, United Kingdom) at a dilution of 1:60, the C-terminal domain (NCL-DYS2, Novocastra Laboratories) at a dilution of 1:30, or (as a reference) laminin .alpha.2 (Chemicon International), a basal lamina protein that is unaffected by dystrophin deficiency, at a dilution of 1:150, followed by Alexa Fluor 488 goat antimouse IgG (H+L) antibody (Molecular Probes) at a dilution of 1:250 for 1 hour. Sections were mounted with Vectashield Mounting Medium (Vector Laboratories). ImageJ software (W. Rasband, National Institutes of Health, http://rsb.info.nih.gov/ij) was used for quantitative image analysis as described previously..sup.60,61 Entire cross sections were subdivided into series of 6 to 10 adjacent images, depending on the size of the section. To ensure reliable measurements, staining of the sections and recording of all images were performed during one session with the use of fixed exposure settings and the avoidance of pixel saturation. The lower-intensity threshold was set at background for Duchenne's muscular dystrophy, and positive fluorescence was quantified for each section (area percentage), both for dystrophin and laminin .alpha.2.
[0162] Western blot analysis was performed as described previously.sup.1 with the use of pooled homogenates from sets of four serial 50-.mu.m sections throughout the biopsy specimen. For each patient, two amounts of total protein--30 .mu.g and 60 .mu.g--were applied, and for the control sample, 3 .mu.g. The Western blot was incubated overnight with dystrophin monoclonal antibody NCL-DYS1 (Novocastra Laboratories) at a dilution of 1:125, followed by horseradish-peroxidase-labeled goat antimouse IgG (Santa Cruz Biotechnology) at a dilution of 1:10,000 for 1 hour. Immunoreactive bands were visualized with the use of the ECL Plus Western blotting detection system (GE Healthcare) and Hyperfilm ECL (Amersham Biosciences). Signal intensities were measured with the use of ImageJ software.
Results
Prescreening of Patients
[0163] The study was planned to include four to six patients. Six patients were invited to participate, and one declined. The remaining five patients were prescreened. First, the condition of the tibialis anterior muscle was evaluated on MRI. The muscle condition of four patients was deemed to be adequate for the study (FIG. 2B), and the absence of dystrophin was confirmed in the patients' original biopsy specimens (FIG. 2B). Second, the mutational status and positive exon-skipping response to PRO051 of these four patients were confirmed in fibroblast cultures. PRO051 treatment generated a novel, shorter fragment of messenger RNA for each patient, representing 46% (in Patient 4) to 90% (in Patient 1) of the total RT-PCR product (FIG. 2C). Precise exon-51 skipping was confirmed by sequencing (FIG. 2D). No other transcript regions were found to be altered. Immunofluorescence analyses showed a preponderance of dystrophin-positive myotubes (FIG. 2E), a finding that was confirmed by Western blot analysis (not shown). Thus, the four patients were judged to be eligible for PRO051 treatment. Their baseline characteristics are shown in Table 2.
Safety and Adverse Events
[0164] All patients had one or more adverse events. However, only one patient reported mild local pain at the injection site, which was considered to be an adverse event related to the study drug. Other events included mild-to-moderate pain after the muscle biopsy. Two patients had blistering under the bandages used for wound closure. In the period between injection and biopsy, two patients reported a few days of flulike symptoms, and one patient had mild diarrhea for 1 day. At baseline, the muscle-strength scores of the treated tibialis anterior muscle in Patients 1, 2, 3, and 4 were 4, 2, 3, and 4, respectively, on the Medical Research Council scale. None of the patients showed changes in the strength of this muscle during the study or significant alterations in standard laboratory measures or increased measures of complement split products or activated partial-thromboplastin time. No local inflammatory or toxic response was detected in the muscle sections of the patients (data not shown). Patient 3 successfully underwent preplanned surgery for scoliosis in the month after the study was completed.
RNA and Protein Level
[0165] At day 28, a biopsy of the treated area was performed in each patient. Total muscle RNA was isolated from serial sections throughout the biopsy specimen. In all patients, RT-PCR identified a novel, shorter fragment caused by exon-51 skipping, as confirmed by sequencing (FIG. 3). Further transcript analysis showed no other alterations (data not shown). Immunofluorescence analyses of sections throughout the biopsy specimen of each patient showed clear sarcolemmal dystrophin signals in the majority of muscle fibers (FIGS. 4A and 4B). Dystrophin antibodies proximal and distal to the deletions that were used included MANDYS106 (FIGS. 4A and 4B) and NCL-DYS2 (similar to MANDYS106, not shown). The fibers in each section were manually counted after staining for laminin .alpha.2..sup.68 The individual numbers varied, consistent with the size of the biopsy specimen and the quality of the muscle. In the largest sections, Patient 2 had 726 fibers, of which 620 were dystrophin-positive, whereas Patient 3 had 120 fibers, of which 117 were dystrophin-positive (Data not shown). The dystrophin intensities were typically lower than those in a healthy muscle biopsy specimen (Data not shown). The single fibers with a more intense dystrophin signal in Patients 2 and 3 could well be revertant fibers (Data not shown).
[0166] Western blot analysis confirmed the presence of dystrophin in varying amounts (FIG. 4A). The dystrophin signals were scanned and correlated to the control (per microgram of total protein). The amounts varied from 3% in Patient 3, who had the most-dystrophic muscle, to 12% in Patient 2, who had the best-preserved muscle. Since such comparison on the basis of total protein does not correct for the varying amounts of fibrotic and adipose tissue in patients with Duchenne's muscular dystrophy, we also quantified the dystrophin fluorescence signal (Data not shown) relative to that of the similarly located laminin .alpha.2 in each section by ImageJ analysis. When the ratio of dystrophin to laminin .alpha.2 was set at 100 for the control section, Patients 1, 2, 3, and 4 had ratios of 33, 35, 17, and 25, respectively (Table 1).
Discussion
[0167] Our study showed that local intramuscular injection of PRO051, a 2OMePS antisense oligoribonucleotide complementary to a 20-nucleotide sequence within exon 51, induced exon-51 skipping, corrected the reading frame, and thus introduced dystrophin in the muscle in all four patients with Duchenne's muscular dystrophy who received therapy. Dystrophin-positive fibers were found throughout the patients' biopsy specimens, indicating dispersion of the compound in the injected area Since no delivery-enhancing excipient was used, PRO051 uptake did not seem to be a major potentially limiting factor. We cannot rule out that increased permeability of the dystrophic fiber membrane had a favorable effect. The patients produced levels of dystrophin that were 3 to 12% of the level in healthy control muscle, as shown on Western blot analysis of total protein. Since the presence of fibrosis and fat may lead to some underestimation of dystrophin in total protein extracts, we determined the ratio of dystrophin to laminin .alpha.2 in the cross sections, which ranged from 17 to 35, as compared with 100 in control muscle. The dystrophin-restoring effect of PRO051 was limited to the treated area, and no strength improvement of the entire muscle was observed. Future systemic treatment will require repeated administration to increase and maintain dystrophin expression at a higher level and to obtain clinical efficacy.
[0168] Because of medical-ethics regulations regarding interventions in minors, we could not obtain a biopsy specimen from the patients' contralateral muscles that had not been injected. However, the patients showed less than 1% of revertant fibers in the original diagnostic biopsy specimens obtained 5 to 9 years before the initiation of the study (Table 2 and FIG. 2B). We consider it very likely that the effects we observed were related to the nature and sequence of the PRO051 reagent rather than to a marked increase in revertant fibers. Indeed, a single, possibly revertant fiber that had an increased dystrophin signal was observed in both Patient 2 and Patient 3 (FIG. 4B).
[0169] In summary, our study showed that local administration of PRO051 to muscle in four patients with Duchenne's muscular dystrophy restored dystrophin to levels ranging from 3 to 12% or 17 to 35%, depending on quantification relative to total protein or myofiber content. Consistent with the distinctly localized nature of the treatment, functional improvement was not observed. The consistently poorer result in Patient 3, who had the most advanced disease, suggests the importance of performing clinical trials in patients at a relatively young age, when relatively little muscle tissue has been replaced by fibrotic and adipose tissue. Our findings provide an indication that antisense-mediated exon skipping may be a potential approach to restoring dystrophin synthesis in the muscles of patients with Duchenne's muscular dystrophy.
Example 2
[0170] In a pre-clinical study in mdx mice (animal model for DMD) the effect of adjunct compound prednisone on AON-induced exon skipping was assessed.
[0171] Mdx mice (C57Bl/10ScSn-mdx/J) were obtained from Charles River Laboratories (The Netherlands). These mice are dystrophin-deficient due to a nonsense mutation in exon 23. AON-induced exon 23 skipping is therapeutic in mdx mice by removing the nonsense mutation and correction of the open reading frame. Two mdx mice per group were injected subcutaneously with: Group 1) physiologic salt (wk 1-8). Group 2) prednisolone (1 mg/kg, wk 1-8), Group 3) mouse-specific antisense oligonucleotide PS49 designed to specifically induce exon 23 skipping (100 mg/kg, wk 4 (5 times), week 5-8 (2 times), Group 4) prednisolone (1 mg/kg. wk 1-8)+PS49 (100 mg/kg, wk 4 (5 times), week 5-8 (2 times). PS49 (5' GGCCAAACCUCGGCUUACCU 3') has a full-length phosphorothioate backbone and 2'O-methyl modified ribose molecules.
[0172] All mice were sacrificed at 1 week post-last-injection. Different muscles groups, including quadriceps, tibialis anterior, and diaphragm muscles were isolated and frozen in liquid nitrogen-cooled 2-methylbutane. For RT-PCR analysis, the muscle samples were homogenized in the RNA-Bee solution (Campro Scientific, The Netherlands). Total RNA was isolated and purified according to the manufacturer's instructions. For cDNA synthesis with reverse transcriptase (Roche Diagnostics. The Netherlands), 300 ng of RNA was used in a 20 .mu.l reaction at 55.degree. C. for 30 min, reverse primed with mouse DMD gene-specific primers. First PCRs were performed with outer primer sets, for 20 cycles of 94.degree. C. (40 sec), 60.degree. C. (40 sec), and 72.degree. C. (60 sec). One .mu.l of this reaction (diluted 1:10) was then re-amplified using nested primer combinations in the exons directly flanking exon 23, with 30 cycles of 94.degree. C. (40 sec), 60.degree. C. (40 sec), and 72.degree. C. (60 sec). PCR products were analysed on 2% agarose gels. Skipping efficiencies were determined by quantification of PCR products using the DNA 1000 LabChip.RTM. Kit and the Agilent 2100 bioanalyzer (Agilent Technologies, The Netherlands). No exon 23 skipping was observed in the muscles from mice treated with physiologic salt or prenisolone only (groups 1 and 2). Levels of exon 23 skipping were detected and per muscle group compared between mice treated with PS49 only (group 3) and mice treated with PS49 and adjunct compound prednisolone (group 4). In the quadriceps (Q), tibialis anterior (TA), and diaphragm (DIA) muscles, exon 23 skipping levels were typically higher in group 4 when compared to group 3 (FIG. 5). This indicates that adjunct compound prednisolone indeed enhances exon 23 skipping levels in mdx mice treated with PS49.
Example 3
A., B
[0173] Differentiated muscle cell cultures (myotubes) derived from a healthy control individual were transfected with 250 nM PS188 ([5' UCAGCUUCUGUUAGCCACUG 3'; SEQ ID NO: 10] an AON optimized to specifically skip exon 44) or 250 nM PS221 ([5' AUUCAAUGUUCUGACAACAGUUUGC 3': SEQ ID NO: 60] an AON optimized to specifically skip exon 45) in the presence of 0 to 0.5 mg/ml pentoxifylline, using the transfection reagent polymer UNIFectylin (2.0 .mu.l UNIFectylin per .mu.g AON in 0.15M NaCl). UNIFectylin interacts electrostatically with nucleic acids, provided that the nucleic acid is negatively charged (such as 2'-O-methyl phosphorothioate AONs). Pentoxyfillin (Sigma Aldrich) was dissolved in water. Total RNA was isolated 24 hrs after transfection in RNA-Bee solution (Campro Scientific, The Netherlands) according to the manufacturer's instructions. For cDNA synthesis with reverse transcriptase (Roche Diagnostics, The Netherlands), 500 ng of RNA was used in a 20 .mu.l reaction at 55.degree. C. for 30 min, reverse primed with DMD gene-specific primers. First PCRs were performed with outer primer sets, for 20 cycles of 94.degree. C. (40 sec), 60.degree. C. (40 sec), and 72.degree. C. (60 sec). One pd of this reaction (diluted 1:10) was then re-amplified using nested primer combinations in the exons directly flanking exon 44 or 45, with 30 cycles of 94.degree. C. (40 sec), 60.degree. C. (40 sec), and 72.degree. C. (60 sec). PCR products were analysed on 2% agarose gels. Skipping efficiencies were determined by quantification of PCR products using the DNA 1000 LabChip.RTM. Kit and the Agilent 2100 bioanalyzer (Agilent Technologies, The Netherlands).
[0174] Both with PS188 and PS221, increasing levels of exon 44 or 45 skipping were obtained with increasing concentrations of the adjunct compound pentoxifylline when compared to those obtained in cells that were not co-treated with pentoxyfilline (see FIG. 6). These results indicate that pentoxifylline enhances exon skipping levels in the muscle cells.
C
[0175] In a pre-clinical study in mdx mice (animal model for DMD) the effect of adjunct compound pentoxyfilline on AON-induced exon skipping was assessed. Mdx mice (C57Bl/10ScSn-mdx/J) were obtained from Charles River Laboratories (The Netherlands). These mice are dystrophin-deficient due to a nonsense mutation in exon 23. AON-induced exon 23 skipping is therapeutic in mdx mice by removing the nonsense mutation and correction of the open reading frame. Two mdx mice per group were injected subcutaneously with: Group 1) pentoxyfilline (50 mg/kg, wk 1-2). Group 2) mouse-specific antisense oligonucleotide PS49 designed to specifically induce exon 23 skipping (100 mg/kg. wk 2 (2 times), Group 3) pentoxyfilline (50 mg/kg, wk 1-2)+PS49 (100 mg/kg, wk 2 (2 times). PS49 (5' GGCCAAACCUCGGCUUACCU 3') has a full-length phosphorothioate backbone and 2'O-methyl modified ribose molecules.
[0176] All mice were sacrificed at 1 week post-last-injection. Different muscles groups, including quadriceps, tibialis anterior, triceps and heart muscles were isolated and frozen in liquid nitrogen-cooled 2-methylbutane. For RT-PCR analysis, the muscle samples were homogenized in the RNA-Bee solution (Campro Scientific, The Netherlands). Total RNA was isolated and purified according to the manufacturer's instructions. For cDNA synthesis with reverse transcriptase (Roche Diagnostics, The Netherlands), 300 ng of RNA was used in a 20 .mu.l reaction at 55.degree. C. for 30 min, reverse primed with mouse DMD gene-specific primers. First PCRs were performed with outer primer sets, for 20 cycles of 94.degree. C. (40 sec), 60.degree. C. (40 sec), and 72.degree. C. (60 sec). One .mu.l of this reaction (diluted 1:10) was then re-amplified using nested primer combinations in the exons directly flanking exon 23, with 30 cycles of 94.degree. C. (40 sec), 60.degree. C. (40 sec), and 72.degree. C. (60 sec). PCR products were analysed on 2% agarose gels. Skipping efficiencies were determined by quantification of PCR products using the DNA 1000 LabChip.RTM. Kit and the Agilent 2100 bioanalyzer (Agilent Technologies, The Netherlands). No exon 23 skipping was observed in the muscles from mice treated with pentoxyfilline only (groups 1). Levels of exon 23 skipping were detected and per muscle group compared between mice treated with PS49 only (group 2) and mice treated with PS49 and adjunct compound pentoxyfilline (group 3). In the quadriceps (Q), tibialis anterior (TA), triceps (Tri) and heart (HRT) muscles, exon 23 skipping levels were typically higher in group 3 when compared to group 2 (FIG. 6c). This indicates that adjunct compound pentoxyfilline indeed enhances exon 23 skipping levels in mdx mice treated with PS49.
TABLE-US-00002 TABLE 2 Baseline characteristics of the DMD patients Patient 1 Patient 2 Patient 3 Patient 4 Age (yrs) 10 13 13 11 Deletion Exon 50 Exons 48-50 Exons 49-50 Exon 52 Age at Loss of Ambulation (yrs) 9 11 7 10 Scoliosis No No Yes Yes Creatine Kinase Levels (U/l).sup.1 5823 2531 717 4711 Steroid treatment Yes Yes Never Until January 2006 Strength TA muscle (MRC scale) 4 2 3 4 MRI status TA muscle Moderate.sup.2 Moderate.sup.2 Moderate.sup.2 Moderate.sup.2 % Revertant fibers N.D. <1% N.D. .sup.1normal level: <200 U/l .sup.2less than 50% fat infiltration and/or fibrosis [Mercuri et al., 2005)
REFERENCES
[0177] 1. Aartsma-Rus A. Janson A A, Kaman W E, et al. Therapeutic antisense-induced exon skipping in cultured muscle cells from six different DMD patients. Hum Mol Genet 2003; 12(8):907-14.
[0178] 2. Aartsma-Rus A, Janson A A, Kaman W E, et al. Antisense-induced multiexon skipping for Duchenne muscular dystrophy makes more sense. Am J Hum Genet 2004; 74(1):83-92.
[0179] 3. Alter J, Lou F, Rabinowitz A, et al. Systemic delivery of morpholino oligonucleotide restores dystrophin expression bodywide and improves dystrophic pathology. Nat Med 2006; 12(2):175-7.
[0180] 4. Goyenvalle A, Vulin A, Fougerousse F. et al. Rescue of dystrophic muscle through U7 snRNA-mediated exon skipping. Science 2004; 306(5702):1796-9.
[0181] 5. Lu Q L, Mann C J, Lou F, et al. Functional amounts of dystrophin produced by skipping the mutated exon in the mdx dystrophic mouse. Nat Med 2003; 6:6.
[0182] 6. Lu Q L, Rabinowitz A, Chen Y C, et al. Systemic delivery of antisense oligoribonucleotide restores dystrophin expression in body-wide skeletal muscles. Proc Natl Acad Sci USA 2005; 102(1):198-203.
[0183] 7. McClorey G, Fall A M, Moulton H M, et al. Induced dystrophin exon skipping in human muscle explants. Neuromuscul Disord 2006; 16(9-10):583-90.
[0184] 8. McClorey G, Moulton H M, Iversen P L, et al. Antisense oligonucleotide-induced exon skipping restores dystrophin expression in vitro in a canine model of DMD. Gene Ther 2006; 13(19):1373-81.
[0185] 9. Pramono Z A, Takeshima Y. Alimsardjono H. Ishii A. Takeda S, Matsuo M. Induction of exon skipping of the dystrophin transcript in lymphoblastoid cells by transfecting an antisense oligodeoxynucleotide complementary to an exon recognition sequence. Biochem Biophys Res Commun 1996; 226(2):445-9.
[0186] 10. Takeshima Y, Yagi M, Wada H. et al. Intravenous infusion of an antisense oligonucleotide results in exon skipping in muscle dystrophin mRNA of Duchenne muscular dystrophy. Pediatr Res 2006; 59(5):690-4.
[0187] 11. van Deutekom J C, Bremmer-Bout M, Janson A A, et al. Antisense-induced exon skipping restores dystrophin expression in DMD patient derived muscle cells. Hum Mol Genet 2001; 10(15):1547-54.
[0188] 12. Aartsma-Rus A, Bremmer-Bout M, Janson A. den Dunnen J, van Ommen G, van Deutekom J. Targeted exon skipping as a potential gene correction therapy for Duchenne muscular dystrophy. Neuromuscul Disord 2002; 12 Suppl:S71-S77.
[0189] 13. Aartsma-Rus A, De Winter C L, Janson A A. et al. Functional analysis of 114 exon-internal AONs for targeted DMD exon skipping: indication for steric hindrance of S R protein binding sites. Oligonucleotides 2005; 15(4):284-97.
[0190] 14. Aartsma-Rus A. Janson A A, Heemskerk J A, C L de Winter, G J Van Ommen, J C Van Deutekom. Therapeutic Modulation of DMD Splicing by Blocking Exonic Splicing Enhancer Sites with Antisense Oligonucleotides. Annals of the New York Academy of Sciences 2006; 1082:74-6.
[0191] 15. Aartsma-Rus A. Kaman W E, Weij R. den Dunnen J T, van Ommen G J, van Deutekom J C. Exploring the frontiers of therapeutic exon skipping for Duchenne muscular dystrophy by double targeting within one or multiple exons. Mol Ther 2006; 14(3):401-7.
[0192] 16. Welch E M, Barton E R, Zhuo J, et al. PTC124 targets genetic disorders caused by nonsense mutations. Nature 2007; 447(7140):87-91.
[0193] 17. Hirawat S, Welch E M, Elfring G L, et al. Safety, tolerability, and pharmacokinetics of PTC124, a nonaminoglycoside nonsense mutation suppressor, following single- and multiple-dose administration to healthy male and female adult volunteers. Journal of clinical pharmacology 2007; 47(4):430-44.
[0194] 18. Wang B, Li J, Xiao X. Adeno-associated virus vector carrying human minidystrophin genes effectively ameliorates muscular dystrophy in mdx mouse model. Proc Natl Acad Sci USA 2000; 97(25):13714-9.
[0195] 19. Fabb S A, Wells D J, Serpente P. Dickson G. Adeno-associated virus vector gene transfer and sarcolemmal expression of a 144 kDa micro-dystrophin effectively restores the dystrophin-associated protein complex and inhibits myofibre degeneration in nude/mdx mice. Hum Mol Genet 2002; 11(7):733-41.
[0196] 20. Wang Z, Kuhr C S. Allen J M, et al. Sustained AAV-mediated dystrophin expression in a canine model of Duchenne muscular dystrophy with a brief course of immunosuppression. Mol Ther 2007; 15(6):1160-6.
[0197] 21. Manzur A Y, Kuntzer T, Pike M, Swan A. Glucocorticoid corticosteroids for Duchenne muscular dystrophy. Cochrane Database Syst Rev 2004; 2.
[0198] 22. Duboc D. Meune C, Pierre B. et al. Perindopril preventive treatment on mortality in Duchenne muscular dystrophy: 10 years' follow-up. American heart journal 2007; 154(3):596-602.
[0199] 23. Cohn R D, van Erp C, Habashi J P, et al. Angiotensin II type 1 receptor blockade attenuates TGF-beta-induced failure of muscle regeneration in multiple myopathic states. Nat Med 2007; 13(2):204-10.
[0200] 24. Grounds M D, Torrisi J. Anti-TNFalpha (Remicade) therapy protects dystrophic skeletal muscle from necrosis. Faseb J 2004; 18(6):676-82.
[0201] 25. Hodgetts S, Radley H, Davies M, Grounds M D. Reduced necrosis of dystrophic muscle by depletion of host neutrophils, or blocking TNFalpha function with Etanercept in mdx mice. Neuromuscul Disord 2006; 16(9-10):591-602.
[0202] 26. Pierno S, Nico B, Burdi R, et al. Role of tumour necrosis factor alpha. but not of cyclo-oxygenase-2-derived eicosanoids, on functional and morphological indices of dystrophic progression in mdx mice: a pharmacological approach. Neuropathology and applied neurobiology 2007; 33(3):344-59.
[0203] 27. Musaro A, McCullagh K, Paul A. et al. Localized Igf-1 transgene expression sustains hypertrophy and regeneration in senescent skeletal muscle. Nat Genet 2001; 27(2):195-200.
[0204] 28. Barton E R, Morris L, Musaro A. Rosenthal N, Sweeney H L. Muscle-specific expression of insulin-like growth factor I counters muscle decline in mdx mice. J Cell Biol 2002; 157(1): 137-48.
[0205] 29. Disatnik M H, Dhawan J, Yu Y, et al. Evidence of oxidative stress in mdx mouse muscle: studies of the pre-necrotic state. J Neurol Sci 1998; 161(1):77-84.
[0206] 30. Nelson S K, Bose S K, Grunwald G K, Myhill P, McCord J M. The induction of human superoxide dismutase and catalase in vivo: a fundamentally new approach to antioxidant therapy. Free radical biology & medicine 2006; 40(2):341-7.
[0207] 31. Hart P E, Lodi R, Rajagopalan B, et al. Antioxidant treatment of patients with Friedreich ataxia: four-year follow-up. Archives of neurology 2005; 62(4):621-6.
[0208] 32. Rolland J F, De Luca A, Burdi R. Andreetta F, Confalonieri P. Conte Camerino D. Overactivity of exercise-sensitive cation channels and their impaired modulation by IGF-1 in mdx native muscle fibers: beneficial effect of pentoxifylline. Neurobiol Dis 2006; 24(3):466-74.
[0209] 33. Whitehead N P, Streamer M. Lusambili L I, Sachs F, Allen D G. Streptomycin reduces stretch-induced membrane permeability in muscles from mdx mice. Neuromuscul Disord 2006; 16(12):845-54.
[0210] 34. Badalamente M A, Stracher A. Delay of muscle degeneration and necrosis in mdx mice by calpain inhibition. Muscle Nerve 2000; 23(1):106-11.
[0211] 35. Burdi R, Didonna M P, Pignol B, et al. First evaluation of the potential effectiveness in muscular dystrophy of a novel chimeric compound, BN 82270, acting as calpain-inhibitor and anti-oxidant. Neuromuscul Disord 2006; 16(4):237-48.
[0212] 36. Bonuccelli G, Sotgia F, Schubert W, et al. Proteasome inhibitor (MG-132) treatment of mdx mice rescues the expression and membrane localization of dystrophin and dystrophin-associated proteins. Am J Pathol 2003; 163(4):1663-75.
[0213] 37. Voisin V. Sebrie C, Matecki S, et al. L-arginine improves dystrophic phenotype in mdx mice. Neurobiol Dis 2005; 20(1):123-30.
[0214] 38. Soret J, Bakkour N, Maire S. et al. Selective modification of alternative splicing by indole derivatives that target serine-arginine-rich protein splicing factors. Proc Natl Acad Sci USA 2005; 102(24):8764-9.
[0215] 39. Mann C J, Honeyman K, McClorey G, Fletcher S, Wilton S D. Improved antisense oligonucleotide induced exon skipping in the mdx mouse model of muscular dystrophy. J Gene Med 2002; 4(6):644-54.
[0216] 40. Graham I R, Hill V J, Manoharan M, Inamati G B, Dickson G. Towards a therapeutic inhibition of dystrophin exon 23 splicing in mdx mouse muscle induced by antisense oligoribonucleotides (splicomers): target sequence optimisation using oligonucleotide arrays. J Gene Med 2004; 6(10):1149-58.
[0217] 41. Mathews D H, Sabina J, Zuker M, Turner D H. Expanded sequence dependence of thermodynamic parameters improves prediction of RNA secondary structure. J Mol Biol 1999; 288(5):911-40.
[0218] 42. Cartegni L, Chew S L, Krainer A R. Listening to silence and understanding nonsense: exonic mutations that affect splicing. Nat Rev Genet 2002; 3(4):285-98.
[0219] 43. Cartegni L, Wang J, Zhu Z, Zhang M Q, Krainer A R. ESEfinder: A web resource to identify exonic splicing enhancers. Nucleic Acids Res 2003; 31(13):3568-71.
[0220] 44. Braasch D A, Corey D R. Locked nucleic acid (LNA): fine-tuning the recognition of DNA and RNA. Chem Biol 2001; 8(1):1-7.
[0221] 45. Braasch D A, Corey D R. Novel antisense and peptide nucleic acid strategies for controlling gene expression. Biochemistry 2002; 41(14):4503-10.
[0222] 46. Elayadi A N, Corey D R. Application of PNA and LNA oligomers to chemotherapy. Curr Opin Investig Drugs 2001; 2(4):558-61.
[0223] 47. Larsen H J, Bentin T, Nielsen P E. Antisense properties of peptide nucleic acid. Biochim Biophys Acta 1999; 1489(1):159-66.
[0224] 48. Summerton J. Morpholino antisense oligomers: the case for an RNase H-independent structural type. Biochim Biophys Acta 1999; 1489(1): 141-58.
[0225] 49. Summerton J, Weller D. Morpholino antisense oligomers: design, preparation, and properties. Antisense Nucleic Acid Drug Dev 1997; 7(3):187-95.
[0226] 50. Wahlestedt C. Salmi P, Good L, et al. Potent and nontoxic antisense oligonucleotides containing locked nucleic acids. Proc Natl Acad Sci USA 2000; 97(10):5633-8.
[0227] 51. De Angelis F G, Sthandier O. Berarducci B, et al. Chimeric snRNA molecules carrying antisense sequences against the splice junctions of exon 51 of the dystrophin pre-mRNA induce exon skipping and restoration of a dystrophin synthesis in Delta 48-50 DMD cells. Proc Natl Acad Sci USA 2002; 99(14):9456-61.
[0228] 52. Denti M A, Rosa A, D'Antona G, et al. Chimeric adeno-associated virus/antisense U1 small nuclear RNA effectively rescues dystrophin synthesis and muscle function by local treatment of mdx mice. Hum Gene Ther 2006; 17(5):565-74.
[0229] 53. Gorman L, Suter D, Emerick V, Schumperli D, Kole R. Stable alteration of pre-mRNA splicing patterns by modified U7 small nuclear RNAs. Proc Natl Acad Sci USA 1998; 95(9):4929-34.
[0230] 54. Suter D, Tomasini R, Reber U, Gorman L, Kole R, Schumperli D. Double-target antisense U7 snRNAs promote efficient skipping of an aberrant exon in three human beta-thalassemic mutations. Hum Mol Genet 1999; 8(13):2415-23.
[0231] 55. Wagner K R, Hamed S, Hadley D W. et al. Gentamicin treatment of Duchenne and Becker muscular dystrophy due to nonsense mutations. Ann Neurol 2001; 49(6):706-11.
[0232] 56. Aartsma-Rus A et al, (2006). Entries in the leiden Duchenne Muscular Dystrophy mutation database: an overview of mutation types and paradoxical cases that confirm the reading-frame rule, Muscle Nerve, 34: 135-144.
[0233] 57. Hodgetts S., et al, (2006), Neuromuscular Disorders, 16: 591-602.
[0234] 58. Manzur A Y et al, (2008), Glucocorticoid corticosteroids for Duchenne muscular dystrophy (review), Wiley publishers, The Cochrane collaboration.
[0235] 59. Van Deutekom J C et al, (2007) Antisense Oligonucleotide PRO051 Restores Local Dystrophin in DMD Patients. N Engl J Med., 357(26): 2677-86.
[0236] 60. Yuan H. Takeuchi E. Taylor G A, McLaughlin M, Brown D, Salant D J. Nephrin dissociates from actin, and its expression is reduced in early experimental membranous nephropathy. J Am Soc Nephrol 2002; 13:946-56.
[0237] 61. Koop K, Bakker R C, Eikmans M, et al. Differentiation between chronic rejection and chronic cyclosporine toxity by analysis of renal cortical mRNA. Kindney Int 2004; 66:2038-46.
[0238] 62. Mercuri E, Bushby K, Ricci e., et al. Muscle MRI findings in patients with limb girdle muscular dystrophy with calpain 3 deficiency (LGMD2A) and early contractures. Neuromuscul Disord 2005; 15:164-71.
[0239] 63. Dorph C, Nennesmo I, Lundberg I E. Percutaneous conchotome muscle biopsy: a useful diagnostic and assessment tool. J Rheumatol 2001; 28:1591-9.
[0240] 64. Havenga M J, Lemckert A A, Ophorst O J, et al. Exploiting the natural diversity in adenovirus tropism for therapy and prevention of disease. J Virol 2002; 76:4612-20.
[0241] 65. Roest P A, van der Tuijn A C, Ginjaar H B, et al. Application of in vitro Myo-differentation of non-muscle cells to enhance gene expression and facilitate analysis of muscle proteins. Neuromuscul Disord 1996; 6:195-202.
[0242] 66. John J. Grading of muscular power: comparison of MRC and analogue scales by physiotherapists. Int J Rehabil Res 1984; 7:173-81.
[0243] 67. Roest P A. Roberts R G, van der Tuijn A C, Heikoop J C, van Ommen G J, den Dunnen J T. Protein truncation test (PTT) to rapidly screen the DMD gene for translation terminating mutations. Neuromuscul Disord 1993; 3:391-4.
[0244] 68. Cullen M J, Walsh J, Roberds S L, Campbell K P. Ultrastructural localization of adhalin, alpha-dystroglycan and merosin in normal and dystrophic muscle. Neuropathol Appl Neurobiol 1996; 22:30-7.
Sequence CWU
1
1
31413685PRTHomo sapiens 1Met Leu Trp Trp Glu Glu Val Glu Asp Cys Tyr Glu
Arg Glu Asp Val 1 5 10
15 Gln Lys Lys Thr Phe Thr Lys Trp Val Asn Ala Gln Phe Ser Lys Phe
20 25 30 Gly Lys Gln
His Ile Glu Asn Leu Phe Ser Asp Leu Gln Asp Gly Arg 35
40 45 Arg Leu Leu Asp Leu Leu Glu Gly
Leu Thr Gly Gln Lys Leu Pro Lys 50 55
60 Glu Lys Gly Ser Thr Arg Val His Ala Leu Asn Asn Val
Asn Lys Ala 65 70 75
80 Leu Arg Val Leu Gln Asn Asn Asn Val Asp Leu Val Asn Ile Gly Ser
85 90 95 Thr Asp Ile Val
Asp Gly Asn His Lys Leu Thr Leu Gly Leu Ile Trp 100
105 110 Asn Ile Ile Leu His Trp Gln Val Lys
Asn Val Met Lys Asn Ile Met 115 120
125 Ala Gly Leu Gln Gln Thr Asn Ser Glu Lys Ile Leu Leu Ser
Trp Val 130 135 140
Arg Gln Ser Thr Arg Asn Tyr Pro Gln Val Asn Val Ile Asn Phe Thr 145
150 155 160 Thr Ser Trp Ser Asp
Gly Leu Ala Leu Asn Ala Leu Ile His Ser His 165
170 175 Arg Pro Asp Leu Phe Asp Trp Asn Ser Val
Val Cys Gln Gln Ser Ala 180 185
190 Thr Gln Arg Leu Glu His Ala Phe Asn Ile Ala Arg Tyr Gln Leu
Gly 195 200 205 Ile
Glu Lys Leu Leu Asp Pro Glu Asp Val Asp Thr Thr Tyr Pro Asp 210
215 220 Lys Lys Ser Ile Leu Met
Tyr Ile Thr Ser Leu Phe Gln Val Leu Pro 225 230
235 240 Gln Gln Val Ser Ile Glu Ala Ile Gln Glu Val
Glu Met Leu Pro Arg 245 250
255 Pro Pro Lys Val Thr Lys Glu Glu His Phe Gln Leu His His Gln Met
260 265 270 His Tyr
Ser Gln Gln Ile Thr Val Ser Leu Ala Gln Gly Tyr Glu Arg 275
280 285 Thr Ser Ser Pro Lys Pro Arg
Phe Lys Ser Tyr Ala Tyr Thr Gln Ala 290 295
300 Ala Tyr Val Thr Thr Ser Asp Pro Thr Arg Ser Pro
Phe Pro Ser Gln 305 310 315
320 His Leu Glu Ala Pro Glu Asp Lys Ser Phe Gly Ser Ser Leu Met Glu
325 330 335 Ser Glu Val
Asn Leu Asp Arg Tyr Gln Thr Ala Leu Glu Glu Val Leu 340
345 350 Ser Trp Leu Leu Ser Ala Glu Asp
Thr Leu Gln Ala Gln Gly Glu Ile 355 360
365 Ser Asn Asp Val Glu Val Val Lys Asp Gln Phe His Thr
His Glu Gly 370 375 380
Tyr Met Met Asp Leu Thr Ala His Gln Gly Arg Val Gly Asn Ile Leu 385
390 395 400 Gln Leu Gly Ser
Lys Leu Ile Gly Thr Gly Lys Leu Ser Glu Asp Glu 405
410 415 Glu Thr Glu Val Gln Glu Gln Met Asn
Leu Leu Asn Ser Arg Trp Glu 420 425
430 Cys Leu Arg Val Ala Ser Met Glu Lys Gln Ser Asn Leu His
Arg Val 435 440 445
Leu Met Asp Leu Gln Asn Gln Lys Leu Lys Glu Leu Asn Asp Trp Leu 450
455 460 Thr Lys Thr Glu Glu
Arg Thr Arg Lys Met Glu Glu Glu Pro Leu Gly 465 470
475 480 Pro Asp Leu Glu Asp Leu Lys Arg Gln Val
Gln Gln His Lys Val Leu 485 490
495 Gln Glu Asp Leu Glu Gln Glu Gln Val Arg Val Asn Ser Leu Thr
His 500 505 510 Met
Val Val Val Val Asp Glu Ser Ser Gly Asp His Ala Thr Ala Ala 515
520 525 Leu Glu Glu Gln Leu Lys
Val Leu Gly Asp Arg Trp Ala Asn Ile Cys 530 535
540 Arg Trp Thr Glu Asp Arg Trp Val Leu Leu Gln
Asp Ile Leu Leu Lys 545 550 555
560 Trp Gln Arg Leu Thr Glu Glu Gln Cys Leu Phe Ser Ala Trp Leu Ser
565 570 575 Glu Lys
Glu Asp Ala Val Asn Lys Ile His Thr Thr Gly Phe Lys Asp 580
585 590 Gln Asn Glu Met Leu Ser Ser
Leu Gln Lys Leu Ala Val Leu Lys Ala 595 600
605 Asp Leu Glu Lys Lys Lys Gln Ser Met Gly Lys Leu
Tyr Ser Leu Lys 610 615 620
Gln Asp Leu Leu Ser Thr Leu Lys Asn Lys Ser Val Thr Gln Lys Thr 625
630 635 640 Glu Ala Trp
Leu Asp Asn Phe Ala Arg Cys Trp Asp Asn Leu Val Gln 645
650 655 Lys Leu Glu Lys Ser Thr Ala Gln
Ile Ser Gln Ala Val Thr Thr Thr 660 665
670 Gln Pro Ser Leu Thr Gln Thr Thr Val Met Glu Thr Val
Thr Thr Val 675 680 685
Thr Thr Arg Glu Gln Ile Leu Val Lys His Ala Gln Glu Glu Leu Pro 690
695 700 Pro Pro Pro Pro
Gln Lys Lys Arg Gln Ile Thr Val Asp Ser Glu Ile 705 710
715 720 Arg Lys Arg Leu Asp Val Asp Ile Thr
Glu Leu His Ser Trp Ile Thr 725 730
735 Arg Ser Glu Ala Val Leu Gln Ser Pro Glu Phe Ala Ile Phe
Arg Lys 740 745 750
Glu Gly Asn Phe Ser Asp Leu Lys Glu Lys Val Asn Ala Ile Glu Arg
755 760 765 Glu Lys Ala Glu
Lys Phe Arg Lys Leu Gln Asp Ala Ser Arg Ser Ala 770
775 780 Gln Ala Leu Val Glu Gln Met Val
Asn Glu Gly Val Asn Ala Asp Ser 785 790
795 800 Ile Lys Gln Ala Ser Glu Gln Leu Asn Ser Arg Trp
Ile Glu Phe Cys 805 810
815 Gln Leu Leu Ser Glu Arg Leu Asn Trp Leu Glu Tyr Gln Asn Asn Ile
820 825 830 Ile Ala Phe
Tyr Asn Gln Leu Gln Gln Leu Glu Gln Met Thr Thr Thr 835
840 845 Ala Glu Asn Trp Leu Lys Ile Gln
Pro Thr Thr Pro Ser Glu Pro Thr 850 855
860 Ala Ile Lys Ser Gln Leu Lys Ile Cys Lys Asp Glu Val
Asn Arg Leu 865 870 875
880 Ser Gly Leu Gln Pro Gln Ile Glu Arg Leu Lys Ile Gln Ser Ile Ala
885 890 895 Leu Lys Glu Lys
Gly Gln Gly Pro Met Phe Leu Asp Ala Asp Phe Val 900
905 910 Ala Phe Thr Asn His Phe Lys Gln Val
Phe Ser Asp Val Gln Ala Arg 915 920
925 Glu Lys Glu Leu Gln Thr Ile Phe Asp Thr Leu Pro Pro Met
Arg Tyr 930 935 940
Gln Glu Thr Met Ser Ala Ile Arg Thr Trp Val Gln Gln Ser Glu Thr 945
950 955 960 Lys Leu Ser Ile Pro
Gln Leu Ser Val Thr Asp Tyr Glu Ile Met Glu 965
970 975 Gln Arg Leu Gly Glu Leu Gln Ala Leu Gln
Ser Ser Leu Gln Glu Gln 980 985
990 Gln Ser Gly Leu Tyr Tyr Leu Ser Thr Thr Val Lys Glu Met
Ser Lys 995 1000 1005
Lys Ala Pro Ser Glu Ile Ser Arg Lys Tyr Gln Ser Glu Phe Glu 1010
1015 1020 Glu Ile Glu Gly Arg
Trp Lys Lys Leu Ser Ser Gln Leu Val Glu 1025 1030
1035 His Cys Gln Lys Leu Glu Glu Gln Met Asn
Lys Leu Arg Lys Ile 1040 1045 1050
Gln Asn His Ile Gln Thr Leu Lys Lys Trp Met Ala Glu Val Asp
1055 1060 1065 Val Phe
Leu Lys Glu Glu Trp Pro Ala Leu Gly Asp Ser Glu Ile 1070
1075 1080 Leu Lys Lys Gln Leu Lys Gln
Cys Arg Leu Leu Val Ser Asp Ile 1085 1090
1095 Gln Thr Ile Gln Pro Ser Leu Asn Ser Val Asn Glu
Gly Gly Gln 1100 1105 1110
Lys Ile Lys Asn Glu Ala Glu Pro Glu Phe Ala Ser Arg Leu Glu 1115
1120 1125 Thr Glu Leu Lys Glu
Leu Asn Thr Gln Trp Asp His Met Cys Gln 1130 1135
1140 Gln Val Tyr Ala Arg Lys Glu Ala Leu Lys
Gly Gly Leu Glu Lys 1145 1150 1155
Thr Val Ser Leu Gln Lys Asp Leu Ser Glu Met His Glu Trp Met
1160 1165 1170 Thr Gln
Ala Glu Glu Glu Tyr Leu Glu Arg Asp Phe Glu Tyr Lys 1175
1180 1185 Thr Pro Asp Glu Leu Gln Lys
Ala Val Glu Glu Met Lys Arg Ala 1190 1195
1200 Lys Glu Glu Ala Gln Gln Lys Glu Ala Lys Val Lys
Leu Leu Thr 1205 1210 1215
Glu Ser Val Asn Ser Val Ile Ala Gln Ala Pro Pro Val Ala Gln 1220
1225 1230 Glu Ala Leu Lys Lys
Glu Leu Glu Thr Leu Thr Thr Asn Tyr Gln 1235 1240
1245 Trp Leu Cys Thr Arg Leu Asn Gly Lys Cys
Lys Thr Leu Glu Glu 1250 1255 1260
Val Trp Ala Cys Trp His Glu Leu Leu Ser Tyr Leu Glu Lys Ala
1265 1270 1275 Asn Lys
Trp Leu Asn Glu Val Glu Phe Lys Leu Lys Thr Thr Glu 1280
1285 1290 Asn Ile Pro Gly Gly Ala Glu
Glu Ile Ser Glu Val Leu Asp Ser 1295 1300
1305 Leu Glu Asn Leu Met Arg His Ser Glu Asp Asn Pro
Asn Gln Ile 1310 1315 1320
Arg Ile Leu Ala Gln Thr Leu Thr Asp Gly Gly Val Met Asp Glu 1325
1330 1335 Leu Ile Asn Glu Glu
Leu Glu Thr Phe Asn Ser Arg Trp Arg Glu 1340 1345
1350 Leu His Glu Glu Ala Val Arg Arg Gln Lys
Leu Leu Glu Gln Ser 1355 1360 1365
Ile Gln Ser Ala Gln Glu Thr Glu Lys Ser Leu His Leu Ile Gln
1370 1375 1380 Glu Ser
Leu Thr Phe Ile Asp Lys Gln Leu Ala Ala Tyr Ile Ala 1385
1390 1395 Asp Lys Val Asp Ala Ala Gln
Met Pro Gln Glu Ala Gln Lys Ile 1400 1405
1410 Gln Ser Asp Leu Thr Ser His Glu Ile Ser Leu Glu
Glu Met Lys 1415 1420 1425
Lys His Asn Gln Gly Lys Glu Ala Ala Gln Arg Val Leu Ser Gln 1430
1435 1440 Ile Asp Val Ala Gln
Lys Lys Leu Gln Asp Val Ser Met Lys Phe 1445 1450
1455 Arg Leu Phe Gln Lys Pro Ala Asn Phe Glu
Gln Arg Leu Gln Glu 1460 1465 1470
Ser Lys Met Ile Leu Asp Glu Val Lys Met His Leu Pro Ala Leu
1475 1480 1485 Glu Thr
Lys Ser Val Glu Gln Glu Val Val Gln Ser Gln Leu Asn 1490
1495 1500 His Cys Val Asn Leu Tyr Lys
Ser Leu Ser Glu Val Lys Ser Glu 1505 1510
1515 Val Glu Met Val Ile Lys Thr Gly Arg Gln Ile Val
Gln Lys Lys 1520 1525 1530
Gln Thr Glu Asn Pro Lys Glu Leu Asp Glu Arg Val Thr Ala Leu 1535
1540 1545 Lys Leu His Tyr Asn
Glu Leu Gly Ala Lys Val Thr Glu Arg Lys 1550 1555
1560 Gln Gln Leu Glu Lys Cys Leu Lys Leu Ser
Arg Lys Met Arg Lys 1565 1570 1575
Glu Met Asn Val Leu Thr Glu Trp Leu Ala Ala Thr Asp Met Glu
1580 1585 1590 Leu Thr
Lys Arg Ser Ala Val Glu Gly Met Pro Ser Asn Leu Asp 1595
1600 1605 Ser Glu Val Ala Trp Gly Lys
Ala Thr Gln Lys Glu Ile Glu Lys 1610 1615
1620 Gln Lys Val His Leu Lys Ser Ile Thr Glu Val Gly
Glu Ala Leu 1625 1630 1635
Lys Thr Val Leu Gly Lys Lys Glu Thr Leu Val Glu Asp Lys Leu 1640
1645 1650 Ser Leu Leu Asn Ser
Asn Trp Ile Ala Val Thr Ser Arg Ala Glu 1655 1660
1665 Glu Trp Leu Asn Leu Leu Leu Glu Tyr Gln
Lys His Met Glu Thr 1670 1675 1680
Phe Asp Gln Asn Val Asp His Ile Thr Lys Trp Ile Ile Gln Ala
1685 1690 1695 Asp Thr
Leu Leu Asp Glu Ser Glu Lys Lys Lys Pro Gln Gln Lys 1700
1705 1710 Glu Asp Val Leu Lys Arg Leu
Lys Ala Glu Leu Asn Asp Ile Arg 1715 1720
1725 Pro Lys Val Asp Ser Thr Arg Asp Gln Ala Ala Asn
Leu Met Ala 1730 1735 1740
Asn Arg Gly Asp His Cys Arg Lys Leu Val Glu Pro Gln Ile Ser 1745
1750 1755 Glu Leu Asn His Arg
Phe Ala Ala Ile Ser His Arg Ile Lys Thr 1760 1765
1770 Gly Lys Ala Ser Ile Pro Leu Lys Glu Leu
Glu Gln Phe Asn Ser 1775 1780 1785
Asp Ile Gln Lys Leu Leu Glu Pro Leu Glu Ala Glu Ile Gln Gln
1790 1795 1800 Gly Val
Asn Leu Lys Glu Glu Asp Phe Asn Lys Asp Met Asn Glu 1805
1810 1815 Asp Asn Glu Gly Thr Val Lys
Glu Leu Leu Gln Arg Gly Asp Asn 1820 1825
1830 Leu Gln Gln Arg Ile Thr Asp Glu Arg Lys Arg Glu
Glu Ile Lys 1835 1840 1845
Ile Lys Gln Gln Leu Leu Gln Thr Lys His Asn Ala Leu Lys Asp 1850
1855 1860 Leu Arg Ser Gln Arg
Arg Lys Lys Ala Leu Glu Ile Ser His Gln 1865 1870
1875 Trp Tyr Gln Tyr Lys Arg Gln Ala Asp Asp
Leu Leu Lys Cys Leu 1880 1885 1890
Asp Asp Ile Glu Lys Lys Leu Ala Ser Leu Pro Glu Pro Arg Asp
1895 1900 1905 Glu Arg
Lys Ile Lys Glu Ile Asp Arg Glu Leu Gln Lys Lys Lys 1910
1915 1920 Glu Glu Leu Asn Ala Val Arg
Arg Gln Ala Glu Gly Leu Ser Glu 1925 1930
1935 Asp Gly Ala Ala Met Ala Val Glu Pro Thr Gln Ile
Gln Leu Ser 1940 1945 1950
Lys Arg Trp Arg Glu Ile Glu Ser Lys Phe Ala Gln Phe Arg Arg 1955
1960 1965 Leu Asn Phe Ala Gln
Ile His Thr Val Arg Glu Glu Thr Met Met 1970 1975
1980 Val Met Thr Glu Asp Met Pro Leu Glu Ile
Ser Tyr Val Pro Ser 1985 1990 1995
Thr Tyr Leu Thr Glu Ile Thr His Val Ser Gln Ala Leu Leu Glu
2000 2005 2010 Val Glu
Gln Leu Leu Asn Ala Pro Asp Leu Cys Ala Lys Asp Phe 2015
2020 2025 Glu Asp Leu Phe Lys Gln Glu
Glu Ser Leu Lys Asn Ile Lys Asp 2030 2035
2040 Ser Leu Gln Gln Ser Ser Gly Arg Ile Asp Ile Ile
His Ser Lys 2045 2050 2055
Lys Thr Ala Ala Leu Gln Ser Ala Thr Pro Val Glu Arg Val Lys 2060
2065 2070 Leu Gln Glu Ala Leu
Ser Gln Leu Asp Phe Gln Trp Glu Lys Val 2075 2080
2085 Asn Lys Met Tyr Lys Asp Arg Gln Gly Arg
Phe Asp Arg Ser Val 2090 2095 2100
Glu Lys Trp Arg Arg Phe His Tyr Asp Ile Lys Ile Phe Asn Gln
2105 2110 2115 Trp Leu
Thr Glu Ala Glu Gln Phe Leu Arg Lys Thr Gln Ile Pro 2120
2125 2130 Glu Asn Trp Glu His Ala Lys
Tyr Lys Trp Tyr Leu Lys Glu Leu 2135 2140
2145 Gln Asp Gly Ile Gly Gln Arg Gln Thr Val Val Arg
Thr Leu Asn 2150 2155 2160
Ala Thr Gly Glu Glu Ile Ile Gln Gln Ser Ser Lys Thr Asp Ala 2165
2170 2175 Ser Ile Leu Gln Glu
Lys Leu Gly Ser Leu Asn Leu Arg Trp Gln 2180 2185
2190 Glu Val Cys Lys Gln Leu Ser Asp Arg Lys
Lys Arg Leu Glu Glu 2195 2200 2205
Gln Lys Asn Ile Leu Ser Glu Phe Gln Arg Asp Leu Asn Glu Phe
2210 2215 2220 Val Leu
Trp Leu Glu Glu Ala Asp Asn Ile Ala Ser Ile Pro Leu 2225
2230 2235 Glu Pro Gly Lys Glu Gln Gln
Leu Lys Glu Lys Leu Glu Gln Val 2240 2245
2250 Lys Leu Leu Val Glu Glu Leu Pro Leu Arg Gln Gly
Ile Leu Lys 2255 2260 2265
Gln Leu Asn Glu Thr Gly Gly Pro Val Leu Val Ser Ala Pro Ile 2270
2275 2280 Ser Pro Glu Glu Gln
Asp Lys Leu Glu Asn Lys Leu Lys Gln Thr 2285 2290
2295 Asn Leu Gln Trp Ile Lys Val Ser Arg Ala
Leu Pro Glu Lys Gln 2300 2305 2310
Gly Glu Ile Glu Ala Gln Ile Lys Asp Leu Gly Gln Leu Glu Lys
2315 2320 2325 Lys Leu
Glu Asp Leu Glu Glu Gln Leu Asn His Leu Leu Leu Trp 2330
2335 2340 Leu Ser Pro Ile Arg Asn Gln
Leu Glu Ile Tyr Asn Gln Pro Asn 2345 2350
2355 Gln Glu Gly Pro Phe Asp Val Gln Glu Thr Glu Ile
Ala Val Gln 2360 2365 2370
Ala Lys Gln Pro Asp Val Glu Glu Ile Leu Ser Lys Gly Gln His 2375
2380 2385 Leu Tyr Lys Glu Lys
Pro Ala Thr Gln Pro Val Lys Arg Lys Leu 2390 2395
2400 Glu Asp Leu Ser Ser Glu Trp Lys Ala Val
Asn Arg Leu Leu Gln 2405 2410 2415
Glu Leu Arg Ala Lys Gln Pro Asp Leu Ala Pro Gly Leu Thr Thr
2420 2425 2430 Ile Gly
Ala Ser Pro Thr Gln Thr Val Thr Leu Val Thr Gln Pro 2435
2440 2445 Val Val Thr Lys Glu Thr Ala
Ile Ser Lys Leu Glu Met Pro Ser 2450 2455
2460 Ser Leu Met Leu Glu Val Pro Ala Leu Ala Asp Phe
Asn Arg Ala 2465 2470 2475
Trp Thr Glu Leu Thr Asp Trp Leu Ser Leu Leu Asp Gln Val Ile 2480
2485 2490 Lys Ser Gln Arg Val
Met Val Gly Asp Leu Glu Asp Ile Asn Glu 2495 2500
2505 Met Ile Ile Lys Gln Lys Ala Thr Met Gln
Asp Leu Glu Gln Arg 2510 2515 2520
Arg Pro Gln Leu Glu Glu Leu Ile Thr Ala Ala Gln Asn Leu Lys
2525 2530 2535 Asn Lys
Thr Ser Asn Gln Glu Ala Arg Thr Ile Ile Thr Asp Arg 2540
2545 2550 Ile Glu Arg Ile Gln Asn Gln
Trp Asp Glu Val Gln Glu His Leu 2555 2560
2565 Gln Asn Arg Arg Gln Gln Leu Asn Glu Met Leu Lys
Asp Ser Thr 2570 2575 2580
Gln Trp Leu Glu Ala Lys Glu Glu Ala Glu Gln Val Leu Gly Gln 2585
2590 2595 Ala Arg Ala Lys Leu
Glu Ser Trp Lys Glu Gly Pro Tyr Thr Val 2600 2605
2610 Asp Ala Ile Gln Lys Lys Ile Thr Glu Thr
Lys Gln Leu Ala Lys 2615 2620 2625
Asp Leu Arg Gln Trp Gln Thr Asn Val Asp Val Ala Asn Asp Leu
2630 2635 2640 Ala Leu
Lys Leu Leu Arg Asp Tyr Ser Ala Asp Asp Thr Arg Lys 2645
2650 2655 Val His Met Ile Thr Glu Asn
Ile Asn Ala Ser Trp Arg Ser Ile 2660 2665
2670 His Lys Arg Val Ser Glu Arg Glu Ala Ala Leu Glu
Glu Thr His 2675 2680 2685
Arg Leu Leu Gln Gln Phe Pro Leu Asp Leu Glu Lys Phe Leu Ala 2690
2695 2700 Trp Leu Thr Glu Ala
Glu Thr Thr Ala Asn Val Leu Gln Asp Ala 2705 2710
2715 Thr Arg Lys Glu Arg Leu Leu Glu Asp Ser
Lys Gly Val Lys Glu 2720 2725 2730
Leu Met Lys Gln Trp Gln Asp Leu Gln Gly Glu Ile Glu Ala His
2735 2740 2745 Thr Asp
Val Tyr His Asn Leu Asp Glu Asn Ser Gln Lys Ile Leu 2750
2755 2760 Arg Ser Leu Glu Gly Ser Asp
Asp Ala Val Leu Leu Gln Arg Arg 2765 2770
2775 Leu Asp Asn Met Asn Phe Lys Trp Ser Glu Leu Arg
Lys Lys Ser 2780 2785 2790
Leu Asn Ile Arg Ser His Leu Glu Ala Ser Ser Asp Gln Trp Lys 2795
2800 2805 Arg Leu His Leu Ser
Leu Gln Glu Leu Leu Val Trp Leu Gln Leu 2810 2815
2820 Lys Asp Asp Glu Leu Ser Arg Gln Ala Pro
Ile Gly Gly Asp Phe 2825 2830 2835
Pro Ala Val Gln Lys Gln Asn Asp Val His Arg Ala Phe Lys Arg
2840 2845 2850 Glu Leu
Lys Thr Lys Glu Pro Val Ile Met Ser Thr Leu Glu Thr 2855
2860 2865 Val Arg Ile Phe Leu Thr Glu
Gln Pro Leu Glu Gly Leu Glu Lys 2870 2875
2880 Leu Tyr Gln Glu Pro Arg Glu Leu Pro Pro Glu Glu
Arg Ala Gln 2885 2890 2895
Asn Val Thr Arg Leu Leu Arg Lys Gln Ala Glu Glu Val Asn Thr 2900
2905 2910 Glu Trp Glu Lys Leu
Asn Leu His Ser Ala Asp Trp Gln Arg Lys 2915 2920
2925 Ile Asp Glu Thr Leu Glu Arg Leu Gln Glu
Leu Gln Glu Ala Thr 2930 2935 2940
Asp Glu Leu Asp Leu Lys Leu Arg Gln Ala Glu Val Ile Lys Gly
2945 2950 2955 Ser Trp
Gln Pro Val Gly Asp Leu Leu Ile Asp Ser Leu Gln Asp 2960
2965 2970 His Leu Glu Lys Val Lys Ala
Leu Arg Gly Glu Ile Ala Pro Leu 2975 2980
2985 Lys Glu Asn Val Ser His Val Asn Asp Leu Ala Arg
Gln Leu Thr 2990 2995 3000
Thr Leu Gly Ile Gln Leu Ser Pro Tyr Asn Leu Ser Thr Leu Glu 3005
3010 3015 Asp Leu Asn Thr Arg
Trp Lys Leu Leu Gln Val Ala Val Glu Asp 3020 3025
3030 Arg Val Arg Gln Leu His Glu Ala His Arg
Asp Phe Gly Pro Ala 3035 3040 3045
Ser Gln His Phe Leu Ser Thr Ser Val Gln Gly Pro Trp Glu Arg
3050 3055 3060 Ala Ile
Ser Pro Asn Lys Val Pro Tyr Tyr Ile Asn His Glu Thr 3065
3070 3075 Gln Thr Thr Cys Trp Asp His
Pro Lys Met Thr Glu Leu Tyr Gln 3080 3085
3090 Ser Leu Ala Asp Leu Asn Asn Val Arg Phe Ser Ala
Tyr Arg Thr 3095 3100 3105
Ala Met Lys Leu Arg Arg Leu Gln Lys Ala Leu Cys Leu Asp Leu 3110
3115 3120 Leu Ser Leu Ser Ala
Ala Cys Asp Ala Leu Asp Gln His Asn Leu 3125 3130
3135 Lys Gln Asn Asp Gln Pro Met Asp Ile Leu
Gln Ile Ile Asn Cys 3140 3145 3150
Leu Thr Thr Ile Tyr Asp Arg Leu Glu Gln Glu His Asn Asn Leu
3155 3160 3165 Val Asn
Val Pro Leu Cys Val Asp Met Cys Leu Asn Trp Leu Leu 3170
3175 3180 Asn Val Tyr Asp Thr Gly Arg
Thr Gly Arg Ile Arg Val Leu Ser 3185 3190
3195 Phe Lys Thr Gly Ile Ile Ser Leu Cys Lys Ala His
Leu Glu Asp 3200 3205 3210
Lys Tyr Arg Tyr Leu Phe Lys Gln Val Ala Ser Ser Thr Gly Phe 3215
3220 3225 Cys Asp Gln Arg Arg
Leu Gly Leu Leu Leu His Asp Ser Ile Gln 3230 3235
3240 Ile Pro Arg Gln Leu Gly Glu Val Ala Ser
Phe Gly Gly Ser Asn 3245 3250 3255
Ile Glu Pro Ser Val Arg Ser Cys Phe Gln Phe Ala Asn Asn Lys
3260 3265 3270 Pro Glu
Ile Glu Ala Ala Leu Phe Leu Asp Trp Met Arg Leu Glu 3275
3280 3285 Pro Gln Ser Met Val Trp Leu
Pro Val Leu His Arg Val Ala Ala 3290 3295
3300 Ala Glu Thr Ala Lys His Gln Ala Lys Cys Asn Ile
Cys Lys Glu 3305 3310 3315
Cys Pro Ile Ile Gly Phe Arg Tyr Arg Ser Leu Lys His Phe Asn 3320
3325 3330 Tyr Asp Ile Cys Gln
Ser Cys Phe Phe Ser Gly Arg Val Ala Lys 3335 3340
3345 Gly His Lys Met His Tyr Pro Met Val Glu
Tyr Cys Thr Pro Thr 3350 3355 3360
Thr Ser Gly Glu Asp Val Arg Asp Phe Ala Lys Val Leu Lys Asn
3365 3370 3375 Lys Phe
Arg Thr Lys Arg Tyr Phe Ala Lys His Pro Arg Met Gly 3380
3385 3390 Tyr Leu Pro Val Gln Thr Val
Leu Glu Gly Asp Asn Met Glu Thr 3395 3400
3405 Pro Val Thr Leu Ile Asn Phe Trp Pro Val Asp Ser
Ala Pro Ala 3410 3415 3420
Ser Ser Pro Gln Leu Ser His Asp Asp Thr His Ser Arg Ile Glu 3425
3430 3435 His Tyr Ala Ser Arg
Leu Ala Glu Met Glu Asn Ser Asn Gly Ser 3440 3445
3450 Tyr Leu Asn Asp Ser Ile Ser Pro Asn Glu
Ser Ile Asp Asp Glu 3455 3460 3465
His Leu Leu Ile Gln His Tyr Cys Gln Ser Leu Asn Gln Asp Ser
3470 3475 3480 Pro Leu
Ser Gln Pro Arg Ser Pro Ala Gln Ile Leu Ile Ser Leu 3485
3490 3495 Glu Ser Glu Glu Arg Gly Glu
Leu Glu Arg Ile Leu Ala Asp Leu 3500 3505
3510 Glu Glu Glu Asn Arg Asn Leu Gln Ala Glu Tyr Asp
Arg Leu Lys 3515 3520 3525
Gln Gln His Glu His Lys Gly Leu Ser Pro Leu Pro Ser Pro Pro 3530
3535 3540 Glu Met Met Pro Thr
Ser Pro Gln Ser Pro Arg Asp Ala Glu Leu 3545 3550
3555 Ile Ala Glu Ala Lys Leu Leu Arg Gln His
Lys Gly Arg Leu Glu 3560 3565 3570
Ala Arg Met Gln Ile Leu Glu Asp His Asn Lys Gln Leu Glu Ser
3575 3580 3585 Gln Leu
His Arg Leu Arg Gln Leu Leu Glu Gln Pro Gln Ala Glu 3590
3595 3600 Ala Lys Val Asn Gly Thr Thr
Val Ser Ser Pro Ser Thr Ser Leu 3605 3610
3615 Gln Arg Ser Asp Ser Ser Gln Pro Met Leu Leu Arg
Val Val Gly 3620 3625 3630
Ser Gln Thr Ser Asp Ser Met Gly Glu Glu Asp Leu Leu Ser Pro 3635
3640 3645 Pro Gln Asp Thr Ser
Thr Gly Leu Glu Glu Val Met Glu Gln Leu 3650 3655
3660 Asn Asn Ser Phe Pro Ser Ser Arg Gly Arg
Asn Thr Pro Gly Lys 3665 3670 3675
Pro Met Arg Glu Asp Thr Met 3680 3685
2153PRTHomo sapiens 2Met Gly Lys Ile Ser Ser Leu Pro Thr Gln Leu Phe Lys
Cys Cys Phe 1 5 10 15
Cys Asp Phe Leu Lys Val Lys Met His Thr Met Ser Ser Ser His Leu
20 25 30 Phe Tyr Leu Ala
Leu Cys Leu Leu Thr Phe Thr Ser Ser Ala Thr Ala 35
40 45 Gly Pro Glu Thr Leu Cys Gly Ala Glu
Leu Val Asp Ala Leu Gln Phe 50 55
60 Val Cys Gly Asp Arg Gly Phe Tyr Phe Asn Lys Pro Thr
Gly Tyr Gly 65 70 75
80 Ser Ser Ser Arg Arg Ala Pro Gln Thr Gly Ile Val Asp Glu Cys Cys
85 90 95 Phe Arg Ser Cys
Asp Leu Arg Arg Leu Glu Met Tyr Cys Ala Pro Leu 100
105 110 Lys Pro Ala Lys Ser Ala Arg Ser Val
Arg Ala Gln Arg His Thr Asp 115 120
125 Met Pro Lys Thr Gln Lys Glu Val His Leu Lys Asn Ala Ser
Arg Gly 130 135 140
Ser Ala Gly Asn Lys Asn Tyr Arg Met 145 150
320DNAArtificialantisense nucleotide 3cgaccugagc uuuguuguag
20425DNAArtificialantisense nucleotide
4cgaccugagc uuuguuguag acuau
25523DNAArtificialantisense nucleotide 5ccugagcuuu guuguagacu auc
23623DNAArtificialantisense
nucleotide 6cguugcacuu ugcaaugcug cug
23719DNAArtificialantisense nucleotide 7cuguagcuuc acccuuucc
19824DNAArtificialantisense
nucleotide 8gagagagcuu ccuguagcuu cacc
24927DNAArtificialantisense nucleotide 9guccuuguac auuuuguuaa
cuuuuuc
271020DNAArtificialantisense nucleotide 10ucagcuucug uuagccacug
201120DNAArtificialantisense
nucleotide 11uucagcuucu guuagccacu
201221DNAArtificialantisense nucleotide 12uucagcuucu guuagccacu
g
211321DNAArtificialantisense nucleotide 13ucagcuucug uuagccacug a
211422DNAArtificialantisense
nucleotide 14uucagcuucu guuagccacu ga
221521DNAArtificialantisense nucleotide 15ucagcuucug uuagccacug
a
211622DNAArtificialantisense nucleotide 16uucagcuucu guuagccacu ga
221722DNAArtificialantisense
nucleotide 17ucagcuucug uuagccacug au
221823DNAArtificialantisense nucleotide 18uucagcuucu guuagccacu
gau
231923DNAArtificialantisense nucleotide 19ucagcuucug uuagccacug auu
232024DNAArtificialantisense
nucleotide 20uucagcuucu guuagccacu gauu
242124DNAArtificialantisense nucleotide 21ucagcuucug uuagccacug
auua
242224DNAArtificialantisense nucleotide 22uucagcuucu guuagccacu gaua
242325DNAArtificialantisense
nucleotide 23ucagcuucug uuagccacug auuaa
252426DNAArtificialantisense nucleotide 24uucagcuucu guuagccacu
gauuaa
262526DNAArtificialantisense nucleotide 25ucagcuucug uuagccacug auuaaa
262627DNAArtificialantisense
nucleotide 26uucagcuucu guuagccacu gauuaaa
272719DNAArtificialantisense nucleotide 27cagcuucugu uagccacug
192821DNAArtificialantisense nucleotide 28cagcuucugu uagccacuga u
212921DNAArtificialantisense
nucleotide 29agcuucuguu agccacugau u
213022DNAArtificialantisense nucleotide 30cagcuucugu uagccacuga
uu
223122DNAArtificialantisense nucleotide 31agcuucuguu agccacugau ua
223223DNAArtificialantisense
nucleotide 32cagcuucugu uagccacuga uua
233323DNAArtificialantisense nucleotide 33agcuucuguu agccacugau
uaa
233424DNAArtificialantisense nucleotide 34cagcuucugu uagccacuga uuaa
243524DNAArtificialantisense
nucleotide 35agcuucuguu agccacugau uaaa
243625DNAArtificialantisense nucleotide 36cagcuucugu uagccacuga
uuaaa
253724DNAArtificialantisense nucleotide 37agcuucuguu agccacugau uaaa
243820DNAArtificialantisense
nucleotide 38agcuucuguu agccacugau
203920DNAArtificialantisense nucleotide 39gcuucuguua gccacugauu
204021DNAArtificialantisense nucleotide 40agcuucuguu agccacugau u
214121DNAArtificialantisense
nucleotide 41gcuucuguua gccacugauu a
214222DNAArtificialantisense nucleotide 42agcuucuguu agccacugau
ua
224322DNAArtificialantisense nucleotide 43gcuucuguua gccacugauu aa
224423DNAArtificialantisense
nucleotide 44agcuucuguu agccacugau uaa
234523DNAArtificialantisense nucleotide 45gcuucuguua gccacugauu
aaa
234624DNAArtificialantisense nucleotide 46agcuucuguu agccacugau uaaa
244723DNAArtificialantisense
nucleotide 47gcuucuguua gccacugauu aaa
234823DNAArtificialantisense nucleotide 48ccauuuguau uuagcauguu
ccc
234920DNAArtificialantisense nucleotide 49agauaccauu uguauuuagc
205019DNAArtificialantisense
nucleotide 50gccauuucuc aacagaucu
195123DNAArtificialantisense nucleotide 51gccauuucuc aacagaucug
uca
235223DNAArtificialantisense nucleotide 52auucucagga auuugugucu uuc
235321DNAArtificialantisense
nucleotide 53ucucaggaau uugugucuuu c
215418DNAArtificialantisense nucleotide 54guucagcuuc uguuagcc
185521DNAArtificialantisense nucleotide 55cugauuaaau aucuuuauau c
215618DNAArtificialantisense
nucleotide 56gccgccauuu cucaacag
185718DNAArtificialantisense nucleotide 57guauuuagca uguuccca
185818DNAArtificialantisense nucleotide 58caggaauuug ugucuuuc
185925DNAArtificialantisense
nucleotide 59uuugccgcug cccaaugcca uccug
256025DNAArtificialantisense nucleotide 60auucaauguu cugacaacag
uuugc
256125DNAArtificialantisense nucleotide 61ccaguugcau ucaauguucu gacaa
256222DNAArtificialantisense
nucleotide 62caguugcauu caauguucug ac
226320DNAArtificialantisense nucleotide 63aguugcauuc aauguucuga
206421DNAArtificialantisense nucleotide 64gauugcugaa uuauuucuuc c
216525DNAArtificialantisense
nucleotide 65gauugcugaa uuauuucuuc cccag
256625DNAArtificialantisense nucleotide 66auugcugaau uauuucuucc
ccagu
256725DNAArtificialantisense nucleotide 67uugcugaauu auuucuuccc caguu
256825DNAArtificialantisense
nucleotide 68ugcugaauua uuucuucccc aguug
256925DNAArtificialantisense nucleotide 69gcugaauuau uucuucccca
guugc
257025DNAArtificialantisense nucleotide 70cugaauuauu ucuuccccag uugca
257125DNAArtificialantisense
nucleotide 71ugaauuauuu cuuccccagu ugcau
257225DNAArtificialantisense nucleotide 72gaauuauuuc uuccccaguu
gcauu
257325DNAArtificialantisense nucleotide 73aauuauuucu uccccaguug cauuc
257425DNAArtificialantisense
nucleotide 74auuauuucuu ccccaguugc auuca
257525DNAArtificialantisense nucleotide 75uuauuucuuc cccaguugca
uucaa
257625DNAArtificialantisense nucleotide 76uauuucuucc ccaguugcau ucaau
257725DNAArtificialantisense
nucleotide 77auuucuuccc caguugcauu caaug
257825DNAArtificialantisense nucleotide 78uuucuucccc aguugcauuc
aaugu
257925DNAArtificialantisense nucleotide 79uucuucccca guugcauuca auguu
258025DNAArtificialantisense
nucleotide 80ucuuccccag uugcauucaa uguuc
258125DNAArtificialantisense nucleotide 81cuuccccagu ugcauucaau
guucu
258225DNAArtificialantisense nucleotide 82uuccccaguu gcauucaaug uucug
258325DNAArtificialantisense
nucleotide 83uccccaguug cauucaaugu ucuga
258425DNAArtificialantisense nucleotide 84ccccaguugc auucaauguu
cugac
258525DNAArtificialantisense nucleotide 85cccaguugca uucaauguuc ugaca
258625DNAArtificialantisense
nucleotide 86ccaguugcau ucaauguucu gacaa
258725DNAArtificialantisense nucleotide 87caguugcauu caauguucug
acaac
258825DNAArtificialantisense nucleotide 88aguugcauuc aauguucuga caaca
258925DNAArtificialantisense
nucleotide 89guugcauuca auguucugac aacag
259025DNAArtificialantisense nucleotide 90uugcauucaa uguucugaca
acagu
259125DNAArtificialantisense nucleotide 91ugcauucaau guucugacaa caguu
259225DNAArtificialantisense
nucleotide 92gcauucaaug uucugacaac aguuu
259325DNAArtificialantisense nucleotide 93cauucaaugu ucugacaaca
guuug
259425DNAArtificialantisense nucleotide 94auucaauguu cugacaacag uuugc
259525DNAArtificialantisense
nucleotide 95ucaauguucu gacaacaguu ugccg
259625DNAArtificialantisense nucleotide 96caauguucug acaacaguuu
gccgc
259725DNAArtificialantisense nucleotide 97aauguucuga caacaguuug ccgcu
259825DNAArtificialantisense
nucleotide 98auguucugac aacaguuugc cgcug
259925DNAArtificialantisense nucleotide 99uguucugaca acaguuugcc
gcugc
2510025DNAArtificialantisense nucleotide 100guucugacaa caguuugccg cugcc
2510125DNAArtificialantisense
nucleotide 101uucugacaac aguuugccgc ugccc
2510225DNAArtificialantisense nucleotide 102ucugacaaca
guuugccgcu gccca
2510325DNAArtificialantisense nucleotide 103cugacaacag uuugccgcug cccaa
2510425DNAArtificialantisense
nucleotide 104ugacaacagu uugccgcugc ccaau
2510525DNAArtificialantisense nucleotide 105gacaacaguu
ugccgcugcc caaug
2510625DNAArtificialantisense nucleotide 106acaacaguuu gccgcugccc aaugc
2510725DNAArtificialantisense
nucleotide 107caacaguuug ccgcugccca augcc
2510825DNAArtificialantisense nucleotide 108aacaguuugc
cgcugcccaa ugcca
2510925DNAArtificialantisense nucleotide 109acaguuugcc gcugcccaau gccau
2511025DNAArtificialantisense
nucleotide 110caguuugccg cugcccaaug ccauc
2511125DNAArtificialantisense nucleotide 111aguuugccgc
ugcccaaugc caucc
2511225DNAArtificialantisense nucleotide 112guuugccgcu gcccaaugcc auccu
2511325DNAArtificialantisense
nucleotide 113uuugccgcug cccaaugcca uccug
2511425DNAArtificialantisense nucleotide 114uugccgcugc
ccaaugccau ccugg
2511525DNAArtificialantisense nucleotide 115ugccgcugcc caaugccauc cugga
2511625DNAArtificialantisense
nucleotide 116gccgcugccc aaugccaucc uggag
2511725DNAArtificialantisense nucleotide 117ccgcugccca
augccauccu ggagu
2511825DNAArtificialantisense nucleotide 118cgcugcccaa ugccauccug gaguu
2511925DNAArtificialantisense
nucleotide 119gcuuuucuuu uaguugcugc ucuuu
2512025DNAArtificialantisense nucleotide 120cuuuucuuuu
aguugcugcu cuuuu
2512125DNAArtificialantisense nucleotide 121uuuucuuuua guugcugcuc uuuuc
2512225DNAArtificialantisense
nucleotide 122uuucuuuuag uugcugcucu uuucc
2512325DNAArtificialantisense nucleotide 123uucuuuuagu
ugcugcucuu uucca
2512425DNAArtificialantisense nucleotide 124ucuuuuaguu gcugcucuuu uccag
2512525DNAArtificialantisense
nucleotide 125cuuuuaguug cugcucuuuu ccagg
2512625DNAArtificialantisense nucleotide 126uuuuaguugc
ugcucuuuuc caggu
2512725DNAArtificialantisense nucleotide 127uuuaguugcu gcucuuuucc agguu
2512825DNAArtificialantisense
nucleotide 128uuaguugcug cucuuuucca gguuc
2512925DNAArtificialantisense nucleotide 129uaguugcugc
ucuuuuccag guuca
2513025DNAArtificialantisense nucleotide 130aguugcugcu cuuuuccagg uucaa
2513125DNAArtificialantisense
nucleotide 131guugcugcuc uuuuccaggu ucaag
2513225DNAArtificialantisense nucleotide 132uugcugcucu
uuuccagguu caagu
2513325DNAArtificialantisense nucleotide 133ugcugcucuu uuccagguuc aagug
2513425DNAArtificialantisense
nucleotide 134gcugcucuuu uccagguuca agugg
2513525DNAArtificialantisense nucleotide 135cugcucuuuu
ccagguucaa guggg
2513625DNAArtificialantisense nucleotide 136ugcucuuuuc cagguucaag uggga
2513725DNAArtificialantisense
nucleotide 137gcucuuuucc agguucaagu gggac
2513825DNAArtificialantisense nucleotide 138cucuuuucca
gguucaagug ggaua
2513925DNAArtificialantisense nucleotide 139ucuuuuccag guucaagugg gauac
2514025DNAArtificialantisense
nucleotide 140cuuuuccagg uucaaguggg auacu
2514125DNAArtificialantisense nucleotide 141uuuuccaggu
ucaaguggga uacua
2514225DNAArtificialantisense nucleotide 142uuuccagguu caagugggau acuag
2514325DNAArtificialantisense
nucleotide 143uuccagguuc aagugggaua cuagc
2514425DNAArtificialantisense nucleotide 144uccagguuca
agugggauac uagca
2514525DNAArtificialantisense nucleotide 145ccagguucaa gugggauacu agcaa
2514625DNAArtificialantisense
nucleotide 146cagguucaag ugggauacua gcaau
2514725DNAArtificialantisense nucleotide 147agguucaagu
gggauacuag caaug
2514825DNAArtificialantisense nucleotide 148gguucaagug ggauacuagc aaugu
2514925DNAArtificialantisense
nucleotide 149guucaagugg gauacuagca auguu
2515025DNAArtificialantisense nucleotide 150uucaaguggg
auacuagcaa uguua
2515125DNAArtificialantisense nucleotide 151ucaaguggga uacuagcaau guuau
2515225DNAArtificialantisense
nucleotide 152caagugggau acuagcaaug uuauc
2515325DNAArtificialantisense nucleotide 153aagugggaua
cuagcaaugu uaucu
2515425DNAArtificialantisense nucleotide 154agugggauac uagcaauguu aucug
2515525DNAArtificialantisense
nucleotide 155gugggauacu agcaauguua ucugc
2515625DNAArtificialantisense nucleotide 156ugggauacua
gcaauguuau cugcu
2515725DNAArtificialantisense nucleotide 157gggauacuag caauguuauc ugcuu
2515825DNAArtificialantisense
nucleotide 158ggauacuagc aauguuaucu gcuuc
2515925DNAArtificialantisense nucleotide 159gauacuagca
auguuaucug cuucc
2516025DNAArtificialantisense nucleotide 160auacuagcaa uguuaucugc uuccu
2516125DNAArtificialantisense
nucleotide 161uacuagcaau guuaucugcu uccuc
2516225DNAArtificialantisense nucleotide 162acuagcaaug
uuaucugcuu ccucc
2516325DNAArtificialantisense nucleotide 163cuagcaaugu uaucugcuuc cucca
2516425DNAArtificialantisense
nucleotide 164uagcaauguu aucugcuucc uccaa
2516525DNAArtificialantisense nucleotide 165agcaauguua
ucugcuuccu ccaac
2516625DNAArtificialantisense nucleotide 166gcaauguuau cugcuuccuc caacc
2516725DNAArtificialantisense
nucleotide 167caauguuauc ugcuuccucc aacca
2516825DNAArtificialantisense nucleotide 168aauguuaucu
gcuuccucca accau
2516925DNAArtificialantisense nucleotide 169auguuaucug cuuccuccaa ccaua
2517025DNAArtificialantisense
nucleotide 170uguuaucugc uuccuccaac cauaa
2517125DNAArtificialantisense nucleotide 171guuaucugcu
uccuccaacc auaaa
2517219DNAArtificialantisense nucleotide 172gcugcucuuu uccagguuc
1917320DNAArtificialantisense
nucleotide 173ucuuuuccag guucaagugg
2017419DNAArtificialantisense nucleotide 174agguucaagu
gggauacua
1917520DNAArtificialantisense nucleotide 175cucagcucuu gaaguaaacg
2017620DNAArtificialantisense
nucleotide 176ccucagcucu ugaaguaaac
2017721DNAArtificialantisense nucleotide 177ccucagcucu
ugaaguaaac g
2117821DNAArtificialantisense nucleotide 178auagugguca guccaggagc u
2117921DNAArtificialantisense
nucleotide 179caguccagga gcuaggucag g
2118025DNAArtificialantisense nucleotide 180uaguggucag
uccaggagcu agguc
2518125DNAArtificialantisense nucleotide 181agagcaggua ccuccaacau caagg
2518225DNAArtificialantisense
nucleotide 182gagcagguac cuccaacauc aagga
2518325DNAArtificialantisense nucleotide 183agcagguacc
uccaacauca aggaa
2518425DNAArtificialantisense nucleotide 184gcagguaccu ccaacaucaa ggaag
2518525DNAArtificialantisense
nucleotide 185cagguaccuc caacaucaag gaaga
2518625DNAArtificialantisense nucleotide 186agguaccucc
aacaucaagg aagau
2518725DNAArtificialantisense nucleotide 187gguaccucca acaucaagga agaug
2518825DNAArtificialantisense
nucleotide 188guaccuccaa caucaaggaa gaugg
2518925DNAArtificialantisense nucleotide 189uaccuccaac
aucaaggaag auggc
2519025DNAArtificialantisense nucleotide 190accuccaaca ucaaggaaga uggca
2519125DNAArtificialantisense
nucleotide 191ccuccaacau caaggaagau ggcau
2519225DNAArtificialantisense nucleotide 192cuccaacauc
aaggaagaug gcauu
2519330DNAArtificialantisense nucleotide 193cuccaacauc aaggaagaug
gcauuucuag
3019425DNAArtificialantisense nucleotide 194uccaacauca aggaagaugg cauuu
2519525DNAArtificialantisense
nucleotide 195ccaacaucaa ggaagauggc auuuc
2519625DNAArtificialantisense nucleotide 196caacaucaag
gaagauggca uuucu
2519725DNAArtificialantisense nucleotide 197aacaucaagg aagauggcau uucua
2519825DNAArtificialantisense
nucleotide 198acaucaagga agauggcauu ucuag
2519930DNAArtificialantisense nucleotide 199acaucaagga
agauggcauu ucuaguuugg
3020025DNAArtificialantisense nucleotide 200acaucaagga agauggcauu ucuag
2520125DNAArtificialantisense
nucleotide 201caucaaggaa gauggcauuu cuagu
2520225DNAArtificialantisense nucleotide 202aucaaggaag
auggcauuuc uaguu
2520325DNAArtificialantisense nucleotide 203ucaaggaaga uggcauuucu aguuu
2520420DNAArtificialantisense
nucleotide 204ucaaggaaga uggcauuucu
2020525DNAArtificialantisense nucleotide 205caaggaagau
ggcauuucua guuug
2520625DNAArtificialantisense nucleotide 206aaggaagaug gcauuucuag uuugg
2520725DNAArtificialantisense
nucleotide 207aggaagaugg cauuucuagu uugga
2520825DNAArtificialantisense nucleotide 208ggaagauggc
auuucuaguu uggag
2520925DNAArtificialantisense nucleotide 209gaagauggca uuucuaguuu ggaga
2521025DNAArtificialantisense
nucleotide 210aagauggcau uucuaguuug gagau
2521125DNAArtificialantisense nucleotide 211agauggcauu
ucuaguuugg agaug
2521225DNAArtificialantisense nucleotide 212gauggcauuu cuaguuugga gaugg
2521325DNAArtificialantisense
nucleotide 213auggcauuuc uaguuuggag auggc
2521425DNAArtificialantisense nucleotide 214uggcauuucu
aguuuggaga uggca
2521525DNAArtificialantisense nucleotide 215ggcauuucua guuuggagau ggcag
2521625DNAArtificialantisense
nucleotide 216gcauuucuag uuuggagaug gcagu
2521725DNAArtificialantisense nucleotide 217cauuucuagu
uuggagaugg caguu
2521825DNAArtificialantisense nucleotide 218auuucuaguu uggagauggc aguuu
2521925DNAArtificialantisense
nucleotide 219uuucuaguuu ggagauggca guuuc
2522025DNAArtificialantisense nucleotide 220uucuaguuug
gagauggcag uuucc
2522125DNAArtificialantisense nucleotide 221ccucuugauu gcuggucuug uuuuu
2522225DNAArtificialantisense
nucleotide 222cucuugauug cuggucuugu uuuuc
2522325DNAArtificialantisense nucleotide 223ucuugauugc
uggucuuguu uuuca
2522425DNAArtificialantisense nucleotide 224cuugauugcu ggucuuguuu uucaa
2522525DNAArtificialantisense
nucleotide 225uugauugcug gucuuguuuu ucaaa
2522625DNAArtificialantisense nucleotide 226ugauugcugg
ucuuguuuuu caaau
2522725DNAArtificialantisense nucleotide 227gauugcuggu cuuguuuuuc aaauu
2522825DNAArtificialantisense
nucleotide 228auugcugguc uuguuuuuca aauuu
2522925DNAArtificialantisense nucleotide 229uugcuggucu
uguuuuucaa auuuu
2523025DNAArtificialantisense nucleotide 230ugcuggucuu guuuuucaaa uuuug
2523125DNAArtificialantisense
nucleotide 231gcuggucuug uuuuucaaau uuugg
2523225DNAArtificialantisense nucleotide 232cuggucuugu
uuuucaaauu uuggg
2523325DNAArtificialantisense nucleotide 233uggucuuguu uuucaaauuu ugggc
2523425DNAArtificialantisense
nucleotide 234ggucuuguuu uucaaauuuu gggca
2523525DNAArtificialantisense nucleotide 235gucuuguuuu
ucaaauuuug ggcag
2523625DNAArtificialantisense nucleotide 236ucuuguuuuu caaauuuugg gcagc
2523725DNAArtificialantisense
nucleotide 237cuuguuuuuc aaauuuuggg cagcg
2523825DNAArtificialantisense nucleotide 238uuguuuuuca
aauuuugggc agcgg
2523925DNAArtificialantisense nucleotide 239uguuuuucaa auuuugggca gcggu
2524025DNAArtificialantisense
nucleotide 240guuuuucaaa uuuugggcag cggua
2524125DNAArtificialantisense nucleotide 241uuuuucaaau
uuugggcagc gguaa
2524225DNAArtificialantisense nucleotide 242uuuucaaauu uugggcagcg guaau
2524325DNAArtificialantisense
nucleotide 243uuucaaauuu ugggcagcgg uaaug
2524425DNAArtificialantisense nucleotide 244uucaaauuuu
gggcagcggu aauga
2524525DNAArtificialantisense nucleotide 245ucaaauuuug ggcagcggua augag
2524625DNAArtificialantisense
nucleotide 246caaauuuugg gcagcgguaa ugagu
2524725DNAArtificialantisense nucleotide 247aaauuuuggg
cagcgguaau gaguu
2524825DNAArtificialantisense nucleotide 248aauuuugggc agcgguaaug aguuc
2524925DNAArtificialantisense
nucleotide 249auuuugggca gcgguaauga guucu
2525025DNAArtificialantisense nucleotide 250ccauuguguu
gaauccuuua acauu
2525122DNAArtificialantisense nucleotide 251ccauuguguu gaauccuuua ac
2225220DNAArtificialantisense
nucleotide 252auuguguuga auccuuuaac
2025320DNAArtificialantisense nucleotide 253ccuguccuaa
gaccugcuca
2025425DNAArtificialantisense nucleotide 254cuuuuggauu gcaucuacug uauag
2525525DNAArtificialantisense
nucleotide 255cauucaacug uugccuccgg uucug
2525624DNAArtificialantisense nucleotide 256cuguugccuc
cgguucugaa ggug
2425731DNAArtificialantisense nucleotide 257cauucaacug uugccuccgg
uucugaaggu g
3125825DNAArtificialantisense nucleotide 258cugaaggugu ucuuguacuu caucc
2525927DNAArtificialantisense
nucleotide 259uguauaggga cccuccuucc augacuc
2726020DNAArtificialantisense nucleotide 260aucccacuga
uucugaauuc
2026122DNAArtificialantisense nucleotide 261uuggcucugg ccuguccuaa ga
2226235DNAArtificialantisense
nucleotide 262aagaccugcu cagcuucuuc cuuagcuucc agcca
3526320DNAArtificialantisense nucleotide 263ggagagagcu
uccuguagcu
2026423DNAArtificialantisense nucleotide 264ucacccuuuc cacaggcguu gca
2326532DNAArtificialantisense
nucleotide 265ugcacuuugc aaugcugcug ucuucuugcu au
3226635DNAArtificialantisense nucleotide 266ucauaaugaa
aacgccgcca uuucucaaca gaucu
3526720DNAArtificialantisense nucleotide 267uuugugucuu ucugagaaac
2026830DNAArtificialantisense
nucleotide 268uuuagcaugu ucccaauucu caggaauuug
3026920DNAArtificialantisense nucleotide 269uccuguagaa
uacuggcauc
2027027DNAArtificialantisense nucleotide 270ugcagaccuc cugccaccgc agauuca
2727134DNAArtificialantisense
nucleotide 271uugcagaccu ccugccaccg cagauucagg cuuc
3427220DNAArtificialantisense nucleotide 272uguuuuugag
gauugcugaa
2027340DNAArtificialantisense nucleotide 273uguucugaca acaguuugcc
gcugcccaau gccauccugg
4027430DNAArtificialantisense nucleotide 274cucuuuucca gguucaagug
ggauacuagc
3027531DNAArtificialantisense nucleotide 275caagcuuuuc uuuuaguugc
ugcucuuuuc c
3127630DNAArtificialantisense nucleotide 276uauucuuuug uucuucuagc
cuggagaaag
3027728DNAArtificialantisense nucleotide 277cugcuuccuc caaccauaaa
acaaauuc
2827829DNAArtificialantisense nucleotide 278ccacucagag cucagaucuu
cuaacuucc
2927927DNAArtificialantisense nucleotide 279cuuccacuca gagcucagau cuucuaa
2728030DNAArtificialantisense
nucleotide 280caguccagga gcuaggucag gcugcuuugc
3028137DNAArtificialantisense nucleotide 281ucuugaagua
aacgguuuac cgccuuccac ucagagc
3728230DNAArtificialantisense nucleotide 282uccaacuggg gacgccucug
uuccaaaucc
3028321DNAArtificialantisense nucleotide 283acuggggacg ccucuguucc a
2128420DNAArtificialantisense
nucleotide 284ccguaaugau uguucuagcc
2028525DNAArtificialantisense nucleotide 285uuuugggcag
cgguaaugag uucuu
2528625DNAArtificialantisense nucleotide 286uuugggcagc gguaaugagu ucuuc
2528725DNAArtificialantisense
nucleotide 287uugggcagcg guaaugaguu cuucc
2528825DNAArtificialantisense nucleotide 288ugggcagcgg
uaaugaguuc uucca
2528925DNAArtificialantisense nucleotide 289gggcagcggu aaugaguucu uccaa
2529025DNAArtificialantisense
nucleotide 290ggcagcggua augaguucuu ccaac
2529125DNAArtificialantisense nucleotide 291gcagcgguaa
ugaguucuuc caacu
2529225DNAArtificialantisense nucleotide 292cagcgguaau gaguucuucc aacug
2529325DNAArtificialantisense
nucleotide 293agcgguaaug aguucuucca acugg
2529425DNAArtificialantisense nucleotide 294gcgguaauga
guucuuccaa cuggg
2529525DNAArtificialantisense nucleotide 295cgguaaugag uucuuccaac ugggg
2529625DNAArtificialantisense
nucleotide 296gguaaugagu ucuuccaacu gggga
2529725DNAArtificialantisense nucleotide 297guaaugaguu
cuuccaacug gggac
2529825DNAArtificialantisense nucleotide 298uaaugaguuc uuccaacugg ggacg
2529925DNAArtificialantisense
nucleotide 299aaugaguucu uccaacuggg gacgc
2530025DNAArtificialantisense nucleotide 300augaguucuu
ccaacugggg acgcc
2530125DNAArtificialantisense nucleotide 301ugaguucuuc caacugggga cgccu
2530225DNAArtificialantisense
nucleotide 302gaguucuucc aacuggggac gccuc
2530325DNAArtificialantisense nucleotide 303aguucuucca
acuggggacg ccucu
2530425DNAArtificialantisense nucleotide 304guucuuccaa cuggggacgc cucug
2530525DNAArtificialantisense
nucleotide 305uucuuccaac uggggacgcc ucugu
2530625DNAArtificialantisense nucleotide 306ucuuccaacu
ggggacgccu cuguu
2530725DNAArtificialantisense nucleotide 307cuuccaacug gggacgccuc uguuc
2530825DNAArtificialantisense
nucleotide 308uuccaacugg ggacgccucu guucc
2530920DNAArtificialantisense nucleotide 309gauugcuggu
cuuguuuuuc
2031020DNAArtificialantisense nucleotide 310ccucuugauu gcuggucuug
2031122DNAArtificialantisense
nucleotide 311gguaaugagu ucuuccaacu gg
2231220DNAArtificialantisense nucleotide 312acuggggacg
ccucuguucc
2031320DNAArtificialPRO 51 313ucaaggaaga uggcauuucu
2031420DNAArtificialPS 49 314ggccaaaccu
cggcuuaccu 20
User Contributions:
Comment about this patent or add new information about this topic: