NOVEL PNEUMOVIRUS COMPOSITIONS AND METHODS FOR USING THE SAME

Abstract

Provided are newly identified pneumoviruses that can infect mammals, including dogs cats and potentially humans. Isolated polynucleotides and proteins of the viruses, as well as the isolated viruses themselves are provided. Included are compositions and methods for detecting the viruses, methods and compositions for prophylaxis and/or therapy of disease signs that are positively correlated with the presence of the viruses, and isolated cells comprising the viruses. Intact virions, viral proteins, and fragments thereof are also provided.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application is a continuation of U.S. application Ser. No. 14/695,498, filed Apr. 24, 2015, which is a continuation of U.S. application Ser. No. 13/518,009, filed Jun. 21, 2012, now U.S. Pat. No. 9,028,834, issued May 12, 2015, which is the National Phase of International application no. PCT/US2010/061510, filed Dec. 21, 2010, which claims priority to U.S. application No. 61/288,401, filed Dec. 21, 2009, the disclosures of each of which are incorporated herein by reference.

FIELD OF THE INVENTION

[0002] The present invention relates generally to the field of virology and more specifically to newly discovered viruses in the family Paramyxoviridae, subfamily Pneumovirinae found in mammals, including canines and felines.

BACKGROUND OF THE INVENTION

[0003] Domestic dogs confined together, as in shelters, boarding kennels, or breeding facilities, are often affected with acute respiratory infections (kennel cough). The disease is transmitted rapidly and is difficult to eliminate as new animals are continually introduced. A spectrum of agents may produce a complex syndrome of multiple and sequentially overlapping infections making diagnosis and treatment difficult. Affected dogs have clinical signs ranging from mild dry cough and nasal discharge to pneumonia and death in severe cases. Cats are also infected with various agents that produce respiratory distress of varying degrees of severity. The same or similar viruses may also infect humans. Thus, there is an ongoing and unmet need to identify the agents that infect a variety of mammals and to develop compositions and methods for use in diagnosis, prophylaxis and/or therapy for such infections. The present invention meets these needs.

SUMMARY OF THE INVENTION

[0004] The present invention is based on our discovery of novel pneumoviruses. The viruses can infect different types of mammals, including but not necessarily limited to dogs, cats, and likely humans. The presence of the virus can be positively correlated with acute respiratory disease of canines (ARDC), or with respiratory disease in felines, or with respiratory or other disorders in humans or other mammals.

[0005] The invention provides isolated polynucleotides and proteins of the viruses, as well as the isolated viruses themselves. The invention includes compositions and methods for detecting the viruses, and methods and compositions for prophylaxis and/or therapy of disease signs that are positively correlated with the presence of the viruses. Also provided are isolated cells that comprise the virus(es).

[0006] The viruses of the invention are negative stranded RNA viruses. The invention includes isolated negative strands, the positive strands which have reverse complementarity to the negative strands, the DNA equivalents of the RNA polynucleotides, proteins that are encoded by the positive strands, and fragments of the polynucleotides and the proteins.

[0007] In certain embodiments, the isolated viruses contain a negative strand polynucleotide that comprises the sequence of SEQ ID NO:1 or a sequence that is at least 96% identical to the sequence of SEQ ID NO:1. Also provided are isolated polynucleotides that comprise the sequence of SEQ ID NO:2 or SEQ ID NO:3, or a polynucleotide that has a sequence that is at least 96% identical to the sequence of SEQ ID NO:2 or 3.

[0008] The invention provides a method of stimulating an immune response in a mammal. The stimulated immune response can be cell-mediated, humoral, or combinations thereof, and can provide a prophylactic and/or therapeutic benefit to the animal. The method of stimulating an immune response comprises administering to a mammal a composition comprising a polynucleotide and/or virus described herein, a viral protein encoded by the viral polynucleotides disclosed herein, a fragment of such a protein, or combinations thereof. The polynucleotides, viruses and/or the proteins and/or fragments thereof can be isolated from any suitable source, or they can be produced recombinantly using well known techniques.

[0009] The invention provides a method for detecting the presence of the virus in a biological sample obtained from a mammal. The method comprises obtaining a biological sample from a mammal and detecting from the biological sample a polynucleotide sequence comprised by the virus, or a viral protein or fragment thereof. The presence of the polynucleotide, protein, protein fragment or combination thereof is indicative that the mammal is infected with the virus.

BRIEF DESCRIPTION OF THE FIGURES

[0010] FIG. 1. Immunofluorescence assay of A72 cells using human respiratory syncytial virus-specific monoclonal antibodies (Mab). A) Mab 2G122 on infected cells. B) Mab 2G122 on uninfected cells. C) Mab 5H5N on infected cells. D) Mab 5H5N on uninfected cells. Primary Mab stocks were used as obtained from the manufacturer at a dilution of 1:100. The red background is produced by counter-staining with Evan's Blue.

[0011] FIG. 2. Immunofluorescence assay showing reactivity of a randomly selected canine serum submitted for non-respiratory related testing against infected and uninfected canine A72 cells. A) Serum on infected cells at a dilution of 1:320. B) Serum on uninfected cells at a dilution of 1:320. The red background is produced by counter-staining with Evan's Blue.

[0012] FIG. 3. A graphical representation of the organization of a viral genome comprising the sequence of SEQ ID NO:1.

DESCRIPTION OF THE INVENTION

[0013] The present invention provides novel isolated viruses, isolated polynucleotides and proteins of the viruses, compositions and methods for detecting the viruses, and compositions and methods for prophylaxis and/or therapy of disease signs that are positively correlated with the presence of the viruses in a mammal.

[0014] The viruses of the invention are negative (minus) stranded RNA viruses. Thus, the genetic material as packaged in the virion is a single strand of RNA that is the reverse complement of a positive strand. The positive strand is transcribed from the negative strand by an RNA-dependent RNA polymerase. The positive strand functions at least in part as an mRNA in that the viral proteins encoded by the positive strand are translated in the cytoplasm of infected cells, and thereafter participate in the assembly of new viral particles and packaging of the minus stranded genomes.

[0015] In certain embodiments the invention provides isolated viruses that contain a negative strand polynucleotide that comprises the sequence of SEQ ID NO:1 or a sequence that is at least 96% identical to the sequence of SEQ ID NO:1. The invention also includes polynucleotides which are complementary to the negative strand. In certain embodiments, these polynucleotides comprise the sequence presented in SEQ ID NO:4, or a sequence that is at least 96% identical to SEQ ID NO:4. Also provided are isolated polynucleotides that comprises the sequence of SEQ ID NO:1 or a sequence that is at least 96% identical to the sequence of SEQ ID NO:1, or which comprise the sequence of SEQ ID NO:4, or a sequence that is at least 96% identical to SEQ ID NO:4. Also provided are polynucleotides that comprise the sequence of SEQ ID NO:2 and/or SEQ ID NO:3, or a polynucleotide that has a sequence that is at least 96% identical to the sequence of SEQ ID NO:2 or 3. The reverse complements of these sequences and sequences that have at least 96% identity to the reverse complements are also provided. Combinations of all of the polynucleotides and proteins and fragments thereof disclosed herein are also included in the invention. The viral polynucleotides provided by the invention can be characterized in that they can function to support replication in live viruses (including attenuated viruses).

[0016] Also provided are cells that contain the viruses. In various embodiments, the cells that comprise the viruses are isolated cell, or cells that are propagated in vitro for attenuating the viruses, and/or as a source of the viruses for use as vaccines or for other purposes. Thus, isolated cells comprising the viruses, cell cultures and/or cell lines comprising the viruses, viruses and/or viral products present in cell culture medium, and isolated tissues comprising the viruses are all aspects of the invention.

[0017] In particular embodiments, the DNA equivalent of each RNA sequence described in the invention is provided. Thus, the invention includes each RNA sequence described herein where each U (uracil) in the RNA is replaced by T (thymine). Each of the viral polynucleotides described in this invention includes polynucleotides that are identical to the sequence presented in the SEQ ID NO designated for each polynucleotide, and further include all polynucleotides that are at least 96% identical to the sequences presented in the viral SEQ ID NOs. In particular embodiments, the polynucleotides that are at least 96% identical to the polynucleotide sequences presented in the sequence listing are at least 96% identical to those sequences across their entire length. Without intending to be bound by any particular theory, it is considered that polynucleotides sequences presented herein and including those having at least 96% identity to the viral polynucleotide sequences set forth in the sequence listing are distinct from the polynucleotides that are comprised by related viruses, such as viruses that are already known to infect murine mammals. It is also considered, again without intending to be bound by any particular theory, that attenuation of the viruses by, for instance, serial passaging, can result in viruses that comprise and/or transcribe polynucleotides that are at least 96% identical to the sequences presented in the sequence listing. The sequences that are not identical to the sequences specifically recited in the sequence listing can be between 96.0% to 99.9% identical to the presented sequences, including all integers to the first decimal point there between. All ranges of sequence identity between 96.0% to 100%, inclusive, are also embodiments of the invention.

[0018] Fragments of the polynucleotides are also included in the invention. Thus, in various embodiments, each viral polynucleotide (including the reverse complements and DNA equivalents thereof) includes fragments of the polynucleotides ranging in length from 10 nucleotides to the entire length of the polynucleotide, and including all integers there between. For instance, the invention includes polynucleotides comprising the sequence of SEQ ID NO:1 and including all fragments of that sequence that are between and include 10 nucleotides, up to 8,598 nucleotides in length, and including all integers there between. The polynucleotides provided by the invention, whether or not present in virions, can be longer than those described herein, since the presented sequences may not include the sequence of the entire viral genomes and/or the reverse complements and/or DNA equivalents thereof.

[0019] The invention also provides a method of stimulating an immune response in a mammal. The stimulated immune response is an immune response that can provide a prophylactic and/or therapeutic benefit to the animal. The stimulated immune response can be a humoral and/or a cell-mediated immune response. The stimulated immune response can be directed against any antigen and/or immunogen encoded by the virus. Thus, intact viral particles, each viral protein, and fragments of the viral proteins are embodiments of the invention that can be used for stimulating immune responses in mammals. In various embodiments, the animals in which the immune response is stimulated are Canis familiaris or Felis catus, i.e., domesticated dogs or cats, respectively.

[0020] In particular embodiments, the polynucleotide that comprises the sequence of SEQ ID NO:1 or a sequence that is at least 96% identical to the sequence of SEQ ID NO:1, or a protein or protein fragment encoded therein, or a viral particle encoded by the reverse complement of SEQ ID NO:1, is used to stimulate an immune response in a canine. The polynucleotide that comprises the sequence of SEQ ID NO:2 and/or SEQ ID NO:3, or a polynucleotide that has a sequence that is at least 96% identical to the sequence of SEQ ID NO:2 or 3, or a protein or protein fragment or a viral protein encoded by the reverse complement of SEQ ID NO:2 or 3 or a polynucleotide that has a sequence that is at least 96% identical to the reverse complement of SEQ ID NO:2 or 3, are preferably used to stimulate an immune response in felines. The same relationship between these sequences, proteins, protein fragments, and viral particles to the canines and felines applies to the use of these compositions for diagnostic purposes, but this does not in any way diminish the suitability for practicing the invention on other mammals, including humans.

[0021] The method of stimulating an immune response comprises administering to the mammal a composition comprising a virus described herein, a viral protein encoded by the viral polynucleotides disclosed herein, a fragment of such a protein, or combinations thereof. The viruses and/or the proteins and/or fragments thereof can be isolated from any suitable source, or they can be produced recombinantly using well known techniques. In various embodiments, the viral proteins provided by the invention for use in vaccines include but are not necessarily limited to the NS-1, NS-2, N, P, M, SH, G, F, M2-1, M2-2, L proteins, and combinations thereof. All nucleotide sequences encoding these proteins are included in the invention and can be determined by those skilled in the art using routine techniques.

[0022] The mammal to which a composition of the invention is administered can be any mammal that is at risk for, is suspected of having, or has been diagnosed with a condition that is positively correlated with the presence of one or more pneumonoviruses, including but not necessarily limited to the viruses disclosed herein. In one embodiment, the animal is a dog that is at risk for, is suspected of having or has been diagnosed with ARDC. In another embodiment, the mammal is a human that is at risk for, is suspected of having or is diagnosed with a respiratory disorder or any other disorder that can be positively associated with a virus described herein. In this regard, it is known in the art that viruses related to the newly discovered viruses described herein, such as murine pneumonia virus, can result in widespread infection of humans (See, for example, Pringle C R, Eglin R P. Murine pneumonia virus: seroepidemiological evidence of widespread human infection. J Gen Virol. 1986 June; 67 (Pt 6):975-82). Therefore, it is reasonable to consider the presently provided compositions and methods to have utility for stimulating immune responses in humans and for use in diagnosis of viral infections in humans.

[0023] The administration of a composition of the invention, i.e., a vaccine, to an animal can result in a prophylactic effect, meaning that the probability of infection is lower in animals that have received the vaccine relative to animals that have not, or the signs of disease that are positively correlated with the presence of the virus in the animal are less severe relative to an animal that has not received the vaccine. The administration of a vaccine of the invention can also have a therapeutic effect, meaning that the degree of infection (i.e., viral load or titer and/or other markers of degree of infection that are known to those skilled in the art) is lower in an infected animal subsequent to receiving the vaccine relative to an infected animal that does not receive the vaccine Likewise, the signs of disease that are positively correlated with the presence of the virus in the animal can be less severe in an infected animal that has received the vaccine relative to an animal that has not.

[0024] The viruses and/or the proteins and the polynucleotides described herein can be isolated, meaning they have been removed from their natural environment by, for example, separating the viruses from an animal and/or a biological sample obtained from the animal. In one embodiment, an isolated cell comprising a virus disclosed herein is considered to encompass an isolated virus. Further, the isolated viruses and/or proteins and/or fragments thereof and/or the isolated and/or recombinant polynucleotides of the invention can be purified to any desired degree of purification. Compositions provided by the invention may comprise, consist or consist essentially of the viruses, viral proteins, fragment(s) thereof, and/or polynucleotides, fragments of the polynucleotides and/or combinations thereof.

[0025] In one embodiment, the method comprises administering to a canine a composition that comprises a polynucleotide comprising the sequence of SEQ ID NO:1 or a polynucleotide that has a sequence that is at least 96% identical to the sequence of SEQ ID NO:1, such that an immune response directed against the virus is stimulated in the canine. In one embodiment, the polynucleotide is administered as a DNA vaccine. Methods for making, formulating pharmaceutical compositions comprising, and administering compositions comprising DNA vaccines are known in the art. In one embodiment, the polynucleotide that is administered to the canine is present in a viral particle. The viral particle can be isolated and/or recombinant. In various embodiments, the virus that is administered to the canine contains a protein that comprises an amino acid sequence that is part of a protein comprised by the viral particle. Predicted amino acid sequences of viral proteins comprised by the viral particle as encoded by the viral genome include the canine viral protein NS1, non-structural protein 1 (SEQ ID NO:7), NS2, non-structural protein 2 (SEQ ID NO:8), N, nucleoprotein (SEQ ID NO:9), P, phosphoprotein (SEQ ID NO:10), M, matrix protein (SEQ ID NO:11), SH, small hydrophobic protein (SEQ ID NO:12), G, attachment protein (SEQ ID NO:13), F, fusion protein (SEQ ID NO:14), M2, matrix proteins M2-1 (SEQ ID NO:15) and M2-2 (SEQ ID NO:16), L, RNA-dependent RNA polymerase, for which a partial sequence is provided (SEQ ID NO:17). Feline virus versions of these proteins are also provided by the invention.

[0026] In another embodiment, the method comprises administering to a feline a virus with a composition that contains a polynucleotide comprising the sequence of SEQ ID NO:2 and/or SEQ ID NO:3, or a polynucleotide that has a sequence that is at least 96% identical to the sequence of SEQ ID NO:2 or 3, such that an immune response directed against the virus is stimulated in the feline. In one embodiment, the polynucleotide that is administered to the feline is present in a viral particle. The particle can be isolated and/or recombinant.

[0027] In various embodiments, the virus that is administered to the feline contains a protein that comprises an amino acid sequence that is selected from SEQ ID NO:5 or SEQ ID NO:6.

[0028] In certain embodiments, the present invention comprises a vaccine which can provide a prophylactic and/or therapeutic effect directed against infection by a virus disclosed herein. The vaccine can contain live or killed (inactivated) virus or fragments thereof. Killed viruses are viruses that cannot replicate. Killed viruses can be prepared using any of a variety of techniques that are well known to those skilled in the art, which include but are not limited to heat inactivation and modification of viral proteins and/or nucleic acids, which methods can include but are not necessarily limited to exposure to paraformaldehyde, formalin and ultraviolet light. For example, viral proteins can be covalently modified by, for instance, cross-linking agents which can modify viral proteins so as to prevent one or more steps required for viral cellular entry and/or replication. Live viruses are considered to include attenuated viruses. Attenuated viruses are those that have reduced virulence relative to their unattenuated form. Thus, attenuated viruses can replicate, but only slowly relative to unattenuated viruses of the same type, and thus generally do not cause disease. Those skilled in the art will recognize these and other distinctions between unattenuated, attenuated and killed viruses such that they can be differentiated from one another.

[0029] Attenuation of a virus can be obtained using any standard technique. In one embodiment, the virus is attenuated by serial passaging in mammalian cell culture. Serial passaging can result in attenuation through a variety of mechanisms. Any cells that support replication of the virus, including but not limited to human cells, can be used in passaging for the purposes of viral propagation and/or attenuation. In various non-limiting examples, the cell cultures for passaging can be obtained or derived from canines or felines, such as from Canis familiaris or Felis catus, respectively. In one embodiment, the cells are primary cell cultures. In one embodiment, the cells are comprised by the canine derived A-72 cell line which has American Type Culture Collection (ATCC) catalog number CRL-1542. Any number of passages suitable for viral attenuation can be used. Those skilled in the art will be able to determine passaging parameters for attenuation of the viruses given the benefit of the present disclosure. In general, between 5-150, including all integers there between, and preferably between 20-50 passages may be used.

[0030] Compositions containing viruses can be provided as pharmaceutical preparations for use as vaccines. Compositions containing viruses can be prepared as a suspension or in a lyophilized form and can additionally contain pharmaceutically acceptable carriers and/or diluents customarily used for such compositions. Some examples of carriers and diluents suitable for use with the invention can be found in: Remington: The Science and Practice of Pharmacy (2005) 21st Edition, Philadelphia, Pa. Lippincott Williams & Wilkins. Specific non-limiting examples of carriers include stabilizers, preservatives and buffers. Specific non-limiting examples of stabilizers include carbohydrates (such as sorbitol, mannitol, starch, sucrose, dextran, glutamate or glucose), proteins (such as dried milk serum, albumin or casein) or degradation products thereof. Suitable specific non-limiting examples of buffers include alkali metal phosphates. Suitable specific non-limiting examples of preservatives are thimerosal, merthiolate and gentamicin. Suitable specific non-limiting examples of diluents include water, aqueous buffer (such as buffered saline), alcohols and polyols (such as glycerol).

[0031] Those skilled in the art will recognize that the vaccine preparations provided herein can comprise one or more compounds with adjuvant activity. Suitable adjuvants include but are not necessarily limited to Freund's incomplete adjuvant, threonyl muramyl dipeptide, aluminium hydroxide, -phosphate or -oxide, oil-in-water or water-in-oil emulsion based on, for example a mineral oil or a vegetable oil such as vitamin E acetate, and saponins.

[0032] The vaccines provided by the invention can be administered via any suitable route. In various embodiments, the vaccines can be administered parenterally, intramuscularly or subcutaneously, intravenously, or orally, including but not necessarily limited to nasally. Those skilled in the art will recognize that effective amounts of the vaccines can be determined using ordinary considerations, such as the type, size, age, environment, risk for or stage of infection, of the animal in which the stimulated immune response is desired. In general, live vaccines according to the invention can be administered in a dose of 10.sup.1-10.sup.6 plaque forming units (pfu) per animal, at for example a 1 ml dose. Inactivated vaccines may contain the antigenic equivalent of 10.sup.6-10.sup.10 pfu per animal.

[0033] The polynucleotides of the invention may be modified to carry a heterologous gene/genes, which can, for example, provide for immunization against not only the viruses disclosed herein, but also against other related or non-related viruses and/or other infectious agents. Likewise, the vaccine formulations provided herein can also comprise immunogenic agents that are intended to stimulate immune response against infectious agents that are distinct from the viruses disclosed herein. Thus, the invention contemplates combination vaccines for use in diverse mammals and against diverse infectious agents. The combination vaccines can include fusion proteins which comprise all or a portion of the viral proteins described herein, and which can contain polypeptide sequences from other proteins to provide a multivalent vaccine that is effective against different infectious agents. The invention further comprises administering other compositions that can provide a beneficial effect in the animal, which could be administered prior to, concurrently, or subsequent to conventional therapies for such infections.

[0034] The invention also provides methods for detecting the viruses disclosed herein. The method comprises obtaining a biological sample from an animal and detecting the presence of a viral protein and/or a viral polynucleotide in or from the sample. Any of the viral polynucleotides and proteins can be used in the method of detecting the presence or absence of the virus. It is considered that detecting the reverse complement or the DNA equivalent of SEQ ID NO:1, 2, or 3, is the same as detecting a polynucleotide comprising the sequence of SEQ ID NO:1, 2, or 3, or a sequence having at least 96% identity to any of those sequences.

[0035] Detection can be carried out using any suitable biological sample obtained from a mammal for which a diagnosis is desired. Suitable sources of biological samples include but are not limited to blood, mucosal scrapings, tissue biopsy, or saliva. In one embodiment, the biological sample comprises a nasal and/or a pharyngeal swab, or tracheal wash.

[0036] The presence or absence of the virus may be detected by testing for DNA, RNA or protein using a variety of techniques that are well known in the art. In certain embodiments, the presence of the virus is determined by detecting polynucleotides that comprise all or part of the viral genome, or are amplified from all or a part of the viral genome. In this regard, the invention includes determining the presence (or absence) of the virus by identifying polynucleotide sequences from the viral negative strand, the viral plus strand, or combinations thereof. The invention also includes detecting the DNA versions of the viral negative strand, plus strand, and combinations thereof. For example, in one embodiment, the reverse transcriptase polymerase chain reaction can be used to produce a DNA copy of the viral minus strand or a portion of it, and the DNA copy can serve as a template for amplification of the viral genome to obtain a plurality of double stranded DNA molecules that include the DNA version of the plus and minus strands or portions thereof in a hybridized duplex. Those skilled in the art will recognize that there are a wide variety of amplification techniques that can be used to increase the amount of genetic material for use in determining whether a virus is or was in a biological sample of interest, and the amplified (on unamplified) genetic material can be analyzed using many well known techniques and reagents for determining polynucleotide sequences. Thus, the invention includes any and all methods for obtaining and analyzing nucleic acids from a biological sample so that the presence or absence of viral polynucleotides can be ascertained, which include but are not limited to those methods that involve detecting the polynucleotides by hybridization of nucleic acid and/or other types of probes, and by determining the sequence of the viral polynucleotides using any known sequencing technique. All or a portion of the sequence can be determined and be used to identify the viral polynucleotides.

[0037] In certain embodiments, the invention provides a composition comprising an isolated viral polynucleotide and components used for nucleic acid hybridization and/or amplification. Accordingly the compositions can additionally comprise a DNA polymerase, a reverse transcriptase, free nucleotide triphosphates, salts, buffers and other reagents typically employed to hybridize and/or amplify nucleic acids. In one embodiment, the invention provides an isolated viral polynucleotide and/or a polynucleotide amplified from a viral polynucleotide, wherein the viral polynucleotide and/or the polynucleotide amplified from the viral polynucleotide is hybridized to one or more amplification primers and detection probes used in real-time nucleic acid amplification techniques.

[0038] The invention also provides an isolated viral polynucleotide and/or a polynuceotide amplified from a viral polynucleotide wherein the polynucleotide is hybridized to at least one probe that is present in an array. The array may be present on, for example, a chip used to determine the presence or absence of a plurality of distinct polynucleotides. Such chips are commercially available and can be customized to detect the presence or absence of essentially any polynucleotide.

[0039] In various embodiments, the invention further comprises fixing in a tangible medium the determination of whether or not the mammal has been infected by a virus disclosed herein. The tangible medium can be any type of tangible medium, such as any type of digital medium, including but not limited to digitized files that can be stored on a computer, a DVD, a CD-ROM, or an electronic mail message. The tangible medium could be provided to a health care provider so as to develop a treatment protocol for the infected mammal.

[0040] It will be recognized by those skilled in the art that, given the benefit of the present invention, a variety of reagents can be made and used in diagnostic methods for detecting the viruses disclosed herein. For instance, polyclonal or monoclonal antibodies can be made using the virions or portions of the virions, or isolated or recombinant viral proteins or fragments thereof. Thus, antibodies can be made to specifically recognize any antigenic determinant present in any of the viral proteins. In various embodiments, the antibodies recognize the NS-1, NS-2, N, P, M, SH, G, F, M2-1, M2-2, and L viral proteins, or portions or combinations thereof. It is expected that antibodies can be made that can discriminate the viruses of the present invention from other related virus, such as MPV.

[0041] The antibodies can be used in any technique whereby the presence or absence of a viral antigen in or from a biological sample can be determined. Such techniques include but are not limited to Western blotting, immunofluorescence, immunohistochemistry, and ELISA assays bead-based or conventional protein arrays.

[0042] In one embodiment, the invention provides an isolated and/or recombinant virus or virus protein that is present in a complex with an antibody.

[0043] The following Examples are meant to illustrate specific embodiments of the invention but should not be construed as limiting the invention in any way.

Example 1

[0044] We obtained samples from nasal and pharyngeal swabs from mixed-breed dogs and used to them to inoculate cultures of canine A72 cells (American Type Culture Collection, CRL-1542) to isolate respiratory viruses. At a late stage of passage in culture corresponding to approximately 21 days post-inoculation, some cultures showed subtle cytopathic changes. After continued passage the cultures exhibited small foci of rounded cells followed by rapid cell death throughout the culture. This pattern was subjectively judged to be uncharacteristic of the viruses commonly associated with ARDC. Thirteen individual viral isolates were obtained and are described in this Example. Testing with a panel of diagnostic reagents specific to common canine respiratory agents failed to identify a known virus. Further testing with additional reagents for other viruses ultimately revealed positive recognition by immunofluorescence assay (IFA) using a monoclonal antibody (Mab) pool against human respiratory syncytial virus (anti-HRSV, no. VP-R151, Vector Laboratories, Burlingame, Calif., USA). This antibody preparation is commonly used in our laboratory for the detection of bovine RSV (BRSV). The staining pattern included filamentous membrane-bound and free-floating virions and cytoplasmic inclusions, typical of the pattern observed in RSV-infected cells.

[0045] Following the initial IFA results, we attempted to amplify a fragment of the nucleocapsid gene (N) from the virus using PCR primers that were designed based on an alignment of human, bovine and ovine RSV sequences. This was unsuccessful. Stocks of the individual Mabs in the anti-RSV pool and their specificities were obtained from the manufacturer and used for IFA (FIG. 1). Staining with Mab 5H5N (M2 protein-specific) illuminated both virions and inclusions. Mab 2G122 (P protein-specific) stained primarily inclusions and gave a relatively uniform membrane-associated signal. No staining was obtained with Mabs 1C3 (N protein-specific) or 5A6 (F protein-specific). All 4 individual Mabs recognized BRSV by IFA. Recognition of the canine virus by only 2 of 4 Mabs and the inability to amplify a conserved region of the RSV genome suggested that it was related to, but was not a typical form of RSV.

[0046] Elucidation of the virus sequence was pursued by designing degenerate PCR primers based on highly conserved amino acid (aa) sequences within multiple sequence alignments of all viruses in the Pneumovirinae subfamily using the CODEHOP algorithm. Specific regions within the L (polymerase) and N genes were targeted. Sequencing of the reaction products and BLAST analysis revealed the virus to be closely related to murine pneumovirus (MPV), traditionally known as pneumovirus (or pneumonia virus) of mice. Two L gene PCR products were found to be 95% to 97% identical to MPV and an N gene fragment was approximately 96% identical.

[0047] To address the question of whether the newly identified pneumovirus was limited to the group of shelter dogs tested, we screened random canine serum samples and found that 6 of 27 animals had antibodies that specifically recognized the virus in infected cultures. Staining patterns were similar to that observed with the Mabs (FIG. 2). Bovine sera containing variable amounts of neutralizing antibodies against BRSV did not stain cells infected with the canine virus.

[0048] This Example demonstrates that the viruses isolated from 13 dogs with ARDC appear to be very closely related to MPV and we therefore consider them to be canine pneumovirus (CnPnV). Murine pneumovirus is one of only three virus species classified in the Pneumovirus genus in the Pneumovirinae subfamily in the family Paramyxoviridae. Human RSV is the type species and it is very closely related to BRSV while MPV is more distantly related. For example, the N protein nucleotide sequences of human and bovine RSV are approximately 94% identical to each other but only have 60% identity to MPV. There are only two fully sequenced strains of MPV, "Strain 15" and J3666, and they are 99.7% identical at the nucleotide level.

[0049] The association of CnPnV with ARDC may be pathogenic in some cases, particularly when involved in complex etiologies. By analogy, MPV is commonly known to infect laboratory rodent colonies and serological evidence points to infection of several wild rodent species but little is known about its natural ecology. In fact, it is not clear that rodents are the only natural hosts of MPV or if closely related viruses may be circulating in other species. Evidence for human infection in association with respiratory symptoms has been reported (Pringle C R, et al. J Gen Virol. 1986; 67:975-82). In nature, infection of rodents may be subclinical or latent. Clinical signs in laboratory mice can vary from asymptomatic to progression to pulmonary edema with high morbidity and mortality. Pathogenic strains, including both J3666 and Strain 15, can produce severe pneumonia and death in 6-10 days when inoculated at low dose. The pathogenicity or lack thereof may be virus and mouse strain dependent.

[0050] Multiple bacterial and viral agents can be involved in canine respiratory disease. CnPnV is thus considered to be another agent capable of initiating the sequence of events which compromises the defense mechanisms of the upper respiratory tract, leading to more severe disease.

Example 2

[0051] The materials and methods presented in this Example were used to obtain the results described in the remaining Examples.

Virus Isolation

[0052] Nasal and pharyngeal specimens were collected from mixed breed dogs with respiratory disease signs using moist swabs and were processed within 24 h of receipt at the Animal Heath Diagnostic Center at Cornell University. Prior to inoculation, the swabs were immersed in 3 ml minimum essential medium (MEM) with Earle's salts (Gibco 10370, Invitrogen, Carlsbad, Calif., USA), 0.5% bovine serum albumin, penicillin (200 U/ml), streptomycin (200 .mu.g/ml), and fungizone (2.5 .mu.g/ml) for 30 min and then mechanically agitated for 10 s. Aliquots of the nasal and pharyngeal swab extracts, 0.5 ml each, were combined and used to inoculate a single T25 flask of semi-confluent A72 cells (Binn et al., 1980) (CRL-1542, American Type Culture Collection, Manassas, Va., USA) without additional medium. The extract was allowed to remain on the monolayer for 1-3 h and it was then rinsed off with phosphate buffered saline (PBS). The cells were maintained in 6 ml of culture medium (Leibovitz's L15 medium, 10% heat inactivated fetal bovine serum (FBS), 200 U/ml penicillin, 200 .mu.g/ml streptomycin, 50 .mu.g/ml gentamicin) at 37.degree. C. and sub-cultured every 6-8 days. Un-inoculated control A72 cultures were carried in parallel throughout the isolation procedure.

Immunofluorescence Assays

[0053] Cells were allowed to attach to glass slides then rinsed with PBS and fixed in cold acetone for 10 min. Slides were air-dried and stored at -20.degree. C. prior to staining. Primary and secondary antibodies diluted in PBS were applied to slides and incubated for 30 min at 37.degree. C. After each incubation the slides were rinsed in PBS for 15 min. Staining was visualized by fluorescence microscopy. A Mab pool against HRSV was used in the initial identification (VP-R151, Vector Laboratories, Burlingame, Calif., USA) at a dilution of 1:400. Mouse anti-PVM (CL-603IFA, Charles River Laboratories, Wilmington, Mass. USA) supplied at a 1.times. concentration was used at a dilution of 1:20. The secondary antibody, FITC-labeled goat anti-mouse IgG (Feb. 18, 2006, KPL, Gaithersburg, Md., USA), was used at a dilution of 1:40 (12.5 .mu.g/ml).

RNA Purification

[0054] Total cellular RNA was purified from A72 cells (74106, Qiagen, Valencia, Calif., USA). Cells from one infected 25 cm.sup.2 flask showing approximately 50-75% cytopathic effect (CPE) were pelleted and purified through each column. Cell-free supernatants and medium containing swab eluates were purified (52906, Qiagen) using 140 .mu.l of sample. Purified RNAs were resuspended in 40 .mu.l RNase-free H.sub.2O.

PCR

[0055] The degenerate primer sequences initially used to obtain genomic fragments were based on alignments of viruses in the Pneumovirinae and were designed using the CODEHOP algorithm (blocks.fhcrc.org/codehop) (Rose et al, 1998). Reverse transcription-PCR (RT-PCR) was performed in a one-step reaction (210212, Qiagen) according to the manufacturer's instructions in a 25 .mu.l volume. One .mu.l of total RNA at a dilution of 1:5-1:10 and 10 pmole of each primer was used per reaction. Reaction conditions for the RT step were 30 min at 50.degree. C. then 15 min at 95.degree. C. Cycling conditions were 60 s at 95.degree. C., 30 s at 54-56.degree. C., and 60-90 s at 72.degree. C. for 35 cycles. Primer sets for N gene: N276F, tccgtgcaggccgaratggarcarg/P1R, (SEQ ID NO:35) ggaactcgggggcgaayttytccat; SEQ ID NO:36); L gene no 1: L428F, ccggatcttcggccayccnatggt/SEQ ID NO:37) L538R, ttcttaggaggggagatggcyttrtcrtt; SEQ ID NO: 38) L gene no. 2: L698F, catcaccgacctgtccaagttyaaycargc/SEQ ID NO: 39) L894R, ttgaagtcgtccaggatggtrttdatcca SEQ ID NO: 40. Two PCR primer sets used with swab samples from various geographic locations were designed based on alignments of the CnPnV, MPV J3666 and strain 15 sequences. G protein: G715F, ggcttctgtttcttcctttctgg/SEQ ID NO: 41) G1062R, ccgtggtggtgcctgtg SEQ ID NO: 42); SH1 protein: SH1F, atggatcctaacatgacctcayac SEQ ID NO: 43)/SH187R, gattgggatgaacygtgcattg SEQ ID NO: 44). Primers used to amplify low passage Brne isolates: G84F, tgtaaaagtgaaccaaatgtgta SEQ ID NO: 45)/G404R, aaatcttcaggtaaatcaggtc SEQ ID NO: 46); G849F, ttttaacaacaagaatcagtc SEQ ID NO: 47)/G1048R, ctcctaggtgcgggggttgg SEQ ID NO: 48). Reaction conditions for the G and SH amplicons were RT at 50.degree. C. for 30 min, inactivation/denaturation at 95.degree. C. for 15 min, and PCR at 60 s at 95.degree. C., 30 s at 54.degree. C., and 90 s at 72.degree. C., for 35 cycles.

Genomic Analysis

[0056] PCR products were sequenced using an Applied Biosystems Automated 3730 DNA Analyzer at the Cornell University Sequencing and Genotyping Core Laboratory. Primers used to determine the complete sequences were based on MPV sequences or previously determined CnPnV sequences. Overlapping PCR products were generated to cover gaps and primer binding regions. All regions were sequenced on both strands. CnPnV isolates were compared to the sequences of MPV strain 15 (GenBank AY729016) and J3666 (GenBank NC006579) using Lasergene (DNASTAR, Madison, Wis., USA).

Example 3

Isolation and Identification

[0057] Nasal and pharyngeal swab eluates were used to inoculate A72 cells. After a relatively long period in culture, usually appearing after the third or fourth passage, a limited CPE was observed. Initial CPE typically included scattered small foci of rounded cells, sometimes with small syncytia and vacuolization. This CPE progressed slowly over several days in stationary cultures. Subculturing often led to monolayers that maintained this low-grade CPE but in some cultures there was rapid progression and disintegration of the monolayer within 24-48 hours. This pattern, although similar to some herpesvirus infections, did not test positive for canine herpesvirus and did not appear to be typical of any of the canine respiratory viruses that are commonly isolated using similar procedures. Several of the early passage isolates replicated poorly in culture, showing little or no CPE following the transfer of supernatant to fresh cells. However, with continued passage some cultures developed more consistently transferable CPE and they were chosen for further analysis. Initial testing showed that sera from several unrelated dogs appeared to recognize viral antigen in cultures with CPE (data not shown) but tests for common canine respiratory viruses were negative. As reported in Example 1, Mabs specific for HRSV strongly recognized viral antigen. Positive IFA staining with an anti-PVM polyclonal serum was used for confirmation. The anti-PVM mouse serum only weakly recognized BRSV by IFA.

[0058] The original 13 isolates of CnPnV described in Example 1 originated from 2 animal shelters that were managed by the same organization. To investigate whether the virus was confined to these 2 locations, nasal or pharyngeal swab specimens from sick dogs from other geographic locations were tested by PCR. Nineteen dogs from 8 states in the USA (CO, GA, FL, IN, MO, NV, SC, VA) were tested using primer sets to the G and SH genes. Of the 19 specimens, one from Nevada, and 5 from a group of 9 dogs from South Carolina, were positive with both G and SH PCRs and were confirmed by sequencing. No PCR positive results were obtained from the other 13 dogs. Virus isolation on A72 cells was attempted on 6 additional nasal swab specimens from New York and Pennsylvania that were submitted for canine respiratory diagnostics. Of these, two additional isolates came from a veterinary hospital in New York City and another originated from a shelter in Philadelphia, Pa. These isolates were confirmed as CnPnV by IFA with anti-RSV and anti-PVM antibodies and subsequently with RT-PCR. While these RT-PCR and virus isolation results do not provide an accurate assessment of prevalence, they do indicate that infection with CnPnV is widespread.

Sequence Analysis

[0059] Previous studies have noted differences among viral isolates that may be attributable to the presence of natural quasispecies, mutation during passage in culture, or PCR artifacts. To determine the most accurate consensus sequences for the CnPnV isolates, multiple, overlapping RT-PCR reactions using total cellular RNA as the template were used. Viral isolates from two dogs were sequenced, one at tissue culture passage 4 (Ane4) and one at passage 17 (Brne17), and compared to the sequences of J3666 (Thorpe and Easton, 2005) and strain 15 (Krempl et al., 2005). An 8598 nt sequence (SEQ ID NO:1) was obtained from CnPnV-Ane4 beginning within the 3' leader adjacent to NS1 and extending a short distance into the L coding region, completely covering 9 of the predicted 10 genes in the genome. The gene order NS1-NS2-N-P-M-SH-G-F-M2-L was confirmed. The overall nt sequence identity of this region of CnPnV-Ane4 as compared to the MPV strains was 95.0% to J3666 and 94.7% to strain 15. The MPV strains are 99.7% identical to each other. No gaps were found within the coding regions in comparisons of CnPnV-Ane4 and the MPV strains. With exceptions to length differences for G and SH as described in sections 3.4 and 3.5, all of the coding regions in MPV and CnPnV-Ane4 were found to encode proteins of the same length.

Comparative Analysis of Non-Translated Regions

[0060] The boundaries of the GS and GE sequences in CnPnV were determined by alignment to the J3666 and strain 15 sequences (Thorpe, L. C., Easton, A. J., 2005. J. Gen. Virol. 86, 159-169; Krempl, et al. 2005. Virus Genes 30, 237-249). The GS sequences of MPV were described by Chambers et al. (1991) and more recently (Dibben and Easton, 2007) as 9 nt in length based on the RSV GS sequences as determined by Collins et al. (1986). Kuo et al. (1997) provided evidence that the 10th nt is also important in the GS of RSV and this has been equated to an MPV GS as being 10 nt in length (Krempl et al., 2005). In Table 1 the GS is presented as 10 nt to include both interpretations. Table 1 provides sequences of GS, GE and IGRs between coding regions in CnPnV-Ane4 compared to MPV strain 15 and J3666.

TABLE-US-00001 TABLE 1 Gene Gene NTR 3' GE IGR GS 5' length aggacaagug NS1 NS1 uaguuaauuaaaa caaagggu aggacaaauc* NS2 no diff. NS2 uaguuauagaaaaa uauu* aggauaaaua N no diff. N uauuuaauuaaaaa cuggaaaauau* aggauaaaua P 1 nt (+1[a]) longer P uaguuaauuaaaa uaac (-3[aca]) aggacaaaua M 3 nt shorter M uaguuaaauaaaa c (-1[u]) aggauaagua* SH no diff..sup.a SH uaguuaacaaaaaa uu aggauaagua G no diff. G uaguuaaugaaaaa uaagcuaugaua aggacaaaua F no diff. (+1[a]) uaau*(-1[c]) F uaguuaauuaaaaaa cuu.sup.b aggauaagug.sup.b M2 1 nt (+1[a]) longer M2 uaguuauauaaaaa uaaucaauu* aggaucaaua L 2 nt (-2[a]) shorter

[0061] For Table 1, there are no differences in NTR lengths between the two MPV strains. RNA sequences are in 5' to 3' orientation. *: Indicates at least 1 nt change from J3666 and strain 15. nt differences are in bold and underlined. GE: gene end; IGR: intergenic region; GS: gene start; no diff; no differences in length. .sup.aFor M-SH there is no difference in overall NTR length; one u is deleted from the IGR and another u is added upstream in the NTR. .sup.b The 3 nucleotide IGR and likely M2 GS is based on analysis by Dibben and Easton (Dibben, O., Easton, A. J., 2007. Mutational Analysis of the Gene Start Sequences of Pneumonia Virus of Mice. Virus Res. 130, 303-309). Sequences having 10 or more nucleotides shown in Table 1 have the following SEQ IDs: For the sequences in the "GE" column: NS1 uaguuaauuaaaa (SEQ ID N0:18); NS2 uaguuauagaaaaa (SEQ ID NO:19); N uauuuaauuaaaaa (SEQ ID NO:20); P (SEQ ID NO:18); M uaguuaaauaaaa (SEQ ID NO:21); SH uaguuaacaaaaaa (SEQ ID NO:22); G uaguuaaugaaaaa (SEQ ID NO:23); F uaguuaauuaaaaaa (SEQ ID NO:33); and M2 uaguuauauaaaaa (SEQ ID NO:34). For the sequences in the "IGR" column: N cuggaaaau u (SEQ ID NO:24); and G uaagcu ugauauaau (SEQ ID NO:25); For the sequences in the "GS" column; NS1 aggacaagug (SEQ ID NO:26; NS2 aggacaa uc (SEQ ID NO:27); N aggauaaaua (SEQ ID NO:28); P (SEQ ID NO:28); M aggacaaaua (SEQ ID NO:29); SH aggauaagua (SEQ ID NO:30); G (SEQ ID NO: 30); M2 aggauaagug (SEQ ID NO:31); F (SEQ ID NO:29) and L aggaucaaua SEQ ID NO:32).

[0062] A few length variations and nt differences were identified in the CnPnV-Ane4 NTRs, the majority found within the IGRs. There are no differences between the two MPV strains in the IGRs. Chambers et al. (Chambers, P., Matthews, D. A., Pringle, C. R., Easton, A. J., 1991. Virus Res. 18, 263-270) determined the GS of M2 from a cDNA clone but also noted the presence of 2 additional potential GS sequences (GS1 and GS2) in the 56 nt IGR. Mutational analysis later determined that the putative GS sequence was non-functional due to G instead of A at position 6. Subsequently, they determined that both the GS1 and GS2 sequences were capable of directing transcriptional initiation with the first sequence (GS1) being most important. They concluded that the originally identified GS sequence was misidentified likely due to a spontaneous deletion during cDNA cloning. In CnPnV the GS1 sequence for M2 that immediately follows the GE sequence for F is identical to the SH and G gene start sequences except at the 10th nt. It is believed that GS1 is used primarily and it is shown in Table 1. The GS2 for M2, AGGACAGGG, differs at only 2 positions from the consensus sequence reported in (Dibben, O., Easton, A. J., 2007. Virus Res. 130, 303-309) but may have limited activity because it does not have a conserved A at position 7. This differs from J3666 and strain 15 where the A is conserved. The third potential M2 GS (GS3) in CnPnV-Ane4 is identical to that of J3666 and strain 15 and is therefore presumed to be poorly-functional due to the G at position 6.

Analysis of Non-Structural Proteins

[0063] The non-structural small hydrophobic protein appears to tolerate significant variability as it is the most divergent protein between the two MPV strains where there is only 92.4% aa identity over the 92 aa that they share. In CnPnV-Ane4 the SH protein was the most divergent of all of the proteins examined when compared to MPV strain 15. CnPnV-Ane4 SH has 4 aa differences (95.7%) with J3666 and 9 aa differences (90.2%) with strain 15 and is therefore more similar to J3666 than the MPV strains are to each other (Table 2). Another significant difference is in the length of the SH ORF in different isolates. Both CnPnV-Ane4 and strain 15 have SH ORFs of 279 nt (92 aa) whereas the published J3666 SH sequence is 345 nt (114 aa). However, it has been reported that independently amplified sequences of J3666 coded variously for 92, 96, or 114 aa and suggested that these represented antibody escape mutants. Table 2 provides a summary of percent identity of CnPnV-Ane4 genes and proteins to viruses in the Pneumovirinae subfamily.

TABLE-US-00002 TABLE 2 MPV-J3666 MPV-strain 15 HRSV BRSV HMPV AMPV Gene nt/aa (.DELTA.nt/.DELTA.aa).sup.a nt/aa (.DELTA.nt/.DELTA.aa) nt/aa nt/aa nt/aa nt/aa NS1 94.4/93.8 (18/7) 94.4/93.8 (18/7) 44.1/15.0 43.4/15.9 NA NA NS2 95.1/94.2 (23/9) 95.1/94.2 (23/9) 42.6/22.6 42.6/22.6 NA NA N 95.9/97.7 (48/9) 96.0/98.0 (42/8) 61.1/59.6 61.4/60.4 51.7/45.2 50.3/42.6 P 95.0/96.6 (44/10) 94.3/94.4 (1/15) 49.9/41.9 48.8/44.4 40.8/29.1 40.4/29.1 M 96.6/98.1 (27/5) 96.5/98.1 (28/5) 54.6/41.6 54.4/42.0 51.4/39.1 50.5/39.1 SH 93.2/95.7 (19/4) 91.0/90.2 (25/9) 44.7/18.5 39.7/16.0 31.5/6.6 29.3/12.0 G 94.5/91.9 (66/32) 94.5/91.7 (65/33) 33.4/19.4 37.1/14.4 36.7/10.5 33.2/10.7 F 97.1/97.4 (47/14) 97.0/97.0 (49/16) 54.6/43.6 55.0/45.3 50.9/40.8 49.8/41.0 M2-1 95.5/96.6 (24/6) 95.5/96.6 (24/6) 53.5/42.6 52.4/42.0 47.0/36.0 48.7/36.0 M2-2 96.3/95.9 (11/4) 96.3/95.9 (11/4) 37.3/11.1 39.9/12.2 34.0/5.6 34.9/9.9

[0064] For Table 2, references to sequence GenBank no: HRSV, NC_001781; BRSV, NC_001989; HMPV, NC_004148.2; AMPV, NC_007652, which correspond to full length sequences of human RSV, bovine RSV, human metapneumovirus and avian metapneumovirus. nt: nucleotide; aa: amino acid; NA: not applicable. .sup.anumbers of nt and aa differences in each gene. The CnPnV-Ane4 P protein was found to have 10 aa differences with J3666 and 15 aa differences with strain 15. Alignments of MPV and RSV P show two regions of high homology flanking an amino-proximal region from aa 22 to 124 that has no obvious similarity and contains 6 to 7 gaps in the alignment. Two regions of moderate diversity were identified within this region of low homology in P when CnPnV-Ane4 was compared to both MPV strains. Seven aa differences are clustered in the aa 58-74 region and another 4 changes are found at aa 93-102. Probability plots predict the first region of diversity from aa 58-74 to have a relatively high surface probability and antigenic index. The second diverse region at aa 93-102 is hydrophobic and has low predicted surface probability (data not shown). A second overlapping internally-initiated ORF in P, capable of encoding a protein of 137 aa, has been identified in MPV. Synthetic mini-genomes constructs were used to study the protein produced from the second ORF and it was found to function as a transcription inhibitor. CnPnV-Ane4 has the second overlapping P ORF initiating at the same position but it terminates earlier and yields a protein of less than half the size at 54 aa due to a T to A transversion at nt 285 producing a TAG codon. (Dibben, O., et al. (2008) Virus Res. 131, 47-53). This leaves open the question as to whether a shorter P-2 protein, if produced, has the same functionality.

[0065] The remaining non-structural proteins include NS1 and NS2, and M1-1 and M1-2 which are translated from alternate reading frames in the M2 gene. There are no differences between these proteins in strain 15 and J3666. However, CnPnV has differences with the MPV isolates in each of these proteins. CnPnV-Ane4 NS1 has 7 aa differences compared with the two MPV strains, 4 located near the C-terminal end. In NS2 there are 9 aa differences that are relatively evenly distributed throughout the sequence. CnPnV-Ane4 is 96.6% identical to M2-1 with 6 aa differences and 95.9% identical to M2-2 with 4 aa differences.

Analysis of Structural Proteins

[0066] The G attachment proteins of pneumoviruses are of special interest because they are typically the most divergent and are primary targets for neutralizing antibody responses. The G protein is relatively highly conserved between the two MPV isolates having only 3 differences out of 396 aa (99.2%). In CnPnV the G protein is the least conserved protein in comparison to J3666 and the second least conserved after SH in strain 15. There are 32 aa and 33 aa differences with J3666 and strain 15 G respectively. The aa differences are generally randomly distributed with the exception of several differences clustered in the 113-124 region and 11 aa differences between aa 331 and 367 (based on the numbering of the Ane4 ORF). One notable observation is that the G ORF of CnPnV-Ane4 is 54 nt longer than its counterpart in J3666 and strain 15. An ACG to AUG change at position +29 from the GS creates an alternative initiation codon that is present in J3666 but not in strain 15. A second UAG to AAG change at +65 eliminates an in-frame termination codon. The G ORF encodes for a protein with a cytoplasmic tail of 53 aa, 18 aa longer than the published J3666 and strain 15 sequences. The sequence of J3666 has a termination codon at this position while strain 15 does not. Therefore, in both J3666 and strain 15 a single point mutation could produce the longer G variant. This is not unprecedented as the sequence of uncloned RT-PCR product amplified from the lungs of J3666-infected mice also had the U to A change at +65. It therefore, appears that the longer variant of G is not a feature that is unique to CnPnV. Given the benefit of the present disclosure, additional sequence data from canine and murine RT-PCR products to determine which variation predominates in natural infections can be determined using ordinary skill in the art. There appears to be some natural plasticity in the length of the G cytoplasmic tail and that the tail is itself a determinant of virulence. A recombinant MPV mutant lacking the G cytoplasmic tail was attenuated in BalbC mice but levels of replication were indistinguishable from wild-type virus (Krempl, C. D., et al. 2007. J. Virol. 81, 9490-9501). In RSV the first 6 aa of the cytoplasmic tail are essential for interaction with the M protein. It is not known if the N-proximal aa of G are essential for binding to M in MPV, but if it proves to be the case then the two variations of the cytoplasmic tail might differ in their ability to interact with M.

[0067] The F protein of CnPnV-Ane4 does not have a similar high level of diversity as is found in G and in fact it is one of the more conserved proteins in comparison to MPV. There are 14 aa differences with J3666 and 16 aa differences with strain 15 with 97% or greater conservation. Approximately one-half of the aa differences are within the final 55 aa at the COOH-terminal end, within or adjacent to the transmembrane domain, and most of the aa substitutions are of similar functional group type. Overall, N is the most highly conserved protein in relation to the other pneumoviruses. The central region of the protein from aa 245-333 in CnPnV-Ane4 reaches 92 to 93% identity with HRSV and BRSV. CnPnV-Ane4 N has 9 aa differences with J3666 and 8 differences with strain 15 that are relatively evenly distributed. None of the aa differences correspond to the invariant positions identified in the pneumoviruses or to the residues that interact with the RNA genome. It seems unlikely that any of these differences would have a significant effect on protein structure or function. The M protein has the highest level of conservation with the MPV isolates at 98.1%. The 5 aa differences are distributed evenly in the sequence and in every case the functional groups are conserved. Only one difference, a V to I change at aa 18, involves a residue that is normally found to be invariant in the M protein of pneumoviruses and metapneumoviruses.

Analysis at High and Low Passage in Culture

[0068] We identified one isolate to be well adapted to culture and consistently replicated and produced CPE when used to infect naive cultures. Although this isolate was at passage 17 (Brne17), it was sequenced and subsequently compared to the lower passage Ane4 isolate. Of the 8423 nt sequenced, 7 nt differences were identified in Brne17 (Table 3, provides nucleotide and amino acid differences between CnPnV-Ane4 and Brne at two stages of passage and ex vivo.) For Table 3, .sup.aNucleotide position from the beginning of each gene start. .sup.bAmino acid numbering based on the position in each ORF. ND: not determined; nt: nucleotide; aa: amino acid.

TABLE-US-00003 TABLE 3 Gene Position Ane4 Brne17 Brne3 BrneSw N nt 1081.sup.a T C ND ND -- -- -- M nt 543 A G ND ND aa 178.sup.b Q R SH-GNTR nt 397 -- +A ND ND -- -- G nt 392 A T T A aa 122 K stop stop K G nt 1053 T C T ND aa 342 L P L F nt 1098 A T ND ND -- -- -- F nt 1140 G A ND ND -- -- --

[0069] A single nt difference in N and 2 differences in F are synonymous substitutions. The addition of an A residue in the SH GE sequence in Brne17 is also non-coding. Two nt differences are non-synonymous substitutions causing a Q to R change at aa 178 in M and an L to P change at aa 342 in G. The most significant difference found in Brne17 is the substitution of a U for an A at nt 364 in the G ORF which results in replacement of a K residue with a termination codon at aa position 122. This position corresponds to nt 310 (aa 104) in the MPV strains. Termination at this position would give Brne17 a truncated G with a cytoplasmic tail of 53 aa, a transmembrane domain of 24 aa, and an ectodomain of only 44 aa. The finding of a truncated Gin Brne17 prompted additional sequencing of amplification products from passage 3 stock and from the original swab eluate (Brne3 and BrneSw). Interestingly, this showed that the truncated variant was already established as early as passage 3. However, in BrneSw there was an A at nt 364 indicating that the predominant viral species in the dog did not have a truncated G. A second independent set of RNA extractions and amplifications included samples from passages 1 and 2 and only in passage 1 was there an underlying peak on the electropherogram indicating a minor subpopulation with A at nt 364. Thus, it appears that the truncated form was rapidly selected for in culture. A similar mutation was identified in the culture passaged strain 15 (Warwick) where a single nt insertion creating a frameshift causes premature termination of the peptide. Translation initiating at an alternate downstream site can still produce a G protein that is 33 aa shorter and lacks a cytoplasmic tail. The truncated G has been suggested as at least a partial explanation for the reduced virulence of strain 15 (Warwick).

[0070] In RSV, the cold-passaged cp-52 mutant was found to have a large deletion that eliminated production of both G and SH but did not prevent replication in culture. The situation is analogous in MPV since a recombinant lacking the entire G gene replicated as well as complete recombinant virus in BHK-21 cell cultures but did not replicate to detectable levels in mice. This suggests that G is always essential in vivo and therefore the detection of only the non-truncated variant in BrneSw would be expected. Why there appeared to be complete selection of the truncated variant by the end of passage 2 is not clear. If selection is simply due to increased efficiency of replication then it would be expected that the absence of G increases replication rate and titer, but there is no supporting evidence that this is the case (Krempl et al., 2007, supra). Factors affecting selection of G deletion mutants may be specific to A72 cells.

[0071] FIG. 3 provides a graphical representation of the genome organization of SEQ ID NO:1. Those skilled in the art will recognize that the graphic in FIG. 3 is shown in the 3' to 5' orientation because it is a negative strand virus, while SEQ ID NO:1 presents the minus strand in 5' to 3' reading from left to right per conventional orientation. Thus, in FIG. 3, the L ORF is at the 3' end of the plus strand. Table 4 provides an annotation of the sequence presented in SEQ ID NO:1; abbreviations are: GS, gene start signal sequence; ORF, open reading frame; GE, gene end signal sequence; IGR, non-transcribed intergenic region. Unlisted nucleotides are believed to be untranslated.

TABLE-US-00004 TABLE 4 3' leader 1-25 NS1-GS 26-35 NS1-ORF 64-405 NS1-GE 423-435 IGR 436-443 NS2-GS 444-453 NS2-ORF 457-927 NS2-GE 1001-1014 IGR 1015-1018 N-GS 1019-1028 N-ORF 1050-2231 N-GE 2225-2238 IGR 2239-2249 P-GS 2250-2259 P-ORF 2259-3146 P-GE 3144-3156 IGR 3157-3160 M-GS 3161-3170 M-ORF 3171-3944 M-GE 4080-4092 IGR 4093 SH-GS 4094-4103 SH-ORF 4104-4382 SH-GE 4476-4489 IGR 4490-4491 G-GS 4492-4501 G-ORF 4520-5764 G-GE 5812-5825 IGR 5826-5841 F-GS 5842-5851 F-ORF 5851-7464 F-GE 7490-7504 IGR 7505-7507 M2-GS 7508-7517 M2-1-ORF 7564-8094 M2-2-ORF 8028-8324 M2-GE 8420-8433 IGR 8434-8442 L-GS 8443-8452 L-ORF 8452-8598

Example 4

[0072] We also analyzed biological samples obtained from felines for the presence of viruses that could be related to the canine virus identified herein. Sequences were obtained for two isolates, termed 29 Kentucky (29 KY) and 77 Kentucky (77 KY). Partial G gene sequences from 29 KY and 77 KY provide 353 nt corresponding to nt 726-1078 in the canine pneumovirus (CnPnV) Ane4 isolate described above and partial SH gene: 29 KY having 207 nt corresponding to nt 2-208 in CnPnV-Ane4.

[0073] The partial G nucleotide sequence of both isolates is 94.7% identical to murine pneumovirus (MPV) isolate J3666 and 98.0% identical to Ane4. The 117 amino acid (aa) sequence is 90.6% identical to J3666 and 97.4% identical to Ane4. Thus, the feline 29 KY/77 KY G sequences are more related to Ane4 than to J3666.

[0074] The partial SH nt sequence of 29 KY is 94.7% identical to J3666 and 97.1% identical to Ane4. The 69 aa sequence is 98.5% identical to J3666 and 97.1% identical to Ane4. Thus, the feline 29 KY sequence is slightly more related to J3666 than to Ane4. Nevertheless, it is considered that these sequences represent newly discovered feline pneumoviruses. Thus, the description of compositions and methods and all embodiments of the invention described for the canine pneumoviruses as set forth above apply to the feline viruses as well and those descriptions are therefore reiterated for the feline virus.

[0075] Those skilled in the art will recognize from the foregoing that we have demonstrated that CnPnV infection is not limited to dogs in the shelters from which it was originally isolated. It has been readily identified in specimens from dogs with acute respiratory disease. While a causative role in disease has not been definitively proven, the present invention has provided compositions and methods for identifying the presence of the virus and protecting against it, which are expected to be important in controlling respiratory disorders in mammals, including but not necessarily limited to such disorders in both felines and canines that are positively correlated with the presence of the virus.

Sequence CWU 1

1

4818598RNACanine pneumovirus 1ggagguggug gcggugaagu cgucuuucaa gaaaggucua ccaaugauac agcugccaag 60agcauuaguu ucacuaaaag auauaacacc cuuuaaguag cuaucuggua aguacacauu 120uacuucuugu ucaucaauag gauccauauu gauccuaauu gauuauuuuu auauaacuau 180ugaauuaaca ugaaguuggu ugacuuggaa ucuacacgau ugacaauuug agguuaauga 240cugauagcug acagaugaag gaauacaguc cacaucaucu ggccugacua uaaucaaagu 300cuaugaucac uugauuacuc cagcugaguu cuaugcagca caaggccucu uucacacagg 360cuaucacauc gacacgguuc cacaccacag acuucccugc aucuauuauu guggaugguc 420uagacccauc guaagugagg uuucuauuua cuccaauaau auacaucuua ugcaguaugg 480cuggauagua uuuaggcagc cuuaucauuc uguuuucaua gaagaauuua ucuucuccuc 540gauggagaug acagauugga ucagacugca uaauacuccu acuggcaguu ucuugagaau 600gugaauaacu ugucucuucu uguguaucuu gucuauauaa gauaguauag uguugcaacu 660ucucaaauaa uugacguccu cugcguugcu aucucuugcu uguauuacca gaccaacauc 720caaguucugu aacacaguaa ucaaacugcc acaagcuauc gacuuaguga uguuguuagu 780uuuuuccagg uaacuuuuca gcacaccuau gguucccaaa gcauacucag caguccuuug 840uggugcauca aauccacuga caucggucau ugcaucugug uugguaucga ggaaccuaua 900aauccuauug agcauauagu ucugccugag cauaagaguu uucaaaggcc auucccaaua 960uuuaugacua uacuugcaau uccucccucu ggaacaaaac ccuugaaccu caaauuugca 1020aggucucaca cucauccuac ccuguccuug agagucgagg gaaguguugg gucuggauug 1080ucacuuaucc uaaguuuuuu aauuaacuaa cucaauuaug auuugguaca auugucauga 1140uaaaacugug aggccaggug uacuuuugga uuucaaccug uugucccuga uaauuuucga 1200uaccuuauac agaaugaacc cuaugacaac cauuauuaua auaagcauua caacgaugag 1260cagaguuguu aguauauaug acuugguuaa acuuuuauuc acucuguuuu cacuuaaguc 1320caauaacuga ucagaggccu ucaagaaugu gcgugucuga uugaugcuau gcuccacauc 1380ucuuauagca acaucaaauu uaucgucagg gaaauucaaa gggucauauu ucaagaccaa 1440cgguuccccu cugacuacaa uugacuugcc aacuucuuug cuaagauagu agacaguguu 1500uccuacuuga accuugucca ccccuuuguu ggagauguag ugacaaccau cuggcagagu 1560ccuuauuaua ccuuugucau uauugaugac ugugcaacug uuauggccau agcaagacac 1620caagcaaccc auuguaguca guacugcugu acucacauau guuuuacuug uggaaaucuu 1680acaaucguag uuagugguau acauguuuga guugcauucu cgugauguua cagguacagu 1740uagacuuuuc agagugucac agaaaacaua cccauugugg aucucacaau cuguugguga 1800ugggaaguau gauaaugagc cugcauugug acaauaccag ccauuaucag cucuagccaa 1860acaagcauau uugucugcua uguuaugaca gucuauggaa cuucuuauua cccaacaauc 1920uguguccaua acaccaaaua acgggaguug uauuauauaa accagugugu cagcauugac 1980ugaacuuaau auugcuaacc cguuucuucu cauuauagcu cuacuagaua gcauuaucuc 2040uuuuuggccu gcugaaacag ccaugccgcc uacuauggag gugaguuccc ggucuguuaa 2100cauaaaagau gaaacagugu guguuaaucc ugcauuagau gaaaauucac gagacacuuc 2160caaaagucuu uuguugagcu guuggaaucu aaugacggca gugaugucgu gcacaucaca 2220agagacucgg uuuauuuuug ggaguaauuc uuuagauaug aaguuuuuca aaucaucuac 2280cacuuuagcu aacacugaca ugccguuggu uaggcuaaca acagccucau uuguauuucu 2340cacugcuucu cuaaucaaug caaucucacu uucaaguugc acugucuugg cuaaagccac 2400cccggcagug acugcagccc cgagaccaag aaucaaaccg aggaaccucu ucuuccuuuu 2460ggacuucaaa gcauuggaug auaacguucu caauucaucc acugcauuac uauagauugc 2520aagcucauga gccaauaacg aguugcugcu cuugcaugac ucaauauuua uuugagacaa 2580cuuaauugac auaacuguca ugugccaacc aguucuaagg gcacucuuau aaccugcagu 2640cucaacacua cauguggacu cauagaauuu uucuguuaau guauuugggu gaauugguuu 2700gguguugaag aucaacagaa gaacuagaaa gauccugcca ggaaucauau uuguccuauu 2760auaucauagc uuauuuuuca uuaacuacug auaagguugg uacuuauucu gaaguugauu 2820cggguauagg ucacucaaga auuagaccuc cuuggaaaua auuggagcau aggacaccaa 2880uagggcauug uugguuuggg uucucugcuu gagccuacuc cacauaaagc ucuuuucuuc 2940cgacugagag guuuggaccu ccuaggugcg gggguugggu uccuugucuc cgguguuggu 3000gccguggugg ugccugugga uuguuugagu gcagcuuugu gggcuugagg acuuaggcug 3060gguaguccaa cuagaggaag guuucuugaa agcccaucac augugagaua aaauuuguua 3120ucuaggccag cugagucugc acagguggua cacugagacu gauucuuguu guuaaaacua 3180ggaaacaaaa ucacaguuug gucugucagg uugcaguuug uucugggaac aacacaauua 3240gaguuacucc aauaguguuu ccaauaggaa ucauaaugca auuccaugau aacuuguuga 3300ccuccaagcu cuagcacggc ucucuucuga ucagugcuua aaccagaaag gaagaaacag 3360aagcccugau cacacccauu guggacacac auugcccuuu uguuggagua cguagaaagg 3420gugauaaccu cuauauaagg ugcagcuucu ucuccaccac cauuguuuaa gcccauguuu 3480gccuucauug uuacaagauc agggcaaaca cuuccuaagu ugaucucacg uuucucauaa 3540caguuggugc ugugauguuc aggaccugga ggcuugcaua gaacauccaa uacgagcuug 3600aaaucuucag guaaaucagg ucggucuaaa uaaccauugc uggagcauug guagggaucc 3660ucugagggug ucaccauuuu gacaggcucu gugaucucau gguggguggu gguuuuggug 3720ggggguuugg ugaguuuggg gguggucccu ugcucugugg ugggcaggcc ggcgguuggu 3780uggggagggg cggaugugcu guuccggauu guggcguucu gcguggaguu ggccuuguga 3840uuugauguga auacagaaua cauuaugacc cccacacaaa cugccacagc agcacuugug 3900agcacaccug caauaagcuu acacauuugg uucacuuuua caacaguccu aaauguguca 3960ggauacugag uucucucaaa guucaaauua guaaugcugc cacccacuuc aaaguuccuu 4020cccauacuaa gugaagucaa cuuguaguuc ucuuguauga gcugcucuac aguucucauc 4080agauuccaau aagauaguac uuauccuaau uuuuuguuaa cuagacgaca uacuacaagg 4140gcugauugaa ucaccuagca gaguggggcu gucuggcucg ggguuuauug aaggaugguu 4200uuugcuguuu auaacauuau guaguguucc uugaguacag guugcccggc agacuaguua 4260cauugauucc auaacuuggu ggagggugau ugggaugaac cgugcauugg cugcuagcga 4320ugccugaugu agcaaugcuc cuacugcugc aggccauuau cagcgcacac acuguguuga 4380uaacagcgca ugcaaggaga agagcuguca gggcuagugu aauauaugua ccaauacggc 4440ugcuggucau guugaucuca aaagugaucu gguaugaggu cauguuagga uccauuacuu 4500auccuguuuu auuuaacuaa gauaugugug uggauauaug uaggugugua uaugugguug 4560ucauauggau guugguggca auaguuguug ugcuagguga agucgugggg uuguaguuau 4620ggauugagcu gaucaauggu gacuuucuau uuuuucaucc acuuguugag gaacucuuga 4680guauguagga agugccugua uguuuccagu ucauaaucac aucauguagg cucaccugag 4740ucagauaggg acccaguucu gcaagaauuu gacaaccugc cuuuagcagu uugaaugcac 4800cuuuggugga ugugauguug aucacaagug ugaguccugc auagggagcc acccuagcug 4860uuguuauagc augguccaca ucggagcuua uagccugcuc cacacuauca agguccugcu 4920gucugauaga cagugcucug augaagacag guauagugaa ugacuuuaau guaacccugu 4980uauggaaaga gcagacagcu aucagcucau gaguaggucg auuaguagga guaaugcugg 5040gcacagugua aagcauguuu uuaggcuuaa gaauugucac acagaagcuc uuuuuaucaa 5100aagcaacagg uacuucguau uccauguugc cccagucauc caaggcuaug auagcauuua 5160ucaagaauug ccuuggcaug guggcuaggc cugcauugga agagcucaga ucuaccuuga 5220ucaugggacc auguacaguu gauauuugug uacagaugac uguaacauca uguagcaggu 5280ccaugacaga guuccuuggu agagauguuu gaaacauugg uauccacaca guuagugaua 5340uguuggcuga auguuuuuca accaaguuua gcuguauugc agcuguauau gggacgccau 5400gguacaucuc uaccaaguag gccuccauua uuuguccugu uauuuuaauu aacuaaaaau 5460uaaugcccau gaugucauca acauccaagu cuuccuuagc cuccucagca uugcuggaca 5520cuaucuuauc uaguauccuu gcucugucug uuaaauaaca ggcugaucca ucaucaguuu 5580cagcucuaga gcauuccuca ucucugagcu ucuccauggc cgccacucug ucauugacag 5640ucaagauguc agacuugauc aucucaauaa guucuucucu agugccuaua agggcaucuc 5700uaaucucauc ucuagcagug guugguccag caguugcuac cauaauggug uuuaaaaggc 5760cuauuaugua ggacaauuuc uccucuauuc uaucuagucu uuguucuaca gaugaagagc 5820ccggcucuug guuagucucc ucaaaugaua gauugcuuuc uucaucauaa ccaucagcgg 5880caaaaguuug cauggucucc uuguacaggc uggcucccaa uccgacaaac uucucuucgg 5940guuccacaaa ggugaccauc ggcuuccuag uuuucuuagu aucgguauca ucugagcagc 6000auggcuucuu acuguguucc ggauugucag gaaccucaua gacauguaug gucucuaugu 6060cagcaucaga uucuuugggc ugcucuuccu uguuuugggg aggugugggu gguggagugg 6120aggggggagu ggaggguuua gugaguuuug cggcggcucu ugggggggag aguuugaaug 6180agcugcgcaa uauggggggc auguuauauu uggugacaug aguggcagug uucgguauac 6240cagcuagugg uuuuuccgaa gggaaggauc uauguuugag aaacuccucu gccuucuugu 6300uggcauccuc accgacaaau ucaggggcaa auuucuccau auuuauccua uauuuuccag 6360uuuuuaauua aauaucauca ucaggagugu caucaacaau gcucagcugu uggcugauca 6420gcucucuuuc uucuguaguc aaguucaaug cacuguaguu aauuacauug uuguccuuua 6480aucuuucugc auaaucuuua gcagcaucaa agaguucucu auucuuagga gcacccuuau 6540aagacccuau gaugccuaaa ccugcagcau ugccaagcac gacacuggug aaauuaggac 6600aauuggucaa agagaggagu gaagcuuuug gauuauuucu aauaugauag aauccugccu 6660ccccuccuug cuucugggca uauucguaaa ccucaaccac cuguuccauc ucagcuugaa 6720cacuagcaug gccuagcaug auauucuuga cagauuuugc caguaaaccc caccucagca 6780uaacuugucc ugccccguau gcauucauga agagaccaga aaacagcccc ucaaccuugc 6840ugccacccuu gacacuagac ugggccaggc caaaagugau gaagacauca auguaauaag 6900gcuuccuuuc aaacagguca uaaaagcuuu cagcuaucug cuugaccucc agguugggau 6960aucuggcuuu cucggcuuuc agcacauuua aagcccuucu uuccacagca ucaaguccuc 7020cucugucucc ugcagcuaau uuggaaacaa cuaaugcugc aacacagaga acuauuacac 7080cacaaucugg ugcaucaugc cuccgauuau cagguaaccc ggcuccuguu uugaguucuu 7140uugcuaccac uccucuggcu uguaucucca gaucagcuaa auuggccgca ucuauuccca 7200cuauaucuag gacuuguauu uuauagucuu uuccuuguaa uuugauugua aaguccuuga 7260gcuguguguc cacacauuuu acauuguagc cggcuucucu caguauuuug augcugucau 7320cucugccuaa caaggacaug gcauauugga gcccuaucuc ugccacuucu ucgcagcggu 7380ugaaagcagu aaguaggaac augccaagug uccuugcaag ggccuucugc auagcaugac 7440cagauacacu gguuacaucg ccuguggauc ugguaacacu guauuugcag uuggacagca 7500ggcuauccuu guuugagaca ucauugagcu ucaacuuguc uagagacauu uuggcccggc 7560uuaggaugug uauuuauccu aauauuuuuc uauaacuaau cauagacuaa auacuguauc 7620acuugcuaua ggugguggga uucucugcug guuggagcga ucugaaucag cucagucauc 7680aucauccuca uuacagauca agucauggcc uggguacaga augcauccug ugcacucaau 7740ccagucuucu uugugcugua caaagaagaa cuuuggguau uucuccccag uuacuuucuu 7800cugccuccuu augcacuucc acucaaugcu gucugccuca gaugccauua ccauccaagc 7860caugucuucc acauauugcu uggccucaau guaccccauu uuuuccuuuu uaagucuauc 7920auugcagauc cugaugaagu uccgguugau guaucuagug auguuuugua agcucggcug 7980gaauuuuuca augagcaagu caagccaccu cucugagcuc ugugugguac gggacaccuu 8040gcccaucccu gcuucaucac ucgacucuuc acugucugaa auguucaaga uaguagcagg 8100uuuagaaaug gucugaguga acuuguucau agcuguggac auuaggauuu guccuacccu 8160uuguuuuaau uaacuacaua augugcuguc auuuuaacca cugaucagcu cugccaauag 8220cucacaugug gggucaaugg gaggcucuau cucuugcccu guaggacuaa acacgauauc 8280uuuugugaac caauguguua auguuuggcc ucuucuagua uuauggauga auuuggcagc 8340uugcacaaau ggucucaaca aguugcaguc ccuucccacg agguacacgg agagucucug 8400aucuugccau guacugcaca cccuagcacc ucuuaagauc guuuccaaau cugaccuauu 8460gaaguugguu auguggaaug ccaaccaugc agcucuucca ccauaaccaa gcuccaucau 8520cacauuacag cccaugauuc uggucuuuaa gacuaguugu cuccacuugu ccuaacuuuu 8580ucggaguggu ggguuugg 85982354RNAFeline pneumovirus 2ccgugguggu gccuguggau uguuugaguu cagcuuugug ggcuugagga cuuaggcugg 60guaguccaac uagagggagg uuucuugaaa gcccaucaca ugugagguaa aauuuguuau 120cuaggccagc ugagucugca caggugguac acugagacug auucuuguug uuaaaacuag 180gaaacaaaau cacaguuugg ucugucaggu ugcaguuugu ucugggaaca acacaauuaa 240aguugcucca auaguguuuc caauaggaau cauaaugcaa uuccaugaua gcuuguugac 300cuccaagcuc uagcacagcu cucuucugau cagugcuuaa accagaaagg aaga 3543207RNAFeline pneumovirus 3gauugggaug aacugugcau uggcugcuaa cgaugccuga uguagcaaug cuccuacugc 60ugcaggccau uaucagcgca cacacugugu ugauaacagc gcaugcaagg aggagagcug 120ucagggcuag uguaauguau gugccaauac ggcugcuggu cauguugauc ucaaaaguga 180ucugguguga ggucauguua ggaucca 20748598RNACanine pneumovirus 4ccaaacccac cacuccgaaa aaguuaggac aaguggagac aacuagucuu aaagaccaga 60aucaugggcu guaaugugau gauggagcuu gguuauggug gaagagcugc augguuggca 120uuccacauaa ccaacuucaa uaggucagau uuggaaacga ucuuaagagg ugcuagggug 180ugcaguacau ggcaagauca gagacucucc guguaccucg ugggaaggga cugcaacuug 240uugagaccau uugugcaagc ugccaaauuc auccauaaua cuagaagagg ccaaacauua 300acacauuggu ucacaaaaga uaucguguuu aguccuacag ggcaagagau agagccuccc 360auugacccca caugugagcu auuggcagag cugaucagug guuaaaauga cagcacauua 420uguaguuaau uaaaacaaag gguaggacaa auccuaaugu ccacagcuau gaacaaguuc 480acucagacca uuucuaaacc ugcuacuauc uugaacauuu cagacaguga agagucgagu 540gaugaagcag ggaugggcaa ggugucccgu accacacaga gcucagagag guggcuugac 600uugcucauug aaaaauucca gccgagcuua caaaacauca cuagauacau caaccggaac 660uucaucagga ucugcaauga uagacuuaaa aaggaaaaaa ugggguacau ugaggccaag 720caauaugugg aagacauggc uuggauggua auggcaucug aggcagacag cauugagugg 780aagugcauaa ggaggcagaa gaaaguaacu ggggagaaau acccaaaguu cuucuuugua 840cagcacaaag aagacuggau ugagugcaca ggaugcauuc uguacccagg ccaugacuug 900aucuguaaug aggaugauga ugacugagcu gauucagauc gcuccaacca gcagagaauc 960ccaccaccua uagcaaguga uacaguauuu agucuaugau uaguuauaga aaaauauuag 1020gauaaauaca cauccuaagc cgggccaaaa ugucucuaga caaguugaag cucaaugaug 1080ucucaaacaa ggauagccug cuguccaacu gcaaauacag uguuaccaga uccacaggcg 1140auguaaccag uguaucuggu caugcuaugc agaaggcccu ugcaaggaca cuuggcaugu 1200uccuacuuac ugcuuucaac cgcugcgaag aaguggcaga gauagggcuc caauaugcca 1260uguccuuguu aggcagagau gacagcauca aaauacugag agaagccggc uacaauguaa 1320aaugugugga cacacagcuc aaggacuuua caaucaaauu acaaggaaaa gacuauaaaa 1380uacaaguccu agauauagug ggaauagaug cggccaauuu agcugaucug gagauacaag 1440ccagaggagu gguagcaaaa gaacucaaaa caggagccgg guuaccugau aaucggaggc 1500augaugcacc agauuguggu guaauaguuc ucuguguugc agcauuaguu guuuccaaau 1560uagcugcagg agacagagga ggacuugaug cuguggaaag aagggcuuua aaugugcuga 1620aagccgagaa agccagauau cccaaccugg aggucaagca gauagcugaa agcuuuuaug 1680accuguuuga aaggaagccu uauuacauug augucuucau cacuuuuggc cuggcccagu 1740cuagugucaa ggguggcagc aagguugagg ggcuguuuuc uggucucuuc augaaugcau 1800acggggcagg acaaguuaug cugagguggg guuuacuggc aaaaucuguc aagaauauca 1860ugcuaggcca ugcuaguguu caagcugaga uggaacaggu gguugagguu uacgaauaug 1920cccagaagca aggaggggag gcaggauucu aucauauuag aaauaaucca aaagcuucac 1980uccucucuuu gaccaauugu ccuaauuuca ccagugucgu gcuuggcaau gcugcagguu 2040uaggcaucau agggucuuau aagggugcuc cuaagaauag agaacucuuu gaugcugcua 2100aagauuaugc agaaagauua aaggacaaca auguaauuaa cuacagugca uugaacuuga 2160cuacagaaga aagagagcug aucagccaac agcugagcau uguugaugac acuccugaug 2220augauauuua auuaaaaacu ggaaaauaua ggauaaauau ggagaaauuu gccccugaau 2280uugucgguga ggaugccaac aagaaggcag aggaguuucu caaacauaga uccuucccuu 2340cggaaaaacc acuagcuggu auaccgaaca cugccacuca ugucaccaaa uauaacaugc 2400cccccauauu gcgcagcuca uucaaacucu cccccccaag agccgccgca aaacucacua 2460aacccuccac uccccccucc acuccaccac ccacaccucc ccaaaacaag gaagagcagc 2520ccaaagaauc ugaugcugac auagagacca uacaugucua ugagguuccu gacaauccgg 2580aacacaguaa gaagccaugc ugcucagaug auaccgauac uaagaaaacu aggaagccga 2640uggucaccuu uguggaaccc gaagagaagu uugucggauu gggagccagc cuguacaagg 2700agaccaugca aacuuuugcc gcugaugguu augaugaaga aagcaaucua ucauuugagg 2760agacuaacca agagccgggc ucuucaucug uagaacaaag acuagauaga auagaggaga 2820aauuguccua cauaauaggc cuuuuaaaca ccauuauggu agcaacugcu ggaccaacca 2880cugcuagaga ugagauuaga gaugcccuua uaggcacuag agaagaacuu auugagauga 2940ucaagucuga caucuugacu gucaaugaca gaguggcggc cauggagaag cucagagaug 3000aggaaugcuc uagagcugaa acugaugaug gaucagccug uuauuuaaca gacagagcaa 3060ggauacuaga uaagauagug uccagcaaug cugaggaggc uaaggaagac uuggauguug 3120augacaucau gggcauuaau uuuuaguuaa uuaaaauaac aggacaaaua auggaggccu 3180acuugguaga gauguaccau ggcgucccau auacagcugc aauacagcua aacuugguug 3240aaaaacauuc agccaacaua ucacuaacug uguggauacc aauguuucaa acaucucuac 3300caaggaacuc ugucauggac cugcuacaug auguuacagu caucuguaca caaauaucaa 3360cuguacaugg ucccaugauc aagguagauc ugagcucuuc caaugcaggc cuagccacca 3420ugccaaggca auucuugaua aaugcuauca uagccuugga ugacuggggc aacauggaau 3480acgaaguacc uguugcuuuu gauaaaaaga gcuucugugu gacaauucuu aagccuaaaa 3540acaugcuuua cacugugccc agcauuacuc cuacuaaucg accuacucau gagcugauag 3600cugucugcuc uuuccauaac aggguuacau uaaagucauu cacuauaccu gucuucauca 3660gagcacuguc uaucagacag caggaccuug auagugugga gcaggcuaua agcuccgaug 3720uggaccaugc uauaacaaca gcuagggugg cucccuaugc aggacucaca cuugugauca 3780acaucacauc caccaaaggu gcauucaaac ugcuaaaggc agguugucaa auucuugcag 3840aacugggucc cuaucugacu caggugagcc uacaugaugu gauuaugaac uggaaacaua 3900caggcacuuc cuacauacuc aagaguuccu caacaagugg augaaaaaau agaaagucac 3960cauugaucag cucaauccau aacuacaacc ccacgacuuc accuagcaca acaacuauug 4020ccaccaacau ccauaugaca accacauaua cacaccuaca uauauccaca cacauaucuu 4080aguuaaauaa aacaggauaa guaauggauc cuaacaugac cucauaccag aucacuuuug 4140agaucaacau gaccagcagc cguauuggua cauauauuac acuagcccug acagcucuuc 4200uccuugcaug cgcuguuauc aacacagugu gugcgcugau aauggccugc agcaguagga 4260gcauugcuac aucaggcauc gcuagcagcc aaugcacggu ucaucccaau cacccuccac 4320caaguuaugg aaucaaugua acuagucugc cgggcaaccu guacucaagg aacacuacau 4380aauguuauaa acagcaaaaa ccauccuuca auaaaccccg agccagacag ccccacucug 4440cuaggugauu caaucagccc uuguaguaug ucgucuaguu aacaaaaaau uaggauaagu 4500acuaucuuau uggaaucuga ugagaacugu agagcagcuc auacaagaga acuacaaguu 4560gacuucacuu aguaugggaa ggaacuuuga aguggguggc agcauuacua auuugaacuu 4620ugagagaacu caguauccug acacauuuag gacuguugua aaagugaacc aaauguguaa 4680gcuuauugca ggugugcuca caagugcugc uguggcaguu uguguggggg ucauaaugua 4740uucuguauuc acaucaaauc acaaggccaa cuccacgcag aacgccacaa uccggaacag 4800cacauccgcc ccuccccaac caaccgccgg ccugcccacc acagagcaag ggaccacccc 4860caaacucacc aaacccccca ccaaaaccac cacccaccau gagaucacag agccugucaa 4920aauggugaca cccucagagg aucccuacca augcuccagc aaugguuauu uagaccgacc 4980ugauuuaccu gaagauuuca agcucguauu ggauguucua ugcaagccuc cagguccuga 5040acaucacagc accaacuguu augagaaacg ugagaucaac uuaggaagug uuugcccuga 5100ucuuguaaca augaaggcaa acaugggcuu aaacaauggu gguggagaag aagcugcacc 5160uuauauagag guuaucaccc uuucuacgua cuccaacaaa agggcaaugu guguccacaa 5220ugggugugau cagggcuucu guuucuuccu uucugguuua agcacugauc agaagagagc 5280cgugcuagag cuuggagguc aacaaguuau cauggaauug cauuaugauu ccuauuggaa 5340acacuauugg aguaacucua auuguguugu ucccagaaca aacugcaacc ugacagacca 5400aacugugauu uuguuuccua guuuuaacaa caagaaucag ucucagugua ccaccugugc 5460agacucagcu ggccuagaua acaaauuuua ucucacaugu gaugggcuuu caagaaaccu 5520uccucuaguu ggacuaccca gccuaagucc ucaagcccac aaagcugcac ucaaacaauc 5580cacaggcacc accacggcac caacaccgga gacaaggaac ccaacccccg caccuaggag 5640guccaaaccu cucagucgga agaaaagagc uuuaugugga guaggcucaa gcagagaacc 5700caaaccaaca

augcccuauu gguguccuau gcuccaauua uuuccaagga ggucuaauuc 5760uugagugacc uauacccgaa ucaacuucag aauaaguacc aaccuuauca guaguuaaug 5820aaaaauaagc uaugauauaa uaggacaaau augauuccug gcaggaucuu ucuaguucuu 5880cuguugaucu ucaacaccaa accaauucac ccaaauacau uaacagaaaa auucuaugag 5940uccacaugua guguugagac ugcagguuau aagagugccc uuagaacugg uuggcacaug 6000acaguuaugu caauuaaguu gucucaaaua aauauugagu caugcaagag cagcaacucg 6060uuauuggcuc augagcuugc aaucuauagu aaugcagugg augaauugag aacguuauca 6120uccaaugcuu ugaaguccaa aaggaagaag agguuccucg guuugauucu uggucucggg 6180gcugcaguca cugccggggu ggcuuuagcc aagacagugc aacuugaaag ugagauugca 6240uugauuagag aagcagugag aaauacaaau gaggcuguug uuagccuaac caacggcaug 6300ucaguguuag cuaaaguggu agaugauuug aaaaacuuca uaucuaaaga auuacuccca 6360aaaauaaacc gagucucuug ugaugugcac gacaucacug ccgucauuag auuccaacag 6420cucaacaaaa gacuuuugga agugucucgu gaauuuucau cuaaugcagg auuaacacac 6480acuguuucau cuuuuauguu aacagaccgg gaacucaccu ccauaguagg cggcauggcu 6540guuucagcag gccaaaaaga gauaaugcua ucuaguagag cuauaaugag aagaaacggg 6600uuagcaauau uaaguucagu caaugcugac acacugguuu auauaauaca acucccguua 6660uuugguguua uggacacaga uuguugggua auaagaaguu ccauagacug ucauaacaua 6720gcagacaaau augcuuguuu ggcuagagcu gauaauggcu gguauuguca caaugcaggc 6780ucauuaucau acuucccauc accaacagau ugugagaucc acaaugggua uguuuucugu 6840gacacucuga aaagucuaac uguaccugua acaucacgag aaugcaacuc aaacauguau 6900accacuaacu acgauuguaa gauuuccaca aguaaaacau augugaguac agcaguacug 6960acuacaaugg guugcuuggu gucuugcuau ggccauaaca guugcacagu caucaauaau 7020gacaaaggua uaauaaggac ucugccagau gguugucacu acaucuccaa caaaggggug 7080gacaagguuc aaguaggaaa cacugucuac uaucuuagca aagaaguugg caagucaauu 7140guagucagag gggaaccguu ggucuugaaa uaugacccuu ugaauuuccc ugacgauaaa 7200uuugauguug cuauaagaga uguggagcau agcaucaauc agacacgcac auucuugaag 7260gccucugauc aguuauugga cuuaagugaa aacagaguga auaaaaguuu aaccaaguca 7320uauauacuaa caacucugcu caucguugua augcuuauua uaauaauggu ugucauaggg 7380uucauucugu auaagguauc gaaaauuauc agggacaaca gguugaaauc caaaaguaca 7440ccuggccuca caguuuuauc augacaauug uaccaaauca uaauugaguu aguuaauuaa 7500aaaacuuagg auaagugaca auccagaccc aacacuuccc ucgacucuca aggacagggu 7560aggaugagug ugagaccuug caaauuugag guucaagggu uuuguuccag agggaggaau 7620ugcaaguaua gucauaaaua uugggaaugg ccuuugaaaa cucuuaugcu caggcagaac 7680uauaugcuca auaggauuua uagguuccuc gauaccaaca cagaugcaau gaccgauguc 7740aguggauuug augcaccaca aaggacugcu gaguaugcuu ugggaaccau aggugugcug 7800aaaaguuacc uggaaaaaac uaacaacauc acuaagucga uagcuugugg caguuugauu 7860acuguguuac agaacuugga uguuggucug guaauacaag caagagauag caacgcagag 7920gacgucaauu auuugagaag uugcaacacu auacuaucuu auauagacaa gauacacaag 7980aagagacaag uuauucacau ucucaagaaa cugccaguag gaguauuaug cagucugauc 8040caaucuguca ucuccaucga ggagaagaua aauucuucua ugaaaacaga augauaaggc 8100ugccuaaaua cuauccagcc auacugcaua agauguauau uauuggagua aauagaaacc 8160ucacuuacga ugggucuaga ccauccacaa uaauagaugc agggaagucu guggugugga 8220accgugucga ugugauagcc ugugugaaag aggccuugug cugcauagaa cucagcugga 8280guaaucaagu gaucauagac uuugauuaua gucaggccag augaugugga cuguauuccu 8340ucaucuguca gcuaucaguc auuaaccuca aauugucaau cguguagauu ccaagucaac 8400caacuucaug uuaauucaau aguuauauaa aaauaaucaa uuaggaucaa uauggauccu 8460auugaugaac aagaaguaaa uguguacuua ccagauagcu acuuaaaggg uguuauaucu 8520uuuagugaaa cuaaugcucu uggcagcugu aucauuggua gaccuuucuu gaaagacgac 8580uucaccgcca ccaccucc 85985116PRTFeline pneumovirus 5Leu Ser Gly Leu Ser Thr Asp Gln Lys Arg Ala Val Leu Glu Leu Gly 1 5 10 15 Gly Gln Gln Ala Ile Met Glu Leu His Tyr Asp Ser Tyr Trp Lys His 20 25 30 Tyr Trp Ser Asn Phe Asn Cys Val Val Pro Arg Thr Asn Cys Asn Leu 35 40 45 Thr Asp Gln Thr Val Ile Leu Phe Pro Ser Phe Asn Asn Lys Asn Gln 50 55 60 Ser Gln Cys Thr Thr Cys Ala Asp Ser Ala Gly Leu Asp Asn Lys Phe 65 70 75 80 Tyr Leu Thr Cys Asp Gly Leu Ser Arg Asn Leu Pro Leu Val Gly Leu 85 90 95 Pro Ser Leu Ser Pro Gln Ala His Lys Ala Glu Leu Lys Gln Ser Thr 100 105 110 Gly Thr Thr Thr 115 668PRTFeline pnuemovirus 6Asp Pro Asn Met Thr Ser His Gln Ile Thr Phe Glu Ile Asn Met Thr 1 5 10 15 Ser Ser Arg Ile Gly Thr Tyr Ile Thr Leu Ala Leu Thr Ala Leu Leu 20 25 30 Leu Ala Cys Ala Val Ile Asn Thr Val Cys Ala Leu Ile Met Ala Cys 35 40 45 Ser Ser Arg Ser Ile Ala Thr Ser Gly Ile Val Ser Ser Gln Cys Thr 50 55 60 Val His Pro Asn 65 7113PRTCanine pneumovirus 7Met Gly Cys Asn Val Met Met Glu Leu Gly Tyr Gly Gly Arg Ala Ala 1 5 10 15 Trp Leu Ala Phe His Ile Thr Asn Phe Asn Arg Ser Asp Leu Glu Thr 20 25 30 Ile Leu Arg Gly Ala Arg Val Cys Ser Thr Trp Gln Asp Gln Arg Leu 35 40 45 Ser Val Tyr Leu Val Gly Arg Asp Cys Asn Leu Leu Arg Pro Phe Val 50 55 60 Gln Ala Ala Lys Phe Ile His Asn Thr Arg Arg Gly Gln Thr Leu Thr 65 70 75 80 His Trp Phe Thr Lys Asp Ile Val Phe Ser Pro Thr Gly Gln Glu Ile 85 90 95 Glu Pro Pro Ile Asp Pro Thr Cys Glu Leu Leu Ala Glu Leu Ile Ser 100 105 110 Gly 8156PRTCanine pneumovirus 8Met Ser Thr Ala Met Asn Lys Phe Thr Gln Thr Ile Ser Lys Pro Ala 1 5 10 15 Thr Ile Leu Asn Ile Ser Asp Ser Glu Glu Ser Ser Asp Glu Ala Gly 20 25 30 Met Gly Lys Val Ser Arg Thr Thr Gln Ser Ser Glu Arg Trp Leu Asp 35 40 45 Leu Leu Ile Glu Lys Phe Gln Pro Ser Leu Gln Asn Ile Thr Arg Tyr 50 55 60 Ile Asn Arg Asn Phe Ile Arg Ile Cys Asn Asp Arg Leu Lys Lys Glu 65 70 75 80 Lys Met Gly Tyr Ile Glu Ala Lys Gln Tyr Val Glu Asp Met Ala Trp 85 90 95 Met Val Met Ala Ser Glu Ala Asp Ser Ile Glu Trp Lys Cys Ile Arg 100 105 110 Arg Gln Lys Lys Val Thr Gly Glu Lys Tyr Pro Lys Phe Phe Phe Val 115 120 125 Gln His Lys Glu Asp Trp Ile Glu Cys Thr Gly Cys Ile Leu Tyr Pro 130 135 140 Gly His Asp Leu Ile Cys Asn Glu Asp Asp Asp Asp 145 150 155 9393PRTCanine pneumovirus 9Met Ser Leu Asp Lys Leu Lys Leu Asn Asp Val Ser Asn Lys Asp Ser 1 5 10 15 Leu Leu Ser Asn Cys Lys Tyr Ser Val Thr Arg Ser Thr Gly Asp Val 20 25 30 Thr Ser Val Ser Gly His Ala Met Gln Lys Ala Leu Ala Arg Thr Leu 35 40 45 Gly Met Phe Leu Leu Thr Ala Phe Asn Arg Cys Glu Glu Val Ala Glu 50 55 60 Ile Gly Leu Gln Tyr Ala Met Ser Leu Leu Gly Arg Asp Asp Ser Ile 65 70 75 80 Lys Ile Leu Arg Glu Ala Gly Tyr Asn Val Lys Cys Val Asp Thr Gln 85 90 95 Leu Lys Asp Phe Thr Ile Lys Leu Gln Gly Lys Asp Tyr Lys Ile Gln 100 105 110 Val Leu Asp Ile Val Gly Ile Asp Ala Ala Asn Leu Ala Asp Leu Glu 115 120 125 Ile Gln Ala Arg Gly Val Val Ala Lys Glu Leu Lys Thr Gly Ala Gly 130 135 140 Leu Pro Asp Asn Arg Arg His Asp Ala Pro Asp Cys Gly Val Ile Val 145 150 155 160 Leu Cys Val Ala Ala Leu Val Val Ser Lys Leu Ala Ala Gly Asp Arg 165 170 175 Gly Gly Leu Asp Ala Val Glu Arg Arg Ala Leu Asn Val Leu Lys Ala 180 185 190 Glu Lys Ala Arg Tyr Pro Asn Leu Glu Val Lys Gln Ile Ala Glu Ser 195 200 205 Phe Tyr Asp Leu Phe Glu Arg Lys Pro Tyr Tyr Ile Asp Val Phe Ile 210 215 220 Thr Phe Gly Leu Ala Gln Ser Ser Val Lys Gly Gly Ser Lys Val Glu 225 230 235 240 Gly Leu Phe Ser Gly Leu Phe Met Asn Ala Tyr Gly Ala Gly Gln Val 245 250 255 Met Leu Arg Trp Gly Leu Leu Ala Lys Ser Val Lys Asn Ile Met Leu 260 265 270 Gly His Ala Ser Val Gln Ala Glu Met Glu Gln Val Val Glu Val Tyr 275 280 285 Glu Tyr Ala Gln Lys Gln Gly Gly Glu Ala Gly Phe Tyr His Ile Arg 290 295 300 Asn Asn Pro Lys Ala Ser Leu Leu Ser Leu Thr Asn Cys Pro Asn Phe 305 310 315 320 Thr Ser Val Val Leu Gly Asn Ala Ala Gly Leu Gly Ile Ile Gly Ser 325 330 335 Tyr Lys Gly Ala Pro Lys Asn Arg Glu Leu Phe Asp Ala Ala Lys Asp 340 345 350 Tyr Ala Glu Arg Leu Lys Asp Asn Asn Val Ile Asn Tyr Ser Ala Leu 355 360 365 Asn Leu Thr Thr Glu Glu Arg Glu Leu Ile Ser Gln Gln Leu Ser Ile 370 375 380 Val Asp Asp Thr Pro Asp Asp Asp Ile 385 390 10295PRTCanine pneumovirus 10Met Glu Lys Phe Ala Pro Glu Phe Val Gly Glu Asp Ala Asn Lys Lys 1 5 10 15 Ala Glu Glu Phe Leu Lys His Arg Ser Phe Pro Ser Glu Lys Pro Leu 20 25 30 Ala Gly Ile Pro Asn Thr Ala Thr His Val Thr Lys Tyr Asn Met Pro 35 40 45 Pro Ile Leu Arg Ser Ser Phe Lys Leu Ser Pro Pro Arg Ala Ala Ala 50 55 60 Lys Leu Thr Lys Pro Ser Thr Pro Pro Ser Thr Pro Pro Pro Thr Pro 65 70 75 80 Pro Gln Asn Lys Glu Glu Gln Pro Lys Glu Ser Asp Ala Asp Ile Glu 85 90 95 Thr Ile His Val Tyr Glu Val Pro Asp Asn Pro Glu His Ser Lys Lys 100 105 110 Pro Cys Cys Ser Asp Asp Thr Asp Thr Lys Lys Thr Arg Lys Pro Met 115 120 125 Val Thr Phe Val Glu Pro Glu Glu Lys Phe Val Gly Leu Gly Ala Ser 130 135 140 Leu Tyr Lys Glu Thr Met Gln Thr Phe Ala Ala Asp Gly Tyr Asp Glu 145 150 155 160 Glu Ser Asn Leu Ser Phe Glu Glu Thr Asn Gln Glu Pro Gly Ser Ser 165 170 175 Ser Val Glu Gln Arg Leu Asp Arg Ile Glu Glu Lys Leu Ser Tyr Ile 180 185 190 Ile Gly Leu Leu Asn Thr Ile Met Val Ala Thr Ala Gly Pro Thr Thr 195 200 205 Ala Arg Asp Glu Ile Arg Asp Ala Leu Ile Gly Thr Arg Glu Glu Leu 210 215 220 Ile Glu Met Ile Lys Ser Asp Ile Leu Thr Val Asn Asp Arg Val Ala 225 230 235 240 Ala Met Glu Lys Leu Arg Asp Glu Glu Cys Ser Arg Ala Glu Thr Asp 245 250 255 Asp Gly Ser Ala Cys Tyr Leu Thr Asp Arg Ala Arg Ile Leu Asp Lys 260 265 270 Ile Val Ser Ser Asn Ala Glu Glu Ala Lys Glu Asp Leu Asp Val Asp 275 280 285 Asp Ile Met Gly Ile Asn Phe 290 295 11257PRTCanine pneumovirus 11Met Glu Ala Tyr Leu Val Glu Met Tyr His Gly Val Pro Tyr Thr Ala 1 5 10 15 Ala Ile Gln Leu Asn Leu Val Glu Lys His Ser Ala Asn Ile Ser Leu 20 25 30 Thr Val Trp Ile Pro Met Phe Gln Thr Ser Leu Pro Arg Asn Ser Val 35 40 45 Met Asp Leu Leu His Asp Val Thr Val Ile Cys Thr Gln Ile Ser Thr 50 55 60 Val His Gly Pro Met Ile Lys Val Asp Leu Ser Ser Ser Asn Ala Gly 65 70 75 80 Leu Ala Thr Met Pro Arg Gln Phe Leu Ile Asn Ala Ile Ile Ala Leu 85 90 95 Asp Asp Trp Gly Asn Met Glu Tyr Glu Val Pro Val Ala Phe Asp Lys 100 105 110 Lys Ser Phe Cys Val Thr Ile Leu Lys Pro Lys Asn Met Leu Tyr Thr 115 120 125 Val Pro Ser Ile Thr Pro Thr Asn Arg Pro Thr His Glu Leu Ile Ala 130 135 140 Val Cys Ser Phe His Asn Arg Val Thr Leu Lys Ser Phe Thr Ile Pro 145 150 155 160 Val Phe Ile Arg Ala Leu Ser Ile Arg Gln Gln Asp Leu Asp Ser Val 165 170 175 Glu Gln Ala Ile Ser Ser Asp Val Asp His Ala Ile Thr Thr Ala Arg 180 185 190 Val Ala Pro Tyr Ala Gly Leu Thr Leu Val Ile Asn Ile Thr Ser Thr 195 200 205 Lys Gly Ala Phe Lys Leu Leu Lys Ala Gly Cys Gln Ile Leu Ala Glu 210 215 220 Leu Gly Pro Tyr Leu Thr Gln Val Ser Leu His Asp Val Ile Met Asn 225 230 235 240 Trp Lys His Thr Gly Thr Ser Tyr Ile Leu Lys Ser Ser Ser Thr Ser 245 250 255 Gly 1292PRTCanine pneumovirus 12Met Asp Pro Asn Met Thr Ser Tyr Gln Ile Thr Phe Glu Ile Asn Met 1 5 10 15 Thr Ser Ser Arg Ile Gly Thr Tyr Ile Thr Leu Ala Leu Thr Ala Leu 20 25 30 Leu Leu Ala Cys Ala Val Ile Asn Thr Val Cys Ala Leu Ile Met Ala 35 40 45 Cys Ser Ser Arg Ser Ile Ala Thr Ser Gly Ile Ala Ser Ser Gln Cys 50 55 60 Thr Val His Pro Asn His Pro Pro Pro Ser Tyr Gly Ile Asn Val Thr 65 70 75 80 Ser Leu Pro Gly Asn Leu Tyr Ser Arg Asn Thr Thr 85 90 13414PRTCanine pneumovirus 13Met Arg Thr Val Glu Gln Leu Ile Gln Glu Asn Tyr Lys Leu Thr Ser 1 5 10 15 Leu Ser Met Gly Arg Asn Phe Glu Val Gly Gly Ser Ile Thr Asn Leu 20 25 30 Asn Phe Glu Arg Thr Gln Tyr Pro Asp Thr Phe Arg Thr Val Val Lys 35 40 45 Val Asn Gln Met Cys Lys Leu Ile Ala Gly Val Leu Thr Ser Ala Ala 50 55 60 Val Ala Val Cys Val Gly Val Ile Met Tyr Ser Val Phe Thr Ser Asn 65 70 75 80 His Lys Ala Asn Ser Thr Gln Asn Ala Thr Ile Arg Asn Ser Thr Ser 85 90 95 Ala Pro Pro Gln Pro Thr Ala Gly Leu Pro Thr Thr Glu Gln Gly Thr 100 105 110 Thr Pro Lys Leu Thr Lys Pro Pro Thr Lys Thr Thr Thr His His Glu 115 120 125 Ile Thr Glu Pro Val Lys Met Val Thr Pro Ser Glu Asp Pro Tyr Gln 130 135 140 Cys Ser Ser Asn Gly Tyr Leu Asp Arg Pro Asp Leu Pro Glu Asp Phe 145 150 155 160 Lys Leu Val Leu Asp Val Leu Cys Lys Pro Pro Gly Pro Glu His His 165 170 175 Ser Thr Asn Cys Tyr Glu Lys Arg Glu Ile Asn Leu Gly Ser Val Cys 180 185 190 Pro Asp Leu Val Thr Met Lys Ala Asn Met Gly Leu Asn Asn Gly Gly 195 200 205 Gly Glu Glu Ala Ala Pro Tyr Ile Glu Val Ile Thr Leu Ser Thr Tyr 210 215 220 Ser Asn Lys Arg Ala Met Cys Val His Asn Gly Cys Asp Gln Gly Phe 225 230 235 240 Cys Phe Phe Leu Ser Gly Leu Ser Thr Asp Gln Lys Arg Ala Val Leu 245 250 255 Glu Leu Gly Gly Gln Gln Val Ile Met Glu Leu His Tyr Asp Ser Tyr 260 265 270 Trp Lys His Tyr Trp Ser Asn Ser Asn Cys Val Val Pro Arg Thr Asn 275 280 285 Cys Asn Leu Thr Asp Gln Thr Val Ile Leu Phe Pro Ser Phe Asn Asn 290 295 300 Lys Asn Gln Ser Gln Cys Thr Thr Cys Ala Asp Ser Ala Gly Leu Asp 305 310 315 320 Asn Lys Phe Tyr Leu Thr Cys Asp Gly Leu Ser Arg Asn Leu Pro Leu 325 330

335 Val Gly Leu Pro Ser Leu Ser Pro Gln Ala His Lys Ala Ala Leu Lys 340 345 350 Gln Ser Thr Gly Thr Thr Thr Ala Pro Thr Pro Glu Thr Arg Asn Pro 355 360 365 Thr Pro Ala Pro Arg Arg Ser Lys Pro Leu Ser Arg Lys Lys Arg Ala 370 375 380 Leu Cys Gly Val Gly Ser Ser Arg Glu Pro Lys Pro Thr Met Pro Tyr 385 390 395 400 Trp Cys Pro Met Leu Gln Leu Phe Pro Arg Arg Ser Asn Ser 405 410 14537PRTCanine pneumovirus 14Met Ile Pro Gly Arg Ile Phe Leu Val Leu Leu Leu Ile Phe Asn Thr 1 5 10 15 Lys Pro Ile His Pro Asn Thr Leu Thr Glu Lys Phe Tyr Glu Ser Thr 20 25 30 Cys Ser Val Glu Thr Ala Gly Tyr Lys Ser Ala Leu Arg Thr Gly Trp 35 40 45 His Met Thr Val Met Ser Ile Lys Leu Ser Gln Ile Asn Ile Glu Ser 50 55 60 Cys Lys Ser Ser Asn Ser Leu Leu Ala His Glu Leu Ala Ile Tyr Ser 65 70 75 80 Asn Ala Val Asp Glu Leu Arg Thr Leu Ser Ser Asn Ala Leu Lys Ser 85 90 95 Lys Arg Lys Lys Arg Phe Leu Gly Leu Ile Leu Gly Leu Gly Ala Ala 100 105 110 Val Thr Ala Gly Val Ala Leu Ala Lys Thr Val Gln Leu Glu Ser Glu 115 120 125 Ile Ala Leu Ile Arg Glu Ala Val Arg Asn Thr Asn Glu Ala Val Val 130 135 140 Ser Leu Thr Asn Gly Met Ser Val Leu Ala Lys Val Val Asp Asp Leu 145 150 155 160 Lys Asn Phe Ile Ser Lys Glu Leu Leu Pro Lys Ile Asn Arg Val Ser 165 170 175 Cys Asp Val His Asp Ile Thr Ala Val Ile Arg Phe Gln Gln Leu Asn 180 185 190 Lys Arg Leu Leu Glu Val Ser Arg Glu Phe Ser Ser Asn Ala Gly Leu 195 200 205 Thr His Thr Val Ser Ser Phe Met Leu Thr Asp Arg Glu Leu Thr Ser 210 215 220 Ile Val Gly Gly Met Ala Val Ser Ala Gly Gln Lys Glu Ile Met Leu 225 230 235 240 Ser Ser Arg Ala Ile Met Arg Arg Asn Gly Leu Ala Ile Leu Ser Ser 245 250 255 Val Asn Ala Asp Thr Leu Val Tyr Ile Ile Gln Leu Pro Leu Phe Gly 260 265 270 Val Met Asp Thr Asp Cys Trp Val Ile Arg Ser Ser Ile Asp Cys His 275 280 285 Asn Ile Ala Asp Lys Tyr Ala Cys Leu Ala Arg Ala Asp Asn Gly Trp 290 295 300 Tyr Cys His Asn Ala Gly Ser Leu Ser Tyr Phe Pro Ser Pro Thr Asp 305 310 315 320 Cys Glu Ile His Asn Gly Tyr Val Phe Cys Asp Thr Leu Lys Ser Leu 325 330 335 Thr Val Pro Val Thr Ser Arg Glu Cys Asn Ser Asn Met Tyr Thr Thr 340 345 350 Asn Tyr Asp Cys Lys Ile Ser Thr Ser Lys Thr Tyr Val Ser Thr Ala 355 360 365 Val Leu Thr Thr Met Gly Cys Leu Val Ser Cys Tyr Gly His Asn Ser 370 375 380 Cys Thr Val Ile Asn Asn Asp Lys Gly Ile Ile Arg Thr Leu Pro Asp 385 390 395 400 Gly Cys His Tyr Ile Ser Asn Lys Gly Val Asp Lys Val Gln Val Gly 405 410 415 Asn Thr Val Tyr Tyr Leu Ser Lys Glu Val Gly Lys Ser Ile Val Val 420 425 430 Arg Gly Glu Pro Leu Val Leu Lys Tyr Asp Pro Leu Asn Phe Pro Asp 435 440 445 Asp Lys Phe Asp Val Ala Ile Arg Asp Val Glu His Ser Ile Asn Gln 450 455 460 Thr Arg Thr Phe Leu Lys Ala Ser Asp Gln Leu Leu Asp Leu Ser Glu 465 470 475 480 Asn Arg Val Asn Lys Ser Leu Thr Lys Ser Tyr Ile Leu Thr Thr Leu 485 490 495 Leu Ile Val Val Met Leu Ile Ile Ile Met Val Val Ile Gly Phe Ile 500 505 510 Leu Tyr Lys Val Ser Lys Ile Ile Arg Asp Asn Arg Leu Lys Ser Lys 515 520 525 Ser Thr Pro Gly Leu Thr Val Leu Ser 530 535 15176PRTCanine pneumovirus 15Met Ser Val Arg Pro Cys Lys Phe Glu Val Gln Gly Phe Cys Ser Arg 1 5 10 15 Gly Arg Asn Cys Lys Tyr Ser His Lys Tyr Trp Glu Trp Pro Leu Lys 20 25 30 Thr Leu Met Leu Arg Gln Asn Tyr Met Leu Asn Arg Ile Tyr Arg Phe 35 40 45 Leu Asp Thr Asn Thr Asp Ala Met Thr Asp Val Ser Gly Phe Asp Ala 50 55 60 Pro Gln Arg Thr Ala Glu Tyr Ala Leu Gly Thr Ile Gly Val Leu Lys 65 70 75 80 Ser Tyr Leu Glu Lys Thr Asn Asn Ile Thr Lys Ser Ile Ala Cys Gly 85 90 95 Ser Leu Ile Thr Val Leu Gln Asn Leu Asp Val Gly Leu Val Ile Gln 100 105 110 Ala Arg Asp Ser Asn Ala Glu Asp Val Asn Tyr Leu Arg Ser Cys Asn 115 120 125 Thr Ile Leu Ser Tyr Ile Asp Lys Ile His Lys Lys Arg Gln Val Ile 130 135 140 His Ile Leu Lys Lys Leu Pro Val Gly Val Leu Cys Ser Leu Ile Gln 145 150 155 160 Ser Val Ile Ser Ile Glu Glu Lys Ile Asn Ser Ser Met Lys Thr Glu 165 170 175 1698PRTCanine pneumovirus 16Met Gln Ser Asp Pro Ile Cys His Leu His Arg Gly Glu Asp Lys Phe 1 5 10 15 Phe Tyr Glu Asn Arg Met Ile Arg Leu Pro Lys Tyr Tyr Pro Ala Ile 20 25 30 Leu His Lys Met Tyr Ile Ile Gly Val Asn Arg Asn Leu Thr Tyr Asp 35 40 45 Gly Ser Arg Pro Ser Thr Ile Ile Asp Ala Gly Lys Ser Val Val Trp 50 55 60 Asn Arg Val Asp Val Ile Ala Cys Val Lys Glu Ala Leu Cys Cys Ile 65 70 75 80 Glu Leu Ser Trp Ser Asn Gln Val Ile Ile Asp Phe Asp Tyr Ser Gln 85 90 95 Ala Arg 1749PRTCanine pneumovirus 17Met Asp Pro Ile Asp Glu Gln Glu Val Asn Val Tyr Leu Pro Asp Ser 1 5 10 15 Tyr Leu Lys Gly Val Ile Ser Phe Ser Glu Thr Asn Ala Leu Gly Ser 20 25 30 Cys Ile Ile Gly Arg Pro Phe Leu Lys Asp Asp Phe Thr Ala Thr Thr 35 40 45 Ser 1813RNACanine pneumovirus 18uaguuaauua aaa 131914RNAcanine pneumovirus 19uaguuauaga aaaa 142014RNAcanine pneumovirus 20uauuuaauua aaaa 142113RNAcanine pneumovirus 21uaguuaaaua aaa 132214RNAcanine pneumovirus 22uaguuaacaa aaaa 142314RNAcanine pneumovirus 23uaguuaauga aaaa 142411RNAcanine pneumovirus 24cuggaaaaua u 112516RNAcanine pneumovirus 25uaagcuauga uauaau 162610RNAcanine pneumovirus 26aggacaagug 102710RNAcanine pneumovirus 27aggacaaauc 102810RNAcanine pneumovirus 28aggauaaaua 102910RNAcanine pneumovirus 29aggacaaaua 103010RNAcanine pneumovirus 30aggauaagua 103110RNAcanine pneumovirus 31aggauaagug 103210RNAcanine pneumovirus 32aggaucaaua 103315RNAcanine pneumovirus 33uaguuaauua aaaaa 153414RNAcanine pneumovirus 34uaguuauaua aaaa 143525DNAartificial sequencedegenerate primer sequence 35tccgtgcagg ccgaratgga rcarg 253625DNAartificial sequencedegenerate primer 36ggaactcggg ggcgaaytty tccat 253724DNAartificial sequenceprimer 37ccggatcttc ggccayccna tggt 243829DNAartificial sequencedegenerate primer 38ttcttaggag gggagatggc yttrtcrtt 293930DNAartificial sequencedegenerate primer 39catcaccgac ctgtccaagt tyaaycargc 304029DNAartificial sequencedegenerate primer 40ttgaagtcgt ccaggatggt rttdatcca 294123DNAartificial sequenceprimer 41ggcttctgtt tcttcctttc tgg 234217DNAartificial sequenceprimer 42ccgtggtggt gcctgtg 174324DNAartificial sequencedegenerate primer 43atggatccta acatgacctc ayac 244422DNAartificial sequencedegenerate primer 44gattgggatg aacygtgcat tg 224523DNAartificial sequenceprimer 45tgtaaaagtg aaccaaatgt gta 234622DNAartificial sequenceprimer 46aaatcttcag gtaaatcagg tc 224721DNAartificial sequenceprimer 47ttttaacaac aagaatcagt c 214820DNAartificial sequenceprimer 48ctcctaggtg cgggggttgg 20

Claims

1. A pharmaceutical preparation for use as vaccine, the pharmaceutical preparation comprising an attenuated or an inactivated virus comprising a polynucleotide that is at least 96% identical to the sequence of SEQ ID NO: 1, 2 or 3, the pharmaceutical preparation further comprising an adjuvant.

2. The pharmaceutical preparation of claim 1, wherein the adjuvant is selected from the group consisting of aluminum hydroxide, aluminum phosphate, aluminum oxide, an oil-in-water emulsion, a water-in-oil emulsion, and combinations thereof.

3. The pharmaceutical preparation of claim 1, wherein the virus comprises a polynucleotide that is at least 96% identical to the sequence of SEQ ID NO: 1.

4. The pharmaceutical preparation of claim 1, wherein the virus comprises a polynucleotide that is at least 96% identical to the sequence of SEQ ID NO: 2.

5. The pharmaceutical preparation of claim 1, wherein the virus comprises a polynucleotide that is at least 96% identical to the sequence of SEQ ID NO: 3.

6. The pharmaceutical preparation of claim 1, wherein the virus is attenuated.

7. The pharmaceutical preparation of claim 1, wherein the virus is inactivated.

8. The pharmaceutical preparation of claim 2, wherein the virus is attenuated.

9. The pharmaceutical preparation of claim 2, wherein the virus is inactivated.

10. A method of stimulating an immune response in a mammal comprising administering to the mammal a pharmaceutical preparation of claim 1, wherein an immune response is stimulated in the mammal subsequent to the administration.

11. The method of claim 11 wherein the adjuvant in the pharmaceutical preparation is selected from the group consisting of aluminum hydroxide, aluminum phosphate, aluminum oxide, an oil-in-water emulsion, a water-in-oil emulsion, and combinations thereof.

12. The method of claim 10, wherein the virus comprises a polynucleotide that is at least 96% identical to the sequence of SEQ ID NO: 1, and wherein the mammal is a canine.

13. The method of claim 10, wherein the virus comprises a polynucleotide that is at least 96% identical to the sequence of SEQ ID NO: 2 or SEQ ID NO:3, and wherein the mammal is a feline.

14. The method of claim 10, wherein the virus is attenuated.

15. The method of claim 10, wherein the virus is inactivated.

16. The method of claim 11, wherein the virus is attenuated.

17. The method of claim 11, wherein the virus is inactivated.

18. The method of claim 11, wherein the mammal is a canine or a feline.

19. The method of claim 18, wherein the virus is attenuated.

20. The method of claim 18, wherein the virus is inactivated.

Images