Patent application title: STABLE FUNGAL CEL6 ENZYME VARIANTS
Inventors:
IPC8 Class: AC12N942FI
USPC Class:
435209
Class name: Hydrolase (3. ) acting on glycosyl compound (3.2) acting on beta-1, 4-glucosidic bond (e.g., cellulase, etc. (3.2.1.4))
Publication date: 2016-09-01
Patent application number: 20160251642
Abstract:
The disclosure provides variant Ce16a enzymes having increased
thermostability, methods of making and using such polypeptides.Claims:
1. A recombinant polypeptide comprising at least 80% identity to SEQ ID
NO:4 and having one or more amino acid substitutions at residues selected
from the group consisting of N38, S54, V151, V154, M158, C269, Q300,
S316, S340, S430, and S437, and wherein the polypeptide has cellulase
activity and comprises increased thermostability compared to a wild-type
enzyme of SEQ ID NO: 4, 6, or 8.
2. The recombinant polypeptide of claim 1, further comprising a cellulose binding domain (CBD) operably linked to the polypeptide.
3. The recombinant polypeptide of claim 2, wherein the CBD comprises a sequence as set forth in SEQ ID NO:10.
4. The recombinant polypeptide of claim 1, wherein the polypeptide comprises one or more substitutions selected from the group consisting of N38S, S54F, S54M, V151A, V154E, M158L, C269A, C269G, C269L, C269S, Q300L, S316R, S340P, S340W, S430P, S437F, and S437W.
5. The recombinant polypeptide of claim 1 comprising SEQ ID NO:4 having substitutions at a positions selected from the group consisting of: (a) one or more residue selected from the group consisting of N38, S54, V151, V154, C269, S316, S430 and any combination thereof; (b) M158 and one or more additional residues selected from the group consisting of N38, S54, V151, V154, C269, S316, and S430; (c) Q300 and one or more additional residue selected from the group consisting of N38, S54, V151, V154, C269, S316, and S430; (d) S340 and one or more additional residue selected from the group consisting of N38, S54, V151, V154, C269, S316, and S430; and (e) S437 and one or more additional residue selected from the group consisting of N38, S54, V151, V154, C269, S316, and S430.
6. The recombinant polypeptide of claim 5, comprising SEQ ID NO:4 and having having substitutions selected from the group consisting of: (a) one or more substitution selected from the group consisting of N38S, S54F, S54M, V151A, V154E, C269A, C269G, C269L, C269S, S316R, and S430P; (b) M158L and one or more additional substitutions selected from the group consisting of N38S, S54F, S54M, V151A, V154E, C269A, C269G, C269L, C269S, S316R, and S430P; (c) Q300L and one or more additional substitutions selected from the group consisting of N38S, S54F, S54M, V151A, V154E, C269A, C269G, C269L, C269S, S316R, and S430P; (d) S340P and one or more additional substitutions selected from the group consisting of N38S, S54F, S54M, V151A, V154E, C269A, C269G, C269L, C269S, S316R, and S430P; (e) S340W and one or more additional substitutions selected from the group consisting of N38S, S54F, S54M, V151A, V154E, C269A, C269G, C269L, C269S, S316R, and S430P; (f) S437F and one or more additional substitutions selected from the group consisting of N38S, S54F, S54M, V151A, V154E, C269A, C269G, C269L, C269S, S316R, and S430P; (g) S437P and one or more additional substitutions selected from the group consisting of N38S, S54F, S54M, V151A, V154E, C269A, C269G, C269L, C269S, S316R, and S430P; and (h) S437W and one or more additional substitutions selected from the group consisting of N38S, S54F, S54M, V151A, V154E, C269A, C269G, C269L, C269S, S316R, and S430P.
7. A recombinant polypeptide comprising at least 80% identity to SEQ ID NO:6 and having one or more amino acid substitutions at residues selected from the group consisting of G37, Q53, V155, V158, Q162, L276, I307, K323, P347, T436, and Y443, and wherein the polypeptide has cellulase activity and comprises increased thermostability compared to a wild-type enzyme of SEQ ID NO: 4, 6, or 8.
8. The recombinant polypeptide of claim 7, wherein the substitutions are selected from the group consisting of G37S, Q53F, Q53M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, K323R, P347W, T436P, Y443F, and Y443W.
9. The recombinant polypeptide of claim 7, wherein the polypeptide comprising SEQ ID NO:6 has up to 50, 25, 10, or 5 conservative amino acid substitutions excluding specific residues G37, Q53, V155, V158, Q162, L276, I307, K323, P347, T436, and/or Y443, wherein at least one or more of these specific residues have substitutions selected form the group consisting of G37S, Q53F, Q53M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, K323R, P347W, T436P, Y443F, and Y443W.
10. The recombinant polypeptide of claim 7 comprising SEQ ID NO:6 having substitutions at a positions selected from the group consisting of: (a) a residue selected from the group consisting of G37, Q53, V155, V158, Q162, L276, I307, K323, P347, and T436; and (b) Y443 and one or more additional residue selected from the group consisting of G37, Q53, V155, V158, Q162, L276, I307, K323, P347, and T436.
11. The recombinant polypeptide of claim 7, comprising SEQ ID NO:6 and having substitutions selected from the group consisting of: (a) a substitution selected from the group consisting of G37S, Q53F, Q53M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, K323R, P347W, and T436P; (b) Y443F and one or more additional substitutions selected from the group consisting of G37S, Q53F, Q53M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, K323R, P347W, T436P; and (c) Y443P and one or more additional substitutions selected from the group consisting of G37S, Q53F, Q53M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, K323R, P347W, T436P; and (d) Y443W and one or more additional substitutions selected from the group consisting of G37S, Q53F, Q53M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, K323R, P347W, and T436P.
12. A recombinant polypeptide comprising at least 80% identity to SEQ ID NO:8 and having one or more amino acid substitutions at residues selected from the group consisting of N38, L54, V155, V158, Q162, L276, I307, R323, 5347, T436, and Y443, and wherein the polypeptide has cellulase activity and comprises increased thermostability compared to a wild-type enzyme of SEQ ID NO: 4, 6, or 8.
13. The recombinant polypeptide of claim 12 comprising SEQ ID NO:8 having substitutions at a positions selected from the group consisting of: (a) a residue selected from the group consisting of N38, L54, V155, V158, Q162, L276, I307, R323, S347, and T436; and (b) Y443 and one or more additional residue selected from the group consisting N38, L54, V155, V158, Q162, L276, I307, R323, S347, and T436.
14. The recombinant polypeptide of claim 12, comprising SEQ ID NO:8 and having having substitutions selected from the group consisting of: (a) a residue selected from the group consisting of N38S, L54F, L54M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, S347P, S347W, and T436P; (b) Y443F and one or more additional substitutions selected from the group consisting N38S, L54F, L54M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, S347P, S347W, and T436P; (c) Y443P and one or more additional substitutions selected from the group consisting N38S, L54F, L54M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, S347P, S347W, and T436P; and (d) Y443W and one or more additional substitutions selected from the group consisting N38S, L54F, L54M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, S347P, S347W, and T436P.
15. The recombinant polypeptide of claim 12, wherein the substitutions are selected from the group consisting of N38S, L54F, L54M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, S347P, S347W, T436P, Y443F, and Y443W.
16. The recombinant polypeptide of claim 12, wherein the polypeptide comprising SEQ ID NO:8 has up to 50, 25, 10, or 5 conservative amino acid substitutions excluding specific residues N38, L54, V155, V158, Q162, L276, I307, R323, S347, T436, and Y443, wherein at least one or more of these specific residues have substitutions selected form the group consisting of N38S, L54F, L54M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, S347P, S347W, T436P, Y443F, and Y443W.
17. A polynucleotide encoding a polypeptide of claim 1.
18. A polynucleotide encoding a polypeptide of claim 7.
19. A polynucleotide encoding a polypeptide of claim 12.
Description:
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional of U.S. application Ser. No. 13/554,736, filed Jul. 20, 2012 (now U.S. Pat. No. 9,322,007), which application claims priority under 35 U.S.C. .sctn.119 to U.S. Provisional Application Ser. No. 61/510,914, filed, Jul. 22, 2011, the disclosures of which are incorporated herein by reference.
TECHNICAL FIELD
[0003] The disclosure provides thermostable variants of fungal Ce16 (cellobiohydrolase II) enzymes and their use to hydrolyze cellulose.
BACKGROUND
[0004] The performance of cellulase mixtures in biomass conversion processes depends on many enzyme properties including stability, product inhibition, synergy among different cellulase components, productive binding versus nonproductive adsorption and pH dependence, in addition to the cellulose substrate physical state and composition. Given the multivariate nature of cellulose hydrolysis, it is desirable to have diverse cellulases to choose from in order to optimize enzyme formulations for different applications and feedstocks.
SUMMARY
[0005] The disclosure provide recombinant or substantially purified polypeptides comprising a sequence that is at least 67.7% identical to a sequence set forth in SEQ ID NO:2, 4, 6, 8, 12, 14, 16, 18, 20, 22, 24, 26, or 28 and having cellulase activity and increased thermostability compared to a polypeptide comprising SEQ ID NO:4, 6, or 8. In one embodiment, the recombinant or substantially purified polypeptide comprises at least 67.7% identity (e.g., 67.7, 70, 80, 85, 90, 95, 98, 99, or 100% identity) to SEQ ID NO:2 and having one or more amino acid substitutions at residues selected from the group consisting of N14, S30, V128, V131, M135, C246, Q277, S293, S317, S406, and S413, and wherein the polypeptide has cellulase activity and comprises increased thermostability compared to a wild-type enzyme of SEQ ID NO: 4, 6, or 8. In another embodiment, the polypeptide comprises one or more substitutions selected from the group consisting of N14S, S30F, S30M, V128A, V131E, M135L, C246A, C246G, C246L, C246S, Q277L, S293R, S317P, S317W, S406P, S413F, and S413W. In yet another embodiment, the polypeptide comprises a sequence as set forth in SEQ ID NO:4 and wherein residues N14, S30, V128, V131, M135, C246, Q277, S293, 5317, S406, and S413 of SEQ ID NO:2 correspond to residues N38, S54, V151, V154, M158, C269, Q300, S316, S340, S430, and S437 in SEQ ID NO:4. In a further description, the polypeptide comprises SEQ ID NO:4 and has one or more substitutions at a residue selected from N38, S54, V151, V154, M158, C269, Q300, S316, S340, S430, and S437. In another embodiment, the polypeptide comprises a sequence as set forth in SEQ ID NO:6 and wherein residues N14, S30, V128, V131, M135, C246, Q277, S293, S317, S406, and S413 of SEQ ID NO:2 correspond to residues G37, Q53, V155, V158, Q162, L276, I307, K323, P347, T436, and Y443 in SEQ ID NO:6. In a further description, the polypeptide comprises SEQ ID NO:6 and has one or more substitutions at a residue selected from G37, Q53, V155, V158, Q162, L276, I307, K323, P347, T436, and Y443. In yet another embodiment, the polypeptide comprises a sequence as set forth in SEQ ID NO:8 and wherein residues N14, S30, V128, V131, M135, C246, Q277, S293, S317, S406, and S413 of SEQ ID NO:2 correspond to residues or N38, L54, V155, V158, Q162, L276, I307, R323, S347, T436, and Y443 in SEQ ID NO:8. In a further description, the polypeptide comprises SEQ ID NO:8 and has one or more substitutions at a residue selected from N38, L54, V155, V158, Q162, L276, I307, R323, S347, T436, and Y443. In another embodiment, the polypeptide comprise a sequence that is at least 80%, 85%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the sequence as set forth in SEQ ID NO:12, 14, 16, 18, 20, 22, 24, 26, or 28. In another of the foregoing embodiments, the polypeptide can further comprise a cellulose binding domain (CBD) operably linked to the polypeptide. In one embodiment, the CBD comprises a sequence as set forth in SEQ ID NO:10.
[0006] The disclosure also provides a recombinant polypeptide comprising at least 80% identity to SEQ ID NO:6 and having one or more substitutions at a residue selected from the group consisting of G37, Q53, V155, V158, Q162, L276, I307, K323, P347, T436, and Y443 and wherein the polypeptide has cellulase activity and comprises increased thermostability compared to a wild-type enzyme of SEQ ID NO: 4, 6, or 8. In a further embodiment, the substitutions are selected from the group consisting of G37S, Q53F, Q53M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, K323R, P347W, T436P, Y443F, and Y443W. In yet another embodiment, the polypeptide comprising SEQ ID NO:6 has up to 50, 25, 10, or 5 conservative amino acid substitutions excluding specific residues G37, Q53, V155, V158, Q162, L276, I307, K323, P347, T436, and/or Y443, wherein at least one or more of these specific residues have substitutions selected form the group consisting of G37S, Q53F, Q53M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, K323R, P347W, T436P, Y443F, and Y443W.
[0007] The disclosure also provides a recombinant polypeptide comprising at least 80% identity to SEQ ID NO:4 and having one or more substitutions at a residue selected from the group consisting of N38, S54, V151, V154, M158, C269, Q300, S316, S340, S430, and S437 and wherein the polypeptide has cellulase activity and comprises increased thermostability compared to a wild-type enzyme of SEQ ID NO: 4, 6, or 8. In one embodiment, the substitutions are selected from the group consisting of N38S, S54F, S54M, V151A, V154E, C269A, C269G, C269L, C269S, Q300L, S316R, S340P, S340W, S430P, S437F, and S437W. In another embodiment, the recombinant polypeptide comprising SEQ ID NO:6 has up to 50, 25, 10, or 5 conservative amino acid substitutions excluding specific residues N38, S54, V151, V154, M158, C269, Q300, S316, S340, S430, and S437, wherein at least one or more of these specific residues have substitutions selected form the group consisting of N38S, S54F, S54M, V151A, V154E, C269A, C269G, C269L, C269S, Q300L, S316R, S340P, S340W, S430P, S347F, and S427W.
[0008] The disclosure also provides a recombinant polypeptide comprising at least 80% identity to SEQ ID NO:8 and having one or more substitutions at a residue selected from the group consisting of N38, L54, V155, V158, Q162, L276, I307, R323, S347, T436, and Y443 and wherein the polypeptide has cellulase activity and comprises increased thermostability compared to a wild-type enzyme of SEQ ID NO: 4, 6, or 8. In one embodiment, the recombinant polypeptide the substitutions are selected from the group consisting of N38S, L54F, L54M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, S347P, S347W, T436P, Y443F, and Y443W. In yet another embodiment, the polypeptide comprising SEQ ID NO:6 has up to 50, 25, 10, or 5 conservative amino acid substitutions excluding specific residues N38, L54, V155, V158, Q162, L276, I307, R323, S347, T436, and Y443, wherein at least one or more of these specific residues have substitutions selected form the group consisting of N38S, L54F, L54M, V155A, V158E, Q162L, L276G, L276A, L276S, I307L, S347P, S347W, T436P, Y443F, and Y443W.
[0009] In certain embodiment, a recombinant polypeptide of the disclosure comprises SEQ ID NO:2 having substitutions selected from the group consisting of: (a) one or more substitution at a residue selected from the group consisting of N14, S30, V128, V131, M135, C246, Q277, S293, S317, S406 and any combination thereof; and (b) a substitution at S413 and one or more substitutions at a residue selected from the group consisting of N14, S30, V128, V131, M135, C246, Q277, S293, S317, S406 and any combination thereof. In a further embodiment, a recombinant polypeptide of the disclosure comprises SEQ ID NO:2 having substitutions selected from the group consisting of: (a) one or more substitutions selected from the group consisting of N14S, S30F, S30M, V128A, V131E, M135L, C246A, C246G, C246L, C246S, Q277L, S293R, S317P, S317W, and S406P; (b) S413F and one or more additional substitutions selected from the group consisting of N14S, S30F, S30M, V128A, V131E, M135L, C246A, C246G, C246L, C246S, Q277L, S293R, S317P, S317W, and S406P; (c) S413P and one or more additional substitutions selected from the group consisting of N14S, S30F, S30M, V128A, V131E, M135L, C246A, C246G, C246L, C246S, Q277L, S293R, S317P, S317W, and S406P; and (d) S413W and one or more additional substitutions selected from the group consisting of N14S, S30F, S30M, V128A, V131E, M135L, C246A, C246G, C246L, C246S, Q277L, S293R, S317P, S317W, and S406P.
[0010] In certain embodiment, a recombinant polypeptide of the disclosure comprises SEQ ID NO:4 having substitutions at a positions selected from the group consisting of: (a) one or more residue selected from the group consisting of N38, S54, V151, V154, C269, S316, S430 and any combination thereof; (b) M158 and one or more additional residues selected from the group consisting of N38, S54, V151, V154, C269, S316, and S430; (c) Q300 and one or more additional residue selected from the group consisting of N38, S54, V151, V154, C269, S316, and S430; (d) S340 and one or more additional residue selected from the group consisting of N38, S54, V151, V154, C269, S316, and S430; and (e) S437 and one or more additional residue selected from the group consisting of N38, S54, V151, V154, C269, S316, and S430. In a further embodiment, a recombinant polypeptide of the disclosure comprises SEQ ID NO:4 having substitutions selected from the group consisting of: (a) one or more substitution selected from the group consisting of N38S, S54F, S54M, V151A, V154E, C269A, C269G, C269L, C269S, S316R, and S430P; (b) M158L and one or more additional substitutions selected from the group consisting of N38S, S54F, S54M, V151A, V154E, C269A, C269G, C269L, C269S, S316R, and S430P; (c) Q300L and one or more additional substitutions selected from the group consisting of N38S, S54F, S54M, V151A, V154E, C269A, C269G, C269L, C269S, S316R, and S430P; (d) S340P and one or more additional substitutions selected from the group consisting of N38S, S54F, S54M, V151A, V154E, C269A, C269G, C269L, C269S, S316R, and S430P; (e) S340W and one or more additional substitutions selected from the group consisting of N38S, S54F, S54M, V151A, V154E, C269A, C269G, C269L, C269S, S316R, and S430P; (f) S437F and one or more additional substitutions selected from the group consisting of N38S, S54F, S54M, V151A, V154E, C269A, C269G, C269L, C269S, S316R, and S430P; (g) S437P and one or more additional substitutions selected from the group consisting of N38S, S54F, S54M, V151A, V154E, C269A, C269G, C269L, C269S, S316R, and S430P; and (h) S437W and one or more additional substitutions selected from the group consisting of N38S, S54F, S54M, V151A, V154E, C269A, C269G, C269L, C269S, S316R, and S430P.
[0011] In certain embodiment, a recombinant polypeptide of the disclosure comprises SEQ ID NO:6 having substitutions at a positions selected from the group consisting of: (a) a residue selected from the group consisting of G37, Q53, V155, V158, Q162, L276, I307, K323, P347, and T436; and (b) Y443 and one or more additional residue selected from the group consisting of G37, Q53, V155, V158, Q162, L276, I307, K323, P347, and T436. In a further embodiment, a recombinant polypeptide of the disclosure comprises SEQ ID NO:6 having substitutions selected from the group consisting of: (a) a substitution selected from the group consisting of G37S, Q53F, Q53M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, K323R, P347W, and T436P; (b) Y443F and one or more additional substitutions selected from the group consisting of G37S, Q53F, Q53M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, K323R, P347W, T436P; and (c) Y443P and one or more additional substitutions selected from the group consisting of G37S, Q53F, Q53M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, K323R, P347W, T436P; and (d) Y443W and one or more additional substitutions selected from the group consisting of G37S, Q53F, Q53M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, K323R, P347W, and T436P.
[0012] In certain embodiment, a recombinant polypeptide of the disclosure comprises SEQ ID NO:8 having substitutions at a positions selected from the group consisting of: (a) a residue selected from the group consisting of N38, L54, V155, V158, Q162, L276, I307, R323, S347, and T436; and (b) Y443 and one or more additional residue selected from the group consisting N38, L54, V155, V158, Q162, L276, I307, R323, S347, and T436. In a further embodiment, the recombinant polypeptide comprises SEQ ID NO:8 having substitutions selected from the group consisting of: (a) a residue selected from the group consisting of N38S, L54F, L54M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, S347P, S347W, and T436P; (b) Y443F and one or more additional substitutions selected from the group consisting N38S, L54F, L54M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, S347P, S347W, and T436P; (c) Y443P and one or more additional substitutions selected from the group consisting N38S, L54F, L54M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, S347P, S347W, and T436P; and (d) Y443W and one or more additional substitutions selected from the group consisting N38S, L54F, L54M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, S347P, S347W, and T436P.
[0013] In various embodiments of the disclosure substitutions in SEQ ID NO:2 are as described above, but specifically exclude substitutions at S413. In various embodiments of the disclosure substitutions in SEQ ID NO:4 are as described above, but specifically exclude substitutions at one or more positions selected from the group consisting of M158, Q300, S340, S437, and S437. In various embodiments of the disclosure substitutions in SEQ ID NO:6 are as described above, but specifically exclude substitutions at Y443. In various embodiments of the disclosure substitutions in SEQ ID NO:8 are as described above, but specifically exclude substitutions at Y443.
[0014] In any of the foregoing embodiments comprising the substitutions above, the resulting "modified" polypeptide comprises a polypeptide having cellulase activity and improved thermostability compared to a wild-type enzyme comprising SEQ ID NO:4, 6, or 8.
[0015] The disclosure also provides a polynucleotide encoding a polypeptide of any of the foregoing embodiments.
[0016] The disclosure also provides a vector comprising a polynucleotide described above as well as host cells comprising a vector of the disclosure.
[0017] The disclosure also provides a host cell that expresses a polypeptide described herein in any of the embodiments described above.
[0018] The disclosure also provides enzymatic preparation comprising a polypeptide of the disclosure.
[0019] The disclosure also provides a method of treating a biomass comprising cellulose, the method comprising contacting the biomass with a polypeptide described in any of the foregoing embodiments, an enzymatic preparation of the disclosure, or a host cell expressing a polypeptide of the disclosure.
BRIEF DESCRIPTION OF THE FIGURES
[0020] FIG. 1 shows alignment of Cel6a amino acid sequences from H. insolens (SEQ ID NO:6), H. jecorina (HJ) (SEQ ID NO:4), C. thermophilum (SEQ ID NO:8), and HJPlus (SEQ ID NO:2). Residues with double underlining are specific residues for mutation.
[0021] FIG. 2 shows the total activity at 75.degree. C. (measured as cellobiose equivalents released) from 3-day S. cerevisiae culture supernatant of cultures expressing HJPlus and the top five variants from the first generation random mutagenesis library.
[0022] FIG. 3 shows the total activity at 75.degree. C. (measured as cellobiose equivalents released) from 3-day S. cerevisiae culture supernatant of cultures expressing 1G6 and the top five variants from the second generation random mutagenesis library.
[0023] FIG. 4 shows the total activity at 75.degree. C. (measured as cellobiose equivalents released) from 3-day S. cerevisiae culture supernatant of cultures expressing 2B3 and the top five variants from the recombination library.
[0024] FIG. 5 shows the total activity at 75.degree. C. (measured as cellobiose equivalents released) from 3-day S. cerevisiae culture supernatant of cultures expressing HJPlus and the top variant from every generation of random mutagenesis and recombination.
[0025] FIG. 6 shows the total activity at 75.degree. C. (measured as cellobiose equivalents released) from 3-day S. cerevisiae culture supernatant of cultures expressing the top five variants from the NNK libraries.
[0026] FIG. 7 shows the half-life and T.sub.50 values for HJPlus and the best variants from each generation of random mutagenesis and recombination.
[0027] FIG. 8 shows the residual activity of 3C6P and C246G at pH 4 (50 mM sodium citrate), pH 5 (50 mM sodium acetate), and pH 6 through 9 (50 mM sodium phosphate) after 15-minute thermal inactivation; the data were modeled with sigmoidal functions.
[0028] FIG. 9 shows the half-lives of C246G at 90.degree. C. at various pH values (pH 4 (50 mM sodium citrate), pH 5 (50 mM sodium acetate), and pH 6 through 9 (50 mM sodium phosphate)).
[0029] FIG. 10 shows 2-hour activity of 3C6P and C246G at 80.degree. C. and 4-hour activity at 90.degree. C. (measured as cellobiose equivalents released) at various pH conditions (pH 4 (50 mM sodium citrate), pH 5 (50 mM sodium acetate), and pH 6 through 9 (50 mM sodium phosphate)).
[0030] FIG. 11 shows the effects of different mutations at residue C246 on the residual activity of the engineered Ce16s. Purified enzymes were inactivated at 50 mM sodium phosphate, pH 7.0 for 15 minutes before assayed for activities with 30 mg/mL of Avicel. The activity was measured as the amount of cellobiose released after 2-hour incubation at 50.degree. C.
[0031] FIG. 12 shows the residual activity of H. jecorina Ce16a and HJ C269G at pH 4 (50 mM sodium citrate), pH 5 (50 mM sodium acetate), and pH 6 through 9 (50 mM sodium phosphate) after 15-minute thermal inactivation; the data were modeled with sigmoidal functions.
[0032] FIG. 13 shows the residual activity of H. insolens Ce16a and HI L276G at pH 4 (50 mM sodium citrate), pH 5 (50 mM sodium acetate), and pH 6 through 9 (50 mM sodium phosphate) after 15-minute thermal inactivation; the data were modeled with sigmoidal functions.
[0033] FIG. 14 shows 2-hour activity of H. jecorina (HJ) Ce16a, HJ with S54F mutation, HJ with S316R mutation, and HJ with S430P mutation at 50.degree. C. and 60.degree. C. (measured as cellobiose equivalents released) at 50 mM sodium acetate buffer, pH 5.0.
DETAILED DESCRIPTION
[0034] As used herein and in the appended claims, the singular forms "a," "and," and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a Ce16 enzyme" includes a plurality of such enzymes and reference to "the protein" includes reference to one or more proteins, and so forth.
[0035] Also, the use of "or" means "and/or" unless stated otherwise. Similarly, "comprise," "comprises," "comprising" "include," "includes," and "including" are interchangeable and not intended to be limiting.
[0036] It is to be further understood that where descriptions of various embodiments use the term "comprising," those skilled in the art would understand that in some specific instances, an embodiment can be alternatively described using language "consisting essentially of" or "consisting of."
[0037] Although methods and materials similar or equivalent to those described herein can be used in the practice of the disclosed methods and compositions, the exemplary methods, devices and materials are described herein.
[0038] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this disclosure belongs. Thus, as used throughout the instant application, the following terms shall have the following meanings.
[0039] Cellulose is the main structural component of most plant cell walls, making it the most abundant biopolymer on earth. Cellulose is a polysaccharide composed of glucosyl units linked together by .beta.-1,4 glycosidic bonds. The .beta.-linkage ensures that the subunits rotate 180.degree. every two glucose subunits along the cellulose chain. The rotation makes the cellulose chains straight and highly symmetrical. X-ray diffraction and nuclear magnetic resonance studies have shown that cellulose chains form extensive intramolecular and intermolecular hydrogen bonds between the hydroxyl groups and the oxygen in the pyranose ring, producing crystalline elementary fibrils with strong tensile strength and low accessibility. The extensive hydrogen bonding makes cellulose a very recalcitrant material, with a half-life of over four million years from spontaneous hydrolysis at 25.degree. C. Despite this recalcitrance, nature has provided several enzyme solutions capable of hydrolyzing cellulose into a form that can be utilized by microorganisms as a source of carbon and energy.
[0040] Recent studies have documented the superior performance of cellulases from thermophilic fungi relative to their mesophilic counterparts in laboratory scale biomass conversion processes, where enhanced stability leads to retention of activity over longer periods of time at both moderate and elevated temperatures. Fungal cellulases are attractive because they are highly active and can be expressed in fungal hosts such as Hypocrea jecorina (anamorph Trichoderma reesei) at levels up to 40 g/L in the supernatant. Unfortunately, the set of documented thermostable fungal cellulases is small. In the case of the processive cellobiohydrolase class II (CBH II) enzymes, fewer than 10 natural thermostable gene sequences are annotated in the CAZy database.
[0041] Fungal cellulases are important in industrial applications, from cotton softening in the textile industries to biofuel production in biorefineries. Specifically, cellulases are used in biorefineries to break down cellulosic biomass into fermentable sugars, from which biofuels and higher-value chemicals can be derived. For cellulosic biomass to become a feasible feedstock for transportation fuels and chemicals, the cost of production needs to be competitive with the current technology of producing them from fossil fuels. Thermostable cellulases are particularly interesting for biomass degradation for several reasons. Thermostable cellulases tend to be more stable during production, storage and over a range of temperatures and operating conditions. Thermostable enzymes are more resilient towards relatively harsh industrial treatments and conditions. They also can be used to hydrolyze cellulose at higher temperatures, where the enzymes can access the substrate and catalyze their reactions at a higher rate--assuming that the reaction temperature is lower than the denaturing temperature for the enzyme. The risk of contamination by microorganisms is also reduced at elevated temperatures, as is the viscosity of hydrolysis mixtures, which lowers process costs.
[0042] The mesophilic fungus Hypocrea jecorina (anamorph Trichoderma reesei) secretes an array of cellulose enzymes that work synergistically to degrade the cellulose to smaller oligomers and eventually to glucose. This fungus' collection of cellulases includes at least five endoglucanases (EGI-V), two cellobiohydrolases (Ce16a, Ce17a), .beta.-glucosidases, and hemicellulases. In Hypocrea jecorina, cellobiohydrolase Ce17a, Ce16a, and EGII comprise 60.+-.5%, 20.+-.6%, and 12.+-.3% of total cellulase protein, respectively. All three cellulases consist of a cellulose-binding domain (CBD) and a catalytic domain connected by a glycosylated peptide linker. Cellobiose is the primary product of cellulose hydrolysis by cellobiohydrolases Ce16a and Ce17a.
[0043] Recently, the creation of a collection of thermostable Family 6 fungal cellobiohydrolases (Ce16) using structure-guided SCHEMA recombination was reported. The genes encoding the Ce16a from Humicola insolens, Hypocrea jecorina, and Chaetomium thermophilum were divided into eight blocks and recombined to create new, chimeric Ce16a enzymes. The block boundaries were identified using computational tools that allowed the number of disrupted side-chain contacts to be minimized, relative to the average number of mutations in the resulting chimeric proteins. Based on activity and stability data obtained from the enzymes encoded by the 48 genes that were sampled (from the 6,561 possible chimeric sequences), linear regression models were built to determine how each sequence block contributes to the thermostability of a chimeric Ce16a enzyme. The four stabilizing blocks were introduced in the cellobiohydrolase of H. jecorina to create the "HJPlus" chimera 12222332 (described in US Patent Publication No. 2010/0304464-A1, incorporated herein by reference), which is stable for more than 12 hours at 63.degree. C. and is also secreted at relatively high levels in S. cerevisiae. In this disclosure, HJPlus was used as the platform for further protein engineering efforts to improve the enzyme properties relevant to optimizing cellulose hydrolysis, most notably thermostability, substrate binding, and cellulose activity. Further improving the thermostability of HJPlus not only pushes the limit of enzyme stability but also allows the discovery of mutations that might not have appeared at lower temperatures because they are not beneficial at lower temperatures. The disclosure also provides a method that allows high throughput screening on microcrystalline cellulose, Avicel, to identify useful mutations.
[0044] The disclosure provides modified Family 6 cellulases (Ce16a) that exhibit enhanced activity, thermostability, substrate binding, and/or expression in S. cerevisiae. The disclosure also provides genetic constructs that encode the modified Ce16a enzymes and the methods for mutating, deriving, and producing the modified Ce16a enzymes from yeast and fungal expression strains. The disclosure also provides use of the modified Ce16a enzymes in the hydrolysis of cellulose or cellulosic biomass and the production of biofuels from fermentable sugars and alcohols, as well as other industrial applications of cellulases.
[0045] As will be described in more detail below, the disclosure is based, at least in part, on the generation and expression of novel enzymes that catalyze the degradation of cellulose. In one embodiment, novel polypeptides that have been engineered/modified to degrade cellulose are provided. Such polypeptides include Ce16a variants that have been altered to include amino acid substitutions at specified residues as well as properties that include increased thermostability compared to wild-type Ce16a enzymes.
[0046] While these variants will be described in more detail below, it is understood that polypeptides of the disclosure contain one or more modified amino acids. The presence of modified amino acids are advantageous in, for example, (a) increasing polypeptide in vivo half-life, activity or thermostability, (b) reducing or increasing polypeptide antigenicity, and (c) increasing polypeptide storage stability. Amino acid(s) are modified, for example, co-translationally or post-translationally during recombinant production (e.g., N-linked glycosylation at N-X-S/T motifs during expression in mammalian cells) or modified by synthetic means. Accordingly, A "mutant", "variant" or "modified" protein, polypeptide, enzyme, polynucleotide, gene, or cell, means a protein, polypeptide, enzyme, polynucleotide, gene, or cell, that has been altered or derived, or is in some way different or changed, from a parent protein, polypeptide, enzyme, polynucleotide, gene, or cell. A mutant or modified protein or enzyme is usually, although not necessarily, expressed from a mutant polynucleotide or gene.
[0047] "Conservative amino acid substitution" or, simply, "conservative variations" of a particular sequence refers to the replacement of one amino acid, or series of amino acids, with essentially identical amino acid sequences. One of skill will recognize that individual substitutions, deletions or additions which alter, add or delete a single amino acid or a percentage of amino acids in an encoded sequence result in "conservative variations" where the alterations result in the deletion of an amino acid, addition of an amino acid, or substitution of an amino acid with a chemically similar amino acid.
[0048] Conservative substitution tables providing functionally similar amino acids are well known in the art. For example, one conservative substitution group includes Alanine (A), Serine (S), and Threonine (T). Another conservative substitution group includes Aspartic acid (D) and Glutamic acid (E). Another conservative substitution group includes Asparagine (N) and Glutamine (Q). Yet another conservative substitution group includes Arginine (R) and Lysine (K). Another conservative substitution group includes Isoleucine, (I) Leucine (L), Methionine (M), and Valine (V). Another conservative substitution group includes Phenylalanine (F), Tyrosine (Y), and Tryptophan (W).
[0049] Thus, "conservative amino acid substitutions" of a listed polypeptide sequence of the disclosure include substitutions of a percentage, typically less than 10%, of the amino acids of the polypeptide sequence, with a conservatively selected amino acid of the same conservative substitution group. Accordingly, a conservatively substituted variation of a polypeptide of the invention can contain 100, 75, 50, 25, or 10 substitutions with a conservatively substituted variation of the same conservative substitution group.
[0050] It is understood that the addition of sequences which do not alter the encoded activity of a nucleic acid molecule, such as the addition of a non-functional or non-coding sequence, is a conservative variation of the basic nucleic acid. The "activity" of an enzyme is a measure of its ability to catalyze a reaction, i.e., to "function", and may be expressed as the rate at which the product of the reaction is produced. For example, enzyme activity can be represented as the amount of product produced per unit of time or per unit of enzyme (e.g., concentration or weight), or in terms of affinity or dissociation constants. As used interchangeably herein a "Ce16a activity", "biological activity of Ce16a" or "functional activity of Ce16a", refers to an activity exerted by a Ce16a, Ce16a polypeptide, or a polypeptide having Ce16a activity on a Ce16a polypeptide substrate, as determined in vitro, according to standard techniques (as described below). Such Ce16a activity can be characterized as the rate of breakdown of cellulose or other organic polymeric sugar composition.
[0051] "Conservative variants" are proteins or enzymes in which a given amino acid residue has been changed without altering overall conformation and function of the protein or enzyme, including, but not limited to, replacement of an amino acid with one having similar properties, including polar or non-polar character, size, shape and charge. Amino acids other than those indicated as conserved may differ in a protein or enzyme so that the percent protein or amino acid sequence similarity between any two proteins of similar function may vary and can be, for example, at least 30%, at least 50%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98% or at least 99%, as determined according to an alignment scheme. As referred to herein, "sequence similarity" means the extent to which nucleotide or protein sequences are related. The extent of similarity between two sequences can be based on percent sequence identity and/or conservation. "Sequence identity" herein means the extent to which two nucleotide or amino acid sequences are invariant. "Sequence alignment" means the process of lining up two or more sequences to achieve maximal levels of identity (and, in the case of amino acid sequences, conservation) for the purpose of assessing the degree of similarity. Numerous methods for aligning sequences and assessing similarity/identity are known in the art such as, for example, the Cluster Method, wherein similarity is based on the MEGALIGN algorithm, as well as BLASTN, BLASTP, and FASTA (Lipman and Pearson, 1985; Pearson and Lipman, 1988). When using all of these programs, the preferred settings are those that results in the highest sequence similarity. For example, an commonly used on-line algorithm can be found at http:(//)web.expasy.org/sim/ and the default parameters used (e.g., gap open penalty of 12, gap extension penalty of 4 and the comparison Matrix being BLOSUM62). Using the immediately foregoing algorithm "SIM" (Huang et al., Advances in Applied Mathematics, vol. 12 (1991), pp. 337-357), the percent identity between SEQ ID NO:2 and SEQ ID NO:6 is 67.7%.
[0052] Non-conservative modifications of a particular polypeptide are those which substitute any amino acid not characterized as a conservative substitution. For example, any substitution which crosses the bounds of the six groups set forth above. These include substitutions of basic or acidic amino acids for neutral amino acids, (e.g., Asp, Glu, Asn, or Gln for Val, Ile, Leu or Met), aromatic amino acid for basic or acidic amino acids (e.g., Phe, Tyr or Trp for Asp, Asn, Glu or Gln) or any other substitution not replacing an amino acid with a like amino acid. Basic side chains include lysine (K), arginine (R), histidine (H); acidic side chains include aspartic acid (D), glutamic acid (E); uncharged polar side chains include glycine (G), asparagine(N), glutamine (Q), serine (S), threonine (T), tyrosine (Y), cysteine (C); nonpolar side chains include alanine (A), valine (V), leucine (L), isoleucine (I), proline (P), phenylalanine (F), methionine (M), tryptophan (W); beta-branched side chains include threonine (T), valine (V), isoleucine (I); aromatic side chains include tyrosine (Y), phenylalanine (F), tryptophan (W), histidine (H).
[0053] Accordingly, some amino acid residues at specific positions in a polypeptide are "excluded" from conservative amino acid substitutions. Instead, these restricted or "specific" amino acids are generally chosen from a particular group of amino acids or a specific amino acid to be substituted at that position. These amino acid residues can be substituted at a designated position to obtain a modified or variant polypeptide. While some overlap may occur, the members substituted at these specific positions are not "conservative amino acid substitutions" as defined above. In general, these mutations represent non-conservative substitutions at the indicated position in the designated sequence. For example, as described more fully below the substitution at position 14 of, e.g., SEQ ID NO:2 (see FIG. 1), replaces Asn or Gly with Ser. This substitution is generally not considered a "conservative" substitution. Similar substitutions are made throughout the various sequences at the indicated positions in order to modify the activity of the polypeptide.
[0054] A "mutation" means any process or mechanism resulting in a mutant protein, enzyme, polynucleotide, gene, or cell. This includes any mutation in which a protein, enzyme, polynucleotide, or gene sequence is altered, and any detectable change in a cell arising from such a mutation. Typically, a mutation occurs in a polynucleotide or gene sequence, by point mutations, deletions, or insertions of single or multiple nucleotide residues. A mutation includes polynucleotide alterations arising within a protein-encoding region of a gene as well as alterations in regions outside of a protein-encoding sequence, such as, but not limited to, regulatory or promoter sequences. A mutation in a gene can be "silent", i.e., not reflected in an amino acid alteration upon expression, leading to a "sequence-conservative" variant of the gene. This generally arises when one amino acid corresponds to more than one codon.
[0055] A "parent" protein, enzyme, polynucleotide, gene, or cell, is any protein, enzyme, polynucleotide, gene, or cell, from which any other protein, enzyme, polynucleotide, gene, or cell, is derived or made, using any methods, tools or techniques, and whether or not the parent is itself native or mutant. A parent polynucleotide or gene encodes for a parent protein or enzyme. Exemplary parent polynucleotides and polypeptides include, for example, SEQ ID NO:3, 5, and 7 and SEQ ID NO: 4, 6, and 8, respectively.
[0056] A "protein" or "polypeptide", which terms are used interchangeably herein, comprises one or more chains of chemical building blocks called amino acids that are linked together by chemical bonds called peptide bonds. An "enzyme" means any substance, composed wholly or largely of protein, that catalyzes or promotes, more or less specifically, one or more chemical or biochemical reactions. A "native" or "wild-type" protein, enzyme, polynucleotide, gene, or cell, means a protein, enzyme, polynucleotide, gene, or cell that occurs in nature. In some embodiments of the disclosure proteins or protein sequences are presented that are not fully "native". For example, in certain aspect of the disclosure the catalytic domains of the respective enzymes are native, but they further comprise a cellulose binding domain and linker from H. jecorina, which results in a protein that is not native to, for example, H. insolens and C. thermophilum.
[0057] A polynucleotide, polypeptide, or other component is "isolated" when it is partially or completely separated from components with which it is normally associated (other proteins, nucleic acids, cells, synthetic reagents, etc.). A nucleic acid or polypeptide is "recombinant" when it is artificial or engineered, or derived from an artificial or engineered protein or nucleic acid. For example, a polynucleotide that is inserted into a vector or any other heterologous location, e.g., in a genome of a recombinant organism, such that it is not associated with nucleotide sequences that normally flank the polynucleotide as it is found in nature is a recombinant polynucleotide. A protein expressed in vitro or in vivo from a recombinant polynucleotide is an example of a recombinant polypeptide. Likewise, a polynucleotide sequence that does not appear in nature, for example a variant of a naturally occurring gene, is recombinant. For example, an "isolated" nucleic acid molecule is one which is separated from other nucleic acid molecules which are present in the natural source of the nucleic acid. For example, with regards to genomic DNA, the term "isolated" includes nucleic acid molecules which are separated from the chromosome with which the genomic DNA is naturally associated. Typically, an "isolated" nucleic acid is free of sequences which naturally flank the nucleic acid (i.e., sequences located at the 5' and 3' ends of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived. For example, in various embodiments, the isolated nucleic acid molecule can contain less than about 5 kb, 4kb, 3kb, 2kb, 1 kb, 0.5 kb or 0.1 kb of nucleotide sequences which naturally flank the nucleic acid molecule in genomic DNA of the cell from which the nucleic acid is derived. Moreover, an "isolated" nucleic acid molecule, such as a cDNA molecule, can be substantially free of other cellular material, or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized.
[0058] "Sequence identity" herein means the extent to which two nucleotide or amino acid sequences are invariant. "Sequence alignment" means the process of lining up two or more sequences to achieve maximal levels of identity (and, in the case of amino acid sequences, conservation) for the purpose of assessing the degree of similarity. Numerous methods for aligning sequences and assessing similarity/identity are known in the art such as, for example, the Cluster Method, wherein similarity is based on the MEGALIGN algorithm, as well as BLASTN, BLASTP, and FASTA (Lipman and Pearson, 1985; Pearson and Lipman, 1988). When using all of these programs, the preferred settings are those that results in the highest sequence similarity. For example, the "identity" or "percent identity" with respect to a particular pair of aligned amino acid sequences can refer to the percent amino acid sequence identity that is obtained by ClustalW analysis (version W 1.8 available from European Bioinformatics Institute, Cambridge, UK), counting the number of identical matches in the alignment and dividing such number of identical matches by the greater of (i) the length of the aligned sequences, and (ii) 96, and using the following default ClustalW parameters to achieve slow/accurate pairwise alignments--Gap Open Penalty: 10; Gap Extension Penalty: 0.10; Protein weight matrix: Gonnet series; DNA weight matrix: IUB; Toggle Slow/Fast pairwise alignments=SLOW or FULL Alignment.
[0059] Two sequences are "optimally aligned" when they are aligned for similarity scoring using a defined amino acid substitution matrix (e.g., BLOSUM62), gap existence penalty and gap extension penalty so as to arrive at the highest score possible for that pair of sequences. Amino acid substitution matrices and their use in quantifying the similarity between two sequences are well-known in the art and described, e.g., in Dayhoff et al. (1978) "A model of evolutionary change in proteins" in "Atlas of Protein Sequence and Structure," Vol. 5, Suppl. 3 (ed. M. 0. Dayhoff), pp. 345-352. Natl. Biomed. Res. Found., Washington, D.C. and Henikoffet al. (1992) Proc. Nat'l. Acad. Sci. USA 89: 10915-10919 (each of which is incorporated by reference). The BLOSUM62 matrix (FIG. 10) is often used as a default scoring substitution matrix in sequence alignment protocols such as Gapped BLAST 2.0. The gap existence penalty is imposed for the introduction of a single amino acid gap in one of the aligned sequences, and the gap extension penalty is imposed for each additional empty amino acid position inserted into an already opened gap. The alignment is defined by the amino acids positions of each sequence at which the alignment begins and ends, and optionally by the insertion of a gap or multiple gaps in one or both sequences so as to arrive at the highest possible score. While optimal alignment and scoring can be accomplished manually, the process is facilitated by the use of a computer-implemented alignment algorithm, e.g., gapped BLAST 2.0, described in Altschul et al. (1997) Nucl. Acids Res. 25: 3389-3402 (incorporated by reference herein), and made available to the public at the National Center for Biotechnology Information (NCBI) Website (www.ncbi.nlm.nih.gov). Optimal alignments, including multiple alignments, can be prepared using, e.g., PSI-BLAST, available through the NCB1 website and described by Altschul et al. (1997) Nucl. Acids Res. 25:3389-3402 (incorporated by reference herein).
[0060] With respect to an amino acid sequence that is optimally aligned with a reference sequence, an amino acid residue "corresponds to" the position in the reference sequence with which the residue is paired in the alignment. The "position" is denoted by a number that sequentially identifies each amino acid in the reference sequence based on its position relative to the N-terminus. For example, in SEQ ID NO:2, position 14 is N, position 15 is W, position 16 is S, etc. When a test sequence is optimally aligned with SEQ ID NO:2, a residue in the test sequence that aligns with the W at position 16 is said to "correspond to position 16" of SEQ ID NO:2. Owing to deletions, insertion, truncations, fusions, etc., that must be taken into account when determining an optimal alignment, in general the amino acid residue number in a test sequence as determined by simply counting from the N-terminal will not necessarily be the same as the number of its corresponding position in the reference sequence. For example, in a case where there is a deletion in an aligned test sequence, there will be no amino acid that corresponds to a position in the reference sequence at the site of deletion. Where there is an insertion in an aligned reference sequence, that insertion will not correspond to any amino acid position in the reference sequence. In the case of truncations or fusions there can be stretches of amino acids in either the reference or aligned sequence that do not correspond to any amino acid in the corresponding sequence.
[0061] By "cellulase activity" means an enzyme that is capable of hydrolyzing cellulose. Cellulase refers to a class of enzymes produced by fungi, bacteria, and protozoans that catalyze the hydrolysis of cellulose. However, there are also cellulases produced by other types of organisms such as plants and animals. The EC number for this group of enzymes is EC 3.2.1.4. There are five general types of cellulases based on the type of reaction catalyzed: endo-cellulase; exo-cellulase, within this category there are two main types of exo-cellulases (or cellobiohydrolases, abbreviate CBH)--one type working processively from the reducing end, and one type working processively from the non-reducing end of cellulose; cellobiase or beta-glucosidase hydrolyses; oxidative cellulases; and cellulose phosphorylases that depolymerize cellulose using phosphates instead of water. Most fungal cellulases have two-domains: a catalytic domain and a cellulose binding domain that are connected by a flexible linker. In specific embodiments of the disclosure the cellulase activity is a Ce16a activity. The sequences described herein include, in some instances, both the cellulose binding domain and the catalytic domain or just the catalytic domain. In such instances where only the catalytic domain sequence is provided it will be recognized that a cellulose binding domain (CBD) such as that provided in SEQ ID NO:10, may be functional linked (either as part of the coding sequence or fused later) to the catalytic domain either directly or through a linker.
[0062] As used herein a "modified" or "thermostable" Ce16a variant refers to a polypeptide as described in more detail below that comprises at least 67.7% identity (e.g., 67.7, 70, 80, 90, 95, 98, 99% identity) to SEQ ID NO:2, 4, 6, 8, 12, 14, 16, 18, 20, 22, 24, 26 or 28 and which has at least one specific mutation as set forth below. A specific mutation refers to a one or more substitutions at N14, S30, V128, V131, M135, C246, Q277, S293, S317, S406, and/or S413 in HJPlus (SEQ ID NO:2); N38, S54, V151, V154, M158, C269, Q300, S316, S340, S430, and/or S437 in Ce16a enzyme from Hypocrea jecorina (SEQ ID NO:4); G37, Q53, V155, V158, Q162, L276, I307, K323, P347, T436, and/or Y443 in Ce16a enzyme from Humicola insolens (SEQ ID NO:6); or N38, L54, V155, V158, Q162, L276, I307, R323, S347, T436, and/or Y443 in Ce16a enzyme from Chaetomium thermophilum (SEQ ID NO:8), and wherein the modified or thermostable variant comprises increased thermostability or activity compared to a wild-type protein of SEQ ID NO:4, 6, or 8.
[0063] Referring to the sequence comparison of various Cel6a polypeptides in FIG. 1, SEQ ID NO:2 includes the amino acid sequence HJplus. SEQ ID NO:4 provides the amino acid sequence of wild-type Ce16a from Hypocrea jecorina (including a signal domain residues 1-24) and shares amino acid sequence identity to HJPlus (SEQ ID NO:2). SEQ ID NO:6 includes the amino acid sequence of Ce16a (including a signal domain residues 1-23) from Humicola insolens. This wild-type Cel6a shares % amino acid sequence identity to the Cel6a of Hypocrea jecorina (SEQ ID NO:4) as well as the HJplus polypeptide of SEQ ID NO:2. SEQ ID NO:8 includes the amino acid sequence of wild-type Cel6a (including a signal domain residues 1-24) from Chaetomium thermophilum and shares amino acid sequence identity to SEQ ID NO:2, 4, and 6.
[0064] The polypeptides of FIG. 1 (SEQ ID Nos:2, 4, 6, and 8) are closely related to one another and show a high degree of sequence identity. The sequences can be aligned based on the sequence homology. The alignment provided in FIG. 1 identifies "equivalent positions" in the sequences. An equivalent position denotes a position which, on the basis of the alignment of the sequence of the parent polypeptides in question with the "reference" Ce16a amino acid sequence in question (e.g. SEQ ID NO:2) so as to achieve juxtapositioning of amino acid residues which are common to both, corresponds most closely to a particular position in the reference sequence in question. This process can cause gaps or insertions to appear in the sequences. In the alignment of FIGS. 1, equivalent positions are shown lined up vertically with one another. For example, position 14 in SEQ ID NO: 2 is equivalent to position 38, 37, and 38 in SEQ ID NO: 4, 6, and 8, respectively.
[0065] In one embodiment, the disclosure provides a modified Ce16a enzyme comprising amino acid substitution(s) at one or more residues selected from N14, S30, V128, V131, M135, C246, Q277, S293, S317, S406, and/or S413 in HJPlus (SEQ ID NO:2), wherein the modified Ce16a comprises increased thermostability and cellulase activity. In one specific embodiment, the disclosure encompasses a variant Ce16a enzyme, wherein said enzyme comprises specific amino acid substitution(s) at one or more of the residues N14S, S30F, S30M, V128A, V131E, M135L, C246A, C246G, C246L, C246S, Q277L, S293R, S317P, S317W, S406P, S413F, and/or S413W in HJPlus (SEQ ID NO:2). Accordingly, in various embodiments, isolated or recombinant polypeptides comprising the amino acid sequence set forth in SEQ ID NO:2 having up to 50, 25, 10, or 5 conservative amino acid substitutions excluding specific residues N14, S30, V128, V131, M135, C246, Q277, S293, S317, S406, and/or S413, wherein at least one or more of these specific residues have substitutions selected form the group consisting of N14S, S30F, S30M, V128A, V131E, M135L, C246A, C246G, C246L, C246S, Q277L, S293R, S317P, S317W, S406P, S413F, and/or S413W. In another embodiment, the disclosure provides polypeptides that have at least 80%, 85%, 90%, 95%, 98%, 99% or 100% sequence identity to SEQ ID NO:12, 14, 16, 18, 20, 22, 24, 26, or 28, wherein the polypeptide comprises cellulase activity and has increased thermostability compared to SEQ ID NO:2, 4, 6, or 8.
[0066] In one embodiment, the disclosure provides modified Ce16a enzymes derived from amino acid substitution(s) at one or more residues G37, Q53, V155, V158, Q162, L276, I307, K323, P347, T436, and/or Y443 in Ce16a enzyme from Humicola insolens (SEQ ID NO:6), from which HJPlus is derived), wherein the modified Ce16a comprises increased thermostability and cellulase activity. The residue position(s) can further be identified by reference to the residues of SEQ ID NO:2 and FIG. 1. In one specific embodiment, the disclosure encompasses a variant Ce16a enzyme, wherein said enzyme comprises amino acid substitution(s) at one or more of the residues G37S, Q53F, Q53M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, K323R, P347W, T436P, Y443F, and/or Y443W in in Ce16a enzyme from Humicola insolens (SEQ ID NO:6), from which HJPlus is derived. Accordingly, in various embodiments, isolated or recombinant polypeptides comprising the amino acid sequence set forth in SEQ ID NO:6 having up to 50, 25, 10, or 5 conservative amino acid substitutions excluding specific residues G37, Q53, V155, V158, Q162, L276, I307, K323, P347, T436, and/or Y443, wherein at least one or more of these specific residues have substitutions selected form the group consisting of G37S, Q53F, Q53M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, K323R, P347W, T436P, Y443F, and/or Y443W. In any of the foregoing embodiments, the polypeptide of SEQ ID NO:6 can lack the leader sequence and comprises amino acid 24-476 of SEQ ID NO:6 and having the foregoing substitutions.
[0067] In one embodiment, the disclosure provides a modified Cel6a enzymes derived from amino acid substitution(s) at one or more residues N38, S54, V151, V154, M158, C269, Q300, S316, S340, S430, and/or S437 in Ce16a enzyme from Hypocrea jecorina (SEQ ID NO:4), from which HJPlus is derived), wherein the modified Ce16a comprises increased thermostability and cellulase activity. The residue position(s) can further be identified by reference to the residues of SEQ ID NO:2 and FIG. 1. In one specific embodiment, the invention encompasses a variant Ce16a enzyme, wherein said enzyme comprises amino acid substitution(s) at one or more of the residues N38S, S54F, S54M, V151A, V154E, C269A, C269G, C269L, C269S, Q300L, S316R, S340P, S340W, S430P, S437F, and/or S437W in in Ce16a enzyme from Hypocrea jecorina (SEQ ID NO:4), from which HJPlus is derived. Accordingly, in various embodiments, isolated or recombinant polypeptides comprising the amino acid sequence set forth in SEQ ID NO:4 having up to 50, 25, 10, or 5 conservative amino acid substitutions excluding specific residues N38, S54, V151, V154, M158, C269, Q300, S316, S340, S430, and/or S437, wherein at least one or more of these specific residues have substitutions selected form the group consisting of N38S, S54F, S54M, V151A, V154E, M158L, C269A, C269G, C269L, C269S, Q300L, S316R, S340P, S340W, S430P, S437F, and/or S437W. In any of the foregoing embodiments, the polypeptide of SEQ ID NO:4 can lack the leader sequence and comprises amino acid 25-471 of SEQ ID NO:4 and having the foregoing substitutions.
[0068] In one embodiment, the disclosure provides a modified Ce16a enzymes derived from amino acid substitution(s) at one or more residues N38, L54, V155, V158, Q162, L276, I307, R323, S347, T436, and/or Y443 in Ce16a enzyme from Chaetomium thermophilum (SEQ ID NO:8), from which HJPlus is derived), wherein the modified Ce16a comprises increased thermostability and cellulase activity. The residue position(s) can further be identified by reference to the residues of SEQ ID NO:2 and FIG. 1. In one specific embodiment, the disclosure encompasses a variant Ce16a enzyme, wherein said enzyme comprises amino acid substitution(s) at one or more of the residues N38S, L54F, L54M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, S347P, S347W, T436P, Y443F, and/or Y443W in in Ce16a enzyme from Chaetomium thermophilum (SEQ ID NO:8), from which HJPlus is derived. Accordingly, in various embodiments, isolated or recombinant polypeptides comprising the amino acid sequence set forth in SEQ ID NO:8 having up to 50, 25, 10, or 5 conservative amino acid substitutions excluding specific residues N38, L54, V155, V158, Q162, L276, I307, R323, S347, T436, and/or Y443, wherein at least one or more of these specific residues have substitutions selected form the group consisting of N38S, L54F, L54M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, S347P, S347W, T436P, Y443F, and/or Y443W. In any of the foregoing embodiments, the polypeptide of SEQ ID NO:8 can lack the leader sequence and comprises amino acid 25-476 of SEQ ID NO:8 and having the foregoing substitutions.
[0069] In one embodiment, the disclosure provides modified Family 6 cellulases derived from amino acid substitution at one or more residues corresponding to N14, S30, V128, V131, M135, C246, Q277, S293, S317, S406, and/or S413 of SEQ ID NO:2. The residue position(s) in related Ce16a's can be identified by reference to FIG. 1. In one specific embodiment, the disclosure encompasses a variant Family 6 cellulase, wherein said enzyme comprises amino acid substitution at one or more of the residues corresponding to N14S, S30F, S30M, V128A, V131E, M135L, C246A, C246G, C246L, C246S, Q277L, S293R, S317P, S317W, S406P, S413F, and/or S413W of SEQ ID NO:2 (see, e.g., FIG. 1). Examples of Family 6 cellulases include, but are limited to, Humicola insolens Ce16a, Hypocrea jecorina Ce16a, Chaetomium thermophilum Ce16a, Phanerochaete chrysosporium Ce16a, Thermobifida fusca Ce16a and Ce16b, Cellulomonas fimi Ce16a and Ce16b, Talaromyces emersonii CBHII, Penicillium decumbens Ce16a, or variants derived from wild-type Family 6 cellulases mentioned above.
[0070] In other embodiments of the disclosure polypeptides comprising at least 67.7% or more (e.g., 80%, 85%, 90%, 95%, 98%, or 99%) identity to SEQ ID NO:2 and having any combination of the following amino acids S14, F30, M30, A128, E131, L135, A246, G246, L246, S246, L277, R293, P317, W317, P406, F413, and/or W413 and having Ce16a activity is provided.
[0071] In other embodiments of the disclosure polypeptides comprising at least 80%, 85%, 90%, 95%, 98%, or 99% identity to SEQ ID NO:4 and having any combination of the following amino acids S38, F54, M54, A151, E154, L158, A269, G269, L269, S269, L300, R316, P340, W340, P430, F437, and/or W437 and having Ce16a activity is provided.
[0072] In other embodiments of the disclosure polypeptides comprising at least 80%, 85%, 90%, 95%, 98%, or 99% identity to SEQ ID NO:6 and having any combination of the following amino acids S37, F53, M53, A155, E158, L162, A276, G276, S276, L307, R323, P347, W347, P436, F443, and/or W443 and having Ce16a activity is provided.
[0073] In other embodiments of the disclosure polypeptides comprising at least 80%, 85%, 90%, 95%, 98%, or 99% identity to SEQ ID NO:8 and having any combination of the following amino acids S38, F54, M54, A155, E158, L162, A276, G276, S276, L307, P347, W347, P436, F443, and/or W443 and having Ce16a activity is provided.
[0074] In one embodiment, the disclosure relates to a variant derived from an amino acid substitution at residue C246G in a thermostable cellulase of SEQ ID NO:2, or C269G of SEQ ID NO:4, or L276G of SEQ ID NO:6, or L276G of SEQ ID NO:8. The residue position corresponds to the position found in HJPlus of SEQ ID NO:2.
[0075] For the purposes of the disclosure, a polypeptide of the disclosure exhibits improved thermostability with respect to a corresponding parent polypeptide if it has a T.sub.50 which is at least about 5.degree. C., or at least about 9.degree. C. higher than that of the parent cellulase, or for example a cellobiohydrolase having a T.sub.50 from about 5.degree. C. to about 30.degree. C. higher, or any amount there between, or a T.sub.50 from about 9.degree. C. to about 30.degree. C. higher, or any amount there between, when compared to that of the parent cellobiohydrolase. The T.sub.50 is the temperature at which the modified or the natural enzyme retains 50% of its residual activity after a pre-incubation for 15 minutes and is determined by the assay detailed in Examples below or as known in the art.
[0076] A thermostable Ce16a variant of the disclosure comprises an enzyme that has a thermostability higher than the wild-type enzyme of SEQ ID NO:4, 6, or 8 by at least 5.degree. C. In one embodiment, the wild-type enzyme has a T.sub.50 of 70.degree. C. and a thermostabilized variant has an increase in T.sub.50 of 5.degree. C. or above. In various embodiments described herein, the modified Ce16a enzymes may exhibit enhanced thermostabilities, characterized by a 20-fold increase in half-life at 75.degree. C. and an increase of 7.9 .degree. C. in T.sub.50 value as compared to HJPlus Ce16a of SEQ ID NO:2, or wild-type enzymes comprising SEQ ID NO:4, 6, or 8.
[0077] The modified cellobiohydrolases or cellulases of the disclosure may have T.sub.50 which is about 5.degree. C. to about 30.degree. C. higher than that of a corresponding parent cellobiohydrolase (e.g., SEQ ID NO:2, 4, 6 or 8), or any range there between, about 5.degree. C. to about 20.degree. C. higher, or any range there between, about 8.degree. C. to about 15.degree. C. higher, or any range there between, or from about 9.degree. C. to about 15.degree. C. higher, or any range there between. For example, the modified cellulase may have a T.sub.50 that is at least about 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, or 30.degree. C. higher than that of the corresponding parent cellobiohydrolase.
[0078] The disclosure provides Ce16a variants, mutants and chimeras having increased thermostability compared to a wild-type protein consisting of SEQ ID NO:4, 6 or 8. In one embodiment, the thermostable enzyme is derived from amino acid substitution(s) at one or more residues G37, Q53, V155, V158, Q162, L276, I307, K323, P347, T436, and/or Y443 in Ce16a enzyme from Humicola insolens (SEQ ID NO:6). In another embodiment, the disclosure encompasses a variant Ce16a enzyme, wherein said thermostable enzyme comprises amino acid substitution(s) at one or more of the residues G37S, Q53F, Q53M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, K323R, P347W, T436P, Y443F, and/or Y443W in Ce16a enzyme from Humicola insolens (SEQ ID NO:6). In various embodiments, isolated or recombinant polypeptides are provided comprising the amino acid sequence set forth in SEQ ID NO:6 having up to 50, 25, 10, or 5 conservative amino acid substitutions excluding specific residues G37, Q53, V155, V158, Q162, L276, I307, K323, P347, T436, and/or Y443, wherein at least one or more of these specific residues have substitutions selected form the group consisting of G37S, Q53F, Q53M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, K323R, P347W, T436P, Y443F, and/or Y443W are provided. In any of the foregoing embodiments, the polypeptide of SEQ ID NO:6 can lack the leader sequence and comprises amino acid 24-476 of SEQ ID NO:6 and having the foregoing substitutions. In one embodiment, the disclosure provides a thermostable enzyme derived from amino acid substitution(s) at one or more residues N38, S54, V151, V154, M158, C269, Q300, S316, S340, S430, and/or S437 in a Ce16a enzyme from Hypocrea jecorina (SEQ ID NO:4). In one specific embodiment, the disclosure encompasses a thermostable variant enzyme, wherein said enzyme comprises amino acid substitution(s) at one or more of the residues N38S, S54F, S54M, V151A, V154E, M158L, C269A, C269G, C269L, C269S, Q300L, S316R, S340P, S340W, S430P, S437F, and/or S437W in in Ce16a enzyme from Hypocrea jecorina (SEQ ID NO:4). Accordingly, in various embodiments, isolated or recombinant thermostable enzymes are provided comprising the amino acid sequence set forth in SEQ ID NO:4 having up to 50, 25, 10, or 5 conservative amino acid substitutions excluding specific residues N38, S54, V151, V154, M158, C269, Q300, S316, S340, S430, and/or S437, wherein at least one or more of these specific residues have substitutions selected form the group consisting of N38S, S54F, S54M, V151A, V154E, M158L, C269A, C269G, C269L, C269S, Q300L, S316R, S340P, S340W, S430P, S437F, and/or S437W. In any of the foregoing embodiments, the polypeptide of SEQ ID NO:4 can lack the leader sequence and comprises amino acid 25-471 of SEQ ID NO:4 and having the foregoing substitutions. In one embodiment, the disclosure provides a thermostable enzyme derived from amino acid substitution(s) at one or more residues N38, L54, V155, V158, Q162, L276, I307, R323, S347, T436, and/or Y443 in Ce16a enzyme from Chaetomium thermophilum (SEQ ID NO:8). In one embodiment, the disclosure encompasses a thermostable variant enzyme, wherein said enzyme comprises amino acid substitution(s) at one or more of the residues N38S, L54F, L54M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, S347P, S347W, T436P, Y443F, and/or Y443W in a Ce16a enzyme from Chaetomium thermophilum (SEQ ID NO:8). Accordingly, in various embodiments, isolated or recombinant thermostable polypeptides are provided comprising the amino acid sequence set forth in SEQ ID NO:8 having up to 50, 25, 10, or 5 conservative amino acid substitutions excluding specific residues N38, L54, V155, V158, Q162, L276, I307, R323, S347, T436, and/or Y443, wherein at least one or more of these specific residues have substitutions selected form the group consisting of N38S, L54F, L54M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, S347P, S347W, T436P, Y443F, and/or Y443W. In any of the foregoing embodiments, the polypeptide of SEQ ID NO:8 can lack the leader sequence and comprises amino acid 25-476 of SEQ ID NO:8 and having the foregoing substitutions.
[0079] Additional Ce16a family members can be identified by sequence alignment using any of the sequences of SEQ ID NO:2, 4, 6, or 8. These family members can then be modified at corresponding amino acid positions as set forth above. The modified polypeptide may then be assayed for activity as described below at various temperatures and conditions to identify those modifications that introduce a favorable activity.
[0080] The variants identified herein can also be used to generate chimeric cellobiohydrolases. For example, SCHEMA has been used previously to create families of hundreds of active .beta.-lactamase and cytochrome P450 enzyme chimeras. SCHEMA uses protein structure data to define boundaries of contiguous amino acid "blocks" which minimize <E>, the library average number of amino acid sidechain contacts that are broken when the blocks are swapped among different parents. It has been shown that the probability that a .beta.-lactamase chimera was folded and active was inversely related to the value of E for that sequence. The RASPP (Recombination as Shortest Path Problem) algorithm was used to identify the block boundaries that minimized <E> relative to the library average number of mutations, <m>. More than 20% of the .about.500 unique chimeras characterized from a .beta.-lactamase collection comprised of 8 blocks from 3 parents (3.sup.8=6,561 possible sequences) were catalytically active. A similar approach produced a 3-parent, 8-block cytochrome P450 chimera family containing more than 2,300 novel, catalytically active enzymes. Chimeras from these two collections were characterized by high numbers of mutations, 66 and 72 amino acids on average from the closest parent, respectively. SCHEMA/RASPP thus enabled design of chimera families having significant sequence diversity and an appreciable fraction of functional members.
[0081] It has also been shown that the thermostabilities of SCHEMA chimeras can be predicted based on sequence-stability data from a small sample of the sequences. Linear regression modeling of thermal inactivation data for 184 cytochrome P450 chimeras showed that SCHEMA blocks made additive contributions to thermostability. More than 300 chimeras were predicted to be thermostable by this model, and all 44 that were tested were more stable than the most stable parent. It was estimated that as few as 35 thermostability measurements could be used to predict the most thermostable chimeras. Furthermore, the thermostable P450 chimeras displayed unique activity and specificity profiles, demonstrating that chimeragenesis can lead to additional useful enzyme properties. Here SCHEMA recombination of CBH II enzymes can generate chimeric cellulases that are active on phosphoric acid swollen cellulose (PASC) at high temperatures, over extended periods of time, and broad ranges of pH.
[0082] Descriptions of SCHEMA directed recombination and synthesis of chimeric polypeptides are described in the examples herein, as well as in Otey et al., (2006), PLoS Biol. 4(5):e112; Meyer et al., (2003) Protein Sci., 12:1686-1693; U.S. patent application Ser. No. 12/024,515, filed Feb. 1, 2008; and U.S. patent application Ser. No. 12/027,885, filed Feb. 7, 2008; such references incorporated herein by reference in their entirety.
[0083] In other embodiments, the thermostable enzymes described above can be operably linked to a cellulose binding domain (CBD) such as the CBD-linker polypeptide set forth in SEQ ID NO:10. "Fused," "operably linked," and "operably associated" are used interchangeably herein to broadly refer to a chemical or physical coupling of two otherwise distinct domains or peptide segments, wherein each domain or peptide segment when operably linked can provide a functional polypeptide having a desired activity. Domains or peptide segments can be connected through peptide linkers such that they are functional or can be fused through other intermediates or chemical bonds. For example, two domains can be part of the same coding sequence, wherein the polynucleotides are in frame such that the polynucleotide when transcribed encodes a single mRNA that when translated comprises both domains as a single polypeptide. Alternatively, both domains can be separately expressed as individual polypeptides and fused to one another using chemical methods. Typically, the coding domains will be linked "in-frame" either directly of separated by a peptide linker and encoded by a single polynucleotide. Various coding sequences for peptide linkers and peptide are known in the art.
[0084] In some embodiments, a polypeptide of the disclosure comprise a substantially pure polypeptide. A "substantially pure polypeptide" refers to a composition in which the polypeptide species is the predominant species present (i.e., on a molar or weight basis it is more abundant than any other individual macromolecular species in the composition), and is generally a substantially purified composition when the object species comprises at least about 50 percent of the macromolecular species present by mole or % weight. Generally, a substantially pure polypeptide composition will comprise about 60% or more, about 70% or more, about 80% or more, about 90% or more, about 95% or more, and about 98% or more of all macromolecular species by mole or % weight present in the composition. In some embodiments, the object species is purified to essential homogeneity (i.e., contaminant species cannot be detected in the composition by conventional detection methods) wherein the composition consists essentially of a single macromolecular species. Solvent species, small molecules (<500 Daltons), and elemental ion species are not considered macromolecular species.
[0085] The disclosure also provides polynucleotide and nucleic acids encoding the polypeptides described herein. "Polynucleotide" or "nucleic acid sequence" refers to a polymeric form of nucleotides. In some instances a polynucleotide refers to a sequence that is not immediately contiguous with either of the coding sequences with which it is immediately contiguous (one on the 5' end and one on the 3' end) in the naturally occurring genome of the organism from which it is derived. The term therefore includes, for example, a recombinant DNA which is incorporated into a vector; into an autonomously replicating plasmid or virus; or into the genomic DNA of a prokaryote or eukaryote, or which exists as a separate molecule (e.g., a cDNA) independent of other sequences. The nucleotides of the disclosure can be ribonucleotides, deoxyribonucleotides, or modified forms of either nucleotide. A polynucleotides as used herein refers to, among others, single-and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, and RNA that is mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or a mixture of single- and double-stranded regions. The term polynucleotide encompasses genomic DNA or RNA (depending upon the organism, i.e., RNA genome of viruses), as well as mRNA encoded by the genomic DNA, and cDNA.
[0086] The polynucleotides may be operatively linked to one or more heterologous regulatory or control sequences that control gene expression to create a recombinant polynucleotide capable of expressing the polypeptide. Expression constructs containing a heterologous polynucleotide encoding the Ce16a variant can be introduced into appropriate host cells to express the polypeptide.
[0087] Given the knowledge of specific sequences of the Ce16a enzymes (see, e.g., SEQ ID NOs:1, 3, 5, and 7), the polynucleotide sequences will be apparent form the amino acid sequence of the disclosure to one of skill in the art. The knowledge of the codons corresponding to various amino acids coupled with the knowledge of the amino acid sequence of the polypeptides allows those skilled in the art to make different polynucleotides encoding the polypeptides of the disclosure. Thus, the disclosure contemplates each and every possible variation of the polynucleotides that could be made by selecting combinations based on possible codon choices, and all such variations are to be considered specifically disclosed for any of the polypeptides described herein.
[0088] In some embodiments, the polynucleotides encode the polypeptides described herein but have about 80% or more sequence identity, about 85% or more sequence identity, about 90% or more sequence identity, about 91% or more sequence identity, about 92% or more sequence identity, about 93% or more sequence identity, about 94% or more sequence identity, about 95% or more sequence identity, about 96% or more sequence identity, about 97% or more sequence identity, about 98% or more sequence identity, or about 99% or more sequence identity at the nucleotide level to a reference polynucleotide encoding the Ce16a polypeptides of SEQ ID NO:2, 4, 6, 8, 12, 14, 16, 18, 20, 22, 24, 26, or 28 and encode a polypeptide having cellulase activity and thermostability that is greater than a wild-type Ce16a of SEQ ID NO:4, 6, or 8.
[0089] In one embodiment, an isolated polynucleotide of the disclosure comprises at least 80% identity (e.g., 80, 85, 90, 95, 98, 99% identity) to SEQ ID NO:1, 3, 5, 7, 11, 13, 15, 17, 19, 21, 23, 25, or 27 and which encodes a polypeptide of SEQ ID NO:2, 4, 6, 8, 12, 14, 16, 18, 20, 22, 24, 26, or 28 and wherein the polypeptide comprises cellulase activity and has improved thermostability compared to a polypeptide comprising SEQ ID NO:4, 6, or 8. In another embodiment, the disclosure provides a polynucleotide comprising a sequence selected from the group consisting of SEQ ID NO: 11, 13, 15, 17, 19, 21, 23, 25, and 27. In yet another embodiment, the disclosure provides a polynucleotide comprising a sequence that encodes a polypeptide of SEQ ID NO:6 and having one or more substitutions selected from the group consisting of G37S, Q53F, Q53M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, K323R, P347W, T436P, Y443F, and Y443W. In yet another embodiment, the disclosure provides a polynucleotide comprising a sequence that encodes a polypeptide of SEQ ID NO:4 and having one or more substitutions selected from the group consisting of N38S, S54F, S54M, V151A, V154E, M158L, C269A, C269G, C269S, Q300L, S316R, S340P, S340W, S430P, S437F, and S437W. In yet another embodiment, the disclosure provides a polynucleotide comprising a sequence that encodes a polypeptide of SEQ ID NO:8 and having one or more substitutions selected from the group consisting of N38S, L54F, L54M, V155A, V158E, Q162L, L276A, L276G, L276S, I307L, S347P, S347W, T436P, Y443F, and Y443W.
[0090] In some embodiments, the isolated polynucleotides encoding the polypeptides may be manipulated in a variety of ways to provide for expression of the polypeptide. Manipulation of the isolated polynucleotide prior to its insertion into a vector may be desirable or necessary depending on the expression vector. The techniques for modifying polynucleotides and nucleic acid sequences utilizing recombinant DNA methods are well known in the art. Guidance is provided in Sambrook et al., 2001, Molecular Cloning: A Laboratory Manual, 3rd Ed., Cold Spring Harbor Laboratory Press; and Current Protocols in Molecular Biology, Ausubel. F. ed., Greene Pub. Associates, 1998, updates to 2007.
[0091] In some embodiments, the polynucleotides are operatively linked to control sequences for the expression of the polynucleotides and/or polypeptides. In some embodiments, the control sequence may be an appropriate promoter sequence, which can be obtained from genes encoding extracellular or intracellular polypeptides, either homologous or heterologous to the host cell. For bacterial host cells, suitable promoters for directing transcription of the nucleic acid constructs of the present disclosure, include the promoters obtained from the E. coli lac operon, Bacillus subtilis xy1A and xy1B genes, Bacillus megatarium xylose utilization genes (e.g., Rygus et al., (1991) Appl. Microbiol. Biotechnol. 35:594-599; Meinhardt et al., (1989) Appl. Microbiol. Biotechnol. 30:343-350), prokaryotic beta-lactamase gene (Villa-Kamaroff et al., (1978) Proc. Natl Acad. Sci. USA 75: 3727-3731), as well as the tac promoter (DeBoer et al., (1983) Proc. Natl Acad. Sci. USA 80: 21-25). Various suitable promoters are described in "Useful proteins from recombinant bacteria" in Scientific American, 1980, 242:74-94; and in Sambrook et al., supra.
[0092] In some embodiments, the control sequence may also be a suitable transcription terminator sequence, a sequence recognized by a host cell to terminate transcription. The terminator sequence is operably linked to the 3' terminus of the nucleic acid sequence encoding the polypeptide. Any terminator which is functional in the host cell of choice may be used.
[0093] In some embodiments, the control sequence may also be a suitable leader sequence, a nontranslated region of an mRNA that is important for translation by the host cell. The leader sequence is operably linked to the 5' terminus of the nucleic acid sequence encoding the polypeptide. Any leader sequence that is functional in the host cell of choice may be used.
[0094] In some embodiments, the control sequence may also be a signal peptide coding region that codes for an amino acid sequence linked to the amino terminus of a polypeptide and directs the encoded polypeptide into the cell's secretory pathway. The 5' end of the coding sequence of the nucleic acid sequence may inherently contain a signal peptide coding region naturally linked in translation reading frame with the segment of the coding region that encodes the secreted polypeptide. Alternatively, the 5' end of the coding sequence may contain a signal peptide coding region that is foreign to the coding sequence. The foreign signal peptide coding region may be required where the coding sequence does not naturally contain a signal peptide coding region. Effective signal peptide coding regions for bacterial host cells can be the signal peptide coding regions obtained from the genes for Bacillus NC1B 11837 maltogenic amylase, Bacillus stearothermophilus alpha-amylase, Bacillus licheniformis subtilisin, Bacillus licheniformis beta-lactamase, Bacillus stearothermophilus neutral proteases (nprT, nprS, nprM), and Bacillus subtilis prsA. Further signal peptides are described by Simonen and Palva, (1993) Microbiol Rev 57: 109-137.
[0095] The disclosure is further directed to a recombinant expression vector comprising a polynucleotide encoding the engineered Cel6a polypeptides, and one or more expression regulating regions such as a promoter and a terminator, a replication origin, etc., depending on the type of hosts into which they are to be introduced. In creating the expression vector, the coding sequence is located in the vector so that the coding sequence is operably linked with the appropriate control sequences for expression.
[0096] The recombinant expression vector may be any vector (e.g., a plasmid or virus), which can be conveniently subjected to recombinant DNA procedures and can bring about the expression of the polynucleotide sequence. The choice of the vector will typically depend on the compatibility of the vector with the host cell into which the vector is to be introduced. The vectors may be linear or closed circular plasmids.
[0097] The expression vector may be an autonomously replicating vector, i.e., a vector that exists as an extrachromosomal entity, the replication of which is independent of chromosomal replication, e.g., a plasmid, an extrachromosomal element, a minichromosome, or an artificial chromosome. The vector may contain any means for assuring self-replication. Alternatively, the vector may be one which, when introduced into the host cell, is integrated into the genome and replicated together with the chromosome(s) into which it has been integrated. Furthermore, a single vector or plasmid or two or more vectors or plasmids which together contain the total DNA to be introduced into the genome of the host cell, or a transposon, may be used.
[0098] In some embodiments, the expression vector of the disclosure contains one or more selectable markers, which permit easy selection of transformed cells. A selectable marker is a gene the product of which provides for biocide or viral resistance, resistance to heavy metals, prototrophy to auxotrophs, and the like. Examples of bacterial selectable markers are the dal genes from Bacillus subtilis or Bacillus licheniformis, or markers, which confer antibiotic resistance such as ampicillin, kanamycin, chloramphenicol or tetracycline resistance. Other useful markers will be apparent to the skilled artisan.
[0099] In another embodiment, the disclosure provides a host cell comprising a polynucleotide encoding a Ce16a polypeptide, the polynucleotide being operatively linked to one or more control sequences for expression of the polypeptide in the host cell. Host cells for use in expressing the polypeptides encoded by the expression vectors of the disclosure are well known in the art and include, but are not limited to, bacterial cells, such as E. coli and Bacillus megaterium; eukaryotic cells, such as yeast cells, CHO cells and the like, insect cells such as Drosophila S2 and Spodoptera Sf9 cells; animal cells such as CHO, COS, BHK, 293, and Bowes melanoma cells; and plant cells. Other suitable host cells will be apparent to the skilled artisan. Appropriate culture mediums and growth conditions for the above-described host cells are well known in the art.
[0100] The Ce16a polypeptides of the disclosure can be made by using methods well known in the art. Polynucleotides can be synthesized by recombinant techniques, such as that provided in Sambrook et al., 2001, Molecular Cloning: A Laboratory Manual, 3rd Ed., Cold Spring Harbor Laboratory Press; and Current Protocols in Molecular Biology, Ausubel. F. ed., Greene Pub. Associates, 1998, updates to 2007. Polynucleotides encoding the enzymes, or the primers for amplification can also be prepared by standard solid-phase methods, according to known synthetic methods, for example using phosphoramidite method described by Beaucage et al., (1981) Tet Lett 22:1859-69, or the method described by Matthes et al., (1984) EMBO J. 3:801-05, e.g., as it is typically practiced in automated synthetic methods. In addition, essentially any nucleic acid can be obtained from any of a variety of commercial sources, such as The Midland Certified Reagent Company, Midland, Tex., The Great American Gene Company, Ramona, Calif., ExpressGen Inc. Chicago, Ill., Operon Technologies Inc., Alameda, Calif., and many others.
[0101] Engineered enzymes expressed in a host cell can be recovered from the cells and or the culture medium using any one or more of the well-known techniques for protein purification, including, among others, lysozyme treatment, sonication, filtration, desalting, ultra-centrifugation, chromatography, and affinity separation (e.g., substrate bound antibodies). Suitable solutions for lysing and the high efficiency extraction of proteins from bacteria, such as E. coli, are commercially available under the trade name CelLytic BTM from Sigma-Aldrich of St. Louis Mo.
[0102] Chromatographic techniques for isolation of the polypeptides include, among others, reverse phase chromatography high performance liquid chromatography, ion exchange chromatography, gel electrophoresis, and affinity chromatography. Conditions for purifying a particular enzyme will depend, in part, on factors such as net charge, hydrophobicity, hydrophilicity, molecular weight, molecular shape, etc., and will be apparent to those having skill in the art.
[0103] As discussed above, the polypeptide can be used in a variety of applications, such as, among others, biofuel generation, cellulose breakdown and the like.
[0104] The disclosure also provides a recombinant yeast expressing a Ce16a polypeptide variant as described above. The recombinant organisms of the disclosure are useful for bioethanol production. The engineered strains can be evaluated for cellulose hydrolysis and ethanol production under different conditions such as resting and growth conditions in SDC medium. Both small and large-scale (shaker flask/one liter bioreactor) studies can be performed. In resting cell experiments, cells are grown aerobically using glucose as the carbon source. Cells are then washed and used in cellulose anaerobic hydrolysis. Enzyme activity, hydrolysis products, glucose, and ethanol will be monitored using methods described herein. In studies carried out in a fermentor, a mild agitation can be used to promote mixing of solid cellulose material with cells. Once optimized industrial yeast fermentation process may be used. Different cellulose concentrations can also be used. The rate of glucose generation will be estimated from the experiments and compared to those without the modified Ce16a polypeptides. In studies under growing conditions, the cells will be provided cellulose as the sole carbon source, and other nutrients necessary for growth. Anaerobic conditions are maintained. Cell biomass, enzyme activities, glucose and ethanol are measured.
[0105] The disclosure provides yeast strains for direct fermentation of cellulose to ethanol, eliminating the need for use of purified cellulases. The methods and compositions of the disclosure provide abundant, low-cost, agriculture residue to be used as raw material for ethanol production. The increased production of ethanol not only reduces pollution to the environment but also the need for imported petroleum as transportation fuel. Collectively, the benefits from the invention include at least efficient, economical, and environmentally friendly conversion of biomass.
[0106] The disclosure also provides purified enzymes (i.e., Ce16a thermostable variants) that can be used for industrial applications. Under such conditions, the enzymes are purified from a yeast or other microorganism engineered to express the thermostable enzyme and the enzymes are then added to a reactor comprising cellulose to be degraded. Other cellulase enzymes (e.g., Ce17a) can be added to the reactor.
[0107] The following examples are meant to further explain, but not limited the foregoing disclosure or the appended claims.
EXAMPLES
[0108] Strains, plasmids, and oligonucleotides. Strains, plasmid, oligonucleotide, nucleotide and amino acid sequences described herein listed in Tables 1, 2, 3, and 4 below.
TABLE-US-00001 TABLE 1 Genotypes of strains disclosed herein Species Strain Genotype E. coli XL1-blue recA1 endA1 gyrA96 thi-1 hsdR17 supE44 relA1 lac [F' proAB lacIqZ.DELTA.M15 Tn10 (Tetr)] S. cerevisiae YDR483W Mata his3D1 leu2D0 lys2D0 ura3D0 BY4742 Dkre2, ATCC No. 4014317
TABLE-US-00002 TABLE 2 Plasmids disclosed herein Name Source or reference pBack YEp352/PGK91-1-.alpha.ss pHJPlus HJPlus gene cloned into the pBack plasmid; it is described in U.S. patent application 12/723,597 p1G6 1G6 gene cloned into the pBack plasmid p2B3 2B3 gene cloned into the pBack plasmid p3C6P 3C6P gene cloned into the pBack plasmid
TABLE-US-00003 TABLE 3 Oligonucleotide sequences (shown from 5' to 3') disclosed herein. Seq Name Sequence ID alpha_HomeRe_Lt CGGGTTATTGTTTATAAATACTACTATTGCCAG 29 His_HomRe_Rt GACATGGGAGATCGAATTCAACTCC 30 S30F_top GCACATGCGTCTACTTCAACGACTATTACTCC 31 S30F_bottom GGAGTAATAGTCGTTGAAGTAGACGCATGTGC 32 WT30_top GCACATGCGTCTACTCCAACGACTATTACTCC 33 WT30_bottom GGAGTAATAGTCGTTGGAGTAGACGCATGTGC 34 V128A_top GCAGCTAGTGCTGCGGCTGAGGTGCCAAGTTTTATGTGGCTGGATAC 35 V128A_bottom GTATCCAGCCACATAAAACTTGGCACCTCAGCCGCAGCACTAGCTGC 36 V131E_top GCAGCTAGTGCTGTGGCTGAGGAGCCAAGTTTTATGTGGCTGGATAC 37 V131E_bottom GTATCCAGCCACATAAAACTTGGCTCCTCAGCCACAGCACTAGCTGC 38 M135L_top GCAGCTAGTGCTGTGGCTGAGGTGCCAAGTTTTTTGTGGCTGGATAC 39 M135L_bottom GTATCCAGCCACAAAAAACTTGGCACCTCAGCCACAGCACTAGCTGC 40 V128A/V131E_top GCAGCTAGTGCTGCGGCTGAGGAGCCAAGTTTTATGTGGCTGGATAC 41 V128A/V131E_bottom GTATCCAGCCACATAAAACTTGGCTCCTCAGCCGCAGCACTAGCTGC 42 V128A/M135L_top GCAGCTAGTGCTGCGGCTGAGGTGCCAAGTTTTTTGTGGCTGGATAC 43 V128A/M135L_bottom GTATCCAGCCACAAAAAACTTGGCACCTCAGCCGCAGCACTAGCTGC 44 V131E/M135L_top GCAGCTAGTGCTGTGGCTGAGGAGCCAAGTTTTTTGTGGCTGGATAC 45 V131E/M135L_bottom GTATCCAGCCACAAAAAACTTGGCTCCTCAGCCACAGCACTAGCTGC 46 128/131/135_top GCAGCTAGTGCTGCGGCTGAGGAGCCAAGTTTTTTGTGGCTGGATAC 47 128/131/135_bottom GTATCCAGCCACAAAAAACTTGGCTCCTCAGCCGCAGCACTAGCTGC 48 WT128/131/135_top GCAGCTAGTGCTGTGGCTGAGGTGCCAAGTTTTATGTGGCTGGATAC 49 WT128/131/135_bottom GTATCCAGCCACATAAAACTTGGCACCTCAGCCACAGCACTAGCTGC 50 S293R_top CAAAAATGCCTCAAGACCTAGAGCGCTG 51 S293R_bottom CAGCGCTCTAGGTCTTGAGGCATTTTTG 52 WT293_top CAAAAATGCCTCAAGTCCTAGAGCGCTG 53 WT293_bottom CAGCGCTCTAGGACTTGAGGCATTTTTG 54 S40613_top GATGGAACGAGTGATCCTTCTGCTCCAAG 55 S406P_bottom CTTGGAGCAGAAGGATCACTCGTTCCATC 56 WT406_top GATGGAACGAGTGATTCTTCTGCTCCAAG 57 WT406_bottom CTTGGAGCAGAAGAATCACTCGTTCCATC 58 N14NNKLt GGCCAATGTGGTGGCCAGNNKTGGTCGGGTCCGAC 59 N14 Rt CTGGCCACCACATTGGCC 60 S30NNK Lt CCGGAAGCACATGCGTCTACNNKAACGACTATTACTCCCAGTG 61 S30 Rt GTAGACGCATGTGCTTCCGG 62 V128NNK Lt CGTGCCGCAGCTAGTGCTNNKGCTGAGGTGCCAAG 63 V128 Rt AGCACTAGCTGCGGCACG 64 V131NNK Lt GCAGCTAGTGCTGTGGCTGAGNNKCCAAGTTTTATGTGGCTG 65 V131 Rt CTCAGCCACAGCACTAGCTGC 66 M135NNK Lt GTGGCTGAGGTGCCAAGTTTTNNKTGGCTGGATACTTTGG 67 M135 Rt AAAACTTGGCACCTCAGCCAC 68 Q277NNK Lt GTTGGGTTGGCCAGCAAATNNKGATCCCGCTGCGCAG 69 Q277 Rt ATTTGCTGGCCAACCCAAC 70 S293NNK Lt GCAAATGTTTACAAAAATGCCTCANNKCCTAGAGCGCTGAGG 71 S293 Rt TGAGGCATTTTTGTAAACATTTGC 72 S317NNK Lt CTTGGTCAATAGCGAGTCCTCCANNKTACACAAGCCCTAACCC 73 S317 Rt GGAGGACTCGCTATTGACCAAG 74 S406NNK Lt GGAGAGTCAGATGGAACGAGTGATNNKTCTGCTCCAAGGTTCG 75 S406 Rt ATCACTCGTTCCATCTGACTCTCC 76 S413NNK Lt GATTCTTCTGCTCCAAGGTTCGATNNKCATTGCGCATTACCAG 77 S413 Rt ATCGAACCTTGGAGCAGAAGAATC 78 W99Y Lt CTTTGAAGGTGTTCAGCTGTATGCTAATAACTATTATAGATCTGAG 79 W99Y Rt CTCAGATCTATAATAGTTATTAGCATACAGCTGAACACCTTCAAAG 80 N102P Lt CAGCTGTGGGCTAATCCATATTATAGATCTGAGGTACATAC 81 N102P Rt GTATGTACCTCAGATCTATAATATGGATTAGCCCACAGCTG 82 R122A Lt GACCCCGCGTTGGCTGCCGCAGCTAGTG 83 R122A Rt CACTAGCTGCGGCAGCCAACGCGGGGTC 84 A124K Lt GCGTTGCGTGCCAAAGCTAGTGCTGCGG 85 A124K Rt CCGCAGCACTAGCTTTGGCACGCAACGC 86 M146L Lt GACAAAACCCCCTTATTGGAACAAACGTTGGC 87 M146L Rt GCCAACGTTTGTTCCAATAAGGGGGTTTTGTC 88 I153A Lt CAAACGTTGGCTGATGCTCGTACTGCGAATAAAAAC 89 I153A Rt GTTTTTATTCGCAGTACGAGCATCAGCCAACGTTTG 90 Y186L Lt GAGCAACGGGGAGTTGAGCATTGCGGATG 91 Y186L Rt CATCCGCAATGCTCAACTCCCCGTTGCTC 92 C246G Lt CAGAGTGCTTATCTTGAGGGTATCAATTATGCAGTCAC 93 C246G Rt GTGACTGCATAATTGATACCCTCAAGATAAGCACTCTG 94 V251L Lt GTGCATCAATTATGCATTGACCCAGTTGAATTTG 95 V251L Rt CAAATTCAACTGGGTCAATGCATAATTGATGCAC 96 S292G Lt GTTTACAAAAATGCCGGTAGTCCTAGAGCGCTG 97 S292G Rt CAGCGCTCTAGGACTACCGGCATTTTTGTAAAC 98 L297V Lt CTCAAGTCCTAGAGCGGTTAGGGGTCTTGCAAC 99 L297V Rt GTTGCAAGACCCCTAACCGCTCTAGGACTTGAG 100 P321W Lt CCACCGTACACAAGCTGGAACCCAAACTACGATG 101 P321W Rt CATCGTAGTTTGGGTTCCAGCTTGTGTACGGTGG 102 F334L Lt GCATTACATAGAAGCATTGGCTCCTTTGCTTCG 103 F334L Rt CGAAGCAAAGGAGCCAATGCTTCTATGTAATGC 104 P358G Lt GAAACGGCAAGCAGGGTACAGGGCAGCTAGAATG 105 G358G Rt CATTCTAGCTGCCCTGTACCCTGCTTGCCGTTTC 106 G360R Lt CAAGCAGCCGACAAGACAGCTAGAATGGGG 107 G360R Rt CCCCATTCTAGCTGTCTTGTCGGCTGCTTG 108 Q361R Lt CAGCCGACAGGGAGACTAGAATGGGGGC 109 Q361R Rt GCCCCCATTCTAGTCTCCCTGTCGGCTG 110 T373A Lt GCAATGTCAAGGGTGCTGGTTTCGGTGTTAGAC 111 T373A Rt GTCTAACACCGAAACCAGCACCCTTGACATTGC 112
[0109] Media, buffers, and reagents. SD-Ura media: commercially available from MP Biomedicals, contains 20 g/L D-glucose, 1.7 g/L yeast nitrogen base, 5 g/L ammonium sulfate, and 0.8 g/L casamino acids without uracil. YPD media: 10 g/L Bacto yeast extract, 20 g/L Bacto peptone, and 20 g/L D-glucose. Tris-DTT buffer: 390 g/L 1,4-dithiothreitol and 121.1 g/L of Tris base, pH 8.0. Buffer E: 1.2 g/L Tris base, 92.4 g/L sucrose, and 0.2 g/L magnesium chloride, pH 7.4. Buffer A: 20 mM Tris, 100 mM sodium chloride, and 10 mM imidazole, pH 8.0. Buffer B: 20 mM Tris, 100 mM sodium chloride, and 300 mM imidazole, pH 8.0. Somogyi reagent 1: 180 g/L Na.sub.2SO.sub.4, 15 g/L Rochelle salt, 30 g/L Na.sub.2CO.sub.3, and 20 g/L NaHCO.sub.3. Somogyi reagent 2: 180 g/L Na.sub.2SO.sub.4 and 12.8 g of anhydrous CuSO.sub.4. Nelson reagent: 50 g/L (NH.sub.4).sub.2MoO.sub.4, 1.5 N H.sub.2SO.sub.4, and 6 g/L NaH.sub.2AsO.sub.4; incubate at 37.degree. C. for 16-24 hours for the formation of the chromogenic compound.
[0110] High-efficiency S. cerevisiae transformation. The transformation protocol published by Chao et al. (Nat Protoc, 1(2):755-768, 2006) was adapted and scaled down to generate libraries with 10.sup.4 colonies. A colony was used to start a 5 mL YPD culture and grown overnight at 30.degree. C. and 250 rpm. In the morning, the overnight culture was used to inoculate 10 mL of YPD media per transformation to an OD.sub.600 of 0.1. The YPD culture was grown at 30.degree. C. and 250 rpm until an OD.sub.600 of 1.5. Once the cells reached the desired absorbance, 100 .mu.L of Tris-DTT buffer per 10 mL of YPD culture was added and incubated at 30.degree. C. and 250 rpm for 15 minutes. The cells were pelleted at 2,500 g for 3 minutes at 4.degree. C., washed with 10 mL of ice-cold buffer E per 10 mL of culture, and again washed with 1 mL of ice-cold buffer E. The cell pellet was resuspended in 50 .mu.L of ice-cold buffer E per transformation. For each transformation, 50 .mu.L competent cells were mixed with 1 .mu.g of DNA in less than 5 .mu.L volume and transferred to an ice-cold 0.2-cm electroporation cuvette. The cells were electroporated at 0.54 kV and 25 .mu.F without a pulse controller and immediately rescued by adding 1 mL of warm (30.degree. C.) YPD media. The cells were incubated at 30.degree. C. and 250 rpm for 1 hour before plating on SD-Ura agar plates and grown at 30.degree. C. for three days.
[0111] Heterologous expression in S. cerevisiae in 96-well plates. To express random mutagenesis libraries in S. cerevisiae, the high-efficiency competent cells were used. The competent cells were transformed with 0.5 .mu.g of the linearized vector and 0.5 .mu.g of the error-prone ce16a PCR insert via electroporation and plated on SD-Ura agar plates. The linearized vector and the PCR insert shared regions of homology upstream and downstream of the ce16a gene and were expected to be joined together by homology recombination in S. cerevisiae. Colonies containing mutant Ce16a were randomly selected and inoculated in 50 .mu.L/well of SD-Ura media in 96-well plates. The culture was grown overnight at 30.degree. C., 250 rpm with 80% humidity in orbital shakers. Once the culture in SD-Ura media reached saturation, it was expanded with 350 .mu.L/well of YPD media and grown at 30.degree. C., 250 rpm with 80% humidity for an additional of 48 hours. Both the SD-Ura media and the YPD media in 96-well plates were supplemented with 25 .mu.g/mL of kanamycin to prevent bacterial contamination. The culture was harvested by centrifugation at 5,000.times.g, 4.degree. C. for 10 minutes, and the supernatant was used for activity assays without further treatment.
[0112] High-throughput Ce16a activity assay on Avicel. Ce16a enzymes in the culture supernatants were purified by binding to the substrate and washing with 50 mM sodium acetate, pH 5.0, to remove the media. Substrate plates were prepared by pipetting 60 .mu.L of well-agitated 50 mg/mL Avicel solution into 96-well PCR plates. 100 .mu.L of 3-day culture supernatant were added to the substrate plates and incubated at 4.degree. C. for 1.5 hours. Avicel and the bound enzymes were pelleted via centrifugation at 1,000.times.g, 4.degree. C. and washed three times with 180 .mu.L of 50 mM sodium acetate, pH 5.0. After the wash step, Avicel and the bound enzymes were resuspended in 75 .mu.L of 50 mM sodium acetate, pH 5.0 and incubated at 75.degree. C. for two hours. After the 2-hour incubation, the mixture was cooled immediately to 4.degree. C. and centrifuged at 1,000 g for 10 minutes at 4.degree. C. 50 .mu.L of the supernatant was transferred for determination of the reducing end concentrations using the Nelson-Somogyi microtiter assay described below. 0.1 mM to 2 mM of cellobiose were used as standards.
[0113] Detection of reducing sugars. For reducing sugar in the range of 0.15 mM to 2 mM, the Nelson-Somogyi assay was used.
[0114] Typically, 50 .mu.L of sugar solution was mixed with 40 .mu.L of Somogyi reagent 1 and 10 .mu.L of Somogyi reagent 2 and boiled at 95.degree. C. for 15 minutes. The reaction was subsequently cooled to 4.degree. C. and mixed with 50 .mu.L of Nelson reagent. The reagents were mixed thoroughly to ensure the evolution of CO.sub.2 was completed and the maximum color development was achieved. After centrifuging the reagents briefly to remove the CO.sub.2 in the solution, the absorbance of the sugar solution at 520 nm was obtained using a SpectraMax microplate reader with or without cellobiose solution as standard.
[0115] Plasmid DNA recovery from S. cerevisiae. The plasmid DNA was recovered from S. cerevisiae using the Zymoprep.TM. II Yeast Plasmid Miniprep kit (Zymo Research). An aliquot of 200 .mu.L of yeast cells from the library screen were pelleted at 2500 g for 2 minutes. The cell pellet was resuspended in 200 .mu.L of Solution 1 and 5 .mu.L of Zymolase.TM. provided by the kit and incubated at 37.degree. C. for 1 hour. 200 .mu.L of Solution 2 and 400 .mu.L of Solution 3 provided by the kit were added sequentially and thoroughly mixed. The mixture was centrifuged at 14,000 rpm for 10 minutes in a table-top microcentrifuge. The following purification steps using the Zymo columns were according to the manufacturer's instructions. The plasmid DNA was eluted with 6 .mu.L of Buffer EB provided by the kit. The plasmid DNA was amplified using E. coli XL1-blue cells and minipreped using QIAprep Spin Miniprep Kit (Qiagen). The sequence of the plasmid DNA was determined using external sequencing facilities.
[0116] Low-efficiency S. cerevisiae transformation. S. cerevisiae cells were made competent using the Frozen-EZ Yeast Transformation II.TM. Kit (Zymo Research) for plasmid DNA transformation. A colony was used to start a 5 mL YPD culture and grown overnight at 30.degree. C. and 250 rpm. In the morning, the overnight culture was used to inoculate a new YPD culture to an OD.sub.600 of 0.1. The YPD culture was grown until the OD.sub.600 of 1. The cells were pelleted, washed once with EZ 1 solution provided by the kit, and resuspended in EZ 2 solution provided by the kit. The cells were either transformed immediately or stored at -80.degree. C. for future use. 50 .mu.L of the competent cells were diluted with 500 .mu.L of EZ 3 solution provided by the kit. 0.5 .mu.g of plasmid DNA (in less than 5 .mu.L volume) was mixed with 75-500 .mu.L of diluted cells and incubated at 30.degree. C. for 45 minutes, vortexed every 15 minutes. 50-100 .mu.L of transformed cells were spread per SD-Ura agar plate and incubated at 30.degree. C. for three days.
[0117] Heterologous expression in S. cerevisiae for enzyme purification. Fresh colonies on SD-Ura plates expressing the desired enzymes were inoculated into 5-10 mL SD-Ura medium and grown overnight at 30.degree. C., 250 rpm. The overnight culture was diluted 1:10 with YPD medium in 300-mL Tunair flasks (Shelton Scientific) and grown at 30.degree. C., 250 rpm for 48 hours. Cultures were centrifuged and sterile-filtered using 0.2 .mu.m polyethersulfone membranes, and PMSF (phenylmethylsulfonylfluoride) and sodium azide were supplemented to a final concentration of 100 .mu.M and 0.02%, respectively. Ce16a enzymes in the culture supernatants were purified using HP Ni-NTA Columns (GE Healthcare) in an AKTApurifier.TM. FPLC system (GE Healthcare), and eluant fractions having elevated absorbance at 280 nm from the baseline were pooled. The enzyme solutions were washed three times using 50 mM sodium acetate, pH 5.0 to remove the imidazole from the elution buffer and concentrated to 500 .mu.L using 20 mL spin columns with 10-kDa PES membranes (Sartorius Stedim Biotech). PMSF and sodium azide were again supplemented to a final concentration of 100 .mu.M and 0.02%, respectively. Purified protein concentrations were determined using the absorbance at 280 nm and the extinction coefficient of the respective protein.
[0118] Half-life measurement. The half-life is defined as the time at which an enzyme loses 50% of its activity upon incubation at a specified temperature and other conditions (pH, buffer, etc.). More thermostable enzymes exhibit longer half-lives upon incubation. 40 .mu.L of 50 ng/.mu.L Ce16a enzyme in 50 mM sodium acetate buffer, pH 5.0 were aliquoted into eppendorf tubes and incubated at the specified temperature for a range of times in the tabletop thermal mixer. At each time point, an aliquot/tube of the enzyme was removed and cooled to 4.degree. C. on ice. The range of incubation time was selected such that the half-life would fall approximately in the middle. After the heat inactivation period and cooling, 60 .mu.L of well-agitated 50 mg/mL Avicel solution was added to the enzymes. The solution was subsequently incubated at 50.degree. C. for 2 hours, to obtain a measure the enzyme's residual activity. After the hydrolysis reaction, the solution was cooled to 4.degree. C. and 50 .mu.L of the supernatant was removed for reducing sugar determination along with cellobiose standards using the Nelson-Somogyi assay as described above. The reducing sugar concentrations over the range of heat inactivation periods were determined using the cellobiose standards, and the natural log of the residual activity at each time point was plotted as a function of time using Excel (Microsoft). The data points were fitted using a 1-parameter linear equation with the y-intercept set to zero, and the half-life of the enzyme was determined using the slope of the fitted equation.
[0119] T.sub.50 value measurement. T.sub.50 is defined as the temperature at which an enzyme loses 50% of its activity during a 15-min heat inactivation period. 40 .mu.L of 50 ng/.mu.L Ce16a enzymes in 50 mM sodium acetate buffer, pH 5.0 were aliquoted into the wells of a 96-well plate and incubated at an elevated temperature gradient in a PCR machine for 15-minutes. The temperature gradient was selected such that the T.sub.50 value would fall in the middle. After the heat inactivation period, the enzymes were cooled to 4.degree. C. and 60 .mu.L of well-agitated 50 mg/mL Avicel solution were added. The plate was subsequently incubated at 50.degree. C. for 2 hours to measure the residual activity. After the hydrolysis reaction, the solution was cooled to 4.degree. C. and 50 .mu.L of the supernatant was removed for reducing sugar determination along with cellobiose standards using Nelson-Somogyi assay as described above. The reducing sugar concentrations across the temperature gradient were determined using the cellobiose standards and plotted against temperature using SigmaPlot (Systat Software Inc). The data points were fitted using 4-parameter sigmoidal curves, and the T.sub.50 value was determined as the temperature where 50% activity was lost.
Example 1
Thermostabilizing Mutations Discovered by Random Mutagenesis and Screening
[0120] The following example illustrates a method for discovering mutations that improve the total activity of Ce16 enzymes at elevated temperatures and also describes the biochemical properties of such improved enzymes.
[0121] Random mutagenesis. Plasmid pHJPlus carrying the HJPlus.sup.his6 gene served as the template for error-prone PCR using forward primer alpha_HomeRe_Lt and reverse primer His_HomRe_Rt. The gene was flanked by the NheI site and the KpnI site in the plasmid pHJPlus. The primers were designed to have regions of homology 85 base-pairs upstream of the NheI site and 65 base-pair downstream of the KpnI site to allow homologous recombination to occur in yeast. The error rates of the libraries were adjusted using different concentrations of manganese chloride in the PCR reaction. Once the error-prone PCR libraries were expressed in yeast, five colonies were randomly selected for sequencing to determine the error-rates. Once the library with the desired mutation rate was identified, roughly 3000 colonies were randomly selected for total secreted cellobiohydrolase activity evaluation at an elevated temperature in the high-throughput assay. The top 1% of the colonies having higher total activities at 75.degree. C. than HJPlus were selected for regrowth and re-evaluation with the activity assay. The total activities from culture supernatants of the top five variants from the rescreen are shown in FIG. 2. The plasmid DNA of the top five variants was recovered, and the region of the Ce16a genes was sequenced. Clone 1G6 was identified as the best-performing variant, with a mutation that encodes for amino acid substitution S317P. Other amino acid substitutions discovered among the top five variants are S30F, V128A, V131E, S293R, and S413F.
[0122] Plasmid p1G6 carrying the 1G6.sup.his6 gene served as the template for error-prone PCR for the second generation of mutants. The error-prone PCR libraries were made and characterized as described for the first generation of mutants. Again, roughly 3000 colonies were randomly selected for the total activity evaluation at an elevated temperature in the high-throughput assay. The top 1% of the colonies with higher total activities at 75.degree. C. than 1G6 were selected for regrowth and re-evaluation with the activity assay. The total activities from culture supernatant of the top five variants from the rescreen are shown in FIG. 3. Plasmid DNA from the top five variants was recovered, and the region of Ce16a gene was sequenced. The mutations of the top five clones are listed in Table 4. Clone 2B3 was identified as the best performing variant. It has a mutation that encodes the amino acid substitution. Other mutations discovered among the top five variants are N14S, M135L, S406P, S413P, and S413F.
TABLE-US-00004 TABLE 4 List of amino acid substitutions the top five most active variants from generations one and two. AA Generation Variant substitution 1 1E6 S30F, V128A 1 1E7 S293R 1 1F4 S413F 1 1F8 V131E 1 1G6 S317P 2 2B3 Q277L 2 2C5 N14S, S413P 2 2F4 M135L 2 2F11 S413F 2 2G6 S406P
Example 2
Enhanced Stability by Recombination of Stabilizing Mutations
[0123] The following example illustrates a method for improving the total activity at elevated temperatures of a cellobiohydrolase by recombining potentially beneficial mutations and screening the resulting variants for higher stability. It also describes the biochemical properties of such improved cellobiohydrolase enzymes.
[0124] Plasmid p2B3 carrying the 2B3.sup.his6 gene served as the template for the recombination of the mutations found in the first two generations of random mutagenesis. The amino acid substitutions included in the recombination library can be found in Table 5. Five PCR fragments were generated using the primers listed in Table 6. The fragments were isolated on 1% TAE agarose gels and purified using the QIAquick Gel Extraction Kit (Qiagen). Fragments 1 and 2 were joined together via overlap extension PCR, while fragment 4 and 5 were joined together also via overlap extension PCR. The recombinant library PCR insert was subsequently made using fragment 1+2, 3, and 4+5 using overlap extension PCR.
TABLE-US-00005 TABLE 5 List of amino acid mutations included in the recombination library Amino Amino acid Acid substitution included Position in 2B3 Mutation in the library 30 Ser Phe Ser, Phe 128 Val Ala Val, Ala 131 Val Glu Val, Glu 135 Met Leu Met, Leu 293 Ser Arg Ser, Arg 406 Ser Pro Ser, Pro 413 Ser -- Ser
TABLE-US-00006 TABLE 6 List of primers used to generate the recombination library Fragment Primers used to clone the amino acid in 2B3 Primers used to clone the library mutation 1 alpha_HomeRe_Lt WT30_bottom alpha_HomeRe_Lt S30F_bottom 2 WT30_top WT128/131/135_bottom S30F_top V128A_bottom, V131E_bottom, M135L_bottom, V128A/V131E_bottom, V128A/M135L_bottom, V131E/M135L_bottom, 128/131/135_bottom 3 WT128/131/135_top WT293_bottom V128A_top, S293R_bottom V131E_top, M135L_top, V128A/V131E_top, V128A/M135L_top, V131E/M135L_top, 128/131/135_top 4 WT293_top WT406_bottom S293R_top S406P_bottom 5 WT406_top His_HomRe_Rt S406P_top His_HomRe_Rt
[0125] The recombinant library was expressed in yeast, and roughly 600 colonies were randomly selected for total activity evaluation at an elevated temperature in the high-throughput assay. The top 6% of the colonies with higher total activities at 75.degree. C. than 2B3 were selected for regrowth and re-evaluation with the activity assay. The total activities of 3-day culture supernatants of the top five variants from the rescreen are shown in FIG. 4. Plasmid DNA was recovered from the top five variants, and the region of Ce16a gene was sequenced. The mutations in the top five variants are listed in Table 7. Variant 3C6 was identified as the best performing variant from the high-throughput screen. Mutation S413F and S413P identified in the previous libraries as beneficial were combined in variant 3C6. The total activities of the variants, as well as that of HJPlus and the best variants from each generation, are shown in FIG. 5. Variant 3C6P was identified to be superior to 3C6F. The best variant 3C6P from the recombinant library contains the mutation S30F, V128A, M135L, Q277L, S317P, S406P, and S413P in the background of HJPlus Ce16a (see, e.g., US Patent Publication No. 2010/0304464-A1, which is incorporated herein by reference).
TABLE-US-00007 TABLE 7 The mutations of the top five variants from the recombination library with respect to 2B3 Variants Mutation(s) with respect to 2B3 3C6 S30F, V128A, M135L, S406P 3D6 M135L, S406P 3D8 S30F, V131E 3E5 V131E, M135L, S293R, S406P 3E8 S30F, M135L, S406P
Example 3
Identifying Stabilizing Mutations by Site-Saturation Mutagenesis at Key Positions
[0126] The following example illustrates a method for improving the total activity at elevated temperatures of a cellobiohydrolase and also describes the biochemical properties of such improved cellobiohydrolase enzymes.
[0127] The random mutagenesis libraries described above identified 10 amino acid positions as important for improving the total activity of the cellobiohydrolase at elevated temperatures. The amino acid positions are N14, S30, V128, V131, M135, Q277, S293, S317, S406, and S413 based on the sequence of HJPlus. Plasmid pHJPlus carrying the HJPlus.sup.his6 gene served as the template for the NNK libraries at the beneficial positions described above. The primers used to construct the NNK libraries can be found in Table 8. The NNK libraries were expressed in yeast, and roughly 90 colonies per NNK library were randomly selected for total activity evaluation at an elevated temperature in the high-throughput assay. Colonies showing an increase of 10% or higher in total activity at 75.degree. C. than HJPlus were selected for regrowth and re-evaluation with the activity assay. The plasmid DNA of the top variants at each amino acid position from the rescreen were recovered, and the region of Ce16a gene was sequenced. The beneficial mutations identified from the random mutagenesis libraries were also found as the top variants in the NNK libraries. In other words, the top variants in the NNK libraries identified the same mutations as beneficial as the random mutagenesis libraries. The total activity from 3-day culture supernatant of the top five variants is shown in FIG. 6, with the variants identified by the mutations they contain. Among the top five variants, two new beneficial substitutions were discovered: S317W (SEQ ID NO:11 and 12, polynucleotide and polypeptide, respectively) and S413W (SEQ ID NO:13 and 14, polynucleotide and polypeptide, respectively).
TABLE-US-00008 TABLE 8 The primers used to construct the NNK libraries at the ten beneficial positions identified in the random mutagenesis libraries Position Left primer Right primer N14 N14NNK Lt N14 Rt S30 S30NNK Lt S30 Rt V128 V128NNK Lt V128 Rt V131 V131NNK Lt V131 Rt M135 M135NNK Lt M135 Rt Q277 Q277NNK Lt Q277 Rt S293 S293NNK Lt S293 Rt S317 S317NNK Lt S317 Rt S406 S406NNK Lt S406 Rt S413 S413NNK Lt S413 Rt
Example 4
Biochemical Analysis of the Top Variants
[0128] The following example describes the biochemical properties of the improved cellobiohydrolase enzymes discovered above.
[0129] HJPlus, the top variants from the NNK libraries (S317W and S413W), and the best variant from each generation of the mutagenesis libraries (1F4, 1G6, 2B3, 3C6, and 3C6P), as well as other top variants from the mutagenesis libraries (2F4, and 2G6) were expressed in yeast and purified using the AKTApurifier.TM. FPLC system as described in the methods section. The half-lives of the purified enzymes were determined at 75.degree. C. in 50 mM sodium acetate buffer, pH 5.0, and the thermal deactivation in 50 mM sodium acetate buffer, pH 5.0 over time was observed to follow a first-order rate equation. As shown in FIG. 7, after three rounds of directed evolution, the half-life of the best variant, 3C6P, at 75.degree. C. increased approximately twenty-fold compared to HJPlus, from 9.5 minutes to 190 minutes.
[0130] The T.sub.50 values of the purified enzymes in 50 mM sodium acetate buffer, pH 5.0 were also determined. The T.sub.50 values of HJPlus, the top two variants from the NNK libraries (S317W and S413W), and the top variants from the mutagenesis libraries (1F4, 1G6, 2B3, 2F4, 2G6, 3C6, and 3C6P) were measured and summarized in Table 9. The top mutations contributed up to 2.4.degree. C. in the T.sub.50 values. The T.sub.50 value of 3C6P increased by 7.9.degree. C., from 71.9 .degree. C. to 79.8 .degree. C., from HJPlus. The improvements in total activities observed during the high throughput assay at 75.degree. C. can be attributed to a significant increase in the thermostability of the variants.
TABLE-US-00009 TABLE 9 The T.sub.50 values for HJPlus and the top variants from the NNK libraries, the random mutagenesis libraries, and the recombination library Variants T50 (.degree. C.) Mutation(s) with respect to HJPlus HJPlus 71.9 .+-. 0.6 -- S317W 73.6 .+-. 0.5 S317W S413W 74.3 .+-. 0.3 S413W 1F4 73.0 .+-. 0.3 S413F 1G6 73.2 .+-. 0.3 S317P 2B3 75.7 .+-. 0.3 Q277L, S317P 2F4 75.0 .+-. 0.2 M135L, S317P 2G6 75.3 .+-. 0.1 S317P, S406P 3C6 76.9 .+-. 0.2 S30F, V128A, M135L, Q277L, S317P, 406P 3C6P 79.8 .+-. 0.3 S30F, V128A, M135L, Q277L, S317P, 406P, S413P
Example 5
Investigating the pH Dependency of the Top Variants
[0131] The following example illustrates a method of identifying residue site(s) for improvements and investigating the pH dependency of the variants at elevated temperatures.
[0132] At high temperatures, certain amino residues such as cysteine or asparagine are prone to chemical modification or destruction that can lead to irreversible thermal inactivation of the enzyme. To examine the effect of cysteine on the thermal inactivation of Family 6 cellulase, the mutation C246G was introduced into the top variant 3C6P, expressed it in yeast, and purified the Ce16 variant using the AKTApurifier.TM. FPLC system as described in the methods section. The residual activities of the purified C246G Ce16a enzyme after 15-minute inactivation at 70.degree. C. through 90.degree. C. was examined in 50 mM sodium acetate buffer, pH 5.0, and compared to that of 3C6P. Interestingly, C246G retained a baseline activity after 15-minute incubation at 90.degree. C., where 3C6P was completely inactivated in the same reaction condition. Further examination showed that the effect was pH-dependent. The baseline activity at 90.degree. C. was the most pronounced at pH 6 and pH 7, followed by pH 5 and pH 8, while 3C6P completely deactivated in the same conditions. At pH 7, the C246G variant retained 73% of the activity after 15-minute inactivation at 90.degree. C. (0.29 mM) compared to the residual activity at 70.degree. C. (0.40 mM). At pH 6 where C246G is the most active, the variant retained 51% of the activity after 15-minute inactivation at 90.degree. C. (0.26 mM) compared to the residual activity at 70.degree. C. (0.50 mM). The residual activities of 3C6P and C246G between pH 4 and 9 after 15-minute inactivation at 70.degree. C. through 90.degree. C. are shown in FIG. 8.
[0133] The half-life of C246G was determined as well, and the thermal deactivation was observed to follow a first-order rate equation. The half-life of C246G is the longest at pH 6, followed by pH 7, 8, 5, 9, and 4, demonstrating thermostability as well as stability at alkaline conditions. The half-life of C246G was up to 83 minutes at pH 6, while the half-life of 3C6P at 90.degree. C. is less than 5 minutes at various pH. The half-lives of C246G at 90.degree. C. at various pH are summarized in FIG. 9.
[0134] In addition to measuring the residual activity of C246G after thermal inactivation in the form of T.sub.50 values and half-lives at 90.degree. C., the total activities of C246G at various temperatures were measured as well. Specifically, the total activities of 3C6P and C246G after 2 hours of incubation at 80.degree. C. and after 4 hours of incubation at 90.degree. C. were measured and compared across different pHs. As shown in FIG. 10, 3C6P and C246G released the same concentration of cellobiose equivalent across different pHs and at both 80.degree. C. and 90.degree. C. The only exception is the activity of C246G at pH 4 where C246G exhibited slightly lower activity than 3C6P. Combining our observation on the stability of the C246G variant, this shows that the mutation C246G can greatly enhances the stability of a thermostable Family 6 cellulase, without compromising on the activity of the enzyme.
[0135] To investigate the mechanism behind the stabilizing effect of the C246G mutation, other amino acid substitution at residue 246 were tested. Three other variants having mutations at residue C246 in the background of 3C6P were constructed and purified: C246S, C246A, and C246L. The activities of the new variants were determined after inactivating them across a temperature gradient between 70.degree. C. and 90.degree. C. for 15 minutes at pH 7.0. As shown in FIG. 11, at pH 7.0 all four variants with mutations at residue C246 exhibited a similar residual activity profile as that of C246G; all four variants retained roughly 35% to 69% activity after heat inactivation.
Example 6
Effect of the pH-Dependent Mutation in the Background of H. jecorina and H. insolens Ce16a
[0136] The following example described the biochemical properties of the pH-dependent mutation in the background of H. jecorina Ce16a and of H. insolens.
[0137] Mutation glycine at position 246 (the numbering based on HJPlus) is introduced into the Cel6a enzyme from H. jecorina, which has a cysteine at position 269, and into the Cel6a enzyme from H. insolens, which has a leucine at position 276. The variants HJ C269G and HI L276G were expressed in yeast and purified using the AKTApurifier.TM. FPLC system as described in the methods section. The residual activities of the purified HJ C269G and HI L276G after 15-minute inactivation was measured at pH 4 to 9 to examine whether the same retention of baseline activity is observed in other Family 6 cellulases. As shown in FIGS. 12 and 13, the mutation glycine at position 269 and 276 does not stabilize the Ce16a from H. jecorina and H. insolens as it did in HJPlus, as measured by the residual activities after 15-minute thermal inactivation. This is in stark contrast to the C246G variant (in the background of 3C6P), where the variant retained a high fraction of its residual activity, even as the temperature of thermal inactivation increased to 90.degree. C. As demonstrated here, this is believed to be due to the fact that both HJ C269G and HI L276G contained another free cysteine that is preventing the enzymes from being thermostabilized by the new mutation as it did in C246G.
Example 7
Effect of the Beneficial Mutations in the Background of H. jecorina Ce16a
[0138] The following example describes the biochemical properties of the beneficial mutations in the background of H. jecorina Ce16a.
[0139] Mutations S54F, S316R, and S430P were introduced into the Ce16a enzyme from H. jecorina and expressed in yeast. 4-day yeast culture supernatants were purified using the AKTApurifier.TM. FPLC system as described in the methods section. The T.sub.50 values of the purified enzymes in 50 mM sodium acetate buffer, pH 5.0 were determined and summarized in Table 10. The mutations contributed up to 1.7.degree. C. in the T.sub.50 values, from 60.degree. C. to 61.7.degree. C. This shows that the mutations not only stabilize the HJPlus Ce16a enzyme but also the Ce16a enzyme from its closest parent, H. jecorina. The total activities of the enzymes after 2 hours of incubation at 50.degree. C. and 60.degree. C. were measured in 50 mM NaOAc buffer, pH 5.0. As shown in FIG. 14, the improvements in the T.sub.50 value translated to increases in total activity of the enzyme after 2 hours. The mutants demonstrated an increase up to 13% in total activity at 50.degree. C., from 0.23 mM of cellobiose equivalents to 0.26 mM, and an increase up to 19% in total activity at 60.degree. C., from 0.26 mM to 0.31 mM. As demonstrated here, it is believed that the beneficial mutations discovered in the background of HJPlus are applicable to other cellulases that share high sequence and/or structural homology with HJPlus, including H. jecoria, H. insolens, C. thermophilum, from which HJPlus is derived, as well as other Family 6 cellulases not listed here. Sequence homology is defined as high when it is 50% or more compared to the sequence of HJPlus. In addition, structural homology is defined as the ones that share the same structural topologies as HJPlus.
TABLE-US-00010 TABLE 10 The T.sub.50 values for H. jecorina (HJ) Cel6a and the beneficial mutations in the background of H. jecorina Cel6a Mutation with respect Variants T50 (.degree. C.) to H. jecorina H. jecorina 60.0 .+-. 0.3 -- HJ S54F 60.4 .+-. 0.3 S54F HJ S316R 60.1 .+-. 0.3 S316R HJ S430P 61.7 .+-. 0.1 S430P
[0140] The foregoing examples are provided to further explain but not limit the disclosure.
Sequence CWU
1
1
11211362DNAArtificial SequenceHJPlus Cel6a variant 1gct agc tgc tca agc
gtc tgg ggc caa tgt ggt ggc cag aat tgg tcg 48Ala Ser Cys Ser Ser
Val Trp Gly Gln Cys Gly Gly Gln Asn Trp Ser 1 5
10 15 ggt ccg act tgc tgt gct
tcc gga agc aca tgc gtc tac tcc aac gac 96Gly Pro Thr Cys Cys Ala
Ser Gly Ser Thr Cys Val Tyr Ser Asn Asp 20
25 30 tat tac tcc cag tgt ctt ccc
ggc gct gca agc tca agc tcg tcc acg 144Tyr Tyr Ser Gln Cys Leu Pro
Gly Ala Ala Ser Ser Ser Ser Ser Thr 35
40 45 cgc gcc gcg tcg acg act tct
cga gta tcc ccc aca aca tcc cgg tcg 192Arg Ala Ala Ser Thr Thr Ser
Arg Val Ser Pro Thr Thr Ser Arg Ser 50 55
60 agc tcc gcg acg cct cca cct ggt
tct act act acc aga gta cct cca 240Ser Ser Ala Thr Pro Pro Pro Gly
Ser Thr Thr Thr Arg Val Pro Pro 65 70
75 80 gtc gga tcg gga acc gct acg tat tca
ggt aac ccc ttt gaa ggt gtt 288Val Gly Ser Gly Thr Ala Thr Tyr Ser
Gly Asn Pro Phe Glu Gly Val 85
90 95 cag ctg tgg gct aat aac tat tat aga
tct gag gta cat aca ctg gcc 336Gln Leu Trp Ala Asn Asn Tyr Tyr Arg
Ser Glu Val His Thr Leu Ala 100 105
110 att ccg caa att aca gac ccc gcg ttg cgt
gcc gca gct agt gct gtg 384Ile Pro Gln Ile Thr Asp Pro Ala Leu Arg
Ala Ala Ala Ser Ala Val 115 120
125 gct gag gtg cca agt ttt atg tgg ctg gat act
ttg gac aaa acc ccc 432Ala Glu Val Pro Ser Phe Met Trp Leu Asp Thr
Leu Asp Lys Thr Pro 130 135
140 tta atg gaa caa acg ttg gct gat ata cgt act
gcg aat aaa aac ggc 480Leu Met Glu Gln Thr Leu Ala Asp Ile Arg Thr
Ala Asn Lys Asn Gly 145 150 155
160 ggc aat tat gct gga caa ttt gtg gtt tat gac ctg
ccg gat aga gat 528Gly Asn Tyr Ala Gly Gln Phe Val Val Tyr Asp Leu
Pro Asp Arg Asp 165 170
175 tgt gct gca cta gcg agc aac ggg gag tac agc att gcg
gat ggc ggt 576Cys Ala Ala Leu Ala Ser Asn Gly Glu Tyr Ser Ile Ala
Asp Gly Gly 180 185
190 gtc gca aag tac aaa aac tat ata gat act atc agg caa
ata gtt gtc 624Val Ala Lys Tyr Lys Asn Tyr Ile Asp Thr Ile Arg Gln
Ile Val Val 195 200 205
gaa tac agt gat att cgt acg ctg ctt gta atc gaa ccc gat
tcc tta 672Glu Tyr Ser Asp Ile Arg Thr Leu Leu Val Ile Glu Pro Asp
Ser Leu 210 215 220
gcg aac ttg gta aca aat cta ggt act ccg aag tgt gcg aac gcg
cag 720Ala Asn Leu Val Thr Asn Leu Gly Thr Pro Lys Cys Ala Asn Ala
Gln 225 230 235
240 agt gct tat ctt gag tgc atc aat tat gca gtc acc cag ttg aat
ttg 768Ser Ala Tyr Leu Glu Cys Ile Asn Tyr Ala Val Thr Gln Leu Asn
Leu 245 250 255
cca aac gtt gca atg tat ctt gat gct ggt cat gcc ggg tgg ttg ggt
816Pro Asn Val Ala Met Tyr Leu Asp Ala Gly His Ala Gly Trp Leu Gly
260 265 270
tgg cca gca aat cag gat ccc gct gcg cag ctg ttt gca aat gtt tac
864Trp Pro Ala Asn Gln Asp Pro Ala Ala Gln Leu Phe Ala Asn Val Tyr
275 280 285
aaa aat gcc tca agt cct aga gcg ctg agg ggt ctt gca aca aat gtt
912Lys Asn Ala Ser Ser Pro Arg Ala Leu Arg Gly Leu Ala Thr Asn Val
290 295 300
gct aat tac aac gct tgg tca ata gcg agt cct cca tcg tac aca agc
960Ala Asn Tyr Asn Ala Trp Ser Ile Ala Ser Pro Pro Ser Tyr Thr Ser
305 310 315 320
cct aac cca aac tac gat gag aag cat tac ata gaa gca ttt gct cct
1008Pro Asn Pro Asn Tyr Asp Glu Lys His Tyr Ile Glu Ala Phe Ala Pro
325 330 335
ttg ctt cgt aac caa ggt ttt gat gca aag ttt atc gtc gat acc gga
1056Leu Leu Arg Asn Gln Gly Phe Asp Ala Lys Phe Ile Val Asp Thr Gly
340 345 350
aga aac ggc aag cag ccg aca ggg cag cta gaa tgg ggg cac tgg tgc
1104Arg Asn Gly Lys Gln Pro Thr Gly Gln Leu Glu Trp Gly His Trp Cys
355 360 365
aat gtc aag ggt acg ggt ttc ggt gtt aga ccc acg gct aac act ggg
1152Asn Val Lys Gly Thr Gly Phe Gly Val Arg Pro Thr Ala Asn Thr Gly
370 375 380
cat gag ttg gtt gat gca ttc gtt tgg gta aaa ccc gga gga gag tca
1200His Glu Leu Val Asp Ala Phe Val Trp Val Lys Pro Gly Gly Glu Ser
385 390 395 400
gat gga acg agt gat tct tct gct cca agg ttc gat tct cat tgc gca
1248Asp Gly Thr Ser Asp Ser Ser Ala Pro Arg Phe Asp Ser His Cys Ala
405 410 415
tta cca gat gct ttg cag cca gca cct caa gca gga gct tgg ttc caa
1296Leu Pro Asp Ala Leu Gln Pro Ala Pro Gln Ala Gly Ala Trp Phe Gln
420 425 430
gct tat ttt gta caa tta ctg act aac gcc aat cct agt ttt cta cat
1344Ala Tyr Phe Val Gln Leu Leu Thr Asn Ala Asn Pro Ser Phe Leu His
435 440 445
cac cat cac cac cat tag
1362His His His His His
450
2453PRTArtificial SequenceSynthetic Construct 2Ala Ser Cys Ser Ser Val
Trp Gly Gln Cys Gly Gly Gln Asn Trp Ser 1 5
10 15 Gly Pro Thr Cys Cys Ala Ser Gly Ser Thr Cys
Val Tyr Ser Asn Asp 20 25
30 Tyr Tyr Ser Gln Cys Leu Pro Gly Ala Ala Ser Ser Ser Ser Ser
Thr 35 40 45 Arg
Ala Ala Ser Thr Thr Ser Arg Val Ser Pro Thr Thr Ser Arg Ser 50
55 60 Ser Ser Ala Thr Pro Pro
Pro Gly Ser Thr Thr Thr Arg Val Pro Pro 65 70
75 80 Val Gly Ser Gly Thr Ala Thr Tyr Ser Gly Asn
Pro Phe Glu Gly Val 85 90
95 Gln Leu Trp Ala Asn Asn Tyr Tyr Arg Ser Glu Val His Thr Leu Ala
100 105 110 Ile Pro
Gln Ile Thr Asp Pro Ala Leu Arg Ala Ala Ala Ser Ala Val 115
120 125 Ala Glu Val Pro Ser Phe Met
Trp Leu Asp Thr Leu Asp Lys Thr Pro 130 135
140 Leu Met Glu Gln Thr Leu Ala Asp Ile Arg Thr Ala
Asn Lys Asn Gly 145 150 155
160 Gly Asn Tyr Ala Gly Gln Phe Val Val Tyr Asp Leu Pro Asp Arg Asp
165 170 175 Cys Ala Ala
Leu Ala Ser Asn Gly Glu Tyr Ser Ile Ala Asp Gly Gly 180
185 190 Val Ala Lys Tyr Lys Asn Tyr Ile
Asp Thr Ile Arg Gln Ile Val Val 195 200
205 Glu Tyr Ser Asp Ile Arg Thr Leu Leu Val Ile Glu Pro
Asp Ser Leu 210 215 220
Ala Asn Leu Val Thr Asn Leu Gly Thr Pro Lys Cys Ala Asn Ala Gln 225
230 235 240 Ser Ala Tyr Leu
Glu Cys Ile Asn Tyr Ala Val Thr Gln Leu Asn Leu 245
250 255 Pro Asn Val Ala Met Tyr Leu Asp Ala
Gly His Ala Gly Trp Leu Gly 260 265
270 Trp Pro Ala Asn Gln Asp Pro Ala Ala Gln Leu Phe Ala Asn
Val Tyr 275 280 285
Lys Asn Ala Ser Ser Pro Arg Ala Leu Arg Gly Leu Ala Thr Asn Val 290
295 300 Ala Asn Tyr Asn Ala
Trp Ser Ile Ala Ser Pro Pro Ser Tyr Thr Ser 305 310
315 320 Pro Asn Pro Asn Tyr Asp Glu Lys His Tyr
Ile Glu Ala Phe Ala Pro 325 330
335 Leu Leu Arg Asn Gln Gly Phe Asp Ala Lys Phe Ile Val Asp Thr
Gly 340 345 350 Arg
Asn Gly Lys Gln Pro Thr Gly Gln Leu Glu Trp Gly His Trp Cys 355
360 365 Asn Val Lys Gly Thr Gly
Phe Gly Val Arg Pro Thr Ala Asn Thr Gly 370 375
380 His Glu Leu Val Asp Ala Phe Val Trp Val Lys
Pro Gly Gly Glu Ser 385 390 395
400 Asp Gly Thr Ser Asp Ser Ser Ala Pro Arg Phe Asp Ser His Cys Ala
405 410 415 Leu Pro
Asp Ala Leu Gln Pro Ala Pro Gln Ala Gly Ala Trp Phe Gln 420
425 430 Ala Tyr Phe Val Gln Leu Leu
Thr Asn Ala Asn Pro Ser Phe Leu His 435 440
445 His His His His His 450
31416DNAHypocrea jecorinaCDS(1)..(1416) 3atg att gtc ggc att ctc acc acg
ctg gct acg ctg gcc aca ctc gca 48Met Ile Val Gly Ile Leu Thr Thr
Leu Ala Thr Leu Ala Thr Leu Ala 1 5
10 15 gct agt gtg cct cta gag gag cgg caa
gct tgc tca agc gtc tgg ggc 96Ala Ser Val Pro Leu Glu Glu Arg Gln
Ala Cys Ser Ser Val Trp Gly 20 25
30 caa tgt ggt ggc cag aat tgg tcg ggt ccg
act tgc tgt gct tcc gga 144Gln Cys Gly Gly Gln Asn Trp Ser Gly Pro
Thr Cys Cys Ala Ser Gly 35 40
45 agc aca tgc gtc tac tcc aac gac tat tac tcc
cag tgt ctt ccc ggc 192Ser Thr Cys Val Tyr Ser Asn Asp Tyr Tyr Ser
Gln Cys Leu Pro Gly 50 55
60 gct gca agc tca agc tcg tcc acg cgc gcc gcg
tcg acg act tct cga 240Ala Ala Ser Ser Ser Ser Ser Thr Arg Ala Ala
Ser Thr Thr Ser Arg 65 70 75
80 gta tcc ccc aca aca tcc cgg tcg agc tcc gcg acg
cct cca cct ggt 288Val Ser Pro Thr Thr Ser Arg Ser Ser Ser Ala Thr
Pro Pro Pro Gly 85 90
95 tct act act acc aga gta cct cca gtc gga tcg gga acc
gct acg tat 336Ser Thr Thr Thr Arg Val Pro Pro Val Gly Ser Gly Thr
Ala Thr Tyr 100 105
110 tca ggc aac cct ttt gtt ggg gtc act cct tgg gcc aat
gca tat tac 384Ser Gly Asn Pro Phe Val Gly Val Thr Pro Trp Ala Asn
Ala Tyr Tyr 115 120 125
gcc tct gaa gtt agc agc ctc gct att cct agc ttg act gga
gcc atg 432Ala Ser Glu Val Ser Ser Leu Ala Ile Pro Ser Leu Thr Gly
Ala Met 130 135 140
gcc act gct gca gca gct gtc gca aag gtt ccc tct ttt atg tgg
cta 480Ala Thr Ala Ala Ala Ala Val Ala Lys Val Pro Ser Phe Met Trp
Leu 145 150 155
160 gat act ctt gac aag acc cct ctc atg gag caa acc ttg gcc gac
atc 528Asp Thr Leu Asp Lys Thr Pro Leu Met Glu Gln Thr Leu Ala Asp
Ile 165 170 175
cgc acc gcc aac aag aat ggc ggt aac tat gcc gga cag ttt gtg gtg
576Arg Thr Ala Asn Lys Asn Gly Gly Asn Tyr Ala Gly Gln Phe Val Val
180 185 190
tat gac ttg ccg gat cgc gat tgc gct gcc ctt gcc tcg aat ggc gaa
624Tyr Asp Leu Pro Asp Arg Asp Cys Ala Ala Leu Ala Ser Asn Gly Glu
195 200 205
tac tct att gcc gat ggt ggc gtc gcc aaa tat aag aac tat atc gac
672Tyr Ser Ile Ala Asp Gly Gly Val Ala Lys Tyr Lys Asn Tyr Ile Asp
210 215 220
acc att cgt caa att gtc gtg gaa tat tcc gat atc cgg acc ctc ctg
720Thr Ile Arg Gln Ile Val Val Glu Tyr Ser Asp Ile Arg Thr Leu Leu
225 230 235 240
gtt att gag cct gac tct ctt gcc aac ctg gtg acc aac ctc ggt act
768Val Ile Glu Pro Asp Ser Leu Ala Asn Leu Val Thr Asn Leu Gly Thr
245 250 255
cca aag tgt gcc aat gct cag tca gcc tac ctt gag tgc atc aac tac
816Pro Lys Cys Ala Asn Ala Gln Ser Ala Tyr Leu Glu Cys Ile Asn Tyr
260 265 270
gcc gtc aca cag ctg aac ctt cca aat gtt gcg atg tat ttg gac gct
864Ala Val Thr Gln Leu Asn Leu Pro Asn Val Ala Met Tyr Leu Asp Ala
275 280 285
ggc cat gca gga tgg ctt ggc tgg ccg gca aac caa gac ccg gcc gct
912Gly His Ala Gly Trp Leu Gly Trp Pro Ala Asn Gln Asp Pro Ala Ala
290 295 300
cag cta ttt gca aat gtt tac aag aat gca tcg tct ccg aga gct ctt
960Gln Leu Phe Ala Asn Val Tyr Lys Asn Ala Ser Ser Pro Arg Ala Leu
305 310 315 320
cgc gga ttg gca acc aat gtc gcc aac tac aac ggg tgg aac att acc
1008Arg Gly Leu Ala Thr Asn Val Ala Asn Tyr Asn Gly Trp Asn Ile Thr
325 330 335
agc ccc cca tcg tac acg caa ggc aac gct gtc tac aac gag aag ctg
1056Ser Pro Pro Ser Tyr Thr Gln Gly Asn Ala Val Tyr Asn Glu Lys Leu
340 345 350
tac atc cac gct att gga cct ctt ctt gcc aat cac ggc tgg tcc aac
1104Tyr Ile His Ala Ile Gly Pro Leu Leu Ala Asn His Gly Trp Ser Asn
355 360 365
gcc ttc ttc atc act gat caa ggt cga tcg gga aag cag cct acc gga
1152Ala Phe Phe Ile Thr Asp Gln Gly Arg Ser Gly Lys Gln Pro Thr Gly
370 375 380
cag caa cag tgg gga gac tgg tgc aat gtg acc ggc acc gga ttt ggt
1200Gln Gln Gln Trp Gly Asp Trp Cys Asn Val Thr Gly Thr Gly Phe Gly
385 390 395 400
att cgc cca tcc gca aac act ggg gac tcg ttg ctg gat tcg ttt gtc
1248Ile Arg Pro Ser Ala Asn Thr Gly Asp Ser Leu Leu Asp Ser Phe Val
405 410 415
tgg gtc aag cca ggc ggc gag tgt gac ggc acc agc gac agc agt gcg
1296Trp Val Lys Pro Gly Gly Glu Cys Asp Gly Thr Ser Asp Ser Ser Ala
420 425 430
cca cga ttt gac tcc cac tgt gcg ctc cca gat gcc ttg caa ccg gcg
1344Pro Arg Phe Asp Ser His Cys Ala Leu Pro Asp Ala Leu Gln Pro Ala
435 440 445
cct caa gct ggt gct tgg ttc caa gcc tac ttt gtg cag ctt ctc aca
1392Pro Gln Ala Gly Ala Trp Phe Gln Ala Tyr Phe Val Gln Leu Leu Thr
450 455 460
aac gca aac cca tcg ttc ctg taa
1416Asn Ala Asn Pro Ser Phe Leu
465 470
4471PRTHypocrea jecorina 4Met Ile Val Gly Ile Leu Thr Thr Leu Ala Thr Leu
Ala Thr Leu Ala 1 5 10
15 Ala Ser Val Pro Leu Glu Glu Arg Gln Ala Cys Ser Ser Val Trp Gly
20 25 30 Gln Cys Gly
Gly Gln Asn Trp Ser Gly Pro Thr Cys Cys Ala Ser Gly 35
40 45 Ser Thr Cys Val Tyr Ser Asn Asp
Tyr Tyr Ser Gln Cys Leu Pro Gly 50 55
60 Ala Ala Ser Ser Ser Ser Ser Thr Arg Ala Ala Ser Thr
Thr Ser Arg 65 70 75
80 Val Ser Pro Thr Thr Ser Arg Ser Ser Ser Ala Thr Pro Pro Pro Gly
85 90 95 Ser Thr Thr Thr
Arg Val Pro Pro Val Gly Ser Gly Thr Ala Thr Tyr 100
105 110 Ser Gly Asn Pro Phe Val Gly Val Thr
Pro Trp Ala Asn Ala Tyr Tyr 115 120
125 Ala Ser Glu Val Ser Ser Leu Ala Ile Pro Ser Leu Thr Gly
Ala Met 130 135 140
Ala Thr Ala Ala Ala Ala Val Ala Lys Val Pro Ser Phe Met Trp Leu 145
150 155 160 Asp Thr Leu Asp Lys
Thr Pro Leu Met Glu Gln Thr Leu Ala Asp Ile 165
170 175 Arg Thr Ala Asn Lys Asn Gly Gly Asn Tyr
Ala Gly Gln Phe Val Val 180 185
190 Tyr Asp Leu Pro Asp Arg Asp Cys Ala Ala Leu Ala Ser Asn Gly
Glu 195 200 205 Tyr
Ser Ile Ala Asp Gly Gly Val Ala Lys Tyr Lys Asn Tyr Ile Asp 210
215 220 Thr Ile Arg Gln Ile Val
Val Glu Tyr Ser Asp Ile Arg Thr Leu Leu 225 230
235 240 Val Ile Glu Pro Asp Ser Leu Ala Asn Leu Val
Thr Asn Leu Gly Thr 245 250
255 Pro Lys Cys Ala Asn Ala Gln Ser Ala Tyr Leu Glu Cys Ile Asn Tyr
260 265 270 Ala Val
Thr Gln Leu Asn Leu Pro Asn Val Ala Met Tyr Leu Asp Ala 275
280 285 Gly His Ala Gly Trp Leu Gly
Trp Pro Ala Asn Gln Asp Pro Ala Ala 290 295
300 Gln Leu Phe Ala Asn Val Tyr Lys Asn Ala Ser Ser
Pro Arg Ala Leu 305 310 315
320 Arg Gly Leu Ala Thr Asn Val Ala Asn Tyr Asn Gly Trp Asn Ile Thr
325 330 335 Ser Pro Pro
Ser Tyr Thr Gln Gly Asn Ala Val Tyr Asn Glu Lys Leu 340
345 350 Tyr Ile His Ala Ile Gly Pro Leu
Leu Ala Asn His Gly Trp Ser Asn 355 360
365 Ala Phe Phe Ile Thr Asp Gln Gly Arg Ser Gly Lys Gln
Pro Thr Gly 370 375 380
Gln Gln Gln Trp Gly Asp Trp Cys Asn Val Thr Gly Thr Gly Phe Gly 385
390 395 400 Ile Arg Pro Ser
Ala Asn Thr Gly Asp Ser Leu Leu Asp Ser Phe Val 405
410 415 Trp Val Lys Pro Gly Gly Glu Cys Asp
Gly Thr Ser Asp Ser Ser Ala 420 425
430 Pro Arg Phe Asp Ser His Cys Ala Leu Pro Asp Ala Leu Gln
Pro Ala 435 440 445
Pro Gln Ala Gly Ala Trp Phe Gln Ala Tyr Phe Val Gln Leu Leu Thr 450
455 460 Asn Ala Asn Pro Ser
Phe Leu 465 470 51431DNAHumicola
insolensCDS(1)..(1431) 5atg gcc aag ttc ttc ctt act gct gcc ttt gcg gct
gcc gct ctc gcc 48Met Ala Lys Phe Phe Leu Thr Ala Ala Phe Ala Ala
Ala Ala Leu Ala 1 5 10
15 gct ccc gtt gtt gag gag cgc cag aac tgt gcc ccg act
tgg ggc cag 96Ala Pro Val Val Glu Glu Arg Gln Asn Cys Ala Pro Thr
Trp Gly Gln 20 25
30 tgc ggt ggc atc ggc ttc aat ggc ccg act tgc tgc cag
tct ggt agc 144Cys Gly Gly Ile Gly Phe Asn Gly Pro Thr Cys Cys Gln
Ser Gly Ser 35 40 45
acc tgc gtg aag cag aac gac tgg tac tcc cag tgc ttg ccc
ggt agc 192Thr Cys Val Lys Gln Asn Asp Trp Tyr Ser Gln Cys Leu Pro
Gly Ser 50 55 60
cag gtc acc acg acc tcg act acg tcg act tcg agc tcg tcg acc
acc 240Gln Val Thr Thr Thr Ser Thr Thr Ser Thr Ser Ser Ser Ser Thr
Thr 65 70 75
80 tcc cgg gcc acc tcg acc acc agg acc ggt ggt gtg acc tcg atc
acc 288Ser Arg Ala Thr Ser Thr Thr Arg Thr Gly Gly Val Thr Ser Ile
Thr 85 90 95
act gct ccc acc cgc acc gtc acc atc cct ggc ggt gcc acc acc acg
336Thr Ala Pro Thr Arg Thr Val Thr Ile Pro Gly Gly Ala Thr Thr Thr
100 105 110
gcc agc tac aac ggc aac ccc ttc gag ggt gtc cag ctc tgg gcc aac
384Ala Ser Tyr Asn Gly Asn Pro Phe Glu Gly Val Gln Leu Trp Ala Asn
115 120 125
aac tac tac cgc tct gag gtc cac acc ctc gcc att cct cag atc acc
432Asn Tyr Tyr Arg Ser Glu Val His Thr Leu Ala Ile Pro Gln Ile Thr
130 135 140
gac cct gcc ttg agg gct gcg gcc tcg gcc gtc gct gag gtc ccg agc
480Asp Pro Ala Leu Arg Ala Ala Ala Ser Ala Val Ala Glu Val Pro Ser
145 150 155 160
ttc cag tgg ctc gac cgc aac gtc acg gtc gac acc ctg ctc gtc gag
528Phe Gln Trp Leu Asp Arg Asn Val Thr Val Asp Thr Leu Leu Val Glu
165 170 175
acc ctc tct gag atc cgc gcc gcg aac cag gcg ggc gcg aac ccc ccg
576Thr Leu Ser Glu Ile Arg Ala Ala Asn Gln Ala Gly Ala Asn Pro Pro
180 185 190
tat gcc gcc cag atc gtc gtt tac gac ctt cct gac cgc gac tgc gct
624Tyr Ala Ala Gln Ile Val Val Tyr Asp Leu Pro Asp Arg Asp Cys Ala
195 200 205
gcc gcg gct tcg aac ggc gag tgg gcg atc gcc aac aac ggc gcc aac
672Ala Ala Ala Ser Asn Gly Glu Trp Ala Ile Ala Asn Asn Gly Ala Asn
210 215 220
aac tac aag gga tac atc aac cgg atc cgc gag att ctc att tcg ttc
720Asn Tyr Lys Gly Tyr Ile Asn Arg Ile Arg Glu Ile Leu Ile Ser Phe
225 230 235 240
tcg gat gtc cgc acg att ctg gtt atc gag ccc gac tcg ctg gcc aac
768Ser Asp Val Arg Thr Ile Leu Val Ile Glu Pro Asp Ser Leu Ala Asn
245 250 255
atg gtc acc aac atg aac gtc gcc aag tgc agc ggt gcc gcc tcg acc
816Met Val Thr Asn Met Asn Val Ala Lys Cys Ser Gly Ala Ala Ser Thr
260 265 270
tac cgc gag ttg acc atc tat gcc ctc aag cag ctc gac ctc ccg cac
864Tyr Arg Glu Leu Thr Ile Tyr Ala Leu Lys Gln Leu Asp Leu Pro His
275 280 285
gtc gcc atg tac atg gac gcc ggc cac gct ggc tgg ctt ggc tgg ccc
912Val Ala Met Tyr Met Asp Ala Gly His Ala Gly Trp Leu Gly Trp Pro
290 295 300
gcc aac atc cag ccc gct gct gag ctc ttc gcc aag atc tac gag gat
960Ala Asn Ile Gln Pro Ala Ala Glu Leu Phe Ala Lys Ile Tyr Glu Asp
305 310 315 320
gcc ggc aag ccc cgc gcc gtc cgc ggt ctc gcc acc aac gtc gcc aac
1008Ala Gly Lys Pro Arg Ala Val Arg Gly Leu Ala Thr Asn Val Ala Asn
325 330 335
tac aac gcc tgg agc atc tcg agc ccg ccg ccg tac acc agc ccc aac
1056Tyr Asn Ala Trp Ser Ile Ser Ser Pro Pro Pro Tyr Thr Ser Pro Asn
340 345 350
ccc aac tac gac gag aag cac tac atc gag gcc ttc cgc cct ctc ctc
1104Pro Asn Tyr Asp Glu Lys His Tyr Ile Glu Ala Phe Arg Pro Leu Leu
355 360 365
gag gcc cgc ggc ttc ccc gcc cag ttc atc gtc gac cag ggc cgc agc
1152Glu Ala Arg Gly Phe Pro Ala Gln Phe Ile Val Asp Gln Gly Arg Ser
370 375 380
ggc aag cag ccc acc ggc cag aag gaa tgg ggc cac tgg tgc aat gcc
1200Gly Lys Gln Pro Thr Gly Gln Lys Glu Trp Gly His Trp Cys Asn Ala
385 390 395 400
att ggc acc ggc ttc ggt atg cgc ccg act gcc aac acc ggc cac cag
1248Ile Gly Thr Gly Phe Gly Met Arg Pro Thr Ala Asn Thr Gly His Gln
405 410 415
tac gtc gac gcc ttc gtc tgg gtc aag ccc ggc ggt gag tgc gac ggc
1296Tyr Val Asp Ala Phe Val Trp Val Lys Pro Gly Gly Glu Cys Asp Gly
420 425 430
acc agc gac acg acc gct gcc cgc tac gac tac cac tgc ggt ctc gag
1344Thr Ser Asp Thr Thr Ala Ala Arg Tyr Asp Tyr His Cys Gly Leu Glu
435 440 445
gac gcc ctc aag ccc gcc cct gag gcc ggc cag tgg ttc caa gcc tac
1392Asp Ala Leu Lys Pro Ala Pro Glu Ala Gly Gln Trp Phe Gln Ala Tyr
450 455 460
ttt gag caa tta ctt cgt aat gcc aat ccg ccg ttc tga
1431Phe Glu Gln Leu Leu Arg Asn Ala Asn Pro Pro Phe
465 470 475
6476PRTHumicola insolens 6Met Ala Lys Phe Phe Leu Thr Ala Ala Phe Ala Ala
Ala Ala Leu Ala 1 5 10
15 Ala Pro Val Val Glu Glu Arg Gln Asn Cys Ala Pro Thr Trp Gly Gln
20 25 30 Cys Gly Gly
Ile Gly Phe Asn Gly Pro Thr Cys Cys Gln Ser Gly Ser 35
40 45 Thr Cys Val Lys Gln Asn Asp Trp
Tyr Ser Gln Cys Leu Pro Gly Ser 50 55
60 Gln Val Thr Thr Thr Ser Thr Thr Ser Thr Ser Ser Ser
Ser Thr Thr 65 70 75
80 Ser Arg Ala Thr Ser Thr Thr Arg Thr Gly Gly Val Thr Ser Ile Thr
85 90 95 Thr Ala Pro Thr
Arg Thr Val Thr Ile Pro Gly Gly Ala Thr Thr Thr 100
105 110 Ala Ser Tyr Asn Gly Asn Pro Phe Glu
Gly Val Gln Leu Trp Ala Asn 115 120
125 Asn Tyr Tyr Arg Ser Glu Val His Thr Leu Ala Ile Pro Gln
Ile Thr 130 135 140
Asp Pro Ala Leu Arg Ala Ala Ala Ser Ala Val Ala Glu Val Pro Ser 145
150 155 160 Phe Gln Trp Leu Asp
Arg Asn Val Thr Val Asp Thr Leu Leu Val Glu 165
170 175 Thr Leu Ser Glu Ile Arg Ala Ala Asn Gln
Ala Gly Ala Asn Pro Pro 180 185
190 Tyr Ala Ala Gln Ile Val Val Tyr Asp Leu Pro Asp Arg Asp Cys
Ala 195 200 205 Ala
Ala Ala Ser Asn Gly Glu Trp Ala Ile Ala Asn Asn Gly Ala Asn 210
215 220 Asn Tyr Lys Gly Tyr Ile
Asn Arg Ile Arg Glu Ile Leu Ile Ser Phe 225 230
235 240 Ser Asp Val Arg Thr Ile Leu Val Ile Glu Pro
Asp Ser Leu Ala Asn 245 250
255 Met Val Thr Asn Met Asn Val Ala Lys Cys Ser Gly Ala Ala Ser Thr
260 265 270 Tyr Arg
Glu Leu Thr Ile Tyr Ala Leu Lys Gln Leu Asp Leu Pro His 275
280 285 Val Ala Met Tyr Met Asp Ala
Gly His Ala Gly Trp Leu Gly Trp Pro 290 295
300 Ala Asn Ile Gln Pro Ala Ala Glu Leu Phe Ala Lys
Ile Tyr Glu Asp 305 310 315
320 Ala Gly Lys Pro Arg Ala Val Arg Gly Leu Ala Thr Asn Val Ala Asn
325 330 335 Tyr Asn Ala
Trp Ser Ile Ser Ser Pro Pro Pro Tyr Thr Ser Pro Asn 340
345 350 Pro Asn Tyr Asp Glu Lys His Tyr
Ile Glu Ala Phe Arg Pro Leu Leu 355 360
365 Glu Ala Arg Gly Phe Pro Ala Gln Phe Ile Val Asp Gln
Gly Arg Ser 370 375 380
Gly Lys Gln Pro Thr Gly Gln Lys Glu Trp Gly His Trp Cys Asn Ala 385
390 395 400 Ile Gly Thr Gly
Phe Gly Met Arg Pro Thr Ala Asn Thr Gly His Gln 405
410 415 Tyr Val Asp Ala Phe Val Trp Val Lys
Pro Gly Gly Glu Cys Asp Gly 420 425
430 Thr Ser Asp Thr Thr Ala Ala Arg Tyr Asp Tyr His Cys Gly
Leu Glu 435 440 445
Asp Ala Leu Lys Pro Ala Pro Glu Ala Gly Gln Trp Phe Gln Ala Tyr 450
455 460 Phe Glu Gln Leu Leu
Arg Asn Ala Asn Pro Pro Phe 465 470 475
71431DNAChaetomium thermophilumCDS(1)..(1431) 7atg gct aag cag ctg ctg
ctc act gcc gct ctt gcg gcc act tcg ctg 48Met Ala Lys Gln Leu Leu
Leu Thr Ala Ala Leu Ala Ala Thr Ser Leu 1 5
10 15 gct gcc cct ctc ctt gag gag
cgc cag agc tgc tcc tcc gtc tgg ggt 96Ala Ala Pro Leu Leu Glu Glu
Arg Gln Ser Cys Ser Ser Val Trp Gly 20
25 30 caa tgc ggt ggc atc aat tac aac
ggc ccg acc tgc tgc cag tcc ggc 144Gln Cys Gly Gly Ile Asn Tyr Asn
Gly Pro Thr Cys Cys Gln Ser Gly 35 40
45 agt gtt tgc act tac ctg aat gac tgg
tac agc cag tgc att ccc ggt 192Ser Val Cys Thr Tyr Leu Asn Asp Trp
Tyr Ser Gln Cys Ile Pro Gly 50 55
60 cag gct cag ccc ggc acg act agc acc acg
gct cgg acc acc agc acc 240Gln Ala Gln Pro Gly Thr Thr Ser Thr Thr
Ala Arg Thr Thr Ser Thr 65 70
75 80 agc acc acc agc act tcg tcg gtc cgc ccg
acc acc tcg aat acc cct 288Ser Thr Thr Ser Thr Ser Ser Val Arg Pro
Thr Thr Ser Asn Thr Pro 85 90
95 gtg acg act gct ccc ccg acg acc acc atc ccg
ggc ggc gcc tcg agc 336Val Thr Thr Ala Pro Pro Thr Thr Thr Ile Pro
Gly Gly Ala Ser Ser 100 105
110 acg gcc agc tac aac ggc aac ccg ttc tcg ggt gtc
caa ctt tgg gcc 384Thr Ala Ser Tyr Asn Gly Asn Pro Phe Ser Gly Val
Gln Leu Trp Ala 115 120
125 aac acc tac tac tcg tcc gag gtg cac act ttg gcc
atc ccc agc ttg 432Asn Thr Tyr Tyr Ser Ser Glu Val His Thr Leu Ala
Ile Pro Ser Leu 130 135 140
tct cct gag ctg gct gcc aag gcc gcc aag gtc gct gag
gtt ccc agc 480Ser Pro Glu Leu Ala Ala Lys Ala Ala Lys Val Ala Glu
Val Pro Ser 145 150 155
160 ttc cag tgg ctc gac cgc aat gtg act gtt gac act ctc ttc
tcc ggc 528Phe Gln Trp Leu Asp Arg Asn Val Thr Val Asp Thr Leu Phe
Ser Gly 165 170
175 act ctt gcc gaa atc cgc gcc gcc aac cag cgc ggt gcc aac
ccg cct 576Thr Leu Ala Glu Ile Arg Ala Ala Asn Gln Arg Gly Ala Asn
Pro Pro 180 185 190
tat gcc ggc att ttc gtg gtt tat gac tta cca gac cgt gat tgc
gcg 624Tyr Ala Gly Ile Phe Val Val Tyr Asp Leu Pro Asp Arg Asp Cys
Ala 195 200 205
gct gct gct tcg aac ggc gag tgg tct atc gcc aac aat ggt gcc aac
672Ala Ala Ala Ser Asn Gly Glu Trp Ser Ile Ala Asn Asn Gly Ala Asn
210 215 220
aac tac aag cgc tac atc gac cgg atc cgt gag ctc ctt atc cag tac
720Asn Tyr Lys Arg Tyr Ile Asp Arg Ile Arg Glu Leu Leu Ile Gln Tyr
225 230 235 240
tcc gat atc cgc act att ctg gtc att gaa cct gat tcc ctg gcc aac
768Ser Asp Ile Arg Thr Ile Leu Val Ile Glu Pro Asp Ser Leu Ala Asn
245 250 255
atg gtc acc aac atg aac gtc cag aag tgc tcg aac gct gcc tcc act
816Met Val Thr Asn Met Asn Val Gln Lys Cys Ser Asn Ala Ala Ser Thr
260 265 270
tac aag gag ctt act gtc tat gcc ctc aaa cag ctc aat ctt cct cac
864Tyr Lys Glu Leu Thr Val Tyr Ala Leu Lys Gln Leu Asn Leu Pro His
275 280 285
gtt gcc atg tac atg gat gct ggc cac gct ggc tgg ctt ggc tgg ccc
912Val Ala Met Tyr Met Asp Ala Gly His Ala Gly Trp Leu Gly Trp Pro
290 295 300
gcc aac atc cag cct gct gct gag ctc ttt gct caa atc tac cgc gac
960Ala Asn Ile Gln Pro Ala Ala Glu Leu Phe Ala Gln Ile Tyr Arg Asp
305 310 315 320
gct ggc agg ccc gct gct gtc cgc ggt ctt gcg acc aac gtt gcc aac
1008Ala Gly Arg Pro Ala Ala Val Arg Gly Leu Ala Thr Asn Val Ala Asn
325 330 335
tac aat gct tgg tcg atc gcc agc cct ccg tcc tac acc tct cct aac
1056Tyr Asn Ala Trp Ser Ile Ala Ser Pro Pro Ser Tyr Thr Ser Pro Asn
340 345 350
ccg aac tac gac gag aag cac tat att gag gcc ttt gct cct ctt ctc
1104Pro Asn Tyr Asp Glu Lys His Tyr Ile Glu Ala Phe Ala Pro Leu Leu
355 360 365
cgc aac cag ggc ttc gac gca aag ttc atc gtc gac acc ggc cgt aac
1152Arg Asn Gln Gly Phe Asp Ala Lys Phe Ile Val Asp Thr Gly Arg Asn
370 375 380
ggc aag cag ccc act ggc cag ctt gaa tgg ggt cac tgg tgc aat gtc
1200Gly Lys Gln Pro Thr Gly Gln Leu Glu Trp Gly His Trp Cys Asn Val
385 390 395 400
aag gga act ggc ttc ggt gtg cgc cct act gct aac act ggg cat gaa
1248Lys Gly Thr Gly Phe Gly Val Arg Pro Thr Ala Asn Thr Gly His Glu
405 410 415
ctt gtt gat gct ttc gtg tgg gtc aag ccc ggt ggc gag tcc gac ggc
1296Leu Val Asp Ala Phe Val Trp Val Lys Pro Gly Gly Glu Ser Asp Gly
420 425 430
acc agc gac acc agc gct gct cgt tat gac tat cac tgc ggc ctt tcc
1344Thr Ser Asp Thr Ser Ala Ala Arg Tyr Asp Tyr His Cys Gly Leu Ser
435 440 445
gac gca ctg act ccg gcg cct gag gct ggc caa tgg ttc cag gct tat
1392Asp Ala Leu Thr Pro Ala Pro Glu Ala Gly Gln Trp Phe Gln Ala Tyr
450 455 460
ttc gaa cag ctg ctc atc aat gcc aac cct ccg ttc tga
1431Phe Glu Gln Leu Leu Ile Asn Ala Asn Pro Pro Phe
465 470 475
8476PRTChaetomium thermophilum 8Met Ala Lys Gln Leu Leu Leu Thr Ala Ala
Leu Ala Ala Thr Ser Leu 1 5 10
15 Ala Ala Pro Leu Leu Glu Glu Arg Gln Ser Cys Ser Ser Val Trp
Gly 20 25 30 Gln
Cys Gly Gly Ile Asn Tyr Asn Gly Pro Thr Cys Cys Gln Ser Gly 35
40 45 Ser Val Cys Thr Tyr Leu
Asn Asp Trp Tyr Ser Gln Cys Ile Pro Gly 50 55
60 Gln Ala Gln Pro Gly Thr Thr Ser Thr Thr Ala
Arg Thr Thr Ser Thr 65 70 75
80 Ser Thr Thr Ser Thr Ser Ser Val Arg Pro Thr Thr Ser Asn Thr Pro
85 90 95 Val Thr
Thr Ala Pro Pro Thr Thr Thr Ile Pro Gly Gly Ala Ser Ser 100
105 110 Thr Ala Ser Tyr Asn Gly Asn
Pro Phe Ser Gly Val Gln Leu Trp Ala 115 120
125 Asn Thr Tyr Tyr Ser Ser Glu Val His Thr Leu Ala
Ile Pro Ser Leu 130 135 140
Ser Pro Glu Leu Ala Ala Lys Ala Ala Lys Val Ala Glu Val Pro Ser 145
150 155 160 Phe Gln Trp
Leu Asp Arg Asn Val Thr Val Asp Thr Leu Phe Ser Gly 165
170 175 Thr Leu Ala Glu Ile Arg Ala Ala
Asn Gln Arg Gly Ala Asn Pro Pro 180 185
190 Tyr Ala Gly Ile Phe Val Val Tyr Asp Leu Pro Asp Arg
Asp Cys Ala 195 200 205
Ala Ala Ala Ser Asn Gly Glu Trp Ser Ile Ala Asn Asn Gly Ala Asn 210
215 220 Asn Tyr Lys Arg
Tyr Ile Asp Arg Ile Arg Glu Leu Leu Ile Gln Tyr 225 230
235 240 Ser Asp Ile Arg Thr Ile Leu Val Ile
Glu Pro Asp Ser Leu Ala Asn 245 250
255 Met Val Thr Asn Met Asn Val Gln Lys Cys Ser Asn Ala Ala
Ser Thr 260 265 270
Tyr Lys Glu Leu Thr Val Tyr Ala Leu Lys Gln Leu Asn Leu Pro His
275 280 285 Val Ala Met Tyr
Met Asp Ala Gly His Ala Gly Trp Leu Gly Trp Pro 290
295 300 Ala Asn Ile Gln Pro Ala Ala Glu
Leu Phe Ala Gln Ile Tyr Arg Asp 305 310
315 320 Ala Gly Arg Pro Ala Ala Val Arg Gly Leu Ala Thr
Asn Val Ala Asn 325 330
335 Tyr Asn Ala Trp Ser Ile Ala Ser Pro Pro Ser Tyr Thr Ser Pro Asn
340 345 350 Pro Asn Tyr
Asp Glu Lys His Tyr Ile Glu Ala Phe Ala Pro Leu Leu 355
360 365 Arg Asn Gln Gly Phe Asp Ala Lys
Phe Ile Val Asp Thr Gly Arg Asn 370 375
380 Gly Lys Gln Pro Thr Gly Gln Leu Glu Trp Gly His Trp
Cys Asn Val 385 390 395
400 Lys Gly Thr Gly Phe Gly Val Arg Pro Thr Ala Asn Thr Gly His Glu
405 410 415 Leu Val Asp Ala
Phe Val Trp Val Lys Pro Gly Gly Glu Ser Asp Gly 420
425 430 Thr Ser Asp Thr Ser Ala Ala Arg Tyr
Asp Tyr His Cys Gly Leu Ser 435 440
445 Asp Ala Leu Thr Pro Ala Pro Glu Ala Gly Gln Trp Phe Gln
Ala Tyr 450 455 460
Phe Glu Gln Leu Leu Ile Asn Ala Asn Pro Pro Phe 465 470
475 9267DNAArtificial SequenceCBD-Linker 9gct agc tgc
tca agc gtc tgg ggc caa tgt ggt ggc cag aat tgg tcg 48Ala Ser Cys
Ser Ser Val Trp Gly Gln Cys Gly Gly Gln Asn Trp Ser 1
5 10 15 ggt ccg act tgc
tgt gct tcc gga agc aca tgc gtc tac tcc aac gac 96Gly Pro Thr Cys
Cys Ala Ser Gly Ser Thr Cys Val Tyr Ser Asn Asp 20
25 30 tat tac tcc cag tgt
ctt ccc ggc gct gca agc tca agc tcg tcc acg 144Tyr Tyr Ser Gln Cys
Leu Pro Gly Ala Ala Ser Ser Ser Ser Ser Thr 35
40 45 cgc gcc gcg tcg acg act
tct cga gta tcc ccc aca aca tcc cgg tcg 192Arg Ala Ala Ser Thr Thr
Ser Arg Val Ser Pro Thr Thr Ser Arg Ser 50
55 60 agc tcc gcg acg cct cca
cct ggt tct act act acc aga gta cct cca 240Ser Ser Ala Thr Pro Pro
Pro Gly Ser Thr Thr Thr Arg Val Pro Pro 65 70
75 80 gtc gga tcg gga acc gct acg
tat tca 267Val Gly Ser Gly Thr Ala Thr
Tyr Ser 85
1089PRTArtificial
SequenceSynthetic Construct 10Ala Ser Cys Ser Ser Val Trp Gly Gln Cys Gly
Gly Gln Asn Trp Ser 1 5 10
15 Gly Pro Thr Cys Cys Ala Ser Gly Ser Thr Cys Val Tyr Ser Asn Asp
20 25 30 Tyr Tyr
Ser Gln Cys Leu Pro Gly Ala Ala Ser Ser Ser Ser Ser Thr 35
40 45 Arg Ala Ala Ser Thr Thr Ser
Arg Val Ser Pro Thr Thr Ser Arg Ser 50 55
60 Ser Ser Ala Thr Pro Pro Pro Gly Ser Thr Thr Thr
Arg Val Pro Pro 65 70 75
80 Val Gly Ser Gly Thr Ala Thr Tyr Ser 85
111362DNAArtificial SequenceCel6A engineered variant S317W 11gct agc
tgc tca agc gtc tgg ggc caa tgt ggt ggc cag aat tgg tcg 48Ala Ser
Cys Ser Ser Val Trp Gly Gln Cys Gly Gly Gln Asn Trp Ser 1
5 10 15 ggt ccg act
tgc tgt gct tcc gga agc aca tgc gtc tac tcc aac gac 96Gly Pro Thr
Cys Cys Ala Ser Gly Ser Thr Cys Val Tyr Ser Asn Asp
20 25 30 tat tac tcc
cag tgt ctt ccc ggc gct gca agc tca agc tcg tcc acg 144Tyr Tyr Ser
Gln Cys Leu Pro Gly Ala Ala Ser Ser Ser Ser Ser Thr 35
40 45 cgc gcc gcg tcg
acg act tct cga gta tcc ccc aca aca tcc cgg tcg 192Arg Ala Ala Ser
Thr Thr Ser Arg Val Ser Pro Thr Thr Ser Arg Ser 50
55 60 agc tcc gcg acg cct
cca cct ggt tct act act acc aga gta cct cca 240Ser Ser Ala Thr Pro
Pro Pro Gly Ser Thr Thr Thr Arg Val Pro Pro 65
70 75 80 gtc gga tcg gga acc
gct acg tat tca ggt aac ccc ttt gaa ggt gtt 288Val Gly Ser Gly Thr
Ala Thr Tyr Ser Gly Asn Pro Phe Glu Gly Val 85
90 95 cag ctg tgg gct aat aac
tat tat aga tct gag gta cat aca ctg gcc 336Gln Leu Trp Ala Asn Asn
Tyr Tyr Arg Ser Glu Val His Thr Leu Ala 100
105 110 att ccg caa att aca gac ccc
gcg ttg cgt gcc gca gct agt gct gtg 384Ile Pro Gln Ile Thr Asp Pro
Ala Leu Arg Ala Ala Ala Ser Ala Val 115
120 125 gct gag gtg cca agt ttt atg
tgg ctg gat act ttg gac aaa acc ccc 432Ala Glu Val Pro Ser Phe Met
Trp Leu Asp Thr Leu Asp Lys Thr Pro 130 135
140 tta atg gaa caa acg ttg gct gat
ata cgt act gcg aat aaa aac ggc 480Leu Met Glu Gln Thr Leu Ala Asp
Ile Arg Thr Ala Asn Lys Asn Gly 145 150
155 160 ggc aat tat gct gga caa ttt gtg gtt
tat gac ctg ccg gat aga gat 528Gly Asn Tyr Ala Gly Gln Phe Val Val
Tyr Asp Leu Pro Asp Arg Asp 165
170 175 tgt gct gca cta gcg agc aac ggg gag
tac agc att gcg gat ggc ggt 576Cys Ala Ala Leu Ala Ser Asn Gly Glu
Tyr Ser Ile Ala Asp Gly Gly 180 185
190 gtc gca aag tac aaa aac tat ata gat act
atc agg caa ata gtt gtc 624Val Ala Lys Tyr Lys Asn Tyr Ile Asp Thr
Ile Arg Gln Ile Val Val 195 200
205 gaa tac agt gat att cgt acg ctg ctt gta atc
gaa ccc gat tcc tta 672Glu Tyr Ser Asp Ile Arg Thr Leu Leu Val Ile
Glu Pro Asp Ser Leu 210 215
220 gcg aac ttg gtg aca aat cta ggt act ccg aag
tgt gcg aac gcg cag 720Ala Asn Leu Val Thr Asn Leu Gly Thr Pro Lys
Cys Ala Asn Ala Gln 225 230 235
240 agt gct tat ctt gag tgc atc aat tat gca gtc acc
cag ttg aat ttg 768Ser Ala Tyr Leu Glu Cys Ile Asn Tyr Ala Val Thr
Gln Leu Asn Leu 245 250
255 cca aac gtt gca atg tat ctt gat gct ggt cat gcc ggg
tgg ttg ggt 816Pro Asn Val Ala Met Tyr Leu Asp Ala Gly His Ala Gly
Trp Leu Gly 260 265
270 tgg cca gca aat cag gat ccc gct gcg cag ctg ttt gca
aat gtt tac 864Trp Pro Ala Asn Gln Asp Pro Ala Ala Gln Leu Phe Ala
Asn Val Tyr 275 280 285
aaa aat gcc tca agt cct aga gcg ctg agg ggt ctt gca aca
aat gtt 912Lys Asn Ala Ser Ser Pro Arg Ala Leu Arg Gly Leu Ala Thr
Asn Val 290 295 300
gct aat tac aac gct tgg tca ata gcg agt cct cca tgg tac aca
agc 960Ala Asn Tyr Asn Ala Trp Ser Ile Ala Ser Pro Pro Trp Tyr Thr
Ser 305 310 315
320 cct aac cca aac tac gat gag aag cat tac ata gaa gca ttt gct
cct 1008Pro Asn Pro Asn Tyr Asp Glu Lys His Tyr Ile Glu Ala Phe Ala
Pro 325 330 335
ttg ctt cgt aac caa ggt ttt gat gca aag ttt atc gtc gat acc gga
1056Leu Leu Arg Asn Gln Gly Phe Asp Ala Lys Phe Ile Val Asp Thr Gly
340 345 350
aga aac ggc aag cag ccg aca ggg cag cta gaa tgg ggg cac tgg tgc
1104Arg Asn Gly Lys Gln Pro Thr Gly Gln Leu Glu Trp Gly His Trp Cys
355 360 365
aat gtc aag ggt acg ggt ttc ggt gtt aga ccc acg gct aac act ggg
1152Asn Val Lys Gly Thr Gly Phe Gly Val Arg Pro Thr Ala Asn Thr Gly
370 375 380
cat gag ttg gtt gat gca ttc gtt tgg gta aaa ccc gga gga gag tca
1200His Glu Leu Val Asp Ala Phe Val Trp Val Lys Pro Gly Gly Glu Ser
385 390 395 400
gat gga acg agt gat tct tct gct cca agg ttc gat tct cat tgc gca
1248Asp Gly Thr Ser Asp Ser Ser Ala Pro Arg Phe Asp Ser His Cys Ala
405 410 415
tta cca gat gct ttg cag cca gca cct caa gca gga gct tgg ttc caa
1296Leu Pro Asp Ala Leu Gln Pro Ala Pro Gln Ala Gly Ala Trp Phe Gln
420 425 430
gct tat ttt gta caa tta ctg act aac gcc aat cct agt ttt cta cat
1344Ala Tyr Phe Val Gln Leu Leu Thr Asn Ala Asn Pro Ser Phe Leu His
435 440 445
cac cat cac cac cat tag
1362His His His His His
450
12453PRTArtificial SequenceSynthetic Construct 12Ala Ser Cys Ser Ser Val
Trp Gly Gln Cys Gly Gly Gln Asn Trp Ser 1 5
10 15 Gly Pro Thr Cys Cys Ala Ser Gly Ser Thr Cys
Val Tyr Ser Asn Asp 20 25
30 Tyr Tyr Ser Gln Cys Leu Pro Gly Ala Ala Ser Ser Ser Ser Ser
Thr 35 40 45 Arg
Ala Ala Ser Thr Thr Ser Arg Val Ser Pro Thr Thr Ser Arg Ser 50
55 60 Ser Ser Ala Thr Pro Pro
Pro Gly Ser Thr Thr Thr Arg Val Pro Pro 65 70
75 80 Val Gly Ser Gly Thr Ala Thr Tyr Ser Gly Asn
Pro Phe Glu Gly Val 85 90
95 Gln Leu Trp Ala Asn Asn Tyr Tyr Arg Ser Glu Val His Thr Leu Ala
100 105 110 Ile Pro
Gln Ile Thr Asp Pro Ala Leu Arg Ala Ala Ala Ser Ala Val 115
120 125 Ala Glu Val Pro Ser Phe Met
Trp Leu Asp Thr Leu Asp Lys Thr Pro 130 135
140 Leu Met Glu Gln Thr Leu Ala Asp Ile Arg Thr Ala
Asn Lys Asn Gly 145 150 155
160 Gly Asn Tyr Ala Gly Gln Phe Val Val Tyr Asp Leu Pro Asp Arg Asp
165 170 175 Cys Ala Ala
Leu Ala Ser Asn Gly Glu Tyr Ser Ile Ala Asp Gly Gly 180
185 190 Val Ala Lys Tyr Lys Asn Tyr Ile
Asp Thr Ile Arg Gln Ile Val Val 195 200
205 Glu Tyr Ser Asp Ile Arg Thr Leu Leu Val Ile Glu Pro
Asp Ser Leu 210 215 220
Ala Asn Leu Val Thr Asn Leu Gly Thr Pro Lys Cys Ala Asn Ala Gln 225
230 235 240 Ser Ala Tyr Leu
Glu Cys Ile Asn Tyr Ala Val Thr Gln Leu Asn Leu 245
250 255 Pro Asn Val Ala Met Tyr Leu Asp Ala
Gly His Ala Gly Trp Leu Gly 260 265
270 Trp Pro Ala Asn Gln Asp Pro Ala Ala Gln Leu Phe Ala Asn
Val Tyr 275 280 285
Lys Asn Ala Ser Ser Pro Arg Ala Leu Arg Gly Leu Ala Thr Asn Val 290
295 300 Ala Asn Tyr Asn Ala
Trp Ser Ile Ala Ser Pro Pro Trp Tyr Thr Ser 305 310
315 320 Pro Asn Pro Asn Tyr Asp Glu Lys His Tyr
Ile Glu Ala Phe Ala Pro 325 330
335 Leu Leu Arg Asn Gln Gly Phe Asp Ala Lys Phe Ile Val Asp Thr
Gly 340 345 350 Arg
Asn Gly Lys Gln Pro Thr Gly Gln Leu Glu Trp Gly His Trp Cys 355
360 365 Asn Val Lys Gly Thr Gly
Phe Gly Val Arg Pro Thr Ala Asn Thr Gly 370 375
380 His Glu Leu Val Asp Ala Phe Val Trp Val Lys
Pro Gly Gly Glu Ser 385 390 395
400 Asp Gly Thr Ser Asp Ser Ser Ala Pro Arg Phe Asp Ser His Cys Ala
405 410 415 Leu Pro
Asp Ala Leu Gln Pro Ala Pro Gln Ala Gly Ala Trp Phe Gln 420
425 430 Ala Tyr Phe Val Gln Leu Leu
Thr Asn Ala Asn Pro Ser Phe Leu His 435 440
445 His His His His His 450
131362DNAArtificial SequenceCel6a engineered variant S413W 13gct agc tgc
tca agc gtc tgg ggc caa tgt ggt ggc cag aat tgg tcg 48Ala Ser Cys
Ser Ser Val Trp Gly Gln Cys Gly Gly Gln Asn Trp Ser 1
5 10 15 ggt ccg act tgc
tgt gct tcc gga agc aca tgc gtc tac tcc aac gac 96Gly Pro Thr Cys
Cys Ala Ser Gly Ser Thr Cys Val Tyr Ser Asn Asp 20
25 30 tat tac tcc cag tgt
ctt ccc ggc gct gca agc tca agc tcg tcc acg 144Tyr Tyr Ser Gln Cys
Leu Pro Gly Ala Ala Ser Ser Ser Ser Ser Thr 35
40 45 cgc gcc gcg tcg acg act
tct cga gta tcc ccc aca aca tcc cgg tcg 192Arg Ala Ala Ser Thr Thr
Ser Arg Val Ser Pro Thr Thr Ser Arg Ser 50
55 60 agc tcc gcg acg cct cca
cct ggt tct act act acc aga gta cct cca 240Ser Ser Ala Thr Pro Pro
Pro Gly Ser Thr Thr Thr Arg Val Pro Pro 65 70
75 80 gtc gga tcg gga acc gct acg
tat tca ggt aac ccc ttt gaa ggt gtt 288Val Gly Ser Gly Thr Ala Thr
Tyr Ser Gly Asn Pro Phe Glu Gly Val 85
90 95 cag ctg tgg gct aat aac tat tat
aga tct gag gta cat aca ctg gcc 336Gln Leu Trp Ala Asn Asn Tyr Tyr
Arg Ser Glu Val His Thr Leu Ala 100
105 110 att ccg caa att aca gac ccc gcg
ttg cgt gcc gca gct agt gct gtg 384Ile Pro Gln Ile Thr Asp Pro Ala
Leu Arg Ala Ala Ala Ser Ala Val 115 120
125 gct gag gtg cca agt ttt atg tgg ctg
gat act ttg gac aaa acc ccc 432Ala Glu Val Pro Ser Phe Met Trp Leu
Asp Thr Leu Asp Lys Thr Pro 130 135
140 tta atg gaa caa acg ttg gct gat ata cgt
act gcg aat aaa aac ggc 480Leu Met Glu Gln Thr Leu Ala Asp Ile Arg
Thr Ala Asn Lys Asn Gly 145 150
155 160 ggc aat tat gct gga caa ttt gtg gtt tat
gac ctg ccg gat aga gat 528Gly Asn Tyr Ala Gly Gln Phe Val Val Tyr
Asp Leu Pro Asp Arg Asp 165 170
175 tgt gct gca cta gcg agc aac ggg gag tac agc
att gcg gat ggc ggt 576Cys Ala Ala Leu Ala Ser Asn Gly Glu Tyr Ser
Ile Ala Asp Gly Gly 180 185
190 gtc gca aag tac aaa aac tat ata gat act atc agg
caa ata gtt gtc 624Val Ala Lys Tyr Lys Asn Tyr Ile Asp Thr Ile Arg
Gln Ile Val Val 195 200
205 gaa tac agt gat att cgt acg ctg ctt gta atc gaa
ccc gat tcc tta 672Glu Tyr Ser Asp Ile Arg Thr Leu Leu Val Ile Glu
Pro Asp Ser Leu 210 215 220
gcg aac ttg gtg aca aat cta ggt act ccg aag tgt gcg
aac gcg cag 720Ala Asn Leu Val Thr Asn Leu Gly Thr Pro Lys Cys Ala
Asn Ala Gln 225 230 235
240 agt gct tat ctt gag tgc atc aat tat gca gtc acc cag ttg
aat ttg 768Ser Ala Tyr Leu Glu Cys Ile Asn Tyr Ala Val Thr Gln Leu
Asn Leu 245 250
255 cca aac gtt gca atg tat ctt gat gct ggt cat gcc ggg tgg
ttg ggt 816Pro Asn Val Ala Met Tyr Leu Asp Ala Gly His Ala Gly Trp
Leu Gly 260 265 270
tgg cca gca aat cag gat ccc gct gcg cag ctg ttt gca aat gtt
tac 864Trp Pro Ala Asn Gln Asp Pro Ala Ala Gln Leu Phe Ala Asn Val
Tyr 275 280 285
aaa aat gcc tca agt cct aga gcg ctg agg ggt ctt gca aca aat gtt
912Lys Asn Ala Ser Ser Pro Arg Ala Leu Arg Gly Leu Ala Thr Asn Val
290 295 300
gct aat tac aac gct tgg tca ata gcg agt cct cca tcg tac aca agc
960Ala Asn Tyr Asn Ala Trp Ser Ile Ala Ser Pro Pro Ser Tyr Thr Ser
305 310 315 320
cct aac cca aac tac gat gag aag cat tac ata gaa gca ttt gct cct
1008Pro Asn Pro Asn Tyr Asp Glu Lys His Tyr Ile Glu Ala Phe Ala Pro
325 330 335
ttg ctt cgt aac caa ggt ttt gat gca aag ttt atc gtc gat acc gga
1056Leu Leu Arg Asn Gln Gly Phe Asp Ala Lys Phe Ile Val Asp Thr Gly
340 345 350
aga aac ggc aag cag ccg aca ggg cag cta gaa tgg ggg cac tgg tgc
1104Arg Asn Gly Lys Gln Pro Thr Gly Gln Leu Glu Trp Gly His Trp Cys
355 360 365
aat gtc aag ggt acg ggt ttc ggt gtt aga ccc acg gct aac act ggg
1152Asn Val Lys Gly Thr Gly Phe Gly Val Arg Pro Thr Ala Asn Thr Gly
370 375 380
cat gag ttg gtt gat gca ttc gtt tgg gta aaa ccc gga gga gag tca
1200His Glu Leu Val Asp Ala Phe Val Trp Val Lys Pro Gly Gly Glu Ser
385 390 395 400
gat gga acg agt gat tct tct gct cca agg ttc gat tgg cat tgc gca
1248Asp Gly Thr Ser Asp Ser Ser Ala Pro Arg Phe Asp Trp His Cys Ala
405 410 415
tta cca gat gct ttg cag cca gca cct caa gca gga gct tgg ttc caa
1296Leu Pro Asp Ala Leu Gln Pro Ala Pro Gln Ala Gly Ala Trp Phe Gln
420 425 430
gct tat ttt gta caa tta ctg act aac gcc aat cct agt ttt cta cat
1344Ala Tyr Phe Val Gln Leu Leu Thr Asn Ala Asn Pro Ser Phe Leu His
435 440 445
cac cat cac cac cat tag
1362His His His His His
450
14453PRTArtificial SequenceSynthetic Construct 14Ala Ser Cys Ser Ser Val
Trp Gly Gln Cys Gly Gly Gln Asn Trp Ser 1 5
10 15 Gly Pro Thr Cys Cys Ala Ser Gly Ser Thr Cys
Val Tyr Ser Asn Asp 20 25
30 Tyr Tyr Ser Gln Cys Leu Pro Gly Ala Ala Ser Ser Ser Ser Ser
Thr 35 40 45 Arg
Ala Ala Ser Thr Thr Ser Arg Val Ser Pro Thr Thr Ser Arg Ser 50
55 60 Ser Ser Ala Thr Pro Pro
Pro Gly Ser Thr Thr Thr Arg Val Pro Pro 65 70
75 80 Val Gly Ser Gly Thr Ala Thr Tyr Ser Gly Asn
Pro Phe Glu Gly Val 85 90
95 Gln Leu Trp Ala Asn Asn Tyr Tyr Arg Ser Glu Val His Thr Leu Ala
100 105 110 Ile Pro
Gln Ile Thr Asp Pro Ala Leu Arg Ala Ala Ala Ser Ala Val 115
120 125 Ala Glu Val Pro Ser Phe Met
Trp Leu Asp Thr Leu Asp Lys Thr Pro 130 135
140 Leu Met Glu Gln Thr Leu Ala Asp Ile Arg Thr Ala
Asn Lys Asn Gly 145 150 155
160 Gly Asn Tyr Ala Gly Gln Phe Val Val Tyr Asp Leu Pro Asp Arg Asp
165 170 175 Cys Ala Ala
Leu Ala Ser Asn Gly Glu Tyr Ser Ile Ala Asp Gly Gly 180
185 190 Val Ala Lys Tyr Lys Asn Tyr Ile
Asp Thr Ile Arg Gln Ile Val Val 195 200
205 Glu Tyr Ser Asp Ile Arg Thr Leu Leu Val Ile Glu Pro
Asp Ser Leu 210 215 220
Ala Asn Leu Val Thr Asn Leu Gly Thr Pro Lys Cys Ala Asn Ala Gln 225
230 235 240 Ser Ala Tyr Leu
Glu Cys Ile Asn Tyr Ala Val Thr Gln Leu Asn Leu 245
250 255 Pro Asn Val Ala Met Tyr Leu Asp Ala
Gly His Ala Gly Trp Leu Gly 260 265
270 Trp Pro Ala Asn Gln Asp Pro Ala Ala Gln Leu Phe Ala Asn
Val Tyr 275 280 285
Lys Asn Ala Ser Ser Pro Arg Ala Leu Arg Gly Leu Ala Thr Asn Val 290
295 300 Ala Asn Tyr Asn Ala
Trp Ser Ile Ala Ser Pro Pro Ser Tyr Thr Ser 305 310
315 320 Pro Asn Pro Asn Tyr Asp Glu Lys His Tyr
Ile Glu Ala Phe Ala Pro 325 330
335 Leu Leu Arg Asn Gln Gly Phe Asp Ala Lys Phe Ile Val Asp Thr
Gly 340 345 350 Arg
Asn Gly Lys Gln Pro Thr Gly Gln Leu Glu Trp Gly His Trp Cys 355
360 365 Asn Val Lys Gly Thr Gly
Phe Gly Val Arg Pro Thr Ala Asn Thr Gly 370 375
380 His Glu Leu Val Asp Ala Phe Val Trp Val Lys
Pro Gly Gly Glu Ser 385 390 395
400 Asp Gly Thr Ser Asp Ser Ser Ala Pro Arg Phe Asp Trp His Cys Ala
405 410 415 Leu Pro
Asp Ala Leu Gln Pro Ala Pro Gln Ala Gly Ala Trp Phe Gln 420
425 430 Ala Tyr Phe Val Gln Leu Leu
Thr Asn Ala Asn Pro Ser Phe Leu His 435 440
445 His His His His His 450
151362DNAArtificial SequenceCel6a engineered variant 1F4 15gct agc tgc
tca agc gtc tgg ggc caa tgt ggt ggc cag aat tgg tcg 48Ala Ser Cys
Ser Ser Val Trp Gly Gln Cys Gly Gly Gln Asn Trp Ser 1
5 10 15 ggt ccg act tgc
tgt gct tcc gga agc aca tgc gtc tac tcc aac gac 96Gly Pro Thr Cys
Cys Ala Ser Gly Ser Thr Cys Val Tyr Ser Asn Asp 20
25 30 tat tac tcc cag tgt
ctt ccc ggc gct gca agc tca agc tcg tcc acg 144Tyr Tyr Ser Gln Cys
Leu Pro Gly Ala Ala Ser Ser Ser Ser Ser Thr 35
40 45 cgc gcc gcg tcg acg act
tct cga gta tcc ccc aca aca tcc cgg tcg 192Arg Ala Ala Ser Thr Thr
Ser Arg Val Ser Pro Thr Thr Ser Arg Ser 50
55 60 agc tcc gcg acg cct cca
cct ggt tct act act acc aga gta cct cca 240Ser Ser Ala Thr Pro Pro
Pro Gly Ser Thr Thr Thr Arg Val Pro Pro 65 70
75 80 gtc gga tcg gga acc gct acg
tat tca ggt aac ccc ttt gaa ggt gtt 288Val Gly Ser Gly Thr Ala Thr
Tyr Ser Gly Asn Pro Phe Glu Gly Val 85
90 95 cag ctg tgg gct aat aac tat tat
aga tct gag gta cat aca ctg gcc 336Gln Leu Trp Ala Asn Asn Tyr Tyr
Arg Ser Glu Val His Thr Leu Ala 100
105 110 att ccg caa att aca gac ccc gcg
ttg cgt gcc gca gct agt gct gtg 384Ile Pro Gln Ile Thr Asp Pro Ala
Leu Arg Ala Ala Ala Ser Ala Val 115 120
125 gct gag gtg cca agt ttt atg tgg ctg
gat act ttg gac aaa acc ccc 432Ala Glu Val Pro Ser Phe Met Trp Leu
Asp Thr Leu Asp Lys Thr Pro 130 135
140 tta atg gaa caa acg ttg gct gat ata cgt
act gcg aat aaa aac ggc 480Leu Met Glu Gln Thr Leu Ala Asp Ile Arg
Thr Ala Asn Lys Asn Gly 145 150
155 160 ggc aat tat gct gga caa ttt gtg gtt tat
gac ctg ccg gat aga gat 528Gly Asn Tyr Ala Gly Gln Phe Val Val Tyr
Asp Leu Pro Asp Arg Asp 165 170
175 tgt gct gca cta gcg agc aac ggg gag tac agc
att gcg gat ggc ggt 576Cys Ala Ala Leu Ala Ser Asn Gly Glu Tyr Ser
Ile Ala Asp Gly Gly 180 185
190 gtc gca aag tac aaa aac tat ata gat act atc agg
caa ata gtt gtc 624Val Ala Lys Tyr Lys Asn Tyr Ile Asp Thr Ile Arg
Gln Ile Val Val 195 200
205 gaa tac agt gat att cgt acg ctg ctt gta atc gaa
ccc gat tcc tta 672Glu Tyr Ser Asp Ile Arg Thr Leu Leu Val Ile Glu
Pro Asp Ser Leu 210 215 220
gcg aac ttg gtg aca aat cta ggt act ccg aag tgt gcg
aac gcg cag 720Ala Asn Leu Val Thr Asn Leu Gly Thr Pro Lys Cys Ala
Asn Ala Gln 225 230 235
240 agt gct tat ctt gag tgc atc aat tat gca gtc acc cag ttg
aat ttg 768Ser Ala Tyr Leu Glu Cys Ile Asn Tyr Ala Val Thr Gln Leu
Asn Leu 245 250
255 cca aac gtt gca atg tat ctt gat gct ggt cat gcc ggg tgg
ttg ggt 816Pro Asn Val Ala Met Tyr Leu Asp Ala Gly His Ala Gly Trp
Leu Gly 260 265 270
tgg cca gca aat cag gat ccc gct gcg cag ctg ttt gca aat gtt
tac 864Trp Pro Ala Asn Gln Asp Pro Ala Ala Gln Leu Phe Ala Asn Val
Tyr 275 280 285
aaa aat gcc tca agt cct aga gcg ctg agg ggt ctt gca aca aat gtt
912Lys Asn Ala Ser Ser Pro Arg Ala Leu Arg Gly Leu Ala Thr Asn Val
290 295 300
gct aat tac aac gct tgg tca ata gcg agt cct cca tcg tac aca agc
960Ala Asn Tyr Asn Ala Trp Ser Ile Ala Ser Pro Pro Ser Tyr Thr Ser
305 310 315 320
cct aac cca aac tac gat gag aag cat tac ata gaa gca ttt gct cct
1008Pro Asn Pro Asn Tyr Asp Glu Lys His Tyr Ile Glu Ala Phe Ala Pro
325 330 335
ttg ctt cgt aac caa ggt ttt gat gca aag ttt atc gtc gat acc gga
1056Leu Leu Arg Asn Gln Gly Phe Asp Ala Lys Phe Ile Val Asp Thr Gly
340 345 350
aga aac ggc aag cag ccg aca ggg cag cta gaa tgg ggg cac tgg tgc
1104Arg Asn Gly Lys Gln Pro Thr Gly Gln Leu Glu Trp Gly His Trp Cys
355 360 365
aat gtc aag ggt acg ggt ttc ggt gtt aga ccc acg gct aac act ggg
1152Asn Val Lys Gly Thr Gly Phe Gly Val Arg Pro Thr Ala Asn Thr Gly
370 375 380
cat gag ttg gtt gat gca ttc gtt tgg gta aaa ccc gga gga gag tca
1200His Glu Leu Val Asp Ala Phe Val Trp Val Lys Pro Gly Gly Glu Ser
385 390 395 400
gat gga acg agt gat tct tct gct cca agg ttc gat ttt cat tgc gca
1248Asp Gly Thr Ser Asp Ser Ser Ala Pro Arg Phe Asp Phe His Cys Ala
405 410 415
tta cca gat gct ttg cag cca gca cct caa gca gga gct tgg ttc caa
1296Leu Pro Asp Ala Leu Gln Pro Ala Pro Gln Ala Gly Ala Trp Phe Gln
420 425 430
gct tat ttt gta caa tta ctg act aac gcc aat cct agt ttt cta cat
1344Ala Tyr Phe Val Gln Leu Leu Thr Asn Ala Asn Pro Ser Phe Leu His
435 440 445
cac cat cac cac cat tag
1362His His His His His
450
16453PRTArtificial SequenceSynthetic Construct 16Ala Ser Cys Ser Ser Val
Trp Gly Gln Cys Gly Gly Gln Asn Trp Ser 1 5
10 15 Gly Pro Thr Cys Cys Ala Ser Gly Ser Thr Cys
Val Tyr Ser Asn Asp 20 25
30 Tyr Tyr Ser Gln Cys Leu Pro Gly Ala Ala Ser Ser Ser Ser Ser
Thr 35 40 45 Arg
Ala Ala Ser Thr Thr Ser Arg Val Ser Pro Thr Thr Ser Arg Ser 50
55 60 Ser Ser Ala Thr Pro Pro
Pro Gly Ser Thr Thr Thr Arg Val Pro Pro 65 70
75 80 Val Gly Ser Gly Thr Ala Thr Tyr Ser Gly Asn
Pro Phe Glu Gly Val 85 90
95 Gln Leu Trp Ala Asn Asn Tyr Tyr Arg Ser Glu Val His Thr Leu Ala
100 105 110 Ile Pro
Gln Ile Thr Asp Pro Ala Leu Arg Ala Ala Ala Ser Ala Val 115
120 125 Ala Glu Val Pro Ser Phe Met
Trp Leu Asp Thr Leu Asp Lys Thr Pro 130 135
140 Leu Met Glu Gln Thr Leu Ala Asp Ile Arg Thr Ala
Asn Lys Asn Gly 145 150 155
160 Gly Asn Tyr Ala Gly Gln Phe Val Val Tyr Asp Leu Pro Asp Arg Asp
165 170 175 Cys Ala Ala
Leu Ala Ser Asn Gly Glu Tyr Ser Ile Ala Asp Gly Gly 180
185 190 Val Ala Lys Tyr Lys Asn Tyr Ile
Asp Thr Ile Arg Gln Ile Val Val 195 200
205 Glu Tyr Ser Asp Ile Arg Thr Leu Leu Val Ile Glu Pro
Asp Ser Leu 210 215 220
Ala Asn Leu Val Thr Asn Leu Gly Thr Pro Lys Cys Ala Asn Ala Gln 225
230 235 240 Ser Ala Tyr Leu
Glu Cys Ile Asn Tyr Ala Val Thr Gln Leu Asn Leu 245
250 255 Pro Asn Val Ala Met Tyr Leu Asp Ala
Gly His Ala Gly Trp Leu Gly 260 265
270 Trp Pro Ala Asn Gln Asp Pro Ala Ala Gln Leu Phe Ala Asn
Val Tyr 275 280 285
Lys Asn Ala Ser Ser Pro Arg Ala Leu Arg Gly Leu Ala Thr Asn Val 290
295 300 Ala Asn Tyr Asn Ala
Trp Ser Ile Ala Ser Pro Pro Ser Tyr Thr Ser 305 310
315 320 Pro Asn Pro Asn Tyr Asp Glu Lys His Tyr
Ile Glu Ala Phe Ala Pro 325 330
335 Leu Leu Arg Asn Gln Gly Phe Asp Ala Lys Phe Ile Val Asp Thr
Gly 340 345 350 Arg
Asn Gly Lys Gln Pro Thr Gly Gln Leu Glu Trp Gly His Trp Cys 355
360 365 Asn Val Lys Gly Thr Gly
Phe Gly Val Arg Pro Thr Ala Asn Thr Gly 370 375
380 His Glu Leu Val Asp Ala Phe Val Trp Val Lys
Pro Gly Gly Glu Ser 385 390 395
400 Asp Gly Thr Ser Asp Ser Ser Ala Pro Arg Phe Asp Phe His Cys Ala
405 410 415 Leu Pro
Asp Ala Leu Gln Pro Ala Pro Gln Ala Gly Ala Trp Phe Gln 420
425 430 Ala Tyr Phe Val Gln Leu Leu
Thr Asn Ala Asn Pro Ser Phe Leu His 435 440
445 His His His His His 450
171362DNAArtificial SequenceCel6a engineered variant 1G6 17gct agc tgc
tca agc gtc tgg ggc caa tgt ggt ggc cag aat tgg tcg 48Ala Ser Cys
Ser Ser Val Trp Gly Gln Cys Gly Gly Gln Asn Trp Ser 1
5 10 15 ggt ccg act tgc
tgt gct tcc gga agc aca tgc gtc tac tcc aac gac 96Gly Pro Thr Cys
Cys Ala Ser Gly Ser Thr Cys Val Tyr Ser Asn Asp 20
25 30 tat tac tcc cag tgt
ctt ccc ggc gct gca agc tca agc tcg tcc acg 144Tyr Tyr Ser Gln Cys
Leu Pro Gly Ala Ala Ser Ser Ser Ser Ser Thr 35
40 45 cgc gcc gcg tcg acg act
tct cga gta tcc ccc aca aca tcc cgg tcg 192Arg Ala Ala Ser Thr Thr
Ser Arg Val Ser Pro Thr Thr Ser Arg Ser 50
55 60 agc tcc gcg acg cct cca
cct ggt tct act act acc aga gta cct cca 240Ser Ser Ala Thr Pro Pro
Pro Gly Ser Thr Thr Thr Arg Val Pro Pro 65 70
75 80 gtc gga tcg gga acc gct acg
tat tca ggt aac ccc ttt gaa ggt gtt 288Val Gly Ser Gly Thr Ala Thr
Tyr Ser Gly Asn Pro Phe Glu Gly Val 85
90 95 cag ctg tgg gct aat aac tat tat
aga tct gag gta cat aca ctg gcc 336Gln Leu Trp Ala Asn Asn Tyr Tyr
Arg Ser Glu Val His Thr Leu Ala 100
105 110 att ccg caa att aca gac ccc gcg
ttg cgt gcc gca gct agt gct gtg 384Ile Pro Gln Ile Thr Asp Pro Ala
Leu Arg Ala Ala Ala Ser Ala Val 115 120
125 gct gag gtg cca agt ttt atg tgg ctg
gat act ttg gac aaa acc ccc 432Ala Glu Val Pro Ser Phe Met Trp Leu
Asp Thr Leu Asp Lys Thr Pro 130 135
140 tta atg gaa caa acg ttg gct gat ata cgt
act gcg aat aaa aac ggc 480Leu Met Glu Gln Thr Leu Ala Asp Ile Arg
Thr Ala Asn Lys Asn Gly 145 150
155 160 ggc aat tat gct gga caa ttt gtg gtt tat
gac ctg ccg gat aga gat 528Gly Asn Tyr Ala Gly Gln Phe Val Val Tyr
Asp Leu Pro Asp Arg Asp 165 170
175 tgt gct gca cta gcg agc aac ggg gag tac agc
att gcg gat ggc ggt 576Cys Ala Ala Leu Ala Ser Asn Gly Glu Tyr Ser
Ile Ala Asp Gly Gly 180 185
190 gtc gca aag tac aaa aac tat ata gat act atc agg
caa ata gtt gtc 624Val Ala Lys Tyr Lys Asn Tyr Ile Asp Thr Ile Arg
Gln Ile Val Val 195 200
205 gaa tac agt gat att cgt acg ctg ctt gta atc gaa
ccc gat tcc tta 672Glu Tyr Ser Asp Ile Arg Thr Leu Leu Val Ile Glu
Pro Asp Ser Leu 210 215 220
gcg aac ttg gtg aca aat cta ggt act ccg aag tgt gcg
aac gcg cag 720Ala Asn Leu Val Thr Asn Leu Gly Thr Pro Lys Cys Ala
Asn Ala Gln 225 230 235
240 agt gct tat ctt gag tgc atc aat tat gca gtc acc cag ttg
aat ttg 768Ser Ala Tyr Leu Glu Cys Ile Asn Tyr Ala Val Thr Gln Leu
Asn Leu 245 250
255 cca aac gtt gca atg tat ctt gat gct ggt cat gcc ggg tgg
ttg ggt 816Pro Asn Val Ala Met Tyr Leu Asp Ala Gly His Ala Gly Trp
Leu Gly 260 265 270
tgg cca gca aat cag gat ccc gct gcg cag ctg ttt gca aat gtt
tac 864Trp Pro Ala Asn Gln Asp Pro Ala Ala Gln Leu Phe Ala Asn Val
Tyr 275 280 285
aaa aat gcc tca agt cct aga gcg ctg agg ggt ctt gca aca aat gtt
912Lys Asn Ala Ser Ser Pro Arg Ala Leu Arg Gly Leu Ala Thr Asn Val
290 295 300
gct aat tac aac gct tgg tca ata gcg agt cct cca ccg tac aca agc
960Ala Asn Tyr Asn Ala Trp Ser Ile Ala Ser Pro Pro Pro Tyr Thr Ser
305 310 315 320
cct aac cca aac tac gat gag aag cat tac ata gaa gca ttt gct cct
1008Pro Asn Pro Asn Tyr Asp Glu Lys His Tyr Ile Glu Ala Phe Ala Pro
325 330 335
ttg ctt cgt aac caa ggt ttt gat gca aag ttt atc gtc gat acc gga
1056Leu Leu Arg Asn Gln Gly Phe Asp Ala Lys Phe Ile Val Asp Thr Gly
340 345 350
aga aac ggc aag cag ccg aca ggg cag cta gaa tgg ggg cac tgg tgc
1104Arg Asn Gly Lys Gln Pro Thr Gly Gln Leu Glu Trp Gly His Trp Cys
355 360 365
aat gtc aag ggt acg ggt ttc ggt gtt aga ccc acg gct aac act ggg
1152Asn Val Lys Gly Thr Gly Phe Gly Val Arg Pro Thr Ala Asn Thr Gly
370 375 380
cat gag ttg gtt gat gca ttc gtt tgg gta aaa ccc gga gga gag tca
1200His Glu Leu Val Asp Ala Phe Val Trp Val Lys Pro Gly Gly Glu Ser
385 390 395 400
gat gga acg agt gat tct tct gct cca agg ttc gat tct cat tgc gca
1248Asp Gly Thr Ser Asp Ser Ser Ala Pro Arg Phe Asp Ser His Cys Ala
405 410 415
tta cca gat gct ttg cag cca gca cct caa gca gga gct tgg ttc caa
1296Leu Pro Asp Ala Leu Gln Pro Ala Pro Gln Ala Gly Ala Trp Phe Gln
420 425 430
gct tat ttt gta caa tta ctg act aac gcc aat cct agt ttt cta cat
1344Ala Tyr Phe Val Gln Leu Leu Thr Asn Ala Asn Pro Ser Phe Leu His
435 440 445
cac cat cac cac cat tag
1362His His His His His
450
18453PRTArtificial SequenceSynthetic Construct 18Ala Ser Cys Ser Ser Val
Trp Gly Gln Cys Gly Gly Gln Asn Trp Ser 1 5
10 15 Gly Pro Thr Cys Cys Ala Ser Gly Ser Thr Cys
Val Tyr Ser Asn Asp 20 25
30 Tyr Tyr Ser Gln Cys Leu Pro Gly Ala Ala Ser Ser Ser Ser Ser
Thr 35 40 45 Arg
Ala Ala Ser Thr Thr Ser Arg Val Ser Pro Thr Thr Ser Arg Ser 50
55 60 Ser Ser Ala Thr Pro Pro
Pro Gly Ser Thr Thr Thr Arg Val Pro Pro 65 70
75 80 Val Gly Ser Gly Thr Ala Thr Tyr Ser Gly Asn
Pro Phe Glu Gly Val 85 90
95 Gln Leu Trp Ala Asn Asn Tyr Tyr Arg Ser Glu Val His Thr Leu Ala
100 105 110 Ile Pro
Gln Ile Thr Asp Pro Ala Leu Arg Ala Ala Ala Ser Ala Val 115
120 125 Ala Glu Val Pro Ser Phe Met
Trp Leu Asp Thr Leu Asp Lys Thr Pro 130 135
140 Leu Met Glu Gln Thr Leu Ala Asp Ile Arg Thr Ala
Asn Lys Asn Gly 145 150 155
160 Gly Asn Tyr Ala Gly Gln Phe Val Val Tyr Asp Leu Pro Asp Arg Asp
165 170 175 Cys Ala Ala
Leu Ala Ser Asn Gly Glu Tyr Ser Ile Ala Asp Gly Gly 180
185 190 Val Ala Lys Tyr Lys Asn Tyr Ile
Asp Thr Ile Arg Gln Ile Val Val 195 200
205 Glu Tyr Ser Asp Ile Arg Thr Leu Leu Val Ile Glu Pro
Asp Ser Leu 210 215 220
Ala Asn Leu Val Thr Asn Leu Gly Thr Pro Lys Cys Ala Asn Ala Gln 225
230 235 240 Ser Ala Tyr Leu
Glu Cys Ile Asn Tyr Ala Val Thr Gln Leu Asn Leu 245
250 255 Pro Asn Val Ala Met Tyr Leu Asp Ala
Gly His Ala Gly Trp Leu Gly 260 265
270 Trp Pro Ala Asn Gln Asp Pro Ala Ala Gln Leu Phe Ala Asn
Val Tyr 275 280 285
Lys Asn Ala Ser Ser Pro Arg Ala Leu Arg Gly Leu Ala Thr Asn Val 290
295 300 Ala Asn Tyr Asn Ala
Trp Ser Ile Ala Ser Pro Pro Pro Tyr Thr Ser 305 310
315 320 Pro Asn Pro Asn Tyr Asp Glu Lys His Tyr
Ile Glu Ala Phe Ala Pro 325 330
335 Leu Leu Arg Asn Gln Gly Phe Asp Ala Lys Phe Ile Val Asp Thr
Gly 340 345 350 Arg
Asn Gly Lys Gln Pro Thr Gly Gln Leu Glu Trp Gly His Trp Cys 355
360 365 Asn Val Lys Gly Thr Gly
Phe Gly Val Arg Pro Thr Ala Asn Thr Gly 370 375
380 His Glu Leu Val Asp Ala Phe Val Trp Val Lys
Pro Gly Gly Glu Ser 385 390 395
400 Asp Gly Thr Ser Asp Ser Ser Ala Pro Arg Phe Asp Ser His Cys Ala
405 410 415 Leu Pro
Asp Ala Leu Gln Pro Ala Pro Gln Ala Gly Ala Trp Phe Gln 420
425 430 Ala Tyr Phe Val Gln Leu Leu
Thr Asn Ala Asn Pro Ser Phe Leu His 435 440
445 His His His His His 450
191362DNAArtificial SequenceCel6a engineered variant 2B3 19gct agc tgc
tca agc gtc tgg ggc caa tgt ggt ggc cag aat tgg tcg 48Ala Ser Cys
Ser Ser Val Trp Gly Gln Cys Gly Gly Gln Asn Trp Ser 1
5 10 15 ggt ccg acc tgc
tgt gct tcc gga agc aca tgc gtc tac tcc aac gac 96Gly Pro Thr Cys
Cys Ala Ser Gly Ser Thr Cys Val Tyr Ser Asn Asp 20
25 30 tat tac tcc cag tgt
ctt ccc ggc gct gca agc tca agc tcg tcc acg 144Tyr Tyr Ser Gln Cys
Leu Pro Gly Ala Ala Ser Ser Ser Ser Ser Thr 35
40 45 cgc gcc gcg tcg acg act
tct cga gta tcc ccc aca aca tcc cgg tcg 192Arg Ala Ala Ser Thr Thr
Ser Arg Val Ser Pro Thr Thr Ser Arg Ser 50
55 60 agc tcc gcg acg cct cca
cct ggt tct act act acc aga gta cct cca 240Ser Ser Ala Thr Pro Pro
Pro Gly Ser Thr Thr Thr Arg Val Pro Pro 65 70
75 80 gtc gga tcg gga acc gct acg
tat tca ggt aac ccc ttt gaa ggt gtt 288Val Gly Ser Gly Thr Ala Thr
Tyr Ser Gly Asn Pro Phe Glu Gly Val 85
90 95 cag ctg tgg gct aat aac tat tat
aga tct gag gta cat aca ctg gcc 336Gln Leu Trp Ala Asn Asn Tyr Tyr
Arg Ser Glu Val His Thr Leu Ala 100
105 110 att ccg caa att aca gac ccc gcg
ttg cgt gcc gca gct agt gct gtg 384Ile Pro Gln Ile Thr Asp Pro Ala
Leu Arg Ala Ala Ala Ser Ala Val 115 120
125 gct gag gtg cca agt ttt atg tgg ctg
gat act ttg gac aaa acc ccc 432Ala Glu Val Pro Ser Phe Met Trp Leu
Asp Thr Leu Asp Lys Thr Pro 130 135
140 tta atg gaa caa acg ttg gct gat ata cgt
act gcg aat aaa aac ggc 480Leu Met Glu Gln Thr Leu Ala Asp Ile Arg
Thr Ala Asn Lys Asn Gly 145 150
155 160 ggc aat tat gct gga caa ttt gtg gtt tat
gac ctg ccg gat aga gat 528Gly Asn Tyr Ala Gly Gln Phe Val Val Tyr
Asp Leu Pro Asp Arg Asp 165 170
175 tgt gct gca cta gcg agc aac ggg gag tac agc
att gcg gat ggc ggt 576Cys Ala Ala Leu Ala Ser Asn Gly Glu Tyr Ser
Ile Ala Asp Gly Gly 180 185
190 gtc gca aag tac aaa aac tat ata gat act atc agg
caa ata gtt gtc 624Val Ala Lys Tyr Lys Asn Tyr Ile Asp Thr Ile Arg
Gln Ile Val Val 195 200
205 gaa tac agt gat att cgt acg ctg ctt gta atc gaa
ccc gat tcc tta 672Glu Tyr Ser Asp Ile Arg Thr Leu Leu Val Ile Glu
Pro Asp Ser Leu 210 215 220
gcg aac ttg gtg aca aat cta ggt act ccg aag tgt gcg
aac gcg cag 720Ala Asn Leu Val Thr Asn Leu Gly Thr Pro Lys Cys Ala
Asn Ala Gln 225 230 235
240 agt gct tat ctt gag tgc atc aat tat gca gtc acc cag ttg
aat ttg 768Ser Ala Tyr Leu Glu Cys Ile Asn Tyr Ala Val Thr Gln Leu
Asn Leu 245 250
255 cca aac gtt gca atg tat ctt gat gct ggt cat gcc ggg tgg
ttg ggt 816Pro Asn Val Ala Met Tyr Leu Asp Ala Gly His Ala Gly Trp
Leu Gly 260 265 270
tgg cca gca aat ctg gat ccc gct gcg cag ctg ttt gca aat gtt
tac 864Trp Pro Ala Asn Leu Asp Pro Ala Ala Gln Leu Phe Ala Asn Val
Tyr 275 280 285
aaa aat gcc tca agt cct aga gcg ctg agg ggt ctt gca aca aat gtt
912Lys Asn Ala Ser Ser Pro Arg Ala Leu Arg Gly Leu Ala Thr Asn Val
290 295 300
gct aat tac aac gct tgg tca ata gcg agt ccc cca ccg tac aca agc
960Ala Asn Tyr Asn Ala Trp Ser Ile Ala Ser Pro Pro Pro Tyr Thr Ser
305 310 315 320
cct aac cca aac tac gat gag aag cat tac ata gaa gca ttt gct cct
1008Pro Asn Pro Asn Tyr Asp Glu Lys His Tyr Ile Glu Ala Phe Ala Pro
325 330 335
ttg ctt cgt aac caa ggt ttt gat gca aag ttt atc gtc gat acc gga
1056Leu Leu Arg Asn Gln Gly Phe Asp Ala Lys Phe Ile Val Asp Thr Gly
340 345 350
aga aac ggc aag cag ccg aca ggg cag cta gaa tgg ggg cac tgg tgc
1104Arg Asn Gly Lys Gln Pro Thr Gly Gln Leu Glu Trp Gly His Trp Cys
355 360 365
aat gtc aag ggt acg ggt ttc ggt gtt aga ccc acg gct aac act ggg
1152Asn Val Lys Gly Thr Gly Phe Gly Val Arg Pro Thr Ala Asn Thr Gly
370 375 380
cat gag ttg gtt gat gca ttc gtt tgg gta aaa ccc gga gga gag tca
1200His Glu Leu Val Asp Ala Phe Val Trp Val Lys Pro Gly Gly Glu Ser
385 390 395 400
gat gga acg agt gat tct tct gct cca agg ttc gat tct cat tgc gca
1248Asp Gly Thr Ser Asp Ser Ser Ala Pro Arg Phe Asp Ser His Cys Ala
405 410 415
tta cca gat gct ttg cag cca gca cct caa gca gga gct tgg ttc caa
1296Leu Pro Asp Ala Leu Gln Pro Ala Pro Gln Ala Gly Ala Trp Phe Gln
420 425 430
gct tat ttt gta caa tta ctg act aac gcc aat cct agt ttt cta cat
1344Ala Tyr Phe Val Gln Leu Leu Thr Asn Ala Asn Pro Ser Phe Leu His
435 440 445
cac cat cac cac cat tag
1362His His His His His
450
20453PRTArtificial SequenceSynthetic Construct 20Ala Ser Cys Ser Ser Val
Trp Gly Gln Cys Gly Gly Gln Asn Trp Ser 1 5
10 15 Gly Pro Thr Cys Cys Ala Ser Gly Ser Thr Cys
Val Tyr Ser Asn Asp 20 25
30 Tyr Tyr Ser Gln Cys Leu Pro Gly Ala Ala Ser Ser Ser Ser Ser
Thr 35 40 45 Arg
Ala Ala Ser Thr Thr Ser Arg Val Ser Pro Thr Thr Ser Arg Ser 50
55 60 Ser Ser Ala Thr Pro Pro
Pro Gly Ser Thr Thr Thr Arg Val Pro Pro 65 70
75 80 Val Gly Ser Gly Thr Ala Thr Tyr Ser Gly Asn
Pro Phe Glu Gly Val 85 90
95 Gln Leu Trp Ala Asn Asn Tyr Tyr Arg Ser Glu Val His Thr Leu Ala
100 105 110 Ile Pro
Gln Ile Thr Asp Pro Ala Leu Arg Ala Ala Ala Ser Ala Val 115
120 125 Ala Glu Val Pro Ser Phe Met
Trp Leu Asp Thr Leu Asp Lys Thr Pro 130 135
140 Leu Met Glu Gln Thr Leu Ala Asp Ile Arg Thr Ala
Asn Lys Asn Gly 145 150 155
160 Gly Asn Tyr Ala Gly Gln Phe Val Val Tyr Asp Leu Pro Asp Arg Asp
165 170 175 Cys Ala Ala
Leu Ala Ser Asn Gly Glu Tyr Ser Ile Ala Asp Gly Gly 180
185 190 Val Ala Lys Tyr Lys Asn Tyr Ile
Asp Thr Ile Arg Gln Ile Val Val 195 200
205 Glu Tyr Ser Asp Ile Arg Thr Leu Leu Val Ile Glu Pro
Asp Ser Leu 210 215 220
Ala Asn Leu Val Thr Asn Leu Gly Thr Pro Lys Cys Ala Asn Ala Gln 225
230 235 240 Ser Ala Tyr Leu
Glu Cys Ile Asn Tyr Ala Val Thr Gln Leu Asn Leu 245
250 255 Pro Asn Val Ala Met Tyr Leu Asp Ala
Gly His Ala Gly Trp Leu Gly 260 265
270 Trp Pro Ala Asn Leu Asp Pro Ala Ala Gln Leu Phe Ala Asn
Val Tyr 275 280 285
Lys Asn Ala Ser Ser Pro Arg Ala Leu Arg Gly Leu Ala Thr Asn Val 290
295 300 Ala Asn Tyr Asn Ala
Trp Ser Ile Ala Ser Pro Pro Pro Tyr Thr Ser 305 310
315 320 Pro Asn Pro Asn Tyr Asp Glu Lys His Tyr
Ile Glu Ala Phe Ala Pro 325 330
335 Leu Leu Arg Asn Gln Gly Phe Asp Ala Lys Phe Ile Val Asp Thr
Gly 340 345 350 Arg
Asn Gly Lys Gln Pro Thr Gly Gln Leu Glu Trp Gly His Trp Cys 355
360 365 Asn Val Lys Gly Thr Gly
Phe Gly Val Arg Pro Thr Ala Asn Thr Gly 370 375
380 His Glu Leu Val Asp Ala Phe Val Trp Val Lys
Pro Gly Gly Glu Ser 385 390 395
400 Asp Gly Thr Ser Asp Ser Ser Ala Pro Arg Phe Asp Ser His Cys Ala
405 410 415 Leu Pro
Asp Ala Leu Gln Pro Ala Pro Gln Ala Gly Ala Trp Phe Gln 420
425 430 Ala Tyr Phe Val Gln Leu Leu
Thr Asn Ala Asn Pro Ser Phe Leu His 435 440
445 His His His His His 450
211362DNAArtificial SequenceCel6a engineered variant 2F4 21gct agc tgc
tca agc gtc tgg ggc caa tgt ggt ggc cag aat tgg tcg 48Ala Ser Cys
Ser Ser Val Trp Gly Gln Cys Gly Gly Gln Asn Trp Ser 1
5 10 15 ggt ccg act tgc
tgt gct tcc gga agc aca tgc gtc tac tcc aac gac 96Gly Pro Thr Cys
Cys Ala Ser Gly Ser Thr Cys Val Tyr Ser Asn Asp 20
25 30 tat tac tcc cag tgt
ctt ccc ggc gct gca agc tca agc tcg tcc acg 144Tyr Tyr Ser Gln Cys
Leu Pro Gly Ala Ala Ser Ser Ser Ser Ser Thr 35
40 45 cgc gcc gcg tcg acg act
tct cga gta tcc ccc aca aca tcc cgg tcg 192Arg Ala Ala Ser Thr Thr
Ser Arg Val Ser Pro Thr Thr Ser Arg Ser 50
55 60 agc tcc gcg acg cct cca
cct ggt tct act act acc aga gta cct cca 240Ser Ser Ala Thr Pro Pro
Pro Gly Ser Thr Thr Thr Arg Val Pro Pro 65 70
75 80 gtc gga tcg gga acc gct acg
tat tca ggt aac ccc ttt gaa ggt gtt 288Val Gly Ser Gly Thr Ala Thr
Tyr Ser Gly Asn Pro Phe Glu Gly Val 85
90 95 cag ctg tgg gct aat aac tat tat
aga tct gag gta cat aca ctg gcc 336Gln Leu Trp Ala Asn Asn Tyr Tyr
Arg Ser Glu Val His Thr Leu Ala 100
105 110 att ccg caa att aca gac ccc gcg
ttg cgt gcc gca gct agt gct gtg 384Ile Pro Gln Ile Thr Asp Pro Ala
Leu Arg Ala Ala Ala Ser Ala Val 115 120
125 gct gag gtg cca agt ttt ttg tgg ctg
gat act ttg gac aaa acc ccc 432Ala Glu Val Pro Ser Phe Leu Trp Leu
Asp Thr Leu Asp Lys Thr Pro 130 135
140 tta atg gaa caa acg ttg gct gat ata cgt
act gcg aat aaa aac ggc 480Leu Met Glu Gln Thr Leu Ala Asp Ile Arg
Thr Ala Asn Lys Asn Gly 145 150
155 160 ggc aat tat gct gga caa ttt gtg gtt tat
gac ctg ccg gat aga gat 528Gly Asn Tyr Ala Gly Gln Phe Val Val Tyr
Asp Leu Pro Asp Arg Asp 165 170
175 tgt gct gca cta gcg agc aac ggg gag tac agc
att gcg gat ggc ggt 576Cys Ala Ala Leu Ala Ser Asn Gly Glu Tyr Ser
Ile Ala Asp Gly Gly 180 185
190 gtc gca aag tac aaa aac tat ata gat act atc agg
caa ata gtt gtc 624Val Ala Lys Tyr Lys Asn Tyr Ile Asp Thr Ile Arg
Gln Ile Val Val 195 200
205 gaa tac agt gat att cgt acg ctg ctt gta atc gaa
ccc gat tcc tta 672Glu Tyr Ser Asp Ile Arg Thr Leu Leu Val Ile Glu
Pro Asp Ser Leu 210 215 220
gcg aac ttg gtg aca aat cta ggt act ccg aag tgt gcg
aac gcg cag 720Ala Asn Leu Val Thr Asn Leu Gly Thr Pro Lys Cys Ala
Asn Ala Gln 225 230 235
240 agt gct tat ctt gag tgc atc aat tat gca gtc acc cag ttg
aat ttg 768Ser Ala Tyr Leu Glu Cys Ile Asn Tyr Ala Val Thr Gln Leu
Asn Leu 245 250
255 cca aac gtt gca atg tat ctt gat gct ggt cat gcc ggg tgg
ttg ggt 816Pro Asn Val Ala Met Tyr Leu Asp Ala Gly His Ala Gly Trp
Leu Gly 260 265 270
tgg cca gca aat cag gat ccc gct gcg cag ctg ttt gca aat gtt
tac 864Trp Pro Ala Asn Gln Asp Pro Ala Ala Gln Leu Phe Ala Asn Val
Tyr 275 280 285
aaa aat gcc tca agt cct aga gcg ctg agg ggt ctt gca aca aat gtt
912Lys Asn Ala Ser Ser Pro Arg Ala Leu Arg Gly Leu Ala Thr Asn Val
290 295 300
gct aat tac aac gct tgg tca ata gcg agt cct cca ccg tac aca agc
960Ala Asn Tyr Asn Ala Trp Ser Ile Ala Ser Pro Pro Pro Tyr Thr Ser
305 310 315 320
cct aac cca aac tac gat gag aag cat tac ata gaa gca ttt gct cct
1008Pro Asn Pro Asn Tyr Asp Glu Lys His Tyr Ile Glu Ala Phe Ala Pro
325 330 335
ttg ctt cgt aac caa ggt ttt gat gca aag ttt atc gtc gat acc gga
1056Leu Leu Arg Asn Gln Gly Phe Asp Ala Lys Phe Ile Val Asp Thr Gly
340 345 350
aga aac ggc aag cag ccg aca ggg cag cta gaa tgg ggg cac tgg tgc
1104Arg Asn Gly Lys Gln Pro Thr Gly Gln Leu Glu Trp Gly His Trp Cys
355 360 365
aat gtc aag ggt acg ggt ttc ggt gtt aga ccc acg gct aac act ggg
1152Asn Val Lys Gly Thr Gly Phe Gly Val Arg Pro Thr Ala Asn Thr Gly
370 375 380
cat gag ttg gtt gat gca ttc gtt tgg gta aaa ccc gga gga gag tca
1200His Glu Leu Val Asp Ala Phe Val Trp Val Lys Pro Gly Gly Glu Ser
385 390 395 400
gat gga acg agt gat tct tct gct cca agg ttc gat tct cat tgc gca
1248Asp Gly Thr Ser Asp Ser Ser Ala Pro Arg Phe Asp Ser His Cys Ala
405 410 415
tta cca gat gct ttg cag cca gca cct caa gca gga gct tgg ttc caa
1296Leu Pro Asp Ala Leu Gln Pro Ala Pro Gln Ala Gly Ala Trp Phe Gln
420 425 430
gct tat ttt gta caa tta ctg act aac gcc aat cct agt ttt cta cat
1344Ala Tyr Phe Val Gln Leu Leu Thr Asn Ala Asn Pro Ser Phe Leu His
435 440 445
cac cat cac cac cat tag
1362His His His His His
450
22453PRTArtificial SequenceSynthetic Construct 22Ala Ser Cys Ser Ser Val
Trp Gly Gln Cys Gly Gly Gln Asn Trp Ser 1 5
10 15 Gly Pro Thr Cys Cys Ala Ser Gly Ser Thr Cys
Val Tyr Ser Asn Asp 20 25
30 Tyr Tyr Ser Gln Cys Leu Pro Gly Ala Ala Ser Ser Ser Ser Ser
Thr 35 40 45 Arg
Ala Ala Ser Thr Thr Ser Arg Val Ser Pro Thr Thr Ser Arg Ser 50
55 60 Ser Ser Ala Thr Pro Pro
Pro Gly Ser Thr Thr Thr Arg Val Pro Pro 65 70
75 80 Val Gly Ser Gly Thr Ala Thr Tyr Ser Gly Asn
Pro Phe Glu Gly Val 85 90
95 Gln Leu Trp Ala Asn Asn Tyr Tyr Arg Ser Glu Val His Thr Leu Ala
100 105 110 Ile Pro
Gln Ile Thr Asp Pro Ala Leu Arg Ala Ala Ala Ser Ala Val 115
120 125 Ala Glu Val Pro Ser Phe Leu
Trp Leu Asp Thr Leu Asp Lys Thr Pro 130 135
140 Leu Met Glu Gln Thr Leu Ala Asp Ile Arg Thr Ala
Asn Lys Asn Gly 145 150 155
160 Gly Asn Tyr Ala Gly Gln Phe Val Val Tyr Asp Leu Pro Asp Arg Asp
165 170 175 Cys Ala Ala
Leu Ala Ser Asn Gly Glu Tyr Ser Ile Ala Asp Gly Gly 180
185 190 Val Ala Lys Tyr Lys Asn Tyr Ile
Asp Thr Ile Arg Gln Ile Val Val 195 200
205 Glu Tyr Ser Asp Ile Arg Thr Leu Leu Val Ile Glu Pro
Asp Ser Leu 210 215 220
Ala Asn Leu Val Thr Asn Leu Gly Thr Pro Lys Cys Ala Asn Ala Gln 225
230 235 240 Ser Ala Tyr Leu
Glu Cys Ile Asn Tyr Ala Val Thr Gln Leu Asn Leu 245
250 255 Pro Asn Val Ala Met Tyr Leu Asp Ala
Gly His Ala Gly Trp Leu Gly 260 265
270 Trp Pro Ala Asn Gln Asp Pro Ala Ala Gln Leu Phe Ala Asn
Val Tyr 275 280 285
Lys Asn Ala Ser Ser Pro Arg Ala Leu Arg Gly Leu Ala Thr Asn Val 290
295 300 Ala Asn Tyr Asn Ala
Trp Ser Ile Ala Ser Pro Pro Pro Tyr Thr Ser 305 310
315 320 Pro Asn Pro Asn Tyr Asp Glu Lys His Tyr
Ile Glu Ala Phe Ala Pro 325 330
335 Leu Leu Arg Asn Gln Gly Phe Asp Ala Lys Phe Ile Val Asp Thr
Gly 340 345 350 Arg
Asn Gly Lys Gln Pro Thr Gly Gln Leu Glu Trp Gly His Trp Cys 355
360 365 Asn Val Lys Gly Thr Gly
Phe Gly Val Arg Pro Thr Ala Asn Thr Gly 370 375
380 His Glu Leu Val Asp Ala Phe Val Trp Val Lys
Pro Gly Gly Glu Ser 385 390 395
400 Asp Gly Thr Ser Asp Ser Ser Ala Pro Arg Phe Asp Ser His Cys Ala
405 410 415 Leu Pro
Asp Ala Leu Gln Pro Ala Pro Gln Ala Gly Ala Trp Phe Gln 420
425 430 Ala Tyr Phe Val Gln Leu Leu
Thr Asn Ala Asn Pro Ser Phe Leu His 435 440
445 His His His His His 450
231362DNAArtificial SequenceCel6a engineered variant 2G6 23gct agc tgc
tca agc gtc tgg ggc caa tgt ggt ggc cag aat tgg tcg 48Ala Ser Cys
Ser Ser Val Trp Gly Gln Cys Gly Gly Gln Asn Trp Ser 1
5 10 15 ggt ccg act tgc
tgt gct tcc gga agc aca tgc gtc tac tcc aac gac 96Gly Pro Thr Cys
Cys Ala Ser Gly Ser Thr Cys Val Tyr Ser Asn Asp 20
25 30 tat tac tcc cag tgt
ctt ccc ggc gct gca agc tca agc tcg tcc acg 144Tyr Tyr Ser Gln Cys
Leu Pro Gly Ala Ala Ser Ser Ser Ser Ser Thr 35
40 45 cgc gcc gcg tcg acg act
tct cga gta tcc ccc aca aca tcc cgg tcg 192Arg Ala Ala Ser Thr Thr
Ser Arg Val Ser Pro Thr Thr Ser Arg Ser 50
55 60 agc tcc gcg acg cct cca
cct ggt tct act act acc aga gta cct cca 240Ser Ser Ala Thr Pro Pro
Pro Gly Ser Thr Thr Thr Arg Val Pro Pro 65 70
75 80 gtc gga tcg gga acc gct acg
tat tca ggt aac ccc ttt gaa ggt gtt 288Val Gly Ser Gly Thr Ala Thr
Tyr Ser Gly Asn Pro Phe Glu Gly Val 85
90 95 cag ctg tgg gct aat aac tat tat
aga tct gag gta cat aca ctg gcc 336Gln Leu Trp Ala Asn Asn Tyr Tyr
Arg Ser Glu Val His Thr Leu Ala 100
105 110 att ccg caa att aca gac ccc gcg
ttg cgt gcc gca gct agt gct gtg 384Ile Pro Gln Ile Thr Asp Pro Ala
Leu Arg Ala Ala Ala Ser Ala Val 115 120
125 gct gag gtg cca agt ttt atg tgg ctg
gat act ttg gac aaa acc ccc 432Ala Glu Val Pro Ser Phe Met Trp Leu
Asp Thr Leu Asp Lys Thr Pro 130 135
140 tta atg gaa caa acg ttg gct gat ata cgt
act gcg aat aaa aac ggc 480Leu Met Glu Gln Thr Leu Ala Asp Ile Arg
Thr Ala Asn Lys Asn Gly 145 150
155 160 ggc aat tat gct gga caa ttt gtg gtt tat
gac ctg ccg gat aga gat 528Gly Asn Tyr Ala Gly Gln Phe Val Val Tyr
Asp Leu Pro Asp Arg Asp 165 170
175 tgt gct gca cta gcg agc aac ggg gag tac agc
att gcg gat ggc ggt 576Cys Ala Ala Leu Ala Ser Asn Gly Glu Tyr Ser
Ile Ala Asp Gly Gly 180 185
190 gtc gca aag tac aaa aac tat ata gat act atc agg
caa ata gtt gtc 624Val Ala Lys Tyr Lys Asn Tyr Ile Asp Thr Ile Arg
Gln Ile Val Val 195 200
205 gaa tac agt gat att cgt acg ctg ctt gta atc gaa
ccc gat tcc tta 672Glu Tyr Ser Asp Ile Arg Thr Leu Leu Val Ile Glu
Pro Asp Ser Leu 210 215 220
gcg aac ttg gtg aca aat cta ggt act ccg aag tgt gcg
aac gcg cag 720Ala Asn Leu Val Thr Asn Leu Gly Thr Pro Lys Cys Ala
Asn Ala Gln 225 230 235
240 agt gct tat ctt gag tgc atc aat tat gca gtc acc cag ttg
aat ttg 768Ser Ala Tyr Leu Glu Cys Ile Asn Tyr Ala Val Thr Gln Leu
Asn Leu 245 250
255 cca aac gtt gca atg tat ctt gat gct ggt cat gcc ggg tgg
ttg ggt 816Pro Asn Val Ala Met Tyr Leu Asp Ala Gly His Ala Gly Trp
Leu Gly 260 265 270
tgg cca gca aat cag gat ccc gct gcg cag ctg ttt gca aat gtt
tac 864Trp Pro Ala Asn Gln Asp Pro Ala Ala Gln Leu Phe Ala Asn Val
Tyr 275 280 285
aaa aat gcc tca agt cct aga gcg ctg agg ggt ctt gca aca aat gtt
912Lys Asn Ala Ser Ser Pro Arg Ala Leu Arg Gly Leu Ala Thr Asn Val
290 295 300
gct aat tac aac gct tgg tca ata gcg agt cct cca ccg tac aca agc
960Ala Asn Tyr Asn Ala Trp Ser Ile Ala Ser Pro Pro Pro Tyr Thr Ser
305 310 315 320
cct aac cca aac tac gat gag aag cat tac ata gaa gca ttt gct cct
1008Pro Asn Pro Asn Tyr Asp Glu Lys His Tyr Ile Glu Ala Phe Ala Pro
325 330 335
ttg ctt cgt aac caa ggt ttt gat gca aag ttt atc gtc gat acc gga
1056Leu Leu Arg Asn Gln Gly Phe Asp Ala Lys Phe Ile Val Asp Thr Gly
340 345 350
aga aac ggc aag cag ccg aca ggg cag cta gaa tgg ggg cac tgg tgc
1104Arg Asn Gly Lys Gln Pro Thr Gly Gln Leu Glu Trp Gly His Trp Cys
355 360 365
aat gtc aag ggt acg ggt ttc ggt gtt aga ccc acg gct aac act ggg
1152Asn Val Lys Gly Thr Gly Phe Gly Val Arg Pro Thr Ala Asn Thr Gly
370 375 380
cat gag ttg gtt gat gca ttc gtt tgg gta aaa ccc gga gga gag tca
1200His Glu Leu Val Asp Ala Phe Val Trp Val Lys Pro Gly Gly Glu Ser
385 390 395 400
gat gga acg agt gat cct tct gct cca agg ttc gat tct cat tgc gca
1248Asp Gly Thr Ser Asp Pro Ser Ala Pro Arg Phe Asp Ser His Cys Ala
405 410 415
tta cca gat gct ttg cag cca gca cct caa gca gga gct tgg ttc caa
1296Leu Pro Asp Ala Leu Gln Pro Ala Pro Gln Ala Gly Ala Trp Phe Gln
420 425 430
gct tat ttt gta caa tta ctg act aac gcc aat cct agt ttt cta cat
1344Ala Tyr Phe Val Gln Leu Leu Thr Asn Ala Asn Pro Ser Phe Leu His
435 440 445
cac cat cac cac cat tag
1362His His His His His
450
24453PRTArtificial SequenceSynthetic Construct 24Ala Ser Cys Ser Ser Val
Trp Gly Gln Cys Gly Gly Gln Asn Trp Ser 1 5
10 15 Gly Pro Thr Cys Cys Ala Ser Gly Ser Thr Cys
Val Tyr Ser Asn Asp 20 25
30 Tyr Tyr Ser Gln Cys Leu Pro Gly Ala Ala Ser Ser Ser Ser Ser
Thr 35 40 45 Arg
Ala Ala Ser Thr Thr Ser Arg Val Ser Pro Thr Thr Ser Arg Ser 50
55 60 Ser Ser Ala Thr Pro Pro
Pro Gly Ser Thr Thr Thr Arg Val Pro Pro 65 70
75 80 Val Gly Ser Gly Thr Ala Thr Tyr Ser Gly Asn
Pro Phe Glu Gly Val 85 90
95 Gln Leu Trp Ala Asn Asn Tyr Tyr Arg Ser Glu Val His Thr Leu Ala
100 105 110 Ile Pro
Gln Ile Thr Asp Pro Ala Leu Arg Ala Ala Ala Ser Ala Val 115
120 125 Ala Glu Val Pro Ser Phe Met
Trp Leu Asp Thr Leu Asp Lys Thr Pro 130 135
140 Leu Met Glu Gln Thr Leu Ala Asp Ile Arg Thr Ala
Asn Lys Asn Gly 145 150 155
160 Gly Asn Tyr Ala Gly Gln Phe Val Val Tyr Asp Leu Pro Asp Arg Asp
165 170 175 Cys Ala Ala
Leu Ala Ser Asn Gly Glu Tyr Ser Ile Ala Asp Gly Gly 180
185 190 Val Ala Lys Tyr Lys Asn Tyr Ile
Asp Thr Ile Arg Gln Ile Val Val 195 200
205 Glu Tyr Ser Asp Ile Arg Thr Leu Leu Val Ile Glu Pro
Asp Ser Leu 210 215 220
Ala Asn Leu Val Thr Asn Leu Gly Thr Pro Lys Cys Ala Asn Ala Gln 225
230 235 240 Ser Ala Tyr Leu
Glu Cys Ile Asn Tyr Ala Val Thr Gln Leu Asn Leu 245
250 255 Pro Asn Val Ala Met Tyr Leu Asp Ala
Gly His Ala Gly Trp Leu Gly 260 265
270 Trp Pro Ala Asn Gln Asp Pro Ala Ala Gln Leu Phe Ala Asn
Val Tyr 275 280 285
Lys Asn Ala Ser Ser Pro Arg Ala Leu Arg Gly Leu Ala Thr Asn Val 290
295 300 Ala Asn Tyr Asn Ala
Trp Ser Ile Ala Ser Pro Pro Pro Tyr Thr Ser 305 310
315 320 Pro Asn Pro Asn Tyr Asp Glu Lys His Tyr
Ile Glu Ala Phe Ala Pro 325 330
335 Leu Leu Arg Asn Gln Gly Phe Asp Ala Lys Phe Ile Val Asp Thr
Gly 340 345 350 Arg
Asn Gly Lys Gln Pro Thr Gly Gln Leu Glu Trp Gly His Trp Cys 355
360 365 Asn Val Lys Gly Thr Gly
Phe Gly Val Arg Pro Thr Ala Asn Thr Gly 370 375
380 His Glu Leu Val Asp Ala Phe Val Trp Val Lys
Pro Gly Gly Glu Ser 385 390 395
400 Asp Gly Thr Ser Asp Pro Ser Ala Pro Arg Phe Asp Ser His Cys Ala
405 410 415 Leu Pro
Asp Ala Leu Gln Pro Ala Pro Gln Ala Gly Ala Trp Phe Gln 420
425 430 Ala Tyr Phe Val Gln Leu Leu
Thr Asn Ala Asn Pro Ser Phe Leu His 435 440
445 His His His His His 450
251362DNAArtificial SequenceCel6a engineered variant 3C6 25gct agc tgc
tca agc gtc tgg ggc caa tgt ggt ggc cag aat tgg tcg 48Ala Ser Cys
Ser Ser Val Trp Gly Gln Cys Gly Gly Gln Asn Trp Ser 1
5 10 15 ggt ccg acc tgc
tgt gct tcc gga agc aca tgc gtc tac ttc aac gac 96Gly Pro Thr Cys
Cys Ala Ser Gly Ser Thr Cys Val Tyr Phe Asn Asp 20
25 30 tat tac tcc cag tgt
ctt ccc ggc gct gca agc tca agc tcg tcc acg 144Tyr Tyr Ser Gln Cys
Leu Pro Gly Ala Ala Ser Ser Ser Ser Ser Thr 35
40 45 cgc gcc gcg tcg acg act
tct cga gta tcc ccc aca aca tcc cgg tcg 192Arg Ala Ala Ser Thr Thr
Ser Arg Val Ser Pro Thr Thr Ser Arg Ser 50
55 60 agc tcc gcg acg cct cca
cct ggt tct act act acc aga gta cct cca 240Ser Ser Ala Thr Pro Pro
Pro Gly Ser Thr Thr Thr Arg Val Pro Pro 65 70
75 80 gtc gga tcg gga acc gct acg
tat tca ggt aac ccc ttt gaa ggt gtt 288Val Gly Ser Gly Thr Ala Thr
Tyr Ser Gly Asn Pro Phe Glu Gly Val 85
90 95 cag ctg tgg gct aat aac tat tat
aga tct gag gta cat aca ctg gcc 336Gln Leu Trp Ala Asn Asn Tyr Tyr
Arg Ser Glu Val His Thr Leu Ala 100
105 110 att ccg caa att aca gac ccc gcg
ttg cgt gcc gca gct agt gct gcg 384Ile Pro Gln Ile Thr Asp Pro Ala
Leu Arg Ala Ala Ala Ser Ala Ala 115 120
125 gct gag gtg cca agt ttt ttg tgg ctg
gat act ttg gac aaa acc ccc 432Ala Glu Val Pro Ser Phe Leu Trp Leu
Asp Thr Leu Asp Lys Thr Pro 130 135
140 tta atg gaa caa acg ttg gct gat ata cgt
act gcg aat aaa aac ggc 480Leu Met Glu Gln Thr Leu Ala Asp Ile Arg
Thr Ala Asn Lys Asn Gly 145 150
155 160 ggc aat tat gct gga caa ttt gtg gtt tat
gac ctg ccg gat aga gat 528Gly Asn Tyr Ala Gly Gln Phe Val Val Tyr
Asp Leu Pro Asp Arg Asp 165 170
175 tgt gct gca cta gcg agc aac ggg gag tac agc
att gcg gat ggc ggt 576Cys Ala Ala Leu Ala Ser Asn Gly Glu Tyr Ser
Ile Ala Asp Gly Gly 180 185
190 gtc gca aag tac aaa aac tat ata gat act atc agg
caa ata gtt gtc 624Val Ala Lys Tyr Lys Asn Tyr Ile Asp Thr Ile Arg
Gln Ile Val Val 195 200
205 gaa tac agt gat att cgt acg ctg ctt gta atc gaa
ccc gat tcc tta 672Glu Tyr Ser Asp Ile Arg Thr Leu Leu Val Ile Glu
Pro Asp Ser Leu 210 215 220
gcg aac ttg gtg aca aat cta ggt act ccg aag tgt gcg
aac gcg cag 720Ala Asn Leu Val Thr Asn Leu Gly Thr Pro Lys Cys Ala
Asn Ala Gln 225 230 235
240 agt gct tat ctt gag tgc atc aat tat gca gtc acc cag ttg
aat ttg 768Ser Ala Tyr Leu Glu Cys Ile Asn Tyr Ala Val Thr Gln Leu
Asn Leu 245 250
255 cca aac gtt gca atg tat ctt gat gct ggt cat gcc ggg tgg
ttg ggt 816Pro Asn Val Ala Met Tyr Leu Asp Ala Gly His Ala Gly Trp
Leu Gly 260 265 270
tgg cca gca aat ctg gat ccc gct gcg cag ctg ttt gca aat gtt
tac 864Trp Pro Ala Asn Leu Asp Pro Ala Ala Gln Leu Phe Ala Asn Val
Tyr 275 280 285
aaa aat gcc tca agt cct aga gcg ctg agg ggt ctt gca aca aat gtt
912Lys Asn Ala Ser Ser Pro Arg Ala Leu Arg Gly Leu Ala Thr Asn Val
290 295 300
gct aat tac aac gct tgg tca ata gcg agt ccc cca ccg tac aca agc
960Ala Asn Tyr Asn Ala Trp Ser Ile Ala Ser Pro Pro Pro Tyr Thr Ser
305 310 315 320
cct aac cca aac tac gat gag aag cat tac ata gaa gca ttt gct cct
1008Pro Asn Pro Asn Tyr Asp Glu Lys His Tyr Ile Glu Ala Phe Ala Pro
325 330 335
ttg ctt cgt aac caa ggt ttt gat gca aag ttt atc gtc gat acc gga
1056Leu Leu Arg Asn Gln Gly Phe Asp Ala Lys Phe Ile Val Asp Thr Gly
340 345 350
aga aac ggc aag cag ccg aca ggg cag cta gaa tgg ggg cac tgg tgc
1104Arg Asn Gly Lys Gln Pro Thr Gly Gln Leu Glu Trp Gly His Trp Cys
355 360 365
aat gtc aag ggt acg ggt ttc ggt gtt aga ccc acg gct aac act ggg
1152Asn Val Lys Gly Thr Gly Phe Gly Val Arg Pro Thr Ala Asn Thr Gly
370 375 380
cat gag ttg gtt gat gca ttc gtt tgg gta aaa ccc gga gga gag tca
1200His Glu Leu Val Asp Ala Phe Val Trp Val Lys Pro Gly Gly Glu Ser
385 390 395 400
gat gga acg agt gat cct tct gct cca agg ttc gat tct cat tgc gca
1248Asp Gly Thr Ser Asp Pro Ser Ala Pro Arg Phe Asp Ser His Cys Ala
405 410 415
tta cca gat gct ttg cag cca gca cct caa gca gga gct tgg ttc caa
1296Leu Pro Asp Ala Leu Gln Pro Ala Pro Gln Ala Gly Ala Trp Phe Gln
420 425 430
gct tat ttt gta caa tta ctg act aac gcc aat cct agt ttt cta cat
1344Ala Tyr Phe Val Gln Leu Leu Thr Asn Ala Asn Pro Ser Phe Leu His
435 440 445
cac cat cac cac cat tag
1362His His His His His
450
26453PRTArtificial SequenceSynthetic Construct 26Ala Ser Cys Ser Ser Val
Trp Gly Gln Cys Gly Gly Gln Asn Trp Ser 1 5
10 15 Gly Pro Thr Cys Cys Ala Ser Gly Ser Thr Cys
Val Tyr Phe Asn Asp 20 25
30 Tyr Tyr Ser Gln Cys Leu Pro Gly Ala Ala Ser Ser Ser Ser Ser
Thr 35 40 45 Arg
Ala Ala Ser Thr Thr Ser Arg Val Ser Pro Thr Thr Ser Arg Ser 50
55 60 Ser Ser Ala Thr Pro Pro
Pro Gly Ser Thr Thr Thr Arg Val Pro Pro 65 70
75 80 Val Gly Ser Gly Thr Ala Thr Tyr Ser Gly Asn
Pro Phe Glu Gly Val 85 90
95 Gln Leu Trp Ala Asn Asn Tyr Tyr Arg Ser Glu Val His Thr Leu Ala
100 105 110 Ile Pro
Gln Ile Thr Asp Pro Ala Leu Arg Ala Ala Ala Ser Ala Ala 115
120 125 Ala Glu Val Pro Ser Phe Leu
Trp Leu Asp Thr Leu Asp Lys Thr Pro 130 135
140 Leu Met Glu Gln Thr Leu Ala Asp Ile Arg Thr Ala
Asn Lys Asn Gly 145 150 155
160 Gly Asn Tyr Ala Gly Gln Phe Val Val Tyr Asp Leu Pro Asp Arg Asp
165 170 175 Cys Ala Ala
Leu Ala Ser Asn Gly Glu Tyr Ser Ile Ala Asp Gly Gly 180
185 190 Val Ala Lys Tyr Lys Asn Tyr Ile
Asp Thr Ile Arg Gln Ile Val Val 195 200
205 Glu Tyr Ser Asp Ile Arg Thr Leu Leu Val Ile Glu Pro
Asp Ser Leu 210 215 220
Ala Asn Leu Val Thr Asn Leu Gly Thr Pro Lys Cys Ala Asn Ala Gln 225
230 235 240 Ser Ala Tyr Leu
Glu Cys Ile Asn Tyr Ala Val Thr Gln Leu Asn Leu 245
250 255 Pro Asn Val Ala Met Tyr Leu Asp Ala
Gly His Ala Gly Trp Leu Gly 260 265
270 Trp Pro Ala Asn Leu Asp Pro Ala Ala Gln Leu Phe Ala Asn
Val Tyr 275 280 285
Lys Asn Ala Ser Ser Pro Arg Ala Leu Arg Gly Leu Ala Thr Asn Val 290
295 300 Ala Asn Tyr Asn Ala
Trp Ser Ile Ala Ser Pro Pro Pro Tyr Thr Ser 305 310
315 320 Pro Asn Pro Asn Tyr Asp Glu Lys His Tyr
Ile Glu Ala Phe Ala Pro 325 330
335 Leu Leu Arg Asn Gln Gly Phe Asp Ala Lys Phe Ile Val Asp Thr
Gly 340 345 350 Arg
Asn Gly Lys Gln Pro Thr Gly Gln Leu Glu Trp Gly His Trp Cys 355
360 365 Asn Val Lys Gly Thr Gly
Phe Gly Val Arg Pro Thr Ala Asn Thr Gly 370 375
380 His Glu Leu Val Asp Ala Phe Val Trp Val Lys
Pro Gly Gly Glu Ser 385 390 395
400 Asp Gly Thr Ser Asp Pro Ser Ala Pro Arg Phe Asp Ser His Cys Ala
405 410 415 Leu Pro
Asp Ala Leu Gln Pro Ala Pro Gln Ala Gly Ala Trp Phe Gln 420
425 430 Ala Tyr Phe Val Gln Leu Leu
Thr Asn Ala Asn Pro Ser Phe Leu His 435 440
445 His His His His His 450
271362DNAArtificial SequenceCel6a engineered variant 3C6P 27gct agc tgc
tca agc gtc tgg ggc caa tgt ggt ggc cag aat tgg tcg 48Ala Ser Cys
Ser Ser Val Trp Gly Gln Cys Gly Gly Gln Asn Trp Ser 1
5 10 15 ggt ccg acc tgc
tgt gct tcc gga agc aca tgc gtc tac ttc aac gac 96Gly Pro Thr Cys
Cys Ala Ser Gly Ser Thr Cys Val Tyr Phe Asn Asp 20
25 30 tat tac tcc cag tgt
ctt ccc ggc gct gca agc tca agc tcg tcc acg 144Tyr Tyr Ser Gln Cys
Leu Pro Gly Ala Ala Ser Ser Ser Ser Ser Thr 35
40 45 cgc gcc gcg tcg acg act
tct cga gta tcc ccc aca aca tcc cgg tcg 192Arg Ala Ala Ser Thr Thr
Ser Arg Val Ser Pro Thr Thr Ser Arg Ser 50
55 60 agc tcc gcg acg cct cca
cct ggt tct act act acc aga gta cct cca 240Ser Ser Ala Thr Pro Pro
Pro Gly Ser Thr Thr Thr Arg Val Pro Pro 65 70
75 80 gtc gga tcg gga acc gct acg
tat tca ggt aac ccc ttt gaa ggt gtt 288Val Gly Ser Gly Thr Ala Thr
Tyr Ser Gly Asn Pro Phe Glu Gly Val 85
90 95 cag ctg tgg gct aat aac tat tat
aga tct gag gta cat aca ctg gcc 336Gln Leu Trp Ala Asn Asn Tyr Tyr
Arg Ser Glu Val His Thr Leu Ala 100
105 110 att ccg caa att aca gac ccc gcg
ttg cgt gcc gca gct agt gct gcg 384Ile Pro Gln Ile Thr Asp Pro Ala
Leu Arg Ala Ala Ala Ser Ala Ala 115 120
125 gct gag gtg cca agt ttt ttg tgg ctg
gat act ttg gac aaa acc ccc 432Ala Glu Val Pro Ser Phe Leu Trp Leu
Asp Thr Leu Asp Lys Thr Pro 130 135
140 tta atg gaa caa acg ttg gct gat ata cgt
act gcg aat aaa aac ggc 480Leu Met Glu Gln Thr Leu Ala Asp Ile Arg
Thr Ala Asn Lys Asn Gly 145 150
155 160 ggc aat tat gct gga caa ttt gtg gtt tat
gac ctg ccg gat aga gat 528Gly Asn Tyr Ala Gly Gln Phe Val Val Tyr
Asp Leu Pro Asp Arg Asp 165 170
175 tgt gct gca cta gcg agc aac ggg gag tac agc
att gcg gat ggc ggt 576Cys Ala Ala Leu Ala Ser Asn Gly Glu Tyr Ser
Ile Ala Asp Gly Gly 180 185
190 gtc gca aag tac aaa aac tat ata gat act atc agg
caa ata gtt gtc 624Val Ala Lys Tyr Lys Asn Tyr Ile Asp Thr Ile Arg
Gln Ile Val Val 195 200
205 gaa tac agt gat att cgt acg ctg ctt gta atc gaa
ccc gat tcc tta 672Glu Tyr Ser Asp Ile Arg Thr Leu Leu Val Ile Glu
Pro Asp Ser Leu 210 215 220
gcg aac ttg gtg aca aat cta ggt act ccg aag tgt gcg
aac gcg cag 720Ala Asn Leu Val Thr Asn Leu Gly Thr Pro Lys Cys Ala
Asn Ala Gln 225 230 235
240 agt gct tat ctt gag tgc atc aat tat gca gtc acc cag ttg
aat ttg 768Ser Ala Tyr Leu Glu Cys Ile Asn Tyr Ala Val Thr Gln Leu
Asn Leu 245 250
255 cca aac gtt gca atg tat ctt gat gct ggt cat gcc ggg tgg
ttg ggt 816Pro Asn Val Ala Met Tyr Leu Asp Ala Gly His Ala Gly Trp
Leu Gly 260 265 270
tgg cca gca aat ctg gat ccc gct gcg cag ctg ttt gca aat gtt
tac 864Trp Pro Ala Asn Leu Asp Pro Ala Ala Gln Leu Phe Ala Asn Val
Tyr 275 280 285
aaa aat gcc tca agt cct aga gcg ctg agg ggt ctt gca aca aat gtt
912Lys Asn Ala Ser Ser Pro Arg Ala Leu Arg Gly Leu Ala Thr Asn Val
290 295 300
gct aat tac aac gct tgg tca ata gcg agt ccc cca ccg tac aca agc
960Ala Asn Tyr Asn Ala Trp Ser Ile Ala Ser Pro Pro Pro Tyr Thr Ser
305 310 315 320
cct aac cca aac tac gat gag aag cat tac ata gaa gca ttt gct cct
1008Pro Asn Pro Asn Tyr Asp Glu Lys His Tyr Ile Glu Ala Phe Ala Pro
325 330 335
ttg ctt cgt aac caa ggt ttt gat gca aag ttt atc gtc gat acc gga
1056Leu Leu Arg Asn Gln Gly Phe Asp Ala Lys Phe Ile Val Asp Thr Gly
340 345 350
aga aac ggc aag cag ccg aca ggg cag cta gaa tgg ggg cac tgg tgc
1104Arg Asn Gly Lys Gln Pro Thr Gly Gln Leu Glu Trp Gly His Trp Cys
355 360 365
aat gtc aag ggt acg ggt ttc ggt gtt aga ccc acg gct aac act ggg
1152Asn Val Lys Gly Thr Gly Phe Gly Val Arg Pro Thr Ala Asn Thr Gly
370 375 380
cat gag ttg gtt gat gca ttc gtt tgg gta aaa ccc gga gga gag tca
1200His Glu Leu Val Asp Ala Phe Val Trp Val Lys Pro Gly Gly Glu Ser
385 390 395 400
gat gga acg agt gat cct tct gct cca agg ttc gat cct cat tgc gca
1248Asp Gly Thr Ser Asp Pro Ser Ala Pro Arg Phe Asp Pro His Cys Ala
405 410 415
tta cca gat gct ttg cag cca gca cct caa gca gga gct tgg ttc caa
1296Leu Pro Asp Ala Leu Gln Pro Ala Pro Gln Ala Gly Ala Trp Phe Gln
420 425 430
gct tat ttt gta caa tta ctg act aac gcc aat cct agt ttt cta cat
1344Ala Tyr Phe Val Gln Leu Leu Thr Asn Ala Asn Pro Ser Phe Leu His
435 440 445
cac cat cac cac cat tag
1362His His His His His
450
28453PRTArtificial SequenceSynthetic Construct 28Ala Ser Cys Ser Ser Val
Trp Gly Gln Cys Gly Gly Gln Asn Trp Ser 1 5
10 15 Gly Pro Thr Cys Cys Ala Ser Gly Ser Thr Cys
Val Tyr Phe Asn Asp 20 25
30 Tyr Tyr Ser Gln Cys Leu Pro Gly Ala Ala Ser Ser Ser Ser Ser
Thr 35 40 45 Arg
Ala Ala Ser Thr Thr Ser Arg Val Ser Pro Thr Thr Ser Arg Ser 50
55 60 Ser Ser Ala Thr Pro Pro
Pro Gly Ser Thr Thr Thr Arg Val Pro Pro 65 70
75 80 Val Gly Ser Gly Thr Ala Thr Tyr Ser Gly Asn
Pro Phe Glu Gly Val 85 90
95 Gln Leu Trp Ala Asn Asn Tyr Tyr Arg Ser Glu Val His Thr Leu Ala
100 105 110 Ile Pro
Gln Ile Thr Asp Pro Ala Leu Arg Ala Ala Ala Ser Ala Ala 115
120 125 Ala Glu Val Pro Ser Phe Leu
Trp Leu Asp Thr Leu Asp Lys Thr Pro 130 135
140 Leu Met Glu Gln Thr Leu Ala Asp Ile Arg Thr Ala
Asn Lys Asn Gly 145 150 155
160 Gly Asn Tyr Ala Gly Gln Phe Val Val Tyr Asp Leu Pro Asp Arg Asp
165 170 175 Cys Ala Ala
Leu Ala Ser Asn Gly Glu Tyr Ser Ile Ala Asp Gly Gly 180
185 190 Val Ala Lys Tyr Lys Asn Tyr Ile
Asp Thr Ile Arg Gln Ile Val Val 195 200
205 Glu Tyr Ser Asp Ile Arg Thr Leu Leu Val Ile Glu Pro
Asp Ser Leu 210 215 220
Ala Asn Leu Val Thr Asn Leu Gly Thr Pro Lys Cys Ala Asn Ala Gln 225
230 235 240 Ser Ala Tyr Leu
Glu Cys Ile Asn Tyr Ala Val Thr Gln Leu Asn Leu 245
250 255 Pro Asn Val Ala Met Tyr Leu Asp Ala
Gly His Ala Gly Trp Leu Gly 260 265
270 Trp Pro Ala Asn Leu Asp Pro Ala Ala Gln Leu Phe Ala Asn
Val Tyr 275 280 285
Lys Asn Ala Ser Ser Pro Arg Ala Leu Arg Gly Leu Ala Thr Asn Val 290
295 300 Ala Asn Tyr Asn Ala
Trp Ser Ile Ala Ser Pro Pro Pro Tyr Thr Ser 305 310
315 320 Pro Asn Pro Asn Tyr Asp Glu Lys His Tyr
Ile Glu Ala Phe Ala Pro 325 330
335 Leu Leu Arg Asn Gln Gly Phe Asp Ala Lys Phe Ile Val Asp Thr
Gly 340 345 350 Arg
Asn Gly Lys Gln Pro Thr Gly Gln Leu Glu Trp Gly His Trp Cys 355
360 365 Asn Val Lys Gly Thr Gly
Phe Gly Val Arg Pro Thr Ala Asn Thr Gly 370 375
380 His Glu Leu Val Asp Ala Phe Val Trp Val Lys
Pro Gly Gly Glu Ser 385 390 395
400 Asp Gly Thr Ser Asp Pro Ser Ala Pro Arg Phe Asp Pro His Cys Ala
405 410 415 Leu Pro
Asp Ala Leu Gln Pro Ala Pro Gln Ala Gly Ala Trp Phe Gln 420
425 430 Ala Tyr Phe Val Gln Leu Leu
Thr Asn Ala Asn Pro Ser Phe Leu His 435 440
445 His His His His His 450
2933DNAArtificial SequenceOligonucleotide Primer 29cgggttattg tttataaata
ctactattgc cag 333025DNAArtificial
SequenceOligonucleotide Primer 30gacatgggag atcgaattca actcc
253132DNAArtificial SequenceOligonucleotide
Primer 31gcacatgcgt ctacttcaac gactattact cc
323232DNAArtificial SequenceOligonucleotide Primer 32ggagtaatag
tcgttgaagt agacgcatgt gc
323332DNAArtificial SequenceOligonucleotide Primer 33gcacatgcgt
ctactccaac gactattact cc
323432DNAArtificial SequenceOligonucleotide Primer 34ggagtaatag
tcgttggagt agacgcatgt gc
323547DNAArtificial SequenceOligonucleotide Primer 35gcagctagtg
ctgcggctga ggtgccaagt tttatgtggc tggatac
473647DNAArtificial SequenceOligonucleotide Primer 36gtatccagcc
acataaaact tggcacctca gccgcagcac tagctgc
473747DNAArtificial SequenceOligonucleotide Primer 37gcagctagtg
ctgtggctga ggagccaagt tttatgtggc tggatac
473847DNAArtificial SequenceOligonucleotide Primer 38gtatccagcc
acataaaact tggctcctca gccacagcac tagctgc
473947DNAArtificial SequenceOligonucleotide Primer 39gcagctagtg
ctgtggctga ggtgccaagt tttttgtggc tggatac
474047DNAArtificial SequenceOligonucleotide Primer 40gtatccagcc
acaaaaaact tggcacctca gccacagcac tagctgc
474147DNAArtificial SequenceOligonucleotide Primer 41gcagctagtg
ctgcggctga ggagccaagt tttatgtggc tggatac
474247DNAArtificial SequenceOligonucleotide Primer 42gtatccagcc
acataaaact tggctcctca gccgcagcac tagctgc
474347DNAArtificial SequenceOligonucleotide Primer 43gcagctagtg
ctgcggctga ggtgccaagt tttttgtggc tggatac
474447DNAArtificial SequenceOligonucleotide Primer 44gtatccagcc
acaaaaaact tggcacctca gccgcagcac tagctgc
474547DNAArtificial SequenceOligonucleotide Primer 45gcagctagtg
ctgtggctga ggagccaagt tttttgtggc tggatac
474647DNAArtificial SequenceOligonucleotide Primer 46gtatccagcc
acaaaaaact tggctcctca gccacagcac tagctgc
474747DNAArtificial SequenceOligonucleotide Primer 47gcagctagtg
ctgcggctga ggagccaagt tttttgtggc tggatac
474847DNAArtificial SequenceOligonucleotide Primer 48gtatccagcc
acaaaaaact tggctcctca gccgcagcac tagctgc
474947DNAArtificial SequenceOligonucleotide Primer 49gcagctagtg
ctgtggctga ggtgccaagt tttatgtggc tggatac
475047DNAArtificial SequenceOligonucleotide Primer 50gtatccagcc
acataaaact tggcacctca gccacagcac tagctgc
475128DNAArtificial SequenceOligonucleotide Primer 51caaaaatgcc
tcaagaccta gagcgctg
285228DNAArtificial SequenceOligonucleotide Primer 52cagcgctcta
ggtcttgagg catttttg
285328DNAArtificial SequenceOligonucleotide Primer 53caaaaatgcc
tcaagtccta gagcgctg
285428DNAArtificial SequenceOligonucleotide Primer 54cagcgctcta
ggacttgagg catttttg
285529DNAArtificial SequenceOligonucleotide Primer 55gatggaacga
gtgatccttc tgctccaag
295629DNAArtificial SequenceOligonucleotide Primer 56cttggagcag
aaggatcact cgttccatc
295729DNAArtificial SequenceOligonucleotide Primer 57gatggaacga
gtgattcttc tgctccaag
295829DNAArtificial SequenceOligonucleotide Primer 58cttggagcag
aagaatcact cgttccatc
295935DNAArtificial SequenceOligonucleotide Primer 59ggccaatgtg
gtggccagnn ktggtcgggt ccgac
356018DNAArtificial SequenceOligonucleotide Primer 60ctggccacca cattggcc
186143DNAArtificial
SequenceOligonucleotide Primer 61ccggaagcac atgcgtctac nnkaacgact
attactccca gtg 436220DNAArtificial
SequenceOligonucleotide Primer 62gtagacgcat gtgcttccgg
206335DNAArtificial SequenceOligonucleotide
Primer 63cgtgccgcag ctagtgctnn kgctgaggtg ccaag
356418DNAArtificial SequenceOligonucleotide Primer 64agcactagct
gcggcacg
186542DNAArtificial SequenceOligonucleotide Primer 65gcagctagtg
ctgtggctga gnnkccaagt tttatgtggc tg
426621DNAArtificial SequenceOligonucleotide Primer 66ctcagccaca
gcactagctg c
216740DNAArtificial SequenceOligonucleotide Primer 67gtggctgagg
tgccaagttt tnnktggctg gatactttgg
406821DNAArtificial SequenceOligonucleotide Primer 68aaaacttggc
acctcagcca c
216937DNAArtificial SequenceOligonucleotide Primer 69gttgggttgg
ccagcaaatn nkgatcccgc tgcgcag
377019DNAArtificial SequenceOligonucleotide Primer 70atttgctggc caacccaac
197142DNAArtificial
SequenceOligonucleotide Primer 71gcaaatgttt acaaaaatgc ctcannkcct
agagcgctga gg 427224DNAArtificial
SequenceOligonucleotide Primer 72tgaggcattt ttgtaaacat ttgc
247343DNAArtificial SequenceOligonucleotide
Primer 73cttggtcaat agcgagtcct ccannktaca caagccctaa ccc
437422DNAArtificial SequenceOligonucleotide Primer 74ggaggactcg
ctattgacca ag
227543DNAArtificial SequenceOligonucleotide Primer 75ggagagtcag
atggaacgag tgatnnktct gctccaaggt tcg
437624DNAArtificial SequenceOligonucleotide Primer 76atcactcgtt
ccatctgact ctcc
247743DNAArtificial SequenceOligonucleotide Primer 77gattcttctg
ctccaaggtt cgatnnkcat tgcgcattac cag
437824DNAArtificial SequenceOligonucleotide Primer 78atcgaacctt
ggagcagaag aatc
247946DNAArtificial SequenceOligonucleotide Primer 79ctttgaaggt
gttcagctgt atgctaataa ctattataga tctgag
468046DNAArtificial SequenceOligonucleotide Primer 80ctcagatcta
taatagttat tagcatacag ctgaacacct tcaaag
468141DNAArtificial SequenceOligonucleotide Primer 81cagctgtggg
ctaatccata ttatagatct gaggtacata c
418241DNAArtificial SequenceOligonucleotide Primer 82gtatgtacct
cagatctata atatggatta gcccacagct g
418328DNAArtificial SequenceOligonucleotide Primer 83gaccccgcgt
tggctgccgc agctagtg
288428DNAArtificial SequenceOligonucleotide Primer 84cactagctgc
ggcagccaac gcggggtc
288528DNAArtificial SequenceOligonucleotide Primer 85gcgttgcgtg
ccaaagctag tgctgcgg
288628DNAArtificial SequenceOligonucleotide Primer 86ccgcagcact
agctttggca cgcaacgc
288732DNAArtificial SequenceOligonucleotide Primer 87gacaaaaccc
ccttattgga acaaacgttg gc
328832DNAArtificial SequenceOligonucleotide Primer 88gccaacgttt
gttccaataa gggggttttg tc
328936DNAArtificial SequenceOligonucleotide Primer 89caaacgttgg
ctgatgctcg tactgcgaat aaaaac
369036DNAArtificial SequenceOligonucleotide Primer 90gtttttattc
gcagtacgag catcagccaa cgtttg
369129DNAArtificial SequenceOligonucleotide Primer 91gagcaacggg
gagttgagca ttgcggatg
299229DNAArtificial SequenceOligonucleotide Primer 92catccgcaat
gctcaactcc ccgttgctc
299338DNAArtificial SequenceOligonucleotide Primer 93cagagtgctt
atcttgaggg tatcaattat gcagtcac
389438DNAArtificial SequenceOligonucleotide Primer 94gtgactgcat
aattgatacc ctcaagataa gcactctg
389534DNAArtificial SequenceOligonucleotide Primer 95gtgcatcaat
tatgcattga cccagttgaa tttg
349634DNAArtificial SequenceOligonucleotide Primer 96caaattcaac
tgggtcaatg cataattgat gcac
349733DNAArtificial SequenceOligonucleotide Primer 97gtttacaaaa
atgccggtag tcctagagcg ctg
339833DNAArtificial SequenceOligonucleotide Primer 98cagcgctcta
ggactaccgg catttttgta aac
339933DNAArtificial SequenceOligonucleotide Primer 99ctcaagtcct
agagcggtta ggggtcttgc aac
3310033DNAArtificial SequenceOligonucleotide Primer 100gttgcaagac
ccctaaccgc tctaggactt gag
3310134DNAArtificial SequenceOligonucleotide Primer 101ccaccgtaca
caagctggaa cccaaactac gatg
3410234DNAArtificial SequenceOligonucleotide Primer 102catcgtagtt
tgggttccag cttgtgtacg gtgg
3410333DNAArtificial SequenceOligonucleotide Primer 103gcattacata
gaagcattgg ctcctttgct tcg
3310433DNAArtificial SequenceOligonucleotide Primer 104cgaagcaaag
gagccaatgc ttctatgtaa tgc
3310534DNAArtificial SequenceOligonucleotide Primer 105gaaacggcaa
gcagggtaca gggcagctag aatg
3410634DNAArtificial SequenceOligonucleotide Primer 106cattctagct
gccctgtacc ctgcttgccg tttc
3410730DNAArtificial SequenceOligonucleotide Primer 107caagcagccg
acaagacagc tagaatgggg
3010830DNAArtificial SequenceOligonucleotide Primer 108ccccattcta
gctgtcttgt cggctgcttg
3010928DNAArtificial SequenceOligonucleotide Primer 109cagccgacag
ggagactaga atgggggc
2811028DNAArtificial SequenceOligonucleotide Primer 110gcccccattc
tagtctccct gtcggctg
2811133DNAArtificial SequenceOligonucleotide Primer 111gcaatgtcaa
gggtgctggt ttcggtgtta gac
3311233DNAArtificial SequenceOligonucleotide Primer 112gtctaacacc
gaaaccagca cccttgacat tgc 33
User Contributions:
Comment about this patent or add new information about this topic: