Patents - stay tuned to the technology

Inventors list

Assignees list

Classification tree browser

Top 100 Inventors

Top 100 Assignees

Patent application title: PORCINE PSEUDORABIES VIRUS, VACCINE COMPOSITION AND PREPARATION METHOD AND USE THEREOF

Inventors:  Xuke Zhang (Luoyang, CN)  Jinzhong Sun (Luoyang, CN)  Rui Wu (Luoyang, CN)  Feifei Tan (Luoyang, CN)  Chaoyang Bai (Luoyang, CN)  Kegong Tian (Luoyang, CN)
Assignees:  PULIKE BIOLOGICAL ENGINEERING, INC.
IPC8 Class: AC07K14005FI
USPC Class: 4242241
Class name: Antigen, epitope, or other immunospecific immunoeffector (e.g., immunospecific vaccine, immunospecific stimulator of cell-mediated immunity, immunospecific tolerogen, immunospecific immunosuppressor, etc.) virus or component thereof rhabdoviridae (e.g., rabies virus, vesicular stomatitis virus, etc.)
Publication date: 2016-05-19
Patent application number: 20160137700



Abstract:

Provided in embodiments of the present invention is a vaccine composition including an immune amount of attenuated live vaccine, inactivated vaccine, subunit vaccine, synthetic peptide vaccine, or genetically engineered vaccine of the porcine pseudorabies virus strain. The vaccine composition can effectively induce antibody generation, and prevent infections of virulent strains of the porcine pseudorabies virus, and provides effective protection for pigs.

Claims:

1-14. (canceled)

15. A nucleotide sequence substantially encoding the protein as shown in SEQ ID NO. 1 of the sequence listing.

16. A nucleotide sequence substantially encoding the protein as shown in SEQ ID NO.2 of the sequence listing.

17. A nucleotide sequence substantially encoding the protein as shown in SEQ ID NO. 3 of the sequence listing.

18. A porcine pseudorabies virus strain comprising gD glycoprotein encoded by the nucleotide sequence as shown in SEQ ID NO.4 of the sequence listing.

19. The pseudorabies virus strain as described in claim 18, wherein said pseudorabies virus strain comprises gB glycoprotein encoded by the nucleotide sequence shown in SEQ ID NO.5 of the sequence listing.

20. The pseudorabies virus strain as described in claim 19, wherein said pseudorabies virus strain is the HN1201 strain or culture thereof, of which the accession number is CCTCC NO. V 201311; said HN1201 strain was deposited in the China Center for Type Culture Collection (CCTCC) on May 20, 2013, of which the address is Wuhan University, Wuhan City, Hubei Province.

21. A vaccine composition, comprising an immune amount of attenuated live vaccine, inactivated vaccine, subunit vaccine, synthetic peptide vaccine, or genetically engineered vaccine of the porcine pseudorabies virus strain as described in claim 18.

22. The vaccine composition as described in claim 21, wherein said vaccine composition comprising an immune amount of attenuated live vaccine, inactivated vaccine, subunit vaccine, synthetic peptide vaccine, or genetically engineered vaccine of said PRV HN1201 strain or culture thereof.

23. The vaccine composition as described in claim 22, wherein said vaccine composition comprises an inactivated vaccine of the PRV HN1201 strain or culture thereof, of which the concentration is not less than 10.sup.6.0 TCID50/ml.

24. The vaccine composition as described in claim 22, wherein said vaccine composition comprises 25.about.100 μg/dose gD protein antigen of the PRV HN1201 strain or culture thereof.

25. The vaccine composition as described in claim 21, wherein said vaccine composition further comprises medium, adjuvants and excipient.

26. A method for preparing said vaccine composition as described in claim 22, comprising the steps: the PRV HN1201 strain is amplified and cultured, inactivated, and then added with adjuvants and mixed thoroughly.

27. A method for preparing said vaccine composition as described in claim 22, comprising the steps: (1) cloning said PRV recombinant gD gene; (2) expressing said PRV recombinant gD protein; and (3) mixing said PRV gD protein antigen with adjuvants based on certain ratio and emulsifying the resulting mixture.

Description:

FIELD OF THE INVENTION

[0001] This invention relates to a vaccine composition, belonging to the field of animal virology.

BACKGROUND

[0002] Pseudorabies, also called Aujeszky's disease, is an acute infectious disease caused by Suid herpesvirus 1 (SuHV1) belonging to the Alphaherpesvirinae subfamily for many kinds of livestock such as swine, cattle and sheep, as well as poultry and wild animals, with the main symptoms of fever, intense itching (except swine) and encephalomyelitis. Pseudorabies in swine is found nationwide in China causing severe damages, and is one of the major diseases limiting the large-scale production of pig farms. Infection can result in abortion, stillborn or mummified fetuses in pregnant sows, and neurological signs, paralysis and a high death rate in piglets. Pseudorabies virus (PRV) with strong pantropic properties, neurotropic properties and latent infectivity, may establish long-term latent infection in the peripheral nervous system, and then the latently infected host starts to get sick when the latent virus is activated into the infectious virus.

[0003] It has been indicated by many researches that a corresponding protection can be provided for the vaccinated animals by a subunit vaccine, which is a vaccine prepared by cloning the protective antigen genes of pathogen into prokaryote and eukaryote expression systems with methods of genetic engineering so as to highly express those genes. It has been found so far that either of glycoprotein B, C and D (gB, gC and gD) in the PRV glycoproteins can make the body generate neutralizing antibodies, which have the ability to neutralize PRV, no matter in vivo or in vitro, or no matter with the presence or absence of complements. The article, Progress in Subunit Vaccine against Pseudorabies Virus Development (Chenghuai Yang, Gaoming Lou, Nanhui Chen, Jiangxi Journal of Animal Husbandry & Veterinary Medicine 2004 Issue 3) has disclosed that either of gB, gC and gD among 11 PRV glycoproteins which have been found so far, can induce the body to generate neutralizing antibodies. In the absence of complements, monoclonal antibodies directed against gB, gC and gD can neutralize PRV. The swine and mice injected with monoclonal antibodies directed against gB, gC and gD can resist attacks by virulent PRV strains. Therefore gB, gC and gD are the most preferred proteins for developing PRV subunit vaccine. The glycoprotein, gD, is an important neutralizing antigen as well as the main target for protective antibodies, and it can induce better protective response. As disclosed by U.S. Pat. No. 6,858,385 and U.S. Pat. No. 6,521,231, vaccine for preventing pseudorabies can be prepared by use of gD of porcine pseudorabies virus.

[0004] The porcine PRV has only one serotype, thus usually the cross-protection immunity between strains of porcine PRV is considered to be very strong. However, piglets may still suffer from typical porcine pseudorabies after their injection with commercial vaccines, with symptoms such as long-term high fever, depression, loss of appetite, respiratory and/or neurological signs. The significant manifestations include that infection among swine at any ages, horizontal transmission among swine herds, short incubation period (1˜2 days), morbidity rates between 10%˜100%, mortality rate in pigs between 10%˜100% (mortality rate in piglets can reach up to 100%), high fever in pigs after being infected (40° C.˜42° C., lasting for more than 3 days), dyspnea, diarrhea, wheezing, coughing, sneezing, hind limb paralysis, dog sitting, suddenly falling down, convulsions, lying on their sides, opisthotonus, making strokes with their arms, and finally dying of exhaustion, and the infection also can cause reproductive disorder symptoms such as declined semen quality of boar, as well as abortion of pregnant sow (the abortion rate can reach up to 35%), premature birth, stillbirth, weakened piglets (weakened piglets die by 14 days of age), etc. By means of prior art, vaccinated pigs cannot completely resist attacks by the wild virus, and still have symptoms like high fever, depression, partially or completely loss of appetite, with a infection rate of more than 30% and a mortality rate between 10% and 20%. There are no vaccines in the prior art capable of solving the pseudorabies caused by variant strains of porcine pseudorabies virus.

SUMMARY OF INVENTION

[0005] In order to solve the deficiency of the prior art, the present invention aims to provide a porcine pseudorabies virus strain for preparing vaccines, which have been proved by animal testing to provide a good immune function for porcine pseudorabies.

[0006] The present invention provides a nucleotide sequence substantially encoding the protein as shown in SEQ ID NO. 1 of the sequence listing.

[0007] The present invention provides a nucleotide sequence substantially encoding the protein as shown in SEQ ID NO.2 of the sequence listing.

[0008] The present invention provides a nucleotide sequence substantially encoding the protein as shown in SEQ ID NO. 3 of the sequence listing.

[0009] The "encoding sequence" in the present invention refers to a deoxyribonucleic acid (DNA) sequence, which can be transcribed into a corresponding RNA sequence.

[0010] To solve the deficiency of the prior art, the main aim of present invention is to provide a porcine pseudorabies virus strain comprising gD glycoprotein encoded by the nucleotide sequence as shown in SEQ ID NO.4 of the sequence listing.

[0011] The term "gD glycoprotein" in the present invention refers to a structural protein required for infection of PRV, which is one of the major glycoproteins in the surface of envelope of mature virus particles, also called gp50 protein.

[0012] The term "homology" in the present invention refers to the level of similarity between two amino acid sequences or two nucleotide sequences. The homology between amino acid sequences or nucleotide sequences can be calculated by any appropriate methods well known in the art, for example, the target amino acid (or nucleotide) sequence and the reference amino acid (or nucleotide) sequence is aligned, and gaps can be induced if necessary to optimize the number of the identical amino acids (or nucleotides) between two aligned sequences, and the percentage of the identical amino acids (or nucleotides) between two aligned sequences can be calculated accordingly. Alignment of amino acid (or nucleotide) sequences and calculation of homology can be achieved by software well kwon in the art. Examples of such software include, but is not limited to, BLAST (which can be accessed through the website of the National Center for Biotechnology Information, NCBI, http://blast.ncbi.nlm.nih.gov/Blast.cgi or can be found in Altschul S. F. et al, J. Mol. Biol, 215:403-410 (1990); Stephen F. et al, Nucleic Acids Res., 25:3389-3402(1997)), ClustalW2 (which can be accessed through the website of the European Bioinformatics Institute, EBI, http://www.eji.ac.uk/Toolsa/clustalw2/, or can be found in Higgins D. G. et al, Methods in Enzymology, 266:383-402(1996); Larkin M. A. et al, Bioinformatics (Oxford, England), 23(21):2947-8(2007)), and TCoffee (which can be accessed through the website of the Sweden Institute of Bioinformatics, SIB, http://tcoffee.vital-it.ch/cgi-bin/Tcoffe_cgi/index.cgi, or can be found in, Poirot O. et. al, Nucleic Acids Res., 31(13):3503-6(2003); Notredame C. et al, J. Mol. Boil, 302(1):205-17(2000)) etc. It is all within the knowledge scope of a person skilled in the art that when using the software to do sequence alignment, he can use the default parameters provided by the software or adjust the parameters provided by the software according to the actual condition.

[0013] Preferably, said PRV strain comprises the gB glycoprotein encoded by the nucleotide sequence shown in SEQ ID NO.5 of the sequence listing.

[0014] Preferably, said PRV comprises the gB glycoprotein encoded by the amino acid sequence as shown in SEQ ID NO.2 of the sequence listing.

[0015] Preferably, said PRV according to the invention comprises the gC glycoprotein encoded by the amino acid sequence as shown in SEQ ID NO.3 of the sequence listing.

[0016] Preferably, said PRV strain is HN1201 strain (pseudorabies virus, strain HN1201), or culture thereof, of which the accession number is CCTCC NO. V 201311; the HN1201 strain was deposited in the China Center for Type Culture Collection (CCTCC) on May 20, 2013, of which the address is Wuhan University, Wuhan City, Hubei Province.

[0017] The term "culture" refers to cultures of different passages of the virus, known to those skilled in the art, which may only have minute variations from one passage to another. Preferably said culture is a culture within 5˜35 passages.

[0018] Another aim of the invention is to provide a vaccine composition comprising an immune amount of attenuated live vaccine, inactivated vaccine, subunit vaccine, synthetic vaccine, or genetically engineered vaccine of the porcine pseudorabies virus strain.

[0019] Preferably the vaccine composition comprises an immune amount of attenuated live vaccine, inactivated vaccine, subunit vaccine, synthetic peptide vaccine, or genetically engineered vaccine of the said PRV HN1201 strain or culture thereof.

[0020] Preferably the vaccine composition according to the present invention comprises said PRV or antigen thereof as an active component. The PRV in the vaccine composition comprises gD glycoprotein represented by the amino acid sequence of SEQ ID NO. 1 or the amino acid sequence which shares at least 98% homology to the sequence of SEQ ID NO. 1.

[0021] Preferably the PRV in said vaccine composition is the HN1201 strain or culture thereof.

[0022] The antigen used in the invention is the antigen ingredients in the components of virus, which induces the immune response, and comprises the amino acid sequence of SEQ ID NO. 1.

[0023] Optionally, the antigen may comprise gB protein with the amino acid sequence of SEQ ID NO. 2 or the one of which the fragment shares at least 95% homology to the sequence of SEQ ID NO. 2.

[0024] Optionally, the antigen may comprise gC protein with the amino acid sequence of SEQ ID NO.3 or the one of which the fragment shares at least 95% homology to the sequence of SEQ ID NO. 3.

[0025] As used herein, the term "live vaccines" refer to vaccines prepared by viruses which still can reproduce in the host or on the cells and in the meanwhile their virulence has been weakened. As used herein, the term "attenuated" refers to artificially reducing the virulence of pathogens via mutation of gene by preparing pathogens which are deprived of pathogenicity but maintain immunogenicity. Generally attenuation can be achieved by UV irradiation, chemical processing or continuous high-order subculturing in vitro. Artificial alteration of gene attenuates the virulence via, for example, the deletion of some specific nucleotides in the given sequence.

[0026] As used herein, the term "inactivated vaccine", also called non-living vaccine, refers to suspension of inactivated virus used as an antigen for producing immunity. Examples of inactivated vaccines include whole virus vaccines and split virus vaccines. By using known methods it is easy to produce inactivated vaccines. For instance, one can obtain inactivated whole virus vaccines by treatment with formaldehyde solution. Split virus vaccines can be prepared with virus envelopes after treatment with ether.

[0027] The term "subunit vaccine" refers to a vaccine prepared via highly effectively expression of protective antigen gene of a pathogen by cloning it into a prokaryotic or eukaryotic expression system. A subunit vaccine has less risk of adverse reactions than a whole virus vaccine. For example, the expressed gD protein or gC protein of PRV can be used for preparing subunit vaccines.

[0028] The term "synthetic peptide vaccine" refers to a small peptide only comprising the component of immunogenic determinants, i.e. a vaccine prepared by synthesizing a protective short peptide according to the amino acid sequence of natural proteins, and adding in an adjuvant after connecting them to a carrier.

[0029] Preferably, said vaccine composition in the invention comprises an inactivated vaccine of the PRV HN1201 strain or culture thereof, of which the content is not less than 106.0 TCID50/ml.

[0030] Preferably, said vaccine composition in the present invention may comprise 106.0 TCID50/ml PRV per pig. The vaccine cannot effectively trigger the generation of antibodies when the amount of said PRV used is less than 106.0 TCID50. On the other hand the excessive amount may not be economical.

[0031] Preferably, said vaccine composition comprises 25˜100 μg/dose of gD protein antigen of the PRV HN1201 strain or culture thereof.

[0032] In addition, said pseudorabies vaccine in the present invention can be used conjunctly with other inactivated pathogens or antigen to prepare combined vaccines or complex vacancies against various diseases including pseudorabies. As used herein, the term "combined vaccine" refers to a vaccine prepared with the virus mixture by mixing the pseudorabies virus in the present invention with at least one different virus. The term "complex vaccine" refers to a vaccine prepared from viruses and bacterium. For example, the pseudorabies virus in the present invention can be mixed or combined with classical swine fever virus, porcine reproductive and respiratory syndrome virus, porcine circovirus and/or haemophilus parasuis and mycoplasma.

[0033] Preferably, said vaccine composition further comprises medium, adjuvants and excipients.

[0034] Said vaccine composition according to the present invention also may comprise medium, adjuvants and/or excipients. Physiological saline or distilled water can be used as medium. Examples of adjuvants used in the vaccine composition include Freund's incomplete adjuvant or Freund's complete adjuvant, aluminum hydroxide gel, vegetable oil or mineral oil etc. Examples of excipients include, but are not limited to, aluminum phosphate, aluminum hydroxide and potassium aluminum sulfate. In practice, all substances for preparing vaccines, known to those skilled in the art, can be adapted to the vaccine composition in the present invention.

[0035] One more aim of the present invention is to provide a method for preparing said vaccine composition comprising the steps: the PRV HN1201 strain is amplified and cultured, inactivated, and then added with adjuvants and mixed thoroughly.

[0036] Specifically, the method comprises the steps: (1) inoculating the PRV vaccine strains into respective susceptible cells, and cultivating the inoculated susceptible cells; and then harvesting cell culture; and (2) treating the viruses obtained from step (1) with formaldehyde solution, BPL (β-beta-Propiolactone) or BEI (binary ethylenimine).

[0037] The susceptible cells can be continuous cell lines or primary cell lines. The susceptible cells adapted to PRV culture include but are not limited to continuous cell lines such as ST cell line (ATCC CRL-1746), PK-15 cell line (ATCC CCL-33), African green monkey kidney Marc-145 cell line (ATCC CRL-12219), Madin-Darby bovine kidney MDBK cell line (ATCC CCL-22), bovine testicle BT continuous cell line (ATCC CRL-1390), Vero cell line (ATCC CCL-81), BHK-21 cell line (ATCC CCL-10), pig kidney continuous cell line (such as IBRS-2, refer to e.g. DECASTRO, M. P. 1964. Behavior of foot and mouth disease virus in cell culture: susceptibility of the IB-RS-2 swine cell line. Arquivos Instituto Biologica 31:63-78), rabbit kidney continuous cell line (RK, e.g. ATCC CCL-106) etc., and primary cell lines such as chicken embryo fibroblasts and porcine kidney cells etc. The primary cells can be isolated and prepared from tissues of animals via methods well known in the art.

[0038] The vaccine composition according to the present invention can be prepared into oral dosage forms or non-oral dosage forms. Non-oral dosage forms are preferred which can be administrated via intradermal route, intramuscular route, intraperitoneal route, intravenous route, subcutaneous route, intranasal route or epidural route.

[0039] Another aim of the invention is to provide a method for preparing the vaccine composition, comprising the steps: (1) cloning said PRV recombinant gD gene; (2) expressing said PRV recombinant gD protein; and (3) mixing said PRV gD protein antigen with adjuvants based on certain ratio and emulsifying the resulting mixture.

[0040] A further aim of the invention is to provide a use of said vaccine composition for preparing medicine for treatment and prevention of diseases relating to PRV.

[0041] As used herein, the term "diseases relating to PRV" can further refer to diseases caused by infection of PRV. Examples includes but are not limited to, obvious neurological signs, lethargy, crying, vomiting diarrhea and fever in infected piglets, and abortion, mummified or stillborn fetuses or reproductive disorder in infected pregnant sows.

[0042] As used herein, the term "diseases relating to PRV" can further refer to diseases with significant manifestations including but not limited to infection among swine at any ages, horizontal transmission among swine herds, short incubation period (1˜2 days), morbidity rates between 10%˜100%, mortality rate in pigs between 10%˜100% (mortality rate in piglets can reach up to 100%), high fever of pigs after being infected (40° C.˜42° C., lasting for more than 3 days), dyspnea, diarrhea, wheezing, coughing, sneezing, hind limb paralysis, dog sitting, suddenly falling down, convulsions, lying on their sides, opisthotonus, making strokes with their arms, and finally dying of exhaustion, and reproductive disorder symptoms caused by infection such as declined semen quality of boar, as well as abortion of pregnant sow (the abortion rate can reach up to 35%), premature birth, stillbirth, weakened piglets (weakened piglets die by 14 days of age), etc. The differences between above described symptoms and symptoms caused by infection of regular pseudorabies virus in the prior art are: in adult pigs (whose weight is above 50 kg), high fever of infected pigs (40° C.˜42° C., lasting for more than 3 days), dyspnea, diarrhea, wheezing, coughing, sneezing, hind limb paralysis, dog sitting, suddenly falling down, convulsions, lying on their sides, opisthotonus, making strokes with their arms, and finally dying of exhaustion; sudden incidence of pseudorabies in newborn piglets and piglets below the age of 4 weeks, further resulting in massive death with a mortality of more than 90%; main manifestations in infected piglets including increased body temperature over 41° C., completely loss of appetite, obvious neurological signs and diarrhea; and in piglets just before or after being weaned, mainly respiratory symptoms, such as dyspnea, coughing and runny noses, etc.

[0043] As used herein, the term "prevention" refers to all behaviors to inhibit the infection of pseudorabies virus or delay the onset of the disease via administration of the vaccine composition according to the present invention. The term "treatment" refers to all behaviors to relieve or cure the symptoms caused by infection of PRV via administration of the vaccine composition according to the present invention.

BRIEF DESCRIPTION OR THE DRAWINGS

[0044] FIG. 1. Result of homology analysis between amino acid sequences of gC in HN1201 strain and SA215 strain.

[0045] FIG. 2. Result of homology analysis between amino acid sequences of gD in HN1201 strain and SA215 strain.

SEQUENCE LISTING

[0046] SEQ ID NO. 1 is the amino acid sequence of gD in the PRV HN1201 strain.

[0047] SEQ ID NO. 2 is the amino acid sequence of gB in the PRV HN1201 strain.

[0048] SEQ ID NO. 3 is the amino acid sequence of gC in the PRV HN1201 strain.

[0049] SEQ ID NO. 4 is the nucleotide sequence of gD in the PRV HN1201 strain.

[0050] SEQ ID NO. 5 is the nucleotide sequence of gB in the PRV HN1201 strain.

[0051] SEQ ID NO.6 is the nucleotide sequence of gC in the PRV HN1201 strain.

DETAILED DESCRIPTION

[0052] The description of the present invention is further provided as follows with reference to the specific embodiments, and features and advantages of the present invention will become more apparent from the following description. However, these embodiments are only exemplary, but not forming any limitation to the scope of the present invention. It should be understood by a person skilled in the art that modifications or alternatives to details and forms of the technical solution of the present invention without deviation from the spirit and scope of the present invention will be allowed, while those modification and alternatives should all fall within the scope of the present invention.

[0053] In the invention, the term "per pig" refers to the amount of vaccine each pig injected.

[0054] In the invention, the term "TCID50" refers to 50% tissue culture infective dose, a way to represent viral infectivity.

[0055] Minimum Essential Medium (MEM) liquid medium is prepared with MEM thy powdered medium purchased from Life Technologies, Corp. according to the instruction.

[0056] Dulbecco's Modified Eagle's Medium (DMEM) in the present invention is prepared with reference to the preparation method from Appendix A of GB/T18641-2002 Diagnostic Techniques for Aujeszk's Disease.

[0057] In the present invention, the term "PBS" is the abbreviation for Phosphate Buffer Saline, and 0.01 mM pH 7.4 PBS as used in the present invention is prepared as described in Molecular cloning: Laboratory manuals, 3rd edition.

Example 1

Collection and Isolation of Viruses

[0058] Porcine brain tissue was collected under aseptic conditions from samples isolated from samples from Henan province suspected of having pseudorabies infection, added in MEM liquid medium in a ratio of 1:10(V:V), and ground to prepare a tissue suspension. After 3 times of repeated freezing-thawing, the tissue suspension was centrifuged at 2000 r/min for 15 minutes. The supernatant was then collected, filtered through a 0.2 μm pore filter, subcultured on PK-15 cells and incubated at 37° C. for 1 h, and then the medium was changed by adding MEM liquid medium supplemented with 2% fetal bovine serum, and incubated at 37° C. for 5 days. PRV was detected by PRV PCR detection kit (Beijing Anheal Laboratories Co., Ltd), and the result was positive; PCR kit was employed to detect the exotic virus contamination (porcine reproductive and respiratory syndrome virus RT-PCR detection kit kit, porcine parvovirus PCR detection kit and classical swine fever virus RT-PCR detection kit, all purchased from Beijing Anheal Laboratories Co., Ltd) for the isolated virus and the PCR detection result was negative, indicating a pure viral specie.

[0059] The isolated PRV strain was deposited in the China Type Culture Collection on May 20, 2013 named HN1201 strain (Pseudorabies virus, strain HN1201) of which the accession number is CCTCC NO. V 201311 and the preservation address is Wuhan University, Wuhan City, Hubei Province.

Example 2

Genetic Characteristics of the Isolated Virus

[0060] Genetic characteristics of the isolated virus in Example 1 were determined by means of gene analysis. Genomic DNA prepared from the pseudorabies virus isolated from PK-15 cells was used as template with primers shown in Table 1 for PCR amplification reactions. The Primer Primer 5.0 was used for designing the primer sequence for amplifying gB, gC and gD gene, respectively.

[0061] The genomic DNA extracted was used as template to prepare the following PCR amplification system: 100 μg template DNA, 0.5 μL PrimerSTAR HS DNA Polymerase (2.5 U/μL), 25 μL 2× PrimerSTAR GC Buffer, 1 μL of each upstream and downstream primer (10 pmol/μL), 4 μL dNTP Mix (2.5 mM each), adjusted to a final volume of 50 μL with distilled water. Two-step PCR reaction was carried out by an initial denaturation for 10 sec at 98° C. followed by annealing and extension at 68° C. (all the time is calculated by 1 kb/min) and there were 30 cycles in total. The PCR reactions were finalized at 4° C. The analysis of the amplification products was conducted by electrophoresis on 1% agarose gel containing ethidium bromide. The sequences of PCR products were determined. The sequence data was analyzed by Lasergene.

TABLE-US-00001 TABLE 1 PCR primer sequences Target Primer sequence Size of gene (5' → 3') PCR product gB aagcgcatctttattgtttcccg 2957 bp ggcttctaccgcttccagacgg gC accgtcgccatgtgcgccacta 1603 bp cgggtcggactcgctgtcgtttatt gD ttcccatacactcacctgccagc 1250 bp tcgacgccggtactgcggag

Example 3

Pathogenicity Test of the Virus

3.1 Pathogenicity of the Virus in Piglets at Different Days of Age

[0062] 6 piglets at 34˜35 days of age which were negative for pseudorabies antibodies were randomly divided into 2 groups, one with 4 piglets (experimental group) and the other with 2 piglets (control group), wherein the experimental group was inoculated with PRV HN1201 strain by intranasal instillation (challenge dosage is 2×108.0 TCID50/piglet) and the control group was inoculated with DMEM medium. Meanwhile 4 piglets at 49 days of age were inoculated with third passage of the virulent HN1201 strain after preservation (challenge dose was 2×108.0 TCID50/piglet), and the control is still piglets at 35 days of age. After inoculation of virus, the temperature of piglets was determined daily, and clinical signs and death status were observed. The results are shown in Table 2.

TABLE-US-00002 TABLE 2 Pathogenicity of PRV HN1201 strain in piglets at different days of age Group Number Days Inoculation Dose Clinical signs Death status 1 A1 35 2 × Body Temperature Died on day 4 108.0TCID50/piglet increased, depres- after viral sion, loss of challenge A2 appetite, onset of Died on day 5 respiratory and/or after viral neurological signs challenge A3 Died on day 5 after viral challenge A4 Died on day 6 after viral challenge 2 B1 49 2 × Body Temperature Died on day 7 108.0TCID50/piglet increased, depres- after viral sion, loss of challenge B2 appetite, onset of Died on day 7 respiratory and/or after viral neurological signs challenge B3 Died on day 5 after viral challenge B4 Survived 3 C1 35 DMEM control Normal Survived C2 Survived

[0063] It showed in the results that inoculation with PRV HN1201 strain in piglets at different days of age could lead to onset of pseudorabies in piglets, as well as death of over 3/4 of inoculated piglets.

3.2 Pathogenicity of the Virus at Different Doses in Piglets

[0064] 8 piglets at 49 days of age which were negative for pseudorabies antibodies were randomly divided into 2 groups, each with 4 piglets, in addition two more piglets were used as control. The experimental groups were inoculated with 2×107.0 TCID50/piglet PRV HN1201 strain and 2×108.0 TCID50/piglet PRV HN1201 strain by intranasal instillation, respectively, and the control group was inoculated with DMEM medium. After inoculation of virus, the body temperature of piglets was determined daily, and clinical signs and death status were observed. The results are shown in Table 3.

TABLE-US-00003 TABLE 3 Pathogenicity of different doses of PRV HN1201 strain in piglets Group Number Inoculation Dose Clinical signs Death status 1 A1 2 × Significant Died on day 5 107.0TCID50/piglet clinical signs: after viral temperature challenge A2 increased, Died on day 6 depression, after viral loss of challenge A3 appetite Died on day 6 after viral challenge A4 Died on day 6 after viral challenge 2 B1 2 × Significant Died on day 2 108.0TCID50/piglet clinical signs: after viral temperature challenge B2 increased, Died on day 3 depression, after viral loss of challenge B3 appetite Died on day 4 after viral challenge B4 Died on day 4 after viral challenge 3 C1 DMEM control Normal Survived C2 Survived

[0065] It showed in the results that inoculation with different doses of clinically isolated PRV HN1201 strain in piglets at 49 days of age could all lead to onset of pseudorabies in piglets, of which 4/4 died.

Example 4

Preparation of the Inactivated PRV Vaccine

[0066] The culture of different passages of the isolated strain was inoculated, according to Table 4, onto PK-15 cell culture to form a seed lot which was then inoculated into a monolayer of PK cell culture at 1% (V/V) of the amount of the liquid virus medium, and placed in a rotary incubator at 37° C. The cell medium containing viruses was harvested when the cytopathic effect of cells reached to 80%; the viruses were harvested after 2 times of freezing-thawing and the virus titer was assessed. 10% (V/V) formaldehyde solution was added to different passages of virus solution respectively, with a final concentration of 0.2% (V/V). The virus solution was inactivated at 37° C. for 18 hours, being stirred for 10 min every 4 hours, and diluted with pH 7.4 phosphate-buffered saline (PBS) to the content of viruses as shown in Table 4, mixed with 206 adjuvant (SEPPIC, France) according to the volume ratio of 54:46, and stirred at 120 rpm for 15 min at 30° C.

TABLE-US-00004 TABLE 4 Preparation of each group of pseudorabies vaccines Ratio of vaccines (inactivated virus Passage number of Content of virus solution:206 Group HN1201 culture before inactivation adjuvant) A 5 108.43TCID50/mL 54:46 B 35 .sup. 106.0TCID50/mL 54:46

Example 5

Immunogenicity Assay of Inactivated Vaccines

[0067] 16 piglets at 21 days of age which were negative for PRV antibodies were randomly divided into 4 groups, each with 4 piglets, and injected with vaccines according to Table 4. Two groups injected with inactivated vaccines were injected with 2 ml/piglet of the inactivated vaccines against pseudorabies prepared in Example 4. As a control vaccine, the live vaccine SA215 strain prepared by using the method in CN101186902 was applied according to the method for determining immunogenicity in the specification of the patent. The control group was inoculated with 2 mL/piglet of DMEM medium. The piglets were challenged with 2×108.0 TCID50/piglet of PRV HN1201 strain on day 28 after immunization. After challenge, the body temperature of piglets was determined daily, and clinical signs and death status were observed (The results are shown in Table 5).

TABLE-US-00005 TABLE 5 Grouping of immunogenicity assay Group Vaccines injected Dose Group A injected with Group A vaccine 2 mL/piglet inactivated vaccine prepared in Example 4 Group B injected with Group B vaccine 2 mL/piglet inactivated vaccine prepared in Example 4 Group injected with Live Live PRV vaccine 106.0TCID50/piglet vaccine SA215 Control group DMEM medium 2 mL/piglet

[0068] After immunization with vaccines, neutralizing titers of antibodies of the inactivated vaccines groups were determined weekly according to the method of serum neutralization test from GB/T18641-2002 Diagnostic Techniques for Aujeszk's Disease. The results are shown in Table 6.

TABLE-US-00006 TABLE 6 Nneutralizing titers of antibodies at different time in piglets after immunization with PRV inactivated vaccines Average value of neutralizing titers of antibodies at different time (weeks) Group 1 2 3 4 Group A injected 1:4.8 1:11.2 1:16.0 1:37.7 with inactivated vaccine Group B injected 1:4.0 1:6.3 1:13.5 1:22.4 with inactivated vaccine Group injected 1:3.7 1:4.0 1:10.0 1:16.0 with live vaccine Control group Negative Negative Negative Negative

[0069] The result from Table 6 indicated that immunization with inactivated PRV vaccines in piglets can produce high neutralizing titers which increase with immunization time.

[0070] The piglets were challenged with 2×108.0 TCID50/piglet of PRV HN1201 strain on day 28 after immunization, clinical signs and death status were observed as shown in Table 7. After challenge the body temperature of piglets was determined daily as shown in Table 8.

TABLE-US-00007 TABLE 7 Viral challenge for piglets after immunization with PRV inactivated vaccines Rate of Group clinical signs and death status protection Group A injected with Body temperature increased 100% (4/4) inactivated vaccine for 2-3 days, normal appetite, basically no neurological signs, survived Group B injected with Body temperature increased 100% (4/4) inactivated vaccine for 2-3 days, normal appetite, basically no neurological signs, survived Group injected with live Body temperature increased 100% (4/4) vaccine for 7-10 days, loss of appetite, significant neurological signs, survived Control group Significant signs, two piglets 0% (0/4) died on day 2 after challenge, and all died within 3 days after challenge.

TABLE-US-00008 TABLE 8 Body temperature change after challenge for piglets immunized with PRV vaccines Group A Group B Group injected with injected with injected inactivated inactivated with live Day vaccine vaccine vaccine day 1 after challenge 39.5 39.6 39.4 day 2 after challenge 41.2 41.6 41.8 day 3 after challenge 40.5 40.3 41.2 day 4 after challenge 40.2 39.7 41.6 day 5 after challenge 39.7 39.5 41.4 day 6 after challenge 39.6 39.4 41.3 day 7 after challenge 39.7 39.5 41.4 day 8 after challenge 39.5 39.7 41.2 day 9 after challenge 39.6 39.4 41.5 day 10 after challenge 39.2 39.5 40.6 day 11 after challenge 39.5 39.7 39.7 day 12 after challenge 39.4 39.5 39.8 day 13 after challenge 39.3 39.4 39.7 day 14 after challenge 39.2 39.1 39.4

[0071] The results from Table 7 and 8 indicated that immunization of piglets with inactivated PRV vaccines could provide a 100% (4/4) protection rate for piglets, even though the infection of viruses could not be avoided (they showed clinical signs), while all piglets in the control group died on day 4 after challenge, therefore the inactivated PRV vaccines can provide excellent protection. In addition, compared with the live vaccine as the control vaccine, it took less time for the body temperature of piglets immunized with the inactivated vaccines to increase, and also they kept a basically normal appetite with no clinical signs, indicating excellent immune protection.

Example 6

Preparation of the PRV gD Protein

1. Amplification of the PRV gD Gene

[0072] The PK-15 cells which were in excellent health were inoculated with the PRV HN1201 strain or culture thereof of different passages (the PRV strain was HN1201 strain (Pseudorabies virus, strain HN1201), of which the accession number was CCTCC NO. V 201311; the HN1201 strain was deposited in the China Center for Type Culture Collection (CCTCC) on May 20, 2013, of which the address was Wuhan University, Wuhan City, Hubei Province), the culture of different passages was the culture within 5˜35 passages. The PRV genomic DNA was extracted by using MiniBEST Viral RNA/DNA Extraction Kit Ver. 3.0 (TAKARA) after harvesting viruses. PCR amplification was performed by using 1 μL genomic DNA as template and gD-specific primers:

TABLE-US-00009 gDSF: 5' ATGCTGCTCGCAGCGCTATTGGC 3' and gDSR: 5' CTACGGACCGGGCTGCGCTTTTAG3'.

[0073] The high fidelity polymerase, Prime STAR® HS DNA Polymerase with GC Buffer (TAKARA) was used in the PCR reaction. The amplification conditions were: 94° C. 3 min; 94° C. 30 s, 68° C. 90 s, 30 cycles; 72° C. 5 min. The PCR product was named gD, of which the nucleotide sequence is shown in SEQ No.4, and the amino acid sequence can be derived as shown in SEQ No.1.

2. Acquisition and Identification of Recombinant Bacmid

[0074] The PCR product, gD obtained from amplification with the high fidelity polymerase was cloned into the pFastBac/HBM-TOPO vector (Invitrogen, A11339). The cloning system was as follows: 4 μL PCR product, gD, 1 μL salt solution, 1 μL TOPO vector; 6 μL in total. The mixture was mixed thoroughly and incubated at room temperature for 5 minutes, and then used to transform One Shot® Mach1® T1R competent cells. The transformation mix was spread onto plates containing ampicillin. A single colony was picked to identify insert directionality of gD gene, and the plasmid with the correct insert directionality was delivered to Invitrogen for sequencing, in order to verify the correct sequence. The plasmid with the correct sequence was named pFastBac/HBM-TOPO-gD.

[0075] After the pFastBac/HBM-TOPO-gD plasmid was transformed into DH10Bac competent cells, transposition occurred between the pFastBac/HBM-TOPO-gD plasmid and the shuttle plasmid Bacmid in the competent cells, and the resulting recombinant plasmid was extracted by using PureLink® HiPure Plasmid DNA Miniprep Kit (Invitrogen), and the insertion of gD was identified with pUCM13 Forward/pUCM13 Reverse primer. The positive Bacmid was named Bacmid-gD.

3. Transfection for Obtaining Recombinant Baculovirus

[0076] This step was carried out based on the method provided by the instruction of Bac-to-Bac HBM TOPO Secreted Expression System (Invitrogen). 8×105 sf9 cells were layered in each well of a 6-well plate, transfection was performed according to the instruction of Cellfectin® II transfection agent after adherence of the cells: 8 μL Cellfectin® II and 1 μg Bacmid-gD DNA were diluted respectively with 100 μL SF-900 II medium and mixed by vortex. The diluted DNA was combined with the diluted Cellfectin® II (total volume ˜210 μL), mixed thoroughly and incubated for 15-30 minutes at room temperature. The transfection mixture was then added dropwise onto the cells. The supernatant of cell culture, marked as PO recombinant baculovirus vBac-gD, was collected 72 h after transfection or until the cytopathic effect was visible. The PO recombinant baculovirus vBac-gD infected sf9 cells, and after three rounds of amplification the resulting P3 recombinant baculovirus vBac-gD was used for expressing the recombinant protein.

4. Infection of High-Five Cells with the Recombinant Baculovirus for Expression of the Recombinant Protein

[0077] The P3 recombinant baculovirus vBac-gD was inoculated in High-five cells (Invitrogen, B85502). Suspension culture of High-five cells was performed in a 500 mL Erlenmeyer flask and the cells were inoculated with the virus with an MOI of 1 when the cell density reached to 7.0×105 cell/mL. The supernatant of cell culture was collected 72 h after infection. A Tangential Flow Filtration System (Millipore) was employed to concentrate the volume into 1/10 of the original one. 1% (V %) of Triton X-100 (Sigma) was used to inactivate the baculovirus, and the content of protein determined by SDS-PAGE optical density method was 200 μg/mL.

Example 7

Preparation of the PRV Subunit Vaccines

[0078] The subunit antigens prepared in Example 6 were diluted with PBS (pH=7.4) to the volumes in Table 4, mixed with 206 adjuvant (SEPPIC, France) at a volume ratio of 54:46, and stirred at 120 rpm for 15 min at 30° C.

TABLE-US-00010 TABLE 9 Preparation of each group of the pseudorabies subunit vaccines Ratio of vaccines (inactivated virus Group Content of protein solution:206 adjuvant) A 25 μg/mL 54:46 B 100 μg/mL 54:46

Example 8

Immunogenicity Assay of the Vaccines in Pigs

[0079] 12 piglets at 21 days of age which were negative for PRV antibodies were randomly divided into 3 groups, each with 4 piglets, and injected with 2 ml/piglet of the subunit vaccines against PRV prepared in Example 2 according to Table 2. The control group was inoculated with 2 mL/piglet of DMEM medium. The piglets were challenged with 2×108.0 TCID50/piglet of PRV HN1201 strain on day 28 after immunization. After challenge, the body temperature of piglets was determined daily, and clinical signs and death status were observed (The results are shown in Table 10).

TABLE-US-00011 TABLE 10 Grouping of immunogenicity assay Group Vaccines injected Dose Group A injected with Group A vaccine prepared 2 mL/piglet subunit vaccine in Example 2 Group B injected with Group B vaccine prepared 2 mL/piglet subunit vaccine in Example 2 Control group DMEM medium 2 mL/piglet

[0080] The piglets were challenged with 2×108.0 TCID50/piglet of PRV HN1201 strain on day 28 after immunization, and clinical signs and death status were observed as shown in Table 11. After challenge the body temperature of piglets was determined daily as shown in Table 12.

TABLE-US-00012 TABLE 11 Viral challenge for piglets after immunization with the PRV subunit vaccines Rate of Group Clinical signs and death status protection Group A injected with Body temperature increased 100% (4/4) subunit vaccine for 2-3 days, normal appetite, basically no neurological signs, survived Group B injected with Body temperature increased 100% (4/4) subunit vaccine for 2-3 days, normal appetite, basically no neurological signs, survived Control group Significant signs, two died on 0% (0/4) day 2 after challenge, and all died within 3 days after challenge.

TABLE-US-00013 TABLE 12 Body temperature change of piglets immunized with the PRV subunit vaccines after challenge Group A injected with Group B injected with Day subunit vaccine subunit vaccine day 1 after challenge 39.5 39.5 day 2 after challenge 41.2 41.6 day 3 after challenge 40.3 40.2 day 4 after challenge 40.1 39.7 day 5 after challenge 39.6 39.5 day 6 after challenge 39.6 39.3 day 7 after challenge 39.6 39.5 day 8 after challenge 39.5 39.4 day 9 after challenge 39.5 39.6 day 10 after challenge 39.2 39.3 day 11 after challenge 39.3 39.4 day 12 after challenge 39.4 39.4 day 13 after challenge 39.2 39.4 day 14 after challenge 39.2 39.1

[0081] The results from Table 11 and 12 indicated that immunization with the PRV subunit vaccines for piglets could provide a 100% (4/4) protection rate for piglets, even though the infection of viruses could not be avoided (they showed clinical signs), while all the control piglets died on day 4 after challenge, therefore the PRV subunit vaccines can provide excellent protection.

[0082] Those are only preferred embodiments of the present invention as described above, which cannot be used to limit the present invention. Any change, substitution or modification etc., which are within the spirit and principle of the invention, should be included within the scope of protection of the present invention.

Sequence CWU 1

1

61402PRTpseudorabies virus 1Met Leu Leu Ala Ala Leu Leu Ala Ala Leu Val Ala Arg Thr Thr Leu 1 5 10 15 Gly Ala Asp Val Asp Ala Val Pro Ala Pro Thr Phe Pro Pro Pro Ala 20 25 30 Tyr Pro Tyr Thr Glu Ser Trp Gln Leu Thr Leu Thr Thr Val Pro Ser 35 40 45 Pro Phe Val Gly Pro Ala Asp Val Tyr His Thr Arg Pro Leu Glu Asp 50 55 60 Pro Cys Gly Val Val Ala Leu Ile Ser Asp Pro Gln Val Asp Arg Leu 65 70 75 80 Leu Asn Glu Ala Val Ala His Arg Arg Pro Thr Tyr Arg Ala His Val 85 90 95 Ala Trp Tyr Arg Ile Ala Asp Gly Cys Ala His Leu Leu Tyr Phe Ile 100 105 110 Glu Tyr Ala Asp Cys Asp Pro Arg Gln Ile Phe Gly Arg Cys Arg Arg 115 120 125 Arg Thr Thr Pro Met Trp Trp Thr Pro Ser Ala Asp Tyr Met Phe Pro 130 135 140 Thr Glu Asp Glu Leu Gly Leu Leu Met Val Ala Pro Gly Arg Phe Asn 145 150 155 160 Glu Gly Gln Tyr Arg Arg Leu Val Ser Val Asp Gly Val Asn Ile Leu 165 170 175 Thr Asp Phe Met Val Ala Leu Pro Glu Gly Gln Glu Cys Pro Phe Ala 180 185 190 Arg Val Asp Gln His Arg Thr Tyr Lys Phe Gly Ala Cys Trp Ser Asp 195 200 205 Asp Ser Phe Lys Arg Gly Val Asp Val Met Arg Phe Leu Thr Pro Phe 210 215 220 Tyr Gln Gln Pro Pro His Arg Glu Val Val Asn Tyr Trp Tyr Arg Lys 225 230 235 240 Asn Gly Arg Thr Leu Pro Arg Ala Tyr Ala Ala Ala Thr Pro Tyr Ala 245 250 255 Ile Asp Pro Ala Arg Pro Ser Ala Gly Ser Pro Arg Pro Arg Pro Arg 260 265 270 Pro Arg Pro Arg Pro Arg Pro Lys Pro Glu Pro Ala Pro Ala Thr Pro 275 280 285 Ala Pro Pro Gly Arg Leu Pro Glu Pro Ala Thr Arg Asp His Ala Ala 290 295 300 Gly Gly Arg Pro Thr Pro Arg Pro Pro Arg Pro Glu Thr Pro His Arg 305 310 315 320 Pro Phe Ala Pro Pro Ala Val Val Pro Ser Gly Trp Pro Gln Pro Ala 325 330 335 Glu Pro Phe Pro Pro Arg Thr Thr Ala Ala Pro Gly Val Ser Arg His 340 345 350 Arg Ser Val Ile Val Gly Thr Gly Thr Ala Met Gly Ala Leu Leu Val 355 360 365 Gly Val Cys Val Tyr Ile Phe Phe Arg Leu Arg Gly Ala Lys Gly Tyr 370 375 380 Arg Leu Leu Gly Gly Pro Ala Asp Ala Asp Glu Leu Lys Ala Gln Pro 385 390 395 400 Gly Pro 2914PRTpseudorabies virus 2Met Pro Ala Gly Gly Gly Leu Trp Arg Gly Pro Arg Gly His Arg Pro 1 5 10 15 Gly His His Gly Gly Ala Gly Leu Gly Arg Leu Trp Pro Ala Pro His 20 25 30 His Ala Ala Ala Ala Arg Gly Ala Val Ala Leu Ala Leu Leu Leu Leu 35 40 45 Ala Leu Ala Ala Thr Pro Thr Cys Gly Ala Ala Ala Val Thr Arg Ala 50 55 60 Ala Ser Ala Ser Pro Ala Pro Gly Thr Gly Ala Thr Pro Asp Gly Phe 65 70 75 80 Ser Ala Glu Glu Ser Leu Glu Glu Ile Asp Gly Ala Val Ser Pro Gly 85 90 95 Pro Ser Asp Ala Pro Asp Gly Glu Tyr Gly Asp Leu Asp Ala Arg Thr 100 105 110 Ala Val Arg Ala Ala Ala Thr Glu Arg Asp Arg Phe Tyr Val Cys Pro 115 120 125 Pro Pro Ser Gly Ser Thr Val Val Arg Leu Glu Pro Glu Gln Ala Cys 130 135 140 Pro Glu Tyr Ser Gln Gly Arg Asn Phe Thr Glu Gly Ile Ala Val Leu 145 150 155 160 Phe Lys Glu Asn Ile Ala Pro His Lys Phe Lys Ala His Ile Tyr Tyr 165 170 175 Lys Asn Val Ile Val Thr Thr Val Trp Ser Gly Ser Thr Tyr Ala Ala 180 185 190 Ile Thr Asn Arg Phe Thr Asp Arg Val Pro Val Pro Val Gln Glu Ile 195 200 205 Thr Asp Val Ile Asp Arg Arg Gly Lys Cys Val Ser Lys Ala Glu Tyr 210 215 220 Val Arg Asn Asn His Lys Val Thr Ala Phe Asp Arg Asp Glu Asn Pro 225 230 235 240 Val Glu Val Asp Leu Arg Pro Ser Arg Leu Asn Ala Leu Gly Thr Arg 245 250 255 Gly Trp His Thr Thr Asn Asp Thr Tyr Thr Lys Ile Gly Ala Ala Gly 260 265 270 Phe Tyr His Thr Gly Thr Ser Val Asn Cys Ile Val Glu Glu Val Glu 275 280 285 Ala Arg Ser Val Tyr Pro Tyr Asp Ser Phe Ala Leu Ser Thr Gly Asp 290 295 300 Ile Val Tyr Met Ser Pro Phe Tyr Gly Leu Arg Glu Gly Ala His Gly 305 310 315 320 Glu His Ile Gly Tyr Ala Pro Gly Arg Phe Gln Gln Val Glu His Tyr 325 330 335 Tyr Pro Ile Asp Leu Asp Ser Arg Leu Arg Ala Ser Glu Ser Val Thr 340 345 350 Arg Asn Phe Leu Arg Thr Pro His Phe Thr Val Ala Trp Asp Trp Ala 355 360 365 Pro Lys Thr Arg Arg Val Cys Ser Leu Ala Lys Trp Arg Glu Ala Glu 370 375 380 Glu Met Ile Arg Asp Glu Thr Arg Asp Gly Ser Phe Arg Phe Thr Ser 385 390 395 400 Arg Ala Leu Gly Ala Ser Phe Val Ser Asp Val Thr Gln Leu Asp Leu 405 410 415 Gln Arg Val His Leu Gly Asp Cys Val Leu Arg Glu Ala Ser Glu Ala 420 425 430 Ile Asp Ala Ile Tyr Arg Arg Arg Tyr Asn Asn Thr His Val Leu Ala 435 440 445 Gly Asp Lys Pro Glu Val Tyr Leu Ala Arg Gly Gly Phe Val Val Ala 450 455 460 Phe Arg Pro Leu Ile Ser Asn Glu Leu Ala Gln Leu Tyr Ala Arg Glu 465 470 475 480 Leu Glu Arg Leu Gly Leu Ala Gly Val Val Gly Pro Ala Ser Pro Ala 485 490 495 Ala Ala Arg Arg Ala Arg Arg Ser Pro Gly Pro Ala Gly Thr Pro Glu 500 505 510 Pro Pro Ala Val Asn Gly Thr Gly His Leu Arg Ile Thr Thr Gly Ser 515 520 525 Ala Glu Phe Ala Arg Leu Gln Phe Thr Tyr Asp His Ile Gln Ala His 530 535 540 Val Asn Asp Met Leu Ser Arg Ile Ala Ala Ala Trp Cys Glu Leu Gln 545 550 555 560 Asn Lys Asp Arg Thr Leu Trp Gly Glu Met Ser Arg Leu Asn Pro Ser 565 570 575 Ala Val Ala Thr Ala Ala Leu Gly Gln Arg Val Ser Ala Arg Met Leu 580 585 590 Gly Asp Val Met Ala Ile Ser Arg Cys Val Glu Val Arg Gly Gly Val 595 600 605 Tyr Val Gln Asn Ser Met Arg Val Pro Gly Glu Arg Gly Thr Cys Tyr 610 615 620 Ser Arg Pro Leu Val Thr Phe Glu His Asn Gly Thr Gly Val Ile Glu 625 630 635 640 Gly Gln Leu Gly Asp Asp Asn Glu Leu Leu Ile Ser Arg Asp Leu Ile 645 650 655 Glu Pro Cys Thr Gly Asn His Arg Arg Tyr Phe Lys Leu Gly Gly Gly 660 665 670 Tyr Val Tyr Tyr Glu Asp Tyr Ser Tyr Val Arg Met Val Glu Val Pro 675 680 685 Glu Thr Ile Ser Thr Arg Val Thr Leu Asn Leu Thr Leu Leu Glu Asp 690 695 700 Arg Glu Phe Leu Pro Leu Glu Val Tyr Thr Arg Glu Glu Leu Ala Asp 705 710 715 720 Thr Gly Leu Leu Asp Tyr Ser Glu Ile Gln Arg Arg Asn Gln Leu His 725 730 735 Ala Leu Lys Phe Tyr Asp Ile Asp Arg Val Val Lys Val Asp His Asn 740 745 750 Val Val Leu Leu Arg Gly Ile Ala Asn Phe Phe Gln Gly Leu Gly Asp 755 760 765 Val Gly Ala Ala Val Gly Lys Val Val Leu Gly Ala Thr Gly Ala Val 770 775 780 Ile Ser Ala Val Gly Gly Met Val Ser Phe Leu Ser Asn Pro Phe Gly 785 790 795 800 Ala Leu Ala Ile Gly Leu Leu Val Leu Ala Gly Leu Val Ala Ala Phe 805 810 815 Leu Ala Tyr Arg His Ile Ser Arg Leu Arg Arg Asn Pro Met Lys Ala 820 825 830 Leu Tyr Pro Val Thr Thr Lys Ala Leu Lys Glu Asp Gly Val Glu Glu 835 840 845 Asp Asp Val Asp Glu Ala Lys Leu Asp Gln Ala Arg Asp Met Ile Arg 850 855 860 Tyr Met Ser Ile Val Ser Ala Leu Glu Gln Gln Glu His Lys Ala Arg 865 870 875 880 Lys Lys Asn Ser Gly Pro Ala Leu Leu Ala Ser Arg Val Gly Ala Met 885 890 895 Ala Thr Arg Arg Arg His Tyr Gln Arg Leu Glu Asn Glu Asp Pro Asp 900 905 910 Ala Pro 3487PRTpseudorabies virus 3Met Ala Ser Leu Ala Arg Ala Met Leu Ala Leu Leu Ala Leu Tyr Thr 1 5 10 15 Ala Ala Ile Ala Ala Ala Pro Ser Ser Thr Thr Ala Leu Gly Thr Thr 20 25 30 Pro Asn Gly Gly Gly Gly Gly Asn Ser Ser Ala Gly Glu Leu Ser Pro 35 40 45 Ser Pro Pro Ser Thr Pro Glu Pro Val Ser Gly Thr Thr Gly Ala Ala 50 55 60 Ala Ser Thr Pro Ala Ala Val Ser Thr Pro Arg Val Pro Pro Pro Ser 65 70 75 80 Val Ser Arg Arg Lys Pro Gln Arg Asn Gly Asn Arg Thr Arg Val His 85 90 95 Gly Asp Lys Ala Thr Ser His Gly Arg Lys Arg Ile Val Cys Arg Glu 100 105 110 Arg Leu Phe Ser Ala Arg Val Gly Asp Ala Val Ser Phe Gly Cys Ala 115 120 125 Val Val Pro Arg Ala Gly Glu Thr Phe Glu Val Arg Phe Cys Arg Arg 130 135 140 Gly Arg Phe Arg Ser Pro Asp Ala Asp Pro Glu Tyr Phe Asp Glu Pro 145 150 155 160 Pro Arg Pro Glu Leu Pro Arg Glu Arg Leu Leu Phe Ser Ser Ala Asn 165 170 175 Ala Ser Leu Ala His Ala Asp Ala Leu Ala Ser Ala Val Val Val Glu 180 185 190 Gly Glu Arg Ala Thr Val Ala Asn Val Ser Gly Glu Val Ser Val Arg 195 200 205 Val Ala Ala Ala Asp Ala Glu Thr Glu Gly Val Tyr Thr Trp Arg Val 210 215 220 Leu Ser Ala Asn Gly Thr Glu Val Arg Ser Ala Asn Val Ser Leu Val 225 230 235 240 Leu Tyr Ser Gln Pro Glu Phe Gly Leu Ser Ala Pro Pro Val Leu Phe 245 250 255 Gly Glu Pro Phe Arg Ala Val Cys Val Val Arg Asp Tyr Tyr Pro Arg 260 265 270 Arg Ser Val Arg Leu Arg Trp Phe Ala Asp Glu His Pro Val Asp Ala 275 280 285 Ala Phe Val Thr Asn Ser Thr Val Ala Asp Glu Leu Gly Arg Arg Thr 290 295 300 Arg Val Ser Val Val Asn Val Thr Arg Ala Asp Val Pro Gly Leu Ala 305 310 315 320 Ala Ala Asp Asp Ala Asp Ala Leu Ala Pro Ser Leu Arg Cys Glu Ala 325 330 335 Val Trp Tyr Arg Asp Ser Val Ala Ser Gln Arg Phe Ser Glu Ala Leu 340 345 350 Arg Pro His Val Tyr His Pro Ala Ala Val Ser Val Arg Phe Val Glu 355 360 365 Gly Phe Ala Val Cys Asp Gly Leu Cys Val Pro Pro Glu Ala Arg Leu 370 375 380 Ala Trp Ser Asp His Ala Ala Asp Thr Val Tyr His Leu Gly Ala Cys 385 390 395 400 Ala Glu His Pro Gly Leu Leu Asn Val Arg Ser Ala Arg Pro Leu Ser 405 410 415 Asp Leu Asp Gly Pro Val Asp Tyr Thr Cys Arg Leu Glu Gly Met Pro 420 425 430 Ser Gln Leu Pro Ile Phe Glu Asp Thr Gln Arg Tyr Asp Ala Ser Pro 435 440 445 Thr Ser Val Ser Trp Pro Val Val Thr Ser Met Ile Thr Val Ile Ala 450 455 460 Gly Ile Ala Ile Leu Ala Ile Val Leu Val Ile Met Ala Thr Cys Val 465 470 475 480 Tyr Tyr Arg Arg Ala Gly Pro 485 41209DNApseudorabies virus 4atgctgctcg cagcgctatt ggcggcgctg gtcgcccgga cgacgctcgg cgcggacgtg 60gacgccgtgc ccgcgccgac cttccccccg cccgcgtacc cgtacaccga gtcgtggcag 120ctgacgctga cgacggtccc ctcgcccttc gtcggccccg cggacgtcta ccacacgcgc 180ccgctggagg acccgtgcgg ggtggtggcg ctgatctccg acccgcaggt ggaccggctg 240ctgaacgagg cggtggccca ccggcggccc acgtaccgcg cccacgtggc ctggtaccgc 300atcgcggacg ggtgcgcgca cctgctgtac tttatcgagt acgccgactg cgaccccagg 360cagatctttg ggcgctgccg gcgccgcacc acgccgatgt ggtggacccc gtccgcggac 420tacatgttcc ccacggagga cgagctgggg ctgctcatgg tggccccggg gcggttcaac 480gagggccagt accggcgcct ggtgtccgtc gacggcgtga acatcctcac cgacttcatg 540gtggcgctcc ccgaggggca agagtgcccg ttcgcccgcg tggaccagca ccgcacgtac 600aagttcggcg cgtgctggag cgacgacagc ttcaagcggg gcgtggacgt gatgcgattc 660ctgacgccgt tctaccagca gcccccgcac cgggaggtgg tgaactactg gtaccgcaag 720aacggccgga cgctcccgcg ggcctacgcc gccgccacgc cgtacgccat cgaccccgcg 780cggccctcgg cgggctcgcc gaggcccagg ccccggcccc ggcccaggcc ccggccgaag 840cccgagcccg ccccggcgac gcccgcgccc cccggccgcc tgcccgagcc ggcgacgcgg 900gaccacgccg ccggggggcg ccccacgccg cgacccccga ggcccgagac gccgcaccgc 960cccttcgccc cgccggccgt cgtgcccagc gggtggccgc agcccgcgga gccgttcccg 1020ccccggacca ccgccgcgcc gggcgtctcg cgccaccgct cggtgatcgt cggcacgggc 1080accgcgatgg gcgcgctcct ggtgggcgtg tgcgtctaca tcttcttccg cctgaggggg 1140gcgaaggggt atcgcctcct gggcggtccc gcggacgccg acgagctaaa agcgcagccc 1200ggtccgtag 120952745DNApseudorabies virus 5ctagggggcg tcggggtcct cgttctcgag gcgctggtag tgccggcggc gcgtggccat 60cgccccgacg cggctggcca gcagcgcggg cccgctgttc ttcttgcgcg ccttgtgctc 120ctgctgctcg agggccgaca cgatggacat gtaccggatc atgtcccggg cctggtccag 180cttggcctcg tccacgtcgt cctcttcgac gccgtcctcc ttgagcgcct tcgtcgtgac 240ggggtacagg gccttcatgg ggttgcggcg caggcgcgag atgtgccggt aggccaggaa 300ggccgcgacc aggccggcca gcaccagcag cccgatggcg agcgccccga aggggttgga 360caggaaggac accatgccgc cgacggccga gatcacggcc cccgtggcgc ccaggaccac 420cttgccgacg gcggcgccca cgtcgccgag gccctggaag aagttggcga tgccgcgcag 480cagcaccacg ttgtggtcca ccttgaccac gcggtcaatg tcgtagaact tgagcgcgtg 540cagctggttg cggcgctgga tctcgctgta gtccaggagg cccgtgtcgg cgagctcctc 600gcgcgtgtac acctcgaggg gcaggaactc gcggtcctcg agcagcgtca ggttcagggt 660cacccgcgtg ctgatcgtct cgggcacctc caccatgcgc acgtagctgt agtcctcgta 720gtacacgtac ccgccgccca gcttaaagta gcgccggtgg ttgccggtgc agggctcgat 780gaggtcgcgc gagatgagga gctcgttgtc gtcgccgagc tggccctcga tcacgcccgt 840gccgttgtgc tcgaaggtca ccagcgggcg gctgtagcac gtgccgcgct cgccgggcac 900gcgcatggag ttctgcacgt acacgccgcc gcgcacctcc acgcaccgcg agatggccat 960cacgtcgccg agcatgcgcg ccgagacgcg ctggcccagc gcggccgtgg ccacggcgct 1020ggggttcagg cgcgacatct cgccccacag ggtgcggtcc ttgttctgca gctcgcacca 1080ggcggccgcg atgcggctca gcatgtcgtt cacgtgcgcc tggatgtggt cgtaggtgaa 1140ctgcaggcgc gcaaactcgg ccgagcccgt ggtgatgcgc aggtgccccg tgccgttgac 1200ggccggcggc tcgggcgtcc ccgccgggcc gggggagcgc cgggcccgac gggcggccgc 1260gggggacgcg gggcccacga cgccggcgag gccgaggcgc tcgagctcgc gcgcgtacag 1320ctgcgccagc tcgttcgaga tcagcgggcg gaaggccacc acgaagcccc cgcgggcgag 1380gtacacctcg ggcttgtcgc cggccagcac gtgcgtgttg ttgtagcgcc gccggtagat 1440ggcgtcgatg gcctccgagg cctcgcggag gacgcagtcg cccaggtgca cgcgctgcag 1500gtcgagctgc gtgacgtcgc tgacgaagga ggcgcccagg gcccgcgacg tgaagcggaa 1560ggacccgtcg cgcgtctcgt cgcggatcat ctcctcggcc tcgcgccact tggccaggct 1620gcacacgcgc cgcgtcttgg gggcccagtc ccaggccacc gtgaagtgcg gcgtgcgcag 1680aaagttgcgc gtcacgctct cggaggcgcg gaggcgcgag tccaggtcga tggggtagta 1740gtgctccacc tgctggaagc gcccgggcgc gtagccgatg tgctccccgt gggccccctc 1800gcgcaggccg tagaaggggg acatgtacac gatgtccccc gtggacaggg cgaaggagtc 1860gtaggggtac acggagcgcg cctccacctc ctcgacgatg cagttgacgg aggtgcccgt

1920gtggtagaag cccgcggcgc cgatcttggt gtaggtgtcg ttggtggtgt gccagccgcg 1980ggtgccgagc gcgttcaggc gcgaggggcg caggtccacc tcgacggggt tctcgtcgcg 2040gtcgaaggcg gtcaccttgt ggttgttgcg cacgtactcg gccttggaga cgcacttgcc 2100gcggcggtcg atcacgtccg tgatctcctg cacggggacg ggcacgcggt ccgtgaagcg 2160gttcgtgatg gccgcgtacg tgctcccgga ccacacggtc gtgacgatga cgttcttgta 2220gtagatgtgg gccttgaact tgtgcggggc gatgttctcc ttgaagagca cggcgatccc 2280ctccgtgaag ttgcgcccct gcgagtactc ggggcaggcc tgctcgggct ccaggcgcac 2340caccgtggag ccggacggcg gcgggcagac gtagaagcgg tcccgctcgg tcgcggccgc 2400gcgcacggcc gtgcgcgcgt ccaggtcgcc gtactcgccg tcgggggcgt ccgaggggcc 2460gggggagacg gccccgtcga tctcctcgag ggactcctcc gcggagaagc cgtctggggt 2520ggcgcccgtc ccgggcgcgg gcgaggccga ggcggcccgc gtcacggccg ccgcgccgca 2580cgtcggggtc gcggcgagcg ccagcagcag cagcgctagc gcgacggcgc cccgcgcagc 2640tgcagcgtgg tgtggagcag gccaaagacg tccgaggcca gcaccgccgt ggtgcccggg 2700ccgatgcccg cggggcccgc gccaaagacc gccaccagcg ggcat 274561464DNApseudorabies virus 6atggcctcgc tcgcgcgtgc gatgctcgcg ctgctggcgc tctacacggc ggccatcgcc 60gcggcgccgt cgtccacgac ggcgctcggc acgacgccca acgggggcgg gggcggcaac 120agcagcgcgg gcgagctctc gccctcgccg ccctcgacgc ccgagcccgt ctcggggacg 180acgggggccg cggcctccac gcccgccgcc gtctcgacgc cccgggtccc gccgccctcg 240gtctcgcgcc ggaagcccca gcggaacggc aacaggacgc gcgtccacgg cgacaaggcc 300acctcgcacg ggcgcaagcg catcgtgtgc cgcgagcggc tgttctcggc gagggtgggg 360gacgcggtca gcttcgggtg cgccgtcgtc ccgcgcgccg gggagacctt cgaggtccgc 420ttctgccgcc gcgggcgctt ccgctcgccc gacgccgacc ccgagtactt tgacgagccc 480ccgcgcccgg agctcccgcg ggagcggctc ctcttcagct ccgccaacgc ctccctcgcc 540cacgcggacg cgctcgcctc cgccgtcgtc gtcgagggcg agcgcgcgac cgtcgccaac 600gtctcgggcg aggtgtccgt gcgcgtggcc gcggcggacg ccgagaccga gggcgtctac 660acgtggcgcg tgctgtccgc caacggcacc gaggtccgca gcgccaacgt ctcgctcgtc 720ctgtacagcc agcccgagtt cggcctgagc gcgccgcccg tcctcttcgg cgagcccttc 780cgggcggtgt gcgtcgtccg cgactactac ccgcggcgca gcgtgcgcct gcgctggttc 840gcggacgagc acccggtgga cgccgccttc gtgaccaaca gcaccgtggc cgacgagctc 900gggcgccgca cgcgcgtctc cgtggtgaac gtgacgcgcg cggacgtccc gggcctcgcg 960gccgcggacg acgcggacgc gctcgcgccg agcctgcgct gcgaggccgt gtggtaccgc 1020gacagcgtgg cctcgcagcg cttctccgag gccctgcgcc cccacgtcta ccacccggcg 1080gcggtctcgg tgcgcttcgt cgagggcttc gccgtctgcg acggcctctg cgtgcccccg 1140gaggcgcgcc tcgcctggtc cgaccacgcc gccgacaccg tctaccacct cggcgcctgc 1200gccgagcacc ccggcctgct caacgtgcgg agcgcccgcc cgctgtcgga cctcgacggg 1260cccgtcgact acacctgccg cctcgagggc atgccctcgc agctgcccat cttcgaggac 1320acgcagcgct acgacgcctc ccccacgtcc gtgagctggc ccgtcgtgac cagcatgatc 1380accgtcatcg ccggcatcgc catcctagcc atcgtgctgg tcatcatggc gacgtgcgtc 1440tactaccgcc gggcggggcc gtga 1464


Patent applications in class Rhabdoviridae (e.g., rabies virus, vesicular stomatitis virus, etc.)

Patent applications in all subclasses Rhabdoviridae (e.g., rabies virus, vesicular stomatitis virus, etc.)


User Contributions:

Comment about this patent or add new information about this topic:

CAPTCHA
Similar patent applications:
DateTitle
2016-02-11Endolysins active against staphylococcus bacteria, pharmaceutical compositions, and methods relating thereto
2016-02-11Therapeutic acid ceramidase compositions and methods of making and using them
2016-02-11Compositions and methods for immune tolerance induction to factor viii replacement therapies in subjects with hemophilia a
2016-02-11Msi-specific frameshift peptides (fsp) for prevention and treatment of cancer
2016-02-11Immunogenic compositions for inducing an immune response for elimination of senescent cells
New patent applications in this class:
DateTitle
2016-03-31Compositions containing ambient-temperature stable, inactivated but therapeutically active biopharmaceuticals & methods for formulation thereof
2015-01-29Adjuvanted formulations of rabies virus immunogens
2014-09-18Intra-testicular injection of immunogens
2014-06-26Lipid and nitrous oxide combination as adjuvant for the enhancement of the efficacy of vaccines
2014-02-06Stabilizing excipient for inactivated whole virus vaccine
New patent applications from these inventors:
DateTitle
2016-04-28Porcine pseudorabies virus, vaccine composition and preparation method and use thereof
Top Inventors for class "Drug, bio-affecting and body treating compositions"
RankInventor's name
1David M. Goldenberg
2Hy Si Bui
3Lowell L. Wood, Jr.
4Roderick A. Hyde
5Yat Sun Or
Website © 2025 Advameg, Inc.