Patents - stay tuned to the technology

Inventors list

Assignees list

Classification tree browser

Top 100 Inventors

Top 100 Assignees

Patent application title: Methods for Enhancing Stress Tolerance in Plants and Compositions Thereof

Inventors:  Mary Fernandes (St. Louis, MO, US)  Mary Fernandes (St. Louis, MO, US)
IPC8 Class: AC12N1582FI
USPC Class:
Class name:
Publication date: 2015-07-16
Patent application number: 20150197769



Abstract:

Increased tolerance to abiotic stress in a plant is provided by introducing DNA expressing a cold shock protein, e.g. bacterial cold shock protein.

Claims:

1.-20. (canceled)

21. A drought tolerant transgenic plant that comprises in its genome a recombinant DNA molecule that expresses a cold shock protein that comprises the cold shock domain sequence [FY]-G-F-I-x(6,7)-[DER]-[LIVM]-F-x-H-x-[STKR]-x-[LIVMFY] of SEQ ID NO:3 and that confers resistance to drought.

22. The drought tolerant transgenic plant of claim 21, wherein said cold shock protein is a bacterial or a plant cold shock protein.

23. The drought tolerant transgenic plant of claim 21, wherein said cold shock protein has at least 60% identity across the entire length of SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 19, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 47, SEQ ID NO: 49, and SEQ ID NO: 51.

24. The drought tolerant transgenic plant of claim 21, wherein said cold shock protein has at least 90% identity across the entire length of SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 19, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 47, SEQ ID NO: 49, and SEQ ID NO: 51.

25. The drought tolerant transgenic plant of claim 21, wherein said cold shock protein is selected from the group consisting of SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 19, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 47, SEQ ID NO: 49, and SEQ ID NO: 51.

26. The drought tolerant transgenic plant of claim 21, wherein said transgenic plant is a monocot or a dicot plant.

27. The drought tolerant transgenic plant of claim 21, wherein said transgenic plant is a soybean, corn, canola, rice, cotton, barley, oat, turf grass, alfalfa, or wheat plant.

28. The transgenic plant of claim 21, wherein said plant has an increased yield when compared to a non-transformed plant of the same species when said transgenic plant and said non-transformed plant are grown under drought stress.

29. A transgenic propagule of the drought tolerant transgenic plant of claim 21, wherein said propagule comprises in its genome a recombinant DNA molecule that expresses a cold shock protein that comprises the cold shock domain sequence [FY]-G-F-I-x(6,7)-[DER]-[LIVM]-F-x-H-x-[STKR]-x-[LIVMFY] of SEQ ID NO:3 and that confers drought resistance to a transgenic plant comprising said recombinant DNA that is produced from said propagule.

30. The transgenic propagule of claim 29, wherein said cold shock protein has at least 60% identity across the entire length of SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 19, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 47, SEQ ID NO: 49, and SEQ ID NO: 51.

31. The transgenic propagule of claim 29, wherein said cold shock protein has at least 90% identity across the entire length of SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 19, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 47, SEQ ID NO: 49, and SEQ ID NO: 51.

32. The transgenic propagule of claim 29, wherein said propagule is a seed.

33. The transgenic propagule of claim 29, wherein said propagule is a root, shoot, leaf, stem, embryo, or cell.

34. A method of improving drought tolerance in a transgenic progeny plant comprising: (i) crossing a plant with a drought tolerant transgenic plant having a recombinant DNA expressing a cold shock protein that comprises a cold shock domain sequence [FY]-G-F-I-x(6,7)-[DER]-[LIVM]-F-x-H-x-[STKR]-x-[LIVMFY] of SEQ ID NO:3 and that confers resistance to drought; and (ii) obtaining a transgenic progeny plant having said recombinant DNA.

35. The method of claim 34, wherein said transgenic plant is a soybean, corn, canola, rice, cotton, barley, oat, turf grass, alfalfa, or wheat plant.

36. A method of producing a drought tolerant transgenic plant comprising the steps of: a) inserting into the genome of plant cells a recombinant DNA molecule that comprises, in the 5' to 3' direction: (i) a first DNA polynucleotide comprising a promoter that functions in plants and which is operably linked to (ii) a second DNA polynucleotide that encodes a cold shock protein that comprises a cold shock domain sequence [FY]-G-F-I-x(6,7)-[DER]-[LIVM]-F-x-H-x-[STKR]-x-[LIVMFY] of SEQ ID NO:3, which is operably linked to (iii) a 3' transcription termination DNA polynucleotide that functions as a polyadenylation sequence; b) obtaining transformed plant cells containing said recombinant DNA; c) regenerating transgenic plants from said plant cells; and d) selecting a transgenic plant having increased drought tolerance.

37. The method of claim 36, wherein said cold shock protein has at least 60% identity across the entire length of SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 19, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 47, SEQ ID NO: 49, and SEQ ID NO: 51.

38. The method of claim 36, wherein said cold shock protein has at least 80% identity across the entire length of SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 19, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 47, SEQ ID NO: 49, and SEQ ID NO: 51.

39. The method of claim 36, wherein said cold shock protein has at least 90% identity across the entire length of SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 19, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 47, SEQ ID NO: 49, and SEQ ID NO: 51.

40. The method of claim 36, wherein said cold shock protein is selected from the group consisting of SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 19, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 47, SEQ ID NO: 49, and SEQ ID NO: 51.

41. The method of claim 36, wherein said transgenic plant is a monocot or a dicot plant.

42. The method of claim 36, wherein said transgenic plant is a soybean, corn, canola, rice, cotton, barley, oat, turf grass, alfalfa, or wheat plant.

43. The method of claim 36, wherein said transgenic plant has an increased yield when compared to a non-transformed plant of the same species and when said transgenic plant and said non-transformed plant are grown under drought stress.

44. A method for increasing yield in a crop subject to water deficit during its growth, said method comprising planting seeds having a recombinant DNA expressing a cold shock protein that comprises the cold shock domain sequence [FY]-G-F-I-x(6,7)-[DER]-[LIVM]-F-x-H-x-[STKR]-x-[LIVMFY] of SEQ ID NO:3 and that confers resistance to drought, and allowing said seeds to grow to mature plants under drought conditions.

45. The method of claim 44, wherein said cold shock protein has at least 60% identity across the entire length of SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 19, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 47, SEQ ID NO: 49, and SEQ ID NO: 51.

46. The method of claim 44, wherein said cold shock protein has at least 80% identity across the entire length of SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 19, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 47, SEQ ID NO: 49, and SEQ ID NO: 51.

47. The method of claim 44, wherein said cold shock protein has at least 90% identity across the entire length of SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 19, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 47, SEQ ID NO: 49, and SEQ ID NO: 51.

48. The method of claim 44, wherein said cold shock protein is selected from the group consisting of SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 19, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 47, SEQ ID NO: 49, and SEQ ID NO: 51.

49. The method of claim 44, wherein said plants are soybean, corn, canola, rice, cotton, barley, oat, turf grass, alfalfa, or wheat plants.

Description:

CROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application is a continuation of U.S. non-provisional patent application Ser. No. 10/953,856, filed Sep. 29, 2004 and incorporated herein by reference in its entirety and which claims benefit under 35 USC §119(e) of U.S. provisional application Ser. No. 60/506,717 filed Sep. 29, 2003 and Ser. No. 60/530,453, filed Dec. 17, 2003.

INCORPORATION OF SEQUENCE LISTING

[0002] A copy of the sequence listing in a computer-readable form and named (47-21)51768D CSP.ST25.txt, which is approximately 99574 bytes (measured in MS-DOS) and was created on Jun. 23, 2010, is filed herewith via the USPTO EFS system and is hereby incorporated by reference.

FIELD OF THE INVENTION

[0003] This invention relates to cold, drought, salt, cold germination, heat, and other abiotic stress tolerance in plants and viral, fungal, bacterial and other abiotic stress tolerance in plants. Specifically this invention relates to a method of increasing the biotic and abiotic stress tolerance of plants by expressing a cold shock protein(s) within the cells of said plant.

BACKGROUND

[0004] Seed and fruit production are multi-billion dollar commercial industries and primary sources of income for numerous states in the United States and for many countries around the world. Commercially valuable seeds include, for example, canola, cottonseeds and sunflower seeds, which are prized for the vegetable oil that can be pressed from the seed. The seeds of leguminous plants such as peas, beans, and lentils also are commercially valuable as they are rich in proteins, with soybeans, for example, consisting of 40-45% protein and 18% fats and oils. In addition, coffee is a valuable crop made from the dried and roasted seeds of Coffea arabica plants, while chocolate is made from the cacao seed or "bean." Similarly, many fruits and seeds are commercially valuable, including, for example, corn, rice, wheat, barley and other cereals, nuts, legumes, tomatoes, and citrus fruits. For example, corn seeds are made into many food items or items used in cooking, such as taco shells, corn oil, tortillas, corn flakes, corn meal, and many others. Corn is also used as raw material in many production processes, including but not limited to, feed and ethanol production.

[0005] Seed and fruit production are both limited inherently due to biotic and abiotic stress. Soybean (Glycine max), for instance, is a crop species that suffers from loss of seed germination during storage and fails to germinate when soil temperatures are cool (Zhang et al., Plant Soil 188: (1997)). This is also true in corn and other plants of agronomic importance. Improvement of abiotic stress tolerance in plants would be an agronomic advantage to growers allowing increasing growth and/or germination in cold, drought, flood, heat, UV stress, ozone increases, acid rain, pollution, salt stress, heavy metals, mineralized soils, and other abiotic stresses. Biotic stress, such as fungal and viral infection, also cause large crop losses world wide.

[0006] Traditional breeding (crossing specific alleles of one genotype into another) has been used for centuries to increase biotic stress tolerance, abiotic stress tolerance, and yield. Traditional breeding is limited inherently to the limited number of alleles present in the parental plants. This in turn limits the amount of genetic variability that can be added in this manner. Molecular biology has allowed the inventors of the instant invention to look far and wide for genes that will improve stress tolerance in plants. Our inventors sought to determine how other organisms react to and tolerate stressful conditions. The cold shock proteins are part of a system used by bacteria and other organisms to survive cold and stressful conditions. It was posited by the inventors that placing genes encoding the cold shock proteins, and proteins related to them, into plants and expressing them would increase the cold, drought, heat, water, and other abiotic stress tolerance of plants as well as fungal, viral, and other biotic stress tolerance of plants. They also believe that using genes that are homologous to cold shock proteins, or have sequence similarity, would also increase biotic and abiotic stress tolerance.

[0007] This invention is useful to farmers to limit their losses due to biotic and abiotic stress.

SUMMARY OF THE INVENTION

[0008] The present invention provides a plant expressing a cold shock protein (Csp) in the cells of the plant. The expression of this csp leads to greater abiotic stress tolerance within said plant. In one embodiment, a polynucleotide encoding a csp is expressed by an operably linked promoter that functions in plants, and a terminator that functions in plants.

[0009] More specifically the invention provides a recombinant DNA molecule that comprises, in the 5' to 3' direction, a first DNA polynucleotide that comprises a promoter that functions in plants, operably linked to a second DNA polynucleotide that encodes a cold shock protein, operably linked to a 3' transcription termination DNA polynucleotide providing a polyadenylation site. The first DNA polynucleotide is often advantageously heterologous to the second DNA polynucleotide. The invention also provides a recombinant DNA molecule having an intron inserted between the first DNA polynucleotide and the second DNA polynucleotide. The invention also provides a recombinant DNA molecule where the second DNA polynucleotide encodes a protein comprising the motif in SEQ ID NO: 3. In specific embodiments of the recombinant DNA of this invention the second DNA polynucleotide encodes a protein selected from the group consisting of

[0010] (a) a protein with an amino acid sequence of substantial identity to an amino acid sequence of a cold shock protein from gram positive bacteria,

[0011] (b) a cold shock protein from Bacillus subtilis,

[0012] (c) a homologue of Bacillus subtilis cold shock protein B (CspB),

[0013] (d) a protein with an amino acid sequence of substantial identity to SEQ ID NO: 2,

[0014] (e) a protein with an amino acid sequence of substantial identity to an amino acid sequence of a cold shock protein from a gram negative bacteria,

[0015] (f) a protein comprising a cold shock protein from Escherichia coli,

[0016] (g) a homologue of Escherichia coli cold shock protein A (CspA),

[0017] (h) a protein with an amino acid sequence that has substantial identity to SEQ ID NO:1,

[0018] (i) a cold shock protein from Agrobacterium tumefaciens, and

[0019] (j) a protein having an amino acid sequence of substantial identity to any of SEQ ID NO: 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, or 65. The invention also provides a recombinant DNA molecule wherein the promoter is selected from the group consisting of inducible promoters, constitutive promoters, temporal-regulated promoters, developmentally-regulated promoters, tissue-preferred promoters, cold enhanced promoters, cold-specific promoters, stress enhanced promoters, stress specific promoters, drought inducible promoters, water deficit inducible promoters, and tissue-specific promoters.

[0020] The invention also provides plant cells and plants containing in their genome recombinant DNA molecules as described and the propagules and progeny produced therefrom. Plants include, but are not limited to crop plants, monocots, and dicots. More specifically these could include soybean, corn, canola, rice, cotton, barley, oats, turf grasses, cotton, and wheat.

[0021] The invention also provides abiotic stress-tolerant, transgenic plants that have been transformed with a recombinant DNA molecule that expresses a cold shock protein. Such plants and their cells and propagules such as seeds contain in their genome recombinant DNA molecules that expresses a cold shock protein. Such plants exhibit one or more of the following enhanced properties: a higher growth rate under conditions where cold temperature would be limiting for growth for a non-transformed plant of the same species,

[0022] (a) a higher growth rate under conditions where high temperature would be limiting for growth for a non-transformed plant of the same species,

[0023] (b) a higher growth rate under conditions where water would be limiting for growth for a non-transformed plant of the same species,

[0024] (c) a higher growth rate under conditions where increased salts or ions in the soil and/or water would be limiting for growth of a non-transformed plant of the same species,

[0025] (d) has a greater percentage of plants surviving after a cold shock than a non-transformed plant of the same species,

[0026] (e) an increased yield when compared to a non-transformed plant of the same species, or

[0027] (f) resistance to drought compared to a non-transformed plant of the same species.

[0028] A method of the invention comprises propagating plants of this invention, e.g. for the purpose of generating seeds, by simply planting such seeds in soil and allowing them to grow, e.g. under stress conditions. More specifically, this invention provides a method of producing a plant that has enhanced trait such as abiotic stress tolerance, increased yield or increased root mass. The method comprises the steps of

[0029] a) inserting into the genome of a plant cell or cells a recombinant DNA molecule comprising DNA encoding a cold shock protein,

[0030] b) obtaining a transformed plant cell or cells,

[0031] c) regenerating plants from said transformed plant cell(s); and

[0032] d) selecting plants which exhibit the enhance trait. In one aspect of the invention plants are selected which exhibit enhanced abiotic stress tolerance selected from the group consisting of heat tolerance, salt tolerance, drought tolerance, and survival after cold shock.

[0033] The invention also provided isolated proteins which are at least 40% identity to a protein having an amino acid sequence selected from the group consisting of SEQ ID NOS: 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, and 65. In certain aspects comparable traits can be achieved by substituting a cold shock protein with a protein having higher homology than 40% identity, e.g. with a protein that is at least 50%, 60%, 70%, 80%, 90% or at least 95% identical to a cold shock protein specifically disclosed herein. Likewise, this invention also provides an isolated nucleic acid encoding a cold shock protein motif which hybridizes to a nucleic acids with a DNA sequence selected from the group comprising SEQ ID NOs: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 90 and 92.

[0034] The invention also specifically provides isolated nucleic acids encoding a cold shock protein which has a DNA sequence that is substantially identical to a sequence in the group consisting of SEQ ID NOs: 5, 7, 9, 29, 31, 33, 35, 37, 39, 41, 43, 53, 55, 57, 59, 61, 63, and 65.

[0035] The invention also provides propagules containing the above recombinant DNA molecules, when they are planted or otherwise caused to germinate, and a field of plants germinated from said propagules, e.g. where such propagule are seeds.

[0036] The invention also provides a method of producing seed comprising planting a seed of claim 59 in soil;

[0037] b) harvesting seed from said plants; and the seed produced therefrom.

[0038] A method of producing a transgenic plant is also provided, the method comprising the steps of (i) introducing into the genome of a plant cell a DNA molecule comprising a DNA polynucleotide at least 40% homologous to a protein having an amino acid sequence selected from the group consisting of SEQ ID NOs: 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, and 65, or fragment, or cis element thereof, wherein said DNA polynucleotide is operably linked to a promoter and operably linked to a 3' transcription termination DNA polynucleotide; and (ii) selecting said transgenic plant cell; and (iii) regenerating said transgenic plant cell into a transgenic plant; also provided are the plants made by this method.

BRIEF DESCRIPTION OF THE DRAWINGS

[0039] FIG. 1 shows a plasmid map of pMON57396.

[0040] FIG. 2 shows a plasmid map of pMON23450.

[0041] FIG. 3 shows a plasmid map of pMON57397.

[0042] FIG. 4 shows a plasmid map of pMON57398.

[0043] FIG. 5 shows a plasmid map of pMON23450.

[0044] FIG. 6 shows a plasmid map of pMON57399.

[0045] FIG. 7 shows a plasmid map of pMON48421.

[0046] FIG. 8 shows a plasmid map of pMON56609.

[0047] FIG. 9 shows a plasmid map of pMON56610.

[0048] FIG. 10 shows a plasmid map of pMON73607.

[0049] FIG. 11 shows a plasmid map of pMON61322.

[0050] FIG. 12 shows a plasmid map of pMON73608.

[0051] FIG. 13 shows a plasmid map of pMON65154.

[0052] FIG. 14 shows a plasmid map of pMON72472.

[0053] FIG. 15 shows a plasmid map of pENTR1.

[0054] FIG. 16 shows the growth pattern of plants expressing the indicated gene, and controls, showing that the genes introduced provide abiotic stress tolerance.

[0055] FIG. 17 shows a plasmid map of pMON42916.

[0056] FIG. 18 shows a plasmid map of pMON73983.

[0057] FIG. 19 shows a plasmid map of pMON73984.

DETAILED DESCRIPTION OF SPECIFIC EMBODIMENTS

[0058] The instant invention provides a plant with increased tolerance to biotic and abiotic stress. The plant provided has increased stress tolerance due to the expression of cold shock protein (csp) in the cells of said plant. The invention provides examples of several embodiments and contemplates other embodiments that are expected to function in the invention.

[0059] The following definitions and methods are provided to better define the current invention and to guide those of ordinary skill in the art in the practice of the present invention. Unless otherwise noted, terms are to be understood according to conventional usage by those of ordinary skill in the art. For example, definitions of common terms used in molecular biology and molecular genetics can be found in Lewin, Genes VII, Oxford University Press and Cell Press, New York, 2000; Buchanan, et al., Biochemistry and Molecular Biology of Plants, Courier Companies, USA, 2000; Lodish, et al., Molecular Cell Biology, W.H. Freeman and Co., New York, 2000. Common terms in genetics can be found in the prior references as well as Lynch, et al., Genetics and Analysis of Quantitative Traits, Sinauer and Associates, Sunderland, Mass., 1998; Hartwell, et al., Genetics: From Genes to Genomes, McGraw-Hill Companies, Boston, Mass., 2000; Hartl, et al., Genetics: Analysis of Genes and Genomes, Jones and Bartlett Publishers, Sudbury, Mass.; Strachan, et al., Human Molecular Genetics, John Wiley and Sons, New York, 1999.

[0060] The nomenclature for DNA bases as set forth in 37 CFR §1.822 is used. The standard one- and three-letter nomenclature for amino acid residues is used.

[0061] Many agronomic traits can affect "yield". For example, these could include, without limitation, plant height, pod number, pod position on the plant, number of internodes, incidence of pod shatter, grain size, efficiency of nodulation and nitrogen fixation, efficiency of nutrient assimilation, resistance to biotic and abiotic stress, carbon assimilation, plant architecture, resistance to lodging, percent seed germination, seedling vigor, and juvenile traits. For example, these could also include, without limitation, efficiency of germination (including germination in stressed conditions), growth rate of any or all plant parts (including growth rate in stressed conditions), ear number, seed number per ear, seed size, composition of seed (starch, oil, protein), characteristics of seed fill. Yield can be measured in many ways, these might include test weight, seed weight, seed number per plant, seed weight per plant, seed number or weight per unit area (i.e. seeds, or weight of seeds, per acre), bushels per acre, tonnes per acre, tons per acre, kilo per hectare. In an embodiment, a plant of the present invention exhibits an enhanced trait that is a component of yield.

[0062] "Nucleic acid (sequence)" or "polynucleotide (sequence)" refers to single- or double-stranded DNA (deoxyribonucleic acid) or RNA (ribonucleic acid) of genomic or synthetic origin, i.e., a polymer of deoxyribonucleotide or ribonucleotide bases, respectively, read from the 5' (upstream) end to the 3' (downstream) end. The nucleic acid can represent the sense or complementary (antisense) strand.

[0063] "Native" refers to a naturally occurring ("wild-type") nucleic acid sequence.

[0064] "Heterologous" sequence refers to a sequence which originates from a foreign source or species or, if from the same source, is modified from its original form. For example, a native promoter could be used to cause the transcription of a heterologous gene from the same or from a different species.

[0065] "Parts" of a plant include all parts or pieces of a plant including, but not limited to, roots, shoots, leaves, stems, pollen, seeds, flowers, stamen, pistils, eggs, embryos, petal, filaments, carpels (including stigma, ovary, and style), cell(s) or any piece of the above.

[0066] "Propagule" includes all products of meiosis and mitosis, including but not limited to, seed and parts of the plant able to propogate a new plant. For example, propagule includes a shoot, root, or other plant part that is capable of growing into an entire plant. Propagule also includes grafts where one portion of a plant is grafted to another portion of a different plant (even one of a different species) to create a living organism. Propagule also includes all plants and seeds produced by cloning or by bringing together meiotic products, or allowing meiotic products to come together to form an embryo or fertilized egg (naturally or with human intervention).

[0067] An "isolated" nucleic acid sequence is substantially separated or purified away from other nucleic acid sequences with which the nucleic acid is normally associated in the cell of the organism in which the nucleic acid naturally occurs, i.e., other chromosomal or extrachromosomal DNA. The term embraces nucleic acids that are biochemically purified so as to substantially remove contaminating nucleic acids and other cellular components. The term also embraces recombinant nucleic acids and chemically synthesized nucleic acids.

[0068] "Identity" or "identical" as used herein, when referring to comparisons between protein(s) or nucleic acid(s) means 98% or greater identity.

[0069] A first nucleic acid or protein sequence displays "substantial identity" or "substantial similarity" to a reference nucleic acid sequence or protein if, when optimally aligned (with appropriate nucleotide or amino acid insertions or deletions totaling less than 20 percent of the reference sequence over the window of comparison) with the other nucleic acid (or its complementary strand) or protein, there is at least about 60% nucleotide sequence equivalence, even better would be 70%, preferably at least about 80% equivalence, more preferably at least about 85% equivalence, and most preferably at least about 90% equivalence over a comparison window of at least 20 nucleotide or amino acid positions, preferably at least 50 nucleotide or amino acid positions, more preferably at least 100 nucleotide or amino acid positions, and most preferably over the entire length of the first nucleic acid or protein. Optimal alignment of sequences for aligning a comparison window may be conducted by the local homology algorithm(s), preferably by computerized implementations of these algorithms (which can be found in, for example, Wisconsin Genetics Software Package Release 7.0, Genetics Computer Group, 575 Science Dr., Madison, Wis.). The reference nucleic acid may be a full-length molecule or a portion of a longer molecule. Alternatively, two nucleic acids have substantial identity if one hybridizes to the other under stringent conditions. Appropriate hybridization conditions can be determined empirically, or can be estimated based, for example, on the relative G+C content of the probe and the number of mismatches between the probe and target sequence, if known. Hybridization conditions can be adjusted as desired by varying, for example, the temperature of hybridizing or the salt concentration (Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Press, 1989).

[0070] A first nucleic acid sequence is "operably linked" with a second nucleic acid sequence when the sequences are so arranged that the first nucleic acid sequence affects the function of the second nucleic acid sequence. Preferably, the two sequences are part of a single contiguous nucleic acid molecule and more preferably are adjacent. For example, a promoter is operably linked to a gene if the promoter regulates or mediates transcription of the gene in a cell. For example, a transcriptional termination region (terminator) is operably linked to a gene when said terminator leads to a RNA polymerase ending a transcript containing said gene at or near the terminator. For example, an enhancer is often not adjacent to the promoter that it is exhibiting its effect on, but is generally in the same nucleic acid molecule.

[0071] A "recombinant" nucleic acid or DNA, or RNA molecule is made by an artificial combination of two otherwise separated segments of sequence, e.g., by chemical synthesis or by the manipulation of isolated segments of nucleic acids by genetic engineering techniques. Techniques for nucleic-acid manipulation are well-known (see, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Press, 1989). Methods for chemical synthesis of nucleic acids are discussed, for example, in Beaucage and Carruthers, Tetra. Letts. 22:1859-1862, 1981, and Matteucci et al., J. Am. Chem. Soc. 103:3185, 1981. Chemical synthesis of nucleic acids can be performed, for example, on commercial automated oligonucleotide synthesizers.

[0072] "Expression" of a gene refers to the transcription of a gene to produce the corresponding mRNA and translation of this mRNA to produce the corresponding gene product, i.e., a peptide, polypeptide, or protein. Gene expression is controlled or modulated by regulatory elements including 5' regulatory elements such as promoters.

[0073] The terms "recombinant DNA construct", "recombinant vector", "expression vector" or "expression cassette" refer to any agent such as a plasmid, cosmid, virus, BAC (bacterial artificial chromosome), autonomously replicating sequence, phage, or linear or circular single-stranded or double-stranded DNA or RNA nucleotide sequence, derived from any source, capable of genomic integration or autonomous replication, comprising a DNA molecule in which one or more DNA sequences have been linked in a functionally operative manner.

[0074] "Complementary" refers to the natural association of nucleic acid sequences by base-pairing. Complementarity between two single-stranded molecules may be partial, if only some of the nucleic acids pair are complementary; or complete, if all bases pair are complementary. The degree of complementarity affects the efficiency and strength of hybridization and amplification reactions.

[0075] "Homology" refers to the level of similarity between nucleic acid or amino acid sequences in terms of nucleotide or amino acid identity or similarity, respectively, i.e., sequence similarity or identity. Homology, homologue, and homologous also refers to the concept of similar functional properties among different nucleic acids or proteins. Homologues include genes that are orthologous and paralogous. Homologues can be determined by using the coding sequence for a gene, disclosed herein or found in appropriate database (such as that at NCBI or others) in one or more of the following ways. For a protein sequence, the sequences should be compared using algorithms (for instance see section on "identity" and "substantial identity"). For nucleotide sequences the sequence of one DNA molecule can be compared to the sequence of a known or putative homologue in much the same way. Homologues are at least 20% identical, more preferably 30%, more preferably 40%, more preferably 50% identical, more preferably 60%, more preferably 70%, more preferably 80%, more preferably 88%, more preferably 92%, most preferably 95%, across any substantial (25 nucleotide or amino acid, more preferably 50 nucleotide or amino acid, more preferably 100 nucleotide or amino acid, or most preferably the entire length of the shorter sequence) region of the molecule (DNA, RNA, or protein molecule).

[0076] Alternatively, two sequences, or DNA or RNA molecules that encode, or can encode, amino acid sequences, are homologous, or homologues, or encode homologous sequences, if the two sequences, or the complement of one or both sequences, hybridize to each other under stringent conditions and exhibit similar function. Thus if one were to determine whether two protein sequences were homologues, one would both do the computer exercises described herein, and create degenerate coding sequences of all possible nucleic acid sequences that could encode the proteins and determine whether they could hybridize under stringent conditions. Appropriate stringency conditions which promote DNA hybridization, for example, 6.0× sodium chloride/sodium citrate (SSC) at about 45° C., followed by a wash of 2.0×SSC at 50° C., are known to those skilled in the art or can be found in Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-6.3.6. For example, the salt concentration in the wash step can be selected from a low stringency of about 2.0×SSC at 50° C. to the high stringency of about 0.2×SSC at 50° C. In addition, the temperature in the wash step can be increased from low stringency conditions at room temperature, about 22° C., to high stringency conditions at about 65° C. Both temperature and salt may be varied, or either the temperature or the salt concentration may be held constant while the other variable is changed. In one preferred embodiment, a nucleic acid encoding a protein described in the present invention will specifically hybridize to one or more of the nucleic acid molecules or complements thereof or fragments of either under highly stringent conditions, for example at about 2.0×SSC and about 65° C. The hybridization of the probe to the target DNA molecule can be detected by any number of methods known to those skilled in the art, these can include, but are not limited to, fluorescent tags, radioactive tags, antibody based tags, and chemiluminescent tags.

[0077] "Cold shock protein(s)" (Csp(s) or CSP(s)) are proteins that have greater than 40% identity to Escherichia coli CspA protein (SEQ ID NO: 1) or Bacillus subtilis CspB protein (SEQ ID NO: 2), or, alternatively, cold shock proteins can be found by using the conserved domain as determined in the literature. For example, as used herein a cold shock protein is 40% identical, more preferably 50% identical, more preferably 60% identical, more preferably 70% identical, more preferably 80% identical, more preferably 90% identical, more preferably 95% identical to E. coli CspA or B. subtilis CspB across the entire length of E. coli CspA or B. subtilis CspB. Several databases are available that allow one skilled in the art to determine whether a new or existing protein contains a cold shock domain or is a cold shock protein, from Genbank to protein databases designed to allow the determination of protein relationships, and/or find related proteins. Included herein within the definition are all known cold shock proteins, including but not limited to CspA, CspB, CspC, CspD, CspE, CspF, CspG, CspH, and CspI (U.S. Pat. No. 6,610,533) from Escherichia coli.

[0078] The conserved cold shock domain is shown in SEQ ID NO: 3 ([FY]-G-F-I-x(6,7)-[DER]-[LIVM]-F-x-H-x-[STKR]-x-[LIVMFY]) (Prosite motif PS00352; Bucher and Bairoch, (In) ISMB-94; Proceedings 2nd International Conference on Intelligent Systems for Molecular Biology, Altman R., Brutlag D., Karp P., Lathrop R., Searls D., Eds., pp 53-61, AAAIPress, Menlo Park, 1994; Hofmann et al., Nucleic Acids Res. 27:215, 1999). Alternatively, cold shock proteins can be found using the Sprint database (a relational protein fingerprint database) (Attwood et al., Nucleic Acids Res. 28(1):225, 2000; Attwood, et al., Nucleic Acids Research, 30(1), in press, 2002). Alternatively, cold shock proteins can be found using a matrix based description, or Pfam. Pfam is a large collection of multiple sequence alignments and hidden Markov models covering many common protein domains (Bateman et al., Nucleic Acids Research 28:263, 2000). At this writing (November 2001; Pfam release 6) there are 3071 families. Cold shock proteins are included as PF00313. The species tree showing the distribution of cold shock proteins as determined in the Pfam database.

[0079] "Cold shock proteins" as used herein also include, but are not limited to, any protein that is found in a search, using a Cold shock protein as a query sequence, of a database using the "Blink" (Blast Link) function that can be found at the National Center for Biotechonology Information. "Blink" is a quick search function used to find proteins with similar sequences. This definition of "cold shock protein" or "cold shock domain" is in addition to those used above, and does not replace said definition. Cold shock proteins or proteins containing cold shock domains include, but are not limited to, all currently known proteins in public and private databases as well as those that have yet to be discovered that are similar enough to the claimed proteins (for example, E. coli CspA and B. subtilis CspB) to be "hits" under the standard blast search settings currently used in Blast Link (as of Nov. 1, 2001). As of this writing Blast 2 is being run, and Blast Link ("Blink") is running the default parameters for protein-protein blast searches. As of this writing we believe the default settings used in Blink are as follows; a BLOSUM62 matrix is being run, using the "nr" database, CD search is selected, as are composition based statistics, with the complexity selected as "low complexity", expect is 10, with a word size of 3, the gap costs are; existence 11, and extension 1. The list in Table I shows the first 200 hits for E. coli CspA using these standard settings, but we do not limit our claim to the first 200 hits. One skilled in the art would note that under these fairly stringent criteria 167 proteins of bacterial origin are found, but also 28 Metazoan and 5 plant proteins. These proteins include a broad range of proteins that, do to their homology to CspA, would be expected by the inventors to function in the present invention. This is by no means an all inclusive list, and other proteins would be expected to function in the present invention.

TABLE-US-00001 TABLE 20 Some cold shock proteins and proteins containing a cold shock domain found by similarity to E. Coli CspA. This list was compiled using the standard Blast Link settings at the National Center for Biotechnology information. The Genbank ID and name of each protein is shown. Genbank ID # Gene Name 576191 Major Cold Shock Protein 7.4 (Cspa (Cs 7.4)) Of (Escherichia Coli) 349561 DNA-binding protein [Salmonella typhimurium] 3891780 Chain A, Major Cold-Shock Protein From Escherichia Coli Solution Nm 479003 cold-shock protein [Escherichia coli] 1778828 major cold shock protein CSPA2 [Yersinia enterocolitica] 6073870 major cold shock protein CSPA1 [Yersinia enterocolitica] 1468921 cold shock potein CspG [Escherichia coli] 2275140 hypothetical protein [Yersinia pestis] 12514257 homolog of Salmonella cold shock protein [Escherichia coli O157:H7 15981565 major cold shock protein Cspa1 [Yersinia pestis] 3249024 cold shock protein CspB [Yersinia enterocolitica] 15979692 cold shock protein [Yersinia pestis] 1742550 Cold shock-like protein CspB. [Escherichia coli] 16419141 RNA chaperone, negative regulator of cspA transcription [Salmonella 10039151 cold shock-like protein cspE [Buchnera sp. APS] 9957540 cold shock protein B [Yersinia enterocolitica] 1778540 cold shock-like protein [Escherichia coli] 471099 CspE (MsmC) [Escherichia coli] 2961317 cspB [Salmonella typhimurium] 16503235 cold shock protein [Salmonella enterica subsp. enterica serovar 9658370 cold shock domain family protein [Vibrio cholerae] 460698 CspC (MsmB) [Escherichia coli] 15980582 putative cold shock protein [Yersinia pestis] 10038996 cold shock-like protein cspC [Buchnera sp. APS] 15979774 cold shock protein [Yersinia pestis] 9657556 cold shock transcriptional regulator CspA [Vibrio cholerae] 4454361 cold shock protein, CSPA [Vibrio cholerae] 2970685 cold shock protein C [Salmonella typhimurium] 1402743 major cold-shock protein [Citrobacter freundii] 5869509 CspG [Shewanella violacea] 5869504 CspA [Shewanella violacea] 9968446 cold shock protein [Lactobacillus plantarum] 1405474 CspC protein [Bacillus cereus] 3850776 cold shock protein D [Lactococcus lactis] 10176234 cold-shock protein [Bacillus halodurans] 1869948 cold shock protein [Lactobacillus plantarum] 729220 COLD SHOCK PROTEIN CSPC 7379745 putative transcriptional regulator [Neisseria meningitidis Z2491] 1620431 csp [Lactobacillus plantarum] 1405472 CspB protein [Bacillus cereus] 3892590 cold shock protein E [Lactococcus lactis] 7226073 cold-shock domain family protein [Neisseria meningitidis MC58] 2493766 COLD SHOCK-LIKE PROTEIN CSPLA (CSPL) 1001878 CspA protein [Listeria monocytogenes] 13623066 putative cold shock protein [Streptococcus pyogenes M1 GAS] 758663 cold shock protein [Arthrobacter globiformis] 4468119 cold shock protein A; CspA protein [Bordetella pertussis] 2370256 cold shock protein [Lactococcus lactis] 1405470 CspA protein [Bacillus cereus] 2226349 CspC [Staphylococcus aureus] 1405476 CspD protein [Bacillus cereus] 1513079 cold acclimation protein A [Pseudomonas fragi] 7242722 cold shock protein [Streptomyces coelicolor A3(2)] 2425105 major cold-shock protein [Micrococcus luteus] 2105046 cspA [Mycobacterium tuberculosis H37Rv] 15023696 Cold shock protein [Clostridium acetobutylicum] 12720931 MsmB [Pasteurella multocida] 8101860 major cold shock protein CspA [Staphylococcus aureus] 1513081 cold acclimation protein B [Pseudomonas fragi] 3097243 small cold-shock protein [Mycobacterium leprae] 9587215 cold-shock protein CspA [Mycobacterium smegmatis] 9107526 cold shock protein [Xylella fastidiosa 9a5c] 1256629 cold-shock protein [Bacillus subtilis] 12054789 cold shock protein (CspLB) [Listeria monocytogenes] 1864167 major cold-shock protein homolog CspB [Listeria monocytogenes] 1421212 Major Cold Shock Protein (Cspb) 297761 cold shock protein (CspB) [Bacillus subtilis] 13625473 cold acclimation protein CapB [Pseudomonas sp. 30/3] 9657576 cold shock DNA-binding domain protein [Vibrio cholerae] 11933043 cold-shock like protein [Streptomyces nodosus] 11933034 cold-shock like protein [Streptomyces hygroscopicus] 8248794 cold shock protein [Streptomyces coelicolor A3(2)] 1778825 major cold shock protein CspA [Pseudomonas aeruginosa] 740006 cold shock protein 2226347 CspB [Staphylococcus aureus] 1616777 cold shock-like protein [Stigmatella aurantiaca] 7210998 cold-shock protein [Streptomyces coelicolor A3(2)] 729217 COLD SHOCK PROTEIN CSPB 1067201 cold shock protein [Streptomyces coelicolor] 7321274 cold shock protein [Streptomyces coelicolor A3(2)] 1402789 major cold-shock protein [Yersinia enterocolitica] 1513086 temperature acclimation protein B [Pseudomonas fragi] 16411332 similar to cold shock protein [Listeria monocytogenes] 5732895 F40 [Streptomyces coelicolor A3(2)] 4193390 CspA [Myxococcus xanthus] 4193394 CspC [Myxococcus xanthus] 1405478 CspE protein [Bacillus cereus] 1402753 major cold-shock protein [Klebsiella pneumoniae] 2983729 cold shock protein [Aquifex aeolicus] 2815334 cold-shock domain protein [Streptomyces coelicolor A3(2)] 4193398 CspE [Myxococcus xanthus] 4193396 CspD [Myxococcus xanthus] 2894098 cold shock protein [Thermotoga maritima] 15074838 PUTATIVE COLD SHOCK-LIKE TRANSCRIPTION REGULATOR PROTEIN 1402731 major cold-shock protein [Aeromonas hydrophila] 46789 7 kDa cold shock like protein [Streptomyces clavuligerus] 9946316 probable cold-shock protein [Pseudomonas aeruginosa] 1402769 major cold-shock protein [Proteus vulgaris] 456240 major cold shock protein (CspB) [Sporosarcina globispora] 19743 nsGRP-2 [Nicotiana sylvestris] 15026046 Cold shock protein [Clostridium acetobutylicum] 11493820 cold shock protein C [Yersinia enterocolitica] 4982460 cold shock protein [Thermotoga maritima] 15979415 cold shock-like protein [Yersinia pestis] 16419455 similar to CspA but not cold shock induced [Salmonella typhimurium 14523127 putative cold shock protein [Sinorhizobium meliloti] 9107847 temperature acclimation protein B [Xylella fastidiosa 9a5c] 3036806 glycine-rich protein [Arabidopsis thaliana] 2182333 Y4cH [Rhizobium sp. NGR234] 1402733 major cold-shock protein [Aeromonas salmonicida] 9655615 cold shock-like protein CspD [Vibrio cholerae] 3831556 major cold shock protein [Enterococcus faecalis] 3821915 major cold shock protein [Lactococcus lactis subsp. cremoris] 15160284 AGR_L_3376p [Agrobacterium tumefaciens] 6458627 cold shock protein, CSD family [Deinococcus radiodurans] 3821923 major cold shock protein [Lactobacillus helveticus] 3821911 major cold shock protein [Lactococcus lactis subsp. lactis] 15157349 AGR_C_4003p [Agrobacterium tumefaciens] 15154976 AGR_C_161p [Agrobacterium tumefaciens] 3831558 major cold shock protein [Pediococcus pentosaceus] 456238 cold shock protein [Bacillus subtilis] 117574 COLD SHOCK-LIKE PROTEIN CSPD (CSP-D) 12620649 ID534 [Bradyrhizobium japonicum] 13424521 cold-shock domain family protein [Caulobacter crescentus] 3776223 CspA [Sinorhizobium meliloti] 15075353 PUTATIVE COLD SHOCK TRANSCRIPTION REGULATOR PROTEIN [Sinorhizobium 15075133 PROBABLE COLD SHOCK TRANSCRIPTION REGULATOR PROTEIN [Sinorhizobium 3821913 major cold shock protein [Lactococcus lactis subsp. lactis] 13476765 cold shock protein [Mesorhizobium loti] 3821925 major cold shock protein [Streptococcus thermophilus] 3821921 major cold shock protein [Lactobacillus acidophilus] 729222 COLD SHOCK-LIKE PROTEIN CSPJ 15162334 AGR_pAT_762p [Agrobacterium tumefaciens] 13475232 cold shock protein [Mesorhizobium loti] 9947082 probable cold-shock protein [Pseudomonas aeruginosa] 13424199 cold-shock domain family protein [Caulobacter crescentus] 9948689 cold-shock protein CspD [Pseudomonas aeruginosa] 4193392 CspB [Myxococcus xanthus] 13488430 cold shock protein [Mesorhizobium loti] 12720739 CspD [Pasteurella multocida] 3831560 major cold shock protein [Bifidobacterium animalis] 1513084 temperature acclimation protein A [Pseudomonas fragi] 1169113 COLD SHOCK-LIKE PROTEIN CSPD 5714745 cold shock protein 7.4 [Rhodococcus sp. 7/1] 1402767 major cold-shock protein [Photobacterium phosphoreum] 14523160 probable CspA5 cold shock protein transcriptional regulator 15979447 cold shock-like protein [Yersinia pestis] 13488214 cold-shock protein [Mesorhizobium loti] 5714743 cold shock protein A [Rhodococcus sp. 5/14] 3861208 COLD SHOCK-LIKE PROTEIN (cspA) [Rickettsia prowazekii] 81624 glycine-rich protein 2-Arabidopsis thaliana 15156913 AGR_C_3315p [Agrobacterium tumefaciens] 15074652 PUTATIVE COLD SHOCK TRANSCRIPTION REGULATOR PROTEIN [Sinorhizobium 7295442 CG17334 gene product [Drosophila melanogaster] 3850772 cold shock protein A [Lactococcus lactis] 14334920 putative glycine-rich zinc-finger DNA-binding protein [Arabidopsis 3892588 cold shock protein C [Lactococcus lactis] 2708747 putative glycine-rich, zinc-finger DNA-binding protein [Arabidopsis 2739396 Y-box protein [Drosophila melanogaster] 1402763 major cold-shock protein [Photobacterium mondopomensis] 15620137 cold shock-like protein [Rickettsia conorii] 1402755 major cold-shock protein [Lactobacillus casei] 409419 Y-Box factor [Aplysia californica] 14039811 Y-box binding protein [Schistosoma japonicum] 9946868 probable cold-shock protein [Pseudomonas aeruginosa] 1483311 Y-box protein [Dugesia japonica] 1477478 Y-box binding protein [Schistosoma mansoni] 1402759 major cold-shock protein [Listeria innocua] 15159048 AGR_L_1288p [Agrobacterium tumefaciens] 2228815 major cold-shock protein CspH [Salmonella typhimurium] 6911694 cold-shock protein A [Streptococcus thermophilus] 2970679 Y box protein [Drosophila silvestris] 14602477 Similar to cold shock domain protein A [Homo sapiens] 10727970 yps gene product [Drosophila melanogaster] 1402757 major cold-shock protein [Listeria grayi] 1402751 major cold-shock protein [Enterococcus faecalis] 1083796 RYB-a protein-rat 505133 RYB-a [Rattus norvegicus] 14523481 probable CspA6 cold shock protein transcriptional regulator 8100512 Y-box protein ZONAB-B [Canis familiaris] 8100510 Y-box protein ZONAB-A [Canis familiaris] 15306095 hypothetical protein XP_053028 [Homo sapiens] 10185725 Y-box protein 3 short isoform [Mus musculus] 10185723 Y-box protein 3 long isoform [Mus musculus] 7385223 RNA binding protein MSY4 [Mus musculus] 6166110 DNA-BINDING PROTEIN A (COLD SHOCK DOMAIN PROTEIN A) 1402783 major cold-shock protein [Streptococcus pyogenes] 1167838 DNA-binding protein [Homo sapiens] 1160331 dbpA murine homologue [Mus musculus] 1101884 YB2 [Rattus norvegicus] 950340 DNA-binding protein A [Homo sapiens] 532211 Y-box binding protein [Mus musculus] 87332 DNA-binding protein A-human (fragment) 14742409 hypothetical protein XP_046353 [Homo sapiens] 14270385 cold-shock domain protein [Takifugu rubripes] 9653686 TSH receptor suppressor element-binding protein-1; TSEP-1 8249978 cold shock protein B [Streptomyces coelicolor A3(2)] 3695368 zfYl [Danio rerio] Note: Due to the way proteins are named, some proteins and sequences will have several entries, as proteins, cDNAs, alleles, etc. Genbank ID can be considered to be specific identifiers of each entry. Entries are in the approximate order of highest to lowest identity, in comparison with the query sequence.

[0080] Bacillus subtilis (B. subtilis) CspB is a protein that accumulates in response to cold shock (Willimsky, et al. Journal of Bacteriology 174:6326 (1992)). It has homology to CspA from E. coli (see Table I) and contains a single stranded nucleic acid binding domain (Lopez, et al., The Journal of Biological Chemistry 276:15511 (2001)). Using the same basic Blast search at NCBI (Blink) the following proteins are designated as "hits". The number of hits shown here is limited to 200, but many other proteins would be expected function in the invention.

TABLE-US-00002 TABLE 21 Some cold shock proteins and proteins containing cold shock domains found searching with B. subtilis CspB. This list was compiled using the standard Blast Link (Blink) settings at the National Center for Biotechnology Information. The Genbank ID and name of each protein is shown. GenBank ID # Gene Name 1421212 Major Cold Shock Protein (Cspb) 1405476 CspD protein [Bacillus cereus] 729217 COLD SHOCK PROTEIN CSPB 456240 major cold shock protein (CspB) [Sporosarcina globispora] 1256629 cold-shock protein [Bacillus subtilis] 740006 cold shock protein 456238 cold shock protein [Bacillus subtilis] 12054789 cold shock protein (CspLB) [Listeria monocytogenes] 1864167 major cold-shock protein homolog CspB [Listeria monocytogenes] 1405472 CspB protein [Bacillus cereus] 8101860 major cold shock protein CspA [Staphylococcus aureus] 16411332 similar to cold shock protein [Listeria monocytogenes] 10176234 cold-shock protein [Bacillus halodurans] 2493766 COLD SHOCK-LIKE PROTEIN CSPLA (CSPL) 1001878 CspA protein [Listeria monocytogenes] 1405470 CspA protein [Bacillus cereus] 1405474 CspC protein [Bacillus cereus] 13623066 putative cold shock protein [Streptococcus pyogenes M1 GAS] 72922000 COLD SHOCK PROTEIN CSPC 2226349 CspC [Staphylococcus aureus] 9968446 cold shock protein [Lactobacillus plantarum] 1402739 major cold-shock protein [Bacillus subtilis] 3892590 cold shock protein E [Lactococcus lactis] 2226347 CspB [Staphylococcus aureus] 3850776 cold shock protein D [Lactococcus lactis] 1402741 major cold-shock protein [Bacillus subtilis] 15979774 cold shock protein [Yersinia pestis] 10039151 cold shock-like protein cspE [Buchnera sp. APS] 8248794 cold shock protein [Streptomyces coelicolor A3(2)] 460698 CspC (MsmB) [Escherichia coli] 11933043 cold-shock like protein [Streptomyces nodosus] 11933034 cold-shock like protein [Streptomyces hygroscopicus] 1620431 csp [Lactobacillus plantarum] 16419141 RNA chaperone, negative regulator of cspA transcription [Salmonella typhimurium LT2] 15979692 cold shock protein [Yersinia pestis] 2894098 cold shock protein [Thermotoga maritima] 1869948 cold shock protein [Lactobacillus plantarum] 2370256 cold shock protein [Lactococcus lactis] 2970685 cold shock protein C [Salmonella typhimurium] 1778540 cold shock-like protein [Escherichia coli] 471099 CspE (MsmC) [Escherichia coli] 10038996 cold shock-like protein cspC [Buchnera sp. APS] 7242722 cold shock protein [Streptomyces coelicolor A3(2)] 15026046 Cold shock protein [Clostridium acetobutylicum] 15980582 putative cold shock protein [Yersinia pestis] 9657576 cold shock DNA-binding domain protein [Vibrio cholerae] 349561 DNA-binding protein [Salmonella typhimurium] 4982460 cold shock protein [Thermotoga maritima] 1405478 CspE protein [Bacillus cereus] 9946316 probable cold-shock protein [Pseudomonas aeruginosa] 9658370 cold shock domain family protein [Vibrio cholerae] 5869509 CspG [Shewanella violacea] 1067201 cold shock protein [Streptomyces coelicolor] 9948689 cold-shock protein CspD [Pseudomonas aeruginosa] 3891780 Chain A, Major Cold-Shock Protein From Escherichia Coli Solution Nmr Structure 576191 Major Cold Shock Protein 7.4 (Cspa (Cs 7.4)) Of (Escherichia Coli) 72232 major cold shock protein cspA-Escherichia coli 9657556 cold shock transcriptional regulator CspA [Vibrio cholerae] 6458627 cold shock protein, CSD family [Deinococcus radiodurans] 3831556 major cold shock protein [Enterococcus faecalis] 15023696 Cold shock protein [Clostridium acetobutylicum] 2425105 major cold-shock protein [Micrococcus luteus] 1402737 major cold-shock protein [Bacillus cereus] 9587215 cold-shock protein CspA [Mycobacterium smegmatis] 7226073 cold-shock domain family protein [Neisseria meningitidis MC58] 4454361 cold shock protein, CSPA [Vibrio cholerae] 479003 cold-shock protein [Escherichia coli] 3097243 small cold-shock protein [Mycobacterium leprae] 1778828 major cold shock protein CSPA2 [Yersinia enterocolitica] 758663 cold shock protein [Arthrobacter globiformis] 2105046 cspA [Mycobacterium tuberculosis H37Rv] 7379745 putative transcriptional regulator [Neisseria meningitidis Z2491] 3249024 cold shock protein CspB [Yersinia enterocolitica] 7210998 cold-shock protein [Streptomyces coelicolor A3(2)] 1513081 cold acclimation protein B [Pseudomonas fragi] 5869504 CspA [Shewanella violacea] 1778825 major cold shock protein CspA [Pseudomonas aeruginosa] 1513086 temperature acclimation protein B [Pseudomonas fragi] 12514257 homolog of Salmonella cold shock protein [Escherichia coli O157:H7 EDL933] 5732895 F40 [Streptomyces coelicolor A3(2)] 3831558 major cold shock protein [Pediococcus pentosaceus] 1468921 cold shock potein CspG [Escherichia coli] 13625473 cold acclimation protein CapB [Pseudomonas sp. 30/3] 6073870 major cold shock protein CSPA1 [Yersinia enterocolitica] 1402771 major cold-shock protein [Staphylococcus aureus] 1402761 major cold-shock protein [Lactococcus lactis subsp. cremoris] 15981565 major cold shock protein Cspa1 [Yersinia pestis] 9107847 temperature acclimation protein B [Xylella fastidiosa 9a5c] 7321274 cold shock protein [Streptomyces coelicolor A3(2)] 2815334 cold-shock domain protein [Streptomyces coelicolor A3(2)] 2275140 hypothetical protein [Yersinia pestis] 9947082 probable cold-shock protein [Pseudomonas aeruginosa] 2983729 cold shock protein [Aquifex aeolicus] 2961317 cspB [Salmonella typhimurium] 46789 7 kDa cold shock like protein [Streptomyces clavuligerus] 9107526 cold shock protein [Xylella fastidiosa 9a5c] 1513079 cold acclimation protein A [Pseudomonas fragi] 4193394 CspC [Myxococcus xanthus] 4193392 CspB [Myxococcus xanthus] 3821911 major cold shock protein [Lactococcus lactis subsp. lactis] 16503235 cold shock protein [Salmonella enterica subsp. enterica serovar Typhi] 9957540 cold shock protein B [Yersinia enterocolitica] 3821921 major cold shock protein [Lactobacillus acidophilus] 1616777 cold shock-like protein [Stigmatella aurantiaca] 1402759 major cold-shock protein [Listeria innocua] 4468119 cold shock protein A; CspA protein [Bordetella pertussis] 1742550 Cold shock-like protein CspB. [Escherichia coli] 12720739 CspD [Pasteurella multocida] 3821915 major cold shock protein [Lactococcus lactis subsp. cremoris] 1402765 major cold-shock protein [Pediococcus pentosaceus] 1513084 temperature acclimation protein A [Pseudomonas fragi] 4193396 CspD [Myxococcus xanthus] 4193398 CspE [Myxococcus xanthus] 3831560 major cold shock protein [Bifidobacterium animalis] 4193390 CspA [Myxococcus xanthus] 3821923 major cold shock protein [Lactobacillus helveticus] 12720931 MsmB [Pasteurella multocida] 3850772 cold shock protein A [Lactococcus lactis] 9655615 cold shock-like protein CspD [Vibrio cholerae] 9946868 probable cold-shock protein [Pseudomonas aeruginosa] 1402757 major cold-shock protein [Listeria grayi] 3821913 major cold shock protein [Lactococcus lactis subsp. lactis] 1402735 major cold-shock protein [Bacillus atrophaeus] 1402751 major cold-shock protein [Enterococcus faecalis] 3892588 cold shock protein C [Lactococcus lactis] 1169113 COLD SHOCK-LIKE PROTEIN CSPD 15979415 cold shock-like protein [Yersinia pestis] 117574 COLD SHOCK-LIKE PROTEIN CSPD (CSP-D) 15075133 PROBABLE COLD SHOCK TRANSCRIPTION REGULATOR PROTEIN [Sinorhizobium meliloti] 16419455 similar to CspA but not cold shock induced [Salmonella typhimurium LT2] 11493820 cold shock protein C [Yersinia enterocolitica] 1402783 major cold-shock protein [Streptococcus pyogenes] 3821925 major cold shock protein [Streptococcus thermophilus] 1402775 major cold-shock protein [Streptococcus dysgalactiae] 8249978 cold shock protein B [Streptomyces coelicolor A3(2)] 15160284 AGR_L_3376p [Agrobacterium tumefaciens] 81624 glycine-rich protein 2-Arabidopsis thaliana 19743 nsGRP-2 [Nicotiana sylvestris] 2916930 cspB [Mycobacterium tuberculosis H37Rv] 13475232 cold shock protein [Mesorhizobium loti] 3861208 COLD SHOCK-LIKE PROTEIN (cspA) [Rickettsia prowazekii] 2182333 Y4cH [Rhizobium sp. NGR234] 13476765 cold shock protein [Mesorhizobium loti] 3776223 CspA [Sinorhizobium meliloti] 1402755 major cold-shock protein [Lactobacillus casei] 15620137 cold shock-like protein [Rickettsia conorii] 15154976 AGR_C_161p [Agrobacterium tumefaciens] 15074838 PUTATIVE COLD SHOCK-LIKE TRANSCRIPTION REGULATOR PROTEIN [Sinorhizobium meliloti] 14548150 RNA-binding cold-shock protein [uncultured crenarchaeote 4B7] 2440094 small cold-shock protein [Mycobacterium leprae] 14523127 putative cold shock protein [Sinorhizobium meliloti] 12620649 ID534 [Bradyrhizobium japonicum] 1063684 AtGRP2b [Arabidopsis thaliana] 13424521 cold-shock domain family protein [Caulobacter crescentus] 3036806 glycine-rich protein [Arabidopsis thaliana] 1402731 major cold-shock protein [Aeromonas hydrophila] 214642 p54 [Xenopus laevis] 15075353 PUTATIVE COLD SHOCK TRANSCRIPTION REGULATOR PROTEIN [Sinorhizobium meliloti] 13424199 cold-shock domain family protein [Caulobacter crescentus] 14602477 Similar to cold shock domain protein A [Homo sapiens] 1175535 CYTOPLASMIC RNA-BINDING PROTEIN P56 (Y BOX BINDING PROTEIN-2) (Y-BOX TRANSCRIPTION FACTOR) (MRNP4) 104266 Ybox-binding protein 2-African clawed frog 15157349 AGR_C_4003p [Agrobacterium tumefaciens] 8100512 Y-box protein ZONAB-B [Canis familiaris] 8100510 Y-box protein ZONAB-A [Canis familiaris] 1483311 Y-box protein [Dugesia japonica] 1402767 major cold-shock protein [Photobacterium phosphoreum] 1402733 major cold-shock protein [Aeromonas salmonicida] 15306095 hypothetical protein XP_053028 [Homo sapiens] 14742409 hypothetical protein XP_046353 [Homo sapiens] 14270385 cold-shock domain protein [Takifugu rubripes] 10185725 Y-box protein 3 short isoform [Mus musculus] 10185723 Y-box protein 3 long isoform [Mus musculus] 9653686 TSH receptor suppressor element-binding protein-1; TSEP-1 [Rattus sp.] 7385223 RNA binding protein MSY4 [Mus musculus] 6166110 DNA-BINDING PROTEIN A (COLD SHOCK DOMAIN PROTEIN A) (SINGLE-STRAND DNA BINDING PROTEIN NF-GMB) 3695368 zfY1 [Danio rerio] 2745892 Y box transcription factor [Mus musculus] 2073109 Y box protein 1 [Carassius auratus] 1353778 Y-Box binding protein [Columba livia] 1167838 DNA-binding protein [Homo sapiens] 1160331 dbpA murine homologue [Mus musculus] 1101884 YB2 [Rattus norvegicus] 1083796 RYB-a protein-rat 988283 mYB-1b [Mus musculus] 988281 mYB-1a [Mus musculus] 950340 DNA-binding protein A [Homo sapiens] 608518 p50 [Oryctolagus cuniculus] 532211 Y-box binding protein [Mus musculus] 516701 similar to dbpB/YB-1 of mouse [Gallus gallus] 505133 RYB-a [Rattus norvegicus] 457262 nuclease sensitive element binding protein-1 [Homo sapiens] 423015 nuclease sensitive element-binding protein 1-human 289797 YB-1 protein [Gallus gallus] 203398 putative [Rattus norvegicus] 199821 Y box transcription factor [Mus musculus] 189299 DNA-binding protein [Homo sapiens] 162983 transcription factor EF1(A) [Bos taurus] 115848 Y BOX BINDING PROTEIN-1 (Y-BOX TRANSCRIPTION FACTOR) (YB-1) (CCAAT-BINDING TRANSCRIPTION FACTOR I SUBUNIT A) (CBF-A) (ENHANCER FACTOR I SUBUNIT A) (EFI-A) (DNA-BINDING PROTEIN B) (DBPB) 112410 Y box-binding protein 1-rat Note: Due to the way proteins are named, some proteins and sequences will have several entries, as proteins, cDNAs, alleles, etc. Genbank ID can be considered to be specific identifiers of each entry. Entries are in the approximate order of highest to lowest identity to the query sequence.

[0081] CSPs are a group of proteins that may or may not be increased in amount when the temperature is lowered or other stress is applied. In fact, in the best studied organism with respect to the cold shock proteins, E. coli, some cold shock proteins are constitutively expressed while others are induced by cold, still others seem to be specific for specific stresses and/or growth conditions or stages. A review of this is Yamanaka, et al., Molecular Microbiology, 27:247 (1998). In this review Yamanaka and colleagues detail how the nine cold shock proteins in E. coli (CspA through CspI) are expressed. CspA, CspB, and CspG are cold inducible. CspD is induced at the stationary phase of the cell cycle and during starvation. CspC and E have been implicated in cell division.

[0082] CspA is the major cold shock protein from Escherichia coli (E. coli) (SEQ ID NO:1). CspA is also called Major Cold Shock Protein 7.4. CspA is highly induced in response to cold shock (Goldstein, et al., Proceedings of the National Academy of Science (USA) 87:283 (1990)). In some conditions of slower growth, ribosomes are slowed due to RNA or DNA secondary structure formation, and this may act as a signal for the increased synthesis of CSPs in their native organism. CSPs bind to ssDNA and RNA under in-vitro conditions (Phadtare, et al., Molecular Microbiology 33:1004 (1999)). CSPs are thought to bind to RNA in a relatively non-specific manner during translation and prevent secondary structure formation and stabilize the RNA (this function is sometimes referred as an RNA chaperone). The ribosome can then easily displace the CSPs and initiate translation on a linear RNA template. We believe that the present invention might involve the single stranded nucleic acid binding function of these proteins, and this function can come from any cold shock protein or protein containing a cold shock domain, which includes, for example, prokaryotic cold shock proteins, eukaryotic Y-Box containing genes, some glycine rich proteins (GRP), and other proteins containing the cold shock domain. These proteins include, but are not limited to, those shown in FIG. 4, Trends in Biochemical Science, 23(8):289 (1998) (paper included, herein incorporated by reference). This figure clearly shows the evolutionary relationship between these proteins. The origin of these proteins likely precedes the divergence of modern day bacteria and eukaryotes, and it has been postulated that these proteins may have been present at the advent of single cell evolution, 3.5 billion years ago. We have selected two proteins to transform into plants as examples, as shown in the figure cited above these proteins are more greatly divergent from each other than from many of their eukaryotic counterparts. We expect that the ectopic expression of these proteins may improve tolerance to biotic and abiotic stresses which could include but are not limited to the growth, vigor, yield, and health of plants under a variety of stressful conditions that may include cold, drought, salt stress, heat, survival after cold shock, fungal infection, viral infection, microbial infection, and cold germination.

[0083] Another possible explanation for the increased growth rate of plants under stress could be the elicitation of pathogen-associated molecular patterns (PAMP) provided by the expression of CSPs. In this model a plant would develop a PAMP response that would elicit a plant response somewhat like systemic acquired resistance (SAR) (much like SAR works for biotic stresses) as the plant would be "prepared" for the stress prior to its application. For this model to work the plant must be signaled that the CSP is present, this mechanism may have recently been provided through a plant receptor that binds CSP (Felix, et al, Journal of Biological Chemistry 278(8):6201-8 (2003)). This mechanism would mean that any gene that bound a receptor which elicited a PAMP-type response would function in the invention. Elicitation of PAMP-type responses has generally been studied for biotic stresses, and has often been elicited through exogenous administration of agents. Herein we could be eliciting the PAMP-type response to the CSP produced from the CSP transgene. The transgene transformed into a plant cell as part of a recombinant DNA construct, through a particle gun or agrobacterium mediated transformation. This in turn could be creating a systemic acquired resistance type response in the plant, in turn increasing resistance to abiotic stress. This response could work in both monocots and dicots, including but not limited to corn, soybean, wheat, rice, Arabidopsis, canola, and cotton. If the above PAMP method is the mode of action for the CSPs, then the CSP might be expected to provide biotic stress protection as well as abiotic stress protection. None of these mechanisms are meant to be limiting and one or both, or myriad others, could be involved in the phenotype manifested.

[0084] MF2, a Csp-like protein from Bacillus thuringensis, has been purported to give some protection against viral infection in a plant. U.S. Pat. No. 6,528,480 shows this tolerance to biotic stress via rubbing the leaves of a plant with an extract containing the protein and infecting the plant with a virus. They contemplate, but do not create, transgenic plants therein.

[0085] "Non-transformed plant of the same species" is meant to be inclusive of all plants of the same species as a transformed plant. In one embodiment the transformed plants is of the same species and strain as the transformed plant. In another embodiment the plant is as identical as possible to the transformed plant.

[0086] The "cold shock domain" (CSD) is a protein sequence that is homologous to the cold shock proteins. For the purposes of this invention, a cold shock domain containing protein is a "cold shock protein". Greater than 40%, 50%, 60%, 70%, 80%, 90%, 95%, or 98% amino acid identity is seen between E. coli CspA or B. subtilis CspB and the cold shock domains of cold shock domain containing proteins (Wistow, Nature 344:823 (1990); Yamanaka, et al., Mol. Micro., 27:247, specifically see FIG. 1B in the Yamanaka reference; Graumann, et al. TIBS 23:286).

[0087] As used herein "yeast" regularly refers to Saccharomyces cerevissiae but could also include Schizosacchoramyces pombe and other varieties (from the genus Pichia, for example). "Corn" refers to Zea Mays and all species and varieties that can be bred with it. "Wheat" refers to all of Triticum aestivum varieties including but not limited to spring, winter, and all facultative wheat varieties. "Wheat" includes any other wheat species, including but not limited to durum wheat (Triticum durum), spelt (Triticum spelta), emmer (Triticum dicoccum), and wild wheat (Triticum monococcum). "Wheat" also includes any species that can be bred with any of the aforementioned wheat species and offspring of said crosses (including triticale, a hybrid of wheat and rye). "Soybeans" refers to Glycine max or Glycine soja and any species or variety that can be bred with them. "Rice" refers to Oryza sativa and any species or variety that can be bred with it. "Barley" refers to Hordeum vulgare and any species or variety that can be bred with it. "Oats" refers to Avena sativa and any species or variety that can be bred with it. "Canola" is a coined name recently given to seed, oil, and meal produced by genetically modified rapeseed plants, oilseed rape (Brassica napus L.) and turnip rape (B. campestris L), herein canola includes all rapeseed plants and organisms that can be bred with them. E. coli and Escherichia coli as used herein includes organisms of the Escherichia coli species and all strains of that this organism; i.e. E. coli K12. E. coli and Escherichia coli as used herein can also includes any organism that can conjugate with any E. coli strain when one is an F.sup.+ or Hfr strain, and the other is not. B. subtilis and Bacillus subtilis refers to all organism of the genus Bacillus, species subtilis. Agrobacterium tumifaciens as used herein includes all strains and types of this species. "Turf grasses" include all species and strains of grass ever planted, or that could be planted, to produce a turf, including but not limited to; a lawn, a field for playing a game (i.e. football, baseball, or soccer), and all areas of a golf course (i.e. tee, fairway, green, rough, etc.). "Cotton" refers to all plants in the genus Gossypium and all plants that can be bred with them.

[0088] "Heat tolerance" is meant herein as a measure of a plants ability to grow under conditions where heat, or warmer temperature, would detrimentally affect the growth, vigor, yield, size, of the a plant of the same species. Heat tolerant plants grow better under conditions of heat stress than non heat tolerant plants of the same species.

[0089] "Salt tolerance" refers to the ability of some plants to grow under osmotic stress, or stress caused by salts or ions in the water and soil. For example, a plant with increased growth rate, compared to a plant of the same species and/or variety, when watered with a liquid, or planted in a media, containing a mix of water and ions that detrimentally affect the growth of another plant of the same species would be said to be salt tolerant. Some transformed plants have a greater tolerance for these types of conditions than non-transformed plants of the same species and strain.

[0090] All numbers used herein should be modified by the term "about", about means that the number can vary, in either direction, by up to 10 percent and still retain the same meaning. For example, a 1 M solution should include all solutions of that type less than, and including, 1.1 M and more than 0.9 M. For example, a percentage can also be modified, 10% is inclusive of all percentages from 9% to 11%. Terms defined by the adjective "exactly" are not defined by the term "about".

[0091] A "glycine rich protein" is defined as a protein in a eukaryote that is, or has substantial identity with, or is a homologue of, a protein containing a cold shock domain.

[0092] "Survival after cold shock" is defined as the ability of a plant to continue growth for a significant period of time after being placed at a temperature below that normally encountered by a plant of that species at that growth stage. It should be noted that some plants, even those of the same species, have been selected for growth under cold conditions. The inbred Wigor strain of corn can tolerate cold conditions and has a significantly higher survival rate when placed in those conditions than most commercial lines sold in the U.S. Wigor is sold commercially in Poland. Thus cold tolerance for transgenic plants must be compared within plants of the same strain at the same relative age, as well as plants of the same species, to gain meaningful scientific data. Plants would then be scored immediately, or some day(s) or week(s) later to determine their viability, growth rate, and other phenotypes after the shock.

[0093] "Drought" or "water would be limiting for growth" is defined as a period of dryness that, especially when prolonged, can cause damage to crops or prevent their successful growth. Again different plants of the same species, and those of different strains of the same species, may have different tolerance for drought, dryness, and/or lack of water. In the laboratory drought can be simulated by giving plants 95% or less water than a control plant and looking for differences in vigor, growth, size, root length, and myriad other physiologic and physical measures. Drought can also be simulated in the field by watering some plants, but not others, and comparing their growth rate, especially where water is severely limited for the growth of that plant.

[0094] Abiotic stress tolerance includes, but is not limited to, increased yield, growth, biomass, health, or other measure that indicates tolerance to a stress which includes but is not limited to heat stress, salt stress, cold stress (including cold stress during germination), water stress (including but not limited to drought stress), nitrogen stress (including high and low nitrogen).

[0095] Biotic stress tolerance includes, but is not limited to, increased yield, growth, biomass, health, or other measure that indicates tolerance to a stress which includes but is not limited to fungal infection, bacterial infection, and viral infection of a plant.

[0096] Certain of the gene sequences disclosed as part of the invention are bacterial in origin, for example, certain prokaryotic cold shock proteins. It is known to one skilled in the art that unmodified bacterial genes are sometimes poorly expressed in transgenic plant cells. Plant codon usage more closely resembles that of humans and other higher organisms than unicellular organisms, such as bacteria. Several reports have disclosed methods for improving expression of recombinant genes in plants. These reports disclose various methods for engineering coding sequences to represent sequences which are more efficiently translated based on plant codon frequency tables, improvements in codon third base position bias, using recombinant sequences which avoid suspect polyadenylation or A/T rich domains or intron splicing consensus sequences. While these methods for synthetic gene construction are notable, the inventors have contemplated creating synthetic genes for cold shock proteins or proteins containing cold shock domains according to the method of Brown et al. (U.S. Pat. No. 5,689,052 1997, which is herein incorporated in its entirety by reference) and/or by the above cited, as well as other methods. Thus, the present invention provides a method for preparing synthetic plant genes express in planta a desired protein product. Briefly, according to Brown et al., the frequency of rare and semi-rare monocotyledonous codons in a polynucleotide sequence encoding a desired protein are reduced and replaced with more preferred monocotyledonous codons. Enhanced accumulation of a desired polypeptide encoded by a modified polynucleotide sequence in a monocotyledonous plant is the result of increasing the frequency of preferred codons by analyzing the coding sequence in successive six nucleotide fragments and altering the sequence based on the frequency of appearance of the six-mers as to the frequency of appearance of the rarest 284, 484, and 664 six-mers in monocotyledonous plants. Furthermore, Brown et al. disclose the enhanced expression of a recombinant gene by applying the method for reducing the frequency of rare codons with methods for reducing the occurrence of polyadenylation signals and intron splice sites in the nucleotide sequence, removing self-complementary sequences in the nucleotide sequence and replacing such sequences with nonself-complementary nucleotides while maintaining a structural gene encoding the polypeptide, and reducing the frequency of occurrence of 5'-CG-3' dinucleotide pairs in the nucleotide sequence. These steps are performed sequentially and have a cumulative effect resulting in a nucleotide sequence containing a preferential utilization of the more-preferred monocotyledonous codons for monocotyledonous plants for a majority of the amino acids present in the desired polypeptide. Specifically all the protein mentioned herein are contemplated to be made into synthetic genes as discussed above, or using similar methods, including but not limited to Escherichia coli CspA and Bacillus subtilis CspB.

[0097] The work described herein has identified methods of potentiating in planta expression of cold shock proteins and proteins containing cold shock domains, which may confer resistance to many plant stresses, which can include but are not limited to cold, heat, drought, salt, and other stresses, or stress related phenotypes (cold germination, survival after cold stress, and other abiotic stresses) when ectopically expressed after incorporation into the nuclear, plastid, or chloroplast genome of susceptible plants. U.S. Pat. No. 5,500,365 (specifically incorporated herein by reference) describes a method for synthesizing plant genes to optimize the expression level of the protein for which the synthesized gene encodes. This method relates to the modification of the structural gene sequences of the exogenous transgene, to make them more "plant-like" and therefore more likely to be translated and expressed by the plant, monocot or dicot. However, the method as disclosed in U.S. Pat. No. 5,689,052 provides for enhanced expression of transgenes, preferably in monocotyledonous plants.

[0098] In developing the nucleic acid constructs of this invention, the various components of the construct or fragments thereof will normally be inserted into a convenient cloning vector, e.g., a plasmid that is capable of replication in a bacterial host, e.g., E. coli. Numerous vectors exist that have been described in the literature, many of which are commercially available. After each cloning, the cloning vector with the desired insert may be isolated and subjected to further manipulation, such as restriction digestion, insertion of new fragments or nucleotides, ligation, deletion, mutation, resection, etc. so as to tailor the components of the desired sequence. Once the construct has been completed, it may then be transferred to an appropriate vector for further manipulation in accordance with the manner of transformation of the host cell.

[0099] A double-stranded DNA molecule of the present invention containing, for example, a cold shock protein in an expression cassette can be inserted into the genome of a plant by any suitable method. Suitable plant transformation vectors include those derived from a Ti plasmid of Agrobacterium tumefaciens, as well as those disclosed, e.g., by Herrera-Estrella et al. (1983), Bevan (1984), Klee et al. (1985) and EPO publication 120,516. In addition to plant transformation vectors derived from the Ti or root-inducing (Ri) plasmids of Agrobacterium, alternative methods can be used to insert the DNA constructs of this invention into plant cells. Such methods may involve, but are not limited to, for example, the use of liposomes, electroporation, chemicals that increase free DNA uptake, free DNA delivery via microprojectile bombardment, and transformation using viruses or pollen.

[0100] A plasmid expression vector suitable for the introduction of a gene coding for a cold shock protein, or protein containing a cold shock domain in monocots using electroporation could be composed of the following: a promoter that functions in plants; an intron that provides a splice site to facilitate expression of the gene, such as the Hsp70 intron (PCT Publication WO93/19189); and a 3' polyadenylation sequence such as the nopaline synthase 3' sequence (NOS 3'). This expression cassette may be assembled on high copy replicons suitable for the production of large quantities of DNA.

[0101] An example of a useful Ti plasmid cassette vector for plant transformation is pMON-17227. This vector is described in PCT Publication WO 92/04449 and contains a gene encoding an enzyme conferring glyphosate resistance (denominated CP4), which is an excellent selection marker gene for many plants. The gene is fused to the Arabidopsis EPSPS chloroplast transit peptide (CTP2) and expressed from the FMV promoter as described therein. When an adequate numbers of cells (or protoplasts) containing the sedoheptulose-1,7-bisphosphatase gene or cDNA are obtained, the cells (or protoplasts) are regenerated into whole plants. Choice of methodology for the regeneration step is not critical, with suitable protocols being available for hosts from Leguminosae (alfalfa, soybean, clover, etc.), Umbelliferae (carrot, celery, parsnip), Cruciferae (cabbage, radish, canola/rapeseed, etc.), Cucurbitaceae (melons and cucumber), Gramineae (wheat, barley, rice, maize, etc.), Solanaceae (potato, tobacco, tomato, peppers), various floral crops, such as sunflower, and nut-bearing trees, such as almonds, cashews, walnuts, and pecans.

[0102] Plants that can be made to express cold shock proteins by practice of the present invention include, but are not limited to, Acacia, alfalfa, aneth, apple, apricot, artichoke, arugula, asparagus, avocado, banana, barley, beans, beet, blackberry, blueberry, broccoli, brussels sprouts, cabbage, canola, cantaloupe, carrot, cassava, cauliflower, celery, cherry, cilantro, citrus, clementines, coffee, corn, cotton, cucumber, Douglas fir, eggplant, endive, escarole, eucalyptus, fennel, figs, gourd, grape, grapefruit, honey dew, jicama, kiwifruit, lettuce, leeks, lemon, lime, Loblolly pine, mango, melon, mushroom, nut, oat, okra, onion, orange, an ornamental plant, papaya, parsley, pea, peach, peanut, pear, pepper, persimmon, pine, pineapple, plantain, plum, pomegranate, poplar, potato, pumpkin, quince, radiata pine, radicchio, radish, raspberry, rice, rye, sorghum, Southern pine, soybean, spinach, squash, strawberry, sugarbeet, sugarcane, sunflower, sweet potato, sweetgum, tangerine, tea, tobacco, tomato, turf, a vine, watermelon, wheat, yams, zucchini, or any other plant.

[0103] "Promoter" refers to a DNA sequence that binds an RNA polymerase (and often other transcription factors) and promotes transcription of a downstream DNA sequence. Promoters are often provide enhanced or reduced expression in some tissues when compared to others. Promoter selection, specifically selecting promoters that increase expression when a plant is undergoing abiotic stress could be particularly useful in the instant invention.

[0104] It has been observed in the art that some stress responses have similar effects on the plant, and resistance to one may provide resistance to another. This is seen, for example, between the responses to dehydration and low temperature (Shinozaki, et al., Current Opinions in Plant Biology 3(3):217, 2000). Many other papers show the general interrelationship between different abiotic stresses, and might indicate that tolerance to one stress might lead to greater tolerance of several other abiotic stresses (Pernas, et al., FEBS Lett 467(2-3):206, 2000; Knight, Int Rev Cytol 195:269, 2000; Didierjean, et al., Planta 199: 1, 1996; Jeong, et al., Mol Cells 12:185, 2001).

[0105] Expression cassettes and regulatory elements found in the DNA segment outside of the plant expression elements contained in the T-DNA are common in many plasmid DNA backbones and function as plasmid maintenance elements, these include, but are not limited to, the aad (Spc/Str) gene for bacterial spectinomycin/streptomycin resistance, the pBR322 on (ori322) that provides the origin of replication for maintenance in E. coli, the born site for the conjugational transfer into the Agrobacterium tumefaciens cells, and a DNA segment is the 0.75 kb oriV containing the origin of replication from the RK2 plasmid. In addition, those plasmids intended for transformation into plants often contain the elements necessary for the endogenous DNA integration proteins of Agrobacterium to function to insert the element. These include borders (right (RB) and left (LB) borders).

[0106] The laboratory procedures in recombinant DNA technology used herein are those well known and commonly employed in the art. Standard techniques are used for cloning, DNA and RNA isolation, amplification and purification. Generally enzymatic reactions involving DNA ligase, DNA polymerase, restriction endonucleases and the like are performed according to the manufacturer's specifications. These techniques and various other techniques are generally performed according to Sambrook et al., Molecular Cloning--A Laboratory Manual, 2nd. ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. (1989).

[0107] All publications and published patent documents cited in this specification are incorporated herein by reference to the same extent as if each individual publication or patent application is specifically and individually indicated to be incorporated by reference.

[0108] The following examples are included to demonstrate embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples that follow represent techniques discovered by the inventors to function well in the practice of the invention. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope of the invention, therefore all matter set forth or shown in the accompanying drawings and examples is to be interpreted as illustrative and not in a limiting sense.

EXAMPLES

Example 1

[0109] pMON57396 (FIG. 1) is a binary vector for Agrobacterium-mediated transformation and constitutive expression of a protein (SEQ ID NO: 56) similar to Escherichia coli CspA in Arabidopsis. To clone the E. coli CspA gene, two gene specific primers, MF1 and MF2, were designed based on the CspA sequence information (Genbank M30139, GI:409136) from the National Center for Biotechnology Information, which is part of the National Library of Medicine, in turn part of the National Institutes of Health (NCBI). The sequence for MF1 is AGGTAATACACCATGGCCGGTAA (SEQ ID NO: 66), which anneals at the translational start site of CspA and introduces an NcoI site at the 5' end, while the sequence of MF2 is TTAAGCAGAGAATTCAGGCTGGTT (SEQ ID NO: 67), which anneals at the last codon of CspA and introduces an EcoRI site at the end of the primer. PCR was performed to isolate E. coli CspA. Specifically, E. coli DH5α cells were lysed and a small amount of the lysate was used as a template to amplify the CspA gene using MF1 and MF2 primers, Taq polymerase and dNTPs from Roche Molecular Biochemicals (Indianapolis, Ind.). The thermal cycling conditions were as follows: 94° C., 1 min, followed by 30 cycles of 94° C., 16 seconds; 55° C., 1 min and 72° C., 1 min. The amplified CspA DNA was purified by gel-electrophoresis, digested with NcoI and EcoRI and ligated to a binary vector pMON23450 (FIG. 2) that had previously been linearized by digestion with NcoI and EcoRI. Ligation was performed using T4 ligase and following procedures recommended by the manufacturer (BRL/Life Technologies, Inc., Gaithersburg, Md.). The ligation mix was transformed into E. coli cells for plasmid propagation (Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Press, 1989). The transformed cells were plated on appropriate selective media (Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Press, 1989) and colonies were scored hours or days later. Plasmids were prepared from individual colonies and full-insert sequence was determined.

[0110] The resulting plasmid was also confirmed by restriction mapping (for example, see Griffiths, et al, An Introduction to Genetic Analysis, 6th Edition pp 449-451, ISBN 0-7167-2604-1, W.H. Freeman and Co., New York) and sequencing. As the chosen NcoI-EcoRI cloning site in the vector was flanked by a CaMV e35S promoter at the upstream (5') and an epitope tag (Flag, which encodes the oligopeptide DYKDDDK (SEQ ID NO: 68), SIGMA, St Louis) at the downstream (3'), the E. coli CspA in this construct is thus tagged at the C-terminus by the Flag epitope tag and will be driven transcriptionally by the CaMV e35S promoter upon transformation in Arabidopsis. The above cloning results in a plasmid encoding a protein similar to SEQ ID NO: 55. The resulting plasmid is called pMON57396.

Example 2

[0111] pMON57397 (FIG. 2) is a binary vector for Agrobacterium-mediated transformation and constitutive expression of a protein (SEQ ID NO: 57), like Escherichia coli CspA protein, in Arabidopsis. To create pMON57397, the binary vector pMON57396 containing the Escherichia coli CspA gene (see example above) tagged at the C-terminus by the Flag epitope tag, was digested with restriction enzymes XhoI and SalI to cleave these sites in the vector and release the FLAG epitope tag (The FLAG tag encodes the oligopeptide DYKDDDK, SIGMA, St Louis). The linearized plasmid was then purified and religated. Ligation was performed using T4 ligase and following procedures recommended by the manufacturer (BRL/Life Technologies, Inc., Gaithersburg, Md.). The ligation mix was transformed into E. coli cells for plasmid propagation (Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Press, 1989). The transformed cells were plated on appropriate selective media (Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Press, 1989) and colonies were scored hours or days later. Plasmids were prepared from individual colonies and full-insert sequence was determined. The cloning above results in the creation of a plasmid encoding a protein similar to SEQ ID NO: 57.

[0112] The resulting plasmid was also confirmed by restriction mapping to ensure that XhoI and SalI sites were absent (for example, see Griffiths, et al, An Introduction to Genetic Analysis, 6th Edition pp 449-451, ISBN 0-7167-2604-1, W.H. Freeman and Co., New York) and sequencing. The E. coli CspA gene in this construct is untagged at the C-terminus and is driven transcriptionally by the CaMV e35S promoter.

Example 3

[0113] pMON57398 (FIG. 4) is a binary vector for Agrobacterium-mediated transformation and constitutive expression of a protein (SEQ ID NO: 59) like Bacillus subtilis CspB, in Arabidopsis. To clone the B. subtilis CspB gene, two gene-specific primers, MF3 and MF4a, were designed based on the CspB sequence information (Genbank U58859, gi:1336655) from the National Center for Biotechnology Information, which is part of the National Library of Medicine, in turn part of the National Institutes of Health (NCBI). The sequence for MF3 is AGGAGGAAATTCCATGGTAGAAG (SEQ ID NO: 69), which anneals at the translational start site of CspB and introduces an NcoI site at the 5' end, while the sequence of MF4a is TCAATTTATGAATTCGCTTCTTTAGT (SEQ ID NO: 70), which anneals at the last codon of CspB and introduces an EcoRI site at the end of the primer. PCR was performed to isolate B. subtilis CspB. Bacillus subtilis cells were obtained from Carolina Biological Supply (Burlington, N.C.), the cells were lysed and a small amount of the lysate was used as a template to amplify the CspB gene using MF3 and MF4a primers, Taq polymerase and dNTPs from Roche Molecular Biochemicals. The thermal cycling conditions were as follows: 94° C., 1 min, followed by 30 cycles of 94° C., 16 seconds; 55° C., 1 min and 72° C., 1 min. The amplified CspB DNA was purified by gel-electrophoresis, digested with NcoI and EcoRI and ligated to a binary vector pMON23450 (FIG. 5) that had previously been linearized by digestion with NcoI and EcoRI. Ligation was performed using T4 ligase and following procedures recommended by the manufacturer (BRL/Life Technologies, Inc., Gaithersburg, Md.). The ligation mix was transformed into E. coli cells for plasmid propagation. The transformed cells were plated on appropriate selective media (Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Press, 1989) and colonies were scored a day later. Plasmids were prepared from individual colonies and full-insert sequence was determined.

[0114] The resulting plasmid was also confirmed by restriction mapping (for example, see Griffiths, et al, An Introduction to Genetic Analysis, 6th Edition pp 449-451, ISBN 0-7167-2604-1, W.H. Freeman and Co., New York) and sequencing. As the chosen NcoI-EcoRI cloning site in the vector was flanked by a CaMV e35S promoter at the upstream (5') and an epitope tag (Flag, which encodes the oligopeptide DYKDDDK (SIGMA, St Louis) at the downstream (3'), the B. subtilis CspB like gene in this construct is thus tagged at the C-terminus by the Flag epitope tag and will be driven transcriptionally by the CaMV e35S promoter upon transformation in Arabidopsis. This cloning results in a plasmid with the sequence encoding a protein similar to SEQ ID NO: 59 being inserted into said plasmid.

Example 4

[0115] pMON57399 (FIG. 6) is a binary vector for Agrobacterium-mediated transformation and constitutive expression of a protein (SEQ ID NO: 61) like Bacillus subtilis CspB in Arabidopsis. To create pMON57399, the binary vector pMON57398 containing the Bacillus subtilis CspB gene (see example above) tagged at the C-terminus by the Flag epitope tag, was digested with restriction enzymes XhoI and SalI to cleave these sites in the vector and release the FLAG epitope tag (The FLAG tag encodes the oligopeptide DYKDDDK, SIGMA, St Louis). The linearized plasmid was then purified and religated. Ligation was performed using T4 ligase and following procedures recommended by the manufacturer (BRL/Life Technologies, Inc., Gaithersburg, Md.). The ligation mix was transformed into E. coli cells for plasmid propagation (Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Press, 1989). The transformed cells were plated on appropriate selective media (Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Press, 1989) and colonies were scored hours or days later. Plasmids were prepared from individual colonies and full-insert sequence was determined. This cloning results in a plasmid with a sequence encoding a protein similar to SEQ ID NO: 61 being inserted into said plasmid.

[0116] The resulting plasmid was also confirmed by restriction mapping to ensure that XhoI and SalI sites were absent (for example, see Griffiths, et al, An Introduction to Genetic Analysis, 6th Edition pp 449-451, ISBN 0-7167-2604-1, W.H. Freeman and Co., New York) and sequencing. As the chosen NcoI-EcoRI cloning site in the vector was flanked by a CaMV e35S promoter at the upstream (5') N-terminus, the B. subtilis CspB gene in this construct is untagged at the C-terminus and is driven transcriptionally by the CaMV e35S promoter upon transformation in Arabidopsis. Said plasmids were transformed into Agrobacterium tumefaciens.

Example 5

[0117] Arabidopsis plants may be transformed by any one of many available methods. For example, Arabidopsis plants may be transformed using In planta transformation method by vacuum infiltration (see, Bechtold et al., In planta Agrobacterium mediated gene transfer by infiltration of adult Arabidopsis thaliana plants. CR Acad. Sci. Paris Sciences de la vie/life sciences 316: 1194-1199 (1993). This example illustrates how Arabidopsis plants may be transformed.

Stock Plant Material and Growth Conditions

[0118] Prepare 2.5 inch pots with soil and cover them with a mesh screen, making sure that the soil is not packed too tightly and the mesh is in contact with the soil surface (this ensures that the germinating seedlings will be able to grow through the mesh). Sow seeds and cover with a germination dome. Vernalize seeds for 3-4 days. Grow plants under conditions of 16 hours light/8 hours dark at 20-22° C., 70% humidity. Water twice weekly, and fertilize from below with 1/2×(half of the strength recommended by the manufacturer) Peters 20-20-20 fertilizer (from Hummert International, Earth City, Mo.). Add micronutrients (Hummert's Dyna-grain Soluble Trace Elements) (in full strength recommended by the manufacturer) every other week. After about 1-2 weeks, remove the dome and thin the pots to one or two plants per pot. Clip the primary bolt, when it develops, to encourage more secondary bolt formation. In 5-7 days the plants will be ready for infiltration.

Agrobacterium Preparation (Small Scale and Large Scale Cultures):

[0119] Agrobacterium strain ABI is streaked onto an LB plate containing Spectinomycin 100 mg/L, Streptomycin 100 mg/L, Chloramphenicol 25 mg/L, and Kanamycin 50 mg/L (denoted SSCK). Two days prior to infiltration, a loop of Agrobacterium is placed into a tube containing 10 mls LB/SSCK and put on a shaker in the dark at 28° C. to grow overnight. The following day, the Agrobacterium is diluted 1:50 in 400 mls YEP/SSCK and put on a shaker at 28° C. to grow for 16-20 hours. (Note: we have found the transformation rate is significantly better when LB is used for the first overnight growth and YEP is used for the large scale overnight culture).

Infiltration

[0120] Harvest the Agrobacterium cells by pouring into a 500 ml centrifuge bottle and spinning at 3500 rpm for 20-25 minutes. Pour off the supernatant. Dry the pellet and then resuspend in 25 ml Infiltration Medium (MS Basal Salts 0.5%, Gamborg's B-5 Vitamins 1%, Sucrose 5%, MES 0.5 g/L, pH 5.7) with 0.44 nM benzylaminopurine (BAP) (10 μl of a 1.0 mg/L stock in DMSO per liter) and 0.02% Vac-In-Stuff (Silwet L-77) from Lehle Seeds (Round Rock, Tex.). The BAP and Silwet L-77 are added fresh the day of infiltration. Add 200 μl of Silwet L-77, and 20 μl of BAP (0.5 mg/L stock). Using Infiltration Medium as your blank, take the OD600 of a 1:10 dilution of the Agrobacterium suspensions. Calculate the volume needed for 400 ml of Agrobacterium suspension/infiltration medium, OD600=0.6, for the vacuum infiltration.

( final volume ) * ( final OD 600 ) OD 600 = Volume needed for final OD 600 of 0.6 Equation ##EQU00001##

[0121] Place resuspended culture in a Rubbermaid container inside a vacuum dessicator. Invert pots containing plants to be infiltrated into the solution so that the entire plant is covered, including the rosette, but not too much of the soil is submerged. Soak the plants with water for at least 30 min. prior to infiltration. (This keeps the soil from soaking up the Agrobacterium suspension).

[0122] Draw a vacuum of ˜23-27 in. Hg for 10 min. Quickly release the vacuum. Briefly drain the pots, place them on their sides in a diaper-lined tray, cover the tray with a dome to maintain humidity, and return to growth chamber. The following day, uncover the pots, set them upright, and remove the diaper. Do not water plants for ˜5 days. After the 5 days are up, allow the plants to be watered and to continue to grow under the same conditions as before. (The leaves that were infiltrated may degenerate but the plant should survive until it is finished flowering).

Harvesting and Sterilizing Seed

[0123] Cone the plants, individually, by using the Lehle Aracons (Lehle Seeds, Round Rock, Tex.) approximately 2 weeks after infiltration. After all of the seed is matured and has set (˜4 weeks post-infitration), remove the plants from water to dry down the seeds. Approximately 2 weeks later harvest the seeds by cutting the branches below the cone. Clean the seed by using a sieve to catch the silique and branch material and allow the seed to go through. Place the seed in an envelope or in 15 ml conical tubes.

[0124] Transfer desired amount of seeds to 15 ml conical tubes prior to sterilization. Loosen the lid to the conicals and place them on their side in a vacuum dessicator with a beaker containing 400 ml of bleach Clorox (Clorox Company, Oakland, Calif.) and 4 ml of Hydrochloric Acid. (Add the HCl to the Clorox in a fume hood). Pull a vacuum just to seal the dessicator, and close the suction (i.e. so that the dessicator is still under a vacuum but the vacuum is not still being directly pulled) for ˜16 hrs. After sterilization, release the vacuum and place tubes containing seed in a sterile hood (keep caps loose so gas can still be released).

Plate ("sprinkle") the seed on selection plates containing MS Basal Salts 4.3 g/L, Gamborg'a B-5 (500×) 2.0 g/L, Sucrose 10 g/L, MES 0.5 g/L, and 8 g/L Phytagar (Life Technologies, Inc., Rockville, Md.) with Carbenicillin 250 mg/L, Cefotaxime 100 mg/L. Selection levels will either be kanamycin 60 mg/L, Glyphosate 60 μM, or Bialaphos 10 mg/L.

[0125] A very small amount of seed can be first plated out to check for contamination. If there is contamination, re-sterilized seeds for ˜4 more hours and check for contamination again. The second sterilization is usually not necessary, but sometimes the seed harbors a fungal contaminant and repeat sterilizations are needed. (The sterilization duration generally is shorter than 16 hours because of significantly decreased germination rates starting at 24 hr. sterilization duration). Seal plates with parafilm and place in a cold room to vernalize for ˜2-4 days. After seeds are vernalized, place in percival with cool white bulbs.

Transfer to Soil

[0126] After 5-10 days at ˜26° C. and a 16/8 light cycle, the transformants will be visible as green plants. After another 1-2 weeks, plants will have at least one set of true leaves. Transfer plants to soil, cover with a germination dome, and move to a growth chamber with normal Arabidopsis growth conditions. Keep covered until new growth is apparent (usually 5-7 days).

Example 6

[0127] In order to compare the growth of wildtype non-transgenic and CspA or CspB transgenic Arabidopsis plants, verticle growth was allowed in sterile Petri dishes:

[0128] Wildtype or transgenic seeds were liquid sterilized using the following method:

[0129] 5 minute incubation in 70% ethanol following vortex mixing

[0130] 5 minute incubation in 30% Chlorox (6.15% sodium hypochlorite)+0.01% Triton X-100 following vortex mixing

[0131] 5 consecutive sterile water washes

[0132] Seeds were plated onto plastic, 100×15 mm square petri dishes (Becton Dickinson-Falcon #35-1112), each containing 40 ml of agar media made as follows:

[0133] 0.5× Murashige and Skoog media with macronutrients, micronutrients and vitamins (Sigma #M5519), adjusted to pH 5.8 with ammonium hydroxide and containing 1% Phytagel (Sigma #P8169) for solid support.

[0134] Ten wild type Arabidopsis seeds were plated across one half of a petri dish, approximately 1 cm from the edge and evenly spaced. This was done with a Gilson P-200 Pipetteman using sterile tips. Ten CspA or CspB transgenic Arabidopsis seeds were similarly plated across the other half of the petri dish, evenly spaced. The plates were labeled with a marking pen to indicate which half contained the transgenic seeds.

[0135] The petri dishes were put at 4° C. for 3 days in the dark to stratify the seeds and then placed in a Percival incubator (model AR-36L) at 8° C. for 6 weeks at 24 hour constant light of 120 microeinsteins/square meter. At the end of this incubation, the size of the CspA and CspB rosettes were compared to that of wildtype and found to be larger. This can be seen in FIG. 16. This can be seen in the first, second, and last pictured plate where the above assay was used. In FIG. 16, the third picture (CspB+Flag, pMON57399) displays a plate wherein the plants were put through a cold shock assay similar to that described below.

Cold Shock Seedling Vigor Assessment of Transgenic Arabidopsis thaliana Seeds: Horizontal Plate Assay.

Introduction:

[0136] This is a procedure for assessing the ability of transgenic Arabidopsis seeds that have germinated at normal temperatures on media agar in horizontal petri plates to continue to grow upon a shift to chilling. In short, seeds from control plants and seeds from tester transgenic plants are sterilized, stratified, and plated in 6×8 grids on either half of a petri dish. The plate is incubated at normal temperature in a horizontal position for one week and then shifted to chilling temperature for two additional weeks, maintaining the horizontal position of the plate. The canopy area of seedlings is recorded by digital photography and quantitated using imaging software. The ratio of the total canopy area of the tester seedlings to that of the control seedlings can be used as a quantitative parameter to compare the cold tolerance potential of various genes of interest in transgenic tester lines.

Materials: The Following Assumes the Normal Capital Equipment Available in a Standard Biotechnology Laboratory (Autoclave, Balance, Laminar Flow Hood, Etc.)



[0137] Arabidopsis seed: the protocols here have been used with Arabidopsis thaliana cv. Columbia, but ought to be suitable for other Arabidopsis species as well.

[0138] Petri dishes: Falcon #35-1112 (100 mm square×15 mm deep)

[0139] Media: Sigma M5519=Murashige & Skoog Basal Media

[0140] Phytagel (Sigma #P-8169)

[0141] 1-liter glass bottles in which to autoclave media agar and from which to pour plates. We use Corning glass bottles with the orange screw caps.

[0142] Magnetic stirrers and magnetic stir bars

[0143] Electric pipettor usable with 50 ml plastic pipettes.

[0144] Small fluorescent light box with plastic magnifying lense for plating seeds.

[0145] P1000 Gilson pipetor (or equivalent) and sterile tips

[0146] P200 Gilson pipetor (or equivalent) and sterile tips

[0147] 70% Ethanol, sterile

[0148] 30% Chlorox bleach+0.1% Tween 20

[0149] Sterile filtered deionized water

[0150] Sterile microcentrifuge tubes and tube racks

[0151] 4° C. cold room, cold box or refrigerator, preferably dark

[0152] 22 degrees C. Percival plant growth chamber or equivalent with ˜150 μE/m2/sec light source

[0153] 8 degress C. Percival plant growth chamber or equivalent with ˜150 μE/m2/sec light source

[0154] Semipermeable surgical tape 3M Micropore tape (3M #1530-1)

[0155] Black (Sharpie) marker

[0156] Vacuum aspirator with trap

[0157] Glassine balance weighing paper (VWR #12578-165)

[0158] Calculator

[0159] Notebook

[0160] IBM compatible computer

[0161] Image-Pro Plus software, version 4.1.0.0

[0162] Microsoft Excel software

Protocol:

[0162]

[0163] 1--Aliquot seeds for storage vials or envelopes to sterile microcentrifuge tubes

[0164] 2--Label tubes with sharpie to retain identity of seeds

[0165] 3--Surface sterilize seeds in tubes by successive washing with the following solutions and waiting times listed below. Note, invert tubes during washings at least twice to ensure good surface contact of solutions on seeds. Seeds will fall down to the bottom of the tube, making a soft pellet:

[0166] a. 70% Ethanol, sterile, for 3 to 5 minutes

[0167] b. 30% Chlorox bleach+0.1% Tween 20, for 3 to 5 minutes

[0168] c. Sterile filtered deionized water, for 30 seconds

[0169] d. Repeat c. four more times and on the last time, leave ˜0.5 ml of sterile water remaining over the seed pellet.

[0170] 1--Place microcentrifuge tubes in the dark at 4° C. for three days to stratify the seeds for more uniform germination upon plating.

[0171] [Alternatively, the seeds can be directly plated onto media agar petri dishes, taped sealed and the petri dish can be put at 4° C. in the dark for three days prior to the 8° C. cold incubation--see below.]

[0172] 2--Make plates by preparing 1-liter aliquots of 0.5× Murashige and Skoog media in the glass bottles, adjust pH to 5.8 with ammonium hydroxide, then add 10 grams of Phytagel. Use a magnetic stirrer when adjusting the pH and to mix in the phytagel uniformly, then autoclave on liquid setting (slow exhaust) for 45 minutes.

[0173] 3--Pour plates in the laminar flow hood using the electric pipettor with the 50 ml sterile pipette to deliver 40 ml of media to each plate, immediately covering the plate with the lid.

[0174] 4--Allow plates to cool in laminar flow hood for at least 2 hours with the blower off and store in dated plastic bags at 4° C.

[0175] 5--Label plates and plate seeds:

[0176] 1--Tape all four edges of the plate with semipermeable micropore tape, label with the date and put plates in a Percival incubator set at 22 C and 16 hour day light cycle at ˜100 μE/m2 sec. Place the plates in a horizontal position only one layer thick and incubate for 7 days. Photograph each plate with a digital camera and store the data to a compact disk.

[0177] 2--Transfer plates to a Percival incubator set at 8° C. and 24 hour day light cycle at ˜100 μE/m2 sec, Place the plates in a horizontal position only one layer thick and incubate for up to 3 additional weeks. Photograph each plate with a digital camera and store the data to a compact disk.

[0178] 3--Observe plates every 2 to 3 days to see how tester germplasms are proceeding compared to controls and digitally photograph at times that are representative of the general performance of the germplasms. This should take less than 2 weeks (3 weeks at the most) of incubation at 8° C. Those germplasms that take longer to show a difference need to be plated at a lower seed density to avoid overcrowding at the time the digital photograph is taken.

[0179] 4--Measure rosette canopy area using digital camera photography and Image-Pro Plus software. Calculate the average seedling canopy for control and tester populations, eliminating seeds from the analysis that never germinated. Calculate the ratio between the average seedling canopy area post temperature shift for the control seedlings and the tester seedlings, the standard deviation and standard error for control and tester seedling sets. Ascertain if there is a statistical difference between the tester seedlings and the control seedlings. Record results in a notebook.

[0180] 5--Discard plates and seedlings in appropriate disposal containers for transgenic plant materials (gray bins with clear plastic waste bags).

Example 7

[0181] PCR products of the CspA and CspB genes were ligated to vector pCR-TOPO 2.1 according to the manufacturer's protocol (Invitrogen, Carlsbad, Calif.). The NcoI/EcoRI fragments of the pCR-TOPO 2.1 derivatives were subcloned into pMON48421 (FIG. 7), linearized by the same restriction enzymes. The NotI fragments of the pMON48421 derivatives encompassing the 35S promoter, Csp genes, and the e9 terminator were subcloned into pMON42916 (FIG. 17) at the NotI site to create pMON56609 (FIG. 8) and pMON56610 (FIG. 9) which contain the CspA and CspB genes, respectively. Said plasmids were transformed into Agrobacterium tumefaciens by known methods. pMON56609 is thought to contain a nucleotide sequence encoding a protein similar to SEQ ID NO: 7. pMON56610 is thought to contain a nucleotide sequence encoding a protein similar to SEQ ID NO: 9.

Example 8

Agrobacterium Preparation

[0182] Agrobacterium strain EHA105 is streaked on LB plate containing Kanamycin 50 mg/L and Hygromycin 50 mg/L (denoted LB/KH). Two days prior to co-cultivation, a loop of Agrobacterium is transferred to a tube containing 10 ml LB/KH and incubated on a shaker in dark at 28 C for 24 hours. This culture is diluted to 1:100 in 20 ml LB/KH and incubated on a shaker in dark at 28 C overnight. The following day 1 ml of 1:2 dilution of this culture is taken in a cuvette and OD600 is taken with LB/KH as blank. Calculate the volume needed for 5 ml of agrobacterium suspension of O.D 1.0 for co-cultivation.

( final volume ) * ( final OD 600 ) OD 600 = Volume needed for final OD 600 of 1.0 Equation ##EQU00002##

[0183] Take the required volume of agrobacterium culture in a 40 ml centrifuge tube and spin at 7000 rpm for 7 minutes. Discard the supernatant and dry the pellet. Resuspend the pellet in 5 ml of co-cultivation media (CC MEDIA-MS Basal salts, Sucrose 20 g/L, Glucose 10 g/L, thiamine HCl 0.5 mg/L, L-Proline 115 mg/L, 2,4-D 2 mg/L) with 20 mg/L of acetosyringone.

Transformation of Rice Embryos:

[0184] Panicles were harvested from greenhouse grown Nipponbare and Taipai 309 rice varieties. The panicles were sterilized by immersing in 50% commercial bleach for 10 minutes followed by rinsing in sterile distilled water. The panicles were given a 70% alcohol treatment for 3 mins. The seeds were then removed from the panicles and dehusked individually and transferred to a falcon tube containing 0.1% tween 20 solution. The seeds were then treated with 70% alcohol in the laminar air flow chamber. Then the seeds were rinsed with sterile water. This was followed by a 50% bleach treatment for 45 minutes. The seeds were rinsed 5 times in sterile distilled water. Finally the seeds are given 0.1% mercuric chloride treatment for 5 minutes. The seeds were again washed 8 times with sterile distilled water.

[0185] The embryos were excised aseptically from the sterile seeds in the laminar flow chamber and placed on solid co-cultivation media (CC MEDIA with 2 g/L phytagel). 50 μL drops of the agrobacterium suspension were placed on a sterile petri-plate. 10 embryos were transferred to each drop. The infection was allowed for 15 minutes. The agrobacterium suspension was removed with a sterile pipette tip. The infected embryos were transferred to a fresh solid CC MEDIA plate and kept in dark for 2 days. On the third day the embryos were washed with cefotaxime 500 mg/L. The embryos were then dried on sterile filter paper and placed on Delay media (MS Basal salts, Thiamine HCl 1 mg/L, Glutamine 500 mg/L, Magnesium Chloride 750 mg/L, casein hyrolysate 100 mg/L, Sucrose 20 mg/L, 2,4-D 2 mg/L, Pichloram 2.2 mg/L, Cefotaxime 250 mg/L). the embryos are kept on delay medium in dark for a period of 7 days. During this period calli are formed. The calli are transferred to selection media (Delay medium with 50 mg/L Hygromycin) and stored in dark for 10 days. The calli are sub-cultured to fresh selection media after this 10 day period. After another 10 days the calli are transferred to regeneration media (MS Basal salts, sucrose 30 mg/L, Kinetin 2 mg/L, NAA 0.2 mg/L, Cefotaxime 250 mg/L, hygromycin 25 mg/L) and kept in dark for 7 days. The calli are then transferred to fresh regeneration media and moved to a 16-hour photoperiod at 30 C. The shoots developed on this callus are transferred to rooting media (half strength MS Basal salts, sucrose 15 g/L, Cefotaxime 250 mg/L, Hygromycin 25 mg/L). The rooted shoots are transferred to test-tubes containing water and placed in a mist chamber for hardening.

[0186] Plants were selected as positive. This could be done, for example, using methods similar to those described in examples 12-14, and 26-29. Including breeding methods described to create the next generation of transgenic plants.

Example 9

Cold Stress Response at Three Leaf Stage--CspB and CspA Rice Transgenic Plants

[0187] Plant Material Preparation:

[0188] Germination: Seeds were sterilized by treating with 0.01 percent mercuric chloride for 3 minutes and washed thoroughly for ten times in milique water to remove the traces of mercuric chloride. Sterilized seeds were allowed to imbibe by soaking in milique water for 3 hours. The imbibed seeds were germinated on a sterilized moist filter paper at 30° C. temperature and 60% RH using a seed germinator (Serwell Instruments Inc.).

[0189] Establishment of three leaf stage seedlings: The three day old germinated seedlings were transferred to portrays (52.5 mm (length)×26 mm (depth)×5.2 mm (diameter)) in the greenhouse having light intensity of 800 micro mol./mt2/sec. and 60% RH. The seedlings were grown till three-leaf stage (Approximately for 12 days) in portrays containing red sandy loam soil. Fertilizer solution was applied to the seedlings once a week till the completion of the experiments (N-75 PPM, P-32 PPM, K-32 PPM, Zn-8 PPM, Mo-2 PPM, Cu-0.04 PPM, B-0.4 PPM and Fe-3.00 PPM).

CspB-R2 Plant Analysis

[0190] Protocol: Three leaf stage rice seedlings (12 day old) were subjected to a cold stress of 10° C. for 4 days in presence of 100 micro mol./mt2/sec.light and 70% RH (Percival growth chamber). After the stress treatment the plants were allowed to recover in the greenhouse for 10 days and on the 10th day the growth observations for survived plants and photographic evidences were recorded. Each treatment had 10 replications per line and they were completely randomized.

[0191] Results: Among eight different lines tested for cold stress tolerance six lines exhibited significantly higher cold tolerance compared to the wild type. The lines including R2-226-6-9-3, R2-226-29-1-1, R2-257-20-2-1, R2-238-1-1-3, R2-230-4-4-2 and R2-257-3-1-3 showed high cold tolerance by exhibiting high recovery growth and less percent reduction in growth (over non-stressed control) compared to the wild type (table-1, plate-1). The line R2-230-4-42, has performed extremely well, it exhibited 100 percent survival and maintained good growth during recovery (Table 1).

TABLE-US-00003 TABLE 1 Three leaf stage cold stress recovery growth observations of CspB R2 transgenic lines. % % Reduction in Survival at plant height end of Plant height (cm) over non- Lines recovery Stressed Non-stressed stressed R2-257-17-1-1 13 21.5 ± 11 43.44 ± 4.09 50.38 R2-230-34-1-2 53 20.78 ± 6.3 45.0 ± 3.51 53.82 R2-226-6-9-3 60 27.5 ± 7 33.74 ± 4.65 18.49 R2-226-29-1-1 53 27.6 ± 10.7 35.22 ± 4.06 21.63 R2-257-20-2-1 93 32.39 ± 5.48 44.0 ± 2.95 27.27 R2-238-1-1-3 80 29.25 ± 8.19 40.72 ± 5.8 25 R2-230-4-4-2 100 33.95 ± 4.10 45 ± 3.98 24 R2-257-3-1-3 40 29.80 ± 2.66 42 ± 4.11 28.5 WT-Taipei 26 23.93 ± 5.61 45.0 ± 3.7 46.6 (Index: WT = Wild type)

CspB-R3 Plant Analysis

[0192] Protocol: Three leaf stage seedlings were exposed to cold stress of 8 degree Celsius for 1 day in presence of 1000 micro mol./mt2/sec. of light. Later the seedlings were allowed to recover at 28 degree Celsius in the greenhouse for 15 days and at the end of recovery the plant height was recorded.

[0193] Results: Eight different lines tested for cold stress tolerance and all the eight lines showed improved tolerance compared to wild type (non-transgenic) plants. These results confirmed the R2 analysis data showing improved cold tolerance (Table 2).

TABLE-US-00004 TABLE 2 Three leaf stage cold stress recovery growth observations of CspB R3 transgenic lines. Non-stressed Percent Stressed-plant plant height reduction in height (cm) at end of (cm) at end plant height Lines recovery of recovery over non-stress R3-226-6-9-3 28.8 ± 2.88 29.34 ± 7.20 1.84 R3-226-29-1-3-4 30.18 ± 3.19 32.07 ± 3.79 5.89 R3-230-4-4-2-1 30.42 ± 2.16 35.09 ± 4.19 13.30 R3-230-34-1-2-1 32.14 ± 3.41 37.4 ± 5.68 14.01 R3-238-1-1-3-4 29.54 ± 3.61 32.2 ± 3.56 8.26 R3-257-3-1-3-1 27.12 ± 3.38 30.86 ± 3.82 12.11 R3-257-15-1-1-2 23.84 ± 2.85 26.71 ± 1.92 10.74 R3-257-20-2-1-1 33.8 ± 3.48 38.82 ± 1.97 12.93 WT-Taipei 23.9 ± 3.74 36.65 ± 4.01 34.78

CspA-R2 Plant Analysis

[0194] Protocol: Three leaf stage rice seedlings (12 day old) were subjected to a cold stress of 10° C. for 3 days in presence of 1000 micro mol./mt2/sec. and 70% RH in a growth chamber. After the stress treatment the plants were allowed to recover in the green house for 15 days and on the 15th day the growth observations were recorded. Each value is an average of 12 observations and the experiment was conducted by following completely randomized (CRD) experimental design.

[0195] Results: Out of seven independent CspA transgenic lines tested 6 lines showed improved cold tolerance compared to wild type. In this experiment plant height was reduced to close to 50% in cold treated control plants (WT) compared to non-stressed plants. Where as in transgenic plants with CspA gene reduction in plant height upon cold treatment varied 4.5% to 22.50% among different independent lines (except one line where reduction in growth was 47.09%). These results suggest that CspA improves the cold tolerance of rice (Table 3).

TABLE-US-00005 TABLE 3 Three leaf stage cold stress recovery growth observations of CspA R2 transgenic rice lines. Plant height at the Percent reduction end of recovery (cm) in plant height Lines Stressed Non-stressed over non-stressed R2-362-3-1-2 28.75 ± 3.11 30.08 ± 2.9 4.5 R2-328-2-1-1 29.5 ± 2.92 35.58 ± 3.12 17.08 R2-362-7-1-2 15.83 ± 2.92 29.92 ± 1.73 47.09 R2-365-4-5-3 26.08 ± 3.75 32.08 ± 2.27 18.7 R2-362-6-1-6 27.17 ± 2.25 32.00 ± 1.76 15.05 R2-362-3-1-10 29.58 ± 3.50 38.17 ± 2.59 22.50 R2-362-7-1-2 24.58 ± 3.42 27.25 ± 2.01 9.79 WT-Nipponbare 20.58 ± 1.73 37.92 ± 8.59 46.05

CspA-R3 Plant Analysis

[0196] Experiment I

[0197] Protocol: Three leaf stage seedlings were exposed to cold stress of 10 degree Celsius for 3 days in presence of 1000 micro mol. of light. Later the seedlings were allowed to recover at 28 degree Celsius in the greenhouse for 30 days and at the end of recovery the plant height and percent seedling survival were recorded. (In this experiment 8 replications were used for each transgenic line and 10 replications were used for wild type.)

[0198] Results: The six transgenic lines subjected to cold stress performed better under cold stress than wild type. These results further confirmed the R2 analysis data by showing improved cold tolerance (Table 4).

TABLE-US-00006 TABLE 4 Three leaf stage cold stress recovery growth observations of CspA R3 transgenic rice lines. Stressed- Non-stressed Percent plant height plant height reduction (cm) at the (cm) at the in plant Percent end of end of height over seedling Lines recovery recovery non-stress Survival R3-362-3-1-2-2 25.5 ± 4.46 32.25 ± 5.03 20.93 100 R3-362-3-1-3-2 25.62 ± 3.36 34.43 ± 6.24 25.58 66 R3-365-10-1-2-3 27.35 ± 3.24 33.75 ± 4.58 18.96 100 R3-362-6-1-2-1 28 ± 2.45 34.45 ± 2.29 18.72 100 R3-362-7-1-2-3 27.5 ± 24.17 29.94 ± 5.03 8.1 100 R3-362-7-1-3-3 27.88 ± 4.22 31.92 ± 2.89 12.65 100 WT-Nipponbare 26.25 ± 3.95 36.34 ± 4.06 27.76 40 Note: Plant height was recorded only for survived plants and their averages are given above.

[0199] Experiment II

[0200] Protocol: Three leaf stage seedlings were exposed to cold stress of 10 degree Celsius for 1 day in presence of 1000 micro mol. of light. Later the seedlings were allowed to recover at 28 degree Celsius in the green house for 30 days and at the end of recovery the plant height and percent seedling survival were recorded.

[0201] Results: The five transgenic lines subjected to cold stress performed better under cold stress than wild type. These results further confirmed the R2 analysis data by showing improved cold tolerance (Table 5).

TABLE-US-00007 TABLE 5 Three leaf stage cold stress recovery growth observations of CspA R3 transgenic rice lines. Stressed- Non-stressed Percent plant height plant height reduction in (cm) at end (cm) at end plant height Lines of recovery of recovery over non-stress R3-362-3-1-2-2 32.76 ± 3.49 32.25 ± 5.03 Nil R3-362-3-1-3-2 36.11 ± 2.04 34.43 ± 6.24 Nil R3-365-10-1-2-3 35.85 ± 2.94 33.75 ± 4.58 Nil R3-362-6-1-2-1 21.54 ± 5.84 34.45 ± 2.29 37.4 R3-362-7-1-2-3 32.55 ± 2.73 29.94 ± 5.03 Nil R3-362-7-1-3-3 32.17 ± 3.27 31.92 ± 2.89 Nil WT-Nipponbare 31.92 ± 2.66 36.34 ± 4.06 12.16

[0202] Heat Stress Response at Three Leaf Stage

[0203] Plant Material Preparation:

[0204] Germination: Seeds were sterilized by treating with 0.01 percent mercuric chloride for 3 minutes and washed thoroughly (˜ten times in deionized water) to remove the traces of mercuric chloride. Sterilized seeds were allowed to imbibe by soaking in milique water for 3 hours. The imbibed seeds were germinated on a sterilized moist filter paper at 30° C. temperature and 60% RH using a seed germinator (Serwell Instruments Inc.).

[0205] Establishment of three leaf stage seedlings: The three day old germinated seedlings were transferred to portrays (52.5 mm (length)×26 mm (depth)×5.2 mm (diameter)) in the green house having light intensity of 800 micro mol./mt2/sec. and 60% RH. The seedlings were grown till three-leaf stage (Approximately for 12 days) in portrays containing red soil. Fertilizer solution was sprayed to the seedlings once a week till the completion of the experiments (N-75 PPM, P-32 PPM, K-32 PPM, Zn-8 PPM, Mo-2 PPM, Cu-0.04 PPM, B-0.4 PPM and Fe-3.00 PPM).

CspA-R2 Plant Analysis

[0206] Protocol: Three leaf stage rice seedlings (12 day old) were subjected to the heat stress of 50° C. for 3 hours in presence of 70% RH. After the stress treatment the plants were allowed to recover in the green house for 15 days and on the 15th day the growth observations were recorded. Each value is an average of 12 observations.

[0207] Results: Out of seven independent CspA transgenic lines tested 6 lines showed improved heat tolerance compared to wild type. In this experiment plant height was reduced by more than 50% in heat-treated control plants (WT) compared to no stressed plants. Where as in transgenic plants with CspA gene reduction in plant height upon heat treatment varied from 9.5% to 35% among different independent lines. These results suggest that CspA improves the heat tolerance of rice (Table 6).

TABLE-US-00008 TABLE 6 Three leaf stage plant heat stress recovery growth observations of CspA R2 transgenic rice lines. Plant height at the end Percent of recovery (cm) reduction in plant Lines Stressed Non-stressed height over non-stressed R2-362-3-1-2 26.67 ± 4.97 30.08 ± 2.9 11.33 R2-328-2-1-1 26.17 ± 3.49 35.58 ± 3.12 26.41 R2-362-7-1-2 25.17 ± 1.94 29.92 ± 1.73 15.87 R2-365-4-5-3 20.83 ± 1.17 32.08 ± 2.27 35.06 R2-362-6-1-6 23.17 ± 1.83 32.00 ± 1.76 27.59 R2-362-3-1-10 29.33 ± 5.01 38.17 ± 2.59 23.15 R2-362-7-1-2 24.67 ± 2.8 27.25 ± 2.01 9.4 WT-Nipponbare 18.5 3.51 37.92 ± 8.59 51.21

CspB-R3 Plant Analysis

[0208] Protocol: Three-leaf stage seedlings were exposed to high temperature stress of 53 degree Celsius for 2 hours and later the seedlings were allowed to recover at 28 degree Celsius in the greenhouse for 15 days and at the end of recovery the plant height was recorded.

[0209] Results: Out of eight transgenic lines tested seven lines performed better under heat stress tested compared to wild type. These results suggest that CspB improves heat tolerance of rice (Table 7).

TABLE-US-00009 TABLE 7 Three leaf stage plant heat stress recovery growth observations of CspB R3 transgenic rice lines. Stressed-plant Non-stressed plant Percent height (cm) height (cm) reduction at end of at end of in plant height Lines recovery recovery over non-stress R3-226-6-9-3 34.53 ± 2.14 35.54 ± 2.07 2.84 R3-226-29-1-3-4 32.38 ± 1.47 37.06 ± 2.92 12.62 R3-230-4-4-2-1 28.78 ± 4.16 35.06 ± 2.07 17.41 R3-230-34-1-2-1 33.3 ± 3.94 37.6 ± 3.05 11.43 R3-238-1-1-3-4 33.96 ± 2.06 41.2 ± 3.83 17.57 R3-257-3-1-3-1 33.76 ± 3.74 35.4 ± 2.07 4.63 R3-257-15-1-1-2 25.68 ± 4.27 38.2 ± 3.11 32.77 R3-257-20-2-1-1 34.78 ± 1.7 42.2 ± 2.97 17.5 WT-Taipei 25.5 ± 2.97 36.65 ± 4.8 30.42

CspA-R3 Plant Analysis

[0210] Experiment I

[0211] Protocol: Three-leaf stage seedlings were exposed to high temperature stress of 53 degree Celsius for 3 hours and later the seedlings were allowed to recover at 28 degree Celsius in the greenhouse for 30 days and at the end of recovery the plant height was recorded.

[0212] Results: These results confirmed the R2 analysis data by showing improved heat tolerance (Table 8).

TABLE-US-00010 TABLE 8 Three leaf stage plant heat stress recovery growth observations of CspA R3 transgenic rice lines. Non-stressed Percent Stressed- plant height reduction in plant plant height (cm) at (cm) at end height over non- Lines end of recovery of recovery stress R3-362-3-1-2-2 31.07 ± 7.01 32.25 ± 5.03 3.6 R3-362-3-1-3-2 30.28 ± 4.74 34.43 ± 6.24 12.05 R3-365-10-1-2-3 24.23 ± 7.60 33.75 ± 4.58 28.20 R3-362-6-1-2-1 26.93 ± 2.97 34.45 ± 2.29 21.82 R3-362-7-1-2-3 29.52 ± 2.61 29.94 ± 5.03 1.40 R3-362-7-1-3-3 21.30 ± 6.37 31.92 ± 2.89 33.27 WT-Nipponbare 22.68 ± 2.96 36.34 ± 4.06 37.58

[0213] Experiment II

[0214] Protocol: Three leaf stage seedlings were exposed to high temperature stress of 50 degree Celsius for 1 hour in the presence of 1000 micro mol. of light and later the seedlings were allowed to recover at 28 degree Celsius in the greenhouse for 30 days and at the end of recovery the plant height was recorded.

[0215] Results: These results confirmed the R2 analysis data by showing improved heat tolerance (Table 9).

TABLE-US-00011 TABLE 9 Three leaf stage plant heat stress recovery growth observations of CspA R3 transgenic rice lines. Non-stressed Percent Stressed- plant height reduction in plant plant height (cm) at (cm) at end height over non- Lines end of recovery of recovery stress R3-362-3-1-2-2 31.57 ± 2.39 32.25 ± 5.03 2.10 R3-362-3-1-3-2 34.20 ± 3.87 34.43 ± 6.24 0.6 R3-365-10-1-2-3 31.63 ± 4.32 33.75 ± 4.58 6.28 R3-362-6-1-2-1 19.72 ± 6.76 34.45 ± 2.29 42.75 R3-362-7-1-2-3 32.18 ± 3.25 29.94 ± 5.03 Nil R3-362-7-1-3-3 32.80 ± 1.51 31.92 ± 2.89 Nil WT-Nipponbare 28.20 ± 2.79 36.34 ± 4.06 22.39

[0216] Water Stress Response

[0217] Plant Material Preparation:

[0218] Germination: Seeds were sterilized by treating with 0.01 percent mercuric chloride for 3 min later washed thoroughly for ten times in milique water to remove the traces of mercuric chloride. Sterilized seeds were allowed to imbibe by soaking in milique water for 3 hours. The imbibed seeds were germinated on a sterilized moist filter paper at 30° C. temperature and 60% RH using a seed germinator (Serwell Instruments Inc.).

[0219] CspB-R2 Plant Analysis

[0220] Experimental Protocol

[0221] The germinated seedlings (3 day old) were transferred to two different levels of water stress, created in PVC pots containing vermiculite, which is measured in terms of field capacity (FC). The FC-100% is a saturated condition (i.e. 100 g vermiculite requires 350 ml of water) (Sharp et. al., 1988, Plant physiol. 87: 50-57). The different levels of water stress (i.e. 50% FC and 25% FC) were created in a PVC pots containing vermiculite by adding required amount of water. The water status in different stress levels was constantly maintained, by adding each day the amount of water lost due to evapotranspiration, through out the experiment. The seedlings were allowed to grow for 15 days in the water stress condition in the greenhouse in presence of 800 micro mol./mt2/sec.light intensity and 60% RH. At 15th day the growth of root and shoot were recorded and photographs were taken. Each treatment had 10 replications per line and they were completely randomized.

[0222] The percent reduction in growth was computed by adopting following formula.

% reduction over absolute control = Growth of root / shoot of absolute control - Growth of root / shoot of FC - 25 % Growth of root / shoot of absolute control × 100 ##EQU00003##

[0223] Results: Four different CspB transgenic lines were analyzed for water stress tolerance. All the CspB transgenic lines tested exhibited significantly higher growth during stress compared to the wild type plants. The transgenic lines including R2-257-15-1-1, R2-238-1-1-3, R2-257-3-1-6 and R2-226-6-9-3 exhibited least percent reduction in root and shoot growth over non-stress control (FC-100%). The reduction in root and shoot growth in these lines ranged between 11 to 25%. Where as, the wild type plants exhibited maximum reduction in growth, which is close to 50%. These results suggest that CspA improves the water stress tolerance of rice (Table-10 and Table-11).

TABLE-US-00012 TABLE 10 Comparison of root and shoot growth at the end of water stress of cspB transgenic lines and the wild type. FC - 100% FC - 50% FC - 25% Lines Root Shoot R:S Root Shoot R:S Root Shoot R:S R2-257-15-1-1 9.2 ± 2.2 24.3 ± 2 .37 9 ± 1.27 23.7 ± 1.5 .37 8.1 ± 1.5 18.5 ± 2.2 .43 R2-238-1-1-3 9.65 ± 2.7 26.3 ± 13.8 .36 8.35 ± 1.56 22.9 ± 1.26 .36 7.15 ± 1.0 18.1 ± 1.6 .39 R2-257-3-1-6 7.35 ± 2.2 26.1 ± 1.31 .28 6.4 ± 1.15 23.0 ± 1.57 .27 6.9 ± 1.07 19.5 ± 1.96 .35 R2-226-6-9-3 8.95 ± 1.82 25.05 ± 1.6 .35 7.4 ± 1.2 19.0 ± 2.24 .38 7.25 ± 1.5 17.4 ± 2.15 .41 WT - Taipei 9.2 ± 1.62 24.6 ± 1.58 .37 7.4 ± 1.66 22.4 ± 0.97 .33 6.58 ± 0.9 12.8 ± 3.2 .51 (Index: WT = wild type, R:S = Root to Shoot ratio)

TABLE-US-00013 TABLE 11 Comparison of percent reduction in growth of root and shoot of cspB transgenic lines and the wild type. % Reduction in % Reduction in % Reduction in Lines root growth shoot growth root and shoot growth R2-257-15-1-1 11 23.8 20 R2-238-1-1-3 25 31 30 R2-257-3-1-6 6 25.2 21 R2-226-6-9-3 19 30.5 27.5 WT-Taipei 28.4 47.9 42.8

[0224] CspA-R2 Plant Analysis

[0225] a. Plant Material Preparation:

[0226] Germination: Seeds were sterilized by treating with 0.01 percent mercuric chloride for 3 minutes and washed thoroughly for ten times in milique water to remove the traces of mercuric chloride. Sterilized seeds were allowed to imbibe by soaking in milique water for 3 hours. The imbibed seeds were germinated on a sterilized moist filter paper at 30° C. temperature and 60% RH using a seed germinator (Serwell Instruments Inc.).

[0227] Establishment of three leaf stage seedlings: The three day old germinated seedlings were transferred to portrays (52.5 mm (length)×26 mm (depth)×5.2 mm (diameter)) in the green house having light intensity of 800 micro mol./mt2/sec. and 60% RH. The seedlings were grown till three-leaf stage (Approximately for 12 days) in portrays containing red sandy loam soil. Fertilizer solution was sprayed to the seedlings once a week till the completion of the experiments (N-75 PPM, P-32 PPM, K-32 PPM, Zn-8 PPM, Mo-2 PPM, Cu-0.04 PPM, B-0.4 PPM and Fe-3.00 PPM).

[0228] Protocol: One-month-old seedlings were subjected to water stress for three days in presence of 800 micro mol./mt2/sec. light and 60% RH in the greenhouse. Water stress was imposed by withholding irrigation. At the end of three days, plants started showing the wilting symptom. The stress was alleviated by irrigating the plants with water and 24 hours later the observations on percent plants showing wilting symptoms were recorded. A minimum of 12 plants was maintained per line per treatment.

[0229] Results: Out of seven independent CspA transgenic lines tested 6 lines showed improved water stress tolerance compared to wild type. Sixty six percent of control plants did not recover from wilting after irrigation where as in CspA transgenic plants percentage of plants showing wilting symptoms after irrigation varied from 5% to 43% among different independent lines (except one line where percentage of plants showing wilting was 85%). These results suggest that CspA improves the water stress tolerance in rice (Table 12).

TABLE-US-00014 TABLE 12 Water stress response of CspA R2 transgenic rice lines. Percentage Lines plants showing wilting R2-362-3-1-2 17 R2-328-2-1-1 43 R2-362-7-1-2 85 R2-365-4-5-3 5 R2-362-6-1-6 Nil R2-362-3-1-10 15 R2-362-7-1-2 8 WT-Nipponbare 66

[0230] Salt Stress Response

[0231] CspB-R3 Plant Analysis

[0232] Protocol: Germinated seedlings (48 h. old) were subjected to salinity stress by transferring them to PVC pots with vermiculite containing 200 mM of NaCl and grown for 10 days. After 10 days of stress the seedlings were allowed to recover for 15 days by transferring them to a fresh trays of vermiculite containing water. The growth observation such as plant height was recorded at the end of recovery. This experiment was conducted in the greenhouse by following Completely Randomized Design (CRD) and maintained eight replications per treatment.

[0233] Results: Seven CspB transgenic lines and wild type plants were subjected to 200 mM NaCl stress. Under this condition five transgenic lines performed better compared to wild type. These results suggest that CspB improves tolerance of rice plants to salt stress (Table 13).

TABLE-US-00015 TABLE 13 Salt stress recovery growth observations of CspA R2 transgenic rice lines. Non-stressed Percent Stressed-plant plant height reduction in height (cm) (cm) at end plant height Lines at end of recovery of recovery over non-stressed R3-226-6-9-3 12.68 ± 2.83 23.48 ± 3.85 45.99 R3-226-29-1-3-4 19.24 ± 3.46 25.54 ± 3.64 24.66 R3-230-4-4-2-1 15.39 ± 3.05 25.2 ± 2.14 38.92 R3-230-34-1-2-1 15.78 ± 3.31 23.26 ± 1.98 32.15 R3-238-1-1-3-4 13.41 ± 2.73 23.63 ± 4.61 43.25 R3-257-3-1-3-1 21.07 ± 3.28 28.95 ± 4.37 27.64 R3-257-20-2-1-1 19.01 ± 3.98 26.35 ± 2.84 27.85 WT-Taipei 14.71 ± 2.28 27.43 ± 2.75 46.37 R3 water stress assay

[0234] Germinated seedlings (3 day old) from four independent transgenic lines (1,2,3,4) of cspA and wild type (Nipponbare--Number.5) were subjected to water stress by transferring them into a pot containing vermiculite. Three levels of water regimes were maintained, they are 100% field capacity (FC-100=3.72 ml of water/g vermiculite)

[0235] 25% field capacity (FC25=0.93 ml of water/g vermiculite) 15% field capacity (FC15=0.558 ml/g vermiculite). The seedlings were grown in different water regimes for 30 days in presence of 800 micro mol./mt2/sec.light intensity and 60% RH in the greenhouse. The water status in different stress levels was constantly maintained, by adding each day the amount of water lost due to vapotranspiration, throughout the experiment. At the end of 30th day plants were allowed to recover by adding water to bring it the level of FC 100 and maintained for 15 days. During the experiment the growth observations such as plant height (pl. ht.) at the end of stress (ES) and root (R) shoot (S) length and dry weight at the end of the recovery were recorded.

[0236] Each treatment had 10 replications per line and they were completely randomized.

TABLE-US-00016 TABLE 14 Average shoot and root length (cm) at the end of recovery Line code Lines FC100_Root FC100_Shoot FC25_Root FC25_Shoot FC15_Root FC15_Shoot 1 R2-362-3-1-3-4 24.5 ± 1.9 49.1 ± 3.6 17.0 ± 2.6 34.5 ± 2.4 12.5 ± 1.4 31.2 ± 1.8 2 R2-362-6-1-2-2 23.3 ± 1.3 45.6 ± 1.5 17.5 ± 1.8 31.5 ± 1.5 17.6 ± 2.3 32.0 ± 0.7 3 R2-362-7-1-3-3 24.5 ± 1.3 47.6 ± 3.3 17.8 ± 2.0 33.5 ± 1.7 15.9 ± 1.7 31.9 ± 1.7 4 R2-365-10-1-2-1 24.03 ± 1.5 44.4 ± 2.2 13.8 ± 1.3 30.24 ± 1.1 13.9 ± 1.3 23.9 ± 0.9 5 WT- Nipponbare 23.84 ± 1.25 44.8 ± 2.0 12.9 ± 1.8 31.6 ± 1.2 13.9 ± 1.9 31.5 ± 1.2

TABLE-US-00017 TABLE 15 Average shoot and root dry weight (mg) at the end of recovery Line code Lines FC100_Root FC100_Shoot FC25_Root FC25_Shoot FC15_Root FC15_Shoot 1 R2-362-3-1-3-4 231 ± 21.8 563.9 ± 60.7 57.6 ± 6.8 189 ± 16.3 44.7 ± 6.3 152.9 ± 22.1 2 R2-362-6-1-2-2 226 ± 14.2 531.8 ± 63 72.1 ± 5.1 179.8 ± 17 53.9 ± 7.9 146.3 ± 21.1 3 R2-362-7-1-3-3 229.5 ± 30.2 533 ± 48.5 66.1 ± 11.9 183 ± 13.9 60.6 ± 5.7 147.4 ± 14.7 4 R2-365-10-1-2-1 219 ± 43.5 557 ± 71.9 56.2 ± 9.3 173.9 ± 27.3 47.3 ± 3.1 133.7 ± 7.7 5 WT-Nipporbare 226 ± 34.5 525 ± 31.3 61.1 ± 4.2 151.1 ± 16.8 45.2 ± 7.5 132.2 ± 11.03

TABLE-US-00018 TABLE 16 Average shoot length (cm) at the end of stress Line code Lines FC100 FC25 FC15 1 R2-362-3-1-3-4 42 ± 4.6 28.4 ± 1.7 27.4 ± 2.1 2 R2-362-6-1-2-2 40.4 ± 2.1 26.1 ± 1.1 25.2 ± 2.2 3 R2-362-7-1-3-3 40.1 ± 2.7 27 ± 2.0 26.3 ± 1.4 4 R2-365-10-1-2-1 38.9 ± 2.3 26.3 ± 1.6 23.3 ± 2.4 5 WT-Nipponbare 39.5 ± 1.05 24.2 ± 2.0 24.7 ± 1.9

Example 10

cspA

[0237] Construction of pMON73607 (FIG. 10)

[0238] 1. Vector pMON61322 cut with NcoI and ApaI to open up backbone and drop out Csp A gene. Backbone fragment isolated by gel purification.

[0239] 2. E. coli cspA gene PCR amplified from pMON56609 (FIG. 8) vector. PCR primers used left the NcoI site at the 5' end of the gene and created a SwaI and an ApaI site at the 3' end.

[0240] 3. Ligated PCR fragment and pMON61322 (FIG. 11) backbone. Transformed into library efficiency DH5α cells. Screened colonies using ApaI and NcoI to identify clones with inserts.

[0241] 4. Sequenced vector to confirm fidelity of the cspA gene and other selected regions of the plasmid.

cspB

[0242] Construction of pMON73608 (FIG. 12)

[0243] 1. Vector pMON61322 cut with NcoI and ApaI to open up backbone and drop out HVA1 gene. Backbone fragment isolated by gel purification.

[0244] 2. Bacillus subtilis cspB gene PCR amplified from pMON56610 vector. PCR primers used left the NcoI site at the 5' end of the gene and created a SwaI and an ApaI site at the 3' end.

[0245] 3. Ligated PCR fragment and pMON61322 backbone. Transformed into library efficiency DH5α cells. Screened colonies using ApaI and NcoI to identify clones with inserts.

[0246] 4. Sequenced vector to confirm CspB gene and other selected regions of the plasmid.

Example 11

Maize Plant Transformation

[0247] Maize plants can be transformed by methods known in the art, for example, see Examples 20-25 herein.

Example 12

[0248] Analysis of transgenic plants for copy number will be done in the following manner.

[0249] Leaf tissue is collected from a young leaf, from as close to the base as possible and from one side of the leaf. Samples are placed in 96-well plates lyophilized overnight. Tissues are homogenized by placing three 3 mm metal balls in each well and shaking using a Mega Grinder at 1200 rpm for 2 minutes. DNA is extracted using standard buffers containing beta-mercaptoethanol, Tris buffered to pH 8, EDTA, NaCl, and sodium dodecyl sulfate. Extraction is performed with potassium acetate followed by chloroform and precipitation is performed with isopropanol. Following centrifugation, washing with ethanol solution, and drying, DNA is resuspended in Tris-EDTA buffer prior to further analysis.

[0250] DNA is digested with multiple restriction endonucleases and fragments are separated by non-denaturing agarose gel electrophoresis. DNA is denatured by NaOH solution. The gel is neutralized in NaCl-containing Tris buffer and blotted to nylon filters by capillary action. Nylon filters are pre-hybridized in buffered solution containing salmon sperm DNA prior to addition of appropriate probes, either radioactive or DIG-labeled. Following hybridization, blots are washed and detected by exposure to autoradiography film or detection of DIG with anti-DIG antibody conjugates and appropriate substrates.

Example 13

[0251] We are using the full length open reading frame of cspA and cspB for expression in E. coli using vectors (Novagen, an affiliate of Merck KgaA, Darmstadt, Germany) that allow synthesis and purification of His-tagged antigen. Purified antigen will be used to generate polyclonal antibodies using a commercial provider, for example Strategic Biosolutions. Antibodies produced will be used to test plants for expression of CSP proteins.

Example 14

[0252] Transgenic maize line advancement. Primary transformants are generated in germplasm such as CORN OF GERMPLASM A, CORN OF GERMPLASM C, and CORN OF GERMPLASM D. Primary transformants are selfed as well as backcrossed to non-transgenic plants of the same inbred genotype. Seed from selfed plants is planted in the field and assayed by Taqman zygosity assay to identify putative homozygous selections, putative heterozygous selections, and negative selections. Putative heterozygous selections are crossed with multiple plants of appropriate testers, e.g. CORN OF GERMPLASM B and CORN OF GERMPLASM D. Hybrid seed is harvested, hand shelled, and pooled by selection. Other breeding methods may also be employed, for example, see example 29 herein.

Example 15

[0253] Seedlings will receive a treatment that limits available water to a sub-optimal level such that the treatment results in a measurable phenotypic response. For example, this treatment could take the form of restricting the amount of water over a number of days leading to a progressive water deficit, or the form of an acute deficit by osmotically stressing the seedlings hydroponically or with a salt treatment. Transgene positive plants will be screened for an improved phenotypic response to the treatment. The phenotypic responses measured may include shoot growth rate or dry weight accumulation during the treatment or following a post-treatment recovery period, wilting or wilt recovery, and root growth rates and dry weight accumulation. Those with improved response will be advanced to a field efficacy trial. Screens will require a number of transgene positive and transgene negative plants to be grown in small pots in a controlled environment such as a growth chamber or greenhouse. The number of plants screened is dictated by the variance associated with treatments applied and phenotypes measured.

Example 16

[0254] Field grown plants will receive a treatment that limits available water to a sub-optimal level such that the treatment results in a measurable phenotypic response. For example, this treatment could take the form of restricting the amount of water available to the plants over a number of days leading to a progressive water deficit either during late vegetative or early reproductive development of the plants. Transgene positive plants will be screened for an improved phenotypic response to the treatment relative to transgene negative plants. The phenotypic responses measured may include shoot growth rate during the treatment, leaf wilting, grain yield, and ear yield components such as kernel number and kernel weight. Those events with improved response will be advanced to a first year yield trial. Screens will be applied at typical planting densities at two dryland field locations with controllable irrigation. The number of plants screened is dictated by the variance associated with treatments applied and phenotypes measured.

Example 17

[0255] Several of the genes described will be cloned, transformed into plants, and be phenotyped in a manner similar to the following (Examples 17-30). For example, nucleotides and nucleotides encoding SEQ ID NOS: 4-53.

Construction of the Destination Vector.

[0256] A GATEWAY® Destination (Invitrogen Life Technologies, Carlsbad, Calif.) plant expression vector was constructed (pMON65154, FIG. 13) using methods known to those of skill in the art. The elements of the expression vector are summarized in Table 17. The backbone of the plasmid pMON65154 comprising the bacterial replication functions and an ampicillin resistance gene expressed in E. coli were derived from the plasmid pSK-. The plant expression elements in pMON64154 are available to those of skill in the art and references are provided for each element in Table 17. All references in Table 17 to location refer to base pair coordinates for each element on the plasmid map disclosed in FIG. 13. Generally, pMON65154 comprises a selectable marker expression cassette comprising a Cauliflower Mosaic Virus 35S promoter operably linked to a gene encoding neomycin phosphotransferase II (nptII). The 3' region of the selectable marker expression cassette comprises the 3' region of the Agrobacterium tumefaciense nopaline synthase gene (nos) followed 3' by the 3' region of the potato proteinase inhibitor II (piffle gene. The plasmid pMON 65154 further comprises a plant expression cassette into which a gene of interest may be inserted using GATEWAY® cloning methods. The GATEWAY® cloning cassette is flanked 5' by a rice actin 1 promoter, exon and intron and flanked 3' by the 3' region of the potato pinII gene. Using GATEWAY® methods, the cloning cassette was replaced by a gene of interest. The vector pMON65154 and derivaties thereof comprising a gene of interest, were particularly useful in methods of plant transformation via direct DNA delivery, such as microprojectile bombardment. One of skill in the art could construct an expression vector with similar features using methods known in the art. Furthermore, one of skill in the art would appreciate that other promoters and 3' regions would be useful for expression of a gene of interest and other selectable markers may be used.

TABLE-US-00019 TABLE 17 Elements of Plasmid pMON65154 CASSETTE FUNCTION ELEMENT LOCATION REFERENCE Plant gene of Promoter Rice actin 1 1796-2638 Wang et al., 1992 interest expression Enhancer Rice actin 1 exon 2639-3170 Wang et al., 1992 1, intron 1 GATEWAY ® Recombination AttR1 3188-3312 GATEWAY ®Cloning cloning Technology Instruction Manual (Invitrogen Life Technologies, Carlsbad, CA) Bacterial CmR gene 3421-4080 GATEWAY ®Cloning chloramphenical Technology Instruction resistance gene Manual (Invitrogen Life Technologies, Carlsbad, CA) Bacterial negative ccdA, ccdB 4200-4727 GATEWAY ®Cloning selectable markers genes Technology Instruction Manual (Invitrogen Life Technologies, Carlsbad, CA) GATEWAY ® attR2 4768-4892 GATEWAY ®Cloning recombination site Technology Instruction Manual (Invitrogen Life Technologies, Carlsbad, CA) Plant gene of 3' region Potato pinII 4907-5846 An et al., 1989 interest expression cassette Plant selectable Promoter Cauliflower 5895-6218 US Patent # 5,352,605 marker gene Mosaic Virus expression cassette 35S Selectable marker nptII 6252-7046 US Patent # 6,174,724 gene 3' region nos 7072-7327 Bevan et al., 1983 3' region pinII 7339-8085 An et al., 1989 Maintenance in E. coli Origin of replication ColE1 858-1267 Oka et al, 1979 Maintenance in E. coli Origin of replication F1 8273-3673 Ravetch et al., 1977 Maintenance in E. coli Ampicillin resistance bla 8909-551 Heffron et al., 1979

[0257] A separate plasmid vector (pMON72472, FIG. 14) was constructed for use in Agrobacterium mediated methods of plant transformation. The plasmid pRG76 comprises the gene of interest plant expression, GATEWAY® cloning, and plant selectable marker expression cassettes present in pMON65154. In addition left and right T-DNA border sequences from Agrobacterium were added to the plasmid. The right border sequence is located 5' to the rice actin 1 promoter and the left border sequence is located 3' to the pinII 3' sequence situated 3' to the nptII gene. Furthermore the pSK-backbone of pMON65164 was replaced by a plasmid backbone to facilitate replication of the plasmid in both E. coli and Agrobacterium tumefaciens. The backbone comprises an oriV wide host range origin of DNA replication functional in Agrobacterium, the rop sequence, a pBR322 origin of DNA replication functional in E. coli and a spectinomycin/stretptomycin resistance gene for selection for the presence of the plasmid in both E. coli and Agrobacterium.

[0258] The elements present in plasmid vector pRG81 are described in Table 18.

TABLE-US-00020 TABLE 18 Genetic Elements of Plasmid Vector pRG81 CASSETTE FUNCTION ELEMENT LOCATION REFERENCE Plant gene of Promoter Rice actin 1 5610-6452 Wang et al., 1992 interest expression Enhancer Rice actin 1 6453-6984 Wang et al., 1992 exon 1, intron 1 GATEWAY ® Recombination AttR1 7002-7126 GATEWAY ®Cloning cloning Technology Instruction Manual (Invitrogen Life Technologies, Carlsbad, CA) Bacterial CmR gene 7235-7894 GATEWAY ®Cloning chloramphenical Technology Instruction resistance gene Manual (Invitrogen Life Technologies, Carlsbad, CA) Bacterial negative ccdA, ccdB 8014-8541 GATEWAY ®Cloning selectable markers genes Technology Instruction Manual (Invitrogen Life Technologies, Carlsbad, CA) GATEWAY ® attR2 8582-8706 GATEWAY ®Cloning recombination site Technology Instruction Manual (Invitrogen Life Technologies, Carlsbad, CA) Plant gene of 3' region Potato pinII 8721-9660 An et al., 1989 interest expression cassette Plant selectable Promoter Cauliflower 1-324 US Patent # 5,352,605 marker gene Mosaic Virus expression 35S cassette Selectable marker nptII 358-1152 US Patent # 6,174,724 gene 3' region nos 1178-1433 Bevan et al., 1983 3' region pinII 1445-2191 An et al., 1989 Agrobacterium DNA transfer Left border 2493-2516 Zambryski et al., 1982; mediated GenBank Accession transformation AJ237588 Maintenance of Origin of replication Ori-V 2755-3147 Honda et al., 1988 plasmid in E. coli or Agrobacterium Maintenance of Origin of replication ColE1 3545-4199 Oka et al., 1972 plasmid in E. coli Maintenance of Spectinomycin/ststreptomycin Spc/Str 4242-5030 Fling et al., 1985 plasmid in E. coli or resistance Agrobacterium Agrobacterium DNA transfer Right 5514-5538 Zambryski et al., 1982; mediated border GenBank Accession transformation AJ237588

Example 18

[0259] Coding sequences were amplified by PCR prior to insertion in a GATEWAY® Destination plant expression vector such as pMON65154 (FIG. 13). All coding sequences were available as either a cloned full length sequence or as DNA sequence information which allowed amplification of the desired sequence from a cDNA library. Primers for PCR amplification were designed at or near the start and stop codons of the coding sequence, in order to eliminate most of the 5' and 3' untranslated regions. PCR products were tailed with attB1 and attB2 sequences in order to allow cloning by recombination into GATEWAY® vectors (Invitrogen Life Technologies, Carlsbad, Calif.).

[0260] Two methods were used to produce attB flanked PCR amplified sequences of interest. Both methods are described in detail in the GATEWAY® Cloning Technology Instruction Manual (Invitrogen Life Technologies, Carlsbad, Calif.). In the first method, a single primer set comprising attB and template specific sequences was used. The primer sequences are as follows:

TABLE-US-00021 attB1 forward primer: (SEQ ID NO: 71) 5' GGG CAC TTT GTA CAA GAA AGC TGG GTN template specific sequence 3' attB2 reverse primer (SEQ ID NO: 72) 5' GGGG CAC TTT GTA CAA GAA AGC TGG GTN template specific sequence 3'

[0261] Alternatively, attB adapter PCR was used to prepare attB flanked PCR products. attB1 adapter PCR uses two sets of primers, i.e., gene specific primers and primers to install the attB sequences. Desired DNA sequence primers were designed which included 12 base pairs of the attB1 or attB2 sequences at the 5' end. The primers that were used were as follows:

TABLE-US-00022 att131 gene specific forward primer (SEQ ID NO: 73) 5' CCTGCAGGACCATG forward gene specific primer 3' attB2 gene specific reverse primer (SEQ ID NO: 74) 5' CCTGCAGGCTCGAGCTA reverse gene specific primer 3'

[0262] The second set of primers were attB adapter primers with the following sequences:

TABLE-US-00023 attB1 adapter forward primer (SEQ ID NO: 75) 5' GGGGACAAGTTTGTACAAAAAAGCAGGCTCCTGCAGGACCATG 3' attB2 adapter reverse primer (SEQ ID NO: 76) 5' GGGGACCACTTTGTACAAGAAAGCTGGGTCCCTGCAGGCTCGAGCT A 3'

[0263] attB 1 and attB2 flanked sequences were amplified by PCR according to the methods described by Invitrogen Life Technologies (Carlsbad, Calif.). attB flanked PCR products were purified and recovered from a gel as described above.

[0264] In some instances, attB flanked sequences were recovered from PCR, but could not be inserted into the Donor Vector using GATEWAY® technology. Conventional cloning methods using ligases were used to insert a DNA sequence into an Entry Vector (Invitrogen Life Technologies, Carlsbad, Calif.) when GATEWAY® recombination into the Donor Vector failed. The choice of Entry Vector depended on the compatibility of restriction endonuclease sites in the Entry Vector and desired insert sequence. The Entry Vector was digested with a selected restriction endonuclease to remove the ccdB gene, dephosphorylated and gel purified. The selected restriction endonuclease depended on the Entry Vector used and the sequence of the desired insert sequence. For example, the ccdB gene was removed from pENTR11 (FIG. 15) using EcoRI or other combinations of restriction endonucleases such as EcoRV, and XmaI or NcoI and XhoI. Other restriction nucleases could be used with other Entry Vectors for use in the GATEWAY® process. To use restriction endonuclease digested Entry Vectors, it was necessary to be able to produce compatible sticky ends on the desired PCR product. Sticky ends could be produced by a number of methods known to those of skill in the art, such as restriction endonuclease digestion, adapter ligation or addition of restriction sites during PCR.

[0265] In some instances, it was not possible to produce compatible sticky ends on a PCR fragment and an Entry Vector. Alternatively, compatible sticky ends could be produced directed by restriction enzyme digestion of a cDNA clone. It was possible, however, to blunt end ligate PCR fragments into an Entry Vector. Using this method, the Entry Vector was cut with a restriction endonuclease to remove the ccdB gene. A gel purified linear Entry Vector was made blunt ended with T4 DNA polymerase. One of skill in the art is aware of other methods of making blunt ended DNA molecules, such as the use of Klenow DNA polymerase. The PCR product was made blunt ended and preferably dephosphorylated by incubation with T4 DNA polymerase, or another suitable polymerase, T4 polynucleotide kinase and a phosphatase enzyme. The Entry Vector and PCR product were blunt end ligated using methods known in the art. Ligation products were transformed into E. coli and plasmids from individual colonies analyzed for presence of the insert DNA and the desired orientation relative to the attL sites in the Entry Vector. Clones with the attL1 sequence next to the amino end of the open reading frame were selected.

[0266] Preferably, the TA method of cloning PCR products (Marchuk et al., 1991) was used when attB flanked PCR products could not be inserted into a plasmid using GATEWAY® methods. The TA method takes advantage of Taq polymerase terminal transferase activity. An Entry Vector was cut with a restriction endonuclease and made blunt ended using the methods described herein. The blunt ended linear Entry Vector was incubated with dTTP and Taq polymerase resulting in the addition of a single thymidine residue at the 3' end of each DNA strand. Since Taq polymerase has a strong preference for dATP, PCR products are most often produced with a single adenosine added to the 3' end. Therefore, the Entry Vector and PCR product have complimentary single base 3' overhangs. Following ligation under conditions known to those of skill in the art, plasmids were transformed into E. coli. Plasmids were isolated from individual colonies and analyzed to identify plasmids with the desired insert in the correct orientation. Alternatively, PCR products, tailed with attB sites were TA cloned into a commercial TA cloning vector, such as pGEM-T EASY (Promega Corporation, Madison, Wis.).

[0267] All PCR amplification products were sequenced prior to introduction into a plant. PCR inserts in Destination expression vectors produced by GATEWAY® methods were sequenced to confirm that the inserted sequenced encoded the expected amino acid sequence. If Entry Vectors were produced using ligation methods, the inserted sequence was sequenced in the Entry Vector prior to production of the Destination expression vector using GATEWAY® technology. Point mutations which did not affect the amino acid coding sequence, i.e., silent mutations, were accepted.

Example 19

Construction of Expression Vectors

[0268] GATEWAY® cloning methods (Invitrogen Life Technologies, Carlsbad, Calif.) were used to construct expression vectors for use in maize transformation. The GATEWAY® methods are fully described in the GATEWAY® Cloning Technology Instruction Manual (Invitrogen Life Technologies, Carlsbad, Calif.). Use of the GATEWAY® system facilitates high throughput cloning of coding sequences into a plant expression vector. Gene sequences flanked by attB 1 and attB2 sequences were produced by PCR as described above. Depending on which recombination sequence, attB 1 and attB2, was placed 5' and 3' to the coding sequence, sense or antisense expression vectors were produced. A plant expression vector, pMON65154 (FIG. 13), into which any coding sequence could be inserted in a sense or antisense orientation was constructed as described in Example 1 and was used as a destination vector in the GATEWAY® cloning process.

[0269] Two alternative processes were used for inserting a PCR amplified coding sequence into a plant expression vector. In the first method, a PCR product comprising the coding sequence of interest flanked by attB 1 and attB2 sequences at the 5' and 3' ends was incubated with the donor vector (pDONR201®, Invitrogen Life Technologies, Carlsbad, Calif.) in the presence of BP CLONASE®. GATEWAY® entry clones were produced from this reaction and transformed into E. coli. Plasmid DNA was isolated from entry clones. Inserted coding sequences could be sequenced from entry vectors in order to confirm the fidelity of PCR amplification. Plasmid DNA, isolated from entry clone E. coli colonies, was incubated with linearized destination vector, preferably pMON65154, in the presence of LR CLONASE® to produce plant expression vectors comprising the coding sequence of interest. DNA from the LR CLONASE® reaction was transformed into E. coli. Plasmid DNA from destination expression vectors was isolated and sequenced in order to determine correct orientation and sequence of the plant expression vector.

[0270] In the second method of generating plant expression vectors, a PCR product flanked by attB1 and attB2 sequences was incubated with a donor vector (pDONR201®, Invitrogen Life Technologies, Carlsbad, Calif.), and BP CLONASE® as described above. Following incubation, an aliquot of the reaction mix was further incubated with linearized destination vector and LR CLONASE®. The resultant DNA was transformed into E. coli and plant expression vectors containing the coding sequence of interest selected using PCR or Southern blot analysis techniques known in the art. Both methods of producting plant expression vectors comprising a coding sequence of interest were described by Invitrogen Life Technologies (GATEWAY® Cloning Technology Instruction Manual).

[0271] Alternatively, Entry Vectors were produced using restriction endonucleases and ligases. Entry Vectors are available from Invitrogen Life Technlogies (Carlsbad, Calif.). Each entry vector, e.g., pENTR1A, pENTR2B, pENTR3C, pENTR4, and pENTR11, has unique cloning and expression features. pENTR11 was preferably used in the practice of the present invention. Those of skill in the art will recognize the usefulness of the other Entry Vectors. Before using restriction endonucleases and ligases to insert desired sequences into one of the Entry Vectors, it was necessary to restriction digest the Entry Vector on each side of the ccdB gene. A number of different combinations of restriction endonucleases were used depending on the restriction sites present on the DNA sequence to be inserted into the Entry Vector. Preferably the Entry Vector was dephosphorylated and gel purified after restriction digestion. The desired DNA sequence was inserted into the Entry Vector using conventional methods of molecular biology known to those of skill in the art. TA cloning (U.S. Pat. No. 5,827,657) is a preferable method of cloning PCR fragments into an Entry Vector.

[0272] Vectors (designated as pMON and a 5 digit number) and coding sequences contained therein that were produced using the GATEWAY® cloning methods are, for example, SEQ ID NOS: 4-28. It is expected that some of the coding sequences of the present invention may be cloned into a plant expression vectors using the methods described herein.

Example 20

[0273] CORN OF GERMPLASM A plants were grown in the greenhouse. Ears were harvested from plants when the embryos were 1.5 to 2.0 mm in length, usually 10 to 15 days after pollination, and most frequently 11 to 12 days after pollination. Ears were surface sterilized by spraying or soaking the ears in 80% ethanol, followed by air drying. Alternatively, ears were surface sterilized by immersion in 50% CLOROX® containing 10% SDS for 20 minutes, followed by three rinses with sterile water.

[0274] Immature embryos were isolated from individual kernels using methods known to those of skill in the art. Immature embryos were cultured on medium 211 (N6 salts, 2% sucrose, 1 mg/L 2,4-D, 0.5 mg/L niacin, 1.0 mg/L thiamine-HCl, 0.91 g/L L-asparagine, 100 mg/L myo-inositiol, 0.5 g/L MES, 100 mg/L casein hydrolysate, 1.6 g/L MgCl2, 0.69 g/L L-proline, 2 g/L GELGRO®, pH 5.8) containing 16.9 mg/L AgNO3, (designated medium 211V) for 3-6 days, preferably 3-4 days prior to microprojectile bombardment.

Example 21

[0275] Methods of Agrobacterium mediated transformation of maize cells and other monocots are known (Hiei et al., 1997; U.S. Pat. No. 5,591,616; U.S. Pat. No. 5,981,840; published EP patent application EP 0 672 752). Although various strains of Agrobacterium may be used (see references above), strain ABI is used preferably by the present inventors. The ABI strain of Agrobacterium is derived from strain A208, a C58 nopaline type strain, from which the Ti plasmid was eliminated by culture at 37° C., and further containing the modified Ti plasmid pMP90RK (Koncz and Schell, 1986). An Agrobacterium tumefaciens binary vector system (An et al., 1998) is preferably used to transform maize. Alternative cointegrating Ti plasmid vectors have been described (Rogers et al., 1988) and could be used to transform maize. A binary vector comprising one or more genes of interest may be introduced into a disarmed Agrobacterium strain using electroporation (Wen-jun and Forde, 1989) or triparental mating (Ditta et al., 1980). A binary vector may contain a selectable marker gene, a screenable marker gene and/or one or more genes that confer a desirable phenotypic trait on the transformed plant. An exemplary binary vector, pMON30113, is shown in FIG. 4. Other binary vectors may be used and are known to those of skill in the art.

[0276] Prior to co-culture of maize cells, Agrobacterium cells may be grown at 28° C. in LB (DIFCO) liquid medium comprising appropriate antibiotics to select for maintenance of the modified Ti plasmid and binary vector. For example, ABI/pMON30113, may be grown in LB medium containing 50 ug/ml kanamycin to select for maintenance of the pMP90RK modified Ti plasmid and 100 ug/ml spectinomycin to select for maintenance of the binary vector pMON30113. It will be obvious to one of skill in the art to use appropriate selection agents to maintain plasmids in the host Agrobacterium strain. Prior to inoculation of maize cells, Agrobacterium cells are grown overnight at room temperature in AB medium (Chilton et al., 1974) comprising appropriate antibiotics for plasmid maintenance and 200 uM acetosyringone. Immediately prior to inoculation of maize cells, Agrobacterium are preferably pelleted by centrifugation, washed in 1/2 MSVI medium (2.2 g/L GIBCO (Carlsbad, Calif.) MS salts, 2 mg/L glycine, 0.5 g/L niacin, 0.5 g/L L-pyridoxine-HCl, 0.1 mg/L thiamine, 115 g/L L-proline, 10 g/L D-glucose, and 10 g/L sucrose, pH 5.4) containing 200 uM acetosyringone, and resuspended at 0.1 to 1.0×109 cells/ml in 1/2 MSPL medium (2.2 g/L GIBCO (Carlsbad, Calif.) MS salts, 2 mg/L glycine, 0.5 g/L niacin, 0.5 g/L L-pyridoxine-HCl, 0.1 mg/L thiamine, 115 g/L L-proline, 26 g/L D-glucose, 68.5 g/L sucrose, pH 5.4) containing 200 uM acetosyringone. One of skill in the art may substitute other media for 1/2 MSVI or 1/2 MSPL.

[0277] Immature maize embryos are isolated as described previously. Embryos are inoculated with Agrobacterium 0-7 days after excision, preferably immediately after excision. Alternatively, immature embryos may be cultured for more than 7 days. For example, embryogenic callus may be initiated as described above and co-cultured with Agrobacterium. Preferably, immature maize embryos are excised, immersed in an Agrobacterium suspension in 1/2 MSPL medium prepared as described above and incubated at room temperature with Agrobacterium for 5-20 minutes.

[0278] Following inoculation embryos are transferred to one-half strength MS medium (Murashige and Skoog, 1962) containing 3.0 mg/L 2,4-dichlorophenyoxyacetic acid (2,4-D), 1% D-glucose, 2% sucrose, 0.115 g/L L-proline, 0.5 mg/L thiamine-HCl, 200 uM acetosyringone, and 20 uM silver nitrate or silver thiosulfate. Immature embryos are co-cultured with Agrobacterium for 1 to 3 days at 23° C. in the dark. One of skill in the art may substitute other media for the described media.

[0279] Co-cultured embryos are transferred to medium 15AA (462 mg/L (NH4)SO4, 400 mg/L KH2PO4, 186 mg/L MgSO4-7H20, 166 mg/L CaCl2-2H20, 10 mg/L MnSO4-H2O, 3 mg/L H3B03, 2 mg/L ZnSO4-7H20, 0.25 mg/L NaMoO4-2H20, 0.025 mg/L CuSO4-5H20, 0.025 mg/L CoCl2-6H20, 0.75 mg/L KI, 2.83 g/L KNO3, 0.2 mg/L niacin, 0.1 mg/L thiamine-HCl, 0.2 mg/L pyridoxine-HCl, 0.1 mg/L D-biotin, 0.1 mg/L choline chloride, 0.1 mg/L calcium pantothenate, 0.05 mg/L folic acid, 0.05 mg/L p-aminobenzoic acid, 0.05 mg/L riboflavin, 0.015 mg/L vitamin B12, 0.5 g/L casamino acids, 33.5 mg/L Na2EDTA, 1.38 g/L L-proline, 20 g/L sucrose, 10 g/L D-glucose), or MS medium containing 1.5 mg/L 2,4-D, 500 mg/L carbenicillin, 3% sucrose, 1.38 g/L L-proline and 20 uM silver nitrate or silver thiosulfate and cultured for 0 to 8 days in the dark at 27° C. without selection. Culture media used for selection of transformants and regeneration of plants preferably contains 500 mg/L carbenicillin. One of skill in the art may substitute other antibiotics that control growth of Agrobacterium. Other culture media that support cell culture may be used alternatively. In the absence of a delay of selection (0 day culture), selection may be initiated on 25 mg/L paromomycin. Selection medium may comprise medium 211 (described above) or a variant of medium 211 in which N6 salts are replaced by MS salts. After two weeks, embryogenic callus are transferred to culture medium containing 100 mg/L paromomycin and subcultured at about two week intervals. When selection is delayed following co-culture, embryos are initially cultured on medium containing 50 mg/L paromomycin followed by subsequent culture of embryogenic callus on medium containing 100-200 mg/L paromomycin. One of skill in the art will culture tissue on concentrations of paromomycin which inhibit growth of cells lacking the selectable marker gene, but a concentration on which transformed callus will proliferate. Alternatively, one may use other selectable markers to identify transformed cells. It is believed that initial culture on 25 to 50 mg/L paromocyin for about two weeks, followed by culture on 50-200 mg/L paromoycin will result in recovery of transformed callus. Transformants are recovered 6 to 8 weeks after initiation of selection. Plants are regenerated from transformed embryogenic callus as described above for transformants recovered following microprojectile bombardment.

Example 22

Agrobacterium Mediated Transformation of Maize Callus

[0280] This example describes methods for transformation of maize callus using Agrobacterium. The method is exemplified using an nptII selectable marker gene and paromomycin selective agent. One of skill in the art will be aware of other selectable marker and selective agent combinations that could be used alternatively.

[0281] Callus was initiated from immature embryos using methods known to those of skill in the art. For example, 1.5 mm to 2.0 mm immature embryos were excised from developing maize seed of a genotype such as CORN OF GERMPLASM A and cultured with the embryonic axis side down on medium 211V, usually for 8-21 days after excision. Alternatively, established an established callus culture may be initiated and maintained by methods known to those of skill in the art.

[0282] Agrobacterium was prepared for inoculation of plant tissue according to the methods described in Example 21. Fifty to 100 pieces of callus was transferred to a 60 mm×20 mm petri dish containing about 15 ml of Agrobacterium suspension at 0.1 to 1.0×109 cfu/ml. A piece of callus was usually all of the callus produced by an immature embryo in up to 21 days of culture or a piece of established callus of 2 mm to 8 mm in diameter. Callus was incubated for about 30 minutes at room temperature with the Agrobacterium suspension, followed by removal of the liquid by aspiration.

[0283] About 50 μL of sterile distilled water was added to a Whatman #1 filter paper in a 60 mm×20 mm petri dish. After 1-5 minutes, 15 to 20 pieces of callus were transferred to each filter paper and the plate sealed with PARAFILM®, for example. The callus and Agrobacterium were co-cultured for about 3 days at 23° C. in the dark.

[0284] Calli were transferred from filter paper to medium 211 with 20 μM silver nitrate and 500 mg/L carbenicillin and cultured in the dark at 27° C. to 28° C. for 2-5 days, preferably 3 days. Selection was initiated by transferring callus to medium 211 containing 20 μM silver nitrate, 500 mg/L carbenicillin and 25 mg/L paromomycin. After 2 weeks culture in the dark at 27° C. to 28° C., callus was transferred to medium 211 with 20 μM silver nitrate, 500 mg/L carbenicillin and 50 mg/L paromomycin (medium 211 QRG). Callus was subcultured after two weeks to fresh medium 211 QRG and further cultured for two weeks in the dark at 27° C. to 28° C. Callus was then transferred to medium 211 with 20 μM silver nitrate, 500 mg/L carbenicillin and 75 mg/L paromomycin. After 2-3 weeks culture in the dark at 27° C. to 28° C., paromomycin resistant callus was identified. One of skill in the art would recognize that times between subcultures of callus are approximate and one may be able to accelerate the selection process by transferring tissue at more frequent intervals, e.g., weekly rather than biweekly.

[0285] Plants were regenerated from transformed callus, transferred to soil and grown in the greenhouse as described. Following Agrobacterium mediated transformation, medium 217 (see Example 9) further contained 500 mg/L carbenicillin and medium 127T (see Example 9) further contained 250 mg/L carbenicillin. Transformed maize plants comprising genes of the present invention that were produced using Agrobacterium mediated transformation are summarized in table Y.

Example 23

Methods of Microprojectile Bombardment

[0286] Approximately four hours prior to microprojectile bombardment, immature embryos were transferred to medium 211 SV (medium 211V with the addition of sucrose to 12%). Twenty five immature embryos were preferably placed in a 60×15 mm petri dish, arranged in a 5×5 grid with the coleoptilar end of the scutellum pressed slightly into the culture medium at a 20 degree angle. Tissue was maintained in the dark prior to bombardment.

[0287] Prior to microprojectile bombardment, a suspension of gold particles was prepared onto which the desired DNA was precipitated. Ten milligrams of 0.6 μm gold particles (BioRad) were suspended in 50 μL buffer (150 mM NaCl, 10 mM Tris-HCl, pH 8.0). Twenty five μL of a 2.4 nM solution of the desired DNA was added to the suspension of gold particles and gently vortexed for about five seconds. Seventy five μL of 0.1M spermidine was added and the solution vortexed gently for about 5 seconds. Seventy five μL of a 25% solution of polyethylene glycol (3000-4000 molecular weight, American Type Culture Collection) was added and the solution was gently vortexed for five seconds. Seventy five μL of 2.5 M CaCl2 was added and the solution vortexed for five seconds. Following the addition of CaCl2, the solution was incubated at room temperature for 10 to 15 minutes. The suspension was subsequently centrifuged for 20 seconds at 12,000 rpm (Sorval MC-12V centrifuge) and the supernatant discarded. The gold particle/DNA pellet was washed twice with 100% ethanol and resuspended in 10 mL 100% ethanol. The gold particle/DNA preparation was stored at -20° C. for up to two weeks.

[0288] DNA was introduced into maize cells using the electric discharge particle acceleration gene delivery device (U.S. Pat. No. 5,015,580). The gold particle/DNA suspension was coated on Mylar sheets (Du Pont Mylar polyester film type SMMC2, aluminum coated on one side, over coated with PVDC co-polymer on both sides, cut to 18 mm square) by dispersion of 310 to 320 μL of the gold particle/DNA suspension on a sheet. After the gold particle suspension settled for one to three minutes, excess ethanol was removed and the sheets were air dried. Microprojectile bombardment of maize tissue was conducted as described in U.S. Pat. No. 5,015,580. AC voltage may be varied in the electric discharge particle delivery device. For microprojectile bombardment of CORN OF GERMPLASM A pre-cultured immature embryos, 35% to 45% of maximum voltage was preferably used. Following microprojectile bombardment, tissue was cultured in the dark at 27° C.

Example 24

Selection of Transformed Cells

[0289] Transformants were selected on culture medium comprising paromomycin, based on expression of a transgenic neomycin phosphotransferase II (nptII) gene. Twenty four hours after DNA delivery, tissue was transferred to 211V medium containing 25 mg/L paromomycin (medium 211HV). After three weeks incubation in the dark at 27° C., tissue was transferred to medium 211 containing 50 mg/L paromomycin (medium 211G). Tissue was transferred to medium 211 containing 75 mg/L paromomycin (medium 211XX) after three weeks. Transformants were isolated following 9 weeks of selection. Table Y discloses results of transformant experiments using the methods of microprojectile bombardment disclosed herein.

Example 25

Regeneration of Fertile Transgenic Plants

[0290] Fertile transgenic plants were produced from transformed maize cells. Transformed callus was transferred to medium 217 (N6 salts, 1 mg/L thiamine-HCl, 0.5 mg/L niacin, 3.52 mg/L benzylaminopurine, 0.91 mg/L L-asparagine monohydrate, 100 mg/L myo-inositol, 0.5 g/L MES, 1.6 g/L MgCl2-6H2O, 100 mg/L casein hydrolysate, 0.69 g/L L-proline, 20 g/L sucrose, 2 g/L GELGRO®, pH 5.8) for five to seven days in the dark at 27° C. Somatic embryos mature and shoot regeneration began on medium 217. Tissue was transferred to medium 127T (MS salts, 0.65 mg/L niacin, 0.125 mg/L pyridoxine-HCl, 0.125 mg/L thiamine-HCl, 0.125 mg/L Ca pantothenate, 150 mg/L L-asparagine, 100 mg/L myo-inositol, 10 g/L glucose, 20 g/L L-maltose, 100 mg/L paromomycin, 5.5 g PHYTAGAR®, pH 5.8) for shoot development. Tissue on medium 127T was cultured in the light at 400-600 lux at 26° C. Plantlets are transferred to soil, preferable 3 inch pots, about four to 6 weeks after transfer to 127T medium when the plantlets are about 3 inches tall and have roots. Plants were maintained for two weeks in a growth chamber at 26° C., followed by two weeks on a mist bench in a greenhouse before transplanting to 5 gallon pots for greenhouse growth. Plants were grown in the greenhouse to maturity and reciprocal pollinations were made with the inbred CORN OF GERMPLASM A. Seed was collected from plants and used for further breeding activities.

Example 26

Isolation of Nucleic Acids from Plants

[0291] Nucleic acids were isolated from leaf tissue of R0 plants, collected and flash frozen in a 96 well collection box, 0 to 2 weeks after plantlets were transferred to soil. Approximately 100 milligrams of tissue was collected from each plant and stored at -80° C. until analysis.

[0292] DNA and RNA were isolated from a single tissue sample using the Qiagen Rneasy 96® kit (Qiagen Inc., Valencia, Calif.) with modifications. One hundred milligrams of frozen tissue was homogenized in 700 μL Rneasy® RTL buffer (Qiagen Inc., Valencia, Calif.) using a Bead Beater® (Biospec Products, Bartlesville, Okla.). Samples were centrifuged at 3200 rpm for 15 minutes and all of the supernatant transferred the wells of a Promega WIZARD® clearing plate (Promega Corporation, Madison, Wis.). The sample solutions were clarified by vacuum filtration through the clearing plate. The cleared supernatant was used for nucleic acid extractions.

[0293] For DNA extractions, 70 μL of the cleared sample was transferred to a v-well PCR plate, covered with adhesive foil, and heated to 95° C. for 8 minutes. The samples were incubated at 0° C. for five minutes, followed by centrifugation for 3 minutes to remove insoluble materials. A Sephadex G-50 gel filtration box (Edge Biosystems, Gaithersburg, Mo.) was conditioned for 2 min at 2000 rpm. Forty μL of the heat-treated supernatant was loaded into each well and the box centrifuged for two minutes at 2500 rpm. An additional 20 μL of TE buffer was added to the column effluent and the sample plate was stored at -20° C. until analysis.

[0294] For RNA extractions, five hundred microliters of cleared solution was transfer to a clean 96 well sample box. Two hundred and fifty microliters of 100% ethanol was added to each sample and the sample was thoroughly mixed. All of the approximately seven hundred and fifty microliters of solution was then loaded into the wells of a Qiagen Rneasy® binding plate in a Promega WIZARD® filtration unit. Five hundred microliters of RW1 buffer (Qiagen Inc., Valencia, Calif.) was added to each well and the buffer removed by vacuum filtration. Eighty microliters of RNAase free DNAase (Qiagen Inc., Valencia, Calif.) was added to each well, incubated at room temperature for 15 minutes the DNAase solution drawn through the wells by vacuum filtration. An additional five hundred microliters RW1 buffer (Qiagen Inc., Valencia, Calif.) was added to the wells and the buffer removed by vacuum filtration. The sample was further washed by vacuum filtration with 500 μL RPE buffer 2× (Qiagen, Valencia, Calif.). The extraction plate was placed on a microtiter plate and centrifuged for three minutes at 3000 rpm to remove any residual RPE buffer solution in the filter. Eighty microliters of RNA grade water (DNAse free) was added to each well, followed by incubation at room temperature for two minutes. The extraction plate and microtiter plate were centrifuged for three minutes at 3000 rpm and the RNA preparation stored frozen in the collection plate at -80° C.

Example 27

Assays for Copy Number

[0295] Copy number of transgenes in R0 plants was determined using TAQMAN® methods. The pMON65154 and pRG76 GATEWAY® destination vectors were constructed with a sequence derived from the 3' region of the potato pinII gene which could be used to assay copy number of transgene insertions. The pinII forward and reverse primers were as follows:

TABLE-US-00024 Forward primer (SEQ ID NO: 77) 5' ccccaccctgcaatgtga 3' Reverse primer (SEQ ID NO: 78) 5' tgtgcatccttttatttcatacattaattaa 3'

[0296] The pinII TAQMAN® probe sequence was

TABLE-US-00025 (SEQ ID NO: 79) 5' cctagacttgtccatcttctggattggcca 3'

[0297] The probe was labelled at the 5' end with the fluorescent dye FAM (6-carboyxfluorescein) and the quencher dye TAMRA (6-carboxy-N,N,N',N'-tetramethylrhodamine) was attached via a linker to the 3' end of the probe. The TAQMAN® probe was obtained from Applied Biosystems (Foster City, Calif.). ______ SAT, a single copy maize gene was used as an internal control in TAQMAN® copy number assays. The SAT primers were as follows

TABLE-US-00026 (SEQ ID NO: 80) Forward primer 5' gcctgccgcagaccaa 3' (SEQ ID NO: 81) Reverse primer 5' atgcagagctcagcttcatc 3'

[0298] The SAT TAQMAN® probe sequence was

TABLE-US-00027 (SEQ ID NO: 82) 5' tccagtacgtgcagtccctcctcc 3'

[0299] the probe was labelled at its 5' end with the fluorescent dye VIC® (Applied Biosystems, Foster City, Calif.) and the quencher dye TAMRA at is 3' end.

[0300] TAQMAN® PCR was performed according to the manufacturer's instructions (Applied Biosystems, Foster City, Calif.). Five to 100 nanograms DNA was used in each assay. PCR amplification and TAQMAN® probe detection were performed in 1× TAQMAN® Universal PCR Master Mix (Applied Biosystems, Foster City, Calif.) which contains AmpliTaq Gold® DNA polymerase, AmpErase® UNG, dNTPs with dUTP, Passive Reference 1, and optimized buffer. Eight hundred nM each forward and reverse pinII primers and 150 nM pinII TAQMAN® probe were used in the TAQMAN® assay. 200 nM each Sat forward and reverse primers and 150 nM Sat TAQMAN® probe were used in the TAQMAN® copy number assay. TAQMAN® PCR was carried out for 2 minutes at 50° C., 10 minutes at 95° C., followed by 40 cycles of 15 seconds at 95° C. and one minute at 60° C. Real time TAQMAN® probe fluorescence was measured using an ABI Prism 7700 Sequence Detection System or ABI7900HT Sequence Detection System (Applied Biosystems, Foster City, Calif.). CT values were calculated according to the TAQMAN® EZ RT-PCR kit instruction manual (Applied Biosystems, Foster City, Calif.). The ΔΔCT value was calculated as CT (internal control gene (Sat))-CT (transgene)-CT (internal control gene (Sat) in nontransgenic plant). The copy number was assigned as follows according to the criteria in Table 19.

TABLE-US-00028 TABLE 19 Critera for Copy Number Determination by TAQMAN ® Copy Number Criteria 1 -0.5 < .sup.ΔΔCT < 0.50 2 0.5 < .sup.ΔΔCT < 1.50 >2 .sup.ΔΔCT > 1.50

[0301] Plants comprising genes of the present invention will be analyzed by TAQMAN® methods for copy number. Southern blot analysis to confirm the TAQMAN® copy number determination in about 80% of the plants that were analyzed by both TAQMAN® and Southern blot hybridization.

Example 28

Assays for Gene Expression

[0302] Expression of a transgene of the present invention was assayed by TAQMAN® RT-PCR using the TAQMAN® EZ RT-PCR kit from Applied Biosystems (Foster City, Calif.). RNA expression was assayed relative to expression in a transgenic standard, a transgenic maize event designated DBT418, comprising a B. thuringiensis cryIAI gene operably linked to a pinII 3' untranslated region. The DBT418 event expresses the cryIAI gene at a level which confers commercial levels of resistance to lepdiopteran insects such as European Corn Borer and was commercially sold by DEKALB Genetics Corporation under the brand name DEKALBt®. The pMON65154 and pRG76 GATEWAY® destination vectors were constructed with a sequence derived from the 3' region of the potato pinII gene which could be used to assay transgene transcript levels for any coding sequence inserted into the Destination Vector. The pinII primers and probe previously described in were used for TAQMAN® RT-PCR. Ubiquitin fusion protein (UBI) RNA was used as an internal control in all TAQMAN® RT-PCR assays. The UBI primers used were as follows:

TABLE-US-00029 (SEQ ID NO: 83) Forward primer 5' cgtctacaatcagaaggcgtaatc 3' (SEQ ID NO: 84) Reverse primer 5' ccaacaggtgaatgcttgatagg 3'

[0303] The sequence of the UBI TAQMAN® probe was

TABLE-US-00030 (SEQ ID NO: 85) 5' catgcgccgctttgcttc 3'

[0304] The UBI TAQMAN® probe was labeled at its 5' end with the fluorescent dye VIC® (Applied Biosystems, Foster City, Calif.) and the quencher dye TAMRA at is 3' end

[0305] Reverse transcription, PCR amplification and TAQMAN® probing were performed according to the one step procedure described in the TAQMAN® EZ RT-PCR kit (Applied Biosystems, Foster City, Calif.). Five to 100 nanograms total RNA was used in each assay. In vitro transcribed control RNA from the DBT418 event was included as a control on every plate and run over a concentration range from 0.01 picograms to 10 picograms. Total RNA from DBT418 leaf and from the non-transgenic inbred CORN OF GERMPLASM A were run as positive and negative controls respectively. RT-PCR was performed in TAQMAN® EZ Buffer (50 mM Bicine, 115 mM potassium acetate, 0.01 mM EDTA, 60 mM Passive Reference 1, 8% glycerol, pH 8.2, Applied Biosystems, Foster City, Calif.) containing 3 mM manganese acetate, 300 μM each dATP, dCTP, dGTP, and dUTP, 100 units rTth® (Applied Biosystems, Foster City, Calif.) DNA polymerase, and 25 units AmpErase UNG (Applied Biosystems, Foster City, Calif.). RT-PCR was caned out as follows: 2 minutes at 50° C., 30 minutes at 60° C., 5 minutes at 95° C., followed by 40 cycles of 20 seconds at 95° C. and 1 minute at 60° C. 400 nM each forward and reverse primers were used for amplification of the pinII sequence and 200 nM TAQMAN® pinII probe used for detection. UBI RNA was amplified using 400 nM each forward and reverse primers and 200 nM UBI TAQMAN® probe was used for detection. TAQMAN® fluorescence was measured using an ABI Prism 7700 Sequence Detection System or ABI7900HT Sequence Detection System (Applied Biosystems, Foster City, Calif.). Expression of transgenes of the present invention was quantitated relative to transgene expression in DBT418 and reported as a ratio of transgene expression to DBT418 expression, i.e., 2.sup.-(ΔΔCT.sup.) (transgene)/2.sup.-(ΔΔCT.sup.) (DBT418).

Example 29

Plant Breeding

[0306] Backcrossing can be used to improve a starting plant. Backcrossing transfers a specific desirable trait from one source to an inbred or other plant that lacks that trait. This can be accomplished, for example, by first crossing a superior inbred (A) (recurrent parent) to a donor inbred (non-recurrent parent), which carries the appropriate gene(s) for the trait in question, for example, a construct prepared in accordance with the current invention. The progeny of this cross first are selected in the resultant progeny for the desired trait to be transferred from the non-recurrent parent, then the selected progeny are mated back to the superior recurrent parent (A). After five or more backcross generations with selection for the desired trait, the progeny are hemizygous for loci controlling the characteristic being transferred, but are like the superior parent for most or almost all other genes. The last backcross generation would be selfed to give progeny which are pure breeding for the gene(s) being transferred, i.e. one or more transformation events.

[0307] Therefore, through a series of a breeding manipulations, a selected transgene may be moved from one line into an entirely different line without the need for further recombinant manipulation. Transgenes are valuable in that they typically behave genetically as any other gene and can be manipulated by breeding techniques in a manner identical to any other corn gene. Therefore, one may produce inbred plants which are true breeding for one or more transgenes. By crossing different inbred plants, one may produce a large number of different hybrids with different combinations of transgenes. In this way, plants may be produced which have the desirable agronomic properties frequently associated with hybrids ("hybrid vigor"), as well as the desirable characteristics imparted by one or more transgene(s).

[0308] It is desirable to introgress the genes of the present invention into maize hybrids for characterization of the phenotype conferred by each gene in a transformed plant. The host genotype into which the transgene was introduced, preferably CORN OF GERMPLASM A, is an elite inbred and therefore only limited breeding is necessary in order to produce high yielding maize hybrids. The transformed plant, regenerated from callus is crossed, to the same genotype, e.g., CORN OF GERMPLASM A. The progeny are self pollinated twice and plants homozygous for the transgene are identified. Homozygous transgenic plants are crossed to a testcross parent in order to produce hybrids. The test cross parent is an inbred belonging to a heterotic group which is different from that of the transgenic parent and for which it is known that high yielding hybrids can be generated, for example hybrids are produced from crosses of CORN OF GERMPLASM A to either CORN OF GERMPLASM E or CORN OF GERMPLASM B.

Example 30

Methods of Evaluating Phenotype

[0309] Expression of the genes of the present invention leads to various phenotypes as disclosed herein in transformed cells and plants. Phenotypic data is collected during the transformation process in callus as well as during plant regeneration, as well as in plants and progeny. Phenotypic data is collected in transformed callus relating to the morphological appearance as well as growth of the callus, e.g., shooty, rooty, starchy, mucoid, non-embryogenic, increased growth rate, decreased growth rate, dead. It is expected that one of skill in the art may recognize other phenotypic characteristics in transformed callus.

[0310] Phenotypic data is also collected during the process of plant regeneration as well as in regenerated plants transferred to soil. Phentoypic data includes characteristics such as normal plants, bushy plants, narrow leaves, striped leaves, knotted phenotype, chlorosis, albino, anthocyanin production, buggy whipped (a phenomenon known to the art in which the most recently emerged leaves are elongated and wrap around each other), or altered tassels, ears or roots. It is expected that one of skill in the art may recognize other phenotypic characteristics in transformed plants.

[0311] A wide variety of phenotypes are monitored during the process of plant breeding and testing in both inbred and hybrid plants. For example, in R0 and R1 plants (plants directly regenerated from callus and the direct progeny of those plants), plant type (general morphological characteristics such as those described above for plantlets) and nutritional composition of grain produced by the plants are recorded. Nutritional composition analysis may include amino acid composition, amount of protein, starch and oil, characteristics of protein, starch and oil, fiber, ash, mineral content may all be measured. It is expected that one of skill in the art may include analyses of other components of the grain. In R2 and R3 plants, days to pollen shed, days to silking, and plant type are observed. Furthermore, metabolite profiling of R2 plants is conducted. Using methods available to those of skill in the art, 50 to 100 or more metabolites may be analyzed in a plant, thereby establishing a metabolic fingerprint of the plant. In addition in R3 plants, leaf extension rate is measured under field conditions. A variety of phenotypes will be assayed in hybrids comprising a transgene of the present invention. For example, yield, moisture, test weight, nutritional composition, chlorophyll content, leaf temperature, stand, seedling vigor, plant height, leaf number, tillering, brace roots, stay green, stalk lodging, root lodging, plant health, barreness/prolificacy, green snap, pest resistance (including diseases, viruses and insects) and metabolic profiles will be recorded. In addition, phenotypic characteristics of grain harvested from hybrids will be recorded, including number of kernels per row on the ear, number of rows of kernels on the ear, kernel abortion, kernel weight, kernel size, kernel density and physical grain quality. Furthermore, characteristics such as photosynthesis, leaf area, husk structure, kernel dry down rate and internode length may be measured in hybrids or inbreds. It is expected that transcriptional profiling may be performed on transgenic plants expressing genes of the present invention.

[0312] In order to determine hybrid yield in transgenic plants expressing genes of the present invention, it is recognized that hybrids must be tested at multiple locations in a geographical location where maize is conventionally grown, e.g., Iowa, Illinois or other locations in the midwestern United States. It is expected that more than one year of yield testing is desirable in order to identify transgenes which contribute to improvement of a maize hybrid. Therefore, transgenic hybrids will be evaluated in a first year at a sufficient number of locations to identify at least an approximately 10% yield difference from a non-transgenic hybrid counterpart. A second year of yield tests is conducted at sufficient locations and with sufficient repetitions to be able to identify a 4-5% yield difference between two hybrids. Furthermore, in the second year of yield tests, hybrids will be evaluated under normal field conditions as well as under stress conditions, e.g., under conditions of water or population density stress. One of skill in the art knows how to design a yield trial such that a statistically significant yield difference can be detected between two hybrids at the desired rate of precision.

Example 31

Surface Sterilization and Imbibition of Corn Seeds

[0313] For each transgenic lot, surface sterilize about 50 corn seeds by putting them in a sterile 500 ml Erlenmyer flask with 50 ml of 30% bleach (sodium hypochlorite solution=Chlorox or equivalent) solution containing 0.01% triton X-100 and rotating the flask on an orbital shaker for 5 minutes. Then pour off the bleach solution and wash with about 100 ml of sterile deionized water and pour off the water wash. Repeat the sterile water wash 4 more times, leaving the last water wash on the seeds. Incubate the seeds in this water at room temperature for 24 h for imbibition under air bubbling (pass through 0.2 μm filter).

I. Preparation of Media in Phytotrays

[0314] Prepare water--agar media for several Phytotrays. We are using Phytotray II (or plastic box: 60×30×15 cm) in the inverted position so that the larger depth side of the vessel is on the bottom and the smaller side is used as the lid. Prepare enough water--agar media for 100 ml per Phytotray by autoclaving 0.3% BactoAgar in deionized water for 45 minutes on the liquid cycle. Cool the media to the extent it can be handled easily and pour approximately 100 ml per Phytotray while still molten.

II. Corn Cold Seedling Vigor Assay



[0315] When the media has solidified, bring it and the sterile seeds to a laminar flow hood.

[0316] Using sterile forceps, select 20 healthy, most uniform seeds and place the seeds in each Phytotray used for the assay, spacing the seeds evenly so that any individuals can be easily removed later.

[0317] Place seeds so that the embryo side is diagonally inserted downward and the seed is just under the surface of the agar. In this position, the emerging shoot and root will be able to directly elongate without cramping.

[0318] Incubate the seeds in the media at 22° C. for one week, or until most of the seeds have extruded radicles and are beginning to emerge from the agar.

[0319] Remove all but the 10 most uniformly grown seedlings in a laminar flow hood.

[0320] Shift the Phytotrays to a cold plant growth chamber set at 10° C. with 16 hour day cycle and incubate there for 2 weeks.

[0321] Shift the Phytotrays back to 22° C. for one week.

[0322] Remove seedlings, measure root length and shoot length for every seedling, and measure fresh weight g/3 seedlings record in notebook.

[0323] Adaptation for cold germination and emergence assay.

Same as above with the following exceptions:

[0324] After the last water wash in I., place the flasks at 10° C. during the overnight imbibition step. Also prechill the Phytotrays with solidified media at 10° C.

[0325] After seeding the chilled Phytotrays with cold imbibed seeds, they are put directly into the 10° C. chamber.

[0326] After about 5 days, remove all but the 10 most uniformly germinated seeds, those whose radicles are about the same length. Return Phytotrays to 10° C. chamber for 1-2 weeks. Remove seedlings, measure root length and shoot length for every seedling, and measure fresh weight from every 3 seedlings, record in notebook.

[0327] Shift the 2nd set Phytotrays to 22° C. for 1 week.

[0328] Remove seedlings, measure root length and shoot length for every seedling, record in notebook.

Example 32

Creation of Plasmids for Transformation of Soybean

Example (for CspA and B Constructs--pMON73983 and 73984)

[0329] pMON73983 (FIG. 18) is a binary vector for Agrobacterium-mediated transformation and constitutive expression of a protein (SEQ ID NO: 1) like Bacillus subtilis CspA in Soybean. To clone the B. subtilis CspA gene, two gene-specific primers, MSA452 and MSA453 were designed based on the CspA sequence information (Genbank #M30139) from the National Center for Biotechnology Information, which is part of the National Library of Medicine, in turn part of the National Institutes of Health (NCBI). The sequence for MSA452 is GCGCAGGCCTAGATGTACCATGTCCGGTAAAATGACTGGTATCGTAAAATGG (SEQ ID NO: 86), which anneals at the translational start site of CspA and introduces StuI and BglII sites at the 5' end, while the sequence of MSA453 is CGCGAATTCGGATCCTTATTACAGGCTGGTTACGTTACCAGCTGCC (SEQ ID NO: 87), which anneals at the last codon of CspA and introduces BamHI and EcoRI sites at the end of the primer. The reverse primer MSA453 was designed to match the 3' end of the Genbank gene sequence. The PCR reaction was carried out using primers MSA452 and MSA453, High Fidelity Taq Polymerase (BRL) and pMON57397 (FIG. 3) as the template. This template differs at the 3' end of the gene CspA, from that of the GeneBank sequence. The amplified CspB DNA was purified by gel-electrophoresis and ligated to pCR-XL-TOPO vector (Invitrogen). The ligation reaction was transformed into E. coli Top10 cells (Invitrogen) as per manufacturer's protocol. Four transformant colonies were picked and miniprep DNA was prepared using Qiagen Miniprep Kit. The inserts were sequenced using M13-specific Forward and Reverse primers. Clone with the correct sequence was named pMON73981 and used for further subcloning.

[0330] PMON73881 DNA was digested with StuI and BamHI to isolate the CspA gene fragment. pMON73980 DNA was digested with StuI and BamHI sequentially, and then purified by Gene Clean II kit. The CspB fragment and this purified vector pMON73980 were ligated and the ligation reaction was electrotransformed into E. coli DH10 B cells. The transformants were selected on Spectinomycin containing media. The miniprep DNA was prepared from the transformants and the DNA was checked for the presence of the insert by using CaMV35S-promoter-specific forward primer. The clone containing this insert was named as pMON73983. A larger DNA prep was made and a series of confirmatory digests were carried out, including BglII, EcoRI, PstI, EcoRI+BamHI, StuI+XhoI. These confirmed the correct cloning.

[0331] pMON73984 is a binary vector for Agrobacterium-mediated transformation and constitutive expression of a protein (SEQ ID NO: 2) like Bacillus subtilis CspB in Arabidopsis. To clone the B. subtilis CspB gene, two gene-specific primers, MSA454 and MSA455 were designed based on the CspB sequence information (Genbank #X59715) from the National Center for Biotechnology Information, which is part of the National Library of Medicine, in turn part of the National Institutes of Health (NCBI). The sequence for MSA454 is GCGCAGGCCTAGATGTACCATGTTAGAAGGTAAAGTAAAATGGTTCAACTCTG (SEQ ID NO: 88), which anneals at the translational start site of CspB and introduces StuI and BglII sites at the 5' end, while the sequence of MSA455 is CGCGAATTCGGATCCTTATTACGCTTCTTTAGTAACGTTAGCAGCTTGTGG (SEQ ID NO: 89), which anneals at the last codon of CspB and introduces BamHI and EcoRI sites at the end of the primer. The reverse primer MSA455 was designed to match the 3' end of the Genbank gene sequence. The PCR reaction was carried out using primers MSA454 and MSA455, High Fedelity Taq Polymerase (BRL) and pMON57399 as the template. This template differs at the 3' end of the gene CspB, from that of the GeneBank sequence. The amplified CspB DNA was purified by gel-electrophoresis and ligated to pCR-XL-TOPO vector (Invitrogen). The ligation reaction was transformed into E. coli Top10 cells (Invitrogen) as per manufacturer's protocol. Four transformant colonies were picked and miniprep DNA was prepared using Qiagen Miniprep Kit. The inserts were sequenced using M13-specific Forward and Reverse primers. Clone with the correct sequence was named pMON73982 and used for further subcloning.

[0332] PMON73882 DNA was digested with StuI and BamHI to isolate the CspB gene fragment. pMON73980 DNA was digested with StuI and BamHI sequentially, and then purified by Gene Clean II kit. The CspB fragment and this purified vector pMON73980 were ligated and the ligation reaction was electrotransformed into E. coli DH10 B cells. The transformants were selected on Spectinomycin containing media. The miniprep DNA was prepared from the transformants and the DNA was checked for the presence of the insert by using CaMV35S-promoter-specific forward primer. The clone containing this insert was named as pMON73984. A larger DNA prep was made and a series of confirmatory digests were carried out, including BglII, EcoRI, PstI, EcoRI+BamHI, StuI+XhoI. These confirmed that the cloning was correct.

[0333] Soybean plants were created, through transformation, with the pMON constructs above stably integrated in their genome.

Example 33

[0334] Corn plant transformed with DNA contructs from examples 10 and 11, above, were studied. Greenhouse

[0335] Two experiments were performed, one testing 10 cspA events and one testing 10 cspB events for drought tolerance.

[0336] 24 transgene positive and 24 transgene negative hybrid seedlings from each event were tested (all seeds derived from segregating hybrid ears).

[0337] The test was performed on benches in a greenhouse.

[0338] The treatment consisted of withholding water and monitoring total pot weight of each pot containing a plant. Fully watered pots weigh about 1000 grams each and water was withheld until each pot's weight reached 400 grams, then pots were maintained at that weight during the remainder of the treatment.

[0339] Throughout the treatment, plant height was determined by measuring the distance from the soil surface in the pot to the tip of the "tallest" leaf. From these measurements LER (leaf extension rates) were determined by comparing the heights at the intervals between measurements.

[0340] LER comparisons during the drought were made between transgene negative and transgene positive plants within an event.

[0341] For three of ten events tested, cspA transgenic plants were significantly (p<0.10) improved for LER during the treatment.

[0342] For three of ten events tested, cspB transgenic plants were significantly (p<0.10) improved for LER during the treatment.

Field Efficacy

[0342]

[0343] Three experiments were performed using hybrid seed, one testing 16 cspB events (CA), one testing 21 cspB events (KS), and one testing 14 cspA events (HI) for drought tolerance during the late vegetative stage of growth.

[0344] For the CA and HI trials, rows containing ˜34 plants, segregating for presence of the transgene, were present in six and four replicates, respectively. Segregating rows were derived from segregating ears.

[0345] For KS experimental rows contained ˜34 plants; as transgenic and non-transgenic paired rows, with six replicates.

[0346] The treatment consisted of withholding water for approximately ten days during the late vegetative phase of growth (giving a small amount as needed to maintain viable plants). At the end of the ten-day period plants were then well irrigated until harvest.

[0347] Throughout the treatment a number of phenotypes were measured including LER, chlorophyll (by SPAD meter), and photosynthesis rate. Following the treatment additional phenotypes measured included: days to pollen shed and silk emergence, and ear components such as kernels/ear, ears with kernels, kernel weight, and yield.

[0348] Phenotype comparisons were made between transgene positive and negative plants within an event and across the construct.

[0349] In the CA trial, cspB as a construct (across all events for vegetative traits and across the "best" six events for reproductive traits) transgene positive plants were significantly (p<0.10) improved for LER, leaf temperature, and kernels/ear during or following the drought treatment.

[0350] In the CA trial, individual events were significantly (p<0.10) improved for LER, average ear length, kernel mass/ear, stomatal conductance, and days to silking during or following the drought treatment.

[0351] In the KS trial, cspB as a construct (across all events for vegetative traits and across the "best" six events for reproductive traits) transgene positive plants were significantly (p<0.10) improved for LER, kernel bearing ears/row, kernels/ear, kernels/plant, shell weight, and yield.

[0352] In the KS trial, individual events were significantly (p<0.10) improved for LER, photosynthetic rate, stomatal conductance, ears/row, and kernels/plant.

[0353] In the HI trial, three events were significantly (p<0.10) improved for LER (chlorophyll content was the only other phenotype measured in HI)

[0354] Summaries of CA and KS Results:

Summary of Field Efficacy Results for cspB--KS Site 1. The field design, site uniformity, and execution of planting and sampling were all consistent with a high quality experiment capable of generating informative data sets. 2. The water-limited treatment was applied in a manner that resulted in treatment impacts on all phenotypes measured, particularly LER, chlorophyll, and photosynthetic rates. 3. The treatment impacts on vegetative and reproductive phenotypes were sufficient to be statistically real and to allow for transgene-mediated improvements to be observed at statistically significant levels. 4. One or more events were statistically improved in transgene containing plants for LER, chlorophyll, photosynthetic rate, stomatal conductance leaf temperature, days to pollen shed, days to silking, anthesis silking interval, ears/plot, kernels/ear, kernels/plant, shell weight, and estimated yield. 5. Construct level statistical improvement was observed at p<0.10 in the dry treatment for LER, ears/plot, kernels/ear, kernels/plant, shell weight, and estimated yield, and for LER in the wet treatment.

TABLE-US-00031 TABLE 20 Event Treatment Improved phenotype P value Construct Dry LER (T1-T0) 0.009 Dry LER (T2-T0) 0.009 Dry LER (T2-T1) 0.096 Dry Stomatal conductance 0.150 Dry Photosynthesis 0.141 Dry Ears/plot 0.012 Dry Kernels/ear 0.062 Dry Kernels/plant 0.006 Dry Shell weight 0.009 Dry Est. Yield 0.008 Wet LER (T2-T1) 0.025 Wet Chlorophyll (--) 0.062 Wet Ears/plot (--) 0.185 Wet Kernels/ear (--) 0.121 Wet Kernels/plant (--) 0.083 Wet Shell weight (--) 0.132 Wet Est. Yield (--) 0.101 ZM_M38835 Dry LER (T1-T0) 0.008 Dry Photosynthesis 0.066 Dry Stomatal conductance 0.064 Dry Transpiration 0.126 Dry Kernels/plant 0.160 Dry Shell weight 0.149 Dry Yield 0.153 Wet LER (T1-T0) 0.099 Wet LER (T2-T1) (--) 0.026 ZM_M38737 Dry Photosynthesis 0.108

Summary of Field Efficacy Results for cspB--CS Site (Font Change) 1. The field design, site uniformity, and execution of planting and sampling were all consistent with a high quality experiment capable of generating informative data sets. 2. The water-limited treatment was applied in a manner that resulted in treatment impacts on all vegetative phenotypes measured, particularly LER, chlorophyll, and photosynthetic rates, but not on all reproductive phenotypes. 3. The treatment impacts on phenotypes (vegetative) of interest were sufficient to be statistically real and to allow for transgene-mediated improvements to be observed at statistically significant levels. 4. One or more events were statistically improved in transgene containing plants for LER, chlorophyll, photosynthetic rate, stomatal conductance leaf temperature, days to pollen shed, days to silking, anthesis silking interval, kernels/ear, average ear length, and kernel mass/ear. 5. Construct level statistical improvement was observed in the dry treatment for LER, leaf temperature, and days to pollen shed, and for ASI in the wet treatment.

TABLE-US-00032 TABLE 21 Event Treatment Improved phenotype P value Construct Dry LER 0.009 Dry Leaf temperature 0.027 Dry Days to pollen shed 0.192 Dry Kernels/ear 0.080 Dry Kernel mass/ear 0.197 Dry Test Wt (lb/bu) Neg 0.084 Wet LER 0.157 Wet Days to pollen shed 0.098 Wet Ave ear length 0.091 Wet Kernel mass/ear 0.010 Wet Test Wt (lb/bu) Neg 0.188 ZM_M39583 Dry LER 0.051 Dry Kernels/ear 0.200 Wet Ave ear length 0.058 Wet Kernel mass/ear 0.070 ZM_M39872 Dry LER 0.159 Wet Days to silking 0.024 Wet ASI 0.064 ZM_M40946 Dry LER 0.201 ZM_M38238 Dry Days to silking 0.176 Dry Kernels/ear 0.192 Wet LER 0.151 Wet Kernel mass/ear 0.034 ZM_M38244 Dry Stomatal Conductance 0.092 Dry Photosynthesis 0.132 Dry Leaf Temperature 0.155 ZM_M38230 Dry Days to silking 0.176 ZM_M38721 Dry Days to silking 0.066 Dry ASI 0.109 Wet Days to silking 0.117 ZM_M38714 Wet Days to silking 0.010 Wet ASI 0.025 ZM_M40939 Dry ASI 0.109

Many of these events have been subsequently tested for improvements in cold germination efficiency and seedling growth under cold conditions, and have not proved efficacious. Thus, these genes driven by this promoter are unlikely to function in maize for improvement of cold germination or seedling growth under cold conditions, but different promoters driving the same genes, or different cold shock proteins may function in maize to improve these phenotypes.

Sequence CWU 1 SEQUENCE LISTING <160> NUMBER OF SEQ ID NOS: 95 <210> SEQ ID NO 1 <211> LENGTH: 70 <212> TYPE: PRT <213> ORGANISM: Escherichia coli <300> PUBLICATION INFORMATION: <301> AUTHORS: Goldstein, et al <302> TITLE: Major cold shock protein of Escherichia coli <303> JOURNAL: Proceedings of the National Academy of Sciences (USA) <304> VOLUME: 87 <305> ISSUE: 1 <306> PAGES: 283-287 <307> DATE: 1990-01-01 <308> DATABASE ACCESSION NUMBER: M30139 <309> DATABASE ENTRY DATE: 1993-10-20 <313> RELEVANT RESIDUES IN SEQ ID NO: (1)..(70) <400> SEQUENCE: 1 Met Ser Gly Lys Met Thr Gly Ile Val Lys Trp Phe Asn Ala Asp Lys 1 5 10 15 Gly Phe Gly Phe Ile Thr Pro Asp Asp Gly Ser Lys Asp Val Phe Val 20 25 30 His Phe Ser Ala Ile Gln Asn Asp Gly Tyr Lys Ser Leu Asp Glu Gly 35 40 45 Gln Lys Val Ser Phe Thr Ile Glu Ser Gly Ala Lys Gly Pro Ala Ala 50 55 60 Gly Asn Val Thr Ser Leu 65 70 <210> SEQ ID NO 2 <211> LENGTH: 67 <212> TYPE: PRT <213> ORGANISM: Bacillus subtilis <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: X59715 <309> DATABASE ENTRY DATE: 1996-03-29 <313> RELEVANT RESIDUES IN SEQ ID NO: (1)..(67) <400> SEQUENCE: 2 Met Leu Glu Gly Lys Val Lys Trp Phe Asn Ser Glu Lys Gly Phe Gly 1 5 10 15 Phe Ile Glu Val Glu Gly Gln Asp Asp Val Phe Val His Phe Ser Ala 20 25 30 Ile Gln Gly Glu Gly Phe Lys Thr Leu Glu Glu Gly Gln Ala Val Ser 35 40 45 Phe Glu Ile Val Glu Gly Asn Arg Gly Pro Gln Ala Ala Asn Val Thr 50 55 60 Lys Glu Ala 65 <210> SEQ ID NO 3 <211> LENGTH: 20 <212> TYPE: PRT <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Prosite motif PS00352 <220> FEATURE: <221> NAME/KEY: MISC_FEATURE <222> LOCATION: (1)..(1) <223> OTHER INFORMATION: Xaa is phe or tyr <220> FEATURE: <221> NAME/KEY: MISC_FEATURE <222> LOCATION: (5)..(11) <223> OTHER INFORMATION: Xaa is any amino acid and (11) may or may not be present <220> FEATURE: <221> NAME/KEY: MISC_FEATURE <222> LOCATION: (12)..(12) <223> OTHER INFORMATION: Xaa is asp, glu, or arg <220> FEATURE: <221> NAME/KEY: MISC_FEATURE <222> LOCATION: (13)..(13) <223> OTHER INFORMATION: Xaa is leu, ile, val, or met <220> FEATURE: <221> NAME/KEY: MISC_FEATURE <222> LOCATION: (15)..(15) <223> OTHER INFORMATION: Xaa is any amino acid <220> FEATURE: <221> NAME/KEY: MISC_FEATURE <222> LOCATION: (17)..(17) <223> OTHER INFORMATION: Xaa is any amino acid <220> FEATURE: <221> NAME/KEY: MISC_FEATURE <222> LOCATION: (18)..(18) <223> OTHER INFORMATION: Xaa is ser, thr, lys, or arg <220> FEATURE: <221> NAME/KEY: MISC_FEATURE <222> LOCATION: (19)..(19) <223> OTHER INFORMATION: Xaa is any amino acid <220> FEATURE: <221> NAME/KEY: MISC_FEATURE <222> LOCATION: (20)..(20) <223> OTHER INFORMATION: Xaa is leu, ile, val, met, phe, or tyr <400> SEQUENCE: 3 Xaa Gly Phe Ile Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Phe Xaa His 1 5 10 15 Xaa Xaa Xaa Xaa 20 <210> SEQ ID NO 4 <211> LENGTH: 545 <212> TYPE: DNA <213> ORGANISM: Glycine max <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (61)..(354) <400> SEQUENCE: 4 attcggctcg aggaccttag aaagagaagg aaaaaaaaaa cttgtgtttc ttgggaagcc 60 atg agc acc acc gag agt caa aga tat aag ggc aca gtg aaa tgg ttc 108 Met Ser Thr Thr Glu Ser Gln Arg Tyr Lys Gly Thr Val Lys Trp Phe 1 5 10 15 aac gag gag aag ggt ttc ggt ttc ata act ccc gaa gat ggt ggc tct 156 Asn Glu Glu Lys Gly Phe Gly Phe Ile Thr Pro Glu Asp Gly Gly Ser 20 25 30 gat ctc ttc gtt cac tac agt gcg atc caa acc gac ggc ggc ttc cgc 204 Asp Leu Phe Val His Tyr Ser Ala Ile Gln Thr Asp Gly Gly Phe Arg 35 40 45 acc ttg tcg gag ggt cag tca gta gag ttc ctc gtc act cag gac gac 252 Thr Leu Ser Glu Gly Gln Ser Val Glu Phe Leu Val Thr Gln Asp Asp 50 55 60 agc ggg cga gcc gcg gcc gtc aac gtg acg acc acc acg gtt aaa tct 300 Ser Gly Arg Ala Ala Ala Val Asn Val Thr Thr Thr Thr Val Lys Ser 65 70 75 80 agt gac agc ggt aac ggg gaa aac tct ggt ggt gat gct gcc aat gtt 348 Ser Asp Ser Gly Asn Gly Glu Asn Ser Gly Gly Asp Ala Ala Asn Val 85 90 95 gag aaa taagtgagaa tgaattattg gagtttcctg aattgcgagt atgatattta 404 Glu Lys tattgatagt tggacaatat actagtccat tggtatttta tattttatta tattatctct 464 ggttattggc atttggttcc aaacttgtaa tacatttatc atgtgtttaa cgtggttatg 524 tagtaagttg ttggatgtgt c 545 <210> SEQ ID NO 5 <211> LENGTH: 98 <212> TYPE: PRT <213> ORGANISM: Glycine max <400> SEQUENCE: 5 Met Ser Thr Thr Glu Ser Gln Arg Tyr Lys Gly Thr Val Lys Trp Phe 1 5 10 15 Asn Glu Glu Lys Gly Phe Gly Phe Ile Thr Pro Glu Asp Gly Gly Ser 20 25 30 Asp Leu Phe Val His Tyr Ser Ala Ile Gln Thr Asp Gly Gly Phe Arg 35 40 45 Thr Leu Ser Glu Gly Gln Ser Val Glu Phe Leu Val Thr Gln Asp Asp 50 55 60 Ser Gly Arg Ala Ala Ala Val Asn Val Thr Thr Thr Thr Val Lys Ser 65 70 75 80 Ser Asp Ser Gly Asn Gly Glu Asn Ser Gly Gly Asp Ala Ala Asn Val 85 90 95 Glu Lys <210> SEQ ID NO 6 <211> LENGTH: 255 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: somewhat similar to E. coli CspA <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (1)..(252) <400> SEQUENCE: 6 atg gcc ggt aaa atg act ggt atc gta aaa tgg ttc aac gct gac aaa 48 Met Ala Gly Lys Met Thr Gly Ile Val Lys Trp Phe Asn Ala Asp Lys 1 5 10 15 ggc ttc ggc ttc atc act cct gac gat ggc tct aaa gat gtg ttc gta 96 Gly Phe Gly Phe Ile Thr Pro Asp Asp Gly Ser Lys Asp Val Phe Val 20 25 30 cac ttc tct gct atc cag aac gat ggt tac aaa tct ctg gac gaa ggt 144 His Phe Ser Ala Ile Gln Asn Asp Gly Tyr Lys Ser Leu Asp Glu Gly 35 40 45 cag aaa gtg tcc ttc acc atc gaa agc ggc gct aaa ggc ccg gca gct 192 Gln Lys Val Ser Phe Thr Ile Glu Ser Gly Ala Lys Gly Pro Ala Ala 50 55 60 ggt aac gta acc agc ctg aat tct cga gcg att aca agg atg atg ata 240 Gly Asn Val Thr Ser Leu Asn Ser Arg Ala Ile Thr Arg Met Met Ile 65 70 75 80 agt aag tcg acc tag 255 Ser Lys Ser Thr <210> SEQ ID NO 7 <211> LENGTH: 84 <212> TYPE: PRT <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 7 Met Ala Gly Lys Met Thr Gly Ile Val Lys Trp Phe Asn Ala Asp Lys 1 5 10 15 Gly Phe Gly Phe Ile Thr Pro Asp Asp Gly Ser Lys Asp Val Phe Val 20 25 30 His Phe Ser Ala Ile Gln Asn Asp Gly Tyr Lys Ser Leu Asp Glu Gly 35 40 45 Gln Lys Val Ser Phe Thr Ile Glu Ser Gly Ala Lys Gly Pro Ala Ala 50 55 60 Gly Asn Val Thr Ser Leu Asn Ser Arg Ala Ile Thr Arg Met Met Ile 65 70 75 80 Ser Lys Ser Thr <210> SEQ ID NO 8 <211> LENGTH: 246 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Somewhat similar to B. subtilis CspB <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (1)..(243) <400> SEQUENCE: 8 atg gta gaa ggt aaa gta aaa tgg ttc aac tct gaa aaa ggt ttc gga 48 Met Val Glu Gly Lys Val Lys Trp Phe Asn Ser Glu Lys Gly Phe Gly 1 5 10 15 ttc atc gaa gta gaa ggt caa gac gat gta ttc gtt cat ttc tct gct 96 Phe Ile Glu Val Glu Gly Gln Asp Asp Val Phe Val His Phe Ser Ala 20 25 30 att caa ggc gaa ggc ttc aaa act tta gaa gaa ggc caa gct gtt tct 144 Ile Gln Gly Glu Gly Phe Lys Thr Leu Glu Glu Gly Gln Ala Val Ser 35 40 45 ttt gaa atc gtt gaa gga aac cgc gga cca caa gct gct aac gtt act 192 Phe Glu Ile Val Glu Gly Asn Arg Gly Pro Gln Ala Ala Asn Val Thr 50 55 60 aaa gaa gcg aat tct cga gcg att aca agg atg atg ata agt aag tcg 240 Lys Glu Ala Asn Ser Arg Ala Ile Thr Arg Met Met Ile Ser Lys Ser 65 70 75 80 acc tag 246 Thr <210> SEQ ID NO 9 <211> LENGTH: 81 <212> TYPE: PRT <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 9 Met Val Glu Gly Lys Val Lys Trp Phe Asn Ser Glu Lys Gly Phe Gly 1 5 10 15 Phe Ile Glu Val Glu Gly Gln Asp Asp Val Phe Val His Phe Ser Ala 20 25 30 Ile Gln Gly Glu Gly Phe Lys Thr Leu Glu Glu Gly Gln Ala Val Ser 35 40 45 Phe Glu Ile Val Glu Gly Asn Arg Gly Pro Gln Ala Ala Asn Val Thr 50 55 60 Lys Glu Ala Asn Ser Arg Ala Ile Thr Arg Met Met Ile Ser Lys Ser 65 70 75 80 Thr <210> SEQ ID NO 10 <211> LENGTH: 877 <212> TYPE: DNA <213> ORGANISM: Escherichia coli <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (528)..(743) <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: L28429 <309> DATABASE ENTRY DATE: 1994-05-04 <313> RELEVANT RESIDUES IN SEQ ID NO: (1)..(877) <400> SEQUENCE: 10 agctttaata tagctcatga aaggtaaaca ttggcagctg aagggccacg cagaccattt 60 atccggcaaa attccacgcg taatccggtg gtaatttctt ctgcatcgcg gagattgagc 120 gctgaaacat gaagctggac atcgatacga ccatcggatg gggtgataag acccttgccg 180 cttttgccgt caaaggtttt gacaattcct gtcattttac gggacaaaaa aattccttaa 240 tactgataac ttggcgcact atacacacgt tcctgaagaa agctatagtt ttttgatggg 300 gttgaagatg gctggatgtc taaaataaac attgcttcat atgttcaact atgcgttaat 360 gattgcgtcg gtttgaagaa cagacgatat acgaagtagt ttactaaagc agttctcatt 420 tcaggtgtta ttcacttatt ccttctttga gtctctccaa ttaagtacga agtcgtttct 480 gttatgcaaa ccatttatgc cgaaaggctc aagttaagga atgtaga atg tca aat 536 Met Ser Asn 1 aaa atg act ggt tta gta aaa tgg ttt aac gct gat aaa ggt ttc ggc 584 Lys Met Thr Gly Leu Val Lys Trp Phe Asn Ala Asp Lys Gly Phe Gly 5 10 15 ttt att tct cct gtt gat ggt agt aaa gat gtg ttt gtg cat ttt tct 632 Phe Ile Ser Pro Val Asp Gly Ser Lys Asp Val Phe Val His Phe Ser 20 25 30 35 gcg att cag aat gat aat tat cga acc tta ttt gaa ggt caa aag gtt 680 Ala Ile Gln Asn Asp Asn Tyr Arg Thr Leu Phe Glu Gly Gln Lys Val 40 45 50 acc ttc tct ata gag agt ggt gct aaa ggt cct gca gca gca aat gtc 728 Thr Phe Ser Ile Glu Ser Gly Ala Lys Gly Pro Ala Ala Ala Asn Val 55 60 65 atc att act gat taa aattcatcgc tcgtctgtat acgataacga agaaggctga 783 Ile Ile Thr Asp 70 tgcctgagta gagatacgga cagagtagtg aatattggat ctctttaata aaaagtaagg 843 aggtccaata catgaaacaa tggctagcat attt 877 <210> SEQ ID NO 11 <211> LENGTH: 71 <212> TYPE: PRT <213> ORGANISM: Escherichia coli <400> SEQUENCE: 11 Met Ser Asn Lys Met Thr Gly Leu Val Lys Trp Phe Asn Ala Asp Lys 1 5 10 15 Gly Phe Gly Phe Ile Ser Pro Val Asp Gly Ser Lys Asp Val Phe Val 20 25 30 His Phe Ser Ala Ile Gln Asn Asp Asn Tyr Arg Thr Leu Phe Glu Gly 35 40 45 Gln Lys Val Thr Phe Ser Ile Glu Ser Gly Ala Lys Gly Pro Ala Ala 50 55 60 Ala Asn Val Ile Ile Thr Asp 65 70 <210> SEQ ID NO 12 <211> LENGTH: 1601 <212> TYPE: DNA <213> ORGANISM: Escherichia coli <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (243)..(452) <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: D28496 <309> DATABASE ENTRY DATE: 1994-02-05 <313> RELEVANT RESIDUES IN SEQ ID NO: (1)..(1601) <400> SEQUENCE: 12 gatcgagaca tgtttaaaaa tggcttgcca taattaacgt tgtatgtgat aacagatttc 60 gggttaaacg aggtacagtt ctgtttatgt gtggcatttt cagtaaagaa gtcctgagta 120 aacacgttga cgttgaatac cgcttctctg ccgagcctta tattggtgcc tcatgcagta 180 atgtgtcagt tttatctatg ttatgcctgc gggcgaagaa aacaatctaa ggaatttttc 240 aa atg gca aag att aaa ggt cag gtt aag tgg ttc aac gag tct aaa 287 Met Ala Lys Ile Lys Gly Gln Val Lys Trp Phe Asn Glu Ser Lys 1 5 10 15 ggt ttt ggc ttc att act ccg gct gat ggc agc aaa gat gtg ttc gta 335 Gly Phe Gly Phe Ile Thr Pro Ala Asp Gly Ser Lys Asp Val Phe Val 20 25 30 cac ttc tcc gct atc cag ggt aat ggc ttc aaa act ctg gct gaa ggt 383 His Phe Ser Ala Ile Gln Gly Asn Gly Phe Lys Thr Leu Ala Glu Gly 35 40 45 cag aac gtt gag ttc gaa att cag gac ggc cag aaa ggt ccg gca gct 431 Gln Asn Val Glu Phe Glu Ile Gln Asp Gly Gln Lys Gly Pro Ala Ala 50 55 60 gtt aac gta aca gct atc tga tcgaatccac tgatctgaag tgtgaatacg 482 Val Asn Val Thr Ala Ile 65 cttcaatctc gctataaagc ctcgtcgaat gcgaggcttt ttactatgct ttatcttcgc 542 tcctggcgtt cggatatttg cccgccgcgt gattcgcgtt acacttgcgg cctttagtat 602 cctgccggag ttgtcatgtc tttttcctgt ccactttgcc atcagcctct ttcgcgtgaa 662 aaaaacagct atatctgtcc ccagcgacat cagtttgata tggcgaaaga agggtatgtc 722 aatctgctgc ccgttcagca taaacggtct cgtgatccgg gcgacagcgc ggaaatgatg 782 caagcacgcc gcgcattctt agatgccgga cattatcagc cgctgcgtga tgcaattgtc 842 gcccaactga gggaacggct tgatgataag gccacggcgg tgctggatat tggctgtggt 902 gaagggtatt acacacacgc atttgccgat gcgttgcccg aaatcaccac gtttggtctg 962 gatgtttcga aggtagcgat aaaagcggcg gcgaaacgct atccgcaggt cactttttgt 1022 gtcgcttcca gccaccgttt gccgttttcc gataccagta tggacgccat aatacgtatt 1082 tacgcgccgt gtaaagcaga agaattagca cgagtagtga agcccggcgg ctgggtcatt 1142 actgccacgc cgggaccgcg acatttgatg gagctgaagg ggctgattta caatgaagta 1202 catcttcatg cacctcatgc agaacaactg gaaggtttta cattacagca gagtgcggag 1262 ttgtgttatc cgatgcgtct tcgcggtgat gaagccgtcg cattattgca gatgacgccg 1322 tttgcctggc gtgcgaagcc agaagtctgg caaacactgg cagcaaaaga agtgttcgac 1382 tgccagacgg actttaatat tcacctctgg cagcgttctt attaaccgtg gaagtgcgtc 1442 cagaggatct ggacgccgat gccgatcagc accagcccgc cgagaatttc cgcttttttc 1502 ccaataattg agccgataaa gcgaccaacc atcatcccta atgttgacat aatcaaggtt 1562 gcacaaccaa tggccaatgc ggtcgcgata atgttgacc 1601 <210> SEQ ID NO 13 <211> LENGTH: 69 <212> TYPE: PRT <213> ORGANISM: Escherichia coli <400> SEQUENCE: 13 Met Ala Lys Ile Lys Gly Gln Val Lys Trp Phe Asn Glu Ser Lys Gly 1 5 10 15 Phe Gly Phe Ile Thr Pro Ala Asp Gly Ser Lys Asp Val Phe Val His 20 25 30 Phe Ser Ala Ile Gln Gly Asn Gly Phe Lys Thr Leu Ala Glu Gly Gln 35 40 45 Asn Val Glu Phe Glu Ile Gln Asp Gly Gln Lys Gly Pro Ala Ala Val 50 55 60 Asn Val Thr Ala Ile 65 <210> SEQ ID NO 14 <211> LENGTH: 351 <212> TYPE: DNA <213> ORGANISM: Escherichia coli <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (74)..(298) <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: P24245 <309> DATABASE ENTRY DATE: 1992-03-01 <313> RELEVANT RESIDUES IN SEQ ID NO: (1)..(351) <400> SEQUENCE: 14 ttttgaacag ccccctctct gaccccggtt tattccatct tacttgtata agatttgcga 60 aggatgtcga agc atg gaa aag ggt act gtt aag tgg ttc aac aat gcc 109 Met Glu Lys Gly Thr Val Lys Trp Phe Asn Asn Ala 1 5 10 aaa ggg ttt ggt ttc atc tgc cct gaa ggc ggc ggc gaa gat att ttc 157 Lys Gly Phe Gly Phe Ile Cys Pro Glu Gly Gly Gly Glu Asp Ile Phe 15 20 25 gct cat tat tcc acc att cag atg gat ggt tac aga acg cta aaa gct 205 Ala His Tyr Ser Thr Ile Gln Met Asp Gly Tyr Arg Thr Leu Lys Ala 30 35 40 gga caa tcc gtt cag ttt gat gtc cac cag ggg cca aaa ggc aat cac 253 Gly Gln Ser Val Gln Phe Asp Val His Gln Gly Pro Lys Gly Asn His 45 50 55 60 gcc agt gtt att gtg ccc gtc gaa gta gaa gcg gca gtc gca tag 298 Ala Ser Val Ile Val Pro Val Glu Val Glu Ala Ala Val Ala 65 70 ctcttctgtc tcattgtgta catcctaaag gcaaaatgcc agcccgatcg gct 351 <210> SEQ ID NO 15 <211> LENGTH: 74 <212> TYPE: PRT <213> ORGANISM: Escherichia coli <400> SEQUENCE: 15 Met Glu Lys Gly Thr Val Lys Trp Phe Asn Asn Ala Lys Gly Phe Gly 1 5 10 15 Phe Ile Cys Pro Glu Gly Gly Gly Glu Asp Ile Phe Ala His Tyr Ser 20 25 30 Thr Ile Gln Met Asp Gly Tyr Arg Thr Leu Lys Ala Gly Gln Ser Val 35 40 45 Gln Phe Asp Val His Gln Gly Pro Lys Gly Asn His Ala Ser Val Ile 50 55 60 Val Pro Val Glu Val Glu Ala Ala Val Ala 65 70 <210> SEQ ID NO 16 <211> LENGTH: 301 <212> TYPE: DNA <213> ORGANISM: Escherichia coli <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (62)..(259) <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: P39819 <309> DATABASE ENTRY DATE: 1995-02-01 <313> RELEVANT RESIDUES IN SEQ ID NO: (1)..(301) <400> SEQUENCE: 16 tcaggaacgt gtgtatagtg cgccaagtta tcagtattaa ggaatttttt tgtcccgtaa 60 a atg aca gga att gtc aaa acc ttt gac ggc aaa agc ggc aag ggt ctt 109 Met Thr Gly Ile Val Lys Thr Phe Asp Gly Lys Ser Gly Lys Gly Leu 1 5 10 15 atc acc cca tcc gat ggt cgt atc gat gtc cag ctt cat gtt tca gcg 157 Ile Thr Pro Ser Asp Gly Arg Ile Asp Val Gln Leu His Val Ser Ala 20 25 30 ctc aat ctc cgc gat gca gaa gaa att acc acc gga tta cgc gtg gaa 205 Leu Asn Leu Arg Asp Ala Glu Glu Ile Thr Thr Gly Leu Arg Val Glu 35 40 45 ttt tgc cgg ata aat ggt ctg cgt ggc cct tca gct gcc aat gtt tac 253 Phe Cys Arg Ile Asn Gly Leu Arg Gly Pro Ser Ala Ala Asn Val Tyr 50 55 60 ctt tca tgagctatat taaagcttta atttcaggcc ccatcggatc ac 301 Leu Ser 65 <210> SEQ ID NO 17 <211> LENGTH: 66 <212> TYPE: PRT <213> ORGANISM: Escherichia coli <400> SEQUENCE: 17 Met Thr Gly Ile Val Lys Thr Phe Asp Gly Lys Ser Gly Lys Gly Leu 1 5 10 15 Ile Thr Pro Ser Asp Gly Arg Ile Asp Val Gln Leu His Val Ser Ala 20 25 30 Leu Asn Leu Arg Asp Ala Glu Glu Ile Thr Thr Gly Leu Arg Val Glu 35 40 45 Phe Cys Arg Ile Asn Gly Leu Arg Gly Pro Ser Ala Ala Asn Val Tyr 50 55 60 Leu Ser 65 <210> SEQ ID NO 18 <211> LENGTH: 994 <212> TYPE: DNA <213> ORGANISM: Escherichia coli <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (560)..(772) <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: D63344 <309> DATABASE ENTRY DATE: 1999-02-13 <313> RELEVANT RESIDUES IN SEQ ID NO: (1)..(994) <400> SEQUENCE: 18 aaatgtatga tgtgactatt cactatccaa taaaccagtc agcttaaaca agcacgtcat 60 attaagagag ataaacattt gccgctgttg gtcctcgcag gccatttacg cggcaaaatt 120 ccacacgtaa tcctggtata agcacttctg cgtcgcgggg agtgaatgcg gaaatatgga 180 cctgaacttc tttacgaccg tcggagggga taatgaatcc tttgccgctt ttgcgatcaa 240 aggttttgac aattcctgtc attttacggg acaaacaaat tccttactga aaatactgcg 300 ctgcactata cggggttaat aaaataaagc cagcgatatt taagaccgcc ggacggctaa 360 aataaaattt gcttaatctc aattatcatg cgttaatagc tgcgtcggtt tgaaagacag 420 acagcataca aagtagttta ctaaagcagt tctcattatc aggcattatc cccttctttt 480 gagtctctct cctgaacact aagtagtttc tgtattaaag ccctgtttgc cgaaaggccc 540 aaaatgaagg aagtaaaat atg tct aat aaa atg act ggt tta gta aaa tgg 592 Met Ser Asn Lys Met Thr Gly Leu Val Lys Trp 1 5 10 ttt aac gca gat aaa ggt ttt ggc ttt atc act cct gat gat ggc agc 640 Phe Asn Ala Asp Lys Gly Phe Gly Phe Ile Thr Pro Asp Asp Gly Ser 15 20 25 aaa gac gtt ttc gtc cat ttc acc gcc atc cag agc aat gaa ttc cgc 688 Lys Asp Val Phe Val His Phe Thr Ala Ile Gln Ser Asn Glu Phe Arg 30 35 40 acg ctg aac gaa aat cag aaa gtt gaa ttt tct att gag cag ggg caa 736 Thr Leu Asn Glu Asn Gln Lys Val Glu Phe Ser Ile Glu Gln Gly Gln 45 50 55 cgt ggc ccc gcg gca gcg aac gtt gtt acg ctc taa ggttgccatt 782 Arg Gly Pro Ala Ala Ala Asn Val Val Thr Leu 60 65 70 attactcaac atctccattt ccgctgtcca tgttgtcatg gttcacagta ccgcacatcg 842 gcattcgatg tgacggagcg aaaccctttg gcgctaagtg tattttttgt aaatcgacga 902 tgatcacctt tgataacgtc gcgctgcaaa tacgcactga ccatgcgcgc tggatttcac 962 aaataatatc aggctcctcg tggagctttt tt 994 <210> SEQ ID NO 19 <211> LENGTH: 70 <212> TYPE: PRT <213> ORGANISM: Escherichia coli <400> SEQUENCE: 19 Met Ser Asn Lys Met Thr Gly Leu Val Lys Trp Phe Asn Ala Asp Lys 1 5 10 15 Gly Phe Gly Phe Ile Thr Pro Asp Asp Gly Ser Lys Asp Val Phe Val 20 25 30 His Phe Thr Ala Ile Gln Ser Asn Glu Phe Arg Thr Leu Asn Glu Asn 35 40 45 Gln Lys Val Glu Phe Ser Ile Glu Gln Gly Gln Arg Gly Pro Ala Ala 50 55 60 Ala Asn Val Val Thr Leu 65 70 <210> SEQ ID NO 20 <211> LENGTH: 351 <212> TYPE: DNA <213> ORGANISM: Agrobacterium tumefaciens <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (125)..(334) <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: AAK90623 <309> DATABASE ENTRY DATE: 2001-12-18 <313> RELEVANT RESIDUES IN SEQ ID NO: (1)..(351) <400> SEQUENCE: 20 catcgaccat tgcttgtgac gtcgttaccg gaacctcgtg ttccccgtcg gatttcctct 60 caaaaatcga tctaatcccg caaggtatcg cgggaaccac aacgattcta aaaaggagat 120 cgtt atg aac act ggt act gta aag tgg ttt aac gcc acc aag ggc ttc 169 Met Asn Thr Gly Thr Val Lys Trp Phe Asn Ala Thr Lys Gly Phe 1 5 10 15 ggc ttc att cag cct gac aac ggc ggc acg gac gtt ttc gtt cac att 217 Gly Phe Ile Gln Pro Asp Asn Gly Gly Thr Asp Val Phe Val His Ile 20 25 30 tct gct gtt gag cgc gct ggc atg cgt tcg ctg aac gac ggc cag aag 265 Ser Ala Val Glu Arg Ala Gly Met Arg Ser Leu Asn Asp Gly Gln Lys 35 40 45 atc agc tat gag atc gtt cag gac cgc cgg tcc gga aaa agc tct gcc 313 Ile Ser Tyr Glu Ile Val Gln Asp Arg Arg Ser Gly Lys Ser Ser Ala 50 55 60 gat aac ctt cag gca gct tga tattcgtcat tttggcc 351 Asp Asn Leu Gln Ala Ala 65 <210> SEQ ID NO 21 <211> LENGTH: 69 <212> TYPE: PRT <213> ORGANISM: Agrobacterium tumefaciens <400> SEQUENCE: 21 Met Asn Thr Gly Thr Val Lys Trp Phe Asn Ala Thr Lys Gly Phe Gly 1 5 10 15 Phe Ile Gln Pro Asp Asn Gly Gly Thr Asp Val Phe Val His Ile Ser 20 25 30 Ala Val Glu Arg Ala Gly Met Arg Ser Leu Asn Asp Gly Gln Lys Ile 35 40 45 Ser Tyr Glu Ile Val Gln Asp Arg Arg Ser Gly Lys Ser Ser Ala Asp 50 55 60 Asn Leu Gln Ala Ala 65 <210> SEQ ID NO 22 <211> LENGTH: 301 <212> TYPE: DNA <213> ORGANISM: Agrobacterium tumefaciens <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (59)..(262) <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: AAK89225 <309> DATABASE ENTRY DATE: 2001-12-18 <313> RELEVANT RESIDUES IN SEQ ID NO: (1)..(301) <400> SEQUENCE: 22 cgtaccgatc aatgatcggt attgcgttga ggtgcactca gcaatcaacg aggacaag 58 atg gca act ggc act gta aaa ttc ttc gct cag gac aag ggc ttt ggc 106 Met Ala Thr Gly Thr Val Lys Phe Phe Ala Gln Asp Lys Gly Phe Gly 1 5 10 15 ttc att acc cct gac aat ggc ggt cct gac gta ttc gtt cac atc tcg 154 Phe Ile Thr Pro Asp Asn Gly Gly Pro Asp Val Phe Val His Ile Ser 20 25 30 gca gtc ggt ttc ggc ggc tct ctt cag gat ggt cag aag gtg agc tac 202 Ala Val Gly Phe Gly Gly Ser Leu Gln Asp Gly Gln Lys Val Ser Tyr 35 40 45 gag ttg gga caa gac cgc aag acc ggt aaa tcg aaa gcc gag aac gtc 250 Glu Leu Gly Gln Asp Arg Lys Thr Gly Lys Ser Lys Ala Glu Asn Val 50 55 60 act ctc ctt tga tggcagcgcc gcggcccaac gcacgatagc gcgtgagca 301 Thr Leu Leu 65 <210> SEQ ID NO 23 <211> LENGTH: 67 <212> TYPE: PRT <213> ORGANISM: Agrobacterium tumefaciens <400> SEQUENCE: 23 Met Ala Thr Gly Thr Val Lys Phe Phe Ala Gln Asp Lys Gly Phe Gly 1 5 10 15 Phe Ile Thr Pro Asp Asn Gly Gly Pro Asp Val Phe Val His Ile Ser 20 25 30 Ala Val Gly Phe Gly Gly Ser Leu Gln Asp Gly Gln Lys Val Ser Tyr 35 40 45 Glu Leu Gly Gln Asp Arg Lys Thr Gly Lys Ser Lys Ala Glu Asn Val 50 55 60 Thr Leu Leu 65 <210> SEQ ID NO 24 <211> LENGTH: 251 <212> TYPE: DNA <213> ORGANISM: Agrobacterium tumefaciens <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (27)..(242) <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: AAK87945 <309> DATABASE ENTRY DATE: 2001-12-18 <313> RELEVANT RESIDUES IN SEQ ID NO: (1)..(251) <400> SEQUENCE: 24 cgggcagagc gaaaaggacc tgatgc atg gcc gaa act ggc acc gta aaa ttc 53 Met Ala Glu Thr Gly Thr Val Lys Phe 1 5 ttt aat acc gac aaa ggc ttc ggc ttc atc aag cca gac aat ggt ggc 101 Phe Asn Thr Asp Lys Gly Phe Gly Phe Ile Lys Pro Asp Asn Gly Gly 10 15 20 25 gct gat atc ttt gtt cac atc tct gcc gta cag gct tct ggc ctg tcc 149 Ala Asp Ile Phe Val His Ile Ser Ala Val Gln Ala Ser Gly Leu Ser 30 35 40 gga ctt tca gaa aat cag aaa gtg agc ttc gac acg gaa ccg gat cgt 197 Gly Leu Ser Glu Asn Gln Lys Val Ser Phe Asp Thr Glu Pro Asp Arg 45 50 55 cgc ggc aag ggc ccg aag gca gtc aat ctg cag att gct ggc tga 242 Arg Gly Lys Gly Pro Lys Ala Val Asn Leu Gln Ile Ala Gly 60 65 70 ccctaaaac 251 <210> SEQ ID NO 25 <211> LENGTH: 71 <212> TYPE: PRT <213> ORGANISM: Agrobacterium tumefaciens <400> SEQUENCE: 25 Met Ala Glu Thr Gly Thr Val Lys Phe Phe Asn Thr Asp Lys Gly Phe 1 5 10 15 Gly Phe Ile Lys Pro Asp Asn Gly Gly Ala Asp Ile Phe Val His Ile 20 25 30 Ser Ala Val Gln Ala Ser Gly Leu Ser Gly Leu Ser Glu Asn Gln Lys 35 40 45 Val Ser Phe Asp Thr Glu Pro Asp Arg Arg Gly Lys Gly Pro Lys Ala 50 55 60 Val Asn Leu Gln Ile Ala Gly 65 70 <210> SEQ ID NO 26 <211> LENGTH: 651 <212> TYPE: DNA <213> ORGANISM: Agrobacterium tumefaciens <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (297)..(605) <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: AAK87573 <309> DATABASE ENTRY DATE: 2001-12-18 <313> RELEVANT RESIDUES IN SEQ ID NO: (1)..(651) <400> SEQUENCE: 26 gcgcgtaatc gaggggttgg caggatatgg ctgataggat gtcatcgaaa acgatagtcg 60 atgtcgagga cctttcgggc gatgccgtcg acctgaccga aatcaccggc gtcgtgaaat 120 ggttcgacgt cgccaagggt ttcggcttca tcgtgcccga taacggtaca caggatgtgc 180 tgctgcacgt ctcgtgcctg cgccgcgacg gctaccagac catccttgaa ggcacgcgca 240 tcgtcgccct catccagcgg cgcgaccgcg gtttccaggt tttccgcatc ctgtcc atg 299 Met 1 gat cag tcg acc gcc gtt cac ccg tcg cag ctg ccg ccg gtg cgc acc 347 Asp Gln Ser Thr Ala Val His Pro Ser Gln Leu Pro Pro Val Arg Thr 5 10 15 cat gtg cag gtg acg ccg cat agc ggg ctt gag cgt gcc atc gtc aag 395 His Val Gln Val Thr Pro His Ser Gly Leu Glu Arg Ala Ile Val Lys 20 25 30 tgg ttc aac cgc acc aag ggt ttc ggt ttc ctg acg cgt ggc gaa gga 443 Trp Phe Asn Arg Thr Lys Gly Phe Gly Phe Leu Thr Arg Gly Glu Gly 35 40 45 acg gaa gat att ttc gtg cat atg gaa acg ctg cgc cgt ttc ggc ctg 491 Thr Glu Asp Ile Phe Val His Met Glu Thr Leu Arg Arg Phe Gly Leu 50 55 60 65 acg gaa ctg cgc ccc ggc cag gtg gtg ctc gtg cgt tac ggc gat ggc 539 Thr Glu Leu Arg Pro Gly Gln Val Val Leu Val Arg Tyr Gly Asp Gly 70 75 80 gac aag ggc ctg atg gca gcg gaa atc cat ccc gat aac ccg gtt tcc 587 Asp Lys Gly Leu Met Ala Ala Glu Ile His Pro Asp Asn Pro Val Ser 85 90 95 atc ggg atg tcg cat tga tgtccggcct gcgtcccatg ctgaaaggcg 635 Ile Gly Met Ser His 100 ccgtcatggc gcttgt 651 <210> SEQ ID NO 27 <211> LENGTH: 102 <212> TYPE: PRT <213> ORGANISM: Agrobacterium tumefaciens <400> SEQUENCE: 27 Met Asp Gln Ser Thr Ala Val His Pro Ser Gln Leu Pro Pro Val Arg 1 5 10 15 Thr His Val Gln Val Thr Pro His Ser Gly Leu Glu Arg Ala Ile Val 20 25 30 Lys Trp Phe Asn Arg Thr Lys Gly Phe Gly Phe Leu Thr Arg Gly Glu 35 40 45 Gly Thr Glu Asp Ile Phe Val His Met Glu Thr Leu Arg Arg Phe Gly 50 55 60 Leu Thr Glu Leu Arg Pro Gly Gln Val Val Leu Val Arg Tyr Gly Asp 65 70 75 80 Gly Asp Lys Gly Leu Met Ala Ala Glu Ile His Pro Asp Asn Pro Val 85 90 95 Ser Ile Gly Met Ser His 100 <210> SEQ ID NO 28 <211> LENGTH: 301 <212> TYPE: DNA <213> ORGANISM: Synechocystis PCC6803 <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (22)..(273) <400> SEQUENCE: 28 ctctggtttt ggagctaatt t atg tcc att tat gtc ggg aac ctt tct tac 51 Met Ser Ile Tyr Val Gly Asn Leu Ser Tyr 1 5 10 caa gcc acc gaa gat gac gtt ttg act gtc ttc tcc gag tat ggc act 99 Gln Ala Thr Glu Asp Asp Val Leu Thr Val Phe Ser Glu Tyr Gly Thr 15 20 25 gtt aag cgg gtt caa ctt ccc act gat cgg gag acc ggt cgt atg cgg 147 Val Lys Arg Val Gln Leu Pro Thr Asp Arg Glu Thr Gly Arg Met Arg 30 35 40 ggt ttt ggt ttc gtt gaa atg tct tcc gat aag gaa gaa gat gcc gcc 195 Gly Phe Gly Phe Val Glu Met Ser Ser Asp Lys Glu Glu Asp Ala Ala 45 50 55 att gaa gct ctg gat gga gcc gaa tgg atg ggg cgg gat ctc aaa gtt 243 Ile Glu Ala Leu Asp Gly Ala Glu Trp Met Gly Arg Asp Leu Lys Val 60 65 70 aat aaa gca aga ccg aga acc cct cgt taa gtttttgcct aattacctga 293 Asn Lys Ala Arg Pro Arg Thr Pro Arg 75 80 atttaaga 301 <210> SEQ ID NO 29 <211> LENGTH: 83 <212> TYPE: PRT <213> ORGANISM: Synechocystis PCC6803 <400> SEQUENCE: 29 Met Ser Ile Tyr Val Gly Asn Leu Ser Tyr Gln Ala Thr Glu Asp Asp 1 5 10 15 Val Leu Thr Val Phe Ser Glu Tyr Gly Thr Val Lys Arg Val Gln Leu 20 25 30 Pro Thr Asp Arg Glu Thr Gly Arg Met Arg Gly Phe Gly Phe Val Glu 35 40 45 Met Ser Ser Asp Lys Glu Glu Asp Ala Ala Ile Glu Ala Leu Asp Gly 50 55 60 Ala Glu Trp Met Gly Arg Asp Leu Lys Val Asn Lys Ala Arg Pro Arg 65 70 75 80 Thr Pro Arg <210> SEQ ID NO 30 <211> LENGTH: 401 <212> TYPE: DNA <213> ORGANISM: Synechocystis PCC6803 <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (91)..(396) <400> SEQUENCE: 30 tctagtatta acggtttttc gcgtttttcc attgacaggc atttctccga aatcaccctc 60 tacatatccc tcagtttttg gagaaaatcc atg tca att tat gta ggc aac ctg 114 Met Ser Ile Tyr Val Gly Asn Leu 1 5 tcc tat gac gtt tca gaa gcc gat tta acc gcg gtt ttt gct gaa tac 162 Ser Tyr Asp Val Ser Glu Ala Asp Leu Thr Ala Val Phe Ala Glu Tyr 10 15 20 ggt tcc gta aag cgg gtt cag ctc ccc acc gac cgg gaa act ggt cgc 210 Gly Ser Val Lys Arg Val Gln Leu Pro Thr Asp Arg Glu Thr Gly Arg 25 30 35 40 atg cgg ggc ttc ggt ttt gtc gag cta gaa gct gac gcc gaa gaa acg 258 Met Arg Gly Phe Gly Phe Val Glu Leu Glu Ala Asp Ala Glu Glu Thr 45 50 55 gct gcc att gaa gcc cta gac ggt gca gaa tgg atg ggt cgt gac ctt 306 Ala Ala Ile Glu Ala Leu Asp Gly Ala Glu Trp Met Gly Arg Asp Leu 60 65 70 aaa gtt aac aaa gcc aag ccc cgg gaa aat cgc agt ggc ggt ggt tcc 354 Lys Val Asn Lys Ala Lys Pro Arg Glu Asn Arg Ser Gly Gly Gly Ser 75 80 85 ttt ggt ggc ggt cgt aaa agc tat ggt ggt agc cgc tac tag ggctt 401 Phe Gly Gly Gly Arg Lys Ser Tyr Gly Gly Ser Arg Tyr 90 95 100 <210> SEQ ID NO 31 <211> LENGTH: 101 <212> TYPE: PRT <213> ORGANISM: Synechocystis PCC6803 <400> SEQUENCE: 31 Met Ser Ile Tyr Val Gly Asn Leu Ser Tyr Asp Val Ser Glu Ala Asp 1 5 10 15 Leu Thr Ala Val Phe Ala Glu Tyr Gly Ser Val Lys Arg Val Gln Leu 20 25 30 Pro Thr Asp Arg Glu Thr Gly Arg Met Arg Gly Phe Gly Phe Val Glu 35 40 45 Leu Glu Ala Asp Ala Glu Glu Thr Ala Ala Ile Glu Ala Leu Asp Gly 50 55 60 Ala Glu Trp Met Gly Arg Asp Leu Lys Val Asn Lys Ala Lys Pro Arg 65 70 75 80 Glu Asn Arg Ser Gly Gly Gly Ser Phe Gly Gly Gly Arg Lys Ser Tyr 85 90 95 Gly Gly Ser Arg Tyr 100 <210> SEQ ID NO 32 <211> LENGTH: 951 <212> TYPE: DNA <213> ORGANISM: Arabidopsis thaliana <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (46)..(654) <400> SEQUENCE: 32 aaagatttag agaaaaaagt gagttattaa gagattccaa tcaaa atg agc gga gac 57 Met Ser Gly Asp 1 aac ggc ggt ggt gag agg cgc aaa ggc tcc gtc aag tgg ttt gat acc 105 Asn Gly Gly Gly Glu Arg Arg Lys Gly Ser Val Lys Trp Phe Asp Thr 5 10 15 20 cag aag ggt ttc ggc ttc atc act cct gac gac ggt ggc gac gat ctc 153 Gln Lys Gly Phe Gly Phe Ile Thr Pro Asp Asp Gly Gly Asp Asp Leu 25 30 35 ttc gtt cac cag tcc tcc atc aga tct gag ggt ttc cgt agc ctc gct 201 Phe Val His Gln Ser Ser Ile Arg Ser Glu Gly Phe Arg Ser Leu Ala 40 45 50 gcc gaa gaa gcc gta gag ttc gag gtt gag atc gac aac aac aac cgt 249 Ala Glu Glu Ala Val Glu Phe Glu Val Glu Ile Asp Asn Asn Asn Arg 55 60 65 ccc aag gcc atc gat gtt tct gga ccc gac ggc gct ccc gtc caa gga 297 Pro Lys Ala Ile Asp Val Ser Gly Pro Asp Gly Ala Pro Val Gln Gly 70 75 80 aac agc ggt ggt ggt tca tct ggc gga cgc ggc ggt ttc ggt gga gga 345 Asn Ser Gly Gly Gly Ser Ser Gly Gly Arg Gly Gly Phe Gly Gly Gly 85 90 95 100 aga gga ggt gga cgc gga tct gga ggt gga tac ggc ggt ggc ggt ggt 393 Arg Gly Gly Gly Arg Gly Ser Gly Gly Gly Tyr Gly Gly Gly Gly Gly 105 110 115 gga tac gga gga aga gga ggt ggt ggt cga gga ggc agc gac tgc tac 441 Gly Tyr Gly Gly Arg Gly Gly Gly Gly Arg Gly Gly Ser Asp Cys Tyr 120 125 130 aag tgt ggt gag ccc ggt cac atg gcg aga gac tgt tct gaa ggc ggt 489 Lys Cys Gly Glu Pro Gly His Met Ala Arg Asp Cys Ser Glu Gly Gly 135 140 145 gga ggt tac gga gga ggc ggc ggt ggc tac gga ggt gga ggc gga tac 537 Gly Gly Tyr Gly Gly Gly Gly Gly Gly Tyr Gly Gly Gly Gly Gly Tyr 150 155 160 ggc gga gga ggt ggt ggt tac gga ggt ggt ggc cgt gga ggt ggt ggc 585 Gly Gly Gly Gly Gly Gly Tyr Gly Gly Gly Gly Arg Gly Gly Gly Gly 165 170 175 180 ggc ggg gga agc tgc tac agc tgt ggc gag tcg gga cat ttc gcc agg 633 Gly Gly Gly Ser Cys Tyr Ser Cys Gly Glu Ser Gly His Phe Ala Arg 185 190 195 gat tgc acc agc ggt gga cgt taaaaccaac gccggttacg cggtggagaa 684 Asp Cys Thr Ser Gly Gly Arg 200 gagtgagttg gttatctcac aagtgatcgg ttctttctcc cgccgccttc tatctctcta 744 ttatccactt tttgcttatt atgatggatc tctatctttg ttagttggtt ttttcttgat 804 ggtttcggat taggactctt cttttggttt tgctacttat ggttggtttt atttctggta 864 cttgtgatat gggtgaaatg ctctacttgt tgctctgttt caagtgttca taatatgcga 924 acaaatattc tgggttttgt ttcagtc 951 <210> SEQ ID NO 33 <211> LENGTH: 203 <212> TYPE: PRT <213> ORGANISM: Arabidopsis thaliana <400> SEQUENCE: 33 Met Ser Gly Asp Asn Gly Gly Gly Glu Arg Arg Lys Gly Ser Val Lys 1 5 10 15 Trp Phe Asp Thr Gln Lys Gly Phe Gly Phe Ile Thr Pro Asp Asp Gly 20 25 30 Gly Asp Asp Leu Phe Val His Gln Ser Ser Ile Arg Ser Glu Gly Phe 35 40 45 Arg Ser Leu Ala Ala Glu Glu Ala Val Glu Phe Glu Val Glu Ile Asp 50 55 60 Asn Asn Asn Arg Pro Lys Ala Ile Asp Val Ser Gly Pro Asp Gly Ala 65 70 75 80 Pro Val Gln Gly Asn Ser Gly Gly Gly Ser Ser Gly Gly Arg Gly Gly 85 90 95 Phe Gly Gly Gly Arg Gly Gly Gly Arg Gly Ser Gly Gly Gly Tyr Gly 100 105 110 Gly Gly Gly Gly Gly Tyr Gly Gly Arg Gly Gly Gly Gly Arg Gly Gly 115 120 125 Ser Asp Cys Tyr Lys Cys Gly Glu Pro Gly His Met Ala Arg Asp Cys 130 135 140 Ser Glu Gly Gly Gly Gly Tyr Gly Gly Gly Gly Gly Gly Tyr Gly Gly 145 150 155 160 Gly Gly Gly Tyr Gly Gly Gly Gly Gly Gly Tyr Gly Gly Gly Gly Arg 165 170 175 Gly Gly Gly Gly Gly Gly Gly Ser Cys Tyr Ser Cys Gly Glu Ser Gly 180 185 190 His Phe Ala Arg Asp Cys Thr Ser Gly Gly Arg 195 200 <210> SEQ ID NO 34 <211> LENGTH: 950 <212> TYPE: DNA <213> ORGANISM: Gossypium hirsutum <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (58)..(618) <400> SEQUENCE: 34 cccacgcgtc cggagactta tttactttag gaattttcta gaaccttctc gaaggca 57 atg gct gag gcg acc agc acc gag aga tcc act ggc aca gtc aaa tgg 105 Met Ala Glu Ala Thr Ser Thr Glu Arg Ser Thr Gly Thr Val Lys Trp 1 5 10 15 ttc agc gcc cag aaa tgt ttt ggt ttc ata gct ccc gac gac gga ggc 153 Phe Ser Ala Gln Lys Cys Phe Gly Phe Ile Ala Pro Asp Asp Gly Gly 20 25 30 gac gac ctt ttc gtc cac caa acc tct att ctt tcc caa ggc ttt cgt 201 Asp Asp Leu Phe Val His Gln Thr Ser Ile Leu Ser Gln Gly Phe Arg 35 40 45 aca ctc tcc gat aac caa ccc gtc gag ttc ttc gtt gat gtc ggt gaa 249 Thr Leu Ser Asp Asn Gln Pro Val Glu Phe Phe Val Asp Val Gly Glu 50 55 60 gat ggc cga gct aag gcc gtt gat gta act cct atg cct cga cct cgc 297 Asp Gly Arg Ala Lys Ala Val Asp Val Thr Pro Met Pro Arg Pro Arg 65 70 75 80 cgt cct tcc cgc ggc ggt gga aga gga gga tat ttt ggc ggc aga ggt 345 Arg Pro Ser Arg Gly Gly Gly Arg Gly Gly Tyr Phe Gly Gly Arg Gly 85 90 95 aga gga ggt ggt ggt tac agg aga gga ggt tat ggt ggt ggc ggt ggc 393 Arg Gly Gly Gly Gly Tyr Arg Arg Gly Gly Tyr Gly Gly Gly Gly Gly 100 105 110 ggt ggc gga ggt agt ggc gct tgt tat aat tgt ggg agg acg ggg cat 441 Gly Gly Gly Gly Ser Gly Ala Cys Tyr Asn Cys Gly Arg Thr Gly His 115 120 125 ata gcc agg gat tgt tat caa ggt ggt gga agt gga agt acg aga tac 489 Ile Ala Arg Asp Cys Tyr Gln Gly Gly Gly Ser Gly Ser Thr Arg Tyr 130 135 140 agt ggc ggc cgt gga gat ggt ggt gga aat aga aga tac ggt ggc gat 537 Ser Gly Gly Arg Gly Asp Gly Gly Gly Asn Arg Arg Tyr Gly Gly Asp 145 150 155 160 agc ggt gat gga cga gga gct ggg gga cga tgt ttt aat tgt gga gat 585 Ser Gly Asp Gly Arg Gly Ala Gly Gly Arg Cys Phe Asn Cys Gly Asp 165 170 175 gaa ggc cat ttt gca agg gat tgc cct aac aaa taattcagaa aacaaaaccg 638 Glu Gly His Phe Ala Arg Asp Cys Pro Asn Lys 180 185 gacatttcct ataatatttt gtgagtataa gtttttcttt tacggtgttt tggaaagggg 698 tttatcagca aaagaagaag aaaccggaaa gttgtctatt ctttccgatc aggcttactt 758 ttcccgattc cgattgatct ggtaacatct ttaaaaaaaa ggtccattgt tttgtataat 818 gtgttgtaat tgttgttatt ctcttaattc ttatcgattc ttctttcttt aatcctctat 878 tcttagtctt tgcattgaca gtatgaacgg gcaatcattt gtcttccttg aagcagattt 938 cttttatttt tc 950 <210> SEQ ID NO 35 <211> LENGTH: 187 <212> TYPE: PRT <213> ORGANISM: Gossypium hirsutum <400> SEQUENCE: 35 Met Ala Glu Ala Thr Ser Thr Glu Arg Ser Thr Gly Thr Val Lys Trp 1 5 10 15 Phe Ser Ala Gln Lys Cys Phe Gly Phe Ile Ala Pro Asp Asp Gly Gly 20 25 30 Asp Asp Leu Phe Val His Gln Thr Ser Ile Leu Ser Gln Gly Phe Arg 35 40 45 Thr Leu Ser Asp Asn Gln Pro Val Glu Phe Phe Val Asp Val Gly Glu 50 55 60 Asp Gly Arg Ala Lys Ala Val Asp Val Thr Pro Met Pro Arg Pro Arg 65 70 75 80 Arg Pro Ser Arg Gly Gly Gly Arg Gly Gly Tyr Phe Gly Gly Arg Gly 85 90 95 Arg Gly Gly Gly Gly Tyr Arg Arg Gly Gly Tyr Gly Gly Gly Gly Gly 100 105 110 Gly Gly Gly Gly Ser Gly Ala Cys Tyr Asn Cys Gly Arg Thr Gly His 115 120 125 Ile Ala Arg Asp Cys Tyr Gln Gly Gly Gly Ser Gly Ser Thr Arg Tyr 130 135 140 Ser Gly Gly Arg Gly Asp Gly Gly Gly Asn Arg Arg Tyr Gly Gly Asp 145 150 155 160 Ser Gly Asp Gly Arg Gly Ala Gly Gly Arg Cys Phe Asn Cys Gly Asp 165 170 175 Glu Gly His Phe Ala Arg Asp Cys Pro Asn Lys 180 185 <210> SEQ ID NO 36 <211> LENGTH: 516 <212> TYPE: DNA <213> ORGANISM: Gossypium hirsutum <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (42)..(377) <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (388)..(388) <223> OTHER INFORMATION: n = A, G, T, or C <400> SEQUENCE: 36 cggacgcgtg ggttgggatt ttaaagatgg gtgagaatag g atg acc ggc aag gtg 56 Met Thr Gly Lys Val 1 5 aag tgg ttc gat gac caa aag ggt tat ggc ttc ata tcc cct gac gac 104 Lys Trp Phe Asp Asp Gln Lys Gly Tyr Gly Phe Ile Ser Pro Asp Asp 10 15 20 ggc ggc gac gat ttg ttt gtt cac cag tct tcc atc cgt tcc gag ggt 152 Gly Gly Asp Asp Leu Phe Val His Gln Ser Ser Ile Arg Ser Glu Gly 25 30 35 ttc cgt agc ctt gct gat ggt gaa gag gtc gag tac gtt gtc gag tct 200 Phe Arg Ser Leu Ala Asp Gly Glu Glu Val Glu Tyr Val Val Glu Ser 40 45 50 tct gaa ggt cgc ccc aag gct gtt gag gtc act ggc ccc aac ggc aac 248 Ser Glu Gly Arg Pro Lys Ala Val Glu Val Thr Gly Pro Asn Gly Asn 55 60 65 cct gtt cgt gga tca tct aga tcc gga cgc ggc ggc ggc ggt ggt ggc 296 Pro Val Arg Gly Ser Ser Arg Ser Gly Arg Gly Gly Gly Gly Gly Gly 70 75 80 85 ggt tat ggc ggt gga tcc ggt gga tat ggt gga ggg gga agg aga ggc 344 Gly Tyr Gly Gly Gly Ser Gly Gly Tyr Gly Gly Gly Gly Arg Arg Gly 90 95 100 ggt tat ggt gga gga att gga ggg gga ttt tag ttgcaaaatg ngcatgctta 397 Gly Tyr Gly Gly Gly Ile Gly Gly Gly Phe 105 110 aaaatattat aagttgtaag cgtgcatgct aatgcagagt gtggttgact atgacgtatc 457 atactgccat actaattaat attattgagt aaaataaaaa acaatgcttt cttgtttcc 516 <210> SEQ ID NO 37 <211> LENGTH: 111 <212> TYPE: PRT <213> ORGANISM: Gossypium hirsutum <400> SEQUENCE: 37 Met Thr Gly Lys Val Lys Trp Phe Asp Asp Gln Lys Gly Tyr Gly Phe 1 5 10 15 Ile Ser Pro Asp Asp Gly Gly Asp Asp Leu Phe Val His Gln Ser Ser 20 25 30 Ile Arg Ser Glu Gly Phe Arg Ser Leu Ala Asp Gly Glu Glu Val Glu 35 40 45 Tyr Val Val Glu Ser Ser Glu Gly Arg Pro Lys Ala Val Glu Val Thr 50 55 60 Gly Pro Asn Gly Asn Pro Val Arg Gly Ser Ser Arg Ser Gly Arg Gly 65 70 75 80 Gly Gly Gly Gly Gly Gly Tyr Gly Gly Gly Ser Gly Gly Tyr Gly Gly 85 90 95 Gly Gly Arg Arg Gly Gly Tyr Gly Gly Gly Ile Gly Gly Gly Phe 100 105 110 <210> SEQ ID NO 38 <211> LENGTH: 792 <212> TYPE: DNA <213> ORGANISM: Glycine max <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (17)..(556) <400> SEQUENCE: 38 aaaaaagagg cgcaag atg agt ggt agg gtt tct ggg aag gtg aag tgg ttc 52 Met Ser Gly Arg Val Ser Gly Lys Val Lys Trp Phe 1 5 10 aac gat cag aag ggg ttt gga ttc ata acc cct gac gat ggc agc gag 100 Asn Asp Gln Lys Gly Phe Gly Phe Ile Thr Pro Asp Asp Gly Ser Glu 15 20 25 gaa ctc ttc gtt cac caa tct cag atc aaa tct gac ggt ttc cga agc 148 Glu Leu Phe Val His Gln Ser Gln Ile Lys Ser Asp Gly Phe Arg Ser 30 35 40 cta gct gaa gga gag tcc gtt gag ttc gct att gaa tct gaa tct gac 196 Leu Ala Glu Gly Glu Ser Val Glu Phe Ala Ile Glu Ser Glu Ser Asp 45 50 55 60 gga cgc gcc aag gct gtt gat gtc act ggc ccc gac ggc gcc agc gtc 244 Gly Arg Ala Lys Ala Val Asp Val Thr Gly Pro Asp Gly Ala Ser Val 65 70 75 cag gga acc aga cgc ggc ggt gat ggt ggc cga agc tat ggc ggg gga 292 Gln Gly Thr Arg Arg Gly Gly Asp Gly Gly Arg Ser Tyr Gly Gly Gly 80 85 90 cga gga ggt ggc tac ggt ggt ggt ggg cga ggc ggt ggt ggc ggg gct 340 Arg Gly Gly Gly Tyr Gly Gly Gly Gly Arg Gly Gly Gly Gly Gly Ala 95 100 105 tgc tac aac tgc ggt gaa tcg gga cat ctg gct agg gac tgc agc caa 388 Cys Tyr Asn Cys Gly Glu Ser Gly His Leu Ala Arg Asp Cys Ser Gln 110 115 120 gga ggc ggt gga gac agg tac ggc gga ggc ggt ggt ggt ggt ggc agg 436 Gly Gly Gly Gly Asp Arg Tyr Gly Gly Gly Gly Gly Gly Gly Gly Arg 125 130 135 140 tat gga ggc ggc ggt ggc ggc agg tac ggt ggt ggt gga gga ggt ggt 484 Tyr Gly Gly Gly Gly Gly Gly Arg Tyr Gly Gly Gly Gly Gly Gly Gly 145 150 155 ggc ggc gga gga agc tgc tac agc tgt gga gag tct ggg cat ttc gcc 532 Gly Gly Gly Gly Ser Cys Tyr Ser Cys Gly Glu Ser Gly His Phe Ala 160 165 170 aga gat tgc cca tca agt gct cgt tgaaattact gttatggtgg tttatgttat 586 Arg Asp Cys Pro Ser Ser Ala Arg 175 180 gcggattgtt ttaagttttt actttaacat gttgtaggga ttttaatggt ttctgtcaaa 646 gctgtggctt cttataagta gatgcgtgag atttttcttt tttttggtta tttaaatgaa 706 agtttctgtg ttatcgttac aatctgcaaa caaaatctgt ttggacctac attttgctat 766 aatgaattgg atgattgtta tcggtt 792 <210> SEQ ID NO 39 <211> LENGTH: 180 <212> TYPE: PRT <213> ORGANISM: Glycine max <400> SEQUENCE: 39 Met Ser Gly Arg Val Ser Gly Lys Val Lys Trp Phe Asn Asp Gln Lys 1 5 10 15 Gly Phe Gly Phe Ile Thr Pro Asp Asp Gly Ser Glu Glu Leu Phe Val 20 25 30 His Gln Ser Gln Ile Lys Ser Asp Gly Phe Arg Ser Leu Ala Glu Gly 35 40 45 Glu Ser Val Glu Phe Ala Ile Glu Ser Glu Ser Asp Gly Arg Ala Lys 50 55 60 Ala Val Asp Val Thr Gly Pro Asp Gly Ala Ser Val Gln Gly Thr Arg 65 70 75 80 Arg Gly Gly Asp Gly Gly Arg Ser Tyr Gly Gly Gly Arg Gly Gly Gly 85 90 95 Tyr Gly Gly Gly Gly Arg Gly Gly Gly Gly Gly Ala Cys Tyr Asn Cys 100 105 110 Gly Glu Ser Gly His Leu Ala Arg Asp Cys Ser Gln Gly Gly Gly Gly 115 120 125 Asp Arg Tyr Gly Gly Gly Gly Gly Gly Gly Gly Arg Tyr Gly Gly Gly 130 135 140 Gly Gly Gly Arg Tyr Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly 145 150 155 160 Ser Cys Tyr Ser Cys Gly Glu Ser Gly His Phe Ala Arg Asp Cys Pro 165 170 175 Ser Ser Ala Arg 180 <210> SEQ ID NO 40 <211> LENGTH: 1245 <212> TYPE: DNA <213> ORGANISM: Zea mays <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (75)..(806) <400> SEQUENCE: 40 gcgagagacg ggcaggggag aggaaaaaaa aaatctaacc ctagcatccg cagcgctagg 60 gttcgggggt tgcg atg gcg gcg gcg gcg aga cag cgg ggg acg gtg aag 110 Met Ala Ala Ala Ala Arg Gln Arg Gly Thr Val Lys 1 5 10 tgg ttc aac gac acc aag ggc ttc ggg ttc atc tcc ccc gag gac ggc 158 Trp Phe Asn Asp Thr Lys Gly Phe Gly Phe Ile Ser Pro Glu Asp Gly 15 20 25 agc gaa gat ctc ttc gtg cac cag tcg tcg atc aag tcg gag ggc ttc 206 Ser Glu Asp Leu Phe Val His Gln Ser Ser Ile Lys Ser Glu Gly Phe 30 35 40 cgc tcg ctc gcg gag ggc gag gag gtg gag ttt tcc gtc tcg gag ggt 254 Arg Ser Leu Ala Glu Gly Glu Glu Val Glu Phe Ser Val Ser Glu Gly 45 50 55 60 gac gac ggc cgc act aag gcc gtc gac gtg acc ggc ccc gac gga tcc 302 Asp Asp Gly Arg Thr Lys Ala Val Asp Val Thr Gly Pro Asp Gly Ser 65 70 75 ttc gtc agg ggc ggc gga ggc gga gga gga ggc ggc ggc ggc tac ggc 350 Phe Val Arg Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Tyr Gly 80 85 90 tcc cgc ggc ggt ggc gga tct ggc ggc ggc ggt cgc agc tac ggt ggt 398 Ser Arg Gly Gly Gly Gly Ser Gly Gly Gly Gly Arg Ser Tyr Gly Gly 95 100 105 agc tgg ggc ggc ggc cgg aga tcc ggc ggc ggg ggc ggt ccc ggc gcg 446 Ser Trp Gly Gly Gly Arg Arg Ser Gly Gly Gly Gly Gly Pro Gly Ala 110 115 120 tgc tac aag tgc ggc gag ccc ggc cac atg gca agg gac tgc cct agc 494 Cys Tyr Lys Cys Gly Glu Pro Gly His Met Ala Arg Asp Cys Pro Ser 125 130 135 140 gcc gac ggc gga ggc ggc tac ggc gga ggc ggc tac gga gga gga ggc 542 Ala Asp Gly Gly Gly Gly Tyr Gly Gly Gly Gly Tyr Gly Gly Gly Gly 145 150 155 ggc ggc ggc ggt ggc tgc ttc aag tgt ggc gag cct ggc cac atg gcc 590 Gly Gly Gly Gly Gly Cys Phe Lys Cys Gly Glu Pro Gly His Met Ala 160 165 170 agg gac tgc tcc agc ggc ggc ggc ggc tac ggc ggt ggc ggc ggc ggc 638 Arg Asp Cys Ser Ser Gly Gly Gly Gly Tyr Gly Gly Gly Gly Gly Gly 175 180 185 ggt gga ggc ggc tgc tac aac tgc ggc cag gcc ggc cac atg gcc agg 686 Gly Gly Gly Gly Cys Tyr Asn Cys Gly Gln Ala Gly His Met Ala Arg 190 195 200 gac tgc ccc agc ggt ggc ggc ggt ggc gga ggg agg ttc ggc ggc ggc 734 Asp Cys Pro Ser Gly Gly Gly Gly Gly Gly Gly Arg Phe Gly Gly Gly 205 210 215 220 ggc ggg ggt ggc ggc gac cgc tcc tgc tac aac tgc ggc gag gcc ggc 782 Gly Gly Gly Gly Gly Asp Arg Ser Cys Tyr Asn Cys Gly Glu Ala Gly 225 230 235 cac atc gcc cgc gac tgc ccc acg tgaggtgtgt ccgcgtccgt ccgtccagcc 836 His Ile Ala Arg Asp Cys Pro Thr 240 agatcagatc ggatcgctcc accacctgct ggtctgatgg cgccgccccc ttctagatct 896 cgcttaaaaa aacacccccc tctcgctgtg tgtcggagta ccgctttagt tttgccgatc 956 cgggcacgag tgcccgctgc ctctttcctc tcatgcgtaa gaggaacccg tccgccgttt 1016 tcagatttcg ttcggtccgt agaagaactc tcaagttaag ttaagttatc atggtgtgtg 1076 cttggtcgtt gttcgtcgtc gtcgttaagg ttttaagaga tgatttggtc ctgtgttgcc 1136 gaggggaagt cgaatctgct tttttctttt tttgtggttt gttccaccag actgaggaag 1196 gagatgagat gattattctc ccaaaaaaaa aaaaaaaaaa aaaaaaaaa 1245 <210> SEQ ID NO 41 <211> LENGTH: 244 <212> TYPE: PRT <213> ORGANISM: Zea mays <400> SEQUENCE: 41 Met Ala Ala Ala Ala Arg Gln Arg Gly Thr Val Lys Trp Phe Asn Asp 1 5 10 15 Thr Lys Gly Phe Gly Phe Ile Ser Pro Glu Asp Gly Ser Glu Asp Leu 20 25 30 Phe Val His Gln Ser Ser Ile Lys Ser Glu Gly Phe Arg Ser Leu Ala 35 40 45 Glu Gly Glu Glu Val Glu Phe Ser Val Ser Glu Gly Asp Asp Gly Arg 50 55 60 Thr Lys Ala Val Asp Val Thr Gly Pro Asp Gly Ser Phe Val Arg Gly 65 70 75 80 Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Tyr Gly Ser Arg Gly Gly 85 90 95 Gly Gly Ser Gly Gly Gly Gly Arg Ser Tyr Gly Gly Ser Trp Gly Gly 100 105 110 Gly Arg Arg Ser Gly Gly Gly Gly Gly Pro Gly Ala Cys Tyr Lys Cys 115 120 125 Gly Glu Pro Gly His Met Ala Arg Asp Cys Pro Ser Ala Asp Gly Gly 130 135 140 Gly Gly Tyr Gly Gly Gly Gly Tyr Gly Gly Gly Gly Gly Gly Gly Gly 145 150 155 160 Gly Cys Phe Lys Cys Gly Glu Pro Gly His Met Ala Arg Asp Cys Ser 165 170 175 Ser Gly Gly Gly Gly Tyr Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly 180 185 190 Cys Tyr Asn Cys Gly Gln Ala Gly His Met Ala Arg Asp Cys Pro Ser 195 200 205 Gly Gly Gly Gly Gly Gly Gly Arg Phe Gly Gly Gly Gly Gly Gly Gly 210 215 220 Gly Asp Arg Ser Cys Tyr Asn Cys Gly Glu Ala Gly His Ile Ala Arg 225 230 235 240 Asp Cys Pro Thr <210> SEQ ID NO 42 <211> LENGTH: 1409 <212> TYPE: DNA <213> ORGANISM: Zea mays <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (27)..(995) <400> SEQUENCE: 42 cgcagcgcta gggttcgggg gttgcg atg gcg gcg gcg gcg agg cag cgg ggg 53 Met Ala Ala Ala Ala Arg Gln Arg Gly 1 5 acg gtg aag tgg ttc aac gac acc aag ggc ttc ggg ttc atc tcc ccc 101 Thr Val Lys Trp Phe Asn Asp Thr Lys Gly Phe Gly Phe Ile Ser Pro 10 15 20 25 gag gac ggc agc gag gat ctc ttc gtg cac cag tcg tcg atc aag tcg 149 Glu Asp Gly Ser Glu Asp Leu Phe Val His Gln Ser Ser Ile Lys Ser 30 35 40 gag ggc ttc cgc tcg ctc gcg gag ggc gag gag gtg gag ttt tcc gtc 197 Glu Gly Phe Arg Ser Leu Ala Glu Gly Glu Glu Val Glu Phe Ser Val 45 50 55 tcg gag ggt gac gac ggc cgc act aag gcc gtc gac gtg acc ggc ccc 245 Ser Glu Gly Asp Asp Gly Arg Thr Lys Ala Val Asp Val Thr Gly Pro 60 65 70 gac gga tcc ttc gtc agg ggc ggc gga ggc gga gga ggc ggc ggc ggc 293 Asp Gly Ser Phe Val Arg Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly 75 80 85 ggc ggc tac ggc tcc cgc ggc ggt ggc gga tct ggc ggc ggc ggt cgc 341 Gly Gly Tyr Gly Ser Arg Gly Gly Gly Gly Ser Gly Gly Gly Gly Arg 90 95 100 105 agc tac ggt ggt agc tgg ggc ggc ggc cgg aga tcc gcg ccc gac gcc 389 Ser Tyr Gly Gly Ser Trp Gly Gly Gly Arg Arg Ser Ala Pro Asp Ala 110 115 120 gct ttc ggc tcc gtc ctc tcc ggc acc gcc ggc gac gcc gcc ccc agc 437 Ala Phe Gly Ser Val Leu Ser Gly Thr Ala Gly Asp Ala Ala Pro Ser 125 130 135 gac cag tgg ttc gtc gac gcg ctc aac gcc ccc gcg ccg cac ccc atc 485 Asp Gln Trp Phe Val Asp Ala Leu Asn Ala Pro Ala Pro His Pro Ile 140 145 150 gag cgc gtc cga tcc gag tcc tcc tcg atc gtc tcc gac gtc ccc gac 533 Glu Arg Val Arg Ser Glu Ser Ser Ser Ile Val Ser Asp Val Pro Asp 155 160 165 tac ctc ttc agc ctc gac agc ccg tcc gac gac ccc agc ccc ggc ccc 581 Tyr Leu Phe Ser Leu Asp Ser Pro Ser Asp Asp Pro Ser Pro Gly Pro 170 175 180 185 tcg gcg gct cgc gcc aag tcc gac ccc gcg gag act ccg cac cac cac 629 Ser Ala Ala Arg Ala Lys Ser Asp Pro Ala Glu Thr Pro His His His 190 195 200 ggc gac gac gtg ccg cct tcc gct cga cag ata ccg cac gtc gca gga 677 Gly Asp Asp Val Pro Pro Ser Ala Arg Gln Ile Pro His Val Ala Gly 205 210 215 gga gcg tca tcg tgg ccc gcc ccg ccg ccg ccg tac atg gcg cag cct 725 Gly Ala Ser Ser Trp Pro Ala Pro Pro Pro Pro Tyr Met Ala Gln Pro 220 225 230 atg tac tac ttc ccc gtg ccg cca ccg gtc cac tac ctc gac cag tct 773 Met Tyr Tyr Phe Pro Val Pro Pro Pro Val His Tyr Leu Asp Gln Ser 235 240 245 gcg cag agt ggc tac atg cct cgc ccg atc tac cac att gtc ggt ggc 821 Ala Gln Ser Gly Tyr Met Pro Arg Pro Ile Tyr His Ile Val Gly Gly 250 255 260 265 gga gga agc gag gcg cct ggc gga gat ctt cac gcg gcc ggc gga gtc 869 Gly Gly Ser Glu Ala Pro Gly Gly Asp Leu His Ala Ala Gly Gly Val 270 275 280 tac ggc gtc tcg cac cac atg cag ggg ttc ccg ccg atg atg tac gcg 917 Tyr Gly Val Ser His His Met Gln Gly Phe Pro Pro Met Met Tyr Ala 285 290 295 ccg ccg cgc gcg gtc atc tac aac tac aag tcg gag ggg atg cca tcg 965 Pro Pro Arg Ala Val Ile Tyr Asn Tyr Lys Ser Glu Gly Met Pro Ser 300 305 310 ctg cct ccg gaa ggt ggg gca cac tct tcc taggtgcatc ggctacttca 1015 Leu Pro Pro Glu Gly Gly Ala His Ser Ser 315 320 catctctgaa tcctgattat tgttgcagat gcctaagcta aggagttttg cgtggtaatt 1075 tttttatcga ttcgtctaga gtcttgttcg ttgttttgta tagatggagg ggttgatggt 1135 gatggataga tattaatgca gttttcgtct agtggaaata tattcgtgaa atgtatatca 1195 tactaaatag tatagtattt ggtgtgatta attaatattc tagttaatgt aatgtgggat 1255 tcatataatc taggtggttc tggtcttata gaaaccattt ttgggcattt tatatttaca 1315 taaactggat gttgggtgaa tgttctaagc agtatgtgct gtgttgaacc tcaatcactt 1375 atgagtggtt actaaatttg aatttgatgt cttc 1409 <210> SEQ ID NO 43 <211> LENGTH: 323 <212> TYPE: PRT <213> ORGANISM: Zea mays <400> SEQUENCE: 43 Met Ala Ala Ala Ala Arg Gln Arg Gly Thr Val Lys Trp Phe Asn Asp 1 5 10 15 Thr Lys Gly Phe Gly Phe Ile Ser Pro Glu Asp Gly Ser Glu Asp Leu 20 25 30 Phe Val His Gln Ser Ser Ile Lys Ser Glu Gly Phe Arg Ser Leu Ala 35 40 45 Glu Gly Glu Glu Val Glu Phe Ser Val Ser Glu Gly Asp Asp Gly Arg 50 55 60 Thr Lys Ala Val Asp Val Thr Gly Pro Asp Gly Ser Phe Val Arg Gly 65 70 75 80 Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Tyr Gly Ser Arg Gly 85 90 95 Gly Gly Gly Ser Gly Gly Gly Gly Arg Ser Tyr Gly Gly Ser Trp Gly 100 105 110 Gly Gly Arg Arg Ser Ala Pro Asp Ala Ala Phe Gly Ser Val Leu Ser 115 120 125 Gly Thr Ala Gly Asp Ala Ala Pro Ser Asp Gln Trp Phe Val Asp Ala 130 135 140 Leu Asn Ala Pro Ala Pro His Pro Ile Glu Arg Val Arg Ser Glu Ser 145 150 155 160 Ser Ser Ile Val Ser Asp Val Pro Asp Tyr Leu Phe Ser Leu Asp Ser 165 170 175 Pro Ser Asp Asp Pro Ser Pro Gly Pro Ser Ala Ala Arg Ala Lys Ser 180 185 190 Asp Pro Ala Glu Thr Pro His His His Gly Asp Asp Val Pro Pro Ser 195 200 205 Ala Arg Gln Ile Pro His Val Ala Gly Gly Ala Ser Ser Trp Pro Ala 210 215 220 Pro Pro Pro Pro Tyr Met Ala Gln Pro Met Tyr Tyr Phe Pro Val Pro 225 230 235 240 Pro Pro Val His Tyr Leu Asp Gln Ser Ala Gln Ser Gly Tyr Met Pro 245 250 255 Arg Pro Ile Tyr His Ile Val Gly Gly Gly Gly Ser Glu Ala Pro Gly 260 265 270 Gly Asp Leu His Ala Ala Gly Gly Val Tyr Gly Val Ser His His Met 275 280 285 Gln Gly Phe Pro Pro Met Met Tyr Ala Pro Pro Arg Ala Val Ile Tyr 290 295 300 Asn Tyr Lys Ser Glu Gly Met Pro Ser Leu Pro Pro Glu Gly Gly Ala 305 310 315 320 His Ser Ser <210> SEQ ID NO 44 <211> LENGTH: 215 <212> TYPE: DNA <213> ORGANISM: Bacillus subtilis <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (15)..(215) <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: AB001488 <309> DATABASE ENTRY DATE: 1999-02-13 <313> RELEVANT RESIDUES IN SEQ ID NO: (1)..(215) <400> SEQUENCE: 44 aggaggcaac aaaa atg gaa caa ggt aca gtt aaa tgg ttt aat gca gaa 50 Met Glu Gln Gly Thr Val Lys Trp Phe Asn Ala Glu 1 5 10 aaa ggt ttt ggc ttt atc gaa cgc gaa aat gga gac gat gta ttc gta 98 Lys Gly Phe Gly Phe Ile Glu Arg Glu Asn Gly Asp Asp Val Phe Val 15 20 25 cac ttt tct gca atc caa agt gac gga ttc aaa tct tta gac gaa ggt 146 His Phe Ser Ala Ile Gln Ser Asp Gly Phe Lys Ser Leu Asp Glu Gly 30 35 40 caa aaa gta tcg ttt gac gtt gag caa ggt gct cgt gga gct caa gct 194 Gln Lys Val Ser Phe Asp Val Glu Gln Gly Ala Arg Gly Ala Gln Ala 45 50 55 60 gct aac gtt caa aaa gct taa 215 Ala Asn Val Gln Lys Ala 65 <210> SEQ ID NO 45 <211> LENGTH: 66 <212> TYPE: PRT <213> ORGANISM: Bacillus subtilis <400> SEQUENCE: 45 Met Glu Gln Gly Thr Val Lys Trp Phe Asn Ala Glu Lys Gly Phe Gly 1 5 10 15 Phe Ile Glu Arg Glu Asn Gly Asp Asp Val Phe Val His Phe Ser Ala 20 25 30 Ile Gln Ser Asp Gly Phe Lys Ser Leu Asp Glu Gly Gln Lys Val Ser 35 40 45 Phe Asp Val Glu Gln Gly Ala Arg Gly Ala Gln Ala Ala Asn Val Gln 50 55 60 Lys Ala 65 <210> SEQ ID NO 46 <211> LENGTH: 201 <212> TYPE: DNA <213> ORGANISM: Bacillus subtilis <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (1)..(201) <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: L77246 <309> DATABASE ENTRY DATE: 2001-12-14 <313> RELEVANT RESIDUES IN SEQ ID NO: (1)..(201) <400> SEQUENCE: 46 atg caa aac ggt aaa gta aaa tgg ttc aac aac gaa aaa gga ttc ggc 48 Met Gln Asn Gly Lys Val Lys Trp Phe Asn Asn Glu Lys Gly Phe Gly 1 5 10 15 ttc att gaa gtt gaa ggc gga gac gat gta ttt gtt cac ttc aca gct 96 Phe Ile Glu Val Glu Gly Gly Asp Asp Val Phe Val His Phe Thr Ala 20 25 30 atc gaa gga gat gga tac aaa tca tta gaa gaa gga caa gaa gtt tct 144 Ile Glu Gly Asp Gly Tyr Lys Ser Leu Glu Glu Gly Gln Glu Val Ser 35 40 45 ttt gaa att gtc gaa ggt aat cgt gga cct caa gct tct aat gtt gta 192 Phe Glu Ile Val Glu Gly Asn Arg Gly Pro Gln Ala Ser Asn Val Val 50 55 60 aaa ctc taa 201 Lys Leu 65 <210> SEQ ID NO 47 <211> LENGTH: 66 <212> TYPE: PRT <213> ORGANISM: Bacillus subtilis <400> SEQUENCE: 47 Met Gln Asn Gly Lys Val Lys Trp Phe Asn Asn Glu Lys Gly Phe Gly 1 5 10 15 Phe Ile Glu Val Glu Gly Gly Asp Asp Val Phe Val His Phe Thr Ala 20 25 30 Ile Glu Gly Asp Gly Tyr Lys Ser Leu Glu Glu Gly Gln Glu Val Ser 35 40 45 Phe Glu Ile Val Glu Gly Asn Arg Gly Pro Gln Ala Ser Asn Val Val 50 55 60 Lys Leu 65 <210> SEQ ID NO 48 <211> LENGTH: 198 <212> TYPE: DNA <213> ORGANISM: Bacillus halodurans <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (1)..(198) <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: AP001519 <309> DATABASE ENTRY DATE: 2001-01-10 <313> RELEVANT RESIDUES IN SEQ ID NO: (1)..(198) <400> SEQUENCE: 48 atg caa gga aaa gta aaa tgg ttt aac gca gaa aaa ggt ttc ggt ttt 48 Met Gln Gly Lys Val Lys Trp Phe Asn Ala Glu Lys Gly Phe Gly Phe 1 5 10 15 atc gag cgc gaa gat ggt gac gat gta ttt gtt cat ttc tct gcc att 96 Ile Glu Arg Glu Asp Gly Asp Asp Val Phe Val His Phe Ser Ala Ile 20 25 30 aac aca gac ggt ttc aaa aca tta gac gaa ggt caa tct gtt gag ttt 144 Asn Thr Asp Gly Phe Lys Thr Leu Asp Glu Gly Gln Ser Val Glu Phe 35 40 45 gat atc gtt gaa gga gct cgc gga cct caa gct gcg aac gtc act aag 192 Asp Ile Val Glu Gly Ala Arg Gly Pro Gln Ala Ala Asn Val Thr Lys 50 55 60 ctt taa 198 Leu 65 <210> SEQ ID NO 49 <211> LENGTH: 65 <212> TYPE: PRT <213> ORGANISM: Bacillus halodurans <400> SEQUENCE: 49 Met Gln Gly Lys Val Lys Trp Phe Asn Ala Glu Lys Gly Phe Gly Phe 1 5 10 15 Ile Glu Arg Glu Asp Gly Asp Asp Val Phe Val His Phe Ser Ala Ile 20 25 30 Asn Thr Asp Gly Phe Lys Thr Leu Asp Glu Gly Gln Ser Val Glu Phe 35 40 45 Asp Ile Val Glu Gly Ala Arg Gly Pro Gln Ala Ala Asn Val Thr Lys 50 55 60 Leu 65 <210> SEQ ID NO 50 <211> LENGTH: 204 <212> TYPE: DNA <213> ORGANISM: Corynebacterium glutamicum <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (1)..(204) <400> SEQUENCE: 50 atg gca cag ggt act gtg aaa tgg ttc aac ggc gaa aag gga ttt ggt 48 Met Ala Gln Gly Thr Val Lys Trp Phe Asn Gly Glu Lys Gly Phe Gly 1 5 10 15 ttc atc gct ccc aac gat ggc tcc gca gat ctc ttc gtc cac tac tct 96 Phe Ile Ala Pro Asn Asp Gly Ser Ala Asp Leu Phe Val His Tyr Ser 20 25 30 gag att cag ggc tcc ggt ttc cgt aat ctt gag gaa aac cag cca gtt 144 Glu Ile Gln Gly Ser Gly Phe Arg Asn Leu Glu Glu Asn Gln Pro Val 35 40 45 gaa ttt gag gtc ggc gag ggc gcc aag ggc cca cag gct cag cag gtt 192 Glu Phe Glu Val Gly Glu Gly Ala Lys Gly Pro Gln Ala Gln Gln Val 50 55 60 cgt gct ctc taa 204 Arg Ala Leu 65 <210> SEQ ID NO 51 <211> LENGTH: 67 <212> TYPE: PRT <213> ORGANISM: Corynebacterium glutamicum <400> SEQUENCE: 51 Met Ala Gln Gly Thr Val Lys Trp Phe Asn Gly Glu Lys Gly Phe Gly 1 5 10 15 Phe Ile Ala Pro Asn Asp Gly Ser Ala Asp Leu Phe Val His Tyr Ser 20 25 30 Glu Ile Gln Gly Ser Gly Phe Arg Asn Leu Glu Glu Asn Gln Pro Val 35 40 45 Glu Phe Glu Val Gly Glu Gly Ala Lys Gly Pro Gln Ala Gln Gln Val 50 55 60 Arg Ala Leu 65 <210> SEQ ID NO 52 <211> LENGTH: 384 <212> TYPE: DNA <213> ORGANISM: Corynebacterium glutamicum <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (1)..(384) <400> SEQUENCE: 52 atg cct gtc gga aca gtg aag tgg tac gac gcg gag cgt ggt ttc ggc 48 Met Pro Val Gly Thr Val Lys Trp Tyr Asp Ala Glu Arg Gly Phe Gly 1 5 10 15 ttt gtc tcc aat cca ggt ggt gaa gat tgc ttc gta ggt aag caa gta 96 Phe Val Ser Asn Pro Gly Gly Glu Asp Cys Phe Val Gly Lys Gln Val 20 25 30 ctt ccc aag gga gtc acc gaa ttg cac aag gga cag cga atc gat ttt 144 Leu Pro Lys Gly Val Thr Glu Leu His Lys Gly Gln Arg Ile Asp Phe 35 40 45 gac ttc gcc gca ggc cgt aag ggc cct caa gca ctt cga ata aag att 192 Asp Phe Ala Ala Gly Arg Lys Gly Pro Gln Ala Leu Arg Ile Lys Ile 50 55 60 ctt gaa act cca cgc agg cgt cca cag cac aaa tac aag cca gaa gag 240 Leu Glu Thr Pro Arg Arg Arg Pro Gln His Lys Tyr Lys Pro Glu Glu 65 70 75 80 ctc aac gga atg atc tct gac ctc atc acg ctt cta gaa agt gga gtg 288 Leu Asn Gly Met Ile Ser Asp Leu Ile Thr Leu Leu Glu Ser Gly Val 85 90 95 caa cca ggc ctt gcc aaa ggg caa tac ccg gag cac aaa gct gga gcg 336 Gln Pro Gly Leu Ala Lys Gly Gln Tyr Pro Glu His Lys Ala Gly Ala 100 105 110 cag gta gca gaa att ctt cgc gtt gtt gcg aag gag ctt gag tct taa 384 Gln Val Ala Glu Ile Leu Arg Val Val Ala Lys Glu Leu Glu Ser 115 120 125 <210> SEQ ID NO 53 <211> LENGTH: 127 <212> TYPE: PRT <213> ORGANISM: Corynebacterium glutamicum <400> SEQUENCE: 53 Met Pro Val Gly Thr Val Lys Trp Tyr Asp Ala Glu Arg Gly Phe Gly 1 5 10 15 Phe Val Ser Asn Pro Gly Gly Glu Asp Cys Phe Val Gly Lys Gln Val 20 25 30 Leu Pro Lys Gly Val Thr Glu Leu His Lys Gly Gln Arg Ile Asp Phe 35 40 45 Asp Phe Ala Ala Gly Arg Lys Gly Pro Gln Ala Leu Arg Ile Lys Ile 50 55 60 Leu Glu Thr Pro Arg Arg Arg Pro Gln His Lys Tyr Lys Pro Glu Glu 65 70 75 80 Leu Asn Gly Met Ile Ser Asp Leu Ile Thr Leu Leu Glu Ser Gly Val 85 90 95 Gln Pro Gly Leu Ala Lys Gly Gln Tyr Pro Glu His Lys Ala Gly Ala 100 105 110 Gln Val Ala Glu Ile Leu Arg Val Val Ala Lys Glu Leu Glu Ser 115 120 125 <210> SEQ ID NO 54 <211> LENGTH: 249 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: somewhat like E. coli CspA <400> SEQUENCE: 54 atggccggta aaatgactgg tatcgtaaaa tggttcaacg ctgacaaagg cttcggcttc 60 atcactcctg acgatggctc taaagatgtg ttcgtacact tctctgctat ccagaacgat 120 ggttacaaat ctctggacga aggtcagaaa gtgtccttca ccatcgaaag cggcgctaaa 180 ggcccggcag ctggtaacgt aaccagcctg aattcctcga gcgattacaa ggatgatgat 240 gataagtaa 249 <210> SEQ ID NO 55 <211> LENGTH: 82 <212> TYPE: PRT <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: E. coli CspA-like <400> SEQUENCE: 55 Met Ala Gly Lys Met Thr Gly Ile Val Lys Trp Phe Asn Ala Asp Lys 1 5 10 15 Gly Phe Gly Phe Ile Thr Pro Asp Asp Gly Ser Lys Asp Val Phe Val 20 25 30 His Phe Ser Ala Ile Gln Asn Asp Gly Tyr Lys Ser Leu Asp Glu Gly 35 40 45 Gln Lys Val Ser Phe Thr Ile Glu Ser Gly Ala Lys Gly Pro Ala Ala 50 55 60 Gly Asn Val Thr Ser Leu Asn Ser Ser Ser Asp Tyr Lys Asp Asp Asp 65 70 75 80 Asp Lys <210> SEQ ID NO 56 <211> LENGTH: 225 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: E. coli CspA-like <400> SEQUENCE: 56 atggccggta aaatgactgg tatcgtaaaa tggttcaacg ctgacaaagg cttcggcttc 60 atcactcctg acgatggctc taaagatgtg ttcgtacact tctctgctat ccagaacgat 120 ggttacaaat ctctggacga aggtcagaaa gtgtccttca ccatcgaaag cggcgctaaa 180 ggcccggcag ctggtaacgt aaccagcctg aattcctcga cctag 225 <210> SEQ ID NO 57 <211> LENGTH: 74 <212> TYPE: PRT <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: E. coli CspA-like protien <400> SEQUENCE: 57 Met Ala Gly Lys Met Thr Gly Ile Val Lys Trp Phe Asn Ala Asp Lys 1 5 10 15 Gly Phe Gly Phe Ile Thr Pro Asp Asp Gly Ser Lys Asp Val Phe Val 20 25 30 His Phe Ser Ala Ile Gln Asn Asp Gly Tyr Lys Ser Leu Asp Glu Gly 35 40 45 Gln Lys Val Ser Phe Thr Ile Glu Ser Gly Ala Lys Gly Pro Ala Ala 50 55 60 Gly Asn Val Thr Ser Leu Asn Ser Ser Thr 65 70 <210> SEQ ID NO 58 <211> LENGTH: 240 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: B. subtilis CspB-like <400> SEQUENCE: 58 atggtagaag gtaaagtaaa atggttcaac tctgaaaaag gtttcggatt catcgaagta 60 gaaggtcaag acgatgtatt cgttcatttc tctgctattc aaggcgaagg cttcaaaact 120 ttagaagaag gccaagctgt ttcttttgaa atcgttgaag gaaaccgcgg accacaagct 180 gctaacgtta ctaaagaagc gaattcctcg agcgattaca aggatgatga tgataagtaa 240 <210> SEQ ID NO 59 <211> LENGTH: 79 <212> TYPE: PRT <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: B. subtilis CspB-like <400> SEQUENCE: 59 Met Val Glu Gly Lys Val Lys Trp Phe Asn Ser Glu Lys Gly Phe Gly 1 5 10 15 Phe Ile Glu Val Glu Gly Gln Asp Asp Val Phe Val His Phe Ser Ala 20 25 30 Ile Gln Gly Glu Gly Phe Lys Thr Leu Glu Glu Gly Gln Ala Val Ser 35 40 45 Phe Glu Ile Val Glu Gly Asn Arg Gly Pro Gln Ala Ala Asn Val Thr 50 55 60 Lys Glu Ala Asn Ser Ser Ser Asp Tyr Lys Asp Asp Asp Asp Lys 65 70 75 <210> SEQ ID NO 60 <211> LENGTH: 216 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: B. subtilis CspB-like <400> SEQUENCE: 60 atggtagaag gtaaagtaaa atggttcaac tctgaaaaag gtttcggatt catcgaagta 60 gaaggtcaag acgatgtatt cgttcatttc tctgctattc aaggcgaagg cttcaaaact 120 ttagaagaag gccaagctgt ttcttttgaa atcgttgaag gaaaccgcgg accacaagct 180 gctaacgtta ctaaagaagc gaattcctcg acctag 216 <210> SEQ ID NO 61 <211> LENGTH: 71 <212> TYPE: PRT <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: B. subtilis CspB-like <400> SEQUENCE: 61 Met Val Glu Gly Lys Val Lys Trp Phe Asn Ser Glu Lys Gly Phe Gly 1 5 10 15 Phe Ile Glu Val Glu Gly Gln Asp Asp Val Phe Val His Phe Ser Ala 20 25 30 Ile Gln Gly Glu Gly Phe Lys Thr Leu Glu Glu Gly Gln Ala Val Ser 35 40 45 Phe Glu Ile Val Glu Gly Asn Arg Gly Pro Gln Ala Ala Asn Val Thr 50 55 60 Lys Glu Ala Asn Ser Ser Thr 65 70 <210> SEQ ID NO 62 <211> LENGTH: 213 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: E. coli CspA-like <400> SEQUENCE: 62 atggccggta aaatgactgg tatcgtaaaa tggttcaacg ctgacaaagg cttcggcttc 60 atcactcctg acgatggctc taaagatgtg ttcgtacact tctctgctat ccagaacgat 120 ggttacaaat ctctggacga aggtcagaaa gtgtccttca ccatcgaaag cggcgctaaa 180 ggcccggcag ctggtaacgt aaccagcctg tga 213 <210> SEQ ID NO 63 <211> LENGTH: 70 <212> TYPE: PRT <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: CspA-like protein <400> SEQUENCE: 63 Met Ala Gly Lys Met Thr Gly Ile Val Lys Trp Phe Asn Ala Asp Lys 1 5 10 15 Gly Phe Gly Phe Ile Thr Pro Asp Asp Gly Ser Lys Asp Val Phe Val 20 25 30 His Phe Ser Ala Ile Gln Asn Asp Gly Tyr Lys Ser Leu Asp Glu Gly 35 40 45 Gln Lys Val Ser Phe Thr Ile Glu Ser Gly Ala Lys Gly Pro Ala Ala 50 55 60 Gly Asn Val Thr Ser Leu 65 70 <210> SEQ ID NO 64 <211> LENGTH: 204 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: B. subtilis CspB-like <400> SEQUENCE: 64 atggtagaag gtaaagtaaa atggttcaac tctgaaaaag gtttcggatt catcgaagta 60 gaaggtcaag acgatgtatt cgttcatttc tctgctattc aaggcgaagg cttcaaaact 120 ttagaagaag gccaagctgt ttcttttgaa atcgttgaag gaaaccgcgg accacaagct 180 gctaacgtta ctaaagaagc gtga 204 <210> SEQ ID NO 65 <211> LENGTH: 67 <212> TYPE: PRT <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: B. subtilis CspB-like <400> SEQUENCE: 65 Met Val Glu Gly Lys Val Lys Trp Phe Asn Ser Glu Lys Gly Phe Gly 1 5 10 15 Phe Ile Glu Val Glu Gly Gln Asp Asp Val Phe Val His Phe Ser Ala 20 25 30 Ile Gln Gly Glu Gly Phe Lys Thr Leu Glu Glu Gly Gln Ala Val Ser 35 40 45 Phe Glu Ile Val Glu Gly Asn Arg Gly Pro Gln Ala Ala Asn Val Thr 50 55 60 Lys Glu Ala 65 <210> SEQ ID NO 66 <211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Primer for PCR <400> SEQUENCE: 66 aggtaataca ccatggccgg taa 23 <210> SEQ ID NO 67 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Primer for PCR <400> SEQUENCE: 67 ttaagcagag aattcaggct ggtt 24 <210> SEQ ID NO 68 <211> LENGTH: 7 <212> TYPE: PRT <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Flag tag for epitope tagging <400> SEQUENCE: 68 Asp Tyr Lys Asp Asp Asp Lys 1 5 <210> SEQ ID NO 69 <211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: PCR primer <400> SEQUENCE: 69 aggaggaaat tccatggtag aag 23 <210> SEQ ID NO 70 <211> LENGTH: 26 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: PCR primer <400> SEQUENCE: 70 tcaatttatg aattcgcttc tttagt 26 <210> SEQ ID NO 71 <211> LENGTH: 27 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: PCR primer <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (27)..(27) <223> OTHER INFORMATION: n=a,c,t, or g <400> SEQUENCE: 71 gggcactttg tacaagaaag ctgggtn 27 <210> SEQ ID NO 72 <211> LENGTH: 28 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: PCR primer <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (28)..(28) <223> OTHER INFORMATION: n=a,c,t, or g <400> SEQUENCE: 72 ggggcacttt gtacaagaaa gctgggtn 28 <210> SEQ ID NO 73 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: PCR primer <400> SEQUENCE: 73 cctgcaggac catg 14 <210> SEQ ID NO 74 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: PCR primer <400> SEQUENCE: 74 cctgcaggct cgagcta 17 <210> SEQ ID NO 75 <211> LENGTH: 43 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: PCR primer <400> SEQUENCE: 75 ggggacaagt ttgtacaaaa aagcaggctc ctgcaggacc atg 43 <210> SEQ ID NO 76 <211> LENGTH: 47 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: PCR primer <400> SEQUENCE: 76 ggggaccact ttgtacaaga aagctgggtc cctgcaggct cgagcta 47 <210> SEQ ID NO 77 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: PCR primer <400> SEQUENCE: 77 ccccaccctg caatgtga 18 <210> SEQ ID NO 78 <211> LENGTH: 31 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: PCR primer <400> SEQUENCE: 78 tgtgcatcct tttatttcat acattaatta a 31 <210> SEQ ID NO 79 <211> LENGTH: 30 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: PCR primer <400> SEQUENCE: 79 cctagacttg tccatcttct ggattggcca 30 <210> SEQ ID NO 80 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: PCR primer <400> SEQUENCE: 80 gcctgccgca gaccaa 16 <210> SEQ ID NO 81 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: PCR primer <400> SEQUENCE: 81 atgcagagct cagcttcatc 20 <210> SEQ ID NO 82 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: PCR primer <400> SEQUENCE: 82 tccagtacgt gcagtccctc ctcc 24 <210> SEQ ID NO 83 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: PCR primer <400> SEQUENCE: 83 cgtctacaat cagaaggcgt aatc 24 <210> SEQ ID NO 84 <211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: PCR primer <400> SEQUENCE: 84 ccaacaggtg aatgcttgat agg 23 <210> SEQ ID NO 85 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: PCR primer <400> SEQUENCE: 85 catgcgccgc tttgcttc 18 <210> SEQ ID NO 86 <211> LENGTH: 52 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: PCR primer <400> SEQUENCE: 86 gcgcaggcct agatgtacca tgtccggtaa aatgactggt atcgtaaaat gg 52 <210> SEQ ID NO 87 <211> LENGTH: 46 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: PCR primer <400> SEQUENCE: 87 cgcgaattcg gatccttatt acaggctggt tacgttacca gctgcc 46 <210> SEQ ID NO 88 <211> LENGTH: 53 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: PCR primer <400> SEQUENCE: 88 gcgcaggcct agatgtacca tgttagaagg taaagtaaaa tggttcaact ctg 53 <210> SEQ ID NO 89 <211> LENGTH: 51 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: PCR primer <400> SEQUENCE: 89 cgcgaattcg gatccttatt acgcttcttt agtaacgtta gcagcttgtg g 51 <210> SEQ ID NO 90 <211> LENGTH: 204 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic codons optimizing CspB for plant expression <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (1)..(204) <400> SEQUENCE: 90 atg gtg gag ggc aag gtg aag tgg ttc aac tcc gag aag ggc ttc ggc 48 Met Val Glu Gly Lys Val Lys Trp Phe Asn Ser Glu Lys Gly Phe Gly 1 5 10 15 ttc atc gag gtg gag ggt caa gac gat gtg ttc gtc cac ttc tcc gcc 96 Phe Ile Glu Val Glu Gly Gln Asp Asp Val Phe Val His Phe Ser Ala 20 25 30 atc cag ggc gaa ggg ttc aag acc ctg gaa gag ggg cag gcc gtc tcc 144 Ile Gln Gly Glu Gly Phe Lys Thr Leu Glu Glu Gly Gln Ala Val Ser 35 40 45 ttc gag atc gtc gag gga aac cgc ggt ccg cag gcc gcg aac gtc acg 192 Phe Glu Ile Val Glu Gly Asn Arg Gly Pro Gln Ala Ala Asn Val Thr 50 55 60 aag gaa gcg tga 204 Lys Glu Ala 65 <210> SEQ ID NO 91 <211> LENGTH: 67 <212> TYPE: PRT <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 91 Met Val Glu Gly Lys Val Lys Trp Phe Asn Ser Glu Lys Gly Phe Gly 1 5 10 15 Phe Ile Glu Val Glu Gly Gln Asp Asp Val Phe Val His Phe Ser Ala 20 25 30 Ile Gln Gly Glu Gly Phe Lys Thr Leu Glu Glu Gly Gln Ala Val Ser 35 40 45 Phe Glu Ile Val Glu Gly Asn Arg Gly Pro Gln Ala Ala Asn Val Thr 50 55 60 Lys Glu Ala 65 <210> SEQ ID NO 92 <211> LENGTH: 213 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic codons encoding CspA <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (1)..(213) <400> SEQUENCE: 92 atg gcc ggc aag atg acc ggc atc gtg aag tgg ttc aac gct gac aag 48 Met Ala Gly Lys Met Thr Gly Ile Val Lys Trp Phe Asn Ala Asp Lys 1 5 10 15 ggc ttc ggc ttc atc acg ccg gac gac ggc agc aag gat gtc ttc gtg 96 Gly Phe Gly Phe Ile Thr Pro Asp Asp Gly Ser Lys Asp Val Phe Val 20 25 30 cac ttc tcc gcc atc cag aac gac ggc tac aag tcc ctc gac gag ggc 144 His Phe Ser Ala Ile Gln Asn Asp Gly Tyr Lys Ser Leu Asp Glu Gly 35 40 45 cag aag gtc agc ttc acc atc gag agc ggc gcc aaa ggc ccg gcc gcc 192 Gln Lys Val Ser Phe Thr Ile Glu Ser Gly Ala Lys Gly Pro Ala Ala 50 55 60 ggt aac gtc acg tcg ctg tga 213 Gly Asn Val Thr Ser Leu 65 70 <210> SEQ ID NO 93 <211> LENGTH: 70 <212> TYPE: PRT <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 93 Met Ala Gly Lys Met Thr Gly Ile Val Lys Trp Phe Asn Ala Asp Lys 1 5 10 15 Gly Phe Gly Phe Ile Thr Pro Asp Asp Gly Ser Lys Asp Val Phe Val 20 25 30 His Phe Ser Ala Ile Gln Asn Asp Gly Tyr Lys Ser Leu Asp Glu Gly 35 40 45 Gln Lys Val Ser Phe Thr Ile Glu Ser Gly Ala Lys Gly Pro Ala Ala 50 55 60 Gly Asn Val Thr Ser Leu 65 70 <210> SEQ ID NO 94 <211> LENGTH: 201 <212> TYPE: DNA <213> ORGANISM: Bacillus thuringiensis <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (1)..(201) <400> SEQUENCE: 94 atg caa aca ggt aaa gtt aaa tgg ttc aac agc gaa aaa ggt ttc ggt 48 Met Gln Thr Gly Lys Val Lys Trp Phe Asn Ser Glu Lys Gly Phe Gly 1 5 10 15 ttc atc gaa gtt gaa ggt gga gac gat gta ttc gtt cac ttc tca gct 96 Phe Ile Glu Val Glu Gly Gly Asp Asp Val Phe Val His Phe Ser Ala 20 25 30 atc caa ggt gac gga ttc aaa act tta gaa gaa ggt caa gaa gtt tct 144 Ile Gln Gly Asp Gly Phe Lys Thr Leu Glu Glu Gly Gln Glu Val Ser 35 40 45 ttc gaa atc gtt gaa ggt aac cgt gga cca caa gct gct aac gtt aca 192 Phe Glu Ile Val Glu Gly Asn Arg Gly Pro Gln Ala Ala Asn Val Thr 50 55 60 aaa aac taa 201 Lys Asn 65 <210> SEQ ID NO 95 <211> LENGTH: 66 <212> TYPE: PRT <213> ORGANISM: Bacillus thuringiensis <400> SEQUENCE: 95 Met Gln Thr Gly Lys Val Lys Trp Phe Asn Ser Glu Lys Gly Phe Gly 1 5 10 15 Phe Ile Glu Val Glu Gly Gly Asp Asp Val Phe Val His Phe Ser Ala 20 25 30 Ile Gln Gly Asp Gly Phe Lys Thr Leu Glu Glu Gly Gln Glu Val Ser 35 40 45 Phe Glu Ile Val Glu Gly Asn Arg Gly Pro Gln Ala Ala Asn Val Thr 50 55 60 Lys Asn 65

1 SEQUENCE LISTING <160> NUMBER OF SEQ ID NOS: 95 <210> SEQ ID NO 1 <211> LENGTH: 70 <212> TYPE: PRT <213> ORGANISM: Escherichia coli <300> PUBLICATION INFORMATION: <301> AUTHORS: Goldstein, et al <302> TITLE: Major cold shock protein of Escherichia coli <303> JOURNAL: Proceedings of the National Academy of Sciences (USA) <304> VOLUME: 87 <305> ISSUE: 1 <306> PAGES: 283-287 <307> DATE: 1990-01-01 <308> DATABASE ACCESSION NUMBER: M30139 <309> DATABASE ENTRY DATE: 1993-10-20 <313> RELEVANT RESIDUES IN SEQ ID NO: (1)..(70) <400> SEQUENCE: 1 Met Ser Gly Lys Met Thr Gly Ile Val Lys Trp Phe Asn Ala Asp Lys 1 5 10 15 Gly Phe Gly Phe Ile Thr Pro Asp Asp Gly Ser Lys Asp Val Phe Val 20 25 30 His Phe Ser Ala Ile Gln Asn Asp Gly Tyr Lys Ser Leu Asp Glu Gly 35 40 45 Gln Lys Val Ser Phe Thr Ile Glu Ser Gly Ala Lys Gly Pro Ala Ala 50 55 60 Gly Asn Val Thr Ser Leu 65 70 <210> SEQ ID NO 2 <211> LENGTH: 67 <212> TYPE: PRT <213> ORGANISM: Bacillus subtilis <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: X59715 <309> DATABASE ENTRY DATE: 1996-03-29 <313> RELEVANT RESIDUES IN SEQ ID NO: (1)..(67) <400> SEQUENCE: 2 Met Leu Glu Gly Lys Val Lys Trp Phe Asn Ser Glu Lys Gly Phe Gly 1 5 10 15 Phe Ile Glu Val Glu Gly Gln Asp Asp Val Phe Val His Phe Ser Ala 20 25 30 Ile Gln Gly Glu Gly Phe Lys Thr Leu Glu Glu Gly Gln Ala Val Ser 35 40 45 Phe Glu Ile Val Glu Gly Asn Arg Gly Pro Gln Ala Ala Asn Val Thr 50 55 60 Lys Glu Ala 65 <210> SEQ ID NO 3 <211> LENGTH: 20 <212> TYPE: PRT <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Prosite motif PS00352 <220> FEATURE: <221> NAME/KEY: MISC_FEATURE <222> LOCATION: (1)..(1) <223> OTHER INFORMATION: Xaa is phe or tyr <220> FEATURE: <221> NAME/KEY: MISC_FEATURE <222> LOCATION: (5)..(11) <223> OTHER INFORMATION: Xaa is any amino acid and (11) may or may not be present <220> FEATURE: <221> NAME/KEY: MISC_FEATURE <222> LOCATION: (12)..(12) <223> OTHER INFORMATION: Xaa is asp, glu, or arg <220> FEATURE: <221> NAME/KEY: MISC_FEATURE <222> LOCATION: (13)..(13) <223> OTHER INFORMATION: Xaa is leu, ile, val, or met <220> FEATURE: <221> NAME/KEY: MISC_FEATURE <222> LOCATION: (15)..(15) <223> OTHER INFORMATION: Xaa is any amino acid <220> FEATURE: <221> NAME/KEY: MISC_FEATURE <222> LOCATION: (17)..(17) <223> OTHER INFORMATION: Xaa is any amino acid <220> FEATURE: <221> NAME/KEY: MISC_FEATURE <222> LOCATION: (18)..(18) <223> OTHER INFORMATION: Xaa is ser, thr, lys, or arg <220> FEATURE: <221> NAME/KEY: MISC_FEATURE <222> LOCATION: (19)..(19) <223> OTHER INFORMATION: Xaa is any amino acid <220> FEATURE: <221> NAME/KEY: MISC_FEATURE <222> LOCATION: (20)..(20) <223> OTHER INFORMATION: Xaa is leu, ile, val, met, phe, or tyr <400> SEQUENCE: 3 Xaa Gly Phe Ile Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Phe Xaa His 1 5 10 15 Xaa Xaa Xaa Xaa 20 <210> SEQ ID NO 4 <211> LENGTH: 545 <212> TYPE: DNA <213> ORGANISM: Glycine max <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (61)..(354) <400> SEQUENCE: 4 attcggctcg aggaccttag aaagagaagg aaaaaaaaaa cttgtgtttc ttgggaagcc 60 atg agc acc acc gag agt caa aga tat aag ggc aca gtg aaa tgg ttc 108 Met Ser Thr Thr Glu Ser Gln Arg Tyr Lys Gly Thr Val Lys Trp Phe 1 5 10 15 aac gag gag aag ggt ttc ggt ttc ata act ccc gaa gat ggt ggc tct 156 Asn Glu Glu Lys Gly Phe Gly Phe Ile Thr Pro Glu Asp Gly Gly Ser 20 25 30 gat ctc ttc gtt cac tac agt gcg atc caa acc gac ggc ggc ttc cgc 204 Asp Leu Phe Val His Tyr Ser Ala Ile Gln Thr Asp Gly Gly Phe Arg 35 40 45 acc ttg tcg gag ggt cag tca gta gag ttc ctc gtc act cag gac gac 252 Thr Leu Ser Glu Gly Gln Ser Val Glu Phe Leu Val Thr Gln Asp Asp 50 55 60 agc ggg cga gcc gcg gcc gtc aac gtg acg acc acc acg gtt aaa tct 300 Ser Gly Arg Ala Ala Ala Val Asn Val Thr Thr Thr Thr Val Lys Ser 65 70 75 80 agt gac agc ggt aac ggg gaa aac tct ggt ggt gat gct gcc aat gtt 348 Ser Asp Ser Gly Asn Gly Glu Asn Ser Gly Gly Asp Ala Ala Asn Val 85 90 95 gag aaa taagtgagaa tgaattattg gagtttcctg aattgcgagt atgatattta 404 Glu Lys tattgatagt tggacaatat actagtccat tggtatttta tattttatta tattatctct 464 ggttattggc atttggttcc aaacttgtaa tacatttatc atgtgtttaa cgtggttatg 524 tagtaagttg ttggatgtgt c 545 <210> SEQ ID NO 5 <211> LENGTH: 98 <212> TYPE: PRT <213> ORGANISM: Glycine max <400> SEQUENCE: 5 Met Ser Thr Thr Glu Ser Gln Arg Tyr Lys Gly Thr Val Lys Trp Phe 1 5 10 15 Asn Glu Glu Lys Gly Phe Gly Phe Ile Thr Pro Glu Asp Gly Gly Ser 20 25 30 Asp Leu Phe Val His Tyr Ser Ala Ile Gln Thr Asp Gly Gly Phe Arg 35 40 45 Thr Leu Ser Glu Gly Gln Ser Val Glu Phe Leu Val Thr Gln Asp Asp 50 55 60 Ser Gly Arg Ala Ala Ala Val Asn Val Thr Thr Thr Thr Val Lys Ser 65 70 75 80 Ser Asp Ser Gly Asn Gly Glu Asn Ser Gly Gly Asp Ala Ala Asn Val 85 90 95 Glu Lys <210> SEQ ID NO 6 <211> LENGTH: 255 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: somewhat similar to E. coli CspA <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (1)..(252) <400> SEQUENCE: 6 atg gcc ggt aaa atg act ggt atc gta aaa tgg ttc aac gct gac aaa 48 Met Ala Gly Lys Met Thr Gly Ile Val Lys Trp Phe Asn Ala Asp Lys 1 5 10 15 ggc ttc ggc ttc atc act cct gac gat ggc tct aaa gat gtg ttc gta 96 Gly Phe Gly Phe Ile Thr Pro Asp Asp Gly Ser Lys Asp Val Phe Val 20 25 30 cac ttc tct gct atc cag aac gat ggt tac aaa tct ctg gac gaa ggt 144 His Phe Ser Ala Ile Gln Asn Asp Gly Tyr Lys Ser Leu Asp Glu Gly 35 40 45 cag aaa gtg tcc ttc acc atc gaa agc ggc gct aaa ggc ccg gca gct 192 Gln Lys Val Ser Phe Thr Ile Glu Ser Gly Ala Lys Gly Pro Ala Ala 50 55 60 ggt aac gta acc agc ctg aat tct cga gcg att aca agg atg atg ata 240 Gly Asn Val Thr Ser Leu Asn Ser Arg Ala Ile Thr Arg Met Met Ile 65 70 75 80 agt aag tcg acc tag 255 Ser Lys Ser Thr <210> SEQ ID NO 7 <211> LENGTH: 84 <212> TYPE: PRT <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 7 Met Ala Gly Lys Met Thr Gly Ile Val Lys Trp Phe Asn Ala Asp Lys 1 5 10 15 Gly Phe Gly Phe Ile Thr Pro Asp Asp Gly Ser Lys Asp Val Phe Val 20 25 30 His Phe Ser Ala Ile Gln Asn Asp Gly Tyr Lys Ser Leu Asp Glu Gly 35 40 45

Gln Lys Val Ser Phe Thr Ile Glu Ser Gly Ala Lys Gly Pro Ala Ala 50 55 60 Gly Asn Val Thr Ser Leu Asn Ser Arg Ala Ile Thr Arg Met Met Ile 65 70 75 80 Ser Lys Ser Thr <210> SEQ ID NO 8 <211> LENGTH: 246 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Somewhat similar to B. subtilis CspB <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (1)..(243) <400> SEQUENCE: 8 atg gta gaa ggt aaa gta aaa tgg ttc aac tct gaa aaa ggt ttc gga 48 Met Val Glu Gly Lys Val Lys Trp Phe Asn Ser Glu Lys Gly Phe Gly 1 5 10 15 ttc atc gaa gta gaa ggt caa gac gat gta ttc gtt cat ttc tct gct 96 Phe Ile Glu Val Glu Gly Gln Asp Asp Val Phe Val His Phe Ser Ala 20 25 30 att caa ggc gaa ggc ttc aaa act tta gaa gaa ggc caa gct gtt tct 144 Ile Gln Gly Glu Gly Phe Lys Thr Leu Glu Glu Gly Gln Ala Val Ser 35 40 45 ttt gaa atc gtt gaa gga aac cgc gga cca caa gct gct aac gtt act 192 Phe Glu Ile Val Glu Gly Asn Arg Gly Pro Gln Ala Ala Asn Val Thr 50 55 60 aaa gaa gcg aat tct cga gcg att aca agg atg atg ata agt aag tcg 240 Lys Glu Ala Asn Ser Arg Ala Ile Thr Arg Met Met Ile Ser Lys Ser 65 70 75 80 acc tag 246 Thr <210> SEQ ID NO 9 <211> LENGTH: 81 <212> TYPE: PRT <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 9 Met Val Glu Gly Lys Val Lys Trp Phe Asn Ser Glu Lys Gly Phe Gly 1 5 10 15 Phe Ile Glu Val Glu Gly Gln Asp Asp Val Phe Val His Phe Ser Ala 20 25 30 Ile Gln Gly Glu Gly Phe Lys Thr Leu Glu Glu Gly Gln Ala Val Ser 35 40 45 Phe Glu Ile Val Glu Gly Asn Arg Gly Pro Gln Ala Ala Asn Val Thr 50 55 60 Lys Glu Ala Asn Ser Arg Ala Ile Thr Arg Met Met Ile Ser Lys Ser 65 70 75 80 Thr <210> SEQ ID NO 10 <211> LENGTH: 877 <212> TYPE: DNA <213> ORGANISM: Escherichia coli <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (528)..(743) <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: L28429 <309> DATABASE ENTRY DATE: 1994-05-04 <313> RELEVANT RESIDUES IN SEQ ID NO: (1)..(877) <400> SEQUENCE: 10 agctttaata tagctcatga aaggtaaaca ttggcagctg aagggccacg cagaccattt 60 atccggcaaa attccacgcg taatccggtg gtaatttctt ctgcatcgcg gagattgagc 120 gctgaaacat gaagctggac atcgatacga ccatcggatg gggtgataag acccttgccg 180 cttttgccgt caaaggtttt gacaattcct gtcattttac gggacaaaaa aattccttaa 240 tactgataac ttggcgcact atacacacgt tcctgaagaa agctatagtt ttttgatggg 300 gttgaagatg gctggatgtc taaaataaac attgcttcat atgttcaact atgcgttaat 360 gattgcgtcg gtttgaagaa cagacgatat acgaagtagt ttactaaagc agttctcatt 420 tcaggtgtta ttcacttatt ccttctttga gtctctccaa ttaagtacga agtcgtttct 480 gttatgcaaa ccatttatgc cgaaaggctc aagttaagga atgtaga atg tca aat 536 Met Ser Asn 1 aaa atg act ggt tta gta aaa tgg ttt aac gct gat aaa ggt ttc ggc 584 Lys Met Thr Gly Leu Val Lys Trp Phe Asn Ala Asp Lys Gly Phe Gly 5 10 15 ttt att tct cct gtt gat ggt agt aaa gat gtg ttt gtg cat ttt tct 632 Phe Ile Ser Pro Val Asp Gly Ser Lys Asp Val Phe Val His Phe Ser 20 25 30 35 gcg att cag aat gat aat tat cga acc tta ttt gaa ggt caa aag gtt 680 Ala Ile Gln Asn Asp Asn Tyr Arg Thr Leu Phe Glu Gly Gln Lys Val 40 45 50 acc ttc tct ata gag agt ggt gct aaa ggt cct gca gca gca aat gtc 728 Thr Phe Ser Ile Glu Ser Gly Ala Lys Gly Pro Ala Ala Ala Asn Val 55 60 65 atc att act gat taa aattcatcgc tcgtctgtat acgataacga agaaggctga 783 Ile Ile Thr Asp 70 tgcctgagta gagatacgga cagagtagtg aatattggat ctctttaata aaaagtaagg 843 aggtccaata catgaaacaa tggctagcat attt 877 <210> SEQ ID NO 11 <211> LENGTH: 71 <212> TYPE: PRT <213> ORGANISM: Escherichia coli <400> SEQUENCE: 11 Met Ser Asn Lys Met Thr Gly Leu Val Lys Trp Phe Asn Ala Asp Lys 1 5 10 15 Gly Phe Gly Phe Ile Ser Pro Val Asp Gly Ser Lys Asp Val Phe Val 20 25 30 His Phe Ser Ala Ile Gln Asn Asp Asn Tyr Arg Thr Leu Phe Glu Gly 35 40 45 Gln Lys Val Thr Phe Ser Ile Glu Ser Gly Ala Lys Gly Pro Ala Ala 50 55 60 Ala Asn Val Ile Ile Thr Asp 65 70 <210> SEQ ID NO 12 <211> LENGTH: 1601 <212> TYPE: DNA <213> ORGANISM: Escherichia coli <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (243)..(452) <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: D28496 <309> DATABASE ENTRY DATE: 1994-02-05 <313> RELEVANT RESIDUES IN SEQ ID NO: (1)..(1601) <400> SEQUENCE: 12 gatcgagaca tgtttaaaaa tggcttgcca taattaacgt tgtatgtgat aacagatttc 60 gggttaaacg aggtacagtt ctgtttatgt gtggcatttt cagtaaagaa gtcctgagta 120 aacacgttga cgttgaatac cgcttctctg ccgagcctta tattggtgcc tcatgcagta 180 atgtgtcagt tttatctatg ttatgcctgc gggcgaagaa aacaatctaa ggaatttttc 240 aa atg gca aag att aaa ggt cag gtt aag tgg ttc aac gag tct aaa 287 Met Ala Lys Ile Lys Gly Gln Val Lys Trp Phe Asn Glu Ser Lys 1 5 10 15 ggt ttt ggc ttc att act ccg gct gat ggc agc aaa gat gtg ttc gta 335 Gly Phe Gly Phe Ile Thr Pro Ala Asp Gly Ser Lys Asp Val Phe Val 20 25 30 cac ttc tcc gct atc cag ggt aat ggc ttc aaa act ctg gct gaa ggt 383 His Phe Ser Ala Ile Gln Gly Asn Gly Phe Lys Thr Leu Ala Glu Gly 35 40 45 cag aac gtt gag ttc gaa att cag gac ggc cag aaa ggt ccg gca gct 431 Gln Asn Val Glu Phe Glu Ile Gln Asp Gly Gln Lys Gly Pro Ala Ala 50 55 60 gtt aac gta aca gct atc tga tcgaatccac tgatctgaag tgtgaatacg 482 Val Asn Val Thr Ala Ile 65 cttcaatctc gctataaagc ctcgtcgaat gcgaggcttt ttactatgct ttatcttcgc 542 tcctggcgtt cggatatttg cccgccgcgt gattcgcgtt acacttgcgg cctttagtat 602 cctgccggag ttgtcatgtc tttttcctgt ccactttgcc atcagcctct ttcgcgtgaa 662 aaaaacagct atatctgtcc ccagcgacat cagtttgata tggcgaaaga agggtatgtc 722 aatctgctgc ccgttcagca taaacggtct cgtgatccgg gcgacagcgc ggaaatgatg 782 caagcacgcc gcgcattctt agatgccgga cattatcagc cgctgcgtga tgcaattgtc 842 gcccaactga gggaacggct tgatgataag gccacggcgg tgctggatat tggctgtggt 902 gaagggtatt acacacacgc atttgccgat gcgttgcccg aaatcaccac gtttggtctg 962 gatgtttcga aggtagcgat aaaagcggcg gcgaaacgct atccgcaggt cactttttgt 1022 gtcgcttcca gccaccgttt gccgttttcc gataccagta tggacgccat aatacgtatt 1082 tacgcgccgt gtaaagcaga agaattagca cgagtagtga agcccggcgg ctgggtcatt 1142 actgccacgc cgggaccgcg acatttgatg gagctgaagg ggctgattta caatgaagta 1202 catcttcatg cacctcatgc agaacaactg gaaggtttta cattacagca gagtgcggag 1262 ttgtgttatc cgatgcgtct tcgcggtgat gaagccgtcg cattattgca gatgacgccg 1322 tttgcctggc gtgcgaagcc agaagtctgg caaacactgg cagcaaaaga agtgttcgac 1382 tgccagacgg actttaatat tcacctctgg cagcgttctt attaaccgtg gaagtgcgtc 1442 cagaggatct ggacgccgat gccgatcagc accagcccgc cgagaatttc cgcttttttc 1502 ccaataattg agccgataaa gcgaccaacc atcatcccta atgttgacat aatcaaggtt 1562 gcacaaccaa tggccaatgc ggtcgcgata atgttgacc 1601 <210> SEQ ID NO 13 <211> LENGTH: 69 <212> TYPE: PRT <213> ORGANISM: Escherichia coli <400> SEQUENCE: 13 Met Ala Lys Ile Lys Gly Gln Val Lys Trp Phe Asn Glu Ser Lys Gly 1 5 10 15 Phe Gly Phe Ile Thr Pro Ala Asp Gly Ser Lys Asp Val Phe Val His 20 25 30 Phe Ser Ala Ile Gln Gly Asn Gly Phe Lys Thr Leu Ala Glu Gly Gln 35 40 45

Asn Val Glu Phe Glu Ile Gln Asp Gly Gln Lys Gly Pro Ala Ala Val 50 55 60 Asn Val Thr Ala Ile 65 <210> SEQ ID NO 14 <211> LENGTH: 351 <212> TYPE: DNA <213> ORGANISM: Escherichia coli <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (74)..(298) <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: P24245 <309> DATABASE ENTRY DATE: 1992-03-01 <313> RELEVANT RESIDUES IN SEQ ID NO: (1)..(351) <400> SEQUENCE: 14 ttttgaacag ccccctctct gaccccggtt tattccatct tacttgtata agatttgcga 60 aggatgtcga agc atg gaa aag ggt act gtt aag tgg ttc aac aat gcc 109 Met Glu Lys Gly Thr Val Lys Trp Phe Asn Asn Ala 1 5 10 aaa ggg ttt ggt ttc atc tgc cct gaa ggc ggc ggc gaa gat att ttc 157 Lys Gly Phe Gly Phe Ile Cys Pro Glu Gly Gly Gly Glu Asp Ile Phe 15 20 25 gct cat tat tcc acc att cag atg gat ggt tac aga acg cta aaa gct 205 Ala His Tyr Ser Thr Ile Gln Met Asp Gly Tyr Arg Thr Leu Lys Ala 30 35 40 gga caa tcc gtt cag ttt gat gtc cac cag ggg cca aaa ggc aat cac 253 Gly Gln Ser Val Gln Phe Asp Val His Gln Gly Pro Lys Gly Asn His 45 50 55 60 gcc agt gtt att gtg ccc gtc gaa gta gaa gcg gca gtc gca tag 298 Ala Ser Val Ile Val Pro Val Glu Val Glu Ala Ala Val Ala 65 70 ctcttctgtc tcattgtgta catcctaaag gcaaaatgcc agcccgatcg gct 351 <210> SEQ ID NO 15 <211> LENGTH: 74 <212> TYPE: PRT <213> ORGANISM: Escherichia coli <400> SEQUENCE: 15 Met Glu Lys Gly Thr Val Lys Trp Phe Asn Asn Ala Lys Gly Phe Gly 1 5 10 15 Phe Ile Cys Pro Glu Gly Gly Gly Glu Asp Ile Phe Ala His Tyr Ser 20 25 30 Thr Ile Gln Met Asp Gly Tyr Arg Thr Leu Lys Ala Gly Gln Ser Val 35 40 45 Gln Phe Asp Val His Gln Gly Pro Lys Gly Asn His Ala Ser Val Ile 50 55 60 Val Pro Val Glu Val Glu Ala Ala Val Ala 65 70 <210> SEQ ID NO 16 <211> LENGTH: 301 <212> TYPE: DNA <213> ORGANISM: Escherichia coli <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (62)..(259) <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: P39819 <309> DATABASE ENTRY DATE: 1995-02-01 <313> RELEVANT RESIDUES IN SEQ ID NO: (1)..(301) <400> SEQUENCE: 16 tcaggaacgt gtgtatagtg cgccaagtta tcagtattaa ggaatttttt tgtcccgtaa 60 a atg aca gga att gtc aaa acc ttt gac ggc aaa agc ggc aag ggt ctt 109 Met Thr Gly Ile Val Lys Thr Phe Asp Gly Lys Ser Gly Lys Gly Leu 1 5 10 15 atc acc cca tcc gat ggt cgt atc gat gtc cag ctt cat gtt tca gcg 157 Ile Thr Pro Ser Asp Gly Arg Ile Asp Val Gln Leu His Val Ser Ala 20 25 30 ctc aat ctc cgc gat gca gaa gaa att acc acc gga tta cgc gtg gaa 205 Leu Asn Leu Arg Asp Ala Glu Glu Ile Thr Thr Gly Leu Arg Val Glu 35 40 45 ttt tgc cgg ata aat ggt ctg cgt ggc cct tca gct gcc aat gtt tac 253 Phe Cys Arg Ile Asn Gly Leu Arg Gly Pro Ser Ala Ala Asn Val Tyr 50 55 60 ctt tca tgagctatat taaagcttta atttcaggcc ccatcggatc ac 301 Leu Ser 65 <210> SEQ ID NO 17 <211> LENGTH: 66 <212> TYPE: PRT <213> ORGANISM: Escherichia coli <400> SEQUENCE: 17 Met Thr Gly Ile Val Lys Thr Phe Asp Gly Lys Ser Gly Lys Gly Leu 1 5 10 15 Ile Thr Pro Ser Asp Gly Arg Ile Asp Val Gln Leu His Val Ser Ala 20 25 30 Leu Asn Leu Arg Asp Ala Glu Glu Ile Thr Thr Gly Leu Arg Val Glu 35 40 45 Phe Cys Arg Ile Asn Gly Leu Arg Gly Pro Ser Ala Ala Asn Val Tyr 50 55 60 Leu Ser 65 <210> SEQ ID NO 18 <211> LENGTH: 994 <212> TYPE: DNA <213> ORGANISM: Escherichia coli <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (560)..(772) <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: D63344 <309> DATABASE ENTRY DATE: 1999-02-13 <313> RELEVANT RESIDUES IN SEQ ID NO: (1)..(994) <400> SEQUENCE: 18 aaatgtatga tgtgactatt cactatccaa taaaccagtc agcttaaaca agcacgtcat 60 attaagagag ataaacattt gccgctgttg gtcctcgcag gccatttacg cggcaaaatt 120 ccacacgtaa tcctggtata agcacttctg cgtcgcgggg agtgaatgcg gaaatatgga 180 cctgaacttc tttacgaccg tcggagggga taatgaatcc tttgccgctt ttgcgatcaa 240 aggttttgac aattcctgtc attttacggg acaaacaaat tccttactga aaatactgcg 300 ctgcactata cggggttaat aaaataaagc cagcgatatt taagaccgcc ggacggctaa 360 aataaaattt gcttaatctc aattatcatg cgttaatagc tgcgtcggtt tgaaagacag 420 acagcataca aagtagttta ctaaagcagt tctcattatc aggcattatc cccttctttt 480 gagtctctct cctgaacact aagtagtttc tgtattaaag ccctgtttgc cgaaaggccc 540 aaaatgaagg aagtaaaat atg tct aat aaa atg act ggt tta gta aaa tgg 592 Met Ser Asn Lys Met Thr Gly Leu Val Lys Trp 1 5 10 ttt aac gca gat aaa ggt ttt ggc ttt atc act cct gat gat ggc agc 640 Phe Asn Ala Asp Lys Gly Phe Gly Phe Ile Thr Pro Asp Asp Gly Ser 15 20 25 aaa gac gtt ttc gtc cat ttc acc gcc atc cag agc aat gaa ttc cgc 688 Lys Asp Val Phe Val His Phe Thr Ala Ile Gln Ser Asn Glu Phe Arg 30 35 40 acg ctg aac gaa aat cag aaa gtt gaa ttt tct att gag cag ggg caa 736 Thr Leu Asn Glu Asn Gln Lys Val Glu Phe Ser Ile Glu Gln Gly Gln 45 50 55 cgt ggc ccc gcg gca gcg aac gtt gtt acg ctc taa ggttgccatt 782 Arg Gly Pro Ala Ala Ala Asn Val Val Thr Leu 60 65 70 attactcaac atctccattt ccgctgtcca tgttgtcatg gttcacagta ccgcacatcg 842 gcattcgatg tgacggagcg aaaccctttg gcgctaagtg tattttttgt aaatcgacga 902 tgatcacctt tgataacgtc gcgctgcaaa tacgcactga ccatgcgcgc tggatttcac 962 aaataatatc aggctcctcg tggagctttt tt 994 <210> SEQ ID NO 19 <211> LENGTH: 70 <212> TYPE: PRT <213> ORGANISM: Escherichia coli <400> SEQUENCE: 19 Met Ser Asn Lys Met Thr Gly Leu Val Lys Trp Phe Asn Ala Asp Lys 1 5 10 15 Gly Phe Gly Phe Ile Thr Pro Asp Asp Gly Ser Lys Asp Val Phe Val 20 25 30 His Phe Thr Ala Ile Gln Ser Asn Glu Phe Arg Thr Leu Asn Glu Asn 35 40 45 Gln Lys Val Glu Phe Ser Ile Glu Gln Gly Gln Arg Gly Pro Ala Ala 50 55 60 Ala Asn Val Val Thr Leu 65 70 <210> SEQ ID NO 20 <211> LENGTH: 351 <212> TYPE: DNA <213> ORGANISM: Agrobacterium tumefaciens <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (125)..(334) <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: AAK90623 <309> DATABASE ENTRY DATE: 2001-12-18 <313> RELEVANT RESIDUES IN SEQ ID NO: (1)..(351) <400> SEQUENCE: 20 catcgaccat tgcttgtgac gtcgttaccg gaacctcgtg ttccccgtcg gatttcctct 60 caaaaatcga tctaatcccg caaggtatcg cgggaaccac aacgattcta aaaaggagat 120 cgtt atg aac act ggt act gta aag tgg ttt aac gcc acc aag ggc ttc 169 Met Asn Thr Gly Thr Val Lys Trp Phe Asn Ala Thr Lys Gly Phe 1 5 10 15 ggc ttc att cag cct gac aac ggc ggc acg gac gtt ttc gtt cac att 217 Gly Phe Ile Gln Pro Asp Asn Gly Gly Thr Asp Val Phe Val His Ile 20 25 30 tct gct gtt gag cgc gct ggc atg cgt tcg ctg aac gac ggc cag aag 265 Ser Ala Val Glu Arg Ala Gly Met Arg Ser Leu Asn Asp Gly Gln Lys 35 40 45 atc agc tat gag atc gtt cag gac cgc cgg tcc gga aaa agc tct gcc 313 Ile Ser Tyr Glu Ile Val Gln Asp Arg Arg Ser Gly Lys Ser Ser Ala 50 55 60 gat aac ctt cag gca gct tga tattcgtcat tttggcc 351 Asp Asn Leu Gln Ala Ala 65

<210> SEQ ID NO 21 <211> LENGTH: 69 <212> TYPE: PRT <213> ORGANISM: Agrobacterium tumefaciens <400> SEQUENCE: 21 Met Asn Thr Gly Thr Val Lys Trp Phe Asn Ala Thr Lys Gly Phe Gly 1 5 10 15 Phe Ile Gln Pro Asp Asn Gly Gly Thr Asp Val Phe Val His Ile Ser 20 25 30 Ala Val Glu Arg Ala Gly Met Arg Ser Leu Asn Asp Gly Gln Lys Ile 35 40 45 Ser Tyr Glu Ile Val Gln Asp Arg Arg Ser Gly Lys Ser Ser Ala Asp 50 55 60 Asn Leu Gln Ala Ala 65 <210> SEQ ID NO 22 <211> LENGTH: 301 <212> TYPE: DNA <213> ORGANISM: Agrobacterium tumefaciens <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (59)..(262) <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: AAK89225 <309> DATABASE ENTRY DATE: 2001-12-18 <313> RELEVANT RESIDUES IN SEQ ID NO: (1)..(301) <400> SEQUENCE: 22 cgtaccgatc aatgatcggt attgcgttga ggtgcactca gcaatcaacg aggacaag 58 atg gca act ggc act gta aaa ttc ttc gct cag gac aag ggc ttt ggc 106 Met Ala Thr Gly Thr Val Lys Phe Phe Ala Gln Asp Lys Gly Phe Gly 1 5 10 15 ttc att acc cct gac aat ggc ggt cct gac gta ttc gtt cac atc tcg 154 Phe Ile Thr Pro Asp Asn Gly Gly Pro Asp Val Phe Val His Ile Ser 20 25 30 gca gtc ggt ttc ggc ggc tct ctt cag gat ggt cag aag gtg agc tac 202 Ala Val Gly Phe Gly Gly Ser Leu Gln Asp Gly Gln Lys Val Ser Tyr 35 40 45 gag ttg gga caa gac cgc aag acc ggt aaa tcg aaa gcc gag aac gtc 250 Glu Leu Gly Gln Asp Arg Lys Thr Gly Lys Ser Lys Ala Glu Asn Val 50 55 60 act ctc ctt tga tggcagcgcc gcggcccaac gcacgatagc gcgtgagca 301 Thr Leu Leu 65 <210> SEQ ID NO 23 <211> LENGTH: 67 <212> TYPE: PRT <213> ORGANISM: Agrobacterium tumefaciens <400> SEQUENCE: 23 Met Ala Thr Gly Thr Val Lys Phe Phe Ala Gln Asp Lys Gly Phe Gly 1 5 10 15 Phe Ile Thr Pro Asp Asn Gly Gly Pro Asp Val Phe Val His Ile Ser 20 25 30 Ala Val Gly Phe Gly Gly Ser Leu Gln Asp Gly Gln Lys Val Ser Tyr 35 40 45 Glu Leu Gly Gln Asp Arg Lys Thr Gly Lys Ser Lys Ala Glu Asn Val 50 55 60 Thr Leu Leu 65 <210> SEQ ID NO 24 <211> LENGTH: 251 <212> TYPE: DNA <213> ORGANISM: Agrobacterium tumefaciens <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (27)..(242) <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: AAK87945 <309> DATABASE ENTRY DATE: 2001-12-18 <313> RELEVANT RESIDUES IN SEQ ID NO: (1)..(251) <400> SEQUENCE: 24 cgggcagagc gaaaaggacc tgatgc atg gcc gaa act ggc acc gta aaa ttc 53 Met Ala Glu Thr Gly Thr Val Lys Phe 1 5 ttt aat acc gac aaa ggc ttc ggc ttc atc aag cca gac aat ggt ggc 101 Phe Asn Thr Asp Lys Gly Phe Gly Phe Ile Lys Pro Asp Asn Gly Gly 10 15 20 25 gct gat atc ttt gtt cac atc tct gcc gta cag gct tct ggc ctg tcc 149 Ala Asp Ile Phe Val His Ile Ser Ala Val Gln Ala Ser Gly Leu Ser 30 35 40 gga ctt tca gaa aat cag aaa gtg agc ttc gac acg gaa ccg gat cgt 197 Gly Leu Ser Glu Asn Gln Lys Val Ser Phe Asp Thr Glu Pro Asp Arg 45 50 55 cgc ggc aag ggc ccg aag gca gtc aat ctg cag att gct ggc tga 242 Arg Gly Lys Gly Pro Lys Ala Val Asn Leu Gln Ile Ala Gly 60 65 70 ccctaaaac 251 <210> SEQ ID NO 25 <211> LENGTH: 71 <212> TYPE: PRT <213> ORGANISM: Agrobacterium tumefaciens <400> SEQUENCE: 25 Met Ala Glu Thr Gly Thr Val Lys Phe Phe Asn Thr Asp Lys Gly Phe 1 5 10 15 Gly Phe Ile Lys Pro Asp Asn Gly Gly Ala Asp Ile Phe Val His Ile 20 25 30 Ser Ala Val Gln Ala Ser Gly Leu Ser Gly Leu Ser Glu Asn Gln Lys 35 40 45 Val Ser Phe Asp Thr Glu Pro Asp Arg Arg Gly Lys Gly Pro Lys Ala 50 55 60 Val Asn Leu Gln Ile Ala Gly 65 70 <210> SEQ ID NO 26 <211> LENGTH: 651 <212> TYPE: DNA <213> ORGANISM: Agrobacterium tumefaciens <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (297)..(605) <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: AAK87573 <309> DATABASE ENTRY DATE: 2001-12-18 <313> RELEVANT RESIDUES IN SEQ ID NO: (1)..(651) <400> SEQUENCE: 26 gcgcgtaatc gaggggttgg caggatatgg ctgataggat gtcatcgaaa acgatagtcg 60 atgtcgagga cctttcgggc gatgccgtcg acctgaccga aatcaccggc gtcgtgaaat 120 ggttcgacgt cgccaagggt ttcggcttca tcgtgcccga taacggtaca caggatgtgc 180 tgctgcacgt ctcgtgcctg cgccgcgacg gctaccagac catccttgaa ggcacgcgca 240 tcgtcgccct catccagcgg cgcgaccgcg gtttccaggt tttccgcatc ctgtcc atg 299 Met 1 gat cag tcg acc gcc gtt cac ccg tcg cag ctg ccg ccg gtg cgc acc 347 Asp Gln Ser Thr Ala Val His Pro Ser Gln Leu Pro Pro Val Arg Thr 5 10 15 cat gtg cag gtg acg ccg cat agc ggg ctt gag cgt gcc atc gtc aag 395 His Val Gln Val Thr Pro His Ser Gly Leu Glu Arg Ala Ile Val Lys 20 25 30 tgg ttc aac cgc acc aag ggt ttc ggt ttc ctg acg cgt ggc gaa gga 443 Trp Phe Asn Arg Thr Lys Gly Phe Gly Phe Leu Thr Arg Gly Glu Gly 35 40 45 acg gaa gat att ttc gtg cat atg gaa acg ctg cgc cgt ttc ggc ctg 491 Thr Glu Asp Ile Phe Val His Met Glu Thr Leu Arg Arg Phe Gly Leu 50 55 60 65 acg gaa ctg cgc ccc ggc cag gtg gtg ctc gtg cgt tac ggc gat ggc 539 Thr Glu Leu Arg Pro Gly Gln Val Val Leu Val Arg Tyr Gly Asp Gly 70 75 80 gac aag ggc ctg atg gca gcg gaa atc cat ccc gat aac ccg gtt tcc 587 Asp Lys Gly Leu Met Ala Ala Glu Ile His Pro Asp Asn Pro Val Ser 85 90 95 atc ggg atg tcg cat tga tgtccggcct gcgtcccatg ctgaaaggcg 635 Ile Gly Met Ser His 100 ccgtcatggc gcttgt 651 <210> SEQ ID NO 27 <211> LENGTH: 102 <212> TYPE: PRT <213> ORGANISM: Agrobacterium tumefaciens <400> SEQUENCE: 27 Met Asp Gln Ser Thr Ala Val His Pro Ser Gln Leu Pro Pro Val Arg 1 5 10 15 Thr His Val Gln Val Thr Pro His Ser Gly Leu Glu Arg Ala Ile Val 20 25 30 Lys Trp Phe Asn Arg Thr Lys Gly Phe Gly Phe Leu Thr Arg Gly Glu 35 40 45 Gly Thr Glu Asp Ile Phe Val His Met Glu Thr Leu Arg Arg Phe Gly 50 55 60 Leu Thr Glu Leu Arg Pro Gly Gln Val Val Leu Val Arg Tyr Gly Asp 65 70 75 80 Gly Asp Lys Gly Leu Met Ala Ala Glu Ile His Pro Asp Asn Pro Val 85 90 95 Ser Ile Gly Met Ser His 100 <210> SEQ ID NO 28 <211> LENGTH: 301 <212> TYPE: DNA <213> ORGANISM: Synechocystis PCC6803 <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (22)..(273) <400> SEQUENCE: 28 ctctggtttt ggagctaatt t atg tcc att tat gtc ggg aac ctt tct tac 51 Met Ser Ile Tyr Val Gly Asn Leu Ser Tyr 1 5 10 caa gcc acc gaa gat gac gtt ttg act gtc ttc tcc gag tat ggc act 99 Gln Ala Thr Glu Asp Asp Val Leu Thr Val Phe Ser Glu Tyr Gly Thr 15 20 25 gtt aag cgg gtt caa ctt ccc act gat cgg gag acc ggt cgt atg cgg 147 Val Lys Arg Val Gln Leu Pro Thr Asp Arg Glu Thr Gly Arg Met Arg 30 35 40

ggt ttt ggt ttc gtt gaa atg tct tcc gat aag gaa gaa gat gcc gcc 195 Gly Phe Gly Phe Val Glu Met Ser Ser Asp Lys Glu Glu Asp Ala Ala 45 50 55 att gaa gct ctg gat gga gcc gaa tgg atg ggg cgg gat ctc aaa gtt 243 Ile Glu Ala Leu Asp Gly Ala Glu Trp Met Gly Arg Asp Leu Lys Val 60 65 70 aat aaa gca aga ccg aga acc cct cgt taa gtttttgcct aattacctga 293 Asn Lys Ala Arg Pro Arg Thr Pro Arg 75 80 atttaaga 301 <210> SEQ ID NO 29 <211> LENGTH: 83 <212> TYPE: PRT <213> ORGANISM: Synechocystis PCC6803 <400> SEQUENCE: 29 Met Ser Ile Tyr Val Gly Asn Leu Ser Tyr Gln Ala Thr Glu Asp Asp 1 5 10 15 Val Leu Thr Val Phe Ser Glu Tyr Gly Thr Val Lys Arg Val Gln Leu 20 25 30 Pro Thr Asp Arg Glu Thr Gly Arg Met Arg Gly Phe Gly Phe Val Glu 35 40 45 Met Ser Ser Asp Lys Glu Glu Asp Ala Ala Ile Glu Ala Leu Asp Gly 50 55 60 Ala Glu Trp Met Gly Arg Asp Leu Lys Val Asn Lys Ala Arg Pro Arg 65 70 75 80 Thr Pro Arg <210> SEQ ID NO 30 <211> LENGTH: 401 <212> TYPE: DNA <213> ORGANISM: Synechocystis PCC6803 <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (91)..(396) <400> SEQUENCE: 30 tctagtatta acggtttttc gcgtttttcc attgacaggc atttctccga aatcaccctc 60 tacatatccc tcagtttttg gagaaaatcc atg tca att tat gta ggc aac ctg 114 Met Ser Ile Tyr Val Gly Asn Leu 1 5 tcc tat gac gtt tca gaa gcc gat tta acc gcg gtt ttt gct gaa tac 162 Ser Tyr Asp Val Ser Glu Ala Asp Leu Thr Ala Val Phe Ala Glu Tyr 10 15 20 ggt tcc gta aag cgg gtt cag ctc ccc acc gac cgg gaa act ggt cgc 210 Gly Ser Val Lys Arg Val Gln Leu Pro Thr Asp Arg Glu Thr Gly Arg 25 30 35 40 atg cgg ggc ttc ggt ttt gtc gag cta gaa gct gac gcc gaa gaa acg 258 Met Arg Gly Phe Gly Phe Val Glu Leu Glu Ala Asp Ala Glu Glu Thr 45 50 55 gct gcc att gaa gcc cta gac ggt gca gaa tgg atg ggt cgt gac ctt 306 Ala Ala Ile Glu Ala Leu Asp Gly Ala Glu Trp Met Gly Arg Asp Leu 60 65 70 aaa gtt aac aaa gcc aag ccc cgg gaa aat cgc agt ggc ggt ggt tcc 354 Lys Val Asn Lys Ala Lys Pro Arg Glu Asn Arg Ser Gly Gly Gly Ser 75 80 85 ttt ggt ggc ggt cgt aaa agc tat ggt ggt agc cgc tac tag ggctt 401 Phe Gly Gly Gly Arg Lys Ser Tyr Gly Gly Ser Arg Tyr 90 95 100 <210> SEQ ID NO 31 <211> LENGTH: 101 <212> TYPE: PRT <213> ORGANISM: Synechocystis PCC6803 <400> SEQUENCE: 31 Met Ser Ile Tyr Val Gly Asn Leu Ser Tyr Asp Val Ser Glu Ala Asp 1 5 10 15 Leu Thr Ala Val Phe Ala Glu Tyr Gly Ser Val Lys Arg Val Gln Leu 20 25 30 Pro Thr Asp Arg Glu Thr Gly Arg Met Arg Gly Phe Gly Phe Val Glu 35 40 45 Leu Glu Ala Asp Ala Glu Glu Thr Ala Ala Ile Glu Ala Leu Asp Gly 50 55 60 Ala Glu Trp Met Gly Arg Asp Leu Lys Val Asn Lys Ala Lys Pro Arg 65 70 75 80 Glu Asn Arg Ser Gly Gly Gly Ser Phe Gly Gly Gly Arg Lys Ser Tyr 85 90 95 Gly Gly Ser Arg Tyr 100 <210> SEQ ID NO 32 <211> LENGTH: 951 <212> TYPE: DNA <213> ORGANISM: Arabidopsis thaliana <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (46)..(654) <400> SEQUENCE: 32 aaagatttag agaaaaaagt gagttattaa gagattccaa tcaaa atg agc gga gac 57 Met Ser Gly Asp 1 aac ggc ggt ggt gag agg cgc aaa ggc tcc gtc aag tgg ttt gat acc 105 Asn Gly Gly Gly Glu Arg Arg Lys Gly Ser Val Lys Trp Phe Asp Thr 5 10 15 20 cag aag ggt ttc ggc ttc atc act cct gac gac ggt ggc gac gat ctc 153 Gln Lys Gly Phe Gly Phe Ile Thr Pro Asp Asp Gly Gly Asp Asp Leu 25 30 35 ttc gtt cac cag tcc tcc atc aga tct gag ggt ttc cgt agc ctc gct 201 Phe Val His Gln Ser Ser Ile Arg Ser Glu Gly Phe Arg Ser Leu Ala 40 45 50 gcc gaa gaa gcc gta gag ttc gag gtt gag atc gac aac aac aac cgt 249 Ala Glu Glu Ala Val Glu Phe Glu Val Glu Ile Asp Asn Asn Asn Arg 55 60 65 ccc aag gcc atc gat gtt tct gga ccc gac ggc gct ccc gtc caa gga 297 Pro Lys Ala Ile Asp Val Ser Gly Pro Asp Gly Ala Pro Val Gln Gly 70 75 80 aac agc ggt ggt ggt tca tct ggc gga cgc ggc ggt ttc ggt gga gga 345 Asn Ser Gly Gly Gly Ser Ser Gly Gly Arg Gly Gly Phe Gly Gly Gly 85 90 95 100 aga gga ggt gga cgc gga tct gga ggt gga tac ggc ggt ggc ggt ggt 393 Arg Gly Gly Gly Arg Gly Ser Gly Gly Gly Tyr Gly Gly Gly Gly Gly 105 110 115 gga tac gga gga aga gga ggt ggt ggt cga gga ggc agc gac tgc tac 441 Gly Tyr Gly Gly Arg Gly Gly Gly Gly Arg Gly Gly Ser Asp Cys Tyr 120 125 130 aag tgt ggt gag ccc ggt cac atg gcg aga gac tgt tct gaa ggc ggt 489 Lys Cys Gly Glu Pro Gly His Met Ala Arg Asp Cys Ser Glu Gly Gly 135 140 145 gga ggt tac gga gga ggc ggc ggt ggc tac gga ggt gga ggc gga tac 537 Gly Gly Tyr Gly Gly Gly Gly Gly Gly Tyr Gly Gly Gly Gly Gly Tyr 150 155 160 ggc gga gga ggt ggt ggt tac gga ggt ggt ggc cgt gga ggt ggt ggc 585 Gly Gly Gly Gly Gly Gly Tyr Gly Gly Gly Gly Arg Gly Gly Gly Gly 165 170 175 180 ggc ggg gga agc tgc tac agc tgt ggc gag tcg gga cat ttc gcc agg 633 Gly Gly Gly Ser Cys Tyr Ser Cys Gly Glu Ser Gly His Phe Ala Arg 185 190 195 gat tgc acc agc ggt gga cgt taaaaccaac gccggttacg cggtggagaa 684 Asp Cys Thr Ser Gly Gly Arg 200 gagtgagttg gttatctcac aagtgatcgg ttctttctcc cgccgccttc tatctctcta 744 ttatccactt tttgcttatt atgatggatc tctatctttg ttagttggtt ttttcttgat 804 ggtttcggat taggactctt cttttggttt tgctacttat ggttggtttt atttctggta 864 cttgtgatat gggtgaaatg ctctacttgt tgctctgttt caagtgttca taatatgcga 924 acaaatattc tgggttttgt ttcagtc 951 <210> SEQ ID NO 33 <211> LENGTH: 203 <212> TYPE: PRT <213> ORGANISM: Arabidopsis thaliana <400> SEQUENCE: 33 Met Ser Gly Asp Asn Gly Gly Gly Glu Arg Arg Lys Gly Ser Val Lys 1 5 10 15 Trp Phe Asp Thr Gln Lys Gly Phe Gly Phe Ile Thr Pro Asp Asp Gly 20 25 30 Gly Asp Asp Leu Phe Val His Gln Ser Ser Ile Arg Ser Glu Gly Phe 35 40 45 Arg Ser Leu Ala Ala Glu Glu Ala Val Glu Phe Glu Val Glu Ile Asp 50 55 60 Asn Asn Asn Arg Pro Lys Ala Ile Asp Val Ser Gly Pro Asp Gly Ala 65 70 75 80 Pro Val Gln Gly Asn Ser Gly Gly Gly Ser Ser Gly Gly Arg Gly Gly 85 90 95 Phe Gly Gly Gly Arg Gly Gly Gly Arg Gly Ser Gly Gly Gly Tyr Gly 100 105 110 Gly Gly Gly Gly Gly Tyr Gly Gly Arg Gly Gly Gly Gly Arg Gly Gly 115 120 125 Ser Asp Cys Tyr Lys Cys Gly Glu Pro Gly His Met Ala Arg Asp Cys 130 135 140 Ser Glu Gly Gly Gly Gly Tyr Gly Gly Gly Gly Gly Gly Tyr Gly Gly 145 150 155 160 Gly Gly Gly Tyr Gly Gly Gly Gly Gly Gly Tyr Gly Gly Gly Gly Arg 165 170 175 Gly Gly Gly Gly Gly Gly Gly Ser Cys Tyr Ser Cys Gly Glu Ser Gly 180 185 190 His Phe Ala Arg Asp Cys Thr Ser Gly Gly Arg 195 200 <210> SEQ ID NO 34 <211> LENGTH: 950 <212> TYPE: DNA <213> ORGANISM: Gossypium hirsutum <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (58)..(618) <400> SEQUENCE: 34 cccacgcgtc cggagactta tttactttag gaattttcta gaaccttctc gaaggca 57 atg gct gag gcg acc agc acc gag aga tcc act ggc aca gtc aaa tgg 105 Met Ala Glu Ala Thr Ser Thr Glu Arg Ser Thr Gly Thr Val Lys Trp 1 5 10 15

ttc agc gcc cag aaa tgt ttt ggt ttc ata gct ccc gac gac gga ggc 153 Phe Ser Ala Gln Lys Cys Phe Gly Phe Ile Ala Pro Asp Asp Gly Gly 20 25 30 gac gac ctt ttc gtc cac caa acc tct att ctt tcc caa ggc ttt cgt 201 Asp Asp Leu Phe Val His Gln Thr Ser Ile Leu Ser Gln Gly Phe Arg 35 40 45 aca ctc tcc gat aac caa ccc gtc gag ttc ttc gtt gat gtc ggt gaa 249 Thr Leu Ser Asp Asn Gln Pro Val Glu Phe Phe Val Asp Val Gly Glu 50 55 60 gat ggc cga gct aag gcc gtt gat gta act cct atg cct cga cct cgc 297 Asp Gly Arg Ala Lys Ala Val Asp Val Thr Pro Met Pro Arg Pro Arg 65 70 75 80 cgt cct tcc cgc ggc ggt gga aga gga gga tat ttt ggc ggc aga ggt 345 Arg Pro Ser Arg Gly Gly Gly Arg Gly Gly Tyr Phe Gly Gly Arg Gly 85 90 95 aga gga ggt ggt ggt tac agg aga gga ggt tat ggt ggt ggc ggt ggc 393 Arg Gly Gly Gly Gly Tyr Arg Arg Gly Gly Tyr Gly Gly Gly Gly Gly 100 105 110 ggt ggc gga ggt agt ggc gct tgt tat aat tgt ggg agg acg ggg cat 441 Gly Gly Gly Gly Ser Gly Ala Cys Tyr Asn Cys Gly Arg Thr Gly His 115 120 125 ata gcc agg gat tgt tat caa ggt ggt gga agt gga agt acg aga tac 489 Ile Ala Arg Asp Cys Tyr Gln Gly Gly Gly Ser Gly Ser Thr Arg Tyr 130 135 140 agt ggc ggc cgt gga gat ggt ggt gga aat aga aga tac ggt ggc gat 537 Ser Gly Gly Arg Gly Asp Gly Gly Gly Asn Arg Arg Tyr Gly Gly Asp 145 150 155 160 agc ggt gat gga cga gga gct ggg gga cga tgt ttt aat tgt gga gat 585 Ser Gly Asp Gly Arg Gly Ala Gly Gly Arg Cys Phe Asn Cys Gly Asp 165 170 175 gaa ggc cat ttt gca agg gat tgc cct aac aaa taattcagaa aacaaaaccg 638 Glu Gly His Phe Ala Arg Asp Cys Pro Asn Lys 180 185 gacatttcct ataatatttt gtgagtataa gtttttcttt tacggtgttt tggaaagggg 698 tttatcagca aaagaagaag aaaccggaaa gttgtctatt ctttccgatc aggcttactt 758 ttcccgattc cgattgatct ggtaacatct ttaaaaaaaa ggtccattgt tttgtataat 818 gtgttgtaat tgttgttatt ctcttaattc ttatcgattc ttctttcttt aatcctctat 878 tcttagtctt tgcattgaca gtatgaacgg gcaatcattt gtcttccttg aagcagattt 938 cttttatttt tc 950 <210> SEQ ID NO 35 <211> LENGTH: 187 <212> TYPE: PRT <213> ORGANISM: Gossypium hirsutum <400> SEQUENCE: 35 Met Ala Glu Ala Thr Ser Thr Glu Arg Ser Thr Gly Thr Val Lys Trp 1 5 10 15 Phe Ser Ala Gln Lys Cys Phe Gly Phe Ile Ala Pro Asp Asp Gly Gly 20 25 30 Asp Asp Leu Phe Val His Gln Thr Ser Ile Leu Ser Gln Gly Phe Arg 35 40 45 Thr Leu Ser Asp Asn Gln Pro Val Glu Phe Phe Val Asp Val Gly Glu 50 55 60 Asp Gly Arg Ala Lys Ala Val Asp Val Thr Pro Met Pro Arg Pro Arg 65 70 75 80 Arg Pro Ser Arg Gly Gly Gly Arg Gly Gly Tyr Phe Gly Gly Arg Gly 85 90 95 Arg Gly Gly Gly Gly Tyr Arg Arg Gly Gly Tyr Gly Gly Gly Gly Gly 100 105 110 Gly Gly Gly Gly Ser Gly Ala Cys Tyr Asn Cys Gly Arg Thr Gly His 115 120 125 Ile Ala Arg Asp Cys Tyr Gln Gly Gly Gly Ser Gly Ser Thr Arg Tyr 130 135 140 Ser Gly Gly Arg Gly Asp Gly Gly Gly Asn Arg Arg Tyr Gly Gly Asp 145 150 155 160 Ser Gly Asp Gly Arg Gly Ala Gly Gly Arg Cys Phe Asn Cys Gly Asp 165 170 175 Glu Gly His Phe Ala Arg Asp Cys Pro Asn Lys 180 185 <210> SEQ ID NO 36 <211> LENGTH: 516 <212> TYPE: DNA <213> ORGANISM: Gossypium hirsutum <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (42)..(377) <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (388)..(388) <223> OTHER INFORMATION: n = A, G, T, or C <400> SEQUENCE: 36 cggacgcgtg ggttgggatt ttaaagatgg gtgagaatag g atg acc ggc aag gtg 56 Met Thr Gly Lys Val 1 5 aag tgg ttc gat gac caa aag ggt tat ggc ttc ata tcc cct gac gac 104 Lys Trp Phe Asp Asp Gln Lys Gly Tyr Gly Phe Ile Ser Pro Asp Asp 10 15 20 ggc ggc gac gat ttg ttt gtt cac cag tct tcc atc cgt tcc gag ggt 152 Gly Gly Asp Asp Leu Phe Val His Gln Ser Ser Ile Arg Ser Glu Gly 25 30 35 ttc cgt agc ctt gct gat ggt gaa gag gtc gag tac gtt gtc gag tct 200 Phe Arg Ser Leu Ala Asp Gly Glu Glu Val Glu Tyr Val Val Glu Ser 40 45 50 tct gaa ggt cgc ccc aag gct gtt gag gtc act ggc ccc aac ggc aac 248 Ser Glu Gly Arg Pro Lys Ala Val Glu Val Thr Gly Pro Asn Gly Asn 55 60 65 cct gtt cgt gga tca tct aga tcc gga cgc ggc ggc ggc ggt ggt ggc 296 Pro Val Arg Gly Ser Ser Arg Ser Gly Arg Gly Gly Gly Gly Gly Gly 70 75 80 85 ggt tat ggc ggt gga tcc ggt gga tat ggt gga ggg gga agg aga ggc 344 Gly Tyr Gly Gly Gly Ser Gly Gly Tyr Gly Gly Gly Gly Arg Arg Gly 90 95 100 ggt tat ggt gga gga att gga ggg gga ttt tag ttgcaaaatg ngcatgctta 397 Gly Tyr Gly Gly Gly Ile Gly Gly Gly Phe 105 110 aaaatattat aagttgtaag cgtgcatgct aatgcagagt gtggttgact atgacgtatc 457 atactgccat actaattaat attattgagt aaaataaaaa acaatgcttt cttgtttcc 516 <210> SEQ ID NO 37 <211> LENGTH: 111 <212> TYPE: PRT <213> ORGANISM: Gossypium hirsutum <400> SEQUENCE: 37 Met Thr Gly Lys Val Lys Trp Phe Asp Asp Gln Lys Gly Tyr Gly Phe 1 5 10 15 Ile Ser Pro Asp Asp Gly Gly Asp Asp Leu Phe Val His Gln Ser Ser 20 25 30 Ile Arg Ser Glu Gly Phe Arg Ser Leu Ala Asp Gly Glu Glu Val Glu 35 40 45 Tyr Val Val Glu Ser Ser Glu Gly Arg Pro Lys Ala Val Glu Val Thr 50 55 60 Gly Pro Asn Gly Asn Pro Val Arg Gly Ser Ser Arg Ser Gly Arg Gly 65 70 75 80 Gly Gly Gly Gly Gly Gly Tyr Gly Gly Gly Ser Gly Gly Tyr Gly Gly 85 90 95 Gly Gly Arg Arg Gly Gly Tyr Gly Gly Gly Ile Gly Gly Gly Phe 100 105 110 <210> SEQ ID NO 38 <211> LENGTH: 792 <212> TYPE: DNA <213> ORGANISM: Glycine max <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (17)..(556) <400> SEQUENCE: 38 aaaaaagagg cgcaag atg agt ggt agg gtt tct ggg aag gtg aag tgg ttc 52 Met Ser Gly Arg Val Ser Gly Lys Val Lys Trp Phe 1 5 10 aac gat cag aag ggg ttt gga ttc ata acc cct gac gat ggc agc gag 100 Asn Asp Gln Lys Gly Phe Gly Phe Ile Thr Pro Asp Asp Gly Ser Glu 15 20 25 gaa ctc ttc gtt cac caa tct cag atc aaa tct gac ggt ttc cga agc 148 Glu Leu Phe Val His Gln Ser Gln Ile Lys Ser Asp Gly Phe Arg Ser 30 35 40 cta gct gaa gga gag tcc gtt gag ttc gct att gaa tct gaa tct gac 196 Leu Ala Glu Gly Glu Ser Val Glu Phe Ala Ile Glu Ser Glu Ser Asp 45 50 55 60 gga cgc gcc aag gct gtt gat gtc act ggc ccc gac ggc gcc agc gtc 244 Gly Arg Ala Lys Ala Val Asp Val Thr Gly Pro Asp Gly Ala Ser Val 65 70 75 cag gga acc aga cgc ggc ggt gat ggt ggc cga agc tat ggc ggg gga 292 Gln Gly Thr Arg Arg Gly Gly Asp Gly Gly Arg Ser Tyr Gly Gly Gly 80 85 90 cga gga ggt ggc tac ggt ggt ggt ggg cga ggc ggt ggt ggc ggg gct 340 Arg Gly Gly Gly Tyr Gly Gly Gly Gly Arg Gly Gly Gly Gly Gly Ala 95 100 105 tgc tac aac tgc ggt gaa tcg gga cat ctg gct agg gac tgc agc caa 388 Cys Tyr Asn Cys Gly Glu Ser Gly His Leu Ala Arg Asp Cys Ser Gln 110 115 120 gga ggc ggt gga gac agg tac ggc gga ggc ggt ggt ggt ggt ggc agg 436 Gly Gly Gly Gly Asp Arg Tyr Gly Gly Gly Gly Gly Gly Gly Gly Arg 125 130 135 140 tat gga ggc ggc ggt ggc ggc agg tac ggt ggt ggt gga gga ggt ggt 484 Tyr Gly Gly Gly Gly Gly Gly Arg Tyr Gly Gly Gly Gly Gly Gly Gly 145 150 155 ggc ggc gga gga agc tgc tac agc tgt gga gag tct ggg cat ttc gcc 532 Gly Gly Gly Gly Ser Cys Tyr Ser Cys Gly Glu Ser Gly His Phe Ala 160 165 170 aga gat tgc cca tca agt gct cgt tgaaattact gttatggtgg tttatgttat 586 Arg Asp Cys Pro Ser Ser Ala Arg 175 180 gcggattgtt ttaagttttt actttaacat gttgtaggga ttttaatggt ttctgtcaaa 646 gctgtggctt cttataagta gatgcgtgag atttttcttt tttttggtta tttaaatgaa 706 agtttctgtg ttatcgttac aatctgcaaa caaaatctgt ttggacctac attttgctat 766 aatgaattgg atgattgtta tcggtt 792 <210> SEQ ID NO 39 <211> LENGTH: 180 <212> TYPE: PRT

<213> ORGANISM: Glycine max <400> SEQUENCE: 39 Met Ser Gly Arg Val Ser Gly Lys Val Lys Trp Phe Asn Asp Gln Lys 1 5 10 15 Gly Phe Gly Phe Ile Thr Pro Asp Asp Gly Ser Glu Glu Leu Phe Val 20 25 30 His Gln Ser Gln Ile Lys Ser Asp Gly Phe Arg Ser Leu Ala Glu Gly 35 40 45 Glu Ser Val Glu Phe Ala Ile Glu Ser Glu Ser Asp Gly Arg Ala Lys 50 55 60 Ala Val Asp Val Thr Gly Pro Asp Gly Ala Ser Val Gln Gly Thr Arg 65 70 75 80 Arg Gly Gly Asp Gly Gly Arg Ser Tyr Gly Gly Gly Arg Gly Gly Gly 85 90 95 Tyr Gly Gly Gly Gly Arg Gly Gly Gly Gly Gly Ala Cys Tyr Asn Cys 100 105 110 Gly Glu Ser Gly His Leu Ala Arg Asp Cys Ser Gln Gly Gly Gly Gly 115 120 125 Asp Arg Tyr Gly Gly Gly Gly Gly Gly Gly Gly Arg Tyr Gly Gly Gly 130 135 140 Gly Gly Gly Arg Tyr Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly 145 150 155 160 Ser Cys Tyr Ser Cys Gly Glu Ser Gly His Phe Ala Arg Asp Cys Pro 165 170 175 Ser Ser Ala Arg 180 <210> SEQ ID NO 40 <211> LENGTH: 1245 <212> TYPE: DNA <213> ORGANISM: Zea mays <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (75)..(806) <400> SEQUENCE: 40 gcgagagacg ggcaggggag aggaaaaaaa aaatctaacc ctagcatccg cagcgctagg 60 gttcgggggt tgcg atg gcg gcg gcg gcg aga cag cgg ggg acg gtg aag 110 Met Ala Ala Ala Ala Arg Gln Arg Gly Thr Val Lys 1 5 10 tgg ttc aac gac acc aag ggc ttc ggg ttc atc tcc ccc gag gac ggc 158 Trp Phe Asn Asp Thr Lys Gly Phe Gly Phe Ile Ser Pro Glu Asp Gly 15 20 25 agc gaa gat ctc ttc gtg cac cag tcg tcg atc aag tcg gag ggc ttc 206 Ser Glu Asp Leu Phe Val His Gln Ser Ser Ile Lys Ser Glu Gly Phe 30 35 40 cgc tcg ctc gcg gag ggc gag gag gtg gag ttt tcc gtc tcg gag ggt 254 Arg Ser Leu Ala Glu Gly Glu Glu Val Glu Phe Ser Val Ser Glu Gly 45 50 55 60 gac gac ggc cgc act aag gcc gtc gac gtg acc ggc ccc gac gga tcc 302 Asp Asp Gly Arg Thr Lys Ala Val Asp Val Thr Gly Pro Asp Gly Ser 65 70 75 ttc gtc agg ggc ggc gga ggc gga gga gga ggc ggc ggc ggc tac ggc 350 Phe Val Arg Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Tyr Gly 80 85 90 tcc cgc ggc ggt ggc gga tct ggc ggc ggc ggt cgc agc tac ggt ggt 398 Ser Arg Gly Gly Gly Gly Ser Gly Gly Gly Gly Arg Ser Tyr Gly Gly 95 100 105 agc tgg ggc ggc ggc cgg aga tcc ggc ggc ggg ggc ggt ccc ggc gcg 446 Ser Trp Gly Gly Gly Arg Arg Ser Gly Gly Gly Gly Gly Pro Gly Ala 110 115 120 tgc tac aag tgc ggc gag ccc ggc cac atg gca agg gac tgc cct agc 494 Cys Tyr Lys Cys Gly Glu Pro Gly His Met Ala Arg Asp Cys Pro Ser 125 130 135 140 gcc gac ggc gga ggc ggc tac ggc gga ggc ggc tac gga gga gga ggc 542 Ala Asp Gly Gly Gly Gly Tyr Gly Gly Gly Gly Tyr Gly Gly Gly Gly 145 150 155 ggc ggc ggc ggt ggc tgc ttc aag tgt ggc gag cct ggc cac atg gcc 590 Gly Gly Gly Gly Gly Cys Phe Lys Cys Gly Glu Pro Gly His Met Ala 160 165 170 agg gac tgc tcc agc ggc ggc ggc ggc tac ggc ggt ggc ggc ggc ggc 638 Arg Asp Cys Ser Ser Gly Gly Gly Gly Tyr Gly Gly Gly Gly Gly Gly 175 180 185 ggt gga ggc ggc tgc tac aac tgc ggc cag gcc ggc cac atg gcc agg 686 Gly Gly Gly Gly Cys Tyr Asn Cys Gly Gln Ala Gly His Met Ala Arg 190 195 200 gac tgc ccc agc ggt ggc ggc ggt ggc gga ggg agg ttc ggc ggc ggc 734 Asp Cys Pro Ser Gly Gly Gly Gly Gly Gly Gly Arg Phe Gly Gly Gly 205 210 215 220 ggc ggg ggt ggc ggc gac cgc tcc tgc tac aac tgc ggc gag gcc ggc 782 Gly Gly Gly Gly Gly Asp Arg Ser Cys Tyr Asn Cys Gly Glu Ala Gly 225 230 235 cac atc gcc cgc gac tgc ccc acg tgaggtgtgt ccgcgtccgt ccgtccagcc 836 His Ile Ala Arg Asp Cys Pro Thr 240 agatcagatc ggatcgctcc accacctgct ggtctgatgg cgccgccccc ttctagatct 896 cgcttaaaaa aacacccccc tctcgctgtg tgtcggagta ccgctttagt tttgccgatc 956 cgggcacgag tgcccgctgc ctctttcctc tcatgcgtaa gaggaacccg tccgccgttt 1016 tcagatttcg ttcggtccgt agaagaactc tcaagttaag ttaagttatc atggtgtgtg 1076 cttggtcgtt gttcgtcgtc gtcgttaagg ttttaagaga tgatttggtc ctgtgttgcc 1136 gaggggaagt cgaatctgct tttttctttt tttgtggttt gttccaccag actgaggaag 1196 gagatgagat gattattctc ccaaaaaaaa aaaaaaaaaa aaaaaaaaa 1245 <210> SEQ ID NO 41 <211> LENGTH: 244 <212> TYPE: PRT <213> ORGANISM: Zea mays <400> SEQUENCE: 41 Met Ala Ala Ala Ala Arg Gln Arg Gly Thr Val Lys Trp Phe Asn Asp 1 5 10 15 Thr Lys Gly Phe Gly Phe Ile Ser Pro Glu Asp Gly Ser Glu Asp Leu 20 25 30 Phe Val His Gln Ser Ser Ile Lys Ser Glu Gly Phe Arg Ser Leu Ala 35 40 45 Glu Gly Glu Glu Val Glu Phe Ser Val Ser Glu Gly Asp Asp Gly Arg 50 55 60 Thr Lys Ala Val Asp Val Thr Gly Pro Asp Gly Ser Phe Val Arg Gly 65 70 75 80 Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Tyr Gly Ser Arg Gly Gly 85 90 95 Gly Gly Ser Gly Gly Gly Gly Arg Ser Tyr Gly Gly Ser Trp Gly Gly 100 105 110 Gly Arg Arg Ser Gly Gly Gly Gly Gly Pro Gly Ala Cys Tyr Lys Cys 115 120 125 Gly Glu Pro Gly His Met Ala Arg Asp Cys Pro Ser Ala Asp Gly Gly 130 135 140 Gly Gly Tyr Gly Gly Gly Gly Tyr Gly Gly Gly Gly Gly Gly Gly Gly 145 150 155 160 Gly Cys Phe Lys Cys Gly Glu Pro Gly His Met Ala Arg Asp Cys Ser 165 170 175 Ser Gly Gly Gly Gly Tyr Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly 180 185 190 Cys Tyr Asn Cys Gly Gln Ala Gly His Met Ala Arg Asp Cys Pro Ser 195 200 205 Gly Gly Gly Gly Gly Gly Gly Arg Phe Gly Gly Gly Gly Gly Gly Gly 210 215 220 Gly Asp Arg Ser Cys Tyr Asn Cys Gly Glu Ala Gly His Ile Ala Arg 225 230 235 240 Asp Cys Pro Thr <210> SEQ ID NO 42 <211> LENGTH: 1409 <212> TYPE: DNA <213> ORGANISM: Zea mays <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (27)..(995) <400> SEQUENCE: 42 cgcagcgcta gggttcgggg gttgcg atg gcg gcg gcg gcg agg cag cgg ggg 53 Met Ala Ala Ala Ala Arg Gln Arg Gly 1 5 acg gtg aag tgg ttc aac gac acc aag ggc ttc ggg ttc atc tcc ccc 101 Thr Val Lys Trp Phe Asn Asp Thr Lys Gly Phe Gly Phe Ile Ser Pro 10 15 20 25 gag gac ggc agc gag gat ctc ttc gtg cac cag tcg tcg atc aag tcg 149 Glu Asp Gly Ser Glu Asp Leu Phe Val His Gln Ser Ser Ile Lys Ser 30 35 40 gag ggc ttc cgc tcg ctc gcg gag ggc gag gag gtg gag ttt tcc gtc 197 Glu Gly Phe Arg Ser Leu Ala Glu Gly Glu Glu Val Glu Phe Ser Val 45 50 55 tcg gag ggt gac gac ggc cgc act aag gcc gtc gac gtg acc ggc ccc 245 Ser Glu Gly Asp Asp Gly Arg Thr Lys Ala Val Asp Val Thr Gly Pro 60 65 70 gac gga tcc ttc gtc agg ggc ggc gga ggc gga gga ggc ggc ggc ggc 293 Asp Gly Ser Phe Val Arg Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly 75 80 85 ggc ggc tac ggc tcc cgc ggc ggt ggc gga tct ggc ggc ggc ggt cgc 341 Gly Gly Tyr Gly Ser Arg Gly Gly Gly Gly Ser Gly Gly Gly Gly Arg 90 95 100 105 agc tac ggt ggt agc tgg ggc ggc ggc cgg aga tcc gcg ccc gac gcc 389 Ser Tyr Gly Gly Ser Trp Gly Gly Gly Arg Arg Ser Ala Pro Asp Ala 110 115 120 gct ttc ggc tcc gtc ctc tcc ggc acc gcc ggc gac gcc gcc ccc agc 437 Ala Phe Gly Ser Val Leu Ser Gly Thr Ala Gly Asp Ala Ala Pro Ser 125 130 135 gac cag tgg ttc gtc gac gcg ctc aac gcc ccc gcg ccg cac ccc atc 485 Asp Gln Trp Phe Val Asp Ala Leu Asn Ala Pro Ala Pro His Pro Ile 140 145 150 gag cgc gtc cga tcc gag tcc tcc tcg atc gtc tcc gac gtc ccc gac 533 Glu Arg Val Arg Ser Glu Ser Ser Ser Ile Val Ser Asp Val Pro Asp 155 160 165 tac ctc ttc agc ctc gac agc ccg tcc gac gac ccc agc ccc ggc ccc 581 Tyr Leu Phe Ser Leu Asp Ser Pro Ser Asp Asp Pro Ser Pro Gly Pro 170 175 180 185 tcg gcg gct cgc gcc aag tcc gac ccc gcg gag act ccg cac cac cac 629 Ser Ala Ala Arg Ala Lys Ser Asp Pro Ala Glu Thr Pro His His His 190 195 200 ggc gac gac gtg ccg cct tcc gct cga cag ata ccg cac gtc gca gga 677 Gly Asp Asp Val Pro Pro Ser Ala Arg Gln Ile Pro His Val Ala Gly

205 210 215 gga gcg tca tcg tgg ccc gcc ccg ccg ccg ccg tac atg gcg cag cct 725 Gly Ala Ser Ser Trp Pro Ala Pro Pro Pro Pro Tyr Met Ala Gln Pro 220 225 230 atg tac tac ttc ccc gtg ccg cca ccg gtc cac tac ctc gac cag tct 773 Met Tyr Tyr Phe Pro Val Pro Pro Pro Val His Tyr Leu Asp Gln Ser 235 240 245 gcg cag agt ggc tac atg cct cgc ccg atc tac cac att gtc ggt ggc 821 Ala Gln Ser Gly Tyr Met Pro Arg Pro Ile Tyr His Ile Val Gly Gly 250 255 260 265 gga gga agc gag gcg cct ggc gga gat ctt cac gcg gcc ggc gga gtc 869 Gly Gly Ser Glu Ala Pro Gly Gly Asp Leu His Ala Ala Gly Gly Val 270 275 280 tac ggc gtc tcg cac cac atg cag ggg ttc ccg ccg atg atg tac gcg 917 Tyr Gly Val Ser His His Met Gln Gly Phe Pro Pro Met Met Tyr Ala 285 290 295 ccg ccg cgc gcg gtc atc tac aac tac aag tcg gag ggg atg cca tcg 965 Pro Pro Arg Ala Val Ile Tyr Asn Tyr Lys Ser Glu Gly Met Pro Ser 300 305 310 ctg cct ccg gaa ggt ggg gca cac tct tcc taggtgcatc ggctacttca 1015 Leu Pro Pro Glu Gly Gly Ala His Ser Ser 315 320 catctctgaa tcctgattat tgttgcagat gcctaagcta aggagttttg cgtggtaatt 1075 tttttatcga ttcgtctaga gtcttgttcg ttgttttgta tagatggagg ggttgatggt 1135 gatggataga tattaatgca gttttcgtct agtggaaata tattcgtgaa atgtatatca 1195 tactaaatag tatagtattt ggtgtgatta attaatattc tagttaatgt aatgtgggat 1255 tcatataatc taggtggttc tggtcttata gaaaccattt ttgggcattt tatatttaca 1315 taaactggat gttgggtgaa tgttctaagc agtatgtgct gtgttgaacc tcaatcactt 1375 atgagtggtt actaaatttg aatttgatgt cttc 1409 <210> SEQ ID NO 43 <211> LENGTH: 323 <212> TYPE: PRT <213> ORGANISM: Zea mays <400> SEQUENCE: 43 Met Ala Ala Ala Ala Arg Gln Arg Gly Thr Val Lys Trp Phe Asn Asp 1 5 10 15 Thr Lys Gly Phe Gly Phe Ile Ser Pro Glu Asp Gly Ser Glu Asp Leu 20 25 30 Phe Val His Gln Ser Ser Ile Lys Ser Glu Gly Phe Arg Ser Leu Ala 35 40 45 Glu Gly Glu Glu Val Glu Phe Ser Val Ser Glu Gly Asp Asp Gly Arg 50 55 60 Thr Lys Ala Val Asp Val Thr Gly Pro Asp Gly Ser Phe Val Arg Gly 65 70 75 80 Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Gly Tyr Gly Ser Arg Gly 85 90 95 Gly Gly Gly Ser Gly Gly Gly Gly Arg Ser Tyr Gly Gly Ser Trp Gly 100 105 110 Gly Gly Arg Arg Ser Ala Pro Asp Ala Ala Phe Gly Ser Val Leu Ser 115 120 125 Gly Thr Ala Gly Asp Ala Ala Pro Ser Asp Gln Trp Phe Val Asp Ala 130 135 140 Leu Asn Ala Pro Ala Pro His Pro Ile Glu Arg Val Arg Ser Glu Ser 145 150 155 160 Ser Ser Ile Val Ser Asp Val Pro Asp Tyr Leu Phe Ser Leu Asp Ser 165 170 175 Pro Ser Asp Asp Pro Ser Pro Gly Pro Ser Ala Ala Arg Ala Lys Ser 180 185 190 Asp Pro Ala Glu Thr Pro His His His Gly Asp Asp Val Pro Pro Ser 195 200 205 Ala Arg Gln Ile Pro His Val Ala Gly Gly Ala Ser Ser Trp Pro Ala 210 215 220 Pro Pro Pro Pro Tyr Met Ala Gln Pro Met Tyr Tyr Phe Pro Val Pro 225 230 235 240 Pro Pro Val His Tyr Leu Asp Gln Ser Ala Gln Ser Gly Tyr Met Pro 245 250 255 Arg Pro Ile Tyr His Ile Val Gly Gly Gly Gly Ser Glu Ala Pro Gly 260 265 270 Gly Asp Leu His Ala Ala Gly Gly Val Tyr Gly Val Ser His His Met 275 280 285 Gln Gly Phe Pro Pro Met Met Tyr Ala Pro Pro Arg Ala Val Ile Tyr 290 295 300 Asn Tyr Lys Ser Glu Gly Met Pro Ser Leu Pro Pro Glu Gly Gly Ala 305 310 315 320 His Ser Ser <210> SEQ ID NO 44 <211> LENGTH: 215 <212> TYPE: DNA <213> ORGANISM: Bacillus subtilis <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (15)..(215) <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: AB001488 <309> DATABASE ENTRY DATE: 1999-02-13 <313> RELEVANT RESIDUES IN SEQ ID NO: (1)..(215) <400> SEQUENCE: 44 aggaggcaac aaaa atg gaa caa ggt aca gtt aaa tgg ttt aat gca gaa 50 Met Glu Gln Gly Thr Val Lys Trp Phe Asn Ala Glu 1 5 10 aaa ggt ttt ggc ttt atc gaa cgc gaa aat gga gac gat gta ttc gta 98 Lys Gly Phe Gly Phe Ile Glu Arg Glu Asn Gly Asp Asp Val Phe Val 15 20 25 cac ttt tct gca atc caa agt gac gga ttc aaa tct tta gac gaa ggt 146 His Phe Ser Ala Ile Gln Ser Asp Gly Phe Lys Ser Leu Asp Glu Gly 30 35 40 caa aaa gta tcg ttt gac gtt gag caa ggt gct cgt gga gct caa gct 194 Gln Lys Val Ser Phe Asp Val Glu Gln Gly Ala Arg Gly Ala Gln Ala 45 50 55 60 gct aac gtt caa aaa gct taa 215 Ala Asn Val Gln Lys Ala 65 <210> SEQ ID NO 45 <211> LENGTH: 66 <212> TYPE: PRT <213> ORGANISM: Bacillus subtilis <400> SEQUENCE: 45 Met Glu Gln Gly Thr Val Lys Trp Phe Asn Ala Glu Lys Gly Phe Gly 1 5 10 15 Phe Ile Glu Arg Glu Asn Gly Asp Asp Val Phe Val His Phe Ser Ala 20 25 30 Ile Gln Ser Asp Gly Phe Lys Ser Leu Asp Glu Gly Gln Lys Val Ser 35 40 45 Phe Asp Val Glu Gln Gly Ala Arg Gly Ala Gln Ala Ala Asn Val Gln 50 55 60 Lys Ala 65 <210> SEQ ID NO 46 <211> LENGTH: 201 <212> TYPE: DNA <213> ORGANISM: Bacillus subtilis <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (1)..(201) <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: L77246 <309> DATABASE ENTRY DATE: 2001-12-14 <313> RELEVANT RESIDUES IN SEQ ID NO: (1)..(201) <400> SEQUENCE: 46 atg caa aac ggt aaa gta aaa tgg ttc aac aac gaa aaa gga ttc ggc 48 Met Gln Asn Gly Lys Val Lys Trp Phe Asn Asn Glu Lys Gly Phe Gly 1 5 10 15 ttc att gaa gtt gaa ggc gga gac gat gta ttt gtt cac ttc aca gct 96 Phe Ile Glu Val Glu Gly Gly Asp Asp Val Phe Val His Phe Thr Ala 20 25 30 atc gaa gga gat gga tac aaa tca tta gaa gaa gga caa gaa gtt tct 144 Ile Glu Gly Asp Gly Tyr Lys Ser Leu Glu Glu Gly Gln Glu Val Ser 35 40 45 ttt gaa att gtc gaa ggt aat cgt gga cct caa gct tct aat gtt gta 192 Phe Glu Ile Val Glu Gly Asn Arg Gly Pro Gln Ala Ser Asn Val Val 50 55 60 aaa ctc taa 201 Lys Leu 65 <210> SEQ ID NO 47 <211> LENGTH: 66 <212> TYPE: PRT <213> ORGANISM: Bacillus subtilis <400> SEQUENCE: 47 Met Gln Asn Gly Lys Val Lys Trp Phe Asn Asn Glu Lys Gly Phe Gly 1 5 10 15 Phe Ile Glu Val Glu Gly Gly Asp Asp Val Phe Val His Phe Thr Ala 20 25 30 Ile Glu Gly Asp Gly Tyr Lys Ser Leu Glu Glu Gly Gln Glu Val Ser 35 40 45 Phe Glu Ile Val Glu Gly Asn Arg Gly Pro Gln Ala Ser Asn Val Val 50 55 60 Lys Leu 65 <210> SEQ ID NO 48 <211> LENGTH: 198 <212> TYPE: DNA <213> ORGANISM: Bacillus halodurans <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (1)..(198) <300> PUBLICATION INFORMATION: <308> DATABASE ACCESSION NUMBER: AP001519 <309> DATABASE ENTRY DATE: 2001-01-10 <313> RELEVANT RESIDUES IN SEQ ID NO: (1)..(198) <400> SEQUENCE: 48 atg caa gga aaa gta aaa tgg ttt aac gca gaa aaa ggt ttc ggt ttt 48 Met Gln Gly Lys Val Lys Trp Phe Asn Ala Glu Lys Gly Phe Gly Phe 1 5 10 15 atc gag cgc gaa gat ggt gac gat gta ttt gtt cat ttc tct gcc att 96 Ile Glu Arg Glu Asp Gly Asp Asp Val Phe Val His Phe Ser Ala Ile

20 25 30 aac aca gac ggt ttc aaa aca tta gac gaa ggt caa tct gtt gag ttt 144 Asn Thr Asp Gly Phe Lys Thr Leu Asp Glu Gly Gln Ser Val Glu Phe 35 40 45 gat atc gtt gaa gga gct cgc gga cct caa gct gcg aac gtc act aag 192 Asp Ile Val Glu Gly Ala Arg Gly Pro Gln Ala Ala Asn Val Thr Lys 50 55 60 ctt taa 198 Leu 65 <210> SEQ ID NO 49 <211> LENGTH: 65 <212> TYPE: PRT <213> ORGANISM: Bacillus halodurans <400> SEQUENCE: 49 Met Gln Gly Lys Val Lys Trp Phe Asn Ala Glu Lys Gly Phe Gly Phe 1 5 10 15 Ile Glu Arg Glu Asp Gly Asp Asp Val Phe Val His Phe Ser Ala Ile 20 25 30 Asn Thr Asp Gly Phe Lys Thr Leu Asp Glu Gly Gln Ser Val Glu Phe 35 40 45 Asp Ile Val Glu Gly Ala Arg Gly Pro Gln Ala Ala Asn Val Thr Lys 50 55 60 Leu 65 <210> SEQ ID NO 50 <211> LENGTH: 204 <212> TYPE: DNA <213> ORGANISM: Corynebacterium glutamicum <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (1)..(204) <400> SEQUENCE: 50 atg gca cag ggt act gtg aaa tgg ttc aac ggc gaa aag gga ttt ggt 48 Met Ala Gln Gly Thr Val Lys Trp Phe Asn Gly Glu Lys Gly Phe Gly 1 5 10 15 ttc atc gct ccc aac gat ggc tcc gca gat ctc ttc gtc cac tac tct 96 Phe Ile Ala Pro Asn Asp Gly Ser Ala Asp Leu Phe Val His Tyr Ser 20 25 30 gag att cag ggc tcc ggt ttc cgt aat ctt gag gaa aac cag cca gtt 144 Glu Ile Gln Gly Ser Gly Phe Arg Asn Leu Glu Glu Asn Gln Pro Val 35 40 45 gaa ttt gag gtc ggc gag ggc gcc aag ggc cca cag gct cag cag gtt 192 Glu Phe Glu Val Gly Glu Gly Ala Lys Gly Pro Gln Ala Gln Gln Val 50 55 60 cgt gct ctc taa 204 Arg Ala Leu 65 <210> SEQ ID NO 51 <211> LENGTH: 67 <212> TYPE: PRT <213> ORGANISM: Corynebacterium glutamicum <400> SEQUENCE: 51 Met Ala Gln Gly Thr Val Lys Trp Phe Asn Gly Glu Lys Gly Phe Gly 1 5 10 15 Phe Ile Ala Pro Asn Asp Gly Ser Ala Asp Leu Phe Val His Tyr Ser 20 25 30 Glu Ile Gln Gly Ser Gly Phe Arg Asn Leu Glu Glu Asn Gln Pro Val 35 40 45 Glu Phe Glu Val Gly Glu Gly Ala Lys Gly Pro Gln Ala Gln Gln Val 50 55 60 Arg Ala Leu 65 <210> SEQ ID NO 52 <211> LENGTH: 384 <212> TYPE: DNA <213> ORGANISM: Corynebacterium glutamicum <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (1)..(384) <400> SEQUENCE: 52 atg cct gtc gga aca gtg aag tgg tac gac gcg gag cgt ggt ttc ggc 48 Met Pro Val Gly Thr Val Lys Trp Tyr Asp Ala Glu Arg Gly Phe Gly 1 5 10 15 ttt gtc tcc aat cca ggt ggt gaa gat tgc ttc gta ggt aag caa gta 96 Phe Val Ser Asn Pro Gly Gly Glu Asp Cys Phe Val Gly Lys Gln Val 20 25 30 ctt ccc aag gga gtc acc gaa ttg cac aag gga cag cga atc gat ttt 144 Leu Pro Lys Gly Val Thr Glu Leu His Lys Gly Gln Arg Ile Asp Phe 35 40 45 gac ttc gcc gca ggc cgt aag ggc cct caa gca ctt cga ata aag att 192 Asp Phe Ala Ala Gly Arg Lys Gly Pro Gln Ala Leu Arg Ile Lys Ile 50 55 60 ctt gaa act cca cgc agg cgt cca cag cac aaa tac aag cca gaa gag 240 Leu Glu Thr Pro Arg Arg Arg Pro Gln His Lys Tyr Lys Pro Glu Glu 65 70 75 80 ctc aac gga atg atc tct gac ctc atc acg ctt cta gaa agt gga gtg 288 Leu Asn Gly Met Ile Ser Asp Leu Ile Thr Leu Leu Glu Ser Gly Val 85 90 95 caa cca ggc ctt gcc aaa ggg caa tac ccg gag cac aaa gct gga gcg 336 Gln Pro Gly Leu Ala Lys Gly Gln Tyr Pro Glu His Lys Ala Gly Ala 100 105 110 cag gta gca gaa att ctt cgc gtt gtt gcg aag gag ctt gag tct taa 384 Gln Val Ala Glu Ile Leu Arg Val Val Ala Lys Glu Leu Glu Ser 115 120 125 <210> SEQ ID NO 53 <211> LENGTH: 127 <212> TYPE: PRT <213> ORGANISM: Corynebacterium glutamicum <400> SEQUENCE: 53 Met Pro Val Gly Thr Val Lys Trp Tyr Asp Ala Glu Arg Gly Phe Gly 1 5 10 15 Phe Val Ser Asn Pro Gly Gly Glu Asp Cys Phe Val Gly Lys Gln Val 20 25 30 Leu Pro Lys Gly Val Thr Glu Leu His Lys Gly Gln Arg Ile Asp Phe 35 40 45 Asp Phe Ala Ala Gly Arg Lys Gly Pro Gln Ala Leu Arg Ile Lys Ile 50 55 60 Leu Glu Thr Pro Arg Arg Arg Pro Gln His Lys Tyr Lys Pro Glu Glu 65 70 75 80 Leu Asn Gly Met Ile Ser Asp Leu Ile Thr Leu Leu Glu Ser Gly Val 85 90 95 Gln Pro Gly Leu Ala Lys Gly Gln Tyr Pro Glu His Lys Ala Gly Ala 100 105 110 Gln Val Ala Glu Ile Leu Arg Val Val Ala Lys Glu Leu Glu Ser 115 120 125 <210> SEQ ID NO 54 <211> LENGTH: 249 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: somewhat like E. coli CspA <400> SEQUENCE: 54 atggccggta aaatgactgg tatcgtaaaa tggttcaacg ctgacaaagg cttcggcttc 60 atcactcctg acgatggctc taaagatgtg ttcgtacact tctctgctat ccagaacgat 120 ggttacaaat ctctggacga aggtcagaaa gtgtccttca ccatcgaaag cggcgctaaa 180 ggcccggcag ctggtaacgt aaccagcctg aattcctcga gcgattacaa ggatgatgat 240 gataagtaa 249 <210> SEQ ID NO 55 <211> LENGTH: 82 <212> TYPE: PRT <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: E. coli CspA-like <400> SEQUENCE: 55 Met Ala Gly Lys Met Thr Gly Ile Val Lys Trp Phe Asn Ala Asp Lys 1 5 10 15 Gly Phe Gly Phe Ile Thr Pro Asp Asp Gly Ser Lys Asp Val Phe Val 20 25 30 His Phe Ser Ala Ile Gln Asn Asp Gly Tyr Lys Ser Leu Asp Glu Gly 35 40 45 Gln Lys Val Ser Phe Thr Ile Glu Ser Gly Ala Lys Gly Pro Ala Ala 50 55 60 Gly Asn Val Thr Ser Leu Asn Ser Ser Ser Asp Tyr Lys Asp Asp Asp 65 70 75 80 Asp Lys <210> SEQ ID NO 56 <211> LENGTH: 225 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: E. coli CspA-like <400> SEQUENCE: 56 atggccggta aaatgactgg tatcgtaaaa tggttcaacg ctgacaaagg cttcggcttc 60 atcactcctg acgatggctc taaagatgtg ttcgtacact tctctgctat ccagaacgat 120 ggttacaaat ctctggacga aggtcagaaa gtgtccttca ccatcgaaag cggcgctaaa 180 ggcccggcag ctggtaacgt aaccagcctg aattcctcga cctag 225 <210> SEQ ID NO 57 <211> LENGTH: 74 <212> TYPE: PRT <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: E. coli CspA-like protien <400> SEQUENCE: 57 Met Ala Gly Lys Met Thr Gly Ile Val Lys Trp Phe Asn Ala Asp Lys 1 5 10 15 Gly Phe Gly Phe Ile Thr Pro Asp Asp Gly Ser Lys Asp Val Phe Val 20 25 30 His Phe Ser Ala Ile Gln Asn Asp Gly Tyr Lys Ser Leu Asp Glu Gly 35 40 45 Gln Lys Val Ser Phe Thr Ile Glu Ser Gly Ala Lys Gly Pro Ala Ala

50 55 60 Gly Asn Val Thr Ser Leu Asn Ser Ser Thr 65 70 <210> SEQ ID NO 58 <211> LENGTH: 240 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: B. subtilis CspB-like <400> SEQUENCE: 58 atggtagaag gtaaagtaaa atggttcaac tctgaaaaag gtttcggatt catcgaagta 60 gaaggtcaag acgatgtatt cgttcatttc tctgctattc aaggcgaagg cttcaaaact 120 ttagaagaag gccaagctgt ttcttttgaa atcgttgaag gaaaccgcgg accacaagct 180 gctaacgtta ctaaagaagc gaattcctcg agcgattaca aggatgatga tgataagtaa 240 <210> SEQ ID NO 59 <211> LENGTH: 79 <212> TYPE: PRT <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: B. subtilis CspB-like <400> SEQUENCE: 59 Met Val Glu Gly Lys Val Lys Trp Phe Asn Ser Glu Lys Gly Phe Gly 1 5 10 15 Phe Ile Glu Val Glu Gly Gln Asp Asp Val Phe Val His Phe Ser Ala 20 25 30 Ile Gln Gly Glu Gly Phe Lys Thr Leu Glu Glu Gly Gln Ala Val Ser 35 40 45 Phe Glu Ile Val Glu Gly Asn Arg Gly Pro Gln Ala Ala Asn Val Thr 50 55 60 Lys Glu Ala Asn Ser Ser Ser Asp Tyr Lys Asp Asp Asp Asp Lys 65 70 75 <210> SEQ ID NO 60 <211> LENGTH: 216 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: B. subtilis CspB-like <400> SEQUENCE: 60 atggtagaag gtaaagtaaa atggttcaac tctgaaaaag gtttcggatt catcgaagta 60 gaaggtcaag acgatgtatt cgttcatttc tctgctattc aaggcgaagg cttcaaaact 120 ttagaagaag gccaagctgt ttcttttgaa atcgttgaag gaaaccgcgg accacaagct 180 gctaacgtta ctaaagaagc gaattcctcg acctag 216 <210> SEQ ID NO 61 <211> LENGTH: 71 <212> TYPE: PRT <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: B. subtilis CspB-like <400> SEQUENCE: 61 Met Val Glu Gly Lys Val Lys Trp Phe Asn Ser Glu Lys Gly Phe Gly 1 5 10 15 Phe Ile Glu Val Glu Gly Gln Asp Asp Val Phe Val His Phe Ser Ala 20 25 30 Ile Gln Gly Glu Gly Phe Lys Thr Leu Glu Glu Gly Gln Ala Val Ser 35 40 45 Phe Glu Ile Val Glu Gly Asn Arg Gly Pro Gln Ala Ala Asn Val Thr 50 55 60 Lys Glu Ala Asn Ser Ser Thr 65 70 <210> SEQ ID NO 62 <211> LENGTH: 213 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: E. coli CspA-like <400> SEQUENCE: 62 atggccggta aaatgactgg tatcgtaaaa tggttcaacg ctgacaaagg cttcggcttc 60 atcactcctg acgatggctc taaagatgtg ttcgtacact tctctgctat ccagaacgat 120 ggttacaaat ctctggacga aggtcagaaa gtgtccttca ccatcgaaag cggcgctaaa 180 ggcccggcag ctggtaacgt aaccagcctg tga 213 <210> SEQ ID NO 63 <211> LENGTH: 70 <212> TYPE: PRT <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: CspA-like protein <400> SEQUENCE: 63 Met Ala Gly Lys Met Thr Gly Ile Val Lys Trp Phe Asn Ala Asp Lys 1 5 10 15 Gly Phe Gly Phe Ile Thr Pro Asp Asp Gly Ser Lys Asp Val Phe Val 20 25 30 His Phe Ser Ala Ile Gln Asn Asp Gly Tyr Lys Ser Leu Asp Glu Gly 35 40 45 Gln Lys Val Ser Phe Thr Ile Glu Ser Gly Ala Lys Gly Pro Ala Ala 50 55 60 Gly Asn Val Thr Ser Leu 65 70 <210> SEQ ID NO 64 <211> LENGTH: 204 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: B. subtilis CspB-like <400> SEQUENCE: 64 atggtagaag gtaaagtaaa atggttcaac tctgaaaaag gtttcggatt catcgaagta 60 gaaggtcaag acgatgtatt cgttcatttc tctgctattc aaggcgaagg cttcaaaact 120 ttagaagaag gccaagctgt ttcttttgaa atcgttgaag gaaaccgcgg accacaagct 180 gctaacgtta ctaaagaagc gtga 204 <210> SEQ ID NO 65 <211> LENGTH: 67 <212> TYPE: PRT <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: B. subtilis CspB-like <400> SEQUENCE: 65 Met Val Glu Gly Lys Val Lys Trp Phe Asn Ser Glu Lys Gly Phe Gly 1 5 10 15 Phe Ile Glu Val Glu Gly Gln Asp Asp Val Phe Val His Phe Ser Ala 20 25 30 Ile Gln Gly Glu Gly Phe Lys Thr Leu Glu Glu Gly Gln Ala Val Ser 35 40 45 Phe Glu Ile Val Glu Gly Asn Arg Gly Pro Gln Ala Ala Asn Val Thr 50 55 60 Lys Glu Ala 65 <210> SEQ ID NO 66 <211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Primer for PCR <400> SEQUENCE: 66 aggtaataca ccatggccgg taa 23 <210> SEQ ID NO 67 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Primer for PCR <400> SEQUENCE: 67 ttaagcagag aattcaggct ggtt 24 <210> SEQ ID NO 68 <211> LENGTH: 7 <212> TYPE: PRT <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Flag tag for epitope tagging <400> SEQUENCE: 68 Asp Tyr Lys Asp Asp Asp Lys 1 5 <210> SEQ ID NO 69 <211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: PCR primer <400> SEQUENCE: 69 aggaggaaat tccatggtag aag 23 <210> SEQ ID NO 70 <211> LENGTH: 26 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: PCR primer <400> SEQUENCE: 70 tcaatttatg aattcgcttc tttagt 26 <210> SEQ ID NO 71 <211> LENGTH: 27 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: PCR primer <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (27)..(27) <223> OTHER INFORMATION: n=a,c,t, or g <400> SEQUENCE: 71

gggcactttg tacaagaaag ctgggtn 27 <210> SEQ ID NO 72 <211> LENGTH: 28 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: PCR primer <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (28)..(28) <223> OTHER INFORMATION: n=a,c,t, or g <400> SEQUENCE: 72 ggggcacttt gtacaagaaa gctgggtn 28 <210> SEQ ID NO 73 <211> LENGTH: 14 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: PCR primer <400> SEQUENCE: 73 cctgcaggac catg 14 <210> SEQ ID NO 74 <211> LENGTH: 17 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: PCR primer <400> SEQUENCE: 74 cctgcaggct cgagcta 17 <210> SEQ ID NO 75 <211> LENGTH: 43 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: PCR primer <400> SEQUENCE: 75 ggggacaagt ttgtacaaaa aagcaggctc ctgcaggacc atg 43 <210> SEQ ID NO 76 <211> LENGTH: 47 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: PCR primer <400> SEQUENCE: 76 ggggaccact ttgtacaaga aagctgggtc cctgcaggct cgagcta 47 <210> SEQ ID NO 77 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: PCR primer <400> SEQUENCE: 77 ccccaccctg caatgtga 18 <210> SEQ ID NO 78 <211> LENGTH: 31 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: PCR primer <400> SEQUENCE: 78 tgtgcatcct tttatttcat acattaatta a 31 <210> SEQ ID NO 79 <211> LENGTH: 30 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: PCR primer <400> SEQUENCE: 79 cctagacttg tccatcttct ggattggcca 30 <210> SEQ ID NO 80 <211> LENGTH: 16 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: PCR primer <400> SEQUENCE: 80 gcctgccgca gaccaa 16 <210> SEQ ID NO 81 <211> LENGTH: 20 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: PCR primer <400> SEQUENCE: 81 atgcagagct cagcttcatc 20 <210> SEQ ID NO 82 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: PCR primer <400> SEQUENCE: 82 tccagtacgt gcagtccctc ctcc 24 <210> SEQ ID NO 83 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: PCR primer <400> SEQUENCE: 83 cgtctacaat cagaaggcgt aatc 24 <210> SEQ ID NO 84 <211> LENGTH: 23 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: PCR primer <400> SEQUENCE: 84 ccaacaggtg aatgcttgat agg 23 <210> SEQ ID NO 85 <211> LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: PCR primer <400> SEQUENCE: 85 catgcgccgc tttgcttc 18 <210> SEQ ID NO 86 <211> LENGTH: 52 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: PCR primer <400> SEQUENCE: 86 gcgcaggcct agatgtacca tgtccggtaa aatgactggt atcgtaaaat gg 52 <210> SEQ ID NO 87 <211> LENGTH: 46 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: PCR primer <400> SEQUENCE: 87 cgcgaattcg gatccttatt acaggctggt tacgttacca gctgcc 46 <210> SEQ ID NO 88 <211> LENGTH: 53 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: PCR primer <400> SEQUENCE: 88 gcgcaggcct agatgtacca tgttagaagg taaagtaaaa tggttcaact ctg 53 <210> SEQ ID NO 89 <211> LENGTH: 51 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: PCR primer <400> SEQUENCE: 89 cgcgaattcg gatccttatt acgcttcttt agtaacgtta gcagcttgtg g 51 <210> SEQ ID NO 90 <211> LENGTH: 204 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic codons optimizing CspB for plant expression <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (1)..(204) <400> SEQUENCE: 90 atg gtg gag ggc aag gtg aag tgg ttc aac tcc gag aag ggc ttc ggc 48 Met Val Glu Gly Lys Val Lys Trp Phe Asn Ser Glu Lys Gly Phe Gly 1 5 10 15 ttc atc gag gtg gag ggt caa gac gat gtg ttc gtc cac ttc tcc gcc 96 Phe Ile Glu Val Glu Gly Gln Asp Asp Val Phe Val His Phe Ser Ala 20 25 30 atc cag ggc gaa ggg ttc aag acc ctg gaa gag ggg cag gcc gtc tcc 144 Ile Gln Gly Glu Gly Phe Lys Thr Leu Glu Glu Gly Gln Ala Val Ser 35 40 45 ttc gag atc gtc gag gga aac cgc ggt ccg cag gcc gcg aac gtc acg 192 Phe Glu Ile Val Glu Gly Asn Arg Gly Pro Gln Ala Ala Asn Val Thr

50 55 60 aag gaa gcg tga 204 Lys Glu Ala 65 <210> SEQ ID NO 91 <211> LENGTH: 67 <212> TYPE: PRT <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 91 Met Val Glu Gly Lys Val Lys Trp Phe Asn Ser Glu Lys Gly Phe Gly 1 5 10 15 Phe Ile Glu Val Glu Gly Gln Asp Asp Val Phe Val His Phe Ser Ala 20 25 30 Ile Gln Gly Glu Gly Phe Lys Thr Leu Glu Glu Gly Gln Ala Val Ser 35 40 45 Phe Glu Ile Val Glu Gly Asn Arg Gly Pro Gln Ala Ala Asn Val Thr 50 55 60 Lys Glu Ala 65 <210> SEQ ID NO 92 <211> LENGTH: 213 <212> TYPE: DNA <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic codons encoding CspA <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (1)..(213) <400> SEQUENCE: 92 atg gcc ggc aag atg acc ggc atc gtg aag tgg ttc aac gct gac aag 48 Met Ala Gly Lys Met Thr Gly Ile Val Lys Trp Phe Asn Ala Asp Lys 1 5 10 15 ggc ttc ggc ttc atc acg ccg gac gac ggc agc aag gat gtc ttc gtg 96 Gly Phe Gly Phe Ile Thr Pro Asp Asp Gly Ser Lys Asp Val Phe Val 20 25 30 cac ttc tcc gcc atc cag aac gac ggc tac aag tcc ctc gac gag ggc 144 His Phe Ser Ala Ile Gln Asn Asp Gly Tyr Lys Ser Leu Asp Glu Gly 35 40 45 cag aag gtc agc ttc acc atc gag agc ggc gcc aaa ggc ccg gcc gcc 192 Gln Lys Val Ser Phe Thr Ile Glu Ser Gly Ala Lys Gly Pro Ala Ala 50 55 60 ggt aac gtc acg tcg ctg tga 213 Gly Asn Val Thr Ser Leu 65 70 <210> SEQ ID NO 93 <211> LENGTH: 70 <212> TYPE: PRT <213> ORGANISM: Artificial sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic Construct <400> SEQUENCE: 93 Met Ala Gly Lys Met Thr Gly Ile Val Lys Trp Phe Asn Ala Asp Lys 1 5 10 15 Gly Phe Gly Phe Ile Thr Pro Asp Asp Gly Ser Lys Asp Val Phe Val 20 25 30 His Phe Ser Ala Ile Gln Asn Asp Gly Tyr Lys Ser Leu Asp Glu Gly 35 40 45 Gln Lys Val Ser Phe Thr Ile Glu Ser Gly Ala Lys Gly Pro Ala Ala 50 55 60 Gly Asn Val Thr Ser Leu 65 70 <210> SEQ ID NO 94 <211> LENGTH: 201 <212> TYPE: DNA <213> ORGANISM: Bacillus thuringiensis <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (1)..(201) <400> SEQUENCE: 94 atg caa aca ggt aaa gtt aaa tgg ttc aac agc gaa aaa ggt ttc ggt 48 Met Gln Thr Gly Lys Val Lys Trp Phe Asn Ser Glu Lys Gly Phe Gly 1 5 10 15 ttc atc gaa gtt gaa ggt gga gac gat gta ttc gtt cac ttc tca gct 96 Phe Ile Glu Val Glu Gly Gly Asp Asp Val Phe Val His Phe Ser Ala 20 25 30 atc caa ggt gac gga ttc aaa act tta gaa gaa ggt caa gaa gtt tct 144 Ile Gln Gly Asp Gly Phe Lys Thr Leu Glu Glu Gly Gln Glu Val Ser 35 40 45 ttc gaa atc gtt gaa ggt aac cgt gga cca caa gct gct aac gtt aca 192 Phe Glu Ile Val Glu Gly Asn Arg Gly Pro Gln Ala Ala Asn Val Thr 50 55 60 aaa aac taa 201 Lys Asn 65 <210> SEQ ID NO 95 <211> LENGTH: 66 <212> TYPE: PRT <213> ORGANISM: Bacillus thuringiensis <400> SEQUENCE: 95 Met Gln Thr Gly Lys Val Lys Trp Phe Asn Ser Glu Lys Gly Phe Gly 1 5 10 15 Phe Ile Glu Val Glu Gly Gly Asp Asp Val Phe Val His Phe Ser Ala 20 25 30 Ile Gln Gly Asp Gly Phe Lys Thr Leu Glu Glu Gly Gln Glu Val Ser 35 40 45 Phe Glu Ile Val Glu Gly Asn Arg Gly Pro Gln Ala Ala Asn Val Thr 50 55 60 Lys Asn 65


Patent applications by Mary Fernandes, St. Louis, MO US


User Contributions:

Comment about this patent or add new information about this topic:

CAPTCHA
New patent applications in this class:
DateTitle
2022-09-08Shrub rose plant named 'vlr003'
2022-08-25Cherry tree named 'v84031'
2022-08-25Miniature rose plant named 'poulty026'
2022-08-25Information processing system and information processing method
2022-08-25Data reassembly method and apparatus
New patent applications from these inventors:
DateTitle
2015-04-23Transgenic plants with enhanced agronomic traits
2014-09-04Methods for enhancing stress tolerance in plants and compositions thereof
2014-07-10Transgenic plants with enhanced agronomic traits
2012-09-06Transgenic plants with enhanced agronomic traits
2012-06-21Transgenic plants with enhanced agronomic traits
Website © 2025 Advameg, Inc.