Production of Stilbenoids

Abstract

A method for the production of a stilbenoid, such as resveratrol or pinosylvin, by fermenting plant material such a grape must using a yeast having a metabolic pathway producing said stilbenoid, separating a solids waste material from said fermentation and extracting said stilbenoid.

Description

[0001] The present invention relates to the production of stilbenoids by extraction thereof from wine making waste.

[0002] A number of strains of yeast which have been genetically engineered to produce one or more stilebenoids such as resveratrol and pinosylvin have been described. Thus, South African Patent 2004/8194 (University of Stellenbosch) and Becker et al disclosed a Saccharomyces cerevisiae for fermenting wine must having introduced therein a coumarate-coenzyme-A ligase encoding gene (4CL216) and a grapevine resveratrol synthase gene (vstl). WO2006/089898 disclosed a Saccharomyces cerevisiae also having introduced therein a gene encoding a phenylalanine or tyrosine-ammonia lyase (PAL/TAL) and a gene encoding a cinnamate 4-hydroxylase (C4H). WO2006/125000 discloses oleaginous cells having resveratrol production capacity. WO2008/009728 discloses a pinosylvin producing Saccharomyces cerevisiae having introduced therein a PAL, 4-coumarate CoA-ligase or cinnamate-CoA ligase, a pinosylvin synthase.

[0003] The extraction of resveratrol from grape seed and skin (marc) of red wine grapes has been proposed (Australian Harvest--Press release).

[0004] Beeckwilder et al disclose resveratrol production by a genetically engineered yeast and detection of resveratrol in the liquid culture medium. It was stated that resveratrol accumulated in the medium rather than in the cells.

[0005] Pretorius disclosed the possibility of developing wine yeasts producing resveratrol but indicated that the chances of success were unknown.

[0006] Becker et al disclosed a genetically modified yeast which produced glycosylated resveratrol during fermentation of a culture medium containing coumaric acid, and discussed the possibility of fermenting grapes with such a modified yeast in the hope of producing wine containing more than a normal level of resveratrol. Glycosylated resveratrol production was demonstrated by extraction from yeast cells grown in culture medium.

[0007] Further sources of stilbenoids are desirable. There is now provided according to the present invention a method for the production of a stilbenoid, comprising extracting said stilbenoid from a solids waste material separated from a fermentation of plant material conducted using a yeast having a metabolic pathway producing said stilbenoid.

[0008] The term `solids waste material` refers to a waste material containing undissolved solids, optionally with significant quantities of free liquid such that the waste material may be flowable or not, including pastes or slurries as well as embracing dry solids. `Waste material` includes any material that is not the desired end product of the fermentation (which will typically be wine or beer of some form) and includes residual plant material mixed with yeast cells (live or dead).

[0009] The method may further comprise the preliminary steps of conducting said fermentation of plant material using a said yeast having a metabolic pathway producing said stilbenoid and separating a solids waste material from said fermentation. The solids waste material may comprise yeast solids and plant material solids.

[0010] Preferably, the fermentation is a fermentation of fruit must together with or separated from pommace or is a fermentation of pommace separated from fruit must. The fruit may for instance be grape, apple or pear. The fermentation may be a beer making fermentation, all forms of beer being included, whether obtained by the use of a top fermenting yeast or a bottom fermenting yeast.

[0011] Methods for extracting stilbenoids, including resveratrol and pinosylvin, are described in the above publications. Suitable solvents include esters such as ethyl acetate or a solvent as described in GB 0714671.5, i.e. an ester which preferably is of the general formula R⁶--COO--R⁷, and R⁶ is H or an aliphatic straight or branched chain hydrocarbon moiety of from 1-6 carbon atoms and R' is an aliphatic straight or branched chain hydrocarbon moiety of from 2-16 carbon atoms, or a heteroatom containing hydrocarbon moiety of from 2 to 16 carbon atoms or an aromatic or heteroaromatic moiety of from 5 to 16 carbon atoms. R⁷ may have from 3 to 9 carbon atoms. R⁶ may have from 1 to 4 carbon atoms.

[0012] Preferably, said ester is an octyl acetate, especially n-octyl acetate.

[0013] Optionally, said liquid comprises or further comprises an alkane. It may consist of a said alkane and a said ester. Said alkane may be a C₆ to C₁₆ straight or branched chain alkane, e.g. a C_9-14 alkane, e.g. a C 2 alkane. Preferably, said alkane is n-dodecane.

[0014] The stilbenoid producing yeast may be as described in any of the above publications or genetically engineered according to the principles or practice there described. In particular, it may be a resveratrol producing yeast as described generally or by way of example in WO2006/089898 or a pinosylvin producing yeast as described generally or by way of example in WO2008/009728.

[0015] Preferably therefore, the yeast may be one having an operative metabolic pathway comprising at least one enzyme activity, said pathway producing 4-coumaric acid and producing resveratrol therefrom, or an oligomeric or glycosidically-bound derivative thereof preferably by a reaction catalysed by an enzyme in which endogenous malonyl-CoA is a substrate. Preferably the resveratrol is produced from 4-coumaroyl-CoA by a resveratrol synthase expressed in said micro-organism from nucleic acid coding for said enzyme which is not native to the yeast.

[0016] The 4-coumaric acid may be produced from trans-cinnamic acid by a cinnamate 4-hydroxylase not native to the yeast.

[0017] 4-coumaric acid may be produced from tyrosine in a reaction catalysed by a L-phenylalanine ammonia lyase or a tyrosine ammonia lyase not native to the yeast. Trans-cinnamic acid may be produced from L-phenylalanine in a reaction catalysed by a L-phenylalanine ammonia lyase not native to the yeast. 4-coumaroyl-CoA may be formed in a reaction catalysed by a 4-coumarate-CoA ligase introduced into the yeast.

[0018] A native NADPH:cytochrome P450 reductase (CPR) may be expressed in the yeast or may recombinantly introduced.

[0019] Thus, the yeast may be one containing one or more copies of an heterologous DNA sequence encoding phenylalanine ammonia lyase operatively associated with an expression signal, and containing one or more copies of an heterologous DNA sequence encoding cinnamate-4-hydroxylase operatively associated with an expression signal, and containing one or more copies of an heterologous DNA sequence encoding 4-coumarate CoA-ligase operatively associated with an expression signal, and containing one or more copies of an heterologous DNA sequence encoding resveratrol synthase operatively associated with an expression signal, or may be one lacking cinnamate-4-hydroxylase activity, and containing one or more copies of a heterologous DNA sequence encoding tyrosine ammonia lyase operatively associated with an expression signal, and containing one or more copies of an heterologous DNA sequence encoding 4-coumarate CoA-ligase operatively associated with an expression signal, and containing one or more copies of an heterologous DNA sequence encoding resveratrol synthase operatively associated with an expression signal.

[0020] For the production of pinosylvin, the yeast may have an operative metabolic pathway comprising at least one enzyme activity, said pathway producing pinosylvin from cinnamic acid and preferably producing cinnamic acid and produces pinosylvin therefrom. Said pinosylvin may be produced in a reaction catalysed by an enzyme in which endogenous malonyl-CoA is a substrate, suitably from cinnamoyl-CoA by a stilbene synthase, suitably expressed in the yeast from nucleic acid coding for said enzyme which is not native to the yeast.

[0021] Cinnamic acid is preferably produced in said pathway from L-phenylalanine in a reaction catalysed by a L-phenylalanine ammonia lyase (PAL) which may be not native to the yeast.

[0022] Said PAL is preferably one accepting phenylalanine as a substrate and producing cinnamic acid therefrom, such that if the PAL also accepts tyrosine as a substrate and forms coumaric acid therefrom, the ratio

Km(phenylalanine)/Km(tyrosine) for said PAL is less than 1:1 and preferably such that the ratio K_cat(PAL)/K_cat(C4H) is at least 2:1.

[0023] Cinnamoyl-CoA may be formed in a reaction catalysed by a 4-coumarate-CoA ligase or a cinnamoyl-CoA ligase which may be not native to the yeast.

[0024] Any or all of at least one copy of a genetic sequence encoding a phenylalanine ammonia lyase, at least one copy of a genetic sequence encoding a 4-coumarate-CoA ligase or cinnamate-CoA ligase, at least one copy of a genetic sequence encoding a resveratrol synthase or a pinosylvin synthase may be present operatively linked to an expression signal not natively associated with said genetic sequence.

[0025] Thus the yeast may be one containing one or more copies of an heterologous DNA sequence encoding phenylalanine ammonia lyase operatively associated with an expression signal, and containing one or more copies of an heterologous DNA sequence encoding 4-coumarate CoA-ligase or cinnamate-CoA ligase operatively associated with an expression signal, and containing one or more copies of an heterologous DNA sequence encoding resveratrol synthase operatively associated with an expression signal or may be one containing one or more copies of an heterologous DNA sequence encoding phenylalanine ammonia lyase operatively associated with an expression signal, and containing one or more copies of an heterologous DNA sequence encoding 4-coumarate CoA-ligase or cinnamate-CoA ligase operatively associated with an expression signal, and containing one or more copies of an heterologous DNA sequence encoding pinosylvin synthase operatively associated with an expression signal.

[0026] In all cases, expression of the gene ACC1 may be boosted to increase the pool of malonyl-CoA available in the metabolic pathway.

[0027] The yeast may be of the genus Saccharomyces and may be of the species Saccharomyces cerevisiae, S. kluyveri, S. bayanus, S. exiguus, S. sevazzi, or S. uvarum or others, especially any conventionally used in brewing or wine making.

[0028] The accompanying drawings show results obtained in the examples as follows:

[0029] FIG. 1 shows a divergent fusion fragment formed between a TEF2 promoter and TDH3 promoter;

[0030] FIG. 2 shows HPLC chromatograms of pulp extract obtained in Example 14 with Absorbance plotted against retention time;

[0031] FIG. 3 shows further chromatograms obtained in Example 14 showing UV spectra of pinosylvin peaks in waste stream extracts (pulp sample and sediment sample) and of a standard; and

[0032] FIG. 4 shows still HPLC chromatograms of sediment obtained in Example 14 with Absorbance plotted against retention time.

[0033] The invention will be illustrated by the following non-limiting examples.

EXAMPLES

Example 1

Isolation of Genes Encoding PAL2, C4H, AR2, 4CL and VST1

[0034] Phenylalanine ammonia lyase (PAL2) (Cochrane et al., 2004) (SEQ ID NO 1), cinnamate 4-hydroxylase (C4H) (Mizutani et al, 1997) (SEQ ID NO 2), cytochrome P450 reductase (AR2)(Mizutani and Ohta, 1998) (SEQ ID NO 3), 4-coumarate:coenzymeA ligase (4CL) (Hamberger and Hahlbrock 2004; Ehlting et al., 1999) (SEQ ID NO 4) were isolated via PCR from A. thaliana cDNA (BioCat, Heidelberg, Germany) using the primers in table 1.

[0035] The codon optimized VST1 gene encoding Vitis vinifera (grapevine) resveratrol synthase (Hain et al., 1993) (SEQ ID NO 5) for expression in S. cerevisiae was synthesized by GenScript Corporation (Piscataway, N.J.). The synthetic VST1 gene was delivered inserted in E. coli pUC57 vector flanked by BamH1 and Xho1 restriction sites. The synthetic gene was purified from the pUC57 vector by BamH1/Xho1 restriction and purified from agarose gel using the QiaQuick Gel Extraction Kit (Qiagen).

TABLE-US-00001 TABLE 1 Primer for amplification of gene (Restriction sites are underlined) Gene 5-CG GAATTC CGTACG TA ATG GAT CAA ATC PAL2 GAA GCA ATG TT SEQ ID NO: 10 5-CG ACTAGT TTA GCA AAT CGG AAT CGG AGC PAL2 SEQ ID NO: 11 5-CG CTCGAG GCGGCCGC TAAAAT ATG GAC CTC C4H CTC TTG CTG GAG SEQ ID NO: 12 5-AGTAGAIGGAGTAGATGGAGTAGATGGAGTAGATGG C4H ACA GTT CCT TGG TTT CAT AAC G SEQ ID NO: 13 5-CCATCTACTCCATCTACTCCATCTACTCCATCTACT AR2 AGG AGA TCC GGT TCT GGG A SEQ ID NO: 14 5-CG GGTACCAT TTA CCA TAC ATC TCT AAG AR2 ATA TCT TCC SEQ ID NO: 15 5' GCGAATTCTTATGACGACACAAGATGTGATAGTCAA 4CL TGAT SEQ ID NO: 16 5' GCACTAGTATCCTAGTTCATTAATCCATTTGCTAG 4CL TCTTGC SEQ ID NO: 17

[0036] The coding sequence of tyrosine ammonia lyase (TAL) from Rhodobacter capsulatus (Kyndt et al., 2002; is codon optimized for expression in S. cerevisiae using the online service backtranslation tool at www.entelechon.com, yielding sequence SEQ ID NO: 6)

Example 2

Construction of a Yeast Vector for Galactose Induced Expression of PAL2 and C4H:AR2 Fusion Gene

[0037] The gene encoding PAL2 was amplified from cDNA from A. thaliana as template using forward primer 5-CG GAATTC CGTACG TA ATG GAT CAA ATC GAA GCA ATG TT-3 SEQ ID NO 29 and reverse primer 5-CG ACTAGT TTA GCA AAT CGG AAT CGG AGC-3 SEQ ID NO 30. The amplified PAL2 PCR-product was digested with EcoR1/Spe1 and ligated into EcoR1/Spe1 digested pESC-URA vector (Stratagene), resulting in vector pESC-URA-PAL2. Two different clones of pESC-URA-Pal2 were sequenced to verify the sequence of the cloned gene.

[0038] C4H was amplified using cDNA from A. thaliana as template using forward primer 5-CG CTCGAG GCGGCCGC TAAAAT ATG GAC CTC CTC TTG CTG GAG-3 SEQ ID NO 31 and reverse primer 5-AGTAGATGGAGTAGATGGAGTAGATGGAGTAGATGG ACA GTT CCT TGG TTT CAT AAC G-3 SEQ ID NO 32. AR2 was amplified using cDNA from A. thaliana as template using forward primer 5-CCATCTACTCCATCTACTCCATCTACTCCATCTACT AGG AGA TCC GGT TCT GGG A-3 SEQ ID NO 33 and reverse primer 5'-CG GGTACCAT TTA CCA TAC ATC TCT AAG ATA TCT TCC-3 SEQ ID NO 34. The amplified PCR products C4H and AR2 were used as templates for the creation of the fusion gene C4H:AR2 using the forward primer 5-CG CTCGAG GCGGCCGC TAAAAT ATG GAC CTC CTC TTG CTG GAG-3 SEQ ID NO 35 and the reverse primer 5-CG GGTACC AT TTA CCA TAC ATC TCT AAG ATA TCT TCC-3 SEQ ID NO 36.

[0039] The fusion gene C4H:AR2 gene was digested with XhoI/KpnI and ligated into XhoI/KpnI digested pESC-URA-PAL2. The resulting plasmid, pESC-URA-PAL2-C4H:AR2, contained the genes encoding PAL2 and C4H:AR2 under the control of the divergent galactose induced <=GAL1/GAL10=> promoters. The sequence of the gene encoding C4H:AR2 was verified by sequencing of two different clones of pESC-URA-PAL2-C4H:AR2.

Example 3

Construction of a Yeast Vector for Galactose Induced Expression of 4CL1 and VST1

[0040] The gene encoding 4CL was isolated as described in example 1. The amplified 4CL PCR-product was digested with EcoR1/Spe1 and ligated into EcoR1/Spe1 digested pESC-HIS vector (Stratagene), resulting in vector pESC-HIS-4CL.

[0041] Two different clones of pESC-HIS-4CL were sequenced to verify the sequence of the cloned gene.

[0042] The gene encoding VST1 was isolated as described in example 1. The amplified synthetic VST1 gene was digested with BamH1/Xho1 and ligated into BamH1/Xho1 digested pESC-HIS-4CL. The resulting plasmid, pESC-HIS-4CL-VST1, contained the genes encoding 4CL and VST1 under the control of the divergent galactose induced <=GAL1/GAL10=> promoters. The sequence of the gene encoding VST1 was verified by sequencing of two different clones of pESC-HIS-4CL-VST1.

Example 4

Construction of Strong Constitutive Promoter Fragment TDH3

[0043] The 600 base pair TDH3 (GPD) promoter was amplified from S. cerevisiae genomic DNA using the forward primer 5'GC GAGCTC AGT TTA TCA TTA TCA ATA CTC GCC ATT TCA AAG SEQ ID NO: 18 containing a Sac1 restriction site and the reverse primer 5'-CG TCTAGA ATC CGT CGA AAC TAA GTT CTG GTG TTT TAA AAC TAA AA SEQ ID NO: 19 containing a Xba1 restriction site. The amplified TDH3 fragment was digested with Sac1/Xba1 and ligated into Sac1/Xba1 digested plasmid pRS416 (Sikorski and Hieter, 1989) as described previously (Mumberg et al, 1995) resulting in plasmid pRS416-TDH3.

Example 5

Construction of Constitutive Strong Promoter Fragment TEF2

[0044] The 400 base pair TEF2 promoter was amplified from S. cerevisiae genomic DNA using the forward primer 5'-GC GAGCTC ATA GCT TCA AAA TGT TTC TAC TCC TTT TTT ACT CTT SEQ ID NO: 20 containing a Sac1 restriction site and the reverse primer 5'-CG TCTAGA AAA CTT AGA TTA GAT TGC TAT GCT TTC TTT CTA ATG A SEQ ID NO: 21 containing a Xba1 restriction site. The amplified TEF2 fragment was digested with Sac1/Xba1 and ligated into Sac1/Xba1 digested plasmid pRS416 (Sikorski and Hieter, 1989) as described previously (Mumberg et al, 1995) resulting in plasmid pRS416-TEF2.

Example 6

Construction of Fused Divergent Constitutive TEF and TDH3 Promoter Fragment

[0045] A divergent fusion fragment (FIG. 1) between TEF2 promoter and TDH3 promoter was constructed starting from PRS416-TEF and PRS416-TDH3.

[0046] The 600 base pair TDH3 fragment was reamplified from PRS416-TDH3 using the forward primer 5' TTGCGTATTGGGCGCTCTTCC GAG CTC AGT TTA TCA TTA TCA ATA CTC GC SEQ ID NO: 22 containing the underlined overhang for fusion PCR to TEF2 fragment and the reverse primer 5' AT GGATCC TCT AGA ATC CGT CGA AAC TAA GTT CTG SEQ ID NO: 23 containing the underlined BamH1 restriction site. This resulted in a fragment ready for fusion to the below TEF2 fragment.

[0047] The 400 base pair TEF2 fragment including a 277 base pair spacer upstream of the Sad restriction site was reamplified from PRS416-TEF2 using the forward primer 5' AT GAATTC TCT AGA AAA CTT AGA TTA GAT TGC TAT GCT TTC SEQ ID NO: 24 containing the underlined EcoR1 restriction site and the reverse primer 5' TGA TAA TGA TAA ACT GAG CTC GGA AGA GCG CCC AAT ACG CAA AC SEQ ID NO: 25 containing the underlined overhang for fusion to the TDH3 fragment. This resulted in a 680 base pair fragment ready for fusion to the TDH3 fragment.

[0048] The 680 base pair TEF2 fragment and the 600 base pair TDH3 fragments were joined together (fused) using fusion PCR with the forward primer 5' AT GAATTC TCT AGA AAA CTT AGA TTA GAT TGC TAT GCT TTC SEQ ID NO 37 and the reverse primer 5' AT GGATCC TCT AGA ATC CGT CGA AAC TAA GTT CTG SEQ ID NO: 26, resulting in the divergent fragment <=TEF2/TDH3=> (Sequence ID NO 7).

Example 7

Construction of a Yeast Vector for Constitutive Expression of PAL2 and C4H:AR2 Fusion Gene

[0049] The vector pESC-URA-PAL2-C4H:AR2 with divergent galactose inducible promoters GAL1/GAL10 was sequentially digested with NotI and BsiWI to remove the GAL1/GAL10 promoters.

[0050] The divergent constitutive <=TEF2/TDH3=> promoter fragment (Example 6) was re-amplified with forward primer 5-GC CGTACG TCT AGA AAA CTT AGA TTA GAT TGC TAT GCT TTC-3 SEQ ID NO: 27 and reverse primer 5-ATT GCGGCCGC TCT AGA ATC CGT CGA AAC TAA GTT CTG-3 SEQ ID NO: 28. The resulting PCR product was sequentially digested with NotI and BsiWI and ligated into the above vector without the GAM/Gall° fragment. This resulted in a vector pESC-URA-TEF-PAL2-TDH3-C4H:AR2 with replaced promoters, from GAM/Gall° to TEF2/TDH3 Sequence ID NO 8).

Example 8

Construction of a Yeast Vector for Constitutive Expression of a TAL Gene

[0051] The vector pESC-URA-TAL with divergent galactose inducible promoters GAL1/GAL10 is sequentially digested with EcoRI and BamHI to remove the GAL1/GAL10 promoters.

[0052] The divergent constitutive <=TEF2/TDH3=> promoter fragment (Example 6) was sequentially digested with EcoR1 and BamH1 and ligated into the above BamHI/EcoRI linearized pESC-URA-TAL vector without the GAL1/GAL10 fragment. This resulted in a vector pesc-URA-TEF-TAL with replaced promoters, from GAL1/Ga110 to TEF2/TDH3.

Example 9

Construction of a Yeast Vector for Constitutive Expression Induced of 4CL and VST1

[0053] The vector pESC-HIS-4CL-VST1 with divergent galactose inducible promoters GAL1/GAL10 was sequentially digested with EcoR1 and BamH1 to remove the GAL1/GAL10 promoters.

[0054] The divergent constitutive <=TEF2/TDH3=> promoter fragment (Example 6) was sequentially digested with EcoR1 and BamH1 and ligated into the above linearized vector without the GAL1/GAL10 fragment. This resulted in a vector pesc-HIS-TEF2-4CL-TDH3-VST1 with replaced promoters, from GAL1/Gal10 to TEF2/TDH3 SEQ ID NO 9).

Example 10

Generation of a Strain with Constitutive Expression of the Phenylpropancid Pathway from Phenylalanine to Resveratrol in the Yeast S. Cerevisiae

[0055] The transformation of the yeast cell was conducted in accordance with methods known in the art, for instance by using lithium acetate transformation method (Gietz and Schiestl, 1991). S. cerevisiae strain FS01528 (CEN.PK MATa ura3 His3) was co-transformed with pESC-URA-TEF-PAL2-TDH3-C4H:AR2 (example 7) and pesc-HIS-TEF2-4CL-TDH3-VST1 (example 9), and the transformed strain was named FS09215. Transformants were selected on medium lacking uracil and histidine and streak purified on the same medium.

Example 11

Generation of a Strain with Constitutive Expression of the Phenylpropancid Pathway from Tyrosine to Resveratrol in the Yeast S. Cerevisiae

[0056] The transformation of the yeast cell is conducted in accordance with methods known in the art, for instance by using lithium acetate transformation method (Gietz and Schiestl, 1991). S. cerevisiae strain FS01528 (CEN.PK MATa ura3 His3) is co-transformed with pESC-URA-TEF-TAL (example 8) and pesc-HIS-TEF2-4CL-TDH3-VST1 (example 9), to obtain strain TEF2-TAL-TEF2-4CL-TDH3-VST1. Transformants are selected on medium lacking uracil and histidine and streak purified on the same medium.

Example 12

HPLC Determination of Stilbenoids, Phenylpropanoids and Ethanol

[0057] For quantitative analysis of cinnamic acid, trans-resveratrol and trans-pinosylvin, samples were subjected to separation by high-performance liquid chromatography (HPLC) Agilent Series 1100 system (Hewlett Packard) prior to uv-diode-array detection at 2=306 nm. A Phenomenex (Torrance, Calif., USA) Luna 2.5 micrometer C18 (100×2.00 mm) column was used at 60° C. As mobile phase a non linear S-shaped gradient of acetonitrile and milliQ water (both containing 50 ppm trifluoroacetic acid) was used at a flow of 0.8 ml/min. The S-shaped gradient profile was from 10% to 100% acetonitrile in 5 minutes. The elution time was approximately 3.0 minutes for trans-resveratrol and 4.4 minutes trans-pinosylvin. Pure pinosylvin standard (>95% pure) was purchased from ArboNova (Turku, Finland) and pure trans-resveratrol standard was purchased from Sigma.

[0058] The grape-must was analysed for the content of ethanol by HPLC using an Aminex HPX-87H ion-exclusion column (Bio-Rad, Hercules, Calif.) at 60° C., with 5 mM H2SO4 as a mobile phase at a flow rate of 0.6 ml/min. The ethanol was detected by a refractometer (Shodex RI-71).

Example 13

Generation of Biomass

[0059] Yeast strains FS01201 (CEN.PK 113-7D wild type non modified control strain) was kept on YPD agar plates with 20 g/l glucose. FS09215 (genetically modified resveratrol producer from example 10) was kept on SC-HIS-URA agar plates with 20 g/l glucose.

[0060] The two yeast strains were grown in 10-16 500 ml shake flasks with 200 ml DELFT medium (Verduyn et al, 1992) containing 45 g/l glucose, 30 g/l ammonium sulphate, 14 g/l KH₂PO₄, and 1.5 g/l MgSO₄ for 4 days at 30° C. and 150 rpm. A paste of wet weight cells was collected (harvested) by centrifugation at 3000 g for 5 minutes in 50 ml Sartorious tubes and discarding the supernatant after each round. After repetitive rounds of centrifugation 26 g wet weight was collected of strain FS01201 and 24 g wet weight of FS09215.

Example 14

Production of Red Wine from Grapes Using a S. Cerevisiae Strain with Constitutive Expression of the Phenylpropanoid Pathway from Phenylalanine to Resveratrol

[0061] Commercially available seedless "Crimson" grapes (product of Brazil), were used to produce two red wine's: a control wine produced by using strain FS01201 and a stilbenoid-enriched wine by using strain FS09215 as described in example 10. Said strain harbours a phenylpropanoid pathway comprising an oxygen-dependent cinnamate-4-hydroxylase (C4H) that converts cinnamic-acid in coumaric-acid. Hence, under the oxygen-deprived conditions that typically prevail in the anaerobic fermentation-process used for wine-making, said strain can only produce resveratrol if endogenous coumaric acid is present in the grape-pulp and grape-must. With a lack of sufficient oxygen, however, said strain has the potential of producing pinosylvin, that is derived from cinnamic acid.

Preparation of Starter Culture

[0062] A starter culture of strain FS01201 and FS09215 was prepared by crushing 2 kilo's of grapes and filtering the resulting grape pulp with a loose-woven cotton cloth (cheesecloth) and subsequently collecting the grape juice in a sterile open plastic bucket. An aliquot of 500 ml of grape juice was enriched with 40 grams of glucose and divided into two aliquots of 250 ml that were transferred to two sterile 500 ml-shakeflasks. The shakeflasks were inoculated with approximately 2 grams wet-weight of cells from either FS01201 or FS09215 as prepared according to example 13, and incubated for approximately 24 hours at room temperature. Activity of yeast was indicated by formation of CO₂ resulting in a foam-layer.

Primary Pulp Fermentation

[0063] A pulp of grapes was prepared by disrupting 16 kilo's of grapes with a semi-professional kitchen blender. The resulting grape-pulp was enriched with approximately 2 coffee-spoons of "yeast nutrient" (stimulates yeast growth) and 3 coffee-spoons of "pecto-enzymes" (breaks down pectin in the grape skin). Both the pecto-enzymes and yeast nutrient were part of a commercially available wine-making kit. Said enriched grape-pulp was divided into two equal aliquots, approximately 7 to 8 litre each, and transferred into two 10 litre plastic round sterilized containers that were open at the top. A pulp-fermentation was initiated by adding the total amount of 250 ml of starter culture to the grape pulp, and mixing it well together with a large spoon; one bucket was inoculated with F501201, and the other with FS09215.

[0064] The progression of the pulp-fermentation was visually monitored on a daily basis, and the appearance of a foam-layer on the top, caused by CO₂ formation, indicated that the fermentation was successfully ongoing. The CO₂ formation caused the grape-pulp to float on top of the grape-juice, and therefore the pulp was mixed with a large spoon on a daily basis as well. Formation of foam ceased after 9 days, and the grape-pulp "fluidized", which indicated that almost al grape-sugars were consumed and the pulp-fermentation was near its end. The grape pulp, therefore, was separated from the liquid fraction (containing the juice and the yeast, i.e. the grape-must) by using a cheesecloth. For each strain approximately 5.5 to 6 litre of grape-must was collected. The fermented juice was analyzed for the content of alcohol and stilbenoids. The FS01201- and FS09215 grape-must contained 84.01 g/l (i.e. 10.6 vol %) of ethanol and 79.65 g/l (i.e. 10.1 vol %) respectively. The development of ethanol formation during the pulp fermentation is listed in table 2 below.

TABLE-US-00002 TABLE 2 Ethanol formation in primary pulp fermentation FS01201 FS09215 g/l vol % g/l vol % Day 6 69.87 8.86 68.72 8.71 Day 7 83.69 10.61 81.8 10.37 Day 8 81.44 10.32 81.68 10.35 Day 9 84.01 10.65 79.65 10.10

[0065] Furthermore, no stilbenoids were found in either grape-must, however, low levels of cinnamic acid (1.05 mg/l) were determined in the FS09215 grape-must. For the FS01201 and FS09215 pulp-fermentation, a total of 1757 grams and 1780 grams wet-weight of grape-pulp was collected respectively. The grape pulp and approximately 1.5 litre of the remaining grape-must were stored at 4° C.

Secondary Grape-Must Fermentation

[0066] The fermentation was now continued with the grape-must. In order to enhance the alcohol percentage to a level that is usually found in commercial red wines (12- to 15 vol %), an aliquot of 3.5 litre of grape-must of either pulp fermentation was enriched with approximately 340 g of commercially available sugar ("Dansukker", dissolved and heated in approximately 300 ml of water). The addition of the extra sugar caused a dilution of the grape-must, resulting in a slight reduction of ethanol titers. Said enriched grape-must was transferred to a 5 litre glass-bottle that was stoppered with a "water-lock" to enable release of CO2, but at the same time preventing contamination. After 4 days the ethanol concentration rose to 99.46 g/l (i.e. 12.6 vol %) and 102.78 g/l (i.e. 13.0 volt). To enhance the ethanol concentration even further, a second addition was made: 150 grams of sugar ("Dansukker") was dissolved into 1400 ml of the previously stored non-enriched grape-must, which was then subsequently added to the fermentation glass-bottle. The total volume of the grape-must was now approximately 5 litres, and with that almost completely filled the glass bottle leaving no room for air in the top of the bottle. The addition of the extra sugar caused a dilution of the grape-must, resulting in a slight reduction of ethanol titers. After a further 8 days, foam formation (i.e. CO₂ formation) ceased completely, indicating that the fermentation was finished and that all sugars were depleted. The final ethanol concentration was 116.06 g/l (i.e. 14.7 vol %) and 109.64 g/l (i.e. 13.9 vol %), as listed in table 3.

TABLE-US-00003 TABLE 3 Ethanol-, phenylpropanoid- and stilbenoid formation in secondary grape-must fermentation FS01201 FS09215 ethanol (g/l) ethanol (vol %) ethanol (g/l) ethanol (vol %) cinnamic acid (mg/l) pinosylvin (mg/l) Day 10 82.39 10.44 85.21 10.80 1.19 0.62 Day 11 91.52 11.60 91.72 11.62 1.51 0.62 Day 12 99.73 12.64 98.2 12.45 not analyzed not analyzed Day 13 99.46 12.61 102.78 13.03 not analyzed not analyzed Day 14 97.58 12.37 92.04 11.67 1.36 0.57 Day 15 98.21 12.45 96.06 12.17 not analyzed not analyzed Day 16 108.07 13.70 100.86 12.78 1.64 0.57 Day 17 109.45 13.87 104.22 13.21 1.72 0.60 Day 18 120.48 15.27 111.6 14.14 1.63 0.60 Day 20 121.79 15.44 111.84 14.17 1.76 0.57 Day 21 116.06 14.71 109.64 13.90 1.90 0.60

[0067] The reference strain FS01201 did neither produce phenylpropanoid-intermediates nor stilbenoids. The chromatograms of the grape-must of FS09215 contained a peak with a similar retention time as pinosylvin; indeed said peak with retention time of 4.4 minutes, displayed a UV-spectrum that was identical to pinosylvin. Similarly, the presence of cinnamic acid was confirmed as well. Quantification of the peaks indicated that the grape-must of strain FS09215 contained cinnamic acid and pinosylvin in final concentrations of 1.90 mg/l and 0.60 mg/l respectively (Table 3). Neither resveratrol nor coumaric acid could be detected, indicating that the activity of C4H was hampered by the anaerobic conditions. Furthermore, the lack of resveratrol and coumaric acid suggested that no endogenous coumaric acid was present in the grape-must of the "Crimson" grapes used for this experiment.

[0068] In both fermentations, sediment settled on the bottom, which likely composed of small-size particle grape-residues and yeast cells. Said sediment was isolated from the grape-must by siphoning, and approximately 300 ml could be collected for either fermentation. The sediments were stored at 4° C. until further analysis on stilbenoid content.

Analysis of Waste-Stream for the Presence of Stilbenoids

[0069] Approximately 125 grams of the grape pulp that was generated in the primary pulp fermentation was extracted over night with 30 ml of ethyl acetate (divided in three 50 ml Sartorious tubes) using a rotary unit at ambient temperature (24° C.). The extraction tubes were covered with aluminium foil to avoid any light induced degradation of stilbenoids. The following day the extraction mixture was centrifuged at 3800×g for 10 minutes, and the upper, yellow/greenish coloured, ethyl acetate was collected and pooled into one tube. From the initial 30 ml ethyl acetate, approximately 28 ml extract was collected for the FS1201 grape-pulp suspension, and 30 ml of ethyl acetate for the FS09215 grape-pulp suspension. Said ethyl acetate fractions were reduced in volume by evaporation for 2 hours, using a freeze dryer, until a dry residue was obtained.

[0070] The dry, dark coloured, residue was dissolved in 500 microlitre 50% ethanol which resulted in a solution that contained non-dissolved dark precipitates. The solution was whirly-mixed and centrifuged at 13000×g for 5 minutes and the supernatant was diluted 5-fold with 50% ethanol. Said procedure resulted in a clear yellowish solution that could be used for HPLC analysis.

[0071] The grape-pulp of the control strain FS01201 did neither contain stilbenoids nor cinnamic- or coumaric acid (FIG. 6).

[0072] The chromatogram of the grape-pulp of FS09215 contained a peak with a similar retention time as pinosylvin; indeed said peak with retention time of 4.4 minutes, displayed a UV-spectrum that was identical to pinosylvin (FIGS. 6 and 7). Similarly, the presence of cinnamic acid was confirmed as well. Quantification of the peaks indicated that the grape-pulp contained cinnamic acid and pinosylvin in concentrations of 1.96 mg/kg pulp and 1.94 mg/kg pulp respectively. The total amount of grape-pulp recovered was 1780 grams, and can be considered as a primary waste-stream generated with the production of 5 litre red wine. Therefore, the production of 5 litre of red wine led to a grape-pulp waste-stream containing in total 1.780*1.96=3.49 mg cinnamic acid and 1.780*1.94=3.45 mg pinosylvin. Hence, for 1 litre of red wine produced, 3.49/5=0.70 mg of cinnamic acid- and 3.45/5=0.69 mg pinosylvin could be recovered from the pulp waste-stream.

[0073] Approximately 20 ml of sediment that was generated in the secondary grape-must fermentation was extracted over-night with 10 ml of ethyl acetate in a 50 ml Sartorious tube, using a rotary unit at ambient temperature (24° C.). The extraction tubes were covered with aluminium foil to avoid any light induced degradation of stilbenoids. The following day the extraction mixture was centrifuged at 3800×g for 10 minutes, and the upper, yellowish/greenish coloured, ethyl acetate was collected and pooled into one tube. From the initial 10 ml of ethyl acetate approximately 8 ml extract was recovered for both the FS1201- and FS9215 sediment suspension. Said ethyl acetate fractions were reduced in volume by evaporation for 2 hours using a freeze dryer until a dry residue was obtained. The dry, dark coloured, residue was dissolved in 500 microlitre 50% ethanol which resulted in a solution that contained non-dissolved dark precipitates. The solution was whirly-mixed and centrifuged at 13000×g for 5 minutes and the supernatant was diluted 5-fold with 50% ethanol. Said procedure resulted in a clear yellowish solution that could be used for HPLC analysis.

[0074] The sediment of the control strain FS01201 did not contain stilbenoids nor cinnamic- nor coumaric acid (FIG. 8).

[0075] The chromatogram of the sediment of FS09215 contained a peak with a similar retention time as pinosylvin; indeed said peak with retention time of 4.4 minutes, displayed a UV-spectrum that was identical to pinosylvin (FIGS. 8 and 7). Similarly, the presence of cinnamic acid was confirmed as well.

[0076] Quantification of the peaks indicated that the sediment contained cinnamic acid and pinosylvin in concentrations of 7.28 mg/l sediment and 2.60 mg/L sediment respectively. The total amount of sediment recovered was approximately 300 ml, and can be considered as secondary waste-stream generated with the production of 5 litre red wine. Therefore, the production of 5 litre of red wine led to a sediment waste-stream containing in total 0.3*7.28=2.18 mg cinnamic acid and 0.3*2.60=0.78 mg pinosylvin. Hence, for 1 litre of red wine produced, 2.18/5=0.44 mg of cinnamic acid- and 0.78/5=0.16 mg of pinosylvin could be recovered from the sediment waste stream.

[0077] Hence, for the production of 1 litre of red wine a total waste-stream was produced from which a total amount of 0.70+0.44=1.14 mg cinnamic acid, and 0.69+0.16=0.85 mg pinosylvin could be recovered.

Example 15

Production of Red Wine from Grapes Using a S. Cerevisiae Strain with Constitutive Expression of the Phenylpropanoid Pathway from Tyrosine to Resveratrol

[0078] Commercially available seedless "Crimson" grapes (product of Brazil), are used to produce two red wine's: a control wine produced by using strain FS01201 and a stilbenoid enriched wine by using strain FS-TEF2-TAL-TEF2-4CL-TDH3-VST1 described in example 11. Said strain harbours a phenylpropanoid pathway comprising enzymes that do not use oxygen as substrate.

[0079] Hence, said strain can produce resveratrol under the oxygen-deprived conditions that typically prevail in the anaerobic fermentation-process used for wine-making.

Preparation of Starter Culture

[0080] A starter culture of strain FS01201 and FS-TEF2-TAL-TEF2-4CL-TDH3-VST1 is prepared by crushing 2 kilo's of grapes and filtering the resulting grape pulp with a loose-woven cotton cloth (cheesecloth) and subsequently collecting the grape juice in a sterile open plastic bucket. An aliquot of 500 ml of grape juice is enriched with 40 grams of glucose and divided into two aliquots of 250 ml that are transferred to two sterile 500 ml-shakeflasks. The shakeflasks are inoculated with approximately 2 grams wet-weight of either FS01201 or FS-TEF2-TAL-TEF2-4CL-TDH3-VST1 as prepared according to example 1, and incubated for approximately 24 hours at room temperature. Activity of yeast is indicated by formation of CO₂ resulting in a foam-layer.

Primary Pulp Fermentation

[0081] A pulp of grapes is prepared by disrupting 16 kilo's of grapes with a semi-professional kitchen blender. The resulting grape-pulp is enriched with approximately 2 coffee-spoons of "yeast nutrient" (stimulates yeast growth) and 3 coffee-spoons of "pecto-enzymes" (breaks down pectin in the grape skin). Both the pecto-enzymes and yeast nutrient are part of a wine-making kit that is commercially available. Said enriched grape-pulp is divided into two equal aliquots, approximately 7 to 8 litre each) and transferred into a 10 litre plastic round sterilized container that is open at the top. A pulp-fermentation is initiated by adding the total amount of 250 ml of starter culture to the grape pulp, and mixing it well together with a large spoon; one bucket is inoculated with F501201, and the other with FS-TEF2-TAL-TEF2-4CL-TDH3-VST1.

[0082] The progression of the pulp-fermentation is visually monitored on a daily basis, and the appearance of a foam-layer on the top, caused by CO₂ formation, indicates that the fermentation is successfully ongoing. The CO₂ formation causes the grape-pulp to float on top of the grape-juice, and therefore the pulp is mixed with a large spoon on a daily basis as well. The pulp-fermentation is near its end when almost al grape-sugars are consumed, which is indicated by cessation of foam-formation and "fluidizing" of the grape-pulp. The grape pulp is then separated from the liquid fraction (containing the juice and the yeast, i.e. the grape-must) by using a cheesecloth. For each strain approximately 5.0 to 6 litres of grape-must is collected and analyzed for the content of alcohol and stilbenoids. The grape pulp and approximately 1.5 litres of the remaining non-enriched grape-must are stored at 4° C.

[0083] Secondary Grape--Must Fermentation

[0084] The fermentation is now continued with the grape-must. In order to enhance the alcohol percentage to a level that is usually found in commercial red wines (12- to 15 vol %), an aliquot of 3.5 litre of grape-must of either pulp fermentation is enriched with approximately 340 g of commercially available sugar ("Dansukker", dissolved and heated in approximately 300 ml of water). The addition of the extra sugar causes a dilution of the grape-must, resulting in a slight reduction of ethanol titers. The enriched grape-must is transferred to a 5 litre glass-bottle that is stoppered with a "water-lock" to enable release of CO₂, but at the same time preventing contamination. When the ethanol concentration reaches a level in between 12- to 13 vol %., a second sugar-addition is made to enhance the ethanol concentration even further: 150 grams of sugar ("Dansukker") is dissolved into 1400 ml of the previously stored non-enriched grape-must, which is then subsequently added to fermentation glass-bottle. The total volume of the fermentation broth is now approximately 5 litres, and with that almost completely fills the glass bottle leaving no room for air in the top of the bottle. The addition of the extra sugar causes a dilution of the grape-must, resulting in a slight reduction of ethanol titers. The fermentation is finished when all sugars are depleted, and is indicated by a complete cessation of foam formation (i.e. CO₂ formation), and the final ethanol concentration is in between 14- to 15 vol %. For each strain the grape-must is analyzed for the content of alcohol and stilbenoids.

[0085] In both fermentations sediment settles on the bottom, which likely composes of small-sized particle grape-residues and yeast cells. Said sediment is isolated from the grape-must by siphoning. The sediments are stored at 4° C. until further analysis on stilbenoid content.

Analysis of Waste-Stream for the Presence of Stilbenoids

[0086] Approximately 125 grams of the grape pulp that is generated in the primary pulp fermentation is extracted over night with 30 ml of ethyl acetate (divided in three 50 ml Sartorious tubes) using a rotary unit at ambient temperature (24° C.). The extraction tubes are covered with aluminium foil to avoid any light induced degradation of stilbenoids. The following day the extraction mixture is centrifuged at 3800×g for 10 minutes, and the upper, yellow/greenish coloured, ethyl acetate is collected and pooled into one tube. Said ethyl acetate fractions are reduced in volume by evaporation for 2 hours, using a freeze dryer, until a dry residue is obtained. The dry, dark coloured, residue is dissolved in 500 microlitre 50% ethanol which results in a solution that contains non-dissolved dark precipitates. The solution is whirly-mixed and centrifuged at 13000×g for 5 minutes and the supernatant is diluted 5-fold with 50% ethanol. Said procedure results in a clear yellowish solution that can be used for HPLC analysis.

[0087] The grape-pulp can be considered as a primary waste-stream generated with the production of 5 litre wine, and the resveratrol that can be recovered from the pulp can be expressed in terms of production of 1 litre red-wine.

[0088] Approximately 20 ml of sediment that is generated in the secondary grape-must fermentation is extracted over night with 10 ml of ethyl acetate in a 50 ml Sartorious tube, using a rotary unit at ambient temperature (24° C.). The extraction tubes are covered with aluminium foil to avoid any light induced degradation of stilbenoids. The following day the extraction mixture is centrifuged at 3800×g for 10 minutes, and the upper, yellowish/greenish coloured, ethyl acetate is collected and pooled into one tube. Said ethyl acetate fractions are reduced in volume by evaporation for 2 hours, using a freeze-dryer, until a dry residue is obtained.

[0089] The dry, dark coloured, residue is dissolved in 500 microlitre 50% ethanol which results in a solution that contains non-dissolved dark precipitates. The solution is whirly-mixed and centrifuged at 13000×g for 5 minutes and the supernatant is diluted 5-fold with 50% ethanol. Said procedure results in a clear yellowish solution that can be used for HPLC analysis.

[0090] The sediment can be considered as a secondary waste-stream generated with the production of 5 litre wine, and resveratrol that can be recovered from the sediment can be expressed in terms of production of 1 litre red-wine.

[0091] Hence, for the production of 1 litre of red wine the total amount of resveratrol that can be recovered from the waste-stream can be found by summation of the amount of the resveratrol present in both the primary- and secondary waste-stream.

Example 16

Isolation of Genes Encoding SAM8, 4CL2 and VST1

[0092] The codon optimized SAM8 gene encoding Saccharotrix espaniensis Tyrosine ammonia lyase (Berner et al, 2006) (SEQ ID NO 38) for expression in S. cerevisiae was synthesized by GenScript Corporation (Piscataway, N.J.). The synthetic Sam8 gene was delivered inserted in E. coli pUC57 vector flanked by EcoRI and SpeI restriction sites. The synthetic gene was purified from the pUC57 vector by EcoRI/SpeI restriction and purified from agarose gel using the QiaQuick Gel Extraction Kit (Qiagen).

[0093] 4-coumarate:coenzymeA ligase (4CL2) (Hamberger and Hahlbrock 2004; Ehlting et al., 1999) (SEQ ID NO 39) was isolated via PCR from A. thaliana cDNA (BioCat, Heidelberg, Germany) using the primers, Forward 5'GCGAATTCTTATGACGACACAAGATGTGATAGTCAATGAT SEQ ID NO 40 with the underlined restriction sequence for ECOR1, and Reverse 5'GCACTAGTATCCTAGTTCATTAATCCATTTGCTAGTCTTGC SEQ ID NO 41 with the underlined restriction site for SpeI.

[0094] The codon optimized VST1 gene encoding Vitis vinifera (grapevine) resveratrol synthase (Hain et al., 1993) (SEQ ID NO 42) for expression in S. cerevisiae was synthesized by GenScript Corporation (Piscataway, N.J.). The synthetic VST1 gene was delivered inserted in E. coli pUC57 vector flanked by BamH1 and Xho1 restriction sites. The synthetic gene was purified from the pUC57 vector by BamH1/Xho1 restriction and purified from agarose gel using the QiaQuick Gel Extraction Kit (Qiagen).

Example 17

Construction of a Yeast Vector for Galactose Induced Expression of SAM8

[0095] The EcoRI/SpeI digested SAM8 product, isolated as described in example 16, was ligated into EcoRI/SpeI digested pESC-URA vector (Stratagene), resulting in vector pESC-URA-SAM8. Two different clones of pESC-URA-SAM8 were sequenced to verify the sequence of the cloned gene.

Example 18

Construction of a Yeast Vector for Galactose Induced Expression of 4CL2 and VST1

[0096] The gene encoding 4CL2 was isolated using the primers as described in example 16. The amplified 4CL2 PCR-product was digested with EcoR1/Spe1 and ligated into EcoR1/Spe1 digested pESC-HIS vector (Stratagene), resulting in vector pESC-HIS-4CL2. Two different clones of pESC-HIS-4CL2 were sequenced to verify the sequence of the cloned gene.

[0097] The gene encoding VST1 was isolated as described in example 16. The amplified synthetic VST1 gene was digested with BamH1/Xho1 and ligated into BamH1/Xho1 digested pESC-HIS-4CL2. The resulting plasmid, pESC-HIS-4CL2-VST1, contained the genes encoding 4CL2 and VST1 under the control of the divergent galactose induced <=GAL1/GAL10=> promoters. The sequence of the gene encoding VST1 was verified by sequencing of two different clones of pESC-HIS-4CL2-VST1.

Example 19

Construction of Strong Constitutive Promoter Fragment TDH3

[0098] The 600 base pair TDH3 (GPD) promoter was amplified from S. cerevisiae genomic DNA using the forward primer 5'GC GAGCTC AGT TTA TCA TTA TCA ATA CTC GCC ATT TCA AAG SEQ ID NO 43 containing a Sad restriction site and the reverse primer 5'-CG TCTAGA ATC CGT CGA AAC TAA GTT CTG GTG TTT TAA AAC TAA AA SEQ ID NO 44 containing a Xba1 restriction site. The amplified TDH3 fragment was digested with Sac1/Xba1 and ligated into Sac1/Xba1 digested plasmid pRS416 (Sikorski and Hieter, 1989) as described previously (Mumberg et al, 1995) resulting in plasmid pRS416-TDH3.

Example 20

Construction of Constitutive Strong Promoter Fragment TEF2

[0099] The 400 base pair TEF2 promoter was amplified from S. cerevisiae genomic DNA using the forward primer 5'-GC GAGCTC ATA GCT TCA AAA TGT TTC TAC TCC TTT TTT ACT CTT SEQ ID NO 45 containing a Sac1 restriction site and the reverse primer 5'-CG TCTAGA AAA CTT AGA TTA GAT TGC TAT GCT TTC TTT CTA ATG A SEQ ID NO 46 containing a Xba1 restriction site. The amplified TEF2 fragment was digested with Sac1/Xba1 and ligated into Sac1/Xba1 digested plasmid pRS416 (Sikorski and Hieter, 1989) as described previously (Mumberg et al, 1995) resulting in plasmid pRS416-TEF2.

Example 21

Construction of Fused Divergent Constitutive TEF and TDH3 Promoter Fragment

[0100] A divergent fusion fragment between TEF2 promoter and TDH3 promoter was constructed starting from PRS416-TEF and PRS416-TDH3.

[0101] The 600 base pair TDH3 fragment was reamplified from PRS416-TDH3 using the forward primer 5' TTGCGTATTGGGCGCTCTTCC GAG CTC AGT TTA TCA TTA TCA ATA CTC GC SEQ ID NO 47 containing the underlined overhang for fusion PCR to TEF2 fragment and the reverse primer 5' AT GGATCC TCT AGA ATC CGT CGA AAC TAA GTT CTG SEQ ID NO 48 containing the underlined BamH1 restriction site. This resulted in a fragment ready for fusion to the below TEF2 fragment.

[0102] The 400 base pair TEF2 fragment including a 277 base pair spacer upstream of the Sad restriction site was reamplified from PRS416-TEF2 using the forward primer 5' AT GAATTC TCT AGA AAA CTT AGA TTA GAT TGC TAT GCT TTC SEQ ID NO 49 containing the underlined EcoR1 restriction site and the reverse primer 5' TGA TAA TGA TAA ACT GAG CTC GGA AGA GCG CCC AAT ACG CAA AC SEQ ID NO 50 containing the underlined overhang for fusion to the TDH3 fragment. This resulted in a 680 base pair fragment ready for fusion to the TDH3 fragment.

[0103] The 680 base pair TEF2 fragment and the 600 base pair TDH3 fragments were joined together (fused) using fusion PCR with the forward primer 5' AT GAATTC TCT AGA AAA CTT AGA TTA GAT TGC TAT GCT TTC SEQ ID NO 51 and the reverse primer 5' AT GGATCC TCT AGA ATC CGT CGA AAC TAA GTT CTG SEQ ID NO 52, resulting in the divergent fragment <=TEF2/TDH3=> (SEQ ID NO 53).

Example 22

Construction of a Yeast Vector for Constitutive Expression of Sam8

[0104] The vector pESC-URA-Sam8 with divergent galactose inducible promoters GAL1/GAL10 was sequentially digested with EcoRI and BamHI to remove the GAL1/GAL10 promoters.

[0105] The divergent constitutive <=TEF2/TDH3=> promoter fragment (Example 21) was re-amplified with forward primer 5' AT GGATCC TCT AGA AAA CTT AGA TTA GAT TGC TAT GCT TTC SEQ ID NO 54 and reverse primer 5'AT GAATTC TCTAGA ATC CGT CGAAACTAAGTTCTGG SEQ ID NO 55.

[0106] The resulting PCR product was sequentially digested with ECORI and BamH1 and ligated into the above ECORI/BamHI digested vector (pESC-URA-Sam8) without the GAL1/Gal10 fragment. This resulted in a vector pESC-URA-TDH3-Sam8 with replaced promoters, from GAL1/Gal10 to TEF2/TDH3 (SEQ ID NO 56).

Example 23

[0107] Construction of a yeast vector for constitutive expression induced of 4CL2 and VST1

[0108] The vector pESC-HIS-4CL2-VST1 with divergent galactose inducible promoters GAL1/GAL10 was sequentially digested with EcoR1 and BamH1 to remove the GAL1/GAL10 promoters.

[0109] The divergent constitutive <=TEF2/TDH3=> promoter fragment (Example 21) was sequentially digested with EcoR1 and BamH1 and ligated into the above linearized vector without the GAL1/GAL10 fragment. This resulted in a vector pesc-HIS-TEF2-4CL2-TDH3-VST1 with replaced promoters, from GAL1/Gal10 to TEF2/TDH3 (SEQ ID NO 57).

Example 24

Generation of Strain with Constitutive Expression of the Pathway to Resveratrol in the Yeast S. Cerevisiae

[0110] The transformation of the yeast cell was conducted in accordance with methods known in the art, for instance by using lithium acetate transformation method (Gietz and Schiestl, 1991). S. cerevisiae strain FS01528 (CEN.PK MATa ura3 His3) was co-transformed with pESC-URA-TDH3-SaM8 (example 22) and pesc-HIS-TEF2-4CL2-TDH3-VST1 (example 23), and the transformed strain was named FS-SAM8-4CL2-VST1. Transformants were selected on medium lacking uracil and histidine and streak purified on the same medium.

Example 25

Generation of Biomass

[0111] Batch fermentation of FS-SAM8-4CL2-VST1 were carried out in order to generate wet biomass for inoculation of the wine fermentation. The fermentation was carried out in a Sartorius Biostat B plus fermentor under aerobic conditions. The working volume was 1 L, agitation was 1000 rpm, and air flow was set to 1.5 vvm. Temperature and pH were 30° C. and 5.5, respectively. The fermentation was inoculated to an initial OD of 0.0005. The composition is described in the following:

Media:

TABLE-US-00004

[0112] Compound Concentration [g/L] Glucose 165 Urea 22.72 KH2PO4 30 MgSO4 5 Vitamin solution 10 mL* Trace metal solution 10 mL* Antifoam 100 μL

Vitamin solution

TABLE-US-00005 Concentration [g/L] Biotin 0.05 Calcium panthotenate 1 Nicotinic acid 1 Myo-inositol 25 Thiamine HCl 1 Pyridoxal HCl 1 Para-aminobenzoic acid 0.2

Trace metal solution

TABLE-US-00006 Concentration [g/L] EDTA 15 ZnSO4 × 7H2O 4.5 MnCl2 × 2H2O 1 CoCl2 × 6H2O 0.3 CuSO4 × 5H2O 0.3 Na2MoO4 × 2H2O 0.4 CaCl2 × 2H2O 4.5 FeSO4 × 7H2O 3 H3BO3 1 KI 0.1

[0113] At the end of the fermentation, when all glucose was depleted, the biomass was harvested into Falcon tubes by centrifugation. Four 50 mL sterile Falcon tubes were used and the cells were harvested using 5 consecutive centrifuge runs at 4° C. with 4000 rpm for five minutes. The centrifuge used was a Satorius Sigma 3-16K including a swing out rotor with for buckets. The supernatant was each discarded after each run. The four tubes contained approximately 70 g of wet biomass, which was used as inoculum for the wine fermentation.

Example 26

Resveratrol Production by Fermenting Wine

[0114] Objective: To evaluate the relative efficacy of producing resveratrol by wine fermentation using wine juice concentrate as plant material compared to commercially available wine yeast,

[0115] Two identical wine making kits procured from Winexpert Incorporated of Canada were used as the basis of making a comparison between the commercially available yeast Saccharomyces bayanus (Lalvin EC1118), the control strain, for wine making versus FS-SAM8-4CL2-VST1. The kit used was the "Selection Original--Barolo Style." This style utilizes the Nebbiolo red grape as the basis of the grape juice concentrate. This concentrate is preserved with suphur dioxide, citric acid, malic acid, tartaric acid, and diammonium phosphate. Also supplied in the kit are single packages of a premeasured amount of bentonite for use as a clarifying agent, potassium metabisuphite as a stabilizer, and oak chips used for flavoring. The package of oak chips was not used in this experiment for either fermentation. Kit designated Lot 07318080147 was used for fermentation of Saccharomyces bayanus (Lalvin EC1118) and Lot 07318080172 was for fermentation of FS-SAM8-4CL2-VST1.

[0116] Each of two kits was treated similarly except for the inoculum. For the wine fermentation using the control strain five grams of yeast (Lalvin EC1118 of Lallemand Inc.) were used, whereas for FS-SAM8-4CL2-VST1 18 g of wet biomass, which was approximately 5 g/L dry weight, was used as inoculum.

[0117] Before inoculation, all equipment and containers being used were first sanitized with a solution of metabisulfite (˜50 grams in 4 liters). Spring water ("Deerpark") was used for all solutions. Two liters of warm water (˜300° C.) were added to a clean 30 liter plastic carboy container and stirred vigorously while slowly sprinkling in the contents of the bentonite package until fully wetted and dispersed; for approximately one minute. The grape juice concentrate (15 L) were filled into the containers. The package of grape juice concentrate was washed with 4 liters, which was afterwards added to container. The final container volume was adjusted to 23 liters with cool. The oak chip package intended to be used as a flavoring enhancer was not used in either the control or treatment groups. With the juice solution at about room temperature (˜20.0° C.), the package of Lalvin yeast was sprinkled on top of the control juice solution and FS-SAM8-4CL2-VST1 was poured into solution. Each container (primary fermentor) was covered with an air-lock. The wine was fermented for 50 days. Samples of wine and mash were taken at the end of the fermentation and placed into a sealed plastic cup and stored frozen until analyses.

Example 27

Extraction of Resveratrol from Wine-Mash

[0118] Two duplicate samples of the mash from the control- and treatment groups were evaluated for their content of stilbenoids, hereafter referred to as control A, control B, treatment A and treatment B. Aliquots of 50 ml of either samples, containing a mixture of mash and wine, were centrifuged for 10 minutes at 3500XG at 10° C., after which the supernatant was discarded. Hereafter, the wet weight content of mash was 12.57 g for control A, 14.03 g for control B, 11.63 g for treatment A and 12.52 g for treatment B. Next, 10 ml of 99% ethyl acetate was added and whirly-mixed at room temperature on an automated whirly mixer for 2 hours at 2500 rpm. Then samples were centrifuged for 10 minutes at 3500×g at 10° C., and the upper, yellow/reddish coloured, ethyl acetate was collected reduced in volume by evaporation in a freeze-dryer. After approximately 2 hours a dry reddish residue was obtained, which was carefully resuspended in 120 μl 20% ethanol and resulted in a solution that contained non-dissolved dark precipitates. The solution was, therefore, whirly-mixed and centrifuged at 13000×g for 5 minutes. The supernatant now consisted of a clear reddish 20%-ethanol solution, which was diluted 100-fold further in two steps of 10-fold; the first dilution step was rendered in 20%-ethanol whereas Millipore water was used for the subsequent second 10-fold dilution step. Samples were then ready to be analyzed by HPLC.

Example 28

HPLC Determination of Stilbenoids and Phenylpropanoids

[0119] For quantitative analysis of coumaric acid, cinnamic acid, trans-resveratrol and trans-pinosylvin, samples were subjected to separation by high-performance liquid chromatography (HPLC), using a HPLC-system from Dionex, prior to UV-diode-array detection at 1=306 nm. A Phenomenex (Torrance, Calif., USA) Gemini C6-Phenyl, 3 micron (100×3.00 mm) column was used at 35° C. The method consisted of a linear gradient of methanol and millipore water (both containing 50 ppm trifluoroacetic acid), at a flow rate of 0.5 ml/min. The gradient profile was linear from 20% methanol to 100% methanol over 20 min. The elution times were 7.5 min. for coumaric acid, 10.1 min. for trans-resveratrol, 11.8 min. for cinnamic acid and 14.0 min for pinosylvin.

Example 29

Concentration of Resveratrol in the Mash

[0120] The chromatograms of both the control group and the treatment group contained all a peak with a similar retention time as resveratrol (9.9 minutes) and with an UV spectrum that resembled the UV spectrum of resveratrol. Quantification of the peak indicated that the resveratrol content in the mash was 0.33 mg/kg for control A, 0.48 mg/kg for control B, giving an average of 0.41 mg/kg for the control group. The mash of treatment A contained 0.80 mg/kg and treatment B contained 0.73 mg/kg, giving an average resveratrol content of 0.77 mg/kg for the treatment group. Hence, on average, the mash of the treatment group contained 89% more resveratrol than the mash of the control group.

[0121] It can, therefore, be concluded that the use of resveratrol-producing yeast in a wine fermentation process has led to a substantial enrichment of the resveratrol in the mash.

[0122] In this specification, unless expressly otherwise indicated, the word `or` is used in the sense of an operator that returns a true value when either or both of the stated conditions is met, as opposed to the operator `exclusive or` which requires that only one of the conditions is met. The word `comprising` is used in the sense of `including` rather than in to mean `consisting of`. All prior teachings acknowledged above are hereby incorporated by reference. No acknowledgement of any prior published document herein should be taken to be an admission or representation that the teaching thereof was common general knowledge in Australia or elsewhere at the date hereof.

REFERENCES

[0123] Becker et al, Ferns Yeast Research, 4, 2003, 79-85 Metabolic engineering of Saccharomyces cerevisiae for the synthesis of the wine related antioxidant resveratrol

[0124] Berner M, Krug D, Bihlmaier C, Vente A, Muller R, Bechthold A. Genes and enzymes involved in caffeic acid biosynthesis in the actinomycete Saccharothrix espanaensis. J. Bacteriol. 2006:188:2666-73

[0125] Cochrane F C, Davin L B, Lewis N G.

[0126] The Arabidopsis phenylalanine ammonia lyase gene family: kinetic characterization of the four PAL isoforms. Phytochemistry. 2004:65:1557-64.

[0127] Ehlting J, Buttner D, Wang Q, Douglas C J, Somssich I E, Kombrink E. Three 4-coumarate:coenzyme A ligases in Arabidopsis thaliana represent. two evolutionarily divergent classes in angiosperms. Plant J. 1999:19:9-20.

[0128] Hain R, Reif H J, Krause E, Langebartels R, Kindl H, Vornam B, Wiese W, Schmelzer E, Schreier P H, Stocker R H, et al. Disease resistance results from foreign phytoalexin expression in a novel plant. Nature. 1993:361:153-6.

[0129] Hamberger B, Hahlbrock K.

[0130] The 4-coumarate:CoA ligase gene family in Arabidopsis thaliana comprises one rare, sinapate-activating and three commonly occurring isoenzymes. Proc Natl Acad Sci USA. 2004:101:2209-14.

[0131] Gietz R D, Schiestl R H. Applications of high efficiency lithium acetate transformation of intact yeast cells using single-stranded nucleic acids as carrier. Yeast. 1991:7:253-63.

[0132] Mizutani M, Ohta D, Sato R.

[0133] Isolation of a cDNA and a genomic clone encoding cinnamate 4-hydroxylase from Arabidopsis and its expression manner in planta. Plant Physiol. 1997:113:755-63.

[0134] Mizutani M, Ohta D.

[0135] Two isoforms of NADPH:cytochrome P450 reductase in Arabidopsis thaliana. Gene structure, heterologous expression in insect cells, and differential regulation. Plant Physiol. 1998:116:357-67.

[0136] Mumberg D, Muller R, Funk M.

[0137] Yeast vectors for the controlled expression of heterologous proteins in different genetic backgrounds. Gene. 1995:156:119-22.

[0138] Sikorski R S, Hieter P.

[0139] A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae.Genetics. 1989:122:19-27.

[0140] Verduyn C, Postma E, Scheffers W A, Van Dijken J P.

[0141] Effect of benzoic acid on metabolic fluxes in yeasts: a continuous-culture study on the regulation of respiration and alcoholic fermentation. Yeast. 1992:8:501-17.

Sequence CWU 1

1

5712154DNAArabidopsis thaliana 1atggatcaaa tcgaagcaat gttgtgcggc ggaggagaga agacaaaagt ggcggttact 60acgaagactt tggcagatcc attgaattgg ggtttagcag cggatcaaat gaaaggaagt 120catttagatg aagtgaagaa gatggtcgaa gagtatcgta gaccagtcgt gaatcttggc 180ggagaaacac tgacgatcgg acaagttgct gccatctcca ccgtaggagg cagcgttaag 240gttgagttag cggagacttc aagagccggt gtgaaagcta gcagtgattg ggttatggag 300agcatgaaca aaggtactga cagttacgga gtcaccaccg gctttggtgc tacttctcac 360cggagaacca aaaacggcac cgcattacaa acagaactca ttagattttt gaacgccgga 420atattcggaa acacgaagga gacatgtcac acactgccgc aatccgccac aagagccgcc 480atgctcgtca gagtcaacac tcttctccaa ggatactccg ggatccgatt cgagatcctc 540gaagcgatta caagtctcct caaccacaac atctctccgt cactacctct ccgtggaacc 600attaccgcct ccggcgatct cgttcctctc tcttacatcg ccggacttct caccggccgt 660cctaattcca aagccaccgg tcccgacggt gaatcgctaa ccgcgaaaga agcttttgag 720aaagccggaa tcagtactgg attcttcgat ttacaaccta aggaaggttt agctctcgtt 780aatggcacgg cggttggatc tggaatggcg tcgatggttc tattcgaagc gaatgtccaa 840gcggtgttag cggaggtttt atcagcgatc ttcgcggagg ttatgagcgg gaaacctgag 900tttaccgatc atctgactca tcgtttaaaa catcatcccg gacaaatcga agcggcggcg 960ataatggagc acatactcga cggaagctca tacatgaaat tagctcaaaa ggttcacgag 1020atggatccat tgcagaaacc aaaacaagat cgttacgctc ttcgtacatc tcctcaatgg 1080ctaggtcctc aaattgaagt aatccgtcaa gctacgaaat cgatagagcg tgaaatcaac 1140tccgttaacg ataatccgtt gatcgatgtt tcgaggaaca aggcgattca cggtggtaac 1200ttccaaggaa caccaatcgg agtttctatg gataacacga gattggcgat tgctgcgatt 1260gggaagctaa tgtttgctca attctctgag cttgttaatg atttctacaa caatggactt 1320ccttcgaatc taactgcttc gagtaatcca agtttggatt atggattcaa aggagcagag 1380attgctatgg cttcttattg ttctgagctt caatacttgg ctaatccagt cacaagccat 1440gttcaatcag ctgagcaaca taatcaagat gtgaactctc ttggtttgat ctcgtctcgt 1500aaaacatctg aagctgtgga tattcttaag ctaatgtcaa caacgttcct tgtggggata 1560tgtcaagctg ttgatttgag acatttggag gagaatctga gacaaactgt gaagaacaca 1620gtttctcaag ttgctaagaa agtgttaacc actggaatca acggtgagtt acatccgtca 1680aggttttgcg agaaggactt gcttaaggtt gttgatcgtg agcaagtgtt cacgtatgtg 1740gatgatcctt gtagcgctac gtacccgttg atgcagagac taagacaagt tattgttgat 1800cacgctttgt ccaacggtga gactgagaag aatgcagtga cttcgatctt tcaaaagatt 1860ggagcttttg aagaggagct taaggctgtg cttccaaagg aagttgaagc ggctagagcg 1920gcttatggga atggaactgc gccgattcct aaccggatta aggaatgtag gtcgtatccg 1980ttgtataggt tcgtgaggga agagcttgga acgaagttgt tgactggaga aaaggttgtg 2040tctccgggag aggagtttga taaggtcttc actgctatgt gtgaaggtaa acttattgat 2100ccgttgatgg attgtctcaa ggaatggaac ggagctccga ttccgatttg ctaa 215421518DNAArabidopsis thaliana 2atggacctcc tcttgctgga gaagtcttta atcgccgtct tcgtggcggt gattctcgcc 60acggtgattt caaagctccg cggcaagaaa ttgaagctac ctccaggtcc tataccaatt 120ccgatcttcg gaaactggct tcaagtcgga gatgatctca accaccgtaa tctcgtcgat 180tacgctaaga aattcggcga tctcttcctc ctccgtatgg gtcagcgaaa cctagtcgtc 240gtctcctcac cggatctaac aaaggaagtg ctcctcactc aaggcgttga gtttggatcc 300agaacgagaa acgtcgtgtt cgacattttc accgggaaag gtcaagatat ggtgttcact 360gtttacggcg agcattggag gaagatgaga agaatcatga cggttccttt cttcaccaac 420aaagttgttc aacagaatcg tgaaggttgg gagtttgaag cagctagtgt tgttgaagat 480gttaagaaga atccagattc tgctacgaaa ggaatcgtgt tgaggaaacg tttgcaattg 540atgatgtata acaatatgtt ccgtatcatg ttcgatagaa gatttgagag tgaggatgat 600cctcttttcc ttaggcttaa ggctttgaat ggtgagagaa gtcgattagc tcagagcttt 660gagtataact atggagattt cattcctatc cttagaccat tcctcagagg ctatttgaag 720atttgtcaag atgtgaaaga tcgaagaatc gctcttttca agaagtactt tgttgatgag 780aggaagcaaa ttgcgagttc taagcctaca ggtagtgaag gattgaaatg tgccattgat 840cacatccttg aagctgagca gaagggagaa atcaacgagg acaatgttct ttacatcgtc 900gagaacatca atgtcgccgc gattgagaca acattgtggt ctatcgagtg gggaattgca 960gagctagtga accatcctga aatccagagt aagctaagga acgaactcga cacagttctt 1020ggaccgggtg tgcaagtcac cgagcctgat cttcacaaac ttccatacct tcaagctgtg 1080gttaaggaga ctcttcgtct gagaatggcg attcctctcc tcgtgcctca catgaacctc 1140catgatgcga agctcgctgg ctacgatatc ccagcagaaa gcaaaatcct tgttaatgct 1200tggtggctag caaacaaccc caacagctgg aagaagcctg aagagtttag accagagagg 1260ttctttgaag aagaatcgca cgtggaagct aacggtaatg acttcaggta tgtgccattt 1320ggtgttggac gtcgaagctg tcccgggatt atattggcat tgcctatttt ggggatcacc 1380attggtagga tggtccagaa cttcgagctt cttcctcctc caggacagtc taaagtggat 1440actagtgaga aaggtggaca attcagcttg cacatcctta accactccat aatcgttatg 1500aaaccaagga actgttaa 151832136DNAArabidopsis thaliana 3atgtcctctt cttcttcttc gtcaacctcc atgatcgatc tcatggcagc aatcatcaaa 60ggagagcctg taattgtctc cgacccagct aatgcctccg cttacgagtc cgtagctgct 120gaattatcct ctatgcttat agagaatcgt caattcgcca tgattgttac cacttccatt 180gctgttctta ttggttgcat cgttatgctc gtttggagga gatccggttc tgggaattca 240aaacgtgtcg agcctcttaa gcctttggtt attaagcctc gtgaggaaga gattgatgat 300gggcgtaaga aagttaccat ctttttcggt acacaaactg gtactgctga aggttttgca 360aaggctttag gagaagaagc taaagcaaga tatgaaaaga ccagattcaa aatcgttgat 420ttggatgatt acgcggctga tgatgatgag tatgaggaga aattgaagaa agaggatgtg 480gctttcttct tcttagccac atatggagat ggtgagccta ccgacaatgc agcgagattc 540tacaaatggt tcaccgaggg gaatgacaga ggagaatggc ttaagaactt gaagtatgga 600gtgtttggat taggaaacag acaatatgag cattttaata aggttgccaa agttgtagat 660gacattcttg tcgaacaagg tgcacagcgt cttgtacaag ttggtcttgg agatgatgac 720cagtgtattg aagatgactt taccgcttgg cgagaagcat tgtggcccga gcttgataca 780atactgaggg aagaagggga tacagctgtt gccacaccat acactgcagc tgtgttagaa 840tacagagttt ctattcacga ctctgaagat gccaaattca atgatataaa catggcaaat 900gggaatggtt acactgtgtt tgatgctcaa catccttaca aagcaaatgt cgctgttaaa 960agggagcttc atactcccga gtctgatcgt tcttgtatcc atttggaatt tgacattgct 1020ggaagtggac ttacgtatga aactggagat catgttggtg tactttgtga taacttaagt 1080gaaactgtag atgaagctct tagattgctg gatatgtcac ctgatactta tttctcactt 1140cacgctgaaa aagaagacgg cacaccaatc agcagctcac tgcctcctcc cttcccacct 1200tgcaacttga gaacagcgct tacacgatat gcatgtcttt tgagttctcc aaagaagtct 1260gctttagttg cgttggctgc tcatgcatct gatcctaccg aagcagaacg attaaaacac 1320cttgcttcac ctgctggaaa ggatgaatat tcaaagtggg tagtagagag tcaaagaagt 1380ctacttgagg tgatggccga gtttccttca gccaagccac cacttggtgt cttcttcgct 1440ggagttgctc caaggttgca gcctaggttc tattcgatat catcatcgcc caagattgct 1500gaaactagaa ttcacgtcac atgtgcactg gtttatgaga aaatgccaac tggcaggatt 1560cataagggag tgtgttccac ttggatgaag aatgctgtgc cttacgagaa gagtgaaaac 1620tgttcctcgg cgccgatatt tgttaggcaa tccaacttca agcttccttc tgattctaag 1680gtaccgatca tcatgatcgg tccagggact ggattagctc cattcagagg attccttcag 1740gaaagactag cgttggtaga atctggtgtt gaacttgggc catcagtttt gttctttgga 1800tgcagaaacc gtagaatgga tttcatctac gaggaagagc tccagcgatt tgttgagagt 1860ggtgctctcg cagagctaag tgtcgccttc tctcgtgaag gacccaccaa agaatacgta 1920cagcacaaga tgatggacaa ggcttctgat atctggaata tgatctctca aggagcttat 1980ttatatgttt gtggtgacgc caaaggcatg gcaagagatg ttcacagatc tctccacaca 2040atagctcaag aacaggggtc aatggattca actaaagcag agggcttcgt gaagaatctg 2100caaacgagtg gaagatatct tagagatgta tggtaa 213641686DNAArabidopsis thaliana 4atggcgccac aagaacaagc agtttctcag gtgatggaga aacagagcaa caacaacaac 60agtgacgtca ttttccgatc aaagttaccg gatatttaca tcccgaacca cctatctctc 120cacgactaca tcttccaaaa catctccgaa ttcgccacta agccttgcct aatcaacgga 180ccaaccggcc acgtgtacac ttactccgac gtccacgtca tctcccgcca aatcgccgcc 240aattttcaca aactcggcgt taaccaaaac gacgtcgtca tgctcctcct cccaaactgt 300cccgaattcg tcctctcttt cctcgccgcc tccttccgcg gcgcaaccgc caccgccgca 360aaccctttct tcactccggc ggagatagct aaacaagcca aagcctccaa caccaaactc 420ataatcaccg aagctcgtta cgtcgacaaa atcaaaccac ttcaaaacga cgacggagta 480gtcatcgtct gcatcgacga caacgaatcc gtgccaatcc ctgaaggctg cctccgcttc 540accgagttga ctcagtcgac aaccgaggca tcagaagtca tcgactcggt ggagatttca 600ccggacgacg tggtggcact accttactcc tctggcacga cgggattacc aaaaggagtg 660atgctgactc acaagggact agtcacgagc gttgctcagc aagtcgacgg cgagaacccg 720aatctttatt tccacagcga tgacgtcata ctctgtgttt tgcccatgtt tcatatctac 780gctttgaact cgatcatgtt gtgtggtctt agagttggtg cggcgattct gataatgccg 840aagtttgaga tcaatctgct attggagctg atccagaggt gtaaagtgac ggtggctccg 900atggttccgc cgattgtgtt ggccattgcg aagtcttcgg agacggagaa gtatgatttg 960agctcgataa gagtggtgaa atctggtgct gctcctcttg gtaaagaact tgaagatgcc 1020gttaatgcca agtttcctaa tgccaaactc ggtcagggat acggaatgac ggaagcaggt 1080ccagtgctag caatgtcgtt aggttttgca aaggaacctt ttccggttaa gtcaggagct 1140tgtggtactg ttgtaagaaa tgctgagatg aaaatagttg atccagacac cggagattct 1200ctttcgagga atcaacccgg tgagatttgt attcgtggtc accagatcat gaaaggttac 1260ctcaacaatc cggcagctac agcagagacc attgataaag acggttggct tcatactgga 1320gatattggat tgatcgatga cgatgacgag cttttcatcg ttgatcgatt gaaagaactt 1380atcaagtata aaggttttca ggtagctccg gctgagctag aggctttgct catcggtcat 1440cctgacatta ctgatgttgc tgttgtcgca atgaaagaag aagcagctgg tgaagttcct 1500gttgcatttg tggtgaaatc gaaggattcg gagttatcag aagatgatgt gaagcaattc 1560gtgtcgaaac aggttgtgtt ttacaagaga atcaacaaag tgttcttcac tgaatccatt 1620cctaaagctc catcagggaa gatattgagg aaagatctga gggcaaaact agcaaatgga 1680ttgtga 168651182DNAVitis vinifera 5atggcatccg tagaggagtt cagaaatgca cagagggcaa aaggtccagc aaccatattg 60gctattggaa cagccacccc tgatcactgt gtttatcaat ctgattacgc tgattactat 120ttcagagtaa ctaaaagtga acatatgaca gaacttaaga aaaagtttaa tagaatttgt 180gataaatcta tgataaagaa aagatacata catctaactg aagaaatgtt agaggaacat 240ccaaatatag gtgcatatat ggcaccatct ttgaatatta gacaagaaat cataacagcc 300gaggtaccta gactaggtag agacgcagcc ttgaaagctt taaaggaatg gggacaacca 360aaatctaaga ttacacattt ggttttctgt acaacttccg gtgtcgaaat gccaggtgct 420gattataaac tagcaaacct attgggatta gagacctctg ttagaagagt tatgttgtat 480catcaaggtt gttacgccgg aggtacagtg cttagaactg ctaaggattt ggcagaaaat 540aacgccggtg ctagggtttt agtcgtctgc agtgaaatca ctgtcgtaac tttcagaggt 600ccatcagaag atgctctaga cagtttggtc ggacaagcat tgtttggcga tggatcttcc 660gccgtaattg taggcagcga tcctgatgtg tccattgaaa gaccactatt tcaattagtt 720tctgctgctc aaacttttat tccaaattcc gccggtgcca tagcaggaaa cttgagagaa 780gttggtttga cttttcattt gtggcctaat gtcccaacct taatttcaga aaacatcgaa 840aaatgcttaa ctcaagcctt tgacccattg ggcataagcg actggaactc attgttttgg 900attgctcatc caggtggtcc agcaatttta gacgcagtgg aggcaaaact aaacttagag 960aagaaaaagt tggaagctac aagacacgtt ctatcagagt atggcaacat gagctctgcc 1020tgcgttttat tcattctaga tgagatgagg aagaagtctt taaagggtga aaaagccaca 1080accggagaag gtttagattg gggtgttcta tttggtttcg gtcctggctt aacaattgag 1140acagtggtgt tacactctgt tccaactgtc actaactaat ga 118261596DNARhodobacter capsulatus 6atgaccctgc aatctcaaac agctaaagat tgtttggctt tggatggtgc cttgacatta 60gttcaatgcg aagcgatagc aacccataga agtagaatct ctgtaacacc agccctacgt 120gagagatgtg ctagagcaca tgctaggtta gaacatgcaa tagccgaaca gcgacacata 180tatgggataa cgacaggctt cgggccactt gctaacaggc tgatcggagc agaccagggt 240gctgaattac aacagaacct tatctaccat ttggcaaccg gagttggccc caaattatca 300tgggccgaag ccagagcttt aatgctcgct cgtttgaata gtatactaca aggtgcttct 360ggtgctagcc ctgaaacaat tgataggatc gttgcagtct taaatgccgg atttgccccg 420gaagtcccag cccaaggaac cgttggtgct tcgggtgact taactccgtt agcacacatg 480gtattagcat tgcaaggcag aggtcgtatg attgatcctt cagggagagt tcaagaagcc 540ggcgctgtca tggataggtt gtgtggaggc cctttaacat tggctgccag agatggcctc 600gccttagtaa atggtacatc tgccatgaca gctattgccg cattgaccgg tgtggaggct 660gcaagagcga ttgatgcagc gcttagacat tccgcagtct tgatggaggt cctgtcaggg 720catgctgagg cttggcaccc tgcctttgcg gaattgcgtc cgcatccagg acaattacgc 780gccactgaga ggttagctca agcattggac ggcgcaggta gagtctgccg gactcttaca 840gccgctaggc gtctaactgc agctgatctg agaccagaag atcatccagc tcaagatgca 900tattcacttc gagtagttcc tcagctggtt ggtgccgtat gggatacgtt ggattggcac 960gacagggttg tgacttgcga acttaactcc gtgaccgaca atccaatttt ccccgagggt 1020tgtgcggttc cagcactaca cggtggaaac tttatgggcg tacatgtggc actagcttct 1080gacgctttaa atgcagcgtt ggttacatta gctggtctag ttgaaaggca gattgcaaga 1140cttactgatg agaagttgaa taagggtttg cctgcttttt tgcatggagg ccaagcaggt 1200ttacaatcag gtttcatggg agctcaggtt actgctactg ctttgctagc ggaaatgaga 1260gctaacgcga ctcccgtgtc cgttcaaagc ctcagcacca atggtgcaaa tcaagacgtg 1320gtaagtatgg gtacgattgc cgcgagacga gcaagagctc aacttttacc tctgtctcaa 1380atccaagcga ttttggcact ggctcttgca caagccatgg atctcctaga cgatcctgaa 1440ggacaagccg gttggtcctt aacggcaaga gatttaagag accgtatacg ggctgtcagt 1500ccagggttgc gcgcagatag accactagcg ggtcatattg aagctgtggc tcaaggtcta 1560agacacccct cggcagctgc cgatccacct gcttaa 159671373DNAartificialTEF2 fragment fused to TDH3 fragment 7atgaattctc tagaaaactt agattagatt gctatgcttt ctttctaatg agcaagaagt 60aaaaaaagtt gtaatagaac aagaaaaatg aaactgaaac ttgagaaatt gaagaccgtt 120tattaactta aatatcaatg ggaggtcatc gaaagagaaa aaaatcaaaa aaaaaatttt 180caagaaaaag aaacgtgata aaaattttta ttgccttttt cgacgaagaa aaagaaacga 240ggcggtctct tttttctttt ccaaaccttt agtacgggta attaacgaca ccctagagga 300agaaagaggg gaaatttagt atgctgtgct tgggtgtttt gaagtggtac ggcgatgcgc 360ggagtccgag aaaatctgga agagtaaaaa aggagtagaa acattttgaa gctatgagct 420ccagcttttg ttccctttag tgagggttaa ttgcgcgctt ggcgtaatca tggtcatagc 480tgtttcctgt gtgaaattgt tatccgctca caattccaca caacatagga gccggaagca 540taaagtgtaa agcctggggt gcctaatgag tgaggtaact cacattaatt gcgttgcgct 600cactgcccgc tttccagtcg ggaaacctgt cgtgccagct gcattaatga atcggccaac 660gcgcggggag aggcggtttg cgtattgggc gctcttccga gctcagttta tcattatcaa 720tactcgccat ttcaaagaat acgtaaataa ttaatagtag tgattttcct aactttattt 780agtcaaaaaa ttagcctttt aattctgctg taacccgtac atgcccaaaa tagggggcgg 840gttacacaga atatataaca tcgtaggtgt ctgggtgaac agtttattcc tggcatccac 900taaatataat ggagcccgct ttttaagctg gcatccagaa aaaaaaagaa tcccagcacc 960aaaatattgt tttcttcacc aaccatcagt tcataggtcc attctcttag cgcaactaca 1020gagaacaggg gcacaaacag gcaaaaaacg ggcacaacct caatggagtg atgcaacctg 1080cctggagtaa atgatgacac aaggcaattg acccacgcat gtatctatct cattttctta 1140caccttctat taccttctgc tctctctgat ttggaaaaag ctgaaaaaaa aggttgaaac 1200cagttccctg aaattattcc cctacttgac taataagtat ataaagacgg taggtattga 1260ttgtaattct gtaaatctat ttcttaaact tcttaaattc tacttttata gttagtcttt 1320tttttagttt taaaacacca gaacttagtt tcgacggatt ctagaggatc cat 1373812851DNAartificialvector 8tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180accataccac agcttttcaa ttcaattcat catttttttt ttattctttt ttttgatttc 240ggtttctttg aaattttttt gattcggtaa tctccgaaca gaaggaagaa cgaaggaagg 300agcacagact tagattggta tatatacgca tatgtagtgt tgaagaaaca tgaaattgcc 360cagtattctt aacccaactg cacagaacaa aaacctgcag gaaacgaaga taaatcatgt 420cgaaagctac atataaggaa cgtgctgcta ctcatcctag tcctgttgct gccaagctat 480ttaatatcat gcacgaaaag caaacaaact tgtgtgcttc attggatgtt cgtaccacca 540aggaattact ggagttagtt gaagcattag gtcccaaaat ttgtttacta aaaacacatg 600tggatatctt gactgatttt tccatggagg gcacagttaa gccgctaaag gcattatccg 660ccaagtacaa ttttttactc ttcgaagaca gaaaatttgc tgacattggt aatacagtca 720aattgcagta ctctgcgggt gtatacagaa tagcagaatg ggcagacatt acgaatgcac 780acggtgtggt gggcccaggt attgttagcg gtttgaagca ggcggcagaa gaagtaacaa 840aggaacctag aggccttttg atgttagcag aattgtcatg caagggctcc ctatctactg 900gagaatatac taagggtact gttgacattg cgaagagcga caaagatttt gttatcggct 960ttattgctca aagagacatg ggtggaagag atgaaggtta cgattggttg attatgacac 1020ccggtgtggg tttagatgac aagggagacg cattgggtca acagtataga accgtggatg 1080atgtggtctc tacaggatct gacattatta ttgttggaag aggactattt gcaaagggaa 1140gggatgctaa ggtagagggt gaacgttaca gaaaagcagg ctgggaagca tatttgagaa 1200gatgcggcca gcaaaactaa aaaactgtat tataagtaaa tgcatgtata ctaaactcac 1260aaattagagc ttcaatttaa ttatatcagt tattacccta tgcggtgtga aataccgcac 1320agatgcgtaa ggagaaaata ccgcatcagg aaattgtaaa cgttaatatt ttgttaaaat 1380tcgcgttaaa tttttgttaa atcagctcat tttttaacca ataggccgaa atcggcaaaa 1440tcccttataa atcaaaagaa tagaccgaga tagggttgag tgttgttcca gtttggaaca 1500agagtccact attaaagaac gtggactcca acgtcaaagg gcgaaaaacc gtctatcagg 1560gcgatggccc actacgtgaa ccatcaccct aatcaagttt tttggggtcg aggtgccgta 1620aagcactaaa tcggaaccct aaagggagcc cccgatttag agcttgacgg ggaaagccgg 1680cgaacgtggc gagaaaggaa gggaagaaag cgaaaggagc gggcgctagg gcgctggcaa 1740gtgtagcggt cacgctgcgc gtaaccacca cacccgccgc gcttaatgcg ccgctacagg 1800gcgcgtccat tcgccattca ggctgcgcaa ctgttgggaa gggcgatcgg tgcgggcctc 1860ttcgctatta cgccagctga attggagcga cctcatgcta tacctgagaa agcaacctga 1920cctacaggaa agagttactc aagaataaga attttcgttt taaaacctaa gagtcacttt 1980aaaatttgta tacacttatt ttttttataa cttatttaat aataaaaatc ataaatcata 2040agaaattcgc ttatttagaa gtgtcaacaa cgtatctacc aacgatttga cccttttcca 2100tcttttcgta aatttctggc aaggtagaca agccgacaac cttgattgga gacttgacca 2160aacctctggc gaagaattgt taattaagag ctcagatctt atcgtcgtca tccttgtaat 2220ccatcgatac tagtttagca aatcggaatc ggagctccgt tccattcctt gagacaatcc 2280atcaacggat caataagttt accttcacac atagcagtga agaccttatc aaactcctct 2340cccggagaca caaccttttc tccagtcaac aacttcgttc caagctcttc cctcacgaac 2400ctatacaacg gatacgacct acattcctta atccggttag gaatcggcgc agttccattc 2460ccataagccg ctctagccgc ttcaacttcc tttggaagca cagccttaag ctcctcttca 2520aaagctccaa tcttttgaaa gatcgaagtc actgcattct tctcagtctc accgttggac 2580aaagcgtgat caacaataac ttgtcttagt ctctgcatca acgggtacgt agcgctacaa 2640ggatcatcca catacgtgaa cacttgctca cgatcaacaa ccttaagcaa gtccttctcg 2700caaaaccttg acggatgtaa ctcaccgttg attccagtgg ttaacacttt cttagcaact 2760tgagaaactg tgttcttcac agtttgtctc agattctcct ccaaatgtct caaatcaaca 2820gcttgacata tccccacaag gaacgttgtt gacattagct taagaatatc cacagcttca 2880gatgttttac gagacgagat caaaccaaga gagttcacat cttgattatg ttgctcagct 2940gattgaacat ggcttgtgac tggattagcc

aagtattgaa gctcagaaca ataagaagcc 3000atagcaatct ctgctccttt gaatccataa tccaaacttg gattactcga agcagttaga 3060ttcgaaggaa gtccattgtt gtagaaatca ttaacaagct cagagaattg agcaaacatt 3120agcttcccaa tcgcagcaat cgccaatctc gtgttatcca tagaaactcc gattggtgtt 3180ccttggaagt taccaccgtg aatcgccttg ttcctcgaaa catcgatcaa cggattatcg 3240ttaacggagt tgatttcacg ctctatcgat ttcgtagctt gacggattac ttcaatttga 3300ggacctagcc attgaggaga tgtacgaaga gcgtaacgat cttgttttgg tttctgcaat 3360ggatccatct cgtgaacctt ttgagctaat ttcatgtatg agcttccgtc gagtatgtgc 3420tccattatcg ccgccgcttc gatttgtccg ggatgatgtt ttaaacgatg agtcagatga 3480tcggtaaact caggtttccc gctcataacc tccgcgaaga tcgctgataa aacctccgct 3540aacaccgctt ggacattcgc ttcgaataga accatcgacg ccattccaga tccaaccgcc 3600gtgccattaa cgagagctaa accttcctta ggttgtaaat cgaagaatcc agtactgatt 3660ccggctttct caaaagcttc tttcgcggtt agcgattcac cgtcgggacc ggtggctttg 3720gaattaggac ggccggtgag aagtccggcg atgtaagaga gaggaacgag atcgccggag 3780gcggtaatgg ttccacggag aggtagtgac ggagagatgt tgtggttgag gagacttgta 3840atcgcttcga ggatctcgaa tcggatcccg gagtatcctt ggagaagagt gttgactctg 3900acgagcatgg cggctcttgt ggcggattgc ggcagtgtgt gacatgtctc cttcgtgttt 3960ccgaatattc cggcgttcaa aaatctaatg agttctgttt gtaatgcggt gccgtttttg 4020gttctccggt gagaagtagc accaaagccg gtggtgactc cgtaactgtc agtacctttg 4080ttcatgctct ccataaccca atcactgcta gctttcacac cggctcttga agtctccgct 4140aactcaacct taacgctgcc tcctacggtg gagatggcag caacttgtcc gatcgtcagt 4200gtttctccgc caagattcac gactggtcta cgatactctt cgaccatctt cttcacttca 4260tctaaatgac ttcctttcat ttgatccgct gctaaacccc aattcaatgg atctgccaaa 4320gtcttcgtag taaccgccac ttttgtcttc tctcctccgc cgcacaacat tgcttcgatt 4380tgatccatta cgtacgtcta gaaaacttag attagattgc tatgctttct ttctaatgag 4440caagaagtaa aaaaagttgt aatagaacaa gaaaaatgaa actgaaactt gagaaattga 4500agaccgttta ttaacttaaa tatcaatggg aggtcatcga aagagaaaaa aatcaaaaaa 4560aaaattttca agaaaaagaa acgtgataaa aatttttatt gcctttttcg acgaagaaaa 4620agaaacgagg cggtctcttt tttcttttcc aaacctttag tacgggtaat taacgacacc 4680ctagaggaag aaagagggga aatttagtat gctgtgcttg ggtgttttga agtggtacgg 4740cgatgcgcgg agtccgagaa aatctggaag agtaaaaaag gagtagaaac attttgaagc 4800tatgagctcc agcttttgtt ccctttagtg agggttaatt gcgcgcttgg cgtaatcatg 4860gtcatagctg tttcctgtgt gaaattgtta tccgctcaca attccacaca acataggagc 4920cggaagcata aagtgtaaag cctggggtgc ctaatgagtg aggtaactca cattaattgc 4980gttgcgctca ctgcccgctt tccagtcggg aaacctgtcg tgccagctgc attaatgaat 5040cggccaacgc gcggggagag gcggtttgcg tattgggcgc tcttccgagc tcagtttatc 5100attatcaata ctcgccattt caaagaatac gtaaataatt aatagtagtg attttcctaa 5160ctttatttag tcaaaaaatt agccttttaa ttctgctgta acccgtacat gcccaaaata 5220gggggcgggt tacacagaat atataacatc gtaggtgtct gggtgaacag tttattcctg 5280gcatccacta aatataatgg agcccgcttt ttaagctggc atccagaaaa aaaaagaatc 5340ccagcaccaa aatattgttt tcttcaccaa ccatcagttc ataggtccat tctcttagcg 5400caactacaga gaacaggggc acaaacaggc aaaaaacggg cacaacctca atggagtgat 5460gcaacctgcc tggagtaaat gatgacacaa ggcaattgac ccacgcatgt atctatctca 5520ttttcttaca ccttctatta ccttctgctc tctctgattt ggaaaaagct gaaaaaaaag 5580gttgaaacca gttccctgaa attattcccc tacttgacta ataagtatat aaagacggta 5640ggtattgatt gtaattctgt aaatctattt cttaaacttc ttaaattcta cttttatagt 5700tagtcttttt tttagtttta aaacaccaga acttagtttc gacggattct agagcggccg 5760ctaaaatatg gacctcctct tgctggagaa gtctttaatc gccgtcttcg tggcggtgat 5820tctcgccacg gtgatttcaa agctccgcgg caagaaattg aagctacctc caggtcctat 5880accaattccg atcttcggaa actggcttca agtcggagat gatctcaacc accgtaatct 5940cgtcgattac gctaagaaat tcggcgatct cttcctcctc cgtatgggtc agcgaaacct 6000agtcgtcgtc tcctcaccgg atctaacaaa ggaagtgctc ctcactcaag gcgttgagtt 6060tggatccaga acgagaaacg tcgtgttcga cattttcacc gggaaaggtc aagatatggt 6120gttcactgtt tacggcgagc attggaggaa gatgagaaga atcatgacgg ttcctttctt 6180caccaacaaa gttgttcaac agaatcgtga aggttgggag tttgaagcag ctagtgttgt 6240tgaagatgtt aagaagaatc cagattctgc tacgaaagga atcgtgttga ggaaacgttt 6300gcaattgatg atgtataaca atatgttccg tatcatgttc gatagaagat ttgagagtga 6360ggatgatcct cttttcctta ggcttaaggc tttgaatggt gagagaagtc gattagctca 6420gagctttgag tataactatg gagatttcat tcctatcctt agaccattcc tcagaggcta 6480tttgaagatt tgtcaagatg tgaaagatcg aagaatcgct cttttcaaga agtactttgt 6540tgatgagagg aagcaaattg cgagttctaa gcctacaggt agtgaaggat tgaaatgtgc 6600cattgatcac atccttgaag ctgagcagaa gggagaaatc aacgaggaca atgttcttta 6660catcgtcgag aacatcaatg tcgccgcgat tgagacaaca ttgtggtcta tcgagtgggg 6720aattgcagag ctagtgaacc atcctgaaat ccagagtaag ctaaggaacg aactcgacac 6780agttcttgga ccgggtgtgc aagtcaccga gcctgatctt cacaaacttc cataccttca 6840agctgtggtt aaggagactc ttcgtctgag aatggcgatt cctctcctcg tgcctcacat 6900gaacctccat gatgcgaagc tcgctggcta cgatatccca gcagaaagca aaatccttgt 6960taatgcttgg tggctagcaa acaaccccaa cagctggaag aagcctgaag agtttagacc 7020agagaggttc tttgaagaag aatcgcacgt ggaagctaac ggtaatgact tcaggtatgt 7080gccatttggt gttggacgtc gaagctgtcc cgggattata ttggcattgc ctattttggg 7140gatcaccatt ggtaggatgg tccagaactt cgagcttctt cctcctccag gacagtctaa 7200agtggatact agtgagaaag gtggacaatt cagcttgcac atccttaacc actccataat 7260cgttatgaaa ccaaggaact gtccatctac tccatctact ccatctactc catctactag 7320gagatccggt tctgggaatt caaaacgtgt cgagcctctt aagcctttgg ttattaagcc 7380tcgtgaggaa gagattgatg atgggcgtaa gaaagttacc atctttttcg gtacacaaac 7440tggtactgct gaaggttttg caaaggcttt aggagaagaa gctaaagcaa gatatgaaaa 7500gaccagattc aaaatcgttg atttggatga ttacgcggct gatgatgatg agtatgagga 7560gaaattgaag aaagaggatg tggctttctt cttcttagcc acatatggag atggtgagcc 7620taccgacaat gcagcgagat tctacaaatg gttcaccgag gggaatgaca gaggagaatg 7680gcttaagaac ttgaagtatg gagtgtttgg attaggaaac agacaatatg agcattttaa 7740taaggttgcc aaagttgtag atgacattct tgtcgaacaa ggtgcacagc gtcttgtaca 7800agttggtctt ggagatgatg accagtgtat tgaagatgac tttaccgctt ggcgagaagc 7860attgtggccc gagcttgata caatactgag ggaagaaggg gatacagctg ttgccacacc 7920atacactgca gctgtgttag aatacagagt ttctattcac gactctgaag atgccaaatt 7980caatgatata aacatggcaa atgggaatgg ttacactgtg tttgatgctc aacatcctta 8040caaagcaaat gtcgctgtta aaagggagct tcatactccc gagtctgatc gttcttgtat 8100ccatttggaa tttgacattg ctggaagtgg acttacgtat gaaactggag atcatgttgg 8160tgtactttgt gataacttaa gtgaaactgt agatgaagct cttagattgc tggatatgtc 8220acctgatact tatttctcac ttcacgctga aaaagaagac ggcacaccaa tcagcagctc 8280actgcctcct cccttcccac cttgcaactt gagaacagcg cttacacgat atgcatgtct 8340tttgagttct ccaaagaagt ctgctttagt tgcgttggct gctcatgcat ctgatcctac 8400cgaagcagaa cgattaaaac accttgcttc acctgctgga aaggatgaat attcaaagtg 8460ggtagtagag agtcaaagaa gtctacttga ggtgatggcc gagtttcctt cagccaagcc 8520accacttggt gtcttcttcg ctggagttgc tccaaggttg cagcctaggt tctattcgat 8580atcatcatcg cccaagattg ctgaaactag aattcacgtc acatgtgcac tggtttatga 8640gaaaatgcca actggcagga ttcataaggg agtgtgttcc acttggatga agaatgctgt 8700gccttacgag aagagtgaaa actgttcctc ggcgccgata tttgttaggc aatccaactt 8760caagcttcct tctgattcta aggtaccgat catcatgatc ggtccaggga ctggattagc 8820tccattcaga ggattccttc aggaaagact agcgttggta gaatctggtg ttgaacttgg 8880gccatcagtt ttgttctttg gatgcagaaa ccgtagaatg gatttcatct acgaggaaga 8940gctccagcga tttgttgaga gtggtgctct cgcagagcta agtgtcgcct tctctcgtga 9000aggacccacc aaagaatacg tacagcacaa gatgatggac aaggcttctg atatctggaa 9060tatgatctct caaggagctt atttatatgt ttgtggtgac gccaaaggca tggcaagaga 9120tgttcacaga tctctccaca caatagctca agaacagggg tcaatggatt caactaaagc 9180agagggcttc gtgaagaatc tgcaaacgag tggaagatat cttagagatg tatggtaagg 9240taccgcggct agctaagatc cgctctaacc gaaaaggaag gagttagaca acctgaagtc 9300taggtcccta tttatttttt tatagttatg ttagtattaa gaacgttatt tatatttcaa 9360atttttcttt tttttctgta cagacgcgtg tacgcatgta acattatact gaaaaccttg 9420cttgagaagg ttttgggacg ctcgaagatc cagctgcatt aatgaatcgg ccaacgcgcg 9480gggagaggcg gtttgcgtat tgggcgctct tccgcttcct cgctcactga ctcgctgcgc 9540tcggtcgttc ggctgcggcg agcggtatca gctcactcaa aggcggtaat acggttatcc 9600acagaatcag gggataacgc aggaaagaac atgtgagcaa aaggccagca aaaggccagg 9660aaccgtaaaa aggccgcgtt gctggcgttt ttccataggc tccgcccccc tgacgagcat 9720cacaaaaatc gacgctcaag tcagaggtgg cgaaacccga caggactata aagataccag 9780gcgtttcccc ctggaagctc cctcgtgcgc tctcctgttc cgaccctgcc gcttaccgga 9840tacctgtccg cctttctccc ttcgggaagc gtggcgcttt ctcatagctc acgctgtagg 9900tatctcagtt cggtgtaggt cgttcgctcc aagctgggct gtgtgcacga accccccgtt 9960cagcccgacc gctgcgcctt atccggtaac tatcgtcttg agtccaaccc ggtaagacac 10020gacttatcgc cactggcagc agccactggt aacaggatta gcagagcgag gtatgtaggc 10080ggtgctacag agttcttgaa gtggtggcct aactacggct acactagaag gacagtattt 10140ggtatctgcg ctctgctgaa gccagttacc ttcggaaaaa gagttggtag ctcttgatcc 10200ggcaaacaaa ccaccgctgg tagcggtggt ttttttgttt gcaagcagca gattacgcgc 10260agaaaaaaag gatctcaaga agatcctttg atcttttcta cggggtctga cgctcagtgg 10320aacgaaaact cacgttaagg gattttggtc atgagattat caaaaaggat cttcacctag 10380atccttttaa attaaaaatg aagttttaaa tcaatctaaa gtatatatga gtaaacttgg 10440tctgacagtt accaatgctt aatcagtgag gcacctatct cagcgatctg tctatttcgt 10500tcatccatag ttgcctgact ccccgtcgtg tagataacta cgatacggga gggcttacca 10560tctggcccca gtgctgcaat gataccgcga gacccacgct caccggctcc agatttatca 10620gcaataaacc agccagccgg aagggccgag cgcagaagtg gtcctgcaac tttatccgcc 10680tccatccagt ctattaattg ttgccgggaa gctagagtaa gtagttcgcc agttaatagt 10740ttgcgcaacg ttgttgccat tgctacaggc atcgtggtgt cacgctcgtc gtttggtatg 10800gcttcattca gctccggttc ccaacgatca aggcgagtta catgatcccc catgttgtgc 10860aaaaaagcgg ttagctcctt cggtcctccg atcgttgtca gaagtaagtt ggccgcagtg 10920ttatcactca tggttatggc agcactgcat aattctctta ctgtcatgcc atccgtaaga 10980tgcttttctg tgactggtga gtactcaacc aagtcattct gagaatagtg tatgcggcga 11040ccgagttgct cttgcccggc gtcaatacgg gataataccg cgccacatag cagaacttta 11100aaagtgctca tcattggaaa acgttcttcg gggcgaaaac tctcaaggat cttaccgctg 11160ttgagatcca gttcgatgta acccactcgt gcacccaact gatcttcagc atcttttact 11220ttcaccagcg tttctgggtg agcaaaaaca ggaaggcaaa atgccgcaaa aaagggaata 11280agggcgacac ggaaatgttg aatactcata ctcttccttt ttcaatatta ttgaagcatt 11340tatcagggtt attgtctcat gagcggatac atatttgaat gtatttagaa aaataaacaa 11400ataggggttc cgcgcacatt tccccgaaaa gtgccacctg aacgaagcat ctgtgcttca 11460ttttgtagaa caaaaatgca acgcgagagc gctaattttt caaacaaaga atctgagctg 11520catttttaca gaacagaaat gcaacgcgaa agcgctattt taccaacgaa gaatctgtgc 11580ttcatttttg taaaacaaaa atgcaacgcg agagcgctaa tttttcaaac aaagaatctg 11640agctgcattt ttacagaaca gaaatgcaac gcgagagcgc tattttacca acaaagaatc 11700tatacttctt ttttgttcta caaaaatgca tcccgagagc gctatttttc taacaaagca 11760tcttagatta ctttttttct cctttgtgcg ctctataatg cagtctcttg ataacttttt 11820gcactgtagg tccgttaagg ttagaagaag gctactttgg tgtctatttt ctcttccata 11880aaaaaagcct gactccactt cccgcgttta ctgattacta gcgaagctgc gggtgcattt 11940tttcaagata aaggcatccc cgattatatt ctataccgat gtggattgcg catactttgt 12000gaacagaaag tgatagcgtt gatgattctt cattggtcag aaaattatga acggtttctt 12060ctattttgtc tctatatact acgtatagga aatgtttaca ttttcgtatt gttttcgatt 12120cactctatga atagttctta ctacaatttt tttgtctaaa gagtaatact agagataaac 12180ataaaaaatg tagaggtcga gtttagatgc aagttcaagg agcgaaaggt ggatgggtag 12240gttatatagg gatatagcac agagatatat agcaaagaga tacttttgag caatgtttgt 12300ggaagcggta ttcgcaatat tttagtagct cgttacagtc cggtgcgttt ttggtttttt 12360gaaagtgcgt cttcagagcg cttttggttt tcaaaagcgc tctgaagttc ctatactttc 12420tagagaatag gaacttcgga ataggaactt caaagcgttt ccgaaaacga gcgcttccga 12480aaatgcaacg cgagctgcgc acatacagct cactgttcac gtcgcaccta tatctgcgtg 12540ttgcctgtat atatatatac atgagaagaa cggcatagtg cgtgtttatg cttaaatgcg 12600tacttatatg cgtctattta tgtaggatga aaggtagtct agtacctcct gtgatattat 12660cccattccat gcggggtatc gtatgcttcc ttcagcacta ccctttagct gttctatatg 12720ctgccactcc tcaattggat tagtctcatc cttcaatgct atcatttcct ttgatattgg 12780atcatactaa gaaaccatta ttatcatgac attaacctat aaaaataggc gtatcacgag 12840gccctttcgt c 12851910157DNAartificialvector 9tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180accataaatt cccgttttaa gagcttggtg agcgctagga gtcactgcca ggtatcgttt 240gaacacggca ttagtcaggg aagtcataac acagtccttt cccgcaattt tctttttcta 300ttactcttgg cctcctctag tacactctat atttttttat gcctcggtaa tgattttcat 360tttttttttt cccctagcgg atgactcttt ttttttctta gcgattggca ttatcacata 420atgaattata cattatataa agtaatgtga tttcttcgaa gaatatacta aaaaatgagc 480aggcaagata aacgaaggca aagatgacag agcagaaagc cctagtaaag cgtattacaa 540atgaaaccaa gattcagatt gcgatctctt taaagggtgg tcccctagcg atagagcact 600cgatcttccc agaaaaagag gcagaagcag tagcagaaca ggccacacaa tcgcaagtga 660ttaacgtcca cacaggtata gggtttctgg accatatgat acatgctctg gccaagcatt 720ccggctggtc gctaatcgtt gagtgcattg gtgacttaca catagacgac catcacacca 780ctgaagactg cgggattgct ctcggtcaag cttttaaaga ggccctactg gcgcgtggag 840taaaaaggtt tggatcagga tttgcgcctt tggatgaggc actttccaga gcggtggtag 900atctttcgaa caggccgtac gcagttgtcg aacttggttt gcaaagggag aaagtaggag 960atctctcttg cgagatgatc ccgcattttc ttgaaagctt tgcagaggct agcagaatta 1020ccctccacgt tgattgtctg cgaggcaaga atgatcatca ccgtagtgag agtgcgttca 1080aggctcttgc ggttgccata agagaagcca cctcgcccaa tggtaccaac gatgttccct 1140ccaccaaagg tgttcttatg tagtgacacc gattatttaa agctgcagca tacgatatat 1200atacatgtgt atatatgtat acctatgaat gtcagtaagt atgtatacga acagtatgat 1260actgaagatg acaaggtaat gcatcattct atacgtgtca ttctgaacga ggcgcgcttt 1320ccttttttct ttttgctttt tctttttttt tctcttgaac tcgacggatc tatgcggtgt 1380gaaataccgc acagatgcgt aaggagaaaa taccgcatca ggaaattgta aacgttaata 1440ttttgttaaa attcgcgtta aatttttgtt aaatcagctc attttttaac caataggccg 1500aaatcggcaa aatcccttat aaatcaaaag aatagaccga gatagggttg agtgttgttc 1560cagtttggaa caagagtcca ctattaaaga acgtggactc caacgtcaaa gggcgaaaaa 1620ccgtctatca gggcgatggc ccactacgtg aaccatcacc ctaatcaagt tttttggggt 1680cgaggtgccg taaagcacta aatcggaacc ctaaagggag cccccgattt agagcttgac 1740ggggaaagcc ggcgaacgtg gcgagaaagg aagggaagaa agcgaaagga gcgggcgcta 1800gggcgctggc aagtgtagcg gtcacgctgc gcgtaaccac cacacccgcc gcgcttaatg 1860cgccgctaca gggcgcgtcg cgccattcgc cattcaggct gcgcaactgt tgggaagggc 1920gatcggtgcg ggcctcttcg ctattacgcc agctgaattg gagcgacctc atgctatacc 1980tgagaaagca acctgaccta caggaaagag ttactcaaga ataagaattt tcgttttaaa 2040acctaagagt cactttaaaa tttgtataca cttatttttt ttataactta tttaataata 2100aaaatcataa atcataagaa attcgcttat ttagaagtgt caacaacgta tctaccaacg 2160atttgaccct tttccatctt ttcgtaaatt tctggcaagg tagacaagcc gacaaccttg 2220attggagact tgaccaaacc tctggcgaag aattgttaat taagagctca gatcttatcg 2280tcgtcatcct tgtaatccat cgatactagt ctagttcatt aatccatttg ctagtcttgc 2340tcttagatcc ttcctcaata tcttccctga tggagcttta ggaatagagt cagtgaagaa 2400cactttgttg attctcttat aaaacacaac ctgttttgac acgaattgct tgatttcatc 2460ttcggatata tttgaatctt tcgatctcac cacaaacgca acaggaacct caccagcatc 2520ttcttccttc atggcgacga cagcaacatc attgatttct ggatgaccta tgaggagaga 2580ctctagctca gctggagcca cttgaaatcc tttgtacttg atgagttctt tcaatctatc 2640cacaatgaaa agctcgtcgt catcatcgat aaatccgacg tctccagtgt gaagccaacc 2700atctttatcg atcgtcgatg ccgtggccaa ggggtcattg agatagcctt tcatgatttg 2760gttgccacgg atgcatattt cgccgggttt gttcctaggc aaagaatctc ctgtgtctgg 2820atcaagtatc ttcatctcgg cgttcctcac caccgtacca catgctcctg acttcactgg 2880aaacggctct ttagcaaacc ctaacgacat tgctagcacc ggacctgctt ctgtcatccc 2940atagccctga ccaagcttgg cgttaggaaa cttagcacta atagcatctt caagctcctt 3000accaagagga gctgctccag acttaaccat cctaaccgag ctcagatcat acttctccgt 3060ctccggcgac ttcgcgatag ctaaaacgat cggtggcacg accatagcca ccgtgacttt 3120acacctttgt atctgctcta acaagagagt gatttcgaac ttaggcatta tcaagatcgt 3180ggcaccaact ctgagactac agagcatgat ggagttgaga gcgtatatat ggaacatagg 3240caagacacag aggatcacgt cgtctctgtt gaagtaaaga ttcggattct cgccgtcgac 3300ttgctgcgcc acgctcgtga ctagaccttt gtgtgttagc atcactcctt tggggagacc 3360cgtcgtgccg gatgagaaag gaagcgccac gacgtcttct ggcgaaatct tctccggtat 3420tgagtccact cgtggttctt cggactgagt taactcggag aaacggaggc agttttcggg 3480gatggcgtcg gagtcggtgg tgacgatcaa aacgccgtcg ttttggaggt tcttgatttt 3540atcgacgtaa cgggattgag tgacgatgag tttcgccgcg gaggctttgg cttgtttaga 3600aatctccgcc ggagtgaaga acgggttcgc ggaggtggtg attgcgccga tgaaggaggc 3660ggcaaggaaa gtgaggacta cttcaggaga gttcgggagg aggatcatta caacgtcgtg 3720ttgcttcacg ccgaggttat gaagaccggc ggcgagtttc cgagatgtta cgtggacatc 3780ggcgtaggtg tatacttcgc cggtgggacc gttgatcaag catggcttag cggcgaactc 3840tgagatattt tcgaagatgt agtcgtggag tgggaggtgg ttagggatgt atatatcagg 3900caatctcgat cggaaaatga cgtcattact acactgtttc tgatcattct gatcattgac 3960tatcacatct tgtgtcgtca tgaattctct agaaaactta gattagattg ctatgctttc 4020tttctaatga gcaagaagta aaaaaagttg taatagaaca agaaaaatga aactgaaact 4080tgagaaattg aagaccgttt attaacttaa atatcaatgg gaggtcatcg aaagagaaaa 4140aaatcaaaaa aaaaattttc aagaaaaaga aacgtgataa aaatttttat tgcctttttc 4200gacgaagaaa aagaaacgag gcggtctctt ttttcttttc caaaccttta gtacgggtaa 4260ttaacgacac cctagaggaa gaaagagggg aaatttagta tgctgtgctt gggtgttttg 4320aagtggtacg gcgatgcgcg gagtccgaga aaatctggaa gagtaaaaaa ggagtagaaa 4380cattttgaag ctatgagctc cagcttttgt tccctttagt gagggttaat tgcgcgcttg 4440gcgtaatcat ggtcatagct gtttcctgtg tgaaattgtt atccgctcac aattccacac 4500aacataggag ccggaagcat aaagtgtaaa gcctggggtg cctaatgagt gaggtaactc 4560acattaattg cgttgcgctc actgcccgct ttccagtcgg gaaacctgtc gtgccagctg 4620cattaatgaa tcggccaacg cgcggggaga ggcggtttgc gtattgggcg ctcttccgag 4680ctcagtttat cattatcaat actcgccatt tcaaagaata cgtaaataat taatagtagt 4740gattttccta actttattta gtcaaaaaat tagcctttta attctgctgt aacccgtaca 4800tgcccaaaat agggggcggg ttacacagaa tatataacat cgtaggtgtc tgggtgaaca 4860gtttattcct ggcatccact aaatataatg gagcccgctt tttaagctgg catccagaaa 4920aaaaaagaat cccagcacca aaatattgtt ttcttcacca accatcagtt cataggtcca 4980ttctcttagc gcaactacag agaacagggg cacaaacagg caaaaaacgg gcacaacctc 5040aatggagtga tgcaacctgc ctggagtaaa tgatgacaca aggcaattga cccacgcatg

5100tatctatctc attttcttac accttctatt accttctgct ctctctgatt tggaaaaagc 5160tgaaaaaaaa ggttgaaacc agttccctga aattattccc ctacttgact aataagtata 5220taaagacggt aggtattgat tgtaattctg taaatctatt tcttaaactt cttaaattct 5280acttttatag ttagtctttt ttttagtttt aaaacaccag aacttagttt cgacggattc 5340tagaggatcc atggcatccg tagaggagtt cagaaatgca cagagggcaa aaggtccagc 5400aaccatattg gctattggaa cagccacccc tgatcactgt gtttatcaat ctgattacgc 5460tgattactat ttcagagtaa ctaaaagtga acatatgaca gaacttaaga aaaagtttaa 5520tagaatttgt gataaatcta tgataaagaa aagatacata catctaactg aagaaatgtt 5580agaggaacat ccaaatatag gtgcatatat ggcaccatct ttgaatatta gacaagaaat 5640cataacagcc gaggtaccta gactaggtag agacgcagcc ttgaaagctt taaaggaatg 5700gggacaacca aaatctaaga ttacacattt ggttttctgt acaacttccg gtgtcgaaat 5760gccaggtgct gattataaac tagcaaacct attgggatta gagacctctg ttagaagagt 5820tatgttgtat catcaaggtt gttacgccgg aggtacagtg cttagaactg ctaaggattt 5880ggcagaaaat aacgccggtg ctagggtttt agtcgtctgc agtgaaatca ctgtcgtaac 5940tttcagaggt ccatcagaag atgctctaga cagtttggtc ggacaagcat tgtttggcga 6000tggatcttcc gccgtaattg taggcagcga tcctgatgtg tccattgaaa gaccactatt 6060tcaattagtt tctgctgctc aaacttttat tccaaattcc gccggtgcca tagcaggaaa 6120cttgagagaa gttggtttga cttttcattt gtggcctaat gtcccaacct taatttcaga 6180aaacatcgaa aaatgcttaa ctcaagcctt tgacccattg ggcataagcg actggaactc 6240attgttttgg attgctcatc caggtggtcc agcaatttta gacgcagtgg aggcaaaact 6300aaacttagag aagaaaaagt tggaagctac aagacacgtt ctatcagagt atggcaacat 6360gagctctgcc tgcgttttat tcattctaga tgagatgagg aagaagtctt taaagggtga 6420aaaagccaca accggagaag gtttagattg gggtgttcta tttggtttcg gtcctggctt 6480aacaattgag acagtggtgt tacactctgt tccaactgtc actaactaat gactcgagta 6540agcttggtac cgcggctagc taagatccgc tctaaccgaa aaggaaggag ttagacaacc 6600tgaagtctag gtccctattt atttttttat agttatgtta gtattaagaa cgttatttat 6660atttcaaatt tttctttttt ttctgtacag acgcgtgtac gcatgtaaca ttatactgaa 6720aaccttgctt gagaaggttt tgggacgctc gaagatccag ctgcattaat gaatcggcca 6780acgcgcgggg agaggcggtt tgcgtattgg gcgctcttcc gcttcctcgc tcactgactc 6840gctgcgctcg gtcgttcggc tgcggcgagc ggtatcagct cactcaaagg cggtaatacg 6900gttatccaca gaatcagggg ataacgcagg aaagaacatg tgagcaaaag gccagcaaaa 6960ggccaggaac cgtaaaaagg ccgcgttgct ggcgtttttc cataggctcc gcccccctga 7020cgagcatcac aaaaatcgac gctcaagtca gaggtggcga aacccgacag gactataaag 7080ataccaggcg tttccccctg gaagctccct cgtgcgctct cctgttccga ccctgccgct 7140taccggatac ctgtccgcct ttctcccttc gggaagcgtg gcgctttctc atagctcacg 7200ctgtaggtat ctcagttcgg tgtaggtcgt tcgctccaag ctgggctgtg tgcacgaacc 7260ccccgttcag cccgaccgct gcgccttatc cggtaactat cgtcttgagt ccaacccggt 7320aagacacgac ttatcgccac tggcagcagc cactggtaac aggattagca gagcgaggta 7380tgtaggcggt gctacagagt tcttgaagtg gtggcctaac tacggctaca ctagaaggac 7440agtatttggt atctgcgctc tgctgaagcc agttaccttc ggaaaaagag ttggtagctc 7500ttgatccggc aaacaaacca ccgctggtag cggtggtttt tttgtttgca agcagcagat 7560tacgcgcaga aaaaaaggat ctcaagaaga tcctttgatc ttttctacgg ggtctgacgc 7620tcagtggaac gaaaactcac gttaagggat tttggtcatg agattatcaa aaaggatctt 7680cacctagatc cttttaaatt aaaaatgaag ttttaaatca atctaaagta tatatgagta 7740aacttggtct gacagttacc aatgcttaat cagtgaggca cctatctcag cgatctgtct 7800atttcgttca tccatagttg cctgactccc cgtcgtgtag ataactacga tacgggaggg 7860cttaccatct ggccccagtg ctgcaatgat accgcgagac ccacgctcac cggctccaga 7920tttatcagca ataaaccagc cagccggaag ggccgagcgc agaagtggtc ctgcaacttt 7980atccgcctcc atccagtcta ttaattgttg ccgggaagct agagtaagta gttcgccagt 8040taatagtttg cgcaacgttg ttgccattgc tacaggcatc gtggtgtcac gctcgtcgtt 8100tggtatggct tcattcagct ccggttccca acgatcaagg cgagttacat gatcccccat 8160gttgtgcaaa aaagcggtta gctccttcgg tcctccgatc gttgtcagaa gtaagttggc 8220cgcagtgtta tcactcatgg ttatggcagc actgcataat tctcttactg tcatgccatc 8280cgtaagatgc ttttctgtga ctggtgagta ctcaaccaag tcattctgag aatagtgtat 8340gcggcgaccg agttgctctt gcccggcgtc aatacgggat aataccgcgc cacatagcag 8400aactttaaaa gtgctcatca ttggaaaacg ttcttcgggg cgaaaactct caaggatctt 8460accgctgttg agatccagtt cgatgtaacc cactcgtgca cccaactgat cttcagcatc 8520ttttactttc accagcgttt ctgggtgagc aaaaacagga aggcaaaatg ccgcaaaaaa 8580gggaataagg gcgacacgga aatgttgaat actcatactc ttcctttttc aatattattg 8640aagcatttat cagggttatt gtctcatgag cggatacata tttgaatgta tttagaaaaa 8700taaacaaata ggggttccgc gcacatttcc ccgaaaagtg ccacctgaac gaagcatctg 8760tgcttcattt tgtagaacaa aaatgcaacg cgagagcgct aatttttcaa acaaagaatc 8820tgagctgcat ttttacagaa cagaaatgca acgcgaaagc gctattttac caacgaagaa 8880tctgtgcttc atttttgtaa aacaaaaatg caacgcgaga gcgctaattt ttcaaacaaa 8940gaatctgagc tgcattttta cagaacagaa atgcaacgcg agagcgctat tttaccaaca 9000aagaatctat acttcttttt tgttctacaa aaatgcatcc cgagagcgct atttttctaa 9060caaagcatct tagattactt tttttctcct ttgtgcgctc tataatgcag tctcttgata 9120actttttgca ctgtaggtcc gttaaggtta gaagaaggct actttggtgt ctattttctc 9180ttccataaaa aaagcctgac tccacttccc gcgtttactg attactagcg aagctgcggg 9240tgcatttttt caagataaag gcatccccga ttatattcta taccgatgtg gattgcgcat 9300actttgtgaa cagaaagtga tagcgttgat gattcttcat tggtcagaaa attatgaacg 9360gtttcttcta ttttgtctct atatactacg tataggaaat gtttacattt tcgtattgtt 9420ttcgattcac tctatgaata gttcttacta caattttttt gtctaaagag taatactaga 9480gataaacata aaaaatgtag aggtcgagtt tagatgcaag ttcaaggagc gaaaggtgga 9540tgggtaggtt atatagggat atagcacaga gatatatagc aaagagatac ttttgagcaa 9600tgtttgtgga agcggtattc gcaatatttt agtagctcgt tacagtccgg tgcgtttttg 9660gttttttgaa agtgcgtctt cagagcgctt ttggttttca aaagcgctct gaagttccta 9720tactttctag agaataggaa cttcggaata ggaacttcaa agcgtttccg aaaacgagcg 9780cttccgaaaa tgcaacgcga gctgcgcaca tacagctcac tgttcacgtc gcacctatat 9840ctgcgtgttg cctgtatata tatatacatg agaagaacgg catagtgcgt gtttatgctt 9900aaatgcgtac ttatatgcgt ctatttatgt aggatgaaag gtagtctagt acctcctgtg 9960atattatccc attccatgcg gggtatcgta tgcttccttc agcactaccc tttagctgtt 10020ctatatgctg ccactcctca attggattag tctcatcctt caatgctatc atttcctttg 10080atattggatc atctaagaaa ccattattat catgacatta acctataaaa ataggcgtat 10140cacgaggccc tttcgtc 101571039DNAartificialprimer 10cggaattccg tacgtaatgg atcaaatcga agcaatgtt 391129DNAartificialprimer 11cgactagttt agcaaatcgg aatcggagc 291243DNAartificialprimer 12cgctcgaggc ggccgctaaa atatggacct cctcttgctg gag 431358DNAartificialprimer 13agtagatgga gtagatggag tagatggagt agatggacag ttccttggtt tcataacg 581455DNAartificialprimer 14ccatctactc catctactcc atctactcca tctactagga gatccggttc tggga 551537DNAartificialprimer 15cgggtaccat ttaccataca tctctaagat atcttcc 371640DNAartificialprimer 16gcgaattctt atgacgacac aagatgtgat agtcaatgat 401741DNAartificialprimer 17gcactagtat cctagttcat taatccattt gctagtcttg c 411841DNAartificialprimer 18gcgagctcag tttatcatta tcaatactcg ccatttcaaa g 411946DNAartificialprimer 19cgtctagaat ccgtcgaaac taagttctgg tgttttaaaa ctaaaa 462044DNAartificialprimer 20gcgagctcat agcttcaaaa tgtttctact ccttttttac tctt 442145DNAartificialprimer 21cgtctagaaa acttagatta gattgctatg ctttctttct aatga 452250DNAartificialprimer 22ttgcgtattg ggcgctcttc cgagctcagt ttatcattat caatactcgc 502335DNAartificialprimer 23atggatcctc tagaatccgt cgaaactaag ttctg 352441DNAartificialprimer 24atgaattctc tagaaaactt agattagatt gctatgcttt c 412544DNAartificialprimer 25tgataatgat aaactgagct cggaagagcg cccaatacgc aaac 442635DNAartificialprimer 26atggatcctc tagaatccgt cgaaactaag ttctg 352741DNAartificialprimer 27gccgtacgtc tagaaaactt agattagatt gctatgcttt c 412838DNAartificialprimer 28attgcggccg ctctagaatc cgtcgaaact aagttctg 382939DNAartificialprimer 29cggaattccg tacgtaatgg atcaaatcga agcaatgtt 393029DNAartificialprimer 30cgactagttt agcaaatcgg aatcggagc 293143DNAartificialprimer 31cgctcgaggc ggccgctaaa atatggacct cctcttgctg gag 433258DNAartificialprimer 32agtagatgga gtagatggag tagatggagt agatggacag ttccttggtt tcataacg 583355DNAartificialprimer 33ccatctactc catctactcc atctactcca tctactagga gatccggttc tggga 553437DNAartificialprimer 34cgggtaccat ttaccataca tctctaagat atcttcc 373543DNAartificialprimer 35cgctcgaggc ggccgctaaa atatggacct cctcttgctg gag 433637DNAartificialprimer 36cgggtaccat ttaccataca tctctaagat atcttcc 373741DNAartificialprimer 37atgaattctc tagaaaactt agattagatt gctatgcttt c 41381536DNAartificialcodon optimised gene 38atgacacagg tagttgaaag gcaggcagat aggcttagtt ccagggaata tcttgccagg 60gtcgtcaggt ccgctggttg ggatgctggt ttgacttcct gtactgatga ggaaatcgtg 120agaatgggtg ctagtgccag aacaattgaa gagtacttga agtccgataa acctatatac 180ggcttaacac aaggatttgg tccacttgtt ctatttgatg ccgatagtga attagagcaa 240ggaggttctt taatctctca tctaggtaca ggccaaggtg ctcctttggc cccagaagtg 300tcaagactaa tcttatggtt gagaatacag aatatgagaa aaggttattc cgcagtgtca 360cctgtattct ggcagaagtt agccgatcta tggaataagg gtttcacacc agctattcca 420aggcacggta ctgtctccgc atctggcgat ttgcagccac ttgctcatgc tgctttagca 480ttcactggcg ttggagaagc atggacaaga gatgctgacg gcagatggag cactgttcct 540gcagtagacg ctttggctgc tttgggtgca gaaccatttg attggccagt tagagaggca 600ttagcttttg ttaatggtac tggcgcctca ttggcagtag ccgtgctaaa ccataggagt 660gctttaagat tagtgagagc ctgtgccgtg ttgtccgcaa ggttagccac attgcttggt 720gccaatcctg agcattatga tgtaggtcat ggcgttgcaa gaggccaagt tggtcaattg 780actgcagcag aatggatcag gcaaggttta cctagaggta tggtcagaga cggaagtagg 840ccattgcaag aaccatactc cttaagatgt gctcctcaag ttttaggtgc cgttttggac 900cagttagatg gagctggtga cgtattagct agggaagtcg acggttgtca ggacaatcct 960ataacttacg aaggagagtt gttgcatggt ggtaatttcc atgcaatgcc agttggtttc 1020gcatctgatc aaataggttt agcaatgcat atggccgctt acttggcaga aaggcagctt 1080ggtttattag ttagccctgt tacaaacggt gaccttccac caatgttaac ccctagggct 1140ggtagaggcg caggactagc aggtgtgcag atatccgcta ccagttttgt tagtagaatt 1200aggcagttgg tgtttcctgc aagcttgaca actttgccta ccaacggatg gaatcaagat 1260cacgtcccaa tggcattgaa tggcgcaaat tcagtattcg aagccttaga gttgggatgg 1320ttaactgttg gtagcttggc agtaggtgtt gcccaattag ccgccatgac aggtcacgct 1380gctgagggtg tttgggcaga acttgctggt atttgccctc cacttgatgc tgatagacct 1440ttgggagcag aagtgagggc tgctagggat cttttgtctg cccacgctga tcaattgtta 1500gtcgatgaag ctgatggaaa agacttcgga taatga 1536391671DNAArabidopsis thaliana 39atgacgacac aagatgtgat agtcaatgat cagaatgatc agaaacagtg tagtaatgac 60gtcattttcc gatcgagatt gcctgatata tacatcccta accacctccc actccacgac 120tacatcttcg aaaatatctc agagttcgcc gctaagccat gcttgatcaa cggtcccacc 180ggcgaagtat acacctacgc cgatgtccac gtaacatctc ggaaactcgc cgccggtctt 240cataacctcg gcgtgaagca acacgacgtt gtaatgatcc tcctcccgaa ctctcctgaa 300gtagtcctca ctttccttgc cgcctccttc atcggcgcaa tcaccacctc cgcgaacccg 360ttcttcactc cggcggagat ttctaaacaa gccaaagcct ccgcggcgaa actcatcgtc 420actcaatccc gttacgtcga taaaatcaag aacctccaaa acgacggcgt tttgatcgtc 480accaccgact ccgacgccat ccccgaaaac tgcctccgtt tctccgagtt aactcagtcc 540gaagaaccac gagtggactc aataccggag aagatttcgc cagaagacgt cgtggcgctt 600cctttctcat ccggcacgac gggtctcccc aaaggagtga tgctaacaca caaaggtcta 660gtcacgagcg tggcgcagca agtcgacggc gagaatccga atctttactt caacagagac 720gacgtgatcc tctgtgtctt gcctatgttc catatatacg ctctcaactc catcatgctc 780tgtagtctca gagttggtgc cacgatcttg ataatgccta agttcgaaat cactctcttg 840ttagagcaga tacaaaggtg taaagtcacg gtggctatgg tcgtgccacc gatcgtttta 900gctatcgcga agtcgccgga gacggagaag tatgatctga gctcggttag gatggttaag 960tctggagcag ctcctcttgg taaggagctt gaagatgcta ttagtgctaa gtttcctaac 1020gccaagcttg gtcagggcta tgggatgaca gaagcaggtc cggtgctagc aatgtcgtta 1080gggtttgcta aagagccgtt tccagtgaag tcaggagcat gtggtacggt ggtgaggaac 1140gccgagatga agatacttga tccagacaca ggagattctt tgcctaggaa caaacccggc 1200gaaatatgca tccgtggcaa ccaaatcatg aaaggctatc tcaatgaccc cttggccacg 1260gcatcgacga tcgataaaga tggttggctt cacactggag acgtcggatt tatcgatgat 1320gacgacgagc ttttcattgt ggatagattg aaagaactca tcaagtacaa aggatttcaa 1380gtggctccag ctgagctaga gtctctcctc ataggtcatc cagaaatcaa tgatgttgct 1440gtcgtcgcca tgaaggaaga agatgctggt gaggttcctg ttgcgtttgt ggtgagatcg 1500aaagattcaa atatatccga agatgaaatc aagcaattcg tgtcaaaaca ggttgtgttt 1560tataagagaa tcaacaaagt gttcttcact gactctattc ctaaagctcc atcagggaag 1620atattgagga aggatctaag agcaagacta gcaaatggat taatgaacta g 16714040DNAartificialprimer 40gcgaattctt atgacgacac aagatgtgat agtcaatgat 404141DNAartificialprimer 41gcactagtat cctagttcat taatccattt gctagtcttg c 41421182DNAartificialcodon optimised gene 42atggcatccg tagaggagtt cagaaatgca cagagggcaa aaggtccagc aaccatattg 60gctattggaa cagccacccc tgatcactgt gtttatcaat ctgattacgc tgattactat 120ttcagagtaa ctaaaagtga acatatgaca gaacttaaga aaaagtttaa tagaatttgt 180gataaatcta tgataaagaa aagatacata catctaactg aagaaatgtt agaggaacat 240ccaaatatag gtgcatatat ggcaccatct ttgaatatta gacaagaaat cataacagcc 300gaggtaccta gactaggtag agacgcagcc ttgaaagctt taaaggaatg gggacaacca 360aaatctaaga ttacacattt ggttttctgt acaacttccg gtgtcgaaat gccaggtgct 420gattataaac tagcaaacct attgggatta gagacctctg ttagaagagt tatgttgtat 480catcaaggtt gttacgccgg aggtacagtg cttagaactg ctaaggattt ggcagaaaat 540aacgccggtg ctagggtttt agtcgtctgc agtgaaatca ctgtcgtaac tttcagaggt 600ccatcagaag atgctctaga cagtttggtc ggacaagcat tgtttggcga tggatcttcc 660gccgtaattg taggcagcga tcctgatgtg tccattgaaa gaccactatt tcaattagtt 720tctgctgctc aaacttttat tccaaattcc gccggtgcca tagcaggaaa cttgagagaa 780gttggtttga cttttcattt gtggcctaat gtcccaacct taatttcaga aaacatcgaa 840aaatgcttaa ctcaagcctt tgacccattg ggcataagcg actggaactc attgttttgg 900attgctcatc caggtggtcc agcaatttta gacgcagtgg aggcaaaact aaacttagag 960aagaaaaagt tggaagctac aagacacgtt ctatcagagt atggcaacat gagctctgcc 1020tgcgttttat tcattctaga tgagatgagg aagaagtctt taaagggtga aaaagccaca 1080accggagaag gtttagattg gggtgttcta tttggtttcg gtcctggctt aacaattgag 1140acagtggtgt tacactctgt tccaactgtc actaactaat ga 11824341DNAartificialprimer 43gcgagctcag tttatcatta tcaatactcg ccatttcaaa g 414446DNAartificialprimer 44cgtctagaat ccgtcgaaac taagttctgg tgttttaaaa ctaaaa 464544DNAartificialprimer 45gcgagctcat agcttcaaaa tgtttctact ccttttttac tctt 444645DNAartificialprimer 46cgtctagaaa acttagatta gattgctatg ctttctttct aatga 454750DNAartificialprimer 47ttgcgtattg ggcgctcttc cgagctcagt ttatcattat caatactcgc 504835DNAartificialprimer 48atggatcctc tagaatccgt cgaaactaag ttctg 354941DNAartificialprimer 49atgaattctc tagaaaactt agattagatt gctatgcttt c 415044DNAartificialprimer 50tgataatgat aaactgagct cggaagagcg cccaatacgc aaac 445141DNAartificialprimer 51atgaattctc tagaaaactt agattagatt gctatgcttt c 415235DNAartificialprimer 52atggatcctc tagaatccgt cgaaactaag ttctg 35531373DNAartificialfused gene fragments 53atgaattctc tagaaaactt agattagatt gctatgcttt ctttctaatg agcaagaagt 60aaaaaaagtt gtaatagaac aagaaaaatg aaactgaaac ttgagaaatt gaagaccgtt 120tattaactta aatatcaatg ggaggtcatc gaaagagaaa aaaatcaaaa aaaaaatttt 180caagaaaaag aaacgtgata aaaattttta ttgccttttt cgacgaagaa aaagaaacga 240ggcggtctct tttttctttt ccaaaccttt agtacgggta attaacgaca ccctagagga 300agaaagaggg gaaatttagt atgctgtgct tgggtgtttt gaagtggtac ggcgatgcgc 360ggagtccgag aaaatctgga agagtaaaaa aggagtagaa acattttgaa gctatgagct 420ccagcttttg ttccctttag tgagggttaa ttgcgcgctt ggcgtaatca tggtcatagc 480tgtttcctgt gtgaaattgt tatccgctca caattccaca caacatagga gccggaagca 540taaagtgtaa agcctggggt gcctaatgag tgaggtaact cacattaatt gcgttgcgct 600cactgcccgc tttccagtcg ggaaacctgt cgtgccagct gcattaatga atcggccaac 660gcgcggggag aggcggtttg cgtattgggc gctcttccga gctcagttta tcattatcaa 720tactcgccat ttcaaagaat acgtaaataa ttaatagtag tgattttcct aactttattt 780agtcaaaaaa ttagcctttt aattctgctg taacccgtac atgcccaaaa tagggggcgg 840gttacacaga atatataaca tcgtaggtgt ctgggtgaac agtttattcc tggcatccac 900taaatataat ggagcccgct ttttaagctg gcatccagaa aaaaaaagaa tcccagcacc 960aaaatattgt tttcttcacc aaccatcagt tcataggtcc attctcttag cgcaactaca 1020gagaacaggg gcacaaacag gcaaaaaacg ggcacaacct caatggagtg atgcaacctg 1080cctggagtaa atgatgacac aaggcaattg acccacgcat gtatctatct cattttctta 1140caccttctat taccttctgc tctctctgat ttggaaaaag ctgaaaaaaa aggttgaaac 1200cagttccctg aaattattcc cctacttgac taataagtat ataaagacgg taggtattga 1260ttgtaattct gtaaatctat ttcttaaact tcttaaattc tacttttata gttagtcttt 1320tttttagttt taaaacacca gaacttagtt tcgacggatt ctagaggatc cat 13735441DNAartificialprimer 54atggatcctc tagaaaactt agattagatt gctatgcttt c 415536DNAartificialprimer 55atgaattctc tagaatccgt cgaaactaag ttctgg 36568832DNAartificialvector 56gacgaaaggg cctcgtgata cgcctatttt tataggttaa tgtcatgata ataatggttt 60cttagtatga tccaatatca aaggaaatga tagcattgaa ggatgagact aatccaattg 120aggagtggca gcatatagaa cagctaaagg gtagtgctga aggaagcata cgataccccg 180catggaatgg gataatatca caggaggtac tagactacct ttcatcctac ataaatagac 240gcatataagt acgcatttaa gcataaacac gcactatgcc gttcttctca tgtatatata 300tatacaggca acacgcagat ataggtgcga cgtgaacagt gagctgtatg tgcgcagctc 360gcgttgcatt ttcggaagcg ctcgttttcg gaaacgcttt

gaagttccta ttccgaagtt 420cctattctct agaaagtata ggaacttcag agcgcttttg aaaaccaaaa gcgctctgaa 480gacgcacttt caaaaaacca aaaacgcacc ggactgtaac gagctactaa aatattgcga 540ataccgcttc cacaaacatt gctcaaaagt atctctttgc tatatatctc tgtgctatat 600ccctatataa cctacccatc cacctttcgc tccttgaact tgcatctaaa ctcgacctct 660acatttttta tgtttatctc tagtattact ctttagacaa aaaaattgta gtaagaacta 720ttcatagagt gaatcgaaaa caatacgaaa atgtaaacat ttcctatacg tagtatatag 780agacaaaata gaagaaaccg ttcataattt tctgaccaat gaagaatcat caacgctatc 840actttctgtt cacaaagtat gcgcaatcca catcggtata gaatataatc ggggatgcct 900ttatcttgaa aaaatgcacc cgcagcttcg ctagtaatca gtaaacgcgg gaagtggagt 960caggcttttt ttatggaaga gaaaatagac accaaagtag ccttcttcta accttaacgg 1020acctacagtg caaaaagtta tcaagagact gcattataga gcgcacaaag gagaaaaaaa 1080gtaatctaag atgctttgtt agaaaaatag cgctctcggg atgcattttt gtagaacaaa 1140aaagaagtat agattctttg ttggtaaaat agcgctctcg cgttgcattt ctgttctgta 1200aaaatgcagc tcagattctt tgtttgaaaa attagcgctc tcgcgttgca tttttgtttt 1260acaaaaatga agcacagatt cttcgttggt aaaatagcgc tttcgcgttg catttctgtt 1320ctgtaaaaat gcagctcaga ttctttgttt gaaaaattag cgctctcgcg ttgcattttt 1380gttctacaaa atgaagcaca gatgcttcgt tcaggtggca cttttcgggg aaatgtgcgc 1440ggaaccccta tttgtttatt tttctaaata cattcaaata tgtatccgct catgagacaa 1500taaccctgat aaatgcttca ataatattga aaaaggaaga gtatgagtat tcaacatttc 1560cgtgtcgccc ttattccctt ttttgcggca ttttgccttc ctgtttttgc tcacccagaa 1620acgctggtga aagtaaaaga tgctgaagat cagttgggtg cacgagtggg ttacatcgaa 1680ctggatctca acagcggtaa gatccttgag agttttcgcc ccgaagaacg ttttccaatg 1740atgagcactt ttaaagttct gctatgtggc gcggtattat cccgtattga cgccgggcaa 1800gagcaactcg gtcgccgcat acactattct cagaatgact tggttgagta ctcaccagtc 1860acagaaaagc atcttacgga tggcatgaca gtaagagaat tatgcagtgc tgccataacc 1920atgagtgata acactgcggc caacttactt ctgacaacga tcggaggacc gaaggagcta 1980accgcttttt tgcacaacat gggggatcat gtaactcgcc ttgatcgttg ggaaccggag 2040ctgaatgaag ccataccaaa cgacgagcgt gacaccacga tgcctgtagc aatggcaaca 2100acgttgcgca aactattaac tggcgaacta cttactctag cttcccggca acaattaata 2160gactggatgg aggcggataa agttgcagga ccacttctgc gctcggccct tccggctggc 2220tggtttattg ctgataaatc tggagccggt gagcgtgggt ctcgcggtat cattgcagca 2280ctggggccag atggtaagcc ctcccgtatc gtagttatct acacgacggg gagtcaggca 2340actatggatg aacgaaatag acagatcgct gagataggtg cctcactgat taagcattgg 2400taactgtcag accaagttta ctcatatata ctttagattg atttaaaact tcatttttaa 2460tttaaaagga tctaggtgaa gatccttttt gataatctca tgaccaaaat cccttaacgt 2520gagttttcgt tccactgagc gtcagacccc gtagaaaaga tcaaaggatc ttcttgagat 2580cctttttttc tgcgcgtaat ctgctgcttg caaacaaaaa aaccaccgct accagcggtg 2640gtttgtttgc cggatcaaga gctaccaact ctttttccga aggtaactgg cttcagcaga 2700gcgcagatac caaatactgt ccttctagtg tagccgtagt taggccacca cttcaagaac 2760tctgtagcac cgcctacata cctcgctctg ctaatcctgt taccagtggc tgctgccagt 2820ggcgataagt cgtgtcttac cgggttggac tcaagacgat agttaccgga taaggcgcag 2880cggtcgggct gaacgggggg ttcgtgcaca cagcccagct tggagcgaac gacctacacc 2940gaactgagat acctacagcg tgagctatga gaaagcgcca cgcttcccga agggagaaag 3000gcggacaggt atccggtaag cggcagggtc ggaacaggag agcgcacgag ggagcttcca 3060gggggaaacg cctggtatct ttatagtcct gtcgggtttc gccacctctg acttgagcgt 3120cgatttttgt gatgctcgtc aggggggcgg agcctatgga aaaacgccag caacgcggcc 3180tttttacggt tcctggcctt ttgctggcct tttgctcaca tgttctttcc tgcgttatcc 3240cctgattctg tggataaccg tattaccgcc tttgagtgag ctgataccgc tcgccgcagc 3300cgaacgaccg agcgcagcga gtcagtgagc gaggaagcgg aagagcgccc aatacgcaaa 3360ccgcctctcc ccgcgcgttg gccgattcat taatgcagct ggatcttcga gcgtcccaaa 3420accttctcaa gcaaggtttt cagtataatg ttacatgcgt acacgcgtct gtacagaaaa 3480aaaagaaaaa tttgaaatat aaataacgtt cttaatacta acataactat aaaaaaataa 3540atagggacct agacttcagg ttgtctaact ccttcctttt cggttagagc ggatcttagc 3600tagccgcggt accaagctta ctcgaggtct tcttcggaaa tcaacttctg ttccatgtcg 3660acgcccgggc cctatagtga gtcgtattac ggatcctcta gaaaacttag attagattgc 3720tatgctttct ttctaatgag caagaagtaa aaaaagttgt aatagaacaa gaaaaatgaa 3780actgaaactt gagaaattga agaccgttta ttaacttaaa tatcaatggg aggtcatcga 3840aagagaaaaa aatcaaaaaa aaaattttca agaaaaagaa acgtgataaa aatttttatt 3900gcctttttcg acgaagaaaa agaaacgagg cggtctcttt tttcttttcc aaacctttag 3960tacgggtaat taacgacacc ctagaggaag aaagagggga aatttagtat gctgtgcttg 4020ggtgttttga agtggtacgg cgatgcgcgg agtccgagaa aatctggaag agtaaaaaag 4080gagtagaaac attttgaagc tatgagctcc agcttttgtt ccctttagtg agggttaatt 4140gcgcgcttgg cgtaatcatg gtcatagctg tttcctgtgt gaaattgtta tccgctcaca 4200attccacaca acataggagc cggaagcata aagtgtaaag cctggggtgc ctaatgagtg 4260aggtaactca cattaattgc gttgcgctca ctgcccgctt tccagtcggg aaacctgtcg 4320tgccagctgc attaatgaat cggccaacgc gcggggagag gcggtttgcg tattgggcgc 4380tcttccgagc tcagtttatc attatcaata ctcgccattt caaagaatac gtaaataatt 4440aatagtagtg attttcctaa ctttatttag tcaaaaaatt agccttttaa ttctgctgta 4500acccgtacat gcccaaaata gggggcgggt tacacagaat atataacatc gtaggtgtct 4560gggtgaacag tttattcctg gcatccacta aatataatgg agcccgcttt ttaagctggc 4620atccagaaaa aaaaagaatc ccagcaccaa aatattgttt tcttcaccaa ccatcagttc 4680ataggtccat tctcttagcg caactacaga gaacaggggc acaaacaggc aaaaaacggg 4740cacaacctca atggagtgat gcaacctgcc tggagtaaat gatgacacaa ggcaattgac 4800ccacgcatgt atctatctca ttttcttaca ccttctatta ccttctgctc tctctgattt 4860ggaaaaagct gaaaaaaaag gttgaaacca gttccctgaa attattcccc tacttgacta 4920ataagtatat aaagacggta ggtattgatt gtaattctgt aaatctattt cttaaacttc 4980ttaaattcta cttttatagt tagtcttttt tttagtttta aaacaccaga acttagtttc 5040gacggattct agagaattcc cgatgacaca ggtagttgaa aggcaggcag ataggcttag 5100ttccagggaa tatcttgcca gggtcgtcag gtccgctggt tgggatgctg gtttgacttc 5160ctgtactgat gaggaaatcg tgagaatggg tgctagtgcc agaacaattg aagagtactt 5220gaagtccgat aaacctatat acggcttaac acaaggattt ggtccacttg ttctatttga 5280tgccgatagt gaattagagc aaggaggttc tttaatctct catctaggta caggccaagg 5340tgctcctttg gccccagaag tgtcaagact aatcttatgg ttgagaatac agaatatgag 5400aaaaggttat tccgcagtgt cacctgtatt ctggcagaag ttagccgatc tatggaataa 5460gggtttcaca ccagctattc caaggcacgg tactgtctcc gcatctggcg atttgcagcc 5520acttgctcat gctgctttag cattcactgg cgttggagaa gcatggacaa gagatgctga 5580cggcagatgg agcactgttc ctgcagtaga cgctttggct gctttgggtg cagaaccatt 5640tgattggcca gttagagagg cattagcttt tgttaatggt actggcgcct cattggcagt 5700agccgtgcta aaccatagga gtgctttaag attagtgaga gcctgtgccg tgttgtccgc 5760aaggttagcc acattgcttg gtgccaatcc tgagcattat gatgtaggtc atggcgttgc 5820aagaggccaa gttggtcaat tgactgcagc agaatggatc aggcaaggtt tacctagagg 5880tatggtcaga gacggaagta ggccattgca agaaccatac tccttaagat gtgctcctca 5940agttttaggt gccgttttgg accagttaga tggagctggt gacgtattag ctagggaagt 6000cgacggttgt caggacaatc ctataactta cgaaggagag ttgttgcatg gtggtaattt 6060ccatgcaatg ccagttggtt tcgcatctga tcaaataggt ttagcaatgc atatggccgc 6120ttacttggca gaaaggcagc ttggtttatt agttagccct gttacaaacg gtgaccttcc 6180accaatgtta acccctaggg ctggtagagg cgcaggacta gcaggtgtgc agatatccgc 6240taccagtttt gttagtagaa ttaggcagtt ggtgtttcct gcaagcttga caactttgcc 6300taccaacgga tggaatcaag atcacgtccc aatggcattg aatggcgcaa attcagtatt 6360cgaagcctta gagttgggat ggttaactgt tggtagcttg gcagtaggtg ttgcccaatt 6420agccgccatg acaggtcacg ctgctgaggg tgtttgggca gaacttgctg gtatttgccc 6480tccacttgat gctgatagac ctttgggagc agaagtgagg gctgctaggg atcttttgtc 6540tgcccacgct gatcaattgt tagtcgatga agctgatgga aaagacttcg gataatgaac 6600tagtatcgat ggattacaag gatgacgacg ataagatctg agctcttaat taacaattct 6660tcgccagagg tttggtcaag tctccaatca aggttgtcgg cttgtctacc ttgccagaaa 6720tttacgaaaa gatggaaaag ggtcaaatcg ttggtagata cgttgttgac acttctaaat 6780aagcgaattt cttatgattt atgattttta ttattaaata agttataaaa aaaataagtg 6840tatacaaatt ttaaagtgac tcttaggttt taaaacgaaa attcttattc ttgagtaact 6900ctttcctgta ggtcaggttg ctttctcagg tatagcatga ggtcgctcca attcagctgg 6960cgtaatagcg aagaggcccg caccgatcgc ccttcccaac agttgcgcag cctgaatggc 7020gaatggacgc gccctgtagc ggcgcattaa gcgcggcggg tgtggtggtt acgcgcagcg 7080tgaccgctac acttgccagc gccctagcgc ccgctccttt cgctttcttc ccttcctttc 7140tcgccacgtt cgccggcttt ccccgtcaag ctctaaatcg ggggctccct ttagggttcc 7200gatttagtgc tttacggcac ctcgacccca aaaaacttga ttagggtgat ggttcacgta 7260gtgggccatc gccctgatag acggtttttc gccctttgac gttggagtcc acgttcttta 7320atagtggact cttgttccaa actggaacaa cactcaaccc tatctcggtc tattcttttg 7380atttataagg gattttgccg atttcggcct attggttaaa aaatgagctg atttaacaaa 7440aatttaacgc gaattttaac aaaatattaa cgtttacaat ttcctgatgc ggtattttct 7500ccttacgcat ctgtgcggta tttcacaccg catagggtaa taactgatat aattaaattg 7560aagctctaat ttgtgagttt agtatacatg catttactta taatacagtt ttttagtttt 7620gctggccgca tcttctcaaa tatgcttccc agcctgcttt tctgtaacgt tcaccctcta 7680ccttagcatc ccttcccttt gcaaatagtc ctcttccaac aataataatg tcagatcctg 7740tagagaccac atcatccacg gttctatact gttgacccaa tgcgtctccc ttgtcatcta 7800aacccacacc gggtgtcata atcaaccaat cgtaaccttc atctcttcca cccatgtctc 7860tttgagcaat aaagccgata acaaaatctt tgtcgctctt cgcaatgtca acagtaccct 7920tagtatattc tccagtagat agggagccct tgcatgacaa ttctgctaac atcaaaaggc 7980ctctaggttc ctttgttact tcttctgccg cctgcttcaa accgctaaca atacctgggc 8040ccaccacacc gtgtgcattc gtaatgtctg cccattctgc tattctgtat acacccgcag 8100agtactgcaa tttgactgta ttaccaatgt cagcaaattt tctgtcttcg aagagtaaaa 8160aattgtactt ggcggataat gcctttagcg gcttaactgt gccctccatg gaaaaatcag 8220tcaagatatc cacatgtgtt tttagtaaac aaattttggg acctaatgct tcaactaact 8280ccagtaattc cttggtggta cgaacatcca atgaagcaca caagtttgtt tgcttttcgt 8340gcatgatatt aaatagcttg gcagcaacag gactaggatg agtagcagca cgttccttat 8400atgtagcttt cgacatgatt tatcttcgtt tcctgcaggt ttttgttctg tgcagttggg 8460ttaagaatac tgggcaattt catgtttctt caacactaca tatgcgtata tataccaatc 8520taagtctgtg ctccttcctt cgttcttcct tctgttcgga gattaccgaa tcaaaaaaat 8580ttcaaagaaa ccgaaatcaa aaaaaagaat aaaaaaaaaa tgatgaattg aattgaaaag 8640ctgtggtatg gtgcactctc agtacaatct gctctgatgc cgcatagtta agccagcccc 8700gacacccgcc aacacccgct gacgcgccct gacgggcttg tctgctcccg gcatccgctt 8760acagacaagc tgtgaccgtc tccgggagct gcatgtgtca gaggttttca ccgtcatcac 8820cgaaacgcgc ga 88325710157DNAArtificial SequenceVector 57tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 60cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 120ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 180accataaatt cccgttttaa gagcttggtg agcgctagga gtcactgcca ggtatcgttt 240gaacacggca ttagtcaggg aagtcataac acagtccttt cccgcaattt tctttttcta 300ttactcttgg cctcctctag tacactctat atttttttat gcctcggtaa tgattttcat 360tttttttttt cccctagcgg atgactcttt ttttttctta gcgattggca ttatcacata 420atgaattata cattatataa agtaatgtga tttcttcgaa gaatatacta aaaaatgagc 480aggcaagata aacgaaggca aagatgacag agcagaaagc cctagtaaag cgtattacaa 540atgaaaccaa gattcagatt gcgatctctt taaagggtgg tcccctagcg atagagcact 600cgatcttccc agaaaaagag gcagaagcag tagcagaaca ggccacacaa tcgcaagtga 660ttaacgtcca cacaggtata gggtttctgg accatatgat acatgctctg gccaagcatt 720ccggctggtc gctaatcgtt gagtgcattg gtgacttaca catagacgac catcacacca 780ctgaagactg cgggattgct ctcggtcaag cttttaaaga ggccctactg gcgcgtggag 840taaaaaggtt tggatcagga tttgcgcctt tggatgaggc actttccaga gcggtggtag 900atctttcgaa caggccgtac gcagttgtcg aacttggttt gcaaagggag aaagtaggag 960atctctcttg cgagatgatc ccgcattttc ttgaaagctt tgcagaggct agcagaatta 1020ccctccacgt tgattgtctg cgaggcaaga atgatcatca ccgtagtgag agtgcgttca 1080aggctcttgc ggttgccata agagaagcca cctcgcccaa tggtaccaac gatgttccct 1140ccaccaaagg tgttcttatg tagtgacacc gattatttaa agctgcagca tacgatatat 1200atacatgtgt atatatgtat acctatgaat gtcagtaagt atgtatacga acagtatgat 1260actgaagatg acaaggtaat gcatcattct atacgtgtca ttctgaacga ggcgcgcttt 1320ccttttttct ttttgctttt tctttttttt tctcttgaac tcgacggatc tatgcggtgt 1380gaaataccgc acagatgcgt aaggagaaaa taccgcatca ggaaattgta aacgttaata 1440ttttgttaaa attcgcgtta aatttttgtt aaatcagctc attttttaac caataggccg 1500aaatcggcaa aatcccttat aaatcaaaag aatagaccga gatagggttg agtgttgttc 1560cagtttggaa caagagtcca ctattaaaga acgtggactc caacgtcaaa gggcgaaaaa 1620ccgtctatca gggcgatggc ccactacgtg aaccatcacc ctaatcaagt tttttggggt 1680cgaggtgccg taaagcacta aatcggaacc ctaaagggag cccccgattt agagcttgac 1740ggggaaagcc ggcgaacgtg gcgagaaagg aagggaagaa agcgaaagga gcgggcgcta 1800gggcgctggc aagtgtagcg gtcacgctgc gcgtaaccac cacacccgcc gcgcttaatg 1860cgccgctaca gggcgcgtcg cgccattcgc cattcaggct gcgcaactgt tgggaagggc 1920gatcggtgcg ggcctcttcg ctattacgcc agctgaattg gagcgacctc atgctatacc 1980tgagaaagca acctgaccta caggaaagag ttactcaaga ataagaattt tcgttttaaa 2040acctaagagt cactttaaaa tttgtataca cttatttttt ttataactta tttaataata 2100aaaatcataa atcataagaa attcgcttat ttagaagtgt caacaacgta tctaccaacg 2160atttgaccct tttccatctt ttcgtaaatt tctggcaagg tagacaagcc gacaaccttg 2220attggagact tgaccaaacc tctggcgaag aattgttaat taagagctca gatcttatcg 2280tcgtcatcct tgtaatccat cgatactagt ctagttcatt aatccatttg ctagtcttgc 2340tcttagatcc ttcctcaata tcttccctga tggagcttta ggaatagagt cagtgaagaa 2400cactttgttg attctcttat aaaacacaac ctgttttgac acgaattgct tgatttcatc 2460ttcggatata tttgaatctt tcgatctcac cacaaacgca acaggaacct caccagcatc 2520ttcttccttc atggcgacga cagcaacatc attgatttct ggatgaccta tgaggagaga 2580ctctagctca gctggagcca cttgaaatcc tttgtacttg atgagttctt tcaatctatc 2640cacaatgaaa agctcgtcgt catcatcgat aaatccgacg tctccagtgt gaagccaacc 2700atctttatcg atcgtcgatg ccgtggccaa ggggtcattg agatagcctt tcatgatttg 2760gttgccacgg atgcatattt cgccgggttt gttcctaggc aaagaatctc ctgtgtctgg 2820atcaagtatc ttcatctcgg cgttcctcac caccgtacca catgctcctg acttcactgg 2880aaacggctct ttagcaaacc ctaacgacat tgctagcacc ggacctgctt ctgtcatccc 2940atagccctga ccaagcttgg cgttaggaaa cttagcacta atagcatctt caagctcctt 3000accaagagga gctgctccag acttaaccat cctaaccgag ctcagatcat acttctccgt 3060ctccggcgac ttcgcgatag ctaaaacgat cggtggcacg accatagcca ccgtgacttt 3120acacctttgt atctgctcta acaagagagt gatttcgaac ttaggcatta tcaagatcgt 3180ggcaccaact ctgagactac agagcatgat ggagttgaga gcgtatatat ggaacatagg 3240caagacacag aggatcacgt cgtctctgtt gaagtaaaga ttcggattct cgccgtcgac 3300ttgctgcgcc acgctcgtga ctagaccttt gtgtgttagc atcactcctt tggggagacc 3360cgtcgtgccg gatgagaaag gaagcgccac gacgtcttct ggcgaaatct tctccggtat 3420tgagtccact cgtggttctt cggactgagt taactcggag aaacggaggc agttttcggg 3480gatggcgtcg gagtcggtgg tgacgatcaa aacgccgtcg ttttggaggt tcttgatttt 3540atcgacgtaa cgggattgag tgacgatgag tttcgccgcg gaggctttgg cttgtttaga 3600aatctccgcc ggagtgaaga acgggttcgc ggaggtggtg attgcgccga tgaaggaggc 3660ggcaaggaaa gtgaggacta cttcaggaga gttcgggagg aggatcatta caacgtcgtg 3720ttgcttcacg ccgaggttat gaagaccggc ggcgagtttc cgagatgtta cgtggacatc 3780ggcgtaggtg tatacttcgc cggtgggacc gttgatcaag catggcttag cggcgaactc 3840tgagatattt tcgaagatgt agtcgtggag tgggaggtgg ttagggatgt atatatcagg 3900caatctcgat cggaaaatga cgtcattact acactgtttc tgatcattct gatcattgac 3960tatcacatct tgtgtcgtca tgaattctct agaaaactta gattagattg ctatgctttc 4020tttctaatga gcaagaagta aaaaaagttg taatagaaca agaaaaatga aactgaaact 4080tgagaaattg aagaccgttt attaacttaa atatcaatgg gaggtcatcg aaagagaaaa 4140aaatcaaaaa aaaaattttc aagaaaaaga aacgtgataa aaatttttat tgcctttttc 4200gacgaagaaa aagaaacgag gcggtctctt ttttcttttc caaaccttta gtacgggtaa 4260ttaacgacac cctagaggaa gaaagagggg aaatttagta tgctgtgctt gggtgttttg 4320aagtggtacg gcgatgcgcg gagtccgaga aaatctggaa gagtaaaaaa ggagtagaaa 4380cattttgaag ctatgagctc cagcttttgt tccctttagt gagggttaat tgcgcgcttg 4440gcgtaatcat ggtcatagct gtttcctgtg tgaaattgtt atccgctcac aattccacac 4500aacataggag ccggaagcat aaagtgtaaa gcctggggtg cctaatgagt gaggtaactc 4560acattaattg cgttgcgctc actgcccgct ttccagtcgg gaaacctgtc gtgccagctg 4620cattaatgaa tcggccaacg cgcggggaga ggcggtttgc gtattgggcg ctcttccgag 4680ctcagtttat cattatcaat actcgccatt tcaaagaata cgtaaataat taatagtagt 4740gattttccta actttattta gtcaaaaaat tagcctttta attctgctgt aacccgtaca 4800tgcccaaaat agggggcggg ttacacagaa tatataacat cgtaggtgtc tgggtgaaca 4860gtttattcct ggcatccact aaatataatg gagcccgctt tttaagctgg catccagaaa 4920aaaaaagaat cccagcacca aaatattgtt ttcttcacca accatcagtt cataggtcca 4980ttctcttagc gcaactacag agaacagggg cacaaacagg caaaaaacgg gcacaacctc 5040aatggagtga tgcaacctgc ctggagtaaa tgatgacaca aggcaattga cccacgcatg 5100tatctatctc attttcttac accttctatt accttctgct ctctctgatt tggaaaaagc 5160tgaaaaaaaa ggttgaaacc agttccctga aattattccc ctacttgact aataagtata 5220taaagacggt aggtattgat tgtaattctg taaatctatt tcttaaactt cttaaattct 5280acttttatag ttagtctttt ttttagtttt aaaacaccag aacttagttt cgacggattc 5340tagaggatcc atggcatccg tagaggagtt cagaaatgca cagagggcaa aaggtccagc 5400aaccatattg gctattggaa cagccacccc tgatcactgt gtttatcaat ctgattacgc 5460tgattactat ttcagagtaa ctaaaagtga acatatgaca gaacttaaga aaaagtttaa 5520tagaatttgt gataaatcta tgataaagaa aagatacata catctaactg aagaaatgtt 5580agaggaacat ccaaatatag gtgcatatat ggcaccatct ttgaatatta gacaagaaat 5640cataacagcc gaggtaccta gactaggtag agacgcagcc ttgaaagctt taaaggaatg 5700gggacaacca aaatctaaga ttacacattt ggttttctgt acaacttccg gtgtcgaaat 5760gccaggtgct gattataaac tagcaaacct attgggatta gagacctctg ttagaagagt 5820tatgttgtat catcaaggtt gttacgccgg aggtacagtg cttagaactg ctaaggattt 5880ggcagaaaat aacgccggtg ctagggtttt agtcgtctgc agtgaaatca ctgtcgtaac 5940tttcagaggt ccatcagaag atgctctaga cagtttggtc ggacaagcat tgtttggcga 6000tggatcttcc gccgtaattg taggcagcga tcctgatgtg tccattgaaa gaccactatt 6060tcaattagtt tctgctgctc aaacttttat tccaaattcc gccggtgcca tagcaggaaa 6120cttgagagaa gttggtttga cttttcattt gtggcctaat gtcccaacct taatttcaga 6180aaacatcgaa aaatgcttaa ctcaagcctt tgacccattg ggcataagcg actggaactc 6240attgttttgg attgctcatc caggtggtcc agcaatttta gacgcagtgg aggcaaaact 6300aaacttagag aagaaaaagt tggaagctac aagacacgtt ctatcagagt atggcaacat 6360gagctctgcc tgcgttttat tcattctaga tgagatgagg aagaagtctt taaagggtga 6420aaaagccaca accggagaag gtttagattg gggtgttcta tttggtttcg gtcctggctt 6480aacaattgag acagtggtgt tacactctgt tccaactgtc actaactaat gactcgagta

6540agcttggtac cgcggctagc taagatccgc tctaaccgaa aaggaaggag ttagacaacc 6600tgaagtctag gtccctattt atttttttat agttatgtta gtattaagaa cgttatttat 6660atttcaaatt tttctttttt ttctgtacag acgcgtgtac gcatgtaaca ttatactgaa 6720aaccttgctt gagaaggttt tgggacgctc gaagatccag ctgcattaat gaatcggcca 6780acgcgcgggg agaggcggtt tgcgtattgg gcgctcttcc gcttcctcgc tcactgactc 6840gctgcgctcg gtcgttcggc tgcggcgagc ggtatcagct cactcaaagg cggtaatacg 6900gttatccaca gaatcagggg ataacgcagg aaagaacatg tgagcaaaag gccagcaaaa 6960ggccaggaac cgtaaaaagg ccgcgttgct ggcgtttttc cataggctcc gcccccctga 7020cgagcatcac aaaaatcgac gctcaagtca gaggtggcga aacccgacag gactataaag 7080ataccaggcg tttccccctg gaagctccct cgtgcgctct cctgttccga ccctgccgct 7140taccggatac ctgtccgcct ttctcccttc gggaagcgtg gcgctttctc atagctcacg 7200ctgtaggtat ctcagttcgg tgtaggtcgt tcgctccaag ctgggctgtg tgcacgaacc 7260ccccgttcag cccgaccgct gcgccttatc cggtaactat cgtcttgagt ccaacccggt 7320aagacacgac ttatcgccac tggcagcagc cactggtaac aggattagca gagcgaggta 7380tgtaggcggt gctacagagt tcttgaagtg gtggcctaac tacggctaca ctagaaggac 7440agtatttggt atctgcgctc tgctgaagcc agttaccttc ggaaaaagag ttggtagctc 7500ttgatccggc aaacaaacca ccgctggtag cggtggtttt tttgtttgca agcagcagat 7560tacgcgcaga aaaaaaggat ctcaagaaga tcctttgatc ttttctacgg ggtctgacgc 7620tcagtggaac gaaaactcac gttaagggat tttggtcatg agattatcaa aaaggatctt 7680cacctagatc cttttaaatt aaaaatgaag ttttaaatca atctaaagta tatatgagta 7740aacttggtct gacagttacc aatgcttaat cagtgaggca cctatctcag cgatctgtct 7800atttcgttca tccatagttg cctgactccc cgtcgtgtag ataactacga tacgggaggg 7860cttaccatct ggccccagtg ctgcaatgat accgcgagac ccacgctcac cggctccaga 7920tttatcagca ataaaccagc cagccggaag ggccgagcgc agaagtggtc ctgcaacttt 7980atccgcctcc atccagtcta ttaattgttg ccgggaagct agagtaagta gttcgccagt 8040taatagtttg cgcaacgttg ttgccattgc tacaggcatc gtggtgtcac gctcgtcgtt 8100tggtatggct tcattcagct ccggttccca acgatcaagg cgagttacat gatcccccat 8160gttgtgcaaa aaagcggtta gctccttcgg tcctccgatc gttgtcagaa gtaagttggc 8220cgcagtgtta tcactcatgg ttatggcagc actgcataat tctcttactg tcatgccatc 8280cgtaagatgc ttttctgtga ctggtgagta ctcaaccaag tcattctgag aatagtgtat 8340gcggcgaccg agttgctctt gcccggcgtc aatacgggat aataccgcgc cacatagcag 8400aactttaaaa gtgctcatca ttggaaaacg ttcttcgggg cgaaaactct caaggatctt 8460accgctgttg agatccagtt cgatgtaacc cactcgtgca cccaactgat cttcagcatc 8520ttttactttc accagcgttt ctgggtgagc aaaaacagga aggcaaaatg ccgcaaaaaa 8580gggaataagg gcgacacgga aatgttgaat actcatactc ttcctttttc aatattattg 8640aagcatttat cagggttatt gtctcatgag cggatacata tttgaatgta tttagaaaaa 8700taaacaaata ggggttccgc gcacatttcc ccgaaaagtg ccacctgaac gaagcatctg 8760tgcttcattt tgtagaacaa aaatgcaacg cgagagcgct aatttttcaa acaaagaatc 8820tgagctgcat ttttacagaa cagaaatgca acgcgaaagc gctattttac caacgaagaa 8880tctgtgcttc atttttgtaa aacaaaaatg caacgcgaga gcgctaattt ttcaaacaaa 8940gaatctgagc tgcattttta cagaacagaa atgcaacgcg agagcgctat tttaccaaca 9000aagaatctat acttcttttt tgttctacaa aaatgcatcc cgagagcgct atttttctaa 9060caaagcatct tagattactt tttttctcct ttgtgcgctc tataatgcag tctcttgata 9120actttttgca ctgtaggtcc gttaaggtta gaagaaggct actttggtgt ctattttctc 9180ttccataaaa aaagcctgac tccacttccc gcgtttactg attactagcg aagctgcggg 9240tgcatttttt caagataaag gcatccccga ttatattcta taccgatgtg gattgcgcat 9300actttgtgaa cagaaagtga tagcgttgat gattcttcat tggtcagaaa attatgaacg 9360gtttcttcta ttttgtctct atatactacg tataggaaat gtttacattt tcgtattgtt 9420ttcgattcac tctatgaata gttcttacta caattttttt gtctaaagag taatactaga 9480gataaacata aaaaatgtag aggtcgagtt tagatgcaag ttcaaggagc gaaaggtgga 9540tgggtaggtt atatagggat atagcacaga gatatatagc aaagagatac ttttgagcaa 9600tgtttgtgga agcggtattc gcaatatttt agtagctcgt tacagtccgg tgcgtttttg 9660gttttttgaa agtgcgtctt cagagcgctt ttggttttca aaagcgctct gaagttccta 9720tactttctag agaataggaa cttcggaata ggaacttcaa agcgtttccg aaaacgagcg 9780cttccgaaaa tgcaacgcga gctgcgcaca tacagctcac tgttcacgtc gcacctatat 9840ctgcgtgttg cctgtatata tatatacatg agaagaacgg catagtgcgt gtttatgctt 9900aaatgcgtac ttatatgcgt ctatttatgt aggatgaaag gtagtctagt acctcctgtg 9960atattatccc attccatgcg gggtatcgta tgcttccttc agcactaccc tttagctgtt 10020ctatatgctg ccactcctca attggattag tctcatcctt caatgctatc atttcctttg 10080atattggatc atctaagaaa ccattattat catgacatta acctataaaa ataggcgtat 10140cacgaggccc tttcgtc 10157

Claims

1. A method for the production of a mixture comprising stilbenoids, comprising extracting resveratrol or pinosylvin from a solids waste material separated from a fermentation of plant material conducted using a genetically modified yeast strain having a metabolic pathway producing the mixture comprising stilbenoids.

2. The method of claim 1, further comprising the preliminary steps of conducting said fermentation of plant material using the genetically modified yeast strain having a metabolic pathway producing the mixture comprising stilbenoids and separating a solids waste material from said fermentation.

3. The method of claim 1, wherein the fermentation is a fermentation of fruit must together with or separated from pommace.

4. The method of claim 1, wherein the fermentation is a fermentation of pommace separated from fruit must.

5. The method of claim 2, wherein the fruit is grape, apple or pear.

6. The method of claim 1, wherein the fermentation is a beer making fermentation.

7. The method of claim 1, wherein the genetically modified yeast strain is genetically modified Saccharomyces yeast.

8. The method of claim 1, further comprising the step of recovering resveratrol or pinosylvin.

Images