Patent application title: OVER EXPRESSION OF FOLDASES AND CHAPERONES IMPROVES PROTEIN PRODUCTION
Inventors:
Frits Goedegebuur (Vlaardingen, NL)
Paulien Neef-Kruithof (Zoetermeer, NL)
Jeffrey P. Pucci (Pacifica, CA, US)
Michael Ward (San Francisco, CA, US)
Assignees:
DANISCO US INC.
IPC8 Class: AC12N964FI
USPC Class:
435226
Class name: Acting on peptide bond (e.g., thromboplastin, leucine amino-peptidase, etc., (3.4)) proteinase derived from animal tissue (e.g., rennin, etc.)
Publication date: 2014-03-27
Patent application number: 20140087443
Abstract:
The present teachings provide methods for increasing protein secretion,
e.g., chymosin in filamentous fungi by co-expressing certain chaperone(s)
and/or foldase(s). The present teachings also provide filamentous fungi
containing certain chaperone(s) and/or foldase(s) and a protein of
interest for increased secretion.Claims:
1. A method for production of a secretable polypeptide in a filamentous
fungal host comprising: expressing a secretion enhancing protein in a
filamentous fungal host containing a secretable polypeptide, wherein the
secretion enhancing protein is bip1 and the secretable polypeptide is a
chymosin.
2. The method of claim 1, comprising expressing at least two secretion enhancing proteins.
3. The method of claim 1, further comprising expressing a second chaperone protein and/or a foldase.
4. The method of claim 1, wherein the filamentous fungal host is T. reesei.
5. The method of claim 1, wherein the filamentous fungal host is selected from: Aspergillus, Acremonium, Aureobasidium, Beauveria, Cephalosporium, Ceriporiopsis, Chaetomium paecilomyces, Chrysosporium, Claviceps, Cochiobolus, Cryptococcus, Cyathus, Endothia, Endothia mucor, Fusarium, Gilocladium, Humicola, Magnaporthe, Myceliophthora, Myrothecium, Mucor, Neurospora, Phanerochaete, Podospora, Paecilomyces, Penicillium, Pyricularia, Rhizomucor, Rhizopus, Schizophylum, Stagonospora, Talaromyces, Trichoderma, Thermomyces, Thermoascus, Thielavia, Tolypocladium, Trichophyton, Trametes, and Pleurotus.
6. The method of claim 1, wherein the chymosin is a bovine chymosin.
7. The method of claim 1, wherein the chymosin is expressed through a promoter of the filamentous fungal host.
8. The method of claim 1, wherein the chymosin is expressed under a cbh1 promoter in T. reesei.
9. The method of claim 1, wherein the chymosin is produced as a fusion protein.
10. The method of claim 1, wherein the chymosin is produced as a fusion protein with a CBHI, or a portion thereof.
11. The method of claim 1, wherein the chymosin is produced as a fusion protein with a CBHI, or a portion thereof, and the CBHI amino acid sequence is altered to reduce or eliminate catalytic activity.
12. The method of claim 1 further comprising inoculating a suitable growth medium with the host and incubating under conditions permitting growth of the host.
13-25. (canceled)
26. A supernatant obtained using the method of claim 1, wherein the supernatant contains substantial amount of chymosin, but not substantial amount of the filamentous fungus.
Description:
[0001] This application claims priority of U.S. Provisional applications
60/919,332, filed Mar. 21, 2007, the contents of which is herein
incorporated by reference in their entirety.
INTRODUCTION
[0002] Protein secretion is an important aspect of protein production in various cell expression systems. One of the factors associated with protein secretion is protein folding. Many proteins can be reversibly unfolded and refolded in vitro at dilute concentrations since all of the information required to specify a compact folded protein structure is present in the amino acid sequence of a protein. However, protein folding in vivo occurs in a concentrated milieu of numerous proteins in which intermolecular aggregation reactions compete with the intramolecular folding process. The first step in the eukaryotic secretory pathway is translocation of the nascent polypeptide across the ER membrane in extended form. Correct folding and assembly of a polypeptide occurs in the ER through the secretory pathway. Many proteins are often highly overexpressed, but poorly secreted even though secretion signals are present on these proteins. There is a need in the art to produce proteins efficiently in cellular production systems.
SUMMARY
[0003] The present teachings are based, at least in part, on the discovery that protein secretion in filamentous fungi can be modulated by a group of chaperones and/or foldases. Accordingly the present teachings provide methods for increasing protein secretion in filamentous fungi by co-expressing certain chaperone(s) and/or foldase(s). The present teachings also provide filamentous fungi containing certain chaperone(s) and/or foldase(s) and a protein of interest for increased secretion.
[0004] In some embodiments, the present teachings provide a method for increasing the secretion of a secretable polypeptide in a filamentous fungus host. The method comprises expressing a secretion enhancing protein in a filamentous fungus host containing a secretable polypeptide, wherein the secretion enhancing protein comprises bip1, clx1, ero1, lhs1, prp3, prp4, prp1, tig1, pdi1, ppi1, ppi2, Scj1, erv2, EDEM, and/or sil1, and wherein the secretable polypeptide can be a chymosin.
[0005] In some embodiments, the present teachings provide a filamentous fungus host containing a first polynucleotide encoding a secretion enhancing protein and a second polynucleotide encoding a chymosin, wherein the secretion enhancing protein comprises bip1, clx1, ero1, lhs1, prp3, prp4, prp1, tig1, pdi1, ppi1, ppi2, Scj1, erv2, EDEM, and/or sil1, and wherein the first polynucleotide can be operably linked to a first promoter and the second polynucleotide can be operably linked to a second promoter.
[0006] One aspect of the invention is a method for production of a secretable polypeptide in a filamentous fungal host by expressing a secretion enhancing protein in a filamentous fungal host containing a secretable polypeptide, wherein the secretion enhancing protein is bip1 and the secretable polypeptide is a chymosin. In some embodiments, at least two secretion enhancing proteins are expressed. In some embodiments, the method includes expression of at least a second chaperone protein and/or a foldase. In some embodiments, the filamentous fungal host is T. reesei. In some embodiments, the host is selected from the following hosts: Aspergillus, Acremonium, Aureobasidium, Beauveria, Cephalosporium, Ceriporiopsis, Chaetomium paecilomyces, Chrysosporium, Claviceps, Cochiobolus, Cryptococcus, Cyathus, Endothia, Endothia mucor, Fusarium, Gilocladium, Humicola, Magnaporthe, Myceliophthora, Myrothecium, Mucor, Neurospora, Phanerochaete, Podospora, Paecilomyces, Penicillium, Pyricularia, Rhizomucor, Rhizopus, Schizophylum, Stagonospora, Talaromyces, Trichoderma, Thermomyces, Thermoascus, Thielavia, Tolypocladium, Trichophyton, Trametes, and Pleurotus. In some embodiments, the chymosin is a bovine chymosin. In some embodiments, the chymosin is expressed through a promoter of the filamentous fungal host. In further embodiments, the chymo sin is expressed under a cbh1 promoter in T. reesei. In some embodiments, the chymosin is produced as a fusion protein. In some embodiments, the chymosin is produced as a fusion protein with a CBHI, or a portion thereof. In some embodiments, the chymosin is produced as a fusion protein with a CBHI, or a portion thereof, and the CBHI amino acid sequence is altered to reduce or eliminate catalytic activity. In other embodiments, the method includes inoculating a suitable growth medium with the host and incubating under conditions permitting growth of the host.
[0007] Other aspects of the invention include a filamentous fungal host having a first polynucleotide encoding a secretion enhancing protein and a second polynucleotide encoding a chymosin, wherein the secretion enhancing protein is bip1, and wherein the first polynucleotide is operably linked to a first promoter and the second polynucleotide is operably linked to a second promoter. In some embodiments, the host also contains a third polynucleotide operably linked to a third promoter, wherein the third polynucleotide encodes a secretion enhancing protein selected from: bip1, clx1, ero1, lhs1, prp3, prp4, prp1, tig1, pdi1, ppi1, ppi2, Scj1, erv2, EDEM, and sil1. In some embodiments, the first polynucleotide encodes a chaperone protein and the third polynucleotide encodes a foldase. In some embodiments, the first promoter and the third promoter is a constitutive promoter. In some embodiments, the first promoter is a constitutive promoter. In some embodiments, the filamentous fungus is T. reesei. In some embodiments, the second promoter is a promoter obtained from the filamentous fungal host. In some embodiments, the filamentous fungus is T. reesei and the second promoter is a CBH1 promoter of T. reesei. In some embodiments, the second polynucleotide encodes a bovine chymosin. In some embodiments, the secretion level of the chymosin in the filamentous fungus is at least 50 mg/liter when the filamentous fungus grows in a fermentation condition.
[0008] Further aspects of the invention include a biologically pure culture comprising a population of filamentous fungi disclosed above. In some embodiments, the culture also contains the chymosin secreted by the filamentous fungi.
[0009] Further aspects of the invention include a supernatant obtained from a culture of the filamentous fungus host, wherein the supernatant contains substantial amount of chymosin, but not substantial amount of the filamentous fungus.
[0010] Further aspects of the invention include a supernatant obtained using the method disclosed above, wherein the supernatant contains substantial amount of chymosin, but not substantial amount of the filamentous fungus.
BRIEF DESCRIPTION OF THE DRAWINGS
[0011] The skilled artisan will understand that the drawings are for illustration purposes only. The drawings are not intended to limit the scope of the present teaching in any way.
[0012] FIG. 1 depicts a Gateway compatible vector for expression cloning in Trichoderma reesei (pTrex2g/HygB).
[0013] FIG. 2 is the DNA sequence of a synthetic prochymosin gene (SEQ ID NO: 42).
[0014] FIG. 3 depicts a CBH1-prochymosin B expression vector, pTrex4-CHYGA.
[0015] FIG. 4 depicts chymosin band density analysis of Western blots of three day shake flask culture samples.
[0016] FIG. 5 depicts the levels of bip1, chymosin and cbh1 mRNA in Trichoderma reesei strains.
DESCRIPTION OF VARIOUS EMBODIMENTS
Definition Section
[0017] The term "promoter" is defined herein as a nucleic acid that directs transcription of a downstream polynucleotide in a cell. In certain cases, the polynucleotide may contain a coding sequence and the promoter may direct the transcription of the coding sequence into translatable RNA.
[0018] The term "isolated" as defined herein means a compound, a protein, cell, nucleic acid sequence or amino acid that is removed from at least one component with which it is naturally associated.
[0019] The term "% homology" is used interchangeably herein with the term "% identity" herein and refers to the level of nucleic acid or amino acid sequence identity between the nucleic acid sequences, when aligned using a sequence alignment program. For example, as used herein, 80% homology means the same thing as 80% sequence identity determined by a defined algorithm, and accordingly a homologue of a given sequence has greater than 80% sequence identity over a length of the given sequence. Exemplary levels of sequence identity include, but are not limited to, 80, 85, 90, 95, 98% or more sequence identity to a given sequence. The term "coding sequence" is defined herein as a nucleic acid that, when placed under the control of appropriate control sequences including a promoter, is transcribed into mRNA which can be translated into a polypeptide. A coding sequence may contain a single open reading frame, or several open reading frames separated by introns, for example. A coding sequence may be cDNA, genomic DNA, synthetic DNA or recombinant DNA, for example. A coding sequence generally starts at a start codon (e.g., ATG) and ends at a stop codon (e.g., UAA, UAG and UGA).
[0020] The term "recombinant" refers to a polynucleotide or polypeptide that does not naturally occur in a host cell. A recombinant molecule may contain two or more naturally occurring sequences that are linked together in a way that does not occur naturally.
[0021] The term "heterologous" refers to elements that are not normally associated with each other. For example, if a recombinant host cell produces a heterologous protein, that protein is not produced in a wild-type host cell of the same type, a heterologous promoter is a promoter that is not present in nucleic acid that is endogenous to a wild type host cell, and a promoter operably linked to a heterologous coding sequence is a promoter that is operably linked to a coding sequence that it is not usually operably linked to in a wild-type host cell.
[0022] The term "operably linked" refers to an arrangement of elements that allows them to be functionally related. For example, a promoter is operably linked to a coding sequence if it controls the transcription of the sequence, and a signal sequence is operably linked to a protein if the signal sequence directs the protein through the secretion system of a host cell.
[0023] The term "nucleic acid" and "polynucleotide" are used interchangeably and encompass DNA, RNA, cDNA, single stranded or double stranded and chemical modifications thereof. Because the genetic code is degenerate, more than one codon may be used to encode a particular amino acid, and the present invention encompasses all polynucleotides, which encode a particular amino acid sequence.
[0024] The term "DNA construct" as used herein means a nucleic acid sequence that comprises at least two DNA polynucleotide fragments.
[0025] The term "signal sequence" refers to a sequence of amino acids at the N-terminal portion of a protein, which facilitates the secretion of the mature form of the protein outside the cell. The mature form of the extracellular protein lacks the signal sequence which is cleaved off during the secretion process.
[0026] The term "vector" is defined herein as a polynucleotide designed to carry nucleic acid sequences to be introduced into one or more cell types. Vectors include cloning vectors, expression vectors, shuttle vectors, plasmids, phage or virus particles, DNA constructs, cassettes and the like. Expression vectors may include regulatory sequences such as promoters, signal sequences, coding sequences and transcription terminators.
[0027] An "expression vector" as used herein means a DNA construct comprising a coding sequence that is operably linked to suitable control sequences capable of effecting expression of a protein in a suitable host. Such control sequences may include a promoter to effect transcription, an optional operator sequence to control transcription, a sequence encoding suitable ribosome binding sites, enhancers and sequences which control termination of transcription and translation.
[0028] As used herein, the terms "polypeptide" and "protein" are used interchangeably and include reference to a polymer of any number of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical analog of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers. The terms also apply to polymers containing conservative amino acid substitutions such that the polypeptide remains functional.
A "host" refers to a suitable host for an expression vector comprising a DNA construct encoding a desired protein. A host may be any cell type.
[0029] The term "filamentous fungi" refers to all filamentous forms of the subdivision Eumycotina (See, Alexopoulos, C. J. (1962), INTRODUCTORY MYCOLOGY, Wiley, New York). These fungi are characterized by a vegetative mycelium with a cell wall composed of chitin, glucans, and other complex polysaccharides. The filamentous fungi of the present teachings are morphologically, physiologically, and genetically distinct from yeasts. Vegetative growth by filamentous fungi is by hyphal elongation and carbon catabolism is obligatory aerobic.
[0030] A "heterologous" nucleic acid construct or sequence has a portion of the sequence which is not native to the cell in which it is expressed. Heterologous, with respect to a control sequence refers to a control sequence (i.e. promoter or enhancer) that does not function in nature to regulate the same gene the expression of which it is currently regulating. Generally, heterologous nucleic acid sequences are not endogenous to the cell or part of the genome in which they are present, and have been added to the cell, by infection, transfection, transformation, microinjection, electroporation, or the like. A "heterologous" nucleic acid construct may contain a control sequence/DNA coding sequence combination that is the same as, or different from a control sequence/DNA coding sequence combination found in the native cell.
[0031] The present teachings are based on the discovery that protein secretion in a host can be modulated by a group of chaperones and/or foldases. Accordingly the present teachings provide methods for increasing protein secretion in a host, e.g., filamentous fungi by co-expressing certain chaperone(s) and/or foldase(s). The present teachings also provide expression hosts, e.g., filamentous fungi containing certain chaperone(s) and/or foldase(s) and a polypeptide of interest for increased secretion.
[0032] According to one aspect of the present teachings, it provides methods for increasing the secretion of a polypeptide of interest in a host by expressing a secretion enhancing protein along with the desired polypeptide in the host. The secretion enhancing protein of the present teachings can be any suitable protein associated with protein folding and/or secretion. In some embodiments, the secretion enhancing protein of the present teachings can be a member of chaperone or foldase protein family. In some embodiments, the secretion enhancing protein can be a member of chaperone or foldase protein family of the host origin. In some embodiments, the secretion enhancing protein includes a combination of a chaperone protein and a foldase protein. In some embodiments, the secretion enhancing protein can be a fragment of a chaperone or foldase protein with substantially the same protein secretion enhancing function as the full-length chaperone or foldase.
[0033] In various embodiments, the secretion enhancing protein of the present teachings can be bip1, clx1, ero1, lhs1, prp3, prp4, prp1, tig1, pdi1, ppi1, ppi2, Scj1, erv2, EDEM, and/or sil1 or combinations thereof. In the context of the present teachings, the name of any particular chaperone or foldase means that particular chaperone or foldase from any species, native or recombinant, or any particular chaperone or foldase with an amino acid sequence identical or substantially identical, e.g., at least 50%, 60%, 70%, 80%, 90%, or 95% identical to the corresponding chaperone or foldase sequence illustrated in the present application, or any polypeptide that can be a homolog of that particular chaperone or foldase, e.g., based on function or structure similarities commonly accepted by one skilled in the art. Examples of nucleic acid and polypeptide sequences of bip1, clx1, ero1, lhs1, prp3, prp4, prp1, tig1, pdi1, ppi1, ppi2, Scj1, erv2, EDEM, and sil1 are illustrated in the present application as SEQ ID NOs. 1-30 (see Table 1).
TABLE-US-00001 TABLE 1 Exemplary nucleic acid and polypeptide sequences of secretion enhancing proteins. Exemplary Nucleotide Exemplary Polypeptide Protein Acid Sequence Sequence bip1 SEQ ID NO: 1 SEQ ID NO: 16 clx1 SEQ ID NO: 2 SEQ ID NO: 17 ero1 SEQ ID NO: 3 SEQ ID NO: 18 lhs1 SEQ ID NO: 4 SEQ ID NO: 19 prp3 SEQ ID NO: 5 SEQ ID NO: 20 prp4 SEQ ID NO: 6 SEQ ID NO: 21 prp1 SEQ ID NO: 7 SEQ ID NO: 22 tig1 SEQ ID NO: 8 SEQ ID NO: 23 pdi1 SEQ ID NO: 9 SEQ ID NO: 24 ppi1 SEQ ID NO: 10 SEQ ID NO: 25 ppi2 SEQ ID NO: 11 SEQ ID NO: 26 Scj1 SEQ ID NO: 12 SEQ ID NO: 27 erv2 SEQ ID NO: 13 SEQ ID NO: 28 EDEM SEQ ID NO: 14 SEQ ID NO: 29 sil1 SEQ ID NO: 15 SEQ ID NO: 30
[0034] In general, the secretion enhancing protein of the present teachings can be co-expressed along with one or more desired polypeptides, e.g., polypeptides of interest in a host. The expression of the secretion enhancing protein can be under any suitable promoter known or later discovered in the art. In some embodiments, the secretion enhancing protein can be expressed under a promoter native to the host. In some embodiments, the secretion enhancing protein can be expressed under a heterologous promoter. In some embodiments, the secretion enhancing protein can be expressed under a constitutive or inducible promoter.
[0035] As used herein, the term "promoter" refers to a nucleic acid sequence that functions to direct transcription of a downstream gene. A promoter can include necessary nucleic acid sequences near the start site of transcription, such as, in the case of a polymerase II type promoter, a TATA element. The promoter together with other transcriptional and translational regulatory nucleic acid sequences, collectively referred to as regulatory sequences controls the expression of a gene. In general, the regulatory sequences include, but are not limited to, promoter sequences, ribosomal binding sites, transcriptional start and stop sequences, translational start and stop sequences, and enhancer or activator sequences. The regulatory sequences will generally be appropriate to and recognized by the host in which the downstream gene is being expressed.
[0036] A constitutive promoter is a promoter that is active under most environmental and developmental conditions. An inducible or repressible promoter is a promoter that is active under environmental or developmental regulation. Promoters can be inducible or repressible by changes in environment factors such as, but not limited to, carbon, nitrogen or other nutrient availability, temperature, pH, osmolarity, the presence of heavy metal, the concentration of an inhibitor, stress, or a combination of the foregoing, as is known in the art. Promoters can be inducible or repressible by metabolic factors, such as the level of certain carbon sources, the level of certain energy sources, the level of certain catabolites, or a combination of the foregoing, as is known in the art.
[0037] Suitable non-limiting examples of promoters include cbh1, cbh2, egl1, egl2, egl3, eg14, egl5, xyn1, and xyn2, repressible acid phosphatase gene (phoA) promoter of P. chrysogenum (see Graessle et al., Applied and Environmental Microbiology (1997), 63(2), 753-756), glucose-repressible PCK1 promoter (see Leuker et al. Gene (1997), 192(2), 235-240), maltose-inducible, glucose-repressible MRP1 promoter (see Munro et al. Molecular Microbiology (2001), 39(5), 1414-1426), methionine-repressible MET3 promoter (see Liu et al. Eukaryotic Cell (2006), 5(4), 638-649).
[0038] In some embodiments of the present teachings, the promoter in the reporter gene construct is a temperature-sensitive promoter. Preferably, the activity of the temperature-sensitive promoter is repressed by elevated temperature. In some embodiments, the promoter is a catabolite-repressed promoter. In some embodiments, the promoter is repressed by changes in osmolarity. In some embodiments, the promoter is inducible or repressible by the levels of polysaccharides, disaccharides, or monosaccharides.
[0039] An example of an inducible promoter useful in the present teachings is the cbh1 promoter of Trichoderma reesei, the nucleotide sequence of which is deposited in GenBank under Accession Number D86235. Other exemplary promoters are promoters involved in the regulation of genes encoding cellulase enzymes, such as, but not limited to, cbh2, egl1, egl2, egl3, egl5, xyn1 and xyn2.
[0040] According to the present teachings, the secretion enhancing protein can be used to increase the secretion of any suitable polypeptide in a host. In some embodiments, the polypeptide can be a heterologous polypeptide. In some embodiments, the polypeptide can be a secretable polypeptide. For example, a secretable polypeptide can be a protein or polypeptide usually secreted outside of a cell or a protein or polypeptide operably linked to a signal sequence, e.g., an amino acid sequence tag leading proteins or polypeptides through the secretion pathway of a cell. Usually any suitable signal sequence known or later discovered can be used including, without any limitation, signal sequences derived from preprochymosin, e.g., bovine preprochymosin, glucoamylase, e.g., A. niger glucoamylase, aspartic protease, e.g., Rhizomucor miehei or Trichoderma reesei aspartic proteases or cellulases, e.g., Trichoderma reesei cellobiohydrolase I, cellobiohydrolase II, endoglucanase I, endoglucanase II or endoglucanase III.
[0041] In some embodiments, the polypeptide of interest can be a member of the aspartic proteinase family, e.g., family A1 of aspartic proteinases according to the MEROPS classification (Rawlings et al., Nucleic Acids Res (2006) 34: D270-72). This protein family contains endopeptidases with a catalytic center formed by two aspartic acid residues that are active at acidic pH. Chymosins (peptidase 3.4.23.4 by the NC-IUMB classification) are aspartic proteases that perform limited digestion of kappa-casein in neonatal gastric digestion. Bovine chymosin is used to clot milk during cheese making. In some embodiments, the polypeptide of interest can be a member of chymosin family, e.g. chymosin of any species including, without any limitation, chymosin of bovine, sheep, or goat origin. In some embodiments, the polypeptide of interest can be a modified chymosin, e.g., chymosin modified, such as mutated, to increase its function in any cheese making or milk coagulation process or optimize its expression in expression hosts. In some embodiments, the polypeptide of interest can be a fusion chymosin including at least two chymosins from two different species. In the context of the present application, the term "chymosin" means chymosin of any species, native or recombinant, or any polypeptide with substantially the same amino acid sequence as chymosin, e.g., any polypeptide having at least 60%, 70%, 80%, 90%, or 95% sequence identity of a chymosin, or any polypeptide with substantially the same protein folding characteristics of a chymosin, or a chymosin homolog, e.g., based on function or structure similarities commonly accepted by one skilled in the art. In some embodiments, the heterologous protein can be any protein expressible in a filamentous fungal host. Examples of proteins expressible in filamentous fungal hosts include, but are not limited to, laccases, endopeptidases, glucoamylases, alpha-amylase, granular starch hydrolyzing enzyme, cellulases, lipases, xylanases, cutinases, hemicellulases, proteases, oxidases, and combinations thereof. In general, the expression of a desired polypeptide in the present teachings can be under any suitable promoter known or later discovered in the art. In some embodiments, the polypeptide of interest in the present teachings can be expressed under a promoter native to the host. In some embodiments, the polypeptide of interest in the present teachings can be expressed under a heterologous promoter. In some embodiments, the polypeptide of interest in the present teachings can be expressed under a constitutive or inducible promoter. In some embodiments, the polypeptide of interest in the present teachings can be expressed in a Trichoderma expression system with a cellulase promoter, e.g., cbh1 promoter.
[0042] According to the present teachings, the secretion enhancing protein can be used in any host, e.g., expression host to increase the secretion of a desired polypeptide in the host. For example, the expression hosts of the present teachings can be filamentous fungi. In general, the "filamentous fungi" of the present teachings are eukaryotic microorganisms and include all filamentous forms of the subdivision Eumycotina. These fungi are characterized by a vegetative mycelium with a cell wall composed of chitin, beta-glucan, and other complex polysaccharides. In various embodiments, the filamentous fungi of the present teachings are morphologically, physiologically, and genetically distinct from yeasts. In some embodiments, the filamentous fungi of the present teachings include, but are not limited to the following genera: Aspergillus, Acremonium, Aureobasidium, Beauveria, Cephalosporium, Ceriporiopsis, Chaetomium paecilomyces, Chrysosporium, Claviceps, Cochiobolus, Cryptococcus, Cyathus, Endothia, Endothia mucor, Fusarium, Gilocladium, Humicola, Magnaporthe, Myceliophthora, Myrothecium, Mucor, Neurospora, Phanerochaete, Podospora, Paecilomyces, Penicillium, Pyricularia, Rhizomucor, Rhizopus, Schizophylum, Stagonospora, Talaromyces, Trichoderma, Thermomyces, Thermoascus, Thielavia, Tolypocladium, Trichophyton, Trametes, and Pleurotus. In some embodiments, the filamentous fungi of the present teachings include, but are not limited to the following: A. nidulans, A. niger, A. awamori, e.g., NRRL 3112, ATCC 22342 (NRRL 3112), ATCC 44733, ATCC 14331 and strain UVK 143f, A. oryzae, e.g., ATCC 11490, N. crassa, Trichoderma reesei, e.g. NRRL 15709, ATCC 13631, 56764, 56765, 56766, 56767, and Trichoderma viride, e.g., ATCC 32098 and 32086.
[0043] According to another aspect of the present teachings, it provides an expression host expressing a secretion enhancing protein and a desired polypeptide, e.g., polypeptide of interest. In some embodiments, the expression host of the present teachings contains a first polynucleotide encoding a secretion enhancing protein and a second polynucleotide encoding a polypeptide of interest. In some embodiments, the expression host of the present teachings contains a first polynucleotide encoding a secretion enhancing protein, a second polynucleotide encoding a polypeptide of interest, and a third polynucleotide encoding a secretion enhancing protein, e.g., different from the one encoded by the first polynucleotide.
[0044] In some embodiments, the expression host of the present teachings contains a first polynucleotide encoding a secretion enhancing protein that can be a chaperone or foldase protein and a second polynucleotide encoding a polypeptide of interest. In some embodiments, the expression host of the present teachings contains a first polynucleotide encoding a secretion enhancing protein that can be a chaperone, a second polynucleotide encoding a polypeptide of interest, and a third polynucleotide encoding a secretion enhancing protein that can be a foldase.
[0045] According to the present teachings, the first, second, and/or third polynucleotide in the expression host of the present teachings can be operably linked to one or more promoters, e.g., native or heterologous promoters of the expression host. Any suitable promoter can be used in the present teachings. In some embodiments, the promoter operably linked to the first and/or third polynucleotide can be a constitutive or inducible promoter. In some embodiments, the promoter operably linked to the second polynucleotide can be a promoter native to the expression host containing the second polynucleotide. In some embodiments, the promoter operably linked to the second polynucleotide can be a native promoter associated with any gene characteristic of active transcription or expression in the expression host. In some embodiments, the promoter operably linked to the second polynucleotide can be a modified native promoter, e.g., mutated native promoter with enhanced transcription activity of the promoter. In some embodiments, the promoter operably linked to the second polypeptide in a Trichoderma expression system can be a cellulase promoter, e.g., cbh1 promoter.
[0046] In some embodiments the desired polypeptide may be produced as a fusion polypeptide. In some embodiments the desired polypeptide may be fused to a polypeptide that is efficiently secreted by a filamentous fungus. In some embodiments the desired polypeptide may be fused to a CBHI polypeptide, or portion thereof. In some embodiments the desired polypeptide may be fused to a CBHI polypeptide, or portion thereof, that is altered to minimize or eliminate catalytic activity. In some embodiments the desired polypeptide may be fused to a polypeptide to enhance secretion, facilitate subsequent purification or enhance stability.
[0047] In general, the first, second, and/or third polynucleotide in the expression host of the present teachings can be either genetically inserted or integrated into the genomic makeup of the expression host, e.g., integrated into the chromosome of the expression host, or existing extrachromosomally, e.g., existing as a replicating vector within the expression host under selection condition for a selection marker carried by the vector.
[0048] According to the present teachings, the secretion level of a desired polypeptide in the expression host of the present teachings can be determined by various factors, e.g., growth conditions of the host, etc., however normally higher than the secretion level of the desired polypeptide expressed in the host without the expression of a secretion enhancing protein. In some embodiments, the secretion level of a desired polypeptide, e.g., bovine chymosin in the expression host of the present teachings, e.g., T. reesei can be at least 1 mg/liter, 2 mg/liter, 3 mg/liter, 4 mg/liter, or 5 mg/liter when the host grows in a batch fermentation mode in a shake flask, or at least 50 mg/liter, 100 mg/liter, 150 mg/liter, 200 mg/liter, 250 mg/liter, or 300 mg/liter when the host grows in a fermenter environment with controlled pH, feed-rate, etc. e.g., fed-batch fermentation.
[0049] In general, the secretion level of a polypeptide can be evaluated via various assays. For example, in order to evaluate the expression and/or secretion of a secretable polypeptide, assays can be carried out at the protein level, the RNA level or by use of functional bioassays particular to secretable polypeptide activity and/or production. Exemplary assays employed to analyze the expression and/or secretion of secretable polypeptide include, Northern blotting, dot blotting (DNA or RNA analysis), RT-PCR (reverse transcriptase polymerase chain reaction), or in situ hybridization, using an appropriately labeled probe (based on the nucleic acid coding sequence) and conventional Southern blotting and autoradiography.
[0050] In addition, the production, expression and/or secretion of a secretable polypeptide can be measured in a sample directly, for example, by assays for enzyme activity, expression and/or production. Protein expression, may be evaluated by immunological methods, such as immunohistochemical staining of cells, tissue sections or immunoassay of tissue culture medium, e.g., by Western blot or ELISA. Such immunoassays can be used to qualitatively and quantitatively evaluate expression of secretable polypeptide. The details of such methods are known to those of skill in the art and many reagents for practicing such methods are commercially available.
[0051] According to yet another aspect of the present teachings, it provides extracts, e.g., solids or supernatant obtained from the culture of the expression host of the present teachings. In some embodiments, the supernatant does not contain substantial amount of the expression host, in some embodiments, the supernatant does not contain any amount of the expression host.
EXAMPLES
[0052] Aspects of the present teachings may be further understood in light of the Examples, which should not be construed as limiting the present teachings in any way.
Example 1
Vector for Over-Expression of Bip1 in T. Reesei
[0053] A Gateway-compatible expression vector, pTrex2g/hygB, was designed to enable over-expression of the T. reesei chaperone gene bip1. After insertion into pTrex2g/hygB the open reading frame of the bip1 gene was flanked by the promoter sequences of the T. reesei pki1 gene and the terminator sequences of the T. reesei cbh1 gene. The vector also contained the E. coli hygromycin phosphotransferase (hph) gene flanked by the promoter sequences of the Neurospora crassa cpc-1 gene and the terminator sequences of the Aspergillus nidulans trpC gene.
[0054] The following segments of DNA were assembled in the construction of Trex2g/HygB (see FIG. 1):
[0055] A 728 bp fragment of T. reesei genomic DNA representing the promoter region from the pki1 (pyruvate kinase) gene. At the 5' end of this DNA were 6 bp of synthetic DNA representing a SpeI restriction site and at the 3' end were 6 bp of synthetic DNA adding a SacII restriction site.
[0056] The 1714 bp Gateway cassette to allow insertion of the chaperone or foldase sequence using Gateway cloning technology (InVitrogen Corporation, USA). This cassette has the following components; the 125 bp E. coli attR1 phage λ0 attachment site, a chloramphenicol resistance gene, the E. coli ccdB gene and the 125 bp E. coli attR2 phage λ attachment site.
[0057] The Gateway cassette was followed by a 17 bp fragment of synthetic DNA ending with an AscI site. The native T. reesei cbh1 terminator region (356 bp) immediately followed the AscI site. This terminator region ended with 4 bp of synthetic DNA being the half of a PmeI restriction site (GTTT) remaining after digestion.
[0058] A 2.6 kb cassette consisting of the Neurospora crassa cpc-1 promoter fused to the E. coli hph open reading frame followed by the Aspergillus nidulans trpC terminator. This cassette was amplified by PCR from the vector pFAC1 described by Barreau et al. (1998). The PCR product had 55 bp of synthetic DNA (part of a multiple cloning site) at one end and was blunt-end ligated to the digested PmeI site at the end of the cbh1 terminator. At the other end the PCR product had 20 bp of synthetic DNA terminating in a SphI site that was digested to link with pSL1180 below.
[0059] The above DNA fragments were inserted in the E. coli vector pSL1180 between the SpeI and SphI sites of the multiple cloning sites.
Example 2
The Trichoderma reesei Chymosin Production Strain CHY1-2
[0060] A synthetic version of the bovine prochymosin B open reading frame (see FIG. 2, SEQ ID NO: 42) was constructed with codon usage optimized for expression in Trichoderma. A vector, pTrex4-ChyGA was designed for the expression of an open reading frame encoding a fusion protein that consists of the following components from the amino-terminus: the T. reesei CBHI secretion signal sequence, the T. reesei CBHI catalytic core and linker region, and the bovine prochymosin B protein. This open reading frame is flanked by the promoter and terminator sequences of the T. reesei cbh1 gene. The vector also contains the Aspergillus nidulans amdS gene, encoding acetamidase, as a selectable marker for transformation of T. reesei.
[0061] The following segments of DNA were assembled in the construction of pTrex4-ChyGA (see FIG. 3):
[0062] The T. reesei cbh1 promoter and coding region. This DNA sequence begins at a naturally occurring HindIII site approximately 2250 bp upstream of the coding region. It ends at a SpeI site created at the end of the sequence encoding the CBHI linker region by changing the codon for the threonine residue at position 478 of preCBHI from ACC to ACT and adding AGT nucleotides immediately afterwards.
[0063] The synthetic coding region for bovine prochymosin B was directly fused to the end of the CBHI coding region. The sequence of this DNA is shown in FIG. 2. Immediately after the prochymosin B stop codon are 8 nucleotides of synthetic DNA representing an AscI restriction site (GGCGCGCC).
[0064] The native T. reesei cbh1 terminator region (356 bp) immediately followed the above AscI site.
[0065] A 2.75 kb fragment of Aspergillus nidulans genomic DNA including the promoter, coding region and terminator of the amdS (acetamidase) gene. This is a blunt-ended fragment generated by digestion with SspI at naturally occurring restriction sites
[0066] The above DNA fragments were inserted in the E. coli vector pSL1180 (Pharmacia) between the HindIII and StuI sites of the multiple cloning site.
[0067] Plasmid pTrex4-CHY GA was inserted into the Trichoderma reesei Morph1 1.1 pyr4+, a strain derived from RL-P37 (Sheir-Neiss, G. and Montenecourt, B. S., 1984, Appl. Microbiol. Biotechnol. 20:46-53) and deleted for the cbh1, cbh2, egl1, and egl2 genes described by Bower et al (Carbohydrases from Trichoderma reesei and other micro-organisms, Royal Society of Chemistry, Cambridge, 1998, p. 327-334) by polyethylene glycol (PEG)-mediated transformation of protoplasts. Transformants were selected on agar medium containing acetamide as sole nitrogen source. This resulted in the chymosin production host strain T. reesei CHY1-2.
Example 3
Cloning the T. Reesei bip1 Gene and Insertion into pTrex2g/hygB
[0068] In order to insert the T. reesei bip1 gene into pTrex2g/HygB the DNA sequence was amplified by PCR using attB PCR primers. The forward primer (F-attB1) had the following sequence at the 5' end, 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCT-3', followed by a sequence specific to the 5' end of the bip1 open reading frame. The reverse primer (R-attB2) had the following sequence at the 5' end, 5'-GGGGACCACTTTGTACAAGAAAGCTGGGT-3', followed by a sequence specific to the 3' end of the bip1 open reading frame. The full sequence of the two primers was:
TABLE-US-00002 (SEQ ID NO: 31) 5'-GGGGACAAGTTTGTACAAAAAAGCAGGCTATGGCTCGTTCACGGAG CTCCC-3' (SEQ ID NO: 32) 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTTTACAATTCGTCGTGGA AGTCGCC-3'
[0069] The bip1 gene was amplified using Phusion polymerase from Finnzymes (Cat. No. F-530) according to the manufacturer's directions. The PCR mixture contained 1 μl T. reesei genomic DNA, 10 μl 5× buffer HF, 1 μl of 10 mM dNTPs, 1.5 μl DMSO, 0.5 μl Phusion DNA polymerase, 2 μl each of the forward and reverse bip1 primers and 32 μl MilliQ H2O. The following temperature and time conditions were used for the PCR. Denaturation of DNA at 98° C. for 30 sec followed by 30 cycles at 98° C. for 10 sec, 55° C. for 30 sec and 72° C. for 90 sec, and a final extension at 72° C. for 10 min.
[0070] After agarose gel electrophoresis the 2.3 kb PCR product was purified using a Qiagen gel extraction kit (Cat. No. 28706) according to the manufacturers instructions. The purified PCR product was inserted into the vector pDONR201 (Invitrogen; Cat. No. 11798014) using a BP Clonase reaction (Invitrogen; Cat. No. 11789013) according the following protocol. The following components were mixed; 2 μl pDONR201, 4 μl PCR product, 4 μl BP Enzyme buffer, 6 μl TE buffer, and 4 μl BP Enyzme. After overnight incubation at 25° C. the reaction was stopped by adding Proteinase K solution and incubating for 10 minutes at 37° C. 2 μl of the reaction mixture was used for transformation of E. coli TOP10 chemical competent cells (Invitrogen Cat. No. C4040-10) according to the manufacturer's directions. After sequence analysis, the bip1 sequence was transferred to the expression vector pTrex2g/hygB using the LR Clonase reaction (Invitrogen; Cat. No. 11791019) according to the following protocol. The following components were mixed. 2 μl pDON201R with inserted bip1 gene, 2 μl pTrex2g/hygB, 4 μl LR enzyme buffer, 4 μl LR enzyme mix, and 8 μl TE. Following overnight incubation at 25° C. the reaction was stopped by addition of Proteinase K solution and incubation for 10 minutes at 37° C. 2 μl of the reaction mixture was transformed into E. coli MAX EFFICIENCY DH5α Competent Cells (Invitrogen; Cat. No. 18258012). Plasmid DNA, pTrex2g/HygB/bip1 was isolated from two resulting E. coli colonies for transformation of T. reesei CHY1-2
Example 4
Trichoderma Transformation
[0071] Expression vector pTrex2g/HygB/bip1 was inserted into spores of T. reesei CHY1-2 using a biolistic transformation procedure. DNA-coated tungsten particles were prepared as follows. 60 mg of M10 tungsten particles were added to 1 ml ethanol (70% or 100%) in a microcentrifuge tube. This mixture was allowed to soak for 15 minutes, followed by centrifugation for 15 min at 15,000 rpm. The supernatant was then decanted and the pellet washed three times with sterile distilled water. The majority of the distilled water was removed after the final wash. The pellet was then resuspended in 1 ml of a 50% glycerol (v/v, sterile) solution. While continuously vortexing a 25 μl aliquot of this particle suspension was removed and placed in a microcentrifuge tube. To this tube the following components were added (while continuously vortexing) in the following order. 0.5-5 μl of pTrex2g/HygB/bip1 DNA solution (1 μg/μl), 25 μl 2.5M CaCl2, and 10 μl 0.1 M spermidine
[0072] The mixture was allowed to coat the particles for 5-15 minutes during continuous vortexing, and was used as soon as possible to avoid tungsten degradation of the DNA. The mixture was then centrifuged for approximately three seconds. The supernatant was then removed and the pellet was washed with approx 200 μl of 70% ethanol (v/v) followed by a 3 second centrifugation and removal of the supernatant. The pellet was again washed with 200 μl of 100% ethanol, followed by another 3 second centrifugation. The supernatant was removed and the pellet was then resuspended in 24 μl 100% ethanol and mixed by pipetting. 8 μl aliquots were placed onto macrocarrier discs (Bio-Rad, Hercules, Calif.) by pipetting the aliquots in the exact center of the disks while the disks were in a desiccator. The discs were kept in a desiccator until thoroughly dry and kept there until immediately before use. The macrocarrier discs were inserted into a Model PDS-1000/He Biolistic Particle Delivery System (Bio-Rad, Hercules, Calif.). This apparatus was used according to the manufacturer's directions to propel the DNA-coated tungsten particles at the T. reesei spores prepared as below.
[0073] A spore suspension of strain CHY1-2 was made with approximately 5×108 spores/ml. 100-200 μl aliquots of the spore suspension was spread over an area approximately 6 cm in diameter at the center of a plate of agar medium containing acetamide as sole nitrogen source. After the biolistic transformation, the plates were placed in a 25° C. incubator for 1 day. Then, 1 ml Hygromycin B solution (4 mg/ml) was spread onto the plates and an additional incubation of 3 days at 28° C. was performed. Transformants were transferred onto fresh agar plates with acetamide as sole nitrogen source and Hygromycin B (200 μl/ml), and placed at 28° C.
Example 5
Chymosin Expression in Shake Flasks
[0074] Lactose defined liquid medium contained the following components. Casamino acids, 9 g/L; (NH4) 2SO4, 5 g/L; MgSO4.7H2O, 1 g/L; KH2PO4, 4.5 g/L; CaCl2.2H2O, 1 g/L, PIPPS, 33 g/L, 400× T. reesei trace elements, 2.5 ml/L; pH adjusted to 5.5 with NaOH. After sterilization, lactose was added to a final concentration of 20% v/v.
[0075] 400× T. reesei trace elements solution contained the following: citric Acid (anhydrous), 175 g/L; FeSO4.7 H2O, 200 g/L, ZnSO4.7 H2O, 16 g/L, CuSO4.5 H2O, 3.2 g/L; MnSO4.H2O, 1.4 g/L; H3BO3, 0.8 g/L.
[0076] Ten transformants of T. reesei strain CHY1-2 with the bip1 expression vector were evaluated by shake flask culture in lactose defined liquid medium for improved chymosin production. From each morphologically stable transformant colony on a Petri dish one square cm was excised and used to inoculate a single 30 ml LD medium in a baffled shake flask. After 3 days of growth at 28° C. and 150 rpm, 5 ml of this pre-culture was used to inoculate 45 ml LD medium in a baffled shake flask. This production culture was grown for 3 days at 28° C. and 150 rpm. Supernatants were collected by centrifugation of the fermentation broth. Chymosin activity was measured and SDS-PAGE and Western analysis were performed to determine the chymosin concentration.
[0077] The chymosin activity in the culture supernatant was measured using essentially the same methods as previously described (Dunn-Coleman et al., 1991, Bio/Technology 9:976-981). Two transformants, bip1 #1.2 and bip1 #1.10 were chosen for further study because they showed a significant improvement in chymosin production compared to the host strain T. reesei CHY1-2 (see Table 2, column 2).
[0078] Culture supernatants from these two transformants were subjected to SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis). Following electrophoresis protein was stained with Coomassie Brilliant Blue. Based on the intensity of the 35 kDa band corresponding to mature chymosin transformants bip1 #1.2 and bip1 #1.10 produced more chymosin than strain CHY 1-2.
[0079] Four replicate shake flask cultures of bip1 #1.2, bip1 #1.10 and strain CHY 1-2 were grown and chymosin activity analysis was performed. Again, transformants bip1 #1.2 and bip1 #1.10 clearly produced more active chymosin than the host strain T. reesei CHY1-2 (Table 2, column 3).
TABLE-US-00003 TABLE 2 Percentage of chymosin activity in shake flask supernatants of transformants bip1 #1.2 and bip1 #1.10 compared to T. reesei CHY1-2 % of chymosin activity % of chymosin activity Strain (Single shake flask experiment) (Average of four flasks) CHY 1-2 100 100 Bip1 #1.2 282 363 Bip1 #1.10 240 370
[0080] It was possible that some secreted chymosin was present in an inactive form due to degradation. Chymosin was initially secreted as a CBHI-prochymosin fusion protein. At low pH, mature active chymosin was expected to be released by autocatalytic cleavage at the junction between the chymosin pro-region and mature chymosin. Therefore, it was also possible that some chymosin was present as CBHI-prochymosin fusion protein in the culture supernatant and consequently inactive. For these reasons, Western blot analysis was performed to determine the total amount of secreted chymosin; as active, inactive and fused protein. Proteins were separated by SDS-PAGE using the NuPAGE Novex pre-cast gel system according to the manufacturer's instructions (InVitrogen, Carlsbad, Calif.). Following electrophoresis the proteins were electro-blotted onto a PVDF membrane using an XCell II Blot Module as directed by the manufacturer (InVitrogen, Carlsbad, Calif.). The BM chromogenic Western Blotting Kit from Roche (Cat. No. 1647644) was used to detect alkaline phosphatase-labeled antibodies. Primary antibodies (affinity-purified polyclonal rabbit anti-chymosin) were diluted 1000 times. The blot was scanned and the intensities of the chymosin-specific bands were measured using Total Lab Software (see FIG. 4). Based on this measure of total chymosin production, transformants bip1 #1.2 and bip1 #1.10 showed a clear increase compared to strain CHY 1-2.
Example 6
mRNA Analysis of T. Reesei CHY1-2 and Bip1 #1.10
[0081] Shake flask fermentations were performed to collect mycelium for mRNA level analysis for chymosin, CBH1 and Bip1 in two T. reesei strains, CHY1-2 and bip1 #1.10. Broth was collected after 72 hrs of culture and frozen in liquid nitrogen. Total RNA was isolated using a FastRNA Red Kit (Bio 101, Inc., Carlsbad, Calif.) according to the manufacturer's instructions. In brief, the following protocol was used. Lysing tubes were chilled on dry ice and 500 μl CRSR RED, 500 μl PAR, and 100 ul CIA were added and frozen.
[0082] A piece of frozen mycelia (approx. 0.7 cm cubed) was added to the lysing tube with frozen reagents. The tube was placed at 60° C. for 2-5 minutes, until bottom reagents around the beads started to thaw, but not top reagents or sample. The tube was immediately secured in a FastPrep machine, and shaken for 3×30 seconds at setting 6, allowing 1 min rest between disruptions. The tubes were removed and placed on wet ice 5 min before centrifugation. The aqueous phase was drawn off to a new tube and an equal volume of CIA was added, vortexed to mix and centrifuged. The last step was repeated and an equal volume of DIPS was added, mixed and incubated at room temperature for 1-2 minutes. The tube was centrifuged to pellet the RNA and the supernatant was removed. The pellet was washed with 500 μl SEWS by adding the wash and removing immediately. The last traces of wash were removed and the pellet was air dried for 5-10 min before resuspending in 200 μl RNase-free water. 40 μl of LiCl solution was added and the sample was incubated at 4° C. overnight. The tube was centrifuged to pellet the RNA, the RNA was washed as before, and finally resuspended in 100-200 μl of RNase-free water.
[0083] Complementary DNA synthesis was performed with a High Archive cDNA synthesis kit from Applied Biosystems Inc. according to the manufacturer's directions, after which the cDNA was amplified with gene specific primers (Table 3).
TABLE-US-00004 TABLE 3 Gene-specific primers designed for use in TaqMan Gene Expression Assays Name Sequence CBH1 forward AGTTACCACGAGCGGTAACAG (SEQ ID NO: 33) CBH1 reverse AAGAGAACTCGTTGCCAAGC (SEQ ID NO: 34) Bip1 forward CACCAACACCGTCTACGATG (SEQ ID NO: 35) Bip1 reverse CGTTCTTCTCAATGACCTTGTAG (SEQ ID NO: 36) Chymosin forward CAGCAAGCTCGTCGGC (SEQ ID NO: 37) Chymosin reverse GGTACATCTTGCCGTTGATCTC (SEQ ID NO: 38)
[0084] Quantification of the amplified cDNA was performed using the TaqMan Gene Expression Assay kit from Applied Biosystems, Inc. with an Applied Biosystems 7900 HT thermal cycler according the manufacturer's instructions. In brief, the TaqMan Universal PCR Master Mix, No AmpErase UNG was mixed with 20× TaqMan Gene Expression Assay Mix (containing unlabelled gene-specific primers and TaqMan MGB probe) and cDNA. The following thermal cycler conditions were then applied. Two minutes at 50° C., 10 min at 95° C., and 40 cycles of 15 sec at 95° C., 1 min at 60° C. The bip1, chymosin and cbh1 levels were determined relative to the native T. reesei genes, gpd1 (encoding glyceraldehyde-3-phosphate dehydrogenase) and act1 (encoding actin). For each gene, a cycle threshold value was determined. This value is equivalent to the number of PCR cycles required for a fluorescence signal to be detectable. The difference between the cycle threshold value (ACT) for each of bip1, chymosin or cbh1 and either gpd1 or act1 was calculated. The units on the y axis of FIG. 5 represent ΔCT and one unit increase represents a doubling of mRNA level.
[0085] The above mRNA analyses showed that bip1, chymosin and cbh1 levels are all increased as a result of bip1 over-expression in transformant bip1 #1.10 compared to strain CHY 1-2. (see FIG. 5).
Example 7
T. Reesei Strain for Chymosin Production
[0086] A vector, pCBHI×CBD-Chy, was designed for the expression of an open reading frame encoding a fusion protein that consists of the following components from the amino-terminus: the T. reesei CBHI secretion signal sequence, the full-length T. reesei CBHI mature protein (including catalytic domain, linker region and cellulose binding domain), and the Bos taurus prochymosin B protein. A single codon was altered within the CBHI catalytic domain in order to inactivate the CBHI enzyme. This open reading frame is flanked by the promoter and terminator sequences of the T. reesei cbh1 gene. The vector also contains the Aspergillus nidulans amdS gene, encoding acetamidase, as a selectable marker for transformation of T. reesei.
[0087] The following segments of DNA were assembled in the construction of pCBHI×CBD-Chy. The T. reesei cbh1 promoter and coding region. This DNA sequence begins at a naturally occurring XbaI site approximately 1500 bp upstream of the coding region. The following changes to the native T. reesei genomic DNA sequence were made. Within the CBHI coding region the codon for amino acid 212 of the mature CBHI protein was changed from GAG (Glutamic acid) to CAG (Glutamine), known to result in production of an inactive form of CBHI (Stahlberg, J. (1996) J. Mol. Biol. 264:337-349).
[0088] Within the segment of the coding region encoding the CBHI linker region a change was made to create a SpeI restriction site. This changed the sequence from ACC CAG to ACT AGT ACC CAG (SEQ ID NO: 39) altering the amino acid sequence by insertion of two residues from Thr Gln to Thr Ser Thr Gln. The Gln in this sequence represents the first amino acid of the cellulose binding domain of CBHI. At the end of the CBHI coding sequence two additional codons (ACT AGT encoding Ser Thr) were added to create a SpeI restriction site.
[0089] The synthetic coding region for bovine prochymosin B is directly fused to the end of the CBHI coding region. The sequence of this DNA, and the encoded protein, are shown in FIG. 2. Immediately after the prochymosin B stop codon are 8 nucleotides of synthetic DNA representing an AscI restriction site (GGCGCGCC).
[0090] The native T. reesei cbh1 terminator region (356 bp) immediately follows the above AscI site. This terminator region ends with 4 bp of synthetic DNA being the half of a PmeI restriction site (GTTT) remaining after digestion.
[0091] A 2.75 kb fragment of Aspergillus nidulans genomic DNA including the promoter, coding region and terminator of the amdS (acetamidase) gene. This is a blunt-ended fragment generated by digestion with SspI at naturally occurring restriction sites. A natural XbaI site occurs before the SspI site at the end of the terminator region. A 55 bp fragment of the multiple cloning site of pSL1180 from the StuI to the KpnI site.
[0092] The above DNA fragments were inserted in the E. coli vector pNEB 193 (New England Biolabs, Inc., USA) between the XbaI and KpnI sites of the multiple cloning site. pNEB 193 is identical to pUC19 (Yannisch-Perron et al., 1985) except for the addition of several restriction endonuclease sites to the multiple cloning site.
[0093] The expression vector pCBHI×CBD-Chy was digested with XbaI to release a fragment of DNA containing only the cbh1 promoter, CHI-prochymosin B coding sequence, cbh1 terminator and A. nidulans amdS gene. Only this XbaI fragment of DNA, not the entire pCBHI×CBD-Chy expression vector, was inserted into the T. reesei production strain.
[0094] In more detail, this XbaI fragment contains the following segments of DNA. The T. reesei cbh1 promoter and coding region. This DNA sequence begins at a naturally occurring XbaI site approximately 1500 bp upstream of the coding region. The following changes to the native T. reesei genomic DNA sequence were made.
[0095] Within the CBHI coding region the codon for amino acid 212 of the mature CBHI protein was changed from GAG (Glutamic acid) to CAG (Glutamine) resulting in production of an inactive form of CBHI. Within the segment of the coding region encoding the CBHI linker region a change was made to create a SpeI restriction site. This changed the sequence from ACC CAG to ACT AGT ACC CAG altering the amino acid sequence by insertion of two residues from Thr Gln to Thr Ser Thr Gln. The Gln in this sequence represents the first amino acid of the cellulose binding domain of CBHI. At the end of the CBHI coding sequence two additional codons (ACT AGT encoding Ser Thr) were added to create a SpeI restriction site.
[0096] The synthetic coding region for bovine prochymosin B was directly fused to the end of the CBHI coding region. The sequence of this DNA, and the encoded protein, are shown in FIG. 2. Immediately after the prochymosin B stop codon are 8 nucleotides of synthetic DNA representing an AscI restriction site (GGCGCGCC).
[0097] The native T. reesei cbh1 terminator region (356 bp) immediately follows the above AscI site. This terminator region ends with 4 bp of synthetic DNA being the half of a PmeI restriction site (GTTT) remaining after digestion. A 2.75 kb fragment of Aspergillus nidulans genomic DNA including the promoter, coding region and terminator of the amdS (acetamidase) gene. This fragment begins at a naturally occurring SspI site and ends at a natural XbaI site.
[0098] The expression vector pTrex2g/HygB/Bip1 was described in Example 1. This vector was digested with SpeI and BmrI to release a fragment of DNA containing only the pki1 promoter, bip1 coding region, and cbh1 terminator. Only this SpeI-BmrI fragment of DNA, not the entire pTrex2g/HygB/Bip1 expression vector, was inserted into the T. reesei production strain. In more detail, this SpeI-BmrI fragment contains the following segments of DNA.
[0099] A 728 bp fragment of T. reesei genomic DNA representing the promoter region from the pki1 (pyruvate kinase) gene. At the 5' end of this DNA are 5 bp of synthetic DNA representing a digested SpeI restriction site and at the 3, end are 6 bp of synthetic DNA adding a SacII restriction site. The 25 bp E. coli attB1 phage λ attachment site that remains after insertion of the sequence bip1 sequence (below) using Gateway cloning technology (InVitrogen Corporation, USA). A 2.3 kb fragment of T. reesei genomic DNA representing only the coding region of the bip1 gene. The 25 bp E. coli attB2 phage λ attachment site that remains after insertion of the sequence bip1 sequence (below) using Gateway cloning technology (InVitrogen Corporation, USA) followed by a 17 bp fragment of synthetic DNA ending with an AscI site.
[0100] The native T. reesei cbh1 terminator region (356 bp) immediately follows the above AscI site. This terminator region ends at a naturally occurring BmrI restriction site. Plasmid pCBHI×CBD-Chy was digested with XbaI and the CBHI-prochymosin B expression cassette (with amdS gene) was purified by agarose gel electrophoresis. Plasmid pTrex2g/HygB/Bip1 was digested with SpeI and BmrI and the Bip1 expression cassette was purified by agarose gel electrophoresis. T. reesei strain Pent Δ (derived from strain RL-P37 with deletions in the cbh1, cbh2, egl1, egl2 and egl3 genes) was transformed with a mixture of the purified CBHI-prochymosin B and Bip1 expression cassettes using a PEG-mediated protoplast transformation protocol.
[0101] Several transformants were isolated, grown in shake flasks and examined for chymosin production. One transformant was chosen and called strain Trichoderma reesei Pent CHY-Bip 3. The integration of DNA in transformant Pent CHY-Bip 3 was investigated by Southern analysis to show that only the intended modifications to the T. reesei Pent A strain had been made. Chromosomal DNA was extracted (see Appendix 1) from the transformant, as well as from the host strain PentΔ. The chromosomal DNA was digested, independently, with XbaI, SpeI or StuI. The digests were purified and concentrated by ethanol precipitation. Digested DNA (5-10 ug) was subjected to electrophoresis on 1% agarose gels. DNA molecular weight markers, and expression vectors pCBHI×CBD-Chy (digested with XbaI) and pTrex2g/HygB/Bip1 (digested with BmrI), were also run on appropriate gels. Following electrophoresis, DNA was transferred to nylon membrane (Nytran SuperCharge; Schleicher & Schuell BioScience). After blotting, the membranes were hybridized with 32P-labeled pCBHI×CBD-Chy, pTrex2g/HygB/Bip1, pUC18, or a PCR product consisting of the entire Hygromycin B resistance cassette (including cpc-1 promoter, hph coding region, and trpC terminator). The latter PCR product was generated from pTrex2g/HygB/Bip1 as template using the following two primers:
TABLE-US-00005 (SEQ ID NO: 40) hph1, 5' TCTCCGGTGTCCCTTGTCCCTTC-3' and (SEQ ID NO: 41) hph2, 5'-ACCTGTGGCGCCGGTGATGCCGG-3'.
[0102] No hybridizing bands were observed with chromosomal DNA extracted from T. reesei Pent Δ or transformant Pent CHY-Bip 3 using the pUC18 probe demonstrating that no bacterial vector DNA was integrated in either of these strains. Similarly, hybridization with the Hygromycin B resistance cassette demonstrated that this DNA had not integrated in strain Pent CHY-Bip 3. The hybridization results with pCBHI×CBD-Chy and pTrex2g/HygB/Bip1 demonstrated that both the CBHI-prochymosin B expression cassette and the Bip1 expression cassette were integrated in strain Pent CHY-Bip 3. These results showed that only the intended CBHI-prochymosin B and Bip1 expression cassettes were integrated into the T. reesei chromosome.
Sequence CWU
1
1
4512267DNATrichoderma reesei 1atggctcgtt cacggagctc cctggccctc gggctgggcc
tgctctgctg gatcacgctg 60ctcttcgctc ctctggcgtt tgtcggaaag gccaatgccg
cgagcgacga cgcggacaac 120tacggcactg ttatcggaat tgtaagtcga ctgacggcag
caaccccgcc attttcttgg 180tgttgatgct caggcagccc tgctaacacg cttctcctcc
gcccaggatc tcggaactac 240ctacagctgc gtcggtgtga tgcagaaggg caaggttgag
attctcgtca acgaccaggg 300taaccgaatc actccctcct acgtggcctt taccgacgag
gagcgtctgg ttggcgattc 360cgccaagaac caggccgccg ccaaccccac caacaccgtc
tacgatgtca agtcagttct 420accgccctgt tggcttctat tgtataagtg gacaattagc
taactgttgt cacaggcgat 480tgattggccg caaattcgac gagaaggaga tccaggccga
catcaagcac ttcccctaca 540aggtcattga gaagaacggc aagcccgtcg tccaggtcca
ggtcaacggc cagaagaagc 600agttcactcc cgaggagatt tctgccatga ttcttggcaa
gatgaaggag gttgccgagt 660cgtacctggg caagaaggtt acccacgccg tcgtcaccgt
ccctgcctac ttcaacgtga 720gtcttttccc cgaaattcct cgaggattcc aagagccatc
tgctaacagc ccgataggac 780aaccagcgac aggccaccaa ggacgccggt accattgccg
gcttgaacgt tctccgaatc 840gtcaacgaac ccaccgctgc cgctatcgcc tatggtctgg
acaagaccga cggtgagcgc 900cagatcattg tctacgatct cggtggtggt acctttgatg
tttctctcct gtccattgac 960aatggcgtct tcgaggtctt ggctaccgcc ggtgacaccc
accttggtgg tgaggacttt 1020gaccagcgca ttatcaacta cctggccaag gcctacaaca
agaagaacaa cgtcgacatc 1080tccaaggacc tcaaggccat gggcaagctc aagcgtgaag
ccgaaaaggc caagcgtacc 1140ctctcttccc agatgagcac tcgtatcgaa atcgaggcct
tcttcgaggg caacgacttc 1200tccgagactc tcacccgggc caagttcgag gagctcaaca
tggacctctt caagaagacc 1260ctgaagcctg tcgagcaggt tctcaaggac gccaacgtca
agaagagcga ggttgacgac 1320atcgttctgg tcggcggttc cacccgtatc cccaaggttc
agtctcttat cgaggagtac 1380tttaacggca agaaggcttc caagggtatc aaccccgacg
aggctgttgc tttcggtgcc 1440gccgtccagg ccggtgtcct ttctggtgag gaaggtaccg
atgacattgt tctcatggac 1500gtcaaccccc tgactctcgg tatcgagacc actggcggag
tcatgaccaa gctcattccc 1560cgcaacaccc ccatccccac tcgcaagagc cagatcttct
cgactgctgc cgataaccag 1620cccgtcgtcc tgatccaggt cttcgagggt gagcgttcca
tgaccaagga caacaacctc 1680ctgggcaagt tcgagcttac cggcattcct cctgcccccc
gcggtgtccc ccagattgag 1740gtttccttcg agttggatgc caacggtatc ctcaaggtct
ccgctcacga caagggcacc 1800ggcaagcagg agtccatcac catcaccaac gacaagggcc
gtctcaccca ggaggagatt 1860gaccgcatgg ttgccgaggc cgagaagttc gccgaggagg
acaaggctac ccgtgagcgc 1920atcgaggccc gtaacggtct tgagaactac gccttcagcc
tgaagaacca ggtcaatgac 1980gaggagggcc tcggcggcaa gattgacgag gaggacaagg
agactgtaag ttgaagcgat 2040ccatcactgc tttctgatgc ggacatgtca cactaacact
tgaccagatt cttgacgccg 2100tcaaggaggc taccgagtgg ctcgaggaga acggcgccga
cgccactacc gaggactttg 2160aggagcagaa ggagaagctg tccaacgtcg cctaccccat
cacctccaag atgtaccagg 2220gtgctggtgg ctccgaggac gatggcgact tccacgacga
attgtaa 226721942DNATrichoderma reesei 2atgaagttca
acaccgtcgc ggccgctgcg gctctgctcg ctggtgtcgc gtatgccgag 60gacgtcgagg
agtccaaggc agtcccggag cttcccacct ttactgtgag tttgccctct 120ctttcatctt
tggaaaagga cccaaatgtt ggcgcttggc tccagcttgg agcaagcttc 180ttggacgacg
ggatatcatg aaccgctgct gacagttccc accaatcgct tagcccacct 240ccatcaaggc
ggacttcctc gagcagttca ccgacgactg ggagtcccgg tggaagcctt 300cccacgccaa
gaaggacacc agcggctccg acaaggacgc agaggaggaa tgggcctacg 360tcggcgagtg
ggcggtcgag gagccctacc agtacaaggg catcaacggc gacaagggcc 420tcgttgtcaa
gaaccctgcc gcgcaccacg ccatctcggc caagttcccc aagaagattg 480acaacaaggg
caagacgctc gtcgtgcagt acgaggtgaa gctccagagt aagtttggcc 540tctgcaactc
ccccgtgata accaaagcga gatgtggaca ttgtgctgac ctatacgctt 600ccagagggac
tggactgcgg cggtgcctac atgaagctgc tgcgcgacaa caaggctctc 660caccaggatg
agttcagcaa caccaccccc tacgtcatca tgtttggccc cgacaagtgc 720ggccacaaca
accgggtcca cttcatcgtc aaccacaaga accccaagac tggcgagtac 780gaggagaagc
acctcaactc ggccccggcc gtcaacattg tcaagacgac ggagctctac 840accctcattg
tccaccccaa caacaccttc tccatcaagc agaacggtgt cgagaccaag 900gccggcagcc
ttctcgagga cctgagccct cccatcaacc ctcccaagga gattgatgac 960cccaaggact
ccaagcccga cgactgggtc gacgaggctc gcattcccga ccccgaggcc 1020gtcaagcccg
aggactggga cgaggatgcg ccctttgaga ttgtcgacga ggaggccgtc 1080aagcccgagg
actggctcga ggacgagccc accacgatcc ccgaccccga ggcccagaag 1140cccgaggact
gggatgacga ggaggacggc gactggatcc ctcccaccgt ccccaacccc 1200aagtgcgagg
acgtctccgg ttgcggcccc tggaccaagc ccatggtcag gaaccccaac 1260tacaagggca
agtggactgc tccttacatt gacaaccctg cctacaaggg cgtctgggct 1320ccccgcaaga
tcaagaaccc cgactacttt gaggacaaga cgcccgccaa ctttgagccc 1380atgggagctg
taagtttcgt tcctttacca agaccttcat gacgctcgat tgctaaccag 1440tgctcgacag
attggcttcg agatctggac catgaccaac gacatcctct ttgacaacat 1500ctacattggc
cactccattg aggatgccga gaagctggcc aacgagacct tcttcgtcaa 1560gcaccccatt
gagaaggcgc ttgccgaggc tgatgagccc aagtttgacg acacccccaa 1620gtcgccctct
gacctcaagt tcctcgacga ccccgtgacc tttgtcaagg agaagcttga 1680cctgttcctg
accattgccc agcgcgaccc cgttgaggcc atcaagtttg ttcccgaggt 1740cgccggtggc
attgccgccg tcttcgtcac cctgattgcc atcattgtcg gtctggtcgg 1800ccttggctcc
tcatcggccg cccccaagaa ggccgccgcc actgctaagg agaaggccaa 1860ggacgtttcc
gaggctgttg caagcggtgc cgacaaggtc aagggagagg ttaccaagcg 1920aaccacccgc
agccagtcgt ag
194231910DNATrichoderma reesei 3atgaagtcgg cgagcaaatt gttctttctc
tccgtgtttt ccctatgggc gacgccgggc 60gcatgctcaa gctcgtcaag tacatgcact
gtacgtcaac ccaaccttgg cctcgtttcc 120cctttggaag aatgctttgc gctgacagat
tttgttgatc tagttctccc caaacgccat 180cattgacgat ggatgcgttt cgtatgcgac
tctcgataga ctcaatgtca aggtgaagcc 240tgctatagac gaactcgttc agacgaccga
cttcttttcg cactatcgct tgaacctctt 300caacaaaaaa tgccccttct ggaacgacga
agatggcatg tgcggtaaca ttgcctgcgc 360cgtcgagacg ctggacaacg aagaagatat
tcccgagata tggagggctc acgagcttag 420caagctggaa ggccctcgag cgaagcatcc
cggcaagcaa gagcagaggc agaaccctga 480gcgaccgctg cagggagagc tgggggagga
tgtaggggag agctgcgtgg ttgaatacga 540cgacgagtgt gacgacagag actactgcgt
ctgggacgac gaaggcgcaa cgtccaaggg 600ggactacatc agcttgttgc gcaaccccga
gcgcttcacc ggctatggcg gtcaaagtgc 660aaagcaggtg tgggacgcca tctactcgga
gaactgcttc aagaagagct cgtttcccaa 720gtcggccgat ctaggcgtct cgcaccgccc
aaccgaggcg gctgctctgg acttcaagca 780ggtcctggac accgctggcc gccaggctca
actggaacag cagcggcaga gcaacccaaa 840cattcccttt gttgccaaca ctggctacga
ggtggacgat gagtgtctgg agaagcgcgt 900gttctaccgg gtggtgtcgg gaatgcacgc
cagcatcagc gtccacctgt gctgggactt 960cctgaaccag agcacggggc aatggcagcc
caacttggac tgctacgaga gccgcctgca 1020caagtttcca gaccgcatca gcaacctcta
cttcaactac gctctcgtga ctcgcgccat 1080tgcgaagctg ggcccgtatg tactgtcacc
gcagtacacc ttttgcacag gggacccgtt 1140gcaagaccag gagacgcgag acaagattgc
ggccgtcacg aagcacgcgg ctagcgtccc 1200gcagatcttt gacgagggcg tcatgtttgt
caacggcgaa ggcccctcgc tcaaggaaga 1260tttccgcaat cgcttccgca acatcagccg
ggtcatggac tgcgtcggct gcgacaagtg 1320ccgtctctgg ggcaagatcc agaccagcgg
ctacggcacg gctttgaaga ttctgtttga 1380gttcaacgag ggccagaagc cgccgcccct
caagaggacc gagctggtgg ccctcttcaa 1440cacgtatgcc agactcagct cgtcggtggc
ggccgttggg cgattcaggg ccatgattga 1500catgcgcgac aagatggcgt ccaagcccga
cttcaagccc gaggatctct acacgctcat 1560cgacgaggcg gacgaggaca tggacgagtt
tatcaggatg caaaatcgtg ggagccacgg 1620agatacgctg ggcgagcagg tcggaaacga
atttgcccgc gtcatgatgg ccgtcaagat 1680tgtgctcaag agttggatcc gaacgcccaa
gatgatgtaa gtctcttctc tctttttttt 1740ccccttcttc gagtggcaca aagctcttca
ttgagatgga ctaacacaat tctagttggc 1800aaattgtctc ggaagagacg tcgagattgt
atcgcgcttg ggtcggtctg cctgcgcgac 1860ccagacggta cgcgttcaga ctgcccaact
tgaatagaga cgagttgtga 191043027DNATrichoderma reesei
4atgaagtcac cgaggaaatc accgttgctg aagctcctcg gagccgcctt tctcttctcc
60accaacgttc tcgccatctc cgctgttctc ggagtcgatc tgggaaccga gtacatcaag
120gcggcgctgg tgaagcccgg catcccgctt gagattgtgc tcacgaaaga ttcccgacga
180aaagaaacct cggccgtcgc cttcaagccg gcaaagggcg ccttaccgga gggccagtac
240cccgaacgga gctatggcgc cgacgcaatg gcactcgccg cacgattccc cggcgaagta
300tacccgaatc tgaagcccct gcttggactg ccagtggggg atgccattgt ccaagaatat
360gcggccaggc accctgcgtt gaagctacag gcgcacccca cgcggggaac tgctgcgttc
420aagacggaga cgctgtctcc ggaagaggag gcttggatgg tggaggagct gttggccatg
480gagcttcaga gcatccagaa gaacgcagag gttaccgctg gcggcgactc ttcgatacgc
540tccatcgtgc tcaccgtccc gccgttttac accatcgagg agaagcgagc cctgcagatg
600gcagcagagc tcgccggctt caaggtcctg agccttgtca gcgacggact ggccgtgggc
660ctcaactatg ccaccagtcg ccaattcccg aatatcaacg aaggcgccaa gccggaatac
720cacttggtct ttgacatggg agcgggctcc acaactgcta cggtcatgag gttccaaagc
780cgtacggtta aggacgtcgg caagttcaac aagacggttc aggagatcca ggttctcggc
840agcggctggg acaggaccct cggaggagac tctctcaact cgctaatcat cgatgacatg
900attgctcagt ttgtggaatc caagggtgct cagaagattt cggcaaccgc cgagcaggtt
960cagtctcatg gccgcgccgt tgcaaagctg agcaaggaag ccgagcgtct ccgacacgtc
1020ctcagcgcca accagaacac ccaagccagc tttgagggac tgtacgaaga tgttgacttc
1080aagtacaaga tctctcgggc tgacttcgag accatggcaa aggctcatgt cgagcgagtc
1140aacgctgcca tcaaggacgc tctgaaggcc gcgaacctcg agattggcga tctgacttcc
1200gtcattcttc acggtggtgc gacccgtact ccgtttgtgc gagaggccat tgagaaagct
1260cttggttctg gcgacaagat ccgtaccaat gtcaactctg atgaggcagc cgtctttggt
1320gctgctttcc gggctgctga gctcagccca agcttccgtg tgaaggagat taggatttct
1380gagggtgcaa actacgcagc tggcattact tggaaggctg cgaacggcaa ggtacaccgc
1440caacgactct ggactgcccc gtcgccgctc ggtggcccgg ccaaggagat tacctttacg
1500gaacaggagg actttactgg tttattctat caacaagttg acactgagga taagcccgtc
1560aagtcgttct cgactaagaa ccttaccgcc tctgttgctg ctctgaaaga aaagtatccc
1620acttgtgccg atactggcgt tcagttcaag gctgccgcga agctccgtac cgagaacggc
1680gaggttgcca tcgtcaaggc ctttgtggag tgcgaggctg aagtcgttga gaaggaaggc
1740tttgttgacg gcgttaagaa cctctttggc ttcgggaaga aagatcagaa gcccctcgcc
1800gaaggaggag acaaggacag tgccgatgcg tctgcggatt ctgaggccga gacggaggaa
1860gctagctctg cgacaaagtc ctcctcttcc accagcacca ccaagtccgg agatgctgcc
1920gagtcaacag aggctgcaaa ggaagtcaag aagaagcagc ttgtttctat ccctgtcgaa
1980gtcacgttgg aaaaggctgg aatccctcag cttaccaagg ccgagtggac caaggccaag
2040gatcgactga aggcattcgc cgcctccgac aaggccaggc tgcagcgcga agaggccctg
2100aaccagctcg aagcattcac ttacaaggtt cgcgaccttg tcgacaacga agccttcatc
2160tccgcgtcta ccgaggcgga gcgacagacg ctctctgaaa aggctagcga agcaagtgac
2220tggctttatg aggagggcga ctcggccacg aaagatgact ttgttgctaa gctcaaggct
2280ctgcaagatc tcgtggcacc gatccagaac cgcctggacg aggctgagaa gcggcctggt
2340ctgattagcg atctgagaaa cattctcaac accacaaatg tgtttattga cactgttcgt
2400gggcagattg ctgcgtatga tgaatggaaa tccacagctt cagccaagtc ggctgaatca
2460gccacctcga gtgctgccgc cgaggcgacg accaacgact ttgaagggct cgaggatgag
2520gacgacagcc ccaaagaggc tgaggagaag cccgttccag aaaaggtcgt gcccccgctg
2580cacaactctg aggagattga cacgctcgag gttctctaca aggagactct ggagtggctg
2640aacaagctcg aacgccaaca ggcagatgtt cctctcaccg aagagcccgt gcttgttgtc
2700agcgagctgg ttgccagacg agatgcgctt gacaaggcca gcttagacct cgcgctgaag
2760agctacaccc aataccagaa gaacaagccc aagaagccca ccaagagcaa gaaggcgaag
2820aagcaggaca agacgaagag cgccgacaag gctggcccga cgtttgagtt tcccgagggc
2880agcgtgcccc tctccggcga ggagctggag gagctggtca agaagtacat gaaggaggag
2940gaggagaccc gcaggcaggc cgagggcgga caggcagagg agaagccggc ggaagataca
3000gagaagtcga gccatgacga gctctaa
302751417DNATrichoderma reesei 5atggtagcca gattgtccag catctacgcc
tgtgggctct tagcctggac gcacattgtt 60tgcgcctctc agtttagcga cccgatgcaa
ctacagaagc atcttgcaca gaatgactat 120actttaattg cttgtaagtc atgacaatat
cgccttctaa agtgtgtcaa ctcaggtaga 180aataattgct aatagtagct tacagttgtt
gctgtaagag ttgttcgggt caatatctta 240cctagtcaag tcgagactcg aggctgacct
taaggtatcg ctaccactta cagcctcaac 300tgtaagtttt ggccaggcca agtttgaacc
catctccctt aagaacaccg aacttaaaaa 360aagtcaaacg gcagagaagc cagcaaactc
ctcttagaag aatggcagac ggtccagcaa 420catgtcgcct ccaccgccac catcgactgt
ccgtccagcc ctaaactctg tcaggagatg 480gacgtcgcct cctttcccgc tattcggctc
taccgccagg atggctcagt aacacgttat 540cgagggcctc gtcggaccgc accgtgagtt
gacactttct tcgaattttg gagttaatct 600ctcaaagcat gaagtgactg actgactacc
ttacctccca ggatcgacgc ctttgtgaag 660cgtgctctca aaccatccgt gcagaatgtt
cctgggcagc aacttgccaa cttcatcacc 720aacgacgact atgtattcat cgccaagctg
caaggcgaga gcgagagcat caattctcac 780tacagggatt ttgcgcaaga gtattctgat
cgatactcgt ttggcatcat cacgagtggc 840tctgtaccct ccaatggcgt ctggtgctac
aacaacgtcg acggaaatca gcacgcggcg 900acggacttga acgatccaaa tgccttgaag
aagcttctca atctttgcac cgcggaggtc 960attccccagc ttacacgacg caatgagatg
acttatcttt ccgtatgtct tctgttctcc 1020ctcctcactt ttaaaatgtt cagtagaaga
agcttgggct tctgacccct tattccagtc 1080aggccgatcc ttggtctatt acttctccaa
caatgaagca gaccgcgaag catacgtcaa 1140agcgctcaaa cccatcgccc agcgatacgc
cgagttcctc cagttcgtca ccgtcgactc 1200tggcgagtat cccgatatgc tgcgcaatct
gggcgttcgc tccgccggag gcctggcagt 1260gcaaaacgtc cacaacggac atattttccc
cttcagagga gacgctgctg cttcgcctgg 1320acaggttgac cagttcattg tggccatctc
agaaggtagg gcgcagcctt gggatgggag 1380gtttgacgag ggacaggagg cgcatgatga
gctctga 141762174DNATrichoderma reesei
6atgcggctaa catccttctt ctctggcctg gccgcctttg gccttctgtc atctccagca
60ctggcagatg atgaagctga caacgtcccc gcgcccacat acttcgattc cgtcatggtg
120cctcccttga cagaactaac gccagacaac ttcgaaaagg aggcaagcaa aaccaagtgg
180cttcttgtga agcactacag gtactaagcc cttcagccat atcacaccac tccccgtctg
240attcaagctg acgcgtagcc gctgtctagt ccatactgcc accattgtat cagctacgcc
300ccgaccttcc agacaaccta cgaattctac tacacatcca agccagaagg agctggcgac
360acgagcttca ccgacttcta cgacttcaag tttgctgccg tgaactgtat cgcctacagc
420gacctttgcg ttgagaatgg cgtcaagcta taccccacta cggttctata cgagaacggc
480aaagaggtca aggccgtaac gggtggccag aacatcacct tcctttctga tctcatcgaa
540gaagctttgg agaagtcgaa gcctggatct cggcccaagt ctctcgcatt gccccaaccg
600ggcgacaaag agcgccccaa atctgagccc gagacagcat cgaggagcgc aaccgaggag
660aagaagccca agaagccggt tgccacgccg aacgaagacg gagtgtcagt ttccttgacg
720gccgaaaact tccagcgcct ggtgactatg actcaggatc cctggttcat caagttttac
780gcgccgtggt gcccccattg ccaagacatg gcgcctacct gggagcagct ggcgaagaac
840atgaagggca agctcaacat tggagaggtc aactgtgaca aggagtcgcg attgtgcaaa
900gacgttggtg cgcgggcgtt tcccactatc ctgttcttca agggtggaga gcgctcagag
960tacgaggggc tccgaggcct gggcgacttt atcaaatatg ccgaaaacgc cgtcgacctc
1020gctagcggag tgcctgacgt ggacttggca gcattcaagg ctctcgagca gaaggaagac
1080gtcatctttg tctactttta cgaccacgcc accacatcgg aggacttcaa tgccctcgag
1140aggctgcccc tgagtctcat cggacatgcc aaactggtta agactaagga tccggccatg
1200tacgagcgct tcaagatcac gacatggccc agattcatgg tttcgaggga gggtcgccct
1260acgtactacc ctcccctcac ccctaacgcg atgagagata cccaccaagt tctggactgg
1320atgaggtcgg tttggcttcc ccttgtcccc gaactgttgg ttaccaacgc ccgccagatc
1380atggacaaca aaattgttgt gctcggcgtc ctgaatcgag aagaccagga atccttccag
1440agtgctcttc gggagatgaa gagcgcagcc aacgagtgga tggacaggca aatccaagag
1500ttccagttgg agcggaagaa gctgcgagac gcgaagcaaa tgaggatcga ggaagctgag
1560gaccgagacg atgagcgcgc cctgcgggcc gccaaggcga tccatattga catgaacaat
1620tccggacgga gagaagtggc ctttgcgtgg gttgatggcg tagcgtggca gcgctggatt
1680cgaaccacgt atggcattga tgttaaggac ggagaaagag tcattatcaa cgaccaagat
1740gtaagcctca agctcacccc catttgtcct ccctctacaa tattgctttg cgtttcgaac
1800atgaacgact aacaaaaaca tttgaacaga gccgcaagta ctgggacagc accgtgacgg
1860gcaactacat cctcgtcagc cgcacgtcca tcctggagac gctcgacaag gtcgtctaca
1920ccccgcaggc cctcaagccc aagctcacca tttcctcttt cgagaagatc tttttcgaca
1980tccgcgtctc cttcaccgag cacccctacc tgaccctggg ctgcatcgtt ggcatcgcct
2040ttggagcctt ctcctggctg cgtggccgct ctcgccgtgg acgcggccac ttccggctcg
2100aggattccat cagcattaga gatttcaagg acgggttcct tggtggatct aacggcaaca
2160ccaaggccga ctga
217471578DNATrichoderma reesei 7atgcatcagc aaaccctcct cgccaccctc
gcggcgagtc tcgctgctct tccttttgct 60caggcgggct tctattcgaa gagctctccc
gtgctgcaag tagacgccaa gtcgtacgac 120cgcctcatca caaagtcgaa tcatacctct
gtaagtatcc gtcctcacac actcacctca 180ctcacaacgc gacatcatat ctcatacaca
tccaccccaa accaccacaa acacaagaca 240tatatcaagc tcaaacacat acacatacat
acaaacacat acacacacag atacatacac 300aactctcata tatatgaacc attcattgac
atttccccca agattgtcga attctacgcc 360ccctggtgcg gccactgcca aaacctcaag
cccgcctacg aaaaggccgc ccgcaccctc 420gacggcctgg ccaaggtcgc cgccgtcgac
tgcgacgacg acgccaacaa ggccctctgc 480ggctccctcg gcgtcaaggg cttccccacc
ctcaagatcg tccgccccgg caagaagccc 540ggccgccccg tcgtcgagga ctaccagggc
cagcgcaccg cgggcgccat tgccgacgcc 600gtcgtcgcca agatcaacaa ccacgtcgtc
aagctgacgg acaaggacat tgatgccttt 660ctggaaaagg acggcgacaa gccaaaggcc
atcttgttca cggaaaaggg aactacgagt 720gcgctgctga ggagccttgc tattgatttt
ctcgacgccg tgaccattgg ccaggtccgc 780aacaaggaaa aggctgccgt cgacaggttc
ggcatctctt cgttcccttc cttcgtcctc 840atccccggag gcggcaagga gcccgtcgtc
tacagcggcg agctcaacaa gaaggacatg 900gtcgagttcc tcaagcaggt cgccgagccc
aaccccgacc cggccccctc aaacggcaag 960tccggcaaga aggcctccac caaggacaag
gccagcagca aggaggcccc ccaaaaggcc 1020gccgccgccg acgagtcttc gtccgccgca
tcctccgaga cctcaacggc cgccgcgccg 1080gagtcgaccc tcatcgacat ccccgccctg
acttccaagg cagagctcga ggagcactgt 1140ctccaaccaa agtcccaaac ctgcgtcctc
gcctttgtgc ccgcgtccgc ctcggagatg 1200cgcaacaaga tcctttctgc cgtctcccag
ctgcacacca agtacgtcca cggaaagcgc 1260cacttcccct tcttctctgt cgacagcgac
gtcgaaggct ctgccgccct caaggaagcc 1320ctcggcctct cgggcaagat tgagctcgtt
gccctcaacg cccgccgggg gtggtggagg 1380cgatacgagg acggtgagtt cagcgttcac
agcgtcgagt cctggattga cgccgttcgc 1440atgggcgagg gcgagaagaa gaagcttccc
gagggagtcg tcgtcgagaa ggcggagccg 1500gcggaggaag caaagtctga gactgaagct
gccgcagctg atgaggccac tgagaagcct 1560gagcacgatg agctctaa
157881167DNATrichoderma reesei
8atggtcttga tcaagagcct cgtgctcgcc gtcctggcca gctcggtggc tgccaagtcg
60gccgtcatcg acctgattcc gtccaacttt gacaagcttg tcttctccgg aaagcccacg
120cttgtcgagt tttttgctcc ctggtgcggc cactgcaaga accttgctcc cgtgtacgag
180gagttggccc aggtgtttga gcatgctaag gacaaggtcc agattgcaaa ggtcgacgcc
240gactcggagc gagacctcgg aaagcggttc ggcatccagg gcttccccac gctcaagttc
300ttcgatggca agagcaagga gccgcaggag tacaagtcgg gccgtgatct ggacagcctg
360accaagttca tcactgagaa gactggtgtc aagcccaaga agaagggcga gctgcccagc
420agcgtggtga tgctgaacac taggaccttc cacgacactg ttggaggcga caagaatgtc
480ctggtagcgt tcactgctcc ttggtgtggc cgtaagtgaa gcctcgaccc ccgactgagt
540cttgattctc gcatatttac ctcttgacca gactgcaaga acctcgcccc cacttgggaa
600aaggttgcca atgacttcgc gggtgatgag aacgttgtga ttgccaaggt cgatgccgag
660ggcgctgaca gcaaggccgt cgccgaagag tacggcgtca ctggctaccc caccatcctc
720ttcttccccg ctggcaccaa gaagcaggtt gactaccaag gcggccgatc ggagggtgac
780tttgtcaact tcatcaacga gaaggccggc accttccgaa ccgagggcgg cgagctgaat
840gacatcgccg gcaccgtggc gcccctcgac accatcgtgg ccaacttcct cagcggcacc
900ggcttggccg aggctgctgc tgagatcaag gaggctgttg acctgcttac ggatgctgcg
960gagaccaagt tcgccgagta ctacgtccgc gtcttcgaca agctgagcaa gaatgagaag
1020tttgttaaca aggagcttgc gagactgcag ggcatcctgg ccaagggtgg ccttgcccct
1080tctaagcggg atgagatcca gatcaagatc aacgtcctgc gcaaatttac ccccaaggag
1140aacgaggacc agaaggacga gctgtga
116791705DNATrichoderma reesei 9atgcaacaga agcgtcttac tgctgccctg
gtggccgctt tggccgctgt ggtctctgcc 60gagtcggatg tcaagtcctt gaccaaggac
accttcaacg acttcatcaa ctccaatgac 120ctcgtcctgg ctgagtgtat gtctctctct
ctctctctcc ccccctcccc tttgccttct 180gccctctcaa gcttctgcat ctctcgaccc
ctcccccgcc agccccccgg catcgagatc 240cccgctaaca gctgcaatct tccagtcttc
gctccctggt gcggccactg caaggctctc 300gcccccgagt acgaggaggc ggccacgact
ctcaaggaca agagcatcaa gctcgccaag 360gtcgactgtg tcgaggaggc tgacctctgc
aaggagcatg gagttgaggg ctaccccacg 420ctcaaggtct tccgtggcct cgataaggtc
gctccctaca ctggtccccg caaggctgac 480gggtaagctt tgaattgcac tgttctttgc
atcaatccat tcattcgcta acgttggttg 540tcctttcagc atcacctcct acatggtgaa
gcagtccctg cctgccgtct ccgccctcac 600caaggatacc ctcgaggact tcaagaccgc
cgacaaggtc gtcctggtcg cctacatcgc 660cgccgatgac aaggcctcca acgagacctt
cactgctctg gccaacgagc tgcgtgacac 720ctacctcttt ggtggcgtca acgatgctgc
cgttgctgag gctgagggcg tcaagttccc 780ttccattgtc ctctacaagt ccttcgacga
gggcaagaac gtcttcagcg agaagttcga 840tgctgaggcc attcgcaact ttgctcaggt
tgccgccact cccctcgttg gcgaagttgg 900ccctgagacc tacgccggct acatgtctgc
cggtatccct ctggcttaca tcttcgccga 960gaccgccgag gagcgtgaga acctggccaa
gaccctcaag cccgtcgccg agaagtacaa 1020gggcaagatc aacttcgcca ccatcgacgc
caagaacttt ggctcgcacg ccggcaacat 1080caacctcaag accgacaagt tccccgcctt
tgccattcac gacattgaga agaacctcaa 1140gttccccttt gaccagtcca aggagatcac
cgagaaggac attgccgcct ttgtcgacgg 1200cttctcctct ggcaagattg aggccagcat
caagtccgag cccatccccg agacccagga 1260gggccccgtc accgttgtcg ttgcccactc
ttacaaggac attgtccttg acgacaagaa 1320ggacgtcctg attgagttct acgctccctg
gtgcggtcac tgcaaggctc tcgcccccaa 1380gtacgatgag ctcgccagcc tgtatgccaa
gagcgacttc aaggacaagg ttgtcatcgc 1440caaggttgat gccactgcca acgacgtccc
cgacgagatc cagggcttcc ccaccatcaa 1500gctctacccc gccggtgaca agaagaaccc
cgtcacctac agcggtgccc gcactgttga 1560ggacttcatc gagttcatca aggagaacgg
caagtacaag gccggcgtcg agatccccgc 1620cgagcccacc gaggaggctg aggcttccga
gtccaaggcc tctgaggagg ccaaggcttc 1680cgaggagact cacgatgagc tgtaa
170510982DNATrichoderma reesei
10atgaaggcag ccctgctcct ctccgccctg gcctcgtgcg ccattggcct cgtcgccgcc
60gccgccgagg acttcaagat cgaggtcacc caccccgtcg agtgcgaccg caagacgcaa
120aagggcgaca agctgtccat gcactaccgc ggcacgctgg ccaagacggg cgacaagttc
180gatgccagtg cgtttcttct attccctttc cctctttcct cccatttctc tcacacacca
240atgacggtcc tccttttctt ttgatctcat tgactgacaa gttttggtct acctactcta
300ggctacgatc gtaaccagcc attcaacttc aagctgggtg ctggccaggt gattaagggg
360ttcgtcttgc ccaccccccc ctaacccacc cctctcgttc ttttatgacg acgacgacga
420cgacgacgtt gggcgacgtt gaggctaacg gcttgtagat gggatcaggg tctccttgac
480atgtgcattg gcgagaagag gtaagacgaa ccgaaccaac ccaactgcgt cgctcactgc
540ctccttgggc ctctatcagg acgcaatgct gaccattaca tcaccaattc aggactctca
600cgatccctcc cgagctgggc tacggccagc gcaacatggg ccccattccc gccggctcaa
660ccctgagtac gtggctccta tcctccccta cctgaactcc caaacccaga gtttcaccca
720cgccgcatgg aaaaccaggc cgcaggctaa caacacacga tgccatacag tctttgagac
780cgagctcctc gccatcgagg gcgtcaaggc ccccgagaag aagcccgtcc ccgagacgcc
840cattgtcgag aagcccgccg aagagacaga ggagagcgtc gtcgagaagg ccgccgaggc
900agccgccagc gtggcctccg aggccgtcga cgccgccaag actgtctttg ccgacactga
960cgagggtcac ggggagctgt aa
98211809DNATrichoderma reesei 11atgctgacct ttaggcggct cttcaccacc
gccatcgtcc tggtggtggg cctgctcttc 60ttcgtcaaga cggccgaggc cgccaagggc
cccaagatca cccacaaggt cttcttcgac 120attgagcacg gcgacgagaa gctgggccgc
atcgtcctgg gcctgtacgg caagacggtc 180cccgagacgg ccgagaactt ccgggccctg
gccaccggcg agaagggctt cggctacgag 240ggctcgacct tccaccgcgt catcaagcag
tttatgattc agggcggcga ctttaccaag 300ggcgatggca ccggtggcaa gtcgagtaag
ttgcctttgg ttcccaaata agcaatcaat 360tgatcaatca attgggtggc atggcgtttg
tcactgcatc tggctctggc tctggctaac 420cttgagggct ccgtctagtc tacggcaaca
agttcaagga cgagaacttc aagctgaagc 480acaccaagaa gggcctgctg tccatggcca
acgcgggacc cgacaccaac ggctcccagt 540tcttcatcac cactgttgtt acctcgtatg
atttccccac cctccttgga agatcctgga 600taagaagtag gaccaatcta acgaacaact
taaacagatg gctcgacggc cgacacgtcg 660tcttcggcga ggttctcgag ggctacgaca
ttgttgagaa gattgaaaac gtccagaccg 720gccccggcga tcgcccagtg aagccggtca
agattgccaa gagcggcgag ctggaggttc 780cccccgaagg tattcacgtc gagctctaa
809121372DNATrichoderma reesei
12atgatactgc gcgcggcaat cttcgtcttg ctggcgctgg tatcgctggc ggtttgcgcc
60gaggactttt acaaggtatg ccgggacgca atgcctcgaa tcaagcacgg agcgtgctga
120cggacacatg acaggttcta ggagtcgaca agtctgcgtc agacaagcag ctcaagcagg
180cctatcgcca gctctccaag aagttccacc cagacaagaa cccgtacgcc ctcctacagc
240tacacgcagt ctcgccaacc ttctccaatg tgctaatcac tctactgctt ctagaggcga
300tgaaacggcg cacgagaaat tcgtgctggt gtccgaggcc tacgaagttc tgagcgattc
360cgagcttcgc aaagtctacg accgctacgg ccacgagggc gtcaagtccc accgtcaagg
420cggcggcgga ggaggaggag gcgacccctt cgacctcttc agcaggttct ttggcggcca
480tggccacttt gggagaaaca gccgcgagcc ccggggcagc aacattgagg tccgcatcga
540gatttccctc cgcgactttt acaacggcgc cacgaccgag ttccagtggg agaagcagca
600catatgcgaa aagtgcgagg gcacgggcag cgcggacgga aaggtcgaga cgtgcagcgt
660ctgcggcgga cacggggttc ggattgtcaa gcagcagctc gttcccggca tgttccagca
720gatgcagatg cgctgcgacc actgtggcgg ctcgggcaag accatcaaga acaagtgttc
780cgtctgccac ggcagccgag tcgagcgcaa gccgacgact gtcagcctga ctgtcgagag
840gggcattgct cgagatgcca aggtggtgtt tgagaacgaa gccgaccaga gccccgactg
900ggttcctggt gatctcattg tcaacctggg cgagaaggcc ccgtcatacg aagacaaccc
960cgatcgcgtc gacggcacct tcttccggcg caagggccat gacctgtact ggaccgaggt
1020tctgtcgctg cgtgaggcct ggatgggtgg ctggacgcgt aacctcacgc acctcgacaa
1080gcacgttgtg cgtcttggac gggagcgagg ccaggttgtt cagagtgggt tggtggaaac
1140cattcccggc gaaggcatgc ccatatggca cgaagaggga gagagcgtct atcacacaca
1200cgagtttgga aatctctacg tcacatacga agtcattttg ccggaccaga tggacaagaa
1260gatggagagc gagttctggg acctgtggga gaagtggcgg tccaagaatg gtgtggacct
1320gcaaaaggat ctcgggcggc ctgagccagg gcatgaccat gatgagttat ga
137213685DNATrichoderma reesei 13atggcgcgcc gccagcacct caccgcgaca
gtcctgctgg ccgtcgtgct cttcttcagc 60atcacgtacc tcctctcggg ctcgtccagc
tccaatgcgg atcgaacgcg cgaggccgta 120gtggcagagc ccaagtcgga attcaaggtg
gattttgacg gcatgccggc caacctgctg 180gagggagagt caatagcacc caagctggag
aatgcgactc tcaagtacgt ttcccgcata 240cccgaacctg ctcccatgag ccaccgacca
tggcagtgtt tcaaaggata ccagttctga 300cgcttttctg caattacata gagccgagct
cggtcgcgca acatggaaat tcatgcacac 360aatggtcgcc cgcttccccg agaagccctc
gcccgaggag cgcaagacgc tcgagacctt 420catctacctc ttcggccggc tgtacccctg
cggcgactgc gcgaggcact tccggggcct 480gctggcaaaa tatccgccgc agacgagtag
ccggaatgcg gctgccggat ggctgtgttt 540tgtgcacaac caggtcaacg agaggctgaa
gaagcccata tttgactgca acaacattgg 600cgacttttac gactgcggct gcggggacga
gaagaaggac gggaaggagg aggccaaggt 660tgatggcgaa ttggtgaagg aatag
685143407DNATrichoderma reesei
14atggtgatgc tggtggcgat cgcgctcgca tggctgggat gctcgctgct gcggccggta
60gatgccatgc gcgcagacta tctggcccag ctgcggcagg agacggtgga catgttctat
120cacggatata gcaactacat ggagcatgcg tttcccgaag acgaggtggg ttccgctgcg
180atagaagatt gttgttgggg ctgctgctat gttccagctc ccggggggtc ggattctctc
240atatagaact agacagctaa cgacttgtgc cttttccata tgcttagctg cgtcccatat
300cgtgcactcc cctgacgcga gatcgagaca atccggggcg catcagcctc aacgatgccc
360tcggcaacta ctctctgacc ctcatagaca gcctgtctac ccttgccatc ctggccggcg
420gcccgcagaa cggcccttac acgggaccgc aggctctgag cgacttccag gatggcgtgg
480ccgagtttgt gcgacactac ggagacgggc gatcggggcc ctccggcgct gggatacgtg
540ccagaggctt tgatctcgac agcaaagttc aggtctttga gaccgtcatc cggggcgtgg
600gcggtctcct tagcgcgcac ctgttcgcca ttggggagct gccgattacc ggatacgtgc
660ccaggccgga gggagtcgca ggcgatgatc ctctggagct ggcccctatt ccgtggccca
720atgggttcag gtacgatggc cagctgctga ggctcgcgct cgacctctcc gagaggctgc
780ttcccgcctt ctacacgccg acgggcattc cgtatcctcg tgtcaatctc cgcagcggca
840tcccctttta cgtcaactcg cctctccacc aaaacctggg cgaggcagtg gaggagcaga
900gtggccgtcc tgaaattacc gagacctgca gcgccggggc gggaagcctg gttctcgaat
960ttaccgtctt gagcaggctc acgggagacg ccaggtttga acaagccgcc aagcgagcat
1020tctgggaggt ctggcatcgc aggagcgaaa ttggcttgat cgggaacggc atcgacgccg
1080agcgcgggct gtggatcggc cctcacgcgg gcattggcgc gggcatggac agcttctttg
1140aatatgcgct caagagccat atcctcctct cgggcctcgg tatgcccaac gcctccacgt
1200cgcgccgaca gagcacaacc agctggctgg atccaaactc cctgcacccg ccgctgccac
1260cagagatgca cacgtcagat gccttcctcc aggcatggca tcaggcgcac gcctcggtca
1320agcggtacct gtacaccgac cggagccact tcccttatta ctccaacaac caccgtgcca
1380cgggccagcc ctatgccatg tggatcgaca gcctgggcgc cttctatccg gggctcctcg
1440ccctggccgg tgaggtggaa gaggccattg aggcgaacct cgtctacaca gccttgtgga
1500cgcggtactc tgcgctgccc gaacgctggt ccgtccgcga aggcaacgtc gaggcaggca
1560tcggctggtg gcccgggagg cccgagttca tcgagtcgac gtaccacatc taccgtgcaa
1620cccgcgaccc gtggtatctg cacgttggcg agatggtcct ccgcgacatt cggcgtcggt
1680gctatgcgga gtgcggctgg gccgggcttc aggacgtgca gacgggcgag aagcaggacc
1740gcatggagag cttcttcttg ggagagacgg caaaatacat gtacctgctg ttcgacccag
1800accatccact caacaagctg gatgccgcct acgtcttcac cacagaaggc catccgctta
1860tcataccaaa gagcaaaagg ggtagcggct ctcacaacag acaggaccgc gctcgcaaag
1920ccaagaagag ccgagacgtc gcagtctaca cctactacga tgaaagcttc acaaactctt
1980gtccggcccc tcggccgcct tcagagcatc acctgatagg ctcggccacg gcggccaggc
2040cagacttgtt ctccgtctct cgcttcacag acctgtacag aacgcccaac gtacacgggc
2100ccctggagaa ggtggagatg cgagacaaga agaagggccg ggtggttcga tacagggcca
2160cctcaaacca caccatcttc ccctggactc ttcccccagc catgctgccg gagaatggca
2220cctgcgctgc tcccccggaa cgcatcatat ccttgattga gttcccggcc aacgacatca
2280ccagtggaat cacgtcgcgg ttcggcaacc atctatcgtg gcagacgcat ctggggccaa
2340cggtcaacat tctagaggga ctgaggctcc agctcgagca ggtgtcggac cctgccacgg
2400gagaagacaa gtggaggatc acacacattg gcaacacgca gctggggcgc cacgagacag
2460tcttcttcca cgcggaacac gtaaggcatc tcaaggacga ggtgttttcc tgccgcagaa
2520ggagggacgc cgtggaaatc gagctcctgg tcgacaagcc gagcgatacc aacaacaaca
2580acacgcttgc ctcgtccgat gacgatgtag tggtagatgc aaaagcagaa gagcaagacg
2640gcatgctagc cgacgacgac ggcgacacac tcaacgcaga aacactctcc tccaactccc
2700tcttccagtc cctcctccgc gccgtctcct ccgtcttcga gcccgtctac accgccatcc
2760ccgagtccga ccccagcgcc ggcaccgcca aggtctacag tttcgacgcc tacacgtcca
2820ccggccccgg cgcgtacccc atgccgtcca tctcggacac gcccatcccc ggcaacccct
2880tttacaactt ccgcaacccg gcctccaact tcccctggtc gaccgtcttc ctcgccggcc
2940aggcctgcga gggcccgctc cccgcgtccg cgccgcgcga gcaccaggtc attgtcatgc
3000tccgcggcgg ctgctccttc agccgcaagc tggacaacat ccccagcttc tcgccccacg
3060acagggcgct gcagctcgtc gttgtcctcg acgaaccgcc gccgccgccg ccgccgccgc
3120cagccagtca gaacagcggc ggcgatgacg acgatgaaga tgacgaagac gaccacgacg
3180ccgtcaacga caacgaagac gacaggcgcg acgtgacgcg gccactgctc gacacggagc
3240agaccacgcc caagggcatg aagcgcctgc acggcatccc aatggtcctc gtccgagccg
3300cgcggggcga ctacgagctt ttcgggcatg ccattggcgt gggcatgagg cgcaagtatc
3360gggttgaaag ccaggggctt gtcgtggaga atgcggttgt gctgtga
3407151221DNATrichoderma reesei 15atgaggcctc tggcactcat atttgccctc
atcttgggcc tattgctctg cttagcagcc 60ccagcaacgg catcgtcatc atcatcacaa
cactctcccc aagcggcatc agacgagtca 120gatttaatat gtcacacatc aaacccagac
gaatgctatc cccgggtctt cgtaccaacg 180catgagttcc agccagtcca cgacgaccag
caactcccaa acggcctcca tgtccgtctc 240aacatctgga ccggccaaaa ggaagccaag
atcaacgtcc ccgatgaggc caaccctgat 300ctcgatggcc tgcccgtcga ccaagccgtg
gttctcgtcg accaggagca gccagaaatt 360atccagatcc ccaagggcgc accaaaatac
gacaatgtcg gcaagatcaa ggaacccgcg 420caagaaggag acgcccaaac ggaagccatt
gcttttgcag agacgttcaa catgctcaag 480accggcaagt cgccaagcgc cgaggagttc
gacaacggac tggaaggcct ggaggagctc 540tcccacgaca tctactacgg gctcaaaatc
acagaggacg cggacgtggt caaggcgcta 600ttctgcttga tgggggctcg cgacggcgac
gcctcggagg gagccacgcc gcgcgaccag 660caagcggccg cgatcctcgc cggcgccctg
tccaacaatc cgtcggcact cgccgagata 720gccaagatct ggcctgagct tctggactcg
tcgtgtcctc gcgacggcgc caccatctct 780gaccgtttct accaagacac cgtctccgtt
gccgactctc cggcaaaggt caaggccgcc 840gtctcggcca tcaacggcct gatcaaggac
ggcgccatcc gaaagcagtt tctcgaaaac 900agcggcatga agcagctcct ctcggtcctg
tgccaagaga agccggagtg ggcgggagcg 960cagcggaaag tcgctcagct ggtgctggac
accttcctgg acgaggacat gggcgcccag 1020cttggccagt ggcccagggg caaggcatcg
aacaacgggg tgtgtgcggc gccggagacg 1080gcgctcgatg acggatgctg ggactatcat
gcggacagga tggtgaagct gcatgggacg 1140ccgtggagca aggagttgaa gcagaggctg
ggagatgcgc gcaaggcgaa cagcaagttg 1200ccggatcatg gcgagctgta g
122116664PRTTrichoderma reesei 16Met Ala
Arg Ser Arg Ser Ser Leu Ala Leu Gly Leu Gly Leu Leu Cys 1 5
10 15 Trp Ile Thr Leu Leu Phe Ala
Pro Leu Ala Phe Val Gly Lys Ala Asn 20 25
30 Ala Ala Ser Asp Asp Ala Asp Asn Tyr Gly Thr Val
Ile Gly Ile Asp 35 40 45
Leu Gly Thr Thr Tyr Ser Cys Val Gly Val Met Gln Lys Gly Lys Val
50 55 60 Glu Ile Leu
Val Asn Asp Gln Gly Asn Arg Ile Thr Pro Ser Tyr Val 65
70 75 80 Ala Phe Thr Asp Glu Glu Arg
Leu Val Gly Asp Ser Ala Lys Asn Gln 85
90 95 Ala Ala Ala Asn Pro Thr Asn Thr Val Tyr Asp
Val Lys Arg Leu Ile 100 105
110 Gly Arg Lys Phe Asp Glu Lys Glu Ile Gln Ala Asp Ile Lys His
Phe 115 120 125 Pro
Tyr Lys Val Ile Glu Lys Asn Gly Lys Pro Val Val Gln Val Gln 130
135 140 Val Asn Gly Gln Lys Lys
Gln Phe Thr Pro Glu Glu Ile Ser Ala Met 145 150
155 160 Ile Leu Gly Lys Met Lys Glu Val Ala Glu Ser
Tyr Leu Gly Lys Lys 165 170
175 Val Thr His Ala Val Val Thr Val Pro Ala Tyr Phe Asn Asp Asn Gln
180 185 190 Arg Gln
Ala Thr Lys Asp Ala Gly Thr Ile Ala Gly Leu Asn Val Leu 195
200 205 Arg Ile Val Asn Glu Pro Thr
Ala Ala Ala Ile Ala Tyr Gly Leu Asp 210 215
220 Lys Thr Asp Gly Glu Arg Gln Ile Ile Val Tyr Asp
Leu Gly Gly Gly 225 230 235
240 Thr Phe Asp Val Ser Leu Leu Ser Ile Asp Asn Gly Val Phe Glu Val
245 250 255 Leu Ala Thr
Ala Gly Asp Thr His Leu Gly Gly Glu Asp Phe Asp Gln 260
265 270 Arg Ile Ile Asn Tyr Leu Ala Lys
Ala Tyr Asn Lys Lys Asn Asn Val 275 280
285 Asp Ile Ser Lys Asp Leu Lys Ala Met Gly Lys Leu Lys
Arg Glu Ala 290 295 300
Glu Lys Ala Lys Arg Thr Leu Ser Ser Gln Met Ser Thr Arg Ile Glu 305
310 315 320 Ile Glu Ala Phe
Phe Glu Gly Asn Asp Phe Ser Glu Thr Leu Thr Arg 325
330 335 Ala Lys Phe Glu Glu Leu Asn Met Asp
Leu Phe Lys Lys Thr Leu Lys 340 345
350 Pro Val Glu Gln Val Leu Lys Asp Ala Asn Val Lys Lys Ser
Glu Val 355 360 365
Asp Asp Ile Val Leu Val Gly Gly Ser Thr Arg Ile Pro Lys Val Gln 370
375 380 Ser Leu Ile Glu Glu
Tyr Phe Asn Gly Lys Lys Ala Ser Lys Gly Ile 385 390
395 400 Asn Pro Asp Glu Ala Val Ala Phe Gly Ala
Ala Val Gln Ala Gly Val 405 410
415 Leu Ser Gly Glu Glu Gly Thr Asp Asp Ile Val Leu Met Asp Val
Asn 420 425 430 Pro
Leu Thr Leu Gly Ile Glu Thr Thr Gly Gly Val Met Thr Lys Leu 435
440 445 Ile Pro Arg Asn Thr Pro
Ile Pro Thr Arg Lys Ser Gln Ile Phe Ser 450 455
460 Thr Ala Ala Asp Asn Gln Pro Val Val Leu Ile
Gln Val Phe Glu Gly 465 470 475
480 Glu Arg Ser Met Thr Lys Asp Asn Asn Leu Leu Gly Lys Phe Glu Leu
485 490 495 Thr Gly
Ile Pro Pro Ala Pro Arg Gly Val Pro Gln Ile Glu Val Ser 500
505 510 Phe Glu Leu Asp Ala Asn Gly
Ile Leu Lys Val Ser Ala His Asp Lys 515 520
525 Gly Thr Gly Lys Gln Glu Ser Ile Thr Ile Thr Asn
Asp Lys Gly Arg 530 535 540
Leu Thr Gln Glu Glu Ile Asp Arg Met Val Ala Glu Ala Glu Lys Phe 545
550 555 560 Ala Glu Glu
Asp Lys Ala Thr Arg Glu Arg Ile Glu Ala Arg Asn Gly 565
570 575 Leu Glu Asn Tyr Ala Phe Ser Leu
Lys Asn Gln Val Asn Asp Glu Glu 580 585
590 Gly Leu Gly Gly Lys Ile Asp Glu Glu Asp Lys Glu Thr
Ile Leu Asp 595 600 605
Ala Val Lys Glu Ala Thr Glu Trp Leu Glu Glu Asn Gly Ala Asp Ala 610
615 620 Thr Thr Glu Asp
Phe Glu Glu Gln Lys Glu Lys Leu Ser Asn Val Ala 625 630
635 640 Tyr Pro Ile Thr Ser Lys Met Tyr Gln
Gly Ala Gly Gly Ser Glu Asp 645 650
655 Asp Gly Asp Phe His Asp Glu Leu 660
17558PRTTrichoderma reesei 17Met Lys Phe Asn Thr Val Ala Ala Ala
Ala Ala Leu Leu Ala Gly Val 1 5 10
15 Ala Tyr Ala Glu Asp Val Glu Glu Ser Lys Ala Val Pro Glu
Leu Pro 20 25 30
Thr Phe Thr Pro Thr Ser Ile Lys Ala Asp Phe Leu Glu Gln Phe Thr
35 40 45 Asp Asp Trp Glu
Ser Arg Trp Lys Pro Ser His Ala Lys Lys Asp Thr 50
55 60 Ser Gly Ser Asp Lys Asp Ala Glu
Glu Glu Trp Ala Tyr Val Gly Glu 65 70
75 80 Trp Ala Val Glu Glu Pro Tyr Gln Tyr Lys Gly Ile
Asn Gly Asp Lys 85 90
95 Gly Leu Val Val Lys Asn Pro Ala Ala His His Ala Ile Ser Ala Lys
100 105 110 Phe Pro Lys
Lys Ile Asp Asn Lys Gly Lys Thr Leu Val Val Gln Tyr 115
120 125 Glu Val Lys Leu Gln Lys Gly Leu
Asp Cys Gly Gly Ala Tyr Met Lys 130 135
140 Leu Leu Arg Asp Asn Lys Ala Leu His Gln Asp Glu Phe
Ser Asn Thr 145 150 155
160 Thr Pro Tyr Val Ile Met Phe Gly Pro Asp Lys Cys Gly His Asn Asn
165 170 175 Arg Val His Phe
Ile Val Asn His Lys Asn Pro Lys Thr Gly Glu Tyr 180
185 190 Glu Glu Lys His Leu Asn Ser Ala Pro
Ala Val Asn Ile Val Lys Thr 195 200
205 Thr Glu Leu Tyr Thr Leu Ile Val His Pro Asn Asn Thr Phe
Ser Ile 210 215 220
Lys Gln Asn Gly Val Glu Thr Lys Ala Gly Ser Leu Leu Glu Asp Leu 225
230 235 240 Ser Pro Pro Ile Asn
Pro Pro Lys Glu Ile Asp Asp Pro Lys Asp Ser 245
250 255 Lys Pro Asp Asp Trp Val Asp Glu Ala Arg
Ile Pro Asp Pro Glu Ala 260 265
270 Val Lys Pro Glu Asp Trp Asp Glu Asp Ala Pro Phe Glu Ile Val
Asp 275 280 285 Glu
Glu Ala Val Lys Pro Glu Asp Trp Leu Glu Asp Glu Pro Thr Thr 290
295 300 Ile Pro Asp Pro Glu Ala
Gln Lys Pro Glu Asp Trp Asp Asp Glu Glu 305 310
315 320 Asp Gly Asp Trp Ile Pro Pro Thr Val Pro Asn
Pro Lys Cys Glu Asp 325 330
335 Val Ser Gly Cys Gly Pro Trp Thr Lys Pro Met Val Arg Asn Pro Asn
340 345 350 Tyr Lys
Gly Lys Trp Thr Ala Pro Tyr Ile Asp Asn Pro Ala Tyr Lys 355
360 365 Gly Val Trp Ala Pro Arg Lys
Ile Lys Asn Pro Asp Tyr Phe Glu Asp 370 375
380 Lys Thr Pro Ala Asn Phe Glu Pro Met Gly Ala Ile
Gly Phe Glu Ile 385 390 395
400 Trp Thr Met Thr Asn Asp Ile Leu Phe Asp Asn Ile Tyr Ile Gly His
405 410 415 Ser Ile Glu
Asp Ala Glu Lys Leu Ala Asn Glu Thr Phe Phe Val Lys 420
425 430 His Pro Ile Glu Lys Ala Leu Ala
Glu Ala Asp Glu Pro Lys Phe Asp 435 440
445 Asp Thr Pro Lys Ser Pro Ser Asp Leu Lys Phe Leu Asp
Asp Pro Val 450 455 460
Thr Phe Val Lys Glu Lys Leu Asp Leu Phe Leu Thr Ile Ala Gln Arg 465
470 475 480 Asp Pro Val Glu
Ala Ile Lys Phe Val Pro Glu Val Ala Gly Gly Ile 485
490 495 Ala Ala Val Phe Val Thr Leu Ile Ala
Ile Ile Val Gly Leu Val Gly 500 505
510 Leu Gly Ser Ser Ser Ala Ala Pro Lys Lys Ala Ala Ala Thr
Ala Lys 515 520 525
Glu Lys Ala Lys Asp Val Ser Glu Ala Val Ala Ser Gly Ala Asp Lys 530
535 540 Val Lys Gly Glu Val
Thr Lys Arg Thr Thr Arg Ser Gln Ser 545 550
555 18585PRTTrichoderma reesei 18Met Lys Ser Ala Ser Lys
Leu Phe Phe Leu Ser Val Phe Ser Leu Trp 1 5
10 15 Ala Thr Pro Gly Ala Cys Ser Ser Ser Ser Ser
Thr Cys Thr Phe Ser 20 25
30 Pro Asn Ala Ile Ile Asp Asp Gly Cys Val Ser Tyr Ala Thr Leu
Asp 35 40 45 Arg
Leu Asn Val Lys Val Lys Pro Ala Ile Asp Glu Leu Val Gln Thr 50
55 60 Thr Asp Phe Phe Ser His
Tyr Arg Leu Asn Leu Phe Asn Lys Lys Cys 65 70
75 80 Pro Phe Trp Asn Asp Glu Asp Gly Met Cys Gly
Asn Ile Ala Cys Ala 85 90
95 Val Glu Thr Leu Asp Asn Glu Glu Asp Ile Pro Glu Ile Trp Arg Ala
100 105 110 His Glu
Leu Ser Lys Leu Glu Gly Pro Arg Ala Lys His Pro Gly Lys 115
120 125 Gln Glu Gln Arg Gln Asn Pro
Glu Arg Pro Leu Gln Gly Glu Leu Gly 130 135
140 Glu Asp Val Gly Glu Ser Cys Val Val Glu Tyr Asp
Asp Glu Cys Asp 145 150 155
160 Asp Arg Asp Tyr Cys Val Trp Asp Asp Glu Gly Ala Thr Ser Lys Gly
165 170 175 Asp Tyr Ile
Ser Leu Leu Arg Asn Pro Glu Arg Phe Thr Gly Tyr Gly 180
185 190 Gly Gln Ser Ala Lys Gln Val Trp
Asp Ala Ile Tyr Ser Glu Asn Cys 195 200
205 Phe Lys Lys Ser Ser Phe Pro Lys Ser Ala Asp Leu Gly
Val Ser His 210 215 220
Arg Pro Thr Glu Ala Ala Ala Leu Asp Phe Lys Gln Val Leu Asp Thr 225
230 235 240 Ala Gly Arg Gln
Ala Gln Leu Glu Gln Gln Arg Gln Ser Asn Pro Asn 245
250 255 Ile Pro Phe Val Ala Asn Thr Gly Tyr
Glu Val Asp Asp Glu Cys Leu 260 265
270 Glu Lys Arg Val Phe Tyr Arg Val Val Ser Gly Met His Ala
Ser Ile 275 280 285
Ser Val His Leu Cys Trp Asp Phe Leu Asn Gln Ser Thr Gly Gln Trp 290
295 300 Gln Pro Asn Leu Asp
Cys Tyr Glu Ser Arg Leu His Lys Phe Pro Asp 305 310
315 320 Arg Ile Ser Asn Leu Tyr Phe Asn Tyr Ala
Leu Val Thr Arg Ala Ile 325 330
335 Ala Lys Leu Gly Pro Tyr Val Leu Ser Pro Gln Tyr Thr Phe Cys
Thr 340 345 350 Gly
Asp Pro Leu Gln Asp Gln Glu Thr Arg Asp Lys Ile Ala Ala Val 355
360 365 Thr Lys His Ala Ala Ser
Val Pro Gln Ile Phe Asp Glu Gly Val Met 370 375
380 Phe Val Asn Gly Glu Gly Pro Ser Leu Lys Glu
Asp Phe Arg Asn Arg 385 390 395
400 Phe Arg Asn Ile Ser Arg Val Met Asp Cys Val Gly Cys Asp Lys Cys
405 410 415 Arg Leu
Trp Gly Lys Ile Gln Thr Ser Gly Tyr Gly Thr Ala Leu Lys 420
425 430 Ile Leu Phe Glu Phe Asn Glu
Gly Gln Lys Pro Pro Pro Leu Lys Arg 435 440
445 Thr Glu Leu Val Ala Leu Phe Asn Thr Tyr Ala Arg
Leu Ser Ser Ser 450 455 460
Val Ala Ala Val Gly Arg Phe Arg Ala Met Ile Asp Met Arg Asp Lys 465
470 475 480 Met Ala Ser
Lys Pro Asp Phe Lys Pro Glu Asp Leu Tyr Thr Leu Ile 485
490 495 Asp Glu Ala Asp Glu Asp Met Asp
Glu Phe Ile Arg Met Gln Asn Arg 500 505
510 Gly Ser His Gly Asp Thr Leu Gly Glu Gln Val Gly Asn
Glu Phe Ala 515 520 525
Arg Val Met Met Ala Val Lys Ile Val Leu Lys Ser Trp Ile Arg Thr 530
535 540 Pro Lys Met Ile
Trp Gln Ile Val Ser Glu Glu Thr Ser Arg Leu Tyr 545 550
555 560 Arg Ala Trp Val Gly Leu Pro Ala Arg
Pro Arg Arg Tyr Ala Phe Arg 565 570
575 Leu Pro Asn Leu Asn Arg Asp Glu Leu 580
585 191008PRTTrichoderma reesei 19Met Lys Ser Pro Arg Lys Ser
Pro Leu Leu Lys Leu Leu Gly Ala Ala 1 5
10 15 Phe Leu Phe Ser Thr Asn Val Leu Ala Ile Ser
Ala Val Leu Gly Val 20 25
30 Asp Leu Gly Thr Glu Tyr Ile Lys Ala Ala Leu Val Lys Pro Gly
Ile 35 40 45 Pro
Leu Glu Ile Val Leu Thr Lys Asp Ser Arg Arg Lys Glu Thr Ser 50
55 60 Ala Val Ala Phe Lys Pro
Ala Lys Gly Ala Leu Pro Glu Gly Gln Tyr 65 70
75 80 Pro Glu Arg Ser Tyr Gly Ala Asp Ala Met Ala
Leu Ala Ala Arg Phe 85 90
95 Pro Gly Glu Val Tyr Pro Asn Leu Lys Pro Leu Leu Gly Leu Pro Val
100 105 110 Gly Asp
Ala Ile Val Gln Glu Tyr Ala Ala Arg His Pro Ala Leu Lys 115
120 125 Leu Gln Ala His Pro Thr Arg
Gly Thr Ala Ala Phe Lys Thr Glu Thr 130 135
140 Leu Ser Pro Glu Glu Glu Ala Trp Met Val Glu Glu
Leu Leu Ala Met 145 150 155
160 Glu Leu Gln Ser Ile Gln Lys Asn Ala Glu Val Thr Ala Gly Gly Asp
165 170 175 Ser Ser Ile
Arg Ser Ile Val Leu Thr Val Pro Pro Phe Tyr Thr Ile 180
185 190 Glu Glu Lys Arg Ala Leu Gln Met
Ala Ala Glu Leu Ala Gly Phe Lys 195 200
205 Val Leu Ser Leu Val Ser Asp Gly Leu Ala Val Gly Leu
Asn Tyr Ala 210 215 220
Thr Ser Arg Gln Phe Pro Asn Ile Asn Glu Gly Ala Lys Pro Glu Tyr 225
230 235 240 His Leu Val Phe
Asp Met Gly Ala Gly Ser Thr Thr Ala Thr Val Met 245
250 255 Arg Phe Gln Ser Arg Thr Val Lys Asp
Val Gly Lys Phe Asn Lys Thr 260 265
270 Val Gln Glu Ile Gln Val Leu Gly Ser Gly Trp Asp Arg Thr
Leu Gly 275 280 285
Gly Asp Ser Leu Asn Ser Leu Ile Ile Asp Asp Met Ile Ala Gln Phe 290
295 300 Val Glu Ser Lys Gly
Ala Gln Lys Ile Ser Ala Thr Ala Glu Gln Val 305 310
315 320 Gln Ser His Gly Arg Ala Val Ala Lys Leu
Ser Lys Glu Ala Glu Arg 325 330
335 Leu Arg His Val Leu Ser Ala Asn Gln Asn Thr Gln Ala Ser Phe
Glu 340 345 350 Gly
Leu Tyr Glu Asp Val Asp Phe Lys Tyr Lys Ile Ser Arg Ala Asp 355
360 365 Phe Glu Thr Met Ala Lys
Ala His Val Glu Arg Val Asn Ala Ala Ile 370 375
380 Lys Asp Ala Leu Lys Ala Ala Asn Leu Glu Ile
Gly Asp Leu Thr Ser 385 390 395
400 Val Ile Leu His Gly Gly Ala Thr Arg Thr Pro Phe Val Arg Glu Ala
405 410 415 Ile Glu
Lys Ala Leu Gly Ser Gly Asp Lys Ile Arg Thr Asn Val Asn 420
425 430 Ser Asp Glu Ala Ala Val Phe
Gly Ala Ala Phe Arg Ala Ala Glu Leu 435 440
445 Ser Pro Ser Phe Arg Val Lys Glu Ile Arg Ile Ser
Glu Gly Ala Asn 450 455 460
Tyr Ala Ala Gly Ile Thr Trp Lys Ala Ala Asn Gly Lys Val His Arg 465
470 475 480 Gln Arg Leu
Trp Thr Ala Pro Ser Pro Leu Gly Gly Pro Ala Lys Glu 485
490 495 Ile Thr Phe Thr Glu Gln Glu Asp
Phe Thr Gly Leu Phe Tyr Gln Gln 500 505
510 Val Asp Thr Glu Asp Lys Pro Val Lys Ser Phe Ser Thr
Lys Asn Leu 515 520 525
Thr Ala Ser Val Ala Ala Leu Lys Glu Lys Tyr Pro Thr Cys Ala Asp 530
535 540 Thr Gly Val Gln
Phe Lys Ala Ala Ala Lys Leu Arg Thr Glu Asn Gly 545 550
555 560 Glu Val Ala Ile Val Lys Ala Phe Val
Glu Cys Glu Ala Glu Val Val 565 570
575 Glu Lys Glu Gly Phe Val Asp Gly Val Lys Asn Leu Phe Gly
Phe Gly 580 585 590
Lys Lys Asp Gln Lys Pro Leu Ala Glu Gly Gly Asp Lys Asp Ser Ala
595 600 605 Asp Ala Ser Ala
Asp Ser Glu Ala Glu Thr Glu Glu Ala Ser Ser Ala 610
615 620 Thr Lys Ser Ser Ser Ser Thr Ser
Thr Thr Lys Ser Gly Asp Ala Ala 625 630
635 640 Glu Ser Thr Glu Ala Ala Lys Glu Val Lys Lys Lys
Gln Leu Val Ser 645 650
655 Ile Pro Val Glu Val Thr Leu Glu Lys Ala Gly Ile Pro Gln Leu Thr
660 665 670 Lys Ala Glu
Trp Thr Lys Ala Lys Asp Arg Leu Lys Ala Phe Ala Ala 675
680 685 Ser Asp Lys Ala Arg Leu Gln Arg
Glu Glu Ala Leu Asn Gln Leu Glu 690 695
700 Ala Phe Thr Tyr Lys Val Arg Asp Leu Val Asp Asn Glu
Ala Phe Ile 705 710 715
720 Ser Ala Ser Thr Glu Ala Glu Arg Gln Thr Leu Ser Glu Lys Ala Ser
725 730 735 Glu Ala Ser Asp
Trp Leu Tyr Glu Glu Gly Asp Ser Ala Thr Lys Asp 740
745 750 Asp Phe Val Ala Lys Leu Lys Ala Leu
Gln Asp Leu Val Ala Pro Ile 755 760
765 Gln Asn Arg Leu Asp Glu Ala Glu Lys Arg Pro Gly Leu Ile
Ser Asp 770 775 780
Leu Arg Asn Ile Leu Asn Thr Thr Asn Val Phe Ile Asp Thr Val Arg 785
790 795 800 Gly Gln Ile Ala Ala
Tyr Asp Glu Trp Lys Ser Thr Ala Ser Ala Lys 805
810 815 Ser Ala Glu Ser Ala Thr Ser Ser Ala Ala
Ala Glu Ala Thr Thr Asn 820 825
830 Asp Phe Glu Gly Leu Glu Asp Glu Asp Asp Ser Pro Lys Glu Ala
Glu 835 840 845 Glu
Lys Pro Val Pro Glu Lys Val Val Pro Pro Leu His Asn Ser Glu 850
855 860 Glu Ile Asp Thr Leu Glu
Val Leu Tyr Lys Glu Thr Leu Glu Trp Leu 865 870
875 880 Asn Lys Leu Glu Arg Gln Gln Ala Asp Val Pro
Leu Thr Glu Glu Pro 885 890
895 Val Leu Val Val Ser Glu Leu Val Ala Arg Arg Asp Ala Leu Asp Lys
900 905 910 Ala Ser
Leu Asp Leu Ala Leu Lys Ser Tyr Thr Gln Tyr Gln Lys Asn 915
920 925 Lys Pro Lys Lys Pro Thr Lys
Ser Lys Lys Ala Lys Lys Gln Asp Lys 930 935
940 Thr Lys Ser Ala Asp Lys Ala Gly Pro Thr Phe Glu
Phe Pro Glu Gly 945 950 955
960 Ser Val Pro Leu Ser Gly Glu Glu Leu Glu Glu Leu Val Lys Lys Tyr
965 970 975 Met Lys Glu
Glu Glu Glu Thr Arg Arg Gln Ala Glu Gly Gly Gln Ala 980
985 990 Glu Glu Lys Pro Ala Glu Asp Thr
Glu Lys Ser Ser His Asp Glu Leu 995 1000
1005 20363PRTTrichoderma reesei 20Met Val Ala Arg
Leu Ser Ser Ile Tyr Ala Cys Gly Leu Leu Ala Trp 1 5
10 15 Thr His Ile Val Cys Ala Ser Gln Phe
Ser Asp Pro Met Gln Leu Gln 20 25
30 Lys His Leu Ala Gln Asn Asp Tyr Thr Leu Ile Ala Phe Val
Ala Ser 35 40 45
Arg Leu Glu Ala Asp Leu Lys Val Ser Leu Pro Leu Thr Ala Ser Thr 50
55 60 Ser Asn Gly Arg Glu
Ala Ser Lys Leu Leu Leu Glu Glu Trp Gln Thr 65 70
75 80 Val Gln Gln His Val Ala Ser Thr Ala Thr
Ile Asp Cys Pro Ser Ser 85 90
95 Pro Lys Leu Cys Gln Glu Met Asp Val Ala Ser Phe Pro Ala Ile
Arg 100 105 110 Leu
Tyr Arg Gln Asp Gly Ser Val Thr Arg Tyr Arg Gly Pro Arg Arg 115
120 125 Thr Ala Pro Ile Asp Ala
Phe Val Lys Arg Ala Leu Lys Pro Ser Val 130 135
140 Gln Asn Val Pro Gly Gln Gln Leu Ala Asn Phe
Ile Thr Asn Asp Asp 145 150 155
160 Tyr Val Phe Ile Ala Lys Leu Gln Gly Glu Ser Glu Ser Ile Asn Ser
165 170 175 His Tyr
Arg Asp Phe Ala Gln Glu Tyr Ser Asp Arg Tyr Ser Phe Gly 180
185 190 Ile Ile Thr Ser Gly Ser Val
Pro Ser Asn Gly Val Trp Cys Tyr Asn 195 200
205 Asn Val Asp Gly Asn Gln His Ala Ala Thr Asp Leu
Asn Asp Pro Asn 210 215 220
Ala Leu Lys Lys Leu Leu Asn Leu Cys Thr Ala Glu Val Ile Pro Gln 225
230 235 240 Leu Thr Arg
Arg Asn Glu Met Thr Tyr Leu Ser Ser Gly Arg Ser Leu 245
250 255 Val Tyr Tyr Phe Ser Asn Asn Glu
Ala Asp Arg Glu Ala Tyr Val Lys 260 265
270 Ala Leu Lys Pro Ile Ala Gln Arg Tyr Ala Glu Phe Leu
Gln Phe Val 275 280 285
Thr Val Asp Ser Gly Glu Tyr Pro Asp Met Leu Arg Asn Leu Gly Val 290
295 300 Arg Ser Ala Gly
Gly Leu Ala Val Gln Asn Val His Asn Gly His Ile 305 310
315 320 Phe Pro Phe Arg Gly Asp Ala Ala Ala
Ser Pro Gly Gln Val Asp Gln 325 330
335 Phe Ile Val Ala Ile Ser Glu Gly Arg Ala Gln Pro Trp Asp
Gly Arg 340 345 350
Phe Asp Glu Gly Gln Glu Ala His Asp Glu Leu 355
360 21688PRTTrichoderma reesei 21Met Arg Leu Thr Ser Phe Phe
Ser Gly Leu Ala Ala Phe Gly Leu Leu 1 5
10 15 Ser Ser Pro Ala Leu Ala Asp Asp Glu Ala Asp
Asn Val Pro Ala Pro 20 25
30 Thr Tyr Phe Asp Ser Val Met Val Pro Pro Leu Thr Glu Leu Thr
Pro 35 40 45 Asp
Asn Phe Glu Lys Glu Ala Ser Lys Thr Lys Trp Leu Leu Val Lys 50
55 60 His Tyr Ser Pro Tyr Cys
His His Cys Ile Ser Tyr Ala Pro Thr Phe 65 70
75 80 Gln Thr Thr Tyr Glu Phe Tyr Tyr Thr Ser Lys
Pro Glu Gly Ala Gly 85 90
95 Asp Thr Ser Phe Thr Asp Phe Tyr Asp Phe Lys Phe Ala Ala Val Asn
100 105 110 Cys Ile
Ala Tyr Ser Asp Leu Cys Val Glu Asn Gly Val Lys Leu Tyr 115
120 125 Pro Thr Thr Val Leu Tyr Glu
Asn Gly Lys Glu Val Lys Ala Val Thr 130 135
140 Gly Gly Gln Asn Ile Thr Phe Leu Ser Asp Leu Ile
Glu Glu Ala Leu 145 150 155
160 Glu Lys Ser Lys Pro Gly Ser Arg Pro Lys Ser Leu Ala Leu Pro Gln
165 170 175 Pro Gly Asp
Lys Glu Arg Pro Lys Ser Glu Pro Glu Thr Ala Ser Arg 180
185 190 Ser Ala Thr Glu Glu Lys Lys Pro
Lys Lys Pro Val Ala Thr Pro Asn 195 200
205 Glu Asp Gly Val Ser Val Ser Leu Thr Ala Glu Asn Phe
Gln Arg Leu 210 215 220
Val Thr Met Thr Gln Asp Pro Trp Phe Ile Lys Phe Tyr Ala Pro Trp 225
230 235 240 Cys Pro His Cys
Gln Asp Met Ala Pro Thr Trp Glu Gln Leu Ala Lys 245
250 255 Asn Met Lys Gly Lys Leu Asn Ile Gly
Glu Val Asn Cys Asp Lys Glu 260 265
270 Ser Arg Leu Cys Lys Asp Val Gly Ala Arg Ala Phe Pro Thr
Ile Leu 275 280 285
Phe Phe Lys Gly Gly Glu Arg Ser Glu Tyr Glu Gly Leu Arg Gly Leu 290
295 300 Gly Asp Phe Ile Lys
Tyr Ala Glu Asn Ala Val Asp Leu Ala Ser Gly 305 310
315 320 Val Pro Asp Val Asp Leu Ala Ala Phe Lys
Ala Leu Glu Gln Lys Glu 325 330
335 Asp Val Ile Phe Val Tyr Phe Tyr Asp His Ala Thr Thr Ser Glu
Asp 340 345 350 Phe
Asn Ala Leu Glu Arg Leu Pro Leu Ser Leu Ile Gly His Ala Lys 355
360 365 Leu Val Lys Thr Lys Asp
Pro Ala Met Tyr Glu Arg Phe Lys Ile Thr 370 375
380 Thr Trp Pro Arg Phe Met Val Ser Arg Glu Gly
Arg Pro Thr Tyr Tyr 385 390 395
400 Pro Pro Leu Thr Pro Asn Ala Met Arg Asp Thr His Gln Val Leu Asp
405 410 415 Trp Met
Arg Ser Val Trp Leu Pro Leu Val Pro Glu Leu Leu Val Thr 420
425 430 Asn Ala Arg Gln Ile Met Asp
Asn Lys Ile Val Val Leu Gly Val Leu 435 440
445 Asn Arg Glu Asp Gln Glu Ser Phe Gln Ser Ala Leu
Arg Glu Met Lys 450 455 460
Ser Ala Ala Asn Glu Trp Met Asp Arg Gln Ile Gln Glu Phe Gln Leu 465
470 475 480 Glu Arg Lys
Lys Leu Arg Asp Ala Lys Gln Met Arg Ile Glu Glu Ala 485
490 495 Glu Asp Arg Asp Asp Glu Arg Ala
Leu Arg Ala Ala Lys Ala Ile His 500 505
510 Ile Asp Met Asn Asn Ser Gly Arg Arg Glu Val Ala Phe
Ala Trp Val 515 520 525
Asp Gly Val Ala Trp Gln Arg Trp Ile Arg Thr Thr Tyr Gly Ile Asp 530
535 540 Val Lys Asp Gly
Glu Arg Val Ile Ile Asn Asp Gln Asp Val Ser Leu 545 550
555 560 Lys Leu Thr Pro Ile Cys Pro Pro Ser
Thr Ile Leu Leu Cys Ser Arg 565 570
575 Lys Tyr Trp Asp Ser Thr Val Thr Gly Asn Tyr Ile Leu Val
Ser Arg 580 585 590
Thr Ser Ile Leu Glu Thr Leu Asp Lys Val Val Tyr Thr Pro Gln Ala
595 600 605 Leu Lys Pro Lys
Leu Thr Ile Ser Ser Phe Glu Lys Ile Phe Phe Asp 610
615 620 Ile Arg Val Ser Phe Thr Glu His
Pro Tyr Leu Thr Leu Gly Cys Ile 625 630
635 640 Val Gly Ile Ala Phe Gly Ala Phe Ser Trp Leu Arg
Gly Arg Ser Arg 645 650
655 Arg Gly Arg Gly His Phe Arg Leu Glu Asp Ser Ile Ser Ile Arg Asp
660 665 670 Phe Lys Asp
Gly Phe Leu Gly Gly Ser Asn Gly Asn Thr Lys Ala Asp 675
680 685 22461PRTTrichoderma reesei
22Met His Gln Gln Thr Leu Leu Ala Thr Leu Ala Ala Ser Leu Ala Ala 1
5 10 15 Leu Pro Phe Ala
Gln Ala Gly Phe Tyr Ser Lys Ser Ser Pro Val Leu 20
25 30 Gln Val Asp Ala Lys Ser Tyr Asp Arg
Leu Ile Thr Lys Ser Asn His 35 40
45 Thr Ser Ile Val Glu Phe Tyr Ala Pro Trp Cys Gly His Cys
Gln Asn 50 55 60
Leu Lys Pro Ala Tyr Glu Lys Ala Ala Arg Thr Leu Asp Gly Leu Ala 65
70 75 80 Lys Val Ala Ala Val
Asp Cys Asp Asp Asp Ala Asn Lys Ala Leu Cys 85
90 95 Gly Ser Leu Gly Val Lys Gly Phe Pro Thr
Leu Lys Ile Val Arg Pro 100 105
110 Gly Lys Lys Pro Gly Arg Pro Val Val Glu Asp Tyr Gln Gly Gln
Arg 115 120 125 Thr
Ala Gly Ala Ile Ala Asp Ala Val Val Ala Lys Ile Asn Asn His 130
135 140 Val Val Lys Leu Thr Asp
Lys Asp Ile Asp Ala Phe Leu Glu Lys Asp 145 150
155 160 Gly Asp Lys Pro Lys Ala Ile Leu Phe Thr Glu
Lys Gly Thr Thr Ser 165 170
175 Ala Leu Leu Arg Ser Leu Ala Ile Asp Phe Leu Asp Ala Val Thr Ile
180 185 190 Gly Gln
Val Arg Asn Lys Glu Lys Ala Ala Val Asp Arg Phe Gly Ile 195
200 205 Ser Ser Phe Pro Ser Phe Val
Leu Ile Pro Gly Gly Gly Lys Glu Pro 210 215
220 Val Val Tyr Ser Gly Glu Leu Asn Lys Lys Asp Met
Val Glu Phe Leu 225 230 235
240 Lys Gln Val Ala Glu Pro Asn Pro Asp Pro Ala Pro Ser Asn Gly Lys
245 250 255 Ser Gly Lys
Lys Ala Ser Thr Lys Asp Lys Ala Ser Ser Lys Glu Ala 260
265 270 Pro Gln Lys Ala Ala Ala Ala Asp
Glu Ser Ser Ser Ala Ala Ser Ser 275 280
285 Glu Thr Ser Thr Ala Ala Ala Pro Glu Ser Thr Leu Ile
Asp Ile Pro 290 295 300
Ala Leu Thr Ser Lys Ala Glu Leu Glu Glu His Cys Leu Gln Pro Lys 305
310 315 320 Ser Gln Thr Cys
Val Leu Ala Phe Val Pro Ala Ser Ala Ser Glu Met 325
330 335 Arg Asn Lys Ile Leu Ser Ala Val Ser
Gln Leu His Thr Lys Tyr Val 340 345
350 His Gly Lys Arg His Phe Pro Phe Phe Ser Val Asp Ser Asp
Val Glu 355 360 365
Gly Ser Ala Ala Leu Lys Glu Ala Leu Gly Leu Ser Gly Lys Ile Glu 370
375 380 Leu Val Ala Leu Asn
Ala Arg Arg Gly Trp Trp Arg Arg Tyr Glu Asp 385 390
395 400 Gly Glu Phe Ser Val His Ser Val Glu Ser
Trp Ile Asp Ala Val Arg 405 410
415 Met Gly Glu Gly Glu Lys Lys Lys Leu Pro Glu Gly Val Val Val
Glu 420 425 430 Lys
Ala Glu Pro Ala Glu Glu Ala Lys Ser Glu Thr Glu Ala Ala Ala 435
440 445 Ala Asp Glu Ala Thr Glu
Lys Pro Glu His Asp Glu Leu 450 455
460 23368PRTTrichoderma reesei 23Met Val Leu Ile Lys Ser Leu Val Leu
Ala Val Leu Ala Ser Ser Val 1 5 10
15 Ala Ala Lys Ser Ala Val Ile Asp Leu Ile Pro Ser Asn Phe
Asp Lys 20 25 30
Leu Val Phe Ser Gly Lys Pro Thr Leu Val Glu Phe Phe Ala Pro Trp
35 40 45 Cys Gly His Cys
Lys Asn Leu Ala Pro Val Tyr Glu Glu Leu Ala Gln 50
55 60 Val Phe Glu His Ala Lys Asp Lys
Val Gln Ile Ala Lys Val Asp Ala 65 70
75 80 Asp Ser Glu Arg Asp Leu Gly Lys Arg Phe Gly Ile
Gln Gly Phe Pro 85 90
95 Thr Leu Lys Phe Phe Asp Gly Lys Ser Lys Glu Pro Gln Glu Tyr Lys
100 105 110 Ser Gly Arg
Asp Leu Asp Ser Leu Thr Lys Phe Ile Thr Glu Lys Thr 115
120 125 Gly Val Lys Pro Lys Lys Lys Gly
Glu Leu Pro Ser Ser Val Val Met 130 135
140 Leu Asn Thr Arg Thr Phe His Asp Thr Val Gly Gly Asp
Lys Asn Val 145 150 155
160 Leu Val Ala Phe Thr Ala Pro Trp Cys Gly His Cys Lys Asn Leu Ala
165 170 175 Pro Thr Trp Glu
Lys Val Ala Asn Asp Phe Ala Gly Asp Glu Asn Val 180
185 190 Val Ile Ala Lys Val Asp Ala Glu Gly
Ala Asp Ser Lys Ala Val Ala 195 200
205 Glu Glu Tyr Gly Val Thr Gly Tyr Pro Thr Ile Leu Phe Phe
Pro Ala 210 215 220
Gly Thr Lys Lys Gln Val Asp Tyr Gln Gly Gly Arg Ser Glu Gly Asp 225
230 235 240 Phe Val Asn Phe Ile
Asn Glu Lys Ala Gly Thr Phe Arg Thr Glu Gly 245
250 255 Gly Glu Leu Asn Asp Ile Ala Gly Thr Val
Ala Pro Leu Asp Thr Ile 260 265
270 Val Ala Asn Phe Leu Ser Gly Thr Gly Leu Ala Glu Ala Ala Ala
Glu 275 280 285 Ile
Lys Glu Ala Val Asp Leu Leu Thr Asp Ala Ala Glu Thr Lys Phe 290
295 300 Ala Glu Tyr Tyr Val Arg
Val Phe Asp Lys Leu Ser Lys Asn Glu Lys 305 310
315 320 Phe Val Asn Lys Glu Leu Ala Arg Leu Gln Gly
Ile Leu Ala Lys Gly 325 330
335 Gly Leu Ala Pro Ser Lys Arg Asp Glu Ile Gln Ile Lys Ile Asn Val
340 345 350 Leu Arg
Lys Phe Thr Pro Lys Glu Asn Glu Asp Gln Lys Asp Glu Leu 355
360 365 24502PRTTrichoderma reesei
24Met Gln Gln Lys Arg Leu Thr Ala Ala Leu Val Ala Ala Leu Ala Ala 1
5 10 15 Val Val Ser Ala
Glu Ser Asp Val Lys Ser Leu Thr Lys Asp Thr Phe 20
25 30 Asn Asp Phe Ile Asn Ser Asn Asp Leu
Val Leu Ala Glu Phe Phe Ala 35 40
45 Pro Trp Cys Gly His Cys Lys Ala Leu Ala Pro Glu Tyr Glu
Glu Ala 50 55 60
Ala Thr Thr Leu Lys Asp Lys Ser Ile Lys Leu Ala Lys Val Asp Cys 65
70 75 80 Val Glu Glu Ala Asp
Leu Cys Lys Glu His Gly Val Glu Gly Tyr Pro 85
90 95 Thr Leu Lys Val Phe Arg Gly Leu Asp Lys
Val Ala Pro Tyr Thr Gly 100 105
110 Pro Arg Lys Ala Asp Gly Ile Thr Ser Tyr Met Val Lys Gln Ser
Leu 115 120 125 Pro
Ala Val Ser Ala Leu Thr Lys Asp Thr Leu Glu Asp Phe Lys Thr 130
135 140 Ala Asp Lys Val Val Leu
Val Ala Tyr Ile Ala Ala Asp Asp Lys Ala 145 150
155 160 Ser Asn Glu Thr Phe Thr Ala Leu Ala Asn Glu
Leu Arg Asp Thr Tyr 165 170
175 Leu Phe Gly Gly Val Asn Asp Ala Ala Val Ala Glu Ala Glu Gly Val
180 185 190 Lys Phe
Pro Ser Ile Val Leu Tyr Lys Ser Phe Asp Glu Gly Lys Asn 195
200 205 Val Phe Ser Glu Lys Phe Asp
Ala Glu Ala Ile Arg Asn Phe Ala Gln 210 215
220 Val Ala Ala Thr Pro Leu Val Gly Glu Val Gly Pro
Glu Thr Tyr Ala 225 230 235
240 Gly Tyr Met Ser Ala Gly Ile Pro Leu Ala Tyr Ile Phe Ala Glu Thr
245 250 255 Ala Glu Glu
Arg Glu Asn Leu Ala Lys Thr Leu Lys Pro Val Ala Glu 260
265 270 Lys Tyr Lys Gly Lys Ile Asn Phe
Ala Thr Ile Asp Ala Lys Asn Phe 275 280
285 Gly Ser His Ala Gly Asn Ile Asn Leu Lys Thr Asp Lys
Phe Pro Ala 290 295 300
Phe Ala Ile His Asp Ile Glu Lys Asn Leu Lys Phe Pro Phe Asp Gln 305
310 315 320 Ser Lys Glu Ile
Thr Glu Lys Asp Ile Ala Ala Phe Val Asp Gly Phe 325
330 335 Ser Ser Gly Lys Ile Glu Ala Ser Ile
Lys Ser Glu Pro Ile Pro Glu 340 345
350 Thr Gln Glu Gly Pro Val Thr Val Val Val Ala His Ser Tyr
Lys Asp 355 360 365
Ile Val Leu Asp Asp Lys Lys Asp Val Leu Ile Glu Phe Tyr Ala Pro 370
375 380 Trp Cys Gly His Cys
Lys Ala Leu Ala Pro Lys Tyr Asp Glu Leu Ala 385 390
395 400 Ser Leu Tyr Ala Lys Ser Asp Phe Lys Asp
Lys Val Val Ile Ala Lys 405 410
415 Val Asp Ala Thr Ala Asn Asp Val Pro Asp Glu Ile Gln Gly Phe
Pro 420 425 430 Thr
Ile Lys Leu Tyr Pro Ala Gly Asp Lys Lys Asn Pro Val Thr Tyr 435
440 445 Ser Gly Ala Arg Thr Val
Glu Asp Phe Ile Glu Phe Ile Lys Glu Asn 450 455
460 Gly Lys Tyr Lys Ala Gly Val Glu Ile Pro Ala
Glu Pro Thr Glu Glu 465 470 475
480 Ala Glu Ala Ser Glu Ser Lys Ala Ser Glu Glu Ala Lys Ala Ser Glu
485 490 495 Glu Thr
His Asp Glu Leu 500 25190PRTTrichoderma reesei 25Met
Lys Ala Ala Leu Leu Leu Ser Ala Leu Ala Ser Cys Ala Ile Gly 1
5 10 15 Leu Val Ala Ala Ala Ala
Glu Asp Phe Lys Ile Glu Val Thr His Pro 20
25 30 Val Glu Cys Asp Arg Lys Thr Gln Lys Gly
Asp Lys Leu Ser Met His 35 40
45 Tyr Arg Gly Thr Leu Ala Lys Thr Gly Asp Lys Phe Asp Ala
Ser Tyr 50 55 60
Asp Arg Asn Gln Pro Phe Asn Phe Lys Leu Gly Ala Gly Gln Val Ile 65
70 75 80 Lys Gly Trp Asp Gln
Gly Leu Leu Asp Met Cys Ile Gly Glu Lys Arg 85
90 95 Thr Leu Thr Ile Pro Pro Glu Leu Gly Tyr
Gly Gln Arg Asn Met Gly 100 105
110 Pro Ile Pro Ala Gly Ser Thr Leu Ile Phe Glu Thr Glu Leu Leu
Ala 115 120 125 Ile
Glu Gly Val Lys Ala Pro Glu Lys Lys Pro Val Pro Glu Thr Pro 130
135 140 Ile Val Glu Lys Pro Ala
Glu Glu Thr Glu Glu Ser Val Val Glu Lys 145 150
155 160 Ala Ala Glu Ala Ala Ala Ser Val Ala Ser Glu
Ala Val Asp Ala Ala 165 170
175 Lys Thr Val Phe Ala Asp Thr Asp Glu Gly His Gly Glu Leu
180 185 190 26207PRTTrichoderma
reesei 26Met Leu Thr Phe Arg Arg Leu Phe Thr Thr Ala Ile Val Leu Val Val
1 5 10 15 Gly Leu
Leu Phe Phe Val Lys Thr Ala Glu Ala Ala Lys Gly Pro Lys 20
25 30 Ile Thr His Lys Val Phe Phe
Asp Ile Glu His Gly Asp Glu Lys Leu 35 40
45 Gly Arg Ile Val Leu Gly Leu Tyr Gly Lys Thr Val
Pro Glu Thr Ala 50 55 60
Glu Asn Phe Arg Ala Leu Ala Thr Gly Glu Lys Gly Phe Gly Tyr Glu 65
70 75 80 Gly Ser Thr
Phe His Arg Val Ile Lys Gln Phe Met Ile Gln Gly Gly 85
90 95 Asp Phe Thr Lys Gly Asp Gly Thr
Gly Gly Lys Ser Ile Tyr Gly Asn 100 105
110 Lys Phe Lys Asp Glu Asn Phe Lys Leu Lys His Thr Lys
Lys Gly Leu 115 120 125
Leu Ser Met Ala Asn Ala Gly Pro Asp Thr Asn Gly Ser Gln Phe Phe 130
135 140 Ile Thr Thr Val
Val Thr Ser Trp Leu Asp Gly Arg His Val Val Phe 145 150
155 160 Gly Glu Val Leu Glu Gly Tyr Asp Ile
Val Glu Lys Ile Glu Asn Val 165 170
175 Gln Thr Gly Pro Gly Asp Arg Pro Val Lys Pro Val Lys Ile
Ala Lys 180 185 190
Ser Gly Glu Leu Glu Val Pro Pro Glu Gly Ile His Val Glu Leu 195
200 205 27413PRTTrichoderma reesei
27Met Ile Leu Arg Ala Ala Ile Phe Val Leu Leu Ala Leu Val Ser Leu 1
5 10 15 Ala Val Cys Ala
Glu Asp Phe Tyr Lys Val Leu Gly Val Asp Lys Ser 20
25 30 Ala Ser Asp Lys Gln Leu Lys Gln Ala
Tyr Arg Gln Leu Ser Lys Lys 35 40
45 Phe His Pro Asp Lys Asn Pro Gly Asp Glu Thr Ala His Glu
Lys Phe 50 55 60
Val Leu Val Ser Glu Ala Tyr Glu Val Leu Ser Asp Ser Glu Leu Arg 65
70 75 80 Lys Val Tyr Asp Arg
Tyr Gly His Glu Gly Val Lys Ser His Arg Gln 85
90 95 Gly Gly Gly Gly Gly Gly Gly Gly Asp Pro
Phe Asp Leu Phe Ser Arg 100 105
110 Phe Phe Gly Gly His Gly His Phe Gly Arg Asn Ser Arg Glu Pro
Arg 115 120 125 Gly
Ser Asn Ile Glu Val Arg Ile Glu Ile Ser Leu Arg Asp Phe Tyr 130
135 140 Asn Gly Ala Thr Thr Glu
Phe Gln Trp Glu Lys Gln His Ile Cys Glu 145 150
155 160 Lys Cys Glu Gly Thr Gly Ser Ala Asp Gly Lys
Val Glu Thr Cys Ser 165 170
175 Val Cys Gly Gly His Gly Val Arg Ile Val Lys Gln Gln Leu Val Pro
180 185 190 Gly Met
Phe Gln Gln Met Gln Met Arg Cys Asp His Cys Gly Gly Ser 195
200 205 Gly Lys Thr Ile Lys Asn Lys
Cys Ser Val Cys His Gly Ser Arg Val 210 215
220 Glu Arg Lys Pro Thr Thr Val Ser Leu Thr Val Glu
Arg Gly Ile Ala 225 230 235
240 Arg Asp Ala Lys Val Val Phe Glu Asn Glu Ala Asp Gln Ser Pro Asp
245 250 255 Trp Val Pro
Gly Asp Leu Ile Val Asn Leu Gly Glu Lys Ala Pro Ser 260
265 270 Tyr Glu Asp Asn Pro Asp Arg Val
Asp Gly Thr Phe Phe Arg Arg Lys 275 280
285 Gly His Asp Leu Tyr Trp Thr Glu Val Leu Ser Leu Arg
Glu Ala Trp 290 295 300
Met Gly Gly Trp Thr Arg Asn Leu Thr His Leu Asp Lys His Val Val 305
310 315 320 Arg Leu Gly Arg
Glu Arg Gly Gln Val Val Gln Ser Gly Leu Val Glu 325
330 335 Thr Ile Pro Gly Glu Gly Met Pro Ile
Trp His Glu Glu Gly Glu Ser 340 345
350 Val Tyr His Thr His Glu Phe Gly Asn Leu Tyr Val Thr Tyr
Glu Val 355 360 365
Ile Leu Pro Asp Gln Met Asp Lys Lys Met Glu Ser Glu Phe Trp Asp 370
375 380 Leu Trp Glu Lys Trp
Arg Ser Lys Asn Gly Val Asp Leu Gln Lys Asp 385 390
395 400 Leu Gly Arg Pro Glu Pro Gly His Asp His
Asp Glu Leu 405 410
28182PRTTrichoderma reesei 28Met Ala Arg Arg Gln His Leu Thr Ala Thr Val
Leu Leu Ala Val Val 1 5 10
15 Leu Phe Phe Ser Ile Thr Tyr Leu Leu Ser Gly Ser Ser Ser Ser Asn
20 25 30 Ala Asp
Arg Thr Arg Glu Ala Val Val Ala Glu Pro Lys Ser Glu Phe 35
40 45 Lys Val Asp Phe Asp Gly Met
Pro Ala Asn Leu Leu Glu Gly Glu Ser 50 55
60 Ile Ala Pro Lys Leu Glu Asn Ala Thr Leu Lys Ala
Glu Leu Gly Arg 65 70 75
80 Ala Thr Trp Lys Phe Met His Thr Met Val Ala Arg Phe Pro Glu Lys
85 90 95 Pro Ser Pro
Glu Glu Arg Lys Thr Leu Glu Thr Phe Ile Tyr Leu Phe 100
105 110 Gly Arg Leu Tyr Pro Cys Gly Asp
Cys Ala Arg His Phe Arg Gly Leu 115 120
125 Leu Ala Lys Tyr Pro Pro Gln Thr Ser Ser Arg Asn Ala
Ala Ala Gly 130 135 140
Trp Leu Cys Phe Val His Asn Gln Val Asn Glu Arg Leu Lys Lys Pro 145
150 155 160 Ile Phe Asp Cys
Asn Asn Ile Gly Asp Phe Tyr Asp Cys Gly Cys Gly 165
170 175 Asp Glu Lys Lys Asp Gly
180 291070PRTTrichoderma reesei 29Met Val Met Leu Val Ala Ile Ala
Leu Ala Trp Leu Gly Cys Ser Leu 1 5 10
15 Leu Arg Pro Val Asp Ala Met Arg Ala Asp Tyr Leu Ala
Gln Leu Arg 20 25 30
Gln Glu Thr Val Asp Met Phe Tyr His Gly Tyr Ser Asn Tyr Met Glu
35 40 45 His Ala Phe Pro
Glu Asp Glu Leu Arg Pro Ile Ser Cys Thr Pro Leu 50
55 60 Thr Arg Asp Arg Asp Asn Pro Gly
Arg Ile Ser Leu Asn Asp Ala Leu 65 70
75 80 Gly Asn Tyr Ser Leu Thr Leu Ile Asp Ser Leu Ser
Thr Leu Ala Ile 85 90
95 Leu Ala Gly Gly Pro Gln Asn Gly Pro Tyr Thr Gly Pro Gln Ala Leu
100 105 110 Ser Asp Phe
Gln Asp Gly Val Ala Glu Phe Val Arg His Tyr Gly Asp 115
120 125 Gly Arg Ser Gly Pro Ser Gly Ala
Gly Ile Arg Ala Arg Gly Phe Asp 130 135
140 Leu Asp Ser Lys Val Gln Val Phe Glu Thr Val Ile Arg
Gly Val Gly 145 150 155
160 Gly Leu Leu Ser Ala His Leu Phe Ala Ile Gly Glu Leu Pro Ile Thr
165 170 175 Gly Tyr Val Pro
Arg Pro Glu Gly Val Ala Gly Asp Asp Pro Leu Glu 180
185 190 Leu Ala Pro Ile Pro Trp Pro Asn Gly
Phe Arg Tyr Asp Gly Gln Leu 195 200
205 Leu Arg Leu Ala Leu Asp Leu Ser Glu Arg Leu Leu Pro Ala
Phe Tyr 210 215 220
Thr Pro Thr Gly Ile Pro Tyr Pro Arg Val Asn Leu Arg Ser Gly Ile 225
230 235 240 Pro Phe Tyr Val Asn
Ser Pro Leu His Gln Asn Leu Gly Glu Ala Val 245
250 255 Glu Glu Gln Ser Gly Arg Pro Glu Ile Thr
Glu Thr Cys Ser Ala Gly 260 265
270 Ala Gly Ser Leu Val Leu Glu Phe Thr Val Leu Ser Arg Leu Thr
Gly 275 280 285 Asp
Ala Arg Phe Glu Gln Ala Ala Lys Arg Ala Phe Trp Glu Val Trp 290
295 300 His Arg Arg Ser Glu Ile
Gly Leu Ile Gly Asn Gly Ile Asp Ala Glu 305 310
315 320 Arg Gly Leu Trp Ile Gly Pro His Ala Gly Ile
Gly Ala Gly Met Asp 325 330
335 Ser Phe Phe Glu Tyr Ala Leu Lys Ser His Ile Leu Leu Ser Gly Leu
340 345 350 Gly Met
Pro Asn Ala Ser Thr Ser Arg Arg Gln Ser Thr Thr Ser Trp 355
360 365 Leu Asp Pro Asn Ser Leu His
Pro Pro Leu Pro Pro Glu Met His Thr 370 375
380 Ser Asp Ala Phe Leu Gln Ala Trp His Gln Ala His
Ala Ser Val Lys 385 390 395
400 Arg Tyr Leu Tyr Thr Asp Arg Ser His Phe Pro Tyr Tyr Ser Asn Asn
405 410 415 His Arg Ala
Thr Gly Gln Pro Tyr Ala Met Trp Ile Asp Ser Leu Gly 420
425 430 Ala Phe Tyr Pro Gly Leu Leu Ala
Leu Ala Gly Glu Val Glu Glu Ala 435 440
445 Ile Glu Ala Asn Leu Val Tyr Thr Ala Leu Trp Thr Arg
Tyr Ser Ala 450 455 460
Leu Pro Glu Arg Trp Ser Val Arg Glu Gly Asn Val Glu Ala Gly Ile 465
470 475 480 Gly Trp Trp Pro
Gly Arg Pro Glu Phe Ile Glu Ser Thr Tyr His Ile 485
490 495 Tyr Arg Ala Thr Arg Asp Pro Trp Tyr
Leu His Val Gly Glu Met Val 500 505
510 Leu Arg Asp Ile Arg Arg Arg Cys Tyr Ala Glu Cys Gly Trp
Ala Gly 515 520 525
Leu Gln Asp Val Gln Thr Gly Glu Lys Gln Asp Arg Met Glu Ser Phe 530
535 540 Phe Leu Gly Glu Thr
Ala Lys Tyr Met Tyr Leu Leu Phe Asp Pro Asp 545 550
555 560 His Pro Leu Asn Lys Leu Asp Ala Ala Tyr
Val Phe Thr Thr Glu Gly 565 570
575 His Pro Leu Ile Ile Pro Lys Ser Lys Arg Gly Ser Gly Ser His
Asn 580 585 590 Arg
Gln Asp Arg Ala Arg Lys Ala Lys Lys Ser Arg Asp Val Ala Val 595
600 605 Tyr Thr Tyr Tyr Asp Glu
Ser Phe Thr Asn Ser Cys Pro Ala Pro Arg 610 615
620 Pro Pro Ser Glu His His Leu Ile Gly Ser Ala
Thr Ala Ala Arg Pro 625 630 635
640 Asp Leu Phe Ser Val Ser Arg Phe Thr Asp Leu Tyr Arg Thr Pro Asn
645 650 655 Val His
Gly Pro Leu Glu Lys Val Glu Met Arg Asp Lys Lys Lys Gly 660
665 670 Arg Val Val Arg Tyr Arg Ala
Thr Ser Asn His Thr Ile Phe Pro Trp 675 680
685 Thr Leu Pro Pro Ala Met Leu Pro Glu Asn Gly Thr
Cys Ala Ala Pro 690 695 700
Pro Glu Arg Ile Ile Ser Leu Ile Glu Phe Pro Ala Asn Asp Ile Thr 705
710 715 720 Ser Gly Ile
Thr Ser Arg Phe Gly Asn His Leu Ser Trp Gln Thr His 725
730 735 Leu Gly Pro Thr Val Asn Ile Leu
Glu Gly Leu Arg Leu Gln Leu Glu 740 745
750 Gln Val Ser Asp Pro Ala Thr Gly Glu Asp Lys Trp Arg
Ile Thr His 755 760 765
Ile Gly Asn Thr Gln Leu Gly Arg His Glu Thr Val Phe Phe His Ala 770
775 780 Glu His Val Arg
His Leu Lys Asp Glu Val Phe Ser Cys Arg Arg Arg 785 790
795 800 Arg Asp Ala Val Glu Ile Glu Leu Leu
Val Asp Lys Pro Ser Asp Thr 805 810
815 Asn Asn Asn Asn Thr Leu Ala Ser Ser Asp Asp Asp Val Val
Val Asp 820 825 830
Ala Lys Ala Glu Glu Gln Asp Gly Met Leu Ala Asp Asp Asp Gly Asp
835 840 845 Thr Leu Asn Ala
Glu Thr Leu Ser Ser Asn Ser Leu Phe Gln Ser Leu 850
855 860 Leu Arg Ala Val Ser Ser Val Phe
Glu Pro Val Tyr Thr Ala Ile Pro 865 870
875 880 Glu Ser Asp Pro Ser Ala Gly Thr Ala Lys Val Tyr
Ser Phe Asp Ala 885 890
895 Tyr Thr Ser Thr Gly Pro Gly Ala Tyr Pro Met Pro Ser Ile Ser Asp
900 905 910 Thr Pro Ile
Pro Gly Asn Pro Phe Tyr Asn Phe Arg Asn Pro Ala Ser 915
920 925 Asn Phe Pro Trp Ser Thr Val Phe
Leu Ala Gly Gln Ala Cys Glu Gly 930 935
940 Pro Leu Pro Ala Ser Ala Pro Arg Glu His Gln Val Ile
Val Met Leu 945 950 955
960 Arg Gly Gly Cys Ser Phe Ser Arg Lys Leu Asp Asn Ile Pro Ser Phe
965 970 975 Ser Pro His Asp
Arg Ala Leu Gln Leu Val Val Val Leu Asp Glu Pro 980
985 990 Pro Pro Pro Pro Pro Pro Pro Pro
Ala Asn Asp Arg Arg Asp Val Thr 995 1000
1005 Arg Pro Leu Leu Asp Thr Glu Gln Thr Thr Pro
Lys Gly Met Lys 1010 1015 1020
Arg Leu His Gly Ile Pro Met Val Leu Val Arg Ala Ala Arg Gly
1025 1030 1035 Asp Tyr Glu
Leu Phe Gly His Ala Ile Gly Val Gly Met Arg Arg 1040
1045 1050 Lys Tyr Arg Val Glu Ser Gln Gly
Leu Val Val Glu Asn Ala Val 1055 1060
1065 Val Leu 1070 30406PRTTrichoderma reesei 30Met Arg
Pro Leu Ala Leu Ile Phe Ala Leu Ile Leu Gly Leu Leu Leu 1 5
10 15 Cys Leu Ala Ala Pro Ala Thr
Ala Ser Ser Ser Ser Ser Gln His Ser 20 25
30 Pro Gln Ala Ala Ser Asp Glu Ser Asp Leu Ile Cys
His Thr Ser Asn 35 40 45
Pro Asp Glu Cys Tyr Pro Arg Val Phe Val Pro Thr His Glu Phe Gln
50 55 60 Pro Val His
Asp Asp Gln Gln Leu Pro Asn Gly Leu His Val Arg Leu 65
70 75 80 Asn Ile Trp Thr Gly Gln Lys
Glu Ala Lys Ile Asn Val Pro Asp Glu 85
90 95 Ala Asn Pro Asp Leu Asp Gly Leu Pro Val Asp
Gln Ala Val Val Leu 100 105
110 Val Asp Gln Glu Gln Pro Glu Ile Ile Gln Ile Pro Lys Gly Ala
Pro 115 120 125 Lys
Tyr Asp Asn Val Gly Lys Ile Lys Glu Pro Ala Gln Glu Gly Asp 130
135 140 Ala Gln Thr Glu Ala Ile
Ala Phe Ala Glu Thr Phe Asn Met Leu Lys 145 150
155 160 Thr Gly Lys Ser Pro Ser Ala Glu Glu Phe Asp
Asn Gly Leu Glu Gly 165 170
175 Leu Glu Glu Leu Ser His Asp Ile Tyr Tyr Gly Leu Lys Ile Thr Glu
180 185 190 Asp Ala
Asp Val Val Lys Ala Leu Phe Cys Leu Met Gly Ala Arg Asp 195
200 205 Gly Asp Ala Ser Glu Gly Ala
Thr Pro Arg Asp Gln Gln Ala Ala Ala 210 215
220 Ile Leu Ala Gly Ala Leu Ser Asn Asn Pro Ser Ala
Leu Ala Glu Ile 225 230 235
240 Ala Lys Ile Trp Pro Glu Leu Leu Asp Ser Ser Cys Pro Arg Asp Gly
245 250 255 Ala Thr Ile
Ser Asp Arg Phe Tyr Gln Asp Thr Val Ser Val Ala Asp 260
265 270 Ser Pro Ala Lys Val Lys Ala Ala
Val Ser Ala Ile Asn Gly Leu Ile 275 280
285 Lys Asp Gly Ala Ile Arg Lys Gln Phe Leu Glu Asn Ser
Gly Met Lys 290 295 300
Gln Leu Leu Ser Val Leu Cys Gln Glu Lys Pro Glu Trp Ala Gly Ala 305
310 315 320 Gln Arg Lys Val
Ala Gln Leu Val Leu Asp Thr Phe Leu Asp Glu Asp 325
330 335 Met Gly Ala Gln Leu Gly Gln Trp Pro
Arg Gly Lys Ala Ser Asn Asn 340 345
350 Gly Val Cys Ala Ala Pro Glu Thr Ala Leu Asp Asp Gly Cys
Trp Asp 355 360 365
Tyr His Ala Asp Arg Met Val Lys Leu His Gly Thr Pro Trp Ser Lys 370
375 380 Glu Leu Lys Gln Arg
Leu Gly Asp Ala Arg Lys Ala Asn Ser Lys Leu 385 390
395 400 Pro Asp His Gly Glu Leu
405 3151DNAArtificial SequenceF-attB1 PCR primer 31ggggacaagt
ttgtacaaaa aagcaggcta tggctcgttc acggagctcc c
513253DNAArtificial SequenceR-attB2 PCR primer 32ggggaccact ttgtacaaga
aagctgggtt tacaattcgt cgtggaagtc gcc 533321DNATrichoderma
reesei 33agttaccacg agcggtaaca g
213420DNATrichoderma reesei 34aagagaactc gttgccaagc
203520DNATrichoderma reesei 35caccaacacc
gtctacgatg
203623DNATrichoderma reesei 36cgttcttctc aatgaccttg tag
233716DNABos taurus 37cagcaagctc gtcggc
163822DNABos taurus
38ggtacatctt gccgttgatc tc
223912DNAArtificial SequenceCBHI linker region with SpeI restriction site
change 39actagtaccc ag
124023DNAArtificial Sequencehph1 PCR primer 40tctccggtgt
cccttgtccc ttc
234123DNAArtificial Sequencehph2 PCR primer 41acctgtggcg ccggtgatgc cgg
23421113DNAArtificial
SequenceSynthetic prochymosin gene 42actagtgccg agatcacccg catccctctc
tacaagggca agagcctccg caaggccctc 60aaggagcacg gcctcctcga ggacttcctc
cagaagcagc agtacggcat cagcagcaag 120tacagcggct tcggcgaggt cgccagcgtc
cctctcacca actacctcga cagccagtac 180ttcggcaaga tctacctcgg cacccctcct
caggagttca ccgtcctctt cgacaccggc 240agcagcgact tctgggtccc gagcatctac
tgcaagagca acgcctgcaa gaaccaccag 300cgcttcgacc ctcgcaagag cagcaccttc
cagaacctcg gcaagcctct cagcatccac 360tacggcaccg gcagcatgca gggcatcctc
ggctacgaca ccgtcacggt ctccaacatc 420gtcgacatcc agcagactgt cggcctcagc
acccaggagc ctggcgacgt ctttacctac 480gccgagttcg acggcatcct gggcatggcc
taccctagcc tcgccagcga gtacagcatc 540cctgtctttg acaacatgat gaaccgccac
ctcgtcgccc aggacctctt cagcgtctac 600atggaccgca acggccaaga gagcatgctc
accctcggcg ccatcgaccc tagctactac 660accggcagcc tccactgggt cccggtcacc
gtccagcagt actggcagtt caccgtcgac 720agcgtcacca tcagcggcgt cgtcgtcgcc
tgcgagggcg gctgccaggc catcctggac 780accggcacca gcaagctcgt cggccctagc
agcgacatcc tgaacatcca gcaggccatc 840ggcgccaccc agaaccagta cggcgagttc
gacatcgact gcgacaacct cagctacatg 900cctaccgtcg tctttgagat caacggcaag
atgtaccctc tcacccctag cgcctacacc 960agccaggacc agggcttctg caccagcggc
ttccagagcg agaaccacag ccagaagtgg 1020atcctcggcg acgtctttat ccgcgagtac
tacagcgtct ttgaccgcgc caacaacctc 1080gtcggcctcg ccaaggccat ctaaggcgcg
ccg 11134329DNAArtificial SequenceF-aatB1
PCR primer 43ggggacaagt ttgtacaaaa aagcaggct
294429DNAArtificial SequenceR-aatB1 PCR primer 44ggggaccact
ttgtacaaga aagctgggt
29454PRTArtificial SequenceCBH1 linker region with a SpeI restriction
site sequence change 45Thr Ser Thr Gln 1
User Contributions:
Comment about this patent or add new information about this topic:
People who visited this patent also read: | |
Patent application number | Title |
---|---|
20140086651 | SLIDE MEMBER FOR FIXING DEVICE, FIXING DEVICE, AND IMAGE FORMING APPARATUS |
20140086650 | FIXING DEVICE AND IMAGE FORMING APPARATUS |
20140086649 | Fixing Device |
20140086648 | Fixing Device |
20140086647 | IMAGE HEATING APPARATUS |