ONCOLYTIC RHABDOVIRUS

Abstract

Embodiments of the invention include compositions and methods related to non-VSV rhabdoviruses and their use as anti-cancer therapeutics. Such rhabdoviruses possess tumor cell killing properties in vitro and in vivo.

Description

[0001] The present invention is a divisional of U.S. application Ser. No. 12/441,494, filed Oct. 21, 2010, which application is the 35 U.S.C. 371 national stage of International Patent Application No. PCT/IB2007/004701, filed Sep. 17, 2007 which claims the benefit of U.S. Provisional Application No. 60/844,726, filed Sep. 15, 2006, the entire contents of which are hereby incorporated by reference.

BACKGROUND OF THE INVENTION

[0002] I. Field of the Invention

[0003] This invention relates generally to virology and medicine. In certain aspects the invention relates to oncolytic viruses, particularly non-VSV oncolytic rhabdoviruses and oncolytic rhabdoviruses comprising a non-VSV glytcoprotein.

[0004] II. Background

[0005] A number of viruses have been shown to replicate in and kill a wide variety of tumor cells in vitro (Sindbis virus (Uno et al., 2005); Sendai virus (Kinoh et al., 2004); Coxackie virus (Shafren et al., 2004); Herpes simplex virus (Mineta et al., 1995); Parvovirus (Abschuetz et al., 2006); Adenovirus (Heise et al., 2000); Polio virus (Gromeier et al., 2000); Newcastle disease virus (Sinkovics and Horvath, 2000); Vesicular stomatitis virus (Stojdl et al., 2000) Meales virus (Grote et al., 2001); Reovirus (Coffey et al., 1998); Retrovirus (Logg et al., 2001); Vaccinia (Timiryasova et al., 1999); and Influenza (Bergmann et al. 2001)). In addition, such viruses have demonstrated efficacy in treating animal models of cancer.

[0006] Vesicular stomatitis virus (VSV), a well known and well studied rhabdovirus, has been shown to kill tumor cell lines in cell culture experiments, and has demonstrated efficacy in a variety of rodent cancer models (Stojdl et al., 2000; Stojdl et al., 2003). However, VSV does not kill all cancer cells.

SUMMARY OF THE INVENTION

[0007] Several newly identified rhabdoviruses are much more efficient at killing particular cancers or cancer cell lines than VSV. Also, VSV and attenuated mutants of VSV are neurovirulent and cause CNS pathology in rodents and primates. Several rhabdoviruses do not infect the CNS (i.e., Muir Springs and Bahia Grande: Kerschner et al., 1986), and demonstrate a more acceptable safety profile. In addition, therapies based on the novel rhabdoviruses can be used to treat cancers of the CNS, both primary and secondary. The rhabdoviruses of the invention (and/or other oncolytic agents) can be used in succession to bypass the host immune response against a particular therapeutic virus(es). This would allow prolonged therapy and improve efficacy.

[0008] Embodiments of the invention include compositions and methods related to non-VSV rhabdoviruses and their use as anti-cancer therapeutics. Such rhabdoviruses possess tumor cell killing properties in vitro and in vivo.

[0009] As used herein, a non-VSV rhabdovirus will include one or more of the following viruses or variants thereof: Arajas virus, Chandipura virus, Cocal virus, Isfahan virus, Maraba virus, Piry virus, Vesicular stomatitis Alagoas virus, BeAn 157575 virus, Boteke virus, Calchaqui virus, Eel virus American, Gray Lodge virus, Jurona virus, Klamath virus, Kwatta virus, La Joya virus, Malpais Spring virus, Mount Elgon bat virus, Perinet virus, Tupaia virus, Farmington, Bahia Grande virus, Muir Springs virus, Reed Ranch virus, Hart Park virus, Flanders virus, Kamese virus, Mosqueiro virus, Mossuril virus, Barur virus, Fukuoka virus, Kern Canyon virus, Nkolbisson virus, Le Dantec virus, Keuraliba virus, Connecticut virus, New Minto virus, Sawgrass virus, Chaco virus, Sena Madureira virus, Timbo virus, Almpiwar virus, Aruac virus, Bangoran virus, Bimbo virus, Bivens Arm virus, Blue crab virus, Charleville virus, Coastal Plains virus, DakArK 7292 virus, Entamoeba virus, Garba virus, Gossas virus, Humpty Doo virus, Joinjakaka virus, Kannamangalam virus, Kolongo virus, Koolpinyah virus, Kotonkon virus, Landjia virus, Manitoba virus, Marco virus, Nasoule virus, Navarro virus, Ngaingan virus, Oak-Vale virus, Obodhiang virus, Oita virus, Ouango virus, Parry Creek virus, Rio Grande cichlid virus, Sandjimba virus, Sigma virus, Sripur virus, Sweetwater Branch virus, Tibrogargan virus, Xiburema virus, Yata virus, Rhode Island, Adelaide River virus, Berrimah virus, Kimberley virus, or Bovine ephemeral fever virus. In certain aspects, non-VSV rhabdovirus can refer to the supergroup of Dimarhabdovirus (defined as rhabdovirus capable of infection both insect and mammalian cells). In specific embodiments, the rhabdovirus is not VSV. In particular aspects the non-VSV rhabdovirus is a Carajas virus, Maraba virus, Farmington, Muir Springs virus, and/or Bahia grande virus, including variants thereof.

[0010] One embodiment of the invention includes methods and compositions comprising an oncolytic non-VSV rhabdovirus or a recombinant oncolytic non-VSV rhabdovirus encoding one or more of rhabdoviral N, P, M, G and/or L protein, or variant thereof (including chimeras and fusion proteins thereof), having an amino acid identity of at least or at most 20, 30, 40, 50, 60, 65, 70, 75, 80, 85, 90, 92, 94, 96, 98, 99, 100%, including all ranges and percentages there between, to the N, P, M, G and/or L protein of Arajas virus, Chandipura virus, Cocal virus, Isfahan virus, Maraba virus, Piry virus, Vesicular stomatitis Alagoas virus, BeAn 157575 virus, Boteke virus, Calchaqui virus, Eel virus American, Gray Lodge virus, Jurona virus, Klamath virus, Kwatta virus, La Joya virus, Malpais Spring virus, Mount Elgon bat virus, Perinet virus, Tupaia virus, Farmington, Bahia Grande virus, Muir Springs virus, Reed Ranch virus, Hart Park virus, Flanders virus, Kamese virus, Mosqueiro virus, Mossuril virus, Barur virus, Fukuoka virus, Kern Canyon virus, Nkolbisson virus, Le Dantec virus, Keuraliba virus, Connecticut virus, New Minto virus, Sawgrass virus, Chaco virus, Sena Madureira virus, Timbo virus, Almpiwar virus, Aruac virus, Bangoran virus, Bimbo virus, Bivens Arm virus, Blue crab virus, Charleville virus, Coastal Plains virus, DakArK 7292 virus, Entamoeba virus, Garba virus, Gossas virus, Humpty Doo virus, Joinjakaka virus, Kannamangalam virus, Kolongo virus, Koolpinyah virus, Kotonkon virus, Landjia virus, Manitoba virus, Marco virus, Nasoule virus, Navarro virus, Ngaingan virus, Oak-Vale virus, Obodhiang virus, Oita virus, Ouango virus, Parry Creek virus, Rio Grande cichlid virus, Sandjimba virus, Sigma virus, Sripur virus, Sweetwater Branch virus, Tibrogargan virus, Xiburema virus, Yata virus, Rhode Island, Adelaide River virus, Berrimah virus, Kimberley virus, or Bovine ephemeral fever virus. Any 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 12 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85 or more, including all integers or ranges there between, of these virus can be specifically excluded from the claim scope. VSV or any non-VSV rhabdovirus can be the background sequence into which a variant G-protein or other viral protein can be intergrated.

[0011] In another aspect of the invention, a non-VSV rhabdovirus, or a recombinant there of, can comprise a nucleic acid segment encoding at least or at most 10, 20, 30, 40, 45, 50, 60, 65, 70, 80, 90, 100, 125, 175, 250 or more contiguous amino acids, including all value and ranges there between, of N, P, M, G or L protein of one or more non-VSV rhabdovirus, including chimeras and fusion proteins thereof. In certain embodiments a chimeric G protein will include a cytoplasmic, transmembrane, or both cytoplasmic and transmembrane portions of a VSV or non-VSV G protein.

[0012] Methods and compositions of the invention can include a second therapeutic virus, such as an oncolytic or replication defective virus. Oncolytic typically refers to an agent that is capable of killing, lysing, or halting the growth of a cancer cell. In terms of an oncolytic virus the term refers to a virus that can replicate to some degree in a cancer cell, cause the death, lysis, or cessation of cancer cell growth and typically have minimal toxic effects on non-cancer cells. A second virus includes, but is not limited to an adenovirus, a vaccinia virus, a Newcastle disease virus, an alphavirus, a parvovirus, a herpes virus, a rhabdovirus, a non-VSV rhabdovirus and the like. In other aspects, the composition is a pharmaceutically acceptable composition. The composition may also include a second anti-cancer agent, such as a chemotherapeutic, radiotherapeutic, or immunotherapeutic.

[0013] Further embodiments of the invention include methods of killing a hyperproliferative cell comprising contacting the cell with an isolated oncolytic rhabdovirus composition; or

[0014] Still further methods include the treatment of a cancer patient comprising administering an effective amount of an oncolytic rhabdovirus composition.

[0015] In certain aspects of the invention, a cell may be comprised in a patient and may be a hyperproliferative, neoplastic, pre-cancerous, cancerous, metastatic, or metastasized cell. A non-VSV rhabdovirus can be administered to a patient having a cell susceptible to killing by at least one non-VSV rhabdovirus or a therapeutic regime or composition including a non-VSV rhabdovirus. Administration of therapeutic compositions may be done 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more times with 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more non-VSV rhabdovirus or recombinant non-VSV rhabdovirus, alone or in various combinations. The composition administered can have 10, 100, 10³, 10⁴ 10⁵, 10⁶, 10⁷, 10⁸ 10⁹, 10¹⁰, 10¹¹, 10¹², 10¹³, 10¹⁴, or more viral particles or plaque forming units (pfu). Administration can be by intraperitoneal, intravenous, intra-arterial, intramuscular, intradermal, subcutaneous, or intranasal administration. In certain aspects, the compositions are administered systemically, particularly by intravascular administration, which includes injection, perfusion and the like. The methods of invention can further comprise administering a second anti-cancer therapy, such as a second therapeutic virus. In particular aspects a therapeutic virus can be an oncolytic virus, more particularly a non-VSV rhabdovirus. In other aspects, a second anti-cancer agent is a chemotherapeutic, a radiotherapeutic, an immunotherapeutic, surgery or the like.

[0016] Embodiments of the invention include compositions and methods related to a VSV rhabdoviruses comprising a heterologous G protein and their use as anti-cancer therapeutics. Such rhabdoviruses possess tumor cell killing properties in vitro and in vivo.

[0017] As used herein, a heterologous G protein includes non-VSV rhabdovirus. Non-VSV rhabdoviruses will include one or more of the following viruses or variants thereof: Arajas virus, Chandipura virus, Cocal virus, Isfahan virus, Maraba virus, Piry virus, Vesicular stomatitis Alagoas virus, BeAn 157575 virus, Boteke virus, Calchaqui virus, Eel virus American, Gray Lodge virus, Jurona virus, Klamath virus, Kwatta virus, La Joya virus, Malpais Spring virus, Mount Elgon bat virus, Perinet virus, Tupaia virus, Farmington, Bahia Grande virus, Muir Springs virus, Reed Ranch virus, Hart Park virus, Flanders virus, Kamese virus, Mosqueiro virus, Mossuril virus, Barur virus, Fukuoka virus, Kern Canyon virus, Nkolbisson virus, Le Dantec virus, Keuraliba virus, Connecticut virus, New Minto virus, Sawgrass virus, Chaco virus, Sena Madureira virus, Timbo virus, Almpiwar virus, Aruac virus, Bangoran virus, Bimbo virus, Bivens Arm virus, Blue crab virus, Charleville virus, Coastal Plains virus, DakArK 7292 virus, Entamoeba virus, Garba virus, Gossas virus, Humpty Doo virus, Joinjakaka virus, Kannamangalam virus, Kolongo virus, Koolpinyah virus, Kotonkon virus, Landjia virus, Manitoba virus, Marco virus, Nasoule virus, Navarro virus, Ngaingan virus, Oak-Vale virus, Obodhiang virus, Oita virus, Ouango virus, Parry Creek virus, Rio Grande cichlid virus, Sandjimba virus, Sigma virus, Sripur virus, Sweetwater Branch virus, Tibrogargan virus, Xiburema virus, Yata virus, Rhode Island, Adelaide River virus, Berrimah virus, Kimberley virus, or Bovine ephemeral fever virus. In certain aspects, non-VSV rhabdovirus can refer to the supergroup of Dimarhabdovirus (defined as rhabdovirus capable of infection both insect and mammalian cells). In particular aspects the non-VSV rhabdovirus is a Carajas virus, Maraba virus, Muir Springs virus, and/or Bahia grande virus, including variants thereof.

[0018] One embodiment of the invention includes methods and compositions comprising a oncolytic VSV rhabdovirus comprising a heterologous G protein or a recombinant oncolytic VSV rhabdovirus encoding one or more of non-VSV rhabdoviral N, P, M, G and/or L protein, or variant thereof (including chimeras and fusion proteins thereof), having an amino acid identity of at least or at most 20, 30, 40, 50, 60, 65, 70, 75, 80, 85, 90, 92, 94, 96, 98, 99, 100%, including all ranges and percentages there between, to the N, P, M, G, and/or L protein of a non-VSV rhabdovirus.

[0019] In another aspect of the invention, a VSV rhabdovirus comprising a heterologous G protein or recombinant thereof, can comprise a nucleic acid comprising a nucleic acid segment encoding at least or at most 10, 20, 30, 40, 45, 50, 60, 65, 70, 80, 90, 100, 125, 175, 250 or more contiguous amino acids, including all value and ranges there between, of N, P, M, G, or L protein of a non-VSV rhabdovirus, including chimeras and fusion proteins thereof. In certain aspects, a chimeric G protein may comprise a cytoplasmic, transmembrane, or both a cytoplasmic and transmembrane portion of VSV or a second non-VSV virus or non-VSV rhabdovirus.

[0020] Methods and compositions of the invention can include a second therapeutic virus, such as an oncolytic or replication defective virus. A second virus includes, but is not limited to an adenovirus, a vaccinia virus, a Newcastle disease virus, a herpes virus, a rhabdovirus, a non-VSV rhabdovirus and the like. In other aspects, the composition is a pharmaceutically acceptable composition. The composition may also include a second anti-cancer agent, such as a chemotherapeutic, radiotherapeutic, or immunotherapeutic.

[0021] Further embodiments of the invention include methods of killing a hyperproliferative cell comprising contacting the cell with an isolated oncolytic rhabdovirus, VSV comprising a heterologous G protein molecule, or a non-VSV rhabdovirus composition. Still further methods include the treatment of a cancer patient comprising administering an effective amount of such a viral composition.

[0022] In certain aspects of the invention, a cell may be comprised in a patient and may be a hyperproliferative, neoplastic, pre-cancerous, cancerous, metastatic, or metastasized cell. A virus of the invention can be administered to a patient having a cell susceptible to killing by at least one virus or a therapeutic regime or composition including a virus. Administration of therapeutic compositions may be done 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more times with 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more virus, alone or in various combinations. The composition administered can have 10, 100, 10³ 10⁴, 10⁵, 10⁶, 10⁷, 10⁸, 10⁹, 10¹⁰, 10¹¹, 10¹², 10¹³, 10¹⁴ or more viral particles or plaque forming units (pfu). Administration can be by intraperitoneal, intravenous, intra-arterial, intramuscular, intradermal, subcutaneous, or intranasal administration. In certain aspects, the compositions are administered systemically, particularly by intravascular administration, which includes injection, perfusion and the like. The methods of invention can further comprise administering a second anti-cancer therapy, such as a second therapeutic virus. In particular aspects a therapeutic virus can be an oncolytic virus such as a VSV comprising a heterologous G protein, more particularly a non-VSV rhabdovirus. In other aspects, a second anti-cancer agent is a chemotherapeutic, a radiotherapeutic, an immunotherapeutic, surgery or the like.

[0023] Other embodiments of the invention are discussed throughout this application. Any embodiment discussed with respect to one aspect of the invention applies to other aspects of the invention as well, and vice versa. The embodiments in the Detailed Description and Example sections are understood to be non-limiting embodiments of the invention that are applicable to all aspects of the invention.

[0024] The terms "inhibiting," "reducing," or "preventing," or any variation of these terms, when used in the claims and/or the specification includes any measurable decrease or complete inhibition to achieve a desired result. Desired results include but are not limited to palliation, reduction, slowing, or eradication of a cancerous or hyperproliferative condition, as well as an improved quality or extension of life.

[0025] The use of the word "a" or "an" when used in conjunction with the term "comprising" in the claims and/or the specification may mean "one," but it is also consistent with the meaning of "one or more," "at least one," and "one or more than one."

[0026] Throughout this application, the term "about" is used to indicate that a value includes the standard deviation of error for the device or method being employed to determine the value.

[0027] The use of the term "or" in the claims is used to mean "and/or" unless explicitly indicated to refer to alternatives only or the alternatives are mutually exclusive, although the disclosure supports a definition that refers to only alternatives and "and/or."

[0028] As used in this specification and claim(s), the words "comprising" (and any form of comprising, such as "comprise" and "comprises"), "having" (and any form of having, such as "have" and "has"), "including" (and any form of including, such as "includes" and "include") or "containing" (and any form of containing, such as "contains" and "contain") are inclusive or open-ended and do not exclude additional, unrecited elements or method steps.

[0029] Other objects, features and advantages of the present invention will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples, while indicating specific embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.

DESCRIPTION OF THE DRAWINGS

[0030] The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.

[0031] FIG. 1. Phylogenetic relationships between rhabdoviruses based on a GDE alignment of a relatively conserved region of the N protein (119 amino acids), and using the paramyxovirus Human parainfluenza virus 1 (HPIV-1) as the outgroup. The tree was generated by the neighbor-joining method and bootstrap values (indicated for each branch node) were estimated using 1000 tree replicas. Branch lengths are proportional to genetic distances. The scale bar corresponds to substitutions per amino acid site Courtesy of H. Badranc and P. J. Walker).

[0032] FIG. 2. Summary of in vitro tumor cell killing assay. Cells from the NCI 60 cell panel were infected for 96 h with a series of dilution of various viruses. Cell viability was assayed using crystal violet staining to detect residual viable cells. The EC₅₀ was calculated from the resulting cell killing curves and summarized in table format. For clarity, the EC₅₀ values have been converted to a value from 1-7 as described in the legend. In addition, the shading has been used to indicate the EC₅₀ range (i.e., darkest to lightest represents highest EC₅₀ to lowest EC₅₀ values). Viruses are abbreviated as follows: MS=Muir Springs, BG=Bahia Grande, NGG=Ngaingan, TIB=Tibrogargan, FMT=Farmington, MRB=Maraba, CRJ=Carajas, VSVHR=Vesicular Stomatitis Virus HR strain and VV=Vaccinia virus JX-963. This data demonstrates that not all rhabdoviruses are equally oncolytic, in fact closely related rhabdoviruses behave very differently on the same tumor cell lines. Thus there is currently no method to predict which rhabdoviruses have oncolytic potential. Empirical testing is required to identify good oncolytic candidate viruses.

[0033] FIGS. 3A-3B. Rhabdovirus productivity on tumor cell lines. SNB19 human glioblastoma and NCI H226 human lung carcinoma cell lines were infected with various rhabdoviruses (MOI=3) and monitored over time for virus production by plaque assay. The data shows that not all rhabdoviruses have the same ability to replicate in these tumor cell lines. NCIH226 cell reveal a great disparity in virus productivity with Bahia Grande not producing virus at all while Maraba virus is able to produce copious infectious virions.

[0034] FIG. 4. Schematic of rescue system to recover recombinant rhabdoviruses from plasmid DNA form. In this example, the Maraba virus has been cloned into a DNA plasmid between the T7 promoter and a rybozyme sequence from Hepatitis D virus. A549 cells are infected with T7 expressing vaccinia virus and then subsequently transfected with a Maraba genome vector engineered to express GFP. The rescued virions are purified and then used to infect Vero cells for 24 hours, resulting in GFP expression in these cells when visualized by fluorescence microscopy.

[0035] FIG. 5. Bioselecting improved strains of oncolytic rhabdoviruses. Rhabdovirses are quasi-species. Bahia Grande is not ncuropathogenic but has the ability to kill human glioblastoma cells. The inventors contemplated improving its virulence while maintaining its selectivity for cancer cells. To improve the virulence of a rhabdovirus for a tumor cell, the inventors selected virus mutants with increased replication capacity in a human glioblastoma cell line. Briefly, 5×10⁵ SNB19 cells were infected with 2.5×10⁶ viral particles, giving an MOI of 5. The initial inoculum had a volume of 200 μl and was allowed 1 hour to infect before the cells were washed 10 times with PBS. The last wash was analyzed for viral particles by plaque assay to ensure proper removal of input virus. At increasing time points, the entire supernatant was collected and replaced with fresh media. The collected media was used to infect new cells for amplification and was analyzed by plaque assay for the presence of viral particles. For the first passage, collections occurred at 4, 8, 12 and 24 hpi (hours post infection) until the initial time for viral release was determined. Viruses from the earliest time point were amplified back to a population of 10⁶ and then re-passed.

[0036] FIG. 6. Bioselecting improved strains of oncolytic rhabdoviruses. In this example, Bahia Grande virus underwent up to 6 iterative cycles of bioselection. The parental strain (WT) along with passages 4-6 were monitored for virus production in SNB19 cells at 4, 6 and 8 hours post infection. A clear and progressive improvement in speed of initial virus replication is evident during increasing rounds of bioselection. MRB=Maraba is included as an exemplar of rapid and desirable virus replication in the cancer cell line.

[0037] FIG. 7. Bahia Grande P13 underwent 13 rounds of bioselection. This virus demonstrated improved virus replication not only in the human glioblastoma used during the bioselection protocol, but on an unrelated human glioblastoma and a human ovarian carcinoma cell line. This demonstrates that rhabdoviruses can be bioselected to improve their oncolytic properties and these improvements are effective on other disparate cancers.

[0038] FIG. 8. Balb/C mice were infected intracranially with the indicated viruses and monitored for morbidity and/or mortality. Both wild type VSV (HR strain) and the delta M51 mutant strain of VSV were extremely neurotoxic, demonstrating hind limb paralysis within days of infection, while Bahia Grande and Muir Springs viruses showed no neurotoxicity. Bahia Grande P6 is a bioselected strain of Bahia Grande with improved replication in human glioblastoma cells. This strain also showed no neurotoxicity, demonstrating that rhabdoviruses can be bioselected for improved virulence on tumor cells, while maintaining their safety profile in normal healthy tissue.

[0039] FIG. 9. In vivo efficacy of Maraba and Carajas rhabdoviruses compared to Chandripura and WT VSV and delta 51 VSV 4T1 tumors (firefly luciferase expressing) were established in 5-8 week old Balb/C female mice by injecting 10⁶ tumor cells in the left, rear mammary gland. After one week, mice were injected intravenously on day 1 & 2 (each dose=10⁷ pfu WT VSV, A51 GFP VSV, Maraba or Chandipura; or 10⁸ pfu Carajas). Tumor responses were measured by bioluminescence imaging using an IVIS 200 (Xenogen) (measured as photons/s/cm²).

[0040] FIG. 10. Infectivity of G-less VSV pseudotyped with Isfahan G and VSV G protein.

[0041] FIG. 11. A one step growth curve of VSV WT, Isfahan and RVR IsfG 1 viruses.

[0042] FIG. 12. RVR comprising an Isfahan G protein remains oncolytic. The cytotoxicity of Isfahan virus, VSV d51 and RVR IsfG1 were assessed on various cancer cell lines.

[0043] FIGS. 13A-13C. RVR comprising Isf G1 is a able to escape immune response to VSV in vivo. In vivo luciferase detection was used to determine the amount of virus in mice inoculated with RVR IsfG1 or VSV. FIG. 13A, in vivo detection of recombinant virus injected into naive mice. FIG. 13B, in vivo detection of VSV injected into mice immunized with VSV. FIG. 13C, in vivo detection of recombinant RVR IsfG1 virus injected into mice immunized with VSV.

[0044] FIG. 14. Virus yields from infected tumors. Tumors were infected with recombinant virus or VSV in the presence or absence of immunization with VSV (as indicated). Graphed data shows the amount virus resulting from the infection of the tumor.

[0045] FIG. 15. A one step growth curve of VSV WT, chandipura virus and RVR.sub.ChaG¹. Results show that the recombinant produces the same amount of virus as VSV.

[0046] FIG. 16. Cytotoxicity of VSV WT, chandipura virus and RVR.sub.ChaG¹. Results show that the recombinant is as cytotoxic as VSV.

[0047] FIG. 17. A one step growth curve of VSV WT, Maraba virus and RVR.sub.MarG¹. Results show that recombinant virus titer was greater than VSV at 48 and 72 h.

[0048] FIG. 18. Cytotoxicity of VSV WT, Maraba virus and RVR.sub.MarG¹. Results show that both maraba and the RVR.sub.MarG¹ are cytotoxic in tumor cells lines and that they are generally more cytotoxic to tumor cells that VSV WT.

DETAILED DESCRIPTION OF THE INVENTION

[0049] Aspects of the invention are based on the killing by non-VSV rhabdovirus or pseudotyped rhabdovirus of several kinds or types cancer cells, which are resistant to killing by VSV. Some of the advantages of these oncolytic rhabdoviruses and recombinant rhabdoviruses include the following: (1) Antibodies to the inventive rhabdoviruses will be rare to non-existent in most populations of the world. (2) rhabdoviruses replicate more quickly than other oncolytic viruses such as adenovirus, reovirus, measles, parvovirus, retrovirus, and HSV. (3) Rhabdovirus grow to high titers and are filterable through 0.2 micron filter. (4) The oncolytic rhabdoviruses and recombinants thereof have a broad host range, capable of infecting many different types of cancer cells and are not limited by receptors on a particular cell (e.g., coxsackie, measles, adenovirus). (5) The rhabdovirus of the invention are amenable to genetic manipulation. (6) The rhabdovirus also has a cytoplasmic life cycle and do not integrate in the genetic material a host cell, which imparts a more favorable safety profile.

[0050] Embodiments of the invention include compositions and methods related to non-VSV rhabdoviruses or pseudotyped rhabdoviruses and their use as anti-cancer therapeutics.

I. FAMILY RHABDOVIRIDAE (RHABDOVIRUS)

[0051] The archetypal rhabdoviruses are rabies and vesicular stomatitis virus (VSV), the most studied of this virus family. Although these viruses share similar morphologies, they are very different in their life cycle, host range, and pathology. Rhabdovirus is a family of bullet shaped viruses having non-segmented (-)sense RNA genomes. There are greater than 250 Rhabdoviruses known that infect mammals, fish, insects, and plants. The family is split into at least 5 genera: (1) Lyssavirus: including Rabies virus, other mammalian viruses, some insect viruses; (2) Vesiculovirus: including Vesicular Stomatitis Virus (VSV); (3) Ephemerovirus: including Bovine ephemeral fever virus (vertebrates); (4) Cytorhabdovirus: including Lettuce necrotic yellows virus (plants); and (5) Nucleorhabdovirus: including Potato yellow dwarf virus (plants). It has also been suggested that there is a supergroup of rhabdovirus denoted Dimarhabdovirus that include a variety of rhabdoviruses that infect both mammals and insects.

[0052] The family Rhabdovirus includes, but is not limited to: Arajas virus, Chandipura virus (AF128868/gi:4583436, AJ810083/gi:57833891, AY871800/gi:62861470, AY871799/gi:62861468, AY871798/gi:62861466, AY871797/gi:62861464, AY871796/gi:62861462, AY871795/gi:62861460, AY871794/gi:62861459, AY871793/gi:62861457, AY871792/gi:62861455, AY871791/gi:62861453), Cocal virus (AF045556/gi:2865658), Isfahan virus (AJ810084/gi:57834038), Maraba virus (SEQ ID NO:1-6), Carajas virus (SEQ ID NO:7-12, AY335185/gi:33578037), Piry virus (D26175/gi:442480, Z15093/gi:61405), Vesicular stomatitis Alagoas virus, BeAn 157575 virus, Boteke virus, Calchaqui virus, Eel virus American, Gray Lodge virus, Jurona virus, Klamath virus, Kwatta virus, La Joya virus, Malpais Spring virus, Mount Elgon bat virus (DQ457103/gi|91984805), Perinet virus (AY854652/gi:71842381), Tupaia virus (NC_--007020/gi:66508427), Farmington, Bahia Grande virus (SEQ ID NO:13-18), Muir Springs virus, Reed Ranch virus, Hart Park virus, Flanders virus (AF523199/gi:25140635, AF523197/gi:25140634, AF523196/gi:25140633, AF523195/gi:25140632, AF523194/gi:25140631, AH012179/gi:25140630), Kamese virus, Mosqueiro virus, Mossuril virus, Barur virus, Fukuoka virus (AY854651/gi:71842379), Kern Canyon virus, Nkolbisson virus, Le Dantec virus (AY854650/gi:71842377), Keuraliba virus, Connecticut virus, New Minto virus, Sawgrass virus, Chaco virus, Sena Madureira virus, Timbo virus, Almpiwar virus (AY854645/gi:71842367), Aruac virus, Bangoran virus, Bimbo virus, Bivens Arm virus, Blue crab virus, Charleville virus, Coastal Plains virus, DakArK 7292 virus, Entamoeba virus, Garba virus, Gossas virus, Humpty Doo virus (AY854643/gi:71842363), Joinjakaka virus, Kannamangalam virus, Kolongo virus (DQ457100/gi|91984799 nucleoprotein (N) mRNA, partial cds); Koolpinyah virus, Kotonkon virus (DQ457099/gi|91984797, AY854638/gi:71842354); Landjia virus, Manitoba virus, Marco virus, Nasoule virus, Navarro virus, Ngaingan virus (AY854649/gi:71842375), Oak-Vale virus (AY854670/gi:71842417), Obodhiang virus (DQ457098/gi|91984795), Oita virus (AB116386/gi:46020027), Ouango virus, Parry Creek virus (AY854647/gi:71842371), Rio Grande cichlid virus, Sandjimba virus (DQ457102/gi/91984803), Sigma virus (AH004209/gi:1680545, AH004208/gi:1680544, AH004206/gi:1680542), Sripur virus, Sweetwater Branch virus, Tibrogargan virus (AY854646/gi:71842369), Xiburema virus, Yata virus, Rhode Island, Adelaide River virus (U10363/gi:600151, AF234998/gi:10443747, AF234534/gi:9971785, AY854635/gi:71842348), Berrimah virus (AY854636/gi:71842350]), Kimberley virus (AY854637/gi:71842352), or Bovine ephemeral fever virus (NC_--002526/gi:10086561).

[0053] Certain unassigned serotypes include (1) Bahia Grande group (Bahia Grande virus (BGV), Muir Springs virus (MSV), Reed Ranch virus (RRV); (2) Hart Park group (Flanders virus (FLAV), Hart Park virus (HPV), Kamese virus (KAMV), Mosqueiro virus (MQOV), Mossuril virus (MOSV); (3) Kern Canyon group (Barur virus (BARV), Fukuoka virus (FUKAV), Kern Canyon virus (KCV), Nkolbisson virus (NKOV); (4) Le Dantec group (Le Dantec virus (LDV), Keuraliba virus (KEUV), (5) Sawgrass group (Connecticut virus (CNTV), New Minto virus (NMV), Sawgrass virus (SAWV); (6) Timbo group (Chaco virus (CHOV), Sena Madureira virus (SMV), Timbo virus (TIMV); and (7) other unassigned viruses (Almpiwar virus (ALMV), Aruac virus (ARUV), Bangoran virus (BGNV), Bimbo virus (BBOV), Bivens Arm virus (BAV), Blue crab virus (BCV), Charleville virus (CHVV), Coastal Plains virus (CPV), DakArK 7292 virus (DAKV-7292), Entamoeba virus (ENTV), Garba virus (GARV), Gossas virus (GOSV), Humpty Doo virus (HDOOV), Joinjakaka virus (JOIV), Kannamangalam virus (KANV), Kolongo virus (KOLV), Koolpinyah virus (KOOLV), Kotonkon virus (KOTV), Landjia virus (LJAV), Manitoba virus (MNTBV), Marco virus (MCOV), Ngaingan, Nasoule virus (NASV), Navarro virus (NAVV), Ngaingan virus (NGAV), Oak-Vale virus (OVRV), Obodhiang virus (OBOV), Oita virus (OITAV), Ouango virus (OUAV), Parry Creek virus (PCRV), Rio Grande cichlid virus (RGRCV), Sandjimba virus (SJAV), Sigma virus [X91062] (SIGMAV), Sripur virus (SRIV), Sweetwater Branch virus (SWBV), Tibrogargan virus (TIBV), Xiburema virus (XIBV), Yata virus (YATAV).

[0054] Aspects of the invention may include, but is not limited to selecting non-VSV rhabdovirus or pseudotyped rhabdovirus based on growth in mammalian cell lines, lack of or minimal toxicity in adult mice (animals), lack of or minimal toxicity in suckling mice (animals).

[0055] A. Rhabdoviral Genome

[0056] Typically the rhabdovirus genome is approximately 11-15 kb with an approximately 50 nucleotide 3' leader and an approximately 60 nucleotide non-translated 5' region of a (-) sense viral RNA (vRNA). Typically, rhabdovirus vRNA has 5 genes encoding 5 proteins. Rhabdoviruses have a conserved polyadenylation signal at the end of each gene and a short intergenic region between each of the 5 genes. All Rhabdoviruses contain five genes which encode the nucleocapsid protein (N), Phosphoprotein (P, also designated NS), matrix protein (M), glycoprotein (G), and large protein (L). Typically these genes are ordered on negative sense vRNA as follows: 3'-N-P-M-G-(X)-L-5'. The order of the genes is important as it dictates the proportion of proteins synthesized. Any manipulations of a Rhabdovirus genome will typically include at least five transcription domains to maintain ability to infect and replicate at high levels. Rhabdoviruses have an endogenous RNA polymerase for transcription of plus sense messenger RNA (mRNA). The X gene does not occur in all Rhabdoviruses. The X gene encodes a nonstructural protein found in the fish infectious hematopoietic necrosis virus (GenBank DQ164103/gi|76262981; DQ164102/gi|76262979; DQ164101/gi|76262977; DQ164100/gi|76262975; DQ164099/gi|76262973; AB250935/gi|112821165; AB250934/gi|112821163; AB250933/gi|112821161; AB250932/gi|112821159; AB250931/gi|112821157; AB250930/gi|112821155; AB250929/gi|112821153; AB250928/gi|112821151; AB250927/gi|112821149, describing the G protein encoding nucleotide sequence), a nonstructural glycoprotein in the bovine ephemeral fever virus and a pseudogene in the rabies virus. The extra (X) gene has been found in different locations on the Rhabdovirus genome. Synthesis of the M protein in infected cells is cytopathic to the cell, and will eventually result in cell death.

[0057] Transmission of rhabdovirus varies depending on virus/host, but most are transmitted by direct contact--e.g., transmission of rabies by animal bites or insect vector. There is a long incubation period in vivo, but this is not reflected in the kinetics of virus replication in culture. The G protein spikes bind to receptors on the surface of host cells and the viruses enters the cell by endocytosis and fusion with the membrane of the vesicle, mediated by the G protein.

[0058] With no intent to be limited to a particular theory, the receptor molecules for rhabdoviruses are believed to be phospholipids rather than specific proteins. Rhabdoviral replication occurs in the cytoplasm--both the L and NS proteins are necessary for transcription--neither function alone. Five monocistronic mRNAs are produced, capped at the 5' end and polyadenylated at the 3' end and each containing the leader sequence from the 3' end of the vRNA at the 5' end of the message. These mRNAs are made by sequential transcription of the ORFs in the virus genome and it has been shown that the intergenic sequence is responsible for termination and re-initiation of transcription by the polymerase between each gene, thus producing separate transcripts.

[0059] Progeny vRNA is made from a (+)sense intermediate. The genome is replicated by the L+P polymerase complex (as in transcription), but additional host cell factors are also required. It is characteristic of Rhabdoviruses that these events all occur in a portion of the cytoplasm which acts as a virus `factory` and appears as a characteristic cytoplasmic inclusion body.

[0060] B. Viral Protein Variants

[0061] In certain embodiments, a rhabdovirus or a non-VSV rhabdovirus will comprise a variant of one or more of the N, P, M, G, and/or L proteins. In certain aspects of the invention these viral protein variants can be comprised in a proteinaceous composition, which is further defined below. Proteinaceous compositions include viral particles and other compositions having one or more viral protein components. These polypeptide variant(s) can be engineered or selected for a modification in one or more physiological or biological characteristics, such as host cell range, host cell specificity, toxicity to non-target cells or organs, replication, cytotoxicity to a target cell, killing of cancer cells, stasis of cancer cells, infectivity, manufacturing parameters, size of virus particle, stability of viral particles, in vivo clearance, immunoreactivity, and the like. These polypeptide variant can be engineered by using a variety of methodology know in the art, including various mutagenesis techniques described see below. In certain aspects, the N, P, M, G, and/or L proteins can be heterologous to a virus (e.g., a VSV may comprise a Isfahan G protein or variant thereof).

[0062] C. Recombinant Rhabdoviruses

[0063] Recombinant rhabdovirus can be produced (1) entirely using cDNAs or (2) a combination of cDNAs transfected into a helper cell, or (3) cDNAs transfected into a cell, which is further infected with a minivirus providing in trans the remaining components or activities needed to produce either an infectious or non-infectious recombinant rhabdovirus. Using any of these methods (e.g., minivirus, helper cell line, or cDNA transfection only), the minimum components required are an RNA molecule containing the cis-acting signals for (1) encapsidation of the genomic (or antigenomic) RNA by the Rhabdovirus N protein, and (2) replication of a genomic or antigenomic (replicative intermediate) RNA equivalent.

[0064] By a replicating element or replicon, the inventors mean a strand of RNA minimally containing at the 5' and 3' ends the leader sequence and the trailer sequence of a rhabdovirus. In the genomic sense, the leader is at the 3' end and the trailer is at the 5' end. Any RNA-placed between these two replication signals will in turn be replicated. The leader and trailer regions further must contain the minimal cis-acting elements for purposes of encapsidation by the N protein and for polymerase binding which are necessary to initiate transcription and replication.

[0065] For preparing engineered rhabdoviruses a minivirus containing the G gene would also contain a leader region, a trailer region and a G gene with the appropriate initiation and termination signals for producing a G protein mRNA. If the minivirus further comprises a M gene, the appropriate initiation and termination signals for producing the M protein mRNA must also present.

[0066] For any gene contained within the engineered rhabdovirus genome, the gene would be flanked by the appropriate transcription initiation and termination signals which will allow expression of those genes and production of the protein products. Particularly a heterologous gene, which is a gene that is typically not encoded by a rhabdovirus as isolated from nature or contains a rhabdovirus coding region in a position, form or context that it typically is not found, e.g., a chimeric G-protein.

[0067] To produce "non-infectious" engineered Rhabdovirus, the engineered Rhabdovirus must have the minimal replicon elements and the N, P, and L proteins and it must contain the M gene (one example is the AG or G-less construct, which is missing the coding region for the G protein). This produces virus particles that are budded from the cell, but are non-infectious particles. To produce "infectious" particles, the virus particles must additionally comprise proteins that can mediate virus particle binding and fusion, such as through the use of an attachment protein or receptor ligand. The native receptor ligand of rhabdoviruses is the G protein.

[0068] A "suitable cell" or "host cell" means any cell that would permit assembly of the recombinant rhabdovirus.

[0069] To prepare infectious virus particles, an appropriate cell line (e.g., BHK cells) is first infected with vaccinia virus vTF7-3 (Fuerst et al., 1986) or equivalent which encodes a T7 RNA polymerase or other suitable bacteriophage polymerase such as the T3 or SP6 polymerases (see Usdin et al., 1993 or Rodriguez et al., 1990). The cells are then transfected with individual cDNA containing the genes encoding the G, N, P, L and M Rhabdovirus proteins. These cDNAs will provide the proteins for building a recombinant Rhabdovirus particle. Cells can be transfected by any method known in the art (e.g., liposomes, electroporation, etc.).

[0070] Also transfected into the cell line is a "polycistronic cDNA" containing the rhabdovirus genomic RNA equivalent. If the infectious, recombinant rhabdovirus particle is intended to be lytic in an infected cell, then the genes encoding for the N, P, M and L proteins must be present as well as any heterologous nucleic acid segment. If the infectious, recombinant rhabdovirus particle is not intended to be lytic, then the gene encoding the M protein is not included in the polycistronic DNA. By "polycistronic cDNA" it is meant a cDNA comprising at least transcription units containing the genes which encode the N, P and L proteins. The recombinant rhabdovirus polycistronic DNA may also contain a gene encoding a protein variant or polypeptide fragment thereof, or a therapeutic nucleic acid. Alternatively, any protein to be initially associated with the viral particle first produced or fragment thereof may be supplied in trans.

[0071] Another embodiment contemplated is a polycistronic cDNA comprising a gene encoding a reporter protein or fluorescent protein (e.g., green fluorescent protein and its derivatives, β-galactosidase, alkaline phosphatase, luciferase, chloramphenicol acetyltransferase, etc.), the N-P-L or N-P-L-M genes, and/or a fusion protein or a therapeutic nucleic acid. Another polycistronic DNA contemplated may contain a gene encoding a protein variant, a gene encoding a reporter, a therapeutic nucleic acid, and/or either the N-P-L genes or the N-P-L-M genes.

[0072] The first step in generating a recombinant rhabdovirus is expression of an RNA that is a genomic or antigenomic equivalent from a cDNA. Then that RNA is packaged by the N protein and then replicated by the P/L proteins. The virus thus produced can be recovered. If the G protein is absent from the recombinant RNA genome, then it is typically supplied in trans. If both the G and the M proteins are absent, then both are supplied in trans.

[0073] For preparing "non-infectious rhabdovirus" particles, the procedure may be the same as above, except that the polycistronic cDNA transfected into the cells would contain the N, P and L genes of the Rhabdovirus only. The polycistronic cDNA of non-infectious rhabdovirus particles may additionally contain a gene encoding a reporter protein or a therapeutic nucleic acid. For additional description regarding methods of producing a recombinant rhabdovirus lacking the gene encoding the G protein, sec Takada et al. (1997).

[0074] 1. Culturing of Cells to Produce Virus

[0075] Transfected cells are usually incubated for at least 24 hr at the desired temperature, usually about 37° C. For non-infectious virus particles, the supernatant is collected and the virus particles isolated. For infectious virus particles, the supernatant containing virus is harvested and transferred to fresh cells. The fresh cells are incubated for approximately 48 hours, and the supernatant is collected.

[0076] 2. Purification of the Recombinant Rhabdovirus

[0077] The terms "isolation" or "isolating" a Rhabdovirus means the process of culturing and purifying the virus particles such that very little cellular debris remains. One example would be to take the virion containing supernatant and pass them through a 0.1-0.2 micron pore size filter (e.g., Millex-GS, Millipore) to remove the virus and cellular debris. Alternatively, virions can be purified using a gradient, such as a sucrose gradient. Recombinant rhabdovirus particles can then be pelleted and resuspended in whatever excipient or carrier is desired. Titers can be determined by indirect immunofluorescence using antibodies specific for particular proteins.

[0078] 3. Methods of Making Recombinant Rhabdoviruses Using cDNAs and a Minivirus or a Helper Cell Line

[0079] Both "miniviruses" and "helper cells" (also known as "helper cell lines") provide the same thing: to provide a source of rhabdovirus proteins for rhabdovirus virion assembly. One example of a rhabdovirus minivirus is the VSV minivirus which expresses only the G and M protein, as reported by Stillman et al., (1995). Helper viruses and miniviruses are used as methods of providing rhabdovirus proteins that are not produced from transfected DNA encoding the genes for rhabdovirus proteins.

[0080] When using a minivirus, cells are infected with vaccinia virus as described above for purposes of providing T7 RNA polymerase. The desired polycistronic RNA, and plasmids containing the N, P and L genes are transfected into cells. The transfection mix is removed after approximately 3 hrs, and cells are infected with the minivirus at a multiplicity of infection (m.o.i.) of about 1. The minivirus supplies the missing G and/or M proteins. The polycistronic RNA transfected into the cell will depend on whether an infectious or non-infectious recombinant rhabdovirus is wanted.

[0081] Alternatively, a minivirus could be used to provide the N, P, and L genes. The minivirus could also be used to produce the M protein in addition to N, P, and L. The minivirus also can produce the G protein.

[0082] When using a helper cell line, the genes encoding the missing rhabdovirus proteins are produced by the helper cell line. The helper cell line has N, P, L, and G proteins for production of recombinant rhabdovirus particles which does not encode wild-type G protein. The proteins are expressed from genes or DNAs that are not part of the recombinant virus genome. These plasmids or other vector system is stably incorporated into the genome of the cell line. The proteins are then produced from the cell's genome and not from a replicon in the cytoplasm. The helper cell line can then be transfected with a polycistronic DNA and plasmid cDNAs containing the other rhabdovirus genes not expressed by the helper virus. The polycistronic RNA used will depend on whether an infectious or non-infectious recombinant rhabdovirus is desired. Otherwise, supply of missing gene products (e.g., G and/or M) would be accomplished as described above.

II. VIRAL COMPOSITIONS

[0083] The present invention concerns rhabdoviruses that are advantageous in the study and treatment of hyperproliferative or neoplastic cells (e.g., cancer cells) and hyperproliferative or neoplastic conditions (e.g., cancer) in a patient. It may concern, but is not limited to, rhabdoviruses with a reduced neurovirulence, e.g., non-VSV rhabdoviruses. In certain aspects rhabdovirus that encode or contain one or more protein components (N, P, M, G, and/or L proteins) or a nucleic acid genome distinct from those of VSV (i.e., at least or at most 10, 20, 40, 50, 60, 70, 80% identical at the amino acid or nucleotide level), and/or that have been constructed with one or more mutations or variations as compared to a wild-type virus or viral proteins such that the virus has desirable properties for use against cancer cells, while being less toxic or non-toxic to non-cancer cells than the virus as originally isolated or VSV. The teachings described below provide various examples of protocols for implementing methods and compositions of the invention. They provide background for generating mutated or variant viruses through the use of bioselection or recombinant DNA or nucleic acid technology.

[0084] A. Proteinaceous Compositions

[0085] Proteinaceous compositions of the invention include viral particles and compositions including the viral particles, as well as isolated polypeptides. In certain embodiments, the present invention concerns generating or isolating pseudotyped or non-VSV oncolytic rhabdoviruses (rhabdoviruses that lyse, kill, or retard growth of cancer cells). In certain embodiments, rhabdoviruses will be engineered to include polypeptide variants of rhabdovirus proteins (N, P, M, G, and/or L) and/or therapeutic nucleic acids that encode therapeutic polypeptides. Other aspects of the invention include the isolation of rhabdoviruses that lack one or more functional polypeptides or proteins. In other embodiments, the present invention concerns rhabdoviruses and their use in combination with or included within proteinaceous compositions as part of a pharmaceutically acceptable formulation.

[0086] As used herein, a "protein" or "polypeptide" refers to a molecule comprising polymer of amino acid residues. In some embodiments, a wild-type version of a protein or polypeptide are employed, however, in many embodiments of the invention, all or part of a viral protein or polypeptide is absent or altered so as to render the virus more useful for the treatment of a patient. The terms described above may be used interchangeably herein. A "modified protein" or "modified polypeptide" or "variant protein" or "variant polypeptide" refers to a protein or polypeptide whose chemical structure or amino acid sequence is altered with respect to the wild-type or a reference protein or polypeptide. In some embodiments, a modified protein or polypeptide has at least one modified activity or function (recognizing that proteins or polypeptides may have multiple activities or functions). The modified activity or function may be reduced, diminished, eliminated, enhanced, improved, or altered in some other way (such as infection specificity) with respect to that activity or function in a wild-type protein or polypeptide, or the characteristics of virus containing such a polypeptide. It is contemplated that a modified protein or polypeptide may be altered with respect to one activity or function yet retain wild-type or unaltered activity or function in other respects. Alternatively, a modified protein may be completely nonfunctional or its cognate nucleic acid sequence may have been altered so that the polypeptide is no longer expressed at all, is truncated, or expresses a different amino acid sequence as a result of a frameshift or other modification.

[0087] In certain embodiments the size of a recombinant protein or polypeptide may comprise, but is not limited to, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500, 525, 550, 575, 600, 625, 650, 675, 700, 725, 750, 775, 800, 825, 850, 875, 900, 925, 950, 975, 1000, 1100, 1200, 1300, 1400, 1500, 1750, 2000, 2250, 2500 or greater amino molecule residues, and any range derivable therein. It is contemplated that polypeptides may be modified by truncation, rendering them shorter than their corresponding unaltered form or by fusion or domain shuffling which may render the altered protein longer.

[0088] As used herein, an "amino molecule" refers to any amino acid, amino acid derivative, or amino acid mimic as would be known to one of ordinary skill in the art. In certain embodiments, the residues of the proteinaceous molecule are sequential, without any non-amino molecule interrupting the sequence of amino molecule residues. In other embodiments, the sequence may comprise one or more non-amino molecule moieties. In particular embodiments, the sequence of residues of the proteinaceous molecule may be interrupted by one or more non-amino molecule moieties. Accordingly, the term "proteinaceous composition" encompasses amino molecule sequences comprising at least one of the 20 common amino acids in naturally synthesized proteins, or at least one modified or unusual amino acid.

[0089] Proteinaceous compositions may be made by any technique known to those of skill in the art, including the expression of proteins, polypeptides, or peptides through standard molecular biological techniques, the isolation of proteinaceous compounds from natural sources, or the chemical synthesis of proteinaceous materials. The nucleotide and polypeptide sequences for various rhabdovirus genes or genomes have been previously disclosed, and may be found at computerized databases known to those of ordinary skill in the art. One such database is the National Center for Biotechnology Information's GenBank and GenPept databases, which can be accessed via the internet at ncbi.nlm.nih.gov/. The coding regions for these known genes and viruses may be amplified and/or expressed using the techniques disclosed herein or as would be know to those of ordinary skill in the art.

[0090] B. Functional Aspects

[0091] When the present application refers to the function or activity of viral proteins or polypeptides, it is meant to refer to the activity or function of that viral protein or polypeptide under physiological conditions, unless otherwise specified. For example, the G protein is involved in specificity and efficiency of binding and infection of particular cell types. Determination of which molecules possess this activity may be achieved using assays familiar to those of skill in the art, such as infectivity assays, protein binding assays, plaque assays and the like.

[0092] C. Variants of Viral Polypeptides

[0093] Amino acid sequence variants of the polypeptides of the present invention can be substitutional, insertional or deletion variants. A mutation in a gene encoding a viral polypeptide may affect 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 275, 300, 325, 350, 375, 400, 425, 450, 475, 500 or more non-contiguous or contiguous amino acids (i.e., segment) of a polypeptide, as compared to a wild-type or unaltered polypeptide or other reference polypeptide. Various polypeptides encoded by rhabdoviruses may be identified by reference to GenBank Accession Numbers and the related public database entries for each of the viruses disclosed herein, all GenBank entries related to the family rhabdoviridae are incorporated herein by reference.

[0094] Deletion variants lack one or more residues of the native, unaltered or wild-type protein. Individual residues can be deleted, or all or part of a domain (such as a catalytic or binding domain) can be deleted. A stop codon may be introduced (by substitution or insertion) into an encoding nucleic acid sequence to generate a truncated protein. Insertional mutants typically involve the addition of material at a non-terminal point in the polypeptide, a specific type of insert is a chimeric polypeptide that include homologous or similar portions of a related protein in place of the related portion of a target protein. This may include the insertion of an immunoreactive epitope or simply one or more residues. Terminal additions, typically called fusion proteins, may also be generated.

[0095] Substitutional variants typically contain the exchange of one amino acid for another at one or more sites within the protein, and may be designed to modulate one or more properties of the polypeptide, with or without the loss of other functions or properties. Substitutions may be conservative, that is, one amino acid is replaced with one of similar shape and charge. Conservative substitutions are well known in the art and include, for example, the changes of: alanine to serine; arginine to lysine; asparagine to glutamine or histidine; aspartate to glutamate; cysteine to serine; glutamine to asparagine; glutamate to aspartate; glycine to proline; histidine to asparagine or glutamine; isoleucine to leucine or valine; leucine to valine or isoleucine; lysine to arginine; methionine to leucine or isoleucine; phenylalanine to tyrosine, leucine or methionine; serine to threonine; threonine to serine; tryptophan to tyrosine; tyrosine to tryptophan or phenylalanine; and valine to isoleucine or leucine. Alternatively, substitutions may be non-conservative such that a function or activity of the polypeptide is affected. Non-conservative changes typically involve substituting a residue with one that is chemically dissimilar, such as a polar or charged amino acid for a nonpolar or uncharged amino acid, and vice versa.

[0096] The term "functionally equivalent codon" is used herein to refer to codons that encode the same amino acid, such as the six codons for arginine or serine, and also refers to codons that encode biologically equivalent amino acids (see Table 1, below).

TABLE-US-00001 TABLE 1 Codon Table Amino Acids Codons Alanine Ala A GCA GCC GCG GCU Cysteine Cys C UGC UGU Aspartic acid Asp D GAC GAU Glutamic acid Glu E GAA GAG Phenylalanine Phe F UUC UUU Glycine Gly G GGA GGC GGG GGU Histidine His H CAC CAU Isoleucine Ile I AUA AUC AUU Lysine Lys K AAA AAG Leucine Leu L UUA UUG CUA CUC CUG CUU Methionine Met M AUG Asparagine Asn N AAC AAU Prolinc Pro P CCA CCC CCG CCU Glutamine Gln Q CAA CAG Arginine Arg R AGA AGG CGA CGC CGG CGU Serine Ser S AGC AGU UCA UCC UCG UCU Threonine Thr T ACA ACC ACG ACU Valine Val V GUA GUC GUG GUU Tryptophan Trp W UGG Tyrosine Tyr Y UAC UAU

[0097] It also will be understood that amino acid and nucleic acid sequences may include additional residues, such as additional N- or C-terminal amino acids or 5' or 3' sequences, and yet still be essentially as set as forth herein, including having a certain biological activity. The addition of terminal sequences particularly applies to nucleic acid sequences that may, for example, include various non-coding sequences flanking either of the 5' or 3' portions of the coding region or may include various internal sequences, i.e., introns, which are known to occur within genes.

[0098] The following is a discussion based upon changing of the amino acids of a N, P, L, or G protein to create an equivalent, or even an improved, molecule. For example, certain amino acids may be substituted for other amino acids in a protein structure without appreciable loss of interactive binding capacity with structures such as, for example, antigen-binding regions of antibodies or binding sites on substrate molecules. Since it is the interactive capacity and nature of a protein that defines that protein's biological functional activity, certain amino acid substitutions can be made in a protein sequence, and in its underlying DNA coding sequence, and nevertheless produce a protein with like properties. It is thus contemplated by the inventors that various changes may be made in the DNA sequences of rhabdovirus without appreciable loss of biological utility or activity of interest, as discussed below.

[0099] In making such changes, the hydropathic index of amino acids may be considered. The importance of the hydropathic amino acid index in conferring a biologic function on a protein is generally understood in the art (Kyte and Doolittle, 1982). It is accepted that the relative hydropathic character of the amino acid contributes to the secondary structure of the resultant protein, which in turn defines the interaction of the protein with other molecules, for example, enzymes, substrates, receptors, DNA, antibodies, antigens, and the like.

[0100] It also is understood in the art that the substitution of like amino acids can be made effectively on the basis of hydrophilicity. U.S. Pat. No. 4,554,101, incorporated herein by reference, states that the greatest local average hydrophilicity of a protein, as governed by the hydrophilicity of its adjacent amino acids, correlates with a biological property of the protein. As detailed in U.S. Pat. No. 4,554,101, the following hydrophilicity values have been assigned to amino acid residues: arginine (+3.0); lysine (+3.0); aspartate (+3.0±1); glutamate (+3.0±1); serine (+0.3); asparagine (+0.2); glutamine (+0.2); glycine (0); threonine (-0.4); proline (-0.5±1); alanine (0.5); histidine *-0.5); cysteine (-1.0); methionine (-1.3); valine (-1.5); leucine (-1.8); isoleucine (-1.8); tyrosine (2.3); phenylalanine (-2.5); tryptophan (-3.4). It is understood that an amino acid can be substituted for another having a similar hydrophilicity value and still produce a biologically equivalent and immunologically equivalent protein. In such changes, the substitution of amino acids whose hydrophilicity values are within ±2 is preferred, those that are within ±1 are particularly preferred, and those within ±0.5 are even more particularly preferred.

[0101] As outlined above, amino acid substitutions generally are based on the relative similarity of the amino acid side-chain substituents, for example, their hydrophobicity, hydrophilicity, charge, size, and the like. Exemplary substitutions that take into consideration the various foregoing characteristics are well known to those of skill in the art and include: arginine and lysine; glutamate and aspartate; serine and threonine; glutamine and asparagine; and valine, leucine and isoleucine.

III. NUCLEIC ACID MOLECULES

[0102] The present invention includes polynucleotides isolatable from cells that are capable of expressing all or part of a viral protein or polypeptide. In some embodiments of the invention, it concerns all or parts of a viral genome that has been specifically mutated or altered to generate a virus or viral polypeptide, e.g., a pseudotyped or non-VSV rhabdoviral polypeptide or virus, with certain properties and/or characteristics. The polynucleotides may encode a peptide or polypeptide containing all or part of a viral or heterologous amino acid sequence or be engineered so they do not encode such a viral polypeptide or encode a viral polypeptide having at least one function or activity added, increased, reduced, added, diminished, or absent. Recombinant proteins can be purified from expressing cells to yield active proteins. The genome of rhabdovirus members may be found in GenBank Accession Numbers in the NCBI database or similar databases, each of which is incorporated herein by reference.

[0103] A. Polynucleotides Encoding Native or Modified Proteins

[0104] As used herein, the term "RNA, DNA, or nucleic acid segment" refers to a RNA, DNA, or nucleic acid molecule that has been isolated free of total genomic DNA or other contaminants. Therefore, a nucleic acid segment encoding a polypeptide refers to a nucleic acid segment that contains wild-type, polymorphic, or mutant polypeptide-coding sequences yet is isolated away from, or purified free from, genomic nucleic acid(s). Included within the term "nucleic acid segment" are polynucleotides, nucleic acid segments smaller than a polynucleotide, and recombinant vectors, including, for example, plasmids, cosmids, phage, viruses, and the like.

[0105] As used in this application, the term "rhabdovirus polynucleotide" can refer to pseudotyped or non-VSV rhabdoviral nucleic acid molecule encoding at least one non-VSV rhabdovirus polypeptide. In certain embodiments the polynucleotide has been isolated free of other nucleic acids. Similarly, a "Maraba virus, Carajas virus, Muir Springs virus and/or Bahia Grande virus polynucleotide" refers to a nucleic acid molecule encoding a Maraba virus, Carajas virus, Muir Springs virus and/or Bahia Grande virus polypeptide that has been isolated from other nucleic acids. A "rhabdovirus genome" or a "Maraba virus, Carajas virus, Muir Springs virus and/or Bahia Grande virus genome" refers to a VSV or a non-VSV nucleic acid molecule that can be provided to a host cell to yield a viral particle, in the presence or absence of a helper virus or complementing coding regions supplying other factors in trans. The genome may or may have not been recombinantly mutated as compared to wild-type or an unaltered virus.

[0106] The term "cDNA" is intended to refer to DNA prepared using RNA as a template. There may be times when the full or partial genomic sequence is preferred.

[0107] It also is contemplated that a particular polypeptide from a given species may be represented by natural variants that have slightly different nucleic acid sequences but, nonetheless, encode the same protein (see Table 1 above).

[0108] Similarly, a polynucleotide encoding an isolated or purified wild-type, or modified polypeptide refers to a DNA segment including wild-type or mutant polypeptide coding sequences and, in certain aspects, regulatory sequences, isolated substantially away from other naturally occurring genes or protein encoding sequences. In this respect, the term "gene" is used for simplicity to refer to a nucleic acid unit encoding a protein, polypeptide, or peptide (including any sequences required for proper transcription, post-translational modification, or localization). As will be understood by those in the art, this functional term includes genomic sequences, cDNA sequences, and smaller engineered nucleic acid segments that express, or may be adapted to express, proteins, polypeptides, domains, peptides, fusion proteins, and mutants. A nucleic acid encoding all or part of a native or modified polypeptide may contain a contiguous nucleic acid of: 10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 441, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890, 900, 910, 920, 930, 940, 950, 960, 970, 980, 990, 1000, 1010, 1020, 1030, 1040, 1050, 1060, 1070, 1080, 1090, 1095, 1100, 1500, 2000, 2500, 3000, 3500, 4000, 4500, 5000, 5500, 6000, 6500, 7000, 7500, 8000, 9000, 10000, or more nucleotides, nucleosides, or base pairs.

[0109] In particular embodiments, the invention concerns isolated nucleic acid segments and recombinant vectors incorporating nucleic acid sequences that encode a wild-type or mutant rhabdovirus polypeptide(s) that includes within its amino acid sequence a contiguous amino acid sequence in accordance with, or essentially corresponding to a native polypeptide. The term "recombinant" may be used in conjunction with a polypeptide or the name of a specific polypeptide, and this generally refers to a polypeptide produced from a nucleic acid molecule that has been manipulated in vitro or that is the replicated product of such a molecule.

[0110] In other embodiments, the invention concerns isolated nucleic acid segments and recombinant vectors incorporating nucleic sequences that encode a polypeptide or peptide that includes within its amino acid sequence a contiguous amino acid sequence in accordance with, or essentially corresponding to one or more rhabdovirus polypeptide.

[0111] The nucleic acid segments used in the present invention, regardless of the length of the coding sequence itself, may be combined with other nucleic acid sequences, such as promoters, polyadenylation signals, additional restriction enzyme sites, multiple cloning sites, other coding segments, and the like, such that their overall length may vary considerably. It is therefore contemplated that a nucleic acid fragment of almost any length may be employed, with the total length preferably being limited by the ease of preparation and use in the intended recombinant nucleic acid protocol.

[0112] It is contemplated that the nucleic acid constructs of the present invention may encode full-length polypeptide(s) from any source or encode a truncated or modified version of the polypeptide(s), for example a truncated rhabdovirus polypeptide, such that the transcript of the coding region represents the truncated version. The truncated transcript may then be translated into a truncated protein. Alternatively, a nucleic acid sequence may encode a full-length polypeptide sequence with additional heterologous coding sequences, for example to allow for purification of the polypeptide, transport, secretion, post-translational modification, or for therapeutic benefits such as targeting or efficacy. As discussed above, a tag or other heterologous polypeptide may be added to the modified polypeptide-encoding sequence, wherein "heterologous" refers to a polypeptide or segment thereof that is not the same as the modified polypeptide or found associated with or encoded by the naturally occurring virus.

[0113] In a non-limiting example, one or more nucleic acid construct may be prepared that include a contiguous stretch of nucleotides identical to or complementary to a particular viral segment, such as a rhabdovirus N, P, M, G, or L gene. A nucleic acid construct may be at least 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, 200, 250, 300, 400, 500, 600, 700, 800, 900, 1,000, 2,000, 3,000, 4,000, 5,000, 6,000, 7,000, 8,000, 9,000, 10,000, 15,000, 20,000, 30,000, 50,000, 100,000, 250,000, 500,000, 750,000, to at least 1,000,000 nucleotides in length, as well as constructs of greater size, up to and including chromosomal sizes (including all intermediate lengths and intermediate ranges). It will be readily understood that "intermediate lengths" and "intermediate ranges," as used herein, means any length or range including or between the quoted values (i.e., all integers including and between such values).

[0114] The nucleic acid segments used in the present invention encompass modified nucleic acids that encode modified polypeptides. Such sequences may arise as a consequence of codon redundancy and functional equivalency that are known to occur naturally within nucleic acid sequences and the proteins thus encoded. Alternatively, functionally equivalent proteins or peptides may be created via the application of recombinant DNA technology, in which changes in the protein structure may be engineered, based on considerations of the properties of the amino acids being exchanged. Changes designed by human may be introduced through the application of site-directed mutagenesis techniques, e.g., to introduce improvements to the antigenicity or lack thereof of the protein, to reduce toxicity effects of the protein in vivo to a subject given the protein, or to increase the efficacy of any treatment involving the protein or a virus comprising such protein.

[0115] In certain other embodiments, the invention concerns isolated nucleic acid segments and recombinant vectors that include within their sequence a contiguous nucleic acid sequence from that shown in sequences identified herein (and/or incorporated by reference). Such sequences, however, may be mutated to yield a protein product whose activity is altered with respect to wild-type.

[0116] It also will be understood that this invention is not limited to the particular nucleic acid and amino acid sequences of these identified sequences. Recombinant vectors and isolated nucleic acid segments may therefore variously include rhabdovirus-coding regions themselves, coding regions bearing selected alterations or modifications in the basic coding region, or they may encode larger polypeptides that nevertheless include rhabdovirus-coding regions, or may encode biologically functional equivalent proteins or peptides that have variant amino acids sequences.

[0117] The nucleic acid segments of the present invention can encode rhabdovirus proteins and peptides that are the biological functional equivalent of, or variants or mutants of rhabdovirus that increase the therapeutic benefit of the virus. Such sequences may arise as a consequence of codon redundancy and functional equivalency that are known to occur naturally within nucleic acid sequences and the proteins thus encoded. Alternatively, functionally equivalent proteins or peptides may be created via the application of recombinant DNA technology, in which changes in the protein structure may be engineered, based on considerations of the properties of the amino acids being exchanged. Changes designed by man may be introduced through the application of site directed mutagenesis techniques, e.g., to introduce improvements in cancer cell binding of a viral protein.

[0118] B. Mutagenesis of Rhabdovirus Polynucleotides

[0119] In various embodiments, the rhabdovirus polynucleotide may be altered or mutagenized. Alterations or mutations may include insertions, deletions, point mutations, inversions, and the like and may result in the modulation, activation and/or inactivation of certain proteins or molecular mechanisms, as well as altering the function, location, or expression of a gene product, in particular rendering a gene product non-functional. Where employed, mutagenesis of a polynucleotide encoding all or part of a rhabdovirus may be accomplished by a variety of standard, mutagenic procedures (Sambrook et al., 2001). Mutation is the process whereby changes occur in the quantity or structure of an organism. Mutation can involve modification of the nucleotide sequence of a single gene, blocks of genes or whole genomes. Changes in single genes may be the consequence of point mutations which involve the removal, addition or substitution of a single nucleotide base within a DNA sequence, or they may be the consequence of changes involving the insertion or deletion of large numbers of nucleotides.

[0120] 1. Random Mutagenesis

[0121] a. Insertional Mutagenesis

[0122] Insertional mutagenesis is based on the inactivation of a gene via insertion of a known nucleic acid fragment. Because it involves the insertion of some type of nucleic acid fragment, the mutations generated are generally loss-of-function, rather than gain-of-function mutations. However, there are several examples of insertions generating gain-of-function mutations. Insertional mutagenesis may be accomplished using standard molecular biology techniques.

[0123] b. Chemical mutagenesis

[0124] Chemical mutagenesis offers certain advantages, such as the ability to find a full range of mutations with degrees of phenotypic severity, and is facile and inexpensive to perform. The majority of chemical carcinogens produce mutations in DNA. Benzo[a]pyrene, N-acetoxy-2-acetyl aminofluorene and aflotoxin B1 cause GC to TA transversions in bacteria and mammalian cells. Benzo[a]pyrene also can produce base substitutions such as AT to TA. N-nitroso compounds produce GC to AT transitions. Alkylation of the O4 position of thymine induced by exposure to n-nitrosourea results in TA to CG transitions.

[0125] c. Radiation Mutagenesis

[0126] Biological molecules are degraded by ionizing radiation. Adsorption of the incident energy leads to the formation of ions and free radicals, and breakage of some covalent bonds. Susceptibility to radiation damage appears quite variable between molecules, and between different crystalline forms of the same molecule. It depends on the total accumulated dose, and also on the dose rate (as once free radicals are present, the molecular damage they cause depends on their natural diffusion rate and thus upon real time). Damage is reduced and controlled by making the sample as cold as possible. Ionizing radiation causes DNA damage, generally proportional to the dose rate.

[0127] In the present invention, the term "ionizing radiation" means radiation comprising particles or photons that have sufficient energy or can produce sufficient energy to produce ionization (gain or loss of electrons). An exemplary and preferred ionizing radiation is an x-radiation. The amount of ionizing radiation needed in a given cell or for a particular molecule generally depends upon the nature of that cell or molecule and the nature of the mutation target. Means for determining an effective amount of radiation are well known in the art.

[0128] d. In Vitro Scanning Mutagenesis

[0129] Random mutagenesis also may be introduced using error prone PCR. The rate of mutagenesis may be increased by performing PCR in multiple tubes with dilutions of templates. One particularly useful mutagenesis technique is alanine scanning mutagenesis in which a number of residues are substituted individually with the amino acid alanine so that the effects of losing side-chain interactions can be determined, while minimizing the risk of large-scale perturbations in protein conformation (Cunningham et al., 1989).

[0130] In vitro scanning saturation mutagenesis provides a rapid method for obtaining a large amount of structure-function information including: (i) identification of residues that modulate ligand binding specificity, (ii) a better understanding of ligand binding based on the identification of those amino acids that retain activity and those that abolish activity at a given location, (iii) an evaluation of the overall plasticity of an active site or protein subdomain, (iv) identification of amino acid substitutions that result in increased binding.

[0131] 2. Site-Directed Mutagenesis

[0132] Structure-guided site-specific mutagenesis represents a powerful tool for the dissection and engineering of protein-ligand interactions (Wells, 1996; Braisted et al., 1996). The technique provides for the preparation and testing of sequence variants by introducing one or more nucleotide sequence changes into a selected DNA.

[0133] C. Vectors

[0134] To generate mutations in a rhabdovirus genome, native and modified polypeptides may be encoded by a nucleic acid molecule comprised in a vector. The term "vector" is used to refer to a carrier nucleic acid molecule into which an exogenous nucleic acid sequence can be inserted for introduction into a cell where it can be replicated. A nucleic acid sequence can be "exogenous," which means that it is foreign to the cell into which the vector is being introduced or that the sequence is homologous to a sequence in the cell but in a position within the host cell nucleic acid in which the sequence is ordinarily not found. Vectors include plasmids, cosmids, viruses (bacteriophage, animal viruses, and plant viruses), and artificial chromosomes (e.g., YACs). One of skill in the art would be well equipped to construct a vector through standard recombinant techniques, which are described in Sambrook et al. (2001) and Ausubel et al. (1994), both incorporated herein by reference.

[0135] In addition to encoding a modified polypeptide such as modified N protein, P protein, M protein, G protein, or L protein, a vector may encode non-modified polypeptide sequences such as a tag or targeting molecule. Useful vectors encoding such fusion proteins include pIN vectors (Inouye et al., 1985), vectors encoding a stretch of histidines, and pGEX vectors, for use in generating glutathione S-transferase (GST) soluble fusion proteins for later purification and separation or cleavage. A targeting molecule is one that directs the modified polypeptide to a particular organ, tissue, cell, or other location in a subject's body. Alternatively, the targeting molecule alters the tropism of an organism, such as rhabdovirus for certain cell types, e.g., cancer cells.

[0136] The term "expression vector" refers to a vector containing a nucleic acid sequence coding for at least part of a gene product capable of being transcribed. In some cases, RNA molecules are translated into a protein, polypeptide, or peptide. In other cases, these sequences are not translated, for example, in the production of antisense molecules or ribozymes. Expression vectors can contain a variety of "control sequences," which refer to nucleic acid sequences necessary for the transcription and possibly translation of an operably linked coding sequence in a particular host organism. In addition to control sequences that govern transcription and translation, vectors and expression vectors may contain nucleic acid sequences that serve other functions as well and are described infra.

[0137] 1. Promoters and Enhancers

[0138] A "promoter" is a control sequence that is a region of a nucleic acid sequence at which initiation and rate of transcription are controlled. It may contain genetic elements that bind regulatory proteins and molecules, such as RNA polymerase and other transcription factors. The phrases "operatively positioned," "operatively coupled," "operatively linked," "under control," and "under transcriptional control" mean that a promoter is in a correct functional location and/or orientation in relation to a nucleic acid sequence to control transcriptional initiation and/or expression of that sequence. A promoter may or may not be used in conjunction with an "enhancer," which refers to a cis-acting regulatory sequence involved in the transcriptional activation of a nucleic acid sequence.

[0139] A promoter may be one naturally associated with a gene or sequence, as may be obtained by isolating the 5' non-coding sequences located upstream of the coding segment and/or exon. Such a promoter can be referred to as "endogenous." Similarly, an enhancer may be one naturally associated with a nucleic acid sequence, located either downstream or upstream of that sequence. Alternatively, certain advantages will be gained by positioning the coding nucleic acid segment under the control of a recombinant or heterologous promoter, which refers to a promoter that is not normally associated with a nucleic acid sequence in its natural environment. A recombinant or heterologous enhancer refers also to an enhancer not normally associated with a nucleic acid sequence in its natural environment. Such promoters or enhancers may include promoters or enhancers of other genes, and promoters or enhancers isolated from any other prokaryotic, viral, or eukaryotic cell, and promoters or enhancers not "naturally occurring," i.e., containing different elements of different transcriptional regulatory regions, and/or mutations that alter expression.

[0140] In addition to producing nucleic acid sequences of promoters and enhancers synthetically, sequences may be produced using recombinant cloning and/or nucleic acid amplification technology, including PCR®, in connection with the compositions disclosed herein (see U.S. Pat. No. 4,683,202, U.S. Pat. No. 5,928,906, each incorporated herein by reference). Furthermore, it is contemplated the control sequences that direct transcription and/or expression of sequences within non-nuclear organelles such as mitochondria, chloroplasts, and the like, can be employed as well.

[0141] Naturally, it may be important to employ a promoter and/or enhancer that effectively directs the expression of the DNA segment in the cell type, organelle, and organism chosen for expression. Those of skill in the art of molecular biology generally know the use of promoters, enhancers, and cell type combinations for protein expression, for example, see Sambrook et al. (2001), incorporated herein by reference. The promoters employed may be constitutive, tissue-specific, cell selective (i.e., more active in one cell type as compared to another), inducible, and/or useful under the appropriate conditions to direct high level expression of the introduced nucleic acid segment, such as is advantageous in the large-scale production of recombinant proteins and/or peptides. The promoter may be heterologous or endogenous.

[0142] Several elements/promoters that may be employed, in the context of the present invention, to regulate the expression of a gene. This list is not intended to be exhaustive of all the possible elements involved in the promotion of expression but, merely, to be exemplary thereof. Also provided are examples of inducible elements, which are regions of a nucleic acid sequence that can be activated in response to a specific stimulus. Promoter/Enhancer (References) include: Immunoglobulin Heavy Chain (Banerji et al., 1983; Gilles et al., 1983; Grosschedl et al., 1985; Atchinson et al., 1986, 1987; Imler et al., 1987; Weinberger et al., 1984; Kiledjian et al., 1988; Porton et al.; 1990); Immunoglobulin Light Chain (Queen et al., 1983; Picard et al., 1984); T Cell Receptor (Luria et al., 1987; Winoto et al., 1989; Redondo et al.; 1990); HLA DQ a and/or DQ 13 (Sullivan et al., 1987); β Interferon (Goodbourn et al., 1986; Fujita et al., 1987; Goodbourn et al., 1988); Interleukin-2 (Greene et al., 1989); Interleukin-2 Receptor (Greene et al., 1989; Lin et al., 1990); MHC Class II 5 (Koch et al., 1989); MHC Class II HLA-DRa (Sherman et al., 1989); 13-Actin (Kawamoto et al., 1988; Ng et al.; 1989); Muscle Creatine Kinase (MCK) (Jaynes et al., 1988; Horlick et al., 1989; Johnson et al., 1989); Prealbumin (Transthyretin) (Costa et al., 1988); Elastase I (Omitz et al., 1987); Metallothionein (MTII) (Karin et al., 1987; Culotta et al., 1989); Collagenase (Pinkert et al., 1987; Angel et al., 1987); Albumin (Pinkert et al., 1987; Tronche et al., 1989, 1990); α-Fetoprotein (Godbout et al., 1988; Campere et al., 1989); γ-Globin (Bodine et al., 1987; Perez-Stable et al., 1990); β-Globin (Trudel et al., 1987); c-fos (Cohen et al., 1987); c-HA-ras (Triesman, 1986; Deschamps et al., 1985); Insulin (Edlund et al., 1985); Neural Cell Adhesion Molecule (NCAM) (Hirsh et al., 1990); α1-Antitrypain (Latimer et al., 1990); H2B (TH2B) Histone (Hwang et al., 1990); Mouse and/or Type I Collagen (Ripe et al., 1989); Glucose-Regulated Proteins (GRP94 and GRP78) (Chang et al., 1989); Rat Growth Hormone (Larsen et al., 1986); Human Serum Amyloid A (SAA) (Edbrooke et al., 1989); Troponin I (TN I) (Yutzey et al., 1989); Platelet-Derived Growth Factor (PDGF) (Pech et al., 1989); Duchenne Muscular Dystrophy (Klamut et al., 1990); SV40 (Banerji et al., 1981; Moreau et al., 1981; Sleigh et al., 1985; Firak et al., 1986; Herr et al., 1986; Imbra et al., 1986; Kadesch et al., 1986; Wang et al., 1986; Ondek et al., 1987; Kuhl et al., 1987; Schaffner et al., 1988); Polyoma (Swartzendruber et al., 1975; Vasseur et al., 1980; Katinka et al., 1980, 1981; Tyndell et al., 1981; Dandolo et al., 1983; de Villiers et al., 1984; Hen et al., 1986; Satake et al., 1988; Campbell et al., 1988); Retroviruses (Kriegler et al., 1982, 1983; Levinson et al., 1982; Kriegler et al., 1983, 1984a, b, 1988; Bosze et al., 1986; Miksicek et al., 1986; Celander et al., 1987; Thiesen et al., 1988; Celander et al., 1988; Chol et al., 1988; Reisman et al., 1989); Papilloma Virus (Campo et al., 1983; Lusky et al., 1983; Spandidos and Wilkie, 1983; Spalholz et al., 1985; Lusky et al., 1986; Cripe et al., 1987; Gloss et al., 1987; Hirochika et al., 1987; Stephens et al., 1987); Hepatitis B Virus (Bulla et al., 1986; Jamcel et al., 1986; Shaul et al., 1987; Spandau et al., 1988; Vannice et al., 1988); Human Immunodeficiency Virus (Muesing et al., 1987; Hauber et al., 1988; Jakobovits et al., 1988; Feng et al., 1988; Takebe et al., 1988; Rosen et al., 1988; Berkhout et al., 1989; Laspia et al., 1989; Sharp et al., 1989; Braddock et al., 1989); Cytomegalovirus (CMV) (Weber et al., 1984; Boshart et al., 1985; Foecking et al., 1986); and Gibbon Ape Leukemia Virus (Holbrook et al., 1987; Quinn et al., 1989).

[0143] Inducible Elements (Element/Inducer (References)) include: MT II/Phorbol Ester (TFA), Heavy metals (Palmiter et al., 1982; Haslinger et al., 1985; Searle et al., 1985; Stuart et al., 1985; Imagawa et al., 1987, Karin et al., 1987; Angel et al., 1987b; McNeall et al., 1989); MMTV (mouse mammary tumor virus)/Glucocorticoids (Huang et al., 1981; Lee et al., 1981; Majors et al., 1983; Chandler et al., 1983; Lee et al., 1984; Ponta et al., 1985; Sakai et al., 1988); P-Interferon/poly(rI)x, poly(rc) (Tavernier et al., 1983); Adenovirus 5 E2/E1A (Imperiale et al., 1984); Collagenase/Phorbol Ester (TPA) (Angel et al., 1987a); Stromelysin/Phorbol Ester (TPA) (Angel et al., 1987b); SV40/Phorbol Ester (TPA) (Angel et al., 1987b); Murine MX Gene/Interferon, Newcastle Disease Virus (Hug et al., 1988); GRP78 Gene/A23187 (Resendez et al., 1988); α-2-Macroglobulin/IL-6 (Kunz et al., 1989); Vimentin/Serum (Rittling et al., 1989); MHC Class I Gene H-2κb/Interferon (Blanar et al., 1989); HSP70/E1A, SV40 Large T Antigen (Taylor et al., 1989, 1990a, 1990b); Proliferin/Phorbol Ester-TPA (Mordacq et al., 1989); Tumor Necrosis Factor/PMA (Hensel et al., 1989); and Thyroid Stimulating Hormone α Gene/Thyroid Hormone (Chatterjee et al., 1989).

[0144] The identity of tissue-specific or tissue-selective (i.e., promoters that have a greater activity in one cell as compared to another) promoters or elements, as well as assays to characterize their activity, is well known to those of skill in the art. Examples of such regions include the human LIMK2 gene (Nomoto et al. 1999), the somatostatin receptor 2 gene (Kraus et al., 1998), murine epididymal retinoic acid-binding gene (Lareyre et al., 1999), human CD4 (Zhao-Emonet et al., 1998), mouse alpha2 (XI) collagen (Tsumaki, et al., 1998), DIA dopamine receptor gene (Lee, et al., 1997), insulin-like growth factor II (Wu et al., 1997), human platelet endothelial cell adhesion molecule-1 (Almendro et al., 1996), and the SM22α promoter.

[0145] Additional viral promoters, cellular promoters/enhancers and inducible promoters/enhancers that could be used in combination with the present invention are listed herein. Additionally any promoter/enhancer combination (as per the Eukaryotic Promoter Data Base EPDB) could also be used to drive expression of structural genes encoding oligosaccharide processing enzymes, protein folding accessory proteins, selectable marker proteins or a heterologous protein of interest. Alternatively, a tissue-specific promoter for cancer gene therapy (Table 2) or the targeting of tumors (Table 3) may be employed with the nucleic acid molecules of the present invention.

TABLE-US-00002 TABLE 2 Candidate Tissue-Specific Promoters for Cancer Gene Therapy Cancers in which promoter Normal cells in which Tissue-specific promoter is active promoter is active Carcinoembryonic antigen Most colorectal carcinomas; Colonic mucosa; gastric (CEA)* 50% of lung carcinomas; 40-50% mucosa; lung epithelia; of gastric carcinomas; eccrine sweat glands; cells in most pancreatic carcinomas; testes many breast carcinomas Prostate-specific antigen Most prostate carcinomas Prostate epithelium (PSA) Vasoactive intestinal peptide Majority of non-small cell Neurons; lymphocytes; mast (VIP) lung cancers cells; eosinophils Surfactant protein A (SP-A) Many lung adenocarcinomas Type II pneumocytes; Clara cells Human achaete-scute Most small cell lung cancers Neuroendocrine cells in lung homolog (hASH) Mucin-1 (MUC1)** Most adenocarcinomas Glandular epithelial cells in (originating from any tissue) breast and in respiratory, gastrointestinal, and genitourinary tracts Alpha-fetoprotein Most hepatocellular Hepatocytes (under certain carcinomas; possibly many conditions); testis testicular cancers Albumin Most hepatocellular Hepatocytes carcinomas Tyrosinase Most melanomas Melanocytes; astrocytes; Schwann cells; some neurons Tyrosine-binding protein Most melanomas Melanocytes; astrocytes, (TRP) Schwann cells; some neurons Keratin 14 Presumably many squamous Keratinocytes cell carcinomas (e.g.: Head and neck cancers) EBV LD-2 Many squamous cell Keratinocytes of upper carcinomas of head and neck digestive Keratinocytes of upper digestive tract Glial fibrillary acidic protein Many astrocytomas Astrocytes (GFAP) Myelin basic protein (MBP) Many gliomas Oligodendrocytes Testis-specific angiotensin- Possibly many testicular Spermatazoa converting enzyme (Testis- cancers specific ACE) Osteocalcin Possibly many Osteoblasts osteosarcomas

TABLE-US-00003 TABLE 3 Candidate Promoters for Use with a Tissue-Specific Targeting of Tumors Cancers in which Promoter Normal cells in which Promoter is active Promoter is active E2F-regulated promoter Almost all cancers Proliferating cells HLA-G Many colorectal carcinomas; Lymphocytes; monocytes; many melanomas; possibly spermatocytes; trophoblast many other cancers FasL Most melanomas; many Activated leukocytes: pancreatic carcinomas; most neurons; endothelial cells; astrocytomas possibly many keratinocytes; cells in other cancers immunoprivileged tissues; some cells in lungs, ovaries, liver, and prostate Myc-regulated promoter Most lung carcinomas (both Proliferating cells (only some small cell and non-small cell-types): mammary cell); most colorectal epithelial cells (including carcinomas non-proliferating) MAGE-1 Many melanomas; some non- Testis small cell lung carcinomas; some breast carcinomas VEGF 70% of all cancers Cells at sites of (constitutive overexpression neovascularization (but in many cancers) unlike in tumors, expression is transient, less strong, and never constitutive) bFGF Presumably many different Cells at sites of ischemia (but cancers, since bFGF unlike tumors, expression is expression is induced by transient, less strong, and ischemic conditions never constitutive) COX-2 Most colorectal carcinomas; Cells at sites of inflammation many lung carcinomas; possibly many other cancers IL-10 Most colorectal carcinomas; Leukocytes many lung carcinomas; many squamous cell carcinomas of head and neck; possibly many other cancers GRP78/BiP Presumably many different Cells at sites of ishemia cancers, since GRP7S expression is induced by tumor-specific conditions CarG elements from Egr-1 Induced by ionization Cells exposed to ionizing radiation, so conceivably radiation; leukocytes most tumors upon irradiation

[0146] 2. Initiation Signals and Internal Ribosome Binding Sites

[0147] A specific initiation signal also may be required for efficient translation of coding sequences. These signals include the ATG initiation codon or adjacent sequences. Exogenous translational control signals, including the ATG initiation codon, may need to be provided. One of ordinary skill in the art would readily be capable of determining this and providing the necessary signals. It is well known that the initiation codon must be "in-frame" with the reading frame of the desired coding sequence to ensure translation of the entire insert. The exogenous translational control signals and initiation codons can be either natural or synthetic. The efficiency of expression may be enhanced by the inclusion of appropriate transcription enhancer elements.

[0148] In certain embodiments of the invention, the use of internal ribosome entry sites (IRES) elements are used to create multigene, or polycistronic, messages. IRES elements are able to bypass the ribosome scanning model of 5' methylated Cap dependent translation and begin translation at internal sites (Pelletier and Sonenberg, 1988). IRES elements from two members of the picornavirus family (polio and encephalomyocarditis) have been described (Pelletier and Sonenberg, 1988), as well an IRES from a mammalian message (Macejak and Sarnow, 1991). IRES elements can be linked to heterologous open reading frames. Multiple open reading frames can be transcribed together, each separated by an IRES, creating polycistronic messages. By virtue of the IRES element, each open reading frame is accessible to ribosomes for efficient translation. Multiple genes can be efficiently expressed using a single promoter/enhancer to transcribe a single message (see U.S. Pat. Nos. 5,925,565 and 5,935,819, herein incorporated by reference).

[0149] 3. Multiple Cloning Sites

[0150] Vectors can include a multiple cloning site (MCS), which is a nucleic acid region that contains multiple restriction enzyme sites any of which can be used in conjunction with standard recombinant technology to digest the vector. (See Carbonelli et al., 1999, Levenson et al., 1998, and Cocea, 1997, incorporated herein by reference.) "Restriction enzyme digestion" refers to catalytic cleavage of a nucleic acid molecule with an enzyme that functions only at specific locations in a nucleic acid molecule. Many of these restriction enzymes are commercially available. Use of such enzymes is widely understood by those of skill in the art. Frequently, a vector is linearized or fragmented using a restriction enzyme that cuts within the MCS to enable exogenous sequences to be ligated to the vector. "Ligation" refers to the process of forming phosphodiester bonds between two nucleic acid fragments, which may or may not be contiguous with each other. Techniques involving restriction enzymes and ligation reactions are well known to those of skill in the art of recombinant technology.

[0151] 4. Termination Signals

[0152] The vectors or constructs of the present invention will generally comprise at least one termination signal. A "termination signal" or "terminator" is comprised of the RNA sequences involved in specific termination of an RNA transcript by an RNA polymerase. Thus, in certain embodiments a termination signal that ends the production of an RNA transcript is contemplated. A terminator may be necessary in vivo to achieve desirable message levels.

[0153] In negative sense RNA viruses, including rhabdoviruses, termination is defined by a RNA motif.

[0154] Terminators contemplated for use in the invention include any known terminator of transcription described herein or known to one of ordinary skill in the art, including but not limited to, for example, the termination sequences of genes, such as for example the bovine growth hormone terminator or viral termination sequences, such as for example the SV40 terminator. In certain embodiments, the termination signal may be a lack of transcribable or translatable sequence, such as due to a sequence truncation.

[0155] 5. Polyadenylation Signals

[0156] In expression, particularly eukaryotic expression, one will typically include a polyadenylation signal to effect proper polyadenylation of the transcript. The nature of the polyadenylation signal is not believed to be crucial to the successful practice of the invention, and/or any such sequence may be employed. Preferred embodiments include the SV40 polyadenylation signal and/or the bovine growth hormone polyadenylation signal, convenient and/or known to function well in various target cells. Polyadenylation may increase the stability of the transcript or may facilitate cytoplasmic transport.

[0157] 6. Origins of Replication

[0158] In order to propagate a vector in a host cell, it may contain one or more origins of replication sites (often termed "ori"), which is a specific nucleic acid sequence at which replication is initiated. Alternatively an autonomously replicating sequence (ARS) can be employed if the host cell is yeast.

[0159] 7. Selectable and Screenable Markers

[0160] In certain embodiments of the invention, cells containing a nucleic acid construct of the present invention may be identified in vitro or in vivo by including a marker in the expression vector. Such markers would confer an identifiable change to the cell permitting easy identification of cells containing the expression vector. Generally, a selectable marker is one that confers a property that allows for selection. A positive selectable marker is one in which the presence of the marker allows for its selection, while a negative selectable marker is one in which its presence prevents its selection. An example of a positive selectable marker is a drug resistance marker.

[0161] Usually the inclusion of a drug selection marker aids in the cloning and identification of transformants, for example, genes that confer resistance to neomycin, puromycin, hygromycin, DHFR, GPT, zcocin and histidinol are useful selectable markers. In addition to markers conferring a phenotype that allows for the discrimination of transformants based on the implementation of conditions, other types of markers including screenable markers such as GFP, whose basis is colorimetric analysis, are also contemplated. Alternatively, screenable enzymes such as herpes simplex virus thymidine kinase (tk) or chloramphenicol acetyltransferase (CAT) may be utilized. One of skill in the art would also know how to employ immunologic markers, possibly in conjunction with FACS analysis. The marker used is not believed to be important, so long as it is capable of being expressed simultaneously with the nucleic acid encoding a gene product. Further examples of selectable and screenable markers are well known to one of skill in the art.

[0162] D. Host Cells

[0163] As used herein, the terms "cell," "cell line," and "cell culture" may be used interchangeably. All of these terms also include their progeny, which is any and all subsequent generations. It is understood that all progeny may not be identical due to deliberate or inadvertent mutations. In the context of expressing a heterologous nucleic acid sequence, "host cell" refers to a prokaryotic or eukaryotic cell, and it includes any transformable organisms that is capable of replicating a vector and/or expressing a heterologous gene encoded by a vector. A host cell can, and has been, used as a recipient for vectors or viruses (which does not qualify as a vector if it expresses no exogenous polypeptides). A host cell may be "transfected" or "transformed," which refers to a process by which exogenous nucleic acid, such as a modified protein-encoding sequence, is transferred or introduced into the host cell. A transformed cell includes the primary subject cell and its progeny.

[0164] Host cells may be derived from prokaryotes or eukaryotes, including yeast cells, insect cells, and mammalian cells, depending upon whether the desired result is replication of the vector or expression of part or all of the vector-encoded nucleic acid sequences. Numerous cell lines and cultures are available for use as a host cell, and they can be obtained through the American Type Culture Collection (ATCC), which is an organization that serves as an archive for living cultures and genetic materials (www.atcc.org). An appropriate host can be determined by one of skill in the art based on the vector backbone and the desired result. A plasmid or cosmid, for example, can be introduced into a prokaryote host cell for replication of many vectors. Bacterial cells used as host cells for vector replication and/or expression include DH5α, JM109, and KC8, as well as a number of commercially available bacterial hosts such as SURE® Competent Cells and SOLOPACK® Gold Cells (STRATAGENE®, La Jolla, Calif.). Alternatively, bacterial cells such as E. coli LE392 could be used as host cells for phage viruses. Appropriate yeast cells include Saccharomyces cerevisiae, Saccharomyces pombe, and Pichia pastoris.

[0165] Examples of eukaryotic host cells for replication and/or expression of a vector include HeLa, NIH3T3, Jurkat, 293, Cos, CHO, Saos, and PC12. Many host cells from various cell types and organisms are available and would be known to one of skill in the art. Similarly, a viral vector may be used in conjunction with either a eukaryotic or prokaryotic host cell, particularly one that is permissive for replication or expression of the vector.

[0166] Some vectors may employ control sequences that allow it to be replicated and/or expressed in both prokaryotic and eukaryotic cells. One of skill in the art would further understand the conditions under which to incubate all of the above described host cells to maintain them and to permit replication of a vector. Also understood and known are techniques and conditions that would allow large-scale production of vectors, as well as production of the nucleic acids encoded by vectors and their cognate polypeptides, proteins, or peptides.

[0167] E. Expression Systems

[0168] Numerous expression systems exist that comprise at least all or part of the compositions discussed above. Prokaryote- and/or eukaryote-based systems can be employed for use with the present invention to produce nucleic acid sequences, or their cognate polypeptides, proteins and peptides. Many such systems are commercially and widely available.

[0169] The insect cell/baculovirus system can produce a high level of protein expression of a heterologous nucleic acid segment, such as described in U.S. Pat. Nos. 5,871,986 and 4,879,236, both herein incorporated by reference, and which can be bought, for example, under the name MAXBAC® 2.0 from INVITROGEN® and BACPACK® BACULOVIRUS EXPRESSION SYSTEM FROM CLONTECH®.

[0170] In addition to the disclosed expression systems of the invention, other examples of expression systems include STRATAGENE®'s COMPLETE CONTROL® Inducible Mammalian Expression System, which involves a synthetic ecdysone-inducible receptor, or its pET Expression System, an E. coli expression system. Another example of an inducible expression system is available from INVITROGEN®, which carries the T-REXT® (tetracycline-regulated expression) System, an inducible mammalian expression system that uses the full-length CMV promoter. INVITROGEN® also provides a yeast expression system called the Pichia methanolica Expression System, which is designed for high-level production of recombinant proteins in the methylotrophic yeast Pichia methanolica. One of skill in the art would know how to express a vector, such as an expression construct, to produce a nucleic acid sequence or its cognate polypeptide, protein, or peptide.

[0171] F. Nucleic Acid Detection

[0172] In addition to their use in directing the expression of poxvirus proteins, polypeptides and/or peptides, the nucleic acid sequences disclosed herein have a variety of other uses. For example, they have utility as probes or primers for embodiments involving nucleic acid hybridization. They may be used in diagnostic or screening methods of the present invention. Detection of nucleic acids encoding rhabdovirus or rhabdovirus polypeptide modulators are encompassed by the invention.

[0173] 1. Hybridization

[0174] The use of a probe or primer of between 13 and 100 nucleotides, preferably between 17 and 100 nucleotides in length, or in some aspects of the invention up to 1-2 kilobases or more in length, allows the formation of a duplex molecule that is both stable and selective. Molecules having complementary sequences over contiguous stretches greater than 20 bases in length are generally preferred, to increase stability and/or selectivity of the hybrid molecules obtained. One will generally prefer to design nucleic acid molecules for hybridization having one or more complementary sequences of 20 to 30 nucleotides, or even longer where desired. Such fragments may be readily prepared, for example, by directly synthesizing the fragment by chemical means or by introducing selected sequences into recombinant vectors for recombinant production.

[0175] Accordingly, the nucleotide sequences of the invention may be used for their ability to selectively form duplex molecules with complementary stretches of DNAs and/or RNAs or to provide primers for amplification of DNA or RNA from samples. Depending on the application envisioned, one would desire to employ varying conditions of hybridization to achieve varying degrees of selectivity of the probe or primers for the target sequence.

[0176] For applications requiring high selectivity, one will typically desire to employ relatively high stringency conditions to form the hybrids. For example, relatively low salt and/or high temperature conditions, such as provided by about 0.02 M to about 0.10 M NaCl at temperatures of about 50° C. to about 70° C. Such high stringency conditions tolerate little, if any, mismatch between the probe or primers and the template or target strand and would be particularly suitable for isolating specific genes or for detecting specific mRNA transcripts. It is generally appreciated that conditions can be rendered more stringent by the addition of increasing amounts of formamide.

[0177] For certain applications, for example, site-directed mutagenesis, it is appreciated that lower stringency conditions are preferred. Under these conditions, hybridization may occur even though the sequences of the hybridizing strands are not perfectly complementary, but are mismatched at one or more positions. Conditions may be rendered less stringent by increasing salt concentration and/or decreasing temperature. For example, a medium stringency condition could be provided by about 0.1 to 0.25 M NaCl at temperatures of about 37° C. to about 55° C., while a low stringency condition could be provided by about 0.15 M to about 0.9 M salt, at temperatures ranging from about 20° C. to about 55° C. Hybridization conditions can be readily manipulated depending on the desired results.

[0178] In other embodiments, hybridization may be achieved under conditions of, for example, 50 nM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl₂, 1.0 mM dithiothreitol, at temperatures between approximately 20° C. to about 37° C. Other hybridization conditions utilized could include approximately 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl₂, at temperatures ranging from approximately 40° C. to about 72° C.

[0179] In certain embodiments, it will be advantageous to employ nucleic acids of defined sequences of the present invention in combination with an appropriate means, such as a label, for determining hybridization. A wide variety of appropriate indicator means are known in the art, including fluorescent, radioactive, enzymatic or other ligands, such as avidin/biotin, which are capable of being detected. In preferred embodiments, one may desire to employ a fluorescent label or an enzyme tag such as urease, alkaline phosphatase or peroxidase, instead of radioactive or other environmentally undesirable reagents. In the case of enzyme tags, colorimetric indicator substrates are known that can be employed to provide a detection means that is visibly or spectrophotometrically detectable, to identify specific hybridization with complementary nucleic acid containing samples.

[0180] In general, it is envisioned that the probes or primers described herein will be useful as reagents in solution hybridization, as in PCR®, for detection of expression of corresponding genes, as well as in embodiments employing a solid phase. In embodiments involving a solid phase, the test DNA (or RNA) is adsorbed or otherwise affixed to a selected matrix or surface. This fixed, single-stranded nucleic acid is then subjected to hybridization with selected probes under desired conditions. The conditions selected will depend on the particular circumstances (depending, for example, on the G+C content, type of target nucleic acid, source of nucleic acid, size of hybridization probe, etc.). Optimization of hybridization conditions for the particular application of interest is well known to those of skill in the art. After washing of the hybridized molecules to remove non-specifically bound probe molecules, hybridization is detected, and/or quantified, by determining the amount of bound label. Representative solid phase hybridization methods are disclosed in U.S. Pat. Nos. 5,843,663, 5,900,481 and 5,919,626. Other methods of hybridization that may be used in the practice of the present invention are disclosed in U.S. Pat. Nos. 5,849,481, 5,849,486 and 5,851,772. The relevant portions of these and other references identified in this section of the Specification are incorporated herein by reference.

[0181] 2. Amplification of Nucleic Acids

[0182] Nucleic acids used as a template for amplification may be isolated from cells, tissues or other samples according to standard methodologies (Sambrook et al., 2001). In certain embodiments, analysis is performed on whole cell or tissue homogenates or biological fluid samples without substantial purification of the template nucleic acid. The nucleic acid may be genomic DNA or fractionated or whole cell RNA. Where RNA is used, it may be desired to first convert the RNA to a complementary DNA.

[0183] The term "primer," as used herein, is meant to encompass any nucleic acid that is capable of priming the synthesis of a nascent nucleic acid in a template-dependent process. Typically, primers are oligonucleotides from ten to twenty and/or thirty base pairs in length, but longer sequences can be employed. Primers may be provided in double-stranded and/or single-stranded form, although the single-stranded form is preferred.

[0184] Pairs of primers designed to selectively hybridize to nucleic acids corresponding to sequences of genes identified herein are contacted with the template nucleic acid under conditions that permit selective hybridization. Depending upon the desired application, high stringency hybridization conditions may be selected that will only allow hybridization to sequences that are completely complementary to the primers. In other embodiments, hybridization may occur under reduced stringency to allow for amplification of nucleic acids contain one or more mismatches with the primer sequences. Once hybridized, the template-primer complex is contacted with one or more enzymes that facilitate template-dependent nucleic acid synthesis. Multiple rounds of amplification, also referred to as "cycles," are conducted until a sufficient amount of amplification product is produced.

[0185] A number of template dependent processes are available to amplify the oligonucleotide sequences present in a given template sample. One of the best known amplification methods is the polymerase chain reaction (referred to as PCR®) which is described in detail in U.S. Pat. Nos. 4,683,195, 4,683,202 and 4,800,159, and in Innis et al., 1988, each of which is incorporated herein by reference in their entirety.

[0186] A reverse transcriptase PCR® amplification procedure may be performed to quantify the amount of mRNA amplified and are well known (see Sambrook et al., 2001; WO 90/07641; and U.S. Pat. No. 5,882,864).

[0187] Another method for amplification is ligase chain reaction ("LCR"), disclosed in European Application No. 320 308, incorporated herein by reference in its entirety. U.S. Pat. No. 4,883,750 describes a method similar to LCR for binding probe pairs to a target sequence. A method based on PCR® and oligonucleotide ligase assay (OLA), disclosed in U.S. Pat. No. 5,912,148, may also be used. Alternative methods for amplification of target nucleic acid sequences that may be used in the practice of the present invention are disclosed in U.S. Pat. Nos. 5,843,650, 5,846,709, 5,846,783, 5,849,546, 5,849,497, 5,849,547, 5,858,652, 5,866,366, 5,916,776, 5,922,574, 5,928,905, 5,928,906, 5,932,451, 5,935,825, 5,939,291 and 5,942,391, GB Application No. 2 202 328, and in PCT Application No. PCT/US89/01025, each of which is incorporated herein by reference in its entirety. Qbeta Replicase, described in PCT Application No. PCT/US87/00880, may also be used as an amplification method in the present invention. Isothermal amplification as described by Walker et al. (1992) can also be used. As well as Strand Displacement Amplification (SDA), disclosed in U.S. Pat. No. 5,916,779.

[0188] Other nucleic acid amplification procedures include transcription-based amplification systems (TAS), including nucleic acid sequence based amplification (NASBA) and 3SR (Kwoh et al., 1989; PCT Application WO 88/10315, incorporated herein by reference in their entirety). European Application No. 329 822 disclose a nucleic acid amplification process involving cyclically synthesizing single-stranded RNA ("ssRNA"), ssDNA, and double-stranded DNA (dsDNA), which may be used in accordance with the present invention.

[0189] PCT Application WO 89/06700 (incorporated herein by reference in its entirety) disclose a nucleic acid sequence amplification scheme based on the hybridization of a promoter region/primer sequence to a target single-stranded DNA ("ssDNA") followed by transcription of many RNA copies of the sequence. Other amplification methods include "RACE" and "one-sided PCR" (Frohman, 1990; Ohara et al., 1989).

[0190] 3. Detection of Nucleic Acids

[0191] Following any amplification, it may be desirable to separate and/or isolate the amplification product from the template and/or the excess primer. In one embodiment, amplification products are separated by agarose, agarose-acrylamide, or polyacrylamide gel electrophoresis using standard methods (Sambrook et al., 2001).

[0192] Separation of nucleic acids may also be effected by chromatographic techniques known in art. There are many kinds of chromatography which may be used in the practice of the present invention, including adsorption, partition, ion-exchange, hydroxylapatite, molecular sieve, reverse-phase, column, paper, thin-layer, and gas chromatography as well as HPLC.

[0193] Typical visualization methods includes staining of a gel with ethidium bromide and visualization of bands under UV light. Alternatively, if the amplification products are integrally labeled with radio- or fluorometrically-labeled nucleotides, the separated amplification products can be exposed to x-ray film or visualized under the appropriate excitatory spectra.

[0194] In particular embodiments, detection is by Southern blotting and hybridization with a labeled probe. The techniques involved in Southern blotting are well known to those of skill in the art (see Sambrook et al., 2001). One example of the foregoing is described in U.S. Pat. No. 5,279,721, incorporated by reference herein, which discloses an apparatus and method for the automated electrophoresis and transfer of nucleic acids.

[0195] Other methods of nucleic acid detection that may be used in the practice of the instant invention are disclosed in U.S. Pat. Nos. 5,840,873, 5,843,640, 5,843,651, 5,846,708, 5,846,717, 5,846,726, 5,846,729, 5,849,487, 5,853,990, 5,853,992, 5,853,993, 5,856,092, 5,861,244, 5,863,732, 5,863,753, 5,866,331, 5,905,024, 5,910,407, 5,912,124, 5,912,145, 5,919,630, 5,925,517, 5,928,862, 5,928,869, 5,929,227, 5,932,413 and 5,935,791, each of which is incorporated herein by reference.

[0196] 4. Other Assays

[0197] Other methods for genetic screening may be used within the scope of the present invention, for example, to detect mutations in genomic nucleic acids, cDNA and/or RNA samples. Methods used to detect point mutations include denaturing gradient gel electrophoresis ("DGGE"), restriction fragment length polymorphism analysis ("RFLP"), chemical or enzymatic cleavage methods, direct sequencing of target regions amplified by PCR® (see above), single-strand conformation polymorphism analysis ("SSCP") and other methods well known in the art. One method of screening for point mutations is based on RNase cleavage of base pair mismatches in RNA/DNA or RNA/RNA heteroduplexes. As used herein, the term "mismatch" is defined as a region of one or more unpaired or mispaired nucleotides in a double-stranded RNA/RNA, RNA/DNA or DNA/DNA molecule. This definition thus includes mismatches due to insertion/deletion mutations, as well as single or multiple base point mutations (for example see U.S. Pat. No. 4,946,773. Alternative methods for detection of deletion, insertion or substitution mutations that may be used in the practice of the present invention are disclosed in U.S. Pat. Nos. 5,849,483, 5,851,770, 5,866,337, 5,925,525 and 5,928,870, each of which is incorporated herein by reference in its entirety.

[0198] G. Methods of Gene Transfer

[0199] Suitable methods for nucleic acid delivery to effect expression of compositions of the present invention are believed to include virtually any method by which a nucleic acid (e.g., DNA or RNA, including viral and nonviral vectors) can be introduced into an organelle, a cell, a tissue or an organism, as described herein or as would be known to one of ordinary skill in the art. Such methods include, but are not limited to, direct delivery of nucleic acid such as by injection (U.S. Pat. Nos. 5,994,624, 5,981,274, 5,945,100, 5,780,448, 5,736,524, 5,702,932, 5,656,610, 5,589,466 and 5,580,859, each incorporated herein by reference), including microinjection (Harland and Weintraub, 1985; U.S. Pat. No. 5,789,215, incorporated herein by reference); by electroporation (U.S. Pat. No. 5,384,253, incorporated herein by reference); by calcium phosphate precipitation (Graham and Van Der Eb, 1973; Chen and Okayama, 1987; Rippe et al., 1990); by using DEAE dextran followed by polyethylene glycol (Copal, 1985); by direct sonic loading (Fechheimer et al., 1987); by liposome mediated transfection (Nicolau and Sene, 1982; Fraley et al., 1979; Nicolau et al., 1987; Wong et al., 1980; Kaneda et al., 1989; Kato et al., 1991); by microprojectile bombardment (PCT Application Nos. WO 94/09699 and 95/06128; U.S. Pat. Nos. 5,610,042; 5,322,783 5,563,055, 5,550,318, 5,538,877 and 5,538,880, and each incorporated herein by reference); by agitation with silicon carbide fibers (Kaeppler et al., 1990; U.S. Pat. Nos. 5,302,523 and 5,464,765, each incorporated herein by reference); by Agrobacterium mediated transformation (U.S. Pat. Nos. 5,591,616 and 5,563,055, each incorporated herein by reference); or by PEG mediated transformation of protoplasts (Omirulleh et al., 1993; U.S. Pat. Nos. 4,684,611 and 4,952,500, each incorporated herein by reference); by desiccation/inhibition mediated DNA uptake (Potrykus et al., 1985). Through the application of techniques such as these, organelle(s), cell(s), tissue(s) or organism(s) may be stably or transiently transformed.

[0200] H. Lipid Components and Moieties

[0201] In certain embodiments, the present invention concerns compositions comprising one or more lipids associated with a nucleic acid, an amino acid molecule, such as a peptide, or another small molecule compound. In any of the embodiments discussed herein, the molecule may be either a rhabdovirus polypeptide or a rhabdovirus polypeptide modulator, for example a nucleic acid encoding all or part of either a rhabdovirus polypeptide, or alternatively, an amino acid molecule encoding all or part of rhabdovirus polypeptide modulator. A lipid is a substance that is characteristically insoluble in water and extractable with an organic solvent. Compounds other than those specifically described herein are understood by one of skill in the art as lipids, and are encompassed by the compositions and methods of the present invention. A lipid component and a non-lipid may be attached to one another, either covalently or non-covalently.

[0202] A lipid may be naturally occurring or synthetic (i.e., designed or produced by man). However, a lipid is usually a biological substance. Biological lipids are well known in the art, and include for example, neutral fats, phospholipids, phosphoglycerides, steroids, terpenes, lysolipids, glycosphingolipids, glucolipids, sulphatides, lipids with ether and ester-linked fatty acids and polymerizable lipids, and combinations thereof.

[0203] A nucleic acid molecule or amino acid molecule, such as a peptide, associated with a lipid may be dispersed in a solution containing a lipid, dissolved with a lipid, emulsified with a lipid, mixed with a lipid, combined with a lipid, covalently bonded to a lipid, contained as a suspension in a lipid or otherwise associated with a lipid. A lipid or lipid/virus-associated composition of the present invention is not limited to any particular structure. For example, they may also simply be interspersed in a solution, possibly forming aggregates which are not uniform in either size or shape. In another example, they may be present in a bilayer structure, as micelles, or with a "collapsed" structure. In another non-limiting example, a lipofectamine (Gibco BRL)-poxvirus or Superfect (Qiagen)-virus complex is also contemplated.

[0204] In certain embodiments, a lipid composition may comprise about 1%, about 2%, about 3%, about 4% about 5%, about 6%, about 7%, about 8%, about 9%, about 10%, about 11%, about 12%, about 13%, about 14%, about 15%, about 16%, about 17%, about 18%, about 19%, about 20%, about 21%, about 22%, about 23%, about 24%, about 25%, about 26%, about 27%, about 28%, about 29%, about 30%, about 31%, about 32%, about 33%, about 34%, about 35%, about 36%, about 37%, about 38%, about 39%, about 40%, about 41%, about 42%, about 43%, about 44%, about 45%, about 46%, about 47%, about 48%, about 49%, about 50%, about 51%, about 52%, about 53%, about 54%, about 55%, about 56%, about 57%, about 58%, about 59%, about 60%, about 61%, about 62%, about 63%, about 64%, about 65%, about 66%, about 67%, about 68%, about 69%, about 70%, about 71%, about 72%, about 73%, about 74%, about 75%, about 76%, about 77%, about 78%, about 79%, about 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 100%, or any range derivable therein, of a particular lipid, lipid type, or non-lipid component such as a drug, protein, sugar, nucleic acids or other material disclosed herein or as would be known to one of skill in the art. In a non-limiting example, a lipid composition may comprise about 10% to about 20% neutral lipids, and about 33% to about 34% of a cerebroside, and about 1% cholesterol. Thus, it is contemplated that lipid compositions of the present invention may comprise any of the lipids, lipid types, or other components in any combination or percentage range.

IV. PHARMACEUTICAL FORMULATIONS AND TREATMENT REGIMENS

[0205] In an embodiment of the present invention, a method of treatment for a hyperproliferative or neoplastic disease, such as cancer, by the delivery of a non-VSV rhabdovirus, such as Maraba virus, Carajas virus, Muir Springs virus, and/or Bahia Grande virus, is contemplated. Examples of cancer contemplated for treatment include lung cancer, head and neck cancer, breast cancer, pancreatic cancer, prostate cancer, renal cancer, bone cancer, testicular cancer, cervical cancer, gastrointestinal cancer, lymphomas, pre-neoplastic lesions, pre-neoplastic lesions in the lung, colon cancer, melanoma, bladder cancer and any other cancers or tumors that may be treated, including metastatic or systemically distributed cancers.

[0206] An effective amount of the pharmaceutical composition, generally, is defined as that amount sufficient to detectably and repeatedly to slow, ameliorate, reduce, minimize, or limit the extent of the disease or its symptoms. More rigorous definitions may apply, including elimination, eradication, or cure of disease.

[0207] Preferably, patients will have adequate bone marrow function (defined as a peripheral absolute granulocyte count of >2,000/mm³ and a platelet count of 100,000/mm³), adequate liver function (bilirubin <1.5 mg/dl) and adequate renal function (creatinine <1.5 mg/dl).

[0208] A. Administration

[0209] To kill cells, inhibit cell growth, inhibit metastasis, decrease tumor or tissue size, and otherwise reverse, stay, or reduce the malignant phenotype of tumor cells, using the methods and compositions of the present invention, one would generally contact a hyperproliferative or neoplastic cell with a therapeutic composition such as a virus or an expression construct encoding a polypeptide. The routes of administration will vary, naturally, with the location and nature of the lesion, and include, e.g., intradermal, transdermal, parenteral, intravascular, intravenous, intramuscular, intranasal, subcutaneous, regional, percutaneous, intratracheal, intraperitoneal, intraarterial, intravesical, intratumoral, inhalation, perfusion, lavage, direct injection, alimentary, and oral administration and formulation.

[0210] To effect a therapeutic benefit with respect to a vascular condition or disease, one would contact a vascular cell with the therapeutic compound. Any of the formulations and routes of administration discussed with respect to the treatment or diagnosis of cancer may also be employed with respect to vascular diseases and conditions.

[0211] Intratumoral injection, or injection into the tumor vasculature is contemplated for discrete, solid, accessible tumors. Local, regional or systemic administration is also contemplated, particularly for those cancers that are disseminated or are likely to disseminated systemically. The viral particles may be administering by at least or at most 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 injections.

[0212] In the case of surgical intervention, the present invention may be used preoperatively, to render an inoperable tumor subject to resection. Alternatively, the present invention may be used at the time of surgery, and/or thereafter, to treat residual or metastatic disease. For example, a resected tumor bed may be injected or perfused with a formulation comprising a rhabdovirus polypeptide or a rhabdovirus, which may or may not harbor a mutation, that is advantageous for treatment of cancer or cancer cells. The perfusion may be continued post-resection, for example, by leaving a catheter implanted at the site of the surgery. Periodic post-surgical treatment also is envisioned.

[0213] Continuous administration also may be applied where appropriate, for example, where a tumor is excised and the tumor bed is treated to eliminate residual, microscopic disease. Delivery via syringe or catherization is preferred. Such continuous perfusion may take place for a period from about 1-2 hours, to about 2-6 hours, to about 6-12 hours, to about 12-24 hours, to about 1-2 days, to about 1-2 wk or longer following the initiation of treatment. Generally, the dose of the therapeutic composition via continuous perfusion will be equivalent to that given by a single or multiple injections, adjusted over a period of time during which the perfusion occurs. It is further contemplated that limb perfusion may be used to administer therapeutic compositions of the present invention, particularly in the treatment of melanomas and sarcomas.

[0214] Treatment regimens may vary as well, and often depend on tumor type, tumor location, disease progression, and health and age of the patient. Obviously, certain types of tumor will require more aggressive treatment, while at the same time, certain patients cannot tolerate more taxing protocols. The clinician will be best suited to make such decisions based on the known efficacy and toxicity (if any) of the therapeutic formulations.

[0215] In certain embodiments, the tumor being treated may not, at least initially, be respectable. Treatments with therapeutic viral constructs may increase the respectability of the tumor due to shrinkage at the margins or by elimination of certain particularly invasive portions. Following treatments, resection may be possible. Additional treatments subsequent to resection will serve to eliminate microscopic residual disease at the tumor site.

[0216] A typical course of treatment, for a primary tumor or a post-excision tumor bed, will involve multiple doses. Typical primary tumor treatment involves a 1, 2, 3, 4, 5, 6 or more dose application over a 1, 2, 3, 4, 5, 6-week period or more. A two-week regimen may be repeated one, two, three, four, five, six or more times. During a course of treatment, the need to complete the planned dosings may be re-evaluated.

[0217] The treatments may include various "unit doses." Unit dose is defined as containing a predetermined quantity of the therapeutic composition. The quantity to be administered, and the particular route and formulation, are within the skill of those in the clinical arts. A unit dose need not be administered as a single injection but may comprise continuous infusion over a set period of time. Unit dose of the present invention may conveniently be described in terms of plaque forming units (pfu) or viral particles for viral constructs. Unit doses range from 10³, 10⁴, 10⁵, 10⁶, 10⁷, 10⁸, 10⁹, 10¹⁰, 10¹¹, 10¹², 10¹³ pfu or vp and higher. Alternatively, depending on the kind of virus and the titer attainable, one will deliver 1 to 100, 10 to 50, 100-1000, or up to about 1×10⁴, 1×10⁵, 1×10⁶, 1×10⁷, 1×10⁸, 1×10⁹, 1×10¹⁰, 1×10¹¹, 1×10¹², 1×10¹³, 1×10¹⁴, or 1×10¹⁵ or higher infectious viral particles (vp) to the patient or to the patient's cells.

[0218] B. Injectable Compositions and Formulations

[0219] The preferred method for the delivery of an expression construct or virus encoding all or part of a rhabdovirus genome to cancer or tumor cells in the present invention is via intravascular injection. However, the pharmaceutical compositions disclosed herein may alternatively be administered intratumorally, parenterally, intravenously, intrarterially, intradermally, intramuscularly, transdermally or even intraperitoneally as described in U.S. Pat. Nos. 5,543,158, 5,641,515 and 5,399,363 (each specifically incorporated herein by reference in its entirety).

[0220] Injection of nucleic acid constructs may be delivered by syringe or any other method used for injection of a solution, as long as the expression construct can pass through the particular gauge of needle required for injection (for examples see U.S. Pat. Nos. 5,846,233 and 5,846,225).

[0221] Solutions of the active compounds as free base or pharmacologically acceptable salts may be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions may also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms. The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions (U.S. Pat. No. 5,466,468, specifically incorporated herein by reference in its entirety). In all cases the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and/or vegetable oils. Proper fluidity may be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.

[0222] For parenteral administration in an aqueous solution, for example, the solution should be suitably buffered if necessary and the liquid diluent first rendered isotonic with sufficient saline or glucose. These particular aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous, intratumoral, and intraperitoneal administration. In this connection, sterile aqueous media that can be employed will be known to those of skill in the art in light of the present disclosure. For example, one dosage may be dissolved in 1 ml of isotonic NaCl solution and either added to 1000 ml of hypodermoclysis fluid or injected at the proposed site of infusion, (see for example, "Remington's Pharmaceutical Sciences" 15th Edition, pages 1035-1038 and 1570-1580). Some variation in dosage will necessarily occur depending on the condition of the subject being treated. The person responsible for administration will, in any event, determine the appropriate dose for the individual subject. Moreover, for human administration, preparations should meet sterility, pyrogenicity, general safety and purity standards required by governments of the countries in which the compositions are being used.

[0223] The compositions disclosed herein may be formulated in a neutral or salt form. Pharmaceutically-acceptable salts, include the acid addition salts (formed with the free amino groups of the protein) and which are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric, mandelic, and the like. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, histidine, procaine and the like. Upon formulation, solutions will be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective. The formulations are easily administered in a variety of dosage forms such as injectable solutions, drug release capsules and the like.

[0224] As used herein, "carrier" includes any and all solvents, dispersion media, vehicles, coatings, diluents, antibacterial and antifungal agents, isotonic and absorption delaying agents, buffers, carrier solutions, suspensions, colloids, and the like. The use of such media and agents for pharmaceutical active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredient, its use in the therapeutic compositions is contemplated. Supplementary active ingredients can also be incorporated into the compositions.

[0225] The phrase "pharmaceutically-acceptable" or "pharmacologically-acceptable" refers to molecular entities and compositions that do not produce an allergic or similar untoward reaction when administered to a human. The preparation of an aqueous composition that contains a protein as an active ingredient is well understood in the art. Typically, such compositions are prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for solution in, or suspension in, liquid prior to injection can also be prepared.

[0226] C. Combination Treatments

[0227] The compounds and methods of the present invention may be used in the context of hyperproliferative or neoplastic diseases/conditions including cancer and atherosclerosis. In order to increase the effectiveness of a treatment with the compositions of the present invention, such as rhabdoviruses, it may be desirable to combine these compositions with other agents effective in the treatment of those diseases and conditions. For example, the treatment of a cancer may be implemented with therapeutic compounds of the present invention and other anti-cancer therapies, such as anti-cancer agents or surgery.

[0228] Various combinations may be employed; for example, a non-VSV rhabdovirus, such as Maraba virus, Carajas virus, Muir Springs virus, and/or Bahia Grande virus, is "A" and the secondary anti-cancer therapy is "B", which may include a second rhabdovirus:

TABLE-US-00004 A/B/A B/A/B B/B/A A/A/B A/B/B B/A/A A/B/B/B B/A/B/B B/B/B/A B/B/A/B A/A/B/B A/B/A/B A/B/B/A B/B/A/A B/A/B/A B/A/A/B A/A/A/B B/A/A/A A/B/A/A A/A/B/A

[0229] Administration of the therapeutic virus or viral constructs of the present invention to a patient will follow general protocols for the administration of that particular secondary therapy, taking into account the toxicity, if any, of the virus treatment. It is expected that the treatment cycles would be repeated as necessary. It also is contemplated that various standard therapies, as well as surgical intervention, may be applied in combination with the described cancer or tumor cell therapy.

[0230] 1. Anti-Cancer Therapy

[0231] An "anti-cancer" agent is capable of negatively affecting cancer in a subject, for example, by killing cancer cells, inducing apoptosis in cancer cells, reducing the growth rate of cancer cells, reducing the incidence or number of metastases, reducing tumor size, inhibiting tumor growth, reducing the blood supply to a tumor or cancer cells, promoting an immune response against cancer cells or a tumor, preventing or inhibiting the progression of cancer, or increasing the lifespan of a subject with cancer. Anti-cancer agents include biological agents (biotherapy), chemotherapy agents, and radiotherapy agents. More generally, these other compositions would be provided in a combined amount effective to kill or inhibit proliferation of the cell. This process may involve contacting the cells with virus or viral construct and the agent(s) or multiple factor(s) at the same time. This may be achieved by contacting the cell with a single composition or pharmacological formulation that includes both agents, or by contacting the cell with two distinct compositions or formulations, at the same time, wherein one composition includes the virus and the other includes the second agent(s).

[0232] Tumor cell resistance to chemotherapy and radiotherapy agents represents a major problem in clinical oncology. One goal of current cancer research is to find ways to improve the efficacy of chemo- and radiotherapy by combining it with gene therapy. For example, the herpes simplex-thymidine kinase (HS-tK) gene, when delivered to brain tumors by a retroviral vector system, successfully induced susceptibility to the antiviral agent ganciclovir (Culver et al., 1992). In the context of the present invention, it is contemplated that poxvirus therapy could be used similarly in conjunction with chemotherapeutic, radiotherapeutic, immunotherapeutic, or other biological intervention, in addition to other pro-apoptotic or cell cycle regulating agents.

[0233] Alternatively, a viral therapy may precede or follow the other treatment by intervals ranging from minutes to weeks. In embodiments where the other agent and virus are applied separately to the cell, one would generally ensure that a significant period of time did not expire between the time of each delivery, such that the agent and virus would still be able to exert an advantageously combined effect on the cell. In such instances, it is contemplated that one may contact the cell with both modalities within about 12-24 h of each other and, more preferably, within about 6-12 h of each other. In some situations, it may be desirable to extend the time period for treatment significantly, however, where several days (2, 3, 4, 5, 6 or 7) to several weeks (1, 2, 3, 4, 5, 6, 7 or 8) lapse between the respective administrations.

[0234] a. Chemotherapy

[0235] Cancer therapies also include a variety of combination therapies with both chemical and radiation based treatments. Combination chemotherapies include, for example, cisplatin (CDDP), carboplatin, procarbazine, mechlorethamine, cyclophosphamide, camptothecin, ifosfamide, melphalan, chlorambucil, busulfan, nitrosurea, dactinomycin, daunorubicin, doxorubicin, bleomycin, plicomycin, mitomycin, etoposide (VP16), tamoxifen, raloxifene, estrogen receptor binding agents, taxol, gemcitabien, navelbine, farnesyl-protein transferase inhibitors, transplatinum, 5-fluorouracil, vincristine, vinblastine and methotrexate, Temazolomide (an aqueous form of DTIC), or any analog or derivative variant of the foregoing. The combination of chemotherapy with biological therapy is known as biochemotherapy.

[0236] b. Radiotherapy

[0237] Other factors that cause DNA damage and have been used extensively include what are commonly known as γ-rays, X-rays, proton beams, and/or the directed delivery of radioisotopes to tumor cells. Other forms of DNA damaging factors are also contemplated such as microwaves and UV-irradiation. It is most likely that all of these factors effect a broad range of damage on DNA, on the precursors of DNA, on the replication and repair of DNA, and on the assembly and maintenance of chromosomes. Dosage ranges for X-rays range from daily doses of 50 to 200 roentgens for prolonged periods of time (3 to 4 wk), to single doses of 2000 to 6000 roentgens. Dosage ranges for radioisotopes vary widely, and depend on the half-life of the isotope, the strength and type of radiation emitted, and the uptake by the neoplastic cells.

[0238] The terms "contacted" and "exposed," when applied to a cell, are used herein to describe the process by which a therapeutic construct and a chemotherapeutic or radiotherapeutic agent are delivered to a target cell or are placed in direct juxtaposition with the target cell. To achieve cell killing or stasis, both agents are delivered to a cell in a combined amount effective to kill the cell or prevent it from dividing.

[0239] c. Immunotherapy

[0240] Immunotherapeutics, generally, rely on the use of immune effector cells and molecules to target and destroy cancer cells. The immune effector may be, for example, an antibody specific for some marker on the surface of a tumor cell. The antibody alone may serve as an effector of therapy or it may recruit other cells to actually effect cell killing. The antibody also may be conjugated to a drug or toxin (chemotherapeutic, radionuclide, ricin A chain, cholera toxin, pertussis toxin, etc.) and serve merely as a targeting agent. Alternatively, the effector may be a lymphocyte carrying a surface molecule that interacts, either directly or indirectly, with a tumor cell target. Various effector cells include cytotoxic T cells and NK cells. The combination of therapeutic modalities, i.e., direct cytotoxic activity and inhibition or reduction of certain rhabdovirus or rhabdovirus polypeptides would provide therapeutic benefit in the treatment of cancer.

[0241] Immunotherapy could also be used as part of a combined therapy. The general approach for combined therapy is discussed below. In one aspect of immunotherapy, the tumor cell must bear some marker that is amenable to targeting, i.e., is not present on the majority of other cells. Many tumor markers exist and any of these may be suitable for targeting in the context of the present invention. Common tumor markers include carcinoembryonic antigen, prostate specific antigen, urinary tumor associated antigen, fetal antigen, tyrosinase (p97), gp68, TAG-72, HMFG, Sialyl Lewis Antigen, MucA, MucB, PLAP, estrogen receptor, laminin receptor, erb B and p155. Tumor cell lysates may also be used in an antigenic composition.

[0242] An alternative aspect of immunotherapy is to combine anticancer effects with immune stimulatory effects. Immune stimulating molecules include: cytokines such as IL-2, IL-4, IL-12, GM-CSF, IFNγ, chemokines such as MIP-1, MCP-1, IL-8 and growth factors such as FLT3 ligand. Combining immune stimulating molecules, either as proteins or using gene delivery in combination with a tumor suppressor has been shown to enhance anti-tumor effects (Ju et al., 2000).

[0243] As discussed earlier, examples of immunotherapies currently under investigation or in use are immune adjuvants (e.g., Mycobacterium bovis, Plasmodium falciparum, dinitrochlorobenzene and aromatic compounds) (U.S. Pat. Nos. 5,801,005 and 5,739,169; Hui and Hashimoto, 1998; Christodoulides et al., 1998), cytokine therapy (e.g., interferons α, β and γ; IL-1, GM-CSF and TNF) (Bukowski et al., 1998; Davidson et al., 1998; Hellstrand et al., 1998) gene therapy (e.g., TNF, IL-1, IL-2, p53) (Qin et al., 1998; Austin-Ward and Villaseca, 1998; U.S. Pat. Nos. 5,830,880 and 5,846,945) and monoclonal antibodies (e.g., anti-ganglioside GM2, anti-HER-2, anti-p185) (Pietras et al., 1998; Hanibuchi et al., 1998; U.S. Pat. No. 5,824,311). Herceptin (trastuzumab) is a chimeric (mouse-human) monoclonal antibody that blocks the HER2-neu receptor (Dillman, 1999). Combination therapy of cancer with herceptin and chemotherapy has been shown to be more effective than the individual therapies. Thus, it is contemplated that one or more anti-cancer therapies may be employed with the rhabdovirus-related therapies described herein.

[0244] (1) Passive Immunotherapy

[0245] A number of different approaches for passive immunotherapy of cancer exist. They may be broadly categorized into the following: injection of antibodies alone; injection of antibodies coupled to toxins or chemotherapeutic agents; injection of antibodies coupled to radioactive isotopes; injection of anti-idiotype antibodies; and finally, purging of tumor cells in bone marrow.

[0246] Preferably, human monoclonal antibodies are employed in passive immunotherapy, as they produce few or no side effects in the patient. However, their application is somewhat limited by their scarcity and have so far only been administered intralesionally. Human monoclonal antibodies to ganglioside antigens have been administered intralesionally to patients suffering from cutaneous recurrent melanoma (Inci and Morton, 1986). Regression was observed in six out of ten patients, following, daily or weekly, intralesional injections. In another study, moderate success was achieved from intralesional injections of two human monoclonal antibodies (Irie et al., 1989).

[0247] It may be favorable to administer more than one monoclonal antibody directed against two different antigens or even antibodies with multiple antigen specificity. Treatment protocols also may include administration of lymphokines or other immune enhancers as described by Bajorin et al. (1988). The development of human monoclonal antibodies is described in further detail elsewhere in the specification.

[0248] (2) Active Immunotherapy

[0249] In active immunotherapy, an antigenic peptide, polypeptide or protein, or an autologous or allogenic tumor cell composition or "vaccine" is administered, generally with a distinct bacterial adjuvant (Ravindranath and Morton, 1991; Morton et al., 1992; Mitchell et al., 1990; Mitchell et al., 1993). In melanoma immunotherapy, those patients who elicit high IgM response often survive better than those who elicit no or low IgM antibodies (Morton et al., 1992). IgM antibodies are often transient antibodies and the exception to the rule appears to be anti ganglioside or anticarbohydrate antibodies.

[0250] (3) Adoptive Immunotherapy

[0251] In adoptive immunotherapy, the patient's circulating lymphocytes, or tumor infiltrated lymphocytes, are isolated in vitro, activated by lymphokines such as IL 2 or transduced with genes for tumor necrosis, and readministered (Rosenberg et al., 1988; 1989). To achieve this, one would administer to an animal, or human patient, an immunologically effective amount of activated lymphocytes in combination with an adjuvant incorporated antigenic peptide composition as described herein. The activated lymphocytes will most preferably be the patient's own cells that were earlier isolated from a blood or tumor sample and activated (or "expanded") in vitro. This form of immunotherapy has produced several cases of regression of melanoma and renal carcinoma, but the percentage of responders were few compared to those who did not respond.

[0252] d. Genes

[0253] In yet another embodiment, the secondary treatment is a gene therapy in which a therapeutic polynucleotide is administered before, after, or at the same time as a rhabdovirus is administered. Delivery of a rhabdovirus in conjunction with a vector encoding one of the following gene products will have a combined anti-cancer effect on target tissues. Alternatively, the rhabdovirus may be engineered as a viral vector to include the therapeutic polynucleotide. A variety of proteins are encompassed within the invention, some of which are described below. Table 4 lists various genes that may be targeted for gene therapy of some form in combination with the present invention.

[0254] (1) Inducers of Cellular Proliferation

[0255] The proteins that induce cellular proliferation further fall into various categories dependent on function. The commonality of all of these proteins is their ability to regulate cellular proliferation. For example, a form of PDGF, the sis oncogene, is a secreted growth factor. Oncogenes rarely arise from genes encoding growth factors, and at the present, sis is the only known naturally-occurring oncogenic growth factor. In one embodiment of the present invention, it is contemplated that anti-sense mRNA directed to a particular inducer of cellular proliferation is used to prevent expression of the inducer of cellular proliferation.

[0256] (2) Inhibitors of Cellular Proliferation

[0257] The tumor suppressor oncogenes function to inhibit excessive cellular proliferation. The inactivation of these genes destroys their inhibitory activity, resulting in unregulated proliferation. Tumor suppressors include p53, p16 and C-CAM. Other genes that may be employed according to the present invention include Rb, APC, DCC, NF-1, NF-2, WT-1, MEN-I, MEN-II, zacl, p73, VHL, MMAC1/PTEN, DBCCR-1, FCC, rsk-3, p27, p27/p16 fusions, p21/p27 fusions, anti-thrombotic genes (e.g., COX-1, TFPI), PGS, Dp, E2F, ras, myc, neu, raf, erb, fms, trk, ret, gsp, hst, abl, E1A, p300, genes involved in angiogenesis (e.g., VEGF, FGF, thrombospondin, BAI-1, GDAIF, or their receptors) and MCC.

[0258] (3) Regulators of Programmed Cell Death

[0259] Apoptosis, or programmed cell death, is an essential process for normal embryonic development, maintaining homeostasis in adult tissues, and suppressing carcinogenesis (Kerr et al., 1972). The Bcl-2 family of proteins and ICE-like proteases have been demonstrated to be important regulators and effectors of apoptosis in other systems. The Bcl 2 protein, discovered in association with follicular lymphoma, plays a prominent role in controlling apoptosis and enhancing cell survival in response to diverse apoptotic stimuli (Bakhshi et al., 1985; Cleary and Sklar, 1985; Cleary et al., 1986; Tsujimoto et al., 1985; Tsujimoto and Croce, 1986). The evolutionarily conserved Bcl-2 protein now is recognized to be a member of a family of related proteins, which can be categorized as death agonists or death antagonists.

[0260] Subsequent to its discovery, it was shown that Bcl 2 acts to suppress cell death triggered by a variety of stimuli. Also, it now is apparent that there is a family of Bcl-2 cell death regulatory proteins which share in common structural and sequence homologies. These different family members have been shown to either possess similar functions to Bcl 2 (e.g., BclXL, BclW, BclS, Mcl-1, A1, Bfl-1) or counteract Bcl 2 function and promote cell death (e.g., Bax, Bak, Bik, Bim, Bid, Bad, Harakiri).

[0261] e. Surgery

[0262] Approximately 60% of persons with cancer will undergo surgery of some type, which includes preventative, diagnostic or staging, curative and palliative surgery. Curative surgery is a cancer treatment that may be used in conjunction with other therapies, such as the treatment of the present invention, chemotherapy, radiotherapy, hormonal therapy, gene therapy, immunotherapy and/or alternative therapies.

[0263] Curative surgery includes resection in which all or part of cancerous tissue is physically removed, excised, and/or destroyed. Tumor resection refers to physical removal of at least part of a tumor. In addition to tumor resection, treatment by surgery includes laser surgery, cryosurgery, electrosurgery, and microscopically controlled surgery (Mohs' surgery). It is further contemplated that the present invention may be used in conjunction with removal of superficial cancers, pre-cancers, or incidental amounts of normal tissue.

[0264] Upon excision of part of all of cancerous cells, tissue, or tumor, a cavity may be formed in the body. Treatment may be accomplished by perfusion, direct injection or local application of the area with an additional anti-cancer therapy. Such treatment may be repeated, for example, every 1, 2, 3, 4, 5, 6, or 7 days, or every 1, 2, 3, 4, and 5 weeks or every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 months. These treatments may be of varying dosages as well.

[0265] f. Other Agents

[0266] It is contemplated that other agents may be used in combination with the present invention to improve the therapeutic efficacy of treatment. These additional agents include immunomodulatory agents, agents that affect the upregulation of cell surface receptors and GAP junctions, cytostatic and differentiation agents, inhibitors of cell adhesion, agents that increase the sensitivity of the hyperproliferative cells to apoptotic inducers, or other biological agents. Immunomodulatory agents include tumor necrosis factor; interferon α, β, and γ; IL-2 and other cytokines; F42K and other cytokine analogs; or MIP-1, MIP-1β, MCP-1, RANTES, and other chemokines. It is further contemplated that the upregulation of cell surface receptors or their ligands such as Fas/Fas ligand, DR4 or DR5/TRAIL (Apo-2 ligand) would potentiate the apoptotic inducing ability of the present invention by establishment of an autocrine or paracrine effect on hyperproliferative cells. Increases intercellular signaling by elevating the number of GAP junctions would increase the anti-hyperproliferative effects on the neighboring hyperproliferative cell population. In other embodiments, cytostatic or differentiation agents can be used in combination with the present invention to improve the anti-hyperproliferative efficacy of the treatments. Inhibitors of cell adhesion are contemplated to improve the efficacy of the present invention. Examples of cell adhesion inhibitors are focal adhesion kinase (FAKs) inhibitors and Lovastatin. It is further contemplated that other agents that increase the sensitivity of a hyperproliferative cell to apoptosis, such as the antibody c225, could be used in combination with the present invention to improve the treatment efficacy.

[0267] There have been many advances in the therapy of cancer following the introduction of cytotoxic chemotherapeutic drugs. However, one of the consequences of chemotherapy is the development/acquisition of drug-resistant phenotypes and the development of multiple drug resistance. The development of drug resistance remains a major obstacle in the treatment of such tumors and therefore, there is an obvious need for alternative approaches such as viral therapy.

[0268] Another form of therapy for use in conjunction with chemotherapy, radiation therapy or biological therapy includes hyperthermia, which is a procedure in which a patient's tissue is exposed to high temperatures (up to 106° F.). External or internal heating devices may be involved in the application of local, regional, or whole-body hyperthermia. Local hyperthermia involves the application of heat to a small area, such as a tumor. Heat may be generated externally with high-frequency waves targeting a tumor from a device outside the body. Internal heat may involve a sterile probe, including thin, heated wires or hollow tubes filled with warm water, implanted microwave antennae, or radiofrequency electrodes.

[0269] A patient's organ or a limb is heated for regional therapy, which is accomplished using devices that produce high energy, such as magnets. Alternatively, some of the patient's blood may be removed and heated before being perfused into an area that will be internally heated. Whole-body heating may also be implemented in cases where cancer has spread throughout the body. Warm-water blankets, hot wax, inductive coils, and thermal chambers may be used for this purpose.

[0270] Hormonal therapy may also be used in conjunction with the present invention or in combination with any other cancer therapy previously described. The use of hormones may be employed in the treatment of certain cancers such as breast, prostate, ovarian, or cervical cancer to lower the level or block the effects of certain hormones such as testosterone or estrogen. This treatment is often used in combination with at least one other cancer therapy as a treatment

V. EXAMPLES

[0271] The following examples are given for the purpose of illustrating various embodiments of the invention and are not meant to limit the present invention in any fashion. One skilled in the art will appreciate readily that the present invention is well adapted to carry out the objects and obtain the ends and advantages mentioned, as well as those objects, ends and advantages inherent herein. The present examples, along with the methods described herein are presently representative of preferred embodiments, are exemplary, and are not intended as limitations on the scope of the invention. Changes therein and other uses which are encompassed within the spirit of the invention as defined by the scope of the claims will occur to those skilled in the art.

Example 1

Screening for Novel Oncolytic Candidate Rhabdoviruses

[0272] In Vitro Screens.

[0273] As an initial screen to identify novel oncolytic viruses, rhabdovirus field isolates were assessed for their ability to kill human tumor cells from the NCI 60 cell panel. This has been a fruitful strategy for the inventors in the past to determine the relative effectiveness of a series of VSV mutants as oncolytic (cancer cell lysing) candidates. Initially, the inventors have examined 13 novel rhabdoviruses that have been previously determined to replicate in mammalian cells. It is contemplated that this procedure will be extended to study rhabdoviruses for which there is less experience in cell culture. In an effort to rapidly and efficiently screen through a matrix of 60 cells infected with 13 different viruses, the inventors use a rapid and inexpensive assay in 96 well format using MTS reduction to formazan, or crystal violet staining of residual cells, to measure cell number and viability. The inventors grow cell lines to 80% confluence in 96 well plates and then expose them in parallel to our rhabdovirus field isolates at increasing MOIs (MOI=0.0001-10 PFUs/cell). At 48 and 96 hours post infection, cells are stained with aqueous MTS regent (Promega USA) and incubated for 3 hours to allow sufficient formazan formation. Alternatively, the plates of infected cells are washed with buffer to remove dead cells, stained with crystal violet dye, washed to remove residual dye, after which time the dye is solublized using detergent. These plates are then read using the integrated multiwell plate reader (Biotek SynergyHT; USA), the data curve fitted, and the EC₅₀ determined from this curve. Typically, assays are performed in sextuplet, with the highest and lowest EC₅₀ values removed, and averaging the remaining four EC₅₀ to ultimately determine a value and confidence interval. (For example see FIG. 2)

[0274] As a counter screen to assess whether a particular virus infects/kills normal human cells in vitro, cultures of normal human fibroblasts, epithelium and endothelium and neuronal cultures from the inventors collection and those commercially available (Cambrex, USA) will be screened. Cultures will be infected with candidate viruses (0.1 to 20 pfu/cell) for 48 and 96 hours. Cell viability will be detected by MTS assay, or crystal violet assay, and further characterized by labeling with activated caspase 3 antibody D175 (Cell Signaling Technologies, USA) and detected using a FITC-conjugated secondary antibody. Studies will be done in parallel with known susceptible/resistant human and mouse tumor cell lines. A combination of untreated cells and cells treated with TRAIL and cyclohexamide has been used to establish the dynamic range of the assay, with preliminary z-factor determinations significantly above 0.5.

[0275] Another contingency is that viruses may replicate and spread efficiently within cultures without rapidly killing these cells. These are also potentially interesting viruses, provided their replication is tumor selective in nature, as their lytic capacity could subsequently be increased through recombinant engineering. To detect these viruses, the inventors will infect cells of the NCI 60 cell panel with field isolates at a low MOI (0.1 pfu/cell) in duplicate wells of a 24 well plate. After 1 hour, wells will be washed thoroughly to remove free input virus, medium added and the cultures incubated for a further 72 hours. These culture supernatants will subsequently be titered on a permissive cell line (Vero cells) to detect and quantify productive infection. The final wash from each of these will be titered to control for residual input virus. Candidate virus hits in this assay will be confirmed in tissue culture cells using virus-specific antisera and standard immunofluorescence microscopy.

[0276] Rank Based on all Parameters.

[0277] Several properties contribute to oncolytic killing of tumor cells including: ability to induce apoptosis, rate of virus production, quantity of virus produced, as well as special functions such as syncytia formation. Promising candidates from the initial screen will be characterized further with respect to apoptosis induction (as determined by TUNEL assay and immunofluorescence staining for activated caspase-3), and one step growth curves to compare kinetics and to quantify virus production. These studies will serve as a guide to improving these strains. For example: (1) if a virus kills tumor cells well but shows unacceptable toxicity to normal cells, the inventors will attenuate this virus using one or more of the strategies outline below; (2) alternatively, if a virus shows slower killing kinetics while maintaining a high replication rate, then the inventors may add a toxic or therapeutic transgene; (3) If a candidate virus replicates slowly yet is an effective killer, the inventor will select a variant with increased growth kinetics to boost its potency.

[0278] From the inventors experience with VSV and other oncolytic viruses, they have identified three key in vitro gating criteria to narrow the list of candidates: (1) selective tumor cell killing, (2) productive replication within tumor cells (independent of killing), and (3) efficacy on VSV resistant tumor lines (UACC-62 melanoma, A431 and NCI-H226 lung, DU-145 prostate, HL60 leukemia). Based on these criteria, results from the screening assays described above will be integrated to pare the list for further evaluate in preliminary in vivo testing.

[0279] In Vivo Toxicity and Biodistribution.

[0280] The two routes of administration related to a clinical setting are intravenous (IV) and intracranial (IC) injections. Lead candidates identified during in vitro screening for toxicity and biodistribution in mice following infection will be assessed by these routes. Groups of 3 mice will be infected either by IV at doses of 1×10⁵ to 1×10⁹ pfu, or by IC at 1×10² to 1×10⁶ pfu. In addition to mortality, morbidity will be monitored daily for signs of lethargy, dehydration, weight loss and limb paralysis. Histopathology will be performed on 2 mice from the minimum lethal dose group (highest dose if no lethal dose is achieved) from each candidate virus infection. WT VSV and mock infection will serve as appropriate positive and negative controls respectively. Organs will be harvested from the remaining mouse in this group, homogenized and titered as a preliminary assessment of virus biodistribution.

[0281] For viruses that display an acceptable lethal dose range, the inventors will subsequently assess biodistribution in tumor bearing mice to identify viruses compatible with systemic administration. The inventor will employ three of our existing cancer models representing very different organ targets of critical clinical relevance: (1) CT-26 mouse colon carcinoma (1×10⁵ cells) injected intravenously to form disseminated lungs tumors in syngeneic Balb/C mice (2), 4T1 mouse breast carcinoma (4×10⁵ cells) injected into the fat pad of syngeneic Balb/C mice to form a single primary tumor with spontaneous metastases, and (3) U87 human glioblastoma cells (1×10⁵ cells) stereotatically implanted in the cortex of nude mice. A maximum tolerable dose for each virus and route (IV or IC) will be determined from the preliminary in vivo toxicity experiments. This value will serve as an initial therapeutic dose for biodistribution studies in tumor bearing mice. In groups of 3 mice, tumors will be established for 1 week and then treated IV or IC with a single dose of each candidate virus at their respective MTD. Forty-eight hours post treatment, animals will be perfused with saline to flush any free virus from the circulation, and tumors and organs will be harvested, homogenized and titered to quantify infectious virus. In this fashion, the inventors will determine which viruses can be delivered to tumor sites by systemic injection, as well as the relative tumor selectivity of virus replication in vivo.

[0282] Re-Rank.

[0283] Based on the toxicity, biodistribution, systemic delivery and tumor selectivity profiles in in vivo studies, the inventors will select the best candidates to proceed with detailed characterization and further development.

Example 2

Building Recombinants

[0284] Sequencing and Recombinant System.

[0285] In order to facilitate rapid research and development, subsequent production of clinical material and to ensure the safety and stability of therapeutic viruses, the inventors will clone and rescue recombinant forms selected viruses.

[0286] Many negative strand ssRNA viruses have been cloned and rescued using standard recombinant techniques. The inventors will employ similar strategies that have been adopted successfully for reported recombinant -ssRNA viruses. Briefly, the genome of a candidate virus will be isolated by RNA extraction (Qiagen Corp) from 1×10⁹ virus purified particles. The purified genomic RNA is then primed with random hexamers and reverse transcribed to cDNA, subsequently rendered double-stranded and cloned by ligating EcoRI adapters, size fractionated and finally ligating into an EcoRI digested bacterial plasmid (pT7Blue; Novagen). The result is a library of genomic fragments that can be easily sequenced by standard techniques. Because of the random primed nature of this library, this strategy will not "capture" the extreme 3' and 5' ends. To do this the inventors ligate oligos to the 3' or 5' ends of the purified genomic RNA using T4 RNA ligase. Using primers complementary to the newly ligated oligo flanking the genome, the inventors PCR amplify and clone the ends of the genome for subsequent sequencing. This sequence information is then used to design end-specific primers for amplifying the entire genome, which is then cloned into a specialized plasmid. This plasmid flanks the genome with a T7 promoter on one end and a hepatitis delta self-cleaving ribozyme and T7 terminator sequence on the opposite flank. When transfected into T7 RNA polymerase expressing (previously infected with a T7 expressing vaccinia virus) A549 cells, this plasmid generates viral genomes in the cytoplasm. In parallel, the viruses' coding sequences for N, P and L genes are cloned into CMV promoter driven expression plasmids. Co-transfection of the genome construct with the N, P and L plasmids into these A549 cells reconstitutes the viral replication complex on the viral genome and results in rescue of infectious virus. As a proof of principle the inventors have cloned, genetically manipulated, and rescued Maraba virus using this method. See FIG. 17 and FIG. 18 for examples of Maraba related viruses.

Example 3

Optimization/Augmentation

[0287] The non-VSV rhabdoviruses are feral viruses; and as with all oncolytic viruses reported thus far, including VSV, the inventors predict that these field isolates will benefit from further optimization through in vitro selection and/or recombinant engineering strategies. Some candidates may require attenuation (e.g., Maraba virus) while some may require augmentation of their replication and/or tumor killing kinetics (e.g., Muir Springs virus). The following is a summary of several strategies the inventors will employ to maximize the effectiveness of newly identified therapeutic viruses.

[0288] Engineered Mutations.

[0289] VSV blocks nuclear/cytoplasmic mRNA transport as a means to defeat host cell innate immunity. The inventors have previously described engineering mutations into the M protein of VSV to disable this activity and thereby selectively attenuate this virus in normal cells. Given that other members of the vesiculoviruses genus have also demonstrated this ability (Chandipura, and spring viremia of carp) and that most vesiculoviruses sequenced thus far (VSV, Chandripura, Piry, Cocal, spring viremia of carp, Maraba) have the critical sequence motif required by VSV for this function, the inventors contemplate attenuate of non-VSV rhabdovirus in an analogous fashion to that used for VSV. However, other rhabdoviruses such as rabies and bovine ephemeral fever virus do not have this motif and do not block nuclear cytoplasmic mRNA transport and perhaps will not be amenable to this strategy of attenuation. As more information becomes available regarding rhabdovirus/host interaction from consortium labs and others, additional structure/functioned-guided manipulations to attenuate theses viruses will be possible.

[0290] Transgenes.

[0291] There are now several reports of "arming" oncolytic viruses with suicide genes or immune mediators to increase their potency. The inventors will focus on adding transgenes to increase the cytotoxicity of candidate viruses that show efficient replication, but insufficient tumor killing. The inventors have a priority-weighted list of transgenes that are currently being engineered into Maraba virus. At present the ranking consists of: (1) Apoptosis Inducing Factor (AIF)--an oxido-reductase homolog responsible for chromatin collapse and degradation in a caspase-independent manner. (2) HaraKiri--the most potent of the BH3-only pro-apoptotic member of the Bcl-2 family responsible for induction of conventional caspase-dependent apoptosis (Type I PCD). (3) XAF1--a potent tumor suppressor gene and direct inhibitor of the IAP family. (4) Atg4B--the key protease responsible for initiating autophagy (Type II PCD).

[0292] Ultimately, members of the intrinsic or extrinsic pathways of cell death could be engineered with Tat or other protein transduction domains to be secreted from virus infected cells to induce bystander killing within the tumor mass. The inventors remain cognizant that other bystander killing effects maybe mediated through components of the host immunity to virus and/or tumor. Thus an alternative strategy would be to engineer a transgene(s) to draw immune cells to sites of infection. Evidence indicates that virus infection of CT26 lung tumors induces neutrophils to infiltrate the tumor and cause a massive apoptotic bystander killing effect.

[0293] Directed Evolution to Improve Oncolytic Rhabdoviruses.

[0294] Many examples of directed evolution have been described where the replication fitness of a parental virus strain was either increased or decreased by serial passage in mammalian cell culture. Rhabdoviruses are particularly amenable to this type of procedure as they exist not as a single entity, but as a population of strains called a quasi-species. The members of the quasi-species represent point mutants of the dominant genome. When an appropriate selection pressure is applied, the fittest member of the population is selected for, and becomes the dominant genome. This has tremendous utility in efforts to build a better oncolytic virus because it provides one with a ready-made collection of mutants from which to select a variant with better oncolytic capabilities. Thus, to attenuate a given candidate, the inventors will select small plaque mutants on primary fibroblasts and subsequently amplify this cloned virus on tumor cells to back-select against non-productive mutations (i.e., mutations which uniformly debilitate, such as polymerase mutations, as opposed to specific disabilities in normal cells/tissues). By performing this in iterative cycles at high MOI (10 pfu/cell), the inventors expect to isolate a mutant that maintains robust replication in tumor cells, yet has lost the ability to productively infect healthy normal cells. Alternatively, the inventors may augment the potency of non-VSV rhabdoviruses, either by selecting faster replicators, or more lethal killers. To speed up the replication rate of a candidate virus the inventors will perform iterative rounds of infection/replication in tumor cell lines, but at each subsequent round will decrease the post infection harvest time. This selection pressure will force viruses to evolve towards rapid replication. If enhanced cytotoxicity is desirable, the inventors will infect resistant or recalcitrant tumor cell lines (1×10⁶ cells) with candidate viruses (MOI=1). Live cells will subsequently be stained with JC1 vital dye to detect early apoptosis events by dual color flow cytometry. Cells undergoing apoptosis will be sorted onto monolayers of Vero cells to recover the virus replicating within them. Iterative rounds of this assay, again with decreasing harvest times, will select for a more rapidly lethal phenotype. Viruses improved in this way will be sequenced to map the genetic alterations and contribute to our structure/function analysis efforts toward better understanding of the biology of rhabdoviruses and oncolysis. The reverse genetic screen allows for an unbiased approach to improving rhabdoviruses, and represents a good complement to efforts to make improvements through recombinant engineering of transgenes or rational mutations based on structure/function studies.

Example 4

In Vivo Testing of Novel Recombinant Oncolytic Rhabdovirus(es)

[0295] The inventors have chosen to use orthotopic models of cancer as they more accurately recapitulate the human clinical disease. However, unlike subcutaneous tumor models, orthotopic tumors are not readily accessible and therefore difficult to assess without sacrificing the experimental animal. To solve this problem, a multimodal optical imaging technology is adopted that allows non-invasive imaging, and repeated measure the growth or regression of the implanted tumors, as well as the development or regression of distal metastatic lesions. The inventors have a highly sensitive fully integrated whole animal imaging platform (IVIS 200; Xenogen Corp) that can detect photons emitted even from within deep tissue. It can measure fluorescent light emitted by recombinant fluorescent proteins such as GFP as well as detect luciferase-generated bioluminescence. By using substrate-specific luciferase reporter genes, one expressed from the virus and the other expressed from tumor cells, the inventors can measure the bioluminescence resulting from virus replication concurrently with tumor measurements. To do this the inventors have cloned either YFP or a novel monomeric RFP in frame with either firefly luciferase or a novel renilla-like luciferase from the marine copepod Gaussia princeps. Between these two coding sequences the inventors have engineered a translation "stop-restart" sequence of 30 amino acids. This small motif comes from the foot and mouth disease virus and allows for the stoichiometric expression of two proteins from a single mRNA, is very small and does not suffer from cell to cell variability as do IRES motifs. These dual reporter constructs were cloned into lentivirus vectors, packaged into virus, and used to establish stable reporter tagged 4T1, CT26 and U87 human glioblastoma cells. These cells lines are used in three orthotopic mouse tumor models: U87 human gliomas implanted intracranially into CD-1 nude mice; 4T1 mouse breast carcinoma cells implanted into the fat pad of Balb/C females (spontaneous, aggressive metastatic disease model); CT-26 colon carcinoma injected into the tail vein of Balb/C mice (disseminated tumors in the lung). The choice of orthotopic model was predicated on the following criteria: aggressive, rapidly developing tumor, and therefore challenging to treat; represent very different organ targets; span both immune competent and immunocompromised host systems.

[0296] The first studies will be to evaluate dose response characteristics in our models to identify an optimal dose. From preliminary toxicity experiments, the inventors will have defined an MTD for each of our candidate strains in non-tumor bearing Balb/C animals. Therefore the inventors will test doses from the MTD, decreasing in half log intervals down to 1×10³ pfu. Using the IVIS to image replication in the established tumors, kinetics of initial virus delivery and duration of subsequent replication will be studied as a function of dose. In parallel studies, mice will be sacrificed during this time course and examined using fluorescence microscopy to determine how dose affects the ability to reach all portions of the tumor and distal metastatic lesions. Healthy tissue will be examined to assess tumor specific replication. Finally, safety at each dose will be determined by monitoring mice for any signs of morbidity such as weight loss, dehydration, and behavioral changes. Tumor responses to the viruses in head-to-head comparisons will be assessed following single dose IV treatment. The sensitivity and quantitative nature of optical imaging technology make it ideally suited for this purpose. Thus tumors will be established as described above and monitor tumor growth or regression following virus dosing and compare these results to UV inactivated virus controls. Based on previous work with VSV, it is contemplated that a single dose may not be sufficient for complete and durable tumor regressions. This necessitates a series of experiments to determine the most efficacious number and timing of doses. In a strategy similar to that described above, the inventors will use tumor models to develop maximally effective dosing strategies. This will be done while monitoring for virus deliver to the tumor, replication, duration of replication at the tumor bed and spread to distant tumor sites, in concert with tumor growth/regression. In addition, the inventors will examine immune cell infiltration and activation in tumor beds and surrounding lymph nodes using flow cytometry and immunohistochemistry as another parameter of oncolytic activity. Ultimately, efficacy will be confirmed by monitoring these mice for overall survival, and/or time to progression; comparing virus treated groups with those treated with UV-inactivated virus as controls. An example of the animal model can be found in FIG. 13.

[0297] Cycle Back to Optimization/Augmentation.

[0298] It may be that several cycles of optimization and then re-testing will be required to ultimately develop a maximally effective therapeutic virus. Therefore, the inventors will use the results from in vivo testing to guide additional rounds of biological and/or recombinant optimization and then re-test in tumor models.

TABLE-US-00005 TABLE 4 Rhabdovirus mediated cell killing on the NCI 60 cell panel. Cells from the NCI 60 cell panel were plated in 6 well plates to a confluency of 90%. These cells were infected at log dilutions with various rhabdoviruses, as indicated. After 48 hours, the monolayers were washed, fixed and stained with crystal violet to score for viable cells. Values represent the pfu required to kill 50% of cells within 48 h. Malignancy Cell Line Chandipura Maraba Carajas Isfahan Klamath Sawgrass VSV HR NSC LUNG A549-ATCC ≦10² ≦10² 10⁴ 10⁵ ≧10⁶ NE ≧10⁶ NSC LUNG EKVX ≦10² .sup. 10³ ≧10⁶ 10³ NSC LUNG HOP92 .sup. 10³ .sup. 10³ 10⁵ ≦10² NSC LUNG NCI-H226 ≧10⁶ ≧10⁶ 10⁴ NSC LUNG NCI-H23 ≦10² ≦10² ≦10² .sup. 10⁴ ≦10² MELANOMA LOX IMVI ≦10² 103 10³ ≦10² MELANOMA M 14 .sup. 10³ ≦10² 10³ ≧10⁶ 10⁵ MELANOMA SK-MEL-2 ≦10² .sup. 10³ ≦10² MELANOMA MALME 3M .sup. 10³ .sup. 10⁵ 10⁵ 10³ 10⁵ MELANOMA UACC-257 ≦10² ≦10² ≦10² 10³ ≦10² MELANOMA UACC-62 ≦10² 10³ ≧10⁶ LEUKEMIA MOLT-4 .sup. 10³ ≦10² LEUKEMIA K-562 .sup. 10⁵ OVARIAN OVCAR-3 .sup. 10³ ≦10² OVARIAN OVCAR-4 .sup. 10³ ≦10² 10⁵ 10⁴ ≧10⁶ .sup. 10⁴ 10³ OVARIAN OVCAR-8 NE ≧10⁶ ≧10⁶ NE NE 10³ OVARIAN SK-OV-3 ≦10² .sup. 10⁵ 10⁵ ≧10⁶ ≧10⁶ 10⁴ CNS SF-268 ≦10² 10⁴ 10⁴ CNS SF-539 ≦10² ≦10² 10³ 10⁴ 10⁵ CNS SNB-19 .sup. 10³ .sup. 10⁴ ≦10² ≦10² CNS SNB-75 .sup. 10³ .sup. 10³ NE 10⁵ ≧10⁶ ≦10² COLON HT29 .sup. 10⁴ ≧10⁶ NE NE NE 10⁵ COLON COLO 205 ≦10² ≦10² ≧10⁶ 10³ COLON HCT-15 .sup. 10⁵ .sup. 10⁴ 10⁵ ≧10⁶ 10³ COLON SW-620 ≦10² ≦10² 10³ 10⁵ ≦10² BREAST HS 578T ≧10⁶ ≧10⁶ ≧10⁶ 10⁴ BREAST MDA-MB-435 ≦10² ≦10² ≦10² 10³ ≦10² RENAL TK-10 ≦10² .sup. 10³ 10⁴ 10⁴ RENAL 786-O .sup. 10⁴ ≦10² 10⁵ 10⁵ 10⁵ RENAL ACHN .sup. 10⁵ .sup. 10³ 10⁵ ≧10⁶ NE ≦10² RENAL A498 .sup. 10⁵ .sup. 10⁵ ≧10⁶ 10⁴ PROSTATE DU-145 ≦10² ≧10⁶ ≧10⁶ PROSTATE PC-3 ≧10⁶ NE ≦10² MOUSE COLON CT26 ≦10² ≦10² ≧10⁶ NE ≦10²

TABLE-US-00006 TABLE 5 Focused comparison between four rhabdoviruses. Cells from the NCI 60 cell panel were plated in 6 well plates to a confluency of 90%. These cells were infected at log dilutions with various rhabdoviruses, as indicated. After 48 hours, the monolayers were washed, fixed and stained with crystal violet to score for viable cells. Values represent the pfu required to kill 50% of cells within 48 h. Chandipura Maraba Carajas WT VSV Lung A549 ≦10² ≦10² 10⁴ ≧10⁶ H226 ≧10⁶ ≧10⁶ 10⁴ ≦10² melanoma M14 10³ ≦10² 10³ 10⁵ Malme 3M 10³ 10⁵ 10⁵ 10⁵ UACC-62 ≦10² 10³ ≧10⁶ leukemia K562 10⁵ 10³ Ovarian OVCAR4 10³ ≦10² 10⁵ 10³ OVCAR8 ≧10⁶ ≧10⁶ 10³ SK-OV-3 ≦10² 10⁵ 10⁵ 10⁴ CNS SF268 ≦10² 10⁴ 10⁴ SF539 ≦10² ≦10² 10³ 10⁵ Colon HCT-15 10⁵ 10⁴ 10⁵ 10³ Breast HS578T ≧10⁶ ≧10⁶ 10⁴ Renal 786-O 10⁴ ≦10² 10⁵ 10⁵ ACHN 10⁵ 10³ 10⁵ ≦10² Prostate DU-145 ≦10² ≧10⁶ PC-3 ≧10⁶ ≦10²

[0299] Differences between VSV and other rhabdoviruses on the NCI 60 cell panel include: (1) preferential killing by Maraba virus compared to VSV of A549 lung, M14 melanoma, UACC-62 melanoma, SF268 CNS, SF539 CNS, 786-0 renal, DU-145 prostate; (2) preferential killing by Carajas virus compared to VSV for M14 melanoma, UACC-62 melanoma, SF539 CNS; preferential killing by VSV for H226 lung, K562 leukemia, OVCAR-8 ovarian, HCT-15, HS578T breast, and PC-3 prostate. All other cell lines of the 60 cell panel show similar susceptibilities to VSV, Maraba and Carajas and Chandipura

TABLE-US-00007 TABLE 6 In vitro killing of selected transformed and immortalized cells by novel rhabdoviruses. Cells were plated in 6 well dishes and allowed reach 75% confluency. These cells were subsequently infected with each virus at a fixed titer. Cultures were scored visually for cell death after 96 h. 4+ = 100% obliterated, 3+ = 75-90% dead, 2+ = 50% dead, 1+ = <30% dead, -- = no death. Muir Rio Lc Farmington Springs Grande Ngaingan Tibrogargan Dantec Kwatta Human 293T ++++ ++++ +++ ++ + Mouse 4T1 + + ++ + Human SW620 +++ +++ +++ + Hamster BIIKT7 + +++ +++ +++ +++ Human U2OS ++++ ++ ++++ ++++ monkey Vero +++ ++++ +++ ++++

Example 5

Chimeric Rhabdoviruses

[0300] One potential problem with oncolytic viral compositions is the potential for an immune response in a patient. Such an immune response may blunt the effectiveness of further applications of oncolytic virus since a significant portion of the applied virus may be neutralized by the patient's immune system. To avoid this problem is would be preferable to have a plurality of oncolytic viral compositions that are immunologically distinct. In this case a different oncolytic virus may be applied to a patient for each subsequent therapy thereby providing sustained oncolytic activity that is minimally effected by a host immune response. To this end a number of pseudotyped viral compositions were constructed and tested for their ability to infect cells.

[0301] To study the possibility of using oncolytic Rhabdoviruses that comprises various G proteins from a number of Rhabdoviruses various recombinant viruses were constructed. Each recombinant included the VSV Indiana wild type backbone (N, P, M and L genes) unless otherwise specified. Furthermore, recombinants included a luciferase reporter gene, either Firefly (FL) or Renilla (RL) between the G and the L gene. The general nomenclature used to refer to the recombinants is RVR_aG^x, wherein RVR stands for Rhabdovirus recombinant, (a) denotes the origin to the G-protein or G-protein-like gene and (x) denotes the version number.

[0302] RVR with Isfahan G Protein.

[0303] A RVR genome was cloned into the pXN2VSV vector such that XhoI and NheI restriction sites flanked the G or G-like genes. The viral stop start sequence was added to the 3' end of all G or G-like genes which encoded the following sequence: CTCGAGGGTATGAAAAAAACTAACAGATATCACGGCTAG (SEQ ID NO:25). Recombinant virus was pscudotyped with the Isfahan G protein which has a protein sequence identity of 37% compared to VSV G Ind. The RVR comprising the FL reporter gene was designated RVR_Isf (Isfahan) G¹ (wherein version 1 indicates the presence of the FL reporter gene).

[0304] Furthermore antibody neutralization studies showed that scrum comprising antibodies from mice immunized with VSV WT did not significantly neutralize the activity of RVR Isf G1 in vitro.

[0305] Furthermore, when mice immunized with VSV-WT were injected with RVR_IsfG¹ the virus with the Isf G polypeptide is able to evade the immune system. As shown in FIG. 6C, RVR_IsfG¹ was detectable at various locations in immunized mice following viral inoculation. The level of RVR_IsfG¹ detect in the immunized mice was similar to the level detected in naive controls animals (FIG. 6A). On the other hand, no virus was detected in immunized mice that were inoculated with VSV (FIG. 6B). Thus, oncolytic viruses comprising the Isf G polypeptide escape host immune response to previously administered VSV in vivo.

[0306] These results were further confirmed by injecting tumors in immunized naive mice with VSV or recombinant virus and determined the virus yield from the infections. As shown in FIG. 7, recombinant virus injected into tumors of immunized or naive mice yielded large amounts of progeny virus. On the other hand, propagation of VSV injected in immunized mice was barely detectable.

[0307] Two additional RVRs comprising the Isf were also constructed. RVR_IsfG² comprises an RL reporter gene in place of the FL reporter gene from RVR_IsfG¹. Also, RVR_IsfG³ comprises a chimeric VSV-Isf G protein. The chimeric protein (SEQ ID NO:19) comprises the Isfahan G ectodomain with VSV G transmembrane domain and cytoplasmic tail.

[0308] RVR with Chandipura G Protein.

[0309] Chandipura G has a protein sequence homology of 42% with VSV G (Indiana). The same cloning strategy described above was used to construct RVR.sub.ChaG¹. A one step growth curve with RVR.sub.ChaG¹ showed that it produces similar amounts of virus compared to VSV (FIG. 8). Furthermore, the RVR had similar cytotoxicity as compared to VSV (FIG. 9).

[0310] RVR with Maraba G Protein.

[0311] Maraba G has a protein sequence homology 83% to VSV G (Indiana). This is the first report of the sequence of the Maraba G protein provided as a DNA sequence in SEQ ID NO:20. The same cloning strategy described above was used to construct RVR.sub.MarG¹. A one step growth curve with RVR.sub.MarG¹ showed that recombinant virus titer was greater than VSV at 48 and 72 h. Thus, switching the G protein may stabilize the virus and thereby enhance yield (FIG. 10). Furthermore, the RVR.sub.MarG¹ was shown to be cytotoxic (FIG. 11). Furthermore, antibody neutralization assays showed that scrum from mice immunized with VSV WT did not neutralize the activity of RVR.sub.MarG¹ indicating the RVR is capable of immune evasion.

[0312] RVR with Muir Springs G Protein.

[0313] Muir Springs G has 25.4% protein sequence homology to VSV G (Indiana). The Muir Springs G sequence is provided in SEQ ID NO:21 (amino acid) and SEQ ID NO:22 (DNA). The same cloning strategy described above was used to construct RVR.sub.MurG¹.

[0314] RVR with Klamath Virus G Protein.

[0315] Pseudotyping experiments confirmed that the Klamath G protein is functional at in a low pH (6.8) environment, unlike VSV G. This of great importance since it is known that the tumor core is hypoxic and acidic. Thus, it may be an advantage to have a virus which can replicate in such an environment. VSV HRGFP-Klamath pseudotyped were generated such that the virions contained the genome of one virus but the envelope proteins of both viruses by co infection into CT26 Cells. 24 hours after co infection the supernatant was collected and the pseudotyped particles tittered. Pseudotyped virus was then used (along with control virus to infect target cells in media of two different acidity. Results show that the Klamath G protein was responsible for the ability of the virus to infect at low pH.

[0316] Essentially the same cloning strategy described above was used to construct RVR.sub.KlaG². However, unlike previous strategies, this recombinant includes the Klamath G in addition to the original VSV G (Indiana).

[0317] RVR with Farmington (Far) Virus G Protein.

[0318] Farmington virus is a non-vesiculovirus that is non-neurotropic and demonstrates formation of large syncitia.

[0319] RVR with Bahia Grande (Bah) Virus G Protein.

[0320] Bahia Grande virus is a non-vesiculovirus that is non-neurotropic.

[0321] RVR with JSR Retroviral Env Protein.

[0322] Since VSV has a known neurotoxicity, a strategy whereby a VSV recombinant would not infect neurons would be advantageous. JSR Env is originally from the JSRV retrovirus (a non-neurotropic virus) envelope (Env) gene non-neurotropic. A chimera comprising JSRV Env ectodomain with VSV G transmembrane domain and cytoplasmic tail is generated (DNA sequence provided as SEQ ID NO:23).

[0323] RVR with Ebola G Protein.

[0324] Ebola is a non-neurotropic virus with a glycoprotein that functions to bind receptor and mediate membrane fusion. The G protein contains a furin Cleavage site at amino acid position 497-501. The products of cleavage (GP1 & GP2) are linked by disulfide bonds and thought to act as a possible decoy for neutralizing antibodies or immunomodulator. However, the furin cleavage site not required for infection or tropism. The Ebola G protein DNA sequence is provided as SEQ ID NO:24.

REFERENCES

[0325] U.S. Pat. No. 4,554,101

[0326] U.S. Pat. No. 4,683,195

[0327] U.S. Pat. No. 4,683,202

[0328] U.S. Pat. No. 4,684,611

[0329] U.S. Pat. No. 4,800,159

[0330] U.S. Pat. No. 4,879,236

[0331] U.S. Pat. No. 4,883,750

[0332] U.S. Pat. No. 4,946,773

[0333] U.S. Pat. No. 4,952,500

[0334] U.S. Pat. No. 5,220,007

[0335] U.S. Pat. No. 5,279,721

[0336] U.S. Pat. No. 5,284,760

[0337] U.S. Pat. No. 5,302,523

[0338] U.S. Pat. No. 5,322,783

[0339] U.S. Pat. No. 5,354,670

[0340] U.S. Pat. No. 5,366,878

[0341] U.S. Pat. No. 5,384,253

[0342] U.S. Pat. No. 5,389,514

[0343] U.S. Pat. No. 5,399,363

[0344] U.S. Pat. No. 5,464,765

[0345] U.S. Pat. No. 5,466,468

[0346] U.S. Pat. No. 5,538,877

[0347] U.S. Pat. No. 5,538,880

[0348] U.S. Pat. No. 5,543,158

[0349] U.S. Pat. No. 5,550,318

[0350] U.S. Pat. No. 5,563,055

[0351] U.S. Pat. No. 5,580,859

[0352] U.S. Pat. No. 5,589,466

[0353] U.S. Pat. No. 5,591,616

[0354] U.S. Pat. No. 5,610,042

[0355] U.S. Pat. No. 5,635,377

[0356] U.S. Pat. No. 5,641,515

[0357] U.S. Pat. No. 5,656,610

[0358] U.S. Pat. No. 5,702,932

[0359] U.S. Pat. No. 5,736,524

[0360] U.S. Pat. No. 5,739,169

[0361] U.S. Pat. No. 5,780,448

[0362] U.S. Pat. No. 5,789,166

[0363] U.S. Pat. No. 5,789,215

[0364] U.S. Pat. No. 5,798,208

[0365] U.S. Pat. No. 5,801,005

[0366] U.S. Pat. No. 5,824,311

[0367] U.S. Pat. No. 5,830,650

[0368] U.S. Pat. No. 5,830,880

[0369] U.S. Pat. No. 5,840,873

[0370] U.S. Pat. No. 5,843,640

[0371] U.S. Pat. No. 5,843,650

[0372] U.S. Pat. No. 5,843,651

[0373] U.S. Pat. No. 5,843,663

[0374] U.S. Pat. No. 5,846,225

[0375] U.S. Pat. No. 5,846,233

[0376] U.S. Pat. No. 5,846,708

[0377] U.S. Pat. No. 5,846,709

[0378] U.S. Pat. No. 5,846,717

[0379] U.S. Pat. No. 5,846,726

[0380] U.S. Pat. No. 5,846,729

[0381] U.S. Pat. No. 5,846,783

[0382] U.S. Pat. No. 5,846,945

[0383] U.S. Pat. No. 5,849,481

[0384] U.S. Pat. No. 5,849,483

[0385] U.S. Pat. No. 5,849,486

[0386] U.S. Pat. No. 5,849,487

[0387] U.S. Pat. No. 5,849,497

[0388] U.S. Pat. No. 5,849,546

[0389] U.S. Pat. No. 5,849,547

[0390] U.S. Pat. No. 5,851,770

[0391] U.S. Pat. No. 5,851,772

[0392] U.S. Pat. No. 5,851,772

[0393] U.S. Pat. No. 5,853,990

[0394] U.S. Pat. No. 5,853,992

[0395] U.S. Pat. No. 5,853,993

[0396] U.S. Pat. No. 5,856,092

[0397] U.S. Pat. No. 5,858,652

[0398] U.S. Pat. No. 5,861,244

[0399] U.S. Pat. No. 5,863,732

[0400] U.S. Pat. No. 5,863,753

[0401] U.S. Pat. No. 5,866,331

[0402] U.S. Pat. No. 5,866,337

[0403] U.S. Pat. No. 5,866,366

[0404] U.S. Pat. No. 5,871,986

[0405] U.S. Pat. No. 5,882,864

[0406] U.S. Pat. No. 5,900,481

[0407] U.S. Pat. No. 5,905,024

[0408] U.S. Pat. No. 5,910,407

[0409] U.S. Pat. No. 5,912,124

[0410] U.S. Pat. No. 5,912,145

[0411] U.S. Pat. No. 5,912,148

[0412] U.S. Pat. No. 5,916,776

[0413] U.S. Pat. No. 5,916,779

[0414] U.S. Pat. No. 5,919,626

[0415] U.S. Pat. No. 5,919,630

[0416] U.S. Pat. No. 5,922,574

[0417] U.S. Pat. No. 5,925,517

[0418] U.S. Pat. No. 5,925,525

[0419] U.S. Pat. No. 5,925,565

[0420] U.S. Pat. No. 5,928,862

[0421] U.S. Pat. No. 5,928,869

[0422] U.S. Pat. No. 5,928,870

[0423] U.S. Pat. No. 5,928,905

[0424] U.S. Pat. No. 5,928,906

[0425] U.S. Pat. No. 5,929,227

[0426] U.S. Pat. No. 5,932,413

[0427] U.S. Pat. No. 5,932,451

[0428] U.S. Pat. No. 5,935,791

[0429] U.S. Pat. No. 5,935,819

[0430] U.S. Pat. No. 5,935,825

[0431] U.S. Pat. No. 5,939,291

[0432] U.S. Pat. No. 5,942,391

[0433] U.S. Pat. No. 5,945,100

[0434] U.S. Pat. No. 5,981,274

[0435] U.S. Pat. No. 5,994,624

[0436] Abschuetz et al., Cell Tissue Res., 325(3):423-36, 2006.

[0437] Almendro et al., J. Immunol., 57(12):5411-5421, 1996.

[0438] Angel et al., Cell, 49:729, 1987a.

[0439] Angel et al., Mol. Cell. Biol., 7:2256, 1987b.

[0440] Austin-Ward and Villaseca, Revista Medica de Chile, 126(7):838-845, 1998.

[0441] Ausubel et al., In: Current Protocols in Molecular Biology, John, Wiley & Sons, Inc, NY, 1994.

[0442] Bajorin et al., J. Clin. Oncol., 6(5):786-792, 1988.

[0443] Bakhshi et al., Cell, 41(3):899-906, 1985.

[0444] Banerji et al., Cell, 27(2 Pt 1):299-308, 1981.

[0445] Banerji et al., Cell, 33(3):729-740, 1983.

[0446] Bergmann et al., Cancer Res., 61(22):8188-93, 2001.

[0447] Berkhout et al., Cell, 59:273-282, 1989.

[0448] Blanar et al., EMBO J., 8:1139, 1989.

[0449] Blood. 2001 Jun. 15; 97(12):3746-54

[0450] Bodine and Ley, EMBO J., 6:2997, 1987.

[0451] Boshart et al., Cell, 41:521, 1985.

[0452] Bosze et al., EMBO J., 5(7):1615-1623, 1986.

[0453] Braddock et al., Cell, 58:269, 1989.

[0454] Braisted and Wells, Proc. Natl. Acad. Sci. USA, 93(12):5688-5692, 1996.

[0455] Bukowski et al., Clinical Cancer Res., 4(10):2337-2347, 1998.

[0456] Bulla and Siddiqui, J. Virology, 62:1437, 1986.

[0457] Burton and Barbas, Adv. Immunol., 57:191-280, 1994.

[0458] Campbell and Villarreal, Mol. Cell. Biol., 8:1993, 1988.

[0459] Campere and Tilghman, Genes and Dev., 3:537, 1989.

[0460] Campo et al., Nature, 303:77, 1983.

[0461] Carbonclli et al., FEMS Microbiol. Lett., 177(1):75-82, 1999.

[0462] Celander and Haseltine, J. Virology, 61:269, 1987.

[0463] Celander et al., J. Virology, 62:1314, 1988.

[0464] Chandler et al., Cell, 33:489, 1983.

[0465] Chandler et al., Proc. Natl. Acad. Sci. USA, 94(8):3596-601, 1997.

[0466] Chang et al., Mol. Cell. Biol., 9:2153, 1989.

[0467] Chatterjee et al., Proc. Natl. Acad. Sci. USA, 86:9114, 1989.

[0468] Chen and Okayama, Mol. Cell. Biol., 7(8):2745-2752, 1987.

[0469] Choi et al., Cell, 53:519, 1988.

[0470] Christodoulides et al., Microbiology, 144(Pt 11):3027-3037, 1998.

[0471] Cleary and Sklar, Proc. Natl. Acad. Sci. USA, 82(21):7439-7443, 1985.

[0472] Cleary et al., J. Exp. Med., 164(1):315-320, 1986.

[0473] Cocea, Biotechniques, 23(5):814-816, 1997.

[0474] Coffey et al., Science, 282(5392):1332-4, 1998.

[0475] Cohen and Wittenauer, J. Cardiovase. Pharmacol., 10:176-181, 1987.

[0476] Costa et al., Mol. Cell. Biol., 8:81-90, 1988.

[0477] Cripe et al., EMBO J., 6:3745, 1987.

[0478] Culotta and Hamer, Mol. Cell. Biol., 9:1376-1380, 1989.

[0479] Culver et al., Science, 256(5063):1550-1552, 1992.

[0480] Cunningham et al., Science, 244(4908):1081-1085, 1989.

[0481] Dandolo et al., J. Virology, 47:55-64, 1983.

[0482] Davidson et al., J. Immunother., 21(5):389-398, 1998.

[0483] de Villiers et al., Nature, 312(5991):242-246, 1984.

[0484] Deschamps et al., Science, 230:1174-1177, 1985.

[0485] Dillman, Cancer Biother. Radiopharm., 14(1):5-10, 1999.

[0486] Edbrooke et al., Mol. Cell. Biol., 9:1908-1916, 1989.

[0487] Edlund et al., Science, 230:912-916, 1985.

[0488] European Appln. 320 308

[0489] European Appln. 329 822

[0490] Fechheimer, et al., Proc Natl. Acad. Sci. USA, 84:8463-8467, 1987.

[0491] Feng and Holland, Nature, 334:6178, 1988.

[0492] Firak and Subramanian, Mol. Cell. Biol., 6:3667, 1986.

[0493] Foecking and Hofstetter, Gene, 45(1):101-105, 1986.

[0494] Fraley et al., Bio/Technology, 3:629-635, 1985.

[0495] Frohman, In: PCR Protocols: A Guide To Methods And Applications, Academic Press, N.Y., 1990.

[0496] Fuerst et al., Proc. Natl. Acad. Sci. USA, 3:8122-8126, 1986.

[0497] Fuerst et al., Proc. Natl. Acad. Sci. USA, 3: 8122-26, 1986.

[0498] Fujita et al., Cell, 49:357, 1987.

[0499] GB Appln. 2 202 328

[0500] Gilles et al., Cell, 33:717, 1983.

[0501] Gloss et al., EMBO J., 6:3735, 1987.

[0502] Godbout et al., Mol. Cell. Biol., 8:1169, 1988.

[0503] Goodbourn and Maniatis, Proc. Natl. Acad. Sci. USA, 85:1447, 1988.

[0504] Goodbourn et al., Cell, 45:601, 1986.

[0505] Gopal, Mol. Cell. Biol., 5:1188-1190, 1985.

[0506] Graham and Van Der Eb, Virology, 52:456-467, 1973.

[0507] Greene et al., Immunology Today, 10:272, 1989.

[0508] Gromeier et al., Proc. Natl. Acad. Sci. USA, 97(12):6803-8, 2000.

[0509] Grosschedl and Baltimore, Cell, 41:885, 1985.

[0510] Grote et al., Blood., 97(12):3746-54, 2001.

[0511] Hanibuchi et al., Int. J. Cancer, 78(4):480-485, 1998.

[0512] Harland and Weintraub, J. Cell Biol., 101(3):1094-1099, 1985.

[0513] Haslinger and Karin, Proc. Natl. Acad. Sci. USA, 82:8572, 1985.

[0514] Hauber and Cullen, J. Virology, 62:673, 1988.

[0515] Heise et al., Nat. Med., 6(10):1134-9, 2000.

[0516] Hellstrand et al., Acta Oncologica, 37(4):347-353, 1998.

[0517] Hen et al., Nature, 321:249, 1986.

[0518] Hensel et al., Lyntphokine Res., 8:347, 1989.

[0519] Herr and Clarke, Cell, 45:461, 1986.

[0520] Hilton et al., J. Biol. Chem., 271(9):4699-4708, 1996.

[0521] Hirochika et al., J. Virol., 61:2599, 1987.

[0522] Hirsch et al., Mol. Cell. Biol., 10:1959, 1990.

[0523] Holbrook et al., Virology, 157:211, 1987.

[0524] Holden et al., EMBO J., 6:1565-1570, 1987.

[0525] Horlick and Benfield, Mol. Cell. Biol., 9:2396, 1989.

[0526] Huang et al., Cell, 27:245, 1981.

[0527] Hug et al., Mol. Cell. Biol., 8:3065-3079, 1988.

[0528] Hui and Hashimoto, Infection Immun., 66(11):5329-5336, 1998.

[0529] Hwang et al., Mol. Cell. Biol., 10:585, 1990.

[0530] Imagawa et al., Cell, 51:251, 1987.

[0531] Imbra and Karin, Nature, 323:555, 1986.

[0532] Imler et al., Mol. Cell. Biol., 7:2558, 1987.

[0533] Imperiale and Nevins, Mol. Cell. Biol., 4:875, 1984.

[0534] Innis et al., Proc. Natl. Acad. Sci. USA, 85(24):9436-9440, 1988.

[0535] Irie and Morton, Proc. Natl. Acad. Sci. USA, 83(22):8694-8698, 1986.

[0536] Irie et al., Lancet., 1(8641):786-787, 1989.

[0537] Jakobovits et al., Mol. Cell. Biol., 8:2555, 1988.

[0538] Jameel and Siddiqui, Mol. Cell. Biol., 6:710, 1986.

[0539] Jaynes et al., Mol. Cell. Biol., 8:62, 1988.

[0540] Johnson et al., Amer. J. Physiol., 256:H1012-1022, 1989.

[0541] in et al., Gene Ther., 7(19):1672-1679, 2000.

[0542] Kadesch and Berg, Mol. Cell. Biol., 6:2593, 1986.

[0543] Kaeppler et al., Plant Cell Reports, 9:415-418, 1990.

[0544] Kaneda et al., Science, 243:375-378, 1989.

[0545] Karin et al., Mol. Cell. Biol., 7:606, 1987.

[0546] Katinka et al., Cell, 20:393, 1980.

[0547] Katinka et al., Nature, 290:720, 1981.

[0548] Kato et al, J. Biol. Chem., 266:3361-3364, 1991.

[0549] Kawamoto et al., Mol. Cell. Biol., 8:267, 1988.

[0550] Kerschner et al., J. Gen. Virol., 67 (Pt 6):1081-9, 1986.

[0551] Kiledjian et al., Mol. Cell. Biol., 8:145, 1988.

[0552] Kinoh et al., Gene Ther., 11(14):1137-45, 2004.

[0553] Klamut et al., Mol. Cell. Biol., 10:193, 1990.

[0554] Koch et al., Mol. Cell. Biol., 9:303, 1989.

[0555] Kraus et al. FEBS Lett., 428(3):165-170, 1998.

[0556] Kriegler and Botchan, In: Eukaryotic Viral Vectors, Gluzman (Ed.), Cold Spring Harbor: Cold Spring Harbor Laboratory, NY, 1982.

[0557] Kriegler and Botchan, Mol. Cell. Biol., 3:325, 1983.

[0558] Kriegler et al., Cell, 38:483, 1984.

[0559] Kriegler et al., Cell, 53:45, 1988.

[0560] Kriegler et al., In: Cancer Cells 2/Oncogenes and Viral Genes, Van de Woude et al. eds, Cold Spring Harbor, Cold Spring Harbor Laboratory, 1984.

[0561] Kriegler et al., In: Gene Expression, Alan Liss (Ed.), Hamer and Rosenberg, New York, 1983

[0562] Kuhl et al., Cell, 50:1057, 1987.

[0563] Kunz et al., Nucl. Acids Res., 17:1121, 1989.

[0564] Kwoh et al., Proc. Natl. Acad. Sci. USA, 86:1173, 1989.

[0565] Kyte and Doolittle, J. Mol. Biol., 157(1):105-132, 1982.

[0566] Lareyre et al., J. Biol. Chem., 274(12):8282-8290, 1999.

[0567] Larsen et al., Proc. Natl. Acad. Sci. USA., 83:8283, 1986.

[0568] Laspia et al., Cell, 59:283, 1989.

[0569] Latimer et al., Mol. Cell. Biol., 10:760, 1990.

[0570] Lee et al., Biochem. Biophys. Res. Commun., 238(2):462-467, 1997.

[0571] Lee et al., Nature, 294:228, 1981.

[0572] Lee et al., Nucleic Acids Res., 12:4191-206, 1984.

[0573] Levenson et al., Hum. Gene Ther., 9(8):1233-1236, 1998.

[0574] Levinson et al., Nature, 295:79, 1982.

[0575] Lin et al., Cytogenet. Cell Genet., 53:169-171, 1990.

[0576] Logg et al., Hum. Gene Ther., 12(8):921-32, 2001.

[0577] Luria et al., EMBO J., 6:3307, 1987.

[0578] Lusky and Botchan, Proc. Natl. Acad. Sci. USA, 83:3609, 1986.

[0579] Lusky et al., Ma Cell. Biol., 3:1108, 1983.

[0580] Macejak and Sarnow, Nature, 353:90-94, 1991.

[0581] Majors and Varmus, Proc. Natl. Acad. Sci. USA., 80:5866, 1983.

[0582] McNeall et al., Gene, 76:81, 1989.

[0583] Miksicek et al., Cell, 46:203, 1986.

[0584] Mineta et al., Nat. Med., 1(9):938-43, 1995.

[0585] Mitchell et al., Ann. NY Acad. Acad. Sci., 690:153-166, 1993.

[0586] Mitchell et al., J. Clin. Oncol., 8(5):856-869, 1990.

[0587] Mordacq and Linzer, Genes and Dev., 3:760, 1989.

[0588] Moreau et al., Nucl. Acids Res., 9:6047, 1981.

[0589] Morton et al., Arch. Surg., 127:392-399, 1992.

[0590] Muesing et al., Cell, 48:691, 1987.

[0591] Muir Springs and Bahia Grande: J Gen Virol. 1986 June; 67 (Pt 6):1081-9

[0592] Ng et al., Nuc. Acids Res., 17:601, 1989.

[0593] Nicolau and Sene, Biochim. Biophys. Acta, 721:185-190, 1982.

[0594] Nicolau et al., Methods Enzymol., 149:157-176, 1987.

[0595] Nomoto et al., Gene, 236(2):259-271, 1999.

[0596] Ohara et al., Proc. Natl. Acad. Sci. USA, 86:5673-5677, 1989.

[0597] Omirulleh et al., Plant Mol. Biol., 21(3):415-428, 1993.

[0598] Omitz et al., Mol. Cell. Biol. 7:3466, 1987.

[0599] Oncol Res. 1999; 11(3):133-44.

[0600] Ondek et al., EMBO J., 6:1017, 1987.

[0601] Palmiter et al., Cell, 29:701, 1982.

[0602] Palmiter et al., Nature, 300:611, 1982.

[0603] PCT Appln. PCT/US87/00880

[0604] PCT Appln. PCT/US89/01025

[0605] PCT Appln. WO 88/10315

[0606] PCT Appln. WO 89/06700

[0607] PCT Appln. WO 90/07641

[0608] PCT Appln. WO 94/09699

[0609] PCT Appln. WO 95/06128

[0610] Pech et al., Mol. Cell. Biol., 9:396, 1989.

[0611] Pelletier and Sonenberg, Nature, 334(6180):320-325, 1988.

[0612] Perez-Stable and Constantini, Mol. Cell. Biol., 10:1116, 1990.

[0613] Picard and Schaffner, Nature, 307:83, 1984.

[0614] Pietras et al., Oncogene, 17(17):2235-2249, 1998.

[0615] Pinkert et al., Genes and Dev., 1:268, 1987.

[0616] Ponta et al., Proc. Natl. Acad. Sci. USA., 82:1020, 1985.

[0617] Porton et al., Mol. Cell. Biol., 10:1076, 1990.

[0618] Potrykus et al., Mol. Gen. Genet., 199(2):169-177, 1985.

[0619] Qin et al., Proc. Natl. Acad. Sci. USA, 95(24):14411-14416, 1998.

[0620] Queen and Baltimore, Cell, 35:741, 1983.

[0621] Quinn et al., Mol. Cell. Biol., 9:4713, 1989.

[0622] Ravindranath and Morton, Intern. Rev. Immunol., 7: 303-329, 1991.

[0623] Redondo et al., Science, 247:1225, 1990.

[0624] Reisman and Rotter, Mol. Cell. Biol., 9:3571, 1989.

[0625] Remington's Pharmaceutical Sciences" 15th Edition, pages 1035-1038 and 1570-1580, 1990.

[0626] Resendez Jr. et al., Mol. Cell. Biol., 8:4579, 1988.

[0627] Rippe et al., Mol. Cell. Biol., 9(5):2224-22277, 1989.

[0628] Riffling et al., NUC. Acids Res., 17:1619, 1989.

[0629] Rodriguez et al. (1990) J. Virol., 64:4851-4857, 1990.

[0630] Rodriguez et al., J. Virol., 64:4851-4857, 1990.

[0631] Rosen et al., Cell, 41:813, 1988.

[0632] Rosenberg et al., Ann. Surg., 210(4):474-548, 1989.

[0633] Rosenberg et al., N. Engl. J. Med., 319:1676, 1988.

[0634] Sakai et al., Genes and Dev., 2:1144, 1988.

[0635] Sambrook and Russell, Molecular Cloning: A Laboratory Manual 3^rd Ed., Cold Spring Harbor Laboratory Press, 2001.

[0636] Satake et al., J. Virology, 62:970, 1988.

[0637] Schaffner et al., J. Mol. Biol., 201:81, 1988.

[0638] Searle et al., Mol. Cell. Biol.,

5:1480, 1985.

[0639] Shafren et al., Clin. Cancer Res., 10(1 Pt 1):53-60, 2004.

[0640] Sharp and Marciniak, Cell, 59:229, 1989.

[0641] Shaul and Ben-Levy, EMBO J., 6:1913, 1987.

[0642] Sherman et al., Mol. Cell. Biol., 9:50, 1989.

[0643] Sinkovics and Horvath. J. Clin. Virol., 16(1):1-15, 2000.

[0644] Sleigh and Lockett, J. EMBO, 4:3831, 1985.

[0645] Spalholz et al., Cell, 42:183, 1985.

[0646] Spandau and Lee, J. Virology, 62:427, 1988.

[0647] Spandidos and Wilkie, EMBO J., 2:1193, 1983.

[0648] Stephens and Hentschel, Biochem. J., 248:1, 1987.

[0649] Stillman et al., J. Virol., 69: 2946-53, 1995.

[0650] Stillman et al., J. Virol., 69:2946-2953, 1995.

[0651] Stojdl et al., Cancer Cell., 4(4):263-75, 2003.

[0652] Stojdl et al., Nat. Aled., 6(7):821-5, 2000.

[0653] Stuart et al., Nature, 317:828, 1985.

[0654] Sullivan and Peterlin, Mol. Cell. Biol., 7:3315, 1987.

[0655] Swartzendruber and Lehman, J. Cell. Physiology, 85:179, 1975.

[0656] Takada et al., Proc. Natl. Acad. Sci. USA, 1997.

[0657] Takada et al., Proc. Natl. Acad. Sci. USA, 1997.

[0658] Takebe et al., Mol. Cell. Biol., 8:466, 1988.

[0659] Tavernier et al., Nature, 301:634, 1983.

[0660] Taylor and Kingston, Mol. Cell. Biol., 10:165, 1990a.

[0661] Taylor and Kingston, Mol. Cell. Biol., 10:176, 1990b.

[0662] Taylor et al., J. Biol. Chem., 264:15160, 1989.

[0663] Thiesen et al., J. Virology, 62:614, 1988.

[0664] Timiryasova et al., Oncol. Res., 11(3):133-44, 1999.

[0665] Treisman, Cell, 46(4):567-174, 1986

[0666] Tronche et al., Mol. Biol. Med., 7:173, 1990.

[0667] Tronche et al., Mol. Cell. Biol., 9(11):4759-4766, 1989.

[0668] Trudel and Constantini, Genes and Dev., 6:954, 1987.

[0669] Tsujimoto and Croce, Proc. Natl. Acad. Sci. USA, 83(14):5214-5218, 1986.

[0670] Tsujimoto et al., Nature, 315:340-343, 1985.

[0671] Tsumaki et al., J. Biol. Chem., 273(36):22861-22864, 1998.

[0672] Unno et al., Clin. Cancer Res., 11(12):4553-60, 2005.

[0673] Usdin et al., (1993) BioTechniques, 14:222-224, 1993.

[0674] Usdin et al., Bio. Techniques., 14:222-224, 1993.

[0675] Vannice and Levinson, J. Virology, 62:1305, 1988.

[0676] Vasseur et al., Proc. Natl. Acad. Sci. USA., 77:1068, 1980.

[0677] Walker et al., Nucleic Acids Res. 20(7):1691-1696, 1992.

[0678] Wang and Calame, Cell, 47:241, 1986.

[0679] Warren et al., Biochemistry, 35(27):8855-8862, 1996.

[0680] Weber et al., Cell, 36:983, 1984.

[0681] Weinberger et al., Mol. Cell. Biol., 8:988, 1984.

[0682] Wells et al., J. Leukoc. Biol., 59(1):53-60, 1996.

[0683] Winoto and Baltimore, Cell, 59:649, 1989.

[0684] Wong et al., Gene, 10:87-94, 1980.

[0685] Wu et al., J. Exp. Med., 185:1681-1691, 1997.

[0686] Yelton et al., J. Immunol., 155(4):1994-2004, 1995.

[0687] Yutzey et al., Mol. Cell. Biol., 9:1397-1405, 1989.

[0688] Zeng et al., Biochemistry, 35(40):13157-13164, 1996.

[0689] Zhao-Emonet et al., Biochim. Biophys. Acta, 1442(2-3):109-119, 1998.

Sequence CWU 1

1

28111068DNAMaraba Virus 1ctgttacagt caagagagtc attgatgatt cactcatcac ccccaaattg cctgcgaatg 60aggaccctgt ggagtaccct gctgattatt tcaaaaagtc ccgtgatatt ccggtgtaca 120taaacacgac caaaagtttg tctgatttgc ggggctatgt ttatcaaggc ctaaagtcag 180gcaacatctc tataattcat gtcaacagtt atctgtatgc agcattaaaa gagatcagag 240gaaaattgga cagagattgg atcacctttg gtatccaaat cggaaaaaca ggagatagcg 300tggggatatt cgatttactg accctaaaac ctctagatgg tgttttacca gatggggtgt 360ctgatgctac tcgaactagc tcagacgatg catggcttcc actgtatcta ttggggttat 420acagagttgg tcgaacacag atgccagaat acaggaagaa gctgatggat ggtctgatta 480atcaatgtaa gatgatcaat gagcagtttg aaccactgtt gccagaagga agagatgtct 540ttgatgtctg gggaaatgac agcaattaca caaagattgt ggccgctgta gatatgttct 600tccatatgtt caaaaagcat gagaaggcct ctttcaggta tggcacaata gtgtcaagat 660ttaaggattg tgcagcattg gctacatttg gtcatctgtg taagatcact ggtatgtcca 720ctgaagatgt gacaacttgg attctaaaca gggaggtggc tgatgagatg gttcaaatga 780tgtacccagg acaggagata gataaggctg attcttacat gccttatcta atcgacttag 840gtctgtcctc aaaatctcca tatccatcag ttaaaaatcc agctttccat ttttggggtc 900aattgaccgc attgttactg agatcaacca gagccagaaa tgcacgtcag ccggatgaca 960tcgagtatac atccctgacc actgctgggc tgttgtatgc atatgccgtt ggttcgtctg 1020cagacctggc tcaacaattc tacgttgggg acaacaagta tgtgccagaa actggagatg 1080gaggattaac caccaatgca ccgccacaag ggcgagatgt ggtcgagtgg cttagttggt 1140ttgaagatca aaacagaaaa cctaccccag acatgctcat gtatgctaag agagctgtca 1200gtgctttaca aggattgagg gagaagacga ttggcaagta cgccaagtca gagtttgaca 1260aatgacaact cactcaccat atgtattact acctttgctt catatgaaaa aaactaacag 1320cgatcatgga tcagctatca aaggtcaagg aattccttaa gacttacgcg cagttggatc 1380aagcagtaca agagatggat gacattgagt ctcagagaga ggaaaagact aattttgatt 1440tgtttcagga agaaggattg gagattaagg agaagccttc ctattatcgg gcagatgaag 1500aagagattga ttcagatgaa gacagcgtgg atgatgcaca agacttaggg atacgtacat 1560caacaagtcc catcgagggg tatgtggatg aggagcagga tgattatgag gatgaggaag 1620tgaacgtggt gtttacatcg gactggaaac agcctgagct ggaatccgac ggggatggga 1680aaactctccg attgacgata ccagatggat tgactgggga gcagaagtcg caatggcttg 1740ccacgattaa ggcagttgtt cagagtgcta aatattggaa catctcagaa tgttcatttg 1800agagttatga gcaaggggtt ttgattagag agagacaaat gactcctgat gtctacaaag 1860tcactcctgt tttaaatgct ccaccggttc aaatgacagc taatcaagat gtttggtctc 1920tcagcagcac tccatttaca tttttgccca agaaacaagg tgtgactcca ttgaccatgt 1980ccttagaaga actcttcaac acccgaggtg aattcatatc tctgggagga aacgggaaaa 2040tgagtcaccg ggaggccatc attctagggt tgagacacaa gaagctctat aatcaagcca 2100gactaaagta taacttagct tgaatatgaa aaaaactaac agatatcaaa agatatctct 2160aactcagtcc attgtgttca gttcaatcat gagctctctc aagaaaattt tgggtattaa 2220agggaaaggg aagaaatcta agaaattagg tatggctccc ccaccctatg aagaagagac 2280tccaatggaa tattctccaa gtgcacctta tgataagtca ttgtttggag tcgaagatat 2340ggatttccat gatcaacgtc aactccgata tgagaaattt cacttctcat tgaagatgac 2400tgtgagatca aacaaaccat ttcgaaatta tgatgacgtt gcagcagcgg tgtccaattg 2460ggatcatatg tacatcggca tggcaggaaa acgtcctttt tataagatat tagcattcat 2520gggttctact ctattgaagg ctacaccagc tgtcttggct gaccaaggac agccagaata 2580tcatgctcac tgtgagggac gagcttactt gccgcatcgg ttagggccga cccctccgat 2640gttgaatgtc cctgaacatt ttcgccgtcc atttaacatc ggattattca gagggacaat 2700cgacataacc ctggtacttt tcgatgatga atctgtagat tctgccccgg tcatatggga 2760tcattttaat gcatccagat tgagcagctt cagagaaaag gctttgttgt ttggtttgat 2820tctagaaaag aaagccactg ggaattgggt attggactct attagtcatt tcaagtaatt 2880atcacaagtg ttgaggtgat gggcagacta tgaaaaaaac taacagggtt caaacactct 2940tgatcgaggt acccagttat atttgttaca acaatgttga gactttttct cttttgtttc 3000ttggccttag gagcccactc caaatttact atagtattcc ctcatcatca aaaagggaat 3060tggaagaatg tgccttccac atatcattat tgcccttcta gttctgacca gaattggcat 3120aatgatttga ctggagttag tcttcatgtg aaaattccca aaagtcacaa agctatacaa 3180gcagatggct ggatgtgcca cgctgctaaa tgggtgacta cttgtgactt cagatggtac 3240ggacccaaat acatcacgca ttccatacac tctatgtcac ccaccctaga acagtgcaag 3300accagtattg agcagacaaa gcaaggagtt tggattaatc caggctttcc ccctcaaagc 3360tgcggatatg ctacagtgac ggatgcagag gtggttgttg tacaagcaac acctcatcat 3420gtgttggttg atgagtacac aggagaatgg attgactcac aattggtggg gggcaaatgt 3480tccaaggagg tttgtcaaac ggttcacaac tcgaccgtgt ggcatgctga ttacaagatt 3540acagggctgt gcgagtcaaa tctggcatca gtggatatca ccttcttctc tgaggatggt 3600caaaagacgt ctttgggaaa accgaacact ggattcagga gtaattactt tgcttacgaa 3660agtggagaga aggcatgccg tatgcagtac tgcacacaat gggggatccg actaccttct 3720ggagtatggt ttgaattagt ggacaaagat ctcttccagg cggcaaaatt gcctgaatgt 3780cctagaggat ccagtatctc agctccttct cagacttctg tggatgttag tttgatacaa 3840gacgtagaga ggatcttaga ttactctcta tgccaggaga cgtggagtaa gatacgagcc 3900aagcttcctg tatctccagt agatctgagt tatctcgccc caaaaaatcc agggagcgga 3960ccggccttca ctatcattaa tggcactttg aaatatttcg aaacaagata catcagagtt 4020gacataagta atcccatcat ccctcacatg gtgggaacaa tgagtggaac cacgactgag 4080cgtgaattgt ggaatgattg gtatccatat gaagacgtag agattggtcc aaatggggtg 4140ttgaaaactc ccactggttt caagtttccg ctgtacatga ttgggcacgg aatgttggat 4200tccgatctcc acaaatcctc ccaggctcaa gtcttcgaac atccacacgc aaaggacgct 4260gcatcacagc ttcctgatga tgagacttta ttttttggtg acacaggact atcaaaaaac 4320ccagtagagt tagtagaagg ctggttcagt agctggaaga gcacattggc atcgttcttt 4380ctgattatag gcttgggggt tgcattaatc ttcatcattc gaattattgt tgcgattcgc 4440tataaataca aggggaggaa gacccaaaaa atttacaatg atgtcgagat gagtcgattg 4500ggaaataaat aacagatgac gcatgagggt cagatcagat ttacagcgta agtgtgatat 4560ttaggattat aaaggttcct tcattttaat ttgttacaga ctgtatgaaa aaaactcatc 4620aacagccatc atggatgtta acgattttga gttgcatgag gactttgcat tgtctgaaga 4680tgactttgtc acttcagaat ttctcaatcc ggaagaccaa atgacatacc tgaatcatgc 4740cgattataat ttgaattctc ccttaatcag cgatgatatt gatttcctga tcaagaaata 4800taatcatgag caaattccga aaatgtggga tgtaaagaat tgggagggag tgttagagat 4860gttgacagcc tggcaagcca gtccaatttt atctagcact atgcataagt gggtgggaaa 4920gtggctcatg tctgatgatc atgacgcaag ccaaggcttc agttttcttc atgaagtgga 4980caaagaagct gatctgacgt ttgaggtggt ggagacattc attagaggat ggggaggtcg 5040agaattgcag tacaagagga aagacacatt tccggactcc tttagagttg cagcctcatt 5100gtgtcaaaaa ttccttgatt tgcacaaact cactctgata atgaattcag tctctgaagt 5160cgaacttacc aacctagcaa agaattttaa aggaaaaaac aggaaagcaa aaagcggaaa 5220tctgataacc agattgaggg ttcccagttt aggtcctgct tttgtgactc agggatgggt 5280gtacatgaag aagttggaaa tgattatgga tcggaatttt ttgttgatgt tgaaagacgt 5340tatcatcggg aggatgcaga cgatcctgtc catgatctca agagatgata atctcttctc 5400cgagtctgat atctttactg tattaaagat ataccggata ggggataaga tattagaaag 5460gcaagggaca aagggttacg acttgatcaa aatgattgag cctatttgta acttaaagat 5520gatgaatctg gcacgtaaat atcgtcctct catccctaca tttcctcatt ttgaaaaaca 5580tattgctgac tctgttaagg aaggatcgaa aatagacaaa gggattgagt ttatatatga 5640tcacattatg tcaatccctg gtgtggactt gaccttagtt atttacggat catttcggca 5700ctggggtcat ccttttatca actactatga gggcttagag aagctacaca agcaggttac 5760aatgcccaag actattgaca gagaatatgc agaatgtctt gctagtgatc tggcaagaat 5820cgttcttcag caacaattca atgaacataa gaaatggttt gttgatgtag ataaagtccc 5880acaatcccat cctttcaaaa gccatatgaa agagaatact tggcctactg cagcccaagt 5940tcaggattac ggcgatcgct ggcatcagct cccactcatc aaatgcttcg aaatcccaga 6000tttgttagat ccatcgatca tctactcaga caaaagtcat tccatgaacc ggtctgaagt 6060actacgacat gtaagactta cacctcatgt gcccattcca agcaggaaag tattgcagac 6120aatgttggag actaaggcaa cagactggaa agagttttta aagaaaattg acgaagaggg 6180gttagaggat gatgatcttg tcataggact caaagggaaa gagagagaat taaaaattgc 6240gggaagattc ttttctttga tgtcctggaa gctcagagag tattttgtca tcactgagta 6300tttgattaag acgcactttg tcccgatgtt taaagggttg accatggcgg atgacttgac 6360agcggtgata aagaagatga tggacacatc ttcaggacaa ggcttagata attatgaatc 6420catttgtata gccaaccata ttgactatga gaagtggaac aatcatcaaa gaaaagagtc 6480gaacgggccc gtgttcaagg tgatgggtca attcttggga tatccacgtc tgattgagag 6540aactcatgaa ttttttgaga agagtctgat atattacaat ggacgaccag atctgatgcg 6600ggttcgagga aattctctag tcaacgcctc atctttaaat gtctgctggg agggtcaagc 6660tgggggatta gaaggactgc gacagaaggg atggagtatt ctaaatttgc ttgtcattca 6720gagagaagca aaaataagga acaccgccgt gaaagtgcta gctcaaggtg acaatcaggt 6780gatatgtact cagtataaaa cgaagaaatc ccggaatgat attgagctta aggcagctct 6840aacacagatg gtatctaata atgagatgat tatgtctgcg attaaatcag gcaccgagaa 6900actgggtctt ttgattaatg atgatgagac aatgcaatct gctgattacc tcaattacgg 6960gaaggttccc attttcagag gagtaatcag aggccttgag acaaaaagat ggtcacgcgt 7020gacctgtgtg acaaatgatc agattccaac gtgtgcgaac attatgagct ctgtgtcaac 7080taatgcatta actgtagccc attttgccga gaatccagtc aatgccatca ttcagtataa 7140ctactttgga acatttgcaa ggctactgct gatgatgcat gaccccgctc tgaggatctc 7200tctgtatgaa gtccaatcaa aaattccagg acttcacagt ttgacattta aatattctat 7260gttgtatctg gatccttcga taggaggagt ctccggaatg tcactctcga gattcctcat 7320aagatcattt ccagatccag tgacagaaag tttggcgttc tggaaattta tccactctca 7380tgcaagaagc gattcattaa aggagatatg tgcagttttt ggaaatcctg aaattgcaag 7440atttcggcta actcatgtcg ataaattggt ggaagaccca acctcattga acatagctat 7500gggaatgagt cctgctaatc tattaaagac agaggtaaaa aaatgtctac tggaatcaag 7560gcagagcatc aagaaccaga ttgtaagaga tgctactatt tacctacacc atgaggaaga 7620caaacttcgt agtttcttat ggtccataac accactgttc cctcggttct tgagtgaatt 7680caaatctggg acattcatcg gagtagcaga tggcctgatc agcttatttc agaactctag 7740gactattcga aattctttta aaaagcgtta tcacagggaa cttgatgatt taataatcaa 7800gagcgaagtt tcctcactta tgcatttggg taagctacat ttgaggcgag gctcagttcg 7860tatgtggact tgctcttcta ctcaggctga tcttctccga ttccggtcat ggggaagatc 7920tgttatagga accacagtcc ctcatccctt agagatgtta ggacaacatt ttaaaaagga 7980gactccttgc agtgcttgca acatatccgg attagactat gtatctgtcc actgtccgaa 8040tgggattcat gacgtttttg aatcacgtgg tccactccct gcatatttgg gttctaaaac 8100atccgaatca acttcgatct tgcagccgtg ggagagagag agtaaagtac cgttgattaa 8160gcgtgccaca aggcttcgtg atgcaatttc atggtttgtg tctcccgact ctaacttggc 8220ctcaactatc cttaagaaca taaatgcatt aacaggagaa gaatggtcaa agaagcagca 8280tggatttaaa aggacgggat cggcgttaca caggttctcc acatccagga tgagtcatgg 8340tggttttgct tctcagagta cggctgcctt gactagattg atggcaacta ctgacactat 8400gagagatctg ggagaacaga actatgattt cctgtttcag gcgacattat tgtatgctca 8460aataaccaca actgtagtca ggaatggatc atttcatagc tgcacggacc attaccatat 8520aacctgcaaa tcttgtctga gggccattga tgagattacc ttggattcag cgatggaata 8580tagccctcca gatgtatcat cagttttaca atcttggagg aatggagaag gctcttgggg 8640acatgaagtg aaacaaatat acccagttga aggtgactgg aggggactat ctcctgttga 8700acaatcttat caagtcggac gctgtatcgg gtttctgttc ggtgatctgg cgtatagaaa 8760atcatcccat gcagatgata gctccatgtt tccgttatct atacaaaaca aagtcagagg 8820aagaggcttt ttaaaagggc ttatggatgg gttaatgaga gccagttgtt gccaggtgat 8880ccatcgtcga agcttagccc atctgaagag accggctaat gcagtctatg gagggctgat 8940ttatttgata gacaaattga gtgcatctgc cccttttctt tcactgacga gacatggacc 9000tttaagggaa gaattagaaa ctgttccaca taagataccg acttcttatc ctacgagcaa 9060ccgagatatg ggggtgatag ttcgtaatta ttttaaatat cagtgcagac tggtagaaaa 9120aggtcggtac aagacacatt atcctcaatt gtggcttttc tcagatgtgc tgtccattga 9180tttcttagga cccctgtcta tatcttcaac tctattgggt attctgtata aacagacgtt 9240atcttctcga gacaaaaatg agttgagaga actcgctaac ttgtcttcat tgttgagatc 9300aggagaagga tgggaagata tccatgtcaa attcttctct aaggacactt tactctgccc 9360tgaagagatc cgacatgcgt gcaaatttgg gattgctaag gaatccgctg ttttaagcta 9420ttatcctcct tggtctcaag agtcttatgg aggcatcacc tcgatccccg tatatttttc 9480gaccaggaag tatcccaaaa ttttagatgt ccctcctcgg gttcaaaacc cattggtctc 9540gggtctacga ttggggcaac tccctactgg agcacattat aagattagga gcattgtaaa 9600gaacaagaac cttcgttata gagatttcct tagttgtggg gatggatctg gggggatgac 9660cgcggcacta ttgagagaaa acagacaaag taggggaatc ttcaacagcc tgttagagtt 9720agccggatct cttatgagag gagcatctcc agagcctcca agtgcactgg agacgctcgg 9780gcaagaacga tctaggtgtg tgaatggaag cacatgttgg gagtactcat ctgacctaag 9840ccaaaaagag acatgggatt acttcttaag attgaagaga ggcctgggtt tgaccgtgga 9900cttaatcacc atggacatgg aggtcagaga ccctaataca agtttgatga tagaaaagaa 9960cctcaaagtt tatctgcatc agatattaga accaactggt gtcttaatat ataaaacata 10020cgggacccat attgcgacac aaacagataa tatcctgacg ataatcggtc ctttctttga 10080gacggttgac ctagtccagt ccgaatacag cagctcacaa acgtccgagg tctattttgt 10140aggacgaggc ttgcgctctc atgttgacga accctgggtg gactggccat ccttaatgga 10200caattggaga tccatttatg cttttcatga tcctactaca gaatttatca gagcaaaaaa 10260agtctgtgaa attgacagtc ttataggcat tccggctcaa ttcattccag acccatttgt 10320aaatctcgag accatgctac agatagttgg tgttccaaca ggagtttcgc atgccgcagc 10380tctattatca tcacaatatc caaatcaatt ggtcacaacg tcaatatttt atatgacact 10440cgtgtcttat tataatgtaa accatattcg aagaagcccc aagcctttct ctcctccgtc 10500tgatggagtc tcacagaaca ttggttcagc catagtcgga ctaagttttt gggtgagttt 10560gatggagaat gatctcggat tatacaaaca ggctctaggt gcaataaaga cgtcattccc 10620tattagatgg tcctctgtcc agaccaagga tgggtttaca caagaatgga gaactaaagg 10680aaacggaatt cctaaagatt gtcgtctctc agactctttg gctcagatag gaaactggat 10740cagagcgatg gaattggtta ggaacaaaac gaggcaatca ggattttctg aaaccctatt 10800tgatcaattc tgcggacttg cagaccatca cctcaaatgg cggaagttgg gaaacagaac 10860aggaattatt gattggctaa ataatagaat ttcatccatt gacaaatcca tcttggtgac 10920caaaagtgat ctgcatgacg agaactcatg gagggagtga agatgtattc ttccacctct 10980cattgggtga tacccatata tgaaaaaaac tataagtact ttaaactctc tttgtttttt 11040aatgtatatc tggttttgtt gtttccgt 110682422PRTMaraba VirusN protein 2Met Ser Val Thr Val Lys Arg Val Ile Asp Asp Ser Leu Ile Thr Pro 1 5 10 15 Lys Leu Pro Ala Asn Glu Asp Pro Val Glu Tyr Pro Ala Asp Tyr Phe 20 25 30 Lys Lys Ser Arg Asp Ile Pro Val Tyr Ile Asn Thr Thr Lys Ser Leu 35 40 45 Ser Asp Leu Arg Gly Tyr Val Tyr Gln Gly Leu Lys Ser Gly Asn Ile 50 55 60 Ser Ile Ile His Val Asn Ser Tyr Leu Tyr Ala Ala Leu Lys Glu Ile 65 70 75 80 Arg Gly Lys Leu Asp Arg Asp Trp Ile Thr Phe Gly Ile Gln Ile Gly 85 90 95 Lys Thr Gly Asp Ser Val Gly Ile Phe Asp Leu Leu Thr Leu Lys Pro 100 105 110 Leu Asp Gly Val Leu Pro Asp Gly Val Ser Asp Ala Thr Arg Thr Ser 115 120 125 Ser Asp Asp Ala Trp Leu Pro Leu Tyr Leu Leu Gly Leu Tyr Arg Val 130 135 140 Gly Arg Thr Gln Met Pro Glu Tyr Arg Lys Lys Leu Met Asp Gly Leu 145 150 155 160 Ile Asn Gln Cys Lys Met Ile Asn Glu Gln Phe Glu Pro Leu Leu Pro 165 170 175 Glu Gly Arg Asp Val Phe Asp Val Trp Gly Asn Asp Ser Asn Tyr Thr 180 185 190 Lys Ile Val Ala Ala Val Asp Met Phe Phe His Met Phe Lys Lys His 195 200 205 Glu Lys Ala Ser Phe Arg Tyr Gly Thr Ile Val Ser Arg Phe Lys Asp 210 215 220 Cys Ala Ala Leu Ala Thr Phe Gly His Leu Cys Lys Ile Thr Gly Met 225 230 235 240 Ser Thr Glu Asp Val Thr Thr Trp Ile Leu Asn Arg Glu Val Ala Asp 245 250 255 Glu Met Val Gln Met Met Tyr Pro Gly Gln Glu Ile Asp Lys Ala Asp 260 265 270 Ser Tyr Met Pro Tyr Leu Ile Asp Leu Gly Leu Ser Ser Lys Ser Pro 275 280 285 Tyr Pro Ser Val Lys Asn Pro Ala Phe His Phe Trp Gly Gln Leu Thr 290 295 300 Ala Leu Leu Leu Arg Ser Thr Arg Ala Arg Asn Ala Arg Gln Pro Asp 305 310 315 320 Asp Ile Glu Tyr Thr Ser Leu Thr Thr Ala Gly Leu Leu Tyr Ala Tyr 325 330 335 Ala Val Gly Ser Ser Ala Asp Leu Ala Gln Gln Phe Tyr Val Gly Asp 340 345 350 Asn Lys Tyr Val Pro Glu Thr Gly Asp Gly Gly Leu Thr Thr Asn Ala 355 360 365 Pro Pro Gln Gly Arg Asp Val Val Glu Trp Leu Ser Trp Phe Glu Asp 370 375 380 Gln Asn Arg Lys Pro Thr Pro Asp Met Leu Met Tyr Ala Lys Arg Ala 385 390 395 400 Val Ser Ala Leu Gln Gly Leu Arg Glu Lys Thr Ile Gly Lys Tyr Ala 405 410 415 Lys Ser Glu Phe Asp Lys 420 3265PRTMaraba VirusP protein 3Met Asp Gln Leu Ser Lys Val Lys Glu Phe Leu Lys Thr Tyr Ala Gln 1 5 10 15 Leu Asp Gln Ala Val Gln Glu Met Asp Asp Ile Glu Ser Gln Arg Glu 20 25 30 Glu Lys Thr Asn Phe Asp Leu Phe Gln Glu Glu Gly Leu Glu Ile Lys 35 40 45 Glu Lys Pro Ser Tyr Tyr Arg Ala Asp Glu Glu Glu Ile Asp Ser Asp 50 55 60 Glu Asp Ser Val Asp Asp Ala Gln Asp Leu Gly Ile Arg Thr Ser Thr 65 70 75 80 Ser Pro Ile Glu Gly Tyr Val Asp Glu Glu Gln Asp Asp Tyr Glu Asp 85 90 95 Glu Glu Val Asn Val Val Phe Thr Ser Asp Trp Lys Gln Pro Glu Leu 100 105 110 Glu Ser Asp Gly Asp Gly Lys Thr Leu Arg Leu Thr Ile Pro Asp Gly 115 120 125 Leu Thr Gly Glu Gln Lys Ser Gln Trp Leu Ala Thr Ile Lys Ala Val 130 135 140 Val Gln Ser Ala Lys Tyr Trp Asn Ile Ser Glu Cys Ser Phe Glu Ser 145 150 155 160 Tyr Glu Gln Gly Val Leu Ile Arg Glu Arg Gln Met Thr Pro Asp Val 165

170 175 Tyr Lys Val Thr Pro Val Leu Asn Ala Pro Pro Val Gln Met Thr Ala 180 185 190 Asn Gln Asp Val Trp Ser Leu Ser Ser Thr Pro Phe Thr Phe Leu Pro 195 200 205 Lys Lys Gln Gly Val Thr Pro Leu Thr Met Ser Leu Glu Glu Leu Phe 210 215 220 Asn Thr Arg Gly Glu Phe Ile Ser Leu Gly Gly Asn Gly Lys Met Ser 225 230 235 240 His Arg Glu Ala Ile Ile Leu Gly Leu Arg His Lys Lys Leu Tyr Asn 245 250 255 Gln Ala Arg Leu Lys Tyr Asn Leu Ala 260 265 4229PRTMaraba VirusM protein 4Met Ser Ser Leu Lys Lys Ile Leu Gly Ile Lys Gly Lys Gly Lys Lys 1 5 10 15 Ser Lys Lys Leu Gly Met Ala Pro Pro Pro Tyr Glu Glu Glu Thr Pro 20 25 30 Met Glu Tyr Ser Pro Ser Ala Pro Tyr Asp Lys Ser Leu Phe Gly Val 35 40 45 Glu Asp Met Asp Phe His Asp Gln Arg Gln Leu Arg Tyr Glu Lys Phe 50 55 60 His Phe Ser Leu Lys Met Thr Val Arg Ser Asn Lys Pro Phe Arg Asn 65 70 75 80 Tyr Asp Asp Val Ala Ala Ala Val Ser Asn Trp Asp His Met Tyr Ile 85 90 95 Gly Met Ala Gly Lys Arg Pro Phe Tyr Lys Ile Leu Ala Phe Met Gly 100 105 110 Ser Thr Leu Leu Lys Ala Thr Pro Ala Val Leu Ala Asp Gln Gly Gln 115 120 125 Pro Glu Tyr His Ala His Cys Glu Gly Arg Ala Tyr Leu Pro His Arg 130 135 140 Leu Gly Pro Thr Pro Pro Met Leu Asn Val Pro Glu His Phe Arg Arg 145 150 155 160 Pro Phe Asn Ile Gly Leu Phe Arg Gly Thr Ile Asp Ile Thr Leu Val 165 170 175 Leu Phe Asp Asp Glu Ser Val Asp Ser Ala Pro Val Ile Trp Asp His 180 185 190 Phe Asn Ala Ser Arg Leu Ser Ser Phe Arg Glu Lys Ala Leu Leu Phe 195 200 205 Gly Leu Ile Leu Glu Lys Lys Ala Thr Gly Asn Trp Val Leu Asp Ser 210 215 220 Ile Ser His Phe Lys 225 5512PRTMaraba VirusG protein 5Met Leu Arg Leu Phe Leu Phe Cys Phe Leu Ala Leu Gly Ala His Ser 1 5 10 15 Lys Phe Thr Ile Val Phe Pro His His Gln Lys Gly Asn Trp Lys Asn 20 25 30 Val Pro Ser Thr Tyr His Tyr Cys Pro Ser Ser Ser Asp Gln Asn Trp 35 40 45 His Asn Asp Leu Thr Gly Val Ser Leu His Val Lys Ile Pro Lys Ser 50 55 60 His Lys Ala Ile Gln Ala Asp Gly Trp Met Cys His Ala Ala Lys Trp 65 70 75 80 Val Thr Thr Cys Asp Phe Arg Trp Tyr Gly Pro Lys Tyr Ile Thr His 85 90 95 Ser Ile His Ser Met Ser Pro Thr Leu Glu Gln Cys Lys Thr Ser Ile 100 105 110 Glu Gln Thr Lys Gln Gly Val Trp Ile Asn Pro Gly Phe Pro Pro Gln 115 120 125 Ser Cys Gly Tyr Ala Thr Val Thr Asp Ala Glu Val Val Val Val Gln 130 135 140 Ala Thr Pro His His Val Leu Val Asp Glu Tyr Thr Gly Glu Trp Ile 145 150 155 160 Asp Ser Gln Leu Val Gly Gly Lys Cys Ser Lys Glu Val Cys Gln Thr 165 170 175 Val His Asn Ser Thr Val Trp His Ala Asp Tyr Lys Ile Thr Gly Leu 180 185 190 Cys Glu Ser Asn Leu Ala Ser Val Asp Ile Thr Phe Phe Ser Glu Asp 195 200 205 Gly Gln Lys Thr Ser Leu Gly Lys Pro Asn Thr Gly Phe Arg Ser Asn 210 215 220 Tyr Phe Ala Tyr Glu Ser Gly Glu Lys Ala Cys Arg Met Gln Tyr Cys 225 230 235 240 Thr Gln Trp Gly Ile Arg Leu Pro Ser Gly Val Trp Phe Glu Leu Val 245 250 255 Asp Lys Asp Leu Phe Gln Ala Ala Lys Leu Pro Glu Cys Pro Arg Gly 260 265 270 Ser Ser Ile Ser Ala Pro Ser Gln Thr Ser Val Asp Val Ser Leu Ile 275 280 285 Gln Asp Val Glu Arg Ile Leu Asp Tyr Ser Leu Cys Gln Glu Thr Trp 290 295 300 Ser Lys Ile Arg Ala Lys Leu Pro Val Ser Pro Val Asp Leu Ser Tyr 305 310 315 320 Leu Ala Pro Lys Asn Pro Gly Ser Gly Pro Ala Phe Thr Ile Ile Asn 325 330 335 Gly Thr Leu Lys Tyr Phe Glu Thr Arg Tyr Ile Arg Val Asp Ile Ser 340 345 350 Asn Pro Ile Ile Pro His Met Val Gly Thr Met Ser Gly Thr Thr Thr 355 360 365 Glu Arg Glu Leu Trp Asn Asp Trp Tyr Pro Tyr Glu Asp Val Glu Ile 370 375 380 Gly Pro Asn Gly Val Leu Lys Thr Pro Thr Gly Phe Lys Phe Pro Leu 385 390 395 400 Tyr Met Ile Gly His Gly Met Leu Asp Ser Asp Leu His Lys Ser Ser 405 410 415 Gln Ala Gln Val Phe Glu His Pro His Ala Lys Asp Ala Ala Ser Gln 420 425 430 Leu Pro Asp Asp Glu Thr Leu Phe Phe Gly Asp Thr Gly Leu Ser Lys 435 440 445 Asn Pro Val Glu Leu Val Glu Gly Trp Phe Ser Ser Trp Lys Ser Thr 450 455 460 Leu Ala Ser Phe Phe Leu Ile Ile Gly Leu Gly Val Ala Leu Ile Phe 465 470 475 480 Ile Ile Arg Ile Ile Val Ala Ile Arg Tyr Lys Tyr Lys Gly Arg Lys 485 490 495 Thr Gln Lys Ile Tyr Asn Asp Val Glu Met Ser Arg Leu Gly Asn Lys 500 505 510 62109PRTMaraba VirusL protein 6Met Asp Val Asn Asp Phe Glu Leu His Glu Asp Phe Ala Leu Ser Glu 1 5 10 15 Asp Asp Phe Val Thr Ser Glu Phe Leu Asn Pro Glu Asp Gln Met Thr 20 25 30 Tyr Leu Asn His Ala Asp Tyr Asn Leu Asn Ser Pro Leu Ile Ser Asp 35 40 45 Asp Ile Asp Phe Leu Ile Lys Lys Tyr Asn His Glu Gln Ile Pro Lys 50 55 60 Met Trp Asp Val Lys Asn Trp Glu Gly Val Leu Glu Met Leu Thr Ala 65 70 75 80 Trp Gln Ala Ser Pro Ile Leu Ser Ser Thr Met His Lys Trp Val Gly 85 90 95 Lys Trp Leu Met Ser Asp Asp His Asp Ala Ser Gln Gly Phe Ser Phe 100 105 110 Leu His Glu Val Asp Lys Glu Ala Asp Leu Thr Phe Glu Val Val Glu 115 120 125 Thr Phe Ile Arg Gly Trp Gly Gly Arg Glu Leu Gln Tyr Lys Arg Lys 130 135 140 Asp Thr Phe Pro Asp Ser Phe Arg Val Ala Ala Ser Leu Cys Gln Lys 145 150 155 160 Phe Leu Asp Leu His Lys Leu Thr Leu Ile Met Asn Ser Val Ser Glu 165 170 175 Val Glu Leu Thr Asn Leu Ala Lys Asn Phe Lys Gly Lys Asn Arg Lys 180 185 190 Ala Lys Ser Gly Asn Leu Ile Thr Arg Leu Arg Val Pro Ser Leu Gly 195 200 205 Pro Ala Phe Val Thr Gln Gly Trp Val Tyr Met Lys Lys Leu Glu Met 210 215 220 Ile Met Asp Arg Asn Phe Leu Leu Met Leu Lys Asp Val Ile Ile Gly 225 230 235 240 Arg Met Gln Thr Ile Leu Ser Met Ile Ser Arg Asp Asp Asn Leu Phe 245 250 255 Ser Glu Ser Asp Ile Phe Thr Val Leu Lys Ile Tyr Arg Ile Gly Asp 260 265 270 Lys Ile Leu Glu Arg Gln Gly Thr Lys Gly Tyr Asp Leu Ile Lys Met 275 280 285 Ile Glu Pro Ile Cys Asn Leu Lys Met Met Asn Leu Ala Arg Lys Tyr 290 295 300 Arg Pro Leu Ile Pro Thr Phe Pro His Phe Glu Lys His Ile Ala Asp 305 310 315 320 Ser Val Lys Glu Gly Ser Lys Ile Asp Lys Gly Ile Glu Phe Ile Tyr 325 330 335 Asp His Ile Met Ser Ile Pro Gly Val Asp Leu Thr Leu Val Ile Tyr 340 345 350 Gly Ser Phe Arg His Trp Gly His Pro Phe Ile Asn Tyr Tyr Glu Gly 355 360 365 Leu Glu Lys Leu His Lys Gln Val Thr Met Pro Lys Thr Ile Asp Arg 370 375 380 Glu Tyr Ala Glu Cys Leu Ala Ser Asp Leu Ala Arg Ile Val Leu Gln 385 390 395 400 Gln Gln Phe Asn Glu His Lys Lys Trp Phe Val Asp Val Asp Lys Val 405 410 415 Pro Gln Ser His Pro Phe Lys Ser His Met Lys Glu Asn Thr Trp Pro 420 425 430 Thr Ala Ala Gln Val Gln Asp Tyr Gly Asp Arg Trp His Gln Leu Pro 435 440 445 Leu Ile Lys Cys Phe Glu Ile Pro Asp Leu Leu Asp Pro Ser Ile Ile 450 455 460 Tyr Ser Asp Lys Ser His Ser Met Asn Arg Ser Glu Val Leu Arg His 465 470 475 480 Val Arg Leu Thr Pro His Val Pro Ile Pro Ser Arg Lys Val Leu Gln 485 490 495 Thr Met Leu Glu Thr Lys Ala Thr Asp Trp Lys Glu Phe Leu Lys Lys 500 505 510 Ile Asp Glu Glu Gly Leu Glu Asp Asp Asp Leu Val Ile Gly Leu Lys 515 520 525 Gly Lys Glu Arg Glu Leu Lys Ile Ala Gly Arg Phe Phe Ser Leu Met 530 535 540 Ser Trp Lys Leu Arg Glu Tyr Phe Val Ile Thr Glu Tyr Leu Ile Lys 545 550 555 560 Thr His Phe Val Pro Met Phe Lys Gly Leu Thr Met Ala Asp Asp Leu 565 570 575 Thr Ala Val Ile Lys Lys Met Met Asp Thr Ser Ser Gly Gln Gly Leu 580 585 590 Asp Asn Tyr Glu Ser Ile Cys Ile Ala Asn His Ile Asp Tyr Glu Lys 595 600 605 Trp Asn Asn His Gln Arg Lys Glu Ser Asn Gly Pro Val Phe Lys Val 610 615 620 Met Gly Gln Phe Leu Gly Tyr Pro Arg Leu Ile Glu Arg Thr His Glu 625 630 635 640 Phe Phe Glu Lys Ser Leu Ile Tyr Tyr Asn Gly Arg Pro Asp Leu Met 645 650 655 Arg Val Arg Gly Asn Ser Leu Val Asn Ala Ser Ser Leu Asn Val Cys 660 665 670 Trp Glu Gly Gln Ala Gly Gly Leu Glu Gly Leu Arg Gln Lys Gly Trp 675 680 685 Ser Ile Leu Asn Leu Leu Val Ile Gln Arg Glu Ala Lys Ile Arg Asn 690 695 700 Thr Ala Val Lys Val Leu Ala Gln Gly Asp Asn Gln Val Ile Cys Thr 705 710 715 720 Gln Tyr Lys Thr Lys Lys Ser Arg Asn Asp Ile Glu Leu Lys Ala Ala 725 730 735 Leu Thr Gln Met Val Ser Asn Asn Glu Met Ile Met Ser Ala Ile Lys 740 745 750 Ser Gly Thr Glu Lys Leu Gly Leu Leu Ile Asn Asp Asp Glu Thr Met 755 760 765 Gln Ser Ala Asp Tyr Leu Asn Tyr Gly Lys Val Pro Ile Phe Arg Gly 770 775 780 Val Ile Arg Gly Leu Glu Thr Lys Arg Trp Ser Arg Val Thr Cys Val 785 790 795 800 Thr Asn Asp Gln Ile Pro Thr Cys Ala Asn Ile Met Ser Ser Val Ser 805 810 815 Thr Asn Ala Leu Thr Val Ala His Phe Ala Glu Asn Pro Val Asn Ala 820 825 830 Ile Ile Gln Tyr Asn Tyr Phe Gly Thr Phe Ala Arg Leu Leu Leu Met 835 840 845 Met His Asp Pro Ala Leu Arg Ile Ser Leu Tyr Glu Val Gln Ser Lys 850 855 860 Ile Pro Gly Leu His Ser Leu Thr Phe Lys Tyr Ser Met Leu Tyr Leu 865 870 875 880 Asp Pro Ser Ile Gly Gly Val Ser Gly Met Ser Leu Ser Arg Phe Leu 885 890 895 Ile Arg Ser Phe Pro Asp Pro Val Thr Glu Ser Leu Ala Phe Trp Lys 900 905 910 Phe Ile His Ser His Ala Arg Ser Asp Ser Leu Lys Glu Ile Cys Ala 915 920 925 Val Phe Gly Asn Pro Glu Ile Ala Arg Phe Arg Leu Thr His Val Asp 930 935 940 Lys Leu Val Glu Asp Pro Thr Ser Leu Asn Ile Ala Met Gly Met Ser 945 950 955 960 Pro Ala Asn Leu Leu Lys Thr Glu Val Lys Lys Cys Leu Leu Glu Ser 965 970 975 Arg Gln Ser Ile Lys Asn Gln Ile Val Arg Asp Ala Thr Ile Tyr Leu 980 985 990 His His Glu Glu Asp Lys Leu Arg Ser Phe Leu Trp Ser Ile Thr Pro 995 1000 1005 Leu Phe Pro Arg Phe Leu Ser Glu Phe Lys Ser Gly Thr Phe Ile 1010 1015 1020 Gly Val Ala Asp Gly Leu Ile Ser Leu Phe Gln Asn Ser Arg Thr 1025 1030 1035 Ile Arg Asn Ser Phe Lys Lys Arg Tyr His Arg Glu Leu Asp Asp 1040 1045 1050 Leu Ile Ile Lys Ser Glu Val Ser Ser Leu Met His Leu Gly Lys 1055 1060 1065 Leu His Leu Arg Arg Gly Ser Val Arg Met Trp Thr Cys Ser Ser 1070 1075 1080 Thr Gln Ala Asp Leu Leu Arg Phe Arg Ser Trp Gly Arg Ser Val 1085 1090 1095 Ile Gly Thr Thr Val Pro His Pro Leu Glu Met Leu Gly Gln His 1100 1105 1110 Phe Lys Lys Glu Thr Pro Cys Ser Ala Cys Asn Ile Ser Gly Leu 1115 1120 1125 Asp Tyr Val Ser Val His Cys Pro Asn Gly Ile His Asp Val Phe 1130 1135 1140 Glu Ser Arg Gly Pro Leu Pro Ala Tyr Leu Gly Ser Lys Thr Ser 1145 1150 1155 Glu Ser Thr Ser Ile Leu Gln Pro Trp Glu Arg Glu Ser Lys Val 1160 1165 1170 Pro Leu Ile Lys Arg Ala Thr Arg Leu Arg Asp Ala Ile Ser Trp 1175 1180 1185 Phe Val Ser Pro Asp Ser Asn Leu Ala Ser Thr Ile Leu Lys Asn 1190 1195 1200 Ile Asn Ala Leu Thr Gly Glu Glu Trp Ser Lys Lys Gln His Gly 1205 1210 1215 Phe Lys Arg Thr Gly Ser Ala Leu His Arg Phe Ser Thr Ser Arg 1220 1225 1230 Met Ser His Gly Gly Phe Ala Ser Gln Ser Thr Ala Ala Leu Thr 1235 1240 1245 Arg Leu Met Ala Thr Thr Asp Thr Met Arg Asp Leu Gly Glu Gln 1250 1255 1260 Asn Tyr Asp Phe Leu Phe Gln Ala Thr Leu Leu Tyr Ala Gln Ile 1265 1270 1275 Thr Thr Thr Val Val Arg Asn Gly Ser Phe His Ser Cys Thr Asp 1280 1285 1290 His Tyr His Ile Thr Cys Lys Ser Cys Leu Arg Ala Ile Asp Glu 1295 1300 1305 Ile Thr Leu Asp Ser Ala Met Glu Tyr Ser Pro Pro Asp Val Ser 1310 1315 1320 Ser Val Leu Gln Ser Trp Arg Asn Gly Glu Gly Ser Trp Gly His 1325 1330 1335 Glu Val Lys Gln Ile Tyr Pro Val Glu Gly Asp Trp Arg Gly Leu 1340 1345 1350 Ser Pro Val Glu Gln Ser Tyr Gln Val Gly Arg Cys Ile Gly Phe 1355 1360 1365 Leu Phe Gly Asp Leu Ala Tyr Arg Lys Ser Ser His Ala Asp Asp 1370 1375 1380 Ser Ser Met Phe Pro Leu Ser Ile Gln Asn Lys Val Arg Gly Arg 1385 1390 1395 Gly Phe Leu Lys Gly Leu Met Asp Gly Leu Met Arg Ala Ser Cys 1400 1405 1410 Cys Gln Val Ile His Arg Arg Ser Leu Ala His Leu Lys Arg Pro 1415 1420 1425 Ala Asn Ala Val Tyr Gly Gly Leu Ile Tyr Leu Ile Asp Lys Leu 1430

1435 1440 Ser Ala Ser Ala Pro Phe Leu Ser Leu Thr Arg His Gly Pro Leu 1445 1450 1455 Arg Glu Glu Leu Glu Thr Val Pro His Lys Ile Pro Thr Ser Tyr 1460 1465 1470 Pro Thr Ser Asn Arg Asp Met Gly Val Ile Val Arg Asn Tyr Phe 1475 1480 1485 Lys Tyr Gln Cys Arg Leu Val Glu Lys Gly Arg Tyr Lys Thr His 1490 1495 1500 Tyr Pro Gln Leu Trp Leu Phe Ser Asp Val Leu Ser Ile Asp Phe 1505 1510 1515 Leu Gly Pro Leu Ser Ile Ser Ser Thr Leu Leu Gly Ile Leu Tyr 1520 1525 1530 Lys Gln Thr Leu Ser Ser Arg Asp Lys Asn Glu Leu Arg Glu Leu 1535 1540 1545 Ala Asn Leu Ser Ser Leu Leu Arg Ser Gly Glu Gly Trp Glu Asp 1550 1555 1560 Ile His Val Lys Phe Phe Ser Lys Asp Thr Leu Leu Cys Pro Glu 1565 1570 1575 Glu Ile Arg His Ala Cys Lys Phe Gly Ile Ala Lys Glu Ser Ala 1580 1585 1590 Val Leu Ser Tyr Tyr Pro Pro Trp Ser Gln Glu Ser Tyr Gly Gly 1595 1600 1605 Ile Thr Ser Ile Pro Val Tyr Phe Ser Thr Arg Lys Tyr Pro Lys 1610 1615 1620 Ile Leu Asp Val Pro Pro Arg Val Gln Asn Pro Leu Val Ser Gly 1625 1630 1635 Leu Arg Leu Gly Gln Leu Pro Thr Gly Ala His Tyr Lys Ile Arg 1640 1645 1650 Ser Ile Val Lys Asn Lys Asn Leu Arg Tyr Arg Asp Phe Leu Ser 1655 1660 1665 Cys Gly Asp Gly Ser Gly Gly Met Thr Ala Ala Leu Leu Arg Glu 1670 1675 1680 Asn Arg Gln Ser Arg Gly Ile Phe Asn Ser Leu Leu Glu Leu Ala 1685 1690 1695 Gly Ser Leu Met Arg Gly Ala Ser Pro Glu Pro Pro Ser Ala Leu 1700 1705 1710 Glu Thr Leu Gly Gln Glu Arg Ser Arg Cys Val Asn Gly Ser Thr 1715 1720 1725 Cys Trp Glu Tyr Ser Ser Asp Leu Ser Gln Lys Glu Thr Trp Asp 1730 1735 1740 Tyr Phe Leu Arg Leu Lys Arg Gly Leu Gly Leu Thr Val Asp Leu 1745 1750 1755 Ile Thr Met Asp Met Glu Val Arg Asp Pro Asn Thr Ser Leu Met 1760 1765 1770 Ile Glu Lys Asn Leu Lys Val Tyr Leu His Gln Ile Leu Glu Pro 1775 1780 1785 Thr Gly Val Leu Ile Tyr Lys Thr Tyr Gly Thr His Ile Ala Thr 1790 1795 1800 Gln Thr Asp Asn Ile Leu Thr Ile Ile Gly Pro Phe Phe Glu Thr 1805 1810 1815 Val Asp Leu Val Gln Ser Glu Tyr Ser Ser Ser Gln Thr Ser Glu 1820 1825 1830 Val Tyr Phe Val Gly Arg Gly Leu Arg Ser His Val Asp Glu Pro 1835 1840 1845 Trp Val Asp Trp Pro Ser Leu Met Asp Asn Trp Arg Ser Ile Tyr 1850 1855 1860 Ala Phe His Asp Pro Thr Thr Glu Phe Ile Arg Ala Lys Lys Val 1865 1870 1875 Cys Glu Ile Asp Ser Leu Ile Gly Ile Pro Ala Gln Phe Ile Pro 1880 1885 1890 Asp Pro Phe Val Asn Leu Glu Thr Met Leu Gln Ile Val Gly Val 1895 1900 1905 Pro Thr Gly Val Ser His Ala Ala Ala Leu Leu Ser Ser Gln Tyr 1910 1915 1920 Pro Asn Gln Leu Val Thr Thr Ser Ile Phe Tyr Met Thr Leu Val 1925 1930 1935 Ser Tyr Tyr Asn Val Asn His Ile Arg Arg Ser Pro Lys Pro Phe 1940 1945 1950 Ser Pro Pro Ser Asp Gly Val Ser Gln Asn Ile Gly Ser Ala Ile 1955 1960 1965 Val Gly Leu Ser Phe Trp Val Ser Leu Met Glu Asn Asp Leu Gly 1970 1975 1980 Leu Tyr Lys Gln Ala Leu Gly Ala Ile Lys Thr Ser Phe Pro Ile 1985 1990 1995 Arg Trp Ser Ser Val Gln Thr Lys Asp Gly Phe Thr Gln Glu Trp 2000 2005 2010 Arg Thr Lys Gly Asn Gly Ile Pro Lys Asp Cys Arg Leu Ser Asp 2015 2020 2025 Ser Leu Ala Gln Ile Gly Asn Trp Ile Arg Ala Met Glu Leu Val 2030 2035 2040 Arg Asn Lys Thr Arg Gln Ser Gly Phe Ser Glu Thr Leu Phe Asp 2045 2050 2055 Gln Phe Cys Gly Leu Ala Asp His His Leu Lys Trp Arg Lys Leu 2060 2065 2070 Gly Asn Arg Thr Gly Ile Ile Asp Trp Leu Asn Asn Arg Ile Ser 2075 2080 2085 Ser Ile Asp Lys Ser Ile Leu Val Thr Lys Ser Asp Leu His Asp 2090 2095 2100 Glu Asn Ser Trp Arg Glu 2105 710716DNACarajas Virus 7cggccggtcg acgctgccta tttacttact gggtctttac cgtgttggaa kaacaaaact 60gccggaatac cgaaagaagt tgatggaggg gttggaaatg cagtgtaaaa tcatgtatcc 120tgactttgta ccaatcgttc cggaaggaat ggacttcttt gatgtgtggg gaaatgatag 180taatttcacc aaaatagtcg ccgcagtgga tatgtttttc catatgttca aaaagcatga 240gagagcatcc ctcagatatg gaacaattgt ctccagattc aaggattgtg ctgcattggc 300tacatttggc catgtatgta aagtttccgg aatgtccaca gaggaggtca ccacttgggt 360gctgaatagg gaagtggcag acgaattatg ccagatgatg ttccctggac aggaaataga 420ccgagcggac tcatacatgc cgtatatgat agatttcggg ttgtctcaga aatcgccata 480ttcctctgtc aaaaatccgt cttttcactt ttgggggcaa cttgcagcac tactgctcag 540atcaaccagg gcaaaaaatg ccagacaacc tgatgacatt gaatacacat cactgactac 600agcaggtcta cttcttgcgt atgctgtagg gtcatctgca gacatctctc aacagttcta 660catgggagat gagaaatata tctcagaccc aagtgcgggt ggattaacct ccaatgcacc 720tccgaaagga aggaatgtag ttgactggct cgggtggttt gaggatcaag gaggaaatat 780cactccagat atgtacactt cgctaaaagg gctgtttgct ctttgcaagg gctgcgagat 840aagaccattg gaaagtatgc caagggagag tttgacaagt gactccattc agatcaaatg 900ctttactaca tgctgtatta tatataacta tgaaaaaaac taacagagat catggataat 960ctctcgaaac ttaaggagta tatggggact tacacccatc tagactctgc attgcaagat 1020gcaaatgaat cagaagaatc tcgagatgaa aagagcaatt ttgatctttt cgatgaggaa 1080agtaaggagg ttgcaagacc ttcttattat tctgcaattg atgaggagtc tgaccaggag 1140gaaactgaat ccgatgatcc agatgaggag ctgaatgact caaatgccca tggggcggtg 1200gatggatggg acgagacgtt gaacgagaat tctcagcctg acgacaatgt ctctgttgag 1260ttcgctcgta catggtcaac accggtgatg gaatcttcgt cagagggaaa gactttgcat 1320ttggctatgc cagatggact gaatccagat caagtcgcac agtggctgca gactgtcaag 1380gctttgtttg agagtgccaa atattggaat ctgtccgaat gcaggatgga agtgctgctt 1440gagggagtat taatcaaaga gagacaaatg actccagatc ttcagaaggt cacaccgaag 1500ccgaacaatc ctcctccaga aagtatgcca tgcgatcctc tccctcccgc tatggacgtg 1560tgggaggccg cgtctcaggt gtatacacta gagcccaagc gggcaaacct ggccccaatg 1620gatgtaaagc tgaaagatct gttttcatct agggccgaat ttctctcagt cggaggatct 1680ccccagatga gctggaaaga ggccattata ttgggtctaa gatacaagaa attgtataat 1740caagctcgcc taaaatattc cctatagggt ataccccata tgaaaaaaac taacagaatt 1800caaaatgagt tctctcaaga aaatactcgg cctgaaaggc aagaaggagg aaaagtccaa 1860aaagttggga cttcctcctc cttacgagat gccagcaaac aatgagttcg agccaaatgc 1920tcctttagat cctgacatgt tcggggcgga acatttggag attgaaagca agtctgccat 1980gcgttatgag aaatttaagt tctctgtcaa gatcaccctt aggaccaatc gacctttgag 2040aacttatgat gatgtgtgcc agattctatc caaatgggat gcaatgtatg tcggcatgat 2100gggtaagcga ccgttctaca aggtattggt cttgatcgga tccagccact tgcaggctac 2160acctgctata ctctcagatc gtggtcaacc agaatatcat atgtacttgg aagatagagg 2220attcatcgca cacaggttgg ggttgacacc gccaatgtta agtgggccgg aaagttttag 2280aagacctttc catgtcggtc tttacagagg gacaattgac attacagtaa atctcatgga 2340cgacgaatca acggaatcag caccacaggt ttgggatcac ttcaatacca gatatgtgaa 2400tcatttcctt gagcatgcaa agaggttcgg attggtcctg tccaagaaac caggtggcgg 2460ctggatatta gatcaagcgg tctgtgcata atgcgaatat aatcatagtc tcatcagacg 2520attatttata cattattcta ttctctctct tagttggtgg tagctatgaa aaaaactaac 2580agagttcaaa actctacatc tcaactgcaa aggctatttt tcttaaaaaa accttttaat 2640acagagtcat cattcaaaaa tgaagatgaa aatggtcata gcaggattaa tcctttgtat 2700agggatttta ccggctattg ggaaaataac aatttctttc ccacaaagct tgaaaggaga 2760ttggaggcct gtacctaagg gatacaatta ttgtcctaca agtgcggata aaaatctcca 2820tggtgatttg attgacatag gtctcagact tcgggcccct aagagcttca aagggatctc 2880cgcagatgga tggatgtgcc atgcggcaag atggatcacc acctgtgatt tcagatggta 2940tggacccaag tacatcaccc actcaattca ctctttcagg ccgagcaatg accaatgcaa 3000agaagcaatc cggctgacta atgaagggaa ttggattaat ccaggtttcc ctccgcaatc 3060ttgcggatat gcttctgtaa ccgactcaga atccgttgtc gtaaccgtga ccaagcacca 3120ggtcctagta gatgagtact ccggctcatg gatcgatagt caattccccg gaggaagttg 3180cacatccccc atttgcgata cagtgcacaa ctcgacactt tggcacgcgg accacaccct 3240ggacagtatc tgtgaccaag aattcgtggc aatggacgca gttctgttca cagagagtgg 3300caaatttgaa gagttcggaa aaccgaactc cggcatcagg agcaactatt ttccttatga 3360gagtctgaaa gatgtatgtc agatggattt ctgcaagagg aaaggattca agctcccatc 3420cggtgtctgg tttgaaatcg aggatgcaga gaaatctcac aaggcccagg ttgaattgaa 3480aataaaacgg tgccctcatg gagcagtaat ctcagctcct aatcagaatg cagcagatat 3540caatctgatc atggatgtgg aacgaattct agactactcc ctttgccaag caacttggag 3600caaaatccaa aacaaggaag cgttgacccc catcgatatc agttatcttg gtccgaaaaa 3660cccaggacca ggcccagcct tcaccataat aaatggaaca ctgcactact tcaatactag 3720atacattcga gtggatattg cagggcctgt taccaaagag attacaggat ttgtttcggg 3780aacatctaca tctagggtgc tgtgggatca gtggtcccat atggagagaa ttccattgga 3840cccaatggct tgctgaaaac cgccagcgga tacaaatatc cattgttcat ggttggtaca 3900ggtgtgctgg atgcggacat ccacaagctg ggagaagcaa ccgtgattga acatccacat 3960gccaaagagg ctcagaaggt agttgatgac agtgaggtta tattttttgg tgacaccgga 4020gtctccaaga atccagtgga ggtagtcgaa ggatggttta gcggatggag aagctctttg 4080atgagcatat ttggcataat tttgttgatt gtttgtttag tcttgattgt tcgaatcctt 4140atagccctta aatactgttg tgttagacac aaaaagagaa ctatttacaa agaggacctt 4200gaaatgggtc gaattcctcg gagggcttaa ttacttataa ttacggactt taaatgtatg 4260aaaaaaacta taacagaagt caaaatggac ttcttacccg ttgaacaaga ggaggactgg 4320ggttatgcag aagatgattt ctctagctca gattatctag attttgaaga acgaatgaca 4380tatttaaatc aggctgatta taatctaaac tcaccattga tatctgatga catttattac 4440ctgagtcgaa aattccactc atatggcatc ccccccatgt ggaacctcaa agaatgggat 4500ggaccattgg agatgttaaa atcatgtcaa gcagacccga ttccacatga tctgatgcac 4560aaatggtttg gaacttggtt agaagacttt gatcacgact ctgcacaagg gatagtgttt 4620ttaagggaag tagacaaaga ggcctccgag acctatgatt tagtggatac ctttttgaaa 4680aattgggcag ggaaatccta tccttacaaa gcaaaggaga gatacttaga tcagatgaag 4740atcattggcc ctttgtgtca aaagttcctt gatttgcaca agctgacatt gatcctcaat 4800gctgttggtc ctgaagagtt gaaaaacctg ttacgaacat ttaagggaag aacgagagat 4860ttatcgacca aagatccatg cactcggcta cgtgttccca gccttgggcc cgtattcata 4920tgcaaaggct gggtctatat ccacaagcac aaaattttga tggaccgaaa tttcctgctt 4980atgtgtaaag atgtcataat aggacgcatg cagaccctat tgtctatgat aggtagatct 5040gacgatgcat tcactcagca agacttcttc acccttgtaa atatctacag gacaggagat 5100atcatcttac aagagaaagg aaatctggcc tatgacttaa tcaagatggt ggagcctatc 5160tgcaatctga aattgatgaa attggcgaga gaatacagac cactgattcc cccttttcca 5220cattttgaaa atcatgttaa aaatgcagtg gacgaacaat ctaaggtctc gaggaggatc 5280aaagttctct ttgagctgat tatgggaatc aaaaatgtgg atcttgtcct ggtgatctat 5340ggatcattta ggcattgggg gcatccattc atagattatt tcgaaggatt aaacaagcta 5400cataagcagg taaccatgtc gaaggagatt gacacggagt atgcaaatgc tctggcaagt 5460gatttggcta gaatcgttct gactaaacag tttgactctg ttaagaagtg gtttgtagac 5520aagacaaaaa tcccctctgc ccatcccttt ttcaagcata tcatggataa cacatggccc 5580actgccgccc agatccaaga ctttggagac cactggcatg aactgccgtt aatcaagtgt 5640tatgagatac ctgacctcat cgatccatct atcatctatt cagacaagag ccactcaatg 5700aaccgatctg aggtgcttgg acatgtgagg agatcccctc atttgccaat accgagcaaa 5760aaggtactcc agactatgct tgataccagg gcgacaaact gggttgagtt tctagaaatg 5820gtagacaaac atggtcttga aaaggatgat ttgataattg gactcaaggg gaaagaacgt 5880gagttaaaat tagcaggtag atttttttca ttgatgtcct ggaagttgag agaatacttc 5940gttatcacgg aatatcttat aaaaacacat tttgtaccct tgtttaaggg gctgacgatg 6000gcagatgatt taacttccgt catcaaaaag atgttggata gttcttccgg acagggaata 6060gacgactact cttcagtgtg ttttgccaat catatagatt acgagaagtg gaataatcac 6120cagagaaagg aatcaaacgg accagtgttt cgggtgatgg gccaattttt gggataccca 6180cgtttgattg aacgaaccca tgagttcttt gagaaaagtc tcatttatta taacaacaga 6240ccggatctaa tgtgggtcaa tgaagacaca ctgattaatc gtacacaaca gcgagtatgt 6300tgggaaggtc aggctggagg ccttgagggg ttgaggcaaa agggttggag tattctcaat 6360cttcttgtga ttcagagaga ggcaaaaatt cgaaacacag cagtcaaggt attggcacaa 6420ggggacaatc aggtcatctg tactcaatat aagacgaaga aatccagaga tcagagtgaa 6480ctcatcaatg cattagatca aatggtgaaa aacaacaaca aaattatgga ggaaataaag 6540aagggaacga gcaaactggg actattgatt aacgatgatg agaccatgca atcggctgat 6600tatttgaatt acggtaaagt tccaatattc cgtggggtaa ttagagggtt agagacaaaa 6660agatggtccc gggtcacatg tgtgacaaat gatcaaattc caacgtgtgc caatctgatg 6720gcttctgtct caactaatgc actaacagta gctcattttg cgtctaaccc aatcaattca 6780atgatacagt acaattactt cggtaacttt tcccgactac tgttgtttat gcatgaccca 6840gcactgcgaa gatcacttta cgatgtgcag aatgaaatac cgggattgca cagtaagact 6900ttcaaatatg caatgctata tttggaccca tctattggcg gcgtttcagg gatggcattg 6960agtagattcc ttatacgtgc attcccggac cctgtaactg aaagcttatc tttctggaaa 7020tttattcatg accatactga tgatgaatac ctcaaaagct tatcaattgc ctttgggaat 7080cctgatatag cgaaattccg actagagcat atcagtaaac tgcttgagga tccaacttcc 7140ctcaatatat ctatgggaat gagtccttca aatcttttga aaaccgaagt taaaaaatgt 7200ctcattgaaa atagaacatc tatcaggaac gatattatca aagatgccac catctatttg 7260aaccaagagg aagcaaaatt gaaaagcttc ttatggtcta tcaatccact gtttcctaga 7320tttttgagtg agttcaaatc tggcaccttc ctgggagtat ccgaaggatt aatcagtcta 7380ttccaaaatt ctcggaccat ccgaaattcc ttcaagggta agtatcggaa agagctggat 7440cacttgatcg tgaagagtga aatttcttct ctcaaacatc tgggcggcat tcacttcaaa 7500ttggggaatg ggaaaatttg gggatgctcg tcatcccaat cagatttgct tagatacaga 7560tcctggggaa gaaaactggt gggaactaca attcctcatc ctttggaaat gcacggagca 7620gcgagtccta aagaggctcc ttgcaccttg tgtaactgct ctggcctgac ttacatctct 7680gttcattgcc cgaaaggaat tacagaggta ttttccagaa gaggaccctt accggcgtac 7740ctgggttcta agacatcgga gaccacttca attcttcagc cttgggaaaa agaaagtaag 7800gttcctattg taagacgagc tactagactg agagatgcca tctcatggtt catagaccca 7860gattctacac ttgctcaatc tattcttgac aacattaaat ctttgacagg ggaagagtgg 7920ggaggaagac agcatgggta taagagaact ggctctgcat tgcatagatt ttctacctca 7980cgtatgagca atggagggtt tgcttctcaa agtcccgcgg ctttgacccg attgattgct 8040acgactgaca ccatgcacga ttatggagac aagaattatg atttcatgtt ccaggcctct 8100ttgttatacg cacagatgac tacatctata tccagatggg ggcatgtcgg ggcttgcaca 8160gatcattacc atgtccgttg tgacagctgc attcgagaaa tacaagagat tgaattgaac 8220actggagtcc agtactctcc ccccgatgtg tcttatgttt tgacaaaatg gcggaacggc 8280tcaggttctt ggggtactgt caccaaacaa ctcatcccga aagaaggaaa ctggaccgta 8340ctctcgcctg cagaacaatc ctatcaagtt ggacggtgta tcggatttct gtacggagat 8400ctagtacata agaaatcaca tcaagcggac gacagttcat tatttccgtt aagcatacaa 8460cacaaagtga gagggagagg ttttcttgaa ggtcttttag atggaataat gagagctagc 8520tgttgtcaag tcattcacag gagaagtgtc gcaaccttaa agcgtccggc aaatgctgtg 8580tatgggggag tcatattctt gattgacaaa ttgagtatgt cagccccatt cttgtcttta 8640acccgtactg gtcctatcag ggaagaacta gaaaatgtcc ctcacaaaat gccagcgtcc 8700tacccaacta ataatcgaga tttggggatg accgtcagaa actacttcaa gtatcaatgt 8760cgaatcattg agagaggaca gtataaatcc cattatccca caatttggtt attttccgat 8820gtcttatcgg tggactttat tggtcctatg tccttgtcat ctggacttat gagattgtta 8880tacaagaaca gtctcagtaa gaaagacaaa aatgagctcc gagacttggc aaatctttca 8940tctcttctca gatcaggaga agaatgggat gatatacatg tcaaattttt ctctcaagac 9000ttactctttt gttctcagga gatacgacat gcctgtaaat tcgggattat acgagacaaa 9060gtaagtctag aagtggatca tgggtggggg aaagaagcat atggaggatg tacagtgctt 9120ccagtgttct acaggtctca gatttataag aaaagtttga ctgtaccccc acgaattcaa 9180aaccctatca tatctggact ccgcttgggg caacttccta caggagctca ttataagatc 9240agatcaatca tcatgactct aaagatcaat tatcaggact tcctgtcatg tggagacggt 9300tcagggggga tgactgcctg cttgctccgg ttaaacccta atagtcgggg aattttcaat 9360agtttgctag aattagatgg agcattaatg agaggatcat cccccgagcc acccagtgcg 9420ctagagacgt tggggagcca aagaactcga tgtgtaaacg gaggaacatg ttgggaacat 9480ccctctgact tgagcgaccc caatacttgg aagtatttta ttggattgaa gagaggatta 9540ggcttgcaga tcaatctgat tactatggat atggaagttc gagatccagt gatctcacac 9600aaaattgaag caaacatccg agcatttctc tatgatcttt tagacccgga gggaaccctt 9660atatacaaaa cgtatggcac atatctggca gaagaggaaa ggaatattct gacagaagta 9720ggtcctttgt ttcacactac tgacttggtg caaactattt acagtagtgc ccagacttcg 9780gaggtttact gtgtatgcag acggttaaag aaatatgctg atcaacaaca tgtggattgg 9840tcattgttga ctgatggatg gtctcggtta tatgcgtttt ctgtgaatcg attggaattc 9900caaagggctc agagtcttcg gaaactggac acactgcaag gaattccaag ctttttcata 9960ccagatcctt ttgtcaatgc ggagacttta ttgcaaattg caggtgttcc aacagggatt 10020tctcacacag ccgtattaca tggatcgtta cattctgaac aattgataac gcttggtatt 10080ttcttctgtg cgctaatctc tcaccataca atgaacatca tacgaatatc acctgtcccc 10140ccgtctcctc catccgatgg gtcaataagt agaatgtgtt ctgcaatcac agggatccta 10200ttttgggtct ccttagtgga gaaggacttg actctataca actcattgtt gtcaataata 10260cagagatcct ttccaatccg atggtacaaa aataaggaga aaaacggatg gtcccaatgt 10320tggggggcaa atggagacgg gatacccaaa gatactcgac taaatgattc gatggcgaac 10380ataggaaact ggataagggc tatggagttg ctttgcaata agaccgctca gatgcccttc

10440tctcccaagt tgttcaatcg attggccgca caatatgaca gagaattaac atggaagaag 10500gtgttggcta aaacaggact tgcagattta ctaacaggac aaatttcaca aattgatcga 10560tcagttgcga atgtccggag cgagccgagt aatgagaact cttggcaaga ttagagcgat 10620ccacaagtat gaaaaaaact aatcccatag ccattttaaa ttattgaaat tgatgaaatt 10680ggcgtcgacc ggccgcgatt ctggakccga tgcgta 107168442PRTCarajas VirusN protein 8Met Asn Ser Ile Val Lys Lys Val Ile Asp Asp Thr Val Ile Gln Pro 1 5 10 15 Lys Leu Pro Ala Asn Glu Asp Pro Val Glu Tyr Pro Ala Asp Tyr Phe 20 25 30 Lys Thr Ser Lys Gln Ile Pro Leu Tyr Ile Asn Thr Asp Lys Thr Leu 35 40 45 Ala Glu Leu Arg Ala Phe Val Tyr Gln Gly Leu Lys Ala Gly Asn Pro 50 55 60 Ser Ile Ile His Val Asn Ser Tyr Leu Tyr Leu Ala Leu Lys Asp Ile 65 70 75 80 Lys Ala Thr Leu Glu Arg Asp Trp Thr Ser Phe Ser Ile Thr Ile Gly 85 90 95 Lys Gln Gly Glu Glu Ile Thr Ile Phe Asn Leu Val Ser Val Arg Pro 100 105 110 Leu Val Ile Thr Val Pro Asp Gly Arg Thr Asp Pro Asp Arg Ser Pro 115 120 125 Asn Asp Asp Lys Trp Leu Pro Ile Tyr Leu Leu Gly Leu Tyr Arg Val 130 135 140 Gly Arg Thr Lys Leu Pro Glu Tyr Arg Lys Lys Leu Met Glu Gly Leu 145 150 155 160 Glu Met Gln Cys Lys Ile Met Tyr Pro Asp Phe Val Pro Ile Val Pro 165 170 175 Glu Gly Met Asp Phe Phe Asp Val Trp Gly Asn Asp Ser Asn Phe Thr 180 185 190 Lys Ile Val Ala Ala Val Asp Met Phe Phe His Met Phe Lys Lys His 195 200 205 Glu Arg Ala Ser Leu Arg Tyr Gly Thr Ile Val Ser Arg Phe Lys Asp 210 215 220 Cys Ala Ala Leu Ala Thr Phe Gly His Val Cys Lys Val Ser Gly Met 225 230 235 240 Ser Thr Glu Glu Val Thr Thr Trp Val Leu Asn Arg Glu Val Ala Asp 245 250 255 Glu Leu Cys Gln Met Met Phe Pro Gly Gln Glu Ile Asp Arg Ala Asp 260 265 270 Ser Tyr Met Pro Tyr Met Ile Asp Phe Gly Leu Ser Gln Lys Ser Pro 275 280 285 Tyr Ser Ser Val Lys Asn Pro Ser Phe His Phe Trp Gly Gln Leu Ala 290 295 300 Ala Leu Leu Leu Arg Ser Thr Arg Ala Lys Asn Ala Arg Gln Pro Asp 305 310 315 320 Asp Ile Glu Tyr Thr Ser Leu Thr Thr Ala Gly Leu Leu Leu Ala Tyr 325 330 335 Ala Val Gly Ser Ser Ala Asp Ile Ser Gln Gln Phe Tyr Met Gly Asp 340 345 350 Glu Lys Tyr Ile Ser Asp Pro Ser Ala Gly Gly Leu Thr Ser Asn Ala 355 360 365 Pro Pro Lys Gly Arg Asn Val Val Asp Trp Leu Gly Trp Phe Glu Asp 370 375 380 Gln Gly Gly Asn Ile Thr Pro Asp Met Tyr Thr Ser Leu Lys Gly Leu 385 390 395 400 Phe Ala Leu Cys Lys Gly Cys Glu Ile Arg Pro Leu Glu Ser Met Pro 405 410 415 Arg Glu Ser Leu Thr Ser Asp Ser Ile Gln Ile Lys Cys Phe Thr Thr 420 425 430 Cys Cys Ile Ile Tyr Asn Tyr Glu Lys Asn 435 440 9261PRTCarajas VirusP protein 9Met Gly Thr Tyr Thr His Leu Asp Ser Ala Leu Gln Asp Ala Asn Glu 1 5 10 15 Ser Glu Glu Ser Arg Asp Glu Lys Ser Asn Phe Asp Leu Phe Asp Glu 20 25 30 Glu Ser Lys Glu Val Ala Arg Pro Ser Tyr Tyr Ser Ala Ile Asp Glu 35 40 45 Glu Ser Asp Gln Glu Glu Thr Glu Ser Asp Asp Pro Asp Glu Glu Leu 50 55 60 Asn Asp Ser Asn Ala His Gly Ala Val Asp Gly Trp Asp Glu Thr Leu 65 70 75 80 Asn Glu Asn Ser Gln Pro Asp Asp Asn Val Ser Val Glu Phe Ala Arg 85 90 95 Thr Trp Ser Thr Pro Val Met Glu Ser Ser Ser Glu Gly Lys Thr Leu 100 105 110 His Leu Ala Met Pro Asp Gly Leu Asn Pro Asp Gln Val Ala Gln Trp 115 120 125 Leu Gln Thr Val Lys Ala Leu Phe Glu Ser Ala Lys Tyr Trp Asn Leu 130 135 140 Ser Glu Cys Arg Met Glu Val Leu Leu Glu Gly Val Leu Ile Lys Glu 145 150 155 160 Arg Gln Met Thr Pro Asp Leu Gln Lys Val Thr Pro Lys Pro Asn Asn 165 170 175 Pro Pro Pro Glu Ser Met Pro Cys Asp Pro Leu Pro Pro Ala Met Asp 180 185 190 Val Trp Glu Ala Ala Ser Gln Val Tyr Thr Leu Glu Pro Lys Arg Ala 195 200 205 Asn Leu Ala Pro Met Asp Val Lys Leu Lys Asp Leu Phe Ser Ser Arg 210 215 220 Ala Glu Phe Leu Ser Val Gly Gly Ser Pro Gln Met Ser Trp Lys Glu 225 230 235 240 Ala Ile Ile Leu Gly Leu Arg Tyr Lys Lys Leu Tyr Asn Gln Ala Arg 245 250 255 Leu Lys Tyr Ser Leu 260 10228PRTCarajas VirusM protein 10Met Ser Ser Leu Lys Lys Ile Leu Gly Leu Lys Gly Lys Lys Glu Glu 1 5 10 15 Lys Ser Lys Lys Leu Gly Leu Pro Pro Pro Tyr Glu Met Pro Ala Asn 20 25 30 Asn Glu Phe Glu Pro Asn Ala Pro Leu Asp Pro Asp Met Phe Gly Ala 35 40 45 Glu His Leu Glu Ile Glu Ser Lys Ser Ala Met Arg Tyr Glu Lys Phe 50 55 60 Lys Phe Ser Val Lys Ile Thr Leu Arg Thr Asn Arg Pro Leu Arg Thr 65 70 75 80 Tyr Asp Asp Val Cys Gln Ile Leu Ser Lys Trp Asp Ala Met Tyr Val 85 90 95 Gly Met Met Gly Lys Arg Pro Phe Tyr Lys Val Leu Val Leu Ile Gly 100 105 110 Ser Ser His Leu Gln Ala Thr Pro Ala Ile Leu Ser Asp Arg Gly Gln 115 120 125 Pro Glu Tyr His Met Tyr Leu Glu Asp Arg Gly Phe Ile Ala His Arg 130 135 140 Leu Gly Leu Thr Pro Pro Met Leu Ser Gly Pro Glu Ser Phe Arg Arg 145 150 155 160 Pro Phe His Val Gly Leu Tyr Arg Gly Thr Ile Asp Ile Thr Val Asn 165 170 175 Leu Met Asp Asp Glu Ser Thr Glu Ser Ala Pro Gln Val Trp Asp His 180 185 190 Phe Asn Thr Arg Tyr Val Asn His Phe Leu Glu His Ala Lys Arg Phe 195 200 205 Gly Leu Val Leu Ser Lys Lys Pro Gly Gly Gly Trp Ile Leu Asp Gln 210 215 220 Ala Val Cys Ala 225 11519PRTCarajas VirusG protein 11Met Val Ile Ala Gly Leu Ile Leu Cys Ile Gly Ile Leu Pro Ala Ile 1 5 10 15 Gly Lys Ile Thr Ile Ser Phe Pro Gln Ser Leu Lys Gly Asp Trp Arg 20 25 30 Pro Val Pro Lys Gly Tyr Asn Tyr Cys Pro Thr Ser Ala Asp Lys Asn 35 40 45 Leu His Gly Asp Leu Ile Asp Ile Gly Leu Arg Leu Arg Ala Pro Lys 50 55 60 Ser Phe Lys Gly Ile Ser Ala Asp Gly Trp Met Cys His Ala Ala Arg 65 70 75 80 Trp Ile Thr Thr Cys Asp Phe Arg Trp Tyr Gly Pro Lys Tyr Ile Thr 85 90 95 His Ser Ile His Ser Phe Arg Pro Ser Asn Asp Gln Cys Lys Glu Ala 100 105 110 Ile Arg Leu Thr Asn Glu Gly Asn Trp Ile Asn Pro Gly Phe Pro Pro 115 120 125 Gln Ser Cys Gly Tyr Ala Ser Val Thr Asp Ser Glu Ser Val Val Val 130 135 140 Thr Val Thr Lys His Gln Val Leu Val Asp Glu Tyr Ser Gly Ser Trp 145 150 155 160 Ile Asp Ser Gln Phe Pro Gly Gly Ser Cys Thr Ser Pro Ile Cys Asp 165 170 175 Thr Val His Asn Ser Thr Leu Trp His Ala Asp His Thr Leu Asp Ser 180 185 190 Ile Cys Asp Gln Glu Phe Val Ala Met Asp Ala Val Leu Phe Thr Glu 195 200 205 Ser Gly Lys Phe Glu Glu Phe Gly Lys Pro Asn Ser Gly Ile Arg Ser 210 215 220 Asn Tyr Phe Pro Tyr Glu Ser Leu Lys Asp Val Cys Gln Met Asp Phe 225 230 235 240 Cys Lys Arg Lys Gly Phe Lys Leu Pro Ser Gly Val Trp Phe Glu Ile 245 250 255 Glu Asp Ala Glu Lys Ser His Lys Ala Gln Val Glu Leu Lys Ile Lys 260 265 270 Arg Cys Pro His Gly Ala Val Ile Ser Ala Pro Asn Gln Asn Ala Ala 275 280 285 Asp Ile Asn Leu Ile Met Asp Val Glu Arg Ile Leu Asp Tyr Ser Leu 290 295 300 Cys Gln Ala Thr Trp Ser Lys Ile Gln Asn Lys Glu Ala Leu Thr Pro 305 310 315 320 Ile Asp Ile Ser Tyr Leu Gly Pro Lys Asn Pro Gly Pro Gly Pro Ala 325 330 335 Phe Thr Ile Ile Asn Gly Thr Leu His Tyr Phe Asn Thr Arg Tyr Ile 340 345 350 Arg Val Asp Ile Ala Gly Pro Val Thr Lys Glu Ile Thr Gly Phe Val 355 360 365 Ser Gly Thr Ser Thr Ser Arg Val Leu Trp Asp Gln Trp Phe Pro Tyr 370 375 380 Gly Glu Asn Ser Ile Gly Pro Asn Gly Leu Leu Lys Thr Ala Ser Gly 385 390 395 400 Tyr Lys Tyr Pro Leu Phe Met Val Gly Thr Gly Val Leu Asp Ala Asp 405 410 415 Ile His Lys Leu Gly Glu Ala Thr Val Ile Glu His Pro His Ala Lys 420 425 430 Glu Ala Gln Lys Val Val Asp Asp Ser Glu Val Ile Phe Phe Gly Asp 435 440 445 Thr Gly Val Ser Lys Asn Pro Val Glu Val Val Glu Gly Trp Phe Ser 450 455 460 Gly Trp Arg Ser Ser Leu Met Ser Ile Phe Gly Ile Ile Leu Leu Ile 465 470 475 480 Val Cys Leu Val Leu Ile Val Arg Ile Leu Ile Ala Leu Lys Tyr Cys 485 490 495 Cys Val Arg His Lys Lys Arg Thr Ile Tyr Lys Glu Asp Leu Glu Met 500 505 510 Gly Arg Ile Pro Arg Arg Ala 515 122109PRTCarajas VirusL protein 12Met Asp Phe Leu Pro Val Glu Gln Glu Glu Asp Trp Gly Tyr Ala Glu 1 5 10 15 Asp Asp Phe Ser Ser Ser Asp Tyr Leu Asp Phe Glu Glu Arg Met Thr 20 25 30 Tyr Leu Asn Gln Ala Asp Tyr Asn Leu Asn Ser Pro Leu Ile Ser Asp 35 40 45 Asp Ile Tyr Tyr Leu Ser Arg Lys Phe His Ser Tyr Gly Ile Pro Pro 50 55 60 Met Trp Asn Leu Lys Glu Trp Asp Gly Pro Leu Glu Met Leu Lys Ser 65 70 75 80 Cys Gln Ala Asp Pro Ile Pro His Asp Leu Met His Lys Trp Phe Gly 85 90 95 Thr Trp Leu Glu Asp Phe Asp His Asp Ser Ala Gln Gly Ile Val Phe 100 105 110 Leu Arg Glu Val Asp Lys Glu Ala Ser Glu Thr Tyr Asp Leu Val Asp 115 120 125 Thr Phe Leu Lys Asn Trp Ala Gly Lys Ser Tyr Pro Tyr Lys Ala Lys 130 135 140 Glu Arg Tyr Leu Asp Gln Met Lys Ile Ile Gly Pro Leu Cys Gln Lys 145 150 155 160 Phe Leu Asp Leu His Lys Leu Thr Leu Ile Leu Asn Ala Val Gly Pro 165 170 175 Glu Glu Leu Lys Asn Leu Leu Arg Thr Phe Lys Gly Arg Thr Arg Asp 180 185 190 Leu Ser Thr Lys Asp Pro Cys Thr Arg Leu Arg Val Pro Ser Leu Gly 195 200 205 Pro Val Phe Ile Cys Lys Gly Trp Val Tyr Ile His Lys His Lys Ile 210 215 220 Leu Met Asp Arg Asn Phe Leu Leu Met Cys Lys Asp Val Ile Ile Gly 225 230 235 240 Arg Met Gln Thr Leu Leu Ser Met Ile Gly Arg Ser Asp Asp Ala Phe 245 250 255 Thr Gln Gln Asp Phe Phe Thr Leu Val Asn Ile Tyr Arg Thr Gly Asp 260 265 270 Ile Ile Leu Gln Glu Lys Gly Asn Leu Ala Tyr Asp Leu Ile Lys Met 275 280 285 Val Glu Pro Ile Cys Asn Leu Lys Leu Met Lys Leu Ala Arg Glu Tyr 290 295 300 Arg Pro Leu Ile Pro Pro Phe Pro His Phe Glu Asn His Val Lys Asn 305 310 315 320 Ala Val Asp Glu Gln Ser Lys Val Ser Arg Arg Ile Lys Val Leu Phe 325 330 335 Glu Leu Ile Met Gly Ile Lys Asn Val Asp Leu Val Leu Val Ile Tyr 340 345 350 Gly Ser Phe Arg His Trp Gly His Pro Phe Ile Asp Tyr Phe Glu Gly 355 360 365 Leu Asn Lys Leu His Lys Gln Val Thr Met Ser Lys Glu Ile Asp Thr 370 375 380 Glu Tyr Ala Asn Ala Leu Ala Ser Asp Leu Ala Arg Ile Val Leu Thr 385 390 395 400 Lys Gln Phe Asp Ser Val Lys Lys Trp Phe Val Asp Lys Thr Lys Ile 405 410 415 Pro Ser Ala His Pro Phe Phe Lys His Ile Met Asp Asn Thr Trp Pro 420 425 430 Thr Ala Ala Gln Ile Gln Asp Phe Gly Asp His Trp His Glu Leu Pro 435 440 445 Leu Ile Lys Cys Tyr Glu Ile Pro Asp Leu Ile Asp Pro Ser Ile Ile 450 455 460 Tyr Ser Asp Lys Ser His Ser Met Asn Arg Ser Glu Val Leu Gly His 465 470 475 480 Val Arg Arg Ser Pro His Leu Pro Ile Pro Ser Lys Lys Val Leu Gln 485 490 495 Thr Met Leu Asp Thr Arg Ala Thr Asn Trp Val Glu Phe Leu Glu Met 500 505 510 Val Asp Lys His Gly Leu Glu Lys Asp Asp Leu Ile Ile Gly Leu Lys 515 520 525 Gly Lys Glu Arg Glu Leu Lys Leu Ala Gly Arg Phe Phe Ser Leu Met 530 535 540 Ser Trp Lys Leu Arg Glu Tyr Phe Val Ile Thr Glu Tyr Leu Ile Lys 545 550 555 560 Thr His Phe Val Pro Leu Phe Lys Gly Leu Thr Met Ala Asp Asp Leu 565 570 575 Thr Ser Val Ile Lys Lys Met Leu Asp Ser Ser Ser Gly Gln Gly Ile 580 585 590 Asp Asp Tyr Ser Ser Val Cys Phe Ala Asn His Ile Asp Tyr Glu Lys 595 600 605 Trp Asn Asn His Gln Arg Lys Glu Ser Asn Gly Pro Val Phe Arg Val 610 615 620 Met Gly Gln Phe Leu Gly Tyr Pro Arg Leu Ile Glu Arg Thr His Glu 625 630 635 640 Phe Phe Glu Lys Ser Leu Ile Tyr Tyr Asn Asn Arg Pro Asp Leu Met 645 650 655 Trp Val Asn Glu Asp Thr Leu Ile Asn Arg Thr Gln Gln Arg Val Cys 660 665 670 Trp Glu Gly Gln Ala Gly Gly Leu Glu Gly Leu Arg Gln Lys Gly Trp 675 680 685 Ser Ile Leu Asn Leu Leu Val Ile Gln Arg Glu Ala Lys Ile Arg Asn 690 695 700 Thr Ala Val Lys Val Leu Ala Gln Gly Asp Asn Gln Val Ile Cys Thr 705 710 715 720 Gln Tyr Lys Thr Lys Lys Ser Arg Asp Gln Ser Glu Leu Ile Asn Ala 725 730 735 Leu Asp Gln Met Val Lys Asn Asn Asn Lys Ile Met Glu Glu Ile Lys 740 745 750 Lys Gly Thr Ser Lys Leu Gly Leu Leu Ile Asn Asp Asp Glu Thr Met 755 760 765 Gln Ser Ala Asp Tyr Leu Asn Tyr Gly Lys Val Pro Ile Phe Arg Gly 770 775 780 Val Ile Arg Gly Leu

Glu Thr Lys Arg Trp Ser Arg Val Thr Cys Val 785 790 795 800 Thr Asn Asp Gln Ile Pro Thr Cys Ala Asn Leu Met Ala Ser Val Ser 805 810 815 Thr Asn Ala Leu Thr Val Ala His Phe Ala Ser Asn Pro Ile Asn Ser 820 825 830 Met Ile Gln Tyr Asn Tyr Phe Gly Asn Phe Ser Arg Leu Leu Leu Phe 835 840 845 Met His Asp Pro Ala Leu Arg Arg Ser Leu Tyr Asp Val Gln Asn Glu 850 855 860 Ile Pro Gly Leu His Ser Lys Thr Phe Lys Tyr Ala Met Leu Tyr Leu 865 870 875 880 Asp Pro Ser Ile Gly Gly Val Ser Gly Met Ala Leu Ser Arg Phe Leu 885 890 895 Ile Arg Ala Phe Pro Asp Pro Val Thr Glu Ser Leu Ser Phe Trp Lys 900 905 910 Phe Ile His Asp His Thr Asp Asp Glu Tyr Leu Lys Ser Leu Ser Ile 915 920 925 Ala Phe Gly Asn Pro Asp Ile Ala Lys Phe Arg Leu Glu His Ile Ser 930 935 940 Lys Leu Leu Glu Asp Pro Thr Ser Leu Asn Ile Ser Met Gly Met Ser 945 950 955 960 Pro Ser Asn Leu Leu Lys Thr Glu Val Lys Lys Cys Leu Ile Glu Asn 965 970 975 Arg Thr Ser Ile Arg Asn Asp Ile Ile Lys Asp Ala Thr Ile Tyr Leu 980 985 990 Asn Gln Glu Glu Ala Lys Leu Lys Ser Phe Leu Trp Ser Ile Asn Pro 995 1000 1005 Leu Phe Pro Arg Phe Leu Ser Glu Phe Lys Ser Gly Thr Phe Leu 1010 1015 1020 Gly Val Ser Glu Gly Leu Ile Ser Leu Phe Gln Asn Ser Arg Thr 1025 1030 1035 Ile Arg Asn Ser Phe Lys Gly Lys Tyr Arg Lys Glu Leu Asp His 1040 1045 1050 Leu Ile Val Lys Ser Glu Ile Ser Ser Leu Lys His Leu Gly Gly 1055 1060 1065 Ile His Phe Lys Leu Gly Asn Gly Lys Ile Trp Gly Cys Ser Ser 1070 1075 1080 Ser Gln Ser Asp Leu Leu Arg Tyr Arg Ser Trp Gly Arg Lys Leu 1085 1090 1095 Val Gly Thr Thr Ile Pro His Pro Leu Glu Met His Gly Ala Ala 1100 1105 1110 Ser Pro Lys Glu Ala Pro Cys Thr Leu Cys Asn Cys Ser Gly Leu 1115 1120 1125 Thr Tyr Ile Ser Val His Cys Pro Lys Gly Ile Thr Glu Val Phe 1130 1135 1140 Ser Arg Arg Gly Pro Leu Pro Ala Tyr Leu Gly Ser Lys Thr Ser 1145 1150 1155 Glu Thr Thr Ser Ile Leu Gln Pro Trp Glu Lys Glu Ser Lys Val 1160 1165 1170 Pro Ile Val Arg Arg Ala Thr Arg Leu Arg Asp Ala Ile Ser Trp 1175 1180 1185 Phe Ile Asp Pro Asp Ser Thr Leu Ala Gln Ser Ile Leu Asp Asn 1190 1195 1200 Ile Lys Ser Leu Thr Gly Glu Glu Trp Gly Gly Arg Gln His Gly 1205 1210 1215 Tyr Lys Arg Thr Gly Ser Ala Leu His Arg Phe Ser Thr Ser Arg 1220 1225 1230 Met Ser Asn Gly Gly Phe Ala Ser Gln Ser Pro Ala Ala Leu Thr 1235 1240 1245 Arg Leu Ile Ala Thr Thr Asp Thr Met His Asp Tyr Gly Asp Lys 1250 1255 1260 Asn Tyr Asp Phe Met Phe Gln Ala Ser Leu Leu Tyr Ala Gln Met 1265 1270 1275 Thr Thr Ser Ile Ser Arg Trp Gly His Val Gly Ala Cys Thr Asp 1280 1285 1290 His Tyr His Val Arg Cys Asp Ser Cys Ile Arg Glu Ile Gln Glu 1295 1300 1305 Ile Glu Leu Asn Thr Gly Val Gln Tyr Ser Pro Pro Asp Val Ser 1310 1315 1320 Tyr Val Leu Thr Lys Trp Arg Asn Gly Ser Gly Ser Trp Gly Thr 1325 1330 1335 Val Thr Lys Gln Leu Ile Pro Lys Glu Gly Asn Trp Thr Val Leu 1340 1345 1350 Ser Pro Ala Glu Gln Ser Tyr Gln Val Gly Arg Cys Ile Gly Phe 1355 1360 1365 Leu Tyr Gly Asp Leu Val His Lys Lys Ser His Gln Ala Asp Asp 1370 1375 1380 Ser Ser Leu Phe Pro Leu Ser Ile Gln His Lys Val Arg Gly Arg 1385 1390 1395 Gly Phe Leu Glu Gly Leu Leu Asp Gly Ile Met Arg Ala Ser Cys 1400 1405 1410 Cys Gln Val Ile His Arg Arg Ser Val Ala Thr Leu Lys Arg Pro 1415 1420 1425 Ala Asn Ala Val Tyr Gly Gly Val Ile Phe Leu Ile Asp Lys Leu 1430 1435 1440 Ser Met Ser Ala Pro Phe Leu Ser Leu Thr Arg Thr Gly Pro Ile 1445 1450 1455 Arg Glu Glu Leu Glu Asn Val Pro His Lys Met Pro Ala Ser Tyr 1460 1465 1470 Pro Thr Asn Asn Arg Asp Leu Gly Met Thr Val Arg Asn Tyr Phe 1475 1480 1485 Lys Tyr Gln Cys Arg Ile Ile Glu Arg Gly Gln Tyr Lys Ser His 1490 1495 1500 Tyr Pro Thr Ile Trp Leu Phe Ser Asp Val Leu Ser Val Asp Phe 1505 1510 1515 Ile Gly Pro Met Ser Leu Ser Ser Gly Leu Met Arg Leu Leu Tyr 1520 1525 1530 Lys Asn Ser Leu Ser Lys Lys Asp Lys Asn Glu Leu Arg Asp Leu 1535 1540 1545 Ala Asn Leu Ser Ser Leu Leu Arg Ser Gly Glu Glu Trp Asp Asp 1550 1555 1560 Ile His Val Lys Phe Phe Ser Gln Asp Leu Leu Phe Cys Ser Gln 1565 1570 1575 Glu Ile Arg His Ala Cys Lys Phe Gly Ile Ile Arg Asp Lys Val 1580 1585 1590 Ser Leu Glu Val Asp His Gly Trp Gly Lys Glu Ala Tyr Gly Gly 1595 1600 1605 Cys Thr Val Leu Pro Val Phe Tyr Arg Ser Gln Ile Tyr Lys Lys 1610 1615 1620 Ser Leu Thr Val Pro Pro Arg Ile Gln Asn Pro Ile Ile Ser Gly 1625 1630 1635 Leu Arg Leu Gly Gln Leu Pro Thr Gly Ala His Tyr Lys Ile Arg 1640 1645 1650 Ser Ile Ile Met Thr Leu Lys Ile Asn Tyr Gln Asp Phe Leu Ser 1655 1660 1665 Cys Gly Asp Gly Ser Gly Gly Met Thr Ala Cys Leu Leu Arg Leu 1670 1675 1680 Asn Pro Asn Ser Arg Gly Ile Phe Asn Ser Leu Leu Glu Leu Asp 1685 1690 1695 Gly Ala Leu Met Arg Gly Ser Ser Pro Glu Pro Pro Ser Ala Leu 1700 1705 1710 Glu Thr Leu Gly Ser Gln Arg Thr Arg Cys Val Asn Gly Gly Thr 1715 1720 1725 Cys Trp Glu His Pro Ser Asp Leu Ser Asp Pro Asn Thr Trp Lys 1730 1735 1740 Tyr Phe Ile Gly Leu Lys Arg Gly Leu Gly Leu Gln Ile Asn Leu 1745 1750 1755 Ile Thr Met Asp Met Glu Val Arg Asp Pro Val Ile Ser His Lys 1760 1765 1770 Ile Glu Ala Asn Ile Arg Ala Phe Leu Tyr Asp Leu Leu Asp Pro 1775 1780 1785 Glu Gly Thr Leu Ile Tyr Lys Thr Tyr Gly Thr Tyr Leu Ala Glu 1790 1795 1800 Glu Glu Arg Asn Ile Leu Thr Glu Val Gly Pro Leu Phe His Thr 1805 1810 1815 Thr Asp Leu Val Gln Thr Ile Tyr Ser Ser Ala Gln Thr Ser Glu 1820 1825 1830 Val Tyr Cys Val Cys Arg Arg Leu Lys Lys Tyr Ala Asp Gln Gln 1835 1840 1845 His Val Asp Trp Ser Leu Leu Thr Asp Gly Trp Ser Arg Leu Tyr 1850 1855 1860 Ala Phe Ser Val Asn Arg Leu Glu Phe Gln Arg Ala Gln Ser Leu 1865 1870 1875 Arg Lys Leu Asp Thr Leu Gln Gly Ile Pro Ser Phe Phe Ile Pro 1880 1885 1890 Asp Pro Phe Val Asn Ala Glu Thr Leu Leu Gln Ile Ala Gly Val 1895 1900 1905 Pro Thr Gly Ile Ser His Thr Ala Val Leu His Gly Ser Leu His 1910 1915 1920 Ser Glu Gln Leu Ile Thr Leu Gly Ile Phe Phe Cys Ala Leu Ile 1925 1930 1935 Ser His His Thr Met Asn Ile Ile Arg Ile Ser Pro Val Pro Pro 1940 1945 1950 Ser Pro Pro Ser Asp Gly Ser Ile Ser Arg Met Cys Ser Ala Ile 1955 1960 1965 Thr Gly Ile Leu Phe Trp Val Ser Leu Val Glu Lys Asp Leu Thr 1970 1975 1980 Leu Tyr Asn Ser Leu Leu Ser Ile Ile Gln Arg Ser Phe Pro Ile 1985 1990 1995 Arg Trp Tyr Lys Asn Lys Glu Lys Asn Gly Trp Ser Gln Cys Trp 2000 2005 2010 Gly Ala Asn Gly Asp Gly Ile Pro Lys Asp Thr Arg Leu Asn Asp 2015 2020 2025 Ser Met Ala Asn Ile Gly Asn Trp Ile Arg Ala Met Glu Leu Leu 2030 2035 2040 Cys Asn Lys Thr Ala Gln Met Pro Phe Ser Pro Lys Leu Phe Asn 2045 2050 2055 Arg Leu Ala Ala Gln Tyr Asp Arg Glu Leu Thr Trp Lys Lys Val 2060 2065 2070 Leu Ala Lys Thr Gly Leu Ala Asp Leu Leu Thr Gly Gln Ile Ser 2075 2080 2085 Gln Ile Asp Arg Ser Val Ala Asn Val Arg Ser Glu Pro Ser Asn 2090 2095 2100 Glu Asn Ser Trp Gln Asp 2105 1312416DNABahia Grande Virus 13acaatattag ataaactcct ctacttctta actatcgtta gacatggccg ccgcaatact 60tccagtttct cgtaacatgc ctgtcagaga aaggacagtg gcaggaagtg taacagcgcc 120accagttcag tatccaagca cctggttcca agcccatgcc ggacaaaaag tttcaataac 180tatttatcaa aatactaatg cacgacaagc tttctccaga attactcaac tcagaaacaa 240cggacaatgg gatgataaat tgatcgctac tttcatgaaa ggtgtcttgg atgaaaatgc 300tgaatggttc caaagccctc ccctcattga ggactggatt gtaaatgaag cagtcatcgg 360aagagtagat gacgtagttg cacccactgc acttgcacag tgggaagagg ttgaaaggcc 420tcaaaacatg gatccagtac ccaatgagga aggagaactg gggactcgga ggtcattttt 480cttggcatta atcaccatct acaggcaagt actgacaaga accatcaatg tggactacgg 540ccaagaagtg agcagaagga taatagataa tttcaaagaa caacctttag gtatgtcaca 600ggatgacata aatgaaatcc aggggtatga atcaaaagaa aggctaacta caaattatgt 660gaaaatctta tgcatccttg atatgttctt caataagttt cagacccatg acaaaagcac 720catcaggata gctactttac caacaagata tagaggatgt gctgcattca cttcatacgg 780agaactagca ataagattgg gaattgaacc cataaagctg cccagtttga ttcttacagt 840agcagtggcc aaagatttcg ataagatcaa tgtcaatgga gagcaagcag agcaattaga 900tggatatttt ccatatcaat tagagttggg attagttaaa aagagtgctt attcagcagg 960aaattgtcca tctttatact tatggatgca caccatagga acaatgctcc atcaacaaag 1020atcttatcga gccaatgttc ccaaaaatgt accagaccaa atgggaacaa taaattctgc 1080aattgctgtt gccatgcagt ttgttgctgg gggagagttc agtatgcaat ttgtagggga 1140tgcacgagtt caagaagcca tgagagaaat gcaaacagca gaagctgaat tgaatgagtt 1200aagaatggct caggcaagag aaatgagagc tgcagcaaga ggagatgaag atgaagaagg 1260ctctgaagat ggacttgatg atgaaaatga tggagaaggg gatgatgagt taccagctga 1320aattgaacaa aatcctgaat atttaaatag agtcaacagg atcagagaat tacaagaaaa 1380cctccaacaa tacaacgcaa cagtacaaca gcacactaat gcggtagaaa aagccgcact 1440cagagcactc gcttatcttc aagaaaatgg aggaattgca gataaggaca agagagactt 1500gggtataaga ttcaggaggt ttgctgatga agcggaaggt agagtcggta aattattagc 1560cagtttgttc cctgccccga gataaatatt ctttcaggta tcattttctt atttttaaaa 1620tattttatcc agattttaat ttctttatct actgtattat tttattcaaa tatgttttca 1680attaattttt tcttctttat atgttatatt ctatacatat gttaatgttc atgaaaaaaa 1740caacaaatct cataagatac tcgtttaaag aaatggctta ttcaactggt ttgattaaag 1800gtgaagtgtc ccaaggattg tctaatgcat ttaaagatgc aggaatacat caaatagaat 1860taaataaaga atatgacaat ttatcaattt tgggggccaa catgagtgca ttgaataaaa 1920tgtttgacac agaagatgaa gggttatctg atactaatac taactcatca aaaaactcta 1980ttttacaagc gagtgatatg ttcataggaa atgatgaata tgaatcagat gactctcatc 2040attttctaag ctcacctagt ccagataaag gaagcagtga agaaggaagc aacctccaag 2100aattcaattt tcagatacct agaaacaagg ttggaaaaga aaaggcatac aggaggggag 2160tcattgatgt attggatttt ctacagagac acagatttat agaagaattc cgtatggaag 2220gacttaatga ggatatagtc tgtatcatcc ctacaagagg aatgatcccc acaaaaacac 2280cccctaccct ggatgacaaa attcatcttg ctaacgatca gtcaatagaa aaagaagaaa 2340tcctccaaaa agacaagaca tcaaaaccaa acaaaggaat caaacagcca aacaagcaag 2400aggcacaacc agtctctgaa tctcaaacag gaatgaagga agacaaaaaa gaacaaaagc 2460caaagcaaaa ccaaattccc attaaaaaca aacaggaaaa tgaagactca aaagaagttg 2520ctaagaccaa caaagataaa gaaaataaag tcagcaaagg aagtatgtca aagaatgaca 2580aactaaaaga aggcaatata actgttccaa aacagggatt tgaaaagaag aaaacaaaac 2640aaataaatga agaaggccac aaatcatttg attatgctaa tacatatggg acaaaagtca 2700ctgtgaaaac tataaggtat tgtaagacat gcaatcctaa tactagaaaa aatgctacag 2760tatatcttga ccatctttat gaacgccaca gtcatgaggt tgctttgatt aahagcttgg 2820cttaccctct tttattttwt ttwwggttga wttaaattaa ctaattagat actttyttaa 2880tacatgawaa wwacaacaaa tctaataaat tacattgaaa caaagatgtc tggtgtgatg 2940agtatattta aaaggaagga caagaaaggg aatgagggtt ccaaagccct agccatacca 3000gatgaaaaat cagtagtccc atctgcacct ccagacatct cagctatgga ttatgggagg 3060tttggtttat tagggaggca aactctatta gaagaagatg aggaagaatc tagatgcatc 3120actattatag atctagaagt cgatctacag atagaggtgt tatctaatag agaaactcga 3180cttgtaatag acttgattgc tcctttgtgt aatcttcaaa ctgattacat tggaaaagag 3240aacacaaaag caatttggat aggattaact gtagtagcag cttttggagt gaaaagaacc 3300attaagacaa aaaatcatca tgtatataaa gggtgtgtct ccagtggact taggctttta 3360atagactcag aaaaacaatt tgagctagat aagaggaata aatgstctca gcatctcagt 3420tatctcacca atggtgtaaa aacagagtgg gccataagag gggagatgat caggacaaga 3480gtaccttacc ttcctcagcc aggaagtgag gatgtgctta tgtttttagc agggatggga 3540ataagttgtt attcaaatcc agatggtcat ttagtcctca aagtttgaaa aataacaaaa 3600ttctttagag atcatattca gtatttatac cttagtaata ttgtggctca gatttaatga 3660tgggagtgcc taaagtattt caattttggg ttagaatcag gacatgaaaa aaacaacaaa 3720tctaattaac tatcatttag tacttagaac gaacttatct tctgttgaat catgatttcg 3780aatatgtttt tcttgtttca actctcatta tttctacagt ttatagcagg agatgagtca 3840ttagaaacaa taacagcccc tgaaactcct gaccctatac tcttaaaagg agatacaaaa 3900tatctgttct tagtcccttc ttctgtcaaa aattggaaac cagctgacct gaatgaatta 3960acatgccccc ccctaatctc gaaaccagat acttctgaaa tgacttattt ttccacagat 4020gtgatggagt tacaaaaaca tcatgaattg gcaccagtag aagggtattt atgttcgggt 4080ttgcgttaca aagtaatatg ttctgaagga ttttttggac aaaaaacaat agcaaaaaag 4140attgagaaca ttgaacctga tagtaaacaa tgccttgatg acttgtcaaa atttaagaat 4200gatgattacc tactcccata tttcccttct gaagattgta attggatgaa agagactccc 4260acccataaag attttatagt ttttcaaaaa cattttgtta aatatgaccc atacaataat 4320ggtttttatg atcctttact taaaaaagac tactgtgata ctcaagtctg tgagacagaa 4380catgatcaaa ctatttggat aacagaaaag agtattgaaa atgaatgcat cttcaattat 4440ccgattaaaa agcatatatt ccatacagct gactttggga aaatgataat agattacgaa 4500ttaaatcaat ggacttcagt ggaagatggg tgtttaatta actattgtgg aagagaggga 4560ataaggttat ctaatgggat gttctttgta ggtaagttct ataaaaatct caataattta 4620cagacctgta gtgctggaac aaaggtcagt tacaagcctt taacctccaa gctggaagaa 4680attgaaaatg aaatcattct agatcaggaa agattattat gtcttgattc aattaggcaa 4740atgacagcaa caaaaaaatt atcattttat tctttatcct ttctagaacc aaaatcttct 4800agtaggcaca aggtctttag aattcataat aaaacactag aatataccga aaccgaatgg 4860catccaatca tgtcgtttaa ttttgatgaa ccaaacaaaa ttggaattga caagaatggt 4920aaatcagttt attggaatga atgggttcct agtggaatat ctgggctgtt atcagggttc 4980aatggagtct acaaaaaaga aaatgaaact aaagtaacta ttgcccgatt agaaacaata 5040aaagaagatt atgataggga gatgatgata gatcacgagt tggtagaggt agaacatcct 5100aaaattgtac acttaaaaag agagaacatc acaggatcta gagtcgaaat tgttaataaa 5160gaacattctg atgtgagtgg ttggctgtca tcagtattga gtagtttttg gggaaaaatc 5220atgatgacaa taataagtat aatcttaatc gtaataatag gattagtttt aataaactgc 5280tgcccaatta tatgcaaatc atgtattaaa cgttataaaa caaaggaaga atcccgcaat 5340agacatagat tggatagaga agataacggt agattgagga ggcaacatcg agttattttt 5400aacaatcaat ccaatgatga agaaaatgcc attgaaatgg tagaatatac tgacactccc 5460aggccattgc gaccgattcc tgatgccaca acatcagaca ctgagtcaag atcccccaca 5520acagcccata gttttttcaa ccgttaaaaa ggtaggttat attatacttt tctctatacc 5580tctaatagtc atcatcgtgt tttttgtgtt attagataga aaacatctca aatatatacc 5640tttaaaggca tggaacactt caataattac aattaaagaa ccttattaaa attaaaaagt 5700tttctttaaa ataattctcc taattgattt taatttcatg aaaaaaacat taahaaatct 5760aagtatmact saaatttagg gtatgcttgg tgtgttaaaa tggatttctc ttatgaacaa 5820ttgctggatc ctatagatgt cttagaagaa gaattatatg aatttgattt cgaatatgat 5880gattacactg atgatgatca gacaccctta cccaatatta agtacaaaaa cctagaaggt 5940aaagactata atttaaactc acctctcatc agcgatgtga tcgattcagg aagagaatac 6000ataattaatt ctaaaaagta cttttctcat

gaaagaacaa atccggagtt ggaacaattt 6060agtaaagctc taatggctat tgggttttct agatttgatt tacgaaaatc atcagaacat 6120cataggtaca tgagttcata tatatatgga aatgagaaaa aacatatgaa aatcgaaata 6180atacccagat ggaaagaagt cttagaactg actcgcaatc ctgtagaagt aacctctcat 6240aagatattgg gatcaaaatc acaatctgat caagaaggat atataaatag attgcgatat 6300attacagtag atggacctca tgcaagaaaa acaagattac accaagaatg ggaaaaattc 6360tcaacattac attatataac gtatattatg aattcaaaag cctttagtga caacaaaaat 6420tgggtgaggg aagtctttga gaccatagaa actagtgaag ttgaccctga aataattaca 6480ataattggaa caggtttatc aaagaaagaa gtatcctgga ttatatctga gaactttgca 6540ttaaatgtta gaacaggttt atttgtctcc aaagatttct tgctgatgat taaagatgtc 6600accttagcta gatgtatgag caaactgagt atgattaaca gaaagtctcc caacacaact 6660tatgatatga taaaattttt ggatagtcta tatgaaagtg gtgacaaaat attgacaaga 6720catggaaatt tagcttacaa gcatatcaag ttattggagg cagcttgtct agagagatgg 6780aatcaattag ggcacaaatt tcgaccattg ataccaatct cttcaagcat gagtgatcat 6840cttagaactc aattagaaga aaatcaagat ctctatatgg tgagtaggga attcttcgat 6900ttgattggaa agattgaaga tccttgggtc gttgctcaag cgtatggaac attcaggcat 6960tggggacatc catacattga ttatttaaat ggtctaaaag atctagaaaa aagagtaaat 7020gaaaatatca aaattgataa aaattatgca gaaaaattgg ctagcgatct tgcgtttata 7080gttctaaaag accaatttgg aaaacataaa agatggtttg ctaaacctaa taaagaattg 7140gatgaaaata atcccatgcg aaaatgcata gaaaacaatg tgtggcctaa cactaaagtt 7200attttagact tcggagacaa ttggcataaa ttagaattat taccatgttt tgaaatccct 7260gatgcaatag acctttctga cctatatagt gataaagctc attccatgca atacagtgaa 7320gtattaaatt atgtaaaata caaaaaatcc aaaaagaata tccctgcctt acgtgttatc 7380gggacattat tagaaaagga aaatccaaat ataaaagaat ttttacaaaa aataaacgat 7440gaaggtttag atgatgatga tctgataata gggctgaaag caaagaaaga gaactgaaag 7500ataaaggaag atttttctct cttatgagtt ggaatattag gttatatttt ktgattacag 7560aatatttaat twwwttwcaw ttttktmcca ttgttttctg gcttaacagt agcggatgac 7620ttaaatactg dcmsmmamrr attmttaagt gctacagaag gacaaggtct agatgactat 7680gaaagggtct acatagcaaa tagtttagat tatgaaaaat ggaacaacag gcagcgttat 7740gaatctaatg aaccagtatt cacagtaatg gggaaatttt taggttatcc aaacttaata 7800tcgtatactc ataagatttt tgaaagatca tttatctatt ataacggaag actagactta 7860atgggagtag atggttacca tatttataat ttatttgatg ataaaatggt ctgttggcat 7920ggtcaattgg gaggatttga aggtgtaaga caaaagggct ggagtgtttt aaattactta 7980attttgcgaa gagaagctgc aacacgaaat actgcaccga aatttttagc ccaaggagac 8040aatcaaattg tcattactca gtatacattg accagtaaaa gcactcaagc tataattgaa 8100cgagaattga ggaatatttg ggaaaacaat gctcatataa tgcataggat acaacaagcg 8160acaagtcgaa ttggattagt cataaataat gatgaagtgt taacttccgc agagttattg 8220gtttacggta aaataccagt atttcgaggg aaattgttac ctttagaaac aaaaagatgg 8280tctagagtca gtaccgtgac aaatgaacag ataccatcct tttctaattc attggctagt 8340agtacaacta ctgctttggc ggttaatcaa cactcagaaa atcctatcga ggttatatct 8400caacatcatt tctttagttc ttttgctggc acattagtaa catttgttaa tcctatctta 8460ggttttgatc cgattaaata ttctcaattg tcagagagaa ataagaagtt attcttatta 8520aggcttattt acaaagatcc aagtgttggg ggagtttgtg gaactaattt attaaggttt 8580tttatatcaa gatttcctga tcctttgaca gagacattga catggtggaa aatattggtt 8640gagaattcta aagataaaga ggttgttaaa attgcgctag aatgtggaaa tcctaagttt 8700ggagggatta atgataagac attagctatg ttactcgaag accctatgtc actaaatata 8760ccaggaggac tctcaagtga cacgatgata aaaaacaaaa tttatgaagg tcttattcat 8820caaatggggc ttaaattgat caaaaatgaa ttggttgtag aatctctaac cttctataat 8880gattacaaag cacaatttgt aagatggtta ttctccataa gaccaatttt cccacgattc 8940attagtgaat tttatacatc tacttatttt tatataacag aaagtgtcct tgccatattt 9000caaaattcta gaaccattag aaaagttttc tcaaaaagat ttccgaaaga ggtttatctc 9060acgatagtta aaggagaaca aatgtctata gatagcttat tgacaaccaa aagagggatt 9120gttagggagg ctatttggaa atgttcagca acgaaagcag atgaaatgag aaaactatca 9180tggggtagag atatggttgg aataacaaca cctcatccag ctgaattcac acaagaatta 9240ttatgttcag acgggtgttc agaacctcac attgtagcca aaaaggttat ttactctgat 9300agaaaattat ggactaaggg taagatgatg ccttaccttg gtactaaaac caaagagtcc 9360acaagtatac ttcaaccatg ggaaaaaaga ttagagattc cattattgag gaaagcatgt 9420gatttaagaa aagccattag gtggtttgta gaagataatt caaacttagc aaaatccatt 9480tataaaaatt tagaaagtat gacaggaatt gatttaagag aagaacttcg aaactataaa 9540agaactggta gtagcaaaca tagattaaga aactcgagag tctccaatga aggtaatccc 9600gccataggtt ataataacct aacgtatgtc acagtaacaa ctgatagttt aggaaatatt 9660aattccgaaa attatgattt catgtatcaa tctatcttat gctggtgtgg tgtattatcg 9720tccctagcaa ccaatcgata tcgagaccat gagactactc attttcatct taaatgtaat 9780gattgcttca gattggttaa agaggaaata ttagaggctc cttcagttta cccatttcct 9840aatgtaagat cctctgtaag gagaatgctt acacaggata ttaaattaaa atatctgcca 9900cgaatttctg cccctgatga aaacacctgg gatactctgg atgttgatca aaaaagttgg 9960catattggga gagctcaagg gtttttgtgg ggattaaatg tatttaccaa aaccactaaa 10020gaggttgagg gtgacatttt cccaacttcc ataacgaaaa aagtcgaacc agaaaattac 10080atggatggtt tacacagagg gttttgttta ggagctactc tctcccccat gtacacaaga 10140tatggatcac tcagcaggat ggctagaaga aaattcgaag gagcatactg ggaaatcgta 10200gatgaagcaa tgaaaactaa tctaccaaat atgattgatc amaaaaattt caaacctttc 10260ctgagaagga caggaggtga tctaattaaa tcttatcctg cacgaaagga agagttggta 10320cttgttttaa agaaatggtt cttacataaa atggtctctg aaagaaaaaa caattccata 10380tgggaaagta aaagagtaat tgcctttgct gacatggaca ctgaatttgt attgtgtctc 10440ttcagattag cggaaagcat actgaattgt tatcaaaatg aagctttatc tgctggtcag 10500gctagggtct tagggaatgc aaaagagaca atagatctga tctcaaaata caataactca 10560aacattaatg cagatgagat tgagcgattg cagcagatat tgatggcttc tgacctgaaa 10620gatcatgaag ttgtagattc acaagctagg catgctgctt ctgacttacc tgaattggca 10680aaatcagaaa attacaatga agtgattaaa tatgtagaat ttagaggtta tggtggtaaa 10740accataagat tagaatatca acctagtgat ttgatagact ggaagggagg aatggttcaa 10800gacctacaag tacctagatt gaagaaccct ttaatttctg gagtcagagt agtgcaatat 10860agcacaggag ctcattataa atataaagat atagaaagag aatttcaaat tgctggtgat 10920ggtatattcg ctggtgatgg ttctggtggt atgggtgcaa accatctgag attacataaa 10980tcagcccgcg ttatatttaa ctctaaatta gagttagaag gagaatcttt aaaagggtta 11040gcccctgcag gacctggagc ttacacggtc tcaggtgaag atgttgtgga aagatgtgtc 11100aattacacaa cttgctggga agaagcttct gatctgagtg acgaaaaaac ttggaagaat 11160ttttttaggc tcataaaaga gtactcatta gatatagaag tgttttgctg tgatgctgaa 11220gtccaagacc catatatcac aaacaaaatt gaatctaata tattgaaata catatctttg 11280atccttaata aaagaactgg aactttaatt tacaaaactt atttcaatag attattggat 11340cccaatacta taacccactt tttgggaatg tttttccata gatgttacgg atttctccct 11400actactcaag gatcctttac ctctgaaatt tacattgtct gtcaatatcc aaagacactt 11460gactctacaa gcaaaacaga gttaacctat actagtttat ttaatattta tcagaacata 11520agagtgatgg aaacttatca aaatgaattt gatagagcat gtagtttatt gttttctgat 11580atgacggaag gtcttattga taaaacacca tttttagatc ctgaagaatt ggctattttc 11640ctgacaacag tgggattgga tacggggtgg gctttactaa tagcagaaca attacagata 11700tcttgctcaa acaaattaca tccaataatc atattatgga ttttaggctt tataatttcc 11760agacacttag tgagtataac atcttggttt cgtagaggaa caaaattccc tccttctatc 11820cagttgcaaa aaatgttagc tgctctattt ggaatctggt atggagtctc ttatattatg 11880aatgatgcag agagttactc aaggatttct gtattgtaca atcaagagat ttatttctca 11940ttaggcttga ctaatatggt atataggaaa aaagatgaca tggaattggg tcaattttca 12000acttggaaga taggacctgg tgataatagt aaactcatag atataggtcc caaagcgggt 12060ataactcaga caatgataag agctattgta gtcttgtata aaggagaaca tataacttct 12120attgtgacta aggaagataa agtagaagga gatagaattt taagcttatt tggaaaagga 12180ttgaatctta aaactttaat ggagcgaaca ggaataaatt atttgcaaat aggggaaaga 12240aatcctcaag aaattccata tacgttagag gaagaagtat tggaagaagt ggtagaagaa 12300aatacaggag aatttgatca atcataaaca gataaaggaa atraaaaaaa aaaaaatata 12360tattgaaata ataaagctta aagaacaaga tcttgaaatt gtgaactact aagtat 1241614513PRTBahia Grande VirusN protein 14Met Ala Ala Ala Ile Leu Pro Val Ser Arg Asn Met Pro Val Arg Glu 1 5 10 15 Arg Thr Val Ala Gly Ser Val Thr Ala Pro Pro Val Gln Tyr Pro Ser 20 25 30 Thr Trp Phe Gln Ala His Ala Gly Gln Lys Val Ser Ile Thr Ile Tyr 35 40 45 Gln Asn Thr Asn Ala Arg Gln Ala Phe Ser Arg Ile Thr Gln Leu Arg 50 55 60 Asn Asn Gly Gln Trp Asp Asp Lys Leu Ile Ala Thr Phe Met Lys Gly 65 70 75 80 Val Leu Asp Glu Asn Ala Glu Trp Phe Gln Ser Pro Pro Leu Ile Glu 85 90 95 Asp Trp Ile Val Asn Glu Ala Val Ile Gly Arg Val Asp Asp Val Val 100 105 110 Ala Pro Thr Ala Leu Ala Gln Trp Glu Glu Val Glu Arg Pro Gln Asn 115 120 125 Met Asp Pro Val Pro Asn Glu Glu Gly Glu Leu Gly Thr Arg Arg Ser 130 135 140 Phe Phe Leu Ala Leu Ile Thr Ile Tyr Arg Gln Val Leu Thr Arg Thr 145 150 155 160 Ile Asn Val Asp Tyr Gly Gln Glu Val Ser Arg Arg Ile Ile Asp Asn 165 170 175 Phe Lys Glu Gln Pro Leu Gly Met Ser Gln Asp Asp Ile Asn Glu Ile 180 185 190 Gln Gly Tyr Glu Ser Lys Glu Arg Leu Thr Thr Asn Tyr Val Lys Ile 195 200 205 Leu Cys Ile Leu Asp Met Phe Phe Asn Lys Phe Gln Thr His Asp Lys 210 215 220 Ser Thr Ile Arg Ile Ala Thr Leu Pro Thr Arg Tyr Arg Gly Cys Ala 225 230 235 240 Ala Phe Thr Ser Tyr Gly Glu Leu Ala Ile Arg Leu Gly Ile Glu Pro 245 250 255 Ile Lys Leu Pro Ser Leu Ile Leu Thr Val Ala Val Ala Lys Asp Phe 260 265 270 Asp Lys Ile Asn Val Asn Gly Glu Gln Ala Glu Gln Leu Asp Gly Tyr 275 280 285 Phe Pro Tyr Gln Leu Glu Leu Gly Leu Val Lys Lys Ser Ala Tyr Ser 290 295 300 Ala Gly Asn Cys Pro Ser Leu Tyr Leu Trp Met His Thr Ile Gly Thr 305 310 315 320 Met Leu His Gln Gln Arg Ser Tyr Arg Ala Asn Val Pro Lys Asn Val 325 330 335 Pro Asp Gln Met Gly Thr Ile Asn Ser Ala Ile Ala Val Ala Met Gln 340 345 350 Phe Val Ala Gly Gly Glu Phe Ser Met Gln Phe Val Gly Asp Ala Arg 355 360 365 Val Gln Glu Ala Met Arg Glu Met Gln Thr Ala Glu Ala Glu Leu Asn 370 375 380 Glu Leu Arg Met Ala Gln Ala Arg Glu Met Arg Ala Ala Ala Arg Gly 385 390 395 400 Asp Glu Asp Glu Glu Gly Ser Glu Asp Gly Leu Asp Asp Glu Asn Asp 405 410 415 Gly Glu Gly Asp Asp Glu Leu Pro Ala Glu Ile Glu Gln Asn Pro Glu 420 425 430 Tyr Leu Asn Arg Val Asn Arg Ile Arg Glu Leu Gln Glu Asn Leu Gln 435 440 445 Gln Tyr Asn Ala Thr Val Gln Gln His Thr Asn Ala Val Glu Lys Ala 450 455 460 Ala Leu Arg Ala Leu Ala Tyr Leu Gln Glu Asn Gly Gly Ile Ala Asp 465 470 475 480 Lys Asp Lys Arg Asp Leu Gly Ile Arg Phe Arg Arg Phe Ala Asp Glu 485 490 495 Ala Glu Gly Arg Val Gly Lys Leu Leu Ala Ser Leu Phe Pro Ala Pro 500 505 510 Arg 15353PRTBahia Grande VirusP protein 15Met Ala Tyr Ser Thr Gly Leu Ile Lys Gly Glu Val Ser Gln Gly Leu 1 5 10 15 Ser Asn Ala Phe Lys Asp Ala Gly Ile His Gln Ile Glu Leu Asn Lys 20 25 30 Glu Tyr Asp Asn Leu Ser Ile Leu Gly Ala Asn Met Ser Ala Leu Asn 35 40 45 Lys Met Phe Asp Thr Glu Asp Glu Gly Leu Ser Asp Thr Asn Thr Asn 50 55 60 Ser Ser Lys Asn Ser Ile Leu Gln Ala Ser Asp Met Phe Ile Gly Asn 65 70 75 80 Asp Glu Tyr Glu Ser Asp Asp Ser His His Phe Leu Ser Ser Pro Ser 85 90 95 Pro Asp Lys Gly Ser Ser Glu Glu Gly Ser Asn Leu Gln Glu Phe Asn 100 105 110 Phe Gln Ile Pro Arg Asn Lys Val Gly Lys Glu Lys Ala Tyr Arg Arg 115 120 125 Gly Val Ile Asp Val Leu Asp Phe Leu Gln Arg His Arg Phe Ile Glu 130 135 140 Glu Phe Arg Met Glu Gly Leu Asn Glu Asp Ile Val Cys Ile Ile Pro 145 150 155 160 Thr Arg Gly Met Ile Pro Thr Lys Thr Pro Pro Thr Leu Asp Asp Lys 165 170 175 Ile His Leu Ala Asn Asp Gln Ser Ile Glu Lys Glu Glu Ile Leu Gln 180 185 190 Lys Asp Lys Thr Ser Lys Pro Asn Lys Gly Ile Lys Gln Pro Asn Lys 195 200 205 Gln Glu Ala Gln Pro Val Ser Glu Ser Gln Thr Gly Met Lys Glu Asp 210 215 220 Lys Lys Glu Gln Lys Pro Lys Gln Asn Gln Ile Pro Ile Lys Asn Lys 225 230 235 240 Gln Glu Asn Glu Asp Ser Lys Glu Val Ala Lys Thr Asn Lys Asp Lys 245 250 255 Glu Asn Lys Val Ser Lys Gly Ser Met Ser Lys Asn Asp Lys Leu Lys 260 265 270 Glu Gly Asn Ile Thr Val Pro Lys Gln Gly Phe Glu Lys Lys Lys Thr 275 280 285 Lys Gln Ile Asn Glu Glu Gly His Lys Ser Phe Asp Tyr Ala Asn Thr 290 295 300 Tyr Gly Thr Lys Val Thr Val Lys Thr Ile Arg Tyr Cys Lys Thr Cys 305 310 315 320 Asn Pro Asn Thr Arg Lys Asn Ala Thr Val Tyr Leu Asp His Leu Tyr 325 330 335 Glu Arg His Ser His Glu Val Ala Leu Ile Lys Ser Leu Ala Tyr Pro 340 345 350 Leu 16220PRTBahia Grande VirusM protein 16Met Ser Gly Val Met Ser Ile Phe Lys Arg Lys Asp Lys Lys Gly Asn 1 5 10 15 Glu Gly Ser Lys Ala Leu Ala Ile Pro Asp Glu Lys Ser Val Val Pro 20 25 30 Ser Ala Pro Pro Asp Ile Ser Ala Met Asp Tyr Gly Arg Phe Gly Leu 35 40 45 Leu Gly Arg Gln Thr Leu Leu Glu Glu Asp Glu Glu Glu Ser Arg Cys 50 55 60 Ile Thr Ile Ile Asp Leu Glu Val Asp Leu Gln Ile Glu Val Leu Ser 65 70 75 80 Asn Arg Glu Thr Arg Leu Val Ile Asp Leu Ile Ala Pro Leu Cys Asn 85 90 95 Leu Gln Thr Asp Tyr Ile Gly Lys Glu Asn Thr Lys Ala Ile Trp Ile 100 105 110 Gly Leu Thr Val Val Ala Ala Phe Gly Val Lys Arg Thr Ile Lys Thr 115 120 125 Lys Asn His His Val Tyr Lys Gly Cys Val Ser Ser Gly Leu Arg Leu 130 135 140 Leu Ile Asp Ser Glu Lys Gln Phe Glu Leu Asp Lys Arg Asn Lys Xaa 145 150 155 160 Ser Gln His Leu Ser Tyr Leu Thr Asn Gly Val Lys Thr Glu Trp Ala 165 170 175 Ile Arg Gly Glu Met Ile Arg Thr Arg Val Pro Tyr Leu Pro Gln Pro 180 185 190 Gly Ser Glu Asp Val Leu Met Phe Leu Ala Gly Met Gly Ile Ser Cys 195 200 205 Tyr Ser Asn Pro Asp Gly His Leu Val Leu Lys Val 210 215 220 17591PRTBahia Grande VirusG protein 17Met Ile Ser Asn Met Phe Phe Leu Phe Gln Leu Ser Leu Phe Leu Gln 1 5 10 15 Phe Ile Ala Gly Asp Glu Ser Leu Glu Thr Ile Thr Ala Pro Glu Thr 20 25 30 Pro Asp Pro Ile Leu Leu Lys Gly Asp Thr Lys Tyr Leu Phe Leu Val 35 40 45 Pro Ser Ser Val Lys Asn Trp Lys Pro Ala Asp Leu Asn Glu Leu Thr 50 55 60 Cys Pro Pro Leu Ile Ser Lys Pro Asp Thr Ser Glu Met Thr Tyr Phe 65 70 75 80 Ser Thr Asp Val Met Glu Leu Gln Lys His His Glu Leu Ala Pro Val 85 90 95 Glu Gly Tyr Leu Cys Ser Gly Leu Arg Tyr Lys Val Ile Cys Ser Glu 100 105 110 Gly Phe Phe Gly Gln Lys Thr Ile Ala Lys Lys Ile Glu Asn Ile Glu 115 120 125 Pro Asp Ser Lys Gln Cys Leu Asp Asp Leu Ser Lys Phe Lys Asn Asp 130 135 140 Asp Tyr Leu Leu Pro Tyr Phe Pro Ser Glu Asp Cys Asn Trp Met Lys 145 150 155 160 Glu Thr Pro Thr His Lys Asp Phe Ile Val Phe Gln Lys His Phe Val 165 170 175 Lys Tyr Asp Pro Tyr Asn Asn Gly Phe Tyr Asp Pro Leu Leu Lys Lys 180 185 190 Asp Tyr Cys Asp Thr Gln Val Cys Glu Thr Glu His Asp Gln Thr Ile 195 200 205 Trp Ile Thr Glu Lys Ser Ile Glu Asn Glu Cys Ile Phe Asn Tyr Pro 210

215 220 Ile Lys Lys His Ile Phe His Thr Ala Asp Phe Gly Lys Met Ile Ile 225 230 235 240 Asp Tyr Glu Leu Asn Gln Trp Thr Ser Val Glu Asp Gly Cys Leu Ile 245 250 255 Asn Tyr Cys Gly Arg Glu Gly Ile Arg Leu Ser Asn Gly Met Phe Phe 260 265 270 Val Gly Lys Phe Tyr Lys Asn Leu Asn Asn Leu Gln Thr Cys Ser Ala 275 280 285 Gly Thr Lys Val Ser Tyr Lys Pro Leu Thr Ser Lys Leu Glu Glu Ile 290 295 300 Glu Asn Glu Ile Ile Leu Asp Gln Glu Arg Leu Leu Cys Leu Asp Ser 305 310 315 320 Ile Arg Gln Met Thr Ala Thr Lys Lys Leu Ser Phe Tyr Ser Leu Ser 325 330 335 Phe Leu Glu Pro Lys Ser Ser Ser Arg His Lys Val Phe Arg Ile His 340 345 350 Asn Lys Thr Leu Glu Tyr Thr Glu Thr Glu Trp His Pro Ile Met Ser 355 360 365 Phe Asn Phe Asp Glu Pro Asn Lys Ile Gly Ile Asp Lys Asn Gly Lys 370 375 380 Ser Val Tyr Trp Asn Glu Trp Val Pro Ser Gly Ile Ser Gly Leu Leu 385 390 395 400 Ser Gly Phe Asn Gly Val Tyr Lys Lys Glu Asn Glu Thr Lys Val Thr 405 410 415 Ile Ala Arg Leu Glu Thr Ile Lys Glu Asp Tyr Asp Arg Glu Met Met 420 425 430 Ile Asp His Glu Leu Val Glu Val Glu His Pro Lys Ile Val His Leu 435 440 445 Lys Arg Glu Asn Ile Thr Gly Ser Arg Val Glu Ile Val Asn Lys Glu 450 455 460 His Ser Asp Val Ser Gly Trp Leu Ser Ser Val Leu Ser Ser Phe Trp 465 470 475 480 Gly Lys Ile Met Met Thr Ile Ile Ser Ile Ile Leu Ile Val Ile Ile 485 490 495 Gly Leu Val Leu Ile Asn Cys Cys Pro Ile Ile Cys Lys Ser Cys Ile 500 505 510 Lys Arg Tyr Lys Thr Lys Glu Glu Ser Arg Asn Arg His Arg Leu Asp 515 520 525 Arg Glu Asp Asn Gly Arg Leu Arg Arg Gln His Arg Val Ile Phe Asn 530 535 540 Asn Gln Ser Asn Asp Glu Glu Asn Ala Ile Glu Met Val Glu Tyr Thr 545 550 555 560 Asp Thr Pro Arg Pro Leu Arg Pro Ile Pro Asp Ala Thr Thr Ser Asp 565 570 575 Thr Glu Ser Arg Ser Pro Thr Thr Ala His Ser Phe Phe Asn Arg 580 585 590 182175PRTBahia Grande VirusL protein 18Met Asp Phe Ser Tyr Glu Gln Leu Leu Asp Pro Ile Asp Val Leu Glu 1 5 10 15 Glu Glu Leu Tyr Glu Phe Asp Phe Glu Tyr Asp Asp Tyr Thr Asp Asp 20 25 30 Asp Gln Thr Pro Leu Pro Asn Ile Lys Tyr Lys Asn Leu Glu Gly Lys 35 40 45 Asp Tyr Asn Leu Asn Ser Pro Leu Ile Ser Asp Val Ile Asp Ser Gly 50 55 60 Arg Glu Tyr Ile Ile Asn Ser Lys Lys Tyr Phe Ser His Glu Arg Thr 65 70 75 80 Asn Pro Glu Leu Glu Gln Phe Ser Lys Ala Leu Met Ala Ile Gly Phe 85 90 95 Ser Arg Phe Asp Leu Arg Lys Ser Ser Glu His His Arg Tyr Met Ser 100 105 110 Ser Tyr Ile Tyr Gly Asn Glu Lys Lys His Met Lys Ile Glu Ile Ile 115 120 125 Pro Arg Trp Lys Glu Val Leu Glu Leu Thr Arg Asn Pro Val Glu Val 130 135 140 Thr Ser His Lys Ile Leu Gly Ser Lys Ser Gln Ser Asp Gln Glu Gly 145 150 155 160 Tyr Ile Asn Arg Leu Arg Tyr Ile Thr Val Asp Gly Pro His Ala Arg 165 170 175 Lys Thr Arg Leu His Gln Glu Trp Glu Lys Phe Ser Thr Leu His Tyr 180 185 190 Ile Thr Tyr Ile Met Asn Ser Lys Ala Phe Ser Asp Asn Lys Asn Trp 195 200 205 Val Arg Glu Val Phe Glu Thr Ile Glu Thr Ser Glu Val Asp Pro Glu 210 215 220 Ile Ile Thr Ile Ile Gly Thr Gly Leu Ser Lys Lys Glu Val Ser Trp 225 230 235 240 Ile Ile Ser Glu Asn Phe Ala Leu Asn Val Arg Thr Gly Leu Phe Val 245 250 255 Ser Lys Asp Phe Leu Leu Met Ile Lys Asp Val Thr Leu Ala Arg Cys 260 265 270 Met Ser Lys Leu Ser Met Ile Asn Arg Lys Ser Pro Asn Thr Thr Tyr 275 280 285 Asp Met Ile Lys Phe Leu Asp Ser Leu Tyr Glu Ser Gly Asp Lys Ile 290 295 300 Leu Thr Arg His Gly Asn Leu Ala Tyr Lys His Ile Lys Leu Leu Glu 305 310 315 320 Ala Ala Cys Leu Glu Arg Trp Asn Gln Leu Gly His Lys Phe Arg Pro 325 330 335 Leu Ile Pro Ile Ser Ser Ser Met Ser Asp His Leu Arg Thr Gln Leu 340 345 350 Glu Glu Asn Gln Asp Leu Tyr Met Val Ser Arg Glu Phe Phe Asp Leu 355 360 365 Ile Gly Lys Ile Glu Asp Pro Trp Val Val Ala Gln Ala Tyr Gly Thr 370 375 380 Phe Arg His Trp Gly His Pro Tyr Ile Asp Tyr Leu Asn Gly Leu Lys 385 390 395 400 Asp Leu Glu Lys Arg Val Asn Glu Asn Ile Lys Ile Asp Lys Asn Tyr 405 410 415 Ala Glu Lys Leu Ala Ser Asp Leu Ala Phe Ile Val Leu Lys Asp Gln 420 425 430 Phe Gly Lys His Lys Arg Trp Phe Ala Lys Pro Asn Lys Glu Leu Asp 435 440 445 Glu Asn Asn Pro Met Arg Lys Cys Ile Glu Asn Asn Val Trp Pro Asn 450 455 460 Thr Lys Val Ile Leu Asp Phe Gly Asp Asn Trp His Lys Leu Glu Leu 465 470 475 480 Leu Pro Cys Phe Glu Ile Pro Asp Ala Ile Asp Leu Ser Asp Leu Tyr 485 490 495 Ser Asp Lys Ala His Ser Met Gln Tyr Ser Glu Val Leu Asn Tyr Val 500 505 510 Lys Tyr Lys Lys Ser Lys Lys Asn Ile Pro Ala Leu Arg Val Ile Gly 515 520 525 Thr Leu Leu Glu Lys Glu Asn Pro Asn Ile Lys Glu Phe Leu Gln Lys 530 535 540 Ile Asn Asp Glu Gly Leu Asp Asp Asp Asp Leu Ile Ile Gly Leu Lys 545 550 555 560 Ala Lys Glu Arg Glu Leu Lys Asp Lys Gly Arg Phe Phe Ser Leu Met 565 570 575 Ser Trp Asn Ile Arg Leu Tyr Phe Val Ile Thr Glu Tyr Leu Ile Lys 580 585 590 Leu His Phe Val Pro Leu Phe Ser Gly Leu Thr Val Ala Asp Asp Leu 595 600 605 Asn Thr Val Thr Lys Lys Leu Leu Ser Ala Thr Glu Gly Gln Gly Leu 610 615 620 Asp Asp Tyr Glu Arg Val Tyr Ile Ala Asn Ser Leu Asp Tyr Glu Lys 625 630 635 640 Trp Asn Asn Arg Gln Arg Tyr Glu Ser Asn Glu Pro Val Phe Thr Val 645 650 655 Met Gly Lys Phe Leu Gly Tyr Pro Asn Leu Ile Ser Tyr Thr His Lys 660 665 670 Ile Phe Glu Arg Ser Phe Ile Tyr Tyr Asn Gly Arg Leu Asp Leu Met 675 680 685 Gly Val Asp Gly Tyr His Ile Tyr Asn Leu Phe Asp Asp Lys Met Val 690 695 700 Cys Trp His Gly Gln Leu Gly Gly Phe Glu Gly Val Arg Gln Lys Gly 705 710 715 720 Trp Ser Val Leu Asn Tyr Leu Ile Leu Arg Arg Glu Ala Ala Thr Arg 725 730 735 Asn Thr Ala Pro Lys Phe Leu Ala Gln Gly Asp Asn Gln Ile Val Ile 740 745 750 Thr Gln Tyr Thr Leu Thr Ser Lys Ser Thr Gln Ala Ile Ile Glu Arg 755 760 765 Glu Leu Arg Asn Ile Trp Glu Asn Asn Ala His Ile Met His Arg Ile 770 775 780 Gln Gln Ala Thr Ser Arg Ile Gly Leu Val Ile Asn Asn Asp Glu Val 785 790 795 800 Leu Thr Ser Ala Glu Leu Leu Val Tyr Gly Lys Ile Pro Val Phe Arg 805 810 815 Gly Lys Leu Leu Pro Leu Glu Thr Lys Arg Trp Ser Arg Val Ser Thr 820 825 830 Val Thr Asn Glu Gln Ile Pro Ser Phe Ser Asn Ser Leu Ala Ser Ser 835 840 845 Thr Thr Thr Ala Leu Ala Val Asn Gln His Ser Glu Asn Pro Ile Glu 850 855 860 Val Ile Ser Gln His His Phe Phe Ser Ser Phe Ala Gly Thr Leu Val 865 870 875 880 Thr Phe Val Asn Pro Ile Leu Gly Phe Asp Pro Ile Lys Tyr Ser Gln 885 890 895 Leu Ser Glu Arg Asn Lys Lys Leu Phe Leu Leu Arg Leu Ile Tyr Lys 900 905 910 Asp Pro Ser Val Gly Gly Val Cys Gly Thr Asn Leu Leu Arg Phe Phe 915 920 925 Ile Ser Arg Phe Pro Asp Pro Leu Thr Glu Thr Leu Thr Trp Trp Lys 930 935 940 Ile Leu Val Glu Asn Ser Lys Asp Lys Glu Val Val Lys Ile Ala Leu 945 950 955 960 Glu Cys Gly Asn Pro Lys Phe Gly Gly Ile Asn Asp Lys Thr Leu Ala 965 970 975 Met Leu Leu Glu Asp Pro Met Ser Leu Asn Ile Pro Gly Gly Leu Ser 980 985 990 Ser Asp Thr Met Ile Lys Asn Lys Ile Tyr Glu Gly Leu Ile His Gln 995 1000 1005 Met Gly Leu Lys Leu Ile Lys Asn Glu Leu Val Val Glu Ser Leu 1010 1015 1020 Thr Phe Tyr Asn Asp Tyr Lys Ala Gln Phe Val Arg Trp Leu Phe 1025 1030 1035 Ser Ile Arg Pro Ile Phe Pro Arg Phe Ile Ser Glu Phe Tyr Thr 1040 1045 1050 Ser Thr Tyr Phe Tyr Ile Thr Glu Ser Val Leu Ala Ile Phe Gln 1055 1060 1065 Asn Ser Arg Thr Ile Arg Lys Val Phe Ser Lys Arg Phe Pro Lys 1070 1075 1080 Glu Val Tyr Leu Thr Ile Val Lys Gly Glu Gln Met Ser Ile Asp 1085 1090 1095 Ser Leu Leu Thr Thr Lys Arg Gly Ile Val Arg Glu Ala Ile Trp 1100 1105 1110 Lys Cys Ser Ala Thr Lys Ala Asp Glu Met Arg Lys Leu Ser Trp 1115 1120 1125 Gly Arg Asp Met Val Gly Ile Thr Thr Pro His Pro Ala Glu Phe 1130 1135 1140 Thr Gln Glu Leu Leu Cys Ser Asp Gly Cys Ser Glu Pro His Ile 1145 1150 1155 Val Ala Lys Lys Val Ile Tyr Ser Asp Arg Lys Leu Trp Thr Lys 1160 1165 1170 Gly Lys Met Met Pro Tyr Leu Gly Thr Lys Thr Lys Glu Ser Thr 1175 1180 1185 Ser Ile Leu Gln Pro Trp Glu Lys Arg Leu Glu Ile Pro Leu Leu 1190 1195 1200 Arg Lys Ala Cys Asp Leu Arg Lys Ala Ile Arg Trp Phe Val Glu 1205 1210 1215 Asp Asn Ser Asn Leu Ala Lys Ser Ile Tyr Lys Asn Leu Glu Ser 1220 1225 1230 Met Thr Gly Ile Asp Leu Arg Glu Glu Leu Arg Asn Tyr Lys Arg 1235 1240 1245 Thr Gly Ser Ser Lys His Arg Leu Arg Asn Ser Arg Val Ser Asn 1250 1255 1260 Glu Gly Asn Pro Ala Ile Gly Tyr Asn Asn Leu Thr Tyr Val Thr 1265 1270 1275 Val Thr Thr Asp Ser Leu Gly Asn Ile Asn Ser Glu Asn Tyr Asp 1280 1285 1290 Phe Met Tyr Gln Ser Ile Leu Cys Trp Cys Gly Val Leu Ser Ser 1295 1300 1305 Leu Ala Thr Asn Arg Tyr Arg Asp His Glu Thr Thr His Phe His 1310 1315 1320 Leu Lys Cys Asn Asp Cys Phe Arg Leu Val Lys Glu Glu Ile Leu 1325 1330 1335 Glu Ala Pro Ser Val Tyr Pro Phe Pro Asn Val Arg Ser Ser Val 1340 1345 1350 Arg Arg Met Leu Thr Gln Asp Ile Lys Leu Lys Tyr Leu Pro Arg 1355 1360 1365 Ile Ser Ala Pro Asp Glu Asn Thr Trp Asp Thr Leu Asp Val Asp 1370 1375 1380 Gln Lys Ser Trp His Ile Gly Arg Ala Gln Gly Phe Leu Trp Gly 1385 1390 1395 Leu Asn Val Phe Thr Lys Thr Thr Lys Glu Val Glu Gly Asp Ile 1400 1405 1410 Phe Pro Thr Ser Ile Thr Lys Lys Val Glu Pro Glu Asn Tyr Met 1415 1420 1425 Asp Gly Leu His Arg Gly Phe Cys Leu Gly Ala Thr Leu Ser Pro 1430 1435 1440 Met Tyr Thr Arg Tyr Gly Ser Leu Ser Arg Met Ala Arg Arg Lys 1445 1450 1455 Phe Glu Gly Ala Tyr Trp Glu Ile Val Asp Glu Ala Met Lys Thr 1460 1465 1470 Asn Leu Pro Asn Met Ile Asp His Lys Asn Phe Lys Pro Phe Leu 1475 1480 1485 Arg Arg Thr Gly Gly Asp Leu Ile Lys Ser Tyr Pro Ala Arg Lys 1490 1495 1500 Glu Glu Leu Val Leu Val Leu Lys Lys Trp Phe Leu His Lys Met 1505 1510 1515 Val Ser Glu Arg Lys Asn Asn Ser Ile Trp Glu Ser Lys Arg Val 1520 1525 1530 Ile Ala Phe Ala Asp Met Asp Thr Glu Phe Val Leu Cys Leu Phe 1535 1540 1545 Arg Leu Ala Glu Ser Ile Leu Asn Cys Tyr Gln Asn Glu Ala Leu 1550 1555 1560 Ser Ala Gly Gln Ala Arg Val Leu Gly Asn Ala Lys Glu Thr Ile 1565 1570 1575 Asp Leu Ile Ser Lys Tyr Asn Asn Ser Asn Ile Asn Ala Asp Glu 1580 1585 1590 Ile Glu Arg Leu Gln Gln Ile Leu Met Ala Ser Asp Leu Lys Asp 1595 1600 1605 His Glu Val Val Asp Ser Gln Ala Arg His Ala Ala Ser Asp Leu 1610 1615 1620 Pro Glu Leu Ala Lys Ser Glu Asn Tyr Asn Glu Val Ile Lys Tyr 1625 1630 1635 Val Glu Phe Arg Gly Tyr Gly Gly Lys Thr Ile Arg Leu Glu Tyr 1640 1645 1650 Gln Pro Ser Asp Leu Ile Asp Trp Lys Gly Gly Met Val Gln Asp 1655 1660 1665 Leu Gln Val Pro Arg Leu Lys Asn Pro Leu Ile Ser Gly Val Arg 1670 1675 1680 Val Val Gln Tyr Ser Thr Gly Ala His Tyr Lys Tyr Lys Asp Ile 1685 1690 1695 Glu Arg Glu Phe Gln Ile Ala Gly Asp Gly Ile Phe Ala Gly Asp 1700 1705 1710 Gly Ser Gly Gly Met Gly Ala Asn His Leu Arg Leu His Lys Ser 1715 1720 1725 Ala Arg Val Ile Phe Asn Ser Lys Leu Glu Leu Glu Gly Glu Ser 1730 1735 1740 Leu Lys Gly Leu Ala Pro Ala Gly Pro Gly Ala Tyr Thr Val Ser 1745 1750 1755 Gly Glu Asp Val Val Glu Arg Cys Val Asn Tyr Thr Thr Cys Trp 1760 1765 1770 Glu Glu Ala Ser Asp Leu Ser Asp Glu Lys Thr Trp Lys Asn Phe 1775 1780 1785 Phe Arg Leu Ile Lys Glu Tyr Ser Leu Asp Ile Glu Val Phe Cys 1790 1795 1800 Cys Asp Ala Glu Val Gln Asp Pro Tyr Ile Thr Asn Lys Ile Glu 1805 1810 1815 Ser Asn Ile Leu Lys Tyr Ile Ser Leu Ile Leu Asn Lys Arg Thr 1820 1825 1830 Gly Thr Leu Ile Tyr Lys Thr Tyr Phe Asn Arg Leu Leu Asp Pro 1835 1840 1845 Asn Thr Ile Thr His Phe Leu Gly Met Phe Phe His Arg Cys Tyr 1850 1855 1860 Gly Phe Leu Pro Thr Thr Gln Gly Ser Phe Thr Ser Glu Ile Tyr 1865 1870 1875 Ile Val Cys Gln Tyr Pro Lys Thr Leu Asp Ser Thr Ser Lys Thr

1880 1885 1890 Glu Leu Thr Tyr Thr Ser Leu Phe Asn Ile Tyr Gln Asn Ile Arg 1895 1900 1905 Val Met Glu Thr Tyr Gln Asn Glu Phe Asp Arg Ala Cys Ser Leu 1910 1915 1920 Leu Phe Ser Asp Met Thr Glu Gly Leu Ile Asp Lys Thr Pro Phe 1925 1930 1935 Leu Asp Pro Glu Glu Leu Ala Ile Phe Leu Thr Thr Val Gly Leu 1940 1945 1950 Asp Thr Gly Trp Ala Leu Leu Ile Ala Glu Gln Leu Gln Ile Ser 1955 1960 1965 Cys Ser Asn Lys Leu His Pro Ile Ile Ile Leu Trp Ile Leu Gly 1970 1975 1980 Phe Ile Ile Ser Arg His Leu Val Ser Ile Thr Ser Trp Phe Arg 1985 1990 1995 Arg Gly Thr Lys Phe Pro Pro Ser Ile Gln Leu Gln Lys Met Leu 2000 2005 2010 Ala Ala Leu Phe Gly Ile Trp Tyr Gly Val Ser Tyr Ile Met Asn 2015 2020 2025 Asp Ala Glu Ser Tyr Ser Arg Ile Ser Val Leu Tyr Asn Gln Glu 2030 2035 2040 Ile Tyr Phe Ser Leu Gly Leu Thr Asn Met Val Tyr Arg Lys Lys 2045 2050 2055 Asp Asp Met Glu Leu Gly Gln Phe Ser Thr Trp Lys Ile Gly Pro 2060 2065 2070 Gly Asp Asn Ser Lys Leu Ile Asp Ile Gly Pro Lys Ala Gly Ile 2075 2080 2085 Thr Gln Thr Met Ile Arg Ala Ile Val Val Leu Tyr Lys Gly Glu 2090 2095 2100 His Ile Thr Ser Ile Val Thr Lys Glu Asp Lys Val Glu Gly Asp 2105 2110 2115 Arg Ile Leu Ser Leu Phe Gly Lys Gly Leu Asn Leu Lys Thr Leu 2120 2125 2130 Met Glu Arg Thr Gly Ile Asn Tyr Leu Gln Ile Gly Glu Arg Asn 2135 2140 2145 Pro Gln Glu Ile Pro Tyr Thr Leu Glu Glu Glu Val Leu Glu Glu 2150 2155 2160 Val Val Glu Glu Asn Thr Gly Glu Phe Asp Gln Ser 2165 2170 2175 19519PRTArtificial SequenceChimeric Isf-VSV G protein 19Met Thr Ser Val Leu Phe Met Val Gly Val Leu Leu Gly Ala Phe Gly 1 5 10 15 Ser Thr His Cys Ser Ile Gln Ile Val Phe Pro Ser Glu Thr Lys Leu 20 25 30 Val Trp Lys Pro Val Leu Lys Gly Thr Arg Tyr Cys Pro Gln Ser Ala 35 40 45 Glu Leu Asn Leu Glu Pro Asp Leu Lys Thr Met Ala Phe Asp Ser Lys 50 55 60 Val Pro Ile Gly Ile Thr Pro Ser Asn Ser Asp Gly Tyr Leu Cys His 65 70 75 80 Ala Ala Lys Trp Val Thr Thr Cys Asp Phe Arg Trp Tyr Gly Pro Lys 85 90 95 Tyr Ile Thr His Ser Val His Ser Leu Arg Pro Thr Val Ser Asp Cys 100 105 110 Lys Ala Ala Val Glu Ala Tyr Asn Ala Gly Thr Leu Met Tyr Pro Gly 115 120 125 Phe Pro Pro Glu Ser Cys Gly Tyr Ala Ser Ile Thr Asp Ser Glu Phe 130 135 140 Tyr Val Met Leu Val Thr Pro His Pro Val Gly Val Asp Asp Tyr Arg 145 150 155 160 Gly His Trp Val Asp Pro Leu Phe Pro Thr Ser Glu Cys Asn Ser Asn 165 170 175 Phe Cys Glu Thr Val His Asn Ala Thr Met Trp Ile Pro Lys Asp Leu 180 185 190 Lys Thr His Asp Val Cys Ser Gln Asp Phe Gln Thr Ile Arg Val Ser 195 200 205 Val Met Tyr Pro Gln Thr Lys Pro Thr Lys Gly Ala Asp Leu Thr Leu 210 215 220 Lys Ser Lys Phe His Ala His Met Lys Gly Asp Arg Val Cys Lys Met 225 230 235 240 Lys Phe Cys Asn Lys Asn Gly Leu Arg Leu Gly Asn Gly Glu Trp Ile 245 250 255 Glu Val Gly Asp Glu Val Met Leu Asp Asn Ser Lys Leu Leu Ser Leu 260 265 270 Phe Pro Asp Cys Leu Val Gly Ser Val Val Lys Ser Thr Leu Leu Ser 275 280 285 Glu Gly Val Gln Thr Ala Leu Trp Glu Thr Asp Arg Leu Leu Asp Tyr 290 295 300 Ser Leu Cys Gln Asn Thr Trp Glu Lys Ile Asp Arg Lys Glu Pro Leu 305 310 315 320 Ser Ala Val Asp Leu Ser Tyr Leu Ala Pro Arg Ser Pro Gly Lys Gly 325 330 335 Met Ala Tyr Ile Val Ala Asn Gly Ser Leu Met Ser Ala Pro Ala Arg 340 345 350 Tyr Ile Arg Val Trp Ile Asp Ser Pro Ile Leu Lys Glu Ile Lys Gly 355 360 365 Lys Lys Glu Ser Ala Ser Gly Ile Asp Thr Val Leu Trp Glu Gln Trp 370 375 380 Leu Pro Phe Asn Gly Met Glu Leu Gly Pro Asn Gly Leu Ile Lys Thr 385 390 395 400 Lys Ser Gly Tyr Lys Phe Pro Leu Tyr Leu Leu Gly Met Gly Ile Val 405 410 415 Asp Gln Asp Leu Gln Glu Leu Ser Ser Val Asn Pro Val Asp His Pro 420 425 430 His Val Pro Ile Ala Gln Ala Phe Val Ser Glu Gly Glu Glu Val Phe 435 440 445 Phe Gly Asp Thr Gly Val Ser Lys Asn Pro Ile Glu Leu Ile Ser Gly 450 455 460 Trp Phe Ser Ser Trp Lys Ser Ser Ile Ala Ser Phe Phe Phe Thr Ile 465 470 475 480 Gly Leu Ile Ile Gly Leu Phe Leu Val Leu Arg Val Gly Ile Tyr Leu 485 490 495 Cys Ile Lys Leu Lys His Thr Lys Lys Arg Gln Ile Tyr Thr Asp Ile 500 505 510 Glu Met Asn Arg Leu Gly Thr 515 201662DNAMaraba VirusG-Protein 20atgaaaaaaa ctaacagggt tcaaacactc ttgatcgagg tattgagact ttttctcttt 60tgtttcttgg ccttaggagc ccactccaaa tttactatag tattccctca tcatcaaaaa 120gggaattgga agaatgtgcc ttccacatat cattattgcc cttctagttc tgaccagaat 180tggcataatg atttgactgg agttagtctt catgtgaaaa ttcccaaaag tcacaaagct 240atacaagcag atggctggat gtgccacgct gctaaatggg tgactacttg tgacttcaga 300tggtacggac ccaaatacat cacgcattcc atacactcta tgtcacccac cctagaacag 360tgcaagacca gtattgagca gacaaagcaa ggagtttgga ttaatccagg ctttccccct 420caaagctgcg gatatgctac agtgacggat gcagaggtgg ttgttgtaca agcaacacct 480catcatgtgt tggttgatga gtacacagga gaatggattg actcacaatt ggtggggggc 540aaatgttcca aggaggtttg tcaaacggtt cacaactcga ccgtgtggca tgctgattac 600aagattacag ggctgtgcga gtcaaatctg gcatcagtgg atatcacctt cttctctgag 660gatggtcaaa agacgtcttt gggaaaaccg aacactggat tcaggagtaa ttactttgct 720tacgaaagtg gagagaaggc atgccgtatg cagtactgca cacaatgggg gatccgacta 780ccttctggag tatggtttga attagtggac aaagatctct tccaggcggc aaaattgcct 840gaatgtccta gaggatccag tatctcagct ccttctcaga cttctgtgga tgttagtttg 900atacaagacg tagagaggat cttagattac tctctatgcc aggagacgtg gagtaagata 960cgagccaagc ttcctgtatc tccagtagat ctgagttatc tcgccccaaa aaatccaggg 1020agcggaccgg ccttcactat cattaatggc actttgaaat atttcgaaac aagatacatc 1080agagttgaca taagtaatcc catcatccct cacatggtgg gaacaatgag tggaaccacg 1140actgagcgtg aattgtggaa tgattggtat ccatatgaag acgtagagat tggtccaaat 1200ggggtgttga aaactcccac tggtttcaag tttccgctgt acatgattgg gcacggaatg 1260ttggattccg atctccacaa atcctcccag gctcaagtct tcgaacatcc acacgcaaag 1320gacgctgcat cacagcttcc tgatgatgag actttatttt ttggtgacac aggactatca 1380aaaaacccag tagagttagt agaaggctgg ttcagtagct ggaagagcac attggcatcg 1440ttctttctga ttataggctt gggggttgca ttaatcttca tcattcgaat tattgttgcg 1500attcgatcac gaattctgga tccgatacgt aacgctctgc agctgcgggt tgcattaatc 1560ttcatcattc gaattattgt tgcgattcgc tataaataca aggggaggaa gacccaaaaa 1620atttacaatg atgtcgagat gagtcgattg ggaaataaat aa 166221518PRTMuir Spring virusG-Protein 21Met Lys Tyr Pro Val Leu Leu Leu Tyr Gln Asn Gln Ile Leu Leu Lys 1 5 10 15 Trp Asn Thr Cys Leu Leu Met Ser Trp Asn Ser Gln Lys His His Glu 20 25 30 Leu Ala Pro Val Gln Gly Tyr Leu Cys Ser Gly Leu Arg Tyr Lys Val 35 40 45 Ile Cys Ser Glu Gly Phe Phe Gly Gln Lys Thr Ile Thr Lys Lys Ile 50 55 60 Glu Asn Leu Glu Pro Asp Gln Asn Lys Cys Val Gln Asp Leu Glu Lys 65 70 75 80 Phe Ile Asn Asp Asp Tyr Leu Leu Pro Tyr Phe Pro Ser Glu Asp Cys 85 90 95 Asn Trp Met Lys Glu Thr Pro Val His Gln Asp Phe Ile Val Tyr Gln 100 105 110 Lys His Gln Val Lys Tyr Asp Pro Tyr His Asn Gly Phe Tyr Asp Ala 115 120 125 Leu Phe Lys Lys Asp Phe Cys Gln Glu Lys Ile Cys Glu Thr Glu His 130 135 140 Asp Gln Thr Ile Trp Ile Thr Asn Gln Glu Leu Lys Gln Glu Cys Thr 145 150 155 160 Phe Asn Tyr Pro Val Lys Lys His Val Phe Tyr Lys Arg Asp Tyr Ser 165 170 175 Lys Met Ile Ile Asp Tyr Glu Ile Asn Gln Trp Thr Ser Val Glu Asp 180 185 190 Gly Cys Leu Ile Arg Tyr Cys Gly Gln Glu Gly Ile Arg Leu Ser Asn 195 200 205 Gly Met Phe Phe Val Gly Lys Phe Tyr Lys Leu Ile Ser Asn Leu Pro 210 215 220 Ile Cys Pro Glu Gly Thr Lys Ile Ser Tyr Lys Pro Ile Lys Ala Gln 225 230 235 240 Leu Asp Glu Ile Glu Asn Glu Ile Ile Leu Asn Gln Glu Arg Leu Leu 245 250 255 Cys Leu Asp Ser Ile Arg Gln Met Thr Ala Ser Lys Lys Leu Ser Phe 260 265 270 Tyr Ser Leu Ser Phe Leu Glu Pro Lys Ser Met Ser Arg His Lys Val 275 280 285 Tyr Arg Ile His Asn Asn Thr Leu Glu Tyr Thr Glu Thr Glu Trp Glu 290 295 300 Pro Ile Val Ala Phe Asn Phe Asn Gly Lys Asn Gln Ile Gly Val Asn 305 310 315 320 Lys Glu Gly Lys Glu Val Tyr Trp Asn Glu Trp Val Pro Ser Gly Lys 325 330 335 Asp Gly Leu Leu Ser Gly Phe Asn Gly Val Tyr Lys Lys Val Asn Ser 340 345 350 Ser Lys Ile Ser Ile Ser Arg Leu Glu Thr Ile Lys Glu Asp Tyr Glu 355 360 365 Arg Glu Met Met Ile Asp His Glu Leu Val Thr Val Glu His Pro Xaa 370 375 380 Ile Xaa His Leu Xaa Xaa Glu Asn Ile Thr Gly Ser Arg Val Glu Ile 385 390 395 400 Val Asn Thr Glu His Ser Asp Val Ser Gly Trp Phe Ser Ser Val Leu 405 410 415 Lys Ser Phe Trp Gly Lys Leu Met Met Thr Val Val Ser Ile Ile Ile 420 425 430 Ile Ile Ile Ile Gly Leu Leu Ile Ile Asn Cys Gly Pro Ile Ile Cys 435 440 445 Lys Thr Cys Ile Ser Ser Tyr Lys Lys Lys Lys Ser Arg Arg Asp Arg 450 455 460 Phe Arg Ala Asp Arg Glu Thr Glu Thr Gly Leu Arg Arg Gln His Arg 465 470 475 480 Val Val Phe His Asn Asn Glu Thr Asp Asp Glu Arg Ala Ile Glu Met 485 490 495 Thr Gly His His Phe Gly Lys His Val Arg Ser Glu Leu Arg Pro Arg 500 505 510 Arg His Pro Gly Ser Gly 515 222248DNAMuir Spring virusG-Protein 22gcggcggggg ctggccatca ctttggcaag cacgtgagat ctgattcgcg gccgcgtcga 60cgcccctgaa actcctgatc ctatcctcct ccaaggagat aaaacttatc tctttttagt 120cccttcagag agcaaaaatt ggaaacccgc agatcttaat gaagtatcct gtcctcctct 180tatatcaaaa ccagatactg ctgaaatgga atacatgtct actgatgtca tggaactcgc 240aaaaacatca tgaactcgcg cctgtgcaag ggtatttatg ttctggctta agatataaag 300ttatttgttc tgaaggattc tttggacaaa aaacaataac taagaaaatt gaaaatcttg 360aacctgatca gaacaaatgt gttcaagatt tagaaaagtt tattaatgac gattatttgc 420taccctattt cccatcagaa gattgtaatt ggatgaaaga aacaccagtt catcaagatt 480tcatagttta ccaaaaacat caggttaaat atgatccata ccacaatggc ttttacgatg 540ctctgttcaa gaaagatttt tgtcaagaga aaatatgtga gacagagcat gatcagacaa 600tatggataac taaccaagaa ttaaaacaag aatgcacttt taattatccg gttaaaaaac 660atgtattcta taagagagat tatagcaaaa tgatcatcga ttatgaaatc aaccaatgga 720cttcagttga ggatggatgt ttgataagat attgtggtca ggaaggaatt agattatcta 780atgggatgtt ctttgtagga aaattttaca aattaatatc gaatctgcca atttgtccag 840aaggaaccaa gatcagctac aagcccatta aagcacaatt agatgaaata gaaaatgaaa 900taattttaaa tcaagaaaga cttttatgtt tagattctat acgacaaatg actgcttcta 960aaaaattatc tttttattca ttatccttct tggagcctaa atccatgagt agacataagg 1020tctatagaat tcacaataat actttagaat acactgaaac tgaatgggaa cctatagtgg 1080cttttaattt taatggaaag aatcaaatcg gagtaaataa agaagggaag gaagtttatt 1140ggaatgaatg ggtgcccagt ggaaaagatg gattgctctc aggattcaat ggagtttata 1200agaaagttaa ttcttccaaa atttcaatat caagattaga aaccattaaa gaagattatg 1260aaagagaaat gatgatagat catgaattgg ttacagttga gcatcctama attgkccatc 1320ttaawasaga aaacatmaca ggttctagag tggagatagt taatactgaa cattcagacg 1380tcagtggttg gttctcatct gttttaaaga gtttttgggg aaagttgatg atgactgttg 1440tcagtataat aataattatc atcataggcc tattgattat caattgtggt ccaattatct 1500gtaaaacttg cattagcagc tataaaaaga aaaagagtag aagagataga tttagagcag 1560atagagaaac tgaaactgga ctgcgtcgac aacatagagt ggtatttcat aataatgaaa 1620cagatgatga aagagcaata gagatgactg gccatcactt tggcaagcac gtgagatctg 1680aattgcggcc gcgtcgacat cctggctcag gatgaacgct ggctgtgtgc ctaatacatg 1740catgtcgagc gaggttcttt tgaacctagc ggcgaatggg tgagtaacac gtgcttaatc 1800taccctttag attggaatac ccaatggaaa cattggctaa tgccggatac gcatggaatc 1860gcatgattcc gttgtgaaag gagcctttaa agctccgcta gaggatgagg gtgcggaaca 1920ttagttagtt ggtagggtaa tggcctacca agactatgat gtttagccgg gtcgagagac 1980tgaacggcca cattgggact gagatacggc ccaaactcct acgggaggca gcagtaggga 2040atattccaca atgagcgaaa gcttgatgga gcgacacagc gtgcacgatg aaggtcttcg 2100gattgtaaag tgctgttata gggaaagaac acctggttga ggaaatgctt ccaggctgac 2160ggtaccctgt cagaaagcga tggctaacta tgtgccagca gccgcggtaa tacataggtc 2220gcaagcgtta tccggaatta ttgggcgt 2248231948DNAVSVg protein 23acgcgttttc gccaccatgc cgaagcgccg cgctggattc cggaaaggct ggtacgcgcg 60gcagaggaac tccctgacgc atcaaatgca acgcatgacg ctgagcgagc ccacgagtga 120gctgcccacc cagaggcaaa ttgaagcgct aatgcgctac gcctggaatg aggcacatgt 180acaacctccg gtgacaccta ctaacatctt gatcatgtta ttattattgt tacagcgggt 240acaaaatggg gcagctgcgg ctttttgggc gtacattcct gatccgccaa tgattcaatc 300cttaggatgg gatagagaaa tagtacccgt atatgttaat gatacgagcc ttttaggagg 360aaaatcagat attcacattt cccctcagca agcaaatatc tctttttatg gccttaccac 420tcaatatccc atgtgctttt cttatcaatc gcagcatcct cattgtatac aggtatcagc 480tgacatatca tatcctcgag tgactatctc aggcattgat gaaaaaactg ggaaaaaatc 540atacgggaac ggatctggac ccctcgacat tccgttttgt gacaagcatt taagcattgg 600cataggcata gacactcctt ggactttatg tcgagcccgg gtcgcgtcag tatataacat 660caataatgcc aatgccacct ttttatggga ttgggcacct ggaggaacac ctgattttcc 720tgaatatcga ggacagcatc cgcctatttt ctctgtgaat accgctccaa tataccaaac 780ggaactatgg aaacttttgg ctgcttttgg tcatggcaat agtttatatt tacagcccaa 840tatcagtgga agcaaatatg gtgatgtagg agttacagga tttttatatc ctcgagcttg 900cgtgccgtat ccattcatgt tgatacaagg ccatatggaa ataacactgt cattaaatat 960ttatcatttg aattgttcta attgcatact gactaattgt atcaggggag tagccaaagg 1020agaacaggtt ataatagtaa aacagcctgc ctttgtaatg ctgcccgttg aaatagctga 1080agcctggtat gatgaaactg ctttagaatt attacaacgc attaatacgg ctcttagccg 1140ccctaagaga ggcctgagcc tgattattct gggtatagta tctttaatca ccctcatagc 1200tacagctgtt acggcttccg tatctttagc acagtctatt caagctgcgc acacggtaga 1260ctccttatca tataatgtta ctaaagtgat ggggacccaa gaagatattg ataaaaaaat 1320agaagatagg ctatcagctc tatatgatgt agtcagagtc ttaggagagc aagttcagag 1380cattaatttt cgcatgaaaa tccaatgtca tgctaactat aaatggattt gtgttacaaa 1440aaaaccatac aacacttctg attttccatg ggacaaagtg aagaaacatt tgcaaggaat 1500ttggttcaat actaatctat cgttagacct tttacaactg cataatgaga ttcttgatat 1560tgaaaattcg ccgaaggcta cactaaatat agccgatact gttgataatt tcttgcaaaa 1620tttattctct aatttcccta gtctccattc gctgtggaaa accctgattg gtgtaggaat 1680acttgtgttt attataattg tcgtaatcct tatatttcct tgcctcgtac gtagtagttg 1740gaagagctct attgcctctt ttttctttac catagggtta atcattggac tattcttggt 1800tctccgagtt ggtatttatc tttgcattaa attaaagcac accaagaaaa gacagattta 1860tacagacata gagatgaacc gacttggaac gtaactcaaa tcctcgaggc taggtatgaa 1920aaaaactaac agatatcacg gctagcgg 1948242031DNAEBOLAG PROTEIN 24atgggcgtta caggaatatt gcagttacct cgtgatcgat tcaagaggac atcattcttt 60ctttgggtaa ttatcctttt ccaaagaaca ttttccatcc cacttggagt catccacaat 120agcacattac aggttagtga tgtcgacaaa ctagtttgtc gtgacaaact gtcatccaca 180aatcaattga

gatcagttgg actgaatctc gaagggaatg gagtggcaac tgacgtgcca 240tctgcaacta aaagatgggg cttcaggtcc ggtgtcccac caaaggtggt caattatgaa 300gctggtgaat gggctgaaaa ctgctacaat cttgaaatca aaaaacctga cgggagtgag 360tgtctaccag cagcgccaga cgggattcgg ggcttccccc ggtgccggta tgtgcacaaa 420gtatcaggaa cgggaccgtg tgccggagac tttgccttcc ataaagaggg tgctttcttc 480ctgtatgatc gacttgcttc cacagttatc taccgaggaa cgactttcgc tgaaggtgtc 540gttgcatttc tgatactgcc ccaagctaag aaggacttct tcagctcaca ccccttgaga 600gagccggtca atgcaacgga ggacccgtct agtggctact attctaccac aattagatat 660caggctaccg gttttggaac caatgagaca gagtacttgt tcgaggttga caatttgacc 720tacgtccaac ttgaatcaag attcacacca cagtttctgc tccagctgaa tgagacaata 780tatacaagtg ggaaaaggag caataccacg ggaaaactaa tttggaaggt caaccccgaa 840attgatacaa caatcgggga gtgggccttc tgggaaacta aaaaaaacct cactagaaaa 900attcgcagtg aagagttgtc tttcacagtt gtatcaaacg gagccaaaaa catcagtggt 960cagagtccgg cgcgaacttc ttccgaccca gggaccaaca caacaactga agaccacaaa 1020atcatggctt cagaaaattc ctctgcaatg gttcaagtgc acagtcaagg aagggaagct 1080gcagtgtcgc atctaacaac ccttgccaca atctccacga gtccccaatc cctcacaacc 1140aaaccaggtc cggacaacag cacccataat acacccgtgt ataaacttga catctctgag 1200gcaactcaag ttgaacaaca tcaccgcaga acagacaacg acagcacagc ctccgacact 1260ccctctgcca cgaccgcagc cggaccccca aaagcagaga acaccaacac gagcaagagc 1320actgacttcc tggaccccgc caccacaaca agtccccaaa accacagcga gaccgctggc 1380aacaacaaca ctcatcacca agataccgga gaagagagtg ccagcagcgg gaagctaggc 1440ttaattacca atactattgc tggagtcgca ggactgatca caggcgggag aagaactcga 1500agagaagcaa ttgtcaatgc tcaacccaaa tgcaacccta atttacatta ctggactact 1560caggatgaag gtgctgcaat cggactggcc tggataccat atttcgggcc agcagccgag 1620ggaatttaca tagaggggct aatgcacaat caagatggtt taatctgtgg gttgagacag 1680ctggccaacg agacgactca agctcttcaa ctgttcctga gagccacaac tgagctacgc 1740accttttcaa tcctcaaccg taaggcaatt gatttcttgc tgcagcgatg gggcggcaca 1800tgccacattc tgggaccgga ctgctgtatc gaaccacatg attggaccaa gaacataaca 1860gacaaaattg atcagattat tcatgatttt gttgataaaa cccttccgga ccagggggac 1920aatgacaatt ggtggacagg atggagacaa tggataccgg caggtattgg agttacaggc 1980gttataattg cagttatcgc tttattctgt atatgcaaat ttgtctttta g 20312539DNAArtificialSynthetic primer 25ctcgagggta tgaaaaaaac taacagatat cacggctag 3926523PRTIsfahan virusG protein 26Met Thr Ser Val Leu Phe Met Val Gly Val Leu Leu Gly Ala Phe Gly 1 5 10 15 Ser Thr His Cys Ser Ile Gln Ile Val Phe Pro Ser Glu Thr Lys Leu 20 25 30 Val Trp Lys Pro Val Leu Lys Gly Thr Arg Tyr Cys Pro Gln Ser Ala 35 40 45 Glu Leu Asn Leu Glu Pro Asp Leu Lys Thr Met Ala Phe Asp Ser Lys 50 55 60 Val Pro Ile Gly Ile Thr Pro Ser Asn Ser Asp Gly Tyr Leu Cys His 65 70 75 80 Ala Ala Lys Trp Val Thr Thr Cys Asp Phe Arg Trp Tyr Gly Pro Lys 85 90 95 Tyr Ile Thr His Ser Val His Ser Leu Arg Pro Thr Val Ser Asp Cys 100 105 110 Lys Ala Ala Val Glu Ala Tyr Asn Ala Gly Thr Leu Met Tyr Pro Gly 115 120 125 Phe Pro Pro Glu Ser Cys Gly Tyr Ala Ser Ile Thr Asp Ser Glu Phe 130 135 140 Tyr Val Met Leu Val Thr Pro His Pro Val Gly Val Asp Asp Tyr Arg 145 150 155 160 Gly His Trp Val Asp Pro Leu Phe Pro Thr Ser Glu Cys Asn Ser Asn 165 170 175 Phe Cys Glu Thr Val His Asn Ala Thr Met Trp Ile Pro Lys Asp Leu 180 185 190 Lys Thr His Asp Val Cys Ser Gln Asp Phe Gln Thr Ile Arg Val Ser 195 200 205 Val Met Tyr Pro Gln Thr Lys Pro Thr Lys Gly Ala Asp Leu Thr Leu 210 215 220 Lys Ser Lys Phe His Ala His Met Lys Gly Asp Arg Val Cys Lys Met 225 230 235 240 Lys Phe Cys Asn Lys Asn Gly Leu Arg Leu Gly Asn Gly Glu Trp Ile 245 250 255 Glu Val Gly Asp Glu Val Met Leu Asp Asn Ser Lys Leu Leu Ser Leu 260 265 270 Phe Pro Asp Cys Leu Val Gly Ser Val Val Lys Ser Thr Leu Leu Ser 275 280 285 Glu Gly Val Gln Thr Ala Leu Trp Glu Thr Asp Arg Leu Leu Asp Tyr 290 295 300 Ser Leu Cys Gln Asn Thr Trp Glu Lys Ile Asp Arg Lys Glu Pro Leu 305 310 315 320 Ser Ala Val Asp Leu Ser Tyr Leu Ala Pro Arg Ser Pro Gly Lys Gly 325 330 335 Met Ala Tyr Ile Val Ala Asn Gly Ser Leu Met Ser Ala Pro Ala Arg 340 345 350 Tyr Ile Arg Val Trp Ile Asp Ser Pro Ile Leu Lys Glu Ile Lys Gly 355 360 365 Lys Lys Glu Ser Ala Ser Gly Ile Asp Thr Val Leu Trp Glu Gln Trp 370 375 380 Leu Pro Phe Asn Gly Met Glu Leu Gly Pro Asn Gly Leu Ile Lys Thr 385 390 395 400 Lys Ser Gly Tyr Lys Phe Pro Leu Tyr Leu Leu Gly Met Gly Ile Val 405 410 415 Asp Gln Asp Leu Gln Glu Leu Ser Ser Val Asn Pro Val Asp His Pro 420 425 430 His Val Pro Ile Ala Gln Ala Phe Val Ser Glu Gly Glu Glu Val Phe 435 440 445 Phe Gly Asp Thr Gly Val Ser Lys Asn Pro Ile Glu Leu Ile Ser Gly 450 455 460 Trp Phe Ser Asp Trp Lys Glu Thr Ala Ala Ala Leu Gly Phe Ala Ala 465 470 475 480 Ile Ser Val Ile Leu Ile Ile Gly Leu Met Arg Leu Leu Pro Leu Leu 485 490 495 Cys Arg Arg Arg Lys Gln Lys Lys Val Ile Tyr Lys Asp Val Glu Leu 500 505 510 Asn Ser Phe Asp Pro Arg Gln Ala Phe His Arg 515 520 27530PRTChandipuraG protein 27Met Thr Ser Ser Val Thr Ile Ser Val Val Leu Leu Ile Ser Phe Ile 1 5 10 15 Thr Pro Ser Tyr Ser Ser Leu Ser Ile Ala Phe Pro Glu Asn Thr Lys 20 25 30 Leu Asp Trp Lys Pro Val Thr Lys Asn Thr Arg Tyr Cys Pro Met Gly 35 40 45 Gly Glu Trp Phe Leu Glu Pro Gly Leu Gln Glu Glu Ser Phe Leu Ser 50 55 60 Ser Thr Pro Ile Gly Ala Thr Pro Ser Lys Ser Asp Gly Phe Leu Cys 65 70 75 80 His Ala Ala Lys Trp Val Thr Thr Cys Asp Phe Arg Trp Tyr Gly Pro 85 90 95 Lys Tyr Ile Thr His Ser Ile His Asn Ile Lys Pro Thr Arg Ser Asp 100 105 110 Cys Asp Thr Ala Leu Ala Ser Tyr Lys Ser Gly Thr Leu Val Ser Pro 115 120 125 Gly Phe Pro Pro Glu Ser Cys Gly Tyr Ala Ser Val Thr Asp Ser Glu 130 135 140 Phe Leu Val Ile Met Ile Thr Pro His His Val Gly Val Asp Asp Tyr 145 150 155 160 Arg Gly His Trp Val Asp Pro Leu Phe Val Gly Gly Glu Cys Asp Gln 165 170 175 Ser Tyr Cys Asp Thr Ile His Asn Ser Ser Val Trp Ile Pro Ala Asp 180 185 190 Gln Thr Lys Lys Asn Ile Cys Gly Gln Ser Phe Thr Pro Leu Thr Val 195 200 205 Thr Val Ala Tyr Val Lys Thr Lys Glu Ile Ala Ala Gly Ala Ile Val 210 215 220 Phe Lys Ser Lys Tyr His Ser His Met Glu Gly Ala Arg Thr Cys Arg 225 230 235 240 Leu Ser Tyr Cys Gly Arg Asn Gly Ile Lys Phe Pro Asn Gly Glu Trp 245 250 255 Val Ser Leu Asp Val Lys Thr Lys Ile Gln Glu Lys Pro Leu Leu Pro 260 265 270 Leu Phe Lys Glu Cys Pro Ala Gly Thr Glu Val Arg Ser Thr Leu Gln 275 280 285 Ser Asp Gly Ala Gln Val Leu Thr Ser Glu Ile Gln Arg Ile Leu Asp 290 295 300 Tyr Ser Leu Cys Gln Asn Thr Trp Asp Lys Val Glu Arg Lys Glu Pro 305 310 315 320 Leu Ser Pro Leu Asp Leu Ser Tyr Leu Ala Ser Lys Ser Pro Gly Lys 325 330 335 Gly Leu Ala Tyr Thr Val Ile Asn Gly Thr Leu Ser Phe Ala His Thr 340 345 350 Arg Tyr Val Arg Met Trp Ile Asp Gly Pro Val Leu Lys Glu Met Lys 355 360 365 Gly Lys Arg Glu Ser Pro Ser Gly Ile Ser Ser Asp Ile Trp Thr Gln 370 375 380 Trp Phe Lys Tyr Gly Asp Met Glu Ile Gly Pro Asn Gly Leu Leu Lys 385 390 395 400 Thr Ala Gly Gly Tyr Lys Phe Pro Trp His Leu Ile Gly Met Gly Ile 405 410 415 Val Asp Asn Glu Leu His Glu Leu Ser Glu Ala Asn Pro Leu Asp His 420 425 430 Pro Gln Leu Pro His Ala Gln Ser Ile Ala Asp Asp Ser Glu Glu Ile 435 440 445 Phe Phe Gly Asp Thr Gly Val Ser Lys Asn Pro Val Glu Leu Val Thr 450 455 460 Gly Trp Phe Thr Ser Trp Lys Glu Ser Leu Ala Ala Gly Val Val Leu 465 470 475 480 Ile Leu Val Val Val Leu Ile Tyr Gly Val Leu Arg Cys Phe Pro Val 485 490 495 Leu Cys Thr Thr Cys Arg Lys Pro Lys Trp Lys Lys Gly Val Glu Arg 500 505 510 Ser Asp Ser Phe Glu Met Arg Ile Phe Lys Pro Asn Asn Met Arg Ala 515 520 525 Arg Val 530 28611PRTJaagsietke sheep retrovirus virusG protein 28Met Pro Lys Arg Arg Ala Gly Phe Arg Lys Gly Trp Tyr Ala Arg Gln 1 5 10 15 Arg Asn Ser Leu Thr His Gln Met Gln Arg Met Thr Leu Ser Glu Pro 20 25 30 Thr Ser Glu Leu Pro Thr Gln Arg Gln Ile Glu Ala Leu Met Arg Tyr 35 40 45 Ala Trp Asn Glu Ala His Val Gln Pro Pro Val Thr Pro Thr Asn Ile 50 55 60 Leu Ile Met Leu Leu Leu Leu Leu Gln Arg Ile Gln Asn Gly Ala Ala 65 70 75 80 Ala Thr Phe Trp Ala Tyr Ile Pro Asp Pro Pro Met Leu Gln Ser Leu 85 90 95 Gly Trp Asp Lys Glu Thr Val Pro Val Tyr Val Asn Asp Thr Ser Leu 100 105 110 Leu Gly Gly Lys Ser Asp Ile His Ile Ser Pro Gln Gln Ala Asn Ile 115 120 125 Ser Phe Tyr Gly Leu Thr Thr Gln Tyr Pro Met Cys Phe Ser Tyr Gln 130 135 140 Ser Gln His Pro His Cys Ile Gln Val Ser Ala Asp Ile Ser Tyr Pro 145 150 155 160 Arg Val Thr Ile Ser Gly Ile Asp Glu Lys Thr Gly Met Arg Ser Tyr 165 170 175 Arg Asp Gly Thr Gly Pro Leu Asp Ile Pro Phe Cys Asp Lys His Leu 180 185 190 Ser Ile Gly Ile Gly Ile Asp Thr Pro Trp Thr Leu Cys Arg Ala Arg 195 200 205 Ile Ala Ser Val Tyr Asn Ile Asn Asn Ala Asn Thr Thr Leu Leu Trp 210 215 220 Asp Trp Ala Pro Gly Gly Thr Pro Asp Phe Pro Glu Tyr Arg Gly Gln 225 230 235 240 His Pro Pro Ile Ser Ser Val Asn Thr Ala Pro Ile Tyr Gln Thr Glu 245 250 255 Leu Trp Lys Leu Leu Ala Ala Phe Gly His Gly Asn Ser Leu Tyr Leu 260 265 270 Gln Pro Asn Ile Ser Gly Ser Lys Tyr Gly Asp Val Gly Val Thr Gly 275 280 285 Phe Leu Tyr Pro Arg Ala Cys Val Pro Tyr Pro Phe Met Val Ile Gln 290 295 300 Gly His Met Glu Ile Thr Pro Ser Leu Asn Ile Tyr Tyr Leu Asn Cys 305 310 315 320 Ser Asn Cys Ile Leu Thr Asn Cys Ile Arg Gly Val Ala Lys Gly Glu 325 330 335 Gln Val Ile Ile Val Lys Gln Pro Ala Phe Val Met Leu Pro Val Glu 340 345 350 Ile Thr Glu Glu Trp Tyr Asp Glu Thr Ala Leu Glu Leu Leu Gln Arg 355 360 365 Ile Asn Thr Ala Leu Ser Arg Pro Lys Arg Gly Leu Ser Leu Ile Ile 370 375 380 Leu Gly Ile Val Ser Leu Ile Thr Leu Ile Ala Thr Ala Val Thr Ala 385 390 395 400 Ser Val Ser Leu Ala Gln Ser Ile Gln Val Ala His Thr Val Asp Ser 405 410 415 Leu Ser Ser Asn Val Thr Lys Val Met Gly Thr Gln Glu Asn Ile Asp 420 425 430 Lys Lys Ile Glu Asp Arg Leu Pro Ala Leu Tyr Asp Val Val Arg Val 435 440 445 Leu Gly Glu Gln Val Gln Ser Ile Asn Phe Arg Met Lys Ile Gln Cys 450 455 460 His Ala Asn Tyr Lys Trp Ile Cys Val Thr Lys Lys Pro Tyr Asn Thr 465 470 475 480 Ser Asp Phe Pro Trp Asp Lys Val Lys Lys His Leu Gln Gly Ile Trp 485 490 495 Phe Asn Thr Thr Val Ser Leu Asp Leu Leu Gln Leu His Asn Glu Ile 500 505 510 Leu Asp Ile Glu Asn Ser Pro Lys Ala Thr Leu Asn Ile Ala Asp Thr 515 520 525 Val Asp Asn Phe Leu Gln Asn Leu Phe Ser Asn Phe Pro Ser Leu His 530 535 540 Ser Leu Trp Arg Ser Ile Ile Ala Met Gly Ala Val Leu Thr Phe Val 545 550 555 560 Leu Ile Ile Ile Cys Leu Ala Pro Cys Leu Ile Arg Ser Ile Val Lys 565 570 575 Glu Phe Leu His Met Arg Val Leu Ile His Lys Asn Met Leu Gln His 580 585 590 Gln His Leu Met Glu Leu Leu Asn Asn Lys Glu Arg Gly Ala Ala Gly 595 600 605 Asp Asp Pro 610

Claims

1. A pharmaceutical composition comprising a pharmaceutically acceptable carrier and an oncolytic Farmington rhabdovirus.

2. The pharmaceutical composition of claim 1, wherein said composition comprises 10.sup.3 to 10.sup.13 plaque forming units (pfu) of Farmington rhabdovirus.

3. A method for treating cancer in a subject comprising administering to the subject an effective amount of the pharmaceutical composition of claim 1.

4. The method of claim 3, wherein the cancer is selected from the group consisting of lung cancer, head and neck cancer, breast cancer, cancer of the central nervous system, pancreatic cancer, prostate cancer, renal cancer, bone cancer, testicular cancer, cervical cancer, ovarian cancer, gastrointestinal cancer, lymphoma, lung cancer, colon cancer, melanoma, and bladder cancer

5. The method of claim 4, wherein the cancer is selected from the group consisting of breast, central nervous system, melanoma, lung, ovarian, pancreatic, colon, prostate and renal cancer.

6. The method of claim 3, wherein the cancer is metastatic.

7. The method of claim 3, wherein the subject is a human.

8. The method of claim 3, wherein the composition is administered by intraperitoneal, intravascular, intramuscular, intratumoral, subcutaneous or intranasal administration.

9. The method of claim 8, wherein the composition is administered by intratumoral or intravascular administration.

10. The method of claim 3, wherein the composition is administered multiple times.

11. The method of claim 3, further comprising administering an additional anti-cancer therapy.

12. The method of claim 11, wherein the additional anti-cancer therapy is chemotherapeutic, radiotherapeutic or immunotherapeutic.

13. The method of claim 11, wherein the additional anti-cancer therapy comprises administering to the subject a second oncolytic virus.

14. The method of claim 13, wherein the second oncolytic virus is a poxvirus, herpes virus, measles virus, paramyxovirus, adenovirus, alphavirus, parvovirus or rhabdovirus.

15. The method of claim 14, wherein the second oncolytic virus is a vaccinia virus.

16. A method for treating cancer in a subject comprising administering to the subject an effective amount of an oncolytic Faimington rhabdovirus.

17. The method of claim 16, wherein the subject is administered between 10.sup.3 and 10.sup.13 plaque forming units (pfu) of Farmington rhabdovirus.

18. The method of claim 16, wherein the cancer is selected from the group consisting of lung cancer, head and neck cancer, breast cancer, cancer of the central nervous system, pancreatic cancer, prostate cancer, renal cancer, bone cancer, testicular cancer, cervical cancer, ovarian cancer, gastrointestinal cancer, lymphoma, lung cancer, colon cancer, melanoma, and bladder cancer

19. The method of claim 18, wherein the cancer is selected from the group consisting of breast, central nervous system, melanoma, lung, ovarian, pancreatic, colon, prostate and renal cancer.

20. The method of claim 16, wherein the subject is a human.

Images