Patents - stay tuned to the technology

Inventors list

Assignees list

Classification tree browser

Top 100 Inventors

Top 100 Assignees

Patent application title: CHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT

Inventors:  Paul Harden (Brentwood, CA, US)  Terry Hermiston (Corte Madera, CA, US)  Terry Hermiston (Corte Madera, CA, US)  Irene Kuhn (Richmond, CA, US)
Assignees:  PSIOXUS THERAPEUTICS LIMITED
IPC8 Class: AC12N701FI
USPC Class: 4352351
Class name: Chemistry: molecular biology and microbiology virus or bacteriophage, except for viral vector or bacteriophage vector; composition thereof; preparation or purification thereof; production of viral subunits; media for propagating
Publication date: 2013-09-05
Patent application number: 20130230902



Abstract:

The present invention relates to oncolytic adenoviruses having therapeutic applications. Recombinant chimeric adenoviruses, and methods to produce them are provided. The chimeric adenoviruses of the invention comprise nucleic acid sequences derived from adenoviral serotypes classified within the subgroups B through F and demonstrate an enhanced therapeutic index.

Claims:

1. A chimeric adenovirus having a genome comprising an E2B region, wherein: said E2B region comprises a nucleic acid sequence derived from a first adenoviral serotype and a nucleic acid sequence derived from a second adenoviral serotype; said first and second serotypes are each selected from the adenoviral subgroups B, C, D, E, or F and are distinct from each other; and said chimeric adenovirus is oncolytic and demonstrates an enhanced therapeutic index for a tumor cell.

2. The chimeric adenovirus of claim 1 wherein the first adenoviral serotype is selected from subgroup B.

3. The chimeric adenovirus of claim 1 wherein the first and second adenoviral serotypes are selected from subgroup B.

4. The chimeric adenovirus of claim 2 wherein one of the adenoviral serotypes is Ad11.

5. The chimeric adenovirus of claim 3 wherein the first adenoviral serotype is Ad11 and the second adenoviral serotype is Ad3.

6. The chimeric adenovirus of claim 1 having regions encoding a fibre, hexon and penton proteins wherein the nucleic acids encoding fibre, hexon and penton proteins are all from the same adenovirus serotype.

7. The chimeric adenovirus of claim 6 wherein the nucleic acids encoding fibre, hexon and penton proteins are all from Ad11.

8. A chimeric adenovirus having a genome comprising an E2B region, and regions encoding a fibre, hexon and penton proteins, wherein: said E2B region comprises a nucleic sequence derived from a first adenoviral serotype and a second adenovirus serotype each independently selected from subgroup B and which are distinct from each other, and the nucleic acids encoding fibre, hexon and penton proteins are all from the same adenovirus serotype, namely Ad11, and said chimeric adenovirus or variant or derivative thereof is oncolytic and demonstrates an enhanced index for a tumor cell.

Description:

[0001] This application is a division of Ser. No. 12/413,748 filed Mar. 30, 2009, which claims the benefit of Ser. No. 11/136,912 filed May 24, 2005, now U.S. Pat. No. 7,510,868, issued Mar. 31, 2009, which claims the benefit of Ser. No. 60/574,851, filed on May 26, 2004. Each of these applications is incorporated herein by reference in its entirety.

[0002] This application incorporates by reference a 101 kb text file created on Apr. 4, 2011 and named "007836--00020sequencelisting.txt," which is the sequence listing for this application.

FIELD OF THE INVENTION

[0003] The invention described herein relates generally to the field of molecular biology, and more specifically to oncolytic adenoviruses having therapeutic applications.

BACKGROUND OF THE INVENTION

[0004] Cancer is a leading cause of death in the United States and elsewhere. Depending on the type of cancer, it is typically treated with surgery, chemotherapy, and/or radiation. These treatments often fail, and it is clear that new therapies are necessary, to be used alone or in combination with classical techniques.

[0005] One approach has been the use of adenoviruses, either alone or as vectors able to deliver anticancer therapeutic proteins to tumor cells. Adenoviruses are non-enveloped icosahedral double-stranded DNA viruses with a linear genome of approximately 36 kilobase pairs. Each end of the viral genome has a short sequence known as the inverted terminal repeat (or ITR), which is required for viral replication. All human adenovirus genomes examined to date have the same general organization; that is, the genes encoding specific functions are located at the same position on the viral genome. The viral genome contains five early transcription units (E1A, E1B, E2, E3, and E4), two delayed early units (IX and Iva2), and one late unit (major late) that is processed to generate five families of late mRNAs (L1-L5). Proteins encoded by the early genes are involved in replication, whereas the late genes encode viral structural proteins. Portions of the viral genome can be readily substituted with DNA of foreign origin and recombinant adenoviruses are structurally stable, properties that make these viruses potentially useful for gene therapy (see Jolly, D. (1994) Cancer Gene Therapy 1:51-64).

[0006] Currently, the research efforts to produce clinically useful adenoviral therapy have focused on the adenoviral serotype, Ad5. The genetics of this human adenovirus are well-characterized and systems are well described for its molecular manipulation. High capacity production methods have been developed to support clinical applications, and some clinical experience with the agent is available. See, Jolly, D. (1994) Cancer Gene Therapy 1:51-64. Research related to the use of human adenoviruses (Ad) in cancer 35 treatment has focused on the development of Ad5-based adenoviruses that have a higher potency in, or are preferentially targeted to, specific tumor cell types and there exists a need for generation of more potent oncolytic viruses if adenoviral therapy is to find practical application in a clinical setting.

[0007] Ad5 is only one of 51 currently known adenoviral serotypes, which are classified into subgroups A-F, based on various attributes including their hemagglutination properties ((see, Shenk, "Adenoviridae: The Viruses and Their Replication," in Fields Virology, Vol. 2, Fourth Edition, Knipe, ea., Lippincott, Williams & Wilkins, pp. 2265-2267 (2001)). These serotypes differ at a variety of levels, e.g. pathology in humans and rodents, cell receptors used for attachment, but these differences have been largely ignored as potential means to develop more potent oncolytic adenoviruses (with the exception of fiber alterations, see Stevenson et al. (1997) J. Virol. 71:4782-4790; Krasnykh et al. (1996) J. Virol. 70:6839-6846; Wickham et al. (1997) J. Virol. 71:8221-8229; Legrand et al. (2002) Curr. Gene Ther. 2:323-329; Barnett et al. (2002) Biochim. Biophys. Acta 1-3:1-14; US Patent Application 2003/0017138).

[0008] Exploitation of differences among adenoviral serotypes may provide a source of more effective adenoviral-based therapeutics, using novel adenoviruses with increased selectivity and potency. There is a need for such improved adenoviral-based therapies.

SUMMARY OF THE INVENTION

[0009] The present invention provides novel chimeric adenoviruses, or variants or derivatives thereof, useful for viral-based therapy. In particular, the invention provides for chimeric adenoviruses, or variants or derivatives thereof, having a genome comprising an E2B region

[0010] wherein said E2B region comprises a nucleic acid sequence derived from a first adenoviral serotype and a nucleic acid sequence derived from a second adenoviral serotype;

[0011] wherein said first and second adenoviral serotypes are each selected from the adenoviral subgroups B, C, D, E, or F and are distinct from each other; and

[0012] wherein said chimeric adenovirus is oncolytic and demonstrates an enhanced therapeutic index for a tumor cell.

[0013] In one embodiment, the chimeric adenovirus further comprises regions encoding fiber, hexon, and penton proteins, wherein the nucleic acids encoding said proteins are all from the same adenoviral serotype. In another embodiment, the chimeric adenovirus of the invention comprises a modified E3 or E4 region.

[0014] In another embodiment, the chimeric adenovirus demonstrates an enhanced therapeutic index in a colon, breast, pancreas, lung, prostate, ovarian or hemopoietic tumor cell. In a particularly preferred embodiment, the chimeric adenovirus displays an enhanced therapeutic index in colon tumor cells.

[0015] In a preferred embodiment, the E2B region of the chimeric adenovirus comprises SEQ ID NO: 3. In a particularly preferred embodiment, the chimeric adenovirus comprises SEQ ID NO: 1.

[0016] The present invention provides for a recombinant chimeric adenovirus, or a variant or derivative thereof, having a genome comprising an E2B region

[0017] wherein said E2B region comprises a nucleic acid sequences derived from a first adenoviral serotype and a nucleic acid second derived from a second adenoviral serotype;

[0018] wherein said first and second adenoviral serotypes are each selected from the adenoviral subgroups B, C, D, E, or F and are distinct from each other;

[0019] wherein said chimeric adenovirus is oncolytic and demonstrates an enhanced therapeutic index for a tumor cell; and

[0020] wherein said chimeric adenovirus has been rendered replication deficient through deletion of one or more adenoviral regions encoding proteins involved in adenoviral replication selected from the group consisting of E1, E2, E3 or E4.

[0021] In one embodiment, the chimeric adenovirus of the invention further comprises a heterologous gene that encodes a therapeutic protein, wherein said heterologous gene is expressed within a cell infected with said adenovirus. In a preferred embodiment, the therapeutic protein is selected from the group consisting of cytokines and chemokines, antibodies, pro-drug converting enzymes, and immunoregulatory proteins.

[0022] The present invention provides methods for using the chimeric adenoviruses of the invention for therapeutic purposes. In one embodiment, the chimeric adenoviruses can be used to inhibit the growth of cancer cells. In a particular embodiment, a chimeric adenovirus comprising SEQ ID NO: 1 is useful for inhibiting the growth of colon cancer cells.

[0023] In another embodiment, the adenoviruses of the invention are useful as vectors to deliver therapeutic proteins to cells.

[0024] The present invention provides a method for production of the chimeric adenoviruses of the invention, wherein the method comprises

[0025] a) pooling of adenoviral serotypes representing adenoviral subgroups B-F, thereby creating an adenoviral mixture;

[0026] b) passaging the pooled adenoviral mixture from step (a) on an actively growing culture of tumor cells at a particle per cell ratio high enough to encourage recombination between serotypes, but not so high as to produce premature cell death;

[0027] c) harvesting the supernatant from step (b);

[0028] d) infecting a quiescent culture of tumor cells with the supernatant harvested in step (c);

[0029] e) harvesting the cell culture supernatant from step (d) prior to any sign of CPE;

[0030] f) infecting a quiescent culture of tumor cells with the supernatant harvested in step (e); and

[0031] g) isolating the chimeric adenovirus from the supernatant harvested in step (f) by plaque purification.

BRIEF DESCRIPTION OF THE FIGURES

[0032] FIG. 1. Ad retention time profiles on a TMAE HPLC column. A) Retention profiles for the individual Ad serotypes that were used to generate the original starting viral pool. B) Retention profiles of the passage 20 pools derived from HT-29, Panc-1, MDA-231, and PC-3 cell lines, respectively.

[0033] FIG. 2. Cytolytic activity of the individual virus pools. A) HT-29, B) MDA-231, C) Panc-1 and D) PC-3 cells were infected with their respective viral pools at VP per cell ratios from 100 to 0.01. MTS assays were performed on differing days post infection (as indicated) dependent upon the cell line. Each data point in the panel represents an assay done in quadruplicate and the results are expressed as the means+/-SD. The panel depicts one representative experiment and all viral pools were assayed at least three independent times on the target tumor cell line (Figure Legend: Ad5; initial viral pool; specific cell derived pool, passage 20).

[0034] FIG. 3. Cytolytic activity of ColoAd1 and Ad5 on human tumor cell lines. An MTS assay was performed on A) a broad panel of human tumor cell lines and B) on a panel of human colon cancer cell lines to determine its potential potency specificity. The MTS assay was performed on differing days dependent upon the cell line. Each panel is a representative experiment that has been repeated at least three times. Each data point in the panel represents an assay done in quadruplicate and the results are expressed as the means+/-SD (Figure Legend: Ad5; ColoAd1).

[0035] FIG. 4. Cytolytic activity of ColoAd1 and Ad5 on a panel of normal cells. HS-27, HUVEC and SAEC cells (primary fibroblast, endothelial, and epithelial cells, respectively) were infected with ColoAd1 and Ad5 at VP per cell ratios from 100 to 0.01. MTS assay was performed on differing days post infection dependent upon the cell and each panel is a representative experiment that has been repeated at least three times. Each data point in the panel represents an assay done in quadruplicate and the results are expressed as the means+/-SD (Figure Legend: Ad5; ColoAd1).

[0036] FIG. 5. Cytolytic activity of ColoAd1, Ad5 and ONYX-015 on primary normal endothelial cells (HUVEC) and a colon tumor cell line (HT-29). Each panel is a representative experiment that has been repeated at least three times. Each data point in the panel represents an assay done in quadruplicate and the results are expressed as the means+/-SD (Figure Legend: Ad5; ColoAd1; Onyx-015).

[0037] FIG. 6. Cytolytic activity of ColoAd1, Ad11p and Ad5 on a normal epithelial cell line (SAEC) and a human colon cancer cell line (HT-29). Each panel is a representative experiment that has been repeated at least three times. Each data point in the panel represents an assay done in quadruplicate and the results are expressed as the means+/-SD (Figure Legend: Ad5; Ad11p; ColoAd1).

[0038] FIG. 7. Cytolytic activity of Recombinant Viruses. Recombinant viruses representing four viral populations (Adp11, ColoAd1, left end Ad11p/right end ColoAd1(ColoAd1.1) and left end ColoAd1/right end Ad11p (ColoAd1.2)) were constructed as described in Example 6. Cytolytic activity of each population in HT29 cells was determined as previously described. (Figure Legend: Ad5; Ad11p; ColoAd1; -υ- ColoAd1.1; -.tangle-solidup.- ColoAd1.2).

DETAILED DESCRIPTION OF THE INVENTION

[0039] All publications, including patents and patent applications, mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication was specifically and individually indicated to be incorporated by reference in its entirety.

DEFINITIONS

[0040] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Generally, the nomenclature used herein and the laboratory procedures described below are those well known and commonly employed in the art.

[0041] As used herein, the term "adenovirus", "serotype" or "adenoviral serotype" refers to any of the 51 human adenoviral serotypes currently known, or isolated in the future. See, for example, Strauss, "Adenovirus infections in humans," in The Adenoviruses, Ginsberg, ea., Plenum Press, New York, N.Y., pp. 451-596 (1984). These serotypes are classified in the subgroups A-F (see, Shenk, "Adenoviridae: The Viruses and Their Replication," in Fields Virology, Vol. 2, Fourth Edition, Knipe, ea., Lippincott Williams & Wilkins, pp. 2265-2267 (2001), as shown in Table 1.

TABLE-US-00001 TABLE 1 SubGroup Adenoviral Serotype A 12, 18, 31 B 3, 7, 11, 14, 16, 21, 34, 35, 51 C 1, 2, 5, 6 D 8-10, 13, 15, 17, 19, 20, 22-30, 32, 33, 36-39, 42-49, 50 E 4 F 40, 41

[0042] As used herein, "chimeric adenovirus" refers to an adenovirus whose nucleic acid sequence is comprised of the nucleic acid sequences of at least two of the adenoviral serotypes described above.

[0043] As used herein, "parent adenoviral serotype" refers to the adenoviral serotype which represents the serotype from which the majority of the genome of the chimeric adenovirus is derived.

[0044] As used herein, the term "homologous recombination" refers to two nucleic acid molecules, each having homologous sequences, where the two nucleic acid molecules cross over or undergo recombination in the region of homology.

[0045] As used herein, the term "potency" refers to the lytic potential of a virus and represents its ability to replicate, lyse, and spread. For the purposes of the instant invention, potency is a value which compares the cytolytic activity of a given adenovirus of the invention to that of Ad5 in the same cell line, i.e. potency=IC50 of AdX/IC50 of Ad5, where X is the particular adenoviral serotype being examined and wherein the potency of Ad5 is given a value of 1.

[0046] As used herein, the term "oncolytic virus" refers to a virus that preferentially kills cancer cells as compared with normal cells.

[0047] As used herein, the term "therapeutic index" or "therapeutic window" refers to a number indicating the oncolytic potential of a given adenovirus and is determined by dividing the potency of the adenovirus in a cancer cell line by the potency of the same adenovirus in a normal (i.e. non-cancerous) cell line.

[0048] As used herein, the term "modified" refers to a molecule with a nucleotide or amino acid sequence differing from a naturally-occurring, e.g. a wild-type nucleotide or amino acid sequence. A modified molecule can retain the function or activity of a wild-type molecule, i.e. a modified adenovirus may retain its oncolytic activity. Modifications include mutations to nucleic acids as described below.

[0049] As used herein, "mutation" with reference to a polynucleotide or polypeptide, refers to a naturally-occurring, synthetic, recombinant, or chemical change or difference to the primary, secondary, or tertiary structure of a polynucleotide or polypeptide, as compared to a reference polynucleotide or polypeptide, respectively (e.g., as compared to a wild-type polynucleotide or polypeptide). Mutations include such changes as, for example, deletions, insertions, or substitutions. Polynucleotides and polypeptides having such mutations can be isolated or generated using methods well known in the art.

[0050] As used herein, "deletion" is defined as a change in either polynucleotide or amino acid sequences in which one or more polynucleotides or amino acid residues, respectively, are absent.

[0051] As used herein, "insertion" or "addition" is that change in a polynucleotide or amino acid sequence which has resulted in the addition of one or more polynucleotides or amino acid residues, respectively, as compared to the naturally occurring polynucleotide or amino acid sequence.

[0052] As used herein, "substitution" results from the replacement of one or more polynucleotides or amino acids by different polynucleotides or amino acids, respectively.

[0053] As used herein, the term "adenoviral derivative" refers to an adenovirus of the invention that has been modified such that an addition, deletion or substitution has been made to or in the viral genome, such that the resulting adenoviral derivative exhibits a potency and/or therapeutic index greater than that of the parent adenovirus, or in some other way is more therapeutically useful (i.e., less immunogenic, improved clearance profile). For example, a derivative of an adenovirus of the invention may have a deletion in one of the early genes of the viral genome, including, but not limited to, the E1A or E2B region of the viral genome.

[0054] As used herein, "variant" with reference to a polynucleotide or polypeptide, refers to a polynucleotide or polypeptide that may vary in primary, secondary, or tertiary structure, as compared to a reference polynucleotide or polypeptide, respectively (e.g., as compared to a wild-type polynucleotide or polypeptide). For example, the amino acid or nucleic acid sequence may contain a mutation or modification that differs from a reference amino acid or nucleic acid sequence. In some embodiments, an adenoviral variant may be a different Isoform or polymorphism. Variants can be naturally-occurring, synthetic, recombinant, or chemically modified polynucleotides or polypeptides isolated or generated using methods well known in the art. Changes in the polynucleotide sequence of the variant may be silent. That is, they may not alter the amino acids encoded by the polynucleotide. Where alterations are limited to silent changes of this type, a variant will encode a polypeptide with the same amino acid sequence as the reference. Alternatively, such changes in the polynucleotide sequence of the variant may alter the amino acid sequence of a polypeptide encoded by the reference polynucleotide, resulting in conservative or non-conservative amino acid changes, as described below. Such polynucleotide changes may result in amino acid substitutions, additions, deletions, fusions and truncations in the polypeptide encoded by the reference sequence. Various codon substitutions, such as the silent changes that produce various restriction sites, may be introduced to optimize cloning into a plasmid or viral vector or expression in a particular prokaryotic or eukaryotic system.

[0055] As used herein, an "adenoviral variant" refers to an adenovirus whose polynucleotide sequence differs from a reference polynucleotide, e.g. a wild-type adenovirus, as described above. The differences are limited so that the polynucleotide sequences of the parent and the variant are similar overall and, in most regions, identical. As used herein, a first nucleotide or amino acid sequence is said to be "similar" to a second sequence when a comparison of the two sequences shows that they have few sequence differences (i.e., the first and second sequences are nearly identical). As used herein, the polynucleotide sequence differences present between the adenoviral variant and the reference adenovirus do not result in a difference in the potency and/or therapeutic index.

[0056] As used herein, the term "conservative" refers to substitution of an amino acid residue for a different amino acid residue that has similar chemical properties. Conservative amino acid substitutions include replacement of a leucine with an isoleucine or valine, an aspartate with a glutamate, or a threonine with a serine. Insertions or deletions are typically in the range of about 1 to 5 amino acids.

[0057] As used herein, the term "nonconservative" refers to substituting an amino acid residue for a different amino acid residue that has different chemical properties. The nonconservative substitutions include, but are not limited to aspartic acid (D) being replaced with glycine (G); asparagine (N) being replaced with lysine (K); or alanine (A) being replaced with arginine (R).

[0058] The single-letter codes for amino acid residues include the following: A=alanine, R=arginine, N=asparagine, D=aspartic acid, C=cysteine, Q=Glutamine, E=Glutamic acid, G=glycine, H=histidine, I=isoleucine, L=leucine, K=lysine, M=methionine, F=phenylalanine, P=proline, S=serine, T=threonine, W=tryptophan, Y=tyrosine, V=valine.

[0059] It will be appreciated that polypeptides often contain amino acids other than the 20 amino acids commonly referred to as the 20 naturally occurring amino acids, and that many amino acids, including the terminal amino acids, may be modified in a given polypeptide, either by natural processes such as glycosylation and other post-translational modifications, or by chemical modification techniques which are well known in the art. Even the common modifications that occur naturally in polypeptides are too numerous to list exhaustively here, but they are well described in basic texts and in more detailed monographs, as well as in a voluminous research literature, and they are well known to those of skill in the art. Among the known modifications which may be present in polypeptides of the present invention are, to name an illustrative few, acetylation, acylation, ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a polynucleotide or polynucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphotidylinositol, cross-linking, cyclization, disulfide bond formation, demethylation, formation of covalent cross-links, formation of cystine, formation of pyroglutamate, formylation, gamma-carboxylation, glycation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, transfer-RNA mediated addition of amino acids to proteins such as arginylation, and ubiquitination.

[0060] Such modifications are well known to those of skill and have been described in great detail in the scientific literature. Several particularly common modifications, glycosylation, lipid attachment, sulfation, gamma-carboxylation of glutamic acid residues, hydroxylation and ADP-ribosylation, for instance, are described in most basic texts, such as, for instance, I. E. Creighton, Proteins-Structure and Molecular Properties, 2nd Ed., W.H. Freeman and Company, New York, 1993. Many detailed reviews are available on this subject, such as, for example, those provided by Wold, F., in Posttranslational Covalent Modification of Proteins, B. C. Johnson, Ed., Academic Press, New York, pp 1-12, 1983; Seifter et al., Meth. Enzymol. 182: 626-646, 1990 and Rattan et al., Protein Synthesis: Posttranslational Modifications and Aging, Ann. N.Y. Acad. Sci. 663: 48-62, 1992.

[0061] It will be appreciated, as is well known and as noted above, that polypeptides are not always entirely linear. For instance, polypeptides may be branched as a result of ubiquitination, and they may be circular, with or without branching, generally as a result of posttranslational events, including natural processing events and events brought about by human manipulation which do not occur naturally. Circular, branched and branched circular polypeptides may be synthesized by non-translational natural processes and by entirely synthetic methods, as well.

[0062] Modifications can occur anywhere in a polypeptide, including the peptide backbone, the amino acid side-chains and the amino or carboxyl termini. In fact, blockage of the amino or carboxyl group in a polypeptide, or both, by a covalent modification, is common in naturally occurring and synthetic polypeptides and such modifications may be present in polypeptides of the present invention, as well. For instance, the amino terminal residue of polypeptides made in E. coli, prior to proteolytic processing, almost invariably will be N-formylmethionine.

[0063] The modifications that occur in a polypeptide often will be a function of how it is made. For polypeptides made by expressing a cloned gene in a host, for instance, the nature and extent of the modifications in large part will be determined by the host cell posttranslational modification capacity and the modification signals present in the polypeptide amino acid sequence. For instance, as is well known, glycosylation often does not occur in bacterial hosts such as E. coli. Accordingly, when glycosylation is desired, a polypeptide should be expressed in a glycosylating host, generally a eukaryotic cell. Insect cells often carry out the same posttranslational glycosylations as mammalian cells and, for this reason, insect cell expression systems have been developed to efficiently express mammalian proteins having native patterns of glycosylation, inter alia. Similar considerations apply to other modifications.

[0064] It will be appreciated that the same type of modification may be present to the same or varying degree at several sites in a given polypeptide. Also, a given polypeptide may contain many types of modifications.

[0065] As used herein, the following terms are used to describe the sequence relationships between two or more polynucleotide or amino acid sequences: "reference sequence", "comparison window", "sequence identity", "percentage of sequence identity", "substantial identity", "similarity", and "homologous". A "reference sequence" is a defined sequence used as a basis for a sequence comparison; a reference sequence may be a subset of a larger sequence, for example, as a segment of a full-length cDNA or gene sequence given in a sequence listing or may comprise a complete cDNA or gene sequence. Generally, a reference sequence is at least 18 nucleotides or 6 amino acids in length, frequently at least 24 nucleotides or 8 amino acids in length, and often at least 48 nucleotides or 16 amino acids in length. Since two polynucleotides or amino acid sequences may each (1) comprise a sequence (i.e., a portion of the complete polynucleotide or amino acid sequence) that is similar between the two molecules, and (2) may further comprise a sequence that is divergent between the two polynucleotides or amino acid sequences, sequence comparisons between two (or more) molecules are typically performed by comparing sequences of the two molecules over a "comparison window" to identify and compare local regions of sequence similarity. A "comparison window", as used herein, refers to a conceptual segment of at least 18 contiguous nucleotide positions or 6 amino acids wherein a polynucleotide sequence or amino acid sequence may be compared to a reference sequence of at least 18 contiguous nucleotides or 6 amino acid sequences and wherein the portion of the polynucleotide sequence in the comparison window may comprise additions, deletions, substitutions, and the like (i.e., gaps) of 20 percent or less as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. Optimal alignment of sequences for aligning a comparison window may be conducted, for example, by the local homology algorithm of Smith and Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman and Wunsch, J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson and Lipman, Proc. Natl. Acad. (U.S.A.) 85:2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package Release 7.0, (Genetics Computer Group, 575 Science Dr., Madison, Wis.), VectorNTI from Informatix, Geneworks, or MacVector software packages), or by inspection, and the best alignment (i.e., resulting in the highest percentage of homology over the comparison window) generated by the various methods is selected.

[0066] As used herein, the term "sequence identity" means that two polynucleotide or amino acid sequences are identical (i.e., on a nucleotide-by-nucleotide or residue-by-residue basis) over the comparison window. The term "percentage of sequence identity" is calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base (e.g., A, T, C, G, U, or I) or residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the comparison window (i.e., the window size), and multiplying the result by 100 to yield the percentage of sequence identity. The terms "substantial identity" as used herein denotes a characteristic of a polynucleotide or amino acid sequence, wherein the polynucleotide or amino acid comprises a sequence that has at least 85 percent sequence identity, preferably at least 90 to 95 percent sequence identity, more usually at least 99 percent sequence identity as compared to a reference sequence over a comparison window of at least 18 nucleotide (6 amino acid) positions, frequently over a window of at least 24-48 nucleotide (8-16 amino acid) positions, wherein the percentage of sequence identity is calculated by comparing the reference sequence to the sequence which may include deletions or additions which total 20 percent or less of the reference sequence over the comparison window. The reference sequence may be a subset of a larger sequence. The term "similarity", when used to describe a polypeptide, is determined by comparing the amino acid sequence and the conserved amino acid substitutes of one polypeptide to the sequence of a second polypeptide. The term "homologous", when used to describe a polynucleotide, indicates that two polynucleotides, or designated sequences thereof, when optimally aligned and compared, are identical, with appropriate nucleotide insertions or deletions, in at least 70% of the nucleotides, usually from about 75% to 99%, and more preferably at least about 98 to 99% of the nucleotides.

[0067] As used herein, "homologous", when used to describe a polynucleotide, indicates that two polynucleotides, or designated sequences thereof, when optimally aligned and compared, are identical, with appropriate nucleotide insertions or deletions, in at least 70% of the nucleotides, usually from about 75% to 99%, and more preferably at least about 98 to 99% of the nucleotides.

[0068] As used herein, "polymerase chain reaction" or "PCR" refers to a procedure wherein specific pieces of DNA are amplified as described in U.S. Pat. No. 4,683,195. Generally, sequence information from the ends of the polypeptide fragment of interest or beyond needs to be available, such that oligonucleotide primers can be designed; these primers will point towards one another, and will be identical or similar in sequence to opposite strands of the template to be amplified. The 5' terminal nucleotides of the two primers will coincide with the ends of the amplified material. PCR can be used to amplify specific DNA sequences from total genomic DNA, cDNA transcribed from total cellular RNA, plasmid sequences, etc. (See generally Mullis et al., Cold Spring Harbor Symp. Quant. Biol., 51: 263, 1987; Erlich, ed., PCR Technology, Stockton Press, NY, 1989).

[0069] As used herein, "stringency" typically occurs in a range from about Tm(melting temperature)-5° C. (5° below the Tm of the probe) to about 20° C. to 25° C. below Tm. As will be understood by those of skill in the art, a stringent hybridization can be used to identify or detect identical polynucleotide sequences or to identify or detect similar or related polynucleotide sequences. As herein used, the term "stringent conditions" means hybridization will occur only if there is at least 95% and preferably at least 97% identity between the sequences.

[0070] As used herein, "hybridization" as used herein, shall include "any process by which a polynucleotide strand joins with a complementary strand through base pairing" (Coombs, J., Dictionary of Biotechnology, Stockton Press, New York, N.Y., 1994).

[0071] As used herein, the term "therapeutically effective dose" or "effective amount" refers to that amount of adenovirus which ameliorates the symptoms or conditions of a disease. A dose is considered a therapeutically effective dose in the treatment of cancer or its metastasis when tumor or metastatic growth is slowed or stopped, or the tumor or metastasis is found to shrink in size, so as to lead to an extension in life-span for the subject.

Adenoviruses of the Invention

[0072] The present invention provides chimeric adenoviruses, or variants or derivatives thereof, having a genome in which the nucleotide sequence of the E2B region of the chimeric adenovirus comprises nucleic acid sequences derived from at least two adenoviral serotypes, which serotypes are each selected from the adenoviral subgroups B, C, D, E and F and are distinct from each other. A chimeric adenovirus of the invention is oncolytic and demonstrates an enhanced therapeutic index for a tumor cell.

Isolation of Chimeric Adenoviruses

[0073] The chimeric adenoviruses of the invention, or variants or derivatives thereof, can be produced using modification of a technique referred to as "bioselection", in which an adenovirus with desired properties, such as enhanced oncogenicity or cell type specificity, is generated through the use of genetic selection under controlled conditions (Yan et al. (2003) J. Virol. 77:2640-2650).

[0074] In the present invention, a mixture of adenoviruses of differing serotypes is pooled and is passaged, preferably at least twice, on a subconfluent culture of tumor cells at a particle per cell ratio high enough to encourage recombination between serotypes, but not so high as to produce premature cell death. A preferred particle per cell ratio is approximately 500 particles per cell, and is easily determined by one skilled in the art. As used herein, a "subconfluent culture" of cells refers to a monolayer or suspension culture in which the cells are actively growing. For cells grown as a monolayer, an example would be a culture where approximately 50% to 80% of the area available for cell growth is covered with cells. Preferred is a culture where approximately 75% of the growth area is covered with cells.

[0075] In a preferred embodiment, the adenoviral mixture is one that includes adenoviral serotypes representative of the adenoviral subgroups B, C, D, E and F. Group A adenoviruses are not included in the mixture as they are associated with tumor formation in rodents. Preferred tumor cell lines useful in the bioselection process include, but are not limited to, those derived from breast, colon, pancreas, lung and prostate. Some examples of solid tumor cell lines useful for the "bioselective" passaging of the adenoviral mixture include, but are not limited to, MDA231, HT29, PAN-1 and PC-3 cells. Hemopoietic cell lines include, but are not limited to, the Raji and Daudi B-lymphoid cells, K562 erythroblastoid cells, U937 myeloid cells, and HSB2 T-lymphoid cells.

[0076] Adenoviruses produced during these initial passages are used to infect quiescent tumor cells at a particle to cell ratio low enough to permit the infection of a cell by no more than one adenovirus. After up to 20 passages under these conditions, the supernatant from the last passage is harvested prior to visible cytopathic effect (CPE, see Fields Virology, Vol. 2, Fourth Edition, Knipe, ea., Lippincott Williams & Wilkins, pp. 135-136) to increase selection of highly potent viruses. The harvested supernatant can be concentrated by techniques well known to those skilled in the art. A preferred method for attaining quiescent cells, i.e. ones in which active cell growth has stopped, in a monolayer culture is to allow the culture to grow for 3 days following confluence, where confluence means that the entire area available for cell growth is occupied (covered with cells). Similarly, suspension cultures can be grown to densities characterized by the absence of active cell growth.

[0077] The serotype profile of the concentrated supernatant, which contains the bioselected adenoviral pool, can be examined by measuring the retention times of the harvested viral pool on an anion exchange column, where different adenoviral serotypes are known to have characteristic retention times (Blanche et al. (2000) Gene Therapy 7:1055-1062); see Example 3, FIGS. 1A and B. Adenoviruses of the invention can be isolated from the concentrated supernatant by dilution and plaque purification, or other techniques well know in the art, and grown for further characterization. Techniques well known in the art are used to determine the sequence of the isolated chimeric adenoviruses (see Example 5).

[0078] An example of a chimeric adenovirus of the invention is the chimeric adenovirus ColoAd1, which was Isolated using HT29 colon cells in the bioselection process. ColoAd1 has the nucleic acid sequence of SEQ ID NO: 1. The majority of the nucleotide sequence of ColoAd1 is identical to the nucleotide sequence of the Ad11 serotype (SEQ ID NO: 2) (Stone et al. (2003) Virology 309:152-165; Mei et al. (2003) J. Gen. Virology 84:2061-2071). There are two deletions in the ColoAd1 nucleotide sequence as compared with Ad11, one 2444 base pairs in length within the E3 transcription unit region of the genome (base pairs 27979 to 30423 of SEQ ID NO: 2) and a second, smaller deletion, 25 base pairs in length (base pairs 33164 to 33189 of SEQ ID NO: 2), within the E4orf4 gene. The E2B transcription unit region (SEQ ID NO: 3) of ColoAd1, which encodes the adenoviral proteins DNA polymerase and terminal protein, is located between base pairs 5067 and 10354 of SEQ ID NO: 1, and is an area of homologous recombination between the Ad11 and Ad3 serotypes. Within this region of ColoAd1, there are 198 base pair changes, as compared with the sequence of Ad11 (SEQ ID NO: 1). The changes result in stretches of nucleotides within the E2B region of ColoAd1 which are homologous to the sequence within a portion of the E2B region of Ad3 (SEQ ID NO: 8), with the longest stretch of homology between ColoAd1 and Ad3 being 414 bp in length. The E2B region of ColoAd1 (SEQ ID NO: 3) confers enhanced potency to the ColoAd1 adenovirus as compared to unmodified Ad11 adenovirus (see Example 6; FIG. 7). In other embodiments, a chimeric adenovirus of the invention can comprise nucleic acid sequences from more than two adenoviral serotypes.

[0079] A chimeric adenovirus of the invention, or a variant or derivative thereof, can be evaluated for its selectivity in a specific tumor type by examination of its lytic potential in a panel of tumor cells derived from the same tissue upon which the adenoviral pool was initially passaged. For example, the chimeric adenovirus ColoAd1 (SEQ ID NO: 1), which was initially derived from an adenoviral pool passaged on HT-29 colon tumor cell lines, was re-examined both in HT-29 cells and in a panel of other colon-derived tumor cells lines, including DLD-1, LS174T, LS1034, SW403, HCI116, SW48, and Colo320DM (see FIG. 3B). Any available colon tumor cell lines would be equally useful for such an evaluation. Isolated adenoviral clones from adenoviral pools selected on other tumor cell types can be similarly tested in a suitable tumor cell panel, including, but not limited to, prostate cell lines (e.g. DU145 and PC-3 cell lines); pancreatic cell lines (e.g. the Panc-1 cell line); breast tumor cell lines (e.g. the MDA231 cell line) and ovarian cell lines (e.g. the OVCAR-3 cell line). Other available tumor cell lines are equally useful in isolating and identifying adenoviruses of the invention.

[0080] The chimeric adenoviruses of the invention have an enhanced therapeutic index as compared with the adenoviral serotypes from which it is derived. (see FIG. 6, which compares the cytolytic activity of the chimeric adenovirus ColoAd1 with Ad11p).

[0081] The invention also encompasses chimeric adenoviruses that are constructed using recombinant techniques well-known to those skilled in the art. Such chimeric adenoviruses comprise a region of nucleotide sequence derived from one adenoviral serotype which is incorporated by recombinant techniques into the genome of a second adenoviral serotype. The incorporated sequence confers a property, e.g. tumor specificity or enhanced potency, to the parental adenoviral serotype. For example, the E2B region of ColoAd1 (SEQ ID NO: 3) can be incorporated into the genome of Ad35 or Ad9.

Adenoviral Derivatives

[0082] The invention also encompasses a chimeric adenovirus of the invention that is modified to provide other therapeutically useful chimeric adenoviruses. Modifications include, but are not limited to, those described below.

[0083] One modification is production of derivatives of the chimeric adenovirus of the invention substantially lacking the ability to bind p53, as a result of a mutation in the adenoviral gene that encodes the E1B-55K protein. Such viruses generally have some, or all, of the E1B-55K region deleted. (see U.S. Pat. No. 5,677,178). U.S. Pat. No. 6,080,578 describes, among other things, Ad5 mutants that have deletions in the region of the E1B-55K protein that is responsible for binding p53. Another preferred modification to the chimeric adenoviruses of the instant invention are mutations in the E1A region, as described in U.S. Pat. Nos. 5,801,029 and 5,972,706. These types of modifications provide derivatives of the chimeric adenoviruses of the invention with greater selectivity for tumor cells.

[0084] Another example of a modification encompassed by the invention is a chimeric adenovirus which exhibits an enhanced degree of tissue specificity due to placement of viral replication under the control of a tissue specific promoter as described in U.S. Pat. No. 5,998,205. Replication of a chimeric adenovirus of the invention can also be put under the control of an E2F responsive element as described in U.S. patent application Ser. No. 09/714,409. This modification affords a viral replication control mechanism based on the presence of E2F, resulting in enhanced tumor tissue specificity, and is distinct from the control realized by a tissue specific promoter. In both of these embodiments, the tissue specific promoter and the E2F responsive element are operably linked to an adenoviral gene that is essential for the replication of the adenovirus.

[0085] Another modification encompassed by the invention is use of a chimeric adenovirus of the invention, e.g. ColoAd1, as the backbone for production of novel replication-deficient adenoviral vectors. As described in Lai et al. ((2002) DNA Cell Bio. 21:895-913), adenoviral vectors which are replication deficient can be used to deliver and express therapeutic genes. Both first generation (in which the E1 and E3-regions are deleted) and second generation (in which the E4 region is additionally deleted) adenoviral vectors derived from the chimeric adenoviruses of the invention are provided herein. Such vectors are easily produced using techniques well known to those skilled in the art (see Imperiale and Kochanek (2004) Curr. Top. Microbiol. Immunol. 273:335-357; Vogels et al. (2003) J. Virol. 77:8263-8271).

[0086] A further modification encompassed by the invention is the insertion of a heterologous gene, useful as a marker or reporter for tracking the efficiency of viral infection. One embodiment of this type of modification is insertion of the thymidine kinase (TK) gene. The expression of TK within infected cells can be used to track the level of virus remaining in cells following viral infection, using radiolabeled substrates of the TK reaction (Sangro et al. (2002) Mol. Imaging Biol. 4:27-33).

[0087] Methods for the construction of the modified chimeric adenoviruses are generally known in the art. See, Mittal, S. K. (1993) Virus Res. 28:67-90 and Hermiston, T. et al. (1999) Methods in Molecular Medicine Adenovirus Methods and Protocols, W. S. M. Wold, ed, Humana Press. Standard techniques are used for recombinant nucleic acid methods, polynucleotide synthesis, and microbial culture and transformation (e.g., electroporation, lipofection). Generally, enzymatic reactions and purification steps are performed according to the manufacturer's specifications. The techniques and procedures are generally performed according to conventional methods in the art and various general references (see generally, Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd. edition (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.) which are provided throughout this document. The nomenclature used herein and the laboratory procedures in analytical chemistry, organic synthetic chemistry, and pharmaceutical formulation described below are those well known and commonly employed in the art.

Determination of Therapeutic Potential

[0088] Chimeric adenoviruses of the invention, or variants or derivatives thereof, can be evaluated for their therapeutic utility by examination of their lytic potential in tumor cells derived from tissues of interest as therapeutic targets. Tumor cell lines useful for testing such adenoviruses include, but are not limited to, colon cell lines, including but not limited to, DLD-1, HCT116, HT29, LS1034 and SW48 cell lines; prostate cell lines, including but not limited to, DU145 and PC-3 cell lines; pancreatic cell lines, including but not limited to, the Panc-1 cell line; breast tumor cell lines, including but not limited to, the MDA231 cell line and ovarian cell lines, including but not limited to, the OVCAR-3 cell line. Hemopoietic cell lines'include, but are not limited to, the Raji and Daudi B-lymphoid cells, K562 erythroblastoid cells, U937 myeloid cells, and HSB2 T-lymphoid cells. Any other tumor cell lines that are available can be used in evaluating and identifying adenoviruses of the invention for use in the treatment of neoplasia.

[0089] The cytolytic activity of adenoviruses of the invention can be determined in representative tumor cell lines and the data converted to a measurement of potency, with an adenovirus belonging to subgroup C, preferably Ad5, being used as a standard (i.e. given a potency of 1). A preferred method for determining cytolytic activity is an MTS assay (see Example 4, FIG. 2).

[0090] The therapeutic index of an adenovirus of the invention in a particular tumor cell line can be calculated by comparison of the potency of the given adenovirus in a tumor cell line with the potency of that same adenovirus in a non-cancerous cell line. Preferred non-cancerous cell lines are SAEC cells, which are epithelial in origin, and HUVEC cells which are endothelial in origin (see FIG. 4). These two cell types represent normal cells from which organs and vasculature, respectively, are derived, and are representative of likely sites of toxicity during adenoviral therapy, depending on the mode of delivery of the adenovirus. However, practice of the invention is not limited to the use of these cells, and other non-cancerous cell lines (e.g. B cells, T cells, macrophages, monocytes, fibroblasts) may also be used.

[0091] The chimeric adenoviruses of the invention can be further evaluated for their ability to target neoplastic cell growth (i.e. cancer) by their capacity to reduce tumorigenesis or neoplastic cell burden in nude mice harboring a transplant of neoplastic cells, as compared to untreated mice harboring an equivalent neoplastic cell burden (see Example 7).

[0092] Evaluation of the adenoviruses of the invention can also be performed using primary human tumor explants (Lam et al. (2003) Cancer Gene Therapy; Grill et al. (2003) Mol. Therapy 6:609-614), which provide test conditions present in tumors that cannot normally be produced using the tumor xenograft studies.

Therapeutic Utility

[0093] The present invention provides for the use of chimeric adenoviruses of the invention for the inhibition of tumor cell growth, as well as for the use of adenoviral vectors derived from these chimeric adenoviruses to deliver therapeutic proteins useful in the treatment of neoplasia and other disease states.

Pharmaceutical Compositions and Administration

[0094] The present invention also relates to pharmaceutical compositions which comprise the chimeric adenoviruses of the invention, including variants and derivatives thereof, formulated for therapeutic administration to a patient. For therapeutic use, a sterile composition containing a pharmacologically effective dosage of adenovirus is administered to a human patient or veterinary non-human patient for treatment, for example, of a neoplastic condition. Generally, the composition will comprise about 1011 or more adenovirus particles in an aqueous suspension. A pharmaceutically acceptable carrier or excipient is often employed in such sterile compositions. A variety of aqueous solutions can be used, e.g. water, buffered water, 0.4% saline, 0.3%-glycine and the like. These solutions are sterile and generally free of particulate matter other than the desired adenoviral vector. The compositions may contain pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions such as pH adjusting and buffering agents, toxicity adjusting agents and the like, e.g. sodium acetate, sodium chloride, potassium chloride, calcium chloride, sodium lactate, etc. Excipients which enhance infection of cells by adenovirus may be included. (see U.S. Pat. No. 6,392,069)

[0095] Adenoviruses of the invention may also be delivered to neoplastic cells by liposome or immunoliposome delivery; such delivery may be selectively targeted to neoplastic cells on the basis of a cell surface property present on the neoplastic cell population (e.g., the presence of a cell surface protein which binds an immunoglobulin in an immunoliposome). Typically, an aqueous suspension containing the virions are encapsulated in liposomes or immunoliposomes. For example, a suspension of adenovirus virions can be encapsulated in micelles to form immunoliposomes by conventional methods (U.S. Pat. No. 5,043,164, U.S. Pat. No. 4,957,735, U.S. Pat. No. 4,925,661; Connor and Huang, (1985) J. Cell Biol. 101: 581; Lasic D. D. (1992) Nature 355: 279; Novel Drug Delivery (eds. Prescott and Nimmo, Wiley, New York-, 1989); Reddy et al. (1992) J. Immunol. 148:1585). Immunoliposomes comprising an antibody that binds specifically to a cancer cell antigen (e.g., CALLA, CEA) present on the cancer cells of the individual may be used to target virions to those cells (Fisher (2001) Gene Therapy 8:341-348).

[0096] To further increase the efficacy of the adenoviruses of the invention, they may be modified to exhibit enhanced tropism for particular tumor cell types. For example, as shown in PCT/US98/04964, a protein on the exterior coat of an adenovirus may be modified to display a chemical agent, preferably a polypeptide, that binds to a receptor present on tumor cells to a greater degree than normal cells. (See also, U.S. Pat. Nos. 5,770,442 and 5,712,136). The polypeptide can be an antibody, and preferably is a single chain antibody.

Adenoviral Therapy

[0097] The adenoviruses of the invention, or pharmaceutical compositions thereof, can be administered for therapeutic treatment of neoplastic disease or cancer. In therapeutic applications, compositions are administered to a patient already affected by the particular neoplastic disease, in an amount sufficient to cure or at least partially arrest the condition and its complications. An amount adequate to accomplish this is defined as a "therapeutically effective dose" or "efficacious dose". Amounts effective for this use will depend upon the severity of the condition, the general state of the patient, and the route of administration.

[0098] For example, but not by way of limitation, a human patient or non-human mammal having a solid or haemotologic neoplastic disease, (e.g. pancreatic, colon, ovarian, lung, or breast carcinoma, leukemia or multiple myeloma) may be treated by administering a therapeutically effective dosage of an appropriate adenovirus of the invention, i.e. one which has been shown to have an improved therapeutic index for that tissue type. For example, a preferred chimeric adenovirus for the treatment of colon cancer would be the adenovirus ColoAd1 (SEQ ID NO: 1). Suspensions of infectious adenovirus particles may be delivered to neoplastic tissue by various routes, including intravenous, intraperitoneal, intramuscular, subdermal, and topical. An adenovirus suspension containing about 103 to 1012 or more virion particles per ml may be administered by infusion (e.g., into the peritoneal cavity for treating ovarian cancer, into the portal vein for treating hepatocarcinoma or liver metastases from other non-hepatic primary tumors) or other suitable route, including direct injection into a tumor mass (e.g. a breast tumor), enema (e.g., colon cancer), or catheter (e.g., bladder cancer). Other routes of administration may be suitable for carcinomas of other origins, i.e. inhalation as a mist (e.g., for pulmonary delivery to treat bronchogenic carcinoma, small-cell lung carcinoma, non-small cell lung carcinoma, lung adenocarcinoma. or laryngeal cancer) or direct application to a tumor site (e.g., bronchogenic carcinoma, nasopharyngeal carcinoma, laryngeal carcinoma, cervical carcinoma).

[0099] Adenoviral therapy using the adenoviruses of the instant invention may be combined with other antineoplastic protocols, such as conventional chemotherapy or x-ray therapy to treat a particular cancer. Treatment can be concurrent or sequential. A preferred chemotherapeutic agent is cisplatin, and the preferred dose may be chosen by the practitioner based on the nature of the cancer to be treated, and other factors routinely considered in administering cisplatin. Preferably, cisplatin will be administered intravenously at a dose of 50-120 mg/m2 over 3-6 hours. More preferably it is administered intravenously at a dose of 80 mg/m2 over 4 hours. A second preferred chemotherapeutic agent is 5-fluorouracil, which is often administered in combination with cisplatin. The preferred dose of 5-fluorouracil is 800-1200 mg/m2 per day for 5 consecutive days.

[0100] Adenoviral therapy using the adenoviruses of the instant invention as adenoviral vectors may also be combined with other genes known to be useful in viral based therapy. See U.S. Pat. No. 5,648,478. In such cases, the chimeric adenovirus further comprises a heterologous gene that encodes a therapeutic protein, incorporated within the viral genome, such that the heterologous gene is expressed within an infected cell. A therapeutic protein, as used herein, refers to a protein that would be expected to provide some therapeutic benefit when expressed in a given cell.

[0101] In one embodiment, the heterologous gene is a pro-drug activator gene, such as cytosine deaminase (CD) (See, U.S. Pat. Nos. 5,631,236; 5,358,866; and 5,677,178). In other embodiments, the heterologous gene is a known inducer of cell-death, e.g apoptin or adenoviral death protein (ADP), or a fusion protein, e.g. fusogenic membrane glycoprotein (Danen-Van Oorschot et al. (1997) Proc. Nat. Acad. Sci. 94:5643-5847; Tollefson et al. (1996) J. Virol. 70:2296-2306; Fu et al. (2003) Mol. Therapy 7: 48-754, 2003; Ahmed et al. (2003) Gene Therapy 10:1663-1871, Galanis et al. (2001) Human Gene Therapy 12(7): 811-821).

[0102] Further examples of heterologous genes, or fragments thereof, include those that encode immunomodulatory proteins, such as cytokines or chemokines. Examples include interleukin 2, U.S. Pat. No. 4,738,927 or 5,641,665; interleukin 7, U.S. Pat. No. 4,965,195 or 5,328,988; and interleukin 12, U.S. Pat. No. 5,457,038; tumor necrosis factor alpha, U.S. Pat. No. 4,677,063 or 5,773,582; interferon gamma, U.S. Pat. No. 4,727,138 or 4,762,791; or GM CSF, U.S. Pat. No. 5,393,870 or 5,391,485, Mackensen et al. (1997) Cytokine Growth Factor Rev. 8:119-128). Additional immunomodulatory proteins further include macrophage inflammatory proteins, including MIP-3. Monocyte chemotatic protein (MCP-3 alpha) may also be used; a preferred embodiment of a heterologous gene is a chimeric gene consisting of a gene that encodes a protein that traverses cell membranes, for example, VP22 or TAT, fused to a gene that encodes a protein that is preferably toxic to cancer but not normal cells.

[0103] The chimeric adenoviruses of the invention can also be used as vectors to deliver genes encoding therapeutically useful RNA molecules, i.e. siRNA (Dorsett and Tuschl (2004) Nature Rev Drug Disc 3:318-329).

[0104] In some cases, genes can be incorporated into a chimeric adenovirus of the invention to further enhance the ability of the oncolytic virus to eradicate the tumor, although not having any direct impact on the tumor itself--these include genes encoding proteins that compromise MHC class I presentation (Hewitt et al. (2003) Immunology 110: 163-169), block complement, inhibit IFNs and IFN-induced mechanisms, chemokines and cytokines, NK cell based killing (Orange et al., (2002) Nature Immunol. 3: 1006-1012; Mireille et al. (2002) Immunogenetics 54: 527-542; Alcami (2003) Nature Rev. Immunol. 3: 36-50; down regulate the immune response (e.g. IL-10, TGF-Beta, Khong and Restifo (2002) Nature Immunol. 3: 999-1005; 2002) and metalloproteases which can breakdown the extracellular matrix and enhance spread of the virus within the tumor (Bosman and Stamenkovic (2003) J. Pathol. 2000: 423-428; Visse and Nagase (2003) Circulation Res. 92: 827-839).

Kits

[0105] The invention further relates to pharmaceutical packs and kits comprising one or more containers filled with one or more of the ingredients of the aforementioned compositions of the invention. Associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, reflecting approval by the agency of the manufacture, use or sale of the product for human administration.

[0106] The present invention is further described by the following examples, which are illustrative of specific embodiments of the invention, and various uses thereof. These exemplifications, which illustrating certain specific aspects of the invention, do not portray the limitations or circumscribe the scope of the disclosed invention.

[0107] Unless otherwise indicated, the practice of the present invention employs conventional techniques of cell culture, molecular biology, microbiology, recombinant DNA manipulation, immunology science, which are within the skill of the art. Such techniques are explained fully in the literature. See, e.g. Cell Biology: a Laboratory Handbook: J. Cells (Ed). Academic Press. N.Y. (1996); Graham, F. L. and Prevec, L. Adenovirus-based expression vectors and recombinant vaccines. In: Vaccines: New Approaches to Immunological Problems. R. W. Ellis (ed) Butterworth. Pp 363-390; Grahan and Prevec Manipulation of adenovirus vectors. In: Methods in Molecular Biology, Vol. 7: Gene Transfer and Expression Techniques. E. J. Murray and J. M. Walker (eds) Humana Press Inc., Clifton, N.J. pp 109-128, 1991; Sambrook et al. (1989), Molecular Cloning, A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory Press; Sambrook et al. (1989), and Ausubel et al. (1995), Short Protocols in Molecular Biology, John Wiley and Sons.

EXAMPLES

Methods

[0108] Standard techniques are used for recombinant nucleic acid methods, polynucleotide synthesis, and microbial culture and transformation (e.g., electroporation, lipofection). Generally, enzymatic reactions and purification steps are performed according to the manufacturer's specifications. The techniques and procedures are generally performed according to conventional methods in the art and various general references (see generally, Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd. edition (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.) which are provided throughout this document. The nomenclature used herein and the laboratory procedures in analytical chemistry, organic synthetic chemistry, and pharmaceutical formulation and delivery, and treatment of patients. Methods for the construction of adenoviral mutants are generally known in the art. See, Mittal, S. K., Virus Res., 1993, vol: 28, pages 67-90; and Hermiston, T. et al., Methods in Molecular Medicine: Adenovirus Methods and Protocols, W. S. M. Wold, ed, Humana Press, 1999. Further, the adenovirus 5 genome is registered as Genbank 10 accession #M73260, and the virus is available from the American Type Culture Collection, Rockville, Md., U.S.A., under accession number VR-5.

Viruses and Cell Lines

[0109] The Ad serotypes Ad3 (GB strain), Ad4 (RI-67 strain), Ad5 (Adenoid 75 strain), Ad9 (Hicks strain), Ad11p (Slobitski strain), Ad16 (Ch. 79 strain) and all the cell lines, with the exception of the following were all purchased from the ATCC: MDA231-mt1 (a derivative isolated by Dr. Deb Zajchowski from a rapidly growing subcutaneous implanted xenograft of MDA231 cells) and Panc1-sct (derived by Dr. Sandra Biroc from a rapidly growing subcutaneous implanted xenograft of Panc1 cells), HUVEC (Vac Technologies, Rensselaer, N.Y.), and SAEC (Clonetics, Walkersville, Md.). Ad40 was a kind gift from Dr. William S. M. Weld at St. Louis University.

Example 1

Viral Purification and Quantitation

[0110] Viral stocks were propagated on 293 cells and purified on CsCl gradients (Hawkins at al., 2001). The method used to quantitate viral particles is based on that of Shabram et al. (1997) Human Gene Therapy 8:453-465, with the exception that the anion-exchanger TMAE Fractogel was used instead of Resource Q. In brief, a 1.25 ml column was packed with Fractogel EMD TMAE-650 (S) (catalog #116887-7 EM Science, Gibbstown, N.J. 08027). HPLC separation was performed on an Agilent HP 1100 HPLC using the following conditions: Buffer A=50 mM HEPES, pH 7.5; Buffer B=1.0 M NaCl in Buffer A; flow rate of 1 ml per minute. After column equilibration for not less than 30 minutes in Buffer A, approximately 109-1011 viral particles of sample were loaded onto the column in 10-100 ul volume, followed by 4 column volumes of Buffer A. A linear gradient extending over 16 column volumes and ending in 100% Buffer B was applied.

[0111] The column effluent was monitored at A260 and A280 nm, peak areas calculated, and the 260 to 280 nm ratio determined. Viral peaks were identified as those peaks having a A260/A280 ratio close to 1.33. A virus standard was included with each sample series. The number of viral particles per ml of the standard had been determined using the method of Lehmberg et al. (1999) J. Chrom. B, 732:411-423}. In the viral concentration range used, the A260 nm peak area of each sample is directly proportional to the number of viral particles in the sample. The number of viral particles per ml in each test sample was calculated by multiplying the known number of viral particles per ml in the standard by the ratio of the A260 nm viral peak area of the sample to the A260 nm viral peak area of the standard.

[0112] The column was regenerated after each sample gradient by washing with two column volumes of 0.5 N NaOH followed by two column volumes of 100% Buffer A, 3 column volumes of 100% Buffer B, and then 4 column volumes of 100% Buffer A.

Example 2

Bioselection

[0113] Viral serotypes representing subgroups Ads B-F were pooled and passaged on sub-confluent cultures of the target tumor cell lines at a high particle-per-cell ratio for two rounds to invite recombination to occur between serotypes. Supernatant (1.0, 0.1 0.01, 0.001 ml) from the second round of the high viral particle-per-cell infection, subconfluent cultures, was then used to infect a series of over-confluent T-75 tissue culture flasks of target tumor cell lines PC-3, HT-29, Panc-1 and MDA-231. To achieve over-confluency, each cell line was seeded at split ratios that allowed that cell line to reach confluency between 24 and 40 hours post seeding, and the cells were allowed to grow a total of 72 hours post seeding prior to infection. This was done to maximize the confluency of the cells to mimic growth conditions in human solid tumors.

[0114] Cell culture supernatant was harvested from the first flask in the 10-fold dilution series that did not show any sign of CPE at day 3 or 4 post-infection (in the case of HT-29 and PC-3, this was modified for passages 10-20 to harvest of the second flask, i.e. harvest 100-fold below the dilution in which CPE were detectable by day 3 post-infection). Each harvest served as the starting material for the successive passage of the virus. This process was repeated until the viral pool achieved 20 bioselective passages.

[0115] Individual viruses from each bioselected pool were isolated by two rounds of plaque purification on A549 cells using standard methods (Tollefson, A., Hermiston, T. W., and Wold, W. S. M.; Preparation and Titration of CsCl-banded Adenovirus Stock° in Adenovirus Methods and Protocols, Humana Press, 1999, pp 1-10, W. S. M. Wold, Ed). In brief, dilutions of the supernatant harvested from the 20th passage on each target tumor line were used to infect A549 cells in a standard plaque assay. Well-individuated plaques were harvested, and the same plaque assay method was used to generate a second round of individual plaques from these harvests. Well isolated plaques from the second round of plaque purification were deemed pure, infected cultures were prepared using these purified plaques, and the oncolytic potency of these culture supernatants determined by MTS assay as described.

Example 3

Serotype Characterization

[0116] The parental adenoviral serotypes comprising the viral pools or the isolated ColoAd1 adenovirus were identified using anion-exchange chromatography similar to that described in Shabram et al. (1997) Human Gene Therapy 8:453:465, with the exception that the anion-exchanger TMAE Fractogel media (EM Industries, Gibbstown, N.J.) was used instead of Resource Q, as described in Example 1 (see FIG. 1).

[0117] Adenovirus type 5 eluted at approximately 60% Buffer B during the gradient. The other serotypes (3, 4, 9, 11p, 16, 35, and 40) each eluted at a characteristic retention time consistent with the retention times on Q Sepharose XL published by Blanche et al. (2000) Gene Therapy 7:1055-1062.

Example 4

Cytolytic Assay

[0118] The viral lytic capacity was measured by using a modification of the MTT assay (Shen et al., 2001). Briefly, the MTS assay (Promega, CellTiter 9600 Aqueous Non-Radioactive Cell Proliferation Assay) was used in place of the MTT assay since conversion of MTS by cells into aqueous, soluble formazan reduces time and eliminates the use of a volatile organic solvent associated with the MTT assay.

[0119] To perform the assay, cells were seeded at a defined density for each tumor cell line that generated a confluent monolayer within 24 hr. These densely seeded cells were allowed to grow for 2 additional days prior to exposure to the test virus(es). Infections of both tumor and primary normal cells were carried out in quadruplicate with serial three fold dilutions of the viruses starting at a particle per cell ratio of 100 and ending at a particle per cell ratio of 0.005. Infected cells were incubated at 37° C. and the MTS assay was performed at the time points indicated for the individual primary cells or tumor cell lines. Mock-infected cells served as negative controls and established the 100% survival point for the given assay.

Example 5

DNA Sequencing

[0120] DNA sequencing of the Ad11p (SEQ ID NO: 2) and ColoAd1 (SEQ ID NO: 1) genomic DNAs was performed as follows. Briefly, purified adenovirus DNA from ColoAd1 and Ad11p was partially digested with the restriction endonuclease Sau3A1 and shotgun cloned into the plasmid vector pBluescript II (Stratagene, La Jolla, Calif.). Positive clones were propagated and sequenced using the primers M13R and KS (Stratagene, La Jolla, Calif.). Individual sequence reactions were trimmed, edited and assembled using Sequencher® (Gene Codes Corp., Ann Arbor, Mich.). Gaps in coverage were amplified with custom oligonucleotide primers and sequenced. The ends of the viral genomes were sequenced directly off the adenoviral DNA. In all, each genome was sequenced at 3X+ coverage and 431 bases at 2× coverage.

[0121] To determine the origin of the ColoAd1 E2B region, two primer sets were generated, one to the E2B pTP gene (bp9115, 5'GGGAGTTTCGCGCGGACACGG3' (SEQ ID NO: 4) and by 9350, 5' GCGCCGCCGCCGCGGAGAGGT3' (SEQ ID NO: 5)) and one to the DNA polymerase gene (bp 7520 5'CGAGAGCCCATTCGTGCAGGTGAG3' (SEQ ID NO: 6) and by 7982, 5'GCTGCGACTACTGCGGCCGTCTGT3' (SEQ ID NO: 7) and used to PCR isolate DNA fragments from the various serotypes (Ad3, 4, 5, 9, 11p, 16 and 40) using reagents from the Advantage 2 PCR kit (Clonetics, Walkersville, Md.; Cat #K1910-Y) and run on a PTC-200 thermocycler from MJ Research (Watertown, Mass.). These fragments were subsequently sequenced along with the DNA sequence of Ad3 using dye terminator sequencing on as ABI 3100 genetic analyzer.

[0122] The E2B region of Ad3 was sequenced using isolated Ad3 DNA and overlapping primers.

[0123] Sequence information was analyzed using the Vector NTI program (Informatix).

Example 6

Construction of Recombinant Viruses

[0124] Genomic DNAs of Ad11p (SEQ ID NO: 2) and ColoAd1 (SEQ ID NO: 1) were purified from CsCl gradient-banded virus particles. The genomic DNAs were digested with Pad which cuts each only once within the viral genome. The Pac1 cut occurs at base 18141 on ColoAd1 nucleotide sequence (SEQ ID NO: 1) and at base 18140 on the Ad11 nucleotide sequence (SEQ ID NO: 2). Digested DNAs were mixed in equal amounts and ligated in the presence of T4 DNA ligase at 16° C. overnight. This ligation mixture was transfected into A549 cells using the CaPO4 transfection kit from Invitrogen, Carlsbad, Calif. (Cat #K2780-01). Isolated plaques were picked and screened by restriction enzyme digestion and PCR analysis to distinguish the four viral populations (M11p, ColoAd1, left end Ad11p/right end ColoAd1 (ColoAd1.1) and left end ColoAd1/right end Ad 11p(ColoAd1.2)).

[0125] The viral lytic capacity of each population was determined in several cell lines, including HT29 and HUVEC cell lines, as described in Example 3. The results demonstrated the order of potency, from least potent to most potent, as Ad11p, ColoAd1.2, ColoAd1.1, ColoAd1 (see FIG. 7 for the results in HT29 cells).

[0126] Also constructed were chimeric adenoviruses pCJ144 and pCJ146, which contain the full-length ColoAd1 genome in which the wild-type Ad11p E3 and E4 region, respectively, has been restored. These modifications were introduced by homologous recombination into BJ5183 E. Coli (Chartier at al. (1996) J. Virol. 70:4805-4810). Both of these chimeric adenoviruses demonstrated reduced lytic capacity in HT29 and HUVEC cells compared to ColoAd1 or ColoAd1.2.

Example 7

In Vivo Efficacy of Adenovirus

[0127] In a typical human tumor xenograft nude mouse experiment, animals are injected with 5×108 cells subcutaneously into the hind flank of the mouse. When the tumors reach 100-200 ul in size, they are injected with vehicle (PBS) or with virus at 2×1010 particles for five consecutive days (1×1011 particles total). A reduction in the size of the tumor would be noted relative to the PBS control and additional control viruses (Ad5, ONYX-015).

Example 8

ColoAd1 Selectivity on Primary Human Tissue Explants

[0128] Tissue specimens from colorectal tumors and adjacent normal tissues removed during surgery were placed in culture media and infected with equal numbers of either ColoAd1 or Ad5 viruses. Culture supernatants were collected at 24 hours post infection and the number of virus particles produced was determined. ColoAd1 produced more virus particles per input particle than Ad5 on tumor tissue, while it produced fewer particles per input particle than Ad5 on normal tissue.

Sequence CWU 1

1

8132325DNAAdenovirus 1ctatctatat aatatacctt atagatggaa tggtgccaat atgtaaatga ggtgatttta 60aaaagtgtgg atcgtgtggt gattggctgt ggggttaacg gctaaaaggg gcggtgcgac 120cgtgggaaaa tgacgttttg tgggggtgga gtttttttgc aagttgtcgc gggaaatgtg 180acgcataaaa aggctttttt ctcacggaac tacttagttt tcccacggta tttaacagga 240aatgaggtag ttttgaccgg atgcaagtga aaattgttga ttttcgcgcg aaaactgaat 300gaggaagtgt ttttctgaat aatgtggtat ttatggcagg gtggagtatt tgttcagggc 360caggtagact ttgacccatt acgtggaggt ttcgattacc gtgtttttta cctgaatttc 420cgcgtaccgt gtcaaagtct tctgttttta cgtaggtgtc agctgatcgc tagggtattt 480atacctcagg gtttgtgtca agaggccact cttgagtgcc agcgagaaga gttttctcct 540ctgcgccggc agtttaataa taaaaaaatg agagatttgc gatttctgcc tcaggaaata 600atctctgctg agactggaaa tgaaatattg gagcttgtgg tgcacgccct gatgggagac 660gatccggagc cacctgtgca gctttttgag cctcctacgc ttcaggaact gtatgattta 720gaggtagagg gatcggagga ttctaatgag gaagctgtaa atggcttttt taccgattct 780atgcttttag ctgctaatga agggttagaa ttagatccgc ctttggacac ttttgatact 840ccaggggtaa ttgtggaaag cggtacaggt gtaagaaaat tacctgattt gagttccgtg 900gactgtgatt tgcactgcta tgaagacggg tttcctccga gtgatgagga ggaccatgaa 960aaggagcagt ccatgcagac tgcagcgggt gagggagtga aggctgccaa tgttggtttt 1020cagttggatt gcccggagct tcctggacat ggctgtaagt cttgtgaatt tcacaggaaa 1080aatactggag taaaggaact gttatgttcg ctttgttata tgagaacgca ctgccacttt 1140atttacagta agtgtgttta agttaaaatt taaaggaata tgctgttttt cacatgtata 1200ttgagtgtga gttttgtgct tcttattata ggtcctgtgt ctgatgctga tgaatcacca 1260tctcctgatt ctactacctc acctcctgag attcaagcac ctgttcctgt ggacgtgcgc 1320aagcccattc ctgtgaagct taagcctggg aaacgtccag cagtggaaaa acttgaggac 1380ttgttacagg gtggggacgg acctttggac ttgagtacac ggaaacgtcc aagacaataa 1440gtgttccata tccgtgttta cttaaggtga cgtcaatatt tgtgtgacag tgcaatgtaa 1500taaaaatatg ttaactgttc actggttttt attgcttttt gggcggggac tcaggtatat 1560aagtagaagc agacctgtgt ggttagctca taggagctgg ctttcatcca tggaggtttg 1620ggccattttg gaagacctta ggaagactag gcaactgtta gagaacgctt cggacggagt 1680ctccggtttt tggagattct ggttcgctag tgaattagct agggtagttt ttaggataaa 1740acaggactat aaacaagaat ttgaaaagtt gttggtagat tgcccaggac tttttgaagc 1800tcttaatttg ggccatcagg ttcactttaa agaaaaagtt ttatcagttt tagacttttc 1860aaccccaggt agaactgctg ctgctgtggc ttttcttact tttatattag ataaatggat 1920cccgcagact catttcagca ggggatacgt tttggatttc atagccacag cattgtggag 1980aacatggaag gttcgcaaga tgaggacaat cttaggttac tggccagtgc agcctttggg 2040tgtagcggga atcctgaggc atccaccggt catgccagcg gttctggagg aggaacagca 2100agaggacaac ccgagagccg gcctggaccc tccagtggag gaggcggagt agctgacttg 2160tctcctgaac tgcaacgggt gcttactgga tctacgtcca ctggacggga taggggcgtt 2220aagagggaga gggcatctag tggtactgat gctagatctg agttggcttt aagtttaatg 2280agtcgcagac gtcctgaaac catttggtgg catgaggttc agaaagaggg aagggatgaa 2340gtttctgtat tgcaggagaa atattcactg gaacaggtga aaacatgttg gttggagcct 2400gaggatgatt gggaggtggc cattaaaaat tatgccaaga tagctttgag gcctgataaa 2460cagtataaga ttactagacg gattaatatc cggaatgctt gttacatatc tggaaatggg 2520gctgaggtgg taatagatac tcaagacaag gcagttatta gatgctgcat gatggatatg 2580tggcctgggg tagtcggtat ggaagcagta acttttgtaa atgttaagtt taggggagat 2640ggttataatg gaatagtgtt tatggccaat accaaactta tattgcatgg ttgtagcttt 2700tttggtttca acaatacctg tgtagatgcc tggggacagg ttagtgtacg gggatgtagt 2760ttctatgcgt gttggattgc cacagctggc agaaccaaga gtcaattgtc tctgaagaaa 2820tgcatatttc aaagatgtaa cctgggcatt ctgaatgaag gcgaagcaag ggtccgccac 2880tgcgcttcta cagatactgg atgttttatt ttgattaagg gaaatgccag cgtaaagcat 2940aacatgattt gcggtgcttc cgatgagagg ccttatcaaa tgctcacttg tgctggtggg 3000cattgtaata tgctggctac tgtgcatatt gtttcccatc aacgcaaaaa atggcctgtt 3060tttgatcaca atgtgatgac gaagtgtacc atgcatgcag gtgggcgtag aggaatgttt 3120atgccttacc agtgtaacat gaatcatgtg aaagtgttgt tggaaccaga tgccttttcc 3180agaatgagcc taacaggaat ttttgacatg aacatgcaaa tctggaagat cctgaggtat 3240gatgatacga gatcgagggt acgcgcatgc gaatgcggag gcaagcatgc caggttccag 3300ccggtgtgtg tagatgtgac tgaagatctc agaccggatc atttggttat tgcccgcact 3360ggagcagagt tcggatccag tggagaagaa actgactaag gtgagtattg ggaaaacttt 3420ggggtgggat tttcagatgg acagattgag taaaaatttg ttttttctgt cttgcagctg 3480tcatgagtgg aaacgcttct tttaaggggg gagtcttcag cccttatctg acagggcgtc 3540tcccatcctg ggcaggagtt cgtcagaatg ttatgggatc tactgtggat ggaagacccg 3600tccaacccgc caattcttca acgctgacct atgctacttt aagttcttca cctttggacg 3660cagctgcagc tgccgccgcc gcttctgttg ccgctaacac tgtgcttgga atgggttact 3720atggaagcat catggctaat tccacttcct ctaataaccc ttctaccctg actcaggaca 3780agttacttgt ccttttggcc cagctggagg ctttgaccca acgtctgggt gaactttctc 3840agcaggtggt cgagttgcga gtacaaactg agtctgctgt cggcacggca aagtctaaat 3900aaaaaaatcc cagaatcaat gaataaataa acaagcttgt tgttgattta aaatcaagtg 3960tttttatttc atttttcgcg cacggtatgc cctagaccac cgatctctat cattgagaac 4020tcggtggatt ttttccagga tcctatagag gtgggattga atgtttagat acatgggcat 4080taggccgtct ttggggtgga gatagctcca ttgaagggat tcatgctccg gggtagtgtt 4140gtaaatcacc cagtcataac aaggtcgcag tgcatggtgt tgcacaatat cttttagaag 4200taggctgatt gccacagata agcccttggt gtaggtgttt acaaaccggt tgagctggga 4260tgggtgcatt cggggtgaaa ttatgtgcat tttggattgg atttttaagt tggcaatatt 4320gccgccaaga tcccgtcttg ggttcatgtt atgaaggacc accaagacgg tgtatccggt 4380acatttagga aatttatcgt gcagcttgga tggaaaagcg tggaaaaatt tggagacacc 4440cttgtgtcct ccaagatttt ccatgcactc atccatgata atagcaatgg ggccgtgggc 4500agcggcgcgg gcaaacacgt tccgtgggtc tgacacatca tagttatgtt cctgagttaa 4560atcatcataa gccattttaa tgaatttggg gcggagagta ccagattggg gtatgaatgt 4620tccttcgggc cccggagcat agttcccctc acagatttgc atttcccaag ctttcagttc 4680cgagggtgga atcatgtcca cctggggggc tatgaaaaac accgtttctg gggcgggggt 4740gattaattgt gatgatagca aatttctgag caattgagat ttgccacatc cggtggggcc 4800ataaatgatt ccgattacgg gttgcaggtg gtagtttagg gaacggcaac tgccgtcttc 4860tcgaagcaag ggggccacct cgttcatcat ttcccttaca tgcatatttt cccgcaccaa 4920atccattagg aggcgctctc ctcctagtga tagaagttct tgtagtgagg aaaagttttt 4980cagcggtttc agaccgtcag ccatgggcat tttggagaga gtttgctgca aaagttctag 5040tctgttccac agttcagtga tgtgttctat ggcatctcga tccagcagac ctcctcgttt 5100cgcgggtttg gacggctcct ggaatagggt atgagacgat gggcgtccag cgctgccagg 5160gttcggtcct tccagggtct cagtgttcga gtcagggttg tttccgtcac agtgaagggg 5220tgtgcgcctg cttgggcgct tgccagggtg cgcttcagac tcatcctgct ggtcgaaaac 5280ttctgtcgct tggcgccctg tatgtcggcc aagtagcagt ttaccatgag ttcgtagttg 5340agcgcctcgg ctgcgtggcc tttggcgcgg agcttacctt tggaagtttt cttgcatacc 5400gggcagtata ggcatttcag cgcatacaac ttgggcgcaa ggaaaacgga ttctggggag 5460tatgcatctg cgccgcagga ggcgcaaaca gtttcacatt ccaccagcca ggttaaatcc 5520ggttcattgg ggtcaaaaac aagttttccg ccatattttt tgatgcgttt cttacctttg 5580gtctccatga gttcgtgtcc tcgttgagtg acaaacaggc tgtccgtgtc cccgtagact 5640gattttacag gcctcttctc cagtggagtg cctcggtctt cttcgtacag gaactctgac 5700cactctgata caaaggcgcg cgtccaggcc agcacaaagg aggctatgtg ggaggggtag 5760cgatcgttgt caaccagggg gtccaccttt tccaaagtat gcaaacacat gtcaccctct 5820tcaacatcca ggaatgtgat tggcttgtag gtgtatttca cgtgacctgg ggtccccgct 5880gggggggtat aaaagggggc ggttctttgc tcttcctcac tgtcttccgg atcgctgtcc 5940aggaacgtca gctgttgggg taggtattcc ctctcgaagg cgggcatgac ctctgcactc 6000aggttgtcag tttctaagaa cgaggaggat ttgatattga cagtgccggt tgagatgcct 6060ttcatgaggt tttcgtccat ctggtcagaa aacacaattt ttttattgtc aagtttggtg 6120gcaaatgatc catacagggc gttggataaa agtttggcaa tggatcgcat ggtttggttc 6180ttttccttgt ccgcgcgctc tttggcggcg atgttgagtt ggacatactc gcgtgccagg 6240cacttccatt cggggaagat agttgttaat tcatctggca cgattctcac ttgccaccct 6300cgattatgca aggtaattaa atccacactg gtggccacct cgcctcgaag gggttcattg 6360gtccaacaga gcctacctcc tttcctagaa cagaaagggg gaagtgggtc tagcataagt 6420tcatcgggag ggtctgcatc catggtaaag attcccggaa gtaaatcctt atcaaaatag 6480ctgatgggag tggggtcatc taaggccatt tgccattctc gagctgccag tgcgcgctca 6540tatgggttaa ggggactgcc ccatggcatg ggatgggtga gtgcagaggc atacatgcca 6600cagatgtcat agacgtagat gggatcctca aagatgccta tgtaggttgg atagcatcgc 6660ccccctctga tacttgctcg cacatagtca tatagttcat gtgatggcgc tagcagcccc 6720ggacccaagt tggtgcgatt gggtttttct gttctgtaga cgatctggcg aaagatggcg 6780tgagaattgg aagagatggt gggtctttga aaaatgttga aatgggcatg aggtagacct 6840acagagtctc tgacaaagtg ggcataagat tcttgaagct tggttaccag ttcggcggtg 6900acaagtacgt ctagggcgca gtagtcaagt gtttcttgaa tgatgtcata acctggttgg 6960tttttctttt cccacagttc gcggttgaga aggtattctt cgcgatcctt ccagtactct 7020tctagcggaa acccgtcttt gtctgcacgg taagatccta gcatgtagaa ctgattaact 7080gccttgtaag ggcagcagcc cttctctacg ggtagagagt atgcttgagc agcttttcgt 7140agcgaagcgt gagtaagggc aaaggtgtct ctgaccatga ctttgaggaa ttggtatttg 7200aagtcgatgt cgtcacaggc tccctgttcc cagagttgga agtctacccg tttcttgtag 7260gcggggttgg gcaaagcgaa agtaacatca ttgaagagaa tcttgccggc cctgggcatg 7320aaattgcgag tgatgcgaaa aggctgtggt acttccgctc ggttattgat aacctgggca 7380gctaggacga tctcgtcgaa accgttgatg ttgtgtccta cgatgtataa ttctatgaaa 7440cgcggcgtgc ctctgacgtg aggtagctta ctgagctcat caaaggttag gtctgtgggg 7500tcagataagg cgtagtgttc gagagcccat tcgtgcaggt gaggattcgc tttaaggaag 7560gaggaccaga ggtccactgc cagtgctgtt tgtaactggt cccggtactg acgaaaatgc 7620cgtccgactg ccattttttc tggggtgacg caatagaagg tttgggggtc ctgccgccag 7680cgatcccact tgagttttat ggcgaggtca taggcgatgt tgacgagccg ctggtctcca 7740gagagtttca tgaccagcat gaaggggatt agctgcttgc caaaggaccc catccaggtg 7800taggtttcca catcgtaggt gagaaagagc ctttctgtgc gaggatgaga gccaatcggg 7860aagaactgga tctcctgcca ccagttggag gaatggctgt tgatgtgatg gaagtagaac 7920tccctgcgac gcgccgagca ttcatgcttg tgcttgtaca gacggccgca gtagtcgcag 7980cgttgcacgg gttgtatctc gtgaatgagt tgtacctggc ttcccttgac gagaaatttc 8040agtgggaagc cgaggcctgg cgattgtatc tcgtgcttta ctatgttgtc tgcatcggcc 8100tgttcatctt ctgtctcgat ggtggtcatg ctgacgagcc ctcgcgggag gcaagtccag 8160acctcggcgc ggcaggggcg gagctcgagg acgagagcgc gcaggctgga gctgtccagg 8220gtcctgagac gctgcggact caggttagta ggcagtgtca ggagattaac ttgcatgatc 8280ttttggaggg cgtgcgggag gttcagatag tacttgatct caacgggtcc gttggtggag 8340atgtcgatgg cttgcagggt tccgtgtccc ttgggcgcta ccaccgtgcc cttgtttttc 8400attttggacg gcggtggctc tgttgcttct tgcatgttta gaagcggtgt cgagggcgcg 8460caccgggcgg caggggcggc tcgggacccg gcggcatggc tggcagtggt acgtcggcgc 8520cgcgcgcggg taggttctgg tactgcgccc tgagaagact cgcatgcgcg acgacgcggc 8580ggttgacatc ctggatctga cgcctctggg tgaaagctac cggccccgtg agcttgaacc 8640tgaaagagag ttcaacagaa tcaatctcgg tatcgttgac ggcggcttgc ctaaggattt 8700cttgcacgtc accagagttg tcctggtagg cgatctccgc catgaactgc tcgatctctt 8760cctcttgaag atctccgcgg cccgctctct cgacggtggc cgcgaggtcg ttggagatgc 8820gcccaatgag ttgagagaat gcattcatgc ccgcctcgtt ccagacgcgg ctgtagacca 8880cggcccccac gggatctctc gcgcgcatga ccacctgggc gaggttgagc tccacgtggc 8940gggtgaagac cgcatagttg cataggcgct ggaaaaggta gttgagtgtg gtggcgatgt 9000gctcggtgac gaagaaatac atgatccatc gtctcagcgg catctcgctg acatcgccca 9060gagcttccaa gcgctccatg gcctcgtaga agtccacggc aaaattaaaa aactgggagt 9120ttcgcgcgga cacggtcaac tcctcttcca gaagacggat aagttcggcg atggtggtgc 9180gcacctcgcg ctcgaaagcc cctgggattt cttcctcaat ctcttcttct tccactaaca 9240tctcttcctc ttcaggtggg gctgcaggag gagggggaac gcggcgacgc cggcggcgca 9300cgggcagacg gtcgatgaat ctttcaatga cctctccgcg gcggcggcgc atggtttcag 9360tgacggcgcg gccgttctcg cgcggtcgca gagtaaaaac accgccgcgc atctccttaa 9420agtggtgact gggaggttct ccgtttggga gggagagggc gctgattata cattttatta 9480attggcccgt agggactgca cgcagagatc tgatcgtgtc aagatccacg ggatctgaaa 9540acctttcgac gaaagcgtct aaccagtcac agtcacaagg taggctgagt acggcttctt 9600gtgggcgggg gtggttatgt gttcggtctg ggtcttctgt ttcttcttca tctcgggaag 9660gtgagacgat gctgctggtg atgaaattaa agtaggcagt tctaagacgg cggatggtgg 9720cgaggagcac caggtctttg ggtccggctt gctggatacg caggcgattg gccattcccc 9780aagcattatc ctgacatcta gcaagatctt tgtagtagtc ttgcatgagc cgttctacgg 9840gcacttcttc ctcacccgtt ctgccatgca tacgtgtgag tccaaatccg cgcattggtt 9900gtaccagtgc caagtcagct acgactcttt cggcgaggat ggcttgctgt acttgggtaa 9960gggtggcttg aaagtcatca aaatccacaa agcggtggta agctcctgta ttaatggtgt 10020aagcacagtt ggccatgact gaccagttaa ctgtctggtg accagggcgc acgagctcgg 10080tgtatttaag gcgcgaatag gcgcgggtgt caaagatgta atcgttgcag gtgcgcacca 10140gatactggta ccctataaga aaatgcggcg gtggttggcg gtagagaggc catcgttctg 10200tagctggagc gccaggggcg aggtcttcca acataaggcg gtgatagccg tagatgtacc 10260tggacatcca ggtgattcct gcggcggtag tagaagcccg aggaaactcg cgtacgcggt 10320tccaaatgtt gcgtagcggc atgaagtagt tcattgtagg cacggtttga ccagtgaggc 10380gcgcgcagtc attgatgctc tatagacacg gagaaaatga aagcgttcag cgactcgact 10440ccgtagcctg gaggaacgtg aacgggttgg gtcgcggtgt accccggttc gagacttgta 10500ctcgagccgg ccggagccgc ggctaacgtg gtattggcac tcccgtctcg acccagccta 10560caaaaatcca ggatacggaa tcgagtcgtt ttgctggttt ccgaatggca gggaagtgag 10620tcctattttt tttttttgcc gctcagatgc atcccgtgct gcgacagatg cgcccccaac 10680aacagccccc ctcgcagcag cagcagcagc aatcacaaaa ggctgtccct gcaactactg 10740caactgccgc cgtgagcggt gcgggacagc ccgcctatga tctggacttg gaagagggcg 10800aaggactggc acgtctaggt gcgccttcac ccgagcggca tccgcgagtt caactgaaaa 10860aagattctcg cgaggcgtat gtgccccaac agaacctatt tagagacaga agcggcgagg 10920agccggagga gatgcgagct tcccgcttta acgcgggtcg tgagctgcgt cacggtttgg 10980accgaagacg agtgttgcgg gacgaggatt tcgaagttga tgaaatgaca gggatcagtc 11040ctgccagggc acacgtggct gcagccaacc ttgtatcggc ttacgagcag acagtaaagg 11100aagagcgtaa cttccaaaag tcttttaata atcatgtgcg aaccctgatt gcccgcgaag 11160aagttaccct tggtttgatg catttgtggg atttgatgga agctatcatt cagaacccta 11220ctagcaaacc tctgaccgcc cagctgtttc tggtggtgca acacagcaga gacaatgagg 11280ctttcagaga ggcgctgctg aacatcaccg aacccgaggg gagatggttg tatgatctta 11340tcaacattct acagagtatc atagtgcagg agcggagcct gggcctggcc gagaaggtgg 11400ctgccatcaa ttactcggtt ttgagcttgg gaaaatatta cgctcgcaaa atctacaaga 11460ctccatacgt tcccatagac aaggaggtga agatagatgg gttctacatg cgcatgacgc 11520tcaaggtctt gaccctgagc gatgatcttg gggtgtatcg caatgacaga atgcatcgcg 11580cggttagcgc cagcaggagg cgcgagttaa gcgacaggga actgatgcac agtttgcaaa 11640gagctctgac tggagctgga accgagggtg agaattactt cgacatggga gctgacttgc 11700agtggcagcc tagtcgcagg gctctgagcg ccgcgacggc aggatgtgag cttccttaca 11760tagaagaggc ggatgaaggc gaggaggaag agggcgagta cttggaagac tgatggcaca 11820acccgtgttt tttgctagat ggaacagcaa gcaccggatc ccgcaatgcg ggcggcgctg 11880cagagccagc cgtccggcat taactcctcg gacgattgga cccaggccat gcaacgtatc 11940atggcgttga cgactcgcaa ccccgaagcc tttagacagc aaccccaggc caaccgtcta 12000tcggccatca tggaagctgt agtgccttcc cgctctaatc ccactcatga gaaggtcctg 12060gccatcgtga acgcgttggt ggagaacaaa gctattcgtc cagatgaggc cggactggta 12120tacaacgctc tcttagaacg cgtggctcgc tacaacagta gcaatgtgca aaccaatttg 12180gaccgtatga taacagatgt acgcgaagcc gtgtctcagc gcgaaaggtt ccagcgtgat 12240gccaacctgg gttcgctggt ggcgttaaat gctttcttga gtactcagcc tgctaatgtg 12300ccgcgtggtc aacaggatta tactaacttt ttaagtgctt tgagactgat ggtatcagaa 12360gtacctcaga gcgaagtgta tcagtccggt cctgattact tctttcagac tagcagacag 12420ggcttgcaga cggtaaatct gagccaagct tttaaaaacc tttaaaggtt tgtggggagt 12480gcatgccccg gtaggagaaa gagcaaccgt gtctagcttg ttaactccga actcccgcct 12540attattactg ttggtagctc ctttcaccga cagcggtagc atcgaccgta attcctattt 12600gggttaccta ctaaacctgt atcgcgaagc catagggcaa agtcaggtgg acgagcagac 12660ctatcaagaa attacccaag tcagtcgcgc tttgggacag gaagacactg gcagtttgga 12720agccactctg aacttcttgc ttaccaatcg gtctcaaaag atccctcctc aatatgctct 12780tactgcggag gaggagagga tccttagata tgtgcagcag agcgtgggat tgtttctgat 12840gcaagagggg gcaactccga ctgcagcact ggacatgaca gcgcgaaata tggagcccag 12900catgtatgcc agtaaccgac ctttcattaa caaactgctg gactacttgc acagagctgc 12960cgctatgaac tctgattatt tcaccaatgc catcttaaac ccgcactggc tgcccccacc 13020tggtttctac acgggcgaat atgacatgcc cgaccctaat gacggatttc tgtgggacga 13080cgtggacagc gatgtttttt cacctctttc tgatcatcgc acgtggaaaa aggaaggcgg 13140cgatagaatg cattcttctg catcgctgtc cggggtcatg ggtgctaccg cggctgagcc 13200cgagtctgca agtccttttc ctagtctacc cttttctcta cacagtgtac gtagcagcga 13260agtgggtaga ataagtcgcc cgagtttaat gggcgaagag gagtatctaa acgattcctt 13320gctcagaccg gcaagagaaa aaaatttccc aaacaatgga atagaaagtt tggtggataa 13380aatgagtaga tggaagactt atgctcagga tcacagagac gagcctggga tcatggggat 13440tacaagtaga gcgagccgta gacgccagcg ccatgacaga cagaggggtc ttgtgtggga 13500cgatgaggat tcggccgatg atagcagcgt gctggacttg ggtgggagag gaaggggcaa 13560cccgtttgct catttgcgcc ctcgcttggg tggtatgttg taaaaaaaaa taaaaaaaaa 13620actcaccaag gccatggcga cgagcgtacg ttcgttcttc tttattatct gtgtctagta 13680taatgaggcg agtcgtgcta ggcggagcgg tggtgtatcc ggagggtcct cctccttcgt 13740acgagagcgt gatgcagcag cagcaggcga cggcggtgat gcaatcccca ctggaggctc 13800cctttgtgcc tccgcgatac ctggcaccta cggagggcag aaacagcatt cgttattcgg 13860aactggcacc tcagtacgat accaccaggt tgtatctggt ggacaacaag tcggcggaca 13920ttgcttctct gaactatcag aatgaccaca gcaacttctt gaccacggtg gtgcaaaaca 13980atgactttac ccctacggaa gccagcaccc agaccattaa ctttgatgaa cgatcgcggt 14040ggggcggtca gctaaagacc atcatgcata ctaacatgcc aaacgtgaac gagtatatgt 14100ttagtaacaa gttcaaagcg cgtgtgatgg tgtccagaaa acctcccgac ggtgctgcag 14160ttggggatac ttatgatcac aagcaggata ttttgaaata tgagtggttc gagtttactt 14220tgccagaagg caacttttca gttactatga ctattgattt gatgaacaat gccatcatag 14280ataattactt gaaagtgggt agacagaatg gagtgcttga aagtgacatt ggtgttaagt 14340tcgacaccag gaacttcaag ctgggatggg atcccgaaac caagttgatc atgcctggag 14400tgtatacgta tgaagccttc catcctgaca ttgtcttact gcctggctgc ggagtggatt 14460ttaccgagag tcgtttgagc aaccttcttg gtatcagaaa aaaacagcca tttcaagagg 14520gttttaagat tttgtatgaa gatttagaag gtggtaatat tccggccctc ttggatgtag 14580atgcctatga gaacagtaag aaagaacaaa aagccaaaat agaagctgct acagctgctg 14640cagaagctaa ggcaaacata gttgccagcg actctacaag ggttgctaac gctggagagg 14700tcagaggaga caattttgcg ccaacacctg ttccgactgc agaatcatta ttggccgatg 14760tgtctgaagg aacggacgtg aaactcacta ttcaacctgt agaaaaagat agtaagaata 14820gaagctataa tgtgttggaa gacaaaatca acacagccta tcgcagttgg tatctttcgt 14880acaattatgg cgatcccgaa aaaggagtgc gttcctggac attgctcacc acctcagatg 14940tcacctgcgg agcagagcag gtctactggt cgcttccaga catgatgaag gatcctgtca 15000ctttccgctc cactagacaa gtcagtaact accctgtggt

gggtgcagag cttatgcccg 15060tcttctcaaa gagcttctac aacgaacaag ctgtgtactc ccagcagctc cgccagtcca 15120cctcgcttac gcacgtcttc aaccgctttc ctgagaacca gattttaatc cgtccgccgg 15180cgcccaccat taccaccgtc agtgaaaacg ttcctgctct cacagatcac gggaccctgc 15240cgttgcgcag cagtatccgg ggagtccaac gtgtgaccgt tactgacgcc agacgccgca 15300cctgtcccta cgtgtacaag gcactgggca tagtcgcacc gcgcgtcctt tcaagccgca 15360ctttctaaaa aaaaaaaaaa tgtccattct tatctcgccc agtaataaca ccggttgggg 15420tctgcgcgct ccaagcaaga tgtacggagg cgcacgcaaa cgttctaccc aacatcctgt 15480ccgtgttcgc ggacattttc gcgctccatg gggcgccctc aagggccgca ctcgcgttcg 15540aaccaccgtc gatgatgtaa tcgatcaggt ggttgccgac gcccgtaatt atactcctac 15600tgcgcctaca tctactgtgg atgcagttat tgacagtgta gtggctgacg ctcgcaacta 15660tgctcgacgt aagagccggc gaaggcgcat tgccagacgc caccgagcta ccactgccat 15720gcgagccgca agagctctgc tacgaagagc tagacgcgtg gggcgaagag ccatgcttag 15780ggcggccaga cgtgcagctt cgggcgccag cgccggcagg tcccgcaggc aagcagccgc 15840tgtcgcagcg gcgactattg ccgacatggc ccaatcgcga agaggcaatg tatactgggt 15900gcgtgacgct gccaccggtc aacgtgtacc cgtgcgcacc cgtccccctc gcacttagaa 15960gatactgagc agtctccgat gttgtgtccc agcggcgagg atgtccaagc gcaaatacaa 16020ggaagaaatg ctgcaggtta tcgcacctga agtctacggc caaccgttga aggatgaaaa 16080aaaaccccgc aaaatcaagc gggttaaaaa ggacaaaaaa gaagaggaag atggcgatga 16140tgggctggcg gagtttgtgc gcgagtttgc cccacggcga cgcgtgcaat ggcgtgggcg 16200caaagttcga catgtgttga gacctggaac ttcggtggtc tttacacccg gcgagcgttc 16260aagcgctact tttaagcgtt cctatgatga ggtgtacggg gatgatgata ttcttgagca 16320ggcggctgac cgattaggcg agtttgctta tggcaagcgt agtagaataa cttccaagga 16380tgagacagtg tcgataccct tggatcatgg aaatcccacc cctagtctta aaccggtcac 16440tttgcagcaa gtgttacccg taactccgcg aacaggtgtt aaacgcgaag gtgaagattt 16500gtatcccact atgcaactga tggtacccaa acgccagaag ttggaggacg ttttggagaa 16560agtaaaagtg gatccagata ttcaacctga ggttaaagtg agacccatta agcaggtagc 16620gcctggtctg ggggtacaaa ctgtagacat taagattccc actgaaagta tggaagtgca 16680aactgaaccc gcaaagccta ctgccacctc cactgaagtg caaacggatc catggatgcc 16740catgcctatt acaactgacg ccgccggtcc cactcgaaga tcccgacgaa agtacggtcc 16800agcaagtctg ttgatgccca attatgttgt acacccatct attattccta ctcctggtta 16860ccgaggcact cgctactatc gcagccgaaa cagtacctcc cgccgtcgcc gcaagacacc 16920tgcaaatcgc agtcgtcgcc gtagacgcac aagcaaaccg actcccggcg ccctggtgcg 16980gcaagtgtac cgcaatggta gtgcggaacc tttgacactg ccgcgtgcgc gttaccatcc 17040gagtatcatc acttaatcaa tgttgccgct gcctccttgc agatatggcc ctcacttgtc 17100gccttcgcgt tcccatcact ggttaccgag gaagaaactc gcgccgtaga agagggatgt 17160tgggacgcgg aatgcgacgc tacaggcgac ggcgtgctat ccgcaagcaa ttgcggggtg 17220gttttttacc agccttaatt ccaattatcg ctgctgcaat tggcgcgata ccaggcatag 17280cttccgtggc ggttcaggcc tcgcaacgac attgacattg gaaaaaaacg tataaataaa 17340aaaaaaaaaa tacaatggac tctgacactc ctggtcctgt gactatgttt tcttagagat 17400ggaagacatc aatttttcat ccttggctcc gcgacacggc acgaagccgt acatgggcac 17460ctggagcgac atcggcacga gccaactgaa cgggggcgcc ttcaattgga gcagtatctg 17520gagcgggctt aaaaattttg gctcaaccat aaaaacatac gggaacaaag cttggaacag 17580cagtacagga caggcgctta gaaataaact taaagaccag aacttccaac aaaaagtagt 17640cgatgggata gcttccggca tcaatggagt ggtagatttg gctaaccagg ctgtgcagaa 17700aaagataaac agtcgtttgg acccgccgcc agcaacccca ggtgaaatgc aagtggagga 17760agaaattcct ccgccagaaa aacgaggcga caagcgtccg cgtcccgatt tggaagagac 17820gctggtgacg cgcgtagatg aaccgccttc ttatgaggaa gcaacgaagc ttggaatgcc 17880caccactaga ccgatagccc caatggccac cggggtgatg aaaccttctc agttgcatcg 17940acccgtcacc ttggatttgc cccctccccc tgctgctact gctgtacccg cttctaagcc 18000tgtcgctgcc ccgaaaccag tcgccgtagc caggtcacgt cccgggggcg ctcctcgtcc 18060aaatgcgcac tggcaaaata ctctgaacag catcgtgggt ctaggcgtgc aaagtgtaaa 18120acgccgtcgc tgcttttaat taaatatgga gtagcgctta acttgcctat ctgtgtatat 18180gtgtcattac acgccgtcac agcagcagag gaaaaaagga agaggtcgtg cgtcgacgct 18240gagttacttt caagatggcc accccatcga tgctgcccca atgggcatac atgcacatcg 18300ccggacagga tgcttcggag tacctgagtc cgggtctggt gcagttcgcc cgcgccacag 18360acacctactt caatctggga aataagttta gaaatcccac cgtagcgccg acccacgatg 18420tgaccaccga ccgtagccag cggctcatgt tgcgcttcgt gcccgttgac cgggaggaca 18480atacatactc ttacaaagtg cggtacaccc tggccgtggg cgacaacaga gtgctggata 18540tggccagcac gttctttgac attaggggtg tgttggacag aggtcccagt ttcaaaccct 18600attctggtac ggcttacaac tccctggctc ctaaaggcgc tccaaataca tctcagtgga 18660ttgcagaagg tgtaaaaaat acaactggtg aggaacacgt aacagaagag gaaaccaata 18720ctactactta cacttttggc aatgctcctg taaaagctga agctgaaatt acaaaagaag 18780gactcccagt aggtttggaa gtttcagatg aagaaagtaa accgatttat gctgataaaa 18840catatcagcc agaacctcag ctgggagatg aaacttggac tgaccttgat ggaaaaaccg 18900aaaagtatgg aggcagggct ctcaaacccg atactaagat gaaaccatgc tacgggtcct 18960ttgccaaacc tactaatgtg aaaggcggtc aggcaaaaca aaaaacaacg gagcagccaa 19020atcagaaagt cgaatatgat atcgacatgg agttttttga tgcggcatcg cagaaaacaa 19080acttaagtcc taaaattgtc atgtatgcag aaaatgtaaa tttggaaact ccagacactc 19140atgtagtgta caaacctgga acagaagaca caagttccga agctaatttg ggacaacaat 19200ctatgcccaa cagacccaac tacattggct tcagagataa ctttattgga cttatgtact 19260ataacagtac tggtaacatg ggggtgctgg ctggtcaagc gtctcagtta aatgcagtgg 19320ttgacttgca ggacagaaac acagaacttt cttaccaact cttgcttgac tctctgggcg 19380acagaaccag atactttagc atgtggaatc aggctgtgga cagttatgat cctgatgtac 19440gtgttattga aaatcatggt gtggaagatg aacttcccaa ctactgtttt ccactggacg 19500gcataggtgt tccaacaacc agttacaaat caatagttcc aaatggagac aatgcgccta 19560attggaagga acctgaagta aatggaacaa gtgagatcgg acagggtaat ttgtttgcca 19620tggaaattaa ccttcaagcc aatctatggc gaagtttcct ttattccaat gtggctctat 19680atctcccaga ctcgtacaaa tacaccccgt ccaatgtcac tcttccagaa aacaaaaaca 19740cctacgacta catgaacggg cgggtggtgc cgccatctct agtagacacc tatgtgaaca 19800ttggtgccag gtggtctctg gatgccatgg acaatgtcaa cccattcaac caccaccgta 19860acgctggctt gcgttaccga tccatgcttc tgggtaacgg acgttatgtg cctttccaca 19920tacaagtgcc tcaaaaattc ttcgctgtta aaaacctgct gcttctccca ggctcctaca 19980cttatgagtg gaactttagg aaggatgtga acatggttct acagagttcc ctcggtaacg 20040acctgcgggt agatggcgcc agcatcagtt tcacgagcat caacctctat gctacttttt 20100tccccatggc tcacaacacc gcttccaccc ttgaagccat gctgcggaat gacaccaatg 20160atcagtcatt caacgactac ctatctgcag ctaacatgct ctaccccatt cctgccaatg 20220caaccaatat tcccatttcc attccttctc gcaactgggc ggctttcaga ggctggtcat 20280ttaccagact gaaaaccaaa gaaactccct ctttggggtc tggatttgac ccctactttg 20340tctattctgg ttctattccc tacctggatg gtaccttcta cctgaaccac acttttaaga 20400aggtttccat catgtttgac tcttcagtga gctggcctgg aaatgacagg ttactatctc 20460ctaacgaatt tgaaataaag cgcactgtgg atggcgaagg ctacaacgta gcccaatgca 20520acatgaccaa agactggttc ttggtacaga tgctcgccaa ctacaacatc ggctatcagg 20580gcttctacat tccagaagga tacaaagatc gcatgtattc atttttcaga aacttccagc 20640ccatgagcag gcaggtggtt gatgaggtca attacaaaga cttcaaggcc gtcgccatac 20700cctaccaaca caacaactct ggctttgtgg gttacatggc tccgaccatg cgccaaggtc 20760aaccctatcc cgctaactat ccctatccac tcattggaac aactgccgta aatagtgtta 20820cgcagaaaaa gttcttgtgt gacagaacca tgtggcgcat accgttctcg agcaacttca 20880tgtctatggg ggcccttaca gacttgggac agaatatgct ctatgccaac tcagctcatg 20940ctctggacat gacctttgag gtggatccca tggatgagcc caccctgctt tatcttctct 21000tcgaagtttt cgacgtggtc agagtgcatc agccacaccg cggcatcatc gaggcagtct 21060acctgcgtac accgttctcg gccggtaacg ctaccacgta agaagcttct tgcttcttgc 21120aaatagcagc tgcaaccatg gcctgcggat cccaaaacgg ctccagcgag caagagctca 21180gagccattgt ccaagacctg ggttgcggac cctatttttt gggaacctac gataagcgct 21240tcccggggtt catggccccc gataagctcg cctgtgccat tgtaaatacg gccggacgtg 21300agacgggggg agagcactgg ttggctttcg gttggaaccc acgttctaac acctgctacc 21360tttttgatcc ttttggattc tcggatgatc gtctcaaaca gatttaccag tttgaatatg 21420agggtctcct gcgccgcagc gctcttgcta ccaaggaccg ctgtattacg ctggaaaaat 21480ctacccagac cgtgcagggt ccccgttctg ccgcctgcgg acttttctgc tgcatgttcc 21540ttcacgcctt tgtgcactgg cctgaccgtc ccatggacgg aaaccccacc atgaaattgc 21600taactggagt gccaaacaac atgcttcatt ctcctaaagt ccagcccacc ctgtgtgaca 21660atcaaaaagc actctaccat tttcttaata cccattcgcc ttattttcgc tcccatcgta 21720cacacatcga aagggccact gcgttcgacc gtatggatgt tcaataatga ctcatgtaaa 21780caacgtgttc aataaacatc actttatttt tttacatgta tcaaggctct gcattactta 21840tttatttaca agtcgaatgg gttctgacga gaatcagaat gacccgcagg cagtgatacg 21900ttgcggaact gatacttggg ttgccacttg aattcgggaa tcaccaactt gggaaccggt 21960atatcgggca ggatgtcact ccacagcttt ctggtcagct gcaaagctcc aagcaggtca 22020ggagccgaaa tcttgaaatc acaattagga ccagtgcttt gagcgcgaga gttgcggtac 22080accggattgc agcactgaaa caccatcagc gacggatgtc tcacgcttgc cagcacggtg 22140ggatctgcaa tcatgcccac atccagatct tcagcattgg caatgctgaa cggggtcatc 22200ttgcaggtct gcctacccat ggcgggcacc caattaggct tgtggttgca atcgcagtgc 22260agggggatca gtatcatctt ggcctgatcc tgtctgattc ctggatacac ggctctcatg 22320aaagcatcat attgcttgaa agcctgctgg gctttactac cctcggtata aaacatcccg 22380caggacctgc tcgaaaactg gttagctgca cagccggcat cattcacaca gcagcgggcg 22440tcattgttag ctatttgcac cacacttctg ccccagcggt tttgggtgat tttggttcgc 22500tcgggattct cctttaaggc tcgttgtccg ttctcgctgg ccacatccat ctcgataatc 22560tgctccttct gaatcataat attgccatgc aggcacttca gcttgccctc ataatcattg 22620cagccatgag gccacaacgc acagcctgta cattcccaat tatggtgggc gatctgagaa 22680aaagaatgta tcattccctg cagaaatctt cccatcatcg tgctcagtgt cttgtgacta 22740gtgaaagtta actggatgcc tcggtgctcc tcgtttacgt actggtgaca gatgcgcttg 22800tattgttcgt gttgctcagg cattagttta aaagaggttc taagttcgtt atccagcctg 22860tacttctcca tcagcagaca catcacttcc atgcctttct cccaagcaga caccaggggc 22920aagctaatcg gattcttaac agtgcaggca gcagctcctt tagccagagg gtcatcttta 22980gcgatcttct caatgcttct tttgccatcc ttctcaacga tgcgcacggg cgggtagctg 23040aaacccactg ctacaagttg cgcctcttct ctttcttctt cgctgtcttg actgatgtct 23100tgcatgggga tatgtttggt cttccttggc ttctttttgg ggggtatcgg aggaggagga 23160ctgtcgctcc gttccggaga cagggaggat tgtgacgttt cgctcaccat taccaactga 23220ctgtcggtag aagaacctga ccccacacgg cgacaggtgt ttctcttcgg gggcagaggt 23280ggaggcgatt gcgaagggct gcggtccgac ctggaaggcg gatgactggc agaacccctt 23340ccgcgttcgg gggtgtgctc cctgtggcgg tcgcttaact gatttccttc gcggctggcc 23400attgtgttct cctaggcaga gaaacaacag acatggaaac tcagccattg ctgtcaacat 23460cgccacgagt gccatcacat ctcgtcctca gcgacgagga aaaggagcag agcttaagca 23520ttccaccgcc cagtcctgcc accacctcta ccctagaaga taaggaggtc gacgcatctc 23580atgacatgca gaataaaaaa gcgaaagagt ctgagacaga catcgagcaa gacccgggct 23640atgtgacacc ggtggaacac gaggaagagt tgaaacgctt tctagagaga gaggatgaaa 23700actgcccaaa acaacgagca gataactatc accaagatgc tggaaatagg gatcagaaca 23760ccgactacct catagggctt gacggggaag acgcgctcct taaacatcta gcaagacagt 23820cgctcatagt caaggatgca ttattggaca gaactgaagt gcccatcagt gtggaagagc 23880tcagccgcgc ctacgagctt aacctctttt cacctcgtac tccccccaaa cgtcagccaa 23940acggcacctg cgagccaaat cctcgcttaa acttttatcc agcttttgct gtgccagaag 24000tactggctac ctatcacatc ttttttaaaa atcaaaaaat tccagtctcc tgccgcgcta 24060atcgcacccg cgccgatgcc ctactcaatc tgggacctgg ttcacgctta cctgatatag 24120cttccttgga agaggttcca aagatcttcg agggtctggg caataatgag actcgggccg 24180caaatgctct gcaaaaggga gaaaatggca tggatgagca tcacagcgtt ctggtggaat 24240tggaaggcga taatgccaga ctcgcagtac tcaagcgaag catcgaggtc acacacttcg 24300catatcccgc tgtcaacctg ccccctaaag tcatgacggc ggtcatggac cagttactca 24360ttaagcgcgc aagtcccctt tcagaagaca tgcatgaccc agatgcctgt gatgagggta 24420aaccagtggt cagtgatgag cagctaaccc gatggctggg caccgactct cccagggatt 24480tggaagagcg tcgcaagctt atgatggccg tggtgctggt taccgtagaa ctagagtgtc 24540tccgacgttt ctttaccgat tcagaaacct tgcgcaaact cgaagagaat ctgcactaca 24600cttttagaca cggctttgtg cggcaggcat gcaagatatc taacgtggaa ctcaccaacc 24660tggtttccta catgggtatt ctgcatgaga atcgcctagg acaaagcgtg ctgcacagca 24720ccctgaaggg ggaagcccgc cgtgattaca tccgcgattg tgtctatctg tacctgtgcc 24780acacgtggca aaccggcatg ggtgtatggc agcaatgttt agaagaacag aacttgaaag 24840agcttgacaa gctcttacag aaatctctta aggttctgtg gacagggttc gacgagcgca 24900ccgtcgcttc cgacctggca gacctcatct tcccagagcg tctcagggtt actttgcgaa 24960acggattgcc tgactttatg agccagagca tgcttaacaa ttttcgctct ttcatcctgg 25020aacgctccgg tatcctgccc gccacctgct gcgcactgcc ctccgacttt gtgcctctca 25080cctaccgcga gtgccccccg ccgctatgga gtcactgcta cctgttccgt ctggccaact 25140atctctccta ccactcggat gtgatcgagg atgtgagcgg agacggcttg ctggagtgtc 25200actgccgctg caatctgtgc acgccccacc ggtccctagc ttgcaacccc cagttgatga 25260gcgaaaccca gataataggc acctttgaat tgcaaggccc cagcagccaa ggcgatgggt 25320cttctcctgg gcaaagttta aaactgaccc cgggactgtg gacctccgcc tacttgcgca 25380agtttgctcc ggaagattac cacccctatg aaatcaagtt ctatgaggac caatcacagc 25440ctccaaaggc cgaactttcg gcctgcgtca tcacccaggg ggcaattctg gcccaattgc 25500aagccatcca aaaatcccgc caagaatttc tactgaaaaa gggtaagggg gtctaccttg 25560acccccagac cggcgaggaa ctcaacacaa ggttccctca ggatgtccca acgacgagaa 25620aacaagaagt tgaaggtgca gccgccgccc ccagaagata tggaggaaga ttgggacagt 25680caggcagagg aggcggagga ggacagtctg gaggacagtc tggaggaaga cagtttggag 25740gaggaaaacg aggaggcaga ggaggtggaa gaagtaaccg ccgacaaaca gttatcctcg 25800gctgcggaga caagcaacag cgctaccatc tccgctccga gtcgaggaac ccggcggcgt 25860cccagcagta gatgggacga gaccggacgc ttcccgaacc caaccagcgc ttccaagacc 25920ggtaagaagg atcggcaggg atacaagtcc tggcgggggc ataagaatgc catcatctcc 25980tgcttgcatg agtgcggggg caacatatcc ttcacgcggc gctacttgct attccaccat 26040ggggtgaact ttccgcgcaa tgttttgcat tactaccgtc acctccacag cccctactat 26100agccagcaaa tcccggcagt ctcgacagat aaagacagcg gcggcgacct ccaacagaaa 26160accagcagcg gcagttagaa aatacacaac aagtgcagca acaggaggat taaagattac 26220agccaacgag ccagcgcaaa cccgagagtt aagaaatcgg atctttccaa ccctgtatgc 26280catcttccag cagagtcggg gtcaagagca ggaactgaaa ataaaaaacc gatctctgcg 26340ttcgctcacc agaagttgtt tgtatcacaa gagcgaagat caacttcagc gcactctcga 26400ggacgccgag gctctcttca acaagtactg cgcgctgact cttaaagagt aggcagcgac 26460cgcgcttatt caaaaaaggc gggaattaca tcatcctcga catgagtaaa gaaattccca 26520cgccttacat gtggagttat caaccccaaa tgggattggc ggcaggcgcc tcccaggact 26580actccacccg catgaattgg ctcagcgccg ggccttctat gatttctcga gttaatgata 26640tacgcgccta ccgaaaccaa atacttttgg aacagtcagc tcttaccacc acgccccgcc 26700aacaccttaa tcccagaaat tggcccgccg ccctagtgta ccaggaaagt cccgctccca 26760ccactgtatt acttcctcga gacgcccagg ccgaagtcca aatgactaat gcaggtgcgc 26820agttagctgg cggctccacc ctatgtcgtc acaggcctcg gcataatata aaacgcctga 26880tgatcagagg ccgaggtatc cagctcaacg acgagtcggt gagctctccg cttggtctac 26940gaccagacgg aatctttcag attgccggct gcgggagatc ttccttcacc cctcgtcagg 27000ctgttctgac tttggaaagt tcgtcttcgc aaccccgctc gggcggaatc gggaccgttc 27060aatttgtgga ggagtttact ccctctgtct acttcaaccc cttctccgga tctcctgggc 27120attacccgga cgagttcata ccgaacttcg acgcgattag cgagtcagtg gacggctacg 27180attgatgtct ggtgacgcgg ctgagctatc tcggctgcga catctagacc actgccgccg 27240ctttcgctgc tttgcccggg aactcattga gttcatctac ttcgaactcc ccaaggatca 27300ccctcaaggt ccggcccacg gagtgcggat ttctatcgaa ggcaaaatag actctcgcct 27360gcaacgaatt ttctcccagc ggcccgtgct gatcgagcga gaccagggaa acaccacggt 27420ttccatctac tgcatttgta atcaccccgg attgcatgaa agcctttgct gtcttatgtg 27480tactgagttt aataaaaact gaattaagac tctcctacgg actgccgctt cttcaacccg 27540gattttacaa ccagaagaac gaaacttttc ctgtcgtcca ggactctgtt aacttcacct 27600ttcctactca caaactagaa gctcaacgac tacaccgctt ttccagaagc attttcccta 27660ctaatactac tttcaaaacc ggaggtgagc tccaaggtct tcctacagaa aacccttggg 27720tggaagcggg ccttgtagtg ctaggaattc ttgcgggtgg gcttgtgatt attctttgct 27780acctatacac accttgcttc actttcttag tggtgttgtg gtattggttt aaaaaatggg 27840gcccatacta gtcttgcttg ttttactttc gcttttggaa ccgggttctg ccaattacga 27900tccatgtcta gacttcgacc cagaaaactg cacacttact tttgcacccg acacaagccg 27960catctgtgga gttcatcgcc tctcttacga acttggcccc caacgacaaa aatttacctg 28020catggtggga atcaacccca tagttatcac ccagcaaagt ggagatacta agggttgcat 28080tcactgctcc tgcgattcca tcgagtgcac ctacaccctg ctgaagaccc tatgcggcct 28140aagagacctg ctaccaatga attaaaaaat gattaataaa aaatcactta cttgaaatca 28200gcaataaggt ctctgttgaa attttctccc agcagcacct cacttccctc ttcccaactc 28260tggtattcta aaccccgttc agcggcatac tttctccata ctttaaaggg gatgtcaaat 28320tttagctcct ctcctgtacc cacaatcttc atgtctttct tcccagatga ccaagagagt 28380ccggctcagt gactccttca accctgtcta cccctatgaa gatgaaagca cctcccaaca 28440cccctttata aacccagggt ttatttcccc aaatggcttc acacaaagcc caaacggagt 28500tcttacttta aaatgtttaa ccccactaac aaccacaggc ggatctctac agctaaaagt 28560gggaggggga cttacagtgg atgacaccaa cggttttttg aaagaaaaca taagtgccac 28620cacaccactc gttaagactg gtcactctat aggtttacca ctaggagccg gattgggaac 28680gaatgaaaat aaactttgta tcaaattagg acaaggactt acattcaatt caaacaacat 28740ttgcattgat gacaatatta acaccttatg gacaggagtc aaccccaccg aagccaactg 28800tcaaatcatg aactccagtg aatctaatga ttgcaaatta attctaacac tagttaaaac 28860tggagcacta gtcactgcat ttgtttatgt tataggagta tctaacaatt ttaatatgct 28920aactacacac agaaatataa attttactgc agagctgttt ttcgattcta ctggtaattt 28980actaactaga ctctcatccc tcaaaactcc acttaatcat aaatcaggac aaaacatggc 29040tactggtgcc attactaatg ctaaaggttt catgcccagc acgactgcct atcctttcaa 29100tgataattct agagaaaaag aaaactacat ttacggaact tgttactaca cagctagtga 29160tcgcactgct tttcccattg acatatctgt catgcttaac cgaagagcaa taaatgacga 29220gacatcatat tgtattcgta taacttggtc ctggaacaca ggagatgccc cagaggtgca 29280aacctctgct acaaccctag tcacctcccc atttaccttt tactacatca gagaagacga 29340ctgacaaata aagtttaact tgtttatttg aaaatcaatt cacaaaatcc gagtagttat 29400tttgcctccc ccttcccatt taacagaata caccaatctc tccccacgca cagctttaaa 29460catttggata ccattagata tagacatggt tttagattcc acattccaaa cagtttcaga 29520gcgagccaat ctggggtcag tgatagataa aaatccatcg ggatagtctt ttaaagcgct 29580ttcacagtcc aactgctgcg gatgcgactc cggagtctgg atcacggtca tctggaagaa 29640gaacgatggg aatcataatc cgaaaacggt atcggacgat tgtgtctcat caaacccaca 29700agcagccgct gtctgcgtcg ctccgtgcga ctgctgttta tgggatcagg gtccacagtg 29760tcctgaagca tgattttaat agcccttaac atcaactttc tggtgcgatg cgcgcagcaa 29820cgcattctga tttcactcaa atctttgcag taggtacaac acattattac aatattgttt 29880aataaaccat aattaaaagc gctccagcca aaactcatat ctgatataat cgcccctgca 29940tgaccatcat accaaagttt aatataaatt aaatgacgtt ccctcaaaaa cacactaccc 30000acatacatga tctcttttgg catgtgcata ttaacaatct gtctgtacca tggacaacgt 30060tggttaatca tgcaacccaa tataaccttc cggaaccaca

ctgccaacac cgctccccca 30120gccatgcatt gaagtgaacc ctgctgatta caatgacaat gaagaaccca attctctcga 30180ccgtgaatca cttgagaatg aaaaatatct atagtggcac aacatagaca taaatgcatg 30240catcttctca taatttttaa ctcctcagga tttagaaaca tatcccaggg aataggaagc 30300tcttgcagaa cagtaaagct ggcagaacaa ggaagaccac gaacacaact tacactatgc 30360atagtcatag tatcacaatc tggcaacagc gggtggtctt cagtcataga agctcgggtt 30420tcattttcct cacaacgtgg taactgggct ctggtgtaag ggtgatgtct ggcgcatgat 30480gtcgagcgtg cgcgcaacct tgtcataatg gagttgcttc ctgacattct cgtattttgt 30540atagcaaaac gcggccctgg cagaacacac tcttcttcgc cttctatcct gccgcttagc 30600gtgttccgtg tgatagttca agtacaacca cactcttaag ttggtcaaaa gaatgctggc 30660ttcagttgta atcaaaactc catcgcatct aatcgttctg aggaaatcat ccaagcaatg 30720caactggatt gtgtttcaag caggagagga gagggaagag acggaagaac catgttaatt 30780tttattccaa acgatctcgc agtacttcaa attgtagatc gcgcagatgg catctctcgc 30840ccccactgtg ttggtgaaaa agcacagcta gatcaaaaga aatgcgattt tcaaggtgct 30900caacggtggc ttccagcaaa gcctccacgc gcacatccaa gaacaaaaga ataccaaaag 30960aaggagcatt ttctaactcc tcaatcatca tattacattc ctgcaccatt cccagataat 31020tttcagcttt ccagccttga attattcgtg tcagttcttg tggtaaatcc aatccacaca 31080ttacaaacag gtcccggagg gcgccctcca ccaccattct taaacacacc ctcataatga 31140caaaatatct tgctcctgtg tcacctgtag cgaattgaga atggcaacat caattgacat 31200gcccttggct ctaagttctt ctttaagttc tagttgtaaa aactctctca tattatcacc 31260aaactgctta gccagaagcc ccccgggaac aagagcaggg gacgctacag tgcagtacaa 31320gcgcagacct ccccaattgg ctccagcaaa aacaagattg gaataagcat attgggaacc 31380gccagtaata tcatcgaagt tgctggaaat ataatcaggc agagtttctt gtaaaaattg 31440aataaaagaa aaatttgcca aaaaaacatt caaaacctct gggatgcaaa tgcaataggt 31500taccgcgctg cgctccaaca ttgttagttt tgaattagtc tgcaaaaata aaaaaaaaaa 31560caagcgtcat atcatagtag cctgacgaac agatggataa atcagtcttt ccatcacaag 31620acaagccaca gggtctccag ctcgaccctc gtaaaacctg tcatcatgat taaacaacag 31680caccgaaagt tcctcgcggt gaccagcatg aataattctt gatgaagcat acaatccaga 31740catgttagca tcagttaacg agaaaaaaca gccaacatag cctttgggta taattatgct 31800taatcgtaag tatagcaaag ccacccctcg cggatacaaa gtaaaaggca caggagaata 31860aaaaatataa ttatttctct gctgctgttc aggcaacgtc gcccccggtc cctctaaata 31920cacatacaaa gcctcatcag ccatggctta ccagacaaag tacagcgggc acacaaagca 31980caagctctaa agtgactctc caacctctcc acaatatata tatacacaag ccctaaactg 32040acgtaatggg agtaaagtgt aaaaaatccc gccaaaccca acacacaccc cgaaactgcg 32100tcaccaggga aaagtacagt ttcacttccg caatcccaac aggcgtaact tcctctttct 32160cacggtacgt gatatcccac taacttgcaa cgtcattttc ccacggtcgc accgcccctt 32220ttagccgtta accccacagc caatcaccac acgatccaca ctttttaaaa tcacctcatt 32280tacatattgg caccattcca tctataaggt atattatata gatag 32325234794DNAAdenovirus 2ctatctatat aatatacctt atagatggaa tggtgccaat atgtaaatga ggtgatttta 60aaaagtgtgg atcgtgtggt gattggctgt ggggttaacg gctaaaaggg gcggtgcgac 120cgtgggaaaa tgacgttttg tgggggtgga gtttttttgc aagttgtcgc gggaaatgtg 180acgcataaaa aggctttttt ctcacggaac tacttagttt tcccacggta tttaacagga 240aatgaggtag ttttgaccgg atgcaagtga aaattgttga ttttcgcgcg aaaactgaat 300gaggaagtgt ttttctgaat aatgtggtat ttatggcagg gtggagtatt tgttcagggc 360caggtagact ttgacccatt acgtggaggt ttcgattacc gtgtttttta cctgaatttc 420cgcgtaccgt gtcaaagtct tctgttttta cgtaggtgtc agctgatcgc tagggtattt 480atacctcagg gtttgtgtca agaggccact cttgagtgcc agcgagaaga gttttctcct 540ctgcgccggc agtttaataa taaaaaaatg agagatttgc gatttctgcc tcaggaaata 600atctctgctg agactggaaa tgaaatattg gagcttgtgg tgcacgccct gatgggagac 660gatccggagc cacctgtgca gctttttgag cctcctacgc ttcaggaact gtatgattta 720gaggtagagg gatcggagga ttctaatgag gaagctgtaa atggcttttt taccgattct 780atgcttttag ctgctaatga agggttagaa ttagatccgc ctttggacac ttttgatact 840ccaggggtaa ttgtggaaag cggtacaggt gtaagaaaat tacctgattt gagttccgtg 900gactgtgatt tgcactgcta tgaagacggg tttcctccga gtgatgagga ggaccatgaa 960aaggagcagt ccatgcagac tgcagcgggt gagggagtga aggctgccaa tgttggtttt 1020cagttggatt gcccggagct tcctggacat ggctgtaagt cttgtgaatt tcacaggaaa 1080aatactggag taaaggaact gttatgttcg ctttgttata tgagaacgca ctgccacttt 1140atttacagta agtgtgttta agttaaaatt taaaggaata tgctgttttt cacatgtata 1200ttgagtgtga gttttgtgct tcttattata ggtcctgtgt ctgatgctga tgaatcacca 1260tctcctgatt ctactacctc acctcctgag attcaagcac ctgttcctgt ggacgtgcgc 1320aagcccattc ctgtgaagct taagcctggg aaacgtccag cagtggaaaa acttgaggac 1380ttgttacagg gtggggacgg acctttggac ttgagtacac ggaaacgtcc aagacaataa 1440gtgttccata tccgtgttta cttaaggtga cgtcaatatt tgtgtgacag tgcaatgtaa 1500taaaaatatg ttaactgttc actggttttt attgcttttt gggcggggac tcaggtatat 1560aagtagaagc agacctgtgt ggttagctca taggagctgg ctttcatcca tggaggtttg 1620ggccattttg gaagacctta ggaagactag gcaactgtta gagaacgctt cggacggagt 1680ctccggtttt tggagattct ggttcgctag tgaattagct agggtagttt ttaggataaa 1740acaggactat aaacaagaat ttgaaaagtt gttggtagat tgcccaggac tttttgaagc 1800tcttaatttg ggccatcagg ttcactttaa agaaaaagtt ttatcagttt tagacttttc 1860aaccccaggt agaactgctg ctgctgtggc ttttcttact tttatattag ataaatggat 1920cccgcagact catttcagca ggggatacgt tttggatttc atagccacag cattgtggag 1980aacatggaag gttcgcaaga tgaggacaat cttaggttac tggccagtgc agcctttggg 2040tgtagcggga atcctgaggc atccaccggt catgccagcg gttctggagg aggaacagca 2100agaggacaac ccgagagccg gcctggaccc tccagtggag gaggcggagt agctgacttg 2160tctcctgaac tgcaacgggt gcttactgga tctacgtcca ctggacggga taggggcgtt 2220aagagggaga gggcatctag tggtactgat gctagatctg agttggcttt aagtttaatg 2280agtcgcagac gtcctgaaac catttggtgg catgaggttc agaaagaggg aagggatgaa 2340gtttctgtat tgcaggagaa atattcactg gaacaggtga aaacatgttg gttggagcct 2400gaggatgatt gggaggtggc cattaaaaat tatgccaaga tagctttgag gcctgataaa 2460cagtataaga ttactagacg gattaatatc cggaatgctt gttacatatc tggaaatggg 2520gctgaggtgg taatagatac tcaagacaag gcagttatta gatgctgcat gatggatatg 2580tggcctgggg tagtcggtat ggaagcagta acttttgtaa atgttaagtt taggggagat 2640ggttataatg gaatagtgtt tatggccaat accaaactta tattgcatgg ttgtagcttt 2700tttggtttca acaatacctg tgtagatgcc tggggacagg ttagtgtacg gggatgtagt 2760ttctatgcgt gttggattgc cacagctggc agaaccaaga gtcaattgtc tctgaagaaa 2820tgcatatttc aaagatgtaa cctgggcatt ctgaatgaag gcgaagcaag ggtccgccac 2880tgcgcttcta cagatactgg atgttttatt ttgattaagg gaaatgccag cgtaaagcat 2940aacatgattt gcggtgcttc cgatgagagg ccttatcaaa tgctcacttg tgctggtggg 3000cattgtaata tgctggctac tgtgcatatt gtttcccatc aacgcaaaaa atggcctgtt 3060tttgatcaca atgtgatgac gaagtgtacc atgcatgcag gtgggcgtag aggaatgttt 3120atgccttacc agtgtaacat gaatcatgtg aaagtgttgt tggaaccaga tgccttttcc 3180agaatgagcc taacaggaat ttttgacatg aacatgcaaa tctggaagat cctgaggtat 3240gatgatacga gatcgagggt acgcgcatgc gaatgcggag gcaagcatgc caggttccag 3300ccggtgtgtg tagatgtgac tgaagatctc agaccggatc atttggttat tgcccgcact 3360ggagcagagt tcggatccag tggagaagaa actgactaag gtgagtattg ggaaaacttt 3420ggggtgggat tttcagatgg acagattgag taaaaatttg ttttttctgt cttgcagctg 3480tcatgagtgg aaacgcttct tttaaggggg gagtcttcag cccttatctg acagggcgtc 3540tcccatcctg ggcaggagtt cgtcagaatg ttatgggatc tactgtggat ggaagacccg 3600tccaacccgc caattcttca acgctgacct atgctacttt aagttcttca cctttggacg 3660cagctgcagc tgccgccgcc gcttctgttg ccgctaacac tgtgcttgga atgggttact 3720atggaagcat catggctaat tccacttcct ctaataaccc ttctaccctg actcaggaca 3780agttacttgt ccttttggcc cagctggagg ctttgaccca acgtctgggt gaactttctc 3840agcaggtggt cgagttgcga gtacaaactg agtctgctgt cggcacggca aagtctaaat 3900aaaaaaatcc cagaatcaat gaataaataa acaagcttgt tgttgattta aaatcaagtg 3960tttttatttc atttttcgcg cacggtatgc cctagaccac cgatctctat cattgagaac 4020tcggtggatt ttttccagga tcctatagag gtgggattga atgtttagat acatgggcat 4080taggccgtct ttggggtgga gatagctcca ttgaagggat tcatgctccg gggtagtgtt 4140gtaaatcacc cagtcataac aaggtcgcag tgcatggtgt tgcacaatat cttttagaag 4200taggctgatt gccacagata agcccttggt gtaggtgttt acaaaccggt tgagctggga 4260tgggtgcatt cggggtgaaa ttatgtgcat tttggattgg atttttaagt tggcaatatt 4320gccgccaaga tcccgtcttg ggttcatgtt atgaaggacc accaagacgg tgtatccggt 4380acatttagga aatttatcgt gcagcttgga tggaaaagcg tggaaaaatt tggagacacc 4440cttgtgtcct ccaagatttt ccatgcactc atccatgata atagcaatgg ggccgtgggc 4500agcggcgcgg gcaaacacgt tccgtgggtc tgacacatca tagttatgtt cctgagttaa 4560atcatcataa gccattttaa tgaatttggg gcggagagta ccagattggg gtatgaatgt 4620tccttcgggc cccggagcat agttcccctc acagatttgc atttcccaag ctttcagttc 4680cgagggtgga atcatgtcca cctggggggc tatgaaaaac accgtttctg gggcgggggt 4740gattaattgt gatgatagca aatttctgag caattgagat ttgccacatc cggtggggcc 4800ataaatgatt ccgattacgg gttgcaggtg gtagtttagg gaacggcaac tgccgtcttc 4860tcgaagcaag ggggccacct cgttcatcat ttcccttaca tgcatatttt cccgcaccaa 4920atccattagg aggcgctctc ctcctagtga tagaagttct tgtagtgagg aaaagttttt 4980cagcggtttc agaccgtcag ccatgggcat tttggagaga gtttgctgca aaagttctag 5040tctgttccac agttcagtga tgtgttctat ggcatctcga tccagcagac ctcctcgttt 5100cgcgggtttg gacggctcct ggaatagggt atgagacgat gggcgtccag cgctgccagg 5160gttcggtcct tccagggtct cagtgttcga gtcagggttg tttccgtcac agtgaagggg 5220tgtgcgcctg cttgggcgct tgccagggtg cgcttcagac tcatcctgct ggtcgaaaac 5280ttctgtcgct tggcgccctg tatgtcggcc aagtagcagt ttaccatgag ttcgtagttg 5340agcgcctcgg ctgcgtggcc tttggcgcgg agcttacctt tggaagtttt cttgcatacc 5400gggcagtata ggcatttcag cgcatacaac ttgggcgcaa ggaaaacgga ttctggggag 5460tatgcatctg cgccgcagga ggcgcaaaca gtttcacatt ccaccagcca ggttaaatcc 5520ggttcattgg ggtcaaaaac aagttttccg ccatattttt tgatgcgttt cttacctttg 5580gtctccatga gttcgtgtcc tcgttgagtg acaaacaggc tgtccgtgtc cccgtagact 5640gattttacag gcctcttctc cagtggagtg cctcggtctt cttcgtacag gaactctgac 5700cactctgata caaaggcgcg cgtccaggcc agcacaaagg aggctatgtg ggaggggtag 5760cgatcgttgt caaccagggg gtccaccttt tccaaagtat gcaaacacat gtcaccctct 5820tcaacatcca ggaatgtgat tggcttgtag gtgtatttca cgtgacctgg ggtccccgct 5880gggggggtat aaaagggggc ggttctttgc tcttcctcac tgtcttccgg atcgctgtcc 5940aggaacgtca gctgttgggg taggtattcc ctctcgaagg cgggcatgac ctctgcactc 6000aggttgtcag tttctaagaa cgaggaggat ttgatattga cagtgccggt tgagatgcct 6060ttcatgaggt tttcgtccat ttggtcagaa aacacaattt ttttattgtc aagtttggtg 6120gcaaatgatc catacagggc gttggataaa agtttggcaa tggatcgcat ggtttggttc 6180ttttccttgt ccgcgcgctc tttggcggcg atgttgagtt ggacatactc gcgtgccagg 6240cacttccatt cggggaagat agttgttaat tcatctggca cgattctcac ttgccaccct 6300cgattatgca aggtaattaa atccacactg gtggccacct cgcctcgaag gggttcattg 6360gtccaacaga gcctacctcc tttcctagaa cagaaagggg gaagtgggtc tagcataagt 6420tcatcgggag ggtctgcatc catggtaaag attcccggaa gtaaatcctt atcaaaatag 6480ctgatgggag tggggtcatc taaggccatt tgccattctc gagctgccag tgcgcgctca 6540tatgggttaa ggggactgcc ccatggcatg ggatgggtga gtgcagaggc atacatgcca 6600cagatgtcat agacgtagat gggatcctca aagatgccta tgtaggttgg atagcatcgc 6660ccccctctga tacttgctcg cacatagtca tatagttcat gtgatggcgc tagcagcccc 6720ggacccaagt tggtgcgatt gggtttttct gttctgtaga cgatctggcg aaagatggcg 6780tgagaattgg aagagatggt gggtctttga aaaatgttga aatgggcatg aggtagacct 6840acagagtctc tgacaaagtg ggcataagat tcttgaagct tggttaccag ttcggcggtg 6900acaagtacgt ctagggcgca gtagtcaagt gtttcttgaa tgatgtcata acctggttgg 6960tttttctttt cccacagttc gcggttgaga aggtattctt cgcgatcctt ccagtactct 7020tctagcggaa acccgtcttt gtctgcacgg taagatccta gcatgtagaa ctgattaact 7080gccttgtaag ggcagcagcc cttctctacg ggtagagagt atgcttgagc agcttttcgt 7140agcgaagcgt gagtaagggc aaaggtgtct ctgaccatga ctttgagaaa ttggtatttg 7200aagtcgatgt cgtcacaggc tccctgttcc cagagttgga agtctacccg tttcttgtag 7260gcggggttgg gcaaagcgaa agtaacatca ttgaagagaa tcttaccggc tctgggcata 7320aaattgcgag tgatgcgaaa aggctgtggt acttccgctc gattgttgat cacctgggca 7380gctaggacga tctcgtcgaa accgttgatg ttgtgtccta cgatgtataa ttctatgaaa 7440cgcggcgtgc ctctgacgtg aggtagctta ctgagctcat caaaggttag gtctgtgggg 7500tcagataagg cgtagtgttc gagagcccat tcgtgcaggt gaggatttgc atgtaggaat 7560gatgaccaaa gatctaccgc cagtgctgtt tgtaactggt cccgatactg acgaaaatgc 7620cggccaattg ccattttttc tggagtgaca cagtagaagg ttctggggtc ttgttgccat 7680cgatcccact tgagtttaat ggctagatcg tgggccatgt tgacgagacg ctcttctcct 7740gagagtttca tgaccagcat gaaaggaact agttgtttgc caaaggatcc catccaggtg 7800taagtttcca catcgtaggt caggaagagt ctttctgtgc gaggatgaga gccgatcggg 7860aagaactgga tttcctgcca ccagttggag gattggctgt tgatgtgatg gaagtagaag 7920tttctgcggc gcgccgagca ttcgtgtttg tgcttgtaca gacggccgca gtagtcgcag 7980cgttgcacgg gttgtatctc gtgaatgagt tgtacctggc ttcccttgac gagaaatttc 8040agtgggaagc cgaggcctgg cgattgtatc tcgtgctctt ctatattcgc tgtatcggcc 8100tgttcatctt ctgtttcgat ggtggtcatg ctgacgagcc cccgcgggag gcaagtccag 8160acctcggcgc gggaggggcg gagctgaagg acgagagcgc gcaggctgga gctgtccaga 8220gtcctgagac gctgcggact caggttagta ggtagggaca gaagattaac ttgcatgatc 8280ttttccaggg cgtgcgggag gttcagatgg tacttgattt ccacaggttc gtttgtagag 8340acgtcaatgg cttgcagggt tccgtgtcct ttgggcgcca ctaccgtacc tttgtttttt 8400cttttgatcg gtggtggctc tcttgcttct tgcatgctca gaagcggtga cggggacgcg 8460cgccgggcgg cagcggttgt tccggacccg agggcatggc tggtagtggc acgtcggcgc 8520cgcgcacggg caggttctgg tactgcgctc tgagaagact tgcgtgcgcc accacgcgtc 8580gattgacgtc ttgtatctga cgtctctggg tgaaagctac cggccccgtg agcttgaacc 8640tgaaagagag ttcaacagaa tcaatttcgg tatcgttaac ggcagcttgt ctcagtattt 8700cttgtacgtc accagagttg tcctggtagg cgatctccgc catgaactgc tcgatttctt 8760cctcctgaag atctccgcga cccgctcttt cgacggtggc cgcgaggtca ttggagatac 8820ggcccatgag ttgggagaat gcattcatgc ccgcctcgtt ccagacgcgg ctgtaaacca 8880cggccccctc ggagtctctt gcgcgcatca ccacctgagc gaggttaagc tccacgtgtc 8940tggtgaagac cgcatagttg cataggcgct gaaaaaggta gttgagtgtg gtggcaatgt 9000gttcggcgac gaagaaatac atgatccatc gtctcagcgg catttcgcta acatcgccca 9060gagcttccaa gcgctccatg gcctcgtaga agtccacggc aaaattaaaa aactgggagt 9120ttcgcgcgga cacggtcaat tcctcctcga gaagacggat gagttcggct atggtggccc 9180gtacttcgcg ttcgaaggct cccgggatct cttcttcctc ttctatctct tcttccacta 9240acatctcttc ttcgtcttca ggcgggggcg gagggggcac gcggcgacgt cgacggcgca 9300cgggcaaacg gtcgatgaat cgttcaatga cctctccgcg gcggcggcgc atggtttcag 9360tgacggcgcg gccgttctcg cgcggtcgca gagtaaaaac accgccgcgc atctccttaa 9420agtggtgact gggaggttct ccgtttggga gggagagggc gctgattata cattttatta 9480attggcccgt agggactgca cgcagagatc tgatcgtgtc aagatccacg ggatctgaaa 9540acctttcgac gaaagcgtct aaccagtcac agtcacaagg taggctgagt acggcttctt 9600gtgggcgggg gtggttatgt gttcggtctg ggtcttctgt ttcttcttca tctcgggaag 9660gtgagacgat gctgctggtg atgaaattaa agtaggcagt tctaagacgg cggatggtgg 9720cgaggagcac caggtctttg ggtccggctt gctggatacg caggcgattg gccattcccc 9780aagcattatc ctgacatcta gcaagatctt tgtagtagtc ttgcatgagc cgttctacgg 9840gcacttcttc ctcacccgtt ctgccatgca tacgtgtgag tccaaatccg cgcattggtt 9900gtaccagtgc caagtcagct acgactcttt cggcgaggat ggcttgctgt acttgggtaa 9960gggtggcttg aaagtcatca aaatccacaa agcggtggta agctcctgta ttaatggtgt 10020aagcacagtt ggccatgact gaccagttaa ctgtctggtg accagggcgc acgagctcgg 10080tgtatttaag gcgcgaatag gcgcgggtgt caaagatgta atcgttgcag gtgcgcacca 10140gatactggta ccctataaga aaatgcggcg gtggttggcg gtagagaggc catcgttctg 10200tagctggagc gccaggggcg aggtcttcca acataaggcg gtgatagccg tagatgtacc 10260tggacatcca ggtgattcct gcggcggtag tagaagcccg aggaaactcg cgtacgcggt 10320tccaaatgtt gcgtagcggc atgaagtagt tcattgtagg cacggtttga ccagtgaggc 10380gcgcgcagtc attgatgctc tatagacacg gagaaaatga aagcgttcag cgactcgact 10440ccgtagcctg gaggaacgtg aacgggttgg gtcgcggtgt accccggttc gagacttgta 10500ctcgagccgg ccggagccgc ggctaacgtg gtattggcac tcccgtctcg acccagccta 10560caaaaatcca ggatacggaa tcgagtcgtt ttgctggttt ccgaatggca gggaagtgag 10620tcctattttt tttttttgcc gctcagatgc atcccgtgct gcgacagatg cgcccccaac 10680aacagccccc ctcgcagcag cagcagcagc aatcacaaaa ggctgtccct gcaactactg 10740caactgccgc cgtgagcggt gcgggacagc ccgcctatga tctggacttg gaagagggcg 10800aaggactggc acgtctaggt gcgccttcac ccgagcggca tccgcgagtt caactgaaaa 10860aagattctcg cgaggcgtat gtgccccaac agaacctatt tagagacaga agcggcgagg 10920agccggagga gatgcgagct tcccgcttta acgcgggtcg tgagctgcgt cacggtttgg 10980accgaagacg agtgttgcgg gacgaggatt tcgaagttga tgaaatgaca gggatcagtc 11040ctgccagggc acacgtgtct gcagccaacc ttgtatcggc ttacgagcag acagtaaagg 11100aagagcgtaa cttccaaaag tcttttaata atcatgtgcg aaccctgatt gcccgcgaag 11160aagttaccct tggtttgatg catttgtggg atttgatgga agctatcatt cagaacccta 11220ctagcaaacc tctgaccgcc cagctgtttc tggtggtgca acacagcaga gacaatgagg 11280ctttcagaga ggcgctgctg aacatcaccg aacccgaggg gagatggttg tatgatctta 11340tcaacattct acagagtatc atagtgcagg agcggagcct gggcctggcc gagaaggtgg 11400ctgccatcaa ttactcggtt ttgagcttgg gaaaatatta cgctcgcaaa atctacaaga 11460ctccatacgt tcccatagac aaggaggtga agatagatgg gttctacatg cgcatgacgc 11520tcaaggtctt gaccctgagc gatgatcttg gggtgtatcg caatgacaga atgcatcgcg 11580cggttagcgc cagcaggagg cgcgagttaa gcgacaggga actgatgcac agtttgcaaa 11640gagctctgac tggagctgga accgagggtg agaattactt cgacatggga gctgacttgc 11700agtggcagcc tagtcgcagg gctctgagcg ccgcgacggc aggatgtgag cttccttaca 11760tagaagaggc ggatgaaggc gaggaggaag agggcgagta cttggaagac tgatggcaca 11820acccgtgttt tttgctagat ggaacagcaa gcaccggatc ccgcaatgcg ggcggcgctg 11880cagagccagc cgtccggcat taactcctcg gacgattgga cccaggccat gcaacgtatc 11940atggcgttga cgactcgcaa ccccgaagcc tttagacagc aaccccaggc caaccgtcta 12000tcggccatca tggaagctgt agtgccttcc cgctctaatc ccactcatga gaaggtcctg 12060gccatcgtga acgcgttggt ggagaacaaa gctattcgtc cagatgaggc cggactggta 12120tacaacgctc tcttagaacg cgtggctcgc tacaacagta gcaatgtgca aaccaatttg 12180gaccgtatga taacagatgt acgcgaagcc gtgtctcagc gcgaaaggtt ccagcgtgat 12240gccaacctgg gttcgctggt ggcgttaaat gctttcttga gtactcagcc tgctaatgtg 12300ccgcgtggtc aacaggatta tactaacttt ttaagtgctt tgagactgat ggtatcagaa 12360gtacctcaga gcgaagtgta tcagtccggt cctgattact tctttcagac tagcagacag 12420ggcttgcaga cggtaaatct gagccaagct tttaaaaacc ttaaaggttt gtggggagtg 12480catgccccgg taggagaaag agcaaccgtg tctagcttgt taactccgaa ctcccgccta 12540ttattactgt tggtagctcc tttcaccgac agcggtagca tcgaccgtaa ttcctatttg 12600ggttacctac taaacctgta tcgcgaagcc atagggcaaa gtcaggtgga cgagcagacc 12660tatcaagaaa ttacccaagt cagtcgcgct ttgggacagg aagacactgg cagtttggaa 12720gccactctga acttcttgct taccaatcgg tctcaaaaga tccctcctca atatgctctt 12780actgcggagg aggagaggat

ccttagatat gtgcagcaga gcgtgggatt gtttctgatg 12840caagaggggg caactccgac tgcagcactg gacatgacag cgcgaaatat ggagcccagc 12900atgtatgcca gtaaccgacc tttcattaac aaactgctgg actacttgca cagagctgcc 12960gctatgaact ctgattattt caccaatgcc atcttaaacc cgcactggct gcccccacct 13020ggtttctaca cgggcgaata tgacatgccc gaccctaatg acggatttct gtgggacgac 13080gtggacagcg atgttttttc acctctttct gatcatcgca cgtggaaaaa ggaaggcggc 13140gatagaatgc attcttctgc atcgctgtcc ggggtcatgg gtgctaccgc ggctgagccc 13200gagtctgcaa gtccttttcc tagtctaccc ttttctctac acagtgtacg tagcagcgaa 13260gtgggtagaa taagtcgccc gagtttaatg ggcgaagagg agtatctaaa cgattccttg 13320ctcagaccgg caagagaaaa aaatttccca aacaatggaa tagaaagttt ggtggataaa 13380atgagtagat ggaagactta tgctcaggat cacagagacg agcctgggat catggggatt 13440acaagtagag cgagccgtag acgccagcgc catgacagac agaggggtct tgtgtgggac 13500gatgaggatt cggccgatga tagcagcgtg ctggacttgg gtgggagagg aaggggcaac 13560ccgtttgctc atttgcgccc tcgcttgggt ggtatgttgt aaaaaaaaat aaaaaaaaaa 13620ctcaccaagg ccatggcgac gagcgtacgt tcgttcttct ttattatctg tgtctagtat 13680aatgaggcga gtcgtgctag gcggagcggt ggtgtatccg gagggtcctc ctccttcgta 13740cgagagcgtg atgcagcagc agcaggcgac ggcggtgatg caatccccac tggaggctcc 13800ctttgtgcct ccgcgatacc tggcacctac ggagggcaga aacagcattc gttattcgga 13860actggcacct cagtacgata ccaccaggtt gtatctggtg gacaacaagt cggcggacat 13920tgcttctctg aactatcaga atgaccacag caacttcttg accacggtgg tgcaaaacaa 13980tgactttacc cctacggaag ccagcaccca gaccattaac tttgatgaac gatcgcggtg 14040gggcggtcag ctaaagacca tcatgcatac taacatgcca aacgtgaacg agtatatgtt 14100tagtaacaag ttcaaagcgc gtgtgatggt gtccagaaaa cctcccgacg gtgctgcagt 14160tggggatact tatgatcaca agcaggatat tttgaaatat gagtggttcg agtttacttt 14220gccagaaggc aacttttcag ttactatgac tattgatttg atgaacaatg ccatcataga 14280taattacttg aaagtgggta gacagaatgg agtgcttgaa agtgacattg gtgttaagtt 14340cgacaccagg aacttcaagc tgggatggga tcccgaaacc aagttgatca tgcctggagt 14400gtatacgtat gaagccttcc atcctgacat tgtcttactg cctggctgcg gagtggattt 14460taccgagagt cgtttgagca accttcttgg tatcagaaaa aaacagccat ttcaagaggg 14520ttttaagatt ttgtatgaag atttagaagg tggtaatatt ccggccctct tggatgtaga 14580tgcctatgag aacagtaaga aagaacaaaa agccaaaata gaagctgcta cagctgctgc 14640agaagctaag gcaaacatag ttgccagcga ctctacaagg gttgctaacg ctggagaggt 14700cagaggagac aattttgcgc caacacctgt tccgactgca gaatcattat tggccgatgt 14760gtctgaagga acggacgtga aactcactat tcaacctgta gaaaaagata gtaagaatag 14820aagctataat gtgttggaag acaaaatcaa cacagcctat cgcagttggt atctttcgta 14880caattatggc gatcccgaaa aaggagtgcg ttcctggaca ttgctcacca cctcagatgt 14940cacctgcgga gcagagcagg tctactggtc gcttccagac atgatgaagg atcctgtcac 15000tttccgctcc actagacaag tcagtaacta ccctgtggtg ggtgcagagc ttatgcccgt 15060cttctcaaag agcttctaca acgaacaagc tgtgtactcc cagcagctcc gccagtccac 15120ctcgcttacg cacgtcttca accgctttcc tgagaaccag attttaatcc gtccgccggc 15180gcccaccatt accaccgtca gtgaaaacgt tcctgctctc acagatcacg ggaccctgcc 15240gttgcgcagc agtatccggg gagtccaacg tgtgaccgtt actgacgcca gacgccgcac 15300ctgtccctac gtgtacaagg cactgggcat agtcgcaccg cgcgtccttt caagccgcac 15360tttctaaaaa aaaaaaaaat gtccattctt atctcgccca gtaataacac cggttggggt 15420ctgcgcgctc caagcaagat gtacggaggc gcacgcaaac gttctaccca acatcctgtc 15480cgtgttcgcg gacattttcg cgctccatgg ggcgccctca agggccgcac tcgcgttcga 15540accaccgtcg atgatgtaat cgatcaggtg gttgccgacg cccgtaatta tactcctact 15600gcgcctacat ctactgtgga tgcagttatt gacagtgtag tggctgacgc tcgcaactat 15660gctcgacgta agagccggcg aaggcgcatt gccagacgcc accgagctac cactgccatg 15720cgagccgcaa gagctctgct acgaagagct agacgcgtgg ggcgaagagc catgcttagg 15780gcggccagac gtgcagcttc gggcgccagc gccggcaggt cccgcaggca agcagccgct 15840gtcgcagcgg cgactattgc cgacatggcc caatcgcgaa gaggcaatgt atactgggtg 15900cgtgacgctg ccaccggtca acgtgtaccc gtgcgcaccc gtccccctcg cacttagaag 15960atactgagca gtctccgatg ttgtgtccca gcggcgagga tgtccaagcg caaatacaag 16020gaagaaatgc tgcaggttat cgcacctgaa gtctacggcc aaccgttgaa ggatgaaaaa 16080aaaccccgca aaatcaagcg ggttaaaaag gacaaaaaag aagaggaaga tggcgatgat 16140gggctggcgg agtttgtgcg cgagtttgcc ccacggcgac gcgtgcaatg gcgtgggcgc 16200aaagttcgac atgtgttgag acctggaact tcggtggtct ttacacccgg cgagcgttca 16260agcgctactt ttaagcgttc ctatgatgag gtgtacgggg atgatgatat tcttgagcag 16320gcggctgacc gattaggcga gtttgcttat ggcaagcgta gtagaataac ttccaaggat 16380gagacagtgt cgataccctt ggatcatgga aatcccaccc ctagtcttaa accggtcact 16440ttgcagcaag tgttacccgt aactccgcga acaggtgtta aacgcgaagg tgaagatttg 16500tatcccacta tgcaactgat ggtacccaaa cgccagaagt tggaggacgt tttggagaaa 16560gtaaaagtgg atccagatat tcaacctgag gttaaagtga gacccattaa gcaggtagcg 16620cctggtctgg gggtacaaac tgtagacatt aagattccca ctgaaagtat ggaagtgcaa 16680actgaacccg caaagcctac tgccacctcc actgaagtgc aaacggatcc atggatgccc 16740atgcctatta caactgacgc cgccggtccc actcgaagat cccgacgaaa gtacggtcca 16800gcaagtctgt tgatgcccaa ttatgttgta cacccatcta ttattcctac tcctggttac 16860cgaggcactc gctactatcg cagccgaaac agtacctccc gccgtcgccg caagacacct 16920gcaaatcgca gtcgtcgccg tagacgcaca agcaaaccga ctcccggcgc cctggtgcgg 16980caagtgtacc gcaatggtag tgcggaacct ttgacactgc cgcgtgcgcg ttaccatccg 17040agtatcatca cttaatcaat gttgccgctg cctccttgca gatatggccc tcacttgtcg 17100ccttcgcgtt cccatcactg gttaccgagg aagaaactcg cgccgtagaa gagggatgtt 17160gggacgcgga atgcgacgct acaggcgacg gcgtgctatc cgcaagcaat tgcggggtgg 17220ttttttacca gccttaattc caattatcgc tgctgcaatt ggcgcgatac caggcatagc 17280ttccgtggcg gttcaggcct cgcaacgaca ttgacattgg aaaaaaacgt ataaataaaa 17340aaaaaaaaat acaatggact ctgacactcc tggtcctgtg actatgtttt cttagagatg 17400gaagacatca atttttcatc cttggctccg cgacacggca cgaagccgta catgggcacc 17460tggagcgaca tcggcacgag ccaactgaac gggggcgcct tcaattggag cagtatctgg 17520agcgggctta aaaattttgg ctcaaccata aaaacatacg ggaacaaagc ttggaacagc 17580agtacaggac aggcgcttag aaataaactt aaagaccaga acttccaaca aaaagtagtc 17640gatgggatag cttccggcat caatggagtg gtagatttgg ctaaccaggc tgtgcagaaa 17700aagataaaca gtcgtttgga cccgccgcca gcaaccccag gtgaaatgca agtggaggaa 17760gaaattcctc cgccagaaaa acgaggcgac aagcgtccgc gtcccgattt ggaagagacg 17820ctggtgacgc gcgtagatga accgccttct tatgaggaag caacgaagct tggaatgccc 17880accactagac cgatagcccc aatggccacc ggggtgatga aaccttctca gttgcatcga 17940cccgtcacct tggatttgcc ccctccccct gctgctactg ctgtacccgc ttctaagcct 18000gtcgctgccc cgaaaccagt cgccgtagcc aggtcacgtc ccgggggcgc tcctcgtcca 18060aatgcgcact ggcaaaatac tctgaacagc atcgtgggtc taggcgtgca aagtgtaaaa 18120cgccgtcgct gcttttaatt aaatatggag tagcgcttaa cttgcctatc tgtgtatatg 18180tgtcattaca cgccgtcaca gcagcagagg aaaaaaggaa gaggtcgtgc gtcgacgctg 18240agttactttc aagatggcca ccccatcgat gctgccccaa tgggcataca tgcacatcgc 18300cggacaggat gcttcggagt acctgagtcc gggtctggtg cagttcgccc gcgccacaga 18360cacctacttc aatctgggaa ataagtttag aaatcccacc gtagcgccga cccacgatgt 18420gaccaccgac cgtagccagc ggctcatgtt gcgcttcgtg cccgttgacc gggaggacaa 18480tacatactct tacaaagtgc ggtacaccct ggccgtgggc gacaacagag tgctggatat 18540ggccagcacg ttctttgaca ttaggggtgt gttggacaga ggtcccagtt tcaaacccta 18600ttctggtacg gcttacaact ccctggctcc taaaggcgct ccaaatacat ctcagtggat 18660tgcagaaggt gtaaaaaata caactggtga ggaacacgta acagaagagg aaaccaatac 18720tactacttac acttttggca atgctcctgt aaaagctgaa gctgaaatta caaaagaagg 18780actcccagta ggtttggaag tttcagatga agaaagtaaa ccgatttatg ctgataaaac 18840atatcagcca gaacctcagc tgggagatga aacttggact gaccttgatg gaaaaaccga 18900aaagtatgga ggcagggctc tcaaacccga tactaagatg aaaccatgct acgggtcctt 18960tgccaaacct actaatgtga aaggcggtca ggcaaaacaa aaaacaacgg agcagccaaa 19020tcagaaagtc gaatatgata tcgacatgga gttttttgat gcggcatcgc agaaaacaaa 19080cttaagtcct aaaattgtca tgtatgcaga aaatgtaaat ttggaaactc cagacactca 19140tgtagtgtac aaacctggaa cagaagacac aagttccgaa gctaatttgg gacaacaatc 19200tatgcccaac agacccaact acattggctt cagagataac tttattggac ttatgtacta 19260taacagtact ggtaacatgg gggtgctggc tggtcaagcg tctcagttaa atgcagtggt 19320tgacttgcag gacagaaaca cagaactttc ttaccaactc ttgcttgact ctctgggcga 19380cagaaccaga tactttagca tgtggaatca ggctgtggac agttatgatc ctgatgtacg 19440tgttattgaa aatcatggtg tggaagatga acttcccaac tactgttttc cactggacgg 19500cataggtgtt ccaacaacca gttacaaatc aatagttcca aatggagaca atgcgcctaa 19560ttggaaggaa cctgaagtaa atggaacaag tgagatcgga cagggtaatt tgtttgccat 19620ggaaattaac cttcaagcca atctatggcg aagtttcctt tattccaatg tggctctata 19680tctcccagac tcgtacaaat acaccccgtc caatgtcact cttccagaaa acaaaaacac 19740ctacgactac atgaacgggc gggtggtgcc gccatctcta gtagacacct atgtgaacat 19800tggtgccagg tggtctctgg atgccatgga caatgtcaac ccattcaacc accaccgtaa 19860cgctggcttg cgttaccgat ccatgcttct gggtaacgga cgttatgtgc ctttccacat 19920acaagtgcct caaaaattct tcgctgttaa aaacctgctg cttctcccag gctcctacac 19980ttatgagtgg aactttagga aggatgtgaa catggttcta cagagttccc tcggtaacga 20040cctgcgggta gatggcgcca gcatcagttt cacgagcatc aacctctatg ctactttttt 20100ccccatggct cacaacaccg cttccaccct tgaagccatg ctgcggaatg acaccaatga 20160tcagtcattc aacgactacc tatctgcagc taacatgctc taccccattc ctgccaatgc 20220aaccaatatt cccatttcca ttccttctcg caactgggcg gctttcagag gctggtcatt 20280taccagactg aaaaccaaag aaactccctc tttggggtct ggatttgacc cctactttgt 20340ctattctggt tctattccct acctggatgg taccttctac ctgaaccaca cttttaagaa 20400ggtttccatc atgtttgact cttcagtgag ctggcctgga aatgacaggt tactatctcc 20460taacgaattt gaaataaagc gcactgtgga tggcgaaggc tacaacgtag cccaatgcaa 20520catgaccaaa gactggttct tggtacagat gctcgccaac tacaacatcg gctatcaggg 20580cttctacatt ccagaaggat acaaagatcg catgtattca tttttcagaa acttccagcc 20640catgagcagg caggtggttg atgaggtcaa ttacaaagac ttcaaggccg tcgccatacc 20700ctaccaacac aacaactctg gctttgtggg ttacatggct ccgaccatgc gccaaggtca 20760accctatccc gctaactatc cctatccact cattggaaca actgccgtaa atagtgttac 20820gcagaaaaag ttcttgtgtg acagaaccat gtggcgcata ccgttctcga gcaacttcat 20880gtctatgggg gcccttacag acttgggaca gaatatgctc tatgccaact cagctcatgc 20940tctggacatg acctttgagg tggatcccat ggatgagccc accctgcttt atcttctctt 21000cgaagttttc gacgtggtca gagtgcatca gccacaccgc ggcatcatcg aggcagtcta 21060cctgcgtaca ccgttctcgg ccggtaacgc taccacgtaa gaagcttctt gcttcttgca 21120aatagcagct gcaaccatgg cctgcggatc ccaaaacggc tccagcgagc aagagctcag 21180agccattgtc caagacctgg gttgcggacc ctattttttg ggaacctacg ataagcgctt 21240cccggggttc atggcccccg ataagctcgc ctgtgccatt gtaaatacgg ccggacgtga 21300gacgggggga gagcactggt tggctttcgg ttggaaccca cgttctaaca cctgctacct 21360ttttgatcct tttggattct cggatgatcg tctcaaacag atttaccagt ttgaatatga 21420gggtctcctg cgccgcagcg ctcttgctac caaggaccgc tgtattacgc tggaaaaatc 21480tacccagacc gtgcagggtc cccgttctgc cgcctgcgga cttttctgct gcatgttcct 21540tcacgccttt gtgcactggc ctgaccgtcc catggacgga aaccccacca tgaaattgct 21600aactggagtg ccaaacaaca tgcttcattc tcctaaagtc cagcccaccc tgtgtgacaa 21660tcaaaaagca ctctaccatt ttcttaatac ccattcgcct tattttcgct cccatcgtac 21720acacatcgaa agggccactg cgttcgaccg tatggatgtt caataatgac tcatgtaaac 21780aacgtgttca ataaacatca ctttattttt ttacatgtat caaggctctg cattacttat 21840ttatttacaa gtcgaatggg ttctgacgag aatcagaatg acccgcaggc agtgatacgt 21900tgcggaactg atacttgggt tgccacttga attcgggaat caccaacttg ggaaccggta 21960tatcgggcag gatgtcactc cacagctttc tggtcagctg caaagctcca agcaggtcag 22020gagccgaaat cttgaaatca caattaggac cagtgctttg agcgcgagag ttgcggtaca 22080ccggattgca gcactgaaac accatcagcg acggatgtct cacgcttgcc agcacggtgg 22140gatctgcaat catgcccaca tccagatctt cagcattggc aatgctgaac ggggtcatct 22200tgcaggtctg cctacccatg gcgggcaccc aattaggctt gtggttgcaa tcgcagtgca 22260gggggatcag tatcatcttg gcctgatcct gtctgattcc tggatacacg gctctcatga 22320aagcatcata ttgcttgaaa gcctgctggg ctttactacc ctcggtataa aacatcccgc 22380aggacctgct cgaaaactgg ttagctgcac agccggcatc attcacacag cagcgggcgt 22440cattgttagc tatttgcacc acacttctgc cccagcggtt ttgggtgatt ttggttcgct 22500cgggattctc ctttaaggct cgttgtccgt tctcgctggc cacatccatc tcgataatct 22560gctccttctg aatcataata ttgccatgca ggcacttcag cttgccctca taatcattgc 22620agccatgagg ccacaacgca cagcctgtac attcccaatt atggtgggcg atctgagaaa 22680aagaatgtat cattccctgc agaaatcttc ccatcatcgt gctcagtgtc ttgtgactag 22740tgaaagttaa ctggatgcct cggtgctcct cgtttacgta ctggtgacag atgcgcttgt 22800attgttcgtg ttgctcaggc attagtttaa aagaggttct aagttcgtta tccagcctgt 22860acttctccat cagcagacac atcacttcca tgcctttctc ccaagcagac accaggggca 22920agctaatcgg attcttaaca gtgcaggcag cagctccttt agccagaggg tcatctttag 22980cgatcttctc aatgcttctt ttgccatcct tctcaacgat gcgcacgggc gggtagctga 23040aacccactgc tacaagttgc gcctcttctc tttcttcttc gctgtcttga ctgatgtctt 23100gcatggggat atgtttggtc ttccttggct tctttttggg gggtatcgga ggaggaggac 23160tgtcgctccg ttccggagac agggaggatt gtgacgtttc gctcaccatt accaactgac 23220tgtcggtaga agaacctgac cccacacggc gacaggtgtt tctcttcggg ggcagaggtg 23280gaggcgattg cgaagggctg cggtccgacc tggaaggcgg atgactggca gaaccccttc 23340cgcgttcggg ggtgtgctcc ctgtggcggt cgcttaactg atttccttcg cggctggcca 23400ttgtgttctc ctaggcagag aaacaacaga catggaaact cagccattgc tgtcaacatc 23460gccacgagtg ccatcacatc tcgtcctcag cgacgaggaa aaggagcaga gcttaagcat 23520tccaccgccc agtcctgcca ccacctctac cctagaagat aaggaggtcg acgcatctca 23580tgacatgcag aataaaaaag cgaaagagtc tgagacagac atcgagcaag acccgggcta 23640tgtgacaccg gtggaacacg aggaagagtt gaaacgcttt ctagagagag aggatgaaaa 23700ctgcccaaaa caacgagcag ataactatca ccaagatgct ggaaataggg atcagaacac 23760cgactacctc atagggcttg acggggaaga cgcgctcctt aaacatctag caagacagtc 23820gctcatagtc aaggatgcat tattggacag aactgaagtg cccatcagtg tggaagagct 23880cagccgcgcc tacgagctta acctcttttc acctcgtact ccccccaaac gtcagccaaa 23940cggcacctgc gagccaaatc ctcgcttaaa cttttatcca gcttttgctg tgccagaagt 24000actggctacc tatcacatct tttttaaaaa tcaaaaaatt ccagtctcct gccgcgctaa 24060tcgcacccgc gccgatgccc tactcaatct gggacctggt tcacgcttac ctgatatagc 24120ttccttggaa gaggttccaa agatcttcga gggtctgggc aataatgaga ctcgggccgc 24180aaatgctctg caaaagggag aaaatggcat ggatgagcat cacagcgttc tggtggaatt 24240ggaaggcgat aatgccagac tcgcagtact caagcgaagc atcgaggtca cacacttcgc 24300atatcccgct gtcaacctgc cccctaaagt catgacggcg gtcatggacc agttactcat 24360taagcgcgca agtccccttt cagaagacat gcatgaccca gatgcctgtg atgagggtaa 24420accagtggtc agtgatgagc agctaacccg atggctgggc accgactctc ccagggattt 24480ggaagagcgt cgcaagctta tgatggccgt ggtgctggtt accgtagaac tagagtgtct 24540ccgacgtttc tttaccgatt cagaaacctt gcgcaaactc gaagagaatc tgcactacac 24600ttttagacac ggctttgtgc ggcaggcatg caagatatct aacgtggaac tcaccaacct 24660ggtttcctac atgggtattc tgcatgagaa tcgcctagga caaagcgtgc tgcacagcac 24720cctgaagggg gaagcccgcc gtgattacat ccgcgattgt gtctatctgt acctgtgcca 24780cacgtggcaa accggcatgg gtgtatggca gcaatgttta gaagaacaga acttgaaaga 24840gcttgacaag ctcttacaga aatctcttaa ggttctgtgg acagggttcg acgagcgcac 24900cgtcgcttcc gacctggcag acctcatctt cccagagcgt ctcagggtta ctttgcgaaa 24960cggattgcct gactttatga gccagagcat gcttaacaat tttcgctctt tcatcctgga 25020acgctccggt atcctgcccg ccacctgctg cgcactgccc tccgactttg tgcctctcac 25080ctaccgcgag tgccccccgc cgctatggag tcactgctac ctgttccgtc tggccaacta 25140tctctcctac cactcggatg tgatcgagga tgtgagcgga gacggcttgc tggagtgtca 25200ctgccgctgc aatctgtgca cgccccaccg gtccctagct tgcaaccccc agttgatgag 25260cgaaacccag ataataggca cctttgaatt gcaaggcccc agcagccaag gcgatgggtc 25320ttctcctggg caaagtttaa aactgacccc gggactgtgg acctccgcct acttgcgcaa 25380gtttgctccg gaagattacc acccctatga aatcaagttc tatgaggacc aatcacagcc 25440tccaaaggcc gaactttcgg cctgcgtcat cacccagggg gcaattctgg cccaattgca 25500agccatccaa aaatcccgcc aagaatttct actgaaaaag ggtaaggggg tctaccttga 25560cccccagacc ggcgaggaac tcaacacaag gttccctcag gatgtcccaa cgacgagaaa 25620acaagaagtt gaaggtgcag ccgccgcccc cagaagatat ggaggaagat tgggacagtc 25680aggcagagga ggcggaggag gacagtctgg aggacagtct ggaggaagac agtttggagg 25740aggaaaacga ggaggcagag gaggtggaag aagtaaccgc cgacaaacag ttatcctcgg 25800ctgcggagac aagcaacagc gctaccatct ccgctccgag tcgaggaacc cggcggcgtc 25860ccagcagtag atgggacgag accggacgct tcccgaaccc aaccagcgct tccaagaccg 25920gtaagaagga tcggcaggga tacaagtcct ggcgggggca taagaatgcc atcatctcct 25980gcttgcatga gtgcgggggc aacatatcct tcacgcggcg ctacttgcta ttccaccatg 26040gggtgaactt tccgcgcaat gttttgcatt actaccgtca cctccacagc ccctactata 26100gccagcaaat cccggcagtc tcgacagata aagacagcgg cggcgacctc caacagaaaa 26160ccagcagcgg cagttagaaa atacacaaca agtgcagcaa caggaggatt aaagattaca 26220gccaacgagc cagcgcaaac ccgagagtta agaaatcgga tctttccaac cctgtatgcc 26280atcttccagc agagtcgggg tcaagagcag gaactgaaaa taaaaaaccg atctctgcgt 26340tcgctcacca gaagttgttt gtatcacaag agcgaagatc aacttcagcg cactctcgag 26400gacgccgagg ctctcttcaa caagtactgc gcgctgactc ttaaagagta ggcagcgacc 26460gcgcttattc aaaaaaggcg ggaattacat catcctcgac atgagtaaag aaattcccac 26520gccttacatg tggagttatc aaccccaaat gggattggcg gcaggcgcct cccaggacta 26580ctccacccgc atgaattggc tcagcgccgg gccttctatg atttctcgag ttaatgatat 26640acgcgcctac cgaaaccaaa tacttttgga acagtcagct cttaccacca cgccccgcca 26700acaccttaat cccagaaatt ggcccgccgc cctagtgtac caggaaagtc ccgctcccac 26760cactgtatta cttcctcgag acgcccaggc cgaagtccaa atgactaatg caggtgcgca 26820gttagctggc ggctccaccc tatgtcgtca caggcctcgg cataatataa aacgcctgat 26880gatcagaggc cgaggtatcc agctcaacga cgagtcggtg agctctccgc ttggtctacg 26940accagacgga atctttcaga ttgccggctg cgggagatct tccttcaccc ctcgtcaggc 27000tgttctgact ttggaaagtt cgtcttcgca accccgctcg ggcggaatcg ggaccgttca 27060atttgtggag gagtttactc cctctgtcta cttcaacccc ttctccggat ctcctgggca 27120ttacccggac gagttcatac cgaacttcga cgcgattagc gagtcagtgg acggctacga 27180ttgatgtctg gtgacgcggc tgagctatct cggctgcgac atctagacca ctgccgccgc 27240tttcgctgct ttgcccggga actcattgag ttcatctact tcgaactccc caaggatcac 27300cctcaaggtc cggcccacgg agtgcggatt tctatcgaag gcaaaataga ctctcgcctg 27360caacgaattt tctcccagcg gcccgtgctg atcgagcgag accagggaaa caccacggtt 27420tccatctact gcatttgtaa tcaccccgga ttgcatgaaa gcctttgctg tcttatgtgt 27480actgagttta ataaaaactg aattaagact ctcctacgga ctgccgcttc ttcaacccgg 27540attttacaac cagaagaacg aaacttttcc tgtcgtccag gactctgtta acttcacctt 27600tcctactcac aaactagaag ctcaacgact acaccgcttt tccagaagca ttttccctac 27660taatactact ttcaaaaccg gaggtgagct ccaaggtctt cctacagaaa acccttgggt 27720ggaagcgggc cttgtagtgc taggaattct tgcgggtggg cttgtgatta ttctttgcta 27780cctatacaca ccttgcttca ctttcttagt ggtgttgtgg tattggttta aaaaatgggg 27840cccatactag tcttgcttgt

tttactttcg cttttggaac cgggttctgc caattacgat 27900ccatgtctag acttcgaccc agaaaactgc acacttactt ttgcacccga cacaagccgc 27960atctgtggag ttcttattaa gtgcggatgg gaatgcaggt ccgttgaaat tacacacaat 28020aacaaaacct ggaacaatac cttatccacc acatgggagc caggagttcc cgagtggtac 28080actgtctctg tccgaggtcc tgacggttcc atccgcatta gtaacaacac tttcattttt 28140tctgaaatgt gcgatctggc catgttcatg agcaaacagt attctctatg gcctcctagc 28200aaggacaaca tcgtaacgtt ctccattgct tattgcttgt gcgcttgcct tcttactgct 28260ttactgtgcg tatgcataca cctgcttgta accactcgca tcaaaaacgc caataacaaa 28320gaaaaaatgc cttaacctct ttctgtttac agacatggct tctcttacat ctctcatatt 28380tgtcagcatt gtcactgccg ctcatggaca aacagtcgtc tctatccctc taggacataa 28440ttacactctc ataggacccc caatcacttc agaggtcatc tggaccaaac tgggaagcgt 28500tgattacttt gatataatct gcaacaaaac aaaaccaata atagtaactt gcaacataca 28560aaatcttaca ttgattaatg ttagcaaagt ttacagcggt tactattatg gttatgacag 28620atacagtagt caatatagaa attacttggt tcgtgttacc cagttgaaaa ccacgaaaat 28680gccaaatatg gcaaagattc gatccgatga caattctcta gaaactttta catctcccac 28740cacacccgac gaaaaaaaca tcccagattc aatgattgca attgttgcag cggtggcagt 28800ggtgatggca ctaataataa tatgcatgct tttatatgct tgtcgctaca aaaagtttca 28860tcctaaaaaa caagatctcc tactaaggct taacatttaa tttcttttta tacagccatg 28920gtttccacta ccacattcct tatgcttact agtctcgcaa ctctgacttc tgctcgctca 28980cacctcactg taactatagg ctcaaactgc acactaaaag gacctcaagg tggtcatgtc 29040ttttggtgga gaatatatga caatggatgg tttacaaaac catgtgacca acctggtaga 29100tttttctgca acggcagaga cctaaccatt atcaacgtga cagcaaatga caaaggcttc 29160tattatggaa ccgactataa aagtagttta gattataaca ttattgtact gccatctacc 29220actccagcac cccgcacaac tactttctct agcagcagtg tcgctaacaa tacaatttcc 29280aatccaacct ttgccgcgct tttaaaacgc actgtgaata attctacaac ttcacataca 29340acaatttcca cttcaacaat cagcattatc gctgcagtga caattggaat atctattctt 29400gtttttacca taacctacta cgcctgctgc tatagaaaag acaaacataa aggtgatcca 29460ttacttagat ttgatattta atttgttctt ttttttttta tttacagtat ggtgaacacc 29520aatcatggta cctagaaatt tcttcttcac catactcatt tgtgcattta atgtttgcgc 29580tactttcaca gcagtagcca cagcaacccc agactgtata ggagcatttg cttcctatgc 29640actttttgct tttgttactt gcatctgcgt atgtagcata gtctgcctgg ttattaattt 29700tttccaactt atagactgga tccttgtgcg aattgcctac ctgcgccacc atcccgaata 29760ccgcaaccaa aatatcgcgg cacttcttag actcatctaa aaccatgcag gctatactac 29820caatattttt gcttctattg cttccctacg ctgtctcaac cccagctgcc tatagtactc 29880caccagaaca ccttagaaaa tgcaaattcc aacaaccgtg gtcatttctt gcttgctatc 29940gagaaaaatc agaaattccc ccaaatttaa taatgattgc tggaataatt aatataatct 30000gttgcaccat aatttcattt ttgatatacc ccctatttga ttttggctgg aatgctccca 30060atgcacatga tcatccacaa gacccagagg aacacattcc cctacaaaac atgcaacatc 30120caatagcgct aatagattac gaaagtgaac cacaaccccc actactccct gctattagtt 30180acttcaacct aaccggcgga gatgactgaa acactcacca cctccaattc cgccgaggat 30240ctgctcgata tggacggccg cgtctcagaa cagcgactcg cccaactacg catccgccag 30300cagcaggaac gcgcggccaa agagctcaga gatgtcatcc aaattcacca atgcaaaaaa 30360ggcatattct gtttggtaaa acaagccaag atatcctacg agatcaccgc tactgaccat 30420cgcctctctt acgaacttgg cccccaacga caaaaattta cctgcatggt gggaatcaac 30480cccatagtta tcacccagca aagtggagat actaagggtt gcattcactg ctcctgcgat 30540tccatcgagt gcacctacac cctgctgaag accctatgcg gcctaagaga cctgctacca 30600atgaattaaa aaatgattaa taaaaaatca cttacttgaa atcagcaata aggtctctgt 30660tgaaattttc tcccagcagc acctcacttc cctcttccca actctggtat tctaaacccc 30720gttcagcggc atactttctc catactttaa aggggatgtc aaattttagc tcctctcctg 30780tacccacaat cttcatgtct ttcttcccag atgaccaaga gagtccggct cagtgactcc 30840ttcaaccctg tctaccccta tgaagatgaa agcacctccc aacacccctt tataaaccca 30900gggtttattt ccccaaatgg cttcacacaa agcccaaacg gagttcttac tttaaaatgt 30960ttaaccccac taacaaccac aggcggatct ctacagctaa aagtgggagg gggacttaca 31020gtggatgaca ccaacggttt tttgaaagaa aacataagtg ccaccacacc actcgttaag 31080actggtcact ctataggttt accactagga gccggattgg gaacgaatga aaataaactt 31140tgtatcaaat taggacaagg acttacattc aattcaaaca acatttgcat tgatgacaat 31200attaacacct tatggacagg agtcaacccc accgaagcca actgtcaaat catgaactcc 31260agtgaatcta atgattgcaa attaattcta acactagtta aaactggagc actagtcact 31320gcatttgttt atgttatagg agtatctaac aattttaata tgctaactac acacagaaat 31380ataaatttta ctgcagagct gtttttcgat tctactggta atttactaac tagactctca 31440tccctcaaaa ctccacttaa tcataaatca ggacaaaaca tggctactgg tgccattact 31500aatgctaaag gtttcatgcc cagcacgact gcctatcctt tcaatgataa ttctagagaa 31560aaagaaaact acatttacgg aacttgttac tacacagcta gtgatcgcac tgcttttccc 31620attgacatat ctgtcatgct taaccgaaga gcaataaatg acgagacatc atattgtatt 31680cgtataactt ggtcctggaa cacaggagat gccccagagg tgcaaacctc tgctacaacc 31740ctagtcacct ccccatttac cttttactac atcagagaag acgactgaca aataaagttt 31800aacttgttta tttgaaaatc aattcacaaa atccgagtag ttattttgcc tcccccttcc 31860catttaacag aatacaccaa tctctcccca cgcacagctt taaacatttg gataccatta 31920gatatagaca tggttttaga ttccacattc caaacagttt cagagcgagc caatctgggg 31980tcagtgatag ataaaaatcc atcgggatag tcttttaaag cgctttcaca gtccaactgc 32040tgcggatgcg actccggagt ctggatcacg gtcatctgga agaagaacga tgggaatcat 32100aatccgaaaa cggtatcgga cgattgtgtc tcatcaaacc cacaagcagc cgctgtctgc 32160gtcgctccgt gcgactgctg tttatgggat cagggtccac agtgtcctga agcatgattt 32220taatagccct taacatcaac tttctggtgc gatgcgcgca gcaacgcatt ctgatttcac 32280tcaaatcttt gcagtaggta caacacatta ttacaatatt gtttaataaa ccataattaa 32340aagcgctcca gccaaaactc atatctgata taatcgcccc tgcatgacca tcataccaaa 32400gtttaatata aattaaatga cgttccctca aaaacacact acccacatac atgatctctt 32460ttggcatgtg catattaaca atctgtctgt accatggaca acgttggtta atcatgcaac 32520ccaatataac cttccggaac cacactgcca acaccgctcc cccagccatg cattgaagtg 32580aaccctgctg attacaatga caatgaagaa cccaattctc tcgaccgtga atcacttgag 32640aatgaaaaat atctatagtg gcacaacata gacataaatg catgcatctt ctcataattt 32700ttaactcctc aggatttaga aacatatccc agggaatagg aagctcttgc agaacagtaa 32760agctggcaga acaaggaaga ccacgaacac aacttacact atgcatagtc atagtatcac 32820aatctggcaa cagcgggtgg tcttcagtca tagaagctcg ggtttcattt tcctcacaac 32880gtggtaactg ggctctggtg taagggtgat gtctggcgca tgatgtcgag cgtgcgcgca 32940accttgtcat aatggagttg cttcctgaca ttctcgtatt ttgtatagca aaacgcggcc 33000ctggcagaac acactcttct tcgccttcta tcctgccgct tagcgtgttc cgtgtgatag 33060ttcaagtaca accacactct taagttggtc aaaagaatgc tggcttcagt tgtaatcaaa 33120actccatcgc atctaatcgt tctgaggaaa tcatccacgg tagcatatgc aaatcccaac 33180caagcaatgc aactggattg tgtttcaagc aggagaggag agggaagaga cggaagaacc 33240atgttaattt ttattccaaa cgatctcgca gtacttcaaa ttgtagatcg cgcagatggc 33300atctctcgcc cccactgtgt tggtgaaaaa gcacagctag atcaaaagaa atgcgatttt 33360caaggtgctc aacggtggct tccagcaaag cctccacgcg cacatccaag aacaaaagaa 33420taccaaaaga aggagcattt tctaactcct caatcatcat attacattcc tgcaccattc 33480ccagataatt ttcagctttc cagccttgaa ttattcgtgt cagttcttgt ggtaaatcca 33540atccacacat tacaaacagg tcccggaggg cgccctccac caccattctt aaacacaccc 33600tcataatgac aaaatatctt gctcctgtgt cacctgtagc gaattgagaa tggcaacatc 33660aattgacatg cccttggctc taagttcttc tttaagttct agttgtaaaa actctctcat 33720attatcacca aactgcttag ccagaagccc cccgggaaca agagcagggg acgctacagt 33780gcagtacaag cgcagacctc cccaattggc tccagcaaaa acaagattgg aataagcata 33840ttgggaaccg ccagtaatat catcgaagtt gctggaaata taatcaggca gagtttcttg 33900taaaaattga ataaaagaaa aatttgccaa aaaaacattc aaaacctctg ggatgcaaat 33960gcaataggtt accgcgctgc gctccaacat tgttagtttt gaattagtct gcaaaaataa 34020aaaaaaaaac aagcgtcata tcatagtagc ctgacgaaca gatggataaa tcagtctttc 34080catcacaaga caagccacag ggtctccagc tcgaccctcg taaaacctgt catcatgatt 34140aaacaacagc accgaaagtt cctcgcggtg accagcatga ataattcttg atgaagcata 34200caatccagac atgttagcat cagttaacga gaaaaaacag ccaacatagc ctttgggtat 34260aattatgctt aatcgtaagt atagcaaagc cacccctcgc ggatacaaag taaaaggcac 34320aggagaataa aaaatataat tatttctctg ctgctgttca ggcaacgtcg cccccggtcc 34380ctctaaatac acatacaaag cctcatcagc catggcttac cagacaaagt acagcgggca 34440cacaaagcac aagctctaaa gtgactctcc aacctctcca caatatatat atacacaagc 34500cctaaactga cgtaatggga gtaaagtgta aaaaatcccg ccaaacccaa cacacacccc 34560gaaactgcgt caccagggaa aagtacagtt tcacttccgc aatcccaaca ggcgtaactt 34620cctctttctc acggtacgtg atatcccact aacttgcaac gtcattttcc cacggtcgca 34680ccgccccttt tagccgttaa ccccacagcc aatcaccaca cgatccacac tttttaaaat 34740cacctcattt acatattggc accattccat ctataaggta tattatatag atag 3479435287DNAAdenovirus 3ctatggcatc tcgatccagc agacctcctc gtttcgcggg tttggacggc tcctggaata 60gggtatgaga cgatgggcgt ccagcgctgc cagggttcgg tccttccagg gtctcagtgt 120tcgagtcagg gttgtttccg tcacagtgaa ggggtgtgcg cctgcttggg cgcttgccag 180ggtgcgcttc agactcatcc tgctggtcga aaacttctgt cgcttggcgc cctgtatgtc 240ggccaagtag cagtttacca tgagttcgta gttgagcgcc tcggctgcgt ggcctttggc 300gcggagctta cctttggaag ttttcttgca taccgggcag tataggcatt tcagcgcata 360caacttgggc gcaaggaaaa cggattctgg ggagtatgca tctgcgccgc aggaggcgca 420aacagtttca cattccacca gccaggttaa atccggttca ttggggtcaa aaacaagttt 480tccgccatat tttttgatgc gtttcttacc tttggtctcc atgagttcgt gtcctcgttg 540agtgacaaac aggctgtccg tgtccccgta gactgatttt acaggcctct tctccagtgg 600agtgcctcgg tcttcttcgt acaggaactc tgaccactct gatacaaagg cgcgcgtcca 660ggccagcaca aaggaggcta tgtgggaggg gtagcgatcg ttgtcaacca gggggtccac 720cttttccaaa gtatgcaaac acatgtcacc ctcttcaaca tccaggaatg tgattggctt 780gtaggtgtat ttcacgtgac ctggggtccc cgctgggggg gtataaaagg gggcggttct 840ttgctcttcc tcactgtctt ccggatcgct gtccaggaac gtcagctgtt ggggtaggta 900ttccctctcg aaggcgggca tgacctctgc actcaggttg tcagtttcta agaacgagga 960ggatttgata ttgacagtgc cggttgagat gcctttcatg aggttttcgt ccatctggtc 1020agaaaacaca atttttttat tgtcaagttt ggtggcaaat gatccataca gggcgttgga 1080taaaagtttg gcaatggatc gcatggtttg gttcttttcc ttgtccgcgc gctctttggc 1140ggcgatgttg agttggacat actcgcgtgc caggcacttc cattcgggga agatagttgt 1200taattcatct ggcacgattc tcacttgcca ccctcgatta tgcaaggtaa ttaaatccac 1260actggtggcc acctcgcctc gaaggggttc attggtccaa cagagcctac ctcctttcct 1320agaacagaaa gggggaagtg ggtctagcat aagttcatcg ggagggtctg catccatggt 1380aaagattccc ggaagtaaat ccttatcaaa atagctgatg ggagtggggt catctaaggc 1440catttgccat tctcgagctg ccagtgcgcg ctcatatggg ttaaggggac tgccccatgg 1500catgggatgg gtgagtgcag aggcatacat gccacagatg tcatagacgt agatgggatc 1560ctcaaagatg cctatgtagg ttggatagca tcgcccccct ctgatacttg ctcgcacata 1620gtcatatagt tcatgtgatg gcgctagcag ccccggaccc aagttggtgc gattgggttt 1680ttctgttctg tagacgatct ggcgaaagat ggcgtgagaa ttggaagaga tggtgggtct 1740ttgaaaaatg ttgaaatggg catgaggtag acctacagag tctctgacaa agtgggcata 1800agattcttga agcttggtta ccagttcggc ggtgacaagt acgtctaggg cgcagtagtc 1860aagtgtttct tgaatgatgt cataacctgg ttggtttttc ttttcccaca gttcgcggtt 1920gagaaggtat tcttcgcgat ccttccagta ctcttctagc ggaaacccgt ctttgtctgc 1980acggtaagat cctagcatgt agaactgatt aactgccttg taagggcagc agcccttctc 2040tacgggtaga gagtatgctt gagcagcttt tcgtagcgaa gcgtgagtaa gggcaaaggt 2100gtctctgacc atgactttga ggaattggta tttgaagtcg atgtcgtcac aggctccctg 2160ttcccagagt tggaagtcta cccgtttctt gtaggcgggg ttgggcaaag cgaaagtaac 2220atcattgaag agaatcttgc cggccctggg catgaaattg cgagtgatgc gaaaaggctg 2280tggtacttcc gctcggttat tgataacctg ggcagctagg acgatctcgt cgaaaccgtt 2340gatgttgtgt cctacgatgt ataattctat gaaacgcggc gtgcctctga cgtgaggtag 2400cttactgagc tcatcaaagg ttaggtctgt ggggtcagat aaggcgtagt gttcgagagc 2460ccattcgtgc aggtgaggat tcgctttaag gaaggaggac cagaggtcca ctgccagtgc 2520tgtttgtaac tggtcccggt actgacgaaa atgccgtccg actgccattt tttctggggt 2580gacgcaatag aaggtttggg ggtcctgccg ccagcgatcc cacttgagtt ttatggcgag 2640gtcataggcg atgttgacga gccgctggtc tccagagagt ttcatgacca gcatgaaggg 2700gattagctgc ttgccaaagg accccatcca ggtgtaggtt tccacatcgt aggtgagaaa 2760gagcctttct gtgcgaggat gagagccaat cgggaagaac tggatctcct gccaccagtt 2820ggaggaatgg ctgttgatgt gatggaagta gaactccctg cgacgcgccg agcattcatg 2880cttgtgcttg tacagacggc cgcagtagtc gcagcgttgc acgggttgta tctcgtgaat 2940gagttgtacc tggcttccct tgacgagaaa tttcagtggg aagccgaggc ctggcgattg 3000tatctcgtgc tttactatgt tgtctgcatc ggcctgttca tcttctgtct cgatggtggt 3060catgctgacg agccctcgcg ggaggcaagt ccagacctcg gcgcggcagg ggcggagctc 3120gaggacgaga gcgcgcaggc tggagctgtc cagggtcctg agacgctgcg gactcaggtt 3180agtaggcagt gtcaggagat taacttgcat gatcttttgg agggcgtgcg ggaggttcag 3240atagtacttg atctcaacgg gtccgttggt ggagatgtcg atggcttgca gggttccgtg 3300tcccttgggc gctaccaccg tgcccttgtt tttcattttg gacggcggtg gctctgttgc 3360ttcttgcatg tttagaagcg gtgtcgaggg cgcgcaccgg gcggcagggg cggctcggga 3420cccggcggca tggctggcag tggtacgtcg gcgccgcgcg cgggtaggtt ctggtactgc 3480gccctgagaa gactcgcatg cgcgacgacg cggcggttga catcctggat ctgacgcctc 3540tgggtgaaag ctaccggccc cgtgagcttg aacctgaaag agagttcaac agaatcaatc 3600tcggtatcgt tgacggcggc ttgcctaagg atttcttgca cgtcaccaga gttgtcctgg 3660taggcgatct ccgccatgaa ctgctcgatc tcttcctctt gaagatctcc gcggcccgct 3720ctctcgacgg tggccgcgag gtcgttggag atgcgcccaa tgagttgaga gaatgcattc 3780atgcccgcct cgttccagac gcggctgtag accacggccc ccacgggatc tctcgcgcgc 3840atgaccacct gggcgaggtt gagctccacg tggcgggtga agaccgcata gttgcatagg 3900cgctggaaaa ggtagttgag tgtggtggcg atgtgctcgg tgacgaagaa atacatgatc 3960catcgtctca gcggcatctc gctgacatcg cccagagctt ccaagcgctc catggcctcg 4020tagaagtcca cggcaaaatt aaaaaactgg gagtttcgcg cggacacggt caactcctct 4080tccagaagac ggataagttc ggcgatggtg gtgcgcacct cgcgctcgaa agcccctggg 4140atttcttcct caatctcttc ttcttccact aacatctctt cctcttcagg tggggctgca 4200ggaggagggg gaacgcggcg acgccggcgg cgcacgggca gacggtcgat gaatctttca 4260atgacctctc cgcggcggcg gcgcatggtt tcagtgacgg cgcggccgtt ctcgcgcggt 4320cgcagagtaa aaacaccgcc gcgcatctcc ttaaagtggt gactgggagg ttctccgttt 4380gggagggaga gggcgctgat tatacatttt attaattggc ccgtagggac tgcacgcaga 4440gatctgatcg tgtcaagatc cacgggatct gaaaaccttt cgacgaaagc gtctaaccag 4500tcacagtcac aaggtaggct gagtacggct tcttgtgggc gggggtggtt atgtgttcgg 4560tctgggtctt ctgtttcttc ttcatctcgg gaaggtgaga cgatgctgct ggtgatgaaa 4620ttaaagtagg cagttctaag acggcggatg gtggcgagga gcaccaggtc tttgggtccg 4680gcttgctgga tacgcaggcg attggccatt ccccaagcat tatcctgaca tctagcaaga 4740tctttgtagt agtcttgcat gagccgttct acgggcactt cttcctcacc cgttctgcca 4800tgcatacgtg tgagtccaaa tccgcgcatt ggttgtacca gtgccaagtc agctacgact 4860ctttcggcga ggatggcttg ctgtacttgg gtaagggtgg cttgaaagtc atcaaaatcc 4920acaaagcggt ggtaagctcc tgtattaatg gtgtaagcac agttggccat gactgaccag 4980ttaactgtct ggtgaccagg gcgcacgagc tcggtgtatt taaggcgcga ataggcgcgg 5040gtgtcaaaga tgtaatcgtt gcaggtgcgc accagatact ggtaccctat aagaaaatgc 5100ggcggtggtt ggcggtagag aggccatcgt tctgtagctg gagcgccagg ggcgaggtct 5160tccaacataa ggcggtgata gccgtagatg tacctggaca tccaggtgat tcctgcggcg 5220gtagtagaag cccgaggaaa ctcgcgtacg cggttccaaa tgttgcgtag cggcatgaag 5280tagttca 5287421DNAArtificial Sequenceprimer 4gggagtttcg cgcggacacg g 21521DNAArtificial Sequenceprimer 5gcgccgccgc cgcggagagg t 21624DNAArtificial Sequenceprimer 6cgagagccca ttcgtgcagg tgag 24724DNAArtificial Sequenceprimer 7gctgcgacta ctgcggccgt ctgt 2484195DNAAdenovirus 8tcataagact ctcgtccatc tggtcagaaa acacaatctt cttgttgtcc agcttggtgg 60caaatgatcc atagagggca ttggatagaa gcttggcgat ggagcgcatg gtttggttct 120tttccttgtc cgcgcgctcc ttggcggtga tgttaagctg gacgtactcg cgcgccacac 180atttccattc aggaaagatg gttgtcagtt catccggaac tattctgatt cgccatcccc 240tattgtgcag ggttatcaga tccacactgg tggccacctc gcctcggagg ggctcattgg 300tccagcagag tcgacctcct tttcttgaac agaaaggggg gagggggtct agcatgaact 360catcaggggg gtccgcatct atggtaaata ttcccggtag caaatctttg tcaaaatagc 420tgatggtggc gggatcatcc aaggtcatct gccattctcg aactgccagc gcgcgctcat 480aggggttaag aggggtgccc cagggcatgg ggtgggtgag cgcggaggca tacatgccac 540agatatcgta gacatagagg ggctcttcga ggatgccgat gtaagtggga taacatcgcc 600cccctctgat gcttgctcgc acatagtcat agagttcatg tgagggggca agaagacccg 660ggcccagatt ggtgcggttg ggtttttccg ccctgtaaac gatctggcga aagatggcat 720gggaattgga agagatagta ggtctctgga atatgttaaa atgggcatga ggtaagccta 780cagagtccct tatgaagtgg gcatatgact cttgcagctt ggctaccagc tcggcggtga 840tgagtacatc cagggcacag tagtcgagag tttcctggat gatgtcataa cgcggttggc 900ttttcttttc ccacagctcg cggttgagaa ggtattcttc gtgatccttc cagtactctt 960cgaggggaaa cccgtctttt tctgcacggt aagagcccaa catgtagaac tgattgactg 1020ccttgtaggg acagcatccc ttctccactg ggagagagta tgcttgggct gcattgcgca 1080gcgaggtatg agtgagggca aaagtgtccc tgaccatgac tttgaggaat tgatacttga 1140agtcgatgtc atcacaggcc ccctgttccc agagttggaa gtccacccgc ttcttgtagg 1200cggggttggg caaagcgaaa gtaacatcat tgaagaggat cttgccggcc ctgggcatga 1260aatttcgggt gattttgaaa ggctgaggaa cctctgctcg gttattgata acctgagcgg 1320ccaagacgat ctcatcaaag ccattgatgt tgtgccccac tatgtacagt tctaagaatc 1380gaggggtgcc cctgacatga ggcagcttct tgagttcttc aaaagtgaga tctgtagggt 1440cagtgagagc atagtgttcg agggcccatt cgtgcacgtg agggttcgct ttaaggaagg 1500aggaccagag gtccactgcc agtgctgttt gtaactggtc ccggtactga cgaaaatgct 1560gtccgactgc catcttttct ggggtgacgc aatagaaggt ttgggggtcc tgccgccagc 1620gatcccactt gagttttatg gcgaggtcat aggcgatgtt gacgagccgc tggtctccag 1680agagtttcat gaccagcatg aaggggatta gctgcttgcc aaaggacccc atccaggtgt 1740aggtttccac atcgtaggtg agaaagagcc tttctgtgcg aggatgagag ccaatcggga 1800agaactggat ctcctgccac cagttggagg aatggctgtt gatgtgatgg aagtagaact 1860ccctgcgacg cgccgagcat tcatgcttgt gcttgtacag acggccgcag tactcgcagc 1920gattcacggg atgcacctta tgaatgagtt gtacctgact tcctttgacg agaaatttca 1980gtggaaaatt gaggcctggc gcttgtacct cgcgctttac tatgttgtct gcatcggcat 2040gaccatcttc tgtctcgatg gtggtcatgc tgacgagccc tcgcgggagg caagtccaga 2100cctcggcgcg gcaggggcgg agctcgagga cgagagcgcg caggccggag ctgtccaggg 2160tcctgagacg ctgcggagtc aggttagtag gcagtgtcag gagattaact tgcatgatct 2220tttggagggc gtgagggagg ttcagatagt acttgatctc aacgggtccg ttggtggaga 2280tgtcgatggc ttgcagggtt ccgtgtccct tgggcgctac caccgtgccc ttgtttttca 2340ttttggacgg cggtggctct gttgcttctt gcatgtttag

aagcggtgtc gagggcgcgc 2400accgggcggc aggggcggct cgggacccgg cggcatggct ggcagtggta cgtcggcgcc 2460gcgcgcgggt aggttctggt actgcgccct gagaagactc gcatgcgcga cgacgcggcg 2520gttgacatcc tggatctgac gcctctgggt gaaagctacc ggccccgtga gcttgaacct 2580gaaagagagt tcaacagaat caatctcggt atcgttgacg gcggcttgcc taaggatttc 2640ttgcacgtcg ccagagttgt cctggtaggc gatctcggcc atgaactgct cgatctcttc 2700ctcttgaaga tctccgcggc ccgctctctc gacggtggcc gcgaggtcgt tggagatgcg 2760cccaatgagt tgagagaatg cattcatgcc cgcctcgttc cagacgcggc tgtagaccac 2820agcccccacg ggatctctcg cgcgcatgac cacctgggcg aggttgagct ccacgtggcg 2880ggtgaagacc gcatagttgc ataggcgctg gaaaaggtag ttgagtgtgg tggcgatgtg 2940ctcggtgacg aagaaataca tgatccatcg tctcagcggc atctcgctga catcgcccag 3000cgcttccaag cgctccatgg cctcgtagaa gtccacggca aagttaaaaa actgggagtt 3060acgcgcggac acggtcaact cctcttccag aagacggata agttcggcga tggtggtgcg 3120cacctcgcgc tcgaaagccc ctgggatttc ttcctcaatc tcttcttctt ccactaacat 3180ctcttcctct tcaggtgggg ctgcaggagg agggggaacg cggcgacgcc ggcggcgcac 3240gggcagacgg tcgatgaatc tttcaatgac ctctccgcgg cggcggcgca tggtctcggt 3300gacggcacga ccgttctccc tgggtctcag agtgaagacg cctccgcgca tctccctgaa 3360gtggtgactg ggaggctctc cgttgggcag ggacaccgcg ctgattatgc attttatcaa 3420ttgccccgta ggtactccgc gcaaggacct gatcgtctca agatccacgg gatctgaaaa 3480cctttcgacg aaagcgtcta accagtcgca atcgcaaggt aggctgagca ctgtttcttg 3540cgggcggggg cggctagacg ctcggtcggg gttctctctt tcttctcctt cctcctcttg 3600ggagggtgag acgatgctgc tggtgatgaa attaaaatag gcagttttga gacggcggat 3660ggtggcgagg agcaccaggt ctttgggtcc ggcttgttgg atacgcaggc gatgagccat 3720tccccaagca ttatcctgac atctggccag atctttatag tagtcttgca tgagtcgttc 3780cacgggcact tcttcttcgc ccgctctgcc atgcatgcga gtgatcccga acccgcgcat 3840gggctggaca agtgccaggt ccgctacaac cctttcggcg aggatggctt gctgcacctg 3900ggtgagggtg gcttggaagt cgtcaaagtc cacgaagcgg tggtaggccc cggtgttgat 3960tgtgtaggag cagttggcca tgactgacca gttgactgtc tggtgcccag ggcgcacgag 4020ctcggtgtac ttgaggcgcg agtatgcgcg ggtgtcaaag atgtaatcgt tgcaggtgcg 4080caccaggtac tggtagccaa tgagaaagtg tggcggtggc tggcggtaca ggggccatcg 4140ctctgtagcc ggggctccgg gggcgaggtc ttccagcatg aggcggtggt agccg 4195


Patent applications by Irene Kuhn, Richmond, CA US

Patent applications by Paul Harden, Brentwood, CA US

Patent applications by Terry Hermiston, Corte Madera, CA US

Patent applications by PSIOXUS THERAPEUTICS LIMITED

Patent applications in class VIRUS OR BACTERIOPHAGE, EXCEPT FOR VIRAL VECTOR OR BACTERIOPHAGE VECTOR; COMPOSITION THEREOF; PREPARATION OR PURIFICATION THEREOF; PRODUCTION OF VIRAL SUBUNITS; MEDIA FOR PROPAGATING

Patent applications in all subclasses VIRUS OR BACTERIOPHAGE, EXCEPT FOR VIRAL VECTOR OR BACTERIOPHAGE VECTOR; COMPOSITION THEREOF; PREPARATION OR PURIFICATION THEREOF; PRODUCTION OF VIRAL SUBUNITS; MEDIA FOR PROPAGATING


User Contributions:

Comment about this patent or add new information about this topic:

CAPTCHA
Images included with this patent application:
CHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and imageCHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and image
CHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and imageCHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and image
CHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and imageCHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and image
CHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and imageCHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and image
CHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and imageCHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and image
CHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and imageCHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and image
CHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and imageCHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and image
CHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and imageCHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and image
CHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and imageCHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and image
CHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and imageCHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and image
CHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and imageCHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and image
CHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and imageCHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and image
CHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and imageCHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and image
CHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and imageCHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and image
CHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and imageCHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and image
CHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and imageCHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and image
CHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and imageCHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and image
CHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and imageCHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and image
CHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and imageCHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and image
CHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and imageCHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and image
CHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and imageCHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and image
CHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and imageCHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and image
CHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and imageCHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and image
CHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and imageCHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and image
CHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and imageCHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and image
CHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and imageCHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and image
CHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and imageCHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and image
CHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and imageCHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and image
CHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and imageCHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and image
CHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and imageCHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and image
CHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and imageCHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and image
CHIMERIC ADENOVIRUSES FOR USE IN CANCER TREATMENT diagram and image
Similar patent applications:
DateTitle
2013-04-04Device and method for continuous cell culture and other reactions
2013-04-04Platform comprising an organic field-effect transistor for biological and medical applications
2010-04-29Somatic cells for use in cell therapy
2012-07-05Cartridge and sensor-dispensing instrument
2012-10-18Thixotropic gel for vadose zone remediation
New patent applications in this class:
DateTitle
2019-05-16Induction of hemogenic endothelium from pluripotent stem cells by forced expression of transcription factors
2016-12-29Cell culture media and methods
2016-09-01Methods and molecules for suppression of rna silencing
2016-05-19Recombinant influenza viruses for vaccines and gene therapy
2016-05-12Method to produce virus in cultured cells
New patent applications from these inventors:
DateTitle
2015-02-12Methods and compositions for production of recombinant protein in hbx-expressing mammalian cells
2015-02-05Chimeric adenoviruses for use in cancer treatment
2014-09-18Monoclonal antibodies against antithrombin beta
Top Inventors for class "Chemistry: molecular biology and microbiology"
RankInventor's name
1Marshall Medoff
2Anthony P. Burgard
3Mark J. Burk
4Robin E. Osterhout
5Rangarajan Sampath
Website © 2025 Advameg, Inc.