BACTERIAL VACCINE

Abstract

A bacterial cell which expresses three or more coli surface (CS) antigens and methods of making such a cell. The cell is useful in making vaccines against diarrhea.

Description

FIELD OF THE INVENTION

[0001] The invention relates to bacterial cells, useful for vaccines, in particular vaccines against diarrhoea.

BACKGROUND TO THE INVENTION

[0002] In general, the purpose of a vaccine is to induce an immune response in the recipient, thus providing protection against subsequent challenge with a pathogen. This may be achieved by inoculation with a live attenuated strain of the pathogen, ie. a strain having reduced virulence such that it does not cause the disease caused by the virulent pathogen while still stimulating a broad immune response.

[0003] Enterotoxigenic E. coli (ETEC) strains are a major cause of travellers diarrhoea and of morbidity and death of children in endemic areas. Virulence is associated with expression of fimbrial colonisation factor antigens (CFAs) which mediate adhesion to the intestine and with secretion of toxins (heat stable toxin (ST), heat labile toxin (LT) and EAST toxin) which are responsible for the loss of fluid characteristic of the disease. Protection against ETEC disease is associated with antibody-mediated neutralisation of the toxins and with a humoral immune response against the CFAs.

SUMMARY OF THE INVENTION

[0004] There are several types of CFA associated with virulent strains of ETEC but CFA/I, CFA/II and CFA/IV are the major types, associated with approximately 70% of clinical isolates. CFA/I is a single fimbrial antigen, whereas CFA/II and CFA/IV are each complexes composed of two different types of coli surface (CS) antigen. CFA/II is composed of CS3 with either CS1 or CS2. CFA/IV is composed of CS6 with either CS4 or CS5.

[0005] CFA expression in wild-type ETEC appears to be restricted so that native ETEC strains express only one type of CFA and a maximum of two types of CS antigen. Thus, native CFA/II ETEC cells are generally either CS1/CS3 or CS2/CS3 expressing strains. Similarly, native CFA/IV ETEC cells are generally either CS4/CS6 or CS5/CS6 expressing strains. CS1 and CS2 have not been found in the same wild type strain (34) and likewise CS4 and CS5 are never expressed together in naturally occurring strains (WO92/01703, (34)).

[0006] An effective vaccine against ETEC must immunise against CFA/I, CFA/II and CFA/IV strains as a minimum. Thus, ETEC vaccines have traditionally required a minimum of 5 bacterial strains--one strain expressing CFA/I, one strain expressing CS1/CS3, one strain expressing CS2/CS3, one strain expressing CS4/CS6 and one strain expressing CS5/CS6. However, the present inventors have now devised a method for producing a bacterial cell which is not so restricted in its CS antigen expression. Accordingly, the present invention provides a bacterial cell which expresses three or more coli surface (CS) antigens. The invention also provides a method for making such a cell, comprising introducing a polynucleotide encoding a heterologous CS antigen into a bacterial cell.

[0007] A bacterial cell according to the invention can be used to manufacture a vaccine against ETEC disease. Thus, the invention provides a vaccine against diarrhoea comprising a cell of the invention and a pharmaceutically acceptable carrier or diluent. Since the present cell avoids the previous limitations on cellular CS antigen expression, the invention provides for the first time, a vaccine against diarrhoea comprising bacterial cells which together express all of CFA/I, CS1, CS2, CS3, CS4, CS5 and CS6, wherein the vaccine comprises fewer than 5 bacterial strains. The invention additionally provides a method of vaccinating a mammal against diarrhoea comprising administering to the mammal a cell or vaccine of the invention.

BRIEF DESCRIPTION OF THE FIGURES

[0008] FIG. 1A Structure of the CS4 operon.

[0009] FIG. 1B Map of plasmid pACYC184.

[0010] FIG. 1C Map of plasmid pACYC-csaA.

[0011] FIG. 1D Map of plasmid pACYC-CS4.

[0012] FIG. 2A SDS PAGE analysis of CS antigen expression in strains WS-2252A, ACAM2006, ACAM2006-pCS4 and Strain K-pCS4. Staining is with Simply Blue Safe Stain (Invitrogen).

[0013] FIG. 2B SDS PAGE analysis of CS antigen expression in strains WS-2252A, ACAM2006, ACAM2006-pCS4 and Strain K-pCS4, using Western Blotting.

[0014] FIG. 2C SDS PAGE analysis of the effect of bile salts on CS antigen expression in strains ACAM2006, ACAM2009 and ACAM2006-pCS4. Staining is with Simply Blue Safe Stain (Invitrogen).

[0015] FIG. 2D SDS PAGE analysis of the effect of bile salts on CS antigen expression in strains ACAM2006, ACAM2009 and ACAM2006-pCS4, using Western Blotting.

[0016] FIG. 2E SDS PAGE analysis of CS antigen expression in the absence of bile salts in strain ACAM2006-pCS4 transformed with pGEM-rns. Staining is with Simply Blue Safe Stain (Invitrogen).

[0017] FIG. 3A Stages 1 to 5 in the construction of pJCB12-ompC-CS4-ompC, and features of the primers used.

[0018] FIG. 3B Features of primers used in construction of pJCB12-ompC-CS4-ompC. Forward primers are written 5'-3' in bold. Reverse primers are written 3' to 5' in normal font. Restriction sites are boxed. Additional nucleotides to introduce complementary sequence for overlap extension PCR are underlined.

[0019] FIG. 4 SDS-PAGE analysis of CS antigen expression in strains ACAM2006 and ACAM2006-CS4 showing the effects of bile salts. [0020] (A) Staining is with Simply Blue Safe Stain (Invitrogen) [0021] (B) Western Blot.

[0022] FIG. 5A Structure of the CS1 operon.

[0023] FIG. 5B Map of plasmid pACYC-CS1.

[0024] FIG. 6 SDS-PAGE analysis of CS antigen expression in strains PTL003, ACAM2007 and ACAM2007-pCS1, using Western Blotting.

[0025] FIG. 7A Structure of the CS5 operon.

[0026] FIG. 7B Construction of plasmid pACYC-Xmal.

[0027] FIG. 7c Structure of plasmid pACYC-CS5.

[0028] FIG. 8A SDS PAGE analysis of CS antigen expression in the presence of bile salts in strains ACAM2009 and ACAM2009-pCS5, using Western Blotting.

[0029] FIG. 8B SDS PAGE analysis of the effect of bile salts on CS antigen expression in strains ACAM2006, ACAM2009 and ACAM2009-pCS5, using Western Blotting.

[0030] FIG. 9 SDS PAGE analysis of CS antigen expression in strains ACAM2009, PTL003 and PTL003-pCS4. Staining is with Simply Blue Safe Stain (Invitrogen).

[0031] FIG. 10 SDS PAGE analysis of CFA/I and CS antigen expression in strains WS2252A, ACAM2010 and ACAM12010-pCS4: [0032] (A) Staining with Simply Blue Safe Stain (Invitrogen) [0033] (B) Western Blot.

[0034] FIG. 11 Map of suicide vector plasmid pDM4. u=unknown sequence, unknown length.

[0035] FIG. 12 Map of suicide vector plasmid pJCB12.

[0036] FIG. 13 Diagram of method used to create specific gene deletion constructs by overlap extension PCR. Step 1=PCR amplification of two DNA fragments. Step 2=overlap extension PCR using DNA products from reaction 1 and reaction 2 of step 1 and amplification of the overlap PCR product. R and S stand for restriction enzyme sites.

[0037] FIG. 14 Diagram of method used to demonstrate correct integration of suicide vector into targeted locus by linkage PCR.

BRIEF DESCRIPTION OF THE SEQUENCES

[0038] SEQ ID NO:1 is nucleotide sequence encoding cooA of the CS1 operon as under GenBank accession number M58550.

[0039] SEQ ID NO:2 is nucleotide sequence encoding cooB of the CS1 operon as under GenBank accession number X62495.

[0040] SEQ ID NO:3 is nucleotide sequence encoding cooC and cooD of the CS1 operon as under GenBank accession number X76908.

[0041] SEQ ID NO:4 is nucleotide sequence encoding cfaD as under GenBank accession number M55609.

[0042] SEQ ID NO:5 is nucleotide sequence encoding cotB, cotA, cotC and cotD of the CS2 operon as under GenBank accession number Z47800.

[0043] SEQ ID NO:6 is nucleotide sequence encoding ms as under GenBank accession number J04166.

[0044] SEQ ID NO:7 is nucleotide sequence of the CS3 operon as under GenBank accession number X16944.

[0045] SEQ ID NO:8 is nucleotide sequence encoding csaA, csaB, csaC, csaE and IS1 of the CS4 operon as under GenBank accession number AF296132.

[0046] SEQ ID NO:9 is nucleotide sequence encoding csfA, csfB, csfC, csfE, csfF and csfD of the CS5 operon as under GenBank accession number AJ224079.

[0047] SEQ ID NO:10 is nucleotide sequence encoding csvR as under GenBank accession number X60106.

[0048] SEQ ID NO:11 is nucleotide sequence encoding cssA, cssB, cssC and cssD of the CS6 operon as under GenBank accession number U04844.

DETAILED DESCRIPTION OF THE INVENTION

[0049] A cell of the invention may be derived from any bacterial cell which is capable of expressing an ETEC CS antigen on its surface. In general, the cell is derived from a bacterium that infects a mammalian host by the oral route. The cell may derive from or be descended from a bacterium that invades and grows within eukaryotic cells and/or colonises mucosal surfaces. In general, the cell is gram negative but in some embodiments gram positive bacteria may be used. The bacterium is generally a pathogen.

[0050] The bacterial cell used may be from the genus Escherichia, Salmonella, Shigella or Vibrio. Preferably the cell of the invention is an E. coli cell. The present cell may be produced from an ETEC or a non-ETEC E. coli strain which does not itself express any ETEC CS antigens.

[0051] Preferably the present cell is derived or descended from an ETEC strain which endogenously expresses an ETEC CS antigen, such as CS1, CS2, CS3, CS4, CS5 or CS6. The present cell may for example, be produced from a wild-type ETEC isolate. Alternatively, the present cell may be produced from an ETEC strain which is itself derived from a wild-type or native ETEC strain. For example, the present cell may be descended from a strain in which a particular toxin gene or genes has been mutated or deleted, or which comprises a further attenuating mutation, or which expresses a further heterologous antigen as described below. A wild-type ETEC strain can be isolated from a human clinical sample using standard techniques. An example of a standard ETEC strain is H10407, deposited at the ATCC under catalogue #35401.

[0052] A cell of the invention may, for example, be produced from one of ETEC strains ACM2005, ACM2002, ACM2003, ACM2004, ACAM2007, ACAM2008, ACAM 2009 or ACAM2012 listed in Tables 1 and 2. Each of the strains has been deposited by Acambis Research Limited of Peterhouse Technology Park, 100 Fulbourn Road, Cambridge, CB1 9PT, United Kingdom with the European Collection of Cell Cultures (ECACC), CAMR, Salisbury, Wiltshire SP4 0JG, United Kingdom in accordance with the Budapest Treaty. Accession numbers for the deposited strains are given in the Tables. Deposits 01090302 to 01090306 were deposited on 3 Sep. 2001. Deposits 02082964 to 02082968 were deposited on 29 Aug. 2002. Further information about strain characteristics is given in Table 1.

[0053] PTL003 (ACM2005, deposit No. 01090302) (Ref 4, 31) was derived from ETEC strain E1392/75-2A (a) (CS1/CS3, ST minus, LT minus) by targeted deletion of three further attenuating genes (aroC, ompC and ompF) (Table 1). PTL003 has already been tested in two clinical trials and has been shown to be safe and immunogenic.

[0054] Strains with deposit nos. 01090303-01090306 were described in UK Patent Application 0121998.9. Both these and the strains with deposit nos. 02082964 to 02082968 are described in the International patent application, claiming priority from UK patent application 0121998.9, and filed by Acambis Research Limited on the same day as the present International application. The contents of that application are hereby incorporated by reference. Each of the strains has been made toxin negative by specific removal of the known toxin genes.

[0055] A cell according to the invention may express any combination of ETEC CS antigens provided that the cell expresses three or more ETEC CS antigens. A large number of CS antigens have been identified, the most prevalent being CS1, CS2, CS3 (the components of CFA/II) and CS4, CS5 and CS6 (the components of CFA/IV). Additional antigens include CS17, CS7, CS9, CS14, CS12, PCFO159, PCFO166. However CFA/II (GenBank accession no M55661) is not a CS antigen for the purposes of this document.

[0056] Preferably a cell of the invention expresses at least one CS antigen selected from ETEC CS1, CS2, CS3, CS4, CS5, CS6. Thus in one embodiment, the present cell may express three or more CS antigens wherein the CS antigen is selected from CS1, CS2, CS3, CS4, CS5 and CS6. Such a cell may express three, four, five or six of the listed CS antigens. A cell may express the CS antigens in any combination. It is particularly preferred that a cell of the invention expresses one of the following combinations of antigens: [0057] CS1, CS2 and CS3 [0058] CS4, CS5 and CS6 [0059] CS4, CS1 and CS3 [0060] CS1, CS5 and CS6

[0061] Thus a cell of the invention may comprise a mixture of CFA protein, for example, a mixture of CFA/II and CFA/IV proteins.

[0062] Bacterial cells according to the invention include ACAM 2006-pCS4 (CS4, CS5, CS6), ACAM 2006-CS4 (CS4, CS5, CS6), ACAM2012-pCS4 (CS4, CS5, CS6), ACAM2012-CS4 (CS4, CS5, CS6), ACAM 2007-pCS1 (CS1, CS2, CS3), ACAM 2009-pCS5 (CS4, CS5, CS6), PTL003-pCS4 (CS1, CS3, CS4) and ACAM2006-pCS1 (CS1, CS5, CS6).

[0063] Strain ACAM2012-CS4 was deposited as ACAM2013 on 29 Aug. 2002 by Acambis Research Limited of Peterhouse Technology Park, 100 Fulbourn Road, Cambridge, CB1 9PT, United Kingdom with the European Collection of Cell Cultures (ECACC), CAMR, Salisbury, Wiltshire, SP4 0JG, United Kingdom, in accordance with the Budapest Treaty. The strain was given Accession No. 02082969 (Table 2).

[0064] In general, a bacterial cell according to the invention expresses a CS antigen on its surface, typically assembled into fimbriae or pili. A candidate cell can be tested for expression of a particular ETEC CS antigen by methods known in the art and described in the Examples herein. For example, in one embodiment a suspension of candidate cells is heated to extract CS antigens and centrifuged. The supernatant is then isolated, subjected to gel electrophoresis and analysed by Western blotting using antigen-specific antibodies or direct protein staining. Typically a strain known to express the particular antigen is included as a positive control for comparative purposes. A negative control may also be included. Suitable methods are known to those skilled in the art. Preferably the level of expression of a CS antigen in a cell of the invention is effective to induce an immune response in a host subject to which the cell has been administered, e.g. as a component of an immunogenic composition such as a vaccine.

[0065] Typically in a wild-type ETEC strain, a CS antigen is expressed from an operon of genes. Usually an operon includes genes for one or two structural proteins, a chaperone and an usher protein. The chaperone and usher proteins generally facilitate transport of the structural protein to the surface of the bacterium for assembly into fimbriae. An operon may be located on the bacterial chromosome (as in the case of CS4 and CS2 in some strains) or on a low copy number plasmid (as in the case of CS1, CS3, CS5 and CS6). In addition, each operon is associated with a regulatory gene, the product of which controls the expression of the operon genes. However, this regulatory gene may be located some distance from the operon itself.

[0066] The CS1 operon (27) is illustrated in FIG. 5A and consists of four genes cooB, cooA, cooC and cooD (GenBank M 58550, X62495 and X76908). The major pilin protein is encoded by cooA, with cooC and cooD encoding transport functions. cooB is required for assembly. Expression of the operon genes is regulated by a further gene cfaD (GenBank M55609).

[0067] The CS2 operon (17) consists of four genes, cotA, cotB, cotC, cotD (GenBank Z 47800) with cotA encoding the major pilin protein. Transport functions are encoded by cotC and cotD. Expression of these genes is regulated by another separate gene rns (GenBank J04166).

[0068] The sequence of the CS3 operon (20) may be found at GenBank X16944. The operon include cstA, which encodes a chaperone protein, cstB which encodes a protein with an usher function and cstH which encodes structural protein.

[0069] The structure of the CS4 operon, which consists of four genes csaA, csaB, csaC, csaE (Genbank AF296132) is shown in FIG. 1A. csaA encodes a chaperone, csaB encodes a major subunit protein, csaC encodes an usher protein and csaE encodes a fimbrial tip protein. Expression of the CS4 genes is regulated by the cfaD gene (GenBank M55609).

[0070] The CS5 operon (15)(Genbank AJ 224079) consists of six genes, csfA, csfB, csfC, csfE, csJF and csfD. csfA encodes a major structural protein, csfC encodes a transport protein and csfD encodes a minor structural protein. The operon is illustrated in FIG. 7A. Regulation of the CS5 operon genes is dependent on the presence of bile salts. The gene involved may be csvR (GenBank X60106).

[0071] The sequence of the CS6 operon (33, 35) is available at GenBank U04844. The operon includes the cssA and cssB genes which encode structural proteins and the cssC and cssD genes which encode transport proteins.

[0072] The sequences of the above operons and genes, specified above by GenBank accession number are also presented in the present sequence listing, as described in the "Brief Description of the Sequences".

[0073] Typically, a cell of the invention expresses sufficient genes, including structural, transport and regulatory genes, to enable expression of a given ETEC CS antigen on the bacterial surface. Usually, the antigen is assembled on the surface in fimbriae or pili. Thus, for a given CS antigen, the present cell expresses a structural gene or genes and if necessary, one or more genes, the products of which will aid correct transport to and assembly on the bacterial surface of the structural protein.

[0074] Any of the genes referred to above, structural, transport or regulatory, may be useful in the present invention. In one embodiment, an antigenic structural, transport or regulatory protein expressed by a cell of the invention may be encoded by: [0075] (i) a DNA molecule comprising the nucleotide sequence of a gene specified above by GenBank accession number or included in the present sequence listing; [0076] (ii) a DNA molecule which hybridises to the complement of the nucleotide sequence in (a); or [0077] (iii) a DNA molecule which encodes the same amino acid sequence as the DNA molecule of (a) or (b) but which is a degenerate form of the DNA molecule of (a) or (b).

[0078] A homologue of the polynucleotide sequence in (a) may be used in the invention. Typically, a homologue has at least 40% sequence identity to the corresponding specified sequence, preferably at least 60 or 80% and more preferably at least 90%, 95% or 99% sequence identity. Such sequence identity may exist over a region of at least 15, preferably at least 30, for instance at least 40, 60 or 100 or more contiguous nucleotides.

[0079] Methods of measuring polynucleotide homology are well known in the art. For example, the UWGCG Package providing the BESTFIT program can be used to calculate homology, e.g. on its default settings (Devereux et al (1984) Nucleic Acids Research 12, p 387-395). The PILEUP and BLAST algorithms can also be used to calculate homology or line up sequences (typically on their default settings), for example as described in Altschul (1993) J Mol Evol 36: 290-300 or Altschul et al (1990) J Mol Biol 215: 403-10.

[0080] A homologue typically hybridises with the corresponding specified sequence at a level significantly above background. The signal level generated by the interaction between the homologue and the specified sequence is typically at least 10 fold, preferably at least 100 fold, as intense as background hybridisation. The intensity of interaction may be measured, for example, by radiolabelling the probe, e.g. with ³²P. Selective hybridisation is typically achieved using conditions of medium to high stringency, for example 0.03M sodium chloride and 0.003M sodium citrate at from about 50° C. to about 60° C.

[0081] The homologue may differ from the corresponding specified sequence by at least 1, 2, 5, 10 or more substitutions, deletions or insertions over a region of at least 30, for instance at least 40, 60 or 100 or more contiguous nucleotides, of the homologue. Thus, the homologue may differ from the corresponding specified sequence by at least 1, 2, 5, 10, 30 or more substitutions, deletions or insertions.

[0082] A homologue structural gene may be tested by expressing the gene in a suitable host and testing for cross reactivity with antibody specific to the particular antigen. A homologue transport or regulatory gene may be tested for the ability to complement the activity of the endogenous transport or regulatory gene in a bacterial cell.

[0083] A transport gene may be endogenous to the structural gene or genes with which it functions. Thus the present cell may comprise both the structural gene or genes and one or more of the transport genes of a given CS operon. In a preferred embodiment, a cell of the invention comprises a complete operon for a given CS antigen.

[0084] In a further embodiment, a cell of the invention may comprise less than the whole operon for a given CS antigen. For example, a cell of the invention may comprise the structural gene or genes for a given CS antigen, without one or more of the endogenous transport genes. In such a cell, one or more heterologous transport genes function to transport the structural protein to the surface of the cell. Thus, for example, structural CS1 gene products may be transported to the surface by the action of the transport genes of CS2 (cot C and cot D) and vice versa (17). Thus, a cell according to the invention may comprise an incomplete operon for a given CS antigen, provided that the antigen is expressed on the bacterial surface. For example, the cell may express the structural gene or genes of a particular operon, accompanied by one or more heterologous but complementary transport genes.

[0085] It is generally preferred that the present cell expresses a CS antigen stably; a cell exhibiting stable antigen expression is a better candidate for an ETEC vaccine. As described above, in native ETEC isolates, the CS2 and CS4 operons are generally located on the bacterial chromosome and the CS1, CS3, CS5 and CS6 operons are generally carried on low copy number plasmids. Thus, in the absence of specific selection mechanisms, endogenous CS genes are generally stably maintained and expressed over many generations. The present cell generally comprises one or more heterologous polynucleotide sequences encoding one or more CS antigens. Such heterologous polynucleotide sequences may be present in the cell on a plasmid or may be located, as a result of an insertion event, in the bacterial chromosome.

[0086] Where a heterologous polynucleotide sequence is carried on and expressed from a plasmid, the plasmid is preferably stably maintained. Stable maintenance is also desirable for ETEC CS bearing native plasmids--this may become an issue where, for example, a native plasmid is manipulated for attenuation purposes as described below. Methods for enhancing plasmid stability are discussed below.

[0087] Preferably a heterologous polynucleotide encoding a CS antigen is positioned in the bacterial chromosome, for example by a recombination event. A chromosomal location generally provides more stable expression than a plasmid location and would also result in a heterologous operon being present at a copy number similar to that occurring in wild-type strains. Where the cell has been obtained by introduction of a heterologous CS antigen encoding polynucleotide into an ETEC strain which endogenously expresses a CS antigen, chromosomal placement also helps to prevent "overloading" with the additional antigenic protein and to minimise interference with regulation of expression of the endogenous antigenic proteins.

[0088] In a wild type ETEC strain, regulation of expression of a CS operon is often effected by a gene which is at some distance from the structural gene or genes. In the present cell, expression of a heterologous CS antigen may be regulated by a regulatory gene native to the cell, a homologue thereof, or a by a heterologous regulatory gene. Thus, where the present cell is obtained by introduction of a heterologous polynucleotide into an E. coli strain which endogenously expresses an ETEC CS antigen, expression of the heterologous sequence may be regulated by a regulatory gene associated with the endogenous CS operon. Without wishing to be bound by theory, it is proposed that host specific regulatory proteins are able to interact with the genes that have been introduced artificially and changed in mode of regulation. Thus, for example, when CS4 genes are introduced into a CS5/CS6 expressing E. coli strain, without the native CS4 regulatory gene cfaD, expression of the CS4 genes may be regulated by the endogenous CS5 regulatory gene, which is dependent on the presence of bile salts. However, if a rns regulator (a homologue of cfaD) is also introduced to this cell, expression of the CS4 gene becomes bile salt independent. Conversely, when CS5 genes are introduced into a CS4/CS6 strain, without the native regulatory gene, expression of the CS5 genes may be regulated by the CS4 regulatory gene cfaD.

[0089] In one embodiment it may be preferable for CS antigen expression in the present cell to be bile salt independent. For example, this may be advantageous if a cell of the invention is to be "preloaded" with CS antigen, in preparation for vaccine use, since animal product free medium may be used to induce CS antigen expression.

[0090] A cell according to the invention has not been isolated in nature. Accordingly, the present cell is generally obtainable by introducing a polynucleotide (e.g. DNA) encoding a heterologous ETEC CS antigen into a suitable bacterial host cell.

[0091] Suitable host strains (or starter strains) from which the present cell may be produced have been described above. Preferably the host strain is an ETEC strain which endogeneously expresses an ETEC CS antigen. In particular the host strain may express CFA/II (includes CS1/CS3 and CS2/CS3) or CFA/IV (includes CS4/CS6 or CS5/CS6). In one embodiment the host strain is selected from deposited strains ACM2005, ACM2003, ACM2002, ACM2004, ACAM2007, ACAM2008, ACAM2009 or ACAM2012 listed in Tables 1 and 2 or descendents of these cells. A descendent is any cell derived from the deposited cell. A descendent may include a cell with one or more further attenuating mutations, such as those described herein. A descendent may include a cell engineered to express a heterologous antigen, also as described herein.

[0092] In general the polynucleotide introduced into the host strain comprises one or more structural genes for a CS antigen. Preferably the polynucleotide includes the structural gene or genes for at least one antigen selected from ETEC CS1, CS2, CS3, CS4, CS5 and CS6. GenBank accession numbers for these gene sequences are given above and in Table 5. Sequences corresponding to those entered under the accession numbers are included in the present sequence listing.

[0093] The process for making the present cell may also comprise the step of introducing into a cell a polynucleotide comprising one or more transport (typically chaperone or usher) genes. In one preferred embodiment, the method comprises introducing to a suitable cell a polynucleotide comprising one or more structural genes for an ETEC CS antigen and one or more complementary transport genes. Alternatively the structural genes and the transport genes may be present on separate polynucleotides. Preferably a method is used which comprises introducing a polynucleotide comprising a heterologous ETEC CS operon. In a further embodiment, transport genes, endogenous to an ETEC host strain may act on an antigen, including a heterologous antigen, in the cell, aiding its progression to the cell surface.

[0094] As already described, regulation of expression of a heterologous ETEC CS antigen in the present cell may be carried out by a regulatory gene endogenous to or already present in the host strain. Alternatively or additionally, the method of deriving the present cell may comprise the step of introducing into a cell a polynucleotide comprising a suitable regulatory gene. A regulatory gene when introduced in this way may be present on the same or a different polynucleotide to the structural gene or genes and/or any transport genes which are being introduced. Typically the regulatory gene will be one which regulates expression of the subject ETEC CS antigen in a native ETEC strain or a homologue thereof. Therefore in one embodiment the present process comprises introducing to a suitable cell a polynucleotide comprising a heterologous ETEC CS operon together with its native regulatory gene.

[0095] A polynucleotide which is to be introduced into a cell according to the present invention may take any suitable form. Typically the polynucleotide is a plasmid vector. In general, the polynucleotide bears a selectable marker.

[0096] The polynucleotide may comprise one or more expression control elements, such as a promoter, enhancer or transcription terminator sequence, operably linked to a gene or genes which need to be expressed. For example, a suitable plasmid expression vector may be used. Suitable vectors are known in the art.

[0097] Preferably a polynucleotide, introduced into a cell in accordance with the invention, is to be inserted in the bacterial cell chromosome, for example, by homologous recombination. Methods for causing chromosomal insertion are known in the art. For instance, the polynucleotide may be introduced on a suitable suicide vector. For example, suicide vector pJCB12 described herein may be used.

[0098] Methods for introducing foreign DNA into prokaryotic cells are known in the art. Examples of suitable methods include conjugation and electroporation. Transformant colonies may be screened and selected for correct uptake of the heterologous nucleic acid using standard screening and selection procedures. Selected transformants may be tested for surface expression of a given ETEC CS antigen using the screening procedures described above.

[0099] In a preferred embodiment the present method comprises: [0100] (i) introducing a polynucleotide encoding ETEC CS4 antigen into a CS5/CS6 ETEC cell; or [0101] (ii) introducing a polynucleotide encoding ETEC CS1 antigen into an CS2/CS3 ETEC cell; or [0102] (iii) introducing a polynucleotide encoding ETEC CS5 antigen into a CS4/CS6 ETEC cell; or [0103] (iv) introducing a polynucleotide encoding ETEC CS4 antigen into a CS1/CS3 ETEC cell.

[0104] It is generally preferred that a cell of the invention is attenuated with respect to a wild type ETEC cell. Thus, the present cell typically has reduced virulence, such that it does not cause ETEC associated disease such as diarrhoea, but is nevertheless capable of stimulating an immune response. This is particularly so when the cell is for use in a vaccine to combat ETEC associated disease such as diarrhoea. Use of an attenuated cell in such vaccine generally results in a lower probability of a vaccinated subject experiencing side-effects, such as diarrhoea symptoms.

[0105] A cell of the invention may be attenuated in a number of ways, generally by some kind of mutation. For example, toxicity may be reduced by use of a cell which does not express the ETEC associated toxins or does not express these toxins in a functional or toxic form. Alternatively, or additionally, attenuation may arise by mutation of a further bacterial gene, typically to cause its inactivation or deletion (e.g. by replacement).

[0106] Colonisation of a host small intestine by ETEC cells is accompanied by the secretion of enterotoxins. Two types of enterotoxins identified in ETEC strains are the heat labile toxin (LT) and the heat stable toxin (ST). LT is highly homologous in structure to the cholera toxin, a multisubunit protein of the form AB₅. The A sub-unit is the active component in the toxin, which functions to increase the activity of adenylate cyclase. This is delivered into host cells by the B subunits, which bind to gangliosides on the cell surface. ST is a small (19 amino acids) non-immunogenic polypeptide, that has guanylate cyclase stimulating activity. In addition, it has been demonstrated recently that a large proportion of ETEC strains also produce EAST1, a heat stable toxin, similar in size and mode of action to ST but different in sequence, which was originally identified in enteroaggregative E. coli strains.

[0107] Thus, in one embodiment a cell of the invention generally does not express functional ETEC toxins, such as LT, ST and EAST1. Such a cell may for example be referred to as a toxin-minus strain. GenBank accession numbers for these toxins axe given in Table 5.

[0108] Attenuation may arise because the cell is derived or produced from a non-ETEC bacterial cell which does not naturally or endogenously express one or more of the ETEC toxins. Alternatively, the cell may derive from an ETEC cell which is attenuated with respect to the ETEC toxins. Such an ETEC strain may arise as a result of spontaneous mutation, for example a deletion event. Alternatively, or additionally, a toxin-minus strain may be produced using genetic engineering or molecular biology techniques.

[0109] Clinical isolates obtained from a long term epidemiological study carried out by scientists at the US NAMRU3 facility in Cairo are listed in Table 3. A number of these isolates are toxin-minus with respect to at least one of the toxins referred to above. Some of these isolates have been used to produce further attenuated strains as described below.

[0110] An example of a spontaneous toxin minus strain is E1392175-2A (CFA/II, ST minus, LT minus) (10) (Table 1). Examples of ETEC strains which have been manipulated to ensure specific removal of all known toxin genes are those with accession numbers 01090304, 1090305, 01090306 (derived from strains H, E, and J in Table 3 respectively) and 02082964, 02082965, 02082966 and 02082968 as described above and shown in Tables 1 and 2. Deposited strain 01090302 is also a toxin minus strain.

[0111] A bacterial cell of the invention may be attenuated due to mutation of a further gene. The attenuation may, for example, be brought about by deleting or inactivating one or more of the following genes: aroA, aroC, aroD, aroE, pur, htrA, ompC, ompF, ompR, cya, crp, phoP, phoQ, surA, rfaY, dksA, hupA, invE and clpB. Preferred combinations of genes include: [0112] at least one aro gene (e.g. aroA, aroC, aroD or aroE) and at least one omp gene (e.g. ompC, ompF or ompR); [0113] at least one aro gene (e.g. aroA, aroC, aroD or aroE) and the htrA gene; [0114] aroC, ompF and ompC.

[0115] For example strains PTL002 and PTL003 (Accession number 01090302) were derived from strain E1392/75-2A above by mutation of aroC/ompR and aroC/ompC/ompF respectively.

[0116] Furthermore, it is generally preferred that any antibiotic resistance genes are removed from a bacterial cell of the invention before use in a vaccine. Bacteria isolated from the wild often contain antibiotic resistance genes, such as resistance genes against ampicillin, streptomycin, sulphmethoxazole, kanamycin, trimetheprim and tetracycline. These genes can be removed using the suicide vector and methods described herein or by methods known to those skilled in the art.

[0117] As noted above, attenuation of the present bacterial cell may arise from one or more mutations in the bacterial genome. A mutation(s) which prevents expression of an enterotoxin or other gene generally deletes or inactivates the gene. Generally there is a complete knock-out of the function of the gene. This may be achieved either by abolishing synthesis of any polypeptide at all from the gene or by making a mutation that results in synthesis of non-functional polypeptide. In order to abolish synthesis of polypeptide, either the entire gene or its 5'-end may be deleted. A deletion or insertion within the coding sequence of a gene may be used to create a gene that synthesises only non-functional polypeptide (e.g. polypeptide that contains only the N-terminal sequence of the wild-type protein). In the case of a toxin gene, the mutation may render the gene product non-toxic.

[0118] A mutation is generally a non-reverting mutation. This is a mutation that shows essentially no reversion back to the wild-type for example when the bacterium is used as a vaccine. Such mutations include insertions and deletions. Insertions and deletions are preferably large, typically at least 10 nucleotides in length up to the length of the entire gene or coding sequence, for example from 10 to 600 nucleotides. Preferably, the whole coding sequence or whole gene is deleted.

[0119] The mutations are typically site-directed. They may be specific or selective to the toxin gene or other gene. For example, in the case of deleting or inactivating the ST gene in a CFA/I or CS5/CS6 strain, the mutation must specifically target the ST gene without deleting or inactivating the (closely-linked) CFA/I gene, CS5 gene or CS6 gene.

[0120] A mutation may arise from use of a suicide vector. In particular, the pJCB12 suicide vector may be used. This vector is described in UK Patent Application No. 0121998.9, and also in the International patent application claiming priority from that UK application and filed by Acambis Research on the same day as this International application. The contents of that International application are hereby incorporated by reference. The vector allows specific and reliable targeting, and is typically less than 5 kb in size (for example from 2.5 to 5 kb or 2.5 to 4 kb).

[0121] An attenuating mutation may be introduced using a suicide vector or by other methods known to those skilled in the art (26). Appropriate known methods include cloning the DNA sequence of the wild-type gene into a vector, e.g. a plasmid, and inserting a selectable marker into the cloned DNA sequence or deleting a part of the DNA sequence, resulting in its inactivation. A deletion may be introduced by, for example, cutting the DNA sequence using restriction enzymes that cut at two points in or just outside the coding sequence and ligating together the two ends in the remaining sequence. Alternatively, and more usually now, a mutant allele in which the flanking regions of a target gene are amplified separately and linked directly together in a separate overlap PCR reaction, with omission of the intervening target sequence, can be constructed (31). A plasmid carrying the mutated DNA sequence can be transformed into the bacterium by known techniques such as electroporation and conjugation. It is then possible by suitable selection to identify a mutant wherein the inactivated DNA sequence has recombined into the chromosome of the bacterium and the wild-type DNA sequence has been rendered non-functional by homologous recombination.

[0122] In another embodiment of the invention, the present cell further expresses an antigen that is not expressed by the native bacterium (a "heterologous antigen"), in addition to an ETEC CS antigen. This is particularly useful where the cell is to be used in a vaccine, since the presence of additional antigens may enhance the immune response generated. In the case that the bacterium is an ETEC bacterium, the antigen may be from another strain of ETEC, so that the vaccine provides protection against the other strain. Furthermore, the bacterium may be engineered to express more than one such heterologous antigen, in which case the heterologous antigens may be from the same or different strains.

[0123] The heterologous antigen may be a complete protein, a part of a protein containing an epitope or a fusion protein. Useful antigens include ETEC non-toxic components or non-toxic mutants of E. coli LT (e.g. the B subunit and mutants of the A subunit, accession numbers for which are given in Table 5), and LT-ST fusion proteins (1, 7-9)

[0124] The DNA encoding a heterologous antigen may be expressed from a promoter that is active in vivo. A promoter may be a strong promoter, such as the tac promoter or a derivative thereof. Promoters that have been shown to work well are the nirB promoter (6, 16), the htrA promoter (16), the pagC promoter (13) and the ssaH promoter (32). For expression of derivatives of LT, CT or ST, the wild-type promoters could be used.

[0125] As noted, it is preferred that a plasmid expressing a heterologous antigen is stably maintained in the present cell. In order to prevent loss of a plasmid expressing a heterologous antigen or of a native plasmid, an element may be added to the plasmid which enhances its stability.

[0126] There are a number of "toxin/antitoxin" plasmid stability determining systems known, for example parDE (25) from plasmid RP4 (2), and hok/sok (also known as parB from plasmid R1 or pndAB from plasmid R483 (18, 19)) which could be used to improve plasmid stability. These systems encode two functions: firstly a toxic entity that would kill cells in which it is expressed, which has a long biological half-life, and secondly an antitoxic entity that prevents this killing but has a short biological half-life. In the event that a plasmid encoding these functions is segregated during division the daughter cell which does not contain the plasmid exhausts its supply of antitoxin and is killed by the more persistent toxin moiety. Thus, only cells that continue to harbour the plasmid are maintained in the growing population.

[0127] Another system that may be used to enhance the stability of a plasmid in accordance with the invention is a multimer resolution system. Multimer resolution systems confer stability by resolving plasmid multimers into single plasmid copies, hence decreasing the chance of plasmid free daughter cells being generated by random segregation at cell division. A number of site-specific recombination systems which act to resolve plasmid multimers into monomers have been identified. In accordance with such a system, the plasmid to be stabilised contains a recognition site for a site-specific recombinase and the host cell contains a DNA sequence encoding a site-specific recombinase. The recombinase acts on the recognition site and thereby directs proper segregation of the plasmid during cell division. The recombinase may be encoded on the plasmid to be stabilised or in the chromosome of the host cell.

[0128] The recombinase is generally a resolvase. Examples of resolvases which may be used in the invention include the Cre recombinase of plasmid P1, the E. coli XerC (ArgR) protein, the D protein recombinase of plasmid F, the ParA recombinases of plasmids RP4 and RK2, the site-specific recombinase of plasmid R1, resolvases encoded by the Tn3-like transposable genetic elements and the Rsd resolvase from the Salmonella dublin virulence plasmid.

[0129] The recognition elements which may be used in the present invention include those for the above recombinases. Any recognition element recognised by the site-specific recombinase employed may be used. Suitable recognition elements include those sites recognised by the XerC site-specific recombinase, such as the cer site of plasmid ColE1 and the similar ckr site of plasmid ColK (29), the psi site of plasmid pSC101 and the cer like site of plasmid pHS-2 from Shigella flexneri. Other recognition elements which may be used include the crs site from the Salmonella dublin virulence plasmid, the loxP site of plasmid P1, the rfs site of the F plasmid and the res site of the Tn3-like transposable genetic element

[0130] In a particularly preferred embodiment of the invention, the recombinase is the Rsd resolvase which acts via the crs recognition element. The Rsd/crs system is described in detail in WO 02/28423.

[0131] A cell according to the invention is suitable for use in the manufacture of a composition or medicament to target bacterial infection.

[0132] Typically the bacterium is ETEC. For example, compositions including the present cell may be used against ETEC associated disease, such as diarrhoea. In general, the composition comprises at least one cell strain of the invention and a pharmaceutically acceptable carrier or diluent. The composition may also comprise one or more other bacterial strains or components.

[0133] A suitable cell for inclusion in the composition may be any of those described herein. In general the composition is capable of generating an immune response in an individual to at least the three or more CS antigens expressed in the cell. This capability can be tested by immunisation studies. For example, the composition may be administered to an animal such as a human and tests may be made for generation of an antibody or T-cell response specific for the three or more CS antigens. Antiserum generated following administration of a composition to an animal can be evaluated for ability to specifically bind either the cell expressing the CS antigens or purified CS antigen. Subsequently the animal may be challenged with an ETEC strain to evaluate whether there is a protective immune response.

[0134] Preferably, an immunogenic composition can generate an immune response against at least CFA/I, CFA/II and CFA/IV strains. Thus the immunogenic composition preferably comprises one or more bacterial strains according to the invention such that each of the above antigens is represented. The composition may comprise one or more other strains. In one embodiment, the composition of the invention comprises: [0135] (i) a strain which expresses CS1, CS2 and CS3 [0136] (ii) a strain which expresses CS4, CS5 and CS6; and [0137] (iii) a strain which expresses CFA/I.

[0138] Examples of CFA/I strains include ACM2001 and ACAM2010 listed in Table 2.

[0139] In a preferred embodiment, the immunogenic composition is a vaccine. For example a vaccine against an ETEC associated disease such as diarrhoea. The vaccine is generally a live attenuated vaccine, comprising one or more live attenuated bacterial strains, at least one of which is a cell strain according to the invention.

[0140] Traditionally, due to the restricted expression of CS antigens by ETEC cells, an effective vaccine has had to include a minimum of 5 bacterial strains. However, by providing the present cells, the present invention now provides an anti-ETEC vaccine which may comprise fewer than 5 strains--for example 3 or 4 strains.

[0141] The present composition or vaccine may be formulated using known techniques for formulating attenuated bacterial compositions or vaccines. The composition or vaccine is advantageously presented for oral administration, for example as a dried stabilised powder for reconstitution in a suitable buffer prior to administration. Reconstitution is advantageously effected in a buffer at a suitable pH to ensure the viability of the bacteria. In order to protect the attenuated bacteria and the composition or vaccine from gastric acidity, a sodium bicarbonate preparation is advantageously administered with each administration of the vaccine. Alternatively, the composition or vaccine is presented in a lyophilised encapsulated form.

[0142] The composition or vaccine may be used in the treatment, such as the vaccination, of a mammalian host, particularly a human host. An infection caused by a microorganism, especially a pathogen, may therefore be targeted or prevented by administering an effective dose of a vaccine prepared according to the invention. The dosage employed may ultimately be at the discretion of the physician, but will be dependent on various factors including the size and weight of the host and the type of composition or vaccine formulated. However, a dosage comprising the oral administration of from 10⁷ to 10¹¹, e.g. from 10⁸ to 10¹⁰, bacteria per dose may be convenient for a 70 kg adult human host.

EXAMPLES

[0143] The following Examples serve to illustrate the invention.

[0144] Unless otherwise indicated, the methods used are standard biochemistry and molecular biology techniques (2, 26).

MATERIALS AND METHODS

Strains

[0145] This work was carried out using a number of clinical isolates of ETEC. Strain E1392/75-2A (9) was provided by the National Collection of Type Cultures and Pathogenic Fungi, Central Public Health Laboratories, Colindale, UK. This is a spontaneous toxin-loss variant of Strain E1392, originally isolated in Hong Kong. Attenuating deletions were introduced into the aroC, ompC and ompF genes at Acambis, UK to create vaccine strain PTL003 (Deposited strain 01090302, Tables 1 and 2) (31). The other wild-type strains were isolated at Naval Medical Research Unit 3 (NAMRU3), Cairo, Egypt from patients with diarrhoea. Toxin genes were deleted from these strains and attenuating deletions were introduced into the aroC, ompC and ompF genes at Acambis, UK (UK Patent application 0121998.9). The strains used in the Examples, their genotypes/phenotypes and where appropriate, the accession numbers for deposited strains are described in Tables 1 and 2.

[0146] The Examples also use three laboratory strains of E. coli which carry the pir gene on the chromosome. These are SY327λpir (23), SM10λpir (28) and DH5αλpir (P Barrow, Institute for Animal Health, Compton).

Growth of Strains

[0147] All media used for maintenance and growth of strains during vaccine development were made from certified animal-free components. Basic LB media was composed of 10 g/l soy peptone, 5 g/l yeast extract and 10 g/l NaCl. Agar (15 g/l) and antibiotics were added as required. CFA agar was used for analysis of vaccine strains and was composed of 10 g/l agar, 10 g/l soy peptone, 1.5 g/l yeast extract, 0.005% MgSO₄, 0.0005% MnCl₂ and 0.15% bile salts.

Preparation of Cs Proteins by Heat Extraction

[0148] Strains were grown overnight in LB media, with antibiotics as required, at 37° C. with shaking. A 10 μl aliquot was then spread onto a 15 ml CFA-agar plate containing antibiotics where appropriate. The plate was incubated overnight at 37° C. until a confluent lawn was achieved. The bacteria were then scraped off the plate into 0.5 ml PBS. 10 μl of this cell suspension was added to 1 ml PBS and the OD₆₀₀ was measured (OD₆₀₀ of 1=1×10⁹ cells/ml). An aliquot of cell suspension containing 10⁹ cells was centrifuged at 13000 rpm for 5 min and the pellet was resuspended in 10 PBS. The sample was heated at 65° C. for 10 min and then centrifuged at 13000 rpm for 5 min. The supernatant was retained and added to 10 μl 2× Novex Tris-Gly sample buffer (Invitrogen) containing 2 μl 1M DTT. Samples were heated at 95° C. for 5 min and then analysed by SDS-PAGE on 14% Novex Tris-Gly gels (Invitrogen) followed by direct staining with SimplyBlue SafeStain (Invitrogen) or by immunoblotting.

Detection of Proteins by Western Blot

[0149] Samples were electrophoresed on 14% Novex Tris-Gly gels at 125V until the dye front was about 0.5 cm from the bottom of the gel. SeeBlue Plus2 markers (Invitrogen) were used as molecular weight standards. Transfer onto 0.45 μm nitrocellulose membrane (LC2001, Invitrogen) was performed for 1 h at 25V according to the manufacturer's instructions (XCell II Blot Module EI 9051 instruction manual, Invitrogen). After transfer, the membrane was blocked for 1 h using PBST (Sigma P-3813, 0.01M Phosphate-buffered saline (0.138M NaCl, 0.0027M KCl) with 0.05% Tween pH7.4) and 5% Marvel dried milk powder. The membrane was washed four times (10 min each) in PBST containing 1% Marvel. The blot was incubated with primary antibody in PBST/1% Marvel for 1 hour and then washed four times as before. The blot was incubated with secondary antibody (anti-rabbit HRP conjugate, Sigma A4914) in PBST/1% Marvel for 1 h and then washed four times as before and twice in PBST alone. The blot was developed using the Pierce Super Signal West Pico reagent according to the manufacturer's instructions and exposed to X-ray film for various time periods.

PCR Reactions

[0150] Except where otherwise described, two types of PCR reactions were formed: reactions to amplify DNA fragments for cloning and reactions for screening and analysis of plasmids/strains. To obtain fragments for cloning, the high fidelity enzyme Pfu Turbo (Stratagene) was used according to the protocols set out in the Instruction Manual #039001b. For screening clones, and cloning the rns gene, Taq polymerase (Invitrogen, Catalogue number 10342-020) was employed according to the manufacturer's instructions.

Oligonucleotides

[0151] The sequences of the oligonucleotides, for example the primers, used in the Examples are given in Table 4.

Example 1

Production of a CS4, CS5, CS6 Strain (CS4 Expressed in a CS5/CS6 Strain)

1.1 Cloning the CS4 Operon

[0152] The sequence of the CS4 operon has been published in Genbank (Reference number AF296132). Computer-aided restriction analysis of this sequence (using the VectorNTi program Version 7, Informax) revealed two BglII sites, one (site (a)) in the first gene of the operon (csaA) and one (site (b)) downstream of the last gene in the operon (csaE) (FIG. 1A). Thus the major part of the operon could be cloned by restriction digestion using these BglII sites, avoiding any PCR-related errors. However, it was necessary to clone the 5' region of the operon by PCR amplification since there were no suitable restriction sites that would permit direct cloning. Two PCR primers (Primer 47151 and Primer 47152) were used to amplify the csaA gene up to and including the BglII site, using chromosomal DNA from Strain WS2252-A (CS4/CS6, Table 1) as template. The forward primer, Primer 47151, introduced a SalI restriction site upstream of the csaA gene, whilst the reverse primer, Primer 47152, introduced an SphI site downstream of the BglII site. These sites were used to clone the 723 bp PCR product into the stable, low-copy number vector pACYC184 ((5); supplied by NEB, FIG. 1B) which was also digested with SalI and SphI. This vector was named pACYC-csaA (FIG. 1C). In this construct, site (a) in FIG. 1A is preserved and can be used for cloning the large fragment from the CS4 operon (between the (a) and (b) sites).

[0153] Thus, another portion of chromosomal DNA from Strain WS2252-A was digested with BglII and subjected to agarose gel electrophoresis. DNA fragments of approximately 5 kb were isolated from the gel using a QIAquick gel extraction kit and were ligated into pACYC-csaA that had been digested with BglII and treated with Calf Intestinal Phosphatase (CIP). Ligation mixture was used to transform E. coli XL10 Gold KanR and transformed colonies were selected on agar plates containing chloramphenicol. Colonies with plasmids containing the 3' region of the CS4 operon in the correct orientation were detected by PCR using Primer 47151 and Primer 47150 that binds within csaC (FIG. 1A). Correct plasmids containing the complete CS4 operon were named pACYC-CS4 (FIG. 1D).

1.2 Expression of CS4

[0154] 1.2.1 Expression of CS4 from the Plasmid pACYC-CS4

[0155] The plasmid pACYC-CS4 was used to transform two strains: `Strain K` is a derivative of a CS4/CS6 strain that has spontaneously lost its CS4 gene such that it expresses CS6 only; ACAM2006 is an attenuated, toxin-minus derivative of WS2773-E, a CS5/CS6 ETEC strain. The strains were designated Strain K-pCS4 and ACAM2006-pCS4 respectively and were maintained on chloramphenicol.

[0156] CS proteins were purified by heat extraction from Strain K-pCS4 and ACAM2006-pCS4 as described in the "Materials and Methods". For comparison, Strain WS-2252A, a CS4/CS6 strain, and ACAM2006 were similarly analysed. After heating for 5 min at 95° C., the samples were analysed by electrophoresis on 14% Tris-Gly polyacrylamide gels (Novex). Bands were visualised by staining with SimplyBlue SafeStain (Invitrogen) (FIG. 2A) or by Western Blot using CS4-specific antibodies (FIG. 2B) as described in the "Materials and Methods".

[0157] CS4 antigen was clearly detected in the control strain, WS-2252A, and also in Strain K-pCS4 indicating that the cloned operon was intact and functioning. However, CS4 was not detected in either ACAM2006 or in ACAM2006-pCS4. It seemed likely that this disparity was due to the presence of different regulatory mechanisms in Strains K and ACAM2006. The cfaD gene product, a protein that is present in Strain K but not in ACAM2006, normally regulates the CS4 operon. Expression of the CS5 operon is poorly understood. The csvR gene has been isolated from another CS5/CS6 strain and is 87% homologous to cfaD. The protein product is able functionally to replace activity of cfaD to mediate CFA/I expression, however, it's role in expression of CS5 is unclear (11, 14). CS5 biosynthesis also differs from expression of CS1, CS2, CS3, CS4 and CS6 in that bile-salts are necessary for production of fimbriae. It was speculated that it might be necessary to add bile salts to the CFA agar used for growth of ACAM2006-pCS4 in order to stimulate expression of the CS4 operon. CS proteins were purified by heat extraction from Strains ACAM2006, ACAM2009 (an attenuated derivative of WS2252A) and ACAM2006-pCS4 as described in the "Materials and Methods". Samples were analysed by electrophoresis on 14% Tris-Gly polyacrylamide gels (Invitrogen) and bands were visualised by staining with SimplyBlue SafeStain (Invitrogen) or by Western blot using CFA/IV specific antibodies as described in the "Materials and Methods". In the presence of bile salts good quantities of CS4 and CS5 were detected in the CFA preparation from ACAM2006-pCS4 (FIGS. 2C and D) indicating that a regulator protein present in ACAM2006, possibly csvR, can activate the CS4 operon and induce expression. CS6 was also detected in ACAM2006-pCS4. Although the levels of this antigen are low they are similar to those seen in CS5/CS6 strains such as ACAM2006. Hence we demonstrated that it was possible to express all three CFA/IV CS proteins within a single strain.

[0158] Bile-salt dependent regulation should work well in vivo in a vaccine strain where expression of CS proteins is expected to mimic that seen in a natural infection. However, it may be possible to change the pattern of regulation by introduction of a different regulator such as rns or cfaD (rns is homologous to cfaD). To investigate this an rns gene was isolated from strain E1392-2A by PCR using primers RNS-03 and RNS-04. The PCR product was amplified using Taq polymerase that leaves an `A` overhang and permits the use of cloning vector pGEM-T Easy (Promega) for cloning. The PCR construct was cloned into the vector according to the supplier's instructions to create plasmid pGEM-rns. This plasmid was introduced into ACAM2006-pCS4 by electroporation and selection on media containing ampicillin and chloramphenicol. CS proteins were prepared from cells grown in CFA media without bile salts and samples were analysed by SDS-PAGE on 14% Tris-Gly gels (Novex) stained with Simply Blue Safe Stain (Invitrogen). Expression of CS4, CS5 and CS6 that was not dependent on the presence of bile salts, was observed (FIG. 2E). However, the amount of CS5 in the cells had a deleterious effect on the level of CS4 in the cell compared with induction by bile salts in the absence of rns (as seen in FIGS. 2C and 2D). Using a low copy number plasmid for expression of rns may have reduced this effect. Thus, regulation of the CS proteins in the vaccine strains could be altered by introduction of different regulator proteins.

1.2.2 Chromosomal Expression

[0159] CS4 and CS2 operons are normally found on the chromosome in wild-type strains and the other CS operons are located on low copy number plasmids. To overcome plasmid stability problems and to create a strain suitable for use as a vaccine, it was desirable to insert the CS4 operon into the chromosome of ACAM2006. This would also result in the operon being present at a similar copy number to that seen in wild-type strains and it was hoped that this would prevent `over-loading` with the additional CS protein. Excessive CS4 protein expression could cause attenuation of the strain and/or interfere with expression of the endogenous CS proteins.

1.2.2.1 Construction of Targeting Vector

[0160] The cloning strategy for chromosomal insertion is described in detail in FIG. 3. The suicide vector pJCB12 (FIG. 12) was used for introducing the operon into the chromosome. This plasmid contains the R6K origin and can only be propagated in strains containing λpir (21). In this case pJCB12 and its derivatives were propagated in E. coli strain DH5αλpir. It was decided to insert the operon into the ompC locus of ACAM2006. Since the ompC gene itself had already been deleted from this strain, its 5' and 3' flanking regions were used to target the CS4 operon into the correct site.

[0161] The first stage of the cloning strategy involved individually amplifying the 5' and 3' ompC flanking regions and the csaA gene by PCR (Stage 1, FIG. 3A). Primers 47173 and 47174 were used to amplify the upstream flanking region of the ompC gene and primers 47177 and 47178 were used to amplify the downstream region of the ompC gene. ACAM2006 chromosomal DNA was used as the template. A 721 bp fragment including the 5' region of the CS4 operon, up to and including the BglII site in the csaA gene was amplified, using primers 47175 and 47176 and WS-2252A chromosomal DNA as template. Primers 47174 and 47175 contained extended sequences such that the 3' sequence of the upstream-ompC flanking region PCR product and the 5' end of the csaA PCR product contained complementary sequences. This allowed the two fragments to be joined together by overlap extension PCR using primers 47173 and 47176 (Stage 2, FIG. 3A). Similarly, primers 47176 and 47177 contained extended sequences such that the 3' sequence of the csaA PCR product and the 5' sequence of the downstream-ompC flanking region PCR product contained complementary sequences. This allowed the ompC-csaA fragment to be fused to the downstream-ompC flanking region by overlap extension PCR using primers 47173 and 47178 (Stage 3, FIG. 3A).

[0162] The ompC-csaA-ompC fragment contained BamHI sites at the 5' and 3' ends, introduced by the primers 47173 and 47178. These sites were used to clone the ompC-csaA-ompC fragment into the BglII site of pJCB12, destroying both the BamHI and BglII recognition sequences (Stage 4, FIG. 3A). This plasmid was called pJCB12-ompC-csaA-ompC. This meant that the BglII site in the csaA gene was now unique and could be used for cloning the remainder of the CS4 operon. Therefore, the remaining 3' region of the CS4 operon was excised from pACYC-CS4 by digestion with BglII and inserted into the BglII restriction site inside the csaA gene (Stage 5, FIG. 3A). Recombinant plasmids with the csaBCE fragment in the correct orientation were identified by PCR screening using oligos 47105 and RGK01. This completed construction of the suicide vector for targeting the CS4 operon into the ompC locus and the plasmid was designated pJCB12-ompC-CS4-ompC.

1.2.2.2 Insertion of the CS4 Operon into the Chromosome

[0163] pJCB12-ompC-CS4-ompC was used to transform the conjugation-competent, tetracycline sensitive E. coli strain SM10λpir (23). ACAM2006 was made tetracycline-resistant by transformation with plasmid pACYC184 (5). Strain SM10 λpir-pJCB12-ompC-CS4-ompC was conjugated with ACAM2006-TetR by cross-streaking on LB agar plates. A 2 cm square area was densely streaked with one strain and then over-streaked with the other strain in a perpendicular direction. After overnight growth at 37° C. the cells were scraped off and spread onto agar plates containing chloramphenicol and tetracycline. Transconjugants in which pJCB12-ompC-CS4-ompC had been inserted into the chromosome of ACAM2006-TetR formed colonies, whereas neither of the parent strains were able to grow on this combination of antibiotics. Homologous recombination of the CS4 operon into the correct site (ie the ompC locus) was continued by PCR using oligos 4732 and 47105.

[0164] Having targeted the CS4 operon into the ompC locus it was necessary to select clones where the vector sequences had been excised, but the CS4 operon had remained in the chromosome. pJCB12 contains the sucrase gene which confers toxicity to cells grown on sucrose, hence correctly targeted transconjugants were grown in medium containing 5% sucrose to select for loss of the suicide vector. Only strains in which the suicide vector had been excised were able to grow. Excision of the vector sequence would mean that the chloramphenicol resistance gene was also lost, therefore sucrose-resistant colonies were further screened to check that they were sensitive to chloramphenicol. Chloramphenicol-sensitive, sucrose-resistant colonies were screened by PCR to identify clones in which the CS4 operon had been retained in the ompC locus (primers 4732 and 47105). A strain in which the CS4 operon was correctly inserted was selected and designated ACAM2006-CS4.

1.2.2.3 Expression of CS4 from the Chromosomal Locus

[0165] ACAM2006-CS4 was grown overnight on plates containing LB agar, CFA agar or CFA agar plus 0.15% bile salts. CS proteins were prepared by heat-extraction as described in the "Materials and Methods". Similar preparations were made from ACAM2006 for comparison. Samples were analysed by SDS-PAGE on 14% Tris-Gly polyacrylamide gels (Novex) Bands were visualised by staining with SimplyBlue SafeStain (Invitrogen) or by Western Blot (FIGS. 4A & B). Blots were stained with rabbit CS4, CS5 and CS6-specific antibodies and an anti-rabbit HRP conjugate (Sigma A4914) as described in the "Materials and Methods".

[0166] Low levels of CS6 were detected from ACAM2006 and ACAM2006-CS4 when the stains were grown either with or without bile salts, although slightly higher levels were detected when bile salts were present. CS5 was detected in both stains but only when bile salts were included in the agar. CS4 was present only in ACAM2006-CS4 and only in the presence of bile salts.

[0167] Thus a strain has been created in which CS4, CS5 and CS6 are all expressed at good levels. As seen with plasmid pACYC-CS4, control of CS4 expression has shifted to become bile-salt dependent, similar to that seen naturally for CS5 expression. This type of regulation should work well in a vaccine strain where CS proteins are induced in vivo. It may be possible, however, to change the pattern of regulation by introduction of a different regulator such as rns or cfaD (Section 1.2.1).

[0168] ACAM2006 and ACAM2006-CS4 carry a P2-like bacteriophage genome in the chromosome (Section 1.2.1). A large part of that genome was deleted from both strains to improve their suitability as components of a vaccine. This deletion did not affect expression of CS4, CS5 or CS6. The bacteriophage-deleted ACAM2006 strain is ACAM2012 (deposited strain with accession number 020282968). Strain ACAM2012-CS4 (ACAM2013) has been deposited with accession number 02082969, as described above.

Example 2

Production of a CS1, CS2, CS3 Strain (CS1 Expressed in a CS2/CS3 Strain

2.1 Cloning of the CS1 Operon

[0169] The genes of the CS1 operon of ETEC have been sequenced (Genbank Accession Numbers M58550, X62495, X76908). These sequences were compiled into the complete operon (cooB, cooA, cooC, cooD) and the restriction sites were analysed using the VectorNTi program Version 7 (Informax) (FIG. 5A). Two sites suitable for cloning the intact operon by restriction digestion were identified: EcoRV upstream of cooB, and 1301 downstream of cooD. Plasmid DNA purified from the CS1/CS3 strain E1392/75-2A (Table 1) was digested with EcoRV and BglII and subjected to agarose gel electrophoresis. DNA fragments of approximately 6.6 kb were isolated from the gel using a QIAquick gel extraction kit. This was the correct size for the CS1 operon as predicted from the compiled Genbank sequences. The 6.6 kb fragments were ligated into the cloning vector pACYC184 ((5); Supplied by NEB, FIG. 1B) that had been digested with EcoRV and BamHI. Ligated colonies were used to transform E. coli K12 and colonies were selected on agar plates containing chloramphenicol. Correct constructs were identified by digestion with HindIII or HindIII/SphI, This construct was designated pACYC-CS1 (FIG. 5B).

2.2 Plasmid Expression

[0170] Strain ACAM2007, an attenuated CS2/CS3 strain, was transformed with pACYC-CS1 by electroporation. This strain was designated ACAM2007-pCS1. Strains PTL003 (CS1/CS3), ACAM2007 and ACAM2007-pCS1 were spread onto CFA-agar plates and CFA proteins were prepared by heat-extraction as described in the "Materials and Methods". Samples were analysed by electrophoresis on 14% Tris-Gly polyacrylamide gels. In order to resolve the CS2 and CS3 proteins, which are approx 15.3 and 15.1 kDa respectively, 14 cm gels were utilised. CS proteins were detected by Western Blot, (FIG. 6) stained with rabbit CFA/II-specific antibodies (which recognise CS1, CS2 and CS3) and developed as described in the "Materials and Methods".

[0171] CS1 and CS3 were detected in PTL003, CS2 and CS3 were detected in ACAM2007 and CS1, CS2 and CS3 were detected in ACAM2007-pCS1. Therefore we had demonstrated that it is possible to express three CFA/II antigens in a single strain.

2.3 Chromosomal Insertion

[0172] A CS2/CS3 strain expressing CS1 may form a component of an ETEC vaccine even when the CS1 operon is carried on a stable plasmid, however for increased strain stability it would be desirable to insert the CS1 operon into the chromosome of the strain. A similar strategy to that described in Section 1.2.2 for the CS4/CS5/CS6 strain, or other technique known in the art, could be employed.

Example 3

Production of a CS4, CS5, CS6 Strain (CS5 Expressed in a CS4/CS6 Strain

3.1 Cloning of the CS5 Operon

[0173] The sequence of the CS5 operon has been published (Genbank AJ224079). Computer aided restriction analysis of this sequence (using Vector NTi Version 7, Informax) revealed an AgeI site upstream of the first gene of the operon (csfA) and an XmaI site downstream of the last gene in the operon (csfD) (FIG. 7A). These sites were suitable for cloning the intact operon by restriction digestion, avoiding any PCR-related errors. The `overhang` generated by digestion with AgeI is complementary to the XmaI overhang, hence the fragment could be cloned directly into XmaI-cut vector. However the vector pACYC184 did not contain an XmaI site and so required some modification (FIG. 7B). Approximately 276 bp of pACYC184 from the unique BamHI site at position 3961 to the unique SalI site at position 4237 were amplified using Primer 47180 and Primer 47182. Both the BamHI and SalI sites were preserved, and Primer 47182 also introduced a new Xmal site 5' of the SalI site. The 295 bp PCR-amplified DNA fragment was digested with SalI and BamHI and was cloned into pACYC184 that had also been digested with SalI and BamHI, thus introducing a new and unique Xmal site into the vector. This vector was named pACYC-XmaI (FIG. 7B).

[0174] Plasmid DNA was isolated from Strain WS2773-E (CS5/CS6) and a portion was digested with AgeI and Xmal and subjected to agarose gel electrophoresis. DNA fragments of approximately 7 kb were isolated from the gel using a QIAquick gel extraction kit (QIAgen) and were ligated into pACYC-XmaI that had also been digested with Xmal and treated with Calf Intestine Alkaline Phosphatase. Ligation mixture was used to transform E. coli XL10 Gold KanR and colonies were selected on agar plates containing chloramphenicol. Colonies were screened for plasmids containing the CS5 operon by PCR with Primers 47168 and 47167. The orientation was determined using primers 47180 and 47168. A correct plasmid was designated pACYC-CS5 (FIG. 7c).

3.2 Plasmid Expression

[0175] Strain ACAM2009, an attenuated CS4/CS6 strain, was transformed with pACYC-CS5 by electroporation and the strain was designated ACAM2009-pCS5.

[0176] Strains ACAM2009 and ACAM2009-pCS5 were spread onto CFA-agar plates containing 0.15% bile salts and CFA proteins were purified as described in the "Materials and Methods". Samples were analysed by SDS PAGE on 14% Tris-Gly gels (Novex) and bands were visualised by Western Blot (FIG. 8A). Blots were stained with rabbit CFA/IV-specific antibodies that detect CS4, CS5 and CS6 and anti-rabbit HRP conjugate (Sigma A4914). All three CS proteins (CS4, CS5 and CS6) were detected in Strain ACAM2009-pCS5 in the presence of bile salts. To determine whether bile salts were necessary for CS5 expression (as in natural CS5/CS6 strains) ACAM2006, ACAM2009 and ACAM2009-pCS5 were spread onto agar plates with or without bile salts and CFA proteins were purified as described in the "Materials and Methods". Samples were analysed by SDS-PAGE followed by Western blotting using CFA/IV-specific antibodies (FIG. 8B). As expected, in ACAM2006 CS5 was expressed only when bile salts were present in the media, whereas in ACAM2009 CS4 was present both with and without bile salts in the media. In ACAM2009-pCS5 both CS4 and CS5 were present independently of the presence of bile salts in the CFA agar. Presumably the cfaD regulator that is present in ACAM2009 and controls expression of CS4 in a bile-salt independent manner is also able to regulate expression of CS5.

3.3 Chromosomal Insertion

[0177] A CS4/CS6 strain expressing CS5 may form a component of an ETEC vaccine even when the CS5 operon is carried on a stable plasmid, however for increased strain stability it would be desirable to insert the CS5 operon into the chromosome of the strain. A similar strategy to that described in Section 1.2.2 or other technique known in the art could be employed.

Example 4

Other Strain Combinations

[0178] We wished to know if expression of CS proteins in the strains is restricted by CFA-type, for example would it be possible to express CFA/II proteins within a CFA/IV strain? To investigate this, plasmids carrying cloned CS operons were used to transform ETEC strains of different CFA types.

4.1 CFA/II and CFA/IV Co-Expression

[0179] pACYC-CS4 (Section 1.1) was used to transform PTL003 (an attenuated CS1/CS3 strain, Table 1) to create PTL003-pCS4. PTL003, PTL003-pCS4 and ACAM2009 (an attenuated CS4/CS6 strain) were spread onto CFA-agar plates and CS proteins were purified as described in the "Materials and Methods". Samples were analysed by electrophoresis on 14% Tris-Gly gels (Novex) and bands were visualised by staining with SimplyBlue SafeStain (Invitrogen) (FIG. 9). CS1 and CS3 were detected in PTL003 and CS4 was detected in ACAM2009. In PTL003-pCS4 CS1, CS3 and CS4 were present. This indicated that it is possible to express CFA/II and CFA/IV antigens in a single strain.

4.2 Reference Example: CFA/1 and CFA/IV Co-Expression

[0180] In order to test if multiple expression of CS proteins in a single strain is restricted by CFA type, pACYC-CS4 (Section 1.1) was used to transform strain ACAM2010 (an attenuated CFA/I strain) to create ACAM2010-pCS4. ACAM2010, ACAM2010-pCS4 and WS-2252A (CS4/CS6) were spread onto CFA-agar plates and CFA proteins were purified as described in the "Materials and Methods". Samples were analysed by electrophoresis on 14% Tris-Gly gels (Novex) and bands were visualised by staining with SimplyBlue SafeStain (Invitrogen) or by Western Blot using CS4 and CFA/1-specific rabbit antibodies (FIG. 10). CFA/I was detected in ACAM2010 and CS4 was detected in WS-2252A. In strain ACAM2010-pCS4 both CFA/I and CS4 were present. This indicated that it is possible to express to different types of CFA antigen in a single strain.

Example 5

Introduction of Multiple Genetic Mutations into Bacterial Vaccine Strains

[0181] This section describes the generation of a novel suicide vector plasmid, pJCB12, and its use for the introduction of mutations into chromosomal or plasmid encoded gene loci. Production and use of pJCB12 is described in UK Patent Application 0121998.9 and in the International patent application claiming priority from UK Patent Application 0121998.9, and filed by Acambis Research Limited on the same day as the present International application. The contents of that International application are incorporated by reference.

[0182] Suicide vector plasmids such as pDM4 (24), pJCB12, pCVD442 (12) and others can be used to introduce defined genetic constructs into specific targets in the bacterial genome. Plasmid pJCB12 is a new, optimised suicide vector based on the previously constructed suicide vector pDM4. The defined genetic construct to be introduced into the bacterial genome may be a deletion mutation of a specific gene, or a more complex structure such as, for example, an insertion of a gene within another and expressed from a chosen promoter from within the construct. Generally, the extremities of, the constructs will consist of nucleotide sequences derived from the region of the genome to be targeted.

[0183] Suicide vectors pDM4 and pJCB12 possess a number of key components (see FIGS. 11 and 12):

[0184] An origin of replication which directs replication of the vector in some strains of bacteria but not in others, oriR6K. oriR6K is the origin of replication derived from the naturally occurring plasmid R6K. This origin requires the R6K pir gene for replication, which is absent from the suicide vectors. Three laboratory E. colt strains are available that carry the pir gene on their chromosome, which are SY327λpir, SM10λpir, and DH5αλpir. All three of these strains may be used to propagate pDM4, pJCB12 and their derivatives.

[0185] A transfer origin that directs conjugative transfer of the vector from one bacterial strain to another, mobRP4. mobRP4 is the transfer origin from the naturally occurring plasmid RP4. This allows the conjugative transfer of pDM4 and pJCB12 and their derivatives to recipient bacterial strains. In order to function, mobRP4 requires the genes encoding the RP4 transfer functions to be present in the donor bacterial cell. Laboratory E. coli strain SM10λpir carries these genes on its chromosome, and so this strain can be used as a donor strain for pDM4, pJCB12 and their derivatives.

[0186] A gene encoding a product that is toxic to bacterial cells when the cells are grown under defined conditions, sacB. sacB codes for levansucrase which produces a product that is toxic to Gram-negative bacteria when grown on sucrose.

[0187] A selectable marker, cat. cat codes for chloramphenicol acetyltransferase and confers resistance to the antibacterial chloramphenicol.

[0188] A multiple cloning site (MCS), i.e. a site into which defined genetic constructs may be cloned for introduction into a recipient bacterial cell.

[0189] Suicide vector pJCB12 is a modified version of pDM4 in which much of the intergenic and non-functional DNA has been removed. Therefore, there is much less opportunity for incorrect targeting using this suicide vector. Whereas pDM4 is approximately 7 kb in size, pJCB12 is only 3 kb but retains all the key components. In particular, the mobRP4 region of pJCB12 is merely 0.15 kb, and the IS1-like nucleotide sequences have been removed from the sacB region. These modifications are particularly advantageous when manipulating ETEC strains which generally harbour many plasmids that could act as undesirable targets of homologous recombination with components of the suicide vector. In addition, the smaller size of pJCB12 allows easier in vitro manipulation and construction of derivatives because smaller DNA molecules ligate together and transform into E. coli hosts more efficiently, improving the chances of obtaining derivatives of the correct construction. The smaller size also allows greater efficiency when introducing the constructs into recipient bacteria by transformation rather than by conjugation.

[0190] Laboratory E. coli strain SM10λpir can be used to transfer pJCB12 and its derivatives to recipient bacterial strains by conjugation because it has the tra functions from plasmid RP4 inserted into its chromosome. However, strain SM10λpir shows relatively low transformation frequencies. For this reason, strain DH5αλpir would normally be used for the construction of pJCB12 derivatives, and once derivatives of the correct construction have been identified these would be transferred to SM10λpir for introduction to recipient strains by conjugation.

Construction of Suicide Vector pJCB12

[0191] Suicide vector pJCB12 was constructed by several rounds of overlap extension PCR (30, FIG. 13) using pDM4 plasmid DNA as template. Initially, four fragments were amplified from pDM4 by PCR using the high fidelity DNA polymerase, Pfu Turbo®. These were the oriR6K fragment, amplified using oligonucleotides 4714 and 4715; the mobRP4 fragment amplified using oligonucleotides 4716 and 4717; and the cat gene that was amplified in two parts using oligonucleotides 4718 with 4719 and 4720 with 4721. This was done in order to remove an EcoRI restriction enzyme site within the cat gene. The oriR6K fragment and the mobRP4 were then joined in an overlap extension PCR reaction using oligonucleotides 4714 and 4717. Likewise, the cat fragments were joined using oligonucleotides 4718 and 4721. These two resulting fragments were then joined in a final overlap extension PCR reaction using oligonucleotides 4717 and 4718. The resulting PCR product was ligated and transformed into SY327λpir cells and transformants were selected on L-agar supplemented with chloramphenicol at 20 mg/ml. Transformants harbouring plasmids of the correct size were obtained and one of these, called pDM4A7, was chosen for further manipulation.

[0192] At this stage, clearly the oriR6K and cat components of the plasmid pDM4A7 are functional. However, in order to confirm that the mobRP4 locus was functional plasmid pDM4A7 was transformed into strain SM10λpir. These transformants were picked onto L-agar supplemented with chloramphenicol at 15 mg/ml and naladixic acid at 5 mg/ml. This L-agar was cross-streaked with cells of strain SY327λpir. While chloramphenicol selects those bacterial cells which harbour pDM4A7, nalidixic acid selects for SY327λpir. After overnight incubation, many colonies grew where the strains were cross-streaked, but none grew elsewhere on the plate, confirming that pDM4A7 is mobilisable from strain SM101pir and that the mobRP4 locus is functional.

[0193] Plasmid pDM4A7 was then digested with EcoRI, treated with Pfu Turbo® DNA polymerase and ligated in order to remove the EcoRI restriction enzyme site to generate plasmid pDM4A7DEcoRI. A short HindIII fragment from pDM4 which includes the multiple cloning site was then ligated into pDM4A7DEcoRI digested with HindIII. The ligation reaction was transformed into SY327λpir and transformants selected on L-agar supplemented with 20 mg/ml chloramphenicol.

[0194] Oligonucleotide R6K-01 hybridises within the short HindIII fragment from pDM4 which includes the multiple cloning site. Therefore, transformants were screened by PCR using oligonucleotides R6K-01 and 4720 in order to identify those harbouring the desired plasmid construct. A number of such transformants were identified, and one of these, called pDM4A7DE, was chosen for further manipulation.

[0195] Plasmid pDM4A7DE carries three EcoRI sites very close together on the short HindIII fragment from pDM4 which includes the multiple cloning site. The two very short EcoRI fragments of pDM4A7DE were therefore removed by digestion with EcoRI followed by ligation. This resulted in a pDM4A7DE derivative that possess only one EcoRI site which was called pJCB10. The region of pJCB10 that includes oriR6K and the MCS was amplified using oligonucleotides 4715 and 4917 and nucleotide sequence determinations for part of this fragment were performed using oligonucleotide 4917. This presented us with the nucleotide sequence across the MCS which was previously unknown.

[0196] The sacB gene was then amplified using Pfu DNA polymerase and oligonucleotides 4722 and 4723. The 1.6 kb product was ligated with the plasmid vector pPCR-Script®(Stratagene) and transformed into E. coli XL10 Gold® cells (Stratagene). Transformants were obtained and the functionality of the sacB gene was confirmed by plating the clones onto L-agar and 5% sucrose agar. One construct gave good growth on L-agar, and none on 5% sucrose agar, and so was chosen as the source of the sacB gene. The sacB gene was then digested from this clone using the restriction enzyme PstI, sites for which were incorporated into oligonucleotides 4722 and 4723 for this purpose, and ligated with pJCB10 also digested with PstI. Colonies were checked by PCR using oligonucleotides 4716 and 4766, yielding a product of the expected size (˜1700 bp). Again the functionality of the gene was confirmed by plating the clones onto L-agar and 5% sucrose agar. One construct grew on L-agar, but not on 5% sucrose agar. Sequencing of this construct using oligonucleotides 4716 and 4766 respectively indicated the orientation of the sacB gene. This construct was called pJCB12.

Principle of Use of pJCB12

[0197] Once a defined genetic construct has been ligated into pJCB12 to give a pJCB12-derivative, the plasmid is transferred into a recipient strain such as an ETEC strain. This may be done according to methods well known in the art, either by conjugation from the pJCB12 host strain SM10λpir, or by transformation of the purified pJCB12-derivative directly into the recipient strain.

[0198] Transconjugants or transformants are selected on bacteriological growth medium supplemented with the antibiotic chloramphenicol. Since the suicide vector pJCB12 is unable to replicate in the absence of the pir gene, any transconjugants or transformants that grow will generally have resulted from fusion of the pJCB12-derivative with another replicon by homologous recombination.

[0199] In order to optimise fully the defined mutation process, a novel approach may be taken to screen transformants or transconjugants using PCR to identify those in which the pJCB12-derivative has targeted the desired region of the genome. For this, one oligonucleotide is designed which hybridises within the pJCB12 nucleotide sequences adjacent to the MCS where the defined genetic construct has been inserted. The other oligonucleotide is designed to hybridise to the region of the genome to be targeted, adjacent to but outside of the defined genetic construct. Transformants or transconjugants that are positive using this PCR will have the pJCB12-derivative targeted to the correct region of the genome (see FIG. 14).

[0200] Once the correct recombinants have been identified, derivatives need to be isolated in which the pJCB12 vector has been lost. Such derivatives may be selected by supplementing the bacteriological growth medium with 5% sucrose, This sucrose selection may be made more efficient using a modified L-medium in which the NaCl ingredient is absent and supplemented with 5% sucrose. Under these conditions the sacB gene of pJCB12 is toxic, and only derivatives where the sacB gene has been lost will grow. This event again occurs by homologous recombination and has a number of outcomes. Firstly, a reversion event will result in the targeted region remaining as it was. Secondly, homologous recombination may result in the defined genetic construct being swapped with the targeted region resulting in the defined construct being incorporated at the target region. In addition, if the targeted region is part of a plasmid, such as many of the toxin genes of ETEC strains, then two additional events may occur. These are, thirdly, an undefined spontaneous deletion event, resulting in the loss of a part of the targeted region which may extend beyond the boundaries of the defined genetic construct, and, fourthly, the loss of the whole plasmid, an event which may be termed "specific plasmid curing".

[0201] Testing of sucrose resistant derivatives by PCR can identify the desired recombinants. For this, oligonucleotides that hybridise at each end of the targeted region and outside of the defined genetic construct are used. If the PCR product is the same size as prior to introduction of the pJCB12-derivative construct, then a reversion event has occurred. If, for example the genetically defined construct is a deletion mutation, then the PCR product should be smaller than previously and of a predictable size. Specific plasmid curing and undefined spontaneous deletion will normally result in no PCR product or non-specific products of unexpected size in this type of PCR reaction.

[0202] In summary, vector pJCB12 (or another similar vector of the invention) may be used in a method for producing a bacterial cell in which a target gene (e.g. a toxin gene such as ST, LT or EAST1 or a chromosomal gene such as an omp or aro gene) is deleted, inactivated or replaced, which method comprises transferring the vector into a bacterial cell containing the target gene and selecting for a cell in which the target gene has been deleted, inactivated or replaced. The selection may be carried out using a multi-stage procedure along the following lines: [0203] Selecting for a colony of cells which contains the selectable marker. If the cell into which the vector is transferred is one that does not support replication of the vector from the origin of replication in the vector, selecting for such a colony of cells identifies cells in which the vector has become incorporated into a cellular replicon; [0204] Carrying out PCR to select for a cell in which the vector has correctly targeted to the target gene, wherein one of the primers used in the PCR hybridizes to vector sequence adjacent to the cloning site and the other hybridizes to a site in the cellular DNA adjacent to the target gene. A positive PCR indicates that the vector has targeted to the target gene.

[0205] Selecting for a cell from which vector sequence has been lost by growing the cell under conditions which make effective the gene encoding a product that is toxic to the cells when grown under defined conditions. Survival of a cell indicates that vector sequence has been lost. Where the gene encoding the toxic product is sacB, the cell may be grown in medium supplemented with sucrose and from which NaCl is absent; the product of sacB is toxic when the cells are grown in this medium. [0206] Finally, PCR may be carried out using primers which hybridize at positions outside, and adjacent to each end of, the target gene, wherein a PCR product smaller than the product obtained from a wild-type cell indicates a deletion mutation.

[0207] For example, in the present study, in general:

[0208] Bacterial Conjugations were performed by mixing donor and recipient ETEC strains on L-agar and incubating at 37° C. for 3 to 18 h. Bacterial growth was scraped off into L-broth and plated onto L-agar plates supplemented with chloramphenicol and another appropriate antibiotic to select ETEC strains (streptomycin for strain B, tetracycline for other ETEC strains) that had incorporated the pJCB12-derivative. For identification of correctly targeted recombinants, transconjugants or transformants obtained by growth on L-agar supplemented with chloramphenicol following introduction of pJCB12-derivative constructs were tested by PCR in order to identify those in which the desired genetic locus had been targeted. For this, one of the oligonucleotides hybridised within the pJCB12 nucleotide sequences adjacent to the multiple cloning site (MCS) where the defined genetic construct had been inserted. The other oligonucleotide hybridised to the genome, adjacent to but outside of the defined genetic construct. In such a PCR, the generation of a fragment indicated that the binding sites for the respective oligonucleotides had become linked, which could occur only if the pJCB12-derivative had targeted the correct region of the genome.

[0209] pJCB12 was excised from transconjugants by growth in the presence of 5% sucrose. Transconjugants or transformants having the pJCB12-derivative targeted to the correct region of the genome were then streaked onto fresh L-agar supplemented with chloramphenicol and another appropriate antibiotic to select ETEC strains (see above), and incubated at 37° C. to allow colonies to grow. L-broth cultures inoculated from these fresh plates were then grown. Cells from these cultures were harvested, resuspened in 5% sucrose broth, and incubated overnight prior to plating serial dilutions on 5% sucrose agar in order to select recombinants in which the pJCB12-derivative had excised. The inoculated sucrose agar plates were then incubated overnight and the resulting colonies tested by PCR using relevant oligonucleotides in order to identify mutants.

TABLE-US-00001 TABLE 1 STRAIN CHARACTERISTICS Accession Antibiotic Strain Parent Strain Number LPS:flagellin Resistance CS Proteins Regulator Toxin Genes E1392/75-2A E1392/75 N/A 06:H16 Strep CS1 CS3 ms None PTL003 E1392/75-2A 01090302 06:H16 Strep CS1 CS3 ms None (submitted as ACM 2005) ACAM2008 PTL003 02082965 06:H16 None CS1 CS3 ms None WS-2773E N/A N/A 039:H12 None CS5 CS6 ?csvR ST EAST LT WS-2773E- WS-2773E 01090305 039:H12 None CS5 CS6 ?csvR None Tox minus (submitted as ACM2002) ACAM2006 WS-2773E- N/A 039:H12 None CS5 CS6 ?csvR None Tox minus ACAM2012* ACAM2006 02082968 039:H12 None CS5 CS6 ?csvR None WS-3504D N/A N/A 0141:H5 Amp CS2 CS3 ms EAST WS-3504D- WS-3504D 01090304 0141:H5 Amp CS2 CS3 ms None Tox minus (submitted as ACM 2003) ACAM2007 WS-3504D- 02082964 0141:H5 None CS2 CS3 ms None Tox minus WS-1858B N/A N/A 071:H- Amp/Tmp/Smz CFA/1 ms ST EAST WS-1858B- WS-1858B N/A 071:H- Amp/Tmp/Smz CFA/1 ms None Tox minus ACAM2010 WS-1858B- 02082967 071:H- None CFA/1 ms None Tox minus WS-2252A N/A N/A 015:H18 None CS4 CS6 cfaD ST EAST LT WS-2252A- WS-2252A 01090306 015:H18 None CS4 CS6 cfaD None Tox minus (submitted as ACM2004) ACAM2009 WS-2252A- 02082966 015:H18 None CS4 CS6 cfaD None Tox minus WS-2511A N/A N/A 04:H- None CS4 CS6 cfaD ST EAST X 2 Strain K WS-2511A- N/A 04:H- None CS6 cfaD ST EAST X 2 Tox minus *ACAM2006 contains a lysogenic phage in its chromosome. ACAM2012 is a derivative of ACAM2006 from which a large part of the genome, including genes critical for phage assembly, have been deleted.

TABLE-US-00002 TABLE 2 CS Antigen Strain Expression Accession No Date of Deposit PTL003 CS1, CS3 01090302 3 Sep. 2001 or ACM 2005 WS-4437A-Tox CFA/I 01090303 3 Sep. 2001 minus or ACM 2001 WS-3504D-Tox CS2, CS3 01090304 3 Sep. 2001 minus or ACM 2003 WS-2773E-Tox CS5, CS6 01090305 3 Sep. 2 001 minus or ACM 2002 WS-2252A-Tox CS4, CS6 01090306 3 Sep. 2001 minus or ACM 2004 ACAM 2007 CS2, CS3 02082964 29 Aug. 2002 ACAM 2008 CS1, CS3 02082965 29 Aug. 2002 ACAM 2009 CS4, CS6 02082966 29 Aug. 2002 ACAM 2010 CFA/I 02082967 29 Aug. 2002 ACAM 2012 CS5, CS6 02082968 29 Aug. 2002 ACAM 2013 CS4, CS5, CS6 02082969 29 Aug. 2002

TABLE-US-00003 TABLE 3 Strain Code Phenotype CFA LT ST EAST1 WS-1858B A O71:H- CFA/I - + + WS-4437A B O128:H12 CFA/I - + - WS-6117A C O153:H45 CFA/I - + + WS-2560B D O25:H- CS4, CS6 + + + WS-2773E E O39:H12 CS5, CS6 + + + WS-4150D F O6:H16 CS2, CS3 + - ? WS-6170A G O17:H18 CS2, CS3 - + ? WS-3504D H O141:H5 CS2, CS3 + + + WS-3517A I O6:H- CS2, CS3 - + + WS-2252A J O15:H18 CS4, CS6 + + + WS-2511A K O4:H- CS4, CS6 - + + WS-2556A L O6:H1 CS4, CS6 - + + WS-4046A M O39:H- None identified + - N.D.

TABLE-US-00004 TABLE 4 OLIGONUCLEOTIDES USED Name Nucleotide sequence Target locus; use 47151 5' CCGGTCGACCTT Cloning csaA (up to Bglll site). Binds 200 bp upstream. ATTGAGGAATATCGG 47152 5' GGCGCATGCAGATCTGATTAGAGC Cloning csaA (up to Bglll site). Includes Bglll & Sphl sites. 47150 5' GGCGCATGCCGGAA Checking orientation of 3' region of CS4 operon in plasmid TTCCATTTGAGACTCCC pACYC-CS4. RNS-03 5' ACATCATAGCGATGGCATCAA Cloning the rns gene from E1392/75-2A. Binds upstream of the gene RNS-04 5' TATTTCAATTCAGTTCGCATCGC Cloning the rns gene from E1392/75-2A. Binds downstream of the gene. 47173 5' GACGGATCCGAAT Forward primer for amplifying upstream region of ompC. Includes GCGAGGCATCCGGTTG BamHI site. 47174 5' TTCCTCAATAAGCTCTG Reverse primer for amplifying upstream region of ompC. Includes TTATATGCCTTTAT TTGC csaA overlap. 47177 5' TCTAATCAGATCTCGACA Forward primer for amplifying downstream region of ompC. ACCAGTTCACTCGTG Includes csaA overlap. 47178 5' GGTGGATCCGTTA Reverse primer for amplifying downstream region of ompC. AAGCGCATCAGCGCGG Includes BamHI site. 47175 5' TATAACAGAGCTTAT Forward primer for amplifying csaA. Includes ompC overlap. TGAGGAATATCGGTGTC 47176 5' GGCAGATCTGATTAGAGCCGCATA Reverse primer for amplifying csaA. Includes ompC overlap. 47180 5' CCGTCCTGTGGATCCTCTACGCCGG Construction of pACYC Xmal. Binds across the BamHI site. 47182 5' ATCGGTCGACGCTC Construction of pACYC Xmal. Binds across the Sall site. TCCCGGGTGCGACTCC Introduces Xmal. 4732 5' GTACAAATAACCTACAAAAAGCCC CS4 chromosome linkage/CS4 retained in ompC locus. 47105 5' TAACGCCTGCTCTAACATTCCC CS4 chromosome linkage/CS4 retained in ompC locus. 47168 5' CGTTATGCAGGAATAATTACG Confirm presence of CS5 in pACYC-CS5. 47168 5' CGTATTTTTATCAACCTTAGC Confirm presence of CS5 in pACYC-CS5. 4714 5' TTCAACCTTAAAAGCTTTAAAAGCCT oriR6K; construction of pJCB12 4715 5' CTACACGAACTCTGA oriR6K; construction of pJCB12 AGATCAGCAGTTCAACC 4716 5' GATCTTCAGAGTTC mobRP4; construction of pJCB12 GTGTAGACTTTCCTTGG 4717 5' GCCACTGCAGCCTCGCAGAGCAGGATTC mobRP4; construction of pJCB12 4718 5' GGCACTGCAGGCGTAGCACCAGGCGTTT cat; construction of pJCB12 4719 5' TCATCCGGAGTTCCGTATGGCAAT cat; construction of pJCB12 4720 5' TGCCATACGGAACTCCGGATGAG cat; construction of pJCB12 4721 5' GCTTTTAAAGCTTTTAAGGTTG cat; construction of pJCB12 AATTCGATCGGCACGTAAGAGGTTC 4722 5' GGCCTGCAGGCAAGACCTAAAATGTG sacB; construction of pJCB12 4723 5' GCGCTGCAGCTTTATGTTGATAAGAAA sacB; construction of pJCB12 4766 5' CAACAGTACTGCGATGAGTGG cat; nucleotide sequence determinations into sacB 4917 5' ATCAACGGTGGTATATCCAGT cat of pJCB12; confirmation of linkage. R6K-01 5' GTGACACAGGAACACTTAACGGC oriR6K; confirmation of linkage

TABLE-US-00005 TABLE 5 GENBANK ACCESSION NUMBERS FOR SEQUENCE DATA EAST1 (astA) AF143819 ST (estA) M18346 LT-A (eltA) V00275 LT-B (eltB) M17874 CFA/I operon M55661 CS1 operon M58550 X62495 X76908 CS2 operon Z47800 CS3 operon X16944 CS4 operon AF296132 CS5 operon AJ224079 CS6 operon U04844 cfaD M55609 csvR X60106 rns J04166 parDE RK2 L05507 sacB X02730 oriR6K M65025 mobRP4 X54459 cat V00622

REFERENCES

[0210] 1. Aitken and Hirst (1993) Vaccine 11(2), 227-233. [0211] 2. Ausubel et al; Current Protocols in Molecular Biology. 1995: John Wiley & Sons Inc. [0212] 3. Burkardt, H. J., G. Riess, and A. Puhler, Relationship of group P1 plasmids revealed by heteroduplex experiments: RP1, RP4, R68 and RK2 are identical. J Gen Microbiol, 1979. 114(2): p. 341-8. [0213] 4. Chatfield WO 99/49026 [0214] 5. Chang A. C. and Cohen S. N. (1978) Journal of Bacteriology 134(3): 1141-1156 [0215] 6. Charles WO 92/15689 [0216] 7. Chong et al (1998) Vaccine 16, 732-740. [0217] 8. Cieplak et al (1995) Journal of Biol. Chem. 270(51), 30545-30550. [0218] 9. Clements (1990) Infect. & Immun. 58(5), 1159-1166. [0219] 10. Cravioto, A. 1980, PhD Thesis, University of London, London, United Kingdom. [0220] 11. de Haan L. A., Willshaw, G. A., Van der Zeijst B. A. and Gaastra W. (1991) FEMS Microbiol Left 67 (3): 341-346 [0221] 12, Donnenberg, M. S. and J. B. Kaper, Construction of an eae deletion mutant of enteropathogenic Escherichia coli by using a positive-selection suicide vector. Infect Immun, 1991. 59(12): p. 4310-7. [0222] 13. Dunstan, S., Simmons, C. and Strugnell, R. Use of in-vivo regulated promoters to deliver antigens from attenuated Salmonella typhimurium. Infection and Immunity (1999) 67, 5133-5141. [0223] 14. Duthy T. G., Staendner L. H., Manning P. A. and Heuzenroeder M. W., (1999) Journal of Bacteriology 181 (18): 5847-5851. [0224] 15. Duthy et al (2001) Microbial Pathogenesis 31: p 115-129 [0225] 16. Everest, P., et al., Expression of LacZ from the htrA, nirB and groE promoters in a Salmonella vaccine strain: influence of growth in mammalian cells. FEMS Microbiol Left, 1995. 126(1): p. 97-101. [0226] 17. Froehlich, B. J., A. Karakashian, H. Sakellario and J. R. Scott, Genes for CS2 Pili of Enterotoxigenic Escherichia coli and their Interchangeability with those for CS1 Pili. Infection and Immunity, 1995 63(12): p. 4849-4856. [0227] 18. Gerdes, K., P. B. Rasmussen, and S. Molin, Unique type of plasmid maintenance function: postsegregational killing of plasmid-free cells. Proc Natl Acad Sci USA, 1986. 83(10): p. 3116-20. [0228] 19. Gerdes, K., et al., The hok killer gene family in gram-negative bacteria. New Biol, 1990. 2(11): p. 946-56. [0229] 20. Jalajakumari M. B. et al (1989) Molecular Microbiology 3(12): 1685-1695. [0230] 21. Kolter R. et al (1978) Cell 15: 1199-1208. [0231] 22. Laemmli, U. K., Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature, 1970. 227(259): p. 680-5. [0232] 23. Miller, V. L. and J. J. Mekalanos, Synthesis of cholera toxin is positively regulated at the transcriptional level by toxR. Proc Natl Acad Sci USA, 1984. 81(11): p. 3471-5. [0233] 24. Milton, D. L., et al., Flagellin A is essential for the virulence of Vibrio anguillarum. J Bacteriol, 1996. 178(5): p. 1310-9. [0234] 25. Roberts, R. C., A. R. Strom, and D. R. Helinski, The parDE operon of the broad-host-range plasmid RK2 specifies growth inhibition associated with plasmid loss. J Mal Biol, 1994. 237(1): p. 35-51. [0235] 26. Sambrook, J., E. F. Fritsch, and T. Maniatis, Molecular cloning: a laboratory manual. 2nd ed. 1989: Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. [0236] 27. Scott J. R. et al (1992) Molecular Microbiology 6(3): 293-300 [0237] 28, Simon, R., U. Priefer, and A. Publer, A broad host range mobilisation system for in vivo genetic engineering: transposon mutagenesis in Gram negative bacteria. Bio/Technology, 1983. 1: p. 784-791. [0238] 29. Summers et al, Mal. Genet. Genes., 20'1(2): 334-338. [0239] 30. Tao, B. Y. and K. C. P. Lee, Mutagenesis by PCR, in PCR Technology: current innovations, H. G. Griffin and A. M. Griffin, Editors. 1994, CRC Press, Inc.: Boca Raton, Fla. p. 69-83. [0240] 31. Turner, A. K., et al., Construction and characterization of genetically defined aro omp mutants of enterotoxigenic Escherichia coli and preliminary studies of safety and immunogenicity in humans. Infect Immun, 2001. 69(8): p. 4969-79. [0241] 32. Valdivia, R. and Falkow, S. Fluorescence-based isolation of bacterial genes expressed within host cells. Science (1997), 277, 2007-2011. [0242] 33. Willshaw G. A. et al (1988) Ferns Microbiol Lett 49: 473-478 [0243] 34. Wolf, M. K. Occurrence, Distribution and Association of O and H Serogroups, Colonisation Factor Antigens and Toxins, of Enterotoxigenic Escherichia coli. Clinical Microbiology Reviews, 1997 10 (4): p 569-584. [0244] 35. Wolf M. K. et al (1997) Ferns Microbiol Lett 148(1): 35-42.

Sequence CWU 1

411703DNAEscherichia coligene(114)..(629)cooA 1atcgatagtg ttgatggaag cgcgggcaag caaggaaagc gaatgctaat aagcattcat 60tgagtattac ttgggtatct taattttcca taataaaaca taatggagtt tatatgaaac 120taaagaaaac aattggcgca atggctctgg cgacattatt tgcaactatg ggagcatctg 180cggtcgagaa gaccattagc gttacggcga gtgttgaccc gactgttgac cttctgcaat 240ctgatggctc tgcgctgccg aactctgtcg cattaaccta ttctccggct gtaaataatt 300ttgaagctca caccatcaac accgttgttc atacaaatga ctcagataaa ggtgttgttg 360tgaagctgtc agcagatcca gtcctgtcca atgttctgaa tccaaccctg caaattcctg 420tttctgtgaa tttcgcagga aaaccactga gcacaacagg cattaccatc gactccaatg 480atctgaactt tgcttcgagt ggtgttaata aagtttcttc tacgcagaaa ctttcaatcc 540atgcagatgc tactcgggta actggcggcg cactaacagc tggtcaatat cagggactcg 600tatcaattat cctgactaag tcaacgtaat tattcagaat tacaacggaa gtcttttaag 660ccagagcagc ggtgtgatgc tgctctgttt ctgtttgtct aga 70321714DNAEscherichia coligene(1001)..(1714)cooB 2gttgtacgca gacttatggt ggaggaacag cttgtcgtca gccgtaaccg tcgtcgcgct 60acagctcata ttgcggagaa atcggaccgg ctccggataa ccttatcgcc agagatttta 120aggcggagca acctaatcag aaatggctgc cagatatcac ggagttccag ttccctgcag 180gtaaagtctg gctatcaccg gtggtggact gcttcgatgg aaaagttgtg agctggtctc 240tcagtacacg ccccgatgct gaactggtca acactatgct ggatagcgct gtcgaaacgt 300taaatgctgg cgaacaaccg gtgatacaca gtgacagagg tgggcattat cgctggccag 360gctggctgga aagagtgaat gcagcaggtc ttattcgctc aatgtcccgt aaaggatgtt 420cacctgataa tgccgcatgc gaaggctttt tcggcagact gaaacggaaa tgtattatgg 480gcgtaaatgg tcggcatcac gccagaaaag ttcatgcagc aagtggatgc ttacatcaga 540tggtataacg agcggcgtat aaaattatcg ctgggtgccg tcagcaccaa aatgtaccgc 600caataatgtg gactggcata ataaagccgt ccaggaaatt atccagatcc ccccccacag 660tgagtcataa tcatcctgac tttccagaac catatggatc gcccgctgac ggacttcggg 720ggagaagtgc gtatttttat tcatcttgtt tacctctttc tctgggagtt tagtcaccaa 780gaactcgggg cagttcaaaa tggttgtcgg aatataactg tgaatgccaa catgaatcac 840tgaacaacat gatgtcgcag gaataaatcg atatttaaat gtcaccaagg gcaagcgcca 900ttggctgctt taatatttgt tgtaatggtt gctgtgtgtt atttatttat ttgattgttg 960attgctgttt gtttaaagtg gccaagtgtt aggagggggt atgcgaaaat tatttttaag 1020tttgcttatg attccctttg ttgcgaaggc gaactttatg atctatccaa tatcaaaaga 1080aatcaaagga ggcagtagtg aacttattcg tatatattct aaatcaaaag atacacaata 1140tataaaagtg tatactaaaa aagttttaaa tccggggaca aaggaagaat acgaggtaga 1200caccccaaat tgggagggag ggttggttac tacgccgtcc aaagtaatct taccgggtgg 1260gggcagtaag tccgttcggt taagtcagtt aaaggacatc agtagcgaag atgtctacag 1320agtgtatttt gaatcaatta aaccagaaaa acaggatggt ttatcgaaaa ataaatcgct 1380gaaaacagac ctatctgtca acattatata tgcggcatta ataagagtgc tccccaagga 1440tgggaaaagt gatatgagag catcattatc acccaagagc agtcttctta taaagaacac 1500aggaaatgtg cgggtcggaa taaaagatgc ttttttttgt aaaaaaacaa gcattaacaa 1560tgatgactgc ataaagaaaa catacaacaa gaatatctat cccggttcat catttgatac 1620aggggttata caaaatggat tctcgcatat ttttatcgat agtgttgatg gaagcgcggg 1680caagcaagga aagcgaatgc taataagcat tcat 171435336DNAEscherichia coligene(85)..(2703)cooC 3taattattca gaattacaac ggaagtcttt taagccagag cagcggtgtg atgctgctct 60gtttctgttt gtctagagga atatatgatt ggtggaaagt cgagcaaggt ggtcattgtg 120ttatccgttc ttattggatc ttcttccgga tttgccagca aatacaacct tgttgatatt 180ccggagtctt ttcgtgattt atggggagag caggacgaat tactcgaagt cagactttat 240gggcaatctc ttggcgttca tcgtattaag tccactccta ctactgtggc atttgagtct 300ccggataatt tattagataa aattgagatt aataaaggaa aggaagctga cttaagagta 360cttatgcgag gttcattcca acggaatgga aatatgagtt gccagggata tacgggacag 420aacaactgca attacattaa aacaaacaca gttgcggtta tcgtagatga tgttgaaaat 480gtacttaatc tttttatagg aaatgagttt cttgcttccg gagagaatga cagtgattat 540tatcagccat ccaagaacac aaaaaaagca ttcatacata gccagacaat taatttatct 600gataccggta attatgaaaa cttgtccatt gtcgggacgg gttcgcttgg gataacagat 660aacagttatg ctattttggg ttgggcagca aattataatc ggtataaatc ttacaattac 720aatgaacagt cgattaacag cctgtatttc agacatgatt ttgaaaaaaa tttttactat 780cagttgggac ggatagacag atccgactta tcgcaaagta gtggcggaaa ctttaacttc 840gatctacttc ctgtacctga tatttatggt atgagagccg gaacgactca gtcatatatc 900aagaatacgg gaaagtcagt tgcatctccg gtcacaatta tgctgaccca cttttcccgt 960gtagaagcat atcgaaatgg gcaattactg ggagtttggt atttagatgc aggtatcagt 1020gagttagata cggagcgttt acctgacgga aattacgatc tgaaattaaa aatatttgag 1080caggagcaac ttgtccgtga agaaattgta ccttttaaca aatcaggttc ttcaattggt 1140gacacgcatt gggatgtttt cgtgcaggca ggcgatatta taaatgataa tggccgatat 1200gttgaaaaac agaaaaacca taaatcagcc attaatagtg gattacgttt accgttaaca 1260aggaatcttg cagtacagct ggggggggct gttattgata ataaaaatta ttacgagact 1320gggattctgt ggaactcagg actccttgat ggttctctca atagcaaatt cactttcctt 1380tttggtgacg acacacatgg aaactatcag aatgtttcct atactgatgg tttcagctta 1440tcgttctatc ataatgataa gcgagttgat gattgtggta aagattacaa tatgggctgg 1500agtggatgtt atgagtctta ttcagcgtct ttaagtatcc ctgtgaaagg gtggaatagc 1560actcttgcat acagtaatac gtacagtacg tctgtataca gatatgatgc tgtttctgaa 1620tatgttcctt attactatta taaaggaaga actaaaagat ggcaacttac tgcttctacg 1680gtggtaagat ggggggacta taacattatg ccaacaatag gagtatataa tagtgaacag 1740aaacaatggg ctgataaagg aggctattta tccttaacgc ttactcgagt tgatggtggc 1800aagtccttga atgctggtta ttcctataac tactcccggg gtaattatac ttctaatgat 1860gcatttgttg aggggcatct ggtttcagat acaaatgtca gttatcgtga actaagtgca 1920cgcgtcagtg gtaatagata ttacactgag ggaggagttt cagggcgcat taacaataga 1980tttggtgatc tgaatgggac acttaatgtt aataaaaaca gaaaatcaca tgatacaact 2040cactctctga cagctggtta cagttcgtca tttgctctta cgaccgatgg catctactgg 2100ggaggaagcg catccgggct gacgaattta tccggaggaa ttgtaagagt aaaatcaaat 2160gaggatgaga gtgaactatt gaatgtgaaa ggctcatcat atggtcatta ttccctgggc 2220agcaatgata gtttatttat acctgtacct gccctgatgc aagccagcct tactattgaa 2280gagaatacaa ataaatctaa aaatattgat gtgctcgcac caacaaaaaa cacttttttt 2340atgttacctg gaagtgttta tcctattgat gtttcagcca atgttagttt tacttacgtt 2400ggacgtggag ttgatgttaa gggacgacct ttatctggtg catatatttt gaatgcgcaa 2460aatattgtgt tggatgaaaa tggtggattt tcttttgaga gttcagagaa tgagaaggaa 2520ctctttttat taaaagataa aacaatttat tcctgttcat tagacagaag cgaaatgcgc 2580aatggtattg ctttcgttgg tgaggttgca tgcaattcta ccatcaaaga acttcttcct 2640gaaaaattgg ttacaaattc tcgcattcat gatttattag cttacaatca ggatactgaa 2700tgaaaaagat atttattttt ttgtctatca tattttctgc ggtggtcagt gccgggcgat 2760acccggaaac tacagtaggt aatctgacga agagttttca agcccctcgt ctggatagaa 2820gcgtacaatc accaatatat aacatcttta cgaatcatgt ggctggatat agtttgagtc 2880atagcttata tgacaggatt gtttttttat gtacatcctc gtcgaatccg gttaatggtg 2940cttgcccaac cattggaaca tctggagttc aatacggtac tacaaccata accttgcagt 3000ttacagaaaa aagaagtctg ataaaaagaa atattaatct tgcaggtaat aagaaaccaa 3060tatgggagaa tcagagttgc gactttagca atctaatggt gttgaattcg aagtcttgga 3120gctgtggggc tcacggaaat gctaacggaa cacttctaaa tctgtatatc cctgcaggag 3180aaatcaacaa attgcctttt ggagggatat gggaggcaac tctgatctta cgcttatcaa 3240gatatggcga agtcagtagc acccattacg gcaattatac cgtaaatatt acggttgatt 3300taactgataa aggtaatatt caggtatggc ttccagggtt tcacagcaac ccgcgtgtag 3360acctgaatct gcgccctatc ggtaattata aatatagtgg tagtaattca ctcgacatgt 3420gtttctatga tggatatagt acaaacagtg atagcatggt aataaagttc caggatgata 3480atcctaccaa ttcatctgaa tataatcttt ataagatagg gggcactgaa aaattaccat 3540atgctgtttc actgcttatg ggagaaaaaa tattttatcc agtgaatggt caatcattta 3600ctatcaatga cagtagtgta ctcgaaacaa actggaatcg agtaaccgca gttgctatgc 3660cggaagttaa tgttccagta ttatgctggc cagcaagatt gctattaaat gctgatgtaa 3720atgctcccga tgcaggacag tattcaggac agatatatat aacatttaca cccagtgtcg 3780aaaatttatg acaaatatgc atatttggca aagaaaaatc tgacactggg cattgtatgt 3840ggcgatggga ggtaactctg ataaatcggg ataggaactg ttctcacgat tccgactcat 3900cccactgtac cgtacatacg gggtcgtata cggcggtttg gttatgttga ttgtcgcctg 3960cctatatttc aggcaggatc agtctggtga acagattata gagtacaggt gtcttgtatg 4020ataacgcgat ggcggagagc atcaatagtc ttgacaaagc gagggcttta agtgctttgt 4080cgaaatcgaa gggctgggac atgtgtcatt cctttttgat tgtatattat ggaatgacac 4140agaatttcta acactctcga gctgacaccc taagttcaca gataaaatat tctctaggat 4200actcggggcg gttcatttcc cgttatgttc agcacttcat tcagcattct gaacagataa 4260atatcgaata tttccgtaca gtatggtctt attggtaaat atacgtcgtc tgttgggata 4320aagttcatta acctagcttc taaggaatga ggtggtgagc gactcgggaa aaggcagaga 4380tctactgtca cgtggagttc gggaagctga acgaaagtaa actgtccgat gaagcatcga 4440aatcttagat gatgtcaaaa tggggctgga tttgccccta tatttccaga catctgttat 4500cacttaaccc attacaagcc cgctgccgca gatattcccg tggcgagcga taacccagcg 4560cactatgcgg atgccattcg ttataatgct cgaacgcctc tgcaaggttc tttgctgccg 4620ttaacccgtc tggtttgggc atgatactga tgtagtcacg ctttatcgtt ttcacgaagc 4680tctctgctat tccattactc tccggactcc gcaccgccgt gttcttcggt tcaagtccca 4740acatccgggc gaactggcgt gtttcattag cccggtagca tgaaccatta tccgtcagcc 4800actccactgg agacgacgga agatcgttgc cgaagcggcg ttccaccgct cccagcatga 4860cgtcctgtac tgtttcactg ttgaagccgc cggtagtgac cgcccagtgc agtgcctcac 4920gatcacagca gtccagcgcg aacgtgacac gcagtctctc tccgttatca cagcagaact 4980cgaacccgtc agagcaccat cgctgattgc tttctttcac ggccactctg cctgtatgtg 5040cccgtttcga tggcggtaca gcaggttttc gctcaagcaa cagcgcattc tggcgcatga 5100tccggtaaac acgtttggca ttgatcgcag gcataccatc aagttctgcc tgtctgcgaa 5160gcagcgccca tacccgacga taaccatacg tgggcagctc tccgataaca tggtgtatac 5220ggagaagcac atccgtatca tcagtgtgac gactgcggcg gccatccatc cagtcatcgg 5280ttcgtctgag aatgacgtgc aactgcgcac gcgacacccg gagacaacgg ctgact 533642116DNAEscherichia coligene(559)..(1356)cfaD 4aattcctatc gatgaacagc tatgcatata tctcacaata caacaaccat taagcataag 60tgcgtttaat ataatattca ttagcagtat tatgatgcta ctatttaaca ctcaacaaaa 120tataattcgt caaagatatg tcatgcataa ccattacaat atcatttttt gtttggattt 180cggccaagaa aatgcttcac aaaacgttcc tctatttatg caccattcta tattttcagc 240atttttacac aaaagtgatg cttgtttcca aagttcaaag gcagaaacta aatccatgtt 300tttttctgcc agcgcggcct tttttttgat agacatgaaa acactcttct tttactttca 360ttgaaagatt gtctctggta aaatattagc tgcacacaag tgtatatcac agcaaggcac 420caaagagata aaataataat aataataaaa agcaaaaaaa gttgaaaaaa catatctttc 480ttttagcgaa agttaggcca atcttgcgaa aggtgattgt acaagcaaat caaacctctt 540gccttttgta ggtataagat ggattttaaa tacactgaag aaaaagaaat gataaaaatt 600aataatatta tgattcataa atacactgta ttatatacat caaattgtat tatggatata 660tattcagaag aagagaaaat cacatgtttt agtaacagac ttgtatttct tgaaagagga 720gtaaatatat ctgtaagaat acagaagaaa attttatcag aaaggccata tgttgcattc 780agattgaacg gagatatact aaggcattta aagaatgcat tgatgataat atatggcatg 840tcaaaagtag ataccaatga ttgtagaggc atgtcaagaa aaataatgac aacagaggtg 900aataaaacct tgttggatga attaaaaaat ataaacagcc atgatgactc agcttttata 960tctagcttaa tatatttgat ttcaaaaatt gagaataatg aaaaaataat agaatcaatt 1020tatatatcat ctgtgagttt tttttctgac aaggtcagaa atgttatcga aaaagatcta 1080tccagaaaat ggacgctggg tattattgca gatgcattta atgtatcaga aataaccatc 1140agaaaaagac tagaatctga gaacactaat tttaatcaga ttttaatgca attaagaatg 1200agcaaggctg cgttattact acttgaaaat tcataccaga tatctcagat atcaaatatg 1260attggaattt ccagtgcgtc ttattttatt agggttttta ataaacatta tggtgttaca 1320ccaaagcagt tttttactta ttttaaaggt ggataaaaac aatcttattt tgaatgtgtt 1380gcataatact atgctgtata aaaatgtatc tagtagagat ttattgcgat gcaaactgaa 1440ttgaaataaa attttttgtt aacaaacaga ttaatccttt acaatattgg cgcgtaatag 1500cgcaatattg ttgttatcta gagtgtttga ctacttgatc gataggaatt aaaaccccaa 1560aagattaaaa aaacaccaca aaacggatat ttcttcaaca tcacttttgc tccatatgaa 1620cggaaccgac gattaaactg gatggctctg attgattcag ggtatgaatg gcggtttttt 1680gctccgtttc cctcaaaatg gacgcaactt cccctctgcg gctctcagcc gaccaccgca 1740ttccgggcca acggctcatg catcaggacc agctctgcca ggacggtagc ccgcttcagc 1800accgtaaaac gcatctgact cccgcacagc acgcacttca gcgggtcaac cttcagtaac 1860ctctgataca tccctctcca ggtgatttgc atcgccgttt ttctcactgt ctccgttatg 1920gtgtacacca cttcttccag taaccgccgt ttcgccggac tgaagtggtc aacaaaaact 1980ggccaccgag ttagagtttt tccagtatcg attttccgat tcgtttgggg gtaacccacc 2040gttatattcg tgcggtctta gtgcgctgta atatccaacg atatagtccg ttatggcgtg 2100agctgccatc gctgaa 211655798DNAEscherichia coligene(499)..(1215)cotB 5ctgcagatgg cgctgtggcg gcgtaagagg ccccggaacg ttatcgttca cacggaccgt 60ggaggccagt actgttcagc agattatcag gcgcaactga agcggcataa tctgcgtgga 120agtatgagcg caaaaggttg ctgctacgat aatgcctgcg tggaaagctt ctttcattcg 180ctgaaagtgg aatgtatcca tggagaacac tttatgagcc gggaaataag tcgggcaacg 240gtgtttaatt atatcgaatg tgattacaat cggtggcggc ggcacagttg gtgtggcggc 300ctcagtccgg aacaatttga aaacaagaac ctcgcttagg cctgtgtcca tattacgtgg 360gtaggatcaa aacactatca ataagttgga gtcattaccg gcattcttga aagcctcatg 420cgtgacaggg tgtgtgttgt atttttatca tattttaacg cctgctttct gataatgttt 480aggaaagggg tgatatgtat gaagatattg ttatttgtta ttctgttttt taatgttttt 540gctgccagtg caaattttat ggtatatccg atctcaaagg atatacagag tggtggcagc 600gaaactataa aagttttttc aaaatctaaa gatgttcagt atataaagat atatacgaaa 660agggttatta atccaggaac aaaagaagag caagaggttg atataaaaaa ttgggatgga 720ggtctgattg taactccggc aaaagttgtt ttgccagctg gagcaagtaa gtcaatacga 780cttactgaga taaataaaaa agagcaggag gaagtctatc gtgtgtattt tgaatctgta 840aaaccgggac agcaagatga tatagaggaa aaaaatgggc gtgtaaatac tgatttatca 900gtaaacataa tctatgccgc tctcataaga accagccctg agaacccaca gaggaaactt 960gatgtatcca tagaatcaaa caatgtatgg attaagaaca ctggaaatat taggctggga 1020attaaggatg tattcttgtg tgatacaacc agcataaatg ataaatgtgc aaagttttct 1080tataatagaa atctatatcc agatatgtcg gtagatacta aattaggaaa aaaaggattt 1140tcttatgctg tcattgatac aaaggatgac agaaatgaaa atagcggaga gttaattaac 1200ataaagctcc cgtaagataa attgttcaat aaccactgta taagggtgta aataatgaaa 1260ctcaataaga ttattggagc attagttctt tcatctacat ttgttagcat gggggcttct 1320gctgccgaga aaaatatcac tgtaactgct agcgttgatc caactatcga tctgatgcaa 1380tctgatggca cagcgttacc aagtgcagtt aatattgcat atcttccagg agagaaaaga 1440tttgaatctg ctcgtatcaa tacccaagtt cataccaata ataaaactaa gggtattcag 1500ataaagctta ctaatgataa tgtggtaatg actaacttat ctgatccaag caagactatt 1560cctttagagg tttcattcgc tggcactaag ctgagcacag ctgcaacatc tattactgcc 1620gatcaattaa attttggcgc agctggtgta gagacagttt ctgcaactaa ggaactcgtt 1680attaatgcag gaagcaccca gcaaactaat attgtagctg gtaactatca aggattggtg 1740tcaattgtgc ttactcaaga accttaataa acattaagat atatcaacag ggttgctgat 1800tttttagtca ccctgttatt aaagaaaata tatttatgcg agctttcaat aaaataactg 1860ttttcatttt gtttattcct ggtttatgtt ttggaacgaa tggtttagag agtaaaaaaa 1920atattcctga agaatttata gacttatgga tggaacagga tgaattactt gaagttaatt 1980tatatgggcg ttctctaggt gttcatcgtg tattgacaac gcctactact gtgaaatttt 2040catctgtaga ggaaattcta gaaaagatta atgtgaaaca agagaaaaaa gaagacctga 2100gaagtcttct tcttcaatca tattcccgca acgggaatat gagttgtaat gggtttgatg 2160aaaaggaata tagctgcaat tacattagaa ctgatacggt taatgttatt gtagatgaag 2220aaaataatga gctaaatctt tttataggtg cgagttttct ttctgttcaa gctcaggata 2280atatttatta tcaaaaaaat ataaactcag aaaaagcatt cattcacagt cagacaatta 2340acttttctga atctgaaggg tataaaagtt tatctttgaa aggggttggt gcacaggggt 2400taactgaaaa tagttatctt gtttttggtt gggatgccat atataatagt tctaggaaat 2460acacatataa aaatcagtca atcaataata tatattacag atatgatttt gataaaaaat 2520attattatca gttggggcga atggatcgtt cagatttatc aagtgcctct agtggtaatt 2580ttaatttcaa tatgcttcct ttgcctgata ttgatggatt tcagataggt acgacccaat 2640cctatattaa aaatatcgaa aaatcaatat catcgccagt aaccgttatg ttaacccgat 2700tttctagggt tgaagccttt cgtaatgaag agttactggg agtatggtat ttgaattcag 2760gaatcaatga tctcgataca agtcgtttgc ctgacggcag ttatgattta acgttgaaga 2820tatttgagca ggacattctt gttcgtgaag agaaggtccc ttttaacaag ggaggagcct 2880cttttgggga tatgcaatgg gatgtgtttg ctcaggctgg taatattgtc aataataacg 2940atagttatat tgagaagcaa actaataaaa aaacgggaat aaatgctggt atacgtacgc 3000ctgtaaccag aaatttatcg ttcttacagg gcggtgctat aattgataat gataaatatt 3060atgaggctgg tgttaactgg cgttcagggt ttcttgatgg ggtactaagt ggaaacttca 3120gtttcctgta tggtgatggt gcaagaggaa attatcaaaa tatttcgtat accgatggtt 3180ttaatctctc tttttatcgt aatgataaaa gcgttgataa ttgtagtcac aattacagtg 3240cgggatggag tgggtgctat gagtcttatt ccttttcact aagtgttcct gtatctggct 3300ggactactac tcttggctat aaccatacaa ataatgaggc tgtacataaa tatgattaca 3360ccccggaata tttttttagt aaaaaatata aaggtgtcag taaaagatgg caattgacat 3420cttcttcgtc ctataaatgg atggattatc atgtgattcc gacgataggt gtatatcgta 3480gtgatcagag tcgatggagt gagcagggag ggtatttttc tttgagtttt acccgagtaa 3540aggaaaatag tgccattaat gcaggatatt cttataatta tgtaaagcat aaaaatgcca 3600cacatgaggc ttttttagat ggtcgtataa cgacaaatac ttttggctat agtgaattag 3660gctctcgtat aaatacgaac aaaaataaca cagaagcagg tgttaccgga cgtgtaaaaa 3720acaggtttgg agatctgaat ggttcattaa atgttaataa aagtaaaaca tccggtaaga 3780tgactcactc aatgagtgca aactataact cctcatttgc aattactggt gattctgtct 3840attggggggg agatgcctct ggtttaacga agctatctgg gggtgtggtg aatgtaagat 3900cagatgataa atcaaaagag ctaataaaaa tatcaggttc ttcatatggt aattatatcc 3960tcggcagtaa tgaccgttca tttatccctg taagtgcatt aatgccaagt aacctaacta 4020tagaagagat tcagtcaaac gacaagaata ttactgttca ggcgttatca aaaaatgact 4080tttttattct gcctggtaat gttttcccta ttgatgtaac tgctaatgtg acagtttctt 4140atatagggag agctcttgat gataaaggaa atccattatc aaatgcccat atacttgatg 4200ttcacggggt taggctggat gaggatggtg gtttttcttt cgaaacttca gctcaaaaga 4260aatctctttt cctgttaaaa gataaagata tttattcatg tgatgttaag aaatatgatt 4320tacgtagtgg tgttttattt actggtgacc ttatatgtga acacagtggt atagaacgtc 4380ttggaaaaga tttggttaac aatccaagag ttaagcaact gcttgcttat aaataaccaa 4440gaggtgaact ttgaaaaaag tgatttttgt tttatccatg tttctatgtt ctcaggttta 4500cgggcaatca tggcatacga acgtagaggc tggttcaata aataaaacag agtcgatagg 4560ccccatagac cgaagtgctg ctgcatcgta tcctgctcat tatatatttc atgaacatgt 4620tgctggttac aataaagatc actctctttt tgacaggatg acgtttttat gtatgtcatc 4680aacagatgca tctaaaggtg catgtccgac aggagaaaac tccaaatcct ctcaagggga 4740gactaatatt aagctaatat ttactgaaaa gaaaagtctg gccagaaaaa cattaaactt 4800aaaaggatat aagagatttt tatatgaatc agatagatgc attcattatg tcgataaaat 4860gaatctcaat tctcatactg ttaaatgtgt aggttcattc

acaagaggag tagatttcac 4920tttatatatc ccacaaggtg aaattgatgg gcttctaact ggaggtatat gggaggcaac 4980actagagtta cgagtcaaaa ggcattacga ctataatcat ggtacttaca aagttaatat 5040cacagttgat ttgacagaca aaggaaatat tcaggtctgg acaccaaagt ttcatagcga 5100tcctagaatt gatctgaatt tacgtcctga aggtaatggt aaatattctg gtagtaacgt 5160gcttgagatg tgtctctatg atggctatag tacacatagt caaagtatag aaatgaggtt 5220tcaggatgac tcacaaacag gaaataatga atataatctt ataaaaactg gagagccatt 5280aaaaaaattg ccatataaac tttctcttct tttaggagga cgagagtttt atccaaataa 5340tggagaggct tttactatta atgatacttc gtcattgttt ataaactgga atcgtattaa 5400gtctgtatcc ttaccacaga ttagtattcc agtactatgc tggccagcaa acttgacatt 5460tatgtcagag ctaaataatc cagaagcggg tgagtattca ggaatactta acgtaacatt 5520tactcctagt agttcaagtc tgtaaaaata gtatctttat aaattatgct atttgcggga 5580gactttatca gctgggaatt agagtcgcaa tgatgtttat cggtaaacca gcaccatact 5640tcggaaaatg ctggcaagct tacgccaatc tttttagatt gagttgttgg tattagatat 5700catagtaaat ggttagcttg taaagttagc gctatcatga aatatttgat ttttataata 5760ttaaaagagt ccctctgaag gtggactgca ccccaaaa 579861187DNAEscherichia coligene(245)..(1042)rns 6gcgcggcttt ttttgataaa acataaaaat gctcttttac tttcattgaa agattgcctc 60tgataaaata tcagaggcat acaattgtac atcatagcga tggcatcaag gagataagat 120aataacaaaa acaccagaag ctgaaaagct gaaaaacata tctttctttt aggggggatt 180aagccaacct tgcaaaaagt gattgtacaa gcaactcaaa cctcttgtct tttgtaggta 240taagatggac tttaaataca ctgaagaaaa agaaacaata aaaattaata atattatgat 300tcataaatac actgtattat atacatcaaa ttgtattatg gatatatatt cggaagaaga 360gaaaattaca tgttttagta acagacttgt atttcttgaa agaggggtaa atatatctgt 420aagaatgcag aagcaaattt tatcagaaaa gccgtatgtt gcattcagat tgaacggaga 480tatgctaagg catttaaagg atgcattgat gataatatat ggcatgtcaa aaatagatac 540caatgcttgt agaagcatgt caagaaaaat aatgacaaca gaggtgaata aaaccttgtt 600ggatgaatta aaaaatataa acagccatga taactcagct tttatatcta gcttgatata 660tttgatttca aaacttgaga ataatgaaaa aataatagaa tcaatttata tatcatctgt 720gagttttttt tctgacaagg tcagaaatct tatcgaaaaa gatctatcca gaaaatggac 780gctgggtatt attgcagatg cgtttaatgc atcagaaata accatcagaa aaagactaga 840atctgagaat actaatttta atcagatatt aatgcaattg agaatgagta aggctgcgtt 900attactactt gaaaattcat accagatatc tcagatatca aatatgattg gaatttccag 960tgcatcttat tttattagga tttttaataa acattatggt gttacaccaa agcaattttt 1020cacttatttt aaaggtggat aaaaacacct tattttgaat gcgttgcata atactatgct 1080gtataaaaat gtatctagta gagatttatt gcgatgcgaa ctgaattgaa ataaaaattt 1140ttgttaacac acagattaat cctttacaat attcggcaca atagcgc 118774746DNAEscherichia coligene(378)..(1103)cstA 7aagcttcacg acatagcggg gaggtttgct tctttgagag gcgggtttac gtttacgggg 60tttagctgaa cgggccatat aaccacctga aagacaatga catttcctgt ttttataacg 120gtaattgcag accatgacaa gccacagccg tcaggctgtc tactcggcat tgttatctct 180ttaaaacatt gaggtgaagc tatgctgaca caggaggtaa ttacccaatc tgaataagaa 240ttattgggtg atctcctccc atgaaaatac gcacgcgaga agtgatatag atggaatgtt 300gtgttttttt atcaaaatta tatttgttta tggagtatta taacaataag ttattgacgc 360ttatgctagg agaaagaatg acacctatta agctaatttt tgcagctctg tctttatttc 420catgcagtaa catttatgca aacaatataa ccactcagaa attcgaagct atattgggtg 480caacaagagt aatttaccac ctagatggta atggtgaaag tctaagagtt aaaaatccgc 540agattagtcc aattctaatt caatctaaag taatggacga gggtagtaaa gataatgcgg 600attttattgt taccccccct ctttttagac tagatgcaaa aagagaaact gacattcgta 660tagttatggt gaatggctta tacccaaaag acagggaatc tctaaagacc ctctgtgtgc 720gaggaattcc accaaaacaa ggagatttat gggctaacaa tgaaaaagaa tttgttggaa 780tgaaacttaa cgtttcaatt aacacatgta ttaaattaat attaagacca cataatcttc 840ctaaacttga tattaattcc gaagggcaga tagaatgggg gataagggat ggtaatttag 900tagcaaagaa taaaacacct tactatttta ctatagtaaa tgcatcgttt aatggaaagg 960cactcaaaac accggggacg ctagggccgt atgagcaaaa actttacacg ctacctagta 1020aaatttctgt atctggactg gtaaagtggg aaattattgg tgatctaggt gagagcagtg 1080aaacaaagaa attcaatatt tgaagaatta aaagtgtact aaaaactgtc gagctaaact 1140attcgtacta ttatttttat gtgattctgt taatgcagaa aaatatatat ttgagcgaga 1200tttccttgct gattctgaaa aaattgattt aacattattg gagtcaagtg cctacccctc 1260tggtcgttat tatgttagtt tgtatttgaa tggggaatac attacaaaag aatgatgatg 1320tactttgacg ctggagaaag tgaggatttt tgtattcagt actctgtact acaggatata 1380ggtgtaactg tgagtgggaa tcaggatgaa tgtgcaaatc ttgatgatga attaaactta 1440agaaccaggt ttgattttta ctcgaaaaga atggatattt ttgtatcacc aaagtttgtt 1500ccacgaaaaa aaaacggtct tgcgccaatt aaactttggg atgagggtga aaatgcgcta 1560ttcacaagtt acaactttag tgaggattat taccatttta aaggtgacgc aagagatagt 1620tattcacaat acgctaacat tcaaccacgc ttaaatatag gaccatggag aataagaact 1680caagccatat ggaataaaaa taataacaca aaaggggagt ggagtaataa ttacctgtat 1740gccgaaagag gcttaggaaa tataaagagt agactataca ttggggatgg atattttcca 1800ttaaaaaact ttaattcgtt caaatttaaa ggaggggtgc taaaaactga tgagaatatg 1860tatccctatt cagaaaaaac ttattcacca atagttaaag gctcggcaaa aactcaagca 1920aaagttgaat tttttcagga tggtgtaaaa atttatagct caatcgtccc tccaggggat 1980ttttctatct cagattatat tttatcaggc tcaaatagtg atctttatgt caaagttata 2040gaggaaaatg gctcaattca ggaatttatc gttccattta cctatcctgc agttgcggtc 2100cgggaaggat ttacctatta tgaaatcgct atgggagaga ctcagcagtc gaatgattat 2160tttacacagt tatcatttac tcgtgggctt ccatatgact ttaccgtact tacatcttta 2220gaatattctg gcttctacag atctcttgaa attgggttag ggaaaatgct tgggaatttg 2280ggcgcattat cgttaatcta tggacagtca aactttagta aaagtgataa tagtaaaaat 2340aaaaaatggg atatcagata taataaaaat attccggacc taaatacata tttgagtttt 2400tctgctgtta gccaaactag aggggggtat tcttcactca gggatgcttt ggactatgag 2460atcggagaat atacttttaa ctcaaaaaac tcctatacag cctcaataaa ccactcatta 2520ggagagcttg gtagtttaaa ctttagtgga acatggcgaa actactggga gaataagaac 2580caaaccagat cttacaattt atcatattct acacaaatct ttaatggaaa ggcctacttg 2640tcaggaagtt tgattagaag tgaacttatg aattttaata ataagataag tgatactatt 2700ttaaatatcg gtgttaatat tccctttggc ctttctcgtg gcattcaatc tgtaagttat 2760aacaccagtt cagtgaaagg ggggaggagt actcatcagt tagggataag tggttctgaa 2820tttgacaata aattgtactg gcatgtaaat cagggttact cagataatta cagtaatacc 2880tctatgtatg gttattataa agctaagtat gctcaggtta atgccggata ctcagtttct 2940gagagataca atcatgctta tggaggtata gagggaggaa ttctggtata tgacggtgga 3000attattttag gtcgcaatct tggtgataca atgtcaatta ttgaagctcc aggtgcggaa 3060aatacaaaga ttagaggatg gggatcgatt gaaactgatt ggagggggag ggcttttatt 3120ggttatcttt caccttacca aaataatgat atatcccttg acccatcatc attaccatta 3180gactcctctt tagatatcac aacaaattcg gttattccaa caactggtgc aattgttaaa 3240acgacatata atgttaaaaa aggaaaaaaa gtaatgctta ctttaaaaaa gtcaaatggt 3300gatgcagttc catttggagc aattgtgaca gttatggatg gcgatcaaaa tacaagcatt 3360gtgggcgata atgggcaatt gtatttaggt tcctcaatgg atacaggaag gctaaaagtt 3420atatggggaa atggcgaaga taaaaaatgt gttgttgact acatagtagg tgacaataaa 3480aatatagcgg gtatttatat aggcagtgcc gaacatgtat ttagctcaat gctcctttat 3540ggcaaaaaaa tatctttttt atccgcttct gtttggtagg ttataggtgt tgttaaagcg 3600tttctgacaa ctctgcaatc caataacgaa tggagaacac acagtgaaaa aaatgatttt 3660agcattgact ttgatgtcgg tgtggggagg tcgtttgccg cagtgggccc aacgaaagat 3720atgagtttag gtgcaaattt aacttcagag cctacattag ctattgattt tacgcctatt 3780gaaaatattt atgtaggtgc caattatggt aaagatattg gaacccttgt tttcacaaca 3840aatgatttaa cagatattac attgatgtca tctcgcagcg ttgttgatgg tcgccagact 3900ggttttttta ccttcatgga ctcatcagcc acttacaaaa ttagtacaaa actgggatca 3960tcgaatgatg taaacattca agaaattact caaggagcta aaattactcc tgttagtgga 4020gagaaaactt tgcctaaaaa attcactctt aagctacatg cacacaggag tagcagtaca 4080gttccagata cgtatactgt tggtcttaac gtaaccagta atgttattta aagtgaatgt 4140atgagggatt cgatgttaaa aataaaatac ttattaatag gtctttcact gtcagctatg 4200agttcatact cactagctgc agcggggccc actctaacca aagaactggc attaaatgtg 4260ctttctcctg cagctctgga tgcaacttgg gctcctcagg ataatttaac attatccaat 4320actggcgttt ctaatacttt ggtgggtgtt ttgactcttt caaataccag tattgataca 4380gttagcattg cgagtacaaa tgtttctgat acatctaaga atggtacagt aacttttgca 4440catgagacaa ataactctgc tagctttgcc accaccattt caacagataa tgccaacatt 4500acgttggata aaaatgctgg aaatacgatt gttaaaacta caaatgggag tcagttgcca 4560actaatttac cacttaagtt tattaccact gaaggtaacg aacatttagt ttcaggtaat 4620taccgtgcaa atataacaat tacttcgaca attaaataat tatataatag acgtagcctt 4680cgaaataaag gctacgttgc tatctttatg tttgtgattt ataggcatca ttaaatagtc 4740aagctt 474687239DNAEscherichia coligene(283)..(999)csaA 8atatatctta ttgaggaata tcggtgtcat tgagtaccgt taacttaaga taaagaatct 60gtctggaaat cgcaggacca agaactctca gtacatctgt ggcgataata ttatcgcttc 120ttatacattc caatatgcag ttcttgtggg tatttgtttg gacatcgcag cattaaatat 180aaaaatagca caggaggcat aattatttgt ttttactgtc ttattttttt atcccatttt 240tttttgtttt gatttatctt tgatgaaagc tcaggaggga atatgcataa attattttgt 300ttactaagtt tactcataac tccatttgtt gcaaatgcaa actttatgat atatccaata 360tcaaaagatt taaagaatgg aaatagcgag ttaattcgtg tttattcaaa atcaaaagag 420atacaatata taaaaatata tacaaaaaag attattaatc ccggcacaac tgaagaacat 480gaagttgata tgcccaattg ggatggtggg tttgtagtta ctcctcaaaa agttattctt 540cctgcaggag ggagtaaatc aatacgttta actcaattta gaataccaaa aaaagaggaa 600atttatagag tatattttga ggcggtaaaa ccagatagca aagaaaatgt aattgataat 660aaaaaactaa caacagagct atctgttaat ataatttatg cggctctaat cagatcttta 720ccaagtgaac aaaacatatc actaaacatt tctagaaatg caagaaaaaa tataattatt 780tataataatg ggaatgttag agcaggtgtt aaagatattt atttttgtaa gtcatctaat 840atcgatgata gctgtgtaaa aaaaacgcat aacaagaata tatatccaga aaagtcattt 900gatacgctgg ttaataacaa tttttcttat gttttcatta aattaaacca tgaagacata 960gaaaaagagc aaggactaat acaattaaaa gttccttgat tactcatcta tatactaagg 1020agttctaatg aaattaaaaa aaactattgg tgcaatggca ctgaccacaa tgtttgtagc 1080tatgagtgct tctgcagtag agaaaaatat cactgtaaca gctagtgttg atcctacaat 1140tgatattttg caagctgatg gtagtagttt acctactgct gtagaattaa cctattcacc 1200tgcggcaagt cgttttgaaa attataaaat cgcaactaaa gttcatacaa atgttataaa 1260taaaaatgta ctagttaagc ttgtaaatga tccaaaactt acaaatgttt tggattctac 1320aaaacaactc cccattactg tatcatatgg aggaaagact ctatcaaccg cagatgtgac 1380ttttgaacct gcagaattaa attttggaac gtcaggtgta actggtgtat cttcttccca 1440agatttagtg attggtgcga ctacagcaca agcaccaacg gcgggaaatt atagtggggt 1500cgtttctatc ttaatgacct tagcatcata aatattttaa tatataaagg agcaggcaca 1560ctgctcctta ttatatggca ataataaaat gacaaaaaaa aatacattat atataacgat 1620catcgcaatg ctaactccat attcagtttt ttccggagat atacccaact ctttccgtga 1680tttatgggga gaacaagatg aattttatga agtaaaacta tatggacaaa ctctaggaat 1740acatcgaatt aaaacaaccc caacacatat taagttttat tcacccgaaa gcattttaga 1800taaaataaat gtaaaaaaag aaaaggaaaa gaaattgagt gttttgttca ctaattcttt 1860ttcaagaaat ggcaatatga gttgtcaggg gaatgctact atacagtata actgcaatta 1920cattaaaaca aaatcagtag atgtcatcgt tgatgatgtt gataatgttg ttaacctttt 1980tataggtaat gaatttctgg attctgaagc acacaatgat gaatatcatc aattatcacg 2040aaatgtaaaa aaagctttta tacaaagcca gacaattaat gtctcagatt ctgggaagta 2100taaaagtttg tctgtttcag ggaatagcgc gctgggtatt acagatacaa gttatgctgt 2160cttaaattgg tggatgaatt acaataaatt taatggttac agcaacaacg aaagaacaat 2220caatagtttg tactttagac atgatttaga taagagatat tattatcaat ttggacgaat 2280ggatcgtaca gatttgtcac aaagtattag cgggaacttt aattttaact tacttccttt 2340acccgatatt gatggtataa ggacaggaac cacacaatct tatatcaaaa atacagataa 2400gtttatcgca tcccctgtaa ctgttatgtt aactaatttt tccagagtgg aagcttttcg 2460caataatcaa ttattgggcg tatggtattt agattctgga gtaaatgaat tagatacagc 2520tcgtttacct tatggtagtt acgatcttaa attaaaaatt tttgaaaata ctcagttagt 2580tcgtgaagaa ataattcctt ttaataaagg gagaagttct attggtgata tgcaatggga 2640cgttttcatt cagggaggga atattattaa tgacaaggat cgttacatag aaaaacaaaa 2700taatcataag tcatcagtta atgctgggct acgtttacca attacgaaaa atatctctgt 2760tcaacaagga gcatctgtta tagataataa aaattattat gaagggagtc tcaaatggaa 2820ttccggcatt ctgtctggct cactaaatag tgagttcagt tttctttggg gagataatgc 2880aaaaggtaat tatcaaagta tctcgtatac cgatggattt agtttatcat tttatcataa 2940tgataagcgg gtcgataatt gtggaagaaa ttacaatgct ggttggagtg gatgctacga 3000atcatattcg gcatctttaa gtattccttt attgggatgg acaagtactc tgggatatag 3060tgacacttat agtgaatcag tttataaaaa ccatattctt tctgaatatg gtttttataa 3120tcaaaacata tataaaggga gaacccaaag atggcaactg acttcgtcca cctctttaaa 3180atggatggat tataatttta tgccagcaat tggaatatat aacagtgagc aaagacaact 3240gactgataaa ggcggatata tatctgtaac tctcacccga gccagcagag aaaattcatt 3300aaacgcaggg tattcttaca actattccag aggaaagtat tcttctaacg aattatttgt 3360tgatggatat atgacatcaa caaataatgg tgactatcat gaggtaagaa tgcgttttaa 3420taaaaataga cataatgcag aaggtagact ttcaggtcgt ataaacaatc gatttggaga 3480tttaaatggt tcattcagca tgaataaaaa cagaaacacc aacagtagca atcattctct 3540cactggtggt tataattcct catttgctct tacaagtgat ggattttact ggggaggaag 3600tgcatctggt ttgacaaaac tagctggcgg tattatcaag gttaaatcaa acgatactaa 3660aaaaaatctg gtaaaagtga ctggggcatt gtacggtgat tattcgctag ggagcaacga 3720taatgctttt attcctgtac cagcattaac tccagccagt ttaattattg aagataataa 3780ttatggtgac aagaatattt ctgtacttgc accaacgaac aacgatatgt ttatattgcc 3840gggtaatgtt tatcctgttg aaattgaaac caaagtaagt gtttcttata ttggtagagg 3900ttttgacaaa aacggcacgc cactttctgg cgcacatgtt ttgaatgaac cacatgttat 3960cctggatgag gacggtggat tttcgtttga atatacaggt aatgagaaaa cacttttttt 4020attaaagggc agaactattt atacatgtca actggggaaa aataaagttc acaaaggcat 4080tgttttcgtc ggagatgtta tatgtgatgt taatagcaca agttccttac cagatgaatt 4140tgtaaagaac ccacgtgtgc aggatttgct ggcaaagaat gataaaggat aaacgatgaa 4200taagatttta tttattttta cattgttttt ctcttcagta ctttttacat ttgctgtatc 4260ggcagataaa attcccggag atgaaagcat aactaatatt tttggcccgc gtgacaggaa 4320cgaatcttcc cccaaacata atatattaaa taaccatatt acagcataca gtgaaagtca 4380tactctgtat gataggatga cttttttatg tttgtcttct cacaatacac ttaatggagc 4440atgtccaacc agtgagaatc ctagcagttc atcggtcagc ggtgaaacaa atataacatt 4500acaatttacg gaaaaaagaa gtttaataaa aagagagcta caaattaaag gctataaaca 4560attattgttc aaaagtgtta actgcccatc cggcctaaca cttaactcag ctcattttaa 4620ctgtaataaa aacgcggctt caggtgcaag tttatattta tatattcctg ctggcgaact 4680aaaaaatttg ccttttggtg gtatctggga tgctactctg aagttaagag taaaaagacg 4740atatagtgag acctatggaa cttacactat aaatatcact attaaattaa ctgataaggg 4800aaatattcag atatggttac ctcagttcaa aagtgacgct cgcgtcgatc ttaacttgcg 4860tccaactggt gggggcacat atattggaag aaattctgtt gatatgtgct tttatgatgg 4920atatagtact aacagcagct ctttggagat aagatttcag gataacaatc ctaaatctga 4980tgggaaattt tatctaagga aaataaatga tgacaccaaa gaaattgcat atactttgtc 5040acttctcttg gcgggtaaaa gtttaactcc aacaaatgga acgtcattaa atattgctga 5100cgcagcttct ctggaaacaa actggaatag aattacagct gtcaccatgc cagaaatcag 5160tgttccggtg ttgtgttggc ctggacgttt gcaattggat gcaaaagtgg aaaatcccga 5220ggctggacaa tatatgggta atattaatgt tactttcaca ccaagtagtc aaacactcta 5280gataacaaca atattggcgc tattgcgcgc caatattgta aaggggtaat ctgtttgtta 5340acaaaacatt ttgtttcaat tcagtttgca tcgcaataaa tctctactag agacattttt 5400atacagcata gtattataca acacattcaa aataaggata tttttatcca cctttaaaat 5460aagtaaaaaa ctgctttggt ataacaccat aatgtttatt aaaaacccta ataaaataag 5520atgtactgga aattccaatc atatttgata tctgagatat ctggtatgaa ttttcaagta 5580gtaataacgc tgccttgctc attctcaatt gcattaagaa ctggttaaaa ttagtattct 5640cagattctag tctttttctg atggttattt ctgattcatt aaacatatct gcaatgatag 5700ccagtgtcca ttttctggat agatcttttt cgataatatt tctgaccttg tcagaaaaaa 5760attcacagat gatatataaa ttgattctat tattttttat tattctcgat ctttgaaatt 5820aaatatatca aattagatat aaaagctgag tcatcatagc tatttatatt ttttaataca 5880tccagtaagg ttttatccac ttctgttttc attattttcc ttgacatatt tctacaatca 5940ttggtatcta tttttgacat accatatatt atcatcaatg catcctttaa atgtcttagt 6000atgtctccgt tcaatctgaa tgcaacatat ggtttttctg ataaaatttg cttctgtatt 6060cttacagata tattcacccc tctttcaaga aatacaggtg atgctgccaa cttactgatt 6120tagtgtatga tggtgttttt gaggtgctcc agtggcttct gtttctatca gctgtccctc 6180ctgttcagct actgacgggg tggtgcgtaa cggcaaaagc actgccggac atcagcgcta 6240tctctgctct cactgccgta aaacatggca actgcagttc acttacactg cttctcaacc 6300cggtacgcac cagaaaatca ttgatatggc catgaatggc gttggatgcc gggcaacagc 6360ccgcattatg ggcgttggcc tcaacacgat tttacgtcac ttaaaaaact caggccgcag 6420tcggtaacct cgcgcataca gccgggcagt gacgtcatcg tctgcgcgga aatggacgaa 6480cagtggggct atgtcggggc taaatcgcgc cagcgctggc tgttttacgc gtatgacagg 6540ctccggaaga cggttgttgc gcacgtattc ggtgaacgca ctatggcgac gctggggcgt 6600cttatgagcc tgctgtcacc ctttgacgtg gtgatatgga tgacggatgg ctggccgctg 6660tatgaatccc gcctgaaggg aaagctgcac gtaatcagca agcgatatac gcagcgaatt 6720gagcggcata acctgaatct gaggcagcac ctggcacggc tgggacggaa gtcgctgtcg 6780ttctcaaaat cggtggagct gcatgacaaa gtcatcgggc attatctgaa cataaaacac 6840tatcaataag ttagagtcat tacctggttc acgtattatt atccgtgact ctttcctggt 6900aactcccgca taataacctc acttttccag tattccagaa gatgatgttt tttcctcgat 6960aataaaaatg tgccaatatg gaaataagaa atcggatttt ttatcagcat acgcaaattt 7020tcagataaca atgaatacag atgtatttta tatacacaga taaaaccgcg caacagacat 7080aaatatgaca gtagcatgaa aaagcagaga gagacagggt gatacagaaa agtaactatt 7140tttttagcta tagtattatt ggttttacct attttcgtga ttgtgtttct gtatatttga 7200caatgagtct ctcagaatcg gtttctcgaa gtgacgagc 723999935DNAEscherichia coligene(1427)..(2038)csfA 9ggtgatgctg ccaacttact gatttagtgt atgatggtgt ttttgaggtg ctccagtggc 60ttctgtttct atcagctgtc cctcctgttc agctactgac ggggtggtgc gtaacggcaa 120aagccccgcc ggacatcagc gctatctctg ctctcactgc cgtaaaacat ggcaactgca 180gttcacttac accgcttctc aacccggtac gcaccagaaa atcattgata tggccatgaa 240tggcgttgga tgccgggcaa ctgcccgcat tatgggcgtt ggcctcaaca cgattttacg 300tcacttaaaa aactcaggcc gcagtcggta acctcgcgca tacagccggg cagtgacgtc 360atcgtctgcg cggaaatgga cgaacagtgg ggctatgtcg gggctaaatc gcgccagcgc 420tggctgtttt acgcgtatga cagtctccgg aagacggttg ttgcgcaagt attcggtgaa 480cgcactatgg cgacgctggg gcgtcttatg agcctgctgt caccctttga cgtggtgata 540tggatgacgg atggctggcc gctgtatgaa tcccgcctga agggaaagct gcacgtaatc 600agcaagcgat atacgcagcg aattgagcgg cataacctga atctgaggca gcacctggca 660cggctgggac ggaagtcgct gtcgttctca aaatcggtgg agctgcatga caaagtcatc

720gggcattatc tgaacataaa acactatcaa taagttggag tcattaccaa cggtttcagc 780ttaaccattt tgtggcgggt ctttctggct ggcggttcag ggtatttaag gtagcgtctg 840accgtccagc tctcagtaca cgtcccgacg ctgaactggt caatacaatg ctggataatg 900ctgtcgaaac gttaaattct ggagaacgac cggtgataca cagtgacaga tgtaggcatt 960atcgctggcc aggctggctg aaagagtgaa tgcagcaggt cttattcgct caatgtcccg 1020taaaggatgt tcacctgata atgccgcatg cgaaggcttt ttcggcggat tgaagactga 1080aatgtattat gggcgtaaat ggtcgggtat catgccagaa aagttcatgc agcaagtaga 1140tgcctacatc agatggtata acgatcggcg tataaaatta tcgctgggta catttcatgg 1200ctgtacagca tcttattaaa caatcattat actatattga cagcatgcaa tatctacatg 1260tttgacgtta ttttactttt cttgttattg tattatcgta ttgtgtatct gtatttttgt 1320agtatatgaa aaaacactat agcaaaacaa gcttacttga aaaagttata agtgttttca 1380caaataaatt cgtgtttatt gtaagacaaa gaaggatgag aataaaatga agaaaaattt 1440actgataact tcagtgttgg caatggcaac cgtatcaggt tctgttttgg ctgctgttac 1500aaatggccaa ctcacattta attggcaggg agtggttcct tccgctcccg ttactcagag 1560cagctgggct tttgtgaacg gattggatat accgtttact cctggtactg aacagttgaa 1620tatcaccctt gattcaaata aagatatcac ggcccgttcg gttaagcctt atgatttttt 1680cattgttcca gtttctggaa acgtaactcc tggagcgccg gttacgcgtg acacgtcagc 1740taatataaac agtgtgaacg cttttctatc aagtgtaccc gtttctaatg gttttgttgg 1800caacaagcag ttaaccctga gtaccgcagt agaagcagct aagggggaag tcgcaatcac 1860tttaaatggt caagcgctta aagtggggag cgctagtcca acagttgtta ctgtggctag 1920taataaaaaa gagtctcata tttctattga tatgaatgcc aaggcagctg ctgcggatgt 1980ggcagagggg gcagctatta actttgtagc tccggtaaca tttgctgttg atatttaatc 2040tgcattattt ttataccaaa ggaggggggg gccctccttt gccggaatag tttttatgaa 2100gattctgtat tcttttttgt tgttaccttt tttttcttgc gccttcagtg ttgattcaat 2160gataaagttt tcaggcgaag atgacttttt tcttgtaaat ggaaatagca aggaaagaga 2220gtatatctat gtaacgcttt ctgaactaat tagcgagaaa aacaataggc gcgatgaaat 2280attttacaac gcagacaatg tgcctctatg gcctatatct gcagaacctg cagatattat 2340tatttcatct ggcgaacaag tcaaaataaa aatcaacaaa aattatactc ctgtcggcgg 2400agatcgaatt tttggtatta atttcagccc agatacactg aatgataatg atagaaatca 2460gtataacata ccgtttggtt ataaagcatg gctgattgtt cccggaacag aatctgaatc 2520tggtacagta gatgttagca aagtttcgga aaaaaacaaa tatatcatta aaaacaacac 2580aaataaagta atggatgttt gggcagatta ttgtggaagt tataataata ataaatgcag 2640agtacagctt attactcgac cgtattcaga aaaaaagata gagatagata gtaacaataa 2700tccaattgaa tttacttttt ctatttatat cggacgcgaa cgaaaactga taaaaagaaa 2760gattttatga ctctaaaaga caccttattt tttttatcta tcagtattta ttgcagtcaa 2820tctctagctg ataaaagtga gctggctata ctcagtccta ataaatcaac cacggatttg 2880gttctggcag gaggaattaa cctgaacgtt tcccgttatg caggaataat tacgcctgaa 2940tctggtacag tcaaggtgct ttttgatgga gtaactgaga gcactctgaa tgccaaaata 3000tccttggata cagtgcagtt tcaagacaat gtacagtttg aatcatttct gaaaaatgtc 3060ggtattcgtg agaaatatat tgaaaaaatc ttgaaccaga atacccgagt cggtttcgtc 3120cattcccaag ggtgtcaggg acctcgaagt gaatgtattg tagttagtaa aggaattgac 3180tttgtcgtgg attactataa ccaaacaatt cgactgtttg ttgcgccaga attgttaggg 3240aagagcgttg gagagaattc atatctcacg cttaatggcg aacttgggat tattaataac 3300ctatcaggtt actattacga aacttttggt cgctatgacc cgacatacta tattcgtgat 3360caaggggtgg ttggggcagg tgcgggattt attcgctata atatttaccg ttcagattat 3420cagaataatg tggatgaact ctattacagc cgtgccttga tagccgataa taaaatactg 3480gttggcagga cgcaaagtaa cggtaacttt aatccatcca gcgctcagtc tattttttct 3540gatatttcag tcactgggat acgatttgga acagccgagg agttggttga tcgcagttat 3600ggaaagaaaa catttagtta ttacagcccg tcaactggaa tagtggaagt aagtaaagat 3660aatattctgg tgtacgctat tgctacgcag gcaggatatg gcgaaatcaa tttagcaaat 3720ttgccttatg ggcagtataa tgctttggtt caggtaaaat cgtcttccgg aatagttgtc 3780tcatcgcaga atgtgctgat taacaataca ggttcattca acagtgactt ctcttggcat 3840ctctttgtag ggaatagtgg ttcttctgac aatgaatttg tcagaaaaaa taccgaagtt 3900attgagagcg gtgttcaact tcctgtaaat acacttactg ctctttacgt aggaggtgct 3960aaggttgata aaaatacgat ttacagtact ggtttaatgt tccagaaaga accgatttct 4020gtttcactaa aaatgggggg ggggcaggga tttagacatt acgaaatgaa aagttatctt 4080gaaagactgt cactctcatg gaaaaagaca agtacaggta aaaactggaa tggcctaaaa 4140tccagcacag ataatactac actatcagcc ggctataact tcaatgtgat gtcgaatgtg 4200tctgctaatg ttggatatat atattcctcg agcatgaggc cagattactt ttacgctaat 4260actgaccatt tgggtatgga gtcagagttc agatataaaa aaaacaacta ttcaaacaag 4320aatctttatg ccaatatgta ttacaatttt cctggaggca atagtttata tctaaacacc 4380tacaaggaat taagaggaaa tgattacagc gtttctttgg ggatgaatat atctttgggt 4440aaaaactcac gttttaacag ctcattctat aaaaacggag cagatataac aaatagtagc 4500actgtggatt atgcaaaaag gctttctgat aactggtcac actcagtatc agtaggaaga 4560tatttttcta atgatagtta taattctgcc acatacagtc tctcccataa tagcaatgaa 4620gtgagggggg caggttatta ctatgctact gataatggac agagtcaact tacgttgaca 4680gcagatagca ctcagattat taacagtaat gggatatatt ttacttcgtc ttcatggaag 4740gataatgctt ttattattcg aggaaaggac gccaaatatg atatttccgt caggaatatg 4800actgataata ccacgcgtta ttttgattcc gacacaaata ttatcagtgt gcctgtatat 4860aataaagtaa tggtgaacag tgacacatct gggtcaaact tgatttttga aaattatcag 4920accaagaaaa gtcgtagttt tgcgcttgta ccagggtcaa cggtaatggt ttcagacaaa 4980actatcagcg cgaactccgt cattgtcaca ctgaaaaaca gtaataatca gtatgcccga 5040acggcatttt gcaacggaga cagttgtata gcagtttctc gcctgaatca gggagtattt 5100cgagtgaaat atacggggga ttcactcacg ctgcgttcgg agggggagca gtgttcgaca 5160tctgaaatta ataaaaggaa atatgtaagc attacctgtc aaaaaatata agagaagagt 5220atctggatga aaataaaaaa attcaaactt gtcttctata tggtaatttt ttatgtaatc 5280agtctgcaag aagtgctatc agccagcacg tctgtgatta ctaataacgg acaaacgata 5340actcttacgc ttcctgtgag ggcaaccatt acagcagata gtattctacg tgacactata 5400ttggttaagc ccttgtcatc cctttatgat gttgttacat gggattcgga gaataacaga 5460tttaaaaatc atgaattcct tgttagggtg attaaagaaa cagctgtacc tatttcattt 5520gaggttatta atgatcaata tacctgtagt tataataacc ctgacaggat gtctcccctg 5580ccgacagata ttgccatcgc gaactctgat tataaataca gtgtttcatg gtcaggtgga 5640tatgttgata tgggaaaggg acgcgcagct actgtaaatg acagtcactc gtggctatct 5700tctgtcaatg gtgttgacag atatttagac ttaacgctaa atataaactt tcctgatatg 5760actccatata ctcagttgct aaatcgtgga ggactatgta gggggagtat aactatgctg 5820ctaagtaata aattataaag agatgaacct aatgtttttt tttagagcga ttttaatcgt 5880tttttttatc ggatcagatg ttcaagcttt tcagatagat acgttaacca aggtgataga 5940taaagacacc caatacattg aaataacggg ggaatacgaa cgggaatata tttatacaca 6000attaacacaa cttcttactg ataaaaaaca tggactccgt gagattcctt ttaatccgga 6060ggatatatct tcatggccta ttattgtaga acctggagaa attgtgcttg ataaggcgga 6120taaaatcaga gttaaaatca tccgaaacgg tccgcaacag gatgaggatc gcgtgtcagg 6180tctagcattt atacccgaaa aggtgcgcag gaagaaaatc caagattcag gccttcaaat 6240atcggtagga tataaggtat ggctgtttat acccggcaaa tctcctttaa agggacagat 6300aaaagcctcc aaaaaaagtg gaaatataac aattgaaaat atgaccaata aaatattaag 6360aattgttcct gatgattgtt caggaaaaaa taaatctgaa tgtgccggag cggtaattct 6420attaccatat actagtaagc agattgatga ctcagagcat gtacagacgc ttagtattta 6480tctaattaat gatttacata aaaaaataaa ggtaatcaca ttatgaaaaa acaacctatt 6540gtattaactc taggcttttt ttcctttatg gttcaggctg ctacaacagt tacttcagaa 6600tttgaaatta ctaataaaac tatcgaaaaa tatacaatat caagtacaga tagtactatg 6660acatatactg atgtatcagg gagtggttta tataaaatat cagaccagta ttcagatgcc 6720aatgtcaata ttagaaatta cggcaatcat cagtttggat tgctcagaaa taacagcact 6780gttaatatta tcatgaaggg cgtaaactta ggccacactt ttactgtaca aggaaaatat 6840gccaattcag ccgtgtcagt tcccaatcct caaaaatatt ttaccgttag aagtaataat 6900ggatgctcaa gtgtatcttc tgcatatcta ggtaatgcga gttatacgct atacgaaata 6960agatctagta atgatgttac acggaactgt tccggacaaa cggatcagta cactcatatg 7020ccaaataata gtggtcaggt aaatgttaca ggaatttaca gagatttcta cttggatatt 7080ggtcgactgc aatcagacgc tgagtatagg aaagcacctc ctgataccta tataggaaca 7140gggacattcg ctggagaggt tttaaagaat cgagtaggtt ctggttatac tccgacttat 7200acaaacaaaa taacaattac aaaaaaacca tattttgaaa gtgtgacatt gcccacggta 7260gataatatct tcgatactcg tactatcggc agacagattc aggggaatct tgtaattcca 7320tttgtgatta atgggcattt cacaccatac aatactattt cgttgcaggt catttcacta 7380aatgggttta agttacaaag tgagaatgtt ggttcctcag caaccattcc ttattcgcta 7440aatatgacga taggtagtga acgacgttat tccttggcca caaatgggaa tggtttggga 7500aatgttacaa taaataacct cgaatctgat ggctattcca ttcaaggacg cttcaatgca 7560gattttttga tcgataaaaa tacagctgtg acaggagatt atgccgatac attgacagca 7620atatttcaga tttcgctact ataaattata gtacgaacaa ttacctcctg tagtggtcag 7680tagcatattg tcttgcattg aggcggttaa ttaacgttac tattttcgtg gattaatttt 7740tgagtgagaa gatgatcagg ccaaatgtag tggagaatat cattgcccgc caacttgaag 7800cttcaggtct ctggcgcagg gcatctgcgt gttggctggt tgttatgggg tattccagat 7860atacagatga agatcgggag tagttattgc agcatcgaga atattgcttg gcgcagatat 7920cgccttcgtc actaccggaa agactggata ttagtgaggt ggcaagggcg aatgatgcaa 7980caccgaaacg tatggggggt ggcaatgcag agagtgaact gtccgataaa acgcggtatc 8040gcgggacccc ggggggcttc ctgcatgtta acgggaaaat actgcgaata tccgccgctg 8100taccgtcaga gtgaaatctt tgtccgtcag ggtgtcgaac tgagctaggt attactctcc 8160aactggattg atgcgtgctg ccagttgatg gttccgccaa atgatgccct atacaactat 8220gtgatgaaca cccgcaatgt tcacactggc gacacaccag taaaagtgct gacaccgggc 8280agaaaaaagc aaaaacaggc cgcatctgga cgtatgtccg ggatacacgt tcagcgcatt 8340ccactgtttc agcaggtata cgaacgctga agtggctgaa gtggcacact gaatttggcc 8400acctgaacag aggtgatatg ctcacctcag aacaacacag gtgctccaat gaaaaaaaga 8460aattttagcg cagagtttaa acgcgaatcc gctcaactgg ttgttgacct gaaatacacg 8520gtggcagatg ccgccaaagc tatggatgtt ggcctttcca caatgatcaa gatgggtcaa 8580acaactacgt gatgagcgtc agggcaaaac acctaaagcc tctccgataa caccagaaca 8640aatcgaaata cgtaagctga ggaaaaagct acaacgcatt gaaatggaga atgaaatatt 8700aaaaaaggct gttgtagatt caattggtca acgcaacagt tatgtgaaaa catggggttg 8760cggaggtttt ttgaatgaga cgaacattta cagcagagga aaaagcctct gtttttgaac 8820tatggaagaa cggaacaggc ttcagtgaaa tagcgaatat cctgggttca aaacccggaa 8880cgatcttcac tatgttaagg gatactggcg gcataaaacc ccatgagcgt aagcgggctg 8940tagctcagct cacctgacac tgtctgagcg cgaggagata cgagctggtt tgtcagccaa 9000aatgagcatt cgtgcgatag ctactgcgct gaatcgcagt ccttcgacga tctcacgtga 9060agttcagcgt aatcggggca gacgctatta caaagctgtt gatgctaata accgagccaa 9120cagaatggcg aaaaggccaa aaccgtgctt actggatcaa aatttaccat tgcgaaagct 9180tgttctggaa aagctggaga tgaaatggtc tccagagcaa atatcaggat ggttaaggcg 9240aacaaaacca cgtcaaaaaa cgctgcgaat atcacctgag acaatttata aaacgctgta 9300ctttcgtagc cgtgaagcgc tacaccacct gaatatacag catctgcggc ggtcgcatag 9360ccttcgccat ggcaggcgtc atacccgcaa aggcgaaaga ggcacgatta acatatgaac 9420ggaacaccaa ttcacgaagt tcccgaaata tcgataacag acgctctcta gggcattggg 9480agggcgattt agtctcaggt acaaaaaact ctcatatagc cacacttgta gaccgaaaat 9540cacgttatac gatcatcctt agactcaggg gcaaagattc tgtctcagta aatcaggctc 9600ttaccgacaa attcctgagt ttaccgtcag aactcagaaa atcactgaca tgggacagag 9660gaatggaact ggccagacat ctagaattta ctgtcagcac cggcgttaaa gtttacttct 9720gcgatcctca gagtccttgg cagcggggaa caaatgagaa cacaaatggg ctaattcggc 9780agtactttcc taaaaagaca tgtcttgccc aatatactca acatgaacta gatctggttg 9840ctgctcagct aaacaacaga ccgagaaaga cactgaagtt caaaacaccg aaagagataa 9900ttgaaagggg tgttgcattg acagattgaa tctac 9935104689DNAEscherichia coligene(1742)..(2647)csvR 10aagcttcttt cattcgctga aagtggaatg tatccatgga gaacacttta tcagctggga 60aataatgcgg gcaacggtat ttaattatat cgaatgtgat tacaatcggt ggcggcggca 120cagttggtgt ggcggcctca gtccggaaca atttgaaaac cagaacctcg cttaggcctg 180tgtccatatt acgtgggtag gatcatatcg cctacattga cacgtttaaa aggagaaacg 240taacgagttt cacctttctc ggatatgact tcaaagtgcg tacgctgaag aatttcaaag 300gcgaactgta ccgaaagtgc atgccgggtg cgtcaaatgc agcaatgcgc aaaataacag 360aaacaatcaa gaagtggcgt atacatcgct caacaggtga gagtttgctg gattttgcga 420gtcgctacaa tgcgatagtg agaggctgga gcgggtacta cggaaagttc tggtccagaa 480atttcaacta tcgactgtgg agtgcaatgc agtcacgtct gctcaagtgg atgcagtcta 540aatacagact ttcgaaccgg aaggctcagt gaaagctgac gctggtaagg aaggagtatc 600cgaagctatt tgtcctctgg tatttcctgc gtgcatcgaa tgagtggtca agagccgtat 660gacgcgagag tgtcacgtac gattccgtga gcagccgggg agtgaaattc tctccggctg 720actcgactcg cgggttccga cagcggtggc gaacatgcgg cggtgttgta ctcgctgatc 780ggcacatgcc gtctgaacaa tgtggagcca gaaaaatggc tgcgttacgt cattgagcat 840atccaggact ggccggcaaa ccgggacgtg atctgttgcc ttggaaagtg atctgagctc 900tcagtaaata tcaattcggt tctgacgagc cgcttacgca acagctgaaa aaggttcatt 960attttatgga aaccgtgagc ccattccccg gtgataaaca tgggctggta aaagagtagc 1020ggtattagat gtagctatct aagaaaatat cataaatatg tcttaattta ggcatatgtg 1080aaacctcaaa agtgcacatt tagctaacac ttgtcatttt ttttctttaa aatatcactt 1140tcccttacat ctgagtgatt tattaacttg ccaattggat gatttttgag ttgtgttttt 1200atttcaatct actgtttata gagaatatac ccttagaata aaggataatt tttttgtaaa 1260ctcacaaaaa caatataagt ataaaatata ccgatgagtg actgttttgc attcaataaa 1320acatataact atatattttg attttttctt tttgagtttc gattaatgaa cgcttcacaa 1380aacattgctc tatctatgca ccactttata ttatcaggca ctttacacaa aagtgatgct 1440tgcttccata gttcaaaggc cgaaaccata tctgtttttc tttctgctaa agcagcttct 1500tgagataaag agtgaaaaga atcttttgcc ataaaagtac attacttaag caggtatatt 1560ggattttgtc agtatacaat acgaatattc cgtcaagatg ataaaaaaat gtagggctaa 1620gaaaatctgg gtgcggaaga gagggttaaa aaaatatcgc tttgtttgca ggtggagagg 1680caagattaca aaggcagatt aagcaagaaa atcaagccac ctaattttta tggatagcga 1740gatggacttt aaatatacag aagaaaaaga gttaataaaa ataaataatg taatgattca 1800taagtatact atattatata catcgaattg tattttggat atatcttttg gtgaagataa 1860gattacatgt ttcaataata ggcttgtgtt tcttgagaga ggggttaata tctctgtgag 1920aatccaaaaa caaaaattaa cagaaaaacc atatgtcgca ttcagattga atgaaaatgt 1980gcttagacat ttaaaaaaca cgttaatgat aatatatgga atgtcaaaaa tagactcctg 2040tgagtgtagg ggagtatcga gaaaaataat gacaactgaa gtagataaaa tgttattgaa 2100tgtgttaaga gagatgatgg ggcatcataa tgatgattca tcttttatat ctgcactaat 2160atatctaatt tcgaaaatca aatgcaatga taaaataata gaatcgcttt acatgtcttc 2220tataaccttt tttactgaca aagtcagagg tgttatcgaa aaagacctat caagaaaatg 2280gactttggct ataattgcag atgtatttaa tgtatcagaa ataactatca gaaaaagatt 2340agaatctgaa gacactaatt tcaaccagat cttaatgcaa tcaagaatga gcaaagcggc 2400attgttattg cttgaaaatt catatcagat atctcagata tctaatatga ttgggatttc 2460tagcgcatct tattttatta ggattttcaa taaacatttt ggcgttacgc gaagcagttt 2520tttaattatt ttaaaggagg atgaaaatgt ttttgctacg cgccaaggca atagttctct 2580gacccagttg acttgcgagt tcaaacacat aagtggaggt aaccgtctaa atcgctgcac 2640ggaataagtt ctccacggct ttgttgaata aatcgaattg ttgctgagtt gaaggatcag 2700acacacatcc cctgacaaca caggcattcc tgtggcaaag cagcagttca gaatcaccaa 2760ttggcacagg gcaggtatga gtcagcaacc ccttcatcac gggaacctca gcgctattct 2820gacctcgcta tcaccactgt tctggtgatt gattacatcg ggctgaaagt tttcggtgac 2880ggtgagtgga aagtcaaaaa acatggcaaa gaacggcgtc gtacttggcg gaacgtacga 2940tggtcaggtt actgaggcac tggctatcgc gccctgaaca aaatgacgaa ggcgggtatg 3000ccagaaagcg tgcaaacttc ctgaaaaccc aactggatac agagcgtctc acctgaaact 3060gggtgatgcc tctaattggt tgaattgaag tataatgctc gcttttgagg ttttctcatg 3120gccatcgtta ctgtccattg tccccgttgt cagtctgctc aggtttaccg ccatggtcag 3180aaccctaaag gccgtgccgg tttcgctgcc gtgactgcca tcgtgtattt ctgctcacct 3240acacctatga agcccgtaag cccggcgtca aagagcaaat caccgaaatg gcgttcaacg 3300gagcaggggg ccgcgatacc gcaaggacac tcaaaattgg tataaatacc gtcatccgca 3360ctttaaaaaa ttcgcgccaa agagaataac gccctctccg gtcgctcatg cagatgtcgc 3420gctcatctgc gagcccgatg aacagtggag ctttgtcggc agcaaggccc gacagcactg 3480gctctggtat gcctgcaaca ccaaaacagg tggtgttctt gcttatacgt tcggtccacg 3540aacggatgaa actgtcgtga gctgctggct ctgctcaccc cgtttaatat cggcatgata 3600acgagcgacg actggggaag ttatgccaga gaagtcgcga aggaaaagca tctgaccggc 3660aaactattca ctcagcgcat tgagcgtaac aatctgacgc tgagaacccg catcaagcgt 3720ctggcccgca aaacaatctg cttttcacgc tcaattgagc tacatgaaaa ggttatcggg 3780gccttaattg aaaaatacat gttctactaa ttggaagcat cacctggaaa ctgacttatc 3840caacaaagca acttaatatt gtatatacaa aaccctctaa aaattagaat aattaaaact 3900tctatcaaat tcaattctaa tgatgaatga aaattttctt acgtttaatg gcattataca 3960acataagaag gaagtcaata aaatatttcg ataaaaacat caaccatcac tccagtttta 4020tgtaagttat tattttttag ctccgagaga agtgcggatg ttttaaaatc agtgaggtag 4080taatacatct gcaaatgtaa ggaaatacaa ataaaaagaa ttatactttc tctttctgta 4140attttttgtt ctcattctgc tttagcaggc agcactgatt ggcagccatc agtagggcca 4200ggacaatgta tagtatatgc agaaattggt gagacaggag ggtataaatg gaataatcag 4260aatgaatgta acgaagttgt gcgcagagga tatgcaatag gagtaggtgt ctcgggtaaa 4320gttatatatg aaggaaataa gccggggtat aatggggatt caattagcta ttcaggtatc 4380gtcacccctg acagagatta taagcgacaa gcacctgccg tttataacgg aaagaaaaaa 4440gtggctcatg gcgatagtta tacgtactgg gcaaaatagt aatcagcaat aaaacctcac 4500tatagttaag tatagcgcaa aagctaatgt tatgctacct tgtgatttca aggtagcata 4560tttataaaaa taatttaaaa atattatccc gatgataaat agtggacacg tttaatgatt 4620cttccctcgt aatatatgat gaccattttt gttattctcc acaacgagtt agttcttctt 4680tttggatcc 4689115113DNAEscherichia coligene(649)..(1113)cssA 11aagcttcacg acatagcggg gaagtttgct tctttgaggg gcaggttttc gtttacgggg 60tttagctgaa ctggtcatat aactaactga aaaacaatga tattatctgt ttttataacg 120gtaatttcag gccatgacaa gccgcagccg ccacggtcta ctcgagtggc taatcagcga 180atgaccggga gtaatgcgcg gtggaaatgg acaacagatt acaaccgtcg ctcgatagcg 240gaaacggcga tgtaccgggt aaaacagctg ttcggggggg gggcactgac gctgcgtgac 300tacgatggtc aggttgcgga ggctatggcc ctggtacgag cgctgaacaa aatgacgaaa 360gcaggtatgc ctgaaagcgt gcgtattgcc tgaaaacaca acccgctacg ggggagactt 420acccgaaatc tgatttattc aacaaaccgt cacggctggg aatctctctc cggcagcctt 480caggaagaaa ttccatcaag acggctgctt aaaaaagaac aaatggtagt gtccgctatt 540gccagtacac ctcactcacc aataaaagcg tcaatacggt gctccgtcga cacattacga 600atgttatgta tacaataaaa atgattatag caatagtaat ggtgttatat gaagaaaaca 660attggtttaa ttctaattct tgcttcattc ggcagccatg ccagaacaga aatagcgact 720aaaaacttcc cagtatcaac gactatttca aaaagttttt ttgcgcctga accacaaatc 780cagccttctt ttggtaaaaa tgttggaaag gaaggaggtt tattatttag tgtgagctta 840actgttcctg aaaatgtatc ccaggtaacg gtctaccctg tttatgatga agattatggg 900ttaggacgac tcgtaaatac cgctgatgat tcccaatcaa taatctacca gattgttgat 960gataaaggga

gaaaaatgtt aaaagatcat ggtgcagagg ttacgcctaa tcaacaaata 1020acttttagag cgctgaatta tactagcgga gataaagaaa tacctcctgg gatatataac 1080gatcaggtta tggttggtta ctatgtaaac taaatactgg aagtatgatt atgttgaaaa 1140aaattattcc ggctattgta ttaattgcag gaacttccgg agtggtaaat gcaggaaact 1200ggcaatataa atctctggat gtaaatgtaa atattgagca aaattttatt ccagatattg 1260attccgctgt tcgtataata cctgttaatt acgattcgga tccgaaactg aattcacagt 1320tatatacggt tgagatgacg atccctgcag gtgtaagcgc agttaaaatc gtaccaacag 1380atagtctgac atcttctgga cagcagatcg gaaagctggt taatgtaaac aatccagatc 1440aaaatatgaa ttattatatc agaaaggatt ctggcgctgg taagtttatg gcagggcaaa 1500aaggctcctt ttctgtcaaa gagaatacgt catacacatt ctcagcaatt tatactggtg 1560gcgaataccc taatagcgga tattcgtctg gtacttatgc aggacatttg actgtatcat 1620tttacagcaa ttaaaaaaag gccgcattat tgattgcggc cattgacgat actgccaggc 1680aaaaatatga aatcaaagtt aattatatta ttgatgttag tgccattttc atctttttca 1740acagaaaata attttgaaat aaataagaca cgagtaattt actctgacag cacaccatca 1800gttcaaatat caaataataa agcatatcct ttaattgttc aaagcaatat atgggatgaa 1860aacaataata aaaatcatga ctttatagca acaccaccga tttttaaaat ggaaagtgaa 1920agcaggaaca taataaaaat aatcaaaaca aatattaaat tgccggactc tcaggaaagt 1980atgagatggt tatgtattga atcaatgcca ccaacagaaa aaagtactaa aataaacaga 2040aaagaaggaa ggacagacag tattaatatc agcattcggg gatgcattaa actgatatat 2100cagcctgcca gtgttccgtc tcctgttttt aataatatag tggaaaaatt aaaatggcat 2160aaaaatggaa agtatcttgt attaaaaaat aatacaccct attacattag cttttctgag 2220gttttttttg attcagataa agtaaacaat gcaaaagata ttttatatgt aaaaccatac 2280tcagagaaga aaatagatat cagcaacaga ataataaaaa aaatcaaatg ggcaatgatt 2340gatgatgctg gcgcaaaaac aaaactttat gaatcaattt tataaaaaat atcattatag 2400tatacaaaaa tatcagatta cagacttgct tttttttcta tttctatatc ctttttcaac 2460ctcatatgga aatgaacaat ttagttttga ctcacgattc ctaccatcag gttataatta 2520ctctttaaat agtaacttac ctcctgaagg tgagtatctg gttgatattt atattaacaa 2580aataaaaaag gagtccgcga ttattccttt ttatataaaa ggaaataaac ttgtaccatg 2640tttatcaaaa gaaaaacttt catctttggg tatcaacatt aataataacg acaacgcaga 2700gtgtgcagaa acaagtaagg caggtattag taatatcagc tttgagttta gctcccttcg 2760tttgtttatt gctgtaccaa aaaatcttct gtctgagatt gataaaatat catcaaagga 2820tatagataac gggatccatg ctttattttt taattatcaa gtaaatacaa ggctagctaa 2880taataaaaat cgttatgatt acatttctgt ttcaccaaat ataaattatt tttcatggcg 2940gttgcgtaat cgttttgaat ttaaccaaaa caacgataaa aaaacatggg aaagaaacta 3000cacttatcta gaaaaaagtt tttatgataa aaagctaaac ttaatcgttg gtgaaagtta 3060tacgagttca aatgtttata ataactactc ttttactggt atttcagttt ctacagatac 3120agatatgtat acgccaagtg aaatcgatta tacaccagaa attcatggag tggctgattc 3180agactctcag attattgtta ggcaaggcaa caccattatc attaatgaaa gtgttccagc 3240cggaccgttc tcatttccaa taaccaatct catgtatact ggggggcaac ttaatgtgga 3300gataacagat atttatggaa ataaaaaaca atatactgtc agtaattcct ctcttcctgt 3360tatgagaaaa gcgggactaa tggtatataa ttttatatct ggaaaattaa caaaaaaaaa 3420tagtgaagat ggtgattttt ttgcccaagg tgatattaac tacggtactc actataacag 3480cacactattc ggtgggtatc agtttagtaa aaattatttt aacttatcta ctggtatagg 3540cactgatctg ggattttctg gagcatggct actaaacgtt agcagaagta attttaagga 3600taaaaatgga tataatatta atctacaaca aaacactcag ttaagaccat tcaatgccgg 3660ggttaatttc gattacatat acagaaaaaa agggtatgtg gaactttccg gcattggctg 3720gcatggtaat ttatataatc aacttaaaaa tagtttttct ttatctttgt caaaatcatt 3780ggataaatac ggaaatttct cacttgatta taacaaaata aaatactggg ataatgcgta 3840tgatagtaac tcaatgtcga ttcgttattt ttttaaattc atgcgagcaa tgattacaac 3900aaattattct ttaaataaat atcaatctta tgaaaaaaaa gataaaagat ttagtattaa 3960tatatcattg cctttaacca aagattacgg gcacatatct tcaaactatt cattttccaa 4020tgcaaataca ggaacggcaa ccagttctgt aggtgtaaac ggtagttttt ttaatgacgc 4080aagattaaac tggaacattc agcagaacag aacgacccgt aacaatggat atactgataa 4140taccagttac atagcaacca gctatgcctc tccctatggc gtttttactg gttcatattc 4200aggatcgaac aagtattcaa gccagttcta ttccgcattg ggaggtattg ttttgcatag 4260cgatggcgta gcttttactc aaaaagccgg agatacctct gctcttgtcc gtattgataa 4320tatttctgat ataaaaattg gtaacactcc tggtgtttat actgggtata atggttttgc 4380tttaattcct catcttcagc cgttcaaaaa aaacaccatt ttaattaatg ataaaggaat 4440tccagacgat attgctcttg ctaatataaa aaaacaagtt atcccatcac gaggagctat 4500tgttaaagta aaatttgatg ctaaaaaagg caataacatt ttgtttaagc ttacaactaa 4560agatggaaaa acgcccccat taggagctat agcccatgaa aaaaatggaa aacagattaa 4620tacgggtatc gttgacgatg atggcatgct ttatatgtct ggattatcag gggcagggat 4680tattaatgta acatggaatg gaaaagtctg ttcatttcct ttttcagaaa aagatatatc 4740tagcaaacaa ttatctgttg taaataaaca atgtaaccgc cccgaaaatt ctggagacta 4800aacttcctga gaaagaggta aacaggatga ctaaaaatac tcgtttttcc ccgaaatccg 4860tcaacgggca gttcaaaagg attatctggc tgaagtggct aattacagta acgaccgctg 4920ggaagcaccg caacgtgcct cacgcctagc tgctagcgta atgaggtagc ctgaatttaa 4980cggacactcc ttcctgaaat agaatgacat cagaaggagt taatcatgac cagaaaacct 5040caaagttact ctaaagaatt taaagccgaa gcggtcagaa ctgttcacgt ataggaaatg 5100gctttgtgaa gtg 51131227DNAArtificial Sequencesynthetic primer 47151 12ccggtcgacc ttattgagga atatcgg 271324DNAArtificial Sequencesynthetic primer 47152 13ggcgcatgca gatctgatta gagc 241431DNAArtificial Sequencesynthetic primer 47150 14ggcgcatgcc ggaattccat ttgagactcc c 311521DNAArtificial Sequencesynthetic primer RNS-03 15acatcatagc gatggcatca a 211623DNAArtificial Sequencesynthetic primer RNS-04 16tatttcaatt cagttcgcat cgc 231729DNAArtificial Sequencesynthetic primer 47173 17gacggatccg aatgcgaggc atccggttg 291835DNAArtificial Sequencesynthetic primer 47174 18ttcctcaata agctctgtta tatgccttta tttgc 351932DNAArtificial Sequencesynthetic primer 47175 19tataacagag cttattgagg aatatcggtg tc 322030DNAArtificial Sequencesynthetic primer 47176 20tggttgtcga gatctgatta gagccgcata 302133DNAArtificial Sequencesynthetic primer 47177 21tctaatcaga tctcgacaac cagttcactc gtg 332229DNAArtificial Sequencesynthetic primer 47178 22ggtggatccg ttaaagcgca tcagcgcgg 292325DNAArtificial Sequencesynthetic primer 47180 23ccgtcctgtg gatcctctac gccgg 252423DNAArtificial Sequencesynthetic primer 47182 24atcggtcgac gctctcccgg tcc 232524DNAArtificial Sequencesynthetic primer 4732 25gtacaaataa cctacaaaaa gccc 242622DNAArtificial Sequencesynthetic primer 47105 26taacgcctgc tctaacattc cc 222721DNAArtificial Sequencesynthetic primer 47168 27cgttatgcag gaataattac g 212821DNAArtificial Sequencesynthetic primer 47167 28cgtattttta tcaaccttag c 212926DNAArtificial Sequencesynthetic primer 4714 29ttcaacctta aaagctttaa aagcct 263032DNAArtificial Sequencesynthetic primer 4715 30ctacacgaac tctgaagatc agcagttcaa cc 323131DNAArtificial Sequencesynthetic primer 4716 31gatcttcaga gttcgtgtag actttccttg g 313228DNAArtificial Sequencesynthetic primer 4717 32gccactgcag cctcgcagag caggattc 283328DNAArtificial Sequencesynthetic primer 4718 33ggcactgcag gcgtagcacc aggcgttt 283424DNAArtificial Sequencesynthetic primer 4719 34tcatccggag ttccgtatgg caat 243523DNAArtificial Sequencesynthetic primer 4720 35tgccatacgg aactccggat gag 233647DNAArtificial Sequencesynthetic primer 4721 36gcttttaaag cttttaaggt tgaattcgat cggcacgtaa gaggttc 473726DNAArtificial Sequencesynthetic primer 4722 37ggcctgcagg caagacctaa aatgtg 263827DNAArtificial Sequencesynthetic primer 4723 38gcgctgcagc tttatgttga taagaaa 273921DNAArtificial Sequencesynthetic primer 4766 39caacagtact gcgatgagtg g 214021DNAArtificial Sequencesynthetic primer 4917 40atcaacggtg gtatatccag t 214123DNAArtificial Sequencesynthetic primer R6K-01 41gtgacacagg aacacttaac ggc 23

Claims

1. A composition that induces an immune response against three or more coli surface (CS) antigens comprising a bacterial cell which expresses said three or more CS antigens.

2. A composition according to claim 1, wherein the cell is an E. coli cell.

3. A composition according to claim 2, wherein the cell is an enterotoxigenic E. coli (ETEC) cell.

4. A composition according to claim 1, wherein the CS antigens are ETEC CS antigens selected from CS1, CS2, CS3, CS4, CS5 and CS6.

5. A composition according to claim 1, wherein the cell expresses CS1, CS2 and CS3.

6. A composition according to claim 1, wherein the cell expresses CS4, CS5 and CS6.

7. A composition according to claim 1, wherein the cell expresses CS1, CS3 and CS4.

8. A composition according to claim 1, wherein the cell is attenuated by deletion or inactivation of a gene.

9. A composition according to claim 8, wherein the cell is attenuated by deletion or inactivation of one or more of aroA, aroC, aroD, aroE, pur, htrA, ompC, ompF, ompR, cya, crp, phoP, phoQ, surA, rfaY, dksA, hupA, invE and clpB.

10. A composition according to claim 9, wherein the cell is attenuated by deletion or inactivation of at least one aro gene and at least one omp gene.

11. A composition according to claim 9, wherein the cell is attenuated by deletion or inactivation of at least one aro gene and the htrA gene.

12. A composition according to claim 9, wherein the cell is attenuated by deletion or inactivation of each of aroC, ompF and ompC.

13. A composition according to claim 1, wherein the cell does not express one or more of heat stable toxin (ST), heat labile toxin (LT) and EAST 1.

14. A composition according to claim 13, wherein the cell is obtainable by a method comprising deletion of all or a part of the ST gene with a suicide vector.

15. A composition according to claim 13, wherein the cell is obtainable by a method comprising site-directed deletion or inactivation of the LT gene and/or the EAST 1 gene.

16. A composition according to claim 1, wherein the cell does not express an antibiotic resistance gene.

17. A composition according to claim 1, wherein the cell further expresses a heterologous antigen in addition to the three or more CS antigens.

18. A composition according to claim 17, wherein the heterologous antigen is an E. coli antigen.

19. A composition according to claim 17, wherein the heterologous antigen is a non-toxic component or form of LT.

20. A composition according to claim 19, wherein the non-toxic component of LT is the B subunit.

21. A composition according to claim 1, wherein the cell is obtainable by a method comprising introduction of a polynucleotide encoding a heterologous CS antigen into a bacterial cell.

22. A composition according to claim 21, wherein the polynucleotide comprises the operon of the heterologous CS antigen.

23. A composition according to claim 21, wherein the method comprises introducing a polynucleotide encoding a regulatory protein into the cell.

24. A composition according to claim 21, wherein the heterologous CS antigen coding sequence is carried on a stable plasmid in the cell.

25. A composition according to claim 21, wherein the heterologous CS antigen coding sequence is inserted in the bacterial chromosome of the cell.

26. A composition according to claim 1, which comprises a bacterial cell as deposited under accession No. 02082969 at the ECACC.

27. A composition according to claim 1, which comprises bacterial cells that together express all of CFA/I, CS1, CS2, CS3, CS4, CS5 and CS6, wherein the composition comprises fewer than five bacterial strains.

28. A composition according to claim 27, which comprises three bacterial strains.

29. A composition according to claim 28, which comprises: (i) a strain which expresses CS1, CS2 and CS3; (ii) a strain which expresses CS4, CS5 and CS6; and (iii) a strain which expresses CFA/I.

30. A method that induces an immune response against three or more coli surface (CS) antigens, comprising administering to a mammal a bacterial cell which expresses said three or more CS antigens.

31. A method according to claim 30, wherein the cell is an E. coli cell.

32. A method according to claim 31, wherein the cell is an enterotoxigenic E. coli (ETEC) cell.

33. A method according to claim 30, wherein the CS antigens are ETEC CS antigens selected from CS1, CS2, CS3, CS4, CS5 and CS6.

34. A method according to claim 30, wherein the cell expresses CS1, CS2 and CS3.

35. A method according to claim 30, wherein the cell expresses CS4, CS5 and CS6.

36. A method according to claim 30, wherein the cell expresses CS1, CS3 and CS4.

37. A method according to claim 30, wherein the cell is attenuated by deletion or inactivation of a gene.

38. A method according to claim 37, wherein the cell is attenuated by deletion or inactivation of one or more of aroA, aroC, aroD, aroE, pur, htrA, ompC, ompF, ompR, cya, crp, phoP, phoQ, surA, rfaY, dksA, hupA, invE and clpB.

39. A method according to claim 38, wherein the cell is attenuated by deletion or inactivation of at least one aro gene and at least one omp gene.

40. A method according to claim 38, wherein the cell is attenuated by deletion or inactivation of at least one aro gene and the htrA gene.

41. A method according to claim 38, wherein the cell is attenuated by deletion or inactivation of each of aroC, ompF and ompC.

42. A method according to claim 30, wherein the cell does not express one or more of heat stable toxin (ST), heat labile toxin (LT) and EAST 1.

43. A method according to claim 42, wherein the cell is obtainable by a method comprising deletion of all or a part of the ST gene with a suicide vector.

44. A method according to claim 42, wherein the cell is obtainable by a method comprising site-directed deletion or inactivation of the LT gene and/or the EAST 1 gene.

45. A method according to claim 30, wherein the cell does not express an antibiotic resistance gene.

46. A method according to claim 30, wherein the cell further expresses a heterologous antigen in addition to the three or more CS antigens.

47. A method according to claim 46, wherein the heterologous antigen is an E. coli antigen.

48. A method according to claim 46, wherein the heterologous antigen is a non-toxic component or form of LT.

49. A method according to claim 48, wherein the non-toxic component of LT is the B subunit.

50. A method according to claim 30, wherein the cell is obtainable by a method comprising introduction of a polynucleotide encoding a heterologous CS antigen into a bacterial cell.

51. A method according to claim 50, wherein the polynucleotide comprises the operon of the heterologous CS antigen.

52. A method according to claim 50, wherein the method comprises introducing a polynucleotide encoding a regulatory protein into the cell.

53. A method according to claim 50, wherein the heterologous CS antigen coding sequence is carried on a stable plasmid in the cell.

54. A method according to claim 50, wherein the heterologous CS antigen coding sequence is inserted in the bacterial chromosome of the cell.

55. A method according to claim 30, wherein the bacterial cell is as deposited under accession No. 02082969 at the ECACC.

56. A method according to claim 30, which comprises administering bacterial cells that together express all of CFA/I, CS1, CS2, CS3, CS4, CS5 and CS6, wherein fewer than five bacterial strains are administered.

57. A method according to claim 56, which comprises administering three bacterial strains.

58. A method according to claim 56, which comprises administering: (i) a strain which expresses CS1, CS2 and CS3; (ii) a strain which expresses CS4, CS5 and CS6; and (iii) a strain which expresses CFA/I.

Images