PAAD DOMAIN-CONTAINING POLYPEPTIDES, ENCODING NUCLEIC ACIDS, AND METHODS OF USE

Abstract

The invention provides isolated nucleic acid molecules encoding PAAD-domain containing polypeptides and functional fragments thereof, including fragments containing PAAD domains, NACHT domains and ARED domains, encoded polypeptides, and antibodies. Also provided are methods of identifying polypeptides and agents that associate with a PAAD-domain containing polypeptide or fragment thereof, or that alter an association of a PAAD domain-containing polypeptides. Further provided are methods of identifying agents that modulate PAAD domain-mediated inhibition of NFκB activity, or modulate an activity of a NACHT domain of a PAAD domain-containing polypeptide. Also provided are methods of modulating NFκB transcriptional activity in a cell, and methods of altering expression of a PAAD domain-containing polypeptide in a cell.

Description

[0001] This application claims benefit of the filing date of U.S. Provisional Application No. 60/370,538, filed Apr. 4, 2002, which is incorporated herein by reference.

BACKGROUND OF THE INVENTION

[0003] 1. Field of the Invention

[0004] This invention relates generally to the fields of molecular biology and molecular medicine and more specifically to the identification of proteins involved in innate immunity, programmed cell death, NFκB induction, cytokine processing and inflammation, and associations of these proteins.

[0005] 2. Background Information

[0006] Proteins containing the death domain fold (DDF) play pivotal roles in programmed cell death (apoptosis) and inflammatory responses. The DDF represents a protein interaction motif consisting of a bundle of (usually) six antiparallel α-helices. This core structure is found in at least three families of evolutionarily conserved and closely related domain families, including Death Domain (DD), Death Effector Domain (DED) and Caspase Recruitment Domain (CARD) families.

[0007] CARD- and DED-family proteins have been implicated in activation of Caspase-family proteases. Though many of these intracellular cysteine proteases are involved in apoptosis induction, some of these proteases, such as Caspase-1, are chiefly responsible for proteolytic processing and activation of pro-inflammatory cytokines, such as Interleukin-1β. Homotypic interactions among CARD- and DED-containing adapter proteins occur with the inactive proforms of those Caspases which possess N-terminal prodomains containing complementary CARDs or DEDs, respectively. The resulting formation of multi-protein complexes leads to protease cleavage and activation by an induced proximity mechanism in which pro-proteases are clustered together, permitting trans-proteolytic cleavage events necessary for generation of active Caspases.

[0008] Besides regulating Caspase activation, some DDF proteins are also known to participate in activation of transcription factor NF-κB, a family of dimeric transcription factors containing the Rel-homology domain (RHD). In mammals, NF-κB family members play critical roles in regulating expression of genes involved in inflammatory and immune responses, including certain cytokines, lymphokines, immunoglobulins, and leukocyte adhesion proteins. Among the DDF proteins, DD- and CARD-containing proteins have been shown to participate in NF-κB induction, with certain DD-family proteins linking cytokine receptors to downstream adapter proteins implicated in IKK activation and specific CARD-family proteins linking to adapter proteins that connect to the IKK complex.

[0009] The identification of proteins with folds that structurally resemble the Death Domain Fold, determination of molecules with which they interact, and elucidation of their biological function, can form the basis for strategies designed to alter apoptosis, NFκB inductions, immune and inflammatory responses, cytokine production, and other cellular processes mediated by these proteins. Thus, a need exists to identify proteins with structural resemblance to DDF proteins, and to identify functional domains within these proteins. The present invention satisfies this need and provides additional advantages as well.

SUMMARY OF THE INVENTION

[0010] The invention provides isolated nucleic acid molecules encoding PAAD-domain containing polypeptides and functional fragments thereof, including fragments containing PAAD domains, NB-ARC (NACHT) domains and LRR domains. Also provided are vectors containing such nucleic acid molecules and host cells containing the vectors. Further provided are oligonucleotides therefrom and methods of identifying nucleic acid molecules encoding a PAAD-containing polypeptide in a sample using such oligonucleotides.

[0011] Also provided are isolated PAAD-domain containing polypeptides and functional fragments thereof, including fragments containing PAAD domains, NB-ARC (NACHT) domains and LRR domains, and'peptides therefrom.

[0012] The invention further provides antibodies that can specifically bind to PAAD-domain containing polypeptides, and methods of detecting PAAD-domain containing polypeptides in a sample using such antibodies.

[0013] Also provided is a method of identifying a polypeptide that associates with a PAAD-domain containing polypeptide or fragment thereof, including fragments containing PAAD domains, NB-ARC (NACHT) domains and LRR domains. The method is practiced by contacting a PAAD domain-containing polypeptide or fragment with a candidate PAAD domain-containing polypeptide-associated polypeptide (PAP), and detecting association of the PAAD domain-containing polypeptide or fragment with the candidate PAP, wherein a candidate PAP that associates with the polypeptide is identified as a PAP.

[0014] The invention also provides a method of identifying an effective agent that alters the association of a PAAD domain-containing polypeptide or fragment with a PAP. The method is practiced by contacting a PAAD domain-containing polypeptide, or a PAAD, NB-ARC (NACHT) or LRR domain therefrom, and the PAP under conditions that allow the PAAD domain-containing polypeptide or fragment and the PAP to associate, with a candidate agent, and detecting the altered association of the PAAD domain-containing polypeptide or domain with the PAP, wherein an agent that alters the association is identified as an effective agent.

[0015] Further provided is a method for identifying an agent that associates with a PAAD-domain containing polypeptide or fragment therefrom, including a fragment containing a PAAD domain, NB-ARC (NACHT) domain or LRR domains. The method is practiced by contacting the PAAD domain-containing polypeptide or fragment with a candidate agent and detecting association of the PAAD domain-containing polypeptide with the agent.

[0016] Also provided is a method of identifying an agent that modulates PAAD domain-mediated inhibition of NFκB activity. The method is practiced by contacting a cell that recombinantly expresses a PAAD containing polypeptide with a candidate agent and detecting NFκB activity in the cell. Increased or decreased NFκB activity in the cell compared to a control cell indicates that the candidate agent is an agent that modulates PAAD domain-mediated inhibition of NFκB activity.

[0017] Further provided is a method of identifying an agent that modulates an activity of a NB-ARC (NACHT) domain of a PAAD domain-containing polypeptide. The method is practiced by contacting an NB-ARC (NACHT) domain-containing polypeptide with a candidate agent and detecting an activity of the NB-ARC (NACHT) domain, wherein an increase or decrease of the activity identifies the agent as an agent that modulates the activity of the NB-ARC (NACHT) domain. The detected activity of the NB-ARC (NACHT) domain can be selected from homo-oligomerization, hetero-oligomerization, nucleotide hydrolysis, and nucleotide binding.

[0018] Further provided is a method of modulating NFκB transcriptional activity in a cell. The method is practiced by introducing a nucleic acid molecule encoding a PAAD domain-containing polypeptide into a cell and expressing the nucleic acid molecule in the cell, wherein the expression of the nucleic acid modulates NFκB transcriptional activity in the cell.

[0019] The invention also provides a method of decreasing expression of a PAAD domain-containing polypeptide in a cell, by introducing an antisense or dsRNA nucleic molecule into a cell, wherein the antisense or dsRNA nucleic molecule binds to a nucleic acid molecule encoding a PAAD domain-containing polypeptide.

BRIEF DESCRIPTION OF THE FIGURES

[0020] FIG. 1 shows that multiple alignment using the CLUSTAL W program (Higgins et al. Nuc. Acid Res. 22:4673-4680 (1995)) of the aligned part of selected members of the PAAD family from humans. NCBI gi accession numbers are included. The "sec_str" line shows secondary structure prediction made for pyrin using the PHD program (Rost et al., Comput. Appl. Biosci. 10:53-60 (1994)).

[0021] FIG. 2 shows the evolutionary tree showing the relationship between selected members of the PAAD family of proteins from humans and viruses. The tree was built using the CLUSTALW program. Proteins containing NB-ARC (NACHT) NTP-ase-domains as well as PAAD domains (NAC and PAN1-6) are shown in grey.

[0022] FIG. 3 shows a schematic (not to scale) representation of domain arrangement in proteins containing a PAAD domain.

[0023] FIG. 4 shows a model of the PAAD domain built on the template of the Death Effector Domain from FADD protein (PDB code: 1a1z), using the FFAS alignment and the Modeller program (Sail et al, J. Mol. Biol. 234:779-815 (1993)). Some motifs identified in the sequence analyses of the PAAD family stand out as surface features that may be responsible for biological activity of these domains. A notable feature is the conserved Lys-Phe-Lys motif, that according to this model, is found on the protein surface, in helix 2. Positively charged residues from this motif, together with other charged residues from another, less conserved motif in helix 5, form a positively charged surface of the predicted protein that may be important for inter-molecule interaction. These residues are shown in the ball-and-stick representation.

[0024] FIG. 5 shows a luciferase reporter assay in which NFκB transcription activity was determined in cells transfected with NIK, IKKα or IKKβ and either an empty vector or the indicated amounts of a vector expressing PAN2.

[0025] FIG. 6 shows a protein interaction assay in which vectors expressing Myc-tagged PAN2, or Myc-tagged domains of PAN2 as indicated, and either Flag-tagged IkBα or Flag-tagged empty vector, were co-transfected into 293T cells. The lysates were immunoprecipitated with an anti-Flag antibody and blotted with either an anti-Myc or an anti-Flag antibody.

[0026] FIG. 7 shows a luciferase reporter assay in which NFκB transcriptional activity was determined in cells transfected with Bcl10 (A), contacted with TNFα (B), contacted with IL-1β (C), or transfected with Bcl10, Nod1 or Cardiak (D), and further transfected with either an empty vector (CNTR), or vectors expressing ASC, domains therefrom, or ASC2, as indicated.

[0027] FIG. 8 shows an immunoblot in which the expression of TRAF1 and TRAF2 was examined in cells transfected with the indicated expression vectors and either stimulated with TNF or unstimulated. The expression of Tubulin was determined as a control.

[0028] FIG. 9 shows the amount of interleukin-1β secreted from 293N or Cos-7 cells transfected with the indicated expression vectors.

[0029] FIG. 10 shows caspase activity, indicated by the cleavage of the fluorogenic substrate Ac-DEVD-AFC over time in cells transfected with the indicated expression vectors. c/a indicates that the caspase is an active site mutant.

[0030] FIG. 11 shows an alignment of the PAAD, NACHT and ARED domains of the indicated proteins (SEQ ID NOS:85-102), and intervening variable sequences. Residues shown in white on a black background are conserved in at least 90% of the proteins; residues boxed in pale grey are conserved in at least 70% of the proteins; residues boxed in dark grey are conserved in at least 50% of the proteins. The PAAD domain, NACHT domain and ARED domain boundaries are shown by overlining.

[0031] FIG. 12 shows the PAN3 nucleotide sequence designated SEQ ID NO:65, and the PAN3 amino acid sequence designated SEQ ID NO:66.

[0032] FIG. 13 shows the PANG nucleotide sequence designated SEQ ID NO:67, and the PANG amino acid sequence designated SEQ ID NO:68.

[0033] FIG. 14 shows the PAN7 nucleotide sequence designated SEQ ID NO:69, and the PAN7 amino acid sequence designated SEQ ID NO:70.

[0034] FIG. 15 shows the PAN8 nucleotide sequence designated SEQ ID NO:71, and the PAN8 amino acid sequence designated SEQ ID NO:72.

[0035] FIG. 16 shows the PAN9 nucleotide sequence designated SEQ ID NO:73, and the PAN9 amino acid sequence designated SEQ ID NO:74.

[0036] FIG. 17 shows the PAN10 nucleotide sequence designated SEQ ID NO:75, and the PAN10 amino acid sequence designated SEQ ID NO:76.

[0037] FIG. 18 shows the PAN5 nucleotide sequence designated SEQ ID NO:83, and the PAN5 amino acid sequence designated SEQ ID NO:84.

DETAILED DESCRIPTION OF THE INVENTION

[0038] In accordance with the present invention, there are provided PAAD domain-containing polypeptides and functional fragments thereof, encoding nucleic acid molecules, and related compositions and methods. The "PAAD domain" is an 80-100 residue domain named after the protein families in which it was first identified: pyrin, AIM (Absent-in-melanoma), ASC (apoptosis-associated speck-like protein containing a caspase recruitment domain), and death domain (DD)-like. The terms "PAAD" and "PACS" (for identified in Pyrin, AIM, Caspase, and Speck-like protein) are synonymous.

[0039] Secondary structural predictions identify the PAAD domain as mostly helical (see FIG. 1). The PAAD domain has the predicted tertiary structure shown in FIG. 4, identifying PAAD as a member of the Death Domain Fold (DDF) family, whose members include Death Domain (DD), Death Effector Domain (DED) and Caspase Recruitment Domain (CARD) proteins. Structural properties of the PAAD domain, which is also known as PYRIN or DAPIN, are described, for example, in Pawlowski et al., Trends Biochem. Sci. 26:85-87 (2001); Bertin et al., Cell Death Differ. 7:1273-1274 (2000); Fairbrother et al., Protein Sci. 10:1911-1918 (2001); Martinon et al., Curr. Biol. 11:R118-120 (2001); and Staub et al., Trends Biochem. Sci. 26:83-85 (2001).

[0040] PAAD domains have been identified at the N-terminus of several different proteins involved in apoptosis, cancer, inflammation and immune responses, as described herein (see FIG. 1). The founding member of the PAAD domain family, Pyrin, is mutated in families with Familial Mediterranean Fever (FMF), a hereditary hyper-inflammatory response syndrome. Mutant alleles of a gene encoding another PAAD family protein, Cryopyrin, have been associated with familial cold auto-inflammatory syndrome and Muckle-Wells syndrome.

[0041] Protein-protein interactions influence the activity of various proteins involved in apoptosis and immune response. Several protein interaction domains have been implicated in interactions among these proteins. The PAAD domain has been identified at the N-terminus of the recently identified caspase-homologous gene from zebrafish (Inohara et al., Cell Death Differ, 7:509-510 (2000)), suggesting the involvement of the PAAD domain in apoptosis. In this protein, the PAAD domain occupies a position corresponding to the prodomain, which in other caspase genes is occupied by a CARD (caspase recruitment domain) or a DED (death effector domain) domain. Thus, it is contemplated herein that the PAAD domain functions as a death domain in apoptosis. Accordingly, methods are provided herein for identifying PAAD domain binding agents that modulate apoptotic activity.

[0042] As disclosed herein, PAAD domain-containing polypeptides bind proteins through their PAAD domains, including other PAAD domain-containing polypeptides, IKAP, Nod1, Cardiak, NIK, IKK-i, IKKα and IKKβ.

[0043] Accordingly, methods are provided herein for identifying PAAD domain-associating proteins, and for identifying compounds that disrupt the interaction between the PAAD domain and PAAD domain-associating proteins.

[0044] As disclosed herein, expression of the PAAD domain of PAAD domain-containing polypeptides is able to specifically modulate the induction of NFκB activity by various stimuli. NFκB is the collective name for inducible dimeric transcription factors composed of members of the Rel family of DNA-binding proteins that recognize a common sequence motif. NFκB is sequestered in the cytoplasm of resting cells through its association with an inhibitory protein called IκB. When stimulated by a variety of extracellular modulators, including the proinflammatory cytokines TNFα and IL-1, T- and B-cell mitogens, bacteria, bacterial lipopolysaccharide (LPS), viruses, viral proteins, double stranded RNA, and physical and chemical stresses, a cascade of adaptor proteins and protein kinases is activated, leading to phosphorylation of IκB by the IκB kinases α and β (IKKα/β). IκB phosphorylation leads to its ubiquitination, which targets the protein for rapid degradation by the 26S proteasome. The degradation of IκB exposes the nuclear localization signal (NLS) of NFκB, resulting in NFκB translocation to the nucleus and activation.

[0045] Active NFκB regulates the transcription of a large number of genes, including those involved in immune and inflammatory responses such as immunoreceptors, cell adhesion molecules, cytokines and chemokines. NFκB also plays an important role in the antiviral response through interferon gene induction. Through adaptation, many viruses that do not cause interferon induction exploit NFκB to activate their own genes and to stimulate the survival and proliferation of lymphoid cells in which they replicate.

[0046] NFκB can have either positive and negative effects on cellular apoptosis depending on the cell type, apoptotic stimulus, and timing of NFκB activation. NFκB regulates the transcription of a variety of genes involved in blocking apoptosis, including cellular inhibitor of apopotosis (cIAP)-1, cIAP-2, TRAF1, TRAF2, superoxide dismutase (SOD), A20, and the Bcl-2 homolog Bfl-1/A1.

[0047] Inappropriate regulation of NFκB is involved in a wide range of human disorders, including cancers, neurodegenerative disorders, ataxia-telangiectasia, arthritis, asthma, inflammatory bowel disease and numerous other inflammatory conditions (see Karin et al., Ann. Rev. Immunol. 18:621-663 (2000), and references therein). Activation of NFκB also correlates with resistance to apoptosis induced by cancer therapeutic agents.

[0048] As disclosed herein, gene-transfer-mediated increases in the level of PAAD domain-containing proteins such as PAN2 and ASC can suppress NFκB transcriptional activity and NFκB DNA-binding activity in response to TNFα and IL-1β, implicating PAAD domain-containing proteins at the point of convergence of these cytokine signal transduction pathways. PAAD domain-containing proteins can also suppress NFκB induction resulting from over-expression of several adapter proteins and protein kinases involved in the TNFα and IL-1β receptor signal transduction pathway, and suppress the cytokine-mediated activation of IKKα and IKKβ. PAAD domain-containing proteins also can associate with IKKα, indicating a direct effect on the IKK complex.

[0049] The PANs of the invention are contemplated to function in a negative feedback mechanism that ensures that NFκB activity is produced in short bursts that limit inflammatory responses. The hereditary mutations associated with the PAN family proteins Cryopyrin and the PAAD-containing protein Pyrin may alter the functions of these proteins so that they are no longer capable of properly suppressing NFκB, thereby explaining the hyperinflammatory syndromes associated with mutations in the genes encoding these proteins. Likewise, mutations in genes encoding PANs of the invention, or altered regulation of such PANs, may be associated with inflammatory syndromes.

[0050] Under certain circumstances, it is contemplated that PANs function as stimulators rather than inhibitors of NFκB. Homotypic interactions between PAAD domains of suppressors and activators can thus set thresholds within cells for NFκB induction and inflammatory responses.

[0051] Accordingly, methods are provided herein to identify agents that modulate, either positively or negatively, the PAAD domain-mediated modulation of NFκB activation. Such agents can thus be used to regulate inflammatory responses, immune responses (including autoimmune responses), apoptosis, and other processes mediated at least in part by NFκB activity.

[0052] Further, PAAD domain-containing polypeptides are contemplated herein as influencing a variety of cellular and biochemical processes beyond apoptosis, including cell adhesion, inflammation and cytokine receptor signaling, and responses to viruses and infectious agents.

[0053] Exemplary invention PAAD domain-containing polypeptides include a family of proteins that in addition to a PAAD domain, contain a domain similar to the recently identified NB-ARC NTP-ase family (Koonin et al., Trends Biochem Sci, 25:223-224 (2000)) (see FIG. 3), as well as ARED domains and variable numbers of Leucine-Rich Repeat (LRR) domains. The NB-ARC, or "NACHT" domain has been implicated in nucleotide binding, oligomerization, and nucleotide (e.g. ATP and/or GTP) hydrolysis. This family of proteins is referred to herein as PAAD and Nucleotide-binding ("PAN") proteins. The topological organisation of domains in PANs is reminiscent of proteins previously implicated in NF-κB induction or Caspase activation, such as Nod1 (CARD4), Nod2 (Inflammatory bowel disease protein 1), and CLAN (Ipaf1; CARD12), which contain a CARD followed by NACHT and LRR domains (Inohara et al., J. Biol. Chem. 274:14560-14567 (1999); Ogura et al., J. Biol. Chem. 276:4812-4818 (2001); and Damiano et al., Genomics 75:77-83 (2001)). In those proteins, the N-terminal CARD is essential for the effector functions of these proteins as inducers of NF-κB or activators of Caspases. As disclosed herein, the PAAD domain of invention PAN proteins also modulates NF-κB induction.

[0054] The amino acid sequence of the PAAD domains of PAN1 through PANG are set forth in FIG. 1 and as SEQ ID NOS:1-6, respectively. Alternatively, the PAAD domains of PAN2-6 can have the boundaries set forth by overlining in FIG. 11, corresponding to SEQ ID NO:103 (PAAD domain of PAN2), SEQ ID NO:106 (PAAD domain of PAN3), SEQ ID NO:109 (PAAD domain of PAN4), SEQ ID NO:112 (PAAD domain of PAN5) and SEQ ID NO:115 (PAAD domain of PAN6).

[0055] The sequences of PAN2-6 cDNAs and encoded polypeptides are set forth as follows: PAN2: SEQ ID NOS:15 and 16; PAN3: SEQ ID NOS:17 and 18; PAN4: SEQ ID NOS:19 and 20; PANS: SEQ ID NOS:21 and 22; PANG: SEQ ID NOS:23 and 24.

[0056] Alternatively, PAN3-6 cDNAs and encoded polypeptides can have sequences set forth in FIG. 12 (PAN 3; SEQ ID NOS:65 and 66), FIG. 18 (PAN 5; SEQ ID NOS:83 and 84) and FIG. 13 (PAN 6; SEQ ID NOS:67 and 68).

[0057] Other invention PAAD domain-containing polypeptides are designated PAN7, PAN8, PAN9 and PAN10. The amino acid sequence of the PAAD domains of PAN7, PAN8, PAN9 and PAN10 are shown by overlining in FIG. 11, corresponding to SEQ ID NO:118 (PAAD domain of PAN7), SEQ ID NO:121 (PAAD domain of PAN8), SEQ ID NO:124 (PAAD domain of PAN9) and SEQ ID NO:127 (PAAD domain of PAN10).

[0058] The cDNA and encoded polypeptide sequences of PAN7, PAN8, PAN9 and PAN10 are set forth in FIG. 14 (PAN7; SEQ ID NOS:69 and 70), FIG. 15 (PAN8; SEQ ID NOS:71 and 72), FIG. 16 (PANS; SEQ ID NOS:73 and 74) and FIG. 17 (PAN10; SEQ ID NOS:75 and 76).

[0059] Other PAAD domain-containing polypeptides include pyrin2 and human ASC2, whose PAAD domain sequences are set forth in FIG. 1 and as SEQ ID NOS:8 and 10, respectively, and the proteins aligned in FIG. 11 designated FLJ20510_human (SEQ ID NO:85), PANunk_mouse (SEQ ID NO:88), NALP3/cryopyrin (SEQ. ID NO:89), NALP1/NAC (SEQ ID NO:92), PAN5_mouse (SEQ ID NO:93), PAN4_CT (SEQ ID NO:6) and PAN2_mouse (SEQ ID NO:97). The sequences of pyrin2 cDNA and encoded polypeptide are set forth as SEQ ID NOS:25 and 26. A 719 residue open reading frame from chromosome 1, which is identical over the N-terminal 41 amino acids with SEQ ID NO:26, has been identified and deposited as gi:14731966 (SEQ ID NOS:58 and 59). Accordingly, a PAAD domain-containing polypeptide can contain the first 41 amino acids of SEQ ID NO:26, and can optionally further comprise the amino acid sequence designated SEQ ID NO:59.

[0060] The sequences of ASC2 cDNA and encoded polypeptide are set forth as SEQ ID NOS:27 and 28. ASC2 is an 89-residue protein containing only the PAAD domain.

[0061] The PAAD domain has also been identified in the N-terminal part of "Absent in Melanoma-2" (AIM2) and several closely homologous human and murine proteins, such as interferon-inducible genes IFI16 and MNDA (DeYoung et al., Oncogene, 15:453-457 (1997) (see FIG. 1; SEQ ID NOS:12 and 13). Proteins from this family were characterized as containing one or more copies of a conserved 200-residue domain, implicated in transcription repression (Johnstone et al., J Biol Chem. 273:17172-17177 (1998). The N-terminal part of AIM2 and related homologous proteins, containing the invention PAAD domain was not functionally analyzed, with two exceptions. In MNDA protein, it was shown that the N-terminal domain is partly responsible for homodimerization (Xie et al., FEBS Lett. 408:151-155 (1997). In IFI16, DNA-binding was attributed to a 159-residue long N-terminal segment (Dawson et al. Biochem Biophys Res Commun, 214:152-162 (1995)). There are also two viral proteins homologous to the interferon-inducible MNDA/IFI16 family, (M013L from myxoma virus and gp013L from rabbit fibroma virus), that contain an invention PAAD domain. The PAAD domain of M013L is shown in FIG. 1 (SEQ ID NO:14).

[0062] A PAAD domain has also been identified in the N-terminus of the ASC protein (apoptosis-associated speck-like protein containing a CARD) (Masumoto et al., J Biol Chem, 274:33835-33838 (1999)) (see FIG. 1; SEQ ID NO:9). The ASC protein was identified by characteristic dot-like aggregates (specks) which were present in cells during apoptosis triggered by retinolic acid and other anti-cancer drugs (Masumoto et al., supra (1999)). The C-terminal half of the speck protein contains an easily recognizable CARD domain, while the N-terminal half has now been found to be occupied by an invention PAAD domain.

[0063] One of the PAAD domain-containing polypeptides, PAN6 (SEQ ID NO:24), allowed an independent and unambigous connection between the pyrin/ASC/caspase and the AIM2/IFI16 branches of the family. Three iterations of a standard PSI-BLAST search against the NCBI nr database starting from this putative domain pulled out, among others, pyrin and AIM2, with E-values of 1e-23 and 1e-18, respectively.

[0064] The average sequence similarity between different branches of the PAAD domain protein family is approximately 25% of sequence identity (see FIG. 1). However, clear amino acid regions of strong sequence similarity are conserved throughout the PAAD domain family of proteins, as shown in FIG. 11.

[0065] Accordingly, in one embodiment, invention PAAD domains comprise the following amino acid consensus sequence motif -KFKX₁X₂L- (SEQ ID NO:29), where X₁ and X₂ can be any amino acid. Preferably, X₁ is selected from amino acids F, M, L, Y, E, H, Q and S, and X₂ is preferably selected from amino acids K, H, L, Y and F. This motif has been found to be present in the N-terminal half of the majority of invention PAAD domains (see, e.g., FIG. 1).

[0066] In another embodiment, invention PAAD domains are also contemplated herein comprising the following amino acid consensus sequence motif -KLKX₁X₂L- (SEQ ID NO:30), where X₁ and X₂ can be any amino acid. Preferably, X₁ is selected from amino acids F, M, L, Y, E, H, Q and S, and X₂ is preferably selected from amino acids K, H, L, Y and F.

[0067] In yet another embodiment, invention PAAD domains are also contemplated herein comprising the following amino acid consensus sequence motif --RFRX₁X₂L-(SEQ ID NO:31), where X₁ and X₂ can be any amino acid. Preferably, X₁ is selected from amino acids F, M, L, Y, E, H, Q and S, and X₂ is preferably selected from amino acids K, H, L, Y and F.

[0068] In yet another embodiment, invention PAAD domains are also contemplated herein comprising the following amino acid consensus sequence motif --RFKX₁X₂L-(SEQ ID NO:32), where X₁ and X₂ can be any amino acid. Preferably, X₁ is selected from amino acids F, M, L, Y, E, H, Q and 5, and X₂ is preferably selected from amino acids K, H, L, Y and F.

[0069] In yet another embodiment, invention PAAD domains are also contemplated herein comprising the following amino acid consensus sequence motif -KFRX₁X₂L-(SEQ ID NO:33), where X₁ and X₂ can be any amino acid. Preferably, X₁ is selected from amino acids F, M, L, Y, E, H, Q and S, and X₂ is preferably selected from amino acids K, H, L, Y and F.

[0070] In still another embodiment, invention PAAD domains are also contemplated herein comprising the following amino acid consensus sequence motif -KFKX₁X₂I- (SEQ ID NO:34), where X₁ and X₂ can be any amino acid. Preferably, X₁ is selected from amino acids F, M, L, Y, E, H, Q and S, and X₂ is preferably selected from amino acids K, H, L, Y and F.

[0071] Accordingly, there are provided PAAD domain-containing polypeptides comprising an amino acid consensus sequence selected from the group consisting of:

TABLE-US-00001 -KFKX₁X₂L-; (SEQ ID NO: 29) -KLKX₁X₂L-; (SEQ ID NO: 30) -RFRX₁X₂L-; (SEQ ID NO: 31) -RFKX₁X₂L-; (SEQ ID NO: 32) -KFRX₁X₂L-; (SEQ ID NO: 33) and -KFKX₁X₂I-; (SEQ ID NO: 34)

where X₁ and X₂ can be any amino acid. Preferably, X₁ is selected from amino acids F, M, L, Y, E, H, Q and S, and X₂ is preferably selected from amino acids K, H, L, Y and F.

[0072] PAAD domains can be present in an invention polypeptide fragment or chimeric protein in conjunction with other types of functional domains, thus providing a mechanism for bringing one or more functional domains into close proximity or contact with a target protein via PAAD:PAAD associations involving two PAAD-containing polypeptides. For example, the PAAD domains of invention PAN proteins (e.g., PAN1 through PAN6, PAN7, PAN8, PAN9 and PAN10) allows invention PAN proteins to self-associate forming homo- or hetero-oligimers, thereby forming an oligomeric complex which brings proteins associated with PAN proteins into close proximity to each other. Because some PAAD domain-containing proteins also contain a CARD domain, exemplary proteins that are contemplated for association with invention PAN proteins are pro-caspases. Because most pro-caspases possess at least a small amount of protease activity even in their unprocessed form, the assembly of a complex that brings the proforms of caspase into juxtaposition can result in trans-processing of zymogens, producing the proteolytically processed and active caspase. Thus, invention PAN proteins can employ a PAAD domain for self-oligomerization and a CARD domain for binding a pro-caspase, resulting in caspase clustering, proteolytic processing and activation. In addition to the ability to activate caspases, PAAD domains are contemplated herein as being able to inhibit caspases.

[0073] In addition to their role in regulation of cell death and cell proliferation, PAAD domains can regulate other cellular processes. A PAAD domain-containing polypeptide can, for example, induce activation of the transcription factor NF-kB. Though caspase activation resulting from PAAD domain interactions can be involved in inducing apoptosis, other caspases can be primarily involved in proteolytic processing and activation of inflammatory cytokines (such as pro-IL-1β and pro-IL-18). Thus, PAAD domain-containing polypeptides can also be involved in cytokine receptor signaling, cytokine production and cJun N-terminal kinase activation, and, therefore, can be involved in regulation of immune and inflammatory responses.

[0074] In view of the function of the PAAD domain within the invention PAAD domain-containing polypeptides or functional fragments thereof, polypeptides of the invention are contemplated herein for use in methods to alter cellular and biochemical processes such as apoptosis, NF-κB induction, cytokine processing, cytokine receptor signaling, caspase-mediated proteolysis, or cJun N-terminal kinase activation, thus having modulating effects on cell life and death (i.e., apoptosis), inflammation, cell adhesion, or other cellular or biochemical processes.

[0075] Invention PAAD domain-containing polypeptides or functional fragments thereof are also contemplated in methods to identify PAAD domain binding agents and PAAD-associated polypeptides (PAPs) that alter apoptosis, NF-kB induction, cytokine processing, cytokine receptor signaling, caspase-mediated proteolysis, or cJun N-terminal kinase activation, thus having modulating effects on cell life and death (i.e., apoptosis), inflammation, cell adhesion, or other cellular or biochemical processes.

[0076] It is also contemplated herein that invention PAAD domain-containing polypeptides can associate with other PAAD domain-containing polypeptides to form invention hetero-oligomers or homo-oligomers, such as heterodimers or homodimers. In particular, the association of the PAAD domain of invention polypeptides with another PAAD domain-containing polypeptide, such as those identified herein, including homo-oligomerization, is sufficiently specific such that the bound complex can form in vivo in a cell or in vitro under suitable conditions. Similarly therefore, an invention PAAD domain-containing polypeptide can associate with another PAAD domain-containing polypeptide by PAAD:PAAD interaction to form invention hetero-oligomers or homo-oligomers, such as heterodimers or homodimers.

[0077] In addition to PAAD domains, an invention PAAD domain-containing polypeptide can contain a variety of additional domains including a CARD domain, a NACHT domain, a LRR domain, an ARED (ANGIO-R) domain, a caspase protease domain, or other recognized domains (see FIG. 3 and FIG. 11). Accordingly, PAAD domain-containing polypeptides can exhibit one or more of the biological activities characteristic of known CARD domain-, NACHT domain-, LRR domain-, ARED (ANGIO-R) domain or caspase domain-containing polypeptides.

[0078] A PAAD domain-containing polypeptide that contains a caspase recruitment domain, or CARD domain (e.g. ASC; FIG. 3), can associate with pro-caspases, caspases or with caspase-associated proteins, thereby altering caspase proteolytic activity.

[0079] A PAAD domain-containing polypeptide that contains a caspase protease domain (e.g. zebrafish caspase; FIG. 3) can hydrolyze amide bonds, particularly the amide bond of a peptide or polypeptide backbone. Typically, a caspase protease domain contains a P20/P10 domain in the active site region of the caspase protease domain. Thus, a caspase protease domain has proteolytic activity.

[0080] Caspase proteolytic activity is associated with apoptosis of cells, and additionally with cytokine production. As used herein a "caspase" is any member of the cysteine aspartyl proteases. A "pro-caspase" is an inactive or less-active precursor form of a caspase, which is typically converted to the more active caspase form by a proteolytic event, often a preceded by a protein:protein interaction, such as an interaction with a PAAD domain-containing polypeptide.

[0081] A PAAD domain-containing polypeptide that contains a NACHT domain (such as a PAN, or NAC; FIG. 3) can associate with other polypeptides, particularly with polypeptides comprising NACHT domains. Thus, a NACHT domain of an invention PAN associates with NACHT domain-containing polypeptides by way of NACHT:NACHT association. Further, a NACHT domain demonstrates both nucleotide-binding (e.g., ATP-binding) and hydrolytic activities, which is typically required for its ability to associate with NACHT domain-containing polypeptides. Thus, a NACHT domain of an invention PAN protein comprises one or more nucleotide binding sites. As used herein, a nucleotide binding site is a portion of a polypeptide that specifically binds a nucleotide such as, e.g., ADP, ATP, and the like. Typically, the nucleotide binding site of NACHT will comprise a P-loop, a kinase 2 motif, or a kinase 3a motif of the invention PAAD domain-containing polypeptide (these motifs are defined, for example, in van der Biezen and Jones, Curr. Biol. 8:R226-R227 (1998)). Preferably, the nucleotide binding site of the NACHT of an invention PAN protein comprises a P-loop. The NACHT domain of the an invention PAN, therefore, is capable of associating with other NACHT domains in homo- or hetero-oligormerization. Additionally, the NACHT domain is characterized by nucleotide hydrolysis activity, which can influence the ability of a NACHT domain to associate with another NACHT domain. In accordance with the present invention, functional fragments of PAN proteins comprising NACHT domains are provided.

[0082] The amino acid sequences of NB-ARC (NACHT) domains of PAN2, 3, 5 and 6 are set forth as follows: PAN2, SEQ ID NO:37, corresponding to amino acids 147-465 of SEQ ID NO:16; PAN3, SEQ ID NO:60, corresponding to amino acids 196-512 of SEQ ID NO:18; PAN5, SEQ ID NO:62, corresponding to amino acids 93-273 of SEQ ID NO:22; and PAN6, SEQ ID NO:63, corresponding to amino acids 183-372 of SEQ ID NO:24. Alternatively, the NACHT domains of PAN2, 3, 5 and 6 can have the boundaries shown in FIG. 11, corresponding to SEQ ID NO:104 (NACHT domain of PAN2), SEQ ID NO:107 (NACHT domain of PAN3), SEQ ID NO:113 (NACHT domain of PANS) and SEQ ID NO:116 (NACHT domain of PAN6).

[0083] The amino acid sequences of the NACHT domains of PAN4, PAN7, PAN8, PAN9 and PAN10 are shown in FIG. 11, and correspond to SEQ ID NO:110 (NACHT domain of PAN4), SEQ ID NO:119 (NACHT domain of PANT), SEQ ID NO:122 (NACHT domain of PAN8), SEQ ID NO:125 (NACHT domain of PAN9) and SEQ ID NO:128 (NACHT domain of PAN10).

[0084] The skilled person can readily determine the NACHT domain amino acid sequences from other invention PAN polypeptides.

[0085] Interestingly, several residues within highly conserved regions of the NACHT domain of PAN10 differ with respect to other NACHT domain-containing proteins. For example, as shown in FIG. 11, the P loop at the N-terminus of the NACHT domain (positions 338 to 351 of the aligned sequences; also called the "kinase 1a motif" in van der Biezen et al., supra (1998)) contains a substitution of an Ala (A) for a completely conserved Gly (G).

[0086] An invention PAAD domain-containing polypeptide, such as a PAN, therefore, is capable of PAAD:PAAD association and/or NACHT:NACHT association, resulting in a multifunctional polypeptide capable of one or more specific associations with other polypeptides.

[0087] As used herein, the term "associate" or "association" refers to binding that is sufficiently specific such that a bound complex can form in vivo in a cell or in vitro under suitable conditions.

[0088] A PAAD domain-containing polypeptide can also contain a Leucine-Rich Repeat (LRR) domain (e.g. PAN2, PAN3, PAN6, NAC; see FIG. 3). Leucine-rich repeats (LRRs) are 22-28 amino acid-long leucine rich sequence motifs found in cytoplasmic, membrane and extracellular proteins, including the mammalian Ced4 proteins Nod1 (Inohara et al., J. Biol. Chem. 274:14560-14567 (1999)) and DEFCAP, Hlaing et al., J. Biol. Chem. 276:9230-9238 (2001), NAC (Chu et al., J. Biol. Chem. 276:9239-9245 (2001), and Toll-like receptors (Takeuchi et al., Gene 231:59-65 (1999)). The biological activities of LRR domains can include, for example, protein-protein interactions that regulate signal transduction and cell adhesion; assisting in formation of large, multiprotein complexes; and binding molecules produced by pathogens (e.g. lipids, RNA, proteins, DNA). For example, other LRR-containing proteins are known to bind bacterial lipopolysaccharide (e.g. TLR4 and Nod1/2), CpG DNA (e.g. TLR9), the bacterial protein flagellin (e.g. TLR5), and steroids (e.g. plant LRRs) (see, for example, Fumitaka et al., Nature 410:1099-1103 (2001); Aderem et al., Nature 406:782-787 (2000); and Beutler, Immunity 15; 5-14 (2001)). One model for how LRR-domain-containing proteins become activated is that the unliganded LRRs function as negative regulatory domains that suppress activitation of the NB-domains until appropriate stimulatory ligands bind, relieving this auto-repression. Thus, the LRRs of the invention PANs are contemplated to recognize pathogen products, changing the activation state of these proteins. In accordance with the present invention, functional fragments of PAN proteins comprising LRR domains are provided.

[0089] The amino acid sequences of the LRR domains of PAN2, 3 and 6 are set forth as follows: PAN2, SEQ ID NO:39, corresponding to amino acids 620-995 of SEQ ID NO:16; PAN3, SEQ ID NO:61, corresponding to amino acids 658 through the C-terminus of SEQ ID NO:18; and PANG, SEQ ID NO:64, corresponding to amino acids 429-1031 of SEQ ID NO:24. The skilled person can readily determine the LRR domain amino acid sequences from other invention PAN polypeptides.

[0090] A PAAD domain-containing polypeptide can also contain an "ANGIO-R" or "ARED" domain. An ANGIO-R (ARED) domain is a region of a polypeptide chain that bears substantial similarity (e.g. 25, 30, 40% or higher sequence identity) to a portion of the 514-residue long protein "angiotensin II/vasopressin receptor" (described in Ruiz-Opazo et al., Nature Med. 1:1074-1081 (1995)). In an invention PAN, generally a single exon encodes both the NACHT domain and the ARED domain.

[0091] The amino acid sequence of the ANGIO-R (ARED) domain of PAN2 is set forth as SEQ ID NO:38, corresponding to amino acids 336-605 of SEQ ID NO:16. Alternatively, the ARED domain of PAN2 can have the boundaries set forth by overlining in FIG. 11, corresponding to SEQ ID NO:105.

[0092] The amino acid sequences of the ARED domains of PAN3-6 and PAN7-10 are shown by overlining in FIG. 11, corresponding to SEQ ID NO:108 (ARED domain of PAN3), SEQ ID NO:111 (ARED domain of PAN4), SEQ ID NO:114 (ARED domain of PANS), SEQ ID NO:117 (ARED domain of PAN6), SEQ ID NO:120 (ARED domain of PAN7), SEQ ID NO:123 (ARED domain of PAN8), SEQ ID NO:126 (ARED domain of PANS) and SEQ ID NO:129 (ARED domain of PAN10).

[0093] An invention PAAD domain-containing polypeptide can alter cell processes such as apoptosis. For example, it is contemplated herein that an invention PAAD domain-containing polypeptide can increase apoptosis in a cell. It is also contemplated herein that an invention PAAD domain-containing polypeptide can decrease the level of apoptosis in a cell. For example, a PAAD domain-containing polypeptide which does not induce apoptosis may form hetero-oligomers with a PAAD domain-containing polypeptide which is apoptotic, thus interfering with its apoptosis-inducing activity.

[0094] In one embodiment, the invention provides PAAD domain-containing polypeptides comprising substantially the same, or the same, amino acid sequence as set forth in any of SEQ ID NOS:16, 18, 20, 22, 24, 26 and 28, and fragments therefrom, including PAAD, NB-ARC (NACHT) and LRR domain-containing fragments.

[0095] The invention also provides PAAD domain-containing polypeptides comprising substantially the same, or the same, amino acid sequence as set forth in any of SEQ ID NOS:66, 68, 70, 72, 74, 76 and 84, and fragments therefrom, including PAAD, NACHT and ARED domain-containing fragments.

[0096] As employed herein, the term "substantially the same amino acid sequence" refers to amino acid sequences having at least about 70% or 75% identity with respect to the reference amino acid sequence and retaining comparable functional and biological activity characteristic of the polypeptide defined by the reference amino acid sequence. Preferably, polypeptides having "substantially the same amino acid sequence" will have at least about 80%, 82%, 84%, 86% or 88%, more preferably 90%, 91%, 92%, 93% or 94% amino acid identity with respect to the reference amino acid sequence; with greater than about 95%, 96%, 97%, 98% or 99% amino acid sequence identity being especially preferred. It is recognized, however, that polypeptides containing less than the described levels of sequence identity arising as splice variants or that are modified by conservative amino acid substitutions, or by substitution of degenerate codons are also encompassed within the scope of the present invention.

[0097] The term "biologically active" or "functional", when used herein as a modifier of invention PAAD domain-containing polypeptide, functional fragments thereof, or chimeric proteins, refers to a polypeptide that exhibits functional characteristics similar to at least a portion of a naturally occurring PAAD domain-containing protein. Biological activities of a naturally occurring PAAD domain-containing protein include, for example, the ability to bind, preferably in vivo, to a nucleotide, to a PAAD domain-containing polypeptide, to a CARD-containing polypeptide, to a NB-ARC (NACHT)-containing polypeptide, to a LRR-containing polypeptide or to homo-oligomerize, or to alter protease activation, particularly caspase activation, or to catalyze reactions such as proteolysis or nucleotide hydrolysis, or to alter NF-kB activity, or to alter cJun N-terminal kinase activity, or to alter apoptosis, cytokine processing, cytokine receptor signaling, inflammation, immune response, or other biological activities described herein. Another biological activity of a PAAD domain-containing polypeptide is the ability to act as an immunogen for the production of polyclonal and monoclonal antibodies that bind specifically to an invention PAAD domain-containing polypeptide.

[0098] A further biological activity of a PAAD domain-containing polypeptide is the ability to modulate the NFκB transcriptional activity induced by a variety of stimuli, including activators of the TNFα and IL-1β signaling pathways (see Examples). The PAAD domain is sufficient for this activity.

[0099] The ability of a PAAD domain-containing polypeptide to bind another polypeptide such as a PAAD-associated polypeptide can be assayed using in vitro or in vivo methods. For example, methods well known in the art such as yeast two-hybrid assays, co-immunoprecipitation, GST fusion co-purification, GST pull-down assays, and other methods provided in standard technique manuals such as Sambrook et al., Molecular Cloning: A Laboratory Manual, 2nd ed., Cold Spring Harbor Press, Plainview, N.Y. (1989) and, Ausubel et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York (2000) can be used.

[0100] As used herein, the term "substantially purified" means a polypeptide that is in a form that is relatively free from contaminating lipids, polypeptides, nucleic acids or other cellular material normally associated with the polypeptide. A substantially purified PAAD domain-containing polypeptide can be obtained by a variety of methods well-known in the art, e.g., recombinant expression systems described herein, precipitation, gel filtration, ion-exchange, reverse-phase and affinity chromatography, and the like. Other well-known methods are described in Deutscher et al., "Guide to Protein Purification" Methods in Enzymology Vol. 182, (Academic Press, (1990)). The methods and conditions for biochemical purification of a polypeptide of the invention can be chosen by those skilled in the art, and purification monitored, for example, by an immunological assay, binding assay, or a functional assay.

[0101] In addition to the ability of invention PAAD domain-containing polypeptides, or functional fragments thereof, to interact with other, heterologous proteins (e.g. other PAAD domain-, LRR domain-, or NB-ARC (NACHT) domain-containing polypeptides), invention PAAD-containing polypeptides have the ability to self-associate to form invention homo-oligomers such as homodimers. This self-association is possible through interactions between PAAD domains, and also through interactions between CARD domains or NACHT domains. Further, self-association can take place as a result of interactions between LRR domains.

[0102] In accordance with the invention, there are also provided mutations of PAAD domain-containing polypeptides which have activity different than a predominant naturally occurring PAAD domain-containing polypeptide activity. As used herein, a "mutation" can be any deletion, insertion, or change of one or more amino acids within the predominant naturally occurring protein sequence (e.g., wild-type), and a "fragment" is any truncated form, either carboxy-terminal, amino-terminal, or both, of the predominant naturally occurring protein. Preferably, the different activity of the mutation or fragment is a result of the mutant polypeptide or fragment maintaining some but not all of the activities of the respective predominant naturally occurring PAAD domain-containing polypeptide.

[0103] For example, a functional fragment of an invention protein can contain one or more of the following: a PAAD domain, a NACHT domain, a LRR domain or an ANGIO-R (ARED) domain. In a specific example, a functional fragment of a PAAD domain-containing polypeptide such as a PAN can contain a PAAD domain and LRR domain, or only a PAAD domain, but lack a functional NACHT domain. Such a fragment will maintain a portion of the predominant naturally occurring PAN activity (e.g., PAAD domain functionality), but not all such activities (e.g., lacking an active NACHT domain). The resultant fragment will therefore have an activity different than the predominant naturally occurring PAN activity. In another example, a functional fragment of a PAN protein might have only the NACHT domain, allowing it to interact with other NACHT domain proteins in forming homo-oligomers or hetero-oligomers. Thus, a functional fragment of a PAAD domain-containing protein or polypeptide is not required to contain a functional PAAD domain, but only to contain a functional domain from a naturally occurring PAAD domain-containing protein. In one embodiment, the activity of the fragment will be "dominant-negative." A dominant-negative activity will allow the fragment to reduce or inactivate the activity of one or more isoforms of a predominant naturally occurring PAAD domain-containing polypeptide.

[0104] Methods to identify additional invention PAAD domain-containing polypeptides and functional fragments thereof are well known in the art and are disclosed herein. For example, genomic or cDNA libraries, including universal cDNA libraries can be probed according to methods disclosed herein or other methods known in the art. Full-length polypeptide-encoding nucleic acids such as full-length cDNAs can be obtained by a variety of methods well-known in the art. For example, 5' and 3' RACE, methodology is well known in the art and described in Ausubel et al., supra, and the like.

[0105] In another embodiment of the invention, chimeric proteins are provided comprising a PAAD domain-containing polypeptide, or a functional fragment thereof, fused with another protein or functional fragment thereof. Functional fragments of a PAAD domain-containing polypeptide include, for example, PAAD, NACHT, LRR, and ANGIO-R CARED) domains or other fragments that retain a biological activity of an invention containing polypeptide. Polypeptides with which the PAAD domain-containing polypeptide or functional fragment thereof are fused can include, for example, glutathione-S-transferase, an antibody, or other proteins or functional fragments thereof which facilitate recovery of the chimera. Further polypeptides with which a PAAD domain-containing polypeptide or functional fragment thereof are fused can include, for example, luciferase, green fluorescent protein, an antibody, or other proteins or functional fragments thereof which facilitate identification of the chimera. Still further polypeptides with which a PAAD-containing polypeptide or functional fragment thereof are fused will include, for example, the LexA DNA binding domain, ricin, α-sarcin, an antibody or fragment thereof, or other polypeptides which have therapeutic properties or other biological activity.

[0106] Further invention chimeric proteins contemplated herein are chimeric proteins wherein a functional fragment of a PAAD domain-containing polypeptide is fused with a catalytic domain or a protein interaction domain from a heterologous polypeptide. For example, chimeric proteins can contain a functional fragment of a PAAD domain-containing polypeptide of the invention fused with a domain of a protein known in the art, such as CED-4, Apaf-1, caspase-1, and the like. For example, the NACHT domain of an invention PAN can be replaced by the NACHT domain of CED-4 and the like. Another example of such a chimera is a polypeptide wherein the CARD domain of an invention PAN is replaced by the CARD domain from CED-4, and the like. In a further example, a NACHT domain can be fused with a P20/P10 domain to form a novel chimera with caspase activity. In another embodiment, a chimeric protein can be formed which contains functional domains of 2 or more PAAD domain-containing polypeptides of the invention.

[0107] As used herein, the term "polypeptide" when used in reference to a PAAD domain-containing polypeptide is intended to refer to a peptide or polypeptide of two or more amino acids. The term "polypeptide analog" includes any polypeptide having an amino acid residue sequence substantially the same as a sequence specifically described herein in which one or more residues have been conservatively substituted with a functionally similar residue and which displays the ability to functionally mimic a PAAD domain-containing polypeptide as described herein. A "modification" of an invention polypeptide also encompasses conservative substitutions of an invention polypeptide amino acid sequence. Conservative substitutions of encoded amino acids include, for example, amino acids that belong within the following groups: (1) non-polar amino acids (Gly, Ala, Val, Leu, and Ile); (2) polar neutral amino acids (Cys, Met, Ser, Thr, Asn, and Gln); (3) polar acidic amino acids (Asp and Glu); (4) polar basic amino acids (Lys, Arg and His); and (5) aromatic amino acids (Phe, Trp, Tyr, and His). Other groupings of amino acids can be found, for example in Taylor, J. Theor. Biol. 119:205-218 (1986), which is incorporated herein by reference. Other minor modifications are included within invention polypeptides so, long as the polypeptide retains some or all of its function as described herein.

[0108] The amino acid length of functional fragments or polypeptide analogs of the present invention can range from about 5 amino acids up to the full-length protein sequence of an invention PAAD domain-containing polypeptide. In certain embodiments, the amino acid lengths include, for example, at least about 10 amino acids, at least about 15, at least about 20, at least about 25, at least about 30, at least about 35, at least about 40, at least about 45, at least about 50, at least about 55, at least about 60, at least about 65, at least about 70, at least about 75, at least about 80, at least about 85, at least about 90, at least about 95, at least about 100, at least about 125, at least about 150, at least about 175, at least about 200, at least about 250 or more amino acids in length up to no more than 1 residue less than a full-length naturally occurring PAAD domain-containing protein. In a particular embodiment of the invention, PAAD domain-containing functional fragments comprise an amino acid consensus sequence selected from the group consisting of:

TABLE-US-00002 -KFKX₁X₂L-; (SEQ ID NO: 29) -KLKX₁X₂L-; (SEQ ID NO: 30) -RFRX₁X₂L-; (SEQ ID NO: 31) -RFKX₁X₂L-; (SEQ ID NO: 32) -KFRX₁X₂L-; (SEQ ID NO: 33) and -KFKX₁X₂I-; (SEQ ID NO: 34)

where X₁ and X₂ can be any amino acid. Preferably, PAAD domain-containing functional fragments comprise 15 or more contiguous amino acids selected from the group consisting of SEQ ID NOS:1-14.

[0109] A modification of a polypeptide can also include derivatives, analogues and functional mimetics thereof, provided that such polypeptide displays a PAAD domain-containing polypeptide biological activity. For example, derivatives can include chemical modifications of the polypeptide such as alkylation, acylation, carbamylation, iodination, or any modification that derivatizes the polypeptide. Such derivatized molecules include, for example, those molecules in which free amino groups have been derivatized to form amine hydrochlorides, p-toluene sulfonyl groups, carbobenzoxy groups, t-butyloxycarbonyl groups, chloroacetyl groups or formyl groups. Free carboxyl groups can be derivatized to form salts, methyl and ethyl esters or other types of esters or hydrazides. Free hydroxyl groups can be derivatized to form O-acyl or O-alkyl derivatives. The imidazole nitrogen of histidine can be derivatized to form N-im-benzylhistidine. Also included as derivatives or analogues are those peptides which contain one or more naturally occurring amino acid derivatives of the twenty standard amino acids, for example, 4-hydroxyproline, 5-hydroxylysine, 3-methylhistidine, homoserine, ornithine or carboxyglutamate, and can include amino acids that are not linked by peptide bonds. Polypeptides of the present invention also include any polypeptide having one or more additions and/or deletions of residues, relative to the sequence of a polypeptide whose sequence is shown herein, so long as PAAD domain-containing polypeptide activity is maintained.

[0110] A modification of an invention polypeptide includes functional mimetics thereof. Mimetics encompass chemicals containing chemical moieties that mimic the function of the polypeptide. For example, if a polypeptide contains two charged chemical moieties having functional activity, a mimetic places two charged chemical moieties in a spatial orientation and constrained structure so that the charged chemical function is maintained in three-dimensional space. Thus, a mimetic, which orients functional groups that provide a function of a PAAD domain-containing polypeptide, are included within the meaning of a PAAD domain-containing polypeptide derivative. All of these modifications are included within the term "polypeptide" so long as the invention polypeptide or functional fragment retains its function. Exemplary mimetics are peptidomimetics, peptoids, or other peptide-like polymers such as poly(b-amino acids), and also non-polymeric compounds upon which functional groups that mimic a peptide are positioned.

[0111] Another embodiment of the invention provides a PAAD domain-containing polypeptide, or a functional fragment thereof, fused with a moiety to form a conjugate. As used herein, a "moiety" can be a physical, chemical or biological entity which contributes functionality to a PAAD domain-containing polypeptide or a functional fragment thereof. Functionalities contributed by a moiety include therapeutic or other biological activity, or the ability to facilitate identification or recovery of a PAAD domain-containing polypeptide. Therefore, a moiety will include molecules known in the art to be useful for detection of the conjugate by, for example, by fluorescence, magnetic imaging, detection of radioactive emission. A moiety may also be useful for recovery of the conjugate, for example a His tag or other known tags used for protein isolation and/or purification, or a physical substance such as a bead. A moiety can be a therapeutic compound, for example, a cytotoxic drug which can be useful to effect a biological change in cells to which the conjugate localizes.

[0112] An example of the methods for preparing the invention polypeptide(s) is to express nucleic acids encoding a PAAD domain-containing polypeptide in a suitable host cell, such as a bacterial cell, a yeast cell, an amphibian cell such as an oocyte, or a mammalian cell, using method well known in the art, and recovering the expressed polypeptide, again using well-known purification methods. Invention polypeptides can be isolated directly from cells that have been transformed with expression vectors as known in the art. Recombinantly expressed polypeptides of the invention can also be expressed as fusion proteins with appropriate affinity tags, such as glutathione S transferase (GST) or poly His, and affinity purified. The invention polypeptide, biologically functional fragments, and functional equivalents thereof can also be produced by in vitro transcription/translation methods known in the art, such as using reticulocyte lysates, as used for example, in the TNT system (Promega). The invention polypeptide, biologically functional fragments, and functional equivalents thereof can also be produced by chemical synthesis. For example, synthetic polypeptides can be produced using Applied Biosystems, Inc. Model 430A or 431A automatic peptide synthesizer (Foster City, Calif.) employing the chemistry provided by the manufacturer.

[0113] The present invention also provides compositions containing an acceptable carrier and any of an isolated, purified PAAD domain-containing mature protein, such as an invention PAN protein, or functional polypeptide fragments thereof, alone or in combination with each other. These polypeptides or proteins can be recombinantly derived, chemically synthesized or purified from native sources. As used herein, the term "acceptable carrier" encompasses any of the standard pharmaceutical carriers, such as phosphate buffered saline solution, water and emulsions such as an oil/water or water/oil emulsion, and various types of wetting agents.

[0114] The invention thus provides a therapeutic composition comprising a pharmaceutically acceptable carrier and a compound selected from the group consisting of a PAAD domain-containing fragment polypeptide, a PAAD domain-containing chimeric protein, a PAAD domain-containing polypeptide modulating compound, and an anti-PAAD antibody. The invention additionally provides a method of treating a pathologies characterized by abnormal cell proliferation, abnormal cell death, or inflammation by administering an effective amount of the composition containing a pharmaceutically acceptable carrier and a compound selected from the group consisting of a PAAD domain-containing polypeptide, a functional fragment thereof, a PAAD domain-containing polypeptide modulating compound, and an anti-PAAD antibody.

[0115] PAAD domain-containing polypeptides can be administered to an individual to increase an activity associated with a PAAD domain-containing polypeptide, including induction of apoptosis, functioning as a tumor suppressor, modulation of inflammation or cell adhesion, and the like. For example, a PAAD domain-containing polypeptide can be administered therapeutically to an individual using expression vectors containing nucleic acids encoding PAAD domain-containing polypeptides, as described below. In addition, PAAD domain-containing polypeptides, or a functional portion thereof, can be directly administered to an individual. Methods of administering therapeutic polypeptides are well known to those skilled in the art, for example, in the form of a pharmaceutical composition.

[0116] In accordance with another embodiment of the invention, there are provided isolated nucleic acids encoding a PAAD domain-containing polypeptide fragment or chimeric protein comprising a PAAD domain-containing polypeptide. The isolated nucleic acids can be selected from: [0117] (a) DNA encoding a polypeptide containing the amino acid sequence set forth in SEQ ID NOs: 16, 18, 20, 22, 24, 26 or 28; or DNA encoding a polypeptide containing the amino acid sequence set forth in SEQ ID NOs: 66, 68, 70, 72, 74, 76 or 84; [0118] (b) DNA that hybridizes to the DNA of (a) under moderately stringent conditions, where the DNA encodes a biologically active PAAD domain-containing polypeptide.

[0119] The nucleic acid molecules described herein are useful, for producing invention polypeptides, when such nucleic acids are incorporated into a variety of protein expression systems known to those of skill in the art. In addition, such nucleic acid molecules or fragments thereof can be labeled with a readily detectable substituent and used as hybridization probes for assaying for the presence and/or amount of an invention PAAD domain encoding gene or mRNA transcript in a given sample. The nucleic acid molecules described herein, and fragments thereof, are also useful as primers and/or templates in a PCR reaction for amplifying genes encoding invention polypeptides described herein.

[0120] The term "nucleic acid" or "nucleic acid molecule" (also referred to as polynucleotides) encompasses ribonucleic acid (RNA) or deoxyribonucleic acid (DNA), probes, oligonucleotides, and primers and can be single stranded or double stranded. DNA can be either complementary DNA (cDNA) or genomic DNA, e.g. a PAAD domain encoding gene, and can represent the sense strand, the anti-sense strand, or both. Examples of nucleic acids are RNA, cDNA, or isolated genomic DNA encoding a PAAD domain-containing polypeptide. One means of isolating a PAAD domain encoding nucleic acid polypeptide is to probe a mammalian genomic or cDNA library with a natural or artificially designed DNA probe using methods well known in the art. DNA probes derived from the PAAD domain encoding gene are particularly useful for this purpose. DNA and cDNA molecules that encode PAAD domain-containing polypeptides can be used to obtain complementary genomic DNA, cDNA Or RNA from mammalian (e.g., human, mouse, rat, rabbit, pig, and the like), or other animal sources, or to isolate related cDNA or genomic clones by screening cDNA or genomic libraries, using methods described in more detail below.

[0121] In one embodiment, invention nucleic acids comprise substantially the same or the same nucleotide sequence as set forth in SEQ ID NOs:15 (PAN2), 17 (PANS), 19 (PAN4), 21 (PANS), 23 (PANG), 25 (pyrin2), or 27 (ASC2). The invention also provides nucleic acids that comprise substantially the same or the same nucleotide sequence as set forth in SEQ ID NOs:65, 67, 69, 71, 73, 75 or 83.

[0122] Thus a PAAD domain encoding nucleic acid as used herein refers to a nucleic acid encoding a polypeptide containing a PAAD domain-containing polypeptide fragment of the invention, or a PAAD domain-containing chimeric protein.

[0123] Use of the terms "isolated" and/or "purified" and/or "substantially purified" in the present specification and claims as a modifier of DNA, RNA, polypeptides or proteins means that the DNA, RNA, polypeptides or proteins so designated have been produced in such form by the hand of man, and thus are separated from their native in vivo cellular environment, and are substantially free of any other species of nucleic acid or protein. As a result of this human intervention, the recombinant DNAs, RNAs, polypeptides and proteins of the invention are useful in ways described herein that the DNAs, RNAs, polypeptides or proteins as they naturally occur are not.

[0124] Invention nucleic acids encoding PAAD domain-containing polypeptides and invention PAAD domain-containing polypeptides can be obtained from any species of organism, such as prokaryotes, eukaryotes, plants, fungi, vertebrates, invertebrates, and the like. A particular species can be mammalian, e.g., human, rat, mouse, rabbit, monkey, baboon, bovine, porcine, ovine, canine, feline, and the like. A preferred PAAD domain encoding nucleic acid herein, is human PAAD domain encoding nucleic acid.

[0125] As employed herein, the term "substantially the same nucleotide sequence" refers to DNA having sufficient identity to the reference polynucleotide, such that it will hybridize to the reference nucleotide under moderately or highly stringent hybridization conditions. In one embodiment, DNA having substantially the same nucleotide sequence as the reference nucleotide sequence encodes substantially the same amino acid sequence as that set forth in any of SEQ ID NOs:16, 18, 20, 22, 24, 26 or 28, or in SEQ ID NOs:65, 67, 69, 71, 73, 75 or 83. In another embodiment, DNA having "substantially the same nucleotide sequence" as the reference nucleotide sequence has at least 60%, or at least 65% identity with respect to the reference nucleotide sequence. DNA having at least 70%, 72%, 74%, 76%, 78%, 80%, 82%, 84%, 86% or 88%, more preferably at least 90%, 91%, 92%, 93% or 94% yet more preferably at least 95%, 96%, 97%, 98% or 99% identity to the reference nucleotide sequence is preferred.

[0126] As used herein, a "modification" of a nucleic acid can also include one or several nucleotide additions, deletions, or substitutions with respect to a reference sequence. A modification of a nucleic acid can include substitutions that do not change the encoded amino acid sequence due to the degeneracy of the genetic code. Such modifications can correspond to variations that are made deliberately, or which occur as mutations during nucleic acid replication.

[0127] Exemplary modifications of the recited nucleotide sequences include sequences that correspond to homologs of other species, including mammalian species such as mouse, primates, including monkey and baboon, rat, rabbit, bovine, porcine, ovine, canine, feline, or other animal species. The corresponding nucleotide sequences of non-human species can be determined by methods known in the art, such as by PCR or by screening genomic, cDNA or expression libraries.

[0128] Another exemplary modification of the invention PAAD domain encoding nucleic acid or PAAD domain-containing polypeptide can correspond to mutant or splice variant forms of the PAAD domain encoding nucleotide sequence. Additionally, a modification of a nucleotide sequence can include one or more non-native nucleotides, having, for example, modifications to the base, the sugar, or the phosphate portion, or having a modified phosphodiester linkage. Such modifications can be advantageous in increasing the stability of the nucleic acid molecule.

[0129] Furthermore, a modification of a nucleotide sequence can include, for example, a detectable moiety, such as a radiolabel, a fluorochrome, a ferromagnetic substance, a luminescent tag or a detectable binding agent such as biotin. Such modifications can be advantageous in applications where detection of a PAAD domain encoding nucleic acid molecule is desired.

[0130] This invention also encompasses nucleic acids which differ from the nucleic acids shown in SEQ ID NOs:15, 17, 19, 21, 23, 25 or 27, or in SEQ ID NOs:65, 67, 69, 71, 73, 75 or 83, but which have the same phenotype. Phenotypically similar nucleic acids are also referred to as "functionally equivalent nucleic acids". As used herein, the phrase "functionally equivalent nucleic acids" encompasses nucleic acids characterized by slight and non-consequential sequence variations that will function in substantially the same manner to produce the same polypeptide product(s) as the nucleic acids disclosed herein. In particular, functionally equivalent nucleic acids encode polypeptides that are the same as those encoded by the nucleic acids disclosed herein or that have conservative amino acid variations. For example, conservative variations include substitution of a non-polar residue with another non-polar residue, or substitution of a charged residue with a similarly charged residue. These variations include those recognized by skilled artisans as those that do not substantially alter the tertiary structure of the protein.

[0131] Further provided are nucleic acids encoding invention PAAD domain-containing polypeptides that, by virtue of the degeneracy of the genetic code, do not necessarily hybridize to the invention nucleic acids under specified hybridization conditions. Preferred nucleic acids encoding the invention PAAD domain-containing polypeptides are comprised of nucleotides that encode substantially the same amino acid sequence as set forth in SEQ ID NOs:16, 18, 20, 22, 24, 26 or 28, or SEQ ID NOs:65, 67, 69, 71, 73, 75 or 83.

[0132] Hybridization refers to the binding of complementary strands of nucleic acid (i.e., sense:antisense strands or probe:target-DNA) to each other through hydrogen bonds, similar to the bonds that naturally occur in chromosomal DNA. Stringency levels used to hybridize a given probe with target-DNA can be readily varied by those of skill in the art.

[0133] The phrase "stringent hybridization" is used herein to refer to conditions under which polynucleic acid hybrids are stable. As known to those of skill in the art, the stability of hybrids is reflected in the melting temperature (Tm) of the hybrids. In general, the stability of a hybrid is a function of sodium ion concentration and temperature. Typically, the hybridization reaction is performed under conditions of lower stringency, followed by washes of varying, but higher, stringency. Reference to hybridization stringency relates to such washing conditions.

[0134] As used herein, the phrase "moderately stringent hybridization" refers to conditions that permit target-nucleic acid to bind a complementary nucleic acid. The hybridized nucleic acids will generally have at least about 60% identity, at least about 75% identity, more at least about 85% identity; or at least about 90% identity. Moderately stringent conditions are conditions equivalent to hybridization in 50% formamide, 5× Denhart's solution, 5×SSPE, 0.2% SDS at 42° C., followed by washing in 0.2×SSPE, 0.2% SDS, at 42° C.

[0135] The phrase "high stringency hybridization" refers to conditions that permit hybridization of only those nucleic acid sequences that form stable hybrids in 0.018M NaCl at 65° C., for example, if a hybrid is not stable in 0.018M NaCl at 65° C., it will not be stable under high stringency conditions, as contemplated herein. High stringency conditions can be provided, for example, by hybridization in 50% formamide, 5× Denhart's solution, 5×SSPE, 0.2% SDS at 42° C., followed by washing in 0.1×SSPE, and 0.1% SDS at 65° C.

[0136] The phrase "low stringency hybridization" refers to conditions equivalent to hybridization in 10% formamide, 5× Denhart's solution, 6×SSPE, 0.2% SDS at 22° C., followed by washing in 1×SSPE, 0.2% SDS, at 37° C. Denhart's solution contains 1% Ficoll, 1% polyvinylpyrolidone, and 1% bovine serum albumin (BSA). 20×SSPE (sodium chloride, sodium phosphate, ethylene diamide tetraacetic acid (EDTA)) contains 3M sodium chloride, 0.2M sodium phosphate, and 0.025 M (EDTA). Other suitable moderate stringency and high stringency hybridization buffers and conditions are well known to those of skill in the art and are described, for example, in Sambrook et al., supra (1989); and Ausubel et al., supra (2000).

[0137] Nucleic acids encoding polypeptides hybridize under moderately stringent or high stringency conditions to substantially the entire sequence, or substantial portions, for example, typically at least 15, 17, 21, 25, 30, 40, 50 or more nucleotides of the recited nucleic acid sequences.

[0138] As used herein, the term "degenerate" refers to codons that differ in at least one nucleotide from a reference nucleic acid, but encode the same amino acids as the reference nucleic acid. For example, codons specified by the triplets "UCU", "UCC", "UCA", and "UCG" are degenerate with respect to each other since all four of these codons encode the amino acid serine.

[0139] The invention also provides a modification of a nucleotide sequence that hybridizes to a PAAD domain encoding nucleic acid molecule under moderately stringent conditions. Modifications of nucleotide sequences, where the modification has at least 60% identity to a PAAD domain encoding nucleotide sequence, are also provided. The invention also provides modification of a PAAD domain encoding nucleotide sequence having at least 65% identity, at least 70% identity, at least 72% identity, at least 74% identity, at least 76% identity, at least 78% identity, at least 80% identity, at least 82% identity, at least 84% identity, at least 86% identity, at least 88% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity or at least 99% identity to a recited sequence.

[0140] Identity of any two nucleic acid or amino acid sequences can be determined by those skilled in the art based, for example, on known computer alignments such as BLAST 2.0, ClustalW and the like, which can be adjusted manually, if appropriate, to insert gaps to optimize the alignment according to standard practice in the art.

[0141] One means of isolating a nucleic acid encoding a PAAD domain-containing polypeptide is to probe a cDNA library or genomic library with a natural or artificially designed nucleic acid probe using methods well known in the art. Nucleic acid probes derived from a PAAD domain encoding gene are particularly useful for this purpose. DNA and cDNA molecules that encode PAAD domain-containing polypeptides can be used to obtain complementary genomic DNA, cDNA or RNA from mammals, for example, human, mouse, rat, rabbit, pig, and the like, or other animal sources, or to isolate related cDNA or genomic clones by the screening of cDNA or genomic libraries, by methods well known in the art (see, for example, Sambrook et al., supra (1989); Ausubel et al., supra (2000)).

[0142] The invention additionally provides a nucleic acid that hybridizes under high stringency conditions to the PAAD domain coding portion of any of SEQ ID NOs:15, 17, 19, 21, 23, 25 or 27, or SEQ ID NOs:65, 67, 69, 71, 73, 75 or 83. The invention also provides a nucleic acid having a nucleotide sequence substantially the same as set that forth in any of SEQ ID NOs:15, 17, 19, 21, 23, 25 or 27, or SEQ ID NOs:65, 67, 69, 71, 73, 75 or 83.

[0143] The invention also provides a method for identifying nucleic acids encoding a mammalian PAAD domain-containing polypeptide by contacting a sample containing nucleic acids with one or more invention oligonucleotides, wherein the contacting is effected under high stringency hybridization conditions, and identifying a nucleic acid that hybridizes to the oligonucleotide. The invention additionally provides a method of detecting a PAAD domain encoding nucleic acid molecule in a sample by contacting the sample with two or more invention oligonucleotides, amplifying a nucleic acid molecule, and detecting the amplification. The amplification can be performed, for example, using PCR. The invention further provides oligonucleotides that function as single stranded nucleic acid primers for amplification of a PAAD domain encoding nucleic acid, wherein the primers comprise a nucleic acid sequence derived from the nucleic acid sequences set forth as SEQ ID NOS:SEQ ID NOs:15, 17, 19, 21, 23, 25 or 27, or SEQ ID NOs:65, 67, 69; 71, 73, 75 or 83.

[0144] In accordance with a further embodiment of the present invention, optionally labeled PAAD-encoding cDNAs, or fragments thereof, can be employed to probe library(ies) such as cDNA, genomic, BAC, and the like for predominant nucleic acid sequences or additional nucleic acid sequences encoding novel PAAD domain-containing polypeptides. Construction and screening of suitable mammalian cDNA libraries, including human cDNA libraries, is well-known in the art, as demonstrated, for example, in Ausubel et al., supra. Screening of such a cDNA library is initially carried out under low-stringency conditions, which comprise a temperature of less than about 42° C., a formamide concentration of less than about 50%, and a moderate to low salt concentration.

[0145] Presently preferred probe-based screening conditions comprise a temperature of about 37° C., a formamide concentration of about 20%, and a salt concentration of about 5× standard saline citrate (SSC; 20×SSC contains 3M sodium chloride, 0.3M sodium citrate, pH 7.0). Such conditions will allow the identification of sequences which have a substantial degree of similarity with the probe sequence, without requiring perfect homology. The phrase "substantial similarity" refers to sequences which share at least 50% homology. Hybridization conditions are selected which allow the identification of sequences having at least 70% homology with the probe, while discriminating against sequences which have a lower degree of homology with the probe. As a result, nucleic acids having substantially the same nucleotide sequence as SEQ ID NOs:15, 17, 19, 21, 23, 25 or 27, or SEQ ID NOs:65, 67, 69, 71, 73, 75 or 83, are obtained.

[0146] As used herein, a nucleic acid "probe" is single-stranded nucleic acid, or analog thereof, that has a sequence of nucleotides that includes at least 15, at least at least 17, at least 20, at least 22, at least 25, at least 30, at least 40, at least 50, at least 75, at least 100, at least 200, at least 300, at least 400, or at least 500 contiguous bases that are substantially the same as, or the complement of, any contiguous bases set forth in any of SEQ ID NOs:15, 17, 19, 21, 23, 25 or 27, or SEQ ID NOs:65, 67, 69, 71, 73, 75 or 83. Preferred regions from which to construct probes include 5' and/or 3' coding regions of SEQ ID NOs:15, 17, 19, 21, 23, 25 or 27. In addition, the entire cDNA encoding region of an invention PAAD domain-containing polypeptide, or an entire sequence substantially the same as SEQ ID NOs:15, 17, 19, 21, 23, 25 or 27, may be used as a probe, or SEQ ID NOs:65, 67, 69, 71, 73, 75 or 83. Probes can be labeled by methods well-known in the art, as described hereinafter, and used in various diagnostic kits.

[0147] The invention additionally provides an oligonucleotide comprising at least 15 contiguous nucleotides of SEQ ID NOs:15, 17, 19, 21, 23, 25 or 27, or SEQ ID NOs:69, 71, 73, 75, or the anti-sense strand thereof. As used herein, the term "oligonucleotide" refers to a nucleic acid molecule that includes at least 15 contiguous nucleotides from a reference nucleotide sequence, can include at least 16, 17, 18, 19, 20 21, 22, or at least 25 contiguous nucleotides, and often includes at least 30, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, 225, 250, 275, 300, 325, 350, 400, 500, 600, 700 or more contiguous nucleotides from the reference nucleotide sequence. The reference nucleotide sequence can be the sense strand or the anti-sense strand.

[0148] In some embodiments, the oligonucleotides comprise, or consist of, sequences from those portions of SEQ ID NOs:65, 67, 69, 71, 73, 75 or 83 that are not also present in SEQ ID NOs:15, 17, 19, 21, 23, 25 or 27.

[0149] The oligonucleotides of the invention that contain at least 15 contiguous nucleotides of a reference PAAD domain encoding nucleotide sequence are able to hybridize to PAAD domain encoding nucleotide sequences under moderately stringent hybridization conditions and thus can be advantageously used, for example, as probes to detect PAAD domain encoding DNA or RNA in a sample, and to detect splice variants thereof; as sequencing or PCR primers; as antisense reagents to block transcription of PAAD domain encoding RNA in cells; or in other applications known to those skilled in the art in which hybridization to a PAAD domain encoding nucleic acid molecule is desirable.

[0150] In accordance with another embodiment of the invention, a method is provided for identifying nucleic acids encoding a PAAD-containing polypeptide, comprising, contacting a sample containing nucleic acids with an invention probe or an invention oligonucleotide, wherein said contacting is effected under high stringency hybridization conditions, and identifying nucleic acids which hybridize thereto. Methods for identification of nucleic acids encoding a PAAD domain-containing polypeptide are disclosed herein.

[0151] Also provided in accordance with present invention is a method for identifying a PAAD domain encoding nucleotide sequence comprising the steps of using a PAAD domain encoding nucleotide sequence selected from SEQ ID NOS:15, 17, 19, 21, 23, 25 or 27, or SEQ ID NOs:65, 67, 69, 71, 73, 75 or 83, to identify a candidate PAAD domain encoding nucleotide sequence and verifying the candidate PAAD domain encoding nucleotide sequence by aligning the candidate sequence with known PAAD domain encoding nucleotide sequences, where a conserved PAAD domain sequence or a predicted three dimensional polypeptide structure similar to a known PAAD domain three dimensional structure confirms the candidate sequence as a PAAD domain encoding sequence. Methods for identifying PAAD-encoding sequences are provided herein (See Examples 1.0, 2.0, 3.0 and 4.0).

[0152] It is understood that a PAAD domain encoding nucleic acid molecule of the invention, as used herein, specifically excludes previously known nucleic acid molecules consisting of nucleotide sequences having exact sequence identity with the PAAD domain encoding nucleotide sequence, such as Expressed Sequence Tags (ESTs), Sequence Tagged Sites (STSs) and genomic fragments, deposited in public databases such as the nr, dbest, dbsts, gss and htgs databases, which are available for searching at http://www.ncbi.nlm.nih.gov/blast/.

[0153] In particular, invention PAAD domain encoding nucleic acid molecules, and PAAD domain-containing polypeptides, excludes the exact, specific and complete nucleic acid and/or amino acid sequences corresponding to any of the nucleotide and/or amino acid sequences having the Genbank (gb), NCBI, EMBL (emb) or DDBJ (dbj) accession numbers described below. Accession numbers specifically excluded include NCBI Accession Nos: GI 4557743, 5094556, 7019331, 7689912, 7020664, 7382417, 2335202, 7690109, 8099799, 8655944, 7662386, 5902751, 2833279, 6523868, 3483677, 10440263, 14731965, 2335202, 15488764, 202805, 9211204, 3483677, 15488878, 14779455, 14779445, 14488058, 11096298, 9802275, 9863861, 9863863, 10835255, 10801601, 7020146, 14779447, 13325315, 15215377, 11230601, 9937751, 14758026, 15193291, 13182796, 14731965, 14731967, 4757727, 3341995, 10440263, 14253110, 9153913, 1383656, 19387135, 15193292, 18448932, 17461450, 17483016, 17483018, 17483020, 17472936, 4081482, 17483013 and EST clones BE018433, AA421452 and AI204456.

[0154] Since one of skill in the art will realize that the above-recited excluded sequences may be revised at a later date, the skilled artisan will recognize that the above-recited sequences are excluded as they stand on the priority date of this application.

[0155] The isolated nucleic acid molecules of the invention can be used in a variety of diagnostic and therapeutic applications. For example, the isolated nucleic acid molecules of the invention can be used as probes, as described above; as templates for the recombinant expression of PAAD domain-containing polypeptides; or in screening assays such as two-hybrid assays to identify cellular molecules that bind PAAD domain-containing polypeptides.

[0156] Another useful method for producing a PAAD domain encoding nucleic acid molecule or fragment of the invention involves amplification of the nucleic acid molecule using PCR and invention oligonucleotides and, optionally, purification of the resulting product by gel electrophoresis. Either PCR or RT-PCR can be used to produce a nucleic acid molecule having any desired nucleotide boundaries. Desired modifications to the nucleic acid sequence can also be introduced by choosing an appropriate oligonucleotide primer with one or more additions, deletions or substitutions. Such nucleic acid molecules can be amplified exponentially starting from as little as a single gene or mRNA copy, from any cell, tissue or species of interest.

[0157] The invention thus provides methods for detecting a PAAD domain encoding nucleic acid or fragment in a sample. The methods of detecting a PAAD domain encoding nucleic acid in a sample can be either qualitative or quantitative, as desired. For example, the presence, abundance, integrity or structure of a PAAD domain encoding nucleic acid can be determined, as desired, depending on the assay format and the probe used for hybridization or primer pair chosen for application.

[0158] Useful assays for detecting a PAAD domain-containing nucleic acid based on specific hybridization with an isolated invention oligonucleotide are well known in the art and include, for example, in situ hybridization, which can be used to detect altered chromosomal location of the nucleic acid molecule, altered gene copy number, and RNA abundance, depending on the assay format used. Other hybridization assays include, for example, Northern blots and RNase protection assays, which can be used to determine the abundance and integrity of different RNA splice variants, and Southern blots, which can be used to determine the copy number and integrity of DNA. A hybridization probe can be labeled with any suitable detectable moiety, such as a radioisotope, fluorochrome, chemiluminescent marker, biotin, or other detectable moiety known in the art that is detectable by analytical methods.

[0159] Useful assays for detecting a PAAD domain encoding nucleic acid in a sample based on amplifying a PAAD domain encoding nucleic acid with two or more invention oligonucleotides are also well known in the art, and include, for example, qualitative or quantitative polymerase chain reaction (PCR); reverse-transcription PCR (RT-PCR); single strand conformational polymorphism (SSCP) analysis, which can readily identify a single point mutation in DNA based on differences in the secondary structure of single-strand DNA that produce an altered electrophoretic mobility upon non-denaturing gel electrophoresis; and coupled PCR, transcription and translation assays, such as a protein truncation test, in which a mutation in DNA is determined by an altered protein product on an electrophoresis gel. Additionally, the amplified PAAD domain encoding nucleic acid can be sequenced to detect mutations and mutational hot-spots, and specific assays for large-scale screening of samples to identify such mutations can be developed.

[0160] In a particular embodiment, a PAAD domain-containing polypeptide, or functional fragment thereof, can be administered to an individual so that the PAAD domain-containing polypeptide or functional fragment is targeted to a tumor to induce apoptosis, inhibit cell proliferation, or otherwise function as a tumor suppressor. One method of delivering a PAAD domain-containing polypeptide to an intracellular target is to fuse a PAAD domain-containing polypeptide or functional fragment to an intracellular-targeting peptide that can penetrate the cell membrane or otherwise deliver a polypeptide to the intracellular environment such as via internalization, thereby causing the fused PAAD domain-containing polypeptide to enter the cell. One example of such an intracellular-targeting peptides is a fusion to the transduction domain of HIV TAT, which allows transduction of up to 100% of cells (Schwarze et al., Science 285:1569-1572 (1999); Vocero-Akbani et al., Nature Med. 5:29-33 (1999)).

[0161] Another example of such an intracellular-targeting peptide is the Antennapeida homeoprotein internalization domain (Holinger et al., J. Biol. Chem. 274:13298-13304 (1999)). Still another intracellular-targeting peptide is a peptide that is specific for a cell surface receptor, which allows binding and internalization of a fusion polypeptide via receptor-mediated endocytosis (Ellerby et al., Nature Med. 5:1032-1038 (1999)). Such intracellular-targeting peptides that mediate specific receptor interactions can be advantageously used to target a tumor (see Ellerby et al., supra, 1999). Alternatively, a PAAD domain-containing polypeptide of the invention can be incorporated, if desired, into liposomes, microspheres or other polymer matrices (Gregoriadis, Liposome Technology, Vols. I to III, 2nd ed., CRC Press, Boca Raton Fla. (1993)).

[0162] Also provided are antisense-nucleic acids having a sequence capable of binding specifically with full-length or any portion of an mRNA that encodes PAAD domain-containing polypeptides so as to prevent translation of the mRNA. The antisense-nucleic acid can have a sequence capable of binding specifically with any portion of the sequence of the cDNA encoding PAAD domain-containing polypeptides. As used herein, the phrase "binding specifically" encompasses the ability of a nucleic acid sequence to recognize a complementary nucleic acid sequence and to form double-helical segments therewith via the formation of hydrogen bonds between the complementary base pairs. An example of an antisense-nucleic acid is an antisense-nucleic acid comprising chemical analogs of nucleotides.

[0163] Also provided are double-stranded RNA molecules for use in RNA interference methods. RNA interference (RNAi) is a process of sequence-specific gene silencing by post-transcriptional RNA degradation, which is initiated by double-stranded RNA (dsRNA) homologous in sequence to the silenced gene. A suitable double-stranded RNA (dsRNA) for RNAi contains sense and antisense strands of about 21 contiguous nucleotides corresponding to the gene to be targeted that form 19 RNA base pairs, leaving overhangs of two nucleotides at each 3' end (Elbashir et al., Nature 411:494-498 (2001); Bass, Nature 411:428-429 (2001); Zamore, Nat. Struct. Biol. 8:746-750 (2001)). dsRNAs of about 25-30 nucleotides have also been used successfully for RNAi (Karabinos et al., Proc. Natl. Acad. Sci. 98:7863-7868 (2001): dsRNA can be synthesized in vitro and introduced into a cell by methods known in the art. By such methods, translation of the target polypeptide can be decreased.

[0164] The present invention provides a method of reducing levels of expression of PAAD domain-containing polypeptides by introducing into a cell anti-sense nucleic acids that inhibit translation or degrade mRNA encoding these polypeptides. Such nucleic acid molecules are designed to recognize and selectively bind to mRNA, such as to mRNA comprising SEQ ID NOs:15, 17, 19, 21, 23, 25 or 27, or SEQ ID NOs:65, 67, 69, 71, 73, 75 or 83, and are complementary to portions thereof.

[0165] The present invention also provides a method of reducing levels of expression of PAAD domain-containing polypeptides by introducing into a cell dsRNA that degrades mRNA encoding such polyepeptides. Such dsRNA contains short contiguous sequences of about 21-30 nucleotides of SEQ ID NOs:15, 17, 19, 21, 23, 25 or 27, or SEQ ID NOs:65, 67, 69, 71, 73, 75 or 83, and about 21-30 nucleotides complementary thereto, designed such that there is about a 2 base overhang at each 3' end of the double-stranded sequence.

[0166] Compositions comprising an amount of the antisense-nucleic acid or dsRNA effective to reduce expression of PAAD domain-containing polypeptides can further contain an acceptable hydrophobic carrier capable of passing through a cell membrane are also provided herein. Suitable hydrophobic carriers are described, for example, in U.S. Pat. Nos. 5,334,761; 4,889,953; 4,897;355, and the like. The acceptable hydrophobic carrier capable of passing through cell membranes may also comprise a structure which binds to a receptor specific for a selected cell type and is thereby taken up by cells of the selected cell type. For example, the structure can be part of a protein known to bind to a cell-type specific receptor.

[0167] The invention also provides a method for expression of a PAAD domain-containing polypeptide by culturing cells containing a PAAD domain encoding nucleic acid under conditions suitable for expression of a PAAD domain-containing polypeptide. Thus, there is provided a method for the recombinant production of a PAAD domain-containing polypeptide of the invention by expressing the PAAD domain encoding nucleic acid sequences in suitable host cells. Recombinant DNA expression systems that are suitable to produce a PAAD domain-containing polypeptide described herein are well-known in the art (see, for example, Ausubel et al., supra (2000)). For example, the above-described nucleotide sequences can be incorporated into vectors for further manipulation. As used herein, a vector refers to a recombinant DNA or RNA plasmid or virus containing discrete elements that are used to introduce heterologous DNA into cells for either expression or replication thereof.

[0168] The invention also provides vectors containing the PAAD domain encoding nucleic acids of the invention. Suitable expression vectors are well-known in the art and include vectors capable of expressing nucleic acid operatively linked to a regulatory sequence or element such as a promoter region or enhancer region that is capable of regulating expression of such nucleic acid. Appropriate expression vectors include those that are replicable in eukaryotic cells and/or prokaryotic cells and those that remain episomal or those which integrate into the host cell genome.

[0169] Promoters or enhancers, depending upon the nature of the regulation, can be constitutive or regulated. The regulatory sequences or regulatory elements are operatively linked to a nucleic acid of the invention such that the physical and functional relationship between the nucleic acid and the regulatory sequence allows transcription of the nucleic acid.

[0170] Suitable vectors for expression in prokaryotic or eukaryotic cells are well known to those skilled in the art (see, for example, Ausubel et al., supra (2000)). Vectors useful for expression in eukaryotic cells can include, for example, regulatory elements including the SV40 early promoter, the cytomegalovirus (CMV) promoter, the mouse mammary tumor virus (MMTV) steroid-inducible promoter, Moloney murine leukemia virus (MMLV) promoter, and the like. The vectors of the invention are useful for subcloning and amplifying a PAAD domain encoding nucleic acid molecule and for recombinantly expressing a PAAD domain-containing polypeptide. A vector of the invention can include, for example, viral vectors such as a bacteriophage, a baculovirus or a retrovirus; cosmids or plasmids; and, particularly for cloning large nucleic acid molecules, bacterial artificial chromosome vectors (BACs) and yeast artificial chromosome vectors (YACs). Such vectors are commercially available, and their uses are well known in the art. One skilled in the art will know or can readily determine an appropriate promoter for expression in a particular host cell.

[0171] The invention additionally provides recombinant cells containing PAAD domain encoding nucleic acids of the invention. The recombinant cells are generated by introducing into a host cell a vector containing a PAAD domain encoding nucleic acid molecule. The recombinant cells are transducted, transfected or otherwise genetically modified. Exemplary host cells that can be used to express recombinant PAAD molecules include mammalian primary cells; established mammalian cell lines, such as COS, CHO, HeLa, NIH3T3, HEK 293 and PC12 cells; amphibian cells, such as Xenopus embryos and oocytes and other vertebrate cells. Exemplary host cells also include insect cells such as Drosophila, yeast cells such as Saccharomyces cerevisiae, Saccharomyces pombe, or Pichia pastoris, and prokaryotic cells such as Escherichia coli. Additional host cells can be obtained, for example, from ATCC (Manassas, Va.)

[0172] In one embodiment, PAAD domain encoding nucleic acids can be delivered into mammalian cells, either in vivo or in vitro using suitable vectors well-known in the art. Suitable vectors for delivering a PAAD domain-containing polypeptide, or a functional fragment thereof to a mammalian cell, include viral vectors such as retroviral vectors, adenovirus, adeno-associated virus, lentivirus, herpesvirus, as well as non-viral vectors such as plasmid vectors. Such vectors are useful for providing therapeutic amounts of a PAAD domain-containing polypeptide (see, for example, U.S. Pat. No. 5,399,346, issued Mar. 21, 1995). Delivery Of PAAD polypeptides or nucleic acids therapeutically can be particularly useful when targeted to a tumor cell, thereby inducing apoptosis in tumor cells. In addition, where it is desirable to limit or reduce the in vivo expression of a PAAD domain-containing polypeptide, the introduction of the antisense strand of the invention nucleic acid is contemplated.

[0173] The invention additionally provides an isolated anti-PAAD domain antibody (also referred to herein as an anti-PAAD antibody) having specific reactivity with a invention PAAD domain-containing polypeptide. The anti-PAAD antibody can be a monoclonal antibody or a polyclonal antibody. The invention further provides cell lines producing monoclonal antibodies having specific reactivity with an invention PAAD domain-containing protein.

[0174] The invention thus provides antibodies that specifically bind a PAAD domain-containing polypeptide. As used herein, the term "antibody" is used in its broadest sense to include polyclonal and monoclonal antibodies, as well as antigen binding fragments of such antibodies. With regard to an anti-PAAD antibody of the invention, the term "antigen" means a native or synthesized PAAD domain-containing polypeptide or fragment thereof. An anti-PAAD antibody, or antigen binding fragment of such an antibody, is characterized by having specific binding activity for a PAAD polypeptide or a peptide portion thereof of at least about 1×10⁵ M^-1. Thus, Fab, F(ab')₂, Fd and Fv fragments of an anti-PAAD antibody, which retain specific binding activity for a PAAD domain-containing polypeptide, are included within the definition of an antibody. Specific binding activity of a PAAD domain-containing polypeptide can be readily determined by one skilled in the art, for example, by comparing the binding activity of an anti-PAAD antibody to a PAAD domain-containing polypeptide versus a reference polypeptide that is not a PAAD domain-containing polypeptide. Methods of preparing polyclonal or monoclonal antibodies are well known to those skilled in the art (see, for example, Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press (1988)).

[0175] In addition, the term "antibody" as used herein includes naturally occurring antibodies as well as non-naturally occurring antibodies, including, for example, single chain antibodies, chimeric, bifunctional and humanized antibodies, as well as antigen-binding fragments thereof. Such non-naturally occurring antibodies can be constructed using solid phase peptide synthesis, can be produced recombinantly or can be obtained, for example, by screening combinatorial libraries consisting of variable heavy chains and variable light chains as described by Huse et al., Science 246:1275-1281 (1989)). These and other methods of making, for example, chimeric, humanized, CDR-grafted, single chain, and bifunctional antibodies are well known to those skilled in the art (Winter and Harris, Immunol. Today 14:243-246 (1993); Ward et al., Nature 341:544-546 (1989); Harlow and Lane, supra, 1988); Hilyard et al., Protein Engineering: A practical approach (IRL Press 1992); Borrabeck, Antibody Engineering, 2d ed. (Oxford University Press 1995)).

[0176] Anti-PAAD antibodies can be raised using a PAAD immunogen such as an isolated PAAD domain-containing functional fragment comprising an amino acid consensus sequence selected from the group consisting of:

TABLE-US-00003 -KFKX₁X₂L-; (SEQ ID NO: 29) -KLKX₁X₂L-; (SEQ ID NO: 30) -RFRX₁X₂L-; (SEQ ID NO: 31) -RFKX₁X₂L-; (SEQ ID NO: 32) -KFRX₁X₂L-; (SEQ ID NO: 33) and -KFKX₁X₂I-; (SEQ ID NO: 34)

where X₁ and X₂ can be any amino acid; or PAAD domain-containing protein having substantially the same amino acid sequence as SEQ ID NOS:16, 18, 20, 22, 24, 26 or 28, or SEQ ID NOs: 66, 68, 70, 72, 74, 76 or 84, or a portion thereof, which can be prepared from natural sources or produced recombinantly. Such a portion of a PAAD domain-containing polypeptide is a functional antigenic portion if the antigenic peptides can be used to generate a PAAD domain-containing polypeptide-specific antibody.

[0177] Thus, the invention provides isolated peptides comprising at least 10 contiguous amino acids of any of SEQ ID NOS:70, 72, 74 or 76, which can be used, for example, as antigens to generate antibodies against the polypeptides of the invention. In some embodiments, the isolated peptides consist of or comprise contiguous sequences of any of SEQ ID NOS:66, 68, 70, 72, 74, 76 or 84 that are not also present in any of SEQ ID NOS:16, 18, 20, 22, 24, 26 or 28.

[0178] The invention further provides a method for detecting the presence of a human PAAD domain-containing polypeptide in a sample by contacting a sample with a PAAD domain specific antibody, and detecting the presence of specific binding of the antibody to the sample, thereby detecting the presence of a human PAAD domain-containing polypeptide in the sample. PAAD domain specific antibodies can be used in diagnostic methods and systems to detect the level of PAAD domain-containing polypeptide present in a sample. As used herein, the term "sample" is intended to mean any biological fluid, cell, tissue, organ or portion thereof, that includes or potentially includes PAAD domain encoding nucleic acids or PAAD domain-containing polypeptides. The term includes samples present in an individual as well as samples obtained or derived from the individual. For example, a sample can be a histologic section of a specimen obtained by biopsy, or cells that are placed in or adapted to tissue culture. A sample further can be a subcellular fraction or extract, or a crude or substantially pure nucleic acid or polypeptide preparation.

[0179] PAAD domain specific antibodies can also be used for the immunoaffinity or affinity chromatography purification of an invention PAAD domain-containing polypeptide. In addition, methods are contemplated herein for detecting the presence of an invention PAAD domain-containing polypeptide in a cell, comprising contacting the cell with an antibody that specifically binds to PAAD domain-containing polypeptides under conditions permitting binding of the antibody to the PAAD domain-containing polypeptides, detecting the presence of the antibody bound to the PAAD domain-containing polypeptide, and thereby detecting the presence of invention polypeptides in a cell. With respect to the detection of such polypeptides, the antibodies can be used for in vitro diagnostic or in vivo imaging methods.

[0180] Immunological procedures useful for in vitro detection of target PAAD domain-containing polypeptides in a sample include immunoassays that employ a detectable antibody. Such immunoassays include, for example, immunohistochemistry, immunofluorescence, ELISA assays, radioimmunoassay, FACS analysis, immunoprecipitation, immunoblot analysis, Pandex microfluorimetric assay, agglutination assays, flow cytometry and serum diagnostic assays, which are well known in the art (Harlow and Lane, supra (1988); Harlow and Lane, Using Antibodies: A Laboratory Manual, Cold Spring Harbor Press (1999)).

[0181] An antibody can be made detectable by various means well known in the art. For example, a detectable marker can be directly attached to the antibody or indirectly attached using, for example, a secondary agent that recognizes the PAAD specific antibody. Useful markers include, for example, radionucleotides, enzymes, binding proteins such as biotin, fluorogens, chromogens, fluorescent labels and chemiluminescent labels. A description of immunofluorescent analytic techniques is found in DeLuca, "Immunofluorescence Analysis", in Antibody As a Tool, Marchalonis et al., eds., John Wiley & Sons, Ltd., pp. 189-231 (1982), which is incorporated herein by reference.

[0182] In addition to detecting the presence of a PAAD domain-containing polypeptide, invention anti-PAAD antibodies are contemplated for use herein to alter the activity of the PAAD domain-containing polypeptide in living animals, in humans, or in biological tissues or fluids isolated therefrom. The term "alter" refers to the ability of a compound such as a PAAD domain-containing polypeptide, a PAAD domain encoding nucleic acid, an agent or other compound to increase or decrease biological activity which is modulated by the compound, by functioning as an agonist or antagonist of the compound. Accordingly, compositions comprising a carrier and an amount of an antibody having specificity for PAAD domain-containing polypeptides effective to block naturally occurring ligands or other PAAD-associated polypeptides from binding to invention PAAD domain-containing polypeptides are contemplated herein. For example, a monoclonal antibody directed to an'epitope of an invention PAAD domain-containing polypeptide, including an amino acid sequence substantially the same as SEQ ID NOS:16, 18, 20, 22, 24, 26 or 28, or SEQ ID NOs: 66, 68, 70, 72, 74, 76 or 84, can be useful for this purpose.

[0183] The present invention further provides transgenic non-human mammals that are capable of expressing exogenous nucleic acids encoding PAAD domain-containing polypeptides. As employed herein, the phrase "exogenous nucleic acid" refers to nucleic acid sequence which is not native to the host, or which is present in the host in other than its native environment, for example, as part of a genetically engineered DNA construct. In addition to naturally occurring PAAD domain-containing polypeptide levels, a PAAD domain-containing polypeptide of the invention can either be overexpressed or underexpressed in transgenic mammals, for example, underexpressed in a knock-out animal.

[0184] Animal model systems useful for elucidating the physiological and behavioral roles of PAAD domain-containing polypeptides are also provided, and are produced by creating transgenic animals in which the expression of the PAAD domain-containing polypeptide is altered using a variety of techniques. Examples of such techniques include the insertion of normal or mutant versions of nucleic acids encoding a PAAD domain-containing polypeptide by microinjection, retroviral infection or other means well known to those skilled in the art, into appropriate fertilized embryos to produce a transgenic animal, see, for example, Hogan et al., Manipulating the Mouse Embryo: A Laboratory Manual (Cold Spring Harbor Laboratory, (1986)). Transgenic animal model systems are useful for in vivo screening of compounds for identification of specific ligands, such as agonists or antagonists, which activate or inhibit a biological activity.

[0185] In accordance with another embodiment of the invention, a method is provided for identifying a PAAD-associated polypeptide (PAP). The method is carried out by contacting an invention PAAD domain-containing polypeptide with a candidate PAP and detecting association of the PAAD domain-containing polypeptide with the PAP.

[0186] As used herein, the term "PAAD-associated polypeptide" or "PAP" means a polypeptide that can specifically bind to the PAAD domain-containing polypeptides of the invention, or to any functional fragment of a PAAD domain-containing polypeptide of the invention. Because PAAD domain-containing polypeptides of the invention contain domains which can self-associate, PAAD domain-containing polypeptides are encompassed by the term PAP. An exemplary PAP is a protein or a polypeptide portion of a protein that can bind a PAAD, NACHT, LRR or ANGIO-R (ARED) domain of an invention PAAD domain-containing polypeptide. A PAP can be identified, for example, using in vitro or in vivo protein-interaction assays and methods known in the art, including yeast two-hybrid assays, co-immunoprecipitation, GST fusion co-purification, GST pull-down assays and the like (see, for example, Ausubel et al., supra (2000)). Additional methods include, for example, scintillation proximity assay (SPA) (Alouani, Methods Mol. Biol. 138:135-41 (2000)), UV or chemical cross-linking (Fancy, Curr. Opin. Chem. Biol. 4:28-33 (2000)), competition binding assays (Yamamura et al., Methods in Neurotransmitter Receptor Analysis, Raven Press, New York, 1990), biomolecular interaction analysis (BIA) such as surface plasmon resonance (SPR) (Weinberger et al., Pharmacogenomics 1:395-416 (2000)), mass spectrometry (MS) (McLafferty et al., Science 284:1289-1290 (1999) and Degterev, et al., Nature Cell Biology 3:173-182 (2001)), nuclear magnetic resonance (NMR) (Shuker et al., Science 274:1531-1534 (1996), Hajduk et al., J. Med. Chem. 42:2315-2317 (1999), and Chen and Shapiro, Anal. Chem. 71:669 A-675A (1999)), and fluorescence polarization assays (FPA) (Degterev et al., supra, 2001).

[0187] Exemplary PAPs contemplated herein can include a protein involved in regulating apoptosis, caspase activation or NFκB induction, and other PAAD domain-containing polypeptides, selected from: Apaf-1, CED4, Nod1/CARD4, ASC-1, CARDX1, pro-Casp1, pro-Casp2, pro-Casp4, pro-Casp5, pro-Casp7, pro-Casp11, pro-Casp12, pro-Casp14, CED3, Dronc, Raidd/CRADD, Cardiak (RIP2, Rick), Bcl-1/CIPER, ARC, NOP30, cIAP-1, cIAP-2, Fadd/mort1, pro-Casp8, pro-Casp10, Dredd, c-Flip/flame, KSV/V-Flip, MCV, DEDD/DEFT, PEA-15, Flash, BAP31, BAR, RIP, IRAK-1, IRAK-2, IRAK-M, My D88, NMP-84, Ankyrin-1, Ankyrin-3, TNFR1, NGFR, Fas, DR3, DR4, DR5, DR6, Tradd, Fadd, Raidd2, DAP Kinase, NIK, IKKα, IKKβ, IκB, p65, p50, IKAP, pyrin, pyrin2, PAN1, PAN2, PAN3, PAN4, PANS, PANG, PANT, PANS, PAN9, PAN10, FLJ20510_human, PANunk_mouse, NALP3/cryopyrin, NALP1/NAC, PAN5_mouse, PAN4_CT, PAN2_mouse, ASC, ASC2, NAC, AIM2, IFI16, MO13L, p52, p100, p105, ParaCaspase (MALT1) and all members of the NFκB/IκB families. The naturally occurring sequences of these molecules from a variety of species, including human and rodent, are well known in the art. The skilled person can readily determine fragments and modifications of naturally occurring PAP sequences that retain their ability to associate with a PAAD domain-containing polypeptide, or domain therefrom, in the assays described herein.

[0188] As disclosed herein, exemplary PAPs that associate, with ASC include ASC, ASC2, Caspase-1, Card10, Nod1, Cardiak, NIK and IKK-i. An exemplary PAP that associates with PAN2 is IκBα. An exemplary PAP that associates with PANG is IKAP.

[0189] The normal association between a PAAD domain-containing polypeptide and a PAP polypeptide in a cell can be altered due, for example, to the expression in the cell of a variant PAP or PAAD domain-containing polypeptide, respectively, either of which can compete with the normal binding function of a PAAD domain-containing polypeptide and, therefore, can decrease the association of PAP and PAAD domain-containing polypeptides in a cell. The term "variant" is used generally herein to mean a polypeptide that is different from the PAP or PAAD domain-containing polypeptide that normally is found in a particular cell type. Thus, a variant can include a mutated protein or a naturally occurring protein, such as an isoform, that is not normally found in a particular cell type.

[0190] PAAD domain-containing polypeptides and PAAD-associated polypeptides of the invention can be characterized, for example, using in vitro binding assays or the yeast two hybrid system. An in vivo transcription activation assay such as the yeast two hybrid system is particularly useful for identifying and manipulating the association of proteins. In addition, the results observed in such an assay likely mirror the events that naturally occur in a cell. Thus, the results obtained in such an in vivo assay can be predictive of results that can occur in a cell in a subject such as a human subject.

[0191] A transcription activation assay such as the yeast two hybrid system is based on the modular nature of transcription factors, which consist of functionally separable DNA-binding and trans-activation domains. When expressed as separate proteins, these two domains fail to mediate gene transcription. However, transcription activation activity can be restored if the DNA-binding domain and the trans-activation domain are bridged together due, for example, to the association of two proteins. The DNA-binding domain and trans-activation domain can be bridged, for example, by expressing the DNA-binding domain and trans-activation domain as fusion proteins (hybrids), provided that the proteins that are fused to the domains can associate with each other. The non-covalent bridging of the two hybrids brings the DNA-binding and trans-activation domains together and creates a transcriptionally competent complex. The association of the proteins is determined by observing transcriptional activation of a reporter gene.

[0192] The yeast two hybrid systems exemplified herein use various strains of S. cerevisiae as host cells for vectors that express the hybrid proteins. A transcription activation assay also can be performed using, for example, mammalian cells. However, the yeast two hybrid system is particularly useful due to the ease of working with yeast and the speed with which the assay can be performed. For example, yeast host cells containing a lacZ reporter gene linked to a LexA operator sequence can be used to demonstrate that a PAAD domain of an invention PAAD domain-containing polypeptide can interact with itself or other PAAD domain-containing polypeptides. For example, the DNA-binding domain can consist of the LexA DNA-binding domain, which binds the LexA promoter, fused to the PAAD domain of a PAAD domain-containing polypeptide of the invention and the trans-activation domain can consist of the B42 acidic region separately fused to several cDNA sequences which encode known PAAD domain-containing polypeptides. When the LexA domain is non-covalently bridged to a trans-activation domain fused to a PAAD domain-containing polypeptide, the association can activate transcription of the reporter gene.

[0193] A PAP, for example, a PAAD domain-containing polypeptide, a CARD-containing polypeptide, an NACHT-containing polypeptide or a LRR-containing polypeptide, also can be identified using well known in vitro assays, for example, an assay utilizing a glutathione-S-transferase (GST) fusion protein. Such an in vitro assay provides a simple, rapid and inexpensive method for identifying and isolating a PAP. Such an in vitro assay is particularly useful in confirming results obtained in vivo and can be used to characterize specific binding domains of a PAP. For example, a GST can be fused to a PAAD domain-containing polypeptide of the invention, and expressed and purified by binding to an affinity matrix containing immobilized glutathione. If desired, a sample that can contains a PAP or active fragments of a PAP can be passed over an affinity column containing bound. GST/PAAD and a PAP that binds to a PAAD domain-containing polypeptide can be obtained. In addition, GST/PAAD can be used to screen a cDNA expression library, wherein binding of the GST/PAAD fusion protein to a clone indicates that the clone contains a cDNA encoding a PAP.

[0194] Thus, one of skill in the art will recognize that using the PAAD domain-containing polypeptides described herein, a variety of methods, such as protein purification, protein interaction cloning, or protein mass-spectrometry, can be used to identify a PAP.

[0195] Although the term "PAP" is used generally, it should be recognized that a PAP that is identified using the novel polypeptides described herein can be a fragment of a protein. Thus, as used herein, a PAP also includes a polypeptide that specifically associates to a portion of an invention PAAD domain-containing polypeptide that does not include a PAAD domain. For example, a PAP can associate with the NACHT domain of an invention PAN. As used herein, a "candidate PAP" refers to a polypeptide containing a polypeptide sequence know or suspected of binding one or more PAAD domain-containing polypeptides of the invention. Thus, a PAP, can represent a full-length protein or a PAAD-associating fragment thereof. Since a PAP polypeptide can be a full-length protein or a PAAD-associating fragment thereof, one of skill in the Art will recognize that a PAP-encoding nucleic acid, such as the genomic sequence, an mRNA sequence or a cDNA sequence need not encode the full-length protein. Thus, a cDNA can encode a polypeptide that is a fragment of a full-length PAP which, nevertheless, binds one or more invention PAAD domain-containing polypeptides. It is also within the scope of the invention that a full-length PAP can assume a conformation that does not, absent some post-translational modification, bind a PAAD domain-containing polypeptide of the invention, due, for example, to steric blocking of the binding site. Thus, a PAP can be a protein or a polypeptide portion of a protein that can bind one of the PAAD domain-containing polypeptides of the invention. Also, it should be recognized that a PAP can be identified by using a minimal polypeptide derived from the sequences of the PAAD domain-containing polypeptides of the invention, and does not necessarily require that the full-length molecules be employed for identifying such PAPs.

[0196] Since PAAD domain-containing polypeptides can be involved in apoptosis, the association of a PAP with a PAAD domain-containing polypeptide can affect the sensitivity or resistance of a cell to apoptosis or can induce or block apoptosis induced by external or internal stimuli. The identification of various PAPs by use of known methods can be used to determine the function of these PAPs in cell death or signal transduction pathways controlled by PAAD domain-containing polypeptides, allowing for the development of assays that are useful for identifying agents that effectively alter the association of a PAP with a PAAD domain-containing polypeptide. Such agents can be useful for providing effective therapy for conditions caused, at least in part, by insufficient apoptosis, such as cancer, autoimmune disease or certain viral infections. Such agents can also be useful for providing an effective therapy for diseases where excessive apoptosis is known to occur, such as stroke, heart failure, or AIDS; as well as inflammatory diseases, such as inflammatory bowel diseases (e.g. Crohn's disease and ulcerative colitus); rheumatoid arthritis, sepsis, trauma, allograft rejection and graft-versus-host disease.

[0197] Since PAAD domain-containing polypeptides are also involved in regulating NFκB activity, the association of a PAP with a PAAD domain-containing polypeptide can also affect responses of cells to stimuli that activate NFκB transcription, including TNFα and IL-1 and other proinflammatory cytokines, T- and B-cell mitogens, bacteria, bacterial lipopolysaccharide (LPS), viruses, viral proteins, double stranded RNA, and physical and chemical stresses. The identification of various PAPs as described herein and agents that effectively alter the association of a PAP with a PAAD domain-containing polypeptide can be used, to provide effective therapy for conditions mediated, at least in part, by NFκB, including, for example, inflammatory conditions, infections, cancers, neurodegenerative disorders, arthritis and asthma.

[0198] Assays of the invention can be used for identification of agents that alter the self-association of the PAAD domain-containing polypeptides of the invention. Thus, the methods of the invention can be used to identify agents that alter the self-association of invention PAAD domains, such as SEQ ID NOS:1-14 and PAAD domain-containing proteins, such as SEQ ID NOs:16, 18, 20, 22, 24, 26 and 28, or SEQ ID NOs: 66, 68, 70, 72, 74, 76 or 84, via their PAAD domains, NB-ARC (NACHT) domains, LRR domains, ANGIO-R (ARED) domains or other domains within these polypeptides.

[0199] The ATP-binding and hydrolysis of the NACHT domains can be critical for function of a PAAD domain-containing polypeptide, for example, by altering the oligomerization of the PAAD domain-containing polypeptide. Thus, agents that interfere with or enhance ATP or nucleotide binding and/or hydrolysis by the NACHT domain of a PAAD domain-containing polypeptide of the invention, such as invention PAN proteins, can also be useful for altering the activity of these polypeptides in cells.

[0200] A further embodiment of the invention provides a method to identify agents that can effectively alter PAAD domain-containing polypeptide activity, for example the ability of PAAD domain-containing polypeptides to associate with one or more heterologous proteins. Thus, the present invention provides a screening assay useful for identifying an effective agent, which can alter the association of a PAAD domain-containing polypeptide, such as a PAN, with a PAAD-associated polypeptide (PAP), such as a heterologous PAAD domain-containing polypeptide.

[0201] Effective agents can be useful to alter a biochemical process modulated by a PAAD domain-containing polypeptide of the invention. Additional biochemical processes (also referred to herein as "cell activities") modulated by PAAD domain-containing polypeptide include, for example, apoptosis, regulation of NFκB induction, cytokine processing, cytokine receptor signaling, cJUN N-terminal kinase induction, caspase-mediated proteolytic activation/inhibition, transcription, inflammation and cell adhesion.

[0202] As used herein, the term "agent" means a chemical or biological molecule such as a simple or complex organic molecule, a peptide, a peptido-mimetic, a polypeptide, a protein or an oligonucleotide that has the potential for altering the association of a PAAD domain-containing polypeptide with a heterologous protein or altering the ability of a PAAD domain-containing polypeptide to self-associate or altering the ligand binding or biological activity of a PAAD domain-containing polypeptide. An exemplary ligand binding activity is nucleotide binding activity, such as ADP or ATP binding activity; and exemplary catalytic activities are nucleotide hydrolytic activity and proteolytic activity. In addition, the term "effective agent" is used herein to mean an agent that is confirmed as capable of altering the association of a PAAD domain-containing polypeptide with a heterologous protein or altering the ability of a PAAD domain-containing polypeptide to self-associate or altering the ligand binding or catalytic activity of a PAAD domain-containing polypeptide. For example, an effective agent may be an anti-PAAD antibody, a PAAD-associated polypeptide and the like.

[0203] As used herein, the term "alter the association" means that the association between two specifically interacting polypeptides either is increased or decreased due to the presence of an effective agent. As a result of an altered association of PAAD domain-containing polypeptide with another polypeptide in a cell, the activity of the PAAD domain-containing polypeptide or the PAP can be increased or decreased, thereby altering a biochemical process, for example, the level of apoptosis or NFκB transcriptional activity in the cell. As used herein, the term "alter the activity" means that the agent can increase or decrease the activity of a PAAD domain-containing polypeptide in a cell, thereby modulating a biochemical process in a cell, for example, the level of apoptosis or NFκB transcriptional activity in the cell. Similarly, the term "alter the level" of a biological process modulated by a PAAD domain-containing polypeptide refers to an increase or decrease a biochemical process which occurs upon altering the activity of a PAAD domain-containing polypeptide. For example, an effective agent can increase or decrease the PAAD:PAAD-associating activity of a PAAD domain-containing polypeptide, which can result in altered apoptosis or increased or decreased NFκB transcriptional activity. In another example, alteration of the ATP hydrolysis activity can modulate the ability of the NACHT domain of a PAAD domain-containing polypeptide to associate with other NACHT-containing polypeptides, such as Apaf-1, thereby altering any process effected by such association between a PAAD domain-containing polypeptide and a NACHT-containing polypeptide.

[0204] An effective agent can act by interfering with the ability of a PAAD domain-containing polypeptide to associate with another polypeptide, or can act by causing the dissociation of a PAAD domain-containing polypeptide from a complex with a PAAD-associated polypeptide, wherein the ratio of bound PAAD domain-containing polypeptide to free PAAD domain-containing polypeptide is related to the level of a biochemical process, such as apoptosis or NFκB transcriptional activity, in a cell. For example, binding of a ligand to a PAP can allow the PAP, in turn, to bind a specific PAAD domain-containing polypeptide such that all of the specific PAAD domain-containing polypeptide is bound to a PAP.

[0205] An effective agent can be useful, for example, to increase the level of apoptosis in a cell such as a cancer cell, which is characterized by having a decreased level of apoptosis as compared to its normal cell counterpart. An effective agent also can be useful, for example, to decrease the level of apoptosis in a cell such as a T lymphocyte in a subject having a viral disease such as acquired immunodeficiency syndrome, which is characterized by an increased level of apoptosis in an infected T cell as compared to a normal T cell. Thus, an effective agent can be useful as a medicament for altering the level of apoptosis in a subject having a pathology characterized by increased or decreased apoptosis. In addition, an effective agent can be used, for example, to decrease the level of apoptosis and, therefore, increase the survival time of a cell such as a hybridoma cell in culture. The use of an effective agent to prolong the survival of a cell in vitro can significantly improve bioproduction yields in industrial tissue culture applications.

[0206] An effective agent can also be useful to increase or decrease NFκB transcriptional activity, and thus can be used to provide effective therapy for conditions mediated, at least in part, by NFκB, including, for example, inflammatory conditions (e.g. inflammatory bowel diseases, such as Crohn's disease and ulcerative colitus), infections, cancers, neurodegenerative disorders, arthritis, asthma, stroke, heart failure, AIDS, sepsis, trauma, allograft rejection and graft-versus-host disease.

[0207] A PAAD domain-containing polypeptide that lacks the ability to bind the CARD domain, NACHT domain or LRR domain of another polypeptide but retains the ability to self-associate via its PAAD domain or to bind to other PAAD domain-containing polypeptides is an example of an effective agent, since the expression of a non-NACHT-associating or non-catalytically active PAAD domain-containing polypeptide in a cell can alter the association of a the endogenous PAAD domain-containing polypeptide with itself or with PAPs.

[0208] Thus, it should be recognized that a mutation of a PAAD domain-containing polypeptide can be an effective agent, depending, for example, on the normal levels of PAAD domain-containing polypeptide and PAAD associated polypeptide that occur in a particular cell type. In addition, an active fragment of a PAAD domain-containing polypeptide can be an effective agent, provided the active fragment can alter the association of a PAAD domain-containing polypeptide and another polypeptide in a cell. Such active fragments, which can be peptides as small as about five amino acids, can be identified, for example, by screening a peptide library (see, for example, Ladner et al., U.S. Pat. No. 5,223,409, which is incorporated herein by reference) to identify peptides that can bind a PAAD-associated polypeptide.

[0209] Similarly, a peptide or polypeptide portion of a PAAD-associated polypeptide also can be an effective agent. A peptide of PAAD-associated polypeptide can be useful, for example, for decreasing the association of a PAAD domain-containing polypeptide with a PAP in a cell by competing for binding to the PAAD domain-containing polypeptide. A non-naturally occurring peptido-mimetic also can be useful as an effective agent. Such a peptido-mimetic can include, for example, a peptoid, which is peptide-like sequence containing N-substituted glycines, or an oligocarbamate. A peptido-mimetic can be particularly useful as an effective agent due, for example, to having an increased stability to enzymatic degradation in vivo.

[0210] In accordance with another embodiment of the present invention, there is provided a method of identifying an effective agent that alters the association of an invention PAAD domain-containing polypeptide with a PAAD-associated polypeptide (PAP), by the steps of: [0211] (a) contacting the PAAD domain-containing polypeptide and PAP polypeptides, under conditions that allow the PAAD domain-containing polypeptide and PAP polypeptides to associate, with an agent suspected of being able to alter the association of the PAAD domain-containing polypeptide and PAP polypeptides; and [0212] (b) detecting the altered association of the PAAD domain-containing polypeptide and PAP polypeptides, where the altered association identifies an effective agent.

[0213] Methods well-known in the art for detecting the altered association of the PAAD domain-containing polypeptide and PAP polypeptides, for example, measuring protein:protein binding, protein degradation or apoptotic activity can be employed in bioassays described herein to identify agents as agonists or antagonists of PAAD domain-containing polypeptides. As described herein, PAAD domain-containing polypeptides have the ability to self-associate. Thus, methods for identifying effective agents that alter the association of a PAAD domain-containing polypeptide with a PAP are useful for identifying effective agents that alter the ability of a PAAD domain-containing polypeptide to self-associate.

[0214] As used herein, "conditions that allow said PAAD domain-containing polypeptide and PAP polypeptides to associate" refers to environmental conditions in which a PAAD domain-containing polypeptide and PAP specifically associate. Such conditions will typically be aqueous conditions, with a pH between 3.0 and 11.0, and temperature below 100° C. Preferably, the conditions will be aqueous conditions with salt concentrations below the equivalent of 1 M NaCl, and pH between 5.0 and 9.0, and temperatures between 0° C. and 50° C.: Most preferably, the conditions will range from physiological conditions of normal yeast or mammalian cells, or conditions favorable for carrying out in vitro assays such as immunoprecipitation and GST protein:protein association assays, and the like.

[0215] In another embodiment of the invention, a method is provided for identifying agents that modulate a biological activity of an invention PAAD domain-containing polypeptide, such as ligand interaction or catalytic activity. The method contains the steps of contacting an invention PAAD domain-containing polypeptide with an agent suspected of modulating a ligand binding or biological activity of the PAAD domain-containing polypeptide and measuring a biological activity of the PAAD domain-containing polypeptide, where modulated biological activity identifies the agent as an agent that alters the biological activity of a PAAD domain-containing polypeptide.

[0216] As used herein in regard to biological activity, "modulate" refers to an increase or decrease in the measured biological activity. Thus, modulation encompasses inhibition of biological activity as well as activation or enhancement of biological activity. Exemplary biological activities include nucleotide binding, nucleotide hydrolysis and modulation of NFκB activation.

[0217] Methods for measuring ligand binding and other biological activities are well known in the art, as disclosed herein. For example, an agent known or suspected of modulating a biological activity can be contacted with an invention PAAD domain-containing polypeptide in vivo or in vitro, and the activity can be measured using known methods. Exemplary agents that can modulate a biological activity include peptides, peptidomimetics and other peptide analogs, non-peptide organic molecules such as naturally occurring protease inhibitors and derviatives thereof, nucleotides and nucleotide analogs, and the like. Such inhibitors can be either reversible or irreversible, as is well known in the art.

[0218] Agents that modulate a biological activity of a PAAD domain-containing polypeptide identified using the invention methods can be used to modulate the activity of a PAAD domain-containing polypeptide. For example, an agent can modulate the nucleotide binding or nucleotide hydrolytic activity of an NACHT domain of a PAAD domain-containing polypeptide. In another example, an agent can modulate the NFκB regulatory activity of the PAAD domain. Methods of modulating a biological activity of invention PAAD domain-containing proteins can be used in methods of altering biochemical processes modulated by PAAD domain-containing proteins, such as the biochemical processes disclosed herein.

[0219] In yet another embodiment of the present invention, there are provided methods for altering a bioloigcal activity of a PAAD domain-containing polypeptide of the invention, the method comprising:

[0220] contacting an PAAD domain-containing polypeptide with an effective amount of an agent identified by the herein-described bioassays.

[0221] The present invention also provides in vitro screening assays. Such screening assay's are particularly useful in that they can be automated, which allows for high through-put screening, for example, of randomly or rationally designed agents such as drugs, peptidomimetics or peptides in order to identify those agents that effectively alter the association of a PAAD domain-containing polypeptide and a PAP or the catalytic or ligand binding activity of a PAAD domain-containing polypeptide and, thereby, alter a biochemical process modulated by a PAAD domain-containing polypeptide such as apoptosis. An in vitro screening assay can utilize, for example, a PAAD domain-containing polypeptide including a PAAD domain-containing fusion protein such as a PAAD-glutathione-S-transferase fusion protein. For use in the in vitro screening assay, the PAAD domain-containing polypeptide should have an affinity for a solid substrate as well as the ability to associate with a PAAD-associated polypeptide. For example, when a PAAD domain-containing polypeptide is used in the assay, the solid substrate can contain a covalently attached anti-PAAD antibody. Alternatively, a GST/PAD fusion protein can be used in the assay and the solid substrate can contain covalently attached glutathione, which is bound by the GST component of the GST/PAAD fusion protein. Similarly, a PAAD-associated polypeptide can be used in any of a variety of in vitro enzymatic or in vitro binding assays known in the art and described in texts such as Ausubel et al., supra, 2000.

[0222] An in vitro screening assay can be performed by allowing a PAAD domain-containing polypeptide or fragment thereof to bind to the solid support, then adding a PAAD-associated polypeptide and an agent to be tested. Reference reactions, which do not contain an agent, can be performed in parallel. Following incubation under suitable conditions, which include, for example, an appropriate buffer concentration and pH and time and temperature that permit binding of the particular PAAD domain-containing polypeptide and PAAD-associated polypeptide, the amount of protein that has associated in the absence of an agent and in the presence of an agent can be determined. The association of a PAAD-associated polypeptide with a PAAD domain-containing polypeptide can be detected, for example, by attaching a detectable moiety such as a radionuclide or a fluorescent label to a PAAD-associated polypeptide and measuring the amount of label that is associated with the solid support, wherein the amount of label detected indicates the amount of association of the PAAD-associated polypeptide with a PAAD domain-containing polypeptide. An effective agent is determined by comparing the amount of specific binding in the presence of an agent as compared to a reference level of binding, wherein an effective agent alters the association of PAAD domain-containing polypeptide with the PAAD-associated polypeptide. Such an assay is particularly useful for screening a panel of agents such as a peptide library in order to detect an effective agent.

[0223] Additionally, a PAAD domain-containing polypeptide or domain thereof, such as a PAAD domain or NACHT domain, can be contacted with a candidate agent and association between the polypeptide and the candidate agent determined. Agents that bind in such assays can further be tested for their ability to alter a biological activity of a PAAD domain-containing polypeptide or for their ability to alter associations between a PAAD domain-containing polypeptide and a PAP.

[0224] Various binding assays described above, such as the two hybrid assay, co-immunoprecipitation assay, co-localization assay, scintillation proximity assay (SPA), UV or chemical cross-linking, biomolecular interaction analysis (BIA), mass spectrometry (MS), nuclear magnetic resonance (NMR), and fluorescence polarization assays (FPA) can be used to identify an effective agent.

[0225] Another assay for screening of agents that alter the activity of a PAAD domain-containing polypeptide is based on altering the phenotype of yeast by expressing a PAAD domain-containing polypeptide. In one embodiment, expression of a PAAD domain-containing polypeptide can be inducible (Tao et al., J. Biol. Chem. 273:23704-23708 (1998), and the compounds can be screened when PAAD domain-containing polypeptide expression is induced. PAAD domain-containing polypeptides of the invention can also be co-expressed in yeast with PAP polypeptides used to screen for compounds that antagonize the activity of the PAAD domain-containing polypeptide.

[0226] A biological activity that can potentially be altered by an agent is PAAD domain-mediated modulation of NFκB activity. An agent that increases or decreases PAAD domain-mediated inhibition of NFκB activity with correspondingly decrease or increase NFκB activity. Such agents can be useful for treating conditions associated with decreased or increased NFκB activity as described herein, including, for example, inflammation, autoimmune diseases, neurodegenerative diseases, cancer and infectious disorders.

[0227] The invention thus provides methods of identifying agents that modulate PAAD domain-mediated inhibition or stimulation of NFκB activity. In one embodiment, a cell that recombinantly expresses a PAAD domain-containing polypeptide is contacted with a candidate agent and altered NFκB activity, such as increased or decreased activity, is detected in the cell. As NFκB activity in an unstimulated cell is normally low, such methods can be practiced by contacting the cell with an NFκB inducer, such as TNFα or IL1β, or recombinantly expressing within the cell an NFκB inducer, such as Bcl10, TRAF2, TRAF6, NIK, RIP2, p65, IRAK2, IRAK3, MyD88, RIP, IL-1R, Nod1, IKKα, IKKβ, TNFR1, and the like, such that the PAAD domain-containing polypeptide inhibits the induced level of NFκB activity.

[0228] The skilled person can employ appropriate controls to confirm that the effect of the candidate agent is specific for the PAAD domain-containing polypeptide. For example, the effect on NFκB activation of the candidate agent can be compared to the effect in a control cell that does not express nucleic acid molecule encoding a PAAD domain-containing polypeptide. Additionally, the effect of the candidate agent on NFκB activation can be compared with the effect of a vehicle control not containing the agent.

[0229] Various methods of determining the amount of NFκB activity in a cell are well known in the art. For example, binding assays have been developed that take advantage of the observation that active NFκB, but not inactive NFκB, binds to DNA. Therefore, the binding of a test cell extract to a labeled oligonucleotide containing an NFκB consensus binding site can be assayed. Active NFκB in the cell extract is evidenced by retardation of the mobility of the oligonucleotide band on a gel (Schreck et al., Nucleic Acids Res. 18:6497-6502 (1990); Rusher et al., J. Biotech. 78:163-170 (2000)). An alternative method is to attach an oligonucleotide containing an NFκB consensus binding site to a multiwell plate and detect bound, active NFκB in an ELISA-type assay using NFκB antibodies (Renard et al., Nucleic Acids Res. 29:E21 (2001)).

[0230] An alternative assay for determining the amount of NFκB activity in a cell monitors the cleavage of the NFκB precursors p100 or p105 to the active p50 or p55 subunits (see, for example, Lin et al., Mol. Cell. Biol. 16:2248-2254 (1996); Morgan et al., Cancer Res. 59:6205-6213 (1999); Uren et al., Mol. Cell. 6:961-967 (2000)).

[0231] Activity assays can also be used to determine the amount of NFκB activity in a cell. For example, a reporter gene such as the luciferase, β-galactosidase or secretory alkaline phosphatase gene can be placed under the control of a promoter containing the NFκB consensus site. NFκB activity in cells transfected with the reporter construct is evidenced by expression of the product of the reporter gene (Moon et al., Anal. Biochem. 292:17-21 (2001); see Examples).

[0232] Additional methods of monitoring NFκB activation include, for example, monitoring cytoplasmic IκB degradation using antibodies directed against IκB (Sun et al., Proc. Natl. Acad. Sci. USA 91:1346-1350 (1994), and monitoring exposure of the nuclear localization signal (NLS) of active NFκB using NLS-specific antibodies (Zabel et al., EMBO J. 12:201-211 (1993)).

[0233] Also provided with the present invention are assays to identify agents that alter PAAD domain-containing polypeptide expression. Methods to determine PAAD domain-containing polypeptide expression can involve detecting a change in PAAD domain-containing polypeptide abundance in response to contacting the cell with an agent that modulates PAAD domain-containing polypeptide expression. Assays for detecting changes in polypeptide expression include, for example, immunoassays with PAAD domain specific antibodies, such as immunoblotting, immunofluorescence, immunohistochemistry and immunoprecipitation assays, as described herein.

[0234] As understood by those of skill in the art, assay methods for identifying agents that alter PAAD domain-containing polypeptide activity generally require comparison to a reference. One type of a "reference" is a cell or culture that is treated substantially the same as the test cell or test culture exposed to the agent, with the distinction that the "reference" cell or culture is not exposed to the agent. Another type of "reference" cell or culture can be a cell or culture that is identical to the test cells, with the exception that the "reference" cells or culture do not express a PAAD domain-containing polypeptide. Accordingly, the response of the transfected cell to an agent is compared to the response, or lack thereof, of the "reference" cell or culture to the same agent under the same reaction conditions.

[0235] Methods for producing pluralities of agents to use in screening for compounds that alter the activity of a PAAD domain-containing polypeptide, including chemical or biological molecules such as simple or complex organic molecules, metal-containing compounds, carbohydrates, peptides, proteins, peptidomimetics, glycoproteins, lipoproteins, nucleic acids, antibodies, and the like, are well known in the art and are described, for example, in Huse, U.S. Pat. No. 5,264,563; Francis et al., Curr. Opin. Chem. Biol. 2:422-428 (1998); Tietze et al., Curr. Biol., 2:363-371 (1998); Sofia, Mol. Divers. 3:75-94 (1998); Eichler et al., Med. Res. Rev. 15:481-496 (1995); and the like. Libraries containing large numbers of natural and synthetic agents also can be obtained from commercial sources. Combinatorial libraries of molecules can be prepared using well known combinatorial chemistry methods (Gordon et al., J. Med. Chem. 37: 1233-1251 (1994); Gordon et al., J. Med. Chem. 37: 1385-1401 (1994); Gordon et al., Acc. Chem. Res. 29:144-154 (1996); Wilson and Czarnik, eds., Combinatorial Chemistry: Synthesis and Application, John Wiley & Sons, New York (1997)).

[0236] The invention further provides a method of diagnosing or predicting clinical prognosis of a pathology characterized by an increased or decreased level of a PAAD domain-containing polypeptide in a subject. The method includes the steps of (a) obtaining a test sample from the subject; (b) contacting the sample with an agent that can bind a PAAD domain-containing polypeptide of the invention under suitable conditions, wherein the conditions allow specific binding of the agent to the PAAD domain-containing polypeptide; and (c) comparing the amount of the specific binding in the test sample with the amount of specific binding in a reference sample, wherein an increased or decreased amount of the specific binding in the test sample as compared to the reference sample is diagnostic of, or predictive of the clinical prognosis of, a pathology. The agent can be, for example, an anti-PAAD antibody, a PAAD-associated-polypeptide (PAP), or a PAAD domain encoding nucleic acid.

[0237] Exemplary pathologies for diagnosis or the prediction of clinical prognosis include any of the pathologies described herein, such as neoplastic pathologies (e.g. cancer), autoimmune diseases, and other pathologies related to abnormal cell proliferation or abnormal cell death (e.g. apoptosis), as disclosed herein.

[0238] The invention also provides a method of diagnosing cancer or monitoring cancer therapy by contacting a test sample from a patient with a PAAD domain specific antibody. The invention additionally provides a method of assessing prognosis (e.g., predicting the clinical prognosis) of patients with cancer comprising contacting a test sample from a patient with a PAAD domain specific antibody.

[0239] The invention additionally provides a method of diagnosing cancer or monitoring cancer therapy by contacting a test sample from a patient with a oligonucleotide that selectively hybridizes to a PAAD domain encoding nucleic acid molecule. The invention further provides a method of assessing prognosis (e.g., predicting the clinical prognosis) of patients with cancer by contacting a test sample from a patient with a oligonucleotide that selectively hybridizes to a PAAD domain encoding nucleic acid molecule.

[0240] The methods of the invention for diagnosing cancer or monitoring cancer therapy using a PAAD domain specific antibody or oligonucleotide or nucleic acid that selectively hybridizes to a PAAD domain encoding nucleic acid molecule can be used, for example, to segregate patients into a high risk group or a low risk group for diagnosing cancer or predicting risk of metastasis or risk of failure to respond to therapy. Therefore, the methods of the invention can be advantageously used to determine, for example, the risk of metastasis in a cancer patient, or the risk of an autoimmune disease of a patient, or as a prognostic indicator of survival or disease progression in a cancer patient or patient with an autoimmune disease. One of ordinary skill in the art would appreciate that the prognostic indicators of survival for cancer patients suffering from stage I cancer can be different from those for cancer patients suffering from stage IV cancer. For example, prognosis for stage I cancer patients can be oriented toward the likelihood of continued growth and/or metastasis of the cancer, whereas prognosis for stage IV cancer patients can be oriented toward the likely effectiveness of therapeutic methods for treating the cancer. Accordingly, the methods of the invention directed to measuring the level of or determining the presence of a PAAD domain-containing polypeptide or PAAD domain encoding nucleic acid can be used advantageously as a prognostic indicator for the presence or progression of a cancer or response to therapy.

[0241] The invention further provides methods for introducing a PAAD domain encoding nucleic acid into a cell in a subject, for example, for gene therapy. Viruses are specialized infectious agents that can elude host defense mechanisms and can infect and propagate in specific cell types. Viral based systems provide the advantage of being able to introduce relatively high levels of the heterologous nucleic acid into a variety of cells. Suitable viral vectors for introducing an invention PAAD domain encoding nucleic acid into mammalian cells (e.g., vascular tissue segments) are well known in the art.

[0242] The present invention also provides therapeutic compositions useful for practicing the therapeutic methods described herein. Therapeutic compositions of the present invention, such as pharmaceutical compositions, contain a physiologically compatible carrier together with an invention PAAD domain-containing polypeptide (or functional fragment thereof), an invention PAAD domain encoding nucleic acid, an agent that alters PAAD activity or expression identified by the methods described herein, or an anti-PAAD antibody, as described herein, dissolved or dispersed therein as an active ingredient. In a preferred embodiment, the therapeutic composition is not immunogenic when administered to a mammal or human patient for therapeutic purposes.

[0243] As used herein, the terms "pharmaceutically acceptable", "physiologically compatible" and grammatical variations thereof, as they refer to compositions, carriers, diluents and reagents, are used interchangeably and represent that the materials are capable of administration to a mammal without the production of undesirable physiological effects such as nausea, dizziness, gastric upset, and the like.

[0244] The preparation of a pharmacological composition that contains active ingredients dissolved or dispersed therein is well known in the art. Typically such compositions are prepared as injectables either as liquid solutions or suspensions; however, solid forms suitable for solution, or suspension, in liquid prior to use can also be prepared. The preparation can also be emulsified.

[0245] The active ingredient can be mixed with excipients which are pharmaceutically acceptable and compatible with the active ingredient in amounts suitable for use in the therapeutic methods described herein. Suitable excipients are, for example, water, saline, dextrose, glycerol, ethanol, or the like, as well as combinations of any two or more thereof. In addition, if desired, the composition can contain minor amounts of auxiliary substances such as wetting or emulsifying agents, pH buffering agents, and the like, which enhance the effectiveness of the active ingredient.

[0246] Physiologically tolerable carriers are well known in the art. Exemplary liquid carriers are sterile aqueous solutions that contain no materials in addition to the active ingredients and water, or contain a buffer such as sodium phosphate at physiological pH, physiological saline or both, such as phosphate-buffered saline. Still further, aqueous carriers can contain more than one buffer salt, as well as salts such as sodium and potassium chlorides, dextrose, polyethylene glycol and other solutes.

[0247] As described herein, an "effective amount" is a predetermined amount calculated to achieve the desired therapeutic effect, i.e., to alter the protein binding activity of a PAAD domain-containing polypeptide or the catalytic activity of a PAAD domain-containing polypeptide, resulting in altered biochemical process modulated by a PAAD domain-containing polypeptide. The required dosage will vary with the particular treatment and with the duration of desired treatment; however, it is anticipated that dosages between about 10 micrograms and about 1 milligram per kilogram of body weight per day will be used for therapeutic treatment. It may be particularly advantageous to administer such agents in depot or long-lasting form as discussed herein. A therapeutically effective amount is typically an amount of an agent identified herein that, when administered in a physiologically acceptable composition, is sufficient to achieve a plasma concentration of from about 0.1 μg/ml to about 100 μg/ml, preferably from about 1.0 μg/ml to about 50 μg/ml, more preferably at least about 2 μg/ml and usually 5 to 10 μg/ml. Therapeutic invention anti-PAAD antibodies can be administered in proportionately appropriate amounts in accordance with known practices in this art.

[0248] Also provided herein are methods of treating pathologies characterized by abnormal cell proliferation, abnormal cell death, or inflammation said method comprising administering an effective amount of an invention therapeutic composition. Such compositions are typically administered in a physiologically compatible composition.

[0249] Exemplary abnormal cell proliferation diseases associated with PAAD domain-containing polypeptides contemplated herein for treatment according to the present invention include cancer pathologies, keratinocyte hyperplasia, neoplasia, keloid, benign prostatic hypertrophy, inflammatory hyperplasia, fibrosis, smooth muscle cell proliferation in arteries following balloon angioplasty (restenosis), and the like. Exemplary cancer pathologies contemplated herein for treatment include, gliomas, carcinomas, adenocarcinomas, sarcomas, melanomas, hamartomas, leukemias, lymphomas, and the like. Further diseases associated with PAAD domain-containing polypeptides contemplated herein for treatment according to the present invention include inflammatory diseases and diseases of cell loss. Such diseases include allergies, inflammatory diseases including arthritis, lupus, Schrogen's syndrome, Crohn's disease, ulcerative colitis, as well as allograft rejection, such as graft-versus-host disease, and the like. PAAD domain-containing polypeptides can also be useful in design of strategies for preventing diseases related to abnormal cell death in conditions such as stroke, myopyrinial infarction, heart failure, neurodegenerative diseases such as Parkinson's and Alzheimer's diseases, and for immunodeficiency associated diseases such as HIV infection, HIV-related disease, and the like.

[0250] Methods of treating pathologies can include methods of modulating the activity of one or more oncogenic proteins, wherein the oncogenic proteins specifically interact with a PAAD domain-containing polypeptide of the invention. Methods of modulating the activity of such oncogenic proteins will include contacting the oncogenic protein with a substantially pure PAAD domain-containing polypeptide or an active fragment (i.e., oncogenic protein-binding fragment) thereof. This contacting will alter the activity of the oncogenic protein, thereby providing a method of treating a pathology caused by the oncogenic protein. Further methods of modulating the activity of oncogenic proteins will include contacting the oncogenic protein with an agent, wherein the agent alters interaction between a PAAD domain-containing polypeptide and an oncogenic protein.

[0251] Also contemplated herein, are therapeutic methods using invention pharmaceutical compositions for the treatment of pathological disorders in which there is too little cell division, such as, for example, bone marrow aplasias, immunodeficiencies due to a decreased number of lymphocytes, and the like. Methods of treating a variety of inflammatory diseases with invention therapeutic compositions are also contemplated herein, such as treatment of sepsis, fibrosis (e.g., scarring), arthritis, graft versus host disease, and the like.

[0252] The present invention also provides methods for diagnosing a pathology that is characterized by an increased or decreased level of a biochemical process to determine whether the increased or decreased level of the biochemical process is due, for example, to increased or decreased expression of a PAAD domain-containing polypeptide or to expression of a variant PAAD domain-containing polypeptide. As disclosed herein, such biochemical processes include apoptosis, NFκB induction, cytokine processing, caspase-mediated proteolysis, transcription, inflammation, cell adhesion, and the like. The identification of such a pathology, which can be due to altered association of a PAAD domain-containing polypeptide with a PAAD-associated polypeptide in a cell, or altered ligand binding or catalytic activity of a PAAD domain-containing polypeptide, can allow for intervention therapy using an effective agent or a nucleic acid molecule or an antisense or dsRNA nucleotide sequence as described herein. In general, a test sample can be obtained from a subject having a pathology characterized by having or suspected of having increased or decreased apoptosis and can be compared to a reference sample from a normal subject to determine whether a cell in the test sample has, for example, increased or decreased expression of a PAAD domain encoding gene. The level of a PAAD domain-containing polypeptide in a cell can be determined by contacting a sample with a reagent such as an anti-PAAD antibody or a PAAD-associated polypeptide, either of which can specifically bind a PAAD domain-containing polypeptide. For example, the level of a PAAD domain-containing polypeptide in a cell can determined by well known immunoassay or immunohistochemical methods using an anti-PAAD antibody (see, for example, Reed and Godzik et al., Anal. Biochem. 205:70-76 (1992); see, also, Harlow and Lane, supra, (1988)). As used herein, the term "reagent", means a chemical or biological molecule that can specifically bind to a PAAD domain-containing polypeptide or to a bound PAAD/PAAD-associated polypeptide complex. For example, either an anti-PAAD antibody or a PAAD-associated polypeptide can be a reagent for a PAAD domain-containing polypeptide, whereas either an anti-PAAD antibody or an anti-PAAD-associated polypeptide antibody can be a reagent for a PAAD:PAAD-associated polypeptide complex.

[0253] As used herein, the term "test sample" means a cell or tissue specimen that is obtained from a subject and is to be examined for expression of a PAAD domain encoding gene in a cell in the sample. A test sample can be obtained, for example, during surgery or by needle biopsy and can be examined using the methods described herein to diagnose a pathology characterized by increased or decreased apoptosis. Increased or decreased expression of a PAAD domain encoding gene in a cell in a test sample can be determined, for example, by comparison to an expected normal level of PAAD domain-containing polypeptide or PAAD domain encoding mRNA in a particular cell type. A normal range of PAAD domain-containing polypeptide or PAAD domain encoding mRNA levels in various cell types can be determined by sampling a statistically significant number of normal subjects. In addition, a reference sample can be evaluated in parallel with a test sample in order to determine whether a pathology characterized by increased or decreased apoptosis is due to increased or decreased expression of a PAAD domain encoding gene. The test sample can be examined using, for example, immunohistochemical methods as described above or the sample can be further processed and examined. For example, an extract of a test sample can be prepared and, examined to determine whether a PAAD domain-containing polypeptide in the sample can associate with a PAAD-associated polypeptide in the same manner as a PAAD domain containing polypeptide from a reference cell or whether, instead, a variant PAAD domain-containing polypeptide is expressed in the cell.

[0254] In accordance with another embodiment of the present invention, there are provided diagnostic systems, preferably in kit form, comprising at least one invention PAAD domain encoding nucleic acid, PAAD domain-containing polypeptide, and/or anti-PAAD antibody described herein, in a suitable packaging material. In one embodiment, for example, the diagnostic nucleic acids are derived from any of SEQ ID NOS:15, 17, 19, 21, 23, 25 or 27, or SEQ ID NOs:65, 67, 69, 71, 73, 75 or 83, or their complements. Invention diagnostic systems are useful for assaying for the presence or absence of PAAD domain encoding nucleic acid in either genomic DNA or in transcribed PAAD domain encoding nucleic acid, such as mRNA or cDNA.

[0255] A suitable diagnostic system includes at least one invention PAAD domain encoding nucleic acid, PAAD domain-containing polypeptide, and/or anti-PAAD antibody, preferably two or more invention nucleic acids, proteins and/or antibodies, as a separately packaged chemical reagent(s) in an amount sufficient for at least one assay. Instructions for use of the packaged reagent are also typically included. Those of skill in the art can readily incorporate invention nucleic acid probes and/or primers into kit form in combination with appropriate buffers and solutions for the practice of the invention methods as described herein.

[0256] As employed herein, the phrase "packaging material" refers to one or more physical structures used to house the contents of the kit, such as invention nucleic acid probes or primers, and the like. The packaging material is constructed by well known methods, preferably to provide a sterile, contaminant-free environment. The packaging material has a label which indicates that the invention nucleic acids can be used for detecting a particular PAAD domain encoding sequence including the nucleotide sequences set forth in SEQ ID NOs:15, 17, 19, 21, 23, 25 or 27, or in SEQ ID NOs:65, 67, 69, 71, 73, 75 or 83, or the complement thereof, or mutations or deletions therein, thereby diagnosing the presence of, or a predisposition for a pathology such as cancer or an autoimmune disease. In addition, the packaging material contains instructions indicating how the materials within the kit are employed both to detect a particular sequence and diagnose the presence of, or a predisposition for a pathology such as cancer or an autoimmune disease.

[0257] The packaging materials employed herein in relation to diagnostic systems are those customarily utilized in nucleic acid-based diagnostic systems. As used herein, the term "package" refers to a solid matrix or material such as glass, plastic, paper, foil, and the like, capable of holding within fixed limits an isolated nucleic acid, oligonucleotide, or primer of the present invention. Thus, for example, a package can be a glass vial used to contain milligram quantities of a contemplated nucleic acid, oligonucleotide or primer, or it can be a microtiter plate well to which microgram quantities of a contemplated nucleic acid probe have been operatively affixed.

[0258] "Instructions for use" typically include a tangible expression describing the reagent concentration or at least one assay method parameter, such as the relative amounts of reagent and sample to be admixed, maintenance time periods for reagent/sample admixtures, temperature, buffer conditions, and the like.

[0259] A diagnostic assay should include a simple method for detecting the amount of a PAAD domain-containing polypeptide or PAAD domain encoding nucleic acid in a sample that is bound to the reagent. Detection can be performed by labeling the reagent and detecting the presence of the label using well known methods (see, for example, Harlow and Lane, supra, 1988; chap. 9, for labeling an antibody). A reagent can be labeled with various detectable moieties including a radiolabel, an enzyme, biotin or a fluorochrome. Materials for labeling the reagent can be included in the diagnostic kit or can be purchased separately from a commercial source. Following contact of a labeled reagent with a test sample and, if desired, a control sample, specifically bound reagent can be identified by detecting the particular moiety.

[0260] A labeled antibody that can specifically bind the reagent also can be used to identify specific binding of an unlabeled reagent. For example, if the reagent is an anti-PAAD antibody, a second antibody can be used to detect specific binding of the anti-PAAD antibody. A second antibody generally will be specific for the particular class of the first antibody. For example, if an anti-PAAD antibody is of the IgG class, a second antibody will be an anti-IgG antibody. Such second antibodies are readily available from commercial sources. The second antibody can be labeled using a detectable moiety as described above. When a sample is labeled using a second antibody, the sample is first contacted with a first antibody, then the sample is contacted with the labeled second antibody, which specifically binds to the first antibody and results in a labeled sample.

[0261] All patents, publications and database sequences mentioned herein are incorporated in their entirety by reference thereto. The invention will now be described in greater detail by reference to the following non-limiting examples.

EXAMPLES

1.0 Identification of PAAD Domain-Containing Polypeptides

[0262] The sequence of the N-terminal 100 amino acid fragment of the pyrin protein (Genbank Accession #NP00234; Pras, 1998, Scand. J. Rheumatol., 27:92-97) was used to perform a cascade of PSI-BLAST searches until no new hits were found. Lower significance hits from this procedure (called Saturated BLAST) were confirmed using the profile-to-profile alignment algorithm FFAS (Rychlewski et al., 2000, Protein Science 9:232-241) against a library of apoptosis-related domains. Proteins suspected of having a PAAD domain were added to the Saturated BLAST and FFAS databases and the FFAS similarity score was used to accept or reject the putative PAAD domains. Most of the proteins identified in FIGS. 1 and 2 could be connected with each other with PSI-BLAST significance better than 0.001 and/or the FFAS Z-score better than 10. The weakest link in the chain is the connection between the AIM2/IFI16 branch and the rest of the family (pyrin/ASC/caspase/NAC), with 0.05 PSI-BLAST E-value and FFAS Z-score of 8. The latter value was independently verified on a protein structure benchmark to give a correct match in more than 99% of cases (Rychlewski et al. supra). The same link was also confirmed by independent application of the Gibbs sampling algorithm (Lawrence, C. et al. (1993) Science 262:208-14), where sequence patterns identified in the pyrin/ASC/caspase branch of the family could be consistently used to find the AIM2/IFI16 group, albeit with low significance. In accordance with the present invention, this Saturated BLAST procedure resulted in the identification of several putative PAAD homologues in the unfinished nucleotide databases.

[0263] The process of gene identification and assembling include the following steps:

A) Identification of new candidate PAAD containing polypeptides. A iterative database search was performed using the TBLASTN program with the PAAD domain of pyrin and all other identified PAAD domains as the query in the following NCBI databases: high throughput genome sequence (HTGS), genomic survey sequence (GSS) and expressed sequence tag (EST) databases. B) Verification that the new candidate PAAD domain-containing polypeptide is novel. Using PSI-BLAST, each new candidate PAAD domain gene was queried in the annotated non-redundant (NR) database at NCBI. When the new candidate gene showed significant but not identical homology with other known PAAD domain-containing polypeptides during this search, the PAAD domain-containing polypeptide candidate was kept for further analysis. C) 3-O-Model Building of new candidate PAAD domain polypeptide: When the sequence homology was low (<25% identity), three-dimensional criteria was added to characterization of new PAAD domain-containing polypeptides. The candidate PAAD domain fragment was analyzed by a profile-profile sequence comparison method which aligns the candidate PAAD domain with a database of sequences of known three-dimensional structure. From this analysis, a sequence alignment was produced and a model three-dimensional structure was built using DD, DED and CARD domains as templates. In most cases, the best score was produced using PAAD domain sequences having known three-dimensional structures. The quality of the three-dimensional model obtained from the alignments confirmed that novel PAAD domain-containing polypeptides had been identified. D) Identification of additional domains in the full length protein. Full length protein sequences were obtained using the new PAAD domain identified in step B as query. TBLASTN searches of the sequences containing the newly identified PAAD domains were performed. Longer aligned fragments or multiple aligned fragments in the accession number corresponding to the newly identified PAAD domain-containing polypeptides indicated a longer PAAD domain-containing protein. E) These additional domains were assembled using the following gene building procedure:

[0264] Genomic DNA fragments identified by T-BLAST-N analysis were extended and identified using intron/exon prediction programs, such as Genescan, GRAIL, ORF-find, and the like; searching in both directions until start and stop codons were identified.

2.0 Identification of PAAD Domain-Containing Polypeptides PAN2-6, Pyrin2 and ASC2

[0265] Nucleic acids encoding PAAD domain-containing proteins corresponding to PAN2, PAN3, PAN4, PAN5, PAN6, Pyrin2, ASC2, PAN7, PAN8, PAN9 and PAN10 were identified from different PAAD domain queries using tblastn and systematically scanning gss, htgs, and all EST databases at NCBI. Further analysis using translated genomic fragments containing PAAD domains, which fragments were larger than the PAAD domain itself as query, were performed to identify additional domains. Genomic DNA were translated in all reading frames and examined for additional domains using psi-blast and nr database. Using this strategy, additional domains of PAAD domain-containing polypeptides, including a NB-ARC (NACHT) domain, LRR repeat and ANGIO-R CARED) domain, were identified.

3.0 Cloning and Sequencing of Large cDNA

[0266] For cDNA larger than 1500 bp, cloning is accomplished by amplification of multiple fragments of the cDNA. Jurkat total RNA is reverse-transcribed to complementary DNAs using MMLV reverse transcriptase (Stratagene) and random hexanucleotide primers. Overlapping cDNA fragments of a PAAD domain-containing polypeptide are amplified from the Jurkat complementary DNAs with Turbo Pfu DNA polymerase (Stratagene) using an oligonucleotide primer set for every 1500 bp of cDNA, where the amplified cDNA fragment contains a unique restriction site near the end that is to be ligated with an adjacent amplified cDNA fragment.

[0267] The resultant cDNA fragments are ligated into mammalian expression vector pcDNA-myc (Invitrogen, modified as described in Roy et al., EMBO J. 16:6914-6925 (1997)) and assembled to full-length cDNA by consecutively ligating adjacent fragments at the unique endonuclease sites form the full-length cDNA. Sequencing analysis of the assembled full-length cDNA is carried out, and splice isoforms of PAAD domain-containing polypeptides can be identified.

4.0 Plasmid Constructions

[0268] Complementary DNA encoding a PAAD domain-containing polypeptide, or a functional fragment thereof is amplified from Jurkat cDNAs with Turbo Pfu DNA polymerase (Stratagene) and desired primers, such as those described above. The resultant PCR fragments are digested with restriction enzymes such as EcoRI and Xho I and ligated into pGEX-4T1 (Pharmacia) and pcDNA-myc vectors.

5.0 In Vitro Protein Binding Assays

[0269] PAAD domain-containing or fragments thereof encoded in pGEX-4T1 are expressed in XL-1 blue E. coli cells (Stratagene), and affinity-purified using glutathione (GSH)-sepharose according to known methods, such as those in Current Protocols in Molecular Biology, Ausubel et al. eds., John Wiley and Sons (1999). For GST pull-down assays, purified PAAD domain GST fusion proteins and GST alone (0.1-0.5 μg immobilized on 10-15 μl GSH-sepharose beads) are incubated with 1 mg/ml of BSA in 100 μl Co-IP buffer [142.4 mM KCl, 5 mM M_gCl₂, 10 mM HEPES (pH 7.4), 0.5 mM EGTA, 0.2% NP-40, 1 mM DTT, and 1 mM PMSF] for 30 min. at room temperature. The beads are then incubated with 1 μl of rat reticulocyte lysates (TnT-lysate; Promega, Inc.) containing ³⁵S-labeled, in vitro translated PAAD domain-containing or control protein Skp-1 in 100 μl Co-IP buffer supplemented with 0.5 mg/ml BSA for overnight at 4° C. The beads are washed four times in 500 μl Co-IP buffer, followed by boiling in 20 μl Laemmli-SDS sample buffer. The eluted proteins are analyzed by SDS-PAGE. The bands of SDS-PAGE gels are detected by fluorography.

[0270] The resultant oligomerization pattern will reveal that PAAD:PAAD and other protein:protein interactions occur with invention PAAD domain-containing polypeptides PAN2 through PAN6, PAN7, PAN8, PAN9 and PAN10 and the like) or fragments thereof.

[0271] In vitro translated candidate PAAD-associated polypeptides, along with a control, are subjected to GST pull-down assay using GSH-sepharose beads conjugated with GST and GST-PAAD domain-containing polypeptides as described above. Lanes containing GST-PAAD domain yield positive binding signals when incubated with a PAAD-associated polypeptide selected from Apaf-1, CED4, Nod1/CARD4, ASC-1, CARDX1, pro-Casp1, pro-Casp2, pro-Casp4, pro-Casp5, pro-Casp7, pro-Casp11, pro-Casp12, pro-Casp14, CED3, Dronc, Raidd/CRADD, Cardiak Rick), Bcl-1/CIPER, ARC, NOP30, cIAP-1, cIAP-2, Fadd/mort1, pro-Casp8, pro-Casp10, Dredd, c-Flip/flame, KSV/V-Flip, MCV, DEDD/DEFT, PEA-15, Flash, BAP31, BAR, RIP, IRAK-1, IRAK-2, IRAK-M, My D88, NMP-84, Ankyrin-1, Ankyrin-3, TNFR1, NGFR, Fas, DR3, DR4, DR5, DR6, Tradd, Fadd, Raidd2, DAP Kinase, NIK, IKKα, IKKβ, IκB, p65, p50, IKAP, pyrin, pyrin2, PAN1, PAN2, PAN3, PAN4, PAN5, PAN6, PAN7, PAN8, PAN9, PAN10, FLJ20510_human, PANunk_mouse, NALP3/cryopyrin, NALP1/NAC, PAN5_mouse, RAN4_CT, PAN2_mouse, ASC, ASC2, NAC, AIM2, IFI16, MO13L, p52, p100, p105, ParaCaspase (MALT1), and all members of the NFκB/IκB families, whereas, the controls GST alone and Skp-1 yield negligible signals.

6.0 Self-Association of NB-ARC (NACHT) Domain of PAAD Domain-Containing Polypeptides

[0272] In vitro translated, ³⁵S-labeled rabbit reticulocyte lysates (1 μl) containing an NB-ARC (NACHT) domain of an invention PAN protein or a control protein, such as SKP-1, are incubated with GSH-sepharose beads conjugated with purified GST-NB-ARC or GST alone for GST pull-down assay, resolved on SDS-PAGE and visualized by fluorography as described above. One tenth of input is loaded for NB-ARC (NACHT) or Skp-1 as controls. The results indicate that the NB-ARC (NACHT) domains of invention proteins can self-associate by binding through the NB-ARC (NACHT) domains.

7.0 Protein-Protein Interactions of PAAD Domain-Containing Polypeptides

[0273] Transient transfections of 293T, a human embryonic kidney fibroblast cell line, are conducted using SuperFect reagents (Qiagen) according to manufacturer's instructions. 293T cells are transiently transfected with an expression plasmid (2 μg) encoding HA-tagged Apaf-1, CED4, Nod1/CARD4, ASC-1, CARDX1, pro-Casp1, pro-Casp2, pro-Casp4, pro-Casp5, pro-Casp7, pro-Casp11, pro-Casp12, pro-Casp14, CED3, Dronc, Raidd/CRADD, Cardiak (RIP2, Rick), Bcl-1/CIPER, ARC, NOP30, cIAP-1, cIAP-2, Fadd/mort1, pro-Casp8, pro-Casp10, Dredd, c-Flip/flame, KSV/V-Flip, MCV, DEDD/DEFT, PEA-15, Flash, BAP31, BAR, RIP, IRAK-1, IRAK-2, IRAK-M, My D88, NMP-84, Ankyrin-1, Ankyrin-3, TNFR1, NGFR, Fas, DR3, DR4, DR5, DR6, Tradd, Fadd, Raidd2, DAP Kinase, NIK, IKKα, IKKβ, IκB, p65, p50, IKAP, pyrin, pyrin2, PAN1, PAN2, PAN3, PAN4, PAN5, PANG, PAN7, PAN8, PAN9, PAN10, FLJ20510 human, PANunk_mouse, NALP3/cryopyrin, NALP1/NAC, PANS mouse, PAN4 CT, PAN2 mouse, ASC, ASC2, NAC, AIM2, IFI16, MO13L, p52, p100, p105, ParaCaspase (MALT1), and all members of the NFκB/IκB families, or the like, in the presence or absence of a plasmid (2 μg) encoding a myc-tagged PAAD domain-containing polypeptide. After 24 hr growth in culture, transfected cells are collected and lysed in Co-IP buffer [142.4 mM KCl, 5 mM MgCl₂, 10 mM HEPES (pH 7.4), 0.5 mM EGTA, 0.1% NP-40, and 1 mM DTT] supplemented with 12.5 mM β-glycerolphosphate, 2 mM NaF, 1 mM Na₃VO₄, 1 mM PMSF, and 1× protenase inhibitor mix (Boehringer Mannheim). Cell lysates are clarified by microcentrifugation and subjected to immunoprecipitation using either a mouse monoclonal antibody to myc (Santa Cruz Biotechnologies, Inc) or a control mouse. IgG. Proteins from the immune complexes are resolved by SDS-PAGE, transferred to nitrocellulose membranes, and subjected to immunoblot analysis using anti-HA antibodies followed by anti-myc antibodies using a standard Western blotting procedure and ECL reagents from Amersham-Pharmacia Biotechnologies, Inc. (Krajewski et al., Proc. Natl. Acad. Sci. USA 96:5752-5757 (1999)).

[0274] The results indicate that invention PAAD domain-containing polypeptides can bind to themselves (e.g., homodimers, and the like) and to one or more polypeptides selected from Apaf-1, CED4, Nod1/CARD4, ASC-1, CARDX1, pro-Casp1, pro-Casp2, pro-Casp4, pro-Casp5, pro-Casp7, pro-Casp11, pro-Casp12, pro-Casp14, CED3, Dronc, Raidd/CRADD, Cardiak (RIP2, Rick), Bcl-1/CIPER, ARC, NOP30, cIAP-1, cIAP-2, Fadd/mort1, pro-Casp8, pro-Casp10, Dredd, c-Flip/flame, KSV/V-Flip, MCV, DEDD/DEFT, PEA-15, Flash, BAP31, BAR, RIP, IRAK-1, IRAK-2, IRAK-M, My D88, NMP-84, Ankyrin-1, Ankyrin-3, TNFR1, NGFR, Fas, DR3, DR4, DR5, DR6, Tradd, Fadd, Raidd2, DAP Kinase, NIK, IKKα, IKKβ, IκB, p65, p50, IKAP, pyrin, pyrin2, PAN1, PAN2, PAN3, PAN4, PAN5, PAN6, PANT, PAN8, PANS, PAN10, FLJ20510_human, PANunk_mouse, NALP3/cryopyrin; NALP1/NAC, PAN5_mouse, PAN4_CT, PAN2_mouse, ASC, ASC2, NAC, AIM2, IFI16, MO13L, p52, p100, p105, ParaCaspase (MALT1), and all members of the NFκB/IκB families.

8.0 Cloning and Characterization of PAN2

[0275] As a first step in cloning PAN2 cDNA, RT-PCR was performed on total RNA from HeLa cells using oligo dT to prime the first-strand synthesis and then 2 PAN2-specific primers designated Pant/5': 5', --CCGGAATTCACCATGGCAGCCTCTTTCTTCTCTGATTTT-3' (SEQ ID NO:35) and Pant/3': 5'-CCGCTCGAGTCACGTAGAGCTGTGTTCATCCTCTTTCTTAA-3' (SEQ ID NO:36). These primers were designed based on the predicted PAN2 open reading frame identified in the genomic sequence AC022066 on chromosome 19, as described in Example 2.0. The ATG of PAN2 and an artificial stop codon inserted after amino acid 620 are underlined in SEQ ID NOS:35 and 36, respectively. EcoRI and XhoI restriction sites are shown in italics in SEQ ID NOS:35 and 36, respectively. The resulting PCR product was cloned into a pcDNA3Myc expression vector at the EcoRI(5') and XhoI(3'), and sequenced.

[0276] A BLAST search of the human EST database was then performed using the partial PAN2 sequence. Several EST clones were identified, and several corresponding I.M.A.G.E. Consortium cDNA clones (Lennon et al., Genomics 33; 151-152 (1996)) were obtained. I.M.A.G.E. Consortium CloneID 3139498, corresponding to EST GenBank Accession Number BE278926, was sequenced and determined to contain full-length PAN2 cDNA, including the stop codon, the 3' UTR of the gene and the poly-A tail.

[0277] The complete coding sequence of PAN2 was cloned by PCR from I.M.A.G.E. Consortium CloneID 3139498 by PCR, using as the 5' primer SEQ ID NO:35 and as the 3' primer Pan2STOP4: 5'-CCTCTCGAGTCAGATCTCTACCCTTGTGATTGTGTCAC-3' (SEQ ID NO:40). The PAN2 cDNA was independently amplified from HeLa cells using overlapping primers to confirm that the I.M.A.G.E. clone contained an intact, single cDNA. The PAN2 cDNA coding sequence (SEQ ID NO:15) is 2985 nucleotides and encodes an amino acid sequence (SEQ ID NO:16) of 995 amino acids.

[0278] The PAN2 gene spans 30 kbp on chromosome 19, and contains at least 10 exons, including 9 coding and at least 1 non-coding exon.

[0279] Several domains within PAN2 were identified, based on homology with known proteins. The PAAD domain (SEQ ID NO:2) corresponds to amino acids 14-89 of SEQ ID NO:16. The nucleotide-binding domain (NB-ARC) (SEQ ID NO:37) corresponds to amino acids 147-336 of SEQ ID NO:16. The Angiotensin receptor-like domain (AR-like or ARED domain) (SEQ ID NO:38) corresponds to amino acids 465-605 of SEQ ID NO:16. The Leucine rich region (LRR) (SEQ ID NO:39) corresponds to amino acids 620-995 of SEQ ID NO:16, or alternatively amino acids 604-995.

[0280] Expression of PAN2 in human tissues was determined using a panel of Clontech (Palo Alto, Calif.) first-strand cDNAs to amplify a region of PAN2 corresponding to the NB-ARC (NACHT) domain (amino acids 147-465), following manufacturer's recommended procedures. PAN2 was found to be expressed in several human tissues, including placenta, lung, liver, muscle, kidney, pancreas, spleen, thymus, prostate, testis and ovary.

[0281] In order to determine whether the PAAD domain of PAN2 is able to self-associate, fusions of the PAN2 PAAD domain (amino acids 1-89 of SEQ ID NO:16) and PAN2(1-620) (amino acids 1-620 of SEQ ID NO:16) with glutathione-S-transferase (GST) were constructed, expressed in bacteria and attached to glutathione beads. The GST fusion proteins were used to pull down in vitro-translated PAN2 PAAD or PAN2(1-620). GST alone and GST-CD40 were used as controls. The PAAD domain of PAN2 was determined not to self-associate or to associate with PAN2. However, PAN2(1-620) was determined to self-associate, likely through its NB-ARC (NACHT) domain. Therefore, the PAAD domain is likely not involved in PAN2/PAN2 interactions.

[0282] The effect of expression of the PAN2 PAAD domain on NF-κB activation by the TNFα pathway and the IL-1β pathway were assessed as follows. 10,000 293N cells were seeded into 96-well plates and cells were transfected the following day using SuperFect® transfection reagent (Qiagen, Venlo, The Netherlands) with 10 ng of pNFκB-luc and 2.5 ng of thymidine kinase promoter-Renilla luciferase (pRL-TK) reporter vectors (Stratagene, San Diego, Calif.), together with 100 ng of plasmids encoding proteins in the TNF-α pathway (pCMV TNFR1, pcDNA3 Traf2 or pcDNA3HA RIP) or in the IL-1β pathway (pCMVFlag IL-1R, pcDNA3His MyD88, pcDNA3HA IRAK3 or pcDNA3HA Traf6), and either 400 ng of pcDNA3Myc ("Empty") or 400 ng of pcDNA3Myc PAAD 1-89 ("PAAD"). After 36 hours, cells were harvested and luciferase activities were determined using the Dual Luciferase. System (Promega, Madison, Wis.).

[0283] The results of the luciferase assays for cells transfected with molecules in the TNFα pathway are shown in Table 1, below. For the "TNFα" condition', cells were stimulated with 10 ng TNFα for 6-8 hours prior to lysis. The numbers indicate the fold induction of NFκB activity.

TABLE-US-00004 TABLE 1 TNFR1 TNFα TRAF2 RIP EMPTY 20.04 21.05 33.53 53.93 PAAD2 19.62 7.14 15.75 23.51

[0284] The results of the luciferase assays for cells transfected with molecules in the IL-1β pathway are shown in Table 2, below. The numbers indicate the fold induction of NFκB activity.

TABLE-US-00005 TABLE 2 IL1R MyD88 IRAK2 TRAF6 EMPTY 6 28.16 10.27 28.17 PAAD2 4.27 21.23 4.58 20.41

[0285] The results of the NFκB activation assays shown in Tables 1 and 2 indicate that expression of the PAAD domain of PAN2 significantly inhibits NFκB activation by either the TNFα or the IL-113 pathway.

[0286] Expression of full-length PAN2 was also demonstrated to inhibit NFκB activation by either the TNFα or the IL-1β pathway. At the same DNA concentration, the inhibition of NFκB activation following transfection with pcDNA3Myc PAN2 was almost the same as the extent of inhibition following transfection with pcDNA3Myc PAAD 1-89. It was concluded that inhibition of NFκB activation by PAN2 was mediated by the PAAD domain.

[0287] To determine whether the observed reduction in NFκB activity correlated with reduced NFκB DNA-binding activity in PAN2 over-expressing cells, an electro-mobility shift assay (EMSA) was performed using a ³²P-labeled double strand DNA oligonucleotide encompassing NFκB binding sites. Nuclear extracts were prepared from cells that had been stably transfected with either control or PAN2-encoding plasmids, then stimulated with TNFα. Incubation of the nuclear extracts with ³²P-labeled NFκB probe then permitted measurements of the relative levels of the NFκB DNA binding activity. The results indicated that TNFα stimulated increases in NFκB DNA-binding activity in control transfected cells. In contrast, NFκB DNA-binding activity was markedly reduced in cells stably over-expressing PAN2. Incubating the protein/DNA complexes with antibodies recognizing various members of the Rel/NFκB family of transcription factors provided evidence that p50 and p65 subunits of NFκB are included in the DNA/protein complexes, producing a super-shift effect in EMSAs. From these experiments it was concluded that PAN2 inhibits the induction NFκB DNA-binding activity by TNFα.

[0288] In order to determine whether PAN2 affects activation of NFκB mediated by upstream components in the NFκB activation pathway, plasmids encoding either NIK (pCMV-NIK), IKKα (pRE-HA-IKKα) or IKKβ (pRE-HA-IKKβ) were co-transfected into 293N cells as described above with from long to 300 ng of pcDNA3Myc PAN2 or with empty Vector, together with 10 ng of pNFκB-luc and 2.5 ng of pTK-RL. Luciferase activities determined as described above. As shown in FIG. 5, PAN2 expression dose-dependently blocked the activation of NFκB mediated by either N1K, IKKα or IKKβ. Therefore, PAN2 acts downstream of the IκB kinase complex.

[0289] The effect of PAN2 on the activity of IKKα was also assessed, using in vitro kinase assays. For these experiments, HEK293 cells were transiently transfected with plasmids encoding epitope-tagged either IKKα or IKKβ together with either a control or various amounts of a PAN2-encoding plasmid. After 36 h, cells were left untreated or stimulated with TNFα for 15 minutes, then cell lysates were prepared and either IKKα or IKKβ was immunoprecipitated. The resulting immunoprecipitates were then employed for in vitro kinase assays, where they were incubated with the exogenous substrate (GST-IκB 1-54) in the presence of ³²P γ-ATP. The kinase reaction products were then analyzed by SDS-PAGE, examining phosphorylation of GST-IκB substrate as well as phosphorylation of the kinases. Furthermore, the immunoprecipitates were subjected to SDS-PAGE/immunoblot analysis to verify loading of equivalent amounts of proteins.

[0290] The results showed that TNFα induced increases in both the phosphorylation and kinase activity of IKKα in control-transfected cells. In contrast, TNFα-inducible IKKα activity and phosphorylation were suppressed in a concentration-dependent manner by PAN2. Similar results were obtained for IKKβ, where PAN2 over-expression potentially suppressed IKKβ activity below baseline levels in TNFα-stimulated HEK293 cells.

[0291] NFκB is normally sequestered into the cytoplasm of nonstimulated cells by a family of inhibitory proteins, called IκB (α, β, γ and ε). Exposure of cells to various stimuli leads to the rapid phosphorylation, ubiquitination and proteolytic degradation of IκB, which frees NFκB to translocate to the nucleus where it regulates gene expression. Accordingly, it was hypothesized that the PAN2 inhibitory effect on NFκB activation could be related to IκB. To test this hypothesis, the in vivo interactions between PAN2 and IκBα were determined.

[0292] For co-immunoprecipitation experiments, HEK293T cells were seeded at 3×10⁶ cells per well in 100 mm dishes and transfected with 6-8 μg plasmid DNA using Lipofectamine Plus® transfection reagent (GIBCO) 24 hours later. After culturing for 36 hours, cells were collected, washed in PBS and lysed in isotonic lysis buffer [150 or 500 mM NaCl, 20 mM Tris/HCl (pH 7.4), 1% NP-40, 12.5 mM β-glycerophosphate, 2 mM NaF, 1 mM Na₃VO₄, 1 mM PMSF, and 1× protease inhibitor mix (Roche)]. Lysates were clarified by centrifugation and subjected to immunoprecipitation using agarose-conjugated anti-c-Myc antibodies (Santa Cruz) or anti-FlagM2 antibodies (Sigma) or non-specific control antibodies and Protein G-agarose for 2-4 hours at 4° C. Immune-complexes were washed 3-5 times with lysis buffer and once with PBS, boiled in 1.5× Laemmli buffer, and separated by 12-15% PAGE. Immune-complexes were then transferred to PVDF membranes (Millipore) and immunoblotted with anti-c-Myc (Santa Cruz) or anti-Flag (Sigma) antibodies in 5% dry milk in TBS-T. Membranes were washed, incubated with HRP-conjugated secondary antibodies, and reactive proteins were detected using ECL.

[0293] As shown in FIG. 6, Flag-tagged IκBα co-immunoprecipitated with Myc-tagged PAN2 ("f.l.") when both plasmids were expressed in 293T cells. Under similar conditions, associations of PAN2 with IKKβ, IKKγ, p105 or Nik were not detected.

[0294] In order to determine which domain of PAN2 is responsible for association with IκB, the following constructs were co-expressed in 293T cells with Flag-tagged IκBα or an empty Flag-tagged vector: Myc-tagged full-length PAN2, Myc-tagged PAN2 ΔLRR (amino acids 1-619 of PAN2), Myc-tagged PAN2PAAD (amino acids 1-89 of PAN2), Myc-tagged PAN2NBARC (amino acids 147-465 of PAN2), or Myc-tagged PAN2AR-like (amino acids 336-605 of PAN2). Immunoprecipitation and immunoblot assays were performed as described above.

[0295] As shown in FIG. 6, Flag-tagged IκBα co-immunoprecipitated with Myc-tagged full-length PAN2 ("f.l."), Myc-tagged PAN2 ΔLRR, and Myc-tagged PAN2NBARC, each of which contained the NBARC domain, but not with Myc-tagged PAN2PAAD or Myc-tagged PAN2AR-like.

[0296] These results indicate that the NBARC (NACHT) domain of PAN2 is responsible for association with IκBα, whereas the PAAD domain of PAN2 is responsible for inhibition of NFκB interaction.

9.0 Cloning and Characterization of PAN5

[0297] In order to clone PAN5 cDNA, first strand cDNA was synthesized at 42° C. for 1 hour from HeLa total RNA (1 μg) using the PANS specific primer (300 ng): L1515 (reverse): TTGCTCGAGTCATCTGAATAC (SEQ ID NO:53), and the ProStart Ultra HF RT-PCR system (Stratagene) as described by the manufacturer. A control mRNA and primers provided in the kit were also used (positive control). The completed first-strand cDNA was used for PCR amplification using Pfu DNA polymerase (2.5 units) and PAN5-specific primers (100 ng each), U1 (forward): ATGGCCATGGCCAAGGC CAGAAAGC (SEQ ID NO:54) and L1515 (reverse): TTGCTCGAGTCATCTGAATAC (SEQ ID NO:55). The following PCR conditions were used: 4' hot start at 94° C., 35 cycles of 94° C. denaturation for 1 minute, 44° C. annealing for 1 minute and extension at 72° C. for 2 minutes and a final 10 minute extension at 72° C. A 1515 bp PCR product corresponding to PAN5 was observed on an agarose gel. The resultant PCR product was cloned into pcDNA4-His/Max Topo (Invitrogen) following the recommendations of the manufacturer.

[0298] The PAAD domain of PAN5 ("PAAD5"), corresponding to bp34-271 of PANS cDNA (SEQ ID NO:21), encoding amino acids 12-90 of SEQ ID NO:22, was amplified by PCR from a HeLa cDNA library using the primer set EA-PAC5-Eco-U34: GAATTCCTCTGGGCCTTGAGTGACCTTGAG (SEQ ID NO:51) and EA-PAC5-Xho-St-L271: CCAGCCGACCTCGAGCAGTCAAATATGGC (SEQ ID NO:52). PCR reactions contained in a total volume of 50 μl: 10×PCR buffer, 20 mM each dNTPs, amplitaq polymerase (0.5 U), 100 ng HeLa cDNA, 50 ng of each primer and 10% DMSO. The same mixture lacking DNA was used as a negative control. The PCR conditions used were as follows: the DNA was first denatured for 3 minutes (hot start). The primer mixture was then added and for 30 subsequent cycles of PCR, the samples were denatured at 94° C. for 30 seconds, annealed at 44° C. for 30 seconds and extended at 72° C. for 1 minute. The 30 cycles of PCR were followed by a 10 minute extension at 72° C.

[0299] The PAAD5 domain was first cloned into pCR-II-Topo, sequence-verified and then digested with EcoRI/Xho1. The digest was then analyzed by gel electrophoresis and the 238 bp band containing the PAAD5 domain gel purified for subcloning into pcDNA3-Myc at the EcoRI/XhoI sites for expression in mammalian cells.

[0300] In order to determine the effect of PAN5 or the PAAD5 domain on NFκB activation, HEK293 cells were transiently transfected using SuperFect® transfection reagent (1.5 μl/well) with pNFκB-Luc (50 ng) and pRL-TK (10 ng) luciferase reporter constructs, pcDNA3-PAAD5 or pcDNA4-PAN5 (390 ng) and 50 ng each of different components of the TNF, LPS or IL signaling pathways, as indicated in Table 3. After incubation for 3 hours, the transfection reagent was removed, fresh serum-containing media was added and cells were then incubated for 36 hours. After 36 hours, cells were lysed with Passive lysis buffer (1x; Promega) and then the effect of PAAD5 domain or PANS on NFκB activity was measured with a luminometer. Co-transfection of pToF-Flash/β-catenin was used as a control for stickiness.

[0301] The results of the luciferase assays are shown in Table 3, below.

TABLE-US-00006 TABLE 3 NFκB Activity Construct (fold induction) Control 1 TNFα 24 PAAD5 3 PAN5 4 TNFR1 23 TNFR1/PAAD5 21 TNFR1/PAN5 24 NIK 30 NIK/PAAD5 5 NIK/PAN5 3 IKKβ 45 IKKβ/PAAD5 6 IKKβ/PAN5 8 p65 55 p65/PAAD5 13 p65/PAN5 46 ToF-Flash + β-catenin 16 ToF-Flash + β-catenin/PAAD5 15 ToF-Flash + β-catenin/PAN5 17

[0302] As evidenced by the data shown in Table 3, overexpression of either PAN5, or the PAAD domain of PAN5, inhibits NFκB activation by a variety of proteins in the TNF, LPS or IL signaling pathways'. Therefore, the PAAD domain of PANS, like the PAAD domain of other PAN proteins described herein, is responsible for the inhibition of NFκB activation.

[0303] In order to determine the expression of PANS in human tissues, a commercially available Northern membrane (Stratagene) was prehybridized with QuikHyb hybridization solution (Stratagene) containing single stranded sperm DNA for 1-2 hours at 68° C. ³²P-- primer labeling of the DNA probe (the 1.5 kb fragment corresponding to the PAN5 ORF) was performed at 37° C. for 30 minutes, using the RTS radprime DNA labeling kit (Life Technologies), as described by the manufacturer. The ³²P-- primer labeling reaction contained 25 ng of denatured DNA, dATP, dAGTP, dTTP, random octamer primers, 50 μCi [³²P] dCTP and Klenow fragment. The prehybridization solution was removed, and the denatured radiolabeled probe was added to the hybridization solution (same as prehybridization buffer) and the membrane was hybridized overnight at 68° C. The membrane was washed three times for 40' with 2×SSC/0.05% SDS at room temperature, washed twice for 40' at 50° C., and exposed to Kodak XAR-5 film with intensifying screens at -70° C. C for 1-3 days.

[0304] Two transcripts, of 1.8 kb and 1.35 kb, were found to be expressed at varying levels in most human tissues tested. Thymus, spleen, placental and lung had the highest expression of PAD5 transcripts. In thymus and spleen, the 1.35 kb transcript was more abundant than the 1.8 kb transcript, whereas in placenta the 1.8 kb transcript was more abundant than the 1.35 kb transcript.

10.0 Cloning and Characterization of PANG

[0305] The PANG gene was determined to share certain LRR-encoding exons with a gene designated RNO2 (GenBank Accession Number NP_--15039 (gi:15193292)). The RNO2 cDNA is expressed in hematopoietic cells and is upregulated in leukemia cells by nitric oxide. It is contemplated that the RNO2 gene product and PAN6 can compete for ligands that bind the LRR domain.

[0306] The PAAD domain of PANG ("PAAD6") corresponding to bp34-271 of PANG cDNA (SEQ ID NO:23), encoding amino acids 12-90 of SEQ ID NO:24, was amplified by PCR from HeLa cDNA library using the primer set EA-PAAD6-U22: GACGGATCCTGTGGCATGGCCACCTACTTGG (SEQ ID NO:56) and EA-PAAD6-L291: ATCCCTCACGAATTCCCCTCACTGTCCTC (SEQ ID NO:57), essentially as described for PAAD5. The PAAD 6 domain was first cloned into pCR-II Topo, sequence-verified and then digested with BamHI and XhoI. The 270 bp band containing the PAAD 6 domain was gel pufified and ligated into pcDNA3-Myc for expression in mammalian cells, into pGEX-4T.3 for GST-fusion protein production and into pGilda for yeast two-hybrid studies, at the BamH1/Xho1 sites of the relevant vector.

[0307] In order to determine the effect of PAAD6 expression on NFκB activation, HEK293 cells were transiently transfected with pNFκB-Luc (50 ng) and pRL-TK (10 ng) luciferase reporter constructs, pcDNA3-PAAD6(390 ng) and 50 ng each of different components of the TNF, LPS or IL signaling pathways, as indicated in Table 4, as described above for PAAD5.

[0308] The results of the luciferase assays are shown in Table 4, below.

TABLE-US-00007 TABLE 4 NFκB Activity Construct (fold induction) Control 1 TNFα 20 PAAD6 4 IRAK2 18 IRAK2/PAAD6 2 TRAF2 44 TRAF2/PAAD6 5 TRAF6 45 TRAF6/PAAD6 6 NIK 29 NIK/PAAD6 3 RIP 45 RIP/PAAD6 2 p65 50 p65/PAAD6 11 IKKβ 42 IKKβ/PAAD6 2 Bcl10 10 Bcl10/PAAD6 1 Nod1 17 Nod1/PAAD6 18 TNFR1 25 TNFR1/PAAD6 19 ToF-Flash + β-catenin 18 ToF-Flash + β-catenin/PAAD6 17

[0309] As evidenced by the data shown in Table 4, overexpression of the PAAD domain of PANG inhibits NFκB activation by a variety of proteins in the TNF, LPS or IL signaling pathways. Therefore, the PAAD domain of PANG, like the PAAD domain of other PAN proteins described herein, is responsible for the inhibition of NFκB activation.

[0310] In order to identify proteins that associate with PANG in vivo, the pGilda plasmid was used to express as a "bait" protein the PAAD domain of PAN6 (nucleotides 22-291 of PANG cDNA, corresponding to amino acids 8-97 of SEQ ID NO:24). The plasmid expressing the LexA-PAAD6 bait protein was then used to transform the yeast strain EGY48 (MAT,trp1,ura3, his,his leu2::6 LexAop-LEU2. The ability of the LexA-PAAD6 bait protein alone to activate LEU2 or LacZ reporter genes was also tested. The LexA-PAAD6 bait protein was used to screen a human fetal brain and Jurkat T cell pJG4-5 cDNA libraries. Briefly, cells were grown in either YPD medium with 1% yeast extract, 2% polypeptone and 2% glucose, or in Burkholder's minimal medium (BMM) supplemented with appropriate amino acids. Transformations were performed by a LiCl method using 0.1 mg of pJG4-5 cDNA library DNA and 5 mg denatured salmon sperm DNA. The potential positive transformants that grew on Leu deficient BMM plates containing 2% galactose were transferred to BMM plates containing leucine and 2% glucose. Filter assays were then performed to measure β-galactosidase activity as described in Sato et al. Proc. Natl. Acad. Sci. USA 91:9238-9242 (1994). As a result of the screening, 7 β-galactosidase positive clones out of 11 clones from the Jurkat T cell cDNA library were obtained that transactivated the LEU2 reporter gene (based on the ability to grow on leu deficient media). The screening of a fetal brain cDNA library gave 430 positive clones for the transactivation of the LEU2 reporter gene. Of those, 42 colonies were also positive in the β-galactosidase assay.

[0311] Two of the clones identified as encoding PAAD6-interacting proteins by yeast two hybrid analysis encoded IKAP, which is an IKβ kinase complex associated protein. The region of IKAP that interacted with PAAD6 was within amino acids 1089-1232. IKAP is known in the art and described, for example, in Cohen et al., Nature 395:292-296 (1998).

[0312] In order to determine the expression of PAN6 in human tissues, a commercially available Northern membrane (Stratagene) was hybridized as described above in regard to PAN5 expression, using the EST I.M.A.G.E. clone 2900568, corresponding to nucleotides 892-2331 of PAN6 as the radiolabeled probe.

[0313] A PAN6 transcript of 3.3 kb was observed at highest levels in thymus, spleen and skeletal muscle, with lower levels in other tissues.

11.0 Cloning and Characterization of ASC and ASC2

[0314] ASC and ASC2 were cloned as following. The ASC or ASC2 (SEQ ID NO:27) open reading frames, or the ASC CARD or PAAD domains, were amplified by high fidelity PCR using primers containing EcoRI and XhoI sites and sub cloned into pcDNA3 vectors containing Myc, Flag or HA epitope tags on the N- or C-terminal end. As template either the ASC cDNA described in Masumoto et al., J. Biol. Chem. 274:33835-33838 (1999) or the 619 bp EST with GenBank Accession No. W73523 (gi:1383656) were used. Authenticity of all constructs was confirmed by DNA sequencing. The primers used were as follows:

TABLE-US-00008 ASC: (SEQ ID NO: 41) 5'-GAATTCGATCCTGGAGCCATGGGG-3'; (SEQ ID NO: 42) 5'-CTCGAGCCGGAGTGTTGCTGGGAA-3'; ASC-PAAD: (SEQ ID NO: 43) 5'-GAATTCGATCCTGGAGCCATGGGG-3; (SEQ ID NO: 44) 5'-CTCGAGTCAGCTTGGCTGCCGACT-3' or (SEQ ID NO: 45) 5-CCCCCTCGAGGGCCTGGCTTGGCTGCCGACT-3'; ASC-CARD: (SEQ ID NO: 46) 5'- GAATTCCCTCAGTCGGCAGCCAAG-3'; (SEQ ID NO: 47) 5'-CTCGAGCCGGAGTGTTGCTGGGAA-3'; ASC2: (SEQ ID NO: 48) 5'- GAATTCGAGGCGCAGGGCTGTG-3'; (SEQ ID NO: 49) 5'-CTCGAGGCTTCACAGGCGTTGCAT-3' or (SEQ ID NO: 50) 5'-CTCGAGGCTACACAGGCGTTGCAT-3'.

[0315] ASC contains a PAAD domain at the N-terminus followed by a CARD domain. ASC2 contains only a PAAD domain, which shares extensive sequence homology with the PAAD domain of ASC. The ASC gene is localized at chromosome 16p12-11.2, whereas the ASC2 gene is localized at chromosome 16.p13.

[0316] To determine associations between various domains of ASC and ASC2, GST pull-down assays and yeast two-hybrid assays were performed. For GST pull-down assays, ASC-PAAD and ASC2 were subcloned into pGEX4-T1 (Pharmacia) and affinity purified as GST-fusion proteins from E. coli XL-1 blue (Stratagene) using GSH-Sepharose. Purified GST-fusion proteins (0.1 μg) immobilized on 10-15 μl of GSH-Sepharose beads were incubated with 1 mg/ml bovine serum albumin in 100 μl buffer A [142.4 mM KCl, 5 mM MgCl₂, 10 mM HEPES (pH 7.4), 0.5 mM EGTA, 1 mM EDTA, and 0.2% Nonidet P-40, supplemented with 1 mM dithiothreitol, 12.5 mM O-glycerol phosphate, 1 μM Na₃VO₄, 1 mM phenylmethylsulfonyl fluoride, and 1× protease inhibitor mix (Roche)] for 30 min at 25° C. The beads were washed twice and incubated overnight at 4° C. with 1 μl of rabbit reticulocyte lysate (Quick-TNT-lysate, Promega) containing ³⁵S-labeled, in vitro-translated proteins in 100 μl of buffer A supplemented with 0.5 mg/ml bovine serum albumin. Bound proteins were washed four times in 500 μl of buffer A, followed by boiling in 20 μl of Laemmli-SDS sample buffer, SDS-PAGE and detected by fluorography.

[0317] By the GST pull-down assays, the PAAD domain of ASC did not associate with the CARD domain of ASC, but weakly associated with full-length ASC and with ASC2, suggesting that the PAAD domain of ASC self-associates and also associates with ASC2.

[0318] For the yeast two-hybrid assays, the yeast EGY-48 strain was transformed with various combinations of ASC, ASC-CARD, ASC-PAAD, and ASC2 in the plasmids pGilda and pJG 4-5, together with the β-galactosidase expression plasmid pSH-18-34 (Invitrogen). Colonies were plated on both LEU+ and LEU- media and also used for a β-Gal-assay. The results of the yeast interaction assays are shown in Table 5, below.

TABLE-US-00009 TABLE 5 pJG 4-5 pGilda Leu β-Gal ASC-CARD ASC-CARD + + ASC-CARD empty - - ASC-CARD ASC + + ASC-CARD ASC-PAAD - - ASC-CARD ASC2 - - ASC-PAAD empty - - ASC-PAAD ASC-PAAD + + ASC2 empty - - ASC2 ASC2 + - ASC2 ASC + + ASC empty - -

[0319] As shown in Table 5, the CARD domain of ASC self associates. In this in vivo assay, the PAAD domain of ASC was shown to self-associate, and also to associate with ASC2.

[0320] For co-immunoprecipitation experiments, HEK293T cells were seeded at 5×10⁵ cells per well in six-well plates (35 mm wells) and transfected with 2 μg plasmid DNA using Superfect (Qiagen) 24 hours later. After culturing for 36 hours, cells were collected, washed in PBS and lysed in isotonic lysis buffer [150 or 500 mM NaCl, 20 mM Tris/HCl (pH 7.4), 0.2% NP-40, 12.5 mM β-glycerophosphate, 2 mM NaF, 1 mM Na₃VO₄, 1 mM PMSF, and 1× protease inhibitor mix (Roche). Lysates were clarified by centrifugation and subjected to immunoprecipitation using agarose-conjugated anti-c-Myc antibodies (Santa Cruz), anti-HA antibodies (Santa Cruz, Roche) anti-FlagM2 antibodies (Sigma) or non-specific control antibodies and Protein G-agarose for 2-4 hours at 4° C. Immune-complexes were washed 3-5 times with lysis buffer and once with PBS, boiled in 1.5× Laemmli buffer, and separated by 12-15% PAGE next to 10% of the total lysate. Immune-complexes were then transferred to PVDF membranes (Millipore) and immunoblotted with anti-c-Myc (Santa Cruz), anti-HA (Roche), or anti-Flag (Sigma) antibodies in 5% dry milk in TBS-T. Membranes were washed, incubated with HRP-conjugated secondary antibodies, and reactive proteins were detected using ECL.

[0321] The results of the co-immunoprecipitation assays are shown in Table 6, below, with a "+" sign indicating co-immunoprecipititation.

TABLE-US-00010 TABLE 6 Myc-ASC HA-ASC + Myc-Caspase-1 HA-ASC + Myc-Card10 HA-ASC + Flag-Nod1 HA-ASC + Flag-Cardiak HA-ASC + Myc-ASC2 HA-ASC-PAAD + Flag-Nod1 HA-ASC-PAAD + Flag-Cardiak HA-ASC-PAAD + Myc-NIK HA-ASC-PAAD + Flag-IKK-i HA-ASC-PAAD + Flag-IκBα HA-ASC-PAAD - HA-IKKβ Myc-ASC-PAAD -

[0322] The results shown in Table 6 indicate that ASC associates with ASC, ASC2, Caspase-1, Card10, Nod1, Cardiak, NIK and IKK-i.

[0323] GST pull-down assays, as described above, were used to determine whether the CARD domain of ASC is able to associate with other proteins, including other CARD domain-containing proteins. The results of these assays are shown in Table 7, with a "+" indicating a detectable interaction between the GST-ASC-CARD domain and the indicated in vitro-translated (IVT) test protein.

TABLE-US-00011 TABLE 7 GST-ASC-CARD/IVT Caspase-8 - GST-ASC-CARD/IVT Caspase-9 - GST-ASC-CARD/IVT Caspase-10 - GST-ASC-CARD/IVT Bcl-10 - GST-ASC-CARD/IVT RAIDD - GST-ASC-CARD/IVT ASC-2 - GST-ASC-CARD/IVT ASC + GST-ASC-CARD/IVT Xiap - GST-ASC-CARD/IVT cIAP-1 - GST-ASC-CARD/IVT cIAP-2 -

[0324] As shown in Table 7, the CARD domain of ASC, while self-associating, does not associate with several other CARD domain-containing proteins.

[0325] In order to determine the localization of ASC and ASC2, Cos-7 cells were seeded onto 12-well plates and transfected with 1.5 μg total fusion plasmid DNA (either EGFP-ASC, EGFP-ASC2 or EGFP-ASC in combination with RFP-ASC2) (Clontech) using Lipofectamine plus (Life Technologies) 24 hours later. The next day cells were trypsinized and seeded onto 4- or 8-well chamber slides (LabTec) and fixed with 4% paraformaldehyde and mounted (Vectashield). Confocal laser scanning microscopy was then performed.

[0326] The microscopy results indicated that ASC, when expressed alone, was localized to characteristic "speckles." ASC2, when expressed alone, exhibited a diffuse pattern of cytoplasmic and nuclear localization. However, when expressed together, ASC and ASC2 co-localized in ASC speckles. Therefore, ASC is apparently able to recruit ASC2 into ASC "speckles." This co-localization is further evidence that ASC and ASC2 associate in vivo.

[0327] In order to determine the effect of ASC, ASC-CARD, ASC-PAAD and ASC2 on NFκB induction in response to TNFα, IL-1β, Bcl10, Nod1 or Cardiak, reporter assays were performed using the Dual-Luciferase assay system (Promega). In brief, HEK293N cells were seeded onto 24-well plates and transfected with 1 μg total plasmid DNA including 6, ng of pRL-TK and 150 ng pRL-NF-κB or pRL-p53 (all Promega) using SuperFect® transfection reagent (Qiagen) 24 hours later. After culturing for 48 hours, cells were lysed in 100 μl passive lysis buffer (Promega) and frozen at -80° C. Subsequently, 5-10 μl of lysate were transferred to 96-well plates and analyzed using a Luminometer (Wallach, Perkin Elmer). If indicated, cells were treated with 10 ng TNF-α or IL-1β 6-8 hours prior to lysis. All experiments were performed in triplicate and repeated at least twice.

[0328] As shown in FIG. 7A-7C, ASC, ASC2 and the PAAD domain of ASC are each able to inhibit NFκB induction by Bcl-10, TNFα and IL-1β. As shown in FIG. 7D, ASC and ASC2 also inhibited NFκB induction by Nod1 and, to a lesser extent, by Cardiak. In other experiments, the inhibition of TNFα-induced NFκB activation was shown to be dependent on the amount of either ASC or ASC2 transfected, and also to be specific for NFκB, as no inhibition of adriamycin-induced p53 activation by ASC was observed.

[0329] Certain genes are induced by NFκB, including TRAF1 (Carpentier et al., FEBS Lett. 460:246-250 (1999). TNFα is a potent inducer of NFκB activation. In order to examine the effect of ASC-PAAD and ASC2 on TNFα-induced expression of the endogenous NFκB target gene TRAF1, HEK 293N cells were transiently transfected with expression plasmids for ASC-PAAD or ASC2, and either treated for 4 hours with TNFα or left untreated. Cleared lysates were immunoblotted with anti-TRAF1 or anti-TRAF2 antibodies. Equal loading was confirmed by re-blotting with an anti-Tubulin antibody. As shown in FIG. 8, treatment with TNF normally causes an increase in expression of TRAF1 but not TRAF2 protein (see lanes marked CNTR, compare - and +TNF). Expression of either ASC-PAAD or ASC2 decreased both basal and TNF-induced expression of TRAF1, without affecting expression of TRAF2. Because increased TRAF1 expression in response to TNF stimulation is mediated by NFκB activation, this result is consistent with the determination (see FIG. 7) that ASC-PAAD or ASC2 inhibit NFκB activation.

[0330] Active caspase-1 cleaves pro-IL-1β, resulting in the generation of bioactive IL-1β which is secreted from cells. In order to determine whether ASC or ASC2 affected caspase-1-induced pro-IL-1β processing, COS-7 cells and HEK293N cells were grown in 24 well plates (14 mm wells) and transfected with 1 μg plasmid DNA (Myc-tagged pro-caspase-1, pro-IL-1β (Lee et al., J. Biol. Chem. 276:34495-34500 (2001); Damiano et al., Genomics 75:77-83 (2001)), HA-tagged ASC and HA-tagged ASC2 in various combinations) using Lipofectamine plus (Gibco BRL, Grand Island, N.Y.) or Superfect (Qiagen, Valencia, Calif.) 24 hours later. After culturing for 36 hours at 37° C. and 5% CO, in Dulbecco's modified Eagle medium (DMEM) supplemented with either 20% or 10% heat-inactivated fetal bovine serum (FBS), 1 mM L-glutamine, and antibiotics, supernatants were collected, volume adjusted and stored at -80° C. or used immediately for an IL-1β, ELISA assay (R&D Systems, Minneapolis, Minn.) according to the manufacturer's instructions. Cells were washed in PBS, lysed in isotonic lysis buffer, and directly analyzed by immunoblotting using anti-Myc and anti-HA antibodies. Results from one representative experiment of at least three experiments are shown in FIG. 9.

[0331] As shown in FIG. 9, co-expression of procaspase-1 and pro-IL-1β ("IL-1") resulted in a high level of secretion of active IL-1β. This IL-13 secretion was inhibited by about 50% by co-expression of ASC, and almost completely inhibited by co-expression of both ASC and ASC2, but was not inhibited by expression of ASC2 alone. Therefore, ASC interferes with activation of a CARD-containing caspase, caspase-1. The association between Cardiak and ASC (see Table 6) may be involved in the inhibition of caspase-1 activation.

[0332] Caspases that cleave the tetrapeptide substrate DEVD-AFC are directly involved in apoptosis, and thus DEDVase activity serves as a surrogate marker of apoptosis. In order to determine the effect of ASC and ASC2 on caspase activation, HEK293N cells were transiently transfected with expression plasmids for ASC; or ASC in combination with ASC2 alone or further in combination with active site mutants of caspase-1, caspase-8, caspase-9 or caspase-10. Transfected HEK293N cells were directly lysed in caspase lysis buffer (10 mM HEPES (pH 7.4), 25 mM NaCl, 0.25% Triton X-100, and 1 mM EDTA), normalized for protein content, and protease activity was measured continuously by monitoring the release of fluorigenic Ac-DEVD-AFC (Bachem, Philadelphia, Pa.) at 370° C. As shown in FIG. 10, caspase activity was increased by expression of ASC (A and B), and further increased by expression of ASC and ASC2 in combination (A and B). Caspase activity was only slightly increased by expression of ASC2 alone (B). Expression of catalytic site mutants of caspase-1, caspase-8 or caspase-10 (c/a) only slightly decreased ASC+ASC2-mediated caspase activity (B), whereas expression of a catalytic site mutant of caspase-9 (c/a) strongly inhibited ASC+ASC2-mediated caspase activity (B). Therefore, ASC and ASC2 activate a caspase-9-dependent pathway for apoptosis.

[0333] Experiments were also performed using stable transfectants of HEK293N expressing the PAAD domain of ASC. The PAAD of ASC was chosen for expression to exclude any contribution from the CARD and to focus on the role of the PAAD in NFκB regulation. Clones of HEK293N stably expressing ASC-PAAD demonstrated reduced activation of a transfected NFκB reporter gene in response to TNFα, consistent with the transient transfection experiments. Moreover, this effect on NfκB activity in HEK293N-ASC-PAAD cells was confirmed to be ASC-dependent by introduction of an ASC-antisense plasmid, in which a cDNA fragment corresponding to the ASC-PAAD was subcloned in reverse orientation downstream of the GFP open reading frame in pEGFP (Clontech), positioning it into the 3' untranslated region of this plasmid. Transfection of various amounts of this ASC-antisense plasmid induced concentration-dependent decreases in the amounts of Myc-ASC-PAAD protein, correlating with dose-dependent restoration of NFκB activity following TNFα-stimulation.

[0334] Next, it was evaluated whether stable expression of the ASC-PAAD protein in HEK293N cells interfered with TNFα-induced expression of an endogenous NFκB target gene, TRAF1, which contains several NFκB binding sites in its promoter. Whereas TNFα stimulated marked increases in TRAF1 protein levels in HEK293N-Neo control cells, this response was markedly blunted in ASC-PAAD-expressing cells. The specificity of these results was confirmed by re-probing the same blot with antibodies recognizing TRAF2 or α-Tubulin, showing that the levels of these proteins did not change in response to TNFα.

[0335] To extend these studies to another cell line, THP-1 monocytic cells were infected with retrovirus encoding either GFP or GFP fused to the PARD of ASC. The effects of LPS on expression of the NFκB-inducible gene, ICAM-1, were then studied in these cells by immunoblotting (Chen et al., J. Biol. Chem. 276:30724-30728 (2001)). Compared to control GFP-expressing THP-1 cells in which LPS induced >20-fold increases in the levels of ICAM protein within 10 hrs after stimulation, LPS-mediated induction of ICAM-1 expression was markedly reduced in ASC-PAAD-expressing cells. Reprobing the same blot with antibodies recognizing GFP confirmed production of the GFP-ASC-PAAD and GFP proteins at comparable levels, while reprobing with anti-β-Actin antibody confirmed loading of equivalent amounts of protein for all samples. Taken together, the data derived from stable transfectants of HEK293N and THP-1 cells indicate that ASC is capable of suppressing TNFα- and LPS-inducible expression of endogenous NFκB target genes through its PAAD domain.

[0336] To map where ASC-PAAD affects pathways leading to NFκB induction, NFκB activity in cells was assessed by transient transfection of plasmids encoding various intracellular signal-transducing proteins that operate within cytokine receptor pathways leading to phosphorylation of IκB, a key event required for NFκB release. Co-expression of ASC-encoding plasmids with these signal transducers revealed that ASC blocks induction of NFκB activity by the adapter proteins TRAF2 and TRAF6, the TRAF-binding kinases TBK1 and NIK, the IKK complex constituents IKKα and IKKβ, and by the related kinase IKKi. In contrast, co-expression of ASC did not suppress reporter gene activation induced by over-expression of the p65 subunit of NFκB These functional mapping studies thus suggest that ASC blocks upstream of NFκB, apparently at the level of the IKK complex.

[0337] Next, in vitro kinase assays were performed to directly evaluate the effects of ASC on IKK activity. For initial experiments, either HA-epitope tagged IKKα or IKKβ was expressed in cells alone or in combination with ASC-encoding or kinase dead IKK expressing plasmids, then either HA-IKKα or HA-IKKβ was immunoprecipitated from transfected cells, and its phosphorylation in vitro of GST-IκBα substrate was measured. In some cases, in vitro phosphorylation of IKKα as well as phosphorylation of associated endogenous IκBα was also measured in the kinase assays. In unstimulated cells, low levels of IKKα and IKKβ activity were detected, which increased about 5-10-fold in response to TNFα stimulation. Co-expression of kinase-dead IKKα or IKKβ mutants blocked this response, serving as a control. TNFα-induced activation of IKKα and IKKβ was suppressed to essentially baseline levels by co-expression of either full-length ASC or its PAAD. This inhibitory effect of ASC and ASC-PAAD on IKKα and IKKβ activity was not attributable to a difference in the total levels of the IKKα or IKKβ proteins, as determined by immunoblot analysis, thus confirming that ASC suppresses activation of the IKK complex. Similar results were obtained when IKKα or IKKβ was activated in cells by transient transfection of plasmids encoding intracellular signaling proteins such as TRAF2 and TRAF6.

[0338] To extend these studies involving expression of epitope-tagged proteins by transient transfection, the activity of endogenous IKKα was evaluated in HEK293 cells that had been stably transfected with either control or Myc-ASC-PAAD-encoding plasmids. ASC-PAAD potently suppressed TNFα-induced activation of endogenous IKKα in these cells, as determined by kinase assays where immunoprecipitated IKKα was tested for ability to phosphorylate GST-IκBα substrate in vitro. The in vitro phosphorylation of IKKα and of endogenous IκBα that was associated with these immune-complexes was also suppressed in ASC-PAAD-expressing cells. These differences in IKKα activity were not due to differences in the total levels of IKKα protein, as determined by immunoblotting.

[0339] Since IKK phosphorylates IκB-family proteins, causing their ubiquitination and proteasome-dependent degradation, the effects of the PAAD domain of ASC on levels of endogenous IκBα in these stably transfected cells were also evaluated, before and at various times after TNFα stimulation. Immunoblot analysis of lysates from HEK293N-Neo cells using anti-IκBα antibody demonstrated the appearance of a doublet band indicative of phosphorylation of IκBα within 5 minutes after TNFα simulation, followed by disappearance of IκBα protein. In contrast, IκBα protein levels were sustained at detectable levels in HEK293N-ASC-PAAD cells despite TNFα treatment. Furthermore, the IκBα doublet band indicative of phosphorylation was not observed until much later, at 15-30 minutes post-stimulation, thus demonstrating a marked delay relative to control cells.

[0340] Having mapped the site of action of ASC to the IKK complex, experiments were performed to explore whether ASC associated with these protein kinases. In the course of these studies of ASC, it was observed that expression of ASC is induced in myeloid-lineage hematopoietic cells by LPS and TNFα. For example, in THP-1 monocytic cells, levels of ASC mRNA (as determined by RT-PCR) and ASC protein (as determined by immunoblot analysis of lysates using anti-ASC antiserum) increased after LPS stimulation, reaching maximum levels at 3 and 6 hrs, respectively, then declining. It was thus determined whether endogenous ASC protein could be found associated with endogenous IKK complex components after LPS- or TNFα-stimulation in these cells. Co-immunoprecipitation experiments provided evidence of association of ASC with both IKKα and IKKβ in LPS-stimulated THP-1 and TNFα-treated HL-60 cells. These protein interactions were reciprocally demonstrable, regardless of whether immune-complexes were prepared using anti-IKKα and anti-IKKβ antibodies (followed by immunoblotting with anti-ASC antiserum) or using anti-ASC antiserum (followed by immunoblotting with anti-IKKα and anti-IKKβ antibodies).

[0341] HEK293N transfectants stably expressing ASC-PAAD were also analyzed to determine whether the PAAD domain is sufficient for association with endogenous IKKα and IKKβ. Again, co-immunoprecipitation experiments demonstrated specific interaction of ASC-PAAD with both IKKα and IKKβ.

[0342] Finally, immunofluorescence microscopy was used to examine the intracellular location of IKKα and IKKβ in control HEK293N and ASC-PAAD-expressing cells. In control-transfected HEK293N cells, endogenous IKKα and IKKβ were diffusely distributed throughout the cytosol. In contrast, IKKα and IKKβ relocated to filament-like structures in HEK293N cells stably expressing ASC-PAAD, co-localizing with the ASC-PAAD proteins (as determined by two-color immunofluorescence microscopy). Treatment of these cells with TNFα did not affect the co-localization of ASC-PAAD with IKKs. It was thus concluded that the PAAD domain of ASC associates with endogenous IKKα and IKKβ containing protein complexes, altering their intracellular location and suppressing cytokine- and LPS-mediated activation of these protein kinases involved in NFκB induction.

[0343] Although the invention has been described with reference to the examples above, it should be understood that various modifications can be made without departing from the spirit of the invention. Accordingly, the invention is limited only by the following claims.

Sequence CWU 1 SEQUENCE LISTING <160> NUMBER OF SEQ ID NOS: 129 <210> SEQ ID NO 1 <211> LENGTH: 76 <212> TYPE: PRT <213> ORGANISM: Homo sapien <400> SEQUENCE: 1 Leu Leu Glu Gln Leu Ser Gln Asp Glu Leu Ser Lys Phe Lys Tyr Leu 1 5 10 15 Ile Thr Thr Phe Ser Leu Ala His Glu Leu Gln Lys Ile Pro His Lys 20 25 30 Glu Val Asp Lys Ala Asp Gly Lys Gln Leu Val Glu Ile Leu Thr Thr 35 40 45 His Cys Asp Ser Tyr Trp Val Glu Met Ala Ser Leu Gln Val Phe Glu 50 55 60 Lys Met His Arg Met Asp Leu Ser Glu Arg Ala Lys 65 70 75 <210> SEQ ID NO 2 <211> LENGTH: 76 <212> TYPE: PRT <213> ORGANISM: Homo sapien <400> SEQUENCE: 2 Tyr Leu Glu Glu Leu Lys Lys Glu Glu Phe Arg Lys Phe Lys Glu His 1 5 10 15 Leu Lys Gln Met Thr Leu Gln Leu Glu Leu Lys Gln Ile Pro Trp Thr 20 25 30 Glu Val Lys Lys Ala Ser Arg Glu Glu Leu Ala Asn Leu Leu Ile Lys 35 40 45 His Tyr Glu Glu Gln Gln Ala Trp Asn Ile Thr Leu Arg Ile Phe Gln 50 55 60 Lys Met Asp Arg Lys Asp Leu Cys Met Lys Val Met 65 70 75 <210> SEQ ID NO 3 <211> LENGTH: 73 <212> TYPE: PRT <213> ORGANISM: Homo sapien <400> SEQUENCE: 3 Ala Leu Glu Glu Leu Ser Gln Glu Gln Leu Lys Arg Phe Arg His Lys 1 5 10 15 Leu Arg Asp Val Gly Pro Asp Gly Arg Ser Ile Pro Trp Gly Arg Leu 20 25 30 Glu Arg Ala Asp Ala Val Asp Leu Ala Glu Gln Leu Ala Gln Phe Tyr 35 40 45 Gly Pro Glu Pro Ala Leu Glu Val Ala Arg Lys Thr Leu Lys Arg Ala 50 55 60 Asp Ala Arg Asp Val Ala Ala Gln Leu 65 70 <210> SEQ ID NO 4 <211> LENGTH: 75 <212> TYPE: PRT <213> ORGANISM: Homo sapien <400> SEQUENCE: 4 Tyr Met Arg Asn Val Ser His Glu Glu Leu Gln Arg Phe Lys Gln Leu 1 5 10 15 Leu Leu Thr Glu Leu Ser Thr Gly Thr Met Pro Ile Thr Trp Asp Gln 20 25 30 Val Glu Thr Ala Ser Trp Ala Glu Val Val His Leu Leu Ile Glu Arg 35 40 45 Phe Pro Gly Arg Arg Ala Trp Asp Val Thr Ser Asn Ile Phe Ala Ile 50 55 60 Met Asn Cys Asp Lys Met Cys Val Val Val Arg 65 70 75 <210> SEQ ID NO 5 <211> LENGTH: 76 <212> TYPE: PRT <213> ORGANISM: Homo sapien <400> SEQUENCE: 5 Ala Leu Ser Asp Leu Glu Glu Asn Asp Phe Lys Lys Leu Lys Phe Tyr 1 5 10 15 Leu Arg Asp Met Thr Leu Ser Glu Gly Gln Pro Pro Leu Ala Arg Gly 20 25 30 Glu Leu Glu Gly Leu Ile Pro Val Asp Leu Ala Glu Leu Leu Ile Ser 35 40 45 Lys Tyr Gly Glu Lys Glu Ala Val Lys Val Val Leu Lys Gly Leu Lys 50 55 60 Val Met Asn Leu Leu Glu Leu Val Asp Gln Leu Ser 65 70 75 <210> SEQ ID NO 6 <211> LENGTH: 75 <212> TYPE: PRT <213> ORGANISM: Homo sapien <400> SEQUENCE: 6 Tyr Leu Glu Glu Leu Glu Ala Val Glu Leu Lys Lys Phe Lys Leu Tyr 1 5 10 15 Leu Gly Thr Ala Thr Glu Leu Gly Glu Gly Lys Ile Pro Trp Gly Ser 20 25 30 Met Glu Lys Ala Gly Pro Leu Glu Met Ala Gln Leu Leu Ile Thr His 35 40 45 Phe Gly Pro Glu Glu Ala Trp Arg Leu Ala Leu Ser Thr Phe Glu Arg 50 55 60 Ile Asn Arg Lys Asp Leu Trp Glu Arg Gly Gln 65 70 75 <210> SEQ ID NO 7 <211> LENGTH: 76 <212> TYPE: PRT <213> ORGANISM: Homo sapien <400> SEQUENCE: 7 Thr Leu Glu Glu Leu Val Pro Tyr Asp Phe Glu Lys Phe Lys Phe Lys 1 5 10 15 Leu Gln Asn Thr Ser Val Gln Lys Glu His Ser Arg Ile Pro Arg Ser 20 25 30 Gln Ile Gln Arg Ala Arg Pro Val Lys Met Ala Thr Leu Leu Val Thr 35 40 45 Tyr Tyr Gly Glu Glu Tyr Ala Val Gln Leu Thr Leu Gln Val Leu Arg 50 55 60 Ala Ile Asn Gln Arg Leu Leu Ala Glu Glu Leu His 65 70 75 <210> SEQ ID NO 8 <211> LENGTH: 71 <212> TYPE: PRT <213> ORGANISM: Homo sapien <400> SEQUENCE: 8 Tyr Leu Glu Asp Leu Glu Asp Val Asp Leu Lys Lys Phe Lys Met His 1 5 10 15 Leu Glu Asp Tyr Pro Pro Gln Lys Gly Cys Ile Pro Leu Pro Arg Gly 20 25 30 Gln Thr Glu Lys Ala Asp His Val Asp Leu Ala Thr Leu Met Ile Asp 35 40 45 Phe Asn Gly Glu Glu Lys Ala Trp Ala Met Val Val Trp Ile Phe Ala 50 55 60 Ala Ile Asn Arg Arg Asp Leu 65 70 <210> SEQ ID NO 9 <211> LENGTH: 76 <212> TYPE: PRT <213> ORGANISM: Homo sapien <400> SEQUENCE: 9 Ala Leu Glu Asn Leu Thr Ala Glu Glu Leu Lys Lys Phe Lys Leu Lys 1 5 10 15 Leu Leu Ser Val Pro Leu Arg Glu Gly Tyr Gly Arg Ile Pro Arg Gly 20 25 30 Ala Leu Leu Pro Met Asp Ala Leu Asp Leu Thr Asp Lys Leu Val Ser 35 40 45 Phe Tyr Leu Glu Thr Tyr Gly Ala Glu Leu Thr Ala Asn Val Leu Arg 50 55 60 Asp Met Gly Leu Gln Glu Met Ala Gly Gln Leu Gln 65 70 75 <210> SEQ ID NO 10 <211> LENGTH: 76 <212> TYPE: PRT <213> ORGANISM: Homo sapien <400> SEQUENCE: 10 Val Leu Glu Asn Leu Thr Pro Glu Glu Leu Lys Lys Phe Lys Met Lys 1 5 10 15 Leu Gly Thr Val Pro Leu Arg Glu Gly Phe Glu Arg Ile Pro Arg Gly 20 25 30 Ala Leu Gly Gln Leu Asp Ile Val Asp Leu Thr Asp Lys Leu Val Ala 35 40 45 Ser Tyr Tyr Glu Asp Tyr Ala Ala Glu Leu Val Val Ala Val Leu Arg 50 55 60 Asp Met Arg Met Leu Glu Glu Ala Ala Arg Leu Gln 65 70 75 <210> SEQ ID NO 11 <211> LENGTH: 76 <212> TYPE: PRT <213> ORGANISM: Homo sapien <400> SEQUENCE: 11 Tyr Leu Glu Phe Leu Lys Lys Glu Glu Leu Lys Glu Phe Gln Leu Leu 1 5 10 15 Leu Ala Asn Lys Ala His Ser Arg Ser Ser Ser Gly Glu Thr Pro Ala 20 25 30 Gln Pro Glu Lys Thr Ser Gly Met Glu Val Ala Ser Tyr Leu Val Ala 35 40 45 Gln Tyr Gly Glu Gln Arg Ala Trp Asp Leu Ala Leu His Thr Trp Glu 50 55 60 Gln Met Gly Leu Arg Ser Leu Cys Ala Gln Ala Gln 65 70 75 <210> SEQ ID NO 12 <211> LENGTH: 70 <212> TYPE: PRT <213> ORGANISM: Homo sapien <400> SEQUENCE: 12 Gly Leu Asp Asn Ile Thr Asp Glu Glu Leu Asp Arg Phe Lys Phe Phe 1 5 10 15 Leu Ser Asp Glu Phe Asn Ile Ala Thr Gly Lys Leu His Thr Ala Asn 20 25 30 Arg Ile Gln Val Ala Thr Leu Met Ile Gln Asn Ala Gly Ala Val Ser 35 40 45 Ala Val Met Lys Thr Ile Arg Ile Phe Gln Lys Leu Asn Tyr Met Leu 50 55 60 Leu Ala Lys Arg Leu Gln 65 70 <210> SEQ ID NO 13 <211> LENGTH: 71 <212> TYPE: PRT <213> ORGANISM: Homo sapien <400> SEQUENCE: 13 Gly Leu Glu Val Ile Asn Asp Tyr His Phe Arg Met Val Lys Ser Leu 1 5 10 15 Leu Ser Asn Asp Leu Lys Leu Asn Leu Lys Met Arg Glu Glu Tyr Asp 20 25 30 Lys Ile Gln Ile Ala Asp Leu Met Glu Glu Lys Phe Arg Gly Asp Ala 35 40 45 Gly Leu Gly Lys Leu Ile Lys Ile Phe Glu Asp Ile Pro Thr Leu Glu 50 55 60 Asp Leu Ala Glu Thr Leu Lys 65 70 <210> SEQ ID NO 14 <211> LENGTH: 70 <212> TYPE: PRT <213> ORGANISM: Myxoma virus <400> SEQUENCE: 14 Val Leu Glu Asn Leu Ser Asp Tyr Gln Phe Lys Met Phe Ile Tyr Leu 1 5 10 15 Ala Met Glu Asp Leu Tyr Ile Glu Arg Ala Glu Lys Glu Lys Ile Asp 20 25 30 Arg Ile Asp Leu Ala His Lys Ile Ser Glu Gln Tyr Leu Gly Thr Asp 35 40 45 Tyr Ile Glu Phe Met Lys Arg Val Thr Asp Phe Ile Pro Asn Lys Val 50 55 60 Tyr Val Asp Ser Leu Leu 65 70 <210> SEQ ID NO 15 <211> LENGTH: 2985 <212> TYPE: DNA <213> ORGANISM: Homo sapien <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (1)...(2985) <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (1)...(1857) <223> OTHER INFORMATION: n = A,T,C or G <400> SEQUENCE: 15 atg gca gcc tct ttc ttc tct gat ttt ggt ctt atg tgg tat ctg gag 48 Met Ala Ala Ser Phe Phe Ser Asp Phe Gly Leu Met Trp Tyr Leu Glu 1 5 10 15 gag ctc aaa aag gag gag ttc agg aaa ttt aaa gaa cat ctc aag caa 96 Glu Leu Lys Lys Glu Glu Phe Arg Lys Phe Lys Glu His Leu Lys Gln 20 25 30 atg act ttg cag ctt gaa ctc aag cag att ccc tgg act gag gtc aaa 144 Met Thr Leu Gln Leu Glu Leu Lys Gln Ile Pro Trp Thr Glu Val Lys 35 40 45 aaa gca tcc cgg gaa gaa ctt gca aac ctc ttg atc aag cac tat gaa 192 Lys Ala Ser Arg Glu Glu Leu Ala Asn Leu Leu Ile Lys His Tyr Glu 50 55 60 gaa caa caa gct tgg aac ata acc tta aga atc ttt caa aag atg gat 240 Glu Gln Gln Ala Trp Asn Ile Thr Leu Arg Ile Phe Gln Lys Met Asp 65 70 75 80 aga aag gat ctc tgc atg aag gtc atg agg gag aga aca gga tac aca 288 Arg Lys Asp Leu Cys Met Lys Val Met Arg Glu Arg Thr Gly Tyr Thr 85 90 95 aag acc tat caa gct cac gca aag cag aaa ttc agc cgc tta tgg tcc 336 Lys Thr Tyr Gln Ala His Ala Lys Gln Lys Phe Ser Arg Leu Trp Ser 100 105 110 agc aag tct gtc act gag att cac cta tac ttt gag gag gaa gtc aag 384 Ser Lys Ser Val Thr Glu Ile His Leu Tyr Phe Glu Glu Glu Val Lys 115 120 125 caa gaa gaa tgt gac cat ttg gac cgc ctt ttt gct ccc aag gaa act 432 Gln Glu Glu Cys Asp His Leu Asp Arg Leu Phe Ala Pro Lys Glu Thr 130 135 140 ggg aaa cag cca cgt aca gtg att att caa gga cca caa gga att gga 480 Gly Lys Gln Pro Arg Thr Val Ile Ile Gln Gly Pro Gln Gly Ile Gly 145 150 155 160 aaa acg aca ctc ctg atg aag ctg atg atg gcc tgg tcg gac aac aag 528 Lys Thr Thr Leu Leu Met Lys Leu Met Met Ala Trp Ser Asp Asn Lys 165 170 175 atc ttt cgg gat agg ttc ctg tac acg ttc tat ttc tgc tgc aga gaa 576 Ile Phe Arg Asp Arg Phe Leu Tyr Thr Phe Tyr Phe Cys Cys Arg Glu 180 185 190 ctg agg gag ttg ccg cca acg agt ttg gct gac ttg att tcc aga gag 624 Leu Arg Glu Leu Pro Pro Thr Ser Leu Ala Asp Leu Ile Ser Arg Glu 195 200 205 tgg cct gac ccc gct gct cct ata aca gag atc gtg tct caa ccg gag 672 Trp Pro Asp Pro Ala Ala Pro Ile Thr Glu Ile Val Ser Gln Pro Glu 210 215 220 aga ctc ttg ttc gtc atc gac agc ttc gaa gag ctg cag ggc ggc ttg 720 Arg Leu Leu Phe Val Ile Asp Ser Phe Glu Glu Leu Gln Gly Gly Leu 225 230 235 240 aac gaa ccc gat tcg gat ctg tgt ggt gac ttg atg gag aaa cgg ccg 768 Asn Glu Pro Asp Ser Asp Leu Cys Gly Asp Leu Met Glu Lys Arg Pro 245 250 255 gtg cag gtg ctt ctg agc agt ttg ctg agg aag aag atg ctc ccg gag 816 Val Gln Val Leu Leu Ser Ser Leu Leu Arg Lys Lys Met Leu Pro Glu 260 265 270 gcc tcc ctg ctc atc gcc atc aaa ccc gtg tgc ccg aag gag ctc cgg 864 Ala Ser Leu Leu Ile Ala Ile Lys Pro Val Cys Pro Lys Glu Leu Arg 275 280 285 gat cag gtg acg atc tca gaa atc tac cag ccc cgg gga ttc aac gag 912 Asp Gln Val Thr Ile Ser Glu Ile Tyr Gln Pro Arg Gly Phe Asn Glu 290 295 300 agt gat agg tta gtg tat ttc tgc tgt ttc ttc aaa gac ccg aaa aga 960 Ser Asp Arg Leu Val Tyr Phe Cys Cys Phe Phe Lys Asp Pro Lys Arg 305 310 315 320 gcc atg gaa gcc ttc aat ctt gta aga gaa agt gaa cag ctg ttt tcc 1008 Ala Met Glu Ala Phe Asn Leu Val Arg Glu Ser Glu Gln Leu Phe Ser 325 330 335 ata tgc caa atc ccg ctc ctc tgc tgg atc ctg tgt acc agt ctg aag 1056 Ile Cys Gln Ile Pro Leu Leu Cys Trp Ile Leu Cys Thr Ser Leu Lys 340 345 350 caa gag atg cag aaa gga aaa gac ctg gcc ctg acc tgc cag agc act 1104 Gln Glu Met Gln Lys Gly Lys Asp Leu Ala Leu Thr Cys Gln Ser Thr 355 360 365 acc tct gtg tac tcc tct ttc gtc ttt aac ctg ttc aca cct gag ggt 1152 Thr Ser Val Tyr Ser Ser Phe Val Phe Asn Leu Phe Thr Pro Glu Gly 370 375 380 gcc gag ggc ccg act ccg caa acc cag cac cag ctg aag gcc ctg tgc 1200 Ala Glu Gly Pro Thr Pro Gln Thr Gln His Gln Leu Lys Ala Leu Cys 385 390 395 400 tcc ctg gct gca gag ggt atg tgg aca gac aca ttt gag ttt tgt gaa 1248 Ser Leu Ala Ala Glu Gly Met Trp Thr Asp Thr Phe Glu Phe Cys Glu 405 410 415 gac gac ctc cgg aga aat ggg gtt gtt gac gct gac atc cct gcg ctg 1296 Asp Asp Leu Arg Arg Asn Gly Val Val Asp Ala Asp Ile Pro Ala Leu 420 425 430 ctg ggc acc aag ata ctt ctg aag tac ggg gag cgt gag agc tcc tac 1344 Leu Gly Thr Lys Ile Leu Leu Lys Tyr Gly Glu Arg Glu Ser Ser Tyr 435 440 445 gtg ttc ctc cac gtg tgt atc cag gag ttc tgt gcc gcc ttg ttc tat 1392 Val Phe Leu His Val Cys Ile Gln Glu Phe Cys Ala Ala Leu Phe Tyr 450 455 460 ttg ctc aag agc cat ctt gat cat cct cac cca gct gtg aga tgt gta 1440 Leu Leu Lys Ser His Leu Asp His Pro His Pro Ala Val Arg Cys Val 465 470 475 480 cag gaa ttg cta gtt gcc aat ttt gaa aaa gca agg aga gca cat tgg 1488 Gln Glu Leu Leu Val Ala Asn Phe Glu Lys Ala Arg Arg Ala His Trp 485 490 495 att ttt ttg ggg tgt ttt cta act ggc ctt tta aat aaa aag gaa caa 1536 Ile Phe Leu Gly Cys Phe Leu Thr Gly Leu Leu Asn Lys Lys Glu Gln 500 505 510 gaa aaa ctg gat gcg ttt ttt ggc ttc caa ctg tcc caa gag ata aag 1584 Glu Lys Leu Asp Ala Phe Phe Gly Phe Gln Leu Ser Gln Glu Ile Lys 515 520 525 cag caa att cac cag tgc ctg aag agc tta ggg gag cgt ggc aat cct 1632 Gln Gln Ile His Gln Cys Leu Lys Ser Leu Gly Glu Arg Gly Asn Pro 530 535 540 cag gga cag gtg gat tcc ttg gcg ata ttt tac tgt ctc ttt gaa atg 1680 Gln Gly Gln Val Asp Ser Leu Ala Ile Phe Tyr Cys Leu Phe Glu Met 545 550 555 560 cag gat cct gcc ttt gtg aag cag gca gtg aac ctc ctc caa gaa gct 1728 Gln Asp Pro Ala Phe Val Lys Gln Ala Val Asn Leu Leu Gln Glu Ala 565 570 575 aac ttt cat att att gac aac gtg gac ttg gtg gtt tct gcc tac tgc 1776 Asn Phe His Ile Ile Asp Asn Val Asp Leu Val Val Ser Ala Tyr Cys 580 585 590 tta aaa tac tgc tcc agc ttg agg aaa ctc tgt ttt tcc gtt caa aat 1824 Leu Lys Tyr Cys Ser Ser Leu Arg Lys Leu Cys Phe Ser Val Gln Asn 595 600 605 gtc ttt aag aaa gag gat gaa cac agc tct acg tcg gat tac agc ctc 1872 Val Phe Lys Lys Glu Asp Glu His Ser Ser Thr Ser Asp Tyr Ser Leu 610 615 620 atc tgt tgg cat cac atc tgc tct gtg ctc acc acc agc ggg cac ctc 1920 Ile Cys Trp His His Ile Cys Ser Val Leu Thr Thr Ser Gly His Leu 625 630 635 640 aga gag ctc cag gtg cag gac agc acc ctc agc gag tcg acc ttt gtg 1968 Arg Glu Leu Gln Val Gln Asp Ser Thr Leu Ser Glu Ser Thr Phe Val 645 650 655 acc tgg tgt aac cag ctg agg cat ccc agc tgt cgc ctt cag aag ctt 2016 Thr Trp Cys Asn Gln Leu Arg His Pro Ser Cys Arg Leu Gln Lys Leu 660 665 670 gga ata aat aac gtt tcc ttt tct ggc cag agt gtt ctg ctc ttt gag 2064 Gly Ile Asn Asn Val Ser Phe Ser Gly Gln Ser Val Leu Leu Phe Glu 675 680 685 gtg ctc ttt tat cag cca gac ttg aaa tac ctg agc ttc acc ctc acg 2112 Val Leu Phe Tyr Gln Pro Asp Leu Lys Tyr Leu Ser Phe Thr Leu Thr 690 695 700 aaa ctc tct cgt gat gac atc agg tcc ctc tgt gat gcc ttg aac tac 2160 Lys Leu Ser Arg Asp Asp Ile Arg Ser Leu Cys Asp Ala Leu Asn Tyr 705 710 715 720 cca gca ggc aac gtc aaa gag cta gcg ctg gta aat tgt cac ctc tca 2208 Pro Ala Gly Asn Val Lys Glu Leu Ala Leu Val Asn Cys His Leu Ser 725 730 735 ccc att gat tgt gaa gtc ctt gct ggc ctt cta acc aac aac aag aag 2256 Pro Ile Asp Cys Glu Val Leu Ala Gly Leu Leu Thr Asn Asn Lys Lys 740 745 750 ctg acg tat ctg aat gta tcc tgc aac cag tta gac aca ggc gtg ccc 2304 Leu Thr Tyr Leu Asn Val Ser Cys Asn Gln Leu Asp Thr Gly Val Pro 755 760 765 ctt ttg tgt gaa gcc ctg tgc agc cca gac acg gtc ctg gta tac ctg 2352 Leu Leu Cys Glu Ala Leu Cys Ser Pro Asp Thr Val Leu Val Tyr Leu 770 775 780 atg ttg gct ttc tgc cac ctc agc gag cag tgc tgc gaa tac atc tct 2400 Met Leu Ala Phe Cys His Leu Ser Glu Gln Cys Cys Glu Tyr Ile Ser 785 790 795 800 gaa atg ctt ctg cgt aac aag agc gtg cgc tat cta gac ctc agt gcc 2448 Glu Met Leu Leu Arg Asn Lys Ser Val Arg Tyr Leu Asp Leu Ser Ala 805 810 815 aat gtc ctg aag gac gaa gga ctg aaa act ctc tgc gag gcc ttg aaa 2496 Asn Val Leu Lys Asp Glu Gly Leu Lys Thr Leu Cys Glu Ala Leu Lys 820 825 830 cat ccg gac tgc tgc ctg gat tca ctg tgt ttg gta aaa tgt ttt atc 2544 His Pro Asp Cys Cys Leu Asp Ser Leu Cys Leu Val Lys Cys Phe Ile 835 840 845 act gct gct ggc tgt gaa gac ctc gcc tct gct ctc atc agc aat caa 2592 Thr Ala Ala Gly Cys Glu Asp Leu Ala Ser Ala Leu Ile Ser Asn Gln 850 855 860 aac ctg aag att ctg caa att ggg tgc aat gaa atc gga gat gtg ggt 2640 Asn Leu Lys Ile Leu Gln Ile Gly Cys Asn Glu Ile Gly Asp Val Gly 865 870 875 880 gtg cag ctg ttg tgt cgg gct ctg acg cat acg gat tgc cgc tta gag 2688 Val Gln Leu Leu Cys Arg Ala Leu Thr His Thr Asp Cys Arg Leu Glu 885 890 895 att ctt ggg ttg gaa gaa tgt ggg tta acg agc acc tgc tgt aag gat 2736 Ile Leu Gly Leu Glu Glu Cys Gly Leu Thr Ser Thr Cys Cys Lys Asp 900 905 910 ctc gcg tct gtt ctc acc tgc agt aag acc ctg cag cag ctc aac ctg 2784 Leu Ala Ser Val Leu Thr Cys Ser Lys Thr Leu Gln Gln Leu Asn Leu 915 920 925 acc ttg aac acc ttg gac cac aca ggg gtg gtt gta ctc tgt gag gcc 2832 Thr Leu Asn Thr Leu Asp His Thr Gly Val Val Val Leu Cys Glu Ala 930 935 940 ctg aga cac cca gag tgt gcc ctg cag gtg ctc ggg ctg aga aaa act 2880 Leu Arg His Pro Glu Cys Ala Leu Gln Val Leu Gly Leu Arg Lys Thr 945 950 955 960 gat ttt gat gag gaa acc cag gca ctt ctg acg gct gag gaa gag aga 2928 Asp Phe Asp Glu Glu Thr Gln Ala Leu Leu Thr Ala Glu Glu Glu Arg 965 970 975 aat cct aac ctg acc atc aca gac gac tgt gac aca atc aca agg gta 2976 Asn Pro Asn Leu Thr Ile Thr Asp Asp Cys Asp Thr Ile Thr Arg Val 980 985 990 gag atc tga 2985 Glu Ile * <210> SEQ ID NO 16 <211> LENGTH: 994 <212> TYPE: PRT <213> ORGANISM: Homo sapien <400> SEQUENCE: 16 Met Ala Ala Ser Phe Phe Ser Asp Phe Gly Leu Met Trp Tyr Leu Glu 1 5 10 15 Glu Leu Lys Lys Glu Glu Phe Arg Lys Phe Lys Glu His Leu Lys Gln 20 25 30 Met Thr Leu Gln Leu Glu Leu Lys Gln Ile Pro Trp Thr Glu Val Lys 35 40 45 Lys Ala Ser Arg Glu Glu Leu Ala Asn Leu Leu Ile Lys His Tyr Glu 50 55 60 Glu Gln Gln Ala Trp Asn Ile Thr Leu Arg Ile Phe Gln Lys Met Asp 65 70 75 80 Arg Lys Asp Leu Cys Met Lys Val Met Arg Glu Arg Thr Gly Tyr Thr 85 90 95 Lys Thr Tyr Gln Ala His Ala Lys Gln Lys Phe Ser Arg Leu Trp Ser 100 105 110 Ser Lys Ser Val Thr Glu Ile His Leu Tyr Phe Glu Glu Glu Val Lys 115 120 125 Gln Glu Glu Cys Asp His Leu Asp Arg Leu Phe Ala Pro Lys Glu Thr 130 135 140 Gly Lys Gln Pro Arg Thr Val Ile Ile Gln Gly Pro Gln Gly Ile Gly 145 150 155 160 Lys Thr Thr Leu Leu Met Lys Leu Met Met Ala Trp Ser Asp Asn Lys 165 170 175 Ile Phe Arg Asp Arg Phe Leu Tyr Thr Phe Tyr Phe Cys Cys Arg Glu 180 185 190 Leu Arg Glu Leu Pro Pro Thr Ser Leu Ala Asp Leu Ile Ser Arg Glu 195 200 205 Trp Pro Asp Pro Ala Ala Pro Ile Thr Glu Ile Val Ser Gln Pro Glu 210 215 220 Arg Leu Leu Phe Val Ile Asp Ser Phe Glu Glu Leu Gln Gly Gly Leu 225 230 235 240 Asn Glu Pro Asp Ser Asp Leu Cys Gly Asp Leu Met Glu Lys Arg Pro 245 250 255 Val Gln Val Leu Leu Ser Ser Leu Leu Arg Lys Lys Met Leu Pro Glu 260 265 270 Ala Ser Leu Leu Ile Ala Ile Lys Pro Val Cys Pro Lys Glu Leu Arg 275 280 285 Asp Gln Val Thr Ile Ser Glu Ile Tyr Gln Pro Arg Gly Phe Asn Glu 290 295 300 Ser Asp Arg Leu Val Tyr Phe Cys Cys Phe Phe Lys Asp Pro Lys Arg 305 310 315 320 Ala Met Glu Ala Phe Asn Leu Val Arg Glu Ser Glu Gln Leu Phe Ser 325 330 335 Ile Cys Gln Ile Pro Leu Leu Cys Trp Ile Leu Cys Thr Ser Leu Lys 340 345 350 Gln Glu Met Gln Lys Gly Lys Asp Leu Ala Leu Thr Cys Gln Ser Thr 355 360 365 Thr Ser Val Tyr Ser Ser Phe Val Phe Asn Leu Phe Thr Pro Glu Gly 370 375 380 Ala Glu Gly Pro Thr Pro Gln Thr Gln His Gln Leu Lys Ala Leu Cys 385 390 395 400 Ser Leu Ala Ala Glu Gly Met Trp Thr Asp Thr Phe Glu Phe Cys Glu 405 410 415 Asp Asp Leu Arg Arg Asn Gly Val Val Asp Ala Asp Ile Pro Ala Leu 420 425 430 Leu Gly Thr Lys Ile Leu Leu Lys Tyr Gly Glu Arg Glu Ser Ser Tyr 435 440 445 Val Phe Leu His Val Cys Ile Gln Glu Phe Cys Ala Ala Leu Phe Tyr 450 455 460 Leu Leu Lys Ser His Leu Asp His Pro His Pro Ala Val Arg Cys Val 465 470 475 480 Gln Glu Leu Leu Val Ala Asn Phe Glu Lys Ala Arg Arg Ala His Trp 485 490 495 Ile Phe Leu Gly Cys Phe Leu Thr Gly Leu Leu Asn Lys Lys Glu Gln 500 505 510 Glu Lys Leu Asp Ala Phe Phe Gly Phe Gln Leu Ser Gln Glu Ile Lys 515 520 525 Gln Gln Ile His Gln Cys Leu Lys Ser Leu Gly Glu Arg Gly Asn Pro 530 535 540 Gln Gly Gln Val Asp Ser Leu Ala Ile Phe Tyr Cys Leu Phe Glu Met 545 550 555 560 Gln Asp Pro Ala Phe Val Lys Gln Ala Val Asn Leu Leu Gln Glu Ala 565 570 575 Asn Phe His Ile Ile Asp Asn Val Asp Leu Val Val Ser Ala Tyr Cys 580 585 590 Leu Lys Tyr Cys Ser Ser Leu Arg Lys Leu Cys Phe Ser Val Gln Asn 595 600 605 Val Phe Lys Lys Glu Asp Glu His Ser Ser Thr Ser Asp Tyr Ser Leu 610 615 620 Ile Cys Trp His His Ile Cys Ser Val Leu Thr Thr Ser Gly His Leu 625 630 635 640 Arg Glu Leu Gln Val Gln Asp Ser Thr Leu Ser Glu Ser Thr Phe Val 645 650 655 Thr Trp Cys Asn Gln Leu Arg His Pro Ser Cys Arg Leu Gln Lys Leu 660 665 670 Gly Ile Asn Asn Val Ser Phe Ser Gly Gln Ser Val Leu Leu Phe Glu 675 680 685 Val Leu Phe Tyr Gln Pro Asp Leu Lys Tyr Leu Ser Phe Thr Leu Thr 690 695 700 Lys Leu Ser Arg Asp Asp Ile Arg Ser Leu Cys Asp Ala Leu Asn Tyr 705 710 715 720 Pro Ala Gly Asn Val Lys Glu Leu Ala Leu Val Asn Cys His Leu Ser 725 730 735 Pro Ile Asp Cys Glu Val Leu Ala Gly Leu Leu Thr Asn Asn Lys Lys 740 745 750 Leu Thr Tyr Leu Asn Val Ser Cys Asn Gln Leu Asp Thr Gly Val Pro 755 760 765 Leu Leu Cys Glu Ala Leu Cys Ser Pro Asp Thr Val Leu Val Tyr Leu 770 775 780 Met Leu Ala Phe Cys His Leu Ser Glu Gln Cys Cys Glu Tyr Ile Ser 785 790 795 800 Glu Met Leu Leu Arg Asn Lys Ser Val Arg Tyr Leu Asp Leu Ser Ala 805 810 815 Asn Val Leu Lys Asp Glu Gly Leu Lys Thr Leu Cys Glu Ala Leu Lys 820 825 830 His Pro Asp Cys Cys Leu Asp Ser Leu Cys Leu Val Lys Cys Phe Ile 835 840 845 Thr Ala Ala Gly Cys Glu Asp Leu Ala Ser Ala Leu Ile Ser Asn Gln 850 855 860 Asn Leu Lys Ile Leu Gln Ile Gly Cys Asn Glu Ile Gly Asp Val Gly 865 870 875 880 Val Gln Leu Leu Cys Arg Ala Leu Thr His Thr Asp Cys Arg Leu Glu 885 890 895 Ile Leu Gly Leu Glu Glu Cys Gly Leu Thr Ser Thr Cys Cys Lys Asp 900 905 910 Leu Ala Ser Val Leu Thr Cys Ser Lys Thr Leu Gln Gln Leu Asn Leu 915 920 925 Thr Leu Asn Thr Leu Asp His Thr Gly Val Val Val Leu Cys Glu Ala 930 935 940 Leu Arg His Pro Glu Cys Ala Leu Gln Val Leu Gly Leu Arg Lys Thr 945 950 955 960 Asp Phe Asp Glu Glu Thr Gln Ala Leu Leu Thr Ala Glu Glu Glu Arg 965 970 975 Asn Pro Asn Leu Thr Ile Thr Asp Asp Cys Asp Thr Ile Thr Arg Val 980 985 990 Glu Ile <210> SEQ ID NO 17 <211> LENGTH: 2844 <212> TYPE: DNA <213> ORGANISM: Homo sapien <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (1)...(2841) <400> SEQUENCE: 17 atg gac cag cca gag gcc ccc tgc tcc agc acg ggg ccg cgc ctc gcg 48 Met Asp Gln Pro Glu Ala Pro Cys Ser Ser Thr Gly Pro Arg Leu Ala 1 5 10 15 gtg gcc cgc gag ctg ctc ctg gct gcg ctg gag gaa ctg agc caa gag 96 Val Ala Arg Glu Leu Leu Leu Ala Ala Leu Glu Glu Leu Ser Gln Glu 20 25 30 cag ctg aag cgc ttc cgc cac aag ctg cgc gac gtg ggc ccg gac gga 144 Gln Leu Lys Arg Phe Arg His Lys Leu Arg Asp Val Gly Pro Asp Gly 35 40 45 cgc agc atc ccg tgg ggg cgg ctg gag cgc gcg gac gcc gtg gac ctc 192 Arg Ser Ile Pro Trp Gly Arg Leu Glu Arg Ala Asp Ala Val Asp Leu 50 55 60 gcg gag cag ctg gcc cag ttc tac ggc ccg gag cct gcc ctg gag gtg 240 Ala Glu Gln Leu Ala Gln Phe Tyr Gly Pro Glu Pro Ala Leu Glu Val 65 70 75 80 gcc cgc aag acc ctc aag agg gcg gac gcg cgc gac gtg gcg gcg cag 288 Ala Arg Lys Thr Leu Lys Arg Ala Asp Ala Arg Asp Val Ala Ala Gln 85 90 95 ctc cag gag cgg cgg ctg cag cgg ctc ggg ctc ggc tcc ggg acg ctg 336 Leu Gln Glu Arg Arg Leu Gln Arg Leu Gly Leu Gly Ser Gly Thr Leu 100 105 110 ctc tcc gtg tcc gag tac aag aag aag tac cgg gag cac gtg ctg cag 384 Leu Ser Val Ser Glu Tyr Lys Lys Lys Tyr Arg Glu His Val Leu Gln 115 120 125 ctg cac gct cgg gtg aag gag agg aac gcc cgc tcc gtg aag atc acc 432 Leu His Ala Arg Val Lys Glu Arg Asn Ala Arg Ser Val Lys Ile Thr 130 135 140 aag cgc ttc acc aag ctg ctc atc gcg ccc gag agc gcc gcc ccg gag 480 Lys Arg Phe Thr Lys Leu Leu Ile Ala Pro Glu Ser Ala Ala Pro Glu 145 150 155 160 gag gcg ctg ggg ccc gcg gaa gag cct gag ccg ggg cgc gcg cgg cgc 528 Glu Ala Leu Gly Pro Ala Glu Glu Pro Glu Pro Gly Arg Ala Arg Arg 165 170 175 tcg gac acg cac act ttc aac cgc ctc ttc cgc cgc gac gag gag ggc 576 Ser Asp Thr His Thr Phe Asn Arg Leu Phe Arg Arg Asp Glu Glu Gly 180 185 190 cgg cgg ccg ctg acc gtg gtg ctg cag ggc ccg gcg ggc atc ggc aag 624 Arg Arg Pro Leu Thr Val Val Leu Gln Gly Pro Ala Gly Ile Gly Lys 195 200 205 acc atg gcg gcc aaa aag atc ctg tac gac tgg gcg gcg ggc aag ctg 672 Thr Met Ala Ala Lys Lys Ile Leu Tyr Asp Trp Ala Ala Gly Lys Leu 210 215 220 tac cag ggc cag gtg gac ttc gcc ttc ttc atg ccc tgc ggc gag ctg 720 Tyr Gln Gly Gln Val Asp Phe Ala Phe Phe Met Pro Cys Gly Glu Leu 225 230 235 240 ctg gag agg ccg ggc acg cgc agc ctg gct gac ctg atc ctg gac cag 768 Leu Glu Arg Pro Gly Thr Arg Ser Leu Ala Asp Leu Ile Leu Asp Gln 245 250 255 tgc ccc gac cgc ggc gcg ccg gtg ccg cag atg ctg gcc cag ccg cag 816 Cys Pro Asp Arg Gly Ala Pro Val Pro Gln Met Leu Ala Gln Pro Gln 260 265 270 cgg ctg ctc ttc atc ctg gac ggc gcg gac gag ctg ccg gcg ctg ggg 864 Arg Leu Leu Phe Ile Leu Asp Gly Ala Asp Glu Leu Pro Ala Leu Gly 275 280 285 ggc ccc gag gcc gcg ccc tgc aca gac ccc ttc gag gcg gcg agc ggc 912 Gly Pro Glu Ala Ala Pro Cys Thr Asp Pro Phe Glu Ala Ala Ser Gly 290 295 300 gcg cgg gtg cta ggc ggg ctg ctg agc aag gcg ctg ctg ccc acg gcc 960 Ala Arg Val Leu Gly Gly Leu Leu Ser Lys Ala Leu Leu Pro Thr Ala 305 310 315 320 ctc ctg ctg gtg acc acg cgc gcc gcc gcc ccc ggg agg ctg cag ggc 1008 Leu Leu Leu Val Thr Thr Arg Ala Ala Ala Pro Gly Arg Leu Gln Gly 325 330 335 cgc ctg tgt tcc ccg cag tgc gcc gag gtg cgc ggc ttc tcc gac aag 1056 Arg Leu Cys Ser Pro Gln Cys Ala Glu Val Arg Gly Phe Ser Asp Lys 340 345 350 gac aag aag aag tat ttc tac aag ttc ttc cgg gat gag agg agg gcc 1104 Asp Lys Lys Lys Tyr Phe Tyr Lys Phe Phe Arg Asp Glu Arg Arg Ala 355 360 365 gag cgc gcc tac cgc ttc gtg aag gag aac gag acg ctg ttc gcg ctg 1152 Glu Arg Ala Tyr Arg Phe Val Lys Glu Asn Glu Thr Leu Phe Ala Leu 370 375 380 tgc ttc gtg ccc ttc gtg tgc tgg atc gtg tgc acc gtg ctg cgc cag 1200 Cys Phe Val Pro Phe Val Cys Trp Ile Val Cys Thr Val Leu Arg Gln 385 390 395 400 cag ctg gag ctc ggt cgg gac ctg tcg cgc acg tcc aag acc acc acg 1248 Gln Leu Glu Leu Gly Arg Asp Leu Ser Arg Thr Ser Lys Thr Thr Thr 405 410 415 tca gtg tac ctg ctt ttc atc acc agc gtt ctg agc tcg gct ccg gta 1296 Ser Val Tyr Leu Leu Phe Ile Thr Ser Val Leu Ser Ser Ala Pro Val 420 425 430 gcc gac ggg ccc cgg ttg cag ggc gac ctg cgc aat ctg tgc cgc ctg 1344 Ala Asp Gly Pro Arg Leu Gln Gly Asp Leu Arg Asn Leu Cys Arg Leu 435 440 445 gcc cgc gag ggc gtc ctc gga cgc agg gcg cag ttt gcc gag aag gaa 1392 Ala Arg Glu Gly Val Leu Gly Arg Arg Ala Gln Phe Ala Glu Lys Glu 450 455 460 ctg gag caa ctg gag ctt cgt ggc tcc aaa gtg cag acg ctg ttt ctc 1440 Leu Glu Gln Leu Glu Leu Arg Gly Ser Lys Val Gln Thr Leu Phe Leu 465 470 475 480 agc aaa aag gag ctg ccg ggc gtg ctg gag aca gag gtc acc tac cag 1488 Ser Lys Lys Glu Leu Pro Gly Val Leu Glu Thr Glu Val Thr Tyr Gln 485 490 495 ttc atc gac cag agc ttc cag gag ttc ctc gcg gca ctg tcc tac ctg 1536 Phe Ile Asp Gln Ser Phe Gln Glu Phe Leu Ala Ala Leu Ser Tyr Leu 500 505 510 ctg gag gac ggc ggg gtg ccc agg acc gcg gct ggc ggc gtt ggg aca 1584 Leu Glu Asp Gly Gly Val Pro Arg Thr Ala Ala Gly Gly Val Gly Thr 515 520 525 ctc ctg cgt ggg gac gcc cag ccg cac agc cac ttg gtg ctc acc acg 1632 Leu Leu Arg Gly Asp Ala Gln Pro His Ser His Leu Val Leu Thr Thr 530 535 540 cgc ttc ctc ttc gga ctg ctg agc gcg gag cgg atg cgc gac atc gag 1680 Arg Phe Leu Phe Gly Leu Leu Ser Ala Glu Arg Met Arg Asp Ile Glu 545 550 555 560 cgc cac ttc ggc tgc atg gtt tca gag cgt gtg aag cag gag gcc ctg 1728 Arg His Phe Gly Cys Met Val Ser Glu Arg Val Lys Gln Glu Ala Leu 565 570 575 cgg tgg gtg cag gga cag gga cag ggc tgc ccc gga gtg gca cca gag 1776 Arg Trp Val Gln Gly Gln Gly Gln Gly Cys Pro Gly Val Ala Pro Glu 580 585 590 gtg acc gag ggg gcc aaa ggg ctc gag gac acc gaa gag cca gag gag 1824 Val Thr Glu Gly Ala Lys Gly Leu Glu Asp Thr Glu Glu Pro Glu Glu 595 600 605 gag gag gag gga gag gag ccc aac tac cca ctg gag ttg ctg tac tgc 1872 Glu Glu Glu Gly Glu Glu Pro Asn Tyr Pro Leu Glu Leu Leu Tyr Cys 610 615 620 ctg tac gag acg cag gag gac gcg ttt gtg cgc caa gcc ctg tgc cgg 1920 Leu Tyr Glu Thr Gln Glu Asp Ala Phe Val Arg Gln Ala Leu Cys Arg 625 630 635 640 ttc ccg gag ctg gcg ctg cag cga gtg cgc ttc tgc cgc atg gac gtg 1968 Phe Pro Glu Leu Ala Leu Gln Arg Val Arg Phe Cys Arg Met Asp Val 645 650 655 gct gtt ctg agc tac tgc gtg agg tgc tgc cct gct gga cag gca ctg 2016 Ala Val Leu Ser Tyr Cys Val Arg Cys Cys Pro Ala Gly Gln Ala Leu 660 665 670 cgg ctg atc agc tgc aga ttg gtt gct gcg cag gag aag aag aag aag 2064 Arg Leu Ile Ser Cys Arg Leu Val Ala Ala Gln Glu Lys Lys Lys Lys 675 680 685 agc ctg ggg aag cgg ctc cag gcc agc ctg ggt ggc ggc agc tgg ctg 2112 Ser Leu Gly Lys Arg Leu Gln Ala Ser Leu Gly Gly Gly Ser Trp Leu 690 695 700 ggg acc caa ctg gct cca gaa gta ccc ttt cga cca ccc tgc tgt gac 2160 Gly Thr Gln Leu Ala Pro Glu Val Pro Phe Arg Pro Pro Cys Cys Asp 705 710 715 720 atc tgc ccc aca cct cca cca gac cct cgg ctc ctc cag ggc aag gct 2208 Ile Cys Pro Thr Pro Pro Pro Asp Pro Arg Leu Leu Gln Gly Lys Ala 725 730 735 ttt gcc aga gtt cct ttg aat ata gct cca att cag ccc ctg ccc agg 2256 Phe Ala Arg Val Pro Leu Asn Ile Ala Pro Ile Gln Pro Leu Pro Arg 740 745 750 ggc ttg gca tct gtt gag agg atg aat gtc acg gtg ttg gca ggg gct 2304 Gly Leu Ala Ser Val Glu Arg Met Asn Val Thr Val Leu Ala Gly Ala 755 760 765 ggg cct ggg gac cca aag acc cat gca atg act gac cca ctg tgc cat 2352 Gly Pro Gly Asp Pro Lys Thr His Ala Met Thr Asp Pro Leu Cys His 770 775 780 ctg agc agc ctc acg ctg tcc cac tgc aaa ctc cct gac gcg gtc tgc 2400 Leu Ser Ser Leu Thr Leu Ser His Cys Lys Leu Pro Asp Ala Val Cys 785 790 795 800 cga gac ctt tct gag gcc ctg agg gca gcc ccc gca ctg acg gag ctg 2448 Arg Asp Leu Ser Glu Ala Leu Arg Ala Ala Pro Ala Leu Thr Glu Leu 805 810 815 ggc ctc ctc cac aac agg ctc agt gag gca gga ctg cgt atg ctg agt 2496 Gly Leu Leu His Asn Arg Leu Ser Glu Ala Gly Leu Arg Met Leu Ser 820 825 830 gag ggc cta gcc tgg ccg cag tgc agg gtg cag acg gtc agg gta cag 2544 Glu Gly Leu Ala Trp Pro Gln Cys Arg Val Gln Thr Val Arg Val Gln 835 840 845 ctg cct gac ccc cag cga ggg ctc cag tac ctg gtg ggt atg ctt cgg 2592 Leu Pro Asp Pro Gln Arg Gly Leu Gln Tyr Leu Val Gly Met Leu Arg 850 855 860 cag agc cct gcc ctg acc acc ctg gat ctc agc ggc tgc caa ctg ccc 2640 Gln Ser Pro Ala Leu Thr Thr Leu Asp Leu Ser Gly Cys Gln Leu Pro 865 870 875 880 gcc ccc atg gtg acc tac ctg tgt gca gtc ctg cag cac cag gga tgc 2688 Ala Pro Met Val Thr Tyr Leu Cys Ala Val Leu Gln His Gln Gly Cys 885 890 895 ggc ctg cag acc ctc agt ctg gcc tct gtg gag ctg agc gag cag tca 2736 Gly Leu Gln Thr Leu Ser Leu Ala Ser Val Glu Leu Ser Glu Gln Ser 900 905 910 cta cag gag ctt cag gct gtg aag aga gca aag ccg gat ctg gtc atc 2784 Leu Gln Glu Leu Gln Ala Val Lys Arg Ala Lys Pro Asp Leu Val Ile 915 920 925 aca cac cca gcg ctg gac ggc cac cca caa cct ccc aag gaa ctc atc 2832 Thr His Pro Ala Leu Asp Gly His Pro Gln Pro Pro Lys Glu Leu Ile 930 935 940 tcg acc ttc tga 2844 Ser Thr Phe 945 <210> SEQ ID NO 18 <211> LENGTH: 947 <212> TYPE: PRT <213> ORGANISM: Homo sapien <400> SEQUENCE: 18 Met Asp Gln Pro Glu Ala Pro Cys Ser Ser Thr Gly Pro Arg Leu Ala 1 5 10 15 Val Ala Arg Glu Leu Leu Leu Ala Ala Leu Glu Glu Leu Ser Gln Glu 20 25 30 Gln Leu Lys Arg Phe Arg His Lys Leu Arg Asp Val Gly Pro Asp Gly 35 40 45 Arg Ser Ile Pro Trp Gly Arg Leu Glu Arg Ala Asp Ala Val Asp Leu 50 55 60 Ala Glu Gln Leu Ala Gln Phe Tyr Gly Pro Glu Pro Ala Leu Glu Val 65 70 75 80 Ala Arg Lys Thr Leu Lys Arg Ala Asp Ala Arg Asp Val Ala Ala Gln 85 90 95 Leu Gln Glu Arg Arg Leu Gln Arg Leu Gly Leu Gly Ser Gly Thr Leu 100 105 110 Leu Ser Val Ser Glu Tyr Lys Lys Lys Tyr Arg Glu His Val Leu Gln 115 120 125 Leu His Ala Arg Val Lys Glu Arg Asn Ala Arg Ser Val Lys Ile Thr 130 135 140 Lys Arg Phe Thr Lys Leu Leu Ile Ala Pro Glu Ser Ala Ala Pro Glu 145 150 155 160 Glu Ala Leu Gly Pro Ala Glu Glu Pro Glu Pro Gly Arg Ala Arg Arg 165 170 175 Ser Asp Thr His Thr Phe Asn Arg Leu Phe Arg Arg Asp Glu Glu Gly 180 185 190 Arg Arg Pro Leu Thr Val Val Leu Gln Gly Pro Ala Gly Ile Gly Lys 195 200 205 Thr Met Ala Ala Lys Lys Ile Leu Tyr Asp Trp Ala Ala Gly Lys Leu 210 215 220 Tyr Gln Gly Gln Val Asp Phe Ala Phe Phe Met Pro Cys Gly Glu Leu 225 230 235 240 Leu Glu Arg Pro Gly Thr Arg Ser Leu Ala Asp Leu Ile Leu Asp Gln 245 250 255 Cys Pro Asp Arg Gly Ala Pro Val Pro Gln Met Leu Ala Gln Pro Gln 260 265 270 Arg Leu Leu Phe Ile Leu Asp Gly Ala Asp Glu Leu Pro Ala Leu Gly 275 280 285 Gly Pro Glu Ala Ala Pro Cys Thr Asp Pro Phe Glu Ala Ala Ser Gly 290 295 300 Ala Arg Val Leu Gly Gly Leu Leu Ser Lys Ala Leu Leu Pro Thr Ala 305 310 315 320 Leu Leu Leu Val Thr Thr Arg Ala Ala Ala Pro Gly Arg Leu Gln Gly 325 330 335 Arg Leu Cys Ser Pro Gln Cys Ala Glu Val Arg Gly Phe Ser Asp Lys 340 345 350 Asp Lys Lys Lys Tyr Phe Tyr Lys Phe Phe Arg Asp Glu Arg Arg Ala 355 360 365 Glu Arg Ala Tyr Arg Phe Val Lys Glu Asn Glu Thr Leu Phe Ala Leu 370 375 380 Cys Phe Val Pro Phe Val Cys Trp Ile Val Cys Thr Val Leu Arg Gln 385 390 395 400 Gln Leu Glu Leu Gly Arg Asp Leu Ser Arg Thr Ser Lys Thr Thr Thr 405 410 415 Ser Val Tyr Leu Leu Phe Ile Thr Ser Val Leu Ser Ser Ala Pro Val 420 425 430 Ala Asp Gly Pro Arg Leu Gln Gly Asp Leu Arg Asn Leu Cys Arg Leu 435 440 445 Ala Arg Glu Gly Val Leu Gly Arg Arg Ala Gln Phe Ala Glu Lys Glu 450 455 460 Leu Glu Gln Leu Glu Leu Arg Gly Ser Lys Val Gln Thr Leu Phe Leu 465 470 475 480 Ser Lys Lys Glu Leu Pro Gly Val Leu Glu Thr Glu Val Thr Tyr Gln 485 490 495 Phe Ile Asp Gln Ser Phe Gln Glu Phe Leu Ala Ala Leu Ser Tyr Leu 500 505 510 Leu Glu Asp Gly Gly Val Pro Arg Thr Ala Ala Gly Gly Val Gly Thr 515 520 525 Leu Leu Arg Gly Asp Ala Gln Pro His Ser His Leu Val Leu Thr Thr 530 535 540 Arg Phe Leu Phe Gly Leu Leu Ser Ala Glu Arg Met Arg Asp Ile Glu 545 550 555 560 Arg His Phe Gly Cys Met Val Ser Glu Arg Val Lys Gln Glu Ala Leu 565 570 575 Arg Trp Val Gln Gly Gln Gly Gln Gly Cys Pro Gly Val Ala Pro Glu 580 585 590 Val Thr Glu Gly Ala Lys Gly Leu Glu Asp Thr Glu Glu Pro Glu Glu 595 600 605 Glu Glu Glu Gly Glu Glu Pro Asn Tyr Pro Leu Glu Leu Leu Tyr Cys 610 615 620 Leu Tyr Glu Thr Gln Glu Asp Ala Phe Val Arg Gln Ala Leu Cys Arg 625 630 635 640 Phe Pro Glu Leu Ala Leu Gln Arg Val Arg Phe Cys Arg Met Asp Val 645 650 655 Ala Val Leu Ser Tyr Cys Val Arg Cys Cys Pro Ala Gly Gln Ala Leu 660 665 670 Arg Leu Ile Ser Cys Arg Leu Val Ala Ala Gln Glu Lys Lys Lys Lys 675 680 685 Ser Leu Gly Lys Arg Leu Gln Ala Ser Leu Gly Gly Gly Ser Trp Leu 690 695 700 Gly Thr Gln Leu Ala Pro Glu Val Pro Phe Arg Pro Pro Cys Cys Asp 705 710 715 720 Ile Cys Pro Thr Pro Pro Pro Asp Pro Arg Leu Leu Gln Gly Lys Ala 725 730 735 Phe Ala Arg Val Pro Leu Asn Ile Ala Pro Ile Gln Pro Leu Pro Arg 740 745 750 Gly Leu Ala Ser Val Glu Arg Met Asn Val Thr Val Leu Ala Gly Ala 755 760 765 Gly Pro Gly Asp Pro Lys Thr His Ala Met Thr Asp Pro Leu Cys His 770 775 780 Leu Ser Ser Leu Thr Leu Ser His Cys Lys Leu Pro Asp Ala Val Cys 785 790 795 800 Arg Asp Leu Ser Glu Ala Leu Arg Ala Ala Pro Ala Leu Thr Glu Leu 805 810 815 Gly Leu Leu His Asn Arg Leu Ser Glu Ala Gly Leu Arg Met Leu Ser 820 825 830 Glu Gly Leu Ala Trp Pro Gln Cys Arg Val Gln Thr Val Arg Val Gln 835 840 845 Leu Pro Asp Pro Gln Arg Gly Leu Gln Tyr Leu Val Gly Met Leu Arg 850 855 860 Gln Ser Pro Ala Leu Thr Thr Leu Asp Leu Ser Gly Cys Gln Leu Pro 865 870 875 880 Ala Pro Met Val Thr Tyr Leu Cys Ala Val Leu Gln His Gln Gly Cys 885 890 895 Gly Leu Gln Thr Leu Ser Leu Ala Ser Val Glu Leu Ser Glu Gln Ser 900 905 910 Leu Gln Glu Leu Gln Ala Val Lys Arg Ala Lys Pro Asp Leu Val Ile 915 920 925 Thr His Pro Ala Leu Asp Gly His Pro Gln Pro Pro Lys Glu Leu Ile 930 935 940 Ser Thr Phe 945 <210> SEQ ID NO 19 <211> LENGTH: 2046 <212> TYPE: DNA <213> ORGANISM: Homo sapien <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (1)...(2043) <400> SEQUENCE: 19 atg agt gac gtg aat cca ccc tct gac acc ccc att ccc ttt tca tcc 48 Met Ser Asp Val Asn Pro Pro Ser Asp Thr Pro Ile Pro Phe Ser Ser 1 5 10 15 tcc tcc act cac agt tct cat att ccg ccc tgg aca ttc tct tgc tac 96 Ser Ser Thr His Ser Ser His Ile Pro Pro Trp Thr Phe Ser Cys Tyr 20 25 30 ccc ggc tcc cca tgt gaa aat ggg gtc atg ctg tac atg aga aac gtg 144 Pro Gly Ser Pro Cys Glu Asn Gly Val Met Leu Tyr Met Arg Asn Val 35 40 45 agc cat gag gag cta caa cgg ttc aag cag ctc tta ctg act gag ctc 192 Ser His Glu Glu Leu Gln Arg Phe Lys Gln Leu Leu Leu Thr Glu Leu 50 55 60 agt act ggc acc atg ccc atc acc tgg gac cag gtc gag aca gcc agc 240 Ser Thr Gly Thr Met Pro Ile Thr Trp Asp Gln Val Glu Thr Ala Ser 65 70 75 80 tgg gca gag gtg gtt cat ctc ttg ata gag cgt ttc cct gga cga cgc 288 Trp Ala Glu Val Val His Leu Leu Ile Glu Arg Phe Pro Gly Arg Arg 85 90 95 gct tgg gat gtg act tcg aac atc ttt gcc att atg aac tgt gat aaa 336 Ala Trp Asp Val Thr Ser Asn Ile Phe Ala Ile Met Asn Cys Asp Lys 100 105 110 atg tgt gtt gta gtc cgc aga gag ata aat gcc att ctg cct acc ttg 384 Met Cys Val Val Val Arg Arg Glu Ile Asn Ala Ile Leu Pro Thr Leu 115 120 125 gaa cca gag gac ttg aat gtg gga gaa aca cag gtg aat ctg gag gaa 432 Glu Pro Glu Asp Leu Asn Val Gly Glu Thr Gln Val Asn Leu Glu Glu 130 135 140 gga gaa tct ggt aaa ata cgg cgg tat aaa tcg aat gtg atg gaa aag 480 Gly Glu Ser Gly Lys Ile Arg Arg Tyr Lys Ser Asn Val Met Glu Lys 145 150 155 160 ttt ttc ccc ata tgg gac att acg act tgg cct gga aac cag agg gac 528 Phe Phe Pro Ile Trp Asp Ile Thr Thr Trp Pro Gly Asn Gln Arg Asp 165 170 175 ttc ttc tac caa ggt gta cac agg cac gag gag tac tta cca tgt ctg 576 Phe Phe Tyr Gln Gly Val His Arg His Glu Glu Tyr Leu Pro Cys Leu 180 185 190 ctt ctg ccc aaa aga ccc cag ggt aga cag ccc aag acc gtg gcc ata 624 Leu Leu Pro Lys Arg Pro Gln Gly Arg Gln Pro Lys Thr Val Ala Ile 195 200 205 cag gga gct cct ggg atc gga aaa aca atc ctg gcc aaa aag gtg atg 672 Gln Gly Ala Pro Gly Ile Gly Lys Thr Ile Leu Ala Lys Lys Val Met 210 215 220 ttt gag tgg gcc aga aac aag ttc tac gcc cac aag cgc tgg tgt gct 720 Phe Glu Trp Ala Arg Asn Lys Phe Tyr Ala His Lys Arg Trp Cys Ala 225 230 235 240 ttc tac ttc cat tgc caa gag gtg aac cag acg aca gac cag agc ttc 768 Phe Tyr Phe His Cys Gln Glu Val Asn Gln Thr Thr Asp Gln Ser Phe 245 250 255 tcc gag ctg att gag caa aag tgg cct gga tct cag gac ctc gtg tca 816 Ser Glu Leu Ile Glu Gln Lys Trp Pro Gly Ser Gln Asp Leu Val Ser 260 265 270 aag att atg tcc aaa ccc gac caa ctt ctg ctg ctc ttg gat ggc ttt 864 Lys Ile Met Ser Lys Pro Asp Gln Leu Leu Leu Leu Leu Asp Gly Phe 275 280 285 gag gag ctc aca tct acc ctc att gac aga ctg gag gac ctg agt gaa 912 Glu Glu Leu Thr Ser Thr Leu Ile Asp Arg Leu Glu Asp Leu Ser Glu 290 295 300 gac tgg agg cag aaa ttg cct ggg tct gtc cta ctg agc agt ttg ctg 960 Asp Trp Arg Gln Lys Leu Pro Gly Ser Val Leu Leu Ser Ser Leu Leu 305 310 315 320 agc aaa acg atg ctt cca gag gcc acg cta ctg atc atg ata aga ttt 1008 Ser Lys Thr Met Leu Pro Glu Ala Thr Leu Leu Ile Met Ile Arg Phe 325 330 335 acc tct tgg cag aca tgc aag ccc ttg ctg aaa tgt ccc tct ctc gta 1056 Thr Ser Trp Gln Thr Cys Lys Pro Leu Leu Lys Cys Pro Ser Leu Val 340 345 350 acc ctt ccg ggg ttt aat acg atg gaa aaa atc aag tat ttc cag atg 1104 Thr Leu Pro Gly Phe Asn Thr Met Glu Lys Ile Lys Tyr Phe Gln Met 355 360 365 tat ttt gga cac aca gag gag gga gac caa gtc ttg agt ttc gcc atg 1152 Tyr Phe Gly His Thr Glu Glu Gly Asp Gln Val Leu Ser Phe Ala Met 370 375 380 gaa aac acc att ctc ttc tcc atg tgc cgg gtc cct gtg gtt tgc tgg 1200 Glu Asn Thr Ile Leu Phe Ser Met Cys Arg Val Pro Val Val Cys Trp 385 390 395 400 atg gtc tgc tct ggt ctg aaa cag caa atg gag aga gga aac aat ctc 1248 Met Val Cys Ser Gly Leu Lys Gln Gln Met Glu Arg Gly Asn Asn Leu 405 410 415 aca cag tca tgt cca aat gcc acc tct gtg ttc gtc cgg tat att tct 1296 Thr Gln Ser Cys Pro Asn Ala Thr Ser Val Phe Val Arg Tyr Ile Ser 420 425 430 agc ttg ttt ccc acc aga gct gag aac ttt tcc aga aag atc cac caa 1344 Ser Leu Phe Pro Thr Arg Ala Glu Asn Phe Ser Arg Lys Ile His Gln 435 440 445 gca caa ctg gaa ggt ctg tgt cac ttg gcc gca gac agc atg tgg cac 1392 Ala Gln Leu Glu Gly Leu Cys His Leu Ala Ala Asp Ser Met Trp His 450 455 460 agg aaa tgg gtg tta ggt aaa gaa gat ctt gag gaa gcc aag ctg gat 1440 Arg Lys Trp Val Leu Gly Lys Glu Asp Leu Glu Glu Ala Lys Leu Asp 465 470 475 480 cag acg gga gtc acc gcc ttc ctt ggc atg agt att ctt cgg aga att 1488 Gln Thr Gly Val Thr Ala Phe Leu Gly Met Ser Ile Leu Arg Arg Ile 485 490 495 gca ggt gag gaa gac cac tat gtc ttt acc ctc gtg act ttt cag gaa 1536 Ala Gly Glu Glu Asp His Tyr Val Phe Thr Leu Val Thr Phe Gln Glu 500 505 510 ttt ttt gcg gcc ttg ttt tat gtt ctc tgt ttc cca caa aga ctc aaa 1584 Phe Phe Ala Ala Leu Phe Tyr Val Leu Cys Phe Pro Gln Arg Leu Lys 515 520 525 aat ttt cat gtg ttg agc cac gtg aat atc cag cgc ctg ata gcg agt 1632 Asn Phe His Val Leu Ser His Val Asn Ile Gln Arg Leu Ile Ala Ser 530 535 540 ccc aga gga agc aaa agc tat ctc tct cac atg gga ctt ttc tta ttc 1680 Pro Arg Gly Ser Lys Ser Tyr Leu Ser His Met Gly Leu Phe Leu Phe 545 550 555 560 ggt ttt ctg aac gag gcc tgc gct tcg gcc gtg gaa cag tca ttc caa 1728 Gly Phe Leu Asn Glu Ala Cys Ala Ser Ala Val Glu Gln Ser Phe Gln 565 570 575 tgc aag gtg tct ttc ggt aat aag agg aaa ctg ctg aaa gtc ata cct 1776 Cys Lys Val Ser Phe Gly Asn Lys Arg Lys Leu Leu Lys Val Ile Pro 580 585 590 ctg ttg cat aaa tgt gac cca cct tct ccg ggc agt ggg gtc ccg cag 1824 Leu Leu His Lys Cys Asp Pro Pro Ser Pro Gly Ser Gly Val Pro Gln 595 600 605 tta ttc tac tgt ctg cat gaa atc cgg gag gaa gcc ttt gta agc caa 1872 Leu Phe Tyr Cys Leu His Glu Ile Arg Glu Glu Ala Phe Val Ser Gln 610 615 620 gcc cta aat gat tat cat aaa gtt gtc ttg aga att ggc aac aac aaa 1920 Ala Leu Asn Asp Tyr His Lys Val Val Leu Arg Ile Gly Asn Asn Lys 625 630 635 640 gaa gtt caa gtg tct gct ttt tgc ctg aag cgg tgt caa tat ttg cat 1968 Glu Val Gln Val Ser Ala Phe Cys Leu Lys Arg Cys Gln Tyr Leu His 645 650 655 gag gtg gaa ctg acc gtc acc ctg aac ttc atg aac gtg tgg aag ctc 2016 Glu Val Glu Leu Thr Val Thr Leu Asn Phe Met Asn Val Trp Lys Leu 660 665 670 agc tcc agc tcc cat cct ggc tct gag taa 2046 Ser Ser Ser Ser His Pro Gly Ser Glu 675 680 <210> SEQ ID NO 20 <211> LENGTH: 681 <212> TYPE: PRT <213> ORGANISM: Homo sapien <400> SEQUENCE: 20 Met Ser Asp Val Asn Pro Pro Ser Asp Thr Pro Ile Pro Phe Ser Ser 1 5 10 15 Ser Ser Thr His Ser Ser His Ile Pro Pro Trp Thr Phe Ser Cys Tyr 20 25 30 Pro Gly Ser Pro Cys Glu Asn Gly Val Met Leu Tyr Met Arg Asn Val 35 40 45 Ser His Glu Glu Leu Gln Arg Phe Lys Gln Leu Leu Leu Thr Glu Leu 50 55 60 Ser Thr Gly Thr Met Pro Ile Thr Trp Asp Gln Val Glu Thr Ala Ser 65 70 75 80 Trp Ala Glu Val Val His Leu Leu Ile Glu Arg Phe Pro Gly Arg Arg 85 90 95 Ala Trp Asp Val Thr Ser Asn Ile Phe Ala Ile Met Asn Cys Asp Lys 100 105 110 Met Cys Val Val Val Arg Arg Glu Ile Asn Ala Ile Leu Pro Thr Leu 115 120 125 Glu Pro Glu Asp Leu Asn Val Gly Glu Thr Gln Val Asn Leu Glu Glu 130 135 140 Gly Glu Ser Gly Lys Ile Arg Arg Tyr Lys Ser Asn Val Met Glu Lys 145 150 155 160 Phe Phe Pro Ile Trp Asp Ile Thr Thr Trp Pro Gly Asn Gln Arg Asp 165 170 175 Phe Phe Tyr Gln Gly Val His Arg His Glu Glu Tyr Leu Pro Cys Leu 180 185 190 Leu Leu Pro Lys Arg Pro Gln Gly Arg Gln Pro Lys Thr Val Ala Ile 195 200 205 Gln Gly Ala Pro Gly Ile Gly Lys Thr Ile Leu Ala Lys Lys Val Met 210 215 220 Phe Glu Trp Ala Arg Asn Lys Phe Tyr Ala His Lys Arg Trp Cys Ala 225 230 235 240 Phe Tyr Phe His Cys Gln Glu Val Asn Gln Thr Thr Asp Gln Ser Phe 245 250 255 Ser Glu Leu Ile Glu Gln Lys Trp Pro Gly Ser Gln Asp Leu Val Ser 260 265 270 Lys Ile Met Ser Lys Pro Asp Gln Leu Leu Leu Leu Leu Asp Gly Phe 275 280 285 Glu Glu Leu Thr Ser Thr Leu Ile Asp Arg Leu Glu Asp Leu Ser Glu 290 295 300 Asp Trp Arg Gln Lys Leu Pro Gly Ser Val Leu Leu Ser Ser Leu Leu 305 310 315 320 Ser Lys Thr Met Leu Pro Glu Ala Thr Leu Leu Ile Met Ile Arg Phe 325 330 335 Thr Ser Trp Gln Thr Cys Lys Pro Leu Leu Lys Cys Pro Ser Leu Val 340 345 350 Thr Leu Pro Gly Phe Asn Thr Met Glu Lys Ile Lys Tyr Phe Gln Met 355 360 365 Tyr Phe Gly His Thr Glu Glu Gly Asp Gln Val Leu Ser Phe Ala Met 370 375 380 Glu Asn Thr Ile Leu Phe Ser Met Cys Arg Val Pro Val Val Cys Trp 385 390 395 400 Met Val Cys Ser Gly Leu Lys Gln Gln Met Glu Arg Gly Asn Asn Leu 405 410 415 Thr Gln Ser Cys Pro Asn Ala Thr Ser Val Phe Val Arg Tyr Ile Ser 420 425 430 Ser Leu Phe Pro Thr Arg Ala Glu Asn Phe Ser Arg Lys Ile His Gln 435 440 445 Ala Gln Leu Glu Gly Leu Cys His Leu Ala Ala Asp Ser Met Trp His 450 455 460 Arg Lys Trp Val Leu Gly Lys Glu Asp Leu Glu Glu Ala Lys Leu Asp 465 470 475 480 Gln Thr Gly Val Thr Ala Phe Leu Gly Met Ser Ile Leu Arg Arg Ile 485 490 495 Ala Gly Glu Glu Asp His Tyr Val Phe Thr Leu Val Thr Phe Gln Glu 500 505 510 Phe Phe Ala Ala Leu Phe Tyr Val Leu Cys Phe Pro Gln Arg Leu Lys 515 520 525 Asn Phe His Val Leu Ser His Val Asn Ile Gln Arg Leu Ile Ala Ser 530 535 540 Pro Arg Gly Ser Lys Ser Tyr Leu Ser His Met Gly Leu Phe Leu Phe 545 550 555 560 Gly Phe Leu Asn Glu Ala Cys Ala Ser Ala Val Glu Gln Ser Phe Gln 565 570 575 Cys Lys Val Ser Phe Gly Asn Lys Arg Lys Leu Leu Lys Val Ile Pro 580 585 590 Leu Leu His Lys Cys Asp Pro Pro Ser Pro Gly Ser Gly Val Pro Gln 595 600 605 Leu Phe Tyr Cys Leu His Glu Ile Arg Glu Glu Ala Phe Val Ser Gln 610 615 620 Ala Leu Asn Asp Tyr His Lys Val Val Leu Arg Ile Gly Asn Asn Lys 625 630 635 640 Glu Val Gln Val Ser Ala Phe Cys Leu Lys Arg Cys Gln Tyr Leu His 645 650 655 Glu Val Glu Leu Thr Val Thr Leu Asn Phe Met Asn Val Trp Lys Leu 660 665 670 Ser Ser Ser Ser His Pro Gly Ser Glu 675 680 <210> SEQ ID NO 21 <211> LENGTH: 1515 <212> TYPE: DNA <213> ORGANISM: Homo sapien <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (1)...(1512) <400> SEQUENCE: 21 atg gcc atg gcc aag gcc aga aag ccc cgg gag gca ttg ctc tgg gcc 48 Met Ala Met Ala Lys Ala Arg Lys Pro Arg Glu Ala Leu Leu Trp Ala 1 5 10 15 ttg agt gac ctt gag gag aac gat ttc aag aag tta aag ttc tac tta 96 Leu Ser Asp Leu Glu Glu Asn Asp Phe Lys Lys Leu Lys Phe Tyr Leu 20 25 30 cgg gat atg acc ctg tct gag ggc cag ccc cca ctg gcc aga ggg gag 144 Arg Asp Met Thr Leu Ser Glu Gly Gln Pro Pro Leu Ala Arg Gly Glu 35 40 45 ttg gag ggc ctg att ccg gtg gac ctg gca gaa tta ctg att tca aag 192 Leu Glu Gly Leu Ile Pro Val Asp Leu Ala Glu Leu Leu Ile Ser Lys 50 55 60 tat gga gaa aag gag gct gtg aaa gtt gtc ctc aag ggc ttg aag gtc 240 Tyr Gly Glu Lys Glu Ala Val Lys Val Val Leu Lys Gly Leu Lys Val 65 70 75 80 atg aac ctg ttg gaa ctt gtg gac cag ctc agc cat att tgt ctg cat 288 Met Asn Leu Leu Glu Leu Val Asp Gln Leu Ser His Ile Cys Leu His 85 90 95 ggg gtc ggc tgg cac tgg aaa gac aac tct cgc cag aaa aag gtg ttg 336 Gly Val Gly Trp His Trp Lys Asp Asn Ser Arg Gln Lys Lys Val Leu 100 105 110 gac tgg gcc acc ggt act ctg tac cca ggc cgg ttt gat tat gtc ttt 384 Asp Trp Ala Thr Gly Thr Leu Tyr Pro Gly Arg Phe Asp Tyr Val Phe 115 120 125 tat gta agc tgc aaa gaa gtg gtc ctg ctg ctg gag agc aaa ctg gag 432 Tyr Val Ser Cys Lys Glu Val Val Leu Leu Leu Glu Ser Lys Leu Glu 130 135 140 cag ctc ctt ttc tgg tgc tgc ggg gac aat caa gcc cct gtc aca gag 480 Gln Leu Leu Phe Trp Cys Cys Gly Asp Asn Gln Ala Pro Val Thr Glu 145 150 155 160 att ctg agg cag cca gag cgg ctc ctg ttc atc ctg gat ggc ttt gat 528 Ile Leu Arg Gln Pro Glu Arg Leu Leu Phe Ile Leu Asp Gly Phe Asp 165 170 175 gag ctg cag agg ccc ttt gaa gaa aag ttg aag aag agg ggt ttg agt 576 Glu Leu Gln Arg Pro Phe Glu Glu Lys Leu Lys Lys Arg Gly Leu Ser 180 185 190 ccc aag gag agc ctg ctg cac ctt cta att agg aga cat aca ctc ccc 624 Pro Lys Glu Ser Leu Leu His Leu Leu Ile Arg Arg His Thr Leu Pro 195 200 205 acg tgc tcc ctt ctc atc acc acc cgg ccc ctg gct ttg agg aat ctg 672 Thr Cys Ser Leu Leu Ile Thr Thr Arg Pro Leu Ala Leu Arg Asn Leu 210 215 220 gag ccc ttg ctg aaa caa gca cgt cat gtc cat atc cta ggc ttc tct 720 Glu Pro Leu Leu Lys Gln Ala Arg His Val His Ile Leu Gly Phe Ser 225 230 235 240 gag gag gag agg gcg agg tac ttc agc tcc tat ttc acg gat gag aag 768 Glu Glu Glu Arg Ala Arg Tyr Phe Ser Ser Tyr Phe Thr Asp Glu Lys 245 250 255 caa gct gac cgt gcc ttc gac att gta cag aaa aat gac att ctc tac 816 Gln Ala Asp Arg Ala Phe Asp Ile Val Gln Lys Asn Asp Ile Leu Tyr 260 265 270 aaa gcg tgt cag gtt cca ggc att tgc tgg gtg gtc tgc tcc tgg ctg 864 Lys Ala Cys Gln Val Pro Gly Ile Cys Trp Val Val Cys Ser Trp Leu 275 280 285 cag ggg cag atg gag aga ggc aaa gtt gtc tta gag aca cct aga aac 912 Gln Gly Gln Met Glu Arg Gly Lys Val Val Leu Glu Thr Pro Arg Asn 290 295 300 agc act gac atc ttc atg gct tac gtc tcc acc ttt ctg ccg ccc gat 960 Ser Thr Asp Ile Phe Met Ala Tyr Val Ser Thr Phe Leu Pro Pro Asp 305 310 315 320 gat gat ggg ggc tgc tcc gag ctt tcc cgg cac agg gtc ctg agg agt 1008 Asp Asp Gly Gly Cys Ser Glu Leu Ser Arg His Arg Val Leu Arg Ser 325 330 335 ctg tgc tcc cta gca gct gaa ggg att cag cac cag agg ttc cta ttt 1056 Leu Cys Ser Leu Ala Ala Glu Gly Ile Gln His Gln Arg Phe Leu Phe 340 345 350 gaa gaa gct gag ctc agg aaa cat aat tta gat ggc ccc agg ctt gcc 1104 Glu Glu Ala Glu Leu Arg Lys His Asn Leu Asp Gly Pro Arg Leu Ala 355 360 365 gct ttc ctg agt agt aac gac tac caa ttg gga ctt gcc atc aag aag 1152 Ala Phe Leu Ser Ser Asn Asp Tyr Gln Leu Gly Leu Ala Ile Lys Lys 370 375 380 ttc tac agc ttc cgc cac atc agc ttc cag gac ttt ttt cat gcc atg 1200 Phe Tyr Ser Phe Arg His Ile Ser Phe Gln Asp Phe Phe His Ala Met 385 390 395 400 tct tac ctg gtg aaa gag gac caa agc cgg ctg ggg aag gag tcc cgc 1248 Ser Tyr Leu Val Lys Glu Asp Gln Ser Arg Leu Gly Lys Glu Ser Arg 405 410 415 aga gaa gtg caa agg ctg ctg gag gta aag gag cag gaa ggg aat gat 1296 Arg Glu Val Gln Arg Leu Leu Glu Val Lys Glu Gln Glu Gly Asn Asp 420 425 430 gag atg acc ctc act atg cag ttt tta ctg gac atc tcg aaa aaa gac 1344 Glu Met Thr Leu Thr Met Gln Phe Leu Leu Asp Ile Ser Lys Lys Asp 435 440 445 agc ttc tcg aac ttg gag ctc aag ttc tgc ttc aga att tct ccc tgt 1392 Ser Phe Ser Asn Leu Glu Leu Lys Phe Cys Phe Arg Ile Ser Pro Cys 450 455 460 tta gcg cag gat ctg aag cat ttt aaa gaa cag atg gaa tct atg aag 1440 Leu Ala Gln Asp Leu Lys His Phe Lys Glu Gln Met Glu Ser Met Lys 465 470 475 480 cac aac agg acc tgg gat ttg gaa ttc tcc ctg tat gaa gct aaa ata 1488 His Asn Arg Thr Trp Asp Leu Glu Phe Ser Leu Tyr Glu Ala Lys Ile 485 490 495 aag aat ctg gta aaa gta ttc aga tga 1515 Lys Asn Leu Val Lys Val Phe Arg 500 <210> SEQ ID NO 22 <211> LENGTH: 504 <212> TYPE: PRT <213> ORGANISM: Homo sapien <400> SEQUENCE: 22 Met Ala Met Ala Lys Ala Arg Lys Pro Arg Glu Ala Leu Leu Trp Ala 1 5 10 15 Leu Ser Asp Leu Glu Glu Asn Asp Phe Lys Lys Leu Lys Phe Tyr Leu 20 25 30 Arg Asp Met Thr Leu Ser Glu Gly Gln Pro Pro Leu Ala Arg Gly Glu 35 40 45 Leu Glu Gly Leu Ile Pro Val Asp Leu Ala Glu Leu Leu Ile Ser Lys 50 55 60 Tyr Gly Glu Lys Glu Ala Val Lys Val Val Leu Lys Gly Leu Lys Val 65 70 75 80 Met Asn Leu Leu Glu Leu Val Asp Gln Leu Ser His Ile Cys Leu His 85 90 95 Gly Val Gly Trp His Trp Lys Asp Asn Ser Arg Gln Lys Lys Val Leu 100 105 110 Asp Trp Ala Thr Gly Thr Leu Tyr Pro Gly Arg Phe Asp Tyr Val Phe 115 120 125 Tyr Val Ser Cys Lys Glu Val Val Leu Leu Leu Glu Ser Lys Leu Glu 130 135 140 Gln Leu Leu Phe Trp Cys Cys Gly Asp Asn Gln Ala Pro Val Thr Glu 145 150 155 160 Ile Leu Arg Gln Pro Glu Arg Leu Leu Phe Ile Leu Asp Gly Phe Asp 165 170 175 Glu Leu Gln Arg Pro Phe Glu Glu Lys Leu Lys Lys Arg Gly Leu Ser 180 185 190 Pro Lys Glu Ser Leu Leu His Leu Leu Ile Arg Arg His Thr Leu Pro 195 200 205 Thr Cys Ser Leu Leu Ile Thr Thr Arg Pro Leu Ala Leu Arg Asn Leu 210 215 220 Glu Pro Leu Leu Lys Gln Ala Arg His Val His Ile Leu Gly Phe Ser 225 230 235 240 Glu Glu Glu Arg Ala Arg Tyr Phe Ser Ser Tyr Phe Thr Asp Glu Lys 245 250 255 Gln Ala Asp Arg Ala Phe Asp Ile Val Gln Lys Asn Asp Ile Leu Tyr 260 265 270 Lys Ala Cys Gln Val Pro Gly Ile Cys Trp Val Val Cys Ser Trp Leu 275 280 285 Gln Gly Gln Met Glu Arg Gly Lys Val Val Leu Glu Thr Pro Arg Asn 290 295 300 Ser Thr Asp Ile Phe Met Ala Tyr Val Ser Thr Phe Leu Pro Pro Asp 305 310 315 320 Asp Asp Gly Gly Cys Ser Glu Leu Ser Arg His Arg Val Leu Arg Ser 325 330 335 Leu Cys Ser Leu Ala Ala Glu Gly Ile Gln His Gln Arg Phe Leu Phe 340 345 350 Glu Glu Ala Glu Leu Arg Lys His Asn Leu Asp Gly Pro Arg Leu Ala 355 360 365 Ala Phe Leu Ser Ser Asn Asp Tyr Gln Leu Gly Leu Ala Ile Lys Lys 370 375 380 Phe Tyr Ser Phe Arg His Ile Ser Phe Gln Asp Phe Phe His Ala Met 385 390 395 400 Ser Tyr Leu Val Lys Glu Asp Gln Ser Arg Leu Gly Lys Glu Ser Arg 405 410 415 Arg Glu Val Gln Arg Leu Leu Glu Val Lys Glu Gln Glu Gly Asn Asp 420 425 430 Glu Met Thr Leu Thr Met Gln Phe Leu Leu Asp Ile Ser Lys Lys Asp 435 440 445 Ser Phe Ser Asn Leu Glu Leu Lys Phe Cys Phe Arg Ile Ser Pro Cys 450 455 460 Leu Ala Gln Asp Leu Lys His Phe Lys Glu Gln Met Glu Ser Met Lys 465 470 475 480 His Asn Arg Thr Trp Asp Leu Glu Phe Ser Leu Tyr Glu Ala Lys Ile 485 490 495 Lys Asn Leu Val Lys Val Phe Arg 500 <210> SEQ ID NO 23 <211> LENGTH: 3108 <212> TYPE: DNA <213> ORGANISM: Homo sapien <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (1)...(3105) <400> SEQUENCE: 23 atg cta cga acc gca ggc agg gac ggc ctc tgt cgc ctg tcc acc tac 48 Met Leu Arg Thr Ala Gly Arg Asp Gly Leu Cys Arg Leu Ser Thr Tyr 1 5 10 15 ttg gaa gaa ctc gag gct gtg gaa ctg aag aag ttc aag tta tac ctg 96 Leu Glu Glu Leu Glu Ala Val Glu Leu Lys Lys Phe Lys Leu Tyr Leu 20 25 30 ggg acc gcg aca gag ctg gga gaa ggc aag atc ccc tgg gga agc atg 144 Gly Thr Ala Thr Glu Leu Gly Glu Gly Lys Ile Pro Trp Gly Ser Met 35 40 45 gag aag gcc ggt ccc ctg gaa atg gcc cag ctg ctc atc acc cac ttc 192 Glu Lys Ala Gly Pro Leu Glu Met Ala Gln Leu Leu Ile Thr His Phe 50 55 60 ggg cca gag gag gcc tgg agg ttg gct ctc agc acc ttt gag cgg ata 240 Gly Pro Glu Glu Ala Trp Arg Leu Ala Leu Ser Thr Phe Glu Arg Ile 65 70 75 80 aac agg aag gac ctg tgg gag aga gga cag aga gag gac ctg gtg agg 288 Asn Arg Lys Asp Leu Trp Glu Arg Gly Gln Arg Glu Asp Leu Val Arg 85 90 95 gat ccc cag gaa acc tac agg gac tat gtc cgc agg aaa ttc cgg ctc 336 Asp Pro Gln Glu Thr Tyr Arg Asp Tyr Val Arg Arg Lys Phe Arg Leu 100 105 110 atg gaa gac cgc aat gcg cgc cta ggg gaa tgt gtc aac ctc agc cac 384 Met Glu Asp Arg Asn Ala Arg Leu Gly Glu Cys Val Asn Leu Ser His 115 120 125 cgg tac acc cgg ctc ctg ctg gtg aag gag cac tca aac ccc atg cag 432 Arg Tyr Thr Arg Leu Leu Leu Val Lys Glu His Ser Asn Pro Met Gln 130 135 140 gtc cag cag cag ctt ctg gac aca ggc cgg gga cac gcg agg acc gtg 480 Val Gln Gln Gln Leu Leu Asp Thr Gly Arg Gly His Ala Arg Thr Val 145 150 155 160 gga cac cag gct agc ccc atc aag ata gag acc ctc ttt gag cca gac 528 Gly His Gln Ala Ser Pro Ile Lys Ile Glu Thr Leu Phe Glu Pro Asp 165 170 175 gag gag cgc ccc gag cca ccg cgc acc gtg gtc atg caa ggc gcg gca 576 Glu Glu Arg Pro Glu Pro Pro Arg Thr Val Val Met Gln Gly Ala Ala 180 185 190 ggg ata ggc aag tcc atg ctg gca cac aag gtg atg ctg gac tgg gcg 624 Gly Ile Gly Lys Ser Met Leu Ala His Lys Val Met Leu Asp Trp Ala 195 200 205 gac ggg aag ctc ttc caa ggc aga ttt gat tat ctc ttc tac atc aac 672 Asp Gly Lys Leu Phe Gln Gly Arg Phe Asp Tyr Leu Phe Tyr Ile Asn 210 215 220 tgc agg gag atg aac cag agt gcc acg gaa tgc agc atg caa gac ctc 720 Cys Arg Glu Met Asn Gln Ser Ala Thr Glu Cys Ser Met Gln Asp Leu 225 230 235 240 atc ttc agc tgc tgg cct gag ccc agc gcg cct ctc cag gag ctc atc 768 Ile Phe Ser Cys Trp Pro Glu Pro Ser Ala Pro Leu Gln Glu Leu Ile 245 250 255 cga gtt ccc gag cgc ctc ctt ttc atc atc gac ggc ttc gat gag ctc 816 Arg Val Pro Glu Arg Leu Leu Phe Ile Ile Asp Gly Phe Asp Glu Leu 260 265 270 aag cct tct ttc cac gat cct cag gga ccc tgg tgc ctc tgc tgg gag 864 Lys Pro Ser Phe His Asp Pro Gln Gly Pro Trp Cys Leu Cys Trp Glu 275 280 285 gag aaa cgg ccc acg gag ctg ctt ctt aac agc tta att cgg aag aag 912 Glu Lys Arg Pro Thr Glu Leu Leu Leu Asn Ser Leu Ile Arg Lys Lys 290 295 300 ctg ctc cct gag cta tct ttg ctc atc acc aca cgg ccc acg gct ttg 960 Leu Leu Pro Glu Leu Ser Leu Leu Ile Thr Thr Arg Pro Thr Ala Leu 305 310 315 320 gag aag ctc cac cgt ctg ctg gag cac ccc agg cat gtg gag atc ctg 1008 Glu Lys Leu His Arg Leu Leu Glu His Pro Arg His Val Glu Ile Leu 325 330 335 ggc ttc tct gag gca gaa agg aag gaa tac ttc tac aag tat ttc cac 1056 Gly Phe Ser Glu Ala Glu Arg Lys Glu Tyr Phe Tyr Lys Tyr Phe His 340 345 350 aat gca gag cag gcg ggc caa gtc ttc aat tac gtg agg gac aac gag 1104 Asn Ala Glu Gln Ala Gly Gln Val Phe Asn Tyr Val Arg Asp Asn Glu 355 360 365 cct ctc ttc acc atg tgc ttc gtc ccc ctg gtg tgc tgg gtg gtg tgt 1152 Pro Leu Phe Thr Met Cys Phe Val Pro Leu Val Cys Trp Val Val Cys 370 375 380 acc tgc ctc cag cag cag ctg gag ggt ggg ggg ctg ttg aga cag acg 1200 Thr Cys Leu Gln Gln Gln Leu Glu Gly Gly Gly Leu Leu Arg Gln Thr 385 390 395 400 tcc agg acc acc act gca gtg tac atg ctc tac ctg ctg agt ctg atg 1248 Ser Arg Thr Thr Thr Ala Val Tyr Met Leu Tyr Leu Leu Ser Leu Met 405 410 415 caa ccc aag ccg ggg gcc ccg cgc ctc cag ccc cca ccc aac cag aga 1296 Gln Pro Lys Pro Gly Ala Pro Arg Leu Gln Pro Pro Pro Asn Gln Arg 420 425 430 ggg ttg tgc tcc ttg gcg gca gat ggg ctc tgg aat cag aaa atc cta 1344 Gly Leu Cys Ser Leu Ala Ala Asp Gly Leu Trp Asn Gln Lys Ile Leu 435 440 445 ttt gag gag cag gac ctc cgg aag cac ggc cta gac ggg gaa gac gtc 1392 Phe Glu Glu Gln Asp Leu Arg Lys His Gly Leu Asp Gly Glu Asp Val 450 455 460 tct gcc ttc ctc aac atg aac atc ttc cag aag gac atc aac tgt gag 1440 Ser Ala Phe Leu Asn Met Asn Ile Phe Gln Lys Asp Ile Asn Cys Glu 465 470 475 480 agg tac tac agc ttc atc cac ttg agt ttc cag gaa ttc ttt gca gct 1488 Arg Tyr Tyr Ser Phe Ile His Leu Ser Phe Gln Glu Phe Phe Ala Ala 485 490 495 atg tac tat atc ctg gac gag ggg gag ggc ggg gca ggc cca gac cag 1536 Met Tyr Tyr Ile Leu Asp Glu Gly Glu Gly Gly Ala Gly Pro Asp Gln 500 505 510 gac gtg acc agg ctg ttg acc gag tac gcg ttt tct gaa agg agc ttc 1584 Asp Val Thr Arg Leu Leu Thr Glu Tyr Ala Phe Ser Glu Arg Ser Phe 515 520 525 ctg gca ctc acc agc cgc ttc ctg ttt gga ctc ctg aac gag gag acc 1632 Leu Ala Leu Thr Ser Arg Phe Leu Phe Gly Leu Leu Asn Glu Glu Thr 530 535 540 agg agc cac ctg gag aag agt ctc tgc tgg aag gtc tcg ccg cac atc 1680 Arg Ser His Leu Glu Lys Ser Leu Cys Trp Lys Val Ser Pro His Ile 545 550 555 560 aag atg gac ctg ttg cag tgg atc caa agc aaa gct cag agc gac ggc 1728 Lys Met Asp Leu Leu Gln Trp Ile Gln Ser Lys Ala Gln Ser Asp Gly 565 570 575 tcc acc ctg cag cag ggc tcc ttg gag ttc ttc agc tgc ttg tac gag 1776 Ser Thr Leu Gln Gln Gly Ser Leu Glu Phe Phe Ser Cys Leu Tyr Glu 580 585 590 atc cag gag gag gag ttt atc cag cag gcc ctg agc cac ttc cag gtg 1824 Ile Gln Glu Glu Glu Phe Ile Gln Gln Ala Leu Ser His Phe Gln Val 595 600 605 atc gtg gtc agc aac att gcc tcc aag atg gag cac atg gtc tcc tcg 1872 Ile Val Val Ser Asn Ile Ala Ser Lys Met Glu His Met Val Ser Ser 610 615 620 ttc tgt ctg aag cgc tgc agg agc gcc cag gtg ctg cac ttg tat ggc 1920 Phe Cys Leu Lys Arg Cys Arg Ser Ala Gln Val Leu His Leu Tyr Gly 625 630 635 640 gcc acc tac agc gcg gac ggg gaa gac cgc gcg agg tgc tcc gca gga 1968 Ala Thr Tyr Ser Ala Asp Gly Glu Asp Arg Ala Arg Cys Ser Ala Gly 645 650 655 gcg cac acg ctg ttg gtg cag ctc aga cca gag agg acc gtt ctg ctg 2016 Ala His Thr Leu Leu Val Gln Leu Arg Pro Glu Arg Thr Val Leu Leu 660 665 670 gac gcc tac agt gaa cat ctg gca gcg gcc ctg tgc acc aat cca aac 2064 Asp Ala Tyr Ser Glu His Leu Ala Ala Ala Leu Cys Thr Asn Pro Asn 675 680 685 ctg ata gag ctg tct ctg tac cga aat gcc ctg ggc agc cgg ggg gtg 2112 Leu Ile Glu Leu Ser Leu Tyr Arg Asn Ala Leu Gly Ser Arg Gly Val 690 695 700 aag ctg ctc tgt caa gga ctc aga cac ccc aac tgc aaa ctt cag aac 2160 Lys Leu Leu Cys Gln Gly Leu Arg His Pro Asn Cys Lys Leu Gln Asn 705 710 715 720 ctg agg ctg aag agg tgc cgc atc tcc agc tca gcc tgc gag gac ctc 2208 Leu Arg Leu Lys Arg Cys Arg Ile Ser Ser Ser Ala Cys Glu Asp Leu 725 730 735 tct gca gct ctc ata gcc aat aag aat ttg aca agg atg gat ctc agt 2256 Ser Ala Ala Leu Ile Ala Asn Lys Asn Leu Thr Arg Met Asp Leu Ser 740 745 750 ggc aac ggc gtt gga ttc cca ggc atg atg ctg ctt tgc gag ggc ctg 2304 Gly Asn Gly Val Gly Phe Pro Gly Met Met Leu Leu Cys Glu Gly Leu 755 760 765 cgg cat ccc cag tgc agg ctg cag atg att cag ttg agg aag tgt cag 2352 Arg His Pro Gln Cys Arg Leu Gln Met Ile Gln Leu Arg Lys Cys Gln 770 775 780 ctg gag tcc ggg gct tgt cag gag atg gct tct gtg ctc ggc acc aac 2400 Leu Glu Ser Gly Ala Cys Gln Glu Met Ala Ser Val Leu Gly Thr Asn 785 790 795 800 cca cat ctg gtt gag ttg gac ctg aca gga aat gca ctg gag gat ttg 2448 Pro His Leu Val Glu Leu Asp Leu Thr Gly Asn Ala Leu Glu Asp Leu 805 810 815 ggc ctg agg tta cta tgc cag gga ctg agg cac cca gtc tgc aga cta 2496 Gly Leu Arg Leu Leu Cys Gln Gly Leu Arg His Pro Val Cys Arg Leu 820 825 830 cgg act ttg tgg ctg aag atc tgc cgc ctc act gct gct gcc tgt gac 2544 Arg Thr Leu Trp Leu Lys Ile Cys Arg Leu Thr Ala Ala Ala Cys Asp 835 840 845 gag ctg gcc tca act ctc agt gtg aac cag agc ctg aga gag ctg gac 2592 Glu Leu Ala Ser Thr Leu Ser Val Asn Gln Ser Leu Arg Glu Leu Asp 850 855 860 ctg agc ctg aat gag ctg ggg gac ctc ggg gtg ctg ctg ctg tgt gag 2640 Leu Ser Leu Asn Glu Leu Gly Asp Leu Gly Val Leu Leu Leu Cys Glu 865 870 875 880 ggc ctc agg cat ccc acg tgc aag ctc cag acc ctg cgg ttg ggc atc 2688 Gly Leu Arg His Pro Thr Cys Lys Leu Gln Thr Leu Arg Leu Gly Ile 885 890 895 tgc cgg ctg ggc tct gcc gcc tgt gag ggt ctt tct gtg gtg ctc cag 2736 Cys Arg Leu Gly Ser Ala Ala Cys Glu Gly Leu Ser Val Val Leu Gln 900 905 910 gcc aac cac aac ctc cgg gag ctg gac ttg agt ttc aac gac ctg gga 2784 Ala Asn His Asn Leu Arg Glu Leu Asp Leu Ser Phe Asn Asp Leu Gly 915 920 925 gac tgg ggc ctg tgg ttg ctg gct gag ggg ctg caa cat ccc gcc tgc 2832 Asp Trp Gly Leu Trp Leu Leu Ala Glu Gly Leu Gln His Pro Ala Cys 930 935 940 aga ctc cag aaa ctg tgg ctg gat agc tgt ggc ctc aca gcc aag gct 2880 Arg Leu Gln Lys Leu Trp Leu Asp Ser Cys Gly Leu Thr Ala Lys Ala 945 950 955 960 tgt gag aat ctt tac ttc acc ctg ggg atc aac cag acc ttg acc gac 2928 Cys Glu Asn Leu Tyr Phe Thr Leu Gly Ile Asn Gln Thr Leu Thr Asp 965 970 975 ctt tac ctg acc aac aac gcc cta ggg gac aca ggt gtc cga ctg ctt 2976 Leu Tyr Leu Thr Asn Asn Ala Leu Gly Asp Thr Gly Val Arg Leu Leu 980 985 990 tgc aag cgg ctg agc cat cct ggc tgc aaa ctc cga gtc ctc tgg tta 3024 Cys Lys Arg Leu Ser His Pro Gly Cys Lys Leu Arg Val Leu Trp Leu 995 1000 1005 ttt ggg atg gac ctg aat aaa atg acc cac agt agg ttg gca gcg ctt 3072 Phe Gly Met Asp Leu Asn Lys Met Thr His Ser Arg Leu Ala Ala Leu 1010 1015 1020 cga gta aca aaa cct tat ttg gac att ggc tgc tga 3108 Arg Val Thr Lys Pro Tyr Leu Asp Ile Gly Cys 1025 1030 1035 <210> SEQ ID NO 24 <211> LENGTH: 1035 <212> TYPE: PRT <213> ORGANISM: Homo sapien <400> SEQUENCE: 24 Met Leu Arg Thr Ala Gly Arg Asp Gly Leu Cys Arg Leu Ser Thr Tyr 1 5 10 15 Leu Glu Glu Leu Glu Ala Val Glu Leu Lys Lys Phe Lys Leu Tyr Leu 20 25 30 Gly Thr Ala Thr Glu Leu Gly Glu Gly Lys Ile Pro Trp Gly Ser Met 35 40 45 Glu Lys Ala Gly Pro Leu Glu Met Ala Gln Leu Leu Ile Thr His Phe 50 55 60 Gly Pro Glu Glu Ala Trp Arg Leu Ala Leu Ser Thr Phe Glu Arg Ile 65 70 75 80 Asn Arg Lys Asp Leu Trp Glu Arg Gly Gln Arg Glu Asp Leu Val Arg 85 90 95 Asp Pro Gln Glu Thr Tyr Arg Asp Tyr Val Arg Arg Lys Phe Arg Leu 100 105 110 Met Glu Asp Arg Asn Ala Arg Leu Gly Glu Cys Val Asn Leu Ser His 115 120 125 Arg Tyr Thr Arg Leu Leu Leu Val Lys Glu His Ser Asn Pro Met Gln 130 135 140 Val Gln Gln Gln Leu Leu Asp Thr Gly Arg Gly His Ala Arg Thr Val 145 150 155 160 Gly His Gln Ala Ser Pro Ile Lys Ile Glu Thr Leu Phe Glu Pro Asp 165 170 175 Glu Glu Arg Pro Glu Pro Pro Arg Thr Val Val Met Gln Gly Ala Ala 180 185 190 Gly Ile Gly Lys Ser Met Leu Ala His Lys Val Met Leu Asp Trp Ala 195 200 205 Asp Gly Lys Leu Phe Gln Gly Arg Phe Asp Tyr Leu Phe Tyr Ile Asn 210 215 220 Cys Arg Glu Met Asn Gln Ser Ala Thr Glu Cys Ser Met Gln Asp Leu 225 230 235 240 Ile Phe Ser Cys Trp Pro Glu Pro Ser Ala Pro Leu Gln Glu Leu Ile 245 250 255 Arg Val Pro Glu Arg Leu Leu Phe Ile Ile Asp Gly Phe Asp Glu Leu 260 265 270 Lys Pro Ser Phe His Asp Pro Gln Gly Pro Trp Cys Leu Cys Trp Glu 275 280 285 Glu Lys Arg Pro Thr Glu Leu Leu Leu Asn Ser Leu Ile Arg Lys Lys 290 295 300 Leu Leu Pro Glu Leu Ser Leu Leu Ile Thr Thr Arg Pro Thr Ala Leu 305 310 315 320 Glu Lys Leu His Arg Leu Leu Glu His Pro Arg His Val Glu Ile Leu 325 330 335 Gly Phe Ser Glu Ala Glu Arg Lys Glu Tyr Phe Tyr Lys Tyr Phe His 340 345 350 Asn Ala Glu Gln Ala Gly Gln Val Phe Asn Tyr Val Arg Asp Asn Glu 355 360 365 Pro Leu Phe Thr Met Cys Phe Val Pro Leu Val Cys Trp Val Val Cys 370 375 380 Thr Cys Leu Gln Gln Gln Leu Glu Gly Gly Gly Leu Leu Arg Gln Thr 385 390 395 400 Ser Arg Thr Thr Thr Ala Val Tyr Met Leu Tyr Leu Leu Ser Leu Met 405 410 415 Gln Pro Lys Pro Gly Ala Pro Arg Leu Gln Pro Pro Pro Asn Gln Arg 420 425 430 Gly Leu Cys Ser Leu Ala Ala Asp Gly Leu Trp Asn Gln Lys Ile Leu 435 440 445 Phe Glu Glu Gln Asp Leu Arg Lys His Gly Leu Asp Gly Glu Asp Val 450 455 460 Ser Ala Phe Leu Asn Met Asn Ile Phe Gln Lys Asp Ile Asn Cys Glu 465 470 475 480 Arg Tyr Tyr Ser Phe Ile His Leu Ser Phe Gln Glu Phe Phe Ala Ala 485 490 495 Met Tyr Tyr Ile Leu Asp Glu Gly Glu Gly Gly Ala Gly Pro Asp Gln 500 505 510 Asp Val Thr Arg Leu Leu Thr Glu Tyr Ala Phe Ser Glu Arg Ser Phe 515 520 525 Leu Ala Leu Thr Ser Arg Phe Leu Phe Gly Leu Leu Asn Glu Glu Thr 530 535 540 Arg Ser His Leu Glu Lys Ser Leu Cys Trp Lys Val Ser Pro His Ile 545 550 555 560 Lys Met Asp Leu Leu Gln Trp Ile Gln Ser Lys Ala Gln Ser Asp Gly 565 570 575 Ser Thr Leu Gln Gln Gly Ser Leu Glu Phe Phe Ser Cys Leu Tyr Glu 580 585 590 Ile Gln Glu Glu Glu Phe Ile Gln Gln Ala Leu Ser His Phe Gln Val 595 600 605 Ile Val Val Ser Asn Ile Ala Ser Lys Met Glu His Met Val Ser Ser 610 615 620 Phe Cys Leu Lys Arg Cys Arg Ser Ala Gln Val Leu His Leu Tyr Gly 625 630 635 640 Ala Thr Tyr Ser Ala Asp Gly Glu Asp Arg Ala Arg Cys Ser Ala Gly 645 650 655 Ala His Thr Leu Leu Val Gln Leu Arg Pro Glu Arg Thr Val Leu Leu 660 665 670 Asp Ala Tyr Ser Glu His Leu Ala Ala Ala Leu Cys Thr Asn Pro Asn 675 680 685 Leu Ile Glu Leu Ser Leu Tyr Arg Asn Ala Leu Gly Ser Arg Gly Val 690 695 700 Lys Leu Leu Cys Gln Gly Leu Arg His Pro Asn Cys Lys Leu Gln Asn 705 710 715 720 Leu Arg Leu Lys Arg Cys Arg Ile Ser Ser Ser Ala Cys Glu Asp Leu 725 730 735 Ser Ala Ala Leu Ile Ala Asn Lys Asn Leu Thr Arg Met Asp Leu Ser 740 745 750 Gly Asn Gly Val Gly Phe Pro Gly Met Met Leu Leu Cys Glu Gly Leu 755 760 765 Arg His Pro Gln Cys Arg Leu Gln Met Ile Gln Leu Arg Lys Cys Gln 770 775 780 Leu Glu Ser Gly Ala Cys Gln Glu Met Ala Ser Val Leu Gly Thr Asn 785 790 795 800 Pro His Leu Val Glu Leu Asp Leu Thr Gly Asn Ala Leu Glu Asp Leu 805 810 815 Gly Leu Arg Leu Leu Cys Gln Gly Leu Arg His Pro Val Cys Arg Leu 820 825 830 Arg Thr Leu Trp Leu Lys Ile Cys Arg Leu Thr Ala Ala Ala Cys Asp 835 840 845 Glu Leu Ala Ser Thr Leu Ser Val Asn Gln Ser Leu Arg Glu Leu Asp 850 855 860 Leu Ser Leu Asn Glu Leu Gly Asp Leu Gly Val Leu Leu Leu Cys Glu 865 870 875 880 Gly Leu Arg His Pro Thr Cys Lys Leu Gln Thr Leu Arg Leu Gly Ile 885 890 895 Cys Arg Leu Gly Ser Ala Ala Cys Glu Gly Leu Ser Val Val Leu Gln 900 905 910 Ala Asn His Asn Leu Arg Glu Leu Asp Leu Ser Phe Asn Asp Leu Gly 915 920 925 Asp Trp Gly Leu Trp Leu Leu Ala Glu Gly Leu Gln His Pro Ala Cys 930 935 940 Arg Leu Gln Lys Leu Trp Leu Asp Ser Cys Gly Leu Thr Ala Lys Ala 945 950 955 960 Cys Glu Asn Leu Tyr Phe Thr Leu Gly Ile Asn Gln Thr Leu Thr Asp 965 970 975 Leu Tyr Leu Thr Asn Asn Ala Leu Gly Asp Thr Gly Val Arg Leu Leu 980 985 990 Cys Lys Arg Leu Ser His Pro Gly Cys Lys Leu Arg Val Leu Trp Leu 995 1000 1005 Phe Gly Met Asp Leu Asn Lys Met Thr His Ser Arg Leu Ala Ala Leu 1010 1015 1020 Arg Val Thr Lys Pro Tyr Leu Asp Ile Gly Cys 1025 1030 1035 <210> SEQ ID NO 25 <211> LENGTH: 243 <212> TYPE: DNA <213> ORGANISM: Homo sapien <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (1)...(243) <400> SEQUENCE: 25 atg gca agc acc cgc tgc aag ctg gcc agg tac ctg gag gac ctg gag 48 Met Ala Ser Thr Arg Cys Lys Leu Ala Arg Tyr Leu Glu Asp Leu Glu 1 5 10 15 gat gtg gac ttg aag aaa ttt aag atg cac tta gag gac tat cct ccc 96 Asp Val Asp Leu Lys Lys Phe Lys Met His Leu Glu Asp Tyr Pro Pro 20 25 30 cag aag ggc tgc atc ccc ctc ccg agg ggt cag aca gag aag gca gac 144 Gln Lys Gly Cys Ile Pro Leu Pro Arg Gly Gln Thr Glu Lys Ala Asp 35 40 45 cat gtg gat cta gcc acg cta atg atc gac ttc aat ggg gag gag aag 192 His Val Asp Leu Ala Thr Leu Met Ile Asp Phe Asn Gly Glu Glu Lys 50 55 60 gcg tgg gcc atg gtc gtg tgg atc ttc gct gcg atc aac agg aga gac 240 Ala Trp Ala Met Val Val Trp Ile Phe Ala Ala Ile Asn Arg Arg Asp 65 70 75 80 ctt 243 Leu <210> SEQ ID NO 26 <211> LENGTH: 81 <212> TYPE: PRT <213> ORGANISM: Homo sapien <400> SEQUENCE: 26 Met Ala Ser Thr Arg Cys Lys Leu Ala Arg Tyr Leu Glu Asp Leu Glu 1 5 10 15 Asp Val Asp Leu Lys Lys Phe Lys Met His Leu Glu Asp Tyr Pro Pro 20 25 30 Gln Lys Gly Cys Ile Pro Leu Pro Arg Gly Gln Thr Glu Lys Ala Asp 35 40 45 His Val Asp Leu Ala Thr Leu Met Ile Asp Phe Asn Gly Glu Glu Lys 50 55 60 Ala Trp Ala Met Val Val Trp Ile Phe Ala Ala Ile Asn Arg Arg Asp 65 70 75 80 Leu <210> SEQ ID NO 27 <211> LENGTH: 270 <212> TYPE: DNA <213> ORGANISM: Homo sapien <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (1)...(267) <400> SEQUENCE: 27 atg gga acg aag cgc gag gcc atc ctg aag gtg ctg gag aac ctg aca 48 Met Gly Thr Lys Arg Glu Ala Ile Leu Lys Val Leu Glu Asn Leu Thr 1 5 10 15 ccg gag gag ctc aag aag ttc aag atg aag ctg ggg acg gtg ccg ctg 96 Pro Glu Glu Leu Lys Lys Phe Lys Met Lys Leu Gly Thr Val Pro Leu 20 25 30 cgc gag ggc ttt gag cgc atc ccg cgg ggc gcg ctc ggg cag cta gat 144 Arg Glu Gly Phe Glu Arg Ile Pro Arg Gly Ala Leu Gly Gln Leu Asp 35 40 45 atc gtg gac ctc acc gac aag ctg gtc gcc tcc tac tac gag gac tac 192 Ile Val Asp Leu Thr Asp Lys Leu Val Ala Ser Tyr Tyr Glu Asp Tyr 50 55 60 gca gcc gag ctc gtc gtg gcc gtg ctg cgc gac atg cgc atg ttg gag 240 Ala Ala Glu Leu Val Val Ala Val Leu Arg Asp Met Arg Met Leu Glu 65 70 75 80 gag gcc gca cgg ctg cag cgg gct gcg tga 270 Glu Ala Ala Arg Leu Gln Arg Ala Ala 85 <210> SEQ ID NO 28 <211> LENGTH: 89 <212> TYPE: PRT <213> ORGANISM: Homo sapien <400> SEQUENCE: 28 Met Gly Thr Lys Arg Glu Ala Ile Leu Lys Val Leu Glu Asn Leu Thr 1 5 10 15 Pro Glu Glu Leu Lys Lys Phe Lys Met Lys Leu Gly Thr Val Pro Leu 20 25 30 Arg Glu Gly Phe Glu Arg Ile Pro Arg Gly Ala Leu Gly Gln Leu Asp 35 40 45 Ile Val Asp Leu Thr Asp Lys Leu Val Ala Ser Tyr Tyr Glu Asp Tyr 50 55 60 Ala Ala Glu Leu Val Val Ala Val Leu Arg Asp Met Arg Met Leu Glu 65 70 75 80 Glu Ala Ala Arg Leu Gln Arg Ala Ala 85 <210> SEQ ID NO 29 <211> LENGTH: 6 <212> TYPE: PRT <213> ORGANISM: Homo sapien <220> FEATURE: <221> NAME/KEY: VARIANT <222> LOCATION: (4)...(5) <223> OTHER INFORMATION: Xaa=any amino acid <400> SEQUENCE: 29 Lys Phe Lys Xaa Xaa Leu 1 5 <210> SEQ ID NO 30 <211> LENGTH: 6 <212> TYPE: PRT <213> ORGANISM: Homo sapien <220> FEATURE: <221> NAME/KEY: VARIANT <222> LOCATION: (4)...(5) <223> OTHER INFORMATION: Xaa=any amino acid <400> SEQUENCE: 30 Lys Leu Lys Xaa Xaa Leu 1 5 <210> SEQ ID NO 31 <211> LENGTH: 6 <212> TYPE: PRT <213> ORGANISM: Homo sapien <220> FEATURE: <221> NAME/KEY: VARIANT <222> LOCATION: (4)...(5) <223> OTHER INFORMATION: Xaa=any amino acid <400> SEQUENCE: 31 Arg Phe Arg Xaa Xaa Leu 1 5 <210> SEQ ID NO 32 <211> LENGTH: 6 <212> TYPE: PRT <213> ORGANISM: Homo sapien <220> FEATURE: <221> NAME/KEY: VARIANT <222> LOCATION: (4)...(5) <223> OTHER INFORMATION: Xaa=any amino acid <400> SEQUENCE: 32 Arg Phe Lys Xaa Xaa Leu 1 5 <210> SEQ ID NO 33 <211> LENGTH: 6 <212> TYPE: PRT <213> ORGANISM: Homo sapien <220> FEATURE: <221> NAME/KEY: VARIANT <222> LOCATION: (4)...(5) <223> OTHER INFORMATION: Xaa=any amino acid <400> SEQUENCE: 33 Lys Phe Arg Xaa Xaa Leu 1 5 <210> SEQ ID NO 34 <211> LENGTH: 6 <212> TYPE: PRT <213> ORGANISM: Homo sapien <220> FEATURE: <221> NAME/KEY: VARIANT <222> LOCATION: (4)...(5) <223> OTHER INFORMATION: Xaa=any amino acid <400> SEQUENCE: 34 Lys Phe Lys Xaa Xaa Ile 1 5 <210> SEQ ID NO 35 <211> LENGTH: 39 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: synthetic primer <400> SEQUENCE: 35 ccggaattca ccatggcagc ctctttcttc tctgatttt 39 <210> SEQ ID NO 36 <211> LENGTH: 41 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: synthetic primer <400> SEQUENCE: 36 ccgctcgagt cacgtagagc tgtgttcatc ctctttctta a 41 <210> SEQ ID NO 37 <211> LENGTH: 319 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 37 Gln Pro Arg Thr Val Ile Ile Gln Gly Pro Gln Gly Ile Gly Lys Thr 1 5 10 15 Thr Leu Leu Met Lys Leu Met Met Ala Trp Ser Asp Asn Lys Ile Phe 20 25 30 Arg Asp Arg Phe Leu Tyr Thr Phe Tyr Phe Cys Cys Arg Glu Leu Arg 35 40 45 Glu Leu Pro Pro Thr Ser Leu Ala Asp Leu Ile Ser Arg Glu Trp Pro 50 55 60 Asp Pro Ala Ala Pro Ile Thr Glu Ile Val Ser Gln Pro Glu Arg Leu 65 70 75 80 Leu Phe Val Ile Asp Ser Phe Glu Glu Leu Gln Gly Gly Leu Asn Glu 85 90 95 Pro Asp Ser Asp Leu Cys Gly Asp Leu Met Glu Lys Arg Pro Val Gln 100 105 110 Val Leu Leu Ser Ser Leu Leu Arg Lys Lys Met Leu Pro Glu Ala Ser 115 120 125 Leu Leu Ile Ala Ile Lys Pro Val Cys Pro Lys Glu Leu Arg Asp Gln 130 135 140 Val Thr Ile Ser Glu Ile Tyr Gln Pro Arg Gly Phe Asn Glu Ser Asp 145 150 155 160 Arg Leu Val Tyr Phe Cys Cys Phe Phe Lys Asp Pro Lys Arg Ala Met 165 170 175 Glu Ala Phe Asn Leu Val Arg Glu Ser Glu Gln Leu Phe Ser Ile Cys 180 185 190 Gln Ile Pro Leu Leu Cys Trp Ile Leu Cys Thr Ser Leu Lys Gln Glu 195 200 205 Met Gln Lys Gly Lys Asp Leu Ala Leu Thr Cys Gln Ser Thr Thr Ser 210 215 220 Val Tyr Ser Ser Phe Val Phe Asn Leu Phe Thr Pro Glu Gly Ala Glu 225 230 235 240 Gly Pro Thr Pro Gln Thr Gln His Gln Leu Lys Ala Leu Cys Ser Leu 245 250 255 Ala Ala Glu Gly Met Trp Thr Asp Thr Phe Glu Phe Cys Glu Asp Asp 260 265 270 Leu Arg Arg Asn Gly Val Val Asp Ala Asp Ile Pro Ala Leu Leu Gly 275 280 285 Thr Lys Ile Leu Leu Lys Tyr Gly Glu Arg Glu Ser Ser Tyr Val Phe 290 295 300 Leu His Val Cys Ile Gln Glu Phe Cys Ala Ala Leu Phe Tyr Leu 305 310 315 <210> SEQ ID NO 38 <211> LENGTH: 270 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 38 Ser Ile Cys Gln Ile Pro Leu Leu Cys Trp Ile Leu Cys Thr Ser Leu 1 5 10 15 Lys Gln Glu Met Gln Lys Gly Lys Asp Leu Ala Leu Thr Cys Gln Ser 20 25 30 Thr Thr Ser Val Tyr Ser Ser Phe Val Phe Asn Leu Phe Thr Pro Glu 35 40 45 Gly Ala Glu Gly Pro Thr Pro Gln Thr Gln His Gln Leu Lys Ala Leu 50 55 60 Cys Ser Leu Ala Ala Glu Gly Met Trp Thr Asp Thr Phe Glu Phe Cys 65 70 75 80 Glu Asp Asp Leu Arg Arg Asn Gly Val Val Asp Ala Asp Ile Pro Ala 85 90 95 Leu Leu Gly Thr Lys Ile Leu Leu Lys Tyr Gly Glu Arg Glu Ser Ser 100 105 110 Tyr Val Phe Leu His Val Cys Ile Gln Glu Phe Cys Ala Ala Leu Phe 115 120 125 Tyr Leu Leu Lys Ser His Leu Asp His Pro His Pro Ala Val Arg Cys 130 135 140 Val Gln Glu Leu Leu Val Ala Asn Phe Glu Lys Ala Arg Arg Ala His 145 150 155 160 Trp Ile Phe Leu Gly Cys Phe Leu Thr Gly Leu Leu Asn Lys Lys Glu 165 170 175 Gln Glu Lys Leu Asp Ala Phe Phe Gly Phe Gln Leu Ser Gln Glu Ile 180 185 190 Lys Gln Gln Ile His Gln Cys Leu Lys Ser Leu Gly Glu Arg Gly Asn 195 200 205 Pro Gln Gly Gln Val Asp Ser Leu Ala Ile Phe Tyr Cys Leu Phe Glu 210 215 220 Met Gln Asp Pro Ala Phe Val Lys Gln Ala Val Asn Leu Leu Gln Glu 225 230 235 240 Ala Asn Phe His Ile Ile Asp Asn Val Asp Leu Val Val Ser Ala Tyr 245 250 255 Cys Leu Lys Tyr Cys Ser Ser Leu Arg Lys Leu Cys Phe Ser 260 265 270 <210> SEQ ID NO 39 <211> LENGTH: 375 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 39 Ser Asp Tyr Ser Leu Ile Cys Trp His His Ile Cys Ser Val Leu Thr 1 5 10 15 Thr Ser Gly His Leu Arg Glu Leu Gln Val Gln Asp Ser Thr Leu Ser 20 25 30 Glu Ser Thr Phe Val Thr Trp Cys Asn Gln Leu Arg His Pro Ser Cys 35 40 45 Arg Leu Gln Lys Leu Gly Ile Asn Asn Val Ser Phe Ser Gly Gln Ser 50 55 60 Val Leu Leu Phe Glu Val Leu Phe Tyr Gln Pro Asp Leu Lys Tyr Leu 65 70 75 80 Ser Phe Thr Leu Thr Lys Leu Ser Arg Asp Asp Ile Arg Ser Leu Cys 85 90 95 Asp Ala Leu Asn Tyr Pro Ala Gly Asn Val Lys Glu Leu Ala Leu Val 100 105 110 Asn Cys His Leu Ser Pro Ile Asp Cys Glu Val Leu Ala Gly Leu Leu 115 120 125 Thr Asn Asn Lys Lys Leu Thr Tyr Leu Asn Val Ser Cys Asn Gln Leu 130 135 140 Asp Thr Gly Val Pro Leu Leu Cys Glu Ala Leu Cys Ser Pro Asp Thr 145 150 155 160 Val Leu Val Tyr Leu Met Leu Ala Phe Cys His Leu Ser Glu Gln Cys 165 170 175 Cys Glu Tyr Ile Ser Glu Met Leu Leu Arg Asn Lys Ser Val Arg Tyr 180 185 190 Leu Asp Leu Ser Ala Asn Val Leu Lys Asp Glu Gly Leu Lys Thr Leu 195 200 205 Cys Glu Ala Leu Lys His Pro Asp Cys Cys Leu Asp Ser Leu Cys Leu 210 215 220 Val Lys Cys Phe Ile Thr Ala Ala Gly Cys Glu Asp Leu Ala Ser Ala 225 230 235 240 Leu Ile Ser Asn Gln Asn Leu Lys Ile Leu Gln Ile Gly Cys Asn Glu 245 250 255 Ile Gly Asp Val Gly Val Gln Leu Leu Cys Arg Ala Leu Thr His Thr 260 265 270 Asp Cys Arg Leu Glu Ile Leu Gly Leu Glu Glu Cys Gly Leu Thr Ser 275 280 285 Thr Cys Cys Lys Asp Leu Ala Ser Val Leu Thr Cys Ser Lys Thr Leu 290 295 300 Gln Gln Leu Asn Leu Thr Leu Asn Thr Leu Asp His Thr Gly Val Val 305 310 315 320 Val Leu Cys Glu Ala Leu Arg His Pro Glu Cys Ala Leu Gln Val Leu 325 330 335 Gly Leu Arg Lys Thr Asp Phe Asp Glu Glu Thr Gln Ala Leu Leu Thr 340 345 350 Ala Glu Glu Glu Arg Asn Pro Asn Leu Thr Ile Thr Asp Asp Cys Asp 355 360 365 Thr Ile Thr Arg Val Glu Ile 370 375 <210> SEQ ID NO 40 <211> LENGTH: 38 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: synthetic primer <400> SEQUENCE: 40 cctctcgagt cagatctcta cccttgtgat tgtgtcac 38 <210> SEQ ID NO 41 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: synthetic primer <400> SEQUENCE: 41 gaattcgatc ctggagccat gggg 24 <210> SEQ ID NO 42 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: synthetic primer <400> SEQUENCE: 42 ctcgagccgg agtgttgctg ggaa 24 <210> SEQ ID NO 43 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: synthetic primer <400> SEQUENCE: 43 gaattcgatc ctggagccat gggg 24 <210> SEQ ID NO 44 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: synthetic primer <400> SEQUENCE: 44 ctcgagtcag cttggctgcc gact 24 <210> SEQ ID NO 45 <211> LENGTH: 31 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: synthetic primer <400> SEQUENCE: 45 ccccctcgag ggcctggctt ggctgccgac t 31 <210> SEQ ID NO 46 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: synthetic primer <400> SEQUENCE: 46 gaattccctc agtcggcagc caag 24 <210> SEQ ID NO 47 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: synthetic primer <400> SEQUENCE: 47 ctcgagccgg agtgttgctg ggaa 24 <210> SEQ ID NO 48 <211> LENGTH: 22 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: synthetic primer <400> SEQUENCE: 48 gaattcgagg cgcagggctg tg 22 <210> SEQ ID NO 49 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: synthetic primer <400> SEQUENCE: 49 ctcgaggctt cacaggcgtt gcat 24 <210> SEQ ID NO 50 <211> LENGTH: 24 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: synthetic primer <400> SEQUENCE: 50 ctcgaggcta cacaggcgtt gcat 24 <210> SEQ ID NO 51 <211> LENGTH: 30 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: synthetic primer <400> SEQUENCE: 51 gaattcctct gggccttgag tgaccttgag 30 <210> SEQ ID NO 52 <211> LENGTH: 29 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: synthetic primer <400> SEQUENCE: 52 ccagccgacc tcgagcagtc aaatatggc 29 <210> SEQ ID NO 53 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: synthetic primer <400> SEQUENCE: 53 ttgctcgagt catctgaata c 21 <210> SEQ ID NO 54 <211> LENGTH: 25 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: synthetic primer <400> SEQUENCE: 54 atggccatgg ccaaggccag aaagc 25 <210> SEQ ID NO 55 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: synthetic primer <400> SEQUENCE: 55 ttgctcgagt catctgaata c 21 <210> SEQ ID NO 56 <211> LENGTH: 31 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: synthetic primer <400> SEQUENCE: 56 gacggatcct gtggcatggc cacctacttg g 31 <210> SEQ ID NO 57 <211> LENGTH: 29 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: synthetic primer <400> SEQUENCE: 57 atccctcacg aattcccctc actgtcctc 29 <210> SEQ ID NO 58 <211> LENGTH: 2524 <212> TYPE: DNA <213> ORGANISM: Homo sapiens <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (176)...(2332) <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (306)...(458) <223> OTHER INFORMATION: n = A,T,C or G <400> SEQUENCE: 58 ttaaagattt tgacttgtta cagtcatgtg acattttttt ctttctgttt gctgagtttt 60 tgataattta tatctctcaa agtggagact ttaaaaaaga ctcatccgtg tgccgtgttc 120 actgcctggt atcttagtgt ggaccgaagc ctaaggaccc tgaaaacagc tgcag atg 178 Met 1 aag atg gca agc acc cgc tgc aag ctg gcc agg tac ctg gag gac ctg 226 Lys Met Ala Ser Thr Arg Cys Lys Leu Ala Arg Tyr Leu Glu Asp Leu 5 10 15 gag gat gtg gac ttg aag aaa ttt aag atg cac tta gag gac tat cct 274 Glu Asp Val Asp Leu Lys Lys Phe Lys Met His Leu Glu Asp Tyr Pro 20 25 30 ccc cag aag ggc tgc atc ccc ctc ccg agg gnn nnn nnn nnn nnn nnn 322 Pro Gln Lys Gly Cys Ile Pro Leu Pro Arg Xaa Xaa Xaa Xaa Xaa Xaa 35 40 45 nnn nnn nnn nnn nnn nnn nnn nnn nnn nnn nnn nnn nnn nnn nnn nnn 370 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 50 55 60 65 nnn nnn nnn nnn nnn nnn nnn nnn nnn nnn nnn nnn nnn nnn nnn nnn 418 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 70 75 80 nnn nnn nnn nnn nnn nnn nnn nnn nnn nnn nnn nnn nnn ngt tca gat 466 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Ser Asp 85 90 95 aat gca cgt gtt tcg aat ccc act gtg ata tgc cag gaa gac agc att 514 Asn Ala Arg Val Ser Asn Pro Thr Val Ile Cys Gln Glu Asp Ser Ile 100 105 110 gaa gag gag tgg atg ggt tta ctg gag tac ctt tcg aga atc tct att 562 Glu Glu Glu Trp Met Gly Leu Leu Glu Tyr Leu Ser Arg Ile Ser Ile 115 120 125 tgt aaa atg aag aaa gat tac cgt aag aag tac aga aag tac gtg aga 610 Cys Lys Met Lys Lys Asp Tyr Arg Lys Lys Tyr Arg Lys Tyr Val Arg 130 135 140 145 agc aga ttc cag tgc att gaa gac agg aat gcc cgt ctg ggt gag agt 658 Ser Arg Phe Gln Cys Ile Glu Asp Arg Asn Ala Arg Leu Gly Glu Ser 150 155 160 gtg agc ctc aac aaa cgc tac aca cga ctg cgt ctc atc aag gag cac 706 Val Ser Leu Asn Lys Arg Tyr Thr Arg Leu Arg Leu Ile Lys Glu His 165 170 175 cgg agc cag cag gag agg gag cag gag ctt ctg gcc atc ggc aag acc 754 Arg Ser Gln Gln Glu Arg Glu Gln Glu Leu Leu Ala Ile Gly Lys Thr 180 185 190 aag acg tgt gag agc ccc gtg agt ccc att aag atg gag ttg ctg ttt 802 Lys Thr Cys Glu Ser Pro Val Ser Pro Ile Lys Met Glu Leu Leu Phe 195 200 205 gac ccc gat gat gag cat tct gag cct gtg cac acc gtg gtg ttc cag 850 Asp Pro Asp Asp Glu His Ser Glu Pro Val His Thr Val Val Phe Gln 210 215 220 225 ggg gcg gca ggg att ggg aaa aca atc ctg gcc agg aag atg atg ttg 898 Gly Ala Ala Gly Ile Gly Lys Thr Ile Leu Ala Arg Lys Met Met Leu 230 235 240 gac tgg gcg tcg ggg aca ctc tac caa gac agg ttt gac tat ctg ttc 946 Asp Trp Ala Ser Gly Thr Leu Tyr Gln Asp Arg Phe Asp Tyr Leu Phe 245 250 255 tat atc cac tgt cga gag gtg agc ctt gtg aca cag agg agc ctg ggg 994 Tyr Ile His Cys Arg Glu Val Ser Leu Val Thr Gln Arg Ser Leu Gly 260 265 270 gac ctg atc atg agc tgc tgc ccc gac cca aac cca ccc atc cac aag 1042 Asp Leu Ile Met Ser Cys Cys Pro Asp Pro Asn Pro Pro Ile His Lys 275 280 285 atc gtg aga aaa ccc tcc aga atc ctc ttc ctc atg gac ggc ttc gat 1090 Ile Val Arg Lys Pro Ser Arg Ile Leu Phe Leu Met Asp Gly Phe Asp 290 295 300 305 gag ctg caa ggt gcc ttt gac gag cac ata gga ccg ctc tgc act gac 1138 Glu Leu Gln Gly Ala Phe Asp Glu His Ile Gly Pro Leu Cys Thr Asp 310 315 320 tgg cag aag gcc gag cgg gga gac att ctc ctg agc agc ctc atc aga 1186 Trp Gln Lys Ala Glu Arg Gly Asp Ile Leu Leu Ser Ser Leu Ile Arg 325 330 335 aag aag ctg ctt ccc gag gcc tct ctg ctc atc acc acg aga cct gtg 1234 Lys Lys Leu Leu Pro Glu Ala Ser Leu Leu Ile Thr Thr Arg Pro Val 340 345 350 gcc ctg gag aaa ctg cag cac ttg ctg gac cat cct cgg cat gtg gag 1282 Ala Leu Glu Lys Leu Gln His Leu Leu Asp His Pro Arg His Val Glu 355 360 365 atc ctg ggt ttc tcc gag gcc aaa agg aaa gag tac ttc ttc aag tac 1330 Ile Leu Gly Phe Ser Glu Ala Lys Arg Lys Glu Tyr Phe Phe Lys Tyr 370 375 380 385 ttc tct gat gag gcc caa gcc agg gca gcc ttc agt ctg att cag gag 1378 Phe Ser Asp Glu Ala Gln Ala Arg Ala Ala Phe Ser Leu Ile Gln Glu 390 395 400 aac gag gtc ctc ttc acc atg tgc ttc atc ccc ctg gtc tgc tgg atc 1426 Asn Glu Val Leu Phe Thr Met Cys Phe Ile Pro Leu Val Cys Trp Ile 405 410 415 gtg tgc act gga ctg aaa cag cag atg gag agt ggc aag agc ctt gcc 1474 Val Cys Thr Gly Leu Lys Gln Gln Met Glu Ser Gly Lys Ser Leu Ala 420 425 430 cag aca tcc aag acc acc acc gcg gtg tac gtc ttc ttc ctt tcc agt 1522 Gln Thr Ser Lys Thr Thr Thr Ala Val Tyr Val Phe Phe Leu Ser Ser 435 440 445 ttg ctg cag ccc cgg gga ggg agc cag gag cac ggc ctc tgc gcc cac 1570 Leu Leu Gln Pro Arg Gly Gly Ser Gln Glu His Gly Leu Cys Ala His 450 455 460 465 ctc tgg ggg ctc tgc tct ttg gct gca gat gga atc tgg aac cag aaa 1618 Leu Trp Gly Leu Cys Ser Leu Ala Ala Asp Gly Ile Trp Asn Gln Lys 470 475 480 atc ctg ttt gag gag tcc gac ctc agg aat cat gga ctg cag aag gcg 1666 Ile Leu Phe Glu Glu Ser Asp Leu Arg Asn His Gly Leu Gln Lys Ala 485 490 495 gat gtg tct gct ttc ctg agg atg aac ctg ttc caa aag gaa gtg gac 1714 Asp Val Ser Ala Phe Leu Arg Met Asn Leu Phe Gln Lys Glu Val Asp 500 505 510 tgc gag aag ttc tac agc ttc atc cac atg act ttc cag gag ttc ttt 1762 Cys Glu Lys Phe Tyr Ser Phe Ile His Met Thr Phe Gln Glu Phe Phe 515 520 525 gcc gcc atg tac tac ctg ctg gaa gag gaa aag gaa gga agg acg aac 1810 Ala Ala Met Tyr Tyr Leu Leu Glu Glu Glu Lys Glu Gly Arg Thr Asn 530 535 540 545 gtt cca ggg agt cgt ttg aag ctt ccc agc cga gac gtg aca gtc ctt 1858 Val Pro Gly Ser Arg Leu Lys Leu Pro Ser Arg Asp Val Thr Val Leu 550 555 560 ctg gaa aac tat ggc aaa ttc gaa aag ggg tat ttg att ttt gtt gta 1906 Leu Glu Asn Tyr Gly Lys Phe Glu Lys Gly Tyr Leu Ile Phe Val Val 565 570 575 cgt ttc ctc ttt ggc ctg gta aac cag gag agg acc tcc tac ttg gag 1954 Arg Phe Leu Phe Gly Leu Val Asn Gln Glu Arg Thr Ser Tyr Leu Glu 580 585 590 aag aaa tta agt tgc aag atc tct cag caa atc agg ctg gag ctg ctg 2002 Lys Lys Leu Ser Cys Lys Ile Ser Gln Gln Ile Arg Leu Glu Leu Leu 595 600 605 aaa tgg att gaa gtg aaa gcc aaa gct aaa aag ctg cag atc cag ccc 2050 Lys Trp Ile Glu Val Lys Ala Lys Ala Lys Lys Leu Gln Ile Gln Pro 610 615 620 625 agc cag ctg gaa ttg ttc tac tgt ttg tac gag atg cag gag gag gac 2098 Ser Gln Leu Glu Leu Phe Tyr Cys Leu Tyr Glu Met Gln Glu Glu Asp 630 635 640 ttc gtg caa agg gcc atg gac tat ttc ccc aag att gag atc aat ctc 2146 Phe Val Gln Arg Ala Met Asp Tyr Phe Pro Lys Ile Glu Ile Asn Leu 645 650 655 tcc acc aga atg gac cac atg gtt tct tcc ttt tgc att gag aac tgt 2194 Ser Thr Arg Met Asp His Met Val Ser Ser Phe Cys Ile Glu Asn Cys 660 665 670 cat cgg gtg gag tca ctg tcc ctg ggg ttt ctc cat aac atg ccc aag 2242 His Arg Val Glu Ser Leu Ser Leu Gly Phe Leu His Asn Met Pro Lys 675 680 685 gag gaa gag gag gag gaa aag gaa ggc cga cac ctt gat atg gtg cag 2290 Glu Glu Glu Glu Glu Glu Lys Glu Gly Arg His Leu Asp Met Val Gln 690 695 700 705 tgt gtc ctc cca agc tcc tct cat gct gcc tgt tct cat ggg 2332 Cys Val Leu Pro Ser Ser Ser His Ala Ala Cys Ser His Gly 710 715 taaggaaact cggcttccag gtgcttcctc ctgcttcctc gccagcttct tcttggcgct 2392 tgcctcctct catctctttt caactatctt ccaaatactg ttgccacagc tacatcataa 2452 tgccaccact gtctgtttga gactccttca tgagcaaaga ttgatgtatg gtaggtggat 2512 aaatgggatg ag 2524 <210> SEQ ID NO 59 <211> LENGTH: 719 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <220> FEATURE: <221> NAME/KEY: VARIANT <222> LOCATION: 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71 <223> OTHER INFORMATION: Xaa = Any Amino Acid <220> FEATURE: <221> NAME/KEY: VARIANT <222> LOCATION: 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95 <223> OTHER INFORMATION: Xaa = Any Amino Acid <400> SEQUENCE: 59 Met Lys Met Ala Ser Thr Arg Cys Lys Leu Ala Arg Tyr Leu Glu Asp 1 5 10 15 Leu Glu Asp Val Asp Leu Lys Lys Phe Lys Met His Leu Glu Asp Tyr 20 25 30 Pro Pro Gln Lys Gly Cys Ile Pro Leu Pro Arg Xaa Xaa Xaa Xaa Xaa 35 40 45 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 50 55 60 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa 65 70 75 80 Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Ser 85 90 95 Asp Asn Ala Arg Val Ser Asn Pro Thr Val Ile Cys Gln Glu Asp Ser 100 105 110 Ile Glu Glu Glu Trp Met Gly Leu Leu Glu Tyr Leu Ser Arg Ile Ser 115 120 125 Ile Cys Lys Met Lys Lys Asp Tyr Arg Lys Lys Tyr Arg Lys Tyr Val 130 135 140 Arg Ser Arg Phe Gln Cys Ile Glu Asp Arg Asn Ala Arg Leu Gly Glu 145 150 155 160 Ser Val Ser Leu Asn Lys Arg Tyr Thr Arg Leu Arg Leu Ile Lys Glu 165 170 175 His Arg Ser Gln Gln Glu Arg Glu Gln Glu Leu Leu Ala Ile Gly Lys 180 185 190 Thr Lys Thr Cys Glu Ser Pro Val Ser Pro Ile Lys Met Glu Leu Leu 195 200 205 Phe Asp Pro Asp Asp Glu His Ser Glu Pro Val His Thr Val Val Phe 210 215 220 Gln Gly Ala Ala Gly Ile Gly Lys Thr Ile Leu Ala Arg Lys Met Met 225 230 235 240 Leu Asp Trp Ala Ser Gly Thr Leu Tyr Gln Asp Arg Phe Asp Tyr Leu 245 250 255 Phe Tyr Ile His Cys Arg Glu Val Ser Leu Val Thr Gln Arg Ser Leu 260 265 270 Gly Asp Leu Ile Met Ser Cys Cys Pro Asp Pro Asn Pro Pro Ile His 275 280 285 Lys Ile Val Arg Lys Pro Ser Arg Ile Leu Phe Leu Met Asp Gly Phe 290 295 300 Asp Glu Leu Gln Gly Ala Phe Asp Glu His Ile Gly Pro Leu Cys Thr 305 310 315 320 Asp Trp Gln Lys Ala Glu Arg Gly Asp Ile Leu Leu Ser Ser Leu Ile 325 330 335 Arg Lys Lys Leu Leu Pro Glu Ala Ser Leu Leu Ile Thr Thr Arg Pro 340 345 350 Val Ala Leu Glu Lys Leu Gln His Leu Leu Asp His Pro Arg His Val 355 360 365 Glu Ile Leu Gly Phe Ser Glu Ala Lys Arg Lys Glu Tyr Phe Phe Lys 370 375 380 Tyr Phe Ser Asp Glu Ala Gln Ala Arg Ala Ala Phe Ser Leu Ile Gln 385 390 395 400 Glu Asn Glu Val Leu Phe Thr Met Cys Phe Ile Pro Leu Val Cys Trp 405 410 415 Ile Val Cys Thr Gly Leu Lys Gln Gln Met Glu Ser Gly Lys Ser Leu 420 425 430 Ala Gln Thr Ser Lys Thr Thr Thr Ala Val Tyr Val Phe Phe Leu Ser 435 440 445 Ser Leu Leu Gln Pro Arg Gly Gly Ser Gln Glu His Gly Leu Cys Ala 450 455 460 His Leu Trp Gly Leu Cys Ser Leu Ala Ala Asp Gly Ile Trp Asn Gln 465 470 475 480 Lys Ile Leu Phe Glu Glu Ser Asp Leu Arg Asn His Gly Leu Gln Lys 485 490 495 Ala Asp Val Ser Ala Phe Leu Arg Met Asn Leu Phe Gln Lys Glu Val 500 505 510 Asp Cys Glu Lys Phe Tyr Ser Phe Ile His Met Thr Phe Gln Glu Phe 515 520 525 Phe Ala Ala Met Tyr Tyr Leu Leu Glu Glu Glu Lys Glu Gly Arg Thr 530 535 540 Asn Val Pro Gly Ser Arg Leu Lys Leu Pro Ser Arg Asp Val Thr Val 545 550 555 560 Leu Leu Glu Asn Tyr Gly Lys Phe Glu Lys Gly Tyr Leu Ile Phe Val 565 570 575 Val Arg Phe Leu Phe Gly Leu Val Asn Gln Glu Arg Thr Ser Tyr Leu 580 585 590 Glu Lys Lys Leu Ser Cys Lys Ile Ser Gln Gln Ile Arg Leu Glu Leu 595 600 605 Leu Lys Trp Ile Glu Val Lys Ala Lys Ala Lys Lys Leu Gln Ile Gln 610 615 620 Pro Ser Gln Leu Glu Leu Phe Tyr Cys Leu Tyr Glu Met Gln Glu Glu 625 630 635 640 Asp Phe Val Gln Arg Ala Met Asp Tyr Phe Pro Lys Ile Glu Ile Asn 645 650 655 Leu Ser Thr Arg Met Asp His Met Val Ser Ser Phe Cys Ile Glu Asn 660 665 670 Cys His Arg Val Glu Ser Leu Ser Leu Gly Phe Leu His Asn Met Pro 675 680 685 Lys Glu Glu Glu Glu Glu Glu Lys Glu Gly Arg His Leu Asp Met Val 690 695 700 Gln Cys Val Leu Pro Ser Ser Ser His Ala Ala Cys Ser His Gly 705 710 715 <210> SEQ ID NO 60 <211> LENGTH: 317 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 60 Leu Thr Val Val Leu Gln Gly Pro Ala Gly Ile Gly Lys Thr Met Ala 1 5 10 15 Ala Lys Lys Ile Leu Tyr Asp Trp Ala Ala Gly Lys Leu Tyr Gln Gly 20 25 30 Gln Val Asp Phe Ala Phe Phe Met Pro Cys Gly Glu Leu Leu Glu Arg 35 40 45 Pro Gly Thr Arg Ser Leu Ala Asp Leu Ile Leu Asp Gln Cys Pro Asp 50 55 60 Arg Gly Ala Pro Val Pro Gln Met Leu Ala Gln Pro Gln Arg Leu Leu 65 70 75 80 Phe Ile Leu Asp Gly Ala Asp Glu Leu Pro Ala Leu Gly Gly Pro Glu 85 90 95 Ala Ala Pro Cys Thr Asp Pro Phe Glu Ala Ala Ser Gly Ala Arg Val 100 105 110 Leu Gly Gly Leu Leu Ser Lys Ala Leu Leu Pro Thr Ala Leu Leu Leu 115 120 125 Val Thr Thr Arg Ala Ala Ala Pro Gly Arg Leu Gln Gly Arg Leu Cys 130 135 140 Ser Pro Gln Cys Ala Glu Val Arg Gly Phe Ser Asp Lys Asp Lys Lys 145 150 155 160 Lys Tyr Phe Tyr Lys Phe Phe Arg Asp Glu Arg Arg Ala Glu Arg Ala 165 170 175 Tyr Arg Phe Val Lys Glu Asn Glu Thr Leu Phe Ala Leu Cys Phe Val 180 185 190 Pro Phe Val Cys Trp Ile Val Cys Thr Val Leu Arg Gln Gln Leu Glu 195 200 205 Leu Gly Arg Asp Leu Ser Arg Thr Ser Lys Thr Thr Thr Ser Val Tyr 210 215 220 Leu Leu Phe Ile Thr Ser Val Leu Ser Ser Ala Pro Val Ala Asp Gly 225 230 235 240 Pro Arg Leu Gln Gly Asp Leu Arg Asn Leu Cys Arg Leu Ala Arg Glu 245 250 255 Gly Val Leu Gly Arg Arg Ala Gln Phe Ala Glu Lys Glu Leu Glu Gln 260 265 270 Leu Glu Leu Arg Gly Ser Lys Val Gln Thr Leu Phe Leu Ser Lys Lys 275 280 285 Glu Leu Pro Gly Val Leu Glu Thr Glu Val Thr Tyr Gln Phe Ile Asp 290 295 300 Gln Ser Phe Gln Glu Phe Leu Ala Ala Leu Ser Tyr Leu 305 310 315 <210> SEQ ID NO 61 <211> LENGTH: 290 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 61 Val Leu Ser Tyr Cys Val Arg Cys Cys Pro Ala Gly Gln Ala Leu Arg 1 5 10 15 Leu Ile Ser Cys Arg Leu Val Ala Ala Gln Glu Lys Lys Lys Lys Ser 20 25 30 Leu Gly Lys Arg Leu Gln Ala Ser Leu Gly Gly Gly Ser Trp Leu Gly 35 40 45 Thr Gln Leu Ala Pro Glu Val Pro Phe Arg Pro Pro Cys Cys Asp Ile 50 55 60 Cys Pro Thr Pro Pro Pro Asp Pro Arg Leu Leu Gln Gly Lys Ala Phe 65 70 75 80 Ala Arg Val Pro Leu Asn Ile Ala Pro Ile Gln Pro Leu Pro Arg Gly 85 90 95 Leu Ala Ser Val Glu Arg Met Asn Val Thr Val Leu Ala Gly Ala Gly 100 105 110 Pro Gly Asp Pro Lys Thr His Ala Met Thr Asp Pro Leu Cys His Leu 115 120 125 Ser Ser Leu Thr Leu Ser His Cys Lys Leu Pro Asp Ala Val Cys Arg 130 135 140 Asp Leu Ser Glu Ala Leu Arg Ala Ala Pro Ala Leu Thr Glu Leu Gly 145 150 155 160 Leu Leu His Asn Arg Leu Ser Glu Ala Gly Leu Arg Met Leu Ser Glu 165 170 175 Gly Leu Ala Trp Pro Gln Cys Arg Val Gln Thr Val Arg Val Gln Leu 180 185 190 Pro Asp Pro Gln Arg Gly Leu Gln Tyr Leu Val Gly Met Leu Arg Gln 195 200 205 Ser Pro Ala Leu Thr Thr Leu Asp Leu Ser Gly Cys Gln Leu Pro Ala 210 215 220 Pro Met Val Thr Tyr Leu Cys Ala Val Leu Gln His Gln Gly Cys Gly 225 230 235 240 Leu Gln Thr Leu Ser Leu Ala Ser Val Glu Leu Ser Glu Gln Ser Leu 245 250 255 Gln Glu Leu Gln Ala Val Lys Arg Ala Lys Pro Asp Leu Val Ile Thr 260 265 270 His Pro Ala Leu Asp Gly His Pro Gln Pro Pro Lys Glu Leu Ile Ser 275 280 285 Thr Phe 290 <210> SEQ ID NO 62 <211> LENGTH: 181 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 62 Ile Cys Leu His Gly Val Gly Trp His Trp Lys Asp Asn Ser Arg Gln 1 5 10 15 Lys Lys Val Leu Asp Trp Ala Thr Gly Thr Leu Tyr Pro Gly Arg Phe 20 25 30 Asp Tyr Val Phe Tyr Val Ser Cys Lys Glu Val Val Leu Leu Leu Glu 35 40 45 Ser Lys Leu Glu Gln Leu Leu Phe Trp Cys Cys Gly Asp Asn Gln Ala 50 55 60 Pro Val Thr Glu Ile Leu Arg Gln Pro Glu Arg Leu Leu Phe Ile Leu 65 70 75 80 Asp Gly Phe Asp Glu Leu Gln Arg Pro Phe Glu Glu Lys Leu Lys Lys 85 90 95 Arg Gly Leu Ser Pro Lys Glu Ser Leu Leu His Leu Leu Ile Arg Arg 100 105 110 His Thr Leu Pro Thr Cys Ser Leu Leu Ile Thr Thr Arg Pro Leu Ala 115 120 125 Leu Arg Asn Leu Glu Pro Leu Leu Lys Gln Ala Arg His Val His Ile 130 135 140 Leu Gly Phe Ser Glu Glu Glu Arg Ala Arg Tyr Phe Ser Ser Tyr Phe 145 150 155 160 Thr Asp Glu Lys Gln Ala Asp Arg Ala Phe Asp Ile Val Gln Lys Asn 165 170 175 Asp Ile Leu Tyr Lys 180 <210> SEQ ID NO 63 <211> LENGTH: 190 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 63 Pro Arg Thr Val Val Met Gln Gly Ala Ala Gly Ile Gly Lys Ser Met 1 5 10 15 Leu Ala His Lys Val Met Leu Asp Trp Ala Asp Gly Lys Leu Phe Gln 20 25 30 Gly Arg Phe Asp Tyr Leu Phe Tyr Ile Asn Cys Arg Glu Met Asn Gln 35 40 45 Ser Ala Thr Glu Cys Ser Met Gln Asp Leu Ile Phe Ser Cys Trp Pro 50 55 60 Glu Pro Ser Ala Pro Leu Gln Glu Leu Ile Arg Val Pro Glu Arg Leu 65 70 75 80 Leu Phe Ile Ile Asp Gly Phe Asp Glu Leu Lys Pro Ser Phe His Asp 85 90 95 Pro Gln Gly Pro Trp Cys Leu Cys Trp Glu Glu Lys Arg Pro Thr Glu 100 105 110 Leu Leu Leu Asn Ser Leu Ile Arg Lys Lys Leu Leu Pro Glu Leu Ser 115 120 125 Leu Leu Ile Thr Thr Arg Pro Thr Ala Leu Glu Lys Leu His Arg Leu 130 135 140 Leu Glu His Pro Arg His Val Glu Ile Leu Gly Phe Ser Glu Ala Glu 145 150 155 160 Arg Lys Glu Tyr Phe Tyr Lys Tyr Phe His Asn Ala Glu Gln Ala Gly 165 170 175 Gln Val Phe Asn Tyr Val Arg Asp Asn Glu Pro Leu Phe Thr 180 185 190 <210> SEQ ID NO 64 <211> LENGTH: 603 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 64 Pro Asn Gln Arg Gly Leu Cys Ser Leu Ala Ala Asp Gly Leu Trp Asn 1 5 10 15 Gln Lys Ile Leu Phe Glu Glu Gln Asp Leu Arg Lys His Gly Leu Asp 20 25 30 Gly Glu Asp Val Ser Ala Phe Leu Asn Met Asn Ile Phe Gln Lys Asp 35 40 45 Ile Asn Cys Glu Arg Tyr Tyr Ser Phe Ile His Leu Ser Phe Gln Glu 50 55 60 Phe Phe Ala Ala Met Tyr Tyr Ile Leu Asp Glu Gly Glu Gly Gly Ala 65 70 75 80 Gly Pro Asp Gln Asp Val Thr Arg Leu Leu Thr Glu Tyr Ala Phe Ser 85 90 95 Glu Arg Ser Phe Leu Ala Leu Thr Ser Arg Phe Leu Phe Gly Leu Leu 100 105 110 Asn Glu Glu Thr Arg Ser His Leu Glu Lys Ser Leu Cys Trp Lys Val 115 120 125 Ser Pro His Ile Lys Met Asp Leu Leu Gln Trp Ile Gln Ser Lys Ala 130 135 140 Gln Ser Asp Gly Ser Thr Leu Gln Gln Gly Ser Leu Glu Phe Phe Ser 145 150 155 160 Cys Leu Tyr Glu Ile Gln Glu Glu Glu Phe Ile Gln Gln Ala Leu Ser 165 170 175 His Phe Gln Val Ile Val Val Ser Asn Ile Ala Ser Lys Met Glu His 180 185 190 Met Val Ser Ser Phe Cys Leu Lys Arg Cys Arg Ser Ala Gln Val Leu 195 200 205 His Leu Tyr Gly Ala Thr Tyr Ser Ala Asp Gly Glu Asp Arg Ala Arg 210 215 220 Cys Ser Ala Gly Ala His Thr Leu Leu Val Gln Leu Arg Pro Glu Arg 225 230 235 240 Thr Val Leu Leu Asp Ala Tyr Ser Glu His Leu Ala Ala Ala Leu Cys 245 250 255 Thr Asn Pro Asn Leu Ile Glu Leu Ser Leu Tyr Arg Asn Ala Leu Gly 260 265 270 Ser Arg Gly Val Lys Leu Leu Cys Gln Gly Leu Arg His Pro Asn Cys 275 280 285 Lys Leu Gln Asn Leu Arg Leu Lys Arg Cys Arg Ile Ser Ser Ser Ala 290 295 300 Cys Glu Asp Leu Ser Ala Ala Leu Ile Ala Asn Lys Asn Leu Thr Arg 305 310 315 320 Met Asp Leu Ser Gly Asn Gly Val Gly Phe Pro Gly Met Met Leu Leu 325 330 335 Cys Glu Gly Leu Arg His Pro Gln Cys Arg Leu Gln Met Ile Gln Leu 340 345 350 Arg Lys Cys Gln Leu Glu Ser Gly Ala Cys Gln Glu Met Ala Ser Val 355 360 365 Leu Gly Thr Asn Pro His Leu Val Glu Leu Asp Leu Thr Gly Asn Ala 370 375 380 Leu Glu Asp Leu Gly Leu Arg Leu Leu Cys Gln Gly Leu Arg His Pro 385 390 395 400 Val Cys Arg Leu Arg Thr Leu Trp Leu Lys Ile Cys Arg Leu Thr Ala 405 410 415 Ala Ala Cys Asp Glu Leu Ala Ser Thr Leu Ser Val Asn Gln Ser Leu 420 425 430 Arg Glu Leu Asp Leu Ser Leu Asn Glu Leu Gly Asp Leu Gly Val Leu 435 440 445 Leu Leu Cys Glu Gly Leu Arg His Pro Thr Cys Lys Leu Gln Thr Leu 450 455 460 Arg Leu Gly Ile Cys Arg Leu Gly Ser Ala Ala Cys Glu Gly Leu Ser 465 470 475 480 Val Val Leu Gln Ala Asn His Asn Leu Arg Glu Leu Asp Leu Ser Phe 485 490 495 Asn Asp Leu Gly Asp Trp Gly Leu Trp Leu Leu Ala Glu Gly Leu Gln 500 505 510 His Pro Ala Cys Arg Leu Gln Lys Leu Trp Leu Asp Ser Cys Gly Leu 515 520 525 Thr Ala Lys Ala Cys Glu Asn Leu Tyr Phe Thr Leu Gly Ile Asn Gln 530 535 540 Thr Leu Thr Asp Leu Tyr Leu Thr Asn Asn Ala Leu Gly Asp Thr Gly 545 550 555 560 Val Arg Leu Leu Cys Lys Arg Leu Ser His Pro Gly Cys Lys Leu Arg 565 570 575 Val Leu Trp Leu Phe Gly Met Asp Leu Asn Lys Met Thr His Ser Arg 580 585 590 Leu Ala Ala Leu Arg Val Thr Lys Pro Tyr Leu 595 600 <210> SEQ ID NO 65 <211> LENGTH: 2708 <212> TYPE: DNA <213> ORGANISM: Homo sapiens <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (1)...(2708) <400> SEQUENCE: 65 atg gac cag cca gag gcc ccc tgc tcc agc acg ggg ccg cgc ctc gcg 48 Met Asp Gln Pro Glu Ala Pro Cys Ser Ser Thr Gly Pro Arg Leu Ala 1 5 10 15 gtg gcc cgc gag ctg ctc ctg gct gcg ctg gag gaa ctg agc caa gag 96 Val Ala Arg Glu Leu Leu Leu Ala Ala Leu Glu Glu Leu Ser Gln Glu 20 25 30 cag ctg aag cgc ttc cgc cac aag ctg cgc gac gtg ggc ccg gac gga 144 Gln Leu Lys Arg Phe Arg His Lys Leu Arg Asp Val Gly Pro Asp Gly 35 40 45 cgc agc atc ccg tgg ggg cgg ctg gag cgc gcg gac gcc gtg gac ctc 192 Arg Ser Ile Pro Trp Gly Arg Leu Glu Arg Ala Asp Ala Val Asp Leu 50 55 60 gcg gag cag ctg gcc cag ttc tac ggc ccg gag cct gcc ctg gag gtg 240 Ala Glu Gln Leu Ala Gln Phe Tyr Gly Pro Glu Pro Ala Leu Glu Val 65 70 75 80 gcc cgc aag acc ctc aag agg gcg gac gcg cgc gac gtg gcg gcg cag 288 Ala Arg Lys Thr Leu Lys Arg Ala Asp Ala Arg Asp Val Ala Ala Gln 85 90 95 ctc cag gag cgg cgg ctg cag cgg ctc ggg ctc ggc tcc ggg acg ctg 336 Leu Gln Glu Arg Arg Leu Gln Arg Leu Gly Leu Gly Ser Gly Thr Leu 100 105 110 ctc tcc gtg tcc gag tac aag aag aag tac cgg gag cac gtg ctg cag 384 Leu Ser Val Ser Glu Tyr Lys Lys Lys Tyr Arg Glu His Val Leu Gln 115 120 125 ctg cac gct cgg gtg aag gag agg aac gcc cgc tcc gtg aag atc acc 432 Leu His Ala Arg Val Lys Glu Arg Asn Ala Arg Ser Val Lys Ile Thr 130 135 140 aag cgc ttc acc aag ctg ctc atc gcg ccc gag agc gcc gcc ccg gag 480 Lys Arg Phe Thr Lys Leu Leu Ile Ala Pro Glu Ser Ala Ala Pro Glu 145 150 155 160 gag gcg ctg ggg ccc gcg gaa gag cct gag ccg ggg cgc gcg cgg cgc 528 Glu Ala Leu Gly Pro Ala Glu Glu Pro Glu Pro Gly Arg Ala Arg Arg 165 170 175 tcg gac acg cac act ttc aac cgc ctc ttc cgc cgc gac gag gag ggc 576 Ser Asp Thr His Thr Phe Asn Arg Leu Phe Arg Arg Asp Glu Glu Gly 180 185 190 cgg cgg ccg ctg acc gtg gtg ctg cag ggc ccg gcg ggc atc ggc aag 624 Arg Arg Pro Leu Thr Val Val Leu Gln Gly Pro Ala Gly Ile Gly Lys 195 200 205 acc atg gcg gcc aaa aag atc ctg tac gac tgg gcg gcg ggc aag ctg 672 Thr Met Ala Ala Lys Lys Ile Leu Tyr Asp Trp Ala Ala Gly Lys Leu 210 215 220 tac cag ggc cag gtg gac ttc gcc ttc ttc atg ccc tgc ggc gag ctg 720 Tyr Gln Gly Gln Val Asp Phe Ala Phe Phe Met Pro Cys Gly Glu Leu 225 230 235 240 ctg gag agg ccg ggc acg cgc agc ctg gct gac ctg atc ctg gac cag 768 Leu Glu Arg Pro Gly Thr Arg Ser Leu Ala Asp Leu Ile Leu Asp Gln 245 250 255 tgc ccc gac cgc ggc gcg ccg gtg ccg cag atg ctg gcc cag ccg cag 816 Cys Pro Asp Arg Gly Ala Pro Val Pro Gln Met Leu Ala Gln Pro Gln 260 265 270 cgg ctg ctc ttc atc ctg gac ggc gcg gac gag ctg ccg gcg ctg ggg 864 Arg Leu Leu Phe Ile Leu Asp Gly Ala Asp Glu Leu Pro Ala Leu Gly 275 280 285 ggc ccc gag gcc gcg ccc tgc aca gac ccc ttc gag gcg gcg agc ggc 912 Gly Pro Glu Ala Ala Pro Cys Thr Asp Pro Phe Glu Ala Ala Ser Gly 290 295 300 gcg cgg gtg cta ggc ggg ctg ctg agc aag gcg ctg ctg ccc acg gcc 960 Ala Arg Val Leu Gly Gly Leu Leu Ser Lys Ala Leu Leu Pro Thr Ala 305 310 315 320 ctc ctg ctg gtg acc acg cgc gcc gcc gcc ccc ggg agg ctg cag ggc 1008 Leu Leu Leu Val Thr Thr Arg Ala Ala Ala Pro Gly Arg Leu Gln Gly 325 330 335 cgc ctg tgt tcc ccg cag tgc gcc gag gtg cgc ggc ttc tcc gac aag 1056 Arg Leu Cys Ser Pro Gln Cys Ala Glu Val Arg Gly Phe Ser Asp Lys 340 345 350 gac aag aag aag tat ttc tac aag ttc ttc cgg gat gag agg agg gcc 1104 Asp Lys Lys Lys Tyr Phe Tyr Lys Phe Phe Arg Asp Glu Arg Arg Ala 355 360 365 gag cgc gcc tac cgc ttc gtg aag gag aac gag acg ctg ttc gcg ctg 1152 Glu Arg Ala Tyr Arg Phe Val Lys Glu Asn Glu Thr Leu Phe Ala Leu 370 375 380 tgc ttc gtg ccc ttc gtg tgc tgg atc gtg tgc acc gtg ctg cgc cag 1200 Cys Phe Val Pro Phe Val Cys Trp Ile Val Cys Thr Val Leu Arg Gln 385 390 395 400 cag ctg gag ctc ggt cgg gac ctg tcg cgc acg tcc aag acc acc acg 1248 Gln Leu Glu Leu Gly Arg Asp Leu Ser Arg Thr Ser Lys Thr Thr Thr 405 410 415 tca gtg tac ctg ctt ttc atc acc agc gtt ctg agc tcg gct ccg gta 1296 Ser Val Tyr Leu Leu Phe Ile Thr Ser Val Leu Ser Ser Ala Pro Val 420 425 430 gcc gac ggg ccc cgg ttg cag ggc gac ctg cgc aat ctg tgc cgc ctg 1344 Ala Asp Gly Pro Arg Leu Gln Gly Asp Leu Arg Asn Leu Cys Arg Leu 435 440 445 gcc cgc gag ggc gtc ctc gga cgc agg gcg cag ttt gcc gag aag gaa 1392 Ala Arg Glu Gly Val Leu Gly Arg Arg Ala Gln Phe Ala Glu Lys Glu 450 455 460 ctg gag caa ctg gag ctt cgt ggc tcc aaa gtg cag acg ctg ttt ctc 1440 Leu Glu Gln Leu Glu Leu Arg Gly Ser Lys Val Gln Thr Leu Phe Leu 465 470 475 480 agc aaa aag gag ctg ccg ggc gtg ctg gag aca gag gtc acc tac cag 1488 Ser Lys Lys Glu Leu Pro Gly Val Leu Glu Thr Glu Val Thr Tyr Gln 485 490 495 ttc atc gac cag agc ttc cag gag ttc ctc gcg gca ctg tcc tac ctg 1536 Phe Ile Asp Gln Ser Phe Gln Glu Phe Leu Ala Ala Leu Ser Tyr Leu 500 505 510 ctg gag gac ggc ggg gtg ccc agg acc gcg gct ggc ggc gtt ggg aca 1584 Leu Glu Asp Gly Gly Val Pro Arg Thr Ala Ala Gly Gly Val Gly Thr 515 520 525 ctc ctg cgt ggg gac gcc cag ccg cac agc cac ttg gtg ctc acc acg 1632 Leu Leu Arg Gly Asp Ala Gln Pro His Ser His Leu Val Leu Thr Thr 530 535 540 cgc ttc ctc ttc gga ctg ctg agc gcg gag cgg atg cgc gac atc gag 1680 Arg Phe Leu Phe Gly Leu Leu Ser Ala Glu Arg Met Arg Asp Ile Glu 545 550 555 560 cgc cac ttc ggc tgc atg gtt tca gag cgt gtg aag cag gag gcc ctg 1728 Arg His Phe Gly Cys Met Val Ser Glu Arg Val Lys Gln Glu Ala Leu 565 570 575 cgg tgg gtg cag gga cag gga cag ggc tgc ccc gga gtg gca cca gag 1776 Arg Trp Val Gln Gly Gln Gly Gln Gly Cys Pro Gly Val Ala Pro Glu 580 585 590 gtg acc gag ggg gcc aaa ggg ctc gag gac acc gaa gag cca gag gag 1824 Val Thr Glu Gly Ala Lys Gly Leu Glu Asp Thr Glu Glu Pro Glu Glu 595 600 605 gag gag gag gga gag gag ccc aac tac cca ctg gag ttg ctg tac tgc 1872 Glu Glu Glu Gly Glu Glu Pro Asn Tyr Pro Leu Glu Leu Leu Tyr Cys 610 615 620 ctg tac gag acg cag gag gac gcg ttt gtg cgc caa gcc ctg tgc cgg 1920 Leu Tyr Glu Thr Gln Glu Asp Ala Phe Val Arg Gln Ala Leu Cys Arg 625 630 635 640 ttc ccg gag ctg gcg ctg cag cga gtg cgc ttc tgc cgc atg gac gtg 1968 Phe Pro Glu Leu Ala Leu Gln Arg Val Arg Phe Cys Arg Met Asp Val 645 650 655 gct gtt ctg agc tac tgc gtg agg tgc tgc cct gct gga cag gca ctg 2016 Ala Val Leu Ser Tyr Cys Val Arg Cys Cys Pro Ala Gly Gln Ala Leu 660 665 670 cgg ctg atc agc tgc aga ttg gtt gct gcg cag gag aag aag aag aag 2064 Arg Leu Ile Ser Cys Arg Leu Val Ala Ala Gln Glu Lys Lys Lys Lys 675 680 685 agc ctg ggg aag cgg ctc cag gcc agc ctg ggt ggc ggc agc tgg ctg 2112 Ser Leu Gly Lys Arg Leu Gln Ala Ser Leu Gly Gly Gly Ser Trp Leu 690 695 700 ggg acc caa ctg gct cca gaa gta ccc ttt cga cca ccc tgc tgt gac 2160 Gly Thr Gln Leu Ala Pro Glu Val Pro Phe Arg Pro Pro Cys Cys Asp 705 710 715 720 atc tgc ccc aca cct cca cca gac cct cgg ctc ctc cag ggc aag gct 2208 Ile Cys Pro Thr Pro Pro Pro Asp Pro Arg Leu Leu Gln Gly Lys Ala 725 730 735 ttt gcc aga gtt cct ttg aat ata gct cca att cag ccc ctg ccc agg 2256 Phe Ala Arg Val Pro Leu Asn Ile Ala Pro Ile Gln Pro Leu Pro Arg 740 745 750 ggc ttg gca tct gtt gag agg atg aat gtc acg gtg ttg gca ggg gct 2304 Gly Leu Ala Ser Val Glu Arg Met Asn Val Thr Val Leu Ala Gly Ala 755 760 765 ggg cct ggg gac cca aag acc cat gca atg act gac cca ctg tgc cat 2352 Gly Pro Gly Asp Pro Lys Thr His Ala Met Thr Asp Pro Leu Cys His 770 775 780 ctg agc agc ctc acg ctg tcc cac tgc aaa ctc cct gac gcg gtc tgc 2400 Leu Ser Ser Leu Thr Leu Ser His Cys Lys Leu Pro Asp Ala Val Cys 785 790 795 800 cga gac ctt tct gag gcc ctg agg gca gcc ccc gca ctg acg gag ctg 2448 Arg Asp Leu Ser Glu Ala Leu Arg Ala Ala Pro Ala Leu Thr Glu Leu 805 810 815 ggc ctc ctc cac aac agg ctc agt gag gca gga ctg cgt atg ctg agt 2496 Gly Leu Leu His Asn Arg Leu Ser Glu Ala Gly Leu Arg Met Leu Ser 820 825 830 gag ggc cta gcc tgg ccg cag tgc agg gtg cag acg gtc agg gta cag 2544 Glu Gly Leu Ala Trp Pro Gln Cys Arg Val Gln Thr Val Arg Val Gln 835 840 845 ctg cct gac ccc cag cga ggg ctc cag tac ctg gtg ggt atg ctt cgg 2592 Leu Pro Asp Pro Gln Arg Gly Leu Gln Tyr Leu Val Gly Met Leu Arg 850 855 860 cag agc cct gcc ctg acc acc ctg gat ctc agc ggc tgc caa ctg ccc 2640 Gln Ser Pro Ala Leu Thr Thr Leu Asp Leu Ser Gly Cys Gln Leu Pro 865 870 875 880 gcc ccc atg gtg acc tac ctg tgt gca gtc ctg cag cac cag gga tgc 2688 Ala Pro Met Val Thr Tyr Leu Cys Ala Val Leu Gln His Gln Gly Cys 885 890 895 ggc ctg cag acc ctc agc ct 2708 Gly Leu Gln Thr Leu Ser 900 <210> SEQ ID NO 66 <211> LENGTH: 902 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 66 Met Asp Gln Pro Glu Ala Pro Cys Ser Ser Thr Gly Pro Arg Leu Ala 1 5 10 15 Val Ala Arg Glu Leu Leu Leu Ala Ala Leu Glu Glu Leu Ser Gln Glu 20 25 30 Gln Leu Lys Arg Phe Arg His Lys Leu Arg Asp Val Gly Pro Asp Gly 35 40 45 Arg Ser Ile Pro Trp Gly Arg Leu Glu Arg Ala Asp Ala Val Asp Leu 50 55 60 Ala Glu Gln Leu Ala Gln Phe Tyr Gly Pro Glu Pro Ala Leu Glu Val 65 70 75 80 Ala Arg Lys Thr Leu Lys Arg Ala Asp Ala Arg Asp Val Ala Ala Gln 85 90 95 Leu Gln Glu Arg Arg Leu Gln Arg Leu Gly Leu Gly Ser Gly Thr Leu 100 105 110 Leu Ser Val Ser Glu Tyr Lys Lys Lys Tyr Arg Glu His Val Leu Gln 115 120 125 Leu His Ala Arg Val Lys Glu Arg Asn Ala Arg Ser Val Lys Ile Thr 130 135 140 Lys Arg Phe Thr Lys Leu Leu Ile Ala Pro Glu Ser Ala Ala Pro Glu 145 150 155 160 Glu Ala Leu Gly Pro Ala Glu Glu Pro Glu Pro Gly Arg Ala Arg Arg 165 170 175 Ser Asp Thr His Thr Phe Asn Arg Leu Phe Arg Arg Asp Glu Glu Gly 180 185 190 Arg Arg Pro Leu Thr Val Val Leu Gln Gly Pro Ala Gly Ile Gly Lys 195 200 205 Thr Met Ala Ala Lys Lys Ile Leu Tyr Asp Trp Ala Ala Gly Lys Leu 210 215 220 Tyr Gln Gly Gln Val Asp Phe Ala Phe Phe Met Pro Cys Gly Glu Leu 225 230 235 240 Leu Glu Arg Pro Gly Thr Arg Ser Leu Ala Asp Leu Ile Leu Asp Gln 245 250 255 Cys Pro Asp Arg Gly Ala Pro Val Pro Gln Met Leu Ala Gln Pro Gln 260 265 270 Arg Leu Leu Phe Ile Leu Asp Gly Ala Asp Glu Leu Pro Ala Leu Gly 275 280 285 Gly Pro Glu Ala Ala Pro Cys Thr Asp Pro Phe Glu Ala Ala Ser Gly 290 295 300 Ala Arg Val Leu Gly Gly Leu Leu Ser Lys Ala Leu Leu Pro Thr Ala 305 310 315 320 Leu Leu Leu Val Thr Thr Arg Ala Ala Ala Pro Gly Arg Leu Gln Gly 325 330 335 Arg Leu Cys Ser Pro Gln Cys Ala Glu Val Arg Gly Phe Ser Asp Lys 340 345 350 Asp Lys Lys Lys Tyr Phe Tyr Lys Phe Phe Arg Asp Glu Arg Arg Ala 355 360 365 Glu Arg Ala Tyr Arg Phe Val Lys Glu Asn Glu Thr Leu Phe Ala Leu 370 375 380 Cys Phe Val Pro Phe Val Cys Trp Ile Val Cys Thr Val Leu Arg Gln 385 390 395 400 Gln Leu Glu Leu Gly Arg Asp Leu Ser Arg Thr Ser Lys Thr Thr Thr 405 410 415 Ser Val Tyr Leu Leu Phe Ile Thr Ser Val Leu Ser Ser Ala Pro Val 420 425 430 Ala Asp Gly Pro Arg Leu Gln Gly Asp Leu Arg Asn Leu Cys Arg Leu 435 440 445 Ala Arg Glu Gly Val Leu Gly Arg Arg Ala Gln Phe Ala Glu Lys Glu 450 455 460 Leu Glu Gln Leu Glu Leu Arg Gly Ser Lys Val Gln Thr Leu Phe Leu 465 470 475 480 Ser Lys Lys Glu Leu Pro Gly Val Leu Glu Thr Glu Val Thr Tyr Gln 485 490 495 Phe Ile Asp Gln Ser Phe Gln Glu Phe Leu Ala Ala Leu Ser Tyr Leu 500 505 510 Leu Glu Asp Gly Gly Val Pro Arg Thr Ala Ala Gly Gly Val Gly Thr 515 520 525 Leu Leu Arg Gly Asp Ala Gln Pro His Ser His Leu Val Leu Thr Thr 530 535 540 Arg Phe Leu Phe Gly Leu Leu Ser Ala Glu Arg Met Arg Asp Ile Glu 545 550 555 560 Arg His Phe Gly Cys Met Val Ser Glu Arg Val Lys Gln Glu Ala Leu 565 570 575 Arg Trp Val Gln Gly Gln Gly Gln Gly Cys Pro Gly Val Ala Pro Glu 580 585 590 Val Thr Glu Gly Ala Lys Gly Leu Glu Asp Thr Glu Glu Pro Glu Glu 595 600 605 Glu Glu Glu Gly Glu Glu Pro Asn Tyr Pro Leu Glu Leu Leu Tyr Cys 610 615 620 Leu Tyr Glu Thr Gln Glu Asp Ala Phe Val Arg Gln Ala Leu Cys Arg 625 630 635 640 Phe Pro Glu Leu Ala Leu Gln Arg Val Arg Phe Cys Arg Met Asp Val 645 650 655 Ala Val Leu Ser Tyr Cys Val Arg Cys Cys Pro Ala Gly Gln Ala Leu 660 665 670 Arg Leu Ile Ser Cys Arg Leu Val Ala Ala Gln Glu Lys Lys Lys Lys 675 680 685 Ser Leu Gly Lys Arg Leu Gln Ala Ser Leu Gly Gly Gly Ser Trp Leu 690 695 700 Gly Thr Gln Leu Ala Pro Glu Val Pro Phe Arg Pro Pro Cys Cys Asp 705 710 715 720 Ile Cys Pro Thr Pro Pro Pro Asp Pro Arg Leu Leu Gln Gly Lys Ala 725 730 735 Phe Ala Arg Val Pro Leu Asn Ile Ala Pro Ile Gln Pro Leu Pro Arg 740 745 750 Gly Leu Ala Ser Val Glu Arg Met Asn Val Thr Val Leu Ala Gly Ala 755 760 765 Gly Pro Gly Asp Pro Lys Thr His Ala Met Thr Asp Pro Leu Cys His 770 775 780 Leu Ser Ser Leu Thr Leu Ser His Cys Lys Leu Pro Asp Ala Val Cys 785 790 795 800 Arg Asp Leu Ser Glu Ala Leu Arg Ala Ala Pro Ala Leu Thr Glu Leu 805 810 815 Gly Leu Leu His Asn Arg Leu Ser Glu Ala Gly Leu Arg Met Leu Ser 820 825 830 Glu Gly Leu Ala Trp Pro Gln Cys Arg Val Gln Thr Val Arg Val Gln 835 840 845 Leu Pro Asp Pro Gln Arg Gly Leu Gln Tyr Leu Val Gly Met Leu Arg 850 855 860 Gln Ser Pro Ala Leu Thr Thr Leu Asp Leu Ser Gly Cys Gln Leu Pro 865 870 875 880 Ala Pro Met Val Thr Tyr Leu Cys Ala Val Leu Gln His Gln Gly Cys 885 890 895 Gly Leu Gln Thr Leu Ser 900 <210> SEQ ID NO 67 <211> LENGTH: 3218 <212> TYPE: DNA <213> ORGANISM: Homo sapiens <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (118)...(3200) <400> SEQUENCE: 67 ctctccgccc gctgcctgtg aatgatgcaa tggaaggtgt gctggggtcg ccctgtgtcc 60 cgtgcatagg agcatctcag cctccaggtc ctctcctttg gggctcacgg caccccc atg 120 Met 1 cta cga acc gca ggc agg gac ggc ctc tgt cgc ctg tcc acc tac ttg 168 Leu Arg Thr Ala Gly Arg Asp Gly Leu Cys Arg Leu Ser Thr Tyr Leu 5 10 15 gaa gaa ctc gag gct gtg gaa ctg aag aag ttc aag tta tac ctg ggg 216 Glu Glu Leu Glu Ala Val Glu Leu Lys Lys Phe Lys Leu Tyr Leu Gly 20 25 30 acc gcg aca gag ctg gga gaa ggc aag atc ccc tgg gga agc atg gag 264 Thr Ala Thr Glu Leu Gly Glu Gly Lys Ile Pro Trp Gly Ser Met Glu 35 40 45 aag gcc ggt ccc ctg gaa atg gcc cag ctg ctc atc acc cac ttc ggg 312 Lys Ala Gly Pro Leu Glu Met Ala Gln Leu Leu Ile Thr His Phe Gly 50 55 60 65 cca gag gag gcc tgg agg ttg gct ctc agc acc ttt gag cgg ata aac 360 Pro Glu Glu Ala Trp Arg Leu Ala Leu Ser Thr Phe Glu Arg Ile Asn 70 75 80 agg aag gac ctg tgg gag aga gga cag aga gag gac ctg gtg agg gat 408 Arg Lys Asp Leu Trp Glu Arg Gly Gln Arg Glu Asp Leu Val Arg Asp 85 90 95 acc cca cct ggt ggc ccg tcc tca ctt ggg aac cag tca aca tgc ctt 456 Thr Pro Pro Gly Gly Pro Ser Ser Leu Gly Asn Gln Ser Thr Cys Leu 100 105 110 ctg gaa gtc tct ctt gtc act cca aga aaa gat ccc cag gaa acc tac 504 Leu Glu Val Ser Leu Val Thr Pro Arg Lys Asp Pro Gln Glu Thr Tyr 115 120 125 agg gac tat gtc cgc agg aaa ttc cgg ctc atg gaa gac cgc aat gcg 552 Arg Asp Tyr Val Arg Arg Lys Phe Arg Leu Met Glu Asp Arg Asn Ala 130 135 140 145 cgc cta ggg gaa tgt gtc aac ctc agc cac cgg tac acc cgg ctc ctg 600 Arg Leu Gly Glu Cys Val Asn Leu Ser His Arg Tyr Thr Arg Leu Leu 150 155 160 ctg gtg aag gag cac tca aac ccc atg cag gtc cag cag cag ctt ctg 648 Leu Val Lys Glu His Ser Asn Pro Met Gln Val Gln Gln Gln Leu Leu 165 170 175 gac aca ggc cgg gga cac gcg agg acc gtg gga cac cag gct agc ccc 696 Asp Thr Gly Arg Gly His Ala Arg Thr Val Gly His Gln Ala Ser Pro 180 185 190 atc aag ata gag acc ctc ttt gag cca gac gag gag cgc ccc gag cca 744 Ile Lys Ile Glu Thr Leu Phe Glu Pro Asp Glu Glu Arg Pro Glu Pro 195 200 205 ccg cgc acc gtg gtc atg caa ggc gcg gca ggg ata ggc aag tcc atg 792 Pro Arg Thr Val Val Met Gln Gly Ala Ala Gly Ile Gly Lys Ser Met 210 215 220 225 ctg gca cac aag gtg atg ctg gac tgg gcg gac ggg aag ctc ttc caa 840 Leu Ala His Lys Val Met Leu Asp Trp Ala Asp Gly Lys Leu Phe Gln 230 235 240 ggc aga ttt gat tat ctc ttc tac atc aac tgc agg gag atg aac cag 888 Gly Arg Phe Asp Tyr Leu Phe Tyr Ile Asn Cys Arg Glu Met Asn Gln 245 250 255 agt gcc acg gaa tgc agc atg caa gac ctc atc ttc agc tgc tgg cct 936 Ser Ala Thr Glu Cys Ser Met Gln Asp Leu Ile Phe Ser Cys Trp Pro 260 265 270 gag ccc agc gcg cct ctc cag gag ctc atc cga gtt ccc gag cgc ctc 984 Glu Pro Ser Ala Pro Leu Gln Glu Leu Ile Arg Val Pro Glu Arg Leu 275 280 285 ctt ttc atc atc gac ggc ttc gat gag ctc aag cct tct ttc cac gat 1032 Leu Phe Ile Ile Asp Gly Phe Asp Glu Leu Lys Pro Ser Phe His Asp 290 295 300 305 cct cag gga ccc tgg tgc ctc tgc tgg gag gag aaa cgg ccc acg gag 1080 Pro Gln Gly Pro Trp Cys Leu Cys Trp Glu Glu Lys Arg Pro Thr Glu 310 315 320 ctg ctt ctt aac agc tta att cgg aag aag ctg ctc cct gag cta tct 1128 Leu Leu Leu Asn Ser Leu Ile Arg Lys Lys Leu Leu Pro Glu Leu Ser 325 330 335 ttg ctc atc acc aca cgg ccc acg gct ttg gag aag ctc cac cgt ctg 1176 Leu Leu Ile Thr Thr Arg Pro Thr Ala Leu Glu Lys Leu His Arg Leu 340 345 350 ctg gag cac ccc agg cat gtg gag atc ctg ggc ttc tct gag gca gaa 1224 Leu Glu His Pro Arg His Val Glu Ile Leu Gly Phe Ser Glu Ala Glu 355 360 365 agg aag gaa tac ttc tac aag tat ttc cac aat gca gag cag gcg ggc 1272 Arg Lys Glu Tyr Phe Tyr Lys Tyr Phe His Asn Ala Glu Gln Ala Gly 370 375 380 385 caa gtc ttc aat tac gtg agg gac aac gag cct ctc ttc acc atg tgc 1320 Gln Val Phe Asn Tyr Val Arg Asp Asn Glu Pro Leu Phe Thr Met Cys 390 395 400 ttc gtc ccc ctg gtg tgc tgg gtg gtg tgt acc tgc ctc cag cag cag 1368 Phe Val Pro Leu Val Cys Trp Val Val Cys Thr Cys Leu Gln Gln Gln 405 410 415 ctg gag ggt ggg ggg ctg ttg aga cag acg tcc agg acc acc act gca 1416 Leu Glu Gly Gly Gly Leu Leu Arg Gln Thr Ser Arg Thr Thr Thr Ala 420 425 430 gtg tac atg ctc tac ctg ctg agt ctg atg caa ccc aag ccg ggg gcc 1464 Val Tyr Met Leu Tyr Leu Leu Ser Leu Met Gln Pro Lys Pro Gly Ala 435 440 445 ccg cgc ctc cag ccc cca ccc aac cag aga ggg ttg tgc tcc ttg gcg 1512 Pro Arg Leu Gln Pro Pro Pro Asn Gln Arg Gly Leu Cys Ser Leu Ala 450 455 460 465 gca gat ggg ctc tgg aat cag aaa atc cta ttt gag gag cag gac ctc 1560 Ala Asp Gly Leu Trp Asn Gln Lys Ile Leu Phe Glu Glu Gln Asp Leu 470 475 480 cgg aag cac ggc cta gac ggg gaa gac gtc tct gcc ttc ctc aac atg 1608 Arg Lys His Gly Leu Asp Gly Glu Asp Val Ser Ala Phe Leu Asn Met 485 490 495 aac atc ttc cag aag gac atc aac tgt gag agg tac tac agc ttc atc 1656 Asn Ile Phe Gln Lys Asp Ile Asn Cys Glu Arg Tyr Tyr Ser Phe Ile 500 505 510 cac ttg agt ttc cag gaa ttc ttt gca gct atg tac tat atc ctg gac 1704 His Leu Ser Phe Gln Glu Phe Phe Ala Ala Met Tyr Tyr Ile Leu Asp 515 520 525 gag ggg gag ggc ggg gca ggc cca gac cag gac gtg acc agg ctg ttg 1752 Glu Gly Glu Gly Gly Ala Gly Pro Asp Gln Asp Val Thr Arg Leu Leu 530 535 540 545 acc gag tac gcg ttt tct gaa agg agc ttc ctg gca ctc acc agc cgc 1800 Thr Glu Tyr Ala Phe Ser Glu Arg Ser Phe Leu Ala Leu Thr Ser Arg 550 555 560 ttc ctg ttt gga ctc ctg aac gag gag acc agg agc cac ctg gag aag 1848 Phe Leu Phe Gly Leu Leu Asn Glu Glu Thr Arg Ser His Leu Glu Lys 565 570 575 agt ctc tgc tgg aag gtc tcg ccg cac atc aag atg gac ctg ttg cag 1896 Ser Leu Cys Trp Lys Val Ser Pro His Ile Lys Met Asp Leu Leu Gln 580 585 590 tgg atc caa agc aaa gct cag agc gac ggc tcc acc ctg cag cag ggc 1944 Trp Ile Gln Ser Lys Ala Gln Ser Asp Gly Ser Thr Leu Gln Gln Gly 595 600 605 tcc ttg gag ttc ttc agc tgc ttg tac gag atc cag gag gag gag ttt 1992 Ser Leu Glu Phe Phe Ser Cys Leu Tyr Glu Ile Gln Glu Glu Glu Phe 610 615 620 625 atc cag cag gcc ctg agc cac ttc cag gtg atc gtg gtc agc aac att 2040 Ile Gln Gln Ala Leu Ser His Phe Gln Val Ile Val Val Ser Asn Ile 630 635 640 gcc tcc aag atg gag cac atg gtc tcc tcg ttc tgt ctg aag cgc tgc 2088 Ala Ser Lys Met Glu His Met Val Ser Ser Phe Cys Leu Lys Arg Cys 645 650 655 agg agc gcc cag gtg ctg cac ttg tat ggc gcc acc tac agc gcg gac 2136 Arg Ser Ala Gln Val Leu His Leu Tyr Gly Ala Thr Tyr Ser Ala Asp 660 665 670 ggg gaa gac cgc gcg agg tgc tcc gca gga gcg cac acg ctg ttg gtg 2184 Gly Glu Asp Arg Ala Arg Cys Ser Ala Gly Ala His Thr Leu Leu Val 675 680 685 cag ctc aga cca gag agg acc gtt ctg ctg gac gcc tac agt gaa cat 2232 Gln Leu Arg Pro Glu Arg Thr Val Leu Leu Asp Ala Tyr Ser Glu His 690 695 700 705 ctg gca gcg gcc ctg tgc acc aat cca aac ctg ata gag ctg tct ctg 2280 Leu Ala Ala Ala Leu Cys Thr Asn Pro Asn Leu Ile Glu Leu Ser Leu 710 715 720 tac cga aat gcc ctg ggc agc cgg ggg gtg aag ctg ctc tgt caa gga 2328 Tyr Arg Asn Ala Leu Gly Ser Arg Gly Val Lys Leu Leu Cys Gln Gly 725 730 735 ctc aga cac ccc aac tgc aaa ctt cag aac ctg agg ctg aag agg tgc 2376 Leu Arg His Pro Asn Cys Lys Leu Gln Asn Leu Arg Leu Lys Arg Cys 740 745 750 cgc atc tcc agc tca gcc tgc gag gac ctc tct gca gct ctc ata gcc 2424 Arg Ile Ser Ser Ser Ala Cys Glu Asp Leu Ser Ala Ala Leu Ile Ala 755 760 765 aat aag aat ttg aca agg atg gat ctc agt ggc aac ggc gtt gga ttc 2472 Asn Lys Asn Leu Thr Arg Met Asp Leu Ser Gly Asn Gly Val Gly Phe 770 775 780 785 cca ggc atg atg ctg ctt tgc gag ggc ctg cgg cat ccc cag tgc agg 2520 Pro Gly Met Met Leu Leu Cys Glu Gly Leu Arg His Pro Gln Cys Arg 790 795 800 ctg cag atg att cag ttg agg aag tgt cag ctg gag tcc ggg gct tgt 2568 Leu Gln Met Ile Gln Leu Arg Lys Cys Gln Leu Glu Ser Gly Ala Cys 805 810 815 cag gag atg gct tct gtg ctc ggc acc aac cca cat ctg gtt gag ttg 2616 Gln Glu Met Ala Ser Val Leu Gly Thr Asn Pro His Leu Val Glu Leu 820 825 830 gac ctg aca gga aat gca ctg gag gat ttg ggc ctg agg tta cta tgc 2664 Asp Leu Thr Gly Asn Ala Leu Glu Asp Leu Gly Leu Arg Leu Leu Cys 835 840 845 cag gga ctg agg cac cca gtc tgc aga cta cgg act ttg tgg ctg aag 2712 Gln Gly Leu Arg His Pro Val Cys Arg Leu Arg Thr Leu Trp Leu Lys 850 855 860 865 atc tgc cgc ctc act gct gct gcc tgt gac gag ctg gcc tca act ctc 2760 Ile Cys Arg Leu Thr Ala Ala Ala Cys Asp Glu Leu Ala Ser Thr Leu 870 875 880 agt gtg aac cag agc ctg aga gag ctg gac ctg agc ctg aat gag ctg 2808 Ser Val Asn Gln Ser Leu Arg Glu Leu Asp Leu Ser Leu Asn Glu Leu 885 890 895 ggg gac ctc ggg gtg ctg ctg ctg tgt gag ggc ctc agg cat ccc acg 2856 Gly Asp Leu Gly Val Leu Leu Leu Cys Glu Gly Leu Arg His Pro Thr 900 905 910 tgc aag ctc cag acc ctg cgg ttg ggc atc tgc cgg ctg ggc tct gcc 2904 Cys Lys Leu Gln Thr Leu Arg Leu Gly Ile Cys Arg Leu Gly Ser Ala 915 920 925 gcc tgt gag ggt ctt tct gtg gtg ctc cag gcc aac cac aac ctc cgg 2952 Ala Cys Glu Gly Leu Ser Val Val Leu Gln Ala Asn His Asn Leu Arg 930 935 940 945 gag ctg gac ttg agt ttc aac gac ctg gga gac tgg ggc ctg tgg ttg 3000 Glu Leu Asp Leu Ser Phe Asn Asp Leu Gly Asp Trp Gly Leu Trp Leu 950 955 960 ctg gct gag ggg ctg caa cat ccc gcc tgc aga ctc cag aaa ctg tgg 3048 Leu Ala Glu Gly Leu Gln His Pro Ala Cys Arg Leu Gln Lys Leu Trp 965 970 975 ctg gat agc tgt ggc ctc aca gcc aag gct tgt gag aat ctt tac ttc 3096 Leu Asp Ser Cys Gly Leu Thr Ala Lys Ala Cys Glu Asn Leu Tyr Phe 980 985 990 acc ctg ggg atc aac cag acc ttg acc gac ctt tac ctg acc aac aac 3144 Thr Leu Gly Ile Asn Gln Thr Leu Thr Asp Leu Tyr Leu Thr Asn Asn 995 1000 1005 gcc cta ggg gac aca ggt gtc cga ctg ctt tgc aag cgg ctg agc cat 3192 Ala Leu Gly Asp Thr Gly Val Arg Leu Leu Cys Lys Arg Leu Ser His 1010 1015 1020 1025 cct ggc tg caaactccga gtcctctg 3218 Pro Gly <210> SEQ ID NO 68 <211> LENGTH: 1027 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 68 Met Leu Arg Thr Ala Gly Arg Asp Gly Leu Cys Arg Leu Ser Thr Tyr 1 5 10 15 Leu Glu Glu Leu Glu Ala Val Glu Leu Lys Lys Phe Lys Leu Tyr Leu 20 25 30 Gly Thr Ala Thr Glu Leu Gly Glu Gly Lys Ile Pro Trp Gly Ser Met 35 40 45 Glu Lys Ala Gly Pro Leu Glu Met Ala Gln Leu Leu Ile Thr His Phe 50 55 60 Gly Pro Glu Glu Ala Trp Arg Leu Ala Leu Ser Thr Phe Glu Arg Ile 65 70 75 80 Asn Arg Lys Asp Leu Trp Glu Arg Gly Gln Arg Glu Asp Leu Val Arg 85 90 95 Asp Thr Pro Pro Gly Gly Pro Ser Ser Leu Gly Asn Gln Ser Thr Cys 100 105 110 Leu Leu Glu Val Ser Leu Val Thr Pro Arg Lys Asp Pro Gln Glu Thr 115 120 125 Tyr Arg Asp Tyr Val Arg Arg Lys Phe Arg Leu Met Glu Asp Arg Asn 130 135 140 Ala Arg Leu Gly Glu Cys Val Asn Leu Ser His Arg Tyr Thr Arg Leu 145 150 155 160 Leu Leu Val Lys Glu His Ser Asn Pro Met Gln Val Gln Gln Gln Leu 165 170 175 Leu Asp Thr Gly Arg Gly His Ala Arg Thr Val Gly His Gln Ala Ser 180 185 190 Pro Ile Lys Ile Glu Thr Leu Phe Glu Pro Asp Glu Glu Arg Pro Glu 195 200 205 Pro Pro Arg Thr Val Val Met Gln Gly Ala Ala Gly Ile Gly Lys Ser 210 215 220 Met Leu Ala His Lys Val Met Leu Asp Trp Ala Asp Gly Lys Leu Phe 225 230 235 240 Gln Gly Arg Phe Asp Tyr Leu Phe Tyr Ile Asn Cys Arg Glu Met Asn 245 250 255 Gln Ser Ala Thr Glu Cys Ser Met Gln Asp Leu Ile Phe Ser Cys Trp 260 265 270 Pro Glu Pro Ser Ala Pro Leu Gln Glu Leu Ile Arg Val Pro Glu Arg 275 280 285 Leu Leu Phe Ile Ile Asp Gly Phe Asp Glu Leu Lys Pro Ser Phe His 290 295 300 Asp Pro Gln Gly Pro Trp Cys Leu Cys Trp Glu Glu Lys Arg Pro Thr 305 310 315 320 Glu Leu Leu Leu Asn Ser Leu Ile Arg Lys Lys Leu Leu Pro Glu Leu 325 330 335 Ser Leu Leu Ile Thr Thr Arg Pro Thr Ala Leu Glu Lys Leu His Arg 340 345 350 Leu Leu Glu His Pro Arg His Val Glu Ile Leu Gly Phe Ser Glu Ala 355 360 365 Glu Arg Lys Glu Tyr Phe Tyr Lys Tyr Phe His Asn Ala Glu Gln Ala 370 375 380 Gly Gln Val Phe Asn Tyr Val Arg Asp Asn Glu Pro Leu Phe Thr Met 385 390 395 400 Cys Phe Val Pro Leu Val Cys Trp Val Val Cys Thr Cys Leu Gln Gln 405 410 415 Gln Leu Glu Gly Gly Gly Leu Leu Arg Gln Thr Ser Arg Thr Thr Thr 420 425 430 Ala Val Tyr Met Leu Tyr Leu Leu Ser Leu Met Gln Pro Lys Pro Gly 435 440 445 Ala Pro Arg Leu Gln Pro Pro Pro Asn Gln Arg Gly Leu Cys Ser Leu 450 455 460 Ala Ala Asp Gly Leu Trp Asn Gln Lys Ile Leu Phe Glu Glu Gln Asp 465 470 475 480 Leu Arg Lys His Gly Leu Asp Gly Glu Asp Val Ser Ala Phe Leu Asn 485 490 495 Met Asn Ile Phe Gln Lys Asp Ile Asn Cys Glu Arg Tyr Tyr Ser Phe 500 505 510 Ile His Leu Ser Phe Gln Glu Phe Phe Ala Ala Met Tyr Tyr Ile Leu 515 520 525 Asp Glu Gly Glu Gly Gly Ala Gly Pro Asp Gln Asp Val Thr Arg Leu 530 535 540 Leu Thr Glu Tyr Ala Phe Ser Glu Arg Ser Phe Leu Ala Leu Thr Ser 545 550 555 560 Arg Phe Leu Phe Gly Leu Leu Asn Glu Glu Thr Arg Ser His Leu Glu 565 570 575 Lys Ser Leu Cys Trp Lys Val Ser Pro His Ile Lys Met Asp Leu Leu 580 585 590 Gln Trp Ile Gln Ser Lys Ala Gln Ser Asp Gly Ser Thr Leu Gln Gln 595 600 605 Gly Ser Leu Glu Phe Phe Ser Cys Leu Tyr Glu Ile Gln Glu Glu Glu 610 615 620 Phe Ile Gln Gln Ala Leu Ser His Phe Gln Val Ile Val Val Ser Asn 625 630 635 640 Ile Ala Ser Lys Met Glu His Met Val Ser Ser Phe Cys Leu Lys Arg 645 650 655 Cys Arg Ser Ala Gln Val Leu His Leu Tyr Gly Ala Thr Tyr Ser Ala 660 665 670 Asp Gly Glu Asp Arg Ala Arg Cys Ser Ala Gly Ala His Thr Leu Leu 675 680 685 Val Gln Leu Arg Pro Glu Arg Thr Val Leu Leu Asp Ala Tyr Ser Glu 690 695 700 His Leu Ala Ala Ala Leu Cys Thr Asn Pro Asn Leu Ile Glu Leu Ser 705 710 715 720 Leu Tyr Arg Asn Ala Leu Gly Ser Arg Gly Val Lys Leu Leu Cys Gln 725 730 735 Gly Leu Arg His Pro Asn Cys Lys Leu Gln Asn Leu Arg Leu Lys Arg 740 745 750 Cys Arg Ile Ser Ser Ser Ala Cys Glu Asp Leu Ser Ala Ala Leu Ile 755 760 765 Ala Asn Lys Asn Leu Thr Arg Met Asp Leu Ser Gly Asn Gly Val Gly 770 775 780 Phe Pro Gly Met Met Leu Leu Cys Glu Gly Leu Arg His Pro Gln Cys 785 790 795 800 Arg Leu Gln Met Ile Gln Leu Arg Lys Cys Gln Leu Glu Ser Gly Ala 805 810 815 Cys Gln Glu Met Ala Ser Val Leu Gly Thr Asn Pro His Leu Val Glu 820 825 830 Leu Asp Leu Thr Gly Asn Ala Leu Glu Asp Leu Gly Leu Arg Leu Leu 835 840 845 Cys Gln Gly Leu Arg His Pro Val Cys Arg Leu Arg Thr Leu Trp Leu 850 855 860 Lys Ile Cys Arg Leu Thr Ala Ala Ala Cys Asp Glu Leu Ala Ser Thr 865 870 875 880 Leu Ser Val Asn Gln Ser Leu Arg Glu Leu Asp Leu Ser Leu Asn Glu 885 890 895 Leu Gly Asp Leu Gly Val Leu Leu Leu Cys Glu Gly Leu Arg His Pro 900 905 910 Thr Cys Lys Leu Gln Thr Leu Arg Leu Gly Ile Cys Arg Leu Gly Ser 915 920 925 Ala Ala Cys Glu Gly Leu Ser Val Val Leu Gln Ala Asn His Asn Leu 930 935 940 Arg Glu Leu Asp Leu Ser Phe Asn Asp Leu Gly Asp Trp Gly Leu Trp 945 950 955 960 Leu Leu Ala Glu Gly Leu Gln His Pro Ala Cys Arg Leu Gln Lys Leu 965 970 975 Trp Leu Asp Ser Cys Gly Leu Thr Ala Lys Ala Cys Glu Asn Leu Tyr 980 985 990 Phe Thr Leu Gly Ile Asn Gln Thr Leu Thr Asp Leu Tyr Leu Thr Asn 995 1000 1005 Asn Ala Leu Gly Asp Thr Gly Val Arg Leu Leu Cys Lys Arg Leu Ser 1010 1015 1020 His Pro Gly 1025 <210> SEQ ID NO 69 <211> LENGTH: 2859 <212> TYPE: DNA <213> ORGANISM: Homo sapiens <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (1)...(2859) <400> SEQUENCE: 69 atg aca tcg ccc cag cta gag tgg act ctg cag acc ctt ctg gag cag 48 Met Thr Ser Pro Gln Leu Glu Trp Thr Leu Gln Thr Leu Leu Glu Gln 1 5 10 15 ctg aac gag gat gaa tta aag agt ttc aaa tcc ctt tta tgg gct ttt 96 Leu Asn Glu Asp Glu Leu Lys Ser Phe Lys Ser Leu Leu Trp Ala Phe 20 25 30 ccc ctc gaa gac gtg cta cag aag acc cca tgg tct gag gtg gaa gag 144 Pro Leu Glu Asp Val Leu Gln Lys Thr Pro Trp Ser Glu Val Glu Glu 35 40 45 gct gat ggc aag aaa ctg gca gaa att ctg gtc aac acc tcc tca gaa 192 Ala Asp Gly Lys Lys Leu Ala Glu Ile Leu Val Asn Thr Ser Ser Glu 50 55 60 aat tgg ata agg aat gcg act gtg aac atc ttg gaa gag atg aat ctc 240 Asn Trp Ile Arg Asn Ala Thr Val Asn Ile Leu Glu Glu Met Asn Leu 65 70 75 80 acg gaa ttg tgt aag atg gca aag gct gag atg atg gag gac gga cag 288 Thr Glu Leu Cys Lys Met Ala Lys Ala Glu Met Met Glu Asp Gly Gln 85 90 95 gtg caa gaa ata gat aat cct gag ctg gga gat gca gaa gaa gac tcg 336 Val Gln Glu Ile Asp Asn Pro Glu Leu Gly Asp Ala Glu Glu Asp Ser 100 105 110 gag tta gca aag cca ggt gaa aag gaa gga tgg aga aat tca atg gag 384 Glu Leu Ala Lys Pro Gly Glu Lys Glu Gly Trp Arg Asn Ser Met Glu 115 120 125 aaa cag tct ttg gtc tgg aag aac acc ttt tgg caa gga gac att gac 432 Lys Gln Ser Leu Val Trp Lys Asn Thr Phe Trp Gln Gly Asp Ile Asp 130 135 140 aat ttc cat gac gac gtc act ctg aga aac caa cgg ttc att cca ttc 480 Asn Phe His Asp Asp Val Thr Leu Arg Asn Gln Arg Phe Ile Pro Phe 145 150 155 160 ttg aat ccc aga aca ccc agg aag cta aca cct tac acg gtg gtg ctg 528 Leu Asn Pro Arg Thr Pro Arg Lys Leu Thr Pro Tyr Thr Val Val Leu 165 170 175 cac ggc ccc gca ggc gtg ggg aaa acc acg ctg gcc aaa aag tgt atg 576 His Gly Pro Ala Gly Val Gly Lys Thr Thr Leu Ala Lys Lys Cys Met 180 185 190 ctg gac tgg aca gac tgc aac ctc agc ccg acg ctc aga tac gcg ttc 624 Leu Asp Trp Thr Asp Cys Asn Leu Ser Pro Thr Leu Arg Tyr Ala Phe 195 200 205 tac ctc agc tgc aag gag ctc agc cgc atg ggc ccc tgc agt ttt gca 672 Tyr Leu Ser Cys Lys Glu Leu Ser Arg Met Gly Pro Cys Ser Phe Ala 210 215 220 gag ctg atc tcc aaa gac tgg cct gaa ttg cag gat gac att cca agc 720 Glu Leu Ile Ser Lys Asp Trp Pro Glu Leu Gln Asp Asp Ile Pro Ser 225 230 235 240 atc cta gcc caa gca cag aga atc ctg ttc gtg gtc gat ggc ctt gat 768 Ile Leu Ala Gln Ala Gln Arg Ile Leu Phe Val Val Asp Gly Leu Asp 245 250 255 gag ctg aaa gtc cca cct ggg gcg ctg atc cag gac atc tgc ggg gac 816 Glu Leu Lys Val Pro Pro Gly Ala Leu Ile Gln Asp Ile Cys Gly Asp 260 265 270 tgg gag aag aag aag ccg gtg ccc gtc ctc ctg ggg agt ttg ctg aag 864 Trp Glu Lys Lys Lys Pro Val Pro Val Leu Leu Gly Ser Leu Leu Lys 275 280 285 agg aag atg tta ccc agg gca gcc ttg ctg gtc acc acg cgg ccc agg 912 Arg Lys Met Leu Pro Arg Ala Ala Leu Leu Val Thr Thr Arg Pro Arg 290 295 300 gca ctg agg gac ctc cag ctc ctg gcg cag cag ccg atc tac gta agg 960 Ala Leu Arg Asp Leu Gln Leu Leu Ala Gln Gln Pro Ile Tyr Val Arg 305 310 315 320 gtg gag ggc ttc ctg gag gag gac agg agg gcc tat ttc ctg aga cac 1008 Val Glu Gly Phe Leu Glu Glu Asp Arg Arg Ala Tyr Phe Leu Arg His 325 330 335 ttt gga gac gag gac caa gcc atg cgt gcc ttt gag cta atg agg agc 1056 Phe Gly Asp Glu Asp Gln Ala Met Arg Ala Phe Glu Leu Met Arg Ser 340 345 350 aac gcg gcc ctg ttc cag ctg ggc tcg gcc ccc gcg gtg tgc tgg att 1104 Asn Ala Ala Leu Phe Gln Leu Gly Ser Ala Pro Ala Val Cys Trp Ile 355 360 365 gtg tgc acg act ctg aag ctg cag atg gag aag ggg gag gac ccg gtc 1152 Val Cys Thr Thr Leu Lys Leu Gln Met Glu Lys Gly Glu Asp Pro Val 370 375 380 ccc acc tgc ctc acc cgc acg ggg ctg ttc ctg cgt ttc ctc tgc agc 1200 Pro Thr Cys Leu Thr Arg Thr Gly Leu Phe Leu Arg Phe Leu Cys Ser 385 390 395 400 cgg ttc ccg cag ggc gca cag ctg cgg ggc gcg ctg cgg acg ctg agc 1248 Arg Phe Pro Gln Gly Ala Gln Leu Arg Gly Ala Leu Arg Thr Leu Ser 405 410 415 ctc ctg gcc gcg cag ggc ctg tgg gcg cag atg tcc gtg ttc cac cga 1296 Leu Leu Ala Ala Gln Gly Leu Trp Ala Gln Met Ser Val Phe His Arg 420 425 430 gag gac ctg gaa agg ctc ggg gtg cag gag tcc gac ctc cgt ctg ttc 1344 Glu Asp Leu Glu Arg Leu Gly Val Gln Glu Ser Asp Leu Arg Leu Phe 435 440 445 ctg gac gga gac atc ctc cgc cag gac aga gtc tcc aaa ggc tgc tac 1392 Leu Asp Gly Asp Ile Leu Arg Gln Asp Arg Val Ser Lys Gly Cys Tyr 450 455 460 tcc ttc atc cac ctc agc ttc cag cag ttt ctc act gcc ctg ttc tac 1440 Ser Phe Ile His Leu Ser Phe Gln Gln Phe Leu Thr Ala Leu Phe Tyr 465 470 475 480 gcc ctg gag aag gag gag ggg gag gac agg gac ggc cac gcc tgg gac 1488 Ala Leu Glu Lys Glu Glu Gly Glu Asp Arg Asp Gly His Ala Trp Asp 485 490 495 atc ggg gac gta cag aag ctg ctt tcc gga gaa gaa aga ctc aag aac 1536 Ile Gly Asp Val Gln Lys Leu Leu Ser Gly Glu Glu Arg Leu Lys Asn 500 505 510 ccc gac ctg att caa gta gga cac ttc tta ttc ggc ctc gct aac gag 1584 Pro Asp Leu Ile Gln Val Gly His Phe Leu Phe Gly Leu Ala Asn Glu 515 520 525 aag aga gcc aag gag ttg gag gcc act ttt ggc tgc cgg atg tca ccg 1632 Lys Arg Ala Lys Glu Leu Glu Ala Thr Phe Gly Cys Arg Met Ser Pro 530 535 540 gac atc aaa cag gaa ttg ctg caa tgc aaa gca cat ctt cat gca aat 1680 Asp Ile Lys Gln Glu Leu Leu Gln Cys Lys Ala His Leu His Ala Asn 545 550 555 560 aag ccc tta tcc gtg acc gac ctg aag gag gtc ttg ggc tgc ctg tat 1728 Lys Pro Leu Ser Val Thr Asp Leu Lys Glu Val Leu Gly Cys Leu Tyr 565 570 575 gag tct cag gag gag gag ctg gcg aag gtg gtg gtg gcc ccg ttc aag 1776 Glu Ser Gln Glu Glu Glu Leu Ala Lys Val Val Val Ala Pro Phe Lys 580 585 590 gaa att tct att cac ctg aca aat act tct gaa gtg atg cat tgt tcc 1824 Glu Ile Ser Ile His Leu Thr Asn Thr Ser Glu Val Met His Cys Ser 595 600 605 ttc agc ctg aag cat tgt caa gac ttg cag aaa ctc tca ctg cag gta 1872 Phe Ser Leu Lys His Cys Gln Asp Leu Gln Lys Leu Ser Leu Gln Val 610 615 620 gca aag ggg gtg ttc ctg gag aat tac atg gat ttt gaa ctg gac att 1920 Ala Lys Gly Val Phe Leu Glu Asn Tyr Met Asp Phe Glu Leu Asp Ile 625 630 635 640 gaa ttt gaa agc tca aac agc aac ctc aag ttt ctg gaa gtg aaa caa 1968 Glu Phe Glu Ser Ser Asn Ser Asn Leu Lys Phe Leu Glu Val Lys Gln 645 650 655 agc ttc ctg agt gac tct tct gtg cgg att ctt tgt gac cac gta acc 2016 Ser Phe Leu Ser Asp Ser Ser Val Arg Ile Leu Cys Asp His Val Thr 660 665 670 cgt agc acc tgt cat ctg cag aaa gtg gag att aaa aac gtc acc cct 2064 Arg Ser Thr Cys His Leu Gln Lys Val Glu Ile Lys Asn Val Thr Pro 675 680 685 gac acc gcg tac cgg gac ttc tgt ctt gct ttc att ggg aag aag acc 2112 Asp Thr Ala Tyr Arg Asp Phe Cys Leu Ala Phe Ile Gly Lys Lys Thr 690 695 700 ctc acg cac ctg acc ctg gca ggg cac atc gag tgg gaa cgc acg atg 2160 Leu Thr His Leu Thr Leu Ala Gly His Ile Glu Trp Glu Arg Thr Met 705 710 715 720 atg ctg atg ctg tgt gac ctg ctc aga aat cat aaa tgc aac ctg cag 2208 Met Leu Met Leu Cys Asp Leu Leu Arg Asn His Lys Cys Asn Leu Gln 725 730 735 tac ctg agg ttg gga ggt cac tgt gcc acc ccg gag cag tgg gct gaa 2256 Tyr Leu Arg Leu Gly Gly His Cys Ala Thr Pro Glu Gln Trp Ala Glu 740 745 750 ttc ttc tat gtc ctc aaa gcc aac cag tcc ctg aag cac ctg cgt ctc 2304 Phe Phe Tyr Val Leu Lys Ala Asn Gln Ser Leu Lys His Leu Arg Leu 755 760 765 tca gcc aat gtg ctc ctg gat gag ggt gcc atg ttg ctg tac aag acc 2352 Ser Ala Asn Val Leu Leu Asp Glu Gly Ala Met Leu Leu Tyr Lys Thr 770 775 780 atg aca cgc cca aaa cac ttc ctg cag atg ttg tcg ttg gaa aac tgt 2400 Met Thr Arg Pro Lys His Phe Leu Gln Met Leu Ser Leu Glu Asn Cys 785 790 795 800 cgt ctt aca gaa gcc agt tgc aag gac ctt gct gct gtc ttg gtt gtc 2448 Arg Leu Thr Glu Ala Ser Cys Lys Asp Leu Ala Ala Val Leu Val Val 805 810 815 agc aag aag ctg aca cac ctg tgc ttg gcc aag aac ccc att ggg gat 2496 Ser Lys Lys Leu Thr His Leu Cys Leu Ala Lys Asn Pro Ile Gly Asp 820 825 830 aca ggg gtg aag ttt ctg tgt gag ggc ttg agt tac cct gat tgt aaa 2544 Thr Gly Val Lys Phe Leu Cys Glu Gly Leu Ser Tyr Pro Asp Cys Lys 835 840 845 ctg cag acc ttg gtg tta cag caa tgc agc ata acc aag ctt ggc tgt 2592 Leu Gln Thr Leu Val Leu Gln Gln Cys Ser Ile Thr Lys Leu Gly Cys 850 855 860 aga tac ctc tca gag gcg ctc caa gaa gcc tgc agc ctc aca aac ctg 2640 Arg Tyr Leu Ser Glu Ala Leu Gln Glu Ala Cys Ser Leu Thr Asn Leu 865 870 875 880 gac ttg agt atc aac cag ata gct cgt gga ttg tgg att ctc tgt cag 2688 Asp Leu Ser Ile Asn Gln Ile Ala Arg Gly Leu Trp Ile Leu Cys Gln 885 890 895 gcg tta gag aat cca aac tgt aac cta aaa cac cta cgg ttg aag acc 2736 Ala Leu Glu Asn Pro Asn Cys Asn Leu Lys His Leu Arg Leu Lys Thr 900 905 910 tat gaa act aat ttg gaa atc aag aag ctg ttg gag gaa gtg aaa gaa 2784 Tyr Glu Thr Asn Leu Glu Ile Lys Lys Leu Leu Glu Glu Val Lys Glu 915 920 925 aag aat ccc aag ctg act att gat tgc aat gct tcc ggg gca acg gca 2832 Lys Asn Pro Lys Leu Thr Ile Asp Cys Asn Ala Ser Gly Ala Thr Ala 930 935 940 cct ccg tgc tgt gac ttt ttt tgc tga 2859 Pro Pro Cys Cys Asp Phe Phe Cys * 945 950 <210> SEQ ID NO 70 <211> LENGTH: 952 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 70 Met Thr Ser Pro Gln Leu Glu Trp Thr Leu Gln Thr Leu Leu Glu Gln 1 5 10 15 Leu Asn Glu Asp Glu Leu Lys Ser Phe Lys Ser Leu Leu Trp Ala Phe 20 25 30 Pro Leu Glu Asp Val Leu Gln Lys Thr Pro Trp Ser Glu Val Glu Glu 35 40 45 Ala Asp Gly Lys Lys Leu Ala Glu Ile Leu Val Asn Thr Ser Ser Glu 50 55 60 Asn Trp Ile Arg Asn Ala Thr Val Asn Ile Leu Glu Glu Met Asn Leu 65 70 75 80 Thr Glu Leu Cys Lys Met Ala Lys Ala Glu Met Met Glu Asp Gly Gln 85 90 95 Val Gln Glu Ile Asp Asn Pro Glu Leu Gly Asp Ala Glu Glu Asp Ser 100 105 110 Glu Leu Ala Lys Pro Gly Glu Lys Glu Gly Trp Arg Asn Ser Met Glu 115 120 125 Lys Gln Ser Leu Val Trp Lys Asn Thr Phe Trp Gln Gly Asp Ile Asp 130 135 140 Asn Phe His Asp Asp Val Thr Leu Arg Asn Gln Arg Phe Ile Pro Phe 145 150 155 160 Leu Asn Pro Arg Thr Pro Arg Lys Leu Thr Pro Tyr Thr Val Val Leu 165 170 175 His Gly Pro Ala Gly Val Gly Lys Thr Thr Leu Ala Lys Lys Cys Met 180 185 190 Leu Asp Trp Thr Asp Cys Asn Leu Ser Pro Thr Leu Arg Tyr Ala Phe 195 200 205 Tyr Leu Ser Cys Lys Glu Leu Ser Arg Met Gly Pro Cys Ser Phe Ala 210 215 220 Glu Leu Ile Ser Lys Asp Trp Pro Glu Leu Gln Asp Asp Ile Pro Ser 225 230 235 240 Ile Leu Ala Gln Ala Gln Arg Ile Leu Phe Val Val Asp Gly Leu Asp 245 250 255 Glu Leu Lys Val Pro Pro Gly Ala Leu Ile Gln Asp Ile Cys Gly Asp 260 265 270 Trp Glu Lys Lys Lys Pro Val Pro Val Leu Leu Gly Ser Leu Leu Lys 275 280 285 Arg Lys Met Leu Pro Arg Ala Ala Leu Leu Val Thr Thr Arg Pro Arg 290 295 300 Ala Leu Arg Asp Leu Gln Leu Leu Ala Gln Gln Pro Ile Tyr Val Arg 305 310 315 320 Val Glu Gly Phe Leu Glu Glu Asp Arg Arg Ala Tyr Phe Leu Arg His 325 330 335 Phe Gly Asp Glu Asp Gln Ala Met Arg Ala Phe Glu Leu Met Arg Ser 340 345 350 Asn Ala Ala Leu Phe Gln Leu Gly Ser Ala Pro Ala Val Cys Trp Ile 355 360 365 Val Cys Thr Thr Leu Lys Leu Gln Met Glu Lys Gly Glu Asp Pro Val 370 375 380 Pro Thr Cys Leu Thr Arg Thr Gly Leu Phe Leu Arg Phe Leu Cys Ser 385 390 395 400 Arg Phe Pro Gln Gly Ala Gln Leu Arg Gly Ala Leu Arg Thr Leu Ser 405 410 415 Leu Leu Ala Ala Gln Gly Leu Trp Ala Gln Met Ser Val Phe His Arg 420 425 430 Glu Asp Leu Glu Arg Leu Gly Val Gln Glu Ser Asp Leu Arg Leu Phe 435 440 445 Leu Asp Gly Asp Ile Leu Arg Gln Asp Arg Val Ser Lys Gly Cys Tyr 450 455 460 Ser Phe Ile His Leu Ser Phe Gln Gln Phe Leu Thr Ala Leu Phe Tyr 465 470 475 480 Ala Leu Glu Lys Glu Glu Gly Glu Asp Arg Asp Gly His Ala Trp Asp 485 490 495 Ile Gly Asp Val Gln Lys Leu Leu Ser Gly Glu Glu Arg Leu Lys Asn 500 505 510 Pro Asp Leu Ile Gln Val Gly His Phe Leu Phe Gly Leu Ala Asn Glu 515 520 525 Lys Arg Ala Lys Glu Leu Glu Ala Thr Phe Gly Cys Arg Met Ser Pro 530 535 540 Asp Ile Lys Gln Glu Leu Leu Gln Cys Lys Ala His Leu His Ala Asn 545 550 555 560 Lys Pro Leu Ser Val Thr Asp Leu Lys Glu Val Leu Gly Cys Leu Tyr 565 570 575 Glu Ser Gln Glu Glu Glu Leu Ala Lys Val Val Val Ala Pro Phe Lys 580 585 590 Glu Ile Ser Ile His Leu Thr Asn Thr Ser Glu Val Met His Cys Ser 595 600 605 Phe Ser Leu Lys His Cys Gln Asp Leu Gln Lys Leu Ser Leu Gln Val 610 615 620 Ala Lys Gly Val Phe Leu Glu Asn Tyr Met Asp Phe Glu Leu Asp Ile 625 630 635 640 Glu Phe Glu Ser Ser Asn Ser Asn Leu Lys Phe Leu Glu Val Lys Gln 645 650 655 Ser Phe Leu Ser Asp Ser Ser Val Arg Ile Leu Cys Asp His Val Thr 660 665 670 Arg Ser Thr Cys His Leu Gln Lys Val Glu Ile Lys Asn Val Thr Pro 675 680 685 Asp Thr Ala Tyr Arg Asp Phe Cys Leu Ala Phe Ile Gly Lys Lys Thr 690 695 700 Leu Thr His Leu Thr Leu Ala Gly His Ile Glu Trp Glu Arg Thr Met 705 710 715 720 Met Leu Met Leu Cys Asp Leu Leu Arg Asn His Lys Cys Asn Leu Gln 725 730 735 Tyr Leu Arg Leu Gly Gly His Cys Ala Thr Pro Glu Gln Trp Ala Glu 740 745 750 Phe Phe Tyr Val Leu Lys Ala Asn Gln Ser Leu Lys His Leu Arg Leu 755 760 765 Ser Ala Asn Val Leu Leu Asp Glu Gly Ala Met Leu Leu Tyr Lys Thr 770 775 780 Met Thr Arg Pro Lys His Phe Leu Gln Met Leu Ser Leu Glu Asn Cys 785 790 795 800 Arg Leu Thr Glu Ala Ser Cys Lys Asp Leu Ala Ala Val Leu Val Val 805 810 815 Ser Lys Lys Leu Thr His Leu Cys Leu Ala Lys Asn Pro Ile Gly Asp 820 825 830 Thr Gly Val Lys Phe Leu Cys Glu Gly Leu Ser Tyr Pro Asp Cys Lys 835 840 845 Leu Gln Thr Leu Val Leu Gln Gln Cys Ser Ile Thr Lys Leu Gly Cys 850 855 860 Arg Tyr Leu Ser Glu Ala Leu Gln Glu Ala Cys Ser Leu Thr Asn Leu 865 870 875 880 Asp Leu Ser Ile Asn Gln Ile Ala Arg Gly Leu Trp Ile Leu Cys Gln 885 890 895 Ala Leu Glu Asn Pro Asn Cys Asn Leu Lys His Leu Arg Leu Lys Thr 900 905 910 Tyr Glu Thr Asn Leu Glu Ile Lys Lys Leu Leu Glu Glu Val Lys Glu 915 920 925 Lys Asn Pro Lys Leu Thr Ile Asp Cys Asn Ala Ser Gly Ala Thr Ala 930 935 940 Pro Pro Cys Cys Asp Phe Phe Cys 945 950 <210> SEQ ID NO 71 <211> LENGTH: 2199 <212> TYPE: DNA <213> ORGANISM: Homo sapiens <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (1)...(2199) <400> SEQUENCE: 71 atg gca gat tca tca tca tct tct ttc ttt cct gat ttt ggg ctg cta 48 Met Ala Asp Ser Ser Ser Ser Ser Phe Phe Pro Asp Phe Gly Leu Leu 1 5 10 15 ttg tat ttg gag gag cta aac aaa gag gaa tta aat aca ttc aag tta 96 Leu Tyr Leu Glu Glu Leu Asn Lys Glu Glu Leu Asn Thr Phe Lys Leu 20 25 30 ttc cta aag gag acc atg gaa cct gag cat ggc ctg aca ccc tgg aat 144 Phe Leu Lys Glu Thr Met Glu Pro Glu His Gly Leu Thr Pro Trp Asn 35 40 45 gaa gtg aag aag gcc agg cgg gag gac ctg gcc aat ttg atg aag aaa 192 Glu Val Lys Lys Ala Arg Arg Glu Asp Leu Ala Asn Leu Met Lys Lys 50 55 60 tat tat cca gga gag aaa gcc tgg agt gtg tct ctc aaa atc ttt ggc 240 Tyr Tyr Pro Gly Glu Lys Ala Trp Ser Val Ser Leu Lys Ile Phe Gly 65 70 75 80 aag atg aac ctg aag gat ctg tgt gag aga gcg aaa gaa gag atc aac 288 Lys Met Asn Leu Lys Asp Leu Cys Glu Arg Ala Lys Glu Glu Ile Asn 85 90 95 tgg tcg gcc cag act ata gga cca gat gat gcc aag gct gga gag aca 336 Trp Ser Ala Gln Thr Ile Gly Pro Asp Asp Ala Lys Ala Gly Glu Thr 100 105 110 caa gaa gat cag gag gca gtg ctg gtc ata gtt aac aca ggg gtc ccc 384 Gln Glu Asp Gln Glu Ala Val Leu Val Ile Val Asn Thr Gly Val Pro 115 120 125 aac tcc tgg gcc aca gac ccc tac tgg tcg gcg gcc cct cgg gaa tca 432 Asn Ser Trp Ala Thr Asp Pro Tyr Trp Ser Ala Ala Pro Arg Glu Ser 130 135 140 ggt cgc ata gca gga ggt gat gga aca gaa tac aga aat aga ata aag 480 Gly Arg Ile Ala Gly Gly Asp Gly Thr Glu Tyr Arg Asn Arg Ile Lys 145 150 155 160 gaa aaa ttt tgc atc act tgg gac aag aag tct ttg gct gga aag cct 528 Glu Lys Phe Cys Ile Thr Trp Asp Lys Lys Ser Leu Ala Gly Lys Pro 165 170 175 gaa gat ttc cat cat gga att gca gag aaa gat aga aaa ctg ttg gaa 576 Glu Asp Phe His His Gly Ile Ala Glu Lys Asp Arg Lys Leu Leu Glu 180 185 190 cac ttg ttc gat gtg gat gtc aaa acc ggt gca cag cca cag atc gtg 624 His Leu Phe Asp Val Asp Val Lys Thr Gly Ala Gln Pro Gln Ile Val 195 200 205 gtg ctt cag gga gct gct gga gtt ggg aaa aca acc ttg gtg aga aag 672 Val Leu Gln Gly Ala Ala Gly Val Gly Lys Thr Thr Leu Val Arg Lys 210 215 220 gca atg tta gat tgg gca gag ggc agt ctc tac cag cag agg ttt aag 720 Ala Met Leu Asp Trp Ala Glu Gly Ser Leu Tyr Gln Gln Arg Phe Lys 225 230 235 240 tat gtt ttt tat ctc aat ggg aga gaa att aac cag ctg aaa gag aga 768 Tyr Val Phe Tyr Leu Asn Gly Arg Glu Ile Asn Gln Leu Lys Glu Arg 245 250 255 agc ttt gct caa ttg ata tca aag gac tgg ccc agc aca gaa ggc ccc 816 Ser Phe Ala Gln Leu Ile Ser Lys Asp Trp Pro Ser Thr Glu Gly Pro 260 265 270 att gaa gaa atc atg tac cag cca agt agc ctc ttg ttt att att gac 864 Ile Glu Glu Ile Met Tyr Gln Pro Ser Ser Leu Leu Phe Ile Ile Asp 275 280 285 agt ttc gat gaa ctg aac ttt gcc ttt gaa gaa cct gag ttt gca ctg 912 Ser Phe Asp Glu Leu Asn Phe Ala Phe Glu Glu Pro Glu Phe Ala Leu 290 295 300 tgc gaa gac tgg acc caa gaa cac cca gtg tcc ttc ctc atg agt agt 960 Cys Glu Asp Trp Thr Gln Glu His Pro Val Ser Phe Leu Met Ser Ser 305 310 315 320 ttg ctg agg aaa gtg atg ctc cct gag gca tcc tta ttg gtg aca aca 1008 Leu Leu Arg Lys Val Met Leu Pro Glu Ala Ser Leu Leu Val Thr Thr 325 330 335 aga ctc aca act tct aag aga cta aag cag ttg ttg aag aat cac cat 1056 Arg Leu Thr Thr Ser Lys Arg Leu Lys Gln Leu Leu Lys Asn His His 340 345 350 tat gta gag cta cta gga atg tct gag gat gca aga gag gag tat att 1104 Tyr Val Glu Leu Leu Gly Met Ser Glu Asp Ala Arg Glu Glu Tyr Ile 355 360 365 tac cag ttt ttt gaa gat aag agg tgg gcc atg aaa gta ttc agt tca 1152 Tyr Gln Phe Phe Glu Asp Lys Arg Trp Ala Met Lys Val Phe Ser Ser 370 375 380 cta aaa agc aat gag atg ctg ttt agc atg tgc caa gtc ccc cta gtg 1200 Leu Lys Ser Asn Glu Met Leu Phe Ser Met Cys Gln Val Pro Leu Val 385 390 395 400 tgc tgg gcc gct tgt act tgt ctg aag cag caa atg gag aag ggt ggt 1248 Cys Trp Ala Ala Cys Thr Cys Leu Lys Gln Gln Met Glu Lys Gly Gly 405 410 415 gat gtc aca ttg acc tgc caa aca acc aca gct ctg ttt acc tgc tat 1296 Asp Val Thr Leu Thr Cys Gln Thr Thr Thr Ala Leu Phe Thr Cys Tyr 420 425 430 att tct agc ttg ttc aca cca gta gat gga ggc tct cct agt cta ccc 1344 Ile Ser Ser Leu Phe Thr Pro Val Asp Gly Gly Ser Pro Ser Leu Pro 435 440 445 aac caa gcc cag ctg aga aga ctg tgc caa gtc gct gcc aaa gga ata 1392 Asn Gln Ala Gln Leu Arg Arg Leu Cys Gln Val Ala Ala Lys Gly Ile 450 455 460 tgg act atg act tac gtg ttt tac aga gaa aat ctc aga agg ctt ggg 1440 Trp Thr Met Thr Tyr Val Phe Tyr Arg Glu Asn Leu Arg Arg Leu Gly 465 470 475 480 tta act caa tct gat gtc tct agt ttt atg gac agc aat att att cag 1488 Leu Thr Gln Ser Asp Val Ser Ser Phe Met Asp Ser Asn Ile Ile Gln 485 490 495 aag gac gca gag tat gaa aac tgc tat gtg ttc acc cac ctt cat gtt 1536 Lys Asp Ala Glu Tyr Glu Asn Cys Tyr Val Phe Thr His Leu His Val 500 505 510 cag gag ttt ttt gca gct atg ttc tat atg ttg aaa ggc agt tgg gaa 1584 Gln Glu Phe Phe Ala Ala Met Phe Tyr Met Leu Lys Gly Ser Trp Glu 515 520 525 gct ggg aac cct tcc tgc cag cct ttt gaa gat ttg aag tca tta ctt 1632 Ala Gly Asn Pro Ser Cys Gln Pro Phe Glu Asp Leu Lys Ser Leu Leu 530 535 540 caa agc aca agt tat aaa gac ccc cat ttg aca cag atg aag tgc ttt 1680 Gln Ser Thr Ser Tyr Lys Asp Pro His Leu Thr Gln Met Lys Cys Phe 545 550 555 560 ttg ttt ggc ctt ttg aat gaa gat cga gta aaa caa ctg gag agg act 1728 Leu Phe Gly Leu Leu Asn Glu Asp Arg Val Lys Gln Leu Glu Arg Thr 565 570 575 ttt aac tgt aaa atg tca ctg aag ata aaa tca aag tta ctt cag tgt 1776 Phe Asn Cys Lys Met Ser Leu Lys Ile Lys Ser Lys Leu Leu Gln Cys 580 585 590 atg gaa gta tta gga aac agt gac tat tct cca tca cag ctg gga ttt 1824 Met Glu Val Leu Gly Asn Ser Asp Tyr Ser Pro Ser Gln Leu Gly Phe 595 600 605 ctg gag ttg ttt cac tgt ctg tat gag act caa gat aaa gcg ttt ata 1872 Leu Glu Leu Phe His Cys Leu Tyr Glu Thr Gln Asp Lys Ala Phe Ile 610 615 620 agc cag gca atg aga tgt ttc cca aag gtt gcc att aat att tgt gag 1920 Ser Gln Ala Met Arg Cys Phe Pro Lys Val Ala Ile Asn Ile Cys Glu 625 630 635 640 aaa ata cat ttg ctt gta tct tct ttc tgc ctt aag cac tgc cgg tgt 1968 Lys Ile His Leu Leu Val Ser Ser Phe Cys Leu Lys His Cys Arg Cys 645 650 655 ttg cgg acc atc agg ctg tct gta act gtg gta ttt gag aag aag ata 2016 Leu Arg Thr Ile Arg Leu Ser Val Thr Val Val Phe Glu Lys Lys Ile 660 665 670 tta aaa aca agc ctc cca act aac act tgg gag tgg atg gga aac ggg 2064 Leu Lys Thr Ser Leu Pro Thr Asn Thr Trp Glu Trp Met Gly Asn Gly 675 680 685 aga gct att gga caa ata aga cct ctg gag tgc cca gag gaa gac ttc 2112 Arg Ala Ile Gly Gln Ile Arg Pro Leu Glu Cys Pro Glu Glu Asp Phe 690 695 700 ctg gtg gac tgt gcc cac ggt gga gct gca ctg gat gct ctt gcc ttt 2160 Leu Val Asp Cys Ala His Gly Gly Ala Ala Leu Asp Ala Leu Ala Phe 705 710 715 720 cca aag tac act tac ttt tac tcc aat act atc ctc tga 2199 Pro Lys Tyr Thr Tyr Phe Tyr Ser Asn Thr Ile Leu * 725 730 <210> SEQ ID NO 72 <211> LENGTH: 732 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 72 Met Ala Asp Ser Ser Ser Ser Ser Phe Phe Pro Asp Phe Gly Leu Leu 1 5 10 15 Leu Tyr Leu Glu Glu Leu Asn Lys Glu Glu Leu Asn Thr Phe Lys Leu 20 25 30 Phe Leu Lys Glu Thr Met Glu Pro Glu His Gly Leu Thr Pro Trp Asn 35 40 45 Glu Val Lys Lys Ala Arg Arg Glu Asp Leu Ala Asn Leu Met Lys Lys 50 55 60 Tyr Tyr Pro Gly Glu Lys Ala Trp Ser Val Ser Leu Lys Ile Phe Gly 65 70 75 80 Lys Met Asn Leu Lys Asp Leu Cys Glu Arg Ala Lys Glu Glu Ile Asn 85 90 95 Trp Ser Ala Gln Thr Ile Gly Pro Asp Asp Ala Lys Ala Gly Glu Thr 100 105 110 Gln Glu Asp Gln Glu Ala Val Leu Val Ile Val Asn Thr Gly Val Pro 115 120 125 Asn Ser Trp Ala Thr Asp Pro Tyr Trp Ser Ala Ala Pro Arg Glu Ser 130 135 140 Gly Arg Ile Ala Gly Gly Asp Gly Thr Glu Tyr Arg Asn Arg Ile Lys 145 150 155 160 Glu Lys Phe Cys Ile Thr Trp Asp Lys Lys Ser Leu Ala Gly Lys Pro 165 170 175 Glu Asp Phe His His Gly Ile Ala Glu Lys Asp Arg Lys Leu Leu Glu 180 185 190 His Leu Phe Asp Val Asp Val Lys Thr Gly Ala Gln Pro Gln Ile Val 195 200 205 Val Leu Gln Gly Ala Ala Gly Val Gly Lys Thr Thr Leu Val Arg Lys 210 215 220 Ala Met Leu Asp Trp Ala Glu Gly Ser Leu Tyr Gln Gln Arg Phe Lys 225 230 235 240 Tyr Val Phe Tyr Leu Asn Gly Arg Glu Ile Asn Gln Leu Lys Glu Arg 245 250 255 Ser Phe Ala Gln Leu Ile Ser Lys Asp Trp Pro Ser Thr Glu Gly Pro 260 265 270 Ile Glu Glu Ile Met Tyr Gln Pro Ser Ser Leu Leu Phe Ile Ile Asp 275 280 285 Ser Phe Asp Glu Leu Asn Phe Ala Phe Glu Glu Pro Glu Phe Ala Leu 290 295 300 Cys Glu Asp Trp Thr Gln Glu His Pro Val Ser Phe Leu Met Ser Ser 305 310 315 320 Leu Leu Arg Lys Val Met Leu Pro Glu Ala Ser Leu Leu Val Thr Thr 325 330 335 Arg Leu Thr Thr Ser Lys Arg Leu Lys Gln Leu Leu Lys Asn His His 340 345 350 Tyr Val Glu Leu Leu Gly Met Ser Glu Asp Ala Arg Glu Glu Tyr Ile 355 360 365 Tyr Gln Phe Phe Glu Asp Lys Arg Trp Ala Met Lys Val Phe Ser Ser 370 375 380 Leu Lys Ser Asn Glu Met Leu Phe Ser Met Cys Gln Val Pro Leu Val 385 390 395 400 Cys Trp Ala Ala Cys Thr Cys Leu Lys Gln Gln Met Glu Lys Gly Gly 405 410 415 Asp Val Thr Leu Thr Cys Gln Thr Thr Thr Ala Leu Phe Thr Cys Tyr 420 425 430 Ile Ser Ser Leu Phe Thr Pro Val Asp Gly Gly Ser Pro Ser Leu Pro 435 440 445 Asn Gln Ala Gln Leu Arg Arg Leu Cys Gln Val Ala Ala Lys Gly Ile 450 455 460 Trp Thr Met Thr Tyr Val Phe Tyr Arg Glu Asn Leu Arg Arg Leu Gly 465 470 475 480 Leu Thr Gln Ser Asp Val Ser Ser Phe Met Asp Ser Asn Ile Ile Gln 485 490 495 Lys Asp Ala Glu Tyr Glu Asn Cys Tyr Val Phe Thr His Leu His Val 500 505 510 Gln Glu Phe Phe Ala Ala Met Phe Tyr Met Leu Lys Gly Ser Trp Glu 515 520 525 Ala Gly Asn Pro Ser Cys Gln Pro Phe Glu Asp Leu Lys Ser Leu Leu 530 535 540 Gln Ser Thr Ser Tyr Lys Asp Pro His Leu Thr Gln Met Lys Cys Phe 545 550 555 560 Leu Phe Gly Leu Leu Asn Glu Asp Arg Val Lys Gln Leu Glu Arg Thr 565 570 575 Phe Asn Cys Lys Met Ser Leu Lys Ile Lys Ser Lys Leu Leu Gln Cys 580 585 590 Met Glu Val Leu Gly Asn Ser Asp Tyr Ser Pro Ser Gln Leu Gly Phe 595 600 605 Leu Glu Leu Phe His Cys Leu Tyr Glu Thr Gln Asp Lys Ala Phe Ile 610 615 620 Ser Gln Ala Met Arg Cys Phe Pro Lys Val Ala Ile Asn Ile Cys Glu 625 630 635 640 Lys Ile His Leu Leu Val Ser Ser Phe Cys Leu Lys His Cys Arg Cys 645 650 655 Leu Arg Thr Ile Arg Leu Ser Val Thr Val Val Phe Glu Lys Lys Ile 660 665 670 Leu Lys Thr Ser Leu Pro Thr Asn Thr Trp Glu Trp Met Gly Asn Gly 675 680 685 Arg Ala Ile Gly Gln Ile Arg Pro Leu Glu Cys Pro Glu Glu Asp Phe 690 695 700 Leu Val Asp Cys Ala His Gly Gly Ala Ala Leu Asp Ala Leu Ala Phe 705 710 715 720 Pro Lys Tyr Thr Tyr Phe Tyr Ser Asn Thr Ile Leu 725 730 <210> SEQ ID NO 73 <211> LENGTH: 1816 <212> TYPE: DNA <213> ORGANISM: Homo sapiens <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (1)...(1816) <400> SEQUENCE: 73 atg tat gag ttt tat att cac aaa ggt tat gat gat gtg tct tca gac 48 Met Tyr Glu Phe Tyr Ile His Lys Gly Tyr Asp Asp Val Ser Ser Asp 1 5 10 15 aac agc aga gag aaa atc aaa ggt gaa ccc tct gaa tgt gag ttg ggg 96 Asn Ser Arg Glu Lys Ile Lys Gly Glu Pro Ser Glu Cys Glu Leu Gly 20 25 30 cac ttc ccg cgt atc ccc tgg gca aac ttg aga gct gcc gac cct ttg 144 His Phe Pro Arg Ile Pro Trp Ala Asn Leu Arg Ala Ala Asp Pro Leu 35 40 45 aat ctg tcc ttt ctt ttg gat gaa cac ttc cca aaa ggt cag gca tgg 192 Asn Leu Ser Phe Leu Leu Asp Glu His Phe Pro Lys Gly Gln Ala Trp 50 55 60 aaa gtg gtc ctc ggc atc ttc cag aca atg aat ctg acc tca ctg tgt 240 Lys Val Val Leu Gly Ile Phe Gln Thr Met Asn Leu Thr Ser Leu Cys 65 70 75 80 gag aaa gtt aga gcc gag atg aaa gag aat gtg cag acc caa gag ctg 288 Glu Lys Val Arg Ala Glu Met Lys Glu Asn Val Gln Thr Gln Glu Leu 85 90 95 caa gat cca acc cag gaa gat cta gag atg cta gaa gca gca gca ggg 336 Gln Asp Pro Thr Gln Glu Asp Leu Glu Met Leu Glu Ala Ala Ala Gly 100 105 110 aat atg cag acc cag gga tgc caa gat cca aac caa gaa gaa cta gac 384 Asn Met Gln Thr Gln Gly Cys Gln Asp Pro Asn Gln Glu Glu Leu Asp 115 120 125 gag cta gaa gaa gaa aca ggg aat gta cag gcc cag gga tgc caa gat 432 Glu Leu Glu Glu Glu Thr Gly Asn Val Gln Ala Gln Gly Cys Gln Asp 130 135 140 cca aac caa gaa gaa cca gag atg cta gag gaa gca gac cac aga aga 480 Pro Asn Gln Glu Glu Pro Glu Met Leu Glu Glu Ala Asp His Arg Arg 145 150 155 160 aaa tac aga gag aac atg aag gct gaa cta ctg gag aca tgg gac aac 528 Lys Tyr Arg Glu Asn Met Lys Ala Glu Leu Leu Glu Thr Trp Asp Asn 165 170 175 atc agt tgg cct aaa gac cac gta tat atc cgt aat aca tca aag gac 576 Ile Ser Trp Pro Lys Asp His Val Tyr Ile Arg Asn Thr Ser Lys Asp 180 185 190 gaa cat gag gaa ctg cag cgc cta ctg gat cct aat agg act aga gcc 624 Glu His Glu Glu Leu Gln Arg Leu Leu Asp Pro Asn Arg Thr Arg Ala 195 200 205 cag gcc cag acg ata gtc ttg gtg ggg agg gca ggg gtt ggg aag acc 672 Gln Ala Gln Thr Ile Val Leu Val Gly Arg Ala Gly Val Gly Lys Thr 210 215 220 acc ttg gca atg cgg gct atg ctg cac tgg gca aat gga gtt ctc ttt 720 Thr Leu Ala Met Arg Ala Met Leu His Trp Ala Asn Gly Val Leu Phe 225 230 235 240 cag caa agg ttc tcc tat gtt ttc tat ctc agc tgc cat aaa ata agg 768 Gln Gln Arg Phe Ser Tyr Val Phe Tyr Leu Ser Cys His Lys Ile Arg 245 250 255 tac atg aag gaa act acc ttt gct gaa ttg att tct ttg gat tgg ccc 816 Tyr Met Lys Glu Thr Thr Phe Ala Glu Leu Ile Ser Leu Asp Trp Pro 260 265 270 gat ttt gat gcc ccc att gaa gag ttc atg tct caa cca gag aag ctc 864 Asp Phe Asp Ala Pro Ile Glu Glu Phe Met Ser Gln Pro Glu Lys Leu 275 280 285 ctg ttt att att gat ggc ttt gag gaa ata atc ata tct gag tca cgc 912 Leu Phe Ile Ile Asp Gly Phe Glu Glu Ile Ile Ile Ser Glu Ser Arg 290 295 300 tct gag agc ttg gat gat ggc tcg cca tgt aca gac tgg tac cag gag 960 Ser Glu Ser Leu Asp Asp Gly Ser Pro Cys Thr Asp Trp Tyr Gln Glu 305 310 315 320 ctc cca gtg acc aaa atc cta cac agc ttg ttg aag aaa gaa ttg gtt 1008 Leu Pro Val Thr Lys Ile Leu His Ser Leu Leu Lys Lys Glu Leu Val 325 330 335 ccc ctg gct acc tta ctg atc acg atc aag acc tgg ttt gtg aga gat 1056 Pro Leu Ala Thr Leu Leu Ile Thr Ile Lys Thr Trp Phe Val Arg Asp 340 345 350 ctt aag gcc tca tta gtg aat cca tgc ttt gta caa att aca ggg ttc 1104 Leu Lys Ala Ser Leu Val Asn Pro Cys Phe Val Gln Ile Thr Gly Phe 355 360 365 aca ggg gac gac cta cgg gta tat ttc atg aga cac ttt gat gac tca 1152 Thr Gly Asp Asp Leu Arg Val Tyr Phe Met Arg His Phe Asp Asp Ser 370 375 380 agt gaa gtt gag aaa atc ctg cag cag cta aga aaa aac gaa act ctc 1200 Ser Glu Val Glu Lys Ile Leu Gln Gln Leu Arg Lys Asn Glu Thr Leu 385 390 395 400 ttt cat tcc tgc agt gcc ccc atg gtg tgt tgg act gta tgt tcc tgt 1248 Phe His Ser Cys Ser Ala Pro Met Val Cys Trp Thr Val Cys Ser Cys 405 410 415 ctg aag cag ccg aag gtg agg tat tac gat ctc cag tca atc act cag 1296 Leu Lys Gln Pro Lys Val Arg Tyr Tyr Asp Leu Gln Ser Ile Thr Gln 420 425 430 act acc acc agt ctg tat gcc tat ttt ttc tcc aac ttg ttc tcc aca 1344 Thr Thr Thr Ser Leu Tyr Ala Tyr Phe Phe Ser Asn Leu Phe Ser Thr 435 440 445 gca gag gta gat ttg gca gat gac agc tgg cca gga caa tgg agg gcc 1392 Ala Glu Val Asp Leu Ala Asp Asp Ser Trp Pro Gly Gln Trp Arg Ala 450 455 460 ctc tgc agc ctg gcc ata gaa ggg ctg tgg tct atg aac ttc aca ttt 1440 Leu Cys Ser Leu Ala Ile Glu Gly Leu Trp Ser Met Asn Phe Thr Phe 465 470 475 480 aac aaa gaa gac act gag att gag ggc ctg gaa gtg cct ttc att gat 1488 Asn Lys Glu Asp Thr Glu Ile Glu Gly Leu Glu Val Pro Phe Ile Asp 485 490 495 tct ctc tac gag ttc aat att ctt caa aag atc aat gac tgt ggg ggt 1536 Ser Leu Tyr Glu Phe Asn Ile Leu Gln Lys Ile Asn Asp Cys Gly Gly 500 505 510 tgc act act ttc acc cac cta agt ttc cag gag ttt ttt gca gcc atg 1584 Cys Thr Thr Phe Thr His Leu Ser Phe Gln Glu Phe Phe Ala Ala Met 515 520 525 tcc ttt gtg cta gag gaa cct aga gaa ttc cct ccc cat tcc aca aag 1632 Ser Phe Val Leu Glu Glu Pro Arg Glu Phe Pro Pro His Ser Thr Lys 530 535 540 cca caa gag atg aag atg tta ctg caa cac gtc ttg ctt gac aaa gaa 1680 Pro Gln Glu Met Lys Met Leu Leu Gln His Val Leu Leu Asp Lys Glu 545 550 555 560 gcc tac tgg act cca gtg gtt ctg ttc ttc ttt ggt ctt tta aat aaa 1728 Ala Tyr Trp Thr Pro Val Val Leu Phe Phe Phe Gly Leu Leu Asn Lys 565 570 575 aac ata gca aga gaa ctg gaa gat act ttg cat tgt aaa ata tct ccc 1776 Asn Ile Ala Arg Glu Leu Glu Asp Thr Leu His Cys Lys Ile Ser Pro 580 585 590 agg gta atg gag gaa tta tta aag tgg gga gaa gag tta g 1816 Arg Val Met Glu Glu Leu Leu Lys Trp Gly Glu Glu Leu 595 600 605 <210> SEQ ID NO 74 <211> LENGTH: 605 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 74 Met Tyr Glu Phe Tyr Ile His Lys Gly Tyr Asp Asp Val Ser Ser Asp 1 5 10 15 Asn Ser Arg Glu Lys Ile Lys Gly Glu Pro Ser Glu Cys Glu Leu Gly 20 25 30 His Phe Pro Arg Ile Pro Trp Ala Asn Leu Arg Ala Ala Asp Pro Leu 35 40 45 Asn Leu Ser Phe Leu Leu Asp Glu His Phe Pro Lys Gly Gln Ala Trp 50 55 60 Lys Val Val Leu Gly Ile Phe Gln Thr Met Asn Leu Thr Ser Leu Cys 65 70 75 80 Glu Lys Val Arg Ala Glu Met Lys Glu Asn Val Gln Thr Gln Glu Leu 85 90 95 Gln Asp Pro Thr Gln Glu Asp Leu Glu Met Leu Glu Ala Ala Ala Gly 100 105 110 Asn Met Gln Thr Gln Gly Cys Gln Asp Pro Asn Gln Glu Glu Leu Asp 115 120 125 Glu Leu Glu Glu Glu Thr Gly Asn Val Gln Ala Gln Gly Cys Gln Asp 130 135 140 Pro Asn Gln Glu Glu Pro Glu Met Leu Glu Glu Ala Asp His Arg Arg 145 150 155 160 Lys Tyr Arg Glu Asn Met Lys Ala Glu Leu Leu Glu Thr Trp Asp Asn 165 170 175 Ile Ser Trp Pro Lys Asp His Val Tyr Ile Arg Asn Thr Ser Lys Asp 180 185 190 Glu His Glu Glu Leu Gln Arg Leu Leu Asp Pro Asn Arg Thr Arg Ala 195 200 205 Gln Ala Gln Thr Ile Val Leu Val Gly Arg Ala Gly Val Gly Lys Thr 210 215 220 Thr Leu Ala Met Arg Ala Met Leu His Trp Ala Asn Gly Val Leu Phe 225 230 235 240 Gln Gln Arg Phe Ser Tyr Val Phe Tyr Leu Ser Cys His Lys Ile Arg 245 250 255 Tyr Met Lys Glu Thr Thr Phe Ala Glu Leu Ile Ser Leu Asp Trp Pro 260 265 270 Asp Phe Asp Ala Pro Ile Glu Glu Phe Met Ser Gln Pro Glu Lys Leu 275 280 285 Leu Phe Ile Ile Asp Gly Phe Glu Glu Ile Ile Ile Ser Glu Ser Arg 290 295 300 Ser Glu Ser Leu Asp Asp Gly Ser Pro Cys Thr Asp Trp Tyr Gln Glu 305 310 315 320 Leu Pro Val Thr Lys Ile Leu His Ser Leu Leu Lys Lys Glu Leu Val 325 330 335 Pro Leu Ala Thr Leu Leu Ile Thr Ile Lys Thr Trp Phe Val Arg Asp 340 345 350 Leu Lys Ala Ser Leu Val Asn Pro Cys Phe Val Gln Ile Thr Gly Phe 355 360 365 Thr Gly Asp Asp Leu Arg Val Tyr Phe Met Arg His Phe Asp Asp Ser 370 375 380 Ser Glu Val Glu Lys Ile Leu Gln Gln Leu Arg Lys Asn Glu Thr Leu 385 390 395 400 Phe His Ser Cys Ser Ala Pro Met Val Cys Trp Thr Val Cys Ser Cys 405 410 415 Leu Lys Gln Pro Lys Val Arg Tyr Tyr Asp Leu Gln Ser Ile Thr Gln 420 425 430 Thr Thr Thr Ser Leu Tyr Ala Tyr Phe Phe Ser Asn Leu Phe Ser Thr 435 440 445 Ala Glu Val Asp Leu Ala Asp Asp Ser Trp Pro Gly Gln Trp Arg Ala 450 455 460 Leu Cys Ser Leu Ala Ile Glu Gly Leu Trp Ser Met Asn Phe Thr Phe 465 470 475 480 Asn Lys Glu Asp Thr Glu Ile Glu Gly Leu Glu Val Pro Phe Ile Asp 485 490 495 Ser Leu Tyr Glu Phe Asn Ile Leu Gln Lys Ile Asn Asp Cys Gly Gly 500 505 510 Cys Thr Thr Phe Thr His Leu Ser Phe Gln Glu Phe Phe Ala Ala Met 515 520 525 Ser Phe Val Leu Glu Glu Pro Arg Glu Phe Pro Pro His Ser Thr Lys 530 535 540 Pro Gln Glu Met Lys Met Leu Leu Gln His Val Leu Leu Asp Lys Glu 545 550 555 560 Ala Tyr Trp Thr Pro Val Val Leu Phe Phe Phe Gly Leu Leu Asn Lys 565 570 575 Asn Ile Ala Arg Glu Leu Glu Asp Thr Leu His Cys Lys Ile Ser Pro 580 585 590 Arg Val Met Glu Glu Leu Leu Lys Trp Gly Glu Glu Leu 595 600 605 <210> SEQ ID NO 75 <211> LENGTH: 2356 <212> TYPE: DNA <213> ORGANISM: Homo sapiens <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (64)...(2356) <400> SEQUENCE: 75 gatctcatat ttcttgtgcc tcaaaatccc ttctctgaag tctgccttcc ctggagaagc 60 aag atg gca gaa tcg gat tct act gac ttt gac ctg ctg tgg tat cta 108 Met Ala Glu Ser Asp Ser Thr Asp Phe Asp Leu Leu Trp Tyr Leu 1 5 10 15 gag aat ctc agt gac aag gaa ttt cag agt ttt aag aag tat ctg gca 156 Glu Asn Leu Ser Asp Lys Glu Phe Gln Ser Phe Lys Lys Tyr Leu Ala 20 25 30 cgc aag att ctt gat ttc aaa ctg cca cag ttt cca ctg ata cag atg 204 Arg Lys Ile Leu Asp Phe Lys Leu Pro Gln Phe Pro Leu Ile Gln Met 35 40 45 aca aaa gaa gaa ctg gct aac gtg ttg cca atc tct tat gag gga cag 252 Thr Lys Glu Glu Leu Ala Asn Val Leu Pro Ile Ser Tyr Glu Gly Gln 50 55 60 tat ata tgg aat atg ctc ttc agc ata ttt tca atg atg cgt aag gaa 300 Tyr Ile Trp Asn Met Leu Phe Ser Ile Phe Ser Met Met Arg Lys Glu 65 70 75 gat ctt tgt agg aag atc att ggc aga cga aac cgc aat cag gag gca 348 Asp Leu Cys Arg Lys Ile Ile Gly Arg Arg Asn Arg Asn Gln Glu Ala 80 85 90 95 tgc aaa gct gtc atg agg aga aaa ttc atg ctg caa tgg gaa agt cac 396 Cys Lys Ala Val Met Arg Arg Lys Phe Met Leu Gln Trp Glu Ser His 100 105 110 act ttt gga aaa ttt cat tat aaa ttt ttt cgt gac gtt tcg tca gat 444 Thr Phe Gly Lys Phe His Tyr Lys Phe Phe Arg Asp Val Ser Ser Asp 115 120 125 gtg ttc tac ata ctt caa tta gcc tat gat tct acc agc tat tat tca 492 Val Phe Tyr Ile Leu Gln Leu Ala Tyr Asp Ser Thr Ser Tyr Tyr Ser 130 135 140 gca aac aat ctc aat gtg ttc ctg atg gga gag aga gca tct gga aaa 540 Ala Asn Asn Leu Asn Val Phe Leu Met Gly Glu Arg Ala Ser Gly Lys 145 150 155 act att gtt ata aat ctg gct gtg ttg agg tgg atc aag ggt gag atg 588 Thr Ile Val Ile Asn Leu Ala Val Leu Arg Trp Ile Lys Gly Glu Met 160 165 170 175 tgg cag aac atg atc tcg tac gtc gtt cac ctc act gct cac gaa ata 636 Trp Gln Asn Met Ile Ser Tyr Val Val His Leu Thr Ala His Glu Ile 180 185 190 aac cag atg acc aac agc agc ttg gct gag cta atc gcc aag gac tgg 684 Asn Gln Met Thr Asn Ser Ser Leu Ala Glu Leu Ile Ala Lys Asp Trp 195 200 205 cct gac ggc cag gct ccc att gca gac atc ctg tct gat ccc aag aaa 732 Pro Asp Gly Gln Ala Pro Ile Ala Asp Ile Leu Ser Asp Pro Lys Lys 210 215 220 ctc ctt ttc atc ctc gag gac ttg gac aac ata aga ttc gag tta aat 780 Leu Leu Phe Ile Leu Glu Asp Leu Asp Asn Ile Arg Phe Glu Leu Asn 225 230 235 gtc aat gaa agt gct ttg tgt agt aac agc acc cag aaa gtt ccc att 828 Val Asn Glu Ser Ala Leu Cys Ser Asn Ser Thr Gln Lys Val Pro Ile 240 245 250 255 cca gtt ctc ctg gtc agt ttg ctg aag aga aaa atg gct cca ggc tgc 876 Pro Val Leu Leu Val Ser Leu Leu Lys Arg Lys Met Ala Pro Gly Cys 260 265 270 tgg ttc ctc atc tcc tca agg ccc aca cgt ggg aat aat gta aaa acg 924 Trp Phe Leu Ile Ser Ser Arg Pro Thr Arg Gly Asn Asn Val Lys Thr 275 280 285 ttc ttg aaa gag gta gat tgc tgc acg acc ttg cag ctg tcg aat ggg 972 Phe Leu Lys Glu Val Asp Cys Cys Thr Thr Leu Gln Leu Ser Asn Gly 290 295 300 aag agg gag ata tat ttt aac tct ttc ttt aaa gac cgc cag agg gcg 1020 Lys Arg Glu Ile Tyr Phe Asn Ser Phe Phe Lys Asp Arg Gln Arg Ala 305 310 315 tcg gca gcc ctc cag ctt gta cat gag gat gaa ata ctc gtg ggt ctg 1068 Ser Ala Ala Leu Gln Leu Val His Glu Asp Glu Ile Leu Val Gly Leu 320 325 330 335 tgc cga gtc gcc atc tta tgc tgg atc acg tgt act gtc ctg aag cgg 1116 Cys Arg Val Ala Ile Leu Cys Trp Ile Thr Cys Thr Val Leu Lys Arg 340 345 350 cag atg gac aag ggg cgt gac ttc cag ctc tgc tgc caa aca ccc act 1164 Gln Met Asp Lys Gly Arg Asp Phe Gln Leu Cys Cys Gln Thr Pro Thr 355 360 365 gat cta cat gcc cac ttt ctt gct gat gcg ttg aca tca gag gct gga 1212 Asp Leu His Ala His Phe Leu Ala Asp Ala Leu Thr Ser Glu Ala Gly 370 375 380 ctt act gcc aat cag tat cac cta ggt ctc cta aaa cgt ctg tgt ttg 1260 Leu Thr Ala Asn Gln Tyr His Leu Gly Leu Leu Lys Arg Leu Cys Leu 385 390 395 ctg gct gca gga gga ctg ttt ctg agc acc ctg aat ttc agt ggt gaa 1308 Leu Ala Ala Gly Gly Leu Phe Leu Ser Thr Leu Asn Phe Ser Gly Glu 400 405 410 415 gac ctc aga tgt gtt ggg ttt act gag gct gat gtc tct gtg ttg cag 1356 Asp Leu Arg Cys Val Gly Phe Thr Glu Ala Asp Val Ser Val Leu Gln 420 425 430 gcc gcg aat att ctt ttg ccg agc aac act cat aaa gac cgt tac aag 1404 Ala Ala Asn Ile Leu Leu Pro Ser Asn Thr His Lys Asp Arg Tyr Lys 435 440 445 ttc ata cac ttg aac gtc cag gag ttt tgt aca gcc att gca ttt ctg 1452 Phe Ile His Leu Asn Val Gln Glu Phe Cys Thr Ala Ile Ala Phe Leu 450 455 460 atg gca gta ccc aac tat ctg atc ccc tca ggc agc aga gag tat aaa 1500 Met Ala Val Pro Asn Tyr Leu Ile Pro Ser Gly Ser Arg Glu Tyr Lys 465 470 475 gag aag aga gaa caa tac tct gac ttt aat caa gtg ttt act ttc att 1548 Glu Lys Arg Glu Gln Tyr Ser Asp Phe Asn Gln Val Phe Thr Phe Ile 480 485 490 495 ttt ggt ctt cta aat gca aac agg aga aag att ctt gag aca tcc ttt 1596 Phe Gly Leu Leu Asn Ala Asn Arg Arg Lys Ile Leu Glu Thr Ser Phe 500 505 510 gga tac cag cta ccg atg gta gac agc ttc aag tgg tac tcg gtg gga 1644 Gly Tyr Gln Leu Pro Met Val Asp Ser Phe Lys Trp Tyr Ser Val Gly 515 520 525 tac atg aaa cat ttg gac cgt gac ccg gaa aag ttg acg cac cat atg 1692 Tyr Met Lys His Leu Asp Arg Asp Pro Glu Lys Leu Thr His His Met 530 535 540 cct ttg ttt tac tgt ctc tat gag aat cgg gaa gaa gaa ttt gtg aag 1740 Pro Leu Phe Tyr Cys Leu Tyr Glu Asn Arg Glu Glu Glu Phe Val Lys 545 550 555 acg att gtg gat gct ctc atg gag gtt aca gtt tac ctt caa tca gac 1788 Thr Ile Val Asp Ala Leu Met Glu Val Thr Val Tyr Leu Gln Ser Asp 560 565 570 575 aag gat atg atg gtc tca tta tac tgt ctg gat tac tgc tgt cac ctg 1836 Lys Asp Met Met Val Ser Leu Tyr Cys Leu Asp Tyr Cys Cys His Leu 580 585 590 agg aca ctt aag ttg agt gtt cag cgc atc ttt caa aac aaa gag cca 1884 Arg Thr Leu Lys Leu Ser Val Gln Arg Ile Phe Gln Asn Lys Glu Pro 595 600 605 ctt ata agg cca act gct agg ttg tcc tat gtc tcg act gct tct ggt 1932 Leu Ile Arg Pro Thr Ala Arg Leu Ser Tyr Val Ser Thr Ala Ser Gly 610 615 620 ttt gaa gac tta ctc aag gct ttg gct cgt aat cgg agc ctg aca tac 1980 Phe Glu Asp Leu Leu Lys Ala Leu Ala Arg Asn Arg Ser Leu Thr Tyr 625 630 635 ctg agt atc aac tgt acg tcc att tcc cta aat atg ttt tca ctt ctg 2028 Leu Ser Ile Asn Cys Thr Ser Ile Ser Leu Asn Met Phe Ser Leu Leu 640 645 650 655 cat gac atc ctg cac gag ccc aca tgc caa ata agt cat ctg agc ttg 2076 His Asp Ile Leu His Glu Pro Thr Cys Gln Ile Ser His Leu Ser Leu 660 665 670 atg aaa tgt gat ttg cga gcc agc gaa tgc gaa gaa atc gcc tct ctc 2124 Met Lys Cys Asp Leu Arg Ala Ser Glu Cys Glu Glu Ile Ala Ser Leu 675 680 685 ctc atc agt ggc ggg agt ctg aga aaa ctg acc tta tcc agc aat ccg 2172 Leu Ile Ser Gly Gly Ser Leu Arg Lys Leu Thr Leu Ser Ser Asn Pro 690 695 700 ctg agg agc gac ggg atg aac ata ctg tgt gat gcc ttg ctt cat ccc 2220 Leu Arg Ser Asp Gly Met Asn Ile Leu Cys Asp Ala Leu Leu His Pro 705 710 715 aac tgc act ctt ata tca ctg gtg tta gtc ttc tgc tgt ctc act gaa 2268 Asn Cys Thr Leu Ile Ser Leu Val Leu Val Phe Cys Cys Leu Thr Glu 720 725 730 735 aat tgc tgc agc gcc ctt gga aga gtg ctt ctg ttc agc cca act cta 2316 Asn Cys Cys Ser Ala Leu Gly Arg Val Leu Leu Phe Ser Pro Thr Leu 740 745 750 aga caa cta gac ctg tgt gtg aat cgc tta aaa aat tac g 2356 Arg Gln Leu Asp Leu Cys Val Asn Arg Leu Lys Asn Tyr 755 760 <210> SEQ ID NO 76 <211> LENGTH: 764 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 76 Met Ala Glu Ser Asp Ser Thr Asp Phe Asp Leu Leu Trp Tyr Leu Glu 1 5 10 15 Asn Leu Ser Asp Lys Glu Phe Gln Ser Phe Lys Lys Tyr Leu Ala Arg 20 25 30 Lys Ile Leu Asp Phe Lys Leu Pro Gln Phe Pro Leu Ile Gln Met Thr 35 40 45 Lys Glu Glu Leu Ala Asn Val Leu Pro Ile Ser Tyr Glu Gly Gln Tyr 50 55 60 Ile Trp Asn Met Leu Phe Ser Ile Phe Ser Met Met Arg Lys Glu Asp 65 70 75 80 Leu Cys Arg Lys Ile Ile Gly Arg Arg Asn Arg Asn Gln Glu Ala Cys 85 90 95 Lys Ala Val Met Arg Arg Lys Phe Met Leu Gln Trp Glu Ser His Thr 100 105 110 Phe Gly Lys Phe His Tyr Lys Phe Phe Arg Asp Val Ser Ser Asp Val 115 120 125 Phe Tyr Ile Leu Gln Leu Ala Tyr Asp Ser Thr Ser Tyr Tyr Ser Ala 130 135 140 Asn Asn Leu Asn Val Phe Leu Met Gly Glu Arg Ala Ser Gly Lys Thr 145 150 155 160 Ile Val Ile Asn Leu Ala Val Leu Arg Trp Ile Lys Gly Glu Met Trp 165 170 175 Gln Asn Met Ile Ser Tyr Val Val His Leu Thr Ala His Glu Ile Asn 180 185 190 Gln Met Thr Asn Ser Ser Leu Ala Glu Leu Ile Ala Lys Asp Trp Pro 195 200 205 Asp Gly Gln Ala Pro Ile Ala Asp Ile Leu Ser Asp Pro Lys Lys Leu 210 215 220 Leu Phe Ile Leu Glu Asp Leu Asp Asn Ile Arg Phe Glu Leu Asn Val 225 230 235 240 Asn Glu Ser Ala Leu Cys Ser Asn Ser Thr Gln Lys Val Pro Ile Pro 245 250 255 Val Leu Leu Val Ser Leu Leu Lys Arg Lys Met Ala Pro Gly Cys Trp 260 265 270 Phe Leu Ile Ser Ser Arg Pro Thr Arg Gly Asn Asn Val Lys Thr Phe 275 280 285 Leu Lys Glu Val Asp Cys Cys Thr Thr Leu Gln Leu Ser Asn Gly Lys 290 295 300 Arg Glu Ile Tyr Phe Asn Ser Phe Phe Lys Asp Arg Gln Arg Ala Ser 305 310 315 320 Ala Ala Leu Gln Leu Val His Glu Asp Glu Ile Leu Val Gly Leu Cys 325 330 335 Arg Val Ala Ile Leu Cys Trp Ile Thr Cys Thr Val Leu Lys Arg Gln 340 345 350 Met Asp Lys Gly Arg Asp Phe Gln Leu Cys Cys Gln Thr Pro Thr Asp 355 360 365 Leu His Ala His Phe Leu Ala Asp Ala Leu Thr Ser Glu Ala Gly Leu 370 375 380 Thr Ala Asn Gln Tyr His Leu Gly Leu Leu Lys Arg Leu Cys Leu Leu 385 390 395 400 Ala Ala Gly Gly Leu Phe Leu Ser Thr Leu Asn Phe Ser Gly Glu Asp 405 410 415 Leu Arg Cys Val Gly Phe Thr Glu Ala Asp Val Ser Val Leu Gln Ala 420 425 430 Ala Asn Ile Leu Leu Pro Ser Asn Thr His Lys Asp Arg Tyr Lys Phe 435 440 445 Ile His Leu Asn Val Gln Glu Phe Cys Thr Ala Ile Ala Phe Leu Met 450 455 460 Ala Val Pro Asn Tyr Leu Ile Pro Ser Gly Ser Arg Glu Tyr Lys Glu 465 470 475 480 Lys Arg Glu Gln Tyr Ser Asp Phe Asn Gln Val Phe Thr Phe Ile Phe 485 490 495 Gly Leu Leu Asn Ala Asn Arg Arg Lys Ile Leu Glu Thr Ser Phe Gly 500 505 510 Tyr Gln Leu Pro Met Val Asp Ser Phe Lys Trp Tyr Ser Val Gly Tyr 515 520 525 Met Lys His Leu Asp Arg Asp Pro Glu Lys Leu Thr His His Met Pro 530 535 540 Leu Phe Tyr Cys Leu Tyr Glu Asn Arg Glu Glu Glu Phe Val Lys Thr 545 550 555 560 Ile Val Asp Ala Leu Met Glu Val Thr Val Tyr Leu Gln Ser Asp Lys 565 570 575 Asp Met Met Val Ser Leu Tyr Cys Leu Asp Tyr Cys Cys His Leu Arg 580 585 590 Thr Leu Lys Leu Ser Val Gln Arg Ile Phe Gln Asn Lys Glu Pro Leu 595 600 605 Ile Arg Pro Thr Ala Arg Leu Ser Tyr Val Ser Thr Ala Ser Gly Phe 610 615 620 Glu Asp Leu Leu Lys Ala Leu Ala Arg Asn Arg Ser Leu Thr Tyr Leu 625 630 635 640 Ser Ile Asn Cys Thr Ser Ile Ser Leu Asn Met Phe Ser Leu Leu His 645 650 655 Asp Ile Leu His Glu Pro Thr Cys Gln Ile Ser His Leu Ser Leu Met 660 665 670 Lys Cys Asp Leu Arg Ala Ser Glu Cys Glu Glu Ile Ala Ser Leu Leu 675 680 685 Ile Ser Gly Gly Ser Leu Arg Lys Leu Thr Leu Ser Ser Asn Pro Leu 690 695 700 Arg Ser Asp Gly Met Asn Ile Leu Cys Asp Ala Leu Leu His Pro Asn 705 710 715 720 Cys Thr Leu Ile Ser Leu Val Leu Val Phe Cys Cys Leu Thr Glu Asn 725 730 735 Cys Cys Ser Ala Leu Gly Arg Val Leu Leu Phe Ser Pro Thr Leu Arg 740 745 750 Gln Leu Asp Leu Cys Val Asn Arg Leu Lys Asn Tyr 755 760 <210> SEQ ID NO 77 <400> SEQUENCE: 77 000 <210> SEQ ID NO 78 <400> SEQUENCE: 78 000 <210> SEQ ID NO 79 <400> SEQUENCE: 79 000 <210> SEQ ID NO 80 <400> SEQUENCE: 80 000 <210> SEQ ID NO 81 <400> SEQUENCE: 81 000 <210> SEQ ID NO 82 <400> SEQUENCE: 82 000 <210> SEQ ID NO 83 <211> LENGTH: 1968 <212> TYPE: DNA <213> ORGANISM: Homo sapiens <220> FEATURE: <221> NAME/KEY: CDS <222> LOCATION: (1)...(1968) <400> SEQUENCE: 83 atg gcc atg gcc aag gcc aga aag ccc cgg gag gca ttg ctc tgg gcc 48 Met Ala Met Ala Lys Ala Arg Lys Pro Arg Glu Ala Leu Leu Trp Ala 1 5 10 15 ttg agt gac ctt gag gag aac gat ttc aag aag tta aag ttc tac tta 96 Leu Ser Asp Leu Glu Glu Asn Asp Phe Lys Lys Leu Lys Phe Tyr Leu 20 25 30 cgg gat atg acc ctg tct gag ggc cag ccc cca ctg gcc aga ggg gag 144 Arg Asp Met Thr Leu Ser Glu Gly Gln Pro Pro Leu Ala Arg Gly Glu 35 40 45 ttg gag ggc ctg att ccg gtg gac ctg gca gaa tta ctg att tca aag 192 Leu Glu Gly Leu Ile Pro Val Asp Leu Ala Glu Leu Leu Ile Ser Lys 50 55 60 tat gga gaa aag gag gct gtg aaa gtt gtc ctc aag ggc ttg aag gtc 240 Tyr Gly Glu Lys Glu Ala Val Lys Val Val Leu Lys Gly Leu Lys Val 65 70 75 80 atg aac ctg ttg gaa ctt gtg gac cag ctc agc cat att tgt ctg cat 288 Met Asn Leu Leu Glu Leu Val Asp Gln Leu Ser His Ile Cys Leu His 85 90 95 gat tac aga gaa gta tac cga gag cat gtg cgc tgc cta gag gaa tgg 336 Asp Tyr Arg Glu Val Tyr Arg Glu His Val Arg Cys Leu Glu Glu Trp 100 105 110 cag gaa gca gga gtc aat ggc aga tac aac cag gtg ctc ctg gtg gcc 384 Gln Glu Ala Gly Val Asn Gly Arg Tyr Asn Gln Val Leu Leu Val Ala 115 120 125 aag ccc agc tca gag agc cca gaa tca ctt gcc tgc ccc ttc ccg gag 432 Lys Pro Ser Ser Glu Ser Pro Glu Ser Leu Ala Cys Pro Phe Pro Glu 130 135 140 cag gag ctg gag tct gtc acg gtg gag gct cta ttt gat tca ggg gaa 480 Gln Glu Leu Glu Ser Val Thr Val Glu Ala Leu Phe Asp Ser Gly Glu 145 150 155 160 aag ccc tca ctg gcc cca tcc tta gtt gtg cta cag ggg tcg gct ggc 528 Lys Pro Ser Leu Ala Pro Ser Leu Val Val Leu Gln Gly Ser Ala Gly 165 170 175 act gga aag aca act ctc gcc aga aaa atg gtg ttg gac tgg gcc acc 576 Thr Gly Lys Thr Thr Leu Ala Arg Lys Met Val Leu Asp Trp Ala Thr 180 185 190 ggt act ctg tac cca ggc cgg ttt gat tat gtc ttt tat gta agc tgc 624 Gly Thr Leu Tyr Pro Gly Arg Phe Asp Tyr Val Phe Tyr Val Ser Cys 195 200 205 aaa gaa gtg gtc ctg ctg ctg gag agc aaa ctg gag cag ctc ctt ttc 672 Lys Glu Val Val Leu Leu Leu Glu Ser Lys Leu Glu Gln Leu Leu Phe 210 215 220 tgg tgc tgc ggg gac aat caa gcc cct gtc aca gag att ctg agg cag 720 Trp Cys Cys Gly Asp Asn Gln Ala Pro Val Thr Glu Ile Leu Arg Gln 225 230 235 240 cca gag cgg ctc ctg ttc atc ctg gat ggc ttt gat gag ctg cag agg 768 Pro Glu Arg Leu Leu Phe Ile Leu Asp Gly Phe Asp Glu Leu Gln Arg 245 250 255 ccc ttt gaa gaa aag ttg aag aag agg ggt ttg agt ccc aag gag agc 816 Pro Phe Glu Glu Lys Leu Lys Lys Arg Gly Leu Ser Pro Lys Glu Ser 260 265 270 ctg ctg cac ctt cta att agg aga cat aca ctc ccc acg tgc tcc ctt 864 Leu Leu His Leu Leu Ile Arg Arg His Thr Leu Pro Thr Cys Ser Leu 275 280 285 ctc atc acc acc cgg ccc ctg gct ttg agg aat ctg gag ccc ttg ctg 912 Leu Ile Thr Thr Arg Pro Leu Ala Leu Arg Asn Leu Glu Pro Leu Leu 290 295 300 aaa caa gca cgt cat gtc cat atc cta ggc ttc tct gag gag gag agg 960 Lys Gln Ala Arg His Val His Ile Leu Gly Phe Ser Glu Glu Glu Arg 305 310 315 320 gcg agg tac ttc agc tcc tat ttc acg gat gag aag caa gct gac cgt 1008 Ala Arg Tyr Phe Ser Ser Tyr Phe Thr Asp Glu Lys Gln Ala Asp Arg 325 330 335 gcc ttc gac att gta cag aaa aat gac att ctc tac aaa gcg tgt cag 1056 Ala Phe Asp Ile Val Gln Lys Asn Asp Ile Leu Tyr Lys Ala Cys Gln 340 345 350 gtt cca ggc att tgc tgg gtg gtc tgc tcc tgg ctg cag ggg cag atg 1104 Val Pro Gly Ile Cys Trp Val Val Cys Ser Trp Leu Gln Gly Gln Met 355 360 365 gag aga ggc aaa gtt gtc tta gag aca cct aga aac agc act gac atc 1152 Glu Arg Gly Lys Val Val Leu Glu Thr Pro Arg Asn Ser Thr Asp Ile 370 375 380 ttc atg gct tac gtc tcc acc ttt ctg ccg ccc gat gat gat ggg ggc 1200 Phe Met Ala Tyr Val Ser Thr Phe Leu Pro Pro Asp Asp Asp Gly Gly 385 390 395 400 tgc tcc gag ctt tcc cgg cac agg gtc ctg agg agt ctg tgc tcc cta 1248 Cys Ser Glu Leu Ser Arg His Arg Val Leu Arg Ser Leu Cys Ser Leu 405 410 415 gca gct gaa ggg att cag cac cag agg ttc cta ttt gaa gaa gct gag 1296 Ala Ala Glu Gly Ile Gln His Gln Arg Phe Leu Phe Glu Glu Ala Glu 420 425 430 ctc agg aaa cat aat tta gat ggc ccc agg ctt gcc gct ttc ctg agt 1344 Leu Arg Lys His Asn Leu Asp Gly Pro Arg Leu Ala Ala Phe Leu Ser 435 440 445 agt aac gac tac caa ttg gga ctt gcc atc aag aag ttc tac agc ttc 1392 Ser Asn Asp Tyr Gln Leu Gly Leu Ala Ile Lys Lys Phe Tyr Ser Phe 450 455 460 cgc cac atc agc ttc cag gac ttt ttt cat gcc atg tct tac ctg gtg 1440 Arg His Ile Ser Phe Gln Asp Phe Phe His Ala Met Ser Tyr Leu Val 465 470 475 480 aaa gag gac caa agc cgg ctg ggg aag gag tcc cgc aga gaa gtg caa 1488 Lys Glu Asp Gln Ser Arg Leu Gly Lys Glu Ser Arg Arg Glu Val Gln 485 490 495 agg ctg ctg gag gta aag gag cag gaa ggg aat gat gag atg acc ctc 1536 Arg Leu Leu Glu Val Lys Glu Gln Glu Gly Asn Asp Glu Met Thr Leu 500 505 510 act atg cag ttt tta ctg gac atc tcg aaa aaa gac agc ttc tcg aac 1584 Thr Met Gln Phe Leu Leu Asp Ile Ser Lys Lys Asp Ser Phe Ser Asn 515 520 525 ttg gag ctc aag ttc tgc ttc aga att tct ccc tgt tta gcg cag gat 1632 Leu Glu Leu Lys Phe Cys Phe Arg Ile Ser Pro Cys Leu Ala Gln Asp 530 535 540 ctg aag cat ttt aaa gaa cag atg gaa tct atg aag cac aac agg acc 1680 Leu Lys His Phe Lys Glu Gln Met Glu Ser Met Lys His Asn Arg Thr 545 550 555 560 tgg gat ttg gaa ttc tcc ctg tat gaa gct aaa ata aag aat ctg gta 1728 Trp Asp Leu Glu Phe Ser Leu Tyr Glu Ala Lys Ile Lys Asn Leu Val 565 570 575 aaa ggt att cag atg aac aat gta tca ttc aag ata aaa cat tca aat 1776 Lys Gly Ile Gln Met Asn Asn Val Ser Phe Lys Ile Lys His Ser Asn 580 585 590 gaa aag aaa tca cag agc cag aat tta ttt tct gtc aaa agc agc ttg 1824 Glu Lys Lys Ser Gln Ser Gln Asn Leu Phe Ser Val Lys Ser Ser Leu 595 600 605 agt cat gga cct aag gag gag caa aaa tgt cct tct gtc cat gga cag 1872 Ser His Gly Pro Lys Glu Glu Gln Lys Cys Pro Ser Val His Gly Gln 610 615 620 aag gag ggc aaa gat aat ata gca gga aca caa aag gaa gct tct act 1920 Lys Glu Gly Lys Asp Asn Ile Ala Gly Thr Gln Lys Glu Ala Ser Thr 625 630 635 640 gga aaa ggc aga ggg aca gag gaa aca cca aaa aat act tac ata taa 1968 Gly Lys Gly Arg Gly Thr Glu Glu Thr Pro Lys Asn Thr Tyr Ile * 645 650 655 <210> SEQ ID NO 84 <211> LENGTH: 655 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 84 Met Ala Met Ala Lys Ala Arg Lys Pro Arg Glu Ala Leu Leu Trp Ala 1 5 10 15 Leu Ser Asp Leu Glu Glu Asn Asp Phe Lys Lys Leu Lys Phe Tyr Leu 20 25 30 Arg Asp Met Thr Leu Ser Glu Gly Gln Pro Pro Leu Ala Arg Gly Glu 35 40 45 Leu Glu Gly Leu Ile Pro Val Asp Leu Ala Glu Leu Leu Ile Ser Lys 50 55 60 Tyr Gly Glu Lys Glu Ala Val Lys Val Val Leu Lys Gly Leu Lys Val 65 70 75 80 Met Asn Leu Leu Glu Leu Val Asp Gln Leu Ser His Ile Cys Leu His 85 90 95 Asp Tyr Arg Glu Val Tyr Arg Glu His Val Arg Cys Leu Glu Glu Trp 100 105 110 Gln Glu Ala Gly Val Asn Gly Arg Tyr Asn Gln Val Leu Leu Val Ala 115 120 125 Lys Pro Ser Ser Glu Ser Pro Glu Ser Leu Ala Cys Pro Phe Pro Glu 130 135 140 Gln Glu Leu Glu Ser Val Thr Val Glu Ala Leu Phe Asp Ser Gly Glu 145 150 155 160 Lys Pro Ser Leu Ala Pro Ser Leu Val Val Leu Gln Gly Ser Ala Gly 165 170 175 Thr Gly Lys Thr Thr Leu Ala Arg Lys Met Val Leu Asp Trp Ala Thr 180 185 190 Gly Thr Leu Tyr Pro Gly Arg Phe Asp Tyr Val Phe Tyr Val Ser Cys 195 200 205 Lys Glu Val Val Leu Leu Leu Glu Ser Lys Leu Glu Gln Leu Leu Phe 210 215 220 Trp Cys Cys Gly Asp Asn Gln Ala Pro Val Thr Glu Ile Leu Arg Gln 225 230 235 240 Pro Glu Arg Leu Leu Phe Ile Leu Asp Gly Phe Asp Glu Leu Gln Arg 245 250 255 Pro Phe Glu Glu Lys Leu Lys Lys Arg Gly Leu Ser Pro Lys Glu Ser 260 265 270 Leu Leu His Leu Leu Ile Arg Arg His Thr Leu Pro Thr Cys Ser Leu 275 280 285 Leu Ile Thr Thr Arg Pro Leu Ala Leu Arg Asn Leu Glu Pro Leu Leu 290 295 300 Lys Gln Ala Arg His Val His Ile Leu Gly Phe Ser Glu Glu Glu Arg 305 310 315 320 Ala Arg Tyr Phe Ser Ser Tyr Phe Thr Asp Glu Lys Gln Ala Asp Arg 325 330 335 Ala Phe Asp Ile Val Gln Lys Asn Asp Ile Leu Tyr Lys Ala Cys Gln 340 345 350 Val Pro Gly Ile Cys Trp Val Val Cys Ser Trp Leu Gln Gly Gln Met 355 360 365 Glu Arg Gly Lys Val Val Leu Glu Thr Pro Arg Asn Ser Thr Asp Ile 370 375 380 Phe Met Ala Tyr Val Ser Thr Phe Leu Pro Pro Asp Asp Asp Gly Gly 385 390 395 400 Cys Ser Glu Leu Ser Arg His Arg Val Leu Arg Ser Leu Cys Ser Leu 405 410 415 Ala Ala Glu Gly Ile Gln His Gln Arg Phe Leu Phe Glu Glu Ala Glu 420 425 430 Leu Arg Lys His Asn Leu Asp Gly Pro Arg Leu Ala Ala Phe Leu Ser 435 440 445 Ser Asn Asp Tyr Gln Leu Gly Leu Ala Ile Lys Lys Phe Tyr Ser Phe 450 455 460 Arg His Ile Ser Phe Gln Asp Phe Phe His Ala Met Ser Tyr Leu Val 465 470 475 480 Lys Glu Asp Gln Ser Arg Leu Gly Lys Glu Ser Arg Arg Glu Val Gln 485 490 495 Arg Leu Leu Glu Val Lys Glu Gln Glu Gly Asn Asp Glu Met Thr Leu 500 505 510 Thr Met Gln Phe Leu Leu Asp Ile Ser Lys Lys Asp Ser Phe Ser Asn 515 520 525 Leu Glu Leu Lys Phe Cys Phe Arg Ile Ser Pro Cys Leu Ala Gln Asp 530 535 540 Leu Lys His Phe Lys Glu Gln Met Glu Ser Met Lys His Asn Arg Thr 545 550 555 560 Trp Asp Leu Glu Phe Ser Leu Tyr Glu Ala Lys Ile Lys Asn Leu Val 565 570 575 Lys Gly Ile Gln Met Asn Asn Val Ser Phe Lys Ile Lys His Ser Asn 580 585 590 Glu Lys Lys Ser Gln Ser Gln Asn Leu Phe Ser Val Lys Ser Ser Leu 595 600 605 Ser His Gly Pro Lys Glu Glu Gln Lys Cys Pro Ser Val His Gly Gln 610 615 620 Lys Glu Gly Lys Asp Asn Ile Ala Gly Thr Gln Lys Glu Ala Ser Thr 625 630 635 640 Gly Lys Gly Arg Gly Thr Glu Glu Thr Pro Lys Asn Thr Tyr Ile 645 650 655 <210> SEQ ID NO 85 <211> LENGTH: 650 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 85 Met Val Ser Ser Ala Gln Met Gly Phe Asn Leu Gln Ala Leu Leu Glu 1 5 10 15 Gln Leu Ser Gln Asp Glu Leu Ser Lys Phe Lys Tyr Leu Ile Thr Thr 20 25 30 Phe Ser Leu Ala His Glu Leu Gln Lys Ile Pro His Lys Glu Val Asp 35 40 45 Lys Ala Asp Gly Lys Gln Leu Val Glu Ile Leu Thr Thr His Cys Asp 50 55 60 Ser Tyr Trp Val Glu Met Ala Ser Leu Gln Val Phe Glu Lys Met His 65 70 75 80 Arg Met Asp Leu Ser Glu Arg Ala Lys Asp Glu Val Arg Glu Ala Ala 85 90 95 Leu Lys Ser Phe Asn Lys Arg Lys Pro Leu Ser Leu Gly Ile Thr Arg 100 105 110 Lys Glu Arg Pro Pro Leu Asp Val Asp Glu Met Leu Glu Arg Phe Lys 115 120 125 Thr Glu Ala Gln Ala Phe Thr Glu Thr Lys Gly Asn Val Ile Cys Leu 130 135 140 Gly Lys Glu Val Phe Lys Gly Lys Lys Pro Asp Lys Asp Asn Arg Cys 145 150 155 160 Arg Tyr Ile Leu Lys Thr Lys Phe Arg Glu Met Trp Lys Ser Trp Pro 165 170 175 Gly Asp Ser Lys Glu Val Gln Val Met Ala Glu Arg Tyr Lys Met Leu 180 185 190 Ile Pro Phe Ser Asn Pro Arg Val Leu Pro Gly Pro Phe Ser Tyr Thr 195 200 205 Val Val Leu Tyr Gly Pro Ala Gly Leu Gly Lys Thr Thr Leu Ala Gln 210 215 220 Lys Leu Met Leu Asp Trp Ala Glu Asp Asn Leu Ile His Lys Phe Lys 225 230 235 240 Tyr Ala Phe Tyr Leu Ser Cys Arg Glu Leu Ser Arg Leu Gly Pro Cys 245 250 255 Ser Phe Ala Glu Leu Val Phe Arg Asp Trp Pro Glu Leu Gln Asp Asp 260 265 270 Ile Pro His Ile Leu Ala Gln Ala Arg Lys Ile Leu Phe Val Ile Asp 275 280 285 Gly Phe Asp Glu Leu Gly Ala Ala Pro Gly Ala Leu Ile Glu Asp Ile 290 295 300 Cys Gly Asp Trp Glu Lys Lys Lys Pro Val Pro Val Leu Leu Gly Ser 305 310 315 320 Leu Leu Asn Arg Val Met Leu Pro Lys Ala Ala Leu Leu Val Thr Thr 325 330 335 Arg Pro Arg Ala Leu Arg Asp Leu Arg Ile Leu Ala Glu Glu Pro Ile 340 345 350 Tyr Ile Arg Val Glu Gly Phe Leu Glu Glu Asp Arg Arg Ala Tyr Phe 355 360 365 Leu Arg His Phe Gly Asp Glu Asp Gln Ala Met Arg Ala Phe Glu Leu 370 375 380 Met Arg Ser Asn Ala Ala Leu Phe Gln Leu Gly Ser Ala Pro Ala Val 385 390 395 400 Cys Trp Ile Val Cys Thr Thr Leu Lys Leu Gln Met Glu Lys Gly Glu 405 410 415 Asp Pro Val Pro Thr Cys Leu Thr Arg Thr Gly Leu Phe Leu Arg Phe 420 425 430 Leu Cys Ser Arg Phe Pro Gln Gly Ala Gln Leu Arg Gly Ala Leu Arg 435 440 445 Thr Leu Ser Leu Leu Ala Ala Gln Gly Leu Trp Ala Gln Thr Ser Val 450 455 460 Leu His Arg Glu Asp Leu Glu Arg Leu Gly Val Gln Glu Ser Asp Leu 465 470 475 480 Arg Leu Phe Leu Asp Gly Asp Ile Leu Arg Gln Asp Arg Val Ser Lys 485 490 495 Gly Cys Tyr Ser Phe Ile His Leu Ser Phe Gln Gln Phe Leu Thr Ala 500 505 510 Leu Phe Tyr Thr Leu Glu Lys Glu Glu Glu Glu Asp Arg Asp Gly His 515 520 525 Thr Trp Asp Ile Gly Asp Val Gln Lys Leu Leu Ser Gly Val Glu Arg 530 535 540 Leu Arg Asn Pro Asp Leu Ile Gln Ala Gly Tyr Tyr Ser Phe Gly Leu 545 550 555 560 Ala Asn Glu Lys Arg Ala Lys Glu Leu Glu Ala Thr Phe Gly Cys Arg 565 570 575 Met Ser Pro Asp Ile Lys Gln Glu Leu Leu Arg Cys Asp Ile Ser Cys 580 585 590 Lys Gly Gly His Ser Thr Val Thr Asp Leu Gln Glu Leu Leu Gly Cys 595 600 605 Leu Tyr Glu Ser Gln Glu Glu Glu Leu Val Lys Glu Val Met Ala Gln 610 615 620 Phe Lys Glu Ile Ser Leu His Leu Asn Ala Val Asp Val Val Pro Ser 625 630 635 640 Ser Phe Cys Val Lys His Cys Arg Asn Leu 645 650 <210> SEQ ID NO 86 <211> LENGTH: 650 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 86 Met Val Ser Ser Ala Gln Met Gly Phe Asn Leu Gln Ala Leu Leu Glu 1 5 10 15 Gln Leu Ser Gln Asp Glu Leu Ser Lys Phe Lys Tyr Leu Ile Thr Thr 20 25 30 Phe Ser Leu Ala His Glu Leu Gln Lys Ile Pro His Lys Glu Val Asp 35 40 45 Lys Ala Asp Gly Lys Gln Leu Val Glu Ile Leu Thr Thr His Cys Asp 50 55 60 Ser Tyr Trp Val Glu Met Ala Ser Leu Gln Val Phe Glu Lys Met His 65 70 75 80 Arg Met Asp Leu Ser Glu Arg Ala Lys Asp Glu Val Arg Glu Ala Ala 85 90 95 Leu Lys Ser Phe Asn Lys Arg Lys Pro Leu Ser Leu Gly Ile Thr Arg 100 105 110 Lys Glu Arg Pro Pro Leu Asp Val Asp Glu Met Leu Glu Arg Phe Lys 115 120 125 Thr Glu Ala Gln Ala Phe Thr Glu Thr Lys Gly Asn Val Ile Cys Leu 130 135 140 Gly Lys Glu Val Phe Lys Gly Lys Lys Pro Asp Lys Asp Asn Arg Cys 145 150 155 160 Arg Tyr Ile Leu Lys Thr Lys Phe Arg Glu Met Trp Lys Ser Trp Pro 165 170 175 Gly Asp Ser Lys Glu Val Gln Val Met Ala Glu Arg Tyr Lys Met Leu 180 185 190 Ile Pro Phe Ser Asn Pro Arg Val Leu Pro Gly Pro Phe Ser Tyr Thr 195 200 205 Val Val Leu Tyr Gly Pro Ala Gly Leu Gly Lys Thr Thr Leu Ala Gln 210 215 220 Lys Leu Met Leu Asp Trp Ala Glu Asp Asn Leu Ile His Lys Phe Lys 225 230 235 240 Tyr Ala Phe Tyr Leu Ser Cys Arg Glu Leu Ser Arg Leu Gly Pro Cys 245 250 255 Ser Phe Ala Glu Leu Val Phe Arg Asp Trp Pro Glu Leu Gln Asp Asp 260 265 270 Ile Pro His Ile Leu Ala Gln Ala Arg Lys Ile Leu Phe Val Ile Asp 275 280 285 Gly Phe Asp Glu Leu Gly Ala Ala Pro Gly Ala Leu Ile Glu Asp Ile 290 295 300 Cys Gly Asp Trp Glu Lys Lys Lys Pro Val Pro Val Leu Leu Gly Ser 305 310 315 320 Leu Leu Asn Arg Val Met Leu Pro Lys Ala Ala Leu Leu Val Thr Thr 325 330 335 Arg Pro Arg Ala Leu Arg Asp Leu Arg Ile Leu Ala Glu Glu Pro Ile 340 345 350 Tyr Ile Arg Val Glu Gly Phe Leu Glu Glu Asp Arg Arg Ala Tyr Phe 355 360 365 Leu Arg His Phe Gly Asp Glu Asp Gln Ala Met Arg Ala Phe Glu Leu 370 375 380 Met Arg Ser Asn Ala Ala Leu Phe Gln Leu Gly Ser Ala Pro Ala Val 385 390 395 400 Cys Trp Ile Val Cys Thr Thr Leu Lys Leu Gln Met Glu Lys Gly Glu 405 410 415 Asp Pro Val Pro Thr Cys Leu Thr Arg Thr Gly Leu Phe Leu Arg Phe 420 425 430 Leu Cys Ser Arg Phe Pro Gln Gly Ala Gln Leu Arg Gly Ala Leu Arg 435 440 445 Thr Leu Ser Leu Leu Ala Ala Gln Gly Leu Trp Ala Gln Thr Ser Val 450 455 460 Leu His Arg Glu Asp Leu Glu Arg Leu Gly Val Gln Glu Ser Asp Leu 465 470 475 480 Arg Leu Phe Leu Asp Gly Asp Ile Leu Arg Gln Asp Arg Val Ser Lys 485 490 495 Gly Cys Tyr Ser Phe Ile His Leu Ser Phe Gln Gln Phe Leu Thr Ala 500 505 510 Leu Phe Tyr Thr Leu Glu Lys Glu Glu Glu Glu Asp Arg Asp Gly His 515 520 525 Thr Trp Asp Ile Gly Asp Val Gln Lys Leu Leu Ser Gly Val Glu Arg 530 535 540 Leu Arg Asn Pro Asp Leu Ile Gln Ala Gly Tyr Tyr Ser Phe Gly Leu 545 550 555 560 Ala Asn Glu Lys Arg Ala Lys Glu Leu Glu Ala Thr Phe Gly Cys Arg 565 570 575 Met Ser Pro Asp Ile Lys Gln Glu Leu Leu Arg Cys Asp Ile Ser Cys 580 585 590 Lys Gly Gly His Ser Thr Val Thr Asp Leu Gln Glu Leu Leu Gly Cys 595 600 605 Leu Tyr Glu Ser Gln Glu Glu Glu Leu Val Lys Glu Val Met Ala Gln 610 615 620 Phe Lys Glu Ile Ser Leu His Leu Asn Ala Val Asp Val Val Pro Ser 625 630 635 640 Ser Phe Cys Val Lys His Cys Arg Asn Leu 645 650 <210> SEQ ID NO 87 <211> LENGTH: 622 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 87 His Thr Arg Ser Thr Met Thr Ser Pro Gln Leu Glu Trp Thr Leu Gln 1 5 10 15 Thr Leu Leu Glu Gln Leu Asn Glu Asp Glu Leu Lys Ser Phe Lys Ser 20 25 30 Leu Leu Trp Ala Phe Pro Leu Glu Asp Val Leu Gln Lys Thr Pro Trp 35 40 45 Ser Glu Val Glu Glu Ala Asp Gly Lys Lys Leu Ala Glu Ile Leu Val 50 55 60 Asn Thr Ser Ser Glu Asn Trp Ile Arg Asn Ala Thr Val Asn Ile Leu 65 70 75 80 Glu Glu Met Asn Leu Thr Glu Leu Cys Lys Met Ala Lys Ala Glu Met 85 90 95 Met Glu Asp Gly Gln Val Gln Glu Ile Asp Asn Pro Glu Leu Gly Asp 100 105 110 Ala Glu Glu Asp Ser Glu Leu Ala Lys Pro Gly Glu Lys Glu Gly Trp 115 120 125 Arg Asn Ser Met Glu Lys Gln Ser Leu Val Trp Lys Asn Thr Phe Trp 130 135 140 Gln Gly Asp Ile Asp Asn Phe His Asp Asp Val Thr Leu Arg Asn Gln 145 150 155 160 Arg Phe Ile Pro Phe Leu Asn Pro Arg Thr Pro Arg Lys Leu Thr Pro 165 170 175 Tyr Thr Val Val Leu His Gly Pro Ala Gly Val Gly Lys Thr Thr Leu 180 185 190 Ala Lys Lys Cys Met Leu Asp Trp Thr Asp Cys Asn Leu Ser Pro Thr 195 200 205 Leu Arg Tyr Ala Phe Tyr Leu Ser Cys Lys Glu Leu Ser Arg Met Gly 210 215 220 Pro Cys Ser Phe Ala Glu Leu Ile Ser Lys Asp Trp Pro Glu Leu Gln 225 230 235 240 Asp Asp Ile Pro Ser Ile Leu Ala Gln Ala Gln Arg Ile Leu Phe Val 245 250 255 Val Asp Gly Leu Asp Glu Leu Lys Val Pro Pro Gly Ala Leu Ile Gln 260 265 270 Asp Ile Cys Gly Asp Trp Glu Lys Lys Lys Pro Val Pro Val Leu Leu 275 280 285 Gly Ser Leu Leu Lys Arg Lys Met Leu Pro Arg Ala Ala Leu Leu Val 290 295 300 Thr Thr Arg Pro Arg Ala Leu Arg Asp Leu Gln Leu Leu Ala Gln Gln 305 310 315 320 Pro Ile Tyr Val Arg Val Glu Gly Phe Leu Glu Glu Asp Arg Arg Ala 325 330 335 Tyr Phe Leu Arg His Phe Gly Asp Glu Asp Gln Ala Met Arg Ala Phe 340 345 350 Glu Leu Met Arg Ser Asn Ala Ala Leu Phe Gln Leu Gly Ser Ala Pro 355 360 365 Ala Val Cys Trp Ile Val Cys Thr Thr Leu Lys Leu Gln Met Glu Lys 370 375 380 Gly Glu Asp Pro Val Pro Thr Cys Leu Thr Arg Thr Gly Leu Phe Leu 385 390 395 400 Arg Phe Leu Cys Ser Arg Phe Pro Gln Gly Ala Gln Leu Arg Gly Ala 405 410 415 Leu Arg Thr Leu Ser Leu Leu Ala Ala Gln Gly Leu Trp Ala Gln Met 420 425 430 Ser Val Phe His Arg Glu Asp Leu Glu Arg Leu Gly Val Gln Glu Ser 435 440 445 Asp Leu Arg Leu Phe Leu Asp Gly Asp Ile Leu Arg Gln Asp Arg Val 450 455 460 Ser Lys Gly Cys Tyr Ser Phe Ile His Leu Ser Phe Gln Gln Phe Leu 465 470 475 480 Thr Ala Leu Phe Tyr Ala Leu Glu Lys Glu Glu Gly Glu Asp Arg Asp 485 490 495 Gly His Ala Trp Asp Ile Gly Asp Val Gln Lys Leu Leu Ser Gly Glu 500 505 510 Glu Arg Leu Lys Asn Pro Asp Leu Ile Gln Val Gly His Phe Leu Phe 515 520 525 Gly Leu Ala Asn Glu Lys Arg Ala Lys Glu Leu Glu Ala Thr Phe Gly 530 535 540 Cys Arg Met Ser Pro Asp Ile Lys Gln Glu Leu Leu Gln Cys Lys Ala 545 550 555 560 His Leu His Ala Asn Lys Pro Leu Ser Val Thr Asp Leu Lys Glu Val 565 570 575 Leu Gly Cys Leu Tyr Glu Ser Gln Glu Glu Glu Leu Ala Lys Val Val 580 585 590 Val Ala Pro Phe Lys Glu Ile Ser Ile His Leu Thr Asn Thr Ser Glu 595 600 605 Val Met His Cys Ser Phe Ser Leu Lys His Cys Gln Asp Leu 610 615 620 <210> SEQ ID NO 88 <211> LENGTH: 612 <212> TYPE: PRT <213> ORGANISM: Mus musculus <400> SEQUENCE: 88 Leu Leu Lys Met Thr Ser Val Arg Cys Lys Leu Ala Gln Tyr Leu Glu 1 5 10 15 Asp Leu Glu Asp Val Asp Leu Lys Lys Phe Lys Met His Leu Glu Asp 20 25 30 Tyr Pro Pro Glu Lys Gly Cys Ile Pro Val Pro Arg Gly Gln Met Glu 35 40 45 Lys Ala Asp His Leu Asp Leu Ala Thr Leu Met Ile Asp Phe Asn Gly 50 55 60 Glu Glu Lys Ala Asp Tyr Cys Lys Met Tyr Arg Arg His Val Arg Ser 65 70 75 80 Arg Phe Tyr Ser Ile Lys Asp Arg Asn Ala Arg Leu Gly Glu Ser Val 85 90 95 Asp Leu Asn Ser Arg Tyr Thr Gln Leu Gln Leu Val Lys Glu His Pro 100 105 110 Ser Lys Gln Glu Arg Glu His Glu Leu Leu Thr Ile Gly Arg Thr Lys 115 120 125 Met Arg Asp Ser Pro Met Ser Ser Leu Lys Leu Glu Leu Leu Phe Glu 130 135 140 Pro Glu Asp Gly His Ser Glu Pro Val His Thr Val Val Phe Gln Gly 145 150 155 160 Ala Ala Gly Ile Gly Lys Thr Ile Leu Ala Arg Lys Ile Met Leu Asp 165 170 175 Trp Ala Leu Gly Lys Leu Phe Lys Asp Lys Phe Asp Tyr Leu Phe Phe 180 185 190 Ile His Cys Arg Glu Val Ser Leu Arg Thr Pro Arg Ser Leu Ala Asp 195 200 205 Leu Ile Val Ser Cys Trp Pro Asp Pro Asn Pro Pro Val Cys Lys Ile 210 215 220 Leu Arg Lys Pro Ser Arg Ile Leu Phe Leu Met Asp Gly Phe Asp Glu 225 230 235 240 Leu Gln Gly Ala Phe Asp Glu His Ile Gly Glu Val Cys Thr Asp Trp 245 250 255 Gln Lys Ala Val Arg Gly Asp Ile Leu Leu Ser Ser Leu Ile Arg Lys 260 265 270 Lys Leu Leu Pro Lys Ala Ser Leu Leu Ile Thr Thr Arg Pro Val Ala 275 280 285 Leu Glu Lys Leu Gln His Leu Leu Asp His Pro Arg His Val Glu Ile 290 295 300 Leu Gly Phe Ser Glu Ala Lys Arg Lys Glu Tyr Phe Phe Lys Tyr Phe 305 310 315 320 Ser Asn Glu Leu Gln Ala Arg Glu Ala Phe Arg Leu Ile Gln Glu Asn 325 330 335 Glu Val Leu Phe Thr Met Cys Phe Ile Pro Leu Val Cys Trp Ile Val 340 345 350 Cys Thr Gly Leu Lys Gln Gln Met Glu Thr Gly Lys Ser Leu Ala Gln 355 360 365 Thr Ser Lys Thr Thr Thr Ala Val Tyr Val Phe Phe Leu Ser Ser Leu 370 375 380 Leu Gln Ser Arg Gly Gly Ile Glu Glu His Leu Phe Ser Asp Tyr Leu 385 390 395 400 Gln Gly Leu Cys Ser Leu Ala Ala Asp Gly Ile Trp Asn Gln Lys Ile 405 410 415 Leu Phe Glu Glu Cys Asp Leu Arg Lys His Gly Leu Gln Lys Thr Asp 420 425 430 Val Ser Ala Phe Leu Arg Met Asn Val Phe Gln Lys Glu Val Asp Cys 435 440 445 Glu Arg Phe Tyr Ser Phe Ser His Met Thr Phe Gln Glu Phe Phe Ala 450 455 460 Ala Met Tyr Tyr Leu Leu Glu Glu Glu Ala Glu Gly Glu Thr Val Arg 465 470 475 480 Lys Gly Pro Gly Gly Cys Ser Asp Leu Leu Asn Arg Asp Val Lys Val 485 490 495 Leu Leu Glu Asn Tyr Gly Lys Phe Glu Lys Gly Tyr Leu Ile Phe Val 500 505 510 Val Arg Phe Leu Phe Gly Leu Val Asn Gln Glu Arg Thr Ser Tyr Leu 515 520 525 Glu Lys Lys Leu Ser Cys Lys Ile Ser Gln Gln Val Arg Leu Glu Leu 530 535 540 Leu Lys Trp Ile Glu Val Lys Ala Lys Ala Lys Lys Leu Gln Trp Gln 545 550 555 560 Pro Ser Gln Leu Glu Leu Phe Tyr Cys Leu Tyr Glu Met Gln Glu Glu 565 570 575 Asp Phe Val Gln Ser Ala Met Asp His Phe Pro Lys Ile Glu Ile Asn 580 585 590 Leu Ser Thr Arg Met Asp His Val Val Ser Ser Phe Cys Ile Lys Asn 595 600 605 Cys His Arg Val 610 <210> SEQ ID NO 89 <211> LENGTH: 674 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 89 Met Ala Ser Thr Arg Cys Lys Leu Ala Arg Tyr Leu Glu Asp Leu Glu 1 5 10 15 Asp Val Asp Leu Lys Lys Phe Lys Met His Leu Glu Asp Tyr Pro Pro 20 25 30 Gln Lys Gly Cys Ile Pro Leu Pro Arg Gly Gln Thr Glu Lys Ala Asp 35 40 45 His Val Asp Leu Ala Thr Leu Met Ile Asp Phe Asn Gly Glu Glu Lys 50 55 60 Ala Trp Ala Met Ala Val Trp Ile Phe Ala Ala Ile Asn Arg Arg Asp 65 70 75 80 Leu Tyr Glu Lys Ala Lys Arg Asp Glu Pro Lys Trp Gly Ser Asp Asn 85 90 95 Ala Arg Val Ser Asn Pro Thr Val Ile Cys Gln Glu Asp Ser Ile Glu 100 105 110 Glu Glu Trp Met Gly Leu Leu Glu Tyr Leu Ser Arg Ile Ser Ile Cys 115 120 125 Lys Met Lys Lys Asp Tyr Arg Lys Lys Tyr Arg Lys Tyr Val Arg Ser 130 135 140 Arg Phe Gln Cys Ile Glu Asp Arg Asn Ala Arg Leu Gly Glu Ser Val 145 150 155 160 Ser Leu Asn Lys Arg Tyr Thr Arg Leu Arg Leu Ile Lys Glu His Arg 165 170 175 Ser Gln Gln Glu Arg Glu Gln Glu Leu Leu Ala Ile Gly Lys Thr Lys 180 185 190 Thr Cys Glu Ser Pro Val Ser Pro Ile Lys Met Glu Leu Leu Phe Asp 195 200 205 Pro Asp Asp Glu His Ser Glu Pro Val His Thr Val Val Phe Gln Gly 210 215 220 Ala Ala Gly Ile Gly Lys Thr Ile Leu Ala Arg Lys Met Met Leu Asp 225 230 235 240 Trp Ala Ser Gly Thr Leu Tyr Gln Asp Arg Phe Asp Tyr Leu Phe Tyr 245 250 255 Ile His Cys Arg Glu Val Ser Leu Val Thr Gln Arg Ser Leu Gly Asp 260 265 270 Leu Ile Met Ser Cys Cys Pro Asp Pro Asn Pro Pro Ile His Lys Ile 275 280 285 Val Arg Lys Pro Ser Arg Ile Leu Phe Leu Met Asp Gly Phe Asp Glu 290 295 300 Leu Gln Gly Ala Phe Asp Glu His Ile Gly Pro Leu Cys Thr Asp Trp 305 310 315 320 Gln Lys Ala Glu Arg Gly Asp Ile Leu Leu Ser Ser Leu Ile Arg Lys 325 330 335 Lys Leu Leu Pro Glu Ala Ser Leu Leu Ile Thr Thr Arg Pro Val Ala 340 345 350 Leu Glu Lys Leu Gln His Leu Leu Asp His Pro Arg His Val Glu Ile 355 360 365 Leu Gly Phe Ser Glu Ala Lys Arg Lys Glu Tyr Phe Phe Lys Tyr Phe 370 375 380 Ser Asp Glu Ala Gln Ala Arg Ala Ala Phe Ser Leu Ile Gln Glu Asn 385 390 395 400 Glu Val Leu Phe Thr Met Cys Phe Ile Pro Leu Val Cys Trp Ile Val 405 410 415 Cys Thr Gly Leu Lys Gln Gln Met Glu Ser Gly Lys Ser Leu Ala Gln 420 425 430 Thr Ser Lys Thr Thr Thr Ala Val Tyr Val Phe Phe Leu Ser Ser Leu 435 440 445 Leu Gln Pro Arg Gly Gly Ser Gln Glu His Gly Leu Cys Ala His Leu 450 455 460 Trp Gly Leu Cys Ser Leu Ala Ala Asp Gly Ile Trp Asn Gln Lys Ile 465 470 475 480 Leu Phe Glu Glu Ser Asp Leu Arg Asn His Gly Leu Gln Lys Ala Asp 485 490 495 Val Ser Ala Phe Leu Arg Met Asn Leu Phe Gln Lys Glu Val Asp Cys 500 505 510 Glu Lys Phe Tyr Ser Phe Ile His Met Thr Phe Gln Glu Phe Phe Ala 515 520 525 Ala Met Tyr Tyr Leu Leu Glu Glu Glu Lys Glu Gly Arg Thr Asn Val 530 535 540 Pro Gly Ser Arg Leu Lys Leu Pro Ser Arg Asp Val Thr Val Leu Leu 545 550 555 560 Glu Asn Tyr Gly Lys Phe Glu Lys Gly Tyr Leu Ile Phe Val Val Arg 565 570 575 Phe Leu Phe Gly Leu Val Asn Gln Glu Arg Thr Ser Tyr Leu Glu Lys 580 585 590 Lys Leu Ser Cys Lys Ile Ser Gln Gln Ile Arg Leu Glu Leu Leu Lys 595 600 605 Trp Ile Glu Val Lys Ala Lys Ala Lys Lys Leu Gln Ile Gln Pro Ser 610 615 620 Gln Leu Glu Leu Phe Tyr Cys Leu Tyr Glu Met Gln Glu Glu Asp Phe 625 630 635 640 Val Gln Arg Ala Met Asp Tyr Phe Pro Lys Ile Glu Ile Asn Leu Ser 645 650 655 Thr Arg Met Asp His Met Val Ser Ser Phe Cys Ile Glu Asn Cys His 660 665 670 Arg Val <210> SEQ ID NO 90 <211> LENGTH: 635 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 90 Met Leu Arg Thr Ala Gly Arg Asp Gly Leu Cys Arg Leu Ser Thr Tyr 1 5 10 15 Leu Glu Glu Leu Glu Ala Val Glu Leu Lys Lys Phe Lys Leu Tyr Leu 20 25 30 Gly Thr Ala Thr Glu Leu Gly Glu Gly Lys Ile Pro Trp Gly Ser Met 35 40 45 Glu Lys Ala Gly Pro Leu Glu Met Ala Gln Leu Leu Ile Thr His Phe 50 55 60 Gly Pro Glu Glu Ala Trp Arg Leu Ala Leu Ser Thr Phe Glu Arg Ile 65 70 75 80 Asn Arg Lys Asp Leu Trp Glu Arg Gly Gln Arg Glu Asp Leu Val Arg 85 90 95 Asp Pro Gln Glu Thr Tyr Arg Asp Tyr Val Arg Arg Lys Phe Arg Leu 100 105 110 Met Glu Asp Arg Asn Ala Arg Leu Gly Glu Cys Val Asn Leu Ser His 115 120 125 Arg Tyr Thr Arg Leu Leu Leu Val Lys Glu His Ser Asn Pro Met Gln 130 135 140 Val Gln Gln Gln Leu Leu Asp Thr Gly Arg Gly His Ala Arg Thr Val 145 150 155 160 Gly His Gln Ala Ser Pro Ile Lys Ile Glu Thr Leu Phe Glu Pro Asp 165 170 175 Glu Glu Arg Pro Glu Pro Pro Arg Thr Val Val Met Gln Gly Ala Ala 180 185 190 Gly Ile Gly Lys Ser Met Leu Ala His Lys Val Met Leu Asp Trp Ala 195 200 205 Asp Gly Lys Leu Phe Gln Gly Arg Phe Asp Tyr Leu Phe Tyr Ile Asn 210 215 220 Cys Arg Glu Met Asn Gln Ser Ala Thr Glu Cys Ser Met Gln Asp Leu 225 230 235 240 Ile Phe Ser Cys Trp Pro Glu Pro Ser Ala Pro Leu Gln Glu Leu Ile 245 250 255 Arg Val Pro Glu Arg Leu Leu Phe Ile Ile Asp Gly Phe Asp Glu Leu 260 265 270 Lys Pro Ser Phe His Asp Pro Gln Gly Pro Trp Cys Leu Cys Trp Glu 275 280 285 Glu Lys Arg Pro Thr Glu Leu Leu Leu Asn Ser Leu Ile Arg Lys Lys 290 295 300 Leu Leu Pro Glu Leu Ser Leu Leu Ile Thr Thr Arg Pro Thr Ala Leu 305 310 315 320 Glu Lys Leu His Arg Leu Leu Glu His Pro Arg His Val Glu Ile Leu 325 330 335 Gly Phe Ser Glu Ala Glu Arg Lys Glu Tyr Phe Tyr Lys Tyr Phe His 340 345 350 Asn Ala Glu Gln Ala Gly Gln Val Phe Asn Tyr Val Arg Asp Asn Glu 355 360 365 Pro Leu Phe Thr Met Cys Phe Val Pro Leu Val Cys Trp Val Val Cys 370 375 380 Thr Cys Leu Gln Gln Gln Leu Glu Gly Gly Gly Leu Leu Arg Gln Thr 385 390 395 400 Ser Arg Thr Thr Thr Ala Val Tyr Met Leu Tyr Leu Leu Ser Leu Met 405 410 415 Gln Pro Lys Pro Gly Ala Pro Arg Leu Gln Pro Pro Pro Asn Gln Arg 420 425 430 Gly Leu Cys Ser Leu Ala Ala Asp Gly Leu Trp Asn Gln Lys Ile Leu 435 440 445 Phe Glu Glu Gln Asp Leu Arg Lys His Gly Leu Asp Gly Glu Asp Val 450 455 460 Ser Ala Phe Leu Asn Met Asn Ile Phe Gln Lys Asp Ile Asn Cys Glu 465 470 475 480 Arg Tyr Tyr Ser Phe Ile His Leu Ser Phe Gln Glu Phe Phe Ala Ala 485 490 495 Met Tyr Tyr Ile Leu Asp Glu Gly Glu Gly Gly Ala Gly Pro Asp Gln 500 505 510 Asp Val Thr Arg Leu Leu Thr Glu Tyr Ala Phe Ser Glu Arg Ser Phe 515 520 525 Leu Ala Leu Thr Ser Arg Phe Leu Phe Gly Leu Leu Asn Glu Glu Thr 530 535 540 Arg Ser His Leu Glu Lys Ser Leu Cys Trp Lys Val Ser Pro His Ile 545 550 555 560 Lys Met Asp Leu Leu Gln Trp Ile Gln Ser Lys Ala Gln Ser Asp Gly 565 570 575 Ser Thr Leu Gln Gln Gly Ser Leu Glu Phe Phe Ser Cys Leu Tyr Glu 580 585 590 Ile Gln Glu Glu Glu Phe Ile Gln Gln Ala Leu Ser His Phe Gln Val 595 600 605 Ile Val Val Ser Asn Ile Ala Ser Lys Met Glu His Met Val Ser Ser 610 615 620 Phe Cys Leu Lys Arg Cys Arg Ser Ala Gln Val 625 630 635 <210> SEQ ID NO 91 <211> LENGTH: 659 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 91 Cys Ser Ser Thr Gly Pro Arg Leu Ala Val Ala Arg Glu Leu Leu Leu 1 5 10 15 Ala Ala Leu Glu Glu Leu Ser Gln Glu Gln Leu Lys Arg Phe Arg His 20 25 30 Lys Leu Arg Asp Val Gly Pro Asp Gly Arg Ser Ile Pro Trp Gly Arg 35 40 45 Leu Glu Arg Ala Asp Ala Val Asp Leu Ala Glu Gln Leu Ala Gln Phe 50 55 60 Tyr Gly Pro Glu Pro Ala Leu Glu Val Ala Arg Lys Thr Leu Lys Arg 65 70 75 80 Ala Asp Ala Arg Asp Val Ala Ala Gln Leu Gln Glu Arg Arg Leu Gln 85 90 95 Arg Leu Gly Leu Gly Ser Gly Thr Leu Leu Ser Val Ser Glu Tyr Lys 100 105 110 Lys Lys Tyr Arg Glu His Val Leu Gln Leu His Ala Arg Val Lys Glu 115 120 125 Arg Asn Ala Arg Ser Val Lys Ile Thr Lys Arg Phe Thr Lys Leu Leu 130 135 140 Ile Ala Pro Glu Ser Ala Ala Pro Glu Glu Ala Leu Gly Pro Ala Glu 145 150 155 160 Glu Pro Glu Pro Gly Arg Ala Arg Arg Ser Asp Thr His Thr Phe Asn 165 170 175 Arg Leu Phe Arg Arg Asp Glu Glu Gly Arg Arg Pro Leu Thr Val Val 180 185 190 Leu Gln Gly Pro Ala Gly Ile Gly Lys Thr Met Ala Ala Lys Lys Ile 195 200 205 Leu Tyr Asp Trp Ala Ala Gly Lys Leu Tyr Gln Gly Gln Val Asp Phe 210 215 220 Ala Phe Phe Met Pro Cys Gly Glu Leu Leu Glu Arg Pro Gly Thr Arg 225 230 235 240 Ser Leu Ala Asp Leu Ile Leu Asp Gln Cys Pro Asp Arg Gly Ala Pro 245 250 255 Val Pro Gln Met Leu Ala Gln Pro Gln Arg Leu Leu Phe Ile Leu Asp 260 265 270 Gly Ala Asp Glu Leu Pro Ala Leu Gly Gly Pro Glu Ala Ala Pro Cys 275 280 285 Thr Asp Pro Phe Glu Ala Ala Ser Gly Ala Arg Val Leu Gly Gly Leu 290 295 300 Leu Ser Lys Ala Leu Leu Pro Thr Ala Leu Leu Leu Val Thr Thr Arg 305 310 315 320 Ala Ala Ala Pro Gly Arg Leu Gln Gly Arg Leu Cys Ser Pro Gln Cys 325 330 335 Ala Glu Val Arg Gly Phe Ser Asp Lys Asp Lys Lys Lys Tyr Phe Tyr 340 345 350 Lys Phe Phe Arg Asp Glu Arg Arg Ala Glu Arg Ala Tyr Arg Phe Val 355 360 365 Lys Glu Asn Glu Thr Leu Phe Ala Leu Cys Phe Val Pro Phe Val Cys 370 375 380 Trp Ile Val Cys Thr Val Leu Arg Gln Gln Leu Glu Leu Gly Arg Asp 385 390 395 400 Leu Ser Arg Thr Ser Lys Thr Thr Thr Ser Val Tyr Leu Leu Phe Ile 405 410 415 Thr Ser Val Leu Ser Ser Ala Pro Val Ala Asp Gly Pro Arg Leu Gln 420 425 430 Gly Asp Leu Arg Asn Leu Cys Arg Leu Ala Arg Glu Gly Val Leu Gly 435 440 445 Arg Arg Ala Gln Phe Ala Glu Lys Glu Leu Glu Gln Leu Glu Leu Arg 450 455 460 Gly Ser Lys Val Gln Thr Leu Phe Leu Ser Lys Lys Glu Leu Pro Gly 465 470 475 480 Val Leu Glu Thr Glu Val Thr Tyr Gln Phe Ile Asp Gln Ser Phe Gln 485 490 495 Glu Phe Leu Ala Ala Leu Ser Tyr Leu Leu Glu Asp Gly Gly Val Pro 500 505 510 Arg Thr Ala Ala Gly Gly Val Gly Thr Leu Leu Arg Gly Asp Ala Gln 515 520 525 Pro His Ser His Leu Val Leu Thr Thr Arg Phe Leu Phe Gly Leu Leu 530 535 540 Ser Ala Glu Arg Met Arg Asp Ile Glu Arg His Phe Gly Cys Met Val 545 550 555 560 Ser Glu Arg Val Lys Gln Glu Ala Leu Arg Trp Val Gln Gly Gln Gly 565 570 575 Gln Gly Cys Pro Gly Val Ala Pro Glu Val Thr Glu Gly Ala Lys Gly 580 585 590 Leu Glu Asp Thr Glu Glu Pro Glu Glu Glu Glu Glu Gly Glu Glu Pro 595 600 605 Asn Tyr Pro Leu Glu Leu Leu Tyr Cys Leu Tyr Glu Thr Gln Glu Asp 610 615 620 Ala Phe Val Arg Gln Ala Leu Cys Arg Phe Pro Glu Leu Ala Leu Gln 625 630 635 640 Arg Val Arg Phe Cys Arg Met Asp Val Ala Val Leu Ser Tyr Cys Val 645 650 655 Arg Cys Cys <210> SEQ ID NO 92 <211> LENGTH: 764 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 92 Met Ala Gly Gly Ala Trp Gly Arg Leu Ala Cys Tyr Leu Glu Phe Leu 1 5 10 15 Lys Lys Glu Glu Leu Lys Glu Phe Gln Leu Leu Leu Ala Asn Lys Ala 20 25 30 His Ser Arg Ser Ser Ser Gly Glu Thr Pro Ala Gln Pro Glu Lys Thr 35 40 45 Ser Gly Met Glu Val Ala Ser Tyr Leu Val Ala Gln Tyr Gly Glu Gln 50 55 60 Arg Ala Trp Asp Leu Ala Leu His Thr Trp Glu Gln Met Gly Leu Arg 65 70 75 80 Ser Leu Cys Ala Gln Ala Gln Glu Gly Ala Gly His Ser Pro Ser Phe 85 90 95 Pro Tyr Ser Pro Ser Glu Pro His Leu Gly Ser Pro Ser Gln Pro Thr 100 105 110 Ser Thr Ala Val Leu Met Pro Trp Ile His Glu Leu Pro Ala Gly Cys 115 120 125 Thr Gln Gly Ser Glu Arg Arg Val Leu Arg Gln Leu Pro Asp Thr Ser 130 135 140 Gly Arg Arg Trp Arg Glu Ile Ser Ala Ser Leu Leu Tyr Gln Ala Leu 145 150 155 160 Pro Ser Ser Pro Asp His Glu Ser Pro Ser Gln Glu Ser Pro Asn Ala 165 170 175 Pro Thr Ser Thr Ala Val Leu Gly Ser Trp Gly Ser Pro Pro Gln Pro 180 185 190 Ser Leu Ala Pro Arg Glu Gln Glu Ala Pro Gly Thr Gln Trp Pro Leu 195 200 205 Asp Glu Thr Ser Gly Ile Tyr Tyr Thr Glu Ile Arg Glu Arg Glu Arg 210 215 220 Glu Lys Ser Glu Lys Gly Arg Pro Pro Trp Ala Ala Val Val Gly Thr 225 230 235 240 Pro Pro Gln Ala His Thr Ser Leu Gln Pro His His His Pro Trp Glu 245 250 255 Pro Ser Val Arg Glu Ser Leu Cys Ser Thr Trp Pro Trp Lys Asn Glu 260 265 270 Asp Phe Asn Gln Lys Phe Thr Gln Leu Leu Leu Leu Gln Arg Pro His 275 280 285 Pro Arg Ser Gln Asp Pro Leu Val Lys Arg Ser Trp Pro Asp Tyr Val 290 295 300 Glu Glu Asn Arg Gly His Leu Ile Glu Ile Arg Asp Leu Phe Gly Pro 305 310 315 320 Gly Leu Asp Thr Gln Glu Pro Arg Ile Val Ile Leu Gln Gly Ala Ala 325 330 335 Gly Ile Gly Lys Ser Thr Leu Ala Arg Gln Val Lys Glu Ala Trp Gly 340 345 350 Arg Gly Gln Leu Tyr Gly Asp Arg Phe Gln His Val Phe Tyr Phe Ser 355 360 365 Cys Arg Glu Leu Ala Gln Ser Lys Val Val Ser Leu Ala Glu Leu Ile 370 375 380 Gly Lys Asp Gly Thr Ala Thr Pro Ala Pro Ile Arg Gln Ile Leu Ser 385 390 395 400 Arg Pro Glu Arg Leu Leu Phe Ile Leu Asp Gly Val Asp Glu Pro Gly 405 410 415 Trp Val Leu Gln Glu Pro Ser Ser Glu Leu Cys Leu His Trp Ser Gln 420 425 430 Pro Gln Pro Ala Asp Ala Leu Leu Gly Ser Leu Leu Gly Lys Thr Ile 435 440 445 Leu Pro Glu Ala Ser Phe Leu Ile Thr Ala Arg Thr Thr Ala Leu Gln 450 455 460 Asn Leu Ile Pro Ser Leu Glu Gln Ala Arg Trp Val Glu Val Leu Gly 465 470 475 480 Phe Ser Glu Ser Ser Arg Lys Glu Tyr Phe Tyr Arg Tyr Phe Thr Asp 485 490 495 Glu Arg Gln Ala Ile Arg Ala Phe Arg Leu Val Lys Ser Asn Lys Glu 500 505 510 Leu Trp Ala Leu Cys Leu Val Pro Trp Val Ser Trp Leu Ala Cys Thr 515 520 525 Cys Leu Met Gln Gln Met Lys Arg Lys Glu Lys Leu Thr Leu Thr Ser 530 535 540 Lys Thr Thr Thr Thr Leu Cys Leu His Tyr Leu Ala Gln Ala Leu Gln 545 550 555 560 Ala Gln Pro Leu Gly Pro Gln Leu Arg Asp Leu Cys Ser Leu Ala Ala 565 570 575 Glu Gly Ile Trp Gln Lys Lys Thr Leu Phe Ser Pro Asp Asp Leu Arg 580 585 590 Lys His Gly Leu Asp Gly Ala Ile Ile Ser Thr Phe Leu Lys Met Gly 595 600 605 Ile Leu Gln Glu His Pro Ile Pro Leu Ser Tyr Ser Phe Ile His Leu 610 615 620 Cys Phe Gln Glu Phe Phe Ala Ala Met Ser Tyr Val Leu Glu Asp Glu 625 630 635 640 Lys Gly Arg Gly Lys His Ser Asn Cys Ile Ile Asp Leu Glu Lys Thr 645 650 655 Leu Glu Ala Tyr Gly Ile His Gly Leu Phe Gly Ala Ser Thr Thr Arg 660 665 670 Phe Leu Leu Gly Leu Leu Ser Asp Glu Gly Glu Arg Glu Met Glu Asn 675 680 685 Ile Phe His Cys Arg Leu Ser Gln Gly Arg Asn Leu Met Gln Trp Val 690 695 700 Pro Ser Leu Gln Leu Leu Leu Gln Pro His Ser Leu Glu Ser Leu His 705 710 715 720 Cys Leu Tyr Glu Thr Arg Asn Lys Thr Phe Leu Thr Gln Val Met Ala 725 730 735 His Phe Glu Glu Met Gly Met Cys Val Glu Thr Asp Met Glu Leu Leu 740 745 750 Val Cys Thr Phe Cys Ile Lys Phe Ser Arg His Val 755 760 <210> SEQ ID NO 93 <211> LENGTH: 571 <212> TYPE: PRT <213> ORGANISM: Mus musculus <400> SEQUENCE: 93 Met Ala Leu Ala Arg Ala Asn Ser Pro Gln Glu Ala Leu Leu Trp Ala 1 5 10 15 Leu Asn Asp Leu Glu Glu Asn Ser Phe Lys Thr Leu Lys Phe His Leu 20 25 30 Arg Asp Val Thr Gln Phe His Leu Ala Arg Gly Glu Leu Glu Ser Leu 35 40 45 Ser Gln Val Asp Leu Ala Ser Lys Leu Ile Ser Met Tyr Gly Ala Gln 50 55 60 Glu Ala Val Arg Val Val Ser Arg Ser Leu Leu Ala Met Asn Leu Met 65 70 75 80 Glu Leu Val Asp Tyr Leu Asn Gln Val Cys Leu Asn His Leu Cys Tyr 85 90 95 Ser Asp Tyr Arg Glu Ile Tyr Arg Glu His Val Arg Cys Leu Glu Glu 100 105 110 Arg Gln Asp Trp Gly Val Asn Ser Ser His Asn Lys Leu Leu Leu Met 115 120 125 Ala Thr Ser Ser Ser Gly Gly Arg Arg Ser Pro Ser Cys Ser Asp Leu 130 135 140 Glu Gln Glu Leu Asp Pro Val Asp Val Glu Thr Leu Phe Ala Pro Glu 145 150 155 160 Ala Glu Ser Tyr Ser Thr Pro Pro Ile Val Val Met Gln Gly Ser Ala 165 170 175 Gly Thr Gly Lys Thr Thr Leu Val Lys Lys Leu Val Gln Asp Trp Ser 180 185 190 Lys Gly Lys Leu Tyr Pro Gly Gln Phe Asp Tyr Val Phe Tyr Val Ser 195 200 205 Cys Arg Glu Val Val Leu Leu Pro Lys Cys Asp Leu Pro Asn Leu Ile 210 215 220 Cys Trp Cys Cys Gly Asp Asp Gln Ala Pro Val Thr Glu Ile Leu Arg 225 230 235 240 Gln Pro Gly Arg Leu Leu Phe Ile Leu Asp Gly Tyr Asp Glu Leu Gln 245 250 255 Lys Ser Ser Arg Ala Glu Cys Val Leu His Ile Leu Met Arg Arg Arg 260 265 270 Glu Val Pro Cys Ser Leu Leu Ile Thr Thr Arg Pro Pro Ala Leu Gln 275 280 285 Ser Leu Glu Pro Met Leu Gly Glu Arg Arg His Val Leu Val Leu Gly 290 295 300 Phe Ser Glu Glu Glu Arg Glu Thr Tyr Phe Ser Ser Cys Phe Thr Asp 305 310 315 320 Lys Glu Gln Leu Lys Asn Ala Leu Glu Phe Val Gln Asn Asn Ala Val 325 330 335 Leu Tyr Lys Ala Cys Gln Val Pro Gly Ile Cys Trp Val Val Cys Ser 340 345 350 Trp Leu Lys Lys Lys Met Ala Arg Gly Gln Glu Val Ser Glu Thr Pro 355 360 365 Ser Asn Ser Thr Asp Ile Phe Thr Ala Tyr Val Ser Thr Phe Leu Pro 370 375 380 Thr Asp Gly Asn Gly Asp Ser Ser Glu Leu Thr Arg His Lys Val Leu 385 390 395 400 Lys Ser Leu Cys Ser Leu Ala Ala Glu Gly Met Arg His Gln Arg Leu 405 410 415 Leu Phe Glu Glu Glu Val Leu Arg Lys His Gly Leu Asp Gly Pro Ser 420 425 430 Leu Thr Ala Phe Leu Asn Cys Ile Asp Tyr Arg Ala Gly Leu Gly Ile 435 440 445 Lys Lys Phe Tyr Ser Phe Arg His Ile Ser Phe Gln Glu Phe Phe Tyr 450 455 460 Ala Met Ser Phe Leu Val Lys Glu Asp Gln Ser Gln Gln Gly Glu Ala 465 470 475 480 Thr His Lys Glu Val Ala Lys Leu Val Asp Pro Glu Asn His Glu Glu 485 490 495 Val Thr Leu Ser Leu Gln Phe Leu Phe Asp Met Leu Lys Thr Glu Gly 500 505 510 Thr Leu Ser Leu Gly Leu Lys Phe Cys Phe Arg Ile Ala Pro Ser Val 515 520 525 Arg Gln Asp Leu Lys His Phe Lys Glu Gln Ile Glu Ala Ile Lys Tyr 530 535 540 Lys Arg Ser Trp Asp Leu Glu Phe Ser Leu Tyr Asp Ser Lys Ile Lys 545 550 555 560 Lys Leu Thr Gln Gly Ile Gln Met Lys Asp Val 565 570 <210> SEQ ID NO 94 <211> LENGTH: 590 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 94 Met Ala Met Ala Lys Ala Arg Lys Pro Arg Glu Ala Leu Leu Trp Ala 1 5 10 15 Leu Ser Asp Leu Glu Glu Asn Asp Phe Lys Lys Leu Lys Phe Tyr Leu 20 25 30 Arg Asp Met Thr Leu Ser Glu Gly Gln Pro Pro Leu Ala Arg Gly Glu 35 40 45 Leu Glu Gly Leu Ile Pro Val Asp Leu Ala Glu Leu Leu Ile Ser Lys 50 55 60 Tyr Gly Glu Lys Glu Ala Val Lys Val Val Leu Lys Gly Leu Lys Val 65 70 75 80 Met Asn Leu Leu Glu Leu Val Asp Gln Leu Ser His Ile Cys Leu His 85 90 95 Asp Tyr Arg Glu Val Tyr Arg Glu His Val Arg Cys Leu Glu Glu Trp 100 105 110 Gln Glu Ala Gly Val Asn Gly Arg Tyr Asn Gln Val Leu Leu Val Ala 115 120 125 Lys Pro Ser Ser Glu Ser Pro Glu Ser Leu Ala Cys Pro Phe Pro Glu 130 135 140 Gln Glu Leu Glu Ser Val Thr Val Glu Ala Leu Phe Asp Ser Gly Glu 145 150 155 160 Lys Pro Ser Leu Ala Pro Ser Leu Val Val Leu Gln Gly Ser Ala Gly 165 170 175 Thr Gly Lys Thr Thr Leu Ala Arg Lys Met Val Leu Asp Trp Ala Thr 180 185 190 Gly Thr Leu Tyr Pro Gly Arg Phe Asp Tyr Val Phe Tyr Val Ser Cys 195 200 205 Lys Glu Val Val Leu Leu Leu Glu Ser Lys Leu Glu Gln Leu Leu Phe 210 215 220 Trp Cys Cys Gly Asp Asn Gln Ala Pro Val Thr Glu Ile Leu Arg Gln 225 230 235 240 Pro Glu Arg Leu Leu Phe Ile Leu Asp Gly Phe Asp Glu Leu Gln Arg 245 250 255 Pro Phe Glu Glu Lys Leu Lys Lys Arg Gly Leu Ser Pro Lys Glu Ser 260 265 270 Leu Leu His Leu Leu Ile Arg Arg His Thr Leu Pro Thr Cys Ser Leu 275 280 285 Leu Ile Thr Thr Arg Pro Leu Ala Leu Arg Asn Leu Glu Pro Leu Leu 290 295 300 Lys Gln Ala Arg His Val His Ile Leu Gly Phe Ser Glu Glu Glu Arg 305 310 315 320 Ala Arg Tyr Phe Ser Ser Tyr Phe Thr Asp Glu Lys Gln Ala Asp Arg 325 330 335 Ala Phe Asp Ile Val Gln Lys Asn Asp Ile Leu Tyr Lys Ala Cys Gln 340 345 350 Val Pro Gly Ile Cys Trp Val Val Cys Ser Trp Leu Gln Gly Gln Met 355 360 365 Glu Arg Gly Lys Val Val Leu Glu Thr Pro Arg Asn Ser Thr Asp Ile 370 375 380 Phe Met Ala Tyr Val Ser Thr Phe Leu Pro Pro Asp Asp Asp Gly Gly 385 390 395 400 Cys Ser Glu Leu Ser Arg His Arg Val Leu Arg Ser Leu Cys Ser Leu 405 410 415 Ala Ala Glu Gly Ile Gln His Gln Arg Phe Leu Phe Glu Glu Ala Glu 420 425 430 Leu Arg Lys His Asn Leu Asp Gly Pro Arg Leu Ala Ala Phe Leu Ser 435 440 445 Ser Asn Asp Tyr Gln Leu Gly Leu Ala Ile Lys Lys Phe Tyr Ser Phe 450 455 460 Arg His Ile Ser Phe Gln Asp Phe Phe His Ala Met Ser Tyr Leu Val 465 470 475 480 Lys Glu Asp Gln Ser Arg Leu Gly Lys Glu Ser Arg Arg Glu Val Gln 485 490 495 Arg Leu Leu Glu Val Lys Glu Gln Glu Gly Asn Asp Glu Met Thr Leu 500 505 510 Thr Met Gln Phe Leu Leu Asp Ile Ser Lys Lys Asp Ser Phe Ser Asn 515 520 525 Leu Glu Leu Lys Phe Cys Phe Arg Ile Ser Pro Cys Leu Ala Gln Asp 530 535 540 Leu Lys His Phe Lys Glu Gln Met Glu Ser Met Lys His Asn Arg Thr 545 550 555 560 Trp Asp Leu Glu Phe Ser Leu Tyr Glu Ala Lys Ile Lys Asn Leu Val 565 570 575 Lys Gly Ile Gln Met Asn Asn Val Ser Phe Lys Ile Lys His 580 585 590 <210> SEQ ID NO 95 <211> LENGTH: 555 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 95 Met Ala Glu Ser Asp Ser Thr Asp Phe Asp Leu Leu Trp Tyr Leu Glu 1 5 10 15 Asn Leu Ser Asp Lys Glu Phe Gln Ser Phe Lys Lys Tyr Leu Ala Arg 20 25 30 Lys Ile Leu Asp Phe Lys Leu Pro Gln Phe Pro Leu Ile Gln Met Thr 35 40 45 Lys Glu Glu Leu Ala Asn Val Leu Pro Ile Ser Tyr Glu Gly Gln Tyr 50 55 60 Ile Trp Asn Met Leu Phe Ser Ile Phe Ser Met Met Arg Lys Glu Asp 65 70 75 80 Leu Cys Arg Lys Ile Ile Gly Arg Arg Asn His Val Phe Tyr Ile Leu 85 90 95 Gln Leu Ala Tyr Asp Ser Thr Ser Tyr Tyr Ser Ala Asn Asn Leu Asn 100 105 110 Val Phe Leu Met Gly Glu Arg Ala Ser Gly Lys Thr Ile Val Ile Asn 115 120 125 Leu Ala Val Leu Arg Trp Ile Lys Gly Glu Met Trp Gln Asn Met Ile 130 135 140 Ser Tyr Val Val His Leu Thr Ala His Glu Ile Asn Gln Met Thr Asn 145 150 155 160 Ser Ser Leu Ala Glu Leu Ile Ala Lys Asp Trp Pro Asp Gly Gln Ala 165 170 175 Pro Ile Ala Asp Ile Leu Ser Asp Pro Lys Lys Leu Leu Phe Ile Leu 180 185 190 Glu Asp Leu Asp Asn Ile Arg Phe Glu Leu Asn Val Asn Glu Ser Ala 195 200 205 Leu Cys Ser Asn Ser Thr Gln Lys Val Pro Ile Pro Val Leu Leu Val 210 215 220 Ser Leu Leu Lys Arg Lys Met Ala Pro Gly Cys Trp Phe Leu Ile Ser 225 230 235 240 Ser Arg Pro Thr Arg Gly Asn Asn Val Lys Thr Phe Leu Lys Glu Val 245 250 255 Asp Cys Cys Thr Thr Leu Gln Leu Ser Asn Gly Lys Arg Glu Ile Tyr 260 265 270 Phe Asn Ser Phe Phe Lys Asp Arg Gln Arg Ala Ser Ala Ala Leu Gln 275 280 285 Leu Val His Glu Asp Glu Ile Leu Val Gly Leu Cys Arg Val Ala Ile 290 295 300 Leu Cys Trp Ile Thr Cys Thr Val Leu Lys Arg Gln Met Asp Lys Gly 305 310 315 320 Arg Asp Phe Gln Leu Cys Cys Gln Thr Pro Thr Asp Leu His Ala His 325 330 335 Phe Leu Ala Asp Ala Leu Thr Ser Glu Ala Gly Leu Thr Ala Asn Gln 340 345 350 Tyr His Leu Gly Leu Leu Lys Arg Leu Cys Leu Leu Ala Ala Gly Gly 355 360 365 Leu Phe Leu Ser Thr Leu Asn Phe Ser Gly Glu Asp Leu Arg Cys Val 370 375 380 Gly Phe Thr Glu Ala Asp Val Ser Val Leu Gln Ala Ala Asn Ile Leu 385 390 395 400 Leu Pro Ser Asn Thr His Lys Asp Arg Tyr Lys Phe Ile His Leu Asn 405 410 415 Val Gln Glu Phe Cys Thr Ala Ile Ala Phe Leu Met Ala Val Pro Asn 420 425 430 Tyr Leu Ile Pro Ser Gly Ser Arg Glu Tyr Lys Glu Lys Arg Glu Gln 435 440 445 Tyr Ser Asp Phe Asn Gln Val Phe Thr Phe Ile Phe Gly Leu Leu Asn 450 455 460 Ala Asn Arg Arg Lys Ile Leu Glu Thr Ser Phe Gly Tyr Gln Leu Pro 465 470 475 480 Met Val Asp Ser Phe Lys Trp Tyr Ser Val Gly Tyr Met Lys His Leu 485 490 495 Asp Arg Asp Pro Glu Lys Leu Thr His His Met Pro Leu Phe Tyr Cys 500 505 510 Leu Tyr Glu Asn Arg Glu Glu Glu Phe Val Lys Thr Ile Val Asp Ala 515 520 525 Leu Met Glu Val Thr Val Tyr Leu Gln Ser Asp Lys Asp Met Met Val 530 535 540 Ser Leu Tyr Cys Leu Asp Tyr Cys Cys His Leu 545 550 555 <210> SEQ ID NO 96 <211> LENGTH: 682 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 96 Met Glu Gly Asp Lys Ser Leu Thr Phe Ser Ser Tyr Gly Leu Gln Trp 1 5 10 15 Cys Leu Tyr Glu Leu Asp Lys Glu Glu Phe Gln Thr Phe Lys Glu Leu 20 25 30 Leu Lys Lys Lys Ser Ser Glu Ser Thr Thr Cys Ser Ile Pro Gln Phe 35 40 45 Glu Ile Glu Asn Ala Asn Val Glu Cys Leu Ala Leu Leu Leu His Glu 50 55 60 Tyr Tyr Gly Ala Ser Leu Ala Trp Ala Thr Ser Ile Ser Ile Phe Glu 65 70 75 80 Asn Met Asn Leu Arg Thr Leu Ser Glu Lys Ala Arg Asp Asp Met Lys 85 90 95 Arg His Ser Pro Glu Asp Pro Glu Ala Thr Met Thr Asp Gln Gly Pro 100 105 110 Ser Lys Glu Lys Val Pro Gly Ile Ser Gln Ala Val Gln Gln Asp Ser 115 120 125 Ala Thr Ala Ala Glu Thr Lys Glu Gln Glu Ile Ser Gln Ala Met Glu 130 135 140 Gln Glu Gly Ala Thr Ala Ala Glu Thr Glu Glu Gln Glu Ile Ser Gln 145 150 155 160 Ala Met Glu Gln Glu Gly Ala Thr Ala Ala Glu Thr Glu Glu Gln Gly 165 170 175 His Gly Gly Asp Thr Trp Asp Tyr Lys Ser His Val Met Thr Lys Phe 180 185 190 Ala Glu Glu Glu Asp Val Arg Arg Ser Phe Glu Asn Thr Ala Ala Asp 195 200 205 Trp Pro Glu Met Gln Thr Leu Ala Gly Ala Phe Asp Ser Asp Arg Trp 210 215 220 Gly Phe Arg Pro Arg Thr Val Val Leu His Gly Lys Ser Gly Ile Gly 225 230 235 240 Lys Ser Ala Leu Ala Arg Arg Ile Val Leu Cys Trp Ala Gln Gly Gly 245 250 255 Leu Tyr Gln Gly Met Phe Ser Tyr Val Phe Phe Leu Pro Val Arg Glu 260 265 270 Met Gln Arg Lys Lys Glu Ser Ser Val Thr Glu Phe Ile Ser Arg Glu 275 280 285 Trp Pro Asp Ser Gln Ala Pro Val Thr Glu Ile Met Ser Arg Pro Glu 290 295 300 Arg Leu Leu Phe Ile Ile Asp Gly Phe Asp Asp Leu Gly Ser Val Leu 305 310 315 320 Asn Asn Asp Thr Lys Leu Cys Lys Asp Trp Ala Glu Lys Gln Pro Pro 325 330 335 Phe Thr Leu Ile Arg Ser Leu Leu Arg Lys Val Leu Leu Pro Glu Ser 340 345 350 Phe Leu Ile Val Thr Val Arg Asp Val Gly Thr Glu Lys Leu Lys Ser 355 360 365 Glu Val Val Ser Pro Arg Tyr Leu Leu Val Arg Gly Ile Ser Gly Glu 370 375 380 Gln Arg Ile His Leu Leu Leu Glu Arg Gly Ile Gly Glu His Gln Lys 385 390 395 400 Thr Gln Gly Leu Arg Ala Ile Met Asn Asn Arg Glu Leu Leu Asp Gln 405 410 415 Cys Gln Val Pro Ala Val Gly Ser Leu Ile Cys Val Ala Leu Gln Leu 420 425 430 Gln Asp Val Val Gly Glu Ser Val Ala Pro Phe Asn Gln Thr Leu Thr 435 440 445 Gly Leu His Ala Ala Phe Val Phe His Gln Leu Thr Pro Arg Gly Val 450 455 460 Val Arg Arg Cys Leu Asn Leu Glu Glu Arg Val Val Leu Lys Arg Phe 465 470 475 480 Cys Arg Met Ala Val Glu Gly Val Trp Asn Arg Lys Ser Val Phe Asp 485 490 495 Gly Asp Asp Leu Met Val Gln Gly Leu Gly Glu Ser Glu Leu Arg Ala 500 505 510 Leu Phe His Met Asn Ile Leu Leu Pro Asp Ser His Cys Glu Glu Tyr 515 520 525 Tyr Thr Phe Phe His Leu Ser Leu Gln Asp Phe Cys Ala Ala Leu Tyr 530 535 540 Tyr Val Leu Glu Gly Leu Glu Ile Glu Pro Ala Leu Cys Pro Leu Tyr 545 550 555 560 Val Glu Lys Thr Lys Arg Ser Met Glu Leu Lys Gln Ala Gly Phe His 565 570 575 Ile His Ser Leu Trp Met Lys Arg Phe Leu Phe Gly Leu Val Ser Glu 580 585 590 Asp Val Arg Arg Pro Leu Glu Val Leu Leu Gly Cys Pro Val Pro Leu 595 600 605 Gly Val Lys Gln Lys Leu Leu His Trp Val Ser Leu Leu Gly Gln Gln 610 615 620 Pro Asn Ala Thr Thr Pro Gly Asp Thr Leu Asp Ala Phe His Cys Leu 625 630 635 640 Phe Glu Thr Gln Asp Lys Glu Phe Val Arg Leu Ala Leu Asn Ser Phe 645 650 655 Gln Glu Val Trp Leu Pro Ile Asn Gln Asn Leu Asp Leu Ile Ala Ser 660 665 670 Ser Phe Cys Leu Gln His Cys Pro Tyr Leu 675 680 <210> SEQ ID NO 97 <211> LENGTH: 598 <212> TYPE: PRT <213> ORGANISM: Mus musculus <400> SEQUENCE: 97 Phe Cys Leu Thr Leu Thr Pro Ala His Leu Ala Asp Phe Gly Phe Ile 1 5 10 15 Trp Tyr Trp Lys Glu Leu Asn Lys Ile Glu Phe Met Tyr Phe Lys Glu 20 25 30 Leu Leu Ile His Glu Ile Leu Gln Met Gly Leu Lys Gln Ile Ser Trp 35 40 45 Thr Glu Val Lys Glu Ala Ser Arg Glu Asp Leu Ala Ile Leu Leu Val 50 55 60 Lys His Cys Asp Gly Asn Gln Ala Trp Asp Thr Thr Phe Arg Val Phe 65 70 75 80 Gln Met Ile Gly Arg Asn Val Ile Thr Asn Arg Ala Thr Gly Glu Ile 85 90 95 Ala Ala His Ser Thr Ile Tyr Arg Ala His Leu Lys Glu Lys Leu Thr 100 105 110 His Asp Cys Ser Arg Lys Phe Asn Ile Ser Ile Gln Asn Phe Phe Gln 115 120 125 Asp Glu Tyr Asp His Leu Glu Asn Leu Leu Val Pro Asn Gly Thr Glu 130 135 140 Asn Asn Pro Lys Met Val Val Leu Gln Gly Val Ala Gly Ile Gly Lys 145 150 155 160 Thr Ile Leu Leu Lys Asn Leu Met Ile Val Trp Ser Glu Gly Leu Val 165 170 175 Phe Gln Asn Lys Phe Ser Tyr Ile Phe Tyr Phe Cys Cys His Asp Val 180 185 190 Lys Gln Leu Gln Thr Ala Ser Leu Ala Asp Leu Ile Ser Arg Glu Trp 195 200 205 Pro Ser Pro Ser Ala Pro Met Glu Glu Ile Leu Ser Gln Pro Glu Lys 210 215 220 Leu Leu Phe Ile Ile Asp Ser Leu Glu Gly Met Glu Trp Asn Val Thr 225 230 235 240 Gln Gln Asp Ser Gln Leu Cys Tyr Asn Cys Met Glu Lys Gln Pro Val 245 250 255 Asn Val Leu Leu Ser Ser Leu Leu Arg Lys Lys Ile Leu Pro Glu Ser 260 265 270 Ser Leu Leu Ile Ser Thr Ser Cys Glu Thr Phe Lys Asp Leu Lys Asp 275 280 285 Trp Ile Glu Tyr Thr Asn Val Arg Thr Ile Thr Gly Phe Lys Glu Asn 290 295 300 Asn Ile Asn Met Cys Phe His Ser Leu Phe Gln Asp Arg Asn Ile Ala 305 310 315 320 Gln Glu Ala Phe Ser Leu Ile Arg Glu Asn Glu Gln Leu Phe Thr Val 325 330 335 Cys Gln Ala Pro Val Val Cys Tyr Met Val Ala Thr Cys Leu Lys Asn 340 345 350 Glu Ile Glu Ser Gly Lys Asp Pro Val Ser Ile Cys Arg Arg Thr Thr 355 360 365 Ser Leu Tyr Thr Thr His Ile Leu Asn Leu Phe Ile Pro His Asn Ala 370 375 380 Gln Asn Pro Ser Asn Asn Ser Glu Asp Leu Leu Asp Asn Leu Cys Phe 385 390 395 400 Leu Ala Val Glu Gly Met Trp Thr Asp Ile Ser Val Phe Asn Glu Glu 405 410 415 Ala Leu Arg Arg Asn Gly Ile Met Asp Ser Asp Ile Pro Thr Leu Leu 420 425 430 Asp Ile Gly Ile Leu Glu Gln Ser Arg Glu Ser Glu Asn Ser Tyr Ile 435 440 445 Phe Leu His Pro Ser Val Gln Glu Phe Cys Ala Ala Met Phe Tyr Leu 450 455 460 Leu His Ser Glu Met Asp His Ser Cys Gln Gly Val Tyr Phe Ile Glu 465 470 475 480 Thr Phe Leu Phe Thr Phe Leu Asn Lys Ile Lys Lys Gln Trp Val Phe 485 490 495 Leu Gly Cys Phe Phe Phe Gly Leu Leu His Glu Thr Glu Gln Glu Lys 500 505 510 Leu Glu Ala Phe Phe Gly Tyr His Leu Ser Lys Glu Leu Arg Arg Gln 515 520 525 Leu Phe Leu Trp Leu Glu Leu Leu Leu Asp Thr Leu His Pro Asp Val 530 535 540 Lys Lys Ile Asn Thr Met Lys Phe Phe Tyr Cys Leu Phe Glu Met Glu 545 550 555 560 Glu Glu Val Phe Val Gln Ser Ala Met Asn Cys Arg Glu Gln Ile Asp 565 570 575 Val Val Val Lys Gly Tyr Ser Asp Phe Ile Val Ala Ala Tyr Cys Leu 580 585 590 Ser His Gly Ser Ala Leu 595 <210> SEQ ID NO 98 <211> LENGTH: 628 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 98 Met Ala Asp Ser Ser Ser Ser Ser Phe Phe Pro Asp Phe Gly Leu Leu 1 5 10 15 Leu Tyr Leu Glu Glu Leu Asn Lys Glu Glu Leu Asn Thr Phe Lys Leu 20 25 30 Phe Leu Lys Glu Thr Met Glu Pro Glu His Gly Leu Thr Pro Trp Asn 35 40 45 Glu Val Lys Lys Ala Arg Arg Glu Asp Leu Ala Asn Leu Met Lys Lys 50 55 60 Tyr Tyr Pro Gly Glu Lys Ala Trp Ser Val Ser Leu Lys Ile Phe Gly 65 70 75 80 Lys Met Asn Leu Lys Asp Leu Cys Glu Arg Ala Lys Glu Glu Ile Asn 85 90 95 Trp Ser Ala Gln Thr Ile Gly Pro Asp Asp Ala Lys Ala Gly Glu Thr 100 105 110 Gln Glu Asp Gln Glu Ala Val Leu Gly Asp Gly Thr Glu Tyr Arg Asn 115 120 125 Arg Ile Lys Glu Lys Phe Cys Ile Thr Trp Asp Lys Lys Ser Leu Ala 130 135 140 Gly Lys Pro Glu Asp Phe His His Gly Ile Ala Glu Lys Asp Arg Lys 145 150 155 160 Leu Leu Glu His Leu Phe Asp Val Asp Val Lys Thr Gly Ala Gln Pro 165 170 175 Gln Ile Val Val Leu Gln Gly Ala Ala Gly Val Gly Lys Thr Thr Leu 180 185 190 Val Arg Lys Ala Met Leu Asp Trp Ala Glu Gly Ser Leu Tyr Gln Gln 195 200 205 Arg Phe Lys Tyr Val Phe Tyr Leu Asn Gly Arg Glu Ile Asn Gln Leu 210 215 220 Lys Glu Arg Ser Phe Ala Gln Leu Ile Ser Lys Asp Trp Pro Ser Thr 225 230 235 240 Glu Gly Pro Ile Glu Glu Ile Met Tyr Gln Pro Ser Ser Leu Leu Phe 245 250 255 Ile Ile Asp Ser Phe Asp Glu Leu Asn Phe Ala Phe Glu Glu Pro Glu 260 265 270 Phe Ala Leu Cys Glu Asp Trp Thr Gln Glu His Pro Val Ser Phe Leu 275 280 285 Met Ser Ser Leu Leu Arg Lys Val Met Leu Pro Glu Ala Ser Leu Leu 290 295 300 Val Thr Thr Arg Leu Thr Thr Ser Lys Arg Leu Lys Gln Leu Leu Lys 305 310 315 320 Asn His His Tyr Val Glu Leu Leu Gly Met Ser Glu Asp Ala Arg Glu 325 330 335 Glu Tyr Ile Tyr Gln Phe Phe Glu Asp Lys Arg Trp Ala Met Lys Val 340 345 350 Phe Ser Ser Leu Lys Ser Asn Glu Met Leu Phe Ser Met Cys Gln Val 355 360 365 Pro Leu Val Cys Trp Ala Ala Cys Thr Cys Leu Lys Gln Gln Met Glu 370 375 380 Lys Gly Gly Asp Val Thr Leu Thr Cys Gln Thr Thr Thr Ala Leu Phe 385 390 395 400 Thr Cys Tyr Ile Ser Ser Leu Phe Thr Pro Val Asp Gly Gly Ser Pro 405 410 415 Ser Leu Pro Asn Gln Ala Gln Leu Arg Arg Leu Cys Gln Val Ala Ala 420 425 430 Lys Gly Ile Trp Thr Met Thr Tyr Val Phe Tyr Arg Glu Asn Leu Arg 435 440 445 Arg Leu Gly Leu Thr Gln Ser Asp Val Ser Ser Phe Met Asp Ser Asn 450 455 460 Ile Ile Gln Lys Asp Ala Glu Tyr Glu Asn Cys Tyr Val Phe Thr His 465 470 475 480 Leu His Val Gln Glu Phe Phe Ala Ala Met Phe Tyr Met Leu Lys Gly 485 490 495 Ser Trp Glu Ala Gly Asn Pro Ser Cys Gln Pro Phe Glu Asp Leu Lys 500 505 510 Ser Leu Leu Gln Ser Thr Ser Tyr Lys Asp Pro His Leu Thr Gln Met 515 520 525 Lys Cys Phe Leu Phe Gly Leu Leu Asn Glu Asp Arg Val Lys Gln Leu 530 535 540 Glu Arg Thr Phe Asn Cys Lys Met Ser Leu Lys Ile Lys Ser Lys Leu 545 550 555 560 Leu Gln Cys Met Glu Val Leu Gly Asn Ser Asp Tyr Ser Pro Ser Gln 565 570 575 Leu Gly Phe Leu Glu Leu Phe His Cys Leu Tyr Glu Thr Gln Asp Lys 580 585 590 Ala Phe Ile Ser Gln Ala Met Arg Cys Phe Pro Lys Val Ala Ile Asn 595 600 605 Ile Cys Glu Lys Ile His Leu Leu Val Ser Ser Phe Cys Leu Lys His 610 615 620 Cys Arg Cys Leu 625 <210> SEQ ID NO 99 <211> LENGTH: 599 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 99 Met Ala Ala Ser Phe Phe Ser Asp Phe Gly Leu Met Trp Tyr Leu Glu 1 5 10 15 Glu Leu Lys Lys Glu Glu Phe Arg Lys Phe Lys Glu His Leu Lys Gln 20 25 30 Met Thr Leu Gln Leu Glu Leu Lys Gln Ile Pro Trp Thr Glu Val Lys 35 40 45 Lys Ala Ser Arg Glu Glu Leu Ala Asn Leu Leu Ile Lys His Tyr Glu 50 55 60 Glu Gln Gln Ala Trp Asn Ile Thr Leu Arg Ile Phe Gln Lys Met Asp 65 70 75 80 Arg Lys Asp Leu Cys Met Lys Val Met Arg Glu Arg Thr Gly Tyr Thr 85 90 95 Lys Thr Tyr Gln Ala His Ala Lys Gln Lys Phe Ser Arg Leu Trp Ser 100 105 110 Ser Lys Ser Val Thr Glu Ile His Leu Tyr Phe Glu Glu Glu Val Lys 115 120 125 Gln Glu Glu Cys Asp His Leu Asp Arg Leu Phe Ala Pro Lys Glu Thr 130 135 140 Gly Lys Gln Pro Arg Thr Val Ile Ile Gln Gly Pro Gln Gly Ile Gly 145 150 155 160 Lys Thr Thr Leu Leu Met Lys Leu Met Met Ala Trp Ser Asp Asn Lys 165 170 175 Ile Phe Arg Asp Arg Phe Leu Tyr Thr Phe Tyr Phe Cys Cys Arg Glu 180 185 190 Leu Arg Glu Leu Pro Pro Thr Ser Leu Ala Asp Leu Ile Ser Arg Glu 195 200 205 Trp Pro Asp Pro Ala Ala Pro Ile Thr Glu Ile Val Ser Gln Pro Glu 210 215 220 Arg Leu Leu Phe Val Ile Asp Ser Phe Glu Glu Leu Gln Gly Gly Leu 225 230 235 240 Asn Glu Pro Asp Ser Asp Leu Cys Gly Asp Leu Met Glu Lys Arg Pro 245 250 255 Val Gln Val Leu Leu Ser Ser Leu Leu Arg Lys Lys Met Leu Pro Glu 260 265 270 Ala Ser Leu Leu Ile Ala Ile Lys Pro Val Cys Pro Lys Glu Leu Arg 275 280 285 Asp Gln Val Thr Ile Ser Glu Ile Tyr Gln Pro Arg Gly Phe Asn Glu 290 295 300 Ser Asp Arg Leu Val Tyr Phe Cys Cys Phe Phe Lys Asp Pro Lys Arg 305 310 315 320 Ala Met Glu Ala Phe Asn Leu Val Arg Glu Ser Glu Gln Leu Phe Ser 325 330 335 Ile Cys Gln Ile Pro Leu Leu Cys Trp Ile Leu Cys Thr Ser Leu Lys 340 345 350 Gln Glu Met Gln Lys Gly Lys Asp Leu Ala Leu Thr Cys Gln Ser Thr 355 360 365 Thr Ser Val Tyr Ser Ser Phe Val Phe Asn Leu Phe Thr Pro Glu Gly 370 375 380 Ala Glu Gly Pro Thr Pro Gln Thr Gln His Gln Leu Lys Ala Leu Cys 385 390 395 400 Ser Leu Ala Ala Glu Gly Met Trp Thr Asp Thr Phe Glu Phe Cys Glu 405 410 415 Asp Asp Leu Arg Arg Asn Gly Val Val Asp Ala Asp Ile Pro Ala Leu 420 425 430 Leu Gly Thr Lys Ile Leu Leu Lys Tyr Gly Glu Arg Glu Ser Ser Tyr 435 440 445 Val Phe Leu His Val Cys Ile Gln Glu Phe Cys Ala Ala Leu Phe Tyr 450 455 460 Leu Leu Lys Ser His Leu Asp His Pro His Pro Ala Val Arg Cys Val 465 470 475 480 Gln Glu Leu Leu Val Ala Asn Phe Glu Lys Ala Arg Arg Ala His Trp 485 490 495 Ile Phe Leu Gly Cys Phe Leu Thr Gly Leu Leu Asn Lys Lys Glu Gln 500 505 510 Glu Lys Leu Asp Ala Phe Phe Gly Phe Gln Leu Ser Gln Glu Ile Lys 515 520 525 Gln Gln Ile His Gln Cys Leu Lys Ser Leu Gly Glu Arg Gly Asn Pro 530 535 540 Gln Gly Gln Val Asp Ser Leu Ala Ile Phe Tyr Cys Leu Phe Glu Met 545 550 555 560 Gln Asp Pro Ala Phe Val Lys Gln Ala Val Asn Leu Leu Gln Glu Ala 565 570 575 Asn Phe His Ile Ile Asp Asn Val Asp Leu Val Val Ser Ala Tyr Cys 580 585 590 Leu Lys Tyr Cys Ser Ser Leu 595 <210> SEQ ID NO 100 <211> LENGTH: 629 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 100 Trp Thr Phe Ser Cys Tyr Pro Gly Ser Pro Cys Glu Asn Gly Val Met 1 5 10 15 Leu Tyr Met Arg Asn Val Ser His Glu Glu Leu Gln Arg Phe Lys Gln 20 25 30 Leu Leu Leu Thr Glu Leu Ser Thr Gly Thr Met Pro Ile Thr Trp Asp 35 40 45 Gln Val Glu Thr Ala Ser Trp Ala Glu Val Val His Leu Leu Ile Glu 50 55 60 Arg Phe Pro Gly Arg Arg Ala Trp Asp Val Thr Ser Asn Ile Phe Ala 65 70 75 80 Ile Met Asn Cys Asp Lys Met Cys Val Val Val Arg Arg Glu Ile Asn 85 90 95 Ala Ile Leu Pro Thr Leu Glu Pro Glu Asp Leu Asn Val Gly Glu Thr 100 105 110 Gln Val Asn Leu Glu Glu Gly Glu Ser Gly Lys Ile Arg Arg Tyr Lys 115 120 125 Ser Asn Val Met Glu Lys Phe Phe Pro Ile Trp Asp Ile Thr Thr Trp 130 135 140 Pro Gly Asn Gln Arg Asp Phe Phe Tyr Gln Gly Val His Arg His Glu 145 150 155 160 Glu Tyr Leu Pro Cys Leu Leu Leu Pro Lys Arg Pro Gln Gly Arg Gln 165 170 175 Pro Lys Thr Val Ala Ile Gln Gly Ala Pro Gly Ile Gly Lys Thr Ile 180 185 190 Leu Ala Lys Lys Val Met Phe Glu Trp Ala Arg Asn Lys Phe Tyr Ala 195 200 205 His Lys Arg Trp Cys Ala Phe Tyr Phe His Cys Gln Glu Val Asn Gln 210 215 220 Thr Thr Asp Gln Ser Phe Ser Glu Leu Ile Glu Gln Lys Trp Pro Gly 225 230 235 240 Ser Gln Asp Leu Val Ser Lys Ile Met Ser Lys Pro Asp Gln Leu Leu 245 250 255 Leu Leu Leu Asp Gly Phe Glu Glu Leu Thr Ser Thr Leu Ile Asp Arg 260 265 270 Leu Glu Asp Leu Ser Glu Asp Trp Arg Gln Lys Leu Pro Gly Ser Val 275 280 285 Leu Leu Ser Ser Leu Leu Ser Lys Thr Met Leu Pro Glu Ala Thr Leu 290 295 300 Leu Ile Met Ile Arg Phe Thr Ser Trp Gln Thr Cys Lys Pro Leu Leu 305 310 315 320 Lys Cys Pro Ser Leu Val Thr Leu Pro Gly Phe Asn Thr Met Glu Lys 325 330 335 Ile Lys Tyr Phe Gln Met Tyr Phe Gly His Thr Glu Glu Gly Asp Gln 340 345 350 Val Leu Ser Phe Ala Met Glu Asn Thr Ile Leu Phe Ser Met Cys Arg 355 360 365 Val Pro Val Val Cys Trp Met Val Cys Ser Gly Leu Lys Gln Gln Met 370 375 380 Glu Arg Gly Asn Asn Leu Thr Gln Ser Cys Pro Asn Ala Thr Ser Val 385 390 395 400 Phe Val Arg Tyr Ile Ser Ser Leu Phe Pro Thr Arg Ala Glu Asn Phe 405 410 415 Ser Arg Lys Ile His Gln Ala Gln Leu Glu Gly Leu Cys His Leu Ala 420 425 430 Ala Asp Ser Met Trp His Arg Lys Trp Val Leu Gly Lys Glu Asp Leu 435 440 445 Glu Glu Ala Lys Leu Asp Gln Thr Gly Val Thr Ala Phe Leu Gly Met 450 455 460 Ser Ile Leu Arg Arg Ile Ala Gly Glu Glu Asp His Tyr Val Phe Thr 465 470 475 480 Leu Val Thr Phe Gln Glu Phe Phe Ala Ala Leu Phe Tyr Val Leu Cys 485 490 495 Phe Pro Gln Arg Leu Lys Asn Phe His Val Leu Ser His Val Asn Ile 500 505 510 Gln Arg Leu Ile Ala Ser Pro Arg Gly Ser Lys Ser Tyr Leu Ser His 515 520 525 Met Gly Leu Phe Leu Phe Gly Phe Leu Asn Glu Ala Cys Ala Ser Ala 530 535 540 Val Glu Gln Ser Phe Gln Cys Lys Val Ser Phe Gly Asn Lys Arg Lys 545 550 555 560 Leu Leu Lys Val Ile Pro Leu Leu His Lys Cys Asp Pro Pro Ser Pro 565 570 575 Gly Ser Gly Val Pro Gln Leu Phe Tyr Cys Leu His Glu Ile Arg Glu 580 585 590 Glu Ala Phe Val Ser Gln Ala Leu Asn Asp Tyr His Lys Val Val Leu 595 600 605 Arg Ile Gly Asn Asn Lys Glu Val Gln Val Ser Ala Phe Cys Leu Lys 610 615 620 Arg Cys Gln Tyr Leu 625 <210> SEQ ID NO 101 <211> LENGTH: 662 <212> TYPE: PRT <213> ORGANISM: Homo sapiens <400> SEQUENCE: 101 Met Tyr Glu Phe Tyr Ile His Lys Gly Tyr Asp Asp Val Ser Ser Asp 1 5 10 15 Asn Ser Arg Glu Lys Ile Lys Gly Glu Pro Ser Glu Cys Glu Leu Gly 20 25 30 His Phe Pro Arg Ile Pro Trp Ala Asn Leu Arg Ala Ala Asp Pro Leu 35 40 45 Asn Leu Ser Phe Leu Leu Asp Glu His Phe Pro Lys Gly Gln Ala Trp 50 55 60 Lys Val Val Leu Gly Ile Phe Gln Thr Met Asn Leu Thr Ser Leu Cys 65 70 75 80 Glu Lys Val Arg Ala Glu Met Lys Glu Asn Val Gln Thr Gln Glu Leu 85 90 95 Gln Asp Pro Thr Gln Glu Asp Leu Glu Met Leu Glu Ala Ala Ala Gly 100 105 110 Asn Met Gln Thr Gln Gly Cys Gln Asp Pro Asn Gln Glu Glu Leu Asp 115 120 125 Glu Leu Glu Glu Glu Thr Gly Asn Val Gln Ala Gln Gly Cys Gln Asp 130 135 140 Pro Asn Gln Glu Glu Pro Glu Met Leu Glu Glu Ala Asp His Arg Arg 145 150 155 160 Lys Tyr Arg Glu Asn Met Lys Ala Glu Leu Leu Glu Thr Trp Asp Asn 165 170 175 Ile Ser Trp Pro Lys Asp His Val Tyr Ile Arg Asn Thr Ser Lys Asp 180 185 190 Glu His Glu Glu Leu Gln Arg Leu Leu Asp Pro Asn Arg Thr Arg Ala 195 200 205 Gln Ala Gln Thr Ile Val Leu Val Gly Arg Ala Gly Val Gly Lys Thr 210 215 220 Thr Leu Ala Met Arg Ala Met Leu His Trp Ala Asn Gly Val Leu Phe 225 230 235 240 Gln Gln Arg Phe Ser Tyr Val Phe Tyr Leu Ser Cys His Lys Ile Arg 245 250 255 Tyr Met Lys Glu Thr Thr Phe Ala Glu Leu Ile Ser Leu Asp Trp Pro 260 265 270 Asp Phe Asp Ala Pro Ile Glu Glu Phe Met Ser Gln Pro Glu Lys Leu 275 280 285 Leu Phe Ile Ile Asp Gly Phe Glu Glu Ile Ile Ile Ser Glu Ser Arg 290 295 300 Ser Glu Ser Leu Asp Asp Gly Ser Pro Cys Thr Asp Trp Tyr Gln Glu 305 310 315 320 Leu Pro Val Thr Lys Ile Leu His Ser Leu Leu Lys Lys Glu Leu Val 325 330 335 Pro Leu Ala Thr Leu Leu Ile Thr Ile Lys Thr Trp Phe Val Arg Asp 340 345 350 Leu Lys Ala Ser Leu Val Asn Pro Cys Phe Val Gln Ile Thr Gly Phe 355 360 365 Thr Gly Asp Asp Leu Arg Val Tyr Phe Met Arg His Phe Asp Asp Ser 370 375 380 Ser Glu Val Glu Lys Ile Leu Gln Gln Leu Arg Lys Asn Glu Thr Leu 385 390 395 400 Phe His Ser Cys Ser Ala Pro Met Val Cys Trp Thr Val Cys Ser Cys 405 410 415 Leu Lys Gln Pro Lys Val Arg Tyr Tyr Asp Leu Gln Ser Ile Thr Gln 420 425 430 Thr Thr Thr Ser Leu Tyr Ala Tyr Phe Phe Ser Asn Leu Phe Ser Thr 435 440 445 Ala Glu Val Asp Leu Ala Asp Asp Ser Trp Pro Gly Gln Trp Arg Ala 450 455 460 Leu Cys Ser Leu Ala Ile Glu Gly Leu Trp Ser Met Asn Phe Thr Phe 465 470 475 480 Asn Lys Glu Asp Thr Glu Ile Glu Gly Leu Glu Val Pro Phe Ile Asp 485 490 495 Ser Leu Tyr Glu Phe Asn Ile Leu Gln Lys Ile Asn Asp Cys Gly Gly 500 505 510 Cys Thr Thr Phe Thr His Leu Ser Phe Gln Glu Phe Phe Ala Ala Met 515 520 525 Ser Phe Val Leu Glu Glu Pro Arg Glu Phe Pro Pro His Ser Thr Lys 530 535 540 Pro Gln Glu Met Lys Met Leu Leu Gln His Val Leu Leu Asp Lys Glu 545 550 555 560 Ala Tyr Trp Thr Pro Val Val Leu Phe Phe Phe Gly Leu Leu Asn Lys 565 570 575 Asn Ile Ala Arg Glu Leu Glu Asp Thr Leu His Cys Lys Ile Ser Pro 580 585 590 Arg Val Met Glu Glu Leu Leu Lys Trp Gly Glu Glu Leu Gly Lys Ala 595 600 605 Glu Ser Ala Ser Leu Gln Phe His Ile Leu Arg Leu Phe His Cys Leu 610 615 620 His Glu Ser Gln Glu Glu Asp Phe Thr Lys Lys Met Leu Gly Arg Ile 625 630 635 640 Phe Glu Val Asp Leu Asn Ile Leu Glu Asp Glu Glu Leu Gln Ala Leu 645 650 655 Lys His Cys Lys Arg Leu 660 <210> SEQ ID NO 102 <211> LENGTH: 322 <212> TYPE: PRT <213> ORGANISM: ascidian <400> SEQUENCE: 102 Thr Val Trp Val Val Gly Pro Pro Gly Val Gly Lys Thr Thr Leu Leu 1 5 10 15 Lys Met Met Val Lys Gln Ile Leu Lys His Glu Phe Leu Pro Asp Thr 20 25 30 Glu Tyr Ile Phe Phe Ile Asn Val Lys Asp Ile Asp Phe Asn Lys Glu 35 40 45 Met Thr Leu Leu Glu Phe Leu Thr Thr Asn Ser Arg Val Lys Val Asn 50 55 60 Tyr Thr Glu Glu Glu Ser Lys Ala Leu Ile Thr Phe Leu His Asn Asn 65 70 75 80 Pro Asn Val Ala Ile Phe Phe Asp Gly Leu Asp Glu Ala Ser Thr Asn 85 90 95 Glu Phe Ala Arg Ile Pro His Ile Cys Lys Leu Asp Gly Lys Ser Lys 100 105 110 Pro Val Asp Ile Met Lys Asn Leu Phe Asn Leu Thr Leu Leu Pro Lys 115 120 125 Ala Lys Ile Val Val Thr Ser Thr Leu His Gln Met Tyr Lys Leu His 130 135 140 Pro Asp Tyr Arg Pro Thr Ser Ile Phe Glu Val Leu Gly Leu Leu Glu 145 150 155 160 Glu Ala Lys Asn Asn Leu Gly Thr Gln Leu Cys Gly Glu Lys Tyr Pro 165 170 175 Ala Ile Lys Lys Ile Leu Asp Gln Gln Pro Asn Leu Ala His Leu Cys 180 185 190 Tyr Leu Pro Ile Asn Phe Ile Leu Ile Val Phe Cys Leu Leu Ser Asn 195 200 205 Glu Gly Ser Asp Ile Lys Thr Met Thr Gln Val Leu Ile Phe Ser Met 210 215 220 Thr Arg Phe Val Glu Leu Ser His Leu Lys Gly Glu Val Pro Leu Asp 225 230 235 240 Lys Val Gly Ala Glu Met Val Lys Leu Ala Arg Leu Ala Tyr Lys Gly 245 250 255 Leu Gln Gln Arg Lys Leu Val Phe Glu Lys Thr Asp Phe Asp Asp Val 260 265 270 Lys Leu Ala Asp Glu Met Val Thr Asn Phe Phe His Thr Tyr Val Asp 275 280 285 Lys Ser Ser Gly Ile Arg Met Lys Ile Leu Glu Gly Asn Lys Arg Ser 290 295 300 Tyr Phe Thr His Leu Ile Trp Gln Glu Phe Tyr Ala Ala Val Tyr Leu 305 310 315 320 Met Leu <210> SEQ ID NO 103 <211> LENGTH: 82 <212> TYPE: PRT <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic construct <400> SEQUENCE: 103 Phe Gly Leu Met Trp Tyr Leu Glu Glu Leu Lys Lys Glu Glu Phe Arg 1 5 10 15 Lys Phe Lys Glu His Leu Lys Gln Met Thr Leu Gln Leu Glu Leu Lys 20 25 30 Gln Ile Pro Trp Thr Glu Val Lys Lys Ala Ser Arg Glu Glu Leu Ala 35 40 45 Asn Leu Leu Ile Lys His Tyr Glu Glu Gln Gln Ala Trp Asn Ile Thr 50 55 60 Leu Arg Ile Phe Gln Lys Met Asp Arg Lys Asp Leu Cys Met Lys Val 65 70 75 80 Met Arg <210> SEQ ID NO 104 <211> LENGTH: 321 <212> TYPE: PRT <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic construct <400> SEQUENCE: 104 Pro Arg Thr Val Ile Ile Gln Gly Pro Gln Gly Ile Gly Lys Thr Thr 1 5 10 15 Leu Leu Met Lys Leu Met Met Ala Trp Ser Asp Asn Lys Ile Phe Arg 20 25 30 Asp Arg Phe Leu Tyr Thr Phe Tyr Phe Cys Cys Arg Glu Leu Arg Glu 35 40 45 Leu Pro Pro Thr Ser Leu Ala Asp Leu Ile Ser Arg Glu Trp Pro Asp 50 55 60 Pro Ala Ala Pro Ile Thr Glu Ile Val Ser Gln Pro Glu Arg Leu Leu 65 70 75 80 Phe Val Ile Asp Ser Phe Glu Glu Leu Gln Gly Gly Leu Asn Glu Pro 85 90 95 Asp Ser Asp Leu Cys Gly Asp Leu Met Glu Lys Arg Pro Val Gln Val 100 105 110 Leu Leu Ser Ser Leu Leu Arg Lys Lys Met Leu Pro Glu Ala Ser Leu 115 120 125 Leu Ile Ala Ile Lys Pro Val Cys Pro Lys Glu Leu Arg Asp Gln Val 130 135 140 Thr Ile Ser Glu Ile Tyr Gln Pro Arg Gly Phe Asn Glu Ser Asp Arg 145 150 155 160 Leu Val Tyr Phe Cys Cys Phe Phe Lys Asp Pro Lys Arg Ala Met Glu 165 170 175 Ala Phe Asn Leu Val Arg Glu Ser Glu Gln Leu Phe Ser Ile Cys Gln 180 185 190 Ile Pro Leu Leu Cys Trp Ile Leu Cys Thr Ser Leu Lys Gln Glu Met 195 200 205 Gln Lys Gly Lys Asp Leu Ala Leu Thr Cys Gln Ser Thr Thr Ser Val 210 215 220 Tyr Ser Ser Phe Val Phe Asn Leu Phe Thr Pro Glu Gly Ala Glu Gly 225 230 235 240 Pro Thr Pro Gln Thr Gln His Gln Leu Lys Ala Leu Cys Ser Leu Ala 245 250 255 Ala Glu Gly Met Trp Thr Asp Thr Phe Glu Phe Cys Glu Asp Asp Leu 260 265 270 Arg Arg Asn Gly Val Val Asp Ala Asp Ile Pro Ala Leu Leu Gly Thr 275 280 285 Lys Ile Leu Leu Lys Tyr Gly Glu Arg Glu Ser Ser Tyr Val Phe Leu 290 295 300 His Val Cys Ile Gln Glu Phe Cys Ala Ala Leu Phe Tyr Leu Leu Lys 305 310 315 320 Ser <210> SEQ ID NO 105 <211> LENGTH: 116 <212> TYPE: PRT <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic construct <400> SEQUENCE: 105 Leu Val Ala Asn Phe Glu Lys Ala Arg Arg Ala His Trp Ile Phe Leu 1 5 10 15 Gly Cys Phe Leu Thr Gly Leu Leu Asn Lys Lys Glu Gln Glu Lys Leu 20 25 30 Asp Ala Phe Phe Gly Phe Gln Leu Ser Gln Glu Ile Lys Gln Gln Ile 35 40 45 His Gln Cys Leu Lys Ser Leu Gly Glu Arg Gly Asn Pro Gln Gly Gln 50 55 60 Val Asp Ser Leu Ala Ile Phe Tyr Cys Leu Phe Glu Met Gln Asp Pro 65 70 75 80 Ala Phe Val Lys Gln Ala Val Asn Leu Leu Gln Glu Ala Asn Phe His 85 90 95 Ile Ile Asp Asn Val Asp Leu Val Val Ser Ala Tyr Cys Leu Lys Tyr 100 105 110 Cys Ser Ser Leu 115 <210> SEQ ID NO 106 <211> LENGTH: 81 <212> TYPE: PRT <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic construct <400> SEQUENCE: 106 Arg Glu Leu Leu Leu Ala Ala Leu Glu Glu Leu Ser Gln Glu Gln Leu 1 5 10 15 Lys Arg Phe Arg His Lys Leu Arg Asp Val Gly Pro Asp Gly Arg Ser 20 25 30 Ile Pro Trp Gly Arg Leu Glu Arg Ala Asp Ala Val Asp Leu Ala Glu 35 40 45 Gln Leu Ala Gln Phe Tyr Gly Pro Glu Pro Ala Leu Glu Val Ala Arg 50 55 60 Lys Thr Leu Lys Arg Ala Asp Ala Arg Asp Val Ala Ala Gln Leu Gln 65 70 75 80 Glu <210> SEQ ID NO 107 <211> LENGTH: 321 <212> TYPE: PRT <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic construct <400> SEQUENCE: 107 Pro Leu Thr Val Val Leu Gln Gly Pro Ala Gly Ile Gly Lys Thr Met 1 5 10 15 Ala Ala Lys Lys Ile Leu Tyr Asp Trp Ala Ala Gly Lys Leu Tyr Gln 20 25 30 Gly Gln Val Asp Phe Ala Phe Phe Met Pro Cys Gly Glu Leu Leu Glu 35 40 45 Arg Pro Gly Thr Arg Ser Leu Ala Asp Leu Ile Leu Asp Gln Cys Pro 50 55 60 Asp Arg Gly Ala Pro Val Pro Gln Met Leu Ala Gln Pro Gln Arg Leu 65 70 75 80 Leu Phe Ile Leu Asp Gly Ala Asp Glu Leu Pro Ala Leu Gly Gly Pro 85 90 95 Glu Ala Ala Pro Cys Thr Asp Pro Phe Glu Ala Ala Ser Gly Ala Arg 100 105 110 Val Leu Gly Gly Leu Leu Ser Lys Ala Leu Leu Pro Thr Ala Leu Leu 115 120 125 Leu Val Thr Thr Arg Ala Ala Ala Pro Gly Arg Leu Gln Gly Arg Leu 130 135 140 Cys Ser Pro Gln Cys Ala Glu Val Arg Gly Phe Ser Asp Lys Asp Lys 145 150 155 160 Lys Lys Tyr Phe Tyr Lys Phe Phe Arg Asp Glu Arg Arg Ala Glu Arg 165 170 175 Ala Tyr Arg Phe Val Lys Glu Asn Glu Thr Leu Phe Ala Leu Cys Phe 180 185 190 Val Pro Phe Val Cys Trp Ile Val Cys Thr Val Leu Arg Gln Gln Leu 195 200 205 Glu Leu Gly Arg Asp Leu Ser Arg Thr Ser Lys Thr Thr Thr Ser Val 210 215 220 Tyr Leu Leu Phe Ile Thr Ser Val Leu Ser Ser Ala Pro Val Ala Asp 225 230 235 240 Gly Pro Arg Leu Gln Gly Asp Leu Arg Asn Leu Cys Arg Leu Ala Arg 245 250 255 Glu Gly Val Leu Gly Arg Arg Ala Gln Phe Ala Glu Lys Glu Leu Glu 260 265 270 Gln Leu Glu Leu Arg Gly Ser Lys Val Gln Thr Leu Phe Leu Ser Lys 275 280 285 Lys Glu Leu Pro Gly Val Leu Glu Thr Glu Val Thr Tyr Gln Phe Ile 290 295 300 Asp Gln Ser Phe Gln Glu Phe Leu Ala Ala Leu Ser Tyr Leu Leu Glu 305 310 315 320 Asp <210> SEQ ID NO 108 <211> LENGTH: 138 <212> TYPE: PRT <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic construct <400> SEQUENCE: 108 Leu Leu Arg Gly Asp Ala Gln Pro His Ser His Leu Val Leu Thr Thr 1 5 10 15 Arg Phe Leu Phe Gly Leu Leu Ser Ala Glu Arg Met Arg Asp Ile Glu 20 25 30 Arg His Phe Gly Cys Met Val Ser Glu Arg Val Lys Gln Glu Ala Leu 35 40 45 Arg Trp Val Gln Gly Gln Gly Gln Gly Cys Pro Gly Val Ala Pro Glu 50 55 60 Val Thr Glu Gly Ala Lys Gly Leu Glu Asp Thr Glu Glu Pro Glu Glu 65 70 75 80 Glu Glu Glu Gly Glu Glu Pro Asn Tyr Pro Leu Glu Leu Leu Tyr Cys 85 90 95 Leu Tyr Glu Thr Gln Glu Asp Ala Phe Val Arg Gln Ala Leu Cys Arg 100 105 110 Phe Pro Glu Leu Ala Leu Gln Arg Val Arg Phe Cys Arg Met Asp Val 115 120 125 Ala Val Leu Ser Tyr Cys Val Arg Cys Cys 130 135 <210> SEQ ID NO 109 <211> LENGTH: 82 <212> TYPE: PRT <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic construct <400> SEQUENCE: 109 Glu Asn Gly Val Met Leu Tyr Met Arg Asn Val Ser His Glu Glu Leu 1 5 10 15 Gln Arg Phe Lys Gln Leu Leu Leu Thr Glu Leu Ser Thr Gly Thr Met 20 25 30 Pro Ile Thr Trp Asp Gln Val Glu Thr Ala Ser Trp Ala Glu Val Val 35 40 45 His Leu Leu Ile Glu Arg Phe Pro Gly Arg Arg Ala Trp Asp Val Thr 50 55 60 Ser Asn Ile Phe Ala Ile Met Asn Cys Asp Lys Met Cys Val Val Val 65 70 75 80 Arg Arg <210> SEQ ID NO 110 <211> LENGTH: 321 <212> TYPE: PRT <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic construct <400> SEQUENCE: 110 Pro Lys Thr Val Ala Ile Gln Gly Ala Pro Gly Ile Gly Lys Thr Ile 1 5 10 15 Leu Ala Lys Lys Val Met Phe Glu Trp Ala Arg Asn Lys Phe Tyr Ala 20 25 30 His Lys Arg Trp Cys Ala Phe Tyr Phe His Cys Gln Glu Val Asn Gln 35 40 45 Thr Thr Asp Gln Ser Phe Ser Glu Leu Ile Glu Gln Lys Trp Pro Gly 50 55 60 Ser Gln Asp Leu Val Ser Lys Ile Met Ser Lys Pro Asp Gln Leu Leu 65 70 75 80 Leu Leu Leu Asp Gly Phe Glu Glu Leu Thr Ser Thr Leu Ile Asp Arg 85 90 95 Leu Glu Asp Leu Ser Glu Asp Trp Arg Gln Lys Leu Pro Gly Ser Val 100 105 110 Leu Leu Ser Ser Leu Leu Ser Lys Thr Met Leu Pro Glu Ala Thr Leu 115 120 125 Leu Ile Met Ile Arg Phe Thr Ser Trp Gln Thr Cys Lys Pro Leu Leu 130 135 140 Lys Cys Pro Ser Leu Val Thr Leu Pro Gly Phe Asn Thr Met Glu Lys 145 150 155 160 Ile Lys Tyr Phe Gln Met Tyr Phe Gly His Thr Glu Glu Gly Asp Gln 165 170 175 Val Leu Ser Phe Ala Met Glu Asn Thr Ile Leu Phe Ser Met Cys Arg 180 185 190 Val Pro Val Val Cys Trp Met Val Cys Ser Gly Leu Lys Gln Gln Met 195 200 205 Glu Arg Gly Asn Asn Leu Thr Gln Ser Cys Pro Asn Ala Thr Ser Val 210 215 220 Phe Val Arg Tyr Ile Ser Ser Leu Phe Pro Thr Arg Ala Glu Asn Phe 225 230 235 240 Ser Arg Lys Ile His Gln Ala Gln Leu Glu Gly Leu Cys His Leu Ala 245 250 255 Ala Asp Ser Met Trp His Arg Lys Trp Val Leu Gly Lys Glu Asp Leu 260 265 270 Glu Glu Ala Lys Leu Asp Gln Thr Gly Val Thr Ala Phe Leu Gly Met 275 280 285 Ser Ile Leu Arg Arg Ile Ala Gly Glu Glu Asp His Tyr Val Phe Thr 290 295 300 Leu Val Thr Phe Gln Glu Phe Phe Ala Ala Leu Phe Tyr Val Leu Cys 305 310 315 320 Phe <210> SEQ ID NO 111 <211> LENGTH: 115 <212> TYPE: PRT <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic construct <400> SEQUENCE: 111 Leu Ile Ala Ser Pro Arg Gly Ser Lys Ser Tyr Leu Ser His Met Gly 1 5 10 15 Leu Phe Leu Phe Gly Phe Leu Asn Glu Ala Cys Ala Ser Ala Val Glu 20 25 30 Gln Ser Phe Gln Cys Lys Val Ser Phe Gly Asn Lys Arg Lys Leu Leu 35 40 45 Lys Val Ile Pro Leu Leu His Lys Cys Asp Pro Pro Ser Pro Gly Ser 50 55 60 Gly Val Pro Gln Leu Phe Tyr Cys Leu His Glu Ile Arg Glu Glu Ala 65 70 75 80 Phe Val Ser Gln Ala Leu Asn Asp Tyr His Lys Val Val Leu Arg Ile 85 90 95 Gly Asn Asn Lys Glu Val Gln Val Ser Ala Phe Cys Leu Lys Arg Cys 100 105 110 Gln Tyr Leu 115 <210> SEQ ID NO 112 <211> LENGTH: 82 <212> TYPE: PRT <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic construct <400> SEQUENCE: 112 Arg Glu Ala Leu Leu Trp Ala Leu Ser Asp Leu Glu Glu Asn Asp Phe 1 5 10 15 Lys Lys Leu Lys Phe Tyr Leu Arg Asp Met Thr Leu Ser Glu Gly Gln 20 25 30 Pro Pro Leu Ala Arg Gly Glu Leu Glu Gly Leu Ile Pro Val Asp Leu 35 40 45 Ala Glu Leu Leu Ile Ser Lys Tyr Gly Glu Lys Glu Ala Val Lys Val 50 55 60 Val Leu Lys Gly Leu Lys Val Met Asn Leu Leu Glu Leu Val Asp Gln 65 70 75 80 Leu Ser <210> SEQ ID NO 113 <211> LENGTH: 317 <212> TYPE: PRT <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic construct <400> SEQUENCE: 113 Pro Ser Leu Val Val Leu Gln Gly Ser Ala Gly Thr Gly Lys Thr Thr 1 5 10 15 Leu Ala Arg Lys Met Val Leu Asp Trp Ala Thr Gly Thr Leu Tyr Pro 20 25 30 Gly Arg Phe Asp Tyr Val Phe Tyr Val Ser Cys Lys Glu Val Val Leu 35 40 45 Leu Leu Glu Ser Lys Leu Glu Gln Leu Leu Phe Trp Cys Cys Gly Asp 50 55 60 Asn Gln Ala Pro Val Thr Glu Ile Leu Arg Gln Pro Glu Arg Leu Leu 65 70 75 80 Phe Ile Leu Asp Gly Phe Asp Glu Leu Gln Arg Pro Phe Glu Glu Lys 85 90 95 Leu Lys Lys Arg Gly Leu Ser Pro Lys Glu Ser Leu Leu His Leu Leu 100 105 110 Ile Arg Arg His Thr Leu Pro Thr Cys Ser Leu Leu Ile Thr Thr Arg 115 120 125 Pro Leu Ala Leu Arg Asn Leu Glu Pro Leu Leu Lys Gln Ala Arg His 130 135 140 Val His Ile Leu Gly Phe Ser Glu Glu Glu Arg Ala Arg Tyr Phe Ser 145 150 155 160 Ser Tyr Phe Thr Asp Glu Lys Gln Ala Asp Arg Ala Phe Asp Ile Val 165 170 175 Gln Lys Asn Asp Ile Leu Tyr Lys Ala Cys Gln Val Pro Gly Ile Cys 180 185 190 Trp Val Val Cys Ser Trp Leu Gln Gly Gln Met Glu Arg Gly Lys Val 195 200 205 Val Leu Glu Thr Pro Arg Asn Ser Thr Asp Ile Phe Met Ala Tyr Val 210 215 220 Ser Thr Phe Leu Pro Pro Asp Asp Asp Gly Gly Cys Ser Glu Leu Ser 225 230 235 240 Arg His Arg Val Leu Arg Ser Leu Cys Ser Leu Ala Ala Glu Gly Ile 245 250 255 Gln His Gln Arg Phe Leu Phe Glu Glu Ala Glu Leu Arg Lys His Asn 260 265 270 Leu Asp Gly Pro Arg Leu Ala Ala Phe Leu Ser Ser Asn Asp Tyr Gln 275 280 285 Leu Gly Leu Ala Ile Lys Lys Phe Tyr Ser Phe Arg His Ile Ser Phe 290 295 300 Gln Asp Phe Phe His Ala Met Ser Tyr Leu Val Lys Glu 305 310 315 <210> SEQ ID NO 114 <211> LENGTH: 93 <212> TYPE: PRT <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic construct <400> SEQUENCE: 114 Leu Leu Glu Val Lys Glu Gln Glu Gly Asn Asp Glu Met Thr Leu Thr 1 5 10 15 Met Gln Phe Leu Leu Asp Ile Ser Lys Lys Asp Ser Phe Ser Asn Leu 20 25 30 Glu Leu Lys Phe Cys Phe Arg Ile Ser Pro Cys Leu Ala Gln Asp Leu 35 40 45 Lys His Phe Lys Glu Gln Met Glu Ser Met Lys His Asn Arg Thr Trp 50 55 60 Asp Leu Glu Phe Ser Leu Tyr Glu Ala Lys Ile Lys Asn Leu Val Lys 65 70 75 80 Gly Ile Gln Met Asn Asn Val Ser Phe Lys Ile Lys His 85 90 <210> SEQ ID NO 115 <211> LENGTH: 82 <212> TYPE: PRT <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic construct <400> SEQUENCE: 115 Leu Cys Arg Leu Ser Thr Tyr Leu Glu Glu Leu Glu Ala Val Glu Leu 1 5 10 15 Lys Lys Phe Lys Leu Tyr Leu Gly Thr Ala Thr Glu Leu Gly Glu Gly 20 25 30 Lys Ile Pro Trp Gly Ser Met Glu Lys Ala Gly Pro Leu Glu Met Ala 35 40 45 Gln Leu Leu Ile Thr His Phe Gly Pro Glu Glu Ala Trp Arg Leu Ala 50 55 60 Leu Ser Thr Phe Glu Arg Ile Asn Arg Lys Asp Leu Trp Glu Arg Gly 65 70 75 80 Gln Arg <210> SEQ ID NO 116 <211> LENGTH: 321 <212> TYPE: PRT <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic construct <400> SEQUENCE: 116 Pro Arg Thr Val Val Met Gln Gly Ala Ala Gly Ile Gly Lys Ser Met 1 5 10 15 Leu Ala His Lys Val Met Leu Asp Trp Ala Asp Gly Lys Leu Phe Gln 20 25 30 Gly Arg Phe Asp Tyr Leu Phe Tyr Ile Asn Cys Arg Glu Met Asn Gln 35 40 45 Ser Ala Thr Glu Cys Ser Met Gln Asp Leu Ile Phe Ser Cys Trp Pro 50 55 60 Glu Pro Ser Ala Pro Leu Gln Glu Leu Ile Arg Val Pro Glu Arg Leu 65 70 75 80 Leu Phe Ile Ile Asp Gly Phe Asp Glu Leu Lys Pro Ser Phe His Asp 85 90 95 Pro Gln Gly Pro Trp Cys Leu Cys Trp Glu Glu Lys Arg Pro Thr Glu 100 105 110 Leu Leu Leu Asn Ser Leu Ile Arg Lys Lys Leu Leu Pro Glu Leu Ser 115 120 125 Leu Leu Ile Thr Thr Arg Pro Thr Ala Leu Glu Lys Leu His Arg Leu 130 135 140 Leu Glu His Pro Arg His Val Glu Ile Leu Gly Phe Ser Glu Ala Glu 145 150 155 160 Arg Lys Glu Tyr Phe Tyr Lys Tyr Phe His Asn Ala Glu Gln Ala Gly 165 170 175 Gln Val Phe Asn Tyr Val Arg Asp Asn Glu Pro Leu Phe Thr Met Cys 180 185 190 Phe Val Pro Leu Val Cys Trp Val Val Cys Thr Cys Leu Gln Gln Gln 195 200 205 Leu Glu Gly Gly Gly Leu Leu Arg Gln Thr Ser Arg Thr Thr Thr Ala 210 215 220 Val Tyr Met Leu Tyr Leu Leu Ser Leu Met Gln Pro Lys Pro Gly Ala 225 230 235 240 Pro Arg Leu Gln Pro Pro Pro Asn Gln Arg Gly Leu Cys Ser Leu Ala 245 250 255 Ala Asp Gly Leu Trp Asn Gln Lys Ile Leu Phe Glu Glu Gln Asp Leu 260 265 270 Arg Lys His Gly Leu Asp Gly Glu Asp Val Ser Ala Phe Leu Asn Met 275 280 285 Asn Ile Phe Gln Lys Asp Ile Asn Cys Glu Arg Tyr Tyr Ser Phe Ile 290 295 300 His Leu Ser Phe Gln Glu Phe Phe Ala Ala Met Tyr Tyr Ile Leu Asp 305 310 315 320 Glu <210> SEQ ID NO 117 <211> LENGTH: 119 <212> TYPE: PRT <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic construct <400> SEQUENCE: 117 Leu Leu Thr Glu Tyr Ala Phe Ser Glu Arg Ser Phe Leu Ala Leu Thr 1 5 10 15 Ser Arg Phe Leu Phe Gly Leu Leu Asn Glu Glu Thr Arg Ser His Leu 20 25 30 Glu Lys Ser Leu Cys Trp Lys Val Ser Pro His Ile Lys Met Asp Leu 35 40 45 Leu Gln Trp Ile Gln Ser Lys Ala Gln Ser Asp Gly Ser Thr Leu Gln 50 55 60 Gln Gly Ser Leu Glu Phe Phe Ser Cys Leu Tyr Glu Ile Gln Glu Glu 65 70 75 80 Glu Phe Ile Gln Gln Ala Leu Ser His Phe Gln Val Ile Val Val Ser 85 90 95 Asn Ile Ala Ser Lys Met Glu His Met Val Ser Ser Phe Cys Leu Lys 100 105 110 Arg Cys Arg Ser Ala Gln Val 115 <210> SEQ ID NO 118 <211> LENGTH: 83 <212> TYPE: PRT <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic construct <400> SEQUENCE: 118 Glu Trp Thr Leu Gln Thr Leu Leu Glu Gln Leu Asn Glu Asp Glu Leu 1 5 10 15 Lys Ser Phe Lys Ser Leu Leu Trp Ala Phe Pro Leu Glu Asp Val Leu 20 25 30 Gln Lys Thr Pro Trp Ser Glu Val Glu Glu Ala Asp Gly Lys Lys Leu 35 40 45 Ala Glu Ile Leu Val Asn Thr Ser Ser Glu Asn Trp Ile Arg Asn Ala 50 55 60 Thr Val Asn Ile Leu Glu Glu Met Asn Leu Thr Glu Leu Cys Lys Met 65 70 75 80 Ala Lys Ala <210> SEQ ID NO 119 <211> LENGTH: 314 <212> TYPE: PRT <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic construct <400> SEQUENCE: 119 Pro Tyr Thr Val Val Leu His Gly Pro Ala Gly Val Gly Lys Thr Thr 1 5 10 15 Leu Ala Lys Lys Cys Met Leu Asp Trp Thr Asp Cys Asn Leu Ser Pro 20 25 30 Thr Leu Arg Tyr Ala Phe Tyr Leu Ser Cys Lys Glu Leu Ser Arg Met 35 40 45 Gly Pro Cys Ser Phe Ala Glu Leu Ile Ser Lys Asp Trp Pro Glu Leu 50 55 60 Gln Asp Asp Ile Pro Ser Ile Leu Ala Gln Ala Gln Arg Ile Leu Phe 65 70 75 80 Val Val Asp Gly Leu Asp Glu Leu Lys Val Pro Pro Gly Ala Leu Ile 85 90 95 Gln Asp Ile Cys Gly Asp Trp Glu Lys Lys Lys Pro Val Pro Val Leu 100 105 110 Leu Gly Ser Leu Leu Lys Arg Lys Met Leu Pro Arg Ala Ala Leu Leu 115 120 125 Val Thr Thr Arg Pro Arg Ala Leu Arg Asp Leu Gln Leu Leu Ala Gln 130 135 140 Gln Pro Ile Tyr Val Arg Val Glu Gly Phe Leu Glu Glu Asp Arg Arg 145 150 155 160 Ala Tyr Phe Leu Arg His Phe Gly Asp Glu Asp Gln Ala Met Arg Ala 165 170 175 Phe Glu Leu Met Arg Ser Asn Ala Ala Leu Phe Gln Leu Gly Ser Ala 180 185 190 Pro Ala Val Cys Trp Ile Val Cys Thr Thr Leu Lys Leu Gln Met Glu 195 200 205 Lys Gly Glu Asp Pro Val Pro Thr Cys Leu Thr Arg Thr Gly Leu Phe 210 215 220 Leu Arg Phe Leu Cys Ser Arg Phe Pro Gln Gly Ala Gln Leu Arg Gly 225 230 235 240 Ala Leu Arg Thr Leu Ser Leu Leu Ala Ala Gln Gly Leu Trp Ala Gln 245 250 255 Met Ser Val Phe His Arg Glu Asp Leu Glu Arg Leu Gly Val Gln Glu 260 265 270 Ser Asp Leu Arg Leu Phe Leu Asp Gly Asp Ile Leu Arg Gln Asp Arg 275 280 285 Val Ser Lys Gly Cys Tyr Ser Phe Ile His Leu Ser Phe Gln Gln Phe 290 295 300 Leu Thr Ala Leu Phe Tyr Ala Leu Glu Lys 305 310 <210> SEQ ID NO 120 <211> LENGTH: 115 <212> TYPE: PRT <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic construct <400> SEQUENCE: 120 Leu Leu Ser Gly Glu Glu Arg Leu Lys Asn Pro Asp Leu Ile Gln Val 1 5 10 15 Gly His Phe Leu Phe Gly Leu Ala Asn Glu Lys Arg Ala Lys Glu Leu 20 25 30 Glu Ala Thr Phe Gly Cys Arg Met Ser Pro Asp Ile Lys Gln Glu Leu 35 40 45 Leu Gln Cys Lys Ala His Leu His Ala Asn Lys Pro Leu Ser Val Thr 50 55 60 Asp Leu Lys Glu Val Leu Gly Cys Leu Tyr Glu Ser Gln Glu Glu Glu 65 70 75 80 Leu Ala Lys Val Val Val Ala Pro Phe Lys Glu Ile Ser Ile His Leu 85 90 95 Thr Asn Thr Ser Glu Val Met His Cys Ser Phe Ser Leu Lys His Cys 100 105 110 Gln Asp Leu 115 <210> SEQ ID NO 121 <211> LENGTH: 82 <212> TYPE: PRT <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic construct <400> SEQUENCE: 121 Asp Phe Gly Leu Leu Leu Tyr Leu Glu Glu Leu Asn Lys Glu Glu Leu 1 5 10 15 Asn Thr Phe Lys Leu Phe Leu Lys Glu Thr Met Glu Pro Glu His Gly 20 25 30 Leu Thr Pro Trp Asn Glu Val Lys Lys Ala Arg Arg Glu Asp Leu Ala 35 40 45 Asn Leu Met Lys Lys Tyr Tyr Pro Gly Glu Lys Ala Trp Ser Val Ser 50 55 60 Leu Lys Ile Phe Gly Lys Met Asn Leu Lys Asp Leu Cys Glu Arg Ala 65 70 75 80 Lys Glu <210> SEQ ID NO 122 <211> LENGTH: 321 <212> TYPE: PRT <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic construct <400> SEQUENCE: 122 Pro Gln Ile Val Val Leu Gln Gly Ala Ala Gly Val Gly Lys Thr Thr 1 5 10 15 Leu Val Arg Lys Ala Met Leu Asp Trp Ala Glu Gly Ser Leu Tyr Gln 20 25 30 Gln Arg Phe Lys Tyr Val Phe Tyr Leu Asn Gly Arg Glu Ile Asn Gln 35 40 45 Leu Lys Glu Arg Ser Phe Ala Gln Leu Ile Ser Lys Asp Trp Pro Ser 50 55 60 Thr Glu Gly Pro Ile Glu Glu Ile Met Tyr Gln Pro Ser Ser Leu Leu 65 70 75 80 Phe Ile Ile Asp Ser Phe Asp Glu Leu Asn Phe Ala Phe Glu Glu Pro 85 90 95 Glu Phe Ala Leu Cys Glu Asp Trp Thr Gln Glu His Pro Val Ser Phe 100 105 110 Leu Met Ser Ser Leu Leu Arg Lys Val Met Leu Pro Glu Ala Ser Leu 115 120 125 Leu Val Thr Thr Arg Leu Thr Thr Ser Lys Arg Leu Lys Gln Leu Leu 130 135 140 Lys Asn His His Tyr Val Glu Leu Leu Gly Met Ser Glu Asp Ala Arg 145 150 155 160 Glu Glu Tyr Ile Tyr Gln Phe Phe Glu Asp Lys Arg Trp Ala Met Lys 165 170 175 Val Phe Ser Ser Leu Lys Ser Asn Glu Met Leu Phe Ser Met Cys Gln 180 185 190 Val Pro Leu Val Cys Trp Ala Ala Cys Thr Cys Leu Lys Gln Gln Met 195 200 205 Glu Lys Gly Gly Asp Val Thr Leu Thr Cys Gln Thr Thr Thr Ala Leu 210 215 220 Phe Thr Cys Tyr Ile Ser Ser Leu Phe Thr Pro Val Asp Gly Gly Ser 225 230 235 240 Pro Ser Leu Pro Asn Gln Ala Gln Leu Arg Arg Leu Cys Gln Val Ala 245 250 255 Ala Lys Gly Ile Trp Thr Met Thr Tyr Val Phe Tyr Arg Glu Asn Leu 260 265 270 Arg Arg Leu Gly Leu Thr Gln Ser Asp Val Ser Ser Phe Met Asp Ser 275 280 285 Asn Ile Ile Gln Lys Asp Ala Glu Tyr Glu Asn Cys Tyr Val Phe Thr 290 295 300 His Leu His Val Gln Glu Phe Phe Ala Ala Met Phe Tyr Met Leu Lys 305 310 315 320 Gly <210> SEQ ID NO 123 <211> LENGTH: 115 <212> TYPE: PRT <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic construct <400> SEQUENCE: 123 Leu Leu Gln Ser Thr Ser Tyr Lys Asp Pro His Leu Thr Gln Met Lys 1 5 10 15 Cys Phe Leu Phe Gly Leu Leu Asn Glu Asp Arg Val Lys Gln Leu Glu 20 25 30 Arg Thr Phe Asn Cys Lys Met Ser Leu Lys Ile Lys Ser Lys Leu Leu 35 40 45 Gln Cys Met Glu Val Leu Gly Asn Ser Asp Tyr Ser Pro Ser Gln Leu 50 55 60 Gly Phe Leu Glu Leu Phe His Cys Leu Tyr Glu Thr Gln Asp Lys Ala 65 70 75 80 Phe Ile Ser Gln Ala Met Arg Cys Phe Pro Lys Val Ala Ile Asn Ile 85 90 95 Cys Glu Lys Ile His Leu Leu Val Ser Ser Phe Cys Leu Lys His Cys 100 105 110 Arg Cys Leu 115 <210> SEQ ID NO 124 <211> LENGTH: 83 <212> TYPE: PRT <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic construct <400> SEQUENCE: 124 Glu Phe Tyr Ile His Lys Gly Tyr Asp Asp Val Ser Ser Asp Asn Ser 1 5 10 15 Arg Glu Lys Ile Lys Gly Glu Pro Ser Glu Cys Glu Leu Gly His Phe 20 25 30 Pro Arg Ile Pro Trp Ala Asn Leu Arg Ala Ala Asp Pro Leu Asn Leu 35 40 45 Ser Phe Leu Leu Asp Glu His Phe Pro Lys Gly Gln Ala Trp Lys Val 50 55 60 Val Leu Gly Ile Phe Gln Thr Met Asn Leu Thr Ser Leu Cys Glu Lys 65 70 75 80 Val Arg Ala <210> SEQ ID NO 125 <211> LENGTH: 325 <212> TYPE: PRT <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic construct <400> SEQUENCE: 125 Ala Gln Thr Ile Val Leu Val Gly Arg Ala Gly Val Gly Lys Thr Thr 1 5 10 15 Leu Ala Met Arg Ala Met Leu His Trp Ala Asn Gly Val Leu Phe Gln 20 25 30 Gln Arg Phe Ser Tyr Val Phe Tyr Leu Ser Cys His Lys Ile Arg Tyr 35 40 45 Met Lys Glu Thr Thr Phe Ala Glu Leu Ile Ser Leu Asp Trp Pro Asp 50 55 60 Phe Asp Ala Pro Ile Glu Glu Phe Met Ser Gln Pro Glu Lys Leu Leu 65 70 75 80 Phe Ile Ile Asp Gly Phe Glu Glu Ile Ile Ile Ser Glu Ser Arg Ser 85 90 95 Glu Ser Leu Asp Asp Gly Ser Pro Cys Thr Asp Trp Tyr Gln Glu Leu 100 105 110 Pro Val Thr Lys Ile Leu His Ser Leu Leu Lys Lys Glu Leu Val Pro 115 120 125 Leu Ala Thr Leu Leu Ile Thr Ile Lys Thr Trp Phe Val Arg Asp Leu 130 135 140 Lys Ala Ser Leu Val Asn Pro Cys Phe Val Gln Ile Thr Gly Phe Thr 145 150 155 160 Gly Asp Asp Leu Arg Val Tyr Phe Met Arg His Phe Asp Asp Ser Ser 165 170 175 Glu Val Glu Lys Ile Leu Gln Gln Leu Arg Lys Asn Glu Thr Leu Phe 180 185 190 His Ser Cys Ser Ala Pro Met Val Cys Trp Thr Val Cys Ser Cys Leu 195 200 205 Lys Gln Pro Lys Val Arg Tyr Tyr Asp Leu Gln Ser Ile Thr Gln Thr 210 215 220 Thr Thr Ser Leu Tyr Ala Tyr Phe Phe Ser Asn Leu Phe Ser Thr Ala 225 230 235 240 Glu Val Asp Leu Ala Asp Asp Ser Trp Pro Gly Gln Trp Arg Ala Leu 245 250 255 Cys Ser Leu Ala Ile Glu Gly Leu Trp Ser Met Asn Phe Thr Phe Asn 260 265 270 Lys Glu Asp Thr Glu Ile Glu Gly Leu Glu Val Pro Phe Ile Asp Ser 275 280 285 Leu Tyr Glu Phe Asn Ile Leu Gln Lys Ile Asn Asp Cys Gly Gly Cys 290 295 300 Thr Thr Phe Thr His Leu Ser Phe Gln Glu Phe Phe Ala Ala Met Ser 305 310 315 320 Phe Val Leu Glu Glu 325 <210> SEQ ID NO 126 <211> LENGTH: 112 <212> TYPE: PRT <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic construct <400> SEQUENCE: 126 Leu Leu Gln His Val Leu Leu Asp Lys Glu Ala Tyr Trp Thr Pro Val 1 5 10 15 Val Leu Phe Phe Phe Gly Leu Leu Asn Lys Asn Ile Ala Arg Glu Leu 20 25 30 Glu Asp Thr Leu His Cys Lys Ile Ser Pro Arg Val Met Glu Glu Leu 35 40 45 Leu Lys Trp Gly Glu Glu Leu Gly Lys Ala Glu Ser Ala Ser Leu Gln 50 55 60 Phe His Ile Leu Arg Leu Phe His Cys Leu His Glu Ser Gln Glu Glu 65 70 75 80 Asp Phe Thr Lys Lys Met Leu Gly Arg Ile Phe Glu Val Asp Leu Asn 85 90 95 Ile Leu Glu Asp Glu Glu Leu Gln Ala Leu Lys His Cys Lys Arg Leu 100 105 110 <210> SEQ ID NO 127 <211> LENGTH: 77 <212> TYPE: PRT <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic construct <400> SEQUENCE: 127 Phe Asp Leu Leu Trp Tyr Leu Glu Asn Leu Ser Asp Lys Glu Phe Gln 1 5 10 15 Ser Phe Lys Lys Tyr Leu Ala Arg Lys Ile Leu Asp Phe Lys Leu Pro 20 25 30 Gln Phe Pro Leu Ile Gln Met Thr Lys Glu Glu Leu Ala Asn Val Leu 35 40 45 Pro Ile Ser Tyr Glu Gly Gln Tyr Ile Trp Asn Met Leu Phe Ser Ile 50 55 60 Phe Ser Met Met Arg Lys Glu Asp Leu Cys Arg Lys Ile 65 70 75 <210> SEQ ID NO 128 <211> LENGTH: 321 <212> TYPE: PRT <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic construct <400> SEQUENCE: 128 Asn Leu Asn Val Phe Leu Met Gly Glu Arg Ala Ser Gly Lys Thr Ile 1 5 10 15 Val Ile Asn Leu Ala Val Leu Arg Trp Ile Lys Gly Glu Met Trp Gln 20 25 30 Asn Met Ile Ser Tyr Val Val His Leu Thr Ala His Glu Ile Asn Gln 35 40 45 Met Thr Asn Ser Ser Leu Ala Glu Leu Ile Ala Lys Asp Trp Pro Asp 50 55 60 Gly Gln Ala Pro Ile Ala Asp Ile Leu Ser Asp Pro Lys Lys Leu Leu 65 70 75 80 Phe Ile Leu Glu Asp Leu Asp Asn Ile Arg Phe Glu Leu Asn Val Asn 85 90 95 Glu Ser Ala Leu Cys Ser Asn Ser Thr Gln Lys Val Pro Ile Pro Val 100 105 110 Leu Leu Val Ser Leu Leu Lys Arg Lys Met Ala Pro Gly Cys Trp Phe 115 120 125 Leu Ile Ser Ser Arg Pro Thr Arg Gly Asn Asn Val Lys Thr Phe Leu 130 135 140 Lys Glu Val Asp Cys Cys Thr Thr Leu Gln Leu Ser Asn Gly Lys Arg 145 150 155 160 Glu Ile Tyr Phe Asn Ser Phe Phe Lys Asp Arg Gln Arg Ala Ser Ala 165 170 175 Ala Leu Gln Leu Val His Glu Asp Glu Ile Leu Val Gly Leu Cys Arg 180 185 190 Val Ala Ile Leu Cys Trp Ile Thr Cys Thr Val Leu Lys Arg Gln Met 195 200 205 Asp Lys Gly Arg Asp Phe Gln Leu Cys Cys Gln Thr Pro Thr Asp Leu 210 215 220 His Ala His Phe Leu Ala Asp Ala Leu Thr Ser Glu Ala Gly Leu Thr 225 230 235 240 Ala Asn Gln Tyr His Leu Gly Leu Leu Lys Arg Leu Cys Leu Leu Ala 245 250 255 Ala Gly Gly Leu Phe Leu Ser Thr Leu Asn Phe Ser Gly Glu Asp Leu 260 265 270 Arg Cys Val Gly Phe Thr Glu Ala Asp Val Ser Val Leu Gln Ala Ala 275 280 285 Asn Ile Leu Leu Pro Ser Asn Thr His Lys Asp Arg Tyr Lys Phe Ile 290 295 300 His Leu Asn Val Gln Glu Phe Cys Thr Ala Ile Ala Phe Leu Met Ala 305 310 315 320 Val <210> SEQ ID NO 129 <211> LENGTH: 111 <212> TYPE: PRT <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Synthetic construct <400> SEQUENCE: 129 Lys Arg Glu Gln Tyr Ser Asp Phe Asn Gln Val Phe Thr Phe Ile Phe 1 5 10 15 Gly Leu Leu Asn Ala Asn Arg Arg Lys Ile Leu Glu Thr Ser Phe Gly 20 25 30 Tyr Gln Leu Pro Met Val Asp Ser Phe Lys Trp Tyr Ser Val Gly Tyr 35 40 45 Met Lys His Leu Asp Arg Asp Pro Glu Lys Leu Thr His His Met Pro 50 55 60 Leu Phe Tyr Cys Leu Tyr Glu Asn Arg Glu Glu Glu Phe Val Lys Thr 65 70 75 80 Ile Val Asp Ala Leu Met Glu Val Thr Val Tyr Leu Gln Ser Asp Lys 85 90 95 Asp Met Met Val Ser Leu Tyr Cys Leu Asp Tyr Cys Cys His Leu 100 105 110

Claims

1. An isolated nucleic acid molecule encoding: (1) a PAAD-containing polypeptide, comprising: (a) a nucleic acid molecule encoding a polypeptide comprising the amino acid sequence set forth as SEQ ID NOs: 66, 68, 70, 72, 74, 76 or 84; or (b) a nucleic acid molecule that hybridizes to the complement of the nucleic acid molecule of (a) under highly stringent conditions, where the nucleic acid molecule encodes a biologically active PAAD domain-containing polypeptide; (2) a PAAD domain, comprising: (a) a nucleic acid molecule encoding a PAAD domain amino acid sequence set forth as any of SEQ ID NOS: 118, 121, 124 or 127; or (b) a nucleic acid molecule that hybridizes to the nucleic acid molecule of (a) under highly stringent conditions, where the nucleic acid molecule encodes a biologically active PAAD domain; or (3) a NACHT domain, comprising: (a) a nucleic acid molecule encoding the NACHT domain amino acid set forth as any of SEQ ID NOS:107, 110, 113, 116, 119, 122, 125, 128; or (b) a nucleic acid molecule that hybridizes to the nucleic acid molecule of (a) under highly stringent conditions, where the nucleic acid molecule encodes a biologically active NACHT domain.

2. (canceled)

3. A vector containing the nucleic acid molecule of claim 1.

4. A recombinant cell containing the nucleic acid molecule of claim 1.

5-10. (canceled)

11. An oligonucleotide comprising at least 17 or 50 nucleotides capable of specifically hybridizing with the nucleotide sequence set forth in any of SEQ ID NOS:69, 71, 73 or 75 or the complement thereof.

12. (canceled)

13. An isolated polypeptide comprising: (1) a PAAD domain-containing polypeptide, comprising an amino acid sequence at least 80% identical to the amino acid sequence set forth in any of SEQ ID NOS:66, 68, 70, 72, 74, 76 or 84, wherein said PAAD domain-containing polypeptide is a biologically active PAAD domain-containing polypeptide; (2) a PAAD domain polypeptide, comprising an amino acid sequence at least 80% identical to the amino acid sequence set forth as any of SEQ ID NOS: 118, 121, 124 or 127, wherein said PAAD domain polypeptide is a biologically active PAAD domain polypeptide; (3) a NACHT domain polypeptide, comprising an amino acid sequence at least 80% identical to the amino acid sequence set forth as any of SEQ ID NOS:107, 110, 113, 116, 119, 122, 125, 128, wherein said NACHT domain polypeptide is a biologically active NACHT domain polypeptide; or (4) at least 10 contiguous amino acids of any of SEQ ID NOS:70, 72, 74 or 76.

14-19. (canceled)

20. A method of producing a PAAD domain-containing polypeptide comprising expressing the nucleic acid molecule of claim 1 in vitro or in a cell under conditions suitable for expression of said polypeptide.

21. An isolated anti-PAAD antibody having specific reactivity with the PAAD domain-containing polypeptide of claim 13.

22. (canceled)

23. A cell line producing the antibody of claim 21.

24. (canceled)

25. A method of identifying a nucleic acid molecule encoding a PAAD-containing polypeptide in a sample, said method comprising: contacting a sample containing nucleic acids with an oligonucleotide according to claim 11, wherein said contacting is effected under high stringency hybridization conditions, and identifying a nucleic acid molecule which hybridizes thereto.

26. A method of detecting the presence of a PAAD domain-containing polypeptide in a sample, said method comprising contacting a test sample with an antibody according to claim 21, detecting the presence of an antibody:polypeptide complex, and thereby detecting the presence of a PAAD domain-containing polypeptide in said test sample.

27. A method of identifying a PAAD domain-containing polypeptide-associated polypeptide (PAP) comprising the steps of: (a) contacting the PAAD domain-containing polypeptide, PAAD domain polypeptide or a NATCH domain polypeptide of claim 13 with a candidate PAP; (b) detecting association of said PAAD domain-containing polypeptide with said candidate PAP, wherein a candidate PAP that associates with said polypeptide is identified as a PAP.

28-29. (canceled)

30. A method of identifying an effective agent that alters the association of a PAAD domain-containing polypeptide with a PAAD domain-containing polypeptide-associated polypeptide (PAP), comprising the steps of: (a) contacting the PAAD domain-containing polypeptide of claim 13, or a PAAD, NACHT or ARED domain therefrom, and said PAP under conditions that allow said PAAD domain-containing polypeptide or said fragment and said PAP to associate, with a candidate agent; and (b) detecting the altered association of said PAAD domain-containing polypeptide or domain with said PAP, wherein an agent that alters said association is identified as an effective agent.

31. (canceled)

32. A method of identifying an agent that associates with a PAAD domain-containing polypeptide, PAAD domain polypeptide or NACHT domain polypeptide, comprising the steps of: (a) contacting the PAAD domain-containing polypeptide, PAAD domain polypeptide or NACHT domain polypeptide of claim 13 with a candidate agent; and (b) detecting association of said PAAD domain-containing polypeptide, PAAD domain polypeptide or NACHT domain polypeptide with said agent.

33-34. (canceled)

35. A method of identifying an agent that modulates PAAD domain-mediated inhibition of NFκB activity, comprising the steps of: (a) contacting a cell that recombinantly expresses a PAAD domain-containing polypeptide with a candidate agent, wherein said PAAD domain polypeptide comprises an amino acid sequence at least 80% identical to the amino acid sequence set forth as any of SEQ ID NOS:118, 121, 124 or 127; and (b) detecting NFκB activity in said cell, whereas increased or decreased NFκB activity in said cell compared to a control cell indicates that said candidate agent is an agent that modulates PAAD domain-mediated inhibition of NFκB activity.

36-37. (canceled)

38. A method of identifying an agent that modulates an activity of a NACHT domain of a PAAD domain-containing polypeptide, comprising the steps of: (a) contacting the NACHT domain polypeptide of claim 13 with a candidate agent; and (b) detecting an activity of said NACHT domain, whereby an increase or decrease of said activity identifies said agent as an agent that modulates the activity of the NACHT domain of said PAAD domain-containing polypeptide; wherein the detected activity of said NACHT domain is selected from homo-oligomerization, hetero-oligomerization, nucleotide hydrolysis, and nucleotide binding.

39. A method of modulating NFκB transcriptional activity in a cell, comprising the steps of: (a) introducing the nucleic acid molecule encoding a PAAD domain of claim 1 into a cell; and (b) expressing said nucleic acid molecule in said cell, whereby the expression of said nucleic acid modulates NFκB transcriptional activity in said cell.

40. A method of decreasing expression of a PAAD domain-containing polypeptide in a cell, comprising introducing an antisense or dsRNA nucleic molecule into a cell, wherein said antisense or dsRNA nucleic molecule binds to any of SEQ ID NOS: 69, 71, 73 or 75.

Images