Plants Having Increased Yield and Method for Making the Same

Abstract

The present invention concerns a method for increasing plant yield in plants grown under non-stress growth conditions relative to yield in corresponding wild type plants grown under comparable conditions, the method comprising preferentially increasing activity in the cytosol of a plant cell of a type I DnaJ-like polypeptide or a homologue thereof. One such method comprises introducing and/or expressing in a plant, plant part or plant cell a type I DnaJ-like nucleic acid or variant thereof. The invention also relates to transgenic plants grown under non-stress conditions having introduced and/or expressed therein a type I DnaJ-like nucleic acid or variant thereof, which plants have increased plant yield relative to corresponding wild type plants grown under comparable conditions. The present invention also concerns constructs useful in the methods of the invention.

Description

RELATED APPLICATIONS

[0001] This application is a continuation of U.S. application Ser. No. 11/794,004, filed Jul. 18, 2007, which is the national stage application (under 35 U.S.C. 371) of PCT/EP2005/057167 filed Dec. 23, 2005, which claims benefit of European application 04106985.7 filed Dec. 24, 2004 and U.S. provisional application 60/641,688 filed Jan. 6, 2005. The entire contents of each of these applications are hereby incorporated by reference herein.

SUBMISSION OF SEQUENCE LISTING

[0002] The Sequence Listing associated with this application is filed in electronic format via EFS-Web and hereby incorporated by reference into the specification in its entirety. The name of the text file containing the Sequence Listing is Sequence_Listing_--14546_--00071. The size of the text file is 172 KB, and the text file was created on Jan. 17, 2011.

[0003] The present invention relates generally to the field of molecular biology and concerns a method for increasing plant yield, in plants grown under non-stress conditions, relative to yield in corresponding wild type plants grown under comparable conditions. More specifically, the present invention concerns a method for increasing plant yield in plants grown under non-stress conditions, comprising preferentially increasing activity in the cytosol of a plant cell of a type I DnaJ-like polypeptide or a homologue thereof. The present invention also concerns plants having preferentially increased activity in the cytosol of a type I DnaJ-like polypeptide or a homologue thereof, which plants have increased yield when grown under non-stressed conditions relative to yield in corresponding wild type plants grown under comparable conditions. The invention also provides constructs useful in the methods of the invention.

[0004] The ever-increasing world population and the dwindling supply of arable land available for agriculture fuel agricultural research towards improving the efficiency of agriculture. Conventional means for crop and horticultural improvements utilise selective breeding techniques to identify plants having desirable characteristics. However, such selective breeding techniques have several drawbacks, namely that these techniques are typically labour intensive and result in plants that often contain heterogeneous genetic components that may not always result in the desirable trait being passed on from parent plants. Advances in molecular biology have allowed mankind to modify the germplasm of animals and plants. Genetic engineering of plants entails the isolation and manipulation of genetic material (typically in the form of DNA or RNA) and the subsequent introduction of that genetic material into a plant. Such technology has the capacity to deliver crops or plants having various improved economic, agronomic or horticultural traits. A trait of particular economic interest is yield. Yield is normally defined as the measurable produce of economic value from a crop. This may be defined in terms of quantity and/or quality. Yield is directly dependent on several factors, for example, the number and size of the organs, plant architecture (for example, the number of branches), seed production and more. Root development, nutrient uptake and stress tolerance may also be important factors in determining yield. Optimizing one of the abovementioned factors may therefore increase crop yield. Furthermore, plant seeds are an important source of human and animal nutrition. Crops such as, corn, rice, wheat, canola and soybean account for over half of total human caloric intake, whether through direct consumption of the seeds themselves or through consumption of meat products raised on processed seeds. They are also a source of sugars, oils and many kinds of metabolites used in industrial processes. Seeds contain an embryo, the source of new shoots and roots after germination, and an endosperm, the source of nutrients for embryo growth, during germination and early growth of seedlings. The development of a seed involves many genes, and requires the transfer of metabolites from roots, leaves and stems into the growing seed. The endosperm, in particular, assimilates the metabolic precursors of carbohydrate polymers, oil and proteins and synthesizes them into storage macromolecules to fill out the grain. The ability to increase plant seed yield, whether through increased harvest index, increased thousand kernel weight, seed number, seed biomass, seed development, seed filling or any other seed-related trait would have many applications in agriculture, and even many non-agricultural uses such as in the biotechnological production of substances such as pharmaceuticals, antibodies or vaccines.

[0005] It has now been found that preferentially increasing activity in the cytosol of a plant cell of a type I DnaJ-like polypeptide gives plants grown under non-stress conditions increased yield relative to corresponding wild type plants grown under comparable conditions.

[0006] DnaJ is a molecular co-chaperone of the Hsp40 (Heat shock protein 40) family. Hsp40 cooperates with chaperone heat shock protein 70 (Hsp70, also called DnaK) and co-chaperone nucleotide exchange factor GrpE to facilitate different aspects of cellular protein metabolism that include ribosome assembly, protein translocation, protein folding and unfolding, suppression of polypeptide aggregation and cell signalling (Walid (2001) Curr Protein Peptide Sci 2: 227-244). DnaJ stimulates Hsp70 to hydrolyze ATP, a key step in the stable binding of a substrate to Hsp70. In addition, DnaJ itself also possesses molecular chaperone functions since it has been shown to bind to nascent chains in in vitro translation systems and to prevent the aggregation of denatured polypeptides (Laufen et al. (2001) Proc Natl Acad Sci USA 96: 5452-5457). Members of the DnaJ family have been identified in a variety of organisms (both in prokaryotes and eucaryotes) and in a variety of cellular compartments, such as cytosol, mitochondria, peroxisome, glyoxysome, endoplasmic reticulum and chloroplast stroma. Within one organism, multiple Hsp40s can interact with a single Hsp70 to generate Hsp70::Hsp40 pairs that facilitate numerous reactions in cellular protein metabolism.

[0007] All DnaJ proteins are defined by the presence of a so-called "J" domain, consisting of approximately 70 amino acids, usually located at the amino terminus of the protein, and by the presence of the highly conserved HPD tri-peptide in the middle of the J-domain (InterPro reference IPRO01623; Zdobnov et al., (2002) 18(8): 1149-50); The "J" domain, consisting of four alpha helices, interacts with Hsp70 proteins. In the genome of Arabidopsis thaliana, at least 89 proteins comprising the J-domain have been identified (Miernyk (2001) Cell Stress & Chaperones). 18 Hsp70 proteins have been identified to date.

[0008] DnaJ proteins have been further classified into Type I, Type II and Type III.

[0009] DnaJ domain proteins (or DnaJ proteins) of type I (to date there being at least 8 in Arabidopsis; Miernyk (2001) Cell Stress & Chaperone 6(3): 209-218), comprise (from amino terminus to carboxy terminus) the domains identified within the archetypal DnaJ protein as first characterized in Escherichia coli: [0010] 1) a G/F domain region of about 30 amino acid residues, rich in glycine (G) and phenylalanine (F), which is proposed to regulate target polypeptide specificity; [0011] 2) a Cys-rich zinc finger domain containing four repeats of the CXXCXGXG (SEQ ID NO: 66), where X represents a charged or polar residue; these four repeats function in pairs to form zinc binding domain I and II (InterPro reference IPR001305; Linke et al. (2003) J Biol Chem 278(45): 44457-44466); the zinc finger domain is thought to mediate direct protein:protein interactions and more specifically to bind non-native polypeptides to be delivered to Hsp70; [0012] 3) a carboxy-terminal domain (CTD; InterPro reference IPRO02939).

[0013] Type II DnaJ domain proteins (to date there being at least 35 in Arabidopsis) comprise the J domain located at the amino terminus of the protein, either the G/F domain or the zinc finger domain and a CTD. Type III DnaJ domain proteins (to date there being at least 45 in Arabidopsis) comprise only the J domain, which may be located anywhere within the protein. In their native form, DnaJ proteins may be targeted to a variety of subcellular compartments, in either a soluble or a membrane-bound form. Examples of such subcellular compartments in plants include mitochondria, chloroplasts, peroxisomes, nucleus, cytoplasm and secretory pathway. Signal sequences and transit peptides, usually located at the amino terminus of the nuclear-encoded DnaJ proteins, are responsible for the targeting of these proteins to specific subcellular compartments.

[0014] Examples of cellular membranes to which DnaJ proteins may be targeted under specific circumstances include the mitochondrial outer membrane, the chloroplastic outer membrane, the peroxisomal membrane, the nuclear envelope, the endoplasmic reticulum (ER) and the cell membrane itself (Miernyk (2001) Cell Stress & Chaperone 6(3): 209-218). One type of membrane association of a DnaJ protein happens after posttranslational modification of the protein, i.e., after isoprenylation. An isoprenoid group is attached to the cysteine of the farnesylation CaaX motif (where C is Cys, a an aliphatic amino acid residue and X any amino acid) located at the carboxy terminus end of the protein. This farnesylation has been shown to result in higher biological activity and membrane association of the DnaJ protein, especially at elevated temperatures (Zhu J-K et al., (1993) The Plant Cell 5:341-9).

[0015] It has been suggested that DnaJ proteins play a role (together with HSP70) in conferring tolerance to heat stress in plants. Whilst DnaJ may have a protective role to play in heat-stressed plants, it is not apparent whether there might be any added advantage to increasing levels and/or activity of DnaJ in nonheat-stressed plants.

[0016] It was therefore surprising to find that a type I DnaJ-like polypeptide could be used under non-stress growth conditions to give plants having increased yield relative to yield in corresponding wild type plants grown under comparable conditions.

[0017] Therefore, according to one embodiment of the present invention, there is provided a method for increasing plant yield in plants grown under non-stress conditions, comprising preferentially increasing activity in the cytosol of a plant cell of a type I DnaJ-like polypeptide or a homologue thereof, which type I DnaJ-like polypeptide or homologue thereof comprises a CaaX motif in its carboxy terminus.

[0018] The term "cytosol" refers to the subcellular location of the DnaJ protein useful in the methods of the invention. A transient or prolonged association of the DnaJ protein with the outer surface of mitochondria, chloroplasts, peroxisome, nucleus, ER or with the cellular membrane, is encompassed by the term cytosol.

[0019] The "carboxy terminus" of a protein may readily be identified by a person skilled in the art.

[0020] Reference herein to "corresponding wild type plants" is taken to mean any suitable control plant or plants, the choice of which would be within the capabilities of a person skilled in the art and may include, for example, corresponding wild type plants or corresponding plants without the gene of interest. A "control plant" as used herein refers not only to whole plants, but also to plant parts, including seeds and seed parts.

[0021] Reference herein to "non-stressed (growth) conditions" is taken to mean growth/cultivation of a plant at any stage in its life cycle (from seed to mature plant and back to seed again) under normal growth conditions, which include the everyday mild stresses that every plant encounters, but which do not include severe stress. An example of a severe stress is heat stress, the occurrence of which would be well known in the art, and which would depend upon various factors, such as the region in which the plant is grown and which would depend upon the plant itself.

[0022] Advantageously, performance of the methods according to the present invention results in plants having increased plant yield, particularly increased seed yield.

[0023] The term "increased yield" as defined herein is taken to mean an increase in any one or more of the following, each relative to corresponding wild type plants: (i) increased biomass (weight) of one or more parts of a plant, particularly aboveground (harvestable) parts, increased root biomass or increased biomass of any other harvestable part; (ii) increased seed yield, which includes an increase in seed biomass (seed weight) and which may be an increase in the seed weight per plant or on an individual seed basis; (iii) increased number of (filled) seeds; (iv) increased fill rate (which is the number of filled seeds divided by the total number of seeds and multiplied by 100); (v) increased seed size, which may also influence the composition of seeds; (vi) increased seed volume, which may also influence the composition of seeds; (vii) increased harvest index, which is expressed as a ratio of the yield of harvestable parts, such as seeds, over the total biomass; and (viii) increased thousand kernel weight (TKW), which is extrapolated from the number of filled seeds counted and their total weight. An increased TKW may result from an increased seed size and/or seed weight.

[0024] Taking corn as an example, a yield increase may be manifested as one or more of the following: increase in the number of plants per hectare or acre, an increase in the number of ears per plant, an increase in the number of rows, number of kernels per row, kernel weight, thousand kernel weight, ear length/diameter, among others. Taking rice as an example, a yield increase may be manifested as an increase in one or more of the following: number of plants per hectare or acre, number of panicles per plant, number of spikelets per panicle, number of flowers per panicle, increase in the seed filling rate, increase in thousand kernel weight, among others. An increase in yield may also result in modified architecture, or may occur because of modified architecture.

[0025] According to a preferred feature, performance of the methods of the invention result in plants having increased seed yield. Therefore, according to the present invention, there is provided a method for increasing plant seed yield in plants grown under non-stress conditions, which method comprises preferentially increasing activity in the cytosol of a plant cell of a type I DnaJ-like polypeptide or a homologue thereof, which type I DnaJ-like polypeptide comprises a CaaX motif at its carboxy terminus.

[0026] Further preferably, the increased seed yield is manifested as an increase in harvest index relative to corresponding wild type plants. Therefore, according to the present invention, there is provided a method for increasing harvest index in plants grown under non-stress conditions, which method comprises preferentially increasing activity in the cytosol of a plant cell of a type I DnaJ-like polypeptide or a homologue thereof, which type I DnaJ-like polypeptide comprises a CaaX motif at its carboxy terminus.

[0027] Since the transgenic plants according to the present invention have increased yield, it is likely that these plants exhibit an increased growth rate (during at least part of their life cycle), relative to the growth rate of corresponding wild type plants at a corresponding stage in their life cycle. The increased growth rate may be specific to one or more parts of a plant (including seeds), or may be throughout substantially the whole plant. A plant having an increased growth rate may even exhibit early flowering. The increase in growth rate may take place at one or more stages in the life cycle of a plant or during substantially the whole plant life cycle. Increased growth rate during the early stages in the life cycle of a plant may reflect enhanced vigour. The increase in growth rate may alter the harvest cycle of a plant allowing plants to be sown later and/or harvested sooner than would otherwise be possible. If the growth rate is sufficiently increased, it may allow for the further sowing of seeds of the same plant species (for example sowing and harvesting of rice plants followed by sowing and harvesting of further rice plants all within one conventional growing period). Similarly, if the growth rate is sufficiently increased, it may allow for the further sowing of seeds of different plants species (for example the sowing and harvesting of rice plants followed by, for example, the sowing and optional harvesting of soybean, potato or any other suitable plant crop). Harvesting additional times from the same rootstock in the case of some plants may also be possible. Altering the harvest cycle of a plant may lead to an increase in annual biomass production per acre (due to an increase in the number of times (say in a year) that any particular plant may be grown and harvested). An increase in growth rate may also allow for the cultivation of transgenic plants in a wider geographical area than their wild-type counterparts, since the territorial limitations for growing a crop are often determined by adverse environmental conditions either at the time of planting (early season) or at the time of harvesting (late season). Such adverse conditions may be avoided if the harvest cycle is shortened. The growth rate may be determined by deriving various parameters from growth curves, such parameters may be: T-Mid (the time taken for plants to reach 50% of their maximal size) and T-90 (time taken for plants to reach 90% of their maximal size), amongst others.

[0028] Performance of the methods of the invention gives plants having an increased growth rate. Therefore, according to the present invention, there is provided a method for increasing the growth rate of plants grown under non-stress conditions relative to the growth rate of wild type plants grown under comparable conditions, which method comprises preferentially increasing activity in the cytosol of a plant cell of a type I DnaJ-like polypeptide or a homologue thereof, which type I DnaJ-like polypeptide or homologue thereof comprises a CaaX motif at its carboxy terminus.

[0029] The abovementioned growth characteristics may advantageously be modified in any plant.

[0030] The term "plant" as used herein encompasses whole plants, ancestors and progeny of the plants and plant parts, including seeds, shoots, stems, leaves, roots (including tubers), flowers, and tissues and organs, wherein each of the aforementioned comprise the gene/nucleic acid of interest. The term "plant" also encompasses plant cells, suspension cultures, callus tissue, embryos, meristematic regions, gametophytes, sporophytes, pollen, and microspores, again wherein each of the aforementioned comprise the gene/nucleic acid of interest.

[0031] Plants that are particularly useful in the methods of the invention include all plants which belong to the superfamily Viridiplantae, in particular monocotyledonous and dicotyledonous plants including fodder or forage legumes, ornamental plants, food crops, trees or shrubs selected from the list comprising Acacia spp., Acer spp., Actinidia spp., Aesculus spp., Agathis australis, Albizia amara, Alsophila tricolor, Andropogon spp., Arachis spp, Areca catechu, Astelia fragrans, Astragalus cicer, Baikiaea plurijuga, Betula spp., Brassica spp., Bruguiera gymnorrhiza, Burkea africana, Butea frondosa, Cadaba farinosa, Calliandra spp, Camellia sinensis, Canna indica, Capsicum spp., Cassia spp., Centroema pubescens, Chaenomeles spp., Cinnamomum cassia, Coffea arabica, Colophospermum mopane, Coronillia varia, Cotoneaster serotina, Crataegus spp., Cucumis spp., Cupressus spp., Cyathea dealbata, Cydonia oblonga, Cryptomeria japonica, Cymbopogon spp., Cynthea dealbata, Cydonia oblonga, Dalbergia monetaria, Davallia divaricata, Desmodium spp., Dicksonia squarosa, Diheteropogon amplectens, Dioclea spp, Dolichos spp., Dorycnium rectum, Echinochloa pyramidalis, Ehrartia spp., Eleusine coracana, Eragrestis spp., Erythrina spp., Eucalyptus spp., Euclea schimperi, Eulalia villosa, Fagopyrum spp., Feijoa sellowiana, Fragaria spp., Flemingia spp, Freycinetia banksii, Geranium thunbergii, Ginkgo biloba, Glycine javanica, Gliricidia spp, Gossypium hirsutum, Grevillea spp., Guibourtia coleosperma, Hedysarum spp., Hemarthia altissima, Heteropogon contortus, Hordeum vulgare, Hyparrhenia rufa, Hypericum erectum, Hyperthelia dissoluta, Indigo incarnata, Iris spp., Leptarrhena pyrolifolia, Lespediza spp., Lettuca spp., Leucaena leucocephala, Loudetia simplex, Lotonus bainesii, Lotus spp., Macrotyloma axillare, Malus spp., Manihot esculenta, Medicago sativa, Metasequoia glyptostroboides, Musa sapientum, Nicotianum spp., Onobrychis spp., Ornithopus spp., Oryza spp., Peltophorum africanum, Pennisetum spp., Persea gratissima, Petunia spp., Phaseolus spp., Phoenix canariensis, Phormium cookianum, Photinia spp., Picea glauca, Pinus spp., Pisum sativum, Podocarpus totara, Pogonarthria fleckii, Pogonarthria squarrosa, Populus spp., Prosopis cineraria, Pseudotsuga menziesii, Pterolobium stellatum, Pyrus communis, Quercus spp., Rhaphiolepsis umbellata, Rhopalostylis sapida, Rhus natalensis, Ribes grossularia, Ribes spp., Robinia pseudoacacia, Rosa spp., Rubus spp., Salix spp., Schyzachyrium sanguineum, Sciadopitys verticillata, Sequoia sempervirens, Sequoiadendron giganteum, Sorghum bicolor, Spinacia spp., Sporobolus fimbriatus, Stiburus alopecuroides, Stylosanthos humilis, Tadehagi spp, Taxodium distichum, Themeda triandra, Trifolium spp., Triticum spp., Tsuga heterophylla, Vaccinium spp., Vicia spp., Vitis vinifera, Watsonia pyramidata, Zantedeschia aethiopica, Zea mays, amaranth, artichoke, asparagus, broccoli, Brussels sprouts, cabbage, canola, carrot, cauliflower, celery, collard greens, flax, kale, lentil, oilseed rape, okra, onion, potato, rice, soybean, strawberry, sugar beet, sugarcane, sunflower, tomato, squash, tea and algae, amongst others.

[0032] Preferably, the plant is a crop plant such as soybean, sunflower, canola, alfalfa, rapeseed, cotton, tomato, potato or tobacco. Further preferably, the plant is a monocotyledonous plant, such as sugarcane. More preferably the plant is a cereal, such as rice, maize, wheat, barley, millet, rye, sorghum or oats.

[0033] The activity of a type I DnaJ-like polypeptide may be increased by raising levels of the polypeptide. Alternatively, activity may also be increased when there is no change in levels of a type I DnaJ-like polypeptide, or even when there is a reduction in levels of a type I DnaJ-like polypeptide. This may occur when the intrinsic properties of the polypeptide are altered, for example, by making mutant versions that are more active that the wild type polypeptide. Reference herein to "preferentially" increasing activity is taken to mean a targeted increase in activity of a type I DnaJ-like polypeptide or a homologue thereof in the cytosol of a plant grown under non-stressed conditions, which increase in activity is above that found in the cytosol of cells of wild type plants grown under comparable conditions.

[0034] The term "type I DnaJ-like polypeptide or a homologue thereof" as defined herein refers to a type I DnaJ polypeptide comprising a CaaX motif at its carboxy terminus.

[0035] Common to all DnaJ proteins is the presence of a J-domain, which consists of approximately 70 amino acids (usually located at the amino terminus of the protein) and which comprises the highly conserved HPD tri-peptide in its middle (InterPro reference IPRO01623; Zdobnov et al., (2002) 18(8): 1149-50); The "J" domain, consisting of four alpha helices, interacts with Hsp70 proteins. In the genome of Arabidopsis thaliana, at least 89 proteins comprising the J-domain have been identified (Miernyk (2001) Cell Stress & Chaperones). To date, 18 Hsp70 proteins have been identified.

[0036] Type I DnaJ domain proteins (or DnaJ proteins) are further characterised by the presence of the following from amino terminus to carboxy terminus: [0037] 1. a G/F domain region of about 30 amino acid residues, rich in glycine (G) and phenylalanine (F), which is proposed to regulate target polypeptide specificity; and [0038] 2. a Cys-rich zinc finger domain containing four repeats of the CXXCXGXG (SEQ ID NO: 66), where X represents a charged or polar residue; these four repeats function in pairs to form zinc binding domain I and II (InterPro reference IPRO01305; Linke et al. (2003) J Biol Chem 278(45): 44457-44466); the zinc finger domain is thought to mediate direct protein:protein interactions and more specifically to bind non-native polypeptides to be delivered to Hsp70; and [0039] 3. a carboxy-terminal domain (CTD; InterPro reference IPR002939).

[0040] In their native form, DnaJ proteins may be targeted to a variety of subcellular compartments, in either a soluble or a membrane-bound form. DnaJ proteins useful in methods of the invention are those without a signal sequence or a transit peptide, and are therefore principally located in the cytosol of a plant cell.

[0041] DnaJ proteins useful in methods of the invention are those comprising a CaaX motif at their carboxy terminus. This polypeptide is thus present in either a soluble or a membrane-bound form, with existence in either form being reversible.

[0042] A "type I DnaJ-like polypeptide or a homologue thereof" may readily be identified using routine techniques well known in the art. For example, stimulation of the ATPase activity of DnaK by DnaJ may readily be determined in vitro as in Zhou et al., (2000), Protein Expression & Purification 19: 253-258. The ability of DnaJ to promote complex formation between DnaK and non-native polypeptides, such as denatured luciferase, may be determined by ELISA (Fan et al., (2004) Molec. Biol. Cell 15: 761-773).

[0043] A "type I DnaJ-like polypeptide or a homologue thereof" may readily be identified using sequence alignment. Methods for the alignment of sequences for comparison are well known in the art, such methods include GAP, BESTFIT, BLAST, FASTA and TFASTA. GAP uses the algorithm of Needleman and Wunsch ((1970) J Mol Biol 48: 443-453) to find the alignment of two complete sequences that maximizes the number of matches and minimizes the number of gaps. The BLAST algorithm (Altschul et al., (1990) J Mol Biol 215: 403-10) calculates percent sequence identity and performs a statistical analysis of the similarity between the two sequences. The software for performing BLAST analysis is publicly available through the National Centre for Biotechnology Information. Homologues of type I DnaJ-like polypeptides and their percentage of identity to the type I DnaJ-like amino acid sequence useful in methods of the invention, as represented by SEQ ID NO: 2, may readily be identified using, for example, the VNTI AlignX multiple alignment program, based on a modified ClustalW algorithm (InforMax, Bethesda, Md.), with default settings for gap opening penalty and gap extension. Preferably, type I DnaJ-like polypeptides or homologues thereof comprising a CaaX motif at their carboxy terminus, and which are useful in methods of the invention, are those having in increasing order of preference at least 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 95% identity to SEQ ID NO: 2.

[0044] Examples of polypeptides covered by the term "type I DnaJ-like polypeptide or a homologue thereof" are listed in Table 1 as SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54 and SEQ ID NO: 56. Type I DnaJ-like polypeptide sequence used to exemplify the invention is as represented by SEQ ID NO: 2.

TABLE-US-00001 TABLE 1 Examples of nucleic acids (DNA SEQ ID) from different organisms encoding type I DnaJ-like polypeptides (Protein SEQ ID) Accession Accession number number Protein SEQ Gene Name DNA DNA SEQ ID protein ID Source CDS1877 AK066420.1 SEQ ID NO: 1 VT SEQ ID NO: 2 Oryza sativa DnaJ Orysa_DNAJ AK10195 SEQ ID NO: 3 VT SEQ ID NO: 4 Oryza sativa II CAAX Orysa_DNAJ AK105028 SEQ ID NO: 5 VT SEQ ID NO: 6 Oryza sativa III CAAX Orysa_DNAJ AK104315 SEQ ID NO: 7 VT SEQ ID NO: 8 Oryza sativa IV CAAX Zeama_ZMDJ1 BT016805* SEQ ID NO: 9 T01643 SEQ ID NO: Zea mays 10 Zeama_DNAJ AY103727.1 SEQ ID NO: VT SEQ ID NO: Zea mays I CAAX 11 12 Zeama_DNAJ AY108160.1 SEQ ID NO: VT SEQ ID NO: Zea mays II CAAX 13 14 Triae_DNAJ BT008914.1 SEQ ID NO: VT SEQ ID NO: Triticum 15 16 aestivum At5g22060 L36113 SEQ ID NO: AAB8679 SEQ ID NO: Arabidopsis AtJ2 CAAX 17 18 thaliana At3g44110 NM_114279 SEQ ID NO: S71199 SEQ ID NO: Arabidopsis AtJ3 CAAX 19 20 thaliana Atrnu_DNAJ L09124 SEQ ID NO: VT SEQ ID NO: Atriplex 21 22 nummularia Cucsa_DNAJ-1 X67695 SEQ ID NO: VT SEQ ID NO: Cucumis 23 24 sativus Dauca_J1P AF308737 SEQ ID NO: VT SEQ ID NO: Daucus carota 25 26 Glyma_pm37 AF169022 SEQ ID NO: VT SEQ ID NO: Glycine max DNAJ 27 28 Hevbr_DNAJ AF085275 SEQ ID NO: AAD1205 SEQ ID NO: Hevea 29 30 brasiliensis Lyces_DNAJ AF124139 SEQ ID NO: AAF28382 SEQ ID NO: Lycopersicum 31 32 esculentum Medsa_DNAJ AJ000995 SEQ ID NO: CAA0444 SEQ ID NO: Medicago 33 34 sativa Nicta_DNAJ AJ299254 SEQ ID NO: CAC1282 SEQ ID NO: Nicotiana 35 36 tabacum Salgi_DNAJ2 AB003137 SEQ ID NO: BAA7688 SEQ ID NO: Salix gilgiana 37 38 Salgi_DNAJ AB015601 SEQ ID NO: BAA3512 SEQ ID NO: Salix gilgiana 39 40 Solto_DNAJ X94301 SEQ ID NO: CAA6396 SEQ ID NO: Solanum 41 42 tuberosum Orysa_DNAJ AK110691 SEQ ID NO: VT SEQ ID NO: Oryza sativa CASQ 43 44 Triae_DNAJ II BT009366 SEQ ID NO: VT SEQ ID NO: Triticum CASQ 45 46 aestivum Ceael_DNaJ NM_072051 SEQ ID NO: NP_50445 SEQ ID NO: Caenorhabditis 47 48 elegans Homsa_HsJ2 D13388 SEQ ID NO: P31689 SEQ ID NO: Homo sapiens 49 50 Sacce_YDJ1 NC_001146 SEQ ID NO: NP_01433 SEQ ID NO: Saccharomyces 51 52 cereviseae Homsa_DNAJ NM_005880 SEQ ID NO: NP_00587 SEQ ID NO: Homo sapiens A2 53 54 Musmu_mDj3 NM_019794 SEQ ID NO: Q9QYJ0 SEQ ID NO: Mus musculus 55 56 VT = virtual translation; *with minor corrections

[0045] It is to be understood that sequences falling under the definition of "type I DnaJ-like polypeptide or homologue thereof" are not to be limited to SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, SEQ ID NO: 16, SEQ ID NO: 18, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32, SEQ ID NO: 34, SEQ ID NO: 36, SEQ ID NO: 38, SEQ ID NO: 40, SEQ ID NO: 42, SEQ ID NO: 44, SEQ ID NO: 46, SEQ ID NO: 48, SEQ ID NO: 50, SEQ ID NO: 52, SEQ ID NO: 54 and SEQ ID NO: 56 listed in Table 1, but that any type I DnaJ-like polypeptide comprising a CaaX motif at its carboxy terminus may be suitable for use in the methods of the invention.

[0046] The nucleic acid encoding a type I DnaJ-like polypeptide or a homologue thereof may be any natural or synthetic nucleic acid. Therefore the term "type I DnaJ-like nucleic acid/gene" as defined herein is any nucleic acid/gene encoding a type I DnaJ-like polypeptide or a homologue thereof as defined hereinabove. Examples of type I DnaJ-like nucleic acids include those listed in Table 1 as SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51 SEQ ID NO: 53 and SEQ ID NO: 55. Type I DnaJ-like nucleic acids/genes and variants thereof may be suitable in practising the methods of the invention. Variant type I DnaJ-like nucleic acid/genes include portions of a type I DnaJ-like nucleic acid/gene and/or nucleic acids capable of hybridising with a type I DnaJ-like nucleic acid/gene.

[0047] The term portion as defined herein refers to a piece of DNA comprising at least 600 nucleotides, which portion encodes a polypeptide of at least 200 amino acids, comprising from the amino terminus to the carboxy terminus, a DnaJ domain, a G/F rich domain and a Cys-rich zinc finger domain, a CTD domain and a CaaX motif. Preferably, the portion comprises at least 1050 nucleotides, which portion encodes a polypeptide of at least 350 amino acids comprising from the amino terminus to the carboxy terminus, a DnaJ domain, a G/F rich domain, a Cys-rich zinc finger domain, a CTD domain and a CaaX motif. Further preferably, a portion as defined above is a portion of a nucleic acid as represented by any one of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51 SEQ ID NO: 53 or SEQ ID NO: 55 of Table 1.

[0048] A portion may be prepared, for example, by making one or more deletions to a type I DnaJ-like nucleic acid. One example consists in removing polynucleotide sequences encoding specific subcellular targeting sequences, such as mitochondrial or plastidic targeting sequences. The portions may be used in isolated form or they may be fused to other coding (or non coding) sequences in order to, for example, produce a protein that combines several activities. When fused to other coding sequences, the resulting polypeptide produced upon translation could be bigger than that predicted for the type I DnaJ-like fragment. For example, an oligonucleotide coding for the farnesylation motif could be fused to a type I DnaJ-like polynucleotide sequence encoding a type I DnaJ-like polypeptide originally lacking this motif. The portion may be fused to another portion of a coding sequence of another member of the type I DnaJ family thereby replacing domains between the two original type I DnaJ-like polypeptides. For example the CTD domain of one type I DnaJ-like polypeptide may be exchanged for the CTD domain of another type I DnaJ-like polypeptide.

[0049] Another variant of a type I DnaJ-like nucleic acid/gene is a nucleic acid capable of hybridising under reduced stringency conditions, preferably under stringent conditions, with a type I DnaJ-like nucleic acid/gene as hereinbefore defined, which hybridising sequence encodes at least the J-domain and the Cys-rich zinc finger domain of a type I DnaJ-like polypeptide. Preferably such variant comprises all of the domains characterizing type I DnaJ-like polypeptides, from the amino terminus to the carboxy terminus, a DnaJ domain, a G/F rich domain, a Cys-rich zinc finger domain and a CTD domain, and additionally a CaaX motif.

[0050] Preferably, the hybridising sequence is one that is capable of hybridising to a nucleic acid as represented by any one of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51 SEQ ID NO: 53 or SEQ ID NO: 55 of Table 1 or to a portion of any of the aforementioned sequences as defined hereinabove.

[0051] The term "hybridisation" as defined herein is a process wherein substantially homologous complementary nucleotide sequences anneal to each other. The hybridisation process can occur entirely in solution, i.e. both complementary nucleic acids are in solution. The hybridisation process can also occur with one of the complementary nucleic acids immobilised to a matrix such as magnetic beads, Sepharose beads or any other resin. The hybridisation process can furthermore occur with one of the complementary nucleic acids immobilised to a solid support such as a nitro-cellulose or nylon membrane or immobilised by e.g. photolithography to, for example, a siliceous glass support (the latter known as nucleic acid arrays or microarrays or as nucleic acid chips). In order to allow hybridisation to occur, the nucleic acid molecules are generally thermally or chemically denatured to melt a double strand into two single strands and/or to remove hairpins or other secondary structures from single stranded nucleic acids. The stringency of hybridisation is influenced by conditions such as temperature, salt concentration, ionic strength and hybridisation buffer composition.

[0052] "Stringent hybridisation conditions" and "stringent hybridisation wash conditions" in the context of nucleic acid hybridisation experiments such as Southern and Northern hybridisations are sequence dependent and are different under different environmental parameters. The skilled artisan is aware of various parameters which may be altered during hybridisation and washing and which will either maintain or change the stringency conditions.

[0053] The T_m is the temperature under defined ionic strength and pH, at which 50% of the target sequence hybridises to a perfectly matched probe. The T_m is dependent upon the solution conditions and the base composition and length of the probe. For example, longer sequences hybridise specifically at higher temperatures. The maximum rate of hybridisation is obtained from about 16° C. up to 32° C. below T_m. The presence of monovalent cations in the hybridisation solution reduce the electrostatic repulsion between the two nucleic acid strands thereby promoting hybrid formation; this effect is visible for sodium concentrations of up to 0.4M. Formamide reduces the melting temperature of DNA-DNA and DNA-RNA duplexes with 0.6 to 0.7° C. for each percent formamide, and addition of 50% formamide allows hybridisaton to be performed at 30 to 45° C., though the rate of hybridisation will be lowered. Base pair mismatches reduce the hybridisation rate and the thermal stability of the duplexes. On average and for large probes, the T_m decreases about 1° C. per % base mismatch. The T_m may be calculated using the following equations, depending on the types of hybrids: [0054] 1. DNA-DNA hybrids (Meinkoth and Wahl, Anal. Biochem., 138: 267-284, 1984): [0055] T_m=81.5° C.+16.6×log [Na.sup.+]^a+0.41×%[G/C^b]-500×[L^c]^-1-0.61.- times.% formamide [0056] 2. DNA-RNA or RNA-RNA hybrids: [0057] T_m=79.8+18.5 (log₁₀[Na.sup.+]^a)+0.58 (% G/C^b)+11.8 (% G/C^b)²-820/L^c [0058] 3. oligo-DNA or oligo-RNA^d hybrids: [0059] For <20 nucleotides: T_m=2 (l_n) [0060] For 20-35 nucleotides: T_m=22+1.46 (l_n) ^a or for other monovalent cation, but only accurate in the 0.01-0.4 M range.^b only accurate for % GC in the 30% to 75% range.^c L=length of duplex in base pairs.^d Oligo, oligonucleotide; l_n, effective length of primer=2×(no. of G/C)+(no. of A/T). Note: for each 1% formamide, the T_m is reduced by about 0.6 to 0.7° C., while the presence of 6 M urea reduces the T_m by about 30° C.

[0061] Specificity of hybridisation is typically the function of post-hybridisation washes. To remove background resulting from non-specific hybridisation, samples are washed with dilute salt solutions. Critical factors of such washes include the ionic strength and temperature of the final wash solution: the lower the salt concentration and the higher the wash temperature, the higher the stringency of the wash. Wash conditions are typically performed at or below hybridisation stringency. Generally, suitable stringent conditions for nucleic acid hybridisation assays or gene amplification detection procedures are as set forth above. Conditions of greater or less stringency may also be selected. Generally, low stringency conditions are selected to be about 50° C. lower than the thermal melting point (T_m) for the specific sequence at a defined ionic strength and pH. Medium stringency conditions are when the temperature is 20° C. below T_m, and high stringency conditions are when the temperature is 10° C. below T_m. For example, stringent conditions are those that are at least as stringent as, for example, conditions A-L; and reduced stringency conditions are at least as stringent as, for example, conditions M-R. Non-specific binding may be controlled using any one of a number of known techniques such as, for example, blocking the membrane with protein containing solutions, additions of heterologous RNA, DNA, and SDS to the hybridisation buffer, and treatment with RNase. Examples of hybridisation and wash conditions are listed in Table 2 below.

TABLE-US-00002 TABLE 2 Examples of hybridisation and wash conditions ##STR00001## .sup..dagger-dbl. The "hybrid length" is the anticipated length for the hybridising nucleic acid. When nucleic acids of known sequence are hybridised, the hybrid length may be determined by aligning the sequences and identifying the conserved regions described herein. .sup.† SSPE (1 × SSPE is 0.15 M NaCl, 10 mM NaH₂PO₄, and 1.25 mM EDTA, pH 7.4) may be substituted for SSC (1 × SSC is 0.15 M NaCl and 15 mM sodium citrate) is the hybridisation and wash buffers; washes are performed for 15 minutes after hybridisation is complete. The hybridisations and washes may additionally include 5 × Denhardt's reagent, 0.5-1.0% SDS, 100 μg/ml denatured, fragmented salmon sperm DNA, 0.5% sodium pyrophosphate, and up to 50% formamide. *Tb-Tr: The hybridisation temperature for hybrids anticipated to be less than 50 base pairs in length should be 5-10° C. less than the melting temperature T_m of the hybrids; the T_m is determined according to the above- mentioned equations. .sup.± The present invention also encompasses the subsititution of any one, or more DNA or RNA hybrid partners with either a PNA, or a modified nucleic acid.

[0062] For the purposes of defining the level of stringency, reference can be made to Sambrook et al., (2001) Molecular Cloning: a laboratory manual, 3^rd Edition Cold Spring Harbor Laboratory Press, CSH, New York or to Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989).

[0063] A type I DnaJ-like nucleic acid or variant thereof may be derived from any natural or artificial source. This nucleic acid may be modified from its native form in composition and/or genomic environment through deliberate human manipulation. The nucleic acid is either of prokaryotic or eukaryotic origin, from a microbial source, such as yeast or fungi, or from a plant, algae or animal (including human) source. Preferably the nucleic acid is of eukaryotic origin. The nucleic acid is further preferably of plant origin, whether from the same plant species (for example to the one in which it is to be introduced) or whether from a different plant species. The nucleic acid may be isolated from a monocotyledonous species, preferably from the family Poaceae, further preferably from Oryza sativa. More preferably, the type I DnaJ-like nucleic acid isolated from Oryza sativa is represented by SEQ ID NO: 1 and the type I DnaJ-like amino acid sequence is as represented by SEQ ID NO: 2.

[0064] The activity of a type I DnaJ-like polypeptide or a homologue thereof may be increased by introducing a genetic modification (preferably in the locus of a type I DnaJ-like gene). The locus of a gene as defined herein is taken to mean a genomic region, which includes the gene of interest and 10 KB up- or downstream of the coding region.

[0065] The genetic modification may be introduced, for example, by any one (or more) of the following methods: T-DNA activation, tilling, site-directed mutagenesis, directed evolution and homologous recombination or by introducing and/or expressing in the cytosol of a plant cell a nucleic acid encoding a type DnaJ-like polypeptide or a homologue thereof, which type I DnaJ-like polypeptide comprises a CaaX motif at its carboxy terminus. Following introduction of the genetic modification, there follows an optional step of selecting for increased activity in the cytosol of a plant cell of a type I DnaJ-like polypeptide, which increase in activity in the gives plants having increased plant yield under non-stress conditions.

[0066] T-DNA activation tagging (Hayashi et al., Science (1992) 1350-1353) involves insertion of T-DNA usually containing a promoter (may also be a translation enhancer or an intron), in the genomic region of the gene of interest or 10 KB up- or downstream of the coding region of a gene in a configuration such that the promoter directs expression of the targeted gene. Typically, regulation of expression of the targeted gene by its natural promoter is disrupted and the gene falls under the control of the newly introduced promoter. The promoter is typically embedded in a T-DNA. This T-DNA is randomly inserted into the plant genome, for example, through Agrobacterium infection and leads to overexpression of genes near the inserted T-DNA. The resulting transgenic plants show dominant phenotypes due to overexpression of genes close to the introduced promoter. The promoter to be introduced may be any promoter capable of directing expression of a gene in the desired organism, in this case a plant. For example, constitutive, tissue-specific, cell type-specific and inducible promoters are all suitable for use in T-DNA activation. Preferably, the promoter is one capable driving expression of the gene in plant seed tissue.

[0067] A genetic modification may also be introduced in the locus of a type I DnaJ-like gene using the technique of TILLING (Targeted Induced Local Lesions In Genomes). This is a mutagenesis technology useful to generate and/or identify, and to eventually isolate mutagenised variants of a type I DnaJ-like nucleic acid capable of exhibiting DnaJ-like activity. TILLING also allows selection of plants carrying such mutant variants. These mutant variants may even exhibit higher DnaJ-like activity than that exhibited by the gene in its natural form. TILLING combines high-density mutagenesis with high-throughput screening methods. The steps typically followed in TILLING are: (a) EMS mutagenesis (Redei GP and Koncz C (1992) In Methods in Arabidopsis Research, Koncz C, Chua N H, Schell J, eds. Singapore, World Scientific Publishing Co, pp. 16-82; Feldmann et al., (1994) In Meyerowitz E M, Somerville C R, eds, Arabidopsis. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., pp 137-172; Lightner J and Caspar T (1998) In J Martinez-Zapater, J Salinas, eds, Methods on Molecular Biology, Vol. 82. Humana Press, Totowa, N.J., pp 91-104); (b) DNA preparation and pooling of individuals; (c) PCR amplification of a region of interest; (d) denaturation and annealing to allow formation of heteroduplexes; (e) DHPLC, where the presence of a heteroduplex in a pool is detected as an extra peak in the chromatogram; (f) identification of the mutant individual; and (g) sequencing of the mutant PCR product. Methods for TILLING are well known in the art (McCallum et al., (2000) Nat Biotechnol 18: 455-457; reviewed by Stemple (2004) Nat Rev Genet. 5(2): 145-50).

[0068] Site-directed mutagenesis may be used to generate variants of type I DnaJ-like nucleic acids or portions thereof. Several methods are available to achieve site-directed mutagenesis, the most common being PCR based methods (Current Protocols in Molecular Biology. Wiley Eds.).

[0069] Directed evolution may be used which consists of iterations of DNA shuffling followed by appropriate screening and/or selection to generate variants of type I DnaJ-like nucleic acids or portions thereof encoding type I DnaJ-like polypeptides or homologues or portions thereof having an increased biological activity (Castle et al., (2004) Science 304(5674): 1151-4; U.S. Pat. Nos. 5,811,238 and 6,395,547).

[0070] T-DNA activation, TILLING, site-directed mutagenesis and directed evolution are examples of technologies that enable the generation of novel alleles and type I DnaJ-like variants.

[0071] Homologous recombination allows introduction in a genome of a selected nucleic acid at a defined selected position. Homologous recombination is a standard technology used routinely in biological sciences for lower organisms such as yeast or the moss Physcomitrella. Methods for performing homologous recombination in plants have been described not only for model plants (Offring a et al., (1990) EMBO J. 9(10): 3077-84) but also for crop plants, for example rice (Terada et al., (2002) Nat Biotech 20(10): 1030-4; lida and Terada (2004) Curr Opin Biotech 15(2):132-8). The nucleic acid to be targeted (which may be a type I DnaJ-like nucleic acid or variant thereof as hereinbefore defined) is targeted to the locus of a type I DnaJ-like gene. The nucleic acid to be targeted may be an improved allele used to replace the endogenous gene or may be introduced in addition to the endogenous gene.

[0072] According to a preferred embodiment of the invention, plant yield may be increased by introducing and/or expressing in the cytosol of a plant cell a nucleic acid encoding a type I DnaJ-like polypeptide or a homologue thereof, which type I DnaJ-like polypeptide or homologue thereof comprises a CaaX motif at its carboxy terminus.

[0073] A preferred method for introducing a genetic modification (which in this case need not be in the locus of a type I DnaJ-like gene) is to introduce and/or express in the cytosol of a plant cell an exogenous nucleic acid encoding a type I DnaJ-like polypeptide or a homologue thereof, which exogenous type I DnaJ-like polypeptide or a homologue thereof comprises a CaaX motif at its carboxy terminus. The nucleic acid to be introduced into a plant may be a full-length nucleic acid or may be a portion or a hybridizing sequence as hereinbefore defined.

[0074] The term "exogenous" as defined herein refers to an isolated gene/nucleic acid, which may be from the same or different plant species, for example an isolated rice gene/nucleic acid introduced and/or expressed in a rice plant is "exogenous" according to the definition above.

[0075] "Homologues" of a protein encompass peptides, oligopeptides, polypeptides, proteins and enzymes having amino acid substitutions, deletions and/or insertions relative to the unmodified protein in question and having similar biological and functional activity as the unmodified protein from which they are derived. To produce such homologues, amino acids of the protein may be replaced by other amino acids having similar properties (such as similar hydrophobicity, hydrophilicity, antigenicity, propensity to form or break α-helical structures or β-sheet structures). Conservative substitution tables are well known in the art (see for example Creighton (1984) Proteins. W.H. Freeman and Company). Table 3 below gives examples of conserved amino acid substitutions.

TABLE-US-00003 TABLE 3 Examples of conserved amino acid substitutions Conservative Residue Substitutions Ala Ser Arg Lys Asn Gln; His Asp Glu Gln Asn Cys Ser Glu Asp Gly Pro His Asn; Gln Ile Leu, Val Leu Ile; Val Lys Arg; Gln Met Leu; Ile Phe Met; Leu; Tyr Ser Thr; Gly Thr Ser; Val Trp Tyr Tyr Trp; Phe Val Ile; Leu

[0076] Homologues include orthologues and paralogoues, which encompass evolutionary concepts used to describe ancestral relationships of genes. Paralogues are genes within the same species that have originated through duplication of an ancestral gene and orthologues are genes from different organisms that have originated through speciation.

[0077] Orthologues in, for example, monocot plant species may easily be found by performing a so-called reciprocal blast search. This may be done by a first blast involving blasting a query sequence (for example, SEQ ID NO: 1 or SEQ ID NO: 2) against any sequence database, such as the publicly available NCBI database which may be found at the NCBI web site. BLASTN or TBLASTX (using standard default values) may be used when starting from a nucleotide sequence and BLASTP or TBLASTN (using standard default values) may be used when starting from a protein sequence. The BLAST results may optionally be filtered. The full-length sequences of either the filtered results or non-filtered results are then BLASTed back (second BLAST) against sequences from the organism from which the query sequence is derived (where the query sequence is SEQ ID NO: 1 or SEQ ID NO: 2 the second blast would therefore be against rice sequences). The results of the first and second BLASTs are then compared. A paralogue is identified if a high-ranking hit from the second blast is from the same species as from which the query sequence is derived; an orthologue is identified if a high-ranking hit is not from the same species as from which the query sequence is derived. High-ranking hits are those having a low E-value. The lower the E-value, the more significant the score (or in other words the lower the chance that the hit was found by chance). Computation of the E-value is well known in the art. In the case of large families, ClustalW may be used, followed by a neighbour joining tree, to help visualize clustering of related genes and to identify orthologues and paralogues.

[0078] A homologue may be in the form of a "substitutional variant" of a protein, i.e. where at least one residue in an amino acid sequence has been removed and a different residue inserted in its place. Amino acid substitutions are typically of single residues, but may be clustered depending upon functional constraints placed upon the polypeptide; insertions will usually be of the order of about 1 to 10 amino acid residues. Preferably, amino acid substitutions comprise conservative amino acid substitutions (see Table 3 above).

[0079] A homologue may also be in the form of an "insertional variant" of a protein, i.e. where one or more amino acid residues are introduced into a predetermined site in a protein. Insertions may comprise amino-terminal and/or carboxy-terminal fusions as well as intra-sequence insertions of single or multiple amino acids. Generally, insertions within the amino acid sequence will be smaller than amino- or carboxy-terminal fusions, of the order of about 1 to 10 residues. Examples of amino- or carboxy-terminal fusion proteins or peptides include the binding domain or activation domain of a transcriptional activator as used in the yeast two-hybrid system, phage coat proteins, (histidine)₆-tag, glutathione S-transferase-tag, protein A, maltose-binding protein, dihydrofolate reductase, Tag-100 epitope, c-myc epitope, FLAG®-epitope, lacZ, CMP (calmodulin-binding peptide), HA epitope, protein C epitope and VSV epitope.

[0080] Homologues in the form of "deletion variants" of a protein are characterised by the removal of one or more amino acids from a protein. One example of such a deletion variant is to remove the mitochondrial or plastidic targeting sequences from type I DnaJ-like proteins otherwise targeted to these organelles.

[0081] Amino acid variants of a protein may readily be made using peptide synthetic techniques well known in the art, such as solid phase peptide synthesis and the like, or by recombinant DNA manipulation. Methods for the manipulation of DNA sequences to produce substitution, insertion or deletion variants of a protein are well known in the art. For example, techniques for making substitution mutations at predetermined sites in DNA are well known to those skilled in the art and include M13 mutagenesis, T7-Gen in vitro mutagenesis (USB, Cleveland, Ohio), QuickChange Site Directed mutagenesis (Stratagene, San Diego, Calif.), PCR-mediated site-directed mutagenesis or other site-directed mutagenesis protocols.

[0082] The type I DnaJ-like polypeptide or homologue thereof may be a derivative. "Derivatives" include peptides, oligopeptides, polypeptides, proteins and enzymes which may comprise substitutions, deletions or additions of naturally and non-naturally occurring amino acid residues compared to the amino acid sequence of a naturally-occurring form of the protein, for example, as presented in SEQ ID NO: 2. "Derivatives" of a protein encompass peptides, oligopeptides, polypeptides, proteins and enzymes which may comprise naturally occurring altered, glycosylated, acylated, prenylated or non-naturally occurring amino acid residues compared to the amino acid sequence of a naturally-occurring form of the polypeptide. A derivative may also comprise one or more non-amino acid substituents compared to the amino acid sequence from which it is derived, for example a reporter molecule or other ligand, covalently or non-covalently bound to the amino acid sequence, such as a reporter molecule which is bound to facilitate its detection, and non-naturally occurring amino acid residues relative to the amino acid sequence of a naturally-occurring protein.

[0083] The type I DnaJ-like polypeptide or homologue thereof may be encoded by an alternative splice variant of a type I DnaJ-like nucleic acid/gene. The term "alternative splice variant" as used herein encompasses variants of a nucleic acid sequence in which selected introns and/or exons have been excised, replaced or added, or in which introns have been shortened or lengthened. Such variants will be ones in which the biological activity of the protein is retained, which may be achieved by selectively retaining functional segments of the protein. Such splice variants may be found in nature or may be manmade. Methods for making such splice variants are well known in the art. Preferred are splice variants encoding a polypeptide being a type I DnaJ-like polypeptide or a homologue thereof, which type I DnaJ-like polypeptide or homologue thereof comprises a CaaX motif at its carboxy terminus, particularly splice variants of SEQ ID NO: 1.

[0084] The homologue may also be encoded by an allelic variant of a nucleic acid encoding a type I DnaJ-like polypeptide or a homologue thereof, preferably an allelic variant of the nucleic acid represented by SEQ ID NO: 1. Further preferably, the polypeptide encoded by the allelic variant is a type I DnaJ-like polypeptide or a homologue thereof, which type I DnaJ-like polypeptide or homologue thereof comprises a CaaX motif at its carboxy terminus.

[0085] Allelic variants exist in nature, and encompassed within the methods of the present invention is the use of these natural alleles. Allelic variants encompass Single Nucleotide Polymorphisms (SNPs), as well as Small Insertion/Deletion Polymorphisms (INDELs). The size of INDELs is usually less than 100 bp. SNPs and INDELs form the largest set of sequence variants in naturally occurring polymorphic strains of most organisms.

[0086] According to a preferred aspect of the present invention, enhanced or increased expression of the type I DnaJ-like nucleic acid or variant thereof is envisaged. Methods for obtaining enhanced or increased expression of genes or gene products are well documented in the art and include, for example, overexpression driven by appropriate promoters, the use of transcription enhancers or translation enhancers. Isolated nucleic acids which serve as promoter or enhancer elements may be introduced in an appropriate position (typically upstream) of a non-heterologous form of a polynucleotide so as to upregulate expression of a type I DnaJ-like nucleic acid or variant thereof. For example, endogenous promoters may be altered in vivo by mutation, deletion, and/or substitution (see, Kmiec, U.S. Pat. No. 5,565,350; Zarling et al., PCT/US93/03868), or isolated promoters may be introduced into a plant cell in the proper orientation and distance from a gene of the present invention so as to control the expression of the gene.

[0087] If polypeptide expression is desired, it is generally desirable to include a polyadenylation region at the 3'-end of a polynucleotide coding region. The polyadenylation region can be derived from the natural gene, from a variety of other plant genes, or from T-DNA. The 3' end sequence to be added may be derived from, for example, the nopaline synthase or octopine synthase genes, or alternatively from another plant gene, or less preferably from any other eukaryotic gene.

[0088] An intron sequence may also be added to the 5' untranslated region or the coding sequence of the partial coding sequence to increase the amount of the mature message that accumulates in the cytosol. Inclusion of a spliceable intron in the transcription unit in both plant and animal expression constructs has been shown to increase gene expression at both the mRNA and protein levels up to 1000-fold, Buchman and Berg, Mol. Cell. biol. 8:4395-4405 (1988); Callis et al., Genes Dev. 1:1183-1200 (1987). Such intron enhancement of gene expression is typically greatest when placed near the 5' end of the transcription unit. Use of the maize introns Adh1-S intron 1, 2, and 6, the Bronze-1 intron are known in the art. See generally, The Maize Handbook, Chapter 116, Freeling and Walbot, Eds., Springer, N.Y. (1994).

[0089] The invention also provides genetic constructs and vectors to facilitate introduction and/or expression of the nucleotide sequences useful in the methods according to the invention.

Therefore, there is provided a gene construct comprising: [0090] (i) a nucleic acid or variant thereof encoding a type I DnaJ-like polypeptide or a homologue thereof, which type I DnaJ-like polypeptide or homologue thereof comprises a CaaX motif at its carboxy terminus; and [0091] (ii) one or more control sequences capable of driving expression of the nucleic acid sequence of (i); and optionally [0092] (iii) a transcription termination sequence.

[0093] Also provided by the present invention is the use of a construct, as defined herein, in methods for increasing plant yield in plants grown under non-stress conditions.

[0094] Constructs useful in the methods according to the present invention may be constructed using recombinant DNA technology well known to persons skilled in the art. The gene constructs may be inserted into vectors, which may be commercially available, suitable for transforming into plants and suitable for expression of the gene of interest in the transformed cells.

[0095] Plants are transformed with a vector comprising the sequence of interest (i.e., nucleic acid or variant thereof encoding a type I DnaJ-like polypeptide or homologue thereof that comprises a CaaX motif at its carboxy terminus). The sequence of interest is operably linked to one or more control sequences (at least to a promoter). The terms "regulatory element", "control sequence" and "promoter" are all used interchangeably herein and are to be taken in a broad context to refer to regulatory nucleic acid sequences capable of effecting expression of the sequences to which they are ligated. Encompassed by the aforementioned terms are transcriptional regulatory sequences derived from a classical eukaryotic genomic gene (including the TATA box which is required for accurate transcription initiation, with or without a CCAAT box sequence) and additional regulatory elements (i.e. upstream activating sequences, enhancers and silencers) which alter gene expression in response to developmental and/or external stimuli, or in a tissue-specific manner. Also included within the term is a transcriptional regulatory sequence of a classical prokaryotic gene, in which case it may include a -35 box sequence and/or -10 box transcriptional regulatory sequences. The term "regulatory element" also encompasses a synthetic fusion molecule or derivative that confers, activates or enhances expression of a nucleic acid molecule in a cell, tissue or organ. The term "operably linked" as used herein refers to a functional linkage between the promoter sequence and the gene of interest, such that the promoter sequence is able to initiate transcription of the gene of interest.

[0096] Advantageously, any type of promoter, whether natural or synthetic, may be used to drive expression of the nucleic acid sequence. Preferably, the promoter is a tissue-specific promoter, i.e. one that is capable of preferentially initiating transcription in certain tissues, such as the leaves, roots, seed tissue etc. Plant-derived promoters are particularly preferred, especially plant-derived tissue-specific promoters. The term "tissue-specific" as defined herein refers to a promoter that is expressed predominantly in at least one plant tissue or organ, but which may have residual expression elsewhere in the plant due to leaky promoter expression. Further preferably, the tissue-specific promoter is a seed-specific promoter, more particularly a promoter isolated from a gene encoding a seed-storage protein, especially an endosperm-specific promoter. Most preferably the endosperm-specific promoter is isolated from a prolamin gene, such as a rice prolamin RP6 (Wen et al., (1993) Plant Physiol 101(3): 1115-6) promoter as represented by SEQ ID NO: 57, or a promoter of similar strength and/or a promoter with a similar expression pattern as the rice prolamin promoter. Similar strength and/or similar expression pattern may be analysed, for example, by coupling the promoters to a reporter gene and checking the function of the reporter gene in tissues of the plant. One well-known reporter gene is beta-glucuronidase and the colorimetric GUS stain used to visualize beta-glucuronidase activity in plant tissue. It should be clear that the applicability of the present invention is not restricted to the type I DnaJ-like nucleic acid represented by SEQ ID NO: 1, nor is the applicability of the invention restricted to expression of a type I DnaJ-like nucleic acid when driven by a prolamin promoter.

[0097] Examples of seed-specific promoters are presented in Table 4, which promoters or derivatives thereof are useful in performing the methods of the present invention. It should be understood that the list below is not exhaustive.

TABLE-US-00004 TABLE 4 Examples of seed-specific promoters for use in the present invention GENE SOURCE EXPRESSION PATTERN REFERENCE seed-specific genes seed Simon, et al., Plant Mol. Biol. 5: 191, 1985; Scofield, et al., J. Biol. Chem. 262: 12202, 1987; Baszczynski, et al., Plant Mol. Biol. 14: 633, 1990. Brazil Nut albumin seed Pearson, et al., Plant Mol. Biol. 18: 235-245, 1992. legumin seed Ellis, et al., Plant Mol. Biol. 10: 203-214, 1988. glutelin (rice) seed Takaiwa, et al., Mol. Gen. Genet. 208: 15-22, 1986; Takaiwa, et al., FEBS Letts. 221: 43-47, 1987. zein seed Matzke et al., Plant Mol Biol, 14(3): 323-32, 1990. napA seed Stalberg, et al., Planta 199: 515-519, 1996. wheat LMW and HMW endosperm Mol Gen Genet 216: 81-90, 1989; NAR glutenin-1 17: 461-2, 1989. wheat SPA seed Albani et al., Plant Cell, 9: 171-184, 1997. wheat α, β, γ-gliadins endosperm EMBO 3: 1409-15, 1984. barley ltr1 promoter endosperm barley B1, C, D, hordein endosperm Theor Appl Gen 98: 1253-62, 1999; Plant J 4: 343-55, 1993; Mol Gen Genet 250: 750-60, 1996. barley DOF endosperm Mena et al., The Plant Journal, 116(1): 53-62, 1998. blz2 endosperm EP99106056.7 synthetic promoter endosperm Vicente-Carbajosa et al., Plant J. 13: 629-640, 1998. rice prolamin NRP33 endosperm Wu et al., Plant Cell Physiology 39(8) 885-889, 1998. rice α-globulin Glb-1 endosperm Wu et al., Plant Cell Physiology 39(8) 885-889, 1998. rice OSH1 embryo Sato et al., Proc. Natl. Acad. Sci. USA, 93: 8117-8122, 1996. rice α-globulin endosperm Nakase et al., Plant Mol. Biol. 33: 513-522, REB/OHP-1 1997. rice ADP-glucose PP endosperm Trans Res 6: 157-68, 1997. maize ESR gene family endosperm Plant J 12: 235-46, 1997. sorgum γ-kafirin endosperm PMB 32: 1029-35, 1996. KNOX embryo Postma-Haarsma et al., Plant Mol. Biol. 39: 257-71, 1999. rice oleosin embryo and aleurone Wu et al., J. Biochem., 123: 386, 1998. sunflower oleosin seed (embryo and dry seed) Cummins et al., Plant Mol. Biol. 19: 873-876, 1992.

[0098] Optionally, one or more terminator sequences may also be used in the construct introduced into a plant. The term "terminator" encompasses a control sequence which is a DNA sequence at the end of a transcriptional unit which signals 3' processing and polyadenylation of a primary transcript and termination of transcription. Additional regulatory elements may include transcriptional as well as translational enhancers. Those skilled in the art will be aware of terminator and enhancer sequences that may be suitable for use in performing the invention. Such sequences would be known or may readily be obtained by a person skilled in the art.

[0099] The genetic constructs of the invention may further include an origin of replication sequence that is required for maintenance and/or replication in a specific cell type. One example is when a genetic construct is required to be maintained in a bacterial cell as an episomal genetic element (e.g. plasmid or cosmid molecule). Preferred origins of replication include, but are not limited to, the f1-ori and colE1.

[0100] The genetic construct may optionally comprise a selectable marker gene. As used herein, the term "selectable marker gene" includes any gene that confers a phenotype on a cell in which it is expressed to facilitate the identification and/or selection of cells that are transfected or transformed with a nucleic acid construct of the invention. Suitable markers may be selected from markers that confer antibiotic or herbicide resistance, that introduce a new metabolic trait or that allow visual selection. Examples of selectable marker genes include genes conferring resistance to antibiotics (such as nptII that phosphorylates neomycin and kanamycin, or hptII, phosphorylating hygromycin), to herbicides (for example bar which provides resistance to Basta; aroA or gox providing resistance against glyphosate), or genes that provide a metabolic trait (such as manA that allows plants to use mannose as sole carbon source). Visual marker genes result in the formation of colour (for example β-glucuronidase, GUS), luminescence (such as luciferase) or fluorescence (Green Fluorescent Protein, GFP, and derivatives thereof).

[0101] The present invention also encompasses plants and plant parts obtainable by the methods according to the present invention. The present invention therefore provides plants and parts thereof obtainable by the methods according to the present invention, which plants have introduced therein a nucleic acid or variant thereof encoding a type I DnaJ-like polypeptide or a homologue thereof, which type I DnaJ-like polypeptide or homologue thereof comprises a CaaX motif at its carboxy terminus.

[0102] The invention also provides a method for the production of transgenic plants having increased plant yield when grown under non-stress conditions, comprising introduction and/or expression in the cytosol of a plant cell of a nucleic acid or a variant thereof encoding a type I DnaJ-like polypeptide or a homologue thereof, which type I DnaJ-like polypeptide or homologue thereof comprises a CaaX motif at its carboxy terminus.

[0103] More specifically, the present invention provides a method for the production of transgenic plants with increased yield which method comprises: [0104] (i) introducing and/or expressing in the cytosol of plant, plants part or plant cell a nucleic acid or variant thereof encoding a type I DnaJ-like polypeptide or a homologue thereof, which type I DnaJ-like polypeptide or homologue thereof comprises a CaaX motif at its carboxy terminus; and [0105] (ii) cultivating the plant, plant part or plant cell under non-stress conditions promoting plant growth and development.

[0106] The nucleic acid may be introduced directly into a plant cell or into the plant itself (including introduction into a tissue, organ or any other part of a plant). According to a preferred feature of the present invention, the nucleic acid is preferably introduced into a plant by transformation.

[0107] The term "transformation" as referred to herein encompasses the transfer of an exogenous polynucleotide into a host cell, irrespective of the method used for transfer. Plant tissue capable of subsequent clonal propagation, whether by organogenesis or embryogenesis, may be transformed with a genetic construct of the present invention and a whole plant regenerated there from. The particular tissue chosen will vary depending on the clonal propagation systems available for, and best suited to, the particular species being transformed. Exemplary tissue targets include leaf disks, pollen, embryos, cotyledons, hypocotyls, megagametophytes, callus tissue, existing meristematic tissue (e.g., apical meristem, axillary buds, and root meristems), and induced meristem tissue (e.g., cotyledon meristem and hypocotyl meristem). The polynucleotide may be transiently or stably introduced into a host cell and may be maintained non-integrated, for example, as a plasmid. Alternatively, it may be integrated into the host genome. The resulting transformed plant cell may then be used to regenerate a transformed plant in a manner known to persons skilled in the art.

[0108] Transformation of plant species is now a fairly routine technique. Advantageously, any of several transformation methods may be used to introduce the gene of interest into a suitable ancestor cell. Transformation methods include the use of liposomes, electroporation, chemicals that increase free DNA uptake, injection of the DNA directly into the plant, particle gun bombardment, transformation using viruses or pollen and microprojection. Methods may be selected from the calcium/polyethylene glycol method for protoplasts (Krens F A et al., (1982) Nature 296, 72-74; Negrutiu I et al., (1987) Plant Mol Biol 8: 363-373); electroporation of protoplasts (Shillito R D et al., 1985 Bio/Technol 3, 1099-1102); microinjection into plant material (Crossway A et al., (1986) Mol. Gen. Genet. 202: 179-185); DNA or RNA-coated particle bombardment (Klein T M et al., (1987) Nature 327: 70) infection with (non-integrative) viruses and the like. Transgenic rice plants expressing a type I DnaJ-like nucleic acid/gene are preferably produced via Agrobacterium-mediated transformation using any of the well known methods for rice transformation, such as described in any of the following: published European patent application EP 1198985 A1, Aldemita and Hodges (Planta 199: 612-617, 1996); Chan et al., (Plant Mol Biol 22 (3): 491-506, 1993), Hiei et al., (Plant J 6 (2): 271-282, 1994), which disclosures are incorporated by reference herein as if fully set forth. In the case of corn transformation, the preferred method is as described in either Ishida et al., (Nat. Biotechnol 14(6): 745-50, 1996) or Frame et al., (Plant Physiol 129(1): 13-22, 2002), which disclosures are incorporated by reference herein as if fully set forth.

[0109] Generally after transformation, plant cells or cell groupings are selected for the presence of one or more markers which are encoded by plant-expressible genes co-transferred with the gene of interest, following which the transformed material is regenerated into a whole plant.

[0110] Following DNA transfer and regeneration, putatively transformed plants may be evaluated, for instance using Southern analysis, for the presence of the gene of interest, copy number and/or genomic organisation. Alternatively or additionally, expression levels of the newly introduced DNA may be monitored using Northern and/or Western analysis, both techniques being well known to persons having ordinary skill in the art.

[0111] The generated transformed plants may be propagated by a variety of means, such as by clonal propagation or classical breeding techniques. For example, a first generation (or T1) transformed plant may be selfed to give homozygous second generation (or T2) transformants, and the T2 plants further propagated through classical breeding techniques.

[0112] The generated transformed organisms may take a variety of forms. For example, they may be chimeras of transformed cells and non-transformed cells; clonal transformants (e.g., all cells transformed to contain the expression cassette); grafts of transformed and untransformed tissues (e.g., in plants, a transformed rootstock grafted to an untransformed scion).

[0113] The present invention clearly extends to any plant cell or plant produced by any of the methods described herein, and to all plant parts and propagules thereof. The present invention extends further to encompass the progeny of a primary transformed or transfected cell, tissue, organ or whole plant that has been produced by any of the aforementioned methods, the only requirement being that progeny exhibit the same genotypic and/or phenotypic characteristic(s) as those produced in the parent by the methods according to the invention. The invention also includes host cells containing an isolated type I DnaJ-like nucleic acid or variant thereof. Preferred host cells according to the invention are plant cells. The invention also extends to harvestable parts of a plant such as but not limited to seeds, leaves, fruits, flowers, stem cultures, rhizomes, tubers and bulbs. The invention furthermore relates to products derived, preferably directly derived from a harvestable part of such a plant, such products may be dry pellets or powders, oils, fats and fatty acids, starch or proteins.

[0114] The present invention also encompasses the use of type I DnaJ-like nucleic acids or variants thereof and the use of type I DnaJ-like polypeptides or homologues thereof, which type I DnaJ-like polypeptide or homologue thereof comprises a CaaX motif at its carboxy terminus. One such use relates to improving plant yield, especially in increasing yield as defined hereinabove.

[0115] Type I DnaJ-like nucleic acids or variants thereof, or type I DnaJ-like polypeptides or homologues thereof, may find use in breeding programmes in which a DNA marker is identified which may be genetically linked to a type I DnaJ-like gene or variant thereof. The type I DnaJ-like nucleic acids/genes or variants thereof, or type I DnaJ-like polypeptides or homologues thereof may be used to define a molecular marker. This DNA or protein marker may then be used in breeding programmes to select plants having increased plant yield. The type I DnaJ-like gene or variant thereof may, for example, be a nucleic acid as represented by any one of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51 SEQ ID NO: 53 or SEQ ID NO: 55 of Table 1.

[0116] Allelic variants of a type I DnaJ-like nucleic acid/gene may also find use in marker-assisted breeding programmes. Such breeding programmes sometimes require introduction of allelic variation by mutagenic treatment of the plants, using for example EMS mutagenesis; alternatively, the programme may start with a collection of allelic variants of so called "natural" origin caused unintentionally. Identification of allelic variants then takes place, for example, by PCR. This is followed by a step for selection of superior allelic variants of the sequence in question and which give increased yield in a plant. Selection is typically carried out by monitoring yield performance of plants containing different allelic variants of the sequence in question, for example, different allelic variants of any one of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, SEQ ID NO: 15, SEQ ID NO: 17, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31, SEQ ID NO: 33, SEQ ID NO: 35, SEQ ID NO: 37, SEQ ID NO: 39, SEQ ID NO: 41, SEQ ID NO: 43, SEQ ID NO: 45, SEQ ID NO: 47, SEQ ID NO: 49, SEQ ID NO: 51 SEQ ID NO: 53 or SEQ ID NO: 55 of Table 1. Yield performance may be monitored in a greenhouse or in the field. Further optional steps include crossing plants, in which the superior allelic variant was identified, with another plant. This could be used, for example, to make a combination of interesting phenotypic features.

[0117] A type I DnaJ-like nucleic acid or variant thereof may also be used as probes for genetically and physically mapping the genes that they are a part of, and as markers for traits linked to those genes. Such information may be useful in plant breeding in order to develop lines with desired phenotypes. Such use of type I DnaJ-like nucleic acids or variants thereof requires only a nucleic acid sequence of at least 15 nucleotides in length. The type I DnaJ-like nucleic acids or variants thereof may be used as restriction fragment length polymorphism (RFLP) markers. Southern blots (Sambrook J, Fritsch EF and Maniatis T (1989) Molecular Cloning, A Laboratory Manual) of restriction-digested plant genomic DNA may be probed with the type I DnaJ-like nucleic acids or variants thereof. The resulting banding patterns may then be subjected to genetic analyses using computer programs such as MapMaker (Lander et al., (1987) Genomics 1: 174-181) in order to construct a genetic map. In addition, the nucleic acids may be used to probe Southern blots containing restriction endonuclease-treated genomic DNAs of a set of individuals representing parent and progeny of a defined genetic cross. Segregation of the DNA polymorphisms is noted and used to calculate the position of the type I DnaJ-like nucleic acid or variant thereof in the genetic map previously obtained using this population (Botstein et al., (1980) Am. J. Hum. Genet. 32:314-331).

[0118] The production and use of plant gene-derived probes for use in genetic mapping is described in Bematzky and Tanksley (1986) Plant Mol. Biol. Reporter 4: 37-41. Numerous publications describe genetic mapping of specific cDNA clones using the methodology outlined above or variations thereof. For example, F2 intercross populations, backcross populations, randomly mated populations, near isogenic lines, and other sets of individuals may be used for mapping. Such methodologies are well known to those skilled in the art.

[0119] The nucleic acid probes may also be used for physical mapping (i.e., placement of sequences on physical maps; see Hoheisel et al., in: Non-mammalian Genomic Analysis: A Practical Guide, Academic press 1996, pp. 319-346, and references cited therein).

[0120] In another embodiment, the nucleic acid probes may be used in direct fluorescence in situ hybridization (FISH) mapping (Trask (1991) Trends Genet. 7:149-154). Although current methods of FISH mapping favour use of large clones (several kb to several hundred kb; see Laan et al., (1995) Genome Res. 5:13-20), improvements in sensitivity may allow performance of FISH mapping using shorter probes.

[0121] A variety of nucleic acid amplification-based methods for genetic and physical mapping may be carried out using the nucleic acids. Examples include allele-specific amplification (Kazazian (1989) J. Lab. Clin. Med. 11:95-96), polymorphism of PCR-amplified fragments (CAPS; Sheffield et al., (1993) Genomics 16:325-332), allele-specific ligation (Landegren at al., (1988) Science 241:1077-1080), nucleotide extension reactions (Sokolov (1990) Nucleic Acid Res. 18:3671), Radiation Hybrid Mapping (Walter at al., (1997) Nat. Genet. 7:22-28) and Happy Mapping (Dear and Cook (1989) Nucleic Acid Res. 17:6795-6807). For these methods, the sequence of a nucleic acid is used to design and produce primer pairs for use in the amplification reaction or in primer extension reactions. The design of such primers is well known to those skilled in the art. In methods employing PCR-based genetic mapping, it may be necessary to identify DNA sequence differences between the parents of the mapping cross in the region corresponding to the instant nucleic acid sequence. This, however, is generally not necessary for mapping methods.

[0122] Performance of the methods according to the present invention result in plants having increased plant yield in plants grown under non-stress conditions, as described hereinbefore. This increased plant yield may also be combined with other economically advantageous traits, such as further yield-enhancing traits, tolerance to various stresses, traits modifying various architectural features and/or biochemical and/or physiological features.

DESCRIPTION OF FIGURES

[0123] The present invention will now be described with reference to the following figures in which:

[0124] FIG. 1 shows the typical domain structure of type I DnaJ-like polypeptide. The J domain is located at the amino terminal end of the protein and encodes an HSP70-binding domain comprising the highly conserved HPD tripeptide. The G/F domain rich in glycine and phenylalanine is specifying target proteins for Hsp70 chaperone activity. The four cysteine-rich domains are involved in the coordination of zinc, with two zinc ions per type I DnaJ monomer. The CTD domain is the less conserved of the four domains defined, and may comprise a farnesylation motif CaaX.

[0125] FIG. 2 shows a multiple alignment of several type I DnaJ-like proteins from the Table 1, using VNTI AlignX multiple alignment program, based on a modified ClustalW algorithm (InforMax, Bethesda, Md.), with default settings for gap opening penalty of 10 and a gap extension of 0.05). The J domain is double-underlined, its four helices represented as grey boxes and its conserved HPD tripeptide boxed. The G/F domain is dotted-underlined. The two zinc binding domains I and II and their conserved CxxCxGxG (SEQ ID NO: 66) are boxed. In the CTD domain, the farnesylation motif is boxed. The sequences aligned are: Musmu_mDj3 (SEQ ID NO: 5), Homsa_DNAJA2 (SEQ ID NO: 54), Homsa_HsJ2 (SEQ ID NO: 50), Sacce_YDJ1 (SEQ ID NO: 52), Ceael_DNaJ (SEQ ID NO: 48), Orysa_DNAJ CASQ (SEQ ID NO: 44), Triae_DNAJ II CASQ (SEQ ID NO: 46), Arath_AtJ3 CAAX (SEQ ID NO: 20), Arath_AtJ2 CAAX (SEQ ID NO: 18), Orysa_DNAJ IV CAAX (SEQ ID NO: 8), Zeama_ZMDJ1 (SEQ ID NO: 10), Orysa_DNAJ II CAAX (SEQ ID NO: 4), Hevbr_DNAJ (SEQ ID NO: 30), Lyces_DNAJ (SEQ ID NO: 32), Glyma_pm37 DNAJ (SEQ ID NO: 28), Salgi_DNAJ2 (SEQ ID NO: 38), Triae_DNAJ (SEQ ID NO: 16), Salgi_DNAJ (SEQ ID NO: 40), Atrnu_DNAJ (SEQ ID NO: 22), Medsa_DNAJ (SEQ ID NO: 34), Zeama_DNAJ (SEQ ID NO: 12), Cucsa_DNAJ-1 (SEQ ID NO: 24), Solto_DNAJ (SEQ ID NO: 42), Dauca_J1P (SEQ ID NO: 26), Nicta_DNAJ (SEQ ID NO: 36), CDS1877 OsDNAJ (SEQ ID NO: 2), Orysa_DNAJ III CAAX (SEQ ID NO: 6), and Zeama_DNAJ CAAX (SEQ ID NO: 14).

[0126] FIG. 3 shows an alignment of type I DnaJ-like polypeptides from Arabidopsis thaliana as disclosed in the table below. The J domain is double underlined, the G/F domain is underlined in bold, the two zinc binding domains I and II and their conserved CxxCxGxG (SEQ ID NO: 66) are boxed, and the CTD is single underlined. The farnesylation motif CaaX at the carboxy terminus of the proteins is represented in bold when present. The amino acid sequences preceding the J domain (separated by a parenthesis; approximate location) represent subcellular targeting sequences. The sequences aligned are: At5g22060 AtJ2 CAAX (SEQ ID NO: 18), At3g44110 AtJ3 CAAX (SEQ ID NO: 20), At1g28210 (SEQ ID NO: 60), At1g80030 (SEQ ID NO: 61), At2g22360 (SEQ ID NO: 62), At3g17830 (SEQ ID NO: 63), At4g39960 (SEQ ID NO: 64), and At5g48030 GFA2 (SEQ ID NO: 65).

TABLE-US-00005 MIPS accession NCBI protein number accession number At3g44110 S71199 At5g22060 AAB86799.1 At1g28210 NP849719 At1g80030 AAK60328 At2g22360 AAD22362 At3g17830 NM112664 At4g39960 AAL36077 At5g48030 BAB11067

[0127] FIG. 4 shows a binary vector for expression in Oryza sativa of an Oryza sativa type I DnaJ-like (internal reference CDS1877) under the control of a prolamin promoter (internal reference PRO0090).

[0128] FIG. 5 details examples of polynucleotide (from start to stop) and polypeptide sequences useful in performing the methods according to the present invention.

EXAMPLES

[0129] The present invention will now be described with reference to the following examples, which are by way of illustration alone.

[0130] DNA manipulation: unless otherwise stated, recombinant DNA techniques are performed according to standard protocols described in (Sambrook (2001) Molecular Cloning: a laboratory manual, 3rd Edition Cold Spring Harbor Laboratory Press, CSH, New York) or in Volumes 1 and 2 of Ausubel et al., (1994), Current Protocols in Molecular Biology, Current Protocols. Standard materials and methods for plant molecular work are described in Plant Molecular Biology Labfase (1993) by R. D. D. Croy, published by BIOS Scientific Publications Ltd (UK) and Blackwell Scientific Publications (UK).

Example 1

Gene Cloning

[0131] The Oryza sativa type I DnaJ-like gene (CDS1877) was amplified by PCR using as template an Oryza sativa seedling cDNA library (Invitrogen, Paisley, UK). After reverse transcription of RNA extracted from seedlings, the cDNAs were cloned into pCMV Sport 6.0. Average insert size of the bank was 1.6 kb and the original number of clones was of the order of 1.67×10⁷ cfu. Original titer was determined to be 3.34×10⁶ cfu/ml after first amplification of 6×10¹° cfu/ml. After plasmid extraction, 200 ng of template was used in a 50 μl PCR mix. Primers prm04266 (SEQ ID NO: 58; sense, start codon in bold, AttB1 site in italic: 5' GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACAATGTACGGACGCATGCC 3') and prm04267 (SEQ ID NO: 59; reverse, complementary, stop in bold, AttB2 site in italic: 5' GGGGACCACTTTGTACAAGAAAGCTGGGTGCATCGAATTGTTCTTACTGC 3'), which include the AttB sites for Gateway recombination, were used for PCR amplification. PCR was performed using Hifi Taq DNA polymerase in standard conditions. A PCR fragment of 1340 by (including attB sites) was amplified and purified also using standard methods. The first step of the Gateway procedure, the BP reaction, was then performed, during which the PCR fragment recombines in vivo with the pDONR201 plasmid to produce, according to the Gateway terminology, an "entry clone", p04452. Plasmid pDONR201 was purchased from Invitrogen, as part of the Gateway® technology.

Example 2

Vector Construction

[0132] The entry clone p04452 was subsequently used in an LR reaction with p00830, a destination vector used for Oryza sativa transformation. This vector contains as functional elements within the T-DNA borders: a plant selectable marker; a screenable marker expression cassette; and a Gateway cassette intended for LR in vivo recombination with the sequence of interest already cloned in the entry clone. A rice RP6 prolamin promoter (SEQ ID NO: 57; Wen et al., (1993) Plant Physiol 101(3): 1115-6) for endosperm-specific expression (PRO0090) was located upstream of this Gateway cassette.

[0133] After the LR recombination step, the resulting expression vector p072 (FIG. 4) was transformed into Agrobacterium strain LBA4044 and subsequently to Oryza sativa plants. Transformed rice plants were allowed to grow and were then examined for the parameters described in Example 3.

Example 3

Evaluation and Results of type I DnaJ-like under the control of the rice RP6 promoter

[0134] Approximately 15 to 20 independent TO rice transformants were generated. The primary transformants were transferred from a tissue culture chamber to a greenhouse for growing and harvest of T1 seed. 5 events, of which the T1 progeny segregated 3:1 for presence/absence of the transgene, were retained. For each of these events, approximately 10 T1 seedlings containing the transgene (hetero- and homo-zygotes) and approximately 10 T1 seedlings lacking the transgene (nullizygotes) were selected by monitoring visual marker expression. 4 T1 events were further evaluated in the T2 generation following the same evaluation procedure as for the T1 generation but with more individuals per event.

Statistical Analysis: F-Test

[0135] A two factor ANOVA (analysis of variants) was used as a statistical model for the overall evaluation of plant phenotypic characteristics. An F-test was carried out on all the parameters measured of all the plants of all the events transformed with the gene of the present invention. The F-test was carried out to check for an effect of the gene over all the transformation events and to verify for an overall effect of the gene, also known as a global gene effect. The threshold for significance for a true global gene effect was set at a 5% probability level for the F-test. A significant F-test value points to a gene effect, meaning that it is not only the presence or position of the gene that is causing the differences in phenotype.

[0136] Since two experiments with overlapping events were carried out, a combined analysis was performed in addition to the analysis described above. This is useful to check consistency of the effects over the two experiments, and if this is the case, to accumulate evidence from both experiments in order to increase confidence in the conclusion. The method used was a mixed-model approach that takes into account the multilevel structure of the data (i.e. experiment--event--segregants). P-values were obtained by comparing likelihood ratio test to chi square distributions.

3.1 Seed-Related Parameter Measurements

[0137] The mature primary panicles were harvested, bagged, barcode-labeled and then dried for three days in an oven at 37° C. The panicles were then threshed and all the seeds were collected and counted. The filled husks were separated from the empty ones using an air-blowing device. The empty husks were discarded and the remaining fraction was counted again. The filled husks were weighed on an analytical balance. The number of filled seeds was determined by counting the number of filled husks that remained after the separation step. The total seed yield was measured by weighing all filled husks harvested from a plant. Total seed number per plant was measured by counting the number of husks harvested from a plant. The harvest index in the present invention is defined as the ratio of total seed yield and the aboveground area (mm²) multiplied by a factor 10⁶.

3.2 Aboveground Area

[0138] Plant aboveground area was determined by counting the total number of pixels from the pictures from the aboveground plant parts discriminated from the background. This value was averaged for the pictures taken on the same time point from the different angles and was converted to a physical surface value expressed in square mm by calibration. Experiments show that the aboveground plant area measured this way correlates with the biomass of plant

[0139] The table of results (Table 5) below shows percentage difference between the transgenics and the corresponding nullizygotes, for harvest index.

[0140] The combined analysis performed confirms the consistency of the effects over the two experiments, and thus increases confidence in the conclusion.

TABLE-US-00006 TABLE 5 Harvest index Harvest Index P value T1 % increase T2 % increase combined Event 1 55 24 0.0024 Event 2 35 11 0.0585 Overall 9 (5 events) 8 (4 events) 0.0063

Sequence CWU 1

6611263DNAOryza sativa 1atgtacggac gcatgccaaa gaagagtaac aataccaagt attatgaggt gcttggtgta 60tctaagacag caacccagga tgagctgaag aaagcgtacc gtaaagctgc cattaaaaac 120caccctgata agggtggaga ccctgagaag tttaaagaat tggctcaagc ttacgaggtt 180cttaatgatc ctgaaaagag ggaaatctat gaccaatatg gcgaggatgc actcaaagaa 240ggaatgggag gaggcagcag cagtgatttc catagtccct tcgatttatt tgagcaaatt 300tttcagaatc gtggtggctt tgggggtaga ggacacagac aaaagcgtgg cgaagatgtg 360gtacatacta tgaaggtttc tttagaagac ctgtataatg gtactaccaa aaaactgtct 420ttgtcacgga atgctctgtg cacaaagtgc aagggtaaag gatccaagag tggggcagca 480gcaacttgcc atggttgtca tggtgcagga atgagaacaa taacaagaca aattgggctt 540ggcatgatcc aacagatgaa cactgtttgc cctgaatgca gaggatcagg tgagatgata 600agtgacaagg ataaatgccc gagttgtaag ggaaacaaag tagtccagca gaagaaggtc 660ttggaggttc atgttgagaa gggaatgcaa catggccaaa agattgtatt ccagggtgaa 720gctgatgaag ctcctgatac agtgacagga gacatagttt ttgtcttgca acttaaagac 780cacccaaaat ttaagaggaa gtttgatgac ctctttactg agcacacaat ctccctgacc 840gaggctctgt gtggcttcca gtttgttcta acccatcttg atggtcggca actcctaatc 900aaatctaatc caggggaggt tataaaacct ggtcaacaca aggccatcaa tgatgaaggc 960atgccccagc atggccgccc tttcatgaaa ggtcgtcttt ttgttgaatt caacgtggag 1020tttcctgagc ctggtgcact cactcctggc caatgccgat cgcttgagaa gattttgcca 1080ccacgaccca ggaatcaatt gtcagacatg gagctagatc aatgtgagga gaccaccatg 1140catgatgtca acatagaaga ggagatgagg cgcaggcagc agcacaggcg gcaggaagca 1200tatgatgaag acgacgacga ggatgctgga gctggaccaa gggtacagtg tgcccagcag 1260taa 12632420PRTOryza sativa 2Met Tyr Gly Arg Met Pro Lys Lys Ser Asn Asn Thr Lys Tyr Tyr Glu1 5 10 15Val Leu Gly Val Ser Lys Thr Ala Thr Gln Asp Glu Leu Lys Lys Ala 20 25 30Tyr Arg Lys Ala Ala Ile Lys Asn His Pro Asp Lys Gly Gly Asp Pro 35 40 45Glu Lys Phe Lys Glu Leu Ala Gln Ala Tyr Glu Val Leu Asn Asp Pro 50 55 60Glu Lys Arg Glu Ile Tyr Asp Gln Tyr Gly Glu Asp Ala Leu Lys Glu65 70 75 80Gly Met Gly Gly Gly Ser Ser Ser Asp Phe His Ser Pro Phe Asp Leu 85 90 95Phe Glu Gln Ile Phe Gln Asn Arg Gly Gly Phe Gly Gly Arg Gly His 100 105 110Arg Gln Lys Arg Gly Glu Asp Val Val His Thr Met Lys Val Ser Leu 115 120 125Glu Asp Leu Tyr Asn Gly Thr Thr Lys Lys Leu Ser Leu Ser Arg Asn 130 135 140Ala Leu Cys Thr Lys Cys Lys Gly Lys Gly Ser Lys Ser Gly Ala Ala145 150 155 160Ala Thr Cys His Gly Cys His Gly Ala Gly Met Arg Thr Ile Thr Arg 165 170 175Gln Ile Gly Leu Gly Met Ile Gln Gln Met Asn Thr Val Cys Pro Glu 180 185 190Cys Arg Gly Ser Gly Glu Met Ile Ser Asp Lys Asp Lys Cys Pro Ser 195 200 205Cys Lys Gly Asn Lys Val Val Gln Gln Lys Lys Val Leu Glu Val His 210 215 220Val Glu Lys Gly Met Gln His Gly Gln Lys Ile Val Phe Gln Gly Glu225 230 235 240Ala Asp Glu Ala Pro Asp Thr Val Thr Gly Asp Ile Val Phe Val Leu 245 250 255Gln Leu Lys Asp His Pro Lys Phe Lys Arg Lys Phe Asp Asp Leu Phe 260 265 270Thr Glu His Thr Ile Ser Leu Thr Glu Ala Leu Cys Gly Phe Gln Phe 275 280 285Val Leu Thr His Leu Asp Gly Arg Gln Leu Leu Ile Lys Ser Asn Pro 290 295 300Gly Glu Val Ile Lys Pro Gly Gln His Lys Ala Ile Asn Asp Glu Gly305 310 315 320Met Pro Gln His Gly Arg Pro Phe Met Lys Gly Arg Leu Phe Val Glu 325 330 335Phe Asn Val Glu Phe Pro Glu Pro Gly Ala Leu Thr Pro Gly Gln Cys 340 345 350Arg Ser Leu Glu Lys Ile Leu Pro Pro Arg Pro Arg Asn Gln Leu Ser 355 360 365Asp Met Glu Leu Asp Gln Cys Glu Glu Thr Thr Met His Asp Val Asn 370 375 380Ile Glu Glu Glu Met Arg Arg Arg Gln Gln His Arg Arg Gln Glu Ala385 390 395 400Tyr Asp Glu Asp Asp Asp Glu Asp Ala Gly Ala Gly Pro Arg Val Gln 405 410 415Cys Ala Gln Gln 42031251DNAOryza sativa 3atgtttgggc gtgtaccgag gagtaacaac accaagtact atgaggttct tggagttcct 60aaaactgcaa gcaaggatga gctaaagaag gcataccgga aggctgccat aaaaaaccat 120cctgacaagg gaggggatcc agaaaagttt aaagaattat cacaagcgta tgaggttctc 180actgatcctg agaagagaga catatatgac caatatgggg aggatgctct taaggatgga 240atgggaggag gcagtgactt ccataatcca tttgacatat ttgagcagtt tttcgggggt 300ggtgcctttg gggggagtag ctcaagagta cgcagacaga gacgtggtga agatgtggcg 360catactttga aggtgtcttt agaagatgtg tataatggat ctatgaagaa actatcatta 420tcacgaaata ttctgtgccc aaagtgcaaa ggaaaaggga ccaaatctga ggctccagca 480acatgctatg gttgtcatgg tgtaggaatg aggaatataa tgcgacagat aggactaggc 540atgattcaac atatgcagac tgtctgtcct gaatgcagag gatcaggtga gatcataagt 600gacagggata aatgcacaaa ctgcagagct agcaaagtta ttcaggagaa aaaggtgctt 660gaggttcata ttgagaaggg aatgcaacat ggccaaaaaa ttgtattcca aggtgaagct 720gatgaagctc ctgatacagt gacaggagat atagtattta tcttgcaagt taaggtacat 780ccaagattta agaggaaata tgatgacctg ttcattgagc gcacaatctc tttaactgag 840gcattgtgtg ggttccaatt catcctcact catctggaca gtaggcagct cctaatcaag 900gcaaatcctg gcgaaattat taaacctggt caacacaagg ccataaatga tgagggaatg 960ccacaccatg gccggccttt catgaagggc cgtctctttg tggaattcaa tgttgagttc 1020cctgaatctg gtgtactctc ccgtgaccaa tgccgggcac ttgagatgat cctaccacct 1080aaacctgggc accaattatc agatatggac ctggatcaat gtgaggaaac taccatgcat 1140gatgtgaaca tagaagagga gatgaggcgc aagcagtatc aaaggaagca ggaagcgtac 1200gacgaagatg aggaggagga tgctccaaga gtacagtgtg ctcaacagta a 12514416PRTOryza sativa 4Met Phe Gly Arg Val Pro Arg Ser Asn Asn Thr Lys Tyr Tyr Glu Val1 5 10 15Leu Gly Val Pro Lys Thr Ala Ser Lys Asp Glu Leu Lys Lys Ala Tyr 20 25 30Arg Lys Ala Ala Ile Lys Asn His Pro Asp Lys Gly Gly Asp Pro Glu 35 40 45Lys Phe Lys Glu Leu Ser Gln Ala Tyr Glu Val Leu Thr Asp Pro Glu 50 55 60Lys Arg Asp Ile Tyr Asp Gln Tyr Gly Glu Asp Ala Leu Lys Asp Gly65 70 75 80Met Gly Gly Gly Ser Asp Phe His Asn Pro Phe Asp Ile Phe Glu Gln 85 90 95Phe Phe Gly Gly Gly Ala Phe Gly Gly Ser Ser Ser Arg Val Arg Arg 100 105 110Gln Arg Arg Gly Glu Asp Val Ala His Thr Leu Lys Val Ser Leu Glu 115 120 125Asp Val Tyr Asn Gly Ser Met Lys Lys Leu Ser Leu Ser Arg Asn Ile 130 135 140Leu Cys Pro Lys Cys Lys Gly Lys Gly Thr Lys Ser Glu Ala Pro Ala145 150 155 160Thr Cys Tyr Gly Cys His Gly Val Gly Met Arg Asn Ile Met Arg Gln 165 170 175Ile Gly Leu Gly Met Ile Gln His Met Gln Thr Val Cys Pro Glu Cys 180 185 190Arg Gly Ser Gly Glu Ile Ile Ser Asp Arg Asp Lys Cys Thr Asn Cys 195 200 205Arg Ala Ser Lys Val Ile Gln Glu Lys Lys Val Leu Glu Val His Ile 210 215 220Glu Lys Gly Met Gln His Gly Gln Lys Ile Val Phe Gln Gly Glu Ala225 230 235 240Asp Glu Ala Pro Asp Thr Val Thr Gly Asp Ile Val Phe Ile Leu Gln 245 250 255Val Lys Val His Pro Arg Phe Lys Arg Lys Tyr Asp Asp Leu Phe Ile 260 265 270Glu Arg Thr Ile Ser Leu Thr Glu Ala Leu Cys Gly Phe Gln Phe Ile 275 280 285Leu Thr His Leu Asp Ser Arg Gln Leu Leu Ile Lys Ala Asn Pro Gly 290 295 300Glu Ile Ile Lys Pro Gly Gln His Lys Ala Ile Asn Asp Glu Gly Met305 310 315 320Pro His His Gly Arg Pro Phe Met Lys Gly Arg Leu Phe Val Glu Phe 325 330 335Asn Val Glu Phe Pro Glu Ser Gly Val Leu Ser Arg Asp Gln Cys Arg 340 345 350Ala Leu Glu Met Ile Leu Pro Pro Lys Pro Gly His Gln Leu Ser Asp 355 360 365Met Asp Leu Asp Gln Cys Glu Glu Thr Thr Met His Asp Val Asn Ile 370 375 380Glu Glu Glu Met Arg Arg Lys Gln Tyr Gln Arg Lys Gln Glu Ala Tyr385 390 395 400Asp Glu Asp Glu Glu Glu Asp Ala Pro Arg Val Gln Cys Ala Gln Gln 405 410 41551254DNAOryza sativa 5atgttcgggc gcgcgccgaa gaagagcgac aacaccaagt actacgagat cctgggggtc 60cccaagaccg cctcccagga cgacctcaag aaggcgtacc gcaaggccgc catcaagaac 120caccccgaca agggcggcga ccccgagaag ttcaaggagc ttgcacaagc ttatgaggta 180ttgagtgacc cggagaaacg tgaaatctat gaccaatatg gtgaagatgc cctcaaggaa 240ggaatgggtg gaggcggatc ccatgttgat ccatttgaca tcttttcatc attctttgga 300ccttcttttg gtggtggtgg cagcagcagg ggcagaaggc aaaggagggg agaggatgtg 360atccatccgc ttaaggtttc tctagaagat ctttacaatg gtacttcaaa gaagctctct 420ctttcccgca atgtcctctg cgccaagtgc aagggcaagg gttccaagtc tggtgcttcc 480atgaggtgcc caggttgcca ggggtctggc atgaaaatca ccatccgcca gctggggccc 540tccatgatac agcagatgca gcagccttgc aatgagtgta aggggactgg agagagcatt 600aatgagaagg atcgctgccc aggctgcaag ggcgagaagg ttattcagga gaagaaggtt 660ctggaggttc acgttgagaa ggggatgcaa cacaatcaga agatcacttt ccctggtgaa 720gctgatgagg cgcctgatac cgttacggga gacattgtat tcgtcctcca gcagaaggac 780cactccaagt tcaaaaggaa gggcgatgat ctcttttatg agcacacctt atctctgact 840gaagcacttt gtggtttcca atttgtcctg acacatctgg acaacagaca gctgctcatt 900aagtcaaacc ccggtgaagt tgttaagcct gaccaattca aggcaataaa cgatgaggga 960atgccaatgt accagaggcc tttcatgaag gggaagctct acattcattt cacggtggag 1020ttccctgatt ccctggcgcc tgaacaatgc aaggctctcg aggctgtgct tccaccgaag 1080cctgcatccc agctgacaga aatggagata gatgaatgcg aggagaccac gatgcacgat 1140gtcaacaaca ttgaggaaga gatgcgcagg aaagcccaag ctgctcagga ggcgtatgat 1200gaggacgatg agatgcctgg aggtgcccag agagttcagt gcgcgcaaca gtaa 12546417PRTOryza sativa 6Met Phe Gly Arg Ala Pro Lys Lys Ser Asp Asn Thr Lys Tyr Tyr Glu1 5 10 15Ile Leu Gly Val Pro Lys Thr Ala Ser Gln Asp Asp Leu Lys Lys Ala 20 25 30Tyr Arg Lys Ala Ala Ile Lys Asn His Pro Asp Lys Gly Gly Asp Pro 35 40 45Glu Lys Phe Lys Glu Leu Ala Gln Ala Tyr Glu Val Leu Ser Asp Pro 50 55 60Glu Lys Arg Glu Ile Tyr Asp Gln Tyr Gly Glu Asp Ala Leu Lys Glu65 70 75 80Gly Met Gly Gly Gly Gly Ser His Val Asp Pro Phe Asp Ile Phe Ser 85 90 95Ser Phe Phe Gly Pro Ser Phe Gly Gly Gly Gly Ser Ser Arg Gly Arg 100 105 110Arg Gln Arg Arg Gly Glu Asp Val Ile His Pro Leu Lys Val Ser Leu 115 120 125Glu Asp Leu Tyr Asn Gly Thr Ser Lys Lys Leu Ser Leu Ser Arg Asn 130 135 140Val Leu Cys Ala Lys Cys Lys Gly Lys Gly Ser Lys Ser Gly Ala Ser145 150 155 160Met Arg Cys Pro Gly Cys Gln Gly Ser Gly Met Lys Ile Thr Ile Arg 165 170 175Gln Leu Gly Pro Ser Met Ile Gln Gln Met Gln Gln Pro Cys Asn Glu 180 185 190Cys Lys Gly Thr Gly Glu Ser Ile Asn Glu Lys Asp Arg Cys Pro Gly 195 200 205Cys Lys Gly Glu Lys Val Ile Gln Glu Lys Lys Val Leu Glu Val His 210 215 220Val Glu Lys Gly Met Gln His Asn Gln Lys Ile Thr Phe Pro Gly Glu225 230 235 240Ala Asp Glu Ala Pro Asp Thr Val Thr Gly Asp Ile Val Phe Val Leu 245 250 255Gln Gln Lys Asp His Ser Lys Phe Lys Arg Lys Gly Asp Asp Leu Phe 260 265 270Tyr Glu His Thr Leu Ser Leu Thr Glu Ala Leu Cys Gly Phe Gln Phe 275 280 285Val Leu Thr His Leu Asp Asn Arg Gln Leu Leu Ile Lys Ser Asn Pro 290 295 300Gly Glu Val Val Lys Pro Asp Gln Phe Lys Ala Ile Asn Asp Glu Gly305 310 315 320Met Pro Met Tyr Gln Arg Pro Phe Met Lys Gly Lys Leu Tyr Ile His 325 330 335Phe Thr Val Glu Phe Pro Asp Ser Leu Ala Pro Glu Gln Cys Lys Ala 340 345 350Leu Glu Ala Val Leu Pro Pro Lys Pro Ala Ser Gln Leu Thr Glu Met 355 360 365Glu Ile Asp Glu Cys Glu Glu Thr Thr Met His Asp Val Asn Asn Ile 370 375 380Glu Glu Glu Met Arg Arg Lys Ala Gln Ala Ala Gln Glu Ala Tyr Asp385 390 395 400Glu Asp Asp Glu Met Pro Gly Gly Ala Gln Arg Val Gln Cys Ala Gln 405 410 415Gln71254DNAOryza sativa 7atgttcgggc gcgcgccgaa gaagagcgac aacacgcggt actacgaggt gcttggggtg 60cccaaggatg cgtcccagga tgacctcaag aaggcgtacc gcaaggccgc catcaagaac 120caccccgaca agggcggaga ccccgagaag ttcaaggaat tggctcaggc ttatgaagtc 180ctgagtgacc ctgagaagcg tgaaatctat gatcagtacg gtgaagatgc tctcaaggag 240gggatgggtc ctggtggtgg gatgcatgac ccatttgaca ttttttcctc attctttgga 300ggtggctttg gaggtggtag cagtaggggc aggagacagc gtaggggaga ggatgtggtt 360caccctctga aggtttctct ggaggaattg tacaatggca catcaaagaa gctctccctt 420tctcgcaatg tgctctgctc caagtgcaat ggcaagggct cgaaatctgg tgcttccatg 480aagtgctctg gttgtcaagg ttctggtatg aaggtccaaa ttcgccagtt ggggccagga 540atgattcagc aaatgcaaca tccctgcaat gagtgcaagg gaactggtga gaccatcagc 600gacaaggata gatgcccagg ctgcaagggt gagaaggtgg cgcaggagaa gaaggttctt 660gaggtggtgg tcgagaaggg catgcagaat ggacagaaga tcaccttccc tggtgaggct 720gatgaagcgc ccgatactgt cactggagac attatcttcg tcctccagca gaaggagcat 780cccaagttca agagaaaggg agatgacctc ttctacgagc acaccctgaa cctcactgag 840gccctttgtg gcttccagtt tgttctcact cacttggaca acaggcagct gcttatcaag 900tccaagcccg gtgaagttgt caagcctgat tcattcaagg ctgtcaacga cgagggcatg 960ccgatgtacc agcggccatt catgaagggg aagctctaca tccacttctc cgtggaattc 1020cccgactctt tgaaccctga ccagtgcaag gccctggaga ccgtcctccc gccaaggccg 1080gtgtcgcagt acaccgacat ggagctcgac gagtgcgagg agaccatgcc gtacgacgtg 1140aacatcgagg aggagatgag gaggcggcag caacagcagc agcaggaggc atacgacgag 1200gacgaggaca tgcacggcgg cggcgcccag cgcgtgcagt gcgcgcagca gtaa 12548417PRTOryza sativa 8Met Phe Gly Arg Ala Pro Lys Lys Ser Asp Asn Thr Arg Tyr Tyr Glu1 5 10 15Val Leu Gly Val Pro Lys Asp Ala Ser Gln Asp Asp Leu Lys Lys Ala 20 25 30Tyr Arg Lys Ala Ala Ile Lys Asn His Pro Asp Lys Gly Gly Asp Pro 35 40 45Glu Lys Phe Lys Glu Leu Ala Gln Ala Tyr Glu Val Leu Ser Asp Pro 50 55 60Glu Lys Arg Glu Ile Tyr Asp Gln Tyr Gly Glu Asp Ala Leu Lys Glu65 70 75 80Gly Met Gly Pro Gly Gly Gly Met His Asp Pro Phe Asp Ile Phe Ser 85 90 95Ser Phe Phe Gly Gly Gly Phe Gly Gly Gly Ser Ser Arg Gly Arg Arg 100 105 110Gln Arg Arg Gly Glu Asp Val Val His Pro Leu Lys Val Ser Leu Glu 115 120 125Glu Leu Tyr Asn Gly Thr Ser Lys Lys Leu Ser Leu Ser Arg Asn Val 130 135 140Leu Cys Ser Lys Cys Asn Gly Lys Gly Ser Lys Ser Gly Ala Ser Met145 150 155 160Lys Cys Ser Gly Cys Gln Gly Ser Gly Met Lys Val Gln Ile Arg Gln 165 170 175Leu Gly Pro Gly Met Ile Gln Gln Met Gln His Pro Cys Asn Glu Cys 180 185 190Lys Gly Thr Gly Glu Thr Ile Ser Asp Lys Asp Arg Cys Pro Gly Cys 195 200 205Lys Gly Glu Lys Val Ala Gln Glu Lys Lys Val Leu Glu Val Val Val 210 215 220Glu Lys Gly Met Gln Asn Gly Gln Lys Ile Thr Phe Pro Gly Glu Ala225 230 235 240Asp Glu Ala Pro Asp Thr Val Thr Gly Asp Ile Ile Phe Val Leu Gln 245 250 255Gln Lys Glu His Pro Lys Phe Lys Arg Lys Gly Asp Asp Leu Phe Tyr 260 265 270Glu His Thr Leu Asn Leu Thr Glu Ala Leu Cys Gly Phe Gln Phe Val 275 280 285Leu Thr His Leu Asp Asn Arg Gln Leu Leu Ile Lys Ser Lys Pro Gly 290 295 300Glu Val Val Lys Pro Asp Ser Phe Lys Ala Val Asn Asp Glu Gly Met305 310 315 320Pro Met Tyr Gln Arg Pro Phe Met Lys Gly Lys Leu Tyr Ile His Phe 325 330 335Ser Val Glu Phe Pro Asp Ser Leu Asn Pro Asp Gln Cys Lys Ala Leu 340 345 350Glu Thr Val Leu Pro Pro Arg Pro Val Ser Gln

Tyr Thr Asp Met Glu 355 360 365Leu Asp Glu Cys Glu Glu Thr Met Pro Tyr Asp Val Asn Ile Glu Glu 370 375 380Glu Met Arg Arg Arg Gln Gln Gln Gln Gln Gln Glu Ala Tyr Asp Glu385 390 395 400Asp Glu Asp Met His Gly Gly Gly Ala Gln Arg Val Gln Cys Ala Gln 405 410 415Gln91260DNAZea mays 9atgttcgggc gcgcgccgaa gaagagcgac aacaccaagt actacgagat cctcggggtg 60cccaagtcgg cgtcccagga cgatctcaag aaggcctacc gcaaggctgc tatcaagaac 120caccccgaca agggcggtga ccccgagaag ttcaaggagc tcgcacaagc ctatgaggtt 180ttgagtgatc cagagaaacg tgagatttat gatcagtatg gtgaagatgc ccttaaggaa 240ggaatgggcg gtggaggatc ccatgttgat ccatttgaca tcttctcatc attttttgga 300ccctcttttg gaggaggtgg tggaagcagc aggggaagaa ggcaaaggag gggagaagat 360gtagttcacc cacttaaagt ttctctggaa gatctttaca atggcacctc aaagaagctc 420tctctttcgc gcaatgtcat ctgctccaag tgcaagggca agggctcgaa gtctggtgcc 480tcaatgaggt gccctggttg ccagggctca ggcatgaaag tcactattcg tcagctgggc 540ccttccatga tacagcagat gcagcagcct tgcaatgagt gcaaggggac tggagagagc 600atcaatgaga aggaccgctg tccagggtgc aagggtgaga aggtcattca agagaagaaa 660gttcttgagg ttcatgttga gaaggggatg caacacaacc agaagatcac cttccctggt 720gaagctgatg aagcgcctga tactgtcact ggagacattg tattcgtcct ccaacagaag 780gatcactcca aattcaaaag aaagggtgaa gatctgttct atgagcacac cttgtctctg 840accgaagcac tatgtgggtt ccaatttgtt cttacacatc tggacaacag gcagcttctc 900atcaaatcag accctggtga agttgttaaa cctgaccaat tcaaggcgat taatgatgag 960gggatgccaa tttaccagag gcctttcatg aaggggaagc tgtacatcca tttcacggtg 1020gagttccctg actcgttggc accagagcag tgcaaggctc tcgagacagt acttccacca 1080aggccttcat ccaagctgac agacatggag atagatgaat gcgaggagac gactatgcat 1140gatgtgaaca acatcgagga agagatgcgc aagaagcaag ctcacgctgc ccaggaggcg 1200tacgaggagg acgacgagat gccgggcgga gcccagagag tgcagtgcgc gcagcagtaa 126010419PRTZea mays 10Met Phe Gly Arg Ala Pro Lys Lys Ser Asp Asn Thr Lys Tyr Tyr Glu1 5 10 15Ile Leu Gly Val Pro Lys Ser Ala Ser Gln Asp Asp Leu Lys Lys Ala 20 25 30Tyr Arg Lys Ala Ala Ile Lys Asn His Pro Asp Lys Gly Gly Asp Pro 35 40 45Glu Lys Phe Lys Glu Leu Ala Gln Ala Tyr Glu Val Leu Ser Asp Pro 50 55 60Glu Lys Arg Glu Ile Tyr Asp Gln Tyr Gly Glu Asp Ala Leu Lys Glu65 70 75 80Gly Met Gly Gly Gly Gly Ser His Val Asp Pro Phe Asp Ile Phe Ser 85 90 95Ser Phe Phe Gly Pro Ser Phe Gly Gly Gly Gly Gly Ser Ser Arg Gly 100 105 110Arg Arg Gln Arg Arg Gly Glu Asp Val Val His Pro Leu Lys Val Ser 115 120 125Leu Glu Asp Leu Tyr Asn Gly Thr Ser Lys Lys Leu Ser Leu Ser Arg 130 135 140Asn Val Ile Cys Ser Lys Cys Lys Gly Lys Gly Ser Lys Ser Gly Ala145 150 155 160Ser Met Arg Cys Pro Gly Cys Gln Gly Ser Gly Met Lys Val Thr Ile 165 170 175Arg Gln Leu Gly Pro Ser Met Ile Gln Gln Met Gln Gln Pro Cys Asn 180 185 190Glu Cys Lys Gly Thr Gly Glu Ser Ile Asn Glu Lys Asp Arg Cys Pro 195 200 205Gly Cys Lys Gly Glu Lys Val Ile Gln Glu Lys Lys Val Leu Glu Val 210 215 220His Val Glu Lys Gly Met Gln His Asn Gln Lys Ile Thr Phe Pro Gly225 230 235 240Glu Ala Asp Glu Ala Pro Asp Thr Val Thr Gly Asp Ile Val Phe Val 245 250 255Leu Gln Gln Lys Asp His Ser Lys Phe Lys Arg Lys Gly Glu Asp Leu 260 265 270Phe Tyr Glu His Thr Leu Ser Leu Thr Glu Ala Leu Cys Gly Phe Gln 275 280 285Phe Val Leu Thr His Leu Asp Asn Arg Gln Leu Leu Ile Lys Ser Asp 290 295 300Pro Gly Glu Val Val Lys Pro Asp Gln Phe Lys Ala Ile Asn Asp Glu305 310 315 320Gly Met Pro Ile Tyr Gln Arg Pro Phe Met Lys Gly Lys Leu Tyr Ile 325 330 335His Phe Thr Val Glu Phe Pro Asp Ser Leu Ala Pro Glu Gln Cys Lys 340 345 350Ala Leu Glu Thr Val Leu Pro Pro Arg Pro Ser Ser Lys Leu Thr Asp 355 360 365Met Glu Ile Asp Glu Cys Glu Glu Thr Thr Met His Asp Val Asn Asn 370 375 380Ile Glu Glu Glu Met Arg Arg Lys Gln Ala His Ala Ala Gln Glu Ala385 390 395 400Tyr Glu Glu Asp Asp Glu Met Pro Gly Gly Ala Gln Arg Val Gln Cys 405 410 415Ala Gln Gln111257DNAZea mays 11atgttcgggc gcgcgccgaa gaagagcgac aacacacggt actacgagat cctcggggtc 60tccaaggacg cgtcccagga tgacctcaag aaagcctacc gcaaggccgc catcaagaac 120caccccgaca agggcggcga tcccgagaag ttcaaggagc tagctcaggc ttatgaggtc 180ctcagtgatc ctgaaaagcg ggagatttat gatcaatatg gtgaggatgc cctcaaggag 240ggaatgggag gtggtggagg gatgcacgat ccctttgaca tattccagtc attctttggt 300ggtggaagcc cttttggagg tggtggcagc agtaggggca gaaggcagcg aaggggagag 360gatgtggttc atcctctaaa ggtttctctg gaggatttgt acaatggcac atcaaagaag 420ctctctctgt cccgcagtgt cctctgctcc aagtgcaatg gtaagggttc aaagtctgga 480gcttcatcga ggtgtgctgg ttgccaaggt tctggcttta aggtccaaat ccggcagttg 540gggcctggaa tgatccagca aatgcagcat ccttgcaacg agtgcaaggg ttctggagag 600acaatcagcg acaaggatag atgcccacag tgcaagggtg ataaagttgt gcaggagaag 660aaggttcttg aagtgtttgt ggagaaaggc atgcagaatg ggcagaagat cacattccct 720ggtgaagctg atgaagcgcc tgacactgtc actggagata tcatttttgt tctccagcag 780aaggagcatc ccaagttcaa gagaaagggc gatgacctct tctacgagca caccctgacc 840ttgactgaat ctctgtgtgg cttccagttt gttgtgactc acttggataa caggcagctg 900ctgatcaaat caaatccggg cgaagttgtg aagcctgatt ctttcaaggc gatcaacgac 960gaaggcatgc ccatgtacca gaggccgttc atgaagggca agctgtacat ccacttctcg 1020gtggagttcc cggactcgct gagcccggag cagtgcaagg ccctggaggc tgtgctcccg 1080cccaagccgg tgtcgcagta caccgacatg gagctggacg agtgcgagga gacgatgccc 1140tatgacgtga acatcgaagc ggagatgcgg aggcggcagc agcagcacca ggaggcctac 1200gacgaggatg aggacatgcc gggcggcgcg cagagggtgc agtgcgccca gcagtag 125712418PRTZea mays 12Met Phe Gly Arg Ala Pro Lys Lys Ser Asp Asn Thr Arg Tyr Tyr Glu1 5 10 15Ile Leu Gly Val Ser Lys Asp Ala Ser Gln Asp Asp Leu Lys Lys Ala 20 25 30Tyr Arg Lys Ala Ala Ile Lys Asn His Pro Asp Lys Gly Gly Asp Pro 35 40 45Glu Lys Phe Lys Glu Leu Ala Gln Ala Tyr Glu Val Leu Ser Asp Pro 50 55 60Glu Lys Arg Glu Ile Tyr Asp Gln Tyr Gly Glu Asp Ala Leu Lys Glu65 70 75 80Gly Met Gly Gly Gly Gly Gly Met His Asp Pro Phe Asp Ile Phe Gln 85 90 95Ser Phe Phe Gly Gly Gly Ser Pro Phe Gly Gly Gly Gly Ser Ser Arg 100 105 110Gly Arg Arg Gln Arg Arg Gly Glu Asp Val Val His Pro Leu Lys Val 115 120 125Ser Leu Glu Asp Leu Tyr Asn Gly Thr Ser Lys Lys Leu Ser Leu Ser 130 135 140Arg Ser Val Leu Cys Ser Lys Cys Asn Gly Lys Gly Ser Lys Ser Gly145 150 155 160Ala Ser Ser Arg Cys Ala Gly Cys Gln Gly Ser Gly Phe Lys Val Gln 165 170 175Ile Arg Gln Leu Gly Pro Gly Met Ile Gln Gln Met Gln His Pro Cys 180 185 190Asn Glu Cys Lys Gly Ser Gly Glu Thr Ile Ser Asp Lys Asp Arg Cys 195 200 205Pro Gln Cys Lys Gly Asp Lys Val Val Gln Glu Lys Lys Val Leu Glu 210 215 220Val Phe Val Glu Lys Gly Met Gln Asn Gly Gln Lys Ile Thr Phe Pro225 230 235 240Gly Glu Ala Asp Glu Ala Pro Asp Thr Val Thr Gly Asp Ile Ile Phe 245 250 255Val Leu Gln Gln Lys Glu His Pro Lys Phe Lys Arg Lys Gly Asp Asp 260 265 270Leu Phe Tyr Glu His Thr Leu Thr Leu Thr Glu Ser Leu Cys Gly Phe 275 280 285Gln Phe Val Val Thr His Leu Asp Asn Arg Gln Leu Leu Ile Lys Ser 290 295 300Asn Pro Gly Glu Val Val Lys Pro Asp Ser Phe Lys Ala Ile Asn Asp305 310 315 320Glu Gly Met Pro Met Tyr Gln Arg Pro Phe Met Lys Gly Lys Leu Tyr 325 330 335Ile His Phe Ser Val Glu Phe Pro Asp Ser Leu Ser Pro Glu Gln Cys 340 345 350Lys Ala Leu Glu Ala Val Leu Pro Pro Lys Pro Val Ser Gln Tyr Thr 355 360 365Asp Met Glu Leu Asp Glu Cys Glu Glu Thr Met Pro Tyr Asp Val Asn 370 375 380Ile Glu Ala Glu Met Arg Arg Arg Gln Gln Gln His Gln Glu Ala Tyr385 390 395 400Asp Glu Asp Glu Asp Met Pro Gly Gly Ala Gln Arg Val Gln Cys Ala 405 410 415Gln Gln131269DNAZea mays 13atgtttggac gcatgccaag gaagagtagt aacaatacca agtattacga ggttcttggt 60gtgtctaaga ccgcaagtca ggatgagctt aagaaagcat acagaaaagc tgccataaaa 120aaccatcctg ataagggtgg agaccctgag aagtttaaag agctgtctca agcttatgat 180gttcttagtg acccggagaa gagggagatc tatgaccagt atggagaaga tgcccttaag 240gaaggaatgg gaggaggcag cagcagtgat ttccatagcc ctttcgacat ttttgagcaa 300ctttttccgg gttctagcac ctttgggggt ggtagctcaa gaggacgcag acaaaagcgt 360ggtgaagatg tggtgcatac tatgaaggtt tccttagacg atctgtacaa tgggacaacc 420aagaaactat ctttatcgcg gagtgctttg tgctccaagt gcaaggggaa aggatccaag 480agtggggcat caggaacatg ccatggttgt cgtggtgctg gaatgagaac aatcacaaga 540cagataggcc ttggcatgat ccaacagatg aacactgttt gccctgaatg caaaggatca 600ggtgagatca taagtgacaa ggacaaatgc ccaagctgta aaggaaacaa ggtagtccag 660gagaagaagg tgttagaggt tcatgtggag aaaggaatgc aacataacca aaagattgta 720ttccagggtc aagctgatga agctcctgat acggttacag gagacattgt ttttgtcttg 780caacttaaag accatccaaa atttaagagg atgtacgatg acttatatgt tgagcacaca 840atctctctca ccgaagcatt gtgtggcttc cagtttgttc ttactcatct tgatgggcga 900cagcttctga tcaaatctga ccccggggag gttattaaac caggtcaaca caaggccatt 960aacgatgaag gtatgcctca gcatggccgt cctttcatga agggccgtct gtttgttgaa 1020ttcaacgtgg tgtttcccga gcctggtgcg ctctcccctg cccagtgccg atcgttggag 1080aagatccttc cgccgaaacc agggagccaa ctgtcggaca tggagctgga ccagtgcgag 1140gagaccaccc ttcacgatgt caacattgaa gaggagatga ggcgcaggca gcagcagaag 1200aagcaggaag cctacgatga agacgaggag gaggatgctc aaccaagggt gcaatgtgcc 1260cagcagtaa 126914422PRTZea mays 14Met Phe Gly Arg Met Pro Arg Lys Ser Ser Asn Asn Thr Lys Tyr Tyr1 5 10 15Glu Val Leu Gly Val Ser Lys Thr Ala Ser Gln Asp Glu Leu Lys Lys 20 25 30Ala Tyr Arg Lys Ala Ala Ile Lys Asn His Pro Asp Lys Gly Gly Asp 35 40 45Pro Glu Lys Phe Lys Glu Leu Ser Gln Ala Tyr Asp Val Leu Ser Asp 50 55 60Pro Glu Lys Arg Glu Ile Tyr Asp Gln Tyr Gly Glu Asp Ala Leu Lys65 70 75 80Glu Gly Met Gly Gly Gly Ser Ser Ser Asp Phe His Ser Pro Phe Asp 85 90 95Ile Phe Glu Gln Leu Phe Pro Gly Ser Ser Thr Phe Gly Gly Gly Ser 100 105 110Ser Arg Gly Arg Arg Gln Lys Arg Gly Glu Asp Val Val His Thr Met 115 120 125Lys Val Ser Leu Asp Asp Leu Tyr Asn Gly Thr Thr Lys Lys Leu Ser 130 135 140Leu Ser Arg Ser Ala Leu Cys Ser Lys Cys Lys Gly Lys Gly Ser Lys145 150 155 160Ser Gly Ala Ser Gly Thr Cys His Gly Cys Arg Gly Ala Gly Met Arg 165 170 175Thr Ile Thr Arg Gln Ile Gly Leu Gly Met Ile Gln Gln Met Asn Thr 180 185 190Val Cys Pro Glu Cys Lys Gly Ser Gly Glu Ile Ile Ser Asp Lys Asp 195 200 205Lys Cys Pro Ser Cys Lys Gly Asn Lys Val Val Gln Glu Lys Lys Val 210 215 220Leu Glu Val His Val Glu Lys Gly Met Gln His Asn Gln Lys Ile Val225 230 235 240Phe Gln Gly Gln Ala Asp Glu Ala Pro Asp Thr Val Thr Gly Asp Ile 245 250 255Val Phe Val Leu Gln Leu Lys Asp His Pro Lys Phe Lys Arg Met Tyr 260 265 270Asp Asp Leu Tyr Val Glu His Thr Ile Ser Leu Thr Glu Ala Leu Cys 275 280 285Gly Phe Gln Phe Val Leu Thr His Leu Asp Gly Arg Gln Leu Leu Ile 290 295 300Lys Ser Asp Pro Gly Glu Val Ile Lys Pro Gly Gln His Lys Ala Ile305 310 315 320Asn Asp Glu Gly Met Pro Gln His Gly Arg Pro Phe Met Lys Gly Arg 325 330 335Leu Phe Val Glu Phe Asn Val Val Phe Pro Glu Pro Gly Ala Leu Ser 340 345 350Pro Ala Gln Cys Arg Ser Leu Glu Lys Ile Leu Pro Pro Lys Pro Gly 355 360 365Ser Gln Leu Ser Asp Met Glu Leu Asp Gln Cys Glu Glu Thr Thr Leu 370 375 380His Asp Val Asn Ile Glu Glu Glu Met Arg Arg Arg Gln Gln Gln Lys385 390 395 400Lys Gln Glu Ala Tyr Asp Glu Asp Glu Glu Glu Asp Ala Gln Pro Arg 405 410 415Val Gln Cys Ala Gln Gln 420151266DNATriticum aestivum 15atgttcgggc gcgggccgcc gaagaagagc gacagcacgc gctactacga gatcctgggc 60gtgcccaagg acgcgtccca ggacgacctc aagaaggcct accgcaaggc cgccatcaag 120aaccaccccg acaagggagg cgacccagag aagttcaagg agctagctca ggcttatgag 180gttctgagtg atcctgagaa gcgagagatc tatgaccagt atggtgagga tgccctcaag 240gagggaatgg gaggtggagg aatgcatgat ccttttgaca tcttccagtc attctttggt 300ggtggcggca accccttcgg aggtggcggg agcagtaggg gcaggcggca gcgcaggggt 360gaggatgtgg ttcatcctct gaaggttagc cttgaggaac tgtacaacgg aacatcaaag 420aagctctctc ttgcccgcaa tgtgctctgc tcgaagtgca atggcaaggg gtcaaagtcc 480ggggcttcga tgaagtgtgc cggctgccaa ggtgctggtt acaaggtgca gataaggcag 540ctgggaccag gaatgattca gcaaatgcag cagccttgca atgagtgcag gggaagtggg 600gagaccatca gcgacaagga tcgctgtggg cagtgcaaag gcgagaaggt ggtgcacgag 660aagaaagtcc tggaggtggt ggtcgagaag ggaatgcagc atgggcagaa gatcaccttc 720cccggcgagg cggatgaagc gcctgatact gttactggag acataatctt cgtcctccag 780cagaaggagc accccaaatt caagcggaag ggcgatgacc tcttctacga gcacaccctg 840accctgaccg aggcactgtg tggcttccag tatgtcctgg ctcatttgga cggcaggcag 900ctgctcatca agtccaaccc tggcgaagtc gtcaagcctg attcgttcaa ggcgatcaac 960gacgagggca tgcccatgta ccagaggccg ttcatgaagg gcaagctgta catccacttc 1020acggttgatt ttcccgactc gctgagcctg gaccagtgca aggcgctcga gactgtcctg 1080ccgcccaagc cggcgtcgca gtacacggac atggagctgg acgagtgcga ggagacgatg 1140gcctacgaca ttgacatcga ggaggagatg cggaggcgac agcagcagca ggcacaggag 1200gcctacgacg aggacgagga catgcccggt ggcggcggcc agcgggtgca gtgcgcccag 1260cagtag 126616421PRTTriticum aestivum 16Met Phe Gly Arg Gly Pro Pro Lys Lys Ser Asp Ser Thr Arg Tyr Tyr1 5 10 15Glu Ile Leu Gly Val Pro Lys Asp Ala Ser Gln Asp Asp Leu Lys Lys 20 25 30Ala Tyr Arg Lys Ala Ala Ile Lys Asn His Pro Asp Lys Gly Gly Asp 35 40 45Pro Glu Lys Phe Lys Glu Leu Ala Gln Ala Tyr Glu Val Leu Ser Asp 50 55 60Pro Glu Lys Arg Glu Ile Tyr Asp Gln Tyr Gly Glu Asp Ala Leu Lys65 70 75 80Glu Gly Met Gly Gly Gly Gly Met His Asp Pro Phe Asp Ile Phe Gln 85 90 95Ser Phe Phe Gly Gly Gly Gly Asn Pro Phe Gly Gly Gly Gly Ser Ser 100 105 110Arg Gly Arg Arg Gln Arg Arg Gly Glu Asp Val Val His Pro Leu Lys 115 120 125Val Ser Leu Glu Glu Leu Tyr Asn Gly Thr Ser Lys Lys Leu Ser Leu 130 135 140Ala Arg Asn Val Leu Cys Ser Lys Cys Asn Gly Lys Gly Ser Lys Ser145 150 155 160Gly Ala Ser Met Lys Cys Ala Gly Cys Gln Gly Ala Gly Tyr Lys Val 165 170 175Gln Ile Arg Gln Leu Gly Pro Gly Met Ile Gln Gln Met Gln Gln Pro 180 185 190Cys Asn Glu Cys Arg Gly Ser Gly Glu Thr Ile Ser Asp Lys Asp Arg 195 200 205Cys Gly Gln Cys Lys Gly Glu Lys Val Val His Glu Lys Lys Val Leu 210 215 220Glu Val Val Val Glu Lys Gly Met Gln His Gly Gln Lys Ile Thr Phe225 230 235 240Pro Gly Glu Ala Asp Glu Ala Pro Asp Thr Val Thr Gly Asp Ile Ile 245 250 255Phe Val Leu Gln Gln Lys Glu His Pro Lys Phe Lys Arg Lys Gly Asp 260 265 270Asp Leu Phe Tyr Glu His Thr Leu Thr Leu Thr Glu Ala Leu Cys Gly 275 280

285Phe Gln Tyr Val Leu Ala His Leu Asp Gly Arg Gln Leu Leu Ile Lys 290 295 300Ser Asn Pro Gly Glu Val Val Lys Pro Asp Ser Phe Lys Ala Ile Asn305 310 315 320Asp Glu Gly Met Pro Met Tyr Gln Arg Pro Phe Met Lys Gly Lys Leu 325 330 335Tyr Ile His Phe Thr Val Asp Phe Pro Asp Ser Leu Ser Leu Asp Gln 340 345 350Cys Lys Ala Leu Glu Thr Val Leu Pro Pro Lys Pro Ala Ser Gln Tyr 355 360 365Thr Asp Met Glu Leu Asp Glu Cys Glu Glu Thr Met Ala Tyr Asp Ile 370 375 380Asp Ile Glu Glu Glu Met Arg Arg Arg Gln Gln Gln Gln Ala Gln Glu385 390 395 400Ala Tyr Asp Glu Asp Glu Asp Met Pro Gly Gly Gly Gly Gln Arg Val 405 410 415Gln Cys Ala Gln Gln 420171260DNAArabidopsis thaliana 17atgtttggaa gaggaccttc aaggaagagc gataacacaa agttctacga gatccttggt 60gttcctaaga ccgcagcacc agaagatctc aagaaagctt ataagaaagc cgctatcaaa 120aaccatcctg ataagggtgg tgatcccgaa aagtttaaag agttagcaca ggcttatgaa 180gttttaagtg atcctgagaa gcgtgagatc tatgatcaat atggggaaga tgcactcaag 240gaaggaatgg gtggtggagg tggtggacac gatccatttg atatcttctc ttccttcttt 300ggtagtggtg gacacccatt cggaagtcat agccggggaa ggaggcagag gcgtggtgaa 360gatgttgttc atcccttgaa ggtttcctta gaggatgttt atctcggaac aacaaagaag 420ctctcacttt ctaggaaggc tttgtgctca aagtgtaacg gcaagggttc aaagtctgga 480gcttcactga aatgtggtgg ctgtcaaggc tcgggaatga agatctcgat caggcagttt 540ggacctggaa tgatgcagca ggtgcagcat gcttgtaatg attccaaagg cacaggagag 600accatcaatg atcgggacag gtgtccacaa tgcaaaggag agaaggttgt ctctgagaag 660aaggtgcttg aagtaaatgt ggagaaggga atgcaacaca atcagaagat cacattcagt 720ggacaagccg atgaagcgcc tgatactgtc accggagata tagtgtttgt cattcagcag 780aaggagcacc caaagttcaa aagaaagggt gaggatctct ttgtggagca caccatctct 840ctaaccgagg ccttgtgtgg cttccagttt gtcttgaccc atttggacaa aagacagctt 900ctcatcaaat ccaagcccgg agaggtcgtc aaacctgatt catacaaggc gataagtgat 960gagggaatgc caatatacca aagtccgttc atgaagggta agctatacat tcacttcacg 1020gttgaattcc cggaatcgct gagcccggat cagacaaagg ccattgaagc agttttgcca 1080aagccaacca aggcagctat aagcgatatg gaaatagacg actgcgaaga gacgactctg 1140catgatgtga acattgagga tgagatgaaa aggaaggcgc aagctcaaag agaggcttat 1200gatgtcgatg aggaagatca cccaggcggt gctcaccgtg tgcaatgtgc ccagcagtga 126018419PRTArabidopsis thaliana 18Met Phe Gly Arg Gly Pro Ser Arg Lys Ser Asp Asn Thr Lys Phe Tyr1 5 10 15Glu Ile Leu Gly Val Pro Lys Thr Ala Ala Pro Glu Asp Leu Lys Lys 20 25 30Ala Tyr Lys Lys Ala Ala Ile Lys Asn His Pro Asp Lys Gly Gly Asp 35 40 45Pro Glu Lys Phe Lys Glu Leu Ala Gln Ala Tyr Glu Val Leu Ser Asp 50 55 60Pro Glu Lys Arg Glu Ile Tyr Asp Gln Tyr Gly Glu Asp Ala Leu Lys65 70 75 80Glu Gly Met Gly Gly Gly Gly Gly Gly His Asp Pro Phe Asp Ile Phe 85 90 95Ser Ser Phe Phe Gly Ser Gly Gly His Pro Phe Gly Ser His Ser Arg 100 105 110Gly Arg Arg Gln Arg Arg Gly Glu Asp Val Val His Pro Leu Lys Val 115 120 125Ser Leu Glu Asp Val Tyr Leu Gly Thr Thr Lys Lys Leu Ser Leu Ser 130 135 140Arg Lys Ala Leu Cys Ser Lys Cys Asn Gly Lys Gly Ser Lys Ser Gly145 150 155 160Ala Ser Met Lys Cys Gly Gly Cys Gln Gly Ser Gly Met Lys Ile Ser 165 170 175Ile Arg Gln Phe Gly Pro Gly Met Met Gln Gln Val Gln His Ala Cys 180 185 190Asn Asp Cys Lys Gly Thr Gly Glu Thr Ile Asn Asp Arg Asp Arg Cys 195 200 205Pro Gln Cys Lys Gly Glu Lys Val Val Ser Glu Lys Lys Val Leu Glu 210 215 220Val Asn Val Glu Lys Gly Met Gln His Asn Gln Lys Ile Thr Phe Ser225 230 235 240Gly Gln Ala Asp Glu Ala Pro Asp Thr Val Thr Gly Asp Ile Val Phe 245 250 255Val Ile Gln Gln Lys Glu His Pro Lys Phe Lys Arg Lys Gly Glu Asp 260 265 270Leu Phe Val Glu His Thr Ile Ser Leu Thr Glu Ala Leu Cys Gly Phe 275 280 285Gln Phe Val Leu Thr His Leu Asp Lys Arg Gln Leu Leu Ile Lys Ser 290 295 300Lys Pro Gly Glu Val Val Lys Pro Asp Ser Tyr Lys Ala Ile Ser Asp305 310 315 320Glu Gly Met Pro Ile Tyr Gln Arg Pro Phe Met Lys Gly Lys Leu Tyr 325 330 335Ile His Phe Thr Val Glu Phe Pro Glu Ser Leu Ser Pro Asp Gln Thr 340 345 350Lys Ala Ile Glu Ala Val Leu Pro Lys Pro Thr Lys Ala Ala Ile Ser 355 360 365Asp Met Glu Ile Asp Asp Cys Glu Glu Thr Thr Leu His Asp Val Asn 370 375 380Ile Glu Asp Glu Met Lys Arg Lys Ala Gln Ala Gln Arg Glu Ala Tyr385 390 395 400Asp Asp Asp Glu Glu Asp His Pro Gly Gly Ala Gln Arg Val Gln Cys 405 410 415Ala Gln Gln191263DNAArabidopsis thaliana 19atgttcggta gaggaccctc gaagaagagc gacaacacta agttctacga gatcttaggt 60gttcctaaga gcgcttcacc agaagatctc aagaaagctt acaaaaaagc cgctatcaag 120aatcatcctg ataagggtgg agatcccgag aaggtgaata atttcttaga tccgtatgaa 180gtgcttagtg acccggagaa gcgtgagatt tatgaccagt atggagagga tgcactcaag 240gaaggaatgg gtggtggagg aggtggacat gatccatttg atattttctc atccttcttt 300ggtggaggcc cctttggagg tgagtctcct tggacactgt ggcagaggcg tggtgaggat 360gttgttcatc ccttgaaggt atctcttgag gatgtgtacc ttggtacaat gaagaagctt 420tcactttcta ggaatgctct ctgctctaag tgtaacgggt tagtacattc gactcgatcc 480tccttgaaat gtggagggtg tcagggatct ggtatgaagg tgtctattag gcagcttgga 540cctggaatga tccagcagat gcagcatgca tgtaatgaat gcaaagggac aggtgagacc 600atcaatgatc gggacaggtg tccacaatgc aaaggagaca aggtcattcc tgagaagaag 660gtgcttgaag tgaatgtgga gaagggaatg caacacagtc agaagatcac atttgaagga 720caagcagatg aagcggtatc tactctcata catttaatag tgtttgtcct tcagcagaaa 780gagcacccaa agttcaagag aaagggagaa gacctctttg tggagcacac actttctcta 840accgaagctt tgtgtggctt ccaatttgtt ctgactcact tggatggcag aagtcttctc 900attaaatcta atcctgggga ggtcgtgaaa cctggtacgt attcagatgc atcgtatgaa 960ggaatgccga tataccagag gccattcatg aagggtaagc tctacatcca cttcacagtg 1020gagttcccgg actcgttgag cccagatcag accaaagcac tggaagctgt tctacctaag 1080ccgtcaacag ctcagttgag tgacatggag atagatgaat gcgaggagac cacgctccac 1140gatgtcaaca ttgaggatga gatgaggagg aaggcacaag ctcaaagaga ggcttatgat 1200gatgacgatg aagatgatga ccatccgggt ggtgctcaaa gggtgcaatg tgcccagcag 1260taa 126320420PRTArabidopsis thaliana 20Met Phe Gly Arg Gly Pro Ser Lys Lys Ser Asp Asn Thr Lys Phe Tyr1 5 10 15Glu Ile Leu Gly Val Pro Lys Ser Ala Ser Pro Glu Asp Leu Lys Lys 20 25 30Ala Tyr Lys Lys Ala Ala Ile Lys Asn His Pro Asp Lys Gly Gly Asp 35 40 45Pro Glu Lys Phe Lys Glu Leu Ala Gln Ala Tyr Glu Val Leu Ser Asp 50 55 60Pro Glu Lys Arg Glu Ile Tyr Asp Gln Tyr Gly Glu Asp Ala Leu Lys65 70 75 80Glu Gly Met Gly Gly Gly Gly Gly Gly His Asp Pro Phe Asp Ile Phe 85 90 95Ser Ser Phe Phe Gly Gly Gly Pro Phe Gly Gly Asn Thr Ser Arg Gln 100 105 110Arg Arg Gln Arg Arg Gly Glu Asp Val Val His Pro Leu Lys Val Ser 115 120 125Leu Glu Asp Val Tyr Leu Gly Thr Met Lys Lys Leu Ser Leu Ser Arg 130 135 140Asn Ala Leu Cys Ser Lys Cys Asn Gly Lys Gly Ser Lys Ser Gly Ala145 150 155 160Ser Leu Lys Cys Gly Gly Cys Gln Gly Ser Gly Met Lys Val Ser Ile 165 170 175Arg Gln Leu Gly Pro Gly Met Ile Gln Gln Met Gln His Ala Cys Asn 180 185 190Glu Cys Lys Gly Thr Gly Glu Thr Ile Asn Asp Arg Asp Arg Cys Pro 195 200 205Gln Cys Lys Gly Asp Lys Val Ile Pro Glu Lys Lys Val Leu Glu Val 210 215 220Asn Val Glu Lys Gly Met Gln His Ser Gln Lys Ile Thr Phe Glu Gly225 230 235 240Gln Ala Asp Glu Ala Pro Asp Thr Val Thr Gly Asp Ile Val Phe Val 245 250 255Leu Gln Gln Lys Glu His Pro Lys Phe Lys Arg Lys Gly Glu Asp Leu 260 265 270Phe Val Glu His Thr Leu Ser Leu Thr Glu Ala Leu Cys Gly Phe Gln 275 280 285Phe Val Leu Thr His Leu Asp Gly Arg Ser Leu Leu Ile Lys Ser Asn 290 295 300Pro Gly Glu Val Val Lys Pro Asp Ser Tyr Lys Ala Ile Ser Asp Glu305 310 315 320Gly Met Pro Ile Tyr Gln Arg Pro Phe Met Lys Gly Lys Leu Tyr Ile 325 330 335His Phe Thr Val Glu Phe Pro Asp Ser Leu Ser Pro Asp Gln Thr Lys 340 345 350Ala Leu Glu Ala Val Leu Pro Lys Pro Ser Thr Ala Gln Leu Ser Asp 355 360 365Met Glu Ile Asp Glu Cys Glu Glu Thr Thr Leu His Asp Val Asn Ile 370 375 380Glu Asp Glu Met Arg Arg Lys Ala Gln Ala Gln Arg Glu Ala Tyr Asp385 390 395 400Asp Asp Asp Glu Asp Asp Asp His Pro Gly Gly Ala Gln Arg Val Gln 405 410 415Cys Ala Gln Gln 420211254DNAAtriplex nummularia 21atgtttggaa gagcaccaaa gaagagtgat agcaccagat attacgagat cttaggcgta 60ccaaaagatg catctcctga agatttgaag aaggcttata aaaaagctgc cattaaaaat 120catcctgaca agggaggtga tcccgagaag tttaaagagc tagctcatgc ttatgaggtc 180ctcagtgatc ccgaaaagcg tgagatctat gatcaatatg gtgaggatgc acttaaggaa 240ggaatgggtg gaggtggcgg tatgcatgat ccattcgaca tcttccaatc cttctttgga 300ggaagtccat ttggtggtgt tggttctagc cgaggaagaa ggcaaaggcg gggagaagat 360gtagttcatc ctcttaaggt ttcactcgag gatctcttta ccggtacaac aaagaagctc 420tcactctctc gcaatgtaat ttgttcaaag tgtactggca aaggatcaaa atcgggagct 480tctatgaagt gttctggatg tcaaggtact ggtatgaagg tttctatcag acatctggga 540ccctcaatga tccagcagat gcagcaccct tgtaatgaat gcaaaggaac tggagagacg 600attaatgaca aagatcgttg ccctcagtgc aaaggtgaga aggttgtgca ggagaagaag 660gtcttagagg ttgttgtgga gaagggcatg caacatggac agaaaattac tttccctgga 720gaggctgatg aagctcctga tactgtcact ggagatatag tctttgtcct gcagcagaaa 780gagcacccta agttcaagag aaagggtgaa gatctcttct acgagcacac tctaagcctg 840actgaagctc tttgcggctt tagatttgtg ctgactcacc ttgatggaag gcaacttctt 900atcaaatcaa acctgggaga agttgtcaag cctgatcaat tcaaggcaat tgaggatgag 960ggtatgccta tataccaaag gccgttcatg aagggcaaga tgtacatcca tttcacagtg 1020gagttccccg attcgttaaa ccctgatcaa gttaaatcct tggaagcgat ccttcctcct 1080aagccatcaa tgtctctcac atacatggag ttagatgaat gtgaagagac aacactgcat 1140aatgtcaaca ttgaagaaga gatgaaaagg aagcagacac aagcacagca ggaggcatac 1200gatgaagatg acgaacctgc cggtggtcag agggtccaat gtgctcaaca gtga 125422417PRTAtriplex nummularia 22Met Phe Gly Arg Ala Pro Lys Lys Ser Asp Ser Thr Arg Tyr Tyr Glu1 5 10 15Ile Leu Gly Val Pro Lys Asp Ala Ser Pro Glu Asp Leu Lys Lys Ala 20 25 30Tyr Lys Lys Ala Ala Ile Lys Asn His Pro Asp Lys Gly Gly Asp Pro 35 40 45Glu Lys Phe Lys Glu Leu Ala His Ala Tyr Glu Val Leu Ser Asp Pro 50 55 60Glu Lys Arg Glu Ile Tyr Asp Gln Tyr Gly Glu Asp Ala Leu Lys Glu65 70 75 80Gly Met Gly Gly Gly Gly Gly Met His Asp Pro Phe Asp Ile Phe Gln 85 90 95Ser Phe Phe Gly Gly Ser Pro Phe Gly Gly Val Gly Ser Ser Arg Gly 100 105 110Arg Arg Gln Arg Arg Gly Glu Asp Val Val His Pro Leu Lys Val Ser 115 120 125Leu Glu Asp Leu Phe Thr Gly Thr Thr Lys Lys Leu Ser Leu Ser Arg 130 135 140Asn Val Ile Cys Ser Lys Cys Thr Gly Lys Gly Ser Lys Ser Gly Ala145 150 155 160Ser Met Lys Cys Ser Gly Cys Gln Gly Thr Gly Met Lys Val Ser Ile 165 170 175Arg His Leu Gly Pro Ser Met Ile Gln Gln Met Gln His Pro Cys Asn 180 185 190Glu Cys Lys Gly Thr Gly Glu Thr Ile Asn Asp Lys Asp Arg Cys Pro 195 200 205Gln Cys Lys Gly Glu Lys Val Val Gln Glu Lys Lys Val Leu Glu Val 210 215 220Val Val Glu Lys Gly Met Gln His Gly Gln Lys Ile Thr Phe Pro Gly225 230 235 240Glu Ala Asp Glu Ala Pro Asp Thr Val Thr Gly Asp Ile Val Phe Val 245 250 255Leu Gln Gln Lys Glu His Pro Lys Phe Lys Arg Lys Gly Glu Asp Leu 260 265 270Phe Tyr Glu His Thr Leu Ser Leu Thr Glu Ala Leu Cys Gly Phe Arg 275 280 285Phe Val Leu Thr His Leu Asp Gly Arg Gln Leu Leu Ile Lys Ser Asn 290 295 300Leu Gly Glu Val Val Lys Pro Asp Gln Phe Lys Ala Ile Glu Asp Glu305 310 315 320Gly Met Pro Ile Tyr Gln Arg Pro Phe Met Lys Gly Lys Met Tyr Ile 325 330 335His Phe Thr Val Glu Phe Pro Asp Ser Leu Asn Pro Asp Gln Val Lys 340 345 350Ser Leu Glu Ala Ile Leu Pro Pro Lys Pro Ser Met Ser Leu Thr Tyr 355 360 365Met Glu Leu Asp Glu Cys Glu Glu Thr Thr Leu His Asn Val Asn Ile 370 375 380Glu Glu Glu Met Lys Arg Lys Gln Thr Gln Ala Gln Gln Glu Ala Tyr385 390 395 400Asp Glu Asp Asp Glu Pro Ala Gly Gly Gln Arg Val Gln Cys Ala Gln 405 410 415Gln231242DNACucumis sativus 23atgtttggaa ggccgaagaa gagcgataat accaaatatt atgagattct tggagtctcg 60aagaatgcgt cgcaagacga tctaaagaag gcttatagaa aggccgccat caagaaccat 120cctgataaag gtggcgaccc tgaaaaattc aaggagttag cacaagccta cgaggtgctg 180agtgatccag agaaacgtga gatatatgat caatatggcg aggatgccct caaggaagga 240atgggaggtg gcggtggtca tgatccattt gacatattcc agtctttctt tggtggaagc 300ccgtttggtg gtggtggaag cagcagaggc cgaaggcaga gaaggggaga ggatgttatc 360catcctctca aggtctcgtt ggaagatctc tacaacggta cttcaaagaa gctctctctt 420tcacgtaatg taatttgctc aaagtgcaag ggtaagggtt ctaaatctgg tgcttcaatg 480aagtgtcctg gctgtcaagg ttctggtatg aaagtttcca tcagacacct tggcccctct 540atgattcagc aaatgcagca tccttgcaat gaatgtaaag gaactggtga gaccatcaat 600gataaagatc gctgctcaca atgcaagggt gaaaaggttg ttcaggagaa aaaagttttg 660gaagttattg tggagaaggg tatgcaaaat gcacaaaaga ttacattccc tggtgaagca 720gatgaagcgc ccgacactgt tactggggac attgtctttg tcctacaaca aaaagagcac 780cccaagttta agagaaaggg cgatgacctc tttgtagagc ataccttgtc tctcgtcgag 840tctctgtgtg gtttccaatt tattctgact catttggatg gccgacagct actcatcaaa 900tcacttcccg gtgaagtagt gaagcctgac caattcaagg ccataaacga tgagggtatg 960cctatgtacc agaggccatt catgaagggc aaactttaca tccacttcag tgttgagttc 1020ccagactcct tgaaccccga acagtgcaag gcgctggagg gcgttctgcc tcccaggacc 1080tcagtgcagc tctcagatat ggaattggat gaatgtgaag agaccactct ccacgatgtc 1140aacattgaag aggagatgcg caggaagcaa gcacaagagg catacgatga agatgaggat 1200atgcacggtg gtgcacagag agtgcagtgt gctcaacaat ga 124224413PRTCucumis sativus 24Met Phe Gly Arg Pro Lys Lys Ser Asp Asn Thr Lys Tyr Tyr Glu Ile1 5 10 15Leu Gly Val Ser Lys Asn Ala Ser Gln Asp Asp Leu Lys Lys Ala Tyr 20 25 30Arg Lys Ala Ala Ile Lys Asn His Pro Asp Lys Gly Gly Asp Pro Glu 35 40 45Lys Phe Lys Glu Leu Ala Gln Ala Tyr Glu Val Leu Ser Asp Pro Glu 50 55 60Lys Arg Glu Ile Tyr Asp Gln Tyr Gly Glu Asp Ala Leu Lys Glu Gly65 70 75 80Met Gly Gly Gly Gly Gly His Asp Pro Phe Asp Ile Phe Gln Ser Phe 85 90 95Phe Gly Gly Ser Pro Phe Gly Gly Gly Gly Ser Ser Arg Gly Arg Arg 100 105 110Gln Arg Arg Gly Glu Asp Val Ile His Pro Leu Lys Val Ser Leu Glu 115 120 125Asp Leu Tyr Asn Gly Thr Ser Lys Lys Leu Ser Leu Ser Arg Asn Val 130 135 140Ile Cys Ser Lys Cys Lys Gly Lys Gly Ser Lys Ser Gly Ala Ser Met145 150 155 160Lys Cys Pro Gly Cys Gln Gly Ser Gly Met Lys Val Ser Ile Arg His 165 170 175Leu Gly Pro Ser Met Ile Gln Gln Met Gln His Pro Cys Asn Glu Cys 180 185 190Lys Gly Thr Gly Glu Thr Ile Asn Asp Lys Asp Arg Cys Ser Gln Cys 195 200 205Lys Gly Glu Lys Val Val Gln Glu Lys

Lys Val Leu Glu Val Ile Val 210 215 220Glu Lys Gly Met Gln Asn Ala Gln Lys Ile Thr Phe Pro Gly Glu Ala225 230 235 240Asp Glu Ala Pro Asp Thr Val Thr Gly Asp Ile Val Phe Val Leu Gln 245 250 255Gln Lys Glu His Pro Lys Phe Lys Arg Lys Gly Asp Asp Leu Phe Val 260 265 270Glu His Thr Leu Ser Leu Val Glu Ser Leu Cys Gly Phe Gln Phe Ile 275 280 285Leu Thr His Leu Asp Gly Arg Gln Leu Leu Ile Lys Ser Leu Pro Gly 290 295 300Glu Val Val Lys Pro Asp Gln Phe Lys Ala Ile Asn Asp Glu Gly Met305 310 315 320Pro Met Tyr Gln Arg Pro Phe Met Lys Gly Lys Leu Tyr Ile His Phe 325 330 335Ser Val Glu Phe Pro Asp Ser Leu Asn Pro Glu Gln Cys Lys Ala Leu 340 345 350Glu Gly Val Leu Pro Pro Arg Thr Ser Val Gln Leu Ser Asp Met Glu 355 360 365Leu Asp Glu Cys Glu Glu Thr Thr Leu His Asp Val Asn Ile Glu Glu 370 375 380Glu Met Arg Arg Lys Gln Ala Gln Glu Ala Tyr Asp Glu Asp Glu Asp385 390 395 400Met His Gly Gly Ala Gln Arg Val Gln Cys Ala Gln Gln 405 410251257DNADaucus carota 25atgtttggga gagcaccaaa gaagagtgac aatacaaagt actatgaaat tcttggtgtc 60ccaaaaacag catcacctga tgatctgaag aaagcttaca ggaaggctgc tatcaagaat 120catcctgata agggtggcga tcctgaaaag tttaaagagc ttgcgcaagc atatgaggtt 180ctgagtgacc cagagaagcg tgaaatctat gatcagtatg gagaggatgc tctcaaggag 240ggaatgggtg gtggtggagg tggtggccat gacccatttg acattttcca atccttcttt 300ggtggcagcc cgtttggtgg aggtggcagc agcagaggac gaaggcaaag aaggggggag 360gatgtcattc atccccttaa ggtttcactg gaagatcttt gcaatgggac ttccaagaag 420ctttcccttt cacgtaatgt aatttgttct aaatgcaagg gaaaggggtc caagtcgggt 480gcttcaatga catgtcctgg ctgccagggt tctggaatga aggtttctat caggcacttg 540ggcccatcta tgatccagca gatgcagcat ccctgcaatg actgcaaggg tactggagaa 600acaatcaacg acaaggatcg ctgccctcaa tgcaaaggtc aaaaggttgt gcaggagaag 660aaagcaatag aagttattgt ggagaagggt atgcaaaacg gacagaagat tacattccct 720ggagaagctg atgaagcgcc tgacacggtt actggggaca tagtgtttgt gttgcaacaa 780aaggagcacc ccaagtttaa gaggaagggt gatgatcttt ttgttgaaca ttcattaact 840ctcagtgaag cactttgtgg cttccaattt actttgactc acctggacgg caggcagctt 900cttattaaat cccagccagg agaagttatc aagccagatc aatttaaggg gataaatgat 960gaaggaatgc caatgtatca gaggccattt atgcgaggaa agctttacat tcactttagt 1020gtagatttcc cagagtcctt gacccctgag cagtgcaaag ctcttgaagc tgtgttacct 1080ccgaggcctt caattcagat gacagacatg gaactggatg aatgtgaaga aacaacactg 1140catgatgtga atattgaaga ggagatgcgt cggaaacagc aagctgccca agaggcatat 1200gacgaagacg aagatatgca tggcggtgct cagagggtgc agtgtgctca acaatga 125726418PRTDaucus carota 26Met Phe Gly Arg Ala Pro Lys Lys Ser Asp Asn Thr Lys Tyr Tyr Glu1 5 10 15Ile Leu Gly Val Pro Lys Thr Ala Ser Pro Asp Asp Leu Lys Lys Ala 20 25 30Tyr Arg Lys Ala Ala Ile Lys Asn His Pro Asp Lys Gly Gly Asp Pro 35 40 45Glu Lys Phe Lys Glu Leu Ala Gln Ala Tyr Glu Val Leu Ser Asp Pro 50 55 60Glu Lys Arg Glu Ile Tyr Asp Gln Tyr Gly Glu Asp Ala Leu Lys Glu65 70 75 80Gly Met Gly Gly Gly Gly Gly Gly Gly His Asp Pro Phe Asp Ile Phe 85 90 95Gln Ser Phe Phe Gly Gly Ser Pro Phe Gly Gly Gly Gly Ser Ser Arg 100 105 110Gly Arg Arg Gln Arg Arg Gly Glu Asp Val Ile His Pro Leu Lys Val 115 120 125Ser Leu Glu Asp Leu Cys Asn Gly Thr Ser Lys Lys Leu Ser Leu Ser 130 135 140Arg Asn Val Ile Cys Ser Lys Cys Lys Gly Lys Gly Ser Lys Ser Gly145 150 155 160Ala Ser Met Thr Cys Pro Gly Cys Gln Gly Ser Gly Met Lys Val Ser 165 170 175Ile Arg His Leu Gly Pro Ser Met Ile Gln Gln Met Gln His Pro Cys 180 185 190Asn Asp Cys Lys Gly Thr Gly Glu Thr Ile Asn Asp Lys Asp Arg Cys 195 200 205Pro Gln Cys Lys Gly Gln Lys Val Val Gln Glu Lys Lys Ala Ile Glu 210 215 220Val Ile Val Glu Lys Gly Met Gln Asn Gly Gln Lys Ile Thr Phe Pro225 230 235 240Gly Glu Ala Asp Glu Ala Pro Asp Thr Val Thr Gly Asp Ile Val Phe 245 250 255Val Leu Gln Gln Lys Glu His Pro Lys Phe Lys Arg Lys Gly Asp Asp 260 265 270Leu Phe Val Glu His Ser Leu Thr Leu Ser Glu Ala Leu Cys Gly Phe 275 280 285Gln Phe Thr Leu Thr His Leu Asp Gly Arg Gln Leu Leu Ile Lys Ser 290 295 300Gln Pro Gly Glu Val Ile Lys Pro Asp Gln Phe Lys Gly Ile Asn Asp305 310 315 320Glu Gly Met Pro Met Tyr Gln Arg Pro Phe Met Arg Gly Lys Leu Tyr 325 330 335Ile His Phe Ser Val Asp Phe Pro Glu Ser Leu Thr Pro Glu Gln Cys 340 345 350Lys Ala Leu Glu Ala Val Leu Pro Pro Arg Pro Ser Ile Gln Met Thr 355 360 365Asp Met Glu Leu Asp Glu Cys Glu Glu Thr Thr Leu His Asp Val Asn 370 375 380Ile Glu Glu Glu Met Arg Arg Lys Gln Gln Ala Ala Gln Glu Ala Tyr385 390 395 400Asp Glu Asp Glu Asp Met His Gly Gly Ala Gln Arg Val Gln Cys Ala 405 410 415Gln Gln271254DNAGlycine max 27atgtttggga gggcaccgaa gaagagcgat aatacgaggt actacgaaat cctcggcgtc 60tccaagaacg cttcgcagga tgatctgaag aaggcttaca agaaagccgc cattaagaat 120caccccgaca agggcggtga tcccgagaag tttaaagagc tggcgcaagc ttatgaggtt 180ctgagtgacc ctgagaagcg tgagatatat gatcagtatg gtgaagatgc gcttaaggaa 240ggaatgggtg gtggcggtgg ccatgatcca tttgatatct tttcatcttt ctttggcggt 300gggagtccct ttggatcagg tggaagtagt cgaggtagga ggcagaggcg cggagaagac 360gtggttcacc ctctcaaggt ctctttggag gacctttatc ttggaacttc caagaagctc 420tccctctcca gaaatgttat atgctccaag tgcagtggca agggttctaa gtctggtgct 480tcgatgaagt gtgctggttg tcaaggaact ggtatgaagg tttctataag acatcttggc 540ccatccatga ttcagcagat gcagcatgcc tgcaatgaat gtaagggtac tggagaaact 600atcaatgaca gagatcgctg cccacagtgc aagggagaga aggttgtgca ggagaagaaa 660gtccttgaag ttattgtaga aaaggggatg cagaatgggc agaagataac attccctggc 720gaagctgatg aagcgccgga cacaattact ggggatatcg tctttgtcct tcagcagaag 780gaacatccca aattcaaaag aaaggctgaa gatctttttg tagagcacac tttgtccctt 840accgaggcct tgtgtggctt ccaatttgtg ctgactcact tggatagccg tcagcttctt 900attaaatcaa atcccgggga agttgtgaag cctgattcat acaaggctat aaatgatgag 960ggaatgccca tgtatcagag gccattcatg aaggggaaac tttacattca cttcactgtg 1020gagtttccag attctctaaa ccctgatcaa gttaaggcct tggaggctgt tctgccacca 1080aagccttctt cacaattgac agacatggag ctggatgaat gtgaggaaac tacactccat 1140gatgtcaaca tggaggagga gactaggagg aagcagcaac aagctcagga ggcatatgat 1200gaggatgatg acatgcctgg tggtgcacag agggtacagt gcgcccagca gtaa 125428417PRTGlycine max 28Met Phe Gly Arg Ala Pro Lys Lys Ser Asp Asn Thr Arg Tyr Tyr Glu1 5 10 15Ile Leu Gly Val Ser Lys Asn Ala Ser Gln Asp Asp Leu Lys Lys Ala 20 25 30Tyr Lys Lys Ala Ala Ile Lys Asn His Pro Asp Lys Gly Gly Asp Pro 35 40 45Glu Lys Phe Lys Glu Leu Ala Gln Ala Tyr Glu Val Leu Ser Asp Pro 50 55 60Glu Lys Arg Glu Ile Tyr Asp Gln Tyr Gly Glu Asp Ala Leu Lys Glu65 70 75 80Gly Met Gly Gly Gly Gly Gly His Asp Pro Phe Asp Ile Phe Ser Ser 85 90 95Phe Phe Gly Gly Gly Ser Pro Phe Gly Ser Gly Gly Ser Ser Arg Gly 100 105 110Arg Arg Gln Arg Arg Gly Glu Asp Val Val His Pro Leu Lys Val Ser 115 120 125Leu Glu Asp Leu Tyr Leu Gly Thr Ser Lys Lys Leu Ser Leu Ser Arg 130 135 140Asn Val Ile Cys Ser Lys Cys Ser Gly Lys Gly Ser Lys Ser Gly Ala145 150 155 160Ser Met Lys Cys Ala Gly Cys Gln Gly Thr Gly Met Lys Val Ser Ile 165 170 175Arg His Leu Gly Pro Ser Met Ile Gln Gln Met Gln His Ala Cys Asn 180 185 190Glu Cys Lys Gly Thr Gly Glu Thr Ile Asn Asp Arg Asp Arg Cys Pro 195 200 205Gln Cys Lys Gly Glu Lys Val Val Gln Glu Lys Lys Val Leu Glu Val 210 215 220Ile Val Glu Lys Gly Met Gln Asn Gly Gln Lys Ile Thr Phe Pro Gly225 230 235 240Glu Ala Asp Glu Ala Pro Asp Thr Ile Thr Gly Asp Ile Val Phe Val 245 250 255Leu Gln Gln Lys Glu His Pro Lys Phe Lys Arg Lys Ala Glu Asp Leu 260 265 270Phe Val Glu His Thr Leu Ser Leu Thr Glu Ala Leu Cys Gly Phe Gln 275 280 285Phe Val Leu Thr His Leu Asp Ser Arg Gln Leu Leu Ile Lys Ser Asn 290 295 300Pro Gly Glu Val Val Lys Pro Asp Ser Tyr Lys Ala Ile Asn Asp Glu305 310 315 320Gly Met Pro Met Tyr Gln Arg Pro Phe Met Lys Gly Lys Leu Tyr Ile 325 330 335His Phe Thr Val Glu Phe Pro Asp Ser Leu Asn Pro Asp Gln Val Lys 340 345 350Ala Leu Glu Ala Val Leu Pro Pro Lys Pro Ser Ser Gln Leu Thr Asp 355 360 365Met Glu Leu Asp Glu Cys Glu Glu Thr Thr Leu His Asp Val Asn Met 370 375 380Glu Glu Glu Thr Arg Arg Lys Gln Gln Gln Ala Gln Glu Ala Tyr Asp385 390 395 400Glu Asp Asp Asp Met Pro Gly Gly Ala Gln Arg Val Gln Cys Ala Gln 405 410 415Gln291248DNAHevea brasiliensis 29atgtttggaa gagcacccaa aaaaagcgat aacaccaagt actatgagat tcttggggtc 60tcaaagaacg cttcacagga tgatctaaag aaggcttata gaaaagctgc catcaagaac 120catcctgaca agggtggtga tcctgaaaag tttaaagagt tggcccaagc ttatgaggtt 180ttgagtgatc cagagaaacg tgagatatat gatcaatatg gagaggacgc cctcaaggag 240ggaatgggca gtggaggtgg tgctcatgac ccatttgaca ttttccaatc cttctttggt 300ggcaacccat ttggtggtgg tggtagcagc agaggccgta ggaaggaggg agaggatgtt 360atccatcctc tcaaggtttc tttggaagat ctctacaatg gcacctcaaa gaagctgtct 420ctttcccgta atgttatctg ctcaaagtgc aaaggtaaag ggtccaaatc aggtgcatca 480atgaaatgtt cgggttgcca aggttctgga atgaaggtct ccataagaca acttggtccc 540tctatgatcc agcaaatgca gcatccttgt aatgaatgta agggtactgg tgagaccatt 600aatgataagg atcgttgccc tcaatgtaaa ggtgaaaagg ttgttcagga gaagaaagtg 660ctggaagtta ttgttgagaa gggtatgcaa aatggacaga ggattacttt ccctggagaa 720gctgatgaag ctcctgatac tattacaggg gacattgttt ttgtccttca gcaaaaggag 780catcctaagt tcaagcgaaa gggtgatgac ctaattgttg atcacacttt atctcttaca 840gaggcacttt gtgcctccca gtttatatta acccatctag atggagacct cctcataaaa 900tcccaacctg gggaggtagt gaagcctgat caattcaagg ccataaatga tgaagggatg 960ccaatgtatc agaggccatt catgaggggg aaactgtaca ttcatttcag tgttgatttc 1020ccagactctc tgccccctga tcagtgcaaa gccctagagg cagttcttcc ctcaagaaca 1080tcagtccagc tgtctgacat ggagctggat gaatgtgagg agacaacttt acacgatgtg 1140aactttgacg aggagatgcg aaggaagcaa caacaggccc aagaggcata tgatgaagat 1200gatgatatgc atggtggtgg ccagagggtg caatgtgctc agcaataa 124830415PRTHevea brasiliensis 30Met Phe Gly Arg Ala Pro Lys Lys Ser Asp Asn Thr Lys Tyr Tyr Glu1 5 10 15Ile Leu Gly Val Ser Lys Asn Ala Ser Gln Asp Asp Leu Lys Lys Ala 20 25 30Tyr Arg Lys Ala Ala Ile Lys Asn His Pro Asp Lys Gly Gly Asp Pro 35 40 45Glu Lys Phe Lys Glu Leu Ala Gln Ala Tyr Glu Val Leu Ser Asp Pro 50 55 60Glu Lys Arg Glu Ile Tyr Asp Gln Tyr Gly Glu Asp Ala Leu Lys Glu65 70 75 80Gly Met Gly Ser Gly Gly Gly Ala His Asp Pro Phe Asp Ile Phe Gln 85 90 95Ser Phe Phe Gly Gly Asn Pro Phe Gly Gly Gly Gly Ser Ser Arg Gly 100 105 110Arg Arg Lys Glu Gly Glu Asp Val Ile His Pro Leu Lys Val Ser Leu 115 120 125Glu Asp Leu Tyr Asn Gly Thr Ser Lys Lys Leu Ser Leu Ser Arg Asn 130 135 140Val Ile Cys Ser Lys Cys Lys Gly Lys Gly Ser Lys Ser Gly Ala Ser145 150 155 160Met Lys Cys Ser Gly Cys Gln Gly Ser Gly Met Lys Val Ser Ile Arg 165 170 175Gln Leu Gly Pro Ser Met Ile Gln Gln Met Gln His Pro Cys Asn Glu 180 185 190Cys Lys Gly Thr Gly Glu Thr Ile Asn Asp Lys Asp Arg Cys Pro Gln 195 200 205Cys Lys Gly Glu Lys Val Val Gln Glu Lys Lys Val Leu Glu Val Ile 210 215 220Val Glu Lys Gly Met Gln Asn Gly Gln Arg Ile Thr Phe Pro Gly Glu225 230 235 240Ala Asp Glu Ala Pro Asp Thr Ile Thr Gly Asp Ile Val Phe Val Leu 245 250 255Gln Gln Lys Glu His Pro Lys Phe Lys Arg Lys Gly Asp Asp Leu Ile 260 265 270Val Asp His Thr Leu Ser Leu Thr Glu Ala Leu Cys Ala Ser Gln Phe 275 280 285Ile Leu Thr His Leu Asp Gly Asp Leu Leu Ile Lys Ser Gln Pro Gly 290 295 300Glu Val Val Lys Pro Asp Gln Phe Lys Ala Ile Asn Asp Glu Gly Met305 310 315 320Pro Met Tyr Gln Arg Pro Phe Met Arg Gly Lys Leu Tyr Ile His Phe 325 330 335Ser Val Asp Phe Pro Asp Ser Leu Pro Pro Asp Gln Cys Lys Ala Leu 340 345 350Glu Ala Val Leu Pro Ser Arg Thr Ser Val Gln Leu Ser Asp Met Glu 355 360 365Leu Asp Glu Cys Glu Glu Thr Thr Leu His Asp Val Asn Phe Asp Glu 370 375 380Glu Met Arg Arg Lys Gln Gln Gln Ala Gln Glu Ala Tyr Asp Glu Asp385 390 395 400Asp Asp Met His Gly Gly Gly Gln Arg Val Gln Cys Ala Gln Gln 405 410 415311260DNALycopersicum esculentum 31atgtttggaa gagcaccgaa gaagagcgat aatacaaagt attatgagat cttaggagtt 60cctaaggctg cttctcagga agatctcaaa aaggcttatc gtaaagctgc tatcaaaaat 120caccctgata agggaggcga tcctgagaag tttaaagagc ttgctcaagc ttatgaggtt 180ctgagtgacc cggagaagcg tgagatatat gatcagtatg gagaggatgc tctaaaggaa 240ggaatgggtg gtggaggtgg tggacatgaa ccatttgata tatttcaatc attcttcggt 300ggtggtggaa acccctttgg tggtggtgga agcagcagag tccgaagaca gagaagagga 360gaggatgtta tccacccgct caaggtttct ttagaggatc tttacaatgg gacatcaaag 420aagctttcac tatctcgcaa tgtgttgtgc tcaaagtgca agggcaaagg ttccaagtca 480ggtgcttcaa tgaaatgttc tggctgtcaa gggtctggaa tgaaagtttc tatcagacag 540ctcggtccat ccatgatcca gcagatgcag cacccttgca atgagtgcaa gggtactgga 600gagacgatca gtgacaaaga taggtgccct cagtgcaagg gtgagaaggt tgtgcaggag 660aagaaggtgt tggaagttca cgtggagaag ggtatgcaga atgggcaaaa gataacattt 720ccaggcgagg cagatgaagc gccagatacc atcactggag acattgtttt tgtcttgcaa 780caaaaggaac atcctaagtt caagcgaaag ggagatgatc tttttgttga gcacacattg 840agccttgacg agtctctatg tggtttccag tttgttctga ctcacctaga caacagacag 900ctgctcatta agtcccaacc tggcgaagtt gtcaagcctg atcagtttaa ggctatcaac 960gatgaaggaa tgccgatgta ccaaaggccg ttcatgaagg gcaaaatgta cattcacttc 1020actgttgatt tccccgagtc attacacgca gagcagtgca agaaccttga ggctgtgctg 1080cctcccaaaa ccaaattgca gatatcagat atggaattgg acgagtggga ggagactact 1140ttgcacgatg tcaacattga ggaggagatg cgaaggaagc agcaagctgc ccaagaggca 1200caggacgaag atgacgatat gcctggtggt gcacagagag tccaatgtgc acagcagtaa 126032419PRTLycopersicum esculentum 32Met Phe Gly Arg Ala Pro Lys Lys Ser Asp Asn Thr Lys Tyr Tyr Glu1 5 10 15Ile Leu Gly Val Pro Lys Ala Ala Ser Gln Glu Asp Leu Lys Lys Ala 20 25 30Tyr Arg Lys Ala Ala Ile Lys Asn His Pro Asp Lys Gly Gly Asp Pro 35 40 45Glu Lys Phe Lys Glu Leu Ala Gln Ala Tyr Glu Val Leu Ser Asp Pro 50 55 60Glu Lys Arg Glu Ile Tyr Asp Gln Tyr Gly Glu Asp Ala Leu Lys Glu65 70 75 80Gly Met Gly Gly Gly Gly Gly Gly His Glu Pro Phe Asp Ile Phe Gln 85 90 95Ser Phe Phe Gly Gly Gly Gly Asn Pro Phe Gly Gly Gly Gly Ser Ser 100 105 110Arg Val Arg Arg Gln Arg Arg Gly Glu Asp Val Ile His Pro Leu Lys 115 120 125Val Ser Leu Glu Asp Leu Tyr Asn Gly Thr Ser Lys Lys Leu Ser Leu 130 135 140Ser Arg Asn Val Leu Cys Ser Lys Cys Lys Gly Lys Gly Ser Lys Ser145 150 155 160Gly Ala Ser Met Lys Cys Ser Gly Cys Gln Gly Ser Gly Met Lys Val

165 170 175Ser Ile Arg Gln Leu Gly Pro Ser Met Ile Gln Gln Met Gln His Pro 180 185 190Cys Asn Glu Cys Lys Gly Thr Gly Glu Thr Ile Ser Asp Lys Asp Arg 195 200 205Cys Pro Gln Cys Lys Gly Glu Lys Val Val Gln Glu Lys Lys Val Leu 210 215 220Glu Val His Val Glu Lys Gly Met Gln Asn Gly Gln Lys Ile Thr Phe225 230 235 240Pro Gly Glu Ala Asp Glu Ala Pro Asp Thr Ile Thr Gly Asp Ile Val 245 250 255Phe Val Leu Gln Gln Lys Glu His Pro Lys Phe Lys Arg Lys Gly Asp 260 265 270Asp Leu Phe Val Glu His Thr Leu Ser Leu Asp Glu Ser Leu Cys Gly 275 280 285Phe Gln Phe Val Leu Thr His Leu Asp Asn Arg Gln Leu Leu Ile Lys 290 295 300Ser Gln Pro Gly Glu Val Val Lys Pro Asp Gln Phe Lys Ala Ile Asn305 310 315 320Asp Glu Gly Met Pro Met Tyr Gln Arg Pro Phe Met Lys Gly Lys Met 325 330 335Tyr Ile His Phe Thr Val Asp Phe Pro Glu Ser Leu His Ala Glu Gln 340 345 350Cys Lys Asn Leu Glu Ala Val Leu Pro Pro Lys Thr Lys Leu Gln Ile 355 360 365Ser Asp Met Glu Leu Asp Glu Trp Glu Glu Thr Thr Leu His Asp Val 370 375 380Asn Ile Glu Glu Glu Met Arg Arg Lys Gln Gln Ala Ala Gln Glu Ala385 390 395 400Gln Asp Glu Asp Asp Asp Met Pro Gly Gly Ala Gln Arg Val Gln Cys 405 410 415Ala Gln Gln331272DNAMedicago sativa 33atgtttgggc gcggaccaac aaggaagagt gataacacca aatattacga tattcttggt 60gtttcaaaaa gtgctagtga agatgaaatc aagaaagcct atagaaaggc agcgatgaag 120aaccatccag ataagggtgg ggatcctgag aagttcaagg agttgggcca agcatatgaa 180gtgttgagcg atcctgaaaa gaaagaactg tatgatcaat atggtgaaga tgcccttaaa 240gaaggaatgg ggggaggcgc aggaagctca tttcataatc cgtttgatat tttcgaatca 300ttttttggtg caggctttgg tggtggtggt ccttcacgcg caagaagaca gaagcaagga 360gaagatgtgg tgcattctat aaaggtttcc ttggaggatg tgtataacgg cactacaaag 420aagctatcac tttctaggaa tgcactgtgc tcaaaatgta aagggaaagg ttcaaaaagt 480ggaactgctg gaaggtgttt tggatgccag ggcacaggta tgaagattac cagaaggcaa 540attggactgg gcatgattca acaaatgcaa cacgtctgtc ctgactgcaa aggaacaggc 600gaggtcatta gtgagagaga tagatgccct caatgcaagg gaaacaagat tactcaagaa 660aagaaggtgc tggaggtgca tgtggaaaag gggatgcagc agggtcacaa gattgtattc 720gaaggacaag ctgatgaact ccctgataca atcacaggag acatagtttt tgtcttgcaa 780gtaaagggac atccgaagtt tcggagggag cgtgatgacc ttcacattga acacaatttg 840agcttaactg atgctctctg tggcttccag tttaatgtca cacatcttga tggaaggcaa 900ctattggtca aatcgaaccc cggcgaagtc atcaagccag gtcaacataa agctataaat 960gatgagggaa tgccacaaca tggtaggccg ttcatgaagg gacgcctata catcaagttt 1020agtgttgatt tcccggattc gggttttctt tccccaagcc aaagcctgga attagaaaag 1080atattacctc aaaagacaag caagaacttg tcccaaaagg aggtagatga ttgtgaggag 1140accaccctgc atgatgtcaa tattgcagag gagatgagtc gaaagaagca acaataccgt 1200gaggcatatg atgacgatga tgatgaagat gatgagcact cgcagcctcg ggtgcaatgc 1260gctcaacagt ag 127234423PRTMedicago sativa 34Met Phe Gly Arg Gly Pro Thr Arg Lys Ser Asp Asn Thr Lys Tyr Tyr1 5 10 15Asp Ile Leu Gly Val Ser Lys Ser Ala Ser Glu Asp Glu Ile Lys Lys 20 25 30Ala Tyr Arg Lys Ala Ala Met Lys Asn His Pro Asp Lys Gly Gly Asp 35 40 45Pro Glu Lys Phe Lys Glu Leu Gly Gln Ala Tyr Glu Val Leu Ser Asp 50 55 60Pro Glu Lys Lys Glu Leu Tyr Asp Gln Tyr Gly Glu Asp Ala Leu Lys65 70 75 80Glu Gly Met Gly Gly Gly Ala Gly Ser Ser Phe His Asn Pro Phe Asp 85 90 95Ile Phe Glu Ser Phe Phe Gly Ala Gly Phe Gly Gly Gly Gly Pro Ser 100 105 110Arg Ala Arg Arg Gln Lys Gln Gly Glu Asp Val Val His Ser Ile Lys 115 120 125Val Ser Leu Glu Asp Val Tyr Asn Gly Thr Thr Lys Lys Leu Ser Leu 130 135 140Ser Arg Asn Ala Leu Cys Ser Lys Cys Lys Gly Lys Gly Ser Lys Ser145 150 155 160Gly Thr Ala Gly Arg Cys Phe Gly Cys Gln Gly Thr Gly Met Lys Ile 165 170 175Thr Arg Arg Gln Ile Gly Leu Gly Met Ile Gln Gln Met Gln His Val 180 185 190Cys Pro Asp Cys Lys Gly Thr Gly Glu Val Ile Ser Glu Arg Asp Arg 195 200 205Cys Pro Gln Cys Lys Gly Asn Lys Ile Thr Gln Glu Lys Lys Val Leu 210 215 220Glu Val His Val Glu Lys Gly Met Gln Gln Gly His Lys Ile Val Phe225 230 235 240Glu Gly Gln Ala Asp Glu Leu Pro Asp Thr Ile Thr Gly Asp Ile Val 245 250 255Phe Val Leu Gln Val Lys Gly His Pro Lys Phe Arg Arg Glu Arg Asp 260 265 270Asp Leu His Ile Glu His Asn Leu Ser Leu Thr Asp Ala Leu Cys Gly 275 280 285Phe Gln Phe Asn Val Thr His Leu Asp Gly Arg Gln Leu Leu Val Lys 290 295 300Ser Asn Pro Gly Glu Val Ile Lys Pro Gly Gln His Lys Ala Ile Asn305 310 315 320Asp Glu Gly Met Pro Gln His Gly Arg Pro Phe Met Lys Gly Arg Leu 325 330 335Tyr Ile Lys Phe Ser Val Asp Phe Pro Asp Ser Gly Phe Leu Ser Pro 340 345 350Ser Gln Ser Leu Glu Leu Glu Lys Ile Leu Pro Gln Lys Thr Ser Lys 355 360 365Asn Leu Ser Gln Lys Glu Val Asp Asp Cys Glu Glu Thr Thr Leu His 370 375 380Asp Val Asn Ile Ala Glu Glu Met Ser Arg Lys Lys Gln Gln Tyr Arg385 390 395 400Glu Ala Tyr Asp Asp Asp Asp Asp Glu Asp Asp Glu His Ser Gln Pro 405 410 415Arg Val Gln Cys Ala Gln Gln 420351257DNANicotiana tabacum 35atgtttggga gaggaccaaa gaagagtgat aatacgaggt actatgaaat attgggtgtg 60tcaaagaatg catcagatga tgaaatcaag aaagcttata gaaaagctgc tatgaagaat 120caccctgata agggtggtga ccctgaaaag tttaaggagc ttgctcaagc ttatgaggtg 180ttgagtgact cacagaagcg tgagatttat gatcagtatg gagaagatgc attaaaagaa 240ggaatgggtg gcggcggcgg aatgcatgat ccatttgaca tctttgaatc tttctttggt 300ggcaatccat ttggaggtgg tggtagcagc agaggaagaa gacagagaag gggtgaggat 360gtagtgcatc cactgaaggt ctctctcgag gacctttaca gtgggataac caaaaaactc 420tccctttcgc gcaatgtcat ttgctccaag tgcagtggga aaggatcgaa gtctggtgct 480tcaatgaagt gttctggttg taaaggtagt ggtatgaagg tttcaattag acaacttggc 540ccttcaatga tccagcaaat gcagcacgct tgtaatgaat gcaagggtac tggagagact 600attgacgata aggatcggtg ccctcggtgc aaaggtgaaa aagtggttca ggagaagaaa 660gtccttgaag ttcatgttga gaaaggcatg caaaatggac agaaaattac attccctgga 720aaggctgatg aaacccctga tgcaattact ggagatatag tttttgtgct ccagcagaaa 780gacacccgag gttccaagag aaagggcgac gatctgtttg tagatcacac attgagtcta 840actgaggctt tatgtggctt ccagttcata atgacacact tggatggcag acaactcctc 900ataaaatcaa atctcgggga agttgttaaa cctgatcaat tcaaggcaat caatgatgag 960ggaacgccaa tgtatcagag gccatttatg aggggcaaat tgtacattcg tttcgtcgtt 1020gaattcccag attcattgaa cacagaacag gtgaaggctc tggaggcaat cttaccacca 1080agacctcagt cacagtacac agacatggaa ttggatgagt gtgaggagac ttctttacat 1140gatgtgaata ttgaggagga aatgagaagg aaacaggcag ctcaacaaga ggcatatgat 1200gaggatgatg agatgcatgg tggtggagga cagagagtac aatgtgcaca gcagtaa 125736418PRTNicotiana tabacum 36Met Phe Gly Arg Gly Pro Lys Lys Ser Asp Asn Thr Arg Tyr Tyr Glu1 5 10 15Ile Leu Gly Val Ser Lys Asn Ala Ser Asp Asp Glu Ile Lys Lys Ala 20 25 30Tyr Arg Lys Ala Ala Met Lys Asn His Pro Asp Lys Gly Gly Asp Pro 35 40 45Glu Lys Phe Lys Glu Leu Ala Gln Ala Tyr Glu Val Leu Ser Asp Ser 50 55 60Gln Lys Arg Glu Ile Tyr Asp Gln Tyr Gly Glu Asp Ala Leu Lys Glu65 70 75 80Gly Met Gly Gly Gly Gly Gly Met His Asp Pro Phe Asp Ile Phe Glu 85 90 95Ser Phe Phe Gly Gly Asn Pro Phe Gly Gly Gly Gly Ser Ser Arg Gly 100 105 110Arg Arg Gln Arg Arg Gly Glu Asp Val Val His Pro Leu Lys Val Ser 115 120 125Leu Glu Asp Leu Tyr Ser Gly Ile Thr Lys Lys Leu Ser Leu Ser Arg 130 135 140Asn Val Ile Cys Ser Lys Cys Ser Gly Lys Gly Ser Lys Ser Gly Ala145 150 155 160Ser Met Lys Cys Ser Gly Cys Lys Gly Ser Gly Met Lys Val Ser Ile 165 170 175Arg Gln Leu Gly Pro Ser Met Ile Gln Gln Met Gln His Ala Cys Asn 180 185 190Glu Cys Lys Gly Thr Gly Glu Thr Ile Asp Asp Lys Asp Arg Cys Pro 195 200 205Arg Cys Lys Gly Glu Lys Val Val Gln Glu Lys Lys Val Leu Glu Val 210 215 220His Val Glu Lys Gly Met Gln Asn Gly Gln Lys Ile Thr Phe Pro Gly225 230 235 240Lys Ala Asp Glu Thr Pro Asp Ala Ile Thr Gly Asp Ile Val Phe Val 245 250 255Leu Gln Gln Lys Asp Thr Arg Gly Ser Lys Arg Lys Gly Asp Asp Leu 260 265 270Phe Val Asp His Thr Leu Ser Leu Thr Glu Ala Leu Cys Gly Phe Gln 275 280 285Phe Ile Met Thr His Leu Asp Gly Arg Gln Leu Leu Ile Lys Ser Asn 290 295 300Leu Gly Glu Val Val Lys Pro Asp Gln Phe Lys Ala Ile Asn Asp Glu305 310 315 320Gly Thr Pro Met Tyr Gln Arg Pro Phe Met Arg Gly Lys Leu Tyr Ile 325 330 335Arg Phe Val Val Glu Phe Pro Asp Ser Leu Asn Thr Glu Gln Val Lys 340 345 350Ala Leu Glu Ala Ile Leu Pro Pro Arg Pro Gln Ser Gln Tyr Thr Asp 355 360 365Met Glu Leu Asp Glu Cys Glu Glu Thr Ser Leu His Asp Val Asn Ile 370 375 380Glu Glu Glu Met Arg Arg Lys Gln Ala Ala Gln Gln Glu Ala Tyr Asp385 390 395 400Glu Asp Asp Glu Met His Gly Gly Gly Gly Gln Arg Val Gln Cys Ala 405 410 415Gln Gln371272DNASalix gilgiana 37atgtttgggc gtgctccgag gaggagtgac aacaccaagt attatgaggt tttggctgtg 60tcaaaaggtg caagtcaaga tgaactgaag aaggcttata agaaagctgc cataaagaat 120catcctgata aaggtggaga tcctgaaaag ttcaaggagt tgtctcaagc ttatgaagtc 180cttagtgatc cagataaaag agaaatttat gatcaatatg gggaagatgc acttaaggag 240gggatgggac ctggtggtgg tgggggtggt cacaatccat ttgatatatt cgaatcattt 300tttggtggag gtggttttgg tggtggtagc agctcaagag gaagaaggca gaagcaaggt 360gaagatgtag cgcaccctct gaaggtttcc ttagaggatt tgtacaatgg aacttcaaag 420aaactctctc tttccagaaa cattttgtgt gccaaatgta aagggaaagg ttcaaagagt 480ggagcctttg ggaaatgtcg tggctgccaa ggtactggaa tgaaagtttc aatccgacaa 540attggattgg gcatgatgca acaaatgcaa catgtgtgtc ctgaatgcag gggctcaggt 600gagctaatta gtgagaagga taaatgccct cattgcagag ggaacaaggt aacgcaggaa 660aagagggtgc tggaagtgca tgttgaaagg ggaatgcagc atggccagaa gatagttttc 720gaaggtcaag ctgatgaagc tcctgacaca attacagggg atgttgtttt tgtattgcaa 780ctgaaaaagc actccaagtt tgaacggaaa atggatgatc tctttgtgga acactctctc 840agtttaacag aggctctttg cgggtatcag tttgccctta cccatcttga tggtcggcag 900cttcttatca aatcaaatcc ttacgagatt gtaaaacctg gtcaatacaa agcaattaac 960gatgaaggaa tgccacatca tcacaggccc ttcatgaggg gcaagctcta tatccatttt 1020aatgtggtgt tccctgactc gggcactcta tcccctgagc agtgccgtac tttagagact 1080atactacccc caaggcaaag caaaaacttg tcagagatgg agattgataa ctgcgaagag 1140acaattatgc atgatgtcaa tatggaggag gagaaaaggc ggaaacagca gcagcgccac 1200cagcatgaag catatgatga ggatgaggag gaggaatcat ccatgccccg ggtgcagtgt 1260gcccagcagt aa 127238423PRTSalix gilgiana 38Met Phe Gly Arg Ala Pro Arg Arg Ser Asp Asn Thr Lys Tyr Tyr Glu1 5 10 15Val Leu Ala Val Ser Lys Gly Ala Ser Gln Asp Glu Leu Lys Lys Ala 20 25 30Tyr Lys Lys Ala Ala Ile Lys Asn His Pro Asp Lys Gly Gly Asp Pro 35 40 45Glu Lys Phe Lys Glu Leu Ser Gln Ala Tyr Glu Val Leu Ser Asp Pro 50 55 60Asp Lys Arg Glu Ile Tyr Asp Gln Tyr Gly Glu Asp Ala Leu Lys Glu65 70 75 80Gly Met Gly Pro Gly Gly Gly Gly Gly Gly His Asn Pro Phe Asp Ile 85 90 95Phe Glu Ser Phe Phe Gly Gly Gly Gly Phe Gly Gly Gly Ser Ser Ser 100 105 110Arg Gly Arg Arg Gln Lys Gln Gly Glu Asp Val Ala His Pro Leu Lys 115 120 125Val Ser Leu Glu Asp Leu Tyr Asn Gly Thr Ser Lys Lys Leu Ser Leu 130 135 140Ser Arg Asn Ile Leu Cys Ala Lys Cys Lys Gly Lys Gly Ser Lys Ser145 150 155 160Gly Ala Phe Gly Lys Cys Arg Gly Cys Gln Gly Thr Gly Met Lys Val 165 170 175Ser Ile Arg Gln Ile Gly Leu Gly Met Met Gln Gln Met Gln His Val 180 185 190Cys Pro Glu Cys Arg Gly Ser Gly Glu Leu Ile Ser Glu Lys Asp Lys 195 200 205Cys Pro His Cys Arg Gly Asn Lys Val Thr Gln Glu Lys Arg Val Leu 210 215 220Glu Val His Val Glu Arg Gly Met Gln His Gly Gln Lys Ile Val Phe225 230 235 240Glu Gly Gln Ala Asp Glu Ala Pro Asp Thr Ile Thr Gly Asp Val Val 245 250 255Phe Val Leu Gln Leu Lys Lys His Ser Lys Phe Glu Arg Lys Met Asp 260 265 270Asp Leu Phe Val Glu His Ser Leu Ser Leu Thr Glu Ala Leu Cys Gly 275 280 285Tyr Gln Phe Ala Leu Thr His Leu Asp Gly Arg Gln Leu Leu Ile Lys 290 295 300Ser Asn Pro Tyr Glu Ile Val Lys Pro Gly Gln Tyr Lys Ala Ile Asn305 310 315 320Asp Glu Gly Met Pro His His His Arg Pro Phe Met Arg Gly Lys Leu 325 330 335Tyr Ile His Phe Asn Val Val Phe Pro Asp Ser Gly Thr Leu Ser Pro 340 345 350Glu Gln Cys Arg Thr Leu Glu Thr Ile Leu Pro Pro Arg Gln Ser Lys 355 360 365Asn Leu Ser Glu Met Glu Ile Asp Asn Cys Glu Glu Thr Ile Met His 370 375 380Asp Val Asn Met Glu Glu Glu Lys Arg Arg Lys Gln Gln Gln Arg His385 390 395 400Gln His Glu Ala Tyr Asp Glu Asp Glu Glu Glu Glu Ser Ser Met Pro 405 410 415Arg Val Gln Cys Ala Gln Gln 420391263DNASalix gilgiana 39atgtttggga gagcaccaaa gaaaagcgac aacaccaagt actatgaggt tcttggagtc 60tcaaagagtg cttcacagga tgatctaaag aaggcttata ggaaagcagc tatcaagaac 120catcctgata agggcggtga tcctgaaaag ttcaaggagt tggcgcaagc atatgaggtt 180ctgagtgacc ctgagaagcg tgagatatat gatcagtatg gagaggatgc cctcaaggaa 240ggaatgggta gcggcggcag cggcgctcac gatccattcg atatcttcca atccttcttt 300ggtggtggca atccattcgg tggtggaggt agcagcaggg gccgaaggca aagaaggggc 360gaggatgtga tccaccctct gaaagtttct tttgaagacc tttataatgg cacatccaag 420aagctttctc tttcacgaaa tgtaatctgc tccaagtgca agggcaaagg ttccaaatcc 480ggagcatcat caaaatgtgc tggttgccaa ggttctggaa tgaaggtctc cataagacac 540ctcggtcctt ctatgatcca gcaaatgcag catgcctgca atgaatgcaa gggcactggc 600gagacaatta acgataagga ccgatgccct caatgcaagg gtgagaaggt tgtccaggag 660aagaaagtgt tggaagtagt tgttgagaag ggcatgcaaa atgggcagaa ggtaacattt 720cctggagaag ctgatgaggc gcctgacact gttacagggg acatagtctt cgtcctgcag 780caaaaggatc accctaagtt taagagaaag ggtgatgacc tatttgttga gcacacacta 840tctcttactg aggcactatg tggcttccaa ttcgtcttga cccatttgga tggaaggcag 900ctcctgataa aatctcaacc cggggaagta gtcaagcctg atcaattcaa ggctataaat 960gatgaaggaa tgccgatgta ccaaaggcca tttatgagag ggaaactcta cattcatttc 1020agtgttgaat tcccagactc cctgtcccct gatatgtgca aggcgttgga ggccgtgctt 1080cctccgcgag cctctgttca gctgactgac atggagcttg atgaatgcga ggaaactact 1140ttacatgatg tgaacatcga tgaggagatg aggaggaaac agcaacagca ggcccaagaa 1200gcgtatgatg aagatgatga gatgcctggt ggtgcccaga gggtgcagtg tgctcagcaa 1260taa 126340420PRTSalix gilgiana 40Met Phe Gly Arg Ala Pro Lys Lys Ser Asp Asn Thr Lys Tyr Tyr Glu1 5 10 15Val Leu Gly Val Ser Lys Ser Ala Ser Gln Asp Asp Leu Lys Lys Ala 20 25 30Tyr Arg Lys Ala Ala Ile Lys Asn His Pro Asp Lys Gly Gly Asp Pro 35 40 45Glu Lys Phe Lys Glu Leu Ala Gln Ala Tyr Glu Val Leu Ser Asp Pro 50 55 60Glu Lys Arg Glu Ile Tyr Asp Gln Tyr Gly Glu Asp Ala Leu Lys Glu65 70 75

80Gly Met Gly Ser Gly Gly Ser Gly Ala His Asp Pro Phe Asp Ile Phe 85 90 95Gln Ser Phe Phe Gly Gly Gly Asn Pro Phe Gly Gly Gly Gly Ser Ser 100 105 110Arg Gly Arg Arg Gln Arg Arg Gly Glu Asp Val Ile His Pro Leu Lys 115 120 125Val Ser Phe Glu Asp Leu Tyr Asn Gly Thr Ser Lys Lys Leu Ser Leu 130 135 140Ser Arg Asn Val Ile Cys Ser Lys Cys Lys Gly Lys Gly Ser Lys Ser145 150 155 160Gly Ala Ser Ser Lys Cys Ala Gly Cys Gln Gly Ser Gly Met Lys Val 165 170 175Ser Ile Arg His Leu Gly Pro Ser Met Ile Gln Gln Met Gln His Ala 180 185 190Cys Asn Glu Cys Lys Gly Thr Gly Glu Thr Ile Asn Asp Lys Asp Arg 195 200 205Cys Pro Gln Cys Lys Gly Glu Lys Val Val Gln Glu Lys Lys Val Leu 210 215 220Glu Val Val Val Glu Lys Gly Met Gln Asn Gly Gln Lys Val Thr Phe225 230 235 240Pro Gly Glu Ala Asp Glu Ala Pro Asp Thr Val Thr Gly Asp Ile Val 245 250 255Phe Val Leu Gln Gln Lys Asp His Pro Lys Phe Lys Arg Lys Gly Asp 260 265 270Asp Leu Phe Val Glu His Thr Leu Ser Leu Thr Glu Ala Leu Cys Gly 275 280 285Phe Gln Phe Val Leu Thr His Leu Asp Gly Arg Gln Leu Leu Ile Lys 290 295 300Ser Gln Pro Gly Glu Val Val Lys Pro Asp Gln Phe Lys Ala Ile Asn305 310 315 320Asp Glu Gly Met Pro Met Tyr Gln Arg Pro Phe Met Arg Gly Lys Leu 325 330 335Tyr Ile His Phe Ser Val Glu Phe Pro Asp Ser Leu Ser Pro Asp Met 340 345 350Cys Lys Ala Leu Glu Ala Val Leu Pro Pro Arg Ala Ser Val Gln Leu 355 360 365Thr Asp Met Glu Leu Asp Glu Cys Glu Glu Thr Thr Leu His Asp Val 370 375 380Asn Ile Asp Glu Glu Met Arg Arg Lys Gln Gln Gln Gln Ala Gln Glu385 390 395 400Ala Tyr Asp Glu Asp Asp Glu Met Pro Gly Gly Ala Gln Arg Val Gln 405 410 415Cys Ala Gln Gln 420411260DNASolanum tuberosum 41atgtttggga gggcaccaga gaagagcgac aacacgaagt actatgagat cttaggtgtc 60cctaagactg ctgcacagga agatctcaag aaagcttacc gtaaagctgc tattaagaat 120catcctgata agggaggtga tcctgaaaag tttaaagagc ttgcacaagc ttatgaggtt 180ctgagtgatc ccgagaagcg tgagatatat gatcagtatg gagaagatgc tctcaaggaa 240ggaatgggtg gtggaggtgg tggacacgac ccatttgata ttttctcatc tttctttggt 300ggcagcccat ttggtggagg tggtggaagc agcagaggaa gaagacaaag aagaggagag 360gatgttgtcc atcctctcaa agtttctctg gaggatctgt acaatggaac atcaaagaag 420ctgtcactat ctcgcaatgt attgtgctcg aagtgcaagg ggaaaggatc taaatcaggt 480gcttcaatga agtgttctgg ctgtcaaggg tctgggatga aagtcactat tagacaactt 540ggcccatcca tgatccagca gatgcagcac ccttgcaacg agtgtaaggg tactggtgag 600atgatcaatg ataaagatag gtgtgggcag tgtaaaggtg agaaagttgt gcaggagaag 660aaggtgttgg aagttgttgt cgagaagggt atgcagaacg gacagaagat aacattcccg 720ggcgaagctg atgaagcacc tgataccgtc actggggaca tagtttttgt cttgcaacag 780aaggaacatc ccaagtttaa gcgaaaggga gatgatctct ttgtagagca caccttgagc 840ttaaccgagg ccctgtgtgg tttccagttc atcttgactc acctagataa taggcagctg 900atcatcaagc cccaagccgg agaagttgtc aagcctgatc aatttaaagc cataaatgat 960gaaggaatgc ctatgtacca aaggccattt atgagaggaa aactatacat tcactttact 1020gtagaattcc ccgacacatt atcccccgag caatgcaaga accttgaagc agtattgcca 1080ccaaaaccga aaacacaaat gactgatatg gaattggacg agtgcgagga gaccacctta 1140catgatgtta acatcgaaga ggagatgcgg aggaagcagc aacaggccca agaggcatat 1200gacgaagatg atgaagacat gcatggaggt gcacagagag ttcagtgtgc acaacagtaa 126042419PRTSolanum tuberosum 42Met Phe Gly Arg Ala Pro Glu Lys Ser Asp Asn Thr Lys Tyr Tyr Glu1 5 10 15Ile Leu Gly Val Pro Lys Thr Ala Ala Gln Glu Asp Leu Lys Lys Ala 20 25 30Tyr Arg Lys Ala Ala Ile Lys Asn His Pro Asp Lys Gly Gly Asp Pro 35 40 45Glu Lys Phe Lys Glu Leu Ala Gln Ala Tyr Glu Val Leu Ser Asp Pro 50 55 60Glu Lys Arg Glu Ile Tyr Asp Gln Tyr Gly Glu Asp Ala Leu Lys Glu65 70 75 80Gly Met Gly Gly Gly Gly Gly Gly His Asp Pro Phe Asp Ile Phe Ser 85 90 95Ser Phe Phe Gly Gly Ser Pro Phe Gly Gly Gly Gly Gly Ser Ser Arg 100 105 110Gly Arg Arg Gln Arg Arg Gly Glu Asp Val Val His Pro Leu Lys Val 115 120 125Ser Leu Glu Asp Leu Tyr Asn Gly Thr Ser Lys Lys Leu Ser Leu Ser 130 135 140Arg Asn Val Leu Cys Ser Lys Cys Lys Gly Lys Gly Ser Lys Ser Gly145 150 155 160Ala Ser Met Lys Cys Ser Gly Cys Gln Gly Ser Gly Met Lys Val Thr 165 170 175Ile Arg Gln Leu Gly Pro Ser Met Ile Gln Gln Met Gln His Pro Cys 180 185 190Asn Glu Cys Lys Gly Thr Gly Glu Met Ile Asn Asp Lys Asp Arg Cys 195 200 205Gly Gln Cys Lys Gly Glu Lys Val Val Gln Glu Lys Lys Val Leu Glu 210 215 220Val Val Val Glu Lys Gly Met Gln Asn Gly Gln Lys Ile Thr Phe Pro225 230 235 240Gly Glu Ala Asp Glu Ala Pro Asp Thr Val Thr Gly Asp Ile Val Phe 245 250 255Val Leu Gln Gln Lys Glu His Pro Lys Phe Lys Arg Lys Gly Asp Asp 260 265 270Leu Phe Val Glu His Thr Leu Ser Leu Thr Glu Ala Leu Cys Gly Phe 275 280 285Gln Phe Ile Leu Thr His Leu Asp Asn Arg Gln Leu Ile Ile Lys Pro 290 295 300Gln Ala Gly Glu Val Val Lys Pro Asp Gln Phe Lys Ala Ile Asn Asp305 310 315 320Glu Gly Met Pro Met Tyr Gln Arg Pro Phe Met Arg Gly Lys Leu Tyr 325 330 335Ile His Phe Thr Val Glu Phe Pro Asp Thr Leu Ser Pro Glu Gln Cys 340 345 350Lys Asn Leu Glu Ala Val Leu Pro Pro Lys Pro Lys Thr Gln Met Thr 355 360 365Asp Met Glu Leu Asp Glu Cys Glu Glu Thr Thr Leu His Asp Val Asn 370 375 380Ile Glu Glu Glu Met Arg Arg Lys Gln Gln Gln Ala Gln Glu Ala Tyr385 390 395 400Asp Glu Asp Asp Glu Asp Met His Gly Gly Ala Gln Arg Val Gln Cys 405 410 415Ala Gln Gln431293DNAOryza sativa 43atggtcaagg acaccaaatt ctacgacacc ctcggctgcg cgcccgacgc taccgagtct 60cagctcaaga ccgcataccg caagggcgcc ctcaagcacc accccgacaa gaacgcacac 120tcgcccgaat ccgaggagaa gttcaaggag atctcacacg catacgaagt cctctcagac 180ccccaaaagc gccaaatcta cgaccagtat ggtgaggagg gtctcgagca gggtggtgga 240atgggcggcg gcggaggcat ggctgccgag gacttgttcg cacagttctt cggcggcggc 300ggtggaggcg gaggcttcgg tggcatgggc ggcatgttcg gcggtcgcga gcccggcccc 360aagaaggctc gcaccatcca ccacgttcac aaggtctctc tcgaggacat ctaccgcggc 420aaggtttcca agcttgccct gcagaagagc gtcatctgct ccaagtgtga tggccgcggt 480ggtaaggagg gtgctgtgaa gacttgccag ggctgccagg gccagggtat gaagaccatg 540atgcgccaga tgggtcccat gatccagcga ttccagaccg tctgccccga ctgcaacggt 600gagggggagc aggtccgcga gaaggacaag tgcaagcagt gctccggaaa gaagaccatc 660atcgagcgca aggtgctcca cgtccacgtc gacaagggtg tgcaaagcgg caccaagatc 720gacttcagag gcgagggtga ccagatgcct ggcgttgagc ccggtgatgt gcagttcgag 780atcgagcaga agcctcaccc tcgcttccag cgcaagggtg acgacctcta ctaccacgcc 840gagatcgacc ttcttactgc gctcgccggc ggtgccatct acgttgagca ccttgacgag 900cgctggttga ccgtcgagat cctgcccggc gaggttatcg caccaggcga ggtcaaggtc 960atccgcggcc agggtatgcc ctcataccgc caccacgacc acggcaacct ttacatccag 1020ttcgacgtca agttccccac atccatccaa ggccctgccg acaaggacgg ccagtccacc 1080tccatgtccg cacaacagat caaggccctc gaatccgtcc ttcctcctcg caagccccaa 1140tcgatccctc ctcccgatgc tatgaccgag gacttccagc tcgagcgcgt agaccccatg 1200gagggctccc gctccaaggg cgcccacagc atggacgagg acgatgacga gatgggcggc 1260ggtggcgagc gcgtgcagtg cgcgtcgcag taa 129344430PRTOryza sativa 44Met Val Lys Asp Thr Lys Phe Tyr Asp Thr Leu Gly Cys Ala Pro Asp1 5 10 15Ala Thr Glu Ser Gln Leu Lys Thr Ala Tyr Arg Lys Gly Ala Leu Lys 20 25 30His His Pro Asp Lys Asn Ala His Ser Pro Glu Ser Glu Glu Lys Phe 35 40 45Lys Glu Ile Ser His Ala Tyr Glu Val Leu Ser Asp Pro Gln Lys Arg 50 55 60Gln Ile Tyr Asp Gln Tyr Gly Glu Glu Gly Leu Glu Gln Gly Gly Gly65 70 75 80Met Gly Gly Gly Gly Gly Met Ala Ala Glu Asp Leu Phe Ala Gln Phe 85 90 95Phe Gly Gly Gly Gly Gly Gly Gly Gly Phe Gly Gly Met Gly Gly Met 100 105 110Phe Gly Gly Arg Glu Pro Gly Pro Lys Lys Ala Arg Thr Ile His His 115 120 125Val His Lys Val Ser Leu Glu Asp Ile Tyr Arg Gly Lys Val Ser Lys 130 135 140Leu Ala Leu Gln Lys Ser Val Ile Cys Ser Lys Cys Asp Gly Arg Gly145 150 155 160Gly Lys Glu Gly Ala Val Lys Thr Cys Gln Gly Cys Gln Gly Gln Gly 165 170 175Met Lys Thr Met Met Arg Gln Met Gly Pro Met Ile Gln Arg Phe Gln 180 185 190Thr Val Cys Pro Asp Cys Asn Gly Glu Gly Glu Gln Val Arg Glu Lys 195 200 205Asp Lys Cys Lys Gln Cys Ser Gly Lys Lys Thr Ile Ile Glu Arg Lys 210 215 220Val Leu His Val His Val Asp Lys Gly Val Gln Ser Gly Thr Lys Ile225 230 235 240Asp Phe Arg Gly Glu Gly Asp Gln Met Pro Gly Val Glu Pro Gly Asp 245 250 255Val Gln Phe Glu Ile Glu Gln Lys Pro His Pro Arg Phe Gln Arg Lys 260 265 270Gly Asp Asp Leu Tyr Tyr His Ala Glu Ile Asp Leu Leu Thr Ala Leu 275 280 285Ala Gly Gly Ala Ile Tyr Val Glu His Leu Asp Glu Arg Trp Leu Thr 290 295 300Val Glu Ile Leu Pro Gly Glu Val Ile Ala Pro Gly Glu Val Lys Val305 310 315 320Ile Arg Gly Gln Gly Met Pro Ser Tyr Arg His His Asp His Gly Asn 325 330 335Leu Tyr Ile Gln Phe Asp Val Lys Phe Pro Thr Ser Ile Gln Gly Pro 340 345 350Ala Asp Lys Asp Gly Gln Ser Thr Ser Met Ser Ala Gln Gln Ile Lys 355 360 365Ala Leu Glu Ser Val Leu Pro Pro Arg Lys Pro Gln Ser Ile Pro Pro 370 375 380Pro Asp Ala Met Thr Glu Asp Phe Gln Leu Glu Arg Val Asp Pro Met385 390 395 400Glu Gly Ser Arg Ser Lys Gly Ala His Ser Met Asp Glu Asp Asp Asp 405 410 415Glu Met Gly Gly Gly Gly Glu Arg Val Gln Cys Ala Ser Gln 420 425 430451263DNATriticum aestivum 45atggtaaaag ataccaaact atatgatact ctgggtattt ccccgacctg tactgaagcc 60gagttaaaaa aagcatacaa aatcggagca cttaaacacc atcctgataa aaacgcctca 120aatccagccg ccgcagaaaa atttaaagaa atatcgcacg catatgaagt actatctgac 180cctcaaaaaa gacacatata cgaccaatat ggcgaagagg gccttgaggg aggtggtggt 240gctgcgggag ggatgaacgc agaagattta ttctctcaat tcttcagcgg tggctctgcc 300ttcggaggtg gaggattggg tggcatgttc gggggagggc cacagcaacg tggcccccca 360aaagcccgca ccattcatca cgttcacaag gtatctctag aagatatcta ccgcggtaaa 420atctcaaaac tggcactaca aaagtcagtc atatgccaca agtgtgaggg acggggtggc 480aaagatggtg cagtaaaaaa atgtgccggc tgtgatggac atggaatgaa aacaatgatg 540cgtcaaatgg gtcctatgat tcagcggttt caaactcact gccccgactg caatggtgag 600ggagaagtca tccgagagaa agataaatgt aagacgtgta acggtaaaaa gaccaacgtg 660gaacgcaaag tactccacgt tcatgtggac agaggtgttc gatcggggca ccggattgaa 720tttaaaggtg aaggagacca aacccccgga gttcaacctg gagatgttat ctttgaaatt 780gagcagaaac cacatccaag attccaacga aaagacgatg accttattta ccacgcagag 840atcgaccttg ttactgcctt agcgggcggg tcaatcttca ttgagcactt agacgaaaga 900tggctgagtg tggagatact tcctggagag gttatctcac ctggatccgt taagatgata 960cgcggtcagg gtatgccatc ccatcgtcac cacgactatg gaaatatgtt tgtacagttt 1020gatgtcaaat tccccgaaag taactttgct gcaaattccg aggcatacgc agctctgaag 1080agtattattc cgccgactgt ggtacctatc actccaccca ctgataccat gactgaaact 1140gtatacttcg aagacattga ccctactcaa caagctcgtg cacagggtgc gacagcaatg 1200gatgaagacg atgaagatgg ccatccagcc ggcgccgaac gggttcaatg tgcgtcacag 1260taa 126346420PRTTriticum aestivum 46Met Val Lys Asp Thr Lys Leu Tyr Asp Thr Leu Gly Ile Ser Pro Thr1 5 10 15Cys Thr Glu Ala Glu Leu Lys Lys Ala Tyr Lys Ile Gly Ala Leu Lys 20 25 30His His Pro Asp Lys Asn Ala Ser Asn Pro Ala Ala Ala Glu Lys Phe 35 40 45Lys Glu Ile Ser His Ala Tyr Glu Val Leu Ser Asp Pro Gln Lys Arg 50 55 60His Ile Tyr Asp Gln Tyr Gly Glu Glu Gly Leu Glu Gly Gly Gly Gly65 70 75 80Ala Ala Gly Gly Met Asn Ala Glu Asp Leu Phe Ser Gln Phe Phe Ser 85 90 95Gly Gly Ser Ala Phe Gly Gly Gly Gly Leu Gly Gly Met Phe Gly Gly 100 105 110Gly Pro Gln Gln Arg Gly Pro Pro Lys Ala Arg Thr Ile His His Val 115 120 125His Lys Val Ser Leu Glu Asp Ile Tyr Arg Gly Lys Ile Ser Lys Leu 130 135 140Ala Leu Gln Lys Ser Val Ile Cys His Lys Cys Glu Gly Arg Gly Gly145 150 155 160Lys Asp Gly Ala Val Lys Lys Cys Ala Gly Cys Asp Gly His Gly Met 165 170 175Lys Thr Met Met Arg Gln Met Gly Pro Met Ile Gln Arg Phe Gln Thr 180 185 190His Cys Pro Asp Cys Asn Gly Glu Gly Glu Val Ile Arg Glu Lys Asp 195 200 205Lys Cys Lys Thr Cys Asn Gly Lys Lys Thr Asn Val Glu Arg Lys Val 210 215 220Leu His Val His Val Asp Arg Gly Val Arg Ser Gly His Arg Ile Glu225 230 235 240Phe Lys Gly Glu Gly Asp Gln Thr Pro Gly Val Gln Pro Gly Asp Val 245 250 255Ile Phe Glu Ile Glu Gln Lys Pro His Pro Arg Phe Gln Arg Lys Asp 260 265 270Asp Asp Leu Ile Tyr His Ala Glu Ile Asp Leu Val Thr Ala Leu Ala 275 280 285Gly Gly Ser Ile Phe Ile Glu His Leu Asp Glu Arg Trp Leu Ser Val 290 295 300Glu Ile Leu Pro Gly Glu Val Ile Ser Pro Gly Ser Val Lys Met Ile305 310 315 320Arg Gly Gln Gly Met Pro Ser His Arg His His Asp Tyr Gly Asn Met 325 330 335Phe Val Gln Phe Asp Val Lys Phe Pro Glu Ser Asn Phe Ala Ala Asn 340 345 350Ser Glu Ala Tyr Ala Ala Leu Lys Ser Ile Ile Pro Pro Thr Val Val 355 360 365Pro Ile Thr Pro Pro Thr Asp Thr Met Thr Glu Thr Val Tyr Phe Glu 370 375 380Asp Ile Asp Pro Thr Gln Gln Ala Arg Ala Gln Gly Ala Thr Ala Met385 390 395 400Asp Glu Asp Asp Glu Asp Gly His Pro Ala Gly Ala Glu Arg Val Gln 405 410 415Cys Ala Ser Gln 420471320DNACaenorhabditis elegans 47atgtttggag gtggaagtag tggtcccgtg gacaccactt tatacacaac actcaatgtg 60agaccagacg cttcgcaggc cgacattaag aaatcttact tcaaacttgc taaagaatac 120catccagata aaaacccgga ccatggagat aaattcaaag agatcagttt tgcctatgaa 180gttctttcga gccctgaaaa acgacgcttg tatgacgcca gaggtttgga aggagttcaa 240ggaggaggag ctggtggtgg tggaggaggc tttcctggag gtctgttctc tcacttcttc 300ggcggtgctg gcggtgatga cgatgacgac gatgatgata tgggtggtca tccatttggt 360ggcttgttcg gtggaatggg tggaatggga cgaggtggcc cacgtcggcg gaaattccaa 420gatactgttc atcccctcaa tgttacactc gaagagcttt acgtcggaaa aacatcaaag 480ctgaagcttt ccaaaaaggc actctgtaaa acttgcgaag ggtcaggtgg aaagaaggga 540gaaaaatata agtgtgatgc atgccgtggt cgtggagtga agacgatcgt tcagcaaatt 600ggccccggaa tgctccaaca aatgcaggtt cactgtgatg cttgtaaggg ttctggaggc 660aaagttccag caggtgataa gtgcaaagga tgccatggag aaaagtacga aaacgtttcg 720aaaatattgg aggttcacgt tcttcctggc atgaaacata acgataaaat tacattcaaa 780ggagatggag accaatctga cccagatggt gagccaggag atgttgtcat tgttattcaa 840cagaaagatc atgatatttt caagagagat ggagatgatc ttcacatgac caagaaacta 900tcactgaatg aggcactttg cggctataat ttccttatca aacatcttga tggccatcct 960ttggttcttt ctagtaaaca aggagatgtt atcaagccag gagtcatcag aggagttctt 1020ggaaaaggaa tgccaaataa gaaataccca gaactcaaag gaaacttgtt cgttgaattt 1080gaagtcgaat ttccaaagga gcatttcctc gatgatgaaa aagcttatgc cgttctgaaa 1140agctgcttcc ctacctcaaa

agttgtcaat gtcaccccag ctgccgcaga agtttctctt 1200atggaatatg acgagaagaa gtacagccga ggacgtggcg gagacgctta caatgaagat 1260tcggacgaag aacaacacgg aggacatcac ggacaaggcg tcagatgcca acaccaatag 132048439PRTCaenorhabditis elegans 48Met Phe Gly Gly Gly Ser Ser Gly Pro Val Asp Thr Thr Leu Tyr Thr1 5 10 15Thr Leu Asn Val Arg Pro Asp Ala Ser Gln Ala Asp Ile Lys Lys Ser 20 25 30Tyr Phe Lys Leu Ala Lys Glu Tyr His Pro Asp Lys Asn Pro Asp His 35 40 45Gly Asp Lys Phe Lys Glu Ile Ser Phe Ala Tyr Glu Val Leu Ser Ser 50 55 60Pro Glu Lys Arg Arg Leu Tyr Asp Ala Arg Gly Leu Glu Gly Val Gln65 70 75 80Gly Gly Gly Ala Gly Gly Gly Gly Gly Gly Phe Pro Gly Gly Leu Phe 85 90 95Ser His Phe Phe Gly Gly Ala Gly Gly Asp Asp Asp Asp Asp Asp Asp 100 105 110Asp Met Gly Gly His Pro Phe Gly Gly Leu Phe Gly Gly Met Gly Gly 115 120 125Met Gly Arg Gly Gly Pro Arg Arg Arg Lys Phe Gln Asp Thr Val His 130 135 140Pro Leu Asn Val Thr Leu Glu Glu Leu Tyr Val Gly Lys Thr Ser Lys145 150 155 160Leu Lys Leu Ser Lys Lys Ala Leu Cys Lys Thr Cys Glu Gly Ser Gly 165 170 175Gly Lys Lys Gly Glu Lys Tyr Lys Cys Asp Ala Cys Arg Gly Arg Gly 180 185 190Val Lys Thr Ile Val Gln Gln Ile Gly Pro Gly Met Leu Gln Gln Met 195 200 205Gln Val His Cys Asp Ala Cys Lys Gly Ser Gly Gly Lys Val Pro Ala 210 215 220Gly Asp Lys Cys Lys Gly Cys His Gly Glu Lys Tyr Glu Asn Val Ser225 230 235 240Lys Ile Leu Glu Val His Val Leu Pro Gly Met Lys His Asn Asp Lys 245 250 255Ile Thr Phe Lys Gly Asp Gly Asp Gln Ser Asp Pro Asp Gly Glu Pro 260 265 270Gly Asp Val Val Ile Val Ile Gln Gln Lys Asp His Asp Ile Phe Lys 275 280 285Arg Asp Gly Asp Asp Leu His Met Thr Lys Lys Leu Ser Leu Asn Glu 290 295 300Ala Leu Cys Gly Tyr Asn Phe Leu Ile Lys His Leu Asp Gly His Pro305 310 315 320Leu Val Leu Ser Ser Lys Gln Gly Asp Val Ile Lys Pro Gly Val Ile 325 330 335Arg Gly Val Leu Gly Lys Gly Met Pro Asn Lys Lys Tyr Pro Glu Leu 340 345 350Lys Gly Asn Leu Phe Val Glu Phe Glu Val Glu Phe Pro Lys Glu His 355 360 365Phe Leu Asp Asp Glu Lys Ala Tyr Ala Val Leu Lys Ser Cys Phe Pro 370 375 380Thr Ser Lys Val Val Asn Val Thr Pro Ala Ala Ala Glu Val Ser Leu385 390 395 400Met Glu Tyr Asp Glu Lys Lys Tyr Ser Arg Gly Arg Gly Gly Asp Ala 405 410 415Tyr Asn Glu Asp Ser Asp Glu Glu Gln His Gly Gly His His Gly Gln 420 425 430Gly Val Arg Cys Gln His Gln 435491194DNAHomo sapiens 49atggtgaaag aaacaactta ctacgatgtt ttgggggtca aacccaatgc tactcaggaa 60gaattgaaaa aggcttatag gaaactggcc ttgaagtacc atcctgataa gaacccaaat 120gaaggagaga agtttaaaca gatttctcaa gcttacgaag ttctctctga tgcaaagaaa 180agggaattat atgacaaagg aggagaacag gcaattaaag agggtggagc aggtggcggt 240tttggctccc ccatggacat ctttgatatg ttttttggag gaggaggaag gatgcagaga 300gaaaggagag gtaaaaatgt tgtacatcag ctctcagtaa ccctagaaga cttatataat 360ggtgcaacaa gaaaactggc tctgcaaaag aatgtgattt gtgacaaatg tgaaggtaga 420ggaggtaaga aaggagcagt agagtgctgt cccaattgcc gaggtactgg aatgcaaata 480agaattcatc agataggacc tggaatggtt cagcaaattc agtctgtgtg catggagtgc 540cagggccatg gggagcggat cagtcctaaa gatagatgta aaagctgcaa cggaaggaag 600atagttcgag agaaaaaaat tttagaagtt catattgaca aaggcatgaa agatggccag 660aagataacat tccatggtga aggagaccaa gaaccaggac tggagccagg cgatattatc 720attgtgttag atcagaagga ccatgctgtt tttactcgac gaggagaaga ccttttcatg 780tgtatggaca tacagctcgt tgaagcactg tgtggcttcc acaagccaat atctactctt 840gacaaccgaa ccatcgtcat cacctctcat ccaggtcaga ttgtcaagca tggagatatc 900aagtgtgtac taaatgaagg catgccaatt tatcgtagac catatgaaaa gggtcgccta 960atcatcgaat ttaaggtaaa ctttcctgag aatggctttc tctctcctga taaactgtct 1020ttgctggaaa aactcctacc cgagaggaag gaagtggaag agactgatga gatggaccaa 1080gtagaactgg tggactttga tccaaatcag gaaagacggc gccactacaa tggagaagca 1140tatgaggatg atgaacatca tcccagaggt ggtgttcagt gtcagacctc ttaa 119450397PRTHomo sapiens 50Met Val Lys Glu Thr Thr Tyr Tyr Asp Val Leu Gly Val Lys Pro Asn1 5 10 15Ala Thr Gln Glu Glu Leu Lys Lys Ala Tyr Arg Lys Leu Ala Leu Lys 20 25 30Tyr His Pro Asp Lys Asn Pro Asn Glu Gly Glu Lys Phe Lys Gln Ile 35 40 45Ser Gln Ala Tyr Glu Val Leu Ser Asp Ala Lys Lys Arg Glu Leu Tyr 50 55 60Asp Lys Gly Gly Glu Gln Ala Ile Lys Glu Gly Gly Ala Gly Gly Gly65 70 75 80Phe Gly Ser Pro Met Asp Ile Phe Asp Met Phe Phe Gly Gly Gly Gly 85 90 95Arg Met Gln Arg Glu Arg Arg Gly Lys Asn Val Val His Gln Leu Ser 100 105 110Val Thr Leu Glu Asp Leu Tyr Asn Gly Ala Thr Arg Lys Leu Ala Leu 115 120 125Gln Lys Asn Val Ile Cys Asp Lys Cys Glu Gly Arg Gly Gly Lys Lys 130 135 140Gly Ala Val Glu Cys Cys Pro Asn Cys Arg Gly Thr Gly Met Gln Ile145 150 155 160Arg Ile His Gln Ile Gly Pro Gly Met Val Gln Gln Ile Gln Ser Val 165 170 175Cys Met Glu Cys Gln Gly His Gly Glu Arg Ile Ser Pro Lys Asp Arg 180 185 190Cys Lys Ser Cys Asn Gly Arg Lys Ile Val Arg Glu Lys Lys Ile Leu 195 200 205Glu Val His Ile Asp Lys Gly Met Lys Asp Gly Gln Lys Ile Thr Phe 210 215 220His Gly Glu Gly Asp Gln Glu Pro Gly Leu Glu Pro Gly Asp Ile Ile225 230 235 240Ile Val Leu Asp Gln Lys Asp His Ala Val Phe Thr Arg Arg Gly Glu 245 250 255Asp Leu Phe Met Cys Met Asp Ile Gln Leu Val Glu Ala Leu Cys Gly 260 265 270Phe Gln Lys Pro Ile Ser Thr Leu Asp Asn Arg Thr Ile Val Ile Thr 275 280 285Ser His Pro Gly Gln Ile Val Lys His Gly Asp Ile Lys Cys Val Leu 290 295 300Asn Glu Gly Met Pro Ile Tyr Arg Arg Pro Tyr Glu Lys Gly Arg Leu305 310 315 320Ile Ile Glu Phe Lys Val Asn Phe Pro Glu Asn Gly Phe Leu Ser Pro 325 330 335Asp Lys Leu Ser Leu Leu Glu Lys Leu Leu Pro Glu Arg Lys Glu Val 340 345 350Glu Glu Thr Asp Glu Met Asp Gln Val Glu Leu Val Asp Phe Asp Pro 355 360 365Asn Gln Glu Arg Arg Arg His Tyr Asn Gly Glu Ala Tyr Glu Asp Asp 370 375 380Glu His His Pro Arg Gly Gly Val Gln Cys Gln Thr Ser385 390 395511230DNASacharomyces cereviseae 51atggttaaag aaactaagtt ttacgatatt ctaggtgttc cagtaactgc cactgatgtc 60gaaattaaga aagcttatag aaaatgcgcc ttaaaatacc atccagataa gaatccaagt 120gaggaagctg cagaaaagtt caaagaagct tcagcagcct atgaaatttt atcagatcct 180gaaaagagag atatatatga ccaatttggt gaagatggtc taagtggtgc tggtggcgct 240ggcggattcc caggtggtgg attcggtttt ggtgacgata tcttttccca attctttggt 300gctggtggcg cacaaagacc aagaggtccc caaagaggta aagatatcaa gcatgaaatt 360tctgcctcac ttgaagaatt atataagggt aggacagcta agttagccct taacaaacag 420atcctatgta aagaatgtga aggtcgtggt ggtaagaaag gcgccgtcaa gaagtgtacc 480agctgtaatg gtcaaggtat taaatttgta acaagacaaa tgggtccaat gatccaaaga 540ttccaaacag agtgtgatgt ctgtcacggt actggtgata tcattgatcc taaggatcgt 600tgtaaatctt gtaacggtaa gaaagttgaa aacgaaagga agatcctaga agtccatgtc 660gaaccaggta tgaaagatgg tcaaagaatc gttttcaaag gtgaagctga ccaagcccca 720gatgtcattc caggtgatgt tgtcttcata gtttctgaga gaccacacaa gagcttcaag 780agagatggtg atgatttagt atatgaggct gaaattgatc tattgactgc tatcgctggt 840ggtgaatttg cattggaaca tgtttctggt gattggttaa aggtcggtat tgttccaggt 900gaagttattg ccccaggtat gcgtaaggtc atcgaaggta aaggtatgcc aattccaaaa 960tacggtggct atggtaattt aatcatcaaa tttactatca agttcccaga aaaccatttc 1020acatcagaag aaaacttgaa gaagttagaa gaaattttgc ctccaagaat tgtcccagcc 1080attccaaaga aagctactgt ggacgaatgt gtactcgcag actttgaccc agccaaatac 1140aacagaacac gggcctccag gggtggtgca aactatgatt ccgatgaaga agaacaaggt 1200ggcgaaggtg ttcaatgtgc atctcaatga 123052409PRTSacharomyces cereviseae 52Met Val Lys Glu Thr Lys Phe Tyr Asp Ile Leu Gly Val Pro Val Thr1 5 10 15Ala Thr Asp Val Glu Ile Lys Lys Ala Tyr Arg Lys Cys Ala Leu Lys 20 25 30Tyr His Pro Asp Lys Asn Pro Ser Glu Glu Ala Ala Glu Lys Phe Lys 35 40 45Glu Ala Ser Ala Ala Tyr Glu Ile Leu Ser Asp Pro Glu Lys Arg Asp 50 55 60Ile Tyr Asp Gln Phe Gly Glu Asp Gly Leu Ser Gly Ala Gly Gly Ala65 70 75 80Gly Gly Phe Pro Gly Gly Gly Phe Gly Phe Gly Asp Asp Ile Phe Ser 85 90 95Gln Phe Phe Gly Ala Gly Gly Ala Gln Arg Pro Arg Gly Pro Gln Arg 100 105 110Gly Lys Asp Ile Lys His Glu Ile Ser Ala Ser Leu Glu Glu Leu Tyr 115 120 125Lys Gly Arg Thr Ala Lys Leu Ala Leu Asn Lys Gln Ile Leu Cys Lys 130 135 140Glu Cys Glu Gly Arg Gly Gly Lys Lys Gly Ala Val Lys Lys Cys Thr145 150 155 160Ser Cys Asn Gly Gln Gly Ile Lys Phe Val Thr Arg Gln Met Gly Pro 165 170 175Met Ile Gln Arg Phe Gln Thr Glu Cys Asp Val Cys His Gly Thr Gly 180 185 190Asp Ile Ile Asp Pro Lys Asp Arg Cys Lys Ser Cys Asn Gly Lys Lys 195 200 205Val Glu Asn Glu Arg Lys Ile Leu Glu Val His Val Glu Pro Gly Met 210 215 220Lys Asp Gly Gln Arg Ile Val Phe Lys Gly Glu Ala Asp Gln Ala Pro225 230 235 240Asp Val Ile Pro Gly Asp Val Val Phe Ile Val Ser Glu Arg Pro His 245 250 255Lys Ser Phe Lys Arg Asp Gly Asp Asp Leu Val Tyr Glu Ala Glu Ile 260 265 270Asp Leu Leu Thr Ala Ile Ala Gly Gly Glu Phe Ala Leu Glu His Val 275 280 285Ser Gly Asp Trp Leu Lys Val Gly Ile Val Pro Gly Glu Val Ile Ala 290 295 300Pro Gly Met Arg Lys Val Ile Glu Gly Lys Gly Met Pro Ile Pro Lys305 310 315 320Tyr Gly Gly Tyr Gly Asn Leu Ile Ile Lys Phe Thr Ile Lys Phe Pro 325 330 335Glu Asn His Phe Thr Ser Glu Glu Asn Leu Lys Lys Leu Glu Glu Ile 340 345 350Leu Pro Pro Arg Ile Val Pro Ala Ile Pro Lys Lys Ala Thr Val Asp 355 360 365Glu Cys Val Leu Ala Asp Phe Asp Pro Ala Lys Tyr Asn Arg Thr Arg 370 375 380Ala Ser Arg Gly Gly Ala Asn Tyr Asp Ser Asp Glu Glu Glu Gln Gly385 390 395 400Gly Glu Gly Val Gln Cys Ala Ser Gln 405531239DNAHomo sapiens 53atggctaacg tggctgacac gaagctgtac gacatcctgg gcgtcccgcc cggcgccagc 60gagaacgagc tgaagaaggc atacagaaag ttagccaagg aatatcatcc tgataagaat 120ccaaatgcag gagacaaatt taaagaaata agttttgcat atgaagtact atcaaatcct 180gagaagcgtg agttatatga cagatacgga gagcaaggtc ttcgggaagg cagcggcgga 240ggtggtggca tggatgatat tttctctcac atttttggtg ggggattgtt cggcttcatg 300ggcaatcaga gtagaagtcg aaatggcaga agaagaggag aggacatgat gcatccactc 360aaagtatctt tagaagatct gtataatggc aagacaacca aactacaact tagcaagaat 420gtgctctgta gtgcatgcag tggccaaggc ggaaagtctg gagctgtcca aaagtgtagt 480gcttgtcgag gtcgaggtgt gcgcatcatg atcagacagc tggctccagg gatggtacaa 540cagatgcagt ctgtgtgctc tgattgtaat ggagaaggag aggtaattaa tgaaaaagac 600cgctgtaaaa aatgtgaagg gaagaaggtg attaaagaag tcaagattct tgaagtccac 660gtagacaaag gcatgaaaca tggacagaga attacattca ctggggaagc agaccaggcc 720ccaggagtgg aacccggaga cattgttctt ttgctacagg agaaagaaca tgaggtattt 780cagagagatg ggaatgattt gcacatgaca tataaaatag gacttgttga agctctatgt 840ggatttcagt tcacatttaa gcaccttgat ggacgtcaga ttgtggtgaa atacccccct 900ggcaaagtaa ttgaaccagg gtgtgttcgt gtagttcgag gtgaagggat gccgcagtat 960cgtaatccct ttgaaaaagg tgatctttac ataaagtttg atgtgcagtt tcctgaaaac 1020aactggatca acccagacaa gctttctgaa ctagaagatc ttctgccatc tagaccggaa 1080gttcctaaca taattggaga aacagaggag gtagagcttc aggaatttga tagcactcga 1140ggctcaggag gtggtcagag gcgtgaagcc tataatgata gctctgatga agaaagcagc 1200agccatcatg gacctggagt gcagtgtgcc catcagtaa 123954412PRTHomo sapiens 54Met Ala Asn Val Ala Asp Thr Lys Leu Tyr Asp Ile Leu Gly Val Pro1 5 10 15Pro Gly Ala Ser Glu Asn Glu Leu Lys Lys Ala Tyr Arg Lys Leu Ala 20 25 30Lys Glu Tyr His Pro Asp Lys Asn Pro Asn Ala Gly Asp Lys Phe Lys 35 40 45Glu Ile Ser Phe Ala Tyr Glu Val Leu Ser Asn Pro Glu Lys Arg Glu 50 55 60Leu Tyr Asp Arg Tyr Gly Glu Gln Gly Leu Arg Glu Gly Ser Gly Gly65 70 75 80Gly Gly Gly Met Asp Asp Ile Phe Ser His Ile Phe Gly Gly Gly Leu 85 90 95Phe Gly Phe Met Gly Asn Gln Ser Arg Ser Arg Asn Gly Arg Arg Arg 100 105 110Gly Glu Asp Met Met His Pro Leu Lys Val Ser Leu Glu Asp Leu Tyr 115 120 125Asn Gly Lys Thr Thr Lys Leu Gln Leu Ser Lys Asn Val Leu Cys Ser 130 135 140Ala Cys Ser Gly Gln Gly Gly Lys Ser Gly Ala Val Gln Lys Cys Ser145 150 155 160Ala Cys Arg Gly Arg Gly Val Arg Ile Met Ile Arg Gln Leu Ala Pro 165 170 175Gly Met Val Gln Gln Met Gln Ser Val Cys Ser Asp Cys Asn Gly Glu 180 185 190Gly Glu Val Ile Asn Glu Lys Asp Arg Cys Lys Lys Cys Glu Gly Lys 195 200 205Lys Val Ile Lys Glu Val Lys Ile Leu Glu Val His Val Asp Lys Gly 210 215 220Met Lys His Gly Gln Arg Ile Thr Phe Thr Gly Glu Ala Asp Gln Ala225 230 235 240Pro Gly Val Glu Pro Gly Asp Ile Val Leu Leu Leu Gln Glu Lys Glu 245 250 255His Glu Val Phe Gln Arg Asp Gly Asn Asp Leu His Met Thr Tyr Lys 260 265 270Ile Gly Leu Val Glu Ala Leu Cys Gly Phe Gln Phe Thr Phe Lys His 275 280 285Leu Asp Gly Arg Gln Ile Val Val Lys Tyr Pro Pro Gly Lys Val Ile 290 295 300Glu Pro Gly Cys Val Arg Val Val Arg Gly Glu Gly Met Pro Gln Tyr305 310 315 320Arg Asn Pro Phe Glu Lys Gly Asp Leu Tyr Ile Lys Phe Asp Val Gln 325 330 335Phe Pro Glu Asn Asn Trp Ile Asn Pro Asp Lys Leu Ser Glu Leu Glu 340 345 350Asp Leu Leu Pro Ser Arg Pro Glu Val Pro Asn Ile Ile Gly Glu Thr 355 360 365Glu Glu Val Glu Leu Gln Glu Phe Asp Ser Thr Arg Gly Ser Gly Gly 370 375 380Gly Gln Arg Arg Glu Ala Tyr Asn Asp Ser Ser Asp Glu Glu Ser Ser385 390 395 400Ser His His Gly Pro Gly Val Gln Cys Ala His Gln 405 410551239DNAMus musculus 55atggcgaacg tggccgacac gaagctgtac gacatcctgg gcgtccctcc cggcgctagc 60gagaacgagc tgaagaaggc ataccgaaag ttagccaaag aataccaccc tgataagaat 120ccaaatgctg gagacaaatt taaagaaata agttttgcat atgaagtatt gtcaaatcca 180gagaagcgag agctgtatga cagatatgga gaacaaggcc tacgggaagg cagcggcgga 240ggcggtggca tggatgatat cttctcacat atttttggtg gaggattgtt tggctttatg 300ggcaatcaga gtagaagtcg aaatggcaga agaagaggcg aggacatgat gcatccacta 360aaagtatctt tagaagacct gtacaatggc aagacaacca aactacaact tagcaagaat 420gtgctctgta gtgcatgcag tggccaaggt gggaagtctg gagctgttca gaaatgcagc 480gcttgtcggg gtcgaggtgt gcgcattatg atcagacagc tggctccagg aatggtgcag 540cagatgcagt ccgtgtgctc cgactgtaat ggagaagggg aggtcatcaa tgaaaaagac 600cgctgtaaaa aatgtgaagg gaagaaggta atcaaagaag tcaagattct ggaagtccat 660gtagacaaag gcatgaaaca tggacagagg attacgttca ctggggaagc agaccaggct 720ccaggagtgg aacctggaga tattgttctt ttgctacagg aaaaagaaca tgaggtgttc 780cagagagatg ggaatgattt gcatatgaca tataagatag gactcgttga agctttatgt 840ggatttcagt tcacatttaa acatcttgat gctcgtcaga ttgtggtgaa atacccccct 900ggcaaagtaa ttgaaccagg atgtgttcgt

gttgttcgag gtgaaggaat gccacagtat 960cgtaatccct ttgaaaaggg tgatctctac ataaagtttg atgtacagtt tcctgagaat 1020aactggatca acccagacaa actttctgaa ttagaagatc tcctgccatc tagaccagaa 1080gttcctaatg ttattggaga gacagaagaa gtggagcttc aggaatttga tagcactcga 1140ggctctggcg gtggtcagag acgtgaagcc tataatgata gctctgatga agaaagtagc 1200agccatcatg gacctggagt gcagtgtgcc catcagtaa 123956412PRTMus musculus 56Met Ala Asn Val Ala Asp Thr Lys Leu Tyr Asp Ile Leu Gly Val Pro1 5 10 15Pro Gly Ala Ser Glu Asn Glu Leu Lys Lys Ala Tyr Arg Lys Leu Ala 20 25 30Lys Glu Tyr His Pro Asp Lys Asn Pro Asn Ala Gly Asp Lys Phe Lys 35 40 45Glu Ile Ser Phe Ala Tyr Glu Val Leu Ser Asn Pro Glu Lys Arg Glu 50 55 60Leu Tyr Asp Arg Tyr Gly Glu Gln Gly Leu Arg Glu Gly Ser Gly Gly65 70 75 80Gly Gly Gly Met Asp Asp Ile Phe Ser His Ile Phe Gly Gly Gly Leu 85 90 95Phe Gly Phe Met Gly Asn Gln Ser Arg Ser Arg Asn Gly Arg Arg Arg 100 105 110Gly Glu Asp Met Met His Pro Leu Lys Val Ser Leu Glu Asp Leu Tyr 115 120 125Asn Gly Lys Thr Thr Lys Leu Gln Leu Ser Lys Asn Val Leu Cys Ser 130 135 140Ala Cys Ser Gly Gln Gly Gly Lys Ser Gly Ala Val Gln Lys Cys Ser145 150 155 160Ala Cys Arg Gly Arg Gly Val Arg Ile Met Ile Arg Gln Leu Ala Pro 165 170 175Gly Met Val Gln Gln Met Gln Ser Val Cys Ser Asp Cys Asn Gly Glu 180 185 190Gly Glu Val Ile Asn Glu Lys Asp Arg Cys Lys Lys Cys Glu Gly Lys 195 200 205Lys Val Ile Lys Glu Val Lys Ile Leu Glu Val His Val Asp Lys Gly 210 215 220Met Lys His Gly Gln Arg Ile Thr Phe Thr Gly Glu Ala Asp Gln Ala225 230 235 240Pro Gly Val Glu Pro Gly Asp Ile Val Leu Leu Leu Gln Glu Lys Glu 245 250 255His Glu Val Phe Gln Arg Asp Gly Asn Asp Leu His Met Thr Tyr Lys 260 265 270Ile Gly Leu Val Glu Ala Leu Cys Gly Phe Gln Phe Thr Phe Lys His 275 280 285Leu Asp Ala Arg Gln Ile Val Val Lys Tyr Pro Pro Gly Lys Val Ile 290 295 300Glu Pro Gly Cys Val Arg Val Val Arg Gly Glu Gly Met Pro Gln Tyr305 310 315 320Arg Asn Pro Phe Glu Lys Gly Asp Leu Tyr Ile Lys Phe Asp Val Gln 325 330 335Phe Pro Glu Asn Asn Trp Ile Asn Pro Asp Lys Leu Ser Glu Leu Glu 340 345 350Asp Leu Leu Pro Ser Arg Pro Glu Val Pro Asn Val Ile Gly Glu Thr 355 360 365Glu Glu Val Glu Leu Gln Glu Phe Asp Ser Thr Arg Gly Ser Gly Gly 370 375 380Gly Gln Arg Arg Glu Ala Tyr Asn Asp Ser Ser Asp Glu Glu Ser Ser385 390 395 400Ser His His Gly Pro Gly Val Gln Cys Ala His Gln 405 41057654DNAOryza sativa 57cttctacatc ggcttaggtg tagcaacacg actttattat tattattatt attattatta 60ttattttaca aaaatataaa atagatcagt ccctcaccac aagtagagca agttggtgag 120ttattgtaaa gttctacaaa gctaatttaa aagttattgc attaacttat ttcatattac 180aaacaagagt gtcaatggaa caatgaaaac catatgacat actataattt tgtttttatt 240attgaaatta tataattcaa agagaataaa tccacatagc cgtaaagttc tacatgtggt 300gcattaccaa aatatatata gcttacaaaa catgacaagc ttagtttgaa aaattgcaat 360ccttatcaca ttgacacata aagtgagtga tgagtcataa tattattttc tttgctaccc 420atcatgtata tatgatagcc acaaagttac tttgatgatg atatcaaaga acatttttag 480gtgcacctaa cagaatatcc aaataatatg actcacttag atcataatag agcatcaagt 540aaaactaaca ctctaaagca accgatggga aagcatctat aaatagacaa gcacaatgaa 600aatcctcatc atccttcacc acaattcaaa tattatagtt gaagcatagt agta 6545851DNAArtificial sequenceprimer prm04266 58ggggacaagt ttgtacaaaa aagcaggctt cacaatgtac ggacgcatgc c 515950DNAArtificial sequenceprimer prm04267 59ggggaccact ttgtacaaga aagctgggtg catcgaattg ttcttactgc 5060427PRTArabidopsis thaliana 60Met Arg Arg Phe Asn Trp Val Leu Arg His Val Gln Ala Arg Arg Thr1 5 10 15Phe Asp Ser Ala Ile Gly Leu Arg Gln Gly Ser Gln Lys Pro Leu Phe 20 25 30Glu Arg Tyr Ile His Ala Thr Gly Ile Asn Asn Ser Ser Ala Arg Asn 35 40 45Tyr Tyr Asp Val Leu Gly Val Ser Pro Lys Ala Thr Arg Glu Glu Ile 50 55 60Lys Lys Ser Phe His Glu Leu Ala Lys Lys Phe His Pro Asp Thr Asn65 70 75 80Arg Asn Asn Pro Ser Ala Lys Arg Lys Phe Gln Glu Ile Arg Glu Ala 85 90 95Tyr Glu Thr Leu Gly Asn Ser Glu Arg Arg Glu Glu Tyr Asp Lys Leu 100 105 110Gln Tyr Arg Asn Ser Asp Tyr Val Asn Asn Asp Gly Gly Asp Ser Glu 115 120 125Arg Phe Arg Arg Ala Tyr Gln Ser Asn Phe Ser Asp Thr Phe His Lys 130 135 140Ile Phe Ser Glu Ile Phe Glu Asn Asn Gln Ile Lys Pro Asp Ile Arg145 150 155 160Val Glu Leu Ser Leu Ser Leu Ser Glu Ala Ala Glu Gly Cys Thr Lys 165 170 175Arg Leu Ser Phe Asp Ala Tyr Val Phe Cys Asp Ser Cys Asp Gly Leu 180 185 190Gly His Pro Ser Asp Ala Ala Met Ser Ile Cys Pro Thr Cys Arg Gly 195 200 205Val Gly Arg Val Thr Ile Pro Pro Phe Thr Ala Ser Cys Gln Thr Cys 210 215 220Lys Gly Thr Gly His Ile Ile Lys Glu Tyr Cys Met Ser Cys Arg Gly225 230 235 240Ser Gly Ile Val Glu Gly Thr Lys Thr Ala Glu Leu Val Ile Pro Gly 245 250 255Gly Val Glu Ser Glu Ala Thr Ile Thr Ile Val Gly Ala Gly Asn Val 260 265 270Ser Ser Arg Thr Ser Gln Pro Gly Asn Leu Tyr Ile Lys Leu Lys Val 275 280 285Ala Asn Asp Ser Thr Phe Thr Arg Asp Gly Ser Asp Ile Tyr Val Asp 290 295 300Ala Asn Ile Ser Phe Thr Gln Ala Ile Leu Gly Gly Lys Val Val Val305 310 315 320Pro Thr Leu Ser Gly Lys Ile Gln Leu Asp Ile Pro Lys Gly Thr Gln 325 330 335Pro Asp Gln Leu Leu Val Leu Arg Gly Lys Gly Leu Pro Lys Gln Gly 340 345 350Phe Phe Val Asp His Gly Asp Gln Tyr Val Arg Phe Arg Val Asn Phe 355 360 365Pro Thr Glu Val Asn Glu Arg Gln Arg Ala Ile Leu Glu Glu Phe Ala 370 375 380Lys Glu Glu Ile Asn Asn Glu Leu Ser Asp Ser Ala Glu Gly Ser Trp385 390 395 400Trp Asn Leu Thr Gly Pro Gln Ile Ile Arg Asp Phe Ser Leu Met Val 405 410 415Leu Leu Ala Leu Leu Leu Ser Arg Leu Met Gly 420 42561500PRTArabidopsis thaliana 61Met Ala Ala Leu Ala Ser Pro Ser Leu Ile Pro Ser Ser Leu Cys Phe1 5 10 15Ala Ala Ala Ala Asp Gly Pro Arg Ser Leu Ser Ser Asn Phe Ser Ala 20 25 30Phe Ser Asp Gly Gly Ser Asn Phe Arg Tyr His Lys Ser Phe Leu Ser 35 40 45Leu Ser Ser Ser Ser Ser Ser Ser Thr Pro Tyr Arg Asn Arg Arg Gly 50 55 60Arg Ser Leu Val Val Phe Ala Thr Ser Gly Asp Tyr Tyr Ala Thr Leu65 70 75 80Gly Val Ser Lys Ser Ala Asn Asn Lys Glu Ile Lys Ala Ala Tyr Arg 85 90 95Arg Leu Ala Arg Gln Tyr His Pro Asp Val Asn Lys Glu Pro Gly Ala 100 105 110Thr Glu Lys Phe Lys Glu Ile Ser Ala Ala Tyr Glu Val Leu Ser Asp 115 120 125Glu Gln Lys Arg Ala Leu Tyr Asp Gln Tyr Gly Glu Ala Gly Val Lys 130 135 140Ser Thr Val Gly Gly Ala Ser Gly Pro Tyr Thr Ser Asn Pro Phe Asp145 150 155 160Leu Phe Glu Thr Phe Phe Gly Ala Ser Met Gly Gly Phe Pro Gly Met 165 170 175Asp Gln Ala Asp Phe Gly Arg Thr Arg Arg Ser Arg Val Thr Lys Gly 180 185 190Glu Asp Leu Arg Tyr Asp Ile Thr Leu Glu Leu Ser Glu Ala Ile Phe 195 200 205Gly Ser Glu Lys Glu Phe Asp Leu Thr His Leu Glu Thr Cys Glu Ala 210 215 220Cys Ala Gly Thr Gly Ala Lys Ala Gly Ser Lys Met Arg Ile Cys Ser225 230 235 240Thr Cys Gly Gly Arg Gly Gln Val Met Arg Thr Glu Gln Thr Pro Phe 245 250 255Gly Met Phe Ser Gln Val Ser Ile Cys Pro Asn Cys Gly Gly Asp Gly 260 265 270Glu Val Ile Ser Glu Asn Cys Arg Lys Cys Ser Gly Glu Gly Arg Val 275 280 285Arg Ile Lys Lys Ser Ile Lys Val Lys Ile Pro Pro Gly Val Ser Ala 290 295 300Gly Ser Ile Leu Arg Val Ala Gly Glu Gly Asp Ser Gly Pro Arg Gly305 310 315 320Gly Pro Pro Gly Asp Leu Tyr Val Tyr Leu Asp Val Glu Asp Val Arg 325 330 335Gly Ile Glu Arg Asp Gly Ile Asn Leu Leu Ser Thr Leu Ser Ile Ser 340 345 350Tyr Leu Asp Ala Ile Leu Gly Ala Val Val Lys Val Lys Thr Val Glu 355 360 365Gly Asp Thr Glu Leu Gln Ile Pro Pro Gly Thr Gln Pro Gly Asp Val 370 375 380Leu Val Leu Ala Lys Lys Gly Val Pro Lys Leu Asn Arg Pro Ser Ile385 390 395 400Arg Gly Asp His Leu Phe Thr Val Lys Val Ser Val Pro Asn Gln Ile 405 410 415Ser Ala Gly Glu Arg Glu Leu Leu Glu Glu Leu Ala Ser Leu Lys Asp 420 425 430Thr Ser Ser Asn Arg Ser Arg Thr Arg Ala Lys Pro Gln Gln Pro Ser 435 440 445Thr Leu Ser Thr Ala Pro Ser Gly Ser Glu Asn Lys Lys Asp Glu Val 450 455 460Lys Glu Glu Asn Glu Glu Pro Glu Gln Glu Asn Tyr Leu Trp Asn Asn465 470 475 480Ile Lys Glu Phe Ala Gly Ser Val Ala Asn Gly Ala Leu Lys Trp Leu 485 490 495Arg Asp Asn Leu 50062442PRTArabidopsis thaliana 62Met Ala Ile Ile Gln Leu Gly Ser Thr Cys Val Ala Gln Trp Ser Ile1 5 10 15Arg Pro Gln Phe Ala Val Arg Ala Tyr Tyr Pro Ser Arg Ile Glu Ser 20 25 30Thr Arg His Gln Asn Ser Ser Ser Gln Val Asn Cys Leu Gly Ala Ser 35 40 45Lys Ser Ser Met Phe Ser His Gly Ser Leu Pro Phe Leu Ser Met Thr 50 55 60Gly Met Ser Arg Asn Met His Pro Pro Arg Arg Gly Ser Arg Phe Thr65 70 75 80Val Arg Ala Asp Ala Asp Tyr Tyr Ser Val Leu Gly Val Ser Lys Asn 85 90 95Ala Thr Lys Ala Glu Ile Lys Ser Ala Tyr Arg Lys Leu Ala Arg Asn 100 105 110Tyr His Pro Asp Val Asn Lys Asp Pro Gly Ala Glu Glu Lys Phe Lys 115 120 125Glu Ile Ser Asn Ala Tyr Glu Val Leu Ser Asp Asp Glu Lys Lys Ser 130 135 140Leu Tyr Asp Arg Tyr Gly Glu Ala Gly Leu Lys Gly Ala Ala Gly Phe145 150 155 160Gly Asn Gly Asp Phe Ser Asn Pro Phe Asp Leu Phe Asp Ser Leu Phe 165 170 175Glu Gly Phe Gly Gly Gly Met Gly Arg Gly Ser Arg Ser Arg Ala Val 180 185 190Asp Gly Gln Asp Glu Tyr Tyr Thr Leu Ile Leu Asn Phe Lys Glu Ala 195 200 205Val Phe Gly Met Glu Lys Glu Ile Glu Ile Ser Arg Leu Glu Ser Cys 210 215 220Gly Thr Cys Glu Gly Ser Gly Ala Lys Pro Gly Thr Lys Pro Thr Lys225 230 235 240Cys Thr Thr Cys Gly Gly Gln Gly Gln Val Val Ser Ala Ala Arg Thr 245 250 255Pro Leu Gly Val Phe Gln Gln Val Met Thr Cys Ser Ser Cys Asn Gly 260 265 270Thr Gly Glu Ile Ser Thr Pro Cys Gly Thr Cys Ser Gly Asp Gly Arg 275 280 285Val Arg Lys Thr Lys Arg Ile Ser Leu Lys Val Pro Ala Gly Val Asp 290 295 300Ser Gly Ser Arg Leu Arg Val Arg Gly Glu Gly Asn Ala Gly Lys Arg305 310 315 320Gly Gly Ser Pro Gly Asp Leu Phe Val Val Ile Glu Val Ile Pro Asp 325 330 335Pro Ile Leu Lys Arg Asp Asp Thr Asn Ile Leu Tyr Thr Cys Lys Ile 340 345 350Ser Tyr Ile Asp Ala Ile Leu Gly Thr Thr Leu Lys Val Pro Thr Val 355 360 365Asp Gly Thr Val Asp Leu Lys Val Pro Ala Gly Thr Gln Pro Ser Thr 370 375 380Thr Leu Val Met Ala Lys Lys Gly Val Pro Val Leu Asn Lys Ser Asn385 390 395 400Met Arg Gly Asp Gln Leu Val Arg Val Gln Val Glu Ile Pro Lys Arg 405 410 415Leu Ser Lys Glu Glu Lys Lys Leu Ile Glu Glu Leu Ala Asp Met Ser 420 425 430Lys Asn Lys Thr Ala Asn Ser Thr Ser Arg 435 44063517PRTArabidopsis thaliana 63Met Ala Ala Met Ala Arg Cys Ala Leu Ile Pro Ser Ile Asn Pro Ala1 5 10 15His Ser Phe Arg His Gln Phe Pro Gln Pro Asn Ala Ser Phe Tyr Leu 20 25 30Pro Pro Thr Leu Pro Ile Phe Ser Arg Val Arg Arg Phe Gly Ile Ser 35 40 45Gly Gly Tyr Arg Arg Arg Val Ile Thr Met Ala Ala Gly Thr Asp His 50 55 60Tyr Ser Thr Leu Asn Val Asn Arg Asn Ala Thr Leu Gln Glu Ile Lys65 70 75 80Ser Ser Tyr Arg Lys Leu Ala Arg Lys Tyr His Pro Asp Met Asn Lys 85 90 95Asn Pro Gly Ala Glu Asp Lys Phe Lys Gln Ile Ser Ala Ala Tyr Glu 100 105 110Val Leu Ser Asp Glu Glu Lys Arg Ser Ala Tyr Asp Arg Phe Gly Glu 115 120 125Ala Gly Leu Glu Gly Asp Phe Asn Gly Ser Gln Asp Thr Ser Pro Gly 130 135 140Val Asp Pro Phe Asp Leu Tyr Ser Ala Phe Phe Gly Gly Ser Asp Gly145 150 155 160Phe Phe Gly Gly Met Gly Glu Ser Gly Gly Met Gly Phe Asp Phe Met 165 170 175Asn Lys Arg Ser Leu Asp Leu Asp Ile Arg Tyr Asp Leu Arg Leu Ser 180 185 190Phe Glu Glu Ala Val Phe Gly Val Lys Arg Glu Ile Glu Val Ser Tyr 195 200 205Leu Glu Thr Cys Asp Gly Cys Gly Gly Thr Gly Ala Lys Ser Ser Asn 210 215 220Ser Ile Lys Gln Cys Ser Ser Cys Asp Gly Lys Gly Arg Val Met Asn225 230 235 240Ser Gln Arg Thr Pro Phe Gly Ile Met Ser Gln Val Ser Thr Cys Ser 245 250 255Lys Cys Gly Gly Glu Gly Lys Thr Ile Thr Asp Lys Cys Arg Lys Cys 260 265 270Ile Gly Asn Gly Arg Leu Arg Ala Arg Lys Lys Met Asp Val Val Val 275 280 285Pro Pro Gly Val Ser Asp Arg Ala Thr Met Arg Ile Gln Gly Glu Gly 290 295 300Asn Met Asp Lys Arg Ser Gly Arg Ala Gly Asp Leu Phe Ile Val Leu305 310 315 320Gln Val Asp Glu Lys Arg Gly Ile Arg Arg Glu Gly Leu Asn Leu Tyr 325 330 335Ser Asn Ile Asn Ile Asp Phe Thr Asp Ala Ile Leu Gly Ala Thr Thr 340 345 350Lys Val Glu Thr Val Glu Gly Ser Met Asp Leu Arg Ile Pro Pro Gly 355 360 365Thr Gln Pro Gly Asp Thr Val Lys Leu Pro Arg Lys Gly Val Pro Asp 370 375 380Thr Asp Arg Pro Ser Ile Arg Gly Asp His Cys Phe Val Val Lys Ile385 390 395 400Ser Ile Pro Lys Lys Leu Ser Glu Arg Glu Arg Lys Leu Val Glu Glu 405 410 415Phe Ser Ser Leu Arg Arg Ser Ser Ser Ser Thr Gly Pro Thr Glu Thr 420 425 430Arg Gln Glu Glu Gln Ser Phe Gly Ser Glu Pro Arg Lys Glu Pro Ser 435 440 445Leu Trp His Lys Met Lys Asn Phe Ile Arg Pro Glu Asp Ser Arg Thr 450 455 460Lys Phe Gly Thr Met Ser Leu Asn Pro Ser Leu Pro Leu Arg Arg Met465 470

475 480Lys Val Ser Glu Thr Ser Ile Ala Phe Ser Val Leu Ala Leu Cys Val 485 490 495Ile Thr Ser Ala Val Ala Leu Val Gln Lys Lys Gly Asn Arg Leu Lys 500 505 510Gln Lys Lys Glu Thr 51564447PRTArabidopsis thaliana 64Met Ala Leu Ile Gln Phe Gly Ser Ser Cys Val Ala Gln Trp Gly Ile1 5 10 15Leu Arg Pro Arg Phe Ala Val Lys Ala Phe Tyr Pro Ser Arg Leu Glu 20 25 30Ser His Gln Asp Asn Cys Ile Ser Gln Ile Asn Cys Leu Gly Ala Ser 35 40 45Arg Ser Ser Met Phe Ala Gln Gly Ser Leu Pro Phe Leu Ser Leu Thr 50 55 60Gly Val Ser Pro Asn Thr His Ser Arg Arg Gly Ala Arg Phe Thr Val65 70 75 80Arg Ala Asp Thr Asp Phe Tyr Ser Val Leu Gly Val Ser Lys Asn Ala 85 90 95Thr Lys Ala Glu Ile Lys Ser Ala Tyr Arg Lys Leu Ala Arg Ser Tyr 100 105 110His Pro Asp Val Asn Lys Asp Ala Gly Ala Glu Asp Lys Phe Lys Glu 115 120 125Ile Ser Asn Ala Tyr Glu Ile Leu Ser Asp Asp Glu Lys Arg Ser Leu 130 135 140Tyr Asp Arg Tyr Gly Glu Ala Gly Val Lys Gly Ala Gly Met Gly Gly145 150 155 160Met Gly Asp Tyr Ser Asn Pro Phe Asp Leu Phe Glu Ser Leu Phe Glu 165 170 175Gly Met Gly Gly Met Gly Gly Met Gly Gly Gly Met Gly Ser Arg Gly 180 185 190Ser Arg Ser Arg Ala Ile Asp Gly Glu Asp Glu Tyr Tyr Ser Leu Ile 195 200 205Leu Asn Phe Lys Glu Ala Val Phe Gly Ile Glu Lys Glu Ile Glu Ile 210 215 220Ser Arg Leu Glu Ser Cys Gly Thr Cys Asn Gly Ser Gly Ala Lys Ala225 230 235 240Gly Thr Lys Pro Thr Lys Cys Lys Thr Cys Gly Gly Gln Gly Gln Val 245 250 255Val Ala Ser Thr Arg Thr Pro Leu Gly Val Phe Gln Gln Val Met Thr 260 265 270Cys Ser Pro Cys Asn Gly Thr Gly Glu Ile Ser Lys Pro Cys Gly Ala 275 280 285Cys Ser Gly Asp Gly Arg Val Arg Arg Thr Lys Arg Ile Ser Leu Lys 290 295 300Val Pro Ala Gly Val Asp Ser Gly Ser Arg Leu Arg Val Arg Gly Glu305 310 315 320Gly Asn Ala Gly Lys Arg Gly Gly Ser Pro Gly Asp Leu Phe Ala Val 325 330 335Ile Glu Val Ile Pro Asp Pro Val Leu Lys Arg Asp Asp Thr Asn Ile 340 345 350Leu Tyr Thr Cys Lys Ile Ser Tyr Val Asp Ala Ile Leu Gly Thr Thr 355 360 365Leu Lys Val Pro Thr Val Asp Gly Glu Val Asp Leu Lys Val Pro Ala 370 375 380Gly Thr Gln Pro Ser Thr Thr Leu Val Met Ala Lys Lys Gly Val Pro385 390 395 400Val Leu Asn Lys Ser Lys Met Arg Gly Asp Gln Leu Val Arg Val Gln 405 410 415Val Glu Ile Pro Lys Arg Leu Ser Lys Glu Glu Lys Met Leu Val Glu 420 425 430Glu Leu Ala Asp Met Ser Lys Asn Lys Val Ala Asn Ser Arg Arg 435 440 44565456PRTArabidopsis thaliana 65Met Val Pro Ser Asn Gly Ala Lys Val Leu Arg Leu Leu Ser Arg Arg1 5 10 15Cys Leu Ser Ser Ser Leu Ile Gln Asp Leu Ala Asn Gln Lys Leu Arg 20 25 30Gly Val Cys Ile Gly Ser Tyr Arg Arg Leu Asn Thr Ser Val Gly Asn 35 40 45His Ala Asn Val Ile Gly Asp Tyr Ala Ser Lys Ser Gly His Asp Arg 50 55 60Lys Trp Ile Asn Phe Gly Gly Phe Asn Thr Asn Phe Gly Ser Thr Arg65 70 75 80Ser Phe His Gly Thr Gly Ser Ser Phe Met Ser Ala Lys Asp Tyr Tyr 85 90 95Ser Val Leu Gly Val Ser Lys Asn Ala Gln Glu Gly Glu Ile Lys Lys 100 105 110Ala Tyr Tyr Gly Leu Ala Lys Lys Leu His Pro Asp Met Asn Lys Asp 115 120 125Asp Pro Glu Ala Glu Thr Lys Phe Gln Glu Val Ser Lys Ala Tyr Glu 130 135 140Ile Leu Lys Asp Lys Glu Lys Arg Asp Leu Tyr Asp Gln Val Gly His145 150 155 160Glu Ala Phe Glu Gln Asn Ala Ser Gly Gly Phe Pro Asn Asp Gln Gly 165 170 175Phe Gly Gly Gly Gly Gly Gly Gly Phe Asn Pro Phe Asp Ile Phe Gly 180 185 190Ser Phe Asn Gly Asp Ile Phe Asn Met Tyr Arg Gln Asp Ile Gly Gly 195 200 205Gln Asp Val Lys Val Leu Leu Asp Leu Ser Phe Met Glu Ala Val Gln 210 215 220Gly Cys Ser Lys Thr Val Thr Phe Gln Thr Glu Met Ala Cys Asn Thr225 230 235 240Cys Gly Gly Gln Gly Val Pro Pro Gly Thr Lys Arg Glu Lys Cys Lys 245 250 255Ala Cys Asn Gly Ser Gly Met Thr Ser Leu Arg Arg Gly Met Leu Ser 260 265 270Ile Gln Thr Thr Cys Gln Lys Cys Gly Gly Ala Gly Gln Thr Phe Ser 275 280 285Ser Ile Cys Lys Ser Cys Arg Gly Ala Arg Val Val Arg Gly Gln Lys 290 295 300Ser Val Lys Val Thr Ile Asp Pro Gly Val Asp Asn Ser Asp Thr Leu305 310 315 320Lys Val Ala Arg Val Gly Gly Ala Asp Pro Glu Gly Asp Gln Pro Gly 325 330 335Asp Leu Tyr Val Thr Leu Lys Val Arg Glu Asp Pro Val Phe Arg Arg 340 345 350Glu Gly Ser Asp Ile His Val Asp Ala Val Leu Ser Val Thr Gln Ala 355 360 365Ile Leu Gly Gly Thr Ile Gln Val Pro Thr Leu Thr Gly Asp Val Val 370 375 380Val Lys Val Arg Pro Gly Thr Gln Pro Gly His Lys Val Val Leu Arg385 390 395 400Asn Lys Gly Ile Arg Ala Arg Lys Ser Thr Lys Phe Gly Asp Gln Tyr 405 410 415Val His Phe Asn Val Ser Ile Pro Ala Asn Ile Thr Gln Arg Gln Arg 420 425 430Glu Leu Leu Glu Glu Phe Ser Lys Ala Glu Gln Gly Glu Tyr Glu Gln 435 440 445Arg Thr Ala Thr Gly Ser Ser Gln 450 455668PRTArtificial sequenceConserved sequence for the zinc binding domain 66Cys Xaa Xaa Cys Xaa Gly Xaa Gly1 5

Claims

1-19. (canceled)

20. A method for the production of a transgenic plant having increased yield comprising: (i) introducing and/or expressing in the cytosol of a plant, plant part or plant cell a nucleic acid encoding a type I DnaJ-like polypeptide or a homologue thereof; and (ii) selecting a plant with increased plant yield compared to a corresponding wild type plant; wherein the type I DnaJ-like polypeptide or a homologue thereof comprises a CaaX motif at its carboxy terminus.

21. The method of claim 20, wherein said nucleic acid encoding a type I DnaJ-like polypeptide or a homologue thereof is of prokaryotic or eukaryotic origin.

22. The method of claim 20, wherein said nucleic acid encoding a type I DnaJ-like polypeptide or a homologue thereof is of plant origin, or is from yeast, fungi, or algae.

23. The method of claim 20, wherein said increased yield is increased seed yield, increased harvest index, or increased growth rate.

24. The method of claim 20, wherein the plant, plant part or plant cell is from a monocotyledonous or dicotyledonous plant.

25. A transgenic plant obtained by the method of claim 20.

26. A method for increasing plant yield under non-stress conditions comprising: (i) introducing and/or expressing in the cytosol of a plant, plant part or plant cell a nucleic acid encoding a type I DnaJ-like polypeptide or a homologue thereof; (ii) selecting a plant with increased plant yield under non-stress conditions compared to yield a corresponding wild type plant grown under comparable conditions; and (iii) cultivating the plant under non-stress growth conditions promoting plant growth and development; wherein the type I DnaJ-like polypeptide or a homologue thereof comprises a CaaX motif at its carboxy terminus.

27. The method of claim 26, wherein said nucleic acid encoding a type I DnaJ-like polypeptide or a homologue thereof is of prokaryotic or eukaryotic origin.

28. The method of claim 26, wherein said nucleic acid encoding a type I DnaJ-like polypeptide or a homologue thereof is of plant origin, or is from yeast, fungi, or algae.

29. The method of claim 26, wherein said increased yield is increased seed yield, increased harvest index, or increased growth rate.

30. A transgenic plant having increased yield under non-stress growth conditions resulting from expression of a type I DnaJ-like nucleic acid in said plant, wherein said type I DnaJ-like nucleic acid encodes a type I DnaJ-like polypeptide or a homologue thereof comprising a CaaX motif at its carboxy terminus.

31. The transgenic plant of claim 30, wherein said type I DnaJ-like nucleic acid is of prokaryotic or eukaryotic origin.

32. The transgenic plant of claim 30, wherein said type I DnaJ-like nucleic acid is of plant origin, or is from plants, yeast, fungi, or algae.

33. The transgenic plant according to claim 30, wherein said plant is a monocotyledonous or dicotyledonous plant.

34. Harvestable parts of the transgenic plant of claim 30, wherein the harvestable parts comprise said type I DnaJ-like nucleic acid.

35. Harvestable parts of claim 34, wherein said harvestable parts are seeds.

36. The transgenic plant of claim 30, wherein said increased plant yield is increased seed yield, increased harvest index, or increased growth rate.

37. A construct comprising: (i) a nucleic acid encoding a type I DnaJ-like polypeptide or a homologue thereof, wherein the type I DnaJ-like polypeptide or homologue thereof comprises a CaaX motif at its carboxy terminus; (ii) at least one control sequence capable of driving expression of the nucleic acid of (i); and optionally (iii) a transcription termination sequence.

38. The construct of claim 37, wherein said at least one control sequence is a seed-specific promoter or an endosperm-specific promoter.

39. The construct of claim 38, wherein said endosperm-specific promoter is the rice prolamin RP6 promoter.

Images