HYDROGENASE POLYPEPTIDE AND METHODS OF USE

Abstract

eptides having hydrogenase activity. The polypeptide may be multimeric, and may have hydrogenase activity of at least 0.05 micromoles H₂ produced min^-1 mg protein^-1. Also provided herein are polynucleotides encoding the polypeptides, genetically modified microbes that include polynucleotides encoding one or more subunits of the multimeric polypeptide, and methods for making and using the polypeptides.

Description

CONTINUING APPLICATION DATA

[0001]This application claims the benefit of U.S. Provisional Application Ser. No. 61/005,383, filed Dec. 5, 2007, which is incorporated by reference herein.

BACKGROUND

[0003]Molecular hydrogen (H₂) is typically produced by steam reforming of methane, and platinum is the most commonly used catalyst for hydrogen production. Due to utilization of fossil fuels as a source of methane, as well as the expense, limited availability, sensitivity to poisoning, and bioincompatibility of the catalyst, it is not likely to be utilized in economical energy conversion systems (Bharadwaj and Schmidt. 1995. Fuel Processing Technology 42:109-127, Ghenciu. 2002. Current Opinion in Solid State & Materials Science 6:389-399). However, in 2003 President Bush in the State of the Union Address proposed the Hydrogen Fuel Initiative, the goal of which was to develop new technologies for production and utilization of H₂ as a potential source of energy to replace fossil fuels. In microorganisms, the molecular machine responsible for the biological uptake and evolution of hydrogen is an enzyme known as hydrogenase. Hydrogenase catalyzes the simplest of chemical reactions, the interconversion of the neutral molecule H₂ and its elementary constituents, two protons and two electrons (Eqn. 1).

2H⁺+2e.sup.-⇄H₂ (1)

Ironically, however, while the reaction that they catalyze is simple, hydrogenase enzymes are multimeric proteins and typically are sensitive to air (oxygen). This has to-date precluded the facile production of a recombinant form of the major class of hydrogenase, the so-called `nickel-iron` (NiFe) type.

[0004]Hydrogenases are found in representatives of most microbial genera, as well as some unicellular eukaryotes (Adams et al. 1980. Biochim Biophys Acta 594:105-76; Cammack et al. 2001. Hydrogen as a fuel: learning from nature. Taylor & Francis, London, New York; Friedrich and Schwartz. 1993. Annual Review of Microbiology 47:351-383; Przybyla et al. 1992. FEMS Microbiology Reviews 88:109-135, Vignais et al. 2001. FEMS Microbiology Reviews 25:455-501). The enzyme allows many microorganisms to use H₂ gas as a source of low potential reductant (H₂/H⁺, E^o'=-420 mV), either for carbon fixation or as a source of energy. In aerobic environments, H₂ oxidation can be coupled via membrane electron transport to the reduction of oxygen (O₂/H₂O, E^o'=+820 mV). There are a variety of electron acceptors that can be coupled to anaerobic H₂ oxidation, including carbon dioxide, which can be reduced to either methane (by methanogens) or acetate (by acetogens), and sulfate and ferric-iron, which are reduced to sulfide and ferrous iron, respectively. On the other hand, microorganisms that produce H₂ during growth are widespread in anaerobic environments. The production of H₂ is used as a mechanism to dispose of the excess reductant that is generated during the oxidation of organic material. These fermentative organisms conserve energy by chemical synthesis (substrate level phosphorylation) independent of the means by which they dispose of reductant (be it as H₂ or as a reduced organic compound such as ethanol). However, it was recently discovered that some organisms are able to conserve energy directly from the production of H₂ by a novel respiratory mechanism (Sapra et al. 2003. Proc Natl Acad Sci USA 100:7545-50).

[0005]Two major types of hydrogenase are known: the nickel-iron (NiFe) and the iron-only (Fe) enzymes (Adams. 1990. Biochimica Et Biophysica Acta 1020:115-145; Albracht. 1994. Biochimica Et Biophysica Acta-Bioenergetics 1188:167-204), which are unrelated phylogenetically (Meyer, J. 2007. Cellular and Molecular Life Sciences 64:1063-1084; Vignais et al. 2001. FEMS Microbiology Reviews 25:455-501). The iron-only type is found in only a few types of anaerobic bacteria and some photosynthetic algae, but they have been extensively studied. This includes structural characterization (Chen et al. 2002. Biochemistry 41:2036-2043; Nicolet et al. 2001. Journal of the American Chemical Society 123:1596-1601; Nicolet et al. 2000. Trends in Biochemical Sciences 25:138-143; Nicolet et al. 1999. Structure with Folding & Design 7:13-23; Peters et al. 1998. Science 282:1853-1858) including potential active site models (Boyke et al. 2004. Journal of the American Chemical Society 126:15151-15160; Tye et al. 2006. Inorg Chem 45:1552-9; Zilberrnan et al. 2007. Inorg Chem 46:1153-61), and recently insights have been provided into their biosynthesis (Mishra et al. 2004. Biochemical and Biophysical Research Communications 324:679-685; Posewitz et al. 2004. Journal of Biological Chemistry 279:25711-25720), as well there are some recent successful attempts to make recombinant forms of these enzymes (King et al. 2006. J Bacteriol 188:2163-72).

[0006]The majority of microorganisms that metabolize H₂, however, contain NiFe-hydrogenases, an example of which is the cytoplasmic NiFe hydrogenase I of the hyperthermophilic archaeon, Pyrococcus furiosus, which grows optimally at 100° C. (Fiala and Stetter. 1986. Archives of Microbiology 145:56-61, Verhagen et al. 2001. Hyperthermophilic Enzymes, Pt A 330:25-30). The NiFe-hydrogenases have also been extensively characterized over the last 40 years, and several crystal structures are available (Garcin et al. 1998. Biochemical Society Transactions 26:396-401, Higuchi. 1999. Structure 7:549-56, Volbeda and Fontecilla-Camps. 2003. Dalton Transactions:4030-4038, Volbeda et al. 1996. Journal of the American Chemical Society 118:12989-12996). They all are made up of at least two subunits, one of which contains the NiFe-catalytic site, while the other contains three iron-sulfur (FeS) clusters. These clusters serve to shuttle electrons from the electron donor to the enzyme to and from the NiFe site in the catalytic subunit. The Ni atom is bound to four cysteinyl residues of this subunit, two of which are near the N-terminus and two near the C-terminus. Two of the four Cys bind a single Fe atom, which is also coordinated, remarkably, by one carbon monoxide (CO) and two cyanide (CN) ligands (Bagley et al. 1995. Biochemistry 34:5527-5535, Happe et al. 1997. Nature 385:126-126, Pierik et al. 1999. Journal of Biological Chemistry 274:3331-3337). These diatomic ligands serve to activate the iron atom (maintaining it in the low spin state) thereby facilitating catalysis. Interestingly, such ligands are also found at the active site of the iron-only hydrogenases (Nicolet et al. 2002. J Inorg Biochem 91:1-8), as well as the mononuclear iron site of a third type of hydrogenase found in a very limited number of archaea (Lyon et al. 2004. Journal of the American Chemical Society 126:14239-14248), an example of convergent evolution toward a similar function.

[0007]The hydrogenase of P. furiosus is of particular interest for additional reasons. First, it is obtained from an organism that grows optimally at 100° C. and has been shown to be an exceedingly robust and thermostable enzyme (Bryant and Adams. 1989. J Biol Chem 264:5070-9; Ma and Adams. 2001. Methods Enzymol 331:208-16). Second, in in vitro assays, the enzyme has been shown to be able to generate hydrogen gas by oxidizing NADPH in a reversible reaction (Ma and Adams. 2001. Methods Enzymol 331:208-16; Ma et al. 2000. J Bacteriol 182:1864-71; Ma et al. 1994. FEMS Microbiology Letters 122:245-250), which is a very rare property among the hydrogenases that have been characterized to date. Consequently, the reversible P. furiosus enzyme has utility in generating reductants such as NADPH. Likewise, the P. furiosus enzyme has utility in hydrogen production systems in which carbohydrates are oxidized to generate NADPH, which in turn can be converted to hydrogen gas by the hydrogenase. The production of hydrogen from glucose in an in vitro cell-free system using purified enzymes was first demonstrated over a decade ago (Woodward et al. 1996. Nat Biotechnol 14:872-4). This work was very recently extended in which the conversion of starch to hydrogen was described using an in vitro cell-free system made up of thirteen different enzymes (Zhang et al. 2007. PLoS ONE 2:e456). Twelve of the enzymes are used to oxidize starch and generate carbon dioxide and NADPH, and the thirteenth, P. furiosus hydrogenase, oxidizes NADPH and produces hydrogen gas. In this system, the hydrogenase was purified from P. furiosus biomass (Ma and Adams. 2001. Methods Enzymol 331:208-16) since a recombinant form of this enzyme was not available.

SUMMARY OF THE INVENTION

[0008]Provided herein are polypeptides having hydrogenase activity. In one aspect, the polypeptide is dimeric polypeptide. The amino acid sequence of the first subunit and the amino acid sequence of SEQ ID NO:6 have at least 80% identity, and the amino acid sequence of the second subunit and the amino acid sequence of SEQ ID NO:8 have at least 80% identity. At least one subunit may be a fusion that includes a heterologous amino acid sequence. The dimeric polypeptide may further include two more subunits to result in a tetrameric polypeptide. The amino acid sequence of the third subunit and the amino acid sequence of SEQ ID NO:2 have at least 80% identity, and the amino acid sequence of the fourth subunit and the amino acid sequence of SEQ ID NO:4 have at least 80% identity. The multimeric polypeptide may be isolated, or purified. The tetrameric polypeptide may be present in a genetically modified microbial cell. In some aspects, the genetically modified microbial cell is not Pyrococcus furiosus, P. abyssi, P. horikoshii, Thermococcus kodakaraensis, or T. onnurineus. It may be present in a microbial cell, such as, but not limited to Escherichia coli.

[0009]The multimeric polypeptide may have hydrogenase activity of at least 0.05 micromoles H₂ produced min^-1 mg protein^-1 when isolated by centrifugation of a whole cell extract at 100,000×g, heat-treatment at 80° C. for 30 minutes, and re-centrifugation at 100,000×g. The heterologous amino acid sequence may be present at, for instance, the amino terminal end of a subunit, or the carboxy terminal end of a subunit. The multimeric polypeptide may include one or more chemically modified subunits. Also provided herein is a polypeptide consisting of two subunits or four subunits.

[0010]Also provided herein are genetically modified microbes. A genetically modified microbe may include an exogenous polypeptide, wherein the exogenous polypeptide includes two subunits. The first subunit includes an amino acid sequence, and the amino acid sequence of the first subunit and the amino acid sequence of SEQ ID NO:6 have at least 80% identity. The second subunit includes an amino acid sequence, and the amino acid sequence of the second subunit and the amino acid sequence of SEQ ID NO:8 have at least 80% identity. The two subunits form a dimeric polypeptide having hydrogenase activity. The dimeric polypeptide may further include two more subunits to form a tetrameric polypeptide having hydrogenase activity, wherein the third subunit includes an amino acid sequence, and the amino acid sequence of the third subunit and the amino acid sequence of SEQ ID NO:2 have at least 80% identity. The fourth subunit includes an amino acid sequence, and the amino acid sequence of the fourth subunit and the amino acid sequence of SEQ ID NO:4 have at least 80% identity. At least one subunit can be a fusion that includes a heterologous amino acid sequence. A genetically modified microbe may include one or more of the accessory polynucleotides described herein.

[0011]A genetically modified microbe may include two exogenous polynucleotides, wherein the exogenous polynucleotides each encode a subunit. The first subunit can include an amino acid sequence, and the amino acid sequence of the first subunit and the amino acid sequence of SEQ ID NO:6 have at least 80% identity. The second subunit can include an amino acid sequence, and the amino acid sequence of the second subunit and the amino acid sequence of SEQ ID NO:8 have at least 80% identity. The two subunits form a dimeric polypeptide having hydrogenase activity. The genetically modified microbe can further include two more exogenous polynucleotides, wherein the two more exogenous polynucleotides each encode a subunit. The third subunit can include an amino acid sequence, and the amino acid sequence of the third subunit and the amino acid sequence of SEQ ID NO:2 have at least 80% identity. The fourth subunit can include an amino acid sequence, and the amino acid sequence of the fourth subunit and the amino acid sequence of SEQ ID NO:4 have at least 80% identity. The four subunits form a tetrameric polypeptide having hydrogenase activity. At least one subunit can be a fusion that includes a heterologous amino acid sequence, such as a histidine tag.

[0012]Further provided herein are methods for making a polypeptide having hydrogenase activity. The methods may include providing a genetically modified microbe including exogenous polynucleotides as described herein, and incubating the microbe under conditions suitable for expression of the exogenous polynucleotides to produce a multimeric polypeptide having hydrogenase activity. The method may further include isolating, or optionally purifying, the polypeptide after the incubating.

[0013]Provided herein are methods for using a polypeptide having hydrogenase activity. The methods may include providing a polypeptide described herein, and incubating the polypeptide under conditions suitable for producing H₂. The produced H₂ may be collected.

[0014]In one aspect, the polypeptide is an isolated or purified polypeptide. The polypeptide may be present on a surface, such as one that conducts electricity, e.g., an anode. The polypeptide may be chemically modified. The incubating may include conditions that include a polysaccharide, such as a starch or a cellulose. The conditions can include a temperature of at least 37° C. or at least 70° C. 70° C.

[0015]In another aspect, the polypeptide is present in a genetically modified microbe. The incubating may include incubating the microbial cell under conditions suitable for the expression of the polypeptide. The incubating may include conditions that include a polysaccharide, such as a starch or a cellulose. The conditions can include a temperature of at least 37° C. or at least 70° C.

[0016]Provided herein are methods for using a polypeptide having hydrogenase activity. The methods for using a polypeptide having hydrogenase activity may include providing a polypeptide described herein, and incubating the polypeptide under conditions suitable for producing NADPH. The produced NADPH may be collected.

[0017]In one aspect, the polypeptide is an isolated or purified polypeptide. The conditions may include molecular hydrogen, and a temperature of at least 37° C. In another aspect, the polypeptide is present in a genetically modified microbe. The incubating may include incubating the microbial cell under conditions suitable for the expression of the polypeptide. The conditions may include a temperature of at least 37° C.

[0018]Also provided herein is an expression system for assembling a polypeptide having hydrogenase activity. The expression system includes the plasmids described herein. The plasmids may be present in a microbe, such as an E. coli.

[0019]As used herein, the term "polypeptide" refers broadly to a polymer of two or more amino acids joined together by peptide bonds. The term "polypeptide" also includes molecules which contain more than one polypeptide joined by a disulfide bond, or complexes of polypeptides that are joined together, covalently or noncovalently, as multimers (e.g., dimers, trimers, tetramers). A polypeptide also may possess non-protein (non-amino acid) ligands including, but not limited to, inorganic iron (Fe), nickel (Ni), inorganic iron-sulfur centers such as [4Fe-4S] clusters, and other organic ligands such as carbon monoxide (CO), cyanide (CN) and flavin. Thus, the terms peptide, oligopeptide, enzyme, subunit, and protein are all included within the definition of polypeptide and these terms are used interchangeably. It should be understood that these terms do not connote a specific length of a polymer of amino acids, nor are they intended to imply or distinguish whether the polypeptide is produced using recombinant techniques, chemical or enzymatic synthesis, or is naturally occurring. As used herein, "heterologous amino acid sequence" refers to amino acid sequences that are not normally present as part of a polypeptide present in a wilt-type cell. For instance, "heterologous amino acid sequence" includes extra amino acids at the amino terminal end or carboxy terminal of a polypeptide that are not normally part of a polypeptide that is present in a wild-type cell.

[0020]As used herein, "hydrogenase activity" refers to the ability of a polypeptide to catalyze the formation of molecular hydrogen (H₂).

[0021]As used herein, "identity" refers to structural similarity between two polypeptides or two polynucleotides. The structural similarity between two polypeptides is determined by aligning the residues of the two polypeptides (e.g., a candidate amino acid sequence and a reference amino acid sequence, such as SEQ ID NO:2, 4, 6, or 8) to optimize the number of identical amino acids along the lengths of their sequences; gaps in either or both sequences are permitted in making the alignment in order to optimize the number of shared amino acids, although the amino acids in each sequence must nonetheless remain in their proper order. The structural similarity is typically at least 80% identity, at least 81% identity, at least 82% identity, at least 83% identity, at least 84% identity, at least 85% identity, at least 86% identity, at least 87% identity, at least 88% identity, at least 89% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, or at least 99% identity. A candidate amino acid sequence can be isolated from a microbe, preferably a Pyrococcus spp., more preferably a P. furiosus, or can be produced using recombinant techniques, or chemically or enzymatically synthesized. Structural similarity may be determined, for example, using sequence techniques such as the BESTFIT algorithm in the GCG package (Madison Wis.), or the Blastp program of the BLAST 2 search algorithm, as described by Tatusova, et al. (FEMS Microbiol Lett 1999, 174:247-250), and available through the World Wide Web, for instance at the interne site maintained by the National Center for Biotechnology Information, National Institutes of Health. Preferably, structural similarity between two amino acid sequences is determined using the Blastp program of the BLAST 2 search algorithm. Preferably, the default values for all BLAST 2 search parameters are used, including matrix=BLOSUM62; open gap penalty=11, extension gap penalty=1, gap x_dropoff=50, expect=10, wordsize=3, and optionally, filter on. In the comparison of two amino acid sequences using the BLAST search algorithm, structural similarity is referred to as "identities."

[0022]The structural similarity between two polynucleotides is determined by aligning the residues of the two polynucleotides (e.g., a candidate nucleotide sequence and a reference nucleotide sequence, such as SEQ ID NO:1, 3, 5, or 7) to optimize the number of identical nucleotides along the lengths of their sequences; gaps in either or both sequences are permitted in making the alignment in order to optimize the number of shared nucleotides, although the nucleotides in each sequence must nonetheless remain in their proper order. The structural similarity is typically at least 80% identity, at least 81% identity, at least 82% identity, at least 83% identity, at least 84% identity, at least 85% identity, at least 86% identity, at least 87% identity, at least 88% identity, at least 89% identity, at least 90% identity, at least 91% identity, at least 92% identity, at least 93% identity, at least 94% identity, at least 95% identity, at least 96% identity, at least 97% identity, at least 98% identity, or at least 99% identity. A candidate nucleotide sequence can be isolated from a microbe, preferably a Pyrococcus spp., more preferably a P. furiosus, or can be produced using recombinant techniques, or chemically or enzymatically synthesized. Structural similarity may be determined, for example, using sequence techniques such as GCG FastA (Genetics Computer Group, Madison, Wis.), MacVector 4.5 (Kodak/IBI software package) or other suitable sequencing programs or methods known in the art. Preferably, structural similarity between two nucleotide sequences is determined using the Blastn program of the BLAST 2 search algorithm, as described by Tatusova, et al. (1999. FEMS Microbiol Lett. 174:247-250), and available through the World Wide Web, for instance at the internet site maintained by the National Center for Biotechnology Information, National Institutes of Health. Preferably, the default values for all BLAST 2 search parameters are used, including reward for match=1, penalty for mismatch=-2, open gap penalty=5, extension gap penalty=2, gap x_dropoff=50, expect=10, wordsize=11, and optionally, filter on. In the comparison of two nucleotide sequences using the BLAST search algorithm, structural similarity is referred to as "identities."

[0023]As used herein, an "isolated" substance is one that has been removed from its natural environment, produced using recombinant techniques, or chemically or enzymatically synthesized. For instance, a polypeptide, a polynucleotide, H₂, or NADPH can be isolated. Preferably, a substance is purified, i.e., is at least 60% free, preferably at least 75% free, and most preferably at least 90% free from other components with which it is naturally associated.

[0024]As used herein, the term "polynucleotide" refers to a polymeric form of nucleotides of any length, either ribonucleotides or deoxynucleotides, and includes both double- and single-stranded RNA and DNA. A polynucleotide can be obtained directly from a natural source, or can be prepared with the aid of recombinant, enzymatic, or chemical techniques. A polynucleotide can be linear or circular in topology. A polynucleotide may be, for example, a portion of a vector, such as an expression or cloning vector, or a fragment. A polynucleotide may include nucleotide sequences having different functions, including, for instance, coding regions, and non-coding regions such as regulatory regions.

[0025]As used herein, the terms "coding region," "coding sequence," and "open reading frame" are used interchangeably and refer to a nucleotide sequence that encodes a polypeptide and, when placed under the control of appropriate regulatory sequences expresses the encoded polypeptide. The boundaries of a coding region are generally determined by a translation start codon at its 5' end and a translation stop codon at its 3' end. A "regulatory sequence" is a nucleotide sequence that regulates expression of a coding sequence to which it is operably linked. Non-limiting examples of regulatory sequences include promoters, enhancers, transcription initiation sites, translation start sites, translation stop sites, and transcription terminators. The term "operably linked" refers to a juxtaposition of components such that they are in a relationship permitting them to function in their intended manner. A regulatory sequence is "operably linked" to a coding region when it is joined in such a way that expression of the coding region is achieved under conditions compatible with the regulatory sequence.

[0026]A polynucleotide that includes a coding region may include heterologous nucleotides that flank one or both sides of the coding region. As used herein, "heterologous nucleotides" refer to nucleotides that are not normally present flanking a coding region that is present in a wild-type cell. For instance, a coding region present in a wild-type microbe and encoding a polypeptide described herein is flanked by homologous sequences, and any other nucleotide sequence flanking the coding region is considered to be heterologous. Examples of heterologous nucleotides include, but are not limited to regulatory sequences. Typically, heterologous nucleotides are present in a polynucleotide described herein through the use of standard genetic and/or recombinant methodologies well known to one skilled in the art. A polynucleotide described herein may be included in a suitable vector.

[0027]As used herein, an "exogenous polynucleotide" refers to a polynucleotide that is not normally or naturally found in a microbe. As used herein, the term "endogenous polynucleotide" refers to a polynucleotide that is normally or naturally found in a cell microbe. An "endogenous polynucleotide " is also referred to as a "native polynucleotide."

[0028]The terms "complement" and "complementary" as used herein, refer to the ability of two single stranded polynucleotides to base pair with each other, where an adenine on one strand of a polynucleotide will base pair to a thymine or uracil on a strand of a second polynucleotide and a cytosine on one strand of a polynucleotide will base pair to a guanine on a strand of a second polynucleotide. Two polynucleotides are complementary to each other when a nucleotide sequence in one polynucleotide can base pair with a nucleotide sequence in a second polynucleotide. For instance, 5'-ATGC and 5'-GCAT are complementary. The term "substantial complement" and cognates thereof as used herein, refer to a polynucleotide that is capable of selectively hybridizing to a specified polynucleotide under stringent hybridization conditions. Stringent hybridization can take place under a number of pH, salt and temperature conditions. The pH can vary from 6 to 9, preferably 6.8 to 8.5. The salt concentration can vary from 0.15 M sodium to 0.9 M sodium, and other cations can be used as long as the ionic strength is equivalent to that specified for sodium. The temperature of the hybridization reaction can vary from 30° C. to 80° C., preferably from 45° C. to 70° C. Additionally, other compounds can be added to a hybridization reaction to promote specific hybridization at lower temperatures, such as at or approaching room temperature. Among the compounds contemplated for lowering the temperature requirements is formamide. Thus, a polynucleotide is typically substantially complementary to a second polynucleotide if hybridization occurs between the polynucleotide and the second polynucleotide. As used herein, "specific hybridization" refers to hybridization between two polynucleotides under stringent hybridization conditions.

[0029]As used herein, "genetically modified microbe" refers to a microbe which has been altered "by the hand of man." A genetically modified microbe includes a microbe into which has been introduced an exogenous polynucleotide, e.g., an expression vector. Genetically modified microbe also refers to a microbe that has been genetically manipulated such that endogenous nucleotides have been altered to include a mutation, such as a deletion, an insertion, a transition, a transversion, or a combination thereof. For instance, an endogenous coding region could be deleted. Such mutations may result in a polypeptide having a different amino acid sequence than was encoded by the endogenous polynucleotide. Another example of a genetically modified microbe is one having an altered regulatory sequence, such as a promoter, to result in increased or decreased expression of an operably linked endogenous coding region.

[0030]Conditions that are "suitable" for an event to occur, such as expression of an exogenous polynucleotide in a cell to produce a polypeptide, or production of molecular hydrogen or NADPH, or "suitable" conditions are conditions that do not prevent such events from occurring. Thus, these conditions permit, enhance, facilitate, and/or are conducive to the event.

[0031]The term "and/or" means one or all of the listed elements or a combination of any two or more of the listed elements.

[0032]The words "preferred" and "preferably" refer to embodiments of the invention that may afford certain benefits, under certain circumstances. However, other embodiments may also be preferred, under the same or other circumstances. Furthermore, the recitation of one or more preferred embodiments does not imply that other embodiments are not useful, and is not intended to exclude other embodiments from the scope of the invention.

[0033]The terms "comprises" and variations thereof do not have a limiting meaning where these terms appear in the description and claims.

[0034]Unless otherwise specified, "a," "an," "the," and "at least one" are used interchangeably and mean one or more than one.

[0035]Also herein, the recitations of numerical ranges by endpoints include all numbers subsumed within that range (e.g., 1 to 5 includes 1, 1.5, 2, 2.75, 3, 3.80, 4, 5, etc.).

[0036]For any method disclosed herein that includes discrete steps, the steps may be conducted in any feasible order. And, as appropriate, any combination of two or more steps may be conducted simultaneously.

BRIEF DESCRIPTION OF THE FIGURES

[0037]FIG. 1. Construction of anaerobic expression vector pC11A-CDABI.

[0038]FIG. 2. Construction of anaerobic expression vector pC3AR-slyD.

[0039]FIG. 3. Construction of anaerobic expression vector pEA-SHI.

[0040]FIG. 4. Construction of anaerobic expression vector pRA-EF.

[0041]FIG. 5. Immunoanalysis using antibodies to the catalytic subunit (PF0894). MW 1001 SHICDABIEFSlyD, MW 1001 containing the coding regions HypC, HypD, HypF, HypE, HypA, HypB, HycI, and SlyD. Native Pf SHI, native P. furiosus SHOI hydrogenase.

[0042]FIG. 6. QPCR analysis of the expression of exogenous coding regions in E. coli.

[0043]FIG. 7. Amino acid sequence and nucleotide sequence of the polypeptides and polynucleotides referenced in Table 1. Coding regions and deduced polypeptide sequences of Pyrococcus furiosus DSM3638 used herein. All P. furiosus DNA and predicted protein sequences were derived from the deposited Genbank sequence NC_--003413. Accession numbers refer to specific sections of this DNA sequence or the translated open reading frames encoded therein. Sequence identification numbers for these sequences are shown in Table 1.

[0044]FIG. 8. Maps and complete nucleotide sequences of four expression vectors. pEA-SH1, SEQ ID NO:29; pC11A-CDABI, SEQ ID NO:30; pRA-EF, SEQ ID NO:31; and pC3AR-slyD, SEQ ID NO:32.

[0045]FIG. 9. MV (methyl viologen)-linked hydrogenase activity of native versus recombinant P. furiosus soluble hydrogenase I.

[0046]FIG. 10. Production of MV-Linked Hydrogenase activity at 80° C. in recombinant E. coli MW/rSHI-C. The results from two separate cultures (one indicated by circles, one by triangles) are shown. The growth curves are shown by solid symbols.

[0047]FIG. 11. High Density 5-Liter Controlled Fermentation of E. coli MW/rSHI-C.

[0048]FIG. 12. Recombinant Hydrogenase Purification Scheme.

[0049]FIG. 13. SDS Gel Analysis of Recombinant Hydrogenase Purification. WCE, whole cell extract; S100, cytoplasmic extract after a 100,000×g centrifugation; DEAE pool, pool from DEAE Sepharose column; and PS pool, pool from Phenyl Sepharose column. The PF numbers and the calculated molecular weights for the four subunits of the hydrogenase are indicated.

[0050]FIG. 14. SDS Gel Analysis of Highly Purified Recombinant Hydrogenase. PS pool, pool from Phenyl Sepharose column; native SHI, native hydrogenase purified from P. furiosus; S200, Sepharcryl S-200 eluate; HAP, Hydroxyapatite eluate.

[0051]FIG. 15. Metal Analysis of Phenyl Sepharose fractions.

[0052]FIG. 16. Thermal Sensitivity of Recombinant Hydrogenase.

[0053]FIG. 17. Oxygen Sensitivity of Recombinant Hydrogenase.

[0054]FIG. 18. Expected Interactions Between Tetrameric Recombinant Hydrogenase and MV and NADPH.

[0055]FIG. 19. Expected Interactions Between Dimeric Recombinant Hydrogenase and MV and NADPH.

[0056]FIG. 20. pEA-0893/0894 (plasmid map and nucleotide sequence, SEQ ID NO:33).

[0057]FIG. 21. Alignments of each of the four subunits of P. furiosus hydogenase I and other related hydrogenases from P. abyssi, P. horikoshii, and Thermococcus kodakaraensis. In each alignment identical residues are not shaded, similar residues are boxed, and non-similar residues are shaded dark gray. In each alignment, PF, P. furiosus; PAB, P. abyssi; TK, Thermococcus kodakaraensis; and PH, P. horikoshii. The gene identifiers refer to the coding regions encoding each polypeptide. PF0891-PF0894 (SEQ ID NOs:2, 4, 6, and 8, respectively) refers to the coding regions present at Genbank Accession No. NC_--003413; PAB1784-PAB1787 (SEQ ID NOs:34, 35, 36, and 37, respectively) refers to the coding regions present at Genbank Accession No. AL096836; TK2069-TK2072 (SEQ ID NOs:38, 39, 40, and 41, respectively) refers to the coding regions present at Genbank Accession No. NC_--006624; and PH1290-1294 (SEQ ID NOs:42, 43, 44, and 45, respectively) refers to the coding regions present at Genbank Accession No. NC_--000961. A. Alignment of the beta subunits. B. Alignment of the gamma subunits. C. Alignment of the delta subunits. D. Alignment of the alpha subunits.

DETAILED DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS

[0058]The expression of a NiFe-hydrogenase from an extremophile is expected to be inactive and unfolded and consequently not stable when expressed in Escherichia coli. We expressed the catalytic subunit (SEQ ID NO:8) in E. coli and to our surprise found that the monomeric subunit was stable. However, the stable expression of one subunit did not indicate that the other structural and accessory proteins would also be stable, and it was expected that chaperones (to stabilize unfolded protein) would be required for the proper assembly of the NiFe site. Furthermore, successful heterologous expression, meaning expression (transcription and translation) of genes not normally found in a given cell, of genes that encode such a molecular machine as a NiFe-hydrogenase has not been possible, in part because there are a large number of accessory proteins involved in its assembly. Despite the fact that the host bacterium used here, E. coli synthesizes its own native hydrogenases (all integral membrane proteins) under anaerobic conditions, attempts to express the genes encoding hydrogenases from other organisms have typically not been done in E. coli, but rather in very closely related organisms (Bascones et al. 2000. Appl Environ Microbiol 66:4292-9; King et al. 2006. J Bacteriol 188:2163-72; Lenz et al. 2005. J Bacteriol 187:6590-5; Morimoto et al. 2005. FEMS Microbiology Letters 246:229-34; Porthun et al. 2002. Arch Microbiol 177:159-66; Rousset et al. 1998. Journal of Bacteriology 180:4982-4986). Only recently have attempts been made to express hydrogenases (from Synechocystis sp.) in E. coli (Maeda et al. 2007. BMC Biotechnol 7:25) and this apparently only has the effect of limiting H₂ uptake in the recombinant strains. Proteins playing a role in the assembly of NiFe hydrogenases in E. coli have been extensively characterized (Bock et al. 2006. Adv Microb Physiol 51:1-71), and homologs of the genes encoding eight of these proteins exist in P. furiosus. Described herein is a system for successful heterologous overexpression of a functional and tagged hyperthermophilic NiFe hydrogenase under anaerobic conditions in the common laboratory protein expression host bacterium E. coli, using the heterologously-expressed accessory proteins from P. furiosus while simultaneously expressing those encoding the protein components of P. furiosus hydrogenase.

[0059]Provided herein are polypeptides having hydrogenase activity. Such polypeptides may be referred to herein as hydrogenase polypeptides. A polypeptide having hydrogenase activity may include four subunits. The first subunit includes the amino acid sequence SEQ ID NO:2, or an amino acid sequence having structural similarity thereto, the second subunit includes the amino acid sequence SEQ ID NO:4 or an amino acid sequence having structural similarity thereto, the third subunit includes the amino acid sequence SEQ ID NO:6 or an amino acid sequence having structural similarity thereto, and the fourth subunit includes the amino acid sequence SEQ ID NO:8 or an amino acid sequence having structural similarity thereto. Such a polypeptide may be isolated from a microbe, such as thermophiles (prokaryotic microbes that grow in environments at temperatures of between 60° C. and 79° C.), and hyperthermophiles (prokaryotic microbes that grow in environments at temperatures above 80° C.). Examples include archaea such as, but not limited to, a member of the genera Pyrococcus, for instance P. furiosus, P. abyssi, or P. horikoshii, or a member of the genera Thermococcus, for instance, T. kodakaraensis or T. onnurineus, or may be produced using recombinant techniques, or chemically or enzymatically synthesized.

[0060]A polypeptide provided herein also includes various subcomplexes. A subcomplex is defined as an engineered version of the hydrogenase polypeptide containing less than the natively purified four subunits. For example, a subcomplex may be the alpha subunit alone (SEQ ID NO: 8), the alpha subunit with one other subunit, (SEQ ID NO: 6, 4 or 2), or the alpha subunit with some combination of the two other subunits. Accordingly, a hydrogenase polypeptide may be monomeric, dimeric, trimeric, or tetrameric. One example of a a hydrogenase polypeptide has 2 subunits, a first subunit that includes the amino acid sequence SEQ ID NO:8, or an amino acid sequence having structural similarity thereto, and a second subunit that includes the amino acid sequence SEQ ID NO:6 or an amino acid sequence having structural similarity thereto.

[0061]The hydrogenase activity of a hydrogenase polypeptide of the present invention may be determined by routine methods known in the art. Preferably, a hydrogen evolution assay is used as described herein. For instance, a cell extract may be tested for hydrogen evolution after preparation of a whole cell extract, centrifugation at 100,000×g, heat-treatment at 80° C. for 30 minutes, and re-centrifugation at 100,000×g (referred to as an S100 fraction). The standard assay conditions may include using 5 mL stoppered vials containing 2 mL of anaerobic 100 mM EPPS buffer pH 8.4, 10 mM sodium dithionite, and 1 mM Methyl Viologen under an atmosphere of argon. Typically, 0.5 milligrams of protein is added when measuring the activity of protein from an 80° C.-treated S100 fraction, and no greater than 0.005 milligrams of protein is added when measuring the activity of protein from a column, such as a DEAF Sepharose and/or Phenyl Sepharose column. The vials are preheated at 80° C. for 1 minute, and 200 μL of sample is injected into the vial. After a period of time, for instance, 6 minutes, samples (100 μL) of the headspace of the sealed vial can be removed with a gas-tight syringe, and then injected into a gas chromatograph. The resulting hydrogen peak can be compared to a known standard curve to calculate micromoles of hydrogen produced per mL of assay solution. The specific activity is at least 0.05, at least 0.1, or at least 0.125 micromoles H₂ produced min^-1 mg protein^-1. If the hydrogenase polypeptide is is further purified, for instance using column chromatography with DEAF Sepharose or a similar matrix, and Phenyl Sepharose or a similar matrix, as described herein, the specific activity is at least 0.5, at least 1, least 5, or at least 7.5 micromoles H₂ produced min^-1 mg protein^-1. A hydrogenase polypeptide described herein that is to be tested may be expressed in a microbe, preferably an E. coli described herein, or produced using recombinant techniques, chemical or enzymatic synthesis. If the hydrogenase polypeptide is expressed in a microbe, preferably the microbe has undetectable levels of endogenous hydrogenase activity. Since most microbes do naturally express hydrogenase activity, microbes useful for expression of the hydrogenase polypeptides described herein may be engineered to not express endogenous hydrogenase activity. An example of such a microbe is MW1001 (Maeda et al. 2007. BMC Biotechnol 7:25). Other microbes can be engineered using methods known in the art to not express endogenous hydrogenase activity.

[0062]A hydrogenase polypeptide described herein typically has additional characteristics, including heat activation. A hydrogenase polypeptide described herein is typically activated by incubation at an elevated temperature. For instance, if a hydrogenase polypeptide is produced at temperatures prevalent when using E. coli to produce the polypeptide, e.g., 37° C., the specific activity can be increased by incubation at a temperature of at least 70° C., or at least 80° C. A hydrogenase polypeptide described herein also has the characteristic of being stable stable to incubation at high temperature. For instance, a hydrogenase polypeptide described herein does not lose any of its activity after incubation 90° C. for 10 hours. A hydrogenase polypeptide described herein also has the characteristic of being as sensitive to oxygen as the native form of the enzyme purifed from P. furiosus. A hydrogenase polypeptide described herein that has hydrogenase activity catalyzes the proton reduction (H₂ production) coupled to the oxidation of an electron donor, such as NADPH, and also catalyzes the reverse, i.e., the oxidation of H₂ coupled to the reduction of an electron acceptor, such as NADP. Another reaction that may be catalyzed by hydrogenase polypeptides described herein is the reduction of elemental sulfur to hydrogen sulfide with the use of molecular hydrogen (Kim et al. 1999. Biotechnol. Bioeng. 65:108-113; Ma et al., Proc. Nat. Acad. Sci. USA. 90:5341-5344).

[0063]A candidate polypeptide having structural similarity to a reference polypeptide may include conservative substitutions of amino acids present in the reference polypeptide. A conservative substitution is typically the substitution of one amino acid for another that is a member of the same class. For example, it is well known in the art of protein biochemistry that an amino acid belonging to a grouping of amino acids having a particular size or characteristic (such as charge, hydrophobicity, and/or hydrophilicity) can generally be substituted for another amino acid without substantially altering the secondary and/or tertiary structure of a polypeptide. For the purposes of this invention, conservative amino acid substitutions are defined to result from exchange of amino acids residues from within one of the following classes of residues: Class I: Gly, Ala, Val, Leu, and Ile (representing aliphatic side chains); Class II: Gly, Ala, Val, Leu, Ile, Ser, and Thr (representing aliphatic and aliphatic hydroxyl side chains); Class III: Tyr, Ser, and Thr (representing hydroxyl side chains); Class IV: Cys and Met (representing sulfur-containing side chains); Class V: Glu, Asp, Asn and Gln (carboxyl or amide group containing side chains); Class VI: His, Arg and Lys (representing basic side chains); Class VII: Gly, Ala, Pro, Trp, Tyr, Ile, Val, Leu, Phe and Met (representing hydrophobic side chains); Class VIII: Phe, Trp, and Tyr (representing aromatic side chains); and Class IX: Asn and Gln (representing amide side chains).

[0064]There are eight major groups of hydrogenase based on sequence similarities of their catalytic subunits (Vignais and Billoud. 2007. Chem Rev 107:4206-72). Hydrogenase polypeptides described herein are members of group 3b, the bidirectional NAD(P)-linked hydrogenases, and include, for instance, those found in other Pyrococcus and closely related species, e.g., Thermococcus, and also in photosynthetic bacteria (Thiocapsa) and aerobic hydrogen bacteria (Ralstonia). All [NiFe] hydrogenases (from all groups) are characterized by two CxxC domains, termed L1 and L2, that coordinate the Ni and Fe atom at the catalytic site of the catalytic subunit, alpha, an example of which is shown at SEQ ID NO:8. Each of the groups has conserved sequences surrounding these sites. The consensus L1 site is R[IV]C[AGS][FIL]Cxxx[HY]xx[AST][ANS]xx[AS][AILV] (SEQ ID NO:46), where x is any amino acid, and where one amino acid is chosen from each set enclosed by brackets (e.g., the second amino acid of the consensus is I or V). Examples of L1 sites include, but are not limited to, RICSFCSAAHKLTALEAA (SEQ ID NO:47), and RVCGICSAAHKLTALEAA (SEQ ID NO:48). The consensus L2 site is R[ANS][FHY]DPCISC[AS][ATV]H (SEQ ID NO:49), where one amino acid is chosen from each set enclosed by brackets (e.g., the second amino acid of the consensus is A or N or S). In both L1 and L2 sites, the change of any of the four cysteines is expected to result in a decrease or complete loss of hydrogenase activity. Further, regions of conservation can be determined by comparison of the amino acid sequences of each subunit (SEQ ID NO:2, 4, 6, or 8) with other hydrogenase subunits from other organisms (see FIG. 21). Thus, the skilled person can easily determine which amino acid residues can be altered without any effect on hydrogenase activity, and which cannot be changed or can be altered only through use of conservative substitutions.

[0065]Guidance concerning how to make phenotypically silent amino acid substitutions is provided in Bowie et al. (1990. Science, 247:1306-1310), wherein the authors indicate proteins are surprisingly tolerant of amino acid substitutions. For example, Bowie et al. disclose that there are two main approaches for studying the tolerance of a polypeptide sequence to change. The first method relies on the process of evolution, in which mutations are either accepted or rejected by natural selection. The second approach uses genetic engineering to introduce amino acid changes at specific positions of a cloned gene and selects or screens to identify sequences that maintain functionality. As stated by the authors, these studies have revealed that proteins are surprisingly tolerant of amino acid substitutions. The authors further indicate which changes are likely to be permissive at a certain position of the protein. For example, most buried amino acid residues require non-polar side chains, whereas few features of surface side chains are generally conserved. Other such phenotypically silent substitutions are described in Bowie et al, and the references cited therein.

[0066]A candidate polypeptide having structural similarity to one of the polypeptides SEQ ID NO:2, 4, 6, or 8 has hydrogenase activity when expressed in a microbe with the other 3 reference structural polypeptides and the other 8 reference accessory polypeptides (SEQ ID NO:s:10, 12, 14, 16, 18, 20, 22, and 24, described in detail below). For instance, when determining if a candidate polypeptide having some level of identity to SEQ ID NO:2 has hydrogenase activity, the candidate polypeptide is expressed in a microbe with reference polypeptides SEQ ID NO: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, and 24. Likewise, when determining if a candidate polypeptide having some level of identity to SEQ ID NO:4 has hydrogenase activity, the candidate polypeptide is expressed in a microbe with reference polypeptides SEQ ID NO: 2, 6, 8, 10, 12, 14, 16, 18, 20, 22, and 24, and so on for determining hydrogenase activity of candidate polypeptides having identity to each of the other structural or accessory polypeptides.

[0067]P. furiosus contains a second hydrogenase (SH-II) that is highly similar to the hydrogenase polypeptides described herein. SH-II was purified from native biomass of P. furiosus (Ma et al., 2000. J Bacteriol. 182(7):1864-71). It has very similar catalytic properties, and virtually identical physical properties to those of the hydrogenase polypeptides described herein. It contains four subunits of very similar size to those of the hydrogenase polypeptides described herein and these are predicted to coordinate exactly the same cofactors as the subunits of the hydrogenase polypeptides described herein. However, the sequences show only 55-63% sequence similarity. Nevertheless, P. furiosus has only one set of accessory genes to process and mature a hydrogenase, and so it is predicted that the set of accessory coding regions described herein that are used by P. furiosus to process the hydrogenase polypeptides described herein must also be used by the organism to process SH-II. Despite the apparent lack of sequence similarity the SH-I alpha and SH-II alpha subunits share a high degree of identity in the conserved L2 region and the C-terminal sequence that is cleaved for hydrogenase activity. Therefore, it is expected that the E. coli expression system described herein, which includes the accessory genes of P. furiosus, would also process and produce an active form of SH-II. In this case the plasmid containing the four SH-I genes would be replaced in E. coli by one containing the four SH-II genes.

[0068]Also provided are isolated polynucleotides encoding the polypeptides described herein. For instance, a polynucleotide may have a nucleotide sequence encoding a polypeptide having the amino acid sequence shown in SEQ ID NOs:2, 4, 6, or 8, and an example of the class of nucleotide sequences encoding each polypeptide is SEQ ID NOs:1, 3, 5, 7, respectively. It should be understood that a polynucleotide encoding a polypeptides represented by one of the sequences disclosed herein, e.g., SEQ ID NOs:2, 4, 6, or 8, is not limited to the nucleotide sequence disclosed at the polynucleotide sequences disclosed herein, e.g., SEQ ID NOs:1, 3, 5, or 7, respectively, but also includes the class of polynucleotides encoding such polypeptides as a result of the degeneracy of the genetic code. For example, the naturally occurring nucleotide sequence SEQ ID NO:1 is but one member of the class of nucleotide sequences encoding a polypeptide having the amino acid sequence SEQ ID NO:2. Likewise, the naturally occurring nucleotide sequences SEQ ID NO:3, 5, or 7, are but single members of the class of nucleotide sequences encoding a polypeptide having the amino acid sequence SEQ ID NO:4, 6, or 8, respectively. The class of nucleotide sequences encoding a selected polypeptide sequence is large but finite, and the nucleotide sequence of each member of the class may be readily determined by one skilled in the art by reference to the standard genetic code, wherein different nucleotide triplets (codons) are known to encode the same amino acid.

[0069]A polynucleotide disclosed herein may have structural similarity with the nucleotide sequence of SEQ ID NO:1, 3, 5, or 7. Such a polynucleotide may be isolated from a microbe, such as thermophiles (prokaryotic microbes that grow in environments at temperatures of between 60° C. and 79° C.), and hyperthermophiles (prokaryotic microbes that grow in environments at temperatures above 80° C.). Examples include archaea such as, but not limited to, a member of the genera Pyrococcus, for instance P. furiosus, P. abyssi, or P. horikoshii, or a member of the genera Thermococcus, for instance, T. kodakaraensis or T. onnurineus, or may be produced using recombinant techniques, or chemically or enzymatically synthesized. A polynucleotide disclosed herein may further include heterologous nucleotides flanking the open reading frame. Typically, heterologous nucleotides may be at the 5' end of the coding region, at the 3' end of the coding region, or the combination thereof. The number of heterologous nucleotides may be, for instance, at least 10, at least 100, or at least 1000.

[0070]An aspect of the present invention also includes fragments of the polypeptides described herein, and the polynucleotides encoding such fragments, such as SEQ ID NOs:2, 4, 6, and 8, as well as those polypeptides having structural similarity to SEQ ID NOs: 2, 4, 6, and 8. A polypeptide fragment may include a sequence of at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 55, at least 60, at least 65, at least 70, at least 75, at least 80, at least 85, at least 90, at least 95, or at least 100 amino acid residues.

[0071]A polypeptide described herein or a fragment thereof may be expressed as a fusion polypeptide that includes a polypeptide of the present invention or a fragment thereof and a heterologous amino acid sequence. The heterologous amino acid sequence may be present at the amino terminal end or the carboxy terminal end of a polypeptide, or it may be present within the amino acid sequence of the polypeptide. For instance, the heterologous amino acid sequence may be useful for purification of the fusion polypeptide by affinity chromatography. Various methods are available for the addition of such affinity purification tags to proteins. Examples of tags include a polyhistidine-tag, maltose-binding protein, and Strep-tag®. Representative examples may be found in Hopp et al. (U.S. Pat. No. 4,703,004), Hopp et al. (U.S. Pat. No. 4,782,137), Sgarlato (U.S. Pat. No. 5,935,824), Sharma (U.S. Pat. No. 5,594,115, and Skerra and Schmidt, 1999, Biomol Eng. 16:79-86). In another example, the heterologous amino acid sequence may be a carrier polypeptide. The carrier polypeptide may be used to increase the immunogenicity of the fusion polypeptide to increase production of antibodies that specifically bind to a polypeptide of the invention. The invention is not limited by the types of carrier polypeptides that may be used to create fusion polypeptides. Examples of carrier polypeptides include, but are not limited to, keyhole limpet hemacyanin, bovine serum albumin, ovalbumin, mouse serum albumin, rabbit serum albumin, and the like. The heterologous amino acid sequence, for instance, a tag or a carrier, may also include a cleavable site that permits removal of most or all of the additional amino acid sequence. Examples of cleavable sites are known to the skilled person and routinely used, and include, but are not limited to, a TEV protease recognition site. The number of heterologous amino acids may be, for instance, at least 5, at least 10, at least 15, at least 20, at least 25, at least 30, at least 35, or at least 40.

[0072]A polypeptide described herein may be modified. An example of a modification is a chemical modification with a hydrophobic group. Examples of suitable hydrophobic groups include, but are not limited to, polyethylene glycol derivatives, such as polyoxyethylene glycol p-nitrophenyl carbonate (PEG-pNPC), methoxypolyethylene glycol p-nitrophenyl carbonate (MPEG-pNPC), and methoxypolyethylene glycol cyanuric chloride (MPEG-CC). Preferably, the molecular weight of a polyethylene glycol derivative is less than 5 KDa. Methods for chemically modifying polypeptides are routine and known in the art. Such modified polypeptides can have altered characteristics such as increased solubility in organic solvents while retaining enzymatic activity. An example is modification of a polypeptide described herein is taught by Kim et al. (1999. Biotechnol. Bioeng. 65:108-113), where an SH-I hydrogenase polypeptide obtained from P. furiosus was modified with MPEG-CC. The resulting polypeptide retained the ability to reduce elemental sulfur to hydrogen sulfide (Ma et al., Proc. Nat. Acad. Sci. USA. 90:5341-5344).

[0073]A polynucleotide disclosed herein can be present in a vector. A vector is a replicating polynucleotide, such as a plasmid, phage, or cosmid, to which another polynucleotide may be attached so as to bring about the replication of the attached polynucleotide. Construction of vectors containing a polynucleotide of the invention may employ standard ligation techniques known in the art. See, e.g., (Sambrook et al., 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.). A vector can provide for further cloning (amplification of the polynucleotide), i.e., a cloning vector, or for expression of the polynucleotide, i.e., an expression vector. The term vector includes, but is not limited to, plasmid vectors, viral vectors, cosmid vectors, and artificial chromosome vectors. Preferably the vector is a plasmid.

[0074]Selection of a vector depends upon a variety of desired characteristics in the resulting construct, such as a selection marker, vector replication rate, and the like. Vectors can be introduced into a host cell using methods that are known and used routinely by the skilled person. The vector may replicate separately from the chromosome present in the microbe, or the polynucleotide may be integrated into a chromosome of the microbe.

[0075]An expression vector may optionally include a promoter that results in expression of an operably linked coding regino during growth in anaerobic conditions. Promoters act as regulatory signals that bind RNA polymerase in a cell to initiate transcription of a downstream (3' direction) coding region. The promoter used may be a constitutive or an inducible promoter. It may be, but need not be, heterologous with respect to a host cell. Examples of suitable promoters include, but are not limited to, P-hya (SEQ ID NO:25), P-hyc (SEQ ID NO:26), and P-xyl (SEQ ID NO:27). The hydrogenase promoters P-hya and P-hyc can be obtained from E. coli, and are expressed (and at different strengths) under anaerobic growth conditions and at undetectable levels under aerobic growth conditions. The xylose responsive promoter P-xyl is a slightly modified version of the B. megaterium xylose promoter (Qazi et al. 2001. Microb Ecol 41:301-309) denoted PxylA (Rygus et al. 1991. Arch Microbiol 155:535-42) (P-xyl, SEQ ID NO:27). This xylose promoter was discovered to be useful for expressing genes in E. coli under either aerobic or anaerobic conditions. This is a promoter sequence derived from an aerobic, gram positive organism (rather than from E. coli, which is a facultatively anaerobic gram negative organism), and it was not expected that this would function in E. coli. Fortuitiously, we discovered that in E. coli it expresses at very high levels under both aerobic and anaerobic conditions.

[0076]It should be understood that a promoter that drives expression of an operably linked coding region during growth in anaerobic conditions is not limited to the nucleotide sequences disclosed at SEQ ID NOs:25, 26, or 27. A person of ordinary skill will understand that the promoters disclosed herein may be modified by substitution (such as transition or transversion), deletion, and/or insertion of one or more nucleotides, where the altered promoter maintains its ability to drive expression of an operably linked coding region during growth in anaerobic conditions. Such modified promoters can be easily constructed using routine methods known in the art such as classical mutagenesis, site-directed mutagenesis, and DNA shuffling. Other useful promoters can be obtained from the genomes of microbes by reference to the regions upstream of coding sequences that are expressed under anaerobic conditions, such as coding regions encoding hydrogenase enzymes or involved in anaerobic respiration.

[0077]A vector introduced into a host cell optionally includes one or more marker sequences, which typically encode a molecule that inactivates or otherwise detects or is detected by a compound in the growth medium. For example, the inclusion of a marker sequence may render the transformed cell resistant to an antibiotic, or it may confer compound-specific metabolism on the transformed cell. Examples of a marker sequence include, but are not limited to, sequences that confer resistance to kanamycin, ampicillin, chloramphenicol, tetracycline, streptomycin, and neomycin.

[0078]Provided herein is a series of expression vectors which express recombinant proteins under strictly anaerobic growth conditions in a microbe, preferably E. coli. No E. coli protein expression vectors currently used are capable of this. In fact, most E. coli expression systems use a modified bacteriophage T7 promoter, regulated by a modification of the E. coli lactose operon repressor, so that expression of target genes can be induced by addition of lactose or the lactose homolog isopropyl-β-D-thiogalactopyranoside (IPTG) (Studier, F. W. 2005. Protein Expr Purif 41:207-34; Terpe, 2006. Appl Microbiol Biotechnol 72:211-22). However, this system does not operate under strictly anaerobic conditions and herein we utilized promoters that E. coli uses when grown in the absence of air. The expression vectors include a P-hly, P-hlc, or P-xyl promoter. An expression vector may include other polynucleotides that aid in, for instance, the cloning, manipulation, or expression of an operably linked coding region, or the purification of a polypeptide encoded by the coding region.

[0079]Polypeptides and fragments thereof described herein may be produced using recombinant DNA techniques, such as an expression vector present in a cell. Such methods are routine and known in the art. The polypeptides and fragments thereof may also be synthesized in vitro, e.g., by solid phase peptide synthetic methods. Solid phase peptide synthetic methods are routine and known in the art. A polypeptide produced using recombinant techniques or by solid phase peptide synthetic methods may be further purified by routine methods, such as fractionation on immunoaffinity or ion-exchange columns, ethanol precipitation, reverse phase HPLC, chromatography on silica or on an anion-exchange resin such as DEAE, chromatofocusing, SDS-PAGE, ammonium sulfate precipitation, gel filtration using, for example, Sephadex G-75, or ligand affinity. A preferred method for isolating and optionally purifiying a hydrogenase polypeptide described herein includes column chromatography using, for instance, ion exchange chromatography, such as DEAE sepharose, hydrophobic interaction chromatography, such as phenyl sepharose, or the combination thereof.

[0080]Polynucleotides of the present invention may be obtained from microbes, or produced in vitro or in vivo. For instance, methods for in vitro synthesis include, but are not limited to, chemical synthesis with a conventional DNA/RNA synthesizer. Commercial suppliers of synthetic polynucleotides and reagents for such synthesis are well known.

[0081]Also disclosed herein are genetically modified microbes that have exogenous polynucleotides encoding one or more of the polypeptides disclosed herein. Compared to a control microbe that is not genetically modified, a genetically modified microbe may exhibit production of a hydrogenase polypeptide, such as a tetrameric or a dimeric hydrogenase polypeptide. Accordingly, in one aspect of the invention a genetically modified microbe may include one or more exogenous polynucleotides that encode the subunits of a hydrogenase polypeptide. Exogenous polynucleotides encoding a hydrogenase polypeptide may be present in the microbe as a vector or integrated into a chromosome.

[0082]Examples of useful bacterial host cells include, but are not limited to, Escherichia (such as Escherichia coli), Salmonella (such as Salmonella enterica, Salmonella typhi, Salmonella typhimurium), a Thermotoga spp. (such as T. maritime), an Aquifex spp (such as A. aeolicus), photosynthetic organisms including cyanobacteria (such as a Synechococcus spp. such as Synechococcus sp. WH8102 or Synechocystis spp. such as Synechocystis PCC 6803) and photosynthetic bacteria (such as a Rhodobacter spp. such as Rhodobacter sphaeroides) and the like. Examples of useful archaeal host cells include, but are not limited to a Pyrococcus spp., such as P. furiosus, P. abyssi, and P. horikoshii, a Sulfolobus spp, such as S. solfataricus, a Thermococcus spp., such as T. kodakaraensis, and the like.

[0083]A genetically modified microbe having exogenous polynucleotides encoding one or more of the polypeptides disclosed herein may optionally include accessory polypeptides. These accessory polypeptides act to assemble the hydrogenase polypeptides described herein. Without intending to be limiting, it is believed the accessory polypeptides play a role in constructing the non-protein ligands present in the hydrogenase polypeptides. The accessory polypeptides include a first accessory polypeptide having the amino acid sequence SEQ ID NO:10 or an amino acid sequence having structural similarity thereto, a second accessory polypeptide having the amino acid sequence SEQ ID NO:12 or an amino acid sequence having structural similarity thereto, a third accessory polypeptide having the amino acid sequence SEQ ID NO:14 or an amino acid sequence having structural similarity thereto, a fourth accessory polypeptide having the amino acid sequence SEQ ID NO:16 or an amino acid sequence having structural similarity thereto, a fifth accessory polypeptide having the amino acid sequence SEQ ID NO:18 or an amino acid sequence having structural similarity thereto, a sixth accessory polypeptide having the amino acid sequence SEQ ID NO:20 or an amino acid sequence having structural similarity thereto, a seventh accessory polypeptide having the amino acid sequence SEQ ID NO:22 or an amino acid sequence having structural similarity thereto, and an eighth accessory polypeptide having the amino acid sequence SEQ ID NO:24 or an amino acid sequence having structural similarity thereto. Preferably, an exogenous polynucleotide encoding an accessory polypeptide is operably linked to a promoter that drives expression of the polynucleotide during growth in anaerobic conditions.

[0084]Also provided herein are isolated polypeptides having the amino acid sequence SEQ ID NOs:10, 12, 14, 16, 18, 20, 22, and 24, and amino acid sequences having structural similarity thereto, and isolated polynucleotides encoding the polypeptides.

[0085]A candidate polypeptide having structural similarity to one of the accessory polypeptides (SEQ ID NOs: 10, 12, 14, 16, 18, 20, 22, or 24) has activity when expressed in a microbe with the 4 reference polypeptides encoding a tetrameric hydrogenase polypeptide and the other 7 reference accessory polypeptides. For instance, when determining if a candidate polypeptide having some level of identity to SEQ ID NO:10 has the activity of catalyzing the biosynthesis of an active hydrogenase polypeptide, the candidate polypeptide is expressed in a microbe with reference polypeptides SEQ ID NO: 2, 4, 6, 8, 12, 14, 16, 18, 20, 22, and 24. Likewise, when determining if a candidate polypeptide having some level of identity to SEQ ID NO:12 has the activity of catalyzing the biosynthesis of an active hydrogenase polypeptide, the candidate polypeptide is expressed in a microbe with reference polypeptides SEQ ID NO: 2, 4, 6, 8, 10, 14, 16, 18, 20, 22, and 24, and so on.

[0086]In another aspect a genetically modified microbe may express an endogenous hydrogenase polypeptide at an increased level or having altered activity. For instance, a genetically modified microbe may include an altered regulatory sequence, where the altered regulatory sequence is operably linked to one or more coding regions encoding subunits of a hydrogenase polypeptide. In another example, an endogenous polynucleotide encoding a subunit of a hydrogenase polypeptide may include a mutation, such as a deletion, an insertion, a transition, a transversion, or a combination thereof, that alters a characteristic of the hydrogenase polypeptides, such as the activity. In those aspects where a genetically modified microbe expresses an endogenous hydrogenase polypeptide at an increased level or having altered activity, the microbe is typically an archaea, such as Pyrococcus spp., such as P. furiosus, P. abyssi, and P. horikoshii, a Thermococcus spp., such as T. kodakaraensis and T. onnurineus, and the like. Methods for modifying genomic DNA sequences of thermophiles and hyperthermophiles are known (Yang et al., PCT Application No. PCT/US2008/081157, filed Oct. 24, 2008, and Westpheling et al., U.S. Provisional Patent Application 61/000,338, filed Oct. 25, 2007).

[0087]A genetically modified microbe may include other modifications in addition to exogenous polynucleotides encoding one or more of the polypeptides disclosed herein, or expressing an endogenous hydrogenase polypeptide at an increased level or having altered activity. Such modifications may provide for increased production of electron donors used by a hydrogenase polypeptide described herein, such as NADPH. For instance, modifications may provide for increased levels in a cell of the enzymes used in the oxidative phase of the pentose phosphate pathway, such as glucose 6-phosphate dehydrogenase, 6-phosphogluconolactonase, and 6-phosphogluconate dehydrogenase. Modifications may provide for increased levels of substrates used in the oxidative phase of the pentose phosphate pathway by, for instance, increasing production of enzymes in biosynthetic pathways, reducing feedback inhibition at different locations in biosynthetic pathways, increasing importation of substrates and/or compounds used in biosynthetic pathways to make substrates, decreasing catabolism of substrates and/or compounds used in biosynthetic pathways to make substrates. Methods for modifying microbes to increase these and other compounds are routine and known in the art.

[0088]A genetically modified microbe of the present invention may include other modifications that provide for increased ability to use renewable resources, such as, but not limited to, biomass containing polysaccharides that can be broken down to yield glucose 6-phosphate, the first reactant of the pentose phosphate pathway and the substrate of the enzyme glucose 6-phosphate dehydrogenase. An example of such a polysaccharide is starch. Such modifications may provide for increased production of enzymes useful in the breakdown of biomass.

[0089]The hydrogenase polypeptides described herein can be used to produce molecular hydrogen. Molecular hydrogen is used in the petroleum and chemical industries. For instance, in a petrochemical plant, hydrogen is used for hydrodealkylation, hydrodesulfurization, and hydrocracking, all methods of refining crude oil for wider use. Molecular hydrogen is used for the production of ammonia, methanol, hydrochloric acid, and as a reducing agent for metal ores. In the food industry molecular hydrogen is used for hydrogenation of vegetable oils and fats, for instance, in producing margarine from liquid vegetable oil. Hydrogen is also useful as a fuel, both in traditional combustion engines as well as in fuel cells, and produces only water vapor when oxidized with oxygen.

[0090]In addition to hydrogen production systems, the applications for hydrogenase polypeptides described herein include cofactor [beta-1,4-nicotinamide adenindinucleotide, reduced form (NADH) or beta-1,4-nicotinamide adenindinucleotide phosphate, reduced form (NADPH)] regeneration (from NAD or NADP, respectively) using hydrogen as the source of energy (Hummel, 1999. Trends Biotechnol. 17:487-492; Mertens et al,. 2003. J. Mol. Catal. B: Enzym. 24-25:39-52). The hydrogenase polypeptides described herein have significant advantages over other enzymatic methods to regenerate these reduced cofactors as there is no oxidation product to remove or dispose of other than protons (from hydrogen oxidation). This is in contrast to, for example, lactate dehydrogenase, where lactate is the source of energy and the product is the C3 compound pyruvate (Eberly and Ely, 2008. Crit. Rev. Microbiol. 34:117-130). Cofactor regeneration using hydrogen with no waste products would be of tremendous benefit for the pharmaceutical industry.

[0091]Hydrogenase polypeptides obtained from P. furiosus have also been chemically modified such that the enzyme is soluble and active in water-immicible organic solvents such as toluene (Kim et al. 1999. Biotechnol. Bioeng. 65:108-113). Hydrogenase polypeptides described herein can also be chemically modified. Thus, the polypeptides described herein can reduce water-insoluble compounds with hydrogen. For example, elemental sulfur can be reduced to H₂S, which is useful in removal of sulfur from some compositions used in the petroleum and coal industries.

[0092]Accordingly, provided herein are methods for making and using the hydrogenase polypeptides of the present invention. Methods for making a polypeptide having hydrogenase activity can include providing a genetically modified microbe that includes exogenous polynucleotides encoding 1, 2, 3, or 4 subunits of a hydrogenase polypeptide described herein, preferably 2 or 4 subunits, and incubating the microbe under conditions suitable for expression of the exogenous polynucleotides to produce a polypeptide, wherein the polypeptide has hydrogenase activity. The genetically modified microbe can be a bacterial cell, such as a gram negative, for instance, E. coli, or it can be an archaeal cell, for instance, a member of the genera Pyrococcus, for instance P. furiosus, P. abyssi, or P. horikoshii, or a member of the genera Thermococcus, for instance, T. kodakaraensis or T. onnurineus, or a photosynthetic bacterium; for instance, Rhodobacter sphaeroides. The genetically modified microbe may include exogenous polynucleotides encoding the accessory polypeptides described herein. In those aspects where the genetically modified microbe is a bacterial cell, such as E. coli, the genetically modified microbe typically does include exogenous polynucleotides encoding the accessory polypeptides. The incubation conditions are typically anaerobic, and the temperature may be at least 37° C., at least 60° C., at least 70° C., at least 80° C., or at least 90° C. The methods can be performed using any convenient manner. For instance, methods for growing microbial cells to high densities are routine and known in the art, and include batch and continuous fermentation processes. The method may further include isolating, and optionally purifying the hydrogenase polypeptide. Methods for isolating and optionally purifying hydrogenase polypeptides described herein are routine and known in the art.

[0093]Also provided herein are methods for using a hydrogenase polypeptide described herein. The methods can include providing a hydrogenase polypeptide, and incubating the hydrogenase polypeptide under conditions suitable for producing desirable products such as H₂ or NADPH. Optionally, the product is collected using methods routine and known in the art.

[0094]In one aspect, the hydrogenase polypeptide used in the methods is cell-free, for instance, it is isolated, or optionally purified. Conditions suitable for incubating an isolated hydrogenase polypeptide may generally include aqueous conditions containing a suitable buffer, such as, but not limited to, EPPS (4-(2-hydroxyethyl)piperazine-1-propanesulfonic acid) at a concentration of 50 mM and buffered near neutral pH (typically 7.5-8.5). The hydrogenase polypeptide may be incubated in an organic solvent, such as, but not limited to, toluene, xylene, benzene, methylene chloride, chloroform, or tetrahydrofuran. A hydrogenase polypeptide that is incubated in an organic solvent is typically chemically modified, preferably with a hydrophobic group, as described herein. The incubation conditions are typically anaerobic, and the temperature may be at least 60° C., at least 70° C., at least 80° C., or at least 90° C. The methods can be performed in any convenient manner. Thus, the reaction steps may be performed in a single reaction vessel. The process may be performed as a batch process or as a continuous process, with desired product and waste products being removed continuously and new raw materials being introduced.

[0095]Methods for using an isolated hydrogenase polypeptide include the use of such a polypeptide bound to a surface. In some aspects the surface can be one that conducts electricity, such as an anode. Hydrogenase polypeptides bound to surfaces are useful for applications such as, but not limited to, fuel cells (Armstrong, U.S. Published Patent Application 20040214053).

[0096]Methods for using an isolated hydrogenase polypeptide include production of desirable products, such as molecular hydrogen, using renewable resources. For instance, biomass derived polysaccharides can be used as a substrate for the production of monomeric carbohydrates that could then be used as a source of NADPH, which in turn can be used by a hydrogenase polypeptide disclosed herein to produce hydrogen. Examples of such methods include in vitro hydrogen production as taught by Woodward et al. (1996. Nat Biotechnol 14:872-4), and Zhang et al. (2007. PLoS ONE 2:e456, and U.S. Published Patent Application 20070264534). Examples of useful polysaccharides include, but are not limited to, starch and cellulose. Renewable sources of these polysaccharides are known in the art.

[0097]In another aspect, a hydrogenase polypeptide used in the methods is present in a microbial cell. The methods can include incubating the microbial cell under conditions suitable for the expression of the polypeptide. The microbial cell is typically a genetically modified microbe, and may be a bacterial cell, such as a gram negative, for instance, E. coli, a photosynthetic organism, for instance, R. sphaeroides, or it can be an archaeal cell, for instance, a member of the genera Pyrococcus, for instance P. furiosus, P. abyssi, or P. horikoshii, or a member of the genera Thermococcus, for instance, T. kodakaraensis or T. onnurineus. The microbe may include exogenous polynucleotides encoding the accessory polypeptides described herein. In those aspects where the microbe is a bacterial cell, such as E. coli, the microbe typically includes exogenous polynucleotides encoding the accessory polypeptides. The incubation conditions are typically anaerobic, and the temperature may be at least 37° C., at least 60° C., at least 70° C., at least 80° C., or at least 90° C. The conditions used to incubate the microbial cell typically include substrates that can be used by a cell to produce a reactant, such as NADPH, or the reductant such as NADPH can be photoproduced by a photosynthetic cell, and the NADPH can be used by the hydrogenase polypeptide to produce molecular hydrogen. Examples of useful substrates include renewable resources containing polysaccharides such as starch, cellulose, or the combination. Alternatively, the conditions used to incubate the microbial cell can include H₂, which can be used by the hydrogenase polypeptide to convert NADP to NADPH. The methods can be performed using any convenient manner. For instance, methods for growing microbial cells to high densities are routine and known in the art, and include batch and continuous fermentation processes.

[0098]The present invention is illustrated by the following examples. It is to be understood that the particular examples, materials, amounts, and procedures are to be interpreted broadly in accordance with the scope and spirit of the invention as set forth herein.

Example 1

Anaerobic Expression Vectors

[0099]A series of compatible vectors has been constructed with the various promoters described above. The expression vectors described here are derivatives of those described in Horanyi et al., (U.S. Published Patent Application 20060183193). These are a series of four vectors with compatible origins of replication and different antibiotic resistance markers which allow coexpression of multiple genes in E. coli using the lac operon regulation. These vectors have been modified to include the "anaerobic" promoters described above (Table 2) and up to 12 genes derived from P. furiosus. These are a) the structural genes for the four subunits of P. furiosus hydrogenase (Table 1) and b) the eight genes that encode the hydrogenase processing genes in P. furiosus (Table 1). The complete list of vectors created is found in Table 3, and four particular examples are shown in FIGS. 1-4. The complete map and sequences of these four vectors are shown in FIG. 8.

TABLE-US-00001 TABLE 1 Pyrococcus furiosus genes encoding structural and accessory proteins for cytoplasmic hydrogenase I and Genbank accession numbers. Coding region or deduced polypeptide sequence encoded by SEQ ID PF gene Gene Genbank coding NO identifier Accession# region 1 PF0891 Structural gene, AE010204.1 coding hydrogenase I region beta subunit 2 PF0891 Structural gene, AAL81015 Polypeptide hydrogenase I encoded by beta subunit coding region 3 PF0892 Structural gene, AE010204.1 coding hydrogenase I region gamma subunit 4 PF0892 Structural gene, AAL81016 Polypeptide hydrogenase I encoded by gamma subunit coding region 5 PF0893 Structural gene, AE010204.1 coding hydrogenase I region delta subunit 6 PF0893 Structural gene, AAL81017 Polypeptide hydrogenase I encoded by delta subunit coding region 7 PF0894 Structural gene, AE010204.1 coding hydrogenase I region alpha subunit 8 PF0894 Structural gene, AAL81018 Polypeptide hydrogenase I encoded by alpha subunit coding region 9 PF0548 HypC AE010177.1 coding region 10 PF0548 HypC AAL80672 Polypeptide encoded by coding region 11 PF0549 HypD AE010177.1 coding region 12 PF0549 HypD AAL80673 Polypeptide encoded by coding region 13 PF0559 HypF AE010178.1 coding region 14 PF0559 HypF AAL80683 Polypeptide encoded by coding region 15 PF0604 HypE AE010182.1 coding region 16 PF0604 HypE AAL80728 Polypeptide encoded by coding region 17 PF0615 HypA AE010183.1 coding region 18 PF0615 HypA AAL80739 Polypeptide encoded by coding region 19 PF0616 HypB AE010183.1 coding region 20 PF0616 HypB AAL80740 Polypeptide encoded by coding region 21 PF0617 HycI AE010183.1 coding region 22 PF0617 HycI AAL80741 Polypeptide encoded by coding region 23 PF1401 SlyD AE010243.1 coding region 24 PF1401 S1yD AAL81525 Polypeptide encoded by coding region

TABLE-US-00002 TABLE 2 Escherichia coli hydrogenase promoter DNA sequences derived from the K12 strain genome (accession number NC_000913), and Bacillus megaterium xylose promoter DNA sequences (derived from accession number X57598) (Qaziet al. 2001. Microb Ecol 41:301-309). Genome SEQ ID Gene Genbank nucleotide DNA NO identifier Accession# start and stop Sequence 25 E. coli K12 hya NC_000913.2 1031062-1031364 CTCGAATTCCTTCTCTTTTACTCGTTTAGCAAC promoter CGGCTAAACATCCCCACCGCCCGGCCAAAAGAA AAATAGGTCCATTTTTATCGCTAAAAGATAAAT CCACACAGTTTGTATTGTTTTGTGCAAAAGTTT CACTACGCTTTATTAACAATACTTTCTGGCGAC GTGCGCCAGTGCAGAAGGATGAGCTTTCGTTTT CAGCATCTCACGTGAAGCGATGGTTTGCCTTGC TACAGGGACGTCGCTTGCCGACCATAAGCGCCC GGTGTCCTGCCGGTGTCGCAAGGAGGAGAGACG TGCGATATGGGTCATCACCATCATCACCACGGC TCGATCACAAGTTTGTACAAAAAAGCAGGCTCA GAAAACCTGTATTTTCAGGGAGGA(PFU GENE)* 26 E.coli K12 hyc NC_0009112 2848966-2848355 CTCGAATTCTGCAGCATGTCACCATGACACTGTGG promoter ACAGCGGCGGACGCGCTGGGTCAGTAGCGTCACAT ACTGTTGGCATGTTTCACACCAGCATTCGGCCTCT TGTTCTTCGAGGTGCAGTTTACAACCTTCCGCCAC GCTGCCGCGGCAAACCAGATCAAAACAAAAGGCAA GAGAGCTGGTTTCGACACAAGAAAATGCGCCAATT TTGAGCCAGACCCCAGTTACGCGTTTTGCGCCGTG TTTTGCGGCCTGCTGTTCGATCAATTCCAGTGCCC GTTGGCAGAGGGTTATTTCGTGCATATCGCCTCCC ATTAACTATTGCCAGCTACAAGCAATAATTGTGCC AGTGTTGATTATCCCTGCGGTGAATAATGTCGATG ATGTCGAAATGACACGTCGACACGGCGACGAAATT CATCTTTAGCTTAAAAATCTCTTTAATAACAATAA ATTAAAAGTTGGCACAAAAAATGCTTAAAGCTGGC ATCTCTGTTAAACGGGTAACCTGACAATGACTATT TGGGAAATAAGCGAGAAAGCCGATTACATCGCACA GCGGCATCGTCGCCTACAGGACCAGTGGCACATCT ACTGCAATTCGCTGGTTCAGGGGAGAGGAGGAATA AAAAATG 27 B. megaterium xylA X57598 GAATTCTAGAATCTAATATTATAACTAAATTTTCT promoter AAAAAAAACATTGGAATAGACATTTATTTTGTATA TGATGAAATAAAGTTAGTTTATTGGATAAACAAAC TAACTTTATTAAGGTAGTTGATGGATAAACTTGTT CACTTAAATCAACCCGGGAACAAGGAGGAATAAAA AATG 28 E. coli pRIL section GGATCCCCGTCACCCTGGATGCTGTACAATTGACG ACGACAAGGGCCCGGGCAAACTAGTAATCAGACGC GGTCGTTCACTTGTTCAGCAACCAGATCAAAAGCC ATTGACTCAGCAAGGGTTGACCGTATAATTCACGC GATTACACCGCATTGCGGTATCAACGCGCCCTTAG CTCAGTTGGATAGAGCAACGACCTTCTAAGTCGTG GGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATTA CAATTCAATCAGTTACGCCTTCTTTATATCCTCCA GCCATGGCCTTGAAATGGCGTTAGTCATGAAATAT AGACCGCCATCGAGTACCCCTTGTACCCTTAACTC TTCCTGATACGTAAATAATGATTTGGTGGCCCTTG CTGGACTTGAACCAGCGACCAAGCGATTATGAGTC GCCTGCTCTAACCACTGAGCTAAAGGGCCTTGAGT GTGCAATAACAATACTTATAAACCACGCAATAAAC ATGATGATCTAGAGAATCCCGTCGTAGCCACCATC TTTTTTTGCGGGAGTGGCGAAATTGGTAGACGCAC CAGATTTAGGTTCTGGCGCCGCTAGGTGTGCGAGT TCAAGTCTCGCCTCCCGCACCATTCACCAGAAAGC GTTGATCGGATGCCCTCGAGTCGGGCAGCGTTGGG TCCTGGCCACGGGTGCGCATGATCGTGCTCCTGTC GTTGAGGACCCGGCTAGGCTGGCGGGGTTGCCTTA CTGGTTAGCAGAATGAATCACCGATACGCGAGCGA ACGTGAAGCGACTGCTGCTGCAAAACGTCTGCGAC CTGAGCTC * TheE. coli hya promoter, including the ATG protein translation initiation site is indicated in boldface in the table. The region immediately after includes ggt (encoding a Glycine)/catcaccatcatcaccac(6x His tag) / ggctcgatcacaagttt gtacaaaaaagcaggctca (Gateway attB1 site, encoding GSITSLYKKAGS)/gaaaacct gtattttcaggga (encoding TEV protease recognition site: ENLYFQG, TEV protease cut between Q and G)/gga, encoding another Glycine (SEQ ID NO: 50). At the asterisk, P. furiosus genes are cloned without a start codon to create a fusion protein MGHHHHHHGSITSLYKKAGSENLYFQGG-Pfu target gene (MGHHHHHHGSITSLYKKAGSENLYFQGG, SEQ ID NO: 51).

TABLE-US-00003 TABLE 3 Complete list of vectors constructed. Plasmids Constructed plasmid promoter gene Antibiotics pHA-BC hya 0894-hybC Amp pHA-CS hya 0894-CS Amp pET-CAG Gateway plasmid, with promoter P-hya , Ampicillin resistant, pET-CXG Gateway plasmid, with promoter P-xylA, Ampicillin resistant, pEA-SH1 hya 0891-0894 Amp pDEST-C11 T7 promoter, Gateway plasmid, from pDEST-C1, Streptomycin resistant pDEST- hya, Gateway plasmid, from pDEST-C1, Streptomycin resistant C11A pDEST- hya PF0615- Sm C11A- 0617 hypABI pC11A- hya PF0548- Sm CDABI 0549-0615- 0616-0617 pDEST-C3A Gateway plasmid with P-hya promoter in front of Gateway cassette, Chloramphenicol resistant pDEST-C3X Gateway plasmid with P-xylA promoter in front of Gateway cassette, Chloramphenicol resistant pDEST-C3- T7 PF0891- Cm SH1 0894 pDEST- hya PF0891- Cm C3A-SH1 0894 pDEST- hya lacZ Cm C3A-lacZ pDEST- P-xylA lacZ Cm C3X-lacZ pDEST- C3AR derivative of plasmid pDEST-C3A, in Which RIL fragment inserted pC3A-slyD hya PF1401 Cm pC3AR-slyD hya PF1401 Cm pRSF-CAG Gateway plasmid, sequencing confirmed, Kanamycin resistant, done by JS pRSF-CXG pRA-hypE hya PF0604 Kan pRA-hypF hya PF0559 Kan pRA-EF hya PF0604- Kan 0559 pDONR/zeo- PF0617 Zeo hycl pDONR/zeo- PF0548- Zeo hypCD-ABI 0549/0615- 0617 pDONR/zeo- PF0604/0559 Zeo hypEF pDON R/zeo- PF1401 Zeo slyD pDONR/zeo- E. coli lacZ N- Zeo lacZ terminal sequence pDONR/zeo- PF0548- Zeo hypCD 0549 pDONR/zeo- PF0604 Zeo hypE pDONR/zeo- PF0559 Zeo hypF Amp, ampicillin resistance marker; Sm, streptomycin/spectinomycin resistance marker; Cm, chloramphenicol resistance marker; Kan, kanamycin resistance marker; Zeo, zeocin resistance marker.

TABLE-US-00004 TABLE 4 Compatible anaerobic expression vectors utilized to express functional P. litriosus cytoplasmic hydrogenase¹ in E. coli. Antibiotic P. furiosus Parent Resistance P. furiosus gene Vector Vector marker gene products number⁶ pC11A- pDEST-C1² Strepto-mycin^R HypCDAB PF0548, CDABI⁶ HycI PF0549, PF0615- 0617 pC3AR-slyD¹ pDEST-C3³ Chloram- SlyD PF1401 phenicol^R pEA-SH1 pET23(+)⁴ Ampicillin^R Hydrogenase I PF0891- PF0894 pRA-EF⁷ pRSFDuet-1⁵ Kanamycin^R HypEF PF0604 PF0559 ¹Also includes the region (SEQ ID NO: 28, see Table 2) of the Stratagene (La Jolla, CA) helper plasmid pRIL BL21-CodonPlus+10 +200 (DE3)-RIL competent cells, catalog number 230245. This strain carries the pRIL plasmid which expresses transfer RNAs that are rare in E. coli. ²Horanyi et al., (U.S. patent application 20060183193) ³Horanyi et al., (U.S. patent application 20060183193) ⁴EMD Chemicals Inc., Catalog Number 69771-3. ⁵EMD Chemicals Inc., Catalog Number 71341. ⁶An artificial intergenic sequence was introduced between the hypD and hypA coding regions to create a Shine-Dalgarno ribosome binding site for hypA. CD-ABI intergenic sequence: gaggtggaaa (SEQ ID NO: 52), there was an artificial Shine-dalgarno sequence (aggaggtg) in front of hypA gene. hypD+3 s expression stops at TAG, while hypA starts with ATG: (hypD-tttacaaatatggcgccctgatgtaggaggtggaaaATGcacgaatgggcgttggcagatgcaatagt- aagg-hypA) (tttacaaatatggcgccctgatgtaggaggtggaaaATGcacgaatgggcgttggcagatgcaatagtaagg, SEQ ID NO: 53). ⁷An artificial intergenic sequence was introduced between the hypE and hypF coding regions to create a Shine-Dalgarno ribosome binding site for hypF. The hypE-hypF intergenic sequence is still gaggtggaaa (SEQ ID NO: 52), there was an same artificial Shine- dalgarno sequence (aggaggtg) in front of hypF gene. hypE+3 s expression stops at tag, while hypF starts with ATG: hypE-gtgatcccgttcctagagtttgttaggaggtggaaaATGatctgggggagagaatgaaagcttatagaa- ttcacg-hypF (gtgatcccgttcctagagtttgttaggaggtggaaaATGatctgggggagagaatgaaagatatagaattcac- g; SEQ ID NO: 54).

[0100]In addition, one of the vectors, pC3AR-slyD (Table 3) has been further modified to include a region (SEQ ID NO: 28) of the Stratagene (La Jolla, Calif.) helper plasmid pRIL. This plasmid was purified from E. coli BL21-CodonPlus cells from Stratagene (La Jolla, Calif. catalog #230240). This overexpresses transfer RNAs that are rare in E. coli but are required for efficient expression of P. furiosus proteins due to differences in codon usage between the two organisms. This eliminates the need for yet another vector (containing pRIL) and yet another antibiotic resistance marker. The following sequence was amplified from pRIL by PCR, and inserted into pDEST-C3A to create destination plasmid pC3A-RIL, which was used to make expression plasmid pC3AR-slyD (ggatccccgtcaccctggatgctgtacaattgacgacgacaagggcccgggcaaactagtaatcagac gcggtcgttcacttgacagcaaccagatcaaaagccattgactcagcaagggagaccgtataattcacg cgattacaccgcattgcggtatcaacgcgccatagctcagttggatagagcaacgaccactaagtcgtg ggccgcaggttcgaatcctgcagggcgcgccattacaattcaatcagttacgccttctttatatcctccagc catggccttgaaatggcgttagtcatgaaatatagaccgccatcgagtaccccttgtaccataactcttcct gatacgtaaataatgatttggtggccatgctggacttgaaccagcgaccaagcgattatgagtcgcctgc tctaaccactgagctaaagggccttgagtgtgcaataacaatacttataaaccacgcaataaacatgatga tctagagaatcccgtcgtagccaccatctttnttgcgggagtggcgaaattggtagacgcaccagatttag gttctggcgccgctaggtgtgcgagttcaagtctcgcctcccgcaccattcaccagaaagcgttgatcgg atgccctcgagtcgggcagcgttgggtcctggccacgggtgcgcatgatcgtgacctgtcgttgagga cccggctaggctggcggggttgccttactggttagcagaatgaatcaccgatacgcgagcgaacgtgaa gcgactgctgctgcaaaacgtctgcgacctgagctc; SEQ ID NO:55). If all four vectors are used, there are seven possible cloning sites available, four Gateway® recombination sites (Invitrogen, Carlsbad, Calif.) under control of four different anaerobic promoters, and three standard multiple cloning sites (under standard T7 promoter control), as these are derived from the Novagen Duet system vectors (EMD Chemicals, San Diego, Calif.), with the exception of pEA-SHI, which was derived from pET23, also from Novagen but not part of the Duet system of vectors. However, as many as five consecutive genes can be cloned in tandem under control of the P-hya promoter (plasmid pC11A-CDABI), and all were expressed as demonstrated by quantitative PCR, as described below. This means as many as twenty genes can potentially be coexpressed anaerobically using these compatible vectors and potentially more. Herein we used all four vectors to express 12 genes from P. furiosus. In each construct, a single gene, or the first gene (at the 5' end) of any group of genes had a poly His-tag which is cleavable with TEV protease.

Example 2

Growth of Recombinant E. Coli and Production of Recombinant P. Furiosus Hydrogenase

[0101]The E. coli strain used for expression of the P. furiosus hydrogenase was MW1001, a derivative of the strain BW25113. This strain has the genotype (hyaB hybC hycE Δkan; defective in LSU of hydrogenases 1, 2, and 3, no antibiotic marker)m and lacks detectable E. coli hydrogenase activity (Maeda et al. 2007. BMC Biotechnol 7:25).

[0102]To obtain the recombinant form of P. furiosus cytoplasmic hydrogenase I, recombinant E. coli cells containing the four vectors (Table 4) were grown on an 8 L scale at 37° C. in 2×YT media (16 g Tryptone, 10 g Yeast Extract, 5 g NaCl) supplemented with 25 μM NiCl₂, 100 μM FeCl₃, 2 mM MgSO₄ and the antibiotics Ampicillin (50 μg/ml), Chloramphenicol (16.5, μg/ml), Streptomycin (25 μg/ml) and Kanamycin (25 μg/ml). Cloning the complete. P. furiosus SHI operon in E. coli resulted in low efficiency of transformation; however, all techniques used for cloning and transformations were standard molecular biology techniques as described (Sambrook et al., J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.), and transformants were obtained. The culture was sparged with sterile, compressed air (3-5 L/min) until an OD₆₀₀ of ˜0.3 was reached. At this time compressed air was turned off and the cells were sparged with sterile argon (˜4 L/min) and 2% glucose and 30 mM sodium formate were added to supplement growth and induce hydrogenase-related genes in E. coli. The culture was allowed to ferment for five hours and the cells were then quickly harvested by centrifugation and frozen at -80° C. Frozen cells were then thawed and lysed at 25° C. in anaerobic 50 mM Tris buffer pH 8.0, 2 mM sodium dithionite, 0.5 mg/mL lysozyme, 50 μg/mL DNase at a ratio of 1 g/3 mL in an anaerobic chamber under an atmosphere of 5% hydrogen/95% argon overnight.

[0103]A hydrogen evolution assay was used to measure hydrogenase activity using an artificial (methyl viologen) electron carrier with sodium dithionite as the electron donor as described (Ma and Adams. 2001. Methods Enzymol 331:208-16). Briefly, this was carried out using 5 mL stoppered vials containing 2 mL of anaerobic 100 mM EPPS buffer pH 8.4, 10 mM sodium dithionite, and 1 mM Methyl Viologen under an atmosphere of argon. Vials were preheated at 80° C. for 1 min and then 200 μL of sample was injected. Samples (100 μL) of the headspace of the sealed vial were removed with a gas-tight syringe and injected into a gas chromatograph after the reaction had proceeded for 6 min. The resulting hydrogen peak was compared to a known standard curve to calculate micromoles of hydrogen produced per mL of assay solution. Specific activity is defined as micromoles H₂ produced min^-1 mg protein^-1. After cell lysis the following samples were analyzed for hydrogen evolution at 80° C.: Whole cell extracts (WCEs), the cytoplasmic extract after a 100,000×g centrifugation (S100), and heat-treated (at 80° C. for 30 min) and re-centrifuged S100. The data are summarized in Table 5.

TABLE-US-00005 TABLE 5 MV-linked H₂-evolving activity of recombinant P. furiosus cytoplasmic hydrogenase I. Total Specific Total Specific Step Units Activity Units Activity BW25113¹ MW1001² WCE 891 2.7 ND⁴ ND⁴ S100 2 0.02 ND⁴ ND⁴ 80° C. ND⁴ ND⁴ ND⁴ ND⁴ treated S100 MW1001 + SHI⁵ MW1001 + SHI + Pf Plasmids⁶ WCE ND⁴ ND⁴ 2.9 0.008 S100 ND⁴ ND⁴ 3.8 0.04 80° C. ND⁴ ND⁴ 4.9 0.31 treated S100 ¹Obtained from T.K. Wood, Texas A&M University, College Station, TX. ²See reference (Maeda et al. 2007. Appl Microbiol Biotechnol 76: 1035-1042). ³Specific activity is defined as μmol H₂ produced min^-1 mg protein^-1. ⁴Not detected (below detection limit of 0.017 Units (measured with 0.5 mg protein after 2 minutes). ⁵Contains one plasmid expressing the four structural genes that encode P. furiosus hydrogenase: pEA-SH1 (PF0891-0894). ⁶Contains all four plasmids expressing P. furiosus hydrogenase genes including structural and processing genes: pEA-SH1 (PF0891-0894), pC11A-CDABI (PF0548-0549, PF0615-0617), pRA-EF (PF0604, PF0559), pC3AR-slyD (PF1401).

[0104]The data clearly demonstrate H₂ evolution from cells expressing the genes encoding P. furiosus hydrogenase, with no detectable H₂ produced by the control strain lacking any gene from P. furiosus. The form of the P. furiosus enzyme responsible for this activity was not only stable at 80° C. for 30 min, but it was activated by this heat treatment, a step that also precipitates heat-labile E. coli proteins. This increase was unexpected and, at 28%, significant. Production of protein corresponding to the catalytic subunit of hydrogenase I (encoded by PF0894) has been confirmed by immunoanalyis (FIG. 5). In addition, expression of the P. furiosus genes in E. coli using these constructs at the level of mRNA has been confirmed by quantitative PCR (FIG. 6). In comparison to the natively purified P. furiosus hydrogenase, FIG. 9 demonstrates that the MV-linked H₂ evolution activity was virtually identical. The expression of coding regions PF0891-0894 resulted in a his-tag present at the amino terminal end of the polypeptide encoded by PF0891, the beta subunit. This tag did not result in a hydrogenase polypeptide that could be affinity purified; however, the hydrogenase polypeptide was active, suggesting the hydrogenase polypeptide is permissive for mutations.

[0105]We have therefore demonstrated that heterologous gene expression of the hydrogenase was achieved in E. coli. This was shown by analysis of cell-extracts for mRNA (by PCR) and for protein (by western blot) and that this gene expression leads to the production of a functional recombinant hydrogenase that is catalytically active at 80° C. (by hydrogen production measurements) and is also heat stable at 80° C. (for at least 30 min).

Example 3

Production of Hydrogenase by E. Coli

[0106]The ability of E. coli containing the four compatible vectors, termed strain MW/rSHI-C, to produce the recombinant hydrogenase was investigated throughout the growth phase (FIG. 10). The strain was grown on an 8-liter scale in carboys in 2×YT growth media (16 g tryptone, 10 g yeast extract and 5 g NaCl per liter) supplemented with 1% glucose, 2 mM MgSO4, Amp (50 μg/ml), Cm (16 μg/ml), Sm (25 μg/ml) and Kan (25 μg/mL), see Table 4. FIG. 10 summarizes the results from two separate cultures (one indicated by circles, one by triangles). At an OD₆₀₀ of 0.2-0.3, 100 μM FeCl3 and 25 μM NiSO4 were added, the culture was then sealed and allowed to ferment anaerobically (indicated by the arrow in FIG. 10). The growth curves are shown by solid symbols. Samples of the culture were taken every hour after the anaerobic switch. The cells were harvested by centrifugation, lysed, and analyzed for MV linked hydrogenase activity at 80° C. (shown by open symbols). The results show that hydrogenase activity is not detected in E. coli MW/rSHI-C until the cells are switched to anaerobic growth, which is expected since expression of the P. furiosus genes is induced by the so-called anaerobic hya promoter. FIG. 10 also shows that the amount of 80° C. hydrogenase activity, and thus production of the recombinant hydrogenase, increases with cell growth until late stationary phase.

[0107]Cell yields of recombinant E. coli MW/rSHI-C approached 1 gram (wet weight)/liter when grown on the 8-liter scale in carboys. We also demonstrated that the same strain could be grown to extremely high cell densities under anaerobic conditions and under such conditions produced the recombinant hydrogenase, as measured by hydrogenase activity at 80° C. Cells were grown in a 5-liter controlled fermentation system (New Brunswick) on same medium that was used in the carboys but with controlled a) pH (6.5), b) dissolved oxygen, and c) glucose concentration. As shown in FIG. 11, cells were grown to an OD₆₀₀ of 38 before switching to anaerobic conditions, in this case by replacing the air with Argon, and this induced the production of the recombinant hydrogenase activity to approximately the same level as in the 8-liter carboy cultures (˜0.1 unit/mg before heat treatment). The cell yield in this case was ˜40 gram (wet weight)/liter.

Example 4

Purification of Hydrogenase

[0108]A method for purifying the recombinant hydrogenase was developed that enabled confirmation of the production of the recombinant forms of all four of the protein subunits of P. furiosus hydrogenase. The scheme is summarized in FIG. 12, and involves two standard column chromatography steps using DEAE-Sepharose and Phenyl Sepharose (GE Healthcare). In brief, the E. coli cells (154 gram, wet weight) were broken by thawing them in 3 mL of anaerobic 50 mM Tris, pH 8.0 (3 mL per gram of frozen cells) containing 0.5 mg/mL lysozyme, 50 μg/mL DNase, 1 mM phenylmethylsulfonyl fluoride, and 2 mM sodium dithionite. The suspension was incubated at room temperature in an anaerobic chamber under an atmosphere of 5% H₂/95% Ar for 4 hours to allow the cells to break. The sample was then sealed in an anaerobic flask and heat-treated at 80° C. for 30 min by immersion of the flask in a hot water bath. Samples were then anaerobically centrifuged at 100,000×g for 30 min. The supernatant (650 mls) was then diluted 5-fold with Buffer A (50 mM Tris, 2 mM sodium dithionite, pH 8.0) at a sample/Buffer A ratio and loaded onto a column of DEAE Sepharose (300 ml; GE Healthcare) equilibrated in Buffer A. The column was then washed with 5 column volumes of Buffer A and eluted with a 20-column volume gradient from 0 to 25% gradient of Buffer B (Buffer A+2M NaCl) in 40 ml fractions. Those that contained hydrogenase activity in the standard assay (at 80° C. using reduced methyl viologen as the electron donor) were combined and Buffer A containing 2.0 M ammonium sulfate (NH₄)₂SO₄ was added to a final concentration of 0.8 M. The sample was then loaded on to a column of Phenyl Sepharose (45 ml) equilibrated in Buffer C (Buffer A containing 0.8M (NH₄)₂SO₄). The column was washed with 5-column volumes of Buffer C and eluted with a 20 column volume gradient from 100% Buffer C to 100% Buffer A in 10 ml fractions. Those containing hydrogenase activity were combined.

[0109]Typical results of this two-column purification are shown in Table 6. The enzyme was purified almost 60-fold, about 20% of the total activity was recovered with a specific activity in the standard 80° C. assay of 6 units/mg. SDS gel analysis of the hydrogenase active fractions obtained at the different purification steps is shown in FIG. 13. The most purified fractions (the PS Pool from the Phenyl Sepharose column) contain six or so major bands on SDS gels. Analysis of the bands that migrated at the expected molecular weights for the four subunits of the recombinant hydrogenase (see FIG. 11) by standard tryptic digestion/mass spectrometry (MALDI) confirmed unambiguously that those were the four subunits of the P. furiosus hydrogenase enzyme.

TABLE-US-00006 TABLE 6 Isolation of recombinant hydrogenase. Total Total Units^a Protein Specific % Fold Step (μmol min-1) (mg) Activity Yield Purification Cell Lysate 1349 13059 0.1 100 1 S100 (after 1380 1231 1 102 11 80° C./30 min) DEAE 640 301 2 47 21 Sepharose Phenyl 239 41 6 18 56 Sepharose ^aHydrogenase activity was measured at 80° C. using reduced MV as the electron donor. One unit of activity is equivalent to the production of 1 μmole of hydrogen per minute.

Example 5

Purification of Hydrogenase

[0110]A method to obtain highly purified preparations of the hydrogenase that are near homogeneous was devised. This involves two subsequent steps of conventional column chromatography. In brief, the PS Pool (see Table 6) was concentrated by ultrafiltration (Amicon, PM-30 membrane), and applied to a column of Sepharcryl S-200 (GE Healthcare) equilibrated with Buffer A. The same buffer was used to elute the column. Fractions that contained hydrogenase activity in the standard assay were combined and applied directly to a column of Hydroxyapatite (Life Science Research, Hercules, Calif.) equilibrated in Buffer A. The column was washed with 5 column volumes of Buffer A and eluted with a 20-column volume gradient from 0 to 50% gradient of Buffer D (Buffer A+0.5 M potassium phosphate). Samples containing hydrogenase activity were combined. As shown in FIG. 14, the fractions from the Hydroxyapatite column contain highly purified hydrogenase containing four major proteins. These corresponded to the protein bands found in the native hydrogenase purified from P. furiosus. The four protein bands in the purified recombinant hydrogenase were unambiguously shown by tryptic digest/MADI analysis to correspond to the four subunits of the recombinant form of P. furiosus hydrogenase. In addition, the hydrogenase activity from the Sephacryl S-200 column eluted a single band with a molecular weight of approximately 150,000, showing that it was a homogeneous species whose size corresponds to that of the native enzyme, which consists of a heterotetramer of four different polypeptides (see FIG. 14).

Example 6

Metal Analysis

[0111]The purified recombinant hydrogenase has hydrogen-evolving activity and must therefore contain a nickel-iron catalytic site. This is demonstrated by a metal analysis of the fractions eluting from the Phenyl Sepharose column using the technique of ICP-MS (Model 7500ce, Agilent Technologies). As shown in FIG. 15, fractions that contained hydrogenase activity also contained both nickel and iron. Moreover, the Fe:Ni ratio was approximately 20, which is almost identical to the value (Fe:Ni=19) proposed to be in the native P. furiosus enzyme (see proposed cofactor content in FIG. 14). Therefore, the recombinant hydrogenase has the expected metal content, consistent with a fully functional enzyme.

[0112]FIG. 15 shows a major additional peak of nickel that is not associated with the enzyme. We propose that this nickel is not inserted into the hydrogenase protein because of a limiting growth factor for hydrogenase biosynthesis in E. coli, but that this would occur when E. coli is grown under the appropriate conditions. As an example, nickel may not be processed completely due to the availability of the cyanide and carbon monoxide ligands that are coordinated to the nickel-iron catalytic site. Others have shown that carbamoyl phosphate is the source of the cyanide (Paschos et al. 2001. FEBS Lett 488:9-12). E. coli cells deficient in carbamoyl phosphate (CP) synthesis (by lesion the carAB locus) lose the ability to synthesize active hydrogenase enzymes (Blokesch and Bock. 2002. Journal of Molecular Biology 324:287-296). It was shown that the ΔcarAB strain contained a stable HypC-HypD complex but that processing of hydrogenase does not occur. The complex disappeared and processing and hydrogenase production was restored when a source of CP (L-citrulline) was added to the E. coli growth media. It is anticipated that the addition of this or similar sources of key nutrients will dramatically increase the yield of active recombinant P. furiosus hydrogenase produced in E. coli.

Example 7

Temperature and Oxygen Sensitivity and Electron Donor Specificity of Recombinant Hydrogenase

[0113]Purified recombinant hydrogenase is as stable to incubation at high temperature (90° C.) and as sensitive to oxygen as the native form of the enzyme purifed from P. furiosus native biomass. For example, as shown in FIG. 16, the thermal stability of purified recombinant hydrogenase (7.5 mg/ml) and the native hydrogenase (0.4 mg/ml) were analyzed by incubating samples anaerobically under Argon in 100 mM EPPS buffer, pH 8.4, containing 2 mM sodium dithionite in a sealed 8-ml serum vials in a 90° C. water bath. Samples were analyzed for 80° C. MV linked hydrogen evolution activity periodically during the incubation. Both enzyme preparations showed an initial activation to over 150% of the initial activity, as originally reported with the native enzyme (Bryant and Adams, 1989. 1989. J Biol Chem 264:5070-5079). Moreover, the recombinant enzyme continued to exhibit an activity above 150% of the initial value even after 11 hours at 90° C., while that of native enzyme decreased (FIG. 16). However, such stability is dependent upon the protein concentration and increases as the concentration increases. Given the 37-fold higher protein concentration of the recombinant enzyme, it can be concluded that the stabilities of the two forms are comparable.

[0114]FIG. 17 shows the results of incubating the purified recombinant hydrogenase (7.5 mg/ml) and the native hydrogenase (0.4 mg/ml) in 100 mM EPPS buffer, pH 8.4, in 8-ml serum vials at room temperature that were exposed at zero time to 20% oxygen (air). The sensitivities of the two forms to oxygen, a property that is not dependent upon protein concentration, was virtually identical.

[0115]The recombinant hydrogenase, like the native enzyme, is also able to use NADPH as an electron donor for hydrogen production at 80° C. As shown in Table 7, the two forms exhibit between 3 and 12% of the activity with MV as the electron donor when it is replaced by NADPH (1 mM) under the same assay conditions. The activity, oxygen and thermal stability data, summarized in Table 7, indicate that the structural and catalytic integrity of the recombinant hydrogenase is comparable to that of the native enzyme.

TABLE-US-00007 TABLE 7 Subunit Structure and Electron Donor Specificity of Native and Recombinant Forms of Hydrogenase Stability Stability MV- NADPH- at in Linked linked Ratio 90° C. Air (t₁/2, Enzyme Type (units/mg) (units/mg) (%) (t₁/2, hr) hour) Native hydrogenase 109 12.7 12 7 >12 (from P. furiosus biomass) Recombinant 5.7 0.15 3 >12 6 Hydrogenase (αβγδ)^a Dimeric 0.4 0 -- ~1 ~1 Recombinant Hydrogenase (αδ)^b Activities were measured using either 1 mM MV or 1 mM NADPH as the electron donor at 80° C. The stability values for the native and recombinant (αβγδ) enzymes are estimates from FIG. 17. The data used to estimate the values for the dimeric form (αδ) is not shown. ^aThe form of the tetrameric recombinant hydrogenase (αβγδ) used in this experiment was obtained after two chromatography steps (see Table 6). ^bThe form of the dimeric recombinant hydrogenase (αδ) used in this experiment was after the cell-free extract was clarified by centrifugation (the S-100 fraction). The dimeric form of the hydrogenase is described below.

Example 8

Production of a Dimeric Hydrogenase

[0116]The ability to generate the recombinant form of the hydrogenase opens up a complete spectrum of possibilities to produce mutant forms with very different properties from that of the native form. For example, FIG. 18 shows the proposed electron pathway from NADPH through the four subunits of the enzyme and the electron-carrying cofactors (FAD and then multiple [2Fe-2S] and [4Fe-4S] clusters) to the NiFe catalytic site, which catalyzes hydrogen (H₂) production. It is assumed that the artificial electron carrier, MV, can donate electrons directly to one or more of the [2Fe-2S] and [4Fe-4S] clusters directly, by-passing the FAD, see FIG. 18. Consequently, the native heterotetrameric (αβγδ) enzyme produced from 4 genes (PF0891-PF0894) evolves hydrogen from both MV and NADPH (Table 7). However, as shown in FIG. 19, a heterodimeric (αδ) enzyme produced by expression of only PF0893 and PF0894 would lack the proposed NADPH-interacting and FAD-containing γ-subunit (PF0892). This dimeric form would not be expected to evolve hydrogen from NADPH, but may from MV (FIG. 19).

[0117]To test this idea and to generate the first mutant form of recombinant P. furiosus hydrogenase, a plasmid, pEA-0893-0894, was constructed that contained only two of the four hydrogenase subunits encoded by PF0893 and PF0894 (FIG. 20). This was based on the plasmid that contains the four genes that encode all four subunits (pEA-SH1, FIG. 8); however, the P-hya promoter in this plasmid did not include the sequences encoding a his-tag. The dimeric (αδ) recombinant enzyme was produced in E. coli strain MW1001 under the same anaerobic expression conditions that were used to produce the recombinant heterotetrameric (αβγδ) enzyme (see FIG. 10) except that pEA-SH1 plasmid was replaced by the pEA-0893-0894 plasmid and that the culture was grown in a 1-liter flask rather than an 8-liter carboy. The recombinant cells (1.5 grams wet weight) were harvested by centrifugation and were lysed by resuspending them in 3 mls (per gram wet weight of cells) of anaerobic 50 mM Tris, pH 8.0, containing 0.5 mg/mL lysozyme, 50 ug/mL DNase, 1 mM phenylmethylsulfonyl fluoride, and 2 mM sodium dithionite. Samples were lysed by incubation at room temperature in an anaerobic chamber under an atmosphere of 5% H₂/95% Ar for 4 hours. The protein content of the cell-free extract was 8.9 mg/mL as determined by the standard protein assay and 5.2 units of hydrogenase activity measured using MV as the electron donor at 80° C. The specific activity was 0.078 U/mg, which is comparable to that obtained with the tetrameric (αβγδ) recombinant enzyme (Table 6). However, as indicated in Table 7, the dimeric (αδ) recombinant form had no detectable hydrogen production activity using NADPH (1 mM) as the electron donor, as was predicted (FIG. 19). Also, the structural as well as the catalytic integrity of the recombinant dimeric hydrogenase differed from that of both the recombinant and native forms of tetrameric holoenzyme. As shown in Table 7, the dimeric form was much more sensitive to oxygen and was much less stable at 90° C. However, the fact that this mutated form of the enzyme containing only two subunits still had an approximate half-life at 90° C. of 1 hour shows the great advantage of using a hyperthermophilic enzyme as the starting material for any manipulation of enzyme structure. The resulting protein was expected to be considerably less stable than its native counterpart, but the extreme stability of the native means that an `unstable` form can still retain remarkably stability and activity, relative to conventional enzymes found in organisms growing at conventional temperatures. Moreover, with the demonstration here of an extremely stable dimeric mutant form with catalytic properties, the means to generate a wide variety of mutant forms, for example, with various tags for purification and immobilization, is now possible.

[0118]In summary, a series of four compatible vectors have been constructed that will express a functional hydrogenase in E. coli. It was shown that recombinant hydrogenase was produced when cells were switched to anaerobic growth and that the amount of the enzyme produced increased with cell growth until late stationary phase. Recombinant hydrogenase was also produced in recombinant E. coli cells grown to exceedingly high densities (OD˜40). A method for purifying the recombinant hydrogenase to a high level of purity is described, and analysis of the protein components of the recombinant enzyme by a standard mass spectrometry technique established unambiguously that it contained the four hydrogenase subunits encoded by the four cloned genes that were heterologously expressed. It was also demonstrated that the recombinant enzyme has approximately the same molecular weight (˜150 kDa) and metal content (20 Fe:1 Ni) as the native enzyme purified from P. furiosus biomass, it is similarly stable to high temperature (half life at 90° C. of ˜12 hr) and sensitive to inactivation by oxygen (half life of ˜6 hr in air) and, like the native enzyme, uses NADPH as an electron donor for hydrogen production at 80° C. The ability to generate mutant or modified forms of the hydrogenase was demonstrated by the production of a heterodimer form containing two subunits rather than the four subunits of the heterotetrameric enzyme. The dimeric form was still catalyitically active at 80° C. with the artificial electron donor MV, but it did not use NADPH as an electron donor. The dimeric form was still very thermostable (half-life at 90° C. of ˜1 hr). This demonstrates the great advantage of using a hyperthermophilic enzyme as the starting material for any manipulation of enzyme structure.

[0119]The complete disclosure of all patents, patent applications, and publications, and electronically available material (including, for instance, nucleotide sequence submissions in, e.g., GenBank and RefSeq, and amino acid sequence submissions in, e.g., SwissProt, PIR, PRF, PDB, and translations from annotated coding regions in GenBank and RefSeq) cited herein are incorporated by reference. In the event that any inconsistency exists between the disclosure of the present application and the disclosure(s) of any document incorporated herein by reference, the disclosure of the present application shall govern. The foregoing detailed description and examples have been given for clarity of understanding only. No unnecessary limitations are to be understood therefrom. The invention is not limited to the exact details shown and described, for variations obvious to one skilled in the art will be included within the invention defined by the claims.

[0120]Unless otherwise indicated, all numbers expressing quantities of components, molecular weights, and so forth used in the specification and claims are to be understood as being modified in all instances by the term "about." Accordingly, unless otherwise indicated to the contrary, the numerical parameters set forth in the specification and claims are approximations that may vary depending upon the desired properties sought to be obtained by the present invention. At the very least, and not as an attempt to limit the doctrine of equivalents to the scope of the claims, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.

[0121]Notwithstanding that the numerical ranges and parameters setting forth the broad scope of the invention are approximations, the numerical values set forth in the specific examples are reported as precisely as possible. All numerical values, however, inherently contain a range necessarily resulting from the standard deviation found in their respective testing measurements.

[0122]All headings are for the convenience of the reader and should not be used to limit the meaning of the text that follows the heading, unless so specified.

Sequence CWU 1

5911104DNAPyrococcus furiosus 1gtgaggtatg ttaagttacc caaggaaaac acttacgagt ttttggaaag acttaaagac 60tgggggaagc tttacgctcc agtaaaaatt tcggacaagt tctatgactt cagggagatt 120gatgatgtta gaaagataga attccactac aacaggacaa taatgccacc taagaagttc 180ttcttcaagc cgagggaaaa gctctttgag ttcgacattt caaaaccaga atacagggag 240gtaatagagg aagttgaacc atttattata tttggagtcc acgcgtgtga catatatggc 300ctaaagatcc tagacacggt ataccttgat gagttccccg acaagtacta caaggtgagg 360agagagaagg ggataatcat tggaataagc tgtatgccag atgaatattg cttctgtaac 420ttaagagaaa cagacttcgc tgatgatggt tttgacttgt tcttccatga actgcccgat 480ggatggttgg taagggttgg cactccaact gggcacaggc ttgttgacaa gaacataaag 540ctctttgaag aggtaacgga caaggatatc tgtgcattta gagattttga aaagaggaga 600cagcaagcat tcaaatacca cgaagactgg ggcaacttga ggtatcttct cgagttggaa 660atggaacatc caatgtggga tgaggaggca gataagtgct tggcttgtgg aatatgtaac 720accacatgcc caacgtgtag atgctatgaa gttcaggata ttgtaaacct agatggagtt 780actggataca gggaaagaag atgggattct tgtcagttca gaagtcatgg cttagttgct 840gggggccaca acttcaggcc cacaaagaag gatcgcttta ggaacagata cctctgtaag 900aacgcatata acgaaaagct tggattaagc tactgtgtcg gttgtggaag gtgtactgca 960ttctgtccag ccaatataag ttttgtaggc aatcttagaa ggattttagg acttgaggag 1020aacaaatgtc ccccaacggt tagtgaggag attccaaaga gaggatttgc atattcctct 1080aacattagag gtgatggagt atga 11042367PRTPyrococcus furiosus 2Met Arg Tyr Val Lys Leu Pro Lys Glu Asn Thr Tyr Glu Phe Leu Glu1 5 10 15Arg Leu Lys Asp Trp Gly Lys Leu Tyr Ala Pro Val Lys Ile Ser Asp 20 25 30Lys Phe Tyr Asp Phe Arg Glu Ile Asp Asp Val Arg Lys Ile Glu Phe 35 40 45His Tyr Asn Arg Thr Ile Met Pro Pro Lys Lys Phe Phe Phe Lys Pro 50 55 60Arg Glu Lys Leu Phe Glu Phe Asp Ile Ser Lys Pro Glu Tyr Arg Glu65 70 75 80Val Ile Glu Glu Val Glu Pro Phe Ile Ile Phe Gly Val His Ala Cys 85 90 95Asp Ile Tyr Gly Leu Lys Ile Leu Asp Thr Val Tyr Leu Asp Glu Phe 100 105 110Pro Asp Lys Tyr Tyr Lys Val Arg Arg Glu Lys Gly Ile Ile Ile Gly 115 120 125Ile Ser Cys Met Pro Asp Glu Tyr Cys Phe Cys Asn Leu Arg Glu Thr 130 135 140Asp Phe Ala Asp Asp Gly Phe Asp Leu Phe Phe His Glu Leu Pro Asp145 150 155 160Gly Trp Leu Val Arg Val Gly Thr Pro Thr Gly His Arg Leu Val Asp 165 170 175Lys Asn Ile Lys Leu Phe Glu Glu Val Thr Asp Lys Asp Ile Cys Ala 180 185 190Phe Arg Asp Phe Glu Lys Arg Arg Gln Gln Ala Phe Lys Tyr His Glu 195 200 205Asp Trp Gly Asn Leu Arg Tyr Leu Leu Glu Leu Glu Met Glu His Pro 210 215 220Met Trp Asp Glu Glu Ala Asp Lys Cys Leu Ala Cys Gly Ile Cys Asn225 230 235 240Thr Thr Cys Pro Thr Cys Arg Cys Tyr Glu Val Gln Asp Ile Val Asn 245 250 255Leu Asp Gly Val Thr Gly Tyr Arg Glu Arg Arg Trp Asp Ser Cys Gln 260 265 270Phe Arg Ser His Gly Leu Val Ala Gly Gly His Asn Phe Arg Pro Thr 275 280 285Lys Lys Asp Arg Phe Arg Asn Arg Tyr Leu Cys Lys Asn Ala Tyr Asn 290 295 300Glu Lys Leu Gly Leu Ser Tyr Cys Val Gly Cys Gly Arg Cys Thr Ala305 310 315 320Phe Cys Pro Ala Asn Ile Ser Phe Val Gly Asn Leu Arg Arg Ile Leu 325 330 335Gly Leu Glu Glu Asn Lys Cys Pro Pro Thr Val Ser Glu Glu Ile Pro 340 345 350Lys Arg Gly Phe Ala Tyr Ser Ser Asn Ile Arg Gly Asp Gly Val 355 360 3653879DNAPyrococcus furiosus 3atgatgttgc caaaagagat tatgatgcca aatgataatc cgtatgccct tcatagagtc 60aaagttctaa aggtttactc cttgacggaa acggaaaagc ttttcctctt tagatttgag 120gatcccgagt tggcagagaa gtggacgttc aaacctggac agtttgtcca gctgacgata 180cctggagttg gagaggttcc cataagtata tgctcttctc caatgaggaa aggattcttt 240gagctctgta taagaaaggc aggaagggtc acaactgttg tccatagact aaagcctggc 300gatactgttc ttgtgagagg gccttacggt aatggattcc cagtggatga gtgggaagga 360atggatctac tattaatagc tgctggcctt ggaactgcac ctcttaggag cgtctttctc 420tatgcaatgg acaacaggtg gaagtatgga aacattacct tcataaacac cgcacgttat 480gggaaggatc tcctcttcta caaggagctg gaggcaatga aagacctagc tgaggctgaa 540aacgtgaaaa tcatccagag cgtcactagg gatccaaact ggccgggcct aaagggtagg 600ccacagcagt tcatcgttga ggccaacaca aatccaaaga acactgcagt tgcaatctgt 660gggcctccta gaatgtataa gtcagtgttt gaggccctca tcaactacgg ttatcgccca 720gagaacatct tcgtgacatt ggagagaaga atgaaatgtg gaatcgggaa gtgcggccac 780tgcaacgtcg gaacgagcac gagctggaag tacatctgta aagatggacc agtcttcacg 840tacttcgaca tagtttcaac cccaggactg ctggactga 8794292PRTPyrococcus furiosus 4Met Met Leu Pro Lys Glu Ile Met Met Pro Asn Asp Asn Pro Tyr Ala1 5 10 15Leu His Arg Val Lys Val Leu Lys Val Tyr Ser Leu Thr Glu Thr Glu 20 25 30Lys Leu Phe Leu Phe Arg Phe Glu Asp Pro Glu Leu Ala Glu Lys Trp 35 40 45Thr Phe Lys Pro Gly Gln Phe Val Gln Leu Thr Ile Pro Gly Val Gly 50 55 60Glu Val Pro Ile Ser Ile Cys Ser Ser Pro Met Arg Lys Gly Phe Phe65 70 75 80Glu Leu Cys Ile Arg Lys Ala Gly Arg Val Thr Thr Val Val His Arg 85 90 95Leu Lys Pro Gly Asp Thr Val Leu Val Arg Gly Pro Tyr Gly Asn Gly 100 105 110Phe Pro Val Asp Glu Trp Glu Gly Met Asp Leu Leu Leu Ile Ala Ala 115 120 125Gly Leu Gly Thr Ala Pro Leu Arg Ser Val Phe Leu Tyr Ala Met Asp 130 135 140Asn Arg Trp Lys Tyr Gly Asn Ile Thr Phe Ile Asn Thr Ala Arg Tyr145 150 155 160Gly Lys Asp Leu Leu Phe Tyr Lys Glu Leu Glu Ala Met Lys Asp Leu 165 170 175Ala Glu Ala Glu Asn Val Lys Ile Ile Gln Ser Val Thr Arg Asp Pro 180 185 190Asn Trp Pro Gly Leu Lys Gly Arg Pro Gln Gln Phe Ile Val Glu Ala 195 200 205Asn Thr Asn Pro Lys Asn Thr Ala Val Ala Ile Cys Gly Pro Pro Arg 210 215 220Met Tyr Lys Ser Val Phe Glu Ala Leu Ile Asn Tyr Gly Tyr Arg Pro225 230 235 240Glu Asn Ile Phe Val Thr Leu Glu Arg Arg Met Lys Cys Gly Ile Gly 245 250 255Lys Cys Gly His Cys Asn Val Gly Thr Ser Thr Ser Trp Lys Tyr Ile 260 265 270Cys Lys Asp Gly Pro Val Phe Thr Tyr Phe Asp Ile Val Ser Thr Pro 275 280 285Gly Leu Leu Asp 2905786DNAPyrococcus furiosus 5atgggaaaag ttaggattgg attttacgca ttaacctcgt gctacggctg tcaattgcag 60ctagctatga tggacgagtt attacaactt atcccaaatg ctgaaatagt ttgctggttc 120atgattgata gagatagcat tgaggatgaa aaggtcgaca tagcttttat agaaggaagc 180gtttcaactg aggaagaagt tgaactcgtg aaaaaaatta gggagaatgc aaagatcgtc 240gttgcggttg gagcttgtgc tgttcaagga ggagttcaga gctggagtga aaagccatta 300gaagagctct ggaagaaggt ttatggagac gcaaaagtca agttccaacc gaagaaggct 360gaaccagttt caaaatacat aaaagttgac tacaacatct acggttgccc accagagaag 420aaggacttcc tctacgccct gggaacattc ttgattggtt catggccaga ggatatagat 480tatccagttt gtctagaatg taggctcaat ggacatccat gtatccttct tgagaaagga 540gaaccctgtc taggtccagt aacaagggca ggatgtaacg cgagatgtcc aggatttgga 600gttgcgtgta taggatgcag aggggcaata gggtacgatg tagcttggtt cgactctcta 660gctaaggtgt tcaaggagaa ggggatgaca aaagaggaga taattgagag aatgaaaatg 720ttcaatggac atgatgagag ggttgagaaa atggttgaaa aaatattctc aggtggtgaa 780caatga 7866261PRTPyrococcus furiosus 6Met Gly Lys Val Arg Ile Gly Phe Tyr Ala Leu Thr Ser Cys Tyr Gly1 5 10 15Cys Gln Leu Gln Leu Ala Met Met Asp Glu Leu Leu Gln Leu Ile Pro 20 25 30Asn Ala Glu Ile Val Cys Trp Phe Met Ile Asp Arg Asp Ser Ile Glu 35 40 45Asp Glu Lys Val Asp Ile Ala Phe Ile Glu Gly Ser Val Ser Thr Glu 50 55 60Glu Glu Val Glu Leu Val Lys Lys Ile Arg Glu Asn Ala Lys Ile Val65 70 75 80Val Ala Val Gly Ala Cys Ala Val Gln Gly Gly Val Gln Ser Trp Ser 85 90 95Glu Lys Pro Leu Glu Glu Leu Trp Lys Lys Val Tyr Gly Asp Ala Lys 100 105 110Val Lys Phe Gln Pro Lys Lys Ala Glu Pro Val Ser Lys Tyr Ile Lys 115 120 125Val Asp Tyr Asn Ile Tyr Gly Cys Pro Pro Glu Lys Lys Asp Phe Leu 130 135 140Tyr Ala Leu Gly Thr Phe Leu Ile Gly Ser Trp Pro Glu Asp Ile Asp145 150 155 160Tyr Pro Val Cys Leu Glu Cys Arg Leu Asn Gly His Pro Cys Ile Leu 165 170 175Leu Glu Lys Gly Glu Pro Cys Leu Gly Pro Val Thr Arg Ala Gly Cys 180 185 190Asn Ala Arg Cys Pro Gly Phe Gly Val Ala Cys Ile Gly Cys Arg Gly 195 200 205Ala Ile Gly Tyr Asp Val Ala Trp Phe Asp Ser Leu Ala Lys Val Phe 210 215 220Lys Glu Lys Gly Met Thr Lys Glu Glu Ile Ile Glu Arg Met Lys Met225 230 235 240Phe Asn Gly His Asp Glu Arg Val Glu Lys Met Val Glu Lys Ile Phe 245 250 255Ser Gly Gly Glu Gln 26071287DNAPyrococcus furiosus 7atgaagaacc tctatcttcc aatcaccatt gatcatatag caagagttga ggggaagggt 60ggtgtggaga taataattgg ggatgatgga gtcaaggagg tcaagctaaa cataattgaa 120gggcccagat tctttgaggc cataactatt gggaagaagc ttgaggaagc tctggccatt 180tacccgagaa tatgctcatt ctgttcagcc gcccacaagt taaccgcatt agaggctgca 240gaaaaggccg tcggttttgt cccaagggaa gagatacagg cccttagaga agtactatac 300atcggagaca tgatagagag tcatgccctt cacctatatc ttctagttct tcccgactac 360aggggctact cgagcccact taagatggtg aatgaataca agagggagat agagatagcc 420cttaagctga agaaccttgg cacctggatg atggacattc tagggtcaag agccatacac 480caagaaaatg cggttttggg cggattcgga aagctccctg agaagagtgt ccttgagaaa 540atgaaagccg agcttaggga agccctacca cttgccgagt atacttttga gttatttgca 600aagcttgagc agtacagcga agttgaaggg ccaataacac acttggccgt gaagccgagg 660ggagatgctt atggaattta tggagattac ataaaggcaa gtgatgggga ggagttccca 720agtgaaaagt acagagatta tataaaggag ttcgtcgttg aacacagttt tgcaaagcac 780agtcactaca agggcagacc cttcatggtt ggggctatat ctagagttat taacaatgct 840gacctcctat acggcaaggc caaggagctg tatgaggcaa acaaagacct attaaaggga 900acaaatccgt ttgcaaataa cttagcccag gccctcgaaa tagtttactt tatagagagg 960gcaatagatc tgctcgacga ggctctcgcc aagtggccaa ttaagcccag ggatgaagtt 1020gagataaagg acggctttgg tgtctcaacg actgaggctc caaggggaat cttagtctat 1080gccctcaaag ttgagaatgg aagggtttct tatgccgaca taataacacc tacagcattc 1140aacttggcaa tgatggaaga acatgtaaga atgatggcag aaaagcacta caatgacgat 1200ccagaaaggt taaagatact ggctgagatg gttgttaggg cttatgatcc atgcatatct 1260tgctcagtcc acgtggttag actttaa 12878428PRTPyrococcus furiosus 8Met Lys Asn Leu Tyr Leu Pro Ile Thr Ile Asp His Ile Ala Arg Val1 5 10 15Glu Gly Lys Gly Gly Val Glu Ile Ile Ile Gly Asp Asp Gly Val Lys 20 25 30Glu Val Lys Leu Asn Ile Ile Glu Gly Pro Arg Phe Phe Glu Ala Ile 35 40 45Thr Ile Gly Lys Lys Leu Glu Glu Ala Leu Ala Ile Tyr Pro Arg Ile 50 55 60Cys Ser Phe Cys Ser Ala Ala His Lys Leu Thr Ala Leu Glu Ala Ala65 70 75 80Glu Lys Ala Val Gly Phe Val Pro Arg Glu Glu Ile Gln Ala Leu Arg 85 90 95Glu Val Leu Tyr Ile Gly Asp Met Ile Glu Ser His Ala Leu His Leu 100 105 110Tyr Leu Leu Val Leu Pro Asp Tyr Arg Gly Tyr Ser Ser Pro Leu Lys 115 120 125Met Val Asn Glu Tyr Lys Arg Glu Ile Glu Ile Ala Leu Lys Leu Lys 130 135 140Asn Leu Gly Thr Trp Met Met Asp Ile Leu Gly Ser Arg Ala Ile His145 150 155 160Gln Glu Asn Ala Val Leu Gly Gly Phe Gly Lys Leu Pro Glu Lys Ser 165 170 175Val Leu Glu Lys Met Lys Ala Glu Leu Arg Glu Ala Leu Pro Leu Ala 180 185 190Glu Tyr Thr Phe Glu Leu Phe Ala Lys Leu Glu Gln Tyr Ser Glu Val 195 200 205Glu Gly Pro Ile Thr His Leu Ala Val Lys Pro Arg Gly Asp Ala Tyr 210 215 220Gly Ile Tyr Gly Asp Tyr Ile Lys Ala Ser Asp Gly Glu Glu Phe Pro225 230 235 240Ser Glu Lys Tyr Arg Asp Tyr Ile Lys Glu Phe Val Val Glu His Ser 245 250 255Phe Ala Lys His Ser His Tyr Lys Gly Arg Pro Phe Met Val Gly Ala 260 265 270Ile Ser Arg Val Ile Asn Asn Ala Asp Leu Leu Tyr Gly Lys Ala Lys 275 280 285Glu Leu Tyr Glu Ala Asn Lys Asp Leu Leu Lys Gly Thr Asn Pro Phe 290 295 300Ala Asn Asn Leu Ala Gln Ala Leu Glu Ile Val Tyr Phe Ile Glu Arg305 310 315 320Ala Ile Asp Leu Leu Asp Glu Ala Leu Ala Lys Trp Pro Ile Lys Pro 325 330 335Arg Asp Glu Val Glu Ile Lys Asp Gly Phe Gly Val Ser Thr Thr Glu 340 345 350Ala Pro Arg Gly Ile Leu Val Tyr Ala Leu Lys Val Glu Asn Gly Arg 355 360 365Val Ser Tyr Ala Asp Ile Ile Thr Pro Thr Ala Phe Asn Leu Ala Met 370 375 380Met Glu Glu His Val Arg Met Met Ala Glu Lys His Tyr Asn Asp Asp385 390 395 400Pro Glu Arg Leu Lys Ile Leu Ala Glu Met Val Val Arg Ala Tyr Asp 405 410 415Pro Cys Ile Ser Cys Ser Val His Val Val Arg Leu 420 4259228DNAPyrococcus furiosus 9atgtgccttg caatcccagg gaaagtggtg gagattaaag gtaacgttgg aatagtggat 60tttggaggaa tacggagaga ggtaaggtta gatcttttga gtgatgttaa agttggcgat 120tacgttatag ttcacactgg ctttgctata gaaaagttag atgagaggag agctagagaa 180attcttgaag cctgggaaga agttttctca gtaattgggg gtgagtaa 2281075PRTPyrococcus furiosus 10Met Cys Leu Ala Ile Pro Gly Lys Val Val Glu Ile Lys Gly Asn Val1 5 10 15Gly Ile Val Asp Phe Gly Gly Ile Arg Arg Glu Val Arg Leu Asp Leu 20 25 30Leu Ser Asp Val Lys Val Gly Asp Tyr Val Ile Val His Thr Gly Phe 35 40 45Ala Ile Glu Lys Leu Asp Glu Arg Arg Ala Arg Glu Ile Leu Glu Ala 50 55 60Trp Glu Glu Val Phe Ser Val Ile Gly Gly Glu65 70 75111104DNAPyrococcus furiosus 11atgcttgaaa aatttggaga caaagctgta gctcaaaaga ttttagaaaa aattaaagag 60gaagctaaag ggatagaaga gctacgattt atgcacgttt gtgggactca tgaggacaca 120gtaactagga gtggaatcag atcacttctt ccagaaaatg taaaaatcat gagtggccca 180ggatgtcccg tctgtataac ccccgttgag gacatagtga agatgatgga aattatgaaa 240gttgcgagag aggagaggga agaaattatt ctcactactt ttggtgacat gtatagaatt 300ccaactccaa taggaagctt tgcagactta aagagtcagg gttacgatgt gaggatagtt 360tactctatat acgactccta taaaatagcc aaggaaaatc cagataagct tgtagtgcac 420ttttctcctg ggtttgagac taccgccgct ccaacagctg gaatgcttga gagcattgtg 480gaagaggggc tagagaactt taagatttat tccgttcata ggttaacccc tcctgcagtt 540gaagctctcc taaatgcggg gactgttttt cacggtttaa tagatcctgg tcatgtctct 600acaataattg gggtgaaagg atgggcgtat ctcacagaaa agtttggaat tcctcaagtt 660gtggctggct ttgagccagt tgatgtttta ctcggaatac ttattctcat taggcttgtg 720aagaggggcg aagcgaaaat aatcaacgag tataatagag ttgtaaagtg ggaaggaaat 780gtcaaggccc aagaactgat ttggaagtac tttgaagtta aagatgcaaa gtggagggcc 840ctaggagtaa ttccaaggag cggattggaa cttaagaaag agtggaagga gctagaaatt 900agaacttatt acaatcccga ggttccaaag ctcccagatc ttgaaaaagg atgtctctgt 960ggggcagtcc ttagaggatt agccttaccg acccagtgcc aacactttgg aaagacatgt 1020acaccaagac atccggtagg tccttgtatg gtttcgtacg aaggaacttg tcacatattt 1080tacaaatatg gcgccctgat gtag 110412367PRTPyrococcus furiosus 12Met Leu Glu Lys Phe Gly Asp Lys Ala Val Ala Gln Lys Ile Leu Glu1 5 10 15Lys Ile Lys Glu Glu Ala Lys Gly Ile Glu Glu Leu Arg Phe Met His 20 25 30Val Cys Gly Thr His Glu Asp Thr Val Thr Arg Ser Gly Ile Arg Ser 35 40 45Leu Leu Pro Glu Asn Val Lys Ile Met Ser Gly Pro Gly Cys Pro Val 50 55 60Cys Ile Thr Pro Val Glu Asp Ile Val Lys Met Met Glu Ile Met Lys65 70 75 80Val Ala Arg Glu Glu Arg Glu Glu Ile Ile

Leu Thr Thr Phe Gly Asp 85 90 95Met Tyr Arg Ile Pro Thr Pro Ile Gly Ser Phe Ala Asp Leu Lys Ser 100 105 110Gln Gly Tyr Asp Val Arg Ile Val Tyr Ser Ile Tyr Asp Ser Tyr Lys 115 120 125Ile Ala Lys Glu Asn Pro Asp Lys Leu Val Val His Phe Ser Pro Gly 130 135 140Phe Glu Thr Thr Ala Ala Pro Thr Ala Gly Met Leu Glu Ser Ile Val145 150 155 160Glu Glu Gly Leu Glu Asn Phe Lys Ile Tyr Ser Val His Arg Leu Thr 165 170 175Pro Pro Ala Val Glu Ala Leu Leu Asn Ala Gly Thr Val Phe His Gly 180 185 190Leu Ile Asp Pro Gly His Val Ser Thr Ile Ile Gly Val Lys Gly Trp 195 200 205Ala Tyr Leu Thr Glu Lys Phe Gly Ile Pro Gln Val Val Ala Gly Phe 210 215 220Glu Pro Val Asp Val Leu Leu Gly Ile Leu Ile Leu Ile Arg Leu Val225 230 235 240Lys Arg Gly Glu Ala Lys Ile Ile Asn Glu Tyr Asn Arg Val Val Lys 245 250 255Trp Glu Gly Asn Val Lys Ala Gln Glu Leu Ile Trp Lys Tyr Phe Glu 260 265 270Val Lys Asp Ala Lys Trp Arg Ala Leu Gly Val Ile Pro Arg Ser Gly 275 280 285Leu Glu Leu Lys Lys Glu Trp Lys Glu Leu Glu Ile Arg Thr Tyr Tyr 290 295 300Asn Pro Glu Val Pro Lys Leu Pro Asp Leu Glu Lys Gly Cys Leu Cys305 310 315 320Gly Ala Val Leu Arg Gly Leu Ala Leu Pro Thr Gln Cys Gln His Phe 325 330 335Gly Lys Thr Cys Thr Pro Arg His Pro Val Gly Pro Cys Met Val Ser 340 345 350Tyr Glu Gly Thr Cys His Ile Phe Tyr Lys Tyr Gly Ala Leu Met 355 360 365132340DNAPyrococcus furiosus 13atgtatctgg gggagagaat gaaagcttat agaattcacg ttcagggaat agttcaggcc 60gtgggattta ggcccttcgt ttatagaata gctcatgctc acaacttgag gggatacgtt 120aggaacttag gcgatgctgg agttgaaatt gttgtcgagg gaagggagga agacatagag 180gcattcatca aggatttata caagaagaaa cccccacttg caaggattga taaggttgag 240agggaggaaa ttcctcttca gggctttgac agattttaca tagagaaaag ctcgacggaa 300aagaaggggg agggagattc aataatccct ccggacatag ctatttgtga ggactgtctt 360agggagttat ttaatccaac tgacaagcgc tacatgtatc ctttcatagt atgtacaaac 420tgtgggccga ggttcacgat aattgaagat cttccctacg atagggagaa cacagcgatg 480agagaattcc cgatgtgcga gttctgtagg agtgaatacg aggatcccct gaataggagg 540tatcatgcag agccggttgc atgtccaact tgtgggccga gctataggct ttacacgagc 600gatggaaatg agataattgg agaccccctg agaaaggcgg caaaactaat cgataaggga 660tacatagttg cgataaaggg tataggtgga attcatttgg cctgcgatgc tacaagagag 720gatgtggtgg ccgagcttag gaagaggatt tttaggcctc agaagccttt cgccattatg 780gccaaagatt tagaaactgt aaggactttt gcctatattt ctcccgaaga ggaggaagaa 840ttaacaagct atagaaggcc aatagtggct ttgaagaaga aggagccctt cccacttccc 900gaaaacctcg ctcctgggct tcacacaatt ggggtaatgc ttccctatgc tggaacccac 960tacatattat tccactggag caagactcca gtttacgtta tgacttccgc aaacttccca 1020gggatgccga tgataaagga caatgaagag gcatttgaaa agcttaggga cgttgctgac 1080tacctcttgc tccacaatag gagaattcca aatagagctg acgatagcgt tgttcgcttt 1140gtagatggta gaagagctgt tattaggagg agcagaggat ttgttccact tggaatagag 1200attccatttg agtacaaagg attggcagtt ggtgctgagt taatgaatgc tttcggagtt 1260gttaagaatg gaaaagttta tccaagtcag tacatagggg atacatcaaa gattgaagtt 1320ttagagttta tgagggaagc cgtgaggcac ttcttcaaga tattgagagt tgataactta 1380gatctagttg ttgcagattt gcatccaagc tacaacacaa ctaagctggg aatggagatc 1440gctgaggaat ttggggcaga attccttcaa gttcaacatc actacgctca cgtggcctct 1500gtaatggctg agcacaactt ggaggaagtt gttggaattg ctctagatgg tgttgggtat 1560ggaaccgacg gaaaaacttg gggtggggaa gtaatatatc taagctatga agatgtggag 1620aggttggccc acatagagta ttatccactc ccaggagggg atttggccag ctactatccc 1680ttgagggcct taattggaat actcagctta aaccacgact tagaggaagt tgagaaaatc 1740ataagggagt tctgtccaaa tgcaataaag agcttaaagt atggggaaac agagtttagg 1800gtaattatga ggcaactcag cagcgggata aacgttgcct atgcctcttc aacgggaagg 1860gtgcttgatg ccttctcggt acttttgaac gtttcctaca ggaggcacta tgagggagag 1920cctgcgatga agctggagag ctttgcatac caaggaaaga acgatctaaa gctcacggct 1980ccaattgaag gtgaggaaat aaaggtttca gagttgtttg aggaagttct tgagctgatg 2040ggcaaggcca atcctaaaga catagcttac tccgttcact tagccttagc tagggcattt 2100gctgaagtta gcgtggagaa agctaaggag tttggagcta aaactgtcgt tttgggtggg 2160ggagtagggt acaatgagct aatagttaag acgataagaa agatagtaga ggggagaggg 2220ctaaggttct taacaactta cgaagttccc aggggagata atggaattaa tgtaggccag 2280gccttcctgg gaggattgta cttggaagga tacttaaata gggaagattt gagcatttag 234014779PRTPyrococcus furiosus 14Met Tyr Leu Gly Glu Arg Met Lys Ala Tyr Arg Ile His Val Gln Gly1 5 10 15Ile Val Gln Ala Val Gly Phe Arg Pro Phe Val Tyr Arg Ile Ala His 20 25 30Ala His Asn Leu Arg Gly Tyr Val Arg Asn Leu Gly Asp Ala Gly Val 35 40 45Glu Ile Val Val Glu Gly Arg Glu Glu Asp Ile Glu Ala Phe Ile Lys 50 55 60Asp Leu Tyr Lys Lys Lys Pro Pro Leu Ala Arg Ile Asp Lys Val Glu65 70 75 80Arg Glu Glu Ile Pro Leu Gln Gly Phe Asp Arg Phe Tyr Ile Glu Lys 85 90 95Ser Ser Thr Glu Lys Lys Gly Glu Gly Asp Ser Ile Ile Pro Pro Asp 100 105 110Ile Ala Ile Cys Glu Asp Cys Leu Arg Glu Leu Phe Asn Pro Thr Asp 115 120 125Lys Arg Tyr Met Tyr Pro Phe Ile Val Cys Thr Asn Cys Gly Pro Arg 130 135 140Phe Thr Ile Ile Glu Asp Leu Pro Tyr Asp Arg Glu Asn Thr Ala Met145 150 155 160Arg Glu Phe Pro Met Cys Glu Phe Cys Arg Ser Glu Tyr Glu Asp Pro 165 170 175Leu Asn Arg Arg Tyr His Ala Glu Pro Val Ala Cys Pro Thr Cys Gly 180 185 190Pro Ser Tyr Arg Leu Tyr Thr Ser Asp Gly Asn Glu Ile Ile Gly Asp 195 200 205Pro Leu Arg Lys Ala Ala Lys Leu Ile Asp Lys Gly Tyr Ile Val Ala 210 215 220Ile Lys Gly Ile Gly Gly Ile His Leu Ala Cys Asp Ala Thr Arg Glu225 230 235 240Asp Val Val Ala Glu Leu Arg Lys Arg Ile Phe Arg Pro Gln Lys Pro 245 250 255Phe Ala Ile Met Ala Lys Asp Leu Glu Thr Val Arg Thr Phe Ala Tyr 260 265 270Ile Ser Pro Glu Glu Glu Glu Glu Leu Thr Ser Tyr Arg Arg Pro Ile 275 280 285Val Ala Leu Lys Lys Lys Glu Pro Phe Pro Leu Pro Glu Asn Leu Ala 290 295 300Pro Gly Leu His Thr Ile Gly Val Met Leu Pro Tyr Ala Gly Thr His305 310 315 320Tyr Ile Leu Phe His Trp Ser Lys Thr Pro Val Tyr Val Met Thr Ser 325 330 335Ala Asn Phe Pro Gly Met Pro Met Ile Lys Asp Asn Glu Glu Ala Phe 340 345 350Glu Lys Leu Arg Asp Val Ala Asp Tyr Leu Leu Leu His Asn Arg Arg 355 360 365Ile Pro Asn Arg Ala Asp Asp Ser Val Val Arg Phe Val Asp Gly Arg 370 375 380Arg Ala Val Ile Arg Arg Ser Arg Gly Phe Val Pro Leu Gly Ile Glu385 390 395 400Ile Pro Phe Glu Tyr Lys Gly Leu Ala Val Gly Ala Glu Leu Met Asn 405 410 415Ala Phe Gly Val Val Lys Asn Gly Lys Val Tyr Pro Ser Gln Tyr Ile 420 425 430Gly Asp Thr Ser Lys Ile Glu Val Leu Glu Phe Met Arg Glu Ala Val 435 440 445Arg His Phe Phe Lys Ile Leu Arg Val Asp Asn Leu Asp Leu Val Val 450 455 460Ala Asp Leu His Pro Ser Tyr Asn Thr Thr Lys Leu Gly Met Glu Ile465 470 475 480Ala Glu Glu Phe Gly Ala Glu Phe Leu Gln Val Gln His His Tyr Ala 485 490 495His Val Ala Ser Val Met Ala Glu His Asn Leu Glu Glu Val Val Gly 500 505 510Ile Ala Leu Asp Gly Val Gly Tyr Gly Thr Asp Gly Lys Thr Trp Gly 515 520 525Gly Glu Val Ile Tyr Leu Ser Tyr Glu Asp Val Glu Arg Leu Ala His 530 535 540Ile Glu Tyr Tyr Pro Leu Pro Gly Gly Asp Leu Ala Ser Tyr Tyr Pro545 550 555 560Leu Arg Ala Leu Ile Gly Ile Leu Ser Leu Asn His Asp Leu Glu Glu 565 570 575Val Glu Lys Ile Ile Arg Glu Phe Cys Pro Asn Ala Ile Lys Ser Leu 580 585 590Lys Tyr Gly Glu Thr Glu Phe Arg Val Ile Met Arg Gln Leu Ser Ser 595 600 605Gly Ile Asn Val Ala Tyr Ala Ser Ser Thr Gly Arg Val Leu Asp Ala 610 615 620Phe Ser Val Leu Leu Asn Val Ser Tyr Arg Arg His Tyr Glu Gly Glu625 630 635 640Pro Ala Met Lys Leu Glu Ser Phe Ala Tyr Gln Gly Lys Asn Asp Leu 645 650 655Lys Leu Thr Ala Pro Ile Glu Gly Glu Glu Ile Lys Val Ser Glu Leu 660 665 670Phe Glu Glu Val Leu Glu Leu Met Gly Lys Ala Asn Pro Lys Asp Ile 675 680 685Ala Tyr Ser Val His Leu Ala Leu Ala Arg Ala Phe Ala Glu Val Ser 690 695 700Val Glu Lys Ala Lys Glu Phe Gly Ala Lys Thr Val Val Leu Gly Gly705 710 715 720Gly Val Gly Tyr Asn Glu Leu Ile Val Lys Thr Ile Arg Lys Ile Val 725 730 735Glu Gly Arg Gly Leu Arg Phe Leu Thr Thr Tyr Glu Val Pro Arg Gly 740 745 750Asp Asn Gly Ile Asn Val Gly Gln Ala Phe Leu Gly Gly Leu Tyr Leu 755 760 765Glu Gly Tyr Leu Asn Arg Glu Asp Leu Ser Ile 770 77515972DNAPyrococcus furiosus 15atggaagaac taattaggga ggtaatcctc aagaatttaa cccttaattc tgctggagga 60ataggattag aggagcttga tgacggagct acaatccccc ttggagataa gcatttagtg 120tttacaatag atgggcatac agtaaagccg atattcttcc cagggggaga catcggaagg 180ttggccgtta gcggaactgt aaacgatttg gctgtcatgg gagctcaacc cttggcaatt 240gcaagctcgt tgataatcga ggaagggttt gaagttagtg agctggaaaa gattctgaag 300tcgatggacg aaacagctaa agaggttcca gttccaattg ttactggaga cacaaaagtc 360gttgaagaca ggataggaat cttcgttata acagctggag tgggggtagc tgagaggccg 420ataagcgatg ccggcgcaaa agttggggat gtcgttttag tgagtggaac aattggagac 480cacggaatag cactaatgag ccatagagag gggatctcct ttgagacaga gcttaagagc 540gatgtagctc caatttggga tgtcgtaaag gccgttgcag atgccattgg ttgggagaac 600atccacgcaa tgaaagatcc cacaagagga ggattgagca acgcactaaa cgagatggca 660agaaaggcaa acgttggaat tttggtaaga gaggaggcaa taccaattag gccagaagta 720aaagctgcca gcgaaatgct tggaataagt ccctatgaag ttgcaaacga aggaaaagtt 780gtaatgatag tggcgaagga gtatgcggag gaggcacttg aggccatgaa gaagacagaa 840aagggtaggg atgccgcaat aataggagaa gttattggtg aatacagagg aaaagttatt 900ctggagacgg gaattggtgg aagaagattt ttagagccgc ctctcggtga tcccgttcct 960agagtttgtt ag 97216323PRTPyrococcus furiosus 16Met Glu Glu Leu Ile Arg Glu Val Ile Leu Lys Asn Leu Thr Leu Asn1 5 10 15Ser Ala Gly Gly Ile Gly Leu Glu Glu Leu Asp Asp Gly Ala Thr Ile 20 25 30Pro Leu Gly Asp Lys His Leu Val Phe Thr Ile Asp Gly His Thr Val 35 40 45Lys Pro Ile Phe Phe Pro Gly Gly Asp Ile Gly Arg Leu Ala Val Ser 50 55 60Gly Thr Val Asn Asp Leu Ala Val Met Gly Ala Gln Pro Leu Ala Ile65 70 75 80Ala Ser Ser Leu Ile Ile Glu Glu Gly Phe Glu Val Ser Glu Leu Glu 85 90 95Lys Ile Leu Lys Ser Met Asp Glu Thr Ala Lys Glu Val Pro Val Pro 100 105 110Ile Val Thr Gly Asp Thr Lys Val Val Glu Asp Arg Ile Gly Ile Phe 115 120 125Val Ile Thr Ala Gly Val Gly Val Ala Glu Arg Pro Ile Ser Asp Ala 130 135 140Gly Ala Lys Val Gly Asp Val Val Leu Val Ser Gly Thr Ile Gly Asp145 150 155 160His Gly Ile Ala Leu Met Ser His Arg Glu Gly Ile Ser Phe Glu Thr 165 170 175Glu Leu Lys Ser Asp Val Ala Pro Ile Trp Asp Val Val Lys Ala Val 180 185 190Ala Asp Ala Ile Gly Trp Glu Asn Ile His Ala Met Lys Asp Pro Thr 195 200 205Arg Gly Gly Leu Ser Asn Ala Leu Asn Glu Met Ala Arg Lys Ala Asn 210 215 220Val Gly Ile Leu Val Arg Glu Glu Ala Ile Pro Ile Arg Pro Glu Val225 230 235 240Lys Ala Ala Ser Glu Met Leu Gly Ile Ser Pro Tyr Glu Val Ala Asn 245 250 255Glu Gly Lys Val Val Met Ile Val Ala Lys Glu Tyr Ala Glu Glu Ala 260 265 270Leu Glu Ala Met Lys Lys Thr Glu Lys Gly Arg Asp Ala Ala Ile Ile 275 280 285Gly Glu Val Ile Gly Glu Tyr Arg Gly Lys Val Ile Leu Glu Thr Gly 290 295 300Ile Gly Gly Arg Arg Phe Leu Glu Pro Pro Leu Gly Asp Pro Val Pro305 310 315 320Arg Val Cys17420DNAPyrococcus furiosus 17atgcacgaat gggcgttggc agatgcaata gtaaggactg ttttagatta cgctcaaaag 60gagggtgcaa gtagggtaaa ggccgtcaag gtagtcctcg gagaactcca agatgttggg 120gaggatatag taaagtttgc catggaagag ctcttcaggg gaacaatagc ggaaggggca 180gagataatat tcgaagagga agaggccgtc tttaagtgcc gcaactgcgg gcatgtatgg 240aagcttaagg aagtcaaaga taagttggat gagaggataa gagaggacat ccactttatt 300ccagaggtcg ttcatgcatt tctatcctgt ccaaaatgtg gaagccatga ttttgaagtg 360gtgaagggaa ggggagttta catttctgga ataatgatcg agaaggaggg agaagaatga 42018139PRTPyrococcus furiosus 18Met His Glu Trp Ala Leu Ala Asp Ala Ile Val Arg Thr Val Leu Asp1 5 10 15Tyr Ala Gln Lys Glu Gly Ala Ser Arg Val Lys Ala Val Lys Val Val 20 25 30Leu Gly Glu Leu Gln Asp Val Gly Glu Asp Ile Val Lys Phe Ala Met 35 40 45Glu Glu Leu Phe Arg Gly Thr Ile Ala Glu Gly Ala Glu Ile Ile Phe 50 55 60Glu Glu Glu Glu Ala Val Phe Lys Cys Arg Asn Cys Gly His Val Trp65 70 75 80Lys Leu Lys Glu Val Lys Asp Lys Leu Asp Glu Arg Ile Arg Glu Asp 85 90 95Ile His Phe Ile Pro Glu Val Val His Ala Phe Leu Ser Cys Pro Lys 100 105 110Cys Gly Ser His Asp Phe Glu Val Val Lys Gly Arg Gly Val Tyr Ile 115 120 125Ser Gly Ile Met Ile Glu Lys Glu Gly Glu Glu 130 13519726DNAPyrococcus furiosus 19atgatagatc ccagagaact cgcaatttca gcgaagcttg agggagtaaa aagaataatc 60ccagttgtaa gtgggaaggg aggagtagga aaatccctaa tctccacaac tcttgcccta 120gttctatcag aacaaaaata caaagttgga cttctcgact tggatttcca tggagcaagt 180gaccacgtca tcctgggatt tgaacccaaa gaacttcccg aggaagacaa aggagttatt 240cccccaacgg ttcacggaat aaagttcatg acaatagcgt attacaccga ggacaggcca 300actcctttaa gaggaaagga gattagcgac gccctaatag agctactaac aataaccagg 360tgggatgagc tcgacttttt agttgttgac atgccccctg ggatgggaga tcagttctta 420gacgttttaa agtacttcaa gaggggagaa ttcttgatag tcgcaactcc gtcaaagctc 480tctcttaatg ttgttaggaa gcttatagag ttgctaaaag aagagaagca tcagatactt 540ggaatagttg agaatatgaa gctggatgaa gaggaagatg ttatgagaat tgcccaggaa 600tatgggatta ggtatcttgg aggaatacct ctgtacaggg atctagagag taaagttgga 660aatgttaatg aacttttagc cacagagttt gccgagaaaa ttagaggaat agctaaaaag 720atttga 72620241PRTPyrococcus furiosus 20Met Ile Asp Pro Arg Glu Leu Ala Ile Ser Ala Lys Leu Glu Gly Val1 5 10 15Lys Arg Ile Ile Pro Val Val Ser Gly Lys Gly Gly Val Gly Lys Ser 20 25 30Leu Ile Ser Thr Thr Leu Ala Leu Val Leu Ser Glu Gln Lys Tyr Lys 35 40 45Val Gly Leu Leu Asp Leu Asp Phe His Gly Ala Ser Asp His Val Ile 50 55 60Leu Gly Phe Glu Pro Lys Glu Leu Pro Glu Glu Asp Lys Gly Val Ile65 70 75 80Pro Pro Thr Val His Gly Ile Lys Phe Met Thr Ile Ala Tyr Tyr Thr 85 90 95Glu Asp Arg Pro Thr Pro Leu Arg Gly Lys Glu Ile Ser Asp Ala Leu 100 105 110Ile Glu Leu Leu Thr Ile Thr Arg Trp Asp Glu Leu Asp Phe Leu Val 115 120 125Val Asp Met Pro Pro Gly Met Gly Asp Gln Phe Leu Asp Val Leu Lys 130 135 140Tyr Phe Lys Arg Gly Glu Phe Leu Ile Val Ala Thr Pro Ser Lys Leu145 150 155 160Ser Leu Asn Val Val Arg Lys Leu Ile Glu Leu Leu Lys Glu Glu Lys

165 170 175His Gln Ile Leu Gly Ile Val Glu Asn Met Lys Leu Asp Glu Glu Glu 180 185 190Asp Val Met Arg Ile Ala Gln Glu Tyr Gly Ile Arg Tyr Leu Gly Gly 195 200 205Ile Pro Leu Tyr Arg Asp Leu Glu Ser Lys Val Gly Asn Val Asn Glu 210 215 220Leu Leu Ala Thr Glu Phe Ala Glu Lys Ile Arg Gly Ile Ala Lys Lys225 230 235 240Ile21477DNAPyrococcus furiosus 21atggaagagc tgagagaagc tctaaaaaat gctaagagaa ttgtaatatg tggaataggg 60aatgacatca ggggagacga cagcttcggg gtttatattg cagaaaaatt aaagagagtt 120ataaagaagg caaacattct agtcctcaac tgtggagagg ttccagagaa ctacacaggg 180aagatactaa actttcaccc tgatttaatc atttttatag acgcagtaaa cttcggagga 240aagcctggag aaataataat tacagatcca gaaaatactg aaggggccgg agtttccacc 300cacagtcttc ccctcaagtt tttggccact tatctcaaag ctaatacaaa tgccaagaca 360atcttaatag gatgccagcc aaagaacatt gggctttttg aagatatgag cgaagaagta 420aaagccgttg cggaagtctt attaaaattc ctttatgaaa gtcttgagct ttcttag 47722158PRTPyrococcus furiosus 22Met Glu Glu Leu Arg Glu Ala Leu Lys Asn Ala Lys Arg Ile Val Ile1 5 10 15Cys Gly Ile Gly Asn Asp Ile Arg Gly Asp Asp Ser Phe Gly Val Tyr 20 25 30Ile Ala Glu Lys Leu Lys Arg Val Ile Lys Lys Ala Asn Ile Leu Val 35 40 45Leu Asn Cys Gly Glu Val Pro Glu Asn Tyr Thr Gly Lys Ile Leu Asn 50 55 60Phe His Pro Asp Leu Ile Ile Phe Ile Asp Ala Val Asn Phe Gly Gly65 70 75 80Lys Pro Gly Glu Ile Ile Ile Thr Asp Pro Glu Asn Thr Glu Gly Ala 85 90 95Gly Val Ser Thr His Ser Leu Pro Leu Lys Phe Leu Ala Thr Tyr Leu 100 105 110Lys Ala Asn Thr Asn Ala Lys Thr Ile Leu Ile Gly Cys Gln Pro Lys 115 120 125Asn Ile Gly Leu Phe Glu Asp Met Ser Glu Glu Val Lys Ala Val Ala 130 135 140Glu Val Leu Leu Lys Phe Leu Tyr Glu Ser Leu Glu Leu Ser145 150 15523777DNAPyrococcus furiosus 23atgaaagtag agaaaggaga tgtcataaga cttcattaca ctggaaaggt taaagaaact 60ggagaaatct tcgacacaac ttatgaggat gttgcaaaag aagctagaat atacaatcca 120aacggaatct atgggccagt ccctatagcg gttggagcgg gacacgtatt gcccggacta 180gacaagagac ttatagggct tgaagttaag aaaaaatacg tcattgaagt tccacccgaa 240gaaggctttg gattgagaga tccaggaaaa attaagatta tcccacttgg aaagttcaga 300aaatctggaa taatcccgta ccctgggcta gaaattgaag ttgaaacaga aaatgggaga 360aaaatgagag gtagggttct tacagttagc ggaggaagag ttagagtaga cttcaatcat 420ccattagcag gaaagactct cgtatatgaa gttgaagttg ttgagaaaat tgaagatcca 480atagaaaaga ttaaggcact aatagaacta agactgccaa tgattgacaa agataaggtt 540attattgaga ttagtgaaaa agatgtaaag ctaaacttca aagacgttga tattgatcca 600aagacactaa ttttgggcga aattcttctc gaaagtgact tgaaatttat aggatatgag 660aaagttgaat ttgagccaac cattgaagag ttattaaagc ccaagtctgc cgaggagcaa 720gagtctccta acgaagaaca gcaagaggag agtgagtcta aagcggaaga atcttaa 77724258PRTPyrococcus furiosus 24Met Lys Val Glu Lys Gly Asp Val Ile Arg Leu His Tyr Thr Gly Lys1 5 10 15Val Lys Glu Thr Gly Glu Ile Phe Asp Thr Thr Tyr Glu Asp Val Ala 20 25 30Lys Glu Ala Arg Ile Tyr Asn Pro Asn Gly Ile Tyr Gly Pro Val Pro 35 40 45Ile Ala Val Gly Ala Gly His Val Leu Pro Gly Leu Asp Lys Arg Leu 50 55 60Ile Gly Leu Glu Val Lys Lys Lys Tyr Val Ile Glu Val Pro Pro Glu65 70 75 80Glu Gly Phe Gly Leu Arg Asp Pro Gly Lys Ile Lys Ile Ile Pro Leu 85 90 95Gly Lys Phe Arg Lys Ser Gly Ile Ile Pro Tyr Pro Gly Leu Glu Ile 100 105 110Glu Val Glu Thr Glu Asn Gly Arg Lys Met Arg Gly Arg Val Leu Thr 115 120 125Val Ser Gly Gly Arg Val Arg Val Asp Phe Asn His Pro Leu Ala Gly 130 135 140Lys Thr Leu Val Tyr Glu Val Glu Val Val Glu Lys Ile Glu Asp Pro145 150 155 160Ile Glu Lys Ile Lys Ala Leu Ile Glu Leu Arg Leu Pro Met Ile Asp 165 170 175Lys Asp Lys Val Ile Ile Glu Ile Ser Glu Lys Asp Val Lys Leu Asn 180 185 190Phe Lys Asp Val Asp Ile Asp Pro Lys Thr Leu Ile Leu Gly Glu Ile 195 200 205Leu Leu Glu Ser Asp Leu Lys Phe Ile Gly Tyr Glu Lys Val Glu Phe 210 215 220Glu Pro Thr Ile Glu Glu Leu Leu Lys Pro Lys Ser Ala Glu Glu Gln225 230 235 240Glu Ser Pro Asn Glu Glu Gln Gln Glu Glu Ser Glu Ser Lys Ala Glu 245 250 255Glu Ser25386DNAEscherichia coli 25ctcgaattcc ttctctttta ctcgtttagc aaccggctaa acatccccac cgcccggcca 60aaagaaaata ggtccatttt tatcgctaaa agataaatcc acacagtttg tattgttttg 120tgcaaaagtt tcactacgct ttattaacaa tactttctgg cgacgtgcgc cagtgcagaa 180ggatgagctt tcgttttcag catctcacgt gaagcgatgg tttgccttgc tacagggacg 240tcgcttgccg accataagcg cccggtgtcc tgccggtgtc gcaaggagga gagacgtgcg 300atatgggtca tcaccatcat caccacggct cgatcacaag tttgtacaaa aaagcaggct 360cagaaaacct gtattttcag ggagga 38626637DNAEscherichia coli 26ctcgaattct gcagcatgtc accatgacac tgtggacagc ggcggacgcg ctgggtcagt 60agcgtcacat actgttggca tgtttcacac cagcattcgg cctcttgttc ttcgaggtgc 120agtttacaac cttccgccac gctgccgcgg caaaccagat caaaacaaaa ggcaagagag 180ctggtttcga cacaagaaaa tgcgccaatt ttgagccaga ccccagttac gcgttttgcg 240ccgtgttttg cggcctgctg ttcgatcaat tccagtgccc gttggcagag ggttatttcg 300tgcatatcgc ctcccattaa ctattgccag ctacaagcaa taattgtgcc agtgttgatt 360atccctgcgg tgaataatgt cgatgatgtc gaaatgacac gtcgacacgg cgacgaaatt 420catctttagc ttaaaaatct ctttaataac aataaattaa aagttggcac aaaaaatgct 480taaagctggc atctctgtta aacgggtaac ctgacaatga ctatttggga aataagcgag 540aaagccgatt acatcgcaca gcggcatcgt cgcctacagg accagtggca catctactgc 600aattcgctgg ttcaggggag aggaggaata aaaaatg 63727179DNABacillus megaterium 27gaattctaga atctaatatt ataactaaat tttctaaaaa aaacattgga atagacattt 60attttgtata tgatgaaata aagttagttt attggataaa caaactaact ttattaaggt 120agttgatgga taaacttgtt cacttaaatc aacccgggaa caaggaggaa taaaaaatg 17928813DNAEscherichia coli 28ggatccccgt caccctggat gctgtacaat tgacgacgac aagggcccgg gcaaactagt 60aatcagacgc ggtcgttcac ttgttcagca accagatcaa aagccattga ctcagcaagg 120gttgaccgta taattcacgc gattacaccg cattgcggta tcaacgcgcc cttagctcag 180ttggatagag caacgacctt ctaagtcgtg ggccgcaggt tcgaatcctg cagggcgcgc 240cattacaatt caatcagtta cgccttcttt atatcctcca gccatggcct tgaaatggcg 300ttagtcatga aatatagacc gccatcgagt accccttgta cccttaactc ttcctgatac 360gtaaataatg atttggtggc ccttgctgga cttgaaccag cgaccaagcg attatgagtc 420gcctgctcta accactgagc taaagggcct tgagtgtgca ataacaatac ttataaacca 480cgcaataaac atgatgatct agagaatccc gtcgtagcca ccatcttttt ttgcgggagt 540ggcgaaattg gtagacgcac cagatttagg ttctggcgcc gctaggtgtg cgagttcaag 600tctcgcctcc cgcaccattc accagaaagc gttgatcgga tgccctcgag tcgggcagcg 660ttgggtcctg gccacgggtg cgcatgatcg tgctcctgtc gttgaggacc cggctaggct 720ggcggggttg ccttactggt tagcagaatg aatcaccgat acgcgagcga acgtgaagcg 780actgctgctg caaaacgtct gcgacctgag ctc 813298123DNAartificialexpression vector sequence 29ttgtacaaac ttgtgatcga gccgtggtga tgatggtgat gacccatatc gcacgtctct 60cctccttgcg acaccggcag gacaccgggc gcttatggtc ggcaagcgac gtccctgtag 120caaggcaaac catcgcttca cgtgagatgc tgaaaacgaa agctcatcct tctgcactgg 180cgcacgtcgc cagaaagtat tgttaataaa gcgtagtgaa acttttgcac aaaacaatac 240aaactgtgtg gatttatctt ttagcgataa aaatggacct atttttcttt tggccgggcg 300gtggggatgt ttagccggtt gctaaacgag taaaagagaa ggaattcgag ctcgaattcg 360gatcctagag ggaaaccgtt gtggtctccc tatagtgagt cgtattaatt tcgcgggatc 420gagatctcgg gcagcgttgg gtcctggcca cgggtgcgca tgatcgtgct cctgtcgttg 480aggacccggc taggctggcg gggttgcctt actggttagc agaatgaatc accgatacgc 540gagcgaacgt gaagcgactg ctgctgcaaa acgtctgcga cctgagcaac aacatgaatg 600gtcttcggtt tccgtgtttc gtaaagtctg gaaacgcgga agtcagcgcc ctgcaccatt 660atgttccgga tctgcatcgc aggatgctgc tggctaccct gtggaacacc tacatctgta 720ttaacgaagc gctggcattg accctgagtg atttttctct ggtcccgccg catccatacc 780gccagttgtt taccctcaca acgttccagt aaccgggcat gttcatcatc agtaacccgt 840atcgtgagca tcctctctcg tttcatcggt atcattaccc ccatgaacag aaatccccct 900tacacggagg catcagtgac caaacaggaa aaaaccgccc ttaacatggc ccgctttatc 960agaagccaga cattaacgct tctggagaaa ctcaacgagc tggacgcgga tgaacaggca 1020gacatctgtg aatcgcttca cgaccacgct gatgagcttt accgcagctg cctcgcgcgt 1080ttcggtgatg acggtgaaaa cctctgacac atgcagctcc cggagacggt cacagcttgt 1140ctgtaagcgg atgccgggag cagacaagcc cgtcagggcg cgtcagcggg tgttggcggg 1200tgtcggggcg cagccatgac ccagtcacgt agcgatagcg gagtgtatac tggcttaact 1260atgcggcatc agagcagatt gtactgagag tgcaccatat atgcggtgtg aaataccgca 1320cagatgcgta aggagaaaat accgcatcag gcgctcttcc gcttcctcgc tcactgactc 1380gctgcgctcg gtcgttcggc tgcggcgagc ggtatcagct cactcaaagg cggtaatacg 1440gttatccaca gaatcagggg ataacgcagg aaagaacatg tgagcaaaag gccagcaaaa 1500ggccaggaac cgtaaaaagg ccgcgttgct ggcgtttttc cataggctcc gcccccctga 1560cgagcatcac aaaaatcgac gctcaagtca gaggtggcga aacccgacag gactataaag 1620ataccaggcg tttccccctg gaagctccct cgtgcgctct cctgttccga ccctgccgct 1680taccggatac ctgtccgcct ttctcccttc gggaagcgtg gcgctttctc atagctcacg 1740ctgtaggtat ctcagttcgg tgtaggtcgt tcgctccaag ctgggctgtg tgcacgaacc 1800ccccgttcag cccgaccgct gcgccttatc cggtaactat cgtcttgagt ccaacccggt 1860aagacacgac ttatcgccac tggcagcagc cactggtaac aggattagca gagcgaggta 1920tgtaggcggt gctacagagt tcttgaagtg gtggcctaac tacggctaca ctagaaggac 1980agtatttggt atctgcgctc tgctgaagcc agttaccttc ggaaaaagag ttggtagctc 2040ttgatccggc aaacaaacca ccgctggtag cggtggtttt tttgtttgca agcagcagat 2100tacgcgcaga aaaaaaggat ctcaagaaga tcctttgatc ttttctacgg ggtctgacgc 2160tcagtggaac gaaaactcac gttaagggat tttggtcatg agattatcaa aaaggatctt 2220cacctagatc cttttaaatt aaaaatgaag ttttaaatca atctaaagta tatatgagta 2280aacttggtct gacagttacc aatgcttaat cagtgaggca cctatctcag cgatctgtct 2340atttcgttca tccatagttg cctgactccc cgtcgtgtag ataactacga tacgggaggg 2400cttaccatct ggccccagtg ctgcaatgat accgcgagac ccacgctcac cggctccaga 2460tttatcagca ataaaccagc cagccggaag ggccgagcgc agaagtggtc ctgcaacttt 2520atccgcctcc atccagtcta ttaattgttg ccgggaagct agagtaagta gttcgccagt 2580taatagtttg cgcaacgttg ttgccattgc tgcaggcatc gtggtgtcac gctcgtcgtt 2640tggtatggct tcattcagct ccggttccca acgatcaagg cgagttacat gatcccccat 2700gttgtgcaaa aaagcggtta gctccttcgg tcctccgatc gttgtcagaa gtaagttggc 2760cgcagtgtta tcactcatgg ttatggcagc actgcataat tctcttactg tcatgccatc 2820cgtaagatgc ttttctgtga ctggtgagta ctcaaccaag tcattctgag aatagtgtat 2880gcggcgaccg agttgctctt gcccggcgtc aatacgggat aataccgcgc cacatagcag 2940aactttaaaa gtgctcatca ttggaaaacg ttcttcgggg cgaaaactct caaggatctt 3000accgctgttg agatccagtt cgatgtaacc cactcgtgca cccaactgat cttcagcatc 3060ttttactttc accagcgttt ctgggtgagc aaaaacagga aggcaaaatg ccgcaaaaaa 3120gggaataagg gcgacacgga aatgttgaat actcatactc ttcctttttc aatattattg 3180aagcatttat cagggttatt gtctcatgag cggatacata tttgaatgta tttagaaaaa 3240taaacaaata ggggttccgc gcacatttcc ccgaaaagtg ccacctgaaa ttgtaaacgt 3300taatattttg ttaaaattcg cgttaaattt ttgttaaatc agctcatttt ttaaccaata 3360ggccgaaatc ggcaaaatcc cttataaatc aaaagaatag accgagatag ggttgagtgt 3420tgttccagtt tggaacaaga gtccactatt aaagaacgtg gactccaacg tcaaagggcg 3480aaaaaccgtc tatcagggcg atggcccact acgtgaacca tcaccctaat caagtttttt 3540ggggtcgagg tgccgtaaag cactaaatcg gaaccctaaa gggagccccc gatttagagc 3600ttgacgggga aagccggcga acgtggcgag aaaggaaggg aagaaagcga aaggagcggg 3660cgctagggcg ctggcaagtg tagcggtcac gctgcgcgta accaccacac ccgccgcgct 3720taatgcgccg ctacagggcg cgtcccattc gccaatccgg atatagttcc tcctttcagc 3780aaaaaacccc tcaagacccg tttagaggcc ccaaggggtt atgctagtta ttgctcagcg 3840gtggcagcag ccaactcagc ttcctttcgg gctttgttag cagccggatc tcagtggtgg 3900tggtggtggt gctcgagtgc ggccgcaagc ttgtcgacgg agcgcaagct tagcagccgg 3960atctgatctt aattaattat caccactttg tacaagaaag ctgggtctcc tccctgaaaa 4020tacaggtttt cctaaagtct aaccacgtgg actgagcaag atatgcatgg atcataagcc 4080ctaacaacca tctcagccag tatctttaac ctttctggat cgtcattgta gtgcttttct 4140gccatcattc ttacatgttc ttccatcatt gccaagttga atgctgtagg tgttattatg 4200tcggcataag aaacccttcc attctcaact ttgagggcat agactaagat tccccttgga 4260gcctcagtcg ttgagacacc aaagccgtcc tttatctcaa cttcatccct gggcttaatt 4320ggccacttgg cgagagcctc gtcgagcaga tctattgccc tctctataaa gtaaactatt 4380tcgagggcct gggctaagtt atttgcaaac ggatttgttc cctttaatag gtctttgttt 4440gcctcataca gctccttggc cttgccgtat aggaggtcag cattgttaat aactctagat 4500atagccccaa ccatgaaggg tctgcccttg tagtgactgt gctttgcaaa actgtgttca 4560acgacgaact cctttatata atctctgtac ttttcacttg ggaactcctc cccatcactt 4620gcctttatgt aatctccata aattccataa gcatctcccc tcggcttcac ggccaagtgt 4680gttattggcc cttcaacttc gctgtactgc tcaagctttg caaataactc aaaagtatac 4740tcggcaagtg gtagggcttc cctaagctcg gctttcattt tctcaaggac actcttctca 4800gggagctttc cgaatccgcc caaaaccgca ttttcttggt gtatggctct tgaccctaga 4860atgtccatca tccaggtgcc aaggttcttc agcttaaggg ctatctctat ctccctcttg 4920tattcattca ccatcttaag tgggctcgag tagcccctgt agtcgggaag aactagaaga 4980tataggtgaa gggcatgact ctctatcatg tctccgatgt atagtacttc tctaagggcc 5040tgtatctctt cccttgggac aaaaccgacg gccttttctg cagcctctaa tgcggttaac 5100ttgtgggcgg ctgaacagaa tgagcatatt ctcgggtaaa tggccagagc ttcctcaagc 5160ttcttcccaa tagttatggc ctcaaagaat ctgggccctt caattatgtt tagcttgacc 5220tccttgactc catcatcccc aattattatc tccacaccac ccttcccctc aactcttgct 5280atatgatcaa tggtgattgg aagatagagg ttcttcattg ttcaccacct gagaatattt 5340tttcaaccat tttctcaacc ctctcatcat gtccattgaa cattttcatt ctctcaatta 5400tctcctcttt tgtcatcccc ttctccttga acaccttagc tagagagtcg aaccaagcta 5460catcgtaccc tattgcccct ctgcatccta tacacgcaac tccaaatcct ggacatctcg 5520cgttacatcc tgcccttgtt actggaccta gacagggttc tcctttctca agaaggatac 5580atggatgtcc attgagccta cattctagac aaactggata atctatatcc tctggccatg 5640aaccaatcaa gaatgttccc agggcgtaga ggaagtcctt cttctctggt gggcaaccgt 5700agatgttgta gtcaactttt atgtattttg aaactggttc agccttcttc ggttggaact 5760tgacttttgc gtctccataa accttcttcc agagctcttc taatggcttt tcactccagc 5820tctgaactcc tccttgaaca gcacaagctc caaccgcaac gacgatcttt gcattctccc 5880taattttttt cacgagttca acttcttcct cagttgaaac gcttccttct ataaaagcta 5940tgtcgacctt ttcatcctca atgctatctc tatcaatcat gaaccagcaa actatttcag 6000catttgggat aagttgtaat aactcgtcca tcatagctag ctgcaattga cagccgtagc 6060acgaggttaa tgcgtaaaat ccaatcctaa cttttcccat tttcctcacc tcagtccagc 6120agtcctgggg ttgaaactat gtcgaagtac gtgaagactg gtccatcttt acagatgtac 6180ttccagctcg tgctcgttcc gacgttgcag tggccgcact tcccgattcc acatttcatt 6240cttctctcca atgtcacgaa gatgttctct gggcgataac cgtagttgat gagggcctca 6300aacactgact tatacattct aggaggccca cagattgcaa ctgcagtgtt ctttggattt 6360gtgttggcct caacgatgaa ctgctgtggc ctacccttta ggcccggcca gtttggatcc 6420ctagtgacgc tctggatgat tttcacgttt tcagcctcag ctaggtcttt cattgcctcc 6480agctccttgt agaagaggag atccttccca taacgtgcgg tgtttatgaa ggtaatgttt 6540ccatacttcc acctgttgtc cattgcatag agaaagacgc tcctaagagg tgcagttcca 6600aggccagcag ctattaatag tagatccatt ccttcccact catccactgg gaatccatta 6660ccgtaaggcc ctctcacaag aacagtatcg ccaggcttta gtctatggac aacagttgtg 6720acccttcctg cctttcttat acagagctca aagaatcctt tcctcattgg agaagagcat 6780atacttatgg gaacctctcc aactccaggt atcgtcagct ggacaaactg tccaggtttg 6840aacgtccact tctctgccaa ctcgggatcc tcaaatctaa agaggaaaag cttttccgtt 6900tccgtcaagg agtaaacctt tagaactttg actctatgaa gggcatacgg attatcattt 6960ggcatcataa tctcttttgg caacatcata ctccatcacc tctaatgtta gaggaatatg 7020caaatcctct ctttggaatc tcctcactaa ccgttggggg acatttgttc tcctcaagtc 7080ctaaaatcct tctaagattg cctacaaaac ttatattggc tggacagaat gcagtacacc 7140ttccacaacc gacacagtag cttaatccaa gcttttcgtt atatgcgttc ttacagaggt 7200atctgttcct aaagcgatcc ttctttgtgg gcctgaagtt gtggccccca gcaactaagc 7260catgacttct gaactgacaa gaatcccatc ttctttccct gtatccagta actccatcta 7320ggtttacaat atcctgaact tcatagcatc tacacgttgg gcatgtggtg ttacatattc 7380cacaagccaa gcacttatct gcctcctcat cccacattgg atgttccatt tccaactcga 7440gaagatacct caagttgccc cagtcttcgt ggtatttgaa tgcttgctgt ctcctctttt 7500caaaatctct aaatgcacag atatccttgt ccgttacctc ttcaaagagc tttatgttct 7560tgtcaacaag cctgtgccca gttggagtgc caacccttac caaccatcca tcgggcagtt 7620catggaagaa caagtcaaaa ccatcatcag cgaagtctgt ttctcttaag ttacagaagc 7680aatattcatc tggcatacag cttattccaa tgattatccc cttctctctc ctcaccttgt 7740agtacttgtc ggggaactca tcaaggtata ccgtgtctag gatctttagg ccatatatgt 7800cacacgcgtg gactccaaat ataataaatg gttcaacttc ctctattacc tccctgtatt 7860ctggttttga aatgtcgaac tcaaagagct tttccctcgg cttgaagaag aacttcttag 7920gtggcattat tgtcctgttg tagtggaatt ctatctttct aacatcatca atctccctga 7980agtcatagaa cttgtccgaa atttttactg gagcgtaaag cttcccccag tctttaagtc 8040tttccaaaaa ctcgtaagtg ttttccttgg gtaacttaac ataccttcct ccctgaaaat 8100acaggttttc tgagcctgct ttt 8123307025DNAartificialexpression vector sequence 30ttgtacaaag tggttgatga gtccggatcc caattgggag ctcgtgtaca cggcgcgcct 60gcaggtcgac aagcttgcgg ccgcactcga gtctggtaaa gaaaccgctg ctgcgaaatt 120tgaacgccag cacatggact cgtctactag cgcagcttaa ttaacctagg ctgctgccac 180cgctgagcaa taactagcat aaccccttgg ggcctctaaa cgggtcttga ggggtttttt 240gctgaaacct caggcatttg

agaagcacac ggtcacactg cttccggtag tcaataaacc 300ggtaaaccag caatagacat aagcggctat ttaacgaccc tgccctgaac cgacgaccgg 360gtcatcgtgg ccggatcttg cggcccctcg gcttgaacga attgttagac attatttgcc 420gactaccttg gtgatctcgc ctttcacgta gtggacaaat tcttccaact gatctgcgcg 480cgaggccaag cgatcttctt cttgtccaag ataagcctgt ctagcttcaa gtatgacggg 540ctgatactgg gccggcaggc gctccattgc ccagtcggca gcgacatcct tcggcgcgat 600tttgccggtt actgcgctgt accaaatgcg ggacaacgta agcactacat ttcgctcatc 660gccagcccag tcgggcggcg agttccatag cgttaaggtt tcatttagcg cctcaaatag 720atcctgttca ggaaccggat caaagagttc ctccgccgct ggacctacca aggcaacgct 780atgttctctt gcttttgtca gcaagatagc cagatcaatg tcgatcgtgg ctggctcgaa 840gatacctgca agaatgtcat tgcgctgcca ttctccaaat tgcagttcgc gcttagctgg 900ataacgccac ggaatgatgt cgtcgtgcac aacaatggtg acttctacag cgcggagaat 960ctcgctctct ccaggggaag ccgaagtttc caaaaggtcg ttgatcaaag ctcgccgcgt 1020tgtttcatca agccttacgg tcaccgtaac cagcaaatca atatcactgt gtggcttcag 1080gccgccatcc actgcggagc cgtacaaatg tacggccagc aacgtcggtt cgagatggcg 1140ctcgatgacg ccaactacct ctgatagttg agtcgatact tcggcgatca ccgcttccct 1200catactcttc ctttttcaat attattgaag catttatcag ggttattgtc tcatgagcgg 1260atacatattt gaatgtattt agaaaaataa acaaatagct agctcactcg gtcgctacgc 1320tccgggcgtg agactgcggc gggcgctgcg gacacataca aagttaccca cagattccgt 1380ggataagcag gggactaaca tgtgaggcaa aacagcaggg ccgcgccggt ggcgtttttc 1440cataggctcc gccctcctgc cagagttcac ataaacagac gcttttccgg tgcatctgtg 1500ggagccgtga ggctcaacca tgaatctgac agtacgggcg aaacccgaca ggacttaaag 1560atccccaccg ttccggcggg tcgctccctc ttgcgctctc ctgttccgac cctgccgttt 1620accggatacc tgttccgcct ttctccctta cgggaagtgt ggcgctttct catagctcac 1680acactggtat ctcggctcgg tgtaggtcgt tcgctccaag ctgggctgta agcaagaact 1740ccccgttcag cccgactgct gcgccttatc cggtaactgt tcacttgagt ccaacccgga 1800aaagcacggt aaaacgccac tggcagcagc cattggtaac tgggagttcg cagaggattt 1860gtttagctaa acacgcggtt gctcttgaag tgtgcgccaa agtccggcta cactggaagg 1920acagatttgg ttgctgtgct ctgcgaaagc cagttaccac ggttaagcag ttccccaact 1980gacttaacct tcgatcaaac cacctcccca ggtggttttt tcgtttacag ggcaaaagat 2040tacgcgcaga aaaaaaggat ctcaagaaga tcctttgatc ttttctactg aaccgctcta 2100gatttcagtg caatttatct cttcaaatgt agcacctgaa gtcagcccca tacgatataa 2160gttgtaattc tcatgttagt catgccccgc gcccaccgga aggagctgac tgggttgaag 2220gctctcaagg gcatcggtcg agatcccggt gcctaatgag tgagctaact tacattaatt 2280gcgttgcgct cactgcccgc tttccagtcg ggaaacctgt cgtgccagct gcattaatga 2340atcggccaac gcgcggggag aggcggtttg cgtattgggc gccagggtgg tttttctttt 2400caccagtgag acgggcaaca gctgattgcc cttcaccgcc tggccctgag agagttgcag 2460caagcggtcc acgctggttt gccccagcag gcgaaaatcc tgtttgatgg tggttaacgg 2520cgggatataa catgagctgt cttcggtatc gtcgtatccc actaccgaga tgtccgcacc 2580aacgcgcagc ccggactcgg taatggcgcg cattgcgccc agcgccatct gatcgttggc 2640aaccagcatc gcagtgggaa cgatgccctc attcagcatt tgcatggttt gttgaaaacc 2700ggacatggca ctccagtcgc cttcccgttc cgctatcggc tgaatttgat tgcgagtgag 2760atatttatgc cagccagcca gacgcagacg cgccgagaca gaacttaatg ggcccgctaa 2820cagcgcgatt tgctggtgac ccaatgcgac cagatgctcc acgcccagtc gcgtaccgtc 2880ttcatgggag aaaataatac tgttgatggg tgtctggtca gagacatcaa gaaataacgc 2940cggaacatta gtgcaggcag cttccacagc aatggcatcc tggtcatcca gcggatagtt 3000aatgatcagc ccactgacgc gttgcgcgag aagattgtgc accgccgctt tacaggcttc 3060gacgccgctt cgttctacca tcgacaccac cacgctggca cccagttgat cggcgcgaga 3120tttaatcgcc gcgacaattt gcgacggcgc gtgcagggcc agactggagg tggcaacgcc 3180aatcagcaac gactgtttgc ccgccagttg ttgtgccacg cggttgggaa tgtaattcag 3240ctccgccatc gccgcttcca ctttttcccg cgttttcgca gaaacgtggc tggcctggtt 3300caccacgcgg gaaacggtct gataagagac accggcatac tctgcgacat cgtataacgt 3360tactggtttc acattcacca ccctgaattg actctcttcc gggcgctatc atgccatacc 3420gcgaaaggtt ttgcgccatt cgatggtgtc cgggatctcg acgctctccc ttatgcgact 3480cctgcattag gaaattaata cgactcacta taggggaatt gtgagcggat aacaattccc 3540ctgtagaaat aattttgttt aactttaata aggagatata ccatggcaca tcaccaccac 3600catcacgtgg gtaccggttc gaatgatctc gaattccttc tcttttactc gtttagcaac 3660cggctaaaca tccccaccgc ccggccaaaa gaaaaatagg tccattttta tcgctaaaag 3720ataaatccac acagtttgta ttgttttgtg caaaagtttc actacgcttt attaacaata 3780ctttctggcg acgtgcgcca gtgcagaagg atgagctttc gttttcagca tctcacgtga 3840agcgatggtt tgccttgcta cagggacgtc gcttgccgac cataagcgcc cggtgtcctg 3900ccggtgtcgc aaggaggaga gacgtgcgat atgggtcatc accatcatca ccacatcgac 3960gacaaatcaa caagtttgta caaaaaagca ggctcagaaa acctgtattt tcagggagga 4020tgccttgcaa tcccagggaa agtggtggag attaaaggta acgttggaat agtggatttt 4080ggaggaatac ggagagaggt aaggttagat cttttgagtg atgttaaagt tggcgattac 4140gttatagttc acactggctt tgctatagaa aagttagatg agaggagagc tagagaaatt 4200cttgaagcct gggaagaagt tttctcagta attgggggtg agtaaatgct tgaaaaattt 4260ggagacaaag ctgtagctca aaagatttta gaaaaaatta aagaggaagc taaagggata 4320gaagagctac gatttatgca cgtttgtggg actcatgagg acacagtaac taggagtgga 4380atcagatcac ttcttccaga aaatgtaaaa atcatgagtg gcccaggatg tcccgtctgt 4440ataacccccg ttgaggacat agtgaagatg atggaaatta tgaaagttgc gagagaggag 4500agggaagaaa ttattctcac tacttttggt gacatgtata gaattccaac tccaatagga 4560agctttgcag acttaaagag tcagggttac gatgtgagga tagtttactc tatatacgac 4620tcctataaaa tagccaagga aaatccagat aagcttgtag tgcacttttc tcctgggttt 4680gagactaccg ccgctccaac agctggaatg cttgagagca ttgtggaaga ggggctagag 4740aactttaaga tttattccgt tcataggtta acccctcctg cagttgaagc tctcctaaat 4800gcggggactg tttttcacgg tttaatagat cctggtcatg tctctacaat aattggggtg 4860aaaggatggg cgtatctcac agaaaagttt ggaattcctc aagttgtggc tggctttgag 4920ccagttgatg ttttactcgg aatacttatt ctcattaggc ttgtgaagag gggcgaagcg 4980aaaataatca acgagtataa tagagttgta aagtgggaag gaaatgtcaa ggcccaagaa 5040ctgatttgga agtactttga agttaaagat gcaaagtgga gggccctagg agtaattcca 5100aggagcggat tggaacttaa gaaagagtgg aaggagctag aaattagaac ttattacaat 5160cccgaggttc caaagctccc agatcttgaa aaaggatgtc tctgtggggc agtccttaga 5220ggattagcct taccgaccca gtgccaacac tttggaaaga catgtacacc aagacatccg 5280gtaggtcctt gtatggtttc gtacgaagga acttgtcaca tattttacaa atatggcgcc 5340ctgatgtagg aggtggaaaa tgcacgaatg ggcgttggca gatgcaatag taaggactgt 5400tttagattac gctcaaaagg agggtgcaag tagggtaaag gccgtcaagg tagtcctcgg 5460agaactccaa gatgttgggg aggatatagt aaagtttgcc atggaagagc tcttcagggg 5520aacaatagcg gaaggggcag agataatatt cgaagaggaa gaggccgtct ttaagtgccg 5580caactgcggg catgtatgga agcttaagga agtcaaagat aagttggatg agaggataag 5640agaggacatc cactttattc cagaggtcgt tcatgcattt ctatcctgtc caaaatgtgg 5700aagccatgat tttgaagtgg tgaagggaag gggagtttac atttctggaa taatgatcga 5760gaaggaggga gaagaatgat agatcccaga gaactcgcaa tttcagcgaa gcttgaggga 5820gtaaaaagaa taatcccagt tgtaagtggg aagggaggag taggaaaatc cctaatctcc 5880acaactcttg ccctagttct atcagaacaa aaatacaaag ttggacttct cgacttggat 5940ttccatgagc aagtgaccac gtcatcctgg gatttgaacc caaagaactt cccgaggaag 6000acaaaggagt tattccccca acggttcacg gaataaagtt catgacaata gcgtattaca 6060ccgaggacag gccaactcct ttaagaggaa aggagattag cgacgcccta atagagctac 6120taacaataac caggtgggat gagctcgact ttttagttgt tgacatgccc cctgggatgg 6180gagatcagtt cttagacgtt ttaaagtact tcaagagggg agaattcttg atagtcgcaa 6240ctccgtcaaa gctctctctt aatgttgtta ggaagcttat agagttgcta aaagaagaga 6300agcatcagat acttggaata gttgagaata tgaagctgga tgaagaggaa gatgttatga 6360gaattgccca ggaatatggg attaggtatc ttggaggaat acctctgtac agggatctag 6420agagtaaagt tggaaatgtt aatgaacttt tagccacaga gtttgccgag aaaattagag 6480gaatagctaa aaagatttga ctggtgcaag ctatggaaga gctgagagaa gctctaaaaa 6540atgctaagag aattgtaata tgtggaatag ggaatgacat caggggagac gacagcttcg 6600gggtttatat tgcagaaaaa ttaaagagag ttataaagaa ggcaaacatt ctagtcctca 6660actgtggaga ggttccagag aactacacag ggaagatact aaactttcac cctgatttaa 6720tcatttttat agacgcagta aacttcggag gaaagcctgg agaaataata attacagatc 6780cagaaaatac tgaaggggcc ggagtttcca cccacagtct tcccctcaag tttttggcca 6840cttatctcaa agctaataca aatgccaaga caatcttaat aggatgccag ccaaagaaca 6900ttgggctttt tgaagatatg agcgaagaag taaaagccgt tgcggaagtc ttattaaaat 6960tcctttatga aagtcttgag ctttcttagg aaaacctgta ttttcaggga ggagacccag 7020ctttc 7025317623DNAartificialexpression vector sequence 31ttgtacaaag tggtgataat taattaagat cagatccggc tgctaagctt gcgctcggcg 60cgcctgcagg tcgacaagct tgcggccgca taatgcttaa gtcgaacaga aagtaatcgt 120attgtacacg gccgcataat cgaaattaat acgactcact ataggggaat tgtgagcgga 180taacaattcc ccatcttagt atattagtta agtataagaa ggagatatac atatggcaga 240tctcaattgg atatcggccg gccacgcgat cgctgacgtc ggtaccctcg agtctggtaa 300agaaaccgct gctgcgaaat ttgaacgcca gcacatggac tcgtctacta gcgcagctta 360attaacctag gctgctgcca ccgctgagca ataactagca taaccccttg gggcctctaa 420acgggtcttg aggggttttt tgctgaaacc tcaggcattt gagaagcaca cggtcacact 480gcttccggta gtcaataaac cggtaaacca gcaatagaca taagcggcta tttaacgacc 540ctgccctgaa ccgacgacaa gctgacgacc gggtctccgc aagtggcact tttcggggaa 600atgtgcgcgg aacccctatt tgtttatttt tctaaataca ttcaaatatg tatccgctca 660tgaattaatt cttagaaaaa ctcatcgagc atcaaatgaa actgcaattt attcatatca 720ggattatcaa taccatattt ttgaaaaagc cgtttctgta atgaaggaga aaactcaccg 780aggcagttcc ataggatggc aagatcctgg tatcggtctg cgattccgac tcgtccaaca 840tcaatacaac ctattaattt cccctcgtca aaaataaggt tatcaagtga gaaatcacca 900tgagtgacga ctgaatccgg tgagaatggc aaaagtttat gcatttcttt ccagacttgt 960tcaacaggcc agccattacg ctcgtcatca aaatcactcg catcaaccaa accgttattc 1020attcgtgatt gcgcctgagc gagacgaaat acgcggtcgc tgttaaaagg acaattacaa 1080acaggaatcg aatgcaaccg gcgcaggaac actgccagcg catcaacaat attttcacct 1140gaatcaggat attcttctaa tacctggaat gctgttttcc cggggatcgc agtggtgagt 1200aaccatgcat catcaggagt acggataaaa tgcttgatgg tcggaagagg cataaattcc 1260gtcagccagt ttagtctgac catctcatct gtaacatcat tggcaacgct acctttgcca 1320tgtttcagaa acaactctgg cgcatcgggc ttcccataca atcgatagat tgtcgcacct 1380gattgcccga cattatcgcg agcccattta tacccatata aatcagcatc catgttggaa 1440tttaatcgcg gcctagagca agacgtttcc cgttgaatat ggctcatact cttccttttc 1500aatattattg aagcatttat cagggttatt gtctcatgag cggatacata tttgaatgta 1560tttagaaaaa taaacaaata ggcatgcagc gctcttccgc ttcctcgctc actgactcgc 1620tacgctcggt cgttcgactg cggcgagcgg tgtcagctca ctcaaaagcg gtaatacggt 1680tatccacaga atcaggggat aaagccggaa agaacatgtg agcaaaaagc aaagcaccgg 1740aagaagccaa cgccgcaggc gtttttccat aggctccgcc cccctgacga gcatcacaaa 1800aatcgacgct caagccagag gtggcgaaac ccgacaggac tataaagata ccaggcgttt 1860ccccctggaa gctccctcgt gcgctctcct gttccgaccc tgccgcttac cggatacctg 1920tccgcctttc tcccttcggg aagcgtggcg ctttctcata gctcacgctg ttggtatctc 1980agttcggtgt aggtcgttcg ctccaagctg ggctgtgtgc acgaaccccc cgttcagccc 2040gaccgctgcg ccttatccgg taactatcgt cttgagtcca acccggtaag acacgactta 2100tcgccactgg cagcagccat tggtaactga tttagaggac tttgtcttga agttatgcac 2160ctgttaaggc taaactgaaa gaacagattt tggtgagtgc ggtcctccaa cccacttacc 2220ttggttcaaa gagttggtag ctcagcgaac cttgagaaaa ccaccgttgg tagcggtggt 2280ttttctttat ttatgagatg atgaatcaat cggtctatca agtcaacgaa cagctattcc 2340gttactctag atttcagtgc aatttatctc ttcaaatgta gcacctgaag tcagccccat 2400acgatataag ttgtaattct catgttagtc atgccccgcg cccaccggaa ggagctgact 2460gggttgaagg ctctcaaggg catcggtcga gatcccggtg cctaatgagt gagctaactt 2520acattaattg cgttgcgctc actgcccgct ttccagtcgg gaaacctgtc gtgccagctg 2580cattaatgaa tcggccaacg cgcggggaga ggcggtttgc gtattgggcg ccagggtggt 2640ttttcttttc accagtgaga cgggcaacag ctgattgccc ttcaccgcct ggccctgaga 2700gagttgcagc aagcggtcca cgctggtttg ccccagcagg cgaaaatcct gtttgatggt 2760ggttaacggc gggatataac atgagctgtc ttcggtatcg tcgtatccca ctaccgagat 2820gtccgcacca acgcgcagcc cggactcggt aatggcgcgc attgcgccca gcgccatctg 2880atcgttggca accagcatcg cagtgggaac gatgccctca ttcagcattt gcatggtttg 2940ttgaaaaccg gacatggcac tccagtcgcc ttcccgttcc gctatcggct gaatttgatt 3000gcgagtgaga tatttatgcc agccagccag acgcagacgc gccgagacag aacttaatgg 3060gcccgctaac agcgcgattt gctggtgacc caatgcgacc agatgctcca cgcccagtcg 3120cgtaccgtct tcatgggaga aaataatact gttgatgggt gtctggtcag agacatcaag 3180aaataacgcc ggaacattag tgcaggcagc ttccacagca atggcatcct ggtcatccag 3240cggatagtta atgatcagcc cactgacgcg ttgcgcgaga agattgtgca ccgccgcttt 3300acaggcttcg acgccgcttc gttctaccat cgacaccacc acgctggcac ccagttgatc 3360ggcgcgagat ttaatcgccg cgacaatttg cgacggcgcg tgcagggcca gactggaggt 3420ggcaacgcca atcagcaacg actgtttgcc cgccagttgt tgtgccacgc ggttgggaat 3480gtaattcagc tccgccatcg ccgcttccac tttttcccgc gttttcgcag aaacgtggct 3540ggcctggttc accacgcggg aaacggtctg ataagagaca ccggcatact ctgcgacatc 3600gtataacgtt actggtttca cattcaccac cctgaattga ctctcttccg ggcgctatca 3660tgccataccg cgaaaggttt tgcgccattc gatggtgtcc gggatctcga cgctctccct 3720tatgcgactc ctgcattagg aaattaatac gactcactat aggggaattg tgagcggata 3780acaattcccc tgtagaaata attttgttta actttaataa ggagatatac catgggcagc 3840agccatcacc atcatcacca cagccaggat ccgaattcga gctcgaattc cttctctttt 3900actcgtttag caaccggcta aacatcccca ccgcccggcc aaaagaaaaa taggtccatt 3960tttatcgcta aaagataaat ccacacagtt tgtattgttt tgtgcaaaag tttcactacg 4020ctttattaac aatactttct ggcgacgtgc gccagtgcag aaggatgagc tttcgttttc 4080agcatctcac gtgaagcgat ggtttgcctt gctacaggga cgtcgcttgc cgaccataag 4140cgcccggtgt cctgccggtg tcgcaaggag gagagacgtg cgatatgggt catcaccatc 4200atcaccacgg ctcgatcaca agtttgtaca aaaaagcagg ctcagaaaac ctgtattttc 4260agggaggaga agaactaatt agggaggtaa tcctcaagaa tttaaccctt aattctgctg 4320gaggaatagg attagaggag cttgatgacg gagctacaat cccccttgga gataagcatt 4380tagtgtttac aatagatggg catacagtaa agccgatatt cttcccaggg ggagacatcg 4440gaaggttggc cgttagcgga actgtaaacg atttggctgt catgggagct caacccttgg 4500caattgcaag ctcgttgata atcgaggaag ggtttgaagt tagtgagctg gaaaagattc 4560tgaagtcgat ggacgaaaca gctaaagagg ttccagttcc aattgttact ggagacacaa 4620aagtcgttga agacaggata ggaatcttcg ttataacagc tggagtgggg gtagctgaga 4680ggccgataag cgatgccggc gcaaaagttg gggatgtcgt tttagtgagt ggaacaattg 4740gagaccacgg aatagcacta atgagccata gagaggggat ctcctttgag acagagctta 4800agagcgatgt agctccaatt tgggatgtcg taaaggccgt tgcagatgcc attggttggg 4860agaacatcca cgcaatgaaa gatcccacaa gaggaggatt gagcaacgca ctaaacgaga 4920tggcaagaaa ggcaaacgtt ggaattttgg taagagagga ggcaatacca attaggccag 4980aagtaaaagc tgccagcgaa atgcttggaa taagtcccta tgaagttgca aacgaaggaa 5040aagttgtaat gatagtggcg aaggagtatg cggaggaggc acttgaggcc atgaagaaga 5100cagaaaaggg tagggatgcc gcaataatag gagaagttat tggtgaatac agaggaaaag 5160ttattctgga gacgggaatt ggtggaagaa gatttttaga gccgcctctc ggtgatcccg 5220ttcctagagt ttgttaggag gtggaaaatg tatctggggg agagaatgaa agcttataga 5280attcacgttc agggaatagt tcaggccgtg ggatttaggc ccttcgttta tagaatagct 5340catgctcaca acttgagggg atacgttagg aacttaggcg atgctggagt tgaaattgtt 5400gtcgagggaa gggaggaaga catagaggca ttcatcaagg atttatacaa gaagaaaccc 5460ccacttgcaa ggattgataa ggttgagagg gaggaaattc ctcttcaggg ctttgacaga 5520ttttacatag agaaaagctc gacggaaaag aagggggagg gagattcaat aatccctccg 5580gacatagcta tttgtgagga ctgtcttagg gagttattta atccaactga caagcgctac 5640atgtatcctt tcatagtatg tacaaactgt gggccgaggt tcacgataat tgaagatctt 5700ccctacgata gggagaacac agcgatgaga gaattcccga tgtgcgagtt ctgtaggagt 5760gaatacgagg atcccctgaa taggaggtat catgcagagc cggttgcatg tccaacttgt 5820gggccgagct ataggcttta cacgagcgat ggaaatgaga taattggaga ccccctgaga 5880aaggcggcaa aactaatcga taagggatac atagttgcga taaagggtat aggtggaatt 5940catttggcct gcgatgctac aagagaggat gtggtggccg agcttaggaa gaggattttt 6000aggcctcaga agcctttcgc cattatggcc aaagatttag aaactgtaag gacttttgcc 6060tatatttctc ccgaagagga ggaagaatta acaagctata gaaggccaat agtggctttg 6120aagaagaagg agcccttccc acttcccgaa aacctcgctc ctgggcttca cacaattggg 6180gtaatgcttc cctatgctgg aacccactac atattattcc actggagcaa gactccagtt 6240tacgttatga cttccgcaaa cttcccaggg atgccgatga taaaggacaa tgaagaggca 6300tttgaaaagc ttagggacgt tgctgactac ctcttgctcc acaataggag aattccaaat 6360agagctgacg atagcgttgt tcgctttgta gatggtagaa gagctgttat taggaggagc 6420agaggatttg ttccacttgg aatagagatt ccatttgagt acaaaggatt ggcagttggt 6480gctgagttaa tgaatgcttt cggagttgtt aagaatggaa aagtttatcc aagtcagtac 6540ataggggata catcaaagat tgaagtttta gagtttatga gggaagccgt gaggcacttc 6600ttcaagatat tgagagttga taacttagat ctagttgttg cagatttgca tccaagctac 6660aacacaacta agctgggaat ggagatcgct gaggaatttg gggcagaatt ccttcaagtt 6720caacatcact acgctcacgt ggcctctgta atggctgagc acaacttgga ggaagttgtt 6780ggaattgctc tagatggtgt tgggtatgga accgacggaa aaacttgggg tggggaagta 6840atatatctaa gctatgaaga tgtggagagg ttggcccaca tagagtatta tccactccca 6900ggaggggatt tggccagcta ctatcccttg agggccttaa ttggaatact cagcttaaac 6960cacgacttag aggaagttga gaaaatcata agggagttct gtccaaatgc aataaagagc 7020ttaaagtatg gggaaacaga gtttagggta attatgaggc aactcagcag cgggataaac 7080gttgcctatg cctcttcaac gggaagggtg cttgatgcct tctcggtact tttgaacgtt 7140tcctacagga ggcactatga gggagagcct gcgatgaagc tggagagctt tgcataccaa 7200ggaaagaacg atctaaagct cacggctcca attgaaggtg aggaaataaa ggtttcagag 7260ttgtttgagg aagttcttga gctgatgggc aaggccaatc ctaaagacat agcttactcc 7320gttcacttag ccttagctag ggcatttgct gaagttagcg tggagaaagc taaggagttt 7380ggagctaaaa ctgtcgtttt gggtggggga gtagggtaca atgagctaat agttaagacg 7440ataagaaaga tagtagaggg gagagggcta aggttcttaa caacttacga agttcccagg 7500ggagataatg gaattaatgt aggccaggcc ttcctgggag gattgtactt ggaaggatac 7560ttaaataggg aagatttgag catttaggaa aacctgtatt ttcagggagg agacccagct 7620ttc 7623326020DNAartificialexpression vector sequence 32ttgtacaaag tggtgataat taattaagat cagatccggc tgctaagctt gcggccgcat 60aatgcttaag tcgaacagaa agtaatcgta ttgtacacgg ccgcataatc gaaattaata 120cgactcacta taggggaatt gtgagcggat aacaattccc catcttagta tattagttaa 180gtataagaag gagatataca tatggcagat ctcaattgga tatcggccgg ccacgcgatc 240gctgacgtcg gtaccctcga gtctggtaaa gaaaccgctg ctgcgaaatt tgaacgccag 300cacatggact cgtctactag cgcagcttaa ttaacctagg ctgctgccac cgctgagcaa 360taactagcat aaccccttgg ggcctctaaa cgggtcttga ggggtttttt gctgaaacct 420caggcatttg agaagcacac

ggtcacactg cttccggtag tcaataaacc ggtaaaccag 480caatagacat aagcggctat ttaacgaccc tgccctgaac cgacgaccgg gtcgaatttg 540ctttcgaatt tctgccattc atccgcttat tatcacttat tcaggcgtag caccaggcgt 600ttaagggcac caataactgc cttaaaaaaa ttacgccccg ccctgccact catcgcagta 660ctgttgtaat tcattaagca ttctgccgac atggaagcca tcacagacgg catgatgaac 720ctgaatcgcc agcggcatca gcaccttgtc gccttgcgta taatatttgc ccatagtgaa 780aacgggggcg aagaagttgt ccatattggc cacgtttaaa tcaaaactgg tgaaactcac 840ccagggattg gctgagacga aaaacatatt ctcaataaac cctttaggga aataggccag 900gttttcaccg taacacgcca catcttgcga atatatgtgt agaaactgcc ggaaatcgtc 960gtggtattca ctccagagcg atgaaaacgt ttcagtttgc tcatggaaaa cggtgtaaca 1020agggtgaaca ctatcccata tcaccagctc accgtctttc attgccatac ggaactccgg 1080atgagcattc atcaggcggg caagaatgtg aataaaggcc ggataaaact tgtgcttatt 1140tttctttacg gtctttaaaa aggccgtaat atccagctga acggtctggt tataggtaca 1200ttgagcaact gactgaaatg cctcaaaatg ttctttacga tgccattggg atatatcaac 1260ggtggtatat ccagtgattt ttttctccat tttagcttcc ttagctcctg aaaatctcga 1320taactcaaaa aatacgcccg gtagtgatct tatttcatta tggtgaaagt tggaacctct 1380tacgtgccga tcaacgtctc attttcgcca aaagttggcc cagggcttcc cggtatcaac 1440agggacacca ggatttattt attctgcgaa gtgatcttcc gtcacaggta tttattcggc 1500gcaaagtgcg tcgggtgatg ctgccaactt actgatttag tgtatgatgg tgtttttgag 1560gtgctccagt ggcttctgtt tctatcagct gtccctcctg ttcagctact gacggggtgg 1620tgcgtaacgg caaaagcacc gccggacatc agcgctagcg gagtgtatac tggcttacta 1680tgttggcact gatgagggtg tcagtgaagt gcttcatgtg gcaggagaaa aaaggctgca 1740ccggtgcgtc agcagaatat gtgatacagg atatattccg cttcctcgct cactgactcg 1800ctacgctcgg tcgttcgact gcggcgagcg gaaatggctt acgaacgggg cggagatttc 1860ctggaagatg ccaggaagat acttaacagg gaagtgagag ggccgcggca aagccgtttt 1920tccataggct ccgcccccct gacaagcatc acgaaatctg acgctcaaat cagtggtggc 1980gaaacccgac aggactataa agataccagg cgtttcccct ggcggctccc tcgtgcgctc 2040tcctgttcct gcctttcggt ttaccggtgt cattccgctg ttatggccgc gtttgtctca 2100ttccacgcct gacactcagt tccgggtagg cagttcgctc caagctggac tgtatgcacg 2160aaccccccgt tcagtccgac cgctgcgcct tatccggtaa ctatcgtctt gagtccaacc 2220cggaaagaca tgcaaaagca ccactggcag cagccactgg taattgattt agaggagtta 2280gtcttgaagt catgcgccgg ttaaggctaa actgaaagga caagttttgg tgactgcgct 2340cctccaagcc agttacctcg gttcaaagag ttggtagctc agagaacctt cgaaaaaccg 2400ccctgcaagg cggttttttc gttttcagag caagagatta cgcgcagacc aaaacgatct 2460caagaagatc atcttattaa tcagataaaa tatttctaga tttcagtgca atttatctct 2520tcaaatgtag cacctgaagt cagccccata cgatataagt tgtaattctc atgttagtca 2580tgccccgcgc ccaccggaag gagctgactg ggttgaaggc tctcaagggc atcggtcgag 2640atcccggtgc ctaatgagtg agctaactta cattaattgc gttgcgctca ctgcccgctt 2700tccagtcggg aaacctgtcg tgccagctgc attaatgaat cggccaacgc gcggggagag 2760gcggtttgcg tattgggcgc cagggtggtt tttcttttca ccagtgagac gggcaacagc 2820tgattgccct tcaccgcctg gccctgagag agttgcagca agcggtccac gctggtttgc 2880cccagcaggc gaaaatcctg tttgatggtg gttaacggcg ggatataaca tgagctgtct 2940tcggtatcgt cgtatcccac taccgagatg tccgcaccaa cgcgcagccc ggactcggta 3000atggcgcgca ttgcgcccag cgccatctga tcgttggcaa ccagcatcgc agtgggaacg 3060atgccctcat tcagcatttg catggtttgt tgaaaaccgg acatggcact ccagtcgcct 3120tcccgttccg ctatcggctg aatttgattg cgagtgagat atttatgcca gccagccaga 3180cgcagacgcg ccgagacaga acttaatggg cccgctaaca gcgcgatttg ctggtgaccc 3240aatgcgacca gatgctccac gcccagtcgc gtaccgtctt catgggagaa aataatactg 3300ttgatgggtg tctggtcaga gacatcaaga aataacgccg gaacattagt gcaggcagct 3360tccacagcaa tggcatcctg gtcatccagc ggatagttaa tgatcagccc actgacgcgt 3420tgcgcgagaa gattgtgcac cgccgcttta caggcttcga cgccgcttcg ttctaccatc 3480gacaccacca cgctggcacc cagttgatcg gcgcgagatt taatcgccgc gacaatttgc 3540gacggcgcgt gcagggccag actggaggtg gcaacgccaa tcagcaacga ctgtttgccc 3600gccagttgtt gtgccacgcg gttgggaatg taattcagct ccgccatcgc cgcttccact 3660ttttcccgcg ttttcgcaga aacgtggctg gcctggttca ccacgcggga aacggtctga 3720taagagacac cggcatactc tgcgacatcg tataacgtta ctggtttcac attcaccacc 3780ctgaattgac tctcttccgg gcgctatcat gccataccgc gaaaggtttt gcgccattcg 3840atggtgtccg ggatctcgac gctctccctt atgcgactcc tgcattagga aattaatacg 3900actcactata ggggaattgt gagcggataa caattcccct gtagaaataa ttttgtttaa 3960ctttaataag gagatatacc atgggcagca gccatcacca tcatcaccac agccaggatc 4020cgtcaccctg gatgctgtac aattgacgac gacaagggcc cgggcaaact agtaatcaga 4080cgcggtcgtt cacttgttca gcaaccagat caaaagccat tgactcagca agggttgacc 4140gtataattca cgcgattaca ccgcattgcg gtatcaacgc gcccttagct cagttggata 4200gagcaacgac cttctaagtc gtgggccgca ggttcgaatc ctgcagggcg cgccattaca 4260attcaatcag ttacgccttc tttatatcct ccagccatgg ccttgaaatg gcgttagtca 4320tgaaatatag accgccatcg agtacccctt gtacccttaa ctcttcctga tacgtaaata 4380atgatttggt ggcccttgct ggacttgaac cagcgaccaa gcgattatga gtcgcctgct 4440ctaaccactg agctaaaggg ccttgagtgt gcaataacaa tacttataaa ccacgcaata 4500aacatgatga tctagagaat cccgtcgtag ccaccatctt tttttgcggg agtggcgaaa 4560ttggtagacg caccagattt aggttctggc gccgctaggt gtgcgagttc aagtctcgcc 4620tcccgcacca ttcaccagaa agcgttgatc ggatgccctc gagtcgggca gcgttgggtc 4680ctggccacgg gtgcgcatga tcgtgctcct gtcgttgagg acccggctag gctggcgggg 4740ttgccttact ggttagcaga atgaatcacc gatacgcgag cgaacgtgaa gcgactgctg 4800ctgcaaaacg tctgcgacct gagctcgaat tccttctctt ttactcgttt agcaaccggc 4860taaacatccc caccgcccgg ccaaaagaaa aataggtcca tttttatcgc taaaagataa 4920atccacacag tttgtattgt tttgtgcaaa agtttcacta cgctttatta acaatacttt 4980ctggcgacgt gcgccagtgc agaaggatga gctttcgttt tcagcatctc acgtgaagcg 5040atggtttgcc ttgctacagg gacgtcgctt gccgaccata agcgcccggt gtcctgccgg 5100tgtcgcaagg aggagagacg tgcgatatgg gtcatcacca tcatcaccac ggctcgatca 5160caagtttgta caaaaaagca ggctcagaaa acctgtattt tcagggagga aaagtagaga 5220aaggagatgt cataagactt cattacactg gaaaggttaa agaaactgga gaaatcttcg 5280acacaactta tgaggatgtt gcaaaagaag ctagaatata caatccaaac ggaatctatg 5340ggccagtccc tatagcggtt ggagcgggac acgtattgcc cggactagac aagagactta 5400tagggcttga agttaagaaa aaatacgtca ttgaagttcc acccgaagaa ggctttggat 5460tgagagatcc aggaaaaatt aagattatcc cacttggaaa gttcagaaaa tctggaataa 5520tcccgtaccc tgggctagaa attgaagttg aaacagaaaa tgggagaaaa atgagaggta 5580gggttcttac agttagcgga ggaagagtta gagtagactt caatcatcca ttagcaggaa 5640agactctcgt atatgaagtt gaagttgttg agaaaattga agatccaata gaaaagatta 5700aggcactaat agaactaaga ctgccaatga ttgacaaaga taaggttatt attgagatta 5760gtgaaaaaga tgtaaagcta aacttcaaag acgttgatat tgatccaaag acactaattt 5820tgggcgaaat tcttctcgaa agtgacttga aatttatagg atatgagaaa gttgaatttg 5880agccaaccat tgaagagtta ttaaagccca agtctgccga ggagcaagag tctcctaacg 5940aagaacagca agaggagagt gagtctaaag cggaagaatc ttaggaaaac ctgtattttc 6000agggaggaga cccagctttc 6020336058DNAartificialplasmid sequence 33ttgtacaaac ttgtgatcga gccacccata tcgcacgtct ctcctccttg cgacaccggc 60aggacaccgg gcgcttatgg tcggcaagcg acgtccctgt agcaaggcaa accatcgctt 120cacgtgagat gctgaaaacg aaagctcatc cttctgcact ggcgcacgtc gccagaaagt 180attgttaata aagcgtagtg aaacttttgc acaaaacaat acaaactgtg tggatttatc 240ttttagcgat aaaaatggac ctatttttct tttggccggg cggtggggat gtttagccgg 300ttgctaaacg agtaaaagag aaggaattcg agctcgaatt cggatcctag agggaaaccg 360ttgtggtctc cctatagtga gtcgtattaa tttcgcggga tcgagatctc gggcagcgtt 420gggtcctggc cacgggtgcg catgatcgtg ctcctgtcgt tgaggacccg gctaggctgg 480cggggttgcc ttactggtta gcagaatgaa tcaccgatac gcgagcgaac gtgaagcgac 540tgctgctgca aaacgtctgc gacctgagca acaacatgaa tggtcttcgg tttccgtgtt 600tcgtaaagtc tggaaacgcg gaagtcagcg ccctgcacca ttatgttccg gatctgcatc 660gcaggatgct gctggctacc ctgtggaaca cctacatctg tattaacgaa gcgctggcat 720tgaccctgag tgatttttct ctggtcccgc cgcatccata ccgccagttg tttaccctca 780caacgttcca gtaaccgggc atgttcatca tcagtaaccc gtatcgtgag catcctctct 840cgtttcatcg gtatcattac ccccatgaac agaaatcccc cttacacgga ggcatcagtg 900accaaacagg aaaaaaccgc ccttaacatg gcccgcttta tcagaagcca gacattaacg 960cttctggaga aactcaacga gctggacgcg gatgaacagg cagacatctg tgaatcgctt 1020cacgaccacg ctgatgagct ttaccgcagc tgcctcgcgc gtttcggtga tgacggtgaa 1080aacctctgac acatgcagct cccggagacg gtcacagctt gtctgtaagc ggatgccggg 1140agcagacaag cccgtcaggg cgcgtcagcg ggtgttggcg ggtgtcgggg cgcagccatg 1200acccagtcac gtagcgatag cggagtgtat actggcttaa ctatgcggca tcagagcaga 1260ttgtactgag agtgcaccat atatgcggtg tgaaataccg cacagatgcg taaggagaaa 1320ataccgcatc aggcgctctt ccgcttcctc gctcactgac tcgctgcgct cggtcgttcg 1380gctgcggcga gcggtatcag ctcactcaaa ggcggtaata cggttatcca cagaatcagg 1440ggataacgca ggaaagaaca tgtgagcaaa aggccagcaa aaggccagga accgtaaaaa 1500ggccgcgttg ctggcgtttt tccataggct ccgcccccct gacgagcatc acaaaaatcg 1560acgctcaagt cagaggtggc gaaacccgac aggactataa agataccagg cgtttccccc 1620tggaagctcc ctcgtgcgct ctcctgttcc gaccctgccg cttaccggat acctgtccgc 1680ctttctccct tcgggaagcg tggcgctttc tcatagctca cgctgtaggt atctcagttc 1740ggtgtaggtc gttcgctcca agctgggctg tgtgcacgaa ccccccgttc agcccgaccg 1800ctgcgcctta tccggtaact atcgtcttga gtccaacccg gtaagacacg acttatcgcc 1860actggcagca gccactggta acaggattag cagagcgagg tatgtaggcg gtgctacaga 1920gttcttgaag tggtggccta actacggcta cactagaagg acagtatttg gtatctgcgc 1980tctgctgaag ccagttacct tcggaaaaag agttggtagc tcttgatccg gcaaacaaac 2040caccgctggt agcggtggtt tttttgtttg caagcagcag attacgcgca gaaaaaaagg 2100atctcaagaa gatcctttga tcttttctac ggggtctgac gctcagtgga acgaaaactc 2160acgttaaggg attttggtca tgagattatc aaaaaggatc ttcacctaga tccttttaaa 2220ttaaaaatga agttttaaat caatctaaag tatatatgag taaacttggt ctgacagtta 2280ccaatgctta atcagtgagg cacctatctc agcgatctgt ctatttcgtt catccatagt 2340tgcctgactc cccgtcgtgt agataactac gatacgggag ggcttaccat ctggccccag 2400tgctgcaatg ataccgcgag acccacgctc accggctcca gatttatcag caataaacca 2460gccagccgga agggccgagc gcagaagtgg tcctgcaact ttatccgcct ccatccagtc 2520tattaattgt tgccgggaag ctagagtaag tagttcgcca gttaatagtt tgcgcaacgt 2580tgttgccatt gctgcaggca tcgtggtgtc acgctcgtcg tttggtatgg cttcattcag 2640ctccggttcc caacgatcaa ggcgagttac atgatccccc atgttgtgca aaaaagcggt 2700tagctccttc ggtcctccga tcgttgtcag aagtaagttg gccgcagtgt tatcactcat 2760ggttatggca gcactgcata attctcttac tgtcatgcca tccgtaagat gcttttctgt 2820gactggtgag tactcaacca agtcattctg agaatagtgt atgcggcgac cgagttgctc 2880ttgcccggcg tcaatacggg ataataccgc gccacatagc agaactttaa aagtgctcat 2940cattggaaaa cgttcttcgg ggcgaaaact ctcaaggatc ttaccgctgt tgagatccag 3000ttcgatgtaa cccactcgtg cacccaactg atcttcagca tcttttactt tcaccagcgt 3060ttctgggtga gcaaaaacag gaaggcaaaa tgccgcaaaa aagggaataa gggcgacacg 3120gaaatgttga atactcatac tcttcctttt tcaatattat tgaagcattt atcagggtta 3180ttgtctcatg agcggataca tatttgaatg tatttagaaa aataaacaaa taggggttcc 3240gcgcacattt ccccgaaaag tgccacctga aattgtaaac gttaatattt tgttaaaatt 3300cgcgttaaat ttttgttaaa tcagctcatt ttttaaccaa taggccgaaa tcggcaaaat 3360cccttataaa tcaaaagaat agaccgagat agggttgagt gttgttccag tttggaacaa 3420gagtccacta ttaaagaacg tggactccaa cgtcaaaggg cgaaaaaccg tctatcaggg 3480cgatggccca ctacgtgaac catcacccta atcaagtttt ttggggtcga ggtgccgtaa 3540agcactaaat cggaacccta aagggagccc ccgatttaga gcttgacggg gaaagccggc 3600gaacgtggcg agaaaggaag ggaagaaagc gaaaggagcg ggcgctaggg cgctggcaag 3660tgtagcggtc acgctgcgcg taaccaccac acccgccgcg cttaatgcgc cgctacaggg 3720cgcgtcccat tcgccaatcc ggatatagtt cctcctttca gcaaaaaacc cctcaagacc 3780cgtttagagg ccccaagggg ttatgctagt tattgctcag cggtggcagc agccaactca 3840gcttcctttc gggctttgtt agcagccgga tctcagtggt ggtggtggtg gtgctcgagt 3900gcggccgcaa gcttagcagc cggatctgat cttaattaat tatcaccact ttgtacaaga 3960aagctgggtc tccctattaa agtctaacca cgtggactga gcaagatatg catggatcat 4020aagccctaac aaccatctca gccagtatct ttaacctttc tggatcgtca ttgtagtgct 4080tttctgccat cattcttaca tgttcttcca tcattgccaa gttgaatgct gtaggtgtta 4140ttatgtcggc ataagaaacc cttccattct caactttgag ggcatagact aagattcccc 4200ttggagcctc agtcgttgag acaccaaagc cgtcctttat ctcaacttca tccctgggct 4260taattggcca cttggcgaga gcctcgtcga gcagatctat tgccctctct ataaagtaaa 4320ctatttcgag ggcctgggct aagttatttg caaacggatt tgttcccttt aataggtctt 4380tgtttgcctc atacagctcc ttggccttgc cgtataggag gtcagcattg ttaataactc 4440tagatatagc cccaaccatg aagggtctgc ccttgtagtg actgtgcttt gcaaaactgt 4500gttcaacgac gaactccttt atataatctc tgtacttttc acttgggaac tcctccccat 4560cacttgcctt tatgtaatct ccataaattc cataagcatc tcccctcggc ttcacggcca 4620agtgtgttat tggcccttca acttcgctgt actgctcaag ctttgcaaat aactcaaaag 4680tatactcggc aagtggtagg gcttccctaa gctcggcttt cattttctca aggacactct 4740tctcagggag ctttccgaat ccgcccaaaa ccgcattttc ttggtgtatg gctcttgacc 4800ctagaatgtc catcatccag gtgccaaggt tcttcagctt aagggctatc tctatctccc 4860tcttgtattc attcaccatc ttaagtgggc tcgagtagcc cctgtagtcg ggaagaacta 4920gaagatatag gtgaagggca tgactctcta tcatgtctcc gatgtatagt acttctctaa 4980gggcctgtat ctcttccctt gggacaaaac cgacggcctt ttctgcagcc tctaatgcgg 5040ttaacttgtg ggcggctgaa cagaatgagc atattctcgg gtaaatggcc agagcttcct 5100caagcttctt cccaatagtt atggcctcaa agaatctggg cccttcaatt atgtttagct 5160tgacctcctt gactccatca tccccaatta ttatctccac accacccttc ccctcaactc 5220ttgctatatg atcaatggtg attggaagat agaggttctt cattgttcac cacctgagaa 5280tattttttca accattttct caaccctctc atcatgtcca ttgaacattt tcattctctc 5340aattatctcc tcttttgtca tccccttctc cttgaacacc ttagctagag agtcgaacca 5400agctacatcg taccctattg cccctctgca tcctatacac gcaactccaa atcctggaca 5460tctcgcgtta catcctgccc ttgttactgg acctagacag ggttctcctt tctcaagaag 5520gatacatgga tgtccattga gcctacattc tagacaaact ggataatcta tatcctctgg 5580ccatgaacca atcaagaatg ttcccagggc gtagaggaag tccttcttct ctggtgggca 5640accgtagatg ttgtagtcaa cttttatgta ttttgaaact ggttcagcct tcttcggttg 5700gaacttgact tttgcgtctc cataaacctt cttccagagc tcttctaatg gcttttcact 5760ccagctctga actcctcctt gaacagcaca agctccaacc gcaacgacga tctttgcatt 5820ctccctaatt tttttcacga gttcaacttc ttcctcagtt gaaacgcttc cttctataaa 5880agctatgtcg accttttcat cctcaatgct atctctatca atcatgaacc agcaaactat 5940ttcagcattt gggataagtt gtaataactc gtccatcata gctagctgca attgacagcc 6000gtagcacgag gttaatgcgt aaaatccaat cctaactttt cctcctgagc ctgctttt 605834367PRTPyrococcus abyssi 34Met Arg Tyr Val Lys Leu Pro Lys Glu Asn Val Tyr Thr Phe Leu Glu1 5 10 15Arg Leu Lys Asp Trp Gly Lys Leu Tyr Ala Pro Val Lys Ile Ser Glu 20 25 30Lys Phe Tyr Asp Phe Arg Glu Ile Asp Asp Val Arg Lys Val Glu Phe 35 40 45His Tyr Thr Arg Thr Ile Met Pro Pro Lys Lys Phe Phe Phe Lys Pro 50 55 60Arg Glu Lys Leu Phe Glu Phe Asp Ile Ser Lys Pro Glu Tyr Arg Glu65 70 75 80Val Ile Glu Asp Val Glu Pro Phe Val Leu Phe Gly Val His Ala Cys 85 90 95Asp Ile Tyr Gly Leu Lys Leu Leu Asp Thr Val Tyr Leu Asp Glu Phe 100 105 110Pro Asp Lys Tyr Tyr Lys Val Arg Arg Glu Lys Gly Ile Ile Ile Gly 115 120 125Ile Ser Cys Met Pro Asp Glu Tyr Cys Phe Cys Asn Leu Arg Glu Thr 130 135 140Asp Phe Ala Asp Asp Gly Phe Asp Leu Phe Leu His Glu Leu Pro Asp145 150 155 160Gly Trp Leu Val Arg Val Gly Thr Pro Thr Gly His Arg Ile Val Asp 165 170 175Lys Asn Ile Lys Leu Phe Glu Glu Val Thr Asn Glu Asp Ile Cys Ala 180 185 190Phe Arg Glu Phe Glu Lys Lys Arg His Glu Ala Phe Lys Tyr His Glu 195 200 205Asp Trp Gly Asn Leu Arg Tyr Leu Leu Glu Leu Glu Met Glu His Pro 210 215 220Met Trp Asp Glu Glu Ala Glu Lys Cys Leu Ala Cys Gly Ile Cys Asn225 230 235 240Thr Thr Cys Pro Thr Cys Arg Cys Tyr Glu Val Gln Asp Ile Val Asn 245 250 255Leu Asp Gly Val Thr Gly Tyr Arg Glu Arg Arg Trp Asp Ser Cys Gln 260 265 270Phe Arg Ser His Gly Leu Val Ala Gly Gly His Asn Phe Arg Pro Thr 275 280 285Lys Lys Ser Arg Phe Leu Asn Arg Tyr Leu Cys Lys Asn Ser Tyr Asn 290 295 300Glu Lys Leu Gly Ile Ser Phe Cys Val Gly Cys Gly Arg Cys Thr Ala305 310 315 320Phe Cys Pro Ala Gly Ile Ser Phe Val Arg Asn Leu Arg Arg Ile Leu 325 330 335Gly Leu Glu Glu Gln Lys Cys Pro Pro Ser Val Ser Glu Glu Ile Pro 340 345 350Lys Arg Gly Phe Ala Tyr Ser Pro Gly Val Gly Gly Glu Glu Glu 355 360 36535292PRTPyrococcus abyssi 35Met Thr Leu Pro Lys Glu Val Met Met Pro Asn Asp Asn Pro Tyr Ala1 5 10 15Leu His Arg Val Lys Val Leu Lys Val Tyr Asp Leu Thr Glu Arg Glu 20 25 30Lys Leu Phe Leu Phe Arg Phe Glu Asp Pro Lys Leu Ala Glu Thr Trp 35 40 45Thr Phe Lys Pro Gly Gln Phe Val Gln Leu Thr Ile Pro Gly Val Gly 50 55 60Glu Val Pro Ile Ser Ile Cys Ser Ser Pro Met Arg Lys Gly Phe Phe65 70 75 80Glu Leu Cys Ile Arg Arg Ala Gly Arg Val Thr Thr Val Val His Arg 85 90 95Leu Lys Pro Gly Asp Thr Val Leu Val Arg Gly Pro Tyr Gly Asn Gly 100 105 110Phe Pro Val Asp Glu Trp Glu Gly Met Asp Leu Leu Leu Ile Ala Ala 115 120 125Gly Leu Gly Thr Ala Pro Leu Arg Ser Val Phe Leu Tyr Ala Met Asp 130 135 140Asn Arg Trp Lys Tyr Gly Asn Ile Thr Phe Ile Asn Thr Ala Arg Tyr145 150 155 160Gly Lys Asp Leu Leu Phe Tyr Lys Glu Leu Glu Ala Met Lys Asp Leu

165 170 175Ala Glu Ala Glu Asn Val Lys Ile Ile Gln Ser Val Thr Arg Asp Pro 180 185 190Asp Trp Pro Gly Leu His Gly Arg Pro Gln Gln Phe Ile Val Glu Ala 195 200 205Asn Thr Asn Pro Lys Asn Thr Ala Val Ala Ile Cys Gly Pro Pro Arg 210 215 220Met Tyr Lys Ala Val Phe Glu Ser Leu Ile Asn Tyr Gly Tyr Arg Pro225 230 235 240Glu Asn Ile Tyr Val Thr Leu Glu Arg Arg Met Lys Cys Gly Ile Gly 245 250 255Lys Cys Gly His Cys Val Ala Gly Thr Ser Thr Ser Trp Lys Tyr Ile 260 265 270Cys Lys Asp Gly Pro Val Phe Thr Tyr Phe Asp Ile Val Ser Thr Pro 275 280 285Gly Leu Leu Asp 29036258PRTPyrococcus abyssi 36Lys Leu Arg Ile Gly Phe Tyr Ala Leu Thr Ser Cys Tyr Gly Cys Gln1 5 10 15Leu Gln Leu Ala Met Met Asp Glu Leu Leu Lys Leu Ile Pro Asn Ala 20 25 30Glu Ile Val Cys Trp Tyr Met Leu Asp Arg Asp Ser Val Glu Asp Lys 35 40 45Pro Val Asp Ile Ala Phe Ile Glu Gly Ser Val Ser Thr Glu Glu Glu 50 55 60Val Glu Leu Val Lys Lys Ile Arg Glu Asn Ala Lys Ile Val Val Ala65 70 75 80Val Gly Ala Cys Ala Val Gln Gly Gly Val Gln Ser Trp Asp Lys Ser 85 90 95Leu Glu Glu Leu Trp Lys Thr Val Tyr Gly Asp Ala Lys Val Lys Phe 100 105 110Gln Pro Lys Lys Ala Glu Pro Val Ser Lys Tyr Ile Lys Val Asp Tyr 115 120 125Asn Ile Tyr Gly Cys Pro Pro Glu Lys Arg Asp Phe Leu Tyr Ala Leu 130 135 140Gly Thr Phe Leu Ile Gly Ser Trp Pro Glu Asp Ile Asp Tyr Pro Val145 150 155 160Cys Leu Glu Cys Arg Leu Asn Gly Tyr Pro Cys Val Leu Leu Glu Lys 165 170 175Gly Glu Pro Cys Leu Gly Pro Ile Thr Arg Ala Gly Cys Asn Ala Arg 180 185 190Cys Pro Gly Phe Gly Ile Ala Cys Ile Gly Cys Arg Gly Ala Ile Gly 195 200 205Tyr Asp Val Ala Trp Phe Asp Ser Leu Ala Arg Val Phe Lys Glu Lys 210 215 220Gly Leu Thr Lys Glu Glu Ile Leu Glu Arg Met Lys Ile Phe Asn Gly225 230 235 240His Asp Glu Arg Ile Glu Lys Met Val Glu Lys Val Phe Gln Glu Val 245 250 255Lys Glu37428PRTPyrococcus abyssi 37Met Arg Asn Leu Tyr Ile Pro Ile Thr Val Asp His Ile Ala Arg Val1 5 10 15Glu Gly Lys Gly Gly Val Glu Ile Ile Val Gly Asp Glu Gly Val Lys 20 25 30Glu Val Lys Leu Asn Ile Ile Glu Gly Pro Arg Phe Phe Glu Ala Ile 35 40 45Thr Ile Gly Lys Lys Leu Glu Glu Ala Leu Ala Ile Tyr Pro Arg Ile 50 55 60Cys Ser Phe Cys Ser Ala Ala His Lys Leu Thr Ala Leu Glu Ala Ala65 70 75 80Glu Lys Ala Ile Gly Phe Thr Pro Arg Glu Glu Ile Gln Ala Leu Arg 85 90 95Glu Val Leu Tyr Ile Gly Asp Met Ile Glu Ser His Ala Leu His Leu 100 105 110Tyr Leu Leu Val Leu Pro Asp Tyr Leu Gly Tyr Ser Ser Pro Leu Lys 115 120 125Met Val Asn Glu Tyr Lys Lys Glu Leu Glu Ile Ala Leu Lys Leu Lys 130 135 140Asn Leu Gly Ser Trp Met Met Asp Val Leu Gly Ser Arg Ala Ile His145 150 155 160Gln Glu Asn Ala Ile Leu Gly Gly Phe Gly Lys Leu Pro Ser Lys Glu 165 170 175Thr Leu Glu Glu Met Lys Ala Lys Leu Arg Glu Ser Leu Ser Leu Ala 180 185 190Glu Tyr Thr Phe Glu Leu Phe Ala Lys Leu Glu Gln Tyr Arg Glu Val 195 200 205Glu Gly Glu Ile Thr His Leu Ala Val Lys Pro Arg Gly Asp Val Tyr 210 215 220Gly Ile Tyr Gly Asp Tyr Ile Lys Ala Ser Asp Gly Glu Glu Phe Pro225 230 235 240Ser Glu Asp Tyr Lys Glu His Ile Asn Glu Phe Val Val Glu His Ser 245 250 255Phe Ala Lys His Ser His Tyr Lys Gly Lys Pro Phe Met Val Gly Ala 260 265 270Ile Ser Arg Val Val Asn Asn Lys Asp Leu Leu Tyr Gly Arg Ala Lys 275 280 285Asp Leu Tyr Glu Ser His Lys Glu Leu Leu Lys Gly Thr Asn Pro Phe 290 295 300Ala Asn Asn Leu Ala Gln Ala Leu Glu Leu Val Tyr Phe Ile Glu Arg305 310 315 320Ala Ile Asp Leu Ile Asp Glu Val Leu Ile Lys Trp Pro Val Lys Glu 325 330 335Arg Asp Lys Val Glu Val Arg Asp Gly Phe Gly Val Ser Thr Thr Glu 340 345 350Ala Pro Arg Gly Ile Leu Val Tyr Ala Leu Lys Val Glu Asn Gly Arg 355 360 365Val Ala Tyr Ala Asp Ile Ile Thr Pro Thr Ala Phe Asn Leu Ala Met 370 375 380Met Glu Glu His Val Arg Met Met Ala Glu Lys His Tyr Asn Asp Asp385 390 395 400Pro Glu Arg Leu Lys Leu Leu Ala Glu Met Val Val Arg Ala Tyr Asp 405 410 415Pro Cys Ile Ser Cys Ser Val His Val Val Lys Leu 420 42538428PRTThermococcus kodakaraensis 38Met Lys Asn Val Tyr Leu Pro Ile Thr Val Asp His Ile Ala Arg Val1 5 10 15Glu Gly Lys Gly Gly Val Glu Ile Val Val Gly Asp Asp Gly Val Lys 20 25 30Glu Val Lys Leu Asn Ile Ile Glu Gly Pro Arg Phe Phe Glu Ala Ile 35 40 45Thr Leu Gly Lys Lys Leu Asp Glu Ala Leu Ala Ile Tyr Pro Arg Ile 50 55 60Cys Ser Phe Cys Ser Ala Ala His Lys Leu Thr Ala Val Glu Ala Ala65 70 75 80Glu Lys Ala Ile Gly Phe Thr Pro Arg Glu Glu Ile Gln Ala Leu Arg 85 90 95Glu Val Leu Tyr Ile Gly Asp Met Ile Glu Ser His Ala Leu His Leu 100 105 110Tyr Leu Leu Val Leu Pro Asp Tyr Leu Gly Tyr Ser Gly Pro Leu His 115 120 125Met Ile Asp Glu Tyr Lys Lys Glu Met Ser Ile Ala Leu Asp Leu Lys 130 135 140Asn Leu Gly Ser Trp Met Met Asp Glu Leu Gly Ser Arg Ala Ile His145 150 155 160Gln Glu Asn Ala Val Leu Gly Gly Phe Gly Lys Leu Pro Asp Lys Ser 165 170 175Val Leu Glu Asn Met Lys Arg Arg Leu Lys Glu Ala Leu Pro Lys Ala 180 185 190Glu Tyr Thr Phe Glu Leu Phe Thr Lys Leu Glu Gln Tyr Glu Glu Val 195 200 205Glu Gly Pro Ile Thr His Ile Ala Val Lys Pro Arg Asn Gly Val Tyr 210 215 220Gly Ile Tyr Gly Asp Tyr Leu Lys Ala Ser Asp Gly Asn Glu Phe Pro225 230 235 240Ser Glu Glu Tyr Arg Glu His Ile Lys Glu Phe Val Val Glu His Ser 245 250 255Phe Ala Lys His Ser His Tyr His Gly Lys Pro Phe Met Val Gly Ala 260 265 270Ile Ser Arg Leu Val Asn Asn Ala Asp Thr Leu Tyr Gly Arg Ala Lys 275 280 285Glu Leu Tyr Glu Ser Tyr Lys Asp Leu Leu Arg Ser Thr Asn Pro Phe 290 295 300Ala Asn Asn Leu Ala Gln Ala Leu Glu Leu Val Tyr Phe Thr Glu Arg305 310 315 320Ala Ile Asp Leu Ile Asp Glu Ala Leu Ala Lys Trp Pro Ile Arg Pro 325 330 335Arg Asp Glu Val Ala Leu Lys Asp Gly Phe Gly Val Ser Thr Thr Glu 340 345 350Ala Pro Arg Gly Val Leu Val Tyr Ala Leu Lys Val Glu Asn Gly Arg 355 360 365Val Ser Tyr Ala Asp Ile Ile Thr Pro Thr Ala Phe Asn Leu Ala Met 370 375 380Met Glu Gln His Val Arg Met Met Ala Glu Lys His Tyr Asn Asp Asp385 390 395 400Pro Glu Lys Leu Lys Leu Leu Ala Glu Met Val Val Arg Ala Tyr Asp 405 410 415Pro Cys Ile Ser Cys Ser Val His Val Ala Arg Leu 420 42539264PRTThermococcus kodakaraensis 39Met Ser Glu Lys Lys Ile Arg Ile Gly Phe Tyr Ala Leu Thr Ser Cys1 5 10 15Tyr Gly Cys Gln Leu Gln Phe Ala Met Met Asp Glu Ile Leu Gln Leu 20 25 30Ile Pro Asn Val Glu Ile Ala Cys Trp Phe Met Leu Glu Arg Asp Ser 35 40 45Tyr Glu Asp Glu Pro Val Asp Ile Ala Phe Ile Glu Gly Ser Val Ser 50 55 60Thr Glu Glu Glu Ala Glu Leu Val Lys Lys Ile Arg Glu Asn Ala Lys65 70 75 80Ile Val Val Ala Val Gly Ser Cys Ala Val Gln Gly Gly Val Gln Ser 85 90 95Trp Glu Lys Asp Lys Pro Leu Glu Glu Leu Trp Lys Thr Val Tyr Gly 100 105 110Asp Ala Lys Val Lys Phe Gln Pro Lys Met Ala Glu Pro Ile Ser Asn 115 120 125Tyr Ile Lys Val Asp Tyr Asn Ile Tyr Gly Cys Pro Pro Glu Lys Arg 130 135 140Asp Phe Leu Tyr Thr Leu Gly Thr Leu Leu Ile Gly Ser Trp Pro Glu145 150 155 160Asp Ile Asp Tyr Pro Val Cys Leu Glu Cys Arg Leu Arg Gly Asn Thr 165 170 175Cys Val Leu Leu Glu Arg Gly Glu Pro Cys Leu Gly Pro Val Thr Arg 180 185 190Ala Gly Cys Asp Ala Arg Cys Pro Ala Tyr Gly Ile Ala Cys Ile Gly 195 200 205Cys Arg Gly Ala Ile Gly Tyr Asp Val Ala Trp Phe Asp Ser Leu Ala 210 215 220Arg Val Phe Arg Glu Lys Gly Leu Thr Lys Glu Glu Ile Leu Glu Arg225 230 235 240Met Arg Met Phe Asn Ala His Asn Pro Lys Leu Glu Glu Met Val Asn 245 250 255Lys Ile Phe Gln Glu Val Lys Glu 26040294PRTThermococcus kodakaraensis 40Met Ser Met Val Leu Pro Lys Glu Ile Met Met Pro Asn Asp Asn Pro1 5 10 15Tyr Ala Leu His Arg Ala Lys Val Leu Arg Val Tyr Pro Leu Thr Glu 20 25 30Lys Glu Lys Leu Phe Leu Phe Arg Phe Glu Asp Ala Glu Leu Ala Glu 35 40 45Lys Trp Thr Phe Arg Pro Gly Gln Phe Val Gln Leu Thr Ile Pro Gly 50 55 60Val Gly Glu Val Pro Ile Ser Ile Cys Ser Ser Ala Met Arg Arg Gly65 70 75 80Phe Phe Glu Leu Cys Ile Arg Lys Ala Gly Arg Val Thr Thr Val Val 85 90 95His Arg Leu Lys Pro Gly Asp Thr Val Leu Val Arg Gly Pro Tyr Gly 100 105 110Asn Gly Phe Pro Val Asp Glu Trp Glu Gly Met Asp Leu Leu Leu Ile 115 120 125Ala Ala Gly Leu Gly Thr Ala Pro Leu Arg Ser Val Phe Leu Tyr Ala 130 135 140Met Asp Asn Arg Trp Lys Tyr Gly Asn Ile Thr Phe Ile Asn Thr Ala145 150 155 160Arg Tyr Gly Lys Asp Leu Leu Phe Tyr Lys Glu Leu Glu Ala Met Lys 165 170 175Asp Leu Ala Glu Ala Glu Asn Val Lys Ile Ile Gln Ser Val Thr Arg 180 185 190Asp Pro Asp Trp Pro Gly Leu His Gly Arg Pro Gln Asn Phe Ile Pro 195 200 205Glu Ala Asn Thr Asn Pro Lys Lys Thr Ala Val Ala Ile Cys Gly Pro 210 215 220Pro Arg Met Tyr Lys Ala Val Phe Glu Ala Leu Ile Asn Tyr Gly Tyr225 230 235 240Arg Pro Glu Asn Ile Tyr Val Thr Leu Glu Arg Lys Met Lys Cys Gly 245 250 255Ile Gly Lys Cys Gly His Cys Asn Val Gly Thr Ser Thr Ser Trp Lys 260 265 270Tyr Val Cys Lys Asp Gly Pro Val Phe Gly Tyr Phe Asp Ile Ile Ser 275 280 285Thr Pro Gly Leu Leu Asp 29041367PRTThermococcus kodakaraensis 41Met Arg Tyr Val Lys Leu Pro Lys Glu Asn Thr Tyr Thr Phe Leu Glu1 5 10 15Arg Leu Lys Glu Trp Gly Lys Leu Tyr Ala Pro Val Lys Ile Ser Glu 20 25 30Lys Phe Tyr Asp Phe Arg Glu Ile Asp Asp Val Arg Lys Val Glu Phe 35 40 45Asn Tyr Asn Arg Thr Ile Met Pro Pro Lys Lys Phe Phe Phe Leu Pro 50 55 60Arg Glu Lys Leu Phe Glu Phe Asp Leu Ser Arg Pro Glu Tyr Arg Glu65 70 75 80Thr Ile Glu Asp Val Glu Pro Phe Val Ile Phe Gly Leu His Ala Cys 85 90 95Asp Ile His Gly Leu Lys Ile Leu Asp Thr Val Tyr Leu Asp Glu Leu 100 105 110Pro Asp Lys Tyr Tyr Lys Ala Arg Arg Glu Lys Gly Ile Ile Ile Gly 115 120 125Ile Ser Cys Met Pro Asp Glu Tyr Cys Phe Cys Asn Leu Arg Glu Thr 130 135 140Asp Phe Ala Asp Asp Gly Phe Asp Leu Phe Leu His Glu Leu Pro Asp145 150 155 160Gly Trp Leu Val Arg Val Gly Ser Pro Thr Gly His Arg Ile Val Asp 165 170 175Lys Asn Met Glu Leu Phe Glu Glu Val Thr Thr Glu Asp Ile Cys Asn 180 185 190Phe Arg Glu Phe Glu Asn Lys Arg Ser Gln Ala Phe Lys Tyr His Glu 195 200 205Asp Trp Ser Asn Leu Arg Tyr Leu Leu Glu Leu Glu Met Glu His Pro 210 215 220Met Trp Glu Glu Gln Ala Asp Leu Cys Leu Ala Cys Gly Ile Cys Asn225 230 235 240Thr Thr Cys Pro Thr Cys Arg Cys Tyr Glu Val Gln Asp Ile Val Asn 245 250 255Leu Asp Gly Asn Thr Gly Tyr Arg Glu Arg Arg Trp Asp Ser Cys Gln 260 265 270Phe Arg Ser His Gly Leu Val Ala Gly Gly His Asn Phe Arg Pro Thr 275 280 285Lys Lys Asp Arg Phe Arg Asn Arg Tyr Leu Cys Lys Asn Ser Tyr Asn 290 295 300Glu Lys Leu Gly Leu Ser Tyr Cys Val Gly Cys Gly Arg Cys Thr Tyr305 310 315 320Phe Cys Pro Ala Gly Ile Ser Phe Val Arg Asn Leu Arg Thr Ile Leu 325 330 335Gly Leu Glu Glu Lys Ser Cys Pro Ser Glu Ile Thr Glu Glu Ile Pro 340 345 350Lys Arg Gly Phe Ala Tyr Ala Ser His Ile Arg Gly Asp Gly Leu 355 360 36542372PRTPyrococcus horikoshii 42Met Glu Val Ile Leu Leu Arg Tyr Val Lys Leu Pro Lys Glu Asn Thr1 5 10 15Tyr Glu Phe Leu Glu Arg Leu Lys Glu Trp Gly Lys Leu Tyr Ala Pro 20 25 30Val Lys Ile Ser Glu Lys Phe Tyr Asp Phe Arg Glu Ile Asp Asp Val 35 40 45Arg Lys Val Glu Phe His Tyr Thr Arg Thr Ile Met Pro Pro Lys Lys 50 55 60Phe Phe Phe Lys Pro Arg Glu Lys Met Phe Glu Phe Asp Leu Ser Lys65 70 75 80Pro Glu Tyr Lys Glu Val Ile Glu Asp Val Glu Pro Phe Val Leu Phe 85 90 95Gly Val His Ala Cys Asp Ile Tyr Gly Leu Lys Ile Leu Asp Thr Ile 100 105 110Tyr Leu Asp Glu Leu Pro Asp Lys Tyr Tyr Lys Ile Arg Arg Glu Lys 115 120 125Gly Ile Ile Ile Gly Ile Ser Cys Met Pro Asp Glu Tyr Cys Phe Cys 130 135 140Asn Leu Arg Lys Thr Asp Phe Ala Asp Asp Gly Phe Asp Leu Phe Leu145 150 155 160His Glu Leu Pro Asp Gly Trp Leu Val Arg Val Gly Ser Pro Thr Gly 165 170 175His Arg Ile Val Asp Lys Asn Ile Lys Leu Phe Glu Glu Val Thr Asp 180 185 190Glu Asp Ile Cys Ala Phe Arg Glu Phe Glu Lys Lys Arg Gln Glu Ala 195 200 205Phe Lys Tyr His Glu Asp Trp Asp Asn Leu Arg Tyr Leu Leu Glu Leu 210 215 220Glu Met Glu His Pro Met Trp Glu Glu Glu Ala Asn Lys Cys Leu Ala225 230 235 240Cys Gly Ile Cys Thr Leu Thr Cys Pro Thr Cys Arg Cys Tyr Glu Val 245 250 255Gln Asp Ile Val Asn Leu Asp Gly Ile Thr Gly Tyr Arg Glu Arg Arg 260 265 270Trp Asp Ser Cys Gln Phe Arg Ser His Gly Leu Val Ala Gly Gly His 275 280 285Asn Phe Arg Pro Thr Lys Lys Asp Arg Phe Arg Asn

Arg Tyr Leu Cys 290 295 300Lys Asn Ala Tyr Asn Glu Lys Leu Gly Leu Ser Tyr Cys Val Gly Cys305 310 315 320Gly Arg Cys Thr Ala Phe Cys Pro Ala Gly Ile Ser Phe Val Arg Asn 325 330 335Leu Arg Val Ile Leu Gly Phe Glu Glu Gln Arg Cys Pro Pro Asn Val 340 345 350Ser Glu Glu Ile Pro Lys Lys Gly Phe Ala Tyr Ser Pro Gly Val Gly 355 360 365Gly Asp Glu Glu 37043292PRTPyrococcus horikoshii 43Met Asn Leu Pro Lys Asp Val Met Met Pro Asn Asp Asn Pro Tyr Ala1 5 10 15Leu His Arg Val Lys Val Leu Lys Val Tyr Asp Leu Thr Glu Lys Glu 20 25 30Lys Leu Phe Leu Phe Arg Phe Glu Asp Pro Lys Leu Ala Glu Thr Trp 35 40 45Thr Phe Lys Pro Gly Gln Phe Val Gln Leu Thr Ile Pro Gly Val Gly 50 55 60Glu Val Pro Ile Ser Ile Cys Ser Ser Pro Met Arg Arg Gly Phe Phe65 70 75 80Glu Leu Cys Ile Arg Arg Ala Gly Arg Val Thr Thr Val Val His Arg 85 90 95Leu Lys Pro Gly Asp Ile Val Leu Val Arg Gly Pro Tyr Gly Asn Gly 100 105 110Phe Pro Val Asp Glu Trp Glu Gly Met Asp Leu Leu Leu Ile Ala Ala 115 120 125Gly Leu Gly Ala Ala Pro Leu Arg Ser Val Phe Leu Tyr Ala Met Asp 130 135 140Asn Arg Trp Lys Tyr Gly Asn Ile Thr Phe Ile Asn Thr Ala Arg Tyr145 150 155 160Gly Lys Asp Leu Leu Phe Tyr Lys Glu Leu Glu Ala Ile Lys Asp Leu 165 170 175Ala Glu Ala Glu Asn Val Lys Ile Ile Gln Ser Val Thr Arg Asp Pro 180 185 190Asn Trp Pro Gly Leu His Gly Arg Pro Gln Gln Phe Ile Val Glu Ala 195 200 205Asn Thr Asn Pro Lys Asn Thr Ala Val Ala Ile Cys Gly Pro Pro Arg 210 215 220Met Tyr Lys Ser Val Phe Glu Ala Leu Ile Asn Tyr Gly Tyr Arg Pro225 230 235 240Glu Asn Ile Tyr Val Thr Leu Glu Arg Lys Met Lys Cys Gly Ile Gly 245 250 255Lys Cys Gly His Cys Val Val Gly Thr Ser Thr Ser Leu Lys Tyr Ile 260 265 270Cys Lys Asp Gly Pro Val Phe Thr Tyr Phe Asp Ile Val Ser Thr Pro 275 280 285Gly Leu Leu Asp 29044265PRTPyrococcus horikoshii 44Met Gly Glu Met Gly Lys Lys Lys Ile Arg Ile Gly Phe Tyr Ala Leu1 5 10 15Thr Ser Cys Tyr Gly Cys Gln Leu Gln Leu Ala Met Met Asp Glu Leu 20 25 30Leu Leu Leu Leu Pro His Ile Glu Leu Val Cys Trp Tyr Met Val Asp 35 40 45Arg Asp Ser Ile Asp Asp Glu Pro Val Asp Ile Ala Phe Ile Glu Gly 50 55 60Ser Val Ser Thr Glu Glu Glu Val Glu Leu Val Lys Lys Ile Arg Glu65 70 75 80Asn Ser Lys Ile Val Val Ala Val Gly Ala Cys Ala Val Gln Gly Gly 85 90 95Val Gln Ser Trp Asp Lys Ser Leu Glu Glu Leu Trp Arg Thr Val Tyr 100 105 110Gly Asp Ala Lys Val Lys Phe Lys Pro Lys Lys Ala Glu Pro Val Ser 115 120 125Lys Tyr Ile Lys Val Asp Tyr Asn Ile Tyr Gly Cys Pro Pro Glu Lys 130 135 140Arg Asp Phe Leu Tyr Ala Leu Gly Thr Phe Leu Ile Gly Ser Trp Pro145 150 155 160Glu Asp Ile Asp Tyr Pro Val Cys Leu Glu Cys Arg Leu Asn Gly Tyr 165 170 175Pro Cys Val Leu Leu Glu Lys Gly Glu Pro Cys Leu Gly Pro Val Thr 180 185 190Arg Ala Gly Cys Asn Ala Arg Cys Pro Gly Phe Gly Ile Ala Cys Ile 195 200 205Gly Cys Arg Gly Ala Ile Gly Tyr Asp Val Ala Trp Phe Asp Ser Leu 210 215 220Ala Arg Val Phe Lys Glu Lys Gly Leu Thr Lys Glu Glu Ile Ile Glu225 230 235 240Arg Met Lys Ile Phe Asn Gly His Asp Asp Arg Ile Glu Lys Met Val 245 250 255Glu Lys Ile Phe Gln Gly Val Lys Glu 260 26545429PRTPyrococcus horikoshii 45Met Lys Glu Ile Tyr Ile Pro Ile Thr Val Asp His Ile Ala Arg Ile1 5 10 15Glu Gly Lys Ala Gly Val Glu Ile Leu Val Gly Glu Asp Gly Val Lys 20 25 30Glu Val Lys Leu Asn Ile Ile Glu Gly Pro Arg Phe Phe Glu Ala Ile 35 40 45Thr Leu Gly Lys Lys Leu Glu Glu Ala Leu Ala Ile Tyr Pro Arg Ile 50 55 60Cys Ser Phe Cys Ser Ala Ala His Lys Leu Thr Ala Leu Glu Ala Ala65 70 75 80Glu Lys Ala Ile Gly Phe Thr Pro Arg Glu Glu Ile Gln Ala Leu Arg 85 90 95Glu Ile Leu Tyr Ile Gly Asp Ile Ile Glu Ser His Ala Leu His Leu 100 105 110Tyr Leu Leu Val Leu Pro Asp Tyr Leu Gly Tyr Ser Ser Pro Leu Lys 115 120 125Met Val Asp Glu Tyr Lys Lys Glu Leu Glu Thr Ala Ile Lys Leu Lys 130 135 140Asn Leu Gly Ser Trp Ile Met Asp Val Leu Gly Ala Arg Ala Ile His145 150 155 160Gln Glu Asn Ala Ile Leu Gly Gly Phe Gly Lys Leu Pro Ser Lys Glu 165 170 175Thr Leu Glu Lys Ile Lys Asp Glu Leu Lys Ser Ala Leu Pro Leu Ala 180 185 190Glu Tyr Thr Phe Glu Leu Phe Ser Lys Leu Glu Gln Tyr Lys Glu Val 195 200 205Glu Gly Glu Ile Thr His Leu Ala Val Lys Pro Arg Lys Asp Ala Tyr 210 215 220Gly Ile Tyr Gly Asp Arg Ile Lys Ala Ser Asp Gly Glu Glu Phe Pro225 230 235 240Ser Glu Glu Tyr Lys Asn Tyr Ile Lys Glu Phe Val Val Glu His Ser 245 250 255Phe Ala Lys His Ser His Tyr Lys Gly Arg Pro Phe Met Val Gly Ala 260 265 270Ile Ser Arg Leu Val Asn Asn His Lys Leu Leu Tyr Gly Lys Ala Lys 275 280 285Glu Leu Tyr Glu Asn Asn Lys Asp Leu Leu Arg Pro Thr Asn Pro Phe 290 295 300Ala Asn Asn Leu Ala Gln Ala Leu Glu Ile Val Tyr Phe Met Glu Arg305 310 315 320Ala Ile Asp Leu Ile Asp Glu Val Leu Ala Lys Trp Pro Ile Lys Pro 325 330 335Arg Asp Glu Val Lys Val Arg Asp Gly Phe Gly Val Ser Thr Thr Glu 340 345 350Ala Pro Arg Gly Ile Leu Val Tyr Ala Leu Lys Val Glu Asn Gly Arg 355 360 365Val Ser Tyr Ala Asp Ile Ile Thr Pro Thr Ala Phe Asn Leu Ala Met 370 375 380Met Glu Arg His Val Arg Met Met Ala Glu Glu His Tyr Lys Asp Asp385 390 395 400Pro Glu Lys Leu Lys Leu Leu Ala Glu Met Val Val Arg Ala Tyr Asp 405 410 415Pro Cys Ile Ser Cys Ser Val His Val Val Lys Leu Gln 420 4254618PRTartificialconsensus L1 site 46Arg Xaa Cys Xaa Xaa Cys Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa Xaa1 5 10 15Xaa Xaa4718PRTartificialL1 site 47Arg Ile Cys Ser Phe Cys Ser Ala Ala His Lys Leu Thr Ala Leu Glu1 5 10 15Ala Ala4818PRTartificialL1 site 48Arg Val Cys Gly Ile Cys Ser Ala Ala His Lys Leu Thr Ala Leu Glu1 5 10 15Ala Ala4912PRTartificialconsensus L2 site 49Arg Xaa Xaa Asp Pro Cys Ile Ser Cys Xaa Xaa His1 5 105081DNAEscherichia coli 50ggtcatcacc atcatcacca cggctcgatc acaagtttgt acaaaaaagc aggctcagaa 60aacctgtatt ttcagggagg a 815128PRTartificialfusion protein fragment 51Met Gly His His His His His His Gly Ser Ile Thr Ser Leu Tyr Lys1 5 10 15Lys Ala Gly Ser Glu Asn Leu Tyr Phe Gln Gly Gly 20 255210DNAartificialCD-ABI intergenic sequence 52gaggtggaaa 105372DNAartificialhypD-hypA intergenic sequence 53tttacaaata tggcgccctg atgtaggagg tggaaaatgc acgaatgggc gttggcagat 60gcaatagtaa gg 725475DNAartificialhypE-hypF intergenic sequence 54gtgatcccgt tcctagagtt tgttaggagg tggaaaatga tctgggggag agaatgaaag 60cttatagaat tcacg 7555813DNAartificialmodified sequence of expression vector 55ggatccccgt caccctggat gctgtacaat tgacgacgac aagggcccgg gcaaactagt 60aatcagacgc ggtcgttcac ttgttcagca accagatcaa aagccattga ctcagcaagg 120gttgaccgta taattcacgc gattacaccg cattgcggta tcaacgcgcc cttagctcag 180ttggatagag caacgacctt ctaagtcgtg ggccgcaggt tcgaatcctg cagggcgcgc 240cattacaatt caatcagtta cgccttcttt atatcctcca gccatggcct tgaaatggcg 300ttagtcatga aatatagacc gccatcgagt accccttgta cccttaactc ttcctgatac 360gtaaataatg atttggtggc ccttgctgga cttgaaccag cgaccaagcg attatgagtc 420gcctgctcta accactgagc taaagggcct tgagtgtgca ataacaatac ttataaacca 480cgcaataaac atgatgatct agagaatccc gtcgtagcca ccatcttttt ttgcgggagt 540ggcgaaattg gtagacgcac cagatttagg ttctggcgcc gctaggtgtg cgagttcaag 600tctcgcctcc cgcaccattc accagaaagc gttgatcgga tgccctcgag tcgggcagcg 660ttgggtcctg gccacgggtg cgcatgatcg tgctcctgtc gttgaggacc cggctaggct 720ggcggggttg ccttactggt tagcagaatg aatcaccgat acgcgagcga acgtgaagcg 780actgctgctg caaaacgtct gcgacctgag ctc 8135610484DNAPyrococcus furiosus 56aggggttttt aacctttggt tttcaatttt cgggtttaaa aaggcttttt tatctccctc 60accaacttta gactgggaaa caaaaatgtt cactaacgaa aatttgagga gtattggtca 120attatgctca ttgggaggtg gtttgtgtga ggtatgttaa gttacccaag gaaaacactt 180acgagttttt ggaaagactt aaagactggg ggaagcttta cgctccagta aaaatttcgg 240acaagttcta tgacttcagg gagattgatg atgttagaaa gatagaattc cactacaaca 300ggacaataat gccacctaag aagttcttct tcaagccgag ggaaaagctc tttgagttcg 360acatttcaaa accagaatac agggaggtaa tagaggaagt tgaaccattt attatatttg 420gagtccacgc gtgtgacata tatggcctaa agatcctaga cacggtatac cttgatgagt 480tccccgacaa gtactacaag gtgaggagag agaaggggat aatcattgga ataagctgta 540tgccagatga atattgcttc tgtaacttaa gagaaacaga cttcgctgat gatggttttg 600acttgttctt ccatgaactg cccgatggat ggttggtaag ggttggcact ccaactgggc 660acaggcttgt tgacaagaac ataaagctct ttgaagaggt aacggacaag gatatctgtg 720catttagaga ttttgaaaag aggagacagc aagcattcaa ataccacgaa gactggggca 780acttgaggta tcttctcgag ttggaaatgg aacatccaat gtgggatgag gaggcagata 840agtgcttggc ttgtggaata tgtaacacca catgcccaac gtgtagatgc tatgaagttc 900aggatattgt aaacctagat ggagttactg gatacaggga aagaagatgg gattcttgtc 960agttcagaag tcatggctta gttgctgggg gccacaactt caggcccaca aagaaggatc 1020gctttaggaa cagatacctc tgtaagaacg catataacga aaagcttgga ttaagctact 1080gtgtcggttg tggaaggtgt actgcattct gtccagccaa tataagtttt gtaggcaatc 1140ttagaaggat tttaggactt gaggagaaca aatgtccccc aacggttagt gaggagattc 1200caaagagagg atttgcatat tcctctaaca ttagaggtga tggagtatga tgttgccaaa 1260agagattatg atgccaaatg ataatccgta tgcccttcat agagtcaaag ttctaaaggt 1320ttactccttg acggaaacgg aaaagctttt cctctttaga tttgaggatc ccgagttggc 1380agagaagtgg acgttcaaac ctggacagtt tgtccagctg acgatacctg gagttggaga 1440ggttcccata agtatatgct cttctccaat gaggaaagga ttctttgagc tctgtataag 1500aaaggcagga agggtcacaa ctgttgtcca tagactaaag cctggcgata ctgttcttgt 1560gagagggcct tacggtaatg gattcccagt ggatgagtgg gaaggaatgg atctactatt 1620aatagctgct ggccttggaa ctgcacctct taggagcgtc tttctctatg caatggacaa 1680caggtggaag tatggaaaca ttaccttcat aaacaccgca cgttatggga aggatctcct 1740cttctacaag gagctggagg caatgaaaga cctagctgag gctgaaaacg tgaaaatcat 1800ccagagcgtc actagggatc caaactggcc gggcctaaag ggtaggccac agcagttcat 1860cgttgaggcc aacacaaatc caaagaacac tgcagttgca atctgtgggc ctcctagaat 1920gtataagtca gtgtttgagg ccctcatcaa ctacggttat cgcccagaga acatcttcgt 1980gacattggag agaagaatga aatgtggaat cgggaagtgc ggccactgca acgtcggaac 2040gagcacgagc tggaagtaca tctgtaaaga tggaccagtc ttcacgtact tcgacatagt 2100ttcaacccca ggactgctgg actgaggtga ggaaaatggg aaaagttagg attggatttt 2160acgcattaac ctcgtgctac ggctgtcaat tgcagctagc tatgatggac gagttattac 2220aacttatccc aaatgctgaa atagtttgct ggttcatgat tgatagagat agcattgagg 2280atgaaaaggt cgacatagct tttatagaag gaagcgtttc aactgaggaa gaagttgaac 2340tcgtgaaaaa aattagggag aatgcaaaga tcgtcgttgc ggttggagct tgtgctgttc 2400aaggaggagt tcagagctgg agtgaaaagc cattagaaga gctctggaag aaggtttatg 2460gagacgcaaa agtcaagttc caaccgaaga aggctgaacc agtttcaaaa tacataaaag 2520ttgactacaa catctacggt tgcccaccag agaagaagga cttcctctac gccctgggaa 2580cattcttgat tggttcatgg ccagaggata tagattatcc agtttgtcta gaatgtaggc 2640tcaatggaca tccatgtatc cttcttgaga aaggagaacc ctgtctaggt ccagtaacaa 2700gggcaggatg taacgcgaga tgtccaggat ttggagttgc gtgtatagga tgcagagggg 2760caatagggta cgatgtagct tggttcgact ctctagctaa ggtgttcaag gagaagggga 2820tgacaaaaga ggagataatt gagagaatga aaatgttcaa tggacatgat gagagggttg 2880agaaaatggt tgaaaaaata ttctcaggtg gtgaacaatg aagaacctct atcttccaat 2940caccattgat catatagcaa gagttgaggg gaagggtggt gtggagataa taattgggga 3000tgatggagtc aaggaggtca agctaaacat aattgaaggg cccagattct ttgaggccat 3060aactattggg aagaagcttg aggaagctct ggccatttac ccgagaatat gctcattctg 3120ttcagccgcc cacaagttaa ccgcattaga ggctgcagaa aaggccgtcg gttttgtccc 3180aagggaagag atacaggccc ttagagaagt actatacatc ggagacatga tagagagtca 3240tgcccttcac ctatatcttc tagttcttcc cgactacagg ggctactcga gcccacttaa 3300gatggtgaat gaatacaaga gggagataga gatagccctt aagctgaaga accttggcac 3360ctggatgatg gacattctag ggtcaagagc catacaccaa gaaaatgcgg ttttgggcgg 3420attcggaaag ctccctgaga agagtgtcct tgagaaaatg aaagccgagc ttagggaagc 3480cctaccactt gccgagtata cttttgagtt atttgcaaag cttgagcagt acagcgaagt 3540tgaagggcca ataacacact tggccgtgaa gccgagggga gatgcttatg gaatttatgg 3600agattacata aaggcaagtg atggggagga gttcccaagt gaaaagtaca gagattatat 3660aaaggagttc gtcgttgaac acagttttgc aaagcacagt cactacaagg gcagaccctt 3720catggttggg gctatatcta gagttattaa caatgctgac ctcctatacg gcaaggccaa 3780ggagctgtat gaggcaaaca aagacctatt aaagggaaca aatccgtttg caaataactt 3840agcccaggcc ctcgaaatag tttactttat agagagggca atagatctgc tcgacgaggc 3900tctcgccaag tggccaatta agcccaggga tgaagttgag ataaaggacg gctttggtgt 3960ctcaacgact gaggctccaa ggggaatctt agtctatgcc ctcaaagttg agaatggaag 4020ggtttcttat gccgacataa taacacctac agcattcaac ttggcaatga tggaagaaca 4080tgtaagaatg atggcagaaa agcactacaa tgacgatcca gaaaggttaa agatactggc 4140tgagatggtt gttagggctt atgatccatg catatcttgc tcagtccacg tggttagact 4200ttaatccttt ttatctattt ttgttgagta cttgtggaga ttctcattca catcacaata 4260ggagagctct tctcttgagg agatgataac aatgcccttc tctttgagaa tttcgaggat 4320agactttagg actttatgtt ttgagtcctc atcaatggca acaactggat cgtcaagaac 4380ataaatctcg gcattcacta gcaaggtgga tgccaattga actcttctaa ttgttccctg 4440ggaaagctct cccagcttct tctttaaatc caagacctcc acggattcaa gtgcatccat 4500aatttcattt ttattaactt taactccata aagactggcc actgctttta aataatcctc 4560aacacttatt ttcctgggca cgattatttc ttcaggaagg aaaaatattt tgcccttaac 4620ttttgttata gggactccat tataaattat ttctcccttg aggggtttca aatatgttga 4680tattgttttt aaaagtgtgg tttttcctat cccatttgga ccgtggaagt tcacgacatt 4740acctttctct atggtcattg ttattctttc gagaactggt ttatcataac caacactaag 4800atctctaatc tcaagtttca ttcccatccc tcccaaattc ctattattcc agaaatagat 4860actaaaagga gggggattgc agcaatacca tttcctttgc taaccaatat tattcctata 4920atgaagggag ctatgaatcc aagaatccag ccacacaact ttctaattga actaacttcc 4980actgtcggtt cccacacaaa cattaatttc ttgaaatcta tagttacttt tacaggtgtc 5040attaggggaa gatattgaag aacttcatga acatataccg ctccaactag tggcaacact 5100acatttttca ctatagattt catatagcaa ttagtgaatt cccctgttat tttacctata 5160agaaaactaa tccaaagtac tagagctaca agaaatccta catatatgct taccattttt 5220atgaaattta aaaattgcct agacatttct tatcaccctt tctagcttta tcctcacaaa 5280atatgcaagt ggagagataa gaattaacaa gggaattacc cacataggaa taattttcct 5340tataataaat ggagcaccca ggataattag atacagaaat aggaagctgt ttctttcaaa 5400acttggcaat gttattgata atacaactct acttatcgct aacatgaaaa ataagatata 5460tagtgtccct aaatactccc tttcaagaat tgccaaggaa taaaatgtca acggaacaat 5520tagcgaaatc aagaagagta gaatttcctt tattagtctt cttaaatagt tctctggttt 5580tagatagtgg agataggcta tataagaatc aacataacta tcaccaacca ggaataaagg 5640ccaaatcata ggggcagtta tgcatatagt aactagcgta cttgcaatcc tctctataat 5700atagaatttt tgcttatcta caatgatatg taatggtaac aaggctttaa atgctccaac 5760tccacaccca aatttcactc cttgcattct caggtgctgg gccataagtg tgaaaactat 5820agagagaata atagcgattc ccctaatttc aaaggaaagg gtagaaatat agatgtttct 5880aactagataa actcttatca gcctatcttt tagaacagag gctaccaagt atgcaattac 5940gaggatgata taacctatca gagtcatctt tctaccacta attgctagga gaccaagaat 6000tgtggctatg cacttaattt taaatgaaac agacagtgga agtatagata aagcggcaaa 6060tacaataata ttggagggca aaaaacctgg gtaaagatag gagcaactaa ggatggaggg 6120gagatttata actactgaga caaatagcac aatgagatca gtgtcgggtc tatatttgag 6180gatcactcca gttttcttag gatcaaagga atttgaaaag agaagtggaa ttgcacctaa 6240caaggcaaaa actattatgt cttcgataat cttacctttt aagaagattg ttaatggtat 6300aagagagatc atcccagcga gataattata

gttttttata gataccaaaa tatggtatct 6360taatatttcc actattctca ctttcattac ctcctaaatc ttctaaggat ttttattgag 6420ctcacaaccc ccaaaagata acataggatt cttgttattg gagttacctt tactgagaca 6480taatatggct catttattgc attaaataga atgccctgcc cgggtggtat tttatttgta 6540gtcaaaatga agattgccaa caaataacta actaaaatag aaaatgaaag agctaagggt 6600attgccgaaa ccaaggctag ggcaaaaaat agttttttag atcttaccac acgaaatcac 6660ctcctatcgc agttggaagc gctggatctg taggattatc tggcatacat tcacagaggc 6720atttgatctc aactcctgaa atagttgctt ttgtctgtgg cccacagtcg gacattatac 6780ctccacctgt actacacaag attgggcact ccctacaata gccatagcac atctttgtgt 6840agtatgtcgc tgtagcagct attattacaa ataaaactat tacccacaat cctacaccat 6900aatacttttg ttttctttaa tacatatata atcaccattt aaattatgct actataaatt 6960ttataaaatt ttcgagaata tcactataac agaagctatt aaaatataat aattattcct 7020aatttgatcg acgatactgt caggataact ggggtatcac ctcttgaagc cattcagtca 7080catcaccagg cggtccacca aaccgagaat gaattctaac aaaattatac cagaatgaaa 7140acagaaaaac aaacctgtga accctcctcc agtctctagc cctgaagtta ttccagaaac 7200gctttgttct ctctttaaca gtcctaaacc agcgctcaac acagttcctc ggcccgaaag 7260tcacatgcag ataatccagc ccgagagatt taaacgctga tttataccac ggccctttgt 7320caaccaggaa aattggctgt ccctcgcagg atttcaaaac aactagaatg aagtccctgg 7380caatccacca gttcctaacg cttgtaatcc atactgctag gatttctttg ctctcaacgt 7440cgattgcagc ccagagaaat ctcttctggc cgttgatctt tatcactgtc tcgtcaattg 7500cgatgaagtt tctctgtttt ttgactgcga ggattttcgg ctggtaaact gctttcgcga 7560atttttggac tgtttcccag actgttgtgt ggctgatttc gaggattgtt cctacctgtc 7620tgtaacttag tccgtgcagg tacaggttta ttgccctggt tttctttttt gctgggattt 7680tgttccggcg aaaggttttt aagactgaaa ccagtaagta gataatggtt tcagtcctca 7740tttctctccc cttttctgaa gaggtatcag aaacttaaac ctaacgtccc actgcttatc 7800ctgacagtgt cttgatcgac tttagaaaca tttttattct tgtttatgtt cccttagact 7860atgagcacca ggggagactt gatcagaatt ttaggtgaga tagaggaaaa gatgaacgaa 7920ctgaaaatgg atggctttaa ccctgacata atcctttttg gcagagaggc ttataacttt 7980ctttcaaatc tcttaaaaaa ggaaatggaa gaggaagggc cttttacgca tgtctctaat 8040atcaagatag aaattcttga ggaattagga ggagacgcag ttgttataga ttcaaaagtc 8100ctaggcctag ttcctggggc cgcaaagaga atcaaaatta ttaagtagcg ctttccaaag 8160tacaggagat gctcacttcc tccttagcta ggattagacc aaaatataac ataaaggagt 8220tgagtgttgc ccaggagggg actagcctcc ttgatattaa taaagggtct ctgcgaagag 8280ttttgtcctg tatcatatta aagagttcgt taattcttgc atctgcaagt tgaaggccta 8340accttgtccg agatttggct gtaatgactt taacagagta atgtttaacc aaaaaaagaa 8400gactttaaaa ccttccactc acaataagta gacgagtcaa caacaatttg agggaaaaga 8460catgggaaat gaaggtgtcc acccccacct gcggaaaagg ttttggagag agatgggtat 8520aaatgcagaa tttgtgatca cagctatctc gatattcatt acaaggacgg gaatgtagag 8580aacaagaatt tagaaaattt gatagttttg tgcaaacaat gtcattatcg acttcaccaa 8640aaggaaagga tggaaagcat taaacaagct ttcgaggatt tcctcgatga actttctaaa 8700aatcctattg aagttgttat agatttcagt ttcaaaaaaa ttgtagagag taatgaagaa 8760aaaatccgaa gagagattat acagggattt actcgtcctt ttggtgttat atcaaggatc 8820caagagaaag ttagggatgc aataatgaag gaaatcgagg aggaaataga aaaagagcaa 8880gcaagtactc ctgaacatct ccgaaaggtt gttcttgaaa gaaataatta tagatgttca 8940gtgtgcggat acggatattt agaggttcac catgtggatg gaaatattct aaataacacc 9000ttggataatt tagtaaccct ctgtagaagg tgtcatcgta aagtccatta tcatccaagt 9060tttcatacaa caccggagga tatggacaaa tgtattagaa gttttcatca tgagttttat 9120agtacgatct atgaaataat gaagaacaaa aagggaaaca ttagaataag cattaaattc 9180gatcaactag gtgttaaagg tgtaaaaatt agtagagctc aatttaaaag aattaatggg 9240ctctttaatc atgaagtcat aaatgatggt atttttaagc agtgggaaag agaaattaag 9300aattatttaa gccgacttga atgggaacag caaaaagaaa tatatagaaa tgtatacttc 9360ttgctagaat gtattttgcc taaagattca tttgaagcgt ttgttaacct tgcaaggaaa 9420ggaaaatttg atagaagaac attaagggaa gcaaagaaag tactaaagaa ctcaattaaa 9480taatttttgt aatttttccc tggaaataca gctcctattc tactattttt aaagtgctgt 9540cttcttcttt tataaaccca tattttttgt tactctttag gaagttcttt attatttcac 9600aaagctcagg gttgagagat cttttcagtt acacacttct tattattcct aaagtacgaa 9660tagaacttag gacttccact ggagtggtat actccaagta tcttcttgtt tctcagcttt 9720tcagctatgt cgggaaaaat cttcttgtat atttttttct ttttagccaa ctttttcata 9780atttcgtagg actctcgccc caaacataaa attaagtccc ccgctatgaa atcaagtacg 9840cgacctaaaa acttccctat gcagttttgt agggtttctg caggtagtgg gactctaaca 9900ttttcactct cacagtatac taattctcca aacagaattg tacttcctcc ggtaaattaa 9960aacagtcttt gctttcttta agaattctag tgtgtttgca aagtatttat agtggaaagg 10020atagttacgg tagttcttga taaattctga gacccatgtg tcatggattt ctttaaaagc 10080tttgatggcg ttacttttgc tatattctga agtaaataat ccatgctttt tcaggatgtc 10140tgtgtagtaa agtctttcaa atggtaagtg ggggcctgga tttattccaa aaataccaat 10200ttttgctttt tctctggaag gctcgccttg aagtgtagaa aggattagaa cccttggaat 10260aatgccctca tccttggaat tctttatacc ttcacacttc tccttctctg agcataagat 10320catctcactg cctaactcca agaatgcctc aggcatcatg gtaatgattt tacacagaga 10380atttaataat aatttcggat ttctcaatgc ttcttaattg agaagctaca ttttgaaaat 10440tgagaaaaat caaaggtacc agtgtgtctc agaaaagtga atat 104845710029DNAPyrococcus furiosus 57agtaataaaa ctacataaaa cttttaccct agttcccatc aggtcgttag aattattaag 60tacttaaatt ttttgattgg ttggtggttg ttatgaactt tcagcaggaa atcctgatca 120taaaatccga aatctatccg atagtcagca aacactaccc gaaaaacact cgcagggaag 180taatcagcct ctacgacctg ataaccttcg caatactagc ccacctgcac ttcggaggag 240tttacaaaca cgcttacgga gccctaatcg aggaaatgaa actgttcccc aaaatcaggt 300acaacaaact aacagaacgc ttgaacaggc acgaaaaact tctgctccta gcgcaggaag 360aattattcaa aaaacacgcc agagaatacg ttagaatact ggactcaaaa cccattcaga 420ccaaggagtt ggccagaaaa aacaggaagg ataaggaggg ttcttcagaa atcatctctg 480aaaagcccgc agttgggttt gttccctcta aaaaaagttt tactatgggt acaagctgac 540ctgttactct gatgggaacc tgttggcttt gctgtccgtt gatccggcaa acaagcatga 600tgtgagtgtt gtcagggaaa agttctgggt gattgttgag gagttttccg gctgttttct 660gtttttggat aagggttacg ttagtagaga acttcaggag gaattcctga agtttggcgt 720tgtttacacg ccggtgaagc gggagaatca ggttagtaat ctggaggaga agaagtttta 780caagtacttg tctgactttc gcagaaggat tgagactttg ttttcgaagt tttctgagtt 840tcttctgagg ccgagcagga gtgttagttt gagggggtta gctgtcagga ttttaggggc 900gattctggcc gtgaatctgg acagattata caacttcaca gatggtggga actagggtta 960aaactttttg atcgtcaatt aatcataata atggcaaaag tttacttagt ggattattat 1020gccacttatg atcttttcat aggggttagt atggaaaacc atatcaagat attgaaggac 1080atgaagtggg gggtaagaaa tggttcgtgt tacgctcgtt aactatacaa agaggccctt 1140agaaacaata acttgggctg cccttataag ctattggggg gaatggagca cggaatcatt 1200tgaaaggata agtgagaatg atgtagaaaa gcatctccct cggatattgg gttatggtca 1260tgagagcatt ttggagcatg caacgtttac tttctcaatc gaaggttgta gtagggtttg 1320tactcatcaa cttgtgaggc atagaatagc cagctacacc cagcaaagcc agcgttacat 1380tgttcttgac gaggagaacg ttgaggaaac gtttgtaatt cctgaatcga taaagaaaga 1440tagagagctt tatgaaaaat ggaagaaggt catggctgag acaataagcc tttacaagga 1500gagcataaat aggggagttc accaggaaga tgctcgattc attcttcctc aagctgtgaa 1560aacgaagata attgtgacga tgaacttgag agaattgaag cacttctttg gccttagact 1620atgtgaaagg gctcaatggg agattaggga agttgcatgg aagatgttag aggagatggc 1680gaagagggat gatataaggc cgataataaa gtgggctaaa cttgggccta ggtgcattca 1740gtttggctat tgtcccgaga gagatctaat gcctcctggg tgcttaaaga aaactagaaa 1800aaagtgggaa aaagttgcgg aaagtaagag ctaaattgtt atattgagta aaagctttct 1860ttctttattt gtctttatgg caaaatccca gaagttcagc tattgaatta gagaactgtt 1920cgtcactgaa agtaaacttc tatgggattc ttctgaatta tatggtaagg tttggaaaat 1980ttggacataa aagtcttaaa gtttcctttt tcaactctaa actagggtga gctaatggat 2040actgaaaaac ttatgaaagc cggagaaata gcaaaaaaag taagagagaa agctattaaa 2100cttgctagac ctgggatgtt gttgttagaa cttgcagagt ctatagaaaa gatgataatg 2160gaacttgggg gtaaacctgc tttcccagta aatttatcaa ttaatgaaat tgcagctcac 2220tatactcctt acaagggaga tactactgtt ctgaaagagg gggattatct aaagatcgac 2280gtgggggttc acatagatgg atttatagca gatactgcag ttacagttag agtagggatg 2340gaagaagatg agcttatgga ggctgccaag gaagcgttaa acgccgcaat ttctgtagct 2400agggcgggag tggagataaa ggaactagga aaggcaatag aaaatgaaat taggaagaga 2460ggattcaaac caatagttaa tctaagtggg cacaagatag aaagatacaa gcttcatgca 2520gggattagca ttccgaacat ttatagaccg catgataact atgttttaaa ggaaggagat 2580gttttcgcaa ttgagccttt cgctactata ggtgctggtc aagtaattga ggttccccca 2640accttaatct acatgtacgt tagagatgtt ccagttagag tggcccaagc taggttcctt 2700ttggctaaga taaaaaggga atatggaacc ctaccctttg cctataggtg gcttcagaat 2760gacatgccag aaggacagct taagttggcc ctaaaaaccc tcgaaaaggc tggagctata 2820tatggctatc cagtgcttaa agaaattaga aatggcattg tggcacaatt tgagcacaca 2880atcattgttg aaaaggattc tgtgatagtg acgacagaat gagttaaact ttataagttc 2940tcatgtatca agaaattggg agcgccgggg tagcctagtc agggaaggcg cgggactcga 3000gatcccgtgg gcgttcgccc gccggggttc aaatccccgc cccggcgcca tttgttaagc 3060acttggaggt ttgataatat ggcatttcta aaggtagtgt cattggaaga agcaatttca 3120ataattaata gctttagact tgaaatagga tttgaggaag ttactttaga taaagctctg 3180gggaggatag ttgcagagga tatttattcc cccttggata ttcctccctt tgatagatcg 3240accgttgatg ggtatgctgt tagggcggag gatactttta tggccagtga agctaatcca 3300gtggaactca aagtaattgg agaagttcat gccggagaac aaccttcagt aaagttaagc 3360aagggagagg cggtctacat tacaacgggg tcaatgatgc cagagaacgc aaatgctgtg 3420attccttttg aggatgttga gagagaagga gatattataa gaatttataa gcctgcatac 3480ccaggtttag gagtcatgaa gaaaggaact gacataaaaa agggccaact cttaattaga 3540agaggaacta agctaacgtt taaagaaact gccctgcttt ctgctgcggg atttttaaaa 3600gtaaaggtct ttaaaaagcc taaagttgcg gtcataagta cggggaatga aattgttctc 3660ccaggtgaag agcttaggcc tggccaaata tatgacatca atggtagagc aatagttgat 3720gccgttaatg aattgggtgg agagggaata ttcgttggga ttgccaggga tgacagagaa 3780agtctcaaaa aattaatact tcaagcctta gaagttggag atattatcgt tattagtggg 3840ggggcaagtg ggggaataaa agacttaaca gcctcggtaa tagaggaact tggagaggtt 3900aaagttcatg gaattgcaat tcagccaggt aaacccacaa taataggggt tataaacggt 3960aagcctgtct ttggcctacc tgggtatccg acaagttgcc taacaaactt caccctctta 4020gttgctcccc tgcttttgag gctacttgga agggaaggaa aaattaagaa ggttaaggcg 4080aaaattaagc ataaagtatt ttcggtaaag ggaagaagac aattcctccc agttaaactt 4140gagggagatg tagcggttcc tatcttgaag ggaagcggag cagtcacaag ctttgtggag 4200gcagatggtt ttgtggaaat tcccgagaat gtagaaagcc ttgatgaggg agaagaagta 4260acggtaacgt tgttctcgtt ttaggaggtg atagtatggt caaggttaag gttaagtact 4320ttgctagatt taggcaactt gcaggagttg atgaagagga gattgagctt ccagagggag 4380ctagagttag ggacttgata gaagaaataa agaaaagaca tgaaaaattt aaggaggagg 4440tctttggaga aggatacgat gaggatgccg atgttaacat tgccgtaaat ggaaggtatg 4500taagctggga tgaagagtta aaggatgggg atgttgttgg agtatttcct cccgtaagcg 4560gaggttaaca tttacatact tttacataaa cttctcttct cctgggtcca tctaactcta 4620caaagagaat gctctgccaa gttcctaaca taagttggcc atttactatt ggaatagtca 4680cgcttgggcc aagtattata gctctgaggt gagagtgggc gttgttatct atagaatcgt 4740gtctgtatcc tgcacctttg ggaattaatt ttgagagaat attttctatg tcgttaagga 4800gccttggctc gttctcattt actattattc ctgtggtggt atgcctagta tagacaacgg 4860caattccatt atcgatgcca ctttttctaa cgatttcctg gactttttcc gttatatcta 4920ttatttcaac ttctttggaa gtccttatag tgatggtttc aatcatattt cttcccctct 4980agataccttt ttatcatctc cctagcgttt tctatatgct tatttgcctc ttcttcatta 5040atgtttttta acgtggccct aacagtaaca atgctctcaa aggcctccaa taacctttga 5100tctgttgtct cttttagaat tctttttagc attaagtatg cttcgtctat gctctcctct 5160cttagggttt tcttagatag tccttcgagg attcgatcta gaatgaatat tctatcttgc 5220aatagcttcc ttcttagtat taatcttctc attgactttc ccctctacca cttttactaa 5280aagttcggaa gcaagttttg aagcaatacc tctatcttta atattcaaaa caacgtcaat 5340agcatctcca acacgcccaa ttctaatgag ataatgggct aggaatccta aggcaactga 5400cctgtgccgt tcgctattaa ttctttttat tactctaact gcctgttgaa ggttgttgag 5460ctctaaataa tactttgtta ttcctactag tatgtcttcg cttattccct ctttctcgag 5520gaggacttga atcattggct ccatcttggg agaacccctc tctagaatcc taaatatgat 5580atccttaacc attaggacca tatcaggggg aaggctttcc attaaaattt tcagcttatc 5640taagtcttct ttagaaagta gagaagttag aatttcccta actattattc tttgcgtggt 5700gggcggtatt gtctttaata cttcaatcga ttgttggata aatccgtgaa ttgcaaatat 5760gtaggcaata tcttccctta tatcttctcc cactttttta gccagctcct cactctcttc 5820tatcaaaatt tttactattt ctgagttttc ctcattattc ttcaaaaatt ctagaacctc 5880atttaatgcc tgtgctatcc agagtttgct ccctatagag tttattaact caagaacaag 5940cttgtattct cctagtgaaa gtagtggttt aattgacttg actattgcct cctctctata 6000gggctcctca atagtttcga gaattaggag tactttcctt cttttatata ttttgtttag 6060tttttcccct tccaaatttt ctaaaacttt ttcgagtatt tcaagaagtt ttttgtttct 6120aagcttcttg ttcttaatct ccacggcata aaataccgct tcgtcagtgt cttttaatga 6180aagcaaataa tcgattgctt cggcttttac aatgtcctga atttcctctg gaagaagttg 6240tgccgatgat atggcctctc taaatgcttt ctttgctgat ttaagccctg ctaaacttgt 6300tgaatatcca atggcgagaa gagctcttac taaaatataa ggatcttcta tttttgataa 6360ttcttcgaaa gcttttctga atgcttttcc tgccctggga tcttttattt tagacaaata 6420tactcctatt ctcccatatg ttaataccct aacgaatggg tctggtatcg agggtactaa 6480ctctaatatt tcatctatta ccataatacc tcaccataag attatacatg gcaaaacgca 6540cttactaagg taaatttatg gacatagata ttttaatctt ttcgtttttg aagcaaatct 6600ttttgtagga agatgatgaa ctaatggttt caaaatgttt aaataaaagc ttaaggtgta 6660gtcaaaatgt tgtctcaaat ttaaagaaaa gaggcgaaac aaagaaaata gagggaagat 6720actttacttc ttgagctttt cacacttctt tacccactcc tcaagaacgt ctctgagctt 6780tggcttgcct atttcctcaa gctcatactt gactcttact gcaggcttgt tgaggttcat 6840gaatcttctt aggtctactg gagttcccat aacgacaacg tctgcatctg ctctgttaat 6900tgtttcctct agctctttga tctgcttctt gccgtatccc attgctggga gtatgttgct 6960taggtgtggg tacttcttgt atgtttcaat tattgaccca acagcgtatg gccttggatc 7020tactatctcc ttagctccga acttcttggc tgctatgtaa cctgcaccga agctcattcc 7080accatgggtg agggtcggac catcctcaac tacgagaacg cgcttaccct tgattagctc 7140tggcttgtcc acgaagattg gtgatgctgc ttcaatgact atagcatttg gatttatctt 7200ttcaatgttc tctctaatct tctgtatgtt ctctggtggg gctgtgtcta ttttattgat 7260tataataaca tcagcacttc tgaagtttgt ttcacctggg tggtgtgtca actcatgacc 7320aggtctgtgt gggtcagtga caactatcca taagtcgggc tcgaagaatg ggaagtcgtt 7380gttcccaccg tcccagagga ttatgtcggc ctctttctct gcctccctca gtatcttctc 7440gtagtcaact ccagcgtata ctaccattcc tctctctagg tatggctcat actcttctct 7500ctcctcaatt gtacactcat atctgtcgag gtcctcaaag gtcgcaaagc gctgaacaac 7560ttgctttctt agatcaccgt agggcattgg gtgtctgact gcaactacct tgaatcccat 7620ctcttggagg atttgggcca cttttcttga ggtctggctc tttccacatc ctgttctgac 7680tgcagttacg gctacaacgg gcttgcttga ctttagcatt gtgctctttg gtccaagtag 7740ccagaagtca gccccagcac tgtgggctct acttgctaag tgcatgacgt gttcgtgaga 7800aacgtcagag tacgcgaaaa ccactatgtc aacatcatgc tctttgatta tcttttccaa 7860atcatcttct ggtagaattg gaattccatt tggatacagt tcaccagcta gctctggggg 7920atatattctc ccctctatat ctggaatttg ggtggcagtg aaggcaacaa cctcgtaatc 7980tgggttatct ctgaaaaaga cgttgaagtt gtggaagtct ctacccgcag cacccagaat 8040tacaaccctt ctcctttttt tctcggccat tttgatcacc tcagaatgtt ttatttcgag 8100ataatactca atctagacat ttataacgat tttcatttaa attggaaata atttttcgaa 8160tgattttaag taaaagttgt gtaaagtcga aaatatttcg aataaatgtg tgtattatta 8220aagggattaa gaaaagggaa aaggttgaaa acttcaagtt tcaaaaaccc ctaaaaagtc 8280taaatcaaac cctctaatgg tgggagtaaa atgtgccttg caatcccagg gaaagtggtg 8340gagattaaag gtaacgttgg aatagtggat tttggaggaa tacggagaga ggtaaggtta 8400gatcttttga gtgatgttaa agttggcgat tacgttatag ttcacactgg ctttgctata 8460gaaaagttag atgagaggag agctagagaa attcttgaag cctgggaaga agttttctca 8520gtaattgggg gtgagtaaat gcttgaaaaa tttggagaca aagctgtagc tcaaaagatt 8580ttagaaaaaa ttaaagagga agctaaaggg atagaagagc tacgatttat gcacgtttgt 8640gggactcatg aggacacagt aactaggagt ggaatcagat cacttcttcc agaaaatgta 8700aaaatcatga gtggcccagg atgtcccgtc tgtataaccc ccgttgagga catagtgaag 8760atgatggaaa ttatgaaagt tgcgagagag gagagggaag aaattattct cactactttt 8820ggtgacatgt atagaattcc aactccaata ggaagctttg cagacttaaa gagtcagggt 8880tacgatgtga ggatagttta ctctatatac gactcctata aaatagccaa ggaaaatcca 8940gataagcttg tagtgcactt ttctcctggg tttgagacta ccgccgctcc aacagctgga 9000atgcttgaga gcattgtgga agaggggcta gagaacttta agatttattc cgttcatagg 9060ttaacccctc ctgcagttga agctctccta aatgcgggga ctgtttttca cggtttaata 9120gatcctggtc atgtctctac aataattggg gtgaaaggat gggcgtatct cacagaaaag 9180tttggaattc ctcaagttgt ggctggcttt gagccagttg atgttttact cggaatactt 9240attctcatta ggcttgtgaa gaggggcgaa gcgaaaataa tcaacgagta taatagagtt 9300gtaaagtggg aaggaaatgt caaggcccaa gaactgattt ggaagtactt tgaagttaaa 9360gatgcaaagt ggagggccct aggagtaatt ccaaggagcg gattggaact taagaaagag 9420tggaaggagc tagaaattag aacttattac aatcccgagg ttccaaagct cccagatctt 9480gaaaaaggat gtctctgtgg ggcagtcctt agaggattag ccttaccgac ccagtgccaa 9540cactttggaa agacatgtac accaagacat ccggtaggtc cttgtatggt ttcgtacgaa 9600ggaacttgtc acatatttta caaatatggc gccctgatgt agtttttatt acgcaaaagt 9660aatataccac tacagcataa accccaaata tggattatcg aaaaattctc gatattcatc 9720atagttttgg ttgttttttc atcagttgct cttctgtcaa agccttatct tccaagagaa 9780cagaaaagaa taacgtactc aggagaaaag ataatcttgc ctgccccaag aactgaagga 9840gaaatgagtg ttgaagaagc tattgcaaaa agaaggagca ttaggacata caaaaatgag 9900cctctaaaga tagaggagct tggtcaacta ttatgggctg cacaaggtat aactcatgaa 9960tataagaggg cagccccaag tgcaggagca acatatccct ttgaaatctt cgttgtcgtt 10020ggtaatgtc 100295812PRTartificialGateway attB1 site 58Gly Ser Ile Thr Ser Leu Tyr Lys Lys Ala Gly Ser1 5 10597PRTartificialTEV protease recognition site 59Glu Asn Leu Tyr Phe Gln Gly1 5

Claims

1. (canceled)

2. A tetrameric polypeptide comprising four subunits, wherein the amino acid sequence of the first subunit and the amino acid sequence of SEQ ID NO:6 have at least 80% identity, wherein the amino acid sequence of the second subunit and the amino acid sequence of SEQ ID NO:8 have at least 80% identity, wherein the amino acid sequence of the third subunit and the amino acid sequence of SEQ ID NO:2 have at least 80% identity, wherein the amino acid sequence of the fourth subunit and the amino acid sequence of SEQ ID NO:4 have at least 80% identity, wherein the tetrameric polypeptide has hydrogenase activity, and wherein the tetrameric polypeptide is present in a genetically modified microbial cell.

3. A tetrameric polypeptide comprising four subunits, wherein the amino acid sequence of the first subunit and the amino acid sequence of SEQ ID NO:6 have at least 80% identity, wherein the amino acid sequence of the second subunit and the amino acid sequence of SEQ ID NO:8 have at least 80% identity, wherein the amino acid sequence of the third subunit and the amino acid sequence of SEQ ID NO:2 have at least 80% identity, wherein the amino acid sequence of the second subunit and the amino acid sequence of SEQ ID NO:4 have at least 80% identity, wherein the tetrameric polypeptide has hydrogenase activity, and wherein one at least one subunit of the tetrameric polypeptide is a fusion comprising a heterologous amino acid sequence.

4. The tetrameric polypeptide of claim 3 wherein the tetrameric polypeptide is isolated.

5. (canceled)

6. The tetrameric polypeptide of claim 3 wherein the tetrameric polypeptide is present in a microbial cell.

7. (canceled)

8. The tetrameric polypeptide of claim 3 wherein the hydrogenase activity is at least 0.05 micromoles H₂ produced min^-1 mg protein^-1 when isolated by whole cell extract, centrifugation of a whole cell extract at 100,000.times.g, heat-treatment at 80.degree. C. for 30 minutes, and re-centrifugation at 100,000.times.g.

9-14. (canceled)

15. The polypeptide of claim 3 wherein the polypeptide consists of the first subunit, the second subunit, the third subunit, and the fourth subunit.

16. (canceled)

17. A genetically modified microbe comprising an exogenous polypeptide, wherein the exogenous polypeptide comprises four subunits, wherein the first subunit comprises an amino acid sequence, and the amino acid sequence of the first subunit and the amino acid sequence of SEQ ID NO:6 have at least 80% identity, wherein the second subunit comprises an amino acid sequence, and the amino acid sequence of the second subunit and the amino acid sequence of SEQ ID NO:8 have at least 80% identity, wherein the third subunit comprises an amino acid sequence, and the amino acid sequence of the third subunit and the amino acid sequence of SEQ ID NO:2 have at least 80% identity, wherein the fourth subunit comprises an amino acid sequence, and the amino acid sequence of the fourth subunit and the amino acid sequence of SEQ ID NO:4 have at least 80% identity., and wherein the four subunits form a dimeric tetrameric polypeptide having hydrogenase activity.

18. (canceled)

19. The genetically modified microbe of claim 17 wherein one at least one subunit is a fusion comprising a heterologous amino acid sequence.

20-27. (canceled)

28. A method for using a polypeptide comprising:providinga) a tetrameric polypeptide comprising four subunits, wherein the amino acid sequence of the first subunit and the amino acid sequence of SEQ ID NO:6 have at least 80% identity, wherein the amino acid sequence of the second subunit and the amino acid sequence of SEQ ID NO:8 have at least 80% identity, wherein the amino acid sequence of the third subunit and the amino acid sequence of SEQ ID NO:2 have at least 80% identity, wherein the amino acid sequence of the fourth subunit and the amino acid sequence of SEQ ID NO:4 have at least 80% identity, wherein the tetrameric polypeptide has hydrogenase activity, and wherein the tetrameric polypeptide is present in a genetically modified microbial cell,b) a tetrameric polypeptide comprising four subunits, wherein the amino acid sequence of the first subunit and the amino acid sequence of SEQ ID NO:6 have at least 80% identity, wherein the amino acid sequence of the second subunit and the amino acid sequence of SEQ ID NO:8 have at least 80% identity, wherein the amino acid sequence of the third subunit and the amino acid sequence of SEQ ID NO:2 have at least 80% identity, wherein the amino acid sequence of the fourth subunit and the amino acid sequence of SEQ ID NO:4 have at least 80% identity, wherein the tetrameric polypeptide has hydrogenase activity, and wherein one at least one subunit of the tetrameric polypeptide is a fusion comprising a heterologous amino acid sequence, orc) a tetrameric polypeptide consisting of four subunits, wherein the amino acid sequence of the first subunit and the amino acid sequence of SEQ ID NO:2 have at least 80% identity, wherein the amino acid sequence of the second subunit and the amino acid sequence of SEQ ID NO:4 have at least 80% identity, wherein the amino acid sequence of the third subunit and the amino acid sequence of SEQ ID NO:6 have at least 80% identity, wherein the amino acid sequence of the fourth subunit and the amino acid sequence of SEQ ID NO:8 have at least 80% identity, wherein one at least one subunit of the tetrameric polypeptide is a fusion comprising a heterologous amino acid sequence, and wherein the tetrameric polypeptide has hydrogenase activity; andincubating the polypeptide under conditions suitable for producing H₂ or NADPH.

29. The method of claim 28 further comprising collecting the produced H₂ or the produced NADPH.

30. The method of claim 28 wherein the tetrameric polypeptide of (a) or (b) is an isolated polypeptide.

31. The method of claim 30 wherein the tetrameric polypeptide is present on a surface.

32. The method of claim 31 wherein the surface conducts electricity.

33. The method of claim 32 wherein the surface is an anode.

34. The method of claim 28 wherein the tetrameric polypeptide of (a) or (b) is chemically modified.

35. The method of claim 28 wherein the incubating comprises conditions that comprise a polysaccharide. (Original) The method of claim 35 wherein the polysaccharide comprises starch.

37. The method of claim 28 wherein the conditions comprise a temperature of at least 70.degree. C.

38-49. (canceled)

Images