NOVEL GENES AND PROTEINS OF BRACHYSPIRA HYODYSENTERIAE AND USES THEREOF

Abstract

amino acids of Brachyspira hyodysenteriae are described. These sequences are useful for diagnosis of B. hyodysenteriae disease in animals and as a therapeutic treatment or prophylactic treatment of B. hyodysenteriae disease in animals. These sequences may also be useful for diagnostic and therapeutic and/or prophylactic treatment of diseases in animals caused by other Brachyspira species, including B. intermedia, B. suantatina, B. alvinipulli, B. aalborgi, B. innocens, B. murdochii, and B. pilosicoli.

Description

FIELD OF INVENTION

[0001]This invention relates to novel genes in Brachyspira hyodysenteriae and the proteins encoded therein. This invention further relates to use of these novel genes and proteins for diagnosis of B. hyodysenteriae disease, vaccines against B. hyodysenteriae and for screening for compounds that kill B. hyodysenteriae or block the pathogenic effects of B. hyodysenteriae. These sequences may also be useful for diagnostic and therapeutic and/or prophylactic treatment of diseases in animals caused by other Brachyspira species, including B. suanatina, B. intermedia, B. alvinipulli, B. aalborgi, B. innocens, B. murdochii, and B. pilosicoli.

BACKGROUND OF INVENTION

[0002]Swine dysentery is a significant endemic disease of pigs in Australia and worldwide. Swine dysentery is a contagious mucohaemorrhagic diarrhoeal disease, characterised by extensive inflammation and necrosis of the epithelial surface of the large intestine. Economic losses due to swine dysentery result mainly from growth retardation, costs of medication and mortality. The causative agent of swine dysentery was first identified as an anaerobic spirochaete (Treponema hyodysenteriae) in 1971, and was recently reassigned to the genus Brachyspira as B. hyodysenteriae. Where swine dysentery is established in a piggery, the disease spectrum can vary from being mild, transient or unapparent, to being severe and even fatal. Medication strategies on individual piggeries may mask clinical signs and on some piggeries the disease may go unnoticed, or may only be suspected. Whether or not obvious disease occurs, B. hyodysenteriae may persist in infected pigs, or in other reservoir hosts such as rodents, or in the environment. All these sources pose potential for transmission of the disease to uninfected herds. Commercial poultry may also be colonized by B. hyodysenteriae, although it is not clear how commonly this occurs under field conditions.

[0003]Colonisation by B. hyodysenteriae elicits a strong immunological response against the spirochaete, hence indirect evidence of exposure to the spirochaete can be obtained by measuring circulating antibody titres in the blood of infected animals. These antibody titres have been reported to be maintained at low levels, even in animals that have recovered from swine dysentery. Serological tests for detection of antibodies therefore have considerable potential for detecting subclinical infections and recovered carrier pigs that have undetectable numbers of spirochaetes in their large intestines. These tests would be particularly valuable in an easy to use kit form, such as an enzyme-linked immunosorbent assay. A variety of techniques have been developed to demonstrate the presence of circulating antibodies against B. hyodysenteriae, including indirect fluorescent antibody tests, haemagglutination tests, microtitration agglutination tests, complement fixation tests, and ELISA using either lipopolysaccharide or whole sonicated spirochaetes as antigen. All these tests have suffered from problems of specificity, as related non-pathogenic intestinal spirochaetes can induce cross-reactive antibodies. These tests are useful for detecting herds where there is obvious disease and high circulating antibody titres, but they are problematic for identifying sub-clinically infected herds and individual infected pigs. Consequently, to date, no completely sensitive and specific assays are available for the detection of antibodies against B. hyodysenteriae. The lack of suitable diagnostic tests has hampered control of swine dysentery.

[0004]A number of methods are employed to control swine dysentery, varying from the prophylactic use of antimicrobial agents, to complete destocking of infected herds and prevention of re-entry of infected carrier pigs. All these options are expensive and, if they are to be fully effective, they require the use of sophisticated diagnostic tests to monitor progress. Currently, detection of swine dysentery in herds with sub-clinical infections, and individual healthy carrier animals, remains a major problem and is hampering implementation of effective control measures. A definitive diagnosis of swine dysentery traditionally has required the isolation and identification of B. hyodysenteriae from the faeces or mucosa of diseased pigs. Major problems involved include the slow growth and fastidious nutritional requirements of these anaerobic bacteria and confusion due to the presence of morphologically similar spirochaetes in the normal flora of the pig intestine. A significant improvement in the diagnosis of individual affected pigs was achieved with the development of polymerase chain reaction (PCR) assays for the detection of spirochaetes from faeces. Unfortunately in practical applications the limit of detection of PCRs rendered it unable to detect carrier animals with subclinical infections. As a consequence of these diagnostic problems, there is a clear need to develop a simple and effective diagnostic tool capable of detecting B. hyodysenteriae infection at the herd and individual pig level.

[0005]A strong immunological response is induced against the spirochaete following colonization with B. hyodysenteriae, and pigs recovered from swine dysentery are protected from re-infection. Despite this, attempts to develop vaccines to control swine dysentery have met with very limited success, either because they have provided inadequate protection on a herd basis, or they have been too costly and difficult to produce to make them commercially viable. Bacterin vaccines provide some level of protection, but they tend to be lipopolysaccharide serogroup-specific, which then requires the use of multivalent bacterins. Furthermore they are difficult and costly to produce on a large scale because of the fastidious anaerobic growth requirements of the spirochaete.

[0006]Several attempts have been made to develop attenuated live vaccines for swine dysentery. This approach has the disadvantage that attenuated strains show reduced colonisation, and hence cause reduced immune stimulation. There also is reluctance on the part of producers and veterinarians to use live vaccines for swine dysentery because of the possibility of reversion to virulence, especially as very little is known about genetic regulation and organization in B. hyodysenteriae.

[0007]The use of recombinant subunit vaccines is an attractive alternative, since the products would be well-defined (essential for registration purposes), and relatively easy to produce on a large scale. To date the first reported use of a recombinant protein from B. hyodysenteriae as a vaccine candidate (a 38-kilodalton flagellar protein) failed to prevent colonisation in pigs. This failure is likely to relate specifically to the particular recombinant protein used, as well as to other more down-stream issues of delivery systems and routes, dose rates, choice of adjuvants etc. (Gabe, J D, Chang, R J, Slomiany, R, Andrews, W H and McCaman, M T (1995) Isolation of extracytoplasmic proteins from Serpulina hyodysenteriae B204 and molecular cloning of the flaB1 gene encoding a 38-kilodalton flagellar protein.

[0008]Infection and Immunity 63:142-148). The first reported partially protective recombinant B. hyodysenteriae protein used for vaccination was a 29.7 kDa outer membrane lipoprotein (Bhlp29.7, also referred to as BmpB and BlpA) which had homology with the methionine-binding lipoproteins of various pathogenic bacteria. The use of the his-tagged recombinant Bhlp29.7 protein for vaccination of pigs, followed by experimental challenge with B. hyodysenteriae, resulted in 17-40% of vaccinated pigs developing disease compared to 50-70% of the unvaccinated control pigs developing disease. Since the incidence of disease for the Bhlp29.7 vaccinated pigs was significantly (P=0.047) less than for the control pigs, Bhlp29.7 appeared to have potential as a swine dysentery vaccine component (La, T, Phillips, N D, Reichel, M P and Hampson, D J (2004). Protection of pigs from swine dysentery by vaccination with recombinant BmpB, a 29.7 kDa outer-membrane lipoprotein of Brachyspira hyodysenteriae. Veterinary Microbiology 102:97-109). A number of other attempts have been made to identify outer envelop proteins from B. hyodysenteriae that could be used as recombinant vaccine components, but again no successful vaccine has yet been made. A much more global approach is needed to the identification of potentially useful immunogenic recombinant proteins from B. hyodysenteriae is needed.

[0009]To date, only one study using DNA for vaccination has been reported. In this study, the B. hyodysenteriae ftnA gene, encoding a putative ferritin, was cloned into an E. coli plasmid and the plasmid DNA used to coat gold beads for ballistic vaccination. A murine model for swine dysentery was used to determine the protective nature of vaccination with DNA and/or recombinant protein. Vaccination with recombinant protein induced a good systemic response against ferritin however vaccination with DNA induced only a detectable systemic response. Vaccination with DNA followed a boost with recombinant protein induced a systemic immune response to ferritin only after boosting with protein. However, none of the vaccination regimes tested was able to provide the mice with protection against B. hyodysenteriae colonisation and the associated lesions. Interestingly, vaccination of the mice with DNA alone resulted in significant exacerbation of disease (Davis, A. J., Smith, S. C. and Moore, R. J. (2005). The Brachyspira hyodysenteriae ftnA gene: DNA vaccination and real-time PCR quantification of bacteria in a mouse model of disease. Current Microbiology 50: 285-291).

BRIEF SUMMARY OF INVENTION

[0010]It is an object of this invention to have novel genes from B. hyodysenteriae and the proteins encoded by those genes. It is a further object of this invention that the novel genes and the proteins encoded by those genes can be used for therapeutic and diagnostic purposes. One can use the genes and/or the proteins in a vaccine against B. hyodysenteriae and to diagnose B. hyodysenteriae infections.

[0011]It is an object of this invention to have novel B. hyodysenteriae genes having the nucleotide sequence contained in SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, and 65. It is also an object of this invention to have nucleotide sequences that are identical to SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, and 65 where the percentage identity can be at least 95%, 90%, 85%, 80%, 75% and 70% (and every integer from 100 to 70). This invention also includes a DNA vaccine or DNA immunogenic composition containing the nucleotide sequence of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, and 65 and sequences that are at least 95%, 90%, 85%, 80%, 75% and 70% identical (and every integer from 100 to 70) to these sequences. This invention further includes a diagnostic assay containing DNA having the nucleotide sequence of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, and 65 and sequences that are at least 95%, 90%, 85%, 80%, 75% and 70% identical (and every integer from 100 to 70) to these sequences.

[0012]It is also an object of this invention to have plasmids containing DNA having the sequence of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, and 65; prokaryotic and/or eukaryotic expression vectors containing DNA having the sequence of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, and 65; and a cell containing the plasmids which contain DNA having the sequence of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, and 65.

[0013]It is an object of this invention to have novel B. hyodysenteriae proteins having the amino acid sequence contained in SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, and 66. It is another object of this invention to have proteins that are at least 95%, 90%, 85%, 80%, 75% and 70% homologous (and every integer from 100 to 70) to the sequences contained in SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, and 66. It is also an object of this invention for a vaccine or immunogenic composition to contain the proteins having the amino acid sequence contained in SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, and 66, or amino acid sequences that are at least 95%, 90%, 85%, 80%, 75% and 70% homologous (and every integer from 100 to 70) to the sequences contained in SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, and 66. It is a further aspect of this invention to have a diagnostic kit containing one or more proteins having a sequence contained in SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, and 66 or that are at least 95%, 90%, 85%, 80%, 75% and 70% homologous to the sequences contained in SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, and 66.

[0014]It is another aspect of this invention to have nucleotide sequences which encode the proteins having the amino acid sequence contained in SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, and 66, and encode the amino acid sequences that are at least 95%, 90%, 85%, 80%, 75% and 70% homologous (and every integer from 100 to 70) to the sequences contained in SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, and 66. The invention also covers plasmids, eukaryotic and prokaryotic expression vectors, and DNA vaccines which contain DNA having a sequence which encodes a protein having the amino acid sequence contained in SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, and 66, and encode amino acid sequences that are at least 95%, 90%, 85%, 80%, 75% and 70% homologous (and every integer from 100 to 70) to the sequences contained in SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, and 66. Cells which contain these plasmids and expression vectors are included in this invention.

[0015]This invention includes monoclonal antibodies that bind to proteins having an amino acid sequence contained in SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, and 66 or bind to proteins that are at least 95%, 90%, 85%, 80%, 75% and 70% homologous (and every integer from 100 to 70) to the sequences contained in SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, and 66. Diagnostic kits containing the monoclonal antibodies that bind to proteins having an amino acid sequence contained in SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, and 66 or bind to proteins that are at least 95%, 90%, 85%, 80%, 75% and 70% homologous (and every integer from 100 to 70) to the sequences contained in SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, and 66 are included in this invention. These diagnostic kits can detect the presence of B. hyodysenteriae in an animal. The animal is preferably any mammal and bird; more preferably, chicken, goose, duck, turkey, parakeet, dog, cat, hamster, gerbil, rabbit, ferret, horse, cow, sheep, pig, monkey, and human.

[0016]The invention also contemplates the method of preventing or treating an infection of B. hyodysenteriae in an animal by administering to an animal a DNA vaccine containing one or more nucleotide sequences listed in SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, and 65 or sequences that are at least 95%, 90%, 85%, 80%, 75% and 70% identical (and every integer from 100 to 70) to these sequences. This invention also covers a method of preventing or treating an infection of B. hyodysenteriae in an animal by administering to an animal a vaccine containing one or more proteins having the amino acid sequence containing in SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, and 66 or sequences that are at least 95%, 90%, 85%, 80%, 75% and 70% homologous (and every integer from 100 to 70) to these sequences. The animal is preferably any mammal and bird; more preferably, chicken, goose, duck, turkey, parakeet, dog, cat, hamster, gerbil, rabbit, ferret, horse, cow, sheep, pig, monkey, and human.

[0017]The invention also contemplates the method of generating an immune response in an animal by administering to an animal an immunogenic composition containing one or more nucleotide sequences listed in SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, and 65 or sequences that are at least 95%, 90%, 85%, 80%, 75% and 70% identical (and every integer from 100 to 70) to these sequences. This invention also covers a method of generating an immune response in an animal by administering to an animal an immunogenic composition containing one or more proteins having the amino acid sequence containing in SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, and 66 or sequences that are at least 95%, 90%, 85%, 80%, 75% and 70% homologous (and every integer from 100 to 70) to these sequences. The animal is preferably any mammal and bird; more preferably, chicken, goose, duck, turkey, parakeet, dog, cat, hamster, gerbil, rabbit, ferret, horse, cow, sheep, pig, monkey, and human.

DETAILED SUMMARY OF INVENTION

[0018]The articles "a" and "an" are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element.

[0019]The term "amino acid" is intended to embrace all molecules, whether natural or synthetic, which include both an amino functionality and an acid functionality and capable of being included in a polymer of naturally-occurring amino acids. Exemplary amino acids include naturally-occurring amino acids; analogs, derivatives and congeners thereof; amino acid analogs having variant side chains; and all stereoisomers of any of any of the foregoing.

[0020]An animal can be any mammal or bird. Examples of mammals include dog, cat, hamster, gerbil, rabbit, ferret, horse, cow, sheep, pig, monkey, and human. Examples of birds include chicken, goose, duck, turkey, and parakeet.

[0021]The term "conserved residue" refers to an amino acid that is a member of a group of amino acids having certain common properties. The term "conservative amino acid substitution" refers to the substitution (conceptually or otherwise) of an amino acid from one such group with a different amino acid from the same group. A functional way to define common properties between individual amino acids is to analyze the normalized frequencies of amino acid changes between corresponding proteins of homologous organisms (Schulz, G. E. and R. H. Schinner., Principles of Protein Structure, Springer-Verlag). According to such analyses, groups of amino acids may be defined where amino acids within a group exchange preferentially with each other, and therefore resemble each other most in their impact on the overall protein structure (Schulz, G. E. and R. H. Schirmer, Principles of Protein Structure, Springer-Verlag). Examples of amino acid groups defined in this manner include: (i) a positively-charged group containing Lys, Arg and His, (ii) a negatively-charged group containing Glu and Asp, (iii) an aromatic group containing Phe, Tyr and Trp, (iv) a nitrogen ring group containing His and Trp, (v) a large aliphatic nonpolar group containing Val, Leu and De, (vi) a slightly-polar group containing Met and Cys, (vii) a small-residue group containing Ser, Thr, Asp, Asn, Gly, Ala, Glu, Gln and Pro, (viii) an aliphatic group containing Val, Leu, De, Met and Cys, and (ix) a small, hydroxyl group containing Ser and Thr.

[0022]A "fusion protein" or "fusion polypeptide" refers to a chimeric protein as that term is known in the art and may be constructed using methods known in the art. In many examples of fusion proteins, there are two different polypeptide sequences, and in certain cases, there may be more. The polynucleotide sequences encoding the fusion protein may be operably linked in frame so that the fusion protein may be translated correctly. A fusion protein may include polypeptide sequences from the same species or from different species. In various embodiments, the fusion polypeptide may contain one or more amino acid sequences linked to a first polypeptide. In the case where more than one amino acid sequence is fused to a first polypeptide, the fusion sequences may be multiple copies of the same sequence, or alternatively, may be different amino acid sequences. The fusion polypeptides may be fused to the N-terminus, the C-terminus, or the N- and C-terminus of the first polypeptide. Exemplary fusion proteins include polypeptides containing a glutathione S-transferase tag (GST-tag), histidine tag (His-tag), an immunoglobulin domain or an immunoglobulin binding domain.

[0023]The term "isolated polypeptide" refers to a polypeptide, in certain embodiments prepared from recombinant DNA or RNA, or of synthetic origin or natural origin, or some combination thereof, which (1) is not associated with proteins that it is normally found with in nature, (2) is separated from the cell in which it normally occurs, (3) is free of other proteins from the same cellular source, (4) is expressed by a cell from a different species, or (5) does not occur in nature. It is possible for an isolated polypeptide exist but not qualify as a purified polypeptide.

[0024]The term "isolated nucleic acid" and "isolated polynucleotide" refers to a polynucleotide whether genomic DNA, cDNA, mRNA, tRNA, rRNA, iRNA, or a polynucleotide obtained from a cellular organelle (such as mitochondria and chloroplast), or whether from synthetic origin, which (1) is not associated with the cell in which the "isolated nucleic acid" is found in nature, or (2) is operably linked to a polynucleotide to which it is not linked in nature. It is possible for an isolated polynucleotide exist but not qualify as a purified polynucleotide.

[0025]The term "nucleic acid" and "polynucleotide" refers to a polymeric form of nucleotides, either ribonucleotides or deoxyribonucleotides or a modified form of either type of nucleotide. The terms should also be understood to include, as equivalents, analogs of either RNA or DNA made from nucleotide analogs, and, as applicable to the embodiment being described, single-stranded (such as sense or antisense) and double-stranded polynucleotides.

[0026]The term "nucleic acid of the invention" and "polynucleotide of the invention" refers to a nucleic acid encoding a polypeptide of the invention. A polynucleotide of the invention may comprise all, or a portion of, a subject nucleic acid sequence; a nucleotide sequence at least 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98% or 99% identical to a subject nucleic acid sequence (and every integer between 60 and 100); a nucleotide sequence that hybridizes under stringent conditions to a subject nucleic acid sequence; nucleotide sequences encoding polypeptides that are functionally equivalent to polypeptides of the invention; nucleotide sequences encoding polypeptides at least about 60%, 70%, 80%, 85%, 90%, 95%, 98%, 99% homologous or identical with a subject amino acid sequence (and every integer between 60 and 100); nucleotide sequences encoding polypeptides having an activity of a polypeptide of the invention and having at least about 60%, 70%, 80%, 85%, 90%, 95%, 98%, 99% or more homology or identity with a subject amino acid sequence (and every integer between 60 and 100); nucleotide sequences that differ by 1 to about 2, 3, 5, 7, 10, 15, 20, 30, 50, 75 or more nucleotide substitutions, additions or deletions, such as allelic variants, of a subject nucleic acid sequence; nucleic acids derived from and evolutionarily related to a subject nucleic acid sequence; and complements of, and nucleotide sequences resulting from the degeneracy of the genetic code, for all of the foregoing and other nucleic acids of the invention. Nucleic acids of the invention also include homologs, e.g., orthologs and paralogs, of a subject nucleic acid sequence and also variants of a subject nucleic acid sequence which have been codon optimized for expression in a particular organism (e.g., host cell).

[0027]The term "operably linked", when describing the relationship between two nucleic acid regions, refers to a juxtaposition wherein the regions are in a relationship permitting them to function in their intended manner. For example, a control sequence "operably linked" to a coding sequence is ligated in such a way that expression of the coding sequence is achieved under conditions compatible with the control sequences, such as when the appropriate molecules (e.g., inducers and polymerases) are bound to the control or regulatory sequence(s).

[0028]The term "polypeptide", and the terms "protein" and "peptide" which are used interchangeably herein, refers to a polymer of amino acids. Exemplary polypeptides include gene products, naturally-occurring proteins, homologs, orthologs, paralogs, fragments, and other equivalents, variants and analogs of the foregoing.

[0029]The terms "polypeptide fragment" or "fragment", when used in reference to a reference polypeptide, refers to a polypeptide in which amino acid residues are deleted as compared to the reference polypeptide itself, but where the remaining amino acid sequence is usually identical to the corresponding positions in the reference polypeptide. Such deletions may occur at the amino-terminus or carboxy-terminus of the reference polypeptide, or alternatively both. Fragments typically are at least 5, 6, 8 or 10 amino acids long, at least 14 amino acids long, at least 20, 30, 40 or 50 amino acids long, at least 75 amino acids long, or at least 100, 150, 200, 300, 500 or more amino acids long. A fragment can retain one or more of the biological activities of the reference polypeptide. In certain embodiments, a fragment may comprise a domain having the desired biological activity, and optionally additional amino acids on one or both sides of the domain, which additional amino acids may number from 5, 10, 15, 20, 30, 40, 50, or up to 100 or more residues. Further, fragments can include a sub-fragment of a specific region, which sub-fragment retains a function of the region from which it is derived. In another embodiment, a fragment may have immunogenic properties.

[0030]The term "polypeptide of the invention" refers to a polypeptide containing a subject amino acid sequence, or an equivalent or fragment thereof. Polypeptides of the invention include polypeptides containing all or a portion of a subject amino acid sequence; a subject amino acid sequence with 1 to about 2, 3, 5, 7, 10, 15, 20, 30, 50, 75 or more conservative amino acid substitutions; an amino acid sequence that is at least 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, or 99% homologous to a subject amino acid sequence (and every integer between 60 and 100); and functional fragments thereof. Polypeptides of the invention also include homologs, e.g., orthologs and paralogs, of a subject amino acid sequence.

[0031]It is also possible to modify the structure of the polypeptides of the invention for such purposes as enhancing therapeutic or prophylactic efficacy, or stability (e.g., ex vivo shelf life, resistance to proteolytic degradation in vivo, etc.). Such modified polypeptides, when designed to retain at least one activity of the naturally-occurring form of the protein, are considered "functional equivalents" of the polypeptides described in more detail herein. Such modified polypeptides may be produced, for instance, by amino acid substitution, deletion, or addition, which substitutions may consist in whole or part by conservative amino acid substitutions.

[0032]For instance, it is reasonable to expect that an isolated conservative amino acid substitution, such as replacement of a leucine with an isoleucine or valine, an aspartate with a glutamate, a threonine with a serine, will not have a major affect on the biological activity of the resulting molecule. Whether a change in the amino acid sequence of a polypeptide results in a functional homolog may be readily determined by assessing the ability of the variant polypeptide to produce a response similar to that of the wild-type protein. Polypeptides in which more than one replacement has taken place may readily be tested in the same manner.

[0033]The term "purified" refers to an object species that is the predominant species present (i.e., on a molar basis it is more abundant than any other individual species in the composition). A "purified fraction" is a composition wherein the object species is at least about 50 percent (on a molar basis) of all species present. In making the determination of the purity or a species in solution or dispersion, the solvent or matrix in which the species is dissolved or dispersed is usually not included in such determination; instead, only the species (including the one of interest) dissolved or dispersed are taken into account. Generally, a purified composition will have one species that is more than about 80% of all species present in the composition, more than about 85%, 90%, 95%, 99% or more of all species present. The object species may be purified to essential homogeneity (contaminant species cannot be detected in the composition by conventional detection methods) wherein the composition is essentially a single species. A skilled artisan may purify a polypeptide of the invention using standard techniques for protein purification in light of the teachings herein. Purity of a polypeptide may be determined by a number of methods known to those of skill in the art, including for example, amino-terminal amino acid sequence analysis, gel electrophoresis, mass-spectrometry analysis and the methods described herein.

[0034]The terms "recombinant protein" or "recombinant polypeptide" refer to a polypeptide which is produced by recombinant DNA techniques. An example of such techniques includes the case when DNA encoding the expressed protein is inserted into a suitable expression vector which is in turn used to transform a host cell to produce the protein or polypeptide encoded by the DNA.

[0035]The term "regulatory sequence" is a generic term used throughout the specification to refer to polynucleotide sequences, such as initiation signals, enhancers, regulators and promoters, that are necessary or desirable to affect the expression of coding and non-coding sequences to which they are operably linked. Exemplary regulatory sequences are described in Goeddel; Gene Expression Technology: Methods in Enzymology, Academic Press, San Diego, Calif. (1990), and include, for example, the early and late promoters of SV40, adenovirus or cytomegalovirus immediate early promoter, the lac system, the trp system, the TAC or TRC system, T7 promoter whose expression is directed by T7 RNA polymerase, the major operator and promoter regions of phage lambda, the control regions for fd coat protein, the promoter for 3-phosphoglycerate kinase or other glycolytic enzymes, the promoters of acid phosphatase (e.g., Pho5), the promoters of the yeast α-mating factors, the polyhedron promoter of the baculovirus system and other sequences known to control the expression of genes of prokaryotic or eukaryotic cells or their viruses, and various combinations thereof. The nature and use of such control sequences may differ depending upon the host organism. In prokaryotes, such regulatory sequences generally include promoter, ribosomal binding site, and transcription termination sequences. The term "regulatory sequence" is intended to include, at a minimum, components whose presence may influence expression, and may also include additional components whose presence is advantageous, for example, leader sequences and fusion partner sequences. In certain embodiments, transcription of a polynucleotide sequence is under the control of a promoter sequence (or other regulatory sequence) which controls the expression of the polynucleotide in a cell-type in which expression is intended. It will also be understood that the polynucleotide can be under the control of regulatory sequences which are the same or different from those sequences which control expression of the naturally-occurring form of the polynucleotide.

[0036]The term "sequence homology" refers to the proportion of base matches between two nucleic acid sequences or the proportion of amino acid matches between two amino acid sequences. When sequence homology is expressed as a percentage, e.g., 50%, the percentage denotes the proportion of matches over the length of sequence from a desired sequence that is compared to some other sequence. Gaps (in either of the two sequences) are permitted to maximize matching; gap lengths of 15 bases or less are usually used, 6 bases or less are used more frequently, with 2 bases or less used even more frequently. The term "sequence identity" means that sequences are identical (i.e., on a nucleotide-by-nucleotide basis for nucleic acids or amino acid-by-amino acid basis for polypeptides) over a window of comparison. The term "percentage of sequence identity" is calculated by comparing two optimally aligned sequences over the comparison window, determining the number of positions at which the identical amino acids or nucleotides occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the comparison window, and multiplying the result by 100 to yield the percentage of sequence identity. Methods to calculate sequence identity are known to those of skill in the art and described in further detail below.

[0037]The term "soluble" as used herein with reference to a polypeptide of the invention or other protein, means that upon expression in cell culture, at least some portion of the polypeptide or protein expressed remains in the cytoplasmic fraction of the cell and does not fractionate with the cellular debris upon lysis and centrifugation of the lysate. Solubility of a polypeptide may be increased by a variety of art recognized methods, including fusion to a heterologous amino acid sequence, deletion of amino acid residues, amino acid substitution (e.g., enriching the sequence with amino acid residues having hydrophilic side chains), and chemical modification (e.g., addition of hydrophilic groups).

[0038]The solubility of polypeptides may be measured using a variety of art recognized techniques, including, dynamic light scattering to determine aggregation state, UV absorption, centrifugation to separate aggregated from non-aggregated material, and SDS gel electrophoresis (e.g., the amount of protein in the soluble fraction is compared to the amount of protein in the soluble and insoluble fractions combined). When expressed in a host cell, the polypeptides of the invention may be at least about 1%, 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more soluble, e.g., at least about 1%, 2%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or more of the total amount of protein expressed in the cell is found in the cytoplasmic fraction. In certain embodiments, a one liter culture of cells expressing a polypeptide of the invention will produce at least about 0.1, 0.2, 0.5, 1, 2, 5, 10, 20, 30, 40, 50 milligrams of more of soluble protein. In an exemplary embodiment, a polypeptide of the invention is at least about 10% soluble and will produce at least about 1 milligram of protein from a one liter cell culture.

[0039]The term "specifically hybridizes" refers to detectable and specific nucleic acid binding. Polynucleotides, oligonucleotides and nucleic acids of the invention selectively hybridize to nucleic acid strands under hybridization and wash conditions that minimize appreciable amounts of detectable binding to nonspecific nucleic acids. Stringent conditions may be used to achieve selective hybridization conditions as known in the art and discussed herein. Generally, the nucleic acid sequence identity between the polynucleotides, oligonucleotides, and nucleic acids of the invention and a nucleic acid sequence of interest will be at least 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 98%, 99%, or more (and every integer between 30 and 100). In certain instances, hybridization and washing conditions are performed under stringent conditions according to conventional hybridization procedures and as described further herein.

[0040]The terms "stringent conditions" or "stringent hybridization conditions" refer to conditions which promote specific hybridization between two complementary polynucleotide strands so as to form a duplex. Stringent conditions may be selected to be about 5° C. lower than the thermal melting point (Tm) for a given polynucleotide duplex at a defined ionic strength and pH. The length of the complementary polynucleotide strands and their GC content will determine the Tm of the duplex, and thus the hybridization conditions necessary for obtaining a desired specificity of hybridization. The Tm is the temperature (under defined ionic strength and pH) at which 50% of a polynucleotide sequence hybridizes to a perfectly matched complementary strand. In certain cases it may be desirable to increase the stringency of the hybridization conditions to be about equal to the Tm for a particular duplex.

[0041]A variety of techniques for estimating the Tm are available. Typically, G-C base pairs in a duplex are estimated to contribute about 3° C. to the Tm, while A-T base pairs are estimated to contribute about 2° C., up to a theoretical maximum of about 80-100° C.

[0042]However, more sophisticated models of Tm are available in which G-C stacking interactions, solvent effects, the desired assay temperature and the like are taken into account. For example, probes can be designed to have a dissociation temperature (Td) of approximately 60° C., using the formula: Td=(((3×#GC)+(2×#AT))×37)-562)/#bp)-5; where #GC, #AT, and #bp are the number of guanine-cytosine base pairs, the number of adenine-thymine base pairs, and the number of total base pairs, respectively, involved in the formation of the duplex.

[0043]Hybridization may be carried out in 5×SSC, 4×SSC, 3×SSC, 2×SSC, 1×SSC or 0.2×SSC for at least about 1 hour, 2 hours, 5 hours, 12 hours, or 24 hours. The temperature of the hybridization may be increased to adjust the stringency of the reaction, for example, from about 25° C. (room temperature), to about 45° C., 50° C., 55° C., 60° C., or 65° C. The hybridization reaction may also include another agent affecting the stringency, for example, hybridization conducted in the presence of 50% formamide increases the stringency of hybridization at a defined temperature.

[0044]The hybridization reaction may be followed by a single wash step, or two or more wash steps, which may be at the same or a different salinity and temperature. For example, the temperature of the wash may be increased to adjust the stringency from about 25° C. (room temperature), to about 45° C., 50° C., 55° C., 60° C., 65° C., or higher. The wash step may be conducted in the presence of a detergent, e.g., 0.1 or 0.2% SDS. For example, hybridization may be followed by two wash steps at 65° C. each for about 20 minutes in 2×SSC, 0.1% SDS, and optionally two additional wash steps at 65° C. each for about 20 minutes in 0.2×SSC, 0.1% SDS.

[0045]Exemplary stringent hybridization conditions include overnight hybridization at 65° C. in a solution containing 50% formamide, 10×Denhardt (0.2% Ficoll, 0.2% polyvinylpyrrolidone, 0.2% bovine serum albumin) and 200 μg/ml of denatured carrier DNA, e.g., sheared salmon sperm DNA, followed by two wash steps at 65° C. each for about 20 minutes in 2×SSC, 0.1% SDS, and two wash steps at 65° C. each for about 20 minutes in 0.2×SSC, 0.1% SDS.

[0046]Hybridization may consist of hybridizing two nucleic acids in solution, or a nucleic acid in solution to a nucleic acid attached to a solid support, e.g., a filter. When one nucleic acid is on a solid support, a prehybridization step may be conducted prior to hybridization. Prehybridization may be carried out for at least about 1 hour, 3 hours or 10 hours in the same solution and at the same temperature as the hybridization solution (without the complementary polynucleotide strand).

[0047]Appropriate stringency conditions are known to those skilled in the art or may be determined experimentally by the skilled artisan. See, for example, Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1-12.3.6; Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual, Cold Spring Harbor Press, N.Y.; S. Agrawal (ed.) Methods in Molecular Biology, volume 20; Tijssen (1993) Laboratory Techniques in Biochemistry and Molecular Biology--Hybridization With Nucleic Acid Probes, e.g., part I chapter 2 "Overview of principles of hybridization and the strategy of nucleic acid probe assays", Elsevier, N.Y.; and Tibanyenda, N. et al., Eur. J. Biochem. 139:19 (1984) and Ebel, S. et al., Biochem. 31:12083 (1992).

[0048]The term "vector" refers to a nucleic acid capable of transporting another nucleic acid to which it has been linked. One type of vector which may be used in accord with the invention is an episome, i.e., a nucleic acid capable of extra-chromosomal replication. Other vectors include those capable of autonomous replication and expression of nucleic acids to which they are linked. Vectors capable of directing the expression of genes to which they are operatively linked are referred to herein as "expression vectors". In general, expression vectors of utility in recombinant DNA techniques are often in the form of "plasmids" which refer to circular double stranded DNA molecules which, in their vector form are not bound to the chromosome. In the present specification, "plasmid" and "vector" are used interchangeably as the plasmid is the most commonly used form of vector. However, the invention is intended to include such other forms of expression vectors which serve equivalent functions and which become known in the art subsequently hereto.

[0049]The nucleic acids of the invention may be used as diagnostic reagents to detect the presence or absence of the target DNA or RNA sequences to which they specifically bind, such as for determining the level of expression of a nucleic acid of the invention. In one aspect, the present invention contemplates a method for detecting the presence of a nucleic acid of the invention or a portion thereof in a sample, the method of the steps of: (a) providing an oligonucleotide at least eight nucleotides in length, the oligonucleotide being complementary to a portion of a nucleic acid of the invention; (b) contacting the oligonucleotide with a sample containing at least one nucleic acid under conditions that permit hybridization of the oligonucleotide with a nucleic acid of the invention or a portion thereof; and (c) detecting hybridization of the oligonucleotide to a nucleic acid in the sample, thereby detecting the presence of a nucleic acid of the invention or a portion thereof in the sample. In another aspect, the present invention contemplates a method for detecting the presence of a nucleic acid of the invention or a portion thereof in a sample, by (a) providing a pair of single stranded oligonucleotides, each of which is at least eight nucleotides in length, complementary to sequences of a nucleic acid of the invention, and wherein the sequences to which the oligonucleotides are complementary are at least ten nucleotides apart; and (b) contacting the oligonucleotides with a sample containing at least one nucleic acid under hybridization conditions; (c) amplifying the nucleotide sequence between the two oligonucleotide primers; and (d) detecting the presence of the amplified sequence, thereby detecting the presence of a nucleic acid of the invention or a portion thereof in the sample.

[0050]In another aspect of the invention, the polynucleotide of the invention is provided in an expression vector containing a nucleotide sequence encoding a polypeptide of the invention and operably linked to at least one regulatory sequence. It should be understood that the design of the expression vector may depend on such factors as the choice of the host cell to be transformed and/or the type of protein desired to be expressed. The vector's copy number, the ability to control that copy number and the expression of any other protein encoded by the vector, such as antibiotic markers, should be considered.

[0051]An expression vector containing the polynucleotide of the invention can then be used as a pharmaceutical agent to treat an animal infected with B. hyodysenteriae or as a vaccine (also a pharmaceutical agent) to prevent an animal from being infected with B. hyodysenteriae, or to reduce the symptoms and course of the disease if the animal does become infected. One manner of using an expression vector as a pharmaceutical agent is to administer a nucleic acid vaccine to the animal at risk of being infected or to the animal after being infected. Nucleic acid vaccine technology is well-described in the art. Some descriptions can be found in U.S. Pat. No. 6,562,376 (Hooper et al.); U.S. Pat. No. 5,589,466 (Felgner, et al.); U.S. Pat. No. 6,673,776 (Felgner, et al.); and U.S. Pat. No. 6,710,035 (Felgner, et al.). Nucleic acid vaccines can be injected into muscle or intradermally, can be electroporated into the animal (see WO 01/23537, King et al.; and WO 01/68889, Malone et al.), via lipid compositions (see U.S. Pat. No. 5,703,055, Felgner, et al), or other mechanisms known in the art field.

[0052]Expression vectors can also be transfected into bacteria which can be administered to the target animal to induce an immune response to the protein encoded by the nucleotides of this invention contained on the expression vector. The expression vector can contain eukaryotic expression sequences such that the nucleotides of this invention are transcribed and translated in the host animal. Alternatively, the expression vector can be transcribed in the bacteria and then translated in the host animal. The bacteria used as a carrier of the expression vector should be attenuated but still invasive. One can use Shigella spp., Salmonella spp., Escherichia spp., and Aeromonas spp., just to name a few, that have been attenuated but still invasive. Examples of these methods can be found in U.S. Pat. No. 5,824,538 (Branstrom et al); U.S. Pat. No. 5,877,159 (Powell, et al.); U.S. Pat. No. 6,150,170 (Powell, et al.); U.S. Pat. No. 6,500,419 (Hone, et al.); and U.S. Pat. No. 6,682,729 (Powell, et al.).

[0053]Alternatively, the polynucleotides of this invention can be placed in certain viruses which act a vector. Viral vectors can either express the proteins of this invention on the surface of the virus, or carry polynucleotides of this invention into an animal cell where the polynucleotide is transcribed and translated into a protein. The animal infected with the viral vectors can develop an immune response to the proteins encoded by the polynucleotides of this invention. Thereby one can alleviate or prevent an infection by B. hyodysenteriae in the animal which received the viral vectors. Examples of viral vectors can be found U.S. Pat. No. 5,283,191 (Morgan et al.); U.S. Pat. No. 5,554,525 (Sondermeijer et al) and U.S. Pat. No. 5,712,118 (Murphy).

[0054]The polynucleotide of the invention may be used to cause expression and over-expression of a polypeptide of the invention in cells propagated in culture, e.g. to produce proteins or polypeptides, including fusion proteins or polypeptides.

[0055]This invention pertains to a host cell transfected with a recombinant gene in order to express a polypeptide of the invention. The host cell may be any prokaryotic or eukaryotic cell. For example, a polypeptide of the invention may be expressed in bacterial cells, such as E. coli, insect cells (baculovirus), yeast, plant, or mammalian cells. In those instances when the host cell is human, it may or may not be in a live subject. Other suitable host cells are known to those skilled in the art. Additionally, the host cell may be supplemented with tRNA molecules not typically found in the host so as to optimize expression of the polypeptide. Alternatively, the nucleotide sequence may be altered to optimize expression in the host cell, yet the protein produced would have high homology to the originally encoded protein. Other methods suitable for maximizing expression of the polypeptide will be known to those in the art.

[0056]The present invention further pertains to methods of producing the polypeptides of the invention. For example, a host cell transfected with an expression vector encoding a polypeptide of the invention may be cultured under appropriate conditions to allow expression of the polypeptide to occur. The polypeptide may be secreted and isolated from a mixture of cells and medium containing the polypeptide. Alternatively, the polypeptide may be retained cytoplasmically and the cells harvested, lysed and the protein isolated.

[0057]A cell culture includes host cells, media and other byproducts. Suitable media for cell culture are well known in the art. The polypeptide may be isolated from cell culture medium, host cells, or both using techniques known in the art for purifying proteins, including ion-exchange chromatography, gel filtration chromatography, ultrafiltration, electrophoresis, and immunoaffinity purification with antibodies specific for particular epitopes of a polypeptide of the invention.

[0058]Thus, a nucleotide sequence encoding all or a selected portion of polypeptide of the invention, may be used to produce a recombinant form of the protein via microbial or eukaryotic cellular processes. Ligating the sequence into a polynucleotide construct, such as an expression vector, and transforming or transfecting into hosts, either eukaryotic (yeast, avian, insect or mammalian) or prokaryotic (bacterial cells), are standard procedures. Similar procedures, or modifications thereof, may be employed to prepare recombinant polypeptides of the invention by microbial means or tissue-culture technology.

[0059]Suitable vectors for the expression of a polypeptide of the invention include plasmids of the types: pTrcHis-derived plasmids, pET-derived plasmids, pBR322-derived plasmids, pEMBL-derived plasmids, pEX-derived plasmids, pBTac-derived plasmids and pUC-derived plasmids for expression in prokaryotic cells, such as E. coli. The various methods employed in the preparation of the plasmids and transformation of host organisms are well known in the art. For other suitable expression systems for both prokaryotic and eukaryotic cells, as well as general recombinant procedures, see Molecular Cloning, A Laboratory Manual, 2nd Ed., ed. by Sambrook, Fritsch and Maniatis (Cold Spring Harbor Laboratory Press, 1989) Chapters 16 and 17.

[0060]Coding sequences for a polypeptide of interest may be incorporated as a part of a fusion gene including a nucleotide sequence encoding a different polypeptide. The present invention contemplates an isolated polynucleotide containing a nucleic acid of the invention and at least one heterologous sequence encoding a heterologous peptide linked in frame to the nucleotide sequence of the nucleic acid of the invention so as to encode a fusion protein containing the heterologous polypeptide. The heterologous polypeptide may be fused to (a) the C-terminus of the polypeptide of the invention, (b) the N-terminus of the polypeptide of the invention, or (c) the C-terminus and the N-terminus of the polypeptide of the invention. In certain instances, the heterologous sequence encodes a polypeptide permitting the detection, isolation, solubilization and/or stabilization of the polypeptide to which it is fused. In still other embodiments, the heterologous sequence encodes a polypeptide such as a poly His tag, myc, HA, GST, protein A, protein G, calmodulin-binding peptide, thioredoxin, maltose-binding protein, poly arginine, poly His-Asp, FLAG, a portion of an immunoglobulin protein, and a transcytosis peptide.

[0061]Fusion expression systems can be useful when it is desirable to produce an immunogenic fragment of a polypeptide of the invention. For example, the VP6 capsid protein of rotavirus may be used as an immunologic carrier protein for portions of polypeptide, either in the monomeric form or in the form of a viral particle. The nucleic acid sequences corresponding to the portion of a polypeptide of the invention to which antibodies are to be raised may be incorporated into a fusion gene construct which includes coding sequences for a late vaccinia virus structural protein to produce a set of recombinant viruses expressing fusion proteins comprising a portion of the protein as part of the virion. The Hepatitis B surface antigen may also be utilized in this role as well. Similarly, chimeric constructs coding for fusion proteins containing a portion of a polypeptide of the invention and the poliovirus capsid protein may be created to enhance immunogenicity (see, for example, EP Publication NO: 0259149; and Evans et al., (1989) Nature 339:385; Huang et al., (1988) J. Virol. 62:3855; and Schlienger et al., (1992) J. Virol. 66:2).

[0062]Fusion proteins may facilitate the expression and/or purification of proteins. For example, a polypeptide of the invention may be generated as a glutathione-S-transferase (GST) fusion protein. Such GST fusion proteins may be used to simplify purification of a polypeptide of the invention, such as through the use of glutathione-derivatized matrices (see, for example, Current Protocols in Molecular Biology, eds. Ausubel et al., (N.Y.: John Wiley & Sons, 1991)). In another embodiment, a fusion gene coding for a purification leader sequence, such as a poly-(His)/enterokinase cleavage site sequence at the N-terminus of the desired portion of the recombinant protein, may allow purification of the expressed fusion protein by affinity chromatography using a Ni²+ metal resin. The purification leader sequence may then be subsequently removed by treatment with enterokinase to provide the purified protein (e.g., see Hochuli et al., (1987) J. Chromatography 411: 177; and Janknecht et al., PNAS USA 88:8972).

[0063]Techniques for making fusion genes are well known. Essentially, the joining of various DNA fragments coding for different polypeptide sequences is performed in accordance with conventional techniques, employing blunt-ended or stagger-ended termini for ligation, restriction enzyme digestion to provide for appropriate termini, filling-in of cohesive ends as appropriate, alkaline phosphatase treatment to avoid undesirable joining, and enzymatic ligation. In another embodiment, the fusion gene may be synthesized by conventional techniques including automated DNA synthesizers. Alternatively, PCR amplification of gene fragments may be carried out using anchor primers which give rise to complementary overhangs between two consecutive gene fragments which may subsequently be annealed to generate a chimeric gene sequence (see, for example, Current Protocols in Molecular Biology, eds. Ausubel et al., John Wiley & Sons: 1992).

[0064]In other embodiments, the invention provides for nucleic acids of the invention immobilized onto a solid surface, including, plates, microtiter plates, slides, beads, particles, spheres, films, strands, precipitates, gels, sheets, tubing, containers, capillaries, pads, slices, etc. The nucleic acids of the invention may be immobilized onto a chip as part of an array. The array may contain one or more polynucleotides of the invention as described herein. In one embodiment, the chip contains one or more polynucleotides of the invention as part of an array of polynucleotide sequences from the same pathogenic species as such polynucleotide(s).

[0065]In a preferred form of the invention there is provided isolated B. hyodysenteriae polypeptides as herein described, and also the polynucleotide sequences encoding these polypeptides. More desirably the B. hyodysenteriae polypeptides are provided in substantially purified form.

[0066]Preferred polypeptides of the invention will have one or more biological properties (e.g., in vivo, in vitro or immunological properties) of the native full-length polypeptide. Non-functional polypeptides are also included within the scope of the invention because they may be useful, for example, as antagonists of the functional polypeptides. The biological properties of analogues, fragments, or derivatives relative to wild type may be determined, for example, by means of biological assays.

[0067]Polypeptides, including analogues, fragments and derivatives, can be prepared synthetically (e.g., using the well known techniques of solid phase or solution phase peptide synthesis). Preferably, solid phase synthetic techniques are employed. Alternatively, the polypeptides of the invention can be prepared using well known genetic engineering techniques, as described infra. In yet another embodiment, the polypeptides can be purified (e.g., by immunoaffinity purification) from a biological fluid, such as but not limited to plasma, faeces, serum, or urine from animals, including, but not limited to, pig, chicken, goose, duck, turkey, parakeet, human, monkey, dog, cat, horse, hamster, gerbil, rabbit, ferret, horse, cattle, and sheep. An animal can be any mammal or bird.

[0068]The B. hyodysenteriae polypeptide analogues include those polypeptides having the amino acid sequence, wherein one or more of the amino acids are substituted with another amino acid which substitutions do not substantially alter the biological activity of the molecule.

[0069]According to the invention, the polypeptides of the invention produced recombinantly or by chemical synthesis and fragments or other derivatives or analogues thereof, including fusion proteins, may be used as an immunogen to generate antibodies that recognize the polypeptides.

[0070]A molecule is "antigenic" when it is capable of specifically interacting with an antigen recognition molecule of the immune system, such as an immunoglobulin (antibody) or T cell antigen receptor. An antigenic amino acid sequence contains at least about 5, and preferably at least about 10, amino acids. An antigenic portion of a molecule can be the portion that is immunodominant for antibody or T cell receptor recognition, or it can be a portion used to generate an antibody to the molecule by conjugating the antigenic portion to a carrier molecule for immunization. A molecule that is antigenic need not be itself immunogenic, i.e., capable of eliciting an immune response without a carrier.

[0071]An "antibody" is any immunoglobulin, including antibodies and fragments thereof, that binds a specific epitope. The term encompasses polyclonal, monoclonal, and chimeric antibodies, the last mentioned described in further detail in U.S. Pat. Nos. 4,816,397 and 4,816,567, as well as antigen binding portions of antibodies, including Fab, F(ab')₂ and F(v) (including single chain antibodies). Accordingly, the phrase "antibody molecule" in its various grammatical forms as used herein contemplates both an intact immunoglobulin molecule and an immunologically active portion of an immunoglobulin molecule containing the antibody combining site. An "antibody combining site" is that structural portion of an antibody molecule comprised of heavy and light chain variable and hypervariable regions that specifically binds an antigen.

[0072]Exemplary antibody molecules are intact immunoglobulin molecules, substantially intact immunoglobulin molecules and those portions of an immunoglobulin molecule that contain the paratope, including those portions known in the art as Fab, Fab', F(ab')₂ and F(v), which portions are preferred for use in the therapeutic methods described herein.

[0073]Fab and F(ab')₂ portions of antibody molecules are prepared by the proteolytic reaction of papain and pepsin, respectively, on substantially intact antibody molecules by methods that are well-known. See for example, U.S. Pat. No. 4,342,566 to Theofilopolous et al. Fab' antibody molecule portions are also well-known and are produced from F(ab')₂ portions followed by reduction with mercaptoethanol of the disulfide bonds linking the two heavy chain portions, and followed by alkylation of the resulting protein mercaptan with a reagent such as iodoacetamide. An antibody containing intact antibody molecules is preferred herein.

[0074]The phrase "monoclonal antibody" in its various grammatical forms refers to an antibody having only one species of antibody combining site capable of immunoreacting with a particular antigen. A monoclonal antibody thus typically displays a single binding affinity for any antigen with which it immunoreacts. A monoclonal antibody may therefore contain an antibody molecule having a plurality of antibody combining sites, each immunospecific for a different antigen; e.g., a bispecific (chimeric) monoclonal antibody.

[0075]The term "adjuvant" refers to a compound or mixture that enhances the immune response to an antigen. An adjuvant can serve as a tissue depot that slowly releases the antigen and also as a lymphoid system activator that non-specifically enhances the immune response [Hood et al., in Immunology, p. 384, Second Ed., Benjamin/Cummings, Menlo Park, Calif. (1984)]. Often, a primary challenge with an antigen alone, in the absence of an adjuvant, will fail to elicit a humoral or cellular immune response. Adjuvants include, but are not limited to, complete Freund's adjuvant, incomplete Freund's adjuvant, saponin, mineral gels such as aluminium hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil or hydrocarbon emulsions, keyhole limpet hemocyanins, dinitrophenol, and potentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and Corynebacterium parvum. Preferably, the adjuvant is pharmaceutically acceptable.

[0076]Various procedures known in the art may be used for the production of polyclonal antibodies to the polypeptides of the invention. For the production of antibody, various host animals can be immunised by injection with the polypeptide of the invention, including but not limited to rabbits, mice, rats, sheep, goats, etc. In one embodiment, a polypeptide of the invention can be conjugated to an immunogenic carrier, e.g., bovine serum albumin (BSA) or keyhole limpet hemocyanin (KLH). Various adjuvants may be used to increase the immunological response, depending on the host species, including but not limited to Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanins, dinitrophenol, and potentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and Corynebacterium parvum.

[0077]For preparation of monoclonal antibodies directed toward a polypeptide of the invention, any technique that provides for the production of antibody molecules by continuous cell lines in culture may be used. These include but are not limited to the hybridoma technique originally developed by Kohler et al., (1975) Nature, 256:495-497, the trioma technique, the human B-cell hybridoma technique [Kozbor et al., (1983) Immunology Today, 4:72], and the EBV-hybridoma technique to produce human monoclonal antibodies [Cole et al., (1985) in Monoclonal Antibodies and Cancer Therapy, pp. 77-96, Alan R. Liss, Inc.]. Immortal, antibody-producing cell lines can be created by techniques other than fusion, such as direct transformation of B lymphocytes with oncogenic DNA, or transfection with Epstein-Barr virus. See, e.g., U.S. Pat. Nos. 4,341,761; 4,399,121; 4,427,783; 4,444,887; 4,451,570; 4,466,917; 4,472,500; 4,491,632; and 4,493,890.

[0078]In an additional embodiment of the invention, monoclonal antibodies can be produced in germ-free animals utilising recent technology. According to the invention, chicken or swine antibodies may be used and can be obtained by using chicken or swine hybridomas or by transforming B cells with EBV virus in vitro. In fact, according to the invention, techniques developed for the production of "chimeric antibodies" [Morrison et al., (1984) J. Bacteriol., 159-870; Neuberger et al., (1984) Nature, 312:604-608; Takeda et al., (1985) Nature, 314:452-454] by splicing the genes from a mouse antibody molecule specific for a polypeptide of the invention together with genes from an antibody molecule of appropriate biological activity can be used; such antibodies are within the scope of this invention. Such chimeric antibodies are preferred for use in therapy of intestinal diseases or disorders (described infra), since the antibodies are much less likely than xenogenic antibodies to induce an immune response, in particular an allergic response, themselves.

[0079]According to the invention, techniques described for the production of single chain antibodies (U.S. Pat. No. 4,946,778) can be adapted to produce single chain antibodies specific for an polypeptide of the invention. An additional embodiment of the invention utilises the techniques described for the construction of Fab expression libraries [Huse et al., (1989) Science, 246:1275-1281] to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity for a polypeptide of the invention.

[0080]Antibody fragments, which contain the idiotype of the antibody molecule, can be generated by known techniques. For example, such fragments include but are not limited to: the F(ab')₂ fragment which can be produced by pepsin digestion of the antibody molecule; the Fab' fragments which can be generated by reducing the disulfide bridges of the F(ab')₂ fragment, and the Fab fragments which can be generated by treating the antibody molecule with papain and a reducing agent.

[0081]In the production of antibodies, screening for the desired antibody can be accomplished by techniques known in the art, e.g., radioimmunoassay, ELISA, "sandwich" immunoassays, immunoradiometric assays, gel diffusion precipitin reactions, immunodiffusion assays, in situ immunoassays (using colloidal gold, enzyme or radioisotope labels, for example), Western blots, precipitation reactions, agglutination assays (e.g., gel agglutination assays, hemagglutination assays), complement fixation assays, immunofluorescence assays, protein A assays, immunoelectrophoresis assays, etc. In one embodiment, antibody binding is detected by detecting a label on the primary antibody. In another embodiment, the primary antibody is detected by detecting binding of a secondary antibody or reagent to the primary antibody. In a further embodiment, the secondary antibody is labelled. Many means are known in the art for detecting binding in an immunoassay and are within the scope of the present invention. For example, to select antibodies that recognise a specific epitope of a polypeptide of the invention, one may assay generated hybridomas for a product that binds to a fragment of a polypeptide of the invention containing such epitope.

[0082]The invention also covers diagnostic and prognostic methods to detect the presence of B. hyodysenteriae using a polypeptide of the invention and/or antibodies which bind to the polypeptide of the invention and kits useful for diagnosis and prognosis of B. hyodysenteriae infections.

[0083]Diagnostic and prognostic methods will generally be conducted using a biological sample obtained from an animal, such as chicken or swine. A "sample" refers to an animal's tissue or fluid suspected of containing a Brachyspira species, such as B. hyodysenteriae, or its polynucleotides or its polypeptides. Examples of such tissue or fluids include, but not limited to, plasma, serum, fecal material, urine, lung, heart, skeletal muscle, stomach, intestines, and in vitro cell culture constituents.

[0084]The invention provides methods for detecting the presence of a polypeptide of the invention in a sample, with the following steps: (a) contacting a sample suspected of containing a polypeptide of the invention with an antibody (preferably bound to a solid support) that specifically binds to the polypeptide of the invention under conditions which allow for the formation of reaction complexes comprising the antibody and the polypeptide of the invention; and (b) detecting the formation of reaction complexes comprising the antibody and polypeptide of the invention in the sample, wherein detection of the formation of reaction complexes indicates the presence of the polypeptide of the invention in the sample.

[0085]Preferably, the antibody used in this method is derived from an affinity-purified polyclonal antibody, and more preferably a monoclonal antibody. In addition, it is preferable for the antibody molecules used herein be in the form of Fab, Fab', F(ab')₂ or F(v) portions or whole antibody molecules.

[0086]Particularly preferred methods for detecting B. hyodysenteriae based on the above method include enzyme linked immunosorbent assays, radioimmunoassays, immunoradiometric assays and immunoenzymatic assays, including sandwich assays using monoclonal and/or polyclonal antibodies.

[0087]Three such procedures that are especially useful utilise either polypeptide of the invention (or a fragment thereof) labelled with a detectable label, antibody Ab₁ labelled with a detectable label, or antibody Ab₂ labelled with a detectable label. The procedures may be summarized by the following equations wherein the asterisk indicates that the particle is labelled and "AA" stands for the polypeptide of the invention:

AA*+Ab₁=AA*Ab₁ (A.)

AA+Ab*₁=AAAb₁* (B.)

AA+Ab₁+Ab₂*=Ab₁AAAb₂* (C.)

[0088]The procedures and their application are all familiar to those skilled in the art and accordingly may be utilised within the scope of the present invention. The "competitive" procedure, Procedure A, is described in U.S. Pat. Nos. 3,654,090 and 3,850,752. Procedure B is representative of well-known competitive assay techniques. Procedure C, the "sandwich" procedure, is described in U.S. Pat. Nos. RE 31,006 and 4,016,043. Still other procedures are known, such as the "double antibody" or "DASP" procedure, and can be used.

[0089]In each instance, the polypeptide of the invention form complexes with one or more antibody(ies) or binding partners and one member of the complex is labelled with a detectable label. The fact that a complex has formed and, if desired, the amount thereof, can be determined by known methods applicable to the detection of labels.

[0090]It will be seen from the above, that a characteristic property of Ab₂ is that it will react with Ab₁. This reaction is because Ab₁, raised in one mammalian species, has been used in another species as an antigen to raise the antibody, Ab₂. For example, Ab₂ may be raised in goats using rabbit antibodies as antigens. Ab₂ therefore would be anti-rabbit antibody raised in goats. For purposes of this description and claims, Ab₁ will be referred to as a primary antibody, and Ab₂ will be referred to as a secondary or anti-Ab₁ antibody.

[0091]The labels most commonly employed for these studies are radioactive elements, enzymes, chemicals that fluoresce when exposed to ultraviolet light, and others. Examples of fluorescent materials capable of being utilised as labels include fluorescein, rhodamine and auramine. A particular detecting material is anti-rabbit antibody prepared in goats and conjugated with fluorescein through an isothiocyanate. Examples of preferred isotope include ³H, ¹⁴C, ³²P, ³5S, ³⁶Cl, ⁵¹Cr, ⁵⁷Co, ⁵⁸Co, ⁵⁹Fe, ⁹0Y, ¹²⁵I, ¹³¹I, and ¹⁸⁶Re. The radioactive label can be detected by any of the currently available counting procedures. While many enzymes can be used, examples of preferred enzymes are peroxidase, β-glucuronidase, β-D-glucosidase, β-D-galactosidase, urease, glucose oxidase plus peroxidase and alkaline phosphatase. Enzyme are conjugated to the selected particle by reaction with bridging molecules such as carbodiimides, diisocyanates, glutaraldehyde and the like. Enzyme labels can be detected by any of the presently utilized colorimetric, spectrophotometric, fluorospectrophotometric, amperometric or gasometric techniques. U.S. Pat. Nos. 3,654,090; 3,850,752; and 4,016,043 are referred to by way of example for their disclosure of alternate labelling material and methods.

[0092]The invention also provides a method of detecting antibodies to a polypeptide of the invention in biological samples, using the following steps: (a) providing a polypeptide of the invention or a fragment thereof; (b) incubating a biological sample with said polypeptide of the invention under conditions which allow for the formation of an antibody-antigen complex; and (c) determining whether an antibody-antigen complex with the polypeptide of the invention is formed.

[0093]In another embodiment of the invention there are provided in vitro methods for evaluating the level of antibodies to a polypeptide of the invention in a biological sample using the following steps: (a) detecting the formation of reaction complexes in a biological sample according to the method noted above; and (b) evaluating the amount of reaction complexes formed, which amount of reaction complexes corresponds to the level of polypeptide of the invention in the biological sample.

[0094]Further there are provided in vitro methods for monitoring therapeutic treatment of a disease associated with B. hyodysenteriae in an animal host by evaluating, as describe above, the levels of antibodies to a polypeptide of the invention in a series of biological samples obtained at different time points from an animal host undergoing such therapeutic treatment.

[0095]The present invention further provides methods for detecting the presence or absence of B. hyodysenteriae in a biological sample by: (a) bringing the biological sample into contact with a polynucleotide probe or primer of polynucleotide of the invention under suitable hybridizing conditions; and (b) detecting any duplex formed between the probe or primer and nucleic acid in the sample.

[0096]According to one embodiment of the invention, detection of B. hyodysenteriae may be accomplished by directly amplifying polynucleotide sequences from biological sample, using known techniques and then detecting the presence of polynucleotide of the invention sequences.

[0097]In one form of the invention, the target nucleic acid sequence is amplified by PCR and then detected using any of the specific methods mentioned above. Other useful diagnostic techniques for detecting the presence of polynucleotide sequences include, but are not limited to: 1) allele-specific PCR; 2) single stranded conformation analysis; 3) denaturing gradient gel electrophoresis; 4) RNase protection assays; 5) the use of proteins which recognize nucleotide mismatches, such as the E. coli mutS protein; 6) allele-specific oligonucleotides; and 7) fluorescent in situ hybridisation.

[0098]In addition to the above methods polynucleotide sequences may be detected using conventional probe technology. When probes are used to detect the presence of the desired polynucleotide sequences, the biological sample to be analysed, such as blood or serum, may be treated, if desired, to extract the nucleic acids. The sample polynucleotide sequences may be prepared in various ways to facilitate detection of the target sequence; e.g. denaturation, restriction digestion, electrophoresis or dot blotting. The targeted region of the sample polynucleotide sequence usually must be at least partially single-stranded to form hybrids with the targeting sequence of the probe. If the sequence is naturally single-stranded, denaturation will not be required. However, if the sequence is double-stranded, the sequence will probably need to be denatured. Denaturation can be carried out by various techniques known in the art.

[0099]Sample polynucleotide sequences and probes are incubated under conditions that promote stable hybrid formation of the target sequence in the probe with the putative desired polynucleotide sequence in the sample. Preferably, high stringency conditions are used in order to prevent false positives.

[0100]Detection, if any, of the resulting hybrid is usually accomplished by the use of labelled probes. Alternatively, the probe may be unlabeled, but may be detectable by specific binding with a ligand that is labelled, either directly or indirectly. Suitable labels and methods for labelling probes and ligands are known in the art, and include, for example, radioactive labels which may be incorporated by known methods (e.g., nick translation, random priming or kinasing), biotin, fluorescent groups, chemiluminescent groups (e.g., dioxetanes, particularly triggered dioxetanes), enzymes, antibodies and the like. Variations of this basic scheme are known in the art, and include those variations that facilitate separation of the hybrids to be detected from extraneous materials and/or that amplify the signal from the labelled moiety.

[0101]It is also contemplated within the scope of this invention that the nucleic acid probe assays of this invention may employ a cocktail of nucleic acid probes capable of detecting the desired polynucleotide sequences of this invention. Thus, in one example to detect the presence of polynucleotide sequences of this invention in a cell sample, more than one probe complementary to a polynucleotide sequences is employed and in particular the number of different probes is alternatively 2, 3, or 5 different nucleic acid probe sequences.

[0102]The polynucleotide sequences described herein (preferably in the form of probes) may also be immobilised to a solid phase support for the detection of Brachyspira species, including but not limited to B. hyodysenteriae, B. intermedia, B. alvinipulli, B. aalborgi, B. innocens, B. murdochii, and B. pilosicoli. Alternatively the polynucleotide sequences described herein will form part of a library of DNA molecules that may be used to detect simultaneously a number of different genes from Brachyspira species, such as B. hyodysenteriae. In a further alternate form of the invention polynucleotide sequences described herein together with other polynucleotide sequences (such as from other bacteria or viruses) may be immobilised on a solid support in such a manner permitting identification of the presence of a Brachyspira species, such as B. hyodysenteriae and/or any of the other polynucleotide sequences bound onto the solid support.

[0103]Techniques for producing immobilised libraries of DNA molecules have been described in the art. Generally, most prior art methods describe the synthesis of single-stranded nucleic acid molecule libraries, using for example masking techniques to build up various permutations of sequences at the various discrete positions on the solid substrate. U.S. Pat. No. 5,837,832 describes an improved method for producing DNA arrays immobilised to silicon substrates based on very large scale integration technology. In particular, U.S. Pat. No. 5,837,832 describes a strategy called "tiling" to synthesize specific sets of probes at spatially defined locations on a substrate that may be used to produced the immobilised DNA libraries of the present invention. U.S. Pat. No. 5,837,832 also provides references for earlier techniques that may also be used. Thus polynucleotide sequence probes may be synthesised in situ on the surface of the substrate.

[0104]Alternatively, single-stranded molecules may be synthesised off the solid substrate and each pre-formed sequence applied to a discrete position on the solid substrate. For example, polynucleotide sequences may be printed directly onto the substrate using robotic devices equipped with either pins or pizo electric devices.

[0105]The library sequences are typically immobilised onto or in discrete regions of a solid substrate. The substrate may be porous to allow immobilisation within the substrate or substantially non-porous, in which case the library sequences are typically immobilised on the surface of the substrate. The solid substrate may be made of any material to which polypeptides can bind, either directly or indirectly. Examples of suitable solid substrates include flat glass, silicon wafers, mica, ceramics and organic polymers such as plastics, including polystyrene and polymethacrylate. It may also be possible to use semi-permeable membranes such as nitrocellulose or nylon membranes, which are widely available. The semi-permeable membranes may be mounted on a more robust solid surface such as glass. The surfaces may optionally be coated with a layer of metal, such as gold, platinum or other transition metal.

[0106]Preferably, the solid substrate is generally a material having a rigid or semi-rigid surface. In preferred embodiments, at least one surface of the substrate will be substantially flat, although in some embodiments it may be desirable to physically separate synthesis regions for different polymers with, for example, raised regions or etched trenches. It is also preferred that the solid substrate is suitable for the high density application of DNA sequences in discrete areas of typically from 50 to 100 μm, giving a density of 10000 to 40000 dots/cm^-2.

[0107]The solid substrate is conveniently divided up into sections. This may be achieved by techniques such as photoetching, or by the application of hydrophobic inks, for example teflon-based inks (Cel-line, USA).

[0108]Discrete positions, in which each different member of the library is located may have any convenient shape, e.g., circular, rectangular, elliptical, wedge-shaped, etc.

[0109]Attachment of the polynucleotide sequences to the substrate may be by covalent or non-covalent means. The polynucleotide sequences may be attached to the substrate via a layer of molecules to which the library sequences bind. For example, the polynucleotide sequences may be labelled with biotin and the substrate coated with avidin and/or streptavidin. A convenient feature of using biotinylated polynucleotide sequences is that the efficiency of coupling to the solid substrate can be determined easily. Since the polynucleotide sequences may bind only poorly to some solid substrates, it is often necessary to provide a chemical interface between the solid substrate (such as in the case of glass) and the nucleic acid sequences. Examples of suitable chemical interfaces include hexaethylene glycol. Another example is the use of polylysine coated glass, the polylysine then being chemically modified using standard procedures to introduce an affinity ligand. Other methods for attaching molecules to the surfaces of solid substrate by the use of coupling agents are known in the art, see for example WO98/49557.

[0110]Binding of complementary polynucleotide sequences to the immobilised nucleic acid library may be determined by a variety of means such as changes in the optical characteristics of the bound polynucleotide sequence (i.e. by the use of ethidium bromide) or by the use of labelled nucleic acids, such as polypeptides labelled with fluorophores. Other detection techniques that do not require the use of labels include optical techniques such as optoacoustics, reflectometry, ellipsometry and surface plasmon resonance (see WO97/49989).

[0111]Thus, the present invention provides a solid substrate having immobilized thereon at least one polynucleotide of the present invention, preferably two or more different polynucleotide sequences of the present invention.

[0112]The present invention also can be used as a prophylactic or therapeutic, which may be utilised for the purpose of stimulating humoral and cell mediated responses in animals, such as chickens and swine, thereby providing protection against colonisation with Brachyspira species, including but not limited to B. hyodysenteriae, B. suanatina, B. intermedia, B. alvinipulli, B. aalborgi, B. innocens, B. murdochii, and B. pilosicoli. Natural infection with a Brachyspira species, such as B. hyodysenteriae induces circulating antibody titres against the proteins described herein. Therefore, the amino acid sequences described herein or parts thereof, have the potential to form the basis of a systemically or orally administered prophylactic or therapeutic to provide protection against intestinal spirochaetosis.

[0113]Accordingly, in one embodiment the present invention provides the amino acid sequences described herein or fragments thereof or antibodies that bind the amino acid sequences or the polynucleotide sequences described herein in a therapeutically effective amount admixed with a pharmaceutically acceptable carrier, diluent, or excipient.

[0114]The phrase "therapeutically effective amount" is used herein to mean an amount sufficient to reduce by at least about 15%, preferably by at least 50%, more preferably by at least 90%, and most preferably prevent, a clinically significant deficit in the activity, function and response of the animal host. Alternatively, a therapeutically effective amount is sufficient to cause an improvement in a clinically significant condition in the animal host.

[0115]The phrase "pharmaceutically acceptable" refers to molecular entities and compositions that are physiologically tolerable and do not typically produce an allergic or similarly untoward reaction, such as gastric upset and the like, when administered to an animal. The term "carrier" refers to a diluent, adjuvant, excipient, or vehicle with which the compound is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water or saline solutions and aqueous dextrose and glycerol solutions are preferably employed as carriers, particularly for injectable solutions. Suitable pharmaceutical carriers are described in Martin, Remington's Pharmaceutical Sciences, 18th Ed., Mack Publishing Co., Easton, Pa., (1990).

[0116]In a more specific form of the invention there are provided pharmaceutical compositions comprising therapeutically effective amounts of the amino acid sequences described herein or an analogue, fragment or derivative product thereof or antibodies thereto together with pharmaceutically acceptable diluents, preservatives, solubilizes, emulsifiers, adjuvants and/or carriers. Such compositions include diluents of various buffer content (e.g., Tris-HCl, acetate, phosphate), pH and ionic strength and additives such as detergents and solubilizing agents (e.g., Tween 80, Polysorbate 80), anti-oxidants (e.g., ascorbic acid, sodium metabisulfite), preservatives (e.g., Thimersol, benzyl alcohol) and bulking substances (e.g., lactose, mannitol). The material may be incorporated into particulate preparations of polymeric compounds such as polylactic acid, polyglycolic acid, etc. or into liposomes. Hylauronic acid may also be used. Such compositions may influence the physical state, stability, rate of in vivo release, and rate of in vivo clearance of the present proteins and derivatives. See, e.g., Martin, Remington's Pharmaceutical Sciences, 18th Ed. (1990, Mack Publishing Co., Easton, Pa. 18042) pages 1435-1712 that are herein incorporated by reference. The compositions may be prepared in liquid form, or may be in dried powder, such as lyophilised form.

[0117]Alternatively, the polynucleotides of the invention can be optimized for expression in plants (e.g., corn). The plant may be transformed with plasmids containing the optimized polynucleotides. Then the plant is grown, and the proteins of the invention are expressed in the plant, or the plant-optimized version is expressed. The plant is later harvested, and the section of the plant containing the proteins of the invention is processed into feed for the animal. This animal feed will impart immunity against B. hyodysenteriae when eaten by the animal. Examples of prior art detailing these methods can be found in U.S. Pat. No. 5,914,123 (Arntzen, et al.); U.S. Pat. No. 6,034,298 (Lam, et al.); and U.S. Pat. No. 6,136,320 (Arntzen, et al.).

[0118]It will be appreciated that pharmaceutical compositions provided accordingly to the invention may be administered by any means known in the art. Preferably, the pharmaceutical compositions for administration are administered by injection, orally, or by the pulmonary, or nasal route. The amino acid sequences described herein or antibodies derived therefrom are more preferably delivered by intravenous, intraarterial, intraperitoneal, intramuscular, or subcutaneous routes of administration. Alternatively, the amino acid sequence described herein or antibodies derived therefrom, properly formulated, can be administered by nasal or oral administration.

[0119]Also encompassed by the present invention is the use of polynucleotide sequences of the invention, as well as antisense and ribozyme polynucleotide sequences hybridisable to a polynucleotide sequence encoding an amino acid sequence according to the invention, for manufacture of a medicament for modulation of a disease associated B. hyodysenteriae.

[0120]Polynucleotide sequences encoding antisense constructs or ribozymes for use in therapeutic methods are desirably administered directly as a naked nucleic acid construct. Uptake of naked nucleic acid constructs by bacterial cells is enhanced by several known transfection techniques, for example those including the use of transfection agents. Example of these agents include cationic agents (for example calcium phosphate and DEAE-dextran) and lipofectants. Typically, nucleic acid constructs are mixed with the transfection agent to produce a composition.

[0121]Alternatively the antisense construct or ribozymes may be combined with a pharmaceutically acceptable carrier or diluent to produce a pharmaceutical composition. Suitable carriers and diluents include isotonic saline solutions, for example phosphate-buffered saline. The composition may be formulated for parenteral, intramuscular, intravenous, subcutaneous, intraocular, oral or transdermal administration. The routes of administration described are intended only as a guide since a skilled practitioner will be able to determine readily the optimum route of administration and any dosage for any particular animal and condition.

[0122]The invention also includes kits for screening animals suspected of being infected with a Brachyspira species, such as B. hyodysenteriae or to confirm that an animal is infected with a Brachyspira species, such as B. hyodysenteriae. In a further embodiment of this invention, kits suitable for use by a specialist may be prepared to determine the presence or absence of Brachyspira species, including but not limited to B. hyodysenteriae, B. suanatina, B. intermedia, B. alvinipulli, B. aalborgi, B. innocens, B. murdochii, and B. pilosicoli in suspected infected animals or to quantitatively measure a Brachyspira species, including but not limited to B. hyodysenteriae, B. suanatina, B. intermedia, B. alvinipulli, B. aalborgi and B. pilosicoli infection. In accordance with the testing techniques discussed above, such kits can contain at least a labelled version of one of the amino acid sequences described herein or its binding partner, for instance an antibody specific thereto, and directions depending upon the method selected, e.g., "competitive," "sandwich," "DASP" and the like. Alternatively, such kits can contain at least a polynucleotide sequence complementary to a portion of one of the polynucleotide sequences described herein together with instructions for its use. The kits may also contain peripheral reagents such as buffers, stabilizers, etc.

[0123]Accordingly, a test kit for the demonstration of the presence of a Brachyspira species, including but not limited to B. hyodysenteriae, B. suanatina, B. intermedia, B. alvinipulli, B. aalborgi, B. innocens, B. murdochii, and B. pilosicoli, may contain the following:

[0124](a) a predetermined amount of at least one labelled immunochemically reactive component obtained by the direct or indirect attachment of one of the amino acid sequences described herein or a specific binding partner thereto, to a detectable label;

[0125](b) other reagents; and

[0126](c) directions for use of said kit.

[0127]More specifically, the diagnostic test kit may contain:

[0128](a) a known amount of one of the amino acid sequences described herein as described above (or a binding partner) generally bound to a solid phase to form an immunosorbent, or in the alternative, bound to a suitable tag, or there are a plural of such end products, etc;

[0129](b) if necessary, other reagents; and

[0130](c) directions for use of said test kit.

[0131]In a further variation, the test kit may contain:

[0132](a) a labelled component which has been obtained by coupling one of the amino acid sequences described herein to a detectable label;

[0133](b) one or more additional immunochemical reagents of which at least one reagent is a ligand or an immobilized ligand, which ligand is selected from the group consisting of: [0134](i) a ligand capable of binding with the labelled component (a); [0135](ii) a ligand capable of binding with a binding partner of the labelled component (a); [0136](iii) a ligand capable of binding with at least one of the component(s) to be determined; or [0137](iv) a ligand capable of binding with at least one of the binding partners of at least one of the component(s) to be determined; and

[0138](c) directions for the performance of a protocol for the detection and/or determination of one or more components of an immunochemical reaction between one of the amino acid sequences described herein and a specific binding partner thereto.

[0139]Preparation of Genomic Library

[0140]A genomic library is prepared using an Australian porcine field isolate of B. hyodysenteriae (strain WA 1). This strain has been well-characterised and shown to be virulent following experimental challenge of pigs. The cetyltrimethylammonium bromide (CTAB) method is used to prepare high quality chromosomal DNA suitable for preparation of genomic DNA libraries. B. hyodysenteriae is grown in 100 ml anaerobic trypticase soy broth culture to a cell density of 10⁹ cells/ml. The cells are harvested at 4,000×g for 10 minutes, and the cell pellet resuspended in 9.5 ml TE buffer. SDS is added to a final concentration of 0.5% (w/v), and the cells lysed at 37° C. for 1 hour with 100 μg of Proteinase K. NaCl is added to a final concentration of 0.7 M and 1.5 ml CTAB/NaCl solution (10% w/v CTAB, 0.7 M NaCl) is added before incubating the solution at 65° C. for 20 minutes. The lysate is extracted with an equal volume of chloroform/isoamyl alcohol, and the tube is centrifuged at 6,000×g for 10 minutes to separate the phases. The aqueous phase is transferred to a fresh tube and 0.6 volumes of isopropanol are added to precipitate the high molecular weight DNA. The precipitated DNA is collected using a hooked glass rod and transferred to a tube containing 1 ml of 70% (v/v) ethanol. The tube is centrifuged at 10,000×g and the pelleted DNA redissolved in 4 ml TE buffer overnight. A cesium chloride gradient containing 1.05 g/ml CsCl and 0.5 mg/ml ethidium bromide is prepared using the redissolved DNA solution. The gradient is transferred to 4 ml sealable centrifuge tubes and centrifuged at 70,000×g overnight at 15° C. The separated DNA is visualized under an ultraviolet light, and the high molecular weight DNA is withdrawn from the gradient using a 15-g needle. The ethidium bromide is removed from the DNA by sequential extraction with CsCl-saturated isopropanol. The purified chromosomal DNA is dialysed against 2 litres TE buffer and precipitated with isopropanol. The resuspended genomic DNA is sheared using a GeneMachines Hydroshear (Genomic Solutions, Ann Arbor, Mich.), and the sheared DNA is filled-in using Klenow DNA polymerase to generate blunt-end fragments. One hundred ng of the blunt-end DNA fragments is ligated with 25 ng of pSMART VC vector (Lucigen, Meddleton, Wis.) using CloneSmart DNA ligase. The ligated DNA is then electroporated into E. coli electrocompetent cells. A small insert (2-3 kb) library and medium insert (3-10 kb) library is constructed into the low copy version of the pSMART VC vector.

[0141]Genomic Sequencing

[0142]After the genomic library is obtained, individual clones of E. coli containing the pSMART VC vector are picked. The plasmid DNA is purified and sequenced. The purified plasmids are subjected to automated direct sequencing of the pSMART VC vector using the forward and reverse primers specific for the pSMART VC vector. Each sequencing reaction is performed in a 10 μl volume consisting of 200 ng of plasmid DNA, 2 pmol of primer, and 4 μl of the ABI PRISM® BigDye Terminator Cycle Sequencing Ready Reaction Mix (PE Applied Biosystems, Foster City, Calif.). Cycling conditions involve a 2 minute denaturing step at 96° C., followed by 25 cycles of denaturation at 96° C. for 10 seconds, and a combined primer annealing and extension step at 60° C. for 4 minutes. Residual dye terminators are removed from the sequencing products by precipitation with 95% (v/v) ethanol containing 85 mM sodium acetate (pH 5.2), 3 mM EDTA (pH 8), and vacuum dried. The plasmids are sequenced in duplicate using each primer. Sequencing products are analysed using an ABI 373A DNA Sequencer (PE Applied Biosystems).

[0143]Annotation

[0144]Partial genome sequences for B. hyodysenteriae are assembled and annotated using a range of public domain bioinformatics tools to analyse and re-analyse the sequences as part of a quality assurance procedure on data analysis. Open reading frames (ORFs) are predicted using a variety of programs including GeneMark, GLIMMER, ORPHEUS, SELFID and GetORF. Putative ORFs are examined for homology (DNA and protein) with existing international databases using searches including BLAST and FASTA. All the predicted ORFs are analysed to determine their cellular localisation using programs including PSI-BLAST, FASTA, MOTIFS, FINDPATTERNS, PHD, SIGNALP and PSORT. Databases including Interpro, Prosite, ProDom, Pfam and Blocks are used to predict surface associated proteins such as transmembrane domains, leader peptides, homologies to known surface proteins, lipoprotein signature, outer membrane anchoring motifs and host cell binding domains. Phylogenetic and other molecular evolution analysis is conducted with the identified genes and with other species to assist in the assignment of function. The in silico analysis of both partially sequenced genomes produces a comprehensive list of all the predicted ORFs present in the sequence data available. Each ORF is interrogated for descriptive information such as predicted molecular weight, isoelectric point, hydrophobicity, and subcellular localisation to enable correlation with the in vitro properties of the native gene product. Predicted genes which encode proteins similar to surface localized components and/or virulence factors in other pathogenic bacteria are selected as potential vaccine targets.

[0145]Bioinformatics Results

[0146]The shotgun sequencing of the B. hyodysenteriae genome results in 94.6% (3028.6 kb out of a predicted 3200 kb) of the genome being sequenced. The B. hyodysenteriae sequence is comprised of 294 contigs with an average contig size of 10.3 kb. For B. hyodysenteriae, 2,593 open-reading frames (ORFs) are predicted from the 294 contigs. Comparison of the predicted ORFs with genes present in the nucleic acid and protein databases indicate that approximately 70% of the ORFs have homology with genes contained in the public databases. The remaining 30% of the predicted ORFs have no known identity.

[0147]Vaccine Candidates

[0148]To help reduce the number of ORFs that would be tested as a vaccine candidate, ORF's showing reasonable homology (E-value less than e^-15) with outer surface proteins, secreted proteins, and possible virulence factors present in public databases are selected as potential vaccine candidates. Of the 2,593 ORFs obtained in the genomic shotgun sequencing, many passed this test but the results of thirty-three genes are presented here. Table 1 shows thirty-three genes selected as potential vaccine targets and their similarity with other known amino acid sequences obtained from SWISS-PROT database. It is noted that the percent identity of amino acids does not raise above 58% while the percent similarity or homology of amino acids remains less than 71%, thus indicating that these ORFs are unique.

TABLE-US-00001 TABLE 1 Identity Similarity Accession Gene Identity of Protein With Highest Homology (amino acids) (amino acids) Number NAV-H54 Variable surface protein (VspD) of 106/223 136/223 O68157 Brachyspira hyodysenteriae (47%) (60%) NAV-H55 Flagellar protein B of Leptospira interrogans 58/213 108/213 Q72SJ3 (27%) (50%) NAV-H56 Myosin-like major antigen 288/1509 609/1509 P21249 (19%) (40%) NAV-H57 Lytic murein transglycosylate (possibly 97/318 158/318 Q6F7W9 outer membrane-bound) (25%) (41%) NAV-H58 Outer membrane protein of Treponema pallidum 57/175 90/175 P96127 (32%) (51%) NAV-H59 Myosin-like major antigen 204/1012 432/1012 P21249 (20%) (42%) NAV-H60 Outer membrane protein and related 46/139 68/139 COG2885 peptidoglycan-associated lipoprotein (33%) (48%) NAV-H61 Putative lipoprotein of Treponema denticola 336/805 483/805 Q73NT0 (41%) (60%) NAV-H62 NlpA lipoprotein of Streptococcus suis 92/269 151/269 Q303L3 (34%) (56%) NAV-H63 NlpA lipoprotein of Streptococcus suis 106/312 167/312 Q303L3 (33%) (53%) NAV-H64 NlpA lipoprotein of Streptococcus suis 112/337 198/337 Q303L3 (33%) (58%) NAV-H65 Putative secreted protein of 50/127 68/127 Q849M9 Streptomyces violaceoruber (39%) (53%) NAV-H66 Toxin (YoeB) of Escherichia coli 42/85 60/85 P69349 (58%) (76%) NAV-H67 Outer membrane protein (TolC) 80/350 171/350 Q2Z054 (20%) (39%) NAV-H68 Probable hemolysin-related protein of 121/415 204/415 Q3ZYX1 Dehalococcoides sp. (29%) (49%) NAV-H69 Outer surface protein of Bacillus cereus 193/357 256/357 Q4MWS0 (54%) (71%) NAV-H70 Membrane associated lipoprotein of 146/417 203/417 Q2SRL9 Vibrio vulnificus (35%) (48%) NAV-H71 Surface layer protein of 72/201 112/201 Q8TJE3 Methanosarcina barkeri (36%) (49%) NAV-H72 Lytic murein transglycosylate (possibly 51/141 6/141 P44049 outer membrane-bound) (36%) (53%) NAV-H73 Toxin (YoeB) of Escherichia coli 42/84 62/84 P69349 (50%) (73%) NAV-H74 Outer membrane protein/protective antigen 210/833 339/833 COG4775 (25%) (40%) NAV-H22 variable surface protein (VspH) of 29% 43% AAK14803.1 Brachyspira hyodysenteriae (133/454) (199/454) NAV-H23 membrane associated lipoprotein of 43% 60% AAF27178.1 Mycoplasma mycoides (114/263) (159/263) NAV-H24 Outer membrane lipoprotein of 32% 53% ZP00300921.1 Geobacter metallireducens (46/142) (76/142) NAV-H30 surface antigen (BspA) of 38% 55% AAC82625.1 Bacteroides forsythus (83/216) (120/216) NAV-H32 hemolytic protein (HlpA) of Nostoc sp. 35% 56% ZP488469.1 (49/137) (77/137) NAV-H33 hemolytic protein of Prevotella intermedia 54% 70% AAC05836.1 (64/117) (83/117) NAV-H37 virulence-mediating protein (VirC) of 36% 63% NP800579.1 Vibrio parahaemolyticus (58/159) (101/159) NAV-H40 lytic murein transglycosylase (contains 26% 41% ZP00146104.1 LysM/invasin domains) (120/449) (185/449) NAV-H41 surface antigen BspA of Bacteroides forsythus 41% 57% AAC82625.1 (84/201) (115/201) NAV-H43 Hemolysins and related proteins of 35% 56% ZP00162711.2 Anabaena variabilis (150/425) (242/425) NAV-H44 outer membrane porin of 20% 41% YP001419.1 Leptospira interrogans (79/393) (163/393) NAV-H45 virulence factor (MviN) protein of 32% 49% NP952225.1 Geobacter sulfurreducens (153/469) (231/469)

[0149]The DNA and amino acid sequences of NAV-H54 are found in SEQ ID NOs: 1 and 2, respectively. The DNA and amino acid sequences of NAV-H55 are found in SEQ ID NOs: 3 and 4, respectively. The DNA and amino acid sequences of NAV-H56 are found in SEQ ID NOs: 5 and 6, respectively. The DNA and amino acid sequences of NAV-H57 are found in SEQ ID NOs: 7 and 8, respectively. The DNA and amino acid sequences of NAV-H58 are found in SEQ ID NOs: 9 and 10, respectively. The DNA and amino acid sequences of NAV-H59 are found in SEQ ID NOs: 11 and 12, respectively. The DNA and amino acid sequences of NAV-H60 are found in SEQ ID NOs: 13 and 14, respectively. The DNA and amino acid sequences of NAV-H61 are found in SEQ ID NOs: 15 and 16, respectively. The DNA and amino acid sequences of NAV-H62 are found in SEQ ID NOs: 17 and 18, respectively. The DNA and amino acid sequences of NAV-H63 are found in SEQ ID NOs: 19 and 20, respectively. The DNA and amino acid sequences of NAV-H64 are found in SEQ ID NOs: 21 and 22, respectively. The DNA and amino acid sequences of NAV-H65 are found in SEQ ID NOs: 23 and 24, respectively. The DNA and amino acid sequences of NAV-H66 are found in SEQ ID NOs: 25 and 26, respectively. The DNA and amino acid sequences of NAV-H67 are found in SEQ ID NOs: 27 and 28, respectively. The DNA and amino acid sequences of NAV-H68 are found in SEQ ID NOs: 29 and 30, respectively. The DNA and amino acid sequences of NAV-H69 are found in SEQ ID NOs: 31 and 32, respectively. The DNA and amino acid sequences of NAV-H70 are found in SEQ ID NOs: 33 and 34, respectively. The DNA and amino acid sequences of NAV-H71 are found in SEQ ID NOs: 35 and 36, respectively. The DNA and amino acid sequences of NAV-H72 are found in SEQ ID NOs: 37 and 38, respectively. The DNA and amino acid sequences of NAV-H73 are found in SEQ ID NOs: 39 and 40, respectively. The DNA and amino acid sequences of NAV-H74 are found in SEQ ID NOs: 41 and 42, respectively.

[0150]The DNA and amino acid sequences of NAV-H22 are found in SEQ ID NOs: 43 and 44, respectively. The DNA and amino acid sequences of NAV-H23 are found in SEQ ID NOs: 45 and 46, respectively. The DNA and amino acid sequences of NAV-H24 are found in SEQ ID NOs: 47 and 48, respectively. The DNA and amino acid sequences of NAV-H30 are found in SEQ ID NOs: 49 and 50, respectively. The DNA and amino acid sequences of NAV-H32 are found in SEQ ID NOs: 51 and 52, respectively. The DNA and amino acid sequences of NAV-H33 are found in SEQ ID NOs: 53 and 54, respectively. The DNA and amino acid sequences of NAV-H37 are found in SEQ ID NOs: 55 and 56, respectively. The DNA and amino acid sequences of NAV-H40 are found in SEQ ID NOs: 57 and 58, respectively. The DNA and amino acid sequences of NAV-H41 are found in SEQ ID NOs: 59 and 60, respectively. The DNA and amino acid sequences of NAV-H43 are found in SEQ ID NOs: 61 and 62, respectively. The DNA and amino acid sequences of NAV-H44 are found in SEQ ID NOs: 63 and 64, respectively. The DNA and amino acid sequences of NAV-H45 are found in SEQ ID NOs: 65 and 66, respectively.

[0151]To further reduce the number of ORFs that would be tested as a vaccine candidate, gene products predicted by the in silico analysis to be localised in the cytoplasm or inner membrane of the spirochaete are abandoned. As a result, twenty one of the thirty three genes presented in Table 1 are further analysed. These include NAV-H58, NAV-H60, NAV-H62, NAV-H64, NAV-H66, NAV-H67, NAV-H69, NAV-H71, NAV-H73, NAV-H22, NAV-H23, NAV-H24, NAV-H30, NAV-H32, NAV-H33, NAV-H37, NAV-H40, NAV-H41, NAV-H43, NAV-H44, and NAV-H45.

[0152]Analysis of Gene Distribution Using Polymerase Chain Reaction (PCR)

[0153]One or two primer pairs which anneal to different regions of the target gene encoding region are designed and optimised for PCR detection. Individual primers are designed using Oligo Explorer 1.2 and primer sets with calculated melting temperatures of approximately 55-60° C. are selected. These primers sets are also selected to generate PCR products greater than 200 bp. A medium-stringency primer annealing temperature of 50° C. is selected for the distribution analysis PCR. The medium-stringency conditions would allow potential minor mismatched sequences (because of strain differences) occurring at the primer binding sites to not affect primer binding. Distribution analysis of the twenty one B. hyodysenteriae target genes are performed on 23 strains of B. hyodysenteriae, including two strains which have been shown to be avirulent. PCR analysis is performed in a 25 μl total volume using Taq DNA polymerase (Biotech International, Thurmont, Md.). The amplification mixture consists of 1×PCR buffer (containing 1.5 mM of MgCl₂), 1 U of Taq DNA polymerase, 0.2 mM of each dNTP (Amersham Pharmacia Biotech, Piscataway, N.J.), 0.5 μM of the primer pair, and 1 μl purified chromosomal template DNA. Cycling conditions involve an initial template denaturation step of 5 minutes at 94° C., follow by 35 cycles of denaturation at 94° C. for 30 seconds, annealing at 50° C. for 15 seconds, and primer extension at 68° C. for 4 minutes. The PCR products are subjected to electrophoresis in 1% (w/v) agarose gels in 1×TAE buffer (40 mM Tris-acetate, 1 mM EDTA), staining with a 1 μg/ml ethidium bromide solution and viewing over UV light.

[0154]The primers used for eighteen genes (out of twenty one) are indicated in Table 2. Of these eighteen genes, three of them (NAV-H23, NAV-H41 and NAV-H71) are present in 83% of the B. hyodysenteriae strains tested; three of them (NAV-H24, NAV-H30 and NAV-H73) are present in 87% of the strains tested, seven of them (NAV-H22, NAV-H32, NAV-H33, NAV-H37, NAV-H43, NAV-H64 and NAV-H69) are present in 91% of the strains tested, and three of them (NAV-H40, NAV-H44, and NAV-H45) are present in 100% of the strains tested. The remaining three genes are present in less than 80% of the B. hyodysenteriae strains tested. The poor distribution of these genes makes them less useful as a vaccine subunit. For this reason, further analysis of these genes has been abandoned.

TABLE-US-00002 TABLE 2 Gene Primer name Primer Sequence (5'-3') NAV-H22 H22-F4 AAACGTTTATATTTTATTTTATC (SEQ ID NO: 67) H22-R1308 AAACTTCCAAGTGATACC (SEQ ID NO: 68) NAV-H23 H23-F4 AAATATAAACCTACAAGCAG (SEQ ID NO: 69) H23-R2366 AATATTTCAGTTAATCTAAAATC (SEQ ID NO: 70) NAV-H24 H24-F19 ACTTTAATCTTTGTATTAATTTTG (SEQ ID NO: 71) H24-R729 TTGTTTTAATTTGATAATATCAG (SEQ ID NO: 72) NAV-H30 H30-F4 AAAAAAATTATTTTATTAATATTTATATT (SEQ ID NO: 73) H30-R969 TTCTCTTATAATCTTTACAGTTG (SEQ ID NO: 74) NAV-H32 H32-F4 CATATTTCTGGTGATTCTC (SEQ ID NO: 75) H32-R564 TTTTTTGATAAATAAGTTTTTTATTTG (SEQ ID NO: 76) NAV-H33 H33-F4 TTTAATACTCCTATATTATTAATTATTT (SEQ ID NO: 77) H33-R396 AAGGAGAATCACCAGAAA (SEQ ID NO: 78) NAV-H37 H37-F4 AATGATATTATTAAAGTGATAAA (SEQ ID NO: 79) H37-R825 AAAATCTAATATAACGGATT (SEQ ID NO: 80) NAV-H40 H40-F16 AAATATGCTTCCATTATAGG (SEQ ID NO: 81) H40-R1815 ACTTTTAGGAAGAAGTTTAAC (SEQ ID NO: 82) NAV-H41 H41-F19 TATATTTTCATTATATATTTATTAG (SEQ ID NO: 83) H41-R1067 CTAGGCATAGATTTTCCA (SEQ ID NO: 84) NAV-H43 H43-F46 TTTGCCATGTCGGAAATTGCAG (SEQ ID NO: 85) H43-R1236 TATTCTAGCACCGTCCATATC (SEQ ID NO: 86) NAV-H44 H44-F43 GTATGTTTATATGCTCAGGATAC (SEQ ID NO: 87) H44-R2931 AACAGCAGCACTATCTTGTAA (SEQ ID NO: 88) H44-F80 CAGCAGCAACAAATAATACTACTG (SEQ ID NO: 89) H44-R929 TGAATATAAACACCTTCTCTCAAAG (SEQ ID NO: 90) NAV-H45 H45-F52 AAAATGTCATTGGTAACTACTGTAAG (SEQ ID NO: 91) H45-R1595 CTTGATAATCTGCCTTTAAACATAC (SEQ ID NO: 92) NAV-H62 H62-F69 ATGTGAGGAAAAAACAGAAAG (SEQ ID NO: 93) H62-R866 TCATTACCAGAAAACCATACTC (SEQ ID NO: 94) NAV-H64 H64-F69 AGGAAATAAAGCTCCTGCTGCTTCAGC (SEQ ID NO: 95) H64-R253 GCATAGCAGCAACTTCAGAAGGTCCA (SEQ ID NO: 96) NAV-H66 H66-F114 CTTATTAATTGGTATAGGAAAACC (SEQ ID NO: 97) H66-R200 AATCTATGTTCTTGATTTATTAGCC (SEQ ID NO: 98) NAV-H69 H69-F546 AGAAGCTACTTTTGGACCTTGGCCTGT (SEQ ID NO: 99) H69-R662 ACACAGTCAACACCAAGAGC (SEQ ID NO: 100) NAV-H71 H71-F568 AAACAGCAGACTAGCTGGTG (SEQ ID NO: 101) H71-R773 TGACCATTACTTACACCGGATACCCCA (SEQ ID NO: 102) H71-F37 TTAATGACTATATCGCTTTCATACACTTTC (SEQ ID NO: 103) H71-R1241 TCAATTCTTCCAGACATAAAATCAGTAAG (SEQ ID NO: 104) NAV-H73 H73-F37 TATATAGAGTGGGTATCAGAAG (SEQ ID NO: 105) H73-R254 TCATAATGGTATTTACAAGATG (SEQ ID NO: 106)

[0155]pTrcHis Plasmid Extraction

[0156]Escherichia coli JM 109 clones harboring the pTrcHis plasmid (Invitrogen, Carlsbad, Calif.) are streaked out from glycerol stock storage onto Luria-Bertani (LB) agar plates supplemented with 100 mg/l ampicillin and incubated at 37° C. for 16 hours. A single colony is used to inoculate 10 ml of LB broth supplemented with 100 mg/l ampicillin, and the broth culture is incubated at 37° C. for 12 hours with shaking. The entire overnight culture is centrifuged at 5,000×g for 10 minutes, and the plasmid contained in the cells is extracted using the QIAprep Spin Miniprep Kit (Qiagen, Doncaster VIC). The pelleted cells are resuspended with 250 μl cell resuspension buffer P1 and then are lysed with the addition of 250 μl cell lysis buffer P2. The lysed cells are neutralized with 350 μl neutralization buffer N3, and the precipitated cell debris is pelleted by centrifugation at 20,000×g for 10 minutes. The supernatant is transferred to a spin column and centrifuged at 10,000×g for 1 minute. After discarding the flow-through, 500 μl wash buffer PE is applied to the column and centrifuged as before. The flow-through is discarded, and the column is dried by centrifugation at 20,000×g for 3 minutes. The plasmid DNA is eluted from the column with 100 μl elution buffer EB. The purified plasmid is quantified using a Dynaquant DNA fluorometer (Hoefer, San Francisco, Calif.), and the DNA concentration is adjusted to 100 μg/ml by dilution with TE buffer. The purified pTrcHis plasmid is stored at -20° C.

[0157]Vector Preparation

[0158]Two μg of the purified pTrcHis plasmid is digested at 37° C. for 1-4 hours in a total volume of 50 μl containing 5 U of two restriction enzymes in 100 mM Tris-HCl (pH 7.5), 50 mM NaCl, 10 mM MgCl₂, 1 mM DTT and 100 μg/ml BSA. The particular pair of restriction enzymes used depends on the sequence of the primers and the sequence of the ORF; the goal being to use primers that would not cut the ORFs. The restricted vector is verified by electrophoresing 1 μl of the digestion reaction through a 1% (w/v) agarose gel in 1×TAE buffer at 90V for 1 hour. The electrophoresed DNA is stained with 1 μg/ml ethidium bromide and is viewed over ultraviolet (UV) light.

[0159]Linearised pTrcHis vector is purified using the UltraClean PCR Clean-up Kit (Mo Bio Laboratories, Carlsbad, Calif.). Briefly, the restriction reaction (50 μl) is mixed with 250 μl SpinBind buffer B1, and the entire volume is added to a spin-column. After centrifugation at 8,000×g for 1 minute, the flow-through is discarded and 300 μl SpinClean buffer B2 is added to the column. The column is centrifuged as before, and the flow-through is discarded before drying the column at 20,000×g for 3 minutes. The purified vector is eluted from the column with 50 μl TE buffer. Purified linear vector is quantified using a fluorometer, and the DNA concentration is adjusted to 50 μg/ml by dilution with TE buffer. The purified restricted vector is stored at -20° C.

[0160]Primer Design for Insert Preparation

[0161]Primer pairs are designed to amplify as much of the coding region of the target gene as possible using genomic DNA as the starting point. All primers sequences include terminal restriction enzyme sites to enable cohesive-end ligation of the resultant amplicon into the linearised pTrcHis vector. The primers are tested using Amplify 1.2 (University of Wisconsin, Madison, Wis.) and the theoretical amplicon sequence is inserted into the appropriate position in the pTrcHis vector sequence. Deduced translation of the chimeric pTrcHis expression cassette is performed using Vector NTI version 6 (InforMax) to confirm that the gene inserts would be in the correct reading frame. Table 3 also provides the gene size, the protein size, the predicted molecular weight of the native protein in daltons and the predicted pI of the protein. It is noted that the histidine-fusion of the recombinant protein adds approximately 4 kDa to the native protein's predicted molecular weight.

TABLE-US-00003 TABLE 3 Gene size Protein size Predicted MW of Predicted Gene (bp) (aa) native protein (Da) pI NAV-H40 1815 605 97,733 9.4853 NAV-H41 1068 356 39,870 5.2168 NAV-H44 2940 980 113,722 5.1864 NAV-H62 1014 338 37642 4.3944 NAV-H64 1011 337 36468 4.4953 NAV-H66 264 88 10629 9.3027 NAV-H69 1080 360 41525 5.7123 NAV-H73 258 86 10527 9.5920

[0162]Amplification of the Gene Inserts

[0163]Using genomic DNA, all target gene inserts are amplified by PCR in a 100 μl total volume using Taq DNA polymerase (Biotech International) and Pfu DNA polymerase (Promega, Madison, Wis.). The amplification mixture consists of 1×PCR buffer (containing 1.5 mM of MgCl₂), 1 U of Taq DNA polymerase, 0.01 U Pfu DNA polymerase, 0.2 mM of each dNTP (Amersham Pharmacia Biotech), 0.5 μM of the appropriate primer pair and 1 μl of purified chromosomal DNA. The chromosomal DNA is prepared from the same B. hyodysenteriae strain used for genome sequencing. Cycling conditions involve an initial template denaturation step of 5 minutes at 94° C., followed by 35 cycles of denaturation at 94° C. for 30 seconds, annealing at 50° C. for 15 seconds, and primer extension at 68° C. for 4 minutes. The PCR products are subjected to electrophoresis in 1% (w/v) agarose gels in 1×TAE buffer, are stained with a 1 μg/ml ethidium bromide solution and are viewed over UV light. After verifying the presence of the correct size PCR product, the PCR reaction is purified using the UltraClean PCR Clean-up Kit (Mo Bio Laboratories, Carlsbad, Calif.). The PCR reaction (100 μl) is mixed with 500 μl SpinBind buffer B1, and the entire volume is added to a spin-column. After centrifugation at 8,000×g for 1 minute, the flow-through is discarded, and 300 μl SpinClean buffer B2 is added to the column. The column is centrifuged as before and the flow-through is discarded before drying the column at 20,000×g for 3 minutes. The purified vector is eluted from the column with 100 μl TE buffer.

[0164]Restriction Enzyme Digestion of the Gene Inserts

[0165]Thirty μl of the purified PCR product are digested in a 50 μl total volume with 1 U of each restriction enzyme compatible with the terminal restriction endonuclease recognition site determined by the cloning oligonucleotide primer. The restriction reaction consists of 100 mM Tris-HCl (pH 7.5), 50 mM NaCl, 10 mM MgCl₂, 1 mM DTT and 100 μg/ml BSA with 1 U of each restriction enzyme at 37° C. for 1-4 hours. The digested insert DNA are purified using the UltraClean PCR Clean-up Kit (see above). Purified digested insert DNA are quantified using the fluorometer, and the DNA concentration is adjusted to 20 μg/ml by dilution with TE buffer. The purified restricted insert DNA are used immediately for vector ligation.

[0166]Ligation of the Gene Inserts into the pTrcHis Vector

[0167]Ligation reactions are all performed in a total volume of 20 μl. One hundred ng of linearised pTrcHis is incubated with 20 ng of restricted insert at 16° C. for 16 hours in 30 mM Tris-HCl (pH 7.8), 10 mM MgCl₂, 10 mM DTT and 1 mM ATP containing I U of T4 DNA ligase (Promega). An identical ligation reaction containing no insert DNA is also included as a vector re-circularisation negative control. The appropriate restriction enzyme is used for each reaction.

[0168]Transformation of pTrcHis Ligations into E. Coli Cells

[0169]Competent E. coli JM109 (Promega) cells are thawed from -80° C. storage on ice and then 50 μl of the cells are transferred into ice-cold 1.5 ml microfuge tubes containing 5 μl of the overnight ligation reactions (equivalent to 25 ng of pTrcHis vector). The tubes are mixed by gently tapping the bottom of each tube on the bench and left on ice for 30 minutes. The cells are then heat-shocked by placing the tubes into a 42° C. water bath for 45 seconds before returning the tube to ice for 2 minutes. The transformed cells are recovered in 1 ml LB broth for 1 hour at 37° C. with gentle mixing. The recovered cells are harvested at 2,500×g for 5 minutes, and the cells are resuspended in 50 μl of fresh LB broth. The entire 50 μl of resuspended cells are spread evenly onto a LB agar plate containing 100 mg/l ampicillin using a sterile glass rod. Plates are incubated at 37° C. for 16 hours.

[0170]Detection of Recombinant pTrcHis Constructs in E. Coli by PCR

[0171]Twelve single transformant colonies for each construct are streaked onto fresh LB agar plates containing 100 mg/l ampicillin and incubated at 37° C. for 16 hours. A single colony from each transformation event is resuspended in 50 μl of TE buffer and is boiled for 1 minute. Two μl of boiled cells are used as template for PCR. The amplification mixture consists of 1×PCR buffer (containing 1.5 mM of MgCl₂), 1 U of Taq DNA polymerase, 0.2 mM of each dNTP, 0.5 μM of the pTrcHis-F primer (5'-CAATTTATCAGACAATCTGTGTG-3' SEQ ID NO: 107) and 0.5 μM of the pTrcHis-R primer (5'-TGCCTGGCAGTTCCCTACTCTCG-3' SEQ ID NO: 108). Cycling conditions involve an initial template denaturation step of 5 minutes at 94° C., followed by 35 cycles of denaturation at 94° C. for 30 seconds, annealing at 60° C. for 15 seconds, and a primer extension at 72° C. for 1 minute. The PCR products are subjected to electrophoresis in 1% (w/v) agarose gels in 1×TAE buffer, are stained with a 1 μg/ml ethidium bromide solution and are viewed over UV light. Cloning of the various inserts into the pTrcHis expression vector produces recombinant constructs of various sizes.

[0172]Pilot Expression of Recombinant His-Tagged Proteins

[0173]Five to ten isolated colonies of recombinant pTrcHis construct in E. coli JM109 are inoculated into 3 ml LB broth in a 5 ml tube containing 100 mg/l ampicillin and 1 mM IPTG and incubated at 37° C. for 16 hours with shaking. The cells are harvested by centrifugation at 5,000×g for 10 minutes at 4° C. The supernatant is discarded, and each pellet is resuspended with 10 μl Ni--NTA denaturing lysis buffer (100 mM NaH₂PO₄, 10 mM Tris-HCl, 8 M urea, pH 8.0). After vortexing the tube for 1 minute, the cellular debris is pelleted by centrifugation at 10,000×g for 10 minute at 4° C. The supernatant is transferred to a new tube and stored at -20° C. until analysis.

[0174]Sodium Dodecyl Sulfate Polyacrylamide Gel Electrophoresis (SDS-Page)

[0175]SDS-PAGE analysis of protein is performed using a discontinuous Tris-glycine buffer system. Thirty μl of protein sample are mixed with 10 μl of 4× sample treatment buffer (250 mM Tris-HCl (pH 6.0), 8% (w/v) SDS, 200 mM DTT, 40% (v/v) glycerol and 0.04% (w/v) bromophenol blue). Samples are boiled for 5 minutes immediately prior to loading 10 μl of the sample into wells in the gel. The gel comprises a stacking gel (125 mM Tris-HCl ph 6.8, 4% w/v acylamide, 0.15% w/v bis-acrylamide and 0.1% w/v SDS) and a separating gel (375 mM Tris-HCl ph 8.8, 12% w/v acylamide, 0.31% w/v bis-acrylamide and 0.1% w/v SDS). These gels are polymerised by the addition of 0.1% (v/v) TEMED and 0.05% (w/v) freshly prepared ammonium sulphate solution and cast into the mini-Protean dual slab cell (Bio-Rad, Hercules, Calif.). Samples are run at 150 V at room temperature (RT) until the bromophenol blue dye reaches the bottom of the gel. Pre-stained molecular weight standards are electrophoresed in parallel with the samples in order to allow molecular weight estimations. After electrophoresis, the gel is immediately stained using Coomassie Brilliant Blue G250 (Bio-Rad) or is subjected to electro-transfer onto nitrocellulose membrane for Western blotting.

[0176]Western Blot Analysis

[0177]Electrophoretic transfer of separated proteins from the SDS-PAGE gel to nitrocellulose membrane is performed using the Towbin transfer buffer system. After electrophoresis, the gel is equilibrated in transfer buffer (25 mM Tris, 192 mM glycine, 20% v/v methanol, pH 8.3) for 15 minutes. The proteins in the gel are electro-transferred to nitrocellulose membrane (Protran, Schleicher and Schuell BioScience, Inc., Keene, N. H.) using the mini-Protean transblot apparatus (Bio-Rad) at 30 V overnight at 4° C. The freshly transferred nitrocellulose membrane containing the separated proteins is blocked with 10 ml of tris-buffered saline (TBS) containing 5% (w/v) skim milk powder for 1 hour at room temperature. The membrane is washed with TBS containing 0.1% (v/v) Tween 20 (TBST) and then is incubated with 10 mL mouse anti-his antibody (diluted 5,000-fold with TBST) for 1 hour at room temperature. After washing three times for 5 minutes with TBST, the membrane is incubated with 10 mL goat anti-mouse IgG (whole molecule)-AP diluted 5,000-fold in TBST for 1 hour at RT. The membrane is developed using the Alkaline Phosphatase Substrate Kit (Bio-Rad). The development reaction is stopped by washing the membrane with distilled water. The membrane is then dried and scanned for presentation.

[0178]Verification of Reading Frame of the Recombinant pTrcHis Constructs by Direct Sequence Analysis

[0179]Two transformant clones for each construct which produced the correct sized PCR products are inoculated into 10 ml LB broth containing 100 mg/l ampicillin and incubated at 37° C. for 12 hours with shaking. The entire overnight cultures are centrifuged at 5,000×g for 10 minutes, and the plasmid contained in the cells are extracted using the QIAprep Spin Miniprep Kit as described previously. The purified plasmid is quantified using a fluorometer. Both purified plasmids are subjected to automated direct sequencing of the pTrcHis expression cassette using the pTrcHis-F and pTrcHis-R primers. Each sequencing reaction is performed in a 10 μl volume consisting of 200 ng of plasmid DNA, 2 pmol of primer, and 4 μl of the ABI PRISM® BigDye Terminator Cycle Sequencing Ready Reaction Mix (PE Applied Biosystems, Foster City, Calif.). Cycling conditions involve a 2 minute denaturing step at 96° C., followed by 25 cycles of denaturation at 96° C. for 10 seconds, and a combined primer annealing and extension step at 60° C. for 4 minutes. Residual dye terminators are removed from the sequencing products by precipitation with 95% (v/v) ethanol containing 85 mM sodium acetate (pH 5.2), 3 mM EDTA (pH 8), and vacuum dried. The plasmids are sequenced in duplicate using each primer. Sequencing products are analysed using an ABI 373A DNA Sequencer (PE Applied Biosystems). Nucleotide sequencing of the pTrcHis is performed to verify that the expression cassette is in the correct reading frame for each constructs.

[0180]Expression and Purification of Recombinant His-Tagged Proteins

[0181]A single colony of the recombinant pTrcHis construct in E. coli JM 109 is inoculated into 50 ml LB broth in a 250 ml conical flask containing 100 mg/l ampicillin and incubated at 37° C. for 16 hours with shaking. A 2 l conical flask containing 1 l of LB broth supplemented with 100 mg/l ampicillin is inoculated with 10 ml of the overnight culture and incubated at 37° C. until the optical density of the cells at 600 nm is 0.5 (approximately 3-4 hours). The culture is then induced by adding IPTG to a final concentration of 1 mM, and the cells are returned to 37° C. with shaking. After 5 hours of induction, the culture is transferred to 250 ml centrifuge bottles, and the bottles are centrifuged at 5,000×g for 20 minutes at 4° C. The supernatant is discarded, and each pellet is resuspended with 8 ml Ni--NTA denaturing lysis buffer (100 mM NaH₂PO₄, 10 mM Tris-HCl, 8 M urea, pH 8.0). The resuspended cells are stored at -20° C. overnight.

[0182]The cell suspension is removed from -20° C. storage and thawed on ice. The cell lysate is then sonicated on ice 3 times for 30 seconds with 1 minute incubation on ice between sonication rounds. The lysed cells are cleared by centrifugation at 20,000×g for 10 minutes at 4° C., and the supernatant is transferred to a 15 ml column containing a 0.5 ml bed volume of Ni--NTA agarose resin (Qiagen). The recombinant His₆-tagged protein is allowed to bind to the resin for 1 hour at 4° C. with end-over-end mixing. The resin is then washed with 30 ml of Ni--NTA denaturing wash buffer (100 mM NaH₂PO₄, 10 mM Tris-HCl, 8 M urea, pH 6.3) before elution with 12 ml of Ni--NTA denaturing elution buffer (100 mM NaH₂PO₄, 10 mM Tris-HCl, 8 M urea, pH 4.5). Four 3 ml fractions of the eluate are collected and stored at 4° C. Thirty μl of each eluate is treated with 10 μl of 4× sample treatment buffer and boiled for 5 minutes. The samples are subjected to SDS-PAGE and stained with Coomassie Brilliant Blue G250 (Bio-Rad). The stained gel is equilibrated in distilled water for 1 hour and dried between two sheets of cellulose overnight at RT.

[0183]Expression of the selected recombinant E. coli clones is performed in medium-scale to generate sufficient recombinant protein for vaccination of mice (see below).

[0184]Dialysis and Lyophilisation of the Purified Recombinant His-Tagged Protein

[0185]The eluted proteins are pooled and transferred into a hydrated dialysis tube (Spectrum Laboratories, Inc., Los Angeles, Calif.) with a molecular weight cut-off (MWCO) of 3,500 Da. A 200 μl aliquot of the pooled eluate is taken and quantified using a commercial Protein Assay (Bio-Rad). The proteins are dialysed against 21 of distilled water at 4° C. with stirring. The dialysis buffer is changed 8 times at 12-hourly intervals. The dialysed proteins are transferred from the dialysis tube into a 50 ml centrifuge tubes (40 ml maximum volume), and the tubes are placed at -80° C. overnight. Tubes are placed into a MAXI freeze-drier (Heto-Holten, Allerod, Denmark) and lyophilised to dryness. The lyophilised proteins are then re-hydrated with PBS to a calculated concentration of 2 mg/ml and stored at -20° C. Following dialysis and lyophilisation, stable recombinant antigen is successfully produced.

[0186]Eight of the eighteen genes are successfully cloned into the E. coli Expression System and recombinant protein can be expressed stabily from these clones.

[0187]Serology Using Purified Recombinant Protein

[0188]Twenty μg of purified recombinant protein is loaded into a 7 cm IEF well, electrophoresed through a 10% (w/v) SDS-PAGE gel, and electro-transferred to nitrocellulose membrane. The membrane is blocked with TBS-skim milk (5% w/v) and assembled into the multi-screen apparatus (Bio-Rad). The wells are incubated with 100 μl of diluted pig serum (100-fold) for 1 hour at room temperature. The pig serum is obtained from high health status pigs (n=3), experimentally challenged pigs showing clinical SD (n=5), naturally infected seroconverting pigs (n=5), and pigs recovered from natural infection (n=4). The membrane then is removed from the apparatus and washed three times with TBST (0.1% v/v) before incubating with 10 ml of goat anti-swine IgG (whole molecule)-AP (5,000-fold) for 1 hour at RT. The membrane is washed three times with TBST before color development using an Alkaline Phosphatase Substrate Kit (Bio-Rad). The membrane is washed with tap water when sufficient development has occurred, dried and scanned for presentation.

[0189]The reactivity of the pig serum obtained from animal of differing health status is shown in the table below. All proteins are recognised by 100% of the panel of serum thus indicating that the genes are expressed in vivo and that they are able to induce a systemic immune response following exposure to the spirochaete.

TABLE-US-00004 TABLE 4 Gene distribution and serologic reactivity of the eight successfully expressed B. hyodysenteriae vaccine candidates. Gene Distribution (%) Serology (%) NAV-H40 100 100% NAV-H41 83 100% NAV-H44 100 100% NAV-H62 96 100% NAV-H64 91 100% NAV-H66 96 100% NAV-H69 91 100% NAV-H73 87 100% The gene distribution was analysed by PCR using a panel of 23 different strains. Serology was performed using 19 serum samples from five different categories of disease.

[0190]Vaccination of Mice Using the Purified Recombinant his-Tagged Proteins

[0191]For each of the purified recombinant his-tagged proteins, ten mice are systemically and orally immunized to determine whether the recombinant protein would be immunogenic. The recombinant protein is emulsified with 30% (v/v) water in oil adjuvant and injected intramuscularly into the quadraceps muscle of ten mice (Balb/cJ: 5 weeks old males). All mice receive 100 μg of protein in a total volume of 100 Three weeks after the first vaccination, all mice receive a second intramuscular vaccination identical to the first vaccination. All mice are killed two weeks after the second vaccination. Sera are obtained from the heart at post-mortem and tested in Western blot analysis for antibodies against cellular extracts of B. hyodysenteriae.

[0192]Western Blot Analysis

[0193]Twenty μg of purified recombinant protein is loaded into a 7 cm IEF well, electrophoresed through a 10% (w/v) SDS-PAGE gel, and electro-transferred to nitrocellulose membrane. The membrane is blocked with TBS-skim milk (5% w/v) and assembled into the multi-screen apparatus (Bio-Rad). The wells are incubated with 100 μl of diluted mouse serum (100-fold) for 1 hour at room temperature. The membrane is removed from the apparatus and washed three times with TBST (0.1% v/v) before incubating with 10 ml of goat anti-mouse IgG (whole molecule)-AP (5,000-fold) for 1 hour at room temperature. The membrane is washed three times with TBST before color development using an Alkaline Phosphatase Substrate Kit (Bio-Rad). The membrane is washed with tap water when sufficient development has occurred, dried and scanned for presentation.

[0194]Western blot analysis shows a significant increase in antibody reactivity in the mice towards the recombinant vaccine antigens following vaccination. All the mice recognise recombinant proteins which are similar in molecular weight to that of the coomassie blue stained purified recombinant proteins. These experiments provide evidence that the recombinant proteins are immunogenic when used to vaccinate mice and that the vaccination protocol employed can induce specific circulating antibody titres against the antigen. The results indicate that the recombinant proteins can be useful in an effective vaccine for animal species from being colonised by B. hyodysenteriae.

[0195]Vaccination of Pigs Using the Purified Recombinant his-Tagged Proteins

[0196]For each of the purified recombinant his-tagged proteins, ten sero-negative pigs are injected intramuscularly with 1 mg of the particular antigen in 1 ml vaccine volume. The antigen is emulsified with an equal volume of a water-in-oil adjuvant. The pigs are vaccinated at three weeks of age and again at six weeks of age. A second group of ten sero-negative pigs is used as negative controls and are left unvaccinated. All pigs are challenged with 100 ml of an active B. hyodysenteriae culture (˜10⁹ cells/ml) at eight weeks of age, and the pigs are observed for clinical signed of swine dysentery during the experiment (up to six weeks post-challenge) and at post-morten examination.

[0197]Diagnostic Kit

[0198]Serum is obtained from pigs in a piggery with known infection of B. hyodysenteriae, from pigs known to have not been infected with B. hyodysenteriae, and from pigs in piggery with unknown infection with B. hyodysenteriae. Twenty μg of purified recombinant protein is loaded into a 7 cm IEF well, electrophoresed through a 10% (w/v) SDS-PAGE gel, and electro-transferred to nitrocellulose membrane. The membrane is blocked with TBS-skim milk (5% w/v) and assembled into the multi-screen apparatus (Bio-Rad). The wells are incubated with 100 μl of diluted pig serum (100-fold) for 1 hour at room temperature. The membrane then is removed from the apparatus and washed three times with TBST (0.1% v/v) before incubating with 10 ml of goat anti-swine IgG (whole molecule)-AP (5,000-fold) for 1 hour at room temperature. The membrane is washed three times with TBST before color development using an Alkaline Phosphatase Substrate Kit (Bio-Rad). The membrane is washed with tap water when sufficient development has occurred, dried and scanned for presentation. One can determine if pigs are infected with B. hyodysenteriae by comparing the results to the positive and negative control.

[0199]While this invention has been described with a reference to specific embodiments, it will be obvious to those of ordinary skill in the art that variations in these methods and compositions may be used and that it is intended that the invention may be practiced otherwise than as specifically described herein. Accordingly this invention includes all modifications encompassed within the spirit and scope of the invention as defined by the claims.

Sequence CWU 1

941600DNABrachyspira hyodysenteriae 1atgggtatta gtttagatcc tcaaatcaga tactatacag gaatagattt gctcaatcaa 60gtaagattaa tagttaaata tggtatgaat caaactaaaa ctgcatcaga aacatataca 120gcttcttctt ttggttttga tttcagatta tatttcggag ctatggttgg aaatgttact 180cttaatcctt tcatcaaagt aacttatgat acttctttag gtgctaaagg taaatctact 240ggaagttatg aagtattatc agacagtgtt gttattccta caacaactgc agctgattta 300cttgatagag aaacttatac tttatctata cttcctactt tagctttaga ggcaagcagt 360gatgtagttt ctctttattt agagcctgga ttaggttatt ctatttatga tgatggtaga 420aaaggttcta aacttaatca ttctttagct tggtcagctt atgcagaact ttatattact 480cctgttgaag atttagaatg gtattttgag atggatgtaa ataatgaggg aggagttcct 540attagctttg catctactac aggtattact tggtacttgc cttctttcgg agcagcagag 6002200PRTBrachyspira hyodysenteriae 2Met Gly Ile Ser Leu Asp Pro Gln Ile Arg Tyr Tyr Thr Gly Ile Asp1 5 10 15Leu Leu Asn Gln Val Arg Leu Ile Val Lys Tyr Gly Met Asn Gln Thr 20 25 30Lys Thr Ala Ser Glu Thr Tyr Thr Ala Ser Ser Phe Gly Phe Asp Phe 35 40 45Arg Leu Tyr Phe Gly Ala Met Val Gly Asn Val Thr Leu Asn Pro Phe 50 55 60Ile Lys Val Thr Tyr Asp Thr Ser Leu Gly Ala Lys Gly Lys Ser Thr65 70 75 80Gly Ser Tyr Glu Val Leu Ser Asp Ser Val Val Ile Pro Thr Thr Thr 85 90 95Ala Ala Asp Leu Leu Asp Arg Glu Thr Tyr Thr Leu Ser Ile Leu Pro 100 105 110Thr Leu Ala Leu Glu Ala Ser Ser Asp Val Val Ser Leu Tyr Leu Glu 115 120 125Pro Gly Leu Gly Tyr Ser Ile Tyr Asp Asp Gly Arg Lys Gly Ser Lys 130 135 140Leu Asn His Ser Leu Ala Trp Ser Ala Tyr Ala Glu Leu Tyr Ile Thr145 150 155 160Pro Val Glu Asp Leu Glu Trp Tyr Phe Glu Met Asp Val Asn Asn Glu 165 170 175Gly Gly Val Pro Ile Ser Phe Ala Ser Thr Thr Gly Ile Thr Trp Tyr 180 185 190Leu Pro Ser Phe Gly Ala Ala Glu 195 2003717DNABrachyspira hyodysenteriae 3atgaaactac aaataggaat tttaactata gtaaatttaa tagcatttat accactatta 60tatatgtttg atatatttgg tgttgttaat tattatactt taatgcgtaa taaaatagca 120cctaatgtac cgggtttttt aacaagattc actcaaaaac ctagagtaga agatatgact 180cttttggcta gagaagatct taataaaatg agagaatcat tcaatttaag agaaaaagat 240ttgcaggctc aggaatcttt aatagcaagc agagcaatag aattgaacac tcaatctgaa 300ttgatagaac aagacagaca aaatctttta aatgcttggt ctaattatca agctactatg 360gatgaatctt ctcagtatca attagtatta actgaccttg ctaataaaat caatagtatg 420cctcctcaaa gctctgtggc attacttaat cagttagctg ctaatggttc tgatgactta 480atcatagatg tattattaga aatggactct atagctgctg ctgaaggaag aaacagtact 540acttcttacc ttttaagctt aatggatccg aatgttgctg ctagaatatt agaaaaatat 600gaagcaagat ctaatcctgg aaataataca gtaccttctt cacctaatga cttccctaat 660tatatgcctg ataataatga cgctatgtta aatgaaggca taatggatat gggagca 7174239PRTBrachyspira hyodysenteriae 4Met Lys Leu Gln Ile Gly Ile Leu Thr Ile Val Asn Leu Ile Ala Phe1 5 10 15Ile Pro Leu Leu Tyr Met Phe Asp Ile Phe Gly Val Val Asn Tyr Tyr 20 25 30Thr Leu Met Arg Asn Lys Ile Ala Pro Asn Val Pro Gly Phe Leu Thr 35 40 45Arg Phe Thr Gln Lys Pro Arg Val Glu Asp Met Thr Leu Leu Ala Arg 50 55 60Glu Asp Leu Asn Lys Met Arg Glu Ser Phe Asn Leu Arg Glu Lys Asp65 70 75 80Leu Gln Ala Gln Glu Ser Leu Ile Ala Ser Arg Ala Ile Glu Leu Asn 85 90 95Thr Gln Ser Glu Leu Ile Glu Gln Asp Arg Gln Asn Leu Leu Asn Ala 100 105 110Trp Ser Asn Tyr Gln Ala Thr Met Asp Glu Ser Ser Gln Tyr Gln Leu 115 120 125Val Leu Thr Asp Leu Ala Asn Lys Ile Asn Ser Met Pro Pro Gln Ser 130 135 140Ser Val Ala Leu Leu Asn Gln Leu Ala Ala Asn Gly Ser Asp Asp Leu145 150 155 160Ile Ile Asp Val Leu Leu Glu Met Asp Ser Ile Ala Ala Ala Glu Gly 165 170 175Arg Asn Ser Thr Thr Ser Tyr Leu Leu Ser Leu Met Asp Pro Asn Val 180 185 190Ala Ala Arg Ile Leu Glu Lys Tyr Glu Ala Arg Ser Asn Pro Gly Asn 195 200 205Asn Thr Val Pro Ser Ser Pro Asn Asp Phe Pro Asn Tyr Met Pro Asp 210 215 220Asn Asn Asp Ala Met Leu Asn Glu Gly Ile Met Asp Met Gly Ala225 230 23554671DNABrachyspira hyodysenteriae 5atgtcagatg ttgatgtatt gttaaaagat gaagttaaag ctctatcaag cagattatca 60gattttgaag agagaataaa agatgatata gtaagagatt tagatgaata ttctatagaa 120ttaaataatc ttactgataa tgtaggaaaa ttaaattcaa gaatagatga tgttaaatca 180caaatagaag atagcattaa taaatcttct gaattggaaa ctcttatttc tagtgaaaaa 240gaagaattag ataataaact atctactatt aaggatgagt tagtatctaa gtctgaaaat 300gatgatacta tagagaaatt attcactcaa gaaaaagaaa aattaaatga acttttcaat 360caaataaaag atgataataa agagttcaga tatagattag agaaacgtgt tgcttatttt 420gaggacactt ggtcagacag cagcagattg aaaaatattt tctcaactga tataagagaa 480caattggata atatcagaaa tgataatgag attaaatttg aaaattctat aaattatttg 540aaagataaag tagaatctat agataatgat atatctaatt ggaaagaaaa cactgttgat 600gaattagtta aacaattagg tgaagctaga gaaagcatat ctaattattt gaatgattca 660gagataaaag gaaaagaatt agtagataat cttttatcta aaatagatga aaaagaaaat 720agcatgtatc agactttaga agataaagag aagaacatgt atcaaacttt agatgataaa 780gaaaagagta tgtatcaaac tctagatgat agagcaagaa acatgtataa atctttagat 840gaaaaagaaa agtctatata tgaaatctta gataataaag tacaggaaat agaaagcaga 900ttatctctta ttgattctaa attgaatgat gatataactt ctaacttaga aaatctatat 960gatatgctaa atgaagcagt agctaaatat gatgaagaga taaaaaatat tgagcattat 1020agattagatg agaataataa gattttagat gatattgata atgtaggaaa agaaataaga 1080tcttcttatg aaaattattc taagcttata gaagaggttt ataataattc tcttaattca 1140ttaaaagatt attctaattc tattaaagat gagatagaaa aatcaagaga agaaacagaa 1200gaaagacact tgtctagtga gagagaatat attgatgagt atttgaaagg atattcagaa 1260aaattagaat ctcaagtatc tgataagata aatatattga atgatgctaa aactgattta 1320gataatatgt taaaatcttc ttttgatgat ttagaagcaa gatttaatga atctatgact 1380aagtttgaag aatcttcaaa taacagagta ttcaaaactt tacaagatat agagaaaaaa 1440gctgatgatg taatttatgg aaacaattat atctacaaga tagaagataa agtaaaagac 1500ttctatggta aaatagatac taaactactt cattttgctg atagatatga tactttagag 1560aaaaagatat atgatttaga gagcaatcaa aattatatat tcagactcga agataaaatt 1620agagatttga atgaaaagct agatgataga ataacaaatg ttaatgaaag atatgataat 1680ttaagaaaat cttttgatga taaatttgtt catatagaaa gtgctgtatt gaataatgag 1740caagttcaga aattgagaga tgatttcatt attttcaaag atgatgtatt gaaagctaat 1800agagataata taccagagct attcaataaa gaaaaagaaa aatttgaaga gttatttaat 1860tcgttcgcta atgatataat atctaaatta gatacttcta atgctaatat agaagagttc 1920aaaaatacta tgtatgatga aaagaattct atattagaaa atatggaatc atttagatat 1980gagttagatg aattaaagaa caatgattct attgaagctt tagaagctga gaaagctaga 2040ttagaagata ctttcaattc tttcagagaa gaatttgaaa gactttatga tttggaaagt 2100gaagtttata atttgaaaag taatttagat ggtgttgatt ctaatttaag aagcgatgtt 2160gataaattat ttgatgaagt ttctgagttt aaatatgctt tagaagaaaa aatagatatt 2220ttagaagata atacagtttc tagagattta tttgatgatg acagagaaaa attatattct 2280ttatatgatg aacttgaagc aggaaataaa gactttaaag atttaatgga taagagaata 2340agttattttg aagatacttg gtctgatcct aataaggctt taaaacttta tgaaaatgct 2400ttaacacctg aagtagataa tttgaaatct gaaatacttt ctaatgtaaa agatcaagta 2460aatgaaatag aaaagaactt atctgtttgg aaagatgata atttgtctct tcttttagag 2520caattaaaag aggctaaaga aaatatcgat aactttatag aaagttctaa agacaagaag 2580aatggtatta ttgccaaaat gatatcttct ataaaagagg aaatattagg caaagaaagt 2640gagataaata ctcgtcttga agaaaaactt tcttctgtta atgaaagaat tgctgattta 2700gaaaatagat taacttctga tgttagcaga tttaataata tgatatctga agcagttgat 2760aaatatgaag atgagcttaa gaatatagaa tcttatagat tagaagaaaa tgaatctata 2820atgagaaatt tggaagatat tggaagaaat ataatttcaa attatgataa ttattctaaa 2880atgctagatt ctgtttatga gaataataaa aatgctttag atgagtattc aaacagctta 2940agaatagaaa tagaaaaagc tagagttgat actaataaag gttatataga tgaatatttg 3000agtgaatatt cttctaaagt agaggctgat ataaaagaaa gactagaaga gcttgagaaa 3060aataaatata atttagatgt tatgataaat gattcattta ataatttgaa tcaaagtatt 3120aataatgcag tatctaaaat gatagaagat tctgattcta aattaagaga tgttatagat 3180aatttagaag ttcagataaa tgatcttata gctaataaag aagaagaaat agttagcaga 3240atatcagctt atgaaacaga tctaaaaaat gaacagtatt cttcacttga agatattaaa 3300aatgagttat taggtcttta taatgagttt aaagagaatg ttaattatga taatttgaaa 3360gatatatctg aaaaattaga tagtatagaa acttcattgt tagaagttaa tactcaatta 3420gaaaataaag ctaaagatat ttctgataga atagatttag aaaaagaaga attatatgct 3480tctgttaata aattgtcttc agaatttgaa gatttcaaat caaatataga tgacagattc 3540aaaactcaag taagcgattt tgtatctaat aatgagcata tattatcact ctttggtgaa 3600tatagtgaga aaatttcttc tgtaactaat atattggaag acatagaaaa tgttaaagta 3660tctttaattg aagaaataaa taaagtaaaa gaagaaatag ataataaata ttcaagtctt 3720actaaagatt ttgataaatc aatagatgat ataaaagatg ctgtattaga taagaataat 3780atacttcaat attatataaa tgaaaaagaa ttgttatgga aagagattga tgctttgaaa 3840gctacttttg cttcaatgaa agataatata ttgaatgcta atgaagcagt tgctaaatat 3900gctccttcta tcattgatag tgagaaagtt cgtatacagt ctgttataga cgatgtattt 3960gaaactttaa gtgctaaaat aaataataat gaagacagta tttctaattt agaatcttct 4020ttctctgaat ataaatctct tatatcagat gctatagacg gatttaaaga tgaaatttct 4080tctataagaa atagtaataa ctatgatgat ttaattgaag agagaaatag attggaagaa 4140tcatttaatt ctcttaaaga tgatttctca aaaatagaag atttggaaaa agatttacat 4200cttgttaaag ctaagttaaa aggtgatgac agcagcttga ttgatgaagt tatgagactt 4260tctgatgagc ttgaaatctt gaaagataat gtatcaaata tgaataatac agataataat 4320gtaaatgata ataatgatat tgatgctatt tatgaagatt tcaaacagtt aaatgaaagt 4380ttagaatcat tcaaagaaac tgttattcct caattatcta cttttagtaa attggaagat 4440aagatatcag aaaatagaga ggaaatctat aaatatatca atagtataat gtattcttta 4500cctgaagctt atataagcag agaagagata tctaatttag aaaataaatt atatgatata 4560tttaataact tcaatgacgg catagtatct ataaagaatg atttagtttt ctatatagag 4620aaagacacta aagatttcaa agatagaata gaaaagaaga atagagttct t 467161557PRTBrachyspira hyodysenteriae 6Met Ser Asp Val Asp Val Leu Leu Lys Asp Glu Val Lys Ala Leu Ser1 5 10 15Ser Arg Leu Ser Asp Phe Glu Glu Arg Ile Lys Asp Asp Ile Val Arg 20 25 30Asp Leu Asp Glu Tyr Ser Ile Glu Leu Asn Asn Leu Thr Asp Asn Val 35 40 45Gly Lys Leu Asn Ser Arg Ile Asp Asp Val Lys Ser Gln Ile Glu Asp 50 55 60Ser Ile Asn Lys Ser Ser Glu Leu Glu Thr Leu Ile Ser Ser Glu Lys65 70 75 80Glu Glu Leu Asp Asn Lys Leu Ser Thr Ile Lys Asp Glu Leu Val Ser 85 90 95Lys Ser Glu Asn Asp Asp Thr Ile Glu Lys Leu Phe Thr Gln Glu Lys 100 105 110Glu Lys Leu Asn Glu Leu Phe Asn Gln Ile Lys Asp Asp Asn Lys Glu 115 120 125Phe Arg Tyr Arg Leu Glu Lys Arg Val Ala Tyr Phe Glu Asp Thr Trp 130 135 140Ser Asp Ser Ser Arg Leu Lys Asn Ile Phe Ser Thr Asp Ile Arg Glu145 150 155 160Gln Leu Asp Asn Ile Arg Asn Asp Asn Glu Ile Lys Phe Glu Asn Ser 165 170 175Ile Asn Tyr Leu Lys Asp Lys Val Glu Ser Ile Asp Asn Asp Ile Ser 180 185 190Asn Trp Lys Glu Asn Thr Val Asp Glu Leu Val Lys Gln Leu Gly Glu 195 200 205Ala Arg Glu Ser Ile Ser Asn Tyr Leu Asn Asp Ser Glu Ile Lys Gly 210 215 220Lys Glu Leu Val Asp Asn Leu Leu Ser Lys Ile Asp Glu Lys Glu Asn225 230 235 240Ser Met Tyr Gln Thr Leu Glu Asp Lys Glu Lys Asn Met Tyr Gln Thr 245 250 255Leu Asp Asp Lys Glu Lys Ser Met Tyr Gln Thr Leu Asp Asp Arg Ala 260 265 270Arg Asn Met Tyr Lys Ser Leu Asp Glu Lys Glu Lys Ser Ile Tyr Glu 275 280 285Ile Leu Asp Asn Lys Val Gln Glu Ile Glu Ser Arg Leu Ser Leu Ile 290 295 300Asp Ser Lys Leu Asn Asp Asp Ile Thr Ser Asn Leu Glu Asn Leu Tyr305 310 315 320Asp Met Leu Asn Glu Ala Val Ala Lys Tyr Asp Glu Glu Ile Lys Asn 325 330 335Ile Glu His Tyr Arg Leu Asp Glu Asn Asn Lys Ile Leu Asp Asp Ile 340 345 350Asp Asn Val Gly Lys Glu Ile Arg Ser Ser Tyr Glu Asn Tyr Ser Lys 355 360 365Leu Ile Glu Glu Val Tyr Asn Asn Ser Leu Asn Ser Leu Lys Asp Tyr 370 375 380Ser Asn Ser Ile Lys Asp Glu Ile Glu Lys Ser Arg Glu Glu Thr Glu385 390 395 400Glu Arg His Leu Ser Ser Glu Arg Glu Tyr Ile Asp Glu Tyr Leu Lys 405 410 415Gly Tyr Ser Glu Lys Leu Glu Ser Gln Val Ser Asp Lys Ile Asn Ile 420 425 430Leu Asn Asp Ala Lys Thr Asp Leu Asp Asn Met Leu Lys Ser Ser Phe 435 440 445Asp Asp Leu Glu Ala Arg Phe Asn Glu Ser Met Thr Lys Phe Glu Glu 450 455 460Ser Ser Asn Asn Arg Val Phe Lys Thr Leu Gln Asp Ile Glu Lys Lys465 470 475 480Ala Asp Asp Val Ile Tyr Gly Asn Asn Tyr Ile Tyr Lys Ile Glu Asp 485 490 495Lys Val Lys Asp Phe Tyr Gly Lys Ile Asp Thr Lys Leu Leu His Phe 500 505 510Ala Asp Arg Tyr Asp Thr Leu Glu Lys Lys Ile Tyr Asp Leu Glu Ser 515 520 525Asn Gln Asn Tyr Ile Phe Arg Leu Glu Asp Lys Ile Arg Asp Leu Asn 530 535 540Glu Lys Leu Asp Asp Arg Ile Thr Asn Val Asn Glu Arg Tyr Asp Asn545 550 555 560Leu Arg Lys Ser Phe Asp Asp Lys Phe Val His Ile Glu Ser Ala Val 565 570 575Leu Asn Asn Glu Gln Val Gln Lys Leu Arg Asp Asp Phe Ile Ile Phe 580 585 590Lys Asp Asp Val Leu Lys Ala Asn Arg Asp Asn Ile Pro Glu Leu Phe 595 600 605Asn Lys Glu Lys Glu Lys Phe Glu Glu Leu Phe Asn Ser Phe Ala Asn 610 615 620Asp Ile Ile Ser Lys Leu Asp Thr Ser Asn Ala Asn Ile Glu Glu Phe625 630 635 640Lys Asn Thr Met Tyr Asp Glu Lys Asn Ser Ile Leu Glu Asn Met Glu 645 650 655Ser Phe Arg Tyr Glu Leu Asp Glu Leu Lys Asn Asn Asp Ser Ile Glu 660 665 670Ala Leu Glu Ala Glu Lys Ala Arg Leu Glu Asp Thr Phe Asn Ser Phe 675 680 685Arg Glu Glu Phe Glu Arg Leu Tyr Asp Leu Glu Ser Glu Val Tyr Asn 690 695 700Leu Lys Ser Asn Leu Asp Gly Val Asp Ser Asn Leu Arg Ser Asp Val705 710 715 720Asp Lys Leu Phe Asp Glu Val Ser Glu Phe Lys Tyr Ala Leu Glu Glu 725 730 735Lys Ile Asp Ile Leu Glu Asp Asn Thr Val Ser Arg Asp Leu Phe Asp 740 745 750Asp Asp Arg Glu Lys Leu Tyr Ser Leu Tyr Asp Glu Leu Glu Ala Gly 755 760 765Asn Lys Asp Phe Lys Asp Leu Met Asp Lys Arg Ile Ser Tyr Phe Glu 770 775 780Asp Thr Trp Ser Asp Pro Asn Lys Ala Leu Lys Leu Tyr Glu Asn Ala785 790 795 800Leu Thr Pro Glu Val Asp Asn Leu Lys Ser Glu Ile Leu Ser Asn Val 805 810 815Lys Asp Gln Val Asn Glu Ile Glu Lys Asn Leu Ser Val Trp Lys Asp 820 825 830Asp Asn Leu Ser Leu Leu Leu Glu Gln Leu Lys Glu Ala Lys Glu Asn 835 840 845Ile Asp Asn Phe Ile Glu Ser Ser Lys Asp Lys Lys Asn Gly Ile Ile 850 855 860Ala Lys Met Ile Ser Ser Ile Lys Glu Glu Ile Leu Gly Lys Glu Ser865 870 875 880Glu Ile Asn Thr Arg Leu Glu Glu Lys Leu Ser Ser Val Asn Glu Arg 885 890 895Ile Ala Asp Leu Glu Asn Arg Leu Thr Ser Asp Val Ser Arg Phe Asn 900 905 910Asn Met Ile Ser Glu Ala Val Asp Lys Tyr Glu Asp Glu Leu Lys Asn 915 920 925Ile Glu Ser Tyr Arg Leu Glu Glu Asn Glu Ser Ile Met Arg Asn Leu 930 935 940Glu Asp Ile Gly Arg Asn Ile Ile Ser Asn Tyr Asp Asn Tyr Ser Lys945 950 955 960Met Leu Asp Ser Val Tyr Glu Asn Asn Lys Asn Ala Leu Asp Glu Tyr 965 970 975Ser Asn Ser Leu Arg Ile Glu Ile Glu Lys Ala Arg Val Asp Thr Asn 980 985 990Lys Gly Tyr Ile Asp Glu Tyr Leu Ser Glu Tyr Ser Ser Lys Val Glu 995 1000 1005Ala Asp Ile Lys Glu Arg Leu Glu Glu Leu Glu Lys Asn Lys Tyr Asn 1010 1015

1020Leu Asp Val Met Ile Asn Asp Ser Phe Asn Asn Leu Asn Gln Ser Ile1025 1030 1035 1040Asn Asn Ala Val Ser Lys Met Ile Glu Asp Ser Asp Ser Lys Leu Arg 1045 1050 1055Asp Val Ile Asp Asn Leu Glu Val Gln Ile Asn Asp Leu Ile Ala Asn 1060 1065 1070Lys Glu Glu Glu Ile Val Ser Arg Ile Ser Ala Tyr Glu Thr Asp Leu 1075 1080 1085Lys Asn Glu Gln Tyr Ser Ser Leu Glu Asp Ile Lys Asn Glu Leu Leu 1090 1095 1100Gly Leu Tyr Asn Glu Phe Lys Glu Asn Val Asn Tyr Asp Asn Leu Lys1105 1110 1115 1120Asp Ile Ser Glu Lys Leu Asp Ser Ile Glu Thr Ser Leu Leu Glu Val 1125 1130 1135Asn Thr Gln Leu Glu Asn Lys Ala Lys Asp Ile Ser Asp Arg Ile Asp 1140 1145 1150Leu Glu Lys Glu Glu Leu Tyr Ala Ser Val Asn Lys Leu Ser Ser Glu 1155 1160 1165Phe Glu Asp Phe Lys Ser Asn Ile Asp Asp Arg Phe Lys Thr Gln Val 1170 1175 1180Ser Asp Phe Val Ser Asn Asn Glu His Ile Leu Ser Leu Phe Gly Glu1185 1190 1195 1200Tyr Ser Glu Lys Ile Ser Ser Val Thr Asn Ile Leu Glu Asp Ile Glu 1205 1210 1215Asn Val Lys Val Ser Leu Ile Glu Glu Ile Asn Lys Val Lys Glu Glu 1220 1225 1230Ile Asp Asn Lys Tyr Ser Ser Leu Thr Lys Asp Phe Asp Lys Ser Ile 1235 1240 1245Asp Asp Ile Lys Asp Ala Val Leu Asp Lys Asn Asn Ile Leu Gln Tyr 1250 1255 1260Tyr Ile Asn Glu Lys Glu Leu Leu Trp Lys Glu Ile Asp Ala Leu Lys1265 1270 1275 1280Ala Thr Phe Ala Ser Met Lys Asp Asn Ile Leu Asn Ala Asn Glu Ala 1285 1290 1295Val Ala Lys Tyr Ala Pro Ser Ile Ile Asp Ser Glu Lys Val Arg Ile 1300 1305 1310Gln Ser Val Ile Asp Asp Val Phe Glu Thr Leu Ser Ala Lys Ile Asn 1315 1320 1325Asn Asn Glu Asp Ser Ile Ser Asn Leu Glu Ser Ser Phe Ser Glu Tyr 1330 1335 1340Lys Ser Leu Ile Ser Asp Ala Ile Asp Gly Phe Lys Asp Glu Ile Ser1345 1350 1355 1360Ser Ile Arg Asn Ser Asn Asn Tyr Asp Asp Leu Ile Glu Glu Arg Asn 1365 1370 1375Arg Leu Glu Glu Ser Phe Asn Ser Leu Lys Asp Asp Phe Ser Lys Ile 1380 1385 1390Glu Asp Leu Glu Lys Asp Leu His Leu Val Lys Ala Lys Leu Lys Gly 1395 1400 1405Asp Asp Ser Ser Leu Ile Asp Glu Val Met Arg Leu Ser Asp Glu Leu 1410 1415 1420Glu Ile Leu Lys Asp Asn Val Ser Asn Met Asn Asn Thr Asp Asn Asn1425 1430 1435 1440Val Asn Asp Asn Asn Asp Ile Asp Ala Ile Tyr Glu Asp Phe Lys Gln 1445 1450 1455Leu Asn Glu Ser Leu Glu Ser Phe Lys Glu Thr Val Ile Pro Gln Leu 1460 1465 1470Ser Thr Phe Ser Lys Leu Glu Asp Lys Ile Ser Glu Asn Arg Glu Glu 1475 1480 1485Ile Tyr Lys Tyr Ile Asn Ser Ile Met Tyr Ser Leu Pro Glu Ala Tyr 1490 1495 1500Ile Ser Arg Glu Glu Ile Ser Asn Leu Glu Asn Lys Leu Tyr Asp Ile1505 1510 1515 1520Phe Asn Asn Phe Asn Asp Gly Ile Val Ser Ile Lys Asn Asp Leu Val 1525 1530 1535Phe Tyr Ile Glu Lys Asp Thr Lys Asp Phe Lys Asp Arg Ile Glu Lys 1540 1545 1550Lys Asn Arg Val Leu 155572256DNABrachyspira hyodysenteriae 7atgaaaaata ctattttaaa aatttttaat aaaagagttt taatatttac actttgtttt 60gaaatcattg ttattgtaat gacatccatg ttgggtgctc aggatatatc attacaaaag 120aatattatat caaaaaataa aatcaattat ggtacggcat tagaacttca taatagagga 180aaatatttag aggcttataa tcaatttaca aatatcatga atacagaaga tgatatgatc 240attagagatt atactatata ttacggagct aaaagtgctt tgctaactaa tatgtataat 300gaagcaatag atttatatgc cttactaatg aaagaatatc cgcgttcatc attatatcct 360tatgcagagc aatataaggc tctttctgag ttttatagag atgattatcc tataagcaat 420ttttttaatg gtaaatctca aaaatggatt aaagaatttg ttggaataag agctttaaga 480gatactgatg ataccaataa ggctagaatg atagcttatg aacttttaaa cagattcgga 540ttaagcgaag ctgctatata ttataataat aatttccctg aagatatttc atcttttcca 600aataatttaa aatttaaaac agcaaccata ctttatgaag caggatatag aaaagcatct 660ttaaagcatt ttcagtattt atatgataat aatgcttata aagcaagttc tacatattat 720atggctagaa ttaaacagaa gtctggagac agaagagatg ctgcggcttt attcgatgag 780tatttatcaa atcttaacaa taaatctcat agaagattag gtctttacta ttctgcagat 840aattataata gattaaaaaa ttatgaaaaa tcaatagaac tttataatac ttttttgaaa 900gaatatccta gagatgatta tgttcctaga atatataata gttttgttac tttgagtttg 960aatagaaata atttagttca ggcaaaaact tatcttacta atgtaatgaa gagatttcct 1020aaaagcagat atacagagct tgcattaaaa tcatatttaa gaaaggcatt caaattaaat 1080aataaaacag aaacttattt tgctactaag gctttagaag caagatatcc tagtttcaga 1140catgattttg cattatcttg gaatatgtgg actgctgaag agtttggaga tattgaaaaa 1200agagatgaat atttaatgaa aacacttctt acaagtaaaa gccattattt tataaaaggt 1260gctttgagtc ttgccaataa tgaaatgata gctaatgttc agcttagcaa tacttattat 1320ttaaatgaag ctaaaagata ttatgctgat tctaatttta ctaaatctat gcagatgctt 1380aataagatac aatttttaaa ttatattgct acaggtaaag aagataatat aacaagagag 1440gctagggcat tggctaaaaa tattcttatg cataatagat ttgtaaaaga tttatacgct 1500aatagaagcg aggatgattt atttaatgaa ttatcacttc agactagaag agaagttaat 1560aaagcaataa tattatacta ttatggcgat tatgataatg catatactga attcgataaa 1620atatttaaaa agacacaggt aacatatcct ttattttatt ttgctgaaaa aatatttaaa 1680gattcaggaa atacaaaaag gcttatacaa gtatcagcaa atataggaaa atattttgga 1740tatccttaca gtgataatgt tgatttgctt cctgatgagt ttagaaagag agtttatcct 1800agatattttg atgaatatgt tgtacctgaa gctaaatatt ataaaataga gcctgctttt 1860gtatatgcta taatgcgtga agaaagttta tttgatccta aagctaaatc ttgggttgga 1920gctatgggac ttatgcagtt aatgcctaca acagcagcag ctgaaaataa aaaggcaaga 1980tatagatata atcctttaga tttaacagat cctaagcaga atattaattt aggagtttct 2040catttaggct ggttattcag cagtcaaaag gctagcaatt atatattagt agcagcaagt 2100tataatgcag gttcaggacg cggaagaaga tggaaagcag agtatggtac taataatatg 2160tatcgtacag gaagattcat tgatattgaa gaaactgaat attatgtaga gagagttatt 2220aaaagctatg aatattacag caagtattat aaggac 22568752PRTBrachyspira hyodysenteriae 8Met Lys Asn Thr Ile Leu Lys Ile Phe Asn Lys Arg Val Leu Ile Phe1 5 10 15Thr Leu Cys Phe Glu Ile Ile Val Ile Val Met Thr Ser Met Leu Gly 20 25 30Ala Gln Asp Ile Ser Leu Gln Lys Asn Ile Ile Ser Lys Asn Lys Ile 35 40 45Asn Tyr Gly Thr Ala Leu Glu Leu His Asn Arg Gly Lys Tyr Leu Glu 50 55 60Ala Tyr Asn Gln Phe Thr Asn Ile Met Asn Thr Glu Asp Asp Met Ile65 70 75 80Ile Arg Asp Tyr Thr Ile Tyr Tyr Gly Ala Lys Ser Ala Leu Leu Thr 85 90 95Asn Met Tyr Asn Glu Ala Ile Asp Leu Tyr Ala Leu Leu Met Lys Glu 100 105 110Tyr Pro Arg Ser Ser Leu Tyr Pro Tyr Ala Glu Gln Tyr Lys Ala Leu 115 120 125Ser Glu Phe Tyr Arg Asp Asp Tyr Pro Ile Ser Asn Phe Phe Asn Gly 130 135 140Lys Ser Gln Lys Trp Ile Lys Glu Phe Val Gly Ile Arg Ala Leu Arg145 150 155 160Asp Thr Asp Asp Thr Asn Lys Ala Arg Met Ile Ala Tyr Glu Leu Leu 165 170 175Asn Arg Phe Gly Leu Ser Glu Ala Ala Ile Tyr Tyr Asn Asn Asn Phe 180 185 190Pro Glu Asp Ile Ser Ser Phe Pro Asn Asn Leu Lys Phe Lys Thr Ala 195 200 205Thr Ile Leu Tyr Glu Ala Gly Tyr Arg Lys Ala Ser Leu Lys His Phe 210 215 220Gln Tyr Leu Tyr Asp Asn Asn Ala Tyr Lys Ala Ser Ser Thr Tyr Tyr225 230 235 240Met Ala Arg Ile Lys Gln Lys Ser Gly Asp Arg Arg Asp Ala Ala Ala 245 250 255Leu Phe Asp Glu Tyr Leu Ser Asn Leu Asn Asn Lys Ser His Arg Arg 260 265 270Leu Gly Leu Tyr Tyr Ser Ala Asp Asn Tyr Asn Arg Leu Lys Asn Tyr 275 280 285Glu Lys Ser Ile Glu Leu Tyr Asn Thr Phe Leu Lys Glu Tyr Pro Arg 290 295 300Asp Asp Tyr Val Pro Arg Ile Tyr Asn Ser Phe Val Thr Leu Ser Leu305 310 315 320Asn Arg Asn Asn Leu Val Gln Ala Lys Thr Tyr Leu Thr Asn Val Met 325 330 335Lys Arg Phe Pro Lys Ser Arg Tyr Thr Glu Leu Ala Leu Lys Ser Tyr 340 345 350Leu Arg Lys Ala Phe Lys Leu Asn Asn Lys Thr Glu Thr Tyr Phe Ala 355 360 365Thr Lys Ala Leu Glu Ala Arg Tyr Pro Ser Phe Arg His Asp Phe Ala 370 375 380Leu Ser Trp Asn Met Trp Thr Ala Glu Glu Phe Gly Asp Ile Glu Lys385 390 395 400Arg Asp Glu Tyr Leu Met Lys Thr Leu Leu Thr Ser Lys Ser His Tyr 405 410 415Phe Ile Lys Gly Ala Leu Ser Leu Ala Asn Asn Glu Met Ile Ala Asn 420 425 430Val Gln Leu Ser Asn Thr Tyr Tyr Leu Asn Glu Ala Lys Arg Tyr Tyr 435 440 445Ala Asp Ser Asn Phe Thr Lys Ser Met Gln Met Leu Asn Lys Ile Gln 450 455 460Phe Leu Asn Tyr Ile Ala Thr Gly Lys Glu Asp Asn Ile Thr Arg Glu465 470 475 480Ala Arg Ala Leu Ala Lys Asn Ile Leu Met His Asn Arg Phe Val Lys 485 490 495Asp Leu Tyr Ala Asn Arg Ser Glu Asp Asp Leu Phe Asn Glu Leu Ser 500 505 510Leu Gln Thr Arg Arg Glu Val Asn Lys Ala Ile Ile Leu Tyr Tyr Tyr 515 520 525Gly Asp Tyr Asp Asn Ala Tyr Thr Glu Phe Asp Lys Ile Phe Lys Lys 530 535 540Thr Gln Val Thr Tyr Pro Leu Phe Tyr Phe Ala Glu Lys Ile Phe Lys545 550 555 560Asp Ser Gly Asn Thr Lys Arg Leu Ile Gln Val Ser Ala Asn Ile Gly 565 570 575Lys Tyr Phe Gly Tyr Pro Tyr Ser Asp Asn Val Asp Leu Leu Pro Asp 580 585 590Glu Phe Arg Lys Arg Val Tyr Pro Arg Tyr Phe Asp Glu Tyr Val Val 595 600 605Pro Glu Ala Lys Tyr Tyr Lys Ile Glu Pro Ala Phe Val Tyr Ala Ile 610 615 620Met Arg Glu Glu Ser Leu Phe Asp Pro Lys Ala Lys Ser Trp Val Gly625 630 635 640Ala Met Gly Leu Met Gln Leu Met Pro Thr Thr Ala Ala Ala Glu Asn 645 650 655Lys Lys Ala Arg Tyr Arg Tyr Asn Pro Leu Asp Leu Thr Asp Pro Lys 660 665 670Gln Asn Ile Asn Leu Gly Val Ser His Leu Gly Trp Leu Phe Ser Ser 675 680 685Gln Lys Ala Ser Asn Tyr Ile Leu Val Ala Ala Ser Tyr Asn Ala Gly 690 695 700Ser Gly Arg Gly Arg Arg Trp Lys Ala Glu Tyr Gly Thr Asn Asn Met705 710 715 720Tyr Arg Thr Gly Arg Phe Ile Asp Ile Glu Glu Thr Glu Tyr Tyr Val 725 730 735Glu Arg Val Ile Lys Ser Tyr Glu Tyr Tyr Ser Lys Tyr Tyr Lys Asp 740 745 7509723DNABrachyspira hyodysenteriae 9atggaaacta gattgcttta caactttgaa acattagacg aatggcaacc aatatcaaat 60gccagccgct ttatgtttag aggtgataga acaaatgaaa atggtgttgt aatgaaatat 120cctaatatga gattgttcgc tacaaaacca tatggtatgg gtaaccaaag ttataattca 180actaattcat tatcagtaag tgtttctttt ttcagaaaat cttataactt ctttgattta 240gttccaacag tacaaaaaat cataccaggt aaagctcaaa cttttgatgt ttgggtatgg 300ggtggtaatt atgactatac tatggaaatg atatttgaag attatcgtgg ttatacttat 360acattacctt taggatctat aagatatata ggttggagaa atatgagtac agcagtgcca 420tctttcattc ctcaagaaga gccttatgtt cctagagcta aaggtttaag atttatgaat 480ttccgtttct ggtcatcacc agaggaaaga gcagataact ttgtagtttt attggattac 540ttccaaacag taacagatac attcagagaa gcttatgacg gatctgatat tgaaactaca 600ttaggtcagg aagttggcgg aagatcttct gaacaatata cagaaggcgg agctaaagta 660gtaggtgaag acggcggtaa cgctggagct gctactacag aacagccaca agaagcgcaa 720caa 72310241PRTBrachyspira hyodysenteriae 10Met Glu Thr Arg Leu Leu Tyr Asn Phe Glu Thr Leu Asp Glu Trp Gln1 5 10 15Pro Ile Ser Asn Ala Ser Arg Phe Met Phe Arg Gly Asp Arg Thr Asn 20 25 30Glu Asn Gly Val Val Met Lys Tyr Pro Asn Met Arg Leu Phe Ala Thr 35 40 45Lys Pro Tyr Gly Met Gly Asn Gln Ser Tyr Asn Ser Thr Asn Ser Leu 50 55 60Ser Val Ser Val Ser Phe Phe Arg Lys Ser Tyr Asn Phe Phe Asp Leu65 70 75 80Val Pro Thr Val Gln Lys Ile Ile Pro Gly Lys Ala Gln Thr Phe Asp 85 90 95Val Trp Val Trp Gly Gly Asn Tyr Asp Tyr Thr Met Glu Met Ile Phe 100 105 110Glu Asp Tyr Arg Gly Tyr Thr Tyr Thr Leu Pro Leu Gly Ser Ile Arg 115 120 125Tyr Ile Gly Trp Arg Asn Met Ser Thr Ala Val Pro Ser Phe Ile Pro 130 135 140Gln Glu Glu Pro Tyr Val Pro Arg Ala Lys Gly Leu Arg Phe Met Asn145 150 155 160Phe Arg Phe Trp Ser Ser Pro Glu Glu Arg Ala Asp Asn Phe Val Val 165 170 175Leu Leu Asp Tyr Phe Gln Thr Val Thr Asp Thr Phe Arg Glu Ala Tyr 180 185 190Asp Gly Ser Asp Ile Glu Thr Thr Leu Gly Gln Glu Val Gly Gly Arg 195 200 205Ser Ser Glu Gln Tyr Thr Glu Gly Gly Ala Lys Val Val Gly Glu Asp 210 215 220Gly Gly Asn Ala Gly Ala Ala Thr Thr Glu Gln Pro Gln Glu Ala Gln225 230 235 240Gln113129DNABrachyspira hyodysenteriae 11atgattgaag aagaaagaag acaggttgct gaaatgtttg aaagcataca aaatgattct 60atagatactg atttgagata tcttacagat tcattcagag atgatatcat aaaagtattt 120gaagaatcta atgatgagtt cagaaaacgt gtagaagcta gaatagttca ttttgaagat 180gcttatgctt cacctgatag aataaaagaa ttctataaag atgctatact ttctgaagtg 240gacagcttga gaagtgatgc agaacagata cttatagatt taaatgataa ggtagaaaat 300gcaaaagaac agatagaagt attagaaaat gatagagtaa aagacataat caataaaata 360gatgaagcag aaaatgatat taattcttta ataaatacta taaaagctaa tattaaagaa 420caagaaaatg agcttagaat gttgagccaa tctcagaaac atatatctca ggaagtagag 480actgttcgca gagagagaga agctcttatg gatatggtta aaaactctga tataaatata 540agaaacaagc ttgacagttt aacaagtgct gtatcagaag ctgcagagat tgcttcatct 600aagatagctg aaaaagaagc agcattcagc agtaaagtta aagaagctga agaatatatt 660aattcattgt ctgatagaat tacattagaa aataacagtg ctttagataa agctagagaa 720gatattaata atttagttgc ttctttcaat gaatcagtta taaaagagac taatgatttg 780gcacctcata taactaatac agttcagaat ttcattaata atgaaatgaa aaaatttgat 840aaattctcag atgttagaag tgctatagaa ggcattgaga atgatattaa taacaagata 900actgaagcat tcaataatat gaacaaagaa cttgaagata atattgttga atttagaaag 960aaaatagata catatcagga agagtttatc agtgaattaa agatgtctgt aaatgtagag 1020ggtgaaaaag ctgttgatga aattaagtct ttacataatg atgaagttgc taaattaaaa 1080gagatgtatt taactactga aaaattctat acagatagac aagagaaaaa ccatgaagac 1140ttctcaaaat tatttgaaga aacttataaa gactataatg aaaaaataga atcattatat 1200gctcaattag atgatactaa acttcaaata agtacttctg ttgaagatgt tgttgctgat 1260ttgaagcagg ctttaagcat aaaagatgag ttcttaactt cagttgaaaa taataaagaa 1320aaacttgaag ctgttgaaga gcaaatgaat aatttacaga atgaatttgc tccttcagta 1380gaaaaattga aagacataat agaagaaaag gcattagaat tacaagagaa aatcaatgaa 1440tactctcaag atatagaact tcaaggagat aagttcaatt ctagattgga agagttatct 1500aataatgcta aatctactat agaagataag gtaactgaat ttgattctat aatagaaaat 1560atttctaata aaatggatac tttattagaa gaaaagaatt cagagttcga tgcattaaaa 1620gcacattatg aaggactttc agaatcattg acagcattga aagatactat atcagaagca 1680gttaatgaaa gaatagaaga agcaaatagc attatagagg aaaatgttca gactatagaa 1740gaatcagcta atgaaaaata tgaaaaatac atagcaagac ttaattctaa tttagaacaa 1800acattgtctc ttttaatgaa cgatgctaaa gaacatatac agaaagctaa agatgaaata 1860attaaagctc atactgataa tttagatgag tatgatcaga gaattacaaa tatgaaagat 1920attgtttcag ctttagaaga agatataact aaatattctt ctgagataga tgcaagactt 1980gaaagtatta atttaagcta tgatgaaaaa acaaatgtta tacttaaaga ttttgaaaat 2040agaactgatg atttgaaatt gaaattaaat gatgcatctg aatctattga caaaatgctt 2100gatttaaaaa ctaatgatat ttctttagag tatgaggcta tgaaatcaaa aatagatgat 2160atagctaaag atatagaaaa atacatgaat actgttaaag tatttgataa tgctaaagaa 2220atggcagatt ctataagaga tgacgtttct aagttgaatg ctttggttga ggatactaaa 2280gctacaacaa ttgaaatgaa taagactatg tccgaatttg atagcttaaa gaaaatgcat 2340caggaaatat taggatatgc agaaagtctt aaaaaggaaa aagacagctt gaaagatact 2400caggaaaaag taaatatgtt aatggaaatg tctggtgaaa ttcaagagag attcgttaat 2460atagcagaaa ataatgctat gatagagcat gctgaggaag gaatacaggt tgttatagat 2520atagcatctc aaatagaaaa

taaactttca ttcattaagg ataaggaaga gtatgcagat 2580gatatattac agcaaataag aaaagctgaa gtagaaaccg aaactatttt agaaagagta 2640gatagtataa aagaagctat ggttgaagtt gaagatacta gaaagaactt tatggataag 2700atttattctt tagaaagaga tatggctaaa atagataaga atgataaaaa agttcagttg 2760tttatttcta aattagaaga gataaatgat ataatagatg ccatacagga tcaaagagaa 2820aatcttgttc gtatgaagaa tcagtatgat gattatgata agaacatagt taagaatttg 2880gaaagagctg aatattttgt aagatattta gagactttac tagataatgc tgataaatat 2940atgtctgata aaggttctaa gacttctaaa aaaggaacag ctgctaaaat agatagtaag 3000aaagaagagt ttataattag aatgtataaa gaaggttgga aaccagatga gatagttaaa 3060aatagttcat attcaagaga tgaagttgaa agaactataa aagcatggaa agataagcaa 3120tccagagga 3129121043PRTBrachyspira hyodysenteriae 12Met Ile Glu Glu Glu Arg Arg Gln Val Ala Glu Met Phe Glu Ser Ile1 5 10 15Gln Asn Asp Ser Ile Asp Thr Asp Leu Arg Tyr Leu Thr Asp Ser Phe 20 25 30Arg Asp Asp Ile Ile Lys Val Phe Glu Glu Ser Asn Asp Glu Phe Arg 35 40 45Lys Arg Val Glu Ala Arg Ile Val His Phe Glu Asp Ala Tyr Ala Ser 50 55 60Pro Asp Arg Ile Lys Glu Phe Tyr Lys Asp Ala Ile Leu Ser Glu Val65 70 75 80Asp Ser Leu Arg Ser Asp Ala Glu Gln Ile Leu Ile Asp Leu Asn Asp 85 90 95Lys Val Glu Asn Ala Lys Glu Gln Ile Glu Val Leu Glu Asn Asp Arg 100 105 110Val Lys Asp Ile Ile Asn Lys Ile Asp Glu Ala Glu Asn Asp Ile Asn 115 120 125Ser Leu Ile Asn Thr Ile Lys Ala Asn Ile Lys Glu Gln Glu Asn Glu 130 135 140Leu Arg Met Leu Ser Gln Ser Gln Lys His Ile Ser Gln Glu Val Glu145 150 155 160Thr Val Arg Arg Glu Arg Glu Ala Leu Met Asp Met Val Lys Asn Ser 165 170 175Asp Ile Asn Ile Arg Asn Lys Leu Asp Ser Leu Thr Ser Ala Val Ser 180 185 190Glu Ala Ala Glu Ile Ala Ser Ser Lys Ile Ala Glu Lys Glu Ala Ala 195 200 205Phe Ser Ser Lys Val Lys Glu Ala Glu Glu Tyr Ile Asn Ser Leu Ser 210 215 220Asp Arg Ile Thr Leu Glu Asn Asn Ser Ala Leu Asp Lys Ala Arg Glu225 230 235 240Asp Ile Asn Asn Leu Val Ala Ser Phe Asn Glu Ser Val Ile Lys Glu 245 250 255Thr Asn Asp Leu Ala Pro His Ile Thr Asn Thr Val Gln Asn Phe Ile 260 265 270Asn Asn Glu Met Lys Lys Phe Asp Lys Phe Ser Asp Val Arg Ser Ala 275 280 285Ile Glu Gly Ile Glu Asn Asp Ile Asn Asn Lys Ile Thr Glu Ala Phe 290 295 300Asn Asn Met Asn Lys Glu Leu Glu Asp Asn Ile Val Glu Phe Arg Lys305 310 315 320Lys Ile Asp Thr Tyr Gln Glu Glu Phe Ile Ser Glu Leu Lys Met Ser 325 330 335Val Asn Val Glu Gly Glu Lys Ala Val Asp Glu Ile Lys Ser Leu His 340 345 350Asn Asp Glu Val Ala Lys Leu Lys Glu Met Tyr Leu Thr Thr Glu Lys 355 360 365Phe Tyr Thr Asp Arg Gln Glu Lys Asn His Glu Asp Phe Ser Lys Leu 370 375 380Phe Glu Glu Thr Tyr Lys Asp Tyr Asn Glu Lys Ile Glu Ser Leu Tyr385 390 395 400Ala Gln Leu Asp Asp Thr Lys Leu Gln Ile Ser Thr Ser Val Glu Asp 405 410 415Val Val Ala Asp Leu Lys Gln Ala Leu Ser Ile Lys Asp Glu Phe Leu 420 425 430Thr Ser Val Glu Asn Asn Lys Glu Lys Leu Glu Ala Val Glu Glu Gln 435 440 445Met Asn Asn Leu Gln Asn Glu Phe Ala Pro Ser Val Glu Lys Leu Lys 450 455 460Asp Ile Ile Glu Glu Lys Ala Leu Glu Leu Gln Glu Lys Ile Asn Glu465 470 475 480Tyr Ser Gln Asp Ile Glu Leu Gln Gly Asp Lys Phe Asn Ser Arg Leu 485 490 495Glu Glu Leu Ser Asn Asn Ala Lys Ser Thr Ile Glu Asp Lys Val Thr 500 505 510Glu Phe Asp Ser Ile Ile Glu Asn Ile Ser Asn Lys Met Asp Thr Leu 515 520 525Leu Glu Glu Lys Asn Ser Glu Phe Asp Ala Leu Lys Ala His Tyr Glu 530 535 540Gly Leu Ser Glu Ser Leu Thr Ala Leu Lys Asp Thr Ile Ser Glu Ala545 550 555 560Val Asn Glu Arg Ile Glu Glu Ala Asn Ser Ile Ile Glu Glu Asn Val 565 570 575Gln Thr Ile Glu Glu Ser Ala Asn Glu Lys Tyr Glu Lys Tyr Ile Ala 580 585 590Arg Leu Asn Ser Asn Leu Glu Gln Thr Leu Ser Leu Leu Met Asn Asp 595 600 605Ala Lys Glu His Ile Gln Lys Ala Lys Asp Glu Ile Ile Lys Ala His 610 615 620Thr Asp Asn Leu Asp Glu Tyr Asp Gln Arg Ile Thr Asn Met Lys Asp625 630 635 640Ile Val Ser Ala Leu Glu Glu Asp Ile Thr Lys Tyr Ser Ser Glu Ile 645 650 655Asp Ala Arg Leu Glu Ser Ile Asn Leu Ser Tyr Asp Glu Lys Thr Asn 660 665 670Val Ile Leu Lys Asp Phe Glu Asn Arg Thr Asp Asp Leu Lys Leu Lys 675 680 685Leu Asn Asp Ala Ser Glu Ser Ile Asp Lys Met Leu Asp Leu Lys Thr 690 695 700Asn Asp Ile Ser Leu Glu Tyr Glu Ala Met Lys Ser Lys Ile Asp Asp705 710 715 720Ile Ala Lys Asp Ile Glu Lys Tyr Met Asn Thr Val Lys Val Phe Asp 725 730 735Asn Ala Lys Glu Met Ala Asp Ser Ile Arg Asp Asp Val Ser Lys Leu 740 745 750Asn Ala Leu Val Glu Asp Thr Lys Ala Thr Thr Ile Glu Met Asn Lys 755 760 765Thr Met Ser Glu Phe Asp Ser Leu Lys Lys Met His Gln Glu Ile Leu 770 775 780Gly Tyr Ala Glu Ser Leu Lys Lys Glu Lys Asp Ser Leu Lys Asp Thr785 790 795 800Gln Glu Lys Val Asn Met Leu Met Glu Met Ser Gly Glu Ile Gln Glu 805 810 815Arg Phe Val Asn Ile Ala Glu Asn Asn Ala Met Ile Glu His Ala Glu 820 825 830Glu Gly Ile Gln Val Val Ile Asp Ile Ala Ser Gln Ile Glu Asn Lys 835 840 845Leu Ser Phe Ile Lys Asp Lys Glu Glu Tyr Ala Asp Asp Ile Leu Gln 850 855 860Gln Ile Arg Lys Ala Glu Val Glu Thr Glu Thr Ile Leu Glu Arg Val865 870 875 880Asp Ser Ile Lys Glu Ala Met Val Glu Val Glu Asp Thr Arg Lys Asn 885 890 895Phe Met Asp Lys Ile Tyr Ser Leu Glu Arg Asp Met Ala Lys Ile Asp 900 905 910Lys Asn Asp Lys Lys Val Gln Leu Phe Ile Ser Lys Leu Glu Glu Ile 915 920 925Asn Asp Ile Ile Asp Ala Ile Gln Asp Gln Arg Glu Asn Leu Val Arg 930 935 940Met Lys Asn Gln Tyr Asp Asp Tyr Asp Lys Asn Ile Val Lys Asn Leu945 950 955 960Glu Arg Ala Glu Tyr Phe Val Arg Tyr Leu Glu Thr Leu Leu Asp Asn 965 970 975Ala Asp Lys Tyr Met Ser Asp Lys Gly Ser Lys Thr Ser Lys Lys Gly 980 985 990Thr Ala Ala Lys Ile Asp Ser Lys Lys Glu Glu Phe Ile Ile Arg Met 995 1000 1005Tyr Lys Glu Gly Trp Lys Pro Asp Glu Ile Val Lys Asn Ser Ser Tyr 1010 1015 1020Ser Arg Asp Glu Val Glu Arg Thr Ile Lys Ala Trp Lys Asp Lys Gln1025 1030 1035 1040Ser Arg Gly13729DNABrachyspira hyodysenteriae 13atgataaaaa aaattttaac tttaatcttt gtattaattt tggcagcttc atgttctact 60aatgataaac atgttgtagt attagctttt agtaaacagc ttcatgctgt actttataat 120gataatagtc agtctacaaa aacagcatca aaaacatata tacaaaaaga tgatattaca 180actgtagcag atcctataaa agaaaaaaaa gaatatacaa atactcaagc acaagtaagt 240aaaaaagcag aagaaaaaaa agaagaactt acaaataacg atgctttaga agaagaaaaa 300cctcaagtta taaagcaaac tgaggttata cagaaagatg ataatgagat tcttcttact 360gcaaatataa tatcttttga ttttgattct tatgaattaa aaaatgaata taatgaaggg 420atagatgaaa tttgcaaata tttaaataat aatcgagata ttaatctaat aatagaagga 480catagcgaca gtatagggga ctcaaattat aatatatatt tatctgaaaa cagagcaaaa 540gcgatatttg ataaattagt agataaagga atagataaag atagacttag atatatagga 600tatggctcta ctcattcatc tgagtataat gataaagaca gaaaatgcca atttgttata 660ataaataatt cagatgaaga gcaggaatac aaaaaagaaa acgaaactga tattatcaaa 720ttaaaacaa 72914243PRTBrachyspira hyodysenteriae 14Met Ile Lys Lys Ile Leu Thr Leu Ile Phe Val Leu Ile Leu Ala Ala1 5 10 15Ser Cys Ser Thr Asn Asp Lys His Val Val Val Leu Ala Phe Ser Lys 20 25 30Gln Leu His Ala Val Leu Tyr Asn Asp Asn Ser Gln Ser Thr Lys Thr 35 40 45Ala Ser Lys Thr Tyr Ile Gln Lys Asp Asp Ile Thr Thr Val Ala Asp 50 55 60Pro Ile Lys Glu Lys Lys Glu Tyr Thr Asn Thr Gln Ala Gln Val Ser65 70 75 80Lys Lys Ala Glu Glu Lys Lys Glu Glu Leu Thr Asn Asn Asp Ala Leu 85 90 95Glu Glu Glu Lys Pro Gln Val Ile Lys Gln Thr Glu Val Ile Gln Lys 100 105 110Asp Asp Asn Glu Ile Leu Leu Thr Ala Asn Ile Ile Ser Phe Asp Phe 115 120 125Asp Ser Tyr Glu Leu Lys Asn Glu Tyr Asn Glu Gly Ile Asp Glu Ile 130 135 140Cys Lys Tyr Leu Asn Asn Asn Arg Asp Ile Asn Leu Ile Ile Glu Gly145 150 155 160His Ser Asp Ser Ile Gly Asp Ser Asn Tyr Asn Ile Tyr Leu Ser Glu 165 170 175Asn Arg Ala Lys Ala Ile Phe Asp Lys Leu Val Asp Lys Gly Ile Asp 180 185 190Lys Asp Arg Leu Arg Tyr Ile Gly Tyr Gly Ser Thr His Ser Ser Glu 195 200 205Tyr Asn Asp Lys Asp Arg Lys Cys Gln Phe Val Ile Ile Asn Asn Ser 210 215 220Asp Glu Glu Gln Glu Tyr Lys Lys Glu Asn Glu Thr Asp Ile Ile Lys225 230 235 240Leu Lys Gln152475DNABrachyspira hyodysenteriae 15atgaaattga ataataaagt tttatataaa ttcccaatat taatactgtt tataatatta 60ttatcatgtt ctaatagtca ggaagaaata gagcaaaaag aaatagacag aggcggagca 120ttaatagata aaataatata tgaagtaaga acagatatga caatagctat taaagatgtg 180gcagacggca gagcagattt aatggcaagc ggaatagacg gaagtacata tttatcatta 240ggcgaaagtg atttagagaa acttgatact tatgcagtac cttcaggttc atggtcatta 300ttgtttaatc ccgtaccaaa taaagctcca tacacagtta caacaagaga cggaaaaact 360cattttaatc ctctagctat aaaagaagta agatttgcta tgaacttctt aattgataga 420aaaaagcttg ttgatgaaat tttaagaggg gcaggacagc cttcatttac acaagcaaca 480ccggggcagc cgggtactta tagatataat cttatacctt caaaaatggg tatgacagaa 540aacggtaatc aggaaaaagc tcttaatgat ataaataaag ctatggaaaa agctgctaat 600ttaccagaga atagaggaaa attagtaaaa gaaaatggat ggtggaaata taatggagaa 660gtagtaacta ttaaatttgt tataagagtt gatgatccta caggaagact tccagctggt 720aatgcaatat ctgatttaat agaaaaaaca ggaataaaag ttgagaaatt attgtatgac 780agaaataaat ctactcaagt tgtatacggt tcagacccaa aagattatga atggaatatt 840ataacagagg cttggggagc aggtgctact cgtgcttggt gggatgttac attaagacag 900atgtatgtaa gggaaggcaa ttatatgcct ggtgctaatg tatctgagtt ttggaattat 960gataataaag aagcttcaag aataagcgac aagaattcaa atggctggtt tttgactgcc 1020gatgaatatt ggaatggtaa tatgcgtttg caggagattg gacttgaaga tgctgtcaga 1080atatatttaa attctcagac tcagtttttt gtagcgaata aagaaagatt caatagaaga 1140atgctttacg gagtaggtga cggggttaat gattggtcta taagaagtgc tgatataaaa 1200ccaaatagaa atggtgaaaa agtattaaga gttcttcagc attctgccca aggttcatta 1260tttataagtc cttgggatcc tgtaggagta ggaggatttt ctgatgccta ttctgctata 1320atgataggac cttgttctga tgcaggtgct acatttgaat cgccttccac tgctaagaca 1380gaattcatac ttggtgaagc tgacaccaac agtttagaaa taggagtgag agcaggaaat 1440aatggaatac ctgttggtac tgttaatgtt cctcaaaatg caataatgta taatccttat 1500actcagaaat gggaagaggg tttaacagtt aaagttaatg ataaaggcga attagtttac 1560acaaaatcgg ataatcttac tgcttatgtg aaatgtgatt ttaagcctag aagttttaaa 1620tggcatcatg gcatagattc atctttggtt gatttgatgt atggaagcgt attcattgct 1680aatataataa caaagactaa tgaaaacgat aaatattatg attctgctat ggctggaaga 1740tatctttctg ctatggacgg agctgtagga agcattataa atgaggacgg aagttttact 1800ttatacggaa attattattg gcctatggat atggacagac aaattgctgt tgctgctgta 1860agtcctaaaa taggcaatcc taatagaaat actgttattc ctttcgagat aaatgaagct 1920ataatgaaaa ttgttcttga aggctctaaa tctggaaatg tttatactat ttcacaggat 1980cagtctttaa cttccataga tgttaaaaat cctacatgtg tatcagatat aaaagaaaaa 2040ttaatagaaa tgcgtgattc tcagtatata cctgctggaa tagaagattt tataactaaa 2100gaagatgcag taaagagata tcaagctgcc attgatttta tagataaata cggacatgct 2160tatatatcaa atggtccttt ctttatttca agaatagatt caaaggcaaa ttatatagaa 2220ttaacagctt ttaaagatta tagctatact gctgattatt ggatagatag attatctacc 2280aaaatgagca gaatagaaga tattgatatg cctgctatag caaacagaaa caatgatatg 2340aatatagata tttatgtttc ttcatataat tatcctgaca atgcattaga aatgccagat 2400cctaatacaa cagtaaaagt attacttcaa ttacaaatgg agggcgaaaa agaatataat 2460gcagttttta gaaaa 247516825PRTBrachyspira hyodysenteriae 16Met Lys Leu Asn Asn Lys Val Leu Tyr Lys Phe Pro Ile Leu Ile Leu1 5 10 15Phe Ile Ile Leu Leu Ser Cys Ser Asn Ser Gln Glu Glu Ile Glu Gln 20 25 30Lys Glu Ile Asp Arg Gly Gly Ala Leu Ile Asp Lys Ile Ile Tyr Glu 35 40 45Val Arg Thr Asp Met Thr Ile Ala Ile Lys Asp Val Ala Asp Gly Arg 50 55 60Ala Asp Leu Met Ala Ser Gly Ile Asp Gly Ser Thr Tyr Leu Ser Leu65 70 75 80Gly Glu Ser Asp Leu Glu Lys Leu Asp Thr Tyr Ala Val Pro Ser Gly 85 90 95Ser Trp Ser Leu Leu Phe Asn Pro Val Pro Asn Lys Ala Pro Tyr Thr 100 105 110Val Thr Thr Arg Asp Gly Lys Thr His Phe Asn Pro Leu Ala Ile Lys 115 120 125Glu Val Arg Phe Ala Met Asn Phe Leu Ile Asp Arg Lys Lys Leu Val 130 135 140Asp Glu Ile Leu Arg Gly Ala Gly Gln Pro Ser Phe Thr Gln Ala Thr145 150 155 160Pro Gly Gln Pro Gly Thr Tyr Arg Tyr Asn Leu Ile Pro Ser Lys Met 165 170 175Gly Met Thr Glu Asn Gly Asn Gln Glu Lys Ala Leu Asn Asp Ile Asn 180 185 190Lys Ala Met Glu Lys Ala Ala Asn Leu Pro Glu Asn Arg Gly Lys Leu 195 200 205Val Lys Glu Asn Gly Trp Trp Lys Tyr Asn Gly Glu Val Val Thr Ile 210 215 220Lys Phe Val Ile Arg Val Asp Asp Pro Thr Gly Arg Leu Pro Ala Gly225 230 235 240Asn Ala Ile Ser Asp Leu Ile Glu Lys Thr Gly Ile Lys Val Glu Lys 245 250 255Leu Leu Tyr Asp Arg Asn Lys Ser Thr Gln Val Val Tyr Gly Ser Asp 260 265 270Pro Lys Asp Tyr Glu Trp Asn Ile Ile Thr Glu Ala Trp Gly Ala Gly 275 280 285Ala Thr Arg Ala Trp Trp Asp Val Thr Leu Arg Gln Met Tyr Val Arg 290 295 300Glu Gly Asn Tyr Met Pro Gly Ala Asn Val Ser Glu Phe Trp Asn Tyr305 310 315 320Asp Asn Lys Glu Ala Ser Arg Ile Ser Asp Lys Asn Ser Asn Gly Trp 325 330 335Phe Leu Thr Ala Asp Glu Tyr Trp Asn Gly Asn Met Arg Leu Gln Glu 340 345 350Ile Gly Leu Glu Asp Ala Val Arg Ile Tyr Leu Asn Ser Gln Thr Gln 355 360 365Phe Phe Val Ala Asn Lys Glu Arg Phe Asn Arg Arg Met Leu Tyr Gly 370 375 380Val Gly Asp Gly Val Asn Asp Trp Ser Ile Arg Ser Ala Asp Ile Lys385 390 395 400Pro Asn Arg Asn Gly Glu Lys Val Leu Arg Val Leu Gln His Ser Ala 405 410 415Gln Gly Ser Leu Phe Ile Ser Pro Trp Asp Pro Val Gly Val Gly Gly 420 425 430Phe Ser Asp Ala Tyr Ser Ala Ile Met Ile Gly Pro Cys Ser Asp Ala 435 440 445Gly Ala Thr Phe Glu Ser Pro Ser Thr Ala Lys Thr Glu Phe Ile Leu 450 455 460Gly Glu Ala Asp Thr Asn Ser Leu Glu Ile Gly Val Arg Ala Gly Asn465 470 475 480Asn Gly Ile Pro Val Gly Thr Val Asn Val Pro Gln Asn Ala Ile Met 485 490 495Tyr Asn Pro Tyr Thr Gln Lys Trp Glu Glu Gly Leu Thr Val Lys Val 500 505 510Asn Asp Lys Gly Glu Leu Val Tyr Thr Lys Ser

Asp Asn Leu Thr Ala 515 520 525Tyr Val Lys Cys Asp Phe Lys Pro Arg Ser Phe Lys Trp His His Gly 530 535 540Ile Asp Ser Ser Leu Val Asp Leu Met Tyr Gly Ser Val Phe Ile Ala545 550 555 560Asn Ile Ile Thr Lys Thr Asn Glu Asn Asp Lys Tyr Tyr Asp Ser Ala 565 570 575Met Ala Gly Arg Tyr Leu Ser Ala Met Asp Gly Ala Val Gly Ser Ile 580 585 590Ile Asn Glu Asp Gly Ser Phe Thr Leu Tyr Gly Asn Tyr Tyr Trp Pro 595 600 605Met Asp Met Asp Arg Gln Ile Ala Val Ala Ala Val Ser Pro Lys Ile 610 615 620Gly Asn Pro Asn Arg Asn Thr Val Ile Pro Phe Glu Ile Asn Glu Ala625 630 635 640Ile Met Lys Ile Val Leu Glu Gly Ser Lys Ser Gly Asn Val Tyr Thr 645 650 655Ile Ser Gln Asp Gln Ser Leu Thr Ser Ile Asp Val Lys Asn Pro Thr 660 665 670Cys Val Ser Asp Ile Lys Glu Lys Leu Ile Glu Met Arg Asp Ser Gln 675 680 685Tyr Ile Pro Ala Gly Ile Glu Asp Phe Ile Thr Lys Glu Asp Ala Val 690 695 700Lys Arg Tyr Gln Ala Ala Ile Asp Phe Ile Asp Lys Tyr Gly His Ala705 710 715 720Tyr Ile Ser Asn Gly Pro Phe Phe Ile Ser Arg Ile Asp Ser Lys Ala 725 730 735Asn Tyr Ile Glu Leu Thr Ala Phe Lys Asp Tyr Ser Tyr Thr Ala Asp 740 745 750Tyr Trp Ile Asp Arg Leu Ser Thr Lys Met Ser Arg Ile Glu Asp Ile 755 760 765Asp Met Pro Ala Ile Ala Asn Arg Asn Asn Asp Met Asn Ile Asp Ile 770 775 780Tyr Val Ser Ser Tyr Asn Tyr Pro Asp Asn Ala Leu Glu Met Pro Asp785 790 795 800Pro Asn Thr Thr Val Lys Val Leu Leu Gln Leu Gln Met Glu Gly Glu 805 810 815Lys Glu Tyr Asn Ala Val Phe Arg Lys 820 825171014DNABrachyspira hyodysenteriae 17gtggtctgca atatgaataa gaagaacatt atattattat tatctattat tatgatgctg 60attgtatcat gtgaggaaaa aacagaaagt actgtgacaa tacaaaaata tccaataaga 120gttggatata tgccagattt ttctggaagt tctgctgttg ctatagcaaa agaaaagggt 180tattttgatg aagaaaattt agatgttaca ttggttgagt ttttagatgg tccttctgaa 240gtagaggaga tgcttttaaa aaatttagaa tttgcttata taggacatgg tgcacatgct 300ttagctattg aaggtaaagt taatgtatta tttcctaatg gtttaagcag atctgaacaa 360attatagtaa gaaatgcttc tcaaatagaa tctattaaag atttaagagg taaaaaagtt 420ggaacacaat taggaacttc ttcagaaatt ttactttatt tggctcttca gtcattaggt 480attaaagcag aagaagtaga tattataaat atggatggaa atactatagt atcatctata 540gctgatggta ctattgatgc tgcttcagtg caagctccat atacttttga aatattaaat 600aatactgaaa acaatgtaaa gtctatagct acaactgttg attattctga tgtaggttct 660tttcctagca gctggatagt tacaccttct tatcaaagta ataatacaga tatagttaat 720agattttcaa gagctatact taaagctatg gactatagac aacttaatat gagtgaagct 780gtgcaattgg ttgctaacat gaatagtaaa acagttgaag aagttgattt agaaagagaa 840acaggagtat ggttttctgg taatgagata aagcaagcat atattaatgg tgatgctggt 900aaatggtata aaacacagca gaatatattt atttatacta aaactattac aaataatatt 960gatattaata attatgtgca gttaaaatac atggttgata atgtatttaa tgaa 101418338PRTBrachyspira hyodysenteriae 18Val Val Cys Asn Met Asn Lys Lys Asn Ile Ile Leu Leu Leu Ser Ile1 5 10 15Ile Met Met Leu Ile Val Ser Cys Glu Glu Lys Thr Glu Ser Thr Val 20 25 30Thr Ile Gln Lys Tyr Pro Ile Arg Val Gly Tyr Met Pro Asp Phe Ser 35 40 45Gly Ser Ser Ala Val Ala Ile Ala Lys Glu Lys Gly Tyr Phe Asp Glu 50 55 60Glu Asn Leu Asp Val Thr Leu Val Glu Phe Leu Asp Gly Pro Ser Glu65 70 75 80Val Glu Glu Met Leu Leu Lys Asn Leu Glu Phe Ala Tyr Ile Gly His 85 90 95Gly Ala His Ala Leu Ala Ile Glu Gly Lys Val Asn Val Leu Phe Pro 100 105 110Asn Gly Leu Ser Arg Ser Glu Gln Ile Ile Val Arg Asn Ala Ser Gln 115 120 125Ile Glu Ser Ile Lys Asp Leu Arg Gly Lys Lys Val Gly Thr Gln Leu 130 135 140Gly Thr Ser Ser Glu Ile Leu Leu Tyr Leu Ala Leu Gln Ser Leu Gly145 150 155 160Ile Lys Ala Glu Glu Val Asp Ile Ile Asn Met Asp Gly Asn Thr Ile 165 170 175Val Ser Ser Ile Ala Asp Gly Thr Ile Asp Ala Ala Ser Val Gln Ala 180 185 190Pro Tyr Thr Phe Glu Ile Leu Asn Asn Thr Glu Asn Asn Val Lys Ser 195 200 205Ile Ala Thr Thr Val Asp Tyr Ser Asp Val Gly Ser Phe Pro Ser Ser 210 215 220Trp Ile Val Thr Pro Ser Tyr Gln Ser Asn Asn Thr Asp Ile Val Asn225 230 235 240Arg Phe Ser Arg Ala Ile Leu Lys Ala Met Asp Tyr Arg Gln Leu Asn 245 250 255Met Ser Glu Ala Val Gln Leu Val Ala Asn Met Asn Ser Lys Thr Val 260 265 270Glu Glu Val Asp Leu Glu Arg Glu Thr Gly Val Trp Phe Ser Gly Asn 275 280 285Glu Ile Lys Gln Ala Tyr Ile Asn Gly Asp Ala Gly Lys Trp Tyr Lys 290 295 300Thr Gln Gln Asn Ile Phe Ile Tyr Thr Lys Thr Ile Thr Asn Asn Ile305 310 315 320Asp Ile Asn Asn Tyr Val Gln Leu Lys Tyr Met Val Asp Asn Val Phe 325 330 335Asn Glu19981DNABrachyspira hyodysenteriae 19atgaaaaaag ttttattagc tgtaacattt atttttatat ttagtttttt aatatcatgc 60ggtaagaaaa caaatgaaaa tgcaggtaaa ataagagtag catatcaccc aaatgtagga 120ggagcttctg caataattac aggtatacag cagaattatt ttaaagatga aggtttggat 180atagaacttg ttaaatttac aagcggacct acagaaatag cagctatggt ttcaggagat 240atacaaatag gttatatagg ttttggagca catacattgg cagcagaagg aaaagttcaa 300ataatagcta ctgacggaat agctgttgta gaaggtatta gaacattaaa aacttcaggc 360ataaactctg ttgaaaaatt aaaaggcaga agtttaataa ctcaattagg tacatcagga 420gaaactatta tagatcaggt attagcagga acaggagtta ataaaacaga tataaatata 480cttaatgctg aagtttcaag tgctgttgca tcattcttgg ctaataaagt tgatgctata 540tctgtatggc ctccttatac tgttgaaata gataatagaa ttggtataga gaatttgtat 600attataaaac ctcaggatgt aggagttgat tctactgcaa gctggatagt aactcctaac 660tatttggaag ctaatactga tacagttata aaattcacaa gagcattata taaatcaatg 720gattatagaa aatcacattt agatgaagct attacaaatg tatcaaatct tataggttta 780gatatagcta cagtttcaca agagaaatac agttctgact ggatggattc tcaaacaatg 840aaaagcagaa taaatgacgg aagcataagt aatatttata aaaaacaaat agactatttt 900gtacagaata atagattaaa ttctgagcct gttcctgtag acaaatatgt aagaatcgac 960attatagaaa aagcattaaa t 98120327PRTBrachyspira hyodysenteriae 20Met Lys Lys Val Leu Leu Ala Val Thr Phe Ile Phe Ile Phe Ser Phe1 5 10 15Leu Ile Ser Cys Gly Lys Lys Thr Asn Glu Asn Ala Gly Lys Ile Arg 20 25 30Val Ala Tyr His Pro Asn Val Gly Gly Ala Ser Ala Ile Ile Thr Gly 35 40 45Ile Gln Gln Asn Tyr Phe Lys Asp Glu Gly Leu Asp Ile Glu Leu Val 50 55 60Lys Phe Thr Ser Gly Pro Thr Glu Ile Ala Ala Met Val Ser Gly Asp65 70 75 80Ile Gln Ile Gly Tyr Ile Gly Phe Gly Ala His Thr Leu Ala Ala Glu 85 90 95Gly Lys Val Gln Ile Ile Ala Thr Asp Gly Ile Ala Val Val Glu Gly 100 105 110Ile Arg Thr Leu Lys Thr Ser Gly Ile Asn Ser Val Glu Lys Leu Lys 115 120 125Gly Arg Ser Leu Ile Thr Gln Leu Gly Thr Ser Gly Glu Thr Ile Ile 130 135 140Asp Gln Val Leu Ala Gly Thr Gly Val Asn Lys Thr Asp Ile Asn Ile145 150 155 160Leu Asn Ala Glu Val Ser Ser Ala Val Ala Ser Phe Leu Ala Asn Lys 165 170 175Val Asp Ala Ile Ser Val Trp Pro Pro Tyr Thr Val Glu Ile Asp Asn 180 185 190Arg Ile Gly Ile Glu Asn Leu Tyr Ile Ile Lys Pro Gln Asp Val Gly 195 200 205Val Asp Ser Thr Ala Ser Trp Ile Val Thr Pro Asn Tyr Leu Glu Ala 210 215 220Asn Thr Asp Thr Val Ile Lys Phe Thr Arg Ala Leu Tyr Lys Ser Met225 230 235 240Asp Tyr Arg Lys Ser His Leu Asp Glu Ala Ile Thr Asn Val Ser Asn 245 250 255Leu Ile Gly Leu Asp Ile Ala Thr Val Ser Gln Glu Lys Tyr Ser Ser 260 265 270Asp Trp Met Asp Ser Gln Thr Met Lys Ser Arg Ile Asn Asp Gly Ser 275 280 285Ile Ser Asn Ile Tyr Lys Lys Gln Ile Asp Tyr Phe Val Gln Asn Asn 290 295 300Arg Leu Asn Ser Glu Pro Val Pro Val Asp Lys Tyr Val Arg Ile Asp305 310 315 320Ile Ile Glu Lys Ala Leu Asn 325211011DNABrachyspira hyodysenteriae 21atgaaaaaaa ctatgtttat ttctatttta tcaatggcag tgatatcttt aataatatcc 60tgttcaggag gaaataaagc tcctgctgct tcagcagatg gtacacttga taaaataaga 120gttgcttatc ttgcagattt tgcaggaact tcttctgttg ctatagctca ggaaaaaggt 180ttttttaaag aagaaaattt agatgttgaa ttagttaaat ttttaaatgg accttctgaa 240gttgctgcta tgctctctgg agatatacaa tttgcatata taggacatgg tgcacattct 300ctagctattc aaggtaaagt taatgtatta tttcctaatg gtttaggtaa atctgaagaa 360attatagttg gtaaatgggc caatgttaat gatttagcag gattaaaagg aaaaactata 420ggtactcagc ttggtacttc tggagatata gtattggata ttgcattaag aaaagttgga 480ctttccaaag aagatgttaa tgttgtcaat atggatgtaa gcggaatagt atcttctatg 540attggtaaaa aagtagatgc agtttcttta tgggctcctt atacttttga aataactaaa 600cagcttggag atgaagctgt tgtaattgct tctattacaa attatttaga tgaagctgta 660tttcctagca gttggatagt tactcctgat tatcaaaata ataatcaaga catagtgaat 720agattctcta aagctatatt taaagctatg gattatagaa gtgagaatat ggatgaggct 780gttgaaattg tagctaaatt aaatggaact cctgttgatt ctgttgcttt agaaaaagaa 840actgctatat ggcttagttc ttctgatata aaaaattctt atactgatgg aacagctgct 900aaatggtatc aagctcagca gaaaatattt ttaaactcag aagtagttac tgaagaagta 960gatgttaata attatgtaca gataaattat ataattgata atgtgcttaa a 101122337PRTBrachyspira hyodysenteriae 22Met Lys Lys Thr Met Phe Ile Ser Ile Leu Ser Met Ala Val Ile Ser1 5 10 15Leu Ile Ile Ser Cys Ser Gly Gly Asn Lys Ala Pro Ala Ala Ser Ala 20 25 30Asp Gly Thr Leu Asp Lys Ile Arg Val Ala Tyr Leu Ala Asp Phe Ala 35 40 45Gly Thr Ser Ser Val Ala Ile Ala Gln Glu Lys Gly Phe Phe Lys Glu 50 55 60Glu Asn Leu Asp Val Glu Leu Val Lys Phe Leu Asn Gly Pro Ser Glu65 70 75 80Val Ala Ala Met Leu Ser Gly Asp Ile Gln Phe Ala Tyr Ile Gly His 85 90 95Gly Ala His Ser Leu Ala Ile Gln Gly Lys Val Asn Val Leu Phe Pro 100 105 110Asn Gly Leu Gly Lys Ser Glu Glu Ile Ile Val Gly Lys Trp Ala Asn 115 120 125Val Asn Asp Leu Ala Gly Leu Lys Gly Lys Thr Ile Gly Thr Gln Leu 130 135 140Gly Thr Ser Gly Asp Ile Val Leu Asp Ile Ala Leu Arg Lys Val Gly145 150 155 160Leu Ser Lys Glu Asp Val Asn Val Val Asn Met Asp Val Ser Gly Ile 165 170 175Val Ser Ser Met Ile Gly Lys Lys Val Asp Ala Val Ser Leu Trp Ala 180 185 190Pro Tyr Thr Phe Glu Ile Thr Lys Gln Leu Gly Asp Glu Ala Val Val 195 200 205Ile Ala Ser Ile Thr Asn Tyr Leu Asp Glu Ala Val Phe Pro Ser Ser 210 215 220Trp Ile Val Thr Pro Asp Tyr Gln Asn Asn Asn Gln Asp Ile Val Asn225 230 235 240Arg Phe Ser Lys Ala Ile Phe Lys Ala Met Asp Tyr Arg Ser Glu Asn 245 250 255Met Asp Glu Ala Val Glu Ile Val Ala Lys Leu Asn Gly Thr Pro Val 260 265 270Asp Ser Val Ala Leu Glu Lys Glu Thr Ala Ile Trp Leu Ser Ser Ser 275 280 285Asp Ile Lys Asn Ser Tyr Thr Asp Gly Thr Ala Ala Lys Trp Tyr Gln 290 295 300Ala Gln Gln Lys Ile Phe Leu Asn Ser Glu Val Val Thr Glu Glu Val305 310 315 320Asp Val Asn Asn Tyr Val Gln Ile Asn Tyr Ile Ile Asp Asn Val Leu 325 330 335Lys23615DNABrachyspira hyodysenteriae 23atggcaagaa gaaaaaagaa aaaatcatct cctttattaa tactatttat tttattaata 60gcagcaggat actattatta taataatata tataataaaa aagaaatatc aaaaacagaa 120aagcccaaaa aagaaactat tacaagatac aatagagatg attggggaga ttgggctgat 180gaagataatg acggacttaa tacaaggcat gaggtattag caagagcatc attagtaaaa 240cctgtaatat ctaataacag agtaatatca ggaaaatggt atgataagtt tacaggaaaa 300tattttacta atgcaaaaga tttagatata gatcatttag tgcctttaaa aaatgcacat 360atcagcggtg ctagtaattg gagtaaagaa aagaaaaatg aatactacaa ttatatgaaa 420aacgaaaatc atttggtagc tgtatcaaaa ggtgcaaatc gttctaaagg tgataaatcc 480ccggtagaat ggctccctcc taatgaagaa tatcaatgcg aatatgtaag agaatggtat 540aaaatcaaaa ccgattgggg gcttacaata gaagaaggtt ttgatgaagt ttcaaacaga 600gtatgcaaag gaaaa 61524205PRTBrachyspira hyodysenteriae 24Met Ala Arg Arg Lys Lys Lys Lys Ser Ser Pro Leu Leu Ile Leu Phe1 5 10 15Ile Leu Leu Ile Ala Ala Gly Tyr Tyr Tyr Tyr Asn Asn Ile Tyr Asn 20 25 30Lys Lys Glu Ile Ser Lys Thr Glu Lys Pro Lys Lys Glu Thr Ile Thr 35 40 45Arg Tyr Asn Arg Asp Asp Trp Gly Asp Trp Ala Asp Glu Asp Asn Asp 50 55 60Gly Leu Asn Thr Arg His Glu Val Leu Ala Arg Ala Ser Leu Val Lys65 70 75 80Pro Val Ile Ser Asn Asn Arg Val Ile Ser Gly Lys Trp Tyr Asp Lys 85 90 95Phe Thr Gly Lys Tyr Phe Thr Asn Ala Lys Asp Leu Asp Ile Asp His 100 105 110Leu Val Pro Leu Lys Asn Ala His Ile Ser Gly Ala Ser Asn Trp Ser 115 120 125Lys Glu Lys Lys Asn Glu Tyr Tyr Asn Tyr Met Lys Asn Glu Asn His 130 135 140Leu Val Ala Val Ser Lys Gly Ala Asn Arg Ser Lys Gly Asp Lys Ser145 150 155 160Pro Val Glu Trp Leu Pro Pro Asn Glu Glu Tyr Gln Cys Glu Tyr Val 165 170 175Arg Glu Trp Tyr Lys Ile Lys Thr Asp Trp Gly Leu Thr Ile Glu Glu 180 185 190Gly Phe Asp Glu Val Ser Asn Arg Val Cys Lys Gly Lys 195 200 20525264DNABrachyspira hyodysenteriae 25atgaataaaa ttttttatga taaagcttgg gaagattatc tttattttca aaagaatgac 60aaaaaaatat tacagaaaat taatgatttt ataaaagata tagaaagaaa tggcttatta 120attggtatag gaaaaccaga gagattaaaa ggtgagttaa acggattgta ttcaaggcta 180ataaatcaag aacatagatt agtatattat attgaagata ataatttatt tatagttgga 240tgtaaaacac attataaaaa taat 2642688PRTBrachyspira hyodysenteriae 26Met Asn Lys Ile Phe Tyr Asp Lys Ala Trp Glu Asp Tyr Leu Tyr Phe1 5 10 15Gln Lys Asn Asp Lys Lys Ile Leu Gln Lys Ile Asn Asp Phe Ile Lys 20 25 30Asp Ile Glu Arg Asn Gly Leu Leu Ile Gly Ile Gly Lys Pro Glu Arg 35 40 45Leu Lys Gly Glu Leu Asn Gly Leu Tyr Ser Arg Leu Ile Asn Gln Glu 50 55 60His Arg Leu Val Tyr Tyr Ile Glu Asp Asn Asn Leu Phe Ile Val Gly65 70 75 80Cys Lys Thr His Tyr Lys Asn Asn 85271503DNABrachyspira hyodysenteriae 27gtgttaagga aattgatata tattattttt ttgcattcaa ttctttttaa tttttttatt 60tttgcacaaa ctaatgaatc agctatatta aattacactc aatatatgga aagaataaaa 120tccataatac cagaaatgaa attaactgca tctcaagaaa gcaatgccta taataattta 180acaaaagcaa aaagctccgg agacgttaaa tttgatttgc aggctggtgc tataggaatg 240caaagccatt ttgatgaata caatttttta gcaacatcag attttaatta taatgggttt 300agaataggtg caggattcag cggacttgta ccatactctg gaactagatg gtctgtagaa 360attaaacatg acagtttttt cggcgacttt aatacaggag atatttcatt accggttgat 420acgcctctag gtagaataaa tggaaaactt ccaaatttaa gtactaatga ttttaaatac 480tattatccaa gcataaaaat tcaaatagct cagcctattt taagggattt ttttggtaaa 540ttggatagat accctataaa agatgcagaa tatcagctta ccatagcaaa attaaaaaga 600ataatagacg acaacagcgt attaacatct tatcagaaaa tttattatca atggataatg 660gcaagaaaat taatagattt atatgatgat atgataagag aagcaagaag ttttgaaaat 720caagtataca gaagatatac aagcggagtt atagataatg actcatatca gaatgcaaaa 780agacaaacat taaaatatat agaagcaaga gataaatctg aattaatgct taaaaaaata 840atgagaaata ttcaattctt tatacctgaa gaaaatatac agccaaatga agatgattgg 900aatcagacat tagaaacctc tataaatgct aaaatagata tagtaccatt

tttagaaagt 960gctcagggac aaatggctta tcaattaaaa ttaagaagcg aatatgctat ttcagtaatg 1020aaaaataatg ctctgcctga tttatctata gtaggaagcg tatcattatc aagtttagat 1080gacagcggat attttaaatc tttttctacc atgactaatg ttgattattt tgtagggctt 1140atgttttcct accccatagg cggacgtgat gctaaagcta aaatggaaga tgcttatgct 1200gctttgaatg ctgttacggc tgattttgat agggtgaaca gagattttga cgttcagata 1260ggtacttatt atgatgagtt tgaggcatac aaaaaaatgc tagaaaataa aaaattggaa 1320gttaatgcta tagtatcaag aataaatacg caaaatgcta aattcagaca aggaagactc 1380cctatagatg aaataataaa tgcaaggctt gatttagcac aggcaagagc agaacttctt 1440aatttgcagt atttaataat aagcactgtt atggattata attctctggt gctgcttaac 1500aat 150328501PRTBrachyspira hyodysenteriae 28Val Leu Arg Lys Leu Ile Tyr Ile Ile Phe Leu His Ser Ile Leu Phe1 5 10 15Asn Phe Phe Ile Phe Ala Gln Thr Asn Glu Ser Ala Ile Leu Asn Tyr 20 25 30Thr Gln Tyr Met Glu Arg Ile Lys Ser Ile Ile Pro Glu Met Lys Leu 35 40 45Thr Ala Ser Gln Glu Ser Asn Ala Tyr Asn Asn Leu Thr Lys Ala Lys 50 55 60Ser Ser Gly Asp Val Lys Phe Asp Leu Gln Ala Gly Ala Ile Gly Met65 70 75 80Gln Ser His Phe Asp Glu Tyr Asn Phe Leu Ala Thr Ser Asp Phe Asn 85 90 95Tyr Asn Gly Phe Arg Ile Gly Ala Gly Phe Ser Gly Leu Val Pro Tyr 100 105 110Ser Gly Thr Arg Trp Ser Val Glu Ile Lys His Asp Ser Phe Phe Gly 115 120 125Asp Phe Asn Thr Gly Asp Ile Ser Leu Pro Val Asp Thr Pro Leu Gly 130 135 140Arg Ile Asn Gly Lys Leu Pro Asn Leu Ser Thr Asn Asp Phe Lys Tyr145 150 155 160Tyr Tyr Pro Ser Ile Lys Ile Gln Ile Ala Gln Pro Ile Leu Arg Asp 165 170 175Phe Phe Gly Lys Leu Asp Arg Tyr Pro Ile Lys Asp Ala Glu Tyr Gln 180 185 190Leu Thr Ile Ala Lys Leu Lys Arg Ile Ile Asp Asp Asn Ser Val Leu 195 200 205Thr Ser Tyr Gln Lys Ile Tyr Tyr Gln Trp Ile Met Ala Arg Lys Leu 210 215 220Ile Asp Leu Tyr Asp Asp Met Ile Arg Glu Ala Arg Ser Phe Glu Asn225 230 235 240Gln Val Tyr Arg Arg Tyr Thr Ser Gly Val Ile Asp Asn Asp Ser Tyr 245 250 255Gln Asn Ala Lys Arg Gln Thr Leu Lys Tyr Ile Glu Ala Arg Asp Lys 260 265 270Ser Glu Leu Met Leu Lys Lys Ile Met Arg Asn Ile Gln Phe Phe Ile 275 280 285Pro Glu Glu Asn Ile Gln Pro Asn Glu Asp Asp Trp Asn Gln Thr Leu 290 295 300Glu Thr Ser Ile Asn Ala Lys Ile Asp Ile Val Pro Phe Leu Glu Ser305 310 315 320Ala Gln Gly Gln Met Ala Tyr Gln Leu Lys Leu Arg Ser Glu Tyr Ala 325 330 335Ile Ser Val Met Lys Asn Asn Ala Leu Pro Asp Leu Ser Ile Val Gly 340 345 350Ser Val Ser Leu Ser Ser Leu Asp Asp Ser Gly Tyr Phe Lys Ser Phe 355 360 365Ser Thr Met Thr Asn Val Asp Tyr Phe Val Gly Leu Met Phe Ser Tyr 370 375 380Pro Ile Gly Gly Arg Asp Ala Lys Ala Lys Met Glu Asp Ala Tyr Ala385 390 395 400Ala Leu Asn Ala Val Thr Ala Asp Phe Asp Arg Val Asn Arg Asp Phe 405 410 415Asp Val Gln Ile Gly Thr Tyr Tyr Asp Glu Phe Glu Ala Tyr Lys Lys 420 425 430Met Leu Glu Asn Lys Lys Leu Glu Val Asn Ala Ile Val Ser Arg Ile 435 440 445Asn Thr Gln Asn Ala Lys Phe Arg Gln Gly Arg Leu Pro Ile Asp Glu 450 455 460Ile Ile Asn Ala Arg Leu Asp Leu Ala Gln Ala Arg Ala Glu Leu Leu465 470 475 480Asn Leu Gln Tyr Leu Ile Ile Ser Thr Val Met Asp Tyr Asn Ser Leu 485 490 495Val Leu Leu Asn Asn 500291386DNABrachyspira hyodysenteriae 29atggaaatac tactagttta tttatttgaa atatttataa ttattattct tattatgctc 60tctgctttat tttctggaag tgagactgca tatacatcta ttgatgatgt tactttaatg 120cgtttggtca gagagaaaaa aatcaaagaa gaagataaaa aatattggga aaagtcaagt 180tctatgatac ctaccctact tgttggtaat aacatagtta atatatcagc aagttccatt 240ataactgtat ttgctgtaag gcttgctgac attctgccgc atgtatcaac aaatgtgatg 300gttacaatat caactgccac aataacaata cttattatta tattcggaga aatacttcct 360aaagtcttaa tgagagttaa tgctgaaaaa atgatgcctt atcttctata ttttatgaag 420ttttgtcatt ttatattcaa gcctataact ttcttaatgg ataaagtaac tacttttata 480atgaattatt ttgtacctaa aagattaaga gatgctgaaa aaagaagtgc tttatcaagt 540atggaagata tcactactat aatacatttg gggcataaag aaggaataat aaaagaatat 600acacatgaaa tgcttacagg agtaatagat tttagaaata aaactgtaga agagataatg 660acgccccgtg ttgatatggt atgtattgaa gctgaaacag atgtaaatga aataataaaa 720cttactgtag aatcaggact ttcaagattt cctgtttatg aggaaacagt agatcatata 780ataggtatat tccatacaag agctttattt aaagaatatg ttaaaggcgg cggaaagatg 840aacaaagtaa aaaagaaagc aatagattat ataatgcttc cctactttgt acctgaaact 900aaaactataa gcagcttatt tagtgatatg caaaagaaaa aacttcagat ggtaattact 960attgatgaat acggcggaac tgccggactt gttactatgg aagatataat agaagagata 1020atgggtgata tagaagatga aagtgataaa aaagaagctg atgtaataag atttaaggga 1080aaaagaatta taataaatgg aaatgcttct atagaagatg tcaacaaaac tttaaaatta 1140gaattagagc atgaagaata tcaaactata gcaggatatg ttattgatat gcttgatcat 1200atacctgaaa caaatgagag attcatatta aaaggatata gggtaagaat aatgaaagtt 1260gaagacagaa gaatagttga aatggaattt actcctataa aatttgcaag aacaaatgaa 1320agtgataata ttgatataca agagacatct gattcagaaa aaaatgattt agaaatttta 1380aatgaa 138630462PRTBrachyspira hyodysenteriae 30Met Glu Ile Leu Leu Val Tyr Leu Phe Glu Ile Phe Ile Ile Ile Ile1 5 10 15Leu Ile Met Leu Ser Ala Leu Phe Ser Gly Ser Glu Thr Ala Tyr Thr 20 25 30Ser Ile Asp Asp Val Thr Leu Met Arg Leu Val Arg Glu Lys Lys Ile 35 40 45Lys Glu Glu Asp Lys Lys Tyr Trp Glu Lys Ser Ser Ser Met Ile Pro 50 55 60Thr Leu Leu Val Gly Asn Asn Ile Val Asn Ile Ser Ala Ser Ser Ile65 70 75 80Ile Thr Val Phe Ala Val Arg Leu Ala Asp Ile Leu Pro His Val Ser 85 90 95Thr Asn Val Met Val Thr Ile Ser Thr Ala Thr Ile Thr Ile Leu Ile 100 105 110Ile Ile Phe Gly Glu Ile Leu Pro Lys Val Leu Met Arg Val Asn Ala 115 120 125Glu Lys Met Met Pro Tyr Leu Leu Tyr Phe Met Lys Phe Cys His Phe 130 135 140Ile Phe Lys Pro Ile Thr Phe Leu Met Asp Lys Val Thr Thr Phe Ile145 150 155 160Met Asn Tyr Phe Val Pro Lys Arg Leu Arg Asp Ala Glu Lys Arg Ser 165 170 175Ala Leu Ser Ser Met Glu Asp Ile Thr Thr Ile Ile His Leu Gly His 180 185 190Lys Glu Gly Ile Ile Lys Glu Tyr Thr His Glu Met Leu Thr Gly Val 195 200 205Ile Asp Phe Arg Asn Lys Thr Val Glu Glu Ile Met Thr Pro Arg Val 210 215 220Asp Met Val Cys Ile Glu Ala Glu Thr Asp Val Asn Glu Ile Ile Lys225 230 235 240Leu Thr Val Glu Ser Gly Leu Ser Arg Phe Pro Val Tyr Glu Glu Thr 245 250 255Val Asp His Ile Ile Gly Ile Phe His Thr Arg Ala Leu Phe Lys Glu 260 265 270Tyr Val Lys Gly Gly Gly Lys Met Asn Lys Val Lys Lys Lys Ala Ile 275 280 285Asp Tyr Ile Met Leu Pro Tyr Phe Val Pro Glu Thr Lys Thr Ile Ser 290 295 300Ser Leu Phe Ser Asp Met Gln Lys Lys Lys Leu Gln Met Val Ile Thr305 310 315 320Ile Asp Glu Tyr Gly Gly Thr Ala Gly Leu Val Thr Met Glu Asp Ile 325 330 335Ile Glu Glu Ile Met Gly Asp Ile Glu Asp Glu Ser Asp Lys Lys Glu 340 345 350Ala Asp Val Ile Arg Phe Lys Gly Lys Arg Ile Ile Ile Asn Gly Asn 355 360 365Ala Ser Ile Glu Asp Val Asn Lys Thr Leu Lys Leu Glu Leu Glu His 370 375 380Glu Glu Tyr Gln Thr Ile Ala Gly Tyr Val Ile Asp Met Leu Asp His385 390 395 400Ile Pro Glu Thr Asn Glu Arg Phe Ile Leu Lys Gly Tyr Arg Val Arg 405 410 415Ile Met Lys Val Glu Asp Arg Arg Ile Val Glu Met Glu Phe Thr Pro 420 425 430Ile Lys Phe Ala Arg Thr Asn Glu Ser Asp Asn Ile Asp Ile Gln Glu 435 440 445Thr Ser Asp Ser Glu Lys Asn Asp Leu Glu Ile Leu Asn Glu 450 455 460311080DNABrachyspira hyodysenteriae 31atgaaagagt taggaatatc catttacccc tttcactcaa aaatggaaga taataaatat 60tatatagatt tggcttctaa atacggattc gcaagatgtt ttatgtgtct gctttcagtt 120gatagatcta aagatgaaat aataaatgaa ttttcaacta taataaatta tgctaaagaa 180aaaggtataa aaactacttt agatatatct ccggctgtat tcaaacattt ggatatagat 240tataaaaatc ttgacttttt tcataaattg ggagcttggg gcgtaagatt agatttaggg 300tttacaggta atgaagaaag tttaatgaca tataacgaat atgatttgaa aatagaatta 360aatatgagca atgatacaga ttatcttgat aatataatga aatattatcc taatactgat 420aatttgatag gctgttataa tttctatcct catgcatata caggactaga cagaacactt 480tttaaaagca gcatgaaacg ttttaaaaaa tattctataa gttcatctgc atttgttaat 540gccaaagaag ctacttttgg accttggcct gtaagcgatg gtatttgcac attggaagaa 600catagagata tgcctataga tgcacaggct atggaattat ttgctcttgg tgttgactgt 660gttttcattg ctaactgtta tgcagatgaa aatactttta aaacattata taatatggat 720aaaagattaa taacttttaa agtagaatta gttgattcta ttcctaaaga agaaaagagt 780atagtattag atatgcttca tcaaaacaga ttagatgctt ctgctgatgt tataagatct 840tcagatacaa gagcaaaata taagggacat aatttcaaaa tatttaatgc tgtttccgat 900ataaaaagag gagatatatt aatagattca tcagaatacg gcagttatac cggagaaatg 960cagatagctt tgaaagattt aaaaaatacc ggaagaacta atgtagtagg cagaattaaa 1020gatgaatatt tatttctgct agattatata agtccggcta aaagatttat tataagagaa 108032360PRTBrachyspira hyodysenteriae 32Met Lys Glu Leu Gly Ile Ser Ile Tyr Pro Phe His Ser Lys Met Glu1 5 10 15Asp Asn Lys Tyr Tyr Ile Asp Leu Ala Ser Lys Tyr Gly Phe Ala Arg 20 25 30Cys Phe Met Cys Leu Leu Ser Val Asp Arg Ser Lys Asp Glu Ile Ile 35 40 45Asn Glu Phe Ser Thr Ile Ile Asn Tyr Ala Lys Glu Lys Gly Ile Lys 50 55 60Thr Thr Leu Asp Ile Ser Pro Ala Val Phe Lys His Leu Asp Ile Asp65 70 75 80Tyr Lys Asn Leu Asp Phe Phe His Lys Leu Gly Ala Trp Gly Val Arg 85 90 95Leu Asp Leu Gly Phe Thr Gly Asn Glu Glu Ser Leu Met Thr Tyr Asn 100 105 110Glu Tyr Asp Leu Lys Ile Glu Leu Asn Met Ser Asn Asp Thr Asp Tyr 115 120 125Leu Asp Asn Ile Met Lys Tyr Tyr Pro Asn Thr Asp Asn Leu Ile Gly 130 135 140Cys Tyr Asn Phe Tyr Pro His Ala Tyr Thr Gly Leu Asp Arg Thr Leu145 150 155 160Phe Lys Ser Ser Met Lys Arg Phe Lys Lys Tyr Ser Ile Ser Ser Ser 165 170 175Ala Phe Val Asn Ala Lys Glu Ala Thr Phe Gly Pro Trp Pro Val Ser 180 185 190Asp Gly Ile Cys Thr Leu Glu Glu His Arg Asp Met Pro Ile Asp Ala 195 200 205Gln Ala Met Glu Leu Phe Ala Leu Gly Val Asp Cys Val Phe Ile Ala 210 215 220Asn Cys Tyr Ala Asp Glu Asn Thr Phe Lys Thr Leu Tyr Asn Met Asp225 230 235 240Lys Arg Leu Ile Thr Phe Lys Val Glu Leu Val Asp Ser Ile Pro Lys 245 250 255Glu Glu Lys Ser Ile Val Leu Asp Met Leu His Gln Asn Arg Leu Asp 260 265 270Ala Ser Ala Asp Val Ile Arg Ser Ser Asp Thr Arg Ala Lys Tyr Lys 275 280 285Gly His Asn Phe Lys Ile Phe Asn Ala Val Ser Asp Ile Lys Arg Gly 290 295 300Asp Ile Leu Ile Asp Ser Ser Glu Tyr Gly Ser Tyr Thr Gly Glu Met305 310 315 320Gln Ile Ala Leu Lys Asp Leu Lys Asn Thr Gly Arg Thr Asn Val Val 325 330 335Gly Arg Ile Lys Asp Glu Tyr Leu Phe Leu Leu Asp Tyr Ile Ser Pro 340 345 350Ala Lys Arg Phe Ile Ile Arg Glu 355 360332574DNABrachyspira hyodysenteriae 33ttgatgaaga aatacaagcc tgaaacaaaa caagaattag aacaattggt atatactgac 60ggaataaaac tctatgatgt agatacgagt cttataacag atatgagcga gctttttcat 120aacagcacca gaaaagattt tgaaggcata gaagattggg acgtttctaa tgttgaggat 180atgtcctata tgtttgccca tatgagttat gatagttatg aaaaccgttc taaagctaag 240tttaatcata atcttaataa ttggaatgta tctaaagtta agcatatgag ttttatgttt 300tattattgtc aggattttaa tcagccttta gataaatggg acgtttctaa tgttcaggat 360acatttagaa tgtttgataa ttgtaaaaaa ttcaatcagc ctttaaatag ctggaatgta 420tctaatgtaa caaatatgag cggtatgttt caggtagcag aaagtttcaa tcagccttta 480gacaagtggg acgtttcaaa agttacaact atgagggcta tgtttaatta tgctaaagct 540tttaatcaag atataagtaa ttggaatgtt agtaaagttg aagatatggg ttatatgttt 600agtatatgcg ttaattttaa tcagcctatt aatgattggg acgtatctaa agtaaaaact 660atggaaggta tgtttagaag tgcttttaaa ttcaatcagc ctttagataa atggaatact 720tcaaaggttg aaaatatgaa tcagatgttt aatgaggctt taaaatttaa tcagccttta 780aatagctgga atgtttccaa tgtaaaaact atggaatgta tgtttcgcgg tactgaagct 840tttaatcagc ctttggataa atgggataca aaaaaattaa aaacaatgtt tggaatgttt 900gactttgctg aaggttataa tagttttgac tcattagcaa actgggattt aaataaagta 960tcagaaatga gtaatttatg ttttaaaagg tatgaagaac ttcctttaag aattaaagca 1020tatcttcagg cattttatgg ttcttataaa gattatttaa ctgttacaaa agataatgtc 1080aaagaaatat atgatcttat ttcaaaagac acaaataaaa aagttttgtc atttaaaaag 1140agattagaaa gcgagtttag tgaggaactt tcatctgtta cagataatta taatttcaaa 1200tctatagaag aagcagaaaa gtatgttgaa aataattata ataaaaaaga tgataagaaa 1260gttagcttta taaatgatta taaagttttg ataaaagata aatcaagaga agttgaaaat 1320aaagttttaa aatatatata tttggaatat ttgctcctta aaagagatgt taaaaaatta 1380gtgcagattg ataatatagt taatttactt gataaagaat catttataaa atttattaaa 1440aatgtttatg atgaaactaa taaagaaaca gccgctttta tttatggcat atacggagga 1500gatgaggcag taaaaaatat atataaaaaa gaaaaagaca ctaaactttc actattaata 1560attaaattaa atatagaaag taaatatgca cttagaatat tatatgaaat atattcaaat 1620acaaaaaaat ctgaagttag ttatgaagct gataaattga ttgatgaagt aatggaaaaa 1680atggatatta gttataatga attccaatta agatattcat ctgatttagg atttaattct 1740aaaggtgaaa aagaattgaa taaagattat aaattaattt tgaatagcga ttattctttg 1800agtctttttg atataaaaaa taataaggaa cttaaaaaag cccctcaaaa tcttaatgaa 1860gatttaaaag aagaaataac aaaattaaga aaagaaattc cttattttat gaaaaacact 1920gcttctcttt tagctgtttt attagcaagc ggtgaaaaat acagttatga tttattcaaa 1980gagattttta ttgataatgc cattatgaat agatttgctt catctttaat atggaatcta 2040tatgacaaag attctaattt tataacaact ttcagatatt caggcgatgg aagttattca 2100aactgtgaag atgaagaagt aaaaattaat gataatagtt ttgtaagttt agcaagccct 2160gtggaaatgg atgatgaaac tatagataaa tggagaaaac agcttgaaga ttatgagata 2220gcacagccaa taagtcaatt aactgtcata aaattagata aagataattt gaaaagcgaa 2280gtagaaaaaa tagataattt agaaatagct tatggtactt tcaaggcttt cggtgaaaga 2340tatgaaatgt atagcgagta tataggttat gatgttgtta aaagttattc attagaatca 2400aagaacggag acactttcac tatagacgct gatgttaatt caaaaactga ttttcatgac 2460agagtaaaaa ttaatattaa ttttgataat gaaaatggtg aggaagtaag taaaagattt 2520atttatactt tgttagtatt aatgatttgg gattttagat taacagattt attt 257434858PRTBrachyspira hyodysenteriae 34Leu Met Lys Lys Tyr Lys Pro Glu Thr Lys Gln Glu Leu Glu Gln Leu1 5 10 15Val Tyr Thr Asp Gly Ile Lys Leu Tyr Asp Val Asp Thr Ser Leu Ile 20 25 30Thr Asp Met Ser Glu Leu Phe His Asn Ser Thr Arg Lys Asp Phe Glu 35 40 45Gly Ile Glu Asp Trp Asp Val Ser Asn Val Glu Asp Met Ser Tyr Met 50 55 60Phe Ala His Met Ser Tyr Asp Ser Tyr Glu Asn Arg Ser Lys Ala Lys65 70 75 80Phe Asn His Asn Leu Asn Asn Trp Asn Val Ser Lys Val Lys His Met 85 90 95Ser Phe Met Phe Tyr Tyr Cys Gln Asp Phe Asn Gln Pro Leu Asp Lys 100 105 110Trp Asp Val Ser Asn Val Gln Asp Thr Phe Arg Met Phe Asp Asn Cys 115 120 125Lys Lys Phe Asn Gln Pro Leu Asn Ser Trp Asn Val Ser Asn Val Thr 130 135 140Asn Met Ser Gly Met Phe Gln Val Ala Glu Ser Phe Asn Gln Pro Leu145 150 155 160Asp Lys Trp Asp Val Ser Lys Val Thr Thr Met Arg Ala Met Phe Asn 165 170

175Tyr Ala Lys Ala Phe Asn Gln Asp Ile Ser Asn Trp Asn Val Ser Lys 180 185 190Val Glu Asp Met Gly Tyr Met Phe Ser Ile Cys Val Asn Phe Asn Gln 195 200 205Pro Ile Asn Asp Trp Asp Val Ser Lys Val Lys Thr Met Glu Gly Met 210 215 220Phe Arg Ser Ala Phe Lys Phe Asn Gln Pro Leu Asp Lys Trp Asn Thr225 230 235 240Ser Lys Val Glu Asn Met Asn Gln Met Phe Asn Glu Ala Leu Lys Phe 245 250 255Asn Gln Pro Leu Asn Ser Trp Asn Val Ser Asn Val Lys Thr Met Glu 260 265 270Cys Met Phe Arg Gly Thr Glu Ala Phe Asn Gln Pro Leu Asp Lys Trp 275 280 285Asp Thr Lys Lys Leu Lys Thr Met Phe Gly Met Phe Asp Phe Ala Glu 290 295 300Gly Tyr Asn Ser Phe Asp Ser Leu Ala Asn Trp Asp Leu Asn Lys Val305 310 315 320Ser Glu Met Ser Asn Leu Cys Phe Lys Arg Tyr Glu Glu Leu Pro Leu 325 330 335Arg Ile Lys Ala Tyr Leu Gln Ala Phe Tyr Gly Ser Tyr Lys Asp Tyr 340 345 350Leu Thr Val Thr Lys Asp Asn Val Lys Glu Ile Tyr Asp Leu Ile Ser 355 360 365Lys Asp Thr Asn Lys Lys Val Leu Ser Phe Lys Lys Arg Leu Glu Ser 370 375 380Glu Phe Ser Glu Glu Leu Ser Ser Val Thr Asp Asn Tyr Asn Phe Lys385 390 395 400Ser Ile Glu Glu Ala Glu Lys Tyr Val Glu Asn Asn Tyr Asn Lys Lys 405 410 415Asp Asp Lys Lys Val Ser Phe Ile Asn Asp Tyr Lys Val Leu Ile Lys 420 425 430Asp Lys Ser Arg Glu Val Glu Asn Lys Val Leu Lys Tyr Ile Tyr Leu 435 440 445Glu Tyr Leu Leu Leu Lys Arg Asp Val Lys Lys Leu Val Gln Ile Asp 450 455 460Asn Ile Val Asn Leu Leu Asp Lys Glu Ser Phe Ile Lys Phe Ile Lys465 470 475 480Asn Val Tyr Asp Glu Thr Asn Lys Glu Thr Ala Ala Phe Ile Tyr Gly 485 490 495Ile Tyr Gly Gly Asp Glu Ala Val Lys Asn Ile Tyr Lys Lys Glu Lys 500 505 510Asp Thr Lys Leu Ser Leu Leu Ile Ile Lys Leu Asn Ile Glu Ser Lys 515 520 525Tyr Ala Leu Arg Ile Leu Tyr Glu Ile Tyr Ser Asn Thr Lys Lys Ser 530 535 540Glu Val Ser Tyr Glu Ala Asp Lys Leu Ile Asp Glu Val Met Glu Lys545 550 555 560Met Asp Ile Ser Tyr Asn Glu Phe Gln Leu Arg Tyr Ser Ser Asp Leu 565 570 575Gly Phe Asn Ser Lys Gly Glu Lys Glu Leu Asn Lys Asp Tyr Lys Leu 580 585 590Ile Leu Asn Ser Asp Tyr Ser Leu Ser Leu Phe Asp Ile Lys Asn Asn 595 600 605Lys Glu Leu Lys Lys Ala Pro Gln Asn Leu Asn Glu Asp Leu Lys Glu 610 615 620Glu Ile Thr Lys Leu Arg Lys Glu Ile Pro Tyr Phe Met Lys Asn Thr625 630 635 640Ala Ser Leu Leu Ala Val Leu Leu Ala Ser Gly Glu Lys Tyr Ser Tyr 645 650 655Asp Leu Phe Lys Glu Ile Phe Ile Asp Asn Ala Ile Met Asn Arg Phe 660 665 670Ala Ser Ser Leu Ile Trp Asn Leu Tyr Asp Lys Asp Ser Asn Phe Ile 675 680 685Thr Thr Phe Arg Tyr Ser Gly Asp Gly Ser Tyr Ser Asn Cys Glu Asp 690 695 700Glu Glu Val Lys Ile Asn Asp Asn Ser Phe Val Ser Leu Ala Ser Pro705 710 715 720Val Glu Met Asp Asp Glu Thr Ile Asp Lys Trp Arg Lys Gln Leu Glu 725 730 735Asp Tyr Glu Ile Ala Gln Pro Ile Ser Gln Leu Thr Val Ile Lys Leu 740 745 750Asp Lys Asp Asn Leu Lys Ser Glu Val Glu Lys Ile Asp Asn Leu Glu 755 760 765Ile Ala Tyr Gly Thr Phe Lys Ala Phe Gly Glu Arg Tyr Glu Met Tyr 770 775 780Ser Glu Tyr Ile Gly Tyr Asp Val Val Lys Ser Tyr Ser Leu Glu Ser785 790 795 800Lys Asn Gly Asp Thr Phe Thr Ile Asp Ala Asp Val Asn Ser Lys Thr 805 810 815Asp Phe His Asp Arg Val Lys Ile Asn Ile Asn Phe Asp Asn Glu Asn 820 825 830Gly Glu Glu Val Ser Lys Arg Phe Ile Tyr Thr Leu Leu Val Leu Met 835 840 845Ile Trp Asp Phe Arg Leu Thr Asp Leu Phe 850 855352100DNABrachyspira hyodysenteriae 35atgagaataa aacttctagc ggttatagta ttatttttaa tgactatatc gctttcatac 60actttcgaca aaactccgta ttatgtaaac acagaaactt atgactcata cagagagtta 120ttgagagggg tgcattatta taatcaggaa agatatgatg catccatagc tagttttaga 180aactctctta atacaaatcc tactgataag ttcataagat attggtatag taagtcttta 240tacaaagccg gatatatgtc cttagctatt aatgaatggc ttaatattac gagaatgggt 300tatgaagatc ctataatact ttctaaaatt aataaatatg attctgcaaa tgttaatgaa 360gagagagaaa atattttgag taattttatt tatttgaaag cattctctac aaatcttaat 420tttagaaaaa atattaatca gcctatacaa ataaaagtaa tgtctgatgg aagtttatat 480gttttggatt atagtgattc ttcattaaag aaatttgata ttaatggaaa tctaataggt 540aaaatatccc atggaaaaag attagaaaaa cagcagacta gctggtggag aaatttactt 600cagtttgcag caaaagttta tccttatgaa aaattagaaa atcctagagg ttttgatata 660gatgcaaacg gatatatata tatagccaat actaaaaaag ataaaatatt aaaatatgat 720gctaatcata attatattac aaatattggg gtatccggtg taagtaatgg tcagcttctt 780ggaccttcat ctgttgctgt tgatagagaa ggaaatttat atgtttctga tacaggaaat 840aatagaatag ttatatttga tatagaagga aatttcttat atagttttgg aaaacttggt 900gaaaataatg gagagttctt ttctcctgcg ggcatagcgg ttgatgacaa atatatttat 960gttgctgata tgggtaataa aagaatacag caatttgatt tgagcggaaa ttatattcag 1020agtataaagc ataatttatt taatgagcct agaggtttat cttttgctaa agatggaaat 1080ctttatatag ctgatggaag taaggttttt tattataata tagctgaatc agattttaca 1140atatttaata attccgaaag atatacagta actcctactt ctattgctga gggacctgat 1200ggaaatatat atcttactga ttttatgtct ggaagaattg atgtatatac tagaaaagaa 1260gaatattacg ctaatttaga tgtatttgta gacagagaat atttaaatag attccctgtt 1320gttgtagctt ctgttacagt gagagataga gctatgaacc ctgtagttgg attaactcct 1380gaaaatttct ttgttacaga gaatgcaggt gttgctcata aagttggttt ttatgatgct 1440cctgaattgc atgaatatag attcgtgtat ttaatagaag atagtcttgc tgctaaacct 1500tatgagagca gaattaaaga agagattagt aattttacta tgagcttaac taataatgat 1560gaagttttag ttatacatta taatgatcag gtttacaagt ctgataatta tgatgctaga 1620aatttaagaa tacttgaaaa tgctaatgct ttccatttta caggcggaat atctgctttg 1680gatgatgctt attatgaagc tataagactt tcaggaaata gttttaagaa aactgctatt 1740atacattttt cagtaactag tcctgacgac agagtatttg atatgatgaa ctttaatgat 1800gtagcaagtt ttgctaaaaa caatgcagtt tcattaaacc aagtttatat cggtacaaat 1860aaatctaatt atttcttaga tttaatgact gagaatactt acggttatat tatagatgct 1920gattattcta taaattatac tgctgagctt aatagaatga aaaatataaa ttttggaaga 1980tatttcatat actataacag ttttagaaat ttagctcagt caggacagtt tagggctttg 2040aatgttaagg ttcaatatag agatatgtat ggtgaagaag aagttggtta tgtagtgcca 210036700PRTBrachyspira hyodysenteriae 36Met Arg Ile Lys Leu Leu Ala Val Ile Val Leu Phe Leu Met Thr Ile1 5 10 15Ser Leu Ser Tyr Thr Phe Asp Lys Thr Pro Tyr Tyr Val Asn Thr Glu 20 25 30Thr Tyr Asp Ser Tyr Arg Glu Leu Leu Arg Gly Val His Tyr Tyr Asn 35 40 45Gln Glu Arg Tyr Asp Ala Ser Ile Ala Ser Phe Arg Asn Ser Leu Asn 50 55 60Thr Asn Pro Thr Asp Lys Phe Ile Arg Tyr Trp Tyr Ser Lys Ser Leu65 70 75 80Tyr Lys Ala Gly Tyr Met Ser Leu Ala Ile Asn Glu Trp Leu Asn Ile 85 90 95Thr Arg Met Gly Tyr Glu Asp Pro Ile Ile Leu Ser Lys Ile Asn Lys 100 105 110Tyr Asp Ser Ala Asn Val Asn Glu Glu Arg Glu Asn Ile Leu Ser Asn 115 120 125Phe Ile Tyr Leu Lys Ala Phe Ser Thr Asn Leu Asn Phe Arg Lys Asn 130 135 140Ile Asn Gln Pro Ile Gln Ile Lys Val Met Ser Asp Gly Ser Leu Tyr145 150 155 160Val Leu Asp Tyr Ser Asp Ser Ser Leu Lys Lys Phe Asp Ile Asn Gly 165 170 175Asn Leu Ile Gly Lys Ile Ser His Gly Lys Arg Leu Glu Lys Gln Gln 180 185 190Thr Ser Trp Trp Arg Asn Leu Leu Gln Phe Ala Ala Lys Val Tyr Pro 195 200 205Tyr Glu Lys Leu Glu Asn Pro Arg Gly Phe Asp Ile Asp Ala Asn Gly 210 215 220Tyr Ile Tyr Ile Ala Asn Thr Lys Lys Asp Lys Ile Leu Lys Tyr Asp225 230 235 240Ala Asn His Asn Tyr Ile Thr Asn Ile Gly Val Ser Gly Val Ser Asn 245 250 255Gly Gln Leu Leu Gly Pro Ser Ser Val Ala Val Asp Arg Glu Gly Asn 260 265 270Leu Tyr Val Ser Asp Thr Gly Asn Asn Arg Ile Val Ile Phe Asp Ile 275 280 285Glu Gly Asn Phe Leu Tyr Ser Phe Gly Lys Leu Gly Glu Asn Asn Gly 290 295 300Glu Phe Phe Ser Pro Ala Gly Ile Ala Val Asp Asp Lys Tyr Ile Tyr305 310 315 320Val Ala Asp Met Gly Asn Lys Arg Ile Gln Gln Phe Asp Leu Ser Gly 325 330 335Asn Tyr Ile Gln Ser Ile Lys His Asn Leu Phe Asn Glu Pro Arg Gly 340 345 350Leu Ser Phe Ala Lys Asp Gly Asn Leu Tyr Ile Ala Asp Gly Ser Lys 355 360 365Val Phe Tyr Tyr Asn Ile Ala Glu Ser Asp Phe Thr Ile Phe Asn Asn 370 375 380Ser Glu Arg Tyr Thr Val Thr Pro Thr Ser Ile Ala Glu Gly Pro Asp385 390 395 400Gly Asn Ile Tyr Leu Thr Asp Phe Met Ser Gly Arg Ile Asp Val Tyr 405 410 415Thr Arg Lys Glu Glu Tyr Tyr Ala Asn Leu Asp Val Phe Val Asp Arg 420 425 430Glu Tyr Leu Asn Arg Phe Pro Val Val Val Ala Ser Val Thr Val Arg 435 440 445Asp Arg Ala Met Asn Pro Val Val Gly Leu Thr Pro Glu Asn Phe Phe 450 455 460Val Thr Glu Asn Ala Gly Val Ala His Lys Val Gly Phe Tyr Asp Ala465 470 475 480Pro Glu Leu His Glu Tyr Arg Phe Val Tyr Leu Ile Glu Asp Ser Leu 485 490 495Ala Ala Lys Pro Tyr Glu Ser Arg Ile Lys Glu Glu Ile Ser Asn Phe 500 505 510Thr Met Ser Leu Thr Asn Asn Asp Glu Val Leu Val Ile His Tyr Asn 515 520 525Asp Gln Val Tyr Lys Ser Asp Asn Tyr Asp Ala Arg Asn Leu Arg Ile 530 535 540Leu Glu Asn Ala Asn Ala Phe His Phe Thr Gly Gly Ile Ser Ala Leu545 550 555 560Asp Asp Ala Tyr Tyr Glu Ala Ile Arg Leu Ser Gly Asn Ser Phe Lys 565 570 575Lys Thr Ala Ile Ile His Phe Ser Val Thr Ser Pro Asp Asp Arg Val 580 585 590Phe Asp Met Met Asn Phe Asn Asp Val Ala Ser Phe Ala Lys Asn Asn 595 600 605Ala Val Ser Leu Asn Gln Val Tyr Ile Gly Thr Asn Lys Ser Asn Tyr 610 615 620Phe Leu Asp Leu Met Thr Glu Asn Thr Tyr Gly Tyr Ile Ile Asp Ala625 630 635 640Asp Tyr Ser Ile Asn Tyr Thr Ala Glu Leu Asn Arg Met Lys Asn Ile 645 650 655Asn Phe Gly Arg Tyr Phe Ile Tyr Tyr Asn Ser Phe Arg Asn Leu Ala 660 665 670Gln Ser Gly Gln Phe Arg Ala Leu Asn Val Lys Val Gln Tyr Arg Asp 675 680 685Met Tyr Gly Glu Glu Glu Val Gly Tyr Val Val Pro 690 695 70037711DNABrachyspira hyodysenteriae 37atgatagaat caatacaaag aatacatgcc agaataggcg agattcagga tacttttaat 60aaattaggtt ttgctcctat taatactcag attcctacta aaccttttgc tgaacattta 120aatgaagcta tggcagaaaa caaagtcaat aatattgatg gttctatagt taatgataca 180aataaaaagt tagataatgg aaaagtaatt aatggagata cttcttctga tgctttcaaa 240ggaaatatat catttggtgt ttatgatagt aatacaaata attttgctaa agctataaat 300gcttataaaa aagcttcagt agaaagtttc cctactaaat atgatgatat aattaaagag 360gcagcagaga aatattcttt gcctgaaaat ttaataaaag cggttataaa gcaggaatca 420aactatgtgc ctaatgctgt aagtcataaa ggtgctgttg gtttgatgca gataatgccg 480caaacaggtg ttggcttagg tattactgat acagaaatgc ttaaagatcc atacactaat 540ataatggctg gaagcagata tttatcacag atgttaaaca gatatgatgg aagacttgat 600ttatctttat ctgcttataa tgccggacct gctttggtag acagattaca gagaatccct 660aatatagagg aaactcaaaa ctatgttaaa aacattatag gatatataaa g 71138237PRTBrachyspira hyodysenteriae 38Met Ile Glu Ser Ile Gln Arg Ile His Ala Arg Ile Gly Glu Ile Gln1 5 10 15Asp Thr Phe Asn Lys Leu Gly Phe Ala Pro Ile Asn Thr Gln Ile Pro 20 25 30Thr Lys Pro Phe Ala Glu His Leu Asn Glu Ala Met Ala Glu Asn Lys 35 40 45Val Asn Asn Ile Asp Gly Ser Ile Val Asn Asp Thr Asn Lys Lys Leu 50 55 60Asp Asn Gly Lys Val Ile Asn Gly Asp Thr Ser Ser Asp Ala Phe Lys65 70 75 80Gly Asn Ile Ser Phe Gly Val Tyr Asp Ser Asn Thr Asn Asn Phe Ala 85 90 95Lys Ala Ile Asn Ala Tyr Lys Lys Ala Ser Val Glu Ser Phe Pro Thr 100 105 110Lys Tyr Asp Asp Ile Ile Lys Glu Ala Ala Glu Lys Tyr Ser Leu Pro 115 120 125Glu Asn Leu Ile Lys Ala Val Ile Lys Gln Glu Ser Asn Tyr Val Pro 130 135 140Asn Ala Val Ser His Lys Gly Ala Val Gly Leu Met Gln Ile Met Pro145 150 155 160Gln Thr Gly Val Gly Leu Gly Ile Thr Asp Thr Glu Met Leu Lys Asp 165 170 175Pro Tyr Thr Asn Ile Met Ala Gly Ser Arg Tyr Leu Ser Gln Met Leu 180 185 190Asn Arg Tyr Asp Gly Arg Leu Asp Leu Ser Leu Ser Ala Tyr Asn Ala 195 200 205Gly Pro Ala Leu Val Asp Arg Leu Gln Arg Ile Pro Asn Ile Glu Glu 210 215 220Thr Gln Asn Tyr Val Lys Asn Ile Ile Gly Tyr Ile Lys225 230 23539258DNABrachyspira hyodysenteriae 39atgaaaatag tttttaatga aagagcttgg caggaatata tagagtgggt atcagaagat 60aaaaaaatag taaaaaaaat taacgacttg attaaagata taataagaaa tccttgtgat 120ggaataggaa aagcagaaaa attaaaatat gataaaaaag atctttactc tagaagaata 180aataaagaac atagattagt atatcatata gaaaataatc aattaataat aacatcttgt 240aaataccatt atgataag 2584086PRTBrachyspira hyodysenteriae 40Met Lys Ile Val Phe Asn Glu Arg Ala Trp Gln Glu Tyr Ile Glu Trp1 5 10 15Val Ser Glu Asp Lys Lys Ile Val Lys Lys Ile Asn Asp Leu Ile Lys 20 25 30Asp Ile Ile Arg Asn Pro Cys Asp Gly Ile Gly Lys Ala Glu Lys Leu 35 40 45Lys Tyr Asp Lys Lys Asp Leu Tyr Ser Arg Arg Ile Asn Lys Glu His 50 55 60Arg Leu Val Tyr His Ile Glu Asn Asn Gln Leu Ile Ile Thr Ser Cys65 70 75 80Lys Tyr His Tyr Asp Lys 85412646DNABrachyspira hyodysenteriae 41gtggagattt tagtgaattt tattaagaaa aattgtatta ttttattttc atttctttta 60cttgctgcag ctttattaat atctgcagag agtgactttg aaaatttaca aacagcaaga 120aatatagctg tatatgaagg gcttacaata aaccgtatag atgttacagg tgaagtaagg 180cttacaaagg aacaaataat aaacaatttt cctataaaag ccggcagtaa atttcaaaga 240acagaaataa atgcagccat aaaaaaacta tttgatacgc agttattcga tagagtggca 300atagatgcaa acagagaaga tgacggagta gttttaaata ttgtagtagc tgaaagattc 360ataataaaag atatagaata tataggaaat aaaagattaa gcagaacagc acttaatgat 420gccgtaaaac caattatgaa agcaggtgat ccttatatac ctcagaaatt aaatgatgct 480gttaatgcta taataacaaa ttatcaagat aaaggatatt tgaaagctta tgttgagcct 540aaagtaatag aaaataaaga tacttctgat gttttaatac aaatgaacat agtagaaggt 600aatgaagtta aggttgctaa tataagattc catggtaata cacattttac tgataatgaa 660cttaaaagac agatgtcaac aaaagaaaat ggatttatga ctcttggaaa atttaatgag 720tttacatttg atggagacaa agataaaatt gttaaatact atgcagatag aggttactat 780agagccaaag ttgataatgt aaagttcaca tatcaatgga gaaatcctga aataaaaaat 840gaacaggatt taataataga tatatatgtt acagagggag ataaatatta tttcggagat 900ataggattta aaggaaactt tataatacct tctgaaaata tacaaaaaga tataaaatca 960aaaaaaggtg ctttatataa ttacacatat catatggcag actatcaggg tatacaaaat 1020aaatattctg aaagaggtta tatattcaga caagttatac ctgtaattac agtaaatgaa 1080gaaaataaaa tagtaaatat aatgtatgat attgttgaaa atgataaagt gcatatagaa 1140aatattacta tagcaggaaa tacaaaaact aaagattttg ttatagaaag atatatagat 1200ataaaacccg gagaagtatt caatactgca aaaatacaaa gagttcaaga gagattatat 1260aatactcaat tctttgataa tattaattta ggagtaaaac ctggttctgc tgaaggactt 1320atggaattaa atttaagtgt

aactgaagga agaacagcta tggtatcagg aggaggcggt 1380ttctccactg gttccggatt taaggtattt gcttctatta gagaaaataa cttcttagga 1440agaggattgc agttaggatt aagcggagaa tttggagagc agcagaaacg tatagctgtt 1500aactttgctg agccttattt acttaatctg cctatatatt tgggtgtgga tttatcatac 1560ttcaatgaag gtgtaaacac tggttatcaa ataggaaccg atggtaattt tggtatacct 1620aaatactcat actatactag acatggtttt gaaggtatag taagactagg ttattacttt 1680gctgattatt attctacatt cataacattt gataccatag tacagcagta tcagcaatgg 1740catgaccaag gagctactgc tgccggtcct aattatgttc ttagtgatat aaaaaaatat 1800ttaactcata gagttaataa aaaagatgga tcattccaaa gatgggaaag tgattggttt 1860acaacattca ttgtttcata ttctttactt agagatagca gaaacgatta tttgaaccct 1920actagaggaa gtttcttgag aggtatggta gatttctatt ttggacacac ccagcttaca 1980agattgagtg ctacaggatt cttggctgta cctgctacag aatggctgtc atttgcattc 2040tatggagaat taggacaaat aattgctact cctggacttg ctttgcaaaa tgatgctgat 2100gttctttatt atcttaaccc atttgaagat gtaaggggat gggatacttc caaatatact 2160atatttaaga aaaacagagg attatcaact tatgatatgt taggagccaa cggttcagac 2220ggtaaaccta ctactgactc ttggagttac ggtagagcaa aagtaagatt ctttgctgaa 2280cttcgtatac ctataatacc taaaactctt ggattcgtta ctttccttga tgcaggacaa 2340ttatggatgc catacagtac aggttggaat caggacggag atgctcattc atatccttct 2400caatttatga atattaaaga tatatttgat ccttctcaat atatatattc tgtaggaata 2460ggattcagac ttacaatacc tatattcaat ataagattct atattgctaa aagattcgtt 2520tacaataaag aagatgttgg atttggtaaa ggatttcaag attttgaagg agatactttc 2580actcctcttg gtgcttggtt cggaagagga tggggaattg catttactat gaaccaccca 2640ttctat 264642882PRTBrachyspira hyodysenteriae 42Val Glu Ile Leu Val Asn Phe Ile Lys Lys Asn Cys Ile Ile Leu Phe1 5 10 15Ser Phe Leu Leu Leu Ala Ala Ala Leu Leu Ile Ser Ala Glu Ser Asp 20 25 30Phe Glu Asn Leu Gln Thr Ala Arg Asn Ile Ala Val Tyr Glu Gly Leu 35 40 45Thr Ile Asn Arg Ile Asp Val Thr Gly Glu Val Arg Leu Thr Lys Glu 50 55 60Gln Ile Ile Asn Asn Phe Pro Ile Lys Ala Gly Ser Lys Phe Gln Arg65 70 75 80Thr Glu Ile Asn Ala Ala Ile Lys Lys Leu Phe Asp Thr Gln Leu Phe 85 90 95Asp Arg Val Ala Ile Asp Ala Asn Arg Glu Asp Asp Gly Val Val Leu 100 105 110Asn Ile Val Val Ala Glu Arg Phe Ile Ile Lys Asp Ile Glu Tyr Ile 115 120 125Gly Asn Lys Arg Leu Ser Arg Thr Ala Leu Asn Asp Ala Val Lys Pro 130 135 140Ile Met Lys Ala Gly Asp Pro Tyr Ile Pro Gln Lys Leu Asn Asp Ala145 150 155 160Val Asn Ala Ile Ile Thr Asn Tyr Gln Asp Lys Gly Tyr Leu Lys Ala 165 170 175Tyr Val Glu Pro Lys Val Ile Glu Asn Lys Asp Thr Ser Asp Val Leu 180 185 190Ile Gln Met Asn Ile Val Glu Gly Asn Glu Val Lys Val Ala Asn Ile 195 200 205Arg Phe His Gly Asn Thr His Phe Thr Asp Asn Glu Leu Lys Arg Gln 210 215 220Met Ser Thr Lys Glu Asn Gly Phe Met Thr Leu Gly Lys Phe Asn Glu225 230 235 240Phe Thr Phe Asp Gly Asp Lys Asp Lys Ile Val Lys Tyr Tyr Ala Asp 245 250 255Arg Gly Tyr Tyr Arg Ala Lys Val Asp Asn Val Lys Phe Thr Tyr Gln 260 265 270Trp Arg Asn Pro Glu Ile Lys Asn Glu Gln Asp Leu Ile Ile Asp Ile 275 280 285Tyr Val Thr Glu Gly Asp Lys Tyr Tyr Phe Gly Asp Ile Gly Phe Lys 290 295 300Gly Asn Phe Ile Ile Pro Ser Glu Asn Ile Gln Lys Asp Ile Lys Ser305 310 315 320Lys Lys Gly Ala Leu Tyr Asn Tyr Thr Tyr His Met Ala Asp Tyr Gln 325 330 335Gly Ile Gln Asn Lys Tyr Ser Glu Arg Gly Tyr Ile Phe Arg Gln Val 340 345 350Ile Pro Val Ile Thr Val Asn Glu Glu Asn Lys Ile Val Asn Ile Met 355 360 365Tyr Asp Ile Val Glu Asn Asp Lys Val His Ile Glu Asn Ile Thr Ile 370 375 380Ala Gly Asn Thr Lys Thr Lys Asp Phe Val Ile Glu Arg Tyr Ile Asp385 390 395 400Ile Lys Pro Gly Glu Val Phe Asn Thr Ala Lys Ile Gln Arg Val Gln 405 410 415Glu Arg Leu Tyr Asn Thr Gln Phe Phe Asp Asn Ile Asn Leu Gly Val 420 425 430Lys Pro Gly Ser Ala Glu Gly Leu Met Glu Leu Asn Leu Ser Val Thr 435 440 445Glu Gly Arg Thr Ala Met Val Ser Gly Gly Gly Gly Phe Ser Thr Gly 450 455 460Ser Gly Phe Lys Val Phe Ala Ser Ile Arg Glu Asn Asn Phe Leu Gly465 470 475 480Arg Gly Leu Gln Leu Gly Leu Ser Gly Glu Phe Gly Glu Gln Gln Lys 485 490 495Arg Ile Ala Val Asn Phe Ala Glu Pro Tyr Leu Leu Asn Leu Pro Ile 500 505 510Tyr Leu Gly Val Asp Leu Ser Tyr Phe Asn Glu Gly Val Asn Thr Gly 515 520 525Tyr Gln Ile Gly Thr Asp Gly Asn Phe Gly Ile Pro Lys Tyr Ser Tyr 530 535 540Tyr Thr Arg His Gly Phe Glu Gly Ile Val Arg Leu Gly Tyr Tyr Phe545 550 555 560Ala Asp Tyr Tyr Ser Thr Phe Ile Thr Phe Asp Thr Ile Val Gln Gln 565 570 575Tyr Gln Gln Trp His Asp Gln Gly Ala Thr Ala Ala Gly Pro Asn Tyr 580 585 590Val Leu Ser Asp Ile Lys Lys Tyr Leu Thr His Arg Val Asn Lys Lys 595 600 605Asp Gly Ser Phe Gln Arg Trp Glu Ser Asp Trp Phe Thr Thr Phe Ile 610 615 620Val Ser Tyr Ser Leu Leu Arg Asp Ser Arg Asn Asp Tyr Leu Asn Pro625 630 635 640Thr Arg Gly Ser Phe Leu Arg Gly Met Val Asp Phe Tyr Phe Gly His 645 650 655Thr Gln Leu Thr Arg Leu Ser Ala Thr Gly Phe Leu Ala Val Pro Ala 660 665 670Thr Glu Trp Leu Ser Phe Ala Phe Tyr Gly Glu Leu Gly Gln Ile Ile 675 680 685Ala Thr Pro Gly Leu Ala Leu Gln Asn Asp Ala Asp Val Leu Tyr Tyr 690 695 700Leu Asn Pro Phe Glu Asp Val Arg Gly Trp Asp Thr Ser Lys Tyr Thr705 710 715 720Ile Phe Lys Lys Asn Arg Gly Leu Ser Thr Tyr Asp Met Leu Gly Ala 725 730 735Asn Gly Ser Asp Gly Lys Pro Thr Thr Asp Ser Trp Ser Tyr Gly Arg 740 745 750Ala Lys Val Arg Phe Phe Ala Glu Leu Arg Ile Pro Ile Ile Pro Lys 755 760 765Thr Leu Gly Phe Val Thr Phe Leu Asp Ala Gly Gln Leu Trp Met Pro 770 775 780Tyr Ser Thr Gly Trp Asn Gln Asp Gly Asp Ala His Ser Tyr Pro Ser785 790 795 800Gln Phe Met Asn Ile Lys Asp Ile Phe Asp Pro Ser Gln Tyr Ile Tyr 805 810 815Ser Val Gly Ile Gly Phe Arg Leu Thr Ile Pro Ile Phe Asn Ile Arg 820 825 830Phe Tyr Ile Ala Lys Arg Phe Val Tyr Asn Lys Glu Asp Val Gly Phe 835 840 845Gly Lys Gly Phe Gln Asp Phe Glu Gly Asp Thr Phe Thr Pro Leu Gly 850 855 860Ala Trp Phe Gly Arg Gly Trp Gly Ile Ala Phe Thr Met Asn His Pro865 870 875 880Phe Tyr431308DNABrachyspira hyodysenteriae 43atgaaacgtt tatattttat tttatcagct ttattaataa ctgcttatag tgcatttagt 60tatactgttg tagaagattt caatgatttt ttagttgatg aaaatcaatt aagaataagg 120cttgacagat tcggagtatt ggcaggaaca gagaatttaa gatttatggt tggagtatca 180ggagaaactg caggagtatt gcttgataat ttagacagag gtactaaagg aggaataaat 240acattcagac cggcagcaat agcaggattt ggatataaaa cagaaagttt tggtataggt 300gtaggttatc agtttaaata tatatcagga agctggcagt cgcatactcc tataataaca 360gcaacagctt tgaatgataa cttgagaatc aatgtacctg ttacaatagg agtaggaagc 420ggaaatgtta atgacggaga tatagcagtt tcaacagata ctagaataga atattataca 480ggaaacaata tattcagcag aataagagtt aatcttaaat atggtatgta tagattaaaa 540gctaatgaaa gcagaagcgg agatttgaca ggaagcggaa atataaatat gggtactgta 600agtggaactg taggcgagaa tggtaaatat ggatttctta aagatactac agcacattct 660ataggaatag atgtaagagg ttattttata gcggcaacag atcctgtatt agtagagcct 720cagataagag tattatatca aggttctata gcggatttta caggtacttc atataaagta 780acaacaccca ctggaactaa agaaggagga gcaggattcg gactctataa tatagatgct 840tcaaatccta taggtgcttt ttcaataggt gatacaggtt caatacaatc agtgccttat 900tatgatttta ctgctcataa tataatgttt acaggtgaag gagcttcaat agagatagga 960ggtacagaat attatcttac aaagccgcag tttttaggaa tatccgttcc tgtggggttt 1020actgctgaaa gtgagtttat tacattgtat ttggagcctg ctttatcatt ctctatgatt 1080acaggaggaa ttaattctta tgcaagcagt gctaagcctg taagaatacc gcctttattt 1140tattcggttg gatatttggt atatggagaa ttatatataa ctcctaaacc taatttagaa 1200tggtattttg aggctcagat tggaagtgct acaactattg atagtatagg agatagtaaa 1260cagggaggtt tagctttcaa tggaagtacc ggtatcactt ggaagttt 130844436PRTBrachyspira hyodysenteriae 44Met Lys Arg Leu Tyr Phe Ile Leu Ser Ala Leu Leu Ile Thr Ala Tyr1 5 10 15Ser Ala Phe Ser Tyr Thr Val Val Glu Asp Phe Asn Asp Phe Leu Val 20 25 30Asp Glu Asn Gln Leu Arg Ile Arg Leu Asp Arg Phe Gly Val Leu Ala 35 40 45Gly Thr Glu Asn Leu Arg Phe Met Val Gly Val Ser Gly Glu Thr Ala 50 55 60Gly Val Leu Leu Asp Asn Leu Asp Arg Gly Thr Lys Gly Gly Ile Asn65 70 75 80Thr Phe Arg Pro Ala Ala Ile Ala Gly Phe Gly Tyr Lys Thr Glu Ser 85 90 95Phe Gly Ile Gly Val Gly Tyr Gln Phe Lys Tyr Ile Ser Gly Ser Trp 100 105 110Gln Ser His Thr Pro Ile Ile Thr Ala Thr Ala Leu Asn Asp Asn Leu 115 120 125Arg Ile Asn Val Pro Val Thr Ile Gly Val Gly Ser Gly Asn Val Asn 130 135 140Asp Gly Asp Ile Ala Val Ser Thr Asp Thr Arg Ile Glu Tyr Tyr Thr145 150 155 160Gly Asn Asn Ile Phe Ser Arg Ile Arg Val Asn Leu Lys Tyr Gly Met 165 170 175Tyr Arg Leu Lys Ala Asn Glu Ser Arg Ser Gly Asp Leu Thr Gly Ser 180 185 190Gly Asn Ile Asn Met Gly Thr Val Ser Gly Thr Val Gly Glu Asn Gly 195 200 205Lys Tyr Gly Phe Leu Lys Asp Thr Thr Ala His Ser Ile Gly Ile Asp 210 215 220Val Arg Gly Tyr Phe Ile Ala Ala Thr Asp Pro Val Leu Val Glu Pro225 230 235 240Gln Ile Arg Val Leu Tyr Gln Gly Ser Ile Ala Asp Phe Thr Gly Thr 245 250 255Ser Tyr Lys Val Thr Thr Pro Thr Gly Thr Lys Glu Gly Gly Ala Gly 260 265 270Phe Gly Leu Tyr Asn Ile Asp Ala Ser Asn Pro Ile Gly Ala Phe Ser 275 280 285Ile Gly Asp Thr Gly Ser Ile Gln Ser Val Pro Tyr Tyr Asp Phe Thr 290 295 300Ala His Asn Ile Met Phe Thr Gly Glu Gly Ala Ser Ile Glu Ile Gly305 310 315 320Gly Thr Glu Tyr Tyr Leu Thr Lys Pro Gln Phe Leu Gly Ile Ser Val 325 330 335Pro Val Gly Phe Thr Ala Glu Ser Glu Phe Ile Thr Leu Tyr Leu Glu 340 345 350Pro Ala Leu Ser Phe Ser Met Ile Thr Gly Gly Ile Asn Ser Tyr Ala 355 360 365Ser Ser Ala Lys Pro Val Arg Ile Pro Pro Leu Phe Tyr Ser Val Gly 370 375 380Tyr Leu Val Tyr Gly Glu Leu Tyr Ile Thr Pro Lys Pro Asn Leu Glu385 390 395 400Trp Tyr Phe Glu Ala Gln Ile Gly Ser Ala Thr Thr Ile Asp Ser Ile 405 410 415Gly Asp Ser Lys Gln Gly Gly Leu Ala Phe Asn Gly Ser Thr Gly Ile 420 425 430Thr Trp Lys Phe 435452367DNABrachyspira hyodysenteriae 45atgaaatata aacctacaag caggaaagaa ttaaaagatt tagtaacaga tgaaagtatt 60tatttgggtg atattgatac tagcttaata actgatatgt caaacttatt tgattttttt 120aatagagata attatgacgg tatagaaaat tgggatactt ctaatgtaga aaatatggct 180ggtatgtttt ctgctaatag gaattttaat aaagatatta gtaaatggaa tgtatctaaa 240gtgaaaaata cagcttatat gtttttcttg gctgaaaaat ttaatcagcc tttgaatgat 300tgggacgtta gtaatgtaat aaatatgaat agcatgttta tgaatgctaa aagttttaat 360cagcctatta ataattggaa tgtaagtaaa gttcaaagta tgagcaatat gtttaatcgt 420gccgaaagtt ttaatcaaaa tataaatgat tggaatgtaa gtaatgtaga aaatatgaat 480catatgtttt catctgccta taaattcaat cagcctttat ttaaatggga tacttctaaa 540gtaaaagaga tggctggtat gttttcatta gcttatgcat ttaatcagcc tcttaacaat 600tggaatgtaa gcaatgttac taatatgagg tgcatgttta tgtttgcaag agattttaat 660aagcctatta ataattggaa tacaaaaaaa ttaaaagatg caggaagtat gttctcaaat 720acatcggcat tcaatcagaa tttagatgat tggaatattg ataatctttc agatatgagt 780aattttaata aagattctaa attagaatta acatttaaat tcaaaattta tttatatgct 840ttaactttag aaaaagaaga aaaaaataat ttacatgatt ttataaaaaa caatgtaaaa 900aagatatatg aaattataga aaatcataaa aacaagaagg ttaatcttct taaaagatat 960ttaataaata atttttatag tgaattaaaa gaattaatac cagattatat tgaaagtttt 1020aatagcatag aagaagttta taattatata gacaaaaatt ataataaaaa agatgataaa 1080aaagtaaaat ttatagatga tataaaaatt gaaaatatag ataaaagaat aataaaatat 1140atttacttat catatttaga attaaaaaga gaagcctaca gaataaagca aatagattat 1200attataaatt taattgataa aaaatctttt ataaatgcaa ttaaaacgat atacacaagc 1260accaataaag aaacatctct aattatgtac ggaatatacg gaggagatga ggcattaaga 1320gagatttaca aaaaagaaaa agattcaaaa ttatgtttac ttgtattttc tatcaataaa 1380aacagtaaat atgctattaa tatgctttat aatgtattta agaaaagtaa aaaatatgaa 1440gtaaaagaga cagcagaaaa aattattgag gatatagcaa aagaaaataa tttgagcgtt 1500tatgaatttg gattaaaaac tataccaaat tttggattca atataaacgg tgaaaaaata 1560ataaataata atcaatataa aataattttg aaaaacgatt atactataga gttttttgat 1620atcaaagaaa ataaaatatt aaagcaaata cctaaatatt ttgataatag taccaaagaa 1680gaaattaaat atataaaaac agaaattcca aatattataa aaaatcaaag cagaaattta 1740ataaaaattt tattaacagg taaaaagtac tatttcaatt tttttaaaga aatatttatt 1800gataatccaa taatgaataa atttgcaatt aatttagttt ggaatttatt tgatgaaaat 1860aacaatttta taacgacatt taggtattca ggcgacggaa gttatacaaa ctacgatgat 1920aatacagtga atataaatga taattatttt gtaagtttat caagccctat agaaatggaa 1980gaaaaaatta tatcaaaatg gaaaaaacat cttgaagatt atgaattatc acagcctata 2040atgcagttta caaatataaa aataaataat ttagaagaag cattaaaaaa attagaaaat 2100atagaaataa gctacggtac aataaaagca ttttctcaaa agtatgatat gaatactgaa 2160tgtaaaagct attacgaaat taacggatat tcatttgaag actcatacaa taatcaagat 2220ttttatataa gaacaaaaat tatcaatact gaaaccaatt ataatgataa aataaaaatt 2280aatatagagt ttaacaatgc tagcaacaga tttatatata cttggcttat acttttaata 2340tgggatttta gattaactga aatattt 236746789PRTBrachyspira hyodysenteriae 46Met Lys Tyr Lys Pro Thr Ser Arg Lys Glu Leu Lys Asp Leu Val Thr1 5 10 15Asp Glu Ser Ile Tyr Leu Gly Asp Ile Asp Thr Ser Leu Ile Thr Asp 20 25 30Met Ser Asn Leu Phe Asp Phe Phe Asn Arg Asp Asn Tyr Asp Gly Ile 35 40 45Glu Asn Trp Asp Thr Ser Asn Val Glu Asn Met Ala Gly Met Phe Ser 50 55 60Ala Asn Arg Asn Phe Asn Lys Asp Ile Ser Lys Trp Asn Val Ser Lys65 70 75 80Val Lys Asn Thr Ala Tyr Met Phe Phe Leu Ala Glu Lys Phe Asn Gln 85 90 95Pro Leu Asn Asp Trp Asp Val Ser Asn Val Ile Asn Met Asn Ser Met 100 105 110Phe Met Asn Ala Lys Ser Phe Asn Gln Pro Ile Asn Asn Trp Asn Val 115 120 125Ser Lys Val Gln Ser Met Ser Asn Met Phe Asn Arg Ala Glu Ser Phe 130 135 140Asn Gln Asn Ile Asn Asp Trp Asn Val Ser Asn Val Glu Asn Met Asn145 150 155 160His Met Phe Ser Ser Ala Tyr Lys Phe Asn Gln Pro Leu Phe Lys Trp 165 170 175Asp Thr Ser Lys Val Lys Glu Met Ala Gly Met Phe Ser Leu Ala Tyr 180 185 190Ala Phe Asn Gln Pro Leu Asn Asn Trp Asn Val Ser Asn Val Thr Asn 195 200 205Met Arg Cys Met Phe Met Phe Ala Arg Asp Phe Asn Lys Pro Ile Asn 210 215 220Asn Trp Asn Thr Lys Lys Leu Lys Asp Ala Gly Ser Met Phe Ser Asn225 230 235 240Thr Ser Ala Phe Asn Gln Asn Leu Asp Asp Trp Asn Ile Asp Asn Leu 245 250 255Ser Asp Met Ser Asn Phe Asn Lys Asp Ser Lys Leu Glu Leu Thr Phe 260 265 270Lys Phe Lys Ile Tyr Leu Tyr Ala Leu Thr Leu Glu Lys Glu Glu Lys 275 280 285Asn Asn Leu His Asp Phe Ile Lys Asn Asn Val Lys Lys Ile Tyr Glu 290

295 300Ile Ile Glu Asn His Lys Asn Lys Lys Val Asn Leu Leu Lys Arg Tyr305 310 315 320Leu Ile Asn Asn Phe Tyr Ser Glu Leu Lys Glu Leu Ile Pro Asp Tyr 325 330 335Ile Glu Ser Phe Asn Ser Ile Glu Glu Val Tyr Asn Tyr Ile Asp Lys 340 345 350Asn Tyr Asn Lys Lys Asp Asp Lys Lys Val Lys Phe Ile Asp Asp Ile 355 360 365Lys Ile Glu Asn Ile Asp Lys Arg Ile Ile Lys Tyr Ile Tyr Leu Ser 370 375 380Tyr Leu Glu Leu Lys Arg Glu Ala Tyr Arg Ile Lys Gln Ile Asp Tyr385 390 395 400Ile Ile Asn Leu Ile Asp Lys Lys Ser Phe Ile Asn Ala Ile Lys Thr 405 410 415Ile Tyr Thr Ser Thr Asn Lys Glu Thr Ser Leu Ile Met Tyr Gly Ile 420 425 430Tyr Gly Gly Asp Glu Ala Leu Arg Glu Ile Tyr Lys Lys Glu Lys Asp 435 440 445Ser Lys Leu Cys Leu Leu Val Phe Ser Ile Asn Lys Asn Ser Lys Tyr 450 455 460Ala Ile Asn Met Leu Tyr Asn Val Phe Lys Lys Ser Lys Lys Tyr Glu465 470 475 480Val Lys Glu Thr Ala Glu Lys Ile Ile Glu Asp Ile Ala Lys Glu Asn 485 490 495Asn Leu Ser Val Tyr Glu Phe Gly Leu Lys Thr Ile Pro Asn Phe Gly 500 505 510Phe Asn Ile Asn Gly Glu Lys Ile Ile Asn Asn Asn Gln Tyr Lys Ile 515 520 525Ile Leu Lys Asn Asp Tyr Thr Ile Glu Phe Phe Asp Ile Lys Glu Asn 530 535 540Lys Ile Leu Lys Gln Ile Pro Lys Tyr Phe Asp Asn Ser Thr Lys Glu545 550 555 560Glu Ile Lys Tyr Ile Lys Thr Glu Ile Pro Asn Ile Ile Lys Asn Gln 565 570 575Ser Arg Asn Leu Ile Lys Ile Leu Leu Thr Gly Lys Lys Tyr Tyr Phe 580 585 590Asn Phe Phe Lys Glu Ile Phe Ile Asp Asn Pro Ile Met Asn Lys Phe 595 600 605Ala Ile Asn Leu Val Trp Asn Leu Phe Asp Glu Asn Asn Asn Phe Ile 610 615 620Thr Thr Phe Arg Tyr Ser Gly Asp Gly Ser Tyr Thr Asn Tyr Asp Asp625 630 635 640Asn Thr Val Asn Ile Asn Asp Asn Tyr Phe Val Ser Leu Ser Ser Pro 645 650 655Ile Glu Met Glu Glu Lys Ile Ile Ser Lys Trp Lys Lys His Leu Glu 660 665 670Asp Tyr Glu Leu Ser Gln Pro Ile Met Gln Phe Thr Asn Ile Lys Ile 675 680 685Asn Asn Leu Glu Glu Ala Leu Lys Lys Leu Glu Asn Ile Glu Ile Ser 690 695 700Tyr Gly Thr Ile Lys Ala Phe Ser Gln Lys Tyr Asp Met Asn Thr Glu705 710 715 720Cys Lys Ser Tyr Tyr Glu Ile Asn Gly Tyr Ser Phe Glu Asp Ser Tyr 725 730 735Asn Asn Gln Asp Phe Tyr Ile Arg Thr Lys Ile Ile Asn Thr Glu Thr 740 745 750Asn Tyr Asn Asp Lys Ile Lys Ile Asn Ile Glu Phe Asn Asn Ala Ser 755 760 765Asn Arg Phe Ile Tyr Thr Trp Leu Ile Leu Leu Ile Trp Asp Phe Arg 770 775 780Leu Thr Glu Ile Phe78547729DNABrachyspira hyodysenteriae 47atgataaaaa aaattttaac tttaatcttt gtattaattt tggcagcttc atgttctact 60aatgataaac atgttgtagt attagctttt agtaaacagc ttcatgctgt actttataat 120gataatagtc agtctacaaa aacagcatca aaaacatata tacaaaaaga tgatattaca 180actgtagcag atcctataaa agaaaaaaaa gaatatacaa atactcaagc acaagtaagt 240aaaaaagcag aagaaaaaaa agaagaactt acaaataacg atgctttaga agaagaaaaa 300cctcaagtta taaagcaaac tgaggttata cagaaagatg ataatgagat tcttcttact 360gcaaatataa tatcttttga ttttgattct tatgaattaa aaaatgaata taatgaaggg 420atagatgaaa tttgcaaata tttaaataat aatcgagata ttaatctaat aatagaagga 480catagcgaca gtatagggga ctcaaattat aatatatatt tatctgaaaa cagagcaaaa 540gcgatatttg ataaattagt agataaagga atagataaag atagacttag atatatagga 600tatggctcta ctcattcatc tgagtataat gataaagaca gaaaatgcca atttgttata 660ataaataatt cagatgaaga gcaggaatac aaaaaagaaa acgaaactga tattatcaaa 720ttaaaacaa 72948243PRTBrachyspira hyodysenteriae 48Met Ile Lys Lys Ile Leu Thr Leu Ile Phe Val Leu Ile Leu Ala Ala1 5 10 15Ser Cys Ser Thr Asn Asp Lys His Val Val Val Leu Ala Phe Ser Lys 20 25 30Gln Leu His Ala Val Leu Tyr Asn Asp Asn Ser Gln Ser Thr Lys Thr 35 40 45Ala Ser Lys Thr Tyr Ile Gln Lys Asp Asp Ile Thr Thr Val Ala Asp 50 55 60Pro Ile Lys Glu Lys Lys Glu Tyr Thr Asn Thr Gln Ala Gln Val Ser65 70 75 80Lys Lys Ala Glu Glu Lys Lys Glu Glu Leu Thr Asn Asn Asp Ala Leu 85 90 95Glu Glu Glu Lys Pro Gln Val Ile Lys Gln Thr Glu Val Ile Gln Lys 100 105 110Asp Asp Asn Glu Ile Leu Leu Thr Ala Asn Ile Ile Ser Phe Asp Phe 115 120 125Asp Ser Tyr Glu Leu Lys Asn Glu Tyr Asn Glu Gly Ile Asp Glu Ile 130 135 140Cys Lys Tyr Leu Asn Asn Asn Arg Asp Ile Asn Leu Ile Ile Glu Gly145 150 155 160His Ser Asp Ser Ile Gly Asp Ser Asn Tyr Asn Ile Tyr Leu Ser Glu 165 170 175Asn Arg Ala Lys Ala Ile Phe Asp Lys Leu Val Asp Lys Gly Ile Asp 180 185 190Lys Asp Arg Leu Arg Tyr Ile Gly Tyr Gly Ser Thr His Ser Ser Glu 195 200 205Tyr Asn Asp Lys Asp Arg Lys Cys Gln Phe Val Ile Ile Asn Asn Ser 210 215 220Asp Glu Glu Gln Glu Tyr Lys Lys Glu Asn Glu Thr Asp Ile Ile Lys225 230 235 240Leu Lys Gln49969DNABrachyspira hyodysenteriae 49atgaaaaaaa ttattttatt aatatttata ttattaaata tatcatgcag aaatatcatt 60acaatagcag aaaataaaaa aaatatagat aatgtaaata atgtacatat agaagaaaat 120gaatacttat atgctcttga aatagataaa gccaatcctc aaaatatgga agaagcatta 180aaaagatatg cagcagatca taatggaaaa tataaattaa tattcacagg tacatcaaca 240aaaaaatatg atgtttggac ttcaataagt caaatgcttg aagatatttc tttaaaaaac 300ataaaaatag aaatatcgat tgtaaatgta atttttccaa atggtaaaat acctgatttt 360ttatttggag gaaatgctgt aaataaatca atagtaaaaa taacatttcc aaatagcata 420actgaaatag gcgaatacag tattttttgt ccagaattaa cggaaataac acttccaagt 480aatttaagaa caataggcag aagaggatta ataggatgcg aaagtttaaa aatactgaaa 540cttcctaatt cattaaaaac aataggagaa ttatcattaa atggatgcgg atttgccagt 600attgtaattc ctgattctgt aacttctata ggtaaaagtg cttttgccga ttgtgagaat 660ttagtaaata taaaattacc aaataattta gaaacaatac ctgatagtat gcttgaaagc 720tgcggatcca ttaatacaat aactatacca gcatctgtaa aaaaaataga aaattctgta 780tttttttact gcaaaaactt tgaaaacatt agatttttaa atggtaatct tcaatcaatg 840acagtaggaa aagatatatt tgcaggctgc cctttaaaaa atgtttatat acctaaaaac 900agcagtgcat cagatgaaga atggagaaat actttaggca ttaaatcaac tgtaaagatt 960ataagagaa 96950323PRTBrachyspira hyodysenteriae 50Met Lys Lys Ile Ile Leu Leu Ile Phe Ile Leu Leu Asn Ile Ser Cys1 5 10 15Arg Asn Ile Ile Thr Ile Ala Glu Asn Lys Lys Asn Ile Asp Asn Val 20 25 30Asn Asn Val His Ile Glu Glu Asn Glu Tyr Leu Tyr Ala Leu Glu Ile 35 40 45Asp Lys Ala Asn Pro Gln Asn Met Glu Glu Ala Leu Lys Arg Tyr Ala 50 55 60Ala Asp His Asn Gly Lys Tyr Lys Leu Ile Phe Thr Gly Thr Ser Thr65 70 75 80Lys Lys Tyr Asp Val Trp Thr Ser Ile Ser Gln Met Leu Glu Asp Ile 85 90 95Ser Leu Lys Asn Ile Lys Ile Glu Ile Ser Ile Val Asn Val Ile Phe 100 105 110Pro Asn Gly Lys Ile Pro Asp Phe Leu Phe Gly Gly Asn Ala Val Asn 115 120 125Lys Ser Ile Val Lys Ile Thr Phe Pro Asn Ser Ile Thr Glu Ile Gly 130 135 140Glu Tyr Ser Ile Phe Cys Pro Glu Leu Thr Glu Ile Thr Leu Pro Ser145 150 155 160Asn Leu Arg Thr Ile Gly Arg Arg Gly Leu Ile Gly Cys Glu Ser Leu 165 170 175Lys Ile Leu Lys Leu Pro Asn Ser Leu Lys Thr Ile Gly Glu Leu Ser 180 185 190Leu Asn Gly Cys Gly Phe Ala Ser Ile Val Ile Pro Asp Ser Val Thr 195 200 205Ser Ile Gly Lys Ser Ala Phe Ala Asp Cys Glu Asn Leu Val Asn Ile 210 215 220Lys Leu Pro Asn Asn Leu Glu Thr Ile Pro Asp Ser Met Leu Glu Ser225 230 235 240Cys Gly Ser Ile Asn Thr Ile Thr Ile Pro Ala Ser Val Lys Lys Ile 245 250 255Glu Asn Ser Val Phe Phe Tyr Cys Lys Asn Phe Glu Asn Ile Arg Phe 260 265 270Leu Asn Gly Asn Leu Gln Ser Met Thr Val Gly Lys Asp Ile Phe Ala 275 280 285Gly Cys Pro Leu Lys Asn Val Tyr Ile Pro Lys Asn Ser Ser Ala Ser 290 295 300Asp Glu Glu Trp Arg Asn Thr Leu Gly Ile Lys Ser Thr Val Lys Ile305 310 315 320Ile Arg Glu51564DNABrachyspira hyodysenteriae 51atgcatattt ctggtgattc tcctttagat aggaaagttg gagatgctag ttattatttt 60gctactgttc aacattgctg ggggtgggct acttggaaaa gagcttggaa atattttgat 120gtaactatgg aaagtataaa ttttgaagat gtaaaaaaaa caattagaaa aagatacaaa 180gattttaata taaaagatta ctggcaaaga tggtttccta gaataaaaaa agagcattct 240tctgtatggg attatcaatg gacttactgt attatctcaa aaaatggaat atgcattaat 300ccaagtataa atttaacttc taatatagga tttggagaag attctaccca cactacaaat 360gaaaatgatg aaaatataaa tagtaaaaca taccctatgg atactgaaaa tattattcat 420cctaaagaaa taaaatgtga tgaaagagct gattttgaaa tagctattaa aagatttaat 480ataaaacctt tctctttaac atctaatata accagagaag ttaaaagaat tataaaacaa 540ataaaaaact tatttatcaa aaaa 56452188PRTBrachyspira hyodysenteriae 52Met His Ile Ser Gly Asp Ser Pro Leu Asp Arg Lys Val Gly Asp Ala1 5 10 15Ser Tyr Tyr Phe Ala Thr Val Gln His Cys Trp Gly Trp Ala Thr Trp 20 25 30Lys Arg Ala Trp Lys Tyr Phe Asp Val Thr Met Glu Ser Ile Asn Phe 35 40 45Glu Asp Val Lys Lys Thr Ile Arg Lys Arg Tyr Lys Asp Phe Asn Ile 50 55 60Lys Asp Tyr Trp Gln Arg Trp Phe Pro Arg Ile Lys Lys Glu His Ser65 70 75 80Ser Val Trp Asp Tyr Gln Trp Thr Tyr Cys Ile Ile Ser Lys Asn Gly 85 90 95Ile Cys Ile Asn Pro Ser Ile Asn Leu Thr Ser Asn Ile Gly Phe Gly 100 105 110Glu Asp Ser Thr His Thr Thr Asn Glu Asn Asp Glu Asn Ile Asn Ser 115 120 125Lys Thr Tyr Pro Met Asp Thr Glu Asn Ile Ile His Pro Lys Glu Ile 130 135 140Lys Cys Asp Glu Arg Ala Asp Phe Glu Ile Ala Ile Lys Arg Phe Asn145 150 155 160Ile Lys Pro Phe Ser Leu Thr Ser Asn Ile Thr Arg Glu Val Lys Arg 165 170 175Ile Ile Lys Gln Ile Lys Asn Leu Phe Ile Lys Lys 180 18553396DNABrachyspira hyodysenteriae 53atgtttaata ctcctatatt attaattatt tttaaaagaa aatatactgc attaaaagtt 60ttagatacaa taagaaatgt aaaacccaaa aaattatata tagcagctga tggctggaga 120aatgaagaag aaaaaacaaa atgtattgat acaagagaag ctgtattaga agctgtagat 180tgggaatgcg aagtaaaaac tttatttcaa gataaaaatt taggatgctg ttatggtcct 240gtaaatgctg taaattggtt atttgaaaat gaagaacaag gaataatact tgaagatgat 300gttatagctg aaacttcttt ttttattatt gcgagaaatt acttaactat tataaagata 360atgaaaaaat tatgcatatt tctggtgatt ctcctt 39654132PRTBrachyspira hyodysenteriae 54Met Phe Asn Thr Pro Ile Leu Leu Ile Ile Phe Lys Arg Lys Tyr Thr1 5 10 15Ala Leu Lys Val Leu Asp Thr Ile Arg Asn Val Lys Pro Lys Lys Leu 20 25 30Tyr Ile Ala Ala Asp Gly Trp Arg Asn Glu Glu Glu Lys Thr Lys Cys 35 40 45Ile Asp Thr Arg Glu Ala Val Leu Glu Ala Val Asp Trp Glu Cys Glu 50 55 60Val Lys Thr Leu Phe Gln Asp Lys Asn Leu Gly Cys Cys Tyr Gly Pro65 70 75 80Val Asn Ala Val Asn Trp Leu Phe Glu Asn Glu Glu Gln Gly Ile Ile 85 90 95Leu Glu Asp Asp Val Ile Ala Glu Thr Ser Phe Phe Ile Ile Ala Arg 100 105 110Asn Tyr Leu Thr Ile Ile Lys Ile Met Lys Lys Leu Cys Ile Phe Leu 115 120 125Val Ile Leu Leu 13055825DNABrachyspira hyodysenteriae 55atgaatgata ttattaaagt gataaatata ttaaacgata taccagaacc tttttctgta 60gatggaataa taaaaacttt tgaagcaagc tctaaagatt ttataaaaag ttttgctgtt 120tatttttata aggaaggcag tgaagaagca agattatggt atacatctaa aaataaatta 180gttattaatg ataaaaaaaa taatagagaa tatactctat ttgccagagg taataaattt 240ggttatataa tagttaatgc agataaaaat aaagatgaaa tggaagtact tattaattat 300ctatcaataa tattatatag tgaaaaactt tcatttttgg caaatagaga caaacttaca 360ggtttataca atcgcggata tataataaaa tatttgcagg agaaagaaac tacaaatgaa 420atatattcta tagtaatagt agatttagat aaattcaaac attataatga tacttacgga 480cataatatag gagatcatgt attaaaatta atttcaaagg taatgaaaga ttctttaaaa 540aatataaaat ataaatctgt attggcaaga tatggaggag aagaatttat tatagtaatt 600gatgttaata ataaaaatga tctttttaat gctatggaag aaataagaaa ctcaataata 660gaaactgatt tatctacaga agaatattct ctaaaagcaa cagcatcttt aggaggtgct 720ataaaagagg aaaatacaac tttaagaact tttataaata aagcagatca atcattatat 780aatgccaaag aaacaggaag aaataaatcc gttatattag atttt 82556275PRTBrachyspira hyodysenteriae 56Met Asn Asp Ile Ile Lys Val Ile Asn Ile Leu Asn Asp Ile Pro Glu1 5 10 15Pro Phe Ser Val Asp Gly Ile Ile Lys Thr Phe Glu Ala Ser Ser Lys 20 25 30Asp Phe Ile Lys Ser Phe Ala Val Tyr Phe Tyr Lys Glu Gly Ser Glu 35 40 45Glu Ala Arg Leu Trp Tyr Thr Ser Lys Asn Lys Leu Val Ile Asn Asp 50 55 60Lys Lys Asn Asn Arg Glu Tyr Thr Leu Phe Ala Arg Gly Asn Lys Phe65 70 75 80Gly Tyr Ile Ile Val Asn Ala Asp Lys Asn Lys Asp Glu Met Glu Val 85 90 95Leu Ile Asn Tyr Leu Ser Ile Ile Leu Tyr Ser Glu Lys Leu Ser Phe 100 105 110Leu Ala Asn Arg Asp Lys Leu Thr Gly Leu Tyr Asn Arg Gly Tyr Ile 115 120 125Ile Lys Tyr Leu Gln Glu Lys Glu Thr Thr Asn Glu Ile Tyr Ser Ile 130 135 140Val Ile Val Asp Leu Asp Lys Phe Lys His Tyr Asn Asp Thr Tyr Gly145 150 155 160His Asn Ile Gly Asp His Val Leu Lys Leu Ile Ser Lys Val Met Lys 165 170 175Asp Ser Leu Lys Asn Ile Lys Tyr Lys Ser Val Leu Ala Arg Tyr Gly 180 185 190Gly Glu Glu Phe Ile Ile Val Ile Asp Val Asn Asn Lys Asn Asp Leu 195 200 205Phe Asn Ala Met Glu Glu Ile Arg Asn Ser Ile Ile Glu Thr Asp Leu 210 215 220Ser Thr Glu Glu Tyr Ser Leu Lys Ala Thr Ala Ser Leu Gly Gly Ala225 230 235 240Ile Lys Glu Glu Asn Thr Thr Leu Arg Thr Phe Ile Asn Lys Ala Asp 245 250 255Gln Ser Leu Tyr Asn Ala Lys Glu Thr Gly Arg Asn Lys Ser Val Ile 260 265 270Leu Asp Phe 275571815DNABrachyspira hyodysenteriae 57atgaaaaata tttttaaata tgcttccatt ataggatgca cttttgcctc gcttaatttt 60gcggctgatt atatagatta taaagtaaaa aacggcgata ctttatttgg aatagctttc 120gctcatgata tgagtgcaaa tgaattttta aaagttaata atataaaaga tcctgataaa 180tataatctta gagtaggaga aactttaaaa gtaaaagata aaggttatac tcttgtatat 240gactctgata ataaagtttt cggcttgaaa ggagaagaag gaaactcata caaagattat 300aaagtaaaaa acggggatac tttatttggt atagcatttg cccatggaat gactgctaat 360gaatttctag ctataaataa tattaaagat gccaataaat ataatcttag agtaggacaa 420actcttaaag tagcaaataa tcaaaaagaa aataatgctt cttcaaataa tataaataat 480agtgataata cagaaaatta tgatacttat aaagtgcaaa gcggtgatac tttatacgga 540atagctttct ctcatggtat gacagcaagc gaatttttaa agattaataa tatagatgat 600cctgataaat ataaactata tgtaggtaaa actatgtatg ttaaatcatc taaaaaagaa 660aataatttaa acacaaataa tgaaaaagat acaggaaaag aaatagaata ctatactgta 720aaaagcggcg ataccttata cggaatagct tttcaaaatg atattagcgt aaatgatttt 780ctaagaatta acaatataga tgatccttta aaatacaaat taagaacagg cgaaaaatta 840aaaatatatg caagagaaaa tgcctcaaat acacaaagca aaactataaa aacatataga 900gtaaaaaacg gagatactct tggagagata gcattaagaa attctatgtc tttgaaagat 960cttcttcaat taaataatct aaaaaataat tatgtgctta aagtaggaga tactttaaaa 1020atatatgata atattaatat aacaagttct

tcaacatcaa caacatacag aactttggaa 1080aattataaag taaaaagcgg tgatacttta agcggaatag ctctagcaag aggaatggat 1140ctagtagaat tatactccat aaataatata aatgacaaat atattttgaa agttggagat 1200aatcttaaag tatatgctaa ccctaaaaaa acaactactt tagtaatatc aaattataaa 1260gttcaaagcg gagatagttt atactcaata gcaaaaaaac ataaaatgga tttaagagat 1320ttaatgcagc ttaataatat aaaaaatgct aatgaatata aattatatgt cggcgccaat 1380ctaaaagtaa aaacagcaaa aatggtgcct tattctttta atgatgattc tatattacct 1440gacagctctt ttatatggcc ttataaagga ataataattt caggatatgg agtagcttct 1500gataaacttg caaacagagg tgtgaatata ttaggagatg taggagacaa agttgtagct 1560tctgatgacg gaatcgtaga atatgctgat aatataagag gattcggtac tgttataata 1620cttaaacata aaaacggata taatacttct tatgctcatc tttctaagat aaatgttaaa 1680cttggagata tagtaaagaa aggagattat ataggagaca ttggcgatac tggtatgata 1740gatagaagcg aactatattt taagatttct tatcagggaa gatcaataga tcctgttaaa 1800cttcttccta aaagt 181558605PRTBrachyspira hyodysenteriae 58Met Lys Asn Ile Phe Lys Tyr Ala Ser Ile Ile Gly Cys Thr Phe Ala1 5 10 15Ser Leu Asn Phe Ala Ala Asp Tyr Ile Asp Tyr Lys Val Lys Asn Gly 20 25 30Asp Thr Leu Phe Gly Ile Ala Phe Ala His Asp Met Ser Ala Asn Glu 35 40 45Phe Leu Lys Val Asn Asn Ile Lys Asp Pro Asp Lys Tyr Asn Leu Arg 50 55 60Val Gly Glu Thr Leu Lys Val Lys Asp Lys Gly Tyr Thr Leu Val Tyr65 70 75 80Asp Ser Asp Asn Lys Val Phe Gly Leu Lys Gly Glu Glu Gly Asn Ser 85 90 95Tyr Lys Asp Tyr Lys Val Lys Asn Gly Asp Thr Leu Phe Gly Ile Ala 100 105 110Phe Ala His Gly Met Thr Ala Asn Glu Phe Leu Ala Ile Asn Asn Ile 115 120 125Lys Asp Ala Asn Lys Tyr Asn Leu Arg Val Gly Gln Thr Leu Lys Val 130 135 140Ala Asn Asn Gln Lys Glu Asn Asn Ala Ser Ser Asn Asn Ile Asn Asn145 150 155 160Ser Asp Asn Thr Glu Asn Tyr Asp Thr Tyr Lys Val Gln Ser Gly Asp 165 170 175Thr Leu Tyr Gly Ile Ala Phe Ser His Gly Met Thr Ala Ser Glu Phe 180 185 190Leu Lys Ile Asn Asn Ile Asp Asp Pro Asp Lys Tyr Lys Leu Tyr Val 195 200 205Gly Lys Thr Met Tyr Val Lys Ser Ser Lys Lys Glu Asn Asn Leu Asn 210 215 220Thr Asn Asn Glu Lys Asp Thr Gly Lys Glu Ile Glu Tyr Tyr Thr Val225 230 235 240Lys Ser Gly Asp Thr Leu Tyr Gly Ile Ala Phe Gln Asn Asp Ile Ser 245 250 255Val Asn Asp Phe Leu Arg Ile Asn Asn Ile Asp Asp Pro Leu Lys Tyr 260 265 270Lys Leu Arg Thr Gly Glu Lys Leu Lys Ile Tyr Ala Arg Glu Asn Ala 275 280 285Ser Asn Thr Gln Ser Lys Thr Ile Lys Thr Tyr Arg Val Lys Asn Gly 290 295 300Asp Thr Leu Gly Glu Ile Ala Leu Arg Asn Ser Met Ser Leu Lys Asp305 310 315 320Leu Leu Gln Leu Asn Asn Leu Lys Asn Asn Tyr Val Leu Lys Val Gly 325 330 335Asp Thr Leu Lys Ile Tyr Asp Asn Ile Asn Ile Thr Ser Ser Ser Thr 340 345 350Ser Thr Thr Tyr Arg Thr Leu Glu Asn Tyr Lys Val Lys Ser Gly Asp 355 360 365Thr Leu Ser Gly Ile Ala Leu Ala Arg Gly Met Asp Leu Val Glu Leu 370 375 380Tyr Ser Ile Asn Asn Ile Asn Asp Lys Tyr Ile Leu Lys Val Gly Asp385 390 395 400Asn Leu Lys Val Tyr Ala Asn Pro Lys Lys Thr Thr Thr Leu Val Ile 405 410 415Ser Asn Tyr Lys Val Gln Ser Gly Asp Ser Leu Tyr Ser Ile Ala Lys 420 425 430Lys His Lys Met Asp Leu Arg Asp Leu Met Gln Leu Asn Asn Ile Lys 435 440 445Asn Ala Asn Glu Tyr Lys Leu Tyr Val Gly Ala Asn Leu Lys Val Lys 450 455 460Thr Ala Lys Met Val Pro Tyr Ser Phe Asn Asp Asp Ser Ile Leu Pro465 470 475 480Asp Ser Ser Phe Ile Trp Pro Tyr Lys Gly Ile Ile Ile Ser Gly Tyr 485 490 495Gly Val Ala Ser Asp Lys Leu Ala Asn Arg Gly Val Asn Ile Leu Gly 500 505 510Asp Val Gly Asp Lys Val Val Ala Ser Asp Asp Gly Ile Val Glu Tyr 515 520 525Ala Asp Asn Ile Arg Gly Phe Gly Thr Val Ile Ile Leu Lys His Lys 530 535 540Asn Gly Tyr Asn Thr Ser Tyr Ala His Leu Ser Lys Ile Asn Val Lys545 550 555 560Leu Gly Asp Ile Val Lys Lys Gly Asp Tyr Ile Gly Asp Ile Gly Asp 565 570 575Thr Gly Met Ile Asp Arg Ser Glu Leu Tyr Phe Lys Ile Ser Tyr Gln 580 585 590Gly Arg Ser Ile Asp Pro Val Lys Leu Leu Pro Lys Ser 595 600 605591068DNABrachyspira hyodysenteriae 59atgattagaa atattaaata tattttcatt atatatttat tagctatttc ctgctctaat 60tatagagtta ctgatccatt ctccattcaa aataatagta ataataacat aagcattata 120cctgaatatg tagatgctca atatttcatc aaagcagatt acactgaaca gcaaatagaa 180gaaataatga ataaatattt ccagaatttt ggagaatata taatattttt aaatgatact 240aaagataata tagataaaaa taaaacaata gaaacaataa ataaagtagt taataaacct 300gcttatttac ataacggagc tgctgttgat ttaagcagaa ctgatataac agaaatagca 360caaagtgcat ttaatgcaaa taaaaattta atagaagtta agcttcctaa ctcattaaaa 420actataaatt catcagcatt tcaatcatgc gaaagattaa aatatataaa tctagtaagc 480tctataaccg atatacaatc tgctgcattt caagactgta tgtctttaga aattattaat 540ataacatcaa aagtaaaaac tatagctaat aatgcattta aaaattgtgt tactttaaga 600gaagtaatac ttcctgaagg attaacttca atagcagatg gagcattcaa ttactgtaca 660tcattagaat caattaattt tccatcaact ttacaaacta taggcacagc agcattttac 720agctgtaaat cattaaaaag tataaaatta aatcaaggat taactaccat aaatgataat 780gcttttaatc tttgctcatc attaacagct ataagcttac ctaatagtat aacaagcctt 840ttaaatcctt cagaaggtaa ggttttttct gattgtaaaa tgcttaaaaa tgttgaatat 900cttgatacag atcccgtaaa aatacttaaa gaaaatgata cattcagagg ttcacctgta 960accgatttat accttcctaa tgtggcagaa gatcctaaaa atggaagctg ggataatttt 1020ttaggtgttg cttggacaac tattcattat ggaaaatcta tgcctagg 106860356PRTBrachyspira hyodysenteriae 60Met Ile Arg Asn Ile Lys Tyr Ile Phe Ile Ile Tyr Leu Leu Ala Ile1 5 10 15Ser Cys Ser Asn Tyr Arg Val Thr Asp Pro Phe Ser Ile Gln Asn Asn 20 25 30Ser Asn Asn Asn Ile Ser Ile Ile Pro Glu Tyr Val Asp Ala Gln Tyr 35 40 45Phe Ile Lys Ala Asp Tyr Thr Glu Gln Gln Ile Glu Glu Ile Met Asn 50 55 60Lys Tyr Phe Gln Asn Phe Gly Glu Tyr Ile Ile Phe Leu Asn Asp Thr65 70 75 80Lys Asp Asn Ile Asp Lys Asn Lys Thr Ile Glu Thr Ile Asn Lys Val 85 90 95Val Asn Lys Pro Ala Tyr Leu His Asn Gly Ala Ala Val Asp Leu Ser 100 105 110Arg Thr Asp Ile Thr Glu Ile Ala Gln Ser Ala Phe Asn Ala Asn Lys 115 120 125Asn Leu Ile Glu Val Lys Leu Pro Asn Ser Leu Lys Thr Ile Asn Ser 130 135 140Ser Ala Phe Gln Ser Cys Glu Arg Leu Lys Tyr Ile Asn Leu Val Ser145 150 155 160Ser Ile Thr Asp Ile Gln Ser Ala Ala Phe Gln Asp Cys Met Ser Leu 165 170 175Glu Ile Ile Asn Ile Thr Ser Lys Val Lys Thr Ile Ala Asn Asn Ala 180 185 190Phe Lys Asn Cys Val Thr Leu Arg Glu Val Ile Leu Pro Glu Gly Leu 195 200 205Thr Ser Ile Ala Asp Gly Ala Phe Asn Tyr Cys Thr Ser Leu Glu Ser 210 215 220Ile Asn Phe Pro Ser Thr Leu Gln Thr Ile Gly Thr Ala Ala Phe Tyr225 230 235 240Ser Cys Lys Ser Leu Lys Ser Ile Lys Leu Asn Gln Gly Leu Thr Thr 245 250 255Ile Asn Asp Asn Ala Phe Asn Leu Cys Ser Ser Leu Thr Ala Ile Ser 260 265 270Leu Pro Asn Ser Ile Thr Ser Leu Leu Asn Pro Ser Glu Gly Lys Val 275 280 285Phe Ser Asp Cys Lys Met Leu Lys Asn Val Glu Tyr Leu Asp Thr Asp 290 295 300Pro Val Lys Ile Leu Lys Glu Asn Asp Thr Phe Arg Gly Ser Pro Val305 310 315 320Thr Asp Leu Tyr Leu Pro Asn Val Ala Glu Asp Pro Lys Asn Gly Ser 325 330 335Trp Asp Asn Phe Leu Gly Val Ala Trp Thr Thr Ile His Tyr Gly Lys 340 345 350Ser Met Pro Arg 355611296DNABrachyspira hyodysenteriae 61atggatataa ttataataat agtgttaata cttttaaatg gtatttttgc catgtcggaa 60attgcagtaa tttctgctag aaaatcttct cttatgaaag acagcaaaga aggaaataaa 120ggtgcaaaga ctgcattagc tttagcagat aatcctgaca aatttttatc tacaatacaa 180ataggtataa ctttaatagg tatattaaca ggtatttact caggcgatac agttgccaaa 240gaagtttcaa atttacttgt aaaaataaat gtaccattaa attatgcttc tttaatagct 300caggtattgg tggtagcatt ggtaacatat cttacattga tattcggaga gcttgtgcct 360aaaagaatag gaatggtaat gcctgaaaga atagcaaaag tggttgcagc tcctatgaca 420atacttgcaa agataggtgc tccttttgtg tggatattat caaatagcgc attgcttgtt 480tcaagagttt tgggtataaa agatgataaa agtcctgtta ctgaagagga aataaaatct 540atgatagaag agggcagaca agggggagaa gttaaggaga tagaacagaa tattatagag 600agggctttct ttttgggaga tagaaaaata gaatctataa tgacacatag aaatgatatg 660gtatttttag atataaatat gagtaatgat gagataaaaa agatagtatc aaaacattct 720ttttctgctt atcctgttgt tgataaaaat ttggataata ttgtaggagt tgtaagagta 780actgatatat tcgataaatt aaatacttca aaggctaaaa tagaaaagtt tgtgaagaaa 840gctaattact ttcataacaa tatggaagtt tatttggttc ttgaagagat gaaaaagaat 900aatactaaaa taggtcttgt atcagatgag tttgggaata tagacggaat gattactcaa 960agcgatatat tcgaggcttt agtgggttct gtaacagaag gaaaagacag taaggatatt 1020agaaagagaa agagcggaag ttggtttgta gatggtcaat gtcctatgta tgatttctta 1080gagtattttg aaatagaaga tgaaaatgct tctaataatt ataatactat aagcggtttg 1140attttagaat tattacagca tgtacctagt gaaggagaat ctttagaatg gaagaattta 1200aatttagaag ttgttgatat ggacggtgct agaatagata aggttatagt aaataaaata 1260gaaaaaactg atgaaaagaa tgattcagac actgaa 129662432PRTBrachyspira hyodysenteriae 62Met Asp Ile Ile Ile Ile Ile Val Leu Ile Leu Leu Asn Gly Ile Phe1 5 10 15Ala Met Ser Glu Ile Ala Val Ile Ser Ala Arg Lys Ser Ser Leu Met 20 25 30Lys Asp Ser Lys Glu Gly Asn Lys Gly Ala Lys Thr Ala Leu Ala Leu 35 40 45Ala Asp Asn Pro Asp Lys Phe Leu Ser Thr Ile Gln Ile Gly Ile Thr 50 55 60Leu Ile Gly Ile Leu Thr Gly Ile Tyr Ser Gly Asp Thr Val Ala Lys65 70 75 80Glu Val Ser Asn Leu Leu Val Lys Ile Asn Val Pro Leu Asn Tyr Ala 85 90 95Ser Leu Ile Ala Gln Val Leu Val Val Ala Leu Val Thr Tyr Leu Thr 100 105 110Leu Ile Phe Gly Glu Leu Val Pro Lys Arg Ile Gly Met Val Met Pro 115 120 125Glu Arg Ile Ala Lys Val Val Ala Ala Pro Met Thr Ile Leu Ala Lys 130 135 140Ile Gly Ala Pro Phe Val Trp Ile Leu Ser Asn Ser Ala Leu Leu Val145 150 155 160Ser Arg Val Leu Gly Ile Lys Asp Asp Lys Ser Pro Val Thr Glu Glu 165 170 175Glu Ile Lys Ser Met Ile Glu Glu Gly Arg Gln Gly Gly Glu Val Lys 180 185 190Glu Ile Glu Gln Asn Ile Ile Glu Arg Ala Phe Phe Leu Gly Asp Arg 195 200 205Lys Ile Glu Ser Ile Met Thr His Arg Asn Asp Met Val Phe Leu Asp 210 215 220Ile Asn Met Ser Asn Asp Glu Ile Lys Lys Ile Val Ser Lys His Ser225 230 235 240Phe Ser Ala Tyr Pro Val Val Asp Lys Asn Leu Asp Asn Ile Val Gly 245 250 255Val Val Arg Val Thr Asp Ile Phe Asp Lys Leu Asn Thr Ser Lys Ala 260 265 270Lys Ile Glu Lys Phe Val Lys Lys Ala Asn Tyr Phe His Asn Asn Met 275 280 285Glu Val Tyr Leu Val Leu Glu Glu Met Lys Lys Asn Asn Thr Lys Ile 290 295 300Gly Leu Val Ser Asp Glu Phe Gly Asn Ile Asp Gly Met Ile Thr Gln305 310 315 320Ser Asp Ile Phe Glu Ala Leu Val Gly Ser Val Thr Glu Gly Lys Asp 325 330 335Ser Lys Asp Ile Arg Lys Arg Lys Ser Gly Ser Trp Phe Val Asp Gly 340 345 350Gln Cys Pro Met Tyr Asp Phe Leu Glu Tyr Phe Glu Ile Glu Asp Glu 355 360 365Asn Ala Ser Asn Asn Tyr Asn Thr Ile Ser Gly Leu Ile Leu Glu Leu 370 375 380Leu Gln His Val Pro Ser Glu Gly Glu Ser Leu Glu Trp Lys Asn Leu385 390 395 400Asn Leu Glu Val Val Asp Met Asp Gly Ala Arg Ile Asp Lys Val Ile 405 410 415Val Asn Lys Ile Glu Lys Thr Asp Glu Lys Asn Asp Ser Asp Thr Glu 420 425 430632940DNABrachyspira hyodysenteriae 63atgcgaatct ttatcttgtt attatttaca ttgattttta atgtatgttt atatgctcag 60gatactaatg taaataatac agcagcaaca aataatacta ctgcagcaac caataatgta 120ggcgaaagtg caataatgca gataaataga tttgatgcta aaagaaatcc tgtatcattt 180attaatttag ttaattttac accatattat gtattgcagg aatatgctag ggttaataat 240atagaaattt atccctatga tactgaaagt acattaagag caagaatcat tgaaagacaa 300gtaaatataa aacaggaagt tattaataat aaagatgaaa tacgcgaagt agcaagaaca 360actataaata gaggcggtgc tcaggtagaa cttataggtg cagattttgc tgaaagatat 420accatagatg aagcaggtga agagcttata tcattatatg gtaatgttac catgaaaatg 480tataataata cattagttgc tgataaggtt gtttatagct taaaaacagg agaagttttt 540gcttcaggaa atttaactgt agcatctgaa ggaagtactt tcaaaggtga atggtttatg 600cttaatagag aaagtaaaag aggcatacta ttcggcggaa atacgaaatt catgagtttt 660acagttgaag ggcgtataat taaatttaat gaccaagatt tttttgctga aaacagcagt 720gtgagttttt cacgtcttac tcctatagcg catgattttt tagcgagtag agtttatctt 780tgggatacta aaaagatgat ggttttcaat agtatctata gggtaggaag acagcctgta 840ttttattttc cattatttat acagaataat tttggtactg gtataatatc ttcttttggg 900cagtctttga gagaaggtgt ttatattcaa aattataaga tatttaattt atatggtgtg 960cagcataaga taagattcga tgcctatcag aaattaggtt ttttattagg agatgaaata 1020aggtatacaa gtcagtatca ggatttagca cttgatgcta tgtttgcttt tggaaggcag 1080tattatttat ttgattccta tattacttca agtgtaggat ttggtacaag gtatgttaac 1140tattttggat caggtgaagg cggaaagttt gtaccaagat ataaatttca atatgatcat 1200accattcaat tatataatag tcaaaatata aatagttata ttacaggaaa gttaaattta 1260aatagcgact tatatttcag atctgatttt tacaatcaaa gaggacagtt tgatatatta 1320acatttttta catcacttac aggaaatttg caggacatag gagattctta tcctgaaaat 1380tatattgaaa attctgttta tcttaataat aatatttacg gacttaattt aaaagttggt 1440gcagaatggg atttagaatc tgttagaaat atatcggttg atgttaatac taatttcgac 1500tattatatgc ctaaaccata taaacttgta cttccttctg tagaagctag ttacaattct 1560atatttggaa atgagacatc ttattacttt ccaaatctta acattaacta taatttaaga 1620gctaattata atcatactat aaattataag acttctgaag gtattgcttt ttataacaat 1680cctatgcttg actcacaatt aaatgataaa cttgctgaaa gagataatct taatttacat 1740ggtgatatat caagagcttt tactaatgat tttttaagat ttgtacctag ctttaatatg 1800gaatactcat atcaaaatag tatagatcct aaagcagaag atttgattta tgataaagat 1860aatacttact ttggtatagg cacaggaatg aatttttcta tgtttttacc ttacagtata 1920ttgccatatg atttcacaag atattttgaa cctactgtta gatgggatac aacatataca 1980ttgggatata gatttaaaga aaaatacatt gatacagatt ataaagattc tcaattcggt 2040gaatttaata atcatagctt tacaactaga ttttctatgg gcggaaccgg atacagctta 2100ttttatttgc ctgatttgaa tctcaatatg gaaacattta taactacagg ttatgatttt 2160atacctagtt ataattcaga aacaagaact tatcaagttg aattttctac aaataaaatg 2220cttacaactg aagtaggtgc ttcagcaaga cttttatata atcaatctta tgtttcttat 2280gatataacta gaaatttatt aggaactaat ttaacagcaa atagaataaa tgcatatttt 2340cactttccta tacctttagg taaaattaca gattggattt taataaaaaa caataaaaga 2400cctttctttg atggtatagt taatgatttt aatttatatt ttggttttgc ctttactcat 2460gattttataa attatagata taatactacc gcatttacat ttggtataga gcttcaggtt 2520ttggaacaat ggaaatttag aatagcaact actagtgcaa atgagaatgc atatagatat 2580ataaaatctt atgcagaaaa agaaaatcaa acttgggtta atcctttttg ggatatcata 2640aattcattca atttctctga cagtaaaaaa agaactgaaa gtttatttaa attaaaatct 2700atagaagcta gtgtttggca tgaattagac ggatggcaga ttcaggctac atttgctgta 2760agaccttcta ctctcccttc tgatattact tcaggttcag taaaaggagt ttattggaac 2820aaggagtttt ggattgaatt tactcttaca gactttccta atgttggatt gcctaagaaa 2880gaatataatc ttaatagtac tattaccgat ttacaagata gtgctgctgt tactactcca 294064980PRTBrachyspira hyodysenteriae 64Met Arg Ile Phe Ile Leu Leu Leu Phe Thr Leu Ile Phe Asn Val Cys1 5 10 15Leu Tyr Ala Gln Asp Thr Asn Val Asn Asn Thr Ala Ala Thr Asn Asn 20 25 30Thr Thr Ala

Ala Thr Asn Asn Val Gly Glu Ser Ala Ile Met Gln Ile 35 40 45Asn Arg Phe Asp Ala Lys Arg Asn Pro Val Ser Phe Ile Asn Leu Val 50 55 60Asn Phe Thr Pro Tyr Tyr Val Leu Gln Glu Tyr Ala Arg Val Asn Asn65 70 75 80Ile Glu Ile Tyr Pro Tyr Asp Thr Glu Ser Thr Leu Arg Ala Arg Ile 85 90 95Ile Glu Arg Gln Val Asn Ile Lys Gln Glu Val Ile Asn Asn Lys Asp 100 105 110Glu Ile Arg Glu Val Ala Arg Thr Thr Ile Asn Arg Gly Gly Ala Gln 115 120 125Val Glu Leu Ile Gly Ala Asp Phe Ala Glu Arg Tyr Thr Ile Asp Glu 130 135 140Ala Gly Glu Glu Leu Ile Ser Leu Tyr Gly Asn Val Thr Met Lys Met145 150 155 160Tyr Asn Asn Thr Leu Val Ala Asp Lys Val Val Tyr Ser Leu Lys Thr 165 170 175Gly Glu Val Phe Ala Ser Gly Asn Leu Thr Val Ala Ser Glu Gly Ser 180 185 190Thr Phe Lys Gly Glu Trp Phe Met Leu Asn Arg Glu Ser Lys Arg Gly 195 200 205Ile Leu Phe Gly Gly Asn Thr Lys Phe Met Ser Phe Thr Val Glu Gly 210 215 220Arg Ile Ile Lys Phe Asn Asp Gln Asp Phe Phe Ala Glu Asn Ser Ser225 230 235 240Val Ser Phe Ser Arg Leu Thr Pro Ile Ala His Asp Phe Leu Ala Ser 245 250 255Arg Val Tyr Leu Trp Asp Thr Lys Lys Met Met Val Phe Asn Ser Ile 260 265 270Tyr Arg Val Gly Arg Gln Pro Val Phe Tyr Phe Pro Leu Phe Ile Gln 275 280 285Asn Asn Phe Gly Thr Gly Ile Ile Ser Ser Phe Gly Gln Ser Leu Arg 290 295 300Glu Gly Val Tyr Ile Gln Asn Tyr Lys Ile Phe Asn Leu Tyr Gly Val305 310 315 320Gln His Lys Ile Arg Phe Asp Ala Tyr Gln Lys Leu Gly Phe Leu Leu 325 330 335Gly Asp Glu Ile Arg Tyr Thr Ser Gln Tyr Gln Asp Leu Ala Leu Asp 340 345 350Ala Met Phe Ala Phe Gly Arg Gln Tyr Tyr Leu Phe Asp Ser Tyr Ile 355 360 365Thr Ser Ser Val Gly Phe Gly Thr Arg Tyr Val Asn Tyr Phe Gly Ser 370 375 380Gly Glu Gly Gly Lys Phe Val Pro Arg Tyr Lys Phe Gln Tyr Asp His385 390 395 400Thr Ile Gln Leu Tyr Asn Ser Gln Asn Ile Asn Ser Tyr Ile Thr Gly 405 410 415Lys Leu Asn Leu Asn Ser Asp Leu Tyr Phe Arg Ser Asp Phe Tyr Asn 420 425 430Gln Arg Gly Gln Phe Asp Ile Leu Thr Phe Phe Thr Ser Leu Thr Gly 435 440 445Asn Leu Gln Asp Ile Gly Asp Ser Tyr Pro Glu Asn Tyr Ile Glu Asn 450 455 460Ser Val Tyr Leu Asn Asn Asn Ile Tyr Gly Leu Asn Leu Lys Val Gly465 470 475 480Ala Glu Trp Asp Leu Glu Ser Val Arg Asn Ile Ser Val Asp Val Asn 485 490 495Thr Asn Phe Asp Tyr Tyr Met Pro Lys Pro Tyr Lys Leu Val Leu Pro 500 505 510Ser Val Glu Ala Ser Tyr Asn Ser Ile Phe Gly Asn Glu Thr Ser Tyr 515 520 525Tyr Phe Pro Asn Leu Asn Ile Asn Tyr Asn Leu Arg Ala Asn Tyr Asn 530 535 540His Thr Ile Asn Tyr Lys Thr Ser Glu Gly Ile Ala Phe Tyr Asn Asn545 550 555 560Pro Met Leu Asp Ser Gln Leu Asn Asp Lys Leu Ala Glu Arg Asp Asn 565 570 575Leu Asn Leu His Gly Asp Ile Ser Arg Ala Phe Thr Asn Asp Phe Leu 580 585 590Arg Phe Val Pro Ser Phe Asn Met Glu Tyr Ser Tyr Gln Asn Ser Ile 595 600 605Asp Pro Lys Ala Glu Asp Leu Ile Tyr Asp Lys Asp Asn Thr Tyr Phe 610 615 620Gly Ile Gly Thr Gly Met Asn Phe Ser Met Phe Leu Pro Tyr Ser Ile625 630 635 640Leu Pro Tyr Asp Phe Thr Arg Tyr Phe Glu Pro Thr Val Arg Trp Asp 645 650 655Thr Thr Tyr Thr Leu Gly Tyr Arg Phe Lys Glu Lys Tyr Ile Asp Thr 660 665 670Asp Tyr Lys Asp Ser Gln Phe Gly Glu Phe Asn Asn His Ser Phe Thr 675 680 685Thr Arg Phe Ser Met Gly Gly Thr Gly Tyr Ser Leu Phe Tyr Leu Pro 690 695 700Asp Leu Asn Leu Asn Met Glu Thr Phe Ile Thr Thr Gly Tyr Asp Phe705 710 715 720Ile Pro Ser Tyr Asn Ser Glu Thr Arg Thr Tyr Gln Val Glu Phe Ser 725 730 735Thr Asn Lys Met Leu Thr Thr Glu Val Gly Ala Ser Ala Arg Leu Leu 740 745 750Tyr Asn Gln Ser Tyr Val Ser Tyr Asp Ile Thr Arg Asn Leu Leu Gly 755 760 765Thr Asn Leu Thr Ala Asn Arg Ile Asn Ala Tyr Phe His Phe Pro Ile 770 775 780Pro Leu Gly Lys Ile Thr Asp Trp Ile Leu Ile Lys Asn Asn Lys Arg785 790 795 800Pro Phe Phe Asp Gly Ile Val Asn Asp Phe Asn Leu Tyr Phe Gly Phe 805 810 815Ala Phe Thr His Asp Phe Ile Asn Tyr Arg Tyr Asn Thr Thr Ala Phe 820 825 830Thr Phe Gly Ile Glu Leu Gln Val Leu Glu Gln Trp Lys Phe Arg Ile 835 840 845Ala Thr Thr Ser Ala Asn Glu Asn Ala Tyr Arg Tyr Ile Lys Ser Tyr 850 855 860Ala Glu Lys Glu Asn Gln Thr Trp Val Asn Pro Phe Trp Asp Ile Ile865 870 875 880Asn Ser Phe Asn Phe Ser Asp Ser Lys Lys Arg Thr Glu Ser Leu Phe 885 890 895Lys Leu Lys Ser Ile Glu Ala Ser Val Trp His Glu Leu Asp Gly Trp 900 905 910Gln Ile Gln Ala Thr Phe Ala Val Arg Pro Ser Thr Leu Pro Ser Asp 915 920 925Ile Thr Ser Gly Ser Val Lys Gly Val Tyr Trp Asn Lys Glu Phe Trp 930 935 940Ile Glu Phe Thr Leu Thr Asp Phe Pro Asn Val Gly Leu Pro Lys Lys945 950 955 960Glu Tyr Asn Leu Asn Ser Thr Ile Thr Asp Leu Gln Asp Ser Ala Ala 965 970 975Val Thr Thr Pro 980651611DNABrachyspira hyodysenteriae 65atgtcagaga ataaaacagt aagtaaagaa aagatagcta aatcatcatt aaaaatgtca 60ttggtaacta ctgtaagcag agtattcgga cttgtaagag atcaaataca ggcggctttg 120cttggtacta cattcatagc agatgctttt gcaataggat ttatacttcc aaatttattg 180aggcgattat ttgctgaagg caatatggtt gcaagcttta tacctgtatt tacagagctt 240gaaaaagaaa aaggtattga agaatcaaag aaatttttta gggcagtttt tacattattg 300ggattaatac ttatagtagt tgtaggcatc ggaataataa tatctccttt gcttgtaaaa 360atactttata aatctgcaca taataatata gaagcactta atttggcatc ggatctatca 420agaataatgt ttccttatct tctatttata tctttggcag ctttgatgca gggcgtactt 480aatataagag gctattattc aatatcagct gcaagtccta tacttttaaa tactgtaatt 540atatctatgg ctttgttctt taaattcttt ttacctaatt tttttaataa tatggcttat 600gtatttgcat ttgctgtgct gcttggtgga ttcgtacagt ttgcctatca aatgcctttt 660gtacataaac aaggttttag tttcaagcct tattttcatt ttaaagaacc ctatgtcata 720aagatgataa aattatttgc tcctggtatt ttcggagcta gtatatatca gataaatttg 780cttgtttcta ctgcatttgc tggagctatt ggagagggca gggtttcagc tgttactttt 840gctactagaa tacatgaatt tgttttgggc gtttttgctg tgagtgtggc aactgttatg 900cttcctactt taagtaaatt aatagctgat aataaaaaag atgaagctgt tgaaaattta 960ggatattctt taaggcttgt tgctttagtt actattcctg ctactttcgg atttgtggta 1020cttggcagag aaattgtaag aatgatattt gaatatggag ctttttcttc aaaatctaca 1080tatttagtat cgagtgcttt aagatattta tccatatcct tattctttgt ggcaagctat 1140agaatacttg tacagtcatt ttatgctatg aaagatatga aaactcctgt atatgtggca 1200ttttttacct ttattattaa tgctgttagt aattatttat gtgtttatat atttaaattc 1260gatattatag gaatatctat atcaagtgtt gttgcaaata ttgtatcttt ttgtatacta 1320tatatattgc ttataaagag aatggcagtg aaatcgataa taaataaaaa aattgaggtt 1380gtaaagacat tggctgctag tttatttatg gctgcttctg tctatggaat gaaatattat 1440ttattataca gcaatgccga ttctaggata atttttataa ttaaagtatt tatagtgata 1500ttattaggag ttgttgttta ttctataatg aacattatat taagaaatga tgattttgtt 1560tcctttatta gtatgtttaa aggcagatta tcaagaaagt ttctgaaaaa a 161166537PRTBrachyspira hyodysenteriae 66Met Ser Glu Asn Lys Thr Val Ser Lys Glu Lys Ile Ala Lys Ser Ser1 5 10 15Leu Lys Met Ser Leu Val Thr Thr Val Ser Arg Val Phe Gly Leu Val 20 25 30Arg Asp Gln Ile Gln Ala Ala Leu Leu Gly Thr Thr Phe Ile Ala Asp 35 40 45Ala Phe Ala Ile Gly Phe Ile Leu Pro Asn Leu Leu Arg Arg Leu Phe 50 55 60Ala Glu Gly Asn Met Val Ala Ser Phe Ile Pro Val Phe Thr Glu Leu65 70 75 80Glu Lys Glu Lys Gly Ile Glu Glu Ser Lys Lys Phe Phe Arg Ala Val 85 90 95Phe Thr Leu Leu Gly Leu Ile Leu Ile Val Val Val Gly Ile Gly Ile 100 105 110Ile Ile Ser Pro Leu Leu Val Lys Ile Leu Tyr Lys Ser Ala His Asn 115 120 125Asn Ile Glu Ala Leu Asn Leu Ala Ser Asp Leu Ser Arg Ile Met Phe 130 135 140Pro Tyr Leu Leu Phe Ile Ser Leu Ala Ala Leu Met Gln Gly Val Leu145 150 155 160Asn Ile Arg Gly Tyr Tyr Ser Ile Ser Ala Ala Ser Pro Ile Leu Leu 165 170 175Asn Thr Val Ile Ile Ser Met Ala Leu Phe Phe Lys Phe Phe Leu Pro 180 185 190Asn Phe Phe Asn Asn Met Ala Tyr Val Phe Ala Phe Ala Val Leu Leu 195 200 205Gly Gly Phe Val Gln Phe Ala Tyr Gln Met Pro Phe Val His Lys Gln 210 215 220Gly Phe Ser Phe Lys Pro Tyr Phe His Phe Lys Glu Pro Tyr Val Ile225 230 235 240Lys Met Ile Lys Leu Phe Ala Pro Gly Ile Phe Gly Ala Ser Ile Tyr 245 250 255Gln Ile Asn Leu Leu Val Ser Thr Ala Phe Ala Gly Ala Ile Gly Glu 260 265 270Gly Arg Val Ser Ala Val Thr Phe Ala Thr Arg Ile His Glu Phe Val 275 280 285Leu Gly Val Phe Ala Val Ser Val Ala Thr Val Met Leu Pro Thr Leu 290 295 300Ser Lys Leu Ile Ala Asp Asn Lys Lys Asp Glu Ala Val Glu Asn Leu305 310 315 320Gly Tyr Ser Leu Arg Leu Val Ala Leu Val Thr Ile Pro Ala Thr Phe 325 330 335Gly Phe Val Val Leu Gly Arg Glu Ile Val Arg Met Ile Phe Glu Tyr 340 345 350Gly Ala Phe Ser Ser Lys Ser Thr Tyr Leu Val Ser Ser Ala Leu Arg 355 360 365Tyr Leu Ser Ile Ser Leu Phe Phe Val Ala Ser Tyr Arg Ile Leu Val 370 375 380Gln Ser Phe Tyr Ala Met Lys Asp Met Lys Thr Pro Val Tyr Val Ala385 390 395 400Phe Phe Thr Phe Ile Ile Asn Ala Val Ser Asn Tyr Leu Cys Val Tyr 405 410 415Ile Phe Lys Phe Asp Ile Ile Gly Ile Ser Ile Ser Ser Val Val Ala 420 425 430Asn Ile Val Ser Phe Cys Ile Leu Tyr Ile Leu Leu Ile Lys Arg Met 435 440 445Ala Val Lys Ser Ile Ile Asn Lys Lys Ile Glu Val Val Lys Thr Leu 450 455 460Ala Ala Ser Leu Phe Met Ala Ala Ser Val Tyr Gly Met Lys Tyr Tyr465 470 475 480Leu Leu Tyr Ser Asn Ala Asp Ser Arg Ile Ile Phe Ile Ile Lys Val 485 490 495Phe Ile Val Ile Leu Leu Gly Val Val Val Tyr Ser Ile Met Asn Ile 500 505 510Ile Leu Arg Asn Asp Asp Phe Val Ser Phe Ile Ser Met Phe Lys Gly 515 520 525Arg Leu Ser Arg Lys Phe Leu Lys Lys 530 5356723DNABrachyspira hyodysenteriae 67aaacgtttat attttatttt atc 236818DNABrachyspira hyodysenteriae 68aaacttccaa gtgatacc 186920DNABrachyspira hyodysenteriae 69aaatataaac ctacaagcag 207023DNABrachyspira hyodysenteriae 70aatatttcag ttaatctaaa atc 237124DNABrachyspira hyodysenteriae 71actttaatct ttgtattaat tttg 247223DNABrachyspira hyodysenteriae 72ttgttttaat ttgataatat cag 237329DNABrachyspira hyodysenteriae 73aaaaaaatta ttttattaat atttatatt 297423DNABrachyspira hyodysenteriae 74ttctcttata atctttacag ttg 237519DNABrachyspira hyodysenteriae 75catatttctg gtgattctc 197627DNABrachyspira hyodysenteriae 76ttttttgata aataagtttt ttatttg 277728DNABrachyspira hyodysenteriae 77tttaatactc ctatattatt aattattt 287818DNABrachyspira hyodysenteriae 78aaggagaatc accagaaa 187923DNABrachyspira hyodysenteriae 79aatgatatta ttaaagtgat aaa 238020DNABrachyspira hyodysenteriae 80aaaatctaat ataacggatt 208120DNABrachyspira hyodysenteriae 81aaatatgctt ccattatagg 208221DNABrachyspira hyodysenteriae 82acttttagga agaagtttaa c 218325DNABrachyspira hyodysenteriae 83tatattttca ttatatattt attag 258418DNABrachyspira hyodysenteriae 84ctaggcatag attttcca 188528DNABrachyspira hyodysenteriae 85gatataatta taataatagt gttaatac 288619DNABrachyspira hyodysenteriae 86ttcagtgtct gaatcattc 198723DNABrachyspira hyodysenteriae 87gtatgtttat atgctcagga tac 238821DNABrachyspira hyodysenteriae 88aacagcagca ctatcttgta a 218924DNABrachyspira hyodysenteriae 89cagcagcaac aaataatact actg 249025DNABrachyspira hyodysenteriae 90tgaatataaa caccttctct caaag 259126DNABrachyspira hyodysenteriae 91aaaatgtcat tggtaactac tgtaag 269225DNABrachyspira hyodysenteriae 92cttgataatc tgcctttaaa catac 259323DNAArtificial SequencepTrcHis-F primer 93caatttatca gacaatctgt gtg 239423DNAArtificial SequencepTrcHis-R primer 94tgcctggcag ttccctactc tcg 23

Claims

1-44. (canceled)

45. An isolated polynucleotide comprising a nucleotide sequence selected from the group consisting of SEQ ID NO: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, 43, 45, 47, 49, 51, 53, 55, 57, 59, 61, 63, and 65.

46. An isolated DNA molecule comprising a sequence that is at least 70% identical to the polynucleotide of claim 45.

47. An isolated DNA molecule comprising a sequence that is at least 80% identical to the polynucleotide of claim 45.

48. An isolated DNA molecule comprising a sequence that is at least 90% identical to the polynucleotide of claim 45.

49. An isolated polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, and 66.

50. An isolated polynucleotide comprising a nucleotide sequence which encodes the polypeptide of claim 49.

51. A plasmid comprising the polynucleotide of claim 45.

52. The plasmid of claim 51, wherein said plasmid is an expression vector.

53. A cell containing the plasmid of claim 51.

54. An isolated protein comprising a sequence that is at least 70% homologous to the polypeptide of claim 49.

55. An isolated protein comprising a sequence that is at least 80% homologous to the polypeptide of claim 49.

56. An isolated protein comprising a sequence that is at least 90% homologous to the polypeptide of claim 49.

57. An immunogenic composition comprising the polypeptide of claim 49.

58. A vaccine composition for the prevention of Brachyspira infection comprising the polypeptide of claim 49.

59. A method of generating an immune response to a Brachyspira infection in an animal comprising administering to said animal the polypeptide of claim 49.

60. A method of preventing a disease caused by a Brachyspira infection in an animal comprising administering to said animal the polypeptide of claim 49.

61. A method of diagnosing Brachyspira infection comprising:(a) providing a sample from an animal suspected of being infected with Brachyspira; (b) contacting the sample with one or more polypeptides comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, and 66,(c) incubating the sample and polypeptide under conditions which allow for the formation of antibody-antigen complexes; and(d) determining whether an antibody-antigen complex with one or more polypeptides is formed,wherein the formation of an antibody-antigen complex indicates the animal is infected with Brachyspira.

62. The method of claim 61, wherein the Brachyspira infection is infection with Brachyspira hyodysenteriae.

63. A kit for diagnosing a Brachyspira infection in an animal comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, and 66.

Images