Patents - stay tuned to the technology

Inventors list

Assignees list

Classification tree browser

Top 100 Inventors

Top 100 Assignees

Patent application title: COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF Eg5 GENE

Inventors:  David Bumcrot (Belmont, MA, US)  Pamela Tan (Kulmbach, DE)  Hans-Peter Vornlocher (Bayreuth, DE)  Anke Geick (Bayreuth, DE)  Anke Geick (Bayreuth, DE)
IPC8 Class: AA61K31713FI
USPC Class: 514 44 A
Class name: Nitrogen containing hetero ring polynucleotide (e.g., rna, dna, etc.) antisense or rna interference
Publication date: 2011-01-20
Patent application number: 20110015250



a double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of the Eg5 gene (Eg5 gene), comprising an antisense strand having a nucleotide sequence which is less that 30 nucleotides in length, generally 19-25 nucleotides in length, and which is substantially complementary to at least a part of the Eg5 gene. The invention also relates to a pharmaceutical composition comprising the dsRNA together with a pharmaceutically acceptable carrier; methods for treating diseases caused by Eg5 expression and the expression of the Eg5 gene using the pharmaceutical composition; and methods for inhibiting the expression of the Eg5 gene in a cell.

Claims:

1. A composition comprising a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of a human kinesin family member 11 (Eg5) gene in a cell, wherein the dsRNA comprises a first sense strand comprising a first sequence and an first antisense strand comprising a second sequence complementary to a first 15 nucleotides of SEQ ID NO:1311, wherein the first sequence is complementary to the second sequence and wherein the dsRNA is between 15 and 30 base pairs in length.

2. The composition of claim 1, wherein the first sense strand consists of the nucleotide sequence of SEQ ID NO:135 and the first antisense strand consists of the nucleotide sequence of SEQ ID NO:136.

3. The composition of claim 2, wherein each strand of the first dsRNA is modified as follows to include a 2'-O-methyl ribonucleotide as indicated by a lower case letter "c" or "u" and a phosphorothioate as indicated by a lower case letter "s": TABLE-US-00014 SEQ ID NO: 135 is ucGAGAAucuAAAcuAAcuTsT SEQ ID NO: 136 is AGUuAGUUuAGAUUCUCGATsT

4. A composition comprising the composition of claim 1 and a second dsRNA that inhibits expression of a human vascular endothelial growth factor (VEGF) gene in a cell, wherein the second dsRNA comprises a second sense strand comprising a third sequence and a second antisense strand comprising a fourth sequence complementary to a first 15 nucleotides of SEQ ID NO:1242, wherein the third sequence is complementary to the fourth sequence and wherein the second dsRNA is between 15 and 30 base pairs in length.

5. The composition of claim 4, wherein the second sense strand consists of the nucleotide sequence of SEQ ID NO:1242 and the second antisense strand consists of the nucleotide sequence SEQ ID NO:1243.

6. The composition of claim 5, wherein the second sense and antisense strands are modified as follows to include a 2'-0-methyl ribonucleotide as indicated by a lower case letter "c" or "u" and a phosphorothioate as indicated by a lower case letter "s": TABLE-US-00015 GcAcAuAGGAGAGAuGAGCUsU (SEQ ID NO: 1242) AAGCUcAUCUCUCCuAuGuGCusG. (SEQ ID NO: 1243)

7. The composition of claim 4, wherein the first sense strand consists of the nucleotide sequence of SEQ ID NO:135 and the first antisense strand consists of the nucleotide sequence of SEQ ID NO:136 and each strand of the first dsRNA is modified as follows to include a 2'-O-methyl ribonucleotide as indicated by a lower case letter "c" or "u" and a phosphorothioate as indicated by a lower case letter "s": TABLE-US-00016 SEQ ID NO: 135 is ucGAGAAucuAAAcuAAcuTsT SEQ ID NO: 136 is AGUuAGUUuAGAUUCUCGATsT;

andwherein the second sense strand consists of the nucleotide sequence of SEQ ID NO:1242 and the second antisense strand consists of the nucleotide sequence SEQ ID NO:1243, and each strand of the second dsRNA is modified as follows to include a 2'-O-methyl ribonucleotide as indicated by a lower case letter "c" or "u" and a phosphorothioate as indicated by a lower case letter "s": TABLE-US-00017 GcAcAuAGGAGAGAuGAGCUsU (SEQ ID NO: 1242) AAGCUcAUCUCUCCuAuGuGCusG. (SEQ ID NO: 1243

8. The composition of claim 1, wherein the dsRNA comprises at least one modified nucleotide.

9. The composition of claim 7, wherein the modified nucleotide is chosen from the group of: a 2'-O-methyl modified nucleotide, a nucleotide comprising a 5'-phosphorothioate group, and a terminal nucleotide linked to a cholesteryl derivative or dodecanoic acid bisdecylamide group.

10. The composition of claim 7, wherein the modified nucleotide is chosen from the group of: a 2'-deoxy-2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a locked nucleotide, an abasic nucleotide, 2'-amino-modified nucleotide, 2'-alkyl-modified nucleotide, morpholino nucleotide, a phosphoramidate, and a non-natural base comprising nucleotide.

11. The composition of claim 7, wherein the first dsRNA comprises at least one 2'-O-methyl modified ribonucleotide and at least one phosphorothioate.

12. The composition of claim 5, wherein at least one dsRNA comprises at least one modified nucleotide.

13. The composition of claim 12, wherein the modified nucleotide is chosen from the group of: a 2'-O-methyl modified nucleotide, a nucleotide comprising a 5'-phosphorothioate group, and a terminal nucleotide linked to a cholesteryl derivative or dodecanoic acid bisdecylamide group.

14. The composition of claim 12, wherein the modified nucleotide is chosen from the group of: a 2'-deoxy-2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a locked nucleotide, an abasic nucleotide, 2'-amino-modified nucleotide, 2'-alkyl-modified nucleotide, morpholino nucleotide, a phosphoramidate, and a non-natural base comprising nucleotide.

15. The composition of claim 12, wherein each dsRNA comprises at least one 2'-O-methyl modified ribonucleotide and at least one phosphorothioate.

16. The composition of claim 1, wherein the composition, upon contact with a cell expressing Eg5, inhibits expression of Eg5 gene by at least 40%.

17. The composition of claim 4, wherein the composition, upon contact with a cell expressing Eg5 and/or VEGF, inhibits expression of the Eg5 and/or VEGF gene by at least 40%.

18. The composition of claim 1, wherein the first dsRNA is 19-21 base pairs in length.

19. The composition of claim 4, wherein the first dsRNA is 19-21 base pairs in length and the second dsRNA is 19-23 base pairs in length.

20. An isolated cell comprising the composition of claim 1.

21. An isolated cell comprising the composition of claim 4.

22. A vector comprising a regulatory sequence operably linked to a nucleotide sequence that encodes at least one strand of the first dsRNA of the composition of claim 1.

23. An isolated cell comprising the vector of claim 22.

24. At least one vector comprising a regulatory sequence operably linked to a nucleotide sequence that encodes at least one strand of the first dsRNA of and at least one strand of the second dsRNA of the composition of claim 4.

25. An isolated cell comprising the vector of claim 24.

26. A pharmaceutical composition for inhibiting Eg5 gene expression comprising the composition of claim 1 and a pharmaceutically acceptable carrier.

27. A pharmaceutical composition for inhibiting Eg5 gene expression and VEGF gene expression comprising the composition of claim 4 and a pharmaceutically acceptable carrier.

28. A method for inhibiting Eg5 gene expression in a cell, the method comprising:introducing into the cell the composition of claim 1; andmaintaining the cell produced in step (a) for a time sufficient to obtain degradation of the mRNA transcript of the Eg5 gene, thereby inhibiting expression of the Eg5 gene in the cell.

29. A method for inhibiting Eg5 gene expression and/or VEGF gene expression in a cell, the method comprising:introducing into the cell the composition of claim 4; andmaintaining the cell produced in step (a) for a time sufficient to obtain degradation of the mRNA transcript of the Eg5 gene and/or degradation of the mRNA transcript of the VEGF gene, thereby inhibiting expression of the Eg5 gene and/or VEGF gene in the cell.

30. A method of treating or managing pathological processes mediated by human Eg5 expression comprising administering to a patient in need of such treatment or management a therapeutically effective amount of the composition of claim 1.

31. A method of treating or managing pathological processes mediated by human Eg5 expression and/or human VEGF expression comprising administering to a patient in need of such treatment or management a therapeutically effective amount of the composition of claim 4.

Description:

RELATED APPLICATIONS

[0001]This application is a divisional application of U.S. application Ser. No. 11/694,215, filed Mar. 30, 2007 (pending, now U.S. Pat. No. ______) which claims the benefit of U.S. Provisional Application No. 60/787,762, filed Mar. 31, 2006, and U.S. Provisional Application No. 60/870,259, filed Dec. 15, 2006. All prior applications are incorporated herein by reference in their entirety.

FIELD OF THE INVENTION

[0002]This invention relates to double-stranded ribonucleic acid (dsRNA), and its use in mediating RNA interference to inhibit the expression of the Eg5 gene and the use of the dsRNA to treat pathological processes mediated by Eg5 expression, such as cancer, alone or in combination with a dsRNA targeting vascular endothelian growth factor (VEGF).

BACKGROUND OF THE INVENTION

[0003]The maintenance of cell populations within an organism is governed by the cellular processes of cell division and programmed cell death. Within normal cells, the cellular events associated with the initiation and completion of each process is highly regulated. In proliferative disease such as cancer, one or both of these processes may be perturbed. For example, a cancer cell may have lost its regulation (checkpoint control) of the cell division cycle through either the overexpression of a positive regulator or the loss of a negative regulator, perhaps by mutation.

[0004]Alternatively, a cancer cell may have lost the ability to undergo programmed cell death through the overexpression of a negative regulator. Hence, there is a need to develop new chemotherapeutic drugs that will restore the processes of checkpoint control and programmed cell death to cancerous cells.

[0005]One approach to the treatment of human cancers is to target a protein that is essential for cell cycle progression. In order for the cell cycle to proceed from one phase to the next, certain prerequisite events must be completed. There are checkpoints within the cell cycle that enforce the proper order of events and phases. One such checkpoint is the spindle checkpoint that occurs during the metaphase stage of mitosis. Small molecules that target proteins with essential functions in mitosis may initiate the spindle checkpoint to arrest cells in mitosis. Of the small molecules that arrest cells in mitosis, those which display anti-tumor activity in the clinic also induce apoptosis, the morphological changes associated with programmed cell death. An effective chemotherapeutic for the treatment of cancer may thus be one which induces checkpoint control and programmed cell death. Unfortunately, there are few compounds available for controlling these processes within the cell. Most compounds known to cause mitotic arrest and apoptosis act as tubulin binding agents. These compounds alter the dynamic instability of microtubules and indirectly alter the function/structure of the mitotic spindle thereby causing mitotic arrest. Because most of these compounds specifically target the tubulin protein which is a component of all microtubules, they may also affect one or more of the numerous normal cellular processes in which microtubules have a role. Hence, there is also a need for small molecules that more specifically target proteins associated with proliferating cells.

[0006]Eg5 is one of several kinesin-like motor proteins that are localized to the mitotic spindle and known to be required for formation and/or function of the bipolar mitotic spindle. Recently, there was a report of a small molecule that disturbs bipolarity of the mitotic spindle (Mayer, T. U. et. al. 1999. Science 286(5441) 971-4, herein incorporated by reference). More specifically, the small molecule induced the formation of an aberrant mitotic spindle wherein a monoastral array of microtubules emanated from a central pair of centrosomes, with chromosomes attached to the distal ends of the microtubules. The small molecule was dubbed "monastrol" after the monoastral array. This monoastral array phenotype had been previously observed in mitotic cells that were immunodepleted of the Eg5 motor protein. This distinctive monoastral array phenotype facilitated identification of monastrol as a potential inhibitor of Eg5. Indeed, monastrol was further shown to inhibit the Eg5 motor-driven motility of microtubules in an in vitro assay. The Eg5 inhibitor monastrol had no apparent effect upon the related kinesin motor or upon the motor(s) responsible for golgi apparatus movement within the cell. Cells that display the monoastral array phenotype either through immunodepletion of Eg5 or monastrol inhibition of Eg5 arrest in M-phase of the cell cycle. However, the mitotic arrest induced by either immunodepletion or inhibition of Eg5 is transient (Kapoor, T. M., 2000. J Cell Biol 150(5) 975-80). Both the monoastral array phenotype and the cell cycle arrest in mitosis induced by monastrol are reversible. Cells recover to form a normal bipolar mitotic spindle, to complete mitosis and to proceed through the cell cycle and normal cell proliferation. These data suggest that a small molecule inhibitor of Eg5 which induced a transient mitotic arrest may not be effective for the treatment of cancer cell proliferation. Nonetheless, the discovery that monastrol causes mitotic arrest is intriguing and hence there is a need to further study and identify compounds which can be used to modulate the Eg5 motor protein in a manner that would be effective in the treatment of human cancers. There is also a need to explore the use of these compounds in combination with other antineoplastic agents.

[0007]VEGF (also known as vascular permeability factor, VPF) is a multifunctional cytokine that stimulates angiogenesis, epithelial cell proliferation, and endothelial cell survival. VEGF can be produced by a wide variety of tissues, and its overexpression or aberrant expression can result in a variety disorders, including cancers and retinal disorders such as age-related macular degeneration and other angiogenic disorders.

[0008]Recently, double-stranded RNA molecules (dsRNA) have been shown to block gene expression in a highly conserved regulatory mechanism known as RNA interference (RNAi). WO 99/32619 (Fire et al.) discloses the use of a dsRNA of at least 25 nucleotides in length to inhibit the expression of genes in C. elegans. dsRNA has also been shown to degrade target RNA in other organisms, including plants (see, e.g., WO 99/53050, Waterhouse et al.; and WO 99/61631, Heifetz et al.), Drosophila (see, e.g., Yang, D., et al., Curr. Biol. (2000) 10:1191-1200), and mammals (see WO 00/44895, Limmer; and DE 101 00 586.5, Kreutzer et al.). This natural mechanism has now become the focus for the development of a new class of pharmaceutical agents for treating disorders that are caused by the aberrant or unwanted regulation of a gene.

[0009]Despite significant advances in the field of RNAi and advances in the treatment of pathological processes mediated by Eg5 expression, there remains a need for an agent that can selectively and efficiently silence the Eg5 gene using the cell's own RNAi machinery that has both high biological activity and in vivo stability, and that can effectively inhibit expression of a target Eg5 gene for use in treating pathological processes mediated by Eg5 expression.

SUMMARY OF THE INVENTION

[0010]The invention provides double-stranded ribonucleic acid (dsRNA), as well as compositions and methods for inhibiting the expression of the Eg5 gene in a cell or mammal using such dsRNA, alone or in combination with a dsRNA targeting VEGF. The invention also provides compositions and methods for treating pathological conditions and diseases caused by the expression of the Eg5 gene, such as in cancer. The dsRNA of the invention comprises an RNA strand (the antisense strand) having a region which is less than 30 nucleotides in length, generally 19-24 nucleotides in length, and is substantially complementary to at least part of an mRNA transcript of the Eg5 gene.

[0011]In one embodiment, the invention provides double-stranded ribonucleic acid (dsRNA) molecules for inhibiting the expression of the Eg5 gene. The dsRNA comprises at least two sequences that are complementary to each other. The dsRNA comprises a sense strand comprising a first sequence and an antisense strand comprising a second sequence. The antisense strand comprises a nucleotide sequence which is substantially complementary to at least part of an mRNA encoding Eg5, and the region of complementarity is less than 30 nucleotides in length, generally 19-24 nucleotides in length. The dsRNA, upon contacting with a cell expressing the Eg5, inhibits the expression of the Eg5 gene by at least 40%.

[0012]For example, the dsRNA molecules of the invention can be comprised of a first sequence of the dsRNA that is selected from the group consisting of the sense sequences of Tables 1-3 and the second sequence is selected from the group consisting of the antisense sequences of Tables 1-3. The dsRNA molecules of the invention can be comprised of naturally occurring nucleotides or can be comprised of at least one modified nucleotide, such as a 2'-O-methyl modified nucleotide, a nucleotide comprising a 5'-phosphorothioate group, and a terminal nucleotide linked to a cholesteryl derivative. Alternatively, the modified nucleotide may be chosen from the group of: a 2'-deoxy-2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a locked nucleotide, an abasic nucleotide, 2'-amino-modified nucleotide, 2'-alkyl-modified nucleotide, morpholino nucleotide, a phosphoramidate, and a non-natural base comprising nucleotide. Generally, such modified sequence will be based on a first sequence of said dsRNA selected from the group consisting of the sense sequences of Tables 1-3 and a second sequence selected from the group consisting of the antisense sequences of Tables 1-3.

[0013]In another embodiment, the invention provides a cell comprising one of the dsRNAs of the invention. The cell is generally a mammalian cell, such as a human cell.

[0014]In another embodiment, the invention provides a pharmaceutical composition for inhibiting the expression of the Eg5 gene in an organism, generally a human subject, comprising one or more of the dsRNA of the invention and a pharmaceutically acceptable carrier or delivery vehicle.

[0015]In another embodiment, the invention provides a method for inhibiting the expression of the Eg5 gene in a cell, comprising the following steps: [0016](a) introducing into the cell a double-stranded ribonucleic acid (dsRNA), wherein the dsRNA comprises at least two sequences that are complementary to each other. The dsRNA comprises a sense strand comprising a first sequence and an antisense strand comprising a second sequence. The antisense strand comprises a region of complementarity which is substantially complementary to at least a part of a mRNA encoding Eg5, and wherein the region of complementarity is less than 30 nucleotides in length, generally 19-24 nucleotides in length, and wherein the dsRNA, upon contact with a cell expressing the Eg5, inhibits expression of the Eg5 gene by at least 40%; and [0017](b) maintaining the cell produced in step (a) for a time sufficient to obtain degradation of the mRNA transcript of the Eg5 gene, thereby inhibiting expression of the Eg5 gene in the cell.

[0018]In another embodiment, the invention provides methods for treating, preventing or managing pathological processes mediated by Eg5 expression, e.g. cancer, comprising administering to a patient in need of such treatment, prevention or management a therapeutically or prophylactically effective amount of one or more of the dsRNAs of the invention.

[0019]In another embodiment, the invention provides vectors for inhibiting the expression of the Eg5 gene in a cell, comprising a regulatory sequence operably linked to a nucleotide sequence that encodes at least one strand of one of the dsRNA of the invention.

[0020]In another embodiment, the invention provides a cell comprising a vector for inhibiting the expression of the Eg5 gene in a cell. The vector comprises a regulatory sequence operably linked to a nucleotide sequence that encodes at least one strand of one of the dsRNA of the invention.

[0021]In a further embodiment, the invention provides the Eg5 dsRNA and the uses thereof as described above in combination with a second dsRNA targeting the VEGF mRNA. A combination of a dsRNA targeting Eg5 and a second dsRNA targeting VEGF provides complementary and synergiatic activity for treating hyperproliferative discords, particularly hepatic carcinoma.

BRIEF DESCRIPTION OF THE FIGURES

[0022]No Figures are presented

DETAILED DESCRIPTION OF THE INVENTION

[0023]The invention provides double-stranded ribonucleic acid (dsRNA), as well as compositions and methods for inhibiting the expression of the Eg5 gene in a cell or mammal using the dsRNA. The invention also provides compositions and methods for treating pathological conditions and diseases in a mammal caused by the expression of the Eg5 gene using dsRNA. dsRNA directs the sequence-specific degradation of mRNA through a process known as RNA interference (RNAi). The invention further provides this dsRNA in combination with a second dsRNA that inhibits the expression of the VEGF gene.

[0024]The dsRNAs of the invention comprises an RNA strand (the antisense strand) having a region which is less than 30 nucleotides in length, generally 19-24 nucleotides in length, and is substantially complementary to at least part of an mRNA transcript of the Eg5 gene. The use of these dsRNAs enables the targeted degradation of mRNAs of genes that are implicated in replication and or maintenance of cancer cells in mammals. Using cell-based and animal assays, the present inventors have demonstrated that very low dosages of these dsRNA can specifically and efficiently mediate RNAi, resulting in significant inhibition of expression of the Eg5 gene. Thus, the methods and compositions of the invention comprising these dsRNAs are useful for treating pathological processes mediated by Eg5 expression, e.g. cancer, by targeting a gene involved in mitotic division.

[0025]The following detailed description discloses how to make and use the dsRNA and compositions containing dsRNA to inhibit the expression of the Eg5 gene, as well as compositions and methods for treating diseases and disorders caused by the expression of Eg5, such as cancer, alone or in combination with a second dsRNA targeting the VEGF gene. The pharmaceutical compositions of the invention comprise a dsRNA having an antisense strand comprising a region of complementarity which is less than 30 nucleotides in length, generally 19-24 nucleotides in length, and is substantially complementary to at least part of an RNA transcript of the Eg5 gene, together with a pharmaceutically acceptable carrier. As discussed above, such compositions can further include a second dsRNA targeting VEGF.

[0026]Accordingly, certain aspects of the invention provide pharmaceutical compositions comprising the dsRNA of the invention together with a pharmaceutically acceptable carrier, methods of using the compositions to inhibit expression of the Eg5 gene, and methods of using the pharmaceutical compositions to treat diseases caused by expression of the Eg5 gene. The invention further provides the above pharmaceutical compositions further containing a second dsRNA designed to inhibit the expression of VEGF.

[0027]I. Definitions

[0028]For convenience, the meaning of certain terms and phrases used in the specification, examples, and appended claims, are provided below. If there is an apparent discrepancy between the usage of a term in other parts of this specification and its definition provided in this section, the definition in this section shall prevail.

[0029]"G," "C," "A" and "U" each generally stand for a nucleotide that contains guanine, cytosine, adenine, and uracil as a base, respectively. However, it will be understood that the term "ribonucleotide" or "nucleotide" can also refer to a modified nucleotide, as further detailed below, or a surrogate replacement moiety. The skilled person is well aware that guanine, cytosine, adenine, and uracil may be replaced by other moieties without substantially altering the base pairing properties of an oligonucleotide comprising a nucleotide bearing such replacement moiety. For example, without limitation, a nucleotide comprising inosine as its base may base pair with nucleotides containing adenine, cytosine, or uracil. Hence, nucleotides containing uracil, guanine, or adenine may be replaced in the nucleotide sequences of the invention by a nucleotide containing, for example, inosine. Sequences comprising such replacement moieties are embodiments of the invention.

[0030]As used herein, "Eg5" refers to the human kinesin family member 11, which is also known as KIF11, Eg5, HKSP, KNSL1 or TRIPS. Eg5 sequence can be found as NCBI GeneID:3832, HGNC ID: HGNC:6388 and RefSeq ID number:NM--004523.

[0031]As used herein, "target sequence" refers to a contiguous portion of the nucleotide sequence of an mRNA molecule formed during the transcription of the Eg5 gene, including mRNA that is a product of RNA processing of a primary transcription product.

[0032]As used herein, VEGF, also known as vascular permeability factor, is an angiogenic growth factor. VEGF is a homodimeric 45 kDa glycoprotein that exists in at least three different isoforms. VEGF isoforms are expressed in endothelial cells. The VEGF gene contains 8 exons that express a 189-amino acid protein isoform. A 165-amino acid isoform lacks the residues encoded by exon 6, whereas a 121-amino acid isoform lacks the residues encoded by exons 6 and 7. VEGF145 is an isoform predicted to contain 145 amino acids and to lack exon 7. VEGF can act on endothelial cells by binding to an endothelial tyrosine kinase receptor, such as Flt-1 (VEGFR-1) or KDR/flk-1 (VEGFR-2). VEGFR-2 is expressed in endothelial cells and is involved in endothelial cell differentiation and vasculogenesis. A third receptor, VEGFR-3 has been implicated in lymphogenesis.

[0033]The various isoforms have different biologic activities and clinical implications. For example, VEGF145 induces angiogenesis and like VEGF189 (but unlike VEGF165) VEGF145 binds efficiently to the extracellular matrix by a mechanism that is not dependent on extracellular matrix-associated heparin sulfates. VEGF displays activity as an endothelial cell mitogen and chemoattractant in vitro and induces vascular permeability and angiogenesis in vivo. VEGF is secreted by a wide variety of cancer cell types and promotes the growth of tumors by inducing the development of tumor-associated vasculature Inhibition of VEGF function has been shown to limit both the growth of primary experimental tumors as well as the incidence of metastases in immunocompromised mice. Various dsRNAs directed to VEGF are described in co-pending U.S. Ser. Nos. 11/078,073 and 11/340,080, herein incorporated by reference).

[0034]As used herein, the term "strand comprising a sequence" refers to an oligonucleotide comprising a chain of nucleotides that is described by the sequence referred to using the standard nucleotide nomenclature.

[0035]As used herein, and unless otherwise indicated, the term "complementary," when used to describe a first nucleotide sequence in relation to a second nucleotide sequence, refers to the ability of an oligonucleotide or polynucleotide comprising the first nucleotide sequence to hybridize and form a duplex structure under certain conditions with an oligonucleotide or polynucleotide comprising the second nucleotide sequence, as will be understood by the skilled person. Such conditions can, for example, be stringent conditions, where stringent conditions may include: 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 50° C. or 70° C. for 12-16 hours followed by washing. Other conditions, such as physiologically relevant conditions as may be encountered inside an organism, can apply. The skilled person will be able to determine the set of conditions most appropriate for a test of complementarity of two sequences in accordance with the ultimate application of the hybridized nucleotides.

[0036]This includes base-pairing of the oligonucleotide or polynucleotide comprising the first nucleotide sequence to the oligonucleotide or polynucleotide comprising the second nucleotide sequence over the entire length of the first and second nucleotide sequence. Such sequences can be referred to as "fully complementary" with respect to each other herein. However, where a first sequence is referred to as "substantially complementary" with respect to a second sequence herein, the two sequences can be fully complementary, or they may form one or more, but generally not more than 4, 3 or 2 mismatched base pairs upon hybridization, while retaining the ability to hybridize under the conditions most relevant to their ultimate application. However, where two oligonucleotides are designed to form, upon hybridization, one or more single stranded overhangs, such overhangs shall not be regarded as mismatches with regard to the determination of complementarity. For example, a dsRNA comprising one oligonucleotide 21 nucleotides in length and another oligonucleotide 23 nucleotides in length, wherein the longer oligonucleotide comprises a sequence of 21 nucleotides that is fully complementary to the shorter oligonucleotide, may yet be referred to as "fully complementary" for the purposes of the invention.

[0037]"Complementary" sequences, as used herein, may also include, or be formed entirely from, non-Watson-Crick base pairs and/or base pairs formed from non-natural and modified nucleotides, in as far as the above requirements with respect to their ability to hybridize are fulfilled.

[0038]The terms "complementary", "fully complementary" and "substantially complementary" herein may be used with respect to the base matching between the sense strand and the antisense strand of a dsRNA, or between the antisense strand of a dsRNA and a target sequence, as will be understood from the context of their use.

[0039]As used herein, a polynucleotide which is "substantially complementary to at least part of a messenger RNA (mRNA) refers to a polynucleotide which is substantially complementary to a contiguous portion of the mRNA of interest (e.g., encoding Eg5). For example, a polynucleotide is complementary to at least a part of a Eg5 mRNA if the sequence is substantially complementary to a non-interrupted portion of a mRNA encoding Eg5.

[0040]The term "double-stranded RNA" or "dsRNA", as used herein, refers to a complex of ribonucleic acid molecules, having a duplex structure comprising two anti-parallel and substantially complementary, as defined above, nucleic acid strands,. The two strands forming the duplex structure may be different portions of one larger RNA molecule, or they may be separate RNA molecules. Where the two strands are part of one larger molecule, and therefore are connected by an uninterrupted chain of nucleotides between the 3'-end of one strand and the 5' end of the respective other strand forming the duplex structure, the connecting RNA chain is referred to as a "hairpin loop". Where the two strands are connected covalently by means other than an uninterrupted chain of nucleotides between the 3'-end of one strand and the 5' end of the respective other strand forming the duplex structure, the connecting structure is referred to as a "linker". The RNA strands may have the same or a different number of nucleotides. The maximum number of base pairs is the number of nucleotides in the shortest strand of the dsRNA minus any overhangs that are present in the duplex. In addition to the duplex structure, a dsRNA may comprise one or more nucleotide overhangs.

[0041]As used herein, a "nucleotide overhang" refers to the unpaired nucleotide or nucleotides that protrude from the duplex structure of a dsRNA when a 3'-end of one strand of the dsRNA extends beyond the 5'-end of the other strand, or vice versa. "Blunt" or "blunt end" means that there are no unpaired nucleotides at that end of the dsRNA, i.e., no nucleotide overhang. A "blunt ended" dsRNA is a dsRNA that is double-stranded over its entire length, i.e., no nucleotide overhang at either end of the molecule.

[0042]The term "antisense strand" refers to the strand of a dsRNA which includes a region that is substantially complementary to a target sequence. As used herein, the term "region of complementarity" refers to the region on the antisense strand that is substantially complementary to a sequence, for example a target sequence, as defined herein. Where the region of complementarity is not fully complementary to the target sequence, the mismatches are most tolerated in the terminal regions and, if present, are generally in a terminal region or regions, e.g., within 6, 5, 4, 3, or 2 nucleotides of the 5' and/or 3' terminus.

[0043]The term "sense strand," as used herein, refers to the strand of a dsRNA that includes a region that is substantially complementary to a region of the antisense strand.

[0044]"Introducing into a cell", when referring to a dsRNA, means facilitating uptake or absorption into the cell, as is understood by those skilled in the art. Absorption or uptake of dsRNA can occur through unaided diffusive or active cellular processes, or by auxiliary agents or devices. The meaning of this term is not limited to cells in vitro; a dsRNA may also be "introduced into a cell", wherein the cell is part of a living organism. In such instance, introduction into the cell will include the delivery to the organism. For example, for in vivo delivery, dsRNA can be injected into a tissue site or administered systemically. In vitro introduction into a cell includes methods known in the art such as electroporation and lipofection.

[0045]The terms "silence" and "inhibit the expression of", in as far as they refer to the Eg5 gene, herein refer to the at least partial suppression of the expression of the Eg5 gene, as manifested by a reduction of the amount of mRNA transcribed from the Eg5 gene which may be isolated from a first cell or group of cells in which the Eg5 gene is transcribed and which has or have been treated such that the expression of the Eg5 gene is inhibited, as compared to a second cell or group of cells substantially identical to the first cell or group of cells but which has or have not been so treated (control cells). The degree of inhibition is usually expressed in terms of

( mRNA in control cells ) - ( mRNA in treated cells ) ( mRNA in control cells ) 100 % ##EQU00001##

[0046]Alternatively, the degree of inhibition may be given in terms of a reduction of a parameter that is functionally linked to Eg5 gene transcription, e.g. the amount of protein encoded by the Eg5 gene which is secreted by a cell, or the number of cells displaying a certain phenotype, e.g apoptosis. In principle, Eg5 gene silencing may be determined in any cell expressing the target, either constitutively or by genomic engineering, and by any appropriate assay. However, when a reference is needed in order to determine whether a given dsRNA inhibits the expression of the Eg5 gene by a certain degree and therefore is encompassed by the instant invention, the assay provided in the Examples below shall serve as such reference.

[0047]For example, in certain instances, expression of the Eg5 gene (or VEGF gene) is suppressed by at least about 20%, 25%, 35%, or 50% by administration of the double-stranded oligonucleotide of the invention. In some embodiment, the Eg5 gene is suppressed by at least about 60%, 70%, or 80% by administration of the double-stranded oligonucleotide of the invention. In some embodiments, the Eg5 gene is suppressed by at least about 85%, 90%, or 95% by administration of the double-stranded oligonucleotide of the invention. Tables 1-3 provides values for inhibition of expression using various Eg5 dsRNA molecules at various concentrations.

[0048]As used herein in the context of Eg5 expression, the terms "treat", "treatment", and the like, refer to relief from or alleviation of pathological processes mediated by Eg5 expression. In the context of the present invention insofar as it relates to any of the other conditions recited herein below (other than pathological processes mediated by Eg5 expression), the terms "treat", "treatment", and the like mean to relieve or alleviate at least one symptom associated with such condition, or to slow or reverse the progression of such condition, such as the slowing and progression of hepatic carcinoma.

[0049]As used herein, the phrases "therapeutically effective amount" and "prophylactically effective amount" refer to an amount that provides a therapeutic benefit in the treatment, prevention, or management of pathological processes mediated by Eg5 expression or an overt symptom of pathological processes mediated by Eg5 expression (alone or in combination with VEGF expression). The specific amount that is therapeutically effective can be readily determined by ordinary medical practitioner, and may vary depending on factors known in the art, such as, e.g. the type of pathological processes mediated by Eg5 expression, the patient's history and age, the stage of pathological processes mediated by Eg5 expression, and the administration of other anti-pathological processes mediated by Eg5 expression agents.

[0050]As used herein, a "pharmaceutical composition" comprises a pharmacologically effective amount of a dsRNA and a pharmaceutically acceptable carrier. As used herein, "pharmacologically effective amount," "therapeutically effective amount" or simply "effective amount" refers to that amount of an RNA effective to produce the intended pharmacological, therapeutic or preventive result. For example, if a given clinical treatment is considered effective when there is at least a 25% reduction in a measurable parameter associated with a disease or disorder, a therapeutically effective amount of a drug for the treatment of that disease or disorder is the amount necessary to effect at least a 25% reduction in that parameter.

[0051]The term "pharmaceutically acceptable carrier" refers to a carrier for administration of a therapeutic agent. Such carriers include, but are not limited to, saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. The term specifically excludes cell culture medium. For drugs administered orally, pharmaceutically acceptable carriers include, but are not limited to pharmaceutically acceptable excipients such as inert diluents, disintegrating agents, binding agents, lubricating agents, sweetening agents, flavoring agents, coloring agents and preservatives. Suitable inert diluents include sodium and calcium carbonate, sodium and calcium phosphate, and lactose, while corn starch and alginic acid are suitable disintegrating agents. Binding agents may include starch and gelatin, while the lubricating agent, if present, will generally be magnesium stearate, stearic acid or talc. If desired, the tablets may be coated with a material such as glyceryl monostearate or glyceryl distearate, to delay absorption in the gastrointestinal tract.

[0052]As used herein, a "transformed cell" is a cell into which a vector has been introduced from which a dsRNA molecule may be expressed.

[0053]II. Double-Stranded Ribonucleic Acid (dsRNA)

[0054]In one embodiment, the invention provides double-stranded ribonucleic acid (dsRNA) molecules for inhibiting the expression of the Eg5 gene (alone or incombinaton with a second dsRNA for inhibiting the expression of VEGF) in a cell or mammal, wherein the dsRNA comprises an antisense strand comprising a region of complementarity which is complementary to at least a part of an mRNA formed in the expression of the Eg5 gene, and wherein the region of complementarity is less than 30 nucleotides in length, generally 19-24 nucleotides in length, and wherein said dsRNA, upon contact with a cell expressing said Eg5 gene, inhibits the expression of said Eg5 gene by at least 40%. The dsRNA comprises two RNA strands that are sufficiently complementary to hybridize to form a duplex structure. One strand of the dsRNA (the antisense strand) comprises a region of complementarity that is substantially complementary, and generally fully complementary, to a target sequence, derived from the sequence of an mRNA formed during the expression of the Eg5 gene, the other strand (the sense strand) comprises a region which is complementary to the antisense strand, such that the two strands hybridize and form a duplex structure when combined under suitable conditions. Generally, the duplex structure is between 15 and 30, more generally between 18 and 25, yet more generally between 19 and 24, and most generally between 19 and 21 base pairs in length. Similarly, the region of complementarity to the target sequence is between 15 and 30, more generally between 18 and 25, yet more generally between 19 and 24, and most generally between 19 and 21 nucleotides in length. The dsRNA of the invention may further comprise one or more single-stranded nucleotide overhang(s). The dsRNA can be synthesized by standard methods known in the art as further discussed below, e.g., by use of an automated DNA synthesizer, such as are commercially available from, for example, Biosearch, Applied Biosystems, Inc. In a preferred embodiment, the Eg5 gene is the human Eg5 gene. In specific embodiments, the antisense strand of the dsRNA comprises the sense sequences of Tables 1-3 and the second sequence is selected from the group consisting of the antisense sequences of Tables 1-3. Alternative antisense agents that target elsewhere in the target sequence provided in Tables 1-3 can readily be determined using the target sequence and the flanking Eg5 sequence. In embodiments using a second dsRNA targeting VEGF, such agents are exemplified in the Examples and in co-pending U.S. Ser. Nos. 11/078,073 and 11/340,080, herein incorporated by reference.

[0055]The dsRNA will comprise at least two nucleotide sequence selected from the groups of sequences provided in Tables 1-3. One of the two sequences is complementary to the other of the two sequences, with one of the sequences being substantially complementary to a sequence of an mRNA generated in the expression of the Eg5 gene. As such, the dsRNA will comprises two oligonucleotides, wherein one oligonucleotide is described as the sense strand in Tables 1-3 and the second oligonucleotide is described as the antisense strand in Tables 1-3

[0056]The skilled person is well aware that dsRNAs comprising a duplex structure of between 20 and 23, but specifically 21, base pairs have been hailed as particularly effective in inducing RNA interference (Elbashir et al., EMBO 2001, 20:6877-6888). However, others have found that shorter or longer dsRNAs can be effective as well. In the embodiments described above, by virtue of the nature of the oligonucleotide sequences provided in Tables 1-3, the dsRNAs of the invention can comprise at least one strand of a length of minimally 21 nt. It can be reasonably expected that shorter dsRNAs comprising one of the sequences of Tables 1-3 minus only a few nucleotides on one or both ends may be similarly effective as compared to the dsRNAs described above. Hence, dsRNAs comprising a partial sequence of at least 15, 16, 17, 18, 19, 20, or more contiguous nucleotides from one of the sequences of Tables 1-3, and differing in their ability to inhibit the expression of the Eg5 gene in a FACS assay as described herein below by not more than 5, 10, 15, 20, 25, or 30% inhibition from a dsRNA comprising the full sequence, are contemplated by the invention. Further dsRNAs that cleave within the target sequence provided in Tables 1-3 can readily be made using the Eg5 sequence and the target sequence provided.

[0057]In addition, the RNAi agents provided in Tables 1-3 identify a site in the Eg5 mRNA that is susceptible to RNAi based cleavage. As such the present invention further includes RNAi agents that target within the sequence targeted by one of the agents of the present invention. As used herein a second RNAi agent is said to target within the sequence of a first RNAi agent if the second RNAi agent cleaves the message anywhere within the mRNA that is complementary to the antisense strand of the first RNAi agent. Such a second agent will generally consist of at least 15 contiguous nucleotides from one of the sequences provided in Tables 1-3 coupled to additional nucleotide sequences taken from the region contiguous to the selected sequence in the Eg5 gene. For example, the last 15 nucleotides of SEQ ID NO:1 combined with the next 6 nucleotides from the target Eg5 gene produces a single strand agent of 21 nucleotides that is based on one of the sequences provided in Tables 1-3.

[0058]The dsRNA of the invention can contain one or more mismatches to the target sequence. In a preferred embodiment, the dsRNA of the invention contains no more than 3 mismatches. If the antisense strand of the dsRNA contains mismatches to a target sequence, it is preferable that the area of mismatch not be located in the center of the region of complementarity. If the antisense strand of the dsRNA contains mismatches to the target sequence, it is preferable that the mismatch be restricted to 5 nucleotides from either end, for example 5, 4, 3, 2, or 1 nucleotide from either the 5' or 3' end of the region of complementarity. For example, for a 23 nucleotide dsRNA strand which is complementary to a region of the Eg5 gene, the dsRNA generally does not contain any mismatch within the central 13 nucleotides. The methods described within the invention can be used to determine whether a dsRNA containing a mismatch to a target sequence is effective in inhibiting the expression of the Eg5 gene. Consideration of the efficacy of dsRNAs with mismatches in inhibiting expression of the Eg5 gene is important, especially if the particular region of complementarity in the Eg5 gene is known to have polymorphic sequence variation within the population.

[0059]In one embodiment, at least one end of the dsRNA has a single-stranded nucleotide overhang of 1 to 4, generally 1 or 2 nucleotides. dsRNAs having at least one nucleotide overhang have unexpectedly superior inhibitory properties than their blunt-ended counterparts. Moreover, the present inventors have discovered that the presence of only one nucleotide overhang strengthens the interference activity of the dsRNA, without affecting its overall stability. dsRNA having only one overhang has proven particularly stable and effective in vivo, as well as in a variety of cells, cell culture mediums, blood, and serum. Generally, the single-stranded overhang is located at the 3'-terminal end of the antisense strand or, alternatively, at the 3'-terminal end of the sense strand. The dsRNA may also have a blunt end, generally located at the 5'-end of the antisense strand. Such dsRNAs have improved stability and inhibitory activity, thus allowing administration at low dosages, i.e., less than 5 mg/kg body weight of the recipient per day. Generally, the antisense strand of the dsRNA has a nucleotide overhang at the 3'-end, and the 5'-end is blunt. In another embodiment, one or more of the nucleotides in the overhang is replaced with a nucleoside thiophosphate.

[0060]In yet another embodiment, the dsRNA is chemically modified to enhance stability. The nucleic acids of the invention may be synthesized and/or modified by methods well established in the art, such as those described in "Current protocols in nucleic acid chemistry", Beaucage, S. L. et al. (Edrs.), John Wiley & Sons, Inc., New York, N.Y., USA, which is hereby incorporated herein by reference. Specific examples of preferred dsRNA compounds useful in this invention include dsRNAs containing modified backbones or no natural internucleoside linkages. As defined in this specification, dsRNAs having modified backbones include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone. For the purposes of this specification, and as sometimes referenced in the art, modified dsRNAs that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides.

[0061]Preferred modified dsRNA backbones include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3'-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3'-5' linkages, 2'-5' linked analogs of these, and those) having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. Various salts, mixed salts and free acid forms are also included.

[0062]Representative U.S. patents that teach the preparation of the above phosphorus-containing linkages include, but are not limited to, U.S. Pat. Nos. 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,195; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,316; 5,550,111; 5,563,253; 5,571,799; 5,587,361; and 5,625,050, each of which is herein incorporated by reference

[0063]Preferred modified dsRNA backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatoms and alkyl or cycloalkyl internucleoside linkages, or ore or more short chain heteroatomic or heterocyclic internucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts.

[0064]Representative U.S. patents that teach the preparation of the above oligonucleosides include, but are not limited to, U.S. Pat. Nos. 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,64,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; and, 5,677,439, each of which is herein incorporated by reference.

[0065]In other preferred dsRNA mimetics, both the sugar and the internucleoside linkage, i.e., the backbone, of the nucleotide units are replaced with novel groups. The base units are maintained for hybridization with an appropriate nucleic acid target compound. One such oligomeric compound, an dsRNA mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA). In PNA compounds, the sugar backbone of an dsRNA is replaced with an amide containing backbone, in particular an aminoethylglycine backbone. The nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone. Representative U.S. patents that teach the preparation of PNA compounds include, but are not limited to, U.S. Pat. Nos. 5,539,082; 5,714,331; and 5,719,262, each of which is herein incorporated by reference. Further teaching of PNA compounds can be found in Nielsen et al., Science, 1991, 254, 1497-1500.

[0066]Most preferred embodiments of the invention are dsRNAs with phosphorothioate backbones and oligonucleosides with heteroatom backbones, and in particular --CH2--NH--CH2--, --CH2--N(CH3)--O--CH2--[known as a methylene (methylimino) or MMI backbone], --CH2--O--N(CH3)--CH2--, --CH2--N(CH3)--N(CH3)--CH2-- and --N(CH3)--CH2--CH2--[wherein the native phosphodiester backbone is represented as --O--P--O--CH2--] of the above-referenced U.S. Pat. No. 5,489,677, and the amide backbones of the above-referenced U.S. Pat. No. 5,602,240. Also preferred are dsRNAs having morpholino backbone structures of the above-referenced U.S. Pat. No. 5,034,506.

[0067]Modified dsRNAs may also contain one or more substituted sugar moieties. Preferred dsRNAs comprise one of the following at the 2' position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted C1 to C10 alkyl or C2 to C10 alkenyl and alkynyl. Particularly preferred are O[(CH2)nO]mCH3, O(CH2)nOCH3, O(CH2)nNH2, O(CH2)nCH3, O(CH2)nONH2, and O(CH2)nON[(CH2)nCH3)]2, where n and m are from 1 to about 10. Other preferred dsRNAs comprise one of the following at the 2' position: C1 to C10 lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an dsRNA, or a group for improving the pharmacodynamic properties of an dsRNA, and other substituents having similar properties. A preferred modification includes 2'-methoxyethoxy (2'-O--CH2CH2OCH3, also known as 2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al., Hely. Chim. Acta, 1995, 78, 486-504) i.e., an alkoxy-alkoxy group. A further preferred modification includes 2'-dimethylaminooxyethoxy, i.e., a O(CH2)2ON(CH3)2 group, also known as 2'-DMAOE, as described in examples hereinbelow, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e., 2'-O--CH2--O--CH2--N(CH2)2, also described in examples hereinbelow.

[0068]Other preferred modifications include 2'-methoxy (2'-OCH3), 2'-aminopropoxy (2'-OCH2CH2CH2NH2) and 2'-fluoro (2'-F). Similar modifications may also be made at other positions on the dsRNA, particularly the 3' position of the sugar on the 3' terminal nucleotide or in 2'-5' linked dsRNAs and the 5' position of 5' terminal nucleotide. DsRNAs may also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar. Representative U.S. patents that teach the preparation of such modified sugar structures include, but are not limited to, U.S. Pat. Nos. 4,981,957; 5,118,800; 5,319,080; 5,359,044; 5,393,878; 5,446,137; 5,466,786; 5,514,785; 5,519,134; 5,567,811; 5,576,427; 5,591,722; 5,597,909; 5,610,300; 5,627,053; 5,639,873; 5,646,265; 5,658,873; 5,670,633; and 5,700,920, certain of which are commonly owned with the instant application, and each of which is herein incorporated by reference in its entirety.

[0069]DsRNAs may also include nucleobase (often referred to in the art simply as "base") modifications or substitutions. As used herein, "unmodified" or "natural" nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl anal other 8-substituted adenines and guanines, 5-halo, particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-daazaadenine and 3-deazaguanine and 3-deazaadenine. Further nucleobases include those disclosed in U.S. Pat. No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859, Kroschwitz, J. L, ed. John Wiley & Sons, 1990, these disclosed by Englisch et al., Angewandte Chemie, International Edition, 1991, 30, 613, and those disclosed by Sanghvi, Y S., Chapter 15, DsRNA Research and Applications, pages 289-302, Crooke, S. T. and Lebleu, B., Ed., CRC Press, 1993. Certain of these nucleobases are particularly useful for increasing the binding affinity of the oligomeric compounds of the invention. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2° C. (Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., Eds., DsRNA Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are presently preferred base substitutions, even more particularly when combined with 2'-O-methoxyethyl sugar modifications.

[0070]Representative U.S. patents that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include, but are not limited to, the above noted U.S. Pat. No. 3,687,808, as well as U.S. Pat. Nos. 4,845,205; 5,130,30; 5,134,066; 5,175,273; 5,367,066; 5,432,272; 5,457,187; 5,459,255; 5,484,908; 5,502,177; 5,525,711; 5,552,540; 5,587,469; 5,594,121, 5,596,091; 5,614,617; and 5,681,941, each of which is herein incorporated by reference, and U.S. Pat. No. 5,750,692, also herein incorporated by reference.

[0071]Another modification of the dsRNAs of the invention involves chemically linking to the dsRNA one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the dsRNA. Such moieties include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger et al., Proc. Natl. Acid. Sci. USA, 199, 86, 6553-6556), cholic acid (Manoharan et al., Biorg. Med. Chem. Let., 1994 4 1053-1060), a thioether, e.g., beryl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660, 306-309; Manoharan et al., Biorg. Med. Chem. Let., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20, 533-538), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., EMBO J, 1991, 10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethyl-ammonium 1,2-di-O-hexadecyl-rac-glycero-3-Hphosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res., 1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264, 229-237), or an octadecylamine or hexylamino-carbonyloxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937).

[0072]Representative U.S. patents that teach the preparation of such dsRNA conjugates include, but are not limited to, U.S. Pat. Nos. 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,254,469; 5,258,506; 5,262,536; 5,272,250; 5,292,873; 5,317,098; 5,371,241, 5,391,723; 5,416,203, 5,451,463; 5,510,475; 5,512,667; 5,514,785; 5,565,552; 5,567,810; 5,574,142; 5,585,481; 5,587,371; 5,595,726; 5,597,696; 5,599,923; 5,599,928 and 5,688,941, each of which is herein incorporated by reference.

[0073]It is not necessary for all positions in a given compound to be uniformly modified, and in fact more than one of the aforementioned modifications may be incorporated in a single compound or even at a single nucleoside within an dsRNA. The present invention also includes dsRNA compounds which are chimeric compounds. "Chimeric" dsRNA compounds or "chimeras," in the context of this invention, are dsRNA compounds, particularly dsRNAs, which contain two or more chemically distinct regions, each made up of at least one monomer unit, i.e., a nucleotide in the case of an dsRNA compound. These dsRNAs typically contain at least one region wherein the dsRNA is modified so as to confer upon the dsRNA increased resistance to nuclease degradation, increased cellular uptake, and/or increased binding affinity for the target nucleic acid. An additional region of the dsRNA may serve as a substrate for enzymes capable of cleaving RNA:DNA or RNA:RNA hybrids. By way of example, RNase H is a cellular endonuclease which cleaves the RNA strand of an RNA:DNAduplex. Activation of RNase H, therefore, results in cleavage of the RNA target, thereby greatly enhancing the efficiency of dsRNA inhibition of gene expression. Consequently, comparable results can often be obtained with shorter dsRNAs when chimeric dsRNAs are used, compared to phosphorothioate deoxydsRNAs hybridizing to the same target region. Cleavage of the RNA target can be routinely detected by gel electrophoresis and, if necessary, associated nucleic acid hybridization techniques known in the art.

[0074]In certain instances, the dsRNA may be modified by a non-ligand group. A number of non-ligand molecules have been conjugated to dsRNAs in order to enhance the activity, cellular distribution or cellular uptake of the dsRNA, and procedures for performing such conjugations are available in the scientific literature. Such non-ligand moieties have included lipid moieties, such as cholesterol (Letsinger et al., Proc. Natl. Acad. Sci. USA, 1989, 86:6553), cholic acid (Manoharan et al., Bioorg. Med. Chem. Lett., 1994, 4:1053), a thioether, e.g., hexyl-S-tritylthiol (Manoharan et al., Ann. N.Y. Acad. Sci., 1992, 660:306; Manoharan et al., Bioorg. Med. Chem. Let., 1993, 3:2765), a thiocholesterol (Oberhauser et al., Nucl. Acids Res., 1992, 20:533), an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras et al., EMBO J., 1991, 10:111; Kabanov et al., FEBS Lett., 1990, 259:327; Svinarchuk et al., Biochimie, 1993, 75:49), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36:3651; Shea et al., Nucl. Acids Res., 1990, 18:3777), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14:969), or adamantane acetic acid (Manoharan et al., Tetrahedron Lett., 1995, 36:3651), a palmityl moiety (Mishra et al., Biochim. Biophys. Acta, 1995, 1264:229), or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277:923). Representative United States patents that teach the preparation of such dsRNA conjugates have been listed above. Typical conjugation protocols involve the synthesis of dsRNAs bearing an aminolinker at one or more positions of the sequence. The amino group is then reacted with the molecule being conjugated using appropriate coupling or activating reagents. The conjugation reaction may be performed either with the dsRNA still bound to the solid support or following cleavage of the dsRNA in solution phase. Purification of the dsRNA conjugate by HPLC typically affords the pure conjugate.

[0075]Vector Encoded RNAi Agents

[0076]The dsRNA of the invention can also be expressed from recombinant viral vectors intracellularly in vivo. The recombinant viral vectors of the invention comprise sequences encoding the dsRNA of the invention and any suitable promoter for expressing the dsRNA sequences. Suitable promoters include, for example, the U6 or H1 RNA pol III promoter sequences and the cytomegalovirus promoter. Selection of other suitable promoters is within the skill in the art. The recombinant viral vectors of the invention can also comprise inducible or regulatable promoters for expression of the dsRNA in a particular tissue or in a particular intracellular environment. The use of recombinant viral vectors to deliver dsRNA of the invention to cells in vivo is discussed in more detail below.

[0077]dsRNA of the invention can be expressed from a recombinant viral vector either as two separate, complementary RNA molecules, or as a single RNA molecule with two complementary regions.

[0078]Any viral vector capable of accepting the coding sequences for the dsRNA molecule(s) to be expressed can be used, for example vectors derived from adenovirus (AV); adeno-associated virus (AAV); retroviruses (e.g, lentiviruses (LV), Rhabdoviruses, murine leukemia virus); herpes virus, and the like. The tropism of viral vectors can be modified by pseudotyping the vectors with envelope proteins or other surface antigens from other viruses, or by substituting different viral capsid proteins, as appropriate.

[0079]For example, lentiviral vectors of the invention can be pseudotyped with surface proteins from vesicular stomatitis virus (VSV), rabies, Ebola, Mokola, and the like. AAV vectors of the invention can be made to target different cells by engineering the vectors to express different capsid protein serotypes. For example, an AAV vector expressing a serotype 2 capsid on a serotype 2 genome is called AAV 2/2. This serotype 2 capsid gene in the AAV 2/2 vector can be replaced by a serotype 5 capsid gene to produce an AAV 2/5 vector. Techniques for constructing AAV vectors which express different capsid protein serotypes are within the skill in the art; see, e.g., Rabinowitz J E et al. (2002), J Virol 76:791-801, the entire disclosure of which is herein incorporated by reference.

[0080]Selection of recombinant viral vectors suitable for use in the invention, methods for inserting nucleic acid sequences for expressing the dsRNA into the vector, and methods of delivering the viral vector to the cells of interest are within the skill in the art. See, for example, Dornburg R (1995), Gene Therap. 2: 301-310; Eglitis M A (1988), Biotechniques 6: 608-614; Miller A D (1990), Hum Gene Therap. 1: 5-14; Anderson W F (1998), Nature 392: 25-30; and Rubinson D A et al., Nat. Genet. 33: 401-406, the entire disclosures of which are herein incorporated by reference.

[0081]Preferred viral vectors are those derived from AV and AAV. In a particularly preferred embodiment, the dsRNA of the invention is expressed as two separate, complementary single-stranded RNA molecules from a recombinant AAV vector comprising, for example, either the U6 or H1 RNA promoters, or the cytomegalovirus (CMV) promoter.

[0082]A suitable AV vector for expressing the dsRNA of the invention, a method for constructing the recombinant AV vector, and a method for delivering the vector into target cells, are described in Xia H et al. (2002), Nat. Biotech. 20: 1006-1010.

[0083]Suitable AAV vectors for expressing the dsRNA of the invention, methods for constructing the recombinant AV vector, and methods for delivering the vectors into target cells are described in Samulski Ret al. (1987), J. Virol. 61: 3096-3101; Fisher K Jet al. (1996), J. Virol, 70: 520-532; Samulski R et al. (1989), J. Virol. 63: 3822-3826; U.S. Pat. No. 5,252,479; U.S. Pat. No. 5,139,941; International Patent Application No. WO 94/13788; and International Patent Application No. WO 93/24641, the entire disclosures of which are herein incorporated by reference.

[0084]III. Pharmaceutical Compositions Comprising dsRNA

[0085]In one embodiment, the invention provides pharmaceutical compositions comprising a dsRNA, as described herein, and a pharmaceutically acceptable carrier. The pharmaceutical composition comprising the dsRNA is useful for treating a disease or disorder associated with the expression or activity of the Eg5 gene, such as pathological processes mediated by Eg5 expression. Such pharmaceutical compositions are formulated based on the mode of delivery. One example is compositions that are formulated for systemic administration via parenteral delivery.

[0086]In another embodiment, such compositions will further comprise a second dsRNA that inhibits VEGF expression. dsRNA directed to VEGF are described in the Examples and in co-pending U.S. Ser. Nos. 11/078,073 and 11/340,080.

[0087]The pharmaceutical compositions of the invention are administered in dosages sufficient to inhibit expression of the Eg5 gene (and VEGF expression when a second dsRNA is included). In general, a suitable dose of dsRNA will be in the range of 0.01 to 5.0 milligrams per kilogram body weight of the recipient per day, generally in the range of 1 microgram to 1 mg per kilogram body weight per day. The pharmaceutical composition may be administered once daily or the dsRNA may be administered as two, three, or more sub-doses at appropriate intervals throughout the day or even using continuous infusion or delivery through a controlled release formulation. In that case, the dsRNA contained in each sub-dose must be correspondingly smaller in order to achieve the total daily dosage. The dosage unit can also be compounded for delivery over several days, e.g., using a conventional sustained release formulation which provides sustained release of the dsRNA over a several day period. Sustained release formulations are well known in the art and are particularly useful for delivery of agents at a particular site, such as could be used with the agents of the present invention. In this embodiment, the dosage unit contains a corresponding multiple of the daily dose.

[0088]The skilled artisan will appreciate that certain factors may influence the dosage and timing required to effectively treat a subject, including but not limited to the severity of the disease or disorder, previous treatments, the general health and/or age of the subject, and other diseases present. Moreover, treatment of a subject with a therapeutically effective amount of a composition can include a single treatment or a series of treatments. Estimates of effective dosages and in vivo half-lives for the individual dsRNAs encompassed by the invention can be made using conventional methodologies or on the basis of in vivo testing using an appropriate animal model, as described elsewhere herein.

[0089]Advances in mouse genetics have generated a number of mouse models for the study of various human diseases, such as pathological processes mediated by Eg5 expression. Such models are used for in vivo testing of dsRNA, as well as for determining a therapeutically effective dose.

[0090]The present invention also includes pharmaceutical compositions and formulations which include the dsRNA compounds of the invention. The pharmaceutical compositions of the present invention may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration may be topical, pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal), oral or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., intrathecal or intraventricular, administration.

[0091]Pharmaceutical compositions and formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable. Coated condoms, gloves and the like may also be useful. Preferred topical formulations include those in which the dsRNAs of the invention are in admixture with a topical delivery agent such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents and surfactants. Preferred lipids and liposomes include neutral (e.g. dioleoylphosphatidyl DOPE ethanolamine, dimyristoylphosphatidyl choline DMPC, distearolyphosphatidyl choline) negative (e.g. dimyristoylphosphatidyl glycerol DMPG) and cationic (e.g. dioleoyltetramethylaminopropyl DOTAP and dioleoylphosphatidyl ethanolamine DOTMA). DsRNAs of the invention may be encapsulated within liposomes or may form complexes thereto, in particular to cationic liposomes. Alternatively, dsRNAs may be complexed to lipids, in particular to cationic lipids. Preferred fatty acids and esters include but are not limited arachidonic acid, oleic acid, eicosanoic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1-monocaprate, 1-dodecylazacycloheptan-2-one, an acylcarnitine, an acylcholine, or a C1-10 alkyl ester (e.g. isopropylmyristate IPM), monoglyceride, diglyceride or pharmaceutically acceptable salt thereof. Topical formulations are described in detail in U.S. patent application Ser. No. 09/315,298 filed on May 20, 1999 which is incorporated herein by reference in its entirety.

[0092]Compositions and formulations for oral administration include powders or granules, microparticulates, nanoparticulates, suspensions or solutions in water or non-aqueous media, capsules, gel capsules, sachets, tablets or minitablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders may be desirable. Preferred oral formulations are those in which dsRNAs of the invention are administered in conjunction with one or more penetration enhancers surfactants and chelators. Preferred surfactants include fatty acids and/or esters or salts thereof, bile acids and/or salts thereof. Preferred bile acids/salts include chenodeoxycholic acid (CDCA) and ursodeoxychenodeoxycholic acid (UDCA), cholic acid, dehydrocholic acid, deoxycholic acid, glucholic acid, glycholic acid, glycodeoxycholic acid, taurocholic acid, taurodeoxycholic acid, sodium tauro-24,25-dihydro-fusidate and sodium glycodihydrofusidate. Preferred fatty acids include arachidonic acid, undecanoic acid, oleic acid, lauric acid, caprylic acid, capric acid, myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein, dilaurin, glyceryl 1-monocaprate, 1-dodecylazacycloheptan-2-one, an acylcarnitine, an acylcholine, or a monoglyceride, a diglyceride or a pharmaceutically acceptable salt thereof (e.g. sodium). Also preferred are combinations of penetration enhancers, for example, fatty acids/salts in combination with bile acids/salts. A particularly preferred combination is the sodium salt of lauric acid, capric acid and UDCA. Further penetration enhancers include polyoxyethylene-9-lauryl ether, polyoxyethylene-20-cetyl ether. DsRNAs of the invention may be delivered orally, in granular form including sprayed dried particles, or complexed to form micro or nanoparticles. DsRNA complexing agents include poly-amino acids; polyimines; polyacrylates; polyalkylacrylates, polyoxethanes, polyalkylcyanoacrylates; cationized gelatins, albumins, starches, acrylates, polyethyleneglycols (PEG) and starches; polyalkylcyanoacrylates; DEAE-derivatized polyimines, pollulans, celluloses and starches. Particularly preferred complexing agents include chitosan, N-trimethylchitosan, poly-L-lysine, polyhistidine, polyornithine, polyspermines, protamine, polyvinylpyridine, polythiodiethylaminomethylethylene P(TDAE), polyaminostyrene (e.g. p-amino), poly(methylcyanoacrylate), poly(ethylcyanoacrylate), poly(butylcyanoacrylate), poly(isobutylcyanoacrylate), poly(isohexylcynaoacrylate), DEAE-methacrylate, DEAE-hexylacrylate, DEAE-acrylamide, DEAE-albumin and DEAE-dextran, polymethylacrylate, polyhexylacrylate, poly(D,L-lactic acid), poly(DL-lactic-co-glycolic acid (PLGA), alginate, and polyethyleneglycol (PEG). Oral formulations for dsRNAs and their preparation are described in detail in U.S. application. Ser. No. 08/886,829 (filed Jul. 1, 1997), Ser. No. 09/108,673 (filed Jul. 1, 1998), Ser. No. 09/256,515 (filed Feb. 23, 1999), Ser. No. 09/082,624 (filed May 21, 1998) and Ser. No. 09/315,298 (filed May 20, 1999), each of which is incorporated herein by reference in their entirety.

[0093]Compositions and formulations for parenteral, intrathecal, intraventricular or intrahepatic administration may include sterile aqueous solutions which may also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.

[0094]Pharmaceutical compositions of the present invention include, but are not limited to, solutions, emulsions, and liposome-containing formulations. These compositions may be generated from a variety of components that include, but are not limited to, preformed liquids, self-emulsifying solids and self-emulsifying semisolids. Particularly preferred are formulations that target the liver when treating hepatic disorders such as hepatic carcinoma.

[0095]The pharmaceutical formulations of the present invention, which may conveniently be presented in unit dosage form, may be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general, the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.

[0096]The compositions of the present invention may be formulated into any of many possible dosage forms such as, but not limited to, tablets, capsules, gel capsules, liquid syrups, soft gels, suppositories, and enemas. The compositions of the present invention may also be formulated as suspensions in aqueous, non-aqueous or mixed media. Aqueous suspensions may further contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran. The suspension may also contain stabilizers.

[0097]Emulsions

[0098]The compositions of the present invention may be prepared and formulated as emulsions. Emulsions are typically heterogenous systems of one liquid dispersed in another in the form of droplets usually exceeding 0.1 μm in diameter (Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199; Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., Volume 1, p. 245; Block in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 2, p. 335; Higuchi et al., in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 1985, p. 301). Emulsions are often biphasic systems comprising two immiscible liquid phases intimately mixed and dispersed with each other. In general, emulsions may be of either the water-in-oil (w/o) or the oil-in-water (o/w) variety. When an aqueous phase is finely divided into and dispersed as minute droplets into a bulk oily phase, the resulting composition is called a water-in-oil (w/o) emulsion. Alternatively, when an oily phase is finely divided into and dispersed as minute droplets into a bulk aqueous phase, the resulting composition is called an oil-in-water (o/w) emulsion. Emulsions may contain additional components in addition to the dispersed phases, and the active drug which may be present as a solution in either the aqueous phase, oily phase or itself as a separate phase. Pharmaceutical excipients such as emulsifiers, stabilizers, dyes, and anti-oxidants may also be present in emulsions as needed. Pharmaceutical emulsions may also be multiple emulsions that are comprised of more than two phases such as, for example, in the case of oil-in-water-in-oil (o/w/o) and water-in-oil-in-water (w/o/w) emulsions. Such complex formulations often provide certain advantages that simple binary emulsions do not. Multiple emulsions in which individual oil droplets of an o/w emulsion enclose small water droplets constitute a w/o/w emulsion. Likewise a system of oil droplets enclosed in globules of water stabilized in an oily continuous phase provides an o/w/o emulsion.

[0099]Emulsions are characterized by little or no thermodynamic stability. Often, the dispersed or discontinuous phase of the emulsion is well dispersed into the external or continuous phase and maintained in this form through the means of emulsifiers or the viscosity of the formulation. Either of the phases of the emulsion may be a semisolid or a solid, as is the case of emulsion-style ointment bases and creams. Other means of stabilizing emulsions entail the use of emulsifiers that may be incorporated into either phase of the emulsion. Emulsifiers may broadly be classified into four categories: synthetic surfactants, naturally occurring emulsifiers, absorption bases, and finely dispersed solids (Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199).

[0100]Synthetic surfactants, also known as surface active agents, have found wide applicability in the formulation of emulsions and have been reviewed in the literature (Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 285; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), Marcel Dekker, Inc., New York, N.Y., 1988, volume 1, p. 199). Surfactants are typically amphiphilic and comprise a hydrophilic and a hydrophobic portion. The ratio of the hydrophilic to the hydrophobic nature of the surfactant has been termed the hydrophile/lipophile balance (HLB) and is a valuable tool in categorizing and selecting surfactants in the preparation of formulations. Surfactants may be classified into different classes based on the nature of the hydrophilic group: nonionic, anionic, cationic and amphoteric (Rieger, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 285).

[0101]Naturally occurring emulsifiers used in emulsion formulations include lanolin, beeswax, phosphatides, lecithin and acacia. Absorption bases possess hydrophilic properties such that they can soak up water to form w/o emulsions yet retain their semisolid consistencies, such as anhydrous lanolin and hydrophilic petrolatum. Finely divided solids have also been used as good emulsifiers especially in combination with surfactants and in viscous preparations. These include polar inorganic solids, such as heavy metal hydroxides, nonswelling clays such as bentonite, attapulgite, hectorite, kaolin, montmorillonite, colloidal aluminum silicate and colloidal magnesium aluminum silicate, pigments and nonpolar solids such as carbon or glyceryl tristearate.

[0102]A large variety of non-emulsifying materials are also included in emulsion formulations and contribute to the properties of emulsions. These include fats, oils, waxes, fatty acids, fatty alcohols, fatty esters, humectants, hydrophilic colloids, preservatives and antioxidants (Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 335; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199).

[0103]Hydrophilic colloids or hydrocolloids include naturally occurring gums and synthetic polymers such as polysaccharides (for example, acacia, agar, alginic acid, carrageenan, guar gum, karaya gum, and tragacanth), cellulose derivatives (for example, carboxymethylcellulose and carboxypropylcellulose), and synthetic polymers (for example, carbomers, cellulose ethers, and carboxyvinyl polymers). These disperse or swell in water to form colloidal solutions that stabilize emulsions by forming strong interfacial films around the dispersed-phase droplets and by increasing the viscosity of the external phase.

[0104]Since emulsions often contain a number of ingredients such as carbohydrates, proteins, sterols and phosphatides that may readily support the growth of microbes, these formulations often incorporate preservatives. Commonly used preservatives included in emulsion formulations include methyl paraben, propyl paraben, quaternary ammonium salts, benzalkonium chloride, esters of p-hydroxybenzoic acid, and boric acid. Antioxidants are also commonly added to emulsion formulations to prevent deterioration of the formulation. Antioxidants used may be free radical scavengers such as tocopherols, alkyl gallates, butylated hydroxyanisole, butylated hydroxytoluene, or reducing agents such as ascorbic acid and sodium metabisulfite, and antioxidant synergists such as citric acid, tartaric acid, and lecithin.

[0105]The application of emulsion formulations via dermatological, oral and parenteral routes and methods for their manufacture have been reviewed in the literature (Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199). Emulsion formulations for oral delivery have been very widely used because of ease of formulation, as well as efficacy from an absorption and bioavailability standpoint (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245; Idson, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 199). Mineral-oil base laxatives, oil-soluble vitamins and high fat nutritive preparations are among the materials that have commonly been administered orally as o/w emulsions.

[0106]In one embodiment of the present invention, the compositions of dsRNAs and nucleic acids are formulated as microemulsions. A microemulsion may be defined as a system of water, oil and amphiphile which is a single optically isotropic and thermodynamically stable liquid solution (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245). Typically microemulsions are systems that are prepared by first dispersing an oil in an aqueous surfactant solution and then adding a sufficient amount of a fourth component, generally an intermediate chain-length alcohol to form a transparent system. Therefore, microemulsions have also been described as thermodynamically stable, isotropically clear dispersions of two immiscible liquids that are stabilized by interfacial films of surface-active molecules (Leung and Shah, in: Controlled Release of Drugs: Polymers and Aggregate Systems, Rosoff, M., Ed., 1989, VCH Publishers, New York, pages 185-215). Microemulsions commonly are prepared via a combination of three to five components that include oil, water, surfactant, cosurfactant and electrolyte. Whether the microemulsion is of the water-in-oil (w/o) or an oil-in-water (o/w) type is dependent on the properties of the oil and surfactant used and on the structure and geometric packing of the polar heads and hydrocarbon tails of the surfactant molecules (Schott, in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., 1985, p. 271).

[0107]The phenomenological approach utilizing phase diagrams has been extensively studied and has yielded a comprehensive knowledge, to one skilled in the art, of how to formulate microemulsions (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245; Block, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 335). Compared to conventional emulsions, microemulsions offer the advantage of solubilizing water-insoluble drugs in a formulation of thermodynamically stable droplets that are formed spontaneously.

[0108]Surfactants used in the preparation of microemulsions include, but are not limited to, ionic surfactants, non-ionic surfactants, Brij 96, polyoxyethylene oleyl ethers, polyglycerol fatty acid esters, tetraglycerol monolaurate (ML310), tetraglycerol monooleate (MO310), hexaglycerol monooleate (PO310), hexaglycerol pentaoleate (PO500), decaglycerol monocaprate (MCA750), decaglycerol monooleate (MO750), decaglycerol sequioleate (SO750), decaglycerol decaoleate (DAO750), alone or in combination with cosurfactants. The cosurfactant, usually a short-chain alcohol such as ethanol, 1-propanol, and 1-butanol, serves to increase the interfacial fluidity by penetrating into the surfactant film and consequently creating a disordered film because of the void space generated among surfactant molecules. Microemulsions may, however, be prepared without the use of cosurfactants and alcohol-free self-emulsifying microemulsion systems are known in the art. The aqueous phase may typically be, but is not limited to, water, an aqueous solution of the drug, glycerol, PEG300, PEG400, polyglycerols, propylene glycols, and derivatives of ethylene glycol. The oil phase may include, but is not limited to, materials such as Captex 300, Captex 355, Capmul MCM, fatty acid esters, medium chain (C8-C12) mono, di, and tri-glycerides, polyoxyethylated glyceryl fatty acid esters, fatty alcohols, polyglycolized glycerides, saturated polyglycolized C8-C 10 glycerides, vegetable oils and silicone oil.

[0109]Microemulsions are particularly of interest from the standpoint of drug solubilization and the enhanced absorption of drugs. Lipid based microemulsions (both o/w and w/o) have been proposed to enhance the oral bioavailability of drugs, including peptides (Constantinides et al., Pharmaceutical Research, 1994, 11, 1385-1390; Ritschel, Meth. Find. Exp. Clin. Pharmacol., 1993, 13, 205). Microemulsions afford advantages of improved drug solubilization, protection of drug from enzymatic hydrolysis, possible enhancement of drug absorption due to surfactant-induced alterations in membrane fluidity and permeability, ease of preparation, ease of oral administration over solid dosage forms, improved clinical potency, and decreased toxicity (Constantinides et al., Pharmaceutical Research, 1994, 11, 1385; Ho et al., J. Pharm. Sci., 1996, 85, 138-143). Often microemulsions may form spontaneously when their components are brought together at ambient temperature. This may be particularly advantageous when formulating thermolabile drugs, peptides or dsRNAs. Microemulsions have also been effective in the transdermal delivery of active components in both cosmetic and pharmaceutical applications. It is expected that the microemulsion compositions and formulations of the present invention will facilitate the increased systemic absorption of dsRNAs and nucleic acids from the gastrointestinal tract, as well as improve the local cellular uptake of dsRNAs and nucleic acids.

[0110]Microemulsions of the present invention may also contain additional components and additives such as sorbitan monostearate (Grill 3), Labrasol, and penetration enhancers to improve the properties of the formulation and to enhance the absorption of the dsRNAs and nucleic acids of the present invention. Penetration enhancers used in the microemulsions of the present invention may be classified as belonging to one of five broad categories--surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p. 92). Each of these classes has been discussed above.

[0111]Liposomes

[0112]There are many organized surfactant structures besides microemulsions that have been studied and used for the formulation of drugs. These include monolayers, micelles, bilayers and vesicles. Vesicles, such as liposomes, have attracted great interest because of their specificity and the duration of action they offer from the standpoint of drug delivery. As used in the present invention, the term "liposome" means a vesicle composed of amphiphilic lipids arranged in a spherical bilayer or bilayers.

[0113]Liposomes are unilamellar or multilamellar vesicles which have a membrane formed from a lipophilic material and an aqueous interior. The aqueous portion contains the composition to be delivered. Cationic liposomes possess the advantage of being able to fuse to the cell wall. Non-cationic liposomes, although not able to fuse as efficiently with the cell wall, are taken up by macrophages in vivo.

[0114]In order to cross intact mammalian skin, lipid vesicles must pass through a series of fine pores, each with a diameter less than 50 nm, under the influence of a suitable transdermal gradient. Therefore, it is desirable to use a liposome which is highly deformable and able to pass through such fine pores.

[0115]Further advantages of liposomes include; liposomes obtained from natural phospholipids are biocompatible and biodegradable; liposomes can incorporate a wide range of water and lipid soluble drugs; liposomes can protect encapsulated drugs in their internal compartments from metabolism and degradation (Rosoff, in Pharmaceutical Dosage Forms, Lieberman, Rieger and Banker (Eds.), 1988, Marcel Dekker, Inc., New York, N.Y., volume 1, p. 245). Important considerations in the preparation of liposome formulations are the lipid surface charge, vesicle size and the aqueous volume of the liposomes.

[0116]Liposomes are useful for the transfer and delivery of active ingredients to the site of action. Because the liposomal membrane is structurally similar to biological membranes, when liposomes are applied to a tissue, the liposomes start to merge with the cellular membranes and as the merging of the liposome and cell progresses, the liposomal contents are emptied into the cell where the active agent may act.

[0117]Liposomal formulations have been the focus of extensive investigation as the mode of delivery for many drugs. There is growing evidence that for topical administration, liposomes present several advantages over other formulations. Such advantages include reduced side-effects related to high systemic absorption of the administered drug, increased accumulation of the administered drug at the desired target, and the ability to administer a wide variety of drugs, both hydrophilic and hydrophobic, into the skin.

[0118]Several reports have detailed the ability of liposomes to deliver agents including high-molecular weight DNA into the skin. Compounds including analgesics, antibodies, hormones and high-molecular weight DNAs have been administered to the skin. The majority of applications resulted in the targeting of the upper epidermis

[0119]Liposomes fall into two broad classes. Cationic liposomes are positively charged liposomes which interact with the negatively charged DNA molecules to form a stable complex. The positively charged DNA/liposome complex binds to the negatively charged cell surface and is internalized in an endosome. Due to the acidic pH within the endosome, the liposomes are ruptured, releasing their contents into the cell cytoplasm (Wang et al., Biochem. Biophys. Res. Commun., 1987, 147, 980-985).

[0120]Liposomes which are pH-sensitive or negatively-charged, entrap DNA rather than complex with it. Since both the DNA and the lipid are similarly charged, repulsion rather than complex formation occurs. Nevertheless, some DNA is entrapped within the aqueous interior of these liposomes. pH-sensitive liposomes have been used to deliver DNA encoding the thymidine kinase gene to cell monolayers in culture. Expression of the exogenous gene was detected in the target cells (Zhou et al., Journal of Controlled Release, 1992, 19, 269-274).

[0121]One major type of liposomal composition includes phospholipids other than naturally-derived phosphatidylcholine. Neutral liposome compositions, for example, can be formed from dimyristoyl phosphatidylcholine (DMPC) or dipalmitoyl phosphatidylcholine (DPPC). Anionic liposome compositions generally are formed from dimyristoyl phosphatidylglycerol, while anionic fusogenic liposomes are formed primarily from dioleoyl phosphatidylethanolamine (DOPE). Another type of liposomal composition is formed from phosphatidylcholine (PC) such as, for example, soybean PC, and egg PC. Another type is formed from mixtures of phospholipid and/or phosphatidylcholine and/or cholesterol.

[0122]Several studies have assessed the topical delivery of liposomal drug formulations to the skin. Application of liposomes containing interferon to guinea pig skin resulted in a reduction of skin herpes sores while delivery of interferon via other means (e.g. as a solution or as an emulsion) were ineffective (Weiner et al., Journal of Drug Targeting, 1992, 2, 405-410). Further, an additional study tested the efficacy of interferon administered as part of a liposomal formulation to the administration of interferon using an aqueous system, and concluded that the liposomal formulation was superior to aqueous administration (du Plessis et al., Antiviral Research, 1992, 18, 259-265).

[0123]Non-ionic liposomal systems have also been examined to determine their utility in the delivery of drugs to the skin, in particular systems comprising non-ionic surfactant and cholesterol. Non-ionic liposomal formulations comprising NovasomeTM. I (glyceryl dilaurate/cholesterol/po-lyoxyethylene-10-stearyl ether) and Novasome® II (glyceryl distearate/cholesterol/polyoxyethylene-10-stearyl ether) were used to deliver cyclosporin-A into the dermis of mouse skin. Results indicated that such non-ionic liposomal systems were effective in facilitating the deposition of cyclosporin-A into different layers of the skin (Hu et al. S.T.P.Pharma. Sci., 1994, 4, 6, 466).

[0124]Liposomes also include "sterically stabilized" liposomes, a term which, as used herein, refers to liposomes comprising one or more specialized lipids that, when incorporated into liposomes, result in enhanced circulation lifetimes relative to liposomes lacking such specialized lipids. Examples of sterically stabilized liposomes are those in which part of the vesicle-forming lipid portion of the liposome (A) comprises one or more glycolipids, such as monosialoganglioside GM1, or (B) is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety. While not wishing to be bound by any particular theory, it is thought in the art that, at least for sterically stabilized liposomes containing gangliosides, sphingomyelin, or PEG-derivatized lipids, the enhanced circulation half-life of these sterically stabilized liposomes derives from a reduced uptake into cells of the reticuloendothelial system (RES) (Allen et al., FEBS Letters, 1987, 223, 42; Wu et al., Cancer Research, 1993, 53, 3765).

[0125]Various liposomes comprising one or more glycolipids are known in the art. Papahadjopoulos et al. (Ann. N.Y. Acad. Sci., 1987, 507, 64) reported the ability of monosialoganglioside GM1, galactocerebroside sulfate and phosphatidylinositol to improve blood half-lives of liposomes. These findings were expounded upon by Gabizon et al. (Proc. Natl. Acad. Sci. U.S.A., 1988, 85, 6949). U.S. Pat. No. 4,837,028 and WO 88/04924, both to Allen et al., disclose liposomes comprising (1) sphingomyelin and (2) the ganglioside GM1 or a galactocerebroside sulfate ester. U.S. Pat. No. 5,543,152 (Webb et al.) discloses liposomes comprising sphingomyelin. Liposomes comprising 1,2-sn-dimyristoylphosphat-idylcholine are disclosed in WO 97/13499 (Lim et al).

[0126]Many liposomes comprising lipids derivatized with one or more hydrophilic polymers, and methods of preparation thereof, are known in the art. Sunamoto et al. (Bull. Chem. Soc. Jpn., 1980, 53, 2778) described liposomes comprising a nonionic detergent, 2C1215G, that contains a PEG moiety. Illum et al. (FEBS Lett., 1984, 167, 79) noted that hydrophilic coating of polystyrene particles with polymeric glycols results in significantly enhanced blood half-lives. Synthetic phospholipids modified by the attachment of carboxylic groups of polyalkylene glycols (e.g., PEG) are described by Sears (U.S. Pat. Nos. 4,426,330 and 4,534,899). Klibanov et al. (FEBS Lett., 1990, 268, 235) described experiments demonstrating that liposomes comprising phosphatidylethanolamine (PE) derivatized with PEG or PEG stearate have significant increases in blood circulation half-lives. Blume et al. (Biochimica et Biophysica Acta, 1990, 1029, 91) extended such observations to other PEG-derivatized phospholipids, e.g., DSPE-PEG, formed from the combination of distearoylphosphatidylethanolamine (DSPE) and PEG. Liposomes having covalently bound PEG moieties on their external surface are described in European Patent No. EP 0 445 131 B1 and WO 90/04384 to Fisher. Liposome compositions containing 1-20 mole percent of PE derivatized with PEG, and methods of use thereof, are described by Woodle et al. (U.S. Pat. Nos. 5,013,556 and 5,356,633) and Martin et al. (U.S. Pat. No. 5,213,804 and European Patent No. EP 0 496 813 B1). Liposomes comprising a number of other lipid-polymer conjugates are disclosed in WO 91/05545 and U.S. Pat. No. 5,225,212 (both to Martin et al.) and in WO 94/20073 (Zalipsky et al.) Liposomes comprising PEG-modified ceramide lipids are described in WO 96/10391 (Choi et al). U.S. Pat. No. 5,540,935 (Miyazaki et al.) and U.S. Pat. No. 5,556,948 (Tagawa et al.) describe PEG-containing liposomes that can be further derivatized with functional moieties on their surfaces.

[0127]A limited number of liposomes comprising nucleic acids are known in the art. WO 96/40062 to Thierry et al. discloses methods for encapsulating high molecular weight nucleic acids in liposomes. U.S. Pat. No. 5,264,221 to Tagawa et al. discloses protein-bonded liposomes and asserts that the contents of such liposomes may include an dsRNA RNA. U.S. Pat. No. 5,665,710 to Rahman et al. describes certain methods of encapsulating oligodeoxynucleotides in liposomes. WO 97/04787 to Love et al. discloses liposomes comprising dsRNA dsRNAs targeted to the raf gene.

[0128]Transfersomes are yet another type of liposomes, and are highly deformable lipid aggregates which are attractive candidates for drug delivery vehicles. Transfersomes may be described as lipid droplets which are so highly deformable that they are easily able to penetrate through pores which are smaller than the droplet. Transfersomes are adaptable to the environment in which they are used, e.g. they are self-optimizing (adaptive to the shape of pores in the skin), self-repairing, frequently reach their targets without fragmenting, and often self-loading. To make transfersomes it is possible to add surface edge-activators, usually surfactants, to a standard liposomal composition. Transfersomes have been used to deliver serum albumin to the skin. The transfersome-mediated delivery of serum albumin has been shown to be as effective as subcutaneous injection of a solution containing serum albumin.

[0129]Surfactants find wide application in formulations such as emulsions (including microemulsions) and liposomes. The most common way of classifying and ranking the properties of the many different types of surfactants, both natural and synthetic, is by the use of the hydrophile/lipophile balance (HLB). The nature of the hydrophilic group (also known as the "head") provides the most useful means for categorizing the different surfactants used in formulations (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, N.Y., 1988, p. 285).

[0130]If the surfactant molecule is not ionized, it is classified as a nonionic surfactant. Nonionic surfactants find wide application in pharmaceutical and cosmetic products and are usable over a wide range of pH values. In general their HLB values range from 2 to about 18 depending on their structure. Nonionic surfactants include nonionic esters such as ethylene glycol esters, propylene glycol esters, glyceryl esters, polyglyceryl esters, sorbitan esters, sucrose esters, and ethoxylated esters. Nonionic alkanolamides and ethers such as fatty alcohol ethoxylates, propoxylated alcohols, and ethoxylated/propoxylated block polymers are also included in this class. The polyoxyethylene surfactants are the most popular members of the nonionic surfactant class.

[0131]If the surfactant molecule carries a negative charge when it is dissolved or dispersed in water, the surfactant is classified as anionic. Anionic surfactants include carboxylates such as soaps, acyl lactylates, acyl amides of amino acids, esters of sulfuric acid such as alkyl sulfates and ethoxylated alkyl sulfates, sulfonates such as alkyl benzene sulfonates, acyl isethionates, acyl taurates and sulfosuccinates, and phosphates. The most important members of the anionic surfactant class are the alkyl sulfates and the soaps.

[0132]If the surfactant molecule carries a positive charge when it is dissolved or dispersed in water, the surfactant is classified as cationic. Cationic surfactants include quaternary ammonium salts and ethoxylated amines. The quaternary ammonium salts are the most used members of this class.

[0133]If the surfactant molecule has the ability to carry either a positive or negative charge, the surfactant is classified as amphoteric. Amphoteric surfactants include acrylic acid derivatives, substituted alkylamides, N-alkylbetaines and phosphatides.

[0134]The use of surfactants in drug products, formulations and in emulsions has been reviewed (Rieger, in Pharmaceutical Dosage Forms, Marcel Dekker, Inc., New York, N.Y., 1988, p. 285).

[0135]Penetration Enhancers

[0136]In one embodiment, the present invention employs various penetration enhancers to effect the efficient delivery of nucleic acids, particularly dsRNAs, to the skin of animals. Most drugs are present in solution in both ionized and nonionized forms. However, usually only lipid soluble or lipophilic drugs readily cross cell membranes. It has been discovered that even non-lipophilic drugs may cross cell membranes if the membrane to be crossed is treated with a penetration enhancer. In addition to aiding the diffusion of non-lipophilic drugs across cell membranes, penetration enhancers also enhance the permeability of lipophilic drugs.

[0137]Penetration enhancers may be classified as belonging to one of five broad categories, i.e., surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92). Each of the above mentioned classes of penetration enhancers are described below in greater detail.

[0138]Surfactants: In connection with the present invention, surfactants (or "surface-active agents") are chemical entities which, when dissolved in an aqueous solution, reduce the surface tension of the solution or the interfacial tension between the aqueous solution and another liquid, with the result that absorption of dsRNAs through the mucosa is enhanced. In addition to bile salts and fatty acids, these penetration enhancers include, for example, sodium lauryl sulfate, polyoxyethylene-9-lauryl ether and polyoxyethylene-20-cetyl ether) (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, p.92); and perfluorochemical emulsions, such as FC-43. Takahashi et al., J. Pharm. Pharmacol., 1988, 40, 252).

[0139]Fatty acids: Various fatty acids and their derivatives which act as penetration enhancers include, for example, oleic acid, lauric acid, capric acid (n-decanoic acid), myristic acid, palmitic acid, stearic acid, linoleic acid, linolenic acid, dicaprate, tricaprate, monoolein (1-monooleoyl-rac-glycerol), dilaurin, caprylic acid, arachidonic acid, glycerol 1-monocaprate, 1-dodecylazacycloheptan-2-one, acylcarnitines, acylcholines, C1-10 alkyl esters thereof (e.g., methyl, isopropyl and t-butyl), and mono- and di-glycerides thereof (i.e., oleate, laurate, caprate, myristate, palmitate, stearate, linoleate, etc.) (Lee et al., Critical Reviews in Therapeutic Drug Carryier Systems, 1991, p. 92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; El Hariri et al., J. Pharm. Pharmacol., 1992, 44, 651-654).

[0140]Bile salts: The physiological role of bile includes the facilitation of dispersion and absorption of lipids and fat-soluble vitamins (Brunton, Chapter 38 in: Goodman & Gilman's The Pharmacological Basis of Therapeutics, 9th Ed., Hardman et al. Eds., McGraw-Hill, New York, 1996, pp. 934-935). Various natural bile salts, and their synthetic derivatives, act as penetration enhancers. Thus the term "bile salts" includes any of the naturally occurring components of bile as well as any of their synthetic derivatives. The bile salts of the invention include, for example, cholic acid (or its pharmaceutically acceptable sodium salt, sodium cholate), dehydrocholic acid (sodium dehydrocholate), deoxycholic acid (sodium deoxycholate), glucholic acid (sodium glucholate), glycholic acid (sodium glycocholate), glycodeoxycholic acid (sodium glycodeoxycholate), taurocholic acid (sodium taurocholate), taurodeoxycholic acid (sodium taurodeoxycholate), chenodeoxycholic acid (sodium chenodeoxycholate), ursodeoxycholic acid (UDCA), sodium tauro-24,25-dihydro-fusidate (STDHF), sodium glycodihydrofusidate and polyoxyethylene-9-lauryl ether (POE) (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Swinyard, Chapter 39 In: Remington's Pharmaceutical Sciences, 18th Ed., Gennaro, ed., Mack Publishing Co., Easton, Pa., 1990, pages 782-783; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; Yamamoto et al., J. Pharm. Exp. Ther., 1992, 263, 25; Yamashita et al., J. Pharm. Sci., 1990, 79, 579-583).

[0141]Chelating Agents: Chelating agents, as used in connection with the present invention, can be defined as compounds that remove metallic ions from solution by forming complexes therewith, with the result that absorption of dsRNAs through the mucosa is enhanced. With regards to their use as penetration enhancers in the present invention, chelating agents have the added advantage of also serving as DNase inhibitors, as most characterized DNA nucleases require a divalent metal ion for catalysis and are thus inhibited by chelating agents (Jarrett, J. Chromatogr., 1993, 618, 315-339). Chelating agents of the invention include but are not limited to disodium ethylenediaminetetraacetate (EDTA), citric acid, salicylates (e.g., sodium salicylate, 5-methoxysalicylate and homovanilate), N-acyl derivatives of collagen, laureth-9 and N-amino acyl derivatives of beta-diketones (enamines)(Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92; Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33; Buur et al., J. Control Rel., 1990, 14, 43-51).

[0142]Non-chelating non-surfactants: As used herein, non-chelating non-surfactant penetration enhancing compounds can be defined as compounds that demonstrate insignificant activity as chelating agents or as surfactants but that nonetheless enhance absorption of dsRNAs through the alimentary mucosa (Muranishi, Critical Reviews in Therapeutic Drug Carrier Systems, 1990, 7, 1-33). This class of penetration enhancers include, for example, unsaturated cyclic ureas, 1-alkyl- and 1-alkenylazacyclo-alkanone derivatives (Lee et al., Critical Reviews in Therapeutic Drug Carrier Systems, 1991, page 92); and non-steroidal anti-inflammatory agents such as diclofenac sodium, indomethacin and phenylbutazone (Yamashita et al., J. Pharm. Pharmacol., 1987, 39, 621-626).

[0143]Agents that enhance uptake of dsRNAs at the cellular level may also be added to the pharmaceutical and other compositions of the present invention. For example, cationic lipids, such as lipofectin (Junichi et al, U.S. Pat. No. 5,705,188), cationic glycerol derivatives, and polycationic molecules, such as polylysine (Lollo et al., PCT Application WO 97/30731), are also known to enhance the cellular uptake of dsRNAs.

[0144]Other agents may be utilized to enhance the penetration of the administered nucleic acids, including glycols such as ethylene glycol and propylene glycol, pyrrols such as 2-pyrrol, azones, and terpenes such as limonene and menthone.

[0145]Carriers

[0146]Certain compositions of the present invention also incorporate carrier compounds in the formulation. As used herein, "carrier compound" or "carrier" can refer to a nucleic acid, or analog thereof, which is inert (i.e., does not possess biological activity per se) but is recognized as a nucleic acid by in vivo processes that reduce the bioavailability of a nucleic acid having biological activity by, for example, degrading the biologically active nucleic acid or promoting its removal from circulation. The coadministration of a nucleic acid and a carrier compound, typically with an excess of the latter substance, can result in a substantial reduction of the amount of nucleic acid recovered in the liver, kidney or other extracirculatory reservoirs, presumably due to competition between the carrier compound and the nucleic acid for a common receptor. For example, the recovery of a partially phosphorothioate dsRNA in hepatic tissue can be reduced when it is coadministered with polyinosinic acid, dextran sulfate, polycytidic acid or 4-acetamido-4'isothiocyano-stilbene-2,2'-disulfonic acid (Miyao et al., DsRNA Res. Dev., 1995, 5, 115-121; Takakura et al., DsRNA & Nucl. Acid Drug Dev., 1996, 6, 177-183.

[0147]Excipients

[0148]In contrast to a carrier compound, a "pharmaceutical carrier" or "excipient" is a pharmaceutically acceptable solvent, suspending agent or any other pharmacologically inert vehicle for delivering one or more nucleic acids to an animal. The excipient may be liquid or solid and is selected, with the planned manner of administration in mind, so as to provide for the desired bulk, consistency, etc., when combined with a nucleic acid and the other components of a given pharmaceutical composition. Typical pharmaceutical carriers include, but are not limited to, binding agents (e.g., pregelatinized maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose, etc.); fillers (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates or calcium hydrogen phosphate, etc.); lubricants (e.g., magnesium stearate, talc, silica, colloidal silicon dioxide, stearic acid, metallic stearates, hydrogenated vegetable oils, corn starch, polyethylene glycols, sodium benzoate, sodium acetate, etc.); disintegrants (e.g., starch, sodium starch glycolate, etc.); and wetting agents (e.g., sodium lauryl sulphate, etc).

[0149]Pharmaceutically acceptable organic or inorganic excipient suitable for non-parenteral administration which do not deleteriously react with nucleic acids can also be used to formulate the compositions of the present invention. Suitable pharmaceutically acceptable carriers include, but are not limited to, water, salt solutions, alcohols, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like.

[0150]Formulations for topical administration of nucleic acids may include sterile and non-sterile aqueous solutions, non-aqueous solutions in common solvents such as alcohols, or solutions of the nucleic acids in liquid or solid oil bases. The solutions may also contain buffers, diluents and other suitable additives. Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral administration which do not deleteriously react with nucleic acids can be used.

[0151]Suitable pharmaceutically acceptable excipients include, but are not limited to, water, salt solutions, alcohol, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like.

[0152]Other Components

[0153]The compositions of the present invention may additionally contain other adjunct components conventionally found in pharmaceutical compositions, at their art-established usage levels. Thus, for example, the compositions may contain additional, compatible, pharmaceutically-active materials such as, for example, antipruritics, astringents, local anesthetics or anti-inflammatory agents, or may contain additional materials useful in physically formulating various dosage forms of the compositions of the present invention, such as dyes, flavoring agents, preservatives, antioxidants, opacifiers, thickening agents and stabilizers. However, such materials, when added, should not unduly interfere with the biological activities of the components of the compositions of the present invention. The formulations can be sterilized and, if desired, mixed with auxiliary agents, e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, colorings, flavorings and/or aromatic substances and the like which do not deleteriously interact with the nucleic acid(s) of the formulation.

[0154]Aqueous suspensions may contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran. The suspension may also contain stabilizers.

[0155]Certain embodiments of the invention provide pharmaceutical compositions containing (a) one or more antisense compounds and (b) one or more other chemotherapeutic agents which function by a non-antisense mechanism. Examples of such chemotherapeutic agents include but are not limited to daunorubicin, daunomycin, dactinomycin, doxorubicin, epirubicin, idarubicin, esorubicin, bleomycin, mafosfamide, ifosfamide, cytosine arabinoside, bis-chloroethylnitrosurea, busulfan, mitomycin C, actinomycin D, mithramycin, prednisone, hydroxyprogesterone, testosterone, tamoxifen, dacarbazine, procarbazine, hexamethylmelamine, pentamethylmelamine, mitoxantrone, amsacrine, chlorambucil, methylcyclohexylnitrosurea, nitrogen mustards, melphalan, cyclophosphamide, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-azacytidine, hydroxyurea, deoxycoformycin, 4-hydroxyperoxycyclophosphor-amide, 5-fluorouracil (5-FU), 5-fluorodeoxyuridine (5-FUdR), methotrexate (MTX), colchicine, taxol, vincristine, vinblastine, etoposide (VP-16), trimetrexate, irinotecan, topotecan, gemcitabine, teniposide, cisplatin and diethylstilbestrol (DES). See, generally, The Merck Manual of Diagnosis and Therapy, 15th Ed. 1987, pp. 1206-1228, Berkow et al., eds., Rahway, N.J. When used with the compounds of the invention, such chemotherapeutic agents may be used individually (e.g., 5-FU and oligonucleotide), sequentially (e.g., 5-FU and oligonucleotide for a period of time followed by MTX and oligonucleotide), or in combination with one or more other such chemotherapeutic agents (e.g., 5-FU, MTX and oligonucleotide, or 5-FU, radiotherapy and oligonucleotide). Anti-inflammatory drugs, including but not limited to nonsteroidal anti-inflammatory drugs and corticosteroids, and antiviral drugs, including but not limited to ribivirin, vidarabine, acyclovir and ganciclovir, may also be combined in compositions of the invention. See, generally, The Merck Manual of Diagnosis and Therapy, 15th Ed., Berkow et al., eds., 1987, Rahway, N.J., pages 2499-2506 and 46-49, respectively). Other non-antisense chemotherapeutic agents are also within the scope of this invention. Two or more combined compounds may be used together or sequentially.

[0156]Toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50/ED50. Compounds which exhibit high therapeutic indices are preferred.

[0157]The data obtained from cell culture assays and animal studies can be used in formulation a range of dosage for use in humans. The dosage of compositions of the invention lies generally within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage may vary within this range depending upon the dosage form employed and the route of administration utilized. For any compound used in the method of the invention, the therapeutically effective dose can be estimated initially from cell culture assays. A dose may be formulated in animal models to achieve a circulating plasma concentration range of the compound or, when appropriate, of the polypeptide product of a target sequence (e.g., achieving a decreased concentration of the polypeptide) that includes the IC50 (i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma may be measured, for example, by high performance liquid chromatography.

[0158]In addition to their administration individually or as a plurality, as discussed above, the dsRNAs of the invention can be administered in combination with other known agents effective in treatment of pathological processes mediated by Eg5 expression. In any event, the administering physician can adjust the amount and timing of dsRNA administration on the basis of results observed using standard measures of efficacy known in the art or described herein.

[0159]Methods for Treating Diseases Caused by Expression of the Eg5 Gene

[0160]The invention relates in particular to the use of a dsRNA or a pharmaceutical composition prepared therefrom for the treatment of cancer, e.g., for inhibiting tumor growth and tumor metastasis. For example, the dsRNA or a pharmaceutical composition prepared therefrom may be used for the treatment of solid tumors, like breast cancer, lung cancer, head and neck cancer, brain cancer, abdominal cancer, colon cancer, colorectal cancer, esophagus cancer, gastrointestinal cancer, glioma, liver cancer, tongue cancer, neuroblastoma, osteosarcoma, ovarian cancer, pancreatic cancer, prostate cancer, retinoblastoma, Wilm's tumor, multiple myeloma and for the treatment of skin cancer, like melanoma, for the treatment of lymphomas and blood cancer. The invention further relates to the use of an dsRNA according to the invention or a pharmaceutical composition prepared therefrom for inhibiting eg5 expression and/or for inhibiting accumulation of ascites fluid and pleural effusion in different types of cancer, e.g., breast cancer, lung cancer, head cancer, neck cancer, brain cancer, abdominal cancer, colon cancer, colorectal cancer, esophagus cancer, gastrointestinal cancer, glioma, liver cancer, tongue cancer, neuroblastoma, osteosarcoma, ovarian cancer, pancreatic cancer, prostate cancer, retinoblastoma, Wilm's tumor, multiple myeloma, skin cancer, melanoma, lymphomas and blood cancer. Owing to the inhibitory effect on eg5 expression, an dsRNA according to the invention or a pharmaceutical composition prepared therefrom can enhance the quality of life.

[0161]The invention furthermore relates to the use of an dsRNA or a pharmaceutical composition thereof, e.g., for treating cancer or for preventing tumor metastasis, in combination with other pharmaceuticals and/or other therapeutic methods, e.g., with known pharmaceuticals and/or known therapeutic methods, such as, for example, those which are currently employed for treating cancer and/or for preventing tumor metastasis. Preference is given to a combination with radiation therapy and chemotherapeutic agents, such as cisplatin, cyclophosphamide, 5-fluorouracil, adriamycin, daunorubicin or tamoxifen. Other embodiments include the use of a second dsRNA used to inhibit the expression of VEGF.

[0162]The invention can also be practiced by including with a specific RNAi agent, in combination with another anti-cancer chemotherapeutic agent, such as any conventional chemotherapeutic agent, or another dsRNA used to inhibit the expression of VEGF. The combination of a specific binding agent with such other agents can potentiate the chemotherapeutic protocol. Numerous chemotherapeutic protocols will present themselves in the mind of the skilled practitioner as being capable of incorporation into the method of the invention. Any chemotherapeutic agent can be used, including alkylating agents, antimetabolites, hormones and antagonists, radioisotopes, as well as natural products. For example, the compound of the invention can be administered with antibiotics such as doxorubicin and other anthracycline analogs, nitrogen mustards such as cyclophosphamide, pyrimidine analogs such as 5-fluorouracil, cisplatin, hydroxyurea, taxol and its natural and synthetic derivatives, and the like. As another example, in the case of mixed tumors, such as adenocarcinoma of the breast, where the tumors include gonadotropin-dependent and gonadotropin-independent cells, the compound can be administered in conjunction with leuprolide or goserelin (synthetic peptide analogs of LH-RH). Other antineoplastic protocols include the use of a tetracycline compound with another treatment modality, e.g., surgery, radiation, etc., also referred to herein as "adjunct antineoplastic modalities." Thus, the method of the invention can be employed with such conventional regimens with the benefit of reducing side effects and enhancing efficacy.

[0163]Methods for Inhibiting Expression of the Eg5 Gene

[0164]In yet another aspect, the invention provides a method for inhibiting the expression of the Eg5 gene in a mammal. The method comprises administering a composition of the invention to the mammal such that expression of the target Eg5 gene is silenced. Because of their high specificity, the dsRNAs of the invention specifically target RNAs (primary or processed) of the target Eg5 gene. Compositions and methods for inhibiting the expression of these Eg5 genes using dsRNAs can be performed as described elsewhere herein.

[0165]In one embodiment, the method comprises administering a composition comprising a dsRNA, wherein the dsRNA comprises a nucleotide sequence which is complementary to at least a part of an RNA transcript of the Eg5 gene of the mammal to be treated. When the organism to be treated is a mammal such as a human, the composition may be administered by any means known in the art including, but not limited to oral or parenteral routes, including intravenous, intramuscular, subcutaneous, transdermal, airway (aerosol), nasal, rectal, and topical (including buccal and sublingual) administration. In preferred embodiments, the compositions are administered by intravenous infusion or injection.

[0166]Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

Examples

Gene Walking of the Eg5 Gene

[0167]Initial Screening Set

[0168]siRNA design was carried out to identify siRNAs targeting Eg5 (also known as KIF11, HSKP, KNSL1 and TRIPS). Human mRNA sequences to Eg5, RefSeq ID number:NM--004523, was used.

[0169]siRNA duplexes cross-reactive to human and mouse Eg5 were designed. Twenty-four duplexes were synthesized for screening. (Table 1).

[0170]Expanded Screening Set

[0171]A second screening set was defined with 266 siRNAs targeting human EG5, as well as its rhesus monkey ortholog (Table 2). An expanded screening set was selected with 328 siRNA targeting human EG5, with no necessity to hit any EG5 mRNA of other species (Table 3).

[0172]The sequences for human and a partial rhesus EG5 mRNAs were downloaded from NCBI Nucleotide database and the human sequence was further on used as reference sequence (Human EG5:NM--004523.2, 4908 bp, and Rhesus EG5: XM--001087644.1, 878 by (only 5' part of human EG5)

[0173]For identification of further rhesus EG5 sequences a mega blast search with the human sequence was conducted at NCBI against rhesus reference genome. The downloaded rhesus sequence and the hit regions in the blast hit were assembled to a rhesus consensus sequence with ˜92% identity to human EG5 over the full-length.

[0174]All possible 19 mers were extracted from the human mRNA sequence, resulting in the pool of candidate target sites corresponding to 4890 (sense strand) sequences of human-reactive EG5 siRNAs.

[0175]Human-rhesus cross-reactivity as prerequisite for in silico selection of siRNAs for an initial screening set out of this candidate pool. To determine rhesus-reactive siRNAs, each candidate siRNA target site was searched for presence in the assembled rhesus sequence. Further, the predicted specificity of the siRNA as criterion for selection of out the pool of human-rhesus cross-reactive siRNAs, manifested by targeting human EG5 mRNA sequences, but not other human mRNAs.

[0176]The specificity of an siRNA can be expressed via its potential to target other genes, which are referred to as "off-target genes".

[0177]For predicting the off-target potential of an siRNA, the following assumptions were made: [0178]1) off-target potential of a strand can be deduced from the number and distribution of mismatches to an off-target [0179]2) the most relevant off-target, that is the gene predicted to have the highest probability to be silenced due to tolerance of mismatches, determines the off-target potential of the strand [0180]3) positions 2 to 9 (counting 5' to 3') of a strand (seed region) may contribute more to off-target potential than rest of sequence (that is non-seed and cleavage site region) [0181]4) positions 10 and 11 (counting 5' to 3') of a strand (cleavage site region) may contribute more to off-target potential than non-seed region (that is positions 12 to 18, counting 5' to 3') [0182]5) positions 1 and 19 of each strand are not relevant for off-target interactions [0183]6) off-target potential can be expressed by the off-target score of the most relevant off-target, calculated based on number and position of mismatches of the strand to the most homologous region in the off-target gene considering assumptions 3 to 5 [0184]7) off-target potential of antisense and sense strand will be relevant, whereas potential abortion of sense strand activity by internal modifications introduced is likely

[0185]SiRNAs with low off-target potential were defined as preferable and assumed to be more specific.

[0186]In order to identify human EG5-specific siRNAs, all other human transcripts, which were all considered potential off-targets, were searched for potential target regions for human-rhesus cross-reactive 19 mer sense strand sequences as well as complementary antisense strands. For this, the fastA algorithm was used to determine the most homologues hit region in each sequence of the human RefSeq database, which we assume to represent the comprehensive human transcriptome.

[0187]To rank all potential off-targets according to assumptions 3 to 5, and by this identify the most relevant off-target gene and its off-target score, fastA output files were analyzed further by a perl script.

[0188]The script extracted the following off-target properties for each 19 mer input sequence and each off-target gene to calculate the off-target score:

[0189]Number of mismatches in non-seed region

[0190]Number of mismatches in seed region

[0191]Number of mismatches in cleavage site region

[0192]The off-target score was calculated by considering assumptions 3 to 5 as follows:

Off - target score = number of seed mismatches * 10 + number of cleavage site mismatches * 1.2 + number of non - seed mismatches * 1 ##EQU00002##

[0193]The most relevant off-target gene for each 19 mer sequence was defined as the gene with the lowest off-target score. Accordingly, the lowest off-target score was defined as representative for the off-target potential of a strand.

[0194]For the screening set in Table 2, an off-target score of 3 or more for the antisense strand and 2 or more for the sense strand was chosen as prerequisite for selection of siRNAs, whereas all sequences containing 4 or more consecutive G's (poly-G sequences) were excluded. 266 human-rhesus cross-reactive sequences passing the specificity criterion, were selected based on this cut-off (see Table 2).

[0195]For definition of the expanded screening set the cross-reactivity to rhesus was disgarded, re-calculated the predicted specificity based on the newly available human RefSeq database and selected only those 328 non-poly-G siRNAs with off-target score of 2,2 or more for the antisense and sense strand (see Table 3).

[0196]For the Tables: Key: A,G,C,U-ribonucleotides: T-deoxythymidine: u,c-2'-O-methyl nucleotides: s-phosphorothioate linkage.

TABLE-US-00001 TABLE 1A position SEQ SEQ SEQ in human ID sequence of total 23mer ID ID antisense sequence duplex access. # NO: target site No: sense sequence (5'-3') No: (5'-3') name 385-407 1244 ACCGAAGUGUUGUUUGUCCAAUU 1 cGAAGuGuuGuuuGuccAATsT 2 UUGGAcAAAcAAcACUUCGTsT AL-DP- 6226 347-369 1245 UAUGGUGUUUGGAGCAUCUACUA 3 uGGuGuuuGGAGcAucuAcTsT 4 GuAGAUGCUCcAAAcACcATsT AL-DP- 6227 1078-1100 1246 AAUCUAAACUAACUAGAAUCCUC 5 ucuAAAcuAAcuAGAAuccTsT 6 GGAUUCuAGUuAGUUuAGATsT AL-DP- 6228 1067-1089 1247 UCCUUAUCGAGAAUCUAAACUAA 7 cuuAucGAGAAucuAAAcuTsT 8 AGUUuAGAUUCUCGAuAAGTsT AL-DP- 6229 374-396 1248 GAUUGAUGUUUACCGAAGUGUUG 9 uuGAuGuuuAccGAAGuGuTsT 10 AcACUUCGGuAAAcAUcAATsT AL-DP- 6230 205-227 1249 UGGUGAGAUGCAGACCAUUUAAU 11 GuGAGAuGcAGAccAuuuATsT 12 uAAAUGGUCUGcAUCUcACTsT AL-DP- 6231 1176-1198 1250 ACUCUGAGUACAUUGGAAUAUGC 13 ucuGAGuAcAuuGGAAuAuTsT 14 AuAUUCcAAUGuACUcAGATsT AL-DP- 6232 386-408 1251 CCGAAGUGUUGUUUGUCCAAUUC 15 GAAGuGuuGuuuGuccAAuTsT 16 AUUGGAcAAAcAAcACUUCTsT AL-DP- 6233 416-438 1252 AGUUAUUAUGGGCUAUAAUUGCA 17 uuAuuAuGGGcuAuAAuuGTsT 18 cAAUuAuAGCCcAuAAuAATsT AL-DP- 6234 485-507 1253 GGAAGGUGAAAGGUCACCUAAUG 19 AAGGuGAAAGGucAccuAATsT 20 UuAGGUGACCUUUcACCUUTsT AL-DP- 6235 476-498 1254 UUUUACAAUGGAAGGUGAAAGGU 21 uuAcAAuGGAAGGuGAAAGTsT 22 CUUUcACCUUCcAUUGuAATsT AL-DP- 6236 486-508 1255 GAAGGUGAAAGGUCACCUAAUGA 23 AGGuGAAAGGucAccuAAuTsT 24 AUuAGGUGACCUUUcACCUTsT AL-DP- 6237 487-509 1256 AAGGUGAAAGGUCACCUAAUGAA 25 GGuGAAAGGucAccuAAuGTsT 26 cAUuAGGUGACCUUUcACCTsT AL-DP- 6238 1066-1088 1257 UUCCUUAUCGAGAAUCUAAACUA 27 ccuuAucGAGAAucuAAAcTsT 28 GUUuAGAUUCUCGAuAAGGTsT AL-DP- 6239 1256-1278 1258 AGCUCUUAUUAAGGAGUAUACGG 29 cucuuAuuAAGGAGuAuAcTsT 30 GuAuACUCCUuAAuAAGAGTsT AL-DP- 6240 2329-2351 1259 CAGAGAGAUUCUGUGCUUUGGAG 31 GAGAGAuucuGuGcuuuGGTsT 32 CcAAAGcAcAGAAUCUCUCTsT AL-DP- 6241 1077-1099 1260 GAAUCUAAACUAACUAGAAUCCU 33 AucuAAAcuAAcuAGAAucTsT 34 GAUUCuAGUuAGUUuAGAUTsT AL-DP- 6242 1244-1266 1261 ACUCACCAAAAAAGCUCUUAUUA 35 ucAccAAAAAAGcucuuAuTsT 36 AuAAGAGCUUUUUUGGUGATsT AL-DP- 6243 637-659 1262 AAGAGCUUUUUGAUCUUCUUAAU 37 GAGcuuuuuGAucuucuuATsT 38 uAAGAAGAUcAAAAAGCUCTsT AL-DP- 6244 1117-1139 1263 GGCGUACAAGAACAUCUAUAAUU 39 cGuAcAAGAAcAucuAuAATsT 40 UuAuAGAUGUUCUUGuACGTsT AL-DP- 6245 373-395 1264 AGAUUGAUGUUUACCGAAGUGUU 41 AuuGAuGuuuAccGAAGuGTsT 42 cACUUCGGuAAAcAUcAAUTsT AL-DP- 6246 1079-1101 1265 AUCUAAACUAACUAGAAUCCUCC 43 cuAAAcuAAcuAGAAuccuTsT 44 AGGAUUCuAGUuAGUUuAGTsT AL-DP- 6247 383-405 1266 UUACCGAAGUGUUGUUUGUCCAA 45 AccGAAGuGuuGuuuGuccTsT 46 GGAcAAAcAAcACUUCGGUTsT AL-DP- 6248 200-222 1267 GGUGGUGGUGAGAUGCAGACCAU 47 uGGuGGuGAGAuGcAGAccTsT 48 GGUCUGcAUCUcACcACcATsT AL-DP- 6249

TABLE-US-00002 TABLE 1B TABLE 1B single dose SDs 2nd screen duplex screen @ 25 nM [% (among name residual mRNA] quadruplicates) AL-DP-6226 23% 3% AL-DP-6227 69% 10% AL-DP-6228 33% 2% AL-DP-6229 2% 2% AL-DP-6230 66% 11% AL-DP-6231 17% 1% AL-DP-6232 9% 3% AL-DP-6233 24% 6% AL-DP-6234 91% 2% AL-DP-6235 112% 4% AL-DP-6236 69% 4% AL-DP-6237 42% 2% AL-DP-6238 45% 2% AL-DP-6239 2% 1% AL-DP-6240 48% 2% AL-DP-6241 41% 2% AL-DP-6242 8% 2% AL-DP-6243 7% 1% AL-DP-6244 6% 2% AL-DP-6245 12% 2% AL-DP-6246 28% 3% AL-DP-6247 71% 4% AL-DP-6248 5% 2% AL-DP-6249 28% 3%

TABLE-US-00003 TABLE 2A position SEQ SEQ SEQ in human ID sequence of total ID ID antisense sequence duplex access. # NO: 19mer target site NO: sense sequence (5'-3') NO: (5'-3') name 829-847 1268 CAUACUCUAGUCGUUCCCA 49 cAuAcucuAGucGuucccATsT 50 UGGGAACGACuAGAGuAUGTsT AD- 12072 246-264 1269 AGCGCCCAUUCAAUAGUAG 51 AGcGcccAuucAAuAGuAGTsT 52 CuACuAUUGAAUGGGCGCUTsT AD- 12073 238-256 1270 GGAAAGCUAGCGCCCAUUC 53 GGAAAGcuAGcGcccAuucTsT 54 GAAUGGGCGCuAGCUUUCCTsT AD- 12074 239-257 1271 GAAAGCUAGCGCCCAUUCA 55 GAAAGcuAGcGcccAuucATsT 56 UGAAUGGGCGCuAGCUUUCTsT AD- 12075 878-896 1272 AGAAACUACGAUUGAUGGA 57 AGAAAcuAcGAuuGAuGGATsT 58 UCcAUcAAUCGuAGUUUCUTsT AD- 12076 1064-1082 1273 UGUUCCUUAUCGAGAAUCU 59 uGuuccuuAucGAGAAucuTsT 60 AGAUUCUCGAuAAGGAAcATsT AD- 12077 3278-3296 1274 CAGAUUACCUCUGCGAGCC 61 cAGAuuAccucuGcGAGccTsT 62 GGCUCGcAGAGGuAAUCUGTsT AD- 12078 247-265 1275 GCGCCCAUUCAAUAGUAGA 63 GcGcccAuucAAuAGuAGATsT 64 UCuACuAUUGAAUGGGCGCTsT AD- 12079 434-452 1276 UUGCACUAUCUUUGCGUAU 65 uuGcAcuAucuuuGcGuAuTsT 66 AuACGcAAAGAuAGUGcAATsT AD- 12080 232-250 1277 CAGAGCGGAAAGCUAGCGC 67 cAGAGcGGAAAGcuAGcGcTsT 68 GCGCuAGCUUUCCGCUCUGTsT AD- 12081 1831-1849 1278 AGACCUUAUUUGGUAAUCU 69 AGAccuuAuuuGGuAAucuTsT 70 AGAUuACcAAAuAAGGUCUTsT AD- 12082 1105-1123 1279 AUUCUCUUGGAGGGCGUAC 71 AuucucuuGGAGGGcGuAcTsT 72 GuACGCCCUCcAAGAGAAUTsT AD- 12083 536-554 1280 GGCUGGUAUAAUUCCACGU 73 GGcuGGuAuAAuuccAcGuTsT 74 ACGUGGAAUuAuACcAGCCTsT AD- 12084 236-254 1281 GCGGAAAGCUAGCGCCCAU 75 GcGGAAAGcuAGcGcccAuTsT 76 AUGGGCGCuAGCUUUCCGCTsT AD- 12085 435-453 1282 UGCACUAUCUUUGCGUAUG 77 uGcAcuAucuuuGcGuAuGTsT 78 cAuACGcAAAGAuAGUGcATsT AD- 12086 541-559 1283 GUAUAAUUCCACGUACCCU 79 GuAuAAuuccAcGuAcccuTsT 80 AGGGuACGUGGAAUuAuACTsT AD- 12087 1076-1094 1284 AGAAUCUAAACUAACUAGA 81 AGAAucuAAAcuAAcuAGATsT 82 UCuAGUuAGUUuAGAUUCUTsT AD- 12088 1432-1450 1285 AGGAGCUGAAUAGGGUUAC 83 AGGAGcuGAAuAGGGuuAcTsT 84 GuAACCCuAUUcAGCUCCUTsT AD- 12089 1821-1839 1286 GAAGUACAUAAGACCUUAU 85 GAAGuAcAuAAGAccuuAuTsT 86 AuAAGGUCUuAUGuACUUCTsT AD- 12090 2126-2144 1287 GACAGUGGCCGAUAAGAUA 87 GAcAGuGGccGAuAAGAuATsT 88 uAUCUuAUCGGCcACUGUCTsT AD- 12091 2373-2391 1288 AAACCACUUAGUAGUGUCC 89 AAAccAcuuAGuAGuGuccTsT 90 GGAcACuACuAAGUGGUUUTsT AD- 12092 4026-4044 1289 UCCCUAGACUUCCCUAUUU 91 ucccuAGAcuucccuAuuuTsT 92 AAAuAGGGAAGUCuAGGGATsT AD- 12093 4030-4048 1290 UAGACUUCCCUAUUUCGCU 93 uAGAcuucccuAuuucGcuTsT 94 AGCGAAAuAGGGAAGUCuATsT AD- 12094 144-162 1291 GCGUCGCAGCCAAAUUCGU 95 GcGucGcAGccAAAuucGuTsT 96 ACGAAUUUGGCUGCGACGCTsT AD- 12095 242-260 1292 AGCUAGCGCCCAUUCAAUA 97 AGcuAGcGcccAuucAAuATsT 98 uAUUGAAUGGGCGCuAGCUTsT AD- 12096 879-897 1293 GAAACUACGAUUGAUGGAG 99 GAAAcuAcGAuuGAuGGAGTsT 100 CUCcAUcAAUCGuAGUUUCTsT AD- 12097 2134-2152 1294 CCGAUAAGAUAGAAGAUCA 101 ccGAuAAGAuAGAAGAucATsT 102 UGAUCUUCuAUCUuAUCGGTsT AD- 12098 245-263 1295 UAGCGCCCAUUCAAUAGUA 103 uAGcGcccAuucAAuAGuATsT 104 uACuAUUGAAUGGGCGCuATsT AD- 12099 444-462 1296 UUUGCGUAUGGCCAAACUG 105 uuuGcGuAuGGccAAAcuGTsT 106 cAGUUUGGCcAuACGcAAATsT AD- 12100 550-568 1297 CACGUACCCUUCAUCAAAU 107 cAcGuAcccuucAucAAAuTsT 108 AUUUGAUGAAGGGuACGUGTsT AD- 12101 442-460 1298 UCUUUGCGUAUGGCCAAAC 109 ucuuuGcGuAuGGccAAAcTsT 110 GUUUGGCcAuACGcAAAGATsT AD- 12102 386-404 1299 CCGAAGUGUUGUUUGUCCA 111 ccGAAGuGuuGuuuGuccATsT 112 UGGAcAAAcAAcACUUCGGTsT AD- 12103 233-251 1300 AGAGCGGAAAGCUAGCGCC 113 AGAGcGGAAAGcuAGcGccTsT 114 GGCGCuAGCUUUCCGCUCUTsT AD- 12104 243-261 1301 GCUAGCGCCCAUUCAAUAG 115 GcuAGcGcccAuucAAuAGTsT 116 CuAUUGAAUGGGCGCuAGCTsT AD- 12105 286-304 1302 AAGUUAGUGUACGAACUGG 117 AAGuuAGuGuAcGAAcuGGTsT 118 CcAGUUCGuAcACuAACUUTsT AD- 12106 294-312 1303 GUACGAACUGGAGGAUUGG 119 GuAcGAAcuGGAGGAuuGGTsT 120 CcAAUCCUCcAGUUCGuACTsT AD- 12107 296-314 1304 ACGAACUGGAGGAUUGGCU 121 AcGAAcuGGAGGAuuGGcuTsT 122 AGCcAAUCCUCcAGUUCGUTsT AD- 12108 373-391 1305 AGAUUGAUGUUUACCGAAG 123 AGAuuGAuGuuuAccGAAGTsT 124 CUUCGGuAAAcAUcAAUCUTsT AD- 12109 422-440 1306 UAUGGGCUAUAAUUGCACU 125 uAuGGGcuAuAAuuGcAcuTsT 126 AGUGcAAUuAuAGCCcAuATsT AD- 12110 441-459 1307 AUCUUUGCGUAUGGCCAAA 127 AucuuuGcGuAuGGccAAATsT 128 UUUGGCcAuACGcAAAGAUTsT AD- 12111 832-850 1308 ACUCUAGUCGUUCCCACUC 129 AcucuAGucGuucccAcucTsT 130 GAGUGGGAACGACuAGAGUTsT AD- 12112 881-899 1309 AACUACGAUUGAUGGAGAA 131 AAcuAcGAuuGAuGGAGAATsT 132 UUCUCcAUcAAUCGuAGUUTsT AD- 12113 975-993 1310 GAUAAGAGAGCUCGGGAAG 133 GAuAAGAGAGcucGGGAAGTsT 134 CUUCCCGAGCUCUCUuAUCTsT AD- 12114 1073-1091 1311 UCGAGAAUCUAAACU 135 ucGAGAAucuAAAcuAAcuTsT 136 AGUuAGUUuAGAUUCUCGATsT AD- AACU 12115 1084-1102 1312 AACUAACUAGAAUCCUCCA 137 AAcuAAcuAGAAuccuccATsT 138 UGGAGGAUUCuAGUuAGUUTsT AD- 12116 1691-1709 1313 GGAUCGUAAGAAGGCAGUU 139 GGAucGuAAGAAGGcAGuuTsT 140 AACUGCCUUCUuACGAUCCTsT AD- 12117 1693-1711 1314 AUCGUAAGAAGGCAGUUGA 141 AucGuAAGAAGGcAGuuGATsT 142 UcAACUGCCUUCUuACGAUTsT AD- 12118 1702-1720 1315 AGGCAGUUGACCAACACAA 143 AGGcAGuuGAccAAcAcAATsT 144 UUGUGUUGGUcAACUGCCUTsT AD- 12119 2131-2149 1316 UGGCCGAUAAGAUAGAAGA 145 uGGccGAuAAGAuAGAAGATsT 146 UCUUCuAUCUuAUCGGCcATsT AD- 12120 2412-2430 1317 UCUAAGGAUAUAGUCAACA 147 ucuAAGGAuAuAGucAAcATsT 148 UGUUGACuAuAUCCUuAGATsT AD- 12121 2859-2877 1318 ACUAAGCUUAAUUGCUUUC 149 AcuAAGcuuAAuuGcuuucTsT 150 GAAAGcAAUuAAGCUuAGUTsT AD- 12122 3294-3312 1319 GCCCAGAUCAACCUUUAAU 151 GcccAGAucAAccuuuAAuTsT 152 AUuAAAGGUUGAUCUGGGCTsT AD- 12123 223-241 1320 UUAAUUUGGCAGAGCGGAA 153 uuAAuuuGGcAGAGcGGAATsT 154 UUCCGCUCUGCcAAAUuAATsT AD- 12124 1070-1088 1321 UUAUCGAGAAUCUAAACUA 155 uuAucGAGAAucuAAAcuATsT 156 uAGUUuAGAUUCUCGAuAATsT AD- 12125 244-262 1322 CUAGCGCCCAUUCAAUAGU 157 cuAGcGcccAuucAAuAGuTsT 158 ACuAUUGAAUGGGCGCuAGTsT AD- 12126 257-275 1323 AAUAGUAGAAUGUGAUCCU 159 AAuAGuAGAAuGuGAuccuTsT 160 AGGAUcAcAUUCuACuAUUTsT AD- 12127 277-295 1324 UACGAAAAGAAGUUAGUGU 161 uAcGAAAAGAAGuuAGuGuTsT 162 AcACuAACUUCUUUUCGuATsT AD- 12128 284-302 1325 AGAAGUUAGUGUACGAACU 163 AGAAGuuAGuGuAcGAAcuTsT 164 AGUUCGuAcACuAACUUCUTsT AD- 12129 366-384 1326 ACUAAACAGAUUGAUGUUU 165 AcuAAAcAGAuuGAuGuuuTsT 166 AAAcAUcAAUCUGUUuAGUTsT AD- 12130 443-461 1327 CUUUGCGUAUGGCCAAACU 167 cuuuGcGuAuGGccAAAcuTsT 168 AGUUUGGCcAuACGcAAAGTsT AD- 12131 504-522 1328 AAUGAAGAGUAUACCUGGG 169 AAuGAAGAGuAuAccuGGGTsT 170 CCcAGGuAuACUCUUcAUUTsT AD- 12132

543-561 1329 AUAAUUCCACGUACCCUUC 171 AuAAuuccAcGuAcccuucTsT 172 GAAGGGuACGUGGAAUuAUTsT AD- 12133 551-569 1330 ACGUACCCUUCAUCAAAUU 173 AcGuAcccuucAucAAAuuTsT 174 AAUUUGAUGAAGGGuACGUTsT AD- 12134 552-570 1331 CGUACCCUUCAUCAAAUUU 175 cGuAcccuucAucAAAuuuTsT 176 AAAUUUGAUGAAGGGuACGTsT AD- 12135 553-571 1332 GUACCCUUCAUCAAAUUUU 177 GuAcccuucAucAAAuuuuTsT 178 AAAAUUUGAUGAAGGGuACTsT AD- 12136 577-595 1333 AACUUACUGAUAAUGGUAC 179 AAcuuAcuGAuAAuGGuAcTsT 180 GuACcAUuAUcAGuAAGUUTsT AD- 12137 602-620 1334 UUCAGUCAAAGUGUCUCUG 181 uucAGucAAAGuGucucuGTsT 182 cAGAGAcACUUUGACUGAATsT AD- 12138 652-670 1335 UUCUUAAUCCAUCAUCUGA 183 uucuuAAuccAucAucuGATsT 184 UcAGAUGAUGGAUuAAGAATsT AD- 12139 747-765 1336 ACAGUACACAACAAGGAUG 185 AcAGuAcAcAAcAAGGAuGTsT 186 cAUCCUUGUUGUGuACUGUTsT AD- 12140 877-895 1337 AAGAAACUACGAUUGAUGG 187 AAGAAAcuAcGAuuGAuGGTsT 188 CcAUcAAUCGuAGUUUCUUTsT AD- 12141 880-898 1338 AAACUACGAUUGAUGGAGA 189 AAAcuAcGAuuGAuGGAGATsT 190 UCUCcAUcAAUCGuAGUUUTsT AD- 12142 965-983 1339 UGGAGCUGUUGAUAAGAGA 191 uGGAGcuGuuGAuAAGAGATsT 192 UCUCUuAUcAAcAGCUCcATsT AD- 12143 1086-1104 1340 CUAACUAGAAUCCUCCAGG 193 cuAAcuAGAAuccuccAGGTsT 194 CCUGGAGGAUUCuAGUuAGTsT AD- 12144 1191-1209 1341 GAAUAUGCUCAUAGAGCAA 195 GAAuAuGcucAuAGAGcAATsT 196 UUGCUCuAUGAGcAuAUUCTsT AD- 12145 1195-1213 1342 AUGCUCAUAGAGCAAAGAA 197 AuGcucAuAGAGcAAAGAATsT 198 UUCUUUGCUCuAUGAGcAUTsT AD- 12146 1412-1430 1343 AAAAAUUGGUGCUGUUGAG 199 AAAAAuuGGuGcuGuuGAGTsT 200 CUcAAcAGcACcAAUUUUUTsT AD- 12147 1431-1449 1344 GAGGAGCUGAAUAGGGUUA 201 GAGGAGcuGAAuAGGGuuATsT 202 uAACCCuAUUcAGCUCCUCTsT AD- 12148 1433-1451 1345 GGAGCUGAAUAGGGUUACA 203 GGAGcuGAAuAGGGuuAcATsT 204 UGuAACCCuAUUcAGCUCCTsT AD- 12149 1434-1452 1346 GAGCUGAAUAGGGUUACAG 205 GAGcuGAAuAGGGuuAcAGTsT 206 CUGuAACCCuAUUcAGCUCTsT AD- 12150 1435-1453 1347 AGCUGAAUAGGGUUACAGA 207 AGcuGAAuAGGGuuAcAGATsT 208 UCUGuAACCCuAUUcAGCUTsT AD- 12151 1436-1454 1348 GCUGAAUAGGGUUACAGAG 209 GcuGAAuAGGGuuAcAGAGTsT 210 CUCUGuAACCCuAUUcAGCTsT AD- 12152 1684-1702 1349 CCAAACUGGAUCGUAAGAA 211 ccAAAcuGGAucGuAAGAATsT 212 UUCUuACGAUCcAGUUUGGTsT AD- 12153 1692-1710 1350 GAUCGUAAGAAGGCAGUUG 213 GAucGuAAGAAGGcAGuuGTsT 214 cAACUGCCUUCUuACGAUCTsT AD- 12154 1833-1851 1351 ACCUUAUUUGGUAAUCUGC 215 AccuuAuuuGGuAAucuGcTsT 216 GcAGAUuACcAAAuAAGGUTsT AD- 12155 1872-1890 1352 UUAGAUACCAUUACUACAG 217 uuAGAuAccAuuAcuAcAGTsT 218 CUGuAGuAAUGGuAUCuAATsT AD- 12156 1876-1894 1353 AUACCAUUACUACAGUAGC 219 AuAccAuuAcuAcAGuAGcTsT 220 GCuACUGuAGuAAUGGuAUTsT AD- 12157 1883-1901 1354 UACUACAGUAGCACUUGGA 221 uAcuAcAGuAGcAcuuGGATsT 222 UCcAAGUGCuACUGuAGuATsT AD- 12158 1987-2005 1355 AAAGUAAAACUGUACUACA 223 AAAGuAAAAcuGuAcuAcATsT 224 UGuAGuAcAGUUUuACUUUTsT AD- 12159 2022-2040 1356 CUCAAGACUGAUCUUCUAA 225 cucAAGAcuGAucuucuAATsT 226 UuAGAAGAUcAGUCUUGAGTsT AD- 12160 2124-2142 1357 UUGACAGUGGCCGAUAAGA 227 uuGAcAGuGGccGAuAAGATsT 228 UCUuAUCGGCcACUGUcAATsT AD- 12161 2125-2143 1358 UGACAGUGGCCGAUAAGAU 229 uGAcAGuGGccGAuAAGAuTsT 230 AUCUuAUCGGCcACUGUcATsT AD- 12162 2246-2264 1359 GCAAUGUGGAAACCUAACU 231 GcAAuGuGGAAAccuAAcuTsT 232 AGUuAGGUUUCcAcAUUGCTsT AD- 12163 2376-2394 1360 CCACUUAGUAGUGUCCAGG 233 ccAcuuAGuAGuGuccAGGTsT 234 CCUGGAcACuACuAAGUGGTsT AD- 12164 2504-2522 1361 AGAAGGUACAAAAUUGGUU 235 AGAAGGuAcAAAAuuGGuuTsT 236 AACcAAUUUUGuACCUUCUTsT AD- 12165 2852-2870 1362 UGGUUUGACUAAGCUUAAU 237 uGGuuuGAcuAAGcuuAAuTsT 238 AUuAAGCUuAGUcAAACcATsT AD- 12166 2853-2871 1363 GGUUUGACUAAGCUUAAUU 239 GGuuuGAcuAAGcuuAAuuTsT 240 AAUuAAGCUuAGUcAAACCTsT AD- 12167 3110-3128 1364 UCUAAGUCAAGAGCCAUCU 241 ucuAAGucAAGAGccAucuTsT 242 AGAUGGCUCUUGACUuAGATsT AD- 12168 3764-3782 1365 UCAUCCCUAUAGUUCACUU 243 ucAucccuAuAGuucAcuuTsT 244 AAGUGAACuAuAGGGAUGATsT AD- 12169 3765-3783 1366 CAUCCCUAUAGUUCACUUU 245 cAucccuAuAGuucAcuuuTsT 246 AAAGUGAACuAuAGGGAUGTsT AD- 12170 4027-4045 1367 CCCUAGACUUCCCUAUUUC 247 cccuAGAcuucccuAuuucTsT 248 GAAAuAGGGAAGUCuAGGGTsT AD- 12171 4031-4049 1368 AGACUUCCCUAUUUCGCUU 249 AGAcuucccuAuuucGcuuTsT 250 AAGCGAAAuAGGGAAGUCUTsT AD- 12172 4082-4100 1369 UCACCAAACCAUUUGUAGA 251 ucAccAAAccAuuuGuAGATsT 252 UCuAcAAAUGGUUUGGUGATsT AD- 12173 4272-4290 1370 UCCUUUAAGAGGCCUAACU 253 uccuuuAAGAGGccuAAcuTsT 254 AGUuAGGCCUCUuAAAGGATsT AD- 12174 4275-4293 1371 UUUAAGAGGCCUAACUCAU 255 uuuAAGAGGccuAAcucAuTsT 256 AUGAGUuAGGCCUCUuAAATsT AD- 12175 4276-4294 1372 UUAAGAGGCCUAACUCAUU 257 uuAAGAGGccuAAcucAuuTsT 258 AAUGAGUuAGGCCUCUuAATsT AD- 12176 4282-4300 1373 GGCCUAACUCAUUCACCCU 259 GGccuAAcucAuucAcccuTsT 260 AGGGUGAAUGAGUuAGGCCTsT AD- 12177 4571-4589 1374 UGGUAUUUUUGAUCUGGCA 261 uGGuAuuuuuGAucuGGcATsT 262 UGCcAGAUcAAAAAuACcATsT AD- 12178 4677-4695 1375 AGUUUAGUGUGUAAAGUUU 263 AGuuuAGuGuGuAAAGuuuTsT 264 AAACUUuAcAcACuAAACUTsT AD- 12179 152-170 1376 GCCAAAUUCGUCUGCGAAG 265 GccAAAuucGucuGcGAAGTsT 266 CUUCGcAGACGAAUUUGGCTsT AD- 12180 156-174 1377 AAUUCGUCUGCGAAGAAGA 267 AAuucGucuGcGAAGAAGATsT 268 UCUUCUUCGcAGACGAAUUTsT AD- 12181 491-509 1378 UGAAAGGUCACCUAAUGAA 269 uGAAAGGucAccuAAuGAATsT 270 UUcAUuAGGUGACCUUUcATsT AD- 12182 215-233 1379 CAGACCAUUUAAUUUGGCA 271 cAGAccAuuuAAuuuGGcATsT 272 UGCcAAAUuAAAUGGUCUGTsT AD- 12183 216-234 1380 AGACCAUUUAAUUUGGCAG 273 AGAccAuuuAAuuuGGcAGTsT 274 CUGCcAAAUuAAAUGGUCUTsT AD- 12184 416-434 1381 AGUUAUUAUGGGCUAUAAU 275 AGuuAuuAuGGGcuAuAAuTsT 276 AUuAuAGCCcAuAAuAACUTsT AD- 12185 537-555 1382 GCUGGUAUAAUUCCACGUA 277 GcuGGuAuAAuuccAcGuATsT 278 uACGUGGAAUuAuACcAGCTsT AD- 12186 221-239 1383 AUUUAAUUUGGCAGAGCGG 279 AuuuAAuuuGGcAGAGcGGTsT 280 CCGCUCUGCcAAAUuAAAUTsT AD- 12187 222-240 1384 UUUAAUUUGGCAGAGCGGA 281 uuuAAuuuGGcAGAGcGGATsT 282 UCCGCUCUGCcAAAUuAAATsT AD- 12188 227-245 1385 UUUGGCAGAGCGGAAAGCU 283 uuuGGcAGAGcGGAAAGcuTsT 284 AGCUUUCCGCUCUGCcAAATsT AD- 12189 476-494 1386 UUUUACAAUGGAAGGUGAA 285 uuuuAcAAuGGAAGGuGAATsT 286 UUcACCUUCcAUUGuAAAATsT AD- 12190 482-500 1387 AAUGGAAGGUGAAAGGUCA 287 AAuGGAAGGuGAAAGGucATsT 288 UGACCUUUcACCUUCcAUUTsT AD- 12191 208-226 1388 UGAGAUGCAGACCAUUUAA 289 uGAGAuGcAGAccAuuuAATsT 290 UuAAAUGGUCUGcAUCUcATsT AD- 12192 147-165 1389 UCGCAGCCAAAUUCGUCUG 291 ucGcAGccAAAuucGucuGTsT 292 cAGACGAAUUUGGCUGCGATsT AD- 12193 426-444 1390 GGCUAUAAUUGCACUAUCU 293 GGcuAuAAuuGcAcuAucuTsT 294 AGAuAGUGcAAUuAuAGCCTsT AD- 12194 2123-2141 1391 AUUGACAGUGGCCGAUAAG 295 AuuGAcAGuGGccGAuAAGTsT 296 CUuAUCGGCcACUGUcAAUTsT AD-

12195 4029-4047 1392 CUAGACUUCCCUAUUUCGC 297 cuAGAcuucccuAuuucGcTsT 298 GCGAAAuAGGGAAGUCuAGTsT AD- 12196 438-456 1393 ACUAUCUUUGCGUAUGGCC 299 AcuAucuuuGcGuAuGGccTsT 300 GGCcAuACGcAAAGAuAGUTsT AD- 12197 830-848 1394 AUACUCUAGUCGUUCCCAC 301 AuAcucuAGucGuucccAcTsT 302 GUGGGAACGACuAGAGuAUTsT AD- 12198 876-894 1395 AAAGAAACUACGAUUGAUG 303 AAAGAAAcuAcGAuuGAuGTsT 304 cAUcAAUCGuAGUUUCUUUTsT AD- 12199 115-133 1396 GCCUUGAUUUUUUGGCGGG 305 GccuuGAuuuuuuGGcGGGTsT 306 CCCGCcAAAAAAUcAAGGCTsT AD- 12200 248-266 1397 CGCCCAUUCAAUAGUAGAA 307 cGcccAuucAAuAGuAGAATsT 308 UUCuACuAUUGAAUGGGCGTsT AD- 12201 1834-1852 1398 CCUUAUUUGGUAAUCUGCU 309 ccuuAuuuGGuAAucuGcuTsT 310 AGcAGAUuACcAAAuAAGGTsT AD- 12202 3050-3068 1399 AGAGACAAUUCCGGAUGUG 311 AGAGAcAAuuccGGAuGuGTsT 312 cAcAUCCGGAAUUGUCUCUTsT AD- 12203 4705-4723 1400 UGACUUUGAUAGCUAAAUU 313 uGAcuuuGAuAGcuAAAuuTsT 314 AAUUuAGCuAUcAAAGUcATsT AD- 12204 229-247 1401 UGGCAGAGCGGAAAGCUAG 315 uGGcAGAGcGGAAAGcuAGTsT 316 CuAGCUUUCCGCUCUGCcATsT AD- 12205 234-252 1402 GAGCGGAAAGCUAGCGCCC 317 GAGcGGAAAGcuAGcGcccTsT 318 GGGCGCuAGCUUUCCGCUCTsT AD- 12206 282-300 1403 AAAGAAGUUAGUGUACGAA 319 AAAGAAGuuAGuGuAcGAATsT 320 UUCGuAcACuAACUUCUUUTsT AD- 12207 433-451 1404 AUUGCACUAUCUUUGCGUA 321 AuuGcAcuAucuuuGcGuATsT 322 uACGcAAAGAuAGUGcAAUTsT AD- 12208 540-558 1405 GGUAUAAUUCCACGUACCC 323 GGuAuAAuuccAcGuAcccTsT 324 GGGuACGUGGAAUuAuACCTsT AD- 12209 831-849 1406 UACUCUAGUCGUUCCCACU 325 uAcucuAGucGuucccAcuTsT 326 AGUGGGAACGACuAGAGuATsT AD- 12210 872-890 1407 UAUGAAAGAAACUACGAUU 327 uAuGAAAGAAAcuAcGAuuTsT 328 AAUCGuAGUUUCUUUcAuATsT AD- 12211 1815-1833 1408 AUGCUAGAAGUACAUAAGA 329 AuGcuAGAAGuAcAuAAGATsT 330 UCUuAUGuACUUCuAGcAUTsT AD- 12212 1822-1840 1409 AAGUACAUAAGACCUUAUU 331 AAGuAcAuAAGAccuuAuuTsT 332 AAuAAGGUCUuAUGuACUUTsT AD- 12213 3002-3020 1410 ACAGCCUGAGCUGUUAAUG 333 AcAGccuGAGcuGuuAAuGTsT 334 cAUuAAcAGCUcAGGCUGUTsT AD- 12214 3045-3063 1411 AAAGAAGAGACAAUUCCGG 335 AAAGAAGAGAcAAuuccGGTsT 336 CCGGAAUUGUCUCUUCUUUTsT AD- 12215 3224-3242 1412 CACACUGGAGAGGUCUAAA 337 cAcAcuGGAGAGGucuAAATsT 338 UUuAGACCUCUCcAGUGUGTsT AD- 12216 3226-3244 1413 CACUGGAGAGGUCUAAAGU 339 cAcuGGAGAGGucuAAAGuTsT 340 ACUUuAGACCUCUCcAGUGTsT AD- 12217 3227-3245 1414 ACUGGAGAGGUCUAAAGUG 341 AcuGGAGAGGucuAAAGuGTsT 342 cACUUuAGACCUCUCcAGUTsT AD- 12218 145-163 1415 CGUCGCAGCCAAAUUCGUC 343 cGucGcAGccAAAuucGucTsT 344 GACGAAUUUGGCUGCGACGTsT AD- 12219 1700-1718 1416 GAAGGCAGUUGACCAACAC 345 GAAGGcAGuuGAccAAcAcTsT 346 GUGUUGGUcAACUGCCUUCTsT AD- 12220 4291-4309 1417 CAUUCACCCUGACAGAGUU 347 cAuucAcccuGAcAGAGuuTsT 348 AACUCUGUcAGGGUGAAUGTsT AD- 12221 4278-4296 1418 AAGAGGCCUAACUCAUUCA 349 AAGAGGccuAAcucAuucATsT 350 UGAAUGAGUuAGGCCUCUUTsT AD- 12222 3051-3069 1419 GAGACAAUUCCGGAUGUGG 351 GAGAcAAuuccGGAuGuGGTsT 352 CcAcAUCCGGAAUUGUCUCTsT AD- 12223 3058-3076 1420 UUCCGGAUGUGGAUGUAGA 353 uuccGGAuGuGGAuGuAGATsT 354 UCuAcAUCcAcAUCCGGAATsT AD- 12224 241-259 1421 AAGCUAGCGCCCAUUCAAU 355 AAGcuAGcGcccAuucAAuTsT 356 AUUGAAUGGGCGCuAGCUUTsT AD- 12225 285-303 1422 GAAGUUAGUGUACGAACUG 357 GAAGuuAGuGuAcGAAcuGTsT 358 cAGUUCGuAcACuAACUUCTsT AD- 12226 542-560 1423 UAUAAUUCCACGUACCCUU 359 uAuAAuuccAcGuAcccuuTsT 360 AAGGGuACGUGGAAUuAuATsT AD- 12227 2127-2145 1424 ACAGUGGCCGAUAAGAUAG 361 AcAGuGGccGAuAAGAuAGTsT 362 CuAUCUuAUCGGCcACUGUTsT AD- 12228 3760-3778 1425 UCUGUCAUCCCUAUAGUUC 363 ucuGucAucccuAuAGuucTsT 364 GAACuAuAGGGAUGAcAGATsT AD- 12229 3993-4011 1426 UUCUUGCUAUGACUUGUGU 365 uucuuGcuAuGAcuuGuGuTsT 366 AcAcAAGUcAuAGcAAGAATsT AD- 12230 1696-1714 1427 GUAAGAAGGCAGUUGACCA 367 GuAAGAAGGcAGuuGAccATsT 368 UGGUcAACUGCCUUCUuACTsT AD- 12231 2122-2140 1428 CAUUGACAGUGGCCGAUAA 369 cAuuGAcAGuGGccGAuAATsT 370 UuAUCGGCcACUGUcAAUGTsT AD- 12232 2371-2389 1429 AGAAACCACUUAGUAGUGU 371 AGAAAccAcuuAGuAGuGuTsT 372 AcACuACuAAGUGGUUUCUTsT AD- 12233 3143-3161 1430 GGAUUGUUCAUCAAUUGGC 373 GGAuuGuucAucAAuuGGcTsT 374 GCcAAUUGAUGAAcAAUCCTsT AD- 12234 4277-4295 1431 UAAGAGGCCUAACUCAUUC 375 uAAGAGGccuAAcucAuucTsT 376 GAAUGAGUuAGGCCUCUuATsT AD- 12235 287-305 1432 AGUUAGUGUACGAACUGGA 377 AGuuAGuGuAcGAAcuGGATsT 378 UCcAGUUCGuAcACuAACUTsT AD- 12236 1823-1841 1433 AGUACAUAAGACCUUAUUU 379 AGuAcAuAAGAccuuAuuuTsT 380 AAAuAAGGUCUuAUGuACUTsT AD- 12237 3379-3397 1434 UGAGCCUUGUGUAUAGAUU 381 uGAGccuuGuGuAuAGAuuTsT 382 AAUCuAuAcAcAAGGCUcATsT AD- 12238 4273-4291 1435 CCUUUAAGAGGCCUAACUC 383 ccuuuAAGAGGccuAAcucTsT 384 GAGUuAGGCCUCUuAAAGGTsT AD- 12239 2375-2393 1436 ACCACUUAGUAGUGUCCAG 385 AccAcuuAGuAGuGuccAGTsT 386 CUGGAcACuACuAAGUGGUTsT AD- 12240 4439-4457 1437 GAAACUUCCAAUUAUGUCU 387 GAAAcuuccAAuuAuGucuTsT 388 AGAcAuAAUUGGAAGUUUCTsT AD- 12241 827-845 1438 UGCAUACUCUAGUCGUUCC 389 uGcAuAcucuAGucGuuccTsT 390 GGAACGACuAGAGuAUGcATsT AD- 12242 1699-1717 1439 AGAAGGCAGUUGACCAACA 391 AGAAGGcAGuuGAccAAcATsT 392 UGUUGGUcAACUGCCUUCUTsT AD- 12243 1824-1842 1440 GUACAUAAGACCUUAUUUG 393 GuAcAuAAGAccuuAuuuGTsT 394 cAAAuAAGGUCUuAUGuACTsT AD- 12244 429-447 1441 UAUAAUUGCACUAUCUUUG 395 uAuAAuuGcAcuAucuuuGTsT 396 cAAAGAuAGUGcAAUuAuATsT AD- 12245 856-874 1442 UCUCUGUUACAAUACAUAU 397 ucucuGuuAcAAuAcAuAuTsT 398 AuAUGuAUUGuAAcAGAGATsT AD- 12246 1194-1212 1443 UAUGCUCAUAGAGCAAAGA 399 uAuGcucAuAGAGcAAAGATsT 400 UCUUUGCUCuAUGAGcAuATsT AD- 12247 392-410 1444 UGUUGUUUGUCCAAUUCUG 401 uGuuGuuuGuccAAuucuGTsT 402 cAGAAUUGGAcAAAcAAcATsT AD- 12248 1085-1103 1445 ACUAACUAGAAUCCUCCAG 403 AcuAAcuAGAAuccuccAGTsT 404 CUGGAGGAUUCuAGUuAGUTsT AD- 12249 2069-2087 1446 UGUGGUGUCUAUACUGAAA 405 uGuGGuGucuAuAcuGAAATsT 406 UUUcAGuAuAGAcACcAcATsT AD- 12250 4341-4359 1447 UAUUAUGGGAGACCACCCA 407 uAuuAuGGGAGAccAcccATsT 408 UGGGUGGUCUCCcAuAAuATsT AD- 12251 759-777 1448 AAGGAUGAAGUCUAUCAAA 409 AAGGAuGAAGucuAucAAATsT 410 UUUGAuAGACUUcAUCCUUTsT AD- 12252 973-991 1449 UUGAUAAGAGAGCUCGGGA 411 uuGAuAAGAGAGcucGGGATsT 412 UCCCGAGCUCUCUuAUcAATsT AD- 12253 1063-1081 1450 AUGUUCCUUAUCGAGAAUC 413 AuGuuccuuAucGAGAAucTsT 414 GAUUCUCGAuAAGGAAcAUTsT AD- 12254 1190-1208 1451 GGAAUAUGCUCAUAGAGCA 415 GGAAuAuGcucAuAGAGcATsT 416 UGCUCuAUGAGcAuAUUCCTsT AD- 12255 1679-1697 1452 CCAUUCCAAACUGGAUCGU 417 ccAuuccAAAcuGGAucGuTsT 418 ACGAUCcAGUUUGGAAUGGTsT AD- 12256 1703-1721 1453 GGCAGUUGACCAACACAAU 419 GGcAGuuGAccAAcAcAAuTsT 420 AUUGUGUUGGUcAACUGCCTsT AD- 12257 1814-1832 1454 CAUGCUAGAAGUACAUAAG 421 cAuGcuAGAAGuAcAuAAGTsT 422

CUuAUGuACUUCuAGcAUGTsT AD- 12258 1818-1836 1455 CUAGAAGUACAUAAGACCU 423 cuAGAAGuAcAuAAGAccuTsT 424 AGGUCUuAUGuACUUCuAGTsT AD- 12259 1897-1915 1456 UUGGAUCUCUCACAUCUAU 425 uuGGAucucucAcAucuAuTsT 426 AuAGAUGUGAGAGAUCcAATsT AD- 12260 2066-2084 1457 AACUGUGGUGUCUAUACUG 427 AAcuGuGGuGucuAuAcuGTsT 428 cAGuAuAGAcACcAcAGUUTsT AD- 12261 2121-2139 1458 UCAUUGACAGUGGCCGAUA 429 ucAuuGAcAGuGGccGAuATsT 430 uAUCGGCcACUGUcAAUGATsT AD- 12262 2280-2298 1459 AUAAAGCAGACCCAUUCCC 431 AuAAAGcAGAcccAuucccTsT 432 GGGAAUGGGUCUGCUUuAUTsT AD- 12263 2369-2387 1460 ACAGAAACCACUUAGUAGU 433 AcAGAAAccAcuuAGuAGuTsT 434 ACuACuAAGUGGUUUCUGUTsT AD- 12264 2372-2390 1461 GAAACCACUUAGUAGUGUC 435 GAAAccAcuuAGuAGuGucTsT 436 GAcACuACuAAGUGGUUUCTsT AD- 12265 2409-2427 1462 AAAUCUAAGGAUAUAGUCA 437 AAAucuAAGGAuAuAGucATsT 438 UGACuAuAUCCUuAGAUUUTsT AD- 12266 2933-2951 1463 UUAUUUAUACCCAUCAACA 439 uuAuuuAuAcccAucAAcATsT 440 UGUUGAUGGGuAuAAAuAATsT AD- 12267 3211-3229 1464 ACAGAGGCAUUAACACACU 441 AcAGAGGcAuuAAcAcAcuTsT 442 AGUGUGUuAAUGCCUCUGUTsT AD- 12268 3223-3241 1465 ACACACUGGAGAGGUCUAA 443 AcAcAcuGGAGAGGucuAATsT 444 UuAGACCUCUCcAGUGUGUTsT AD- 12269 3225-3243 1466 ACACUGGAGAGGUCUAAAG 445 AcAcuGGAGAGGucuAAAGTsT 446 CUUuAGACCUCUCcAGUGUTsT AD- 12270 3291-3309 1467 CGAGCCCAGAUCAACCUUU 447 cGAGcccAGAucAAccuuuTsT 448 AAAGGUUGAUCUGGGCUCGTsT AD- 12271 4036-4054 1468 UCCCUAUUUCGCUUUCUCC 449 ucccuAuuucGcuuucuccTsT 450 GGAGAAAGCGAAAuAGGGATsT AD- 12272 4180-4198 1469 UCUAAAAUCACUGUCAACA 451 ucuAAAAucAcuGucAAcATsT 452 UGUUGAcAGUGAUUUuAGATsT AD- 12273 151-169 1470 AGCCAAAUUCGUCUGCGAA 453 AGccAAAuucGucuGcGAATsT 454 UUCGcAGACGAAUUUGGCUTsT AD- 12274 250-268 1471 CCCAUUCAAUAGUAGAAUG 455 cccAuucAAuAGuAGAAuGTsT 456 cAUUCuACuAUUGAAUGGGTsT AD- 12275 821-839 1472 GAUGAAUGCAUACUCUAGU 457 GAuGAAuGcAuAcucuAGuTsT 458 ACuAGAGuAUGcAUUcAUCTsT AD- 12276 1060-1078 1473 CUCAUGUUCCUUAUCGAGA 459 cucAuGuuccuuAucGAGATsT 460 UCUCGAuAAGGAAcAUGAGTsT AD- 12277 1075-1093 1474 GAGAAUCUAAACUAACUAG 461 GAGAAucuAAAcuAAcuAGTsT 462 CuAGUuAGUUuAGAUUCUCTsT AD- 12278 1819-1837 1475 UAGAAGUACAUAAGACCUU 463 uAGAAGuAcAuAAGAccuuTsT 464 AAGGUCUuAUGuACUUCuATsT AD- 12279 3003-3021 1476 CAGCCUGAGCUGUUAAUGA 465 cAGccuGAGcuGuuAAuGATsT 466 UcAUuAAcAGCUcAGGCUGTsT AD- 12280 3046-3064 1477 AAGAAGAGACAAUUCCGGA 467 AAGAAGAGAcAAuuccGGATsT 468 UCCGGAAUUGUCUCUUCUUTsT AD- 12281 3134-3152 1478 UGCUGGUGUGGAUUGUUCA 469 uGcuGGuGuGGAuuGuucATsT 470 UGAAcAAUCcAcACcAGcATsT AD- 12282 155-173 1479 AAAUUCGUCUGCGAAGAAG 471 AAAuucGucuGcGAAGAAGTsT 472 CUUCUUCGcAGACGAAUUUTsT AD- 12283 4596-4614 1480 UUUCUGGAAGUUGAGAUGU 473 uuucuGGAAGuuGAGAuGuTsT 474 AcAUCUcAACUUCcAGAAATsT AD- 12284 365-383 1481 UACUAAACAGAUUGAUGUU 475 uAcuAAAcAGAuuGAuGuuTsT 476 AAcAUcAAUCUGUUuAGuATsT AD- 12285 374-392 1482 GAUUGAUGUUUACCGAAGU 477 GAuuGAuGuuuAccGAAGuTsT 478 ACUUCGGuAAAcAUcAAUCTsT AD- 12286 436-454 1483 GCACUAUCUUUGCGUAUGG 479 GcAcuAucuuuGcGuAuGGTsT 480 CcAuACGcAAAGAuAGUGCTsT AD- 12287 539-557 1484 UGGUAUAAUUCCACGUACC 481 uGGuAuAAuuccAcGuAccTsT 482 GGuACGUGGAAUuAuACcATsT AD- 12288 1629-1647 1485 AGCAAGCUGCUUAACACAG 483 AGcAAGcuGcuuAAcAcAGTsT 484 CUGUGUuAAGcAGCUUGCUTsT AD- 12289 2370-2388 1486 CAGAAACCACUUAGUAGUG 485 cAGAAAccAcuuAGuAGuGTsT 486 cACuACuAAGUGGUUUCUGTsT AD- 12290 2676-2694 1487 AACUUAUUGGAGGUUGUAA 487 AAcuuAuuGGAGGuuGuAATsT 488 UuAcAACCUCcAAuAAGUUTsT AD- 12291 3228-3246 1488 CUGGAGAGGUCUAAAGUGG 489 cuGGAGAGGucuAAAGuGGTsT 490 CcACUUuAGACCUCUCcAGTsT AD- 12292 3703-3721 1489 AAAAAAGAUAUAAGGCAGU 491 AAAAAAGAuAuAAGGcAGuTsT 492 ACUGCCUuAuAUCUUUUUUTsT AD- 12293 3737-3755 1490 GAAUUUUGAUAUCUACCCA 493 GAAuuuuGAuAucuAcccATsT 494 UGGGuAGAuAUcAAAAUUCTsT AD- 12294 4573-4591 1491 GUAUUUUUGAUCUGGCAAC 495 GuAuuuuuGAucuGGcAAcTsT 496 GUUGCcAGAUcAAAAAuACTsT AD- 12295 526-544 1492 AGGAUCCCUUGGCUGGUAU 497 AGGAucccuuGGcuGGuAuTsT 498 AuACcAGCcAAGGGAUCCUTsT AD- 12296 527-545 1493 GGAUCCCUUGGCUGGUAUA 499 GGAucccuuGGcuGGuAuATsT 500 uAuACcAGCcAAGGGAUCCTsT AD- 12297 256-274 1494 CAAUAGUAGAAUGUGAUCC 501 cAAuAGuAGAAuGuGAuccTsT 502 GGAUcAcAUUCuACuAUUGTsT AD- 12298 427-445 1495 GCUAUAAUUGCACUAUCUU 503 GcuAuAAuuGcAcuAucuuTsT 504 AAGAuAGUGcAAUuAuAGCTsT AD- 12299 554-572 1496 UACCCUUCAUCAAAUUUUU 505 uAcccuucAucAAAuuuuuTsT 506 AAAAAUUUGAUGAAGGGuATsT AD- 12300 1210-1228 1497 AGAACAUAUUGAAUAAGCC 507 AGAAcAuAuuGAAuAAGccTsT 508 GGCUuAUUcAAuAUGUUCUTsT AD- 12301 1414-1432 1498 AAAUUGGUGCUGUUGAGGA 509 AAAuuGGuGcuGuuGAGGATsT 510 UCCUcAAcAGcACcAAUUUTsT AD- 12302 1438-1456 1499 UGAAUAGGGUUACAGAGUU 511 uGAAuAGGGuuAcAGAGuuTsT 512 AACUCUGuAACCCuAUUcATsT AD- 12303 1516-1534 1500 AAGAACUUGAAACCACUCA 513 AAGAAcuuGAAAccAcucATsT 514 UGAGUGGUUUcAAGUUCUUTsT AD- 12304 2279-2297 1501 AAUAAAGCAGACCCAUUCC 515 AAuAAAGcAGAcccAuuccTsT 516 GGAAUGGGUCUGCUUuAUUTsT AD- 12305 2939-2957 1502 AUACCCAUCAACACUGGUA 517 AuAcccAucAAcAcuGGuATsT 518 uACcAGUGUUGAUGGGuAUTsT AD- 12306 3142-3160 1503 UGGAUUGUUCAUCAAUUGG 519 uGGAuuGuucAucAAuuGGTsT 520 CcAAUUGAUGAAcAAUCcATsT AD- 12307 3229-3247 1504 UGGAGAGGUCUAAAGUGGA 521 uGGAGAGGucuAAAGuGGATsT 522 UCcACUUuAGACCUCUCcATsT AD- 12308 3763-3781 1505 GUCAUCCCUAUAGUUCACU 523 GucAucccuAuAGuucAcuTsT 524 AGUGAACuAuAGGGAUGACTsT AD- 12309 4801-4819 1506 AUAAUGGCUAUAAUUUCUC 525 AuAAuGGcuAuAAuuucucTsT 526 GAGAAAUuAuAGCcAUuAUTsT AD- 12310 529-547 1507 AUCCCUUGGCUGGUAUAAU 527 AucccuuGGcuGGuAuAAuTsT 528 AUuAuACcAGCcAAGGGAUTsT AD- 12311 425-443 1508 GGGCUAUAAUUGCACUAUC 529 GGGcuAuAAuuGcAcuAucTsT 530 GAuAGUGcAAUuAuAGCCCTsT AD- 12312 1104-1122 1509 GAUUCUCUUGGAGGGCGUA 531 GAuucucuuGGAGGGcGuATsT 532 uACGCCCUCcAAGAGAAUCTsT AD- 12313 1155-1173 1510 GCAUCUCUCAAUCUUGAGG 533 GcAucucucAAucuuGAGGTsT 534 CCUcAAGAUUGAGAGAUGCTsT AD- 12314 2403-2421 1511 CAGCAGAAAUCUAAGGAUA 535 cAGcAGAAAucuAAGGAuATsT 536 uAUCCUuAGAUUUCUGCUGTsT AD- 12315 3115-3133 1512 GUCAAGAGCCAUCUGUAGA 537 GucAAGAGccAucuGuAGATsT 538 UCuAcAGAUGGCUCUUGACTsT AD- 12316 3209-3227 1513 AAACAGAGGCAUUAACACA 539 AAAcAGAGGcAuuAAcAcATsT 540 UGUGUuAAUGCCUCUGUUUTsT AD- 12317 3293-3311 1514 AGCCCAGAUCAACCUUUAA 541 AGcccAGAucAAccuuuAATsT 542 UuAAAGGUUGAUCUGGGCUTsT AD- 12318 4574-4592 1515 UAUUUUUGAUCUGGCAACC 543 uAuuuuuGAucuGGcAAccTsT 544 GGUUGCcAGAUcAAAAAuATsT AD- 12319 352-370 1516 UGUUUGGAGCAUCUACUAA 545 uGuuuGGAGcAucuAcuAATsT 546 UuAGuAGAUGCUCcAAAcATsT AD- 12320

741-759 1517 GAAAUUACAGUACACAACA 547 GAAAuuAcAGuAcAcAAcATsT 548 UGUUGUGuACUGuAAUUUCTsT AD- 12321 1478-1496 1518 ACUUGACCAGUGUAAAUCU 549 AcuuGAccAGuGuAAAucuTsT 550 AGAUUuAcACUGGUcAAGUTsT AD- 12322 1483-1501 1519 ACCAGUGUAAAUCUGACCU 551 AccAGuGuAAAucuGAccuTsT 552 AGGUcAGAUUuAcACUGGUTsT AD- 12323 1967-1985 1520 AGAACAAUCAUUAGCAGCA 553 AGAAcAAucAuuAGcAGcATsT 554 UGCUGCuAAUGAUUGUUCUTsT AD- 12324 2247-2265 1521 CAAUGUGGAAACCUAACUG 555 cAAuGuGGAAAccuAAcuGTsT 556 cAGUuAGGUUUCcAcAUUGTsT AD- 12325 2500-2518 1522 ACCAAGAAGGUACAAAAUU 557 AccAAGAAGGuAcAAAAuuTsT 558 AAUUUUGuACCUUCUUGGUTsT AD- 12326 2508-2526 1523 GGUACAAAAUUGGUUGAAG 559 GGuAcAAAAuuGGuuGAAGTsT 560 CUUcAACcAAUUUUGuACCTsT AD- 12327 3138-3156 1524 GGUGUGGAUUGUUCAUCAA 561 GGuGuGGAuuGuucAucAATsT 562 UUGAUGAAcAAUCcAcACCTsT AD- 12328 4304-4322 1525 AGAGUUCACAAAAAGCCCA 563 AGAGuucAcAAAAAGcccATsT 564 UGGGCUUUUUGUGAACUCUTsT AD- 12329 4711-4729 1526 UGAUAGCUAAAUUAAACCA 565 uGAuAGcuAAAuuAAAccATsT 566 UGGUUuAAUUuAGCuAUcATsT AD- 12330 1221-1239 1527 AAUAAGCCUGAAGUGAAUC 567 AAuAAGccuGAAGuGAAucTsT 568 GAUUcACUUcAGGCUuAUUTsT AD- 12331 1705-1723 1528 CAGUUGACCAACACAAUGC 569 cAGuuGAccAAcAcAAuGcTsT 570 GcAUUGUGUUGGUcAACUGTsT AD- 12332 3137-3155 1529 UGGUGUGGAUUGUUCAUCA 571 uGGuGuGGAuuGuucAucATsT 572 UGAUGAAcAAUCcAcACcATsT AD- 12333 4292-4310 1530 AUUCACCCUGACAGAGUUC 573 AuucAcccuGAcAGAGuucTsT 574 GAACUCUGUcAGGGUGAAUTsT AD- 12334 1829-1847 1531 UAAGACCUUAUUUGGUAAU 575 uAAGAccuuAuuuGGuAAuTsT 576 AUuACcAAAuAAGGUCUuATsT AD- 12335 2244-2262 1532 AAGCAAUGUGGAAACCUAA 577 AAGcAAuGuGGAAAccuAATsT 578 UuAGGUUUCcAcAUUGCUUTsT AD- 12336 2888-2906 1533 UCUGAAACUGGAUAUCCCA 579 ucuGAAAcuGGAuAucccATsT 580 UGGGAuAUCcAGUUUcAGATsT AD- 12337

TABLE-US-00004 TABLE 2B 1st single 2nd single dose screen SDs 1st dose screen SDs 2nd TABLE 2B @ 50 nM screen @ 25 nM screen 3rd single SDs 3rd screen duplex [% resudual (among [% resudual (among dose screen (among name mRNA] quadruplicates) mRNA] quadruplicates) @ 25 nM quadruplicates) AD-12072 65% 2% 82% 5% AD-12073 84% 1% 61% 6% AD-12074 51% 3% 36% 9% AD-12075 56% 4% 36% 4% AD-12076 21% 4% 13% 3% AD-12077 11% 2% 6% 1% AD-12078 22% 3% 9% 2% AD-12079 22% 10% 15% 7% AD-12080 68% 4% 52% 13% AD-12081 34% 8% 35% 24% AD-12082 20% 2% 92% 5% AD-12083 85% 6% 63% 10% AD-12084 18% 6% 17% 4% AD-12085 13% 4% 12% 4% AD-12086 26% 5% 17% 3% AD-12087 95% 4% 80% 4% AD-12088 29% 6% 29% 2% AD-12089 69% 5% 64% 7% AD-12090 46% 15% 34% 5% AD-12091 16% 6% 17% 3% AD-12092 82% 26% 63% 5% AD-12093 84% 4% 70% 4% AD-12094 46% 3% 34% 1% AD-12095 14% 2% 13% 1% AD-12096 26% 11% 17% 1% AD-12097 23% 2% 21% 1% AD-12098 41% 14% 17% 3% AD-12099 57% 2% 48% 6% AD-12100 101% 11% 98% 8% AD-12101 46% 7% 32% 2% AD-12102 96% 17% 88% 18% AD-12103 19% 5% 20% 2% AD-12104 40% 8% 24% 2% AD-12105 39% 2% 36% 10% AD-12106 87% 6% 79% 19% AD-12107 29% 2% 32% 16% AD-12108 38% 4% 39% 8% AD-12109 49% 3% 44% 10% AD-12110 85% 5% 80% 14% AD-12111 64% 6% 71% 18% AD-12112 48% 4% 41% 5% AD-12113 13% 0% 14% 3% AD-12114 32% 6% 16% 4% AD-12115 8% 4% 7% 5% AD-12116 74% 5% 61% 7% AD-12117 21% 4% 20% 2% AD-12118 44% 4% 42% 6% AD-12119 37% 4% 24% 3% AD-12120 22% 2% 15% 4% AD-12121 32% 1% 22% 2% AD-12122 36% 16% 19% 5% AD-12123 28% 1% 16% AD-12124 28% 2% 16% AD-12125 15% 1% 14% AD-12126 51% 22% 27% AD-12127 54% 4% 42% 9% AD-12128 29% 1% 20% 2% AD-12129 22% 3% 19% 3% AD-12130 53% 6% 42% 7% AD-12131 28% 5% 22% 3% AD-12132 88% 2% 90% 18% AD-12133 34% 2% 26% 6% AD-12134 18% 3% 14% 2% AD-12135 50% 6% 37% 4% AD-12136 42% 19% 22% 2% AD-12137 85% 12% 92% 4% AD-12138 47% 6% 49% 1% AD-12139 80% 5% 72% 4% AD-12140 97% 22% 67% 9% AD-12141 120% 4% 107% 10% AD-12142 55% 8% 33% 4% AD-12143 64% 34% 19% 2% AD-12144 58% 29% 17% 2% AD-12145 27% 8% 18% 2% AD-12146 19% 20% 15% 1% AD-12147 29% 9% 35% 3% AD-12148 30% 3% 56% 5% AD-12149 8% 2% 12% 3% AD-12150 31% 2% 31% 7% AD-12151 9% 5% 14% 2% AD-12152 3% 3% 23% 3% AD-12153 20% 6% 34% 4% AD-12154 24% 7% 44% 3% AD-12155 33% 6% 53% 11% AD-12156 35% 5% 40% 5% AD-12157 8% 3% 23% 4% AD-12158 13% 2% 22% 5% AD-12159 34% 6% 46% 5% AD-12160 19% 3% 31% 4% AD-12161 88% 4% 83% 7% AD-12162 26% 7% 32% 7% AD-12163 55% 9% 40% 3% AD-12164 21% 3% AD-12165 30% 3% 41% 4% AD-12166 9% 10% 22% 9% AD-12167 26% 3% 30% 2% AD-12168 54% 4% 59% 20% AD-12169 41% 4% 51% 16% AD-12170 43% 4% 52% 20% AD-12171 67% 3% 73% 25% AD-12172 53% 15% 37% 2% AD-12173 39% 0% 39% 0% AD-12174 41% 5% 27% 0% AD-12175 29% 0% 38% 14% AD-12176 43% 2% 56% 25% AD-12177 68% 6% 74% 30% AD-12178 41% 4% 41% 6% AD-12179 53% 5% 44% 5% AD-12180 16% 2% 13% 4% AD-12181 19% 3% 14% 2% AD-12182 16% 4% 18% 8% AD-12183 26% 3% 19% 4% AD-12184 54% 2% 77% 8% AD-12185 8% 1% 9% 1% AD-12186 36% 3% 41% 6% AD-12187 34% 17% 27% 1% AD-12188 30% 3% 27% 4% AD-12189 51% 4% 48% 5% AD-12190 33% 2% 26% 4% AD-12191 20% 2% 13% 0% AD-12192 21% 1% 23% 10% AD-12193 64% 8% 98% 6% AD-12194 8% 2% 15% 4% AD-12195 34% 2% 48% 3% AD-12196 34% 2% 51% 3% AD-12197 75% 4% 93% 6% AD-12198 55% 5% 48% 2% AD-12199 102% 6% 118% 9% AD-12200 75% 6% 60% 12% AD-12201 42% 3% 16% 4% AD-12202 29% 4% 9% 3% AD-12203 114% 14% 89% 20% AD-12204 64% 7% 26% 5% AD-12205 66% 12% 35% 4% AD-12206 46% 3% 32% 12% AD-12207 57% 5% 40% 6% AD-12208 30% 8% 10% 5% AD-12209 101% 6% 102% 23% AD-12210 38% 11% 27% 14% AD-12211 16% 6% 10% 5% AD-12212 59% 8% 65% 5% AD-12213 24% 9% 12% 2% AD-12214 67% 14% 70% 12% AD-12215 29% 13% 13% 4% AD-12216 36% 4% 13% 1% AD-12217 36% 9% 11% 2% AD-12218 35% 5% 17% 3% AD-12219 41% 9% 14% 1% AD-12220 37% 5% 23% 3% AD-12221 58% 7% 39% 6% AD-12222 74% 9% 53% 3% AD-12223 74% 10% 67% 7% AD-12224 24% 2% 11% 2% AD-12225 75% 5% 76% 14% AD-12226 45% 8% 40% 3% AD-12227 61% 6% 47% 5% AD-12228 28% 3% 25% 5% AD-12229 54% 13% 37% 6% AD-12230 70% 17% 65% 4% AD-12231 32% 12% 22% 6% AD-12232 30% 3% 17% 2% AD-12233 38% 2% 32% 3% AD-12234 90% 5% 95% 7% AD-12235 57% 7% 46% 3% AD-12236 34% 8% 16% 2% AD-12237 42% 9% 32% 8% AD-12238 42% 6% 34% 6% AD-12239 42% 3% 40% 4% AD-12240 47% 6% 36% 5% AD-12241 69% 5% 70% 8% AD-12242 61% 2% 47% 3% AD-12243 26% 7% 15% 1% AD-12244 25% 6% 15% 1% AD-12245 65% 6% 83% 13% AD-12246 29% 7% 31% 6% AD-12247 57% 13% 50% 3% AD-12248 36% 8% 20% 3% 15% 7% AD-12249 44% 3% 70% 11% 103% 34% AD-12250 47% 5% 18% 5% 17% 4% AD-12251 121% 28% 35% 8% 60% 42% AD-12252 94% 19% 8% 3% 5% 3% AD-12253 94% 33% 42% 8% 49% 27% AD-12254 101% 58% 70% 5% 80% 32% AD-12255 163% 27% 28% 6% 36% 10% AD-12256 112% 62% 18% 3% 9% 4% AD-12257 10% 4% 9% 2% 6% 2% AD-12258 27% 9% 18% 3% 20% 6% AD-12259 20% 5% 12% 2% 13% 5% AD-12260 22% 7% 81% 7% 65% 13% AD-12261 122% 11% 66% 7% 80% 22% AD-12262 97% 30% 33% 6% 44% 18% AD-12263 177% 57% 85% 11% 84% 15% AD-12264 37% 6% 10% 1% 10% 4% AD-12265 40% 8% 17% 1% 20% 10% AD-12266 33% 9% 9% 1% 8% 4% AD-12267 34% 13% 11% 1% 6% 2% AD-12268 34% 6% 11% 1% 9% 2% AD-12269 54% 6% 33% 4% 29% 7% AD-12270 52% 5% 29% 4% 27% 6% AD-12271 53% 7% 27% 3% 19% 6% AD-12272 85% 15% 57% 7% 51% 16% AD-12273 36% 6% 26% 2% 30% 5% AD-12274 75% 21% 40% 2% 50% 19% AD-12275 29% 9% 8% 1% 8% 4% AD-12276 45% 19% 15% 2% 16% 12% AD-12277 58% 17% 32% 2% 55% 14% AD-12278 120% 35% 96% 10% 124% 38% AD-12279 47% 29% 17% 1% 12% 4% AD-12280 2% 0% 3% 1% AD-12281 2% 0% 5% 2% AD-12282 3% 0% 25% 5% AD-12283 3% 1% 35% 4% AD-12284 5% 2% 49% 8% AD-12285 7% 7% 21% 26% AD-12286 28% 34% 12% 7% AD-12287 40% 21% 51% 23% AD-12288 26% 7% 155% 146% AD-12289 43% 21% 220% 131% AD-12290 2% 1% 81% 23% AD-12291 4% 1% 70% 3% AD-12292 2% 1% 6% 2% AD-12293 4% 2% 36% 3% AD-12294 10% 6% 38% 3% AD-12295 29% 31% 37% 3% AD-12296 82% 4% 89% 2% AD-12297 75% 3% 65% 2% AD-12298 73% 4% 60% 3% AD-12299 76% 4% 66% 4% AD-12300 36% 4% 15% 1% AD-12301 33% 4% 18% 2% AD-12302 66% 5% 65% 3% AD-12303 35% 6% 17% 2% AD-12304 70% 8% 70% 6% AD-12305 63% 8% 80% 7% AD-12306 23% 6% 20% 3% AD-12307 78% 10% 58% 5% AD-12308 27% 8% 15% 2% AD-12309 58% 11% 42% 3% AD-12310 106% 23% 80% 2% AD-12311 73% 12% 60% 2% AD-12312 39% 3% 36% 3%

AD-12313 64% 9% 49% 6% AD-12314 28% 7% 14% 6% AD-12315 31% 7% 13% 2% AD-12316 42% 5% 14% 2% AD-12317 34% 9% 15% 5% AD-12318 46% 4% 28% 4% AD-12319 77% 3% 56% 4% AD-12320 55% 7% 41% 3% AD-12321 21% 3% 10% 2% AD-12322 27% 8% 30% 12% AD-12323 26% 7% 35% 18% AD-12324 27% 8% 27% 14% AD-12325 32% 12% 32% 22% AD-12326 42% 22% 45% 41% AD-12327 36% 14% 37% 32% AD-12328 45% 2% 31% 3% AD-12329 61% 4% 34% 3% AD-12330 63% 5% 38% 4% AD-12331 50% 2% 26% 5% AD-12332 80% 4% 51% 7% AD-12333 34% 6% 12% 2% AD-12334 27% 2% 18% 3% AD-12335 84% 6% 60% 7% AD-12336 45% 4% 36% 4% AD-12337 30% 7% 19% 2%

TABLE-US-00005 TABLE 3 single dose SDs screen @ 2nd SEQ SEQ 25 nM [% screen ID ID duplex residual (among sequence (5'-3') NO. sequence (5'-3') NO. name mRNA] quadruplicates) ccAuuAcuAcAGuAGcAcuTsT 582 AGUGCuACUGuAGuAAUGGTsT 583 AD-14085 19% 1% AucuGGcAAccAuAuuucuTsT 584 AGAAAuAUGGUUGCcAGAUTsT 585 AD-14086 38% 1% GAuAGcuAAAuuAAAccAATsT 586 UUGGUUuAAUUuAGCuAUCTsT 587 AD-14087 75% 10% AGAuAccAuuAcuAcAGuATsT 588 uACUGuAGuAAUGGuAUCUTsT 589 AD-14088 22% 8% GAuuGuucAucAAuuGGcGTsT 590 CGCcAAUUGAUGAAcAAUCTsT 591 AD-14089 70% 12% GcuuucuccucGGcucAcuTsT 592 AGuGAGCCGAGGAGAAAGCTsT 593 AD-14090 79% 11% GGAGGAuuGGcuGAcAAGATsT 594 UCUUGUcAGCcAAUCCUCCTsT 595 AD-14091 29% 3% uAAuGAAGAGuAuAccuGGTsT 596 CcAGGuAuACUCUUcAUuATsT 597 AD-14092 23% 2% uuucAccAAAccAuuuGuATsT 598 uAcAAAUGGUUUGGUGAAATsT 599 AD-14093 60% 2% cuuAuuAAGGAGuAuAcGGTsT 600 CCGuAuACUCCUuAAuAAGTsT 601 AD-14094 11% 3% GAAAucAGAuGGAcGuAAGTsT 602 CUuACGUCcAUCUGAUUUCTsT 603 AD-14095 10% 2% cAGAuGucAGcAuAAGcGATsT 604 UCGCUuAUGCUGAcAUCUGTsT 605 AD-14096 27% 2% AucuAAcccuAGuuGuAucTsT 606 GAuAcAACuAGGGUuAGAUTsT 607 AD-14097 45% 6% AAGAGcuuGuuAAAAucGGTsT 608 CCGAUUUuAAcAAGCUCUUTsT 609 AD-14098 50% 10% uuAAGGAGuAuAcGGAGGATsT 610 UCCUCCGuAuACUCCUuAATsT 611 AD-14099 12% 4% uuGcAAuGuAAAuAcGuAuTsT 612 AuACGuAUUuAcAUUGcAATsT 613 AD-14100 49% 7% ucuAAcccuAGuuGuAuccTsT 614 GGAuAcAACuAGGGUuAGATsT 615 AD-14101 36% 1% cAuGuAucuuuuucucGAuTsT 616 AUCGAGAAAAAGAuAcAUGTsT 617 AD-14102 49% 3% GAuGucAGcAuAAGcGAuGTsT 618 cAUCGCUuAUGCUGAcAUCTsT 619 AD-14103 74% 5% ucccAAcAGGuAcGAcAccTsT 620 GGUGUCGuACCUGUUGGGATsT 621 AD-14104 27% 3% uGcucAcGAuGAGuuuAGuTsT 622 ACuAAACUcAUCGUGAGcATsT 623 AD-14105 34% 4% AGAGcuuGuuAAAAucGGATsT 624 UCCGAUUUuAAcAAGCUCUTsT 625 AD-14106 9% 2% GcGuAcAAGAAcAucuAuATsT 626 uAuAGAUGUUCUUGuACGCTsT 627 AD-14107 5% 1% GAGGuuGuAAGccAAuGuuTsT 628 AAcAUUGGCUuAcAACCUCTsT 629 AD-14108 15% 1% AAcAGGuAcGAcAccAcAGTsT 630 CUGUGGUGUCGuACCUGUUTsT 631 AD-14109 91% 2% AAcccuAGuuGuAucccucTsT 632 GAGGGAuAcAACuAGGGUUTsT 633 AD-14110 66% 5% GcAuAAGcGAuGGAuAAuATsT 634 uAUuAUCcAUCGCUuAUGCTsT 635 AD-14111 33% 3% AAGcGAuGGAuAAuAccuATsT 636 uAGGuAUuAUCcAUCGCUUTsT 637 AD-14112 51% 3% uGAuccuGuAcGAAAAGAATsT 638 UUCUUUUCGuAcAGGAUcATsT 639 AD-14113 22% 3% AAAAcAuuGGccGuucuGGTsT 640 CcAGAACGGCcAAUGUUUUTsT 641 AD-14114 117% 8% cuuGGAGGGcGuAcAAGAATsT 642 UUCUUGuACGCCCUCcAAGTsT 643 AD-14115 50% 8% GGcGuAcAAGAAcAucuAuTsT 644 AuAGAUGUUCUUGuACGCCTsT 645 AD-14116 14% 3% AcucuGAGuAcAuuGGAAuTsT 646 AUUCcAAUGuACUcAGAGUTsT 647 AD-14117 12% 4% uuAuuAAGGAGuAuAcGGATsT 648 UCCGuAuACUCCUuAAuAATsT 649 AD-14118 26% 4% uAAGGAGuAuAcGGAGGAGTsT 650 CUCCUCCGuAuACUCCUuATsT 651 AD-14119 24% 5% AAAucAAuAGucAAcuAAATsT 652 UUuAGUUGACuAUUGAUUUTsT 653 AD-14120 8% 1% AAucAAuAGucAAcuAAAGTsT 654 CUUuAGUUGACuAUUGAUUTsT 655 AD-14121 24% 2% uucucAGuAuAcuGuGuAATsT 656 UuAcAcAGuAuACUGAGAATsT 657 AD-14122 10% 1% uGuGAAAcAcucuGAuAAATsT 658 UUuAUcAGAGUGUUUCAcATsT 659 AD-14123 8% 1% AGAuGuGAAucucuGAAcATsT 660 UGUUcAGAGAUUcAcAUCUTsT 661 AD-14124 9% 2% AGGuuGuAAGccAAuGuuGTsT 662 cAAcAUUGGCUuAcAACCUTsT 663 AD-14125 114% 6% uGAGAAAucAGAuGGAcGuTsT 664 ACGUCcAUCUGAUUUCUcATsT 665 AD-14126 9% 1% AGAAAucAGAuGGAcGuAATsT 666 UuACGUCcAUCUGAUUUCUTsT 667 AD-14127 57% 6% AuAucccAAcAGGuAcGAcTsT 668 GUCGuACCUGUUGGGAuAUTsT 669 AD-14128 104% 6% cccAAcAGGuAcGAcAccATsT 670 UGGUGUCGuACCUGUUGGGTsT 671 AD-14129 21% 2% AGuAuAcuGAAGAAccucuTsT 672 AGAGGUUCUUcAGuAuACUTsT 673 AD-14130 57% 6% AuAuAuAucAGccGGGcGcTsT 674 GCGCCCGGCUGAuAuAuAUTsT 675 AD-14131 93% 6% AAucuAAcccuAGuuGuAuTsT 676 AuAcAACuAGGGUuAGAUUTsT 677 AD-14132 75% 8% cuAAcccuAGuuGuAucccTsT 678 GGGAuAcAACuAGGGUuAGTsT 679 AD-14133 66% 4% cuAGuuGuAucccuccuuuTsT 680 AAAGGAGGGAuAcAACuAGTsT 681 AD-14134 44% 6% AGAcAucuGAcuAAuGGcuTsT 682 AGCcAUuAGUcAGAUGUCUTsT 683 AD-14135 55% 6% GAAGcucAcAAuGAuuuAATsT 684 UuAAAUcAUUGUGAGCUUCTsT 685 AD-14136 29% 3% AcAuGuAucuuuuucucGATsT 686 UCGAGAAAAAGAuAcAUGUTsT 687 AD-14137 40% 3% ucGAuucAAAucuuAAcccTsT 688 GGGUuAAGAUUUGAAUCGATsT 689 AD-14138 39% 5% ucuuAAcccuuAGGAcucuTsT 690 AGAGUCCuAAGGGUuAAGATsT 691 AD-14139 71% 11% GcucAcGAuGAGuuuAGuGTsT 692 cACuAAACUcAUCGUGAGCTsT 693 AD-14140 43% 15% cAuAAGcGAuGGAuAAuAcTsT 694 GuAUuAUCcAUCGCUuAUGTsT 695 AD-14141 33% 6% AuAAGcGAuGGAuAAuAccTsT 696 GGuAUuAUCcAUCGCUuAUTsT 697 AD-14142 51% 14% ccuAAuAAAcuGcccucAGTsT 698 CUGAGGGcAGUUuAUuAGGTsT 699 AD-14143 42% 1% ucGGAAAGuuGAAcuuGGuTsT 700 ACcAAGUUcAACUUUCCGATsT 701 AD-14144 4% 4% GAAAAcAuuGGccGuucuGTsT 702 cAGAACGGCcAAUGUUUUCTsT 703 AD-14145 92% 5% AAGAcuGAucuucuAAGuuTsT 704 AACUuAGAAGAUcAGUCUUTsT 705 AD-14146 13% 2% GAGcuuGuuAAAAucGGAATsT 706 UUCCGAUUUuAAcAAGCUCTsT 707 AD-14147 8% 1% AcAuuGGccGuucuGGAGcTsT 708 GCUCcAGAACGGCcAAUGUTsT 709 AD-14148 80% 7% AAGAAcAucuAuAAuuGcATsT 710 UGcAAUuAuAGAUGUUCUUTsT 711 AD-14149 44% 7% AAAuGuGucuAcucAuGuuTsT 712 AAcAUGAGuAGAcAcAUUUTsT 713 AD-14150 32% 29% uGucuAcucAuGuuucucATsT 714 UGAGAAAcAUGAGuAGAcATsT 715 AD-14151 75% 11% GuAuAcuGuGuAAcAAucuTsT 716 AGAUUGUuAcAcAGuAuACTsT 717 AD-14152 8% 5% uAuAcuGuGuAAcAAucuATsT 718 uAGAUUGUuAcAcAGuAuATsT 719 AD-14153 17% 11% cuuAGuAGuGuccAGGAAATsT 720 UUUCCUGGAcACuACuAAGTsT 721 AD-14154 16% 4% ucAGAuGGAcGuAAGGcAGTsT 722 CUGCCUuACGUCcAUCUGATsT 723 AD-14155 11% 1% AGAuAAAuuGAuAGcAcAATsT 724 UUGUGCuAUcAAUUuAUCUTsT 725 AD-14156 10% 1% cAAcAGGuAcGAcAccAcATsT 726 UGUGGUGUCGuACCUGUUGTsT 727 AD-14157 29% 3% uGcAAuGuAAAuAcGuAuuTsT 728 AAuACGuAUUuAcAUUGcATsT 729 AD-14158 51% 3% AGucAGAAuuuuAucuAGATsT 730 UCuAGAuAAAAUUCUGACUTsT 731 AD-14159 53% 5% cuAGAAAucuuuuAAcAccTsT 732 GGUGUuAAAAGAUUUCuAGTsT 733 AD-14160 40% 3% AAuAAAucuAAcccuAGuuTsT 734 AACuAGGGUuAGAUUuAUUTsT 735 AD-14161 83% 7% AAuuuucuGcucAcGAuGATsT 736 UcAUCGUGAGcAGAAAAUUTsT 737 AD-14162 44% 6% GcccucAGuAAAuccAuGGTsT 738 CcAUGGAUUuACUGAGGGCTsT 739 AD-14163 57% 3% AcGuuuAAAAcGAGAucuuTsT 740 AAGAUCUCGUUUuAAACGUTsT 741 AD-14164 4% 1% AGGAGAuAGAAcGuuuAAATsT 742 UUuAAACGUUCuAUCUCCUTsT 743 AD-14165 11% 1% GAccGucAuGGcGucGcAGTsT 744 CUGCGACGCcAUGACGGUCTsT 745 AD-14166 90% 5% AccGucAuGGcGucGcAGcTsT 746 GCUGCGACGCcAUGACGGUTsT 747 AD-14167 49% 1% GAAcGuuuAAAAcGAGAucTsT 748 GAUCUCGUUUuAAACGUUCTsT 749 AD-14168 12% 2% uuGAGcuuAAcAuAGGuAATsT 750 UuACCuAUGUuAAGCUcAATsT 751 AD-14169 66% 4% AcuAAAuuGAucucGuAGATsT 752 UCuACGAGAUcAAUUuAGUTsT 753 AD-14170 52% 6% ucGuAGAAuuAucuuAAuATsT 754 uAUuAAGAuAAUUCuACGATsT 755 AD-14171 42% 4% GGAGAuAGAAcGuuuAAAATsT 756 UUUuAAACGUUCuAUCUCCTsT 757 AD-14172 3% 1% AcAAcuuAuuGGAGGuuGuTsT 758 AcAACCUCcAAuAAGUUGUTsT 759 AD-14173 29% 2% uGAGcuuAAcAuAGGuAAATsT 760 UUuACCuAUGUuAAGCUcATsT 761 AD-14174 69% 2% AucucGuAGAAuuAucuuATsT 762 uAAGAuAAUUCuACGAGAUTsT 763 AD-14175 53% 3% cuGcGuGcAGucGGuccucTsT 764 GAGGACCGACUGcACGcAGTsT 765 AD-14176 111% 4% cAcGcAGcGcccGAGAGuATsT 766 uACUCUCGGGCGCUGCGUGTsT 767 AD-14177 87% 6% AGuAccAGGGAGAcuccGGTsT 768 CCGGAGUCUCCCUGGuACUTsT 769 AD-14178 59% 2% AcGGAGGAGAuAGAAcGuuTsT 770 AACGUUCuAUCUCCUCCGUTsT 771 AD-14179 9% 2% AGAAcGuuuAAAAcGAGAuTsT 772 AUCUCGUUUuAAACGUUCUTsT 773 AD-14180 43% 2% AAcGuuuAAAAcGAGAucuTsT 774 AGAUCUCGUUUuAAACGUUTsT 775 AD-14181 70% 10% AGcuuGAGcuuAAcAuAGGTsT 776 CCuAUGUuAAGCUcAAGCUTsT 777 AD-14182 100% 7% AGcuuAAcAuAGGuAAAuATsT 778 uAUUuACCuAUGUuAAGCUTsT 779 AD-14183 60% 5% uAGAGcuAcAAAAccuAucTsT 780 GAuAGGUUUUGuAGCUCuATsT 781 AD-14184 129% 6% uAGuuGuAucccuccuuuATsT 782 uAAAGGAGGGAuAcAACuATsT 783 AD-14185 62% 4% AccAcccAGAcAucuGAcuTsT 784 AGUcAGAUGUCUGGGUGGUTsT 785 AD-14186 42% 3% AGAAAcuAAAuuGAucucGTsT 786 CGAGAUcAAUUuAGUUUCUTsT 787 AD-14187 123% 12% ucucGuAGAAuuAucuuAATsT 788 UuAAGAuAAUUCuACGAGATsT 789 AD-14188 38% 2% cAAcuuAuuGGAGGuuGuATsT 790 uAcAACCUCcAAuAAGUUGTsT 791 AD-14189 13% 1% uuGuAucccuccuuuAAGuTsT 792 ACUuAAAGGAGGGAuAcAATsT 793 AD-14190 59% 3% ucAcAAcuuAuuGGAGGuuTsT 794 AACCUCcAAuAAGUUGUGATsT 795 AD-14191 93% 3% AGAAcuGuAcucuucucAGTsT 796 CUGAGAAGAGuAcAGUUCUTsT 797 AD-14192 45% 5% GAGcuuAAcAuAGGuAAAuTsT 798 AUUuACCuAUGUuAAGCUCTsT 799 AD-14193 57% 3% cAccAAcAucuGuccuuAGTsT 800 CuAAGGAcAGAUGUUGGUGTsT 801 AD-14194 51% 4% AAAGcccAcuuuAGAGuAuTsT 802 AuACUCuAAAGUGGGCUUUTsT 803 AD-14195 77% 5% AAGcccAcuuuAGAGuAuATsT 804 uAuACUCuAAAGUGGGCUUTsT 805 AD-14196 42% 6% GAccuuAuuuGGuAAucuGTsT 806 cAGAUuACcAAAuAAGGUCTsT 807 AD-14197 15% 2% GAuuAAuGuAcucAAGAcuTsT 808 AGUCUUGAGuAcAUuAAUCTsT 809 AD-14198 12% 2% cuuuAAGAGGccuAAcucATsT 810 UGAGUuAGGCCUCUuAAAGTsT 811 AD-14199 18% 2% uuAAAccAAAcccuAuuGATsT 812 UcAAuAGGGUUUGGUUuAATsT 813 AD-14200 72% 9% ucuGuuGGAGAucuAuAAuTsT 814 AUuAuAGAUCUCcAAcAGATsT 815 AD-14201 9% 3% cuGAuGuuucuGAGAGAcuTsT 816 AGUCUCUcAGAAAcAUcAGTsT 817 AD-14202 25% 3% GcAuAcucuAGucGuucccTsT 818 GGGAACGACuAGAGuAUGCTsT 819 AD-14203 21% 1% GuuccuuAucGAGAAucuATsT 820 uAGAUUCUCGAuAAGGAACTsT 821 AD-14204 4% 2%

GcAcuuGGAucucucAcAuTsT 822 AUGUGAGAGAUCcAAGUGCTsT 823 AD-14205 5% 1% AAAAAAGGAAcuAGAuGGcTsT 824 GCcAUCuAGUUCCUUUUUUTsT 825 AD-14206 79% 6% AGAGcAGAuuAccucuGcGTsT 826 CGcAGAGGuAAUCUGCUCUTsT 827 AD-14207 55% 2% AGcAGAuuAccucuGcGAGTsT 828 CUCGcAGAGGuAAUCUGCUTsT 829 AD-14208 100% 4% cccuGAcAGAGuucAcAAATsT 830 UUUGUGAACUCUGUcAGGGTsT 831 AD-14209 34% 3% GuuuAccGAAGuGuuGuuuTsT 832 AAAcAAcACUUCGGuAAACTsT 833 AD-14210 13% 2% uuAcAGuAcAcAAcAAGGATsT 834 UCCUUGUUGUGuACUGuAATsT 835 AD-14211 9% 1% AcuGGAucGuAAGAAGGcATsT 836 UGCCUUCUuACGAUCcAGUTsT 837 AD-14212 20% 3% GAGcAGAuuAccucuGcGATsT 838 UCGcAGAGGuAAUCUGCUCTsT 839 AD-14213 48% 5% AAAAGAAGuuAGuGuAcGATsT 840 UCGuAcACuAACUUCUUUUTsT 841 AD-14214 28% 18% GAccAuuuAAuuuGGcAGATsT 842 UCUGCcAAAUuAAAUGGUCTsT 843 AD-14215 132% 0% GAGAGGAGuGAuAAuuAAATsT 844 UUuAAUuAUcACUCCUCUCTsT 845 AD-14216 3% 0% cuGGAGGAuuGGcuGAcAATsT 846 UUGUcAGCcAAUCCUCcAGTsT 847 AD-14217 19% 1% cucuAGucGuucccAcucATsT 848 UGAGUGGGAACGACuAGAGTsT 849 AD-14218 67% 8% GAuAccAuuAcuAcAGuAGTsT 850 CuACUGuAGuAAUGGuAUCTsT 851 AD-14219 76% 4% uucGucuGcGAAGAAGAAATsT 852 UUUCUUCUUCGcAGACGAATsT 853 AD-14220 33% 8% GAAAAGAAGuuAGuGuAcGTsT 854 CGuAcACuAACUUCUUUUCTsT 855 AD-14221 25% 2% uGAuGuuuAccGAAGuGuuTsT 856 AAcACUUCGGuAAAcAUcATsT 857 AD-14222 7% 2% uGuuuGuccAAuucuGGAuTsT 858 AUCcAGAAUUGGAcAAAcATsT 859 AD-14223 19% 2% AuGAAGAGuAuAccuGGGATsT 860 UCCcAGGuAuACUCUUcAUTsT 861 AD-14224 13% 1% GcuAcucuGAuGAAuGcAuTsT 862 AUGcAUUcAUcAGAGuAGCTsT 863 AD-14225 15% 2% GcccuuGuAGAAAGAAcAcTsT 864 GUGUUCUUUCuAcAAGGGCTsT 865 AD-14226 11% 0% ucAuGuuccuuAucGAGAATsT 866 UUCUCGAuAAGGAAcAUGATsT 867 AD-14227 5% 1% GAAuAGGGuuAcAGAGuuGTsT 868 cAACUCUGuAACCCuAUUCTsT 869 AD-14228 34% 3% cAAAcuGGAucGuAAGAAGTsT 870 CUUCUuACGAUCcAGUUUGTsT 871 AD-14229 15% 2% cuuAuuuGGuAAucuGcuGTsT 872 cAGcAGAUuACcAAAuAAGTsT 873 AD-14230 20% 1% AGcAAuGuGGAAAccuAAcTsT 874 GUuAGGUUUCcAcAUUGCUTsT 875 AD-14231 18% 1% AcAAuAAAGcAGAcccAuuTsT 876 AAUGGGUCUGCUUuAUUGUTsT 877 AD-14232 21% 1% AAccAcuuAGuAGuGuccATsT 878 UGGAcACuACuAAGUGGUUTsT 879 AD-14233 106% 12% AGucAAGAGccAucuGuAGTsT 880 CuAcAGAUGGCUCUUGACUTsT 881 AD-14234 35% 3% cucccuAGAcuucccuAuuTsT 882 AAuAGGGAAGUCuAGGGAGTsT 883 AD-14235 48% 4% AuAGcuAAAuuAAAccAAATsT 884 UUUGGUUuAAUUuAGCuAUTsT 885 AD-14236 23% 3% uGGcuGGuAuAAuuccAcGTsT 886 CGUGGAAUuAuACcAGCcATsT 887 AD-14237 79% 9% uuAuuuGGuAAucuGcuGuTsT 888 AcAGcAGAUuACcAAAuAATsT 889 AD-14238 92% 7% AAcuAGAuGGcuuucucAGTsT 890 CUGAGAAAGCcAUCuAGUUTsT 891 AD-14239 20% 2% ucAuGGcGucGcAGccAAATsT 892 UUUGGCUGCGACGCcAUGATsT 893 AD-14240 71% 6% AcuGGAGGAuuGGcuGAcATsT 894 UGUcAGCcAAUCCUCcAGUTsT 895 AD-14241 14% 1% cuAuAAuuGcAcuAucuuuTsT 896 AAAGAuAGUGcAAUuAuAGTsT 897 AD-14242 11% 2% AAAGGucAccuAAuGAAGATsT 898 UCUUcAUuAGGUGACCUUUTsT 899 AD-14243 11% 1% AuGAAuGcAuAcucuAGucTsT 900 GACuAGAGuAUGcAUUcAUTsT 901 AD-14244 15% 2% AAcAuAuuGAAuAAGccuGTsT 902 cAGGCUuAUUcAAuAUGUUTsT 903 AD-14245 80% 7% AAGAAGGcAGuuGAccAAcTsT 904 GUUGGUcAACUGCCUUCUUTsT 905 AD-14246 57% 5% GAuAcuAAAAGAAcAAucATsT 906 UGAUUGUUCUUUuAGuAUCTsT 907 AD-14247 9% 3% AuAcuGAAAAucAAuAGucTsT 908 GACuAUUGAUUUUcAGuAUTsT 909 AD-14248 39% 4% AAAAAGGAAcuAGAuGGcuTsT 910 AGCcAUCuAGUUCCUUUUUTsT 911 AD-14249 64% 2% GAAcuAGAuGGcuuucucATsT 912 UGAGAAAGCcAUCuAGUUCTsT 913 AD-14250 18% 2% GAAAccuAAcuGAAGAccuTsT 914 AGGUCUUcAGUuAGGUUUCTsT 915 AD-14251 56% 6% uAcccAucAAcAcuGGuAATsT 916 UuACcAGUGUUGAUGGGuATsT 917 AD-14252 48% 6% AuuuuGAuAucuAcccAuuTsT 918 AAUGGGuAGAuAUcAAAAUTsT 919 AD-14253 39% 5% AucccuAuAGuucAcuuuGTsT 920 cAAAGUGAACuAuAGGGAUTsT 921 AD-14254 44% 8% AuGGGcuAuAAuuGcAcuATsT 922 uAGUGcAAUuAuAGCCcAUTsT 923 AD-14255 108% 8% AGAuuAccucuGcGAGcccTsT 924 GGGCUCGcAGAGGuAAUCUTsT 925 AD-14256 108% 6% uAAuuccAcGuAcccuucATsT 926 UGAAGGGuACGUGGAAUuATsT 927 AD-14257 23% 2% GucGuucccAcucAGuuuuTsT 928 AAAACuGAGuGGGAACGACTsT 929 AD-14258 21% 3% AAAucAAucccuGuuGAcuTsT 930 AGUcAAcAGGGAUUGAUUUTsT 931 AD-14259 19% 2% ucAuAGAGcAAAGAAcAuATsT 932 uAUGUUCUUUGCUCuAUGATsT 933 AD-14260 10% 1% uuAcuAcAGuAGcAcuuGGTsT 934 CcAAGUGCuACUGuAGuAATsT 935 AD-14261 76% 3% AuGuGGAAAccuAAcuGAATsT 936 UUcAGUuAGGUUUCcAcAUTsT 937 AD-14262 13% 2% uGuGGAAAccuAAcuGAAGTsT 938 CUUcAGUuAGGUUUCcAcATsT 939 AD-14263 14% 2% ucuuccuuAAAuGAAAGGGTsT 940 CCCUUUcAUUuAAGGAAGATsT 941 AD-14264 65% 3% uGAAGAAccucuAAGucAATsT 942 UUGACUuAGAGGUUCUUcATsT 943 AD-14265 13% 1% AGAGGucuAAAGuGGAAGATsT 944 UCUUCcACUUuAGACCUCUTsT 945 AD-14266 18% 3% AuAucuAcccAuuuuucuGTsT 946 cAGAAAAAUGGGuAGAuAUTsT 947 AD-14267 50% 9% uAAGccuGAAGuGAAucAGTsT 948 CUGAUUcACUUcAGGCUuATsT 949 AD-14268 13% 3% AGAuGcAGAccAuuuAAuuTsT 950 AAUuAAAUGGUCUGcAUCUTsT 951 AD-14269 19% 4% AGuGuuGuuuGuccAAuucTsT 952 GAAUUGGAcAAAcAAcACUTsT 953 AD-14270 11% 2% cuAuAAuGAAGAGcuuuuuTsT 954 AAAAAGCUCUUcAUuAuAGTsT 955 AD-14271 11% 1% AGAGGAGuGAuAAuuAAAGTsT 956 CUUuAAUuAUcACUCCUCUTsT 957 AD-14272 7% 1% uuucucuGuuAcAAuAcAuTsT 958 AUGuAUUGuAAcAGAGAAATsT 959 AD-14273 14% 2% AAcAucuAuAAuuGcAAcATsT 960 UGUUGcAAUuAuAGAUGUUTsT 961 AD-14274 73% 4% uGcuAGAAGuAcAuAAGAcTsT 962 GUCUuAUGuACUUCuAGcATsT 963 AD-14275 10% 1% AAuGuAcucAAGAcuGAucTsT 964 GAUcAGUCUUGAGuAcAUUTsT 965 AD-14276 89% 2% GuAcucAAGAcuGAucuucTsT 966 GAAGAUcAGUCUUGAGuACTsT 967 AD-14277 7% 1% cAcucuGAuAAAcucAAuGTsT 968 cAUUGAGUUuAUcAGAGUGTsT 969 AD-14278 12% 1% AAGAGcAGAuuAccucuGcTsT 970 GcAGAGGuAAUCUGCUCUUTsT 971 AD-14279 104% 3% ucuGcGAGcccAGAucAAcTsT 972 GUUGAUCUGGGCUCGcAGATsT 973 AD-14280 21% 2% AAcuuGAGccuuGuGuAuATsT 974 uAuAcAcAAGGCUcAAGUUTsT 975 AD-14281 43% 3% GAAuAuAuAuAucAGccGGTsT 976 CCGGCUGAuAuAuAuAUUCTsT 977 AD-14282 45% 6% uGucAucccuAuAGuucAcTsT 978 GUGAACuAuAGGGAUGAcATsT 979 AD-14283 35% 5% GAucuGGcAAccAuAuuucTsT 980 GAAAuAUGGUUGCcAGAUCTsT 981 AD-14284 58% 3% uGGcAAccAuAuuucuGGATsT 982 UCcAGAAAuAUGGUUGCcATsT 983 AD-14285 48% 3% GAuGuuuAccGAAGuGuuGTsT 984 cAAcACUUCGGuAAAcAUCTsT 985 AD-14286 49% 3% uuccuuAucGAGAAucuAATsT 986 UuAGAUUCUCGAuAAGGAATsT 987 AD-14287 6% 1% AGcuuAAuuGcuuucuGGATsT 988 UCcAGAAAGcAAUuAAGCUTsT 989 AD-14288 50% 2% uuGcuAuuAuGGGAGAccATsT 990 UGGUCUCCcAuAAuAGcAATsT 991 AD-14289 48% 1% GucAuGGcGucGcAGccAATsT 992 UUGGCUGCGACGCcAUGACTsT 993 AD-14290 112% 7% uAAuuGcAcuAucuuuGcGTsT 994 CGcAAAGAuAGUGcAAUuATsT 995 AD-14291 77% 2% cuAucuuuGcGuAuGGccATsT 996 UGGCcAuACGcAAAGAuAGTsT 997 AD-14292 80% 6% ucccuAuAGuucAcuuuGuTsT 998 AcAAAGUGAACuAuAGGGATsT 999 AD-14293 58% 2% ucAAccuuuAAuucAcuuGTsT 1000 cAAGUGAAUuAAAGGUUGATsT 1001 AD-14294 77% 2% GGcAAccAuAuuucuGGAATsT 1002 UUCcAGAAAuAUGGUUGCCTsT 1003 AD-14295 62% 2% AuGuAcucAAGAcuGAucuTsT 1004 AGAUcAGUCUUGAGuAcAUTsT 1005 AD-14296 59% 4% GcAGAccAuuuAAuuuGGcTsT 1006 GCcAAAUuAAAUGGUCUGCTsT 1007 AD-14297 37% 1% ucuGAGAGAcuAcAGAuGuTsT 1008 AcAUCUGuAGUCUCUcAGATsT 1009 AD-14298 21% 1% uGcucAuAGAGcAAAGAAcTsT 1010 GUUCUUUGCUCuAUGAGcATsT 1011 AD-14299 6% 1% AcAuAAGAccuuAuuuGGuTsT 1012 ACcAAAuAAGGUCUuAUGUTsT 1013 AD-14300 17% 2% uuuGuGcuGAuucuGAuGGTsT 1014 CcAUcAGAAUcAGcAcAAATsT 1015 AD-14301 97% 6% ccAucAAcAcuGGuAAGAATsT 1016 UUCUuACcAGUGUUGAUGGTsT 1017 AD-14302 13% 1% AGAcAAuuccGGAuGuGGATsT 1018 UCcAcAUCCGGAAUUGUCUTsT 1019 AD-14303 13% 3% GAAcuuGAGccuuGuGuAuTsT 1020 AuAcAcAAGGCUcAAGUUCTsT 1021 AD-14304 38% 2% uAAuuuGGcAGAGcGGAAATsT 1022 UUUCCGCUCUGCcAAAUuATsT 1023 AD-14305 14% 2% uGGAuGAAGuuAuuAuGGGTsT 1024 CCcAuAAuAACUUcAUCcATsT 1025 AD-14306 22% 4% AucuAcAuGAAcuAcAAGATsT 1026 UCUUGuAGUUcAUGuAGAUTsT 1027 AD-14307 26% 6% GGuAuuuuuGAucuGGcAATsT 1028 UUGCcAGAUcAAAAAuACCTsT 1029 AD-14308 62% 8% cuAAuGAAGAGuAuAccuGTsT 1030 cAGGuAuACUCUUcAUuAGTsT 1031 AD-14309 52% 5% uuuGAGAAAcuuAcuGAuATsT 1032 uAUcAGuAAGUUUCUcAAATsT 1033 AD-14310 32% 3% cGAuAAGAuAGAAGAucAATsT 1034 UUGAUCUUCuAUCUuAUCGTsT 1035 AD-14311 23% 2% cuGGcAAccAuAuuucuGGTsT 1036 CcAGAAAuAUGGUUGCcAGTsT 1037 AD-14312 49% 6% uAGAuAccAuuAcuAcAGuTsT 1038 ACUGuAGuAAUGGuAUCuATsT 1039 AD-14313 69% 4% GuAuuAAAuuGGGuuucAuTsT 1040 AUGAAACCcAAUUuAAuACTsT 1041 AD-14314 52% 3% AAGAccuuAuuuGGuAAucTsT 1042 GAUuACcAAAuAAGGUCUUTsT 1043 AD-14315 66% 4% GcuGuuGAuAAGAGAGcucTsT 1044 GAGCUCUCUuAUcAAcAGCTsT 1045 AD-14316 19% 4% uAcucAuGuuucucAGAuuTsT 1046 AAUCUGAGAAAcAUGAGuATsT 1047 AD-14317 16% 5% cAGAuGGAcGuAAGGcAGcTsT 1048 GCUGCCUuACGUCcAUCUGTsT 1049 AD-14318 52% 11% uAucccAAcAGGuAcGAcATsT 1050 UGUCGuACCUGUUGGGAuATsT 1051 AD-14319 28% 11% cAuuGcuAuuAuGGGAGAcTsT 1052 GUCUCCcAuAAuAGcAAUGTsT 1053 AD-14320 52% 10% cccucAGuAAAuccAuGGuTsT 1054 ACcAUGGAUUuACUGAGGGTsT 1055 AD-14321 53% 6% GGucAuuAcuGcccuuGuATsT 1056 uAcAAGGGcAGuAAUGACCTsT 1057 AD-14322 20% 2% AAccAcucAAAAAcAuuuGTsT 1058 cAAAUGUUUUUGAGUGGUUTsT 1059 AD-14323 116% 6% uuuGcAAGuuAAuGAAucuTsT 1060 AGAUUcAUuAACUUGcAAATsT 1061 AD-14324 14% 2% uuAuuuucAGuAGucAGAATsT 1062 UUCUGACuACUGAAAAuAATsT 1063 AD-14325 50% 2% uuuucucGAuucAAAucuuTsT 1064 AAGAUUuGAAUCGAGAAAATsT 1065 AD-14326 47% 3% GuAcGAAAAGAAGuuAGuGTsT 1066 cACuAACUUCUUUUCGuACTsT 1067 AD-14327 18% 2% uuuAAAAcGAGAucuuGcuTsT 1068 AGcAAGAUCUCGUUUuAAATsT 1069 AD-14328 19% 1% GAAuuGAuuAAuGuAcucATsT 1070 UGAGuAcAUuAAUcAAUUCTsT 1071 AD-14329 94% 10% GAuGGAcGuAAGGcAGcucTsT 1072 GAGCUGCCUuACGUCcAUCTsT 1073 AD-14330 60% 4%

cAucuGAcuAAuGGcucuGTsT 1074 cAGAGCcAUuAGUcAGAUGTsT 1075 AD-14331 54% 7% GuGAuccuGuAcGAAAAGATsT 1076 UCUUUUCGuAcAGGAUcACTsT 1077 AD-14332 22% 4% AGcucuuAuuAAGGAGuAuTsT 1078 AuACUCCUuAAuAAGAGCUTsT 1079 AD-14333 70% 10% GcucuuAuuAAGGAGuAuATsT 1080 uAuACUCCUuAAuAAGAGCTsT 1081 AD-14334 18% 3% ucuuAuuAAGGAGuAuAcGTsT 1082 CGuAuACUCCUuAAuAAGATsT 1083 AD-14335 38% 6% uAuuAAGGAGuAuAcGGAGTsT 1084 CUCCGuAuACUCCUuAAuATsT 1085 AD-14336 16% 3% cuGcAGcccGuGAGAAAAATsT 1086 UUUUUCUcACGGGCUGcAGTsT 1087 AD-14337 65% 4% ucAAGAcuGAucuucuAAGTsT 1088 CUuAGAAGAUcAGUCUUGATsT 1089 AD-14338 18% 0% cuucuAAGuucAcuGGAAATsT 1090 UUUCcAGUGAACUuAGAAGTsT 1091 AD-14339 20% 4% uGcAAGuuAAuGAAucuuuTsT 1092 AAAGAUUcAUuAACUUGcATsT 1093 AD-14340 24% 1% AAucuAAGGAuAuAGucAATsT 1094 UUGACuAuAUCCUuAGAUUTsT 1095 AD-14341 27% 3% AucucuGAAcAcAAGAAcATsT 1096 UGUUCUUGUGUUcAGAGAUTsT 1097 AD-14342 13% 1% uucuGAAcAGuGGGuAucuTsT 1098 AGAuACCcACUGUUcAGAATsT 1099 AD-14343 19% 1% AGuuAuuuAuAcccAucAATsT 1100 UUGAUGGGuAuAAAuAACUTsT 1101 AD-14344 23% 2% AuGcuAAAcuGuucAGAAATsT 1102 UUUCUGAAcAGUUuAGcAUTsT 1103 AD-14345 21% 4% cuAcAGAGcAcuuGGuuAcTsT 1104 GuAACcAAGUGCUCUGuAGTsT 1105 AD-14346 18% 2% uAuAuAucAGccGGGcGcGTsT 1106 CGCGCCCGGCUGAuAuAuATsT 1107 AD-14347 67% 2% AuGuAAAuAcGuAuuucuATsT 1108 uAGAAAuACGuAUUuAcAUTsT 1109 AD-14348 39% 3% uuuuucucGAuucAAAucuTsT 1110 AGAUUuGAAUCGAGAAAAATsT 1111 AD-14349 83% 6% AAucuuAAcccuuAGGAcuTsT 1112 AGUCCuAAGGGUuAAGAUUTsT 1113 AD-14350 54% 2% ccuuAGGAcucuGGuAuuuTsT 1114 AAAuACcAGAGUCCuAAGGTsT 1115 AD-14351 57% 8% AAuAAAcuGcccucAGuAATsT 1116 UuACUGAGGGcAGUUuAUUTsT 1117 AD-14352 82% 3% GAuccuGuAcGAAAAGAAGTsT 1118 CUUCUUUUCGuAcAGGAUCTsT 1119 AD-14353 2% 1% AAuGuGAuccuGuAcGAAATsT 1120 UUUCGuAcAGGAUcAcAUUTsT 1121 AD-14354 18% 11% GuGAAAAcAuuGGccGuucTsT 1122 GAACGGCcAAUGUUUUcACTsT 1123 AD-14355 2% 1% cuuGAGGAAAcucuGAGuATsT 1124 uACUcAGAGUUUCCUcAAGTsT 1125 AD-14356 8% 2% cGuuuAAAAcGAGAucuuGTsT 1126 cAAGAUCUCGUUUuAAACGTsT 1127 AD-14357 6% 3% uuAAAAcGAGAucuuGcuGTsT 1128 cAGcAAGAUCUCGUUUuAATsT 1129 AD-14358 98% 17% AAAGAuGuAucuGGucuccTsT 1130 GGAGACcAGAuAcAUCUUUTsT 1131 AD-14359 10% 1% cAGAAAAuGuGucuAcucATsT 1132 UGAGuAGAcAcAUUUUCUGTsT 1133 AD-14360 6% 4% cAGGAAuuGAuuAAuGuAcTsT 1134 GuAcAUuAAUcAAUUCCUGTsT 1135 AD-14361 30% 5% AGucAAcuAAAGcAuAuuuTsT 1136 AAAuAUGCUUuAGUUGACUTsT 1137 AD-14362 28% 2% uGuGuAAcAAucuAcAuGATsT 1138 UcAUGuAGAUUGUuAcAcATsT 1139 AD-14363 60% 6% AuAccAuuuGuuccuuGGuTsT 1140 ACcAAGGAAcAAAUGGuAUTsT 1141 AD-14364 12% 9% GcAGAAAucuAAGGAuAuATsT 1142 uAuAUCCUuAGAUUUCUGCTsT 1143 AD-14365 5% 2% uGGcuucucAcAGGAAcucTsT 1144 GAGUUCCUGUGAGAAGCcATsT 1145 AD-14366 28% 5% GAGAuGuGAAucucuGAAcTsT 1146 GUUcAGAGAUUcAcAUCUCTsT 1147 AD-14367 42% 4% uGuAAGccAAuGuuGuGAGTsT 1148 CUcAcAAcAUUGGCUuAcATsT 1149 AD-14368 93% 12% AGccAAuGuuGuGAGGcuuTsT 1150 AAGCCUcAcAAcAUUGGCUTsT 1151 AD-14369 65% 4% uuGuGAGGcuucAAGuucATsT 1152 UGAACUUGAAGCCUcAcAATsT 1153 AD-14370 5% 2% AGGcAGcucAuGAGAAAcATsT 1154 UGUUUCUcAUGAGCUGCCUTsT 1155 AD-14371 54% 5% AuAAAuuGAuAGcAcAAAATsT 1156 UUUUGUGCuAUcAAUUuAUTsT 1157 AD-14372 4% 1% AcAAAAucuAGAAcuuAAuTsT 1158 AUuAAGUUCuAGAUUUUGUTsT 1159 AD-14373 5% 1% GAuAucccAAcAGGuAcGATsT 1160 UCGuACCUGUUGGGAuAUCTsT 1161 AD-14374 92% 6% AAGuuAuuuAuAcccAucATsT 1162 UGAUGGGuAuAAAuAACUUTsT 1163 AD-14375 76% 4% uGuAAAuAcGuAuuucuAGTsT 1164 CuAGAAAuACGuAUUuAcATsT 1165 AD-14376 70% 5% ucuAGuuuucAuAuAAAGuTsT 1166 ACUUuAuAUGAAAACuAGATsT 1167 AD-14377 48% 4% AuAAAGuAGuucuuuuAuATsT 1168 uAuAAAAGAACuACUUuAUTsT 1169 AD-14378 48% 3% ccAuuuGuAGAGcuAcAAATsT 1170 UUUGuAGCUCuAcAAAUGGTsT 1171 AD-14379 44% 5% uAuuuucAGuAGucAGAAuTsT 1172 AUUCUGACuACUGAAAAuATsT 1173 AD-14380 35% 16% AAAucuAAcccuAGuuGuATsT 1174 uAcAACuAGGGUuAGAUUUTsT 1175 AD-14381 44% 5% cuuuAGAGuAuAcAuuGcuTsT 1176 AGcAAUGuAuACUCuAAAGTsT 1177 AD-14382 28% 1% AucuGAcuAAuGGcucuGuTsT 1178 AcAGAGCcAUuAGUcAGAUTsT 1179 AD-14383 55% 11% cAcAAuGAuuuAAGGAcuGTsT 1180 cAGUCCUuAAAUcAUUGUGTsT 1181 AD-14384 48% 9% ucuuuuucucGAuucAAAuTsT 1182 AUUuGAAUCGAGAAAAAGATsT 1183 AD-14385 36% 2% cuuuuucucGAuucAAAucTsT 1184 GAUUuGAAUCGAGAAAAAGTsT 1185 AD-14386 41% 7% AuuuucuGcucAcGAuGAGTsT 1186 CUcAUCGUGAGcAGAAAAUTsT 1187 AD-14387 38% 3% uuucuGcucAcGAuGAGuuTsT 1188 AACUcAUCGUGAGcAGAAATsT 1189 AD-14388 50% 4% AGAGcuAcAAAAccuAuccTsT 1190 GGAuAGGUUUUGuAGCUCUTsT 1191 AD-14389 98% 6% GAGccAAAGGuAcAccAcuTsT 1192 AGUGGUGuACCUUUGGCUCTsT 1193 AD-14390 43% 8% GccAAAGGuAcAccAcuAcTsT 1194 GuAGUGGUGuACCUUUGGCTsT 1195 AD-14391 48% 4% GAAcuGuAcucuucucAGcTsT 1196 GCUGAGAAGAGuAcAGUUCTsT 1197 AD-14392 44% 3% AGGuAAAuAucAccAAcAuTsT 1198 AUGUUGGUGAuAUUuACCUTsT 1199 AD-14393 37% 2% AGcuAcAAAAccuAuccuuTsT 1200 AAGGAuAGGUUUUGuAGCUTsT 1201 AD-14394 114% 7% uGuGAAAGcAuuuAAuuccTsT 1202 GGAAUuAAAUGCUUUcAcATsT 1203 AD-14395 55% 4% GcccAcuuuAGAGuAuAcATsT 1204 UGuAuACUCuAAAGUGGGCTsT 1205 AD-14396 49% 5% uGuGccAcAcuccAAGAccTsT 1206 GGUCUUGGAGUGUGGcAcATsT 1207 AD-14397 71% 6% AAAcuAAAuuGAucucGuATsT 1208 uACGAGAUcAAUUuAGUUUTsT 1209 AD-14398 81% 7% uGAucucGuAGAAuuAucuTsT 1210 AGAuAAUUCuACGAGAUcATsT 1211 AD-14399 38% 4% GcGuGcAGucGGuccuccATsT 1212 UGGAGGACCGACUGcACGCTsT 1213 AD-14400 106% 8% AAAGuuuAGAGAcAucuGATsT 1214 UcAGAUGUCUCuAAACUUUTsT 1215 AD-14401 47% 3% cAGAAGGAAuAuGuAcAAATsT 1216 UUUGuAcAuAUUCCUUCUGTsT 1217 AD-14402 31% 1% cGcccGAGAGuAccAGGGATsT 1218 UCCCUGGuACUCUCGGGCGTsT 1219 AD-14403 105% 4% cGGAGGAGAuAGAAcGuuuTsT 1220 AAACGUUCuAUCUCCUCCGTsT 1221 AD-14404 3% 1% AGAuAGAAcGuuuAAAAcGTsT 1222 CGUUUuAAACGUUCuAUCUTsT 1223 AD-14405 15% 1% GGAAcAGGAAcuucAcAAcTsT 1224 GUuGuGAAGUUCCuGUUCCTsT 1225 AD-14406 44% 5% GuGAGccAAAGGuAcAccATsT 1226 UGGUGuACCUUUGGCUcACTsT 1227 AD-14407 41% 4% AuccucccuAGAcuucccuTsT 1228 AGGGAAGUCuAGGGAGGAUTsT 1229 AD-14408 104% 3% cAcAcuccAAGAccuGuGcTsT 1230 GcAcAGGUCUUGGAGUGUGTsT 1231 AD-14409 67% 4% AcAGAAGGAAuAuGuAcAATsT 1232 UUGuAcAuAUUCCUUCUGUTsT 1233 AD-14410 22% 1% uuAGAGAcAucuGAcuuuGTsT 1234 cAAAGUcAGAUGUCUCuAATsT 1235 AD-14411 29% 3% AAuuGAucucGuAGAAuuATsT 1236 uAAUUCuACGAGAUcAAUUTsT 1237 AD-14412 31% 4%

dsRNA Synthesis

[0197]Source of Reagents

[0198]Where the source of a reagent is not specifically given herein, such reagent may be obtained from any supplier of reagents for molecular biology at a quality/purity standard for application in molecular biology.

[0199]siRNA Synthesis

[0200]Single-stranded RNAs were produced by solid phase synthesis on a scale of 1 μmole using an Expedite 8909 synthesizer (Applied Biosystems, Applera Deutschland GmbH, Darmstadt, Germany) and controlled pore glass (CPG, 500 Å, Proligo Biochemie GmbH, Hamburg, Germany) as solid support. RNA and RNA containing 2'-O-methyl nucleotides were generated by solid phase synthesis employing the corresponding phosphoramidites and 2'-O-methyl phosphoramidites, respectively (Proligo Biochemie GmbH, Hamburg, Germany). These building blocks were incorporated at selected sites within the sequence of the oligoribonucleotide chain using standard nucleoside phosphoramidite chemistry such as described in Current protocols in nucleic acid chemistry, Beaucage, S. L. et al. (Edrs.), John Wiley & Sons, Inc., New York, N.Y., USA. Phosphorothioate linkages were introduced by replacement of the iodine oxidizer solution with a solution of the Beaucage reagent (Chruachem Ltd, Glasgow, UK) in acetonitrile (1%). Further ancillary reagents were obtained from Mallinckrodt Baker (Griesheim, Germany).

[0201]Deprotection and purification of the crude oligoribonucleotides by anion exchange HPLC were carried out according to established procedures. Yields and concentrations were determined by UV absorption of a solution of the respective RNA at a wavelength of 260 nm using a spectral photometer (DU 640B, Beckman Coulter GmbH, Unterschleiβheim, Germany). Double stranded RNA was generated by mixing an equimolar solution of complementary strands in annealing buffer (20 mM sodium phosphate, pH 6.8; 100 mM sodium chloride), heated in a water bath at 85-90° C. for 3 minutes and cooled to room temperature over a period of 3-4 hours. The annealed RNA solution was stored at -20° C. until use.

[0202]For the synthesis of 3'-cholesterol-conjugated siRNAs (herein referred to as -Chol-3'), an appropriately modified solid support was used for RNA synthesis. The modified solid support was prepared as follows:

Diethyl-2-azabutane-1,4-dicarboxylate AA

##STR00001##

[0204]A 4.7 M aqueous solution of sodium hydroxide (50 mL) was added into a stirred, ice-cooled solution of ethyl glycinate hydrochloride (32.19 g, 0.23 mole) in water (50 mL). Then, ethyl acrylate (23.1 g, 0.23 mole) was added and the mixture was stirred at room temperature until completion of the reaction was ascertained by TLC. After 19 h the solution was partitioned with dichloromethane (3×100 mL). The organic layer was dried with anhydrous sodium sulfate, filtered and evaporated. The residue was distilled to afford AA (28.8 g, 61%).

3-{Ethoxycarbonylmethyl-[6-(9H-fluoren-9-ylmethoxycarbonyl-amino)-hexanoyl- ]-amino}-propionic acid ethyl ester AB

##STR00002##

[0206]Fmoc-6-amino-hexanoic acid (9.12 g, 25.83 mmol) was dissolved in dichloromethane (50 mL) and cooled with ice. Diisopropylcarbodiimde (3.25 g, 3.99 mL, 25.83 mmol) was added to the solution at 0° C. It was then followed by the addition of Diethyl-azabutane-1,4-dicarboxylate (5 g, 24.6 mmol) and dimethylamino pyridine (0.305 g, 2.5 mmol). The solution was brought to room temperature and stirred further for 6 h. Completion of the reaction was ascertained by TLC. The reaction mixture was concentrated under vacuum and ethyl acetate was added to precipitate diisopropyl urea. The suspension was filtered. The filtrate was washed with 5% aqueous hydrochloric acid, 5% sodium bicarbonate and water. The combined organic layer was dried over sodium sulfate and concentrated to give the crude product which was purified by column chromatography (50% EtOAC/Hexanes) to yield 11.87 g (88%) of AB.

3-[(6-Amino-hexanoyl)-ethoxycarbonylmethyl-amino]-propionic acid ethyl ester AC

##STR00003##

[0208]3-{Ethoxycarbonylmethyl-[6-(9H-fluoren-9-ylmethoxycarbonylamino)-hex- anoyl]-amino}-propionic acid ethyl ester AB (11.5 g, 21.3 mmol) was dissolved in 20% piperidine in dimethylformamide at 0° C. The solution was continued stirring for 1 h. The reaction mixture was concentrated under vacuum, water was added to the residue, and the product was extracted with ethyl acetate. The crude product was purified by conversion into its hydrochloride salt.

3-({6-[17-(1,5-Dimethyl-hexyl)-10,13-dimethyl-2,3,4,7,8,9,10,11,12,13,14,1- 5,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yloxycarbonylamino]-h- exanoyl}ethoxycarbonylmethyl-amino)-propionic acid ethyl ester AD

##STR00004##

[0210]The hydrochloride salt of 3-[(6-Amino-hexanoyl)-ethoxycarbonylmethyl-amino]-propionic acid ethyl ester AC (4.7 g, 14.8 mmol) was taken up in dichloromethane. The suspension was cooled to 0° C. on ice. To the suspension diisopropylethylamine (3.87 g, 5.2 mL, 30 mmol) was added. To the resulting solution cholesteryl chloroformate (6.675 g, 14.8 mmol) was added. The reaction mixture was stirred overnight. The reaction mixture was diluted with dichloromethane and washed with 10% hydrochloric acid. The product was purified by flash chromatography (10.3 g, 92%).

1-{6-[17-(1,5-Dimethyl-hexyl)-10,13-dimethyl-2,3,4,7,8,9,10,11,12,13,14,15- ,16,17-tetradecahydro-1H-cyclopenta[a] phenanthren-3-yloxycarbonylamino]-hexanoyl}-4-oxo-pyrrolidine-3-carboxyli- c acid ethyl ester AE

##STR00005##

[0212]Potassium t-butoxide (1.1 g, 9.8 mmol) was slurried in 30 mL of dry toluene. The mixture was cooled to 0° C. on ice and 5 g (6.6 mmol) of diester AD was added slowly with stirring within 20 mins. The temperature was kept below 5° C. during the addition. The stirring was continued for 30 mins at 0° C. and 1 mL of glacial acetic acid was added, immediately followed by 4 g of NaH2PO4.H2O in 40 mL of water The resultant mixture was extracted twice with 100 mL of dichloromethane each and the combined organic extracts were washed twice with 10 mL of phosphate buffer each, dried, and evaporated to dryness. The residue was dissolved in 60 mL of toluene, cooled to 0° C. and extracted with three 50 mL portions of cold pH 9.5 carbonate buffer. The aqueous extracts were adjusted to pH 3 with phosphoric acid, and extracted with five 40 mL portions of chloroform which were combined, dried and evaporated to dryness. The residue was purified by column chromatography using 25% ethylacetate/hexane to afford 1.9 g of b-ketoester (39%).

[6-(3-Hydroxy-4-hydroxymethyl-pyrrolidin-1-yl)-6-oxo-hexyl]-carbamic acid 17-(1,5-dimethyl-hexyl)-10,13-dimethyl-2,3,4,7,8,9,10,11,12,13,14,15,16,1- 7-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl ester AF

##STR00006##

[0214]Methanol (2 mL) was added dropwise over a period of 1 h to a refluxing mixture of b-ketoester AE (1.5 g, 2.2 mmol) and sodium borohydride (0.226 g, 6 mmol) in tetrahydrofuran (10 mL). Stirring was continued at reflux temperature for 1 h. After cooling to room temperature, 1 N HCl (12.5 mL) was added, the mixture was extracted with ethylacetate (3×40 mL). The combined ethylacetate layer was dried over anhydrous sodium sulfate and concentrated under vacuum to yield the product which was purified by column chromatography (10% MeOH/CHCl3) (89%).

(6-{3-[Bis-(4-methoxy-phenyl)-phenyl-methoxymethyl]-4-hydroxy-pyrrolidin-1- -yl}-6-oxo-hexyl)-carbamic acid 17-(1,5-dimethyl-hexyl)-10,13-dimethyl-2,3,4,7,8,9,10,11,12,13,14,15,16,1- 7-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl ester AG

##STR00007##

[0216]Diol AF (1.25 gm 1.994 mmol) was dried by evaporating with pyridine (2×5 mL) in vacuo. Anhydrous pyridine (10 mL) and 4,4'-dimethoxytritylchloride (0.724 g, 2.13 mmol) were added with stirring. The reaction was carried out at room temperature overnight. The reaction was quenched by the addition of methanol. The reaction mixture was concentrated under vacuum and to the residue dichloromethane (50 mL) was added. The organic layer was washed with 1M aqueous sodium bicarbonate. The organic layer was dried over anhydrous sodium sulfate, filtered and concentrated. The residual pyridine was removed by evaporating with toluene. The crude product was purified by column chromatography (2% MeOH/Chloroform, Rf=0.5 in 5% MeOH/CHCl3) (1.75 g, 95%).

Succinic acid mono-(4-[bis-(4-methoxy-phenyl)-phenyl-methoxymethyl]-1-{6-[17-(1,5-dimet- hyl-hexyl)-10,13-dimethyl 2,3,4,7,8,9,10,11,12,13,14,15,16,17-tetradecahydro-1H cyclopenta[a]phenanthren-3-yloxycarbonylamino]-hexanoyl}-pyrrolidin-3-yl) ester AH

##STR00008##

[0218]Compound AG (1.0 g, 1.05 mmol) was mixed with succinic anhydride (0.150 g, 1.5 mmol) and DMAP (0.073 g, 0.6 mmol) and dried in a vacuum at 40° C. overnight. The mixture was dissolved in anhydrous dichloroethane (3 mL), triethylamine (0.318 g, 0.440 mL, 3.15 mmol) was added and the solution was stirred at room temperature under argon atmosphere for 16 h. It was then diluted with dichloromethane (40 mL) and washed with ice cold aqueous citric acid (5 wt %, 30 mL) and water (2×20 mL). The organic phase was dried over anhydrous sodium sulfate and concentrated to dryness. The residue was used as such for the next step.

Cholesterol Derivatised CPG AI

##STR00009##

[0220]Succinate AH (0.254 g, 0.242 mmol) was dissolved in a mixture of dichloromethane/acetonitrile (3:2, 3 mL). To that solution DMAP (0.0296 g, 0.242 mmol) in acetonitrile (1.25 mL), 2,2'-Dithio-bis(5-nitropyridine) (0.075 g, 0.242 mmol) in acetonitrile/dichloroethane (3:1, 1.25 mL) were added successively. To the resulting solution triphenylphosphine (0.064 g, 0.242 mmol) in acetonitrile (0.6 ml) was added. The reaction mixture turned bright orange in color. The solution was agitated briefly using a wrist-action shaker (5 mins). Long chain alkyl amine-CPG (LCAA-CPG) (1.5 g, 61 mM) was added. The suspension was agitated for 2 h. The CPG was filtered through a sintered funnel and washed with acetonitrile, dichloromethane and ether successively. Unreacted amino groups were masked using acetic anhydride/pyridine. The achieved loading of the CPG was measured by taking UV measurement (37 mM/g).

[0221]The synthesis of siRNAs bearing a 5'-12-dodecanoic acid bisdecylamide group (herein referred to as "5'-C32-") or a 5'-cholesteryl derivative group (herein referred to as "5'-Chol-") was performed as described in WO 2004/065601, except that, for the cholesteryl derivative, the oxidation step was performed using the Beaucage reagent in order to introduce a phosphorothioate linkage at the 5'-end of the nucleic acid oligomer.

[0222]Nucleic acid sequences are represented below using standard nomenclature, and specifically the abbreviations of Table 4.

TABLE-US-00006 TABLE 4 Abbreviations of nucleotide monomers used in nucleic acid sequence representation. It will be understood that these monomers, when present in an oligonucleotide, are mutually linked by 5'-3'-phosphodiester bonds. Abbreviationa Nucleotide(s) A, a 2'-deoxy-adenosine-5'-phosphate, adenosine-5'- phosphate C, c 2'-deoxy-cytidine-5'-phosphate, cytidine-5'-phosphate G, g 2'-deoxy-guanosine-5'-phosphate, guanosine-5'- phosphate T, t 2'-deoxy-thymidine-5'-phosphate, thymidine-5'- phosphate U, u 2'-deoxy-uridine-5'-phosphate, uridine-5'-phosphate N, n any 2'-deoxy-nucleotide/nucleotide (G, A, C, or T, g, a, c or u) Am 2'-O-methyladenosine-5'-phosphate Cm 2'-O-methylcytidine-5'-phosphate Gm 2'-O-methylguanosine-5'-phosphate Tm 2'-O-methyl-thymidine-5'-phosphate Um 2'-O-methyluridine-5'-phosphate Af 2'-fluoro-2'-deoxy-adenosine-5'-phosphate Cf 2'-fluoro-2'-deoxy-cytidine-5'-phosphate Gf 2'-fluoro-2'-deoxy-guanosine-5'-phosphate Tf 2'-fluoro-2'-deoxy-thymidine-5'-phosphate Uf 2'-fluoro-2'-deoxy-uridine-5'-phosphate A, C, G, T, U, a, underlined: nucleoside-5'-phosphorothioate c, g, t, u am, cm, gm, tm, underlined: 2-O-methyl-nucleoside-5'-phosphorothioate um acapital letters represent 2'-deoxyribonucleotides (DNA), lower case letters represent ribonucleotides (RNA)

dsRNA Expression Vectors

[0223]In another aspect of the invention, Eg5 specific dsRNA molecules that modulate Eg5 gene expression activity are expressed from transcription units inserted into DNA or RNA vectors (see, e.g., Couture, A, et al., TIG. (1996), 12:5-10; Skillern, A., et al., International PCT Publication No. WO 00/22113, Conrad, International PCT Publication No. WO 00/22114, and Conrad, U.S. Pat. No. 6,054,299). These transgenes can be introduced as a linear construct, a circular plasmid, or a viral vector, which can be incorporated and inherited as a transgene integrated into the host genome. The transgene can also be constructed to permit it to be inherited as an extrachromosomal plasmid (Gassmann, et al., Proc. Natl. Acad. Sci. USA (1995) 92:1292).

[0224]The individual strands of a dsRNA can be transcribed by promoters on two separate expression vectors and co-transfected into a target cell. Alternatively each individual strand of the dsRNA can be transcribed by promoters both of which are located on the same expression plasmid. In a preferred embodiment, a dsRNA is expressed as an inverted repeat joined by a linker polynucleotide sequence such that the dsRNA has a stem and loop structure.

[0225]The recombinant dsRNA expression vectors are generally DNA plasmids or viral vectors. dsRNA expressing viral vectors can be constructed based on, but not limited to, adeno-associated virus (for a review, see Muzyczka, et al., Curr. Topics Micro. Immunol. (1992) 158:97-129)); adenovirus (see, for example, Berkner, et al., BioTechniques (1998) 6:616), Rosenfeld et al. (1991, Science 252:431-434), and Rosenfeld et al. (1992), Cell 68:143-155)); or alphavirus as well as others known in the art. Retroviruses have been used to introduce a variety of genes into many different cell types, including epithelial cells, in vitro and/or in vivo (see, e.g., Eglitis, et al., Science (1985) 230:1395-1398; Danos and Mulligan, Proc. NatI. Acad. Sci. USA (1998) 85:6460-6464; Wilson et al., 1988, Proc. NatI. Acad. Sci. USA 85:3014-3018; Armentano et al., 1990, Proc. NatI. Acad. Sci. USA 87:61416145; Huber et al., 1991, Proc. NatI. Acad. Sci. USA 88:8039-8043; Ferry et al., 1991, Proc. NatI. Acad. Sci. USA 88:8377-8381; Chowdhury et al., 1991, Science 254:1802-1805; van Beusechem. et al., 1992, Proc. Nad. Acad. Sci. USA 89:7640-19; Kay et al., 1992, Human Gene Therapy 3:641-647; Dai et al., 1992, Proc. Natl. Acad. Sci. USA 89:10892-10895; Hwu et al., 1993, J. Immunol. 150:4104-4115; U.S. Pat. No. 4,868,116; U.S. Pat. No. 4,980,286; PCT Application WO 89/07136; PCT Application WO 89/02468; PCT Application WO 89/05345; and PCT Application WO 92/07573). Recombinant retroviral vectors capable of transducing and expressing genes inserted into the genome of a cell can be produced by transfecting the recombinant retroviral genome into suitable packaging cell lines such as PA317 and Psi-CRIP (Comette et al., 1991, Human Gene Therapy 2:5-10; Cone et al., 1984, Proc. Natl. Acad. Sci. USA 81:6349). Recombinant adenoviral vectors can be used to infect a wide variety of cells and tissues in susceptible hosts (e.g., rat, hamster, dog, and chimpanzee) (Hsu et al., 1992, J. Infectious Disease, 166:769), and also have the advantage of not requiring mitotically active cells for infection.

[0226]The promoter driving dsRNA expression in either a DNA plasmid or viral vector of the invention may be a eukaryotic RNA polymerase I (e.g. ribosomal RNA promoter), RNA polymerase II (e.g. CMV early promoter or actin promoter or Ul snRNA promoter) or generally RNA polymerase III promoter (e.g. U6 snRNA or 7SK RNA promoter) or a prokaryotic promoter, for example the T7 promoter, provided the expression plasmid also encodes T7 RNA polymerase required for transcription from a T7 promoter. The promoter can also direct transgene expression to the pancreas (see, e.g. the insulin regulatory sequence for pancreas (Bucchini et al., 1986, Proc. Natl. Acad. Sci. USA 83:2511-2515)).

[0227]In addition, expression of the transgene can be precisely regulated, for example, by using an inducible regulatory sequence and expression systems such as a regulatory sequence that is sensitive to certain physiological regulators, e.g., circulating glucose levels, or hormones (Docherty et al., 1994, FASEB J. 8:20-24). Such inducible expression systems, suitable for the control of transgene expression in cells or in mammals include regulation by ecdysone, by estrogen, progesterone, tetracycline, chemical inducers of dimerization, and isopropyl-beta-D1-thiogalactopyranoside (EPTG). A person skilled in the art would be able to choose the appropriate regulatory/promoter sequence based on the intended use of the dsRNA transgene.

[0228]Generally, recombinant vectors capable of expressing dsRNA molecules are delivered as described below, and persist in target cells. Alternatively, viral vectors can be used that provide for transient expression of dsRNA molecules. Such vectors can be repeatedly administered as necessary. Once expressed, the dsRNAs bind to target RNA and modulate its function or expression. Delivery of dsRNA expressing vectors can be systemic, such as by intravenous or intramuscular administration, by administration to target cells ex-planted from the patient followed by reintroduction into the patient, or by any other means that allows for introduction into a desired target cell.

[0229]dsRNA expression DNA plasmids are typically transfected into target cells as a complex with cationic lipid carriers (e.g. Oligofectamine) or non-cationic lipid-based carriers (e.g. Transit-TKO®). Multiple lipid transfections for dsRNA-mediated knockdowns targeting different regions of a single Eg5 gene or multiple Eg5 genes over a period of a week or more are also contemplated by the invention. Successful introduction of the vectors of the invention into host cells can be monitored using various known methods. For example, transient transfection. can be signaled with a reporter, such as a fluorescent marker, such as Green Fluorescent Protein (GFP). Stable transfection of ex vivo cells can be ensured using markers that provide the transfected cell with resistance to specific environmental factors (e.g., antibiotics and drugs), such as hygromycin B resistance.

[0230]The Eg5 specific dsRNA molecules can also be inserted into vectors and used as gene therapy vectors for human patients. Gene therapy vectors can be delivered to a subject by, for example, intravenous injection, local administration (see U.S. Pat. No. 5,328,470) or by stereotactic injection (see e.g., Chen et al. (1994) Proc. Natl. Acad. Sci. USA 91:3054-3057). The pharmaceutical preparation of the gene therapy vector can include the gene therapy vector in an acceptable diluent, or can comprise a slow release matrix in which the gene delivery vehicle is imbedded. Alternatively, where the complete gene delivery vector can be produced intact from recombinant cells, e.g., retroviral vectors, the pharmaceutical preparation can include one or more cells which produce the gene delivery system.

Eg5 siRNA In Vitro Screening Via Cell Proliferation

[0231]As silencing of Eg5 has been shown to cause mitotic arrest (Weil, D, et al [2002] Biotechniques 33: 1244-8), a cell viability assay was used for siRNA activity screening. HeLa cells (14000 per well [Screens 1 and 3] or 10000 per well [Screen2])) were seeded in 96-well plates and simultaneously transfected with Lipofectamine 2000 (Invitrogen) at a final siRNA concentration in the well of 30 nM and at final concentrations of 50 nM (1st screen) and 25 nM (2nd screen). A subset of duplexes was tested at 25 nM in a third screen (Table 5).

[0232]Seventy-two hours post-transfection, cell proliferation was assayed the addition of WST-1 reagent (Roche) to the culture medium, and subsequent absorbance measurement at 450 nm. The absorbance value for control (non-transfected) cells was considered 100 percent, and absorbances for the siRNA transfected wells were compared to the control value. Assays were performed in sextuplicate for each of three screens. A subset of the siRNAs was further tested at a range of siRNA concentrations. Assays were performed in HeLa cells (14000 per well; method same as above, Table 5).

TABLE-US-00007 TABLE 5 Relative absorbance at 450 nm Screen I Screen II Screen III Duplex mean sd Mean sd mean Sd AL-DP-6226 20 10 28 11 43 9 AL-DP-6227 66 27 96 41 108 33 AL-DP-6228 56 28 76 22 78 18 AL-DP-6229 17 3 31 9 48 13 AL-DP-6230 48 8 75 11 73 7 AL-DP-6231 8 1 21 4 41 10 AL-DP-6232 16 2 37 7 52 14 AL-DP-6233 31 9 37 6 49 12 AL-DP-6234 103 40 141 29 164 45 AL-DP-6235 107 34 140 27 195 75 AL-DP-6236 48 12 54 12 56 12 AL-DP-6237 73 14 108 18 154 37 AL-DP-6238 64 9 103 10 105 24 AL-DP-6239 9 1 20 4 31 11 AL-DP-6240 99 7 139 16 194 43 AL-DP-6241 43 9 54 12 66 19 AL-DP-6242 6 1 15 7 36 8 AL-DP-6243 7 2 19 5 33 13 AL-DP-6244 7 2 19 3 37 13 AL-DP-6245 25 4 45 10 58 9 AL-DP-6246 34 8 65 10 66 13 AL-DP-6247 53 6 78 14 105 20 AL-DP-6248 7 0 22 7 39 12 AL-DP-6249 36 8 48 13 61 7

[0233]The nine siRNA duplexes that showed the greatest growth inhibition in Table 5 were re-tested at a range of siRNA concentrations in HeLa cells. The siRNA concentrations tested were 100 nM, 33.3 nM, 11.1 nM, 3.70 nM, 1.23 nM, 0.41 nM, 0.14 nM and 0.046 nM. Assays were performed in sextuplicate, and the concentration of each siRNA resulting in fifty percent inhibition of cell proliferation (IC50) was calculated. This dose-response analysis was performed between two and four times for each duplex. Mean IC50 values (nM) are given in Table 6.

TABLE-US-00008 TABLE 6 Duplex Mean IC50 AL-DP-6226 15.5 AL-DP-6229 3.4 AL-DP-6231 4.2 AL-DP-6232 17.5 AL-DP-6239 4.4 AL-DP-6242 5.2 AL-DP-6243 2.6 AL-DP-6244 8.3 AL-DP-6248 1.9

[0234]Eg5 siRNA In Vitro Screening Via Cell Proliferation

[0235]Directly before transfection, Hela S3 (ATCC-Number: CCL-2.2, LCG Promochem GmbH, Wesel, Germany) cells were seeded at 1.5×104 cells/well on 96-well plates (Greiner Bio-One GmbH, Frickenhausen, Germany) in 75 μl of growth medium (Ham's F12, 10% fetal calf serum, 100u penicillin/100 μg/ml streptomycin, all from Biochrom AG, Berlin, Germany). Transfections were performed in quadruplicates. For each well 0.5 μl Lipofectamine2000 (Invitrogen GmbH, Karlsruhe, Germany) were mixed with 12 μl Opti-MEM (Invitrogen) and incubated for 15 min at room temperature. For the siRNA concentration being 50 nM in the 100 μl transfection volume, 1 μl of a 5 μM siRNA were mixed with 11.5 μl Opti-MEM per well, combined with the Lipofectamine2000-Opti-MEM mixture and again incubated for 15 minutes at room temperature. siRNA-Lipofectamine2000-complexes were applied completely (25 μl each per well) to the cells and cells were incubated for 24 h at 37° C. and 5% CO2 in a humidified incubator (Heraeus GmbH, Hanau). The single dose screen was done once at 50 nM and at 25 nM, respectively.

[0236]Cells were harvested by applying 50 μl of lysis mixture (content of the QuantiGene bDNA-kit from Genospectra, Fremont, USA) to each well containing 100 μl of growth medium and were lysed at 53° C. for 30 min. Afterwards, 50 μl of the lysates were incubated with probesets specific to human Eg5 and human GAPDH and proceeded according to the manufacturer's protocol for QuantiGene. In the end chemoluminescence was measured in a Victor2-Light (Perkin Elmer, Wiesbaden, Germany) as RLUs (relative light units) and values obtained with the hEg5 probeset were normalized to the respective GAPDH values for each well. Values obtained with siRNAs directed against Eg5 were related to the value obtained with an unspecific siRNA (directed against HCV) which was set to 100% (Tables 1, 2 and 3).

[0237]Effective siRNAs from the screen were further characterized by dose response curves. Transfections of dose response curves were performed at the following concentrations: 100 nM, 16.7 nM, 2.8 nM, 0.46 nM, 77 picoM, 12.8 picoM, 2.1 picoM, 0.35 picoM, 59.5 fM, 9.9 fM and mock (no siRNA) and diluted with Opti-MEM to a final concentration of 12.5 μl according to the above protocol. Data analysis was performed by using the Microsoft Excel add-in software XL-fit 4.2 (IDBS, Guildford, Surrey, UK) and applying the dose response model number 205 (Tables 1, 2 and 3).

[0238]The lead siRNA AD12115 was additionally analyzed by applying the WST-proliferation assay from Roche (as previously described).

[0239]A subset of 34 duplexes from Table 2 that showed greatest activity was assayed by transfection in HeLa cells at final concentrations ranging from 100 nM to 10 fM. Transfections were performed in quadruplicate. Two dose-response assays were performed for each duplex. The concentration giving 20% (IC20), 50% (IC50) and 80% (IC80) reduction of KSP mRNA was calculated for each duplex. (Table 7).

TABLE-US-00009 TABLE 7 Concentrations given in pM IC20s IC50s IC80s Duplex 1st 2nd 1st 2nd 1st 2nd name screen screen screen screen screen screen AD12077 1.19 0.80 6.14 10.16 38.63 76.16 AD12078 25.43 25.43 156.18 156.18 ND ND AD12085 9.08 1.24 40.57 8.52 257.68 81.26 AD12095 1.03 0.97 9.84 4.94 90.31 60.47 AD12113 4.00 5.94 17.18 28.14 490.83 441.30 AD12115 0.60 0.41 3.79 3.39 23.45 23.45 AD12125 31.21 22.02 184.28 166.15 896.85 1008.11 AD12134 2.59 5.51 17.87 22.00 116.36 107.03 AD12149 0.72 0.50 4.51 3.91 30.29 40.89 AD12151 0.53 6.84 4.27 10.72 22.88 43.01 AD12152 155.45 7.56 867.36 66.69 13165.27 ND AD12157 0.30 26.23 14.60 92.08 14399.22 693.31 AD12166 0.20 0.93 3.71 3.86 46.28 20.59 AD12180 28.85 28.85 101.06 101.06 847.21 847.21 AD12185 2.60 0.42 15.55 13.91 109.80 120.63 AD12194 2.08 1.11 5.37 5.09 53.03 30.92 AD12211 5.27 4.52 11.73 18.93 26.74 191.07 AD12257 4.56 5.20 21.68 22.75 124.69 135.82 AD12280 2.37 4.53 6.89 20.23 64.80 104.82 AD12281 8.81 8.65 19.68 42.89 119.01 356.08 AD12282 7.71 456.42 20.09 558.00 ND ND AD12285 ND 1.28 57.30 7.31 261.79 42.53 AD12292 40.23 12.00 929.11 109.10 ND ND AD12252 0.02 18.63 6.35 68.24 138.09 404.91 AD12275 25.76 25.04 123.89 133.10 1054.54 776.25 AD12266 4.85 7.80 10.00 32.94 41.67 162.65 AD12267 1.39 1.21 12.00 4.67 283.03 51.12 AD12264 0.92 2.07 8.56 15.12 56.36 196.78 AD12268 2.29 3.67 22.16 25.64 258.27 150.84 AD12279 1.11 28.54 23.19 96.87 327.28 607.27 AD12256 7.20 33.52 46.49 138.04 775.54 1076.76 AD12259 2.16 8.31 8.96 40.12 50.05 219.42 AD12276 19.49 6.14 89.60 59.60 672.51 736.72 AD12321 4.67 4.91 24.88 19.43 139.50 89.49 (ND--not determined)

Silencing of Liver Eg5/KSP in Juvenile Rats Following Single-Bolus Administration of LNP01 Formulated siRNA

[0240]From birth until approximately 23 days of age, Eg5/KSP expression can be detected in the growing rat liver. Target silencing with a formulated Eg5/KSP siRNA was evaluated in juvenile rats.

[0241]KSP Duplex Tested

TABLE-US-00010 !Duplex ID? Target? Sense? Antisense AD6248 Eg5/KSP AccGAAGuGuuGuuuGuccTsT GGAcAAAcAAcACUUCGGUTsT (SEQ ID NO: 1238) (SEQ ID NO: 1239)

[0242]Methods

[0243]Dosing of animals. Male, juvenile Sprague-Dawley rats (19 days old) were administered single doses of lipidoid ("LNP01") formulated siRNA via tail vein injection. Groups of ten animals received doses of 10 milligrams per kilogram (mg/kg) bodyweight of either AD6248 or an unspecific siRNA. Dose level refers to the amount of siRNA duplex administered in the formulation. A third group received phosphate-buffered saline. Animals were sacrificed two days after siRNA administration. Livers were dissected, flash frozen in liquid Nitrogen and pulverized into powders.

[0244]mRNA measurements. Levels of Eg5/KSP mRNA were measured in livers from all treatment groups. Samples of each liver powder (approximately ten milligrams) were homogenized in tissue lysis buffer containing proteinase K. Levels of Eg5/KSP and GAPDH mRNA were measured in triplicate for each sample using the Quantigene branched DNA assay (GenoSpectra). Mean values for Eg5/KSP were normalized to mean GAPDH values for each sample. Group means were determined and normalized to the PBS group for each experiment.

[0245]Statistical analysis. Significance was determined by ANOVA followed by the Tukey post-hoc test

[0246]Results

[0247]Data Summary

[0248]Mean values (±standard deviation) for Eg5/KSP mRNA are given. Statistical significance (p value) versus the PBS group is shown (ns, not significant [p>0.05]).

[0249]Experiment 1

TABLE-US-00011 VEGF/GAPDH p value PBS 1.0 ± 0.47 AD6248 10 mg/kg 0.47 ± 0.12 <0.001 unspec 10 mg/kg 1.0 ± 0.26 ns

[0250]A statistically significant reduction in liver Eg5/KSP mRNA was obtained following treatment with formulated AD6248 at a dose of 10 mg/kg.

Silencing of Rat Liver VEGF Following Intravenous Infusion of LNP01 Formulated siRNA Duplexes

[0251]A "lipidoid" formulation comprising an equimolar mixture of two siRNAs was administered to rats. One siRNA (AD3133) was directed towards VEGF. The other (AD12115) was directed towards Eg5/KSP. Since Eg5/KSP expression is nearly undetectable in the adult rat liver, only VEGF levels were measured following siRNA treatment.

[0252]siRNA Duplexes Administered

TABLE-US-00012 Duplex ID Target Sense Antisense AD12115 Eg5/KSP ucGAGAAucuAAAcuAAcuTsT AGUuAGUUuAGAUUCUCGATsT (SEQ ID NO: 1240) (SEQ ID NO: 1241) AD3133 VEGF GcAcAuAGGAGAGAuGAGCUsU AAGCUcAUCUCUCCuAuGuGCusG (SEQ ID NO: 1242) (SEQ ID NO: 1243) Key: A,G,C,U-ribonucleotides; c,u-2'-O-Me ribonucleotides; s-phorphorothioate.

[0253]Methods

[0254]Dosing of animals. Adult, female Sprague-Dawley rats were administered lipidoid ("LNP01") formulated siRNA by a two-hour infusion into the femoral vein. Groups of four animals received doses of 5, 10 and 15 milligrams per kilogram (mg/kg) bodyweight of formulated siRNA. Dose level refers to the total amount of siRNA duplex administered in the formulation. A fourth group received phosphate-buffered saline. Animals were sacrificed 72 hours after the end of the siRNA infusion. Livers were dissected, flash frozen in liquid Nitrogen and pulverized into powders.

[0255]Formulation Procedure The lipidoid ND98.4HCl (MW 1487) (Formula 1), Cholesterol (Sigma-Aldrich), and PEG-Ceramide C16 (Avanti Polar Lipids) were used to prepare lipid-siRNA nanoparticles. Stock solutions of each in ethanol were prepared: ND98, 133 mg/mL; Cholesterol, 25 mg/mL, PEG-Ceramide C16, 100 mg/mL. ND98, Cholesterol, and PEG-Ceramide C16 stock solutions were then combined in a 42:48:10 molar ratio. Combined lipid solution was mixed rapidly with aqueous siRNA (in sodium acetate pH 5) such that the final ethanol concentration was 35-45% and the final sodium acetate concentration was 100-300 mM. Lipid-siRNA nanoparticles formed spontaneously upon mixing. Depending on the desired particle size distribution, the resultant nanoparticle mixture was in some cases extruded through a polycarbonate membrane (100 nm cut-off) using a thermobarrel extruder (Lipex Extruder, Northern Lipids, Inc). In other cases, the extrusion step was omitted. Ethanol removal and simultaneous buffer exchange was accomplished by either dialysis or tangential flow filtration. Buffer was exchanged to phosphate buffered saline (PBS) pH 7.2.

##STR00010##

[0256]Characterization of formulations Formulations prepared by either the standard or extrusion-free method are characterized in a similar manner. Formulations are first characterized by visual inspection. They should be whitish translucent solutions free from aggregates or sediment. Particle size and particle size distribution of lipid-nanoparticles are measured by dynamic light scattering using a Malvern Zetasizer Nano ZS (Malvern, USA). Particles should be 20-300 nm, and ideally, 40-100 nm in size. The particle size distribution should be unimodal. The total siRNA concentration in the formulation, as well as the entrapped fraction, is estimated using a dye exclusion assay. A sample of the formulated siRNA is incubated with the RNA-binding dye Ribogreen (Molecular Probes) in the presence or absence of a formulation disrupting surfactant, 0.5% Triton-X100. The total siRNA in the formulation is determined by the signal from the sample containing the surfactant, relative to a standard curve. The entrapped fraction is determined by subtracting the "free" siRNA content (as measured by the signal in the absence of surfactant) from the total siRNA content. Percent entrapped siRNA is typically >85%.

[0257]mRNA measurements. Samples of each liver powder (approximately ten milligrams) were homogenized in tissue lysis buffer containing proteinase K. Levels of VEGF and GAPDH mRNA were measured in triplicate for each sample using the Quantigene branched DNA assay (GenoSpectra). Mean values for VEGF were normalized to mean GAPDH values for each sample. Group means were determined and normalized to the PBS group for each experiment.

[0258]Protein measurements. Samples of each liver powder (approximately 60 milligrams) were homogenized in 1 ml RIPA buffer. Total protein concentrations were determined using the Micro BCA protein assay kit (Pierce). Samples of total protein from each animal was used to determine VEGF protein levels using a VEGF ELISA assay (R&D systems). Group means were determined and normalized to the PBS group for each experiment.

[0259]Statistical analysis. Significance was determined by ANOVA followed by the Tukey post-hoc test

[0260]Results

[0261]Data Summary

[0262]Mean values (±standard deviation) for mRNA (VEGF/GAPDH) and protein (rel. VEGF) are shown for each treatment group. Statistical significance (p value) versus the PBS group for each experiment is shown.

TABLE-US-00013 VEGF/GAPDH p value rel VEGF p value PBS 1.0 ± 0.17 1.0 ± 0.17 5 mg/kg 0.74 ± 0.12 <0.05 0.23 ± 0.03 <0.001 10 mg/kg 0.65 ± 0.12 <0.005 0.22 ± 0.03 <0.001 15 mg/kg 0.49 ± 0.17 <0.001 0.20 ± 0.04 <0.001

[0263]Statistically significant reductions in liver VEGF mRNA and protein were measured at all three siRNA dose levels.

Sequence CWU 1 SEQUENCE LISTING <160> NUMBER OF SEQ ID NOS: 1533 <210> SEQ ID NO 1 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1 cgaaguguug uuuguccaat t 21 <210> SEQ ID NO 2 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 2 uuggacaaac aacacuucgt t 21 <210> SEQ ID NO 3 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 3 ugguguuugg agcaucuact t 21 <210> SEQ ID NO 4 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 4 guagaugcuc caaacaccat t 21 <210> SEQ ID NO 5 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 5 ucuaaacuaa cuagaaucct t 21 <210> SEQ ID NO 6 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 6 ggauucuagu uaguuuagat t 21 <210> SEQ ID NO 7 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 7 cuuaucgaga aucuaaacut t 21 <210> SEQ ID NO 8 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 8 aguuuagauu cucgauaagt t 21 <210> SEQ ID NO 9 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 9 uugauguuua ccgaagugut t 21 <210> SEQ ID NO 10 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 10 acacuucggu aaacaucaat t 21 <210> SEQ ID NO 11 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 11 gugagaugca gaccauuuat t 21 <210> SEQ ID NO 12 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 12 uaaauggucu gcaucucact t 21 <210> SEQ ID NO 13 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 13 ucugaguaca uuggaauaut t 21 <210> SEQ ID NO 14 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 14 auauuccaau guacucagat t 21 <210> SEQ ID NO 15 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 15 gaaguguugu uuguccaaut t 21 <210> SEQ ID NO 16 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 16 auuggacaaa caacacuuct t 21 <210> SEQ ID NO 17 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 17 uuauuauggg cuauaauugt t 21 <210> SEQ ID NO 18 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 18 caauuauagc ccauaauaat t 21 <210> SEQ ID NO 19 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 19 aaggugaaag gucaccuaat t 21 <210> SEQ ID NO 20 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 20 uuaggugacc uuucaccuut t 21 <210> SEQ ID NO 21 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 21 uuacaaugga aggugaaagt t 21 <210> SEQ ID NO 22 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 22 cuuucaccuu ccauuguaat t 21 <210> SEQ ID NO 23 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 23 aggugaaagg ucaccuaaut t 21 <210> SEQ ID NO 24 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 24 auuaggugac cuuucaccut t 21 <210> SEQ ID NO 25 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 25 ggugaaaggu caccuaaugt t 21 <210> SEQ ID NO 26 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 26 cauuagguga ccuuucacct t 21 <210> SEQ ID NO 27 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 27 ccuuaucgag aaucuaaact t 21 <210> SEQ ID NO 28 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 28 guuuagauuc ucgauaaggt t 21 <210> SEQ ID NO 29 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 29 cucuuauuaa ggaguauact t 21 <210> SEQ ID NO 30 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 30 guauacuccu uaauaagagt t 21 <210> SEQ ID NO 31 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 31 gagagauucu gugcuuuggt t 21 <210> SEQ ID NO 32 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 32 ccaaagcaca gaaucucuct t 21 <210> SEQ ID NO 33 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 33 aucuaaacua acuagaauct t 21 <210> SEQ ID NO 34 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 34 gauucuaguu aguuuagaut t 21 <210> SEQ ID NO 35 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 35 ucaccaaaaa agcucuuaut t 21 <210> SEQ ID NO 36 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 36 auaagagcuu uuuuggugat t 21 <210> SEQ ID NO 37 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 37 gagcuuuuug aucuucuuat t 21 <210> SEQ ID NO 38 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 38 uaagaagauc aaaaagcuct t 21 <210> SEQ ID NO 39 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 39 cguacaagaa caucuauaat t 21 <210> SEQ ID NO 40 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 40 uuauagaugu ucuuguacgt t 21 <210> SEQ ID NO 41 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 41 auugauguuu accgaagugt t 21 <210> SEQ ID NO 42 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 42 cacuucggua aacaucaaut t 21 <210> SEQ ID NO 43 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 43 cuaaacuaac uagaauccut t 21 <210> SEQ ID NO 44 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 44 aggauucuag uuaguuuagt t 21 <210> SEQ ID NO 45 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 45 accgaagugu uguuugucct t 21 <210> SEQ ID NO 46 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 46 ggacaaacaa cacuucggut t 21 <210> SEQ ID NO 47 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 47 ugguggugag augcagacct t 21 <210> SEQ ID NO 48 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 48 ggucugcauc ucaccaccat t 21 <210> SEQ ID NO 49 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 49 cauacucuag ucguucccat t 21 <210> SEQ ID NO 50 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 50 ugggaacgac uagaguaugt t 21 <210> SEQ ID NO 51 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 51 agcgcccauu caauaguagt t 21 <210> SEQ ID NO 52 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 52 cuacuauuga augggcgcut t 21 <210> SEQ ID NO 53 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 53 ggaaagcuag cgcccauuct t 21 <210> SEQ ID NO 54 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 54 gaaugggcgc uagcuuucct t 21 <210> SEQ ID NO 55 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 55 gaaagcuagc gcccauucat t 21 <210> SEQ ID NO 56 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 56 ugaaugggcg cuagcuuuct t 21 <210> SEQ ID NO 57 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 57 agaaacuacg auugauggat t 21 <210> SEQ ID NO 58 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 58 uccaucaauc guaguuucut t 21 <210> SEQ ID NO 59 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 59 uguuccuuau cgagaaucut t 21 <210> SEQ ID NO 60 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 60 agauucucga uaaggaacat t 21 <210> SEQ ID NO 61 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 61 cagauuaccu cugcgagcct t 21 <210> SEQ ID NO 62 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 62 ggcucgcaga gguaaucugt t 21 <210> SEQ ID NO 63 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 63 gcgcccauuc aauaguagat t 21 <210> SEQ ID NO 64 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 64 ucuacuauug aaugggcgct t 21 <210> SEQ ID NO 65 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 65 uugcacuauc uuugcguaut t 21 <210> SEQ ID NO 66 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 66 auacgcaaag auagugcaat t 21 <210> SEQ ID NO 67 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 67 cagagcggaa agcuagcgct t 21 <210> SEQ ID NO 68 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 68 gcgcuagcuu uccgcucugt t 21 <210> SEQ ID NO 69 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 69 agaccuuauu ugguaaucut t 21 <210> SEQ ID NO 70 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 70 agauuaccaa auaaggucut t 21 <210> SEQ ID NO 71 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 71 auucucuugg agggcguact t 21 <210> SEQ ID NO 72 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 72 guacgcccuc caagagaaut t 21 <210> SEQ ID NO 73 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 73 ggcugguaua auuccacgut t 21 <210> SEQ ID NO 74 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 74 acguggaauu auaccagcct t 21 <210> SEQ ID NO 75 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 75 gcggaaagcu agcgcccaut t 21 <210> SEQ ID NO 76 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 76 augggcgcua gcuuuccgct t 21 <210> SEQ ID NO 77 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 77 ugcacuaucu uugcguaugt t 21 <210> SEQ ID NO 78 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 78 cauacgcaaa gauagugcat t 21 <210> SEQ ID NO 79 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 79 guauaauucc acguacccut t 21 <210> SEQ ID NO 80 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 80 aggguacgug gaauuauact t 21 <210> SEQ ID NO 81 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 81 agaaucuaaa cuaacuagat t 21 <210> SEQ ID NO 82 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 82 ucuaguuagu uuagauucut t 21 <210> SEQ ID NO 83 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 83 aggagcugaa uaggguuact t 21 <210> SEQ ID NO 84 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 84 guaacccuau ucagcuccut t 21 <210> SEQ ID NO 85 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 85 gaaguacaua agaccuuaut t 21 <210> SEQ ID NO 86 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 86 auaaggucuu auguacuuct t 21 <210> SEQ ID NO 87 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 87 gacaguggcc gauaagauat t 21 <210> SEQ ID NO 88 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 88 uaucuuaucg gccacuguct t 21 <210> SEQ ID NO 89 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 89 aaaccacuua guagugucct t 21 <210> SEQ ID NO 90 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 90 ggacacuacu aagugguuut t 21 <210> SEQ ID NO 91 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 91 ucccuagacu ucccuauuut t 21 <210> SEQ ID NO 92 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 92 aaauagggaa gucuagggat t 21 <210> SEQ ID NO 93 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 93 uagacuuccc uauuucgcut t 21 <210> SEQ ID NO 94 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 94 agcgaaauag ggaagucuat t 21 <210> SEQ ID NO 95 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 95 gcgucgcagc caaauucgut t 21 <210> SEQ ID NO 96 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 96 acgaauuugg cugcgacgct t 21 <210> SEQ ID NO 97 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 97 agcuagcgcc cauucaauat t 21 <210> SEQ ID NO 98 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 98 uauugaaugg gcgcuagcut t 21 <210> SEQ ID NO 99 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 99 gaaacuacga uugauggagt t 21 <210> SEQ ID NO 100 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 100 cuccaucaau cguaguuuct t 21 <210> SEQ ID NO 101 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 101 ccgauaagau agaagaucat t 21 <210> SEQ ID NO 102 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 102 ugaucuucua ucuuaucggt t 21 <210> SEQ ID NO 103 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 103 uagcgcccau ucaauaguat t 21 <210> SEQ ID NO 104 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 104 uacuauugaa ugggcgcuat t 21 <210> SEQ ID NO 105 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 105 uuugcguaug gccaaacugt t 21 <210> SEQ ID NO 106 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 106 caguuuggcc auacgcaaat t 21 <210> SEQ ID NO 107 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 107 cacguacccu ucaucaaaut t 21 <210> SEQ ID NO 108 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 108 auuugaugaa ggguacgugt t 21 <210> SEQ ID NO 109 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 109 ucuuugcgua uggccaaact t 21 <210> SEQ ID NO 110 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 110 guuuggccau acgcaaagat t 21 <210> SEQ ID NO 111 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 111 ccgaaguguu guuuguccat t 21 <210> SEQ ID NO 112 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 112 uggacaaaca acacuucggt t 21 <210> SEQ ID NO 113 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 113 agagcggaaa gcuagcgcct t 21 <210> SEQ ID NO 114 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 114 ggcgcuagcu uuccgcucut t 21 <210> SEQ ID NO 115 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 115 gcuagcgccc auucaauagt t 21 <210> SEQ ID NO 116 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 116 cuauugaaug ggcgcuagct t 21 <210> SEQ ID NO 117 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 117 aaguuagugu acgaacuggt t 21 <210> SEQ ID NO 118 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 118 ccaguucgua cacuaacuut t 21 <210> SEQ ID NO 119 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 119 guacgaacug gaggauuggt t 21 <210> SEQ ID NO 120 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 120 ccaauccucc aguucguact t 21 <210> SEQ ID NO 121 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 121 acgaacugga ggauuggcut t 21 <210> SEQ ID NO 122 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 122 agccaauccu ccaguucgut t 21 <210> SEQ ID NO 123 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 123 agauugaugu uuaccgaagt t 21 <210> SEQ ID NO 124 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 124 cuucgguaaa caucaaucut t 21 <210> SEQ ID NO 125 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 125 uaugggcuau aauugcacut t 21 <210> SEQ ID NO 126 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 126 agugcaauua uagcccauat t 21 <210> SEQ ID NO 127 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 127 aucuuugcgu auggccaaat t 21 <210> SEQ ID NO 128 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 128 uuuggccaua cgcaaagaut t 21 <210> SEQ ID NO 129 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 129 acucuagucg uucccacuct t 21 <210> SEQ ID NO 130 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 130 gagugggaac gacuagagut t 21 <210> SEQ ID NO 131 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 131 aacuacgauu gauggagaat t 21 <210> SEQ ID NO 132 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 132 uucuccauca aucguaguut t 21 <210> SEQ ID NO 133 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 133 gauaagagag cucgggaagt t 21 <210> SEQ ID NO 134 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 134 cuucccgagc ucucuuauct t 21 <210> SEQ ID NO 135 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 135 ucgagaaucu aaacuaacut t 21 <210> SEQ ID NO 136 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 136 aguuaguuua gauucucgat t 21 <210> SEQ ID NO 137 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 137 aacuaacuag aauccuccat t 21 <210> SEQ ID NO 138 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 138 uggaggauuc uaguuaguut t 21 <210> SEQ ID NO 139 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 139 ggaucguaag aaggcaguut t 21 <210> SEQ ID NO 140 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 140 aacugccuuc uuacgaucct t 21 <210> SEQ ID NO 141 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 141 aucguaagaa ggcaguugat t 21 <210> SEQ ID NO 142 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 142 ucaacugccu ucuuacgaut t 21 <210> SEQ ID NO 143 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 143 aggcaguuga ccaacacaat t 21 <210> SEQ ID NO 144 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 144 uuguguuggu caacugccut t 21 <210> SEQ ID NO 145 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 145 uggccgauaa gauagaagat t 21 <210> SEQ ID NO 146 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 146 ucuucuaucu uaucggccat t 21 <210> SEQ ID NO 147 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 147 ucuaaggaua uagucaacat t 21 <210> SEQ ID NO 148 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 148 uguugacuau auccuuagat t 21 <210> SEQ ID NO 149 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 149 acuaagcuua auugcuuuct t 21 <210> SEQ ID NO 150 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 150 gaaagcaauu aagcuuagut t 21 <210> SEQ ID NO 151 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 151 gcccagauca accuuuaaut t 21 <210> SEQ ID NO 152 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 152 auuaaagguu gaucugggct t 21 <210> SEQ ID NO 153 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 153 uuaauuuggc agagcggaat t 21 <210> SEQ ID NO 154 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 154 uuccgcucug ccaaauuaat t 21 <210> SEQ ID NO 155 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 155 uuaucgagaa ucuaaacuat t 21 <210> SEQ ID NO 156 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 156 uaguuuagau ucucgauaat t 21 <210> SEQ ID NO 157 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 157 cuagcgccca uucaauagut t 21 <210> SEQ ID NO 158 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 158 acuauugaau gggcgcuagt t 21 <210> SEQ ID NO 159 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 159 aauaguagaa ugugauccut t 21 <210> SEQ ID NO 160 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 160 aggaucacau ucuacuauut t 21 <210> SEQ ID NO 161 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 161 uacgaaaaga aguuagugut t 21 <210> SEQ ID NO 162 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 162 acacuaacuu cuuuucguat t 21 <210> SEQ ID NO 163 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 163 agaaguuagu guacgaacut t 21 <210> SEQ ID NO 164 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 164 aguucguaca cuaacuucut t 21 <210> SEQ ID NO 165 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 165 acuaaacaga uugauguuut t 21 <210> SEQ ID NO 166 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 166 aaacaucaau cuguuuagut t 21 <210> SEQ ID NO 167 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 167 cuuugcguau ggccaaacut t 21 <210> SEQ ID NO 168 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 168 aguuuggcca uacgcaaagt t 21 <210> SEQ ID NO 169 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 169 aaugaagagu auaccugggt t 21 <210> SEQ ID NO 170 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 170 cccagguaua cucuucauut t 21 <210> SEQ ID NO 171 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 171 auaauuccac guacccuuct t 21 <210> SEQ ID NO 172 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 172 gaaggguacg uggaauuaut t 21 <210> SEQ ID NO 173 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 173 acguacccuu caucaaauut t 21 <210> SEQ ID NO 174 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 174 aauuugauga aggguacgut t 21 <210> SEQ ID NO 175 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 175 cguacccuuc aucaaauuut t 21 <210> SEQ ID NO 176 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 176 aaauuugaug aaggguacgt t 21 <210> SEQ ID NO 177 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 177 guacccuuca ucaaauuuut t 21 <210> SEQ ID NO 178 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 178 aaaauuugau gaaggguact t 21 <210> SEQ ID NO 179 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 179 aacuuacuga uaaugguact t 21 <210> SEQ ID NO 180 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 180 guaccauuau caguaaguut t 21 <210> SEQ ID NO 181 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 181 uucagucaaa gugucucugt t 21 <210> SEQ ID NO 182 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 182 cagagacacu uugacugaat t 21 <210> SEQ ID NO 183 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 183 uucuuaaucc aucaucugat t 21 <210> SEQ ID NO 184 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 184 ucagaugaug gauuaagaat t 21 <210> SEQ ID NO 185 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 185 acaguacaca acaaggaugt t 21 <210> SEQ ID NO 186 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 186 cauccuuguu guguacugut t 21 <210> SEQ ID NO 187 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 187 aagaaacuac gauugauggt t 21 <210> SEQ ID NO 188 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 188 ccaucaaucg uaguuucuut t 21 <210> SEQ ID NO 189 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 189 aaacuacgau ugauggagat t 21 <210> SEQ ID NO 190 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 190 ucuccaucaa ucguaguuut t 21 <210> SEQ ID NO 191 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 191 uggagcuguu gauaagagat t 21 <210> SEQ ID NO 192 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 192 ucucuuauca acagcuccat t 21 <210> SEQ ID NO 193 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 193 cuaacuagaa uccuccaggt t 21 <210> SEQ ID NO 194 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 194 ccuggaggau ucuaguuagt t 21 <210> SEQ ID NO 195 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 195 gaauaugcuc auagagcaat t 21 <210> SEQ ID NO 196 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 196 uugcucuaug agcauauuct t 21 <210> SEQ ID NO 197 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 197 augcucauag agcaaagaat t 21 <210> SEQ ID NO 198 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 198 uucuuugcuc uaugagcaut t 21 <210> SEQ ID NO 199 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 199 aaaaauuggu gcuguugagt t 21 <210> SEQ ID NO 200 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 200 cucaacagca ccaauuuuut t 21 <210> SEQ ID NO 201 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 201 gaggagcuga auaggguuat t 21 <210> SEQ ID NO 202 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 202 uaacccuauu cagcuccuct t 21 <210> SEQ ID NO 203 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 203 ggagcugaau aggguuacat t 21 <210> SEQ ID NO 204 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 204 uguaacccua uucagcucct t 21 <210> SEQ ID NO 205 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 205 gagcugaaua ggguuacagt t 21 <210> SEQ ID NO 206 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 206 cuguaacccu auucagcuct t 21 <210> SEQ ID NO 207 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 207 agcugaauag gguuacagat t 21 <210> SEQ ID NO 208 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 208 ucuguaaccc uauucagcut t 21 <210> SEQ ID NO 209 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 209 gcugaauagg guuacagagt t 21 <210> SEQ ID NO 210 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 210 cucuguaacc cuauucagct t 21 <210> SEQ ID NO 211 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 211 ccaaacugga ucguaagaat t 21 <210> SEQ ID NO 212 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 212 uucuuacgau ccaguuuggt t 21 <210> SEQ ID NO 213 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 213 gaucguaaga aggcaguugt t 21 <210> SEQ ID NO 214 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 214 caacugccuu cuuacgauct t 21 <210> SEQ ID NO 215 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 215 accuuauuug guaaucugct t 21 <210> SEQ ID NO 216 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 216 gcagauuacc aaauaaggut t 21 <210> SEQ ID NO 217 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 217 uuagauacca uuacuacagt t 21 <210> SEQ ID NO 218 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 218 cuguaguaau gguaucuaat t 21 <210> SEQ ID NO 219 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 219 auaccauuac uacaguagct t 21 <210> SEQ ID NO 220 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 220 gcuacuguag uaaugguaut t 21 <210> SEQ ID NO 221 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 221 uacuacagua gcacuuggat t 21 <210> SEQ ID NO 222 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 222 uccaagugcu acuguaguat t 21 <210> SEQ ID NO 223 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 223 aaaguaaaac uguacuacat t 21 <210> SEQ ID NO 224 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 224 uguaguacag uuuuacuuut t 21 <210> SEQ ID NO 225 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 225 cucaagacug aucuucuaat t 21 <210> SEQ ID NO 226 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 226 uuagaagauc agucuugagt t 21 <210> SEQ ID NO 227 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 227 uugacagugg ccgauaagat t 21 <210> SEQ ID NO 228 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 228 ucuuaucggc cacugucaat t 21 <210> SEQ ID NO 229 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 229 ugacaguggc cgauaagaut t 21 <210> SEQ ID NO 230 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 230 aucuuaucgg ccacugucat t 21 <210> SEQ ID NO 231 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 231 gcaaugugga aaccuaacut t 21 <210> SEQ ID NO 232 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 232 aguuagguuu ccacauugct t 21 <210> SEQ ID NO 233 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 233 ccacuuagua guguccaggt t 21 <210> SEQ ID NO 234 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 234 ccuggacacu acuaaguggt t 21 <210> SEQ ID NO 235 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 235 agaagguaca aaauugguut t 21 <210> SEQ ID NO 236 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 236 aaccaauuuu guaccuucut t 21 <210> SEQ ID NO 237 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 237 ugguuugacu aagcuuaaut t 21 <210> SEQ ID NO 238 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 238 auuaagcuua gucaaaccat t 21 <210> SEQ ID NO 239 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 239 gguuugacua agcuuaauut t 21 <210> SEQ ID NO 240 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 240 aauuaagcuu agucaaacct t 21 <210> SEQ ID NO 241 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 241 ucuaagucaa gagccaucut t 21 <210> SEQ ID NO 242 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 242 agauggcucu ugacuuagat t 21 <210> SEQ ID NO 243 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 243 ucaucccuau aguucacuut t 21 <210> SEQ ID NO 244 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 244 aagugaacua uagggaugat t 21 <210> SEQ ID NO 245 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 245 caucccuaua guucacuuut t 21 <210> SEQ ID NO 246 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 246 aaagugaacu auagggaugt t 21 <210> SEQ ID NO 247 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 247 cccuagacuu cccuauuuct t 21 <210> SEQ ID NO 248 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 248 gaaauaggga agucuagggt t 21 <210> SEQ ID NO 249 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 249 agacuucccu auuucgcuut t 21 <210> SEQ ID NO 250 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 250 aagcgaaaua gggaagucut t 21 <210> SEQ ID NO 251 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 251 ucaccaaacc auuuguagat t 21 <210> SEQ ID NO 252 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 252 ucuacaaaug guuuggugat t 21 <210> SEQ ID NO 253 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 253 uccuuuaaga ggccuaacut t 21 <210> SEQ ID NO 254 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 254 aguuaggccu cuuaaaggat t 21 <210> SEQ ID NO 255 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 255 uuuaagaggc cuaacucaut t 21 <210> SEQ ID NO 256 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 256 augaguuagg ccucuuaaat t 21 <210> SEQ ID NO 257 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 257 uuaagaggcc uaacucauut t 21 <210> SEQ ID NO 258 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 258 aaugaguuag gccucuuaat t 21 <210> SEQ ID NO 259 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 259 ggccuaacuc auucacccut t 21 <210> SEQ ID NO 260 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 260 agggugaaug aguuaggcct t 21 <210> SEQ ID NO 261 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 261 ugguauuuuu gaucuggcat t 21 <210> SEQ ID NO 262 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 262 ugccagauca aaaauaccat t 21 <210> SEQ ID NO 263 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 263 aguuuagugu guaaaguuut t 21 <210> SEQ ID NO 264 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 264 aaacuuuaca cacuaaacut t 21 <210> SEQ ID NO 265 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 265 gccaaauucg ucugcgaagt t 21 <210> SEQ ID NO 266 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 266 cuucgcagac gaauuuggct t 21 <210> SEQ ID NO 267 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 267 aauucgucug cgaagaagat t 21 <210> SEQ ID NO 268 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 268 ucuucuucgc agacgaauut t 21 <210> SEQ ID NO 269 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 269 ugaaagguca ccuaaugaat t 21 <210> SEQ ID NO 270 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 270 uucauuaggu gaccuuucat t 21 <210> SEQ ID NO 271 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 271 cagaccauuu aauuuggcat t 21 <210> SEQ ID NO 272 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 272 ugccaaauua aauggucugt t 21 <210> SEQ ID NO 273 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 273 agaccauuua auuuggcagt t 21 <210> SEQ ID NO 274 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 274 cugccaaauu aaauggucut t 21 <210> SEQ ID NO 275 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 275 aguuauuaug ggcuauaaut t 21 <210> SEQ ID NO 276 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 276 auuauagccc auaauaacut t 21 <210> SEQ ID NO 277 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 277 gcugguauaa uuccacguat t 21 <210> SEQ ID NO 278 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 278 uacguggaau uauaccagct t 21 <210> SEQ ID NO 279 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 279 auuuaauuug gcagagcggt t 21 <210> SEQ ID NO 280 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 280 ccgcucugcc aaauuaaaut t 21 <210> SEQ ID NO 281 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 281 uuuaauuugg cagagcggat t 21 <210> SEQ ID NO 282 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 282 uccgcucugc caaauuaaat t 21 <210> SEQ ID NO 283 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 283 uuuggcagag cggaaagcut t 21 <210> SEQ ID NO 284 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 284 agcuuuccgc ucugccaaat t 21 <210> SEQ ID NO 285 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 285 uuuuacaaug gaaggugaat t 21 <210> SEQ ID NO 286 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 286 uucaccuucc auuguaaaat t 21 <210> SEQ ID NO 287 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 287 aauggaaggu gaaaggucat t 21 <210> SEQ ID NO 288 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 288 ugaccuuuca ccuuccauut t 21 <210> SEQ ID NO 289 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 289 ugagaugcag accauuuaat t 21 <210> SEQ ID NO 290 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 290 uuaaaugguc ugcaucucat t 21 <210> SEQ ID NO 291 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 291 ucgcagccaa auucgucugt t 21 <210> SEQ ID NO 292 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 292 cagacgaauu uggcugcgat t 21 <210> SEQ ID NO 293 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 293 ggcuauaauu gcacuaucut t 21 <210> SEQ ID NO 294 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 294 agauagugca auuauagcct t 21 <210> SEQ ID NO 295 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 295 auugacagug gccgauaagt t 21 <210> SEQ ID NO 296 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 296 cuuaucggcc acugucaaut t 21 <210> SEQ ID NO 297 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 297 cuagacuucc cuauuucgct t 21 <210> SEQ ID NO 298 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 298 gcgaaauagg gaagucuagt t 21 <210> SEQ ID NO 299 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 299 acuaucuuug cguauggcct t 21 <210> SEQ ID NO 300 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 300 ggccauacgc aaagauagut t 21 <210> SEQ ID NO 301 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 301 auacucuagu cguucccact t 21 <210> SEQ ID NO 302 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 302 gugggaacga cuagaguaut t 21 <210> SEQ ID NO 303 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 303 aaagaaacua cgauugaugt t 21 <210> SEQ ID NO 304 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 304 caucaaucgu aguuucuuut t 21 <210> SEQ ID NO 305 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 305 gccuugauuu uuuggcgggt t 21 <210> SEQ ID NO 306 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 306 cccgccaaaa aaucaaggct t 21 <210> SEQ ID NO 307 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 307 cgcccauuca auaguagaat t 21 <210> SEQ ID NO 308 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 308 uucuacuauu gaaugggcgt t 21 <210> SEQ ID NO 309 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 309 ccuuauuugg uaaucugcut t 21 <210> SEQ ID NO 310 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 310 agcagauuac caaauaaggt t 21 <210> SEQ ID NO 311 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 311 agagacaauu ccggaugugt t 21 <210> SEQ ID NO 312 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 312 cacauccgga auugucucut t 21 <210> SEQ ID NO 313 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 313 ugacuuugau agcuaaauut t 21 <210> SEQ ID NO 314 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 314 aauuuagcua ucaaagucat t 21 <210> SEQ ID NO 315 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 315 uggcagagcg gaaagcuagt t 21 <210> SEQ ID NO 316 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 316 cuagcuuucc gcucugccat t 21 <210> SEQ ID NO 317 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 317 gagcggaaag cuagcgccct t 21 <210> SEQ ID NO 318 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 318 gggcgcuagc uuuccgcuct t 21 <210> SEQ ID NO 319 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 319 aaagaaguua guguacgaat t 21 <210> SEQ ID NO 320 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 320 uucguacacu aacuucuuut t 21 <210> SEQ ID NO 321 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 321 auugcacuau cuuugcguat t 21 <210> SEQ ID NO 322 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 322 uacgcaaaga uagugcaaut t 21 <210> SEQ ID NO 323 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 323 gguauaauuc cacguaccct t 21 <210> SEQ ID NO 324 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 324 ggguacgugg aauuauacct t 21 <210> SEQ ID NO 325 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 325 uacucuaguc guucccacut t 21 <210> SEQ ID NO 326 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 326 agugggaacg acuagaguat t 21 <210> SEQ ID NO 327 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 327 uaugaaagaa acuacgauut t 21 <210> SEQ ID NO 328 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 328 aaucguaguu ucuuucauat t 21 <210> SEQ ID NO 329 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 329 augcuagaag uacauaagat t 21 <210> SEQ ID NO 330 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 330 ucuuauguac uucuagcaut t 21 <210> SEQ ID NO 331 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 331 aaguacauaa gaccuuauut t 21 <210> SEQ ID NO 332 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 332 aauaaggucu uauguacuut t 21 <210> SEQ ID NO 333 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 333 acagccugag cuguuaaugt t 21 <210> SEQ ID NO 334 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 334 cauuaacagc ucaggcugut t 21 <210> SEQ ID NO 335 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 335 aaagaagaga caauuccggt t 21 <210> SEQ ID NO 336 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 336 ccggaauugu cucuucuuut t 21 <210> SEQ ID NO 337 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 337 cacacuggag aggucuaaat t 21 <210> SEQ ID NO 338 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 338 uuuagaccuc uccagugugt t 21 <210> SEQ ID NO 339 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 339 cacuggagag gucuaaagut t 21 <210> SEQ ID NO 340 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 340 acuuuagacc ucuccagugt t 21 <210> SEQ ID NO 341 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 341 acuggagagg ucuaaagugt t 21 <210> SEQ ID NO 342 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 342 cacuuuagac cucuccagut t 21 <210> SEQ ID NO 343 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 343 cgucgcagcc aaauucguct t 21 <210> SEQ ID NO 344 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 344 gacgaauuug gcugcgacgt t 21 <210> SEQ ID NO 345 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 345 gaaggcaguu gaccaacact t 21 <210> SEQ ID NO 346 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 346 guguugguca acugccuuct t 21 <210> SEQ ID NO 347 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 347 cauucacccu gacagaguut t 21 <210> SEQ ID NO 348 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 348 aacucuguca gggugaaugt t 21 <210> SEQ ID NO 349 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 349 aagaggccua acucauucat t 21 <210> SEQ ID NO 350 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 350 ugaaugaguu aggccucuut t 21 <210> SEQ ID NO 351 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 351 gagacaauuc cggauguggt t 21 <210> SEQ ID NO 352 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 352 ccacauccgg aauugucuct t 21 <210> SEQ ID NO 353 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 353 uuccggaugu ggauguagat t 21 <210> SEQ ID NO 354 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 354 ucuacaucca cauccggaat t 21 <210> SEQ ID NO 355 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 355 aagcuagcgc ccauucaaut t 21 <210> SEQ ID NO 356 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 356 auugaauggg cgcuagcuut t 21 <210> SEQ ID NO 357 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 357 gaaguuagug uacgaacugt t 21 <210> SEQ ID NO 358 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 358 caguucguac acuaacuuct t 21 <210> SEQ ID NO 359 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 359 uauaauucca cguacccuut t 21 <210> SEQ ID NO 360 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 360 aaggguacgu ggaauuauat t 21 <210> SEQ ID NO 361 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 361 acaguggccg auaagauagt t 21 <210> SEQ ID NO 362 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 362 cuaucuuauc ggccacugut t 21 <210> SEQ ID NO 363 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 363 ucugucaucc cuauaguuct t 21 <210> SEQ ID NO 364 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 364 gaacuauagg gaugacagat t 21 <210> SEQ ID NO 365 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 365 uucuugcuau gacuugugut t 21 <210> SEQ ID NO 366 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 366 acacaaguca uagcaagaat t 21 <210> SEQ ID NO 367 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 367 guaagaaggc aguugaccat t 21 <210> SEQ ID NO 368 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 368 uggucaacug ccuucuuact t 21 <210> SEQ ID NO 369 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 369 cauugacagu ggccgauaat t 21 <210> SEQ ID NO 370 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 370 uuaucggcca cugucaaugt t 21 <210> SEQ ID NO 371 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 371 agaaaccacu uaguagugut t 21 <210> SEQ ID NO 372 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 372 acacuacuaa gugguuucut t 21 <210> SEQ ID NO 373 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 373 ggauuguuca ucaauuggct t 21 <210> SEQ ID NO 374 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 374 gccaauugau gaacaaucct t 21 <210> SEQ ID NO 375 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 375 uaagaggccu aacucauuct t 21 <210> SEQ ID NO 376 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 376 gaaugaguua ggccucuuat t 21 <210> SEQ ID NO 377 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 377 aguuagugua cgaacuggat t 21 <210> SEQ ID NO 378 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 378 uccaguucgu acacuaacut t 21 <210> SEQ ID NO 379 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 379 aguacauaag accuuauuut t 21 <210> SEQ ID NO 380 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 380 aaauaagguc uuauguacut t 21 <210> SEQ ID NO 381 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 381 ugagccuugu guauagauut t 21 <210> SEQ ID NO 382 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 382 aaucuauaca caaggcucat t 21 <210> SEQ ID NO 383 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 383 ccuuuaagag gccuaacuct t 21 <210> SEQ ID NO 384 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 384 gaguuaggcc ucuuaaaggt t 21 <210> SEQ ID NO 385 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 385 accacuuagu aguguccagt t 21 <210> SEQ ID NO 386 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 386 cuggacacua cuaaguggut t 21 <210> SEQ ID NO 387 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 387 gaaacuucca auuaugucut t 21 <210> SEQ ID NO 388 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 388 agacauaauu ggaaguuuct t 21 <210> SEQ ID NO 389 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 389 ugcauacucu agucguucct t 21 <210> SEQ ID NO 390 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 390 ggaacgacua gaguaugcat t 21 <210> SEQ ID NO 391 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 391 agaaggcagu ugaccaacat t 21 <210> SEQ ID NO 392 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 392 uguuggucaa cugccuucut t 21 <210> SEQ ID NO 393 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 393 guacauaaga ccuuauuugt t 21 <210> SEQ ID NO 394 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 394 caaauaaggu cuuauguact t 21 <210> SEQ ID NO 395 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 395 uauaauugca cuaucuuugt t 21 <210> SEQ ID NO 396 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 396 caaagauagu gcaauuauat t 21 <210> SEQ ID NO 397 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 397 ucucuguuac aauacauaut t 21 <210> SEQ ID NO 398 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 398 auauguauug uaacagagat t 21 <210> SEQ ID NO 399 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 399 uaugcucaua gagcaaagat t 21 <210> SEQ ID NO 400 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 400 ucuuugcucu augagcauat t 21 <210> SEQ ID NO 401 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 401 uguuguuugu ccaauucugt t 21 <210> SEQ ID NO 402 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 402 cagaauugga caaacaacat t 21 <210> SEQ ID NO 403 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 403 acuaacuaga auccuccagt t 21 <210> SEQ ID NO 404 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 404 cuggaggauu cuaguuagut t 21 <210> SEQ ID NO 405 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 405 uguggugucu auacugaaat t 21 <210> SEQ ID NO 406 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 406 uuucaguaua gacaccacat t 21 <210> SEQ ID NO 407 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 407 uauuauggga gaccacccat t 21 <210> SEQ ID NO 408 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 408 uggguggucu cccauaauat t 21 <210> SEQ ID NO 409 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 409 aaggaugaag ucuaucaaat t 21 <210> SEQ ID NO 410 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 410 uuugauagac uucauccuut t 21 <210> SEQ ID NO 411 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 411 uugauaagag agcucgggat t 21 <210> SEQ ID NO 412 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 412 ucccgagcuc ucuuaucaat t 21 <210> SEQ ID NO 413 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 413 auguuccuua ucgagaauct t 21 <210> SEQ ID NO 414 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 414 gauucucgau aaggaacaut t 21 <210> SEQ ID NO 415 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 415 ggaauaugcu cauagagcat t 21 <210> SEQ ID NO 416 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 416 ugcucuauga gcauauucct t 21 <210> SEQ ID NO 417 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 417 ccauuccaaa cuggaucgut t 21 <210> SEQ ID NO 418 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 418 acgauccagu uuggaauggt t 21 <210> SEQ ID NO 419 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 419 ggcaguugac caacacaaut t 21 <210> SEQ ID NO 420 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 420 auuguguugg ucaacugcct t 21 <210> SEQ ID NO 421 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 421 caugcuagaa guacauaagt t 21 <210> SEQ ID NO 422 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 422 cuuauguacu ucuagcaugt t 21 <210> SEQ ID NO 423 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 423 cuagaaguac auaagaccut t 21 <210> SEQ ID NO 424 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 424 aggucuuaug uacuucuagt t 21 <210> SEQ ID NO 425 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 425 uuggaucucu cacaucuaut t 21 <210> SEQ ID NO 426 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 426 auagauguga gagauccaat t 21 <210> SEQ ID NO 427 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 427 aacuguggug ucuauacugt t 21 <210> SEQ ID NO 428 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 428 caguauagac accacaguut t 21 <210> SEQ ID NO 429 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 429 ucauugacag uggccgauat t 21 <210> SEQ ID NO 430 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 430 uaucggccac ugucaaugat t 21 <210> SEQ ID NO 431 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 431 auaaagcaga cccauuccct t 21 <210> SEQ ID NO 432 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 432 gggaaugggu cugcuuuaut t 21 <210> SEQ ID NO 433 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 433 acagaaacca cuuaguagut t 21 <210> SEQ ID NO 434 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 434 acuacuaagu gguuucugut t 21 <210> SEQ ID NO 435 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 435 gaaaccacuu aguaguguct t 21 <210> SEQ ID NO 436 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 436 gacacuacua agugguuuct t 21 <210> SEQ ID NO 437 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 437 aaaucuaagg auauagucat t 21 <210> SEQ ID NO 438 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 438 ugacuauauc cuuagauuut t 21 <210> SEQ ID NO 439 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 439 uuauuuauac ccaucaacat t 21 <210> SEQ ID NO 440 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 440 uguugauggg uauaaauaat t 21 <210> SEQ ID NO 441 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 441 acagaggcau uaacacacut t 21 <210> SEQ ID NO 442 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 442 aguguguuaa ugccucugut t 21 <210> SEQ ID NO 443 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 443 acacacugga gaggucuaat t 21 <210> SEQ ID NO 444 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 444 uuagaccucu ccagugugut t 21 <210> SEQ ID NO 445 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 445 acacuggaga ggucuaaagt t 21 <210> SEQ ID NO 446 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 446 cuuuagaccu cuccagugut t 21 <210> SEQ ID NO 447 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 447 cgagcccaga ucaaccuuut t 21 <210> SEQ ID NO 448 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 448 aaagguugau cugggcucgt t 21 <210> SEQ ID NO 449 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 449 ucccuauuuc gcuuucucct t 21 <210> SEQ ID NO 450 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 450 ggagaaagcg aaauagggat t 21 <210> SEQ ID NO 451 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 451 ucuaaaauca cugucaacat t 21 <210> SEQ ID NO 452 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 452 uguugacagu gauuuuagat t 21 <210> SEQ ID NO 453 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 453 agccaaauuc gucugcgaat t 21 <210> SEQ ID NO 454 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 454 uucgcagacg aauuuggcut t 21 <210> SEQ ID NO 455 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 455 cccauucaau aguagaaugt t 21 <210> SEQ ID NO 456 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 456 cauucuacua uugaaugggt t 21 <210> SEQ ID NO 457 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 457 gaugaaugca uacucuagut t 21 <210> SEQ ID NO 458 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 458 acuagaguau gcauucauct t 21 <210> SEQ ID NO 459 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 459 cucauguucc uuaucgagat t 21 <210> SEQ ID NO 460 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 460 ucucgauaag gaacaugagt t 21 <210> SEQ ID NO 461 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 461 gagaaucuaa acuaacuagt t 21 <210> SEQ ID NO 462 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 462 cuaguuaguu uagauucuct t 21 <210> SEQ ID NO 463 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 463 uagaaguaca uaagaccuut t 21 <210> SEQ ID NO 464 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 464 aaggucuuau guacuucuat t 21 <210> SEQ ID NO 465 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 465 cagccugagc uguuaaugat t 21 <210> SEQ ID NO 466 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 466 ucauuaacag cucaggcugt t 21 <210> SEQ ID NO 467 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 467 aagaagagac aauuccggat t 21 <210> SEQ ID NO 468 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 468 uccggaauug ucucuucuut t 21 <210> SEQ ID NO 469 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 469 ugcuggugug gauuguucat t 21 <210> SEQ ID NO 470 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 470 ugaacaaucc acaccagcat t 21 <210> SEQ ID NO 471 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 471 aaauucgucu gcgaagaagt t 21 <210> SEQ ID NO 472 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 472 cuucuucgca gacgaauuut t 21 <210> SEQ ID NO 473 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 473 uuucuggaag uugagaugut t 21 <210> SEQ ID NO 474 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 474 acaucucaac uuccagaaat t 21 <210> SEQ ID NO 475 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 475 uacuaaacag auugauguut t 21 <210> SEQ ID NO 476 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 476 aacaucaauc uguuuaguat t 21 <210> SEQ ID NO 477 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 477 gauugauguu uaccgaagut t 21 <210> SEQ ID NO 478 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 478 acuucgguaa acaucaauct t 21 <210> SEQ ID NO 479 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 479 gcacuaucuu ugcguauggt t 21 <210> SEQ ID NO 480 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 480 ccauacgcaa agauagugct t 21 <210> SEQ ID NO 481 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 481 ugguauaauu ccacguacct t 21 <210> SEQ ID NO 482 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 482 gguacgugga auuauaccat t 21 <210> SEQ ID NO 483 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 483 agcaagcugc uuaacacagt t 21 <210> SEQ ID NO 484 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 484 cuguguuaag cagcuugcut t 21 <210> SEQ ID NO 485 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 485 cagaaaccac uuaguagugt t 21 <210> SEQ ID NO 486 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 486 cacuacuaag ugguuucugt t 21 <210> SEQ ID NO 487 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 487 aacuuauugg agguuguaat t 21 <210> SEQ ID NO 488 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 488 uuacaaccuc caauaaguut t 21 <210> SEQ ID NO 489 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 489 cuggagaggu cuaaaguggt t 21 <210> SEQ ID NO 490 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 490 ccacuuuaga ccucuccagt t 21 <210> SEQ ID NO 491 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 491 aaaaaagaua uaaggcagut t 21 <210> SEQ ID NO 492 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 492 acugccuuau aucuuuuuut t 21 <210> SEQ ID NO 493 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 493 gaauuuugau aucuacccat t 21 <210> SEQ ID NO 494 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 494 uggguagaua ucaaaauuct t 21 <210> SEQ ID NO 495 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 495 guauuuuuga ucuggcaact t 21 <210> SEQ ID NO 496 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 496 guugccagau caaaaauact t 21 <210> SEQ ID NO 497 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 497 aggaucccuu ggcugguaut t 21 <210> SEQ ID NO 498 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 498 auaccagcca agggauccut t 21 <210> SEQ ID NO 499 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 499 ggaucccuug gcugguauat t 21 <210> SEQ ID NO 500 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 500 uauaccagcc aagggaucct t 21 <210> SEQ ID NO 501 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 501 caauaguaga augugaucct t 21 <210> SEQ ID NO 502 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 502 ggaucacauu cuacuauugt t 21 <210> SEQ ID NO 503 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 503 gcuauaauug cacuaucuut t 21 <210> SEQ ID NO 504 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 504 aagauagugc aauuauagct t 21 <210> SEQ ID NO 505 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 505 uacccuucau caaauuuuut t 21 <210> SEQ ID NO 506 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 506 aaaaauuuga ugaaggguat t 21 <210> SEQ ID NO 507 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 507 agaacauauu gaauaagcct t 21 <210> SEQ ID NO 508 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 508 ggcuuauuca auauguucut t 21 <210> SEQ ID NO 509 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 509 aaauuggugc uguugaggat t 21 <210> SEQ ID NO 510 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 510 uccucaacag caccaauuut t 21 <210> SEQ ID NO 511 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 511 ugaauagggu uacagaguut t 21 <210> SEQ ID NO 512 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 512 aacucuguaa cccuauucat t 21 <210> SEQ ID NO 513 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 513 aagaacuuga aaccacucat t 21 <210> SEQ ID NO 514 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 514 ugagugguuu caaguucuut t 21 <210> SEQ ID NO 515 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 515 aauaaagcag acccauucct t 21 <210> SEQ ID NO 516 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 516 ggaauggguc ugcuuuauut t 21 <210> SEQ ID NO 517 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 517 auacccauca acacugguat t 21 <210> SEQ ID NO 518 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 518 uaccaguguu gauggguaut t 21 <210> SEQ ID NO 519 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 519 uggauuguuc aucaauuggt t 21 <210> SEQ ID NO 520 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 520 ccaauugaug aacaauccat t 21 <210> SEQ ID NO 521 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 521 uggagagguc uaaaguggat t 21 <210> SEQ ID NO 522 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 522 uccacuuuag accucuccat t 21 <210> SEQ ID NO 523 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 523 gucaucccua uaguucacut t 21 <210> SEQ ID NO 524 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 524 agugaacuau agggaugact t 21 <210> SEQ ID NO 525 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 525 auaauggcua uaauuucuct t 21 <210> SEQ ID NO 526 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 526 gagaaauuau agccauuaut t 21 <210> SEQ ID NO 527 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 527 aucccuuggc ugguauaaut t 21 <210> SEQ ID NO 528 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 528 auuauaccag ccaagggaut t 21 <210> SEQ ID NO 529 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 529 gggcuauaau ugcacuauct t 21 <210> SEQ ID NO 530 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 530 gauagugcaa uuauagccct t 21 <210> SEQ ID NO 531 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 531 gauucucuug gagggcguat t 21 <210> SEQ ID NO 532 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 532 uacgcccucc aagagaauct t 21 <210> SEQ ID NO 533 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 533 gcaucucuca aucuugaggt t 21 <210> SEQ ID NO 534 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 534 ccucaagauu gagagaugct t 21 <210> SEQ ID NO 535 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 535 cagcagaaau cuaaggauat t 21 <210> SEQ ID NO 536 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 536 uauccuuaga uuucugcugt t 21 <210> SEQ ID NO 537 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 537 gucaagagcc aucuguagat t 21 <210> SEQ ID NO 538 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 538 ucuacagaug gcucuugact t 21 <210> SEQ ID NO 539 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 539 aaacagaggc auuaacacat t 21 <210> SEQ ID NO 540 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 540 uguguuaaug ccucuguuut t 21 <210> SEQ ID NO 541 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 541 agcccagauc aaccuuuaat t 21 <210> SEQ ID NO 542 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 542 uuaaagguug aucugggcut t 21 <210> SEQ ID NO 543 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 543 uauuuuugau cuggcaacct t 21 <210> SEQ ID NO 544 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 544 gguugccaga ucaaaaauat t 21 <210> SEQ ID NO 545 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 545 uguuuggagc aucuacuaat t 21 <210> SEQ ID NO 546 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 546 uuaguagaug cuccaaacat t 21 <210> SEQ ID NO 547 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 547 gaaauuacag uacacaacat t 21 <210> SEQ ID NO 548 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 548 uguuguguac uguaauuuct t 21 <210> SEQ ID NO 549 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 549 acuugaccag uguaaaucut t 21 <210> SEQ ID NO 550 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 550 agauuuacac uggucaagut t 21 <210> SEQ ID NO 551 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 551 accaguguaa aucugaccut t 21 <210> SEQ ID NO 552 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 552 aggucagauu uacacuggut t 21 <210> SEQ ID NO 553 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 553 agaacaauca uuagcagcat t 21 <210> SEQ ID NO 554 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 554 ugcugcuaau gauuguucut t 21 <210> SEQ ID NO 555 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 555 caauguggaa accuaacugt t 21 <210> SEQ ID NO 556 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 556 caguuagguu uccacauugt t 21 <210> SEQ ID NO 557 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 557 accaagaagg uacaaaauut t 21 <210> SEQ ID NO 558 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 558 aauuuuguac cuucuuggut t 21 <210> SEQ ID NO 559 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 559 gguacaaaau ugguugaagt t 21 <210> SEQ ID NO 560 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 560 cuucaaccaa uuuuguacct t 21 <210> SEQ ID NO 561 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 561 gguguggauu guucaucaat t 21 <210> SEQ ID NO 562 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 562 uugaugaaca auccacacct t 21 <210> SEQ ID NO 563 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 563 agaguucaca aaaagcccat t 21 <210> SEQ ID NO 564 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 564 ugggcuuuuu gugaacucut t 21 <210> SEQ ID NO 565 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 565 ugauagcuaa auuaaaccat t 21 <210> SEQ ID NO 566 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 566 ugguuuaauu uagcuaucat t 21 <210> SEQ ID NO 567 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 567 aauaagccug aagugaauct t 21 <210> SEQ ID NO 568 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 568 gauucacuuc aggcuuauut t 21 <210> SEQ ID NO 569 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 569 caguugacca acacaaugct t 21 <210> SEQ ID NO 570 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 570 gcauuguguu ggucaacugt t 21 <210> SEQ ID NO 571 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 571 ugguguggau uguucaucat t 21 <210> SEQ ID NO 572 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 572 ugaugaacaa uccacaccat t 21 <210> SEQ ID NO 573 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 573 auucacccug acagaguuct t 21 <210> SEQ ID NO 574 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 574 gaacucuguc agggugaaut t 21 <210> SEQ ID NO 575 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 575 uaagaccuua uuugguaaut t 21 <210> SEQ ID NO 576 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 576 auuaccaaau aaggucuuat t 21 <210> SEQ ID NO 577 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 577 aagcaaugug gaaaccuaat t 21 <210> SEQ ID NO 578 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 578 uuagguuucc acauugcuut t 21 <210> SEQ ID NO 579 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 579 ucugaaacug gauaucccat t 21 <210> SEQ ID NO 580 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 580 ugggauaucc aguuucagat t 21 <210> SEQ ID NO 581 <400> SEQUENCE: 581 000 <210> SEQ ID NO 582 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 582 ccauuacuac aguagcacut t 21 <210> SEQ ID NO 583 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 583 agugcuacug uaguaauggt t 21 <210> SEQ ID NO 584 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 584 aucuggcaac cauauuucut t 21 <210> SEQ ID NO 585 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 585 agaaauaugg uugccagaut t 21 <210> SEQ ID NO 586 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 586 gauagcuaaa uuaaaccaat t 21 <210> SEQ ID NO 587 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 587 uugguuuaau uuagcuauct t 21 <210> SEQ ID NO 588 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 588 agauaccauu acuacaguat t 21 <210> SEQ ID NO 589 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 589 uacuguagua augguaucut t 21 <210> SEQ ID NO 590 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 590 gauuguucau caauuggcgt t 21 <210> SEQ ID NO 591 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 591 cgccaauuga ugaacaauct t 21 <210> SEQ ID NO 592 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 592 gcuuucuccu cggcucacut t 21 <210> SEQ ID NO 593 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 593 agugagccga ggagaaagct t 21 <210> SEQ ID NO 594 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 594 ggaggauugg cugacaagat t 21 <210> SEQ ID NO 595 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 595 ucuugucagc caauccucct t 21 <210> SEQ ID NO 596 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 596 uaaugaagag uauaccuggt t 21 <210> SEQ ID NO 597 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 597 ccagguauac ucuucauuat t 21 <210> SEQ ID NO 598 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 598 uuucaccaaa ccauuuguat t 21 <210> SEQ ID NO 599 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 599 uacaaauggu uuggugaaat t 21 <210> SEQ ID NO 600 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 600 cuuauuaagg aguauacggt t 21 <210> SEQ ID NO 601 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 601 ccguauacuc cuuaauaagt t 21 <210> SEQ ID NO 602 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 602 gaaaucagau ggacguaagt t 21 <210> SEQ ID NO 603 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 603 cuuacgucca ucugauuuct t 21 <210> SEQ ID NO 604 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 604 cagaugucag cauaagcgat t 21 <210> SEQ ID NO 605 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 605 ucgcuuaugc ugacaucugt t 21 <210> SEQ ID NO 606 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 606 aucuaacccu aguuguauct t 21 <210> SEQ ID NO 607 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 607 gauacaacua ggguuagaut t 21 <210> SEQ ID NO 608 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 608 aagagcuugu uaaaaucggt t 21 <210> SEQ ID NO 609 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 609 ccgauuuuaa caagcucuut t 21 <210> SEQ ID NO 610 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 610 uuaaggagua uacggaggat t 21 <210> SEQ ID NO 611 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 611 uccuccguau acuccuuaat t 21 <210> SEQ ID NO 612 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 612 uugcaaugua aauacguaut t 21 <210> SEQ ID NO 613 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 613 auacguauuu acauugcaat t 21 <210> SEQ ID NO 614 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 614 ucuaacccua guuguaucct t 21 <210> SEQ ID NO 615 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 615 ggauacaacu aggguuagat t 21 <210> SEQ ID NO 616 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 616 cauguaucuu uuucucgaut t 21 <210> SEQ ID NO 617 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 617 aucgagaaaa agauacaugt t 21 <210> SEQ ID NO 618 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 618 gaugucagca uaagcgaugt t 21 <210> SEQ ID NO 619 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 619 caucgcuuau gcugacauct t 21 <210> SEQ ID NO 620 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 620 ucccaacagg uacgacacct t 21 <210> SEQ ID NO 621 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 621 ggugucguac cuguugggat t 21 <210> SEQ ID NO 622 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 622 ugcucacgau gaguuuagut t 21 <210> SEQ ID NO 623 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 623 acuaaacuca ucgugagcat t 21 <210> SEQ ID NO 624 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 624 agagcuuguu aaaaucggat t 21 <210> SEQ ID NO 625 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 625 uccgauuuua acaagcucut t 21 <210> SEQ ID NO 626 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 626 gcguacaaga acaucuauat t 21 <210> SEQ ID NO 627 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 627 uauagauguu cuuguacgct t 21 <210> SEQ ID NO 628 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 628 gagguuguaa gccaauguut t 21 <210> SEQ ID NO 629 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 629 aacauuggcu uacaaccuct t 21 <210> SEQ ID NO 630 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 630 aacagguacg acaccacagt t 21 <210> SEQ ID NO 631 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 631 cugugguguc guaccuguut t 21 <210> SEQ ID NO 632 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 632 aacccuaguu guaucccuct t 21 <210> SEQ ID NO 633 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 633 gagggauaca acuaggguut t 21 <210> SEQ ID NO 634 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 634 gcauaagcga uggauaauat t 21 <210> SEQ ID NO 635 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 635 uauuauccau cgcuuaugct t 21 <210> SEQ ID NO 636 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 636 aagcgaugga uaauaccuat t 21 <210> SEQ ID NO 637 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 637 uagguauuau ccaucgcuut t 21 <210> SEQ ID NO 638 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 638 ugauccugua cgaaaagaat t 21 <210> SEQ ID NO 639 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 639 uucuuuucgu acaggaucat t 21 <210> SEQ ID NO 640 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 640 aaaacauugg ccguucuggt t 21 <210> SEQ ID NO 641 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 641 ccagaacggc caauguuuut t 21 <210> SEQ ID NO 642 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 642 cuuggagggc guacaagaat t 21 <210> SEQ ID NO 643 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 643 uucuuguacg cccuccaagt t 21 <210> SEQ ID NO 644 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 644 ggcguacaag aacaucuaut t 21 <210> SEQ ID NO 645 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 645 auagauguuc uuguacgcct t 21 <210> SEQ ID NO 646 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 646 acucugagua cauuggaaut t 21 <210> SEQ ID NO 647 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 647 auuccaaugu acucagagut t 21 <210> SEQ ID NO 648 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 648 uuauuaagga guauacggat t 21 <210> SEQ ID NO 649 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 649 uccguauacu ccuuaauaat t 21 <210> SEQ ID NO 650 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 650 uaaggaguau acggaggagt t 21 <210> SEQ ID NO 651 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 651 cuccuccgua uacuccuuat t 21 <210> SEQ ID NO 652 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 652 aaaucaauag ucaacuaaat t 21 <210> SEQ ID NO 653 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 653 uuuaguugac uauugauuut t 21 <210> SEQ ID NO 654 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 654 aaucaauagu caacuaaagt t 21 <210> SEQ ID NO 655 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 655 cuuuaguuga cuauugauut t 21 <210> SEQ ID NO 656 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 656 uucucaguau acuguguaat t 21 <210> SEQ ID NO 657 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 657 uuacacagua uacugagaat t 21 <210> SEQ ID NO 658 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 658 ugugaaacac ucugauaaat t 21 <210> SEQ ID NO 659 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 659 uuuaucagag uguuucacat t 21 <210> SEQ ID NO 660 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 660 agaugugaau cucugaacat t 21 <210> SEQ ID NO 661 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 661 uguucagaga uucacaucut t 21 <210> SEQ ID NO 662 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 662 agguuguaag ccaauguugt t 21 <210> SEQ ID NO 663 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 663 caacauuggc uuacaaccut t 21 <210> SEQ ID NO 664 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 664 ugagaaauca gauggacgut t 21 <210> SEQ ID NO 665 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 665 acguccaucu gauuucucat t 21 <210> SEQ ID NO 666 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 666 agaaaucaga uggacguaat t 21 <210> SEQ ID NO 667 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 667 uuacguccau cugauuucut t 21 <210> SEQ ID NO 668 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 668 auaucccaac agguacgact t 21 <210> SEQ ID NO 669 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 669 gucguaccug uugggauaut t 21 <210> SEQ ID NO 670 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 670 cccaacaggu acgacaccat t 21 <210> SEQ ID NO 671 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 671 uggugucgua ccuguugggt t 21 <210> SEQ ID NO 672 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 672 aguauacuga agaaccucut t 21 <210> SEQ ID NO 673 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 673 agagguucuu caguauacut t 21 <210> SEQ ID NO 674 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 674 auauauauca gccgggcgct t 21 <210> SEQ ID NO 675 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 675 gcgcccggcu gauauauaut t 21 <210> SEQ ID NO 676 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 676 aaucuaaccc uaguuguaut t 21 <210> SEQ ID NO 677 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 677 auacaacuag gguuagauut t 21 <210> SEQ ID NO 678 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 678 cuaacccuag uuguauccct t 21 <210> SEQ ID NO 679 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 679 gggauacaac uaggguuagt t 21 <210> SEQ ID NO 680 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 680 cuaguuguau cccuccuuut t 21 <210> SEQ ID NO 681 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 681 aaaggaggga uacaacuagt t 21 <210> SEQ ID NO 682 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 682 agacaucuga cuaauggcut t 21 <210> SEQ ID NO 683 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 683 agccauuagu cagaugucut t 21 <210> SEQ ID NO 684 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 684 gaagcucaca augauuuaat t 21 <210> SEQ ID NO 685 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 685 uuaaaucauu gugagcuuct t 21 <210> SEQ ID NO 686 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 686 acauguaucu uuuucucgat t 21 <210> SEQ ID NO 687 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 687 ucgagaaaaa gauacaugut t 21 <210> SEQ ID NO 688 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 688 ucgauucaaa ucuuaaccct t 21 <210> SEQ ID NO 689 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 689 ggguuaagau uugaaucgat t 21 <210> SEQ ID NO 690 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 690 ucuuaacccu uaggacucut t 21 <210> SEQ ID NO 691 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 691 agaguccuaa ggguuaagat t 21 <210> SEQ ID NO 692 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 692 gcucacgaug aguuuagugt t 21 <210> SEQ ID NO 693 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 693 cacuaaacuc aucgugagct t 21 <210> SEQ ID NO 694 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 694 cauaagcgau ggauaauact t 21 <210> SEQ ID NO 695 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 695 guauuaucca ucgcuuaugt t 21 <210> SEQ ID NO 696 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 696 auaagcgaug gauaauacct t 21 <210> SEQ ID NO 697 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 697 gguauuaucc aucgcuuaut t 21 <210> SEQ ID NO 698 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 698 ccuaauaaac ugcccucagt t 21 <210> SEQ ID NO 699 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 699 cugagggcag uuuauuaggt t 21 <210> SEQ ID NO 700 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 700 ucggaaaguu gaacuuggut t 21 <210> SEQ ID NO 701 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 701 accaaguuca acuuuccgat t 21 <210> SEQ ID NO 702 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 702 gaaaacauug gccguucugt t 21 <210> SEQ ID NO 703 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 703 cagaacggcc aauguuuuct t 21 <210> SEQ ID NO 704 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 704 aagacugauc uucuaaguut t 21 <210> SEQ ID NO 705 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 705 aacuuagaag aucagucuut t 21 <210> SEQ ID NO 706 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 706 gagcuuguua aaaucggaat t 21 <210> SEQ ID NO 707 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 707 uuccgauuuu aacaagcuct t 21 <210> SEQ ID NO 708 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 708 acauuggccg uucuggagct t 21 <210> SEQ ID NO 709 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 709 gcuccagaac ggccaaugut t 21 <210> SEQ ID NO 710 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 710 aagaacaucu auaauugcat t 21 <210> SEQ ID NO 711 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 711 ugcaauuaua gauguucuut t 21 <210> SEQ ID NO 712 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 712 aaaugugucu acucauguut t 21 <210> SEQ ID NO 713 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 713 aacaugagua gacacauuut t 21 <210> SEQ ID NO 714 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 714 ugucuacuca uguuucucat t 21 <210> SEQ ID NO 715 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 715 ugagaaacau gaguagacat t 21 <210> SEQ ID NO 716 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 716 guauacugug uaacaaucut t 21 <210> SEQ ID NO 717 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 717 agauuguuac acaguauact t 21 <210> SEQ ID NO 718 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 718 uauacugugu aacaaucuat t 21 <210> SEQ ID NO 719 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 719 uagauuguua cacaguauat t 21 <210> SEQ ID NO 720 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 720 cuuaguagug uccaggaaat t 21 <210> SEQ ID NO 721 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 721 uuuccuggac acuacuaagt t 21 <210> SEQ ID NO 722 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 722 ucagauggac guaaggcagt t 21 <210> SEQ ID NO 723 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 723 cugccuuacg uccaucugat t 21 <210> SEQ ID NO 724 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 724 agauaaauug auagcacaat t 21 <210> SEQ ID NO 725 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 725 uugugcuauc aauuuaucut t 21 <210> SEQ ID NO 726 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 726 caacagguac gacaccacat t 21 <210> SEQ ID NO 727 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 727 uguggugucg uaccuguugt t 21 <210> SEQ ID NO 728 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 728 ugcaauguaa auacguauut t 21 <210> SEQ ID NO 729 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 729 aauacguauu uacauugcat t 21 <210> SEQ ID NO 730 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 730 agucagaauu uuaucuagat t 21 <210> SEQ ID NO 731 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 731 ucuagauaaa auucugacut t 21 <210> SEQ ID NO 732 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 732 cuagaaaucu uuuaacacct t 21 <210> SEQ ID NO 733 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 733 gguguuaaaa gauuucuagt t 21 <210> SEQ ID NO 734 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 734 aauaaaucua acccuaguut t 21 <210> SEQ ID NO 735 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 735 aacuaggguu agauuuauut t 21 <210> SEQ ID NO 736 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 736 aauuuucugc ucacgaugat t 21 <210> SEQ ID NO 737 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 737 ucaucgugag cagaaaauut t 21 <210> SEQ ID NO 738 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 738 gcccucagua aauccauggt t 21 <210> SEQ ID NO 739 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 739 ccauggauuu acugagggct t 21 <210> SEQ ID NO 740 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 740 acguuuaaaa cgagaucuut t 21 <210> SEQ ID NO 741 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 741 aagaucucgu uuuaaacgut t 21 <210> SEQ ID NO 742 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 742 aggagauaga acguuuaaat t 21 <210> SEQ ID NO 743 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 743 uuuaaacguu cuaucuccut t 21 <210> SEQ ID NO 744 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 744 gaccgucaug gcgucgcagt t 21 <210> SEQ ID NO 745 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 745 cugcgacgcc augacgguct t 21 <210> SEQ ID NO 746 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 746 accgucaugg cgucgcagct t 21 <210> SEQ ID NO 747 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 747 gcugcgacgc caugacggut t 21 <210> SEQ ID NO 748 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 748 gaacguuuaa aacgagauct t 21 <210> SEQ ID NO 749 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 749 gaucucguuu uaaacguuct t 21 <210> SEQ ID NO 750 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 750 uugagcuuaa cauagguaat t 21 <210> SEQ ID NO 751 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 751 uuaccuaugu uaagcucaat t 21 <210> SEQ ID NO 752 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 752 acuaaauuga ucucguagat t 21 <210> SEQ ID NO 753 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 753 ucuacgagau caauuuagut t 21 <210> SEQ ID NO 754 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 754 ucguagaauu aucuuaauat t 21 <210> SEQ ID NO 755 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 755 uauuaagaua auucuacgat t 21 <210> SEQ ID NO 756 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 756 ggagauagaa cguuuaaaat t 21 <210> SEQ ID NO 757 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 757 uuuuaaacgu ucuaucucct t 21 <210> SEQ ID NO 758 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 758 acaacuuauu ggagguugut t 21 <210> SEQ ID NO 759 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 759 acaaccucca auaaguugut t 21 <210> SEQ ID NO 760 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 760 ugagcuuaac auagguaaat t 21 <210> SEQ ID NO 761 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 761 uuuaccuaug uuaagcucat t 21 <210> SEQ ID NO 762 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 762 aucucguaga auuaucuuat t 21 <210> SEQ ID NO 763 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 763 uaagauaauu cuacgagaut t 21 <210> SEQ ID NO 764 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 764 cugcgugcag ucgguccuct t 21 <210> SEQ ID NO 765 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 765 gaggaccgac ugcacgcagt t 21 <210> SEQ ID NO 766 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 766 cacgcagcgc ccgagaguat t 21 <210> SEQ ID NO 767 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 767 uacucucggg cgcugcgugt t 21 <210> SEQ ID NO 768 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 768 aguaccaggg agacuccggt t 21 <210> SEQ ID NO 769 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 769 ccggagucuc ccugguacut t 21 <210> SEQ ID NO 770 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 770 acggaggaga uagaacguut t 21 <210> SEQ ID NO 771 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 771 aacguucuau cuccuccgut t 21 <210> SEQ ID NO 772 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 772 agaacguuua aaacgagaut t 21 <210> SEQ ID NO 773 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 773 aucucguuuu aaacguucut t 21 <210> SEQ ID NO 774 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 774 aacguuuaaa acgagaucut t 21 <210> SEQ ID NO 775 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 775 agaucucguu uuaaacguut t 21 <210> SEQ ID NO 776 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 776 agcuugagcu uaacauaggt t 21 <210> SEQ ID NO 777 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 777 ccuauguuaa gcucaagcut t 21 <210> SEQ ID NO 778 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 778 agcuuaacau agguaaauat t 21 <210> SEQ ID NO 779 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 779 uauuuaccua uguuaagcut t 21 <210> SEQ ID NO 780 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 780 uagagcuaca aaaccuauct t 21 <210> SEQ ID NO 781 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 781 gauagguuuu guagcucuat t 21 <210> SEQ ID NO 782 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 782 uaguuguauc ccuccuuuat t 21 <210> SEQ ID NO 783 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 783 uaaaggaggg auacaacuat t 21 <210> SEQ ID NO 784 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 784 accacccaga caucugacut t 21 <210> SEQ ID NO 785 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 785 agucagaugu cuggguggut t 21 <210> SEQ ID NO 786 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 786 agaaacuaaa uugaucucgt t 21 <210> SEQ ID NO 787 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 787 cgagaucaau uuaguuucut t 21 <210> SEQ ID NO 788 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 788 ucucguagaa uuaucuuaat t 21 <210> SEQ ID NO 789 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 789 uuaagauaau ucuacgagat t 21 <210> SEQ ID NO 790 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 790 caacuuauug gagguuguat t 21 <210> SEQ ID NO 791 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 791 uacaaccucc aauaaguugt t 21 <210> SEQ ID NO 792 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 792 uuguaucccu ccuuuaagut t 21 <210> SEQ ID NO 793 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 793 acuuaaagga gggauacaat t 21 <210> SEQ ID NO 794 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 794 ucacaacuua uuggagguut t 21 <210> SEQ ID NO 795 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 795 aaccuccaau aaguugugat t 21 <210> SEQ ID NO 796 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 796 agaacuguac ucuucucagt t 21 <210> SEQ ID NO 797 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 797 cugagaagag uacaguucut t 21 <210> SEQ ID NO 798 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 798 gagcuuaaca uagguaaaut t 21 <210> SEQ ID NO 799 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 799 auuuaccuau guuaagcuct t 21 <210> SEQ ID NO 800 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 800 caccaacauc uguccuuagt t 21 <210> SEQ ID NO 801 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 801 cuaaggacag auguuggugt t 21 <210> SEQ ID NO 802 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 802 aaagcccacu uuagaguaut t 21 <210> SEQ ID NO 803 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 803 auacucuaaa gugggcuuut t 21 <210> SEQ ID NO 804 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 804 aagcccacuu uagaguauat t 21 <210> SEQ ID NO 805 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 805 uauacucuaa agugggcuut t 21 <210> SEQ ID NO 806 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 806 gaccuuauuu gguaaucugt t 21 <210> SEQ ID NO 807 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 807 cagauuacca aauaagguct t 21 <210> SEQ ID NO 808 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 808 gauuaaugua cucaagacut t 21 <210> SEQ ID NO 809 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 809 agucuugagu acauuaauct t 21 <210> SEQ ID NO 810 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 810 cuuuaagagg ccuaacucat t 21 <210> SEQ ID NO 811 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 811 ugaguuaggc cucuuaaagt t 21 <210> SEQ ID NO 812 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 812 uuaaaccaaa cccuauugat t 21 <210> SEQ ID NO 813 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 813 ucaauagggu uugguuuaat t 21 <210> SEQ ID NO 814 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 814 ucuguuggag aucuauaaut t 21 <210> SEQ ID NO 815 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 815 auuauagauc uccaacagat t 21 <210> SEQ ID NO 816 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 816 cugauguuuc ugagagacut t 21 <210> SEQ ID NO 817 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 817 agucucucag aaacaucagt t 21 <210> SEQ ID NO 818 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 818 gcauacucua gucguuccct t 21 <210> SEQ ID NO 819 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 819 gggaacgacu agaguaugct t 21 <210> SEQ ID NO 820 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 820 guuccuuauc gagaaucuat t 21 <210> SEQ ID NO 821 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 821 uagauucucg auaaggaact t 21 <210> SEQ ID NO 822 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 822 gcacuuggau cucucacaut t 21 <210> SEQ ID NO 823 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 823 augugagaga uccaagugct t 21 <210> SEQ ID NO 824 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 824 aaaaaaggaa cuagauggct t 21 <210> SEQ ID NO 825 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 825 gccaucuagu uccuuuuuut t 21 <210> SEQ ID NO 826 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 826 agagcagauu accucugcgt t 21 <210> SEQ ID NO 827 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 827 cgcagaggua aucugcucut t 21 <210> SEQ ID NO 828 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 828 agcagauuac cucugcgagt t 21 <210> SEQ ID NO 829 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 829 cucgcagagg uaaucugcut t 21 <210> SEQ ID NO 830 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 830 cccugacaga guucacaaat t 21 <210> SEQ ID NO 831 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 831 uuugugaacu cugucagggt t 21 <210> SEQ ID NO 832 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 832 guuuaccgaa guguuguuut t 21 <210> SEQ ID NO 833 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 833 aaacaacacu ucgguaaact t 21 <210> SEQ ID NO 834 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 834 uuacaguaca caacaaggat t 21 <210> SEQ ID NO 835 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 835 uccuuguugu guacuguaat t 21 <210> SEQ ID NO 836 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 836 acuggaucgu aagaaggcat t 21 <210> SEQ ID NO 837 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 837 ugccuucuua cgauccagut t 21 <210> SEQ ID NO 838 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 838 gagcagauua ccucugcgat t 21 <210> SEQ ID NO 839 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 839 ucgcagaggu aaucugcuct t 21 <210> SEQ ID NO 840 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 840 aaaagaaguu aguguacgat t 21 <210> SEQ ID NO 841 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 841 ucguacacua acuucuuuut t 21 <210> SEQ ID NO 842 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 842 gaccauuuaa uuuggcagat t 21 <210> SEQ ID NO 843 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 843 ucugccaaau uaaaugguct t 21 <210> SEQ ID NO 844 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 844 gagaggagug auaauuaaat t 21 <210> SEQ ID NO 845 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 845 uuuaauuauc acuccucuct t 21 <210> SEQ ID NO 846 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 846 cuggaggauu ggcugacaat t 21 <210> SEQ ID NO 847 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 847 uugucagcca auccuccagt t 21 <210> SEQ ID NO 848 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 848 cucuagucgu ucccacucat t 21 <210> SEQ ID NO 849 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 849 ugagugggaa cgacuagagt t 21 <210> SEQ ID NO 850 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 850 gauaccauua cuacaguagt t 21 <210> SEQ ID NO 851 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 851 cuacuguagu aaugguauct t 21 <210> SEQ ID NO 852 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 852 uucgucugcg aagaagaaat t 21 <210> SEQ ID NO 853 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 853 uuucuucuuc gcagacgaat t 21 <210> SEQ ID NO 854 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 854 gaaaagaagu uaguguacgt t 21 <210> SEQ ID NO 855 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 855 cguacacuaa cuucuuuuct t 21 <210> SEQ ID NO 856 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 856 ugauguuuac cgaaguguut t 21 <210> SEQ ID NO 857 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 857 aacacuucgg uaaacaucat t 21 <210> SEQ ID NO 858 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 858 uguuugucca auucuggaut t 21 <210> SEQ ID NO 859 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 859 auccagaauu ggacaaacat t 21 <210> SEQ ID NO 860 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 860 augaagagua uaccugggat t 21 <210> SEQ ID NO 861 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 861 ucccagguau acucuucaut t 21 <210> SEQ ID NO 862 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 862 gcuacucuga ugaaugcaut t 21 <210> SEQ ID NO 863 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 863 augcauucau cagaguagct t 21 <210> SEQ ID NO 864 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 864 gcccuuguag aaagaacact t 21 <210> SEQ ID NO 865 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 865 guguucuuuc uacaagggct t 21 <210> SEQ ID NO 866 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 866 ucauguuccu uaucgagaat t 21 <210> SEQ ID NO 867 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 867 uucucgauaa ggaacaugat t 21 <210> SEQ ID NO 868 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 868 gaauaggguu acagaguugt t 21 <210> SEQ ID NO 869 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 869 caacucugua acccuauuct t 21 <210> SEQ ID NO 870 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 870 caaacuggau cguaagaagt t 21 <210> SEQ ID NO 871 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 871 cuucuuacga uccaguuugt t 21 <210> SEQ ID NO 872 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 872 cuuauuuggu aaucugcugt t 21 <210> SEQ ID NO 873 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 873 cagcagauua ccaaauaagt t 21 <210> SEQ ID NO 874 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 874 agcaaugugg aaaccuaact t 21 <210> SEQ ID NO 875 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 875 guuagguuuc cacauugcut t 21 <210> SEQ ID NO 876 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 876 acaauaaagc agacccauut t 21 <210> SEQ ID NO 877 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 877 aaugggucug cuuuauugut t 21 <210> SEQ ID NO 878 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 878 aaccacuuag uaguguccat t 21 <210> SEQ ID NO 879 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 879 uggacacuac uaagugguut t 21 <210> SEQ ID NO 880 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 880 agucaagagc caucuguagt t 21 <210> SEQ ID NO 881 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 881 cuacagaugg cucuugacut t 21 <210> SEQ ID NO 882 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 882 cucccuagac uucccuauut t 21 <210> SEQ ID NO 883 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 883 aauagggaag ucuagggagt t 21 <210> SEQ ID NO 884 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 884 auagcuaaau uaaaccaaat t 21 <210> SEQ ID NO 885 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 885 uuugguuuaa uuuagcuaut t 21 <210> SEQ ID NO 886 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 886 uggcugguau aauuccacgt t 21 <210> SEQ ID NO 887 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 887 cguggaauua uaccagccat t 21 <210> SEQ ID NO 888 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 888 uuauuuggua aucugcugut t 21 <210> SEQ ID NO 889 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 889 acagcagauu accaaauaat t 21 <210> SEQ ID NO 890 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 890 aacuagaugg cuuucucagt t 21 <210> SEQ ID NO 891 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 891 cugagaaagc caucuaguut t 21 <210> SEQ ID NO 892 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 892 ucauggcguc gcagccaaat t 21 <210> SEQ ID NO 893 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 893 uuuggcugcg acgccaugat t 21 <210> SEQ ID NO 894 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 894 acuggaggau uggcugacat t 21 <210> SEQ ID NO 895 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 895 ugucagccaa uccuccagut t 21 <210> SEQ ID NO 896 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 896 cuauaauugc acuaucuuut t 21 <210> SEQ ID NO 897 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 897 aaagauagug caauuauagt t 21 <210> SEQ ID NO 898 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 898 aaaggucacc uaaugaagat t 21 <210> SEQ ID NO 899 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 899 ucuucauuag gugaccuuut t 21 <210> SEQ ID NO 900 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 900 augaaugcau acucuaguct t 21 <210> SEQ ID NO 901 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 901 gacuagagua ugcauucaut t 21 <210> SEQ ID NO 902 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 902 aacauauuga auaagccugt t 21 <210> SEQ ID NO 903 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 903 caggcuuauu caauauguut t 21 <210> SEQ ID NO 904 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 904 aagaaggcag uugaccaact t 21 <210> SEQ ID NO 905 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 905 guuggucaac ugccuucuut t 21 <210> SEQ ID NO 906 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 906 gauacuaaaa gaacaaucat t 21 <210> SEQ ID NO 907 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 907 ugauuguucu uuuaguauct t 21 <210> SEQ ID NO 908 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 908 auacugaaaa ucaauaguct t 21 <210> SEQ ID NO 909 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 909 gacuauugau uuucaguaut t 21 <210> SEQ ID NO 910 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 910 aaaaaggaac uagauggcut t 21 <210> SEQ ID NO 911 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 911 agccaucuag uuccuuuuut t 21 <210> SEQ ID NO 912 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 912 gaacuagaug gcuuucucat t 21 <210> SEQ ID NO 913 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 913 ugagaaagcc aucuaguuct t 21 <210> SEQ ID NO 914 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 914 gaaaccuaac ugaagaccut t 21 <210> SEQ ID NO 915 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 915 aggucuucag uuagguuuct t 21 <210> SEQ ID NO 916 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 916 uacccaucaa cacugguaat t 21 <210> SEQ ID NO 917 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 917 uuaccagugu ugauggguat t 21 <210> SEQ ID NO 918 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 918 auuuugauau cuacccauut t 21 <210> SEQ ID NO 919 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 919 aauggguaga uaucaaaaut t 21 <210> SEQ ID NO 920 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 920 aucccuauag uucacuuugt t 21 <210> SEQ ID NO 921 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 921 caaagugaac uauagggaut t 21 <210> SEQ ID NO 922 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 922 augggcuaua auugcacuat t 21 <210> SEQ ID NO 923 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 923 uagugcaauu auagcccaut t 21 <210> SEQ ID NO 924 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 924 agauuaccuc ugcgagccct t 21 <210> SEQ ID NO 925 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 925 gggcucgcag agguaaucut t 21 <210> SEQ ID NO 926 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 926 uaauuccacg uacccuucat t 21 <210> SEQ ID NO 927 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 927 ugaaggguac guggaauuat t 21 <210> SEQ ID NO 928 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 928 gucguuccca cucaguuuut t 21 <210> SEQ ID NO 929 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 929 aaaacugagu gggaacgact t 21 <210> SEQ ID NO 930 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 930 aaaucaaucc cuguugacut t 21 <210> SEQ ID NO 931 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 931 agucaacagg gauugauuut t 21 <210> SEQ ID NO 932 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 932 ucauagagca aagaacauat t 21 <210> SEQ ID NO 933 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 933 uauguucuuu gcucuaugat t 21 <210> SEQ ID NO 934 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 934 uuacuacagu agcacuuggt t 21 <210> SEQ ID NO 935 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 935 ccaagugcua cuguaguaat t 21 <210> SEQ ID NO 936 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 936 auguggaaac cuaacugaat t 21 <210> SEQ ID NO 937 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 937 uucaguuagg uuuccacaut t 21 <210> SEQ ID NO 938 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 938 uguggaaacc uaacugaagt t 21 <210> SEQ ID NO 939 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 939 cuucaguuag guuuccacat t 21 <210> SEQ ID NO 940 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 940 ucuuccuuaa augaaagggt t 21 <210> SEQ ID NO 941 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 941 cccuuucauu uaaggaagat t 21 <210> SEQ ID NO 942 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 942 ugaagaaccu cuaagucaat t 21 <210> SEQ ID NO 943 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 943 uugacuuaga gguucuucat t 21 <210> SEQ ID NO 944 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 944 agaggucuaa aguggaagat t 21 <210> SEQ ID NO 945 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 945 ucuuccacuu uagaccucut t 21 <210> SEQ ID NO 946 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 946 auaucuaccc auuuuucugt t 21 <210> SEQ ID NO 947 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 947 cagaaaaaug gguagauaut t 21 <210> SEQ ID NO 948 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 948 uaagccugaa gugaaucagt t 21 <210> SEQ ID NO 949 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 949 cugauucacu ucaggcuuat t 21 <210> SEQ ID NO 950 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 950 agaugcagac cauuuaauut t 21 <210> SEQ ID NO 951 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 951 aauuaaaugg ucugcaucut t 21 <210> SEQ ID NO 952 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 952 aguguuguuu guccaauuct t 21 <210> SEQ ID NO 953 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 953 gaauuggaca aacaacacut t 21 <210> SEQ ID NO 954 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 954 cuauaaugaa gagcuuuuut t 21 <210> SEQ ID NO 955 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 955 aaaaagcucu ucauuauagt t 21 <210> SEQ ID NO 956 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 956 agaggaguga uaauuaaagt t 21 <210> SEQ ID NO 957 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 957 cuuuaauuau cacuccucut t 21 <210> SEQ ID NO 958 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 958 uuucucuguu acaauacaut t 21 <210> SEQ ID NO 959 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 959 auguauugua acagagaaat t 21 <210> SEQ ID NO 960 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 960 aacaucuaua auugcaacat t 21 <210> SEQ ID NO 961 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 961 uguugcaauu auagauguut t 21 <210> SEQ ID NO 962 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 962 ugcuagaagu acauaagact t 21 <210> SEQ ID NO 963 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 963 gucuuaugua cuucuagcat t 21 <210> SEQ ID NO 964 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 964 aauguacuca agacugauct t 21 <210> SEQ ID NO 965 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 965 gaucagucuu gaguacauut t 21 <210> SEQ ID NO 966 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 966 guacucaaga cugaucuuct t 21 <210> SEQ ID NO 967 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 967 gaagaucagu cuugaguact t 21 <210> SEQ ID NO 968 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 968 cacucugaua aacucaaugt t 21 <210> SEQ ID NO 969 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 969 cauugaguuu aucagagugt t 21 <210> SEQ ID NO 970 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 970 aagagcagau uaccucugct t 21 <210> SEQ ID NO 971 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 971 gcagagguaa ucugcucuut t 21 <210> SEQ ID NO 972 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 972 ucugcgagcc cagaucaact t 21 <210> SEQ ID NO 973 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 973 guugaucugg gcucgcagat t 21 <210> SEQ ID NO 974 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 974 aacuugagcc uuguguauat t 21 <210> SEQ ID NO 975 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 975 uauacacaag gcucaaguut t 21 <210> SEQ ID NO 976 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 976 gaauauauau aucagccggt t 21 <210> SEQ ID NO 977 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 977 ccggcugaua uauauauuct t 21 <210> SEQ ID NO 978 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 978 ugucaucccu auaguucact t 21 <210> SEQ ID NO 979 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 979 gugaacuaua gggaugacat t 21 <210> SEQ ID NO 980 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 980 gaucuggcaa ccauauuuct t 21 <210> SEQ ID NO 981 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 981 gaaauauggu ugccagauct t 21 <210> SEQ ID NO 982 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 982 uggcaaccau auuucuggat t 21 <210> SEQ ID NO 983 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 983 uccagaaaua ugguugccat t 21 <210> SEQ ID NO 984 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 984 gauguuuacc gaaguguugt t 21 <210> SEQ ID NO 985 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 985 caacacuucg guaaacauct t 21 <210> SEQ ID NO 986 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 986 uuccuuaucg agaaucuaat t 21 <210> SEQ ID NO 987 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 987 uuagauucuc gauaaggaat t 21 <210> SEQ ID NO 988 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 988 agcuuaauug cuuucuggat t 21 <210> SEQ ID NO 989 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 989 uccagaaagc aauuaagcut t 21 <210> SEQ ID NO 990 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 990 uugcuauuau gggagaccat t 21 <210> SEQ ID NO 991 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 991 uggucuccca uaauagcaat t 21 <210> SEQ ID NO 992 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 992 gucauggcgu cgcagccaat t 21 <210> SEQ ID NO 993 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 993 uuggcugcga cgccaugact t 21 <210> SEQ ID NO 994 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 994 uaauugcacu aucuuugcgt t 21 <210> SEQ ID NO 995 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 995 cgcaaagaua gugcaauuat t 21 <210> SEQ ID NO 996 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 996 cuaucuuugc guauggccat t 21 <210> SEQ ID NO 997 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 997 uggccauacg caaagauagt t 21 <210> SEQ ID NO 998 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 998 ucccuauagu ucacuuugut t 21 <210> SEQ ID NO 999 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 999 acaaagugaa cuauagggat t 21 <210> SEQ ID NO 1000 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1000 ucaaccuuua auucacuugt t 21 <210> SEQ ID NO 1001 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1001 caagugaauu aaagguugat t 21 <210> SEQ ID NO 1002 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1002 ggcaaccaua uuucuggaat t 21 <210> SEQ ID NO 1003 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1003 uuccagaaau augguugcct t 21 <210> SEQ ID NO 1004 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1004 auguacucaa gacugaucut t 21 <210> SEQ ID NO 1005 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1005 agaucagucu ugaguacaut t 21 <210> SEQ ID NO 1006 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1006 gcagaccauu uaauuuggct t 21 <210> SEQ ID NO 1007 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1007 gccaaauuaa auggucugct t 21 <210> SEQ ID NO 1008 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1008 ucugagagac uacagaugut t 21 <210> SEQ ID NO 1009 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1009 acaucuguag ucucucagat t 21 <210> SEQ ID NO 1010 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1010 ugcucauaga gcaaagaact t 21 <210> SEQ ID NO 1011 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1011 guucuuugcu cuaugagcat t 21 <210> SEQ ID NO 1012 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1012 acauaagacc uuauuuggut t 21 <210> SEQ ID NO 1013 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1013 accaaauaag gucuuaugut t 21 <210> SEQ ID NO 1014 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1014 uuugugcuga uucugauggt t 21 <210> SEQ ID NO 1015 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1015 ccaucagaau cagcacaaat t 21 <210> SEQ ID NO 1016 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1016 ccaucaacac ugguaagaat t 21 <210> SEQ ID NO 1017 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1017 uucuuaccag uguugauggt t 21 <210> SEQ ID NO 1018 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1018 agacaauucc ggauguggat t 21 <210> SEQ ID NO 1019 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1019 uccacauccg gaauugucut t 21 <210> SEQ ID NO 1020 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1020 gaacuugagc cuuguguaut t 21 <210> SEQ ID NO 1021 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1021 auacacaagg cucaaguuct t 21 <210> SEQ ID NO 1022 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1022 uaauuuggca gagcggaaat t 21 <210> SEQ ID NO 1023 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1023 uuuccgcucu gccaaauuat t 21 <210> SEQ ID NO 1024 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1024 uggaugaagu uauuaugggt t 21 <210> SEQ ID NO 1025 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1025 cccauaauaa cuucauccat t 21 <210> SEQ ID NO 1026 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1026 aucuacauga acuacaagat t 21 <210> SEQ ID NO 1027 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1027 ucuuguaguu cauguagaut t 21 <210> SEQ ID NO 1028 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1028 gguauuuuug aucuggcaat t 21 <210> SEQ ID NO 1029 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1029 uugccagauc aaaaauacct t 21 <210> SEQ ID NO 1030 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1030 cuaaugaaga guauaccugt t 21 <210> SEQ ID NO 1031 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1031 cagguauacu cuucauuagt t 21 <210> SEQ ID NO 1032 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1032 uuugagaaac uuacugauat t 21 <210> SEQ ID NO 1033 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1033 uaucaguaag uuucucaaat t 21 <210> SEQ ID NO 1034 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1034 cgauaagaua gaagaucaat t 21 <210> SEQ ID NO 1035 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1035 uugaucuucu aucuuaucgt t 21 <210> SEQ ID NO 1036 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1036 cuggcaacca uauuucuggt t 21 <210> SEQ ID NO 1037 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1037 ccagaaauau gguugccagt t 21 <210> SEQ ID NO 1038 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1038 uagauaccau uacuacagut t 21 <210> SEQ ID NO 1039 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1039 acuguaguaa ugguaucuat t 21 <210> SEQ ID NO 1040 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1040 guauuaaauu ggguuucaut t 21 <210> SEQ ID NO 1041 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1041 augaaaccca auuuaauact t 21 <210> SEQ ID NO 1042 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1042 aagaccuuau uugguaauct t 21 <210> SEQ ID NO 1043 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1043 gauuaccaaa uaaggucuut t 21 <210> SEQ ID NO 1044 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1044 gcuguugaua agagagcuct t 21 <210> SEQ ID NO 1045 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1045 gagcucucuu aucaacagct t 21 <210> SEQ ID NO 1046 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1046 uacucauguu ucucagauut t 21 <210> SEQ ID NO 1047 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1047 aaucugagaa acaugaguat t 21 <210> SEQ ID NO 1048 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1048 cagauggacg uaaggcagct t 21 <210> SEQ ID NO 1049 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1049 gcugccuuac guccaucugt t 21 <210> SEQ ID NO 1050 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1050 uaucccaaca gguacgacat t 21 <210> SEQ ID NO 1051 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1051 ugucguaccu guugggauat t 21 <210> SEQ ID NO 1052 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1052 cauugcuauu augggagact t 21 <210> SEQ ID NO 1053 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1053 gucucccaua auagcaaugt t 21 <210> SEQ ID NO 1054 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1054 cccucaguaa auccauggut t 21 <210> SEQ ID NO 1055 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1055 accauggauu uacugagggt t 21 <210> SEQ ID NO 1056 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1056 ggucauuacu gcccuuguat t 21 <210> SEQ ID NO 1057 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1057 uacaagggca guaaugacct t 21 <210> SEQ ID NO 1058 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1058 aaccacucaa aaacauuugt t 21 <210> SEQ ID NO 1059 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1059 caaauguuuu ugagugguut t 21 <210> SEQ ID NO 1060 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1060 uuugcaaguu aaugaaucut t 21 <210> SEQ ID NO 1061 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1061 agauucauua acuugcaaat t 21 <210> SEQ ID NO 1062 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1062 uuauuuucag uagucagaat t 21 <210> SEQ ID NO 1063 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1063 uucugacuac ugaaaauaat t 21 <210> SEQ ID NO 1064 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1064 uuuucucgau ucaaaucuut t 21 <210> SEQ ID NO 1065 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1065 aagauuugaa ucgagaaaat t 21 <210> SEQ ID NO 1066 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1066 guacgaaaag aaguuagugt t 21 <210> SEQ ID NO 1067 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1067 cacuaacuuc uuuucguact t 21 <210> SEQ ID NO 1068 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1068 uuuaaaacga gaucuugcut t 21 <210> SEQ ID NO 1069 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1069 agcaagaucu cguuuuaaat t 21 <210> SEQ ID NO 1070 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1070 gaauugauua auguacucat t 21 <210> SEQ ID NO 1071 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1071 ugaguacauu aaucaauuct t 21 <210> SEQ ID NO 1072 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1072 gauggacgua aggcagcuct t 21 <210> SEQ ID NO 1073 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1073 gagcugccuu acguccauct t 21 <210> SEQ ID NO 1074 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1074 caucugacua auggcucugt t 21 <210> SEQ ID NO 1075 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1075 cagagccauu agucagaugt t 21 <210> SEQ ID NO 1076 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1076 gugauccugu acgaaaagat t 21 <210> SEQ ID NO 1077 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1077 ucuuuucgua caggaucact t 21 <210> SEQ ID NO 1078 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1078 agcucuuauu aaggaguaut t 21 <210> SEQ ID NO 1079 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1079 auacuccuua auaagagcut t 21 <210> SEQ ID NO 1080 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1080 gcucuuauua aggaguauat t 21 <210> SEQ ID NO 1081 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1081 uauacuccuu aauaagagct t 21 <210> SEQ ID NO 1082 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1082 ucuuauuaag gaguauacgt t 21 <210> SEQ ID NO 1083 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1083 cguauacucc uuaauaagat t 21 <210> SEQ ID NO 1084 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1084 uauuaaggag uauacggagt t 21 <210> SEQ ID NO 1085 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1085 cuccguauac uccuuaauat t 21 <210> SEQ ID NO 1086 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1086 cugcagcccg ugagaaaaat t 21 <210> SEQ ID NO 1087 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1087 uuuuucucac gggcugcagt t 21 <210> SEQ ID NO 1088 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1088 ucaagacuga ucuucuaagt t 21 <210> SEQ ID NO 1089 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1089 cuuagaagau cagucuugat t 21 <210> SEQ ID NO 1090 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1090 cuucuaaguu cacuggaaat t 21 <210> SEQ ID NO 1091 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1091 uuuccaguga acuuagaagt t 21 <210> SEQ ID NO 1092 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1092 ugcaaguuaa ugaaucuuut t 21 <210> SEQ ID NO 1093 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1093 aaagauucau uaacuugcat t 21 <210> SEQ ID NO 1094 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1094 aaucuaagga uauagucaat t 21 <210> SEQ ID NO 1095 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1095 uugacuauau ccuuagauut t 21 <210> SEQ ID NO 1096 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1096 aucucugaac acaagaacat t 21 <210> SEQ ID NO 1097 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1097 uguucuugug uucagagaut t 21 <210> SEQ ID NO 1098 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1098 uucugaacag uggguaucut t 21 <210> SEQ ID NO 1099 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1099 agauacccac uguucagaat t 21 <210> SEQ ID NO 1100 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1100 aguuauuuau acccaucaat t 21 <210> SEQ ID NO 1101 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1101 uugaugggua uaaauaacut t 21 <210> SEQ ID NO 1102 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1102 augcuaaacu guucagaaat t 21 <210> SEQ ID NO 1103 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1103 uuucugaaca guuuagcaut t 21 <210> SEQ ID NO 1104 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1104 cuacagagca cuugguuact t 21 <210> SEQ ID NO 1105 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1105 guaaccaagu gcucuguagt t 21 <210> SEQ ID NO 1106 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1106 uauauaucag ccgggcgcgt t 21 <210> SEQ ID NO 1107 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1107 cgcgcccggc ugauauauat t 21 <210> SEQ ID NO 1108 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1108 auguaaauac guauuucuat t 21 <210> SEQ ID NO 1109 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1109 uagaaauacg uauuuacaut t 21 <210> SEQ ID NO 1110 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1110 uuuuucucga uucaaaucut t 21 <210> SEQ ID NO 1111 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1111 agauuugaau cgagaaaaat t 21 <210> SEQ ID NO 1112 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1112 aaucuuaacc cuuaggacut t 21 <210> SEQ ID NO 1113 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1113 aguccuaagg guuaagauut t 21 <210> SEQ ID NO 1114 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1114 ccuuaggacu cugguauuut t 21 <210> SEQ ID NO 1115 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1115 aaauaccaga guccuaaggt t 21 <210> SEQ ID NO 1116 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1116 aauaaacugc ccucaguaat t 21 <210> SEQ ID NO 1117 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1117 uuacugaggg caguuuauut t 21 <210> SEQ ID NO 1118 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1118 gauccuguac gaaaagaagt t 21 <210> SEQ ID NO 1119 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1119 cuucuuuucg uacaggauct t 21 <210> SEQ ID NO 1120 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1120 aaugugaucc uguacgaaat t 21 <210> SEQ ID NO 1121 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1121 uuucguacag gaucacauut t 21 <210> SEQ ID NO 1122 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1122 gugaaaacau uggccguuct t 21 <210> SEQ ID NO 1123 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1123 gaacggccaa uguuuucact t 21 <210> SEQ ID NO 1124 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1124 cuugaggaaa cucugaguat t 21 <210> SEQ ID NO 1125 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1125 uacucagagu uuccucaagt t 21 <210> SEQ ID NO 1126 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1126 cguuuaaaac gagaucuugt t 21 <210> SEQ ID NO 1127 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1127 caagaucucg uuuuaaacgt t 21 <210> SEQ ID NO 1128 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1128 uuaaaacgag aucuugcugt t 21 <210> SEQ ID NO 1129 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1129 cagcaagauc ucguuuuaat t 21 <210> SEQ ID NO 1130 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1130 aaagauguau cuggucucct t 21 <210> SEQ ID NO 1131 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1131 ggagaccaga uacaucuuut t 21 <210> SEQ ID NO 1132 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1132 cagaaaaugu gucuacucat t 21 <210> SEQ ID NO 1133 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1133 ugaguagaca cauuuucugt t 21 <210> SEQ ID NO 1134 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1134 caggaauuga uuaauguact t 21 <210> SEQ ID NO 1135 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1135 guacauuaau caauuccugt t 21 <210> SEQ ID NO 1136 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1136 agucaacuaa agcauauuut t 21 <210> SEQ ID NO 1137 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1137 aaauaugcuu uaguugacut t 21 <210> SEQ ID NO 1138 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1138 uguguaacaa ucuacaugat t 21 <210> SEQ ID NO 1139 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1139 ucauguagau uguuacacat t 21 <210> SEQ ID NO 1140 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1140 auaccauuug uuccuuggut t 21 <210> SEQ ID NO 1141 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1141 accaaggaac aaaugguaut t 21 <210> SEQ ID NO 1142 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1142 gcagaaaucu aaggauauat t 21 <210> SEQ ID NO 1143 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1143 uauauccuua gauuucugct t 21 <210> SEQ ID NO 1144 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1144 uggcuucuca caggaacuct t 21 <210> SEQ ID NO 1145 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1145 gaguuccugu gagaagccat t 21 <210> SEQ ID NO 1146 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1146 gagaugugaa ucucugaact t 21 <210> SEQ ID NO 1147 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1147 guucagagau ucacaucuct t 21 <210> SEQ ID NO 1148 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1148 uguaagccaa uguugugagt t 21 <210> SEQ ID NO 1149 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1149 cucacaacau uggcuuacat t 21 <210> SEQ ID NO 1150 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1150 agccaauguu gugaggcuut t 21 <210> SEQ ID NO 1151 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1151 aagccucaca acauuggcut t 21 <210> SEQ ID NO 1152 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1152 uugugaggcu ucaaguucat t 21 <210> SEQ ID NO 1153 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1153 ugaacuugaa gccucacaat t 21 <210> SEQ ID NO 1154 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1154 aggcagcuca ugagaaacat t 21 <210> SEQ ID NO 1155 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1155 uguuucucau gagcugccut t 21 <210> SEQ ID NO 1156 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1156 auaaauugau agcacaaaat t 21 <210> SEQ ID NO 1157 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1157 uuuugugcua ucaauuuaut t 21 <210> SEQ ID NO 1158 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1158 acaaaaucua gaacuuaaut t 21 <210> SEQ ID NO 1159 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1159 auuaaguucu agauuuugut t 21 <210> SEQ ID NO 1160 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1160 gauaucccaa cagguacgat t 21 <210> SEQ ID NO 1161 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1161 ucguaccugu ugggauauct t 21 <210> SEQ ID NO 1162 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1162 aaguuauuua uacccaucat t 21 <210> SEQ ID NO 1163 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1163 ugauggguau aaauaacuut t 21 <210> SEQ ID NO 1164 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1164 uguaaauacg uauuucuagt t 21 <210> SEQ ID NO 1165 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1165 cuagaaauac guauuuacat t 21 <210> SEQ ID NO 1166 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1166 ucuaguuuuc auauaaagut t 21 <210> SEQ ID NO 1167 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1167 acuuuauaug aaaacuagat t 21 <210> SEQ ID NO 1168 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1168 auaaaguagu ucuuuuauat t 21 <210> SEQ ID NO 1169 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1169 uauaaaagaa cuacuuuaut t 21 <210> SEQ ID NO 1170 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1170 ccauuuguag agcuacaaat t 21 <210> SEQ ID NO 1171 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1171 uuuguagcuc uacaaauggt t 21 <210> SEQ ID NO 1172 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1172 uauuuucagu agucagaaut t 21 <210> SEQ ID NO 1173 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1173 auucugacua cugaaaauat t 21 <210> SEQ ID NO 1174 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1174 aaaucuaacc cuaguuguat t 21 <210> SEQ ID NO 1175 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1175 uacaacuagg guuagauuut t 21 <210> SEQ ID NO 1176 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1176 cuuuagagua uacauugcut t 21 <210> SEQ ID NO 1177 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1177 agcaauguau acucuaaagt t 21 <210> SEQ ID NO 1178 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1178 aucugacuaa uggcucugut t 21 <210> SEQ ID NO 1179 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1179 acagagccau uagucagaut t 21 <210> SEQ ID NO 1180 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1180 cacaaugauu uaaggacugt t 21 <210> SEQ ID NO 1181 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1181 caguccuuaa aucauugugt t 21 <210> SEQ ID NO 1182 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1182 ucuuuuucuc gauucaaaut t 21 <210> SEQ ID NO 1183 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1183 auuugaaucg agaaaaagat t 21 <210> SEQ ID NO 1184 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1184 cuuuuucucg auucaaauct t 21 <210> SEQ ID NO 1185 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1185 gauuugaauc gagaaaaagt t 21 <210> SEQ ID NO 1186 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1186 auuuucugcu cacgaugagt t 21 <210> SEQ ID NO 1187 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1187 cucaucguga gcagaaaaut t 21 <210> SEQ ID NO 1188 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1188 uuucugcuca cgaugaguut t 21 <210> SEQ ID NO 1189 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1189 aacucaucgu gagcagaaat t 21 <210> SEQ ID NO 1190 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1190 agagcuacaa aaccuaucct t 21 <210> SEQ ID NO 1191 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1191 ggauagguuu uguagcucut t 21 <210> SEQ ID NO 1192 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1192 gagccaaagg uacaccacut t 21 <210> SEQ ID NO 1193 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1193 agugguguac cuuuggcuct t 21 <210> SEQ ID NO 1194 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1194 gccaaaggua caccacuact t 21 <210> SEQ ID NO 1195 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1195 guaguggugu accuuuggct t 21 <210> SEQ ID NO 1196 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1196 gaacuguacu cuucucagct t 21 <210> SEQ ID NO 1197 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1197 gcugagaaga guacaguuct t 21 <210> SEQ ID NO 1198 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1198 agguaaauau caccaacaut t 21 <210> SEQ ID NO 1199 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1199 auguugguga uauuuaccut t 21 <210> SEQ ID NO 1200 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1200 agcuacaaaa ccuauccuut t 21 <210> SEQ ID NO 1201 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1201 aaggauaggu uuuguagcut t 21 <210> SEQ ID NO 1202 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1202 ugugaaagca uuuaauucct t 21 <210> SEQ ID NO 1203 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1203 ggaauuaaau gcuuucacat t 21 <210> SEQ ID NO 1204 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1204 gcccacuuua gaguauacat t 21 <210> SEQ ID NO 1205 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1205 uguauacucu aaagugggct t 21 <210> SEQ ID NO 1206 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1206 ugugccacac uccaagacct t 21 <210> SEQ ID NO 1207 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1207 ggucuuggag uguggcacat t 21 <210> SEQ ID NO 1208 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1208 aaacuaaauu gaucucguat t 21 <210> SEQ ID NO 1209 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1209 uacgagauca auuuaguuut t 21 <210> SEQ ID NO 1210 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1210 ugaucucgua gaauuaucut t 21 <210> SEQ ID NO 1211 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1211 agauaauucu acgagaucat t 21 <210> SEQ ID NO 1212 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1212 gcgugcaguc gguccuccat t 21 <210> SEQ ID NO 1213 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1213 uggaggaccg acugcacgct t 21 <210> SEQ ID NO 1214 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1214 aaaguuuaga gacaucugat t 21 <210> SEQ ID NO 1215 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1215 ucagaugucu cuaaacuuut t 21 <210> SEQ ID NO 1216 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1216 cagaaggaau auguacaaat t 21 <210> SEQ ID NO 1217 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1217 uuuguacaua uuccuucugt t 21 <210> SEQ ID NO 1218 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1218 cgcccgagag uaccagggat t 21 <210> SEQ ID NO 1219 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1219 ucccugguac ucucgggcgt t 21 <210> SEQ ID NO 1220 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1220 cggaggagau agaacguuut t 21 <210> SEQ ID NO 1221 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1221 aaacguucua ucuccuccgt t 21 <210> SEQ ID NO 1222 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1222 agauagaacg uuuaaaacgt t 21 <210> SEQ ID NO 1223 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1223 cguuuuaaac guucuaucut t 21 <210> SEQ ID NO 1224 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1224 ggaacaggaa cuucacaact t 21 <210> SEQ ID NO 1225 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1225 guugugaagu uccuguucct t 21 <210> SEQ ID NO 1226 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1226 gugagccaaa gguacaccat t 21 <210> SEQ ID NO 1227 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1227 ugguguaccu uuggcucact t 21 <210> SEQ ID NO 1228 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1228 auccucccua gacuucccut t 21 <210> SEQ ID NO 1229 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1229 agggaagucu agggaggaut t 21 <210> SEQ ID NO 1230 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1230 cacacuccaa gaccugugct t 21 <210> SEQ ID NO 1231 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1231 gcacaggucu uggagugugt t 21 <210> SEQ ID NO 1232 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1232 acagaaggaa uauguacaat t 21 <210> SEQ ID NO 1233 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1233 uuguacauau uccuucugut t 21 <210> SEQ ID NO 1234 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1234 uuagagacau cugacuuugt t 21 <210> SEQ ID NO 1235 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1235 caaagucaga ugucucuaat t 21 <210> SEQ ID NO 1236 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1236 aauugaucuc guagaauuat t 21 <210> SEQ ID NO 1237 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1237 uaauucuacg agaucaauut t 21 <210> SEQ ID NO 1238 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1238 accgaagugu uguuugucct t 21 <210> SEQ ID NO 1239 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1239 ggacaaacaa cacuucggut t 21 <210> SEQ ID NO 1240 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1240 ucgagaaucu aaacuaacut t 21 <210> SEQ ID NO 1241 <211> LENGTH: 21 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1241 aguuaguuua gauucucgat t 21 <210> SEQ ID NO 1242 <211> LENGTH: 21 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1242 gcacauagga gagaugagcu u 21 <210> SEQ ID NO 1243 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1243 aagcucaucu cuccuaugug cug 23 <210> SEQ ID NO 1244 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1244 accgaagugu uguuugucca auu 23 <210> SEQ ID NO 1245 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1245 uaugguguuu ggagcaucua cua 23 <210> SEQ ID NO 1246 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1246 aaucuaaacu aacuagaauc cuc 23 <210> SEQ ID NO 1247 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1247 uccuuaucga gaaucuaaac uaa 23 <210> SEQ ID NO 1248 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1248 gauugauguu uaccgaagug uug 23 <210> SEQ ID NO 1249 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1249 uggugagaug cagaccauuu aau 23 <210> SEQ ID NO 1250 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1250 acucugagua cauuggaaua ugc 23 <210> SEQ ID NO 1251 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1251 ccgaaguguu guuuguccaa uuc 23 <210> SEQ ID NO 1252 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1252 aguuauuaug ggcuauaauu gca 23 <210> SEQ ID NO 1253 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1253 ggaaggugaa aggucaccua aug 23 <210> SEQ ID NO 1254 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1254 uuuuacaaug gaaggugaaa ggu 23 <210> SEQ ID NO 1255 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1255 gaaggugaaa ggucaccuaa uga 23 <210> SEQ ID NO 1256 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1256 aaggugaaag gucaccuaau gaa 23 <210> SEQ ID NO 1257 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1257 uuccuuaucg agaaucuaaa cua 23 <210> SEQ ID NO 1258 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1258 agcucuuauu aaggaguaua cgg 23 <210> SEQ ID NO 1259 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1259 cagagagauu cugugcuuug gag 23 <210> SEQ ID NO 1260 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1260 gaaucuaaac uaacuagaau ccu 23 <210> SEQ ID NO 1261 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1261 acucaccaaa aaagcucuua uua 23 <210> SEQ ID NO 1262 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1262 aagagcuuuu ugaucuucuu aau 23 <210> SEQ ID NO 1263 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1263 ggcguacaag aacaucuaua auu 23 <210> SEQ ID NO 1264 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1264 agauugaugu uuaccgaagu guu 23 <210> SEQ ID NO 1265 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1265 aucuaaacua acuagaaucc ucc 23 <210> SEQ ID NO 1266 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1266 uuaccgaagu guuguuuguc caa 23 <210> SEQ ID NO 1267 <211> LENGTH: 23 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1267 ggugguggug agaugcagac cau 23 <210> SEQ ID NO 1268 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1268 cauacucuag ucguuccca 19 <210> SEQ ID NO 1269 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1269 agcgcccauu caauaguag 19 <210> SEQ ID NO 1270 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1270 ggaaagcuag cgcccauuc 19 <210> SEQ ID NO 1271 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1271 gaaagcuagc gcccauuca 19 <210> SEQ ID NO 1272 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1272 agaaacuacg auugaugga 19 <210> SEQ ID NO 1273 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1273 uguuccuuau cgagaaucu 19 <210> SEQ ID NO 1274 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1274 cagauuaccu cugcgagcc 19 <210> SEQ ID NO 1275 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1275 gcgcccauuc aauaguaga 19 <210> SEQ ID NO 1276 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1276 uugcacuauc uuugcguau 19 <210> SEQ ID NO 1277 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1277 cagagcggaa agcuagcgc 19 <210> SEQ ID NO 1278 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1278 agaccuuauu ugguaaucu 19 <210> SEQ ID NO 1279 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1279 auucucuugg agggcguac 19 <210> SEQ ID NO 1280 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1280 ggcugguaua auuccacgu 19 <210> SEQ ID NO 1281 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1281 gcggaaagcu agcgcccau 19 <210> SEQ ID NO 1282 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1282 ugcacuaucu uugcguaug 19 <210> SEQ ID NO 1283 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1283 guauaauucc acguacccu 19 <210> SEQ ID NO 1284 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1284 agaaucuaaa cuaacuaga 19 <210> SEQ ID NO 1285 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1285 aggagcugaa uaggguuac 19 <210> SEQ ID NO 1286 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1286 gaaguacaua agaccuuau 19 <210> SEQ ID NO 1287 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1287 gacaguggcc gauaagaua 19 <210> SEQ ID NO 1288 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1288 aaaccacuua guagugucc 19 <210> SEQ ID NO 1289 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1289 ucccuagacu ucccuauuu 19 <210> SEQ ID NO 1290 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1290 uagacuuccc uauuucgcu 19 <210> SEQ ID NO 1291 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1291 gcgucgcagc caaauucgu 19 <210> SEQ ID NO 1292 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1292 agcuagcgcc cauucaaua 19 <210> SEQ ID NO 1293 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1293 gaaacuacga uugauggag 19 <210> SEQ ID NO 1294 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1294 ccgauaagau agaagauca 19 <210> SEQ ID NO 1295 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1295 uagcgcccau ucaauagua 19 <210> SEQ ID NO 1296 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1296 uuugcguaug gccaaacug 19 <210> SEQ ID NO 1297 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1297 cacguacccu ucaucaaau 19 <210> SEQ ID NO 1298 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1298 ucuuugcgua uggccaaac 19 <210> SEQ ID NO 1299 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1299 ccgaaguguu guuugucca 19 <210> SEQ ID NO 1300 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1300 agagcggaaa gcuagcgcc 19 <210> SEQ ID NO 1301 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1301 gcuagcgccc auucaauag 19 <210> SEQ ID NO 1302 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1302 aaguuagugu acgaacugg 19 <210> SEQ ID NO 1303 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1303 guacgaacug gaggauugg 19 <210> SEQ ID NO 1304 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1304 acgaacugga ggauuggcu 19 <210> SEQ ID NO 1305 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1305 agauugaugu uuaccgaag 19 <210> SEQ ID NO 1306 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1306 uaugggcuau aauugcacu 19 <210> SEQ ID NO 1307 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1307 aucuuugcgu auggccaaa 19 <210> SEQ ID NO 1308 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1308 acucuagucg uucccacuc 19 <210> SEQ ID NO 1309 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1309 aacuacgauu gauggagaa 19 <210> SEQ ID NO 1310 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1310 gauaagagag cucgggaag 19 <210> SEQ ID NO 1311 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1311 ucgagaaucu aaacuaacu 19 <210> SEQ ID NO 1312 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1312 aacuaacuag aauccucca 19 <210> SEQ ID NO 1313 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1313 ggaucguaag aaggcaguu 19 <210> SEQ ID NO 1314 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1314 aucguaagaa ggcaguuga 19 <210> SEQ ID NO 1315 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1315 aggcaguuga ccaacacaa 19 <210> SEQ ID NO 1316 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1316 uggccgauaa gauagaaga 19 <210> SEQ ID NO 1317 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1317 ucuaaggaua uagucaaca 19 <210> SEQ ID NO 1318 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1318 acuaagcuua auugcuuuc 19 <210> SEQ ID NO 1319 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1319 gcccagauca accuuuaau 19 <210> SEQ ID NO 1320 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1320 uuaauuuggc agagcggaa 19 <210> SEQ ID NO 1321 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1321 uuaucgagaa ucuaaacua 19 <210> SEQ ID NO 1322 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1322 cuagcgccca uucaauagu 19 <210> SEQ ID NO 1323 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1323 aauaguagaa ugugauccu 19 <210> SEQ ID NO 1324 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1324 uacgaaaaga aguuagugu 19 <210> SEQ ID NO 1325 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1325 agaaguuagu guacgaacu 19 <210> SEQ ID NO 1326 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1326 acuaaacaga uugauguuu 19 <210> SEQ ID NO 1327 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1327 cuuugcguau ggccaaacu 19 <210> SEQ ID NO 1328 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1328 aaugaagagu auaccuggg 19 <210> SEQ ID NO 1329 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1329 auaauuccac guacccuuc 19 <210> SEQ ID NO 1330 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1330 acguacccuu caucaaauu 19 <210> SEQ ID NO 1331 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1331 cguacccuuc aucaaauuu 19 <210> SEQ ID NO 1332 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1332 guacccuuca ucaaauuuu 19 <210> SEQ ID NO 1333 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1333 aacuuacuga uaaugguac 19 <210> SEQ ID NO 1334 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1334 uucagucaaa gugucucug 19 <210> SEQ ID NO 1335 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1335 uucuuaaucc aucaucuga 19 <210> SEQ ID NO 1336 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1336 acaguacaca acaaggaug 19 <210> SEQ ID NO 1337 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1337 aagaaacuac gauugaugg 19 <210> SEQ ID NO 1338 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1338 aaacuacgau ugauggaga 19 <210> SEQ ID NO 1339 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1339 uggagcuguu gauaagaga 19 <210> SEQ ID NO 1340 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1340 cuaacuagaa uccuccagg 19 <210> SEQ ID NO 1341 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1341 gaauaugcuc auagagcaa 19 <210> SEQ ID NO 1342 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1342 augcucauag agcaaagaa 19 <210> SEQ ID NO 1343 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1343 aaaaauuggu gcuguugag 19 <210> SEQ ID NO 1344 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1344 gaggagcuga auaggguua 19 <210> SEQ ID NO 1345 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1345 ggagcugaau aggguuaca 19 <210> SEQ ID NO 1346 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1346 gagcugaaua ggguuacag 19 <210> SEQ ID NO 1347 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1347 agcugaauag gguuacaga 19 <210> SEQ ID NO 1348 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1348 gcugaauagg guuacagag 19 <210> SEQ ID NO 1349 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1349 ccaaacugga ucguaagaa 19 <210> SEQ ID NO 1350 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1350 gaucguaaga aggcaguug 19 <210> SEQ ID NO 1351 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1351 accuuauuug guaaucugc 19 <210> SEQ ID NO 1352 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1352 uuagauacca uuacuacag 19 <210> SEQ ID NO 1353 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1353 auaccauuac uacaguagc 19 <210> SEQ ID NO 1354 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1354 uacuacagua gcacuugga 19 <210> SEQ ID NO 1355 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1355 aaaguaaaac uguacuaca 19 <210> SEQ ID NO 1356 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1356 cucaagacug aucuucuaa 19 <210> SEQ ID NO 1357 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1357 uugacagugg ccgauaaga 19 <210> SEQ ID NO 1358 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1358 ugacaguggc cgauaagau 19 <210> SEQ ID NO 1359 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1359 gcaaugugga aaccuaacu 19 <210> SEQ ID NO 1360 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1360 ccacuuagua guguccagg 19 <210> SEQ ID NO 1361 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1361 agaagguaca aaauugguu 19 <210> SEQ ID NO 1362 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1362 ugguuugacu aagcuuaau 19 <210> SEQ ID NO 1363 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1363 gguuugacua agcuuaauu 19 <210> SEQ ID NO 1364 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1364 ucuaagucaa gagccaucu 19 <210> SEQ ID NO 1365 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1365 ucaucccuau aguucacuu 19 <210> SEQ ID NO 1366 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1366 caucccuaua guucacuuu 19 <210> SEQ ID NO 1367 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1367 cccuagacuu cccuauuuc 19 <210> SEQ ID NO 1368 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1368 agacuucccu auuucgcuu 19 <210> SEQ ID NO 1369 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1369 ucaccaaacc auuuguaga 19 <210> SEQ ID NO 1370 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1370 uccuuuaaga ggccuaacu 19 <210> SEQ ID NO 1371 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1371 uuuaagaggc cuaacucau 19 <210> SEQ ID NO 1372 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1372 uuaagaggcc uaacucauu 19 <210> SEQ ID NO 1373 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1373 ggccuaacuc auucacccu 19 <210> SEQ ID NO 1374 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1374 ugguauuuuu gaucuggca 19 <210> SEQ ID NO 1375 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1375 aguuuagugu guaaaguuu 19 <210> SEQ ID NO 1376 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1376 gccaaauucg ucugcgaag 19 <210> SEQ ID NO 1377 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1377 aauucgucug cgaagaaga 19 <210> SEQ ID NO 1378 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1378 ugaaagguca ccuaaugaa 19 <210> SEQ ID NO 1379 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1379 cagaccauuu aauuuggca 19 <210> SEQ ID NO 1380 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1380 agaccauuua auuuggcag 19 <210> SEQ ID NO 1381 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1381 aguuauuaug ggcuauaau 19 <210> SEQ ID NO 1382 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1382 gcugguauaa uuccacgua 19 <210> SEQ ID NO 1383 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1383 auuuaauuug gcagagcgg 19 <210> SEQ ID NO 1384 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1384 uuuaauuugg cagagcgga 19 <210> SEQ ID NO 1385 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1385 uuuggcagag cggaaagcu 19 <210> SEQ ID NO 1386 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1386 uuuuacaaug gaaggugaa 19 <210> SEQ ID NO 1387 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1387 aauggaaggu gaaagguca 19 <210> SEQ ID NO 1388 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1388 ugagaugcag accauuuaa 19 <210> SEQ ID NO 1389 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1389 ucgcagccaa auucgucug 19 <210> SEQ ID NO 1390 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1390 ggcuauaauu gcacuaucu 19 <210> SEQ ID NO 1391 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1391 auugacagug gccgauaag 19 <210> SEQ ID NO 1392 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1392 cuagacuucc cuauuucgc 19 <210> SEQ ID NO 1393 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1393 acuaucuuug cguauggcc 19 <210> SEQ ID NO 1394 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1394 auacucuagu cguucccac 19 <210> SEQ ID NO 1395 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1395 aaagaaacua cgauugaug 19 <210> SEQ ID NO 1396 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1396 gccuugauuu uuuggcggg 19 <210> SEQ ID NO 1397 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1397 cgcccauuca auaguagaa 19 <210> SEQ ID NO 1398 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1398 ccuuauuugg uaaucugcu 19 <210> SEQ ID NO 1399 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1399 agagacaauu ccggaugug 19 <210> SEQ ID NO 1400 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1400 ugacuuugau agcuaaauu 19 <210> SEQ ID NO 1401 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1401 uggcagagcg gaaagcuag 19 <210> SEQ ID NO 1402 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1402 gagcggaaag cuagcgccc 19 <210> SEQ ID NO 1403 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1403 aaagaaguua guguacgaa 19 <210> SEQ ID NO 1404 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1404 auugcacuau cuuugcgua 19 <210> SEQ ID NO 1405 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1405 gguauaauuc cacguaccc 19 <210> SEQ ID NO 1406 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1406 uacucuaguc guucccacu 19 <210> SEQ ID NO 1407 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1407 uaugaaagaa acuacgauu 19 <210> SEQ ID NO 1408 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1408 augcuagaag uacauaaga 19 <210> SEQ ID NO 1409 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1409 aaguacauaa gaccuuauu 19 <210> SEQ ID NO 1410 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1410 acagccugag cuguuaaug 19 <210> SEQ ID NO 1411 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1411 aaagaagaga caauuccgg 19 <210> SEQ ID NO 1412 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1412 cacacuggag aggucuaaa 19 <210> SEQ ID NO 1413 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1413 cacuggagag gucuaaagu 19 <210> SEQ ID NO 1414 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1414 acuggagagg ucuaaagug 19 <210> SEQ ID NO 1415 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1415 cgucgcagcc aaauucguc 19 <210> SEQ ID NO 1416 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1416 gaaggcaguu gaccaacac 19 <210> SEQ ID NO 1417 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1417 cauucacccu gacagaguu 19 <210> SEQ ID NO 1418 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1418 aagaggccua acucauuca 19 <210> SEQ ID NO 1419 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1419 gagacaauuc cggaugugg 19 <210> SEQ ID NO 1420 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1420 uuccggaugu ggauguaga 19 <210> SEQ ID NO 1421 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1421 aagcuagcgc ccauucaau 19 <210> SEQ ID NO 1422 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1422 gaaguuagug uacgaacug 19 <210> SEQ ID NO 1423 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1423 uauaauucca cguacccuu 19 <210> SEQ ID NO 1424 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1424 acaguggccg auaagauag 19 <210> SEQ ID NO 1425 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1425 ucugucaucc cuauaguuc 19 <210> SEQ ID NO 1426 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1426 uucuugcuau gacuugugu 19 <210> SEQ ID NO 1427 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1427 guaagaaggc aguugacca 19 <210> SEQ ID NO 1428 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1428 cauugacagu ggccgauaa 19 <210> SEQ ID NO 1429 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1429 agaaaccacu uaguagugu 19 <210> SEQ ID NO 1430 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1430 ggauuguuca ucaauuggc 19 <210> SEQ ID NO 1431 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1431 uaagaggccu aacucauuc 19 <210> SEQ ID NO 1432 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1432 aguuagugua cgaacugga 19 <210> SEQ ID NO 1433 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1433 aguacauaag accuuauuu 19 <210> SEQ ID NO 1434 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1434 ugagccuugu guauagauu 19 <210> SEQ ID NO 1435 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1435 ccuuuaagag gccuaacuc 19 <210> SEQ ID NO 1436 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1436 accacuuagu aguguccag 19 <210> SEQ ID NO 1437 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1437 gaaacuucca auuaugucu 19 <210> SEQ ID NO 1438 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1438 ugcauacucu agucguucc 19 <210> SEQ ID NO 1439 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1439 agaaggcagu ugaccaaca 19 <210> SEQ ID NO 1440 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1440 guacauaaga ccuuauuug 19 <210> SEQ ID NO 1441 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1441 uauaauugca cuaucuuug 19 <210> SEQ ID NO 1442 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1442 ucucuguuac aauacauau 19 <210> SEQ ID NO 1443 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1443 uaugcucaua gagcaaaga 19 <210> SEQ ID NO 1444 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1444 uguuguuugu ccaauucug 19 <210> SEQ ID NO 1445 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1445 acuaacuaga auccuccag 19 <210> SEQ ID NO 1446 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1446 uguggugucu auacugaaa 19 <210> SEQ ID NO 1447 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1447 uauuauggga gaccaccca 19 <210> SEQ ID NO 1448 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1448 aaggaugaag ucuaucaaa 19 <210> SEQ ID NO 1449 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1449 uugauaagag agcucggga 19 <210> SEQ ID NO 1450 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1450 auguuccuua ucgagaauc 19 <210> SEQ ID NO 1451 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1451 ggaauaugcu cauagagca 19 <210> SEQ ID NO 1452 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1452 ccauuccaaa cuggaucgu 19 <210> SEQ ID NO 1453 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1453 ggcaguugac caacacaau 19 <210> SEQ ID NO 1454 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1454 caugcuagaa guacauaag 19 <210> SEQ ID NO 1455 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1455 cuagaaguac auaagaccu 19 <210> SEQ ID NO 1456 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1456 uuggaucucu cacaucuau 19 <210> SEQ ID NO 1457 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1457 aacuguggug ucuauacug 19 <210> SEQ ID NO 1458 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1458 ucauugacag uggccgaua 19 <210> SEQ ID NO 1459 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1459 auaaagcaga cccauuccc 19 <210> SEQ ID NO 1460 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1460 acagaaacca cuuaguagu 19 <210> SEQ ID NO 1461 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1461 gaaaccacuu aguaguguc 19 <210> SEQ ID NO 1462 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1462 aaaucuaagg auauaguca 19 <210> SEQ ID NO 1463 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1463 uuauuuauac ccaucaaca 19 <210> SEQ ID NO 1464 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1464 acagaggcau uaacacacu 19 <210> SEQ ID NO 1465 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1465 acacacugga gaggucuaa 19 <210> SEQ ID NO 1466 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1466 acacuggaga ggucuaaag 19 <210> SEQ ID NO 1467 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1467 cgagcccaga ucaaccuuu 19 <210> SEQ ID NO 1468 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1468 ucccuauuuc gcuuucucc 19 <210> SEQ ID NO 1469 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1469 ucuaaaauca cugucaaca 19 <210> SEQ ID NO 1470 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1470 agccaaauuc gucugcgaa 19 <210> SEQ ID NO 1471 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1471 cccauucaau aguagaaug 19 <210> SEQ ID NO 1472 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1472 gaugaaugca uacucuagu 19 <210> SEQ ID NO 1473 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1473 cucauguucc uuaucgaga 19 <210> SEQ ID NO 1474 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1474 gagaaucuaa acuaacuag 19 <210> SEQ ID NO 1475 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1475 uagaaguaca uaagaccuu 19 <210> SEQ ID NO 1476 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1476 cagccugagc uguuaauga 19 <210> SEQ ID NO 1477 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1477 aagaagagac aauuccgga 19 <210> SEQ ID NO 1478 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1478 ugcuggugug gauuguuca 19 <210> SEQ ID NO 1479 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1479 aaauucgucu gcgaagaag 19 <210> SEQ ID NO 1480 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1480 uuucuggaag uugagaugu 19 <210> SEQ ID NO 1481 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1481 uacuaaacag auugauguu 19 <210> SEQ ID NO 1482 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1482 gauugauguu uaccgaagu 19 <210> SEQ ID NO 1483 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1483 gcacuaucuu ugcguaugg 19 <210> SEQ ID NO 1484 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1484 ugguauaauu ccacguacc 19 <210> SEQ ID NO 1485 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1485 agcaagcugc uuaacacag 19 <210> SEQ ID NO 1486 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1486 cagaaaccac uuaguagug 19 <210> SEQ ID NO 1487 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1487 aacuuauugg agguuguaa 19 <210> SEQ ID NO 1488 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1488 cuggagaggu cuaaagugg 19 <210> SEQ ID NO 1489 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1489 aaaaaagaua uaaggcagu 19 <210> SEQ ID NO 1490 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1490 gaauuuugau aucuaccca 19 <210> SEQ ID NO 1491 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1491 guauuuuuga ucuggcaac 19 <210> SEQ ID NO 1492 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1492 aggaucccuu ggcugguau 19 <210> SEQ ID NO 1493 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1493 ggaucccuug gcugguaua 19 <210> SEQ ID NO 1494 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1494 caauaguaga augugaucc 19 <210> SEQ ID NO 1495 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1495 gcuauaauug cacuaucuu 19 <210> SEQ ID NO 1496 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1496 uacccuucau caaauuuuu 19 <210> SEQ ID NO 1497 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1497 agaacauauu gaauaagcc 19 <210> SEQ ID NO 1498 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1498 aaauuggugc uguugagga 19 <210> SEQ ID NO 1499 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1499 ugaauagggu uacagaguu 19 <210> SEQ ID NO 1500 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1500 aagaacuuga aaccacuca 19 <210> SEQ ID NO 1501 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1501 aauaaagcag acccauucc 19 <210> SEQ ID NO 1502 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1502 auacccauca acacuggua 19 <210> SEQ ID NO 1503 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1503 uggauuguuc aucaauugg 19 <210> SEQ ID NO 1504 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1504 uggagagguc uaaagugga 19 <210> SEQ ID NO 1505 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1505 gucaucccua uaguucacu 19 <210> SEQ ID NO 1506 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1506 auaauggcua uaauuucuc 19 <210> SEQ ID NO 1507 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1507 aucccuuggc ugguauaau 19 <210> SEQ ID NO 1508 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1508 gggcuauaau ugcacuauc 19 <210> SEQ ID NO 1509 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1509 gauucucuug gagggcgua 19 <210> SEQ ID NO 1510 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1510 gcaucucuca aucuugagg 19 <210> SEQ ID NO 1511 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1511 cagcagaaau cuaaggaua 19 <210> SEQ ID NO 1512 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1512 gucaagagcc aucuguaga 19 <210> SEQ ID NO 1513 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1513 aaacagaggc auuaacaca 19 <210> SEQ ID NO 1514 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1514 agcccagauc aaccuuuaa 19 <210> SEQ ID NO 1515 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1515 uauuuuugau cuggcaacc 19 <210> SEQ ID NO 1516 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1516 uguuuggagc aucuacuaa 19 <210> SEQ ID NO 1517 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1517 gaaauuacag uacacaaca 19 <210> SEQ ID NO 1518 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1518 acuugaccag uguaaaucu 19 <210> SEQ ID NO 1519 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1519 accaguguaa aucugaccu 19 <210> SEQ ID NO 1520 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1520 agaacaauca uuagcagca 19 <210> SEQ ID NO 1521 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1521 caauguggaa accuaacug 19 <210> SEQ ID NO 1522 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1522 accaagaagg uacaaaauu 19 <210> SEQ ID NO 1523 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1523 gguacaaaau ugguugaag 19 <210> SEQ ID NO 1524 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1524 gguguggauu guucaucaa 19 <210> SEQ ID NO 1525 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1525 agaguucaca aaaagccca 19 <210> SEQ ID NO 1526 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1526 ugauagcuaa auuaaacca 19 <210> SEQ ID NO 1527 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1527 aauaagccug aagugaauc 19 <210> SEQ ID NO 1528 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1528 caguugacca acacaaugc 19 <210> SEQ ID NO 1529 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1529 ugguguggau uguucauca 19 <210> SEQ ID NO 1530 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1530 auucacccug acagaguuc 19 <210> SEQ ID NO 1531 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1531 uaagaccuua uuugguaau 19 <210> SEQ ID NO 1532 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1532 aagcaaugug gaaaccuaa 19 <210> SEQ ID NO 1533 <211> LENGTH: 19 <212> TYPE: RNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide <400> SEQUENCE: 1533 ucugaaacug gauauccca 19



Patent applications by Anke Geick, Bayreuth DE

Patent applications by David Bumcrot, Belmont, MA US

Patent applications by Hans-Peter Vornlocher, Bayreuth DE

Patent applications by Pamela Tan, Kulmbach DE

Patent applications in class Antisense or RNA interference

Patent applications in all subclasses Antisense or RNA interference


User Contributions:

Comment about this patent or add new information about this topic:

CAPTCHA
People who visited this patent also read:
Patent application numberTitle
20130180020Liriope muscari plant named 'LIRES'
20130180019PROBE SHAPE EVALUATION METHOD FOR A SCANNING PROBE MICROSCOPE
20130180018QUANTITATIVE CHARACTERIZATION OF METALLIC AND SEMICONDUCTOR SINGLE-WALLED CARBON NANOTUBE RATIOS
20130180017WATERMELON VARIETY NUN 01009 WMW
20130180016COMBINATIONS INCLUDING CRY34AB/35AB AND CRY3BA PROTEINS TO PREVENT DEVELOPMENT OF RESISTANCE IN CORN ROOTWORMS (DIABROTICA SPP.)
Similar patent applications:
DateTitle
2013-07-25Composition comprising xanthoceras sorbifolia extracts, compounds isolated from same, methods for preparing same and uses thereof
2013-07-25Polysaccharides compositions comprising fucans and galactans and their use to reduce extravasation and inflammation
2013-07-25Tumor growth controlling method targeting galactosylceramide expression factor-1
2013-07-25Peptide antagonists of zonulin and methods for use of the same
2013-07-25Compounds for inhibition of cancer cell proliferation
New patent applications in this class:
DateTitle
2022-05-05Kit, device, and method for detecting uterine leiomyosarcoma
2022-05-05Prevention or treatment of fibrotic disease
2022-05-05Compositions for suppressing trim28 and uses thereof
2022-05-05Immunostimulatory bacteria engineered to colonize tumors, tumor-resident immune cells, and the tumor microenvironment
2022-05-05Anti-mirna carrier conjugated with a peptide binding to a cancer cell surface protein and use thereof
New patent applications from these inventors:
DateTitle
2022-07-28Rnai inhibition of alpha-enac expression
2021-12-30Compositions and methods for inhibiting expression of the pcsk9 gene
2016-12-29Rnai inhibition of alpha-enac expression
Top Inventors for class "Drug, bio-affecting and body treating compositions"
RankInventor's name
1Anthony W. Czarnik
2Ulrike Wachendorff-Neumann
3Ken Chow
4John E. Donello
5Rajinder Singh
Website © 2025 Advameg, Inc.