Patent application title: OSTEOPROTEGERIN
Inventors:
William J. Boyle (Moorpark, CA, US)
David L. Lacey (Thousand Oaks, CA, US)
Frank J. Calzone (Westlake Village, CA, US)
Frank J. Calzone (Westlake Village, CA, US)
Ming-Shi Chang (Newbury Park, CA, US)
IPC8 Class: AA61K3819FI
USPC Class:
514 169
Class name: Peptide (e.g., protein, etc.) containing doai bone affecting osteoporosis
Publication date: 2010-11-25
Patent application number: 20100298229
Claims:
1-60. (canceled)
61. A truncated OPG polypeptide encoded by a nucleic acid which hybridizes under high stringency conditions corresponding to 5.times.SSC, 50% formamide and 42.degree. C. and washing at 0.5.times.SSC at 55.degree. C. with the complement of the nucleic acid sequence as shown in SEQ ID NO: 124, wherein the truncated OPG polypeptide comprises at least about 164 amino acids comprising four cysteine-rich domains characteristic of the cysteine rich domains of tumor necrosis factor extracellular regions and has the activity of inhibiting bone resorption.
62. The polypeptide of claim 61 comprising cysteine residues at positions 41, 44, 54, 62, 65, 80, 83, 87, 98, 105, 107, 118, 124, 142, 145, 160, 166 and 185 as shown in SEQ ID NO: 125.
63. The polypeptide of claim 61 further comprising an Fc region of human IgG or a derivative of an Fc region of human IgG.
64. The polypeptide of claim 61 which is the product of an exogenous DNA in a transformed or transfected host cell.
65. The polypeptide of claim 61 wherein the exogenous DNA is cDNA, genomic DNA or synthetic DNA.
66. The polypeptide of claim 61 wherein the host cell is a prokaryotic or eucaryotic host cell.
67. The polypeptide of claim 66 wherein the host cell is selected from CHO, COS, 293, 3T3, CV-1 or BHK cells.
68. The polypeptide of claim 66 wherein the host cell is Escherichia coli.
69. The polypeptide of claim 61 further comprising a water soluble polymer.
70. The polypeptide of claim 69 wherein the water soluble polymer is polyethylene glycol or dextran.
71. A pharmaceutical composition comprising a therapeutically effective amount of the polypeptide of claim 61 and one or more of a pharmaceutically acceptable carrier, adjuvant, solubilizer, stabilizer and anti-oxidant.
72. An OPG multimer comprising monomers which comprise a truncated OPG polypeptide encoded by a nucleic acid which hybridizes under high stringency conditions corresponding to 5.times.SSC, 50% formamide and 42.degree. C. and washing at 0.5.times.SSC at 55.degree. C. with the complement of the nucleic acid sequence as shown in SEQ ID NO: 124, wherein the truncated OPG polypeptide comprises at least about 164 amino acids comprising four cysteine-rich domains characteristic of the cysteine rich domains of tumor necrosis factor extracellular regions and the OPG multimer has the activity of inhibiting bone resorption.
Description:
[0001]This application is a divisional of Ser. No. 09/718,725, filed Nov.
22, 2000, which is a continuation of Ser. No. 09/132,985 filed Aug. 12,
1998, which is a continuation of Ser. No. 08/771,777, filed Dec. 20,
1996, which is a continuation in part of Ser. No. 08/706,945, filed Sep.
3, 1996, which is a continuation in part of Ser. No. 08/577,788, filed
Dec. 22, 1995, which are hereby incorporated by reference.
[0002]The instant application contains an ASCII "txt" complaint sequence listing submitted via EFS-WEB on Dec. 14, 2009, which serves as both the computer readable form (CRF) and the paper copy required by 37 C.F.R. Section 1.821(c) and 1.821(e), which is hereby incorporated by reference in its entirety. The name of the "txt" file created on Dec. 18, 2002, is: A-378-US-DIV7SeqListFromA-378CIP2C3ST25-Created121802.txt and is 113 KB in size.
FIELD OF THE INVENTION
[0003]The invention relates generally to polypeptides involved in the regulation of bone metabolism. More particularly, the invention relates to a novel polypeptide, termed osteoprotegerin, which is a member of the tumor necrosis factor receptor superfamily. The polypeptide is used to treat bone diseases characterized by increased bone loss such as osteoporosis.
BACKGROUND OF THE INVENTION
[0004]Polypeptide growth factors and cytokines are secreted factors which signal a wide variety of changes in cell growth, differentiation, and metabolism, by specifically binding to discrete, surface bound receptors. As a class of proteins, receptors vary in their structure and mode of signal transduction. They are characterized by having an extracellular domain that is involved in ligand binding, and cytoplasmic domain which transmits an appropriate intracellular signal. Receptor expression patterns ultimately determine which cells will respond to a given ligand, while the structure of a given receptor dictates the cellular response induced by ligand binding. Receptors have been shown to transmit intracellular signals via their cytoplasmic domains by activating protein tyrosine, or protein serine/threonine phosphorylation (e.g., platelet derived growth factor receptor (PDGFR) or transforming growth factor-β receptor-I (TGFβR-I), by stimulating G-protein activation (e.g., β-adrenergic receptor), and by modulating associations with cytoplasmic signal transducing proteins (e.g., TNFR-1 and Fas/APO) (Heldin, Cell 80, 213-223 (1995)).
[0005]The tumor necrosis factor receptor (TNFR) superfamily is a group of type I transmembrane proteins which share a conserved cysteine-rich motif which is repeated three to six times in the extracellular domain (Smith, et al. Cell 76, 953-962 (1994)). Collectively, these repeat units form the ligand binding domains of these receptors (Chen et al., Chemistry 270, 2874-2878 (1995)). The ligands for these receptors are a structurally related group of proteins homologous to TNFα. (Goeddel et al. Cold Spring Harbor Symp. Quart. Biol. 51, 597-609 (1986); Nagata et al. Science 267, 1449-1456 (1995)). TNFα binds to distinct, but closely related receptors, TNFR-1 and TNFR-2. TNFα produces a variety of biological responses in receptor bearing cells, including, proliferation, differentiation, and cytotoxicity and apoptosis (Beutler et al. Ann. Rev. Biochem. 57, 505-518 (1988)).
[0006]TNFα is believed to mediate acute and chronic inflammatory responses (Beutler et al. Ann. Rev. Biochem. 57, 505-508 (1988)). Systemic delivery of TNFα induces toxic shock and widespread tissue necrosis. Because of this, TNFα may be responsible for the severe morbidity and mortality associated with a variety of infectious diseases, including sepsis. Mutations in FasL, the ligand for the TNFR-related receptor Fas/APO (Suda et al. Cell 75, 1169-1178 (1993)), is associated with autoimmunity (Fisher et al. Cell 81, 935-946 (1995)), while overproduction of FasL may be implicated in drug-induced hepatitis. Thus, ligands to the various TNFR-related proteins often mediate the serious effects of many disease states, which suggests that agents that neutralize the activity of these ligands would have therapeutic value. Soluble TNFR-1 receptors, and antibodies that bind TNFα, have been tested for their ability to neutralize systemic TNFα (Loetscher et al. Cancer Cells 3(6), 221-226 (1991)). A naturally occurring form of a secreted TNFR-1 mRNA was recently cloned, and its product tested for its ability to neutralize TNFα activity in vitro and in vivo (Kohno et al. PNAS USA 87, 8331-8335 (1990)). The ability of this protein to neutralize TNFα suggests that soluble TNF receptors function to bind and clear TNF thereby blocking the cytotoxic effects on TNFR-bearing cells.
[0007]An object of the invention to identify new members of the TNFR super family. It is anticipated that new family members may be transmembrane proteins or soluble forms thereof comprising extracellular domains and lacking transmembrane and cytoplasmic domains. We have identified a new member of the TNFR superfamily which encodes a secreted protein that is closely related to TNFR-2. By analogy to soluble TNFR-1, the TNFR-2 related protein may negatively regulate the activity of its ligand, and thus may be useful in the treatment of certain human diseases.
SUMMARY OF THE INVENTION
[0008]A novel member of the tumor necrosis factor receptor (TNFR) superfamily has been identified from a fetal rat intestinal cDNA library. A full-length cDNA clone was obtained and sequenced. Expression of the rat cDNA in a transgenic mouse revealed a marked increase in bones density, particularly in long bones, pelvic bone and vertebrae. The polypeptide encoded by the cDNA is termed Osteprotegerin (OPG) and plays a role in promoting bone accumulation.
[0009]The invention provides for nucleic acids encoding a polypeptide having at least one of the biological activities of OPG. Nucleic acids which hybridize to nucleic acids encoding mouse, rat or human OPG as shown in FIGS. 2B-2C (SEQ ID NO:120), 9A-9B (SEQ ID NO: 122), and 9C-9D (SEQ ID NO: 124) are also provided. Preferably, OPG is mammalian OPG and more preferably is human OPG. Recombinant vectors and host cells expressing OPG are also encompassed as are methods of producing recombinant OPG. Antibodies or fragments thereof which specifically bind the polypeptide are also disclosed.
[0010]Methods of treating bone diseases are also provided by the invention. The polypeptides are useful for preventing bone resorption and may be used to treat any condition resulting in bone loss such as osteoporosis, hypercalcemia, Paget's disease of bone, and bone loss due to rheumatoid arthritis or osteomyelitis, and the like. Bone diseases may also be treated with anti-sense or gene therapy using nucleic acids of the invention. Pharmaceutical compositions comprising OPG nucleic acids and polypeptides are also encompassed.
DESCRIPTION OF THE FIGURES
[0011]FIG. 1. A. FASTA analysis of novel EST LORF. Shown is the deduced FRI-1 amino acid sequence aligned to the human TNFR-2 sequence. B. Profile analysis of the novel EST LORF shown is the deduced FRI-1 amino acid sequence aligned to the TNFR-profile. C. Structural view of TNFR superfamily indicating region which is homologous to the novel FRI-1.
[0012]FIG. 2. Structure and sequence of full length rat OPG gene, a novel member of the TNFR superfamily. A. Map of pMOB-B1.1 insert. Box indicates position of LORF within the cDNA sequence (bold line). Black box indicates signal peptide, and gray ellipses indicate position of cysteine-rich repeat sequences. B, C. Nucleic acid and protein sequence of the Rat OPG cDNA. The predicted signal peptide is underlined, and potential sites of N-linked glycosylation are indicated in bold, underlined letters. D, E. Pileup sequence comparison (Wisconsin GCG Package, Version 8.1) of OPG with other members of the TNFR superfamily, fas (SEQ ID NO:128); tnfr1 (SEQ ID NO: 129); sfu-t2 (SEQ ID NO:130); tnfr2 (SEQ ID NO:131); cd40 (SEQ ID NO:132); osteo (SEQ ID NO:133); ngfr (SEQ ID NO:134); ox40 (SEQ ID NO:135); 41bb (SEQ ID NO:136).
[0013]FIG. 3. PepPlot analysis (Wisconsin GCG Package, Version 8.1) of the predicted rat OPG protein sequence. A. Schematic representation of rat OPG showing hydrophobic (up) and hydrophilic (down) amino acids. Also shown are basic (up) and acidic (down) amino acids. B. Display of amino acid residues that are beta-sheet forming (up) and beta-sheet breaking down) as defined by Chou and Fasman (Adv. Enz. 47, 45-147 (1948)). C. Display of propensity measures for alpha-helix and beta-sheet (Chou and Fasman, ibid). Curves above 1.00 show propensity for alpha-helix or beta-sheet structure. Structure may terminate in regions of protein where curves drop below 1.00. D. Display of residues that are alpha-forming (up) or alpha-breaking (down). E. Display of portions of the protein sequence that resemble sequences typically found at the amino end of alpha and beta structures (Chou and Fasman, ibid). F. Display of portions of the protein sequence that resemble sequences typically found at the carboxyl end of alpha and beta structures (Chou and Fasman, ibid). G. Display of portions of the proteins sequence typically found in turns (Chou and Fasman, ibid) H. Display of the helical hydrophobic moment (Eisenberg et al. Proc. Natl. Acad. Sci. USA 81, 140-144 (1984)) at each position in the sequence. I. Display of average hydrophathy based upon Kyte and Doolittle (J. Mol. Biol. 157, 105-132 (1982)) and Goldman et al. (reviewed in Ann. Rev. Biophys. Biophys. Chem. 15, 321-353 (1986)).
[0014]FIG. 4. mRNA expression patterns for the OPG cDNA in human tissues. Northern blots were probed with a 32P-labeled rat cDNA insert (A, left two panels), or with the human cDNA insert (B, right panel).
[0015]FIG. 5. Creation of transgenic mice expressing the OPG cDNA in hepatocytes. Northern blot expression of HE-OPG transgene in mouse liver.
[0016]FIG. 6. Increase in bone density in OPG transgenic mice. Panel A-F. Control Mice. G-J, OPG expressing mice. At necropsy, all animals were radiographed and photographs prepared. In A-F, the radiographs of the control animals and the one transgenic non-expressor (#28) are shown. Note that the bones have a clearly defined cortex and a lucent central marrow cavity. In contrast, the OPG (G-J) animals have a poorly defined cortex and increased density in the marrow zone.
[0017]FIG. 7. Increase in trabecular bone in OPG transgenic mice. A-D. Representative photomicrographs of bones from control animals. In A and B, low (4×, 10×) power images of the femurs are shown (Masson Trichrome stain). Stains for tartrate resistant acid phosphatase (TRAP) demonstrate osteoclasts (see arrows) both resorbing cartilage (C) and trabecular bone (D). Note the flattened appearance of osteoclasts on trabecular bone. E-H. Representative photomicrographs of bones from OPG-expressing animals. In E and F, low (4×, 10×) power images of the femurs are shown (Masson Trichrome stain). The clear region is the growth plate cartilage, blue stained area is bone, and the red area is marrow. Note that in contrast to the controls, the trabecular bone has not been resorbed resulting in the absence of the usual marrow cavity. Also, the resulting trabeculae have a variegated appearance with blue and clear areas. The clear areas are remnants of growth plate cartilage that have never been remodeled. Based on TRAP stains, these animals do have osteoclasts (see arrows) at the growth plate (G), which may be reduced in number. However, the surfaces of the trabeculae away from the growth plate are virtually devoid of osteoclasts (H), a finding that stands in direct contrast with the control animals (see D).
[0018]FIG. 8. HE-OPG expressors do not have a defect in monocyte-macrophage development. One cause for osteopetrosis in mice is defective M-CSF production due to a point mutation in the M-CSF gene. This results in a marked deficit of circulating and tissue based macrophages. The peripheral blood of OPG expressors contained monocytes as assessed by H1E analysis. To affirm the presence of tissue macrophages, immnohistochemistry was performed using F480 antibodies, which recognize a cell surface antigen on murine macrophages. A and C show low power (4×) photomicrographs of the spleens from normal and CR1 overexpressors. Note that both animals have numerous F480 positive cells. Monocyte-macrophages were also present in the marrow of normal (B) and HE-OPG overexpressors (D) (40×).
[0019]FIG. 9. Structure and sequence of mouse and human OPG cDNA clones. A, B. Mouse cDNA and protein sequence. C, D. Human cDNA and protein sequence. The predicted signal peptides are underlined, and potential sites of N-linked glycosylation are indicated in bold. E, F. Sequence alignment and comparison of rat, mouse and human OPG amino acid sequences.
[0020]FIG. 10. Comparison of conserved sequences in extracellular domain of TNFR-1 and human OPG. PrettyPlot (Wisconsin GCG Package, Version 8.1) of the TNFR1 and OPG alignment described in example 6. Top line, human TNFR1 sequences encoding domains 1-4. Bottom line, human OPG sequences encoding domains 1-4. Conserved residues are highlighted by rectangular boxes.
[0021]FIG. 11. Three-dimensional representation of human OPG. Side-view of the Molescript display of the predicted 3-dimensional structure of human OPG residues 25 through 163, (wide line), co-crystallized with human TNFβ (thin line). As a reference for orientation, the bold arrows along the OPG polypeptide backbone are pointing in the N-terminal to C-terminal direction. The location of individual cysteine residue side chains are inserted along the polypeptide backbone to help demonstrate the separate cysteine-rich domains. The TNFβ molecule is aligned as described by Banner et al. (1993).
[0022]FIG. 12. Structure of OPG cysteine-rich domains. Alignment of the human (top line SEQ ID NO:136) and mouse (bottom line) OPG amino acid sequences highlighting the predicted domain structure of OPG. The polypeptide is divided into two halves; the N-terminus (A), and C-terminus (B). The N-terminal half is predicted to contain four cysteine rich domains (labeled 1-4). The predicted intrachain disulfide bonds are indicated by bold lines, labeled "SS1", "SS2", or "SS3". Tyrosine 28 and histidine 75 (underlined) are predicted to form an ionic interaction. Those amino acids predicted to interact with an OPG ligand are indicated by bold dots above the appropriate residue. The cysteine residues located in the C-terminal half of OPG are indicated by rectangular boxes.
[0023]FIG. 13. Expression and secretion of full length and truncated mouse OPG-Fc fusion proteins. A. Map indicating points of fusion to the human IgG1 Fc domain are indicated by arrowheads. B. Silver stain of a SDS-polyacrylamide gel of conditioned media obtained from cells expressing either Fl.Fc (Full length OPG fused to Fc at Leucine 401) or CT.Fc (Carboxy-terminal truncated OPG fused to Fc at threonine 180) fusion protein expression vectors. Lane 1, parent pCEP4 expression vector cell line; Lane 2, Fl.Fc vector cell line; Lane 3, CT.Fc vector cell line. C. Western blot of conditioned media obtained from Fl.Fc and CT.Fc fusion protein expression vectors probed with anti-human IgG1 Fc domain (Pierce). Lane 1, parent pCEP4 expression vector cell line; Lane 2, Fl.Fc vector cell line; Lane 3, CT.Fc vector cell line.
[0024]FIG. 14. Expression of human OPG in E. coli. A. Construction of a bacterial expression vector. The LORF of the human OPG gene was amplified by PCR, then joined to a oligonucleotide linker fragment (top strand is SEQ ID NO:137; bottom strand is SEQ ID NO:127), and ligated into pAMG21 vector DNA. The resulting vector is capable of expressing OPG residues 32-401 linked to a N-terminal methionine residue. B SDS-PAGE analysis of uninduced and induced bacterial harboring the pAMG21-human OPG-32-401 plasmid. Lane 1, MW standards; lane 2, uninduced bacteria; lane 3, 30° C. induction; lane 4, 37° C. induction; lane 5, whole cell lysate from 37° C. induction; lane 6, soluble fraction of whole cell lysate; lane 7, insoluble fraction of whole cell lysate; lane 8, purified inclusion bodies obtained from whole cell lysate.
[0025]FIG. 15. Analysis of recombinant murine OPG produced in CHO cells by SDS-PAGE and western blotting. An equal amount of CHO conditioned media was applied to each lane shown, and was prepared by treatment with either reducing sample buffer (left lane), or non-reducing sample buffer (right lane). After electrophoresis, the resolved proteins were transferred to a nylon membrane, then probed with anti-OPG antibodies. The relative positions of the 55 kd monomeric and 100 kd dimeric forms of OPG are indicated by arrowheads.
[0026]FIG. 16. Pulse-chase analysis of recombinant murine OPG produced in CHO cells. CHO cells were pulse-labeled with 35S-methionine/cysteine, then chased for the indicated time. Metabolically labeled cultures were separated into both conditioned media and cells, and detergent extracts were prepared from each, clarified, then immunoprecipitated with anti-OPG antibodies. The immunoprecipitates were the resolved by SDS-PAGE, and exposed to film. Top left and right panels; samples analyzed under non-reducing conditions. Lower left and right panels; samples analyzed under reducing conditions. Top and bottom left panels; Cell extracts. Top and bottom right panels; Conditioned media extracts. The relative mobility of the 55 kd monomeric and 100 kd dimeric forms of OPG are indicated by arrowheads.
[0027]FIG. 17. Expression of OPG in the CTLL-2 cell line. Serum-free conditioned media from CTLL-2 cells and CHO-mu OPG [1-401] transfected cells was prepared, concentrated, then analyzed by non-reducing SDS-PAGE and western blotting. Left lane; CTLL-2 conditioned media. Right lane; CHO-muOPG conditioned media. The relative mobility of the 55 kd monomeric and 100 kd dimeric forms of OPG are indicated by arrowheads.
[0028]FIG. 18. Detection of OPG expression in serum samples and liver extracts obtained from control and OPG transgenic mice. Transgenic mice were constructed as described in Example 4. OPG expression was visualized after SDS-PAGE followed by Western blotting using anti-OPG antibodies.
[0029]FIG. 19. Effects of huOPG [22-401]-Fc fusion protein on osteoclast formation in vitro. The osteoclast forming assay was performed as described in Example 11A in the absence (control) or presence of the indicated amounts of huOPG [22-401]-Fc fusion. Osteoclast formation was visualized by histochemical staining for tartrate acid phosphatase (TRAP).). A. OPG added to 100 ng/ml. D. OPG added to 0.1 ng/ml. E. OPG added to 0.01 ng/ml. F. OPG added to 0.001 ng/ml. G. Control. No OPG added.
[0030]FIG. 20. Decrease in osteoclast culture TRAP activity with increasing amounts of OPG. Indicated concentrations of huOPG [22-401]-Fc fusion protein were added to osteoclast forming assay and TRAP activity quantitated as described in Example 11A.
[0031]FIG. 21. Effect of OPG on a terminal stage of osteoclast differentiation. huOPG [22-401]-Fc fusion was added to the osteoclast forming assay during the intermediate stage of osteoclast maturation (days 5-6; OPG-CTL) or during the terminal stage of osteoclast maturation (days 7-15; CTL-OPG). TRAP activity was quantitated and compared with the activity observed in the absence of OPG (CTL-CTL) in the presence of OPG throughout (OPG-OPG).
[0032]FIG. 22. Effects of IL-1β, IL-1α and OPG on blood ionized calcium in mice. Levels of blood ionized calcium were monitored after injection of IL-1β alone, IL-1α alone, IL-1β plus muOPG [22-401]-Fc, IL-1α plus MuOPG [22-401]-Fc, and muOPG [22-401]-Fc alone. Control mice received injections of phosphate buffered saline (PBS) only. IL-1B experiment shown in A; IL-1α experiment shown in B.
[0033]FIG. 23. Effects of OPG on calvarial osteoclasts in control and IL1-treated mice. Histological methods for analyzing mice calvarial bone samples are described in Example 11B. Arrows indicate osteoclasts present in day 2-treated mice. Calvarial samples of mice receiving four PBS injections daily (A), one injection of IL-1 and three injections of PBS daily (B), one injection of PBS and three injections of OPG daily (C), one injection of IL-1 and three injections of OPG daily.
[0034]FIG. 24. Radiographic analysis of bone accumulation in marrow cavity of normal mice. Mice were injected subcutaneously with saline (A) or muOPG [22-401]-Fc fusion (5 mg/kg/d) for 14 days (B) and bone density determined as described in Example 11C.
[0035]FIG. 25. Histomorphometric analysis of bone accumulation in marrow cavity of normal mice. Injection experiments and bone histology performed as described in Example 11C.
[0036]FIG. 26. Histology analysis of bone accumulation in marrow cavity of normal mice. Injection experiments and bone histology performed as described in Example 11C. A. Saline injection B. Injection of muOPG [22-401]-Fc fusion.
[0037]FIG. 27. Activity of OPG administered to ovariectomized rats. In this two week experiment the trend to reduced bone density appears to be blocked by OPG or other anti-resorptive therapies. DEXA measurements were taken at time of ovariectomy and at week 1 and week 2 of treatment. The results are expressed as % change from the initial bone density (Mean+/-SEM).
[0038]FIG. 28. Bone density in the femoral metaphysis, measured by histomorphometric methods, tends to be lower in ovariectomized rats (OVX) than sham operated animals (SHAM) 17 days following ovariectomy. This effect was blocked by OPG-Fc, with OPG-Fc treated ovariectomized rats (OVX+OPG) having significantly higher bone density than vehicle treated ovariectomized rats (OVX). (Mean+/-SEM).
DETAILED DESCRIPTION OF THE INVENTION
[0039]A novel member of the tumor necrosis factor receptor (TNFR) superfamily was identified as an expressed sequence tag (EST) isolated from a fetal rat intestinal cDNA library. The structures of the full-length rat cDNA clones and the corresponding mouse and human cDNA clones were determined as described in Examples 1 and 6. The rat, mouse and human genes are shown in FIGS. 2B-2C (SEQ ID NO:120), 9A-9B (SEQ ID NO:122), and 9C-9D (SEQ ID NO:124), respectively. All three sequences showed strong similarity to the extracellular domains of TNFR family members. None of the full-length cDNA clones isolated encoded transmembrane and cytoplasmic domains that would be expected for membrane-bound receptors, suggesting that these cDNAs encode soluble, secreted proteins rather than cell surface receptors. A portion of the human gene spanning nucleotides 1200-1353 shown in FIG. 9D was deposited in the Genebank database on Nov. 22, 1995 under accession no. 17188769.
[0040]The tissue distribution of the rat and human mRNA was determined as described in Example 2. In rat, mRNA expression was detected in kidney, liver, placenta and heart with the highest expression in the kidney. Expression in skeletal muscle and pancreas was also detected. In humans, expression was detected in the same tissues along with lymph node, thymus, spleen and appendix.
[0041]The rat cDNA was expressed in transgenic mice (Example 3) using the liver-specific ApoE promoter expression system. Analysis of expressors showed a marked increase in bone density, particularly in long bones (femurs), vertebrae and flat bones (pelvis). Histological analysis of stained sections of bone showed severe osteopetrosis (see Example 4) indicating a marked imbalance between bone formation and resorption which has led to a marked accumulation of bone and cartilage. A decrease in the number of trabecular osteoclasts in the bones of OPG expressor animals indicate that a significant portion of the activity of the TNFR-related protein may be to prevent bone resorption, a process mediated by osteoclasts. In view of the activity in transgenic expressors, the TNFR-related proteins described herein are termed OPGs.
[0042]Using the rat cDNA sequence, mouse and human cDNA clones were isolated (Example 5). Expression of mouse OPG in 293 cells and human OPG in E. coli is described in Examples 7 and 8. Mouse OPG was produced as an Fc fusion which was purified by Protein A affinity chromatography. Also described in Example 7 is the expression of full-length and truncated human and mouse OPG polypeptides in CHO and 293 cells either as fusion polypeptides to the Fc region of human IgG1 or as unfused polypeptides. The expression of full-length and truncated human and mouse OPGs in E. coli either as Fc fusion polypeptides or as unfused polypeptides is described in Example 8. Purification of recombinantly produced mammalian and bacterial OPG is described in Example 10.
[0043]The biological activity of OPG was determined using an in vitro osteoclast maturation assay, an in vivo model of interleukin-1 (IL-1) induced hypercalcemia, and injection studies of bone density in normal mice (see Example 11). The following OPG recombinant proteins produced in CHO or 293 cells demonstrated activity in the in E. coli osteoclast maturation assay: muOPG [22-185]-Fc, muOPG [22-194]-Fc, muOPG [22-401]Fc, muOPG [22-401], huOPG [22-201]-Fc, huOPG [22-401]-Fc. muOPG [22-180]-Fc produced in CHO cells and huOPG met[32-401] produced in E. coli did not demonstrate activity in the in vitro assay.
[0044]OPG from several sources was produced as a dimer and to some extent as a higher multimer. Rat OPG [22-401] produced in transgenic mice, muOPG [22-401] and huOPG [22-401] produced as a recombinant polypeptide in CHO cells, and OPG expressed as a naturally occurring product from a cytotoxic T cell line were predominantly dimers and trimers when analyzed on nonreducing SDS gels (see Example 9). Truncated OPG polypeptides having deletions in the region of amino acids 186-401 (e.g., OPG [1-185] and OPG [1-194]) were predominantly monomeric suggesting that the region 186-401 may be involved in self-association of OPG polypeptides. However, huOPG met[32-401] produced in E. coli was largely monomeric.
[0045]OPG may be important in regulating bone resorption. The protein appears to act as a soluble receptor of the TNF family and may prevent a receptor-ligand interaction involved in the osteolytic pathway. One aspect of the regulation appears to be a reduction in the number of osteoclasts.
Nucleic Acids
[0046]The invention provides for an isolated nucleic acid encoding a polypeptide having at least one of the biological activities of OPG. As described herein, the biological activities of OPG include, but are not limited to, any activity involving bone metabolism and in particular, include increasing bone density. The nucleic acids of the invention are selected from the following:
[0047]a) the nucleic acid sequences as shown in FIGS. 2B-2C (SEQ ID NO:120), 9A-9B (SEQ ID NO:122), and 9C-9D (SEQ ID NO:124) or complementary strands thereof;
[0048]b) the nucleic acids which hybridize under stringent conditions with the polypeptide-encoding region in FIGS. 2B-2C (SEQ ID NO:120), 9A-9B (SEQ ID NO:122), and 9C-9D (SEQ ID NO:124); and
[0049]c) nucleic acids which hybridize under stringent conditions with nucleotides 148 through 337 inclusive as shown in FIG. 1A.
[0050]d) the nucleic acid sequences which are degenerate to the sequences in (a) and (b).
[0051]The invention provides for nucleic acids which encode rat, mouse and human OPG as well as nucleic acid sequences hybridizing thereto which encode a polypeptide having at least one of the biological activities of OPG. Also provided for are nucleic acids which hybridize to a rat OPG EST encompassing nucleotides 148-337 as shown in FIG. 1A. The conditions for hybridization are generally of high stringency such as 5×SSC, 50% formamide and 42° C. described in Example 1 of the specification. Equivalent stringency to these conditions may be readily obtained by adjusting salt and organic solvent concentrations and temperature. The nucleic acids in (b) encompass sequences encoding OPG-related polypeptides which do not undergo detectable hybridization with other known members of the TNF receptor superfamily. In a preferred embodiment, the nucleic acids are as shown in FIGS. 2B-2C (SEQ ID NO:120), 9A-9B (SEQ ID NO:122), and 9C-9D (SEQ ID NO:124).
[0052]The length of hybridizing nucleic acids of the invention may be variable since hybridization may occur in part or all of the polypeptide-encoding regions as shown in FIGS. 2B-2C (SEQ ID NO:120), 9A-9B (SEQ ID NO:122), and 9C-9D (SEQ ID NO:124), and may also occur in adjacent noncoding regions. Therefore, hybridizing nucleic acids may be truncations or extensions of the sequences shown in FIGS. 2B-2C (SEQ ID NO:120), 9A-9B (SEQ ID NO:122), and 9C-9D (SEQ ID NO:124). Truncated or extended nucleic acids are encompassed by the invention provided they retain one or more of the biological properties of OPG. The hybridizing nucleic acids may also include adjacent noncoding regions which are 5' and/or 3' to the OPG coding region. The noncoding regions include regulatory regions involved in OPG expression, such as promoters, enhance, translational initiation sites, transcription termination sites and the like.
[0053]Hybridization conditions for nucleic acids are described in Sambrook et al. Molecular Cloning: A Laboratory Manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989)
[0054]DNA encoding rat OPG was provided in plasmid pMO-B1.1 deposited with the American Type Culture Collection, Rockville, Md. on Dec. 27, 1995 under ATCC accession no. 69970. DNA encoding mouse OPG was provided in plasmid pRcCMV-murine OPG deposited with the American Type Culture Collection, Rockville, Md. on Dec. 27, 1995 under accession no. 69971. DNA encoding human OPG was provided in plasmid pRcCMV-human OPG deposited with the American Type Culture Collection, Rockville, Md. on Dec. 27, 1995 under accession no. 69969. The nucleic acids of the invention will hybridize under stringent conditions to the DNA inserts of ATCC accession nos. 69969, 69970, and 69971 and have at least one of the biological activities of OPG.
[0055]Also provided by the invention are derivatives of the nucleic acid sequences as shown in FIGS. 2B, 9A and 9B. As used herein, derivatives include nucleic acid sequences having addition, substitution, insertion or deletion of one or more residues such that the resulting sequences encode polypeptides having one or more amino acid residues which have been added, deleted, inserted or substituted and the resulting polypeptide has the activity of OPG. The nucleic acid derivatives may be naturally occurring, such as by splice variation or polymorphism, or may be constructed using site-directed mutagenesis techniques available to the skilled worker. One example of a naturally occurring variant of OPG is a nucleic acid encoding a lys to asn change at residue 3 within the leader sequence (see Example 5). It is anticipated that nucleic acid derivatives will encode amino acid changes in regions of the molecule which are least likely to disrupt biological activity. Other derivatives include a nucleic acid encoding a membrane-bound form of OPG having an extracellular domain as shown in FIGS. 2B-2C (SEQ ID NO:120), 9A-9B (SEQ ID NO:122), and 9C-9D (SEQ ID NO:124) along with transmembrane and cytoplasmic domains.
[0056]In one embodiment, derivatives of OPG include nucleic acids encoding truncated forms of OPG having one or more amino acids deleted from the carboxy terminus. Nucleic acids encoding OPG may have from 1 to 216 amino acids deleted from the carboxy terminus. Optionally, an antibody Fc region may extend from the new carboxy terminus to yield a biologically active OPG-Fc fusion polypeptide. (see Example 11). In preferred embodiments, nucleic acids encode OPG having the amino acid sequence from residues 22-185, 22-189, 22-194 or 22-201 (using numbering in FIG. 9E-F) and optionally, encoding an Fc region of human IgG.
[0057]Also included are nucleic acids encoding truncated forms of OPG having one or more amino acids deleted from the amino terminus. Truncated forms include those lacking part or all the 21 amino acids comprising the leader sequence. Additionally, the invention provides for nucleic acids encoding OPG having from 1 to 10 amino acids deleted from the mature amino terminus (at residue 22) and, optionally, having from 1 to 216 amino acids deleted from the carboxy terminus (at residue 401). Optionally, the nucleic acids may encode a methionine residue at the amino terminus. Examples of such OPG truncated polypeptides are described in Example 8.
[0058]Examples of the nucleic acids of the invention include cDNA, genomic DNA, synthetic DNA and RNA. cDNA is obtained from libraries prepared from mRNA isolated from various tissues expressing OPG. In humans, tissue sources for OPG include kidney, liver, placenta and heart. Genomic DNA encoding OPG is obtained from genomic libraries which are commercially available from a variety of species. Synthetic DNA is obtained by chemical synthesis of overlapping oligonucleotide fragments followed by assembly of the fragments to reconstitute part or all of the coding region and flanking sequences (see U.S. Pat. No. 4,695,623 describing the chemical synthesis of interferon genes). RNA is obtained most easily by procaryotic expression vectors which direct high-level synthesis of mRNA, such as vectors using T7 promoters and RNA polymerase.
[0059]Nucleic acid sequences of the invention are used for the detection of OPG sequences in biological samples in order to determine which cells and tissues are expressing OPG mRNA. The sequences may also be used to screen cDNA and genomic libraries for sequences related to OPG. Such screening is well within the capabilities of one skilled in the art using appropriate hybridization conditions to detect homologous sequences. The nucleic acids are also useful for modulating the expression of OPG levels by anti-sense therapy or gene therapy. The nucleic acids are also used for the development of transgenic animals which may be used for the production of the polypeptide and for the study of biological activity (see Example 3).
Vectors and Host Cells
[0060]Expression vectors containing nucleic acid sequences encoding OPG, host cells transformed with said vectors and methods for the production of OPG are also provided by the invention. An overview of expression of recombinant proteins is found in Methods of Enzymology v. 185, Goeddel, D. V. ed. Academic Press (1990).
[0061]Host cells for the production of OPG include procaryotic host cells, such as E. coli, yeast, plant, insect and mammalian host cells. E. coli strains such as HB101 or JM101 are suitable for expression. Preferred mammalian host cells include COS, CHOd-, 293, CV-1, 3T3, baby hamster kidney (BHK) cells and others. Mammalian host cells are preferred when post-translational modifications, such as glycosylation and polypeptide processing, are important for OPG activity. Mammalian expression allows for the production of secreted polypeptides which may be recovered from the growth medium.
[0062]Vectors for the expression of OPG contain at a minimum sequences required for vector propagation and for expression of the cloned insert. These sequences include a replication origin, selection marker, promoter, ribosome binding site, enhancer sequences, RNA splice sites and transcription termination site. Vectors suitable for expression in the aforementioned host cells are readily available and the nucleic acids of the invention are inserted into the vectors using standard recombinant DNA techniques. Vectors for tissue-specific expression of OPG are also included. Such vectors include promoters which function specifically in liver, kidney or other organs for production in mice, and viral vectors for the expression of OPG in targeted human cells.
[0063]Using an appropriate host-vector system, OPG is produced recombinantly by culturing a host cell transformed with an expression vector containing nucleic acid sequences encoding OPG under conditions such that OPG is produced, and isolating the product of expression. OPG is produced in the supernatant of transfected mammalian cells or in inclusion bodies of transformed bacterial host cells. OPG so produced may be purified by procedures known to one skilled in the art as described below. The expression of OPG in mammalian and bacterial host systems is described in Examples 7 and 8. Expression vectors for mammalian hosts are exemplified by plasmids such as pDSRα described in PCT Application No. 90/14363. Expression vectors for bacterial host cells are exemplified by plasmids pAMG21 and pAMG22-His described in Example 8. Plasmid pAMG21 was deposited with the American Type Culture Collection, Rockville, Md. on Jul. 24, 1996 under accession no. 98113. Plasmid pAMG22-His was deposited with the American Type Culture Collection, Rockville, Md. on Jul. 24, 1996 under accession no. 98112. It is anticipated that the specific plasmids and host cells described are for illustrative purposes and that other available plasmids and host cells could also be used to express the polypeptides.
[0064]The invention also provides for expression of OPG from endogenous nucleic acids by in vivo or ex vivo recombination events to allow modulation of OPG from the host chromosome. Expression of OPG by the introduction of exogenous regulatory sequences (e.g. promoters or enhancers) capable of directing the production of OPG from endogenous OPG coding regions is also encompassed. Stimulation of endogenous regulatory sequences capable of directing OPG production (e.g. by exposure to transcriptional enhancing factors) is also provided by the invention.
Polypeptides
[0065]The invention provides for OPG, a novel member of the TNF receptor superfamily, having an activity associated with bone metabolism and in particular having the activity of inhibiting bone resorption thereby increasing bone density. OPG refers to a polypeptide having an amino acid sequence of mouse, rat or human OPG or a derivative thereof having at least one of the biological activities of OPG. The amino acid sequences of rat, mouse and human OPG are shown in FIGS. 2B-2C (SEQ ID NO:121), 9A-9B (SEQ ID NO:123), and 9C-9D (SEQ ID NO:125) respectively. A derivative of OPG refers to a polypeptide having an addition, deletion, insertion or substitution of one or more amino acids such that the resulting polypeptide has at least one of the biological activities of OPG. The biological activities of OPG include, but are not limited to, activities involving bone metabolism. Preferably, the polypeptides will have the amino terminal leader sequence of 21 amino acids removed.
[0066]OPG polypeptides encompassed by the invention include rat [1-401], rat [22-180], rat [22-401], rat [22-401]-Fc fusion, rat [1-180]-Fc fusion, mouse [1-401], mouse [1-180], mouse [22-401], human [1-401], mouse [22-180], human [22-401], human [22-180], human [1-180], human [22-180]-Fc fusion and human met-32-401. Amino acid numbering is as shown in SEQ ID NO:121 (rat), SEQ ID NO:123 (mouse) and SEQ ID NO:125 (human). Also encompassed are polypeptide derivatives having deletions or carboxy-terminal truncations of part or all of amino acids residues 180-401 of OPG; one or more amino acid changes in residues 180-401; deletion of part or all of a cysteine-rich domain of OPG, in particular deletion of the distal (carboxy-terminal) cysteine-rich domain; and one or more amino acid changes in a cysteine-rich domain, in particular in the distal (carboxy-terminal) cysteine-rich domain. In one embodiment, OPG has from 1 to about 216 amino acids deleted from the carboxy terminus. In another embodiment, OPG has from 1 to about 10 amino acids deleted from the mature amino terminus (wherein the mature amino terminus is at residue 22) and, optionally, has from 1 to about 216 amino acids deleted from the carboxy terminus.
[0067]Additional OPG polypeptides encompassed by the invention include the following: human [22-180]-Fc fusion, human [22-201]-Fc fusion, human [22-401]-Fc fusion, mouse [22-185]-Fc fusion, mouse [22-194]-Fc fusion. These polypeptides are produced in mammalian host cells, such as CHO or 293 cells, Additional OPG polypeptides encompassed by the invention which are expressed in procaryotic host cells include the following: human met[22-401], Fc-human met[22-401] fusion (Fc region is fused at the amino terminus of the full-length OPG coding sequence as described in Example 8), human met[22-401]-Fc fusion (Fc region fused to the full-length OPG sequence), Fc-mouse met[22-401] fusion, mouse met[22-401]-Fc fusion, human met[27-401], human met[22-185], human met[22-189], human met[22-194], human met[22-194] (P25A), human met [22-194] (P26A), human met[27-185], human met[27-189], human met[27-194], human met-arg-gly-ser-(his)6 [22-401], human met-lys [22-401], human met-(lys)3-[22-401], human met[22-401]-Fc (P25A), human met[22-401] (P25A), human met[22-401] (P26A), human met[22-401] (P26D), mouse met[22-401], mouse met[27-401], mouse met[32-401], mouse met[27-180], mouse met[22-189], mouse met[22-194], mouse met[27-189], mouse met[27-194], mouse met-lys[22-401], mouse HEK[22-401] (A45T), mouse met-lys-(his)7 [22-401], mouse met-lys[22-401]-(his)7 and mouse met[27-401] (P33E, G36S, A45P). It is understood that the above OPG polypeptides produced in procaryotic host cells have an amino-terminal methionine residue, if such a residue is not indicated. In specific examples, OPG-Fc fusion were produced using a 227 amino acid region of human IgG1-γ1 was used having the sequence as shown in Ellison et al. (Nuc. Acids Res. 10, 4071-4079 (1982)). However, variants of the Fc region of human IgG may also be used.
[0068]Analysis of the biological activity of carboxy-terminal OPG truncations fused to the human IgG1 Fc region indicates a portion of OPG of about 164 amino acids which is required for activity. This region encompasses amino acids 22-185, preferably those in FIG. 9C-9D (SEQ ID NO:125), and comprises four cysteine-rich domains characteristic of the cysteine-rich domains of TNFR extracellular domains.
[0069]Using the homology between OPG and the extracellular ligand binding domains of TNF receptor family members, a three-dimensional model of OPG was generated based upon the known crystal structure of the extracellular domain of TNFR-I (see Example 6). This model was used to identify those residues within OPG which may be important for biological activity. Cysteine residues that are involved in maintaining the structure of the four cysteine-rich domains were identified. The following disulfide bonds were identified in the model: Domain 1: cys41 to cys54, cys44 to cys62, tyr23 and his 66 may act to stabilize the structure of this domain; Domain 2: cys65 to cys80, cys83 to cys98, cys87 to cys105; Domain 3: cys107 to cys118, cys124 to cys142; Domain 4: cys145 to cys160, cys166 to cys185. Residues were also identified which were in close proximity to TNFβ as shown in FIGS. 11 and 12A-12B. In this model, it is assumed that OPG binds to a corresponding ligand; TNFβ was used as a model ligand to simulate the interaction of OPG with its ligand. Based upon this modeling, the following residues in OPG may be important for ligand binding: glu34, lys43, pro66 to gln91 (in particular, pro66, his68, tyr69, tyr70, thr71, asp72, ser73, his76, ser77, asp78, glu79, leu81, tyr82, pro85, val86, lys88, glu90 and gln91), glu153 and ser155.
[0070]Alterations in these amino acid residues, either singly or in combination, may alter the biological activity of OPG. For example, changes in specific cysteine residues may alter the structure of individual cysteine-rich domains, whereas changes in residues important for ligand binding may affect physical interactions of OPG with ligand. Structural models can aid in identifying analogs which have more desirable properties, such as enhanced biological activity, greater stability, or greater ease of formulation.
[0071]The invention also provides for an OPG multimer comprising OPG monomers. OPG appears to be active as a multimer (e.g, dimer, trimer of a higher number of monomers). Preferably, OPG multimers are dimers or trimers. OPG multimers may comprise monomers having the amino acid sequence of OPG sufficient to promote multimer formation or may comprise monomers having heterologous sequences such as an antibody Fc region. Analysis of carboxy-terminal deletions of OPG suggest that at least a portion of the region 186-401 is involved in association of OPG polypeptides. Substitution of part or all of the region of OPG amino acids 186-401 with an amino acid sequence capable of self-association is also encompassed by the invention. Alternatively, OPG polypeptides or derivatives thereof may be modified to form dimers or multimers by site directed mutagenesis to create unpaired cysteine residues for interchain disulfide bond romation, by photochemical crosslinking, such as exposure to ultraviolet light, or by chemical crosslinking with bifunctional linker molecules such as bifunctional polyethylene glycol and the like.
[0072]Modifications of OPG polypeptides are encompassed by the invention and include post-translational modifications (e.g., N-linked or O-linked carbohydrate chains, processing of N-terminal or C-terminal ends), attachment of chemical moieties to the amino acid backbone, chemical modifications of N-linked or O-linked carbohydrate chains, and addition of an N-terminal methionine residue as a result of procaryotic host cell expression. The polypeptides may also be modified with a detectable label, such as an enzymatic, fluorescent, isotopic or affinity label to allow for detection and isolation of the protein.
[0073]Further modifications of OPG include chimeric proteins wherein OPG is fused to a heterologous amino acid sequence. The heterologous sequence may be any sequence which allows the resulting fusion protein to retain the activity of OPG. The heterologous sequences include for example, immunoglobulin fusions, such as Fc fusions, which may aid in purification of the protein. A heterologous sequence which promotes association of OPG monomers to form dimers, trimers and other higher multimeric forms is preferred.
[0074]The polypeptides of the invention are isolated and purified from other polypeptides present in tissues, cell lines and transformed host cells expressing OPG, or purified from components in cell cultures containing the secreted protein. In one embodiment, the polypeptide is free from association with other human proteins, such as the expression product of a bacterial host cell.
[0075]Also provided by the invention are chemically modified derivatives of OPG which may provide additional advantages such as increasing stability and circulating time of the polypeptide, or decreasing immunogenicity (see U.S. Pat. No. 4,179,337). The chemical moieties for derivitization may be selected from water soluble polymers such as polyethylene glycol, ethylene glycol/propylene glycol copolymers, carboxymethylcellulose, dextran, polyvinyl alcohol and the like. The polypeptides may be modified at random positions within the molecule, or at predetermined positions within the molecule and may include one, two, three or more attached chemical moieties.
[0076]The polymer may be of any molecular weight, and may be branched or unbranched. For polyethylene glycol, the preferred molecular weight is between about 1 kDa and about 100 kDa (the term "about" indicating that in preparations of polyethylene glycol, some molecules will weigh more, some less, than the stated molecular weight) for ease in handling and manufacturing. Other sizes may be used, depending on the desired therapeutic profile (e.g., the duration of sustained release desired, the effects, if any on biological activity, the ease in handling, the degree or lack of antigenicity and other known effects of the polyethylene glycol to a therapeutic protein or analog).
[0077]The polyethylene glycol molecules (or other chemical moieties) should be attached to the protein with consideration of effects on functional or antigenic domains of the protein. There are a number of attachment methods available to those skilled in the art, e.g. EP 0 401 384 herein incorporated by reference (coupling PEG to G-CSF), see also Malik et al., Exp. Hematol. 20: 1028-1035 (1992) (reporting pegylation of GM-CSF using tresyl chloride). For example, polyethylene glycol may be covalently bound through amino acid residues via a reactive group, such as, a free amino or carboxyl group. Reactive groups are those to which an activated polyethylene glycol molecule may be bound. The amino acid residues having a free amino group may include lysine residues and the N-terminal amino acid residues; those having a free carboxyl group may include aspartic acid residues glutamic acid residues and the C-terminal amino acid residue. Sulfhydrl groups may also be used as a reactive group for attaching the polyethylene glycol molecule(s). Preferred for therapeutic purposes is attachment at an amino group, such as attachment at the N-terminus or lysine group.
[0078]One may specifically desire N-terminally chemically modified protein. Using polyethylene glycol as an illustration of the present compositions, one may select from a variety of polyethylene glycol molecules (by molecular weight, branching, etc.), the proportion of polyethylene glycol molecules to protein (or peptide) molecules in the reaction mix, the type of pegylation reaction to be performed, and the method of obtaining the selected N-terminally pegylated protein. The method of obtaining the N-terminally pegylated preparation (i.e., separating this moiety from other monopegylated moieties if necessary) may be by purification of the N-terminally pegylated material from a population of pegylated protein molecules. Selective N-terminal chemically modification may be accomplished by reductive alkylation which exploits differential reactivity of different types of primary amino groups (lysine versus the N-terminal) available for derivatization in a particular protein. Under the appropriate reaction conditions, substantially selective derivatization of the protein at the N-terminus with a carbonyl group containing polymer is achieved.
[0079]Synthetic OPG dimers may be prepared by various chemical crosslinking procedures. OPG monomers may be chemically linked in any fashion that retains or enhances the biological activity of OPG. A variety of chemical crosslinkers may be used depending upon which properties of the protein dimer are desired. For example, crosslinkers may be short and relatively rigid or longer and more flexible, may be biologically reversible, and may provide reduced immunogenicity or longer pharmacokinetic half-life.
[0080]In one example, OPG molecules are linked through the amino terminus by a two step synthesis (see Example 12). In the first step, OPG is chemically modified at the amino terminus to introduce a protected thiol, which after purification is deprotected and used as a point of attachment for site-specific conjugation through a variety of crosslinkers with a second OPG molecule. Amino-terminal crosslinks include, but are not limited to, a disulfide bond, thioether linkages using short-chain, bis-functional aliphatic crosslinkers, and thioether linkages to variable length, bifunctional polyethylene glycol crosslinkers (PEG "dumbbells"). Also encompassed by PEG dumbbell synthesis of OPG dimers is a byproduct of such synthesis, termed a "monobell". An OPG monobell consists of a monomer coupled to a linear bifunctional PEG with a free polymer terminus. Alternatively, OPG may be crosslinked directly through a variety of amine specific homobifunctional crosslinking techniques which include reagents such as: diethylenetriaminepentaacetic dianhydride (DTPA), p-benzoquinone (pBQ) or bis(sulfosuccinimidyl) suberate (BS3) as well as others known in the art. It is also possible to thiolate OPG directly with reagents such as iminothiolane in the presence of a variety of bifunctional, thiol specific crosslinkers, such as PEG bismaleimide, and achieve dimerization and/or dumbbells in a one step process.
[0081]A method for the purification of OPG from natural sources and from transfected host cells is also included. The purification process may employ one or more standard protein purification steps in an appropriate order to obtain purified protein. The chromatography steps can include ion exchange, gel filtration, hydrophobic interaction, reverse phase, chromatofocusing, affinity chromatography employing an anti-OPG antibody or biotin-streptavidin affinity complex and the like.
Antibodies
[0082]Also encompassed by the invention are antibodies specifically binding to OPG. Antigens for the generation of antibodies may be full-length polypeptides or peptides spanning a portion of the OPG sequence. Immunological procedures for the generation of polyclonal or monoclonal antibodies reactive with OPG are known to one skilled in the art (see, for example, Harlow and Lane, Antibodies: A Laboratory Manual Cold Spring Harbor Laboratory Press, Cold Spring Harbor N.Y. (1988)). Antibodies so produced are characterized for binding specificity and epitope recognition using standard enzyme-linked immunosorbent assays. Antibodies also include chimeric antibodies having variable and constant domain regions derived from different species. In one embodiment, the chimeric antibodies are humanized antibodies having murine variable domains and human constant domains. Also encompassed are complementary determining regions grafted to a human framework (so-called CDR-grafted antibodies). Chimeric and CDR-grafted antibodies are made by recombinant methods known to one skilled in the art. Also encompassed are human antibodies made in mice.
[0083]Anti-OPG antibodies of the invention may be used as an affinity reagent to purify OPG from biological samples (see Example 10). In one method, the antibody is immobilized on CnBr-activated Sepharose and a column of antibody-Sepharose conjugate is used to remove OPG from liquid samples. Antibodies are also used as diagnostic reagents to detect and quantitate OPG in biological samples by methods described below.
Pharmaceutical Compositions
[0084]The invention also provides for pharmaceutical compositions comprising a therapeutically effective amount of the polypeptide of the invention together with a pharmaceutically acceptable diluent, carrier, solubilizer, emulsifier, preservative and/or adjuvant. The term "therapeutically effective amount" means an amount which provides a therapeutic effect for a specified condition and route of administration. The composition may be in a liquid or lyophilized form and comprises a diluent (Tris, acetate or phosphate buffers) having various pH values and ionic strengths, solubilizer such as Tween or Polysorbate, carriers such as human serum albumin or gelatin, preservatives such as thimerosal or benzyl alcohol, and antioxidants such as ascrobic acid or sodium metabisulfite. Also encompassed are compositions comprising OPG modified with water soluble polymers to increase solubility or stability. Compositions may also comprise incorporation of OPG into liposomes, microemulsions, micelles or vesicles for controlled delivery over an extended period of time.
[0085]Specifically, OPG compositions may comprise incorporation into polymer matricies such as hydrogels, silicones, polyethylenes, ethylene-vinyl acetate copolymers, or biodegradable polymers. Examples of hydrogels include polyhydroxyalkylmethacrylates (p-HEMA), polyacrylamide, polymethacrylamide, polyvinylpyrrolidone, polyvinyl alcohol and various polyelectrolyte complexes. Examples of biodegradable polymers include polylactic acid (PLA), polyglycolic acid (PGA), copolymers of PLA and PGA, polyamides and copolymers of polyamides and polyesters. Other controlled release formulations include microcapsules, microspheres, macromolecular complexes and polymeric beads which may be administered by injection.
[0086]Selection of a particular composition will depend upon a number of factors, including the condition being treated, the route of administration and the pharmacokinetic parameters desired. A more extensive survey of component suitable for pharmaceutical compositions is found in Remington's Pharmaceutical Sciences, 18th ed. A. R. Gennaro, ed. Mack, Easton, Pa. (1980).
[0087]Compositions of the invention may be administered by injection, either subcutaneous, intravenous or intramuscular, or by oral, nasal, pulmonary or rectal administration. The route of administration eventually chosen will depend upon a number of factors and may be ascertained by one skilled in the art.
[0088]The invention also provides for pharmaceutical compositions comprising a therapeutically effective amount of the nucleic acids of the invention together with a pharmaceutically acceptable adjuvant. Nucleic acid compositions will be suitable for the delivery of part or all of the OPG coding region to cells and tissues as part of an anti-sense or gene therapy regimen.
Methods of Treatment
[0089]Bone tissue provides support for the body and consists of mineral (largely calcium and phosphorus), a matrix of collagenous and noncollagenous proteins, and cells. Three types of cells found in bone, osteocytes, osteoblasts and osteoclasts, are involved in the dynamic process by which bone is continually formed and resorbed. Osteoblasts promote formation of bone tissue whereas osteoclasts are associated with resorption. Resorption, or the dissolution of bone matrix and mineral, is a fast and efficient process compared to bone formation and can release large amounts of mineral from bone. Osteoclasts are involved in the regulation of the normal remodeling of skeletal tissue and in resorption induced by hormones. For instance, resorption is stimulated by the secretion of parathyroid hormone in response to decreasing concentrations of calcium ion in extracellular fluids. In contrast, inhibition of resorption is the principal function of calcitonin. In addition, metabolites of vitamin D alter the responsiveness of bone to parathyroid hormone and calcitonin.
[0090]After skeletal maturity, the amount of bone in the skeleton reflects the balance (or imbalance) of bone formation and bone resorption. Peak bone mass occurs after skeletal maturity prior to the fourth decade. Between the fourth and fifth decades, the equilibrium shifts and bone resorption dominates. The inevitable decrease in bone mass with advancing years starts earlier in females than males and is distinctly accelerated after menopause in some females (principally those of Caucasian and Asian descent).
[0091]Osteopenia is a condition relating generally to any decrease in bone mass to below normal levels. Such a condition may arise from a decrease in the rate of bone synthesis or an increase in the rate of bone destruction or both. The most common form of osteopenia is primary osteoporosis, also referred to as postmenopausal and senile osteoporosis. This form of osteoporosis is a consequence of the universal loss of bone with age and is usually a result of increase in bone resorption with a normal rate of bone formation. About 25 to 30 percent of all white females in the United States develop symptomatic osteoporosis. A direct relationship exists between osteoporosis and the incidence of hip, femoral, neck and inter-trochanteric fracture in women 45 years and older. Elderly males develop symptomatic osteoporosis between the ages of 50 and 70, but the disease primarily affects females.
[0092]The cause of postmenopausal and senile osteoporosis is unknown. Several factors have been identified which may contribute to the condition. They include alteration in hormone levels accompanying aging and inadequate calcium consumption attributed to decreased intestinal absorption of calcium and other minerals. Treatments have usually included hormone therapy or dietary supplements in an attempt to retard the process. To date, however, an effective treatment for bone loss does not exist.
[0093]The invention provides for a method of treating a bone disorder using a therapeutically effective amount of OPG. The bone disorder may be any disorder characterized by a net bone loss (osteopenia or osteolysis). In general, treatment with OPG is anticipated when it is necessary to suppress the rate of bone resorption. Thus treatment may be done to reduce the rate of bone resorption where the resorption rate is above normal or to reduce bone resorption to below normal levels in order to compensate for below normal levels of bone formation.
[0094]Conditions which are treatable with OPG include the following:
[0095]Osteoporosis, such as primary osteoporosis, endocrine osteoporosis (hyperthyroidism, hyperparathryoidism, Cushing's syndrome, and acromegaly), hereditary and congenital forms of osteoporosis (osteogenesis imperfecta, homocystinuria, Menkes' syndrome, and Riley-Day syndrome) and osteoporosis due to immobilization of extremities.
[0096]Paget's disease of bone (osteitis deformans) in adults and juveniles
[0097]Osteomyelitis, or an infectious lesion in bone, leading to bone loss.
[0098]Hypercalcemia resulting from solid tumors (breast, lung and kidney) and hematologic malignancies (multiple myeloma, lymphoma and leukemia), idiopathic hypercalcemia, and hypercalcemia associated with hyperthryoidism and renal function disorders.
[0099]Osteopenia following surgery, induced by steroid administration, and associated with disorders of the small and large intestine and with chronic hepatic and renal diseases.
[0100]Osteonecrosis, or bone cell death, associated with traumatic injury or nontraumatic necrosis associated with Gaucher's disease, sickle cell anemia, systemic lupus erythematosus and other conditions.
[0101]Bone loss due to rheumatoid arthritis.
[0102]Periodontal bone loss.
[0103]Osteolytic metastasis
[0104]It is understood that OPG may be used alone or in conjunction with other factors for the treatment of bone disorders. In one embodiment, osteoprotegerin is used in conjunction with a therapeutically effective amount of a factor which stimulates bone formation. Such factors include but are not limited to the bone morphogenic factors designated BMP-1 through BMP-12, transforming growth factor-β (TGF-β) and TGF-β family members, interleukin-1 inhibitors, TNFα inhibitors, parathyroid hormone and analogs thereof, parathyroid related protein and analogs thereof, E series prostaglandins, bisphosphonates (such as alendronate and others), and bone-enhancing minerals such as fluoride and calcium.
[0105]The following examples are offered to more fully illustrate the invention, but are not construed as limiting the scope thereof.
Example 1
Identification and Isolation of the Rat OPG cDNA
[0106]Materials and methods for cDNA cloning and analysis are described in Maniatis et al, ibid. Polymerase chain reactions (PCR) were performed using a Perkin-Elmer 9600 thermocycler using PCR reaction mixture (Boehringer-Mannheim) and primer concentrations specified by the manufacturer. In general, 25-50 μl reactions were denatured at 94° C., followed by 20-40 cycles of 94° C. for 5 seconds, 50-60° C. for 5 seconds, and 72° C. for 3-5 minutes. Reactions were the treated for 72° C. for 3-5 minutes. Reactions were then analyzed by gel electrophoresis as described in Maniatis et al., ibid.
[0107]A cDNA library was constructed using mRNA isolated from embryonic d20 intestine for EST analysis (Adams et al. Science 252, 1651-1656 (1991)). Rat embryos were dissected, and the entire developing small and large intestine removed and washed in PBS. Total cell RNA was purified by acid guanidinium thiocyanate-phenol-chloroform extraction (Chomczynski and Sacchi Anal. Biochem. 162, 156-159, (1987)). The poly (A+) mRNA fraction was obtained from the total RNA preparation by adsorption to, and elution from, Dynabeads Oligo (dT)25 (Dynal Corp) using the manufacturer's recommended procedures. A random primed cDNA library was prepared using the Superscript Plasmid System (Gibco BRL, Gaithersburg, Md.). The random cDNA primer containing an internal Not I restriction site was used to initiate first strand synthesis and had the following sequence:
TABLE-US-00001 (SEQ ID NO: 1) 5'-AAAGGAAGGAAAAAAGCGGCCGCTACANNNNNNNNT-3' Not I
[0108]For the first strand synthesis three separate reactions were assembled that contained 2.5 μg of poly(A) RNA and 120 ng, 360 ng or 1,080 ng of random primer. After second strand synthesis, the reaction products were separately extracted with a mixture of phenol:choroform:isoamyl alcohol (25:24:1 ratio), and then ethanol precipitated. The double strand (ds) cDNA products of the three reactions were combined and ligated to the following ds oligonucleotide adapter:
TABLE-US-00002 5'-TCGACCCACGCGTCCG-3' (SEQ ID NO: 2) 3'-GGGTGCGCAGGCp-5' (SEQ ID NO: 3)
[0109]After ligation the cDNA was digested to completion with Not I, extracted with phenol:chloroform:isoamyl (25:24:1) alcohol and ethanol precipitated. The resuspended cDNA was then size fractionated by gel filtration using premade columns provided with the Superscript Plasmid System (Gibco BRL, Gaithersburg, Md.) as recommended by the manufacturer. The two fractions containing the largest cDNA products were pooled, ethanol precipitated and then directionally ligated into Not I and Sal I digested pMOB vector DNA (Strathmann et al, 1991). The ligated cDNA was introduced into competent ElectroMAX DH10B E. coli (Gibco BRL, Gaithersburg, Md.) by electroporation. For automated sequence analysis approximately 10,000 transformants were plated on 20 cm×20 cm agar plates containing ampicillin supplemented LB nutrient media. The colonies that arose were picked and arrayed onto 96 well microtiter plates containing 200 ml of L-broth, 7.5% glycerol, and 50 μg/ml ampicillin. The cultures were grown overnight at 37° C., a duplicate set of microtiter plates were made using a sterile 96 pin replicating tool, then both sets were stored at -80° C. for further analysis. For full-length cDNA cloning approximately one million transformants were plated on 96 bacterial ampicillin plates containing about 10,000 clones each. The plasmid DNA from each pool was separately isolated using the Qiagen Plasmid Maxi Kit (Qiagen Corp., Germany) and arrayed into 96 microtiter plates for PCR analyses.
[0110]To sequence random fetal rat intestine cDNA clones, glycerol stocks were thawed, and small aliquots diluted 1:25 in distilled. Approximately 3.0 ul of diluted bacterial cultures were added to PCR reaction mixture (Boehringer-Mannheim) containing the following oligonucleotides:
TABLE-US-00003 5'-TGTAAAACGACGGCCAGT-3' (SEQ ID NO: 4) 5'-CAGGAAACAGCTATGACC-3' (SEQ ID NO: 5)
[0111]The reactions were incubated in a thermocycler (Perkin-Elmer 9600) with the following cycle conditions: 94 C for 2 minutes; 30 cycles of 94° C. for 5 seconds, 50° C. for 5 seconds, and 72° C. for 3 minutes.; 72° C. for 4 minutes. After incubation in the thermocycler, the reactions were diluted with 2.0 mL of water. The amplified DNA fragments were further purified using Centricon columns (Princeton Separations) using the manufacturer's recommended procedures. The PCR reaction products were sequenced on an Applied Biosystems 373A automated DNA sequencer using T3 primer (oligonucleotide 353-23; 5'-CAATTAACCCTCACTAAAGG-3') (SEQ ID NO:6) Taq dye-terminator reactions (Applied Biosystems) following the manufacturer's recommended procedures.
[0112]The resulting 5' nucleotide sequence obtained from randomly picked cDNA clones translated and then compared to the existing database of known protein sequences using a modified version of the FASTA program (Pearson et al. Meth. Enzymol. 183, (1990)). Translated sequences were also analysed for the presence of a specific cysteine-rich protein motif found in all known members of the tumor necrosis factor receptor (TNFR) superfamily (Smith et al. Cell 76, 959-962 (1994)), using the sequence profile method of Gribskov et al. (Proc. Natl. Acad. Sci. USA 83, 4355-4359 (1987)), as modified by Luethy et al. (Protein Science 3, 139-146 (1994)).
[0113]Using the FASTA and Profile search data, an EST, FRI-1 (Fetal Rat Intestine-1), was identified as a possible new member of the TNFR superfamily. FRI-1 contained an approximately 600 bp insert with a LORF of about 150 amino acids. The closest match in the database was the human type II TNFR (TNFR-2). The region compared showed an ˜43% homology between TNFR-2 and FRI-1 over this 150 aa LORF. Profile analysis using the first and second cysteine-rich repeats of the TNFR superfamily yielded a Z score of ˜8, indicating that the FRI-1 gene possibly encodes a new family member.
[0114]To deduce the structure of the FRI-1 product, the fetal rat intestine cDNA library was screened for full length clones. The following oligonucleotides were derived from the original FRI-1 sequence:
TABLE-US-00004 5'-GCATTATGACCCAGAAACCGGAC-3' (SEQ ID NO: 7) 5'-AGGTAGCGCCCTTCCTCACATTC-3' (SEQ ID NO: 8)
[0115]These primers were used in PCR reactions to screen 96 pools of plasmid DNA, each pool containing plasmid DNA from 10,000 independent cDNA clones. Approximately 1 ug of plasmid pool DNA was amplified in a PCR reaction mixture (Boehringer-Mannheim) using a Perkin-Elmer 96 well thermal cycler with the following cycle conditions: 2 min at 94° C., 1 cycle; 15 sec at 94° C., then 45 sec at 65° C., 30 cycles; 7 min at 65° C., 1 cycle. PCR reaction products were analysed by gel electrophoresis. 13 out of 96 plasmid DNA pools gave rise to amplified DNA products with the expected relative molecular mass.
[0116]DNA from one positive pool was used to transform competent ElectroMAX DH10B E. coli (Gibco BRL, Gaithersburg, Md.) as described above. Approximately 40,000 transformants were plated onto sterile nitrocellulose filters (BA-85, Schleicher and Schuell), and then screened by colony hybridization using a 32P-dCTP labelled version of the PCR product obtained above. Filters were prehybridized in 5×SSC, 50% deionized formamide, 5× Denhardt's solution, 0.5% SDS, and 100 ug/ml denatured salmon sperm DNA for 2-4 hours at 42° C. Filters were then hybridized in 5×SSC, 50% deionized formamide, 2× Denhardt's solution, 0.1% SDS, 100 μg/ml denatured salmon sperm DNA, and ˜5 ng/ml of labelled probe for ˜18 hours at 42° C. The filters were then washed in 2×SSC for 10 min at RT, 1×SSC for 10 min at 55° C., and finally in 0.5×SSC for 10-15 min at 55° C. Hybridizing clones were detected following autoradiography, and then replated onto nitrocellulose filters for secondary screening. Upon secondary screening, a plasmid clone (pB1.1) was isolated, then amplified in L-broth media containing 100 ug/ml ampicillin and the plasmid DNA obtained. Both strands of the 2.4 kb pB1.1 insert were sequenced.
[0117]The pB1.1 insert sequence was used for a FASTA search of the public database to detect any existing sequence matches and/or similarities. No matches to any known genes or EST's were found, although there was an approximate 45% similarity to the human and mouse TNFR-2 genes. A methionine start codon is found at bp 124 of the nucleotide sequence, followed by a LORF encoding 401 aa residues that terminates at bp 1327. The 401 aa residue product is predicted to have a hydrophobic signal peptide of approximately 31 residues at its N-terminus, and 4 potential sites of N-linked glycosylation. No hydrophobic transmembrane spanning sequence was identified using the PepPlot program (Wisconsin GCG package, version 8.1). The deduced 401 aa sequence was then used to search the protein database. Again, there were no existing matches, although there appeared to be a strong similarity to many members of the TNFR superfamily, most notably the human and mouse TNFR-2. A sequence alignment of this novel protein with known members of the TNFR-superfamily was prepared using the Pileup program, and then modified by PrettyPlot (Wisconsin GCG package, version 8.1). This alignment shows a clear homology between the full length FRI-1 gene product and all other TNFR family members. The homologous region maps to the extracellular domain of TNFR family members, and corresponds to the three or four cysteine-rich repeats found in the ligand binding domain of these proteins. This suggested that the FRI-1 gene encoded a novel TNFR family member. Since no transmembrane spanning region was detected we predicted that this may be a secreted receptor, similar to TNFR-1 derived soluble receptors (Kohno et al. Proc. Natl. Acad. Sci. USA 87, 8331-8335 (1990)). Due to the apparent biological activity of the FRI-1 gene (vide infra), the product was named Osteoprotegerin (OPG).
Example 2
OPG mRNA Expression Patterns in Tissues
[0118]Multiple human tissue northern blots (Clonetech) were probed with a 32P-dCTP labelled FRI-1 PCR product to detect the size of the human transcript and to determine patterns of expression. Northern blots were prehybridized in 5×SSPE, 50% formamide, 5× Denhardt's solution, 0.5% SDS, and 100 μg/ml denatured salmon sperm DNA for 2-4 hr at 42° C. The blots were then hybridized in 5×SSPE, 50% formamide, 2× Denhardt's solution, 0.1% SDS, 100 μg/ml denatured salmon sperm DNA, and 5 ng/ml labelled probe for 18-24 hr at 42° C. The blots were then washed in 2×SSC for 10 min at RT, 1×SSC for 10 min at 50° C., then in 0.5×SSC for 10-15 min.
[0119]Using a probe derived from the rat gene, a predominant mRNA species with a relative molecular mass of about 2.4 kb is detected in several tissues, including kidney, liver, placenta, and heart. Highest levels are detected in the kidney. A large mRNA species of Mr 4.5 and 7.5 kb was detected in skeletal muscle and pancreas. In human fetal tissue, kidney was found to express relatively high levels of the 2.4 kb mRNA. Using a human probe (vide infra), only the 2.4 kb transcript is detected in these same tissues. In addition, relatively high levels of the 2.4 kb transcript was detected in the lymph node, thymus, spleen and appendix. The size of the transcript detected by both the rat and human Osteoprotegerin gene is almost identical to the length of the rat pB1.1 FRI-1 insert, suggesting it was a full length cDNA clone.
Example 3
Systemic Delivery of OPG in Transgenic Mice
[0120]The rat OPG clone pB1.1 was used as template to PCR amplify the coding region for subcloning into an ApoE-liver specific expression vector (Simonet et al. J. Clin. Invest. 94, 1310-1319 (1994), and PCT Application No. US94/11675 and co-owned U.S. Ser. No. 08/221,767. The following 5' and 3' oligonucleotide primers were used for PCR amplification, respectively:
TABLE-US-00005 (SEQ ID NO: 9) 5'-GACTAGTCCCACAATGAACAAGTGGCTGTG-3' (SEQ ID NO: 10) 5'-ATAAGAATGCGGCCGCTAAACTATGAAACAGCCCAGTGACCATTC- 3'
[0121]The PCR reaction mixture (Boehringer-Mannheim) was treated as follows: 94° C. for 1 minute, 1 cycle; 94° C. for 20 sec, 62° C. for 30 sec, and 74 C for 1 minute, 25 cycles. Following amplification, the samples were purified over Qiagen PCR columns and digested overnight with SpeI and NotI restriction enzymes. The digested products were extracted and precipitated and subcloned into the ApoE promoter expression vector. Prior to microinjecting the resulting clone, HE-OPG, it was sequenced to ensure it was mutation-free.
[0122]The HE-OPG plasmid was purified through two rounds of CsCl density gradient centrifugation. The purified plasmid DNA was digested with XhoI and Ase I, and the 3.6 kb transgene insert was purified by gel electrophoresis. The purified fragment was diluted to a stock injection solution of 1 μg/ml in 5 mM Tris, pH 7.4, 0.2 mM EDTA. Single-cell embryos from BDF1×BDF1-bred mice were injected essentially as described (Brinster et al., Proc. Natl. Acad. Sci. USA 82, 4338 (1985)), except that injection needles were beveled and siliconized before use. Embryos were cultured overnight in a CO2 incubator and 15 to 20 2-cell embryos were transferred to the oviducts of pseudopregnant CD1 female mice.
[0123]Following term pregnancy, 49 offspring were obtained from implantation of microinjected embryos. The offspring were screened by PCR amplification of the integrated transgene in genomic DNA samples. The target region for amplification was a 369 bp region of the human Apo E intron which was included in the expression vector. The oligos used for PCR amplification were:
TABLE-US-00006 5'-GCC TCT AGA AAG AGC TGG GAC-3' (SEQ ID NO: 11) 5'-CGC CGT GTT CCA TTT ATG AGC-3' (SEQ ID NO: 12)
[0124]The conditions for PCR were: 94° C. for 2 minute, 1 cycle; 94° C. for 1 min, 63° C. for 20 sec, and 72° C. for 30 sec, 30 cycles. Of the 49 original offspring, 9 were identified as PCR positive transgenic founders.
[0125]At 8-10 weeks of age, five transgenic founders (2, 11, 16, 17, and 28) and five controls (1, 12, 15, 18, and 30) were sacrificed for necropsy and pathological analysis. Liver was isolated from the remaining 4 founders by partial hepatectomy. For partial hepatectomy, the mice were anesthetized and a lobe of liver was surgically removed. Total cellular RNA was isolated from livers of all transgenic founders, and 5 negative control littermates as described (McDonald et al. Meth. Enzymol. 152, 219 (1987)). Northern blot analysis was performed on these samples to assess the level of transgene expression. Approximately 10 ug of total RNA from each animal liver was resolved by electrophoresis denaturing gels (Ogden et al. Meth. Enzymol 152, 61 (1987)), then transferred to HYBOND-N nylon membrane (Amersham), and probed with 32P dCTP-labelled pB1.1 insert DNA. Hybridization was performed overnight at 42° C. in 50% Formamide, 5×SSPE, 0.5% SDS, 5× Denhardt's solution, 100 μg/ml denatured salmon sperm DNA and 2-4×106 cpm of labeled probe/ml of hybridization buffer. Following hybridization, blots were washed twice in 2×SSC, 0.1% SDS at room temperature for 5 min each, and then twice in 0.1×SSC, 0.1% SDS at 55° C. for 5-10 min each. Expression of the transgene in founder and control littermates was determined following autoradiography.
[0126]The northern blot data indicate that 7 of the transgenic founders express detectable levels of the transgene mRNA (animal #'s 2,11,16,17,22,33,and 45). The negative control mice and one of the founders (#28) expressed no transgene-related mRNA. Since OPG is predicted to be a secreted protein, overexpression of transgene mRNA should be a proxy for the level of systemically delivered gene product. Of the PCR and northern blot positive mice, animal 2, 17 and 22 expressed the highest levels of transgene mRNA, and may show more extensive biological effects on host cells and tissues.
Example 4
Biological Activity of OPG
[0127]Five of the transgenic mice (animals 2,11,16,17 and 28) and 5 control littermates (animals 1,12,15,18, and 30) were sacrificed for necropsy and pathological analysis using the following procedures: Prior to euthanasia, all animals had their identification numbers verified, then were weighed, anesthetized and blood drawn. The blood was saved as both serum and whole blood for a complete serum chemistry and hematology panel. Radiography was performed just after terminal anesthesia by lethal CO2 inhalation, and prior to the gross dissection. Following this, tissues were removed and fixed in 10% buffered Zn-Formalin for histological examination. The tissues collected included the liver, spleen, pancreas, stomach, duodenum, ileum, colon, kidney, reproductive organs, skin and mammary glands, bone, brain, heart, lung, thymus, trachea, esophagus, thyroid, jejunem, cecum, rectum, adrenals, urinary bladder, and skeletal muscle. Prior to fixation the whole organ weights were determined for the liver, stomach, kidney, adrenals, spleen, and thymus. After fixation the tissues were processed into paraffin blocks, and 3 um sections were obtained. Bone tissue was decalcified using a formic acid solution, and all sections were stained with hematoxylin and eosin. In addition, staining with Gomori's reticulin and Masson's trichrome were performed on certain tissues. Enzyme histochemistry was performed to determine the expression of tartrate resistant acid phosphatase (TRAP), an enzyme highly expressed by osteoclasts, multinucleated bone-resorbing cells of monocyte-macrophage lineage. Immunohistochemistry for BrdU and F480 monocyte-macrophage surface antigen was also performed to detect replicating cells and cells of the monocyte-macrophage lineage, respectively. To detect F480 surface antigen expression, formalin fixed, paraffin embedded 4 μm sections were deparaffinized and hydrated to deionized water. The sections were quenched with 3% hydrogen peroxide, blocked with Protein Block (Lipshaw, Pittsburgh, Pa.), and incubated in rat monoclonal anti-mouse F480 (Harlan, Indianapolis, Ind.). This antibody was detected by biotinylated rabbit anti-rat immunoglobulins, peroxidase conjugated strepavidin (BioGenex San Ramon, Calif.) with DAB as chromagen (BioTek, Santa Barbara, Calif.). Sections were counterstained with hematoxylin.
[0128]Upon gross dissection and observation of visceral tissues, no abnormalities were found in the transgene expressors or control littermates. Analysis of organ weight indicate that spleen size increased by approximately 38% in the transgenic mice relative to controls. There was a slight enlargement of platelet size and increased circulating unstained cells in the transgene expressors. There was a marginal decrease in platelet levels in the transgene expressors. In addition, the serum uric acid, urea nitrogen, and alkaline phosphatase levels all trended lower in the transgene expressors. The expressors were found to have increased radiodensity of the skeleton, including long bones (femurs), vertebrae, and flat bones (pelvis). The relative size of femurs in the expressors were not different from the control mice.
[0129]Histological analysis of stained sections of bone from the OPG expressors show severe osteopetrosis with the presence of cartilage remnants from the primary spongiosa seen within bone trabeculae in the diaphysis of the femur. A clearly defined cortex was not identifiable in the sections of femur. In normal animals, the central diaphysis is filled with bone marrow. Sections of vertebra also show osteopetrotic changes implying that the OPG-induced skeletal changes were systemic. The residual bone marrow showed predominantly myeloid elements. Megakaryocytes were present. Reticulin stains showed no evidence for reticulin deposition. Immunohistochemistry for F480, a cell surface antigen expressed by cells of monocyte-macrophage derivation in the mouse, showed the presence of F480 positive cells in the marrow spaces. Focally, flattened F480 positive cells could be seen directly adjacent to trabecular bone surfaces.
[0130]The mesenchymal cells lining the bony trabeculae were flattened and appeared inactive. Based on H&E and TRAP stains, osteoclasts were rarely found on the trabecular bone surfaces in the OPG expressors. In contrast, osteoclasts and/or chondroclasts were seen in the region of the growth plate resorbing cartilage, but their numbers may be reduced compared to controls. Also, osteoclasts were present on the cortical surface of the metaphysis where modeling activity is usually robust. The predominant difference between the expressors and controls was the profound decrease in trabecular osteoclasts, both in the vertebrae and femurs. The extent of bone accumulation was directly correlated with the level of OPG transgene mRNA detected by northern blotting of total liver RNA.
[0131]The spleens from the OPG expressors had an increased amount of red pulp with the expansion due to increased hematopoiesis. All hematopoietic lineages are represented. F480 positive cells were present in both control and OPG expressors in the red pulp. Two of the expressors (2 and 17) had foci of extramedullary hematopoiesis within the liver and this is likely due to the osteopetrotic marrow.
[0132]There were no observable abnormalities in the thymus, lymph nodes, gastrointestinal tract, pancreato-hepatobiliary tract, respiratory tract, reproductive system, genito-urinary system, skin, nervous system, heart and aorta, breast, skeletal muscle and fat.
Example 5
Isolation of Mouse and Human OPG cDNA
[0133]A cDNA clone corresponding to the 5' end of the mouse OPG mRNA was isolated from a mouse kidney cDNA library (Clontech) by PCR amplification. The oligonucleotides were derived from the rat OPG cDNA sequence and are shown below:
TABLE-US-00007 (SEQ ID NO: 13) 5'-ATCAAAGGCAGGGCATACTTCCTG-3' (SEQ ID NO: 14) 5'-GTTGCACTCCTGTTTCACGGTCTG-3' (SEQ ID NO: 15) 5'-CAAGACACCTTGAAGGGCCTGATG-3' (SEQ ID NO: 16) 5'-TAACTTTTACAGAAGAGCATCAGC-3' (SEQ ID NO: 17) 5'-AGCGCGGCCGCATGAACAAGTGGCTGTGCTGCG-3' (SEQ ID NO: 18) 5'-AGCTCTAGAGAAACAGCCCAGTGACCATTCC-3'
[0134]The partial and full-length cDNA products obtained in this process were sequenced. The full-length product was digested with Not I and Xba I, then directionally cloned into the plasmid vector pRcCMV (Invitrogen). The resulting plasmid was named pRcCMV-Mu-OPG. The nucleotide sequence of the cloned product was compared to the rat OPG cDNA sequence. Over the 1300 bp region spanning the OPG LORF, the rat and mouse DNA sequences are approximately 88% identical. The mouse cDNA sequence contained a 401 aa LORF, which was compared to the rat OPG protein sequence and found to be ˜94% identical without gaps. This indicates that the mouse cDNA sequence isolated encodes the murine OPG protein, and that the sequence and structure has been highly conserved throughout evolution. The mouse OPG protein sequence contains an identical putative signal peptide at its N-terminus, and all 4 potential sites of N-linked glycosylation are conserved.
[0135]A partial human OPG cDNA was cloned from a human kidney cDNA library using the following rat-specific oligonucleotides:
TABLE-US-00008 (SEQ ID NO: 19) 5'-GTG AAG CTG TGC AAG AAC CTG ATG-3' (SEQ ID NO: 20) 5'-ATC AAA GGC AGG GCA TAC TTC CTG-3'
[0136]This PCR product was sequenced and used to design primers for amplifying the 3' end of the human cDNA using a human OPG genomic clone in lambda as template:
TABLE-US-00009 5'-TCCGTAAGAAACAGCCCAGTGACC-3' (SEQ ID NO: 29) 5'-CAGATCCTGAAGCTGCTCAGTTTG-3' (SEQ ID NO: 21)
[0137]The amplified PCR product was sequenced, and together with the 5' end sequence, was used to design 5' and 3' human-specific primers useful for amplifying the entire human OPG cDNA coding sequences:
TABLE-US-00010 (SEQ ID NO: 22) 5'-AGCGCGGCCGCGGGGACCACAATGAACAAGTTG-3' (SEQ ID NO: 23) 5'-AGCTCTAGAATTGTGAGGAAACAGCTCAATGGC-3'
[0138]The full-length human PCR product was sequenced, then directionally cloned into the plasmid vector pRcCMV (Invitrogen) using Not I and Xba I. The resulting plasmid was named pRcCMV-human OPG. The nucleotide sequence of the cloned product was compared to the rat and mouse OPG cDNA sequences. Over the 1300 bp region spanning the OPG LORF, the rat and mouse DNA sequences are approximately 78-88% identical to the human OPG cDNA. The human OPG cDNA sequence also contained a 401 aa LORF, and it was compared to the rat and mouse protein sequences. The predicted human OPG protein is approximately 85% identical, and ˜90% identical to the rat and mouse proteins, respectively. Sequence alignment of rat, mouse and human proteins show that they have been highly conserved during evolution. The human protein is predicted to have a N-terminal signal peptide, and 5 potential sites of N-linked glycosylation, 4 of which are conserved between the rat and mouse OPG proteins.
[0139]The DNA and predicted amino acid sequence of mouse OPG is shown in FIGS. 9A and 9B (SEQ ID NO:122). The DNA and predicted amino acid sequence of human OPG is shown in FIGS. 9C and 9D (SEQ ID NO:124). A comparison of the rat, mouse and human OPG amino acid sequences is shown in FIGS. 9E and 9F.
[0140]Isolation of additional human OPG cDNA clones revealed the presence of a G to C base change at position 103 of the DNA sequence shown in FIG. 9C. This nucleotide change results in substitution of an asparagine for a lysine at position 3 of the amino acid sequence shown in FIG. 9C. The remainder of the sequence in clones having this change was identical to that in FIGS. 9C and 9D.
Example 6
OPG Three-Dimensional Structure Modeling
[0141]The amino-terminal portion of OPG has homology to the extracellular portion of all known members of the TNFR superfamily (FIG. 1C). The most notable motif in this region of TNFR-related genes is an ˜40 amino acid, cysteine-rich repeat sequence which folds into distinct structures (Banner et al. Cell 73, 431-445 (1993)). This motif is usually displayed in four (range 3-6) tandem repeats (see FIG. 1C), and is known to be involved in ligand binding (Beutler and van Huffel Science 264, 667-663 (1994)). Each repeat usually contains six interspaced cysteine residues, which are involved in forming three intradomain disulfide bonds, termed SS1, SS2, and SS3 (Banner et al., ibid). In some receptors, such as TNFR2, CD30 and CD40, some of the repeat domains contain only two intrachain disulfide bonds (SS1 and SS3).
[0142]The human OPG protein sequence was aligned to a TNFR1 extracellular domain profile using methods described by Luethy, et al., ibid, and the results were graphically displayed using the PrettyPlot program from the Wisconsin Package, version 8.1 (Genetics Computer Group, Madison, Wis.) (FIG. 10). The alignment indicates a clear conservation of cysteine residues involved in formation of domains 1-4. This alignment was then used to construct a three-dimensional (3-D) model of the human OPG N-terminal domain using the known 3-D structure of the extracellular domain of p55 TNFR1 (Banner et al., ibid) as the template. To do this the atomic coordinates of the peptide backbone and side chains of identical residues were copied from the crystal structure coordinates of TNFR1. Following this, the remaining coordinates for the insertions and different side chains were generated using the LOOK program (Molecular Applications Group, Palo Alto, Calif.). The 3-D model was then refined by minimizing its conformational energy using LOOK.
[0143]By analogy with other TNFR family members, it is assumed that OPG binds to a ligand. For the purpose of modeling the interaction of OPG with its ligand, the crystal structure of TNF-β was used to simulate a 3-D representation of an "OPG ligand". This data was graphically displayed (see FIG. 11) using Molscript (Kraulis, J. Appl. Cryst. 24, 946-950, 1991). A model for the OPG/ligand complex with 3 TNFβ and 3 OPG molecules was constructed where the relative positions of OPG are identical to TNFR1 in the crystal structure. This model was then used to find the residues of OPG that could interact with its ligand using the following approach: The solvent accessible area of all residues in the complex and one single OPG model were calculated. The residues that have different accessibility in the complex than in the monomer are likely to interact with the ligand.
[0144]The human and mouse OPG amino acid sequences were realigned using this information to highlight sequences comprising each of the cysteine rich domains 1-4 (FIGS. 12A and 12B). Each domain has individual structural characteristics which can be predicted:
[0145]Domain 1
[0146]Contains 4 cysteines involved in SS2 (C41 to C54) and SS3 (C44 to C62) disulfide bonds. Although no SS1 bond is evident based on disulfide bridges, the conserved tyrosine at position 28 is homologous to Y20 in TNFR1, which is known to be involved in interacting with H66 to aid in domain formation. OPG has a homologous histidine at position 75, suggesting OPG Y28 and H75 stack together in the native protein, as do the homologous residues in TNFR1. Therefore, both of these residues may indeed be important for biological activity, and N-terminal OPG truncations up to and beyond Y28 may have altered activity. In addition, residues E34 and K43 are predicted to interact with a bound ligand based on our 3-dimensional model.
[0147]Domain 2
[0148]Contains six cysteines and is predicted to contain SS1 (C65 to C80), SS2 (C83 to C98) and SS3 (C87 to C105) disulfide bonds. This region of OPG also contains an region stretching from P66-Q91 which aligns to the portion of TNFR1 domain 2 which forms close contacts with TNFβ (see above), and may interact with an OPG ligand. In particular residues P66, H68, Y69, Y70, T71, D72, S73, H75, T76, S77, D78, E79, L81, Y82, P85, V86, K88, E89, L90, and Q91 are predicted to interact with a bound ligand based on our structural data.
[0149]Domain 3
[0150]Contains 4 cysteines involved in SS1 (C107 to C 118) and SS3 (C124 to C142) disulfide bonds, but not an SS2 bond. Based on our structural data, residues E115, L118 and K119 are predicted in to interact with an OPG ligand.
[0151]Domain 4
[0152]Contains 4 cysteines involved in SS1 (C145 to C160) and SS3 (C166 to C185) disulfide bonds, but not an SS2 bond, similar to domain 3. Our structural data predict that E153 and S155 interact with an OPG ligand.
[0153]Thus, the predicted structural model for OPG identifies a number of highly conserved residues which are likely to be important for its biological activity.
Example 7
Production of Recombinant Secreted OPG Protein in Mammalian Cells
[0154]To determine if OPG is actually a secreted protein, mouse OPG cDNA was fused to the human IgG1 Fc domain as a tag (Capon et al. Nature 337, 525-531 (1989)), and expressed in human 293 fibroblasts. Fc fusions were carried out using the vector pFc-A3. pFc-A3 contains the region encoding the Fc portion of human immunoglobulin IgG-γ1 heavy chain (Ellison et al. ibid) from the first amino acid of the hinge domain (Glu-99) to the carboxyl terminus and is flanked by a 5'-NotI fusion site and 3'-SalI and XbaI sites. The plasmid was constructed by PCR amplification of the human spleen cDNA library (Clontech). PCR reactions were in a final volume of 100 μl and employed 2 units of Vent DNA polymerase (New England Biolabs) in 20 mM Tris-HCl (pH 8.8), 10 mM KCl, 10 μM (NH4)2SO4, 2 mM MgSO4, 0.1% Triton X-100 with 400 μM each dNTP and 1 ng of the cDNA library to be amplified together with 1 μM of each primer. Reactions were initiated by denaturation at 95° C. for 2 min, followed by 30 cycles of 95° C. for 30 s, 55° C. for 30 s, and 73° C. for 2 min. The 5' primer 5' ATAGCGGCCGCTGAGCCCAAATCTTGTGACAAAACTCAC 3' (SEQ ID NO:24) incorporated a NotI site immediately 5' to the first residue (Glu-99) of the hinge domain of IgG-γ1. The 3' primer 5'-TCTAGAGTCGACTTATCATTTACCCGGAGACAGGGAGAGGCTCTT-3' (SEQ ID NO:25) incorporated SalI and XbaI sites. The 717-bp PCR product was digested with NotI and SalI, isolated by electrophoresis through 1% agarose (FMC Corp.), purified by the Geneclean procedure (BIO 101, Inc.) and cloned into NotI, SalI-digested pBluescript II KS vector (Stratagene). The insert in the resulting plasmid, pFc-A3, was sequenced to confirm the fidelity of the PCR reaction.
[0155]The cloned mouse cDNA in plasmid pRcCMV-MuOPG was amplified using the following two sets of primer pairs:
TABLE-US-00011 Pair 1 (SEQ ID NO: 26) 5'-CCTCTGAGCTCAAGCTTCCGAGGACCACAATGAACAAG-3' (SEQ ID NO: 27) 5'-CCTCTGCGGCCGCTAAGCAGCTTATTTTCACGGATTGAACCTG-3' Pair 2 (SEQ ID NO: 28) 5'-CCTCTGAGCTCAAGCTTCCGAGGACCACAATGAACAAG-3' (SEQ ID NO: 30) 5'-CCTCTGCGGCCGCTGTTGCATTTCCTTTCTG-3'
[0156]The first pair amplifies the entire OPG LORF, and creates a NotI restriction site which is compatible with the in-frame Not I site in Fc fusion vector pFcA3. pFcA3 was prepared by engineering a NotI restriction site 5' to aspartic acid reside 216 of the human IgG1 Fc cDNA. This construct introduces a linker which encodes two irrelevant amino acids which span the junction between the OPG protein and the IgG Fc region. This product, when linked to the Fc portion, would encode all 401 OPG residues directly followed by all 227 amino acid residues of the human IgG1 Fc region (Fl.Fc). The second primer pair amplifies the DNA sequences encoding the first 180 amino acid residues of OPG, which encompasses its putative ligand binding domain. As above, the 3' primer creates an artificial Not I restriction site which fuses the C-terminal truncated OPG LORF at position threonine 180 directly to the IgG1 Fc domain (CT.fc).
[0157]The amino acid sequence junction linking OPG residue 401 and aseptic acid residue 221 of the human Fc region can be modified as follows: The DNA encoding residues 216-220 of the human Fc region can be deleted as described below, or the cysteine residue corresponding to C220 of the human Fc region can be mutated to either serine or alanine. OPF-Fc fusion protein encoded by these modified vectors can be transfected into human 293 cells, or CHO cells, and recombinant OPG-Fc fusion protein purified as described below.
[0158]Both products were directionally cloned into the plasmid vector pCEP4 (Invitrogen). pCEP4 contains the Epstein-Barr virus origin of replication, and is capable of episomal replication in 293-EBNA-1 cells. The parent pCEP4, and pCEP4-Fl.Fc and pCEP4-CT.Fc vectors were lipofected into 293-EBNA-1 cells using the manufacturer's recommended methods. The transfected cells were then selected in 100 μg/ml hygromycin to select for vector expression, and the resulting drug-resistant mass cultures were grown to confluence. The cells were then cultured in serum-free media for 72 hr, and the conditioned media removed and analysed by SDS-PAGE. A silver staining of the polyacrylamide gel detects the major conditioned media proteins produced by the drug resistant 293 cultures. In the pCEP4-Fl.Fc and the pCEP4-CT.Fc conditioned media, unique bands of the predicted sizes were abundantly secreted (see FIGS. 13B and 13C). The full-length Fc fusion protein accumulated to a high concentration, indicating that it may be stable. Both Fc fusion proteins were detected by anti-human IgG1 Fc antibodies (Pierce) on western blots, indicating that they are recombinant OPG products.
[0159]The full length OPG-Fc fusion protein was purified by Protein-A column chromatography (Pierce) using the manufacturers recommended procedures. The protein was then subjected to N-terminal sequence analysis by automated Edman degradation as essentially described by Matsudaira et al. (J. Biol. Chem. 262, 10-35 (1987)). The following amino acid sequence was read after 19 cycles:
TABLE-US-00012 (SEQ ID NO: 31) NH2-E T L P P K Y L H Y D P E T G H Q L L-CO2H
[0160]This sequence was identical to the predicted mouse OPG amino acid sequence beginning at amino acid residue 22, suggesting that the natural mammalian leader cleavage site is between amino acid residues Q21-E22, not between Y31-D32 as originally predicted. The expression experiments performed in 293-EBNA cells with pCEP4-Fl.Fc and pCEP4-CT.Fc demonstrate that OPG is a secreted protein, and may act systemically to bind its ligand.
[0161]Procedures similar to those used to construct and express the muOPG[22-180]-Fc and muOPG[22-401]-Fc fusions were employed for additional mouse and human OPG-Fc fusion proteins.
[0162]Murine OPG cDNA encoding amino acids 1-185 fused to the Fc region of human IgG1 [muOPG Ct(185).Fc] was constructed as follows. Murine OPG cDNA from plasmid pRcCMV Mu Osteoprotegerin (described in Example 5) was amplified using the following primer pair in a polymerase chain reaction as described above:
TABLE-US-00013 1333-82: (SEQ ID NO: 32) 5'-TCC CTT GCC CTG ACC ACT CTT-3' 1333-80: (SEQ ID NO: 33) 5'-CCT CTG CGG CCG CAC ACA CGT TGT CAT GTG TTG C- 3'
[0163]This primer pair amplifies the murine OPG cDNA region encoding amino acid residues 63-185 (corresponding to bp 278-645) of the OPG reading frame as shown in FIG. 9A. The 3' primer contains a Not I restriction site which is compatible with the in-frame Not I site of the Fc fusion vector pFcA3. The product also spans a unique EcoRI restriction site located at bp 436. The amplified PCR product was purified, cleaved with NotI and EcoRI, and the resulting EcoRI-NotI restriction fragment was purified. The vector pCEP4 having the murine 1-401 OPG-Fc fusion insert was cleaved with EcoRI and NotI, purified, and ligated to the PCR product generated above. The resulting pCEP4-based expression vector encodes OPG residues 1-185 directly followed by all 227 amino acid residues of the human IgG1 Fc region. The murine OPG 1-185.Fc fusion vector was transfected into 293 cells, drug selected, and conditioned media was produced as described above. The resulting secreted murine OPG 1-185.Fc fusion product was purified by Protein-A column chromatography (Pierce) using the manufacturers recommended procedures.
[0164]Murine OPG DNA encoding amino acid residues 1-194 fused to the Fc region of human IgG1 (muOPG Ct(194).Fc) was constructed as follows. Mouse OPG cDNA from plasmid pRcCMV Mu-Osteoprotegerin was amplified using the following primer pairs:
TABLE-US-00014 1333-82: (SEQ ID NO: 34) 5'-TCC CTT GCC CTG ACC ACT CTT-3' 1333-81: (SEQ ID NO: 35) 5'-CCT CTG CGG CCG CCT TTT GCG TGG CTT CTC TGT T- 3'
[0165]This primer pair amplifies the murine OPG cDNA region encoding amino acid residues 70-194 (corresponding to bp 298-672) of the OPG reading frame. The 3' primer contains a Not I restriction site which is compatible with the in-frame Not I site of the Fc fusion vector pFcA3. The product also spans a unique EcoRI restriction site located at bp 436. The amplified PCR product was cloned into the murine OPG[1-401] Fc fusion vector as described above. The resulting pCEP4-based expression vector encodes OPG residues 1-194 directly followed by all 227 amino acid residues of the human IgG1 Fc region. The murine OPG 1-194.Fc fusion vector was transfected into 293 cells, drug selected, and conditioned media was produced. The resulting secreted fusion product was purified by Protein-A column chromatography (Pierce) using the manufacturers recommended procedures.
[0166]Human OPG DNA encoding amino acids 1-401 fused to the Fc region of human IgG1 was constructed as follows. Human OPG DNA in plasmid pRcCMV-hu osteoprotegerin (described in Example 5) was amplified using the following oligonucleotide primers:
TABLE-US-00015 1254-90: (SEQ ID NO: 36) 5'CCT CTG AGC TCA AGC TTG GTT TCC GGG GAC CAC AAT G-3' 1254-95: (SEQ ID NO: 37) 5'-CCT CTG CGG CCG CTA AGC AGC TTA TTT TTA CTG AAT GG-3'
[0167]The resulting PCR product encodes the full-length human OPG protein and creates a Not I restriction site which is compatible with the in-frame Not I site Fc fusion vector FcA3. The PCR product was directionally cloned into the plasmid vector pCEP4 as described above. The resulting expression vector encodes human OPG residues 1-401 directly followed by 227 amino acid residues of the human IgG1 Fc region. Conditioned media from transfected and drug selected cells was produced and the huOPG Fl.Fc fusion product was purified by Protein-A column chromatography (Pierce) using the manufacturers recommended procedures.
[0168]Human OPG DNA encoding amino acid residues 1-201 fused to the Fc region of human IgG1 [huOPG Ct(201).Fc] was constructed as follows. The cloned human OPG cDNA from plasmid pRrCMV-hu osteoprotegerin was amplified by PCR using the following oligonucleotide primer pair:
TABLE-US-00016 1254-90: (SEQ ID NO: 38) 5'-CCT CTG AGC TCA AGC TTG GTT TCC GGG GAC CAC AAT G-3' 1254-92: (SEQ ID NO: 39) 5'-CCT CTG CGG CCG CCA GGG TAA CAT CTA TTC CAC-3'
[0169]This primer pair amplifies the human OPG cDNA region encoding amino acid residues 1-201 of the OPG reading frame, and creates a Not I restriction site at the 3' end which is compatible with the in-frame Not I site Fc fusion vector FcA3. This product, when linked to the Fc portion, encodes OPG residues 1-201 directly followed by all 221 amino acid residues of the human IgG1 Fc region. The PCR product was directionally cloned into the plasmid vector pCEP4 as described above. Conditioned media from transfected and drug selected cells was produced, and the hu OPG Ct(201).Fc fusion products purified by Protein-A column chromatography (Pierce) using the manufacturer's recommended procedures.
[0170]The following procedures were used to construct and express unfused mouse and human OPG.
[0171]A plasmid for mammalian expression of full-length murine OPG (residues 1-401) was generated by PCR amplification of the murine OPG cDNA insert from pRcCMV Mu-Osteoprotegerin and subcloned into the expression vector pDSRα (DeClerck et. atl. J. Biol. Chem. 266, 3893 (1991)). The following oligonucleotide primers were used:
TABLE-US-00017 1295-26: (SEQ ID NO: 40) 5'-CCG AAG CTT CCA CCA TGA ACA AGT GGC TGT GCT GC-3' 1295-27: (SEQ ID NO: 41) 5'-CCT CTG TCG ACT ATT ATA AGC AGC TTA TTT TCA CGG ATT G-3'
[0172]The murine OPG full length reading frame was amplified by PCR as described above. The PCR product was purified and digested with restriction endonucleases Hind III and Xba I (Boehringer Mannheim, Indianapolis, Ind.) under the manufacturers recommended conditions, then ligated to Hind III and Xba I digested pDSRα. Recombinant clones were detected by restriction endonuclease digestion, then sequenced to ensure no mutations were produced during the PCR amplification steps.
[0173]The resulting plasmid, pDSRα-muOPG was introduced into Chinese hamster ovary (CHO) cells by calcium mediated transfection (Wigler et al. Cell 11, 233 (1977)). Individual colonies were selected based upon expression of the dihydrofolate reductase (DHFR) gene in the plasmid vector and several clones were isolated. Expression of the murine OPG recombinant protein was monitored by western blot analysis of CHO cell conditioned media. High expressing cells were selected, and OPG expression was further amplified by treatment with methotrexate as described (DeClerck et al., idid). Conditioned media from CHO cell lines was produced for further purification of recombinant secreted murine OPG protein.
[0174]A plasmid for mammalian expression of full-length human OPG (amino acids 1-401) was generated by subcloning the cDNA insert in pRcCMV-hu Osteoprotegerin directly into vector pDSRα (DeClerck et al., ibid). The pRcCMV-OPG plasmid was digested to completion with Not I, blunt ended with Klenow, then digested to completion with Xba I. Vector DNA was digested with Hind III, blunt ended with Klenow, then digested with Xba I, then ligated to the OPG insert. Recombinant plasmids were then sequenced to confirm proper orientation of the human OPG cDNA.
[0175]The resulting plasmid pDSRα-huOPG was introduced into Chinese hamster ovary (CHO) cells as described above. Individual colonies were selected based upon expression of the dihydrofolate reductase (DHFR) gene in the plasmid vector and several clones were isolated. Expression of the human OPG recombinant protein was monitored by western blot analysis of CHO cell conditioned media. High expressing clones were selected, and OPG expression was further amplified by treatment with methotrexate. Conditioned media from CHO cell lines expressing human OPG was produced for protein purification.
[0176]Expression vectors for murine OPG encoding residues 1-185 were constructed as follows. Murine OPG cDNA from pRcCMV-Mu OPG was amplified using the following oligonucleotide primers:
TABLE-US-00018 1333-82: (SEQ ID NO: 42) 5'-TCC CTT GCC CTG ACC ACT CTT-3' 1356-12: (SEQ ID NO: 43) 5'-CCT CTG TCG ACT TAA CAC ACG TTG TCA TGT GTT GC-3'
[0177]This primer pair amplifies the murine OPG cDNA region encoding amino acids 63-185 of the OPG reading frame (bp 278-645) and contains an artificial stop codon directly after the cysteine codon (C185), which is followed by an artificial Sal I restriction endonuclease site. The predicted product contains an internal Eco RI restriction site useful for subcloning into a pre-existing vector. After PCR amplification, the resulting purified product was cleaved with Eco RI and Sal I restriction endonucleases, and the large fragment was gel purified. The purified product was then subcloned into the large restriction fragment of an Eco RI and Sal I digest of pBluescript-muOPG Fl.Fc described above. The resulting plasmid was digested with Hind III and Xho I and the small fragment was gel purified. This fragment, which contains a open reading frame encoding residues 1-185 was then subcloned into a Hind III and Xho I digest of the expression vector pCEP4. The resulting vector, pmuOPG [1-185], encodes a truncated OPG polypeptide which terminates at a cysteine residue located at position 185. Conditioned media from transfected and drug selected cells was produced as described above.
TABLE-US-00019 (SEQ ID NO: 44) 1333-82: 5'-TCC CTT GCC CTG ACC ACT CTT-3' (SEQ ID NO: 45) 1356-13: 5'-CCT CTG TCG ACT TAC TTT TGC GTG GCT TCT CTG TT-3'
[0178]This primer pair amplifies the murine OPG cDNA region encoding amino acids 70-194 of the OPG reading frame (bp 298-672) and contains an artificial stop codon directly after the lysine codon (K194), which is followed by an artificial Sal I restriction endonuclease site. The predicted product contains an internal Eco RI restriction site useful for subcloning into a pre-existing vector. After PCR amplification, the resulting purified product was cleaved with Eco RI and Sal I restriction endonucleases, and the large fragment was gel purified. The purified product was then subcloned into the large restriction fragment of an Eco RI and Sal I digest of pBluescript-muOPG Fl.Fc described above. The resulting plasmid was digested with Hind III and Xho I and the small fragment was gel purified. This fragment, which contains a open reading frame encoding residues 1-185 was then subcloned into a Hind III and Xho I digest of the expression vector pCEP4. The resulting vector, pmuOPG [1-185], encodes a truncated OPG polypeptide which terminates at a lysine at position 194. Conditioned media from transfected and drug selected cells was produced as described above.
[0179]Several mutations were generated at the 5' end of the huOPG [22-401]-Fc gene that introduce either amino acid substitutions, or deletions, of OPG between residues 22 through 32. All mutations were generated with the "QuickChange® Site-Directed Mutagenesis Kit" (Stratagene, San Diego, Calif.) using the manufacturer's recommended conditions. Briefly, reaction mix containing huOPG [22-401]-Fc plasmid DNA template and mutagenic primers were treated with Pfu polymerase in the presence of deoxynucleotides, then amplified in a thermocycler as described above. An aliqout of the reaction is then transfected into competent E. coli XL1-Blue by heatshock, then plated. Plasmid DNA from transformants was then sequenced to verify mutations.
[0180]The following primer pairs were used to delete residues 22-26 of the human OPG gene, resulting in the production of a huOPG [27-401]-Fc fusion protein:
TABLE-US-00020 (SEQ ID NO: 140) 1436-11: 5'-TGG ACC ACC CAG AAG TAC CTT CAT TAT GAC-3' (SEQ ID NO: 141) 1436-12: 5'-GTC ATA ATG AAG GTA CTT CTG GGT GGT CCA-3'
[0181]The following primer pairs were used to delete residues 22-28 of the human OPG gene, resulting in the production of a huOPG [29-401]-Fc fusion protein:
TABLE-US-00021 (SEQ ID NO: 142) 1436-17: 5'-GGA CCA CCC AGC TTC ATT ATG ACG AAG AAA C-3' (SEQ ID NO: 143) 1436-18: 5'-GTT TCT TCG TCA TAA TGA AGC TGG GTG GTC C-3'
[0182]The following primer pairs were used to delete residues 22-31 of the human OPG gene, resulting in the production of a huOPG [32-401]-Fc fusion protein:
TABLE-US-00022 (SEQ ID NO: 144) 1436-27: 5'-GTG GAC CAC CCA GGA CGA AGA AAC CTC TC-3' (SEQ ID NO: 145) 1436-28: 5'-GAG AGG TTT CTT CGT CCT GGG TGG TCC AC-3'
[0183]The following primer pairs were used to change the codon for tyrosine residue 28 to phenylalanine of the human OPG gene, resulting in the production of a huOPG [22-401]-Fc Y28F fusion protein:
TABLE-US-00023 (SEQ ID NO: 146) 1436-29: 5'-CGT TTC CTC CAA AGT TCC TTC ATT ATG AC-3' (SEQ ID NO: 147) 1436-30: 5'-GTC ATA ATG AAG GAA CTT TGG AGG AAA CG-3'
[0184]The following primer pairs were used to change the codon for proline residue 26 to alanine of the human OPG gene, resulting in the production of a huOPG [22-401]-Fc P26A fusion protein:
TABLE-US-00024 (SEQ ID NO: 148) 1429-83: 5'-GGA AAC GTT TCC TGC AAA GTA CCT TCA TTA TG-3 (SEQ ID NO: 149) 1429-84: 5'-CAT AAT GAA GGT ACT TTG CAG GAA ACG TTT CC-3'
[0185]Each resulting muOPG [22-401]-Fc plasmid containing the appropriate mutation was then transfected into human 293 cells, the mutant OPG-Fc fusion protein purified from conditioned media as described above. The biological activity of each protein was assessed the in vitro osteoclast forming assay described in Example 11.
Example 8
Expression of OPG in E. Coli
A. Bacterial Expression Vectors
[0186]pAMG21
[0187]The expression plasmid pAMG21 can be derived from the Amgen expression vector pCFM1656 (ATCC #69576) which in turn be derived from the Amgen expression vector system described in U.S. Pat. No. 4,710,473. The pCFM1656 plasmid can be derived from the described pCFM836 plasmid (U.S. Pat. No. 4,710,473) by: (a) destroying the two endogenous NdeI restriction sites by end filling with T4 polymerase enzyme followed by blunt end ligation; (b) replacing the DNA sequence between the unique AatII and Clal restriction sites containing the synthetic PL promoter with a similar fragment obtained from pCFM636 (U.S. Pat. No. 4,710,473) containing the PL promoter
TABLE-US-00025 AatII 5' CTAATTCCGCTCTCACCTACCAAACAATGCCCCCCTGCAAAAAATAAATTCATAT- 3'TGCAGATTAAGGCGAGAGTGGATGGTTTGTTACGGGGGGACGTTTTTTATTTAAGTATA- -AAAAAACATACAGATAACCATCTGCGGTGATAAATTATCTCTGGCGGTGTTGACATAAA- -TTTTTTGTATGTCTATTGGTAGACGCCACTATTTAATAGAGACCGCCACAACTGTATTT- -TACCACTGGCGGTGATACTGAGCACAT 3'(SEQ ID NO: 53) -ATGGTGACCGCCACTATGACTCGTGTAGC5'(SEQ ID NO: 54) ClaI
and then (c) substituting the small DNA sequence between the unique ClaI and KpnI restriction sites with the following oligonucleotide:
TABLE-US-00026 (SEQ ID NO: 48) 5'CGATTTGATTCTAGAAGGAGGAATAACATATGGTTAACGCGTTGGAATTCGGTAC3' (SEQ ID NO: 49) 3'TAAACTAAGATCTTCCTCCTTATTGTATACCAATTGCGCAACCTTAAGC5' ClaI KpnI
The expression plasmid pAMG21 can then be derived from pCFM1656 by making a series of site directed base changes by PCR overlapping oligo mutagenesis and DNA sequence substitutions. Starting with the BglII site (plasmid by #180) immediately 5' to the plasmid replication promoter PcopB and proceeding toward the plasmid replication genes, the base pair changes are as follows:
TABLE-US-00027 pAMG21 by # bp in pCFM1656 bp changed to in pAMG21 # 204 T/A C/G # 428 A/T G/C # 509 G/C A/T # 617 -- insert two G/C bp # 679 G/C T/A # 980 T/A C/G # 994 G/C A/T # 1004 A/T C/G # 1007 C/G T/A # 1028 A/T T/A # 1047 C/G T/A # 1178 G/C T/A # 1466 G/C T/A # 2028 G/C bp deletion # 2187 C/G T/A # 2480 A/T T/A # 2499-2502 AGTG GTCA TCAC CAGT # 2642 TCCGAGC 7 bp deletion AGGCTCG # 3435 G/C A/T # 3446 G/C A/T # 3643 A/T T/A
The DNA sequence between the unique AatII (position #4364 in pCFM1656) and SacII (position #4585 in pCFM1656) restriction sites is substituted with the following DNA sequence:
TABLE-US-00028 [AatII sticky end] 5' GCGTAACGTATGCATGGTCTCC- (position #4358 in pAMG21) 3' TGCACGCATTGCATACGTACCAGAGG- -CCATGCGAGAGTAGGGAACTGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACT- -GGTACGCTCTCATCCCTTGACGGTCCGTAGTTTATTTTGCTTTCCGAGTCAGCTTTCTGA- -GGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCCTGAGTAGGACAAATCCGC- -CCCGGAAAGCAAAATAGACAACAAACAGCCACTTGCGAGAGGACTCATCCTGTTTAGGCG- -CGGGAGCGGATTTGAACGTTGCGAAGCAACGGCCCGGAGGGTGGCGGGCAGGACGCCCGC- -GCCCTCGCCTAAACTTGCAACGCTTCGTTGCCGGGCCTCCCACCGCCCGTCCTGCGGGCG- -CATAAACTGCCAGGCATCAAATTAAGCAGAAGGCCATCCTGACGGATGGCCTTTTTGCGT- -GTATTTGACGGTCCGTAGTTTAATTCGTCTTCCGGTAGGACTGCCTACCGGAAAAACGCA- AatII -TTCTACAAACTCTTTTGTTTATTTTTCTAAATACATTCAAATATGGACGTCGTACTTAAC- -AAGATGTTTGAGAAAACAAATAAAAAGATTTATGTAAGTTTATACCTGCAGCATGAATTG- -TTTTAAAGTATGGGCAATCAATTGCTCCTGTTAAAATTGCTTTAGAAATACTTTGGCAGC- -AAAATTTCATACCCGTTAGTTAACGAGGACAATTTTAACGAAATCTTTATGAAACCGTCG- -GGTTTGTTGTATTGAGTTTCATTTGCGCATTGGTTAAATGGAAAGTGACCGTGCGCTTAC- -CCAAACAACATAACTCAAAGTAAACGCGTAACCAATTTACCTTTCACTGGCACGCGAATG- -TACAGCCTAATATTTTTGAAATATCCCAAGAGCTTTTTCCTTCGCATGCCCACGCTAAAC- -ATGTCGGATTATAAAAACTTTATAGGGTTCTCGAAAAAGGAAGCGTACGGGTGCGATTTG- -ATTCTTTTTCTCTTTTGGTTAAATCGTTGTTTGATTTATTATTTGCTATATTTATTTTTC- -TAAGAAAAAGAGAAAACCAATTTAGCAACAAACTAAATAATAAACGATATAAATAAAAAG- -GATAATTATCAACTAGAGAAGGAACAATTAATGGTATGTTCATACACGCATGTAAAAATA- -CTATTAATAGTTGATCTCTTCCTTGTTAATTACCATACAAGTATGTGCGTACATTTTTAT- -AACTATCTATATAGTTGTCTTTCTCTGAATGTGCAAAACTAAGCATTCCGAAGCCATTAT- -TTGATAGATATATCAACAGAAAGAGACTTACACGTTTTGATTCGTAAGGCTTCGGTAATA- -TAGCAGTATGAATAGGGAAACTAAACCCAGTGATAAGACCTGATGATTTCGCTTCTTTAA- -ATCGTCATACTTATCCCTTTGATTTGGGTCACTATTCTGGACTACTAAAGCGAAGAAATT- -TTACATTTGGAGATTTTTTATTTACAGCATTGTTTTCAAATATATTCCAATTAATCGGTG- -AATGTAAACCTCTAAAAAATAAATGTCGTAACAAAAGTTTATATAAGGTTAATTAGCCAC- -AATGATTGGAGTTAGAATAATCTACTATAGGATCATATTTTATTAAATTAGCGTCATCAT- -TTACTAACCTCAATCTTATTAGATGATATCCTAGTATAAAATAATTTAATCGCAGTAGTA- -AATATTGCCTCCATTTTTTAGGGTAATTATCCAGAATTGAAATATCAGATTTAACCATAG- -TTATAACGGAGGTAAAAAATCCCATTAATAGGTCTTAACTTTATAGTCTAAATTGGTATC- -AATGAGGATAAATGATCGCGAGTAAATAATATTCACAATGTACCATTTTAGTCATATCAG- -TTACTCCTATTTACTAGCGCTCATTTATTATAAGTGTTACATGGTAAAATCAGTATAGTC- -ATAAGCATTGATTAATATCATTATTGCTTCTACAGGCTTTAATTTTATTAATTATTCTGT- -TATTCGTAACTAATTATAGTAATAACGAAGATGTCCGAAATTAAAATAATTAATAAGACA- -AAGTGTCGTCGGCATTTATGTCTTTCATACCCATCTCTTTATCCTTACCTATTGTTTGTC- -TTCACAGCAGCCGTAAATACAGAAAGTATGGGTAGAGAAATAGGAATGGATAACAAACAG- -GCAAGTTTTGCGTGTTATATATCATTAAAACGGTAATAGATTGACATTTGATTCTAATAA- -CGTTCAAAACGCACAATATATAGTAATTTTGCCATTATCTAACTGTAAACTAAGATTATT- -ATTGGATTTTTGTCACACTATTATATCGCTTGAAATACAATTGTTTAACATAAGTACCTG- -TAACCTAAAAACAGTGTGATAATATAGCGAACTTTATGTTAACAAATTGTATTCATGGAC- -TAGGATCGTACAGGTTTACGCAAGAAAATGGTTTGTTATAGTCGATTAATCGATTTGATT- -ATCCTAGCATGTCCAAATGCGTTCTTTTACCAAACAATATCAGCTAATTAGCTAAACTAA- -CTAGATTTGTTTTAACTAATTAAAGGAGGAATAACATATGGTTAACGCGTTGGAATTCGA- -GATCTAAACAAAATTGATTAATTTCCTCCTTATTGTATACCAATTGCGCAACCTTAAGCT- SacII -GCTCACTAGTGTCGACCTGCAGGGTACCATGGAAGCTTACTCGAGGATCCGCGGAAAGAA- -CGAGTGATCACAGCTGGACGTCCCATGGTACCTTCGAATGAGCTCCTAGGCGCCTTTCTT- -GAAGAAGAAGAAGAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATA- -CTTCTTCTTCTTCTTTCGGGCTTTCCTTCGACTCAACCGACGACGGTGGCGACTCGTTAT- -ACTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGCTGAAAGGAGG- -TGATCGTATTGGGGAACCCCGGAGATTTGCCCAGAACTCCCCAAAAAACGACTTTCCTCC- (SEQ ID NO: 50) -AACCGCTCTTCACGCTCTTCACGC 3' [SacII sticky end] (SEQ ID NO: 46) -TTGGCGAGAAGTGCGAGAAGTG 5' (position #5904 in pAMG21)
During the ligation of the sticky ends of this substitution DNA sequence, the outside AatII and SacII sites are destroyed. There are unique AatII and SacII sites in the substituted DNA.pAMG22-His
[0188]The expression plasmid pAMG22-His can be derived from the Amgen expression vector pAMG22 by substituting the small DNA sequence between the unique NdeI (#4795) and EcoRI (#4818) restriction sites of pAMG22 with the following oligonucleotide duplex:
TABLE-US-00029 NdeI NheI EcoRI (SEQ ID NO: 51) 5' TATGAAACATCATCACCATCACCATCATGCTAGCGTTAACGCGTTGG 3' (SEQ ID NO: 52) 3' ACTTTGTAGTAGTGGTAGTGGTAGTACGATCGCAATTGCGCAACCTTAA 5' (SEQ ID NO: 168) MetLysHisHisHisHisHisHisHisAlaSerValAsnAlaLeuGlu
pAMG22
[0189]The expression plasmid pAMG22 can be derived from the Amgen expression vector pCFM1656 (ATCC #69576) which in turn be derived from the Amgen expression vector system described in U.S. Pat. No. 4,710,473 granted Dec. 1, 1987. The pCFM1656 plasmid can be derived from the described pCFM836 plasmid (U.S. Pat. No. 4,710,473) by: (a) destroying the two endogenous NdeI restriction sites by end filling with T4 polymerase enzyme followed by blunt end ligation; (b) replacing the DNA sequence between the unique AatII and ClaI restriction sites containing the synthetic PL promoter with a similar fragment obtained from pCFM636 (U.S. Pat. No. 4,710,473) containing the PL promoter
TABLE-US-00030 AatII 5' CTAATTCCGCTCTCACCTACCAAACAATGCCCCCCTGCAAAAAATAAATTCATAT- 3'TGCAGATTAAGGCGAGAGTGGATGGTTTGTTACGGGGGGACGTTTTTTATTTAAGTATA- -AAAAAACATACAGATAACCATCTGCGGTGATAAATTATCTCTGGCGGTGTTGACATAAA- -TTTTTTGTATGTCTATTGGTAGACGCCACTATTTAATAGAGACCGCCACAACTGTATTT- -TACCACTGGCGGTGATACTGAGCACAT 3'(SEQ ID NO: 53) -ATGGTGACCGCCACTATGACTCGTGTAGC5'(SEQ ID NO: 54) ClaI
and then (c) substituting the small DNA sequence between the unique ClaI and KpnI restriction sites with the following oligonucleotide:
TABLE-US-00031 (SEQ ID NO: 55) 5' CGATTTGATTCTAGAAGGAGGAATAACATATGGTTAACGCGTTGGAATTCGGTAC 3' (SEQ ID NO: 56) 3' TAAACTAAGATCTTCCTCCTTATTGTATACCAATTGCGCAACCTTAAGC 5' ClaI KpnI
The expression plasmid pAMG22 can then be derived from pCFM1656 by making a series of site directed base changes by PCR overlapping oligo mutagenesis and DNA sequence substitutions. Starting with the BglII site (plasmid by #180) immediately 5' to the plasmid replication promoter PcopB and proceeding toward the plasmid replication genes, the base pair changes are as follows:
TABLE-US-00032 bp in bp changed to in pAMG22 bp # pCFM1656 pAMG22 # 204 T/A C/G # 428 A/T G/C # 509 G/C A/T # 617 -- insert two G/C bp # 679 G/C T/A # 980 T/A C/G # 994 G/C A/T # 1004 A/T C/G # 1007 C/G T/A # 1028 A/T T/A # 1047 C/G T/A # 1178 G/C T/A # 1466 G/C T/A # 2028 G/C bp deletion # 2187 C/G T/A # 2480 A/T T/A # 2499-2502 AGTG GTCA TCAC CAGT # 2642 TCCGAGC 7 bp deletion AGGCTCG # 3435 G/C A/T # 3446 G/C A/T # 3643 A/T T/A
The DNA sequence between the unique AatII (position #4364 in pCFM1656) and SacII (position #4585 in pCFM1656) restriction sites is substituted with the following DNA sequence:
TABLE-US-00033 [AatII sticky end] (position #4358 in pAMG22) 5' GCGTAACGTATGCATGGTCTCCCCATGCGAGAGTAGGGAACTGCCAGGCATCAA- 3' TGCACGCATTGCATACGTACCAGAGGGGTACGCTCTCATCCCTTGACGGTCCGTAGTT- -ATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTG- -TATTTTGCTTTCCGAGTCAGCTTTCTGACCCGGAAAGCAAAATAGACAACAAACAGCCAC- -AACGCTCTCCTGAGTAGGACAAATCCGCCGGGAGCGGATTTGAACGTTGCGAAGCAACGG- -TTGCGAGAGGACTCATCCTGTTTAGGCGGCCCTCGCCTAAACTTGCAACGCTTCGTTGCC- -CCCGGAGGGTGGCGGGCAGGACGCCCGCCATAAACTGCCAGGCATCAAATTAAGCAGAAG- -GGGCCTCCCACCGCCCGTCCTGCGGGCGGTATTTGACGGTCCGTAGTTTAATTCGTCTTC- -GCCATCCTGACGGATGGCCTTTTTGCGTTTCTACAAACTCTTTTGTTTATTTTTCTAAAT- -CGGTAGGACTGCCTACCGGAAAAACGCAAAGATGTTTGAGAAAACAAATAAAAAGATTTA- AatII -ACATTCAAATATGGACGTCTCATAATTTTTAAAAAATTCATTTGACAAATGCTAAAATTC- -TGTAAGTTTATACCTGCAGAGTATTAAAAATTTTTTAAGTAAACTGTTTACGATTTTAAG- -TTGATTAATATTCTCAATTGTGAGCGCTCACAATTTATCGATTTGATTCTAGATTTGTTT- -AACTAATTATAAGAGTTAACACTCGCGAGTGTTAAATAGCTAAACTAAGATCTAAACTCA- -TAACTAATTAAAGGAGGAATAACATATGGTTAACGCGTTGGAATTCGAGCTCACTAGTGT- -ATTGATTAATTTCCTCCTTATTGTATACCAATTGCGCAACCTTAAGCTCGAGTGATCACA- SacII -CGACCTGCAGGGTACCATGGAAGCTTACTCGAGGATCCGCGGAAAGAAGAAGAAGAAGAA- -GCTGGACGTCCCATGGTACCTTCGAATGAGCTCCTAGGCGCCTTTCTTCTTCTTCTTCTT- -GAAAGCCCGAAAGGAAGCTGAGTTGGCTGCTGCCACCGCTGAGCAATAACTAGCATAACC- -CTTTCGGGCTTTCCTTCGACTCAACCGACGACGGTGGCGACTCGTTATTGATCGTATTGG- -CCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGCTGAAAGGAGGAACCGCTCTTCA- -GGAACCCCGGAGATTTGCCCAGAACTCCCCAAAAAACGACTTTCCTCCTTGGCGAGAAGT- -CGCTCTTCACGC 3'(SEQ ID NO: 58) -GCGAGAAGTG 5' (SEQ ID NO: 57) [SacII sticky end] (position #5024 in pAMG22)
During the ligation of the sticky ends of this substitution DNA sequence, the outside AatII and SacII sites are destroyed. There are unique AatII and SacII sites in the substituted DNA.
B. Human OPG Met[32-401]
[0190]In the example, the expression vector used was pAMG21, a derivative of pCFM1656 (ATCC accession no. 69576) which contains appropriate restriction sites for insertion of genes downstream from the lux PR promoter. (See U.S. Pat. No. 5,169,318 for description of the lux expression system). The host cell used was GM120 (ATCC accession no. 55764). This host has the lacIQ promoter and lad gene integrated into a second site in the host chromosome of a prototrophic E. coli K12 host. Other commonly used E. coli expression vectors and host cells are also suitable for expression.
[0191]A DNA sequence coding for an N-terminal methionine and amino acids 32-401 of the human OPG polypeptide was placed under control of the luxPR promoter in the plasmid expression vector pAMG21 as follows. To accomplish this, PCR using oligonucleotides #1257-20 and #1257-19 as primers was performed using as a template plasmid pRcCMV-Hu OPG DNA containing the human OPG cDNA and thermocycling for 30 cycles with each cycle being: 94° C. for 20 seconds, followed by 37° C. for 30 seconds, followed by 72° C. for 30 seconds. The resulting PCR sample was resolved on an agarose gel, the PCR product was excised, purified, and restricted with KpnI and BamHI restriction endonucleases and purified. Synthetic oligonucleotides #1257-21 and #1257-22 were phophorylated individually using T4 polynucleotide kinase and ATP, and were then mixed together, heated at 94° C. and allowed to slow cool to room temperature to form an oligonucleotide linker duplex containing NdeI and KpnI sticky ends. The phosphorylated linker duplex formed between oligonucleotides #1257-21 and #1257-22 containing NdeI and KpnI cohesive ends (see FIG. 14A) and the KpnI and BamHI digested and purified PCR product generated using oligo primers #1257-20 and #1257-19 (see above) was directionally inserted between two sites of the plasmid vector pAMG21, namely the NdeI site and BamHI site, using standard recombinant DNA methodology (see FIG. 14A and sequences below). The synthetic linker utilized E. coli codons and provided for a N-terminal methionine.
[0192]Two clones were selected and plasmid DNA isolated, and the human OPG insert was subsequently DNA sequence confirmed. The resulting pAMG21 plasmid containing amino acids 32-401 of the human OPG polypeptide immediately preceded in frame by a methionine is referred to as pAMG21-huOPG met[32-401] or pAMG21-huOPG met[32-401].
TABLE-US-00034 Oligo#1257-19 (SEQ ID NO: 59) 5'-TACGCACTGGATCCTTATAAGCAGCTTATTTTTACTGATTGGAC-3' Oligo#1257-20 (SEQ ID NO: 60) 5'-GTCCTCCTGGTACCTACCTAAAACAAC-3' Oligo#1257-21 (SEQ ID NO: 61) 5'-TATGGATGAAGAAACTTCTCATCAGCTGCTGTGTGATAAATGTCC GCCGGGTAC-3' Oligo#1257-22 (SEQ ID NO: 47) 5'-CCGGCGGACATTTATCACACAGCAGCTGATGAGAAGTTTCTTCA TCCA-3'
[0193]Cultures of pAMG21-huOPG met[32-401] in E. coli GM120 in 2×YT media containing 20 μg/ml kanamycin were incubated at 30° C. prior to induction. Induction of huOPG met[32-401] gene product expression from the luxPR promoter was achieved following the addition of the synthetic autoinducer N-(3-oxohexanoyl)-DL-homoserine lactone to the culture media to a final concentration of 30 ng/ml and cultures were incubated at either 30° C. or 37° C. for a further 6 hours. After 6 hours, the bacterial cultures were examined by microscopy for the presence of inclusion bodies and were then pelletted by centrifugation. Refractile inclusion bodies were observed in induced cultures indicating that some of the recombinant huOPG met[32-401] gene product was produced insolubly in E. coli. Some bacterial pellets were resuspended in 10 mM Tris-HCl/pH8, 1 mM EDTA and lysed directly by addition of 2× Laemlli sample buffer to 1× final, and β-mercaptoethanol to 5% final concentration, and analyzed by SDS-PAGE. A substantially more intense coomassie stained band of approximately 42 kDa was observed on a SDS-PAGE gel containing total cell lysates of 30° C. and 37° C. induced cultures versus lane 2 which is a total cell lysate of a 30° C. uninduced culture (FIG. 14B). The expected gene product would be 370 amino acids in length and have an expected molecular weight of about 42.2 kDa. Following induction at 37° C. for 6 hours, an additional culture was pelleted and either processed for isolation of inclusion bodies (see below) or processed by microfluidizing. The pellet processed for microfluidizing was resuspended in 25 mM Tris-HCl/pH8, 0.5M NaCl buffer and passed 20 times through a Microfluidizer Model 1108 (Microfluidics Corp.) and collected. An aliquot was removed of the collected sample (microfluidized total lysate), and the remainder was pelleted at 20,000×g for 20 minutes. The supernatant following centrifugation was removed (microfluidized soluble fraction) and the pellet resuspended in a 25 mM Tris-HCl/pH8, 0.5M NaCl, 6M urea solution (microfluidized insoluble fraction). To an aliquot of either the total soluble, or insoluble fraction was added to an equal volume of 2× Laemalli sample buffer and β-mercaptoethanol to 5% final concentration. The samples were then analyzed by SDS-PAGE. A significant amount of recombinant huOPG met[32-401] gene product appeared to be found in the insoluble fraction. To purify the recombinant protein inclusion bodies were purified as follows: Bacterial cells were separated from media by density gradient centrifugation in a Beckman J-6B centrifuge equipped with a JS-4.2 rotor at 4,900×g for 15 minutes at 4° C. The bacterial pellet was resuspended in 5 ml of water and then diluted to a final volume of 10 ml with water. This suspension was transferred to a stainless steel cup cooled in ice and subjected to sonic disruption using a Branson Sonifier equipped with a standard tip (power setting=5, duty cycle=95%, 80 bursts). The sonicated cell suspension was centrifuged in a Beckman Optima TLX ultracentrifuge equipped with a TLA 100.3 rotor at 195,000×g for 5 to 10 minutes at 23° C. The supernatant was discarded and the pellet rinsed with a stream of water from a squirt bottle. The pellets were collected by scraping with a micro spatula and transferred to a glass homogenizer (15 ml capacity). Five ml of Percoll solution (75% liquid Percoll, 0.15 M sodium chloride) was added to the homogenizer and the contents are homogenized until uniformly suspended. The volume was increased to 19.5 ml by the addition of Percoll solution, mixed, and distributed into 3 Beckman Quick-Seal tubes (13×32 mm). Tubes were sealed according to manufacturers instructions. The tubes were spun in a Beckman TLA 100.3 rotor at 23° C., 20,000 rpm (21,600×g), 30 minutes. The tubes were examined for the appropriate banding pattern. To recover the refractile bodies, gradient fractions were recovered and pooled, then diluted with water. The inclusion bodies were pelleted by centrifugation, and the protein concentration estimated following SDS-PAGE.
[0194]An aliquot of inclusion bodies isolated as described below was dissolved into 1×Laemlli sample buffer with 5% β-mercaptoethanol and resolved on a SDS-PAGE gel and the isolated inclusion bodies provide a highly purified recombinant huOPG[32-401] gene product. The major -42 kDa band observed after resolving inclusion bodies on a SDS-polyacrylamide gel was excised from a separate gel and the N-terminal amino acid sequence determined essentially as described (Matsudaira et al. J. Biol. Chem. 262, 10-35 (1987)). The following sequence was determined after 19 cycles:
TABLE-US-00035 (SEQ ID NO: 62) NH2-MDEETSHQLLCDKCPPGTY-COOH
This sequence was found to be identical to the first 19 amino acids encoded by the pAMG21 Hu-OPG met[32-401] expression vector, produced by a methionine residue provided by the bacterial expression vector.
C. Human OPG Met[22-401]
[0195]A DNA sequence coding for an N-terminal methionine and amino acids 22 through 401 of human OPG was placed under control of the luxPR promoter in a prokaryotic plasmid expression vector pAMG21 as follows. Isolated plasmid DNA of pAMG21-huOPG met[32-401] (see Section B) was cleaved with KpnI and BamHI restriction endonucleases and the resulting fragments were resolved on an agarose gel. The B fragment (˜1064 by fragment) was isolated from the gel using standard methodology. Synthetic oligonucleotides (oligos) #1267-06 and #1267-07 were phosphorylated individually and allowed to form an oligo linker duplex, which contained NdeI and KpnI cohesive ends, using methods described in Section B. The synthetic linker duplex utilized E. coli codons and provided for an N-terminal methionine. The phosphorylated oligo linker containing NdeI and KpnI cohesive ends and the isolated ˜1064 by fragment of pAMG21-huOP met[32-401] digested with KpnI and BamHI restriction endonucleases were directionally inserted between the NdeI and BamHI sites of pAMG21 using standard recombinant DNA methodology. The ligation mixture was transformed into E. coli host 393 by electroporation utilizing the manufacturer's protocol. Clones were selected, plasmid DNA was isolated, and DNA sequencing was performed to verify the DNA sequence of the huOPG-met[22-401] gene.
TABLE-US-00036 Oligo #1267-06 (SEQ ID NO: 63) 5'-TAT GGA AAC TTT TCC TCC AAA ATA TCT TCA TTA TGA TGA AGA AAC TTC TCA TCA GCT GCT GTG TGA TAA ATG TCC GCC GGG TAC-3' Oligo #1267-07 (SEQ ID NO: 64) 5'-CCG GCG GAC ATT TAT CAC ACA GCA GCT GAT GAG AAG TTT CTT CAT CAT AAT GAA GAT ATT TTG GAG GAA AAG TTT CCA-3'
[0196]Cultures of pAMG21-huOPG-met[22-401] in E. coli host 393 were placed in 2×YT media containing 20 μg/ml kanamycin and were incubated at 30° C. prior to induction. Induction of recombinant gene product expression from the luxPR promoter of vector pAMG21 was achieved following the addition of the synthetic autoinducer N-(3-oxohexanoyl)-DL-homoserine lactone to the culture media to a final concentration of 30 ng/ml and incubation at either 30° C. or 37° C. for a further 6 hours. After 6 hours, bacterial cultures were pelleted by centrifugation (=30° C. I+6 or 37° C. I+6). Bacterial cultures were also either pelleted just prior to induction (=30° C. PreI) or alternatively no autoinducer was added to a separate culture which was allowed to incubate at 30° C. for a further 6 hours to give an uninduced (UI) culture (=30° C. UI). Bacterial pellets of either 30° C. PreI, 30° C. UI, 30° C. I+6, or 37° C. I+6 cultures were resuspended, lysed, and analyzed by SDS-polyacrylamide gel electrophoresis (PAGE) as described in Section B. Polyacrylamide gels were either stained with coomassie blue and/or Western transferred to nitrocellulose and immunoprobed with rabbit anti-mu OPG-Fc polyclonal antibody as described in Example 10. The level of gene product following induction compared to either an uninduced (30° C. UI) or pre-induction (30° C. PreI) sample.
D. Murine OPG Met[22-401]
[0197]A DNA sequence coding for an N-terminal methionine and amino acids 22 through 401 of the murine (mu) OPG (OPG) polypeptide was placed under control of the luxPR promoter in a prokaryotic plasmid expression vector pAMG21 as follows. PCR was performed using oligonucleotides #1257-16 and #1257-15 as primers, plasmid pRcCMV-Mu OPG DNA as a template and thermocycling conditions as described in Section B. The PCR product was purified and cleaved with KpnI and BamHI restriction endonucleases as described in Section B. Synthetic oligos #1260-61 and #1260-82 were phosphorylated individually and allowed to form an oligo linker duplex with NdeI and KpnI cohesive ends using methods described in Section B. The synthetic linker duplex utilized E. coli codons and provided for an N-terminal methionine. The phosphorylated linker duplex formed between oligos #1260-61 and #1260-82 containing NdeI and KpnI cohesive ends and the KpnI and BamHI digested and purified PCR product generated using oligo primers #1257-16 and #1257-15 were directionally inserted between the NdeI and BamHI sites of pAMG21 using standard methodology. The ligation mixture was transformed into E. coli host 393 by electroporation utilizing the manufacturer's protocol. Clones were selected, plasmid DNA was isolated, and DNA sequencing was performed to verify the DNA sequence of the MuOPG met[22-401] gene.
[0198]Expression of recombinant muOPG met[22-401] polypeptide from cultures of 393 cells harboring plasmid pAMG21-MuOPG met[22-401] following induction was determined using methods described in Section C.
TABLE-US-00037 Oligo #1257-15 (SEQ ID NO: 65) 5'-TAC GCA CTG GAT CCT TAT AAG CAG CTT ATT TTC ACG GAT TGA AC-3' Oligo #1257-16 (SEQ ID NO: 66) 5'-GTG CTC CTG GTA CCT ACC TAA AAC AGC ACT GCA CAG TG-3' Oligo #1260-61 (SEQ ID NO: 67) 5'-TAT GGA AAC TCT GCC TCC AAA ATA CCT GCA TTA CGA TCC GGA AAC TGG TCA TCA GCT GCT GTG TGA TAA ATG TGC TCC GGG TAC-3' Oligo #1260-82 (SEQ ID NO: 68) 5'-CCG GAG CAC ATT TAT CAC ACA GCA GCT GAT GAC CAG TTT CCG GAT CGT AAT GCA GGT ATT TTG GAG GCA GAG TTT CCA-3'
E. Murine OPG Met[32-401]
[0199]A DNA sequence coding for an N-terminal methionine and amino acids 32 through 401 of murine OPG was placed under control of the luxPR promoter in a prokaryotic plasmid expression vector pAMG21 as follows. To accomplish this, Synthetic oligos #1267-08 and #1267-09 were phosphorylated individually and allowed to form an oligo linker duplex using methods described in Section B. The synthetic linker duplex utilized E. coli codons and provided for an N-terminal methionine. The phosphorylated linker duplex formed between oligos #1267-08 and #1267-09 containing NdeI and KpnI cohesive ends, and the KpnI and BamHI digested and purified PCR product described earlier (see Section D), was directionally inserted between the NdeI and BamHI sites of pAMG21 using standard methodology. The ligation mixture was transformed into E. coli host 393 by electroporation utilizing the manufacturer's protocol. Clones were selected, plasmid DNA was isolated, and DNA sequencing was performed to verify the DNA sequence of the muOPG-met[32-401] gene.
[0200]Expression of recombinant muOPG-met[32-401] polypeptide from cultures of 393 cells harboring the pAMG21 recombinant plasmid following induction was determined using methods described in Section C.
TABLE-US-00038 Oligo #1267-08 (SEQ ID NO: 69) 5'-TAT GGA CCC AGA AAC TGG TCA TCA GCT GCT GTG TGA TAA ATG TGC TCC GGG TAC-3' Oligo #1267-09 (SEQ ID NO: 70) 5'-CCG GAG CAC ATT TAT CAC ACA GCA GCT GAT GAC CAG TTT CTG GGT CCA-3'
F. Murine OPG Met-Lys[22-401]
[0201]A DNA sequence coding for an N-terminal methionine followed by a lysine residue and amino acids 22 through 401 of murine OPG was placed under control of the lux PR promoter in prokaryotic expression vector pAMG21 as follows. Synthetic oligos #1282-95 and #1282-96 were phosphorylated individually and allowed to form an oligo linker duplex using methods described in Section B. The synthetic linker duplex utilized E. coli codons and provided for an N-terminal methionine. The phosphorylated linker duplex formed between oligos #1282-95 and #1282-96 containing NdeI and KpnI cohesive ends and the KpnI and BamHI digested and purified PCR product described in Section D was directionally inserted between the NdeI and BamHI sites in pAMG21 using standard methodology. The ligation mixture was transformed into E. coli host 393 by electroporation utilizing the manufacturer's protocol. Clones were selected, plasmid DNA was isolated, and DNA sequencing was performed to verify the DNA sequence of the MuOPG-Met-Lys[22-401] gene.
[0202]Expression of recombinant MuOPG Met-Lys[22-401] polypeptide from transformed 393 cells harboring the recombinant pAMG21 plasmid following induction was determined using methods described in Section C.
TABLE-US-00039 Oligo #1282-95 (SEQ ID NO: 71) 5'-TAT GAA AGA AAC TCT GCC TCC AAA ATA CCT GCA TTA CGA TCC GGA AAC TGG TCA TCA GCT GCT GTG TGA TAA ATG TGC TCC GGG TAC-3' Oligo #1282-96 (SEQ ID NO: 72) 5'-CCG GAG CAC ATT TAT CAC ACA GCA GCT GAT GAC CAG TTT CCG GAT CGT AAT GCA GGT ATT TTG GAG GCA GAG TTT CTT TCA-3'
G. Murine OPG Met-Lys-(His)7[22-401]
[0203]A DNA sequence coding for N-terminal residues Met-Lys-His-His-His-His-His-His-His (=MKH) followed by amino acids 22 through 401 of Murine OPG was placed under control of the lux PR promoter in prokaryotic expression vector pAMG21 as follows. PCR was performed using oligonucleotides #1300-50 and #1257-15 as primers and plasmid pAMG21-muOPG-met[22-401] DNA as template. Thermocycling conditions were as described in Section B. The resulting PCR sample was resolved on an agarose gel, the PCR product was excised, purified, cleaved with NdeI and BamHI restriction endonucleases and purified. The NdeI and BamHI digested and purified PCR product generated using oligo primers #1300-50 and #1257-15 was directionally inserted between the NdeI and BamHI sites of pAMG21 using standard DNA methodology. The ligation mixture was transformed into E. coli host 393 by electroporation utilizing the manufacturer's protocol. Clones were selected, plasmid DNA was isolated, and DNA sequencing performed to verify the DNA sequence of the muOPG-MKH[22-401] gene.
[0204]Expression of recombinant MuOPG-MKH[22-401] polypeptide from transformed 393 cultures harboring the recombinant pAMG21 plasmid following induction was determined using methods described in Section C.
TABLE-US-00040 Oligo #1300-50 (SEQ ID NO: 73) 5'-GTT CTC CTC ATA TGA AAC ATC ATC ACC ATC ACC ATC ATG AAA CTC TGC CTC CAA AAT ACC TGC ATT ACG AT-3' Oligo #1257-15 (see Section D)
H. Murine OPG Met-Lys[22-401] (His)7
[0205]A DNA sequence coding for a N-terminal met-lys, amino acids 22 through 401 murine OPG, and seven histidine residues following amino acid 401 (=muOPG MK[22-401]-H7), was placed under control of the lux PR promoter in prokaryotic expression vector pAMG21 as follows. PCR was performed using oligonucleotides #1300-49 and #1300-51 as primers and pAMG21-muOPG met[22-401] DNA as template. Thermocycling conditions were as described in Section B. The resulting PCR sample was resolved on an agarose gel, the PCR product was excised, purified, restricted with NdeI and BamHI restriction endonucleases, and purified. The NdeI and BamHI digested and purified PCR product was directionally inserted between the NdeI and BamHI sites in pAMG21 using standard methodology. The ligation was transformed into E. coli host 393 by electroporation utilizing the manufacturer's protocol. Clones were selected, plasmid DNA was isolated, and DNA sequencing was performed to verify the DNA sequence of the muOPG MK[22-401]-H7 gene.
[0206]Expression of the recombinant muOPG MK-[22-401]-H7 polypeptide from a transformed 393 cells harboring the recombinant pAMG21 plasmid following induction was determined using methods described in Section C.
TABLE-US-00041 Oligo #1300-49 (SEQ ID NO: 74) 5'-GTT CTC CTC ATA TGA AAG AAA CTC TGC CTC CAA AAT ACC TGC A-3' Oligo #1300-51 (SEQ ID NO: 75) 5'-TAC GCA CTG GAT CCT TAA TGA TGG TGA TGG TGA TGA TGT AAG CAG CTT ATT TTC ACG GAT TGA ACC TGA TTC CCT A-3'
I. Murine OPG Met[27-401]
[0207]A DNA sequence coding for a N-terminal methionine and amino acids 27 through 401 of murine OPG was placed under control of the lux PR promoter of prokaryotic expression vector pAMG21 as follows. PCR was performed with oligonucleotides #1309-74 and #1257-15 as primers and plasmid pAMG21-muOPG-met[22-401] DNA as template. Thermocycling conditions were as described in Section B. The resulting PCR sample was resolved on an agarose gel, the PCR product was excised, purified, cleaved with NdeI and BamHI restriction endonucleases, and purified. The NdeI and BamHI digested and purified PCR product was directionally inserted between the NdeI and BamHI sites of pAMG21 using standard methodology. The ligation mixture was transformed into E. coli host 393 by electroporation utilizing the manufacturer's protocol. Clones were selected, plasmid DNA was isolated, and DNA sequencing was performed to verify the DNA sequence of the muOPG-met[27-401] gene.
[0208]Expression of recombinant muOPG-met[27-401] polypeptide from a transfected 393 culture harboring the recombinant pAMG21 plasmid following induction was determined using methods described in Section C.
TABLE-US-00042 Oligo#1309-74 (SEQ ID NO: 76) 5'-GTT CTC CTC ATA TGA AAT ACC TGC ATT ACG ATC CGG AAA CTG GTC AT-3' Oligo#1257-15 (See Section D)
J. Human OPG Met[27-401]
[0209]A DNA sequence coding for a N-terminal methionine and amino acids 27 through 401 of human OPG was placed under control of the lux PR promoter of prokaryotic expression vector pAMG21 as follows. PCR was performed using oligonucleotides #1309-75 and #1309-76 as primers and plasmid pAMG21-huOPG-met[22-401] DNA as template. Thermocycling conditions were as described in Section B. The resulting PCR sample was resolved on an agarose gel, the PCR product was excised, purified, restricted with AseI and BamHI restriction endonucleases, and purified. The AseI and BamHI digested and purified PCR product above was directionally inserted between the NdeI and BamHI sites of pAMG21 using standard methodology. The ligation mixture was transformed into E. coli host 393 by electroporation utilizing the manufacturer's protocol. Clones were selected, plasmid DNA was isolated, and DNA sequencing was performed to verify the DNA sequence of the huOPG-met[27-401] gene.
[0210]Expression of the recombinant huOPG-met[27-401] polypeptide following induction of from transfected 393 cells harboring the recombinant pAMG21 plasmid was determined using methods described in Section C.
TABLE-US-00043 Oligo #1309-75 (SEQ ID NO: 77) 5'-GTT CTC CTA TTA ATG AAA TAT CTT CAT TAT GAT GAA GAA ACT T-3' Oligo #1309-76 (SEQ ID NO: 78) 5'-TAC GCA CTG GAT CCT TAT AAG CAG CTT ATT TTT ACT GAT T-3'
K. Murine OPG Met[22-180]
[0211]A DNA sequence coding for a N-terminal methionine and amino acids 22 through 180 of murine OPG was placed under control of the lux PR promoter of prokaryotic expression vector pAMG21 as follows. PCR was performed with oligonucleotides #1309-72 and #1309-73 as primers and plasmid pAMG21-muOPG-met[22-401] DNA as template. Thermocycling conditions were as described in Section B. The resulting PCR sample was resolved on an agarose gel, the PCR product was excised, purified, restricted with NdeI and BamHI restriction endonucleases, and purified. The NdeI and BamHI digested and purified PCR product above was directionally inserted between the NdeI and BamHI sites of pAMG21 using standard methodology. The ligation was transformed into E. coli host 393 by electroporation utilizing the manufacturer's protocol. Clones were selected, plasmid DNA was isolated, and DNA sequencing was performed to verify the DNA sequence of the muOPG-met[22-180] gene.
[0212]Expression of recombinant muOPG-met[22-180] polypeptide from transformed 393 cultures harboring the recombinant pAMG21 plasmid following induction was determined using methods described in Section C.
TABLE-US-00044 Oligo #1309-72 (SEQ ID NO: 79) 5'-GTT CTC CTC ATA TGG AAA CTC TGC CTC CAA AAT ACC TGC A-3' Oligo #1309-73 (SEQ ID NO: 80) 5'-TAC GCA CTG GAT CCT TAT GTT GCA TTT CCT TTC TGA ATT AGC A-3'
L. Murine OPG Met[27-180]
[0213]A DNA sequence coding for a N-terminal methionine and amino acids 27 through 180 of murine OPG was placed under the control of the lux PR promoter of prokaryotic expression vector pAMG21 as follows. PCR was performed using oligonucleotides #1309-74 (see Section I) and #1309-73 (see Section K) as primers and plasmid pAMG21-muOPG met[22-401] DNA as template. Thermocycling conditions were as described in Section B. The resulting PCR sample was resolved on an agarose gel, the PCR product excised, purified, restricted with NdeI and BamHI restriction endonucleases, and purified. The NdeI and BamHI digested and purified PCR product above was directionally inserted between the NdeI and BamHI sites in pAMG21 using standard methodology. The ligation mixture was transformed into E. coli host 393 by electroporation utilizing the manufacturer's protocol. Clones were selected, plasmid DNA was isolated, and DNA sequencing was performed to verify the DNA sequence of the muOPG met[27-180] gene.
[0214]Expression of recombinant muOPG met[27-180] polypeptide from cultures of transformed 393 cells harboring the recombinant pAMG21 plasmid following induction was determined using methods described in Section C.
M. Murine OPG Met[22-189] and Met[22-194]
[0215]A DNA sequence coding for a N-terminal methionine and either amino acids 22 through 189, or 22 through 194 of murine OPG was placed under control of the lux PR promoter of prokaryotic expression vector pAMG21 as follows. The pair of synthetic oligonucleotides #1337-92 and #1337-93 (=muOPG-189 linker) or #1333-57 and #1333-58 (=muOPG-194 linker) were phosphorylated individually and allowed to form an oligo linker duplex pair using methods described in Section B. Purified plasmid DNA of pAMG21-muOPG-met[22-401] was cleaved with KpnI and BspEI restriction endonucleases and the resulting DNA fragments were resolved on an agarose gel. The -413 by B fragment was isolated using standard recombinant DNA methodology. The phosphorylated oligo linker duplexes formed between either oligos #1337-92 and #1337-93 (muOPG-189 linker) or oligos #1333-57 and #1333-58 (muOPG-194 linker) containing BspEI and BamHI cohesive ends, and the isolated -413 by B fragment of plasmid pAMG21-muOPG-met[22-401] digested with KpnI and BspEI restriction endonucleases above, was directionally inserted between the KpnI and BamHI sites of pAMG21-muOPG met[22-401] using standard methodology. Each ligation mixture was transformed into E. coli host 393 by electroporation utilizing the manufacturer's protocol. Clones were selected, plasmid DNA was isolated, and DNA sequencing was performed to verify the DNA sequence of either the muOPG-met[22-189] or muOPG-met[22-194] genes.
[0216]Expression of recombinant muOPG-met[22-189] and muOPG-met[22-194] polypeptides from recombinant pAMG21 plasmids transformed into 393 cells was determined using methods described in Section C.
TABLE-US-00045 Oligo #1337-92 (SEQ ID NO: 81) 5'-CCG GAA ACA GAT AAT GAG-3' Oligo #1337-93 (SEQ ID NO: 82) 5'-GAT CCT CAT TAT CTG TTT-3' Oligo #1333-57 (SEQ ID NO: 83) 5'-CCG GAA ACA GAG AAG CCA CGC AAA AGT AAG-3' Oligo #1333-58 (SEQ ID NO: 84) 5'-GAT CCT TAC TTT TGC GTG GCT TCT CTG TTT-3'
N. Murine OPG Met[27-189] and Met[27-194]
[0217]A DNA sequence coding for a N-terminal methionine and either amino acids 27 through 189, or 27 through 194 of murine OPG was placed under control of the lux PR promoter of prokaryotic expression vector pAMG21 as follows. Phosphorylated oligo linkers either "muOPG-189 linker" or "muOPG-194 linker" (see Section M) containing BspEI and BamHI cohesive ends, and the isolated ˜413 by B fragment of plasmid pAMG21-muOPG-met[22-401] digested with KpnI and BspEI restriction endonucleases were directionally inserted between the KpnI and BamHI sites of plasmid pAMG21-muOPG-met[27-401] using standard methodology. Each ligation was transformed into E. coli host 393 by electroporation utilizing the manufacturer's protocol. Clones were selected, plasmid DNA was isolated, and DNA sequencing was performed to verify the DNA sequence of either the muOPG met[27-189] or muOPG met[27-194] genes.
[0218]Expression of recombinant muOPG met[27-189] and muOPG met[27-194] following induction of 393 cells harboring recombinant pAMG21 plasmids was determined using methods described in Section C.
O. Human OPG Met[22-185], Met[22-189], Met[22-194]
[0219]A DNA sequence coding for a N-terminal methionine and either amino acids 22 through 185, 22 through 189, or 22 through 194 of the human OPG polypeptide was placed under control of the lux PR promoter of prokaryotic expression vector pAMG21 as follows. The pair of synthetic oligonucleotides #1331-87 and #1331-88 (=huOPG-185 linker), #1331-89 and #1331-90 (=huOPG-189 linker), or #1331-91 & #1331-92 (=huOPG-194 linker) were phosphorylated individually and each allowed to form an oligo linker duplex pair using methods described in Section B. Purified plasmid DNA of pAMG21-huOPG-met[27-401] was restricted with KpnI and NdeI restriction endonucleases and the resulting DNA fragments were resolved on an agarose gel. The ˜407 by B fragment was isolated using standard recombinant DNA methodology. The phophorylated oligo linker duplexes formed between either oligos #1331-87 and #1331-88 (huOPG-185 linker), oligos #1331-89 and #1331-90 (huOPG-189 linker), or oligos #1331-91 and #1331-92 (huOPG-194 linker) [each linker contains NdeI and BamHI cohesive ends], and the isolated -407 by B fragment of plasmid pAMG21-huOPG-met[27-401] digested with KpnI and NdeI restriction endonucleases above, was directionally inserted between the KpnI and BamHI sites of plasmid pAMG21-huOPG-met[22-401] using standard methodology. Each ligation was transformed into E. coli host 393 by electroporation utilizing the manufacturer's protocol. Clones were selected, plasmid DNA was isolated, and DNA sequencing was performed to verify the DNA sequence of either the huOPG-met[22-185], huOPG-met[22-189], or huOPG-met[22-194] genes.
[0220]Expression of recombinant huOPG-met[22-185], huOPG-met[22-189] or huOPG-met[22-194] in transformed 393 cells harboring recombinant pAMG21 plasmids following induction was determined using methods described in Section C.
TABLE-US-00046 Oligo #1331-87 (SEQ ID NO: 85) 5'-TAT GTT AAT GAG-3' Oligo #1331-88 (SEQ ID NO: 86) 5'-GAT CCT CAT TAA CA-3' Oligo #1331-89 (SEQ ID NO: 87) 5'-TAT GTT CCG GAA ACA GTT AAG-3' Oligo #1331-90 (SEQ ID NO: 88) 5'-GAT CCT TAA CTG TTT CCG GAA CA-3' Oligo #1331-91 (SEQ ID NO: 89) 5'-TAT GTT CCG GAA ACA GTG AAT CAA CTC AAA AAT AAG-3' Oligo #1331-92 (SEQ ID NO: 90) 5'-GAT CCT TAT TTT TGA GTT GAT TCA CTG TTT CCG GAA CA-3'
P. Human OPG Met[27-185], Met[27-189], Met [27-194]
[0221]A DNA sequence coding for a N-terminal methionine and either amino acids 27 through 185, 27 through 189, or 27 through 194 of the human OPG polypeptide was placed under control of the lux PR promoter of prokaryotic expression vector pAMG21 as follows. Phosphorylated oligo linkers "huOPG-185 linker", "huOPG-189 linker", or "huOPG-194 linker" (See Section 0) each containing NdeI and BamHI cohesive ends, and the isolated ˜407 by B fragment of plasmid pAMG21-huOPG-met[27-401] digested with KpnI and NdeI restriction endonucleases (See Section O) were directionally inserted between the KpnI and BamHI sites of plasmid pAMG21-huOPG-met[27-401] (See Section J) using standard methodology. Each ligation was transformed into E. coli host 393 by electroporation utilizing the manufacturer's protocol. Clones were selected, plasmid DNA isolated, and DNA sequencing performed to verify the DNA sequence of either the huOPG-met[27-185], huOPG-met[27-189], or huOPG-met[27-194] genes.
[0222]Expression of recombinant huOPG-met[27-185], huOPG-met[27-189], and huOPG-met[27-194] from recombinant pAMG21 plasmids transformed into 393 cells was determined using methods described in Section C.
Q. Murine OPG Met[27-401] (P33E, G36S, A45P)
[0223]A DNA sequence coding for an N-terminal methionine and amino acids 27 through 48 of human OPG followed by amino acid residues 49 through 401 of murine OPG was placed under control of the lux PR promoter of prokaryotic expression vector pAMG21 as follows. Purified plasmid DNA of pAMG21-huOPG-met[27-401] (See Section J) was cleaved with AatII and KpnI restriction endonucleases and a ˜1075 by B fragment isolated from an agarose gel using standard recombinant DNA methodology. Additionally, plasmid pAMG21-muOPG-met[22-401] DNA (See Section D) was digested with KpnI and BamHI restriction endonucleases and the ˜1064 by B fragment isolated as described above. The isolated ˜1075 by pAMG21-huOPG-met[27-401] restriction fragment containing AatII & KpnI cohesive ends (see above), the ˜1064 by pAMG21-muOPG-met[22-401] restriction fragment containing KpnI and BamHI sticky ends and a ˜5043 by restriction fragment containing AatII and BamHI cohesive ends and corresponding to the nucleic acid sequence of pAMG21 between AatII & BamHI were ligated using standard recombinant DNA methodology. The ligation was transformed into E. coli host 393 by electroporation utilizing the manufacturer's protocol. Clones were selected, and the presence of the recombinant insert in the plasmid verified using standard DNA methodology. muOPG-27-401 (P33E, G36S, A45P) gene. Amino acid changes in muOPG from proline-33 to glutamic acid-33, glycine-36 to serine-36, and alanine-45 to proline-45, result from replacement of muOPG residues 27 through 48 with huOPG residues 27 through 48.
[0224]Expression of recombinant muOPG-met[27-401] (P33E, G36S, A45P) from transformed 393 cells harboring the recombinant pAMG21 plasmid was determined using methods described in Section C.
R. Murine OPG Met-Lys-(His)7-Ala-Ser-(Asp)4-Lys[22-401] (A45T)
[0225]A DNA sequence coding for an N-terminal His tag and enterokinase recognition sequence which is (NH2 to COOH terminus): Met-Lys-His-His-His-His-His-His-His-Ala-Ser-Asp-Asp-Asp-Asp-Lys (=HEK), followed by amino acids 22 through 401 of the murine OPG polypeptide was placed under control of the lac repressor regulated Ps4 promoter as follows. pAMG22-His (See Section A) was digested with NheI and BamHI restriction endonucleases, and the large fragment (the A fragment) isolated from an agarose gel using standard recombinant DNA methodology. Oligonucleotides #1282-91 and #1282-92 were phosphorylated individually and allowed to form an oligo linker duplex using methods previously described (See Section B). The phosphorylated linker duplex formed between oligos #1282-91 and #1282-92 containing NheI and KpnI cohesive ends, the KpnI and BamHI digested and purified PCR product described (see Section D), and the A fragment of vector pAMG22-His digested with NheI and BamHI were ligated using standard recombinant DNA methodology. The ligation was transformed into E. coli host GM120 by electroporation utilizing the manufacturer's protocol. Clones were selected, plasmid DNA isolated and DNA sequencing performed to verify the DNA sequence of the muOPG-HEK[22-401] gene. DNA sequencing revealed a spurious mutation in the natural muOPG sequence that resulted in a single amino acid change of Alanine-45 of muOPG polypeptide to a Threonine.
[0226]Expression of recombinant muOPG-HEK[22-401] (A45T) from GM120 cells harboring the recombinant pAMG21 plasmid was determined using methods similar to those described in Section C, except instead of addition of the synthetic autoinducer, IPTG was added to 0.4 mM final to achieve induction.
TABLE-US-00047 Oligo #1282-91 (SEQ ID NO: 91) 5'-CTA GCG ACG ACG ACG ACA AAG AAA CTC TGC CTC CAA AAT ACC TGC ATT ACG ATC CGG AAA CTG GTC ATC AGC TGC TGT GTG ATA AAT GTG CTC CGG GTA C-3' Oligo #1282-92 (SEQ ID NO: 92) 5'-CCG GAG CAC ATT TAT CAC ACA GCA GCT GAT GAC CAG TTT CCG GAT CGT AAT GCA GGT ATT TTG GAG GCA GAG TTT CTT TGT CGT CGT CGT CG-3'
S. Human OPG Met-Arg-Gly-Ser-(His)6[22-401]
[0227]Eight oligonucleotides (1338-09 to 1338-16 shown below) were designed to produce a 175 base fragment as overlapping, double stranded DNA. The oligos were annealed, ligated, and the 5' and 3' oligos were used as PCR primers to produce large quantities of the 175 base fragment. The final PCR gene products were digested with restriction endonucleases ClaI and KpnI to yield a fragment which replaces the N-terminal 28 codons of human OPG. The ClaI and KpnI digested PCR product was inserted into pAMG21-huOPG [27-401] which had also been cleaved with ClaI and KpnI. Ligated DNA was transformed into competent host cells of E. coli strain 393. Clones were screened for the ability to produce the recombinant protein product and to possess the gene fusion having the correct nucleotide sequence. Protein expression levels were determined from 50 ml shaker flask studies. Whole cell lysate and sonic pellet were analyzed for expression of the construct by Coomassie stained PAGE gels and Western analysis with murine anti-OPG antibody. Expression of huOPG Met-Arg-Gly-Ser-(His)6 [22-401] resulting in the formation of large inclusion bodies and the protein was localized to the insoluble (pellet) fraction.
TABLE-US-00048 1338-09 (SEQ ID NO: 93) ACA AAC ACA ATC GAT TTG ATA CTA GA 1338-10 (SEQ ID NO: 94) TTT GTT TTA ACT AAT TAA AGG AGG AAT AAA ATA TGA GAG GAT CGC ATC AC 1338-11 (SEQ ID NO: 95) CAT CAC CAT CAC GAA ACC TTC CCG CCG AAA TAC CTG CAC TAC GAC GAA GA 1338-12 (SEQ ID NO: 96) AAC CTC CCA CCA GCT GCT GTG CGA CAA ATG CCC GCC GGG TAC CCA AAC A 1338-13 (SEQ ID NO: 97) TGT TTG GGT ACC CGG CGG GCA TTT GT 1338-14 (SEQ ID NO: 98) CGC ACA GCA GCT GGT GGG AGG TTT CTT CGT CGT AGT GCA GGT ATT TCG GC 1338-15 (SEQ ID NO: 99) GGG AAG GTT TCG TGA TGG TGA TGG TGA TGC GAT CCT CTC ATA TTT TAT T 1338-16 (SEQ ID NO: 100) CCT CCT TTA ATT AGT TAA AAC AAA TCT AGT ATC AAA TCG ATT GTG TTT GT
T. Human OPG Met-Lys[22-401] and Met(Lys)3[22-401]
[0228]To construct the met-lys and met-(lys)3 versions of human OPG[22-401], overlapping oligonucleotides were designed to add the appropriate number of lysine residues. The two oligos for each construct were designed to overlap, allowing two rounds of PCR to produce the final product. The template for the first PCR reaction was a plasmid DNA preparation containing the human OPG 22-401 gene. The first PCR added the lysine residue(s). The second PCR used the product of the first round and added sequence back to the first restriction site, ClaI.
[0229]The final PCR gene products were digested with restriction endonucleases ClaI and KpnI, which replace the N-terminal 28 codons of hu OPG, and then ligated into plasmid pAMG21-hu OPG [27-401] which had been also digested with the two restriction endonucleases. Ligated DNA was transformed into competent host cells of E. coli strain 393. Clones were screened for the ability to produce the recombinant protein product and to possess the gene fusion having the correct nucleotide sequence. Protein expression levels were determined from 50 ml shaker flask studies. Whole cell lysate and sonic pellet were analyzed for expression of the construct by Coomassie stained PAGE gels and Western analysis with murine anti-OPG antibody. Neither construct had a detectable level of protein expression and inclusion bodies were not visible. The DNA sequences were confirmed by DNA sequencing.
TABLE-US-00049 Oligonucleotide primers to prepare Met-Lys huOPG[22-401]: 1338-17 (SEQ ID NO: 101) ACA AAC ACA ATC GAT TTG ATA CTA GAT TTG TTT TAA CTA ATT AAA GGA GGA ATA AAA TG 1338-18 (SEQ ID NO: 102) CTA ATT AAA GGA GGA ATA AAA TGA AAG AAA CTT TTC CTC CAA AAT ATC 1338-20 (SEQ ID NO: 103) TGT TTG GGT ACC CGG CGG ACA TTT ATC ACA C Oligonucleotide primers to prepare Met- (Lys)3-huOPG[22-401]: 1338-17 (SEQ ID NO: 104) ACA AAC ACA ATC GAT TTG ATA CTA GAT TTG TTT TAA CTA ATT AAA GGA GGA ATA AAA TG 1338-19 (SEQ ID NO: 105) CTA ATT AAA GGA GGA ATA AAA TGA AAA AAA AAG AAA CTT TTC CTC CAA AAT ATC 1338-20 (SEQ ID NO: 106) TGT TTG GGT ACC CGG CGG ACA TTT ATC ACA C
U. Human and Murine OPG [22-401]/Fc Fusions
[0230]Four OPG-Fc fusions were constructed where the Fc region of human IgG1 was fused at the N-terminus of either human or murine Osteoprotegerin amino acids 22 to 401 (referred to as Fc/OPG [22-401]) or at the C-terminus (referred to as OPG[22-401]/Fc). Fc fusions were constructed using the fusion vector pFc-A3 described in Example 7.
[0231]All fusion genes were constructed using standard PCR technology. Template for PCR reactions were plasmid preparations containing the target genes. Overlapping oligos were designed to combine the C-terminal portion of one gene with the N terminal portion of the other gene. This process allows fusing the two genes together in the correct reading frame after the appropriate PCR reactions have been performed. Initially one "fusion" oligo for each gene was put into a PCR reaction with a universal primer for the vector carrying the target gene. The complimentary "fusion" oligo was used with a universal primer to PCR the other gene. At the end of this first PCR reaction, two separate products were obtained, with each individual gene having the fusion site present, creating enough overlap to drive the second round of PCR and create the desired fusion. In the second round of PCR, the first two PCR products were combined along with universal primers and via the overlapping regions, the full length fusion DNA sequence was produced.
[0232]The final PCR gene products were digested with restriction endonucleases XbaI and BamHI, and then ligated into the vector pAMG21 having been also digested with the two restriction endonucleases. Ligated DNA was transformed into competent host cells of E. coli strain 393. Clones were screened for the ability to produce the recombinant protein product and to possess the gene fusion having the correct nucleotide sequence. Protein expression levels were determined from 50 ml shaker flask studies. Whole cell lysate, sonic pellet, and supernatant were analyzed for expression of the fusion by Coomassie stained PAGE gels and Western analysis with murine anti-OPG antibody.
Fc/huOPG [22-401]
[0233]Expression of the Fc/hu OPG [22-401] fusion peptide was detected on a Coomassie stained PAGE gel and on a Western blot. The cells have very large inclusion bodies, and the majority of the product is in the insoluble (pellet) fraction. The following primers were used to construct this OPG-Fc fusion:
TABLE-US-00050 1318-48 (SEQ ID NO: 107) CAG CCC GGG TAA AAT GGA AAC GTT TCC TCC AAA ATA TCT TCA TT 1318-49 (SEQ ID NO: 108) CGT TTC CAT TTT ACC CGG GCT GAG CGA GAG GCT CTT CTG CGT GT
Fc/muOPG [22-401]
[0234]Expression of the fusion peptide was detected on a Coomassie stained gel and on a Western blot. The cells have very large inclusion bodies, and the majority of the product is in the insoluble (pellet) fraction. The following primers were used to construct this OPG-Fc fusion:
TABLE-US-00051 1318-50 (SEQ ID NO: 109) CGC TCA GCC CGG GTA AAA TGG AAA CGT TGC CTC CAA AAT ACC TGC 1318-51 (SEQ ID NO: 110) CCA TTT TAC CCG GGC TGA GCG AGA GGC TCT TCT GCG TGT
muOPG [22-401]/Fc
[0235]Expression of the fusion peptide was detected on a Coomassie stained gel and on a Western blot. The amount of recombinant product was less than the OPG fusion proteins having the Fc region in the N terminal position. Obvious inclusion bodies were not detected. Most of the product appeared to be in the insoluble (pellet) fraction. The following primers were used to construct this OPG-Fc fusion:
TABLE-US-00052 1318-54 (SEQ ID NO: 111) GAA AAT AAG CTG CTT AGC TGC AGC TGA ACC AAA ATC 1318-55 (SEQ ID NO: 112) CAG CTG CAG CTA AGC AGC TTA TTT TCA CGG ATT G
huOPG [22-401]/Fc
[0236]Expression of the fusion peptide was not detected on a Coomassie stained gel, although a faint Western positive signal was present. Obvious inclusion bodies were not detected. The following primers were used to prepare this OPG-Fc fusion:
TABLE-US-00053 1318-52 (SEQ ID NO: 113) AAA AAT AAG CTG CTT AGC TGC AGC TGA ACC AAA ATC 1318-53 (SEQ ID NO: 114) CAG CTG CAG CTA AGC AGC TTA TTT TTA CTG ATT GG
V. Human OPG Met[22-401]-Fc Fusion (P25A)
[0237]This construct combines a proline to alanine amino acid change at position 25 (P25A) with the huOPG met[22-401]-Fc fusion. The plasmid was digested with restriction endonucleases ClaI and KpnI, which removes the N-terminal 28 codons of the gene, and the resulting small (less than 200 base pair) fragment was gel purified. This fragment containing the proline to alanine change was then ligated into plasmid pAMG21-huOPG [22-401]-Fc fusion which had been digested with the two restriction endonucleases. The ligated DNA was transformed into competent host cells of E. coli strain 393. Clones were screened for the ability to produce the recombinant protein product and to possess the gene fusion having the correct nucleotide sequence. Protein expression levels were determined from 50 ml shaker flask studies. Whole cell lysate and sonic pellet were analyzed for expression of the construct by Coomassie stained PAGE gels and Western analysis with murine anti-OPG antibody. The expression level of the fusion peptide was detected on a Coomassie stained PAGE gel and on a Western blot. The protein was in the insoluble (pellet) fraction. The cells had large inclusion bodies.
W. Human OPG Met[22-401] (P25A)
[0238]A DNA sequence coding for an N-terminal methionine and amino acids 22 through 401 of human OPG with the proline at position 25 being substituted by alanine under control of the lux PR promoter in prokaryotic expression vector pAMG21 was constructed as follows: Synthetic oligos #1289-84 and 1289-85 were annealed to form an oligo linker duplex with XbaI and KpnI cohesive ends. The synthetic linker duplex utilized optimal E. coli codons and encoded an N-terminal methionine. The linker also included an SpeI restriction site which was not present in the original sequence. The linker duplex was directionally inserted between the XbaI and KpnI sites in pAMG21-huOPG-22-401 using standard methods. The ligation mixture was introduced into E. coli host GM221 by transformation. Clones were initially screened for production of the recombinant protein. Plasmid DNA was isolated from positive clones and DNA sequencing was performed to verify the DNA sequence of the HuOPG-Met[22-401] (P25A) gene. The following oligonucleotides were used to generate the XbaI-KpnI linker:
TABLE-US-00054 Oligo #1289-84 (SEQ ID NO: 115) 5'-CTA GAA GGA GGA ATA ACA TAT GGA AAC TTT TGC TCC AAA ATA TCT TCA TTA TGA TGA AGA AAC TAG TCA TCA GCT GCT GTG TGA TAA ATG TCC GCC GGG TAC-3' Oligo #1289-85 (SEQ ID NO: 116) 5'-CCG GCG GAC ATT TAT CAC ACA GCA GCT GAT GAC TAG TTT CTT CAT CAT AAT GAA GAT ATT TTG GAG CAA AAG TTT CCA TAT GTT ATT CCT CCT T-3'
X. Human OPG Met[22-401] (P26A) and (P26D)
[0239]A DNA sequence coding for an N-terminal methionine and amino acids 22 through 401 of human OPG with the proline at position 26 being substituted by alanine under control of the lux PR promoter in prokaryotic expression vector pAMG21 was constructed as follows: Synthetic oligos #1289-86 and 1289-87 were annealed to form an oligo linker duplex with XbaI and SpeI cohesive ends. The synthetic linker duplex utilized optimal E. coli codons and encoded an N-terminal methionine. The linker duplex was directionally inserted between the XbaI and SpeI sites in pAMG21-huOPG[22-401] (P25A) using standard methods. The ligation mixture was introduced into E. coli host GM221 by transformation. Clones were initially screened for production of the recombinant protein. Plasmid DNA was isolated from positive clones and DNA sequencing was performed to verify the DNA sequence of the huOPG-met[22-401] (P26A) gene. One of the clones sequenced was found to have the proline at position 26 substituted by aspartic acid rather than alanine, and this clone was designated huOPG-met[22-401] (P26D). The following oligonucleotides were used to generate the XbaI-SpeI linker:
TABLE-US-00055 Oligo #1289-86 (SEQ ID NO: 117) 5'-CTA GAA GGA GGA ATA ACA TAT GGA AAC TTT TCC TGC TAA ATA TCT TCA TTA TGA TGA AGA AA-3' Oligo #1289-87 (SEQ ID NO: 118) 5'-CTA GTT TCT TCA TCA TAA TGA AGA TAT TTA GCA GGA AAA GTT TCC ATA TGT TAT TCC TCC TT-3'
Y. Human OPG Met[22-194] (P25A)
[0240]A DNA sequence coding for an N-terminal methionine and amino acids 22 through 194 of human OPG with the proline at position 25 being substituted by alanine under control of the lux PR promoter in prokaryotic expression vector pAMG21 was constructed as follows: The plasmids pAMG21-huOPG[27-194] and pAMG21-huOPG[22-401] (P25A) were each digested with KpnI and BamHI endonucleases. The 450 by fragment was isolated from pAMG21-huOPG[27-194] and the 6.1 kbp fragment was isolated from pAMG21-huOPG[22-401] (P25A). These fragments were ligated together and introduced into E. coli host GM221 by transformation. Clones were initially screened for production of the recombinant protein. Plasmid DNA was isolated from positive clones and DNA sequencing was performed to verify the DNA sequence of the huOPG-Met[22-194] (P25A) gene.
Example 9
Association of OPG Monomers
[0241]CHO cells engineered to overexpress muOPG [22-401] were used to generate conditioned media for the analysis of secreted recombinant OPG using rabbit polyclonal anti-OPG antibodies. An aliquot of conditioned media was concentrated 20-fold, then analysed by reducing and non-reducing SDS-PAGE (FIG. 15). Under reducing conditions, the protein migrated as a Mr 50-55 kd polypeptide, as would be predicted if the mature product was glycosylated at one or more of its consensus N-linked glycosylation sites. Surprisingly, when the same samples were analysed by non-reducing SDS-PAGE, the majority of the protein migrated as an approximately 100 kd polypeptide, twice the size of the reduced protein. In addition, there was a smaller amount of the Mr 50-55 kd polypeptide. This pattern of migration on SDS-PAGE was consistent with the notion that the OPG product was forming dimers through oxidation of a free sulfhydryl group(s).
[0242]The predicted mature OPG polypeptide contains 23 cysteine residues, 18 of which are predicted to be involved in forming intrachain disulfide bridges which comprise the four cysteine-rich domains (FIG. 12A). The five remaining C-terminal cysteine residues are not involved in secondary structure which can be predicted based upon homology with other TNFR family members. Overall there is a net uneven number of cysteine residues, and it is formally possible that at least one residue is free to form an intermolecular disulfide bond between two OPG monomers.
[0243]To help elucidate patterns of OPG kinesis and monomer association, a pulse-chase labelling study was performed. CHO cells expressing muOPG [22-401] were metabolically labelled as described above in serum-free medium containing 35S methionine and cysteine for 30 min. After this period, the media was removed, and replaced with complete medium containing unlabelled methionine and cysteine at levels approximately 2,000-fold excess to the original concentration of radioactive amino acids. At 30 min, 1 hr, 2 hr, 4 hr, 6 hr and 12 hr post addition, cultures were harvested by the removal of the conditioned media, and lysates of the conditioned media and adherent monolayers were prepared. The culture media and cell lysates were clarified as described above, and then immunoprecipitated using anti-OPG antibodies as described above. After the immunoprecipitates were washed, they were released by boiling in non-reducing SDS-PAGE buffer then split into two equal halves. To one half, the reducing agent β-mercaptothanol was added to 5% (v/v) final concentration, while the other half was maintained in non-reducing conditions. Both sets of immunoprecipitates were analysed by SDS-PAGE as described above, then processed for autoradiography and exposed to film. The results are shown in FIG. 16. The samples analysed by reducing SDS-PAGE are depicted in the bottom two panels. After synthesis, the OPG polypeptide is rapidly processed to a slightly larger polypeptide, which probably represents modification by N-linked glycoslyation. After approximately 1-2 hours, the level of OPG in the cell decreases dramatically, and concomitantly appears in the culture supernatant. This appears to be the result of the vectoral transport of OPG from the cell into the media over time, consistent with the notion that OPG is a naturally secreted protein. Analysis of the same immunoprecipitates under nonreducing conditions reveals the relationship between the formation of OPG dimers and secretion into the conditioned media (FIG. 16, upper panels). In the first 30-60 minutes, OPG monomers are processed in the cell by apparent glycoslylation, followed by dimer formation. Over time, the bulk of OPG monomers are driven into dimers, which subsequently disappear from the cell. Beginning about 60 minutes after synthesis, OPG dimers appear in the conditioned media, and accumulate over the duration of the experiment. Following this period, OPG dimers are formed, which are then secreted into the culture media. OPG monomers persist at a low level inside the cell over time, and small amounts also appear in the media. This does not appear to be the result of breakdown of covalent OPG dimers, but rather the production of sub-stoichiometric amounts of monomers in the cell and subsequent secretion.
[0244]Recombinantly produced OPG from transfected CHO cells appears to be predominantly a dimer. To determine if dimerization is a natural process in OPG synthesis, we analysed the conditioned media of a cell line found to naturally express OPG. The CTLL-2 cell line, a murine cytotoxic T lymphocytic cell line (ATCC accession no. TIB-214), was found to express OPG mRNA in a screen of tissue and cell line RNA. The OPG transcript was found to be the same as the cloned and sequenced 2.5-3.0 kb RNA identified from kidney and found to encode a secreted molecule. Western blot analysis of conditioned media obtained from CTLL-2 cells shows that most, if not all, of the OPG protein secreted is a dimer (FIG. 17). This suggests that OPG dimerization and secretion is not an artifact of overexpression in a cell line, but is likely to be the main form of the product as it is produced by expressing cells.
[0245]Normal and transgenic mouse tissues and serum were analysed to determine the nature of the OPG molecule expressed in OPG transgenic mice. Since the rat OPG cDNA was expressed under the control of a hepatocyte control element, extracts made from the parenchyma of control and transgenic mice under non-reducing conditions were analysed (FIG. 18). In extract from transgenic, but not control mice, OPG dimers are readily detected, along with substoichiometric amounts of monomers. The OPG dimers and monomers appear identical to the recombinant murine protein expressed in the genetically engineered CHO cells. This strongly suggests that OPG dimers are indeed a natural form of the gene product, and are likely to be key active components. Serum samples obtained from control and transgenic mice were similarly analysed by western blot analysis. In control mice, the majority of OPG protein migrates as a dimer, while small amounts of monomer are also detected. In addition, significant amounts of a larger OPG related protein is detected, which migrates with a relative molecular mass consistent with the predicted size of a covalently-linked trimer. Thus, recombinant OPG is expressed predominantly as a dimeric protein in OPG transgenic mice, and the dimer form may be the basis for the osteopetrotic phenotype in OPG mice. OPG recombinant protein may also exist in higher molecular weight "trimeric" forms.
[0246]To determine if the five C-terminal cysteine residues of OPG play a role in homodimerization, the murine OPG codons for cytsteine residues 195 (C195), C202, C277, C319, and C400 were changed to serine using the QuickChange® Site-Directed Mutagenesis Kit (Stratagene, San Diego, Calif.) as described above. The muOPG gene was subcloned between the Not I and Xba I sites of the pcDNA 3.1 (+) vector (Invitrogen, San Diego, Calif.). The resulting plasmid, pcDNA3.1-muOPG, and mutagenic primers were treated with Pfu polymerase in the presence of deoxynucleotides, then amplified in a thermocycler as described above. An aliqout of the reaction is then transfected into competent E. coli XL1-Blue by heatshock, then plated. Plasmid DNA from transformants was then sequenced to verify mutations.
[0247]The following primer pairs were used to change the codon for cysteine residue 195 to serine of the murine OPG gene, resulting in the production of a muOPG [22-401] C195S protein:
TABLE-US-00056 1389-19: (SEQ ID NO: 150) 5'-CAC GCA AAA GTC GGG AAT AGA TGT CAC-3' 1406-38: (SEQ ID NO: 151) 5'-GTG ACA TCT ATT CCC GAC TTT TGC GTG-3'
[0248]The following primer pairs were used to change the codon for cysteine residue 202 to serine of the murine OPG gene, resulting in the production of a muOPG [22-401] C202S protein:
TABLE-US-00057 1389-21: (SEQ ID NO: 152) 5'-CAC CCT GTC GGA AGA GGC CTT CTT C-3' 1389-22: (SEQ ID NO: 153) 5'-GAA GAA GGC CTC TTC CGA CAG GGT G-3' (1389-22)
[0249]The following primer pairs were used to change the codon for cysteine residue 277 to serine of the murine OPG gene, resulting in the production of a muOPG [22-401] C277S protein:
TABLE-US-00058 1389-23: (SEQ ID NO: 154) 5'-TGA CCT CTC GGA AAG CAG CGT GCA-3' 1389-24: (SEQ ID NO: 155) 5'-TGC ACG CTG CTT TCC GAG AGG TCA-3'
[0250]The following primer pairs were used to change the codon for cysteine residue 319 to serine of the murine OPG gene, resulting in the production of a muOPG [22-401] C319S protein:
TABLE-US-00059 1389-17: (SEQ ID NO: 156) 5'-CCT CGA AAT CGA GCG AGC AGC TCC-3' 1389-18: (SEQ ID NO: 157) 5'-CGA TTT CGA GGT CTT TCT CGT TCT C-3'
[0251]The following primer pairs were used to change the codon for cysteine residue 400 to serine of the murine OPG gene, resulting in the production of a muOPG [22-401] C400S protein:
TABLE-US-00060 1406-72: (SEQ ID NO: 158) 5'-CCG TGA AAA TAA GCT CGT TAT AAC TAG GAA TGG-3' 1406-75: (SEQ ID NO: 159) 5'-CCA TTC CTA GTT ATA ACG AGC TTA TTT TCA CGG-3'
[0252]Each resulting muOPG [22-401] plasmid containing the appropriate mutation was then transfected into human 293 cells, the mutant OPG-Fc fusion protein purified from conditioned media as described above. The biological activity of each protein was assessed the in vitro osteoclast forming assay described in example 11. Conditioned media from each transfectant was analysed by non-reducing SDS-PAGE and western blotting with anti-OPG antibodies.
[0253]Mutation of any of the five C-terminal cysteine residues results in the production of predominantly (>90%) monomeric 55 kd OPG molecules. This strongly suggests that the C-terminal cysteine residues together play a role in OPG homodimerization.
[0254]C-terminal OPG deletion mutants were constructed to map the region(s) of the OPG C-terminal domain which are important for OPG homodimerization. These OPG mutants were constructed by PCR amplification using primers which introduce premature stop translation signals in the C-terminal region of murine OPG. The 5' oligo was designed to the MuOPG start codon (containing a HindIII restriction site) and the 3' oligonucleotides (containing a stop codon and XhoI site) were designed to truncate the C-terminal region of muOPG ending at either threonine residue 200 (CT 200), proline 212 (CT212), glutamic acid 293 (CT-293), or serine 355 (CT-355).
[0255]The following primers were used to construct muOPG [22-200]:
TABLE-US-00061 1091-39: (SEQ ID NO: 160) 5'-CCT CTG AGC TCA AGC TTC CGA GGA CCA CAA TGA ACA AG-3' 1391-91: (SEQ ID NO: 161) 5'-CCT CTC TCG AGT CAG GTG ACA TCT ATT CCA CAC TTT TGC GTG GC-3' (1391-91)
[0256]The following primers were used to construct muOPG [22-212]:
TABLE-US-00062 1091-39: (SEQ ID NO: 162) 5'-CCT CTG AGC TCA AGC TTC CGA GGA CCA CAA TGA ACA AG-3' 1391-90: (SEQ ID NO: 163) 5'-CCT CTC TCG AGT CAA GGA ACA GCA AAC CTG AAG AAG GC-3'
[0257]The following primers were used to construct muOPG [22-293]:
TABLE-US-00063 1091-39: (SEQ ID NO: 164) 5'-CCT CTG AGC TCA AGC TTC CGA GGA CCA CAA TGA ACA AG-3' 1391-89: (SEQ ID NO: 165) 5'-CCT CTC TCG AGT CAC TCT GTG GTG AGG TTC GAG TGG CC-3' The following primers were used to construct muOPG [22-355]: 1091-39: (SEQ ID NO: 166) 5'-CCT CTG AGC TCA AGC TTC CGA GGA CCA CAA TGA ACA AG-3' 1391-88: (SEQ ID NO: 167) 5' CCT CTC TCG AGT CAG GAT GTT TTC AAG TGC TTG AGG GC-3'
[0258]Each resulting muOPG-CT plasmid containing the appropriate truncation was then transfected into human 293 cells, the mutant OPG-Fc fusion protein purified from conditioned media as described above. The biological activity of each protein was assessed the in vitro osteoclast forming assay described in example 11. The conditioned medias were also analysed by non-reducing SDS-PAGE and western blotting using anti-OPG antibodies.
[0259]Truncation of the C-terminal region of OPG effects the ability of OPG to form homodimers. CT 355 is predominantly monomeric, although some dimer is formed. CT 293 forms what appears to be equal molar amounts of monomer and dimer, and also high molecular weight aggregates. However, CT 212 and CT 200 are monomeric.
Example 10
Purification of OPG
A. Purification of Mammalian OPG-Fc Fusion Proteins
[0260]5 L of conditioned media from 293 cells expressing an OPG-Fc fusion protein were prepared as follows. A frozen sample of cells was thawed into 10 ml of 293S media (DMEM-high glucose, 1× L-glutamine, 10% heat inactivated fetal bovine serum (FBS) and 100 ug/ml hygromycin) and fed with fresh media after one day. After three days, cells were split into two T175 flasks at 1:10 and 1:20 dilutions. Two additional 1:10 splits were done to scale up to 200 T175 flasks. Cells were at 5 days post-thawing at this point. Cells were grown to near confluency (about three days) at which time serum-containing media was aspirated, cells were washed one time with 25 ml PBS per flask and 25 ml of SF media (DMEM-high glucose, 1× L-glutamine) was added to each flask. Cells were maintained at 5% CO2 for three days at which point the media was harvested, centrifuged, and filtered through 0.45m cellulose nitrate filters (Corning).
[0261]OPG-Fc fusion proteins were purified using a Protein G Sepharose column (Pharmacia) equilibrated in PBS. The column size varied depending on volume of starting media. Conditioned media prepared as described above was loaded onto the column, the column washed with PBS, and pure protein eluted using 100 mM glycine pH 2.7. Fractions were collected into tubes containing 1M Tris pH 9.2 in order to neutralize as quickly as possible. Protein containing fractions were pooled, concentrated in either an Amicon Centricon 10 or Centriprep 10 and diafiltered into PBS. The pure protein is stored at -80° C.
[0262]Murine [22-401]-Fc, Murine [22-180]-Fc, Murine [22-194]-Fc, human [22-401]-Fc and human [22-201]Fc were purified by this procedure. Murine [22-185]-Fc is purified by this procedure.
B. Preparation of Anti-OPG Antibodies
[0263]Three New Zealand White rabbits (5-8 lbs initial wt) were injected subcutaneously with muOPG[22-401]-Fc fusion protein. Each rabbit was immunized on day 1 with 50 μg of antigen emulsified in an equal volume of Freunds complete adjuvant. Further boosts (Days 14 and 28) were performed by the same procedure with the substitution of Freunds incomplete adjuvant. Antibody titers were monitored by EIA. After the second boost, the antisera revealed high antibody titers and 25 ml production bleeds were obtained from each animal. The sera was first passed over an affinity column to which murine OPG-Fc had be immobilized. The anti-OPG antibodies were eluted with Pierce Gentle Elution Buffer containing 1% glacial acetic acid. The eluted protein was then dialyzed into PBS and passed over a Fc column to remove any antibodies specific for the Fc portion of the OPG fusion protein. The run through fractions containing anti-OPG specific antibodies were dialyzed into PBS.
C. Purification of Murine OPG[22-401]
Antibody Affinity Chromatography
[0264]Affinity purified anti-OPG antibodies were diafiltered into coupling buffer (0.1M sodium carbonate pH 8.3, 0.5M NaCl), and mixed with CNBr-activated sepharose beads (Pharmacia) for two hours at room temperature. The resin was then washed with coupling buffer extensively before blocking unoccupied sited with 1M ethanolamine (pH 8.0) for two hours at room temperature. The resin was then washed with low pH (0.1M sodium acetate pH 4.0, 0.5M NaCl) followed by a high pH wash (0.1M Tris-HCl pH 8.0, 0.5M NaCl). The last washes were repeated three times. The resin was finally equilibrated with PBS before packing into a column. Once packed, the resin was washed with PBS. A blank elution was performed with 0.1M glycine-HCl, pH 2.5), followed by re-equilibration with PBS.
[0265]Concentrated conditioned media from CHO cells expressing muOPG[22-410] was applied to the column at a low flow rate. The column was washed with PBS until UV absorbance measured at 280 nm returned to baseline. The protein was eluted from the column first with 0.1M glycine-HCl (pH 2.5), re-equilibrated with PBS, and eluted with a second buffer (0.1M CAPS, pH 10.5), 1M NaCl). The two elution pools were diafiltered separately into PBS and sterile filtered before freezing at -20° C.
Conventional Chromatography
[0266]CHO cell conditioned media was concentrated 23× in an Amicon spiral wound cartridge (S10Y10) and diafiltered into 20mM tris pH 8.0. The diafiltered media was then applied to a Q-sepharose HP (Pharmacia) column which had been equilibrated with 20 mM tris pH 8.0. The column was then washed until absorbence at 280nm reached baseline. Protein was eluted with a 20 column volume gradient of 0-300 mM NaCl in tris pH 8.0. OPG protein was detected using a western blot of column fractions.
[0267]Fractions containing OPG were pooled and brought to a final concentration of 300 mM NaCl, 0.2 mM DTT. A NiNTA superose (Qiagen) column was equilibrated with 20 mM tris pH 8.0, 300 mM NaCl, 0.2 mM DTT after which the pooled fractions were applied. The column was washed with equilibration buffer until baseline absorbence was reached. Proteins were eluted from the column with a 0-30 mM Imidazole gradient in equilibration buffer. Remaining proteins were washed off the column with 1M Imidazole. Again a western blot was used to detect OPG containing fractions.
[0268]Pooled fractions from the NiNTA column were dialyzed into 10 mm potassium phosphate pH 7.0, 0.2 mM DTT. The dialyzed pool was then applied to a ceramic hydroxyapatite column (Bio-Rad) which had been equilibrated in 10 mM phosphate buffer. After column washing, the protein was eluted with a 10-100 mM potassium phosphate gradient over 20 column volumes. This was then followed by a 20 column volume gradient of 100-400 mM phosphate.
[0269]OPG was detected by coomassie blue staining of SDS-polyacrylamide gels and by western blotting. Fractions were pooled and diafiltered onto PBS and frozen at -80° C. The purified protein runs as a monomer and will remain so after diafiltration into PBS. The monomer is stable when stored frozen or at pH 5 at 4° C. However if stored at 4° C. in PBS, dimers and what appears to be trimers and tetramers will form after one week.
D. Purification of Human OPG Met[22-401] from E. coli
[0270]The bacterial cell paste was suspended into 10 mM EDTA to a concentration of 15% (w/v) using a low shear homogenizer at 5° C. The cells were then disrupted by two homogenizations at 15,000 psi each at 5° C. The resulting homogenate was centrifuged at 5,000×g for one hour at 5° C. The centrifugal pellet was washed by low shear homogenization into water at the original homogenization volume followed by centrifugation as before. The washed pellet was then solubilized to 150 (w/v) by a solution of (final concentration) 6 M guanidine HCl, 10 mM dithiothreitol, 10 mM TrisHCl, pH 8.5 at ambient temperature for 30 minutes. This solution was diluted 30-fold into 2M urea containing 50 mM CAPS, pH 10.5, 1 mM reduced glutathione and then stirred for 72 hours at 5° C. The OPG was purified from this solution at 25° C. by first adjustment to pH 4.5 with acetic acid and then chromatography over a column of SP-HP Sepharose resin equilibrated with 25 mM sodium acetate, pH 4.5. The column elution was carried out with a linear sodium chloride gradient from 50 mM to 550 mM in the same buffer using 20 column volumes at a flow rate of 0.1 column volumes/minute. The peak fractions containing only the desired OPG form were pooled and stored at 5° C. or buffer exchanged into phosphate buffered saline, concentrated by ultrafiltration, and then stored at 5° C. This material was analyzed by reverse phase HPLC, SDS-PAGE, limulus amebocyte lysate assay for the presence of endotoxin, and N-terminal sequencing. In addition, techniques such as mass spectrometry, pH/temperature stability, fluoresence, circular dichroism, differential scanning calorimetry, and protease profiling assays may also be used to examine the folded nature of the protein.
Example 11
Biological Activity of Recombinant OPG
[0271]Based on histology and histomorphometry, it appeared that hepatic overexpression of OPG in transgenic mice markedly decreased the numbers of osteoclasts leading to a marked increase in bone tissue (see Example 4). To gain further insight into potential mechanism(s) underlying this in vivo effect, various forms of recombinant OPG have been tested in an in vitro culture model of osteoclast formation (osteoclast forming assay). This culture system was originally devised by Udagawa (Udagawa et al. Endocrinology 125, 1805-1813 (1989), Proc. Natl. Acad. Sci. USA 87, 7260-7264 (1990)) and employs a combination of bone marrow cells and cells from bone marrow stromal cell lines. A description of the modification of this culture system used for these studies has been previously published (Lacey et al. Endocrinology 136, 2367-2376 (1995)). In this method, bone marrow cells, flushed from the femurs and tibiae of mice, are cultured overnight in culture media (alpha MEM with 10% heat inactivated fetal bovine serum) supplemented with 500 U/ml CSF-1 (colony stimulating factor 1, also called M-CSF), a hematopoietic growth factor specific for cells of the monocyte/macrophage family lineage. Following this incubation, the non-adherent cells are collected, subjected to gradient purification, and then cocultured with cells from the bone marrow cell line ST2 (1×106 non-adherent cells:1×105 ST2 cells/ml media). The media is supplemented with dexamethasone (100 nM) and the biologically-active metabolite of vitamin D3 known as 1,25 dihydroxyvitamin D3 (1,25 (OH)2 D3, 10 nM). To enhance osteoclast appearance, prostaglandin E2 (250 nM) is added to some cultures. The coculture period usually ranges from 8-10 days and the media, with all of the supplements freshly added, is renewed every 3-4 days. At various intervals, the cultures are assessed for the presence of tartrate acid phosphatase (TRAP) using either a histochemical stain (Sigma Kit #387A, Sigma, St. Louis, Mo.) or TRAP solution assay. The TRAP histochemical method allows for the identification of osteoclasts phenotypically which are multinucleated (•3 nuclei) cells that are also TRAP+. The solution assay involves lysing the osteoclast-containing cultures in a citrate buffer (100 mM, pH 5.0) containing 0.1% Triton X-100. Tartrate resistant acid phosphatase activity is then measured based on the conversion of p-nitrophenylphosphate (20 nM) to p-nitrophenol in the presence of 80 mM sodium tartrate which occurs during a 3-5 minute incubation at RT. The reaction is terminated by the addition of NaOH to a final concentration of 0.5 M. The optical density at 405 nm is measured and the results are plotted.
[0272]Previous studies (Udagawa et al. ibid) using the osteoclast forming assay have demonstrated that these cells express receptors for 125I-calcitonin (autoradiography) and can make pits on bone surfaces, which when combined with TRAP positivity confirm that the multinucleated cells have an osteoclast phenotype. Additional evidence in support of the osteoclast phenotype of the multinucleated cells that arise in vitro in the osteoclast forming assay are that the cells express αv and β3 integrins by immunocytochemistry and calcitonin receptor and TRAP mRNA by in situ hybridization (ISH).
[0273]The huOPG [22-401]-Fc fusion was purified from CHO cell conditioned media and subsequently utilized in the osteoclast forming assay. At 100 ng/ml of huOPG [22-401]-Fc, osteoclast formation was virtually 100% inhibited (FIG. 19A). The levels of TRAP measured in lysed cultures in microtitre plate wells were also inhibited in the presence of OPG with an ID50 of approximately 3 ng/ml (FIG. 20). The level of TRAP activity in lysates appeared to correlate with the relative number of osteoclasts seen by TRAP cytochemistry (compare FIGS. 19A-19G and 20). Purified human IgG1 and TNFbp were also tested in this model and were found to have no inhibitory or stimulatory effects suggesting that the inhibitory effects of the huOPG [22-401]-Fc were due to the OPG portion of the fusion protein. Additional forms of the human and murine molecules have been tested and the cumulative data are summarized in Table 1.
TABLE-US-00064 TABLE 1 Effects of various OPG forms on in vitro osteoclast formation OPG Construct Relative Bioactivity in vitro muOPG [22-401]-Fc +++ muOPG [22-194]-Fc +++ muOPG [22-185]-Fc ++ muOPG [22-180]-Fc - muOPG [22-401] +++ muOPG [22-401] C195 +++ muOPG [22-401] C202 + muOPG [22-401] C277 - muOPG [22-401] C319 + muOPG [22-401] C400 + muOPG [22-185] - muOPG [22-194] ++ muOPG [22-200] ++ muOPG [22-212] - muOPG [22-293] +++ muOPG [22-355] +++ huOPG [22-401]-Fc +++ huOPG [22-201]-Fc +++ huOPG [22-401]-Fc P26A +++ huOPG [22-401]-Fc Y28F +++ huOPG [22-401] +++ huOPG [27-401]-Fc ++ huOPG [29-401]-Fc ++ huOPG [32-401]-Fc +/- +++, ED50 = 0.4-2 ng/ml ++, ED50 = 2-10 ng/ml +, ED50 = 10-100 ng/ml -, ED50 > 100 ng/ml
[0274]The cumulative data suggest that murine and human OPG amino acid sequences 22-401 are fully active in vitro, when either fused to the Fc domain, or unfused. They inhibit in a dose-dependent manner and possess half-maximal activities in the 2-10 ng/ml range. Truncation of the murine C-terminus at threonine residue 180 inactivates the molecule, whereas truncations at cysteine 185 and beyond have full activity. The cysteine residue located at position 185 is predicted to form an SS3 bond in the domain 4 region of OPG. Removal of this residue in other TNFR-related proteins has previously been shown to abrogate biological activity (Yan et al. J. Biol. Chem. 266, 12099-12104 (1994)). Our finding that muOPG[22-180]-Fc is inactive while muOPG[22-185]-Fc is active is consistent with these findings. This suggests that amino acid residues 22-185 define a region for OPG activity.
[0275]These findings indicate that like transgenically-expressed OPG, recombinant OPG protein also suppressed osteoclast formation as tested in the osteoclast forming assay. Time course experiments examining the appearance of TRAP+ cells, β3+ cells, F480+ cells in cultures continuously exposed to OPG demonstrate that OPG blocks the appearance TRAP+ and β3+ cells, but not F480+ cells. In contrast, TRAP+ and β3+ cells begin to appear as early as day 4 following culture establishment in control cultures. Only F480+ cells can be found in OPG-treated cultures and they appear to be present at qualitatively the same numbers as the control cultures. Thus, the mechanism of OPG effects in vitro appears to involve a blockade in osteoclast differentiation at a step beyond the appearance of monocyte-macrophages but before the appearance of cells expressing either TRAP or β3 integrins. Collectively these findings indicate that OPG does not interfere with the general growth and differentiation of monocyte-macrophage precursors from bone marrow, but rather suggests that OPG specifically blocks the selective differentiation of osteoclasts from monocyte-macrophage precursors.
[0276]To determine more specifically when in the osteoclast differentiation pathway that OPG was inhibitory, a variation of the in vitro culture method was employed. This variation, described in (Lacey et al. supra), employs bone marrow macrophages as osteoclast precursors. The osteoclast precursors are derived by taking the nonadherent bone marrow cells after an overnight incubation in CSF-1/M-CSF, and culturing the cells for an additional 4 days with 1,000-2,000 U/ml CSF-1. Following 4 days of culture, termed the growth phase, the non-adherent cells are removed. The adherent cells, which are bone marrow macrophages, can then be exposed for up to 2 days to various treatments in the presence of 1,000-2,000 U/ml CSF-1. This 2 day period is called the intermediate differentiation period. Thereafter, the cell layers are again rinsed and then ST-2 cells (1×105 cell/ml), dexamethasone (100 nM) and 1,25 (OH)2 D3 (10 nM) are added for the last 8 days for what is termed the terminal differentiation period. Test agents can be added during this terminal period as well. Acquisition of phenotypic markers of osteoclast differentiation are acquired during this terminal period (Lacey et al. ibid).
[0277]huOPG [22-401]-Fc (100 ng/ml) was tested for its effects on osteoclast formation in this model by adding it during either the intermediate, terminal or, alternatively, both differentiation periods. Both TRAP cytochemistry and solution assays were performed. The results of the solution assay are shown in FIG. 21. HuOPG [22-401]-Fc inhibited the appearance of TRAP activity when added to both the intermediate and terminal or only the terminal differentiation phases. When added to the intermediate phase and then removed from the cultures by rinsing, huOPG [22-401]-Fc did not block the appearance of TRAP activity in culture lysates. The cytochemistry results parallel the solution assay data. Collectively, these observations indicate that huOPG [22-401]-Fc only needs to be present during the terminal differentiation period for it to exert its all of its suppressive effects on osteoclast formation.
B. In vivo IL1-α and IL1-β Challenge Experiments
[0278]IL1 increases bone resorption both systemically and locally when injected subcutaneously over the calvaria of mice (Boyce et al., Endocrinology 125, 1142-1150 (1989)). The systemic effects can be assessed by the degree of hypercalcemia and the local effects histologically by assessing the relative magnitude of the osteoclast-mediated response. The aim of these experiments was to determine if recombinant muOPG [22-401]-Fc could modify the local and/or systemic actions of IL1 when injected subcutaneously over the same region of the calvaria as IL1.
IL-1 β Experiment
[0279]Male mice (ICR Swiss white) aged 4 weeks were divided into the following treatment groups (5 mice per group): Control group: IL1 treated animals (mice received 1 injection/day of 2.5 ug of IL1-β); Low dose muOPG [22-401]-Fc treated animals (mice received 3 injections/day of 1 μg of muOPG [22-401]-Fc); Low dose muopg [22-401]-Fc and IL1-β; High dose muOPG [22-401]-Fc treated animals (mice receive 3 injections/day of 10 μg muOPG [22-401]-Fc); High dose muOPG [22-401]-Fc and IL1-β. All mice received the same total number of injections of either active factor or vehicle (0.1% bovine serum albumin in phosphate buffered saline). All groups are sacrificed on the day after the last injection. The weights and blood ionized calcium levels are measured before the first injections, four hours after the second injection and 24 hours after the third IL1 injection, just before the animals were sacrificed. After sacrifice the calvaria were removed and processed for paraffin sectioning.
IL1-α Experiment
[0280]Male mice (ICR Swiss white) aged 4 weeks were divided into the following treatment groups (5 mice per group): Control group; IL1 alpha treated animals (mice received 1 injection/day of 5 ug of IL1-alpha); Low dose muOPG [22-401]-Fc treated animals (mice received 1 injection/day of 10 μg of muOPG [22-401]-Fc; Low dose muopg [22-401]-Fc and IL1-alpha, (dosing as above); High dose muopg [22-401]-Fc treated animals (mice received 3 injections/day of 10 μg muOPG [22-401]-Fc; High dose muOPG [22-401]-Fc and IL1-α. All mice received the same number of injections/day of either active factor or vehicle. All groups were sacrificed on the day after the last injection. The blood ionized calcium levels were measured before the first injection, four hours after the second injection and 24 hours after the third IL1 injection, just before the animals were sacrificed. The animal weights were measured before the first injection, four hours after the second injection and 24 hours after the third IL1 injection, just before the animals were sacrificed. After sacrifice the calvaria were removed and processed for paraffin sectioning.
Histological Methods
[0281]Calvarial bone samples were fixed in zinc formalin, decalcified in formic acid, dehydrated through ethanol and mounted in paraffin. Sections (5 μm thick) were cut through the calvaria adjacent to the lambdoid suture and stained with either hematoxylin and eosin or reacted for tartrate resistant acid phosphatase activity (Sigma Kit #387A) and counterstained with hematoxylin. Bone resorption was assessed in the IL1-α treated mice by histomorphometric methods using the Osteomeasure (Osteometrics, Atlanta, Ga.) by tracing histologic features onto a digitizor platen using a microscope-mounted camera lucida attachment. Osteoclast numbers, osteoclast lined surfaces, and eroded surfaces were determined in the marrow spaces of the calvarial bone. The injected and non-injected sides of the calvaria were measured separately.
Results
[0282]IL1-α and IL1-β produced hypercalcemia at the doses used, particularly on the second day, presumably by the induction of increased bone resorption systemically. The hypercalcemic response was blocked by muOPG [22-401]-Fc in the IL1-beta treated mice and significantly diminished in mice treated with IL1-alpha, an effect most apparent on day 2 (FIG. 22A-22B).
[0283]Histologic analysis of the calvariae of mice treated with IL1-alpha and beta shows that IL1 treatments alone produce a marked increase in the indices of bone resorption including: osteoclast number, osteoclast lined surface, and eroded surface (surfaces showing deep scalloping due to osteoclastic action (FIG. 23B, Table 2). In response to IL1-α or IL1-β, the increases in bone resorption were similar on the injected and non-injected sides of the calvaria. Muopg [22-401]-Fc injections reduced bone resorption in both IL1-alpha and beta treated mice and in mice receiving vehicle alone but this reduction was seen only on the muopg [22-401]-Fc injected sides of the calvariae.
[0284]The most likely explanation for these observations is that muOPG [22-401]-Fc inhibited bone resorption, a conclusion supported by the reduction of both the total osteoclast number and the percentage of available bone surface undergoing bone resorption, in the region of the calvaria adjacent to the muOPG [22-401]-Fc injection sites. The actions of muOPG [22-401]-Fc appeared to be most marked locally by histology, but the fact that muOPG [22-401]-Fc also blunted IL1-induced hypercalcemia suggests that muOPG [22-401]-Fc has more subtle effects on bone resorption systemically.
TABLE-US-00065 TABLE 2 Effects of OPG on variables of bone resorption in IL-1 injected mice. Osteoclast Surface % Osteoclast Number/mm2 Bone Surface (mean ± Eroded Surface % Bone Tissue Area (mean ± S.D) Surface (mean ± S.D) S.D) Non- Non- Non- injected Injected injected Injected injected Injected side side side side side side Experiment 1 Control 12.36 ± 3.44 9.54 ± 2.46 8.07 ± 3.90 9.75 ± 3.16 32.51 ± 11.09 23.50 ± 10.83 IL1-β 17.18 ± 1.30 16.40 ± 2.16 40.66 ± 4.28 37.53 ± 10.28 71.80 ± 18.76 60.89 ± 5.16 (2.5 μg/d) OPG 10.12 ± 3.71 5.04 ± 1.66 9.73 ± 4.33 4.19 ± 3.61 32.73 ± 11.09 15.24 ± 7.54 (40 μg/d) OPG + IL1-β 18.61 ± 2.46 #13.26 ± 2.50 44.87 ± 8.63 #25.94 ± 6.82 69.42 ± 36.29 #47.13 ± 24.26 Experiment 2 Control 11.56 ± 4.22 11.95 ± 2.97 12.67 ± 5.04 10.03 ± 5.13 51.72 ± 23.93 56.03 ± 30.70 IL1-α 28.81 ± 4.84 23.46 ± 5.76 37.51 ± 5.16 41.10 ± 12.53 113.60 ± 18.04 102.70 ± 32.09 (5 μg/d) OPG 14.40 ± 1.00 #4.26 ± 2.54 11.55 ± 4.14 #4.29 ± 3.16 72.28 ± 14.11 #22.65 ± 16.68 (40 μg/d) OPG + IL1-α 29.58 ± 8.80 #17.83 ± 3.34 33.66 ± 9.21 #24.38 ± 8.88 146.10 ± 42.37 #66.56 ± 15.62 #Different to non-injected side p < 0.05 (by paired t test)
C. Systemic Effects of muOPG [22-401]-Fc in Growing Mice
[0285]Male BDF1 mice aged 3-4 weeks, weight range 9.2-15.7 g were divided into groups of ten mice per group. These mice were injected subcutaneously with saline or muOPG [22-401]-Fc 2.5 mg/kg bid for 14 days (5 mg/kg/day). The mice were radiographed before treatment, at day 7 and on day 14. The mice were sacrificed 24 hours after the final injection. The right femur was removed, fixed in zinc formalin, decalcified in formic acid and embedded in paraffin. Sections were cut through the mid region of the distal femoral metaphysis and the femoral shaft. Bone density, by histomorphometry, was determined in six adjacent regions extending from the metaphyseal limit of the growth plate, through the primary and secondary spongiosa and into the femoral diaphysis (shaft). Each region was 0.5×0.5 mm2.
Radiographic Changes
[0286]After seven days of treatment there was evidence of a zone of increased bone density in the spongiosa associated with the growth plates in the OPG treated mice relative to that seen in the controls. The effects were particularly striking in the distal femoral and the proximal tibial metaphases (FIG. 24A-24B). However bands of increased density were also apparent in the vertebral bodies, the iliac crest and the distal tibia. At 14 days, the regions of opacity had extended further into the femoral and tibial shafts though the intensity of the radio-opacity was diminished. Additionally, there were no differences in the length of the femurs at the completion of the experiment or in the change in length over the duration of the experiment implying that OPG does not alter bone growth.
Histological Changes
[0287]The distal femoral metaphysis showed increased bone density in a regions 1.1 to 2.65 mm in distance from the growth plate (FIGS. 25 and 26A-26B). This is a region where bone is rapidly removed by osteoclast-mediated bone resorption in mice. In these rapidly growing young mice, the increase in bone in this region observed with OPG treatment is consistent with an inhibition of bone resorption.
D. Effects of Osteoprotegerin on Bone Loss Induced by Ovariectomy in the Rat
[0288]Twelve week old female Fisher rats were ovariectomized (OVX) or sham operated and dual xray absorptiometry (DEXA) measurements made of the bone density in the distal femoral metaphysis. After 3 days recovery period, the animals received daily injections for 14 days as follows: Ten sham operated animals received vehicle (phosphate buffered saline); Ten OVX animals received vehicle (phosphate buffered saline); Six OVX animals received OPG-Fc 5 mg/kg SC; Six OVX animals received pamidronate (PAM) 5 mg/kg SC; Six OVX animals received estrogen (ESTR) 40 ug/kg SC. After 7 and 14 days treatment the animals had bone density measured by DEXA. Two days after the last injection the animals were killed and the right tibia and femur removed for histological evaluation.
[0289]The DEXA measurements of bone density showed a trend to reduction in the bone density following ovariectomy that was blocked by OPG-Fc. Its effects were similar to the known antiresorptive agents estrogen and pamidronate. (FIG. 27). The histomorphometric analysis confirmed these observations with OPG-Fc treatment producing a bone density that was significantly higher in OVX rats than that seen in untreated OVX rats (FIG. 28). These results confirm the activity of OPG in the bone loss associated with withdrawal of endogenous estrogen following ovariectomy.
In vivo Summary
[0290]The in vivo actions of recombinant OPG parallel the changes seen in OPG transgenic mice. The reduction in osteoclast number seen in the OPG transgenic is reproduced by injecting recombinant OPG locally over the calvaria in both normal mice and in mice treated with IL1-α or IL1-β. The OPG transgenic mice develop an osteopetrotic phenotype with progressive filling of the marrow cavity with bone and unremodelled cartilage extending from the growth plates from day 1 onward after birth. In normal three week old (growing) mice, OPG treatments also led to retention of bone and unremodelled cartilage in regions of endochondral bone formation, an effect observed radiographically and confirmed histologically. Thus, recombinant OPG produces phenotypic changes in normal animals similar to those seen in the transgenic animals and the changes are consistent with OPG-induced inhibition of bone resorption. Based on in vitro assays of osteoclast formation, a significant portion of this inhibition is due to impaired osteoclast formation. Consistent with this hypothesis, OPG blocks ovariectomy-induced osteoporosis in rat. Bone loss in this model is known to be mediated by activated osteoclasts, suggesting a role for OPG in treatment of primary osteoporosis.
Example 12
Pegylation Derivatives of OPG
Preparation of N-Terminal PEG-OPG Conjugates by Reductive Alkylation
[0291]HuOPG met [22-194] P25A was buffer exchanged into 25-50 mM NaOAc, pH 4.5-4.8 and concentrated to 2-5 mg/ml. This solution was used to conduct OPG reductive alkylation with monofunctional PEG aldehydes at 5-7° C. PEG monofunctional aldehydes, linear or branched, MW=1 to 57 kDa (available from Shearwater Polymers) were added to the OPG solution as solids in amounts constituting 2-4 moles of PEG aldehyde per mole of OPG. After dissolution of polymer into the protein solution, sodium cyanoborohydride was added to give a final concentration of 15 to 20 mM in the reaction mixture from 1-1.6 M freshly prepared stock solution in cold DI water. The progress of the reaction and the extent of OPG PEGylation was monitored by size exclusion HPLC on a G3000SWXL column (Toso Haas) eluting with 100 mM NaPO4, 0.5 M NaCl, 10% ethanol, pH 6.9. Typically the reaction was allowed to proceed for 16-18 hours, after which the reaction mixture was diluted 6-8 times and the pH lowered to 3.5-4. The reaction mixture was fractionated by ion exchange chromatography (HP SP HiLoad 16/10, Pharmacia) eluting with 20 mM NaOAc pH 4 with a linear gradient to 0.75M NaCl over 25 column volumes at a flow rate of 30 cm/h. Fractions of mono-, di- or poly-PEGylated OPG were pooled and characterized by SEC HPLC and SDS-PAGE. By N-terminal sequencing, it was determined that the monoPEG-OPG conjugate, the major reaction product in most cases, was 98% N-terminally PEG-modified OPG.
[0292]This procedure was generally used to prepare the following N-terminal PEG-OPG conjugates (where OPG is HuOPG met [22-194] P25A: 5 kD monoPEG, 10 kD mono branched PEG, 12 kD monoPEG, 20 kD monoPEG, 20 kD mono branched PEG, 25 kD monoPEG, 31 kD monoPEG, 57 kD monoPEG, 12 kD diPEG, 25 kD diPEG, 31 kD diPEG, 57 kD diPEG, 25 kD triPEG.
Preparation of PEG-OPG Conjugates by Acylation
[0293]HuOPG met [22-194] P25A was buffer exchanged into 50 mM BICINE buffer, pH 8 and concentrated to 2-3 mg/ml. This solution was used to conduct OPG acylation with monofunctional PEG N-hydroxysuccinimidyl esters at room temperature. PEG N-hydroxysuccinimidyl esters, linear or branched, MW=1 to 57 kDa (available from Shearwater Polymers) were added to the OPG solution as solids in amounts constituting 4-8 moles of PEG N-hydroxysuccinimidyl ester per mole of OPG. The progress of the reaction and the extent of OPG PEGylation was monitored by size exclusion HPLC on a G3000SWXL column (Toso Haas) eluting with 100 mM NaPO4, 0.5 M NaCl, 10% ethanol, pH 6.9. Typically the reaction was allowed to proceed for 1 hour, after which the reaction mixture was diluted 6-8 times and the pH lowered to 3.5-4. The reaction mixture was fractionated by ion exchange chromatography (HP SP HiLoad 16/10, Pharmacia) eluting with 20 mM NaOAc pH 4 with a linear gradient to 0.75M NaCl over 25 column volumes at a flow rate of 30 cm/h. Fractions of mono-, di- or poly- PEGylated OPG were pooled and characterized by SEC HPLC and SDS-PAGE.
[0294]This procedure was generally used to prepare the following PEG-OPG conjugates: 5 kD polyPEG, 20 kD polyPEG, 40 kD poly branched PEG, 50 kD poly PEG.
Preparation of Dimeric PEG-OPG
[0295]HuOPG met [22-194] P25A is prepared for thiolation at 1-3 mg/ml in a phosphate buffer at near neutral pH. S-acetyl mecaptosuccinic anhydride (AMSA) is added in a 3-7 fold molar excess while maintaining pH at 7.0 and the rxn stirred at 4° C. for 2 hrs. The monothiolated-OPG is separated from unmodified and polythiolated OPG by ion exchange chromatography and the protected thiol deprotected by treatment with hydroxylamine. After deprotection, the hydroxylamine is removed by gel filtration and the resultant monothiolated-OPG is subjected to a variety of thiol specific crosslinking chemistries. To generate a disulfide bonded dimer, the thiolated OPG at >1 mg/ml is allowed to undergo air oxidation by dialysis in slightly basic phosphate buffer. The covalent thioether OPG dimer was prepared by reacting the bis-maleimide crosslinker, N,N-bis(3-maleimido propianyl)-2-hydroxy 1,3 propane with the thiolated OPG at >1 mg/ml at a 0.6× molar ratio of crosslinker:OPG in phosphate buffer at pH 6.5. Similarly, the PEG dumbbells are produced by reaction of substoichiometric amounts of bis-maleimide PEG crosslinkers with thiolated OPG at >1 mg/ml in phosphate buffer at pH 6.5. Any of the above dimeric conjugates may be further purified using either ion exchange or size exclusion chromatographies.
[0296]Dimeric PEG-OPG conjugates (where OPG is HuOPG met [22-194] P25A prepared using the above procedures include disulfide-bonded OPG dimer, covalent thioether OPG dimer with an aliphatic amine type crosslinker, 3.4 kD and 8kD PEG dumbbells and monobells.
[0297]PEG-OPG conjugates were tested for activity in vitro using the osteoclast maturation assay described in Example 11A and for activity in vivo by measuring increased bone density after injection into mice as described in Example 11C. The in vivo activity is shown below in Table 3.
TABLE-US-00066 TABLE 3 In vivo biological activity of Pegylated OPG Increase in OPG Construct Tibial Bone Density muOPG met [22-194] - muOPG met [22-194] 5k PEG + muOPG met [22-194] 20k PEG + huOPG met [22-194] P25A - huOPG met [22-194] P25A 5k PEG + huOPG met [22-194] P25A 20k PEG + huOPG met [22-194] P25A 31k PEG + huOPG met [22-194] P25A 57k PEG + huOPG met [22-194] P25A 12k PEG + huOPG met [22-194] P25A 20k Branched PEG + huOPG met [22-194] P25A 8k PEG dimer + huOPG met [22-194] P25A disulfide crosslink +
[0298]While the invention has been described in what is considered to be its preferred embodiments, it is not to be limited to the disclosed embodiments, but on the contrary, is intended to cover various modifications and equivalents included within the spirit and scope of the appended claims, which scope is to be accorded the broadest interpretation so as to encompass all such modifications and equivalents.
Sequence CWU
1
179136DNAArtificial sequenceSynthetic oligonucleotide 1aaaggaagga
aaaaagcggc cgctacannn nnnnnt
36216DNAArtificial sequenceSynthetic oligonucleotide 2tcgacccacg cgtccg
16312DNAArtificial
sequenceSynthetic oligonucleotide 3gggtgcgcag gc
12418DNAArtificial sequenceSynthetic
oligonucleotide 4tgtaaaacga cggccagt
18518DNAArtificial sequenceSynthetic oligonucleotide
5caggaaacag ctatgacc
18620DNAArtificial sequenceSynthetic oligonucleotide 6caattaaccc
tcactaaagg
20723DNAArtificial sequenceSynthetic oligonucleotide 7gcattatgac
ccagaaaccg gac
23823DNAArtificial sequenceSynthetic oligonucleotide 8aggtagcgcc
cttcctcaca ttc
23930DNAArtificial sequenceSynthetic oligonucleotide 9gactagtccc
acaatgaaca agtggctgtg
301045DNAArtificial sequenceSynthetic oligonucleotide 10ataagaatgc
ggccgctaaa ctatgaaaca gcccagtgac cattc
451121DNAArtificial sequenceSynthetic oligonucleotide 11gcctctagaa
agagctggga c
211221DNAArtificial sequenceSynthetic oligonucleotide 12cgccgtgttc
catttatgag c
211324DNAArtificial sequenceSynthetic oligonucleotide 13atcaaaggca
gggcatactt cctg
241424DNAArtificial sequenceSynthetic oligonucleotide 14gttgcactcc
tgtttcacgg tctg
241524DNAArtificial sequenceSynthetic oligonucleotide 15caagacacct
tgaagggcct gatg
241624DNAArtificial sequenceSynthetic oligonucleotide 16taacttttac
agaagagcat cagc
241733DNAArtificial sequenceSynthetic oligonucleotide 17agcgcggccg
catgaacaag tggctgtgct gcg
331831DNAArtificial sequenceSynthetic oligonucleotide 18agctctagag
aaacagccca gtgaccattc c
311924DNAArtificial sequenceSynthetic oligonucleotide 19gtgaagctgt
gcaagaacct gatg
242024DNAArtificial sequenceSynthetic oligonucleotide 20atcaaaggca
gggcatactt cctg
242124DNAArtificial sequenceSynthetic oligonucleotide 21cagatcctga
agctgctcag tttg
242233DNAArtificial sequenceSynthetic oligonucleotide 22agcgcggccg
cggggaccac aatgaacaag ttg
332333DNAArtificial sequenceSynthetic oligonucleotide 23agctctagaa
ttgtgaggaa acagctcaat ggc
332439DNAArtificial sequenceSynthetic oligonucleotide 24atagcggccg
ctgagcccaa atcttgtgac aaaactcac
392545DNAArtificial sequenceSynthetic oligonucleotide 25tctagagtcg
acttatcatt tacccggaga cagggagagg ctctt
452638DNAArtificial sequenceSynthetic oligonucleotide 26cctctgagct
caagcttccg aggaccacaa tgaacaag
382743DNAArtificial sequenceSynthetic oligonucleotide 27cctctgcggc
cgctaagcag cttattttca cggattgaac ctg
432838DNAArtificial sequenceSynthetic oligonucleotide 28cctctgagct
caagcttccg aggaccacaa tgaacaag
382924DNAArtificial sequenceSynthetic oligonucleotide 29tccgtaagaa
acagcccagt gacc
243031DNAArtificial sequenceSynthetic oligonucleotide 30cctctgcggc
cgctgttgca tttcctttct g
313119PRTArtificial sequenceSynthetic 31Glu Thr Leu Pro Pro Lys Tyr Leu
His Tyr Asp Pro Glu Thr Gly His1 5 10
15Gln Leu Leu3221DNAArtificial sequenceSynthetic
oligonucleotide 32tcccttgccc tgaccactct t
213334DNAArtificial sequenceSynthetic oligonucleotide
33cctctgcggc cgcacacacg ttgtcatgtg ttgc
343421DNAArtificial sequenceSynthetic oligonucleotide 34tcccttgccc
tgaccactct t
213534DNAArtificial sequenceSynthetic oligonucleotide 35cctctgcggc
cgccttttgc gtggcttctc tgtt
343637DNAArtificial sequenceSynthetic oligonucleotide 36cctctgagct
caagcttggt ttccggggac cacaatg
373738DNAArtificial sequenceSynthetic oligonucleotide 37cctctgcggc
cgctaagcag cttattttta ctgaatgg
383837DNAArtificial sequenceSynthetic oligonucleotide 38cctctgagct
caagcttggt ttccggggac cacaatg
373933DNAArtificial sequenceSynthetic oligonucleotide 39cctctgcggc
cgccagggta acatctattc cac
334035DNAArtificial sequenceSynthetic oligonucleotide 40ccgaagcttc
caccatgaac aagtggctgt gctgc
354140DNAArtificial sequenceSynthetic oligonucleotide 41cctctgtcga
ctattataag cagcttattt tcacggattg
404221DNAArtificial sequenceSynthetic oligonucleotide 42tcccttgccc
tgaccactct t
214335DNAArtificial sequenceSynthetic oligonucleotide 43cctctgtcga
cttaacacac gttgtcatgt gttgc
354421DNAArtificial sequenceSynthetic oligonucleotide 44tcccttgccc
tgaccactct t
214535DNAArtificial sequenceSynthetic oligonucleotide 45cctctgtcga
cttacttttg cgtggcttct ctgtt
35461537DNAEscherichia coli 46gtgaagagcg tgaagagcgg ttcctccttt cagcaaaaaa
cccctcaaga cccgtttaga 60ggccccaagg ggttatgcta gttattgctc agcggtggca
gcagccaact cagcttcctt 120tcgggctttc ttcttcttct tcttctttcc gcggatcctc
gagtaagctt ccatggtacc 180ctgcaggtcg acactagtga gctcgaattc caacgcgtta
accatatgtt attcctcctt 240taattagtta aaacaaatct agaatcaaat cgattaatcg
actataacaa accattttct 300tgcgtaaacc tgtacgatcc tacaggtact tatgttaaac
aattgtattt caagcgatat 360aatagtgtga caaaaatcca atttattaga atcaaatgtc
aatctattac cgttttaatg 420atatataaca cgcaaaactt gcgacaaaca ataggtaagg
ataaagagat gggtatgaaa 480gacataaatg ccgacgacac ttacagaata attaataaaa
ttaaagcctg tagaagcaat 540aatgatatta atcaatgctt atctgatatg actaaaatgg
tacattgtga atattattta 600ctcgcgatca tttatcctca ttctatggtt aaatctgata
tttcaattct ggataattac 660cctaaaaaat ggaggcaata ttatgatgac gctaatttaa
taaaatatga tcctatagta 720gattattcta actccaatca ttcaccgatt aattggaata
tatttgaaaa caatgctgta 780aataaaaaat ctccaaatgt aattaaagaa gcgaaatcat
caggtcttat cactgggttt 840agtttcccta ttcatactgc taataatggc ttcggaatgc
ttagttttgc acattcagag 900aaagacaact atatagatag tttattttta catgcgtgta
tgaacatacc attaattgtt 960ccttctctag ttgataatta tcgaaaaata aatatagcaa
ataataaatc aaacaacgat 1020ttaaccaaaa gagaaaaaga atgtttagcg tgggcatgcg
aaggaaaaag ctcttgggat 1080atttcaaaaa tattaggctg tagtaagcgc acggtcactt
tccatttaac caatgcgcaa 1140atgaaactca atacaacaaa ccgctgccaa agtatttcta
aagcaatttt aacaggagca 1200attgattgcc catactttaa aagttaagta cgacgtccat
atttgaatgt atttagaaaa 1260ataaacaaaa gagtttgtag aaacgcaaaa aggccatccg
tcaggatggc cttctgctta 1320atttgatgcc tggcagttta tggcgggcgt cctgcccgcc
accctccggg ccgttgcttc 1380gcaacgttca aatccgctcc cggcggattt gtcctactca
ggagagcgtt caccgacaaa 1440caacagataa aacgaaaggc ccagtctttc gactgagcct
ttcgttttat ttgatgcctg 1500gcagttccct actctcgcat ggggagacca tgcatac
15374748DNAArtificial sequenceSynthetic
oligonucleotide 47ccggcggaca tttatcacac agcagctgat gagaagtttc ttcatcca
484855DNAArtificial sequenceSynthetic oligonucleotide
48cgatttgatt ctagaaggag gaataacata tggttaacgc gttggaattc ggtac
554949DNAArtificial sequenceSynthetic oligonucleotide 49cgaattccaa
cgcgttaacc atatgttatt cctccttcta gaatcaaat
49501546DNAEscherichia coli 50gcgtaacgta tgcatggtct ccccatgcga gagtagggaa
ctgccaggca tcaaataaaa 60cgaaaggctc agtcgaaaga ctgggccttt cgttttatct
gttgtttgtc ggtgaacgct 120ctcctgagta ggacaaatcc gccgggagcg gatttgaacg
ttgcgaagca acggcccgga 180gggtggcggg caggacgccc gccataaact gccaggcatc
aaattaagca gaaggccatc 240ctgacggatg gcctttttgc gtttctacaa actcttttgt
ttatttttct aaatacattc 300aaatatggac gtcgtactta acttttaaag tatgggcaat
caattgctcc tgttaaaatt 360gctttagaaa tactttggca gcggtttgtt gtattgagtt
tcatttgcgc attggttaaa 420tggaaagtga ccgtgcgctt actacagcct aatatttttg
aaatatccca agagcttttt 480ccttcgcatg cccacgctaa acattctttt tctcttttgg
ttaaatcgtt gtttgattta 540ttatttgcta tatttatttt tcgataatta tcaactagag
aaggaacaat taatggtatg 600ttcatacacg catgtaaaaa taaactatct atatagttgt
ctttctctga atgtgcaaaa 660ctaagcattc cgaagccatt attagcagta tgaataggga
aactaaaccc agtgataaga 720cctgatgatt tcgcttcttt aattacattt ggagattttt
tatttacagc attgttttca 780aatatattcc aattaatcgg tgaatgattg gagttagaat
aatctactat aggatcatat 840tttattaaat tagcgtcatc ataatattgc ctccattttt
tagggtaatt atccagaatt 900gaaatatcag atttaaccat agaatgagga taaatgatcg
cgagtaaata atattcacaa 960tgtaccattt tagtcatatc agataagcat tgattaatat
cattattgct tctacaggct 1020ttaattttat taattattct gtaagtgtcg tcggcattta
tgtctttcat acccatctct 1080ttatccttac ctattgtttg tcgcaagttt tgcgtgttat
atatcattaa aacggtaata 1140gattgacatt tgattctaat aaattggatt tttgtcacac
tattatatcg cttgaaatac 1200aattgtttaa cataagtacc tgtaggatcg tacaggttta
cgcaagaaaa tggtttgtta 1260tagtcgatta atcgatttga ttctagattt gttttaacta
attaaaggag gaataacata 1320tggttaacgc gttggaattc gagctcacta gtgtcgacct
gcagggtacc atggaagctt 1380actcgaggat ccgcggaaag aagaagaaga agaagaaagc
ccgaaaggaa gctgagttgg 1440ctgctgccac cgctgagcaa taactagcat aaccccttgg
ggcctctaaa cgggtcttga 1500ggggtttttt gctgaaagga ggaaccgctc ttcacgctct
tcacgc 15465147DNAArtificial sequenceSynthetic
oligonucleotide 51tatgaaacat catcaccatc accatcatgc tagcgttaac gcgttgg
475249DNAArtificial sequenceSynthetic oligonucleotide
52aattccaacg cgttaacgct agcatgatgg tgatggtgat gatgtttca
4953141DNAArtificial sequenceSynthetic oligonucleotide 53ctaattccgc
tctcacctac caaacaatgc ccccctgcaa aaaataaatt catataaaaa 60acatacagat
aaccatctgc ggtgataaat tatctctggc ggtgttgaca taaataccac 120tggcggtgat
actgagcaca t
14154147DNAArtificial sequenceSynthetic oligonucleotide 54cgatgtgctc
agtatcaccg ccagtggtat ttatgtcaac accgccagag ataatttatc 60accgcagatg
gttatctgta tgttttttat atgaatttat tttttgcagg ggggcattgt 120ttggtaggtg
agagcggaat tagacgt
1475555DNAArtificial sequenceSynthetic oligonucleotide 55cgatttgatt
ctagaaggag gaataacata tggttaacgc gttggaattc ggtac
555649DNAArtificial sequenceSynthetic oligonucleotide 56cgaattccaa
cgcgttaacc atatgttatt cctccttcta gaatcaaat
4957668DNAEscherichia coli 57gtgaagagcg tgaagagcgg ttcctccttt cagcaaaaaa
cccctcaaga cccgtttaga 60ggccccaagg ggttatgcta gttattgctc agcggtggca
gcagccaact cagcttcctt 120tcgggctttc ttcttcttct tcttctttcc gcggatcctc
gagtaagctt ccatggtacc 180ctgcaggtcg acactagtga gctcgaattc caacgcgtta
accatatgtt attcctcctt 240taattagtta actcaaatct agaatcaaat cgataaattg
tgagcgctca caattgagaa 300tattaatcaa gaattttagc atttgtcaaa tgaatttttt
aaaaattatg agacgtccat 360atttgaatgt atttagaaaa ataaacaaaa gagtttgtag
aaacgcaaaa aggccatccg 420tcaggatggc cttctgctta atttgatgcc tggcagttta
tggcgggcgt cctgcccgcc 480accctccggg ccgttgcttc gcaacgttca aatccgctcc
cggcggattt gtcctactca 540ggagagcgtt caccgacaaa caacagataa aacgaaaggc
ccagtctttc gactgagcct 600ttcgttttat ttgatgcctg gcagttccct actctcgcat
ggggagacca tgcatacgtt 660acgcacgt
66858726DNAEscherichia coli 58gcgtaacgta
tgcatggtct ccccatgcga gagtagggaa ctgccaggca tcaaataaaa 60cgaaaggctc
agtcgaaaga ctgggccttt cgttttatct gttgtttgtc ggtgaacgct 120ctcctgagta
ggacaaatcc gccgggagcg gatttgaacg ttgcgaagca acggcccgga 180gggtggcggg
caggacgccc gccataaact gccaggcatc aaattaagca gaaggggcct 240cccaccgccc
gtcctgcggg cggtatttga cggtccgtag tttaattcgt cttcgccatc 300ctgacggatg
gcctttttgc gtttctacaa actcttttgt ttatttttct aaatacattc 360aaatatggac
gtctcataat ttttaaaaaa ttcatttgac aaatgctaaa attcttgatt 420aatattctca
attgtgagcg ctcacaattt atcgatttga ttctagattt gttttaacta 480attaaaggag
gaataacata tggttaacgc gttggaattc gagctcacta gtgtcgacct 540gcagggtacc
atggaagctt actcgaggat ccgcggaaag aagaagaaga agaagaaagc 600ccgaaaggaa
gctgagttgg ctgctgccac cgctgagcaa taactagcat aaccccttgg 660ggcctctaaa
cgggtcttga ggggtttttt gctgaaagga ggaaccgctc ttcacgctct 720tcacgc
7265944DNAArtificial sequenceSynthetic oligonucleotide 59tacgcactgg
atccttataa gcagcttatt tttactgatt ggac
446027DNAArtificial sequenceSynthetic oligonucleotide 60gtcctcctgg
tacctaccta aaacaac
2761102DNAArtificial sequenceSynthetic oligonucleotide 61tatggatgaa
gaaacttctc atcagctgct gtgtgataaa tgtccgccgg gtacccggcg 60gacatttatc
acacagcagc tgatgagaag tttcttcatc ca
1026219PRTArtificial sequenceSynthetic 62Met Asp Glu Glu Thr Ser His Gln
Leu Leu Cys Asp Lys Cys Pro Pro1 5 10
15Gly Thr Tyr6384DNAArtificial sequenceSynthetic
oligonucleotide 63tatggaaact tttcctccaa aatatcttca ttatgatgaa gaaacttctc
atcagctgct 60gtgtgataaa tgtccgccgg gtac
846478DNAArtificial sequenceSynthetic oligonucleotide
64ccggcggaca tttatcacac agcagctgat gagaagtttc ttcatcataa tgaagatatt
60ttggaggaaa agtttcca
786544DNAArtificial sequenceSynthetic oligonucleotide 65tacgcactgg
atccttataa gcagcttatt ttcacggatt gaac
446638DNAArtificial sequenceSynthetic oligonucleotide 66gtgctcctgg
tacctaccta aaacagcact gcacagtg
386784DNAArtificial sequenceSynthetic oligonucleotide 67tatggaaact
ctgcctccaa aatacctgca ttacgatccg gaaactggtc atcagctgct 60gtgtgataaa
tgtgctccgg gtac
846878DNAArtificial sequenceSynthetic oligonucleotide 68ccggagcaca
tttatcacac agcagctgat gaccagtttc cggatcgtaa tgcaggtatt 60ttggaggcag
agtttcca
786954DNAArtificial sequenceSynthetic oligonucleotide 69tatggaccca
gaaactggtc atcagctgct gtgtgataaa tgtgctccgg gtac
547048DNAArtificial sequenceSynthetic oligonucleotide 70ccggagcaca
tttatcacac agcagctgat gaccagtttc tgggtcca
487187DNAArtificial sequenceSynthetic oligonucleotide 71tatgaaagaa
actctgcctc caaaatacct gcattacgat ccggaaactg gtcatcagct 60gctgtgtgat
aaatgtgctc cgggtac
877281DNAArtificial sequenceSynthetic oligonucleotide 72ccggagcaca
tttatcacac agcagctgat gaccagtttc cggatcgtaa tgcaggtatt 60ttggaggcag
agtttctttc a
817371DNAArtificial sequenceSynthetic oligonucleotide 73gttctcctca
tatgaaacat catcaccatc accatcatga aactctgcct ccaaaatacc 60tgcattacga t
717443DNAArtificial sequenceSynthetic oligonucleotide 74gttctcctca
tatgaaagaa actctgcctc caaaatacct gca
437576DNAArtificial sequenceSynthetic oligonucleotide 75tacgcactgg
atccttaatg atggtgatgg tgatgatgta agcagcttat tttcacggat 60tgaacctgat
tcccta
767647DNAArtificial sequenceSynthetic oligonucleotide 76gttctcctca
tatgaaatac ctgcattacg atccggaaac tggtcat
477743DNAArtificial sequenceSynthetic oligonucleotide 77gttctcctat
taatgaaata tcttcattat gatgaagaaa ctt
437840DNAArtificial sequenceSynthetic oligonucleotide 78tacgcactgg
atccttataa gcagcttatt tttactgatt
407940DNAArtificial sequenceSynthetic oligonucleotide 79gttctcctca
tatggaaact ctgcctccaa aatacctgca
408043DNAArtificial sequenceSynthetic oligonucleotide 80tacgcactgg
atccttatgt tgcatttcct ttctgaatta gca
438118DNAArtificial sequenceSynthetic oligonucleotide 81ccggaaacag
ataatgag
188218DNAArtificial sequenceSynthetic oligonucleotide 82gatcctcatt
atctgttt
188330DNAArtificial sequenceSynthetic oligonucleotide 83ccggaaacag
agaagccacg caaaagtaag
308430DNAArtificial sequenceSynthetic oligonucleotide 84gatccttact
tttgcgtggc ttctctgttt
308512DNAArtificial sequenceSynthetic oligonucleotide 85tatgttaatg ag
128614DNAArtificial
sequenceSynthetic oligonucleotide 86gatcctcatt aaca
148721DNAArtificial sequenceSynthetic
oligonucleotide 87tatgttccgg aaacagttaa g
218823DNAArtificial sequenceSynthetic oligonucleotide
88gatccttaac tgtttccgga aca
238936DNAArtificial sequenceSynthetic oligonucleotide 89tatgttccgg
aaacagtgaa tcaactcaaa aataag
369038DNAArtificial sequenceSynthetic oligonucleotide 90gatccttatt
tttgagttga ttcactgttt ccggaaca
3891100DNAArtificial sequenceSynthetic oligonucleotide 91ctagcgacga
cgacgacaaa gaaactctgc ctccaaaata cctgcattac gatccggaaa 60ctggtcatca
gctgctgtgt gataaatgtg ctccgggtac
1009292DNAArtificial sequenceSynthetic oligonucleotide 92ccggagcaca
tttatcacac agcagctgat gaccagtttc cggatcgtaa tgcaggtatt 60ttggaggcag
agtttctttg tcgtcgtcgt cg
929326DNAArtificial sequenceSynthetic oligonucleotide 93acaaacacaa
tcgatttgat actaga
269450DNAArtificial sequenceSynthetic oligonucleotide 94tttgttttaa
ctaattaaag gaggaataaa atatgagagg atcgcatcac
509550DNAArtificial sequenceSynthetic oligonucleotide 95catcaccatc
acgaaacctt cccgccgaaa tacctgcact acgacgaaga
509649DNAArtificial sequenceSynthetic oligonucleotide 96aacctcccac
cagctgctgt gcgacaaatg cccgccgggt acccaaaca
499726DNAArtificial sequenceSynthetic oligonucleotide 97tgtttgggta
cccggcgggc atttgt
269850DNAArtificial sequenceSynthetic oligonucleotide 98cgcacagcag
ctggtgggag gtttcttcgt cgtagtgcag gtatttcggc
509949DNAArtificial sequenceSynthetic oligonucleotide 99gggaaggttt
cgtgatggtg atggtgatgc gatcctctca tattttatt
4910050DNAArtificial sequenceSynthetic oligonucleotide 100cctcctttaa
ttagttaaaa caaatctagt atcaaatcga ttgtgtttgt
5010159DNAArtificial sequenceSynthetic oligonucleotide 101acaaacacaa
tcgatttgat actagatttg ttttaactaa ttaaaggagg aataaaatg
5910248DNAArtificial sequenceSynthetic oligonucleotide 102ctaattaaag
gaggaataaa atgaaagaaa cttttcctcc aaaatatc
4810331DNAArtificial sequenceSynthetic oligonucleotide 103tgtttgggta
cccggcggac atttatcaca c
3110459DNAArtificial sequenceSynthetic oligonucleotide 104acaaacacaa
tcgatttgat actagatttg ttttaactaa ttaaaggagg aataaaatg
5910554DNAArtificial sequenceSynthetic oligonucleotide 105ctaattaaag
gaggaataaa atgaaaaaaa aagaaacttt tcctccaaaa tatc
5410631DNAArtificial sequenceSynthetic oligonucleotide 106tgtttgggta
cccggcggac atttatcaca c
3110744DNAArtificial sequenceSynthetic oligonucleotide 107cagcccgggt
aaaatggaaa cgtttcctcc aaaatatctt catt
4410844DNAArtificial sequenceSynthetic oligonucleotide 108cgtttccatt
ttacccgggc tgagcgagag gctcttctgc gtgt
4410945DNAArtificial sequenceSynthetic oligonucleotide 109cgctcagccc
gggtaaaatg gaaacgttgc ctccaaaata cctgc
4511039DNAArtificial sequenceSynthetic oligonucleotide 110ccattttacc
cgggctgagc gagaggctct tctgcgtgt
3911136DNAArtificial sequenceSynthetic oligonucleotide 111gaaaataagc
tgcttagctg cagctgaacc aaaatc
3611234DNAArtificial sequenceSynthetic oligonucleotide 112cagctgcagc
taagcagctt attttcacgg attg
3411336DNAArtificial sequenceSynthetic oligonucleotide 113aaaaataagc
tgcttagctg cagctgaacc aaaatc
3611435DNAArtificial sequenceSynthetic oligonucleotide 114cagctgcagc
taagcagctt atttttactg attgg
35115102DNAArtificial sequenceSynthetic oligonucleotide 115ctagaaggag
gaataacata tggaaacttt tgctccaaaa tatcttcatt atgatgaaga 60aactagtcat
cagctgctgt gtgataaatg tccgccgggt ac
10211694DNAArtificial sequenceSynthetic oligonucleotide 116ccggcggaca
tttatcacac agcagctgat gactagtttc ttcatcataa tgaagatatt 60ttggagcaaa
agtttccata tgttattcct cctt
9411762DNAArtificial sequenceSynthetic oligonucleotide 117ctagaaggag
gaataacata tggaaacttt tcctgctaaa tatcttcatt atgatgaaga 60aa
6211862DNAArtificial sequenceSynthetic oligonucleotide 118ctagtttctt
catcataatg aagatattta gcaggaaaag tttccatatg ttattcctcc 60tt
6211951PRTArtificial sequenceSynthetic 119Tyr His Tyr Tyr Asp Gln Asn Gly
Arg Met Cys Glu Glu Cys His Met1 5 10
15Cys Gln Pro Gly His Phe Leu Val Lys His Cys Lys Gln Pro
Lys Arg 20 25 30Asp Thr Val
Cys His Lys Pro Cys Glu Pro Gly Val Thr Tyr Thr Asp 35
40 45Asp Trp His 501202432DNARattus
rattusCDS(124)..(1326) 120atcaaaggca gggcatactt cctgttgccc agaccttata
taaaacgtca tgttcgcctg 60ggcagcagag aagcacctag cactggccca gcggctgccg
cctgaggttt ccagaggacc 120aca atg aac aag tgg ctg tgc tgt gca ctc ctg
gtg ttc ttg gac atc 168 Met Asn Lys Trp Leu Cys Cys Ala Leu Leu
Val Phe Leu Asp Ile 1 5 10
15att gaa tgg aca acc cag gaa acc ttt cct cca aaa tac ttg cat tat
216Ile Glu Trp Thr Thr Gln Glu Thr Phe Pro Pro Lys Tyr Leu His Tyr
20 25 30gac cca gaa acc gga
cgt cag ctc ttg tgt gac aaa tgt gct cct ggc 264Asp Pro Glu Thr Gly
Arg Gln Leu Leu Cys Asp Lys Cys Ala Pro Gly 35
40 45acc tac cta aaa cag cac tgc aca gtc agg agg aag
aca ctg tgt gtc 312Thr Tyr Leu Lys Gln His Cys Thr Val Arg Arg Lys
Thr Leu Cys Val 50 55 60cct tgc
cct gac tac tct tat aca gac agc tgg cac acg agt gat gaa 360Pro Cys
Pro Asp Tyr Ser Tyr Thr Asp Ser Trp His Thr Ser Asp Glu 65
70 75tgc gtg tac tgc agc ccc gtg tgc aag gaa ctg
cag acc gtg aaa cag 408Cys Val Tyr Cys Ser Pro Val Cys Lys Glu Leu
Gln Thr Val Lys Gln80 85 90
95gag tgc aac cgc acc cac aac cga gtg tgc gaa tgt gag gaa ggg cgc
456Glu Cys Asn Arg Thr His Asn Arg Val Cys Glu Cys Glu Glu Gly Arg
100 105 110tac ctg gag ctc gaa
ttc tgc ttg aag cac cgg agc tgt ccc cca ggc 504Tyr Leu Glu Leu Glu
Phe Cys Leu Lys His Arg Ser Cys Pro Pro Gly 115
120 125ttg ggt gtg ctg cag gct ggg acc cca gag cga aac
acg gtt tgc aaa 552Leu Gly Val Leu Gln Ala Gly Thr Pro Glu Arg Asn
Thr Val Cys Lys 130 135 140aga tgt
ccg gat ggg ttc ttc tca ggt gag acg tca tcg aaa gca ccc 600Arg Cys
Pro Asp Gly Phe Phe Ser Gly Glu Thr Ser Ser Lys Ala Pro 145
150 155tgt agg aaa cac acc aac tgc agc tca ctt ggc
ctc ctg cta att cag 648Cys Arg Lys His Thr Asn Cys Ser Ser Leu Gly
Leu Leu Leu Ile Gln160 165 170
175aaa gga aat gca aca cat gac aat gta tgt tcc gga aac aga gaa gca
696Lys Gly Asn Ala Thr His Asp Asn Val Cys Ser Gly Asn Arg Glu Ala
180 185 190act caa aat tgt gga
ata gat gtc acc ctg tgc gaa gag gca ttc ttc 744Thr Gln Asn Cys Gly
Ile Asp Val Thr Leu Cys Glu Glu Ala Phe Phe 195
200 205agg ttt gct gtg cct acc aag att ata ccg aat tgg
ctg agt gtt ctg 792Arg Phe Ala Val Pro Thr Lys Ile Ile Pro Asn Trp
Leu Ser Val Leu 210 215 220gtg gac
agt ttg cct ggg acc aaa gtg aat gca gag agt gta gag agg 840Val Asp
Ser Leu Pro Gly Thr Lys Val Asn Ala Glu Ser Val Glu Arg 225
230 235ata aaa cgg aga cac agc tcg caa gag caa act
ttc cag cta ctt aag 888Ile Lys Arg Arg His Ser Ser Gln Glu Gln Thr
Phe Gln Leu Leu Lys240 245 250
255ctg tgg aag cat caa aac aga gac cag gaa atg gtg aag aag atc atc
936Leu Trp Lys His Gln Asn Arg Asp Gln Glu Met Val Lys Lys Ile Ile
260 265 270caa gac att gac ctc
tgt gaa agc agt gtg caa cgg cat atc ggc cac 984Gln Asp Ile Asp Leu
Cys Glu Ser Ser Val Gln Arg His Ile Gly His 275
280 285gcg aac ctc acc aca gag cag ctc cgc atc ttg atg
gag agc ttg cct 1032Ala Asn Leu Thr Thr Glu Gln Leu Arg Ile Leu Met
Glu Ser Leu Pro 290 295 300ggg aag
aag atc agc cca gac gag att gag aga acg aga aag acc tgc 1080Gly Lys
Lys Ile Ser Pro Asp Glu Ile Glu Arg Thr Arg Lys Thr Cys 305
310 315aaa ccc agc gag cag ctc ctg aag cta ctg agc
ttg tgg agg atc aaa 1128Lys Pro Ser Glu Gln Leu Leu Lys Leu Leu Ser
Leu Trp Arg Ile Lys320 325 330
335aat gga gac caa gac acc ttg aag ggc ctg atg tac gca ctc aag cac
1176Asn Gly Asp Gln Asp Thr Leu Lys Gly Leu Met Tyr Ala Leu Lys His
340 345 350ttg aaa gca tac cac
ttt ccc aaa acc gtc acc cac agt ctg agg aag 1224Leu Lys Ala Tyr His
Phe Pro Lys Thr Val Thr His Ser Leu Arg Lys 355
360 365acc atc agg ttc ttg cac agc ttc acc atg tac cga
ttg tat cag aaa 1272Thr Ile Arg Phe Leu His Ser Phe Thr Met Tyr Arg
Leu Tyr Gln Lys 370 375 380ctc ttt
cta gaa atg ata ggg aat cag gtt caa tca gtg aag ata agc 1320Leu Phe
Leu Glu Met Ile Gly Asn Gln Val Gln Ser Val Lys Ile Ser 385
390 395tgc tta tagttaggaa tggtcactgg gctgtttctt
caggatgggc caacactgat 1376Cys Leu400ggagcagatg gctgcttctc cggctcttga
aatggcagtt gattcctttc tcatcagttg 1436gtgggaatga agatcctcca gcccaacaca
cacactgggg agtctgagtc aggagagtga 1496ggcaggctat ttgataattg tgcaaagctg
ccaggtgtac acctagaaag tcaagcaccc 1556tgagaaagag gatattttta taacctcaaa
cataggccct ttccttcctc tccttatgga 1616tgagtactca gaaggcttct actatcttct
gtgtcatccc tagatgaagg cctcttttat 1676ttattttttt attctttttt tcggagctgg
ggaccgaacc cagggccttg cgcttgcgag 1736gcaagtgctc taccactgag ctaaatctcc
aacccctgaa ggcctctttc tttctgcctc 1796tgatagtcta tgacattctt ttttctacaa
ttcgtatcag gtgcacgagc cttatcccat 1856ttgtaggttt ctaggcaagt tgaccgttag
ctatttttcc ctctgaagat ttgattcgag 1916ttgcagactt ggctagacaa gcaggggtag
gttatggtag tttatttaac agactgccac 1976caggagtcca gtgtttcttg ttcctctgta
gttgtaccta agctgactcc aagtacattt 2036agtatgaaaa ataatcaaca aattttattc
cttctatcaa cattggctag ctttgtttca 2096gggcactaaa agaaactact atatggagaa
agaattgata ttgcccccaa cgttcaacaa 2156cccaatagtt tatccagctg tcatgcctgg
ttcagtgtct actgactatg cgccctctta 2216ttactgcatg cagtaattca actggaaata
gtaataataa taatagaaat aaaatctaga 2276ctccattgga tctctctgaa tatgggaata
tctaacttaa gaagctttga gatttcagtt 2336gtgttaaagg cttttattaa aaagctgatg
ctcttctgta aaagttacta atatatctgt 2396aagactatta cagtattgct atttatatcc
atccag 2432121401PRTRattus rattus 121Met Asn
Lys Trp Leu Cys Cys Ala Leu Leu Val Phe Leu Asp Ile Ile1 5
10 15Glu Trp Thr Thr Gln Glu Thr Phe
Pro Pro Lys Tyr Leu His Tyr Asp 20 25
30Pro Glu Thr Gly Arg Gln Leu Leu Cys Asp Lys Cys Ala Pro Gly
Thr 35 40 45Tyr Leu Lys Gln His
Cys Thr Val Arg Arg Lys Thr Leu Cys Val Pro 50 55
60Cys Pro Asp Tyr Ser Tyr Thr Asp Ser Trp His Thr Ser Asp
Glu Cys65 70 75 80Val
Tyr Cys Ser Pro Val Cys Lys Glu Leu Gln Thr Val Lys Gln Glu
85 90 95Cys Asn Arg Thr His Asn Arg
Val Cys Glu Cys Glu Glu Gly Arg Tyr 100 105
110Leu Glu Leu Glu Phe Cys Leu Lys His Arg Ser Cys Pro Pro
Gly Leu 115 120 125Gly Val Leu Gln
Ala Gly Thr Pro Glu Arg Asn Thr Val Cys Lys Arg 130
135 140Cys Pro Asp Gly Phe Phe Ser Gly Glu Thr Ser Ser
Lys Ala Pro Cys145 150 155
160Arg Lys His Thr Asn Cys Ser Ser Leu Gly Leu Leu Leu Ile Gln Lys
165 170 175Gly Asn Ala Thr His
Asp Asn Val Cys Ser Gly Asn Arg Glu Ala Thr 180
185 190Gln Asn Cys Gly Ile Asp Val Thr Leu Cys Glu Glu
Ala Phe Phe Arg 195 200 205Phe Ala
Val Pro Thr Lys Ile Ile Pro Asn Trp Leu Ser Val Leu Val 210
215 220Asp Ser Leu Pro Gly Thr Lys Val Asn Ala Glu
Ser Val Glu Arg Ile225 230 235
240Lys Arg Arg His Ser Ser Gln Glu Gln Thr Phe Gln Leu Leu Lys Leu
245 250 255Trp Lys His Gln
Asn Arg Asp Gln Glu Met Val Lys Lys Ile Ile Gln 260
265 270Asp Ile Asp Leu Cys Glu Ser Ser Val Gln Arg
His Ile Gly His Ala 275 280 285Asn
Leu Thr Thr Glu Gln Leu Arg Ile Leu Met Glu Ser Leu Pro Gly 290
295 300Lys Lys Ile Ser Pro Asp Glu Ile Glu Arg
Thr Arg Lys Thr Cys Lys305 310 315
320Pro Ser Glu Gln Leu Leu Lys Leu Leu Ser Leu Trp Arg Ile Lys
Asn 325 330 335Gly Asp Gln
Asp Thr Leu Lys Gly Leu Met Tyr Ala Leu Lys His Leu 340
345 350Lys Ala Tyr His Phe Pro Lys Thr Val Thr
His Ser Leu Arg Lys Thr 355 360
365Ile Arg Phe Leu His Ser Phe Thr Met Tyr Arg Leu Tyr Gln Lys Leu 370
375 380Phe Leu Glu Met Ile Gly Asn Gln
Val Gln Ser Val Lys Ile Ser Cys385 390
395 400Leu1221324DNAMus musculusCDS(90)..(1292)
122ccttatataa acgtcatgat tgcctgggct gcagagacgc acctagcact gacccagcgg
60ctgcctcctg aggtttcccg aggaccaca atg aac aag tgg ctg tgc tgc gca
113 Met Asn Lys Trp Leu Cys Cys Ala
1 5ctc ctg gtg ctc ctg gac atc att
gaa tgg aca acc cag gaa acc ctt 161Leu Leu Val Leu Leu Asp Ile Ile
Glu Trp Thr Thr Gln Glu Thr Leu 10 15
20cct cca aag tac ttg cat tat gac cca gaa act ggt cat cag ctc ctg
209Pro Pro Lys Tyr Leu His Tyr Asp Pro Glu Thr Gly His Gln Leu Leu25
30 35 40tgt gac aaa tgt gct
cct ggc acc tac cta aaa cag cac tgc aca gtg 257Cys Asp Lys Cys Ala
Pro Gly Thr Tyr Leu Lys Gln His Cys Thr Val 45
50 55agg agg aag aca ttg tgt gtc cct tgc cct gac
cac tct tat acg gac 305Arg Arg Lys Thr Leu Cys Val Pro Cys Pro Asp
His Ser Tyr Thr Asp 60 65
70agc tgg cac acc agt gat gag tgt gtg tat tgc agc cca gtg tgc aag
353Ser Trp His Thr Ser Asp Glu Cys Val Tyr Cys Ser Pro Val Cys Lys
75 80 85gaa ctg cag tcc gtg aag cag gag
tgc aac cgc acc cac aac cga gtg 401Glu Leu Gln Ser Val Lys Gln Glu
Cys Asn Arg Thr His Asn Arg Val 90 95
100tgt gag tgt gag gaa ggg cgt tac ctg gag atc gaa ttc tgc ttg aag
449Cys Glu Cys Glu Glu Gly Arg Tyr Leu Glu Ile Glu Phe Cys Leu Lys105
110 115 120cac cgg agc tgt
ccc ccg ggc tcc ggc gtg gtg caa gct gga acc cca 497His Arg Ser Cys
Pro Pro Gly Ser Gly Val Val Gln Ala Gly Thr Pro 125
130 135gag cga aac aca gtt tgc aaa aaa tgt cca
gat ggg ttc ttc tca ggt 545Glu Arg Asn Thr Val Cys Lys Lys Cys Pro
Asp Gly Phe Phe Ser Gly 140 145
150gag act tca tcg aaa gca ccc tgt ata aaa cac acg aac tgc agc aca
593Glu Thr Ser Ser Lys Ala Pro Cys Ile Lys His Thr Asn Cys Ser Thr
155 160 165ttt ggc ctc ctg cta att cag
aaa gga aat gca aca cat gac aac gtg 641Phe Gly Leu Leu Leu Ile Gln
Lys Gly Asn Ala Thr His Asp Asn Val 170 175
180tgt tcc gga aac aga gaa gcc acg caa aag tgt gga ata gat gtc acc
689Cys Ser Gly Asn Arg Glu Ala Thr Gln Lys Cys Gly Ile Asp Val Thr185
190 195 200ctg tgt gaa gag
gcc ttc ttc agg ttt gct gtt cct acc aag att ata 737Leu Cys Glu Glu
Ala Phe Phe Arg Phe Ala Val Pro Thr Lys Ile Ile 205
210 215cca aat tgg ctg agt gtt ttg gtg gac agt
ttg cct ggg acc aaa gtg 785Pro Asn Trp Leu Ser Val Leu Val Asp Ser
Leu Pro Gly Thr Lys Val 220 225
230aat gcc gag agt gta gag agg ata aaa cgg aga cac agc tca caa gag
833Asn Ala Glu Ser Val Glu Arg Ile Lys Arg Arg His Ser Ser Gln Glu
235 240 245caa acc ttc cag ctg ctg aag
ctg tgg aaa cat caa aac aga gac cag 881Gln Thr Phe Gln Leu Leu Lys
Leu Trp Lys His Gln Asn Arg Asp Gln 250 255
260gaa atg gtg aag aag atc atc caa gac att gac ctc tgt gaa agc agc
929Glu Met Val Lys Lys Ile Ile Gln Asp Ile Asp Leu Cys Glu Ser Ser265
270 275 280gtg cag cgg cat
ctc ggc cac tcg aac ctc acc aca gag cag ctt ctt 977Val Gln Arg His
Leu Gly His Ser Asn Leu Thr Thr Glu Gln Leu Leu 285
290 295gcc ttg atg gag agc ctg cct ggg aag aag
atc agc cca gaa gag att 1025Ala Leu Met Glu Ser Leu Pro Gly Lys Lys
Ile Ser Pro Glu Glu Ile 300 305
310gag aga acg aga aag acc tgc aaa tcg agc gag cag ctc ctg aag cta
1073Glu Arg Thr Arg Lys Thr Cys Lys Ser Ser Glu Gln Leu Leu Lys Leu
315 320 325ctc agt tta tgg agg atc aaa
aat ggt gac caa gac acc ttg aag ggc 1121Leu Ser Leu Trp Arg Ile Lys
Asn Gly Asp Gln Asp Thr Leu Lys Gly 330 335
340ctg atg tat gcc ctc aag cac ttg aaa aca tcc cac ttt ccc aaa act
1169Leu Met Tyr Ala Leu Lys His Leu Lys Thr Ser His Phe Pro Lys Thr345
350 355 360gtc acc cac agt
ctg agg aag acc atg agg ttc ctg cac agc ttc aca 1217Val Thr His Ser
Leu Arg Lys Thr Met Arg Phe Leu His Ser Phe Thr 365
370 375atg tac aga ctg tat cag aag ctc ttt tta
gaa atg ata ggg aat cag 1265Met Tyr Arg Leu Tyr Gln Lys Leu Phe Leu
Glu Met Ile Gly Asn Gln 380 385
390gtt caa tcc gtg aaa ata agc tgc tta taactaggaa tggtcactgg
1312Val Gln Ser Val Lys Ile Ser Cys Leu 395
400gctgtttctt ca
1324123401PRTMus musculus 123Met Asn Lys Trp Leu Cys Cys Ala Leu Leu Val
Leu Leu Asp Ile Ile1 5 10
15Glu Trp Thr Thr Gln Glu Thr Leu Pro Pro Lys Tyr Leu His Tyr Asp
20 25 30Pro Glu Thr Gly His Gln Leu
Leu Cys Asp Lys Cys Ala Pro Gly Thr 35 40
45Tyr Leu Lys Gln His Cys Thr Val Arg Arg Lys Thr Leu Cys Val
Pro 50 55 60Cys Pro Asp His Ser Tyr
Thr Asp Ser Trp His Thr Ser Asp Glu Cys65 70
75 80Val Tyr Cys Ser Pro Val Cys Lys Glu Leu Gln
Ser Val Lys Gln Glu 85 90
95Cys Asn Arg Thr His Asn Arg Val Cys Glu Cys Glu Glu Gly Arg Tyr
100 105 110Leu Glu Ile Glu Phe Cys
Leu Lys His Arg Ser Cys Pro Pro Gly Ser 115 120
125Gly Val Val Gln Ala Gly Thr Pro Glu Arg Asn Thr Val Cys
Lys Lys 130 135 140Cys Pro Asp Gly Phe
Phe Ser Gly Glu Thr Ser Ser Lys Ala Pro Cys145 150
155 160Ile Lys His Thr Asn Cys Ser Thr Phe Gly
Leu Leu Leu Ile Gln Lys 165 170
175Gly Asn Ala Thr His Asp Asn Val Cys Ser Gly Asn Arg Glu Ala Thr
180 185 190Gln Lys Cys Gly Ile
Asp Val Thr Leu Cys Glu Glu Ala Phe Phe Arg 195
200 205Phe Ala Val Pro Thr Lys Ile Ile Pro Asn Trp Leu
Ser Val Leu Val 210 215 220Asp Ser Leu
Pro Gly Thr Lys Val Asn Ala Glu Ser Val Glu Arg Ile225
230 235 240Lys Arg Arg His Ser Ser Gln
Glu Gln Thr Phe Gln Leu Leu Lys Leu 245
250 255Trp Lys His Gln Asn Arg Asp Gln Glu Met Val Lys
Lys Ile Ile Gln 260 265 270Asp
Ile Asp Leu Cys Glu Ser Ser Val Gln Arg His Leu Gly His Ser 275
280 285Asn Leu Thr Thr Glu Gln Leu Leu Ala
Leu Met Glu Ser Leu Pro Gly 290 295
300Lys Lys Ile Ser Pro Glu Glu Ile Glu Arg Thr Arg Lys Thr Cys Lys305
310 315 320Ser Ser Glu Gln
Leu Leu Lys Leu Leu Ser Leu Trp Arg Ile Lys Asn 325
330 335Gly Asp Gln Asp Thr Leu Lys Gly Leu Met
Tyr Ala Leu Lys His Leu 340 345
350Lys Thr Ser His Phe Pro Lys Thr Val Thr His Ser Leu Arg Lys Thr
355 360 365Met Arg Phe Leu His Ser Phe
Thr Met Tyr Arg Leu Tyr Gln Lys Leu 370 375
380Phe Leu Glu Met Ile Gly Asn Gln Val Gln Ser Val Lys Ile Ser
Cys385 390 395
400Leu1241355DNAHomo sapiensCDS(94)..(1296) 124gtatatataa cgtgatgagc
gtacgggtgc ggagacgcac cggagcgctc gcccagccgc 60cgctccaagc ccctgaggtt
tccggggacc aca atg aac aag ttg ctg tgc tgc 114
Met Asn Lys Leu Leu Cys Cys
1 5gcg ctc gtg ttt ctg gac atc tcc att aag tgg acc acc
cag gaa acg 162Ala Leu Val Phe Leu Asp Ile Ser Ile Lys Trp Thr Thr
Gln Glu Thr 10 15 20ttt cct cca
aag tac ctt cat tat gac gaa gaa acc tct cat cag ctg 210Phe Pro Pro
Lys Tyr Leu His Tyr Asp Glu Glu Thr Ser His Gln Leu 25
30 35ttg tgt gac aaa tgt cct cct ggt acc tac cta aaa
caa cac tgt aca 258Leu Cys Asp Lys Cys Pro Pro Gly Thr Tyr Leu Lys
Gln His Cys Thr40 45 50
55gca aag tgg aag acc gtg tgc gcc cct tgc cct gac cac tac tac aca
306Ala Lys Trp Lys Thr Val Cys Ala Pro Cys Pro Asp His Tyr Tyr Thr
60 65 70gac agc tgg cac acc agt
gac gag tgt cta tac tgc agc ccc gtg tgc 354Asp Ser Trp His Thr Ser
Asp Glu Cys Leu Tyr Cys Ser Pro Val Cys 75 80
85aag gag ctg cag tac gtc aag cag gag tgc aat cgc acc
cac aac cgc 402Lys Glu Leu Gln Tyr Val Lys Gln Glu Cys Asn Arg Thr
His Asn Arg 90 95 100gtg tgc gaa
tgc aag gaa ggg cgc tac ctt gag ata gag ttc tgc ttg 450Val Cys Glu
Cys Lys Glu Gly Arg Tyr Leu Glu Ile Glu Phe Cys Leu 105
110 115aaa cat agg agc tgc cct cct gga ttt gga gtg gtg
caa gct gga acc 498Lys His Arg Ser Cys Pro Pro Gly Phe Gly Val Val
Gln Ala Gly Thr120 125 130
135cca gag cga aat aca gtt tgc aaa aga tgt cca gat ggg ttc ttc tca
546Pro Glu Arg Asn Thr Val Cys Lys Arg Cys Pro Asp Gly Phe Phe Ser
140 145 150aat gag acg tca tct
aaa gca ccc tgt aga aaa cac aca aat tgc agt 594Asn Glu Thr Ser Ser
Lys Ala Pro Cys Arg Lys His Thr Asn Cys Ser 155
160 165gtc ttt ggt ctc ctg cta act cag aaa gga aat gca
aca cac gac aac 642Val Phe Gly Leu Leu Leu Thr Gln Lys Gly Asn Ala
Thr His Asp Asn 170 175 180ata tgt
tcc gga aac agt gaa tca act caa aaa tgt gga ata gat gtt 690Ile Cys
Ser Gly Asn Ser Glu Ser Thr Gln Lys Cys Gly Ile Asp Val 185
190 195acc ctg tgt gag gag gca ttc ttc agg ttt gct
gtt cct aca aag ttt 738Thr Leu Cys Glu Glu Ala Phe Phe Arg Phe Ala
Val Pro Thr Lys Phe200 205 210
215acg cct aac tgg ctt agt gtc ttg gta gac aat ttg cct ggc acc aaa
786Thr Pro Asn Trp Leu Ser Val Leu Val Asp Asn Leu Pro Gly Thr Lys
220 225 230gta aac gca gag agt
gta gag agg ata aaa cgg caa cac agc tca caa 834Val Asn Ala Glu Ser
Val Glu Arg Ile Lys Arg Gln His Ser Ser Gln 235
240 245gaa cag act ttc cag ctg ctg aag tta tgg aaa cat
caa aac aaa gcc 882Glu Gln Thr Phe Gln Leu Leu Lys Leu Trp Lys His
Gln Asn Lys Ala 250 255 260caa gat
ata gtc aag aag atc atc caa gat att gac ctc tgt gaa aac 930Gln Asp
Ile Val Lys Lys Ile Ile Gln Asp Ile Asp Leu Cys Glu Asn 265
270 275agc gtg cag cgg cac att gga cat gct aac ctc
acc ttc gag cag ctt 978Ser Val Gln Arg His Ile Gly His Ala Asn Leu
Thr Phe Glu Gln Leu280 285 290
295cgt agc ttg atg gaa agc tta ccg gga aag aaa gtg gga gca gaa gac
1026Arg Ser Leu Met Glu Ser Leu Pro Gly Lys Lys Val Gly Ala Glu Asp
300 305 310att gaa aaa aca ata
aag gca tgc aaa ccc agt gac cag atc ctg aag 1074Ile Glu Lys Thr Ile
Lys Ala Cys Lys Pro Ser Asp Gln Ile Leu Lys 315
320 325ctg ctc agt ttg tgg cga ata aaa aat ggc gac caa
gac acc ttg aag 1122Leu Leu Ser Leu Trp Arg Ile Lys Asn Gly Asp Gln
Asp Thr Leu Lys 330 335 340ggc cta
atg cac gca cta aag cac tca aag acg tac cac ttt ccc aaa 1170Gly Leu
Met His Ala Leu Lys His Ser Lys Thr Tyr His Phe Pro Lys 345
350 355act gtc act cag agt cta aag aag acc atc agg
ttc ctt cac agc ttc 1218Thr Val Thr Gln Ser Leu Lys Lys Thr Ile Arg
Phe Leu His Ser Phe360 365 370
375aca atg tac aaa ttg tat cag aag tta ttt tta gaa atg ata ggt aac
1266Thr Met Tyr Lys Leu Tyr Gln Lys Leu Phe Leu Glu Met Ile Gly Asn
380 385 390cag gtc caa tca gta
aaa ata agc tgc tta taactggaaa tggccattga 1316Gln Val Gln Ser Val
Lys Ile Ser Cys Leu 395 400gctgtttcct
cacaattggc gagatcccat ggatgataa 1355
125401PRTHomo sapiens 125Met Asn Lys Leu Leu Cys Cys Ala Leu Val Phe Leu
Asp Ile Ser Ile1 5 10
15Lys Trp Thr Thr Gln Glu Thr Phe Pro Pro Lys Tyr Leu His Tyr Asp
20 25 30Glu Glu Thr Ser His Gln Leu
Leu Cys Asp Lys Cys Pro Pro Gly Thr 35 40
45Tyr Leu Lys Gln His Cys Thr Ala Lys Trp Lys Thr Val Cys Ala
Pro 50 55 60Cys Pro Asp His Tyr Tyr
Thr Asp Ser Trp His Thr Ser Asp Glu Cys65 70
75 80Leu Tyr Cys Ser Pro Val Cys Lys Glu Leu Gln
Tyr Val Lys Gln Glu 85 90
95Cys Asn Arg Thr His Asn Arg Val Cys Glu Cys Lys Glu Gly Arg Tyr
100 105 110Leu Glu Ile Glu Phe Cys
Leu Lys His Arg Ser Cys Pro Pro Gly Phe 115 120
125Gly Val Val Gln Ala Gly Thr Pro Glu Arg Asn Thr Val Cys
Lys Arg 130 135 140Cys Pro Asp Gly Phe
Phe Ser Asn Glu Thr Ser Ser Lys Ala Pro Cys145 150
155 160Arg Lys His Thr Asn Cys Ser Val Phe Gly
Leu Leu Leu Thr Gln Lys 165 170
175Gly Asn Ala Thr His Asp Asn Ile Cys Ser Gly Asn Ser Glu Ser Thr
180 185 190Gln Lys Cys Gly Ile
Asp Val Thr Leu Cys Glu Glu Ala Phe Phe Arg 195
200 205Phe Ala Val Pro Thr Lys Phe Thr Pro Asn Trp Leu
Ser Val Leu Val 210 215 220Asp Asn Leu
Pro Gly Thr Lys Val Asn Ala Glu Ser Val Glu Arg Ile225
230 235 240Lys Arg Gln His Ser Ser Gln
Glu Gln Thr Phe Gln Leu Leu Lys Leu 245
250 255Trp Lys His Gln Asn Lys Ala Gln Asp Ile Val Lys
Lys Ile Ile Gln 260 265 270Asp
Ile Asp Leu Cys Glu Asn Ser Val Gln Arg His Ile Gly His Ala 275
280 285Asn Leu Thr Phe Glu Gln Leu Arg Ser
Leu Met Glu Ser Leu Pro Gly 290 295
300Lys Lys Val Gly Ala Glu Asp Ile Glu Lys Thr Ile Lys Ala Cys Lys305
310 315 320Pro Ser Asp Gln
Ile Leu Lys Leu Leu Ser Leu Trp Arg Ile Lys Asn 325
330 335Gly Asp Gln Asp Thr Leu Lys Gly Leu Met
His Ala Leu Lys His Ser 340 345
350Lys Thr Tyr His Phe Pro Lys Thr Val Thr Gln Ser Leu Lys Lys Thr
355 360 365Ile Arg Phe Leu His Ser Phe
Thr Met Tyr Lys Leu Tyr Gln Lys Leu 370 375
380Phe Leu Glu Met Ile Gly Asn Gln Val Gln Ser Val Lys Ile Ser
Cys385 390 395
400Leu126139PRTHomo sapiens 126Cys Pro Gln Gly Lys Tyr Ile His Pro Gln
Asn Asn Ser Ile Cys Cys1 5 10
15Thr Lys Cys His Lys Gly Thr Tyr Leu Tyr Asn Asp Cys Pro Gly Pro
20 25 30Gly Gln Asp Thr Asp Cys
Arg Glu Cys Glu Ser Gly Ser Phe Thr Ala 35 40
45Ser Glu Asn His Leu Arg His Cys Leu Ser Cys Ser Lys Cys
Arg Lys 50 55 60Glu Met Gly Gln Val
Glu Ile Ser Ser Cys Thr Val Asp Arg Asp Thr65 70
75 80Val Cys Gly Cys Arg Lys Asn Gln Tyr Arg
His Tyr Trp Ser Glu Asn 85 90
95Leu Phe Gln Cys Phe Asn Cys Ser Leu Cys Leu Asn Gly Thr Val His
100 105 110Leu Ser Cys Gln Glu
Lys Gln Asn Thr Val Cys Thr Cys His Ala Gly 115
120 125Phe Phe Leu Arg Glu Asn Glu Cys Val Ser Cys 130
13512748DNAArtificial sequenceSynthetic oligonucleotide
127ccggcggaca tttatcacac agcagctgat gagaagtttc ttcatcca
48128219PRTHomo sapiens 128Met Leu Gly Ile Trp Thr Leu Leu Pro Leu Val
Leu Thr Ser Val Ala1 5 10
15Arg Leu Ser Ser Lys Ser Val Asn Ala Gln Val Thr Asp Ile Asn Ser
20 25 30Lys Gly Leu Glu Leu Arg Lys
Thr Val Thr Thr Val Glu Thr Gln Asn 35 40
45Leu Glu Gly Leu His His Asp Gly Gln Phe Cys His Lys Pro Cys
Pro 50 55 60Pro Gly Glu Arg Lys Ala
Arg Asp Cys Thr Val Asn Gly Asp Glu Pro65 70
75 80Asp Cys Val Pro Cys Gln Glu Gly Lys Glu Tyr
Thr Asp Lys Ala His 85 90
95Phe Ser Ser Lys Cys Arg Arg Cys Arg Leu Cys Asp Glu Gly His Gly
100 105 110Leu Glu Val Glu Ile Asn
Cys Thr Arg Thr Gln Asn Thr Lys Cys Arg 115 120
125Cys Lys Pro Asn Phe Phe Cys Asn Ser Thr Val Cys Glu His
Cys Asp 130 135 140Pro Cys Thr Lys Cys
Glu His Gly Ile Ile Lys Glu Cys Thr Leu Thr145 150
155 160Ser Asn Thr Lys Cys Lys Glu Glu Gly Ser
Arg Ser Asn Leu Gly Trp 165 170
175Leu Cys Leu Leu Leu Leu Pro Ile Pro Leu Ile Val Trp Val Lys Arg
180 185 190Lys Glu Val Gln Lys
Thr Cys Arg Lys His Arg Lys Glu Asn Gln Gly 195
200 205Ser His Glu Ser Pro Thr Leu Asn Pro Glu Thr 210
215129280PRTHomo sapiens 129Met Gly Leu Ser Thr Val Pro
Asp Leu Leu Leu Pro Leu Val Leu Leu1 5 10
15Glu Leu Leu Val Gly Ile Tyr Pro Ser Gly Val Ile Gly
Leu Val Pro 20 25 30His Leu
Gly Asp Arg Glu Lys Arg Asp Ser Val Cys Pro Gln Gly Lys 35
40 45Tyr Ile His Pro Gln Asn Asn Ser Ile Cys
Cys Thr Lys Cys His Lys 50 55 60Gly
Thr Tyr Leu Tyr Asn Asp Cys Pro Gly Pro Gly Gln Asp Thr Asp65
70 75 80Cys Arg Glu Cys Glu Ser
Gly Ser Phe Thr Ala Ser Glu Asn His Leu 85
90 95Arg His Cys Leu Ser Cys Ser Lys Cys Arg Lys Glu
Met Gly Gln Val 100 105 110Glu
Ile Ser Ser Cys Thr Val Asp Arg Asp Thr Val Cys Gly Cys Arg 115
120 125Lys Asn Gln Tyr Arg His Tyr Trp Ser
Glu Asn Leu Phe Gln Cys Phe 130 135
140Asn Cys Ser Leu Cys Leu Asn Gly Thr Val His Leu Ser Cys Gln Glu145
150 155 160Lys Gln Asn Thr
Val Cys Thr Cys His Ala Gly Phe Phe Leu Arg Glu 165
170 175Asn Glu Cys Val Ser Cys Ser Asn Cys Lys
Lys Ser Leu Glu Cys Thr 180 185
190Lys Leu Cys Leu Pro Gln Ile Glu Asn Val Lys Gly Thr Glu Asp Ser
195 200 205Gly Thr Thr Val Leu Leu Pro
Leu Val Ile Phe Phe Gly Leu Cys Leu 210 215
220Leu Ser Leu Leu Phe Ile Gly Leu Met Tyr Arg Tyr Gln Arg Trp
Lys225 230 235 240Ser Lys
Leu Tyr Ser Ile Val Cys Gly Lys Ser Thr Pro Glu Lys Glu
245 250 255Gly Glu Leu Glu Gly Thr Thr
Thr Lys Pro Leu Ala Pro Asn Pro Ser 260 265
270Phe Ser Pro Thr Pro Gly Phe Thr 275
280130207PRTShope fibroma virus 130Met Leu Arg Leu Ile Ala Leu Leu Val
Cys Val Val Tyr Val Tyr Gly1 5 10
15Asp Asp Val Pro Tyr Ser Ser Asn Gln Gly Lys Cys Gly Gly His
Asp 20 25 30Tyr Glu Lys Asp
Gly Leu Cys Cys Ala Ser Cys His Pro Gly Phe Tyr 35
40 45Ala Ser Arg Leu Cys Gly Pro Gly Ser Asn Thr Val
Cys Ser Pro Cys 50 55 60Glu Asp Gly
Thr Phe Thr Ala Ser Thr Asn His Ala Pro Ala Cys Val65 70
75 80Ser Cys Arg Gly Pro Cys Thr Gly
His Leu Ser Glu Ser Gln Pro Cys 85 90
95Asp Arg Thr His Asp Arg Val Cys Asn Cys Ser Thr Gly Asn
Tyr Cys 100 105 110Leu Leu Lys
Gly Gln Asn Gly Cys Arg Ile Cys Ala Pro Gln Thr Lys 115
120 125Cys Pro Ala Gly Tyr Gly Val Ser Gly His Thr
Arg Ala Gly Asp Thr 130 135 140Leu Cys
Glu Lys Cys Pro Pro His Thr Tyr Ser Asp Ser Leu Ser Pro145
150 155 160Thr Glu Arg Cys Gly Thr Ser
Phe Asn Tyr Ile Ser Val Gly Phe Asn 165
170 175Leu Tyr Pro Val Asn Glu Thr Ser Cys Thr Thr Thr
Ala Gly His Asn 180 185 190Glu
Val Ile Lys Thr Lys Glu Phe Thr Val Thr Leu Asn Tyr Thr 195
200 205131227PRTHomo sapiens 131Met Ala Pro Val
Ala Val Trp Ala Ala Leu Ala Val Gly Leu Glu Leu1 5
10 15Trp Ala Ala Ala His Ala Leu Pro Ala Gln
Val Ala Phe Thr Pro Tyr 20 25
30Ala Pro Glu Pro Gly Ser Thr Cys Arg Leu Arg Glu Tyr Tyr Asp Gln
35 40 45Thr Ala Gln Met Cys Cys Ser Lys
Cys Ser Pro Gly Gln His Ala Lys 50 55
60Val Phe Cys Thr Lys Thr Ser Asp Thr Val Cys Asp Ser Cys Glu Asp65
70 75 80Ser Thr Tyr Thr Gln
Leu Trp Asn Trp Val Pro Glu Cys Leu Ser Cys 85
90 95Gly Ser Arg Cys Ser Ser Asp Gln Val Glu Thr
Gln Ala Cys Thr Arg 100 105
110Glu Gln Asn Arg Ile Cys Thr Cys Arg Pro Gly Trp Tyr Cys Ala Leu
115 120 125Ser Lys Gln Glu Gly Cys Arg
Leu Cys Ala Pro Leu Arg Lys Cys Arg 130 135
140Pro Gly Phe Gly Val Ala Arg Pro Gly Thr Glu Thr Ser Asp Val
Val145 150 155 160Cys Lys
Pro Cys Ala Pro Gly Thr Phe Ser Asn Thr Thr Ser Ser Thr
165 170 175Asp Ile Cys Arg Pro His Gln
Ile Cys Asn Val Val Ala Ile Pro Gly 180 185
190Asn Ala Ser Arg Asp Ala Val Cys Thr Ser Thr Ser Pro Thr
Arg Ser 195 200 205Met Ala Pro Gly
Ala Val His Leu Pro Gln Pro Val Ser Thr Arg Ser 210
215 220Gln His Thr225132197PRTMus musculus 132Met Val Ser
Leu Pro Arg Leu Cys Ala Leu Trp Gly Cys Leu Leu Thr1 5
10 15Ala Val His Leu Gly Gln Cys Val Thr
Cys Ser Asp Lys Gln Tyr Leu 20 25
30His Asp Gly Gln Cys Cys Asp Leu Cys Gln Pro Gly Ser Arg Leu Thr
35 40 45Ser His Cys Thr Ala Leu Glu
Lys Thr Gln Cys His Pro Cys Asp Ser 50 55
60Gly Glu Phe Ser Ala Gln Trp Asn Arg Glu Ile Arg Cys His Gln His65
70 75 80Arg His Cys Glu
Pro Asn Gln Gly Leu Arg Val Lys Lys Glu Gly Thr 85
90 95Ala Glu Ser Asp Thr Val Cys Thr Cys Lys
Glu Gly Gln His Cys Thr 100 105
110Ser Lys Asp Cys Glu Ala Cys Ala Gln His Thr Pro Cys Ile Pro Gly
115 120 125Phe Gly Val Met Glu Met Ala
Thr Glu Thr Thr Asp Thr Val Cys His 130 135
140Pro Cys Pro Val Gly Phe Phe Ser Asn Gln Ser Ser Leu Phe Glu
Lys145 150 155 160Cys Tyr
Pro Trp Thr Ser Cys Glu Asp Lys Asn Leu Glu Val Leu Gln
165 170 175Lys Gly Thr Ser Gln Thr Asn
Val Ile Cys Gly Leu Lys Ser Arg Met 180 185
190Arg Ala Leu Leu Val 195133208PRTRattus rattus
133Met Asn Lys Trp Leu Cys Cys Ala Leu Leu Val Phe Leu Asp Ile Ile1
5 10 15Glu Trp Thr Thr Gln Glu
Thr Phe Pro Pro Lys Tyr Leu His Tyr Asp 20 25
30Pro Glu Thr Gly Arg Gln Leu Leu Cys Asp Lys Cys Ala
Pro Gly Thr 35 40 45Tyr Leu Lys
Gln His Cys Thr Val Arg Arg Lys Thr Leu Cys Val Pro 50
55 60Cys Pro Asp Tyr Ser Tyr Thr Asp Ser Trp His Thr
Ser Asp Glu Cys65 70 75
80Val Tyr Cys Ser Pro Val Cys Lys Glu Leu Gln Thr Val Lys Gln Glu
85 90 95Cys Asn Arg Thr His Asn
Arg Val Cys Glu Cys Glu Glu Gly Arg Tyr 100
105 110Leu Glu Leu Glu Phe Cys Leu Lys His Arg Ser Cys
Pro Pro Gly Leu 115 120 125Gly Val
Leu Gln Ala Gly Thr Pro Glu Arg Asn Thr Val Cys Lys Arg 130
135 140Cys Pro Asp Gly Phe Phe Ser Gly Glu Thr Ser
Ser Lys Ala Pro Cys145 150 155
160Arg Lys His Thr Asn Cys Ser Ser Leu Gly Leu Leu Leu Ile Gln Lys
165 170 175Gly Asn Ala Thr
His Asp Asn Val Cys Ser Gly Asn Arg Glu Ala Thr 180
185 190Gln Asn Cys Gly Ile Asp Val Thr Leu Cys Glu
Glu Ala Phe Phe Arg 195 200
205134224PRTHomo sapiens 134Met Gly Ala Gly Ala Thr Gly Arg Ala Met Asp
Gly Pro Arg Leu Leu1 5 10
15Leu Leu Leu Leu Leu Gly Val Ser Leu Gly Gly Ala Lys Glu Ala Cys
20 25 30Pro Thr Gly Leu Tyr Thr His
Ser Gly Glu Cys Cys Lys Ala Cys Asn 35 40
45Leu Gly Glu Gly Val Ala Gln Pro Cys Gly Ala Asn Gln Thr Val
Cys 50 55 60Glu Pro Cys Leu Asp Ser
Val Thr Phe Ser Asp Val Val Ser Ala Thr65 70
75 80Glu Pro Cys Lys Pro Cys Thr Glu Cys Val Gly
Leu Gln Ser Met Ser 85 90
95Ala Pro Cys Val Glu Ala Asp Asp Ala Val Cys Arg Cys Ala Tyr Gly
100 105 110Tyr Tyr Gln Asp Glu Thr
Thr Gly Arg Cys Glu Ala Cys Arg Val Cys 115 120
125Glu Ala Gly Ser Gly Leu Val Phe Ser Cys Gln Asp Lys Gln
Asn Thr 130 135 140Val Cys Glu Glu Cys
Pro Asp Gly Thr Tyr Ser Asp Glu Ala Asn His145 150
155 160Val Asp Pro Cys Leu Pro Cys Thr Val Cys
Glu Asp Thr Glu Arg Gln 165 170
175Leu Arg Glu Cys Thr Arg Trp Ala Asp Ala Glu Cys Glu Glu Ile Pro
180 185 190Gly Arg Trp Ile Thr
Arg Ser Thr Pro Pro Glu Gly Ser Asp Ser Thr 195
200 205Ala Pro Ser Thr Gln Glu Pro Glu Ala Pro Pro Glu
Gln Asp Leu Ile 210 215
220135202PRTRattus rattus 135Met Tyr Val Trp Val Gln Gln Pro Thr Ala Phe
Leu Leu Leu Gly Leu1 5 10
15Ser Leu Gly Val Thr Val Lys Leu Asn Cys Val Lys Asp Thr Tyr Pro
20 25 30Ser Gly His Lys Cys Cys Arg
Glu Cys Gln Pro Gly His Gly Met Val 35 40
45Ser Arg Cys Asp His Thr Arg Asp Thr Val Cys His Pro Cys Glu
Pro 50 55 60Gly Phe Tyr Asn Glu Ala
Val Asn Tyr Asp Thr Cys Lys Gln Cys Thr65 70
75 80Gln Cys Asn His Arg Ser Gly Ser Glu Leu Lys
Gln Asn Cys Thr Pro 85 90
95Thr Glu Asp Thr Val Cys Gln Cys Arg Pro Gly Thr Gln Pro Arg Gln
100 105 110Asp Ser Ser His Lys Leu
Gly Val Asp Cys Val Pro Cys Pro Pro Gly 115 120
125His Phe Ser Pro Gly Ser Asn Gln Ala Cys Lys Pro Trp Thr
Asn Cys 130 135 140Thr Leu Ser Gly Lys
Gln Ile Arg His Pro Ala Ser Asn Ser Val Cys145 150
155 160Glu Asp Arg Ser Leu Leu Ala Thr Leu Leu
Trp Glu Thr Gln Arg Thr 165 170
175Thr Phe Arg Pro Thr Thr Val Pro Ser Thr Thr Val Trp Pro Arg Thr
180 185 190Ser Gln Leu Pro Ser
Thr Pro Thr Leu Val 195 200136380PRTHomo sapiens
136Glu Thr Phe Pro Pro Lys Tyr Leu His Tyr Asp Glu Glu Thr Ser His1
5 10 15Gln Leu Leu Cys Asp Lys
Cys Pro Pro Gly Thr Tyr Leu Lys Gln His 20 25
30Cys Thr Ala Lys Trp Lys Thr Val Cys Ala Pro Cys Pro
Asp His Tyr 35 40 45Tyr Thr Asp
Ser Trp His Thr Ser Asp Glu Cys Leu Tyr Cys Ser Pro 50
55 60Val Cys Lys Glu Leu Gln Tyr Val Lys Gln Glu Cys
Asn Arg Thr His65 70 75
80Asn Arg Val Cys Glu Cys Lys Glu Gly Arg Tyr Leu Glu Ile Glu Phe
85 90 95Cys Leu Lys His Arg Ser
Cys Pro Pro Gly Phe Gly Val Val Gln Ala 100
105 110Gly Thr Pro Glu Arg Asn Thr Val Cys Lys Arg Cys
Pro Asp Gly Phe 115 120 125Phe Ser
Asn Glu Thr Ser Ser Lys Ala Pro Cys Arg Lys His Thr Asn 130
135 140Cys Ser Val Phe Gly Leu Leu Leu Thr Gln Lys
Gly Asn Ala Thr His145 150 155
160Asp Asn Ile Cys Ser Gly Asn Ser Glu Ser Thr Gln Lys Cys Gly Ile
165 170 175Asp Val Thr Leu
Cys Glu Glu Ala Phe Phe Arg Phe Ala Val Pro Thr 180
185 190Lys Phe Thr Pro Asn Trp Leu Ser Val Leu Val
Asp Asn Leu Pro Gly 195 200 205Thr
Lys Val Asn Ala Glu Ser Val Glu Arg Ile Lys Arg Gln His Ser 210
215 220Ser Gln Glu Gln Thr Phe Gln Leu Leu Lys
Leu Trp Lys His Gln Asn225 230 235
240Lys Asp Gln Asp Ile Val Lys Lys Ile Ile Gln Asp Ile Asp Leu
Cys 245 250 255Glu Asn Ser
Val Gln Arg His Ile Gly His Ala Asn Leu Thr Phe Glu 260
265 270Gln Leu Arg Ser Leu Met Glu Ser Leu Pro
Gly Lys Lys Val Gly Ala 275 280
285Glu Asp Ile Glu Lys Thr Ile Lys Ala Cys Lys Pro Ser Asp Gln Ile 290
295 300Leu Lys Leu Leu Ser Leu Trp Arg
Ile Lys Asn Gly Asp Gln Asp Thr305 310
315 320Leu Lys Gly Leu Met His Ala Leu Lys His Ser Lys
Thr Tyr His Phe 325 330
335Pro Lys Thr Val Thr Gln Ser Leu Lys Lys Thr Ile Arg Phe Leu His
340 345 350Ser Phe Thr Met Tyr Lys
Leu Tyr Gln Lys Leu Phe Leu Glu Met Ile 355 360
365Gly Asn Gln Val Gln Ser Val Lys Ile Ser Cys Leu 370
375 38013754DNAArtificial sequenceSynthetic
oligonucleotide 137tatggatgaa gaaacttctc atcagctgct gtgtgataaa tgtccgccgg
gtac 54138380PRTMus musculus 138Glu Thr Leu Pro Pro Lys Tyr Leu
His Tyr Asp Pro Glu Thr Gly His1 5 10
15Gln Leu Leu Cys Asp Lys Cys Ala Pro Gly Thr Tyr Leu Lys
Gln His 20 25 30Cys Thr Val
Arg Arg Lys Thr Leu Cys Val Pro Cys Pro Asp His Ser 35
40 45Tyr Thr Asp Ser Trp His Thr Ser Asp Glu Cys
Val Tyr Cys Ser Pro 50 55 60Val Cys
Lys Glu Leu Gln Ser Val Lys Gln Glu Cys Asn Arg Thr His65
70 75 80Asn Arg Val Cys Glu Cys Glu
Glu Gly Arg Tyr Leu Glu Ile Glu Phe 85 90
95Cys Leu Lys His Arg Ser Cys Pro Pro Gly Ser Gly Val
Val Gln Ala 100 105 110Gly Thr
Pro Glu Arg Asn Thr Val Cys Lys Lys Cys Pro Asp Gly Phe 115
120 125Phe Ser Gly Glu Thr Ser Ser Lys Ala Pro
Cys Ile Lys His Thr Asn 130 135 140Cys
Ser Thr Phe Gly Leu Leu Leu Ile Gln Lys Gly Asn Ala Thr His145
150 155 160Asp Asn Val Cys Ser Gly
Asn Arg Glu Ala Thr Gln Lys Cys Gly Ile 165
170 175Asp Val Thr Leu Cys Glu Glu Ala Phe Phe Arg Phe
Ala Val Pro Thr 180 185 190Lys
Ile Ile Pro Asn Trp Leu Ser Val Leu Val Asp Ser Leu Pro Gly 195
200 205Thr Lys Val Asn Ala Glu Ser Val Glu
Arg Ile Lys Arg Arg His Ser 210 215
220Ser Gln Glu Gln Thr Phe Gln Leu Leu Lys Leu Trp Lys His Gln Asn225
230 235 240Arg Asp Gln Glu
Met Val Lys Lys Ile Ile Gln Asp Ile Asp Leu Cys 245
250 255Glu Ser Ser Val Gln Arg His Leu Gly His
Ser Asn Leu Thr Thr Glu 260 265
270Gln Leu Leu Ala Leu Met Glu Ser Leu Pro Gly Lys Lys Ile Ser Pro
275 280 285Glu Glu Ile Glu Arg Thr Arg
Lys Thr Cys Lys Ser Ser Glu Gln Leu 290 295
300Leu Lys Leu Leu Ser Leu Trp Arg Ile Lys Asn Gly Asp Gln Asp
Thr305 310 315 320Leu Lys
Gly Leu Met Tyr Ala Leu Lys His Leu Lys Thr Ser His Phe
325 330 335Pro Lys Thr Val Thr His Ser
Leu Arg Lys Thr Met Arg Phe Leu His 340 345
350Ser Phe Thr Met Tyr Arg Leu Tyr Gln Lys Leu Phe Leu Glu
Met Ile 355 360 365Gly Asn Gln Val
Gln Ser Val Lys Ile Ser Cys Leu 370 375
380139380PRTHomo sapiens 139Glu Thr Phe Pro Pro Lys Tyr Leu His Tyr Asp
Glu Glu Thr Ser His1 5 10
15Gln Leu Leu Cys Asp Lys Cys Pro Pro Gly Thr Tyr Leu Lys Gln His
20 25 30Cys Thr Ala Lys Trp Lys Thr
Val Cys Ala Pro Cys Pro Asp His Tyr 35 40
45Tyr Thr Asp Ser Trp His Thr Ser Asp Glu Cys Leu Tyr Cys Ser
Pro 50 55 60Val Cys Lys Glu Leu Gln
Tyr Val Lys Gln Glu Cys Asn Arg Thr His65 70
75 80Asn Arg Val Cys Glu Cys Lys Glu Gly Arg Tyr
Leu Glu Ile Glu Phe 85 90
95Cys Leu Lys His Arg Ser Cys Pro Pro Gly Phe Gly Val Val Gln Ala
100 105 110Gly Thr Pro Glu Arg Asn
Thr Val Cys Lys Arg Cys Pro Asp Gly Phe 115 120
125Phe Ser Asn Glu Thr Ser Ser Lys Ala Pro Cys Arg Lys His
Thr Asn 130 135 140Cys Ser Val Phe Gly
Leu Leu Leu Thr Gln Lys Gly Asn Ala Thr His145 150
155 160Asp Asn Ile Cys Ser Gly Asn Ser Glu Ser
Thr Gln Lys Cys Gly Ile 165 170
175Asp Val Thr Leu Cys Glu Glu Ala Phe Phe Arg Phe Ala Val Pro Thr
180 185 190Lys Phe Thr Pro Asn
Trp Leu Ser Val Leu Val Asp Asn Leu Pro Gly 195
200 205Thr Lys Val Asn Ala Glu Ser Val Glu Arg Ile Lys
Arg Gln His Ser 210 215 220Ser Gln Glu
Gln Thr Phe Gln Leu Leu Lys Leu Trp Lys His Gln Asn225
230 235 240Lys Ala Gln Asp Ile Val Lys
Lys Ile Ile Gln Asp Ile Asp Leu Cys 245
250 255Glu Asn Ser Val Gln Arg His Ile Gly His Ala Asn
Leu Thr Phe Glu 260 265 270Gln
Leu Arg Ser Leu Met Glu Ser Leu Pro Gly Lys Lys Val Gly Ala 275
280 285Glu Asp Ile Glu Lys Thr Ile Lys Ala
Cys Lys Pro Ser Asp Gln Ile 290 295
300Leu Lys Leu Leu Ser Leu Trp Arg Ile Lys Asn Gly Asp Gln Asp Thr305
310 315 320Leu Lys Gly Leu
Met His Ala Leu Lys His Ser Lys Thr Tyr His Phe 325
330 335Pro Lys Thr Val Thr Gln Ser Leu Lys Lys
Thr Ile Arg Phe Leu His 340 345
350Ser Phe Thr Met Tyr Lys Leu Tyr Gln Lys Leu Phe Leu Glu Met Ile
355 360 365Gly Asn Gln Val Gln Ser Val
Lys Ile Ser Cys Leu 370 375
38014030DNAArtificial sequenceSynthetic oligonucleotide 140tggaccaccc
agaagtacct tcattatgac
3014130DNAArtificial sequenceSynthetic oligonucleotide 141gtcataatga
aggtacttct gggtggtcca
3014231DNAArtificial sequenceSynthetic oligonucleotide 142ggaccaccca
gcttcattat gacgaagaaa c
3114331DNAArtificial sequenceSynthetic oligonucleotide 143gtttcttcgt
cataatgaag ctgggtggtc c
3114429DNAArtificial sequenceSynthetic oligonucleotide 144gtggaccacc
caggacgaag aaacctctc
2914529DNAArtificial sequenceSynthetic oligonucleotide 145gagaggtttc
ttcgtcctgg gtggtccac
2914629DNAArtificial sequenceSynthetic oligonucleotide 146cgtttcctcc
aaagttcctt cattatgac
2914729DNAArtificial sequenceSynthetic oligonucleotide 147gtcataatga
aggaactttg gaggaaacg
2914832DNAArtificial sequenceSynthetic oligonucleotide 148ggaaacgttt
cctgcaaagt accttcatta tg
3214932DNAArtificial sequenceSynthetic oligonucleotide 149cataatgaag
gtactttgca ggaaacgttt cc
3215027DNAArtificial sequenceSynthetic oligonucleotide 150cacgcaaaag
tcgggaatag atgtcac
2715127DNAArtificial sequenceSynthetic oligonucleotide 151gtgacatcta
ttcccgactt ttgcgtg
2715225DNAArtificial sequenceSynthetic oligonucleotide 152caccctgtcg
gaagaggcct tcttc
2515325DNAArtificial sequenceSynthetic oligonucleotide 153gaagaaggcc
tcttccgaca gggtg
2515424DNAArtificial sequenceSynthetic oligonucleotide 154tgacctctcg
gaaagcagcg tgca
2415524DNAArtificial sequenceSynthetic oligonucleotide 155tgcacgctgc
tttccgagag gtca
2415624DNAArtificial sequenceSynthetic oligonucleotide 156cctcgaaatc
gagcgagcag ctcc
2415725DNAArtificial sequenceSynthetic oligonucleotide 157cgatttcgag
gtctttctcg ttctc
2515833DNAArtificial sequenceSynthetic oligonucleotide 158ccgtgaaaat
aagctcgtta taactaggaa tgg
3315933DNAArtificial sequenceSynthetic oligonucleotide 159ccattcctag
ttataacgag cttattttca cgg
3316038DNAArtificial sequenceSynthetic oligonucleotide 160cctctgagct
caagcttccg aggaccacaa tgaacaag
3816144DNAArtificial sequenceSynthetic oligonucleotide 161cctctctcga
gtcaggtgac atctattcca cacttttgcg tggc
4416238DNAArtificial sequenceSynthetic oligonucleotide 162cctctgagct
caagcttccg aggaccacaa tgaacaag
3816338DNAArtificial sequenceSynthetic oligonucleotide 163cctctctcga
gtcaaggaac agcaaacctg aagaaggc
3816438DNAArtificial sequenceSynthetic oligonucleotide 164cctctgagct
caagcttccg aggaccacaa tgaacaag
3816538DNAArtificial sequenceSynthetic oligonucleotide 165cctctctcga
gtcactctgt ggtgaggttc gagtggcc
3816638DNAArtificial sequenceSynthetic oligonucleotide 166cctctgagct
caagcttccg aggaccacaa tgaacaag
3816738DNAArtificial sequenceSynthetic oligonucleotide 167cctctctcga
gtcaggatgt tttcaagtgc ttgagggc
3816816PRTArtificial sequenceSynthetic oligonucleotide 168Met Lys His His
His His His His His Ala Ser Val Asn Ala Leu Glu1 5
10 1516970PRTRattus rattus 169Ala Leu Leu Val
Phe Leu Asp Ile Ile Glu Trp Thr Thr Gln Glu Thr1 5
10 15Phe Pro Pro Lys Tyr Leu His Tyr Asp Pro
Glu Thr Gly Arg Gln Leu 20 25
30Leu Cys Asp Lys Cys Ala Pro Gly Thr Tyr Leu Lys Gln His Cys Thr
35 40 45Val Arg Arg Lys Thr Leu Cys Val
Pro Cys Pro Asp Tyr Ser Tyr Thr 50 55
60Asp Ser Trp His Thr Ser65 70170120PRTHomo sapiens
170His Ala Leu Pro Ala Gln Val Ala Phe Thr Pro Tyr Ala Pro Glu Pro1
5 10 15Gly Ser Thr Cys Arg Leu
Arg Glu Tyr Tyr Asp Gln Thr Ala Gln Met 20 25
30Cys Cys Ser Lys Cys Ser Pro Gly Gln His Ala Lys Val
Phe Cys Thr 35 40 45Lys Thr Ser
Asp Thr Val Cys Asp Ser Cys Glu Asp Ser Thr Tyr Thr 50
55 60Gln Leu Trp Asn Trp Val Pro Glu Cys Leu Ser Cys
Gly Ser Arg Cys65 70 75
80Ser Ser Asp Gln Val Glu Thr Gln Ala Cys Thr Arg Glu Gln Asn Arg
85 90 95Ile Cys Thr Cys Arg Pro
Gly Trp Tyr Cys Ala Leu Ser Lys Gln Glu 100
105 110Gly Cys Arg Leu Cys Ala Pro Leu 115
12017148PRTRattus rattus 171Tyr Leu His Tyr Asp Pro Glu Thr Gly
Arg Gln Leu Leu Cys Asp Lys1 5 10
15Cys Ala Pro Gly Thr Tyr Leu Lys Gln His Cys Thr Val Arg Arg
Lys 20 25 30Thr Leu Cys Val
Pro Cys Pro Asp Tyr Ser Tyr Thr Asp Ser Trp His 35
40 45172139PRTHomo sapiens 172Pro Pro Lys Tyr Leu His
Tyr Asp Glu Glu Thr Ser His Gln Leu Leu1 5
10 15Cys Asp Lys Cys Pro Pro Gly Thr Tyr Leu Lys Gln
His Cys Thr Ala 20 25 30Lys
Trp Lys Thr Val Cys Ala Pro Cys Pro Asp His Tyr Tyr Thr Asp 35
40 45Ser Trp His Thr Ser Asp Glu Cys Leu
Tyr Cys Ser Pro Val Cys Lys 50 55
60Glu Leu Gln Tyr Val Lys Gln Glu Cys Asn Arg Thr His Asn Arg Val65
70 75 80Cys Glu Cys Lys Glu
Gly Arg Tyr Leu Glu Ile Glu Phe Cys Leu Lys 85
90 95His Arg Ser Cys Pro Pro Gly Phe Gly Val Val
Gln Ala Gly Thr Pro 100 105
110Glu Arg Asn Thr Val Cys Lys Arg Cys Pro Asp Gly Phe Phe Ser Asn
115 120 125Glu Thr Ser Ser Lys Ala Pro
Cys Arg Lys His 130 13517351PRTHomo sapiens 173Tyr His
Tyr Tyr Asp Gln Asn Gly Arg Met Cys Glu Glu Cys His Met1 5
10 15Cys Gln Pro Gly His Phe Leu Val
Lys His Cys Lys Gln Pro Lys Arg 20 25
30Asp Thr Val Cys His Lys Pro Cys Glu Pro Gly Val Thr Tyr Thr
Asp 35 40 45Asp Trp His
50174401PRTMus musculus 174Met Asn Lys Trp Leu Cys Cys Ala Leu Leu Val
Leu Leu Asp Ile Ile1 5 10
15Glu Trp Thr Thr Gln Glu Thr Leu Pro Pro Lys Tyr Leu His Tyr Asp
20 25 30Pro Glu Thr Gly His Gln Leu
Leu Cys Asp Lys Cys Ala Pro Gly Thr 35 40
45Tyr Leu Lys Gln His Cys Thr Val Arg Arg Lys Thr Leu Cys Val
Pro 50 55 60Cys Pro Asp His Ser Tyr
Thr Asp Ser Trp His Thr Ser Asp Glu Cys65 70
75 80Val Tyr Cys Ser Pro Val Cys Lys Glu Leu Gln
Ser Val Lys Gln Glu 85 90
95Cys Asn Arg Thr His Asn Arg Val Cys Glu Cys Glu Glu Gly Arg Tyr
100 105 110Leu Glu Ile Glu Phe Cys
Leu Lys His Arg Ser Cys Pro Pro Gly Ser 115 120
125Gly Val Val Gln Ala Gly Thr Pro Glu Arg Asn Thr Val Cys
Lys Lys 130 135 140Cys Pro Asp Gly Phe
Phe Ser Gly Glu Thr Ser Ser Lys Ala Pro Cys145 150
155 160Ile Lys His Thr Asn Cys Ser Thr Phe Gly
Leu Leu Leu Ile Gln Lys 165 170
175Gly Asn Ala Thr His Asp Asn Val Cys Ser Gly Asn Arg Glu Ala Thr
180 185 190Gln Lys Cys Gly Ile
Asp Val Thr Leu Cys Glu Glu Ala Phe Phe Arg 195
200 205Phe Ala Val Pro Thr Lys Ile Ile Pro Asn Trp Leu
Ser Val Leu Val 210 215 220Asp Ser Leu
Pro Gly Thr Lys Val Asn Ala Glu Ser Val Glu Arg Ile225
230 235 240Lys Arg Arg His Ser Ser Gln
Glu Gln Thr Phe Gln Leu Leu Lys Leu 245
250 255Trp Lys His Gln Asn Arg Asp Gln Glu Met Val Lys
Lys Ile Ile Gln 260 265 270Asp
Ile Asp Leu Cys Glu Ser Ser Val Gln Arg His Leu Gly His Ser 275
280 285Asn Leu Thr Thr Glu Gln Leu Leu Ala
Leu Met Glu Ser Leu Pro Gly 290 295
300Lys Lys Ile Ser Pro Glu Glu Ile Glu Arg Thr Arg Lys Thr Cys Lys305
310 315 320Ser Ser Glu Gln
Leu Leu Lys Leu Leu Ser Leu Trp Arg Ile Lys Asn 325
330 335Gly Asp Gln Asp Thr Leu Lys Gly Leu Met
Tyr Ala Leu Lys His Leu 340 345
350Lys Thr Ser His Phe Pro Lys Thr Val Thr His Ser Leu Arg Lys Thr
355 360 365Met Arg Phe Leu His Ser Phe
Thr Met Tyr Arg Leu Tyr Gln Lys Leu 370 375
380Phe Leu Glu Met Ile Gly Asn Gln Val Gln Ser Val Lys Ile Ser
Cys385 390 395
400Leu175401PRTRattus rattus 175Met Asn Lys Trp Leu Cys Cys Ala Leu Leu
Val Phe Leu Asp Ile Ile1 5 10
15Glu Trp Thr Thr Gln Glu Thr Phe Pro Pro Lys Tyr Leu His Tyr Asp
20 25 30Pro Glu Thr Gly Arg Gln
Leu Leu Cys Asp Lys Cys Ala Pro Gly Thr 35 40
45Tyr Leu Lys Gln His Cys Thr Val Arg Arg Lys Thr Leu Cys
Val Pro 50 55 60Cys Pro Asp Tyr Ser
Tyr Thr Asp Ser Trp His Thr Ser Asp Glu Cys65 70
75 80Val Tyr Cys Ser Pro Val Cys Lys Glu Leu
Gln Thr Val Lys Gln Glu 85 90
95Cys Asn Arg Thr His Asn Arg Val Cys Glu Cys Glu Glu Gly Arg Tyr
100 105 110Leu Glu Leu Glu Phe
Cys Leu Lys His Arg Ser Cys Pro Pro Gly Leu 115
120 125Gly Val Leu Gln Ala Gly Thr Pro Glu Arg Asn Thr
Val Cys Lys Arg 130 135 140Cys Pro Asp
Gly Phe Phe Ser Gly Glu Thr Ser Ser Lys Ala Pro Cys145
150 155 160Arg Lys His Thr Asn Cys Ser
Ser Leu Gly Leu Leu Leu Ile Gln Lys 165
170 175Gly Asn Ala Thr His Asp Asn Val Cys Ser Gly Asn
Arg Glu Ala Thr 180 185 190Gln
Asn Cys Gly Ile Asp Val Thr Leu Cys Glu Glu Ala Phe Phe Arg 195
200 205Phe Ala Val Pro Thr Lys Ile Ile Pro
Asn Trp Leu Ser Val Leu Val 210 215
220Asp Ser Leu Pro Gly Thr Lys Val Asn Ala Glu Ser Val Glu Arg Ile225
230 235 240Lys Arg Arg His
Ser Ser Gln Glu Gln Thr Phe Gln Leu Leu Lys Leu 245
250 255Trp Lys His Gln Asn Arg Asp Gln Glu Met
Val Lys Lys Ile Ile Gln 260 265
270Asp Ile Asp Leu Cys Glu Ser Ser Val Gln Arg His Ile Gly His Ala
275 280 285Asn Leu Thr Thr Glu Gln Leu
Arg Ile Leu Met Glu Ser Leu Pro Gly 290 295
300Lys Lys Ile Ser Pro Asp Glu Ile Glu Arg Thr Arg Lys Thr Cys
Lys305 310 315 320Pro Ser
Glu Gln Leu Leu Lys Leu Leu Ser Leu Trp Arg Ile Lys Asn
325 330 335Gly Asp Gln Asp Thr Leu Lys
Gly Leu Met Tyr Ala Leu Lys His Leu 340 345
350Lys Ala Tyr His Phe Pro Lys Thr Val Thr His Ser Leu Arg
Lys Thr 355 360 365Ile Arg Phe Leu
His Ser Phe Thr Met Tyr Arg Leu Tyr Gln Lys Leu 370
375 380Phe Leu Glu Met Ile Gly Asn Gln Val Gln Ser Val
Lys Ile Ser Cys385 390 395
400Leu176401PRTHomo sapiens 176Met Asn Lys Leu Leu Cys Cys Ala Leu Val
Phe Leu Asp Ile Ser Ile1 5 10
15Lys Trp Thr Thr Gln Glu Thr Phe Pro Pro Lys Tyr Leu His Tyr Asp
20 25 30Glu Glu Thr Ser His Gln
Leu Leu Cys Asp Lys Cys Pro Pro Gly Thr 35 40
45Tyr Leu Lys Gln His Cys Thr Ala Lys Trp Lys Thr Val Cys
Ala Pro 50 55 60Cys Pro Asp His Tyr
Tyr Thr Asp Ser Trp His Thr Ser Asp Glu Cys65 70
75 80Leu Tyr Cys Ser Pro Val Cys Lys Glu Leu
Gln Tyr Val Lys Gln Glu 85 90
95Cys Asn Arg Thr His Asn Arg Val Cys Glu Cys Lys Glu Gly Arg Tyr
100 105 110Leu Glu Ile Glu Phe
Cys Leu Lys His Arg Ser Cys Pro Pro Gly Leu 115
120 125Gly Val Val Gln Ala Gly Thr Pro Glu Arg Asn Thr
Val Cys Lys Arg 130 135 140Cys Pro Asp
Gly Phe Phe Ser Asn Glu Thr Ser Ser Lys Ala Pro Cys145
150 155 160Arg Lys His Thr Asn Cys Ser
Val Phe Gly Leu Leu Leu Thr Gln Lys 165
170 175Gly Asn Ala Thr His Asp Asn Ile Cys Ser Gly Asn
Ser Glu Ser Thr 180 185 190Gln
Lys Cys Gly Ile Asp Val Thr Leu Cys Glu Glu Ala Phe Phe Arg 195
200 205Phe Ala Val Pro Thr Lys Phe Thr Pro
Asn Trp Leu Ser Val Leu Val 210 215
220Asp Asn Leu Pro Gly Thr Lys Val Asn Ala Glu Ser Val Glu Arg Ile225
230 235 240Lys Arg Gln His
Ser Ser Gln Glu Gln Thr Phe Gln Leu Leu Lys Leu 245
250 255Trp Lys His Gln Asn Lys Asp Gln Asp Ile
Val Lys Lys Ile Ile Gln 260 265
270Asp Ile Asp Leu Cys Glu Asn Ser Val Gln Arg His Ile Gly His Ala
275 280 285Asn Leu Thr Phe Glu Gln Leu
Arg Ser Leu Met Glu Ser Leu Pro Gly 290 295
300Lys Lys Val Gly Ala Glu Asp Ile Glu Lys Thr Ile Lys Ala Cys
Lys305 310 315 320Pro Ser
Asp Gln Ile Leu Lys Leu Leu Ser Leu Trp Arg Ile Lys Asn
325 330 335Gly Asp Gln Asp Thr Leu Lys
Gly Leu Met His Ala Leu Lys His Ser 340 345
350Lys Thr Tyr His Phe Pro Lys Thr Val Thr Gln Ser Leu Lys
Lys Thr 355 360 365Ile Arg Phe Leu
His Ser Phe Thr Met Tyr Lys Leu Tyr Gln Lys Leu 370
375 380Phe Leu Glu Met Ile Gly Asn Gln Val Gln Ser Val
Lys Ile Ser Cys385 390 395
400Leu177139PRTHomo sapiens 177Cys Pro Gln Gly Lys Tyr Ile His Pro Gln
Asn Asn Ser Ile Cys Cys1 5 10
15Thr Lys Cys His Lys Gly Thr Tyr Leu Tyr Asn Asp Cys Pro Gly Pro
20 25 30Gly Gln Asp Thr Asp Cys
Arg Glu Cys Glu Ser Gly Ser Phe Thr Ala 35 40
45Ser Glu Asn His Leu Arg His Cys Leu Ser Cys Ser Lys Cys
Arg Lys 50 55 60Glu Met Gly Gln Val
Glu Ile Ser Ser Cys Thr Val Asp Arg Asp Thr65 70
75 80Val Cys Gly Cys Arg Lys Asn Gln Tyr Arg
His Tyr Trp Ser Glu Asn 85 90
95Leu Phe Gln Cys Phe Asn Cys Ser Leu Cys Leu Asn Gly Thr Val His
100 105 110Leu Ser Cys Gln Glu
Lys Gln Asn Thr Val Cys Thr Cys His Ala Gly 115
120 125Phe Phe Leu Arg Glu Asn Glu Cys Val Ser Cys 130
135178139PRTHomo sapiens 178Pro Pro Lys Tyr Leu His Tyr
Asp Glu Glu Thr Ser His Gln Leu Leu1 5 10
15Cys Asp Lys Cys Pro Pro Gly Thr Tyr Leu Lys Gln His
Cys Thr Ala 20 25 30Lys Trp
Lys Thr Val Cys Ala Pro Cys Pro Asp His Tyr Tyr Thr Asp 35
40 45Ser Trp His Thr Ser Asp Glu Cys Leu Tyr
Cys Ser Pro Val Cys Lys 50 55 60Glu
Leu Gln Tyr Val Lys Gln Glu Cys Asn Arg Thr His Asn Arg Val65
70 75 80Cys Glu Cys Lys Glu Gly
Arg Tyr Leu Glu Ile Glu Phe Cys Leu Lys 85
90 95His Arg Ser Cys Pro Pro Gly Phe Gly Val Val Gln
Ala Gly Thr Pro 100 105 110Glu
Arg Asn Thr Val Cys Lys Arg Cys Pro Asp Gly Phe Phe Ser Asn 115
120 125Glu Thr Ser Ser Lys Ala Pro Cys Arg
Lys His 130 135179379PRTMus musculus 179Glu Thr Leu
Pro Pro Lys Tyr Leu His Tyr Asp Pro Glu Thr Gly His1 5
10 15Gln Leu Leu Cys Asp Lys Cys Ala Pro
Gly Thr Tyr Leu Lys Gln His 20 25
30Cys Thr Val Arg Arg Lys Thr Leu Cys Val Pro Cys Pro Asp His Ser
35 40 45Tyr Thr Asp Ser Trp His Thr
Ser Asp Glu Cys Val Tyr Cys Ser Pro 50 55
60Val Cys Lys Glu Leu Gln Ser Val Lys Gln Glu Cys Asn Arg Thr His65
70 75 80Asn Arg Val Cys
Glu Cys Glu Glu Gly Arg Tyr Leu Glu Ile Glu Phe 85
90 95Cys Leu Lys His Arg Ser Cys Pro Pro Gly
Ser Gly Val Val Gln Ala 100 105
110Gly Thr Pro Glu Arg Asn Thr Val Lys Lys Cys Pro Asp Gly Phe Phe
115 120 125Ser Gly Glu Thr Ser Ser Lys
Ala Pro Cys Ile Lys His Thr Asn Cys 130 135
140Ser Thr Phe Gly Leu Leu Leu Ile Gln Lys Gly Asn Ala Thr His
Asp145 150 155 160Asn Val
Cys Ser Gly Asn Arg Glu Ala Thr Gln Lys Cys Gly Ile Asp
165 170 175Val Thr Leu Cys Glu Glu Ala
Phe Phe Arg Phe Ala Val Pro Thr Lys 180 185
190Ile Ile Pro Asn Trp Leu Ser Val Leu Val Asp Ser Leu Pro
Gly Thr 195 200 205Lys Val Asn Ala
Glu Ser Val Glu Arg Ile Lys Arg Arg His Ser Ser 210
215 220Gln Glu Gln Thr Phe Gln Leu Leu Lys Leu Trp Lys
His Gln Asn Arg225 230 235
240Asp Gln Glu Met Val Lys Lys Ile Ile Gln Asp Ile Asp Leu Cys Glu
245 250 255Ser Ser Val Gln Arg
His Leu Gly His Ser Asn Leu Thr Thr Glu Gln 260
265 270Leu Leu Ala Leu Met Glu Ser Leu Pro Gly Lys Lys
Ile Ser Pro Glu 275 280 285Glu Ile
Glu Arg Thr Arg Lys Thr Cys Lys Ser Ser Glu Gln Leu Leu 290
295 300Lys Leu Leu Ser Leu Trp Arg Ile Lys Asn Gly
Asp Gln Asp Thr Leu305 310 315
320Lys Gly Leu Met Tyr Ala Leu Lys His Leu Lys Thr Ser His Phe Pro
325 330 335Lys Thr Val Thr
His Ser Leu Arg Lys Thr Met Arg Phe Leu His Ser 340
345 350Phe Thr Met Tyr Arg Leu Tyr Gln Lys Leu Phe
Leu Glu Met Ile Gly 355 360 365Asn
Gln Val Gln Ser Val Lys Ile Ser Cys Leu 370 375
User Contributions:
Comment about this patent or add new information about this topic:
People who visited this patent also read: | |
Patent application number | Title |
---|---|
20130096863 | USER-MOUNTED DEVICE CALIBRATION USING EXTERNAL DATA |
20130096862 | ENCODER AND APPARATUS WITH THE SAME |
20130096861 | Method and Apparatus for Testing Received Signals in a Radio Signal Positioning System |
20130096860 | INFORMATION PROCESSING APPARATUS, INFORMATION PROCESSING METHOD, AND COMPUTER READABLE MEDIUM STORING PROGRAM |
20130096859 | RESISTANCE DETERMINING SYSTEM |