LPS-Responsive CHS1/Beige-Like Anchor Gene and Therapeutic Applications Thereof

Abstract

ates to a novel LPS-responsive and Beige-like Anchor gene (lrba), variants of the lrba gene, fragments of the lrba gene, and polypeptides encoded thereby. The subject invention also pertains to lrba interfering RNA, and uses thereof. In another aspect, the present invention also includes methods of inhibiting tumor growth in a patient by suppressing lrba function.

Description

CROSS-REFERENCE TO RELATED APPLICATION

[0001]This application is a continuation of U.S. patent application Ser. No. 10/473,741, filed on Mar. 18, 2004, which is the national stage of PCT Application No. PCT/US02/10350, filed Apr. 2, 2002, which claims the benefit of U.S. Provisional Application Ser. No. 60/280,107, filed Apr. 2, 2001, the disclosure of each of which is incorporated herein by reference in its entirety, including all figures, tables, amino acid and nucleic acid sequences.

[0002]The Sequence Listing for this application is labeled "new5ST25.txt" which was created on Dec. 20, 2007 and is 319 KB. The entire contents of the sequence listing is incorporated herein by reference in its entirety.

BACKGROUND OF THE INVENTION

[0004]Mutations in chs1/beige result in a deficiency in intracellular transport of vesicles that leads to a generalized immune deficiency in mouse and man. The function of NK cells, CTL, and granulocytes is impaired by these mutations indicating that polarized trafficking of vesicles is controlled by chs1/beige proteins. However, a molecular explanation for this defect has not been identified.

[0005]Lipopolysaccharide (LPS) is a potent inducer of maturation in B cells, monocytes, and dendritic cells that facilitates production of inflammatory cytokines, nitric oxide, and antigen presentation so that these cells can participate in the immune response to bacterial pathogens (Harris, M. R. et al. Journal of Immunology, 1984, 133:1202; Tobias, P. S. et al. Progress in Clinical & Biol. Res., 1994, 388:31; Inazawa, M. et al. Lymphokine Res., 1985, 4:343). In an attempt to identify genes involved in the maturation of immune cells, a gene-trapping strategy was developed to identify mammalian genes whose expression is altered by cellular stimuli (Kerr, W. G. et al. Cold Spring Harbor Symposia on Quantitative Biology, 1989, 54:767). Several novel LPS-responsive genes were successfully trapped (Kerr, W. G. et al. Proc. Natl. Acad. of Sci. USA, 1996, 93:3947), including the SHIP gene that plays a role in controlling the maturation and proliferation of B cells and monocytes/macrophages in vivo (Huber, M. et al. Prog. in Biophysics and Molecular Biol., 1999, 71:423; Ono, M. et al. Nature, 1996, 383:263; Ono, M. et al. Cell, 1997, 90:293).

[0006]Chediak-Higashi Syndrome (CHS³) patients suffer from a systematic immune deficiency characterized by a severe immune defect, hypopigmentation, progressive neurologic dysfunction and a bleeding diathesis (Spritz, R. A. Jour. of Clinical Immun., 1998, 18:97). Specific defects in immune cells include defects in T cell cytotoxicity (Abo, T. et al. Jour. of Clinical Investigation, 1982, 70:193; Baetz, K. et al. Jour. of Immun., 1995, 154:6122), killing by NK cells (Haliotis, T. et al. Jour. of Exper. Med., 1980, 151:1039), defective bactericidal activity and chemotaxis by granulocytes and monocytes (Clark, R. A. and H. R. Kimball Jour. of Clinical Investigation, 1971, 50:2645). CHS and beige lysosomes also exhibit compartmental missorting of proteins (Takeuchi, K. et al. Jour. of Exper. Med., 1986, 163:665). Other studies have found that beige macrophages are defective for class II surface presentation (Faigle, W. et al. J. Cell Biol., 1998, 141:1121; Lem, L. et al. Jour. of Immun., 1999, 162:523) and that T cells in CHS patients are defective for CTLA4 surface expression (Barrat, F. J. et al. Proc. Natl. Acad. of Sci. USA, 1999, 96:8645). All cells in beige mice and CHS patients bear giant vesicles that cluster around the nucleus. Affected vesicles include lysosomes, platelet dense granules, endosomes, and cytolytic granules. These giant vesicles seem normal in several aspects except for their failure to release their contents, probably resulting from inability of the giant granules to mobilize and/or fuse with the membrane upon stimulation (Baetz, K. et al. Jour. of Immun., 1995, 154:6122). However, despite these very provocative findings there still remains no direct evidence that BG(beige)/CHS1 proteins associate with intracellular vesicles and thus a molecular explanation for defective vesicle trafficking and protein missorting in these diseases is still sought.

BRIEF SUMMARY OF THE INVENTION

[0007]The present invention relates to a novel LPS-responsive and Beige-like Anchor gene (lrba), its transcriptional/translational products, and the targeting of the lrba gene for the treatment of cancer. Thus, the present application is directed to the lrba gene, variants of the lrba gene, fragments of the lrba gene, corresponding polypeptides encoding by such nucleotides, and uses thereof. The mouse lrba gene product is disclosed herein in FIG. 1 and the human lrba gene product is disclosed herein in FIG. 9. The lrba gene is associated with the vesicular system, such as the Golgi complex, lysosomes, endoplasmic reticulum, plasma membrane and perinuclear ER, and plays an important role in coupling signal transduction and vesicle trafficking to enable polarized secretion and/or membrane deposition of immune effector molecules. In one aspect, the lrba variants of the subject invention include five isoforms of the lrba gene, including lrba-α, lrba-β, lrba-δ, lrba-γ, and lrba-ε. The sequences of the mouse lrba cDNAs have been deposited in GENBANK with the following GENBANK accession numbers: lrba-a: AF187731, lrba-β: AF188506, lrba-γ: AF188507.

[0008]The subject invention also relates to cloning and expression vectors containing the lrba gene, and fragments and variants thereof, and cells transformed with such vectors.

[0009]In one aspect, the subject invention concerns lrba small interfering RNA (siRNA) sequences useful for the treatment of cancer. Preferably, the siRNA duplex is formed by annealing single-stranded RNA sequences (ssRNA) of 5'CCAGCAAAGGUCUUGGCUAdTdT3' (SEQ ID NO: 1) and 5'CAGUCGGGUUUGCGACUGGdTdT3' (SEQ ID NO: 2) from the lrba gene.

[0010]In a further aspect, the subject invention concerns methods of inhibiting the growth of tumors in a patient by suppressing lrba function. According to the method of the subject invention, suppression of lrba function can be carried out at various levels, including the levels of gene transcription, translation, expression, or post-expression. For example, suppression of lrba gene expression can be carried out using a variety of modalities known in the art for interfering with the production of a functional product of a target gene. For example, siRNA sequences, such as those described above, can be administered to a patient in need thereof The siRNA can be produced and administered exogenously, or the siRNA can be inserted into an appropriate vector and the vector can be administered to the patient for production of the siRNA in vivo, for example.

[0011]The subject invention also provides methods of detecting the presence of lrba nucleic acids, transcriptional products, or polypeptides in samples suspected of containing lrba genes, transcriptional products, or polypeptides.

[0012]Another aspect of the subject invention provides kits for detecting the presence of lrba genes, lrba variants, lrba polypeptides, or lrba transcriptional products obtained from the polynucleotide sequences.

BRIEF DESCRIPTION OF DRAWINGS

[0013]FIGS. 1A and 1B show the sequence and structure of the mouse lrba gene. FIG. 1A shows the predicted full-length amino acid sequence of the lrba-a (SEQ ID NO: 3) and lrba-β (SEQ ID NO: 4) (stopped at the boxed "R" with the additional sequence VSAVGSTLFLLLGSSK (SEQ ID NO: 5)) and lrba-γ (SEQ ID NO: 6) cDNAs (stopped at the boxed "I" with the additional sequence GLPLLSLFAIH (SEQ ID NO: 7)). Bold amino acids indicate the BEACH domain (2204-2482) based on alignment with 20 other BEACH domains. Eight WD repeats predicted by an algorithm available at http://bmerc-www.bu.edu/psa/request.htm, are underlined or dotted-underlined. The first three WD repeats are not predicted by other programs but resemble WD repeats and thus are referred to herein as WDL (WD-like) repeats. Two putative protein kinase A RII binding sites are shaded. The sequences of the mouse lrba cDNAs have been deposited in GENBANK with the following GENBANK accession numbers: lrba-a: AF187731, lrba-β: AF188506, lrba-γ: AF188507. FIG. 1B shows a schematic diagram of mLRBA protein and alignment of the predicted mLRBA protein with its orthologues and some paralogues. The stop sites for the lrba-β and lrba-γ are indicated by dashed lines. The human LRBA protein (SEQ ID NO: 8) was predicted from a 9.9 kb "hybrid" cDNA sequence with the first 5' 2577 nucleotides from this work (GENBANK accession numbers AF216648) and the rest from the CDC4L partial cDNA sequence (GENBANK accession numbers M83822) (Feuchter, A. E. et al. (1992) Genomics 13:1237) except one G was added after position 5696 for two reasons: (i) the G base is present in the eDNA sequence (GENBANK accession numbers AF217149); and (ii) this addition extended the CDC4L ORF by an additional 165 AA that had high homology with mLRBA and other proteins shown in this figure. The dLRBA was predicted from the drosophila melanogaster genomic sequence (GENBANK accession number AE003433). cLRBA (GENBANK accession number T20719, Caenorhabditis elegans), aCDC4L (GENBANK accession number T00867, Arabidopsis thaliana), LSVA (GENBANK accession number AAD52096, Dictyostelium discoideum), hFAN (GENBANK accession number NP_--0035711, Homo sapiens), CHS1 (Chediak-Higashi Syndrome 1, GENBANK accession number NP_--000072, Homo sapiens), mBG (GENBANK accession number AAB60778, Mus musculus).

[0014]FIGS. 2A and 2B show the PKA binding sites in LRBA. In FIG. 2A, the conservation of hydrophobic amino acids of putative PKA hinging sites in mLRBA (SEQ ID NO: 9), hLRBA (SEQ ID NO: 10), dLRBA (SEQ ID NOs: 11-12), and cLRBA (SEQ ID NO: 13) are shown by aligning with the known B1 and B2 PKA RII tethering sites (underlined) in DAKAP550 (a partial cDNA sequence for dLRBA) along with other sequences in these regions. FIG. 2B shows the predicted secondary structure of the putative PKA binding sites in mLRBA (mLRBAb1, mLRBAb2). The hydrophobic amino acids on the hydrophobic side of the predicted amphipathic helices are boxed.

[0015]FIG. 3 shows the alignment of the C-terminal sequences of mLRBA (SEQ ID NO: 14), hLRBA (SEQ ID NO: 15), dLRBA (SEQ ID NO: 16), CHS1 (SEQ ID NO: 17), and hFAN (SEQ ID NO: 18), which include the BEACH domains (in the middle, boxed), 5 WD repeats and the 3 WDL repeats predicted in mLRBA and hLRBA. The predicted SH3, SH2 binding sites and tyrosine kinase recognition sites are also boxed. The C-terminal difference of the three isoforms of the mLRBA, a (SEQ ID NO: 14), β (SEQ ID NO: 19), and γ (SEQ ID NO: 20), are shown here (and FIG. 1B in more detail).

[0016]FIGS. 4A and 4B show that expression of lrba is inducible in B cells and macrophages. FIG. 4A shows Northern blot hybridization of mRNA from B cell line 70Z/3 and the macrophage cell line J774. Both cell lines were cultured with or without LPS for 20 hours. The poly A⁺RNA was purified from these cells, run on a denaturing formaldehyde agarose gell, and transferred to a Hybond-N+ filter. The filter was hybridized with the 2.5 kb probe that corresponds to the coding region of the lrba gene including the BEACH and WD domains, as described in the Materials and Methods section. The hybridized filter was exposed to X-ray film for 24 hours. Similar amounts of β-actin mRNA were found in all mRNA tested (Actin panels). FIGS. 4B and 4C show expression of mRNA of three lrba isoforms (α, β, and γ) in B cell lines (FIG. 4B) and tissues (FIG. 4C). Three isoform-specific primer pairs were used to detect the expression of the three isoforms by RT-PCR, the expected product size of the RT-PCR product for the a form is 1344 bp, for the β form 836 bp, and for the γ form 787 bp. Total RNA is analyzed. Aliquots (10 μl) of the PCR products were resolved on 0.8% agarose gels. Three independent experiments were performed and yielded similar results.

[0017]FIGS. 5A-5I show subcellular localization of GFP-LRBA fusion proteins revealed by UV-fluorescence microscopy and laser-scan confocal microscopy. FIG. 5A shows the RAW 267.4 macrophage cell line (R7) stably transfected with a BEACH-WD-GFP fusion construct. Most cells have diffuse, cytosolic GFP fluorescence, but some cells show vesicle association of the GFP fusion protein. In FIG. 5B, the same cell line from FIG. 5A was plated on glass-covered plates and stimulated with LPS (100 ng/ml) for 24 hours. Extensive vesicle association of the fusion protein was observed. FIG. 5C shows RAW 267.4 macrophages stably transfected with the control vector pEGFP-N2 that were cultured with 100 ng/ml LPS stimulation. No obvious vesicle association of native GFP was observed. Magnification: 400×. FIG. 5D shows part of an R7 macrophage cell, showing GFP fluorescence. FIG. 5E shows the same part of an R7 macrophage cell as in FIG. 5D, showing acidic lysosomes specifically labeled by LysoTracker Red in living cells. FIG. 5F shows lysosome co-localization (white part) of GFP fusion protein by overlapping pictures of FIGS. 5D and 5E; N=nucleus. FIG. 5G shows R7 macrophage cells, showing GFP fluorescence. FIG. 5H shows the same R7 macrophage cells as in FIG. 5G, showing prominent labeling of the Golgi complex (between the two nuclei) specifically labeled by BODIPY TR ceramide. Other intracellular membranes are weakly labeled. FIG. 5I shows Golgi co-localization (white part) of GFP fusion protein by overlapping pictures shown in FIGS. 5G and 5H. Co-localization was determined by Zeiss LSM 510 software, which allows for a reliability of 99% for actual pixels with both fluorophores. Co-localization mask pixels are converted to white color for clarity. All cells were stimulated with LPS (100 ng/ml) for 24 hours except for FIG. 5A.

[0018]FIGS. 6A-6F show immunoelectron microscopy of LRBA-GFP fusion protein. The LPS-stimulated R7 macrophage cells were fixed and processed for postembedding immunocytochemistry. The cells were dehydrated and embedded in gelatin capsules in LR White resin. Ultrathin sections of LR White embedded cells were collected on nickel grids and immunolabeled with rabbit-anti-GFP followed by labeling with anti-rabbit IgG-gold secondary antibody, and finally stained with uranyl acetate and lead citrate before examination with EM. FIG. 6A shows a clathrin-coated pit (endocytic, or coated vesicle) labeled with gold particles (open arrow). This is a vesicle forming on the cell surface. The fact that there is clathrin around this vacuole indicates that it is involved in endocytosis and not exocytosis. FIG. 6B shows intense labeling of a primary lysosome (open arrow) and a vesicle on the cell surface (closed arrow). In FIG. 6C, the black arrows show ribosomes lining a profile of endoplasmic reticulum (er). There are three gold particles labeling the ER (open arrow). The gray structure next to the ER is a mitochondrion (m), which is not labeled. FIG. 6D shows a Golgi region of a cell labeled for GFP. The open arrows show gold particles on a Golgi cisterna. FIG. 6E shows labeling of endoplasmic reticulum comprising the perinuclear cisterna (open arrows), and labeling of the plasma membrane of the cell (closed arrows). FIG. 6F shows gold particles surrounding a secondary lysosome in a cell (*). At the top of the lysosome is a coated vesicle (closed arrow) fusing with the lysosome. A portion of ER surrounds the bottom of the lysosome, which is also labeled with gold particles (open arrow). Labeling of the perimeter of the secondary lysosome shows routing of GFP from the cell surface to the lysosome limiting membrane. In FIGS. 6A-6F, e=extracellular space; n=nucleus; er=endoplasmic reticulum; g=Golgi; m=mitochondrion; c=cytoplasm. The size of gold particles is 10 nm.

[0019]FIG. 7 shows a model of vesicle secretion for WBW protein family using the lrba gene as a prototype. Following immune cell activation, the BEACH domain binds to vesicles containing cargo proteins and membrane proteins for secretion or deposition in the plasma membrane. The anchor domain binds to microtubules to move the vesicles to the membrane where the WD domain hinds to phosphorylated sequences of membrane receptor complexes to mediate the fusion of the vesicles with the membrane, thus releasing the cargo proteins or depositing membrane proteins on the plasma membrane of immune cells.

[0020]FIG. 8 shows a Western blot of a Raw 264.7 macrophage cell line and stably transfected Raw 264.7 cell lines, demonstrating inhibition of apoptosis by LRBA fusion proteins. 586-2 cells were transfected with BEACH-GFP construct; R7 cells were transfected with. BEACH-WD-GFP construct; and RGFP cells were transfected with pEGFP vector. The level of both cleaved PARP (poly(ADP-ribose) polymerase and cleaved caspase 3 are higher in control cell lines (Raw 264.7 and RGFP) than in LRBA transfected Raw 264.7 cell lines (586-2 and R7), suggesting LRBA constructs can prevent cells from apoptosis induced by staursporine.

[0021]FIG. 9 shows the predicted full-length amino acid sequence and structure of the human LRBA gene and its five isoforms (SEQ ID NO:182). Each isoform is shown by α (SEQ ID NO: 8), β (SEQ ID NO: 21), γ (SEQ ID NO: 22), δ (SEQ ID NO: 23), ε (SEQ ID NO: 24) at the right of each C-terminus or the five amino acid insertion(γ). Residues in italic letters indicate isoform-specific sequences. Asterisk *=stop codon. Sequences are connected by arrows. The numbers at the right are for the α form. The domains are shaded and named above each domain. Five WD repeats predicted by an algorithm available on the protein sequence analysis (PSA) server at the Boston University website are also shaded or boxed. HSH (helix-sheet-helix); SET: Rich in Serine(S), Glutamic acid(E) and Threonine(T). G peptide has five consecutive glycine. The two potential start codons are boxed. The sequences of the LRBA cDNAs have been deposited in GenBank (accession number NM_--006726).

[0022]FIG. 10 shows secondary structure prediction and alignment of the HSH domain in several WBW proteins (SEQ ID NOs: 25-31). Sequence positions highlighted in magenta and yellow correspond, respectively, to helices and strands. Sequence positions highlighted in blue are potential glycosylation sites. Squared positions correspond to conserved residues found in the three WBW protein. The positions of the predicted helical regions of the HSH structure are indicated as tubes at the top of the sequences. Sequences having homologues in FIG. 9 were analyzed as multiple sequence alignments using the Jpred² method (Cuff, J. A. et al. (1998) Bioinformatics 14:892-893; Cuff J. A. and Barton, G. J. (1999) Proteins: Structure, Function and Genetics 34:508-519; Cuff, J. A. and Barton, G. J. (1999) Proteins: Structure, Function and Genetics 40:502-511). Several sequences that, after a first prediction run, were found to have more than 25% homology in one of the three conserved helical regions were reprocessed together as a multiple sequence alignment using Jpred² to refine the prediction of that particular region. Secondary structure predictions were performed by the Jpred² method. Rectangles indicate -helices and arrows indicate -strands. HSH (helix-sheet-helix) domain: Several WBW proteins have a high homology and a common predicted protein secondary structure (HSH structure) over an 100 amino acid stretch near their N-terminus, as shown in FIG. 10. Because the HSH domain exists in evolutionarily very distant species (Dictyostelium is a cellular slime mold, more ancient than yeast), it may have important function in a cell's life. SET domain: rich in serine (S, 13.70%), glutamic acid (E, 13.40%) and threonine (T, 9.03%). Its function is still unknown. This domain is very hydrophobic and has a very high antigenic index. PI is 3.96.

[0023]FIG. 11 shows the genomic structure of the human LRBA gene. The gene contains 59 exons, which span more than 700 kb. The exon/intron structure of the LRBA gene is mapped to the corresponding cDNA regions encoded by each exon. Location and size of exons and introns are drawn to scale (GenBank accession number NM_--006726).

[0024]FIG. 12 shows a molecular phylogenic tree of the amino acid sequences of WBW genes from various species. The tree was constructed by the neighbor joining method, based on sequence alignment conducted by CLUSTALX software using either whole length sequence or only the BEACH domain, which gave very similar results. This indicates that the BEACH domain is co-evolving with the rest sequence of the gene and, as the whole sequences of some WBW genes are still unavailable (moreover, the length of the BEACH domain is relatively consistent (around 278 amino acids)), using the BEACH domain seems more reasonable. Thus, FIG. 12 is based on the BEACH domain. All the sequences are from GeneBank. The numbers in parenthesis are GI numbers.

[0025]FIG. 13 shows alternative splicing of the human LRBA gene. The solid or gray box indicates coding exon, and the hatched box indicates UTR (untranslated region). The top numbers indicate exons in the main form (constitutive isoform versus alternative isoform) of human lrba, while the bottom numbers indicate alternative splicing isoforms of the human LRBA gene. The single Greek letters denote the five isoforms. The LRBAδ has a 310 by Alu sequence at its poly(A) tail. 5'-1, 3'-1 and 3'-2 indicate 5' end and 3' end splicing, while I-1 and I-2 represent internal splicing. 5'-1 splicing gives alternative transcription start site and suggests alternative promoter for human LRBA gene. The internal splicing I-1 interrupts the coding sequence of LRBA, splitting LRBA into two open reading frames (ORF), and thus alternative potential start codon ATG (the meaning of this splicing is further described and discussed later). Another internal alternative splicing I-2 is a 15 by sequence in frame with the main ORF, inserting a YLLLQ (SEQ ID NO: 32) insertion into the human LRBA protein (noting that the 1 and w are hydrophobic amino acids). AATAAA indicate a polyadenine signal. 3'-1 and 3'-2 splicing generate two additional different 3' UTR tails for human LRBA gene. The isoform identification was conducted by using the following cultured cells and tissues: (1.) human pre-B (6417) cells; (2.) human Raji B cells; (3.) 293 cells; (4.) human MCF7 breast cancer cells; (5.) human HTB4 lung cancer; (6.) human H322 human lung cancer; (7.) human A539 human lung cancer; (8.) human lung carcinoma; (9.) human lung carcinoma adjacent tissue; (10.) human B-cell lymphoma; (11.) human B-cell lymphoma; and (12.) normal adjacent tissue (3 pairs of tumor tissue and adjacent tissue of human prostate).

[0026]FIGS. 14 shows results of a 5'RACE (rapid amplification of cDNA end) procedure and 3'RACE procedure, respectively, conducted on the human lrba gene. In FIG. 14, the lower band contains an AluSx repeat sequence 312 by long. RNAs were from: (1.) pre-B (6417); (2.) Raji B cells; (3.) 293 cells; (4.) MCF7 breast cells; (5.) HTB4 lung cancer; (6.) H322 human lung cancer; (7.) A539 human lung cancer; (8.) human lung carcinoma; (9.) human lung carcinoma adjacent tissue; (10.) B-cell lymphoma; (11.) B-cell lymphoma; and (12.) normal adjacent tissue.

[0027]FIG. 15 shows the 5' end of the human lrbaε isoform with a long 5' UTR (SEQ ID NO: 33). There are four small ORFs before the major ORF of the human lrba gene. The longest small ORF encodes the first 73 amino acids of the hlrba protein (SEQ ID NO: 34) and is in frame with the major ORF, though there are four in-frame stop codons and 6 out-of-frame stop codons, in between which would prevent potential read-through that makes a fusion protein. The other three ORFs encode 20 amino acids, 18 amino acids, and 15 amino acids, respectively. The partial major coding sequence is in bold (SEQ ID NO: 35). The amino acid sequence in italics is present in the main form of the LRBA gene but absent in the delta form of the LRBA gene (SEQ ID NO: 36). The grey shaded sequence is the extra exon that has interrupted the LRBA sequence.

[0028]FIG. 16 shows the predicted secondary structure of RNA sequence between the two ORF of human lrbaδ (SEQ ID NO:181). The free energy for the structure is -40.29 kcal/mol. This suggests a potential IRES (internal ribosome entry signal). There is no homologous sequence between IRES, however they all have complex secondary structure like long stem structure.

[0029]FIG. 17 shows the promoter and part of the 5' cDNA sequence of the human lrba gene (SEQ ID NO: 37). Transcription start sites as determined by 5'RACE procedure are indicated by arrows. Sequence for a CpG island is in bold. The DNA consensus binding motifs for various transcription factors shown in the region -1561 to +1 were identified using the TFSEARCH (version 1.3) software (Yukata Akiyama (Kyoto Univ.)), the first nucleotide of the most 5' cDNA denoted as 1. The initiator methionine is in bold. The transcription binding sites are shaded, boxed, or underlined. The genomic sequences have GenBank accession number AC104796.

[0030]FIGS. 18A and 18B show RT-PCR of human prostate tumor tissue and adjacent normal tissue, demonstrating that LRBA expression is increased in human prostate cancer relative to matched normal tissue controls. FIG. 18A shows RT-PCR detection of human LRBA mRNA. FIG. 18B shows RT-PCR detection of human β-Actin mRNA to control for the amounts of mRNA present. The PCR cycle parameters were as follows: 94° C. for 30 seconds, 68° C. for 30 seconds, 72° C. for 1 minute, 25 cycles. The sources from the matched samples are (from left to right) 1, 3, and 5: prostate adenocarcinoma tissue; 2, 4, and 6: normal prostate tissue. Samples 1 & 2, 3 & 4, and 5 & 6, are matched pairs from three different prostate cancer patients.

[0031]FIG. 19 shows growth inhibition of human breast cancer cells by expression of a dominant negative human LRBA mutant. MCF7 human breast cancer cells were seeded (1×10⁴/well) into a 96-well plate. On the second day, cells were infected with various titers of a recombinant adenovirus that contains a dominant negative LRBA mutant, in the presence or absence of doxycycline. The BW-GFP mutant comprises the BEACH and WD domains of LRBA fused to GFP. The adenoviral vector has a tetracycline-responsive promoter that is repressed in the presence of doxycycline and, thus, the BW-GFP mutant is expressed in the absence of doxycycline. Three days post-infection, the cells were labeled with ³H-thymidine, the cells harvested and CPM incorporated into high molecular weight DNA counted as a measure of cell proliferation (DNA synthesis).

[0032]FIGS. 20A-20C show the knock-down of Lrba expression by LRBA siRNA treatment and death of cancer cells. HeLa cells were plated 2×10⁴ cells/well of a 24-well dish. The next day, cells were transfected as indicated or were left untreated (Blank). The cells were photographed 72 hours after transfected and the wells harvested for cell counting. HeLa cells (human adenocarcinoma) transfected with Lrba siRNA and lipofectamine (FIG. 20A) or mock transfected with H₂O and lipofectamine (FIG. 20B). Magnification is 400×. Note the presence of apoptotic or necrotic cell bodies as well as the spindly, stressed morphology of the remaining adherent cells in the siRNA Lrba-treated well. FIG. 20c shows absolute cell numbers recovered as determined by Coulter Counter. Students' T-test: P<0.0006 for mock versus Lrba siRNA; P<0.0036 for Blank versus Lrba siRNA; P<0.2271 for mock versus blank. The siRNA treated cultures show a statistically significant decrease in cell number as compared to either mock or blank cultures, but there is no significant difference in the number of cells recovered from the mock and blank cultures. The RNA sequences that were annealed to make the Lrba siRNA were: Lrba sense-strand: 5'CCAGCAAAGGUCUUGGCUAdTdT3' (SEQ ID NO: 1); Lrba antisense-strand: 5'UAGCCAAGACCUUUGCUGGdTdT3' (SEQ ID NO: 38).

[0033]FIGS. 21A-21D show silencing of the Lrba gene in MCF7 human breast cancer cells and MCF10A human breast normal cells by two pairs of Lrba siRNA (siRNA1 and siRNA2), demonstrating that Lrba siRNAs selectively kill human breast cancer cells but not normal cells. MCF7 cells (FIG. 21A-21C) and MCF10A cells (FIG. 21D) were seeded at 2×10⁴ cells per well in 24-well plates. One day later, the cells were transfected with Lrba siRNAs or with scramble siRNA as a negative control using oligofectamine. After 72 hours of siRNA treatment, the photos (FIG. 21A, MCF7 transfected with siRNA1; FIG. 21B, MCF7 transfected with scramble siRNA negative control; magnification 400×) were taken and the cell numbers were counted by a Coulter counter. T-test: FIG. 21C (MCF7), P=0.0009 for scramble negative control versus siRNA1; P=0.0005 for scramble negative control 1 versus Lrba siRNA2; P=0.004 for siRNA1 versus siRNA2. FIG. 21D (MCF10A), P=0.4070 for scramble negative control versus siRNA1; P=0.9456 for scramble negative control 1 versus Lrba siRNA2; P=0.0514 for siRNA1 versus siRNA2. The siRNA sequences: siRNA1: CCAGCAAAGGUCUUGGCUAdTdT (SEQ ID NO: 1); siRNA2: GGGCACUCUUUCUGUCACCdTdT (SEQ ID NO: 39); scramble negative control: CAGUCGGGUUUGCGACUGGdTdT (SEQ ID NO: 2).

[0034]FIGS. 22A-22F show upregulation of lrba promoter activity by p53 and E2F transcription factors. The GFP reporter (GFP gene is placed downstream of the lrba gene promoter, designated pLP-GFP) construct was transfected into 293T cells with or without p53 or E2F wild type vector. The pictures were taken one day after transfection. FACS analysis was carried out 60 hours after transfection. The results show that there is 0.7% GFP positive cells in pLP-GFP only (FIGS. 22A and 22D), 6.88% in pLP-GFP+p53 vector (FIG. 22B and 22E), 2.06% in pLP-GFP+pE2F1 vector (FIG. 22c and 22F), suggesting that only a small fraction of cells have detectable lrba promoter activity, p53 and E2F can induce the lrba promoter activity to 9.8, 3-fold respectively. p53 and E2F are important cell cycle and apoptosis mediators. All or most tumors can be characterized as being defective in p53 function.

BRIEF DESCRIPTION OF THE SEQUENCES

[0035]SEQ ID NO: 1 is the human lrba siRNA (siRNA1), including 3' two-dT overhang.

[0036]SEQ ID NO: 2 is the human lrba siRNA, including 3' two-dT overhang.

[0037]SEQ ID NO: 3 is the murine LRBA-α amino acid sequence (FIG. 1A).

[0038]SEQ ID NO: 4 is the murine LRBA-β amino acid sequence (FIG. 1A).

[0039]SEQ ID NO: 5 is the additional amino acid sequence at end of LRBA-β protein sequence (FIG. 1A).

[0040]SEQ ID NO: 6 is the murine LRBA-γ amino acid sequence (FIG. 1A).

[0041]SEQ ID NO: 7 is the additional amino acid sequence at end of LRBA-γ protein sequence (FIG. 1A).

[0042]SEQ ID NO: 8 is the human LRBA amino acid sequence also termed LRBA-α (FIGS. 9 and 3).

[0043]SEQ ID NO: 9 is the amino acid sequence of murine LRBA putative PKA binding sites (FIG. 2A).

[0044]SEQ ID NO: 10 is the amino acid sequence of human LRBA putative PKA binding sites (FIG. 2A).

[0045]SEQ ID NO: 11 is the amino acid sequence of drosophila LRBA putative PKA binding sites (FIG. 2A).

[0046]SEQ ID NO: 12 is the amino acid sequence of drosophila LRBA2 putative PKA binding sites (FIG. 2A).

[0047]SEQ ID NO: 13 is the amino acid sequence of C. elegans LRBA putative PKA binding sites (FIG. 2A).

[0048]SEQ ID NO: 14 is the C-terminal amino acid sequence of murine LRBA also termed LRBA-α (FIG. 3).

[0049]SEQ ID NO: 15 is the C-terminal amino acid sequence of human LRBA (FIG. 3).

[0050]SEQ ID NO: 16 is the C-terminal amino acid sequence of drosophila. LRBA (FIG. 3).

[0051]SEQ ID NO: 17 is the C-terminal amino acid sequence of human CHS1 (FIG. 3).

[0052]SEQ ID NO: 18 is the C-terminal amino acid sequence of human FAN (FIG. 3).

[0053]SEQ ID NO: 19 is the C-terminal amino acid sequence of murine LRBA-β (FIG. 3).

[0054]SEQ ID NO: 20 is the C-terminal amino acid sequence of murine LRBA-γ (FIG. 3).

[0055]SEQ ID NO: 21 is the human LRBA-β amino acid sequence (FIG. 9).

[0056]SEQ ID NO: 22 is the human LRBA-γ amino acid sequence (FIG. 9).

[0057]SEQ ID NO: 23 is the human LRBA-δ amino acid sequence (FIG. 9).

[0058]SEQ ID NO: 24 is the human LRBA-ε amino acid sequence (FIG. 9).

[0059]SEQ ID NO: 25 is the amino acid sequence of HSH domain of murine LRBA (FIG. 10).

[0060]SEQ ID NO: 26 is the amino acid sequence of HSH domain of human LRBA (FIG. 10).

[0061]SEQ ID NO: 27 is the amino acid sequence of HSH domain of drosophila AKAP550 (FIG. 10).

[0062]SEQ ID NO: 28 is the amino acid sequence of HSH domain of C. elegans F10F2.1 (FIG. 10).

[0063]SEQ ID NO: 29 is the amino acid sequence of HSH domain of arabidopsis CDC4L (FIG. 10).

[0064]SEQ ID NO: 30 is the amino acid sequence of HSH domain of dictyostelium LysA (FIG. 10).

[0065]SEQ ID NO: 31 is the amino acid sequence of HSH domain of arabidopsis LYSTL.

[0066]SEQ ID NO: 32 is the inserted amino acid sequence in human LRBA-γ.

[0067]SEQ ID NO: 33 is the 5' end of human lrba-ε isoform with a long 5' UTR (FIG. 15).

[0068]SEQ ID NO: 34 is the first 73 amino acids of the human LRBA (FIG. 15).

[0069]SEQ ID NO: 35 is the partial major coding sequence of human LRBA (FIG. 15).

[0070]SEQ ID NO: 36 is the amino acids encoded by the extra exon interrupting the lrba gene (FIG. 15).

[0071]SEQ ID NO: 37 is the promoter and part of the 5' cDNA sequence of the human lrba gene (FIG. 17).

[0072]SEQ ID NO: 38 is the human lrba siRNA antisense strand, including 3' two-dT overhang.

[0073]SEQ ID NO: 39 is the human lrba siRNA (siRNA2), including 3' two-dT overhang.

[0074]SEQ ID NOs: 40-46 are the primers used in cloning and sequencing of murine lrba cDNA.

[0075]SEQ ID NOs: 47-50 are the primers used in cloning and sequencing of human lrba cDNA.

[0076]SEQ ID NOs: 51-56 are the primers used in RT-PCR analysis of murine lrba expression.

[0077]SEQ ID NOs: 48, 57-61 are the primers used for amplification of human lrba.

[0078]SEQ ID NOs: 62-118 are the human lrba 5' splice donor sites (exons 1-57) (Table 2).

[0079]SEQ ID NOs: 119-175 are the human lrba 3' splice acceptor sites (introns 1-57) (Table 2).

[0080]SEQ ID NO: 176 is the amino acid sequence of p21 RAS motif.

[0081]SEQ ID NO: 177 is the human lrba siRNA (siRNA1).

[0082]SEQ ID NO: 178 is the human lrba siRNA.

[0083]SEQ ID NO: 179 is the human lrba siRNA antisense strand.

[0084]SEQ ID NO: 180 is the human lrba siRNA (siRNA2).

[0085]SEQ ID NO: 181 is the RNA sequence between the two open reading frames of human lrbad (FIG. 16).

[0086]SEQ ID NO: 182 is the predicted full-length amino acid sequence of human LRBA (all five isoforms) (FIG. 9).

DETAILED DISCLOSURE OF THE INVENTION

[0087]The subject invention concerns a method of inhibiting cancerous tumor growth in a patient by suppressing lrba function. Preferably, the method comprises suppressing the functional expression of the lrba gene. Various methods known in the art for suppressing the functional expression of a gene can be utilized to carry out this method of the subject invention. The lrba gene can be disrupted partially (e.g., a leaky mutation), resulting, for example, in reduced expression, or the lrba gene can be fully disrupted (e.g., complete gene ablation). Such mutations can include, for example, point mutations, such as transitions or transversions, or insertions and/or deletions, and the mutation can occur in the coding region encoding lrba or merely in its regulatory sequences. According to the method of the subject invention, functional expression of the lrba gene can be suppressed at any level. In another aspect, the subject invention includes methods of disrupting expression of the lrba gene in vivo or in vitro.

[0088]Using the method of the subject invention, lrba function is suppressed, which causes inhibition of tumor growth. Preferably, the suppression of lrba function results in death of tumor cells. More preferably, lrba function is suppressed to an extent that normal (non-cancerous) cells are not killed.

[0089]Various means for suppression of lrba function can be utilized according to the method of the subject invention. For example, suppression of lrba function can be carried by administration of an agent that directly or indirectly causes suppression of lrba function. Agents suitable for the method of the subject invention include nucleic acids, such as a genetic construct or other genetic means for directing expression of an antagonist of lrba function. Nucleic acid molecules suitable for the method of the invention include, for example, anti-sense polynucleotides, or other polynucleotides that bind to lrba mRNA, for example. Preferably, the nucleic acid molecules administered to the patient are those disclosed herein. Other agents that can be utilized to carry out suppression of lrba function include, for example, peptidomimetics, ribozymes, and RNA aptamers.

[0090]According to the method of the subject invention, polypeptides can be administered to a patient in order to suppress lrba function and inhibit tumor growth. Preferably, the polypeptides utilized are those disclosed herein. More preferably, the polypeptides comprise fragments of the full-length lrba amino acid sequence (including fragments of full-length amino acid sequences of lrba orthologs). Most preferably, the polypeptides comprise amino acid sequences corresponding to the BEACH domain, WD domain, or BEACH and WD domains, of the lrba gene (including lrba gene orthologs). Various means for delivering polypeptides to a cell can be utilized to carry out the method of the subject invention. For example, protein transduction domains (PTDs) can be fused to the polypeptide, producing a fusion polypeptide, in which the PTDs are capable of transducing the polypeptide cargo across the plasma membrane (Wadia, J. S. and Dowdy, S. F., Curr. Opin. Biotechnol., 2002, 13(1)52-56). Examples of PTDs include the Drosophila homeotic transcription protein antennapedia (Antp), the herpes simples virus structural protein VP22, and the human immuno-deficiency virus 1 (HIV-1) transcriptional activator Tat protein.

[0091]According to the method of tumor inhibition of the subject invention, recombinant cells can he administered to a patient, wherein the recombinant cells have been genetically modified to express an lrba gene product, such as a portion of the amino acid sequences set forth in FIG. 1 (SEQ ID NOs: 3-7) or FIG. 9 (SEQ ID NOs: 8 and 21-24), or variants thereof.

[0092]The method of tumor inhibition of the subject invention can be used to treat patient suffering from cancer or as a cancer preventative. The method of tumor inhibition of the subject invention can be used to treat patients suffering from a variety of cancers including, but not limited, to cancer of the breast, prostate, melanoma, chronic myelogenous leukemia, cervical cancer, adenocarcinoma, lymphoblastic leukemia, colorectal cancer, and lung carcinoma.

[0093]In another aspect, the subject invention provides isolated and/or purified nucleotide sequences comprising: (i) a polynucleotide sequence encoding the amino acid sequence set forth in FIG. 1 (SEQ ID NOs: 3-7) or FIG. 9 (SEQ ID NOs: 8 and 21-24), or a complement thereof; (ii) a polynucleotide sequence having at least about 20% to 99.99% identity to the polynucleotide sequence of (i); (iii) a polynucleotide encoding a fragment of the amino acid sequence shown in FIG. 1 (SEQ ID NOs 3-7) or FIG. 9 (SEQ ID NOs: 8 and 21-24); or (iv) an interfering RNA sequence corresponding to the transcript of the polynucleotide set forth in FIG. 1 (SEQ ID NOs: 3-7) or FIG. 9 (SEQ ID NOs: 8 and 21-24), or a fragment of the transcript.

[0094]Nucleotide, polynucleotide, or nucleic acid sequences(s) are understood to mean, according to the present invention, either a double-stranded DNA, a single-stranded DNA, or products of transcription of the said DNAs (e.g., RNA molecules). It should also be understood that the present invention does not relate to the genomic nucleotide sequences encoding lrba in their natural/native environment or natural/native state. The nucleic acid, polynucleotide, or nucleotide sequences of the invention have been isolated, purified (or partially purified), by separation methods including, but not limited to, ion-exchange chromatography, molecular size exclusion chromatography, affinity chromatography, or by genetic engineering methods such as amplification, cloning or subcloning.

[0095]Optionally, the polynucleotide sequences of the instant invention can also contain one or more polynucleotides encoding heterologous polypeptide sequences (e.g., tags that facilitate purification of the polypeptides of the invention (see, for example, U.S. Pat. No. 6,342,362, hereby incorporated by reference in its entirety; Altendorf et al. [1999-WWW, 2000] "Structure and Function of the F_o Complex of the ATP Synthase from Escherichia Coli," J. of Experimental Biology 203:19-28, The Co. of Biologists, Ltd., G. B.; Baneyx [1999] "Recombinant Protein Expression in Escherichia coli," Biotechnology 10:411-21, Elsevier Science Ltd.; Eihauer et al. [2001] "The FLAG® Peptide, a Versatile Fusion Tag for the Purification of Recombinant Proteins," J. Biochem Biophys Methods 49:455-65; Jones et al. [1995] J. Chromatography 707:3-22; Jones et al. [1995] "Current Trends in Molecular Recognition and Bioseparation," J. of Chromatography A. 707:3-22, Elsevier Science B. V.; Margolin [2000] "Green Fluorescent Protein as a Reporter for Macromolecular Localization in Bacterial Cells," Methods 20:62-72, Academic Press; Puig et al. [2001] "The Tandem Affinity Purification (TAP) Method: A General Procedure of Protein Complex Purification," Methods 24:218-29, Academic Press; Sassenfeld [1990] "Engineering Proteins for Purification," TibTech 8:88-93; Sheibani [1999] "Prokaryotic Gene Fusion Expression Systems and Their Use in Structural and Functional Studies of Proteins," Prep. Biochem. & Biotechnol. 29(1):77-90, Marcel Dekker, Inc.; Skerra et al. [1999] "Applications of a Peptide Ligand for Streptavidin: the Strep-tag", Biomolecular Engineering 16:79-86, Elsevier Science, B. V.; Smith [1998] "Cookbook for Eukaryotic Protein Expression: Yeast, Insect, and Plant Expression Systems," The Scientist 12(22):20; Smyth et al. [2000] "Eukaryotic Expression and Purification of Recombinant Extracellular Matrix Proteins Carrying the Strep II Tag", Methods in Molecular Biology, 139:49-57; Unger "Show Me the Money: Prokaryotic Expression Vectors and Purification Systems," The Scientist 11(17):20, each of which is hereby incorporated by reference in their entireties), or commercially available tags from vendors such as such as STRATAGENE (La Jolla, Calif.), NOVAGEN (Madison, Wis.), QIAGEN, Inc., (Valencia, Calif.), or INVITROGEN (San Diego, Calif.).

[0096]Other aspects of the invention provide vectors containing one or more of the polynucleotides of the invention. The vectors can be vaccine, replication, or amplification vectors. In some embodiments of this aspect of the invention, the polynucleotides are operably associated with regulatory elements capable of causing the expression of the polynucleotide sequences. Such vectors include, among others, chromosomal, episomal and virus-derived vectors, e.g., vectors derived from bacterial plasmids, from bacteriophage, from transposons, from yeast episomes, from insertion elements, from yeast chromosomal elements, from viruses such as baculoviruses, papova viruses, such as SV40, vaccinia viruses, adenoviruses, fowl pox viruses, pseudorabies viruses and retroviruses, and vectors derived from combinations of the aforementioned vector sources, such as those derived from plasmid and bacteriophage genetic elements (e.g., cosmids and phagemids).

[0097]As indicated above, vectors of this invention can also comprise elements necessary to provide for the expression and/or the secretion of a polypeptide encoded by the nucleotide sequences of the invention in a given host cell. The vector can contain one or more elements selected from the group consisting of a promoter, signals for initiation of translation, signals for termination of translation, and appropriate regions for regulation of transcription. In certain embodiments, the vectors can be stably maintained in the host cell and can, optionally, contain signal sequences directing the secretion of translated protein. Other embodiments provide vectors that are not stable in transformed host cells. Vectors can integrate into the host genome or be autonomously-replicating vectors.

[0098]In a specific embodiment, a vector comprises a promoter operably linked to a protein or peptide-encoding nucleic acid sequence, one or more origins of replication, and, optionally, one or more selectable markers (e.g., an antibiotic resistance gene). Non-limiting exemplary vectors for the expression of the polypeptides of the invention include pBr-type vectors, pET-type plasmid vectors (Promega), pBAD plasmid vectors (Initrogen) or those provided in the examples below. Furthermore, vectors according to the invention are useful for transforming host cells for the cloning or expression of the nucleotide sequences of the invention.

[0099]Promoters which may be used to control expression include, but are not limited to, the CMV promoter, the SV40 early promoter region (Bernoist and Chambon [1981] Nature 290:304-310), the promoter contained in the 3' long terminal repeat of Rous sarcoma virus (Yamamoto, et al. [1980] Cell 22:787-797), the herpes thymidine kinase promoter (Wagner et al. [1981] Proc. Natl. Acad. Sci. USA 78:1441-1445), the regulatory sequences of the metallothionein gene (Brinster et al. [1982] Nature 296:39-42); prokaryotic vectors containing promoters such as the β-lactamase promoter (Villa-Kamaroff, et al. [1978] Proc. Natl. Acad. Sci. USA 75:3727-3731), or the tac promoter (DeBoer, et al. [1983] Proc. Natl. Acad. Sci. USA 80:21-25); see also, "Useful Proteins from Recombinant Bacteria" in Scientific American, 1980, 242:74-94; plant expression vectors comprising the nopaline synthetase promoter region (Herrera-Estrella et al. [1983] Nature 303:209-213) or the cauliflower mosaic virus 35S RNA promoter (Gardner, et al. [1981] Nucl. Acids Res. 9:2871), and the promoter of the photosynthetic enzyme ribulose biphosphate carboxylase (Herrera-Estrella et al. [1984] Nature 310:115-120); promoter elements from yeast or fungi such as the Gal 4 promoter, the ADC (alcohol dehydrogenase) promoter, PGK (phosphoglycerol kinase) promoter, and/or the alkaline phosphatase promoter.

[0100]The subject invention also provides for "homologous" or "modified" nucleotide sequences. Modified nucleic acid sequences will be understood to mean any nucleotide sequence obtained by mutagenesis according to techniques well known to persons skilled in the art, and exhibiting modifications in relation to the normal sequences. For example, mutations in the regulatory and/or promoter sequences for the expression of a polypeptide that result in a modification of the level of expression of a polypeptide according to the invention provide for a "modified nucleotide sequence". Likewise, substitutions, deletions, or additions of nucleic acid to the polynucleotides of the invention provide for "homologous" or "modified" nucleotide sequences. In various embodiments, "homologous" or "modified" nucleic acid sequences have substantially the same biological or serological activity as the native (naturally occurring) LRBA polypeptides. A "homologous" or "modified" nucleotide sequence will also be understood to mean a splice variant of the polynucleotides of the instant invention or any nucleotide sequence encoding a "modified polypeptide" as defined below.

[0101]A homologous nucleotide sequence, for the purposes of the present invention, encompasses a nucleotide sequence having a percentage identity with the bases of the nucleotide sequences of between at least (or at least about) 20.00% to 99.99% (inclusive). The aforementioned range of percent identity is to be taken as including, and providing written description and support for, any fractional percentage, in intervals of 0.01%, between 20.00% and 99.99%. These percentages are purely statistical and differences between two nucleic acid sequences can be distributed randomly and over the entire sequence length.

[0102]In various embodiments, homologous sequences exhibiting a percentage identity with the bases of the nucleotide sequences of the present invention can have 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99 percent identity with the polynucleotide sequences of the instant invention.

[0103]Both protein and nucleic acid sequence homologies may be evaluated using any of the variety of sequence comparison algorithms and programs known in the art. Such algorithms and programs include, but are by no means limited to, TBLASTN, BLASTP, FASTA, TFASTA, and CLUSTALW (Pearson and Lipman [1988] Proc. Natl. Acad. Sci. USA 85(8):2444-2448; Altschul et al. [1990] J. Mol. Biol. 215(3):403-410; Thompson [1994] Nucleic Acids Res. 22(2):4673-4680; Higgins et al. [1996] Methods Enmol. 266:383-402; Altschul et al. [1990] J. Mol. Biol. 215(3):403-410; Altschul et al. [1993] Nature Genetics 3:266-272).

[0104]The subject invention also provides nucleotide sequences complementary to any of the polynucleotide sequences disclosed herein. Thus, the invention is understood to include any DNA whose nucleotides are complementary to those of the sequence of the invention, and whose orientation is reversed (e.g., an antisense sequence).

[0105]The present invention further provides fragments of the polynucleotide sequences provided herein. Representative fragments of the polynucleotide sequences according to the invention will be understood to mean any nucleotide fragment having at least 8 or 9 successive nucleotides, preferably at least 12 successive nucleotides, and still more preferably at least 15 or at least 20 successive nucleotides of the sequence from which it is derived. The upper limit for such fragments is the total number of polynucleotides found in the full-length sequence (or, in certain embodiments, of the full length open reading frame (ORF) identified herein). It is understood that such fragments refer only to portions of the disclosed polynucleotide sequences that are not listed in a publicly available database or prior art references. However, it should be understood that with respect to the method for inhibiting tumor growth of the subject invention, disclosed nucleotides (and polypeptides encoded by such nucleotides) that are listed in a publicly available database or prior art reference can also be utilized. For example, nucleotide sequences that are lrba orthologs, or fragments thereof, which have been previously identified, can be utilized to carry out the method for inhibiting tumor growth of the subject invention. Thus sequences from the drosophila melanogaster genomic sequence (GENBANK accession number AE003433), cLRBA (GENBANK accession number T20719, Caenorhabditis elegans), aCDC4L (GENBANK accession number T00867, Arabidopsis thaliana), LSVA (GENBANK accession number AAD52096, Dictyostelium discoideum), hFAN (GENBANK accession number NP_--0035711, Homo sapiens), CHS1 (Chediak-Higashi Syndrome 1, GENBANK accession number NP_--000072, Homo sapiens), or mBG (GENBANK accession number AAB60778, Mus musculus) can be utilized to carry out the method of tumor growth inhibition of the subject invention.

[0106]In other embodiments, fragments contain from one nucleotide less than the full length polynucleotide sequence (1249 nucleotides) to fragments comprising up to, and including 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 205, 210, 215, 220, 225, 230, 235, 240, 245, 250, 255, . . . and up to, for example, 1,245 consecutive nucleotides of a particular sequence disclosed herein.

[0107]Yet other embodiments provide fragments (or detection probes) comprising nucleotides within the lrba cDNA sequence, such as the human lrba cDNA sequence (GenBank accession number NM_--006726), including 245 to 458 (G-peptide), 488 to 1424 (HSH domain), 2573-2627 (siRNA1) (SEQ ID NO: 5), 3179 to 4148 (SET domain), 4301 to 4505 (PKA RII binding sites), 6347 to 6749 (WDL repeats), 6878 to 7709 (BEACH domain), 8018 to 8831 (WD repeats).

[0108]Among these representative fragments, those capable of hybridizing under stringent conditions with a nucleotide sequence according to the invention are preferred. Conditions of high or intermediate stringency are provided infra and are chosen to allow for hybridization between two complementary DNA fragments. Hybridization conditions for a polynucleotide of about 300 bases in size will he adapted by persons skilled in the art for larger- or smaller-sized oligonucleotides, according to methods well known in the art (see, for example, Sambrook et al. [1989]).

[0109]The subject invention also provides detection probes (e.g., fragments of the disclosed polynucleotide sequences) for hybridization with a target sequence or an amplicon generated from the target sequence. Such a detection probe will advantageously have as sequence a sequence of at least 9, 12, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 nucleotides. Alternatively, detection probes can comprise 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 205, 210, 215, 220, 225, 230, 235, 240, 245, 250, 255, . . . and up to, for example, 1245 consecutive nucleotides of the disclosed nucleic acids. The detection probes can also be used as labeled probe or primer in the subject invention. Labeled probes or primers are labeled with a radioactive compound or with another type of label. Alternatively, non-labeled nucleotide sequences may be used directly as probes or primers; however, the sequences are generally labeled with a radioactive element (³²P, ³5S, ³H, ¹²⁵I) or with a molecule such as biotin, acetylaminofluorene, digoxigenin, 5-bromo-deoxyuridine, or fluorescein to provide probes that can be used in numerous applications.

[0110]The nucleotide sequences according to the invention may also be used in analytical systems, such as DNA chips. DNA chips and their uses are well known in the art and (see for example, U.S. Pat. Nos. 5,561,071; 5,753,439; 6,214,545; Schena et al. [1996]BioEssays 18:427-431; Bianchi et al. [1997] Clin. Diagn. Virol. 8:199-208; each of which is hereby incorporated by reference in their entireties) and/or are provided by commercial vendors such as AFFYMETRIX, Inc. (Santa Clara, Calif.).

[0111]Various degrees of stringency of hybridization can be employed. The more severe the conditions, the greater the complementarity that is required for duplex formation. Severity of conditions can be controlled by temperature, probe concentration, probe length, ionic strength, time, and the like. Preferably, hybridization is conducted under moderate to high stringency conditions by techniques well known in the art, as described, for example, in Keller, G. H., M. M. Manak [1987] DNA Probes, Stockton Press, New York, N.Y., pp. 169-170.

[0112]By way of example, hybridization of immobilized DNA on Southern blots with ³²P-labeled gene-specific probes can be performed by standard methods (Maniatis et al. [1982] Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York). In general, hybridization and subsequent washes can be carried out under moderate to high stringency conditions that allow for detection of target sequences with homology to the exemplified polynucleotide sequence. For double-stranded DNA gene probes, hybridization can be carried out overnight at 20-25° C. below the melting temperature (Tm) of the DNA hybrid in 6×SSPE, 5× Denhardt's solution, 0.1% SDS, 0.1 mg/ml denatured DNA. The melting temperature is described by the following formula (Beltz et al. [1983] Methods of Enzymology, R. Wu, L. Grossman and K. Moldave [eds.] Academic Press, New York 100:266-285).

[0113]T_m=81.5° C.+16.6 Log[Na+]+0.41 (%G+C)-0.61(% formamide)-600/length of duplex in base pairs.

[0114]Washes are typically carried out as follows: [0115](1) twice at room temperature for 15 minutes in 1×SSPE, 0.1% SDS (low stringency wash); [0116](2) once at T_m-20° C. for 15 minutes in 0.2×SSPE, 0.1% SDS (moderate stringency wash).

[0117]For oligonucleotide probes, hybridization can be carried out overnight at 10-20° C. below the melting temperature (T_m) of the hybrid in 6×SSPE, 5× Denhardt's solution, 0.1% SDS, 0.1 mg/ml denatured DNA. T_m for oligonucleotide probes can be determined by the following formula:

[0118]T_m(° C)=2(number T/A base pairs)+4(number G/C base pairs) (Suggs et al. [1981] ICN-UCLA Symp. Dev. Biol. Using Purified Genes, D. D. Brown [ed.], Academic Press, New York, 23:683-693).

[0119]Washes can be carried out as follows: [0120](1) twice at room temperature for 15 minutes 1×SSPE, 0.1% SDS (low stringency wash; [0121]2) once at the hybridization temperature for 15 minutes in 1×SSPE, 0.1% SDS (moderate stringency wash).

[0122]In general, salt and/or temperature can be altered to change stringency. With a labeled DNA fragment>70 or so bases in length, the following conditions can be used:

TABLE-US-00001 Low: 1 or 2X SSPE, room temperature Low: 1 or 2X SSPE, 42° C. Moderate: 0.2X or 1X SSPE, 65° C. High: 0.1X SSPE, 65° C.

[0123]By way of another non-limiting example, procedures using conditions of high stringency can also be performed as follows: Pre-hybridization of filters containing DNA is carried out for 8 h to overnight at 65° C. in buffer composed of 6×SSC, 50 mM Tris-HCl (pH 7.5), 1 mM EDTA, 0.02% PVP, 0.02% Ficoll, 0.02% BSA, and 500 μg/ml denatured salmon sperm DNA. Filters are hybridized for 48 h at 65° C., the preferred hybridization temperature, in pre-hybridization mixture containing 100 μg/ml denatured salmon sperm DNA and 5-20×10⁶ cpm of ³²P-labeled probe. Alternatively, the hybridization step can be performed at 65° C. in the presence of SSC buffer, 1×SSC corresponding to 0.15M NaCl and 0.05 M Na citrate. Subsequently, filter washes can be done at 37° C. for 1 h in a solution containing 2×SSC, 0.01% PVP, 0.01% Ficoll, and 0.01% BSA, followed by a wash in 0.1×SSC at 50° C. for 45 min. Alternatively, filter washes can be performed in a solution containing 2×SSC and 0.1% SDS, or 0.5×SSC and 0.1% SDS, or 0.1×SSC and 0.1% SDS at 68° C. for 15 minute intervals. Following the wash steps, the hybridized probes are detectable by autoradiography. Other conditions of high stringency which may be used are well known in the art (see, for example, Sambrook et al. [1989] Molecular Cloning, A Laboratory Manual, Second Edition, Cold Spring Harbor Press, N.Y., pp. 9.47-9.57; and Ausubel et al. [1989] Current Protocols in Molecular Biology, Green Publishing Associates and Wiley Interscience, N.Y., each incorporated herein in its entirety).

[0124]A further non-limiting example of procedures using conditions of intermediate stringency are as follows: Filters containing DNA are pre-hybridized, and then hybridized at a temperature of 60° C. in the presence of a 5×SSC buffer and labeled probe. Subsequently, filters washes are performed in a solution containing 2×SSC at 50° C. and the hybridized probes are detectable by autoradiography. Other conditions of intermediate stringency which may be used are well known in the art (see, for example, Sambrook et al. [1989] Molecular Cloning, A Laboratory Manual, Second Edition, Cold Spring Harbor Press, N.Y., pp. 9.47-9.57; and Ausubel et al. [1989] Current Protocols in Molecular Biology, Green Publishing Associates and Wiley Interscience, N.Y., each of which is incorporated herein in its entirety).

[0125]Duplex formation and stability depend on substantial complementarity between the two strands of a hybrid and, as noted above, a certain degree of mismatch can be tolerated. Therefore, the probe sequences of the subject invention include mutations (both single and multiple), deletions, insertions of the described sequences, and combinations thereof, wherein said mutations, insertions and deletions permit formation of stable hybrids with the target polynucleotide of interest. Mutations, insertions and deletions can be produced in a given polynucleotide sequence in many ways, and these methods are known to an ordinarily skilled artisan. Other methods may become known in the future.

[0126]It is also well known in the art that restriction enzymes can be used to obtain functional fragments of the subject DNA sequences. For example, Bal31 exonuclease can be conveniently used for time-controlled limited digestion of DNA (commonly referred to as "erase-a-base" procedures). See, for example, Maniatis et al. [1982] Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York; Wei et al. [1983] J. Biol. Chem. 258:13006-13512. The nucleic acid sequences of the subject invention can also be used as molecular weight markers in nucleic acid analysis procedures.

[0127]The invention also provides host cells transformed by a polynucleotide according to the invention and the production of LRBA (or LRBA ortholog) polypeptides by the transformed host cells. In some embodiments, transformed cells comprise an expression vector containing LRBA, or LRBA ortholog, polynucleotide sequences. Other embodiments provide for host cells transformed with nucleic acids. Yet other embodiments provide transformed cells comprising an expression vector containing fragments of lrba, or lrba ortholog, polynucleotide sequences. Transformed host cells according to the invention are cultured under conditions allowing the replication and/or the expression of the nucleotide sequences of the invention. Expressed polypeptides are recovered from culture media and purified, for further use, according to methods known in the art.

[0128]The host cell may be chosen from eukaryotic or prokaryotic systems, for example bacterial cells (Gram negative or Gram positive), yeast cells, animal cells, plant cells, and/or insect cells using baculovirus vectors. In some embodiments, the host cell for expression of the polypeptides include, and are not limited to, those taught in U.S. Pat. Nos. 6,319,691; 6,277,375; 5,643,570; 5,565,335; Unger [1997] The Scientist 11(17):20; or Smith [1998] The Scientist 12(22):20, each of which is incorporated by reference in its entirety, including all references cited within each respective patent or reference. Other exemplary, and non-limiting, host cells include Staphylococcus spp., Enterococcus spp., E. coli, and Bacillus subtilis; fungal cells, such as Streptomyces spp., Aspergillus spp., S. cerevisiae, Schizosaccharomyces pombe, Pichia pastoris, Hansela polymorpha, Kluveromyces lactis, and Yarrowia lipolytica; insect cells such as Drosophila S2 and Spodoptera Sf9 cells; animal cells such as CHO, COS, HeLa, C127, 3T3, BHK, 293 and Bowes melanoma cells; and plant cells. A great variety of expression systems can be used to produce the polypeptides of the invention and polynucleotides can be modified according to methods known in the art to provide optimal codon usage for expression in a particular expression system.

[0129]Furthermore, a host cell strain may be chosen that modulates the expression of the inserted sequences, modifies the gene product, and/or processes the gene product in the specific fashion. Expression from certain promoters can be elevated in the presence of certain inducers; thus, expression of the genetically engineered polypeptide may be controlled. Furthermore, different host cells have characteristic and specific mechanisms for the translational and post-translational processing and modification (e.g., glycosylation, phosphorylation) of proteins. Appropriate cell lines or host systems can be chosen to ensure the desired modification and processing of the foreign protein expressed. For example, expression in a bacterial system can be used to produce an unglycosylated core protein product whereas expression in yeast will produce a glycosylated product. Expression in mammalian cells can be used to provide "native" glycosylation of a heterologous protein. Furthermore, different vector/host expression systems may effect processing reactions to different extents.

[0130]Nucleic acids and/or vectors can be introduced into host cells by well-known methods, such as, calcium phosphate transfection, DEAE-dextran mediated transfection, transfection, microinjection, cationic lipid-mediated transfection, electroporation, transduction, scrape loading, ballistic introduction and infection (see, for example, Sambrook et al. [1989] Molecular Cloning: A Laboratory Manual, 2^nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.).

[0131]The subject invention also provides for the expression of a polypeptide, derivative, or a variant (e.g., a splice variant) encoded by a polynucleotide sequence disclosed herein. Alternatively, the invention provides for the expression of a polypeptide fragment obtained from a polypeptide, derivative, or a variant encoded by a polynucleotide fragment derived from the polynucleotide sequences disclosed herein. In either embodiment, the disclosed sequences can be regulated by a second nucleic acid sequence so that the polypeptide or fragment is expressed in a host transformed with a recombinant DNA molecule according to the subject invention. For example, expression of a protein or peptide may be controlled by any promoter/enhancer element known in the art.

[0132]The subject invention also provides nucleic acid based methods for the identification of the presence of the lrba gene, or orthologs thereof, in a sample. These methods can utilize the nucleic acids of the subject invention and are well known to those skilled in the art (see, for example, Sambrook et al. [1989] or Abbaszadega [2001] "Advanced Detection of Viruses and Protozoan Parasites in Water," Reviews in Biology and Biotechnology, 1(2):21-26). Among the techniques useful in such methods are enzymatic gene amplification (or PCR), Southern blots, Northern blots, or other techniques utilizing nucleic acid hybridization for the identification of polynucleotide sequences in a sample. The nucleic acids can be used to screen individuals for cancers, tumors, or malignancies associated with dysregulation of the lrba gene or its transcriptional products.

[0133]The subject invention also provides polypeptides encoded by nucleotide sequences of the invention. The subject invention also provides fragments of at least 5 amino acids of a polypeptide encoded by the polynucleotides of the instant invention.

[0134]In the context of the instant invention, the terms polypeptide, peptide and protein are used interchangeably. Likewise, the terms variant and homologous are also used interchangeably. It should be understood that the invention does not relate to the polypeptides in natural form or native environment. Peptides and polypeptides according to the invention have been isolated or obtained by purification from natural sources (or their native environment), chemically synthesized, or obtained from host cells prepared by genetic manipulation (e.g., the polypeptides, or fragments thereof, are recombinantly produced by host cells). Polypeptides according to the instant invention may also contain non-natural amino acids, as will be described below.

[0135]"Variant" or "homologous" polypeptides will be understood to designate the polypeptides containing, in relation to the native polypeptide, modifications such as deletion, addition, or substitution of at least one amino acid, truncation, extension, or the addition of chimeric heterologous polypeptides. Optionally, "variant" or "homologous" polypeptides can contain a mutation or post-translational modifications. Among the "variant" or "homologous" polypeptides, those whose amino acid sequence exhibits 20.00% to 99.99% (inclusive) identity to the native polypeptide sequence are preferred. The aforementioned range of percent identity is to be taken as including, and providing written description and support for, any fractional percentage, in intervals of 0.01%, between 50.00% and, up to, including 99.99%. These percentages are purely statistical and differences between two polypeptide sequences can be distributed randomly and over the entire sequence length.

[0136]"Variant" or "homologous" polypeptide sequences exhibiting a percentage identity with the polypeptides of the present invention can, alternatively, have 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 91, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99 percent identity with the polypeptide sequences of the instant invention. The expression equivalent amino acid is intended here to designate any amino acid capable of being substituted for one of the amino acids in the basic structure without, however, essentially modifying the biological activities of the corresponding peptides and as provided below.

[0137]By way of example, amino acid substitutions can be carried out without resulting in a substantial modification of the biological activity of the corresponding modified polypeptides; for example, the replacement of leucine with valine or isoleucine; aspartic acid with glutamic acid; glutamine with asparagine; arginine with lysine; and the reverse substitutions can be performed without substantial modification of the biological activity of the polypeptides.

[0138]In other embodiments, homologous polypeptides according to the subject invention also include various splice variants identified within the lrba coding sequence.

[0139]The subject invention also provides biologically active fragments of a polypeptide according to the invention and includes those peptides capable of eliciting an immune response. The immune response can provide components (either antibodies or components of the cellular immune response (e.g., B-cells, helper, cytotoxic, and/or suppressor T-cells) reactive with the biologically active fragment of a polypeptide, the intact, full length, unmodified polypeptide disclosed herein, or both the biologically active fragment of a polypeptide and the intact, full length, unmodified polypeptides disclosed herein. Biologically active fragments according to the invention comprise from five (5) amino acids to one amino acid less than the full length of any polypeptide sequence provided herein. Alternatively, fragments comprising 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, 200, 205, 210, 215, 220, 225, 230, 235, 240, 245, 250, 255, . . . and up to 2845 consecutive amino acids of a disclosed polypeptide sequence are provided herein.

[0140]Fragments, as described herein, can be obtained by cleaving the polypeptides of the invention with a proteolytic enzyme (such as trypsin, chymotrypsin, or collagenase) or with a chemical reagent, such as cyanogen bromide (CNBr). Alternatively, polypeptide fragments can be generated in a highly acidic environment, for example at pH 2.5. Such polypeptide fragments may be equally well prepared by chemical synthesis or using hosts transformed with an expression vector containing nucleic acids encoding polypeptide fragments according to the invention. The transformed host cells contain a nucleic acid and are cultured according to well-known methods; thus, the invention allows for the expression of these fragments, under the control of appropriate elements for regulation and/or expression of the polypeptide fragments.

[0141]Modified polypeptides according to the invention are understood to designate a polypeptide obtained by variation in the splicing of transcriptional products of the lrba gene, genetic recombination, or by chemical synthesis as described below. Modified polypeptides contain at least one modification in relation to the normal polypeptide sequence. These modifications can include the addition, substitution, deletion of amino acids contained within the polypeptides of the invention.

[0142]Conservative substitutions whereby an amino acid of one class is replaced with another amino acid of the same type fall within the scope of the subject invention so long as the substitution does not materially alter the biological activity of the polypeptide. For example, the class of nonpolar amino acids include Ala, Val, Leu, Ile, Pro, Met, Phe, and Trp; the class of uncharged polar amino acids includes Gly, Ser, Thr, Cys, Tyr, Asn, and Gln; the class of acidic amino acids includes Asp and Glu; and the class of basic amino acids includes Lys, Arg, and His. In some instances, non-conservative substitutions can be made where these substitutions do not significantly detract from the biological activity of the polypeptide.

[0143]In order to extend the life of the polypeptides of the invention, it may be advantageous to use non-natural amino acids, for example in the D form, or alternatively amino acid analogs, such as sulfur-containing forms of amino acids. Alternative means for increasing the life of polypeptides can also be used in the practice of the instant invention. For example, polypeptides of the invention, and fragments thereof, can be recombinantly modified to include elements that increase the plasma, or serum half-life of the polypeptides of the invention. These elements include, and are not limited to, antibody constant regions (see for example, U.S. Pat. No. 5,565,335, hereby incorporated by reference in its entirety, including all references cited therein), or other elements such as those disclosed in U.S. Pat. Nos. 6,319,691; 6,277,375; or 5,643,570, each of which is incorporated by reference in its entirety, including all references cited within each respective patent. Alternatively, the polynucleotides and genes of the instant invention can be recombinantly fused to elements that are useful in the preparation of immunogenic constructs for the purposes of vaccine formulation or elements useful for the isolation of the polypeptides of the invention.

[0144]The polypeptides, fragments, and immunogenic fragments of the invention may further contain linkers that facilitate the attachment of the fragments to a carrier molecule for the stimulation of an immune response or diagnostic purposes. The linkers can also be used to attach fragments according to the invention to solid support matrices for use in affinity purification protocols. In this aspect of the invention, the linkers specifically exclude, and are not to be considered anticipated, where the fragment is a subsequence of another peptide, polypeptide, or protein as identified in a search of protein sequence databases as indicated in the preceding paragraph. In other words, the non-identical portions of the other peptide, polypeptide, of protein is not considered to be a "linker" in this aspect of the invention. Non-limiting examples of "linkers" suitable for the practice of the invention include chemical linkers (such as those sold by Pierce, Rockford, Ill.), peptides that allow for the connection of the immunogenic fragment to a carrier molecule (see, for example, linkers disclosed in U.S. Pat. Nos. 6,121,424; 5,843,464; 5,750,352; and 5,990,275, hereby incorporated by reference in their entirety). In various embodiments, the linkers can be up to 50 amino acids in length, up to 40 amino acids in length, up to 30 amino acids in length, up to 20 amino acids in length, up to 10 amino acids in length, or up to 5 amino acids in length.

[0145]In other specific embodiments, the polypeptides, peptides, derivatives, or analogs thereof may be expressed as a fusion, or chimeric protein product (comprising the protein, fragment, analog, or derivative joined via a peptide bond to a heterologous protein sequence (e.g., a different protein)). Such a chimeric product can be made by ligating the appropriate nucleic acid sequences encoding the desired amino acid sequences to each other by methods known in the art, in the proper coding frame, and expressing the chimeric product by methods commonly known in the art (see, for example, U.S. Pat. No. 6,342,362, hereby incorporated by reference in its entirety; Altendorf et al. [1999-WWW, 2000] "Structure and Function of the F_o Complex of the ATP Synthase from Escherichia Coli," J. of Experimental Biology 203:19-28, The Co. of Biologists, Ltd., G. B.; Baneyx [1999] "Recombinant Protein Expression in Escherichia coli," Biotechnology 10:411-21, Elsevier Science Ltd.; Eihauer et al. [2001] "The FLAG® Peptide, a Versatile Fusion Tag for the Purification of Recombinant Proteins," J. Biochem Biophys Methods 49:455-65; Jones et al. [1995] J. Chromatography 707:3-22; Jones et al. [1995] "Current Trends in Molecular Recognition and Bioseparation," J. Chromatography A. 707:3-22, Elsevier Science B. V.; Margolin [2000] "Green Fluorescent Protein as a Reporter for Macromolecular Localization in Bacterial Cells," Methods 20:62-72, Academic Press; Puig et al. [2001] "The Tandem Affinity Purification (TAP) Method: A General Procedure of Protein Complex Purification," Methods 24:218-29, Academic Press; Sassenfeld [1990] "Engineering Proteins for Purification," TibTech 8:88-93; Sheibani [1999] "Prokaryotic Gene Fusion Expression Systems and Their Use in Structural and Functional. Studies of Proteins," Prep. Biochem. & Biotechnol. 29(1):77-90, Marcel Dekker, Inc.; Skerra et al. [1999] "Applications of a Peptide Ligand for Streptavidin: The Strep-tag", Biomolecular Engineering 16:79-86, Elsevier Science, B. V.; Smith [1998] "Cookbook for Eukaryotic Protein Expression: Yeast, Insect, and Plant Expression Systems," The Scientist 12(22):20; Smyth et al. [2000] "Eukaryotic Expression and Purification of Recombinant Extracellular Matrix Proteins Carrying the Strep II Tag", Methods in Molecular Biology, 139:49-57; Unger [1997] "Show Me the Money: Prokaryotic Expression Vectors and Purification Systems," The Scientist 11(17):20, each of which is hereby incorporated by reference in their entireties). Alternatively, such a chimeric product may be made by protein synthetic techniques, e.g., by use of a peptide synthesizer. Fusion peptides can comprise polypeptides of the subject invention and one or more protein transduction domains, as described above. Such fusion peptides are particularly useful for delivering the cargo polypeptide through the cell membrane.

[0146]The expression of the lrba gene or lrba gene product (e.g., DNA, RNA, or polypeptide) is disregulated in a variety of cancers, tumors, and/or malignancies. Non-limiting examples of such cancers, tumors, and/or malignancies include prostate cancer, breast cancer, melanoma, chronic myelogenous leukemia, cervical cancer, adenocarcinomas, lymphoblastic leukemia, colorectal cancer, and lung carcinoma. Accordingly, the present invention provides a method for screening, or aiding in the diagnosis of, an individual suspected of having a malignancy or cancer. The subject invention provides methods comprising the steps of determining the amount of lrba in a biological sample obtained from said individual and comparing the measured amount of lrba to the amount of lrba found in the normal population. The presence of a significantly increased amount of lrba is associated with an indication of a malignancy or cancer. Lrba gene product can be detected by well-known methodologies including, and not limited to, Western blots, enzyme linked immunoassays (ELISAs), radioimmunoassays (RIAs), Northern blots, Southern blots, PCR-based assays, or other assays for the quantification of gene product known to the skilled artisan. This info, iation, in conjunction with other information available to the skilled practitioner, assists in making a diagnosis.

[0147]Antisense technology can also be used to interfere with expression of the disclosed polynucleotides. For example, the transformation of a cell or organism with the reverse complement of a gene encoded by a polynucleotide exemplified herein can result in strand co-suppression and silencing or inhibition of a target gene, e.g., one involved in the infection process.

[0148]Polynucleotides disclosed herein are useful as target genes for the synthesis of antisense RNA or dsRNA useful for RNA-mediated gene interference. The ability to specifically inhibit gene function in a variety of organisms utilizing antisense RNA or ds RNA-mediated interference is well known in the fields of molecular biology (see for example C. P. Hunter, Current Biology [1999] 9:R440-442; Hamilton et al., [1999] Science, 286:950-952; and S. W. Ding, Current Opinions in Biotechnology [2000] 11:152-156, hereby incorporated by reference in their entireties). dsRNA (RNAi) typically comprises a polynucleotide sequence identical or homologous to a target gene (or fragment thereof) linked directly, or indirectly, to a polynucleotide sequence complementary to the sequence of the target gene (or fragment thereof). The dsRNA may comprise a polynucleotide linker sequence of sufficient length to allow for the two polynucleotide sequences to fold over and hybridize to each other; however, a linker sequence is not necessary. The linker sequence is designed to separate the antisense and sense strands of RNAi significantly enough to limit the effects of steric hindrances and allow for the formation of dsRNA molecules and should not hybridize with sequences within the hybridizing portions of the dsRNA molecule. The specificity of this gene silencing mechanism appears to be extremely high, blocking expression only of targeted genes, while leaving other genes unaffected. Accordingly, one method for controlling gene expression according to the subject invention provides materials and methods using double-stranded interfering RNA (dsRNAi), or RNA-mediated interference (RNAi). The terms "dsRNAi", "RNAi", "iRNA", and "siRNA" are used interchangeably herein unless otherwise noted.

[0149]RNA containing a nucleotide sequence identical to a fragment of the target gene is preferred for inhibition; however, RNA sequences with insertions, deletions, and point mutations relative to the target sequence can also be used for inhibition. Sequence identity may optimized by sequence comparison and alignment algorithms known in the art (see Gribskov and Devereux, Sequence Analysis Primer, Stockton Press, 1991, and references cited therein) and calculating the percent difference between the nucleotide sequences by, for example, the Smith-Waterman algorithm as implemented in the BESTFIT software program using default parameters (e.g., University of Wisconsin Genetic Computing Group). Alternatively, the duplex region of the RNA may be defined functionally as a nucleotide sequence that is capable of hybridizing with a fragment of the target gene transcript.

[0150]RNA may be synthesized either in vivo or in vitro. Endogenous RNA polymerase of the cell may mediate transcription in vivo, or cloned RNA polymerase can be used for transcription in vivo or in vitro. For transcription from a transgene in vivo or an expression construct, a regulatory region (e.g., promoter, enhancer, silencer, splice donor and acceptor, polyadenylation) may be used to transcribe the RNA strand (or strands); the promoters may be known inducible promoters such as baculovirus. Inhibition may be targeted by specific transcription in an organ, tissue, or cell type. The RNA strands may or may not be polyadenylated; the RNA strands may or may not be capable of being translated into a polypeptide by a cell's translational apparatus. RNA may be chemically or enzymatically synthesized by manual or automated reactions. The RNA may be synthesized by a cellular RNA polymerase or a bacteriophage RNA polymerase (e.g., T3, T7, SP6). The use and production of an expression construct are known in the art (see, for example, WO 97/32016; U.S. Pat. Nos. 5,593,874; 5,698,425; 5,712,135; 5,789,214; and 5,804,693; and the references cited therein). if synthesized chemically or by in vitro enzymatic synthesis, the RNA may be purified prior to introduction into the cell. For example, RNA can be purified from a mixture by extraction with a solvent or resin, precipitation, electrophoresis, chromatography, or a combination thereof. Alternatively, the RNA may be used with no, or a minimum of, purification to avoid losses due to sample processing. The RNA may be dried for storage or dissolved in an aqueous solution. The solution may contain buffers or salts to promote annealing, and/or stabilization of the duplex strands.

[0151]Preferably and most conveniently, dsRNAi can be targeted to an entire polynucleotide sequence set forth herein. Preferred RNAi molecules of the instant invention are highly homologous or identical to the polynucleotides of the sequence listing. The homology may be greater than 70%, preferably greater than 80%, more preferably greater than 90% and is most preferably greater than 95%.

[0152]Fragments of genes can also be utilized for targeted suppression of gene expression. These fragments are typically in the approximate size range of about 20 nucleotides. Thus, targeted fragments are preferably at least about 15 nucleotides. In certain embodiments, the gene fragment targeted by the RNAi molecule is about 20-25 nucleotides in length. In a more preferred embodiment, the gene fragments are at least about 25 nucleotides in length. In an even more preferred embodiment, the gene fragments are at least 50 nucleotides in length.

[0153]Thus, RNAi molecules of the subject invention are not limited to those that are targeted to the full-length polynucleotide or gene. Gene product can be inhibited with an RNAi molecule that is targeted to a portion or fragment of the exemplified polynucleotides; high homology (90-95%) or greater identity is also preferred, but not necessarily essential, for such applications.

[0154]In another aspect of the invention, the dsRNA molecules of the invention may be introduced into cells with single stranded (ss) RNA molecules which are sense or anti-sense RNA derived from the nucleotide sequences disclosed herein. Methods of introducing ssRNA and dsRNA molecules into cells are well-known to the skilled artisan and includes transcription of plasmids, vectors, or genetic constructs encoding the ssRNA or dsRNA molecules according to this aspect of the invention; electroporation, biolistics, or other well-known methods of introducing nucleic acids into cells may also be used to introduce the ssRNA and dsRNA molecules of this invention into cells.

[0155]As used herein, the term "administration" or "administering" refers to the process of delivering an agent to a patient, wherein the agent directly or indirectly suppresses lrba function and inhibits the growth of tumors. The process of administration can be varied, depending on the agent, or agents, and the desired effect. Administration can be accomplished by any means appropriate for the therapeutic agent, for example, by parenteral, mucosal, pulmonary, topical, catheter-based, or oral means of delivery. Parenteral delivery can include for example, subcutaneous intravenous, intramuscular, intra-arterial, and injection into the tissue of an organ, particularly tumor tissue. Mucosal delivery can include, for example, intranasal delivery. Oral or intranasal delivery can include the administration of a propellant. Pulmonary delivery can include inhalation of the agent. Catheter-based delivery can include delivery by iontropheretic catheter-based delivery. Oral delivery can include delivery of a coated pill, or administration of a liquid by mouth. Administration can generally also include delivery with a pharmaceutically acceptable carrier, such as, for example, a buffer, a polypeptide, a peptide, a polysaccharide conjugate, a liposome, and/or a lipid. Gene therapy protocol is also considered an administration in which the therapeutic agent is a polynucleotide capable of accomplishing a therapeutic goal when expressed as a transcript or a polypeptide into the patient.

[0156]As used herein, the term "biological activity" with respect to the nucleotides and polypeptides of the subject invention refers to the inhibition of tumor cell growth or proliferation. Thus, cell-based assays can he utilized to determine whether an agent, such as nucleotide or polypeptide, can be utilized to carry out the method of tumor growth inhibition of the subject invention, as shown in FIGS. 18A-21D.

[0157]The term "means for inhibiting or suppressing lrba function" comprises genetic and non-genetic means for inhibiting or suppressing lrba function. Among the genetic constructs inhibiting lrba function are various "gene delivery vehicles" known to those of ordinary skill in the art, that facilitate delivery to a cell of, for example, a coding sequence for expression of a polypeptide, such as an lrba inhibitor, an anti-sense oligonucleotide, an RNA aptamer capable of inhibiting lrba function, or other genetic construct capable of inhibiting lrba function at the transciption, translation, or post-translation level. Methods of gene silencing and/or knock-down, as described herein, and as known to those of ordinary skill in the art, can be utilized to suppress lrba function, for example. For example, gene therapy comprising administration of a dominant negative lrba mutant can be utilized to carry out the method of tumor inhibition of the subject invention.

[0158]Among the non-genetic means for inhibiting lrba function are pharmaceutical agents, or pharmaceutically acceptable salts thereof, which are preferably administered in a pharmaceutically acceptable carrier.

[0159]The term "patient", as used herein, refers to any vertebrate species. Preferably, the patient is of a mammalian species. Mammalian species which benefit from the disclosed methods of treatment include, and are not limited to, apes, chimpanzees, orangutans, humans, monkeys; domesticated animals (e.g., pets) such as dogs, cats, guinea pigs, hamsters, Vietnamese pot-bellied pigs, rabbits, and ferrets; domesticated farm animals such as cows, buffalo, bison, horses, donkey, swine, sheep, and goats; exotic animals typically found in zoos, such as bear, lions, tigers, panthers, elephants, hippopotamus, rhinoceros, giraffes, antelopes, sloth, gazelles, zebras, wildebeests, prairie dogs, koala bears, kangaroo, opossums, raccoons, pandas, hyena, seals, sea lions, elephant seals, otters, porpoises, dolphins, and whales.

[0160]The terms "lrba", "LRBA", and "Lrba" (italicized and unitalicized) are used herein interchangeably to refer to the LPS-responsive CHS1/beige-like gene or its polypeptide product, and includes lrba homologs (such as human and mouse orthologs), unless otherwise noted.

[0161]The terms "comprising", "consisting of', and "consisting essentially of are defined according to their standard meaning and may be substituted for one another throughout the instant application in order to attach the specific meaning associated with each term.

Materials and Methods

[0162]Murine RNA Isolation and cDNA Synthesis. Total RNA was prepared using the RNEASY kit (QIAGEN, Valencia, Calif.). Poly(A)⁺ RNA was prepared using the FAST TRACK mRNA isolation kit (INVITROGEN, Calsbad, Calif.). RNA was prepared from murine cell lines as well as liver and thymus of C57BL6/J mice per the manufacturers' instructions. RNAs were treated with Rnase-free Dnase I (AMERSHAM PHARMACIA BIOTECH, Piscataway, N.J.) at 10 U/μg of RNA for 30 minutes at 37° C. to destroy genomic DNA. First-strand cDNA synthesis was primed with random DNA hexamers or oligo(dT) primers at 42° C. for 1 hour using the SUPERSCRIPT II RNase H Reverse Transcriptase cDNA Synthesis System (Life Technologies, Inc., Rockville, Md.).

[0163]Cloning and Sequencing of Murine lrba Gene eDNAs. Primers (5'AGAGAAGAGGAGAAGATGTGTGATC3' (SEQ ID NO: 40); and 5'CCAGGCTCCATGCTTGTCTGTGAG3' (SEQ ID NO: 41) forward and reverse, respectively) were designed from a 143 by cDNA fragment obtained from previous gene-trap experiments (Kerr, W. G. et al. Proc. Natl. Acad. of Sci. USA, 1996, 93:3947) and combined with Lambda GT10 forward and reverse primers (5'AGCAAGTTCAGCCTGGTTAAGT3' (SEQ ID NO: 42) and 5'TTATGAGTATTTCTTCCAGGG3' (SEQ ID NO: 43), respectively) to amplify the lrba gene cDNA from a mouse B lymphocyte eDNA library (Mouse lymphocyte 5' stretch cDNA library, CLONTECH, Palo Alto, Calif.). These PCR products were then cloned and sequenced. New primers were then designed from these sequences and further RT-PCR reactions were carried out to extend the cDNA sequence to the 5' or 3' direction. The SMART RACE amplification kit (CLONTECH, Palo Alto, Calif.) was used to amplify 5' cDNA ends using the following lrba-specific primers: 5'ACTGCAGCAAGCTCCTCCTGTTTTCTC3' (SEQ ID NO: 44) and a nested primer: 5'TGGGCGAAGAGCGGAAACAGAAC3' (SEQ ID NO: 45), while for 3' cDNA clones the following primers were used: 5'AGAGAAGAGGAGAAGATGTGTGATC3' (SEQ ID NO: 40) and a nested primer: 5'GAGTGATGGATGATGGGACAGTGGTG3' (SEQ ID NO: 46). PCR conditions for the 5'-RACE and 3'-RACE were as follows using the ADVANTAGE polymerase mix (CLONTECH, Palo Alto, Cailf.): 94° C. for 30 seconds, followed by 5 cycles at 94° C. for 30 seconds, 70° C. for 30 seconds, and 72° C. for 3-5 minutes; 5 cycles at 94° C. for 30 seconds, 68° C. for 30 seconds, and 72° C. for 3-5 minutes; 20 cycles at 94° C. for 30 seconds, 65° C. for 30 seconds, and 72° C. for 3-5 minutes; and a final extension at 72° C. for 30 minutes. After the full-length cDNA sequence of the lrba gene was obtained, several primers were designed to amplify the region of the lrba gene cDNA containing its major open reading frame (ORF). The region containing the major ORF of the lrba gene was then amplified from a single source of C57BL6/J liver mRNA and resequenced to confirm that the lrba cDNAs obtained from liver cells were identical to that amplified from the aligned cDNA fragments amplified from primary and transformed B lymphocytes, indicating that these represent the major mRNAs expressed from the lrba locus. All RT-PCR and RACE products were isolated and purified from agarose gels using the QIAEX II Gel Extraction Kit (QIAGEN; Valencia, Calif.). The purified products were sequenced directly to avoid detecting the mutations introduced during PCT. Both strands of each template were sequenced and the sequence was confirmed by sequence analysis of at least two independent PCR products. PCR products and RACE products were cloned into PCRII vector (TA cloning kit; INVITROGEN, Carlsbad, Calif.) and multiple clones were sequenced. Plasmids were purified from liquid cultures using the QIAGEN plasmid Maxi preparation kit (QIAGEN; Valencia, Calif.).

[0164]Human lrba cDNA Cloning and Sequencing. A search of GENBANK indicated that the murine lrba gene has a high degree of homology to a 7.3 kb human partial cDNA sequence (GENBANK accession numbers M83822) called BGL (Feuchter, A. E. et al. Genomics, 1992, 13:1237), which was thereby tentatively identified as possibly a small fragment of a human lrba gene. The 5' end of the human lrba gene was obtained by using a 5' primer (5'GCCACCTCCGTCTCGCTGC3' (SEQ ID NO: 47)) from the mouse lrba gene cDNA sequence and a 3' primer (5'GGGCACTGGGGAGAATTTCGAAGTAGG3' (SEQ ID NO: 48)) from the human BGL sequence. Human lung, brain, and kidney cDNA libraries (MARATHON cDNA Libraries, CLONTECH, Palo Alto, Calif.) were used as templates for the amplification of the 5' and 3' ends of the human cDNA under the following PCR conditions: 35 cycles at 95° C. for 45 seconds; 60° C. for 15 seconds; 72° C. for 3 minutes. The PCR products were cloned into a TA cloning vector and multiple clones were sequenced. Additional PCRs were carried out with the primers from the 3' cDNA clones obtained as described above to complete the sequence of the human lrba cDNA. The primer pairs used for these additional 3' cDNA clones were 5'TTCAGGCAGTTTTCAGGACCCTCCAAG3' (SEQ ID NO: 49) and 5'TAGTGTCTGATGTTGAACTTCCTCCTG3' (SEQ ID NO: 50). Overlapping regions of the 5' and 3' human lrba cDNAs were compared and merged with the human BGL cDNA in GENBANK to construct, for the first time, a complete sequence for the human lrba gene (GenBank accession number AF216648). The human lrba gene encodes a 319 KD protein that has 2863 amino acids. The amino acid homology between the human and murine lrba gene is 93% (identity 89%, similarity 4%). Like the murine lrba gene, the human lrba gene contains BEACH domain, five WD40 repeats and two novel domains that are defined as followed (FIGS. 9 and 10).

[0165]Northern Blot Analysis. 70Z/3 B lymphoma cells were maintained in RPMI1640 supplemented with 10^-5M 2-mercaptoethanol and 10% fetal bovine serum (FBS). J774 cells were maintained in DMEM supplemented with 10% FBS. 70Z/3 cells were stimulated with 10 ng/ml LPS (Sigma, St. Louis, Mo.) and J774 cells were stimulated with 1 ng/ml LPS for 20 hours. Poly(A)⁺ RNA was prepared from 10⁸ stimulated or unstimulated cells using the FASTRACK isolation kit (INVITROGEN, Carlsbad, Calif.). Poly(A)⁺RNA (5 μg/lane) was size-fractionated by electrophoresis on a 6% formaldehyde/1% agarose gel buffered with MOPS, transferred to a nylon membrane (STRATAGENE, La Jolla, Calif.) by capillary action in 20×SSC and immobilized by UV cross-linking. The filter was probed with a uniformly labeled ³²P probe using the READY-TO-GO DNA labeling kit (AMERSHAM PHARMACIA BIOTECH, Piscataway, N.J.). The probe corresponds to a 2.5 kb PCR product that spans nucleotides 3545-6040 of the murine lrba eDNA. The filter was hybridized with the probe in 2×SSC, 0.5% SDS, 5× Denhardt's containing 100 μg/ml heat denatured salmon sperm DNA at 68° C. overnight. Filters were washed 2 times for 5 minutes at room temperature in 2×SSC/0.5% SDS and 2 times for 30 minutes at 68° C. in 0.1×SSC/0.1% SDS. Hybridization signals were detected and quantitated using a Molecular Dynamics PHOSPHORIMAGER and IMAGEQUANT software.

[0166]RT-PCR Analysis of lrba Expression. The cell lines (70Z/3, BAL17, A20, WEHI231, and S194) used for the RT-PCR were obtained from ATCC (Rockville, Md.). Spleen, brain, lung, and bone marrow were obtained from C57BL6/J mice. The preparation of total RNA and cDNA synthesis were carried out as described above. First strand cDNA reaction products (2 μl) were amplified in a 25 μl PCR reaction using primers that detect three of the lrba isoforms ("5'GGCACAACCTTCCTGCTCAC3'" (SEQ ID NO: 51) and "5'CCTGTCCCCCATTTGAACCC3'" (SEQ ID NO: 52) for the a form: "5'ACGGCTGCTTCTGCACCTTC3'" (SEQ ID NO: 53) and "5'TTTTGGGACAGGGCTTCTCTG3'" (SEQ ID NO: 54) for the β form; "5'GGCACAACCTTCCTGCTCAC3'" (SEQ ID NO: 55) and "5'GCAGATGCTCTCCTCGCTCC3'" (SEQ ID NO: 56) for the γ form). The cycling program was: 94° C. for 30 seconds, followed by 5 cycles at 94° C. for 30 seconds, 70° C. for 30 seconds, and 72° C. for 4 minutes; 5 cycles at 94° C. for 30 seconds, 68° C. for 30 seconds, and 72° C. for 4 minutes; 30 cycles at 94° C. for 30 seconds, 62° C. for 30 seconds, and 72° C. for 4 minutes; and a final extension at 72° C. for 10 minutes.

[0167]Gene and Protein Structure Prediction. Analyses of the nucleotide and amino acid sequences for the murine and human lrba gene were performed using MACVECTOR (Oxford Molecular Group Inc., Oxford, UK). Nucleotide sequence alignments and other analyses were carried out using BLAST (Altschul, S. F. and E. V. Koonin Trends in Biochemical Sciences, 1998, 23:444). SMART (Schultz, J. et al. Nucleic Acids Res., 2000, 28:231), and CLUSTLX (Thompson, J. D. et al. Clinical Orthopaedics & Related Res., 1997, 241) were used for protein secondary structure predictions. For WD repeat prediction, an algorithm developed by Neer et al (Neer, E. J. and T. F. Smith Cell, 1996, 84:175; Garcia-Higuera, I. et al. Biochemistry, 1996, 35:13985; Neer, E. J. et al. Nature, October 1994, 371(6500):812; Smith, T. F. et al. Trends Biochem., 1999, 24:181; Neer, E. J. and T. F. Smith Proc. Natl. Acad. Sci. USA, 2000, 97:960) is used.

[0168]Construction, Expression, and Fluorescence Microscopy of the Lrba-GFP Fusion Protein. A region from the murine lrba cDNA that includes the BEACH and the WD domains 3' to the BEACH domain was inserted "in-frame" and upstream of the coding region of a modified GFP gene cloned in a mammalian expression vector pEGFP-N2 (CLONTECH, Palo Alto, Calif.). Recombinant clones (called pBWEGFP) were picked, plasmid DNAs prepared and sequenced to confirm that no mutations were introduced during these manipulations. Murine 3T3 cells, the macrophage RAW264.7 cells, and human 293 cells were transfected by the FUGEN transfection kit (ROCHE Molecular Biochemicals, Indianapolis, Ind.) or by electroporation (Gene Pulser; BIO-RAD Laboratories, Hercules, Calif.) with 20 μg of linearized recombinant plasmid pBWEGFP DNA as well as the control vector pEGFP at 250V, 500 μF. One day later, cells were cultured in DMEM containing 0.8 μg/ml of G418 (LIFE TECHNOLOGIES, Inc., Rockville, Md.). This medium was changed every day for the first four days. The surviving G418 resistant colonies were isolated and used for further experimentation. For subcellular localization, cells were plated in glass-covered plates at 2.5×10⁵ cells/ml in 2 ml DMEM media with or without LPS at 100 ng/ml. After 12 hours, cells were directly examined by fluorescence microscopy using a fluorescein isothiocyanate filter to detect expression of GFP fusion proteins. Fluorescent photomicrography was performed using Nikon photomicrographic equipment model H-III and image software (NIKON, Tokyo, Japan).

[0169]Confocal Laser Scanning Microscopy. The RAW 264.7 cells stably transfected with the pBWEGFP construct were grown on glass coverslips and stimulated with 100 ng/ml LPS for 24 hours. Golgi and lysosomes were specifically labeled with BODIPY TR ceramide and LysoTracker Red DND-99 (MOLECULAR PROBE, Eugene, Oreg.), respectively, following the manufacturer's protocols. Briefly, for Golgi labeling, cells were washed with PBS three times and incubated for 30 minutes at 4° C. with 5 μM BODIPY TR ceramide, rinsed several times with ice-cold medium, and then incubated in fresh medium at 37° C. for another 30 minutes. For lysosome labeling, medium was changed with pre-warmed fresh medium containing 60-75 nM lysosome probe and the cell sample was incubated for 30 minutes. Finally, the medium was removed, washed with PBS three times, fixed with 3.7% formaldehyde for 10-20 minutes, washed again, and the slides were mounted with DAPI-containing VECTASHIELD medium (VECTOR LABORATORIES, Burlingame, Calif.). Cells were observed on a Zeiss inverted Axiovert 100 M laser scanning confocal microscope. Fluorescence of GFP was excited using a 458/488 nm argon/krypton laser, and emitted fluorescence was detected with 505-530 nm band pass filter. For LysoTracker Red and BODIPY TR, a 633-nm helium/neon laser was used for excitation, and fluorescence was detected with a 585 nm band pass filter, using a 100X oil immersion lens. The co-localization function of LSM510 software (EMBO Laboratory) allows for a reliability of 99% for actual pixels with both fluorophores. The co-localization mask pixels were converted to white color for clarity.

[0170]Immunoelectron Microscopy. The RAW 264.7 cells stably transfected with the pBWEGFP construct were grown in the presence of 100 ng/ml LPS for 24 hours, washed with PBS three times, fixed with 2% paraformaldehyde in phosphate buffer for 1 hour and 4° C., and processed for postembedding immunocytochemistry. The cells were scraped from the dishes they were grown in and pelleted by low speed centrifugation. The pellets were dehydrated in a graded series of ethanol dilutions and embedded in gelatin capsules in LR White resin. The resin was polymerized for 48 hours at 50° C. Ultrathin sections of LR White embedded cells were collected on nickel grids and immunolabeled according to the technique of Haller et al. (Haller, E. M. et al. J. Histochem Cytochem, 1992, 40:1491) with rabbit-anti-GFP (CLONTECH, Palo Alto, Calif.) at 1:20 ration for 1 hour at room temperature, followed by extensive rinsing and then labeling with 10 nm goat-anti-rabbit IgG-gold (AURION, Wageningen, The Netherlands) for 1 hour at room temperature. Control grids were labeled by replacing the primary antibody with normal rabbit serum. After extensive washing, thin sections were stained with uranyl acetate and lead citrate before examination with EM.

[0171]Primers. The gene-specific primers were designed from the partial sequences of the human lrba that were obtained and from BGL sequence in the GenBank (GenBank accession numbers M83822). The sequences of synthetic oligonucleotides used for PCR amplification were as follows: cdc415mar2: CACACAGAGCATTGTAGCAAGCTCCTC (SEQ ID NO: 57); h65-56153: TGCAGACTTGAAGATTCCG (SEQ ID NO: 58); 3CDS: 5'-AAGCAGTGGTATCAACGCAGAGTACTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTV N-3' (SEQ ID NO: 59); h6439: GAGTGATGGATGATGGGACAGTAGTG (SEQ ID NO: 60); cdc415mar1: GGGCACTGGGGAGAATTTCGAAGTAGG (SEQ ID NO: 48); and h5end65': CGAGAAGATGAGAAGATGTGTGATC (SEQ ID NO: 61).

[0172]Human RNA isolation and cDNA synthesis. Total RNA was prepared using the RNeasy kit (QIAGEN, Valencia, Calif.). RNA was prepared from cell lines as well as human prostate tumor tissues and normal adjacent tissue per the manufacturers' instructions. First-strand cDNA synthesis was primed with gene-specific primers or oligo(dT) primers at 42° C. for 1 h-2 h using the SUPERSCRIPT II RNase H Reverse Transcriptase cDNA Synthesis System (Life TECHNOLOGIES, Inc., Rockville, Md.) or PowerScript Reverse Transcriptase (CLONTECH, Palo Alto, Calif.).

[0173]5'-RACE, 3'-RACE and the Cloning of human lrba Gene eDNAs. 5'-RACE, 3'-RACE of hlrba gene were carried out by using the SMART RACE amplification kit (CLONTECH, Palo Alto, Calif.) and the following condition: 5'-RACE: cdc415mar2 as reverse transcription primer, 1-2.5 μg RNAs were used. cdc4l5marl was used for first PCR reaction, h65-56153 ( ) was used for nested primer; 3'-RACE: 3CDS from the kit was used as reverse transcription primer. h5end65' was used for first PCR reaction and h6439 was used for nested PCR primer. The PCR parameters are: 94° C. for 30 seconds, followed by 5 cycles at 94° C. for 30 s, 70° C. for 30 s, and 72° C. for 3-5 min; 5 cycles at 94° C. for 30 s, 68° C. for 30 s, and 72° C. for 3-5 min; 25 cycles at 94° C. for 30 s, 65° C. for 30 s, and 72° C. for 3-5 min; and a final extension at 72° C. for 10 min. All RT-PCR and RACE products were isolated and purified from agarose gels using the QIAEX II Gel Extraction Kit (QIAGEN; Valencia, Calif.). The purified products were sequenced directly to avoid detecting the mutations introduced during PCR. Both strands of each template were sequenced and the sequence was confirmed by sequence analysis of at least two independent PCR products. PCR products and RACE products were cloned into PCRII vector (TA cloning kit; INVITROGEN, Carlsbad, Calif.) and multiple clones were sequenced.

[0174]Mapping of the 5' end of the human lrba gene. The 5' end of the human lrba gene were determined by SMART 5' RACE (Clontech, Palo Alto, Calif.) in tumor tissues and adjacent tissues from prostate, human lung carcinoma, B-cell lymphoma and B-cell lymphoma (AMBION, Austin, Tex.). cdc415marl as reverse transcription primer were used. The lrba gene-specific primer cdc415mar2 was used to prime reverse transcription using 1-2.5 μg RNAs. Then first PCR reaction was performed using gene-specific primer cdc415mar2, h65-56153 was used for nested primer. Products were sequenced both directly and indirectly by first cloning into pCR2.1 vector (TA cloning kit; INVITROGEN, Carlsbad, Calif.).

[0175]Multiple Sequence Alignment. All amino acid sequences were obtained from the SWISS-PROT/TrEMBL database at the Expasy web site (www.expasy.ch). Homologous sequences were searched for using the BLAST server of Expasy. To gather tetraspanin and tetraspanin-like sequences from the data base, BLAST searches were performed using a number of sequences from well established members of the tetraspanin superfamily (i.e. CD81, CD82, CD9, CD53, CD63, UPK, RDS, and ROM). A multiple sequence alignment was initially achieved with the CLUSTAL1× software. The alignment was then improved manually using the GENEDOC software.

[0176]Secondary Structure Prediction. To predict the secondary structure of the HSH domain, two methods (available on the World Wide Web) based on a consensus assignment were used. The first method, Jpred², takes a multiple sequence alignment as input and performs a consensus average of nine different alignment-based secondary structure prediction methods. Alignment-based prediction methods have been demonstrated to have a significantly better accuracy than those using single sequences, and consensus averaging by Jpred² has been shown to increase the accuracy to 72.9%. The use of alignment-based secondary structure prediction methods requires the sequences to have a degree of homology of at least ˜25%.

[0177]RT-PCR Analysis of hlrba Expression. The cell lines MCF7 breast cancer cell line, 293 cell line, pre-B (6417); Raji B cells; HTB4 lung cancer; H322 human lung cancer; A539 human lung cancer used for the RT-PCR were obtained from ATCC (Rockville, Md.). The preparation of total RNA and cDNA synthesis were carried out as described above. First strand cDNA reaction products (2 μl) were amplified in a 25 μl PCR reaction using primers.

[0178]Following examples illustrate procedures for practicing the invention. These examples should not be construed as limiting. All percentages are by weight and all solvent mixture proportions are by volume unless otherwise noted.

Example 1

Cloning and Sequencing of the Murine LRBA CDNA

[0179]An LPS-inducible gene was identified by integration of Gensr1 gene-trap retrovirus (Kerr, W. G. et al. Proc. Natl. Acad. of Sci. USA, 1996, 93:3947). A partial cDNA sequence of the LPS-inducible gene-trap cell clone, 7a65, was used to design PCR primers to amplify the upstream and downstream regions of cDNA from a mouse B lymphocyte library. Initially, a 1.6 Kb cDNA sequence was obtained by this strategy. Sequence analysis confirmed that this 1.6 Kb cDNA sequence contains the original 142 by sequence obtained by gene-trapping (Kerr, W. G. et al. Proc. Natl. Acad. of Sri. USA, 1996, 93:3947). 5' RACE reactions using anti-sense primers from the 5' end of this 1.6 Kb region yield additional 5' cDNA sequences including the 5' UTS of the lrba gene as well as the ATG of its major ORF. Sense strand primers were also designed from the 1.6 Kb cDNA sequence and three 3' RACE fragments of 2.5 Kb, 2 Kb, and 1.4 Kb were obtained that have identical 5' end sequence; however, their 3' ends differ substantially. The amino acid sequence of the major ORF in the murine lrba cDNA is shown in FIG. 1A. The human lrba orthologue is obtained as described in the Experimental Procedures section.

[0180]Sequence analysis of the lrba cDNAs indicated the existence of three isoforms with identical 5' ends that differ at their 3' termini. These isoforms include a 9903 by form (lrba-a), a 9396 by form (lrba-β) and 8854 by form (lrba-γ) encoding proteins of 2856, 2792, and 2779aa, respectively. All three ORFs begin with the same Kozak consensus ATG at nucleotide 308. The first 2776aa of the B form are identical to the first 2776aa of the a form, while the 16aa at its C-terminus are unique to it. The first 2769aa of the γ form are identical to the first 2769aa of the a and β forms with its C-terminal 10aa unique to it; the a form has its C-terminal 80aa unique to it (FIG. 1). Homology search indicates that all lrba isoforms have a BEACH domain (Nagle, D. L. et al. Nature Genetics, 1996, 14:307); however, the lrba-a isoform has 5 WD repeats, lrba-β has 3 WD repeats while lrba-γ lacks WD repeats (FIG. 1B). The isoform specific unique coding sequences and the associated 3' untranslated sequence (totally 1267 by for α form, 761 by for β form, and 845 by for γ form) show no significant homology with each other. Interestingly, only the a form has an AATAAA sequence for polyA recognition and a TGA stop codon, while the β and γ forms have TAA stop codons.

Example 2

lbra Orthologues Exist in Diverse Organisms and Belong to a Novel Gene Family

[0181]Homology analysis revealed that lrba has significant homology with the partial protein sequence DAKAP550 (Han, J. D. et al. Jour. Biol. Chem., 1997, 272:26611), which is an AKAP, and with AKAP550 (GENBANK accession number AAF46011) predicted from the Drosophila genomic sequence (GENBANK accession number AE003433). A longer sequence for this gene is predicted from the genomic sequence and is designated dLRBA, which is identical to AKAP550 except that it has an additional 160aa at its N-terminus. As used herein, the first letter of the genus is placed before the gene's name to distinguish the lrba genes of different species. Thus, DAKAP550 is a partial sequence of dLRBA and AKAP550. Amino acid alignment analysis shows that the murine LRBA protein has 85% aa identity with human LRBA, 51% aa identity with dLRBA and 35% aa identity with the C. elegans CDC4L gene (GENBANK accession number T20719) (designated cLRBA for clarity) (FIG. 1B). This homology analysis shows that the lrba and DAKAP550 genes are othologues based on their high homology that extends from their N terminus to the C terminus (FIGS. 1-3 and Table 1). Furthermore, two putative PKA binding sites are found in all lrba orthologues (FIGS. 2A and 2B) and are structurally similar to the B1 and B2 RII binding sites of DAKAP550, a protein that has been demonstrated to bind PKA in vitro and in vivo (Han, J. D. et al. Jour. Biol. Chem., 1997, 272:26611). This region is highly conserved in lrba orthologues in mice, man, Drosophila, and C. elegans (FIG. 2A) and potentially provides another two PKA binding sites for DAKAP550. Unexpectedly, the B1 and B2 sites of DAKAP550 are not found in other LRBA proteins; they may be species-specific and these potential RII binding sites need to be confirmed by biochemical studies.

[0182]Table 1 shows the protein homology between LRBA and dLRBA, mBG, and hFAN, showing the precentage of identity, and positive gaps. The positions of each fragment are also indicated.

TABLE-US-00002 TABLE 1 Identities Positives Length (aa) mLBA dLBA 92-405 47-394 51% 73% 314 405-959 601-1160 55% 75% 555 998-1576 1542-2127 36% 53% 579 1793-2856 2642-3727 56% 74% 1064 mLBA cLBA 65-946 164-1057 42% 61% 882 1300-1571 1065-1333 39% 59% 271 1787-2856 1436-22512 47% 64% 1070 mLBA hLBA 1-2856 1-2863 85% 88% 2856 mLBA mBG 1934-2839 1460-2335 27% 43% 906 mLBA hFAN 2038-2841 163-913 29% 45% 803

[0183]These lrba orthologues also have a highly conserved long C-terminal region (around 1000 amino acids) shared with a group of proteins including CHS1/BG (Perou, C. M. et al. Nature Genetics, 1996, 13:303; Kingsmore, S. F. et al. Jour. Invest. Med., 1996, 44:454), FAN (Adam-Klages, S. et al. Cell, 1996, 86:937), LVSA (Kwak, E. et al. Cell, 1999, 10:4429) proteins (FIGS. 2A and 2B), and a number of anonymous ORFs. They constitute a new gene family. The conserved region contains an unidentified region followed by one BEACH domain and several WD repeats. Several WD repeats are found in the unidentified region of homology in these genes when about 1000 aa of C-terminal sequence is searched for WD repeats; however, no WD repeat is predicted when this region is analyzed alone (data not shown). Thus, this region is designated herein as WD repeat-like domain (WDL). In aggregate, and not to be limited by theory, the entire WDL-BEACH-WD (WBW) structure may have a precise functional role since the WD repeats found in the WBW structures of different beige-like genes have a higher degree of homology with each other than with other WD repeats in proteins that lack a BEACH domain (FIG. 3). This homology analysis suggests the evolutionary conservation of the WBW structure in a gene family that includes lrba, chs1/beige, FAN, lvsA, and other unidentified ORFs in GENBANK. However, the BEACH domain can exist without WD motifs as in the case of lrba-γ (FIGS. 1A, 1B and 3). It is shown herein that all BEACH domains have an SH3 binding site (consensus sequence PXXP), an SH2 binding site (consensus sequence YXXhy) (Pawson, T. and J. D. Scott Science, 1997, 278:2075), and a tyrosine kinase phosphorylation site (consensus sequence: (RK)-x(2,3)-(DE)-x(2,3)-Y) (Patschinsky, T. et al. Proc. Natl. Acad. Sci. USA, 1982, 79:973; Hunter, T. J. Biol. Chem., 1982, 257:4843; Cooper, J. A. et al. J. Biol. Chem., 1984, 259:7835), as shown in FIG. 3. These putative binding sites show that WBW proteins may interact with multiple signal transduction components.

Example 3

Analysis of LRBA MRNA Expression

[0184]Northern blot analysis indicates a single mRNA of about 10 Kb encoding the lrba gene is present in LPS-induced J774 macrophages and 70Z/3 B cells (FIG. 4A), as well as in other B cell lines (WEHI231, BCL1) and the macrophage cell line, RAW264.7 [RAW267.4]. The size (˜10 Kb) of the transcript is consistent with the cDNA sequence analysis described herein (9903 by for lrba-a). The expression of the lrba gene is significantly up-regulated in LPS-induced J774 macrophage cells as the lrba mRNA is nearly undetectable in J774 cells in the absence of LPS stimulation. The level of lrba mRNA is increased by 3 fold in 70Z/3 B cells (FIG. 4A) using 13-actin mRNA as an internal standard. The upregulation of lrba expression in the B cell lines is consistent with the FACS analysis of lacZ induction in the 7a65 gene-trap cell clone (Kerr, W. G. et al. Proc. Natl. Acad. of Sci. USA, 1996, 93:3947).

[0185]A multiplex RT-PCR assay was also developed that can simultaneously detect the expression of the lrba mRNA isoforms. RT-PCR analysis of lrba mRNA (FIGS. 4B and 4C) shows that lrba-β mRNA is expressed in all cell lines and tissues analyzed; however, lrba-a mRNA is absent in 70Z/3, lung and bone marrow and is less abundant in spleen and lung, suggesting that these different isoforms may have discrete functions in different tissues.

Example 4

Subcellular Localization of LRBA-GFP Fusion Protein Shifts Upon LPS Stimulation

[0186]All mutations in beige or chs1 genes result in truncated proteins that lack the BEACH and COOH terminal WD repeats (Certain, S. et al. Blood, 2000, 95:979). This region may contain sequences critical to the function of chs1/beige and lrba genes. In particular, the ability of their gene products to associate with intracellular vesicles to influence their trafficking may be lost in these truncated mutants. Therefore, a GFP fusion with the BEACH-WD region of lrba called BW-GFP was created. As shown in FIGS. 5A-5I, fluorescence microscopy of RAW 267.4 cells stably transfected with an expression vector encoding the BW-GFP fusion shows that the BW-GFP protein is present in the cytosol with rare cells showing a vesicular staining pattern in the absence of LPS stimulation (FIG. 5A). However, this vesicular staining pattern is dramatically increased in these cells following LPS stimulation (FIG. 5B). Both the percentage of cells and the degree of vesicular staining in each cell are increased following LPS stimulation. RAW267.4 cells stably transfected with a GFP control construct show no change in their GFP fluorescence pattern upon LPS stimulation (FIG. 5C).

[0187]To determine which vesicular compartments the BW-GFP fusion localizes to, the RAW264.7 cells stably transfected with the pBWEGFP construct stained with a lysosome specific dye (FIG. 5E) and trans-Golgi specific dye (FIG. 5H) were analyzed with confocal microscopy. The merged pictures show that some LRBA-GFP proteins are co-localized with lysosomes (FIG. 5F, white area) and co-localization with the trans-Golgi complex (FIG. 5I, white peri-nucleus area).

[0188]Immunogold labeling experiments were also performed that show the LRBA-GFP fusion protein can be found in association with the Golgi complex (FIG. 6D), lysosomes (FIG. 6B and 6F), endoplasmic reticulum (FIG. 6C), plasma membrane (FIG. 6E), perinuclear ER (FIG. 6E), and endocytic vacuole (FIG. 6A, as the gold particles are labeling a clathrin coated endocytic vacuole, which indicates that it is involved in endocytosis and not exocytosis). The immunoelectron microscopy results agree well with the observations made by fluorescence microscopy and confocal fluorescence microscopy.

Example 5

Exon/Intron Structure of the Human LRBA Gene

[0189]The genomic locus of lrba gene is composed of 58 exons and 57 introns, spinning over a 700 K bps genomic sequence. Exon 1 and exon 2 contain the first part of the 5' UTR, exon 2 contains the rest of the 5'UTR and the start methione, while exon 58, the final exon, contains part of the WD5 and the whole 3'UTR. There are two considerably large exons--exon 24 (1059 bps) and exon 58 (1148 bps). The entire SET domain is encoded by one exon--exon 24, while other domains are econded by multiple exons. The remaining exons range in size from 33 to 435 bps, most are below 200 bps. All exon/intron junctions conform to the GT-donor/AG-acceptor rule (Breathnach and Chambon, 1981) (Table 1). The function of the lrba gene is defined by its domain structure consisting of BEACH domain, WD repeats, HSH domain and SET domain and potential RII binding sites. The BEACH domain is encoded by exons 45 to 51. The 5-WD repeat domain is encoded by exons 54 to 58. Isoforms are formed by splicing with splicing site inside the exons of the other isoforms.

[0190]Table 2 shows the exon/intron organization of the human lrba gene.

TABLE-US-00003 TABLE 2 Exon/Intron Organization of the Human lrba Gene Exon Exon SEQ ID Intron Intron SEQ ID No size(bp) 5'Splice donor NO: No size(kb) 3'Splice acceptor NO: 1 -67 AGT ATC TGG gtgaggaag 62 I 0.340 tccaataag GGT TTG GCG 119 2 435 TTT AAC CTG gtaagtcca 63 II 85.572 ccttgtaag TTG GTA GGA 120 3 232 TGA TAG CAG gtatgattt 64 III 0.217 tgtttccag ATC TTT TGG 121 4 101 GGA CGA TGG gtaaaaaaa 65 IV 7.224 tcttcatag CCT CCA CAT 122 5 96 AGT GCT GCA gtaagtaa 66 V 4.458 ttcctttag GCT ATT GCA 123 6 122 TTT GTA TTG gtatgtatt 67 VI 0.089 tctttatag TTT CAG AAC 124 7 127 CCA CAA AAG gtacatgat 68 VII 0.674 cttctgcag TGG TAT ATG 125 8 120 ACT AGC GAT gtaagtagt 69 VIII 1.266 cttttacag ACC TTT GAC 126 9 147 GGA TAC AAG gtagtttgc 70 IX 5.537 ttcttagag GGT ACA TTT 127 10 198 ATG CTC CAG gtactaact 71 X 0.192 tcttacaag GAT GTA AAG 128 11 134 GAC TAT ATG gtgagtgcc 72 XI 1.971 aaattctag TTC AAC CTT 129 12 109 CTT GAA AAG gtaaagtat 73 XII 0.306 tttttgcag TCT TCC AAA 130 13 153 CCA GCC AAG gtaatatat 74 XIII 5.619 attctgtag GTT CAA CTG 131 14 169 AAG GAT TAG gtatataat 75 XIV 2.233 ttttaaaag ATG GAC CGC 132 15 80 GTG ATG AAG gtaggttca 76 XV 1.282 tttttgaag GAT TCT GGA 133 16 63 ATG CAT GAG gtaatatat 77 XVI 3.245 tgattatag GAT GAC AAT 134 17 98 TGG GTT ACG gtaagagtt 78 XVII 20.299 ttcattcag TGT TAT CTA 135 18 93 GGC CCC AAA gtaagtatg 79 XVIII 1.209 taattgcag GAG GAA AGC 136 19 109 CTG TTT GAG gtaggaatg 80 XIX 0.738 cttctgtag ATT CTT ATA 137 20 82 AAA CCC CTC gtatgtatg 81 XX 2.220 agattacag AGA TAC TAA 138 21 124 AAA CAG GAG gtaagctga 82 XXI 0.318 aattttcag GAG CTT GCT 139 22 193 CAT TCA AAG gtaagtttc 83 XXII 14.688 ttcacctag GTC ACT TTT 140 23 1059 GTG CTT GAG gtgatttta 84 XIII 0.982 tgtattaag ATA TCA AGG 141 24 179 GTG GAG AAG gtttgtcta 85 XXIV 1.148 tttggacag CCA TTC AAC 142 25 154 TCG GCT ACA gtaaggact 86 XXV 0.423 tctttatag CAT GAA CTG 143 26 181 TCC GAC TAG gtgagctgc 87 XXVI 4.039 aaattacag TTT GTG GAG 144 27 122 GCA GCG AAG gtaagtata 88 XXVII 0.450 cttaaatag AGC CCA GTG 145 28 108 AGA GAC ATA gtaagttac 89 XXVIII 12.124 ttttcccag GAG GAT AGC 146 29 160 CAC TCT CTG gtaagtttg 90 XXIX 3.193 atgatatag AAA TCA CAC 147 30 442 TTT TGA CAG gtactgata 91 XXX 10.928 ttattacag AAG TGT CAT 148 31 134 AAT CAC CAG gtgagttag 92 XXXI 8.713 cttttatag GCA GTA GAT 149 32 79 AAA TAT GAG gtatttaag 93 XXXII 1.909 tttccttag TAT TAC AGA 150 33 134 AAG GAA CAA gtaagtggt 94 XXXIII 7.964 ttaaaatag GTC TGG TTT 151 34 62 TGT TCT CAG gtgagtggc 95 XXXIV 35.939 tttttatag GAG TGG CAA 152 35 65 ATG AGG AAG gtaatttat 96 XXXV 26.429 ttcttacag GTT GCT TAG 153 36 109 GAA TTT GAG gtaggttac 97 XXXVI >28.963 ctctccaag TCA CTG TGT 154 37 167 TGC AGT GAG gtaaaggga 98 XXXVII 83.886 cattgtag TCG TCC TCT 155 38 125 TGG AAC ATG gtcagtgg 99 XXXVIII 1.891 atgttttag TGT GCA TTT 156 39 33 ACA GCA AAG gtaagcatt 100 XXXIX 6.179 tcatttcag CCA CAG ATG 157 40 147 ATC TTG CCG gtaaatttg 101 XXXX 2.515 ttttggcag GTC CTG TTA 158 41 137 GAC CCC AAG gt 102 XXXXI 96.572 cctcattag ATC TTG GCA 159 42 118 CAA ACA GAG gtaatgtgt 103 XXXXII 3.088 ctgttgtag TTG CTG TGA 160 43 103 TCA AAC CAG gtactgttt 104 XXXXIII 15.997 ttcttgcag ACG TAT TTC 161 44 116 CGA TAG CAG gtaacctaa 105 XXXXIV 3.840 ccctatcag GAC GGA GTT 162 45 113 TTG TCC AAG gtaatttct 106 XXXXV 30.846 tattggcag CCA ATA GGA 163 46 141 CTA AGA ATA gtaagttca 107 XXXXVI 1.015 attttttag GAA CCC TTT 164 47 120 GAT ATT AAG gtacagaaa 108 XXXXVII 19.536 tttatatag GAG TTG ATC 165 48 153 AAC AGA TTG gtaagataa 109 XXXXVIII 65.358 ttttttcag GCC CTG GAG 166 49 169 TTG AGA GAG gtaagttat 110 XXXXIX 24.093 ccttttcag? GCT GTT GAA 167 50 90 ATG CAA CTG gtaagtgct 111 XXXXX 4.443 ctcctgcag AGT CCA TTG 168 51 178 ACC TTC CTG gtaagtaaa 112 XXXXXI 5.563 gaattccag CTC ATC AAG 169 52 63 CTC TCA TAG gtctgtcac 113 XXXXXII 5.176 ttcttacag CCA GCA ATA 170 53 156 CAG ACA CAG gtaattttc 114 XXXXXIII 7.441 gcattacag GAA GAT TGA 171 54 168 ACC CAG GCA gtaagtatg 115 XXXXXIV 16.043 ttcctaaag GTG AGA CTG 172 55 102 GTT CAC AAG gtaaacctg 116 XXXXXV 3.286 tcttctcag AAG GAC CAT 173 56 197 AAC ATA AGA gtgagtgcc 117 XXXXXVI 4.444 gtctcacag GCC ATC CAG 174 57 152 CGA CCA GAG gtaacactg 118 XXXXXVII 12.028 ttctcctag GTG CAT CAT 175 58 1148 Total 9936 >716.138

Example 6

Molecular Phylogenic Relationship of HLRBA Proteins with Other WBWs

[0191]Phylogenic analysis of the WBW family reveals that the members can be grouped into two major families, as shown in FIG. 12. One family is composed of proteins from C. elegans, D. melanogaster, H. sapiens, S. pombe, S. cerevisiae, A. thaliana, D. discoideum, and the other family contains proteins from H. sapiens. M. musculus, Dr. melanogaster, C. elegans, A. thaliana, B. taurus, L. major. These can be further sub-grouped into five distinct subfamilies, each of which may contains every species from the very ancient unicellular eukaryote to human. Lrba in human and murine, AKAP550 in fruit fly, F10F2.1 in C. elegans are orthologs as indicated previously, while NBEA and CG1332 are very close to lrba gene. Lrba, CHS1/beige and FAN belong to the same family. Despite the divergence of these species over several hundred million years, there is a high degree of sequence conservation in the BEACH domain, which may suggest an important role in the life of the cell concerning the BEACH domain.

Example 7

The Human LRBAε Alternative Transcript has Two Inframe ORF

[0192]The ORF prediction shows there are two in frame ORFs in the human lrbaε alternative transcript. One ORF encodes a 72 amino acid protein, another encodes a 2782 amino acid protein. A very conserved motif (p21 RAS motif IV(LLGVGGFD (SEQ ID NO: 176))) is missing from both proteins as a result of the disruption. Both ATGs are in the Kozak sequence and thus could serve as translation initiation sites. According to the translation scanning theory, the translation of the first ORF should not be a problem. There are three possibilities for the translation of the second ORF. The first possibility is leaking scanning, meaning that some ribosomes do not recognize the first ATG, but recognize the later ATG. However, there are four ATGs before the main ATG. and there is a long stem secondary structure between the two ORFs. Therefore, it is unlikely that the leaking model is the mechanism of translation. The second possibility is reading through translation, meaning that the translation machinery ignores the stop codon and reads through it. However, there are 10 stop codons between the two ORFs. Likewise, this is unlikely. A third possibility is that IRES (internal ribosome entry signal) translation is cap-independent. There is no homologous sequence between IRES, but they have complex secondary structure, such as long stem secondary structure. The RNA sequence between the two ORFs of human lrbac can form a long stem structure, which could further make the leaking scanning or reading through impossible. Some mRNAs encoding pro-apoptic proteins, including Apaf-1 and DAP5 are also translated via an IRES element. IRES-independent initiation is sometimes utilized during mitosis. The numberous mRNAs whose 5' UTR structures likely interfere with the 5' cap-dependent ribosome are good candidates for the presence of an TRES. However, the prediction of an IRES from only looking at the 5' UTR could be strengthened by a better understanding of the structural components that comprise these IRES elements.

Example 8

Identification of the Five Isoforms of the Human LRBA Gene

[0193]Four isoforms that encode four different proteins are present in human lrba gene, among which three isoforms differ at C-terminal: h-lrbaa has five WD repeats, h-lrbaβ lacks WD repeats, h-lrbaδ lacks WD repeats and part of BEACH domain. The fourth isoform h-lrbaγ has a YLLLQ (SEQ ID NO: 32) additional sequence between BEACH domain and WD repeats. This insertion isoform also exists in murine LRBA gene, and the 15 by nucleotide sequence insertion remains unchanged. All the isoforms are summarized as shown in FIG. 13.

TABLE-US-00004 TABLE 3 Pattern of alternative Isoforms Positions Features Implications splicing* 1 There is one Disrrupt the Bicistron may exist in Cassette α extra exon coding sequence eukaryotes. Ribosome between Exon2 of the lrba gene Internal entry sequence. and Exon 3 at the N-terminus 2 Poly(A) There is a 312 bp 1. The BEACH domain is Multiple β alternative Alu repeat not a minimum domain, Polyadenylation splicing after sequence at the could be actually Site Exon 48 5'UTR, splitting composed of two the BEACH domains. 2. The Alu domain at two sequence may regulate third into two the translation of LRBA potential gene or other gene. domains 3 15 bp insertion The insertion Leucine (L) is a Retained intron γ before Exon encodes a hydrophobic amino acid 51, just after YLLLQ peptide and may be involved in BEACH insertion into the protein-protein domain and LRBA protein. interaction(as Leucine before WD Zipper structure). That repeats there are three consecutive Ls in a short sequence is unusual and Y could be a potential target for phosphorilation. 4 Poly(A) The isoform Although BEACH Multiple δ alternative doesn't have WD domain and WD repeats Polyadenylation splicing after repeats but often stay together, they Site Exon 52 BEACH domain are separate domain and can exist and function separately. 5 An additional Alternative. LRBA may use different Multiple ε exon at 5' end promoter and promoters to regulate the Promoters (Exon 5'-1) transcription start expression of LRBA. before Exon 1 site

[0194]The LRBA gene and five isoforms of the LRBA gene are disclosed and characterized herein. Northern blot experiments show that expression of lrba is upregulated 2-4 fold following LPS stimulation of B cells and macrophages. A homology search of GENBANK reveals that lrba gene has othologues in C. elegans, Drosophila, mice and humans and paralogues in diverse species ranging from yeast to human. These genes define a new protein family that are designated the WBW gene family herein because the members share an evolutionarily conserved structure over a long protein sequence (around 1000 aa). The analysis of subcellular localization with a BEACH-WD-GFP fusion protein described herein provides the first direct evidence that the lrba member of the WBW' family can physically associate with various vesicular compartments in cells. Furthermore, it is proposed that the lrba gene is also an AKAP, suggesting that WBW family proteins may have microtubule and PKA binding properties like AKAPs (Colledge, M. and J. D. Scott Trends in Cell Biology, 1999, 9:216). Studies of FAN suggest that WBW proteins can bind to cytoplasmic tails of activated receptors via their WD repeats (Adam-Klages, S. et al. Cell, 1996, 86:937).

[0195]The evidence suggests that WBW proteins are involved in intracellular vesicle trafficking. For example, the strikingly enlarged vesicles in beige/CHS cells occur in membrane-bound organelles. The CHS1/BG protein has a similar modular architecture to the VPS 15 and Huntington proteins that are associated with the membrane fraction (Nagle, D. L. et al. Nature Genetics, 1996, 14:307) and the lvsA gene that is essential for cytokinesis (Kwak, E. et al. Cell, 1999, 10:4429)--a process that also involves fusion of intracellular vesicles (Jantsch-Plunger, V. and M. Glotzer Curr. Biol., 1999, 9:738; Heese, M. et al. Curr. Opin. Plant Biol., 1998, 1:486). FAN may also be involved in vesicle trafficking since FAN-deficient mice, after cutaneous barrier disruption, have delayed kinetics of skin recovery that requires secretion of vesicles (Kreder, D. et al. EMBO Journal, 1999, 18:2472; Elias, P. M. J. Invest. Dermatol., 1983, 80:44s). However, there is no direct evidence that these WBW proteins directly associate with vesicles. In contrast, others found unexpectedly by Western blot that the BG, LVSA, and DAKAP550 proteins are present in the cytosolic fraction of cells and not in the membrane fraction (Kwak, E. et al. Cell, 1999, 10:4429; Perou, C. M. et al. Jour. Biol. Chem., 1997, 272:29790) or cytoskeleton (Han, J. D. et al. Jour. Biol. Chem., 1997, 272:26611). This paradox can be explained by hypothesizing (without being limited by theory) that these proteins are not constitutively associated with vesicles, but rather associate with vesicles under certain conditions like LPS stimulation. This hypothesis agrees well with the observation that an LRBA-GFP fusion protein is located in the cytosol; however, it becomes associated with vesicles following activation of the cells by LPS stimulation. Confocal microscopy also shows this fusion protein co-localizes with the trans-Golgi and lysosomes. Immunoelectron microscopy further demonstrates that it is also localized to endoplasmic reticulum and the plasma membrane as well as the trans-Golgi complex and lysosomes. Therefore, it is established herein that the BEACH-WD-GFP fusion protein is associated with the vesicular system. This may be true for the intact LRBA protein as well as for other WBW proteins like CHS1/BG, LVSA, and FAN, since they share high homology with the region in mouse lrba that was used for the GFP fusion experiment. The activation-triggered vesicle trafficking hypothesis is further supported by the following: (1) BEACH domain contains a tyrosine phosphorylation site, (2) the WD repeats binding site of FAN contains a serine residue (Adam-Klages. S. et al. Cell, 1996, 86:937), it is possible that this serine is a target of serine kinases, as some experiments suggest that the WD repeats binding requires phosphorylation of the WD binding sites (Skowyra, D. et al. Cell, 1997, 91:209) and (3) MAPK was suggested to control the movement of lytic granules of NK cells (Wei, S. et al. Jour. Exper. Med., 1998, 187:1753). Potentially, WBW protein functions are activated by tyrosine and/or serine/threonine kinases following stimulation by agents like LPS. Although the GFP fusion experiment previously described does not demonstrate that the BEACH domain and/or the WD repeats in LRBA directly associate with intracellular vesicles, it is proposed that the BEACH domain binds to vesicles while the WD repeat domains bind to a membrane-associated protein. It is proposed that because BEACH domains and WD repeats exist separately in some proteins, they have separate functions. For instance, the WD repeats of the FAN protein bind to the cytoplasmic tail of the TNFR55 receptor independent of the BEACH domain (Adam-Klages, S. et al. Cell, 1996, 86:937). It is worth noting that the FAN gene is made up almost entirely of the sequence in the highly conserved WBW structure (FIG. 3), therefore other WBW-containing proteins may act like FAN and bind the cytoplasmic tails of TNFR55 or TNFR55-like receptors.

[0196]As indicated above, the lrba gene is a potential AKAP. The recently completed genomic sequence of Drosophila indicates that lrba has an orthologue in Drosophila (DAKAP550) that is capable of binding to protein kinase A (Han, J. D. et al. Jour. Biol. Chem., 1997, 272:26611). The DAKAP550 gene is expressed in all tissues throughout development and is the principal A-kinase anchor protein in adult flies: it is enriched in secretory tissues such as neurons and salivary glands, and is found concentrated in the apical cytoplasm of some cells (Han, J. D. et al. Jour. Biol. Chem., 1997, 272:26611), in agreement with the proposed function in secretion of lrba. Although the B1 and B2 RII binding sites of DAKAP550 are not present in mLRBA, hLRBA, and cLRBA, two sequences are disclosed that are very similar to the B1 and B2 RII binding sites in all lrba orthologues. The two sequences are predicted to form two adjacent amphipathic helices characteristic of PKA binding sites, satisfying the requirement of the hydrophobic interaction mechanism of RII peptide binding to the RII subunits of PKA revealed recently (Newlon, M. G. et al. Nat. Struct. Biol., 1999, 6:222). Thus, lrba may serve as an AKAP that is involved in cAMP-mediated signaling secretory processes by translocating PKA to specific membrane sites. This translocation may require microtubule binding as suggested by the recent finding that another WBW protein, human CHS1, can associate with microtubules (Faigle, W. et al. J. Cell Biol., 1998, 141:1121). Based on these findings, it is proposed a two-signal model for the function of the WBW protein family using the lrba gene as a protoype: LRBA is constitutively associated with PKA like other AKAPs and following LPS stimulation (signal one) the BEACH domain is phosphorylated. This enables the LRBA/PKA complex to bind to intracellular vesicles and tether vesicles to microtubules for transport to the plasma membrane. At the membrane, a second signal is required that generates cAMP. Binding of locally generated cAMP to the LRBA/PKA complex releases PKA, allowing it to phosphorylate cytoplasmic tails of activated receptors to enable binding of LRBA via its WD repeats. This final step would result in vesicle fusion with the plasma membrane (FIG. 7). Many immune processes need a second signal such as in the case of co-stimulators. Without being bound by theory, it proposed that a first signal activates an immune cell to transport enough vesicles to the plasma membrane area that contact another cell. A second signal generated by the contact with the target cell produces cAMP that stimulates PKA activity resulting in membrane fusion of vesicles. Thus, LRBA and other WBW proteins may provide a means for eukaryotic cells to direct the fusion of membrane-bound vesicles in a polarized fashion, in coordination with signal transduction complexes at the plasma membrane as is required of many different effector cell types in the immune system (Stinchcombe, J. C. and G. M. Griffiths Jour. Cell Biol., 1999, 147:1).

[0197]Increasing evidence suggests that all clinical symptoms of CHS/beige patients could be explained by a secretion malfunction. The cytolytic proteins (granzymes A/B and perform) in CHS CTL are expressed normally, but are not secreted upon stimulation (Baetz, K. et al. Jour. of Immun., 1995, 154:6122). Secretion of other enzymes are also defective in macrophages and neutrophils (Barak, Y. and E. Nir American Journal of Pediatric Hematology-Oncology, 1987, 9:42) as are the membrane deposition of class II molecules (Faigle, W. et al. J. Cell Biol., 1998, 141:1121) and CTL-4 (Barrat, F. J. et al. Proc. Natl. Acad. of Sci. USA, 1999, 96:8645). However, there is a dispute over whether giant lysosomes in beige/CHS disease are a result of abnormalities in the fusion or fission of lysosomes (Baetz, K. et al. Jour. of Immun., 1995, 154:6122; Barrat, F. J. et al. Proc. Natl. Acad. of Sci. USA, 1999, 96:8645; Perou, C. M. et al. Jour. Biol. Chem., 1997, 272:29790; Cervero, C. et al. Sangre, 1994, 39:135; Barbosa, M. D. et al. Nature, 1996, 382:262; Menard, M. and K. M. Meyers Blood, 1988, 72:1726). How the secretion pathway is impaired is unclear. The characterization of the lrba gene and the model for its function, described herein, may provide a molecular explanation for these two major cellular dysfunctions of CHS/beige: giant vesicles and secretion malfunction. Vesicles may require association with the BEACH domain of CHS1 for fission and/or movement to the plasma membrane. After reaching the plasma membrane, they then require recognition of certain membrane proteins by the WD repeats to mediate fusion with the plasma membrane. This requires CHS1 proteins to be full-length for proper function since the WD repeats are at the COOH terminus. Thus, truncated beige/CHS protein molecules (or perhaps LRBA proteins) that lack the COOH terminal WD repeats would be expected to cause disease (Certain, S. et al. Blood, 2000, 95:979). The giant lysosomes in the affected cells may come from the failure of vesicle movement and/or fusion with the membrane. Similar disorders of beige/CHS have also been described in mink, cattle, cats, and killer whales. Given the structural similarity of the WBW gene family, it is proposed that the genetic mutations in these species also involve other WBW genes. There are also other lysosomal trafficking mutants in mice with similar phenotypes to beige that may also involve mutation of other WBW gene family members.

[0198]In summary, the existence of a novel gene family, the WBW family, is demonstrated herein, which includes the lrba gene that: (1) is associated with the vesicular system, including the Golgi complex, lysosomes, endoplasmic reticulum, plasma membrane, and perinuclear ER, (2) is LPS inducible, (3) is an A kinase anchor protein (AKAP), and (4) has 5 different isoforms that differ in WD repeat number. These findings suggest an important role for lrba in coupling signal transduction and vesicle trafficking to enable polarized secretion and/or membrane deposition of immune effector molecules. This disclosure provides novel tools and methods that can be used to further the understanding of the mechanism of CHS and other related diseases as well as general immune cell function.

[0199]The cell membrane system not only delimits and protects cell and intracellular organelles, maintaining the essential differences between the cell interior and the environment, but also transports various molecules back and forth between the membrane-bound compartments in the cell, and between the cell and the environment through vesicle trafficking processes. These processes are critical for the correct biological functioning of a eukaryotic cell. A novel gene family, WBW, may play an essential role in vesicle trafficking has been identified in eukaryotic organisms from the very ancient unicellular organism Dictyostelium to human, but not in prokaryotes, which have no vesicle system (Wang. J. W. et al. Journal of Immunology, 2001, 166(7):4586-4595; Kwak, E. et al. Mol. Biol. Cell, 1999, 10(12):4429-4439; Adam-Klages, S. et al. Cell, 1996, 86(6):937-947; Barbosa, M. D. et al. Nature, 1996, 382(6588):262-265; Nagle, D. L. et al. Nat. Genet., 1996, 14(3):307-311). The WBW proteins all have a highly conserved long WBW(WDL-BEACH-WD) structure composed of three domains at their C-termini (Wang, J. W. et al. Journal of Immunology, 2001, 166(7):4586-4595). WD domain is present in over two thousand proteins and is thought to be involved in protein-protein interaction (Smith, T. F. et al. Trends Biochem. Sci., 1999, 24(5):181-185). The WD repeats of FAN bind to NSD motif of TNFR55 to mediate the activation of the plasma membrane-bound neutral sphingomyelinase, producing the secondary messenger ceramide to activate raf-1 and MAP kinases, leading to cell growth and inflammation responses (Adam-Klages, S. et al. Cell, 1996, 86(6):937-947). The function of the BEACH domain is unclear, it potentially has SH3 and SH2 binding sites and a tyrosine kinase phosphorylation site, and those sites may interact with multiple signal transduction proteins (Wang, J. W. et al. Journal of Immunology, 2001, 166(7):4586-4595). The WDL domain was first described in a previous publication, and its function also remains unknown (Wang, J. W. et al. Journal of Immunology, 2001, 166(7):4586-4595). However, the WBW structure is very conserved and the WBW structure of FAN represents most of its ORF, and thus it is reasonable to propose that the WBW structure has a similar function to that of FAN. Another interesting question is if WBW proteins are also AKAPs (A kinase anchor protein), as DAKAP550 and Neurobeachin have been experimentally proved to be AKAPs, which can direct protein kinase A to discrete intracellular locations, where PKA may be activated by the secondary messenger cAMP (Han, J. D. et al. J. Biol. Chem., 1997, 272(42):26611-26619; Wang, X. et al. J. Neurosci., 2000, 20(23):8551-8565). The subcellular localizations of the WBW proteins are not restricted to the plasma membrane, but are found in the Golgi complex, lysosomes, ER, perinuclear ER and clathrin-coated endocytosis pits (Wang, J. W. et al. Journal of Immunology, 2001, 166(7):4586-4595; Wang, X. et al. J. Neurosci., 2000, 20(23):8551-8565), moreover are associated with microtubules (Faigle, W. et al. J. Cell Biol., 1998, 141(5)1121-1134).

[0200]In the WBW family chs1/beige gene is the most extensively studied. The mutations of the gene can cause a generalized immunodeficiency in mice and humans with the impairment of NK cells, CTL, and granulocytes and often cause premature death in humans due to a second disease phase characterized by a lymphoproliferative syndrome, probably as a result of defective intracellular trafficking of vesicles (Spritz, R. A. et al. J. Clin. Immunol., 1998, 18(2):97-105). For example, the deposition of some membrane proteins (HLA-DR) and antigen presentation are affected (Faigle, W. et al. J. Cell Biol., 1998, 141(5):1121-1134). FAN has a role in TNF pathway by binding to a cytoplasmic motif upstream of the death domain of some INF family receptors (TNFR55 and CD40) (Adam-Klages, S. et al. Cell, 1996, 86(6):937-947; Segui, B. et al. J. Biol. Chem., 1999, 274(52):37251-37258). FAN knockout or FAN dominant-negative form can protect cell from apoptosis mediated by CD40 or TNF receptor (Segui, B. et al. Clin. Invest., 2001, 108(1):143-151; Segui, B. et al. J. Biol. Chem., 1999, 274(52):37251-37258). LvsA gene is essential for cytokinesis by possibly playing an important role in a membrane-processing pathway (Kwak, E. et al. Mol. Biol. Cell, 1999, 10(12):4429-4439). These studies suggest that the WBW proteins may play a role not only in vesicle trafficking, but also in some important cell processes like apoptosis and cell cycle.

[0201]However, the exact molecular mechanism of vesicle trafficking for the WBW proteins remains largely unclear. The mouse lrba (LPS-responsive beige-like PKA anchor gene) has its three isoforms, which differ at C-termini and have tissue-specific and development stage-specific expression pattern. LRBA gene is LPS inducible and can physically associate with various vesicular compartments in cells (Wang. J. W. et al. Journal of Immunology, 2001, 166(7):4586-4695). Described herein is the cloning, genomic structure and promoter analysis of the human lrba gene and its five isoforms. Its genomic locus consists of 58 exons and 57 introns, spinning over 700 K bps. Three isoforms (α, β, δ) differ at BEACH domain and WD repeats at their C-termini. The fourth isoform(γ) has a YLLLQ insertion sequence. The mRNA of the fifth isoform (6) has two ORFs and a potential IRES for the translation of the second ORF. In the promoter region, there are four E2F binding sites and a CpG island, and surprisingly a potential p53 binding site was found in the promoter, suggesting that lrba gene may be involved in p53 mediated apoptosis or cell arrest, and E2F regulated cell cycle progress, and is regulated developmentally by CpG island. These results show that the Lrba gene is highly regulated at both the transcriptional and translational level, indicating that lrba gene may have a critical role in the life of the cell.

[0202]All patents, patent applications, provisional applications, publications, and nucleic acid and amino acid sequences associated with the GenBank accession numbers referred to or cited herein are incorporated by reference in their entirety, including all figures and tables, to the extent they are not inconsistent with the explicit teachings of this specification.

[0203]It should be understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application.

Sequence CWU 1

182121DNAArtificial Sequencelrba siRNA (siRNA1) 1ccagcaaagg ucuuggcuat t 21221DNAArtificial Sequencelrba siRNA 2cagucggguu ugcgacuggt t 2132856PRTMus musculusBINDING(1350)..(1369)Putative Protein Kinase A RII binding site 3Met Ala Ser Glu Asp Asn Arg Ala Pro Ser Arg Pro Pro Thr Gly Asp1 5 10 15Asp Gly Gly Gly Gly Gly Lys Glu Glu Thr Pro Thr Glu Gly Gly Ala 20 25 30Leu Ser Leu Lys Pro Gly Leu Pro Ile Arg Gly Ile Arg Met Lys Phe 35 40 45Ala Val Leu Thr Gly Leu Val Glu Val Gly Glu Val Ser Asn Arg Asp 50 55 60Ile Val Glu Thr Val Phe Asn Leu Leu Val Gly Gly Gln Phe Asp Leu65 70 75 80Glu Met Asn Phe Ile Ile Gln Glu Gly Glu Ser Ile Met Cys Met Val 85 90 95Glu Leu Leu Glu Lys Cys Asp Val Thr Cys Gln Ala Glu Val Trp Ser 100 105 110Met Phe Thr Ala Ile Leu Lys Lys Ser Ile Arg Asn Leu Gln Val Cys 115 120 125Thr Glu Val Gly Leu Val Glu Lys Val Leu Gly Lys Ile Glu Lys Val 130 135 140Asp Ser Met Ile Ala Asp Leu Leu Val Asp Met Leu Gly Val Leu Ala145 150 155 160Ser Tyr Asn Leu Thr Val Arg Glu Leu Lys Leu Phe Phe Ser Lys Leu 165 170 175Gln Gly Asp Lys Gly Gln Trp Pro Pro His Ala Gly Lys Leu Leu Ser 180 185 190Val Leu Lys His Met Pro Gln Lys Tyr Gly Pro Asp Ala Phe Phe Asn 195 200 205Phe Pro Gly Lys Ser Ala Ala Ala Ile Ala Leu Pro Pro Ile Ala Arg 210 215 220Trp Pro Tyr Gln Asn Gly Phe Thr Phe His Thr Trp Leu Arg Met Asp225 230 235 240Pro Val Asn Asn Ile Asn Val Asp Lys Asp Lys Pro Tyr Leu Tyr Cys 245 250 255Phe Arg Thr Ser Lys Gly Leu Gly Tyr Ser Ala His Phe Val Gly Gly 260 265 270Cys Leu Ile Ile Thr Ser Ile Lys Ser Lys Gly Lys Gly Phe Gln His 275 280 285Cys Val Lys Phe Asp Phe Lys Pro Gln Lys Trp Tyr Met Val Thr Ile 290 295 300Val His Ile Tyr Asn Arg Trp Lys Asn Ser Glu Leu Arg Cys Tyr Val305 310 315 320Asn Gly Glu Leu Ala Ser Tyr Gly Glu Ile Thr Trp Phe Val Asn Thr 325 330 335Ser Asp Thr Phe Asp Lys Cys Phe Leu Gly Ser Ser Glu Thr Ala Asp 340 345 350Ala Asn Arg Val Phe Cys Gly Gln Met Thr Ala Val Tyr Leu Phe Ser 355 360 365Asp Ala Leu Asn Ala Ala Gln Ile Phe Ala Ile Tyr Gln Leu Gly Leu 370 375 380Gly Tyr Lys Gly Thr Phe Lys Phe Lys Ala Glu Ser Asp Leu Phe Leu385 390 395 400Ala Glu His His Lys Leu Leu Leu Tyr Asp Gly Lys Leu Ser Ser Ala 405 410 415Ile Ala Phe Met Tyr Asn Pro Arg Ala Thr Asp Ala Gln Leu Cys Leu 420 425 430Glu Ser Ser Pro Lys Asp Asn Pro Ser Ile Phe Val His Ser Pro His 435 440 445Ala Leu Met Leu Gln Asp Val Lys Ala Val Leu Thr His Ser Ile Gln 450 455 460Ser Ala Met His Ser Ile Gly Gly Val Gln Val Leu Phe Pro Leu Phe465 470 475 480Ala Gln Leu Asp Tyr Lys Gln Tyr Leu Ser Asp Glu Val Asp Leu Thr 485 490 495Ile Cys Thr Thr Leu Leu Ala Phe Ile Met Glu Leu Leu Lys Asn Ser 500 505 510Ile Ala Met Gln Glu Gln Met Leu Ala Cys Lys Gly Phe Leu Val Ile 515 520 525Gly Tyr Ser Leu Glu Lys Ser Ser Lys Ser His Val Ser Arg Ala Val 530 535 540Leu Glu Leu Cys Leu Ala Phe Ser Lys Tyr Leu Ser Asn Leu Gln Asn545 550 555 560Gly Met Pro Leu Leu Lys Gln Leu Cys Asp His Ile Leu Leu Asn Pro 565 570 575Ala Val Trp Ile His Thr Pro Ala Lys Val Gln Leu Met Leu Tyr Thr 580 585 590Tyr Leu Ser Thr Glu Phe Ile Gly Thr Val Asn Ile Tyr Asn Thr Ile 595 600 605Arg Arg Val Gly Thr Val Leu Leu Ile Met His Thr Leu Lys Tyr Tyr 610 615 620Tyr Trp Ala Val Asn Pro Gln Asp Arg Ser Gly Ile Thr Pro Lys Gly625 630 635 640Leu Asp Gly Pro Arg Pro Asn Gln Lys Glu Ile Leu Ser Leu Arg Ala 645 650 655Phe Leu Leu Met Phe Ile Lys Gln Leu Val Met Lys Asp Ser Gly Val 660 665 670Lys Glu Asp Glu Leu Gln Ala Ile Leu Asn Tyr Leu Leu Thr Met His 675 680 685Glu Asp Asp Asn Leu Met Asp Val Leu Gln Leu Leu Val Ala Leu Met 690 695 700Ala Glu His Pro Asn Ser Met Ile Pro Ala Phe Asp Gln Arg Asn Gly705 710 715 720Leu Arg Val Ile Tyr Lys Leu Leu Ala Ser Lys Ser Glu Gly Ile Arg 725 730 735Val Gln Ala Leu Lys Ala Leu Gly Tyr Phe Leu Lys His Leu Ala Pro 740 745 750Lys Arg Lys Ala Glu Val Met Leu Gly His Gly Leu Phe Ser Leu Leu 755 760 765Ala Glu Arg Leu Met Leu Gln Thr Asn Leu Ile Thr Met Thr Met Tyr 770 775 780Asn Val Leu Phe Glu Ile Leu Ile Glu Gln Ile Cys Thr Gln Val Ile785 790 795 800His Lys Gln His Pro Asp Pro Asp Ser Thr Val Lys Ile Gln Asn Pro 805 810 815Gln Ile Leu Lys Val Ile Ala Thr Leu Leu Arg Asn Ser Pro Gln Cys 820 825 830Pro Glu Ser Met Glu Val Arg Arg Ala Phe Leu Ser Asp Met Ile Lys 835 840 845Leu Phe Asn Asn Ser Arg Glu Asn Arg Arg Ser Leu Leu Gln Cys Ser 850 855 860Val Trp Gln Glu Trp Met Leu Ser Leu Cys Tyr Phe Asn Pro Lys Asn865 870 875 880Ser Asp Glu Gln Lys Ile Thr Glu Met Val Tyr Ala Ile Phe Arg Ile 885 890 895Leu Leu Tyr His Ala Val Lys Tyr Glu Trp Gly Gly Trp Arg Val Trp 900 905 910Val Asp Thr Leu Ser Ile Thr His Ser Lys Val Thr Phe Glu Ile His 915 920 925Lys Glu Asn Leu Ala Asn Ile Phe Arg Glu Glu Gln Arg Lys Gly Asp 930 935 940Glu Glu Thr Gly Pro Cys Ser Ser Ser Leu Val Pro Glu Gly Thr Gly945 950 955 960Ala Thr Arg Gly Val Asp Val Ser Val Gly Ser Gln His Glu Asp Arg 965 970 975Lys Asp Ser Pro Ile Ser Pro His Phe Thr Arg Asn Ser Asp Glu Asn 980 985 990Ser Ser Ile Gly Arg Ala Ser Ser Ile Asp Ser Ala Ser Asn Thr Glu 995 1000 1005Leu Gln Thr His Asp Met Ser Ser Asp Glu Lys Lys Val Glu Arg 1010 1015 1020Glu Asn Gln Glu Leu Leu Asp Gln Ala Thr Val Glu Glu Thr Ala 1025 1030 1035Thr Asn Gly Ala Lys Asp Asp Leu Glu Thr Ser Ser Asp Ala Ala 1040 1045 1050Glu Pro Val Thr Ile Asn Ser Asn Ser Leu Glu Pro Gly Lys Asp 1055 1060 1065Thr Val Thr Ile Ser Glu Val Ser Ala Ser Ile Ser Ser Pro Ser 1070 1075 1080Glu Glu Asp Ala Ala Glu Met Pro Glu Leu Leu Glu Lys Ser Gly 1085 1090 1095Val Glu Glu Lys Glu Asp Asp Asp Tyr Val Glu Leu Lys Val Glu 1100 1105 1110Gly Ser Pro Thr Glu Glu Ala Gly Leu Pro Thr Glu Leu Gln Gly 1115 1120 1125Glu Gly Leu Val Ser Ala Ala Ser Gly Gly Arg Glu Glu Pro Asp 1130 1135 1140Met Cys Gly His Gly Cys Glu Val Gln Val Glu Ala Pro Ile Thr 1145 1150 1155Lys Ile His Asn Asp Pro Glu Thr Thr Asp Ser Glu Asp Ser Arg 1160 1165 1170Phe Pro Thr Val Ala Thr Ala Gly Ser Leu Ala Thr Ser Ser Glu 1175 1180 1185Val Pro Val Pro Gln Ala Thr Val Gln Ser Asp Ser His Glu Met 1190 1195 1200Leu Asp Gly Gly Met Lys Ala Thr Asn Leu Ala Gly Glu Thr Glu 1205 1210 1215Ser Val Ser Asp Cys Ala Asp Asn Val Ser Glu Ala Pro Ala Thr 1220 1225 1230Ser Glu Gln Lys Ile Thr Lys Leu Asp Val Ser Ser Val Ala Ser 1235 1240 1245Asp Thr Glu Arg Phe Glu Leu Lys Ala Ser Thr Ser Thr Glu Ala 1250 1255 1260Pro Gln Pro Gln Arg His Gly Leu Glu Ile Ser Arg Gln Gln Glu 1265 1270 1275Gln Thr Ala Gln Gly Thr Ala Pro Asp Ala Val Asp Gln Gln Arg 1280 1285 1290Arg Asp Ser Arg Ser Thr Met Phe Arg Ile Pro Glu Phe Lys Trp 1295 1300 1305Ser Gln Met His Gln Arg Leu Leu Thr Asp Leu Leu Phe Ser Ile 1310 1315 1320Glu Thr Asp Ile Gln Met Trp Arg Ser His Ser Thr Lys Thr Val 1325 1330 1335Met Asp Phe Val Asn Ser Ser Asp Asn Val Ile Phe Val His Asn 1340 1345 1350Thr Ile His Leu Ile Ser Gln Val Met Asp Asn Met Val Met Ala 1355 1360 1365Cys Gly Gly Ile Leu Pro Leu Leu Ser Ala Ala Thr Ser Ala Thr 1370 1375 1380His Glu Leu Glu Asn Ile Glu Pro Thr Gln Gly Leu Ser Ile Glu 1385 1390 1395Ala Ser Val Thr Phe Leu Gln Arg Leu Ile Ser Leu Val Asp Val 1400 1405 1410Leu Ile Phe Ala Ser Ser Leu Gly Phe Thr Glu Ile Glu Ala Glu 1415 1420 1425Lys Asn Met Ser Ser Gly Gly Ile Leu Arg Gln Cys Leu Arg Leu 1430 1435 1440Val Cys Ala Val Ala Val Arg Asn Cys Leu Glu Cys Gln Gln His 1445 1450 1455Ser Gln Leu Lys Ala Arg Gly Asp Thr Ala Lys Ser Ser Lys Thr 1460 1465 1470Ile His Ser Leu Ile Pro Met Gly Lys Ser Ala Ala Lys Ser Pro 1475 1480 1485Val Asp Ile Val Thr Gly Gly Ile Ser Ser Val Arg Asp Leu Asp 1490 1495 1500Arg Leu Pro Ala Arg Thr Trp Thr Leu Ile Gly Leu Arg Ala Val 1505 1510 1515Val Phe Arg Asp Ile Glu Asp Ser Lys Gln Ala Gln Phe Leu Ala 1520 1525 1530Leu Ala Val Val Tyr Phe Ile Ser Val Leu Met Val Ser Lys Tyr 1535 1540 1545Arg Asp Ile Leu Glu Pro Gln Asp Glu Arg His Ser Gln Ser Leu 1550 1555 1560Lys Glu Thr Ser Ser Asp Asn Gly Asn Ala Ser Leu Pro Asp Ala 1565 1570 1575Glu Asn Thr Pro Ala Glu Phe Ser Ser Leu Thr Leu Ser Ser Val 1580 1585 1590Glu Glu Ser Leu Glu Gly Thr Ser Cys Thr Arg Arg Arg Asp Ser 1595 1600 1605Gly Leu Gly Glu Glu Thr Ala Ser Gly Leu Gly Ser Gly Leu Val 1610 1615 1620Ser Ala Ser Pro Ala Ala Pro Leu Gly Val Ser Ala Gly Pro Asp 1625 1630 1635Ala Ile Ser Glu Val Leu Cys Thr Leu Ser Leu Glu Val Asn Lys 1640 1645 1650Ser Gln Glu Thr Arg Ile Asp Gly Gly Asn Glu Leu Asp Arg Lys 1655 1660 1665Val Thr Pro Ser Val Pro Val Ser Lys Asn Val Asn Val Lys Asp 1670 1675 1680Ile Leu Arg Ser Leu Val Asn Met Pro Ala Asp Gly Val Thr Val 1685 1690 1695Asp Pro Ala Leu Leu Pro Pro Ala Cys Leu Gly Ala Leu Gly Asp 1700 1705 1710Leu Ser Val Asp Pro Pro Met Gln Phe Arg Ser Phe Asp Arg Ser 1715 1720 1725Val Ile Ile Ala Thr Lys Lys Ser Ser Val Leu Pro Ser Ala Leu 1730 1735 1740Thr Thr Ser Ala Pro Ser Ser Ala Val Ser Val Val Ser Ser Val 1745 1750 1755Asp Pro Thr His Ala Ser Asp Thr Gly Gly Glu Ser Pro Gly Ser 1760 1765 1770Arg Ser Pro Lys Cys Lys Thr Ala Leu Ser Cys Lys Gln Leu Ala 1775 1780 1785Pro Ser His Lys Thr Pro Ala Ala His Met Ser Ile Thr Glu Arg 1790 1795 1800Leu Glu His Ala Leu Glu Lys Ala Ala Pro Leu Leu Arg Glu Ile 1805 1810 1815Phe Val Asp Phe Ala Pro Phe Leu Ser Arg Thr Leu Leu Gly Ser 1820 1825 1830His Gly Gln Glu Leu Leu Ile Glu Gly Thr Ser Leu Val Cys Met 1835 1840 1845Lys Ser Ser Ser Ser Val Val Glu Leu Val Met Leu Leu Cys Ser 1850 1855 1860Gln Glu Trp Gln Asn Ser Ile Gln Lys Asn Ala Gly Leu Ala Phe 1865 1870 1875Ile Glu Leu Val Asn Glu Gly Arg Leu Leu Ser Gln Thr Met Lys 1880 1885 1890Asp His Leu Val Arg Val Ala Asn Glu Ala Glu Phe Ile Leu Ser 1895 1900 1905Arg Gln Arg Ala Glu Asp Ile His Arg His Ala Glu Phe Glu Ser 1910 1915 1920Leu Cys Ala Gln Tyr Ser Ala Asp Lys Arg Glu Glu Glu Lys Met 1925 1930 1935Cys Asp His Leu Ile Arg Ala Ala Lys Tyr Arg Asp His Val Thr 1940 1945 1950 Ala Thr Gln Leu Ile Gln Lys Ile Ile Asn Leu Leu Thr Asp Lys 1955 1960 1965His Gly Ala Trp Gly Ser Ser Ala Val Ser Arg Pro Arg Glu Phe 1970 1975 1980Trp Arg Leu Asp Tyr Trp Glu Asp Asp Leu Arg Arg Arg Arg Arg 1985 1990 1995Phe Val Arg Asn Pro Leu Gly Ser Thr His Pro Glu Ala Thr Leu 2000 2005 2010Lys Thr Ala Val Glu His Ala Ala Asp Glu Asp Ile Leu Ala Lys 2015 2020 2025Gly Lys Gln Ser Ile Lys Ser Gln Ala Leu Gly Asn Gln Asn Ser 2030 2035 2040Glu Asn Glu Ala Leu Leu Glu Gly Asp Asp Asp Thr Leu Ser Ser 2045 2050 2055Val Asp Glu Lys Asp Leu Glu Asn Leu Ala Gly Pro Val Ser Leu 2060 2065 2070Ser Thr Pro Ala Gln Leu Val Ala Pro Ser Val Val Val Lys Gly 2075 2080 2085Thr Leu Ser Val Thr Ser Ser Glu Leu Tyr Phe Glu Val Asp Glu 2090 2095 2100Glu Asp Pro Asn Phe Lys Lys Ile Asp Pro Lys Ile Leu Ala Tyr 2105 2110 2115Thr Glu Gly Leu His Gly Lys Trp Leu Phe Thr Glu Ile Arg Ser 2120 2125 2130Ile Phe Ser Arg Arg Tyr Leu Leu Gln Asn Thr Ala Leu Glu Ile 2135 2140 2145 Phe Met Ala Asn Arg Val Ala Val Met Phe Asn Phe Pro Asp Pro 2150 2155 2160Ala Thr Val Lys Lys Val Val Asn Tyr Leu Pro Arg Val Gly Val 2165 2170 2175Gly Thr Ser Phe Gly Leu Pro Gln Thr Arg Arg Ile Ser Leu Ala 2180 2185 2190Thr Pro Arg Gln Leu Phe Lys Ala Ser Asn Met Thr Gln Arg Trp 2195 2200 2205Gln His Arg Glu Ile Ser Asn Phe Glu Tyr Leu Met Phe Leu Asn 2210 2215 2220Thr Ile Ala Gly Arg Ser Tyr Asn Asp Leu Asn Gln Tyr Pro Val 2225 2230 2235Phe Pro Trp Val Ile Thr Asn Tyr Glu Ser Glu Glu Leu Asp Leu 2240 2245 2250Thr Leu Pro Ser Asn Phe Arg Asp Leu Ser Lys Pro Ile Gly Ala 2255 2260 2265Leu Asn Pro Lys Arg Ala Ala Phe Phe Ala Glu Arg Phe Glu Ser 2270 2275 2280Trp Glu Asp Asp Gln Val Pro Lys Phe His Tyr Gly Thr His Tyr 2285 2290 2295Ser Thr Ala Ser Phe Val Leu Ala Trp Leu Leu Arg Ile Glu Pro 2300 2305 2310Phe Thr Thr Tyr Phe Leu Asn Leu Gln Gly Gly Lys Phe Asp His 2315 2320 2325Ala Asp Arg Thr Phe Ser Ser Val Ser Arg Ala Trp Arg Asn Ser 2330 2335 2340Gln Arg Asp Thr Ser Asp Ile Lys Glu Leu Ile Pro Glu Phe Tyr 2345 2350 2355Tyr Leu Pro Glu Met Phe Val Asn Phe Asn Asn Tyr Asn Leu Gly 2360 2365 2370Val Met Asp Asp Gly Thr Val Val Ser Asp Val Glu Leu Pro Pro 2375 2380 2385Trp Ala Lys Thr Ser Glu Glu Phe Val Arg Ile Asn Arg Leu Ala 2390 2395 2400Leu Glu Ser Glu Phe Val Ser Cys Gln

Leu His Gln Trp Ile Asp 2405 2410 2415Leu Ile Phe Gly Tyr Lys Gln Gln Gly Pro Glu Ala Val Arg Ala 2420 2425 2430Leu Asn Val Phe Tyr Tyr Leu Thr Tyr Glu Gly Ala Val Asn Leu 2435 2440 2445Asn Ser Ile Thr Asp Pro Val Leu Arg Glu Ala Val Glu Ala Gln 2450 2455 2460Ile Arg Ser Phe Gly Gln Thr Pro Ser Gln Leu Leu Ile Glu Pro 2465 2470 2475His Pro Pro Arg Gly Ser Ala Met Gln Ala Ser Pro Leu Met Phe 2480 2485 2490Thr Asp Gln Ala Gln Gln Asp Val Ile Met Val Leu Lys Phe Pro 2495 2500 2505Ser Asn Ser Pro Val Thr His Val Ala Ala Asn Thr Gln Pro Gly 2510 2515 2520Leu Ala Met Pro Ala Val Ile Thr Val Thr Ala Asn Arg Leu Phe 2525 2530 2535Ala Val Asn Lys Trp His Asn Leu Pro Ala His Gln Gly Ala Val 2540 2545 2550Gln Asp Gln Pro Tyr Gln Leu Pro Val Glu Ile Asp Pro Leu Ile 2555 2560 2565Ala Cys Gly Thr Gly Thr His Arg Arg Gln Val Thr Asp Leu Leu 2570 2575 2580Asp Gln Ser Ile Gln Val His Ser Gln Cys Phe Val Ile Thr Ser 2585 2590 2595Asp Asn Arg Tyr Ile Leu Val Cys Gly Phe Trp Asp Lys Ser Phe 2600 2605 2610 Arg Val Tyr Ser Thr Asp Thr Gly Lys Leu Ile Gln Val Val Phe 2615 2620 2625Gly His Trp Asp Val Val Thr Cys Leu Ala Arg Ser Glu Ser Tyr 2630 2635 2640Ile Gly Gly Asn Cys Tyr Ile Leu Ser Gly Ser Arg Asp Ala Thr 2645 2650 2655Leu Leu Leu Trp Tyr Trp Asn Gly Lys Ser Ser Gly Ile Gly Asp 2660 2665 2670Asn Pro Gly Gly Glu Thr Ala Thr Pro Arg Ala Ile Leu Thr Gly 2675 2680 2685His Asp Tyr Glu Ile Thr Cys Ala Ala Val Cys Ala Glu Leu Gly 2690 2695 2700Leu Val Leu Ser Gly Ser Gln Glu Gly Pro Cys Leu Ile His Ser 2705 2710 2715Met Asn Gly Asp Leu Leu Arg Thr Leu Glu Gly Pro Glu Asn Cys 2720 2725 2730Leu Lys Pro Lys Leu Ile Gln Ala Ser Arg Glu Gly His Cys Val 2735 2740 2745Ile Phe Tyr Glu Asn Gly Cys Phe Cys Thr Phe Ser Val Asn Gly 2750 2755 2760Lys Leu Gln Ala Thr Val Glu Thr Asp Asp His Ile Arg Ala Ile 2765 2770 2775Gln Leu Ser Arg Asp Gly Gln Tyr Leu Leu Thr Gly Gly Asp Asn 2780 2785 2790 Gly Val Val Ile Val Arg Gln Val Ser Asp Leu Lys Gln Leu Phe 2795 2800 2805Ala Tyr Pro Gly Cys Asp Ala Gly Ile Arg Ala Met Ala Leu Ser 2810 2815 2820Phe Asp Gln Arg Cys Ile Ile Ser Gly Met Ala Ser Gly Ser Ile 2825 2830 2835Val Leu Phe Tyr Asn Asp Phe Asn Arg Trp His His Glu Tyr Gln 2840 2845 2850Thr Arg Tyr 285542792PRTMus musculusBINDING(1350)..(1369)Putative Protein Kinase A RII binding site 4Met Ala Ser Glu Asp Asn Arg Ala Pro Ser Arg Pro Pro Thr Gly Asp1 5 10 15Asp Gly Gly Gly Gly Gly Lys Glu Glu Thr Pro Thr Glu Gly Gly Ala 20 25 30Leu Ser Leu Lys Pro Gly Leu Pro Ile Arg Gly Ile Arg Met Lys Phe 35 40 45Ala Val Leu Thr Gly Leu Val Glu Val Gly Glu Val Ser Asn Arg Asp 50 55 60Ile Val Glu Thr Val Phe Asn Leu Leu Val Gly Gly Gln Phe Asp Leu65 70 75 80Glu Met Asn Phe Ile Ile Gln Glu Gly Glu Ser Ile Met Cys Met Val 85 90 95Glu Leu Leu Glu Lys Cys Asp Val Thr Cys Gln Ala Glu Val Trp Ser 100 105 110Met Phe Thr Ala Ile Leu Lys Lys Ser Ile Arg Asn Leu Gln Val Cys 115 120 125Thr Glu Val Gly Leu Val Glu Lys Val Leu Gly Lys Ile Glu Lys Val 130 135 140Asp Ser Met Ile Ala Asp Leu Leu Val Asp Met Leu Gly Val Leu Ala145 150 155 160Ser Tyr Asn Leu Thr Val Arg Glu Leu Lys Leu Phe Phe Ser Lys Leu 165 170 175Gln Gly Asp Lys Gly Gln Trp Pro Pro His Ala Gly Lys Leu Leu Ser 180 185 190Val Leu Lys His Met Pro Gln Lys Tyr Gly Pro Asp Ala Phe Phe Asn 195 200 205Phe Pro Gly Lys Ser Ala Ala Ala Ile Ala Leu Pro Pro Ile Ala Arg 210 215 220Trp Pro Tyr Gln Asn Gly Phe Thr Phe His Thr Trp Leu Arg Met Asp225 230 235 240Pro Val Asn Asn Ile Asn Val Asp Lys Asp Lys Pro Tyr Leu Tyr Cys 245 250 255Phe Arg Thr Ser Lys Gly Leu Gly Tyr Ser Ala His Phe Val Gly Gly 260 265 270Cys Leu Ile Ile Thr Ser Ile Lys Ser Lys Gly Lys Gly Phe Gln His 275 280 285Cys Val Lys Phe Asp Phe Lys Pro Gln Lys Trp Tyr Met Val Thr Ile 290 295 300Val His Ile Tyr Asn Arg Trp Lys Asn Ser Glu Leu Arg Cys Tyr Val305 310 315 320Asn Gly Glu Leu Ala Ser Tyr Gly Glu Ile Thr Trp Phe Val Asn Thr 325 330 335Ser Asp Thr Phe Asp Lys Cys Phe Leu Gly Ser Ser Glu Thr Ala Asp 340 345 350Ala Asn Arg Val Phe Cys Gly Gln Met Thr Ala Val Tyr Leu Phe Ser 355 360 365Asp Ala Leu Asn Ala Ala Gln Ile Phe Ala Ile Tyr Gln Leu Gly Leu 370 375 380Gly Tyr Lys Gly Thr Phe Lys Phe Lys Ala Glu Ser Asp Leu Phe Leu385 390 395 400Ala Glu His His Lys Leu Leu Leu Tyr Asp Gly Lys Leu Ser Ser Ala 405 410 415Ile Ala Phe Met Tyr Asn Pro Arg Ala Thr Asp Ala Gln Leu Cys Leu 420 425 430Glu Ser Ser Pro Lys Asp Asn Pro Ser Ile Phe Val His Ser Pro His 435 440 445Ala Leu Met Leu Gln Asp Val Lys Ala Val Leu Thr His Ser Ile Gln 450 455 460Ser Ala Met His Ser Ile Gly Gly Val Gln Val Leu Phe Pro Leu Phe465 470 475 480Ala Gln Leu Asp Tyr Lys Gln Tyr Leu Ser Asp Glu Val Asp Leu Thr 485 490 495Ile Cys Thr Thr Leu Leu Ala Phe Ile Met Glu Leu Leu Lys Asn Ser 500 505 510Ile Ala Met Gln Glu Gln Met Leu Ala Cys Lys Gly Phe Leu Val Ile 515 520 525Gly Tyr Ser Leu Glu Lys Ser Ser Lys Ser His Val Ser Arg Ala Val 530 535 540Leu Glu Leu Cys Leu Ala Phe Ser Lys Tyr Leu Ser Asn Leu Gln Asn545 550 555 560Gly Met Pro Leu Leu Lys Gln Leu Cys Asp His Ile Leu Leu Asn Pro 565 570 575Ala Val Trp Ile His Thr Pro Ala Lys Val Gln Leu Met Leu Tyr Thr 580 585 590Tyr Leu Ser Thr Glu Phe Ile Gly Thr Val Asn Ile Tyr Asn Thr Ile 595 600 605Arg Arg Val Gly Thr Val Leu Leu Ile Met His Thr Leu Lys Tyr Tyr 610 615 620Tyr Trp Ala Val Asn Pro Gln Asp Arg Ser Gly Ile Thr Pro Lys Gly625 630 635 640Leu Asp Gly Pro Arg Pro Asn Gln Lys Glu Ile Leu Ser Leu Arg Ala 645 650 655Phe Leu Leu Met Phe Ile Lys Gln Leu Val Met Lys Asp Ser Gly Val 660 665 670Lys Glu Asp Glu Leu Gln Ala Ile Leu Asn Tyr Leu Leu Thr Met His 675 680 685Glu Asp Asp Asn Leu Met Asp Val Leu Gln Leu Leu Val Ala Leu Met 690 695 700Ala Glu His Pro Asn Ser Met Ile Pro Ala Phe Asp Gln Arg Asn Gly705 710 715 720Leu Arg Val Ile Tyr Lys Leu Leu Ala Ser Lys Ser Glu Gly Ile Arg 725 730 735Val Gln Ala Leu Lys Ala Leu Gly Tyr Phe Leu Lys His Leu Ala Pro 740 745 750Lys Arg Lys Ala Glu Val Met Leu Gly His Gly Leu Phe Ser Leu Leu 755 760 765Ala Glu Arg Leu Met Leu Gln Thr Asn Leu Ile Thr Met Thr Met Tyr 770 775 780Asn Val Leu Phe Glu Ile Leu Ile Glu Gln Ile Cys Thr Gln Val Ile785 790 795 800His Lys Gln His Pro Asp Pro Asp Ser Thr Val Lys Ile Gln Asn Pro 805 810 815Gln Ile Leu Lys Val Ile Ala Thr Leu Leu Arg Asn Ser Pro Gln Cys 820 825 830Pro Glu Ser Met Glu Val Arg Arg Ala Phe Leu Ser Asp Met Ile Lys 835 840 845Leu Phe Asn Asn Ser Arg Glu Asn Arg Arg Ser Leu Leu Gln Cys Ser 850 855 860Val Trp Gln Glu Trp Met Leu Ser Leu Cys Tyr Phe Asn Pro Lys Asn865 870 875 880Ser Asp Glu Gln Lys Ile Thr Glu Met Val Tyr Ala Ile Phe Arg Ile 885 890 895Leu Leu Tyr His Ala Val Lys Tyr Glu Trp Gly Gly Trp Arg Val Trp 900 905 910Val Asp Thr Leu Ser Ile Thr His Ser Lys Val Thr Phe Glu Ile His 915 920 925Lys Glu Asn Leu Ala Asn Ile Phe Arg Glu Glu Gln Arg Lys Gly Asp 930 935 940Glu Glu Thr Gly Pro Cys Ser Ser Ser Leu Val Pro Glu Gly Thr Gly945 950 955 960Ala Thr Arg Gly Val Asp Val Ser Val Gly Ser Gln His Glu Asp Arg 965 970 975Lys Asp Ser Pro Ile Ser Pro His Phe Thr Arg Asn Ser Asp Glu Asn 980 985 990Ser Ser Ile Gly Arg Ala Ser Ser Ile Asp Ser Ala Ser Asn Thr Glu 995 1000 1005Leu Gln Thr His Asp Met Ser Ser Asp Glu Lys Lys Val Glu Arg 1010 1015 1020Glu Asn Gln Glu Leu Leu Asp Gln Ala Thr Val Glu Glu Thr Ala 1025 1030 1035Thr Asn Gly Ala Lys Asp Asp Leu Glu Thr Ser Ser Asp Ala Ala 1040 1045 1050Glu Pro Val Thr Ile Asn Ser Asn Ser Leu Glu Pro Gly Lys Asp 1055 1060 1065Thr Val Thr Ile Ser Glu Val Ser Ala Ser Ile Ser Ser Pro Ser 1070 1075 1080Glu Glu Asp Ala Ala Glu Met Pro Glu Leu Leu Glu Lys Ser Gly 1085 1090 1095Val Glu Glu Lys Glu Asp Asp Asp Tyr Val Glu Leu Lys Val Glu 1100 1105 1110Gly Ser Pro Thr Glu Glu Ala Gly Leu Pro Thr Glu Leu Gln Gly 1115 1120 1125Glu Gly Leu Val Ser Ala Ala Ser Gly Gly Arg Glu Glu Pro Asp 1130 1135 1140Met Cys Gly His Gly Cys Glu Val Gln Val Glu Ala Pro Ile Thr 1145 1150 1155Lys Ile His Asn Asp Pro Glu Thr Thr Asp Ser Glu Asp Ser Arg 1160 1165 1170Phe Pro Thr Val Ala Thr Ala Gly Ser Leu Ala Thr Ser Ser Glu 1175 1180 1185Val Pro Val Pro Gln Ala Thr Val Gln Ser Asp Ser His Glu Met 1190 1195 1200Leu Asp Gly Gly Met Lys Ala Thr Asn Leu Ala Gly Glu Thr Glu 1205 1210 1215Ser Val Ser Asp Cys Ala Asp Asn Val Ser Glu Ala Pro Ala Thr 1220 1225 1230Ser Glu Gln Lys Ile Thr Lys Leu Asp Val Ser Ser Val Ala Ser 1235 1240 1245Asp Thr Glu Arg Phe Glu Leu Lys Ala Ser Thr Ser Thr Glu Ala 1250 1255 1260Pro Gln Pro Gln Arg His Gly Leu Glu Ile Ser Arg Gln Gln Glu 1265 1270 1275Gln Thr Ala Gln Gly Thr Ala Pro Asp Ala Val Asp Gln Gln Arg 1280 1285 1290Arg Asp Ser Arg Ser Thr Met Phe Arg Ile Pro Glu Phe Lys Trp 1295 1300 1305Ser Gln Met His Gln Arg Leu Leu Thr Asp Leu Leu Phe Ser Ile 1310 1315 1320Glu Thr Asp Ile Gln Met Trp Arg Ser His Ser Thr Lys Thr Val 1325 1330 1335Met Asp Phe Val Asn Ser Ser Asp Asn Val Ile Phe Val His Asn 1340 1345 1350Thr Ile His Leu Ile Ser Gln Val Met Asp Asn Met Val Met Ala 1355 1360 1365Cys Gly Gly Ile Leu Pro Leu Leu Ser Ala Ala Thr Ser Ala Thr 1370 1375 1380His Glu Leu Glu Asn Ile Glu Pro Thr Gln Gly Leu Ser Ile Glu 1385 1390 1395Ala Ser Val Thr Phe Leu Gln Arg Leu Ile Ser Leu Val Asp Val 1400 1405 1410Leu Ile Phe Ala Ser Ser Leu Gly Phe Thr Glu Ile Glu Ala Glu 1415 1420 1425Lys Asn Met Ser Ser Gly Gly Ile Leu Arg Gln Cys Leu Arg Leu 1430 1435 1440Val Cys Ala Val Ala Val Arg Asn Cys Leu Glu Cys Gln Gln His 1445 1450 1455Ser Gln Leu Lys Ala Arg Gly Asp Thr Ala Lys Ser Ser Lys Thr 1460 1465 1470Ile His Ser Leu Ile Pro Met Gly Lys Ser Ala Ala Lys Ser Pro 1475 1480 1485Val Asp Ile Val Thr Gly Gly Ile Ser Ser Val Arg Asp Leu Asp 1490 1495 1500Arg Leu Pro Ala Arg Thr Trp Thr Leu Ile Gly Leu Arg Ala Val 1505 1510 1515Val Phe Arg Asp Ile Glu Asp Ser Lys Gln Ala Gln Phe Leu Ala 1520 1525 1530 Leu Ala Val Val Tyr Phe Ile Ser Val Leu Met Val Ser Lys Tyr 1535 1540 1545Arg Asp Ile Leu Glu Pro Gln Asp Glu Arg His Ser Gln Ser Leu 1550 1555 1560Lys Glu Thr Ser Ser Asp Asn Gly Asn Ala Ser Leu Pro Asp Ala 1565 1570 1575Glu Asn Thr Pro Ala Glu Phe Ser Ser Leu Thr Leu Ser Ser Val 1580 1585 1590Glu Glu Ser Leu Glu Gly Thr Ser Cys Thr Arg Arg Arg Asp Ser 1595 1600 1605Gly Leu Gly Glu Glu Thr Ala Ser Gly Leu Gly Ser Gly Leu Val 1610 1615 1620Ser Ala Ser Pro Ala Ala Pro Leu Gly Val Ser Ala Gly Pro Asp 1625 1630 1635Ala Ile Ser Glu Val Leu Cys Thr Leu Ser Leu Glu Val Asn Lys 1640 1645 1650Ser Gln Glu Thr Arg Ile Asp Gly Gly Asn Glu Leu Asp Arg Lys 1655 1660 1665Val Thr Pro Ser Val Pro Val Ser Lys Asn Val Asn Val Lys Asp 1670 1675 1680Ile Leu Arg Ser Leu Val Asn Met Pro Ala Asp Gly Val Thr Val 1685 1690 1695Asp Pro Ala Leu Leu Pro Pro Ala Cys Leu Gly Ala Leu Gly Asp 1700 1705 1710Leu Ser Val Asp Pro Pro Met Gln Phe Arg Ser Phe Asp Arg Ser 1715 1720 1725Val Ile Ile Ala Thr Lys Lys Ser Ser Val Leu Pro Ser Ala Leu 1730 1735 1740Thr Thr Ser Ala Pro Ser Ser Ala Val Ser Val Val Ser Ser Val 1745 1750 1755Asp Pro Thr His Ala Ser Asp Thr Gly Gly Glu Ser Pro Gly Ser 1760 1765 1770Arg Ser Pro Lys Cys Lys Thr Ala Leu Ser Cys Lys Gln Leu Ala 1775 1780 1785Pro Ser His Lys Thr Pro Ala Ala His Met Ser Ile Thr Glu Arg 1790 1795 1800Leu Glu His Ala Leu Glu Lys Ala Ala Pro Leu Leu Arg Glu Ile 1805 1810 1815Phe Val Asp Phe Ala Pro Phe Leu Ser Arg Thr Leu Leu Gly Ser 1820 1825 1830His Gly Gln Glu Leu Leu Ile Glu Gly Thr Ser Leu Val Cys Met 1835 1840 1845Lys Ser Ser Ser Ser Val Val Glu Leu Val Met Leu Leu Cys Ser 1850 1855 1860Gln Glu Trp Gln Asn Ser Ile Gln Lys Asn Ala Gly Leu Ala Phe 1865 1870 1875Ile Glu Leu Val Asn Glu Gly Arg Leu Leu Ser Gln Thr Met Lys 1880 1885 1890Asp His Leu Val Arg Val Ala Asn Glu Ala Glu Phe Ile Leu Ser 1895 1900 1905Arg Gln Arg Ala Glu Asp Ile His Arg His Ala Glu Phe Glu Ser 1910 1915 1920Leu Cys Ala Gln Tyr Ser Ala Asp Lys Arg Glu Glu Glu Lys Met 1925 1930 1935Cys Asp His Leu Ile Arg Ala Ala Lys Tyr Arg Asp His Val Thr 1940 1945 1950Ala Thr Gln Leu Ile Gln Lys Ile Ile Asn Leu Leu Thr Asp Lys 1955 1960 1965His Gly Ala Trp Gly Ser Ser Ala Val Ser Arg Pro Arg Glu Phe 1970 1975 1980Trp Arg Leu Asp Tyr Trp Glu Asp Asp Leu Arg Arg Arg Arg

Arg 1985 1990 1995Phe Val Arg Asn Pro Leu Gly Ser Thr His Pro Glu Ala Thr Leu 2000 2005 2010Lys Thr Ala Val Glu His Ala Ala Asp Glu Asp Ile Leu Ala Lys 2015 2020 2025Gly Lys Gln Ser Ile Lys Ser Gln Ala Leu Gly Asn Gln Asn Ser 2030 2035 2040Glu Asn Glu Ala Leu Leu Glu Gly Asp Asp Asp Thr Leu Ser Ser 2045 2050 2055Val Asp Glu Lys Asp Leu Glu Asn Leu Ala Gly Pro Val Ser Leu 2060 2065 2070Ser Thr Pro Ala Gln Leu Val Ala Pro Ser Val Val Val Lys Gly 2075 2080 2085Thr Leu Ser Val Thr Ser Ser Glu Leu Tyr Phe Glu Val Asp Glu 2090 2095 2100Glu Asp Pro Asn Phe Lys Lys Ile Asp Pro Lys Ile Leu Ala Tyr 2105 2110 2115Thr Glu Gly Leu His Gly Lys Trp Leu Phe Thr Glu Ile Arg Ser 2120 2125 2130Ile Phe Ser Arg Arg Tyr Leu Leu Gln Asn Thr Ala Leu Glu Ile 2135 2140 2145Phe Met Ala Asn Arg Val Ala Val Met Phe Asn Phe Pro Asp Pro 2150 2155 2160Ala Thr Val Lys Lys Val Val Asn Tyr Leu Pro Arg Val Gly Val 2165 2170 2175Gly Thr Ser Phe Gly Leu Pro Gln Thr Arg Arg Ile Ser Leu Ala 2180 2185 2190Thr Pro Arg Gln Leu Phe Lys Ala Ser Asn Met Thr Gln Arg Trp 2195 2200 2205Gln His Arg Glu Ile Ser Asn Phe Glu Tyr Leu Met Phe Leu Asn 2210 2215 2220Thr Ile Ala Gly Arg Ser Tyr Asn Asp Leu Asn Gln Tyr Pro Val 2225 2230 2235Phe Pro Trp Val Ile Thr Asn Tyr Glu Ser Glu Glu Leu Asp Leu 2240 2245 2250Thr Leu Pro Ser Asn Phe Arg Asp Leu Ser Lys Pro Ile Gly Ala 2255 2260 2265Leu Asn Pro Lys Arg Ala Ala Phe Phe Ala Glu Arg Phe Glu Ser 2270 2275 2280Trp Glu Asp Asp Gln Val Pro Lys Phe His Tyr Gly Thr His Tyr 2285 2290 2295Ser Thr Ala Ser Phe Val Leu Ala Trp Leu Leu Arg Ile Glu Pro 2300 2305 2310Phe Thr Thr Tyr Phe Leu Asn Leu Gln Gly Gly Lys Phe Asp His 2315 2320 2325Ala Asp Arg Thr Phe Ser Ser Val Ser Arg Ala Trp Arg Asn Ser 2330 2335 2340Gln Arg Asp Thr Ser Asp Ile Lys Glu Leu Ile Pro Glu Phe Tyr 2345 2350 2355Tyr Leu Pro Glu Met Phe Val Asn Phe Asn Asn Tyr Asn Leu Gly 2360 2365 2370Val Met Asp Asp Gly Thr Val Val Ser Asp Val Glu Leu Pro Pro 2375 2380 2385Trp Ala Lys Thr Ser Glu Glu Phe Val Arg Ile Asn Arg Leu Ala 2390 2395 2400Leu Glu Ser Glu Phe Val Ser Cys Gln Leu His Gln Trp Ile Asp 2405 2410 2415Leu Ile Phe Gly Tyr Lys Gln Gln Gly Pro Glu Ala Val Arg Ala 2420 2425 2430Leu Asn Val Phe Tyr Tyr Leu Thr Tyr Glu Gly Ala Val Asn Leu 2435 2440 2445Asn Ser Ile Thr Asp Pro Val Leu Arg Glu Ala Val Glu Ala Gln 2450 2455 2460Ile Arg Ser Phe Gly Gln Thr Pro Ser Gln Leu Leu Ile Glu Pro 2465 2470 2475His Pro Pro Arg Gly Ser Ala Met Gln Ala Ser Pro Leu Met Phe 2480 2485 2490Thr Asp Gln Ala Gln Gln Asp Val Ile Met Val Leu Lys Phe Pro 2495 2500 2505Ser Asn Ser Pro Val Thr His Val Ala Ala Asn Thr Gln Pro Gly 2510 2515 2520Leu Ala Met Pro Ala Val Ile Thr Val Thr Ala Asn Arg Leu Phe 2525 2530 2535Ala Val Asn Lys Trp His Asn Leu Pro Ala His Gln Gly Ala Val 2540 2545 2550Gln Asp Gln Pro Tyr Gln Leu Pro Val Glu Ile Asp Pro Leu Ile 2555 2560 2565Ala Cys Gly Thr Gly Thr His Arg Arg Gln Val Thr Asp Leu Leu 2570 2575 2580Asp Gln Ser Ile Gln Val His Ser Gln Cys Phe Val Ile Thr Ser 2585 2590 2595Asp Asn Arg Tyr Ile Leu Val Cys Gly Phe Trp Asp Lys Ser Phe 2600 2605 2610Arg Val Tyr Ser Thr Asp Thr Gly Lys Leu Ile Gln Val Val Phe 2615 2620 2625Gly His Trp Asp Val Val Thr Cys Leu Ala Arg Ser Glu Ser Tyr 2630 2635 2640 Ile Gly Gly Asn Cys Tyr Ile Leu Ser Gly Ser Arg Asp Ala Thr 2645 2650 2655 Leu Leu Leu Trp Tyr Trp Asn Gly Lys Ser Ser Gly Ile Gly Asp 2660 2665 2670Asn Pro Gly Gly Glu Thr Ala Thr Pro Arg Ala Ile Leu Thr Gly 2675 2680 2685His Asp Tyr Glu Ile Thr Cys Ala Ala Val Cys Ala Glu Leu Gly 2690 2695 2700Leu Val Leu Ser Gly Ser Gln Glu Gly Pro Cys Leu Ile His Ser 2705 2710 2715Met Asn Gly Asp Leu Leu Arg Thr Leu Glu Gly Pro Glu Asn Cys 2720 2725 2730Leu Lys Pro Lys Leu Ile Gln Ala Ser Arg Glu Gly His Cys Val 2735 2740 2745Ile Phe Tyr Glu Asn Gly Cys Phe Cys Thr Phe Ser Val Asn Gly 2750 2755 2760Lys Leu Gln Ala Thr Val Glu Thr Asp Asp His Ile Arg Val Ser 2765 2770 2775Ala Val Gly Ser Thr Leu Phe Leu Leu Leu Gly Ser Ser Lys 2780 2785 2790516PRTMus musculus 5Val Ser Ala Val Gly Ser Thr Leu Phe Leu Leu Leu Gly Ser Ser Lys1 5 10 1562579PRTMus musculusBINDING(1350)..(1369)Putative Protein Kinase A RII binding site 6Met Ala Ser Glu Asp Asn Arg Ala Pro Ser Arg Pro Pro Thr Gly Asp1 5 10 15Asp Gly Gly Gly Gly Gly Lys Glu Glu Thr Pro Thr Glu Gly Gly Ala 20 25 30Leu Ser Leu Lys Pro Gly Leu Pro Ile Arg Gly Ile Arg Met Lys Phe 35 40 45Ala Val Leu Thr Gly Leu Val Glu Val Gly Glu Val Ser Asn Arg Asp 50 55 60Ile Val Glu Thr Val Phe Asn Leu Leu Val Gly Gly Gln Phe Asp Leu65 70 75 80Glu Met Asn Phe Ile Ile Gln Glu Gly Glu Ser Ile Met Cys Met Val 85 90 95Glu Leu Leu Glu Lys Cys Asp Val Thr Cys Gln Ala Glu Val Trp Ser 100 105 110Met Phe Thr Ala Ile Leu Lys Lys Ser Ile Arg Asn Leu Gln Val Cys 115 120 125Thr Glu Val Gly Leu Val Glu Lys Val Leu Gly Lys Ile Glu Lys Val 130 135 140Asp Ser Met Ile Ala Asp Leu Leu Val Asp Met Leu Gly Val Leu Ala145 150 155 160Ser Tyr Asn Leu Thr Val Arg Glu Leu Lys Leu Phe Phe Ser Lys Leu 165 170 175Gln Gly Asp Lys Gly Gln Trp Pro Pro His Ala Gly Lys Leu Leu Ser 180 185 190Val Leu Lys His Met Pro Gln Lys Tyr Gly Pro Asp Ala Phe Phe Asn 195 200 205Phe Pro Gly Lys Ser Ala Ala Ala Ile Ala Leu Pro Pro Ile Ala Arg 210 215 220Trp Pro Tyr Gln Asn Gly Phe Thr Phe His Thr Trp Leu Arg Met Asp225 230 235 240Pro Val Asn Asn Ile Asn Val Asp Lys Asp Lys Pro Tyr Leu Tyr Cys 245 250 255Phe Arg Thr Ser Lys Gly Leu Gly Tyr Ser Ala His Phe Val Gly Gly 260 265 270Cys Leu Ile Ile Thr Ser Ile Lys Ser Lys Gly Lys Gly Phe Gln His 275 280 285Cys Val Lys Phe Asp Phe Lys Pro Gln Lys Trp Tyr Met Val Thr Ile 290 295 300Val His Ile Tyr Asn Arg Trp Lys Asn Ser Glu Leu Arg Cys Tyr Val305 310 315 320Asn Gly Glu Leu Ala Ser Tyr Gly Glu Ile Thr Trp Phe Val Asn Thr 325 330 335Ser Asp Thr Phe Asp Lys Cys Phe Leu Gly Ser Ser Glu Thr Ala Asp 340 345 350Ala Asn Arg Val Phe Cys Gly Gln Met Thr Ala Val Tyr Leu Phe Ser 355 360 365Asp Ala Leu Asn Ala Ala Gln Ile Phe Ala Ile Tyr Gln Leu Gly Leu 370 375 380Gly Tyr Lys Gly Thr Phe Lys Phe Lys Ala Glu Ser Asp Leu Phe Leu385 390 395 400Ala Glu His His Lys Leu Leu Leu Tyr Asp Gly Lys Leu Ser Ser Ala 405 410 415Ile Ala Phe Met Tyr Asn Pro Arg Ala Thr Asp Ala Gln Leu Cys Leu 420 425 430Glu Ser Ser Pro Lys Asp Asn Pro Ser Ile Phe Val His Ser Pro His 435 440 445Ala Leu Met Leu Gln Asp Val Lys Ala Val Leu Thr His Ser Ile Gln 450 455 460Ser Ala Met His Ser Ile Gly Gly Val Gln Val Leu Phe Pro Leu Phe465 470 475 480Ala Gln Leu Asp Tyr Lys Gln Tyr Leu Ser Asp Glu Val Asp Leu Thr 485 490 495Ile Cys Thr Thr Leu Leu Ala Phe Ile Met Glu Leu Leu Lys Asn Ser 500 505 510Ile Ala Met Gln Glu Gln Met Leu Ala Cys Lys Gly Phe Leu Val Ile 515 520 525Gly Tyr Ser Leu Glu Lys Ser Ser Lys Ser His Val Ser Arg Ala Val 530 535 540Leu Glu Leu Cys Leu Ala Phe Ser Lys Tyr Leu Ser Asn Leu Gln Asn545 550 555 560Gly Met Pro Leu Leu Lys Gln Leu Cys Asp His Ile Leu Leu Asn Pro 565 570 575Ala Val Trp Ile His Thr Pro Ala Lys Val Gln Leu Met Leu Tyr Thr 580 585 590Tyr Leu Ser Thr Glu Phe Ile Gly Thr Val Asn Ile Tyr Asn Thr Ile 595 600 605Arg Arg Val Gly Thr Val Leu Leu Ile Met His Thr Leu Lys Tyr Tyr 610 615 620Tyr Trp Ala Val Asn Pro Gln Asp Arg Ser Gly Ile Thr Pro Lys Gly625 630 635 640Leu Asp Gly Pro Arg Pro Asn Gln Lys Glu Ile Leu Ser Leu Arg Ala 645 650 655Phe Leu Leu Met Phe Ile Lys Gln Leu Val Met Lys Asp Ser Gly Val 660 665 670Lys Glu Asp Glu Leu Gln Ala Ile Leu Asn Tyr Leu Leu Thr Met His 675 680 685Glu Asp Asp Asn Leu Met Asp Val Leu Gln Leu Leu Val Ala Leu Met 690 695 700Ala Glu His Pro Asn Ser Met Ile Pro Ala Phe Asp Gln Arg Asn Gly705 710 715 720Leu Arg Val Ile Tyr Lys Leu Leu Ala Ser Lys Ser Glu Gly Ile Arg 725 730 735Val Gln Ala Leu Lys Ala Leu Gly Tyr Phe Leu Lys His Leu Ala Pro 740 745 750Lys Arg Lys Ala Glu Val Met Leu Gly His Gly Leu Phe Ser Leu Leu 755 760 765Ala Glu Arg Leu Met Leu Gln Thr Asn Leu Ile Thr Met Thr Met Tyr 770 775 780Asn Val Leu Phe Glu Ile Leu Ile Glu Gln Ile Cys Thr Gln Val Ile785 790 795 800His Lys Gln His Pro Asp Pro Asp Ser Thr Val Lys Ile Gln Asn Pro 805 810 815Gln Ile Leu Lys Val Ile Ala Thr Leu Leu Arg Asn Ser Pro Gln Cys 820 825 830Pro Glu Ser Met Glu Val Arg Arg Ala Phe Leu Ser Asp Met Ile Lys 835 840 845Leu Phe Asn Asn Ser Arg Glu Asn Arg Arg Ser Leu Leu Gln Cys Ser 850 855 860Val Trp Gln Glu Trp Met Leu Ser Leu Cys Tyr Phe Asn Pro Lys Asn865 870 875 880Ser Asp Glu Gln Lys Ile Thr Glu Met Val Tyr Ala Ile Phe Arg Ile 885 890 895Leu Leu Tyr His Ala Val Lys Tyr Glu Trp Gly Gly Trp Arg Val Trp 900 905 910Val Asp Thr Leu Ser Ile Thr His Ser Lys Val Thr Phe Glu Ile His 915 920 925Lys Glu Asn Leu Ala Asn Ile Phe Arg Glu Glu Gln Arg Lys Gly Asp 930 935 940Glu Glu Thr Gly Pro Cys Ser Ser Ser Leu Val Pro Glu Gly Thr Gly945 950 955 960Ala Thr Arg Gly Val Asp Val Ser Val Gly Ser Gln His Glu Asp Arg 965 970 975Lys Asp Ser Pro Ile Ser Pro His Phe Thr Arg Asn Ser Asp Glu Asn 980 985 990Ser Ser Ile Gly Arg Ala Ser Ser Ile Asp Ser Ala Ser Asn Thr Glu 995 1000 1005Leu Gln Thr His Asp Met Ser Ser Asp Glu Lys Lys Val Glu Arg 1010 1015 1020Glu Asn Gln Glu Leu Leu Asp Gln Ala Thr Val Glu Glu Thr Ala 1025 1030 1035Thr Asn Gly Ala Lys Asp Asp Leu Glu Thr Ser Ser Asp Ala Ala 1040 1045 1050Glu Pro Val Thr Ile Asn Ser Asn Ser Leu Glu Pro Gly Lys Asp 1055 1060 1065 Thr Val Thr Ile Ser Glu Val Ser Ala Ser Ile Ser Ser Pro Ser 1070 1075 1080Glu Glu Asp Ala Ala Glu Met Pro Glu Leu Leu Glu Lys Ser Gly 1085 1090 1095Val Glu Glu Lys Glu Asp Asp Asp Tyr Val Glu Leu Lys Val Glu 1100 1105 1110Gly Ser Pro Thr Glu Glu Ala Gly Leu Pro Thr Glu Leu Gln Gly 1115 1120 1125Glu Gly Leu Val Ser Ala Ala Ser Gly Gly Arg Glu Glu Pro Asp 1130 1135 1140Met Cys Gly His Gly Cys Glu Val Gln Val Glu Ala Pro Ile Thr 1145 1150 1155Lys Ile His Asn Asp Pro Glu Thr Thr Asp Ser Glu Asp Ser Arg 1160 1165 1170Phe Pro Thr Val Ala Thr Ala Gly Ser Leu Ala Thr Ser Ser Glu 1175 1180 1185Val Pro Val Pro Gln Ala Thr Val Gln Ser Asp Ser His Glu Met 1190 1195 1200Leu Asp Gly Gly Met Lys Ala Thr Asn Leu Ala Gly Glu Thr Glu 1205 1210 1215 Ser Val Ser Asp Cys Ala Asp Asn Val Ser Glu Ala Pro Ala Thr 1220 1225 1230Ser Glu Gln Lys Ile Thr Lys Leu Asp Val Ser Ser Val Ala Ser 1235 1240 1245Asp Thr Glu Arg Phe Glu Leu Lys Ala Ser Thr Ser Thr Glu Ala 1250 1255 1260Pro Gln Pro Gln Arg His Gly Leu Glu Ile Ser Arg Gln Gln Glu 1265 1270 1275Gln Thr Ala Gln Gly Thr Ala Pro Asp Ala Val Asp Gln Gln Arg 1280 1285 1290Arg Asp Ser Arg Ser Thr Met Phe Arg Ile Pro Glu Phe Lys Trp 1295 1300 1305 Ser Gln Met His Gln Arg Leu Leu Thr Asp Leu Leu Phe Ser Ile 1310 1315 1320Glu Thr Asp Ile Gln Met Trp Arg Ser His Ser Thr Lys Thr Val 1325 1330 1335Met Asp Phe Val Asn Ser Ser Asp Asn Val Ile Phe Val His Asn 1340 1345 1350Thr Ile His Leu Ile Ser Gln Val Met Asp Asn Met Val Met Ala 1355 1360 1365Cys Gly Gly Ile Leu Pro Leu Leu Ser Ala Ala Thr Ser Ala Thr 1370 1375 1380His Glu Leu Glu Asn Ile Glu Pro Thr Gln Gly Leu Ser Ile Glu 1385 1390 1395Ala Ser Val Thr Phe Leu Gln Arg Leu Ile Ser Leu Val Asp Val 1400 1405 1410Leu Ile Phe Ala Ser Ser Leu Gly Phe Thr Glu Ile Glu Ala Glu 1415 1420 1425Lys Asn Met Ser Ser Gly Gly Ile Leu Arg Gln Cys Leu Arg Leu 1430 1435 1440Val Cys Ala Val Ala Val Arg Asn Cys Leu Glu Cys Gln Gln His 1445 1450 1455Ser Gln Leu Lys Ala Arg Gly Asp Thr Ala Lys Ser Ser Lys Thr 1460 1465 1470Ile His Ser Leu Ile Pro Met Gly Lys Ser Ala Ala Lys Ser Pro 1475 1480 1485Val Asp Ile Val Thr Gly Gly Ile Ser Ser Val Arg Asp Leu Asp 1490 1495 1500Arg Leu Pro Ala Arg Thr Trp Thr Leu Ile Gly Leu Arg Ala Val 1505 1510 1515Val Phe Arg Asp Ile Glu Asp Ser Lys Gln Ala Gln Phe Leu Ala 1520 1525 1530 Leu Ala Val Val Tyr Phe Ile Ser Val Leu Met Val Ser Lys Tyr 1535 1540 1545Arg Asp Ile Leu Glu Pro Gln Asp Glu Arg His Ser Gln Ser Leu 1550 1555 1560Lys Glu Thr Ser Ser Asp Asn Gly Asn Ala Ser Leu Pro Asp Ala 1565 1570 1575Glu Asn Thr Pro Ala Glu Phe Ser Ser Leu Thr Leu Ser Ser Val 1580 1585 1590Glu Glu Ser Leu Glu Gly Thr Ser Cys Thr Arg Arg Arg Asp Ser 1595 1600 1605Gly Leu Gly Glu Glu Thr Ala Ser Gly Leu Gly Ser Gly Leu

Val 1610 1615 1620Ser Ala Ser Pro Ala Ala Pro Leu Gly Val Ser Ala Gly Pro Asp 1625 1630 1635Ala Ile Ser Glu Val Leu Cys Thr Leu Ser Leu Glu Val Asn Lys 1640 1645 1650Ser Gln Glu Thr Arg Ile Asp Gly Gly Asn Glu Leu Asp Arg Lys 1655 1660 1665Val Thr Pro Ser Val Pro Val Ser Lys Asn Val Asn Val Lys Asp 1670 1675 1680Ile Leu Arg Ser Leu Val Asn Met Pro Ala Asp Gly Val Thr Val 1685 1690 1695Asp Pro Ala Leu Leu Pro Pro Ala Cys Leu Gly Ala Leu Gly Asp 1700 1705 1710Leu Ser Val Asp Pro Pro Met Gln Phe Arg Ser Phe Asp Arg Ser 1715 1720 1725Val Ile Ile Ala Thr Lys Lys Ser Ser Val Leu Pro Ser Ala Leu 1730 1735 1740Thr Thr Ser Ala Pro Ser Ser Ala Val Ser Val Val Ser Ser Val 1745 1750 1755Asp Pro Thr His Ala Ser Asp Thr Gly Gly Glu Ser Pro Gly Ser 1760 1765 1770Arg Ser Pro Lys Cys Lys Thr Ala Leu Ser Cys Lys Gln Leu Ala 1775 1780 1785Pro Ser His Lys Thr Pro Ala Ala His Met Ser Ile Thr Glu Arg 1790 1795 1800Leu Glu His Ala Leu Glu Lys Ala Ala Pro Leu Leu Arg Glu Ile 1805 1810 1815Phe Val Asp Phe Ala Pro Phe Leu Ser Arg Thr Leu Leu Gly Ser 1820 1825 1830His Gly Gln Glu Leu Leu Ile Glu Gly Thr Ser Leu Val Cys Met 1835 1840 1845Lys Ser Ser Ser Ser Val Val Glu Leu Val Met Leu Leu Cys Ser 1850 1855 1860Gln Glu Trp Gln Asn Ser Ile Gln Lys Asn Ala Gly Leu Ala Phe 1865 1870 1875Ile Glu Leu Val Asn Glu Gly Arg Leu Leu Ser Gln Thr Met Lys 1880 1885 1890Asp His Leu Val Arg Val Ala Asn Glu Ala Glu Phe Ile Leu Ser 1895 1900 1905Arg Gln Arg Ala Glu Asp Ile His Arg His Ala Glu Phe Glu Ser 1910 1915 1920Leu Cys Ala Gln Tyr Ser Ala Asp Lys Arg Glu Glu Glu Lys Met 1925 1930 1935 Cys Asp His Leu Ile Arg Ala Ala Lys Tyr Arg Asp His Val Thr 1940 1945 1950Ala Thr Gln Leu Ile Gln Lys Ile Ile Asn Leu Leu Thr Asp Lys 1955 1960 1965His Gly Ala Trp Gly Ser Ser Ala Val Ser Arg Pro Arg Glu Phe 1970 1975 1980Trp Arg Leu Asp Tyr Trp Glu Asp Asp Leu Arg Arg Arg Arg Arg 1985 1990 1995Phe Val Arg Asn Pro Leu Gly Ser Thr His Pro Glu Ala Thr Leu 2000 2005 2010Lys Thr Ala Val Glu His Ala Ala Asp Glu Asp Ile Leu Ala Lys 2015 2020 2025Gly Lys Gln Ser Ile Lys Ser Gln Ala Leu Gly Asn Gln Asn Ser 2030 2035 2040Glu Asn Glu Ala Leu Leu Glu Gly Asp Asp Asp Thr Leu Ser Ser 2045 2050 2055Val Asp Glu Lys Asp Leu Glu Asn Leu Ala Gly Pro Val Ser Leu 2060 2065 2070Ser Thr Pro Ala Gln Leu Val Ala Pro Ser Val Val Val Lys Gly 2075 2080 2085Thr Leu Ser Val Thr Ser Ser Glu Leu Tyr Phe Glu Val Asp Glu 2090 2095 2100Glu Asp Pro Asn Phe Lys Lys Ile Asp Pro Lys Ile Leu Ala Tyr 2105 2110 2115Thr Glu Gly Leu His Gly Lys Trp Leu Phe Thr Glu Ile Arg Ser 2120 2125 2130Ile Phe Ser Arg Arg Tyr Leu Leu Gln Asn Thr Ala Leu Glu Ile 2135 2140 2145Phe Met Ala Asn Arg Val Ala Val Met Phe Asn Phe Pro Asp Pro 2150 2155 2160Ala Thr Val Lys Lys Val Val Asn Tyr Leu Pro Arg Val Gly Val 2165 2170 2175Gly Thr Ser Phe Gly Leu Pro Gln Thr Arg Arg Ile Ser Leu Ala 2180 2185 2190Thr Pro Arg Gln Leu Phe Lys Ala Ser Asn Met Thr Gln Arg Trp 2195 2200 2205 Gln His Arg Glu Ile Ser Asn Phe Glu Tyr Leu Met Phe Leu Asn 2210 2215 2220Thr Ile Ala Gly Arg Ser Tyr Asn Asp Leu Asn Gln Tyr Pro Val 2225 2230 2235Phe Pro Trp Val Ile Thr Asn Tyr Glu Ser Glu Glu Leu Asp Leu 2240 2245 2250Thr Leu Pro Ser Asn Phe Arg Asp Leu Ser Lys Pro Ile Gly Ala 2255 2260 2265Leu Asn Pro Lys Arg Ala Ala Phe Phe Ala Glu Arg Phe Glu Ser 2270 2275 2280Trp Glu Asp Asp Gln Val Pro Lys Phe His Tyr Gly Thr His Tyr 2285 2290 2295Ser Thr Ala Ser Phe Val Leu Ala Trp Leu Leu Arg Ile Glu Pro 2300 2305 2310Phe Thr Thr Tyr Phe Leu Asn Leu Gln Gly Gly Lys Phe Asp His 2315 2320 2325Ala Asp Arg Thr Phe Ser Ser Val Ser Arg Ala Trp Arg Asn Ser 2330 2335 2340Gln Arg Asp Thr Ser Asp Ile Lys Glu Leu Ile Pro Glu Phe Tyr 2345 2350 2355Tyr Leu Pro Glu Met Phe Val Asn Phe Asn Asn Tyr Asn Leu Gly 2360 2365 2370Val Met Asp Asp Gly Thr Val Val Ser Asp Val Glu Leu Pro Pro 2375 2380 2385Trp Ala Lys Thr Ser Glu Glu Phe Val Arg Ile Asn Arg Leu Ala 2390 2395 2400Leu Glu Ser Glu Phe Val Ser Cys Gln Leu His Gln Trp Ile Asp 2405 2410 2415Leu Ile Phe Gly Tyr Lys Gln Gln Gly Pro Glu Ala Val Arg Ala 2420 2425 2430Leu Asn Val Phe Tyr Tyr Leu Thr Tyr Glu Gly Ala Val Asn Leu 2435 2440 2445Asn Ser Ile Thr Asp Pro Val Leu Arg Glu Ala Val Glu Ala Gln 2450 2455 2460Ile Arg Ser Phe Gly Gln Thr Pro Ser Gln Leu Leu Ile Glu Pro 2465 2470 2475His Pro Pro Arg Gly Ser Ala Met Gln Ala Ser Pro Leu Met Phe 2480 2485 2490Thr Asp Gln Ala Gln Gln Asp Val Ile Met Val Leu Lys Phe Pro 2495 2500 2505Ser Asn Ser Pro Val Thr His Val Ala Ala Asn Thr Gln Pro Gly 2510 2515 2520Leu Ala Met Pro Ala Val Ile Thr Val Thr Ala Asn Arg Leu Phe 2525 2530 2535Ala Val Asn Lys Trp His Asn Leu Pro Ala His Gln Gly Ala Val 2540 2545 2550 Gln Asp Gln Pro Tyr Gln Leu Pro Val Glu Ile Asp Pro Leu Ile 2555 2560 2565Gly Leu Pro Leu Leu Ser Leu Phe Ala Ile His 2570 2575711PRTMus musculus 7Gly Leu Pro Leu Leu Ser Leu Phe Ala Ile His1 5 1082863PRTHomo sapiensDOMAIN(1)..(72)G peptide 8Met Ala Ser Glu Asp Asn Arg Val Pro Ser Pro Pro Pro Thr Gly Asp1 5 10 15Asp Gly Gly Gly Gly Gly Arg Glu Glu Thr Pro Thr Glu Gly Gly Ala 20 25 30Leu Ser Leu Lys Pro Gly Leu Pro Ile Arg Gly Ile Arg Met Lys Phe 35 40 45Ala Val Leu Thr Gly Leu Val Glu Val Gly Glu Val Ser Asn Arg Asp 50 55 60Ile Val Glu Thr Val Phe Asn Leu Leu Val Gly Gly Gln Phe Asp Leu65 70 75 80Glu Met Asn Phe Ile Ile Gln Glu Gly Glu Ser Ile Asn Cys Met Val 85 90 95Asp Leu Leu Glu Lys Cys Asp Ile Thr Cys Gln Ala Glu Val Trp Ser 100 105 110Met Phe Thr Ala Ile Leu Lys Lys Ser Ile Arg Asn Leu Gln Val Cys 115 120 125Thr Glu Val Gly Leu Val Glu Lys Val Leu Gly Lys Ile Glu Lys Val 130 135 140Asp Asn Met Ile Ala Asp Leu Leu Val Asp Met Leu Gly Val Leu Ala145 150 155 160Ser Tyr Asn Leu Thr Val Arg Glu Leu Lys Leu Phe Phe Ser Lys Leu 165 170 175Gln Gly Asp Lys Gly Arg Trp Pro Pro His Ala Gly Lys Leu Leu Ser 180 185 190Val Leu Lys His Met Pro Gln Lys Tyr Gly Pro Asp Ala Phe Phe Asn 195 200 205Phe Pro Gly Lys Ser Ala Ala Ala Ile Ala Leu Pro Pro Ile Ala Lys 210 215 220Trp Pro Tyr Gln Asn Gly Phe Thr Phe His Thr Trp Leu Arg Met Asp225 230 235 240Pro Val Asn Asn Ile Asn Val Asp Lys Asp Lys Pro Tyr Leu Tyr Cys 245 250 255Phe Arg Thr Ser Lys Gly Leu Gly Tyr Ser Ala His Phe Val Gly Gly 260 265 270Cys Leu Ile Val Thr Ser Ile Lys Ser Lys Gly Lys Gly Phe Gln His 275 280 285Cys Val Lys Phe Asp Phe Lys Pro Gln Lys Trp Tyr Met Val Thr Ile 290 295 300Val His Ile Tyr Asn Arg Trp Lys Asn Ser Glu Leu Arg Cys Tyr Val305 310 315 320Asn Gly Glu Leu Ala Ser Tyr Gly Glu Ile Thr Trp Phe Val Asn Thr 325 330 335Ser Asp Thr Phe Asp Lys Cys Phe Leu Gly Ser Ser Glu Thr Ala Asp 340 345 350Ala Asn Arg Val Phe Cys Gly Gln Met Thr Ala Val Tyr Leu Phe Ser 355 360 365Glu Ala Leu Asn Ala Ala Gln Ile Phe Ala Ile Tyr Gln Leu Gly Leu 370 375 380Gly Tyr Lys Gly Thr Phe Lys Phe Lys Ala Glu Ser Asp Leu Phe Leu385 390 395 400Ala Glu His His Lys Leu Leu Leu Tyr Asp Gly Lys Leu Ser Ser Ala 405 410 415Ile Ala Phe Thr Tyr Asn Pro Arg Ala Thr Asp Ala Gln Leu Cys Leu 420 425 430Glu Ser Ser Pro Lys Asp Asn Pro Ser Ile Phe Val His Ser Pro His 435 440 445Ala Leu Met Leu Gln Asp Val Lys Ala Val Leu Thr His Ser Ile Gln 450 455 460Ser Ala Met His Ser Ile Gly Gly Val Gln Val Leu Phe Pro Leu Phe465 470 475 480Ala Gln Leu Asp Tyr Arg Gln Tyr Leu Ser Asp Glu Ile Asp Leu Thr 485 490 495Ile Cys Ser Thr Leu Leu Ala Phe Ile Met Glu Leu Leu Lys Asn Ser 500 505 510Ile Ala Met Gln Glu Gln Met Leu Ala Cys Lys Gly Phe Leu Val Ile 515 520 525Gly Tyr Ser Leu Glu Lys Ser Ser Lys Ser His Val Ser Arg Ala Val 530 535 540Leu Glu Leu Cys Leu Ala Phe Ser Lys Tyr Leu Ser Asn Leu Gln Asn545 550 555 560Gly Met Pro Leu Leu Lys Gln Leu Cys Asp His Val Leu Leu Asn Pro 565 570 575Ala Ile Trp Ile His Thr Pro Ala Lys Val Gln Leu Met Leu Tyr Thr 580 585 590Tyr Leu Ser Thr Glu Phe Ile Gly Thr Val Asn Ile Tyr Asn Thr Ile 595 600 605Arg Arg Val Gly Thr Val Leu Leu Ile Met His Thr Leu Lys Tyr Tyr 610 615 620Tyr Trp Ala Val Asn Pro Gln Asp Arg Ser Gly Ile Thr Pro Lys Gly625 630 635 640Leu Asp Gly Pro Arg Pro Asn Gln Lys Glu Met Leu Ser Leu Arg Ala 645 650 655Phe Leu Leu Met Phe Ile Lys Gln Leu Val Met Lys Asp Ser Gly Val 660 665 670Lys Glu Asp Glu Leu Gln Ala Ile Leu Asn Tyr Leu Leu Thr Met His 675 680 685Glu Asp Asp Asn Leu Met Asp Val Leu Gln Leu Leu Val Ala Leu Met 690 695 700Ser Glu His Pro Asn Ser Met Ile Pro Ala Phe Asp Gln Arg Asn Gly705 710 715 720Leu Arg Val Ile Tyr Lys Leu Leu Ala Ser Lys Ser Glu Gly Ile Arg 725 730 735Val Gln Ala Leu Lys Ala Met Gly Tyr Phe Leu Lys His Arg Pro Pro 740 745 750Lys Arg Lys Ala Glu Val Met Leu Gly His Gly Leu Phe Ser Leu Leu 755 760 765Ala Glu Arg Leu Met Leu Gln Thr Asn Leu Ile Thr Met Thr Thr Tyr 770 775 780Asn Val Leu Phe Glu Ile Leu Ile Glu Gln Ile Gly Thr Gln Val Ile785 790 795 800His Lys Gln His Pro Asp Pro Asp Ser Ser Val Lys Ile Gln Asn Pro 805 810 815Gln Ile Leu Lys Val Ile Ala Thr Leu Leu Arg Asn Ser Pro Gln Cys 820 825 830Pro Glu Ser Met Glu Val Arg Arg Ala Phe Leu Ser Asp Met Ile Lys 835 840 845Leu Phe Asn Asn Ser Arg Glu Asn Arg Arg Ser Leu Leu Gln Cys Ser 850 855 860Val Trp Gln Glu Trp Met Leu Ser Leu Cys Tyr Phe Asn Pro Lys Asn865 870 875 880Ser Asp Glu Gln Lys Ile Thr Glu Met Val Tyr Ala Ile Phe Arg Ile 885 890 895Leu Leu Tyr His Ala Val Lys Tyr Glu Trp Gly Gly Trp Arg Val Trp 900 905 910Val Asp Thr Leu Ser Ile Thr His Ser Lys Val Thr Phe Glu Ile His 915 920 925Lys Glu Asn Leu Ala Asn Ile Phe Arg Glu Gln Gln Gly Lys Val Asp 930 935 940Glu Glu Ile Gly Leu Cys Ser Ser Thr Ser Val Gln Ala Ala Ser Gly945 950 955 960Ile Arg Arg Asp Ile Asn Val Ser Val Gly Ser Gln Gln Pro Asp Thr 965 970 975Lys Asp Ser Pro Val Cys Pro His Phe Thr Thr Asn Gly Asn Glu Asn 980 985 990Ser Ser Ile Glu Lys Thr Ser Ser Leu Glu Ser Ala Ser Asn Ile Glu 995 1000 1005Leu Gln Thr Thr Asn Thr Ser Tyr Glu Glu Met Lys Ala Glu Gln 1010 1015 1020Glu Asn Gln Glu Leu Pro Asp Glu Gly Thr Leu Glu Glu Thr Leu 1025 1030 1035Thr Asn Glu Thr Arg Asn Ala Asp Asp Leu Glu Val Ser Ser Asp 1040 1045 1050Ile Ile Glu Ala Val Ala Ile Ser Ser Asn Ser Phe Ile Thr Thr 1055 1060 1065Gly Lys Asp Ser Met Thr Val Ser Glu Val Thr Ala Ser Ile Ser 1070 1075 1080Ser Pro Ser Glu Glu Asp Ala Ser Glu Met Pro Glu Phe Leu Asp 1085 1090 1095Lys Ser Ile Val Glu Glu Glu Glu Asp Asp Asp Tyr Val Glu Leu 1100 1105 1110Lys Val Glu Gly Ser Pro Thr Glu Glu Ala Asn Leu Pro Thr Glu 1115 1120 1125Leu Gln Asp Asn Ser Leu Ser Pro Ala Ala Ser Glu Ala Gly Glu 1130 1135 1140Lys Leu Asp Met Phe Gly Asn Asp Asp Lys Leu Ile Phe Gln Glu 1145 1150 1155 Gly Lys Pro Val Thr Glu Lys Gln Thr Asp Thr Glu Thr Gln Asp 1160 1165 1170Ser Lys Asp Ser Gly Ile Gln Thr Met Thr Ala Ser Gly Ser Ser 1175 1180 1185Ala Met Ser Pro Glu Thr Thr Val Ser Gln Ile Ala Val Glu Ser 1190 1195 1200Asp Leu Gly Gln Met Leu Glu Glu Gly Lys Lys Ala Thr Asn Leu 1205 1210 1215Thr Arg Glu Thr Lys Leu Ile Asn Asp Cys His Gly Ser Val Ser 1220 1225 1230Glu Ala Ser Ser Glu Gln Lys Ile Ala Lys Leu Asp Val Ser Asn 1235 1240 1245Val Ala Thr Asp Thr Glu Arg Leu Glu Leu Lys Ala Ser Pro Asn 1250 1255 1260Val Glu Ala Pro Gln Pro His Arg His Val Leu Glu Ile Ser Arg 1265 1270 1275Gln His Glu Gln Pro Gly Gln Gly Ile Ala Pro Asp Ala Val Asn 1280 1285 1290Gly Gln Arg Arg Asp Ser Arg Ser Thr Val Phe Arg Ile Pro Glu 1295 1300 1305Phe Asn Trp Ser Gln Met His Gln Arg Leu Leu Thr Asp Leu Leu 1310 1315 1320Phe Ser Ile Glu Thr Asp Ile Gln Met Trp Arg Ser His Ser Thr 1325 1330 1335Lys Thr Val Met Asp Phe Val Asn Ser Ser Asp Asn Val Ile Phe 1340 1345 1350 Val His Asn Thr Ile His Leu Ile Ser Gln Val Met Asp Asn Met 1355 1360 1365Val Met Ala Cys Gly Gly Ile Leu Pro Leu Leu Ser Ala Ala Thr 1370 1375 1380Ser Ala Thr His Glu Leu Glu Asn Ile Glu Pro Thr Gln Gly Leu 1385 1390 1395Ser Ile Glu Ala Ser Val Thr Phe Leu Gln Arg Leu Ile Ser Leu 1400 1405 1410Val Asp Val Leu Ile Phe Ala Ser Ser Leu Gly Phe Thr Glu Ile 1415 1420 1425Glu Ala Glu Lys Ser Met Ser Ser Gly Gly Ile Leu Arg Gln Cys 1430 1435 1440Leu Arg Leu Val Cys Ala Val Ala Val Arg Asn Cys Leu Glu Cys 1445 1450 1455Gln Gln His Ser Gln Leu Lys Thr Arg Gly Asp Lys Ala Leu Lys 1460

1465 1470Pro Met His Ser Leu Ile Pro Leu Gly Lys Ser Ala Ala Lys Ser 1475 1480 1485Pro Val Asp Ile Val Thr Gly Gly Ile Ser Pro Val Arg Asp Leu 1490 1495 1500Asp Arg Leu Leu Gln Asp Met Asp Ile Asn Arg Leu Arg Ala Val 1505 1510 1515Val Phe Arg Asp Ile Glu Asp Ser Lys Gln Ala Gln Phe Leu Ala 1520 1525 1530Leu Ala Val Val Tyr Phe Ile Ser Val Leu Met Val Ser Lys Tyr 1535 1540 1545Arg Asp Ile Leu Glu Pro Gln Asn Glu Arg His Ser Gln Ser Cys 1550 1555 1560Thr Glu Thr Gly Ser Glu Asn Glu Asn Val Ser Leu Ser Glu Ile 1565 1570 1575Thr Pro Ala Ala Phe Ser Thr Leu Thr Thr Ala Ser Val Glu Glu 1580 1585 1590Ser Glu Ser Thr Ser Ser Ala Arg Arg Arg Asp Ser Gly Ile Gly 1595 1600 1605Glu Glu Thr Ala Thr Gly Leu Gly Ser His Val Glu Val Thr Pro 1610 1615 1620His Thr Ala Pro Pro Gly Val Ser Ala Gly Pro Asp Ala Ile Ser 1625 1630 1635Glu Val Leu Ser Thr Leu Ser Leu Glu Val Asn Lys Ser Pro Glu 1640 1645 1650Thr Lys Asn Asp Arg Gly Asn Asp Leu Asp Thr Lys Ala Thr Pro 1655 1660 1665Ser Val Ser Val Ser Lys Asn Val Asn Val Lys Asp Ile Leu Arg 1670 1675 1680Ser Leu Val Asn Ile Pro Ala Asp Gly Val Thr Val Asp Pro Ala 1685 1690 1695Leu Leu Pro Pro Ala Cys Leu Gly Ala Leu Gly Asp Leu Ser Val 1700 1705 1710Glu Gln Pro Val Gln Phe Arg Ser Phe Asp Arg Ser Val Ile Val 1715 1720 1725Ala Ala Lys Lys Ser Ala Val Ser Pro Ser Thr Phe Asn Thr Ser 1730 1735 1740Ile Pro Thr Asn Ala Val Ser Val Val Ser Ser Val Asp Ser Ala 1745 1750 1755Gln Ala Ser Asp Met Gly Gly Glu Ser Pro Gly Ser Arg Ser Ser 1760 1765 1770Asn Ala Lys Leu Pro Ser Val Pro Thr Val Asp Ser Val Ser Gln 1775 1780 1785Asp Pro Val Ser Asn Met Ser Ile Thr Glu Arg Leu Glu His Ala 1790 1795 1800Leu Glu Lys Ala Ala Pro Leu Leu Arg Glu Ile Phe Val Asp Phe 1805 1810 1815Ala Pro Phe Leu Ser Arg Thr Leu Leu Gly Ser His Gly Gln Glu 1820 1825 1830Leu Leu Ile Glu Gly Thr Ser Leu Val Cys Met Lys Ser Ser Ser 1835 1840 1845Ser Val Val Glu Leu Val Met Leu Leu Cys Ser Gln Glu Trp Gln 1850 1855 1860Asn Ser Ile Gln Lys Asn Ala Gly Leu Ala Phe Ile Glu Leu Val 1865 1870 1875Asn Glu Gly Arg Leu Leu Ser Gln Thr Met Lys Asp His Leu Val 1880 1885 1890Arg Val Ala Asn Glu Ala Glu Phe Ile Leu Ser Arg Gln Arg Ala 1895 1900 1905Glu Asp Ile His Arg His Ala Glu Phe Glu Ser Leu Cys Ala Gln 1910 1915 1920Tyr Ser Ala Asp Lys Arg Glu Asp Glu Lys Met Cys Asp His Leu 1925 1930 1935Ile Arg Ala Ala Lys Tyr Arg Asp His Val Thr Ala Thr Gln Leu 1940 1945 1950Ile Gln Lys Ile Ile Asn Ile Leu Thr Asp Lys His Gly Ala Trp 1955 1960 1965Gly Asn Ser Ala Val Ser Arg Pro Leu Glu Phe Trp Arg Leu Asp 1970 1975 1980Tyr Trp Glu Asp Asp Leu Arg Arg Arg Arg Arg Phe Val Arg Asn 1985 1990 1995Pro Leu Gly Ser Thr His Pro Glu Ala Thr Leu Lys Thr Ala Val 2000 2005 2010Glu His Val Cys Ile Phe Lys Leu Arg Glu Asn Ser Lys Ala Thr 2015 2020 2025Asp Glu Asp Ile Leu Ala Lys Gly Lys Gln Ser Ile Arg Ser Gln 2030 2035 2040Ala Leu Gly Asn Gln Asn Ser Glu Asn Glu Ile Leu Leu Glu Gly 2045 2050 2055Asp Asp Asp Thr Leu Ser Ser Val Asp Glu Lys Asp Leu Glu Asn 2060 2065 2070Leu Ala Gly Pro Val Ser Leu Ser Thr Pro Ala Gln Leu Val Ala 2075 2080 2085Pro Ser Val Val Val Lys Gly Thr Leu Ser Val Thr Ser Ser Glu 2090 2095 2100Leu Tyr Phe Glu Val Asp Glu Glu Asp Pro Asn Phe Lys Lys Ile 2105 2110 2115Asp Pro Lys Ile Leu Ala Tyr Thr Glu Gly Leu His Gly Lys Trp 2120 2125 2130Leu Phe Thr Glu Ile Arg Ser Ile Phe Ser Arg Arg Tyr Leu Leu 2135 2140 2145Gln Asn Thr Ala Leu Glu Ile Phe Met Ala Asn Arg Val Ala Val 2150 2155 2160Met Phe Asn Phe Pro Asp Pro Ala Thr Val Lys Lys Val Val Asn 2165 2170 2175Phe Leu Pro Arg Val Gly Val Gly Thr Ser Phe Gly Leu Pro Gln 2180 2185 2190Thr Arg Arg Ile Ser Leu Ala Ser Pro Arg Gln Leu Phe Lys Ala 2195 2200 2205Ser Asn Met Thr Gln Arg Trp Gln His Arg Glu Ile Ser Asn Phe 2210 2215 2220Glu Tyr Leu Met Phe Leu Asn Thr Ile Ala Gly Arg Ser Tyr Asn 2225 2230 2235Asp Leu Asn Gln Tyr Pro Val Phe Pro Trp Val Ile Thr Asn Tyr 2240 2245 2250Glu Ser Glu Glu Leu Asp Leu Thr Leu Pro Thr Asn Phe Arg Asp 2255 2260 2265Leu Ser Lys Pro Ile Gly Ala Leu Asn Pro Lys Arg Ala Ala Phe 2270 2275 2280Phe Ala Glu Arg Tyr Glu Ser Trp Glu Asp Asp Gln Val Pro Lys 2285 2290 2295Phe His Tyr Gly Thr His Tyr Ser Thr Ala Ser Phe Val Leu Ala 2300 2305 2310Trp Leu Leu Arg Ile Glu Pro Phe Thr Thr Tyr Phe Leu Asn Leu 2315 2320 2325Gln Gly Gly Lys Phe Asp His Ala Asp Arg Thr Phe Ser Ser Ile 2330 2335 2340Ser Arg Ala Trp Arg Asn Ser Gln Arg Asp Thr Ser Asp Ile Lys 2345 2350 2355Glu Leu Ile Pro Glu Phe Tyr Tyr Leu Pro Glu Met Phe Val Asn 2360 2365 2370Phe Asn Asn Tyr Asn Leu Gly Val Met Asp Asp Gly Thr Val Val 2375 2380 2385Ser Asp Val Glu Leu Pro Pro Trp Ala Lys Thr Ser Glu Glu Phe 2390 2395 2400Val His Ile Asn Arg Leu Ala Leu Glu Ser Glu Phe Val Ser Cys 2405 2410 2415Gln Leu His Gln Trp Ile Asp Leu Ile Phe Gly Tyr Lys Gln Gln 2420 2425 2430Gly Pro Glu Ala Val Arg Ala Leu Asn Val Phe Tyr Tyr Leu Thr 2435 2440 2445Tyr Glu Gly Ala Val Asn Leu Asn Ser Ile Thr Asp Pro Val Leu 2450 2455 2460Arg Glu Ala Val Glu Ala Gln Ile Arg Ser Phe Gly Gln Thr Pro 2465 2470 2475Ser Gln Leu Leu Ile Glu Pro His Pro Pro Arg Gly Ser Ala Met 2480 2485 2490Gln Val Ser Pro Leu Met Phe Thr Asp Lys Ala Gln Gln Asp Val 2495 2500 2505Ile Met Val Leu Lys Phe Pro Ser Asn Ser Pro Val Thr His Val 2510 2515 2520Ala Ala Asn Thr Gln Pro Gly Leu Ala Thr Pro Ala Val Ile Thr 2525 2530 2535Val Thr Ala Asn Arg Leu Phe Ala Val Asn Lys Trp His Asn Leu 2540 2545 2550 Pro Ala His Gln Gly Ala Val Gln Asp Gln Pro Tyr Gln Leu Pro 2555 2560 2565Val Glu Ile Asp Pro Leu Ile Ala Ser Asn Thr Gly Met His Arg 2570 2575 2580Arg Gln Ile Thr Asp Leu Leu Asp Gln Ser Ile Gln Val His Ser 2585 2590 2595Gln Cys Phe Val Ile Thr Ser Asp Asn Arg Tyr Ile Leu Val Cys 2600 2605 2610Gly Phe Trp Asp Lys Ser Phe Arg Val Tyr Ser Thr Asp Thr Gly 2615 2620 2625Arg Leu Ile Gln Val Val Phe Gly His Trp Asp Val Val Thr Cys 2630 2635 2640Leu Ala Arg Ser Glu Ser Tyr Ile Gly Gly Asn Cys Tyr Ile Leu 2645 2650 2655Ser Gly Ser Arg Asp Ala Thr Leu Leu Leu Trp Tyr Trp Asn Gly 2660 2665 2670Lys Cys Ser Gly Ile Gly Asp Asn Pro Gly Ser Glu Thr Ala Ala 2675 2680 2685Pro Arg Ala Ile Leu Thr Gly His Asp Tyr Glu Val Thr Cys Ala 2690 2695 2700 Ala Val Cys Ala Glu Leu Gly Leu Val Leu Ser Gly Ser Gln Glu 2705 2710 2715Gly Pro Cys Leu Ile His Ser Met Asn Gly Asp Leu Leu Arg Thr 2720 2725 2730Leu Glu Gly Pro Glu Asn Cys Leu Lys Pro Lys Leu Ile Gln Ala 2735 2740 2745Ser Arg Glu Gly His Cys Val Ile Phe Tyr Glu Asn Gly Leu Phe 2750 2755 2760Cys Thr Phe Ser Val Asn Gly Lys Leu Gln Ala Thr Met Glu Thr 2765 2770 2775Asp Asp Asn Ile Arg Ala Ile Gln Leu Ser Arg Asp Gly Gln Tyr 2780 2785 2790Leu Leu Thr Gly Gly Asp Arg Gly Val Val Val Val Arg Gln Val 2795 2800 2805Ser Asp Leu Lys Gln Leu Phe Ala Tyr Pro Gly Cys Asp Ala Gly 2810 2815 2820Ile Arg Ala Met Ala Leu Ser Tyr Asp Gln Arg Cys Ile Ile Ser 2825 2830 2835 Gly Met Ala Ser Gly Ser Ile Val Leu Phe Tyr Asn Asp Phe Asn 2840 2845 2850Arg Trp His His Glu Tyr Gln Thr Arg Tyr 2855 2860969PRTMus musculusBINDING(1)..(21)Putative Protein Kinase A RII binding site 9Phe Val His Asn Thr Ile His Leu Ile Ser Gln Val Met Asp Asn Met1 5 10 15Val Met Ala Cys Gly Gly Ile Leu Pro Leu Leu Ser Ala Ala Thr Ser 20 25 30Ala Thr His Glu Leu Glu Asn Ile Glu Pro Thr Gln Gly Leu Ser Ile 35 40 45Glu Ala Ser Val Thr Phe Leu Gln Arg Leu Ile Ser Leu Val Asp Val 50 55 60Leu Ile Phe Ala Ser651069PRTHomo sapiensBINDING(1)..(21)Putative Protein Kinase A RII binding site 10Phe Val His Asn Thr Ile His Leu Ile Ser Gln Val Met Asp Asn Met1 5 10 15Val Met Ala Cys Gly Gly Ile Leu Pro Leu Leu Ser Ala Ala Thr Ser 20 25 30Ala Thr His Glu Leu Glu Asn Ile Glu Pro Thr Gln Gly Leu Ser Ile 35 40 45Glu Ala Ser Val Thr Phe Leu Gln Arg Leu Ile Ser Leu Val Asp Val 50 55 60Leu Ile Phe Ala Ser651176PRTDrosophila melanogasterBINDING(1)..(21)Putative Protein Kinase A RII binding site 11Val Ala Leu Ala Val Arg Asp Ile Val Glu Gln Leu Ile Asp Lys Val1 5 10 15Ile Asp Ala Thr Glu Ala Glu Ser Ala Ser Glu Thr Lys Thr Glu Thr 20 25 30Asn Asn Asn Glu Ile Pro Lys Lys Glu Lys Gln Thr Ser Glu Glu Pro 35 40 45Glu Asp Val Glu Thr Ala Glu Thr Leu Ala Ala Ala Ala Lys Glu Ile 50 55 60Val Gln Glu Val Val Glu Ala Ala Leu Val Val Val65 70 751269PRTDrosophila melanogasterBINDING(1)..(21)Putative Protein Kinase A RII binding site 12Phe Val Val Asn Thr Val His Leu Ile Ser Gln Leu Ala Asp Asn Leu1 5 10 15Ile Ile Ala Cys Gly Gly Leu Leu Pro Leu Leu Ala Ser Ala Thr Ser 20 25 30Pro Asn Ser Glu Leu Asp Val Leu Glu Pro Thr Gln Gly Met Pro Leu 35 40 45Glu Val Ala Val Ser Phe Leu Gln Arg Leu Val Asn Met Ala Asp Val 50 55 60Leu Ile Phe Ala Thr651370PRTCaenorhabditis elegansBINDING(1)..(21)Putative Protein Kinase A RII binding site 13Phe Val Gly Asn Val Val His Val Val Ser Gln Leu Ser Asp Ser Leu1 5 10 15Ile Met Ala Cys Gly Gly Leu Leu Pro Leu Leu Ala Ser Ala Thr Ala 20 25 30Pro Asn Asn Asp Met Glu Ile Val Asp Pro Cys Gln Gln Gln Leu Pro 35 40 45Ile Ser Val Ser Ala Gly Phe Leu Met Arg Phe Ala Arg Leu Val Asp 50 55 60Thr Phe Val Leu Ala Ser65 7014972PRTMus musculusREPEAT(144)..(187)WDL (WD-like) repeat 14Gly Arg Leu Leu Ser Gln Thr Met Lys Asp His Leu Val Arg Val Ala1 5 10 15Asn Glu Ala Glu Phe Ile Leu Ser Arg Gln Arg Ala Glu Asp Ile His 20 25 30Arg His Ala Glu Phe Glu Ser Leu Cys Ala Gln Tyr Ser Ala Asp Lys 35 40 45Arg Glu Glu Glu Lys Met Cys Asp His Leu Ile Arg Ala Ala Lys Tyr 50 55 60Arg Asp His Val Thr Ala Thr Gln Leu Ile Gln Lys Ile Ile Asn Leu65 70 75 80Leu Thr Asp Lys His Gly Ala Trp Gly Ser Ser Ala Val Ser Arg Pro 85 90 95Arg Glu Phe Trp Arg Leu Asp Tyr Trp Glu Asp Asp Leu Arg Arg Arg 100 105 110Arg Arg Phe Val Arg Asn Pro Leu Gly Ser Thr His Pro Glu Ala Thr 115 120 125Leu Lys Thr Ala Val Glu His Ala Ala Asp Glu Asp Ile Leu Ala Lys 130 135 140Gly Lys Gln Ser Ile Lys Ser Gln Ala Leu Gly Asn Gln Asn Ser Glu145 150 155 160Asn Glu Ala Leu Leu Glu Gly Asp Asp Asp Thr Leu Ser Ser Val Asp 165 170 175Glu Lys Asp Leu Glu Asn Leu Ala Gly Pro Val Ser Leu Ser Thr Pro 180 185 190Ala Gln Leu Val Ala Pro Ser Val Val Val Lys Gly Thr Leu Ser Val 195 200 205Thr Ser Ser Glu Leu Tyr Phe Glu Val Asp Glu Glu Asp Pro Asn Phe 210 215 220Lys Lys Ile Asp Pro Lys Ile Leu Ala Tyr Thr Glu Gly Leu His Gly225 230 235 240Lys Trp Leu Phe Thr Glu Ile Arg Ser Ile Phe Ser Arg Arg Tyr Leu 245 250 255Leu Gln Asn Thr Ala Leu Glu Ile Phe Met Ala Asn Arg Val Ala Val 260 265 270Met Phe Asn Phe Pro Asp Pro Ala Thr Val Lys Lys Val Val Asn Tyr 275 280 285Leu Pro Arg Val Gly Val Gly Thr Ser Phe Gly Leu Pro Gln Thr Arg 290 295 300Arg Ile Ser Leu Ala Thr Pro Arg Gln Leu Phe Lys Ala Ser Asn Met305 310 315 320Thr Gln Arg Trp Gln His Arg Glu Ile Ser Asn Phe Glu Tyr Leu Met 325 330 335Phe Leu Asn Thr Ile Ala Gly Arg Ser Tyr Asn Asp Leu Asn Gln Tyr 340 345 350Pro Val Phe Pro Trp Val Ile Thr Asn Tyr Glu Ser Glu Glu Leu Asp 355 360 365Leu Thr Leu Pro Ser Asn Phe Arg Asp Leu Ser Lys Pro Ile Gly Ala 370 375 380Leu Asn Pro Lys Arg Ala Ala Phe Phe Ala Glu Arg Phe Glu Ser Trp385 390 395 400Glu Asp Asp Gln Val Pro Lys Phe His Tyr Gly Thr His Tyr Ser Thr 405 410 415Ala Ser Phe Val Leu Ala Trp Leu Leu Arg Ile Glu Pro Phe Thr Thr 420 425 430Tyr Phe Leu Asn Leu Gln Gly Gly Lys Phe Asp His Ala Asp Arg Thr 435 440 445Phe Ser Ser Val Ser Arg Ala Trp Arg Asn Ser Gln Arg Asp Thr Ser 450 455 460Asp Ile Lys Glu Leu Ile Pro Glu Phe Tyr Tyr Leu Pro Glu Met Phe465 470 475 480Val Asn Phe Asn Asn Tyr Asn Leu Gly Val Met Asp Asp Gly Thr Val 485 490 495Val Ser Asp Val Glu Leu Pro Pro Trp Ala Lys Thr Ser Glu Glu Phe 500 505 510Val Arg Ile Asn Arg Leu Ala Leu Glu Ser Glu Phe Val Ser Cys Gln 515 520 525Leu His Gln Trp Ile Asp Leu Ile Phe Gly Tyr Lys Gln Gln Gly Pro 530 535 540Glu Ala Val Arg Ala Leu Asn Val Phe Tyr Tyr Leu Thr Tyr Glu Gly545 550 555 560Ala Val Asn Leu Asn Ser Ile Thr Asp Pro Val Leu Arg Glu Ala Val 565 570 575Glu Ala Gln Ile Arg Ser Phe Gly Gln Thr Pro Ser Gln Leu Leu Ile 580 585 590Glu Pro His Pro Pro Arg Gly Ser Ala Met Gln Ala Ser Pro Leu Met 595 600 605Phe Thr Asp Gln Ala Gln Gln Asp Val Ile Met Val Leu Lys Phe Pro 610 615 620Ser Asn Ser Pro Val Thr His Val Ala Ala Asn Thr Gln Pro Gly Leu625 630 635 640Ala Met Pro Ala

Val Ile Thr Val Thr Ala Asn Arg Leu Phe Ala Val 645 650 655Asn Lys Trp His Asn Leu Pro Ala His Gln Gly Ala Val Gln Asp Gln 660 665 670Pro Tyr Gln Leu Pro Val Glu Ile Asp Pro Leu Ile Ala Cys Gly Thr 675 680 685Gly Thr His Arg Arg Gln Val Thr Asp Leu Leu Asp Gln Ser Ile Gln 690 695 700Val His Ser Gln Cys Phe Val Ile Thr Ser Asp Asn Arg Tyr Ile Leu705 710 715 720Val Cys Gly Phe Trp Asp Lys Ser Phe Arg Val Tyr Ser Thr Asp Thr 725 730 735Gly Lys Leu Ile Gln Val Val Phe Gly His Trp Asp Val Val Thr Cys 740 745 750Leu Ala Arg Ser Glu Ser Tyr Ile Gly Gly Asn Cys Tyr Ile Leu Ser 755 760 765Gly Ser Arg Asp Ala Thr Leu Leu Leu Trp Tyr Trp Asn Gly Lys Ser 770 775 780Ser Gly Ile Gly Asp Asn Pro Gly Gly Glu Thr Ala Thr Pro Arg Ala785 790 795 800Ile Leu Thr Gly His Asp Tyr Glu Ile Thr Cys Ala Ala Val Cys Ala 805 810 815Glu Leu Gly Leu Val Leu Ser Gly Ser Gln Glu Gly Pro Cys Leu Ile 820 825 830His Ser Met Asn Gly Asp Leu Leu Arg Thr Leu Glu Gly Pro Glu Asn 835 840 845Cys Leu Lys Pro Lys Leu Ile Gln Ala Ser Arg Glu Gly His Cys Val 850 855 860Ile Phe Tyr Glu Asn Gly Cys Phe Cys Thr Phe Ser Val Asn Gly Lys865 870 875 880Leu Gln Ala Thr Val Glu Thr Asp Asp His Ile Arg Ala Ile Gln Leu 885 890 895Ser Arg Asp Gly Gln Tyr Leu Leu Thr Gly Gly Asp Asn Gly Val Val 900 905 910Ile Val Arg Gln Val Ser Asp Leu Lys Gln Leu Phe Ala Tyr Pro Gly 915 920 925Cys Asp Ala Gly Ile Arg Ala Met Ala Leu Ser Phe Asp Gln Arg Cys 930 935 940Ile Ile Ser Gly Met Ala Ser Gly Ser Ile Val Leu Phe Tyr Asn Asp945 950 955 960Phe Asn Arg Trp His His Glu Tyr Gln Thr Arg Tyr 965 97015983PRTHomo sapiensREPEAT(155)..(198)WDL (WD-like) repeat 15Gly Arg Leu Leu Ser Gln Thr Met Lys Asp His Leu Val Arg Val Ala1 5 10 15Asn Glu Ala Glu Phe Ile Leu Ser Arg Gln Arg Ala Glu Asp Ile His 20 25 30Arg His Ala Glu Phe Glu Ser Leu Cys Ala Gln Tyr Ser Ala Asp Lys 35 40 45Arg Glu Asp Glu Lys Met Cys Asp His Leu Ile Arg Ala Ala Lys Tyr 50 55 60Arg Asp His Val Thr Ala Thr Gln Leu Ile Gln Lys Ile Ile Asn Ile65 70 75 80Leu Thr Asp Lys His Gly Ala Trp Gly Asn Ser Ala Val Ser Arg Pro 85 90 95Leu Glu Phe Trp Arg Leu Asp Tyr Trp Glu Asp Asp Leu Arg Arg Arg 100 105 110Arg Arg Phe Val Arg Asn Pro Leu Gly Ser Thr His Pro Glu Ala Thr 115 120 125Leu Lys Thr Ala Val Glu His Val Cys Ile Phe Lys Leu Arg Glu Asn 130 135 140Ser Lys Ala Thr Asp Glu Asp Ile Leu Ala Lys Gly Lys Gln Ser Ile145 150 155 160Arg Ser Gln Ala Leu Gly Asn Gln Asn Ser Glu Asn Glu Ile Leu Leu 165 170 175Glu Gly Asp Asp Asp Thr Leu Ser Ser Val Asp Glu Lys Asp Leu Glu 180 185 190Asn Leu Ala Gly Pro Val Ser Leu Ser Thr Pro Ala Gln Leu Val Ala 195 200 205Pro Ser Val Val Val Lys Gly Thr Leu Ser Val Thr Ser Ser Glu Leu 210 215 220Tyr Phe Glu Val Asp Glu Glu Asp Pro Asn Phe Lys Lys Ile Asp Pro225 230 235 240Lys Ile Leu Ala Tyr Thr Glu Gly Leu His Gly Lys Trp Leu Phe Thr 245 250 255Glu Ile Arg Ser Ile Phe Ser Arg Arg Tyr Leu Leu Gln Asn Thr Ala 260 265 270Leu Glu Ile Phe Met Ala Asn Arg Val Ala Val Met Phe Asn Phe Pro 275 280 285Asp Pro Ala Thr Val Lys Lys Val Val Asn Phe Leu Pro Arg Val Gly 290 295 300Val Gly Thr Ser Phe Gly Leu Pro Gln Thr Arg Arg Ile Ser Leu Ala305 310 315 320Ser Pro Arg Gln Leu Phe Lys Ala Ser Asn Met Thr Gln Arg Trp Gln 325 330 335His Arg Glu Ile Ser Asn Phe Glu Tyr Leu Met Phe Leu Asn Thr Ile 340 345 350Ala Gly Arg Ser Tyr Asn Asp Leu Asn Gln Tyr Pro Val Phe Pro Trp 355 360 365Val Ile Thr Asn Tyr Glu Ser Glu Glu Leu Asp Leu Thr Leu Pro Thr 370 375 380Asn Phe Arg Asp Leu Ser Lys Pro Ile Gly Ala Leu Asn Pro Lys Arg385 390 395 400Ala Ala Phe Phe Ala Glu Arg Tyr Glu Ser Trp Glu Asp Asp Gln Val 405 410 415Pro Lys Phe His Tyr Gly Thr His Tyr Ser Thr Ala Ser Phe Val Leu 420 425 430Ala Trp Leu Leu Arg Ile Glu Pro Phe Thr Thr Tyr Phe Leu Asn Leu 435 440 445Gln Gly Gly Lys Phe Asp His Ala Asp Arg Thr Phe Ser Ser Ile Ser 450 455 460Arg Ala Trp Arg Asn Ser Gln Arg Asp Thr Ser Asp Ile Lys Glu Leu465 470 475 480Ile Pro Glu Phe Tyr Tyr Leu Pro Glu Met Phe Val Asn Phe Asn Asn 485 490 495Tyr Asn Leu Gly Val Met Asp Asp Gly Thr Val Val Ser Asp Val Glu 500 505 510Leu Pro Pro Trp Ala Lys Thr Ser Glu Glu Phe Val His Ile Asn Arg 515 520 525Leu Ala Leu Glu Ser Glu Phe Val Ser Cys Gln Leu His Gln Trp Ile 530 535 540Asp Leu Ile Phe Gly Tyr Lys Gln Gln Gly Pro Glu Ala Val Arg Ala545 550 555 560Leu Asn Val Phe Tyr Tyr Leu Thr Tyr Glu Gly Ala Val Asn Leu Asn 565 570 575Ser Ile Thr Asp Pro Val Leu Arg Glu Ala Val Glu Ala Gln Ile Arg 580 585 590Ser Phe Gly Gln Thr Pro Ser Gln Leu Leu Ile Glu Pro His Pro Pro 595 600 605Arg Gly Ser Ala Met Gln Val Ser Pro Leu Met Phe Thr Asp Lys Ala 610 615 620Gln Gln Asp Val Ile Met Val Leu Lys Phe Pro Ser Asn Ser Pro Val625 630 635 640Thr His Val Ala Ala Asn Thr Gln Pro Gly Leu Ala Thr Pro Ala Val 645 650 655Ile Thr Val Thr Ala Asn Arg Leu Phe Ala Val Asn Lys Trp His Asn 660 665 670Leu Pro Ala His Gln Gly Ala Val Gln Asp Gln Pro Tyr Gln Leu Pro 675 680 685Val Glu Ile Asp Pro Leu Ile Ala Ser Asn Thr Gly Met His Arg Arg 690 695 700Gln Ile Thr Asp Leu Leu Asp Gln Ser Ile Gln Val His Ser Gln Cys705 710 715 720Phe Val Ile Thr Ser Asp Asn Arg Tyr Ile Leu Val Cys Gly Phe Trp 725 730 735Asp Lys Ser Phe Arg Val Tyr Ser Thr Asp Thr Gly Arg Leu Ile Gln 740 745 750Val Val Phe Gly His Trp Asp Val Val Thr Cys Leu Ala Arg Ser Glu 755 760 765Ser Tyr Ile Gly Gly Asn Cys Tyr Ile Leu Ser Gly Ser Arg Asp Ala 770 775 780Thr Leu Leu Leu Trp Tyr Trp Asn Gly Lys Cys Ser Gly Ile Gly Asp785 790 795 800Asn Pro Gly Ser Glu Thr Ala Ala Pro Arg Ala Ile Phe Thr Gly His 805 810 815Asp Tyr Glu Val Thr Cys Ala Ala Val Cys Ala Glu Leu Gly Leu Val 820 825 830Leu Ser Gly Ser Gln Glu Gly Pro Cys Leu Ile His Ser Met Asn Gly 835 840 845Asp Leu Leu Arg Thr Leu Glu Gly Pro Glu Asn Cys Leu Lys Pro Lys 850 855 860Leu Ile Gln Ala Ser Arg Glu Gly His Cys Val Ile Phe Tyr Glu Asn865 870 875 880Gly Leu Phe Cys Thr Phe Ser Val Asn Gly Lys Leu Gln Ala Thr Met 885 890 895Glu Thr Asp Asp Asn Ile Arg Ala Ile Gln Leu Ser Arg Asp Gly Gln 900 905 910Tyr Leu Leu Thr Gly Gly Asp Arg Gly Val Val Val Val Arg Gln Val 915 920 925Ser Asp Leu Lys Gln Leu Phe Ala Tyr Pro Gly Cys Asp Ala Gly Ile 930 935 940Arg Ala Met Ala Leu Ser Tyr Asp Gln Arg Cys Ile Ile Ser Gly Met945 950 955 960Ala Ser Gly Ser Ile Val Leu Phe Tyr Asn Asp Phe Asn Arg Trp His 965 970 975His Glu Tyr Gln Thr Arg Tyr 98016994PRTDrosophila melanogasterDOMAIN(320)..(611)BEACH domain 16Gly Arg Leu Leu Ser His Ala Met Lys Asp His Ile Val Arg Val Ala1 5 10 15Asn Glu Ala Glu Phe Ile Leu Asn Arg Met Arg Ala Asp Asp Val Leu 20 25 30Lys His Ala Asp Phe Glu Ser Gln Cys Ala Gln Thr Leu Leu Glu Arg 35 40 45Arg Glu Glu Glu Arg Met Cys Asp His Leu Ile Thr Ala Ala Arg Arg 50 55 60Arg Asp Asn Val Ile Ala Ser Arg Leu Leu Glu Lys Val Arg Asn Ile65 70 75 80Met Cys Asn Arg His Gly Ala Trp Gly Asp Ser Ser Ser Thr Ser Ser 85 90 95Gly Gly Ala Ile Val Gly Ala Val Gln Lys Ser Pro Tyr Trp Lys Leu 100 105 110Asp Ala Trp Glu Asp Asp Ala Arg Arg Arg Lys Arg Met Val Gln Asn 115 120 125Pro Arg Gly Ser Ser His Pro Gln Ala Thr Leu Lys Ala Ala Leu Glu 130 135 140Asn Gly Gly Pro Glu Asp Ala Ile Leu Gln Thr Arg Asp Glu Phe His145 150 155 160Thr Gln Ile Ala Val Ser Arg Thr His Pro Ser Gly Gln His Asn Gly 165 170 175Glu Leu Leu Asp Asp Ala Glu Leu Leu Ile Glu Asp Arg Glu Leu Asp 180 185 190Leu Asp Leu Thr Gly Pro Val Asn Ile Ser Thr Lys Ala Arg Leu Ile 195 200 205Ala Pro Gly Leu Val Ala Pro Gly Thr Val Ser Ile Thr Ser Thr Glu 210 215 220Met Phe Phe Glu Val Asp Glu Glu His Pro Glu Phe Gln Lys Ile Asp225 230 235 240Gly Glu Val Leu Lys Tyr Cys Asp His Leu His Gly Lys Trp Tyr Phe 245 250 255Ser Glu Val Arg Ala Ile Phe Ser Arg Arg Tyr Leu Leu Gln Asn Val 260 265 270Ala Leu Glu Ile Phe Leu Ala Ser Arg Thr Ser Ile Leu Phe Ala Phe 275 280 285Pro Asp Gln His Thr Val Lys Lys Val Ile Lys Ala Leu Pro Arg Val 290 295 300Gly Val Gly Ile Lys Tyr Gly Ile Pro Gln Thr Arg Arg Ala Ser Met305 310 315 320Met Ser Pro Arg Gln Leu Met Arg Asn Ser Asn Met Thr Gln Lys Trp 325 330 335Gln Arg Arg Glu Ile Ser Asn Phe Glu Tyr Leu Met Phe Leu Asn Thr 340 345 350Ile Ala Gly Arg Thr Tyr Asn Asp Leu Asn Gln Tyr Pro Ile Phe Pro 355 360 365Trp Val Leu Thr Asn Tyr Glu Ser Lys Asp Leu Asp Leu Ser Leu Pro 370 375 380Ser Asn Tyr Arg Asp Leu Ser Lys Pro Ile Gly Ala Leu Asn Pro Ser385 390 395 400Arg Arg Ala Tyr Phe Glu Glu Arg Tyr Glu Ser Trp Asp Ser Asp Thr 405 410 415Ile Pro Pro Phe His Tyr Gly Thr His Tyr Ser Thr Ala Ala Phe Thr 420 425 430Leu Asn Trp Leu Val Arg Val Glu Pro Phe Thr Thr Met Phe Leu Ala 435 440 445Leu Gln Gly Gly Lys Phe Asp Tyr Pro Asp Arg Leu Phe Ser Ser Val 450 455 460Ser Leu Ser Trp Lys Asn Cys Gln Arg Asp Thr Ser Asp Val Lys Glu465 470 475 480Leu Ile Pro Glu Trp Tyr Phe Leu Pro Glu Met Phe Tyr Asn Ser Ser 485 490 495Gly Tyr Arg Leu Gly His Arg Glu Asp Gly Ala Leu Val Asp Asp Ile 500 505 510Glu Leu Pro Pro Trp Ala Lys Ser Pro Glu Glu Phe Val Arg Ile Asn 515 520 525Arg Met Ala Leu Glu Ser Glu Phe Val Ser Cys Gln Leu His Gln Trp 530 535 540Ile Asp Leu Ile Phe Gly Tyr Lys Gln Arg Gly Pro Glu Ala Ile Arg545 550 555 560Ala Thr Asn Val Phe Tyr Tyr Leu Thr Tyr Glu Gly Ser Val Asp Leu 565 570 575Asp Gly Val Leu Asp Pro Val Met Arg Glu Ala Val Glu Asn Gln Ile 580 585 590Arg Asn Phe Gly Gln Thr Pro Ser Gln Leu Leu Met Glu Pro His Pro 595 600 605Pro Arg Ser Ser Ala Met His Leu Ser Pro Met Met Phe Ser Ala Met 610 615 620Pro Glu Asp Leu Cys Gln Met Leu Lys Phe Tyr Gln Asn Ser Pro Val625 630 635 640Ile His Ile Ser Ala Asn Thr Tyr Pro Gln Leu Ser Leu Pro Ser Val 645 650 655Val Thr Val Thr Ala Gly His Gln Phe Ala Val Asn Arg Trp Asn Cys 660 665 670Asn Tyr Thr Ala Ser Val Gln Ser Pro Ser Tyr Ala Glu Ser Pro Gln 675 680 685Ser Pro Gly Ser Asn Gln Pro Leu Thr Ile Asp Pro Val Leu Ala Val 690 695 700His Gly Thr Asn Asn Asn Ser Asn Ala Ala Ser Arg Arg His Leu Gly705 710 715 720Asp Asn Phe Ser Gln Met Leu Lys Ile Arg Ser Asn Cys Phe Val Thr 725 730 735Thr Val Asp Ser Arg Phe Leu Ile Ala Cys Gly Phe Trp Asp Asn Ser 740 745 750Phe Arg Val Phe Ala Thr Glu Thr Ala Lys Ile Val Gln Ile Val Phe 755 760 765Gly His Phe Gly Val Val Thr Cys Met Ala Arg Ser Glu Cys Asn Ile 770 775 780Thr Ser Asp Cys Tyr Ile Ala Ser Gly Ser Ala Asp Cys Thr Val Leu785 790 795 800Leu Trp His Trp Asn Ala Arg Thr Gln Ser Ile Val Gly Glu Gly Asp 805 810 815Val Pro Thr Pro Arg Ala Thr Leu Thr Gly His Glu Gln Ala Val Thr 820 825 830Ser Val Val Ile Ser Ala Glu Leu Gly Leu Val Val Ser Gly Ser Ser 835 840 845Asn Gly Pro Val Leu Ile His Thr Thr Phe Gly Asp Leu Leu Arg Ser 850 855 860Leu Asp Pro Pro Ala Glu Phe His Ser Pro Glu Leu Ile Thr Met Ser865 870 875 880Arg Glu Gly Phe Ile Val Ile Asn Tyr Asp Lys Gly Asn Val Ala Ala 885 890 895Tyr Thr Ile Asn Gly Lys Lys Leu Arg His Glu Thr His Asn Asp Asn 900 905 910Leu Gln Cys Met Leu Leu Ser Arg Asp Gly Glu Tyr Leu Met Thr Ala 915 920 925Gly Asp Arg Gly Ile Val Glu Val Trp Arg Thr Phe Asn Leu Ala Pro 930 935 940Leu Tyr Ala Phe Pro Ala Cys Asn Ala Gly Ile Arg Ser Leu Ala Leu945 950 955 960Thr His Asp Gln Lys Tyr Leu Leu Ala Gly Leu Ser Thr Gly Ser Ile 965 970 975Ile Val Phe His Ile Asp Phe Asn Arg Trp His His Glu Tyr Gln Gln 980 985 990Arg Tyr 17973PRTHomo sapiensDOMAIN(292)..(595)BEACH domain 17Cys Ile Pro Pro Ser Ala Ser Thr Lys Ala Asp Leu Ile Lys Met Ile1 5 10 15Lys Glu Glu Gln Lys Lys Tyr Glu Thr Glu Glu Gly Val Asn Lys Ala 20 25 30Ala Trp Gln Lys Thr Val Asn Asn Asn Gln Gln Ser Leu Phe Gln Arg 35 40 45Leu Asp Ser Lys Ser Lys Asp Ile Ser Lys Ile Ala Ala Asp Ile Thr 50 55 60Gln Ala Val Ser Leu Ser Gln Gly Asn Glu Arg Lys Lys Val Ile Gln65 70 75 80His Ile Arg Gly Met Tyr Lys Val Asp Leu Ser Ala Ser Arg His Trp 85 90 95Gln Glu Leu Ile Gln Gln Leu Thr His Asp Arg Ala Val Trp Tyr Asp 100 105 110Pro Ile Tyr Tyr Pro Thr Ser Trp Gln Leu Asp Pro Thr Glu Gly Pro 115 120 125Asn Arg Glu Arg Arg Arg Leu Gln Arg Cys Tyr Leu Thr Ile Pro Asn 130 135 140Lys

Tyr Leu Leu Arg Asp Arg Gln Lys Ser Glu Asp Val Val Lys Pro145 150 155 160Pro Leu Ser Tyr Leu Phe Glu Asp Lys Thr His Ser Ser Phe Ser Ser 165 170 175Thr Val Lys Asp Lys Ala Ala Ser Glu Ser Ile Arg Val Asn Arg Arg 180 185 190Cys Ile Ser Val Ala Pro Ser Arg Glu Thr Ala Gly Glu Leu Leu Leu 195 200 205Gly Lys Cys Gly Met Tyr Phe Val Glu Asp Asn Ala Ser Asp Thr Val 210 215 220Glu Ser Ser Ser Leu Gln Gly Glu Leu Glu Pro Ala Ser Phe Ser Trp225 230 235 240Thr Tyr Glu Glu Ile Lys Glu Val His Lys Arg Trp Trp Gln Leu Arg 245 250 255Asp Asn Ala Val Glu Ile Phe Leu Thr Asn Gly Arg Thr Leu Leu Leu 260 265 270Ala Phe Asp Asn Thr Lys Val Arg Asp Asp Val Tyr His Asn Ile Leu 275 280 285Thr Asn Asn Leu Pro Asn Leu Leu Glu Tyr Gly Asn Ile Thr Ala Leu 290 295 300Thr Asn Leu Trp Tyr Thr Gly Gln Ile Thr Asn Phe Glu Tyr Leu Thr305 310 315 320His Leu Asn Lys His Ala Gly Arg Ser Phe Asn Asp Leu Met Gln Tyr 325 330 335Pro Val Phe Pro Phe Ile Leu Ala Asp Tyr Val Ser Glu Thr Leu Asp 340 345 350Leu Asn Asp Leu Leu Ile Tyr Arg Asn Leu Ser Lys Pro Ile Ala Val 355 360 365Gln Tyr Lys Glu Lys Glu Asp Arg Tyr Val Asp Thr Tyr Lys Tyr Leu 370 375 380Glu Glu Glu Tyr Arg Lys Gly Ala Arg Glu Asp Asp Pro Met Pro Pro385 390 395 400Val Gln Pro Tyr His Tyr Gly Ser His Tyr Ser Asn Ser Gly Thr Val 405 410 415Leu His Phe Leu Val Arg Met Pro Pro Phe Thr Lys Met Phe Leu Ala 420 425 430Tyr Gln Asp Gln Ser Phe Asp Ile Pro Asp Arg Thr Phe His Ser Thr 435 440 445Asn Thr Thr Trp Arg Leu Ser Ser Phe Glu Ser Met Thr Asp Val Lys 450 455 460Glu Leu Ile Pro Glu Phe Phe Tyr Leu Pro Glu Phe Leu Val Asn Arg465 470 475 480Glu Gly Phe Asp Phe Gly Val Arg Gln Asn Gly Glu Arg Val Asn His 485 490 495Val Asn Leu Pro Pro Trp Ala Arg Asn Asp Pro Arg Leu Phe Ile Leu 500 505 510Ile His Arg Gln Ala Leu Glu Ser Asp Tyr Val Ser Gln Asn Ile Cys 515 520 525Gln Trp Ile Asp Leu Val Phe Gly Tyr Lys Gln Lys Gly Lys Ala Ser 530 535 540Val Gln Ala Ile Asn Val Phe His Pro Ala Thr Tyr Phe Gly Met Asp545 550 555 560Val Ser Ala Val Glu Asp Pro Val Gln Arg Arg Ala Leu Glu Thr Met 565 570 575Ile Lys Thr Tyr Gly Gln Thr Pro Arg Gln Leu Phe His Met Ala His 580 585 590Val Ser Arg Pro Gly Ala Lys Leu Asn Ile Glu Gly Glu Leu Pro Ala 595 600 605Ala Val Gly Leu Leu Val Gln Phe Ala Phe Arg Glu Thr Arg Glu Gln 610 615 620Val Lys Glu Ile Thr Tyr Pro Ser Pro Leu Ser Trp Ile Lys Gly Leu625 630 635 640Lys Trp Gly Glu Tyr Val Gly Ser Pro Ser Ala Pro Val Pro Val Val 645 650 655Cys Phe Ser Gln Pro His Gly Glu Arg Phe Gly Ser Leu Gln Ala Leu 660 665 670Pro Thr Arg Ala Ile Cys Gly Leu Ser Arg Asn Phe Cys Leu Val Met 675 680 685Thr Tyr Ser Lys Glu Gln Gly Val Arg Ser Met Asn Ser Thr Asp Ile 690 695 700Gln Trp Ser Ala Ile Leu Ser Trp Gly Tyr Ala Asp Asn Ile Leu Arg705 710 715 720Leu Lys Ser Lys Gln Ser Glu Pro Pro Val Asn Phe Ile Gln Ser Ser 725 730 735Gln Gln Tyr Gln Val Thr Ser Cys Ala Trp Val Pro Asp Ser Cys Gln 740 745 750Leu Phe Thr Gly Ser Lys Cys Gly Val Ile Thr Ala Tyr Thr Asn Arg 755 760 765Phe Thr Ser Ser Thr Pro Ser Glu Ile Glu Met Glu Thr Gln Ile His 770 775 780Leu Tyr Gly His Thr Glu Glu Ile Thr Ser Leu Phe Val Cys Lys Pro785 790 795 800Tyr Ser Ile Leu Ile Ser Val Ser Arg Asp Gly Thr Cys Ile Ile Trp 805 810 815Asp Leu Asn Arg Leu Cys Tyr Val Gln Ser Leu Ala Gly His Lys Ser 820 825 830Pro Val Thr Ala Val Ser Ala Ser Glu Thr Ser Gly Asp Ile Ala Thr 835 840 845Val Cys Asp Ser Ala Gly Gly Gly Ser Asp Leu Arg Leu Trp Thr Val 850 855 860Asn Gly Asp Leu Val Gly His Val His Cys Arg Glu Ile Ile Cys Ser865 870 875 880Val Ala Phe Ser Asn Gln Pro Glu Gly Val Ser Ile Asn Val Ile Ala 885 890 895Gly Gly Leu Glu Asn Gly Ile Val Arg Leu Trp Ser Thr Trp Asp Leu 900 905 910Lys Pro Val Arg Glu Ile Thr Phe Pro Lys Ser Asn Lys Pro Ile Ile 915 920 925Ser Leu Thr Phe Ser Cys Asp Gly His His Leu Tyr Thr Ala Asn Ser 930 935 940Asp Gly Thr Val Ile Ala Trp Cys Arg Lys Asp Gln Gln Arg Leu Lys945 950 955 960Gln Pro Met Phe Tyr Ser Phe Leu Ser Ser Tyr Ala Ala 965 97018907PRTHomo sapiensDOMAIN(279)..(565)BEACH domain 18Gln Gln Leu Gln Leu Tyr Ser Lys Glu Arg Phe Ser Leu Leu Leu Leu1 5 10 15Asn Leu Glu Glu Tyr Tyr Phe Glu Gln His Arg Ala Asn His Ile Leu 20 25 30His Lys Gly Ser His His Glu Arg Lys Ile Arg Gly Ser Leu Lys Ile 35 40 45Cys Ser Lys Ser Val Ile Phe Glu Pro Asp Ser Ile Ser Gln Pro Ile 50 55 60Ile Lys Ile Pro Leu Arg Asp Cys Ile Lys Ile Gly Lys His Gly Glu65 70 75 80Asn Gly Ala Asn Arg His Phe Thr Lys Ala Lys Ser Gly Gly Ile Ser 85 90 95Leu Ile Phe Ser Gln Val Tyr Phe Ile Lys Glu His Asn Val Val Ala 100 105 110Pro Tyr Lys Ile Glu Arg Gly Lys Met Glu Tyr Val Phe Glu Leu Asp 115 120 125Val Pro Gly Lys Val Glu Asp Val Val Glu Thr Leu Leu Gln Leu His 130 135 140Arg Ala Ser Cys Leu Asp Lys Leu Gly Asp Gln Thr Ala Met Ile Thr145 150 155 160Ala Ile Leu Gln Ser Arg Leu Ala Arg Thr Ser Phe Asp Lys Asn Arg 165 170 175Phe Gln Asn Ile Ser Glu Lys Leu His Met Glu Cys Lys Ala Glu Met 180 185 190Val Thr Pro Leu Val Thr Asn Pro Gly His Val Cys Ile Thr Asp Thr 195 200 205Asn Leu Tyr Phe Gln Pro Leu Asn Gly Tyr Pro Lys Pro Val Val Gln 210 215 220Ile Thr Leu Gln Asp Val Arg Arg Ile Tyr Lys Arg Arg His Gly Leu225 230 235 240Met Pro Leu Gly Leu Glu Val Phe Cys Thr Glu Asp Asp Leu Cys Ser 245 250 255Asp Ile Tyr Leu Lys Phe Tyr Glu Pro Gln Asp Arg Asp Asp Leu Tyr 260 265 270Phe Tyr Ile Ala Thr Tyr Leu Glu His His Val Ala Glu His Thr Ala 275 280 285Glu Ser Tyr Met Leu Gln Trp Gln Arg Gly His Leu Ser Asn Tyr Gln 290 295 300Tyr Leu Leu His Leu Asn Asn Leu Ala Asp Arg Ser Cys Asn Asp Leu305 310 315 320Ser Gln Tyr Pro Val Phe Pro Trp Ile Ile His Asp Tyr Ser Ser Ser 325 330 335Glu Leu Asp Leu Ser Asn Pro Gly Thr Phe Arg Asp Leu Ser Lys Pro 340 345 350Val Gly Ala Leu Asn Lys Glu Arg Leu Glu Arg Leu Leu Thr Arg Tyr 355 360 365Gln Glu Met Pro Glu Pro Lys Phe Met Tyr Gly Ser His Tyr Ser Ser 370 375 380Pro Gly Tyr Val Leu Phe Tyr Leu Val Arg Ile Ala Pro Glu Tyr Met385 390 395 400Leu Cys Leu Gln Asn Gly Arg Phe Asp Asn Ala Asp Arg Met Phe Asn 405 410 415Ser Ile Ala Glu Thr Trp Lys Asn Cys Leu Asp Gly Ala Thr Asp Phe 420 425 430Lys Glu Leu Ile Pro Glu Phe Tyr Gly Asp Asp Val Ser Phe Leu Val 435 440 445Asn Ser Leu Lys Leu Asp Leu Gly Lys Arg Gln Gly Gly Gln Met Val 450 455 460Asp Asp Val Glu Leu Pro Pro Trp Ala Ser Ser Pro Glu Asp Phe Leu465 470 475 480Gln Lys Ser Lys Asp Ala Leu Glu Ser Asn Tyr Val Ser Glu His Leu 485 490 495His Glu Trp Ile Asp Leu Ile Phe Gly Tyr Lys Gln Lys Gly Ser Asp 500 505 510Ala Val Gly Ala His Asn Val Phe His Pro Leu Thr Tyr Glu Gly Gly 515 520 525Val Asp Leu Asn Ser Ile Gln Asp Pro Asp Glu Lys Val Ala Met Leu 530 535 540Thr Gln Ile Leu Glu Phe Gly Gln Thr Pro Lys Gln Leu Phe Val Thr545 550 555 560Pro His Pro Arg Arg Ile Thr Pro Lys Phe Lys Ser Leu Ser Gln Thr 565 570 575Ser Ser Tyr Asn Ala Ser Met Ala Asp Ser Pro Gly Glu Glu Ser Phe 580 585 590Glu Asp Leu Thr Glu Glu Ser Lys Thr Leu Ala Trp Asn Asn Ile Thr 595 600 605Lys Leu Gln Leu His Glu His Tyr Lys Ile His Lys Glu Ala Val Thr 610 615 620Gly Ile Thr Val Ser Arg Asn Gly Ser Ser Val Phe Thr Thr Ser Gln625 630 635 640Asp Ser Thr Leu Lys Met Phe Ser Lys Glu Ser Lys Met Leu Gln Arg 645 650 655Ser Ile Ser Phe Ser Asn Met Ala Leu Ser Ser Cys Leu Leu Leu Pro 660 665 670Gly Asp Ala Thr Val Ile Thr Ser Ser Trp Asp Asn Asn Val Tyr Phe 675 680 685Tyr Ser Ile Ala Phe Gly Arg Arg Gln Asp Thr Leu Met Gly His Asp 690 695 700Asp Ala Val Ser Lys Ile Cys Trp His Asp Asn Arg Leu Tyr Ser Ala705 710 715 720Ser Trp Asp Ser Thr Val Lys Val Trp Ser Gly Val Pro Ala Glu Met 725 730 735Pro Gly Thr Lys Arg His His Phe Asp Leu Leu Ala Glu Leu Glu His 740 745 750Asp Val Ser Val Asp Thr Ile Ser Leu Asn Ala Ala Ser Thr Leu Leu 755 760 765Val Ser Gly Thr Lys Glu Gly Thr Val Asn Ile Trp Asp Leu Thr Thr 770 775 780Ala Thr Leu Met His Gln Ile Pro Cys His Ser Gly Ile Val Cys Asp785 790 795 800Thr Ala Phe Ser Pro Asp Ser Arg His Val Leu Ser Thr Gly Thr Asp 805 810 815Gly Cys Leu Asn Val Ile Asp Val Gln Thr Gly Met Leu Ile Ser Ser 820 825 830Met Thr Ser Asp Glu Pro Gln Thr Cys Phe Val Trp Asp Gly Asn Ser 835 840 845Val Leu Ser Gly Ser Gln Ser Gly Glu Leu Leu Val Trp Asp Leu Leu 850 855 860Gly Ala Lys Ile Ser Glu Arg Ile Gln Gly His Thr Gly Ala Val Thr865 870 875 880Cys Ile Trp Met Asn Glu Gln Cys Ser Ser Ile Ile Thr Gly Gly Glu 885 890 895Asp Arg Gln Ile Ile Phe Trp Lys Leu Gln Tyr 900 90519908PRTMus musculusREPEAT(144)..(187)WDL (WD-like) repeat 19Gly Arg Leu Leu Ser Gln Thr Met Lys Asp His Leu Val Arg Val Ala1 5 10 15Asn Glu Ala Glu Phe Ile Leu Ser Arg Gln Arg Ala Glu Asp Ile His 20 25 30Arg His Ala Glu Phe Glu Ser Leu Cys Ala Gln Tyr Ser Ala Asp Lys 35 40 45Arg Glu Glu Glu Lys Met Cys Asp His Leu Ile Arg Ala Ala Lys Tyr 50 55 60Arg Asp His Val Thr Ala Thr Gln Leu Ile Gln Lys Ile Ile Asn Leu65 70 75 80Leu Thr Asp Lys His Gly Ala Trp Gly Ser Ser Ala Val Ser Arg Pro 85 90 95Arg Glu Phe Trp Arg Leu Asp Tyr Trp Glu Asp Asp Leu Arg Arg Arg 100 105 110Arg Arg Phe Val Arg Asn Pro Leu Gly Ser Thr His Pro Glu Ala Thr 115 120 125Leu Lys Thr Ala Val Glu His Ala Ala Asp Glu Asp Ile Leu Ala Lys 130 135 140Gly Lys Gln Ser Ile Lys Ser Gln Ala Leu Gly Asn Gln Asn Ser Glu145 150 155 160Asn Glu Ala Leu Leu Glu Gly Asp Asp Asp Thr Leu Ser Ser Val Asp 165 170 175Glu Lys Asp Leu Glu Asn Leu Ala Gly Pro Val Ser Leu Ser Thr Pro 180 185 190Ala Gln Leu Val Ala Pro Ser Val Val Val Lys Gly Thr Leu Ser Val 195 200 205Thr Ser Ser Glu Leu Tyr Phe Glu Val Asp Glu Glu Asp Pro Asn Phe 210 215 220Lys Lys Ile Asp Pro Lys Ile Leu Ala Tyr Thr Glu Gly Leu His Gly225 230 235 240Lys Trp Leu Phe Thr Glu Ile Arg Ser Ile Phe Ser Arg Arg Tyr Leu 245 250 255Leu Gln Asn Thr Ala Leu Glu Ile Phe Met Ala Asn Arg Val Ala Val 260 265 270Met Phe Asn Phe Pro Asp Pro Ala Thr Val Lys Lys Val Val Asn Tyr 275 280 285Leu Pro Arg Val Gly Val Gly Thr Ser Phe Gly Leu Pro Gln Thr Arg 290 295 300Arg Ile Ser Leu Ala Thr Pro Arg Gln Leu Phe Lys Ala Ser Asn Met305 310 315 320Thr Gln Arg Trp Gln His Arg Glu Ile Ser Asn Phe Glu Tyr Leu Met 325 330 335Phe Leu Asn Thr Ile Ala Gly Arg Ser Tyr Asn Asp Leu Asn Gln Tyr 340 345 350Pro Val Phe Pro Trp Val Ile Thr Asn Tyr Glu Ser Glu Glu Leu Asp 355 360 365Leu Thr Leu Pro Ser Asn Phe Arg Asp Leu Ser Lys Pro Ile Gly Ala 370 375 380Leu Asn Pro Lys Arg Ala Ala Phe Phe Ala Glu Arg Phe Glu Ser Trp385 390 395 400Glu Asp Asp Gln Val Pro Lys Phe His Tyr Gly Thr His Tyr Ser Thr 405 410 415Ala Ser Phe Val Leu Ala Trp Leu Leu Arg Ile Glu Pro Phe Thr Thr 420 425 430Tyr Phe Leu Asn Leu Gln Gly Gly Lys Phe Asp His Ala Asp Arg Thr 435 440 445Phe Ser Ser Val Ser Arg Ala Trp Arg Asn Ser Gln Arg Asp Thr Ser 450 455 460Asp Ile Lys Glu Leu Ile Pro Glu Phe Tyr Tyr Leu Pro Glu Met Phe465 470 475 480Val Asn Phe Asn Asn Tyr Asn Leu Gly Val Met Asp Asp Gly Thr Val 485 490 495Val Ser Asp Val Glu Leu Pro Pro Trp Ala Lys Thr Ser Glu Glu Phe 500 505 510Val Arg Ile Asn Arg Leu Ala Leu Glu Ser Glu Phe Val Ser Cys Gln 515 520 525Leu His Gln Trp Ile Asp Leu Ile Phe Gly Tyr Lys Gln Gln Gly Pro 530 535 540Glu Ala Val Arg Ala Leu Asn Val Phe Tyr Tyr Leu Thr Tyr Glu Gly545 550 555 560Ala Val Asn Leu Asn Ser Ile Thr Asp Pro Val Leu Arg Glu Ala Val 565 570 575Glu Ala Gln Ile Arg Ser Phe Gly Gln Thr Pro Ser Gln Leu Leu Ile 580 585 590Glu Pro His Pro Pro Arg Gly Ser Ala Met Gln Ala Ser Pro Leu Met 595 600 605Phe Thr Asp Gln Ala Gln Gln Asp Val Ile Met Val Leu Lys Phe Pro 610 615 620Ser Asn Ser Pro Val Thr His Val Ala Ala Asn Thr Gln Pro Gly Leu625 630 635 640Ala Met Pro Ala Val Ile Thr Val Thr Ala Asn Arg Leu Phe Ala Val 645 650 655Asn Lys Trp His Asn Leu Pro Ala His Gln Gly Ala Val Gln Asp Gln 660 665 670Pro Tyr Gln Leu Pro Val Glu Ile Asp Pro Leu Ile Ala Cys Gly Thr 675 680 685Gly Thr His Arg Arg Gln Val Thr Asp Leu Leu Asp Gln Ser Ile Gln 690 695 700Val His Ser Gln Cys Phe Val Ile Thr Ser Asp Asn Arg Tyr Ile Leu705 710 715 720Val Cys Gly Phe

Trp Asp Lys Ser Phe Arg Val Tyr Ser Thr Asp Thr 725 730 735Gly Lys Leu Ile Gln Val Val Phe Gly His Trp Asp Val Val Thr Cys 740 745 750Leu Ala Arg Ser Glu Ser Tyr Ile Gly Gly Asn Cys Tyr Ile Leu Ser 755 760 765Gly Ser Arg Asp Ala Thr Leu Leu Leu Trp Tyr Trp Asn Gly Lys Ser 770 775 780Ser Gly Ile Gly Asp Asn Pro Gly Gly Glu Thr Ala Thr Pro Arg Ala785 790 795 800Ile Leu Thr Gly His Asp Tyr Glu Ile Thr Cys Ala Ala Val Cys Ala 805 810 815Glu Leu Gly Leu Val Leu Ser Gly Ser Gln Glu Gly Pro Cys Leu Ile 820 825 830His Ser Met Asn Gly Asp Leu Leu Arg Thr Leu Glu Gly Pro Glu Asn 835 840 845Cys Leu Lys Pro Lys Leu Ile Gln Ala Ser Arg Glu Gly His Cys Val 850 855 860Ile Phe Tyr Glu Asn Gly Cys Phe Cys Thr Phe Ser Val Asn Gly Lys865 870 875 880Leu Gln Ala Thr Val Glu Thr Asp Asp His Ile Arg Val Ser Ala Val 885 890 895Gly Ser Thr Leu Phe Leu Leu Leu Gly Ser Ser Lys 900 90520695PRTMus musculusREPEAT(144)..(187)WDL (WD-like) repeat 20Gly Arg Leu Leu Ser Gln Thr Met Lys Asp His Leu Val Arg Val Ala1 5 10 15Asn Glu Ala Glu Phe Ile Leu Ser Arg Gln Arg Ala Glu Asp Ile His 20 25 30Arg His Ala Glu Phe Glu Ser Leu Cys Ala Gln Tyr Ser Ala Asp Lys 35 40 45Arg Glu Glu Glu Lys Met Cys Asp His Leu Ile Arg Ala Ala Lys Tyr 50 55 60Arg Asp His Val Thr Ala Thr Gln Leu Ile Gln Lys Ile Ile Asn Leu65 70 75 80Leu Thr Asp Lys His Gly Ala Trp Gly Ser Ser Ala Val Ser Arg Pro 85 90 95Arg Glu Phe Trp Arg Leu Asp Tyr Trp Glu Asp Asp Leu Arg Arg Arg 100 105 110Arg Arg Phe Val Arg Asn Pro Leu Gly Ser Thr His Pro Glu Ala Thr 115 120 125Leu Lys Thr Ala Val Glu His Ala Ala Asp Glu Asp Ile Leu Ala Lys 130 135 140Gly Lys Gln Ser Ile Lys Ser Gln Ala Leu Gly Asn Gln Asn Ser Glu145 150 155 160Asn Glu Ala Leu Leu Glu Gly Asp Asp Asp Thr Leu Ser Ser Val Asp 165 170 175Glu Lys Asp Leu Glu Asn Leu Ala Gly Pro Val Ser Leu Ser Thr Pro 180 185 190Ala Gln Leu Val Ala Pro Ser Val Val Val Lys Gly Thr Leu Ser Val 195 200 205Thr Ser Ser Glu Leu Tyr Phe Glu Val Asp Glu Glu Asp Pro Asn Phe 210 215 220Lys Lys Ile Asp Pro Lys Ile Leu Ala Tyr Thr Glu Gly Leu His Gly225 230 235 240Lys Trp Leu Phe Thr Glu Ile Arg Ser Ile Phe Ser Arg Arg Tyr Leu 245 250 255Leu Gln Asn Thr Ala Leu Glu Ile Phe Met Ala Asn Arg Val Ala Val 260 265 270Met Phe Asn Phe Pro Asp Pro Ala Thr Val Lys Lys Val Val Asn Tyr 275 280 285Leu Pro Arg Val Gly Val Gly Thr Ser Phe Gly Leu Pro Gln Thr Arg 290 295 300Arg Ile Ser Leu Ala Thr Pro Arg Gln Leu Phe Lys Ala Ser Asn Met305 310 315 320Thr Gln Arg Trp Gln His Arg Glu Ile Ser Asn Phe Glu Tyr Leu Met 325 330 335Phe Leu Asn Thr Ile Ala Gly Arg Ser Tyr Asn Asp Leu Asn Gln Tyr 340 345 350Pro Val Phe Pro Trp Val Ile Thr Asn Tyr Glu Ser Glu Glu Leu Asp 355 360 365Leu Thr Leu Pro Ser Asn Phe Arg Asp Leu Ser Lys Pro Ile Gly Ala 370 375 380Leu Asn Pro Lys Arg Ala Ala Phe Phe Ala Glu Arg Phe Glu Ser Trp385 390 395 400Glu Asp Asp Gln Val Pro Lys Phe His Tyr Gly Thr His Tyr Ser Thr 405 410 415Ala Ser Phe Val Leu Ala Trp Leu Leu Arg Ile Glu Pro Phe Thr Thr 420 425 430Tyr Phe Leu Asn Leu Gln Gly Gly Lys Phe Asp His Ala Asp Arg Thr 435 440 445Phe Ser Ser Val Ser Arg Ala Trp Arg Asn Ser Gln Arg Asp Thr Ser 450 455 460Asp Ile Lys Glu Leu Ile Pro Glu Phe Tyr Tyr Leu Pro Glu Met Phe465 470 475 480Val Asn Phe Asn Asn Tyr Asn Leu Gly Val Met Asp Asp Gly Thr Val 485 490 495Val Ser Asp Val Glu Leu Pro Pro Trp Ala Lys Thr Ser Glu Glu Phe 500 505 510Val Arg Ile Asn Arg Leu Ala Leu Glu Ser Glu Phe Val Ser Cys Gln 515 520 525Leu His Gln Trp Ile Asp Leu Ile Phe Gly Tyr Lys Gln Gln Gly Pro 530 535 540Glu Ala Val Arg Ala Leu Asn Val Phe Tyr Tyr Leu Thr Tyr Glu Gly545 550 555 560Ala Val Asn Leu Asn Ser Ile Thr Asp Pro Val Leu Arg Glu Ala Val 565 570 575Glu Ala Gln Ile Arg Ser Phe Gly Gln Thr Pro Ser Gln Leu Leu Ile 580 585 590Glu Pro His Pro Pro Arg Gly Ser Ala Met Gln Ala Ser Pro Leu Met 595 600 605Phe Thr Asp Gln Ala Gln Gln Asp Val Ile Met Val Leu Lys Phe Pro 610 615 620Ser Asn Ser Pro Val Thr His Val Ala Ala Asn Thr Gln Pro Gly Leu625 630 635 640Ala Met Pro Ala Val Ile Thr Val Thr Ala Asn Arg Leu Phe Ala Val 645 650 655Asn Lys Trp His Asn Leu Pro Ala His Gln Gly Ala Val Gln Asp Gln 660 665 670Pro Tyr Gln Leu Pro Val Glu Ile Asp Pro Leu Ile Gly Leu Pro Leu 675 680 685Leu Ser Leu Phe Ala Ile His 690 695212586PRTHomo sapiensDOMAIN(1)..(72)G peptide 21Met Ala Ser Glu Asp Asn Arg Val Pro Ser Pro Pro Pro Thr Gly Asp1 5 10 15Asp Gly Gly Gly Gly Gly Arg Glu Glu Thr Pro Thr Glu Gly Gly Ala 20 25 30Leu Ser Leu Lys Pro Gly Leu Pro Ile Arg Gly Ile Arg Met Lys Phe 35 40 45Ala Val Leu Thr Gly Leu Val Glu Val Gly Glu Val Ser Asn Arg Asp 50 55 60Ile Val Glu Thr Val Phe Asn Leu Leu Val Gly Gly Gln Phe Asp Leu65 70 75 80Glu Met Asn Phe Ile Ile Gln Glu Gly Glu Ser Ile Asn Cys Met Val 85 90 95Asp Leu Leu Glu Lys Cys Asp Ile Thr Cys Gln Ala Glu Val Trp Ser 100 105 110Met Phe Thr Ala Ile Leu Lys Lys Ser Ile Arg Asn Leu Gln Val Cys 115 120 125Thr Glu Val Gly Leu Val Glu Lys Val Leu Gly Lys Ile Glu Lys Val 130 135 140Asp Asn Met Ile Ala Asp Leu Leu Val Asp Met Leu Gly Val Leu Ala145 150 155 160Ser Tyr Asn Leu Thr Val Arg Glu Leu Lys Leu Phe Phe Ser Lys Leu 165 170 175Gln Gly Asp Lys Gly Arg Trp Pro Pro His Ala Gly Lys Leu Leu Ser 180 185 190Val Leu Lys His Met Pro Gln Lys Tyr Gly Pro Asp Ala Phe Phe Asn 195 200 205Phe Pro Gly Lys Ser Ala Ala Ala Ile Ala Leu Pro Pro Ile Ala Lys 210 215 220Trp Pro Tyr Gln Asn Gly Phe Thr Phe His Thr Trp Leu Arg Met Asp225 230 235 240Pro Val Asn Asn Ile Asn Val Asp Lys Asp Lys Pro Tyr Leu Tyr Cys 245 250 255Phe Arg Thr Ser Lys Gly Leu Gly Tyr Ser Ala His Phe Val Gly Gly 260 265 270Cys Leu Ile Val Thr Ser Ile Lys Ser Lys Gly Lys Gly Phe Gln His 275 280 285Cys Val Lys Phe Asp Phe Lys Pro Gln Lys Trp Tyr Met Val Thr Ile 290 295 300Val His Ile Tyr Asn Arg Trp Lys Asn Ser Glu Leu Arg Cys Tyr Val305 310 315 320Asn Gly Glu Leu Ala Ser Tyr Gly Glu Ile Thr Trp Phe Val Asn Thr 325 330 335Ser Asp Thr Phe Asp Lys Cys Phe Leu Gly Ser Ser Glu Thr Ala Asp 340 345 350Ala Asn Arg Val Phe Cys Gly Gln Met Thr Ala Val Tyr Leu Phe Ser 355 360 365Glu Ala Leu Asn Ala Ala Gln Ile Phe Ala Ile Tyr Gln Leu Gly Leu 370 375 380Gly Tyr Lys Gly Thr Phe Lys Phe Lys Ala Glu Ser Asp Leu Phe Leu385 390 395 400Ala Glu His His Lys Leu Leu Leu Tyr Asp Gly Lys Leu Ser Ser Ala 405 410 415Ile Ala Phe Thr Tyr Asn Pro Arg Ala Thr Asp Ala Gln Leu Cys Leu 420 425 430Glu Ser Ser Pro Lys Asp Asn Pro Ser Ile Phe Val His Ser Pro His 435 440 445Ala Leu Met Leu Gln Asp Val Lys Ala Val Leu Thr His Ser Ile Gln 450 455 460Ser Ala Met His Ser Ile Gly Gly Val Gln Val Leu Phe Pro Leu Phe465 470 475 480Ala Gln Leu Asp Tyr Arg Gln Tyr Leu Ser Asp Glu Ile Asp Leu Thr 485 490 495Ile Cys Ser Thr Leu Leu Ala Phe Ile Met Glu Leu Leu Lys Asn Ser 500 505 510Ile Ala Met Gln Glu Gln Met Leu Ala Cys Lys Gly Phe Leu Val Ile 515 520 525Gly Tyr Ser Leu Glu Lys Ser Ser Lys Ser His Val Ser Arg Ala Val 530 535 540Leu Glu Leu Cys Leu Ala Phe Ser Lys Tyr Leu Ser Asn Leu Gln Asn545 550 555 560Gly Met Pro Leu Leu Lys Gln Leu Cys Asp His Val Leu Leu Asn Pro 565 570 575Ala Ile Trp Ile His Thr Pro Ala Lys Val Gln Leu Met Leu Tyr Thr 580 585 590Tyr Leu Ser Thr Glu Phe Ile Gly Thr Val Asn Ile Tyr Asn Thr Ile 595 600 605Arg Arg Val Gly Thr Val Leu Leu Ile Met His Thr Leu Lys Tyr Tyr 610 615 620Tyr Trp Ala Val Asn Pro Gln Asp Arg Ser Gly Ile Thr Pro Lys Gly625 630 635 640Leu Asp Gly Pro Arg Pro Asn Gln Lys Glu Met Leu Ser Leu Arg Ala 645 650 655Phe Leu Leu Met Phe Ile Lys Gln Leu Val Met Lys Asp Ser Gly Val 660 665 670Lys Glu Asp Glu Leu Gln Ala Ile Leu Asn Tyr Leu Leu Thr Met His 675 680 685Glu Asp Asp Asn Leu Met Asp Val Leu Gln Leu Leu Val Ala Leu Met 690 695 700Ser Glu His Pro Asn Ser Met Ile Pro Ala Phe Asp Gln Arg Asn Gly705 710 715 720Leu Arg Val Ile Tyr Lys Leu Leu Ala Ser Lys Ser Glu Gly Ile Arg 725 730 735Val Gln Ala Leu Lys Ala Met Gly Tyr Phe Leu Lys His Arg Pro Pro 740 745 750Lys Arg Lys Ala Glu Val Met Leu Gly His Gly Leu Phe Ser Leu Leu 755 760 765Ala Glu Arg Leu Met Leu Gln Thr Asn Leu Ile Thr Met Thr Thr Tyr 770 775 780Asn Val Leu Phe Glu Ile Leu Ile Glu Gln Ile Gly Thr Gln Val Ile785 790 795 800His Lys Gln His Pro Asp Pro Asp Ser Ser Val Lys Ile Gln Asn Pro 805 810 815Gln Ile Leu Lys Val Ile Ala Thr Leu Leu Arg Asn Ser Pro Gln Cys 820 825 830Pro Glu Ser Met Glu Val Arg Arg Ala Phe Leu Ser Asp Met Ile Lys 835 840 845Leu Phe Asn Asn Ser Arg Glu Asn Arg Arg Ser Leu Leu Gln Cys Ser 850 855 860Val Trp Gln Glu Trp Met Leu Ser Leu Cys Tyr Phe Asn Pro Lys Asn865 870 875 880Ser Asp Glu Gln Lys Ile Thr Glu Met Val Tyr Ala Ile Phe Arg Ile 885 890 895Leu Leu Tyr His Ala Val Lys Tyr Glu Trp Gly Gly Trp Arg Val Trp 900 905 910Val Asp Thr Leu Ser Ile Thr His Ser Lys Val Thr Phe Glu Ile His 915 920 925Lys Glu Asn Leu Ala Asn Ile Phe Arg Glu Gln Gln Gly Lys Val Asp 930 935 940Glu Glu Ile Gly Leu Cys Ser Ser Thr Ser Val Gln Ala Ala Ser Gly945 950 955 960Ile Arg Arg Asp Ile Asn Val Ser Val Gly Ser Gln Gln Pro Asp Thr 965 970 975Lys Asp Ser Pro Val Cys Pro His Phe Thr Thr Asn Gly Asn Glu Asn 980 985 990Ser Ser Ile Glu Lys Thr Ser Ser Leu Glu Ser Ala Ser Asn Ile Glu 995 1000 1005Leu Gln Thr Thr Asn Thr Ser Tyr Glu Glu Met Lys Ala Glu Gln 1010 1015 1020Glu Asn Gln Glu Leu Pro Asp Glu Gly Thr Leu Glu Glu Thr Leu 1025 1030 1035Thr Asn Glu Thr Arg Asn Ala Asp Asp Leu Glu Val Ser Ser Asp 1040 1045 1050Ile Ile Glu Ala Val Ala Ile Ser Ser Asn Ser Phe Ile Thr Thr 1055 1060 1065Gly Lys Asp Ser Met Thr Val Ser Glu Val Thr Ala Ser Ile Ser 1070 1075 1080Ser Pro Ser Glu Glu Asp Ala Ser Glu Met Pro Glu Phe Leu Asp 1085 1090 1095Lys Ser Ile Val Glu Glu Glu Glu Asp Asp Asp Tyr Val Glu Leu 1100 1105 1110Lys Val Glu Gly Ser Pro Thr Glu Glu Ala Asn Leu Pro Thr Glu 1115 1120 1125Leu Gln Asp Asn Ser Leu Ser Pro Ala Ala Ser Glu Ala Gly Glu 1130 1135 1140Lys Leu Asp Met Phe Gly Asn Asp Asp Lys Leu Ile Phe Gln Glu 1145 1150 1155Gly Lys Pro Val Thr Glu Lys Gln Thr Asp Thr Glu Thr Gln Asp 1160 1165 1170Ser Lys Asp Ser Gly Ile Gln Thr Met Thr Ala Ser Gly Ser Ser 1175 1180 1185Ala Met Ser Pro Glu Thr Thr Val Ser Gln Ile Ala Val Glu Ser 1190 1195 1200Asp Leu Gly Gln Met Leu Glu Glu Gly Lys Lys Ala Thr Asn Leu 1205 1210 1215Thr Arg Glu Thr Lys Leu Ile Asn Asp Cys His Gly Ser Val Ser 1220 1225 1230Glu Ala Ser Ser Glu Gln Lys Ile Ala Lys Leu Asp Val Ser Asn 1235 1240 1245Val Ala Thr Asp Thr Glu Arg Leu Glu Leu Lys Ala Ser Pro Asn 1250 1255 1260Val Glu Ala Pro Gln Pro His Arg His Val Leu Glu Ile Ser Arg 1265 1270 1275Gln His Glu Gln Pro Gly Gln Gly Ile Ala Pro Asp Ala Val Asn 1280 1285 1290Gly Gln Arg Arg Asp Ser Arg Ser Thr Val Phe Arg Ile Pro Glu 1295 1300 1305Phe Asn Trp Ser Gln Met His Gln Arg Leu Leu Thr Asp Leu Leu 1310 1315 1320Phe Ser Ile Glu Thr Asp Ile Gln Met Trp Arg Ser His Ser Thr 1325 1330 1335Lys Thr Val Met Asp Phe Val Asn Ser Ser Asp Asn Val Ile Phe 1340 1345 1350Val His Asn Thr Ile His Leu Ile Ser Gln Val Met Asp Asn Met 1355 1360 1365Val Met Ala Cys Gly Gly Ile Leu Pro Leu Leu Ser Ala Ala Thr 1370 1375 1380Ser Ala Thr His Glu Leu Glu Asn Ile Glu Pro Thr Gln Gly Leu 1385 1390 1395Ser Ile Glu Ala Ser Val Thr Phe Leu Gln Arg Leu Ile Ser Leu 1400 1405 1410Val Asp Val Leu Ile Phe Ala Ser Ser Leu Gly Phe Thr Glu Ile 1415 1420 1425Glu Ala Glu Lys Ser Met Ser Ser Gly Gly Ile Leu Arg Gln Cys 1430 1435 1440Leu Arg Leu Val Cys Ala Val Ala Val Arg Asn Cys Leu Glu Cys 1445 1450 1455Gln Gln His Ser Gln Leu Lys Thr Arg Gly Asp Lys Ala Leu Lys 1460 1465 1470Pro Met His Ser Leu Ile Pro Leu Gly Lys Ser Ala Ala Lys Ser 1475 1480 1485Pro Val Asp Ile Val Thr Gly Gly Ile Ser Pro Val Arg Asp Leu 1490 1495 1500Asp Arg Leu Leu Gln Asp Met Asp Ile Asn Arg Leu Arg Ala Val 1505 1510 1515Val Phe Arg Asp Ile Glu Asp Ser Lys Gln Ala Gln Phe Leu Ala 1520 1525 1530Leu Ala Val Val Tyr Phe Ile Ser Val Leu Met Val Ser Lys Tyr 1535 1540 1545Arg Asp Ile Leu Glu Pro Gln Asn Glu Arg His Ser Gln Ser Cys 1550 1555 1560Thr Glu Thr Gly Ser Glu Asn Glu Asn Val Ser Leu Ser

Glu Ile 1565 1570 1575Thr Pro Ala Ala Phe Ser Thr Leu Thr Thr Ala Ser Val Glu Glu 1580 1585 1590Ser Glu Ser Thr Ser Ser Ala Arg Arg Arg Asp Ser Gly Ile Gly 1595 1600 1605Glu Glu Thr Ala Thr Gly Leu Gly Ser His Val Glu Val Thr Pro 1610 1615 1620His Thr Ala Pro Pro Gly Val Ser Ala Gly Pro Asp Ala Ile Ser 1625 1630 1635Glu Val Leu Ser Thr Leu Ser Leu Glu Val Asn Lys Ser Pro Glu 1640 1645 1650Thr Lys Asn Asp Arg Gly Asn Asp Leu Asp Thr Lys Ala Thr Pro 1655 1660 1665Ser Val Ser Val Ser Lys Asn Val Asn Val Lys Asp Ile Leu Arg 1670 1675 1680Ser Leu Val Asn Ile Pro Ala Asp Gly Val Thr Val Asp Pro Ala 1685 1690 1695Leu Leu Pro Pro Ala Cys Leu Gly Ala Leu Gly Asp Leu Ser Val 1700 1705 1710Glu Gln Pro Val Gln Phe Arg Ser Phe Asp Arg Ser Val Ile Val 1715 1720 1725Ala Ala Lys Lys Ser Ala Val Ser Pro Ser Thr Phe Asn Thr Ser 1730 1735 1740Ile Pro Thr Asn Ala Val Ser Val Val Ser Ser Val Asp Ser Ala 1745 1750 1755Gln Ala Ser Asp Met Gly Gly Glu Ser Pro Gly Ser Arg Ser Ser 1760 1765 1770Asn Ala Lys Leu Pro Ser Val Pro Thr Val Asp Ser Val Ser Gln 1775 1780 1785Asp Pro Val Ser Asn Met Ser Ile Thr Glu Arg Leu Glu His Ala 1790 1795 1800Leu Glu Lys Ala Ala Pro Leu Leu Arg Glu Ile Phe Val Asp Phe 1805 1810 1815Ala Pro Phe Leu Ser Arg Thr Leu Leu Gly Ser His Gly Gln Glu 1820 1825 1830Leu Leu Ile Glu Gly Thr Ser Leu Val Cys Met Lys Ser Ser Ser 1835 1840 1845Ser Val Val Glu Leu Val Met Leu Leu Cys Ser Gln Glu Trp Gln 1850 1855 1860Asn Ser Ile Gln Lys Asn Ala Gly Leu Ala Phe Ile Glu Leu Val 1865 1870 1875Asn Glu Gly Arg Leu Leu Ser Gln Thr Met Lys Asp His Leu Val 1880 1885 1890Arg Val Ala Asn Glu Ala Glu Phe Ile Leu Ser Arg Gln Arg Ala 1895 1900 1905Glu Asp Ile His Arg His Ala Glu Phe Glu Ser Leu Cys Ala Gln 1910 1915 1920Tyr Ser Ala Asp Lys Arg Glu Asp Glu Lys Met Cys Asp His Leu 1925 1930 1935Ile Arg Ala Ala Lys Tyr Arg Asp His Val Thr Ala Thr Gln Leu 1940 1945 1950Ile Gln Lys Ile Ile Asn Ile Leu Thr Asp Lys His Gly Ala Trp 1955 1960 1965Gly Asn Ser Ala Val Ser Arg Pro Leu Glu Phe Trp Arg Leu Asp 1970 1975 1980Tyr Trp Glu Asp Asp Leu Arg Arg Arg Arg Arg Phe Val Arg Asn 1985 1990 1995Pro Leu Gly Ser Thr His Pro Glu Ala Thr Leu Lys Thr Ala Val 2000 2005 2010Glu His Val Cys Ile Phe Lys Leu Arg Glu Asn Ser Lys Ala Thr 2015 2020 2025Asp Glu Asp Ile Leu Ala Lys Gly Lys Gln Ser Ile Arg Ser Gln 2030 2035 2040Ala Leu Gly Asn Gln Asn Ser Glu Asn Glu Ile Leu Leu Glu Gly 2045 2050 2055Asp Asp Asp Thr Leu Ser Ser Val Asp Glu Lys Asp Leu Glu Asn 2060 2065 2070Leu Ala Gly Pro Val Ser Leu Ser Thr Pro Ala Gln Leu Val Ala 2075 2080 2085Pro Ser Val Val Val Lys Gly Thr Leu Ser Val Thr Ser Ser Glu 2090 2095 2100 Leu Tyr Phe Glu Val Asp Glu Glu Asp Pro Asn Phe Lys Lys Ile 2105 2110 2115Asp Pro Lys Ile Leu Ala Tyr Thr Glu Gly Leu His Gly Lys Trp 2120 2125 2130Leu Phe Thr Glu Ile Arg Ser Ile Phe Ser Arg Arg Tyr Leu Leu 2135 2140 2145Gln Asn Thr Ala Leu Glu Ile Phe Met Ala Asn Arg Val Ala Val 2150 2155 2160Met Phe Asn Phe Pro Asp Pro Ala Thr Val Lys Lys Val Val Asn 2165 2170 2175Phe Leu Pro Arg Val Gly Val Gly Thr Ser Phe Gly Leu Pro Gln 2180 2185 2190Thr Arg Arg Ile Ser Leu Ala Ser Pro Arg Gln Leu Phe Lys Ala 2195 2200 2205Ser Asn Met Thr Gln Arg Trp Gln His Arg Glu Ile Ser Asn Phe 2210 2215 2220Glu Tyr Leu Met Phe Leu Asn Thr Ile Ala Gly Arg Ser Tyr Asn 2225 2230 2235Asp Leu Asn Gln Tyr Pro Val Phe Pro Trp Val Ile Thr Asn Tyr 2240 2245 2250Glu Ser Glu Glu Leu Asp Leu Thr Leu Pro Thr Asn Phe Arg Asp 2255 2260 2265Leu Ser Lys Pro Ile Gly Ala Leu Asn Pro Lys Arg Ala Ala Phe 2270 2275 2280Phe Ala Glu Arg Tyr Glu Ser Trp Glu Asp Asp Gln Val Pro Lys 2285 2290 2295Phe His Tyr Gly Thr His Tyr Ser Thr Ala Ser Phe Val Leu Ala 2300 2305 2310Trp Leu Leu Arg Ile Glu Pro Phe Thr Thr Tyr Phe Leu Asn Leu 2315 2320 2325Gln Gly Gly Lys Phe Asp His Ala Asp Arg Thr Phe Ser Ser Ile 2330 2335 2340Ser Arg Ala Trp Arg Asn Ser Gln Arg Asp Thr Ser Asp Ile Lys 2345 2350 2355Glu Leu Ile Pro Glu Phe Tyr Tyr Leu Pro Glu Met Phe Val Asn 2360 2365 2370Phe Asn Asn Tyr Asn Leu Gly Val Met Asp Asp Gly Thr Val Val 2375 2380 2385Ser Asp Val Glu Leu Pro Pro Trp Ala Lys Thr Ser Glu Glu Phe 2390 2395 2400Val His Ile Asn Arg Leu Ala Leu Glu Ser Glu Phe Val Ser Cys 2405 2410 2415Gln Leu His Gln Trp Ile Asp Leu Ile Phe Gly Tyr Lys Gln Gln 2420 2425 2430Gly Pro Glu Ala Val Arg Ala Leu Asn Val Phe Tyr Tyr Leu Thr 2435 2440 2445Tyr Glu Gly Ala Val Asn Leu Asn Ser Ile Thr Asp Pro Val Leu 2450 2455 2460 Arg Glu Ala Val Glu Ala Gln Ile Arg Ser Phe Gly Gln Thr Pro 2465 2470 2475Ser Gln Leu Leu Ile Glu Pro His Pro Pro Arg Gly Ser Ala Met 2480 2485 2490Gln Val Ser Pro Leu Met Phe Thr Asp Lys Ala Gln Gln Asp Val 2495 2500 2505Ile Met Val Leu Lys Phe Pro Ser Asn Ser Pro Val Thr His Val 2510 2515 2520Ala Ala Asn Thr Gln Pro Gly Leu Ala Thr Pro Ala Val Ile Thr 2525 2530 2535Val Thr Ala Asn Arg Leu Phe Ala Val Asn Lys Trp His Asn Leu 2540 2545 2550Pro Ala His Gln Gly Ala Val Gln Asp Gln Pro Tyr Gln Leu Pro 2555 2560 2565Val Glu Ile Asp Pro Leu Ile Gly Leu Ser Leu Pro Ser Leu Phe 2570 2575 2580Ala Ile His 2585222868PRTHomo sapiensDOMAIN(1)..(72)G peptide 22Met Ala Ser Glu Asp Asn Arg Val Pro Ser Pro Pro Pro Thr Gly Asp1 5 10 15Asp Gly Gly Gly Gly Gly Arg Glu Glu Thr Pro Thr Glu Gly Gly Ala 20 25 30Leu Ser Leu Lys Pro Gly Leu Pro Ile Arg Gly Ile Arg Met Lys Phe 35 40 45Ala Val Leu Thr Gly Leu Val Glu Val Gly Glu Val Ser Asn Arg Asp 50 55 60Ile Val Glu Thr Val Phe Asn Leu Leu Val Gly Gly Gln Phe Asp Leu65 70 75 80Glu Met Asn Phe Ile Ile Gln Glu Gly Glu Ser Ile Asn Cys Met Val 85 90 95Asp Leu Leu Glu Lys Cys Asp Ile Thr Cys Gln Ala Glu Val Trp Ser 100 105 110Met Phe Thr Ala Ile Leu Lys Lys Ser Ile Arg Asn Leu Gln Val Cys 115 120 125Thr Glu Val Gly Leu Val Glu Lys Val Leu Gly Lys Ile Glu Lys Val 130 135 140Asp Asn Met Ile Ala Asp Leu Leu Val Asp Met Leu Gly Val Leu Ala145 150 155 160Ser Tyr Asn Leu Thr Val Arg Glu Leu Lys Leu Phe Phe Ser Lys Leu 165 170 175Gln Gly Asp Lys Gly Arg Trp Pro Pro His Ala Gly Lys Leu Leu Ser 180 185 190Val Leu Lys His Met Pro Gln Lys Tyr Gly Pro Asp Ala Phe Phe Asn 195 200 205Phe Pro Gly Lys Ser Ala Ala Ala Ile Ala Leu Pro Pro Ile Ala Lys 210 215 220Trp Pro Tyr Gln Asn Gly Phe Thr Phe His Thr Trp Leu Arg Met Asp225 230 235 240Pro Val Asn Asn Ile Asn Val Asp Lys Asp Lys Pro Tyr Leu Tyr Cys 245 250 255Phe Arg Thr Ser Lys Gly Leu Gly Tyr Ser Ala His Phe Val Gly Gly 260 265 270Cys Leu Ile Val Thr Ser Ile Lys Ser Lys Gly Lys Gly Phe Gln His 275 280 285Cys Val Lys Phe Asp Phe Lys Pro Gln Lys Trp Tyr Met Val Thr Ile 290 295 300Val His Ile Tyr Asn Arg Trp Lys Asn Ser Glu Leu Arg Cys Tyr Val305 310 315 320Asn Gly Glu Leu Ala Ser Tyr Gly Glu Ile Thr Trp Phe Val Asn Thr 325 330 335Ser Asp Thr Phe Asp Lys Cys Phe Leu Gly Ser Ser Glu Thr Ala Asp 340 345 350Ala Asn Arg Val Phe Cys Gly Gln Met Thr Ala Val Tyr Leu Phe Ser 355 360 365Glu Ala Leu Asn Ala Ala Gln Ile Phe Ala Ile Tyr Gln Leu Gly Leu 370 375 380Gly Tyr Lys Gly Thr Phe Lys Phe Lys Ala Glu Ser Asp Leu Phe Leu385 390 395 400Ala Glu His His Lys Leu Leu Leu Tyr Asp Gly Lys Leu Ser Ser Ala 405 410 415Ile Ala Phe Thr Tyr Asn Pro Arg Ala Thr Asp Ala Gln Leu Cys Leu 420 425 430Glu Ser Ser Pro Lys Asp Asn Pro Ser Ile Phe Val His Ser Pro His 435 440 445Ala Leu Met Leu Gln Asp Val Lys Ala Val Leu Thr His Ser Ile Gln 450 455 460Ser Ala Met His Ser Ile Gly Gly Val Gln Val Leu Phe Pro Leu Phe465 470 475 480Ala Gln Leu Asp Tyr Arg Gln Tyr Leu Ser Asp Glu Ile Asp Leu Thr 485 490 495Ile Cys Ser Thr Leu Leu Ala Phe Ile Met Glu Leu Leu Lys Asn Ser 500 505 510Ile Ala Met Gln Glu Gln Met Leu Ala Cys Lys Gly Phe Leu Val Ile 515 520 525Gly Tyr Ser Leu Glu Lys Ser Ser Lys Ser His Val Ser Arg Ala Val 530 535 540Leu Glu Leu Cys Leu Ala Phe Ser Lys Tyr Leu Ser Asn Leu Gln Asn545 550 555 560Gly Met Pro Leu Leu Lys Gln Leu Cys Asp His Val Leu Leu Asn Pro 565 570 575Ala Ile Trp Ile His Thr Pro Ala Lys Val Gln Leu Met Leu Tyr Thr 580 585 590Tyr Leu Ser Thr Glu Phe Ile Gly Thr Val Asn Ile Tyr Asn Thr Ile 595 600 605Arg Arg Val Gly Thr Val Leu Leu Ile Met His Thr Leu Lys Tyr Tyr 610 615 620Tyr Trp Ala Val Asn Pro Gln Asp Arg Ser Gly Ile Thr Pro Lys Gly625 630 635 640Leu Asp Gly Pro Arg Pro Asn Gln Lys Glu Met Leu Ser Leu Arg Ala 645 650 655Phe Leu Leu Met Phe Ile Lys Gln Leu Val Met Lys Asp Ser Gly Val 660 665 670Lys Glu Asp Glu Leu Gln Ala Ile Leu Asn Tyr Leu Leu Thr Met His 675 680 685Glu Asp Asp Asn Leu Met Asp Val Leu Gln Leu Leu Val Ala Leu Met 690 695 700Ser Glu His Pro Asn Ser Met Ile Pro Ala Phe Asp Gln Arg Asn Gly705 710 715 720Leu Arg Val Ile Tyr Lys Leu Leu Ala Ser Lys Ser Glu Gly Ile Arg 725 730 735Val Gln Ala Leu Lys Ala Met Gly Tyr Phe Leu Lys His Arg Pro Pro 740 745 750Lys Arg Lys Ala Glu Val Met Leu Gly His Gly Leu Phe Ser Leu Leu 755 760 765Ala Glu Arg Leu Met Leu Gln Thr Asn Leu Ile Thr Met Thr Thr Tyr 770 775 780Asn Val Leu Phe Glu Ile Leu Ile Glu Gln Ile Gly Thr Gln Val Ile785 790 795 800His Lys Gln His Pro Asp Pro Asp Ser Ser Val Lys Ile Gln Asn Pro 805 810 815Gln Ile Leu Lys Val Ile Ala Thr Leu Leu Arg Asn Ser Pro Gln Cys 820 825 830Pro Glu Ser Met Glu Val Arg Arg Ala Phe Leu Ser Asp Met Ile Lys 835 840 845Leu Phe Asn Asn Ser Arg Glu Asn Arg Arg Ser Leu Leu Gln Cys Ser 850 855 860Val Trp Gln Glu Trp Met Leu Ser Leu Cys Tyr Phe Asn Pro Lys Asn865 870 875 880Ser Asp Glu Gln Lys Ile Thr Glu Met Val Tyr Ala Ile Phe Arg Ile 885 890 895Leu Leu Tyr His Ala Val Lys Tyr Glu Trp Gly Gly Trp Arg Val Trp 900 905 910Val Asp Thr Leu Ser Ile Thr His Ser Lys Val Thr Phe Glu Ile His 915 920 925Lys Glu Asn Leu Ala Asn Ile Phe Arg Glu Gln Gln Gly Lys Val Asp 930 935 940Glu Glu Ile Gly Leu Cys Ser Ser Thr Ser Val Gln Ala Ala Ser Gly945 950 955 960Ile Arg Arg Asp Ile Asn Val Ser Val Gly Ser Gln Gln Pro Asp Thr 965 970 975Lys Asp Ser Pro Val Cys Pro His Phe Thr Thr Asn Gly Asn Glu Asn 980 985 990Ser Ser Ile Glu Lys Thr Ser Ser Leu Glu Ser Ala Ser Asn Ile Glu 995 1000 1005Leu Gln Thr Thr Asn Thr Ser Tyr Glu Glu Met Lys Ala Glu Gln 1010 1015 1020Glu Asn Gln Glu Leu Pro Asp Glu Gly Thr Leu Glu Glu Thr Leu 1025 1030 1035Thr Asn Glu Thr Arg Asn Ala Asp Asp Leu Glu Val Ser Ser Asp 1040 1045 1050Ile Ile Glu Ala Val Ala Ile Ser Ser Asn Ser Phe Ile Thr Thr 1055 1060 1065Gly Lys Asp Ser Met Thr Val Ser Glu Val Thr Ala Ser Ile Ser 1070 1075 1080Ser Pro Ser Glu Glu Asp Ala Ser Glu Met Pro Glu Phe Leu Asp 1085 1090 1095Lys Ser Ile Val Glu Glu Glu Glu Asp Asp Asp Tyr Val Glu Leu 1100 1105 1110Lys Val Glu Gly Ser Pro Thr Glu Glu Ala Asn Leu Pro Thr Glu 1115 1120 1125Leu Gln Asp Asn Ser Leu Ser Pro Ala Ala Ser Glu Ala Gly Glu 1130 1135 1140Lys Leu Asp Met Phe Gly Asn Asp Asp Lys Leu Ile Phe Gln Glu 1145 1150 1155Gly Lys Pro Val Thr Glu Lys Gln Thr Asp Thr Glu Thr Gln Asp 1160 1165 1170 Ser Lys Asp Ser Gly Ile Gln Thr Met Thr Ala Ser Gly Ser Ser 1175 1180 1185Ala Met Ser Pro Glu Thr Thr Val Ser Gln Ile Ala Val Glu Ser 1190 1195 1200Asp Leu Gly Gln Met Leu Glu Glu Gly Lys Lys Ala Thr Asn Leu 1205 1210 1215Thr Arg Glu Thr Lys Leu Ile Asn Asp Cys His Gly Ser Val Ser 1220 1225 1230Glu Ala Ser Ser Glu Gln Lys Ile Ala Lys Leu Asp Val Ser Asn 1235 1240 1245Val Ala Thr Asp Thr Glu Arg Leu Glu Leu Lys Ala Ser Pro Asn 1250 1255 1260Val Glu Ala Pro Gln Pro His Arg His Val Leu Glu Ile Ser Arg 1265 1270 1275Gln His Glu Gln Pro Gly Gln Gly Ile Ala Pro Asp Ala Val Asn 1280 1285 1290Gly Gln Arg Arg Asp Ser Arg Ser Thr Val Phe Arg Ile Pro Glu 1295 1300 1305Phe Asn Trp Ser Gln Met His Gln Arg Leu Leu Thr Asp Leu Leu 1310 1315 1320Phe Ser Ile Glu Thr Asp Ile Gln Met Trp Arg Ser His Ser Thr 1325 1330 1335Lys Thr Val Met Asp Phe Val Asn Ser Ser Asp Asn Val Ile Phe 1340 1345 1350Val His Asn Thr Ile His Leu Ile Ser Gln Val Met Asp Asn Met 1355 1360 1365Val Met Ala Cys Gly Gly Ile Leu Pro Leu Leu Ser Ala Ala Thr 1370 1375 1380Ser Ala Thr His Glu Leu Glu Asn Ile Glu Pro Thr Gln Gly Leu 1385 1390 1395Ser Ile Glu Ala Ser Val Thr Phe Leu Gln Arg Leu Ile Ser Leu 1400 1405 1410Val Asp Val Leu Ile Phe Ala Ser Ser Leu Gly Phe Thr Glu Ile 1415 1420

1425Glu Ala Glu Lys Ser Met Ser Ser Gly Gly Ile Leu Arg Gln Cys 1430 1435 1440Leu Arg Leu Val Cys Ala Val Ala Val Arg Asn Cys Leu Glu Cys 1445 1450 1455Gln Gln His Ser Gln Leu Lys Thr Arg Gly Asp Lys Ala Leu Lys 1460 1465 1470Pro Met His Ser Leu Ile Pro Leu Gly Lys Ser Ala Ala Lys Ser 1475 1480 1485Pro Val Asp Ile Val Thr Gly Gly Ile Ser Pro Val Arg Asp Leu 1490 1495 1500Asp Arg Leu Leu Gln Asp Met Asp Ile Asn Arg Leu Arg Ala Val 1505 1510 1515Val Phe Arg Asp Ile Glu Asp Ser Lys Gln Ala Gln Phe Leu Ala 1520 1525 1530Leu Ala Val Val Tyr Phe Ile Ser Val Leu Met Val Ser Lys Tyr 1535 1540 1545Arg Asp Ile Leu Glu Pro Gln Asn Glu Arg His Ser Gln Ser Cys 1550 1555 1560Thr Glu Thr Gly Ser Glu Asn Glu Asn Val Ser Leu Ser Glu Ile 1565 1570 1575Thr Pro Ala Ala Phe Ser Thr Leu Thr Thr Ala Ser Val Glu Glu 1580 1585 1590Ser Glu Ser Thr Ser Ser Ala Arg Arg Arg Asp Ser Gly Ile Gly 1595 1600 1605Glu Glu Thr Ala Thr Gly Leu Gly Ser His Val Glu Val Thr Pro 1610 1615 1620His Thr Ala Pro Pro Gly Val Ser Ala Gly Pro Asp Ala Ile Ser 1625 1630 1635Glu Val Leu Ser Thr Leu Ser Leu Glu Val Asn Lys Ser Pro Glu 1640 1645 1650Thr Lys Asn Asp Arg Gly Asn Asp Leu Asp Thr Lys Ala Thr Pro 1655 1660 1665Ser Val Ser Val Ser Lys Asn Val Asn Val Lys Asp Ile Leu Arg 1670 1675 1680Ser Leu Val Asn Ile Pro Ala Asp Gly Val Thr Val Asp Pro Ala 1685 1690 1695Leu Leu Pro Pro Ala Cys Leu Gly Ala Leu Gly Asp Leu Ser Val 1700 1705 1710Glu Gln Pro Val Gln Phe Arg Ser Phe Asp Arg Ser Val Ile Val 1715 1720 1725Ala Ala Lys Lys Ser Ala Val Ser Pro Ser Thr Phe Asn Thr Ser 1730 1735 1740Ile Pro Thr Asn Ala Val Ser Val Val Ser Ser Val Asp Ser Ala 1745 1750 1755Gln Ala Ser Asp Met Gly Gly Glu Ser Pro Gly Ser Arg Ser Ser 1760 1765 1770Asn Ala Lys Leu Pro Ser Val Pro Thr Val Asp Ser Val Ser Gln 1775 1780 1785Asp Pro Val Ser Asn Met Ser Ile Thr Glu Arg Leu Glu His Ala 1790 1795 1800Leu Glu Lys Ala Ala Pro Leu Leu Arg Glu Ile Phe Val Asp Phe 1805 1810 1815Ala Pro Phe Leu Ser Arg Thr Leu Leu Gly Ser His Gly Gln Glu 1820 1825 1830Leu Leu Ile Glu Gly Thr Ser Leu Val Cys Met Lys Ser Ser Ser 1835 1840 1845Ser Val Val Glu Leu Val Met Leu Leu Cys Ser Gln Glu Trp Gln 1850 1855 1860Asn Ser Ile Gln Lys Asn Ala Gly Leu Ala Phe Ile Glu Leu Val 1865 1870 1875Asn Glu Gly Arg Leu Leu Ser Gln Thr Met Lys Asp His Leu Val 1880 1885 1890Arg Val Ala Asn Glu Ala Glu Phe Ile Leu Ser Arg Gln Arg Ala 1895 1900 1905Glu Asp Ile His Arg His Ala Glu Phe Glu Ser Leu Cys Ala Gln 1910 1915 1920Tyr Ser Ala Asp Lys Arg Glu Asp Glu Lys Met Cys Asp His Leu 1925 1930 1935Ile Arg Ala Ala Lys Tyr Arg Asp His Val Thr Ala Thr Gln Leu 1940 1945 1950Ile Gln Lys Ile Ile Asn Ile Leu Thr Asp Lys His Gly Ala Trp 1955 1960 1965Gly Asn Ser Ala Val Ser Arg Pro Leu Glu Phe Trp Arg Leu Asp 1970 1975 1980Tyr Trp Glu Asp Asp Leu Arg Arg Arg Arg Arg Phe Val Arg Asn 1985 1990 1995Pro Leu Gly Ser Thr His Pro Glu Ala Thr Leu Lys Thr Ala Val 2000 2005 2010Glu His Val Cys Ile Phe Lys Leu Arg Glu Asn Ser Lys Ala Thr 2015 2020 2025Asp Glu Asp Ile Leu Ala Lys Gly Lys Gln Ser Ile Arg Ser Gln 2030 2035 2040Ala Leu Gly Asn Gln Asn Ser Glu Asn Glu Ile Leu Leu Glu Gly 2045 2050 2055Asp Asp Asp Thr Leu Ser Ser Val Asp Glu Lys Asp Leu Glu Asn 2060 2065 2070Leu Ala Gly Pro Val Ser Leu Ser Thr Pro Ala Gln Leu Val Ala 2075 2080 2085Pro Ser Val Val Val Lys Gly Thr Leu Ser Val Thr Ser Ser Glu 2090 2095 2100Leu Tyr Phe Glu Val Asp Glu Glu Asp Pro Asn Phe Lys Lys Ile 2105 2110 2115Asp Pro Lys Ile Leu Ala Tyr Thr Glu Gly Leu His Gly Lys Trp 2120 2125 2130Leu Phe Thr Glu Ile Arg Ser Ile Phe Ser Arg Arg Tyr Leu Leu 2135 2140 2145Gln Asn Thr Ala Leu Glu Ile Phe Met Ala Asn Arg Val Ala Val 2150 2155 2160Met Phe Asn Phe Pro Asp Pro Ala Thr Val Lys Lys Val Val Asn 2165 2170 2175Phe Leu Pro Arg Val Gly Val Gly Thr Ser Phe Gly Leu Pro Gln 2180 2185 2190Thr Arg Arg Ile Ser Leu Ala Ser Pro Arg Gln Leu Phe Lys Ala 2195 2200 2205Ser Asn Met Thr Gln Arg Trp Gln His Arg Glu Ile Ser Asn Phe 2210 2215 2220Glu Tyr Leu Met Phe Leu Asn Thr Ile Ala Gly Arg Ser Tyr Asn 2225 2230 2235Asp Leu Asn Gln Tyr Pro Val Phe Pro Trp Val Ile Thr Asn Tyr 2240 2245 2250Glu Ser Glu Glu Leu Asp Leu Thr Leu Pro Thr Asn Phe Arg Asp 2255 2260 2265Leu Ser Lys Pro Ile Gly Ala Leu Asn Pro Lys Arg Ala Ala Phe 2270 2275 2280Phe Ala Glu Arg Tyr Glu Ser Trp Glu Asp Asp Gln Val Pro Lys 2285 2290 2295Phe His Tyr Gly Thr His Tyr Ser Thr Ala Ser Phe Val Leu Ala 2300 2305 2310Trp Leu Leu Arg Ile Glu Pro Phe Thr Thr Tyr Phe Leu Asn Leu 2315 2320 2325Gln Gly Gly Lys Phe Asp His Ala Asp Arg Thr Phe Ser Ser Ile 2330 2335 2340Ser Arg Ala Trp Arg Asn Ser Gln Arg Asp Thr Ser Asp Ile Lys 2345 2350 2355Glu Leu Ile Pro Glu Phe Tyr Tyr Leu Pro Glu Met Phe Val Asn 2360 2365 2370Phe Asn Asn Tyr Asn Leu Gly Val Met Asp Asp Gly Thr Val Val 2375 2380 2385Ser Asp Val Glu Leu Pro Pro Trp Ala Lys Thr Ser Glu Glu Phe 2390 2395 2400Val His Ile Asn Arg Leu Ala Leu Glu Ser Glu Phe Val Ser Cys 2405 2410 2415Gln Leu His Gln Trp Ile Asp Leu Ile Phe Gly Tyr Lys Gln Gln 2420 2425 2430Gly Pro Glu Ala Val Arg Ala Leu Asn Val Phe Tyr Tyr Leu Thr 2435 2440 2445Tyr Glu Gly Ala Val Asn Leu Asn Ser Ile Thr Asp Pro Val Leu 2450 2455 2460Arg Glu Ala Val Glu Ala Gln Ile Arg Ser Phe Gly Gln Thr Pro 2465 2470 2475Ser Gln Leu Leu Ile Glu Pro His Pro Pro Arg Gly Ser Ala Met 2480 2485 2490Gln Val Tyr Leu Leu Leu Gln Ser Pro Leu Met Phe Thr Asp Lys 2495 2500 2505Ala Gln Gln Asp Val Ile Met Val Leu Lys Phe Pro Ser Asn Ser 2510 2515 2520Pro Val Thr His Val Ala Ala Asn Thr Gln Pro Gly Leu Ala Thr 2525 2530 2535Pro Ala Val Ile Thr Val Thr Ala Asn Arg Leu Phe Ala Val Asn 2540 2545 2550Lys Trp His Asn Leu Pro Ala His Gln Gly Ala Val Gln Asp Gln 2555 2560 2565Pro Tyr Gln Leu Pro Val Glu Ile Asp Pro Leu Ile Ala Ser Asn 2570 2575 2580Thr Gly Met His Arg Arg Gln Ile Thr Asp Leu Leu Asp Gln Ser 2585 2590 2595Ile Gln Val His Ser Gln Cys Phe Val Ile Thr Ser Asp Asn Arg 2600 2605 2610Tyr Ile Leu Val Cys Gly Phe Trp Asp Lys Ser Phe Arg Val Tyr 2615 2620 2625Ser Thr Asp Thr Gly Arg Leu Ile Gln Val Val Phe Gly His Trp 2630 2635 2640Asp Val Val Thr Cys Leu Ala Arg Ser Glu Ser Tyr Ile Gly Gly 2645 2650 2655Asn Cys Tyr Ile Leu Ser Gly Ser Arg Asp Ala Thr Leu Leu Leu 2660 2665 2670Trp Tyr Trp Asn Gly Lys Cys Ser Gly Ile Gly Asp Asn Pro Gly 2675 2680 2685Ser Glu Thr Ala Ala Pro Arg Ala Ile Leu Thr Gly His Asp Tyr 2690 2695 2700Glu Val Thr Cys Ala Ala Val Cys Ala Glu Leu Gly Leu Val Leu 2705 2710 2715Ser Gly Ser Gln Glu Gly Pro Cys Leu Ile His Ser Met Asn Gly 2720 2725 2730Asp Leu Leu Arg Thr Leu Glu Gly Pro Glu Asn Cys Leu Lys Pro 2735 2740 2745Lys Leu Ile Gln Ala Ser Arg Glu Gly His Cys Val Ile Phe Tyr 2750 2755 2760Glu Asn Gly Leu Phe Cys Thr Phe Ser Val Asn Gly Lys Leu Gln 2765 2770 2775Ala Thr Met Glu Thr Asp Asp Asn Ile Arg Ala Ile Gln Leu Ser 2780 2785 2790Arg Asp Gly Gln Tyr Leu Leu Thr Gly Gly Asp Arg Gly Val Val 2795 2800 2805Val Val Arg Gln Val Ser Asp Leu Lys Gln Leu Phe Ala Tyr Pro 2810 2815 2820Gly Cys Asp Ala Gly Ile Arg Ala Met Ala Leu Ser Tyr Asp Gln 2825 2830 2835Arg Cys Ile Ile Ser Gly Met Ala Ser Gly Ser Ile Val Leu Phe 2840 2845 2850Tyr Asn Asp Phe Asn Arg Trp His His Glu Tyr Gln Thr Arg Tyr 2855 2860 2865232411PRTHomo sapiensDOMAIN(1)..(72)G peptide 23Met Ala Ser Glu Asp Asn Arg Val Pro Ser Pro Pro Pro Thr Gly Asp1 5 10 15Asp Gly Gly Gly Gly Gly Arg Glu Glu Thr Pro Thr Glu Gly Gly Ala 20 25 30Leu Ser Leu Lys Pro Gly Leu Pro Ile Arg Gly Ile Arg Met Lys Phe 35 40 45Ala Val Leu Thr Gly Leu Val Glu Val Gly Glu Val Ser Asn Arg Asp 50 55 60Ile Val Glu Thr Val Phe Asn Leu Leu Val Gly Gly Gln Phe Asp Leu65 70 75 80Glu Met Asn Phe Ile Ile Gln Glu Gly Glu Ser Ile Asn Cys Met Val 85 90 95Asp Leu Leu Glu Lys Cys Asp Ile Thr Cys Gln Ala Glu Val Trp Ser 100 105 110Met Phe Thr Ala Ile Leu Lys Lys Ser Ile Arg Asn Leu Gln Val Cys 115 120 125Thr Glu Val Gly Leu Val Glu Lys Val Leu Gly Lys Ile Glu Lys Val 130 135 140Asp Asn Met Ile Ala Asp Leu Leu Val Asp Met Leu Gly Val Leu Ala145 150 155 160Ser Tyr Asn Leu Thr Val Arg Glu Leu Lys Leu Phe Phe Ser Lys Leu 165 170 175Gln Gly Asp Lys Gly Arg Trp Pro Pro His Ala Gly Lys Leu Leu Ser 180 185 190Val Leu Lys His Met Pro Gln Lys Tyr Gly Pro Asp Ala Phe Phe Asn 195 200 205Phe Pro Gly Lys Ser Ala Ala Ala Ile Ala Leu Pro Pro Ile Ala Lys 210 215 220Trp Pro Tyr Gln Asn Gly Phe Thr Phe His Thr Trp Leu Arg Met Asp225 230 235 240Pro Val Asn Asn Ile Asn Val Asp Lys Asp Lys Pro Tyr Leu Tyr Cys 245 250 255Phe Arg Thr Ser Lys Gly Leu Gly Tyr Ser Ala His Phe Val Gly Gly 260 265 270Cys Leu Ile Val Thr Ser Ile Lys Ser Lys Gly Lys Gly Phe Gln His 275 280 285Cys Val Lys Phe Asp Phe Lys Pro Gln Lys Trp Tyr Met Val Thr Ile 290 295 300Val His Ile Tyr Asn Arg Trp Lys Asn Ser Glu Leu Arg Cys Tyr Val305 310 315 320Asn Gly Glu Leu Ala Ser Tyr Gly Glu Ile Thr Trp Phe Val Asn Thr 325 330 335Ser Asp Thr Phe Asp Lys Cys Phe Leu Gly Ser Ser Glu Thr Ala Asp 340 345 350Ala Asn Arg Val Phe Cys Gly Gln Met Thr Ala Val Tyr Leu Phe Ser 355 360 365Glu Ala Leu Asn Ala Ala Gln Ile Phe Ala Ile Tyr Gln Leu Gly Leu 370 375 380Gly Tyr Lys Gly Thr Phe Lys Phe Lys Ala Glu Ser Asp Leu Phe Leu385 390 395 400Ala Glu His His Lys Leu Leu Leu Tyr Asp Gly Lys Leu Ser Ser Ala 405 410 415Ile Ala Phe Thr Tyr Asn Pro Arg Ala Thr Asp Ala Gln Leu Cys Leu 420 425 430Glu Ser Ser Pro Lys Asp Asn Pro Ser Ile Phe Val His Ser Pro His 435 440 445Ala Leu Met Leu Gln Asp Val Lys Ala Val Leu Thr His Ser Ile Gln 450 455 460Ser Ala Met His Ser Ile Gly Gly Val Gln Val Leu Phe Pro Leu Phe465 470 475 480Ala Gln Leu Asp Tyr Arg Gln Tyr Leu Ser Asp Glu Ile Asp Leu Thr 485 490 495Ile Cys Ser Thr Leu Leu Ala Phe Ile Met Glu Leu Leu Lys Asn Ser 500 505 510Ile Ala Met Gln Glu Gln Met Leu Ala Cys Lys Gly Phe Leu Val Ile 515 520 525Gly Tyr Ser Leu Glu Lys Ser Ser Lys Ser His Val Ser Arg Ala Val 530 535 540Leu Glu Leu Cys Leu Ala Phe Ser Lys Tyr Leu Ser Asn Leu Gln Asn545 550 555 560Gly Met Pro Leu Leu Lys Gln Leu Cys Asp His Val Leu Leu Asn Pro 565 570 575Ala Ile Trp Ile His Thr Pro Ala Lys Val Gln Leu Met Leu Tyr Thr 580 585 590Tyr Leu Ser Thr Glu Phe Ile Gly Thr Val Asn Ile Tyr Asn Thr Ile 595 600 605Arg Arg Val Gly Thr Val Leu Leu Ile Met His Thr Leu Lys Tyr Tyr 610 615 620Tyr Trp Ala Val Asn Pro Gln Asp Arg Ser Gly Ile Thr Pro Lys Gly625 630 635 640Leu Asp Gly Pro Arg Pro Asn Gln Lys Glu Met Leu Ser Leu Arg Ala 645 650 655Phe Leu Leu Met Phe Ile Lys Gln Leu Val Met Lys Asp Ser Gly Val 660 665 670Lys Glu Asp Glu Leu Gln Ala Ile Leu Asn Tyr Leu Leu Thr Met His 675 680 685Glu Asp Asp Asn Leu Met Asp Val Leu Gln Leu Leu Val Ala Leu Met 690 695 700Ser Glu His Pro Asn Ser Met Ile Pro Ala Phe Asp Gln Arg Asn Gly705 710 715 720Leu Arg Val Ile Tyr Lys Leu Leu Ala Ser Lys Ser Glu Gly Ile Arg 725 730 735Val Gln Ala Leu Lys Ala Met Gly Tyr Phe Leu Lys His Arg Pro Pro 740 745 750Lys Arg Lys Ala Glu Val Met Leu Gly His Gly Leu Phe Ser Leu Leu 755 760 765Ala Glu Arg Leu Met Leu Gln Thr Asn Leu Ile Thr Met Thr Thr Tyr 770 775 780Asn Val Leu Phe Glu Ile Leu Ile Glu Gln Ile Gly Thr Gln Val Ile785 790 795 800His Lys Gln His Pro Asp Pro Asp Ser Ser Val Lys Ile Gln Asn Pro 805 810 815Gln Ile Leu Lys Val Ile Ala Thr Leu Leu Arg Asn Ser Pro Gln Cys 820 825 830Pro Glu Ser Met Glu Val Arg Arg Ala Phe Leu Ser Asp Met Ile Lys 835 840 845Leu Phe Asn Asn Ser Arg Glu Asn Arg Arg Ser Leu Leu Gln Cys Ser 850 855 860Val Trp Gln Glu Trp Met Leu Ser Leu Cys Tyr Phe Asn Pro Lys Asn865 870 875 880Ser Asp Glu Gln Lys Ile Thr Glu Met Val Tyr Ala Ile Phe Arg Ile 885 890 895Leu Leu Tyr His Ala Val Lys Tyr Glu Trp Gly Gly Trp Arg Val Trp 900 905 910Val Asp Thr Leu Ser Ile Thr His Ser Lys Val Thr Phe Glu Ile His 915 920 925Lys Glu Asn Leu Ala Asn Ile Phe Arg Glu Gln Gln Gly Lys Val Asp 930 935 940Glu Glu Ile Gly Leu Cys Ser Ser Thr Ser Val Gln Ala Ala Ser Gly945 950 955 960Ile Arg Arg Asp Ile Asn Val Ser Val Gly Ser Gln Gln Pro Asp Thr 965 970 975Lys Asp Ser Pro Val Cys Pro His Phe Thr Thr Asn Gly Asn Glu Asn 980 985 990Ser Ser Ile Glu Lys Thr Ser Ser Leu Glu Ser Ala Ser Asn Ile Glu 995

1000 1005Leu Gln Thr Thr Asn Thr Ser Tyr Glu Glu Met Lys Ala Glu Gln 1010 1015 1020Glu Asn Gln Glu Leu Pro Asp Glu Gly Thr Leu Glu Glu Thr Leu 1025 1030 1035Thr Asn Glu Thr Arg Asn Ala Asp Asp Leu Glu Val Ser Ser Asp 1040 1045 1050Ile Ile Glu Ala Val Ala Ile Ser Ser Asn Ser Phe Ile Thr Thr 1055 1060 1065Gly Lys Asp Ser Met Thr Val Ser Glu Val Thr Ala Ser Ile Ser 1070 1075 1080Ser Pro Ser Glu Glu Asp Ala Ser Glu Met Pro Glu Phe Leu Asp 1085 1090 1095Lys Ser Ile Val Glu Glu Glu Glu Asp Asp Asp Tyr Val Glu Leu 1100 1105 1110Lys Val Glu Gly Ser Pro Thr Glu Glu Ala Asn Leu Pro Thr Glu 1115 1120 1125Leu Gln Asp Asn Ser Leu Ser Pro Ala Ala Ser Glu Ala Gly Glu 1130 1135 1140Lys Leu Asp Met Phe Gly Asn Asp Asp Lys Leu Ile Phe Gln Glu 1145 1150 1155Gly Lys Pro Val Thr Glu Lys Gln Thr Asp Thr Glu Thr Gln Asp 1160 1165 1170Ser Lys Asp Ser Gly Ile Gln Thr Met Thr Ala Ser Gly Ser Ser 1175 1180 1185Ala Met Ser Pro Glu Thr Thr Val Ser Gln Ile Ala Val Glu Ser 1190 1195 1200Asp Leu Gly Gln Met Leu Glu Glu Gly Lys Lys Ala Thr Asn Leu 1205 1210 1215Thr Arg Glu Thr Lys Leu Ile Asn Asp Cys His Gly Ser Val Ser 1220 1225 1230Glu Ala Ser Ser Glu Gln Lys Ile Ala Lys Leu Asp Val Ser Asn 1235 1240 1245Val Ala Thr Asp Thr Glu Arg Leu Glu Leu Lys Ala Ser Pro Asn 1250 1255 1260Val Glu Ala Pro Gln Pro His Arg His Val Leu Glu Ile Ser Arg 1265 1270 1275Gln His Glu Gln Pro Gly Gln Gly Ile Ala Pro Asp Ala Val Asn 1280 1285 1290Gly Gln Arg Arg Asp Ser Arg Ser Thr Val Phe Arg Ile Pro Glu 1295 1300 1305Phe Asn Trp Ser Gln Met His Gln Arg Leu Leu Thr Asp Leu Leu 1310 1315 1320Phe Ser Ile Glu Thr Asp Ile Gln Met Trp Arg Ser His Ser Thr 1325 1330 1335Lys Thr Val Met Asp Phe Val Asn Ser Ser Asp Asn Val Ile Phe 1340 1345 1350Val His Asn Thr Ile His Leu Ile Ser Gln Val Met Asp Asn Met 1355 1360 1365Val Met Ala Cys Gly Gly Ile Leu Pro Leu Leu Ser Ala Ala Thr 1370 1375 1380Ser Ala Thr His Glu Leu Glu Asn Ile Glu Pro Thr Gln Gly Leu 1385 1390 1395Ser Ile Glu Ala Ser Val Thr Phe Leu Gln Arg Leu Ile Ser Leu 1400 1405 1410Val Asp Val Leu Ile Phe Ala Ser Ser Leu Gly Phe Thr Glu Ile 1415 1420 1425Glu Ala Glu Lys Ser Met Ser Ser Gly Gly Ile Leu Arg Gln Cys 1430 1435 1440Leu Arg Leu Val Cys Ala Val Ala Val Arg Asn Cys Leu Glu Cys 1445 1450 1455Gln Gln His Ser Gln Leu Lys Thr Arg Gly Asp Lys Ala Leu Lys 1460 1465 1470Pro Met His Ser Leu Ile Pro Leu Gly Lys Ser Ala Ala Lys Ser 1475 1480 1485Pro Val Asp Ile Val Thr Gly Gly Ile Ser Pro Val Arg Asp Leu 1490 1495 1500Asp Arg Leu Leu Gln Asp Met Asp Ile Asn Arg Leu Arg Ala Val 1505 1510 1515Val Phe Arg Asp Ile Glu Asp Ser Lys Gln Ala Gln Phe Leu Ala 1520 1525 1530Leu Ala Val Val Tyr Phe Ile Ser Val Leu Met Val Ser Lys Tyr 1535 1540 1545Arg Asp Ile Leu Glu Pro Gln Asn Glu Arg His Ser Gln Ser Cys 1550 1555 1560Thr Glu Thr Gly Ser Glu Asn Glu Asn Val Ser Leu Ser Glu Ile 1565 1570 1575Thr Pro Ala Ala Phe Ser Thr Leu Thr Thr Ala Ser Val Glu Glu 1580 1585 1590Ser Glu Ser Thr Ser Ser Ala Arg Arg Arg Asp Ser Gly Ile Gly 1595 1600 1605Glu Glu Thr Ala Thr Gly Leu Gly Ser His Val Glu Val Thr Pro 1610 1615 1620His Thr Ala Pro Pro Gly Val Ser Ala Gly Pro Asp Ala Ile Ser 1625 1630 1635Glu Val Leu Ser Thr Leu Ser Leu Glu Val Asn Lys Ser Pro Glu 1640 1645 1650Thr Lys Asn Asp Arg Gly Asn Asp Leu Asp Thr Lys Ala Thr Pro 1655 1660 1665Ser Val Ser Val Ser Lys Asn Val Asn Val Lys Asp Ile Leu Arg 1670 1675 1680Ser Leu Val Asn Ile Pro Ala Asp Gly Val Thr Val Asp Pro Ala 1685 1690 1695Leu Leu Pro Pro Ala Cys Leu Gly Ala Leu Gly Asp Leu Ser Val 1700 1705 1710Glu Gln Pro Val Gln Phe Arg Ser Phe Asp Arg Ser Val Ile Val 1715 1720 1725Ala Ala Lys Lys Ser Ala Val Ser Pro Ser Thr Phe Asn Thr Ser 1730 1735 1740Ile Pro Thr Asn Ala Val Ser Val Val Ser Ser Val Asp Ser Ala 1745 1750 1755Gln Ala Ser Asp Met Gly Gly Glu Ser Pro Gly Ser Arg Ser Ser 1760 1765 1770Asn Ala Lys Leu Pro Ser Val Pro Thr Val Asp Ser Val Ser Gln 1775 1780 1785Asp Pro Val Ser Asn Met Ser Ile Thr Glu Arg Leu Glu His Ala 1790 1795 1800Leu Glu Lys Ala Ala Pro Leu Leu Arg Glu Ile Phe Val Asp Phe 1805 1810 1815Ala Pro Phe Leu Ser Arg Thr Leu Leu Gly Ser His Gly Gln Glu 1820 1825 1830Leu Leu Ile Glu Gly Thr Ser Leu Val Cys Met Lys Ser Ser Ser 1835 1840 1845Ser Val Val Glu Leu Val Met Leu Leu Cys Ser Gln Glu Trp Gln 1850 1855 1860Asn Ser Ile Gln Lys Asn Ala Gly Leu Ala Phe Ile Glu Leu Val 1865 1870 1875Asn Glu Gly Arg Leu Leu Ser Gln Thr Met Lys Asp His Leu Val 1880 1885 1890Arg Val Ala Asn Glu Ala Glu Phe Ile Leu Ser Arg Gln Arg Ala 1895 1900 1905Glu Asp Ile His Arg His Ala Glu Phe Glu Ser Leu Cys Ala Gln 1910 1915 1920Tyr Ser Ala Asp Lys Arg Glu Asp Glu Lys Met Cys Asp His Leu 1925 1930 1935Ile Arg Ala Ala Lys Tyr Arg Asp His Val Thr Ala Thr Gln Leu 1940 1945 1950Ile Gln Lys Ile Ile Asn Ile Leu Thr Asp Lys His Gly Ala Trp 1955 1960 1965Gly Asn Ser Ala Val Ser Arg Pro Leu Glu Phe Trp Arg Leu Asp 1970 1975 1980Tyr Trp Glu Asp Asp Leu Arg Arg Arg Arg Arg Phe Val Arg Asn 1985 1990 1995Pro Leu Gly Ser Thr His Pro Glu Ala Thr Leu Lys Thr Ala Val 2000 2005 2010Glu His Val Cys Ile Phe Lys Leu Arg Glu Asn Ser Lys Ala Thr 2015 2020 2025Asp Glu Asp Ile Leu Ala Lys Gly Lys Gln Ser Ile Arg Ser Gln 2030 2035 2040Ala Leu Gly Asn Gln Asn Ser Glu Asn Glu Ile Leu Leu Glu Gly 2045 2050 2055Asp Asp Asp Thr Leu Ser Ser Val Asp Glu Lys Asp Leu Glu Asn 2060 2065 2070Leu Ala Gly Pro Val Ser Leu Ser Thr Pro Ala Gln Leu Val Ala 2075 2080 2085Pro Ser Val Val Val Lys Gly Thr Leu Ser Val Thr Ser Ser Glu 2090 2095 2100Leu Tyr Phe Glu Val Asp Glu Glu Asp Pro Asn Phe Lys Lys Ile 2105 2110 2115Asp Pro Lys Ile Leu Ala Tyr Thr Glu Gly Leu His Gly Lys Trp 2120 2125 2130Leu Phe Thr Glu Ile Arg Ser Ile Phe Ser Arg Arg Tyr Leu Leu 2135 2140 2145Gln Asn Thr Ala Leu Glu Ile Phe Met Ala Asn Arg Val Ala Val 2150 2155 2160Met Phe Asn Phe Pro Asp Pro Ala Thr Val Lys Lys Val Val Asn 2165 2170 2175Phe Leu Pro Arg Val Gly Val Gly Thr Ser Phe Gly Leu Pro Gln 2180 2185 2190Thr Arg Arg Ile Ser Leu Ala Ser Pro Arg Gln Leu Phe Lys Ala 2195 2200 2205Ser Asn Met Thr Gln Arg Trp Gln His Arg Glu Ile Ser Asn Phe 2210 2215 2220Glu Tyr Leu Met Phe Leu Asn Thr Ile Ala Gly Arg Ser Tyr Asn 2225 2230 2235Asp Leu Asn Gln Tyr Pro Val Phe Pro Trp Val Ile Thr Asn Tyr 2240 2245 2250Glu Ser Glu Glu Leu Asp Leu Thr Leu Pro Thr Asn Phe Arg Asp 2255 2260 2265Leu Ser Lys Pro Ile Gly Ala Leu Asn Pro Lys Arg Ala Ala Phe 2270 2275 2280Phe Ala Glu Arg Tyr Glu Ser Trp Glu Asp Asp Gln Val Pro Lys 2285 2290 2295Phe His Tyr Gly Thr His Tyr Ser Thr Ala Ser Phe Val Leu Ala 2300 2305 2310Trp Leu Leu Arg Ile Glu Pro Phe Thr Thr Tyr Phe Leu Asn Leu 2315 2320 2325Gln Gly Gly Lys Phe Asp His Ala Asp Arg Thr Phe Ser Ser Ile 2330 2335 2340Ser Arg Ala Trp Arg Asn Ser Gln Arg Asp Thr Ser Asp Ile Lys 2345 2350 2355Glu Leu Ile Pro Glu Phe Tyr Tyr Leu Pro Glu Met Phe Val Asn 2360 2365 2370Phe Asn Asn Tyr Asn Leu Gly Val Met Asp Asp Gly Thr Val Val 2375 2380 2385Ser Asp Val Glu Leu Pro Pro Trp Ala Lys Thr Ser Glu Glu Phe 2390 2395 2400Val His Ile Asn Arg Leu Val Arg 2405 24102472PRTHomo sapiensDOMAIN(1)..(72)G peptide 24Met Ala Ser Glu Asp Asn Arg Val Pro Ser Pro Pro Pro Thr Gly Asp1 5 10 15Asp Gly Gly Gly Gly Gly Arg Glu Glu Thr Pro Thr Glu Gly Gly Ala 20 25 30Leu Ser Leu Lys Pro Gly Leu Pro Ile Arg Gly Ile Arg Met Lys Phe 35 40 45Ala Val Leu Thr Gly Leu Val Glu Val Gly Glu Val Ser Asn Arg Asp 50 55 60Ile Val Glu Thr Val Phe Asn Leu65 7025341PRTMus musculus 25Leu Thr Gly Leu Val Glu Val Gly Glu Val Ser Asn Arg Asp Ile Val1 5 10 15Glu Thr Val Phe Asn Leu Leu Val Gly Gly Gln Phe Asp Leu Glu Met 20 25 30Asn Phe Ile Ile Gln Glu Gly Glu Ser Ile Met Cys Met Val Glu Leu 35 40 45Leu Glu Lys Cys Asp Val Thr Cys Gln Ala Glu Val Trp Ser Met Phe 50 55 60Thr Ala Ile Leu Lys Lys Ser Ile Arg Asn Leu Gln Val Cys Thr Glu65 70 75 80Val Gly Leu Val Glu Lys Val Leu Gly Lys Ile Glu Lys Val Asp Ser 85 90 95Met Ile Ala Asp Leu Leu Val Asp Met Leu Gly Val Leu Ala Ser Tyr 100 105 110Asn Leu Thr Val Arg Glu Leu Lys Leu Phe Phe Ser Lys Leu Gln Gly 115 120 125Asp Lys Gly Gln Trp Pro Pro His Ala Gly Lys Leu Leu Ser Val Leu 130 135 140Lys His Met Pro Gln Lys Tyr Gly Pro Asp Ala Phe Phe Asn Phe Pro145 150 155 160Gly Lys Ser Ala Ala Ala Ile Ala Leu Pro Pro Ile Ala Arg Trp Pro 165 170 175Tyr Gln Asn Gly Phe Thr Phe His Thr Trp Leu Arg Met Asp Pro Val 180 185 190Asn Asn Ile Asn Val Asp Lys Asp Lys Pro Tyr Leu Tyr Cys Phe Arg 195 200 205Thr Ser Lys Gly Leu Gly Tyr Ser Ala His Phe Val Gly Gly Cys Leu 210 215 220Ile Ile Thr Ser Ile Lys Ser Lys Gly Lys Gly Phe Gln His Cys Val225 230 235 240Lys Phe Asp Phe Lys Pro Gln Lys Trp Tyr Met Val Thr Ile Val His 245 250 255Ile Tyr Asn Arg Trp Lys Asn Ser Glu Leu Arg Cys Tyr Val Asn Gly 260 265 270Glu Leu Ala Ser Tyr Gly Glu Ile Thr Trp Phe Val Asn Thr Ser Asp 275 280 285Thr Phe Asp Lys Cys Phe Leu Gly Ser Ser Glu Thr Ala Asp Ala Asn 290 295 300Arg Val Phe Cys Gly Gln Met Thr Ala Val Tyr Leu Phe Ser Asp Ala305 310 315 320Leu Asn Ala Ala Gln Ile Phe Ala Ile Tyr Gln Leu Gly Leu Gly Tyr 325 330 335Lys Gly Thr Phe Lys 34026341PRTHomo sapiens 26Leu Thr Gly Leu Val Glu Val Gly Glu Val Ser Asn Arg Asp Ile Val1 5 10 15Glu Thr Val Phe Asn Leu Leu Val Gly Gly Gln Phe Asp Leu Glu Met 20 25 30Asn Phe Ile Ile Gln Glu Gly Glu Ser Ile Asn Cys Met Val Asp Leu 35 40 45Leu Glu Lys Cys Asp Ile Thr Cys Gln Ala Glu Val Trp Ser Met Phe 50 55 60Thr Ala Ile Leu Lys Lys Ser Ile Arg Asn Leu Gln Val Cys Thr Glu65 70 75 80Val Gly Leu Val Glu Lys Val Leu Gly Lys Ile Glu Lys Val Asp Asn 85 90 95Met Ile Ala Asp Leu Leu Val Asp Met Leu Gly Val Leu Ala Ser Tyr 100 105 110Asn Leu Thr Val Arg Glu Leu Lys Leu Phe Phe Ser Lys Leu Gln Gly 115 120 125Asp Lys Gly Arg Trp Pro Pro His Ala Gly Lys Leu Leu Ser Val Leu 130 135 140Lys His Met Pro Gln Lys Tyr Gly Pro Asp Ala Phe Phe Asn Phe Pro145 150 155 160Gly Lys Ser Ala Ala Ala Ile Ala Leu Pro Pro Ile Ala Lys Trp Pro 165 170 175Tyr Gln Asn Gly Phe Thr Phe His Thr Trp Leu Arg Met Asp Pro Val 180 185 190Asn Asn Ile Asn Val Asp Lys Asp Lys Pro Tyr Leu Tyr Cys Phe Arg 195 200 205Thr Ser Lys Gly Leu Gly Tyr Ser Ala His Phe Val Gly Gly Cys Leu 210 215 220Ile Val Thr Ser Ile Lys Ser Lys Gly Lys Gly Phe Gln His Cys Val225 230 235 240Lys Phe Asp Phe Lys Pro Gln Lys Trp Tyr Met Val Thr Ile Val His 245 250 255Ile Tyr Asn Arg Trp Lys Asn Ser Glu Leu Arg Cys Tyr Val Asn Gly 260 265 270Glu Leu Ala Ser Tyr Gly Glu Ile Thr Trp Phe Val Asn Thr Ser Asp 275 280 285Thr Phe Asp Lys Cys Phe Leu Gly Ser Ser Glu Thr Ala Asp Ala Asn 290 295 300Arg Val Phe Cys Gly Gln Met Thr Ala Val Tyr Leu Phe Ser Glu Ala305 310 315 320Leu Asn Ala Ala Gln Ile Phe Ala Ile Tyr Gln Leu Gly Leu Gly Tyr 325 330 335Lys Gly Thr Phe Lys 34027206PRTDrosophila melanogaster 27Leu Leu Phe Asn Ile Ala Leu Val Val Lys Phe Glu Leu Leu Leu Ile1 5 10 15Ala Phe Arg Ser His Phe Arg Phe Arg Phe Thr Phe Val Gln Ala Met 20 25 30Val Leu Pro Pro Leu Ala Lys Trp Pro Tyr Glu Asn Gly Phe Thr Phe 35 40 45Thr Thr Trp Cys Arg Leu Asp Pro Ile Asn Ser Val Asn Ile Glu Arg 50 55 60Glu Lys Pro Tyr Leu Tyr Ser Phe Lys Thr Ser Lys Gly Val Gly Tyr65 70 75 80Thr Ala His Phe Val Gly Asn Cys Leu Val Leu Thr Ser Met Lys Val 85 90 95Lys Gly Lys Gly Phe Gln His Cys Val Lys Tyr Glu Phe Gln Pro Pro 100 105 110Lys Trp Tyr Met Ile Ala Ile Val Tyr Ile Tyr Asn Arg Trp Thr Lys 115 120 125Ser Glu Ile Lys Cys Leu Val Asn Gly Gln Leu Ala Ser Ser Thr Glu 130 135 140Met Ala Trp Phe Val Ser Thr Asn Asp Pro Phe Asp Lys Cys Tyr Ile145 150 155 160Gly Ala Thr Pro Glu Leu Asp Glu Glu Arg Val Phe Cys Gly Gln Met 165 170 175Ser Ala Ile Tyr Leu Phe Ser Glu Ala Leu Thr Thr Gln Gln Ile Cys 180 185 190Ala Met His Arg Leu Gly Pro Gly Tyr Lys Ser Gln Phe Arg 195 200 20528333PRTCaenorhabditis elegans 28Val Val Asp Asn Leu Phe Asn Leu Leu Val Gly Gly His Phe Asp Gln1 5 10 15Glu Ser Lys Phe Val Ile Glu Asp Ala Ala Asn Val Asp His Met Leu 20 25 30Thr Leu Leu Ser His Cys Asp Tyr Asp Leu Gln Asn Glu Ile Trp Ser 35 40 45Leu Phe Leu Ala Val Met Lys Lys Ser Asn Arg Asn Leu Glu Ala Cys 50 55

60Thr Arg Val Gly Leu Ile Ser Lys Thr Gln Leu Phe Phe Arg Val Leu65 70 75 80Asp Ile Leu Pro Glu Ala Pro Pro Leu Leu Ala Asp Leu Leu Val Gln 85 90 95Ile Ile Ala Ala Leu Val Ala Tyr Ser Ile Asn Val Lys Gln Thr Lys 100 105 110His Leu Leu Arg Ala Leu Lys Ser Thr Lys Glu Gln Trp Pro Pro Asn 115 120 125Ser Leu Lys Leu Leu His Val Leu Lys Glu Met Pro Gln His Asp Ser 130 135 140Ala Asp Val Phe Phe Ser Phe Pro Gly Lys Asp Gln Ser Gly Ile Ile145 150 155 160Leu Pro Pro Ile Lys Thr Met Pro Tyr Gln Gln Gly Trp Thr Phe Ala 165 170 175Thr Trp Leu Arg Met Glu Pro Leu Asn Ser Val Thr Phe Glu Lys Glu 180 185 190Gln Pro Val Leu Tyr Ser Phe Arg Thr Ser Lys Gly Val Gly Tyr Ser 195 200 205Cys His Phe Thr Gly Asn Cys Leu Val Val Asn Val Glu Lys Thr Lys 210 215 220Gly Lys Glu Gln Ser Arg Cys Val Arg Ala Glu Leu Gly Ala Arg Lys225 230 235 240Trp His His Ile Ala Ile Ala His Cys Tyr Ser Arg Trp Gly Arg Ser 245 250 255Asp Ile Lys Cys Phe Ile Asp Gly Gln Leu Ala Glu Thr Ile Glu Leu 260 265 270Ser Trp Val Val Thr Ser Ala Thr Asn Trp Asp Arg Cys Ser Ile Gly 275 280 285Val Ser Ala Asp Gly Thr Ala Asn Ser Ala Phe Cys Gly Gln Met Gly 290 295 300Ala Met Tyr Leu Phe Ala Glu Ala Leu Thr Leu Gln Gln Ala Asn Ser305 310 315 320Leu Phe Cys Leu Gly Pro Val Tyr Gln Ser Thr Phe Lys 325 33029328PRTArabidopsis thaliana 29Ile Leu Pro Ser Cys Thr Arg Asn Arg Ala Met Cys Ser Thr Ala Gly1 5 10 15Leu Leu Gly Val Leu Leu Arg Ser Val Glu Ala Ile Thr Ser Lys Asp 20 25 30Val Asp Met Lys Trp Asn Ala Ala Ala Ile Leu Leu Leu Cys Ile Gln 35 40 45His Leu Ala Gly His Ser Leu Ser Val Asp Asp Leu His Arg Trp Leu 50 55 60Gln Val Ile Lys Ala Ala Ile Thr Thr Ala Trp Ser Ser Pro Leu Met65 70 75 80Leu Ala Leu Glu Lys Ala Met Ser Gly Lys Glu Ser Arg Gly Pro Ala 85 90 95Cys Thr Phe Glu Phe Asp Gly Glu Ser Ser Gly Leu Leu Gly Pro Gly 100 105 110Glu Ser Arg Trp Pro Phe Thr Asn Gly Tyr Ala Phe Ala Thr Trp Ile 115 120 125Tyr Ile Glu Ser Phe Ala Asp Thr Leu Asn Ala Ala Thr Ala Ala Ala 130 135 140Ala Ile Ala Ala Ala Ala Ala Ala Lys Ser Gly Lys Thr Ser Ala Met145 150 155 160Ser Ala Ala Ala Ala Ala Ser Ala Leu Ala Gly Glu Gly Thr Ala His 165 170 175Met Pro Arg Leu Phe Ser Phe Leu Ser Ala Asp Asn Gln Gly Ile Glu 180 185 190Ala Tyr Phe His Ala Gln Phe Leu Val Val Glu Ser Gly Ser Gly Lys 195 200 205Gly Arg Lys Ser Ser Leu His Phe Thr His Ala Phe Lys Pro Gln Cys 210 215 220Trp Tyr Phe Ile Gly Leu Glu His Ser Cys Lys Gln Gly Leu Leu Gly225 230 235 240Lys Ala Glu Ser Glu Leu Arg Leu Tyr Ile Asp Gly Ser Leu Tyr Glu 245 250 255Ser Arg Pro Phe Asp Phe Pro Arg Ile Ser Lys Pro Leu Ser Phe Cys 260 265 270Cys Ile Gly Thr Asn Pro Pro Pro Thr Met Ala Gly Leu Gln Arg Arg 275 280 285Arg Arg Cys Cys Pro Leu Phe Ala Glu Met Gly Pro Val Tyr Ile Phe 290 295 300Lys Glu Pro Ile Gly Pro Glu Arg Met Ala Arg Leu Ala Ser Arg Gly305 310 315 320Gly Asp Val Leu Pro Cys Phe Gly 32530373PRTDictyostelium discoideum 30Ile Met Thr Gly Val Leu Gly Thr Glu Phe Ser Lys Ser Val Val Asp1 5 10 15Phe Ile Phe Asp Met Val Thr Glu Asn Leu Asn Ala Ser Asp Gln Ile 20 25 30Ser Asn Gln Met Ile Ile Asn Asn Val Glu Ser Phe Asn Val Ile Leu 35 40 45Asp Ile Ile Pro His Ile Glu Asn Lys Asp Phe Arg Leu Gln Ile Ile 50 55 60Ser Arg Ile Asn Lys Met Ala Glu Tyr Gly Arg Tyr Asn Gln Glu Ala65 70 75 80Leu Ser Lys Leu Ser Ile Pro Ile Trp Ile Leu Ser Arg Phe Pro Ser 85 90 95Asn Leu Ser Asn Ala Asn Asp Pro Leu Gln Pro Leu Leu Leu Ser Leu 100 105 110Ile Gln Thr Val Gly Ala Asn Cys Leu Ser Gly Ser Glu Leu Arg Gln 115 120 125Phe Val Lys Leu Leu Gln Pro Glu His Ser Pro Glu Val Leu Leu Lys 130 135 140Ile Leu Ser Ser Met Ala Lys Ser Pro Pro Thr Pro Pro Tyr Phe Glu145 150 155 160Phe Asn Leu Ser Lys Ile Pro Phe Gly Tyr Ile Arg Val Pro Ile Thr 165 170 175Glu Arg Ala Trp Pro Pro Thr Asn Gly Tyr Thr Ile Met Phe Trp Leu 180 185 190Tyr Ile Asp Lys Phe Pro Thr Val Asn Asn Asn Asn Asn Asn Asn Asn 195 200 205Ser Ser Asn Asn Ser Asn Asn Ser Asn Asn Ser Asn Asn Asn Asn Asn 210 215 220Asn Asn Asn Asn Asn Asp Gln Ile Asp Leu Val His Ile Tyr Ser Asp225 230 235 240Asp Lys Lys Ser Ser Leu Tyr Ile Tyr Leu Lys Asn Gly Ile Ile Thr 245 250 255Val Asn Ile Ile Asn Ser Ser Lys Tyr Val Ile Glu Ile Pro Ser Tyr 260 265 270Lys Phe Val Glu Gly Lys Trp Tyr His Ile Gly Ile Val His Ala Arg 275 280 285Arg Leu Leu Gly Gly Thr Asp Phe Lys Leu Phe Val Asp Gly Phe Leu 290 295 300Lys Tyr Thr Ala Thr Lys Ala Gln Tyr Pro Ala Gln Ile Thr Ser Gly305 310 315 320Ser Met Leu Ile Cys Asp Ile Gly Val Ser Asn Gln Asn Arg Phe Pro 325 330 335Thr Asp Ser Ile Trp Arg Ile Gly Thr Phe Tyr Leu Leu Glu Asp Ser 340 345 350Leu Gly Ala Lys His Ile Asn Thr Ile Tyr Phe Leu Gly Pro Asn Tyr 355 360 365Ala Ser Asn Phe Lys 37031374PRTArabidopsis thaliana 31Thr Ala Leu Ala Thr Ile Pro Glu Asn Glu Asn Thr Thr Phe Val Val1 5 10 15Thr Thr Pro Ser Gly Gln Phe Asn Pro Asp Lys Glu Arg Ile Tyr Asn 20 25 30Ala Gly Ala Val Arg Val Leu Ile Arg Ser Leu Leu Leu Phe Ser Pro 35 40 45Lys Met Gln Leu Glu Phe Leu Arg Leu Leu Glu Ser Leu Ala Arg Ala 50 55 60Ser Pro Phe Asn Gln Glu Asn Leu Thr Ser Ile Gly Cys Val Glu Leu65 70 75 80Leu Leu Glu Ile Ile Tyr Pro Phe Leu Ala Gly Ser Ser Pro Phe Leu 85 90 95Ser Tyr Ala Leu Lys Ile Val Glu Ile Leu Gly Ala Tyr Arg Leu Ser 100 105 110Pro Ser Glu Leu Arg Met Leu Phe Arg Tyr Val Leu Gln Met Arg Ile 115 120 125Met Asn Ser Gly His Ala Ile Val Gly Met Met Glu Lys Leu Ile Leu 130 135 140Met Glu Asp Thr Ala Leu Glu His Leu Ser Leu Ala Pro Phe Val Glu145 150 155 160Leu Asp Met Ser Lys Thr Gly His Ala Ser Val Gln Val Ser Leu Gly 165 170 175Glu Arg Ser Trp Pro Pro Ala Ala Gly Tyr Ser Phe Val Cys Trp Phe 180 185 190Gln Phe Arg Asn Phe Leu Thr Thr Gln Gly Lys Glu Ser Glu Ala Ser 195 200 205Lys Ala Gly Gly Ser Ser Lys Thr Arg Met Thr Ser Ala Gln Gln His 210 215 220Glu Gln Asn Ile Phe Arg Met Phe Ser Val Gly Ala Val Ser Asn Glu225 230 235 240Ser Pro Phe Tyr Ala Glu Leu Tyr Phe Gln Glu Asp Gly Ile Leu Thr 245 250 255Leu Ala Thr Ser Asn Ser His Ser Leu Ser Phe Ser Gly Leu Glu Ile 260 265 270Glu Glu Gly Arg Trp His His Leu Ala Val Val His Ser Lys Pro Asn 275 280 285Ala Leu Ala Gly Leu Phe Gln Ala Ser Val Ala Tyr Val Tyr Leu Asp 290 295 300Gly Lys Leu Arg His Thr Gly Lys Leu Gly Tyr Ser Pro Ser Pro Val305 310 315 320Gly Lys Ser Leu Gln Val Thr Val Gly Thr Pro Ala Thr Cys Ala Arg 325 330 335Val Ser Asp Leu Thr Trp Lys Thr Arg Ser Cys Tyr Leu Phe Glu Glu 340 345 350Val Leu Thr Ser Gly Cys Ile Gly Phe Met Tyr Ile Leu Gly Arg Gly 355 360 365Tyr Lys Gly Leu Phe Gln 370325PRTHomo sapiensMISC_FEATURE(1)..(5)inserted amino acid sequence in human LRBA-g 32Tyr Leu Leu Leu Gln1 533646DNAHomo sapiensmisc_feature(248)..(250)translation initiation codon 33ggggtgagga cgagtccgga gtatctgggg tttggcgttg ttgtcagcct cggggagaga 60gattggacaa atattctcca agaggaggag ggcgacgcca aggactttcc acatcaactg 120ctttggggta tctccacaag ttggaagagg gaccctttcg ttttgcattg cgtgtgttgt 180gctcattacc agtgcagcga ctgccgtccc agggtgactc tgagttgtcc tttatcgtga 240gctagcaatg gctagcgaag acaatcgtgt cccttccccg ccaccaacag gtgatgacgg 300gggaggtgga gggagagaag aaacccctac tgaagggggt gcattgtctc tgaaaccagg 360gctccccatc aggggcatca gaatgaaatt tgccgtgttg accggtttgg ttgaagttgg 420agaagtatcc aatagggata ttgtagaaac tgtctttaac ctgtgagaaa cagaaatttg 480tggtagtaat ataatccata attacttatt tgtgtgtgaa gacacaacat cttttggcag 540aaggaggatt tgaactcctg ttctttagaa tgtgctgtgt tggagtggat gaccaaactt 600ggtaggagga cagtttgatc tggaaatgaa tttcattatc caagaa 6463472PRTHomo sapiens 34Met Ala Ser Glu Asp Asn Arg Val Pro Ser Pro Pro Pro Thr Gly Asp1 5 10 15Asp Gly Gly Gly Gly Gly Arg Glu Glu Thr Pro Thr Glu Gly Gly Ala 20 25 30Leu Ser Leu Lys Pro Gly Leu Pro Ile Arg Gly Ile Arg Met Lys Phe 35 40 45Ala Val Leu Thr Gly Leu Val Glu Val Gly Glu Val Ser Asn Arg Asp 50 55 60Ile Val Glu Thr Val Phe Asn Leu65 70357PRTHomo sapiens 35Met Asn Phe Ile Ile Gln Glu1 5369PRTHomo sapiens 36Leu Val Gly Gly Gln Phe Asp Leu Glu1 5371920DNAHomo sapiensprotein_bind(786)..(793)E2F transcription binding site 37cccggcttct gtccacttct caaggccatc tcaaataact ttttcttcag gaaactattt 60ctcaaaccac tataattttt tcctaagttc tctagaattc ttcctttgtt taatcccact 120ttttgcttca ctttcatttt aggagctagg cgtattttta aaaaggccct ttgacctcaa 180aggatacacg tgggtgaaaa accaccttcc tctaaattta tttttcactc actaggaaga 240atggtttact gttaatagcg ggtggaaaga agggacactg agtatgagga cctatctgta 300ctacctaata taatttatct tttgatctac tctgagaatg acgcgagcct aatcttcaca 360ttggaaaatc acgagaggaa aaaacccttc ggaggtctac aggcacaagg aaccctgtct 420ccacgctgtt tatagcagct gtctcaggaa tcctctgcct agaatgaatg tgggagaggt 480ttcgtggcgc ggcagctgca aagcaaggaa tctttcccat tcctcgtcga ctcggtcccc 540tcccctcccc tcccgaatgg cggcagctgc cgaggtatcc cagtggaaat ctccaagtct 600ccgccgagag cggcgggcgg gcaacagctg aaagcagcca ggggtgggga ctcctcgctc 660ccattgggca gggacagcag cctcactggc tccagcgccg tcacctctct ggctcgtaga 720ggtgcctcag gtgttcttct ccaagtccaa tgagacacct aggcaacgca gcgcgtgttc 780cctccgcgcc aagagaccct acggtaactt aacaacagca ggagcgccaa aatccccgcc 840tcaggacttg gcagaagcac ctcccgaggt ccgagagtgg gagaggggaa agtgtaggcc 900ctcggacgga agggtctctc ctcgccgggc cgggtacaca cctggtgcta ccagagcagc 960gcgcctagtg cagccggaag ccccagccca gcactccggc tggctcgggg cccccttggc 1020tgtccgcgcg tgtaaccgcg cccccggccg cgcgggtggc tccgctttgg cgccctcccc 1080gcccgcgcac tcgcgctcgc gcacgcgcac gccgcgcccg gcagcactcg gcgctgtcat 1140ggcggccggg agcagcttca gtgggcacac gacagccgcg cgacccgtgg cggggcgagc 1200tgtggcagta gcatcctcac cactcgcagc agcctcagcc gcggcgcccg tagcgccagc 1260agcggctgct tttgcaaagg ctgagcgcag gggcggggcg ggccaggaag ccatggagtt 1320ctgtgcagcc gcggactccc ggggagcgga ctagggaaac ttggaggctg cgaccaggtg 1380cactgacctc tctgtcctcc cttctctccc tgcggtggcc gctgggtttc tctggccgct 1440cccctccctt cctgccacca cacacacctc cccacccctt cccgtcgaat ctcaggtgcc 1500tgagagaggt gcttcactcc tcccactggg ccgagcattt agaataatca ccgccccctt 1560cccccgcctt ttcctgccct ggatctccgc cgccacctcg gtctcgctgc tcctgggcgg 1620ggggtgagga cgagtccgga gtatctgggg tttggcgttg ttgtcagcct cggggagaga 1680gattggacaa atattctcca agaggaggag ggcgacgcca aggactttcc acatcaactg 1740ctttggggta tctccacaag ttggaagagg gaccctttcg ttttgcattg cgtgtgttgt 1800gctcattacc agtgcagcga ctgccgtccc agggtgactc tgagttgtcc tttatcgtga 1860gctagcaatg gctagcgaag acaatcgtgt cccttccccg ccaccaacag gtgatgacgg 19203821DNAArtificial Sequencelrba siRNA antisense strand 38uagccaagac cuuugcuggt t 213921DNAArtificial Sequencelrba siRNA (siRNA2) 39gggcacucuu ucugucacct t 214025DNAArtificial Sequencesynthetic oligonucleotide 40agagaagagg agaagatgtg tgatc 254124DNAArtificial Sequencesynthetic oligonucleotide 41ccaggctcca tgcttgtctg tgag 244222DNAArtificial Sequencesynthetic oligonucleotide 42agcaagttca gcctggttaa gt 224321DNAArtificial Sequencesynthetic oligonucleotide 43ttatgagtat ttcttccagg g 214427DNAArtificial Sequencesynthetic oligonucleotide 44actgcagcaa gctcctcctg ttttctc 274523DNAArtificial Sequencesynthetic oligonucleotide 45tgggcgaaga gcggaaacag aac 234626DNAArtificial Sequencesynthetic oligonucleotide 46gagtgatgga tgatgggaca gtggtg 264719DNAArtificial Sequencesynthetic oligonucleotide 47gccacctccg tctcgctgc 194827DNAArtificial Sequencesynthetic oligonucleotide 48gggcactggg gagaatttcg aagtagg 274927DNAArtificial Sequencesynthetic oligonucleotide 49ttcaggcagt tttcaggacc ctccaag 275027DNAArtificial Sequencesynthetic oligonucleotide 50tagtgtctga tgttgaactt cctcctg 275120DNAArtificial Sequencesynthetic oligonucleotide 51ggcacaacct tcctgctcac 205220DNAArtificial Sequencesynthetic oligonucleotide 52cctgtccccc atttgaaccc 205320DNAArtificial Sequencesynthetic oligonucleotide 53acggctgctt ctgcaccttc 205421DNAArtificial Sequencesynthetic oligonucleotide 54ttttgggaca gggcttctct g 215520DNAArtificial Sequencesynthetic oligonucleotide 55ggcacaacct tcctgctcac 205620DNAArtificial Sequencesynthetic oligonucleotide 56gcagatgctc tcctcgctcc 205727DNAArtificial Sequencesynthetic oligonucleotide 57cacacagagc attgtagcaa gctcctc 275819DNAArtificial Sequencesynthetic oligonucleotide 58tgcagacttg aagattccg 195957DNAArtificial Sequencesynthetic oligonucleotide 59aagcagtggt atcaacgcag agtacttttt tttttttttt tttttttttt tttttvn 576026DNAArtificial Sequencesynthetic oligonucleotide 60gagtgatgga tgatgggaca gtagtg 266125DNAArtificial Sequencesynthetic oligonucleotide 61cgagaagatg agaagatgtg tgatc 256218DNAHomo sapiensmisc_feature(1)..(18)Exon 1 5' spice donor 62agtatctggg tgaggaag 186318DNAHomo sapiensmisc_feature(1)..(18)Exon 2 5' spice donor 63tttaacctgg taagtcca 186418DNAHomo sapiensmisc_feature(1)..(18)Exon 3 5' spice donor 64tgatagcagg tatgattt 186518DNAHomo sapiensmisc_feature(1)..(18)Exon 4 5' spice donor 65ggacgatggg taaaaaaa 186617DNAHomo sapiensmisc_feature(1)..(17)Exon 5 5' spice donor 66agtgctgcag taagtaa 176718DNAHomo

sapiensmisc_feature(1)..(18)Exon 6 5' spice donor 67tttgtattgg tatgtatt 186818DNAHomo sapiensmisc_feature(1)..(18)Exon 7 5' spice donor 68ccacaaaagg tacatgat 186918DNAHomo sapiensmisc_feature(1)..(18)Exon 8 5' spice donor 69actagcgatg taagtagt 187018DNAHomo sapiensmisc_feature(1)..(18)Exon 9 5' spice donor 70ggatacaagg tagtttgc 187118DNAHomo sapiensmisc_feature(1)..(18)Exon 10 5' spice donor 71atgctccagg tactaact 187218DNAHomo sapiensmisc_feature(1)..(18)Exon 11 5' spice donor 72gactatatgg tgagtgcc 187318DNAHomo sapiensmisc_feature(1)..(18)Exon 12 5' spice donor 73cttgaaaagg taaagtat 187418DNAHomo sapiensmisc_feature(1)..(18)Exon 13 5' spice donor 74ccagccaagg taatatat 187518DNAHomo sapiensmisc_feature(1)..(18)Exon 14 5' spice donor 75aaggattagg tatataat 187618DNAHomo sapiensmisc_feature(1)..(18)Exon 15 5' spice donor 76gtgatgaagg taggttca 187718DNAHomo sapiensmisc_feature(1)..(18)Exon 16 5' spice donor 77atgcatgagg taatatat 187818DNAHomo sapiensmisc_feature(1)..(18)Exon 17 5' spice donor 78tgggttacgg taagagtt 187918DNAHomo sapiensmisc_feature(1)..(18)Exon 18 5' spice donor 79ggccccaaag taagtatg 188018DNAHomo sapiensmisc_feature(1)..(18)Exon 19 5' spice donor 80ctgtttgagg taggaatg 188118DNAHomo sapiensmisc_feature(1)..(18)Exon 20 5' spice donor 81aaacccctcg tatgtatg 188218DNAHomo sapiensmisc_feature(1)..(18)Exon 21 5' spice donor 82aaacaggagg taagctga 188318DNAHomo sapiensmisc_feature(1)..(18)Exon 22 5' spice donor 83cattcaaagg taagtttc 188418DNAHomo sapiensmisc_feature(1)..(18)Exon 23 5' spice donor 84gtgcttgagg tgatttta 188518DNAHomo sapiensmisc_feature(1)..(18)Exon 24 5' spice donor 85gtggagaagg tttgtcta 188618DNAHomo sapiensmisc_feature(1)..(18)Exon 25 5' spice donor 86tcggctacag taaggact 188718DNAHomo sapiensmisc_feature(1)..(18)Exon 26 5' spice donor 87tccgactagg tgagctgc 188818DNAHomo sapiensmisc_feature(1)..(18)Exon 27 5' spice donor 88gcagcgaagg taagtata 188918DNAHomo sapiensmisc_feature(1)..(18)Exon 28 5' spice donor 89agagacatag taagttac 189018DNAHomo sapiensmisc_feature(1)..(18)Exon 29 5' spice donor 90cactctctgg taagtttg 189118DNAHomo sapiensmisc_feature(1)..(18)Exon 30 5' spice donor 91ttttgacagg tactgata 189218DNAHomo sapiensmisc_feature(1)..(18)Exon 31 5' spice donor 92aatcaccagg tgagttag 189318DNAHomo sapiensmisc_feature(1)..(18)Exon 32 5' spice donor 93aaatatgagg tatttaag 189418DNAHomo sapiensmisc_feature(1)..(18)Exon 33 5' spice donor 94aaggaacaag taagtggt 189518DNAHomo sapiensmisc_feature(1)..(18)Exon 34 5' spice donor 95tgttctcagg tgagtggc 189618DNAHomo sapiensmisc_feature(1)..(18)Exon 35 5' spice donor 96atgaggaagg taatttat 189718DNAHomo sapiensmisc_feature(1)..(18)Exon 36 5' spice donor 97gaatttgagg taggttac 189818DNAHomo sapiensmisc_feature(1)..(18)Exon 37 5' spice donor 98tgcagtgagg taaaggga 189917DNAHomo sapiensmisc_feature(1)..(17)Exon 38 5' spice donor 99tggaacatgg tcagtgg 1710018DNAHomo sapiensmisc_feature(1)..(18)Exon 39 5' spice donor 100acagcaaagg taagcatt 1810118DNAHomo sapiensmisc_feature(1)..(18)Exon 40 5' spice donor 101atcttgccgg taaatttg 1810211DNAHomo sapiensmisc_feature(1)..(11)Exon 41 5' spice donor 102gaccccaagg t 1110318DNAHomo sapiensmisc_feature(1)..(18)Exon 42 5' spice donor 103caaacagagg taatgtgt 1810418DNAHomo sapiensmisc_feature(1)..(18)Exon 43 5' spice donor 104tcaaaccagg tactgttt 1810518DNAHomo sapiensmisc_feature(1)..(18)Exon 44 5' spice donor 105cgatagcagg taacctaa 1810618DNAHomo sapiensmisc_feature(1)..(18)Exon 45 5' spice donor 106ttgtccaagg taatttct 1810718DNAHomo sapiensmisc_feature(1)..(18)Exon 46 5' spice donor 107ctaagaatag taagttca 1810818DNAHomo sapiensmisc_feature(1)..(18)Exon 47 5' spice donor 108gatattaagg tacagaaa 1810918DNAHomo sapiensmisc_feature(1)..(18)Exon 48 5' spice donor 109aacagattgg taagataa 1811018DNAHomo sapiensmisc_feature(1)..(18)Exon 49 5' spice donor 110ttgagagagg taagttat 1811118DNAHomo sapiensmisc_feature(1)..(18)Exon 50 5' spice donor 111atgcaagtgg taagtgct 1811218DNAHomo sapiensmisc_feature(1)..(18)Exon 51 5' spice donor 112accttcctgg taagtaaa 1811318DNAHomo sapiensmisc_feature(1)..(18)Exon 52 5' spice donor 113ctctcatagg tctgtcac 1811418DNAHomo sapiensmisc_feature(1)..(18)Exon 53 5' spice donor 114cagacacagg taattttc 1811518DNAHomo sapiensmisc_feature(1)..(18)Exon 54 5' spice donor 115acccaggcag taagtatg 1811618DNAHomo sapiensmisc_feature(1)..(18)Exon 55 5' spice donor 116gttcacaagg taaacctg 1811718DNAHomo sapiensmisc_feature(1)..(18)Exon 56 5' spice donor 117aacataagag tgagtgcc 1811818DNAHomo sapiensmisc_feature(1)..(18)Exon 57 5' spice donor 118cgaccagagg taacactg 1811918DNAHomo sapiensmisc_feature(1)..(18)Intron 1 3' splice acceptor 119tccaataagg gtttggcg 1812018DNAHomo sapiensmisc_feature(1)..(18)Intron 2 3' splice acceptor 120ccttgtaagt tggtagga 1812118DNAHomo sapiensmisc_feature(1)..(18)Intron 3 3' splice acceptor 121tgtttccaga tcttttgg 1812218DNAHomo sapiensmisc_feature(1)..(18)Intron 4 3' splice acceptor 122tcttcatagc ctccacat 1812318DNAHomo sapiensmisc_feature(1)..(18)Intron 5 3' splice acceptor 123ttcctttagg ctattgca 1812418DNAHomo sapiensmisc_feature(1)..(18)Intron 6 3' splice acceptor 124tctttatagt ttcagaac 1812518DNAHomo sapiensmisc_feature(1)..(18)Intron 7 3' splice acceptor 125cttctgcagt ggtatatg 1812618DNAHomo sapiensmisc_feature(1)..(18)Intron 8 3' splice acceptor 126cttttacaga cctttgac 1812718DNAHomo sapiensmisc_feature(1)..(18)Intron 9 3' splice acceptor 127ttcttagagg gtacattt 1812818DNAHomo sapiensmisc_feature(1)..(18)Intron 10 3' splice acceptor 128tcttacaagg atgtaaag 1812918DNAHomo sapiensmisc_feature(1)..(18)Intron 11 3' splice acceptor 129aaattctagt tcaacctt 1813018DNAHomo sapiensmisc_feature(1)..(18)Intron 12 3' splice acceptor 130tttttgcagt cttccaaa 1813118DNAHomo sapiensmisc_feature(1)..(18)Intron 13 3' splice acceptor 131attctgtagg ttcaactg 1813218DNAHomo sapiensmisc_feature(1)..(18)Intron 14 3' splice acceptor 132ttttaaaaga tggaccgc 1813318DNAHomo sapiensmisc_feature(1)..(18)Intron 15 3' splice acceptor 133tttttgaagg attctgga 1813418DNAHomo sapiensmisc_feature(1)..(18)Intron 16 3' splice acceptor 134tgattatagg atgacaat 1813518DNAHomo sapiensmisc_feature(1)..(18)Intron 17 3' splice acceptor 135ttcattcagt gttatcta 1813618DNAHomo sapiensmisc_feature(1)..(18)Intron 18 3' splice acceptor 136taattgcagg aggaaagc 1813718DNAHomo sapiensmisc_feature(1)..(18)Intron 19 3' splice acceptor 137cttctgtaga ttcttata 1813818DNAHomo sapiensmisc_feature(1)..(18)Intron 20 3' splice acceptor 138agattacaga gatactaa 1813918DNAHomo sapiensmisc_feature(1)..(18)Intron 21 3' splice acceptor 139aattttcagg agcttgct 1814018DNAHomo sapiensmisc_feature(1)..(18)Intron 22 3' splice acceptor 140ttcacctagg tcactttt 1814118DNAHomo sapiensmisc_feature(1)..(18)Intron 23 3' splice acceptor 141tgtattaaga tatcaagg 1814218DNAHomo sapiensmisc_feature(1)..(18)Intron 24 3' splice acceptor 142tttggacagc cattcaac 1814318DNAHomo sapiensmisc_feature(1)..(18)Intron 25 3' splice acceptor 143tctttacagc atgaactg 1814418DNAHomo sapiensmisc_feature(1)..(18)Intron 26 3' splice acceptor 144aaattacagt ttgtgcag 1814518DNAHomo sapiensmisc_feature(1)..(18)Intron 27 3' splice acceptor 145cttaaataga gcccagtg 1814618DNAHomo sapiensmisc_feature(1)..(18)Intron 28 3' splice acceptor 146ttttcccagg aggatagc 1814718DNAHomo sapiensmisc_feature(1)..(18)Intron 29 3' splice acceptor 147atgatataga aatcacac 1814818DNAHomo sapiensmisc_feature(1)..(18)Intron 30 3' splice acceptor 148ttattacaga agtgtcat 1814918DNAHomo sapiensmisc_feature(1)..(18)Intron 31 3' splice acceptor 149cttttatagg cagtagat 1815018DNAHomo sapiensmisc_feature(1)..(18)Intron 32 3' splice acceptor 150tttccttagt attacaga 1815118DNAHomo sapiensmisc_feature(1)..(18)Intron 33 3' splice acceptor 151ttaaaatagg tctggttt 1815218DNAHomo sapiensmisc_feature(1)..(18)Intron 34 3' splice acceptor 152tttttatagg agtggcaa 1815318DNAHomo sapiensmisc_feature(1)..(18)Intron 35 3' splice acceptor 153ttcttacagg ttgcttag 1815418DNAHomo sapiensmisc_feature(1)..(18)Intron 36 3' splice acceptor 154ctctccaagt cactgtgt 1815517DNAHomo sapiensmisc_feature(1)..(17)Intron 37 3' splice acceptor 155cattgtagtc gtcctct 1715618DNAHomo sapiensmisc_feature(1)..(18)Intron 38 3' splice acceptor 156atgttttagt gtgcattt 1815718DNAHomo sapiensmisc_feature(1)..(18)Intron 39 3' splice acceptor 157tcatttcagc cacagatg 1815818DNAHomo sapiensmisc_feature(1)..(18)Intron 40 3' splice acceptor 158ttttggcagg tcctgtta 1815918DNAHomo sapiensmisc_feature(1)..(18)Intron 41 3' splice acceptor 159cctcattaga tcttggca 1816018DNAHomo sapiensmisc_feature(1)..(18)Intron 42 3' splice acceptor 160ctgttgtagt tgctgtga 1816118DNAHomo sapiensmisc_feature(1)..(18)Intron 43 3' splice acceptor 161ttcttgcaga cgtatttc 1816218DNAHomo sapiensmisc_feature(1)..(18)Intron 44 3' splice acceptor 162ccctatcagg acggagtt 1816318DNAHomo sapiensmisc_feature(1)..(18)Intron 45 3' splice acceptor 163tattggcagc caatagga 1816418DNAHomo sapiensmisc_feature(1)..(18)Intron 46 3' splice acceptor 164attttttagg aacccttt 1816518DNAHomo sapiensmisc_feature(1)..(18)Intron 47 3' splice acceptor 165tttatatagg agttgatc 1816618DNAHomo sapiensmisc_feature(1)..(18)Intron 48 3' splice acceptor 166ttttttcagg ccctggag 1816718DNAHomo sapiensmisc_feature(1)..(18)Intron 49 3' splice acceptor 167ccttttcagg ctgttgaa 1816818DNAHomo sapiensmisc_feature(1)..(18)Intron 50 3' splice acceptor 168ctcctgcaga gtccattg 1816918DNAHomo sapiensmisc_feature(1)..(18)Intron 51 3' splice acceptor 169gaattccagc tcatcaag 1817018DNAHomo sapiensmisc_feature(1)..(18)Intron 52 3' splice acceptor 170ttcttacagc cagcaata 1817118DNAHomo sapiensmisc_feature(1)..(18)Intron 53 3' splice acceptor 171gcattacagg aagattga 1817218DNAHomo sapiensmisc_feature(1)..(18)Intron 54 3' splice acceptor 172ttcctaaagg tgagactg 1817318DNAHomo sapiensmisc_feature(1)..(18)Intron 55 3' splice acceptor 173tcttctcaga aggaccat 1817418DNAHomo sapiensmisc_feature(1)..(18)Intron 56 3' splice acceptor 174gtctcacagg ccatccag 1817518DNAHomo sapiensmisc_feature(1)..(18)Intron 57 3' splice acceptor 175ttctcctagg tgcatcat 181768PRTArtificial Sequencep21 RAS motif 176Leu Leu Gly Val Gly Gly Phe Asp1 517719RNAArtificial Sequencelrba siRNA (siRNA1) 177ccagcaaagg ucuuggcua 1917819RNAArtificial Sequencelrba siRNA 178cagucggguu ugcgacugg 1917919RNAArtificial Sequencelrba siRNA antisense strand 179uagccaagac cuuugcugg 1918019RNAArtificial Sequencelrba siRNA (siRNA2) 180gggcacucuu ucugucacc 19181165RNAHomo sapiens 181ugagaaacag aaauuugugg uaguaauaua auccauaauu acuuauuugu gugugaagac 60acaacaucuu uuggcagaag gaggauuuga acuccuguuc uuuagaaugu gcuguguugg 120aguggaugac caaacuuggu aggaggacag uuugaucugg aaaug 1651822818PRTHomo sapiens 182Met Ala Ser Glu Asp Asn Arg Val Pro Ser Pro Pro Pro Thr Gly Asp1 5 10 15Asp Gly Gly Gly Gly Gly Arg Glu Glu Thr Pro Thr Glu Gly Gly Ala 20 25 30Leu Ser Leu Lys Pro Gly Leu Pro Ile Arg Gly Ile Arg Met Lys Phe 35 40 45Ala Val Leu Thr Gly Leu Val Glu Val Gly Glu Val Ser Asn Arg Asp 50 55 60Ile Val Glu Thr Val Phe Asn Leu Leu Val Gly Gly Gln Phe Asp Leu65 70 75 80Glu Met Asn Phe Ile Ile Gln Glu Gly Glu Ser Ile Asn Cys Met Val 85 90 95Asp Leu Leu Glu Lys Cys Asp Ile Thr Cys Gln Ala Glu Val Trp Ser 100 105 110Met Phe Thr Ala Ile Leu Lys Lys Ser Ile Arg Asn Leu Gln Val Cys 115 120 125Thr Glu Val Gly Leu Val Glu Lys Val Leu Gly Lys Ile Glu Lys Val 130 135 140Asp Asn Met Ile Ala Asp Leu Leu Val Asp Met Leu Gly Val Leu Ala145 150 155 160Ser Tyr Asn Leu Thr Val Arg Glu Leu Lys Leu Phe Phe Ser Lys Leu 165 170 175Gln Gly Asp Lys Gly Arg Trp Pro Pro His Ala Gly Lys Leu Leu Ser 180 185 190Val Leu Lys His Met Pro Gln Lys Tyr Gly Pro Asp Ala Phe Phe Asn 195 200 205Phe Pro Gly Lys

Ser Ala Ala Ala Ile Ala Leu Pro Pro Ile Ala Lys 210 215 220Trp Pro Tyr Gln Asn Gly Phe Thr Phe His Thr Trp Leu Arg Met Asp225 230 235 240Pro Val Asn Asn Ile Asn Val Asp Lys Asp Lys Pro Tyr Leu Tyr Cys 245 250 255Phe Arg Thr Ser Lys Gly Leu Gly Tyr Ser Ala His Phe Val Gly Gly 260 265 270Cys Leu Ile Val Thr Ser Ile Lys Ser Lys Gly Lys Gly Phe Gln His 275 280 285Cys Val Lys Phe Asp Phe Lys Pro Gln Lys Trp Tyr Met Val Thr Ile 290 295 300Val His Ile Tyr Asn Arg Trp Lys Asn Ser Glu Leu Arg Cys Tyr Val305 310 315 320Asn Gly Glu Leu Ala Ser Tyr Gly Glu Ile Thr Trp Phe Val Asn Thr 325 330 335Ser Asp Thr Phe Asp Lys Cys Phe Leu Gly Ser Ser Glu Thr Ala Asp 340 345 350Ala Asn Arg Val Phe Cys Gly Gln Met Thr Ala Val Tyr Leu Phe Ser 355 360 365Glu Ala Leu Asn Ala Ala Gln Ile Phe Ala Ile Tyr Gln Leu Gly Leu 370 375 380Gly Tyr Lys Gly Thr Phe Lys Phe Lys Ala Glu Ser Asp Leu Phe Leu385 390 395 400Ala Glu His His Lys Leu Leu Leu Tyr Asp Gly Lys Leu Ser Ser Ala 405 410 415Ile Ala Phe Thr Tyr Asn Pro Arg Ala Thr Asp Ala Gln Leu Cys Leu 420 425 430Glu Ser Ser Pro Lys Asp Asn Pro Ser Ile Phe Val His Ser Pro His 435 440 445Ala Leu Met Leu Gln Asp Val Lys Ala Val Leu Thr His Ser Ile Gln 450 455 460Ser Ala Met His Ser Ile Gly Gly Val Gln Val Leu Phe Pro Leu Phe465 470 475 480Ala Gln Leu Asp Tyr Arg Gln Tyr Leu Ser Asp Glu Ile Asp Leu Thr 485 490 495Ile Cys Ser Thr Leu Leu Ala Phe Ile Met Glu Leu Leu Lys Asn Ser 500 505 510Ile Ala Met Gln Glu Gln Met Leu Ala Cys Lys Gly Phe Leu Val Ile 515 520 525Gly Tyr Ser Leu Glu Lys Ser Ser Lys Ser His Val Ser Arg Ala Val 530 535 540Leu Glu Leu Cys Leu Ala Phe Ser Lys Tyr Leu Ser Asn Leu Gln Asn545 550 555 560Gly Met Pro Leu Leu Lys Gln Leu Cys Asp His Val Leu Leu Asn Pro 565 570 575Ala Ile Trp Ile His Thr Pro Ala Lys Val Gln Leu Met Leu Tyr Thr 580 585 590Tyr Leu Ser Thr Glu Phe Ile Gly Thr Val Asn Ile Tyr Asn Thr Ile 595 600 605Arg Arg Val Gly Thr Val Leu Leu Ile Met His Thr Leu Lys Tyr Tyr 610 615 620Tyr Trp Ala Val Asn Pro Gln Asp Arg Ser Gly Ile Thr Pro Lys Gly625 630 635 640Leu Asp Gly Pro Arg Pro Asn Gln Lys Glu Met Leu Ser Leu Arg Ala 645 650 655Phe Leu Leu Met Phe Ile Lys Gln Leu Val Met Lys Asp Ser Gly Val 660 665 670Lys Glu Asp Glu Leu Gln Ala Ile Leu Asn Tyr Leu Leu Thr Met His 675 680 685Glu Asp Asp Asn Leu Met Asp Val Leu Gln Leu Leu Val Ala Leu Met 690 695 700Ser Glu His Pro Asn Ser Met Ile Pro Ala Phe Asp Gln Arg Asn Gly705 710 715 720Leu Arg Val Ile Tyr Lys Leu Leu Ala Ser Lys Ser Glu Gly Ile Arg 725 730 735Val Gln Ala Leu Lys Ala Met Gly Tyr Phe Leu Lys His Arg Pro Pro 740 745 750Lys Arg Lys Ala Glu Val Met Leu Gly His Gly Leu Phe Ser Leu Leu 755 760 765Ala Glu Arg Leu Met Leu Gln Thr Asn Leu Ile Thr Met Thr Thr Tyr 770 775 780Asn Val Leu Phe Glu Ile Leu Ile Glu Gln Ile Gly Thr Gln Val Ile785 790 795 800His Lys Gln His Pro Asp Pro Asp Ser Ser Val Lys Ile Gln Asn Pro 805 810 815Gln Ile Leu Lys Val Ile Ala Thr Leu Leu Arg Asn Ser Pro Gln Cys 820 825 830Pro Glu Ser Met Glu Val Arg Arg Ala Phe Leu Ser Asp Met Ile Lys 835 840 845Leu Phe Asn Asn Ser Arg Glu Asn Arg Arg Ser Leu Leu Gln Cys Ser 850 855 860Val Trp Gln Glu Trp Met Leu Ser Leu Cys Tyr Phe Asn Pro Lys Asn865 870 875 880Ser Asp Glu Gln Lys Ile Thr Glu Met Val Tyr Ala Ile Phe Arg Ile 885 890 895Leu Leu Tyr His Ala Val Lys Tyr Glu Trp Gly Gly Trp Arg Val Trp 900 905 910Val Asp Thr Leu Ser Ile Thr His Ser Lys Val Thr Phe Glu Ile His 915 920 925Lys Glu Asn Leu Ala Asn Ile Phe Arg Glu Gln Gln Gly Lys Val Asp 930 935 940Glu Glu Ile Gly Leu Cys Ser Ser Thr Ser Val Gln Ala Ala Ser Gly945 950 955 960Ile Arg Arg Asp Ile Asn Val Ser Val Gly Ser Gln Gln Pro Asp Thr 965 970 975Lys Asp Ser Pro Val Cys Pro His Phe Thr Thr Asn Gly Asn Glu Asn 980 985 990Ser Ser Ile Glu Lys Thr Ser Ser Leu Glu Ser Ala Ser Asn Ile Glu 995 1000 1005Leu Gln Thr Thr Asn Thr Ser Tyr Glu Glu Met Lys Ala Glu Gln 1010 1015 1020Glu Asn Gln Glu Leu Pro Asp Glu Gly Thr Leu Glu Glu Thr Leu 1025 1030 1035Thr Asn Glu Thr Arg Asn Ala Asp Asp Leu Glu Val Ser Ser Asp 1040 1045 1050Ile Ile Glu Ala Val Ala Ile Ser Ser Asn Ser Phe Ile Thr Thr 1055 1060 1065Gly Lys Asp Ser Met Thr Val Ser Glu Val Thr Ala Ser Ile Ser 1070 1075 1080Ser Pro Ser Glu Glu Asp Ala Ser Glu Met Pro Glu Phe Leu Asp 1085 1090 1095 Lys Ser Ile Val Glu Glu Glu Glu Asp Asp Asp Tyr Val Glu Leu 1100 1105 1110Lys Val Glu Gly Ser Pro Thr Glu Glu Ala Asn Leu Pro Thr Glu 1115 1120 1125Leu Gln Asp Asn Ser Leu Ser Pro Ala Ala Ser Glu Ala Gly Glu 1130 1135 1140Lys Leu Asp Met Phe Gly Asn Asp Asp Lys Leu Ile Phe Gln Glu 1145 1150 1155Gly Lys Pro Val Thr Glu Lys Gln Thr Asp Thr Glu Thr Gln Asp 1160 1165 1170Ser Lys Asp Ser Gly Ile Gln Thr Met Thr Ala Ser Gly Ser Ser 1175 1180 1185Ala Met Ser Pro Glu Thr Thr Val Ser Gln Ile Ala Val Glu Ser 1190 1195 1200Asp Leu Gly Gln Met Leu Glu Glu Gly Lys Lys Ala Thr Asn Leu 1205 1210 1215Thr Arg Glu Thr Lys Leu Ile Asn Asp Cys His Gly Ser Val Ser 1220 1225 1230Glu Ala Ser Ser Glu Gln Lys Ile Ala Lys Leu Asp Val Ser Asn 1235 1240 1245Val Ala Thr Asp Thr Glu Arg Leu Glu Leu Lys Ala Ser Pro Asn 1250 1255 1260Val Glu Ala Pro Gln Pro His Arg His Val Leu Glu Ile Ser Arg 1265 1270 1275Gln His Glu Gln Pro Gly Gln Gly Ile Ala Pro Asp Ala Val Asn 1280 1285 1290Gly Gln Arg Arg Asp Ser Arg Ser Thr Val Phe Arg Ile Pro Glu 1295 1300 1305Phe Asn Trp Ser Gln Met His Gln Arg Leu Leu Thr Asp Leu Leu 1310 1315 1320Phe Ser Ile Glu Thr Asp Ile Gln Met Trp Arg Ser His Ser Thr 1325 1330 1335Lys Thr Val Met Asp Phe Val Asn Ser Ser Asp Asn Val Ile Phe 1340 1345 1350Val His Asn Thr Ile His Leu Ile Ser Gln Val Met Asp Asn Met 1355 1360 1365Val Met Ala Cys Gly Gly Ile Leu Pro Leu Leu Ser Ala Ala Thr 1370 1375 1380Ser Ala Thr His Glu Leu Glu Asn Ile Glu Pro Thr Gln Gly Leu 1385 1390 1395Ser Ile Glu Ala Ser Val Thr Phe Leu Gln Arg Leu Ile Ser Leu 1400 1405 1410Val Asp Val Leu Ile Phe Ala Ser Ser Leu Gly Phe Thr Glu Ile 1415 1420 1425Glu Ala Glu Lys Ser Met Ser Ser Gly Gly Ile Leu Arg Gln Cys 1430 1435 1440Leu Arg Leu Val Cys Ala Val Ala Val Arg Asn Cys Leu Glu Cys 1445 1450 1455Gln Gln His Ser Gln Leu Lys Thr Arg Gly Asp Lys Ala Leu Lys 1460 1465 1470Pro Met His Ser Leu Ile Pro Leu Gly Lys Ser Ala Ala Lys Ser 1475 1480 1485Pro Val Asp Ile Val Thr Gly Gly Ile Ser Pro Val Arg Asp Leu 1490 1495 1500Asp Arg Leu Leu Gln Asp Met Asp Ile Asn Arg Leu Arg Ala Val 1505 1510 1515Val Phe Arg Asp Ile Glu Asp Ser Lys Gln Ala Gln Phe Leu Ala 1520 1525 1530Leu Ala Val Val Tyr Phe Ile Ser Val Leu Met Val Ser Lys Tyr 1535 1540 1545Arg Asp Ile Leu Glu Pro Gln Asn Glu Arg His Ser Gln Ser Cys 1550 1555 1560Thr Glu Thr Gly Ser Glu Asn Glu Asn Val Ser Leu Ser Glu Ile 1565 1570 1575Thr Pro Ala Ala Phe Ser Thr Leu Thr Thr Ala Ser Val Glu Glu 1580 1585 1590Ser Glu Ser Thr Ser Ser Ala Arg Arg Arg Asp Ser Gly Ile Gly 1595 1600 1605Glu Glu Thr Ala Thr Gly Leu Gly Ser His Val Glu Val Thr Pro 1610 1615 1620His Thr Ala Pro Pro Gly Val Ser Ala Gly Pro Asp Ala Ile Ser 1625 1630 1635Glu Val Leu Ser Thr Leu Ser Leu Glu Val Asn Lys Ser Pro Glu 1640 1645 1650Thr Lys Asn Asp Arg Gly Asn Asp Leu Asp Thr Lys Ala Thr Pro 1655 1660 1665Ser Val Ser Val Ser Lys Asn Val Asn Val Lys Asp Ile Leu Arg 1670 1675 1680Ser Leu Val Asn Ile Pro Ala Asp Gly Val Thr Val Asp Pro Ala 1685 1690 1695Leu Leu Pro Pro Ala Cys Leu Gly Ala Leu Gly Asp Leu Ser Val 1700 1705 1710Glu Gln Pro Val Gln Phe Arg Ser Phe Asp Arg Ser Val Ile Val 1715 1720 1725Ala Ala Lys Lys Ser Ala Val Ser Pro Ser Thr Phe Asn Thr Ser 1730 1735 1740Ile Pro Thr Asn Ala Val Ser Val Val Ser Ser Val Asp Ser Ala 1745 1750 1755Gln Ala Ser Asp Met Gly Gly Glu Ser Pro Gly Ser Arg Ser Ser 1760 1765 1770Asn Ala Lys Leu Pro Ser Val Pro Thr Val Asp Ser Val Ser Gln 1775 1780 1785Asp Pro Val Ser Asn Met Ser Ile Thr Glu Arg Leu Glu His Ala 1790 1795 1800Leu Glu Lys Ala Ala Pro Leu Leu Arg Glu Ile Phe Val Asp Phe 1805 1810 1815Ala Pro Phe Leu Ser Arg Thr Leu Leu Gly Ser His Gly Gln Glu 1820 1825 1830Leu Leu Ile Glu Gly Thr Ser Leu Val Cys Met Lys Ser Ser Ser 1835 1840 1845Ser Val Val Glu Leu Val Met Leu Leu Cys Ser Gln Glu Trp Gln 1850 1855 1860Asn Ser Ile Gln Lys Asn Ala Gly Leu Ala Phe Ile Glu Leu Val 1865 1870 1875Asn Glu Gly Arg Leu Leu Ser Gln Thr Met Lys Asp His Leu Val 1880 1885 1890Arg Val Ala Asn Glu Ala Glu Phe Ile Leu Ser Arg Gln Arg Ala 1895 1900 1905Glu Asp Ile His Arg His Ala Glu Phe Glu Ser Leu Cys Ala Gln 1910 1915 1920Tyr Ser Ala Asp Lys Arg Glu Asp Glu Lys Met Cys Asp His Leu 1925 1930 1935Ile Arg Ala Ala Lys Tyr Arg Asp His Val Thr Ala Thr Gln Leu 1940 1945 1950Ile Gln Lys Ile Ile Asn Ile Leu Thr Asp Lys His Gly Ala Trp 1955 1960 1965Gly Asn Ser Ala Val Ser Arg Pro Leu Glu Phe Trp Arg Leu Asp 1970 1975 1980Tyr Trp Glu Asp Asp Leu Arg Arg Arg Arg Arg Phe Val Arg Asn 1985 1990 1995Pro Leu Gly Ser Thr His Pro Glu Ala Thr Leu Lys Thr Ala Val 2000 2005 2010Glu His Val Cys Ile Phe Lys Leu Arg Glu Asn Ser Lys Ala Thr 2015 2020 2025Asp Glu Asp Ile Leu Ala Lys Gly Lys Gln Ser Ile Arg Ser Gln 2030 2035 2040Ala Leu Gly Asn Gln Asn Ser Glu Asn Glu Ile Leu Leu Glu Gly 2045 2050 2055Asp Asp Asp Thr Leu Ser Ser Val Asp Glu Lys Asp Leu Glu Asn 2060 2065 2070Leu Ala Gly Pro Val Ser Leu Ser Thr Pro Ala Gln Leu Val Ala 2075 2080 2085Pro Ser Val Val Val Lys Gly Thr Leu Ser Val Thr Ser Ser Glu 2090 2095 2100Leu Tyr Phe Glu Val Asp Glu Glu Asp Pro Asn Phe Lys Lys Ile 2105 2110 2115Asp Pro Lys Ile Leu Ala Tyr Thr Glu Gly Leu His Gly Lys Trp 2120 2125 2130Leu Phe Thr Glu Ile Arg Ser Ile Phe Ser Arg Arg Tyr Leu Leu 2135 2140 2145Gln Asn Thr Ala Leu Glu Ile Phe Met Ala Asn Arg Val Ala Val 2150 2155 2160Met Phe Asn Phe Pro Asp Pro Ala Thr Val Lys Lys Val Val Asn 2165 2170 2175Phe Leu Pro Arg Val Gly Val Gly Thr Ser Phe Gly Leu Pro Gln 2180 2185 2190Thr Arg Arg Ile Ser Leu Ala Ser Pro Arg Gln Leu Phe Lys Ala 2195 2200 2205Ser Asn Met Thr Gln Arg Trp Gln His Arg Glu Ile Ser Asn Phe 2210 2215 2220Glu Tyr Leu Met Phe Leu Asn Thr Ile Ala Gly Arg Ser Tyr Asn 2225 2230 2235Asp Leu Asn Gln Tyr Pro Val Phe Pro Trp Val Ile Thr Asn Tyr 2240 2245 2250Glu Ser Glu Glu Leu Asp Leu Thr Leu Pro Thr Asn Phe Arg Asp 2255 2260 2265Leu Ser Lys Pro Ile Gly Ala Leu Asn Pro Lys Arg Ala Ala Phe 2270 2275 2280Phe Ala Glu Arg Tyr Glu Ser Trp Glu Asp Asp Gln Val Pro Lys 2285 2290 2295Phe His Tyr Gly Thr His Tyr Ser Thr Ala Ser Phe Val Leu Ala 2300 2305 2310Trp Leu Leu Arg Ile Glu Pro Phe Thr Thr Tyr Phe Leu Asn Leu 2315 2320 2325Gln Gly Gly Lys Phe Asp His Ala Asp Arg Thr Phe Ser Ser Ile 2330 2335 2340Ser Arg Ala Trp Arg Asn Ser Gln Arg Asp Thr Ser Asp Ile Lys 2345 2350 2355Glu Leu Ile Pro Glu Phe Tyr Tyr Leu Pro Glu Met Phe Val Asn 2360 2365 2370Phe Asn Asn Tyr Asn Leu Gly Val Met Asp Asp Gly Thr Val Val 2375 2380 2385Ser Asp Val Glu Leu Pro Pro Trp Ala Lys Thr Ser Glu Glu Phe 2390 2395 2400Val His Ile Asn Arg Leu Val Arg Ala Leu Glu Ser Glu Phe Val 2405 2410 2415Ser Cys Gln Leu His Gln Trp Ile Asp Leu Ile Phe Gly Tyr Lys 2420 2425 2430Gln Gln Gly Pro Glu Ala Val Arg Ala Leu Asn Val Phe Tyr Tyr 2435 2440 2445Leu Thr Tyr Glu Gly Ala Val Asn Leu Asn Ser Ile Thr Asp Pro 2450 2455 2460Val Leu Arg Glu Ala Val Glu Ala Gln Ile Arg Ser Phe Gly Gln 2465 2470 2475Thr Pro Ser Gln Leu Leu Ile Glu Pro His Pro Pro Arg Gly Ser 2480 2485 2490Ala Met Gln Val Tyr Leu Leu Leu Gln Ser Pro Leu Met Phe Thr 2495 2500 2505Asp Lys Ala Gln Gln Asp Val Ile Met Val Leu Lys Phe Pro Ser 2510 2515 2520Asn Ser Pro Val Thr His Val Ala Ala Asn Thr Gln Pro Gly Leu 2525 2530 2535Ala Thr Pro Ala Val Ile Thr Val Thr Ala Asn Arg Leu Phe Ala 2540 2545 2550Val Asn Lys Trp His Asn Leu Pro Ala His Gln Gly Ala Val Gln 2555 2560 2565Asp Gln Pro Tyr Gln Leu Pro Val Glu Ile Asp Pro Leu Ile Gly 2570 2575 2580Leu Ser Leu Pro Ser Leu Phe Ala Ile His Ala Ser Asn Thr Gly 2585 2590 2595Met His Arg Arg Gln Ile Thr Asp Leu Leu Asp Gln Ser Ile Gln 2600 2605 2610Val His Ser Gln Cys Phe Val Ile Thr Ser Asp Asn Arg Tyr Ile 2615 2620 2625Leu Val Cys Gly Phe Trp Asp Lys Ser Phe Arg Val Tyr Ser Thr 2630 2635 2640Asp Thr Gly Arg Leu Ile Gln Val Val Phe Gly His Trp Asp Val 2645 2650

2655Val Thr Cys Leu Ala Arg Ser Glu Ser Tyr Ile Gly Gly Asn Cys 2660 2665 2670Tyr Ile Leu Ser Gly Ser Arg Asp Ala Thr Leu Leu Leu Trp Tyr 2675 2680 2685Trp Asn Gly Lys Cys Ser Gly Ile Gly Asp Asn Pro Gly Ser Glu 2690 2695 2700Thr Ala Ala Pro Arg Ala Ile Leu Thr Gly His Asp Tyr Glu Val 2705 2710 2715Thr Cys Ala Ala Val Cys Ala Glu Leu Gly Leu Val Leu Ser Gly 2720 2725 2730 Ser Gln Glu Gly Pro Cys Leu Ile His Ser Met Asn Gly Asp Leu 2735 2740 2745Leu Arg Thr Leu Glu Gly Pro Glu Asn Cys Leu Lys Pro Lys Leu 2750 2755 2760 Ile Gln Ala Ser Arg Glu Gly His Cys Val Ile Phe Tyr Glu Asn 2765 2770 2775Gly Leu Phe Cys Thr Phe Ser Val Asn Gly Lys Leu Gln Ala Thr 2780 2785 2790Met Glu Thr Asp Asp Asn Ile Arg Ala Ile Gln Leu Ser Arg Asp 2795 2800 2805Gly Gln Tyr Leu Leu Thr Gly Gly Asp Arg 2810 2815

Claims

1. A method for inhibiting the growth of a tumor in a patient, comprising administering an agent to the patient, wherein the agent suppresses LPS-responsive CHS1/beige-like anchor gene (irba) function in the patient.

2. The method according to claim 1, wherein the agent is a polynucleotide fragment of an lrba gene, or a variant thereof, or a polypeptide fragment of an lrba gene product, or a variant thereof.

3. The method according to claim 1, wherein the agent is a polynucleotide sequence encoding a fragment of the amino acid sequence of SEQ ID NO: 3 or SEQ ID NO: 8, and wherein the amino acid sequence is at least five amino acids in length.

4. The method according to claim 1, wherein the agent is a polynucleotide sequence encoding an lrba BEACH domain of SEQ ID NO: 3 or SEQ ID NO: 8, or a polynucleotide sequence encoding an lrba WD domain of SEQ ID NO: 3 or SEQ ID NO: 8, or a polynucleotide encoding both an lrba BEACH domain and an lrba WD domain of SEQ ID NO: 3 or SEQ ID NO: 8.

5. The method according to claim 1, wherein the agent is a polynucleotide encoding an amino acid sequence selected from the group consisting of:residues 2028 to 2071 of SEQ ID NO: 3, or a fragment thereof;residues 2072 to 2121 of SEQ ID NO: 3, or a fragment thereof;residues 2122 to 2162 of SEQ ID NO: 3, or a fragment thereof;residues 2204 to 2482 of SEQ ID NO: 3, or a fragment thereof;residues 2584 to 2628 of SEQ ID NO: 3, or a fragment thereof;residues 2629 to 2687 of SEQ ID NO: 3, or a fragment thereof;residues 2688 to 2769 of SEQ ID NO: 3, or a fragment thereof;residues 2770 to 2811 of SEQ ID NO: 3, or a fragment thereof;residues 2812 to 2856 of SEQ ID NO: 3, or a fragment thereof;residues 2035 to 2169 of SEQ ID NO: 8, or a fragment thereof;residues 2212 to 2489 of SEQ ID NO: 8, or a fragment thereof;residues 2592 to 2635 of SEQ ID NO: 8, or a fragment thereof;residues 2636 to 2694 of SEQ ID NO: 8, or a fragment thereof;residues 2695 to 2778 of SEQ ID NO: 8, or a fragment thereof;residues 2779 to 2819 of SEQ ID NO: 8, or a fragment thereof; andresidues 2820 to 2863 of SEQ ID NO: 8, or a fragment thereof

6. The method according to claim 3, wherein the polynucleotide sequence is expressed within a tumor cell of the patient.

7. The method according to claim 3, wherein the polynucleotide is contained within a vector, and wherein the vector further comprises a promoter sequence operably linked to the polynucleotide.

8. The method according to claim 3, wherein the polynucleotide is contained within a recombinant cell, wherein said recombinant cell further comprises a promoter sequence operably linked to the polynucleotide.

9. The method according to claim 1, wherein the agent is an antisense oligonucleotide.

10. The method according to claim 1, wherein the agent is administered to a tumor site on the patient.

11. The method according to claim 1, wherein the patient is a mammal.

12. The method according to claim 1, wherein the patient is a human.

13. The method according to claim 1, wherein the patient is suffering from a tumor of a cancer type selected from the group consisting of breast, prostate, melanoma, chronic myelogenous leukemia, cervical cancer, adenocarcinoma, lymphoblastic leukemia, colorectal cancer, and lung carcinoma.

14. An isolated polynucleotide encoding an amino acid sequence selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, and SEQ ID NO: 24, or a fragment or variant thereof, or an isolated polynucleotide that is complementary to any of the foregoing polynucleotides.

15. The polynucleotide of claim 14, wherein said polynucleotide encodes an amino acid sequence selected from the group consisting of:residues 2028 to 2071 of SEQ ID NO: 3, or a fragment thereof;residues 2072 to 2121 of SEQ ID NO: 3, or a fragment thereof;residues 2122 to 2162 of SEQ ID NO. 3, or a fragment thereof;residues 2204 to 2482 of SEQ ID NO: 3, or a fragment thereof;residues 2584 to 2628 of SEQ ID NO: 3, or a fragment thereof;residues 2629 to 2687 of SEQ ID NO: 3, or a fragment thereof;residues 2688 to 2769 of SEQ ID NO: 3, or a fragment thereof;residues 2770 to 2811 of SEQ ID NO: 3, or a fragment thereof;residues 2812 to 2856 of SEQ ID NO: 3, or a fragment thereof;residues 2035 to 2169 of SEQ ID NO: 8, or a fragment thereof;residues 2212 to 2489 of SEQ ID NO: 8, or a fragment thereof;residues 2592 to 2635 of SEQ ID NO: 8, or a fragment thereof;residues 2636 to 2694 of SEQ ID NO: 8, or a fragment thereof;residues 2695 to 2778 of SEQ ID NO: 8, or a fragment thereof;residues 2779 to 2819 of SEQ ID NO: 8, or a fragment thereof; andresidues 2820 to 2863 of SEQ ID NO: 8, or a fragment thereof

16. The polynucleotide of claim 14, wherein said polynucleotide is an lrba gene isoform selected from the group consisting of lrba-.alpha., lrba-.beta., lrba-.epsilon., lrba-.gamma., and lrba-.epsilon..

17. An isolated polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, and SEQ ID NO: 24, or a fragment or variant thereof.

18. The polypeptide of claim 17, wherein said polypeptide comprises an amino acid sequence selected from the group consisting of:residues 2028 to 2071 of SEQ ID NO: 3, or a fragment thereof;residues 2072 to 2121 of SEQ ID NO: 3, or a fragment thereof;residues 2122 to 2162 of SEQ ID NO: 3, or a fragment thereof;residues 2204 to 2482 or SEQ ID NO: 3, or a fragment thereof;residues 2584 to 2628 of SEQ ID NO: 3, or a fragment thereof;residues 2629 to 2687 of SEQ ID NO: 3, or a fragment thereof;residues 2688 to 2769 of SEQ ID NO: 3, or a fragment thereof;residues 2770 to 2811 of SEQ ID NO: 3, or a fragment thereof;residues 2812 to 2856 of SEQ ID NO: 3, or a fragment thereof;residues 2035 to 2169 of SEQ ID NO: 8, or a fragment thereof;residues 2212 to 2489 of SEQ ID NO: 8, or a fragment thereof;residues 2592 to 2635 of SEQ ID NO: 8, or a fragment thereof;residues 2636 to 2694 of SEQ ID NO: 8, or a fragment thereof;residues 2695 to 2778 of SEQ ID NO: 8, or a fragment thereof;residues 2779 to 2819 of SEQ ID NO: 8, or a fragment thereof; andresidues 2820 to 2863 of SEQ ID NO: 8, or a fragment thereof.

19. The polypeptide of claim 17, wherein said polypeptide is encoded by an lrba gene isoform selected from the group consisting of lrba-.alpha., lrba-.beta., lrba-.delta., lrba-.gamma., and lrba-.epsilon..

20. A recombinant host transformed with a polynucleotide encoding an amino acid sequence selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, and SEQ ID NO: 24, or a fragment or variant thereof, wherein said polynucleotide is operatively linked to a promoter sequence.

21. The recombinant host of claim 20, wherein said polynucleotide encodes an amino acid sequence selected from the group consisting of:residues 2028 to 2071 of SEQ ID NO: 3, or a fragment thereof;residues 2072 to 2121 of SEQ ID NO: 3, or a fragment thereof;residues 2122 to 2162 of SEQ ID NO: 3, or a fragment thereof;residues 2204 to 2482 of SEQ ID NO: 3, or a fragment thereof;residues 2584 to 2628 of SEQ ID NO: 3, or a fragment thereof;residues 2629 to 2687 of SEQ ID NO: 3, or a fragment thereof;residues 2688 to 2769 of SEQ ID NO: 3, or a fragment thereof;residues 2770 to 2811 of SEQ ID NO: 3, or a fragment thereof;residues 2812 to 2856 of SEQ ID NO: 3. or a fragment thereof;residues 2035 to 2169 of SEQ ID NO: 8, or a fragment thereof;residues 2212 to 2489 of SEQ ID NO: 8, or a fragment thereof;residues 2592 to 2635 of SEQ ID NO: 8, or a fragment thereof;residues 2636 to 2694 of SEQ ID NO: 8, or a fragment thereof;residues 2695 to 2778 of SEQ ID NO: 8, or a fragment thereof;residues 2779 to 2819 of SEQ ID NO: 8, or a fragment thereof; andresidues 2820 to 2863 of SEQ ID NO: 8, or a fragment thereof.

22. The recombinant host of claim 20, wherein said host is a prokaryotic cell.

23. The recombinant host of claim 20, wherein said host is a eukaryotic cell.

24. A vector comprising a polynucleotide encoding an amino acid sequence selected from the group consisting of SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6. SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, and SEQ ID NO: 24, or a fragment or variant thereof.

25. The vector of claim 24, wherein said vector is an adenovirus.

26. The vector of claim 24, wherein said polynucleotide encodes an amino acid sequence selected from the group consisting of:residues 2028 to 2071 of SEQ ID NO: 3, or a fragment thereof;residues 2072 to 2121 of SEQ ID NO: 3, or a fragment thereof;residues 2122 to 2162 of SEQ ID NO: 3, or a fragment thereof;residues 2204 to 2482 of SEQ ID NO: 3, or a fragment thereof;residues 2584 to 2628 of SEQ ID NO: 3, or a fragment thereof;residues 2629 to 2687 of SEQ ID NO: 3, or a fragment thereof;residues 2688 to 2769 of SEQ ID NO: 3. or a fragment thereof;residues 2770 to 2811 of SEQ ID NO: 3, or a fragment thereof;residues 2812 to 2856 of SEQ ID NO: 3, or a fragment thereof;residues 2035 to 2169 of SEQ ID NO: 8, or a fragment thereof;residues 2212 to 2489 of SEQ ID NO: 8, or a fragment thereof;residues 2592 to 2635 of SEQ ID NO: 8, or a fragment thereof;residues 2636 to 2694 of SEQ ID NO: 8, or a fragment thereof;residues 2695 to 2778 of SEQ ID NO: 8, or a fragment thereof;residues 2779 to 2819 of SEQ ID NO: 8, or a fragment thereof andresidues 2820 to 2863 of SEQ ID NO: 8, or a fragment thereof.

27. The vector of claim 24, wherein said vector further comprises a promoter sequence operatively linked to said polynucleotide.

28. An interfering RNA molecule that suppresses mammalian LPS-responsive CHS1/beige-like anchor gene (lrba) function.

29. The method according to claim 1, wherein the agent is selected from the group consisting of a dominant negative mutant, an interfering RNA molecule, and a peptidomimetic.

30. The method according to claim 29, wherein the dominant negative mutant is a polynucleotide encoding the BEACH domain of SEQ ID NO: 3 or SEQ ID NO: 8, a polynucleotide encoding a WD domain of SEQ ID NO: 3 or SEQ ID NO: 8, or a polynucleotide encoding both the BEACH domain of SEQ ID NO: 3 or SEQ ID NO: 8 and a WD domain of SEQ ID NO: 3 or SEQ ID NO: 8.

31. A method of screening an individual for cancer comprising obtaining a biological sample from the individual and determining the amount of lrba gene expression in the biological sample.

32. The method according to claim 34, further comprising comparing the determined amount of lrba gene expression in the sample with that found in a normal population.

Images