Patents - stay tuned to the technology

Inventors list

Assignees list

Classification tree browser

Top 100 Inventors

Top 100 Assignees

Patent application title: MicroRNA Expression Profiling of Cerebrospinal Fluid

Inventors:  Anna Krichevsky (Brookline, MA, US)  Brit Mollenhauer (Brookline, MA, US)
Assignees:  THE BRIGHAM AND WOMEN'S HOSPITAL, INC.
IPC8 Class: AC40B3004FI
USPC Class: 506 9
Class name: Combinatorial chemistry technology: method, library, apparatus method of screening a library by measuring the ability to specifically bind a target molecule (e.g., antibody-antigen binding, receptor-ligand binding, etc.)
Publication date: 2010-07-01
Patent application number: 20100167948



directed to assay methods in which the levels of certain specific microRNAs are determined in the cerebrospinal fluid of a subject. These methods may be used in the diagnosis or monitoring of neurological diseases, especially brain tumors.

Claims:

1. A method of diagnosing or monitoring a neurological disease in a subject, comprising:a) obtaining a test sample of cerebrospinal fluid (CSF) from said subject;b) assaying said test sample to determine the concentration or amount of one or more microRNAs;c) comparing the concentration or amount determined in step b) with the concentration or amount determined for the same one or more microRNAs in one or more control samples of CSF; andd) concluding that said subject has said neurological disease, or that said neurological disease has progressed or recurred, if the concentration or amount of said microRNA is at least 25% higher or lower in said test sample than in said one or more control samples.

2. The method of claim 1, wherein it is concluded in step d) that said subject has said neurological disease, or that said neurological disease has progressed or recurred, if the concentration or amount of said microRNA is at least 50% higher or lower in said test sample than in said one or more controls samples.

3. (canceled)

4. The method of claim 1, wherein said microRNA is selected from the group consisting of: miR-21; miR-17-5p; miR-18; miR-19; miR-20; miR-92; mir-10a; mir-10b; mir-96; mir-182/182*; mir-183; mir-15a; mir-15b; mir-16; mir-125b; mir-124; mir-1; mir-7; mir-103; mir-134; mir-137; mir-345; mir-200a; mir-330; mir-485-5p; mir-151; mir-22; mir-181; mir-219; mir-30a; mir-128; mir-29a; mir-29b; mir-29c; mir-139; mir-338; mir-324-3p; mir-135; mir-296; mir-467; mir-521; mir-155; mir-26b; mir-132; and mir-212.

5. The assay of claim 1, wherein said microRNA is mir-21or mir-10b and the presence or progression of said neurological disease is based upon the concentration or amount of said microRNA being increased by at least 25% relative to the concentration or amount present in said control sample.

6. The assay of claim 5, wherein said neurological disease is a cancer of the brain.

7. (canceled)

8. The assay of claim 1, wherein said microRNA is mir-125b or mir-124 and the presence or progression of said neurological disease is based upon the concentration or amount of said microRNA being decreased by at least 25% relative to the concentration or amount present in said control sample.

9. The assay of claim 8, wherein said neurological disease is a cancer of the brain.

10. (canceled)

11. The assay of claim 1, wherein said microRNA is mir-30a or mir-26b and the presence or progression of said neurological disease is based upon the concentration or amount of said microRNA being increased by at least 25% relative to the concentration or amount present in said control sample.

12. The assay of claim 11, wherein said neurological disease is Alzheimer's disease.

13. The assay of claim 1, wherein said microRNA is mir-132 or mir-212 and the presence or progression of said neurological disease is based upon the concentration or amount of said microRNA being decreased by at least 25% relative to the concentration or amount present in said control sample.

14. The assay of claim 13, wherein said neurological disease is Alzheimer's disease.

15. The method of claim 1, wherein said method is used to monitor a patient that has been treated for a neurological disease by surgery, radiation or medication and wherein said control sample is a CSF sample taken from said patient at an earlier time.

16-22. (canceled)

23. A microarray useful for diagnosing neurological diseases comprising:a) a solid support comprising a membrane, glass or plastic dish, plate or slide; andb) at least 5 distinct polynucleotides, each of which is attached to said solid support at a separate site and each of which hybridizes under stringent conditions to a different microRNA or complement thereof, wherein said microRNA is selected from the group consisting of: miR-21; miR-17-5p; miR-18; miR-19; miR-20; miR-92; mir-10a; mir10b; mir-96; mir-182/182*; mir-83; mir-15 a; mir-15b; mir-16; mir-125b; mir-124; mir-1; mir-7; mir-103; mir-134; mir-137; mir-345; mir-200a; mir-330; mir-485-5p ; mir-151; mir-22; mir-181; mir-219; mir-30; mir-128; mir-29a; mir-29b; mir-29c; mir-139; mir-338; mir-324-3p; mir-135; mir-296; mir-467; mir-521; mir-155; mir-26b; mir-132; and mir-212.

24. (canceled)

25. The microarray of claim 23, wherein said microarray includes distinct polynucleotides, hybridizing to at least 20 of said microRNAs or complements thereof

26. The microarray of claim 23, wherein said microarray includes distinct polynucleotides, hybridizing to at least 40 of said microRNAs or complements thereof

27. The microarray of claim 23, wherein said microarray includes distinct polynucleotides, hybridizing to 5-45 of said microRNAs or complements thereof.

28. (canceled)

29. The microarray of claim 23, wherein said microarray includes no more than 20 distinct polynucleotides, hybridizing to said microRNAs or complements thereof.

30. The microarray of claim 23, wherein said microRNAs include miR-21 and mir-10b.

31. The microarray of claim 30, wherein said microRNAs include miR-125b and mir-124.

32. An diagnostic assay for cancer of the brain comprising determining the amount or concentration of at least 5 distinct microRNAs in cerebrospinal fluid from a subject by performing a hybridization with the micrarray microarray of claim 23.

Description:

CROSS REFERENCE TO RELATED APPLICATIONS

[0001]The present application claims priority to, and the benefit of, U.S. provisional application 60/924,600, filed on May 22, 2007, the contents of which is hereby incorporated by reference in its entirety.

FIELD OF THE INVENTION

[0003]The present invention is directed to methods for diagnostically evaluating cerebrospinal fluid (CSF) based upon the relative amount of specific microRNAs that are present. These methods can be used in the detection and monitoring of neurological diseases.

BACKGROUND OF THE INVENTION

[0004]MicroRNAs (miRNA) are small, single-stranded nucleic acids that bind to partly complementary sequences in mRNAs and thereby prevent them from being translated into protein. In this manner, miRNAs are believed to play a major role in regulating gene expression (Bartel, Cell 116:281-297 (2004); He, et al., Nat. Rev. Genet. 5:522-531(2004)). It has been found that miRNA levels are often altered in tumor cells and there have been suggestions that such alterations may contribute directly to the formation of some cancers (Meltzer, Nature 435:745-746 (2005)). As a result, there has been a great deal of interest in the diagnostic and therapeutic use of these molecules (see e.g., US 2007/0089196; 2005/0120415; 2005/0227934; 2005/02222067; 2006/0105360; 2006/0200878; 2006/0185025; and 2006/0019286).

[0005]Although, the diagnostic potential miRNA has been suggested, the use of cerebrospinal fluid (CSF) as a source for test samples has been largely overlooked. This is unfortunate since assays of CSF might be of considerable value in the diagnosis and monitoring of neurological diseases and, especially, brain tumors.

SUMMARY OF THE INVENTION

[0006]General Summary

[0007]The present invention is based upon the discovery that some microRNAs are expressed at different levels in the normal and pathological brain and that these differences are reflected in the cerebrospinal fluid (CSF) of patients. These observations provide a basis for the concept that assays of CSF microRNA levels may be used in diagnosing brain diseases and in the post-therapy monitoring of patients. In particular, a comparison can be made between the levels of microRNA in the CSF of a test subject and in that of one or more control subjects. Comparisons can either be made directly or a comparison of the ratio of two microRNAs can be made. In the latter case, one would: a) measure the expression of two microRNAs; b) calculate the ratio of their expression levels; and c) determine the presence or progression of a disease if the ratio exceeds a certain threshold. For example, in the case of brain tumors, a ratio of miR-21 to mir-125b of greater than about 4 is indicative of a high grade glioma. Measurements of microRNA levels may be carried out using singleplex (involving one set of primers) or multiplex (involving more than one set of primers) qRT-PCR as described by, for example, Chen, et al. (Nucleic Acids Res. 33(20):e179 (2005), incorporated herein by reference in its entirety).

[0008]Specific Aspects of the Invention

[0009]In its first aspect, the invention is directed to a method of diagnosing or monitoring a neurological disease in a subject. The term "diagnosing" refers to the detection of disease in an individual that either has not previously had the disease or that has had the disease but who was treated and is believed to be cured. The term "monitoring" refers to tests performed on patients known to have a disease for the purpose of measuring its progress or for measuring the response of a patient to therapy. The method involves obtaining a test sample of cerebrospinal fluid (CSF) from the subject and assaying this sample to determine the concentration or amount of one or more microRNAs. The results obtained are compared with those obtained using control samples of CSF. The control samples may be from subjects known to be free of the disease or they may be from the general population. In cases where the method is being used to monitor a patient who has a disease or to test for the recurrence of a disease, the "control" sample may be test results obtained from the same patient at an earlier time, i.e., the patient may be examined for changes in microRNA levels before and after surgery or treatment.

[0010]It will be understood that it is not absolutely essential that an actual control sample be run at the same time that assays are being performed on a test sample. Once "normal," i.e., control, levels of the microRNAs (or of microRNA ratios) have been established, these levels can provide a basis for comparison without the need to rerun a new control sample with each assay. The comparison between the test and control samples provides a basis for a conclusion as to whether a subject has a neurological disease (in cases where the method is being used diagnostically) or whether the disease is progressing or regressing in response to therapy (in cases where the method is being used for monitoring). In general, the greater the difference between the test sample and the control, the stronger the indication for the presence or progression of disease. At a minimum, a difference of 25% should be seen to conclude that a disease is present or progressing with higher differences (50%, 75%, 100% or more) being more conclusive.

[0011]The specific microRNAs that are tested for in the method discussed above include one or more of the following: miR-21; miR-17-5p; miR-18; miR-19; miR-20; miR-92; mir-10a; mir-10b; mir-96; mir-182/182*; mir-183; mir-15a; mir-15b; mir-16; mir-125b; mir-124; mir-1; mir-7; mir-103; mir-134; mir-137; mir-345; mir-200a; mir-330; mir-485-5p; mir-151; mir-22; mir-181; mir-219; mir-30; mir-128; mir-29a; mir-29b; mir-29c; mir-139; mir-338; mir-324-3p; mir-135; mir-296; mir-467; mir-521; and mir-155. The designations provided are standard in the art and are associated with specific sequences that can be found at the microRNA registry (http://microrna.sanger.ac.uk/sequences/). In all cases, they refer to human sequences as shown in Table 1. In some cases, there are additional family members of these microRNAs that are recognized in the art and which should be considered equivalents of the specific sequences listed herein. Although all sequences are shown as RNA sequences, it will be understood that, when referring to hybridizations or other assays, corresponding DNA sequences can be used as well. For example, RNA sequences may be reverse transcribed and amplified using the polymerase chain reaction (PCR) in order to facilitate detection. In these cases, it will actually be DNA and not RNA that is directly quantitated. It will also be understood that the complement of the reverse transcribed DNA sequences can be analyzed instead of the sequence itself. In this context, the term "complement" refers to an oligonucleotide that has an exactly complementary sequence, i.e. for each adenine there is a thymine, etc. Although assays may be performed for the microRNAs individually, it is generally preferable to assay several microRNAs or to compare the ratio of two of the microRNAs.

[0012]The microRNAs above will be particularly useful in the diagnosis and monitoring of cancers of the brain (e.g., gliomas, meningiomas, medulloblastomas, pituitary tumors, nerve sheath tumors, ependymomas, or CNS lymphomas). The most preferred of these microRNAs are miR-21 (increased levels being indicative of the presence or progression of a glioma) and mir-125b (decreased levels being indicative of the presence or progression of a glioma). The ratio of these two microRNAs may also be used to detect and monitor gliomas with a ratio of miR-21 to mir-125b of 3 or 4 being dispositive. Alternative microRNAs that may be used are mir-10b (increased in glioma) and mir-124 (decreased in glioma).

[0013]Specific neurological diseases that may be tested for using the methods described above include Alzheimer's disease; Huntington's disease; Parkinson's disease; amyotrophic lateral sclerosis; multiple sclerosis; stroke; and brain tumors. Of these, brain tumors are especially preferred with gliomas being the most preferred brain tumor. For Alzheimer's disease, the most preferred diagnostic microRNAs are mir-132 (decreased in AD), mir-212 (decreased in AD), mir-30a (increased in AD) and mir-26b (increased in AD).

[0014]In order to facilitate the testing of multiple microRNAs with the limited amounts of total RNA available from CSF, one of the following methods can be used: 1) multiplex and/or singleplex real-time RT-PCR (reagents available from, e.g., Applied Biosystems and System Biosciences (SBI)); 2) single-molecule detection (Neely, et al., Nat. Methods. 3(1):41-46 (2006); 3) bead-based flow cytometric methods (Lu, et al., Nature 435:7043 (2005); systems or reagents available from Luminex, Austin, Tex.); 4) array-based methods (e.g., Nelson, et al., Nat. Methods 1(2):155-61 (2004); Wu, et al., RNA 13(1): 151-159 (2007), all references being hereby incorporated by reference in their entirety). Microarrays can be prepared in which oligonucleotides having complementary sequences (or oligonucleotides with sequences matching the microRNAs themselves) are immobilized on the surface of a solid support. Materials that can be used as supports include membranes, and plates dishes or slides made of glass or plastic. At least 5 (and preferably, 10, 30 or more) of the microRNAs described above should be recognized by the immobilized oligonucleotides, with each different oligonucleotide occupying a distinct and known position on the support. Microarrays of this type may be made using methodology well known in the art or appropriate microRNA arrays can purchased commercially (e.g., from Ambion (Applied Biosystems), Foster City, Calif., Agilent or Exiqon). MicroRNA can then be isolated from the CSF (e.g., using Ambion's mirVana® miRNA Isolation Kit) of a test subject, amplified using the polymerase chain reaction, and analyzed by hybridizations performed under stringent conditions.

DETAILED DESCRIPTION OF THE INVENTION

[0015]The present invention is based upon the identification of microRNAs that are present in CSF and that can be used to identify patients with neurological diseases. These are shown in Table 1 and are all known in the art. References providing methods that can be used for amplifying and quantitating miRNA sequences include: Chen, et al., (Nucl. Ac. Res. 33(20):e179 (2005); Lao, et al., Biochem. Biophys. Res. Commun. 343(1):85-9 (2006); Lao, et al., Biotechnol. J. 2(1):33-5 (2007); Tang, et al., Nat. Protoc. 1(3):1154-1159 (2006); Neely, et al., Nat. Methods. 3(1):41-6 (2006) all incorporated by reference herein in their entirety).

[0016]Although an increased level of any of these microRNAs in the CSF of a subject is suggestive of the presence of disease, especially a brain tumor, a much better assessment can be made by examining many, preferably all, of the microRNAs. Many United States patents have issued describing techniques that can be used for detecting and quantitating microRNA and which may be used to analyze cerebrospinal fluid. These techniques include the following: detection by quantitative real time reverse transcriptase PCR (qRT-PCR) as described in patents owned by Applied Biosystems (U.S. Pat. Nos. 5,928,907; and 6,015,674), single-molecule detection as described in patents owned by US Genomics (U.S. Pat. Nos. 6,355,420; 6,916,661; and 6,632,526), bead-based assays as described in patents owned by Luminex (e.g., U.S. Pat. No. 6,524,793) and in assays using arrays of nucleic acids as described in patents owned by Ambion, Agilent, and Exiqon (U.S. Pat. Nos. 6,057,134; 6,891,032; 7,122,303; 6,458,583; 6,465,183; 6,461,816; 6,458,583; 7,026,124; 7,052,841; 7,060,809; 6,436,640; and 7,060,809). Other references providing guidance helpful in conducting assays include: patents generally describing techniques for producing microarray plates, slides and related instruments (U.S. Pat. No. 6,902,702; U.S. Pat. No. 6,594,432; U.S. Pat. Nos. 5,622,826; 5,556,752; 6,600,031; 6,576,424; 5,566,495; 6,551,784; and 6,887,655) and for carrying out assays (U.S. Pat. No. 6,902,900; U.S. Pat. No. 6,759,197). All of these patent references are hereby incorporated by reference herein in their entirety.

[0017]When microarray supports are used in assays they may be membranes or glass or plastic plates, slides or dishes having a series of distinct, immobilized oligonucleotides recognizing some or all of the microRNA sequences shown Table 1. The immobilized oligonucleotides must hybridize under stringent conditions to one of the microRNA sequences. The term "stringent conditions" indicates conditions that essentially only permit hybridization to occur with the exact complementary sequence of the immobilized oligonucleotide. In general, these hybridizations are performed in buffers of about neutral pH containing 0.1-0.5 NaCl and at a temperature of between 37-50° C. It is also possible to carry out incubations under conditions of low stringency and then to use high stringency wash conditions to cause the dissociation of hybridized sequences that are not exact matches.

[0018]One way to carry out microarray assays would involve amplifying microRNA in the presence of a detectable label, e.g., a nucleotide bound to a dye or other marker and present in a PCR primer. Thus, a population of labeled cDNAs may be obtained that can be used directly in hybridizations with oligonucleotides immobilized on a microarray plate or slide. After hybridizations are completed, plates may be analyzed using an automated reader to determine the amount of label associated with each immobilized sequence, which, in turn, reflects the abundance of the hybridized sequence in the original microRNA population. Many variations of this basic procedure have been described in the art and are compatible with the present invention.

TABLE-US-00001 TABLE 1 MicroRNA Sequences MicroRNA Sequence SEQ ID NO: miR-21 uagcuuaucagacugauguuga 1 miR-17-5p caaagugcuuacagugcagguagu 2 miR-18b uaaggugcaucuagugcaguua 3 miR-19 ugugcaaaucuaugcaaaacuga 4 miR-20 uaaagugcuuauagugcagguag 5 miR-92 uauugcacuugucccggccug 6 mir-10a uacccuguagauccgaauuugu 7 mir-10b uacccuguagaaccgaauuugu 8 mir-96 uuuggcacuagcacauuuuugc 9 mir-182 uuuggcaaugguagaacucaca 10 mir-182* ugguucuagacuugccaacua 11 mir-183 uauggcacugguagaauucacug 12 mir-15a uagcagcacauaaugguuugug 13 mir-15b uagcagcacaucaugguuuaca 14 mir-16 uagcagcacguaaauauuggcg 15 mir-125b ucccugagacccuaacuuguga 16 mir-124 uuaaggcacgcggugaaugcca 17 mir-1 uggaauguaaagaaguaugua 18 mir-7 uggaagacuagugauuuuguug 19 mir-103 agcagcauuguacagggcuauga 20 mir-134 ugugacugguugaccagaggg 21 mir-137 uauugcuuaagaauacgcguag 22 mir-345 ugcugacuccuaguccagggc 23 mir-200a caucuuaccggacagugcugga 24 mir-330 gcaaagcacacggccugcagaga 25 mir-485-5p agaggcuggccgugaugaauuc 26 mir-151 acuagacugaagcuccuugagg 27 mir-22 aagcugccaguugaagaacugu 28 mir-181 aacauucaacgcugucggugagu 29 mir-219 ugauuguccaaacgcaauucu 30 mir-30a uguaaacauccucgacuggaag 31 mir-128 ucacagugaaccggucucuuuu 32 mir-29a uagcaccaucugaaaucgguu 33 mir-29b uagcaccauuugaaaucaguguu 34 mir-29c uagcaccauuugaaaucggu 35 mir-139 ucuacagugcacgugucu 36 mir-338 uccagcaucagugauuuuguuga 37 mir-324-3p ccacugccccaggugcugcugg 38 mir-135 uauggcuuuuuauuccuauguga 39 mir-296 agggcccccccucaauccugu 40 mir-467 auauacauacacacaccuacac 41 mir-521 aacgcacuucccuuuagagugu 42 mir-155 uuaaugcuaaucgugauagggg 43 mir-26b uucaaguaauucaggauagguu 44 mir-132 uaacagucuacagccauggucg 45 mir-212 uaacagucuccagucacggcc 46

[0019]All references cited herein are fully incorporated by reference in their entirety. Having now fully described the invention, it will be understood by those of skill in the art that the invention may be practiced within a wide and equivalent range of conditions, parameters and the like, without affecting the spirit or scope of the invention or any embodiment thereof.

Sequence CWU 1

46122RNAHomo sapiens 1uagcuuauca gacugauguu ga 22224RNAHomo sapiens 2caaagugcuu acagugcagg uagu 24322RNAHomo sapiens 3uaaggugcau cuagugcagu ua 22423RNAHomo sapiens 4ugugcaaauc uaugcaaaac uga 23523RNAHomo sapiens 5uaaagugcuu auagugcagg uag 23621RNAHomo sapiens 6uauugcacuu gucccggccu g 21722RNAHomo sapiens 7uacccuguag auccgaauuu gu 22822RNAHomo sapiens 8uacccuguag aaccgaauuu gu 22922RNAHomo sapiens 9uuuggcacua gcacauuuuu gc 221022RNAHomo sapiens 10uuuggcaaug guagaacuca ca 221121RNAHomo sapiens 11ugguucuaga cuugccaacu a 211223RNAHomo sapiens 12uauggcacug guagaauuca cug 231322RNAHomo sapiens 13uagcagcaca uaaugguuug ug 221422RNAHomo sapiens 14uagcagcaca ucaugguuua ca 221522RNAHomo sapiens 15uagcagcacg uaaauauugg cg 221622RNAHomo sapiens 16ucccugagac ccuaacuugu ga 221722RNAHomo sapiens 17uuaaggcacg cggugaaugc ca 221821RNAHomo sapiens 18uggaauguaa agaaguaugu a 211922RNAHomo sapiens 19uggaagacua gugauuuugu ug 222023RNAHomo sapiens 20agcagcauug uacagggcua uga 232121RNAHomo sapiens 21ugugacuggu ugaccagagg g 212222RNAHomo sapiens 22uauugcuuaa gaauacgcgu ag 222321RNAHomo sapiens 23ugcugacucc uaguccaggg c 212422RNAHomo sapiens 24caucuuaccg gacagugcug ga 222523RNAHomo sapiens 25gcaaagcaca cggccugcag aga 232622RNAHomo sapiens 26agaggcuggc cgugaugaau uc 222722RNAHomo sapiens 27acuagacuga agcuccuuga gg 222822RNAHomo sapiens 28aagcugccag uugaagaacu gu 222923RNAHomo sapiens 29aacauucaac gcugucggug agu 233021RNAHomo sapiens 30ugauugucca aacgcaauuc u 213122RNAHomo sapiens 31uguaaacauc cucgacugga ag 223222RNAHomo sapiens 32ucacagugaa ccggucucuu uu 223321RNAHomo sapiens 33uagcaccauc ugaaaucggu u 213423RNAHomo sapiens 34uagcaccauu ugaaaucagu guu 233520RNAHomo sapiens 35uagcaccauu ugaaaucggu 203618RNAHomo sapiens 36ucuacagugc acgugucu 183723RNAHomo sapiens 37uccagcauca gugauuuugu uga 233822RNAHomo sapiens 38ccacugcccc aggugcugcu gg 223923RNAHomo sapiens 39uauggcuuuu uauuccuaug uga 234021RNAHomo sapiens 40agggcccccc cucaauccug u 214122RNAHomo sapiens 41auauacauac acacaccuac ac 224222RNAHomo sapiens 42aacgcacuuc ccuuuagagu gu 224322RNAHomo sapiens 43uuaaugcuaa ucgugauagg gg 224422RNAHomo sapiens 44uucaaguaau ucaggauagg uu 224522RNAHomo sapiens 45uaacagucua cagccauggu cg 224621RNAHomo sapiens 46uaacagucuc cagucacggc c 21



Patent applications by THE BRIGHAM AND WOMEN'S HOSPITAL, INC.

Patent applications in class By measuring the ability to specifically bind a target molecule (e.g., antibody-antigen binding, receptor-ligand binding, etc.)

Patent applications in all subclasses By measuring the ability to specifically bind a target molecule (e.g., antibody-antigen binding, receptor-ligand binding, etc.)


User Contributions:

Comment about this patent or add new information about this topic:

CAPTCHA
People who visited this patent also read:
Patent application numberTitle
20100167434METHOD FOR FABRICATING LIGHT EMITTING DIODE CHIP
20100167433PIEZOELECTRIC INKJET PRINTHEAD AND METHOD OF MANUFACTURING THE SAME
20100167432Method of manufacturing semiconductor device
20100167431LASER PROCESSING APPARATUS
20100167430APPARATUS AND METHOD FOR TESTING A TRANSDUCER AND/OR ELECTRONIC CIRCUITRY ASSOCIATED WITH A TRANSDUCER
Images included with this patent application:
MicroRNA Expression Profiling of Cerebrospinal Fluid diagram and imageMicroRNA Expression Profiling of Cerebrospinal Fluid diagram and image
MicroRNA Expression Profiling of Cerebrospinal Fluid diagram and imageMicroRNA Expression Profiling of Cerebrospinal Fluid diagram and image
MicroRNA Expression Profiling of Cerebrospinal Fluid diagram and imageMicroRNA Expression Profiling of Cerebrospinal Fluid diagram and image
MicroRNA Expression Profiling of Cerebrospinal Fluid diagram and imageMicroRNA Expression Profiling of Cerebrospinal Fluid diagram and image
Similar patent applications:
DateTitle
2011-03-03Microarray for expression analysis of cellular glycosylation mechanism
2010-04-29Three frame cdna expression libraries for functional screening of proteins
2011-07-21Microarray for monitoring gene expression in multiple strains of streptococcus pneumoniae
2009-03-26Gene expression profiling from ffpe samples
2010-08-05Gene expression profiling from ffpe samples
New patent applications in this class:
DateTitle
2022-05-05Microfluidic system for amplifying and detecting polynucleotides in parallel
2019-05-16Reagents and methods for detecting protein lysine 2-hydroxyisobutyrylation
2019-05-16Lateral flow analyte detection
2019-05-16Mutations in the bcr-abl tyrosine kinase associated with resistance to sti-571
2019-05-16Enhanced methods of ribonucleic acid hybridization
Top Inventors for class "Combinatorial chemistry technology: method, library, apparatus"
RankInventor's name
1Mehdi Azimi
2Kia Silverbrook
3Geoffrey Richard Facer
4Alireza Moini
5William Marshall
Website © 2025 Advameg, Inc.