Patent application title: IMMUNOSTIMULATORY NUCLEIC ACIDS
Inventors:
Arthur M. Krieg (Wellesley, MA, US)
Christian Schetter (Hilden, DE)
Jörg Vollmer (Dusseldorf, DE)
Jörg Vollmer (Dusseldorf, DE)
Jörg Vollmer (Dusseldorf, DE)
Assignees:
University of Iowa Research Foundation
Coley Pharmaceutical GmbH
IPC8 Class: AA61K317088FI
USPC Class:
4241301
Class name: Drug, bio-affecting and body treating compositions immunoglobulin, antiserum, antibody, or antibody fragment, except conjugate or complex of the same with nonimmunoglobulin material
Publication date: 2009-07-30
Patent application number: 20090191188
Claims:
1. A method of stimulating an immune response comprisingadministering an
immunostimulatory nucleic acid to a non-rodent subject in an amount
effective to induce an immune response in the non-rodent subject, wherein
the immunostimulatory nucleic acid is greater than 60% T, contains a CpG
dinucleotide, and is 8-100 nucleotides in length.
2. (canceled)
3. The method of claim 1, wherein the immunostimulatory nucleic acid is a poly T nucleic acid comprising5'TTTT3'.
4. The method of claim 3, wherein the poly T nucleic acid comprises5'X1X2TTTTX3X43'wherein X1, X2, X3 and X4 are nucleotides.
5. The method of claim 3, wherein the immunostimulatory nucleic acid comprises a plurality of poly T nucleic acid motifs.
6. The method of claim 4, wherein X1X2 is TT.
7. The method of claim 4, wherein X3X4 is TT.
8-14. (canceled)
15. The method of claim 1, wherein the immunostimulatory nucleic acid comprises a nucleotide composition of greater than 80% T.
16-17. (canceled)
18. The method of claim 1, wherein the immunostimulatory nucleic acid has a nucleotide backbone which includes at least one backbone modification.
19. The method of claim 18, wherein the backbone modification is a phosphorothioate modification.
20. The method of claim 18, wherein the nucleotide backbone is chimeric.
21. The method of claim 18, wherein the nucleotide backbone is entirely modified.
22-33. (canceled)
34. The method of claim 1, wherein the immune response is a mucosal immune response.
35. The method of claim 1, wherein the immune response is a systemic immune response.
36. (canceled)
37. The method of claim 1, further comprising exposing the subject to an antigen and wherein the immune response is an antigen-specific immune response.
38-51. (canceled)
52. The method of claim 1, wherein the subject is a human.
53. (canceled)
54. The method of claim 1, further comprising administering an antibody specific for a cell surface antigen, and wherein the immune response results in antigen dependent cellular cytotoxicity (ADCC).
55-75. (canceled)
76. The method of claim 1, wherein the immunostimulatory nucleic acid is administered on a regular basis.
77. The method of claim 1, wherein the immune response is an innate immune response.
78. A composition comprisinga sustained release device including an immunostimulatory nucleic acid, wherein the immunostimulatory nucleic acid is free of unmethylated CpG motifs and is a T-rich nucleic acid.
79. (canceled)
80. A composition of a nutritional supplement comprisingan immunostimulatory nucleic acid in a delivery device selected from the group consisting of a capsule, a pill, and a sublingual tablet, wherein the immunostimulatory nucleic acid is free of unmethylated CpG motifs and is a T-rich nucleic acid.
81. (canceled)
82. A composition comprisingan immunostimulatory nucleic acid and an antigen, wherein the immunostimulatory nucleic acid is free of unmethylated CpG motifs and is a T-rich nucleic acid.
83. A composition comprisingan immunostimulatory nucleic acid and another therapeutic agent selected from the group consisting of: an anti-microbial agent, an anti-cancer agent, an asthma/allergy medicament, wherein the immunostimulatory nucleic acid is free of unmethylated CpG motifs and is a T-rich nucleic acid.
84-94. (canceled)
95. A pharmaceutical composition comprising an effective amount for stimulating an immune response of an isolated the immunostimulatory nucleic acid of claim 1, and a pharmaceutically acceptable carrier.
96. A composition of matter, comprising the immunostimulatory nucleic acid of claim 1, and a pharmaceutically acceptable carrier.
97-101. (canceled)
102. A composition comprisingan immunostimulatory nucleic acid consisting essentially of:5'M1TCGTCGTTM23'wherein at least one of the Cs is unmethylated, wherein M1 is a nucleic acid having at least one nucleotide, wherein M2 is a nucleic acid having between 0 and 50 nucleotides, and wherein the immunostimulatory nucleic acid has less than 100 nucleotides.
103. A pharmaceutical composition comprisingan immunostimulatory nucleic acid comprising:5'TCGTCGTT3'wherein at least one of the Cs is unmethylated, wherein the immunostimulatory nucleic acid has less than 100 nucleotides and a phosphodiester backbone,and a sustained release device.
104-106. (canceled)
Description:
RELATED APPLICATIONS
[0001]This application is a continuation of U.S. patent application Ser. No. 09/669,187 filed Sep. 25, 2000, currently pending, which claims priority under 35 U.S.C. § 119 to U.S. Provisional Patent Application Nos. 60/156,113, filed Sep. 25, 1999, 60/156,135, filed Sep. 27, 1999, and 60/227,436, filed Aug. 23, 2000, the entire contents of all of which are hereby incorporated by reference.
FIELD OF THE INVENTION
[0002]The present invention relates generally to immunostimulatory nucleic acids, compositions thereof and methods of using the immunostimulatory nucleic acids.
BACKGROUND OF THE INVENTION
[0003]Bacterial DNA has immune stimulatory effects to activate B cells and natural killer cells, but vertebrate DNA does not (Tokunaga, T., et al., 1988. Jpn. J. Cancer Res. 79:682-686; Tokunaga, T., et al., 1984, JNCI 72:955-962; Messina, J. P., et al., 1991, J. Immunol. 147:1759-1764; and reviewed in Krieg, 1998, In: Applied Oligonucleotide Technology, C. A. Stein and A. M. Krieg, (Eds.), John Wiley and Sons, Inc., New York, N.Y., pp. 431-448). It is now understood that these immune stimulatory effects of bacterial DNA are a result of the presence of unmethylated CpG dinucleotides in particular base contexts (CpG motifs), which are common in bacterial DNA, but methylated and underrepresented in vertebrate DNA (Krieg et al, 1995 Nature 374:546-549; Krieg, 1999 Biochim. Biophys. Acta 93321:1-10). The immune stimulatory effects of bacterial DNA can be mimicked with synthetic oligodeoxynucleotides (ODN) containing these CpG motifs. Such CpG ODN have highly stimulatory effects on human and murine leukocytes, inducing B cell proliferation; cytokine and immunoglobulin secretion; natural killer (NK) cell lytic activity and IFN-γ secretion; and activation of dendritic cells (DCs) and other antigen presenting cells to express costimulatory molecules and secrete cytokines, especially the Th1-like cytokines that are important in promoting the development of Th1-like T cell responses. These immune stimulatory effects of native phosphodiester backbone CpG ODN are highly CpG specific in that the effects are essentially abolished if the CpG motif is methylated, changed to a GpC, or otherwise eliminated or altered (Krieg et al, 1995 Nature 374:546-549; Hartmann et al, 1999 Proc. Natl. Acad. Sci. USA 96:9305-10). Phosphodiester CpG ODN can be formulated in lipids, alum, or other types of vehicles with depot properties or improved cell uptake in order to enhance the immune stimulatory effects (Yamamoto et al, 1994 Microbiol. Immunol. 38:831-836; Gramzinski et al, 1998 Mol. Med. 4:109-118).
[0004]In early studies, it was thought that the immune stimulatory CpG motif followed the formula purine-purine-CpG-pyrimidine-pyrimidine (Krieg et al, 1995 Nature 374:546-549; Pisetsky, 1996 J. Immunol. 156:421-423; Hacker et al., 1998 EMBO J. 17:6230-6240; Lipford et al, 1998 Trends in Microbiol. 6:496-500). However, it is now clear that mouse lymphocytes respond quite well to phosphodiester CpG motifs that do not follow this "formula" (Yi et al., 1998 J. Immunol. 160:5898-5906) and the same is true of human B cells and dendritic cells (Hartmann et al, 1999 Proc. Natl. Acad. Sci. USA 96:9305-10; Liang, 1996 J. Clin. Invest. 98:1119-1129).
[0005]Several past investigators have looked at whether the nucleotide content of ODN may have effects independently of the sequence of the ODN. Interestingly, antisense ODN have been found to be generally enriched in the content of GG, CCC, CC, CAC, and CG sequences, while having reduced frequency of TT or TCC nucleotide sequences compared to what would be expected if base usage were random (Smetsers et al., 1996 Antisense Nucleic Acid Drug Develop. 6:63-67). This raised the possibility that the over-represented sequences may comprise preferred targeting elements for antisense oligonucleotides or visa versa. One reason to avoid the use of thymidine-rich ODN for antisense experiments is that degradation of the ODN by nucleases present in cells releases free thymidine which competes with 3H-thymidine which is frequently used in experiments to assess cell proliferation (Matson et al., 1992 Antisense Research and Development 2:325-330).
SUMMARY OF THE INVENTION
[0006]The present invention relates in part to pyrimidine rich (Py-rich) and in some embodiments thymidine (T) rich immunostimulatory nucleic acids which do not require the presence of a CpG motif. The present invention also relates in part to the discovery that nucleic acids which contain a TG dinucleotide motif are also immunostimulatory. The invention is based in part on the unexpected finding that nucleic acid sequences which do not contain CpG motifs are immunostimulatory. It was discovered upon analysis of the immune stimulation properties of many nucleic acid sequences that these sequences may be Py-rich e.g., T-rich or that they may contain TG motifs. It was also discovered that these sequences preferentially activate non-rodent immune cells. The Py-rich and TG sequences are only minimally immunostimulatory with respect to rodent immune cells, compared to non-rodent immune cells. Thus, it is possible according to the methods of the invention to induce an immune response in a non-rodent subject by administering Py-rich or TG immunostimulatory nucleic acids. The Py-rich and TG immunostimulatory nucleic acids of the invention may optionally include CpG motifs. These findings have important implications for the clinical development of immunostimulatory CpG containing and non-CpG containing nucleic acids.
[0007]In one aspect the invention is a pharmaceutical composition comprising an effective amount for stimulating an immune response of isolated Py-rich or TG immunostimulatory nucleic acids, and a pharmaceutically acceptable carrier. In other aspects the invention is a composition of matter, comprising an isolated Py-rich or TG immunostimulatory nucleic acid. In other embodiments, the immunostimulatory nucleic acid may be T-rich. In still other embodiments, the immunostimulatory nucleic acid may be T-rich and also have at least one TG motif.
[0008]Preferably the Py-rich nucleic acid is a T-rich nucleic acid. In some embodiments the T-rich immunostimulatory nucleic acid is a poly T nucleic acid comprising 5' TTTT 3'. In yet other embodiments the poly T nucleic acid comprises 5' X1 X2TTTTX3 X4 3' wherein X1, X2, X3 and X4 are nucleotides. In some embodiments X1X2 is TT and/or X3X4 is TT. In other embodiments X1X2 is selected from the group consisting of TA, TG, TC, AT, AA, AG, AC, CT, CC, CA, CG, GT, GG, GA, and GC; and/or X3X4 is selected from the group consisting of TA, TG, TC, AT, AA, AG, AC, CT, CC, CA, CG, GT, GG, GA, and GC.
[0009]The T-rich immunostimulatory nucleic acid may have only a single poly T motif or it may have a plurality of poly T nucleic acid motifs. In some embodiments the T-rich immunostimulatory nucleic acid comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, or at least 8 T motifs. In other embodiments it comprises at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, or at least 8 CpG motifs. In preferred embodiments the plurality of CpG motifs and poly T motifs are interspersed.
[0010]In yet other embodiments at least one of the plurality of poly T motifs comprises at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, or at least 9 contiguous T nucleotide residues. In other embodiments the plurality of poly T motifs is at least 3 motifs and wherein at least 3 motifs each comprises at least 3 contiguous T nucleotide residues or the plurality of poly T motifs is at least 4 motifs and wherein the at least 4 motifs each comprises at least 3 contiguous T nucleotide residues.
[0011]In some cases the T-rich immunostimulatory nucleic acid may be free of poly T motifs but may rather comprise a nucleotide composition of greater than 25% T. In other embodiments the T-rich immunostimulatory nucleic acids have poly T motifs and also comprise a nucleotide composition of greater than 25% T. In preferred embodiments the T-rich immunostimulatory nucleic acid comprises a nucleotide composition of greater than 35% T, greater than 40% T, greater than 50% T, greater than 60% T, greater than 80% T, or greater than 90% T nucleotide residues. In important embodiments, the nucleic acid is at least 50% T.
[0012]The T-rich and TG immunostimulatory nucleic acids can have any length greater than 7 nucleotides, but in some embodiments can be between 8 and 100 nucleotide residues in length. In preferred embodiments the T-rich immunostimulatory nucleic acid comprises at least 20 nucleotides, at least 24 nucleotides, at least 27, nucleotides, or at least 30 nucleotides. In preferred embodiments, the TG immunostimulatory nucleic acid is between 15 and 25 nucleotides in length. The T-rich and TG immunostimulatory nucleic acids may be single stranded or double stranded.
[0013]In one preferred embodiment, the immunostimulatory nucleic acid has a T-rich region located in the middle of its length (i.e., an approximately equal number of nucleotides flank the T-rich region on the 5' and 3' ends).
[0014]The T rich nucleic acid in some embodiments is selected from the group consisting of SEQ ID NO: 59-63, 73-75, 142, 215, 226, 241, 267-269, 282, 301, 304, 330, 342, 358, 370-372, 393, 433, 471, 479, 486, 491, 497, 503, 556-558, 567, 694, 793-794, 797, 833, 852, 861, 867, 868, 882, 886, 905, 907, 908, and 910-913. In other embodiments the T rich nucleic acids are sequence selected from the group consisting of SEQ ID NO: 64, 98, 112, 146, 185, 204, 208, 214, 224, 233, 244, 246, 247, 258, 262, 263, 265, 270-273, 300, 305, 316, 317, 343, 344, 350, 352, 354, 374, 376, 392, 407, 411-413, 429-432, 434, 435, 443, 474, 475, 498-501, 518, 687, 692, 693, 804, 862, 883, 884, 888, 890, and 891.
[0015]In other embodiments the Py-rich immunostimulatory nucleic acid is a C-rich nucleic acid. An immunostimulatory C-rich nucleic acid is a nucleic acid including at least one and preferably at least 2 poly-C regions or which includes 50% or greater C nucleotides.
[0016]The Py-rich and TG immunostimulatory nucleic acids may include one or more CpG motifs. The motifs may be methylated or unmethylated. In other embodiments the Py-rich and TG immunostimulatory nucleic acids are free of one or more CpG dinucleotides.
[0017]In other embodiments the Py-rich and TG immunostimulatory nucleic acids also include poly-A, poly G, and/or poly C motifs. In yet other embodiments the Py-rich or TG immunostimulatory nucleic acid is free of two poly C sequences of at least 3 contiguous C nucleotide residues or is free of two poly A sequences of at least 3 contiguous A nucleotide residues. In other embodiments the Py-rich or TG immunostimulatory nucleic acid comprises a nucleotide composition of greater than 25% C or greater than 25% A. In yet other embodiments the Py-rich or TG immunostimulatory nucleic acid is free of poly-C sequences, poly-G sequences or poly-A sequences.
[0018]A poly G nucleic acid in some embodiments is selected from the group consisting of SEQ ID NO: 5, 6, 73, 215, 267-269, 276, 282, 288, 297-299, 355, 359, 386, 387, 444, 476, 531, 557-559, 733, 768, 795, 796, 914-925, 928-931, 933-936, and 938. In other embodiments the poly G nucleic acid includes a sequence selected from the group consisting of SEQ ID NO: 67, 80-82, 141, 147, 148, 173, 178, 183, 185, 214, 224, 264, 265, 315, 329, 434, 435, 475, 519, 521-524, 526, 527, 535, 554, 565, 609, 628, 660, 661, 662, 725, 767, 825, 856, 857, 876, 892, 909, 926, 927, 932, and 937.
[0019]According to another aspect of the invention, the immunostimulatory nucleic acids may be defined as those which possess a TG motif, herein referred to as TG immunostimulatory nucleic acids. The TG nucleic acid in one embodiment contains at least one TG dinucleotide having a sequence including at least the following formula: 5'N1X1TGX2N23'. In related embodiments, N1 is a nucleic acid sequence composed of a number of nucleotides ranging from (11-N2) to (21-N2) and N2 is a nucleic acid sequence composed of a number of nucleotides ranging from (11-N1) to (21-N1). In a preferred embodiment, X2 is thymidine.
[0020]In other embodiments, the TG nucleic acid has at least the following formula: 5' X1 X2TGX3 X4 3'. In yet another embodiment, the TG nucleic acid comprises the following sequence: 5'N1X1X2TGX3X4N23'. In a related embodiment, N1 is a nucleic acid sequence composed of a number of nucleotides ranging from (9-N2) to (19-N2) and N2 is a nucleic acid sequence composed of a number of nucleotides ranging from (9-N1) to (19-N1). In one preferred embodiment, X3 is thymidine. X1X2 are nucleotides which may be selected from the group consisting of GT, GG, GA, AA, AT, AG, CT, CA, CG, TA and TT, and X3X4 are nucleotides which may be selected from the group consisting of TT, CT, AT, AG, CG, TC, AC, CC, TA, AA, and CA. In some preferred embodiments, X3 is a thymidine. In important embodiments, X3X4 are nucleotides selected from the group consisting of TT, TC, TA and TG. In other embodiments X1X2 are GA or GT and X3X4 are TT. In yet other embodiments X1 or X2 or both are purines and X3 or X4 or both are pyrimidines or X1X2 are GpA and X3 or X4 or both are pyrimidines. In one embodiment X2 is a T and X3 is a pyrimidine.
[0021]In one embodiment the 5' X1 X2TGX3 X4 3' sequence of the TG nucleic acid or the entire length or some fragment thereof of the TG nucleic acid is a non-palindromic sequence, and in other embodiments it is a palindromic sequence.
[0022]In some preferred embodiments, the TG nucleic acid is also T-rich.
[0023]The Py-rich and TG immunostimulatory nucleic acids in some embodiments have a nucleotide backbone which includes at least one backbone modification, such as a phosphorothioate modification. The nucleotide backbone may be chimeric, or preferably the nucleotide backbone is entirely modified. In one preferred embodiment, the immunostimulatory nucleic acid has a poly T motif and a phosphorothioate backbone.
[0024]In another aspect the invention is a composition of an immunostimulatory nucleic acid, in the form of a Py-rich or a TG nucleic acid, and an antigen, wherein the nucleic acid is free of unmethylated CpG motifs.
[0025]Another composition of the invention is a Py-rich or TG immunostimulatory nucleic acid and an anti-microbial agent, wherein the Py-rich or TG nucleic acid is free of unmethylated CpG motifs. Preferably the anti-microbial agent is selected from the group consisting of an anti-viral agent, an anti-parasitic agent, an anti-bacterial agent and an anti-fungal agent.
[0026]A composition of a sustained release device including a Py-rich and/or TG immunostimulatory nucleic acid, wherein the Py-rich and/or TG nucleic acid is free of unmethylated CpG motifs, is provided according to another aspect of the invention.
[0027]The invention also includes nutritional supplements of a Py-rich or TG immunostimulatory nucleic acid in a delivery device selected from the group consisting of a capsule, a pill, and a sublingual tablet, wherein the Py-rich or TG nucleic acid is free of unmethylated CpG motifs.
[0028]It should be understood that when it is useful to administer a Py-rich e.g., poly T, T-rich, C-rich, or TG oligonucleotide and a CpG oligonucleotide, it may also be desirable to co-administer a Py-rich or a TG oligonucleotide together with a physically separate CpG, Py-rich or TG oligonucleotide. Alternatively, the CpG, Py-rich or TG motif may be present on the same contiguous nucleic acid as the Py-rich or TG oligonucleotide. In yet a further embodiment, all or some combination of Py-rich, TG and CpG nucleic acids may be co-administered either on separate nucleic acids or in the same nucleic acid molecule. By co-administer it is intended that the nucleic acids be administered close enough in time to one another to achieve a combined benefit of both oligonucleotides, preferably more than the benefit achieved by administering each of the oligonucleotides alone at the same dose.
[0029]CpG oligonucleotides have, in general, the formula 5'X1X2CGX3X43', wherein X1, X2, X3 and X4 are nucleotides and wherein at least the C of CpG is unmethylated. Preferred CpG oligonucleotides are 8-100 nucleotides in length and have modified back bones. Particular structures are detailed in the published PCT applications, U.S. applications and references cited herein, the disclosures of which are incorporated herein in their entirety. In one embodiment, the CpG oligonucleotide is free of poly T and TG motifs and is not T-rich.
[0030]In other embodiments, the CpG oligonucleotide has a sequence selected from the group consisting of SEQ ID NO: 1, 3, 4, 14-16, 18-24, 28, 29, 33-46, 49, 50, 52-56, 58, 64-67, 69, 71, 72, 76-87, 90, 91, 93, 94, 96, 98, 102-124, 126-128, 131-133, 136-141, 146-150, 152-153, 155-171, 173-178, 180-186, 188-198, 201, 203-214, 216-220, 223, 224, 227-240, 242-256, 258, 260-265, 270-273, 275, 277-281, 286-287, 292, 295-296, 300, 302, 305-307, 309-312, 314-317, 320-327, 329, 335, 337-341, 343-352, 354, 357, 361-365, 367-369, 373-376, 378-385, 388-392, 394, 395, 399, 401-404, 406-426, 429-433, 434-437, 439, 441-443, 445, 447, 448, 450, 453-456, 460-464, 466-469, 472-475, 477, 478, 480, 483-485, 488, 489, 492, 493, 495-502, 504-505, 507-509, 511, 513-529, 532-541, 543-555, 564-566, 568-576, 578, 580, 599, 601-605, 607-611, 613-615, 617, 619-622, 625-646, 648-650, 653-664, 666-697, 699-706, 708, 709, 711-716, 718-732, 736, 737, 739-744, 746, 747, 749-761, 763, 766-767, 769, 772-779, 781-783, 785-786, 7900792, 798-799, 804-808, 810, 815, 817, 818, 820-832, 835-846, 849-850, 855-859, 862, 865, 872, 874-877, 879-881, 883-885, 888-904, and 909-913.
[0031]In another embodiment, the Py-rich or TG oligonucleotide is free of a CpG motifs. This embodiment of the invention also involves pharmaceutical compositions and kits which contain both a CpG oligonucleotide (which can be free of poly T and TG motifs and not be T-rich) and a Py-rich and/or TG oligonucleotide physically separate from the CpG oligonucleotide. The pharmaceutical preparations are in effective amounts and typically include pharmaceutically acceptable carriers, all as set forth in detail herein with respect to Py-rich and TG oligonucleotides. The kits include at least one container containing an oligonucleotide which is a Py-rich or TG oligonucleotide (or some combination thereof). The same container, or in other embodiments, a second container, may contain an oligonucleotide with a CpG motif, which may be free of Py-rich and/or TG motifs. The kit also contains instructions for administering the oligonucleotides to a subject. The kits also may include a container containing a solvent or a diluent.
[0032]In summary, as if fully recited herein, a CpG oligonucleotide physically separate from the Py-rich or TG oligonucleotide can be used together with the Py-rich or TG oligonucleotides in the methods, compositions and products described above.
[0033]The invention relates in other aspects to immunostimulatory oligonucleotides which have chimeric backbones and which do not require the presence of a CpG motif. The invention is based in part on the discovery that nucleic acid sequences which did not contain CpG motifs were immunostimulatory, and that those which have chimeric backbones have unexpectedly enhanced immune stimulating properties. Thus the invention in one aspect relates to a composition of an oligonucleotide having a formula: 5' Y1N1ZN2Y2 3', wherein Y1 and Y2 are, independent of one another, nucleic acid molecules having between 1 and 10 nucleotides, wherein Y1 includes at least one modified internucleotide linkage and Y2 includes at least one modified internucleotide linkage and wherein N1 and N2 are nucleic acid molecules, each independent of one another, having between 0 and 5 nucleotides, but wherein N1ZN2 has at least 6 nucleotides in total and wherein the nucleotides of N1ZN2 have a phosphodiester backbone, and wherein Z is an immunostimulatory nucleic acid motif but does not include a CG. In one embodiment Z is a nucleic acid sequence selected from the group consisting of TTTT, TG, and a sequence wherein at least 50% of the bases of the sequence are Ts.
[0034]In some embodiments Y1 and/or Y2 have between 3 and 8 nucleotides. In other embodiments Y1 and/or Y2 are comprised of at least three Gs, at least four Gs, least seven Gs, or all Gs. In other embodiments Y1 and/or Y2 are selected from the group consisting of TCGTCG, TCGTCGT, and TCGTCGTT (SEQ ID NO:1145). In yet other embodiments Y1 and/or Y2 include at least one, two, three, four, or five poly-A, poly-T, or poly-C sequences.
[0035]The center nucleotides (N1ZN2) of the formula Y1N1ZN2Y2 have phosphodiester internucleotide linkages and Y1 and Y2 have at least one modified internucleotide linkage. In some embodiments Y1 and/or Y2 have at least two modified internucleotide linkages. In other embodiments Y1 and/or Y2 have between two and five modified internucleotide linkages. In yet other embodiments Y1 has two modified internucleotide linkages and Y2 has five modified internucleotide linkages or Y1 has five modified internucleotide linkages and Y2 has two modified internucleotide linkages. The modified internucleotide linkage, in some embodiments is a phosphorothioate modified linkage, a phosphorodithioate modified linkage or a p-ethoxy modified linkage.
[0036]Portions of the formula Y1N1ZN2Y2 may optionally form a palindrome. Thus, in some embodiments the nucleotides of N1ZN2 form a palindrome. In some embodiments the palindrome is not a direct repeat. In yet other embodiments the nucleotides of N1ZN2 do not form a palindrome.
[0037]According to other embodiments N1ZN2 has a sequence of nucleotides selected from the group consisting of GATTTTATCGTC (SEQ ID NO: 1098); TCGATTTTTCGA (SEQ ID NO: 1099); TCATTTTTATGA (SEQ ID NO: 1100); GTTTTTTACGAC (SEQ ID NO: 1101); TCAATTTTTTGA (SEQ ID NO: 1102); ACGTTTTTACGT (SEQ ID NO: 1103); TCGTTTTTACGA (SEQ ID NO: 1104); TCGATTTTTACGTCGA (SEQ ID NO: 1105); AATTTTTTAACGTT (SEQ ID NO: 1106); TCGTTTTTTAACGA (SEQ ID NO: 1107); ACGTTTTTTAACGT (SEQ ID NO: 1108); GATTTTTATCGTC (SEQ ID NO: 1109); GACGATTTTTCGTC (SEQ ID NO: 1110); GATTTTAGCTCGTC (SEQ ID NO: 1111); GATTTTTACGTC (SEQ ID NO: 1112); ATTTTATCGT (SEQ ID NO: 1113); AACGATTTTTCGTT (SEQ ID NO: 1114); TCACTTTTGTGA (SEQ ID NO: 1115); TCGTATTTTA (SEQ ID NO: 1116); ACTTTTGTACCGGT (SEQ ID NO: 1117); TCGATTTTTCGACGTCGA (SEQ ID NO: 1118); ACGATTTTTCGT (SEQ ID NO: 1119); GATGATCGTC (SEQ ID NO: 1120); TCGATGTCGA (SEQ ID NO: 1121); TCATGTATGA (SEQ ID NO: 1122); GTGTTACGAC (SEQ ID NO: 1123); TCAATGTTGA (SEQ ID NO: 1124); ACGTGTACGT (SEQ ID NO: 1125); TCGTGTACGA (SEQ ID NO: 1126); TCGATGTACGTCGA (SEQ ID NO: 1127); AATGTTAACGTT (SEQ ID NO: 1128); TCGTGTTAACGA (SEQ ID NO: 1129); ACGTGTTAACGT (SEQ ID NO: 1130); GATGTATCGTC (SEQ ID NO: 1131); GACGATGTCGTC (SEQ ID NO: 1132); GATGAGCTCGTC (SEQ ID NO: 1133); GATGTACGTC (SEQ ID NO: 1134); ATGATCGT (SEQ ID NO: 1135); AACGATGTCGTT (SEQ ID NO: 1136); TCACTGGTGA (SEQ ID NO: 1137); TCGTATGA (SEQ ID NO: 1138); ACTGGTACCGGT (SEQ ID NO: 1139); TCGATGTCGACGTCGA (SEQ ID NO: 1140); and ACGATGTCGT (SEQ ID NO: 1141).
[0038]The composition may optionally include a pharmaceutical carrier and/or be formulated in a delivery device. In some embodiments the delivery device is selected from the group consisting of cationic lipids, cell permeating proteins, and sustained release devices. In one preferred embodiment the sustained release device is a biodegradable polymer. In another embodiment the sustained release device is a microparticle.
[0039]In another aspect the invention is a composition of an immunostimulatory oligonucleotide having the formula Y1N1ZN2Y2, and an antigen.
[0040]Another composition of the invention is an immunostimulatory oligonucleotide having the formula Y1N1ZN2Y2, and an anti-microbial therapeutic agent. Preferably the anti-microbial therapeutic agent is selected from the group consisting of an anti-viral agent, an anti-parasitic agent, an anti-bacterial agent, or an anti-fungal agent.
[0041]A composition of a sustained release device including an immunostimulatory oligonucleotide having the formula Y1N1ZN2Y2, is provided according to another aspect of the invention.
[0042]The invention also includes nutritional supplements of an immunostimulatory oligonucleotide having the formula Y1N1ZN2Y2, in a delivery device selected from the group consisting of a capsule, a sublingual tablet, and a pill.
[0043]In another aspect the compositions described above also include an immunostimulatory nucleic acid having an unmethylated CG dinucleotide, a TG dinucleotide or a Py-rich sequence wherein the immunostimulatory nucleic acid having an unmethylated CG dinucleotide, a TG dinucleotide or a Py-rich sequence has a different sequence than the oligonucleotide comprising 5' Y1N1ZN2Y2 3'.
[0044]In some embodiments the immunostimulatory nucleic acid having an unmethylated CG dinucleotide, a TG dinucleotide or a Py-rich sequence has a completely phosphodiester backbone and in other embodiments the immunostimulatory nucleic acid having an unmethylated CG dinucleotide, a TG dinucleotide or a Py-rich sequence has a modified backbone, which optionally may have internucleotide linkages selected from the group consisting of phosphorothioate, phosphorodithioate, and p-ethoxy.
[0045]In one embodiment immunostimulatory nucleic acid having an unmethylated CG dinucleotide has a formula comprising: 5' X1X2CGX3X4 31 wherein X1, X2, X3 and X4 are nucleotides. In other embodiments the immunostimulatory nucleic acid sequence includes at least the following formula: 5' TCNTX1X2CGX3X4 3' wherein N is a nucleic acid sequence composed of from about 0-25 nucleotides, wherein at least one nucleotide has a modified internucleotide linkage, and wherein the nucleic acid has less than or equal to 100 nucleotides. According to some embodiments X1X2 are nucleotides selected from the group consisting of: GT, GG, GA and AA and X3X4 are nucleotides selected from the group consisting of: TT, CT or GT. In a preferred embodiment X1X2 are GA and X3X4 are TT.
[0046]In another embodiment the immunostimulatory nucleic acid sequence having an unmethylated CG dinucleotide includes at least one of the following sequences:
TABLE-US-00001 ATCGACTCTCGAGCGTTCTC; (SEQ ID No. 15) TCCATGTCGGTCCTGCTGAT; (SEQ ID No. 32) TCCATGTCGGTZCTGATGCT; (SEQ ID No. 31) ATCGACTCTCGAGCGTTZTC; (SEQ ID No. 18) TCCATGTCGGTCCTGATGCT; (SEQ ID No. 28) GGGGGG; (SEQ ID No. 12) TCCATGACGGTCCTGATGCT; (SEQ ID No. 35) TCCATGGCGGTCCTGATGCT; (SEQ ID No. 34) TCCATGACGTTCCTGATGCT; (SEQ ID No. 7) TCCATGTCGTTCCTGATGCT; (SEQ ID No. 38) GGGGTCAGTCTTGACGGGG; (SEQ ID No. 41) TCCATGTCGCTCCTGATGCT; (SEQ ID No. 37) TCCATGTCGATCCTGATGCT; (SEQ ID No. 36) TCCATGCCGGTCCTGATGCT; (SEQ ID No. 33) TCCATAACGTTCCTGATGCT; (SEQ ID No. 3) TCCATGACGTTCCTGATGCT; (SEQ ID No. 7) TCCATGACGTCCCTGATGCT; (SEQ ID No. 39) TCCATCACGTGCCTGATGCT; (SEQ ID No. 48) TCCATGACGTTCCTGACGTT; (SEQ ID No. 10) ATGACGTTCCTGACGTT; (SEQ ID No. 70) TCTCCCAGCGCGCGCCAT; (SEQ ID No. 72) TCCATGTCGTTCCTGTCGTT; (SEQ ID No. 73) TCCATAGCGTTCCTAGCGTT; (SEQ ID No. 74) TCCTGACGTTCCTGACGTT; (SEQ ID No. 76) TCCTGTCGTTCCTGTCGTT; (SEQ ID No. 77) TCCTGTCGTTCCTTGTCGTT; (SEQ ID No. 52) TCCTTGTCGTTCCTGTCGTT; (SEQ ID No. 121) TCCTGTCGTTTTTTGTCGTT; (SEQ ID No. 208) TCGTCGCTGTTGTCGTTTCTT; (SEQ ID No. 120) TCCATGCGTTGCGTTGCGTT; (SEQ ID No. 81) TCCACGACGTTTTCGACGTT; (SEQ ID No. 82) TCGTCGTTGTCGTTGTCGTT; (SEQ ID No. 47) TCGTCGTTTTGTCGTTTTGTCGTT; (SEQ ID No. 46) TCGTCGTTGTCGTTTTGTCGTT; (SEQ ID No. 49) GCGTGCGTTGTCGTTGTCGTT; (SEQ ID No. 56) TGTCGTTTGTCGTTTGTCGTT; (SEQ ID No. 48) TGTCGTTGTCGTTGTCGTTGTCGTT; (SEQ ID No. 84) TGTCGTTGTCGTTGTCGTT; (SEQ ID No. 50) TCGTCGTCGTCGTT; (SEQ ID No. 51) and TGTCGTTGTCGTT. (SEQ ID No. 85)
In another embodiment the immunostimulatory nucleic acid having a Py-rich or TG sequence is a nucleic acid as described above.
[0047]In another aspect the invention relates to pharmaceutical compositions and kits which contain both an oligonucleotide having the formula Y1N1ZN2Y2 and a CpG oligonucleotide (which optionally may be free of poly T and TG motifs and not be Py-rich), a Py-rich and/or TG oligonucleotide physically separate from the oligonucleotide having the formula Y1N1ZN2Y2. The pharmaceutical preparations are in effective amounts and typically include pharmaceutically acceptable carriers, all as set forth in detail herein. The kits include at least one container containing an oligonucleotide having the formula Y1N1ZN2Y2. The same container, or in other embodiments, a second container, may contain an oligonucleotide with a CpG motif, which optionally may be free of Py-rich and/or TG motifs and/or a Py-rich or TG oligonucleotide (or some combination thereof). The kit also contains instructions for administering the oligonucleotides to a subject. The kits also may include a container containing a solvent or a diluent.
[0048]In summary, as if fully recited herein, an oligonucleotide having the formula Y1N1ZN2Y2 which is physically separate from the CpG, Py-rich or TG oligonucleotide can be used together with the CpG, Py-rich, TG oligonucleotides, in the methods, compositions and products described herein.
[0049]In another aspect the invention relates to a pharmaceutical composition including at least two oligonucleotides of the invention, wherein the at least two oligonucleotides have different sequences from one another and a pharmaceutically acceptable carrier.
[0050]A vaccine formulation is provided according to another aspect of the invention. The vaccine includes any of the compositions of the invention in combination with an antigen.
[0051]According to another aspect of the invention a method of stimulating an immune response is provided. The method involves administering a Py-rich or a TG immunostimulatory nucleic acid to a non-rodent subject in an amount effective to induce an immune response in the non-rodent subject. Preferably the Py-rich or TG immunostimulatory nucleic acid is administered orally, locally, in a sustained release device, mucosally to a mucosal surface, systemically, parenterally, or intramuscularly. When the Py-rich or TG immunostimulatory nucleic acid is administered to the mucosal surface it may be delivered in an amount effective for inducing a mucosal immune response or a systemic immune response. In preferred embodiments the mucosal surface is selected from the group consisting of an oral, nasal, rectal, vaginal, and ocular surface.
[0052]In some embodiments the method includes exposing the subject to an antigen wherein the immune response is an antigen-specific immune response. The antigen may be encoded by a nucleic acid vector which can be delivered to the subject. In some embodiments the antigen is selected from the group consisting of a tumor antigen, a viral antigen, a bacterial antigen, a parasitic antigen and a peptide antigen.
[0053]Py-rich and TG immunostimulatory nucleic acids are capable of provoking a broad spectrum of immune response. For instance these immunostimulatory nucleic acids can be used to redirect a Th2 to a Th1 immune response. Py-rich and TG nucleic acids may also be used to activate an immune cell, such as a leukocyte, a dendritic cell, and an NK cell. The activation can be performed in vivo, in vitro, or ex vivo, i.e., by isolating an immune cell from the subject, contacting the immune cell with an effective amount to activate the immune cell of the Py-rich or TG immunostimulatory nucleic acid and re-administering the activated immune cell to the subject. In some embodiments the dendritic cell expresses a cancer antigen. The dendritic cell can be exposed to the cancer antigen ex vivo.
[0054]The immune response produced by Py-rich or TG nucleic acids may also result in induction of cytokine production, e.g., production of IL-6, IL-12, IL-18 TNF, IFN-α and IFN-γ.
[0055]In still another embodiment, the Py-rich and TG nucleic acids are useful for treating cancer. The Py-rich and TG nucleic acids are also useful according to other aspects of the invention in preventing cancer (e.g., reducing a risk of developing cancer) in a subject at risk of developing a cancer. The cancer may be selected from the group consisting of biliary tract cancer, breast cancer, cervical cancer, choriocarcinoma, colon cancer, endometrial cancer, gastric cancer, intraepithelial neoplasms, lymphomas, liver cancer, lung cancer (e.g. small cell and non-small cell), melanoma, neuroblastomas, oral cancer, ovarian cancer, pancreas cancer, prostate cancer, rectal cancer, sarcomas, thyroid cancer, and renal cancer, as well as other carcinomas and sarcomas. In some important embodiments, the cancer is selected from the group consisting of bone cancer, brain and CNS cancer, connective tissue cancer, esophageal cancer, eye cancer, Hodgkin's lymphoma, larynx cancer, oral cavity cancer, skin cancer, and testicular cancer.
[0056]Py-rich and TG nucleic acids may also be used for increasing the responsiveness of a cancer cell to a cancer therapy (e.g., an anti-cancer therapy), optionally when the Py-rich or TG immunostimulatory nucleic acid is administered in conjunction with an anti-cancer therapy. The anti-cancer therapy may be a chemotherapy, a vaccine (e.g., an in vitro primed dendritic cell vaccine or a cancer antigen vaccine) or an antibody based therapy. This latter therapy may also involve administering an antibody specific for a cell surface antigen of, for example, a cancer cell, wherein the immune response results in antibody dependent cellular cytotoxicity (ADCC). In one embodiment, the antibody may be selected from the group consisting Rituxin, Herceptin, Quadramet, Panorex, IDEC-Y2B8, BEC2, C225, Oncolym, SMART M195, ATRAGEN, Ovarex, Bexxar, LDP-03, ior t6, MDX-210, MDX-11, MDX-22, OV103, 3622W94, anti-VEGF, Zenapax, MDX-220, MDX-447, MELIMMUNE-2, MELIMMUNE-1, CEACIDE, Pretarget, NovoMAb-G2, TNT, Gliomab-H, GNI-250, EMD-72000, LymphoCide, CMA 676, Monopharm-C, 4B5, ior egf.r3, ior c5, BABS, anti-FLK-2, MDX-260, ANA Ab, SMART 1D10 Ab, SMART ABL 364 Ab and ImmuRAIT-CEA.
[0057]Thus, according to some aspects of the invention, a subject having cancer or at risk of having a cancer is administered an immunostimulatory nucleic acid and an anti-cancer therapy. In some embodiments, the anti-cancer therapy is selected from the group consisting of a chemotherapeutic agent, an immunotherapeutic agent and a cancer vaccine. The chemotherapeutic agent may be selected from the group consisting of methotrexate, vincristine, adriamycin, cisplatin, non-sugar containing chloroethylnitrosoureas, 5-fluorouracil, mitomycin C, bleomycin, doxorubicin, dacarbazine, taxol, fragyline, Meglamine GLA, valrubicin, carmustaine and poliferposan, MMI270, BAY 12-9566, RAS farnesyl transferase inhibitor, farnesyl transferase inhibitor, MMP, MTA/LY231514, LY264618/Lometexol, Glamolec, CI-994, TNP-470, Hycamtin/Topotecan, PKC412, Valspodar/PSC833, Novantrone/Mitroxantrone, Metaret/Suramin, Batimastat, E7070, BCH-4556, CS-682, 9-AC, AG3340, AG3433, Incel/VX-710, VX-853, ZD0101, ISI641, ODN 698, TA 2516/Marmistat, BB2516/Marmistat, CDP 845, D2163, PD183805, DX8951f, Lemonal DP 2202, FK 317, Picibanil/OK-432, AD 32/Valrubicin, Metastron/strontium derivative, Temodal/Temozolomide, Evacet/liposomal doxorubicin, Yewtaxan/Placlitaxel, Taxol/Paclitaxel, Xeload/Capecitabine, Furtulon/Doxifluridine, Cyclopax/oral paclitaxel, Oral Taxoid, SPU-077/Cisplatin, HMR 1275/Flavopiridol, CP-358 (774)/EGFR, CP-609 (754)/RAS oncogene inhibitor, BMS-182751/oral platinum, UFT (Tegafur/Uracil), Ergamisol/Levamisole, Eniluracil/776C85/5FU enhancer, Campto/Levamisole, Camptosar/Irinotecan, Tumodex/Ralitrexed, Leustatin/Cladribine, Paxex/Paclitaxel, Doxil/liposomal doxorubicin, Caelyx/liposomal doxorubicin, Fludara/Fludarabine, Pharmarubicin/Epirubicin, DepoCyt, ZD1839, LU 79553/Bis-Naphtalimide, LU 103793/Dolastain, Caetyx/liposomal doxorubicin, Gemzar/Gemcitabine, ZD 0473/Anormed, YM 116, Iodine seeds, CDK4 and CDK2 inhibitors, PARP inhibitors, D4809/Dexifosamide, Ifes/Mesnex/Ifosamide, Vumon/Teniposide, Paraplatin/Carboplatin, Plantinol/cisplatin, Vepeside/Etoposide, ZD 9331, Taxotere/Docetaxel, prodrug of guanine arabinoside, Taxane Analog, nitrosoureas, alkylating agents such as melphelan and cyclophosphamide, Aminoglutethimide, Asparaginase, Busulfan, Carboplatin, Chlorombucil, Cytarabine HCl, Dactinomycin, Daunorubicin HCl, Estramustine phosphate sodium, Etoposide (VP16-213), Floxuridine, Fluorouracil (5-FU), Flutamide, Hydroxyurea (hydroxycarbamide), Ifosfamide, Interferon Alfa-2a, Alfa-2b, Leuprolide acetate (LHRH-releasing factor analogue), Lomustine (CCNU), Mechlorethamine HCl (nitrogen mustard), Mercaptopurine, Mesna, Mitotane (o.p'-DDD), Mitoxantrone HCl, Octreotide, Plicamycin, Procarbazine HCl, Streptozocin, Tamoxifen citrate, Thioguanine, Thiotepa, Vinblastine sulfate, Amsacrine (m-AMSA), Azacitidine, Erthropoietin, Hexamethylmelamine (HMM), Interleukin 2, Mitoguazone (methyl-GAG; methyl glyoxal bis-guanylhydrazone; MGBG), Pentostatin (2'deoxycoformycin), Semustine (methyl-CCNU), Teniposide (VM-26) and Vindesine sulfate, but it is not so limited.
[0058]The immunotherapeutic agent may be selected from the group consisting of Ributaxin, Herceptin, Quadramet, Panorex, IDEC-Y2B8, BEC2, C225, Oncolym, SMART M195, ATRAGEN, Ovarex, Bexxar, LDP-03, ior t6, MDX-210, MDX-11, MDX-22, OV103, 3622W94, anti-VEGF, Zenapax, MDX-220, MDX-447, MELIMMUNE-2, MELIMMUNE-1, CEACIDE, Pretarget, NovoMAb-G2, TNT, Gliomab-H, GNI-250, EMD-72000, LymphoCide, CMA 676, Monopharm-C, 4B5, ior egf.r3, ior c5, BABS, anti-FLK-2, MDX-260, ANA Ab, SMART 1D10 Ab, SMART ABL 364 Ab and ImmuRAIT-CEA, but it is not so limited.
[0059]The cancer vaccine may be selected from the group consisting of EGF, Anti-idiotypic cancer vaccines, Gp75 antigen, GMK melanoma vaccine, MGV ganglioside conjugate vaccine, Her2/neu, Ovarex, M-Vax, O-Vax, L-Vax, STn-KHL theratope, BLP25 (MUC-1), liposomal idiotypic vaccine, Melacine, peptide antigen vaccines, toxin/antigen vaccines, MVA-based vaccine, PACIS, BCG vacine, TA-HPV, TA-CIN, DISC-virus and ImmuCyst/TheraCys, but it is not so limited.
[0060]In still another embodiment of the methods directed to preventing or treating cancer, the subject may be further administered interferon-α.
[0061]The invention in other aspects relates to methods for preventing disease in a subject. The method involves administering to the subject a Py-rich or a TG immunostimulatory nucleic acid on a regular basis to promote immune system responsiveness to prevent disease in the subject. Examples of diseases or conditions sought to be prevented using the prophylactic methods of the invention include microbial infections (e.g., sexually transmitted diseases) and anaphylactic shock from food allergies.
[0062]In other aspects, the invention is a method for inducing an innate immune response by administering to the subject a Py-rich or a TG immunostimulatory nucleic acid in an amount effective for activating an innate immune response.
[0063]According to another aspect of the invention a method for treating or preventing a viral or retroviral infection is provided. The method involves administering to a subject having or at risk of having a viral or retroviral infection, an effective amount for treating or preventing the viral or retroviral infection of any of the compositions of the invention. In some embodiments the virus is caused by a hepatitis virus, HIV, hepatitis B, hepatitis C, herpes virus, or papillomavirus.
[0064]A method for treating or preventing a bacterial infection is provided according to another aspect of the invention. The method involves administering to a subject having or at risk of having a bacterial infection, an effective amount for treating or preventing the bacterial infection of any of the compositions of the invention. In one embodiment the bacterial infection is due to an intracellular bacteria.
[0065]In another aspect the invention is a method for treating or preventing a parasite infection by administering to a subject having or at risk of having a parasite infection, an effective amount for treating or preventing the parasite infection of any of the compositions of the invention. In one embodiment the parasite infection is due to an intracellular parasite. In another embodiment the parasite infection is due to a non-helminthic parasite.
[0066]In some embodiments the subject is a human and in other embodiments the subject is a non-human vertebrate selected from the group consisting of a dog, cat, horse, cow, pig, goat, fish, monkey, chicken, and sheep.
[0067]In yet another aspect, the invention is a method for treating or preventing asthma, by administering to a subject having or at risk of having asthma, an effective amount for treating or preventing the asthma of any of the compositions of the invention. In one embodiment the asthma is allergic asthma.
[0068]In another aspect the invention relates to a method for treating or preventing allergy. The method involves administering to a subject having or at risk of having allergy, an effective amount for treating or preventing the allergy of any of the compositions of the invention.
[0069]A method for treating or preventing an immune deficiency is provided according to another aspect of the invention. The method involves administering to a subject having or at risk of an immune deficiency, an effective amount for treating or preventing the immune deficiency of any of the compositions of the invention.
[0070]In another aspect the invention relates to a method for inducing a TH1 immune response by administering to a subject any of the compositions of the invention in an effective amount to produce a TH1 immune response.
[0071]In one embodiment the methods of the invention involve administering an oligonucleotide of formula 5' Y1N1ZN2Y2 3' and an immunostimulatory nucleic acid having an unmethylated CG dinucleotide a TG dinucleotide or a T-rich sequence. In an embodiment the oligonucleotide comprising 5' Y1N1ZN2Y2 3' is administered separately from the immunostimulatory nucleic acid. In some embodiments the oligonucleotide comprising 5' Y1N1ZN2Y2 3' and the immunostimulatory nucleic acid are administered on an alternating weekly schedule and in other embodiments the oligonucleotide comprising 5' Y1N1ZN2Y2 3' and the immunostimulatory nucleic acid are administered on an alternating biweekly schedule.
[0072]The invention provides in another aspect a composition, comprising an immunostimulatory nucleic acid and an anti-cancer therapy, formulated in a pharmaceutically-acceptable carrier and in an effective amount to treat a cancer or to reduce the risk of developing a cancer. In important embodiments, the immunostimulatory nucleic acid is selected from the group consisting of a T-rich nucleic acid, a TG nucleic acid and a C-rich nucleic acid.
[0073]The invention further provides a kit comprising a first container housing an immunostimulatory nucleic acid and at least one other container (e.g., a second container) housing a an anti-cancer therapy, and instructions for use. In one embodiment, the kit further comprises interferon-α, which may be separately housed in yet another container (e.g., a third container). In an important embodiment, the kit comprises a sustained-release vehicle containing an immunostimulatory nucleic acid, and at least one container housing an anti-cancer therapy, and instructions for timing of administration of the anti-cancer therapy. The immunostimulatory nucleic acid may be selected from the group consisting of a Py-rich nucleic acid, a TG nucleic acid and a CpG nucleic acid, wherein the CpG nucleic acid has a nucleotide sequence comprising SEQ ID NO: 246.
[0074]The invention further provides a method for preventing or treating asthma or allergy, comprising administering an immunostimulatory nucleic acid and an asthma/allergy medicament in an effective amount to treat or prevent the asthma or allergy. In important embodiments, the immunostimulatory nucleic acid is selected from the group consisting of a T-rich nucleic acid, a TG nucleic acid and a C-rich nucleic acid.
[0075]In one embodiment the immunostimulatory nucleic acid is a T-rich nucleic acid. In a related embodiment, the T-rich nucleic acid has a nucleotide sequence selected from the group consisting of SEQ ID NO: 59-63, 73-75, 142, 215, 226, 241, 267-269, 282, 301, 304, 330, 342, 358, 370-372, 393, 433, 471, 479, 486, 491, 497, 503, 556-558, 567, 694, 793-794, 797, 833, 852, 861, 867, 868, 882, 886, 905, 907, 908, and 910-913. In other embodiments the T-rich nucleic acids are sequence selected from the group consisting of SEQ ID NO: 64, 98, 112, 146, 185, 204, 208, 214, 224, 233, 244, 246, 247, 258, 262, 263, 265, 270-273, 300, 305, 316, 317, 343, 344, 350, 352, 354, 374, 376, 392, 407, 411-413, 429-432, 434, 435, 443, 474, 475, 498-501, 518, 687, 692, 693, 804, 862, 883, 884, 888, 890, and 891.
[0076]In yet a further related embodiment, the T-rich nucleic acid is not a TG nucleic acid. In yet still another embodiment, the T-rich nucleic acid is not a CpG nucleic acid.
[0077]In one embodiment, the immunostimulatory nucleic acid is a TG nucleic acid. In a further related embodiment, the TG nucleic acid is not a T-rich nucleic acid. In another related embodiment, the TG nucleic acid is not a CpG nucleic acid.
[0078]In one embodiment, the immunostimulatory nucleic acid is a CpG nucleic acid, wherein the CpG nucleic acid has a nucleotide sequence comprising SEQ ID NO: 246.
[0079]In another embodiment, the asthma/allergy medicament is a medicament selected from the group consisting of PDE-4 inhibitor, Bronchodilator/beta-2 agonist, K+ channel opener, VLA-4 antagonist, Neurokin antagonist, TXA2 synthesis inhibitor, Xanthanine, Arachidonic acid antagonist, 5 lipoxygenase inhibitor, Thromboxin A2 receptor antagonist, Thromboxane A2 antagonist, Inhibitor of 5-lipox activation protein, and Protease inhibitor, but is not so limited. In some important embodiments, the asthma/allergy medicament is a Bronchodilator/beta-2 agonist selected from the group consisting of salmeterol, salbutamol, terbutaline, D2522/formoterol, fenoterol, and orciprenaline.
[0080]In another embodiment, the asthma/allergy medicament is a medicament selected from the group consisting of Anti-histamines and Prostaglandin inducers. In one embodiment, the anti-histamine is selected from the group consisting of loratidine, cetirizine, buclizine, ceterizine analogues, fexofenadine, terfenadine, desloratadine, norastemizole, epinastine, ebastine, ebastine, astemizole, levocabastine, azelastine, tranilast, terfenadine, mizolastine, betatastine, CS 560, and HSR 609. In another embodiment, the Prostaglandin inducer is S-5751.
[0081]In yet another embodiment, the asthma/allergy medicament is selected from the group consisting of Steroids and Immunomodulators. The immunomodulators may be selected from the group consisting of anti-inflammatory agents, leukotriene antagonists, IL4 muteins, Soluble IL-4 receptors, Immunosuppressants, anti-IL-4 antibodies, IL-4 antagonists, anti-IL-5 antibodies, soluble IL-13 receptor-Fc fusion proteins, anti-IL-9 antibodies, CCR3 antagonists, CCR5 antagonists, VLA-4 inhibitors, and Downregulators of IgE, but are not so limited. In one embodiment, the downregulator of IgE is an anti-IgE.
[0082]In another embodiment, the Steroid is selected from the group consisting of beclomethasone, fluticasone, tramcinolone, budesonide, and budesonide. In still a further embodiment, the Immunosuppressant is a Tolerizing peptide vaccine.
[0083]In one embodiment, the immunostimulatory nucleic acid is administered concurrently with the asthma/allergy medicament. In another embodiment, the subject is an immunocompromised subject.
[0084]The immunostimulatory nucleic acids to be administered to a subject in the methods disclosed herein relating to the prevention and treatment of asthma/allergy are as described for other method aspects of the invention.
[0085]In another aspect, the invention provides a kit comprising a first container housing an immunostimulatory nucleic acid, and at least another container (e.g., a second container) housing an asthma/allergy medicament, and instructions for use. The immunostimulatory nucleic acid useful in the kit is as described herein. In important embodiments, the immunostimulatory nucleic acid is selected from the group consisting of a T-rich nucleic acid, a TG nucleic acid and a C-rich nucleic acid. In another important embodiment, the kit comprises a sustained-release vehicle containing an immunostimulatory nucleic acid, and at least one container housing an asthma/allergy medicament, and instructions for timing of administration of the asthma/allergy medicament. The asthma/allergy medicament may be selected from the group of asthma/allergy medicaments described in the foregoing methods directed towards the prevention or treatment of asthma/allergy.
[0086]In yet another aspect, the invention provides a composition, comprising an immunostimulatory nucleic acid and an asthma/allergy medicament, formulated in a pharmaceutically-acceptable carrier and in an effective amount for preventing or treating an immune response associated with exposure to a mediator of asthma or allergy. The immunostimulatory nucleic acid may be selected from the group of immunostimulatory nucleic acids described for the foregoing methods and compositions. In important embodiments, the immunostimulatory nucleic acid is selected from the group consisting of a T-rich nucleic acid, a TG nucleic acid and a C-rich nucleic acid. The asthma/allergy medicament may be selected from the group consisting of asthma medicaments and allergy medicaments as described in the foregoing methods and compositions.
[0087]In still a further aspect, the invention provides a composition comprising an immunostimulatory nucleic acid selected from the group consisting of SEQ ID NO: 95-136, SEQ ID NO: 138-152, SEQ ID NO: 154-222, SEQ ID NO: 224-245, SEQ ID NO: 247-261, SEQ ID NO: 263-299, SEQ ID NO: 301, SEQ ID NO: 303-4109, SEQ ID NO: 414-420, SEQ ID NO: 424, SEQ ID NO: 426-947, SEQ ID NO: 959-1022, SEQ ID NO: 1024-1093, and a pharmaceutically acceptable carrier. Preferably the immunostimulatory nucleic acid is present in the composition in an effective amount. In one embodiment, the immunostimulatory nucleic acid is present in an effective amount to induce an immune response. In another embodiment, the immunostimulatory nucleic acid is present in an effective amount to prevent or treat cancer. In yet a further embodiment, the immunostimulatory nucleic acid is present in an effective amount to prevent or treat asthma/allergy. The invention also provides kits comprising any of the foregoing immunostimulatory nucleic acid compositions, and instructions for use.
[0088]In another aspect the invention includes a composition of an immunostimulatory nucleic acid consisting essentially of: 5' M1TCGTCGTTM2 3' wherein at least one of the Cs is unmethylated, wherein M1 is a nucleic acid having at least one nucleotide, wherein M2 is a nucleic acid having between 0 and 50 nucleotides, and wherein the immunostimulatory nucleic acid has less than 100 nucleotides.
[0089]In yet other aspects the invention relates to a pharmaceutical composition of an immunostimulatory nucleic acid comprising: 5' TCGTCGTT 3' wherein at least one of the Cs is unmethylated, wherein the immunostimulatory nucleic acid has less than 100 nucleotides and a phosphodiester backbone, and a sustained release device. In some embodiments the sustained release device is a microparticle. In other embodiments the composition includes an antigen.
[0090]Each of the limitations of the invention can encompass various embodiments of the invention. It is, therefore, anticipated that each of the limitations of the invention involving any one element or combinations of elements can be included in each aspect of the invention.
BRIEF DESCRIPTION OF THE DRAWINGS
[0091]FIG. 1A is a histogram of the expression of CD86 (Y-axis) by CD19+ cells following exposure of these cells to the oligonucleotides shown on the X-axis at a concentration of 0.15 μg/ml.
[0092]FIG. 1B is a table with the data from FIG. 1A.
[0093]FIG. 1c is a histogram of the expression of CD86 (Y-axis) by CD19+ cells following exposure of these cells to the oligonucleotides shown on the X-axis at a concentration of 0.30 μg/ml.
[0094]FIG. 1D is a table with the data from FIG. 1c.
[0095]FIG. 2 is a graph comparing the abilities of ODN 2137, ODN 2177, ODN 2200 and ODN 2202 to stimulate B cell proliferation at concentrations ranging from 0.2 μg/ml to 20 μg/ml.
[0096]FIG. 3 is a graph comparing the abilities of ODN 2188, ODN 2189, ODN 2190 and ODN 2182 to stimulate B cell proliferation at concentrations ranging from 0.2 μg/ml to 20 μg/ml.
[0097]FIG. 4 is a bar graph depicting dose-dependent B cell activation induced by non-CpG ODN. PBMC of a blood donor were incubated with the indicated concentrations of ODNs 2006 (SEQ ID NO.: 246), 2117 (SEQ ID NO.: 358), 2137 (SEQ ID NO.: 886), 5126 (SEQ ID NO.: 1058) and 5162 (SEQ ID NO.: 1094) and stained with mAb for CD19 (B cell marker) and CD86 (B cell activation marker, B7-2). Expression was measured by flow cytometry.
[0098]FIG. 5 is a bar graph depicting stimulation of B cells by a diverse set of non-CpG ODNs. PBMC of one representative donor were stimulated by 0.4 μg/ml, 1.0 μg/ml or 10.0 μg/ml of the following ODNs: 2006 (SEQ ID NO.: 246), 2196 (SEQ ID NO.: 913), 2194 (SEQ ID NO.: 911), 5162 (SEQ ID NO.: 1094), 5163 (SEQ ID NO.: 1095), 5168 (SEQ ID NO.: 1096) and 5169 (SEQ ID NO.: 1097) and expression of the activation marker CD86 (B7-2) on CD19-positive B cells was measured by flow cytometry.
[0099]FIG. 6 is a bar graph depicting B cell activation by non-CpG ODNs 1982 and 2041. PBMC were incubated with the indicated concentrations of ODN 2006 (SEQ ID NO.: 246), 1982 (SEQ ID NO.: 225) and 2041 (SEQ ID NO.: 282) and B cell activation (expression of the activation marker CD86) was measured by flow cytometry.
[0100]FIG. 7 is a bar graph depicting NK cells are activated by non-CpG ODNs. PBMC were incubated with 6 μg/ml of the following ODNs: 2006 (SEQ ID NO.: 246), 2117 (SEQ ID NO.: 358), 2137 (SEQ ID NO.: 886), 2183 (SEQ ID NO.: 433), 2194 (SEQ ID NO.: 911) and 5126 (SEQ ID NO.: 1058) and stained with mAb for CD3 (T cell marker), CD56 (NK cell marker) and CD69 (early activation marker). Expression of CD69 on CD56-positive NK cells was measured by flow cytometry.
[0101]FIG. 8 is a bar graph depicting NK-mediated cytotoxicity is enhanced by non-CpG ODN. NK-mediated lysis of K-562 target cells was measured after over night incubation of PBMC with 6 μg/ml of the ODN 2006 (SEQ ID NO.: 246), 2194 (SEQ ID NO.: 911) and 5126 (SEQ ID NO.: 1058).
[0102]FIG. 9 is a bar graph depicting NKT cells can be activated by non-CpG ODN. PBMC of one representative donor were incubated with 6 μg/ml ODN 2006 (SEQ ID NO.: 246), 2117 (SEQ ID NO.: 358), 2137 (SEQ ID NO.: 886), 2183 (SEQ ID NO.: 433), 2194 (SEQ ID NO.: 911) and 5126 (SEQ ID NO.: 1058) for 24 h and activation of NKT cells was measured by flow cytometry after staining of cells with mAb for CD3 (T cell marker), CD56 (NK cell marker) and CD69 (early activation marker).
[0103]FIG. 10 is a bar graph depicting stimulation of monocytes by different CpG and non-CpG ODN. PBMC were incubated with 6 μg/ml 2006 (SEQ ID NO.: 246), 2117 (SEQ ID NO.: 358), 2137 (SEQ ID NO.: 886), 2178 (SEQ ID NO.: 428), 2183 (SEQ ID NO.: 433), 2194 (SEQ ID NO.: 911), 5126 (SEQ ID NO.: 1058) and 5163 (SEQ ID NO.: 1095) and stained for CD14 (monocyte marker) and CD80 (B7-1, activation marker). Expression was measured by flow cytometry.
[0104]FIG. 11 is a bar graph depicting release of TNFα upon culture of human cells with non-CpG ODN. PBMC were cultured for 24 h with or without 6 μg/ml of the indicated ODNs or 1 μg/ml LPS as positive control and TNFα measured by ELISA.
[0105]FIG. 12 is a bar graph depicting release of IL-6 after culture with non-CpG ODNs shows the same pattern as for TNFα. PBMC were cultured with the indicated ODNs (1.0 μg/ml) and IL-6 was measured in the supernatants by ELISA.
DETAILED DESCRIPTION
[0106]The invention in one aspect involves the finding that pyrimidine (Py) rich and preferably thymidine (T) rich nucleic acids as well as nucleic acids that contain TG dinucleotide motifs are effective in mediating immune stimulatory effects. It was known in the prior art that CpG containing nucleic acids are therapeutic and prophylactic compositions that stimulate the immune system to treat cancer, infectious diseases, allergy, asthma and other disorders and to help protect against opportunistic infections following cancer chemotherapies. The strong yet balanced, cellular and humoral immune responses that result from CpG stimulation reflect the body's own natural defense system against invading pathogens and cancerous cells. CpG sequences, while relatively rare in human DNA are commonly found in the DNA of infectious organisms such as bacteria. The human immune system has apparently evolved to recognize CpG sequences as an early warning sign of infection, and to initiate an immediate and powerful immune response against invading pathogens without causing adverse reactions frequently seen with other immune stimulatory agents. Thus CpG containing nucleic acids, relying on this innate immune defense mechanism, can utilize a unique and natural pathway for immune therapy. The effects of CpG nucleic acids on immune modulation were discovered by the inventor of the instant patent application and have been described extensively in co-pending patent applications, such as U.S. patent application Ser. Nos. 08/386,063, now U.S. Pat. No. 6,194,388, filed on 02/07/95 (and related PCT U.S. 95/01570); 08/738,652, now U.S. Pat. No. 6,207,646, filed on Oct. 30, 1996; 08/960,774, now U.S. Pat. No. 6,429,199, filed on Oct. 30, 1997 (and related PCT/U.S. 97/19791, WO 98/18810); 09/191,170 filed on Nov. 13, 1998; 09/030,701, now U.S. Pat. No. 6,214,806, filed on 02/25/98 (and related PCT/U.S. 98/03678; 09/082,649, now U.S. Pat. No. 6,339,068, filed on May 20, 1998 (and related PCT/U.S. 98/10408); 09/325,193, now U.S. Pat. No. 6,405,705, filed on Jun. 3, 1999 (and related PCT/U.S. 98/04703); 09/286,098, now U.S. Pat. No. 6,218,371, filed on Apr. 2, 1999 (and related PCT/U.S. 99/07335); 09/306,281 filed on May 6, 1999 (and related PCT/U.S. 99/09863). The entire contents of each of these patents and patent applications is hereby incorporated by reference.
[0107]The findings of the instant invention are applicable to all of the above described uses of CpG containing nucleic acids as well as any other known use for CpG nucleic acids. The invention involves, in one aspect, the discovery that Py-rich and preferably T-rich and TG nucleic acids have similar immune stimulatory properties to CpG oligonucleotides regardless of whether a CpG motif is present. Thus the invention is useful for any method for stimulating the immune system using Py-rich or TG nucleic acids. It was also discovered surprisingly according to the invention that chimeric oligonucleotides which lack a CpG motif are immune stimulatory and have many of the same prophylactic and therapeutic activities as a CpG oligonucleotide.
[0108]A Py-rich nucleic acid is a T-rich or C-rich immunostimulatory nucleic acid. In some embodiments T-rich nucleic acids are preferred. A T-rich nucleic acid is a nucleic acid which includes at least one poly T sequence and/or which has a nucleotide composition of greater than 25% T nucleotide residues. A nucleic acid having a poly-T sequence includes at least four Ts in a row, such as 5'TTTT3'. Preferably the T-rich nucleic acid includes more than one poly T sequence. In preferred embodiments the T-rich nucleic acid may have 2, 3, 4, etc poly T sequences, such as oligonucleotide #2006 (SEQ ID NO:246). One of the most highly immunostimulatory T-rich oligonucleotides discovered according to the invention is a nucleic acid composed entirely of T nucleotide residues, e.g., oligonucleotide #2183 (SEQ ID NO:433). Other T-rich nucleic acids according to the invention have a nucleotide composition of greater than 25% T nucleotide residues, but do not necessarily include a poly T sequence. In these T-rich nucleic acids the T nucleotide resides may be separated from one another by other types of nucleotide residues, i.e., G, C, and A. In some embodiments the T-rich nucleic acids have a nucleotide composition of greater than 35%, 40%, 50%, 60%, 70%, 80%, 90%, and 99%, T nucleotide residues and every integer % in between. Preferably the T-rich nucleic acids have at least one poly T sequence and a nucleotide composition of greater than 25% T nucleotide residues.
[0109]It was discovered according to the invention that the T content of an ODN has a dramatic effect on the immune stimulatory effect of the ODN and that T-rich ODN can activate multiple human immune cell types in the absence of any CpG motifs. An oligonucleotide having a 3' poly-T region and 2 5'CGs e.g., ODN 2181 (SEQ ID NO:431) is highly immune stimulatory. An oligonucleotide of similar length, ODN 2116 (SEQ ID NO:357) which contains two CG dinucleotides at the 5' end and a poly-C region at the 3' end was also immune stimulatory but to a lesser extent than the T-rich oligonucleotide using standard experimental conditions. Thus, although C and T have almost identical structures, their effects on the immune properties of an ODN are varied. They both are capable of inducing an immune response but to different extents. Thus both T-rich and C-rich oligonucleotides are useful according to the invention, but T-rich oligonucleotides are preferred. Furthermore, if the T content of the ODN is reduced by incorporating other bases such as G, A, or C, then the immune stimulatory effects are reduced (ODN #2188 (SEQ ID NO:905), 2190 (SEQ ID NO:907), 2191 (SEQ ID NO:908), and 2193 (SEQ ID NO:910)).
[0110]A C-rich nucleic acid is a nucleic acid molecule having at least one or preferably at least two poly-C regions or which is composed of at least 50% C nucleotides. A poly-C region is at least four C residues in a row. Thus a poly-C region is encompassed by the formula 5'CCCC 3'. In some embodiments it is preferred that the poly-C region have the formula 5'CCCCCC 3'. Other C-rich nucleic acids according to the invention have a nucleotide composition of greater than 50% C nucleotide residues, but do not necessarily include a poly C sequence. In these C-rich nucleic acids the C nucleotide residues may be separated from one another by other types of nucleotide residues, i.e., G, T, and A. In some embodiments the C-rich nucleic acids have a nucleotide composition of greater than 60%, 70%, 80%, 90%, and 99%, C nucleotide residues and every integer % in between. Preferably the C-rich nucleic acids have at least one poly C sequence and a nucleotide composition of greater than 50% C nucleotide residues, and in some embodiments are also T-rich.
[0111]As shown in the Examples, several ODN previously believed to be non-immunostimulatory, including two ODNs SEQ ID NO.: 225 and SEQ ID NO.: 282 previously described to be non-stimulatory and mainly used as control ODNs (Takahashi, T., M. Nieda, Y. Koezuka, A. Nicol, S. A. Porcelli, Y. Ishikawa, K. Tadokoro, H. Hirai, and T. Juji. 2000. Analysis of human VA24+CD4+ NKT cells activated by a-glycosylceramide-pulsed monocyte-derived dendritic cells. J. Immunol. 164:4458) were found to be immunostimulatory. Our experiments, demonstrated that these ODNs can stimulate B cells, although at higher concentrations compared to CpG ODNs (FIG. 6). A long Poly T ODN (30 mer) induced, at least in some experiments, comparable strong activation of B cells to one of the strongest CpG ODN activators of B cells. These experiments also revealed the surprising finding that even Poly C ODNs can lead to stimulation of B cells.
[0112]Immunostimulation by these ODNs, however, was not limited to human B cells. Different experimental assays clearly demonstrated in addition that monocytes, NK cells and even NKT cells can be activated by such non-CpG ODNs (FIG. 7-10). In contrast to Poly T and Poly C sequences, immunostimulation by Poly A sequences (at least for monocytes, B and NK cells) was not achieved. Interestingly it was found that the introduction of a CpG motif into SEQ ID NO.: 225 enhanced the immunostimulatory activity whereas the elongation with a Poly T stretch did not enhance immunostimulation. This suggests that CpG and T-rich ODN may operate through different mechanisms or pathways. It is also possible that insertion of a poly-T motif into a different position of SEQ ID NO.: 225 may result in a change in immunostimulatory properties.
[0113]A "TG nucleic acid" or a "TG immunostimulatory nucleic acid" as used herein is a nucleic acid containing at least one TpG dinucleotide (thymidine-guanine dinucleotide sequence, i.e. "TG DNA" or DNA containing a 5' thymidine followed by 3' guanosine and linked by a phosphate bond) and activates a component of the immune system.
[0114]In one embodiment the invention provides a TG nucleic acid represented by at least the formula:
5'N1X1TGX2N23'
[0115]wherein X1 and X2 are nucleotides and N is any nucleotide and N1 and N2 are nucleic acid sequences composed of any number of N provided that the sum total of N1 and N2 is in the range of 11 to 21. As an example, if N1 is 5, then N2 may be 6 (leading to a total length for the oligonucleotide of 15 nucleotides). The TG may be located anywhere within the oligonucleotide stretch, including the 5' end, the center and the 3' end. Thus, N1 may be zero through to 21, inclusive, provided that N2 is appropriately chosen to give a sum of N2 and N1 equal to 11 through to 21, inclusive. Similarly, N2 may be zero through to 21, inclusive, provided that the sum total of N1 and N2 equals 11 to 21, inclusive. In some embodiments X1 is adenine, guanine, or thymidine and X2 is cytosine, adenine, or thymidine. In one preferred embodiment, X2 is thymidine. In other embodiments X1 is cytosine and/or X2 is guanine. In other embodiments, as discussed herein, the nucleic acid may encompass other motifs, provided it is long enough to do so.
[0116]In other embodiments the TG nucleic acid is represented by at least the formula:
5'N1X1X2TGX3X4N23'
[0117]wherein X1, X2, X3, and X4 are nucleotides. In some embodiments, X1X2 are nucleotides selected from the group consisting of: GpT, GpG, GpA, ApA, ApT, ApG, CpT, CpA, TpA and TpT; and X3X4 are nucleotides selected from the group consisting of: TpT, CpT, ApT, ApG, TpC, ApC, CpC, TpA, ApA, and CpA; N is any nucleotide and N1 and N2 are nucleic acid sequences composed of any number of nucleotides provide that the sum total of N1 and N2 is in the range of 9 to 19. In some embodiments, X1X2 are GpA or GpT and X3X4 are TpT. In other embodiments X1 or X2 or both are purines and X3 or X4 or both are pyrimidines or X1X2 are GpA and X3 or X4 or both are pyrimidines. In one preferred embodiment, X3X4 are nucleotides selected from the group consisting of: TpT, TpC and TpA.
[0118]The immunostimulatory nucleic acid may be any size (i.e., length) provided it is at least 4 nucleotides. In important embodiments, the immunostimulatory nucleic acids have a length in the range of between 6 and 100. In still other embodiments, the length is in the range of between 8 and 35 nucleotides. Preferably, the TG oligonucleotides range in size from 15 to 25 nucleotides.
[0119]The size (i.e., the number of nucleotide residues along the length of the nucleic acid) of the immunostimulatory nucleic acid may also contribute to the stimulatory activity of the nucleic acid. It has been discovered, surprisingly that even for highly immune stimulating immunostimulatory nucleic acids, the length of the nucleic acid influences the extent of immunostimulation that can be achieved. It has been demonstrated that increasing the length of a T-rich nucleic acid up to 24 nucleotides causes increased immune stimulation. The experiments presented in the examples demonstrate that when the length of the T-rich nucleic acid is increased from 18 to 27 nucleotides the ability of the nucleic acid to stimulate an immune response is increased significantly (compare ODN #2194, 2183, 2195, and 2196 decreasing in size from 27-18 nucleotides). Increasing the length of the nucleic acid up to 30 nucleotides had a dramatic impact on the biological properties of the nucleic acid but increasing the length beyond 30 nucleotides did not appear to further influence the immune stimulatory effect (e.g., compare ODN 2179 to 2006).
[0120]It has been shown that TG nucleic acids ranging in length from 15 to 25 nucleotides in length may exhibit an increased immune stimulation. Thus, in one aspect, the invention provides an oligonucleotide that is 15-27 nucleotides in length (i.e., an oligonucleotide that is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26 or 27 nucleotides in length) that may be a T-rich nucleic acid or may be a TG nucleic acid, or may be both a T-rich and a TG nucleic acid. In one embodiment, the oligonucleotide is not a T-rich nucleic acid nor is it a TG nucleic acid. In other embodiments, the oligonucleotide does not have a CG motif. The invention similarly provides oligonucleotides that are 15-27 nucleotides in length, oligonucleotides that are 18-25 nucleotides in length, oligonucleotides that are 20-23 nucleotides in length, and oligonucleotides that are 23-25 nucleotides in length. Any of the foregoing embodiments relating to oligonucleotides 15-27 in length also relate to the oligonucleotides of these differing lengths. The invention further embraces the use of any of these foregoing oligonucleotides in the methods recited herein.
[0121]Although a maximal level of immune stimulation is achieved with some T-rich nucleic acids when the nucleic acid is 24-30 nucleotide residues in length, as well as with some TG nucleic acids that range from 15 to 25 nucleotides in length, shorter or longer immunostimulatory nucleic acids can also be used according to the methods of the invention. For facilitating uptake into cells immunostimulatory nucleic acids preferably have a minimum length of 6 nucleotide residues. Nucleic acids of any size greater than 6 nucleotides (even many kb long) are capable of inducing an immune response according to the invention if sufficient immunostimulatory motifs are present, since larger nucleic acids are degraded inside of cells. Preferably the immunostimulatory nucleic acids are in the range of between 8 and 100 and in some embodiments T-rich containing immunostimulatory nucleic acids are between 24 and 40 nucleotides in length and TG containing immunostimulatory nucleic acids are between 15 and 25 nucleotides in length.
[0122]In one embodiment the T-rich nucleic acid is represented by at least the formula:
5'X1X2TTTTX3X43'
[0123]wherein X1, X2, X3, and X4 are nucleotides. In one embodiment X1X2 is TT and/or X3X4 is TT. In another embodiment X1X2 are any one of the following nucleotides TA, TG, TC, AT, AA, AG, AC, CT, CC, CA, GT, GG, GA, and GC; and X3X4 are any one of the following nucleotides TA, TG, TC, AT, AA, AG, AC, CT, CC, CA, GT, GG, GA, and GC.
[0124]In some embodiments it is preferred that the immunostimulatory nucleic acids do not contain poly-C(CCCC), or poly-A (AAAA). In other embodiments it is preferred that the immunostimulatory nucleic acid include poly-C, poly-A, poly-G (GGGG) or multiple GGs. In particular poly-G or multiple GG motifs have dramatic effects on some immunostimulatory nucleic acids. The effect of these non-T sequences depends in part on the status of the nucleic acid backbone. For instance, if the nucleic acid has a phosphodiester backbone or a chimeric backbone the inclusion of these sequences in the nucleic acid will only have minimal if any effect on the biological activity of the nucleic acid. If the backbone is completely phosphorothioate (or other phosphate modification) or significantly phosphorothioate then the inclusion of these sequences may have more influence on the biological activity or the kinetics of the biological activity, causing a decrease in potency of the T-rich and TG immunostimulatory nucleic acids.
[0125]Although C-rich nucleic acids have been demonstrated to have immune stimulating properties, insertion of Poly-C sequences into a T-rich nucleic acid in a manner that would reduce the relative proportion of T nucleotides in the nucleic acid can have a negative impact on the nucleic acid. Although applicants are not bound by a proposed mechanism, it is believed that the immune system has developed a mechanism for distinguishing nucleic acids having different nucleotide properties, possibly resulting from different sets of binding proteins which recognize different sequences or specific binding proteins which recognize all the immunostimulatory sequences but with different affinities. In general nucleic acids including unmethylated CpG motifs are the most immunostimulatory, followed by T-rich nucleic acids, TG nucleic acids and C-rich nucleic acids. This generalization, however, has many exceptions. For instance a strong T-rich nucleic acid like SEQ ID NO.: 886 is more immune stimulatory in some assays than some CpG containing nucleic acids (e.g., a phosphorothioate CpG nucleic acid containing a single CpG motif).
[0126]It has also been discovered that the addition of a poly-A tail to an immunostimulatory nucleic acid can enhance the activity of the nucleic acid. It was discovered that when a highly immune stimulatory CpG nucleic acid (SEQ ID NO.: 246) was modified with the addition of a poly-A tail (AAAAAA) or a poly-T tail (TTTTTT), the resultant oligonucleotides increased in immune stimulatory activity. The ability of the poly-A tail and the poly-T tail to increase the immunostimulating properties of the oligonucleotide was very similar. SEQ ID NO.: 246 is a T-rich oligonucleotide. It is likely that if poly-A and poly-T tails are added to a nucleic acid which is not T-rich, it would have a bigger impact on the immune stimulating capability of the nucleic acid. Since the poly-T tail was added to a nucleic acid that was already highly T-rich the immune stimulating properties of the poly-T addition was diluted somewhat, although not completely. This finding has important implications for the use of poly-A regions. Thus in some embodiments the immunostimulatory nucleic acids include a poly-A region and in other embodiments they do not.
[0127]Some of the immunostimulatory nucleic acids of the invention include one or more CG motifs. The presence of CG motifs in the immunostimulatory nucleic acids also has an influence on the biological activity of the nucleic acids. If the total length of an immunostimulatory nucleic acid is 20 nucleotide residues or less, then CpG motifs are important in determining the immune effect of the nucleic acid, and methylation of these motifs reduces the potency of the immune stimulatory effects of the nucleic acid. If the length of the immunostimulatory nucleic acid is increased to 24, then the immune stimulatory effects of the nucleic acid become less dependent on the CpG motifs, and are no longer abolished by methylation of the CpG motifs or by their inversion to GC dinucleotides, provided the other immune-stimulatory properties described herein are present.
[0128]For example, ODN 2006 (SEQ ID NO:246) is a highly immune stimulatory T-rich nucleic acid of 24 nucleotide residues in length with four CpG dinucleotides. However, ODN 2117 (SEQ ID NO:358), in which the CpG motifs are methylated is also highly immune stimulatory. ODN 2137 (SEQ ID NO:886), in which the CpG motifs of ODN 2006 are inverted to GpC, and which as a result possesses six TG dinucleotides is also immune stimulatory. The immune stimulatory effects of nucleic acids such as ODN 2117 and 2137 are regulated by their T and TG content. Each of these three nucleic acids is T-rich and ODN 2137 is additionally TG rich. If their T content is reduced by inserting other bases such as A (ODN 2117 (SEQ ID NO:358)) or if their TG content is reduced by substituting TG with AG, then the immune stimulatory effects are somewhat reduced. In another example, a nucleic acid 24 nucleotides in length in which all of the positions are randomized has only a modest immune stimulatory effect (ODN 2182 (SEQ ID NO:432)). Likewise, a nucleic acid 24 nucleotides in length with other nucleotide compositions have variable immune stimulatory effects, depending on their T content (ODN 2188 (SEQ ID NO:905), 2189 (SEQ ID NO:906), 2190 (SEQ ID NO:907), 2191 (SEQ ID NO:908), 2193 (SEQ ID NO:910), 2183 (SEQ ID NO:433), and 2178 (SEQ ID NO:428)). ODN 2190 which contains TGT motifs is more immune stimulatory than ODN 2202 which possesses TGG motifs. Thus, in some embodiments, TGT motifs are preferred. In still other embodiments, the number of TG motifs is important in that an increase in the number of TG motifs leads to an increase in immune stimulation. Some preferred TG nucleic acids contain at least three TG motifs.
[0129]Examples of CpG nucleic acids include but are not limited to those listed in Table A, such as SEQ ID NO: 1, 3, 4, 14-16, 18-24, 28, 29, 33-46, 49, 50, 52-56, 58, 64-67, 69, 71, 72, 76-87, 90, 91, 93, 94, 96, 98, 102-124, 126-128, 131-133, 136-141, 146-150, 152-153, 155-171, 173-178, 180-186, 188-198, 201, 203-214, 216-220, 223, 224, 227-240, 242-256, 258, 260-265, 270-273, 275, 277-281, 286-287, 292, 295-296, 300, 302, 305-307, 309-312, 314-317, 320-327, 329, 335, 337-341, 343-352, 354, 357, 361-365, 367-369, 373-376, 378-385, 388-392, 394, 395, 399, 401-404, 406-426, 429-433, 434-437, 439, 441-443, 445, 447, 448, 450, 453-456, 460-464, 466-469, 472-475, 477, 478, 480, 483-485, 488, 489, 492, 493, 495-502, 504-505, 507-509, 511, 513-529, 532-541, 543-555, 564-566, 568-576, 578, 580, 599, 601-605, 607-611, 613-615, 617, 619-622, 625-646, 648-650, 653-664, 666-697, 699-706, 708, 709, 711-716, 718-732, 736, 737, 739-744, 746, 747, 749-761, 763, 766-767, 769, 772-779, 781-783, 785-786, 7900792, 798-799, 804-808, 810, 815, 817, 818, 820-832, 835-846, 849-850, 855-859, 862, 865, 872, 874-877, 879-881, 883-885, 888-904, and 909-913.
[0130]In some embodiments of the invention the immunostimulatory nucleic acids include CpG dinucleotides and in other embodiments the immunostimulatory nucleic acids are free of CpG dinucleotides. The CpG dinucleotides may be methylated or unmethylated. A nucleic acid containing at least one unmethylated CpG dinucleotide is a nucleic acid molecule which contains an unmethylated cytosine-guanine dinucleotide sequence (i.e. "CpG DNA" or DNA containing an unmethylated 5' cytosine followed by 3' guanosine and linked by a phosphate bond) and activates the immune system. A nucleic acid containing at least one methylated CpG dinucleotide is a nucleic acid which contains a methylated cytosine-guanine dinucleotide sequence (i.e., a methylated 5' cytosine followed by a 3' guanosine and linked by a phosphate bond).
[0131]Examples of T rich nucleic acids that are free of CpG nucleic acids include but are not limited to those listed in Table A, such as SEQ ID NO: 59-63, 73-75, 142, 215, 226, 241, 267-269, 282, 301, 304, 330, 342, 358, 370-372, 393, 433, 471, 479, 486, 491, 497, 503, 556-558, 567, 694, 793-794, 797, 833, 852, 861, 867, 868, 882, 886, 905, 907, 908, and 910-913. Examples of T rich nucleic acids that include CpG nucleic acids include but are not limited to those listed in Table A, such as SEQ ID NO: 64, 98, 112, 146, 185, 204, 208, 214, 224, 233, 244, 246, 247, 258, 262, 263, 265, 270-273, 300, 305, 316, 317, 343, 344, 350, 352, 354, 374, 376, 392, 407, 411-413, 429-432, 434, 435, 443, 474, 475, 498-501, 518, 687, 692, 693, 804, 862, 883, 884, 888, 890, and 891.
[0132]The immunostimulatory nucleic acids can be double-stranded or single-stranded. Generally, double-stranded molecules are more stable in vivo, while single-stranded molecules have increased immune activity. Thus in some aspects of the invention it is preferred that the nucleic acid be single stranded and in other aspects it is preferred that the nucleic acid be double stranded.
[0133]The term T-rich nucleic acid and TG nucleic acid, as used herein, refers to an immunostimulatory T-rich nucleic acid and an immunostimulatory TG nucleic acid, respectively, unless otherwise indicated. The T-rich nucleic acid sequences of the invention are those broadly described above as well as the nucleic acids shown in Table A that have at least one poly T motif and/or have a composition of greater than 25% T or preferably 35% nucleotide residues. The C-rich nucleic acids are those having at least one and preferably at least two poly-C regions. The TG nucleic acids of the invention are those broadly described above as well as the specific nucleic acids shown in Table A that have at least one TG motif.
[0134]The nucleic acids of the invention may, but need not, also include a poly G motif. Poly G containing nucleic acids are also immunostimulatory. A variety of references, including Pisetsky and Reich, 1993 Mol. Biol. Reports, 18:217-221; Krieger and Herz, 1994, Ann. Rev. Biochem., 63:601-637; Macaya et al., 1993, PNAS, 90:3745-3749; Wyatt et al., 1994, PNAS, 91:1356-1360; Rando and Hogan, 1998, In Applied Antisense Oligonucleotide Technology, ed. Krieg and Stein, p. 335-352; and Kimura et al., 1994, J. Biochem. 116, 991-994 also describe the immunostimulatory properties of poly G nucleic acids.
[0135]Poly G nucleic acids preferably are nucleic acids having the following formulas:
5'X1X2GGGX3X43'
wherein X1, X2, X3, and X4 are nucleotides. In preferred embodiments at least one of X3 and X4 are a G. In other embodiments both of X3 and X4 are a G. In yet other embodiments the preferred formula is 5' GGGNGGG 3', or 5' GGGNGGGNGGG 3' wherein N represents between 0 and 20 nucleotides. In other embodiments the poly G nucleic acid is free of unmethylated CG dinucleotides, such as, for example, the nucleic acids listed below as SEQ ID NO: 5, 6, 73, 215, 267-269, 276, 282, 288, 297-299, 355, 359, 386, 387, 444, 476, 531, 557-559, 733, 768, 795, 796, 914-925, 928-931, 933-936, and 938. In other embodiments the poly G nucleic acid includes at least one unmethylated CG dinucleotide, such as, for example, the nucleic acids listed above as SEQ ID NO: 67, 80-82, 141, 147, 148, 173, 178, 183, 185, 214, 224, 264, 265, 315, 329, 434, 435, 475, 519, 521-524, 526, 527, 535, 554, 565, 609, 628, 660, 661, 662, 725, 767, 825, 856, 857, 876, 892, 909, 926, 927, 932, and 937.
[0136]The terms "nucleic acid" and "oligonucleotide" are used interchangeably to mean multiple nucleotides (i.e. molecules comprising a sugar (e.g. ribose or deoxyribose) linked to a phosphate group and to an exchangeable organic base, which is either a substituted pyrimidine (e.g. cytosine (C), thymidine (T) or uracil (U)) or a substituted purine (e.g. adenine (A) or guanine (G)). As used herein, the terms refer to oligoribonucleotides as well as oligodeoxyribonucleotides. The terms shall also include polynucleosides (i.e. a polynucleotide minus the phosphate) and any other organic base containing polymer. Nucleic acid molecules can be obtained from existing nucleic acid sources (e.g., genomic or cDNA), but are preferably synthetic (e.g. produced by nucleic acid synthesis).
[0137]The terms nucleic acid and oligonucleotide also encompass nucleic acids or oligonucleotides with substitutions or modifications, such as in the bases and/or sugars. For example, they include nucleic acids having backbone sugars which are covalently attached to low molecular weight organic groups other than a hydroxyl group at the 3' position and other than a phosphate group at the 5' position. Thus modified nucleic acids may include a 2'-O-alkylated ribose group. In addition, modified nucleic acids may include sugars such as arabinose instead of ribose. Thus the nucleic acids may be heterogeneous in backbone composition thereby containing any possible combination of polymer units linked together such as peptide-nucleic acids (which have amino acid backbone with nucleic acid bases). In some embodiments, the nucleic acids are homogeneous in backbone composition. Nucleic acids also include substituted purines and pyrimidines such as C-5 propyne modified bases (Wagner et al., Nature Biotechnology 14:840-844, 1996). Purines and pyrimidines include but are not limited to adenine, cytosine, guanine, thymidine, 5-methylcytosine, 2-aminopurine, 2-amino-6-chloropurine, 2,6-diaminopurine, hypoxanthine, and other naturally and non-naturally occurring nucleobases, substituted and unsubstituted aromatic moieties. Other such modifications are well known to those of skill in the art.
[0138]For use in the instant invention, the nucleic acids of the invention can be synthesized de novo using any of a number of procedures well known in the art. For example, the b-cyanoethyl phosphoramidite method (Beaucage, S. L., and Caruthers, M. H., Tet. Let. 22:1859, 1981); nucleoside H-phosphonate method (Garegg et al., Tet. Let. 27:4051-4054, 1986; Froehler et al., Nucl. Acid. Res. 14:5399-5407, 1986,; Garegg et al., Tet. Let. 27:4055-4058, 1986, Gaffney et al., Tet. Let. 29:2619-2622, 1988). These chemistries can be performed by a variety of automated nucleic acid synthesizers available in the market. These nucleic acids are referred to as synthetic nucleic acids. Alternatively, T-rich and/or TG dinucleotides can be produced on a large scale in plasmids, (see Sambrook, T., et al., "Molecular Cloning: A Laboratory Manual", Cold Spring Harbor laboratory Press, New York, 1989) and separated into smaller pieces or administered whole. Nucleic acids can be prepared from existing nucleic acid sequences (e.g., genomic or cDNA) using known techniques, such as those employing restriction enzymes, exonucleases or endonucleases. Nucleic acids prepared in this manner are referred to as isolated nucleic acid. An isolated nucleic acid generally refers to a nucleic acid which is separated from components which it is normally associated with in nature. As an example, an isolated nucleic acid may be one which is separated from a cell, from a nucleus, from mitochondria or from chromatin. The terms Py-rich nucleic acids and TG nucleic acids encompasses both synthetic and isolated Py-rich nucleic acids and TG nucleic acids.
[0139]For use in vivo, the Py-rich and TG nucleic acids may optionally be relatively resistant to degradation (e.g., are stabilized). A "stabilized nucleic acid molecule" shall mean a nucleic acid molecule that is relatively resistant to in vivo degradation (e.g. via an exo- or endo-nuclease). Stabilization can be a function of length or secondary structure. Nucleic acids that are tens to hundreds of kbs long are relatively resistant to in vivo degradation. For shorter nucleic acids, secondary structure can stabilize and increase their effect. For example, if the 3' end of an nucleic acid has self-complementarity to an upstream region, so that it can fold back and form a sort of stem loop structure, then the nucleic acid becomes stabilized and therefore exhibits more activity.
[0140]Alternatively, nucleic acid stabilization can be accomplished via phosphate backbone modifications. Preferred stabilized nucleic acids of the instant invention have a modified backbone. It has been demonstrated that modification of the nucleic acid backbone provides enhanced activity of the Py-rich and TG nucleic acids when administered in vivo. These stabilized structures are preferred because the Py-rich and TG molecules of the invention have at least a partial modified backbone. Py-rich and TG constructs having phosphorothioate linkages provide maximal activity and protect the nucleic acid from degradation by intracellular exo- and endo-nucleases. Other modified nucleic acids include phosphodiester modified nucleic acids, combinations of phosphodiester and phosphorothioate nucleic acid, methylphosphonate, methylphosphorothioate, phosphorodithioate, p-ethoxy, and combinations thereof. Each of these combinations and their particular effects on immune cells is discussed in more detail with respect to CpG nucleic acids in PCT Published Patent Applications PCT/U.S. 95/01570 (WO 96/02555) and PCT/U.S. 97/19791 (WO 98/18810) claiming priority to U.S. Ser. Nos. 08/386,063, now U.S. Pat. Nos. 6,194,388, and 08/960,774, now U.S. Pat. No. 6,239,116, filed on Feb. 7, 1995 and Oct. 30, 1997 respectively, the entire contents of which are hereby incorporated by reference. It is believed that these modified nucleic acids may show more stimulatory activity due to enhanced nuclease resistance, increased cellular uptake, increased protein binding, and/or altered intracellular localization.
[0141]The compositions of the invention may optionally be chimeric oligonucleotides. The chimeric oligonucleotides are oligonucleotides having a formula: 5' Y1N1ZN2Y2 3'. Y1 and Y2 are nucleic acid molecules having between 1 and 10 nucleotides. Y1 and Y2 each include at least one modified internucleotide linkage. Since at least 2 nucleotides of the chimeric oligonucleotides include backbone modifications these nucleic acids are an example of one type of "stabilized immunostimulatory nucleic acids."
[0142]With respect to the chimeric oligonucleotides, Y1 and Y2 are considered independent of one another. This means that each of Y1 and Y2 may or may not have different sequences and different backbone linkages from one anther in the same molecule. The sequences vary, but in some cases Y1 and Y2 have a poly-G sequence. A poly-G sequence refers to at least 3 Gs in a row. In other embodiments the poly-G sequence refers to at least 4, 5, 6, 7, or 8 Gs in a row. In other embodiments Y1 and Y2 may be TCGTCG, TCGTCGT, or TCGTCGTT (SEQ ID NO: 1145). Y1 and Y2 may also have a poly-C, poly-T, or poly-A sequence. In some embodiments Y1 and/or Y2 have between 3 and 8 nucleotides.
[0143]N1 and N2 are nucleic acid molecules having between 0 and 5 nucleotides as long as N1ZN2 has at least 6 nucleotides in total. The nucleotides of N1ZN2 have a phosphodiester backbone and do not include nucleic acids having a modified backbone.
[0144]Z is an immunostimulatory nucleic acid motif but does not include a CG. For instance, Z may be a nucleic acid a T-rich sequence, e.g. including a TTTT motif or a sequence wherein at least 50% of the bases of the sequence are Ts or Z may be a TG sequence.
[0145]The center nucleotides (N1ZN2) of the formula Y1N1ZN2Y2 have phosphodiester internucleotide linkages and Y1 and Y2 have at least one, but may have more than one or even may have all modified internucleotide linkages. In preferred embodiments Y1 and/or Y2 have at least two or between two and five modified internucleotide linkages or Y1 has two modified internucleotide linkages and Y2 has five modified internucleotide linkages or Y1 has five modified internucleotide linkages and Y2 has two modified internucleotide linkages. The modified internucleotide linkage, in some embodiments is a phosphorothioate modified linkage, a phosphorodithioate modified linkage or a p-ethoxy modified linkage.
[0146]Modified backbones such as phosphorothioates may be synthesized using automated techniques employing either phosphoramidate or H-phosphonate chemistries. Aryl- and alkyl-phosphonates can be made, e.g., as described in U.S. Pat. No. 4,469,863; and alkylphosphotriesters (in which the charged oxygen moiety is alkylated as described in U.S. Pat. No. 5,023,243 and European Patent No. 092,574) can be prepared by automated solid phase synthesis using commercially available reagents. Methods for making other DNA backbone modifications and substitutions have been described (Uhlmann, E. and Peyman, A., Chem. Rev. 90:544, 1990; Goodchild, J., Bioconjugate Chem. 1:165, 1990).
[0147]Other stabilized nucleic acids include: nonionic DNA analogs, such as alkyl- and aryl-phosphates (in which the charged phosphonate oxygen is replaced by an alkyl or aryl group), phosphodiester and alkylphosphotriesters, in which the charged oxygen moiety is alkylated. Nucleic acids which contain diol, such as tetraethyleneglycol or hexaethyleneglycol, at either or both termini have also been shown to be substantially resistant to nuclease degradation.
[0148]In the case when the Py-rich or TG nucleic acid is administered in conjunction with an antigen which is encoded in a nucleic acid vector, it is preferred that the backbone of the Py-rich or TG nucleic acid be a chimeric combination of phosphodiester and phosphorothioate (or other phosphate modification). The cell may have a problem taking up a plasmid vector in the presence of completely phosphorothioate nucleic acid. Thus when both a vector and a nucleic acid are delivered to a subject, it is preferred that the nucleic acid have a chimeric backbone or have a phosphorothioate backbone but that the plasmid be associated with a vehicle that delivers it directly into the cell, thus avoiding the need for cellular uptake. Such vehicles are known in the art and include, for example, liposomes and gene guns.
[0149]The nucleic acids described herein as well as various control nucleic acids are presented below in Table A.
TABLE-US-00002 TABLE A SEQ ID NO: ODN SEQUENCE BACKBONE 1 tctcccagcgtgcgccat s 2 ataatccagcttgaaccaag s 3 ataatcgacgttcaagcaag s 4 taccgcgtgcgaccctct s 5 ggggagggt s 6 ggggagggg s 7 ggtgaggtg s 8 tccatgtzgttcctgatgct o 9 gctaccttagzgtga o 10 tccatgazgttcctgatgct o 11 tccatgacgttcztgatgct o 12 gctagazgttagtgt o 13 agctccatggtgctcactg s 14 ccacgtcgaccctcaggcga s 15 gcacatcgtcccgcagccga s 16 gtcactcgtggtacctcga s 17 gttggatacaggccagactttgttg o 18 gattcaacttgcgctcatcttaggc o 19 accatggacgaactgtttcccctc s 20 accatggacgagctgtttcccctc s 21 accatggacgacctgtttcccctc s 22 accatggacgtactgtttcccctc s 23 accatggacggtctgtttcccctc s 24 accatggacgttctgtttcccctc s 25 ccactcacatctgctgctccacaag o 26 acttctcatagtccctttggtccag o 27 tccatgagcttcctgagtct o 28 gaggaaggigiggaigacgt o 29 gtgaaticgttcicgggict o 30 aaaaaa s 31 cccccc s 32 ctgtca s 33 tcgtag s 34 tcgtgg s 35 cgtcgt s 36 tccatgtcggtcctgagtct sos 37 tccatgccggtcctgagtct sos 38 tccatgacggtcctgagtct sos 39 tccatgacggtcctgagtct sos 40 tccatgtcgatcctgagtct sos 41 tccatgtcgctcctgagtct sos 42 tccatgtcgttcctgagtct sos 43 tccatgacgttcctgagtct sos 44 tccataacgttcctgagtct sos 45 tccatgacgtccctgagtct sos 46 tccatcacgtgcctgagtct sos 47 tccatgctggtcctgagtct sos 48 tccatgtzggtcctgagtct sos 49 ccgcttcctccagatgagctcatgggtttc o tccaccaag 50 cttggtggagaaacccatgagctcatctgg o aggaagcgg 51 ccccaaagggatgagaagtt o 52 agatagcaaatcggctgacg o 53 ggttcacgtgctcatggctg o 54 tctcccagcgtgcgccat s 55 tctcccagcgtgcgccat s 56 taccgcgtgcgaccctct s 57 ataatccagcttgaaccaag s 58 ataatcgacgttcaagcaag s 59 tccatgattttcctgatttt o 62 tgctgcttttgtgcttttgtgctt s 63 tgctgcttgtgcttttgtgctt o 64 gcattcatcaggcgggcaagaat o 65 taccgagcttcgacgagatttca o 66 gcatgacgttgagct s 67 cacgttgaggggcat s 68 ctgctgagactggag s 69 tccatgacgttcctgacgtt s 70 gcatgagcttgagctga o 71 tcagcgtgcgcc s 72 atgacgttcctgacgtt s 73 ttttggggttttggggtttt s 74 tctaggctttttaggcttcc s 75 tgcattttttaggccaccat s 76 tctcccagcgtgcgtgcgccat s 77 tctcccagcgggcgcat s 78 tctcccagcgagcgccat s 79 tctcccagcgcgcgccat s 80 ggggtgacgttcagggggg sos 81 ggggtccagcgtgcgccatggggg sos 82 ggggtgtcgttcagggggg sos 83 tccatgtcgttcctgtcgtt s 84 tccatagcgttcctagcgtt s 85 tcgtcgctgtctccgcttctt s 86 gcatgacgttgagct sos 87 tctcccagcgtgcgccatat sos 88 tccatgazgttcctgazgtt s 89 gcatgazgttgagct o 90 tccagcgtgcgccata sos 91 tctcccagcgtgcgccat o 92 tccatgagcttcctgagtct o 93 gcatgtcgttgagct sos 94 tcctgacgttcctgacgtt s 95 gcatgatgttgagct o 96 gcatttcgaggagct o 97 gcatgtagctgagct o 98 tccaggacgttcctagttct o 99 tccaggagcttcctagttct o 100 tccaggatgttcctagttct o 101 tccagtctaggcctagttct o 102 tccagttcgagcctagttct o 103 gcatggcgttgagct sos 104 gcatagcgttgagct sos 105 gcattgcgttgagct sos 106 gcttgcgttgcgttt sos 107 tctcccagcgttgcgccatat sos 108 tctcccagcgtgcgttatat sos 109 tctccctgcgtgcgccatat sos 110 tctgcgtgcgtgcgccatat sos 111 tctcctagcgtgcgccatat sos 112 tctcccagcgtgcgcctttt sos 113 gctandcghhagc o 114 tcctgacgttccc o 115 ggaagacgttaga 0 116 tcctgacgttaga o 117 tcagaccagctggtcgggtgttcctga o 118 tcaggaacacccgaccagctggtctga o 119 gctagtcgatagc o 120 gctagtcgctagc o 121 gcttgacgtctagc o 122 gcttgacgtttagc o 123 gcttgacgtcaagc o 124 gctagacgtttagc o
125 tccatgacattcctgatgct o 126 gctagacgtctagc o 127 ggctatgtcgttcctagcc o 128 ggctatgtcgatcctagcc o 129 ctcatgggtttctccaccaag o 130 cttggtggagaaacccatgag o 131 tccatgacgttcctagttct o 132 ccgcttcctccagatgagctcatg o 133 catgagctcatctggaggaagcgg o 134 ccagatgagctcatgggtttctcc o 135 ggagaaacccatgagctcatctgg o 136 agcatcaggaacgacatgga o 137 tccatgacgttcctgacgtt rna 138 gcgcgcgcgcgcgcgcgcg o 139 ccggccggccggccggccgg o 140 ttccaatcagccccacccgctctggcccca o ccctcaccctcca 141 tggagggtgagggtggggccagagcgggtg o gggctgattggaa 142 tcaaatgtgggattttcccatgagtct o 143 agactcatgggaaaatcccacatttga o 144 tgccaagtgctgagtcactaataaaga o 145 tctttattagtgactcagcacttggca o 146 tgcaggaagtccgggttttccccaaccccc o c 147 ggggggttggggaaaacccggacttcctgc o a 148 ggggactttccgctggggactttccagggg sos gactttcc 149 tccatgacgttcctctccatgacgttcctc o tccatgacgttcctc 150 gaggaacgtcatggagaggaacgtcatgga o gaggaacgtcatgga 151 ataatagagcttcaagcaag s 152 tccatgacgttcctgacgtt s 153 tccatgacgttcctgacgtt sos 154 tccaggactttcctcaggtt s 155 tcttgcgatgctaaaggacgtcacattgca o caatcttaataaggt 156 accttattaagattgtgcaatgtgacgtcc o tttagcatcgcaaga 157 tcctgacgttcctggcggtcctgtcgct o 158 tcctgtcgctcctgtcgct o 159 tcctgacgttgaagt o 160 tcctgtcgttgaagt o 161 tcctggcgttgaagt o 162 tcctgccgttgaagt o 163 tccttacgttgaagt o 164 tcctaacgttgaagt o 165 tcctcacgttgaagt o 166 tcctgacgatgaagt o 167 tcctgacgctgaagt o 168 tcctgacggtgaagt o 169 tcctgacgtagaagt o 170 tcctgacgtcgaagt o 171 tcctgacgtggaagt o 172 tcctgagcttgaagt o 173 gggggacgttggggg o 174 tcctgacgttccttc o 175 tctcccagcgagcgagcgccat s 176 tcctgacgttcccctggcggtcccctgtcg o ct 177 tcctgtcgctcctgtcgctcctgtcgct o 178 tcctggcggggaagt o 179 tcctgazgttgaagt o 180 tcztgacgttgaagt o 181 tcctagcgttgaagt o 182 tccagacgttgaagt o 183 tcctgacggggaagt o 184 tcctggcggtgaagt o 185 ggctccggggagggaatttttgtctat o 186 atagacaaaaattccctccccggagcc o 187 tccatgagcttccttgagtct rna 188 tcgtcgctgtctccgcttctt so 189 tcgtcgctgtctccgcttctt s20 190 tcgagacattgcacaatcatctg o 191 cagattgtgcaatgtctcga o 192 tccatgtcgttcctgatgcg o 193 gcgatgtcgttcctgatgct o 194 gcgatgtcgttcctgatgcg o 195 tccatgtcgttccgcgcgcg o 196 tccatgtcgttcctgccgct o 197 tccatgtcgttcctgtagct o 198 gcggcgggcggcgcgcgccc o 199 atcaggaacgtcatgggaagc o 200 tccatgagcttcctgagtct p-ethoxy 201 tcaacgtt p-ethoxy 202 tcaagctt p-ethoxy 203 tcctgtcgttcctgtcgtt s 204 tccatgtcgtttttgtcgtt s 205 tcctgtcgttccttgtcgtt s 206 tccttgtcgttcctgtcgtt s 207 btccattccatgacgttcctgatgcttcca os 208 tcctgtcgttttttgtcgtt s 209 tcgtcgctgtctccgcttctt s 210 tcgtcgctgtctgcccttctt s 211 tcgtcgctgttgtcgtttctt s 212 tcctgtcgttcctgtcgttggaacgacagg o 213 tcctgtcgttcctgtcgtttcaacgtcagg o aacgacagga 214 ggggtctgtcgttttgggggg sos 215 ggggtctgtgcttttgggggg sos 216 tccggccgttgaagt o 217 tccggacggtgaagt o 218 tcccgccgttgaagt o 219 tccagacggtgaagt o 220 tcccgacggtgaagt o 221 tccagagcttgaagt o 222 tccatgtzgttcctgtzgtt s 223 tccatgacgttcctgacgtt sos 224 ggggttgacgttttgggggg sos 225 tccaggacttctctcaggtt s 226 tttttttttttttttttttt s 227 tccatgccgttcctgccgtt s 228 tccatggcgggcctggcggg s 229 tccatgacgttcctgccgtt s 230 tccatgacgttcctggcggg s 231 tccatgacgttcctgcgttt s 232 tccatgacggtcctgacggt s 233 tccatgcgtgcgtgcgtttt s 234 tccatgcgttgcgttgcgtt s 235 btccattccattctaggcctgagtcttccat os 236 tccatagcgttcctagcgtt o 237 tccatgtcgttcctgtcgtt o 238 tccatagcgatcctagcgat o 239 tccattgcgttccttgcgtt o 240 tccatagcggtcctagcggt o 241 tccatgattttcctgcagttcctgatttt 242 tccatgacgttcctgcagttcctgacgtt s 243 ggcggcggcggcggcggcgg o 244 tccacgacgttttcgacgtt s
245 tcgtcgttgtcgttgtcgtt s 246 tcgtcgttttgtcgttttgtcgtt s 247 tcgtcgttgtcgttttgtcgtt s 248 gcgtgcgttgtcgttgtcgtt s 249 czggczggczgggczccgg o 250 gcggcgggcggcgcgcgccc s 251 agicccgigaacgiattcac o 252 tgtcgtttgtcgtttgtcgtt s 253 tgtcgttgtcgttgtcgttgtcgtt s 254 tgtcgttgtcgttgtcgttgtcgtt s 255 tcgtcgtcgtcgtt s 256 tgtcgttgtcgtt s 257 cccccccccccccccccccc s 258 tctagcgtttttagcgttcc sos 259 tgcatcccccaggccaccat s 260 tcgtcgtcgtcgtcgtcgtcgtt sos 261 tcgtcgttgtcgttgtcgtt sos 262 tcgtcgttttgtcgttttgtcgtt sos 263 tcgtcgttgtcgttttgtcgtt sos 264 ggggagggaggaacttcttaaaattccccca o gaatgttt 265 aaacattctgggggaattttaagaagttcct o ccctcccc 266 atgtttacttcttaaaattcccccagaatgt o tt 267 aaacattctgggggaattttaagaagtaaac o at 268 atgtttactagacaaaattcccccagaatgt o tt 269 aaacattctgggggaattttgtctagtaaac o at 270 aaaattgacgttttaaaaaa sos 271 ccccttgacgttttcccccc sos 272 ttttcgttgtttttgtcgtt 273 tcgtcgttttgtcgttttgtcgtt sos 274 ctgcagcctgggac o 275 acccgtcgtaattatagtaaaaccc o 276 ggtacctgtggggacattgtg o 277 agcaccgaacgtgagagg o 278 tccatgccgttcctgccgtt o 279 tccatgacggtcctgacggt o 280 tccatgccggtcctgccggt o 281 tccatgcgcgtcctgcgcgt o 282 ctggtctttctggtttttttctgg s 283 tcaggggtggggggaacctt sos 284 tccatgazgttcctagttct o 285 tccatgatgttcctagttct o 286 cccgaagtcatttcctcttaacctgg o 287 ccaggttaagaggaaatgacttcggg o 288 tcctggzggggaagt o 289 gzggzgggzggzgzgzgccc x 290 tccatgtgcttcctgatgct o 291 tccatgtccttcctgatgct 292 tccatgtcgttcctagttct 293 tccaagtagttcctagttct o 294 tccatgtagttcctagttct o 295 tcccgcgcgttccgcgcgtt s 296 tcctggcggtcctggcggtt s 297 tcctggaggggaagt o 298 tcctgggggggaagt o 299 tcctggtggggaagt o 300 tcgtcgttttgtcgttttgtcgtt o 301 ctggtctttctggtttttttctgg o 302 tccatgacgttcctgacgtt o 303 tccaggacttctctcaggtt sos 304 tzgtzgttttgtzgttttgtzgtt o 305 btcgtcgttttgtcgttttgtcgttttttt os 306 gctatgacgttccaaggg s 307 tcaacgtt s 308 tccaggactttcctcaggtt o 309 ctctctgtaggcccgcttgg s 310 ctttccgttggacccctggg s 311 gtccgggccaggccaaagtc s 312 gtgcgcgcgagcccgaaatc s 313 tccatgaigttcctgaigtt s 314 aatagtcgccataacaaaac o 315 aatagtcgccatggcggggc o 316 btttttccatgtcgttcctgatgcttttt os 317 tcctgtcgttgaagtttttt o 318 gctagctttagagctttagagctt o 319 tgctgcttcccccccccccc o 320 tcgacgttcccccccccccc o 321 tcgtcgttcccccccccccc o 322 tcgtcgttcccccccccccc o 323 tcgccgttcccccccccccc o 324 tcgtcgatcccccccccccc o 325 tcctgacgttgaagt s 326 tcctgccgttgaagt s 327 tcctgacggtgaagt s 328 tcctgagcttgaagt s 329 tcctggcggggaagt s 330 aaaatctgtgcttttaaaaaa sos 331 gatccagtcacagtgacctggcagaatctgg o at 332 gatccagattctgccaggtcactgtgactgg o at 333 gatccagtcacagtgactcagcagaatctgg o at 334 gatccagattctgctgagtcactgtgactgg o at 335 tcgtcgttccccccczcccc o 336 tzgtqgttcccccccccccc o 337 tzgtcgttcccccccccccc o 338 tcgtzgttcccccccccccc o 339 tcgtcgctcccccccccccc o 340 tcgtcggtcccccccccccc o 341 tcggcgttcccccccccccc o 342 ggccttttcccccccccccc o 343 tcgtcgttttgacgttttgtcgtt s 344 tcgtcgttttgacgttttgacgtt s 345 ccgtcgttcccccccccccc o 346 gcgtcgttcccccccccccc o 347 tcgtcattcccccccccccc o 348 acgtcgttcccccccccccc o 349 ctgtcgttcccccccccccc o 350 btttttcgtcgttcccccccccccc os 351 tcgtcgttccccccccccccb o 352 tcgtcgttttgtcgttttgtcgttb o 353 tccagttccttcctcagtct o 354 tzgtcgttttgtcgttttgtcgtt o 355 tcctggaggggaagt s 356 tcctgaaaaggaagt s 357 tcgtcgttccccccccc s 358 tzgtzgttttgtzgttttgtzgtt s 359 ggggtcaagcttgagggggg sos 360 tgctgcttcccccccccccc s 361 tcgtcgtcgtcgtt s2 362 tcgtcgtcgtcgtt s20 363 tcgtcgtcgtcgtt os2 364 tcaacgttga s
365 tcaacgtt s 366 atagttttccatttttttac 367 aatagtcgccatcgcgcgac o 368 aatagtcgccatcccgggac o 369 aatagtcgccatcccccccc o 370 tgctgcttttgtgcttttgtgctt o 371 ctgtgctttctgtgtttttctgtg s 372 ctaatctttctaatttttttctaa s 373 tcgtcgttggtgtcgttggtgtcgtt s 374 tcgtcgttggttgtcgttttggtt s 375 accatggacgagctgtttcccctc 376 tcgtcgttttgcgtgcgttt s 377 ctgtaagtgagcttggagag 378 gagaacgctggaccttcc 379 cgggcgactcagtctatcgg 380 gttctcagataaagcggaaccagcaacagac acagaa 381 ttctgtgtctgttgctggttccgctttatc tgagaac 382 cagacacagaagcccgatagacg 383 agacagacacgaaacgaccg 384 gtctgtcccatgatctcgaa 385 gctggccagcttacctcccg 386 ggggcctctatacaacctggg 387 ggggtccctgagactgcc 388 gagaacgctggaccttccat 389 tccatgtcggtcctgatgct 390 ctcttgcgacctggaaggta 391 aggtacagccaggactacga 392 accatggacgacctgtttcccctc 393 accatggattacctttttcccctt 394 atggaaggtccagcgttctc o 395 agcatcaggaccgacatgga o 396 ctctccaagctcacttacag 397 tccctgagactgccccacctt 398 gccaccaaaacttgtccatg 399 gtccatggcgtgcgggatga 400 cctctatacaacctgggac 401 cgggcgactcagtctatcgg 402 gcgctaccggtagcctgagt 403 cgactgccgaacaggatatcggtgatcagca ctgg 404 ccagtgctgatcaccgatatcctgttcggca gtcg 405 ccaggttgtatagaggc 406 tctcccagcgtacgccat s 407 tctcccagcgtgcgtttt s 408 tctcccgacgtgcgccat s 409 tctcccgtcgtgcgccat s 410 ataatcgtcgttcaagcaag s 411 tcgtcgttttgtcgttttgtcgt s2 412 tcgtcgttttgtcgttttgtcgtt s2 413 tcgtcgttttgtcgttttgtcgtt s2 414 tcntcgtnttntcgtnttntcgtn s 415 tctcccagcgtcgccat s 416 tctcccatcgtcgccat s 417 ataatcgtgcgttcaagaaag s 418 ataatcgacgttcccccccc s 419 tctatcgacgttcaagcaag s 420 tcc tga cgg gg agt s 421 tccatgacgttcctgatcc 422 tccatgacgttcctgatcc 423 tccatgacgttcctgatcc 424 tcc tgg cgt gga agt s 425 tccatgacgttcctgatcc 426 tcgtcgctgttgtcgtttctt s 427 agcagctttagagctttagagctt s 428 cccccccccccccccccccccccc s 429 tcgtcgttttgtcgttttgtcgttttgtcgt s t 430 tcgtcgttttttgtcgttttttgtcgtt s 431 tcgtcgtttttttttttttt s 432 tttttcaacgttgatttttt sos 434 ggggtcgtcgttttgggggg 435 tcgtcgttttgtcgttttgggggg 436 tcgtcgctgtctccgcttcttcttgcc s 437 tcgtcgctgtctccg s 438 ctgtaagtgagcttggagag 439 gagaacgctggaccttccat 440 ccaggttgtatagaggc 441 gctagacgttagcgtga 442 ggagctcttcgaacgccata 443 tctccatgatggttttatcg 444 aaggtggggcagtctcaggga 445 atcggaggactggcgcgccg 446 ttaggacaaggtctagggtg 447 accacaacgagaggaacgca 448 ggcagtgcaggctcaccggg 449 gaaccttccatgctgtt 450 gctagacgttagcgtga 451 gcttggagggcctgtaagtg 452 gtagccttccta 453 cggtagccttccta 454 cacggtagccttccta 455 agcacggtagccttccta 456 gaacgctggaccttccat 457 gaccttccat 458 tggaccttccat 459 gctggaccttccat 460 acgctggaccttccat 461 taagctctgtcaacgccagg 462 gagaacgctggaccttccatgt 463 tccatgtcggtcctgatgct 464 ttcatgccttgcaaaatggcg 465 tgctagctgtgcctgtacct 466 agcatcaggaccgacatgga 467 gaccttccatgtcggtcctgat 468 acaaccacgagaacgggaac 469 gaaccttccatgctgttccg 470 caatcaatctgaggagaccc 471 tcagctctggtactttttca 472 tggttacggtctgtcccatg 473 gtctatcggaggactggcgc 474 cattttacgggcgggcgggc 475 gaggggaccattttacgggc 476 tgtccagccgaggggaccat 477 cgggcttacggcggatgctg 478 tggaccttctatgtcggtcc 479 tgtcccatgtttttagaagc 480 gtggttacggtcgtgcccat 481 cctccaaatgaaagaccccc 482 ttgtactctccatgatggtt 483 ttccatgctgttccggctgg 484 gaccttctatgtcggtcctg 485 gagaccgctcgaccttcgat 486 ttgccccatattttagaaac 487 ttgaaactgaggtgggac 488 ctatcggaggactggcgcgcc
489 cttggagggcctcccggcgg 490 gctgaaccttccatgctgtt 491 tagaaacagcattcttcttttagggcagcac a 492 agatggttctcagataaagcggaa 493 ttccgctttatctgagaaccatct 494 gtcccaggttgtatagaggctgc 495 gcgccagtcctccgatagac 496 atcggaggactggcgcgccg 497 ggtctgtcccatatttttag 498 tttttcaacgttgagggggg sos 499 tttttcaagcgttgatttttt sos 500 ggggtcaacgttgatttttt sos 501 ggggttttcaacgttttgagggggg sos 502 ggttacggtctgtcccatat 503 ctgtcccatatttttagaca 504 accatcctgaggccattcgg 505 cgtctatcgggcttctgtgtctg 506 ggccatcccacattgaaagtt 507 ccaaatatcggtggtcaagcac 508 gtgcttgaccaccgatatttgg 509 gtgctgatcaccgatatcctgttcgg 510 ggccaactttcaatgtgggatggcctc 511 ttccgccgaatggcctcaggatggtac 512 tatagtccctgagactgccccaccttctcaa caacc 513 gcagcctctatacaacctgggacggga 514 ctatcggaggactggcgcgccg 515 tatcggaggactggcgcgccg 516 gatcggaggactggcgcgccg 517 ccgaacaggatatcggtgatcagcac 518 ttttggggtcaacgttgagggggg 519 ggggtcaacgttgagggggg sos 520 cgcgcgcgcgcgcgcgcgcg s 521 ggggcatgacgttcgggggg ss 522 ggggcatgacgttcaaaaaa s 523 ggggcatgagcttcgggggg s 524 ggggcatgacgttcgggggg sos 525 aaaacatgacgttcaaaaaa sos 526 aaaacatgacgttcgggggg sos 527 ggggcatgacgttcaaaaaa sos 528 accatggacgatctgtttcccctc s 529 gccatggacgaactgttccccctc s 530 cccccccccccccccccccc sos 531 gggggggggggggggggggg sos 532 gctgtaaaatgaatcggccg sos 533 ttcgggcggactcctccatt sos 534 tatgccgcgcccggacttat sos 535 ggggtaatcgatcagggggg sos 536 tttgagaacgctggaccttc sos 537 gatcgctgatctaatgctcg sos 538 gtcggtcctgatgctgttcc sos 539 tcgtcgtcagttcgctgtcg sos 540 ctggaccttccatgtcgg sos 541 gctcgttcagcgcgtct sos 542 ctggaccttccatgtc sos 543 cactgtccttcgtcga sos 544 cgctggaccttccatgtcgg sos 545 gctgagctcatgccgtctgc sos 546 aacgctggaccttccatgtc sos 547 tgcatgccgtacacagctct sos 548 ccttccatgtcggtcctgat sos 549 tactcttcggatcccttgcg sos 550 ttccatgtcggtcctgat sos 551 ctgattgctctctcgtga sos 552 ggcgttattcctgactcgcc o 553 cctacgttgtatgcgcccagct o 554 ggggtaatcgatgagggggg o 555 ttcgggcggactcctccatt o 557 gggggttttttttttggggg o 558 tttttggggggggggttttt o 559 ggggggggggggggggggt o 560 aaaaaaaaaaaaaaaaaaaa o 561 cccccaaaaaaaaaaccccc o 562 aaaaaccccccccccaaaaa o 563 tttgaattcaggactggtgaggttgag o 564 tttgaatcctcagcggtctccagtggc o 565 aattctctatcggggcttctgtgtctgttgc o tggttccgctttat 566 ctagataaagcggaaccagcaacagacacag o aagccccgatagag 567 ttttctagagaggtgcacaatgctctgg o 568 tttgaattccgtgtacagaagcgagaagc o 569 tttgcggccgctagacttaacctgagagata o 570 tttgggcccacgagagacagagacacttc o 571 tttgggcccgcttctcgcttctgtacacg o 572 gagaacgctggaccttccat s 573 tccatgtcggtcctgatgct s 574 ctgtcg s 575 tcgtga s 576 cgtcga s 577 agtgct s 578 ctgtcg o 579 agtgct o 580 cgtcga o 581 tcgtga o 582 gagaacgctccagcttcgat o 583 gctagacgtaagcgtga o 584 gagaacgctcgaccttccat o 585 gagaacgctggacctatccat o 586 gctagaggttagcgtga o 587 gagaacgctggacttccat o 588 tcacgctaacgtctagc o 589 bgctagacgttagcgtga o 590 atggaaggtcgagcgttctc o 591 gagaacgctggaccttcgat o 592 gagaacgatggaccttccat o 593 gagaacgctggatccat o 594 gagaacgctccagcactgat o 595 tccatgtcggtcctgctgat o 596 atgtcctcggtcctgatgct o 597 gagaacgctccaccttccat o 598 gagaacgctggaccttcgta o 599 batggaaggtccagcgttctc o 600 tcctga o 601 tcaacgtt o 602 aacgtt o 603 aacgttga o 604 tcacgctaacctctagc o 605 gagaacgctggaccttgcat o 606 gctggaccttccat o 607 gagaacgctggacctcatccat o 608 gagaacgctggacgctcatccat o 609 aacgttgaggggcat o 610 atgcccctcaacgtt o 611 tcaacgttga o 612 gctggaccttccat o 613 caacgtt o
614 acaacgttga o 615 tcacgt o 616 tcaagctt o 617 tcgtca o 618 aggatatc o 619 tagacgtc o 620 gacgtcat o 621 ccatcgat o 622 atcgatgt o 623 atgcatgt o 624 ccatgcat o 625 agcgctga o 626 tcagcgct o 627 ccttcgat o 628 gtgccggggtctccgggc s 629 gctgtggggcggctcctg s 630 btcaacgtt o 631 ftcaacgtt o 632 faacgttga o 633 tcaacgt s 634 aacgttg s 635 cgacga o 636 tcaacgtt o 637 tcgga o 638 agaacgtt o 639 tcatcgat o 640 taaacgtt s 641 ccaacgtt s 642 gctcga s 643 cgacgt s 644 cgtcgt s 645 acgtgt s 646 cgttcg s 647 gagcaagctggaccttccat s 648 cgcgta s 649 cgtacg s 650 tcaccggt s 651 caagagatgctaacaatgca s 652 acccatcaatagctctgtgc s 653 ccatcgat o 654 tcgacgtc o 655 ctagcgct o 656 taagcgct o 657 tcgcgaattcgcg o 658 atggaaggtccagcgttct o 659 actggacgttagcgtga o 660 cgcctggggctggtctgg o 661 gtgtcggggtctccgggc o 662 gtgccggggtctccgggc o 663 cgccgtcgcggcggttgg o 664 gaagttcacgttgaggggcat o 665 atctggtgagggcaagctatg s 666 gttgaaacccgagaacatcat s 667 gcaacgtt o 668 gtaacgtt o 669 cgaacgtt o 670 gaaacgtt o 671 caaacgtt o 672 ctaacgtt o 673 ggaacgtt o 674 tgaacgtt o 675 acaacgtt o 676 ttaacgtt o 677 aaaacgtt o 678 ataacgtt o 679 aacgttct o 680 tccgatcg o 681 tccgtacg o 682 gctagacgctagcgtga o 683 gagaacgctggacctcatcatccat o 684 gagaacgctagaccttctat o 685 actagacgttagtgtga o 686 cacaccttggtcaatgtcacgt o 687 tctccatcctatggttttatcg o 688 cgctggaccttccat o 689 caccaccttggtcaatgtcacgt o 690 gctagacgttagctgga o 691 agtgcgattgcagatcg o 692 ttttcgttttgtggttttgtggtt 693 ttttcgtttgtcgttttgtcgtt 694 tttttgttttgtggttttgtggtt 695 accgcatggattctaggcca s 696 gctagacgttagcgt o 697 aacgctggaccttccat o 698 tcaazgtt o 699 ccttcgat o 700 actagacgttagtgtga s 701 gctagaggttagcgtga s 702 atggactctccagcgttctc 0 703 atcgactctcgagcgttctc o 704 gctagacgttagc o 705 gctagacgt o 706 agtgcgattcgagatcg o 707 tcagzgct o 708 ctgattgctctctcgtga o 709 tzaacgtt o 710 gagaazgctggaccttccat o 711 gctagacgttaggctga o 712 gctacttagcgtga o 713 gctaccttagcgtga o 714 atcgacttcgagcgttctc o 715 atgcactctgcagcgttctc o 716 agtgactctccagcgttctc o 717 gccagatgttagctgga o 718 atcgactcgagcgttctc o 719 atcgatcgagcgttctc o 720 bgagaacgctcgaccttcgat o 721 gctagacgttagctgga sos 722 atcgactctcgagcgttctc sos 723 tagacgttagcgtga o 724 cgactctcgagcgttctc o 725 ggggtcgaccttggagggggg sos 726 gctaacgttagcgtga o 727 cgtcgtcgt o 728 gagaacgctggaczttccat o 729 atcgacctacgtgcgttztc o 730 atzgacctacgtgcgttctc o 731 gctagazgttagcgt o 732 atcgactctcgagzgttctc o 733 ggggtaatgcatcagggggg sos 734 ggctgtattcctgactgccc s 735 ccatgctaacctctagc o 736 gctagatgttagcgtga o 737 cgtaccttacggtga o 738 tccatgctggtcctgatgct o
739 atcgactctctcgagcgttctc o 740 gctagagcttagcgtga o 741 atcgactctcgagtgttctc o 742 aacgctcgaccttcgat o 743 ctcaacgctggaccttccat o 744 atcgacctacgtgcgttctc o 745 gagaatgctggaccttccat o 746 tcacgctaacctctgac o 747 bgagaacgctccagcactgat o 748 bgagcaagctggaccttccat o 749 cgctagaggttagcgtga o 750 gctagatgttaacgt o 751 atggaaggtccacgttctc o 752 gctagatgttagcgt o 753 gctagacgttagtgt o 754 tccatgacggtcctgatgct o 755 tccatggcggtcctgatgct o 756 gctagacgatagcgt o 757 gctagtcgatagcgt o 758 tccatgacgttcctgatgct o 759 tccatgtcgttcctgatgct o 760 gctagacgttagzgt o 761 gctaggcgttagcgt o 762 tccatgtzggtcctgatgct o 763 tccatgtcggtzctgatgct o 764 atzgactctzgagzgttctc o 765 atggaaggtccagtgttctc o 766 gcatgacgttgagct o 767 ggggtcaacgttgagggggg s 768 ggggtcaagtctgagggggg sos 769 cgcgcgcgcgcgcgcgcgcg o 770 cccccccccccccccccccccccccccc s 771 ccccccccccccccccccccccccccccccc s cccc 772 tccatgtcgctcctgatcct o 773 gctaaacgttagcgt o 774 tccatgtcgatcctgatgct o 775 tccatgccggtcctgatgct o 776 aaaatcaacgttgaaaaaaa sos 777 tccataacgttcctgatgct o 778 tggaggtcccaccgagatcggag o 779 cgtcgtcgtcgtcgtcgtcgt s 780 ctgctgctgctgctgctgctg s 781 gagaacgctccgaccttcgat s 782 gctagatgttagcgt s 783 gcatgacgttgagct s 784 tcaatgctgaf o 785 tcaacgttgaf o 786 tcaacgttgab o 787 gcaatattgcb o 788 gcaatattgcf o 789 agttgcaact o 790 tcttcgaa o 791 tcaacgtc o 792 ccatgtcggtcctgatgct o 793 gtttttatataatttggg o 794 tttttgtttgtcgttttgtcgtt o 795 ttggggggggtt s 796 ggggttgggggtt s 797 ggtggtgtaggttttgg o 798 bgagaazgctcgaccttcgat o 799 tcaacgttaacgttaacgtt o 800 bgagcaagztggaccttccat o 801 bgagaazgctccagcactgat o 802 tcaazgttgax o 803 gzaatattgcx o 804 tgctgcttttgtcgttttgtgctt o 805 ctgcgttagcaatttaactgtg o 806 tccatgacgttcctgatgct s 807 tgcatgccgtgcatccgtacacagctct s 808 tgcatgccgtacacagctct s 809 tgcatcagctct s 810 tgcgctct s 811 cccccccccccccccccccc s 812 cccccccccccc s 813 cccccccc s 814 tgcatcagctct sos 815 tgcatgccgtacacagctct o 816 gagcaagctggaccttccat s 817 tcaacgttaacgttaacgttaacgttaacgt s t 818 gagaacgctcgaccttcgat s 819 gtccccatttcccagaggaggaaat o 820 ctagcggctgacgtcatcaagctag o 821 ctagcttgatgacgtcagccgctag o 822 cggctgacgtcatcaa s 823 ctgacgtg o 824 ctgacgtcat o 825 attcgatcggggcggggcgag o 826 ctcgccccgccccgatcgaat o 827 gactgacgtcagcgt o 828 ctagcggctgacgtcataaagctagc s 829 ctagctttatgacgtcagccgctagc s 830 ctagcggctgagctcataaagctagc s 831 ctagtggctgacgtcatcaagctag s 832 tccaccacgtggtctatgct s 833 gggaatgaaagattttattataag o 834 tctaaaaaccatctattcttaaccct o 835 agctcaacgtcatgc o 836 ttaacggtggtagcggtattggtc o 837 ttaagaccaataccgctaccaccg o 838 gatctagtgatgagtcagccggatc o 839 gatccggctgactcatcactagatc o 840 tccaagacgttcctgatgct o 841 tccatgacgtccctgatgct o 842 tccaccacgtggctgatgct o 843 ccacgtggacctctagc o 844 tcagaccacgtggtcgggtgttcctga o 845 tcaggaacacccgaccacgtggtctga o 846 catttccacgatttccca o 847 ttcctctctgcaagagact o 848 tgtatctctctgaaggact o 849 ataaagcgaaactagcagcagtttc o 850 gaaactgctgctagtttcgctttat o 851 tgcccaaagaggaaaatttgtttcatacag o 852 ctgtatgaaacaaattttcctctttgggca o 853 ttagggttagggttagggtt ss 854 tccatgagcttcctgatgct ss 855 aaaacatgacgttcaaaaaa ss 856 aaaacatgacgttcgggggg ss 857 ggggcatgagcttcgggggg sos 858 ctaggctgacgtcatcaagctagt o 859 tctgacgtcatctgacgttggctgacgtct o 860 ggaattagtaatagatatagaagtt o 861 tttaccttttataaacataactaaaacaaa o 862 gcgtttttttttgcg s 863 atatctaatcaaaacattaacaaa o
864 tctatcccaggtggttcctgttag o 865 btccatgacgttcctgatgct o 866 btccatgagcttcctgatgct o 867 tttttttttttttf o 868 tttttttttttttf so 869 ctagcttgatgagctcagccgctag o 870 ttcagttgtcttgctgcttagctaa o 871 tccatgagcttcctgagtct s 872 ctagcggctgacgtcatcaatctag o 873 tgctagctgtgcctgtacct s 874 atgctaaaggacgtcacattgca o 875 tgcaatgtgacgtcctttagcat o 876 gtaggggactttccgagctcgagatcctatg o 877 cataggatctcgagctcggaaagtcccctac o 878 ctgtcaggaactgcaggtaagg o 879 cataacataggaatatttactcctcgc o 880 ctccagctccaagaaaggacg o 881 gaagtttctggtaagtcttcg o 882 tgctgcttttgtgcttttgtgctt s 883 tcgtcgttttgtggttttgtggtt s 884 tcgtcgtttgtcgttttgtcgtt s 885 tcctgacgttcggcgcgcgccc s 886 tgctgcttttgtgcttttgtgctt 887 tccatgagcttcctgagctt s 888 tcgtcgtttcgtcgttttgacgtt s 889 tcgtcgtttgcgtgcgtttcgtcgtt s 890 tcgcgtgcgttttgtcgttttgacgtt s 891 ttcgtcgttttgtcgttttgtcgtt s 892 tcctgacggggaagt s 893 tcctggcgtggaagt s 894 tcctggcggtgaagt s 895 tcctggcgttgaagt s 896 tcctgacgtggaagt s 897 gcgacgttcggcgcgcgccc s 898 gcgacgggcggcgcgcgccc s 899 gcggcgtgcggcgcgcgccc s 900 gcggcggtcggcgcgcgccc s 901 gcgacggtcggcgcgcgccc s 902 gcggcgttcggcgcgcgccc s 903 gcgacgtgcggcgcgcgccc s 904 tcgtcgctgtctccg s 905 tgtgggggttttggttttgg s 906 aggggaggggaggggagggg s 907 tgtgtgtgtgtgtgtgtgtgt s 908 ctctctctctctctctctctct chimeric 909 ggggtcgacgtcgagggggg s 910 atatatatatatatatatatat s 912 ttttttttttttttttttttt s 914 gctagaggggagggt 915 gctagatgttagggg 916 gcatgagggggagct 917 atggaaggtccagggggctc 918 atggactctggagggggctc 919 atggaaggtccaaggggctc 920 gagaaggggggaccttggat 921 gagaaggggggaccttccat 922 gagaaggggccagcactgat 923 tccatgtggggcctgatgct 924 tccatgaggggcctgatgct 925 tccatgtggggcctgctgat 926 atggactctccggggttctc 927 atggaaggtccggggttctc 928 atggactctggaggggtctc 929 atggaggctccatggggctc 930 atggactctggggggttctc 931 tccatgtgggtggggatgct 932 tccatgcgggtggggatgct 933 tccatgggggtcctgatgct 934 tccatggggtccctgatgct 935 tccatggggtgcctgatgct 936 tccatggggttcctgatgct 937 tccatcgggggcctgatgct 938 gctagagggagtgt 940 gmggtcaacgttgagggmggg s 941 ggggagttcgttgaggggggg s 942 tcgtcgtttccccccccccc s 943 ttggggggttttttttttttttttt s 944 tttaaattttaaaatttaaaata s 945 ttggtttttttggtttttttttgg s 946 tttcccttttccccttttcccctc s 947 ggggtcatcgatgagggggg s sos 948 tccatgacgttcctgacgtt 949 tccatgacgttcctgacgtt 950 tccatgacgttcctgacgtt 951 tccatgacgttcctgacgtt 952 tccatgacgttcctgacgtt 953 tccatgacgttcctgacgtt 954 tccatgacgttcctgacgtt 955 tccatgacgttcctgacgtt 956 tccatgacgttcctgacgtt 957 tccatgacgttcctgacgtt 958 tccatgacgttcctgacgtt 959 gggggacgatcgtcggggg sos 960 gggggtcgtacgacgggggg sos 962 aaaaaaaaaaaaaaaaaaaaaaaa po 963 cccccccccccccccccccccccc po 964 tcgtcgttttgtcgttttgtcgtt 965 tcgtcgttttgtcgttttgtcgtt 966 tcgtcgttttgtcgttttgtcgtt 967 tcgtcgttttgtcgttttgtcgtt 968 ggggtcaacgttgagggggg 969 ggggtcaacgttgagggggg 970 ggggtcaagcttgagggggg 971 tgctgcttcccccccccccc 972 ggggacgtcgacgtgggggg sos 973 ggggtcgtcgacgagggggg sos 974 ggggtcgacgtacgtcgagggggg sos 975 ggggaccggtaccggtgggggg sos 976 gggtcgacgtcgagggggg sos 977 ggggtcgacgtcgaggggg sos 978 ggggaacgttaacgttgggggg sos 979 ggggtcaccggtgagggggg sos 980 ggggtcgttcgaacgagggggg sos 981 ggggacgttcgaacgtgggggg sos 982 tcaactttga s 983 tcaagcttga s 984 tcacgatcgtga s 985 tcagcatgctga s 986 gggggagcatgctggggggg sos 987 gggggggggggggggggggg sos 988 gggggacgatatcgtcgggggg sos 989 gggggacgacgtcgtcgggggg sos 990 gggggacgagctcgtcgggggg sos 991 gggggacgtacgtcgggggg sos 992 tcaacgtt
993 tccataccggtcctgatgct 994 tccataccggtcctaccggt s 995 gggggacgatcgttgggggg sos 996 ggggaacgatcgtcgggggg sos 997 ggg ggg acg atc gtc ggg ggg sos 998 ggg gga cga tcg tcg ggg ggg sos 999 aaa gac gtt aaa po 1000 aaagagcttaaa po 1001 aaagazgttaaa po 1002 aaattcggaaaa po 1003 gggggtcatcgatgagggggg sos 1004 gggggtcaacgttgagggggg sos 1005 atgtagcttaataacaaagc po 1006 ggatcccttgagttacttct po 1007 ccattccacttctgattacc po 1008 tatgtattatcatgtagata po 1009 agcctacgtattcaccctcc po 1010 ttcctgcaactactattgta po 1011 atagaaggccctacaccagt po 1012 ttacaccggtctatggaggt po 1013 ctaaccagatcaagtctagg po 1014 cctagacttgatctggttag po 1015 tataagcctcgtccgacatg po 1016 catgtcggacgaggcttata po 1017 tggtggtggggagtaagctc po 1018 gagctactcccccaccacca po 1019 gccttcgatcttcgttggga po 1020 tggacttctctttgccgtct po 1021 atgctgtagcccagcgataa po 1022 accgaatcagcggaaagtga po 1023 tccatgacgttcctgacgtt 1024 ggagaaacccatgagctcatctgg 1025 accacagaccagcaggcaga 1026 gagcgtgaactgcgcgaaga 1027 tcggtacccttgcagcggtt 1028 ctggagccctagccaaggat 1029 gcgactccatcaccagcgat 1030 cctgaagtaagaaccagatgt 1031 ctgtgttatctgacatacacc 1032 aattagccttaggtgattggg 1033 acatctggttcttacttcagg 1034 ataagtcatattttgggaactac 1035 cccaatcacctaaggctaatt 1036 ggggtcgtcgacgagggggg sos 1037 ggggtcgttcgaacgagggggg sos 1038 ggggacgttcgaacgtgggggg sos 1039 tcctggcgqggaagt s 1040 ggggaacgacgtcgttgggggg sos 1041 ggggaacgtacgtcgggggg sos 1042 ggggaacgtacgtacgttgggggg sos 1043 ggggtcaccggtgagggggg sos 1044 ggggtcgacgtacgtcgagggggg sos 1045 ggggaccggtaccggtgggggg sos 1046 gggtcgacgtcgagggggg sos 1047 ggggtcgacgtcgagggg sos 1048 ggggaacgttaacgttgggggg sos 1049 ggggacgtcgacgtggggg sos 1050 gcactcttcgaagctacagccggcagcctct gat 1051 cggctcttccatgaggtctttgctaatcttg g 1052 cggctcttccatgaaagtctttggacgatgt gagc 1053 tcctgcaggttaagt s 1054 gggggtcgttcgttgggggg sos 1055 gggggatgattgttgggggg sos 1056 gggggazgatzgttgggggg sos 1057 gggggagctagcttgggggg sos 1058 ggttcttttggtccttgtct s 1059 ggttcttttggtcctcgtct s 1060 ggttcttttggtccttatct s 1061 ggttcttggtttccttgtct s 1062 tggtcttttggtccttgtct s 1063 ggttcaaatggtccttgtct s 1064 gggtcttttgggccttgtct s 1065 tccaggacttctctcaggtttttt s 1066 tccaaaacttctctcaaatt s 1067 tactacttttatacttttatactt s 1068 tgtgtgtgtgtgtgtgtgtgtgtg s 1069 ttgttgttgttgtttgttgttgttg s 1070 ggctccggggagggaatttttgtctat s 1071 gggacgatcgtcggggggg sos 1072 gggtcgtcgacgaggggggg sos 1073 ggtcgtcgacgaggggggg sos 1074 gggtcgtcgtcgtggggggg sos 1075 ggggacgatcgtcggggggg sos 1076 ggggacgtcgtcgtgggggg sos 1077 ggggtcgacgtcgacgtcgaggggggg sos 1078 ggggaaccgcggttggggggg sos 1079 ggggacgacgtcgtggggggg sos 1080 tcgtcgtcgtcgtcgtggggggg sos 1081 tcctgccggggaagt s 1082 tcctgcaggggaagt s 1083 tcctgaaggggaagt s 1084 tcctggcgggcaagt s 1085 tcctggcgggtaagt s 1086 tcctggcgggaaagt s 1087 tccgggcggggaagt s 1088 tcggggcggggaagt s 1089 tcccggcggggaagt s 1090 gggggacgttggggg s 1091 ggggttttttttttgggggg sos 1092 ggggccccccccccgggggg sos 1093 ggggttgttgttgttgggggg sos 1094 tttttttttttttttttttttttttttttt 1095 aaaaaaaaaaaaaaaaaaaaaaaaaaaaaa 1096 cccccccccccccccccccccccccccccc 1097 cgcgcgcgcgcgcgcgcgcgcgcgcgcgcg
[0150]While CpG effects in mice are well characterized, information regarding the human system is limited. CpG phosphorothioate oligonucleotides with strong stimulatory activity in the mouse system show lower activity on human and other non-rodent immune cells. In the examples the development of a potent human CpG motif and the characterization of its effects and mechanisms of action on human primary B-cells is described. DNA containing this CpG motif strongly stimulated primary human B-cells to proliferate, to produce IL-6 and to express increased levels of CD86, CD40, CD54 and MHC II. It increased DNA binding activity of the transcription factors NFκB and AP-1, as well as phosphorylation of the stress activated protein kinases JNK and p38, and the transcription factor ATF-2. B-cell signaling pathways activated by CpG DNA were different from those activated by the B-cell receptor which activated ERK and a different isoform of JNK, but did not activate p38 and ATF-2. In general the data on CpG DNA-initiated signal transduction are consistent with those obtained in mice (Hacker H., Mischak H., Miethke T., Liptay S., Schmid R., Sparwasser T., Heeg K., Lipford G. B., and Wagner H. 1998. CpG-DNA-specific activation of antigen-presenting cells requires stress kinase activity and is preceded by non-specific endocytosis and endosomal maturation. Embo J 17:6230, Yi A. K., and Krieg A. M. 1998. Rapid induction of mitogen-activated protein kinases by immune stimulatory CpG DNA. J Immunol 161:4493).
[0151]The preferred non-rodent motif is 5' TCGTCGTT 3'. Base exchanges within the most potent 8 mer CpG motif (5' TCGTCGTT 3') diminished the activity of the oligonucleotide. The thymidines at the 5' and the 3' position of this motif were more important than the thymidine at the middle position. An adenine or guanosine at the middle position produced a decrease in the activity.
[0152]Of note, our studies demonstrate that one human CpG motif within a phosphodiester oligonucleotide (2080) is sufficient to produce the maximal effect, and that additional CpG motifs (2059) did not further enhance the activity. The oligonucleotide with the 8 mer motif 5' TCG TCG TT 3' (2080) containing two CpG dinucleotides showed the highest activity in the studies. Replacement of the bases flanking the two CpG dinucleotides (5' position, middle position, 3' position) reduced the activity of this sequence. Both CpG dinucleotides within the 8 mer CpG motif were required for the optimal activity (2108, 2106). Cytidine methylation of the CpG dinucleotides (2095) abolished the activity of 2080, while methylation of an unrelated cytidine (2094) did not. The addition of two CpG motifs into the sequence of 2080 resulting in 2059 did not further increase the activity of the phosphodiester oligonucleotide. The sequence of 2080 with a phosphorothioate backbone (2116) demonstrated less activity, suggesting that additional CpG motifs are preferred for a potent phosphorothioate oligonucleotide.
[0153]It has been discovered according to the invention that the immunostimulatory nucleic acids have dramatic immune stimulatory effects on human cells such as NK cells, B cells, and DCs in vitro. It has been demonstrated that that the in vitro assays used herein predict in vivo effectiveness as a vaccine adjuvant in non-rodent vertebrates (Example 12), suggesting that immunostimulatory nucleic acids are effective therapeutic agents for human vaccination, cancer immunotherapy, asthma immunotherapy, general enhancement of immune function, enhancement of hematopoietic recovery following radiation or chemotherapy, and other immune modulatory applications.
[0154]Thus the immunostimulatory nucleic acids are useful in some aspects of the invention as a prophylactic vaccine for the treatment of a subject at risk of developing an infection with an infectious organism or a cancer in which a specific cancer antigen has been identified or an allergy or asthma where the allergen or predisposition to asthma is known. The immunostimulatory nucleic acids can also be given without the antigen or allergen for shorter term protection against infection, allergy or cancer, and in this case repeated doses will allow longer term protection. A subject at risk as used herein is a subject who has any risk of exposure to an infection causing pathogen or a cancer or an allergen or a risk of developing cancer. For instance, a subject at risk may be a subject who is planning to travel to an area where a particular type of infectious agent is found or it may be a subject who through lifestyle or medical procedures is exposed to bodily fluids which may contain infectious organisms or directly to the organism or even any subject living in an area where an infectious organism or an allergen has been identified. Subjects at risk of developing infection also include general populations to which a medical agency recommends vaccination with a particular infectious organism antigen. If the antigen is an allergen and the subject develops allergic responses to that particular antigen and the subject may be exposed to the antigen, i.e., during pollen season, then that subject is at risk of exposure to the antigen. A subject at risk of developing an allergy to asthma includes those subjects that have been identified as having an allergy or asthma but that don't have the active disease during the immunostimulatory nucleic acid treatment as well as subjects that are considered to be at risk of developing these diseases because of genetic or environmental factors.
[0155]A subject at risk of developing a cancer is one who is who has a high probability of developing cancer. These subjects include, for instance, subjects having a genetic abnormality, the presence of which has been demonstrated to have a correlative relation to a higher likelihood of developing a cancer and subjects exposed to cancer causing agents such as tobacco, asbestos, or other chemical toxins, or a subject who has previously been treated for cancer and is in apparent remission. When a subject at risk of developing a cancer is treated with an antigen specific for the type of cancer to which the subject is at risk of developing and a immunostimulatory nucleic acid, the subject may be able to kill the cancer cells as they develop. If a tumor begins to form in the subject, the subject will develop a specific immune response against the tumor antigen.
[0156]In addition to the use of the immunostimulatory nucleic acids for prophylactic treatment, the invention also encompasses the use of the immunostimulatory nucleic acids for the treatment of a subject having an infection, an allergy, asthma, or a cancer.
[0157]A subject having an infection is a subject that has been exposed to an infectious pathogen and has acute or chronic detectable levels of the pathogen in the body. The immunostimulatory nucleic acids can be used with an antigen to mount an antigen specific systemic or mucosal immune response that is capable of reducing the level of or eradicating the infectious pathogen. An infectious disease, as used herein, is a disease arising from the presence of a foreign microorganism in the body. It is particularly important to develop effective vaccine strategies and treatments to protect the body's mucosal surfaces, which are the primary site of pathogenic entry.
[0158]A subject having an allergy is a subject that has or is at risk of developing an allergic reaction in response to an allergen. An allergy refers to acquired hypersensitivity to a substance (allergen). Allergic conditions include but are not limited to eczema, allergic rhinitis or coryza, hay fever, conjunctivitis, bronchial asthma, urticaria (hives) and food allergies, and other atopic conditions.
[0159]Currently, allergic diseases are generally treated by the injection of small doses of antigen followed by subsequent increasing dosage of antigen. It is believed that this procedure induces tolerization to the allergen to prevent further allergic reactions. These methods, however, can take several years to be effective and are associated with the risk of side effects such as anaphylactic shock. The methods of the invention avoid these problems.
[0160]Allergies are generally caused by IgE antibody generation against harmless allergens. The cytokines that are induced by systemic or mucosal administration of immunostimulatory nucleic acids are predominantly of a class called Th1 (examples are IL-12 and IFN-γ) and these induce both humoral and cellular immune responses. The types of antibodies associated with a Th1 response are generally more protective because they have high neutralization and opsonization capabilities. The other major type of immune response, which is associated with the production of IL-4, IL-5 and IL-10 cytokines, is termed a Th2 immune response. Th2 responses involve predominately antibodies and these have less protective effect against infection and some Th2 isotypes (e.g., IgE) are associated with allergy. In general, it appears that allergic diseases are mediated by Th2 type immune responses while Th1 responses provide the best protection against infection, although excessive Th1 responses are associated with autoimmune disease. Based on the ability of the immunostimulatory nucleic acids to shift the immune response in a subject from a Th2 (which is associated with production of IgE antibodies and allergy) to a Th1 response (which is protective against allergic reactions), an effective dose for inducing an immune response of a immunostimulatory nucleic acid can be administered to a subject to treat or prevent an allergy.
[0161]Thus, the immunostimulatory nucleic acids have significant therapeutic utility in the treatment of allergic and non-allergic conditions such as asthma. Th2 cytokines, especially IL-4 and IL-5 are elevated in the airways of asthmatic subjects. These cytokines promote important aspects of the asthmatic inflammatory response, including IgE isotope switching, eosinophil chemotaxis and activation and mast cell growth. Th1 cytokines, especially IFN-γ and IL-12, can suppress the formation of Th2 clones and production of Th2 cytokines. Asthma refers to a disorder of the respiratory system characterized by inflammation, narrowing of the airways and increased reactivity of the airways to inhaled agents. Asthma is frequently, although not exclusively associated with atopic or allergic symptoms.
[0162]A subject having a cancer is a subject that has detectable cancerous cells. The cancer may be a malignant or non-malignant cancer. Cancers or tumors include but are not limited to biliary tract cancer; brain cancer; breast cancer; cervical cancer; choriocarcinoma; colon cancer; endometrial cancer; esophageal cancer; gastric cancer; intraepithelial neoplasms; lymphomas; liver cancer; lung cancer (e.g. small cell and non-small cell); melanoma; neuroblastomas; oral cancer; ovarian cancer; pancreas cancer; prostate cancer; rectal cancer; sarcomas; skin cancer; testicular cancer; thyroid cancer; and renal cancer, as well as other carcinomas and sarcomas. In one embodiment the cancer is hairy cell leukemia, chronic myelogenous leukemia, cutaneous T-cell leukemia, multiple myeloma, follicular lymphoma, malignant melanoma, squamous cell carcinoma, renal cell carcinoma, prostate carcinoma, bladder cell carcinoma, or colon carcinoma.
[0163]A subject according to the invention is a non-rodent subject. A non-rodent subject shall mean a human or vertebrate animal including but not limited to a dog, cat, horse, cow, pig, sheep, goat, chicken, primate, e.g., monkey, and fish (aquaculture species), e.g. salmon, but specifically excluding rodents such as rats and mice.
[0164]Thus, the invention can also be used to treat cancer and tumors in non human subjects. Cancer is one of the leading causes of death in companion animals (i.e., cats and dogs). Cancer usually strikes older animals which, in the case of house pets, have become integrated into the family. Forty-five % of dogs older than 10 years of age, are likely to succumb to the disease. The most common treatment options include surgery, chemotherapy and radiation therapy. Others treatment modalities which have been used with some success are laser therapy, cryotherapy, hyperthermia and immunotherapy. The choice of treatment depends on type of cancer and degree of dissemination. Unless the malignant growth is confined to a discrete area in the body, it is difficult to remove only malignant tissue without also affecting normal cells.
[0165]Malignant disorders commonly diagnosed in dogs and cats include but are not limited to lymphosarcoma, osteosarcoma, mammary tumors, mastocytoma, brain tumor, melanoma, adenosquamous carcinoma, carcinoid lung tumor, bronchial gland tumor, bronchiolar adenocarcinoma, fibroma, myxochondroma, pulmonary sarcoma, neurosarcoma, osteoma, papilloma, retinoblastoma, Ewing's sarcoma, Wilm's tumor, Burkitt's lymphoma, microglioma, neuroblastoma, osteoclastoma, oral neoplasia, fibrosarcoma, osteosarcoma and rhabdomyosarcoma. Other neoplasias in dogs include genital squamous cell carcinoma, transmissable veneral tumor, testicular tumor, seminoma, Sertoli cell tumor, hemangiopericytoma, histiocytoma, chloroma (granulocytic sarcoma), corneal papilloma, corneal squamous cell carcinoma, hemangiosarcoma, pleural mesothelioma, basal cell tumor, thymoma, stomach tumor, adrenal gland carcinoma, oral papillomatosis, hemangioendothelioma and cystadenoma. Additional malignancies diagnosed in cats include follicular lymphoma, intestinal lymphosarcoma, fibrosarcoma and pulmonary squamous cell carcinoma. The ferret, an ever-more popular house pet is known to develop insulinoma, lymphoma, sarcoma, neuroma, pancreatic islet cell tumor, gastric MALT lymphoma and gastric adenocarcinoma.
[0166]Neoplasias affecting agricultural livestock include leukemia, hemangiopericytoma and bovine ocular neoplasia (in cattle); preputial fibrosarcoma, ulcerative squamous cell carcinoma, preputial carcinoma, connective tissue neoplasia and mastocytoma (in horses); hepatocellular carcinoma (in swine); lymphoma and pulmonary adenomatosis (in sheep); pulmonary sarcoma, lymphoma, Rous sarcoma, reticulendotheliosis, fibrosarcoma, nephroblastoma, B-cell lymphoma and lymphoid leukosis (in avian species); retinoblastoma, hepatic neoplasia, lymphosarcoma (lymphoblastic lymphoma), plasmacytoid leukemia and swimbladder sarcoma (in fish), caseous lumphadenitis (CLA): chronic, infectious, contagious disease of sheep and goats caused by the bacterium Corynebacterium pseudotuberculosis, and contagious lung tumor of sheep caused by jaagsiekte.
[0167]The subject is exposed to the antigen. As used herein, the term exposed to refers to either the active step of contacting the subject with an antigen or the passive exposure of the subject to the antigen in vivo. Methods for the active exposure of a subject to an antigen are well-known in the art. In general, an antigen is administered directly to the subject by any means such as intravenous, intramuscular, oral, transdermal, mucosal, intranasal, intratracheal, or subcutaneous administration. The antigen can be administered systemically or locally. Methods for administering the antigen and the immunostimulatory nucleic acid are described in more detail below. A subject is passively exposed to an antigen if an antigen becomes available for exposure to the immune cells in the body. A subject may be passively exposed to an antigen, for instance, by entry of a foreign pathogen into the body or by the development of a tumor cell expressing a foreign antigen on its surface.
[0168]The methods in which a subject is passively exposed to an antigen can be particularly dependent on timing of administration of the immunostimulatory nucleic acid. For instance, in a subject at risk of developing a cancer or an infectious disease or an allergic or asthmatic response, the subject may be administered the immunostimulatory nucleic acid on a regular basis when that risk is greatest, i.e., during allergy season or after exposure to a cancer causing agent. Additionally the immunostimulatory nucleic acid may be administered to travelers before they travel to foreign lands where they are at risk of exposure to infectious agents. Likewise the immunostimulatory nucleic acid may be administered to soldiers or civilians at risk of exposure to biowarfare to induce a systemic or mucosal immune response to the antigen when and if the subject is exposed to it.
[0169]An antigen as used herein is a molecule capable of provoking an immune response. Antigens include but are not limited to cells, cell extracts, proteins, polypeptides, peptides, polysaccharides, polysaccharide conjugates, peptide and non-peptide mimics of polysaccharides and other molecules, small molecules, lipids, glycolipids, carbohydrates, viruses and viral extracts and muticellular organisms such as parasites and allergens. The term antigen broadly includes any type of molecule which is recognized by a host immune system as being foreign. Antigens include but are not limited to cancer antigens, microbial antigens, and allergens.
[0170]A cancer antigen as used herein is a compound, such as a peptide or protein, associated with a tumor or cancer cell surface and which is capable of provoking an immune response when expressed on the surface of an antigen presenting cell in the context of an MHC molecule. Cancer antigens can be prepared from cancer cells either by preparing crude extracts of cancer cells, for example, as described in Cohen, et al., 1994, Cancer Research, 54:1055, by partially purifying the antigens, by recombinant technology, or by de novo synthesis of known antigens. Cancer antigens include but are not limited to antigens that are recombinantly expressed, an immunogenic portion of, or a whole tumor or cancer. Such antigens can be isolated or prepared recombinantly or by any other means known in the art.
[0171]A microbial antigen as used herein is an antigen of a microorganism and includes but is not limited to virus, bacteria, parasites, and fungi. Such antigens include the intact microorganism as well as natural isolates and fragments or derivatives thereof and also synthetic compounds which are identical to or similar to natural microorganism antigens and induce an immune response specific for that microorganism. A compound is similar to a natural microorganism antigen if it induces an immune response (humoral and/or cellular) to a natural microorganism antigen. Such antigens are used routinely in the art and are well known to those of ordinary skill in the art.
[0172]Examples of viruses that have been found in humans include but are not limited to: Retroviridae (e.g. human immunodeficiency viruses, such as HIV-1 (also referred to as HTLV-III, LAV or HTLV-III/LAV, or HIV-III; and other isolates, such as HIV-LP; Picornaviridae (e.g. polio viruses, hepatitis A virus; enteroviruses, human Coxsackie viruses, rhinoviruses, echoviruses); Calciviridae (e.g. strains that cause gastroenteritis); Togaviridae (e.g. equine encephalitis viruses, rubella viruses); Flaviridae (e.g. dengue viruses, encephalitis viruses, yellow fever viruses); Coronoviridae (e.g. coronaviruses); Rhabdoviradae (e.g. vesicular stomatitis viruses, rabies viruses); Coronaviridae (e.g. coronaviruses); Rhabdoviridae (e.g. vesicular stomatitis viruses, rabies viruses); Filoviridae (e.g. ebola viruses); Paramyxoviridae (e.g. parainfluenza viruses, mumps virus, measles virus, respiratory syncytial virus); Orthomyxoviridae (e.g. influenza viruses); Bungaviridae (e.g. Hantaan viruses, bunga viruses, phleboviruses and Nairo viruses); Arena viridae (hemorrhagic fever viruses); Reoviridae (e.g. reoviruses, orbiviurses and rotaviruses); Birnaviridae; Hepadnaviridae (Hepatitis B virus); Parvovirida (parvoviruses); Papovaviridae (papilloma viruses, polyoma viruses); Adenoviridae (most adenoviruses); Herpesviridae (herpes simplex virus (HSV) 1 and 2, varicella zoster virus, cytomegalovirus (CMV), herpes virus; Poxyiridae (variola viruses, vaccinia viruses, pox viruses); and Iridoviridae (e.g. African swine fever virus); and unclassified viruses (e.g. the etiological agents of Spongiform encephalopathies, the agent of delta hepatitis (thought to be a defective satellite of hepatitis B virus), the agents of non-A, non-B hepatitis (class 1=internally transmitted; class 2=parenterally transmitted (i.e. Hepatitis C); Norwalk and related viruses, and astroviruses).
[0173]Both gram negative and gram positive bacteria serve as antigens in vertebrate animals. Such gram positive bacteria include, but are not limited to, Pasteurella species, Staphylococci species, and Streptococcus species. Gram negative bacteria include, but are not limited to, Escherichia coli, Pseudomonas species, and Salmonella species. Specific examples of infectious bacteria include but are not limited to, Helicobacter pyloris, Borelia burgdorferi, Legionella pneumophilia, Mycobacteria sps (e.g. M. tuberculosis, M. avium, M. intracellulare, M. kansaii, M. gordonae), Staphylococcus aureus, Neisseria gonorrhoeae, Neisseria meningitidis, Listeria monocytogenes, Streptococcus pyogenes (Group A Streptococcus), Streptococcus agalactiae (Group B Streptococcus), Streptococcus (viridans group), Streptococcus faecalis, Streptococcus bovis, Streptococcus (anaerobic sps.), Streptococcus pneumoniae, pathogenic Campylobacter sp., Enterococcus sp., Haemophilus influenzae, Bacillus antracis, corynebacterium diphtheriae, corynebacterium sp., Erysipelothrix rhusiopathiae, Clostridium perfringers, Clostridium tetani, Enterobacter aerogenes, Klebsiella pneumoniae, Pasturella multocida, Bacteroides sp., Fusobacterium nucleatum, Streptobacillus moniliformis, Treponema pallidium, Treponema pertenue, Leptospira, Rickettsia, and Actinomyces israelli.
[0174]Examples of fungi include Cryptococcus neoformans, Histoplasma capsulatum, Coccidioides immitis, Blastomyces dermatitidis, Chlamydia trachomatis, Candida albicans.
[0175]Other infectious organisms (i.e., protists) include Plasmodium spp. such as Plasmodium falciparum, Plasmodium malariae, Plasmodium ovale, and Plasmodium vivax and Toxoplasma gondii. Blood-borne and/or tissues parasites include Plasmodium spp., Babesia microti, Babesia divergens, Leishmania tropica, Leishmania spp., Leishmania braziliensis, Leishmania donovani, Trypanosoma gambiense and Trypanosoma rhodesiense (African sleeping sickness), Trypanosoma cruzi (Chagas' disease), and Toxoplasma gondii.
[0176]Other medically relevant microorganisms have been described extensively in the literature, e.g., see C. G. A Thomas, Medical Microbiology, Bailliere Tindall, Great Britain 1983, the entire contents of which is hereby incorporated by reference.
[0177]Although many of the microbial antigens described above relate to human disorders, the invention is also useful for treating other nonhuman vertebrates. Nonhuman vertebrates are also capable of developing infections which can be prevented or treated with the Immunostimulatory nucleic acids disclosed herein. For instance, in addition to the treatment of infectious human diseases, the methods of the invention are useful for treating infections of animals.
[0178]As used herein, the term treat, treated, or treating when used with respect to an infectious disease refers to a prophylactic treatment which increases the resistance of a subject (a subject at risk of infection) to infection with a pathogen or, in other words, decreases the likelihood that the subject will become infected with the pathogen as well as a treatment after the subject (a subject who has been infected) has become infected in order to fight the infection, e.g., reduce or eliminate the infection or prevent it from becoming worse.
[0179]Many vaccines for the treatment of non-human vertebrates are disclosed in Bennett, K. Compendium of Veterinary Products, 3rd ed. North American Compendiums, Inc., 1995. As discussed above, antigens include infectious microbes such as virus, parasite, bacteria and fungi and fragments thereof, derived from natural sources or synthetically. Infectious viruses of both human and non-human vertebrates, include retroviruses, RNA viruses and DNA viruses. This group of retroviruses includes both simple retroviruses and complex retroviruses. The simple retroviruses include the subgroups of B-type retroviruses, C-type retroviruses and D-type retroviruses. An example of a B-type retrovirus is mouse mammary tumor virus (MMTV). The C-type retroviruses include subgroups C-type group A (including Rous sarcoma virus (RSV), avian leukemia virus (ALV), and avian myeloblastosis virus (AMV)) and C-type group B (including feline leukemia virus (FeLV), gibbon ape leukemia virus (GALV), spleen necrosis virus (SNV), reticuloendotheliosis virus (RV) and simian sarcoma virus (SSV)). The D-type retroviruses include Mason-Pfizer monkey virus (MPMV) and simian retrovirus type 1 (SRV-1). The complex retroviruses include the subgroups of lentiviruses, T-cell leukemia viruses and the foamy viruses. Lentiviruses include HIV-1, but also include HIV-2, SIV, Visna virus, feline immunodeficiency virus (FIV), and equine infectious anemia virus (EIAV). The T-cell leukemia viruses include HTLV-1, HTLV-II, simian T-cell leukemia virus (STLV), and bovine leukemia virus (BLV). The foamy viruses include human foamy virus (HFV), simian foamy virus (SFV) and bovine foamy virus (BFV).
[0180]Examples of other RNA viruses that are antigens in vertebrate animals include, but are not limited to, members of the family Reoviridae, including the genus Orthoreovirus (multiple serotypes of both mammalian and avian retroviruses), the genus Orbivirus (Bluetongue virus, Eugenangee virus, Kemerovo virus, African horse sickness virus, and Colorado Tick Fever virus), the genus Rotavirus (human rotavirus, Nebraska calf diarrhea virus, simian rotavirus, bovine or ovine rotavirus, avian rotavirus); the family Picornaviridae, including the genus Enterovirus (poliovirus, Coxsackie virus A and B, enteric cytopathic human orphan (ECHO) viruses, hepatitis A virus, Simian enteroviruses, Murine encephalomyelitis (ME) viruses, Poliovirus muris, Bovine enteroviruses, Porcine enteroviruses, the genus Cardiovirus (Encephalomyocarditis virus (EMC), Mengovirus), the genus Rhinovirus (Human rhinoviruses including at least 113 subtypes; other rhinoviruses), the genus Apthovirus (Foot and Mouth disease (FMDV); the family Calciviridae, including Vesicular exanthema of swine virus, San Miguel sea lion virus, Feline picornavirus and Norwalk virus; the family Togaviridae, including the genus Alphavirus (Eastern equine encephalitis virus, Semliki forest virus, Sindbis virus, Chikungunya virus, O'Nyong-Nyong virus, Ross river virus, Venezuelan equine encephalitis virus, Western equine encephalitis virus), the genus Flavirius (Mosquito borne yellow fever virus, Dengue virus, Japanese encephalitis virus, St. Louis encephalitis virus, Murray Valley encephalitis virus, West Nile virus, Kunjin virus, Central European tick borne virus, Far Eastern tick borne virus, Kyasanur forest virus, Louping III virus, Powassan virus, Omsk hemorrhagic fever virus), the genus Rubivirus (Rubella virus), the genus Pestivirus (Mucosal disease virus, Hog cholera virus, Border disease virus); the family Bunyaviridae, including the genus Bunyvirus (Bunyamwera and related viruses, California encephalitis group viruses), the genus Phlebovirus (Sandfly fever Sicilian virus, Rift Valley fever virus), the genus Nairovirus (Crimean-Congo hemorrhagic fever virus, Nairobi sheep disease virus), and the genus Uukuvirus (Uukuniemi and related viruses); the family Orthomyxoviridae, including the genus Influenza virus (Influenza virus type A, many human subtypes); Swine influenza virus, and Avian and Equine Influenza viruses; influenza type B (many human subtypes), and influenza type C (possible separate genus); the family paramyxoviridae, including the genus Paramyxovirus (Parainfluenza virus type 1, Sendai virus, Hemadsorption virus, Parainfluenza viruses types 2 to 5, Newcastle Disease Virus, Mumps virus), the genus Morbillivirus (Measles virus, subacute sclerosing panencephalitis virus, distemper virus, Rinderpest virus), the genus Pneumovirus (respiratory syncytial virus (RSV), Bovine respiratory syncytial virus and Pneumonia virus); the family Rhabdoviridae, including the genus Vesiculovirus (VSV), Chandipura virus, Flanders-Hart Park virus), the genus Lyssavirus (Rabies virus), fish Rhabdoviruses, and two probable Rhabdoviruses (Marburg virus and Ebola virus); the family Arenaviridae, including Lymphocytic choriomeningitis virus (LCM), Tacaribe virus complex, and Lassa virus; the family Coronoaviridae, including Infectious Bronchitis Virus (IBV), Hepatitis virus, Human enteric corona virus, and Feline infectious peritonitis (Feline coronavirus).
[0181]Illustrative DNA viruses that are antigens in vertebrate animals include, but are not limited to, the family Poxyiridae, including the genus Orthopoxvirus (Variola major, Variola minor, Monkey pox Vaccinia, Cowpox, Buffalopox, Rabbitpox, Ectromelia), the genus Leporipoxvirus (Myxoma, Fibroma), the genus Avipoxvirus (Fowlpox, other avian poxvirus), the genus Capripoxvirus (sheeppox, goatpox), the genus Suipoxvirus (Swinepox), the genus Parapoxvirus (contagious postular dermatitis virus, pseudocowpox, bovine papular stomatitis virus); the family Iridoviridae (African swine fever virus, Frog viruses 2 and 3, Lymphocystis virus of fish); the family Herpesviridae, including the alpha-Herpesviruses (Herpes Simplex Types 1 and 2, Varicella-Zoster, Equine abortion virus, Equine herpes virus 2 and 3, pseudorabies virus, infectious bovine keratoconjunctivitis virus, infectious bovine rhinotracheitis virus, feline rhinotracheitis virus, infectious laryngotracheitis virus) the Beta-herpesviruses (Human cytomegalovirus and cytomegaloviruses of swine and monkeys); the gamma-herpesviruses (Epstein-Barr virus (EBV), Marek's disease virus, Herpes saimiri, Herpesvirus ateles, Herpesvirus sylvilagus, guinea pig herpes virus, Lucke tumor virus); the family Adenoviridae, including the genus Mastadenovirus (Human subgroups A, B, C, D, E and ungrouped; simian adenoviruses (at least 23 serotypes), infectious canine hepatitis, and adenoviruses of cattle, pigs, sheep, frogs and many other species, the genus Aviadenovirus (Avian adenoviruses); and non-cultivatable adenoviruses; the family Papoviridae, including the genus Papillomavirus (Human papilloma viruses, bovine papilloma viruses, Shope rabbit papilloma virus, and various pathogenic papilloma viruses of other species), the genus Polyomavirus (polyomavirus, Simian vacuolating agent (SV-40), Rabbit vacuolating agent (RKV), K virus, BK virus, JC virus, and other primate polyoma viruses such as Lymphotrophic papilloma virus); the family Parvoviridae including the genus Adeno-associated viruses, the genus Parvovirus (Feline panleukopenia virus, bovine parvovirus, canine parvovirus, Aleutian mink disease virus, etc). Finally, DNA viruses may include viruses which do not fit into the above families such as Kuru and Creutzfeldt-Jacob disease viruses and chronic infectious neuropathic agents (CHINA virus).
[0182]Each of the foregoing lists is illustrative, and is not intended to be limiting.
[0183]In addition to the use of the immunostimulatory nucleic acids to induce an antigen specific immune response in humans, the methods of the preferred embodiments are particularly well suited for treatment of birds such as hens, chickens, turkeys, ducks, geese, quail, and pheasant. Birds are prime targets for many types of infections.
[0184]Hatching birds are exposed to pathogenic microorganisms shortly after birth. Although these birds are initially protected against pathogens by maternal derived antibodies, this protection is only temporary, and the bird's own immature immune system must begin to protect the bird against the pathogens. It is often desirable to prevent infection in young birds when they are most susceptible. It is also desirable to prevent against infection in older birds, especially when the birds are housed in closed quarters, leading to the rapid spread of disease. Thus, it is desirable to administer the Immunostimulatory nucleic acid and the non-nucleic acid adjuvant of the invention to birds to enhance an antigen-specific immune response when antigen is present.
[0185]An example of a common infection in chickens is chicken infectious anemia virus (CIAV). CIAV was first isolated in Japan in 1979 during an investigation of a Marek's disease vaccination break (Yuasa et al., 1979, Avian Dis. 23:366-385). Since that time, CIAV has been detected in commercial poultry in all major poultry producing countries (van Bulow et al., 1991, pp. 690-699) in Diseases of Poultry, 9th edition, Iowa State University Press).
[0186]CIAV infection results in a clinical disease, characterized by anemia, hemorrhage and immunosuppression, in young susceptible chickens. Atrophy of the thymus and of the bone marrow and consistent lesions of CIAV-infected chickens are also characteristic of CIAV infection. Lymphocyte depletion in the thymus, and occasionally in the bursa of Fabricius, results in immunosuppression and increased susceptibility to secondary viral, bacterial, or fungal infections which then complicate the course of the disease. The immunosuppression may cause aggravated disease after infection with one or more of Marek's disease virus (MDV), infectious bursal disease virus, reticuloendotheliosis virus, adenovirus, or reovirus. It has been reported that pathogenesis of MDV is enhanced by CIAV (DeBoer et al., 1989, p. 28 In Proceedings of the 38th Western Poultry Diseases Conference, Tempe, Ariz.). Further, it has been reported that CIAV aggravates the signs of infectious bursal disease (Rosenberger et al., 1989, Avian Dis. 33:707-713). Chickens develop an age resistance to experimentally induced disease due to CAA. This is essentially complete by the age of 2 weeks, but older birds are still susceptible to infection (Yuasa, N. et al., 1979 supra; Yuasa, N. et al., Arian Diseases 24, 202-209, 1980). However, if chickens are dually infected with CAA and an immunosuppressive agent (IBDV, MDV etc.), age resistance against the disease is delayed (Yuasa, N. et al., 1979 and 1980 supra; Bulow von V. et al., J. Veterinary Medicine 33, 93-116, 1986). Characteristics of CIAV that may potentiate disease transmission include high resistance to environmental inactivation and some common disinfectants. The economic impact of CIAV infection on the poultry industry is clear from the fact that 10% to 30% of infected birds in disease outbreaks die.
[0187]Vaccination of birds, like other vertebrate animals can be performed at any age. Normally, vaccinations are performed at up to 12 weeks of age for a live microorganism and between 14-18 weeks for an inactivated microorganism or other type of vaccine. For in ovo vaccination, vaccination can be performed in the last quarter of embryo development. The vaccine may be administered subcutaneously, by spray, orally, intraocularly, intratracheally, nasally, or by other mucosal delivery methods described herein. Thus, the immunostimulatory nucleic acids of the invention can be administered to birds and other non-human vertebrates using routine vaccination schedules and the antigen can be administered after an appropriate time period as described herein.
[0188]Cattle and livestock are also susceptible to infection. Diseases which affect these animals can produce severe economic losses, especially amongst cattle. The methods of the invention can be used to protect against infection in livestock, such as cows, horses, pigs, sheep, and goats.
[0189]Cows can be infected by bovine viruses. Bovine viral diarrhea virus (BVDV) is a small enveloped positive-stranded RNA virus and is classified, along with hog cholera virus (HOCV) and sheep border disease virus (BDV), in the pestivirus genus. Although, Pestiviruses were previously classified in the Togaviridae family, some studies have suggested their reclassification within the Flaviviridae family along with the flavivirus and hepatitis C virus (HCV) groups (Francki, et al., 1991).
[0190]BVDV, which is an important pathogen of cattle can be distinguished, based on cell culture analysis, into cytopathogenic (CP) and noncytopathogenic (NCP) biotypes. The NCP biotype is more widespread although both biotypes can be found in cattle. If a pregnant cow becomes infected with an NCP strain, the cow can give birth to a persistently infected and specifically immunotolerant calf that will spread virus during its lifetime. The persistently infected cattle can succumb to mucosal disease and both biotypes can then be isolated from the animal. Clinical manifestations can include abortion, teratogenesis, and respiratory problems, mucosal disease and mild diarrhea. In addition, severe thrombocytopenia, associated with herd epidemics, that may result in the death of the animal has been described and strains associated with this disease seem more virulent than the classical BVDVs.
[0191]Equine herpes viruses (EHV) comprise a group of antigenically distinct biological agents which cause a variety of infections in horses ranging from subclinical to fatal disease. These include Equine herpesvirus-1 (EHV-1), a ubiquitous pathogen in horses. EHV-1 is associated with epidemics of abortion, respiratory tract disease, and central nervous system disorders. Primary infection of upper respiratory tract of young horses results in a febrile illness which lasts for 8 to 10 days. Immunologically experienced mares may be re-infected via the respiratory tract without disease becoming apparent, so that abortion usually occurs without warning. The neurological syndrome is associated with respiratory disease or abortion and can affect animals of either sex at any age, leading to lack of co-ordination, weakness and posterior paralysis (Telford, E. A. R. et al., Virology 189, 304-316, 1992). Other EHV's include EHV-2, or equine cytomegalovirus, EHV-3, equine coital exanthema virus, and EHV-4, previously classified as EHV-1 subtype 2.
[0192]Sheep and goats can be infected by a variety of dangerous microorganisms including visna-maedi.
[0193]Primates such as monkeys, apes and macaques can be infected by simian immunodeficiency virus. Inactivated cell-virus and cell-free whole simian immunodeficiency vaccines have been reported to afford protection in macaques (Stott et al. (1990) Lancet 36:1538-1541; Desrosiers et al. PNAS USA (1989) 86:6353-6357; Murphey-Corb et al. (1989) Science 246:1293-1297; and Carlson et al. (1990) AIDS Res. Human Retroviruses 6:1239-1246). A recombinant HIV gp120 vaccine has been reported to afford protection in chimpanzees (Berman et al. (1990) Nature 345:622-625).
[0194]Cats, both domestic and wild, are susceptible to infection with a variety of microorganisms. For instance, feline infectious peritonitis is a disease which occurs in both domestic and wild cats, such as lions, leopards, cheetahs, and jaguars. When it is desirable to prevent infection with this and other types of pathogenic organisms in cats, the methods of the invention can be used to vaccinate cats to protect them against infection.
[0195]Domestic cats may become infected with several retroviruses, including but not limited to feline leukemia virus (FeLV), feline sarcoma virus (FeSV), endogenous type Concomavirus (RD-114), and feline syncytia-forming virus (FeSFV). Of these, FeLV is the most significant pathogen, causing diverse symptoms, including lymphoreticular and myeloid neoplasms, anemias, immune mediated disorders, and an immunodeficiency syndrome which is similar to human acquired immune deficiency syndrome (AIDS). Recently, a particular replication-defective FeLV mutant, designated FeLV-AIDS, has been more particularly associated with immunosuppressive properties.
[0196]The discovery of feline T-lymphotropic lentivirus (also referred to as feline immunodeficiency) was first reported in Pedersen et al. (1987) Science 235:790-793. Characteristics of FIV have been reported in Yamamoto et al. (1988) Leukemia, December Supplement 2:204 S-215S; Yamamoto et al. (1988) Am. J. Vet. Res. 49:1246-1258; and Ackley et al. (1990) J. Virol. 64:5652-5655. Cloning and sequence analysis of FIV have been reported in Olmsted et al. (1989) Proc. Natl. Acad. Sci. USA 86:2448-2452 and 86:4355-4360.
[0197]Feline infectious peritonitis (FIP) is a sporadic disease occurring unpredictably in domestic and wild Felidae. While FIP is primarily a disease of domestic cats, it has been diagnosed in lions, mountain lions, leopards, cheetahs, and the jaguar. Smaller wild cats that have been afflicted with FIP include the lynx and caracal, sand cat, and pallas cat. In domestic cats, the disease occurs predominantly in young animals, although cats of all ages are susceptible. A peak incidence occurs between 6 and 12 months of age. A decline in incidence is noted from 5 to 13 years of age, followed by an increased incidence in cats 14 to 15 years old.
[0198]Viral, bacterial, and parasitic diseases in fin-fish, shellfish or other aquatic life forms pose a serious problem for the aquaculture industry. Owing to the high density of animals in the hatchery tanks or enclosed marine farming areas, infectious diseases may eradicate a large proportion of the stock in, for example, a fin-fish, shellfish, or other aquatic life forms facility. Prevention of disease is a more desired remedy to these threats to fish than intervention once the disease is in progress. Vaccination of fish is the only preventative method which may offer long-term protection through immunity. Nucleic acid based vaccinations are described in U.S. Pat. No. 5,780,448 issued to Davis.
[0199]The fish immune system has many features similar to the mammalian immune system, such as the presence of B cells, T cells, lymphokines, complement, and immunoglobulins. Fish have lymphocyte subclasses with roles that appear similar in many respects to those of the B and T cells of mammals. Vaccines can be administered by immersion or orally.
[0200]Aquaculture species include but are not limited to fin-fish, shellfish, and other aquatic animals. Fin-fish include all vertebrate fish, which may be bony or cartilaginous fish, such as, for example, salmonids, carp, catfish, yellowtail, seabream, and seabass. Salmonids are a family of fin-fish which include trout (including rainbow trout), salmon, and Arctic char. Examples of shellfish include, but are not limited to, clams, lobster, shrimp, crab, and oysters. Other cultured aquatic animals include, but are not limited to eels, squid, and octopi.
[0201]Polypeptides of viral aquaculture pathogens include but are not limited to glycoprotein (G) or nucleoprotein (N) of viral hemorrhagic septicemia virus (VHSV); G or N proteins of infectious hematopoietic necrosis virus (IHNV); VP1, VP2, VP3 or N structural proteins of infectious pancreatic necrosis virus (IPNV); G protein of spring viremia of carp (SVC); and a membrane-associated protein, tegumin or capsid protein or glycoprotein of channel catfish virus (CCV).
[0202]Typical parasites infecting horses are Gasterophilus spp.; Eimeria leuckarti, Giardia spp.; Tritrichomonas equi; Babesia spp. (RBC's), Theileria equi; Trypanosoma spp.; Klossiella equi; Sarcocystis spp.
[0203]Typical parasites infecting swine include Eimeria bebliecki, Eimeria scabra, Isospora suis, Giardia spp.; Balantidium coli, Entamoeba histolytica; Toxoplasma gondii and Sarcocystis spp., and Trichinella spiralis.
[0204]The major parasites of dairy and beef cattle include Eimeria spp., Cryptosporidium sp., Giardia spp.; Toxoplasma gondii; Babesia bovis (RBC), Babesia bigemina (RBC), Trypanosoma spp. (plasma), Theileria spp. (RBC); Theileria parva (lymphocytes); Tritrichomonas foetus; and Sarcocystis spp.
[0205]The major parasites of raptors include Trichomonas gallinae; Coccidia (Eimeria spp.); Plasmodium relictum, Leucocytozoon danilewskyi (owls), Haemoproteus spp., Trypanosoma spp.; Histomonas; Cryptosporidium meleagridis, Cryptosporidium baileyi, Giardia, Eimeria; Toxoplasma.
[0206]Typical parasites infecting sheep and goats include Eimeria spp., Cryptosporidium sp., Giardia sp.; Toxoplasma gondii; Babesia spp. (RBC), Trypanosoma spp. (plasma), Theileria spp. (RBC); and Sarcocystis spp.
[0207]Typical parasitic infections in poultry include coccidiosis caused by Eimeria acervulina, E. necatrix, E. tenella, Isospora spp. and Eimeria truncata; histomoniasis, caused by Histomonas meleagridis and Histomonas gallinarum; trichomoniasis caused by Trichomonas gallinae; and hexamitiasis caused by Hexamita meleagridis. Poultry can also be infected Emeria maxima, Emeria meleagridis, Eimeria adenoeides, Eimeria meleagrimitis, Cryptosporidium, Eimeria brunetti, Emeria adenoeides, Leucocytozoon spp., Plasmodium spp., Hemoproteus meleagridis, Toxoplasma gondii and Sarcocystis.
[0208]The methods of the invention can also be applied to the treatment and/or prevention of parasitic infection in dogs, cats, birds, fish and ferrets. Typical parasites of birds include Trichomonas gallinae; Eimeria spp., Isospora spp., Giardia; Cryptosporidium; Sarcocystis spp., Toxoplasma gondii, Haemoproteus/Parahaemoproteus, Plasmodium spp., Leucocytozoon/Akiba, Atoxoplasma, Trypanosoma spp. Typical parasites infecting dogs include Trichinella spiralis; Isopora spp., Sarcocystis spp., Cryptosporidium spp., Hammondia spp., Giardia duodenalis (canis); Balantidium coli, Entamoeba histolytica; Hepatozoon canis; Toxoplasma gondii, Trypanosoma cruzi; Babesia canis; Leishmania amastigotes; Neospora caninum.
[0209]Typical parasites infecting feline species include Isospora spp., Toxoplasma gondii, Sarcocystis spp., Hammondia hammondi, Besnoitia spp., Giardia spp.; Entamoeba histolytica; Hepatozoon canis, Cytauxzoon sp., Cytauxzoon sp., Cytauxzoon sp. (red cells, RE cells).
[0210]Typical parasites infecting fish include Hexamita spp., Eimeria spp.; Cryptobia spp., Nosema spp., Myxosoma spp., Chilodonella spp., Trichodina spp.; Plistophora spp., Myxosoma Henneguya; Costia spp., Ichthyophithirius spp., and Oodinium spp.
[0211]Typical parasites of wild mammals include Giardia spp. (carnivores, herbivores), Isospora spp. (carnivores), Eimeria spp. (carnivores, herbivores); Theileria spp. (herbivores), Babesia spp. (carnivores, herbivores), Trypanosoma spp. (carnivores, herbivores); Schistosoma spp. (herbivores); Fasciola hepatica (herbivores), Fascioloides magna (herbivores), Fasciola gigantica (herbivores), Trichinella spiralis (carnivores, herbivores).
[0212]Parasitic infections in zoos can also pose serious problems. Typical parasites of the bovidae family (blesbok, antelope, banteng, eland, gaur, impala, klipspringer, kudu, gazelle) include Eimeria spp. Typical parasites in the pinnipedae family (seal, sea lion) include Eimeria phocae. Typical parasites in the camelidae family (camels, llamas) include Eimeria spp. Typical parasites of the giraffidae family (giraffes) include Eimeria spp. Typical parasites in the elephantidae family (African and Asian) include Fasciola spp. Typical parasites of lower primates (chimpanzees, orangutans, apes, baboons, macaques, monkeys) include Giardia sp.; Balantidium coli, Entamoeba histolytica, Sarcocystis spp., Toxoplasma gondii; Plasmodim spp. (RBC), Babesia spp. (RBC), Trypanosoma spp. (plasma), Leishmania spp. (macrophages).
[0213]Polypeptides of bacterial pathogens include but are not limited to an iron-regulated outer membrane protein, (IROMP), an outer membrane protein (OMP), and an A-protein of Aeromonis salmonicida which causes furunculosis, p57 protein of Renibacterium salmoninarum which causes bacterial kidney disease (BKD), major surface associated antigen (msa), a surface expressed cytotoxin (mpr), a surface expressed hemolysin (ish), and a flagellar antigen of Yersiniosis; an extracellular protein (ECP), an iron-regulated outer membrane protein (IROMP), and a structural protein of Pasteurellosis; an OMP and a flagellar protein of Vibrosis anguillarum and V. ordalii; a flagellar protein, an OMP protein, aroA, and purA of Edwardsiellosis ictaluri and E. tarda; and surface antigen of Ichthyophthirius; and a structural and regulatory protein of Cytophaga columnari; and a structural and regulatory protein of Rickettsia.
[0214]Polypeptides of a parasitic pathogen include but are not limited to the surface antigens of Ichthyophthirius.
[0215]An allergen refers to a substance (antigen) that can induce an allergic or asthmatic response in a susceptible subject. The list of allergens is enormous and can include pollens, insect venoms, animal dander dust, fungal spores and drugs (e.g. penicillin). Examples of natural, animal and plant allergens include but are not limited to proteins specific to the following genuses: Canine (Canis familiaris); Dermatophagoides (e.g. Dermatophagoides farinae); Felis (Felis domesticus); Ambrosia (Ambrosia artemiisfolia; Lolium (e.g. Lolium perenne or Lolium multiflorum); Cryptomeria (Cryptomeria japonica); Alternaria (Alternaria alternata); Alder; Alnus (Alnus gultinoasa); Betula (Betula verrucosa); Quercus (Quercus alba); Olea (Olea europa); Artemisia (Artemisia vulgaris); Plantago (e.g. Plantago lanceolata); Parietaria (e.g. Parietaria officinalis or Parietaria judaica); Blattella (e.g. Blattella germanica); Apis (e.g. Apis multiflorum); Cupressus (e.g. Cupressus sempervirens, Cupressus arizonica and Cupressus macrocarpa); Juniperus (e.g. Juniperus sabinoides, Juniperus virginiana, Juniperus communis and Juniperus ashei); Thuya (e.g. Thuya orientalis); Chamaecyparis (e.g. Chamaecyparis obtusa); Periplaneta (e.g. Periplaneta americana); Agropyron (e.g. Agropyron repens); Secale (e.g. Secale cereale); Triticum (e.g. Triticum aestivum); Dactylis (e.g. Dactylis glomerata); Festuco (e.g. Festuco elatior); Poa (e.g. Poa pratensis or Poa compressa); Avena (e.g. Avena sativa); Holcus (e.g. Holcus lanatus); Anthoxanthum (e.g. Anthoxanthum odoratum); Arrhenatherum (e.g. Arrhenatherum elatius); Agrostis (e.g. Agrostis alba); Phleum (e.g. Phleum pratense); Phalaris (e.g. Phalaris arundinacea); Paspalum (e.g. Paspalum notatum); Sorghum (e.g. Sorghum halepensis); and Bromus (e.g. Bromus inermis).
[0216]The antigen may be an antigen that is encoded by a nucleic acid vector or it may be not encoded in a nucleic acid vector. In the former case the nucleic acid vector is administered to the subject and the antigen is expressed in vivo. In the latter case the antigen may be administered directly to the subject. An antigen not encoded in a nucleic acid vector as used herein refers to any type of antigen that is not a nucleic acid. For instance, in some aspects of the invention the antigen not encoded in a nucleic acid vector is a polypeptide. Minor modifications of the primary amino acid sequences of polypeptide antigens may also result in a polypeptide which has substantially equivalent antigenic activity as compared to the unmodified counterpart polypeptide. Such modifications may be deliberate, as by site-directed mutagenesis, or may be spontaneous. All of the polypeptides produced by these modifications are included herein as long as antigenicity still exists. The polypeptide may be, for example, a viral polypeptide.
[0217]The term substantially purified as used herein refers to a polypeptide which is substantially free of other proteins, lipids, carbohydrates or other materials with which it is naturally associated. One skilled in the art can purify viral or bacterial polypeptides using standard techniques for protein purification. The substantially pure polypeptide will often yield a single major band on a non-reducing polyacrylamide gel. In the case of partially glycosylated polypeptides or those that have several start codons, there may be several bands on a non-reducing polyacrylamide gel, but these will form a distinctive pattern for that polypeptide. The purity of the viral or bacterial polypeptide can also be determined by amino-terminal amino acid sequence analysis. Other types of antigens not encoded by a nucleic acid vector such as polysaccharides, small molecule, mimics etc are described above, and included within the invention.
[0218]The invention also utilizes polynucleotides encoding the antigenic polypeptides. It is envisioned that the antigen may be delivered to the subject in a nucleic acid molecule which encodes for the antigen such that the antigen must be expressed in vivo. Such antigens delivered to the subject in a nucleic acid vector are referred to as antigens encoded by a nucleic acid vector. The nucleic acid encoding the antigen is operatively linked to a gene expression sequence which directs the expression of the antigen nucleic acid within a eukaryotic cell. The gene expression sequence is any regulatory nucleotide sequence, such as a promoter sequence or promoter-enhancer combination, which facilitates the efficient transcription and translation of the antigen nucleic acid to which it is operatively linked. The gene expression sequence may, for example, be a mammalian or viral promoter, such as a constitutive or inducible promoter. Constitutive mammalian promoters include, but are not limited to, the promoters for the following genes: hypoxanthine phosphoribosyl transferase (HPTR), adenosine deaminase, pyruvate kinase, b-actin promoter and other constitutive promoters. Exemplary viral promoters which function constitutively in eukaryotic cells include, for example, promoters from the cytomegalovirus (CMV), simian virus (e.g., SV40), papilloma virus, adenovirus, human immunodeficiency virus (HIV), Rous sarcoma virus, cytomegalovirus, the long terminal repeats (LTR) of Moloney leukemia virus and other retroviruses, and the thymidine kinase promoter of herpes simplex virus. Other constitutive promoters are known to those of ordinary skill in the art. The promoters useful as gene expression sequences of the invention also include inducible promoters. Inducible promoters are expressed in the presence of an inducing agent. For example, the metallothionein promoter is induced to promote transcription and translation in the presence of certain metal ions. Other inducible promoters are known to those of ordinary skill in the art.
[0219]In general, the gene expression sequence shall include, as necessary, 5' non-transcribing and 5' non-translating sequences involved with the initiation of transcription and translation, respectively, such as a TATA box, capping sequence, CAAT sequence, and the like. Especially, such 5' non-transcribing sequences will include a promoter region which includes a promoter sequence for transcriptional control of the operably joined antigen nucleic acid. The gene expression sequences optionally include enhancer sequences or upstream activator sequences as desired.
[0220]The antigen nucleic acid is operatively linked to the gene expression sequence. As used herein, the antigen nucleic acid sequence and the gene expression sequence are said to be operably linked when they are covalently linked in such a way as to place the expression or transcription and/or translation of the antigen coding sequence under the influence or control of the gene expression sequence. Two DNA sequences are said to be operably linked if induction of a promoter in the 5' gene expression sequence results in the transcription of the antigen sequence and if the nature of the linkage between the two DNA sequences does not (1) result in the introduction of a frame-shift mutation, (2) interfere with the ability of the promoter region to direct the transcription of the antigen sequence, or (3) interfere with the ability of the corresponding RNA transcript to be translated into a protein. Thus, a gene expression sequence would be operably linked to an antigen nucleic acid sequence if the gene expression sequence were capable of effecting transcription of that antigen nucleic acid sequence such that the resulting transcript is translated into the desired protein or polypeptide.
[0221]The antigen nucleic acid of the invention may be delivered to the immune system alone or in association with a vector. In its broadest sense, a vector is any vehicle capable of facilitating the transfer of the antigen nucleic acid to the cells of the immune system so that the antigen can be expressed and presented on the surface of the immune cell. The vector generally transports the nucleic acid to the immune cells with reduced degradation relative to the extent of degradation that would result in the absence of the vector. The vector optionally includes the above-described gene expression sequence to enhance expression of the antigen nucleic acid in immune cells. In general, the vectors useful in the invention include, but are not limited to, plasmids, phagemids, viruses, other vehicles derived from viral or bacterial sources that have been manipulated by the insertion or incorporation of the antigen nucleic acid sequences. Viral vectors are a preferred type of vector and include, but are not limited to, nucleic acid sequences from the following viruses: retrovirus, such as Moloney murine leukemia virus, Harvey murine sarcoma virus, murine mammary tumor virus, and Rous sarcoma virus; adenovirus, adeno-associated virus; SV40-type viruses; polyoma viruses; Epstein-Barr viruses; papilloma viruses; herpes virus; vaccinia virus; polio virus; and RNA virus such as a retrovirus. One can readily employ other vectors not named but known in the art.
[0222]Preferred viral vectors are based on non-cytopathic eukaryotic viruses in which non-essential genes have been replaced with the gene of interest. Non-cytopathic viruses include retroviruses, the life cycle of which involves reverse transcription of genomic viral RNA into DNA with subsequent proviral integration into host cellular DNA. Retroviruses have been approved for human gene therapy trials. Most useful are those retroviruses that are replication-deficient (i.e., capable of directing synthesis of the desired proteins, but incapable of manufacturing an infectious particle). Such genetically altered retroviral expression vectors have general utility for the high-efficiency transduction of genes in vivo. Standard protocols for producing replication-deficient retroviruses (including the steps of incorporation of exogenous genetic material into a plasmid, transfection of a packaging cell lined with plasmid, production of recombinant retroviruses by the packaging cell line, collection of viral particles from tissue culture media, and infection of the target cells with viral particles) are provided in Kriegler, M., Gene Transfer and Expression, A Laboratory Manual W.H. Freeman C.O., New York (1990) and Murry, E. J. Methods in Molecular Biology, vol. 7, Humana Press, Inc., Cliffton, N.J. (1991).
[0223]A preferred virus for certain applications is the adeno-associated virus, a double-stranded DNA virus. The adeno-associated virus can be engineered to be replication-deficient and is capable of infecting a wide range of cell types and species. It further has advantages such as, heat and lipid solvent stability; high transduction frequencies in cells of diverse lineages, including hemopoietic cells; and lack of superinfection inhibition thus allowing multiple series of transductions. Reportedly, the adeno-associated virus can integrate into human cellular DNA in a site-specific manner, thereby minimizing the possibility of insertional mutagenesis and variability of inserted gene expression characteristic of retroviral infection. In addition, wild-type adeno-associated virus infections have been followed in tissue culture for greater than 100 passages in the absence of selective pressure, implying that the adeno-associated virus genomic integration is a relatively stable event. The adeno-associated virus can also function in an extrachromosomal fashion.
[0224]Other vectors include plasmid vectors. Plasmid vectors have been extensively described in the art and are well-known to those of skill in the art. See e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, 1989. In the last few years, plasmid vectors have been found to be particularly advantageous for delivering genes to cells in vivo because of their inability to replicate within and integrate into a host genome. These plasmids, however, having a promoter compatible with the host cell, can express a peptide from a gene operatively encoded within the plasmid. Some commonly used plasmids include pBR322, pUC18, pUC19, pRC/CMV, SV40, and pBlueScript. Other plasmids are well-known to those of ordinary skill in the art. Additionally, plasmids may be custom designed using restriction enzymes and ligation reactions to remove and add specific fragments of DNA.
[0225]It has recently been discovered that gene carrying plasmids can be delivered to the immune system using bacteria. Modified forms of bacteria such as Salmonella can be transfected with the plasmid and used as delivery vehicles. The bacterial delivery vehicles can be administered to a host subject orally or by other administration means. The bacteria deliver the plasmid to immune cells, e.g. B cells, dendritic cells, likely by passing through the gut barrier. High levels of immune protection have been established using this methodology. Such methods of delivery are useful for the aspects of the invention utilizing systemic delivery of antigen, Immunostimulatory nucleic acid and/or other therapeutic agent.
[0226]Thus, the immunostimulatory nucleic acids are useful as vaccine adjuvants. It was previously established that CpG oligonucleotides are excellent vaccine adjuvants. It was also demonstrated, however, that CpG ODN which are superb vaccine adjuvants in mice are not the preferred adjuvants in non-rodent animals. In order to identify the best immunostimulatory nucleic acids for use as a vaccine adjuvant in humans and other non-rodent animals, in vivo screening of different nucleic acids for this purpose was conducted. Several in vitro assays were evaluated in mice for their predictive value of adjuvant activity in vivo in mice. During the course of this study, an in vitro test that is predictive of in vivo efficacy was identified. It was discovered, rather surprisingly, that both B cell and NK cell activation correlated particularly well with the ability of an immunostimulatory nucleic acid to enhance an in vivo immune response against an antigen.
[0227]The good predictive value of B cell activation for in vivo vaccine adjuvant activity is most likely linked to the central role of B cells in the establishment of a specific immune response. Polyclonal proliferation of B cells (induced by immunostimulatory nucleic acids) increases the likelihood of an antigen specific B cell/T helper cell match. Furthermore, enhanced expression of the co-stimulatory molecule CD86 on polyclonally expanded B cells activates antigen specific T helper cells. B cells also increase their CD40 expression in response to immunostimulatory nucleic acids improving the capability of CD40L expressing activated T helper cells to stimulate B cells. Increased ICAM-1 synthesis on B cells facilitates the cell to cell contact. Thus, the activation status of polyclonal B cells plays a critical role during the initiation of a specific antibody response.
[0228]The contribution of NK cell activity for the establishment of specific antibodies was, however, surprising. NK cells are part of the innate immune system and as such are involved in the first line of defense against pathogens. Most likely the cytokine pattern produced by NK cells upon activation is closely related to the initiation of a specific immune response. Thus, in one aspect the invention relates to a method of identifying an adjuvant, by detecting NK cell activation. The NK cell activation assay may be carried out as described in the Examples below or using other known NK cell activity assays. It is preferred, however that a mixed cell population such as PBMC be used because of the likelihood that NK cell activation is an indirect effect. The assay is preferably useful for identifying immunostimulatory nucleic acids which are useful as adjuvants in human and other non-rodent animals.
[0229]Cytokine induction was also identified as an important predictor of in vivo adjuvant activity. As there is a 2 log higher endotoxin sensitivity of human than mouse primary monocytes, some caution, however, is required to avoid endotoxin contamination of immunostimulatory nucleic acids used for testing in the human system (Hartmann G., and Krieg A. M. 1999. Gene Therapy 6:893). Since TNF-α, IL-6 and IL-12 are produced by human monocytes in response to even low amounts of endotoxin, their value for high throughput in vitro screening assays is limited. On the other hand, human B cells and NK cells show only minor activation by endotoxin and thus are far more useful in testing for immunostimulatory activity.
[0230]Stimulation of cellular function in either NK or B cells (i.e., lytic activity, proliferation) requires a stronger immunostimulatory nucleic acid than the induction of activation markers at their surface (CD69, CD86). For both cell types, the use of cell surface activation markers showed a higher nonspecific background attributable to the phosphorothioate backbone compared to the functional assays. This high sensitivity of surface markers requires the use of low immunostimulatory nucleic acid concentrations for optimal discrimination between immunostimulatory nucleic acid of similar activity. Thus, the use of surface markers allows the comparison of immunostimulatory nucleic acids with weak activity, while functional assays are preferred for comparing immunostimulatory nucleic acids with high activity. It is of note that the optimal immunostimulatory nucleic acid concentrations for stimulating B cells and NK cells differ. While 0.6 μg/ml ODN is already maximal to stimulate B cells, optimal NK cell activation may require 6 μg/ml ODN. Both B cell activation and NK cell functional activity were measured within freshly isolated PBMC. It was previously found that highly purified human primary B cells are activated by CpG DNA. The existence of a direct effect of CpG DNA on NK cells is less clear, and a secondary mechanism mediated by another cell type within PBMC might contribute to CpG-induced functional activity of NK cells.
[0231]The nucleic acids of the invention may be administered to a subject with an anti-microbial agent. An anti-microbial agent, as used herein, refers to a naturally-occurring or synthetic compound which is capable of killing or inhibiting infectious microorganisms. The type of anti-microbial agent useful according to the invention will depend upon the type of microorganism with which the subject is infected or at risk of becoming infected. Anti-microbial agents include but are not limited to anti-bacterial agents, anti-viral agents, anti-fungal agents and anti-parasitic agents. Phrases such as "anti-infective agent", "anti-bacterial agent", "anti-viral agent", "anti-fungal agent", "anti-parasitic agent" and "parasiticide" have well-established meanings to those of ordinary skill in the art and are defined in standard medical texts. Briefly, anti-bacterial agents kill or inhibit bacteria, and include antibiotics as well as other synthetic or natural compounds having similar functions. Antibiotics are low molecular weight molecules which are produced as secondary metabolites by cells, such as microorganisms. In general, antibiotics interfere with one or more bacterial functions or structures which are specific for the microorganism and which are not present in host cells. Anti-viral agents can be isolated from natural sources or synthesized and are useful for killing or inhibiting viruses. Anti-fungal agents are used to treat superficial fungal infections as well as opportunistic and primary systemic fungal infections. Anti-parasite agents kill or inhibit parasites.
[0232]Examples of anti-parasitic agents, also referred to as parasiticides useful for human administration include but are not limited to albendazole, amphotericin B, benznidazole, bithionol, chloroquine HCl, chloroquine phosphate, clindamycin, dehydroemetine, diethylcarbamazine, diloxanide furoate, eflomithine, furazolidaone, glucocorticoids, halofantrine, iodoquinol, ivermectin, mebendazole, mefloquine, meglumine antimoniate, melarsoprol, metrifonate, metronidazole, niclosamide, nifurtimox, oxamniquine, paromomycin, pentamidine isethionate, piperazine, praziquantel, primaquine phosphate, proguanil, pyrantel pamoate, pyrimethanmine-sulfonamides, pyrimethanmine-sulfadoxine, quinacrine HCl, quinine sulfate, quinidine gluconate, spiramycin, stibogluconate sodium (sodium antimony gluconate), suramin, tetracycline, doxycycline, thiabendazole, tinidazole, trimethroprim-sulfamethoxazole, and tryparsamide some of which are used alone or in combination with others.
[0233]Parasiticides used in non-human subjects include piperazine, diethylcarbamazine, thiabendazole, fenbendazole, albendazole, oxfendazole, oxibendazole, febantel, levamisole, pyrantel tartrate, pyrantel pamoate, dichlorvos, ivermectin, doramectic, milbemycin oxime, iprinomectin, moxidectin, N-butyl chloride, toluene, hygromycin B thiacetarsemide sodium, melarsomine, praziquantel, epsiprantel, benzimidazoles such as fenbendazole, albendazole, oxfendazole, clorsulon, albendazole, amprolium; decoquinate, lasalocid, monensin sulfadimethoxine; sulfamethazine, sulfaquinoxaline, metronidazole.
[0234]Parasiticides used in horses include mebendazole, oxfendazole, febantel, pyrantel, dichlorvos, trichlorfon, ivermectin, piperazine; for S. westeri: ivermectin, benzimiddazoles such as thiabendazole, cambendazole, oxibendazole and fenbendazole. Useful parasiticides in dogs include milbemycin oxine, ivermectin, pyrantel pamoate and the combination of ivermectin and pyrantel. The treatment of parasites in swine can include the use of levamisole, piperazine, pyrantel, thiabendazole, dichlorvos and fenbendazole. In sheep and goats anthelmintic agents include levamisole or ivermectin. Caparsolate has shown some efficacy in the treatment of D. immitis (heartworm) in cats.
[0235]Antibacterial agents kill or inhibit the growth or function of bacteria. A large class of antibacterial agents is antibiotics. Antibiotics, which are effective for killing or inhibiting a wide range of bacteria, are referred to as broad spectrum antibiotics. Other types of antibiotics are predominantly effective against the bacteria of the class gram-positive or gram-negative. These types of antibiotics are referred to as narrow spectrum antibiotics. Other antibiotics which are effective against a single organism or disease and not against other types of bacteria, are referred to as limited spectrum antibiotics. Antibacterial agents are sometimes classified based on their primary mode of action. In general, antibacterial agents are cell wall synthesis inhibitors, cell membrane inhibitors, protein synthesis inhibitors, nucleic acid synthesis or functional inhibitors, and competitive inhibitors.
[0236]Anti-bacterial agents useful in the invention include but are not limited to natural penicillins, semi-synthetic penicillins, clavulanic acid, cephalolsporins, bacitracin, ampicillin, carbenicillin, oxacillin, azlocillin, mezlocillin, piperacillin, methicillin, dicloxacillin, nafcillin, cephalothin, cephapirin, cephalexin, cefamandole, cefaclor, cefazolin, cefuroxine, cefoxitin, cefotaxime, cefsulodin, cefetamet, cefixime, ceftriaxone, cefoperazone, ceftazidine, moxalactam, carbapenems, imipenems, monobactems, euztreonam, vancomycin, polymyxin, amphotericin B, nystatin, imidazoles, clotrimazole, miconazole, ketoconazole, itraconazole, fluconazole, rifampins, ethambutol, tetracyclines, chloramphenicol, macrolides, aminoglycosides, streptomycin, kanamycin, tobramycin, amikacin, gentamicin, tetracycline, minocycline, doxycycline, chlortetracycline, erythromycin, roxithromycin, clarithromycin, oleandomycin, azithromycin, chloramphenicol, quinolones, co-trimoxazole, norfloxacin, ciprofloxacin, enoxacin, nalidixic acid, temafloxacin, sulfonamides, gantrisin, and trimethoprim; Acedapsone; Acetosulfone Sodium; Alamecin; Alexidine; Amdinocillin; Amdinocillin Pivoxil; Amicycline; Amifloxacin; Amifloxacin Mesylate; Amikacin; Amikacin Sulfate; Aminosalicylic acid; Aminosalicylate sodium; Amoxicillin; Amphomycin; Ampicillin; Ampicillin Sodium; Apalcillin Sodium; Apramycin; Aspartocin; Astromicin Sulfate; Avilamycin; Avoparcin; Azithromycin; Azlocillin; Azlocillin Sodium; Bacampicillin Hydrochloride; Bacitracin; Bacitracin Methylene Disalicylate; Bacitracin Zinc; Bambermycins; Benzoylpas Calcium; Berythromycin; Betamicin Sulfate; Biapenem; Biniramycin; Biphenamine Hydrochloride; Bispyrithione Magsulfex; Butikacin; Butirosin Sulfate; Capreomycin Sulfate; Carbadox; Carbenicillin Disodium; Carbenicillin Indanyl Sodium; Carbenicillin Phenyl Sodium; Carbenicillin Potassium; Carumonam Sodium; Cefaclor; Cefadroxil; Cefamandole; Cefamandole Nafate; Cefamandole Sodium; Cefaparole; Cefatrizine; Cefazaflur Sodium; Cefazolin; Cefazolin Sodium; Cefbuperazone; Cefdinir; Cefepime; Cefepime Hydrochloride; Cefetecol; Cefixime; Cefmenoxime Hydrochloride; Cefmetazole; Cefmetazole Sodium; Cefonicid Monosodium; Cefonicid Sodium; Cefoperazone Sodium; Ceforanide; Cefotaxime Sodium; Cefotetan; Cefotetan Disodium; Cefotiam Hydrochloride; Cefoxitin; Cefoxitin Sodium; Cefpimizole; Cefpimizole Sodium; Cefpiramide; Cefpiramide Sodium; Cefpirome Sulfate; Cefpodoxime Proxetil; Cefprozil; Cefroxadine; Cefsulodin Sodium; Ceftazidime; Ceftibuten; Ceftizoxime Sodium; Ceftriaxone Sodium; Cefuroxime; Cefuroxime Axetil; Cefuroxime Pivoxetil; Cefuroxime Sodium; Cephacetrile Sodium; Cephalexin; Cephalexin Hydrochloride; Cephaloglycin; Cephaloridine; Cephalothin Sodium; Cephapirin Sodium; Cephradine; Cetocycline Hydrochloride; Cetophenicol; Chloramphenicol; Chloramphenicol Palmitate; Chloramphenicol Pantothenate Complex; Chloramphenicol Sodium Succinate; Chlorhexidine Phosphanilate; Chloroxylenol; Chlortetracycline Bisulfate; Chlortetracycline Hydrochloride; Cinoxacin; Ciprofloxacin; Ciprofloxacin Hydrochloride; Cirolemycin; Clarithromycin; Clinafloxacin Hydrochloride; Clindamycin; Clindamycin Hydrochloride; Clindamycin Palmitate Hydrochloride; Clindamycin Phosphate; Clofazimine; Cloxacillin Benzathine; Cloxacillin Sodium; Cloxyquin; Colistimethate Sodium; Colistin Sulfate; Coumermycin; Coumermycin Sodium; Cyclacillin; Cycloserine; Dalfopristin; Dapsone; Daptomycin; Demeclocycline; Demeclocycline Hydrochloride; Demecycline; Denofungin; Diaveridine; Dicloxacillin; Dicloxacillin Sodium; Dihydrostreptomycin Sulfate; Dipyrithione; Dirithromycin; Doxycycline; Doxycycline Calcium; Doxycycline Fosfatex; Doxycycline Hyclate; Droxacin Sodium; Enoxacin; Epicillin; Epitetracycline Hydrochloride; Erythromycin; Erythromycin Acistrate; Erythromycin Estolate; Erythromycin Ethylsuccinate; Erythromycin Gluceptate; Erythromycin Lactobionate; Erythromycin Propionate; Erythromycin Stearate; Ethambutol Hydrochloride; Ethionamide; Fleroxacin; Floxacillin; Fludalanine; Flumequine; Fosfomycin; Fosfomycin Tromethamine; Fumoxicillin; Furazolium Chloride; Furazolium Tartrate; Fusidate Sodium; Fusidic Acid; Gentamicin Sulfate; Gloximonam; Gramicidin; Haloprogin; Hetacillin; Hetacillin Potassium; Hexedine; Ibafloxacin; Imipenem; Isoconazole; Isepamicin; Isoniazid; Josamycin; Kanamycin Sulfate; Kitasamycin; Levofuraltadone; Levopropylcillin Potassium; Lexithromycin; Lincomycin; Lincomycin Hydrochloride; Lomefloxacin; Lomefloxacin Hydrochloride; Lomefloxacin Mesylate; Loracarbef; Mafenide; Meclocycline; Meclocycline Sulfosalicylate; Megalomicin Potassium Phosphate; Mequidox; Meropenem; Methacycline; Methacycline Hydrochloride; Methenamine; Methenamine Hippurate; Methenamine Mandelate; Methicillin Sodium; Metioprim; Metronidazole Hydrochloride; Metronidazole Phosphate; Mezlocillin; Mezlocillin Sodium; Minocycline; Minocycline Hydrochloride; Mirincamycin Hydrochloride; Monensin; Monensin Sodium; Nafcillin Sodium; Nalidixate Sodium; Nalidixic Acid; Natamycin; Nebramycin; Neomycin Palmitate; Neomycin Sulfate; Neomycin Undecylenate; Netilmicin Sulfate; Neutramycin; Nifuradene; Nifuraldezone; Nifuratel; Nifuratrone; Nifurdazil; Nifurimide; Nifurpirinol; Nifurquinazol; Nifurthiazole; Nitrocycline; Nitrofurantoin; Nitromide; Norfloxacin; Novobiocin Sodium; Ofloxacin; Ormetoprim; Oxacillin Sodium; Oximonam; Oximonam Sodium; Oxolinic Acid; Oxytetracycline; Oxytetracycline Calcium; Oxytetracycline Hydrochloride; Paldimycin; Parachlorophenol; Paulomycin; Pefloxacin; Pefloxacin Mesylate; Penamecillin; Penicillin G Benzathine; Penicillin G Potassium; Penicillin G Procaine; Penicillin G Sodium; Penicillin V; Penicillin V Benzathine; Penicillin V Hydrabamine; Penicillin V Potassium; Pentizidone Sodium; Phenyl Aminosalicylate; Piperacillin Sodium; Pirbenicillin Sodium; Piridicillin Sodium; Pirlimycin Hydrochloride; Pivampicillin Hydrochloride; Pivampicillin Pamoate; Pivampicillin Probenate; Polymyxin B Sulfate; Porfiromycin; Propikacin; Pyrazinamide; Pyrithione Zinc; Quindecamine Acetate; Quinupristin; Racephenicol; Ramoplanin; Ranimycin; Relomycin; Repromicin; Rifabutin; Rifametane; Rifamexil; Rifamide; Rifampin; Rifapentine; Rifaximin; Rolitetracycline; Rolitetracycline Nitrate; Rosaramicin; Rosaramicin Butyrate; Rosaramicin Propionate; Rosaramicin Sodium Phosphate; Rosaramicin Stearate; Rosoxacin; Roxarsone; Roxithromycin; Sancycline; Sanfetrinem Sodium; Sarmoxicillin; Sarpicillin; Scopafungin; Sisomicin; Sisomicin Sulfate; Sparfloxacin; Spectinomycin Hydrochloride; Spiramycin; Stallimycin Hydrochloride; Steffimycin; Streptomycin Sulfate; Streptonicozid; Sulfabenz; Sulfabenzamide; Sulfacetamide; Sulfacetamide Sodium; Sulfacytine; Sulfadiazine; Sulfadiazine Sodium; Sulfadoxine; Sulfalene; Sulfamerazine; Sulfameter; Sulfamethazine; Sulfamethizole; Sulfamethoxazole; Sulfamonomethoxine; Sulfamoxole; Sulfanilate Zinc; Sulfanitran Sulfasalazine; Sulfasomizole; Sulfathiazole; Sulfazamet; Sulfisoxazole; Sulfisoxazole Acetyl; Sulfisoxazole Diolamine; Sulfomyxin; Sulopenem; Sultamicillin; Suncillin Sodium; Talampicillin Hydrochloride; Teicoplanin; Temafloxacin Hydrochloride; Temocillin; Tetracycline; Tetracycline Hydrochloride; Tetracycline Phosphate Complex; Tetroxoprim; Thiamphenicol; Thiphencillin Potassium; Ticarcillin Cresyl Sodium; Ticarcillin Disodium; Ticarcillin Monosodium; Ticlatone; Tiodonium Chloride; Tobramycin; Tobramycin Sulfate; Tosufloxacin; Trimethoprim; Trimethoprim Sulfate; Trisulfapyrimidines; Troleandomycin; Trospectomycin Sulfate; Tyrothricin; Vancomycin; Vancomycin Hydrochloride; Virginiamycin; and Zorbamycin.
[0237]Antiviral agents are compounds which prevent infection of cells by viruses or replication of the virus within the cell. There are many fewer antiviral drugs than antibacterial drugs because the process of viral replication is so closely related to DNA replication within the host cell, that non-specific antiviral agents would often be toxic to the host. There are several stages within the process of viral infection which can be blocked or inhibited by antiviral agents. These stages include, attachment of the virus to the host cell (immunoglobulin or binding peptides), uncoating of the virus (e.g. amantadine), synthesis or translation of viral mRNA (e.g. interferon), replication of viral RNA or DNA (e.g. nucleoside analogues), maturation of new virus proteins (e.g. protease inhibitors), and budding and release of the virus.
[0238]Nucleotide analogues are synthetic compounds which are similar to nucleotides, but which have an incomplete or abnormal deoxyribose or ribose group. Once the nucleotide analogues are in the cell, they are phosphorylated, producing the triphosphate formed which competes with normal nucleotides for incorporation into the viral DNA or RNA. Once the triphosphate form of the nucleotide analogue is incorporated into the growing nucleic acid chain, it causes irreversible association with the viral polymerase and thus chain termination. Nucleotide analogues include, but are not limited to, acyclovir (used for the treatment of herpes simplex virus and varicella-zoster virus), gancyclovir (useful for the treatment of cytomegalovirus), idoxuridine, ribavirin (useful for the treatment of respiratory syncitial virus), dideoxyinosine, dideoxycytidine, and zidovudine (azidothymidine).
[0239]The interferons are cytokines which are secreted by virus-infected cells as well as immune cells. The interferons function by binding to specific receptors on cells adjacent to the infected cells, causing the change in the cell which protects it from infection by the virus. α and β-interferon also induce the expression of Class I and Class II MHC molecules on the surface of infected cells, resulting in increased antigen presentation for host immune cell recognition. α and β-interferons are available as recombinant forms and have been used for the treatment of chronic hepatitis B and C infection. At the dosages which are effective for anti-viral therapy, interferons have severe side effects such as fever, malaise and weight loss.
[0240]Immunoglobulin therapy is used for the prevention of viral infection. Immunoglobulin therapy for viral infections is different than bacterial infections, because rather than being antigen-specific, the immunoglobulin therapy functions by binding to extracellular virions and preventing them from attaching to and entering cells which are susceptible to the viral infection. The therapy is useful for the prevention of viral infection for the period of time that the antibodies are present in the host. In general there are two types of immunoglobulin therapies, normal immunoglobulin therapy and hyper-immunoglobulin therapy. Normal immune globulin therapy utilizes a antibody product which is prepared from the serum of normal blood donors and pooled. This pooled product contains low titers of antibody to a wide range of human viruses, such as hepatitis A, parvovirus, enterovirus (especially in neonates). Hyper-immune globulin therapy utilizes antibodies which are prepared from the serum of individuals who have high titers of an antibody to a particular virus. Those antibodies are then used against a specific virus. Examples of hyper-immune globulins include zoster immune globulin (useful for the prevention of varicella in immuno-compromised children and neonates), human rabies immunoglobulin (useful in the post-exposure prophylaxis of a subject bitten by a rabid animal), hepatitis B immune globulin (useful in the prevention of hepatitis B virus, especially in a subject exposed to the virus), and RSV immune globulin (useful in the treatment of respiratory syncitial virus infections).
[0241]Another type of immunoglobulin therapy is active immunization. This involves the administration of antibodies or antibody fragments to viral surface proteins. Two types of vaccines which are available for active immunization of hepatitis B include serum-derived hepatitis B antibodies and recombinant hepatitis B antibodies. Both are prepared from HBsAg. The antibodies are administered in three doses to subjects at high risk of infection with hepatitis B virus, such as health care workers, sexual partners of chronic carriers, and infants.
[0242]Thus, anti-viral agents useful in the invention include but are not limited to immunoglobulins, amantadine, interferon, nucleoside analogues, and protease inhibitors. Specific examples of anti-virals include but are not limited to Acemannan; Acyclovir; Acyclovir Sodium; Adefovir; Alovudine; Alvircept Sudotox; Amantadine Hydrochloride; Aranotin; Arildone; Atevirdine Mesylate; Avridine; Cidofovir; Cipamfylline; Cytarabine Hydrochloride; Delavirdine Mesylate; Desciclovir; Didanosine; Disoxaril; Edoxudine; Enviradene; Enviroxime; Famciclovir; Famotine Hydrochloride; Fiacitabine; Fialuridine; Fosarilate; Foscamet Sodium; Fosfonet Sodium; Ganciclovir; Ganciclovir Sodium; Idoxuridine; Kethoxal; Lamivudine; Lobucavir; Memotine Hydrochloride; Methisazone; Nevirapine; Penciclovir; Pirodavir; Ribavirin; Rimantadine Hydrochloride; Saquinavir Mesylate; Somantadine Hydrochloride; Sorivudine; Statolon; Stavudine; Tilorone Hydrochloride; Trifluridine; Valacyclovir Hydrochloride; Vidarabine; Vidarabine Phosphate; Vidarabine Sodium Phosphate; Viroxime; Zalcitabine; Zidovudine; and Zinviroxime.
[0243]Anti-fungal agents are useful for the treatment and prevention of infective fungi. Anti-fungal agents are sometimes classified by their mechanism of action. Some anti-fungal agents function as cell wall inhibitors by inhibiting glucose synthase. These include, but are not limited to, basiungin/ECB. Other anti-fungal agents function by destabilizing membrane integrity. These include, but are not limited to, immidazoles, such as clotrimazole, sertaconzole, fluconazole, itraconazole, ketoconazole, miconazole, and voriconacole, as well as FK 463, amphotericin B, BAY 38-9502, MK 991, pradimicin, UK 292, butenafine, and terbinafine. Other anti-fungal agents function by breaking down chitin (e.g. chitinase) or immunosuppression (501 cream). Some examples of commercially-available agents are shown in Table B.
TABLE-US-00003 TABLE B Company Brand Name Generic Name Indication Mechanism of Action PHARMACIA & PNU 196443 PNU 196443 Anti Fungal n/k UPJOHN Lilly LY 303366 Basiungin/ECB Fungal Infections Anti-fungal/cell wall inhibitor, glucose synthase inhibitor Bayer Canesten Clotrimazole Fungal Infections Membrane integrity destabilizer Fujisawa FK 463 FK 463 Fungal Infections Membrane integrity destabilizer Mylan Sertaconzaole Sertaconzole Fungal Infections Membrane integrity destabilizer Genzyme Chitinase Chitinase Fungal Infections, Systemic Chitin Breakdown Liposome Abelcet Amphotericin B, Liposomal Fungal Infections, Systemic Membrane integrity destabilizer Sequus Amphotec Amphotericin B, Liposomal Fungal Infections, Systemic Membrane integrity destabilizer Bayer BAY 38-9502 BAY 38-9502 Fungal Infections, Systemic Membrane integrity destabilizer Pfizer Diflucan Fluconazole Fungal Infections, Systemic Membrane integrity destabilizer Johnson & Johnson Sporanox Itraconazole Fungal Infections, Systemic Membrane integrity destabilizer Sepracor Itraconzole (2R, 4S) Itraconzole (2R, 4S) Fungal Infections, Systemic Membrane integrity destabilizer Johnson & Johnson Nizoral Ketoconazole Fungal Infections, Systemic Membrane integrity destabilizer Johnson & Johnson Monistat Miconazole Fungal Infections, Systemic Membrane integrity destabilizer Merck MK 991 MK 991 Fungal Infections, Systemic Membrane integrity destabilizer Bristol Myers Sq'b Pradimicin Pradimicin Fungal Infections, Systemic Membrane integrity destabilizer Pfizer UK-292, 663 UK-292, 663 Fungal Infections, Systemic Membrane integrity destabilizer Pfizer Voriconazole Voriconazole Fungal Infections, Systemic Membrane integrity destabilizer Mylan 501 Cream 501 Cream Inflammatory Fungal Immunosuppression Conditions Mylan Mentax Butenafine Nail Fungus Membrane Integrity Destabiliser Schering Plough Anti Fungal Anti Fungal Opportunistic Infections Membrane Integrity Destabiliser Alza Mycelex Troche Clotrimazole Oral Thrush Membrane Integrity Stabliser Novartis Lamisil Terbinafine Systemic Fungal Infections, Membrane Integrity Destabiliser Onychomycosis
[0244]Thus, the anti-fungal agents useful in the invention include but are not limited to imidazoles, FK 463, amphotericin B, BAY 38-9502, MK 991, pradimicin, UK 292, butenafine, chitinase, 501 cream, Acrisorcin; Ambruticin; Amorolfine, Amphotericin B; Azaconazole; Azaserine; Basifungin; Bifonazole; Biphenamine Hydrochloride; Bispyrithione Magsulfex; Butoconazole Nitrate; Calcium Undecylenate; Candicidin; Carbol-Fuchsin; Chlordantoin; Ciclopirox; Ciclopirox Olamine; Cilofungin; Cisconazole; Clotrimazole; Cuprimyxin; Denofungin; Dipyrithione; Doconazole; Econazole; Econazole Nitrate; Enilconazole; Ethonam Nitrate; Fenticonazole Nitrate; Filipin; Fluconazole; Flucytosine; Fungimycin; Griseofulvin; Hamycin; Isoconazole; Itraconazole; Kalafungin; Ketoconazole; Lomofungin; Lydimycin; Mepartricin; Miconazole; Miconazole Nitrate; Monensin; Monensin Sodium; Naftifine Hydrochloride; Neomycin Undecylenate; Nifuratel; Nifurmerone; Nitralamine Hydrochloride; Nystatin; Octanoic Acid; Orconazole Nitrate; Oxiconazole Nitrate; Oxifungin Hydrochloride; Parconazole Hydrochloride; Partricin; Potassium Iodide; Proclonol; Pyrithione Zinc; Pyrrolnitrin; Rutamycin; Sanguinarium Chloride; Saperconazole; Scopafungin; Selenium Sulfide; Sinefungin; Sulconazole Nitrate; Terbinafine; Terconazole; Thiram; Ticlatone; Tioconazole; Tolciclate; Tolindate; Tolnaftate; Triacetin; Triafungin; Undecylenic Acid; Viridofulvin; Zinc Undecylenate; and Zinoconazole Hydrochloride.
[0245]Immunostimulatory nucleic acids can be combined with other therapeutic agents such as adjuvants to enhance immune responses. The immunostimulatory nucleic acid and other therapeutic agent may be administered simultaneously or sequentially. When the other therapeutic agents are administered simultaneously they can be administered in the same or separate formulations, but are administered at the same time. The other therapeutic agents are administered sequentially with one another and with immunostimulatory nucleic acid, when the administration of the other therapeutic agents and the immunostimulatory nucleic acid is temporally separated. The separation in time between the administration of these compounds may be a matter of minutes or it may be longer. Other therapeutic agents include but are not limited to adjuvants, cytokines, antibodies, antigens, etc.
[0246]The immunostimulatory nucleic acids are useful as adjuvants for inducing a systemic immune response. Thus either can be delivered to a subject exposed to an antigen to produce an enhanced immune response to the antigen.
[0247]In addition to the immunostimulatory nucleic acids, the compositions of the invention may also be administered with non-nucleic acid adjuvants. A non-nucleic acid adjuvant is any molecule or compound except for the immunostimulatory nucleic acids described herein which can stimulate the humoral and/or cellular immune response. Non-nucleic acid adjuvants include, for instance, adjuvants that create a depo effect, immune stimulating adjuvants, and adjuvants that create a depo effect and stimulate the immune system.
[0248]An adjuvant that creates a depo effect as used herein is an adjuvant that causes the antigen to be slowly released in the body, thus prolonging the exposure of immune cells to the antigen. This class of adjuvants includes but is not limited to alum (e.g., aluminum hydroxide, aluminum phosphate); or emulsion-based formulations including mineral oil, non-mineral oil, water-in-oil or oil-in-water-in oil emulsion, oil-in-water emulsions such as Seppic ISA series of Montanide adjuvants (e.g., Montanide ISA 720, AirLiquide, Paris, France); MF-59 (a squalene-in-water emulsion stabilized with Span 85 and Tween 80; Chiron Corporation, Emeryville, Calif.; and PROVAX (an oil-in-water emulsion containing a stabilizing detergent and a micelle-forming agent; IDEC, Pharmaceuticals Corporation, San Diego, Calif.).
[0249]An immune stimulating adjuvant is an adjuvant that causes activation of a cell of the immune system. It may, for instance, cause an immune cell to produce and secrete cytokines. This class of adjuvants includes but is not limited to saponins purified from the bark of the Q. saponaria tree, such as QS21 (a glycolipid that elutes in the 21st peak with HPLC fractionation; Aquila Biopharmaceuticals, Inc., Worcester, Mass.); poly[di(carboxylatophenoxy)phosphazene (PCPP polymer; Virus Research Institute, USA); derivatives of lipopolysaccharides such as monophosphoryl lipid A (MPL; Ribi ImmunoChem Research, Inc., Hamilton, Mont.), muramyl dipeptide (MDP; Ribi) and threonyl-muramyl dipeptide (t-MDP; Ribi); OM-174 (a glucosamine disaccharide related to lipid A; OM Pharma SA, Meyrin, Switzerland); and Leishmania elongation factor (a purified Leishmania protein; Corixa Corporation, Seattle, Wash.).
[0250]Adjuvants that create a depo effect and stimulate the immune system are those compounds which have both of the above-identified functions. This class of adjuvants includes but is not limited to ISCOMS (Immunostimulating complexes which contain mixed saponins, lipids and form virus-sized particles with pores that can hold antigen; CSL, Melbourne, Australia); SB-AS2 (SmithKline Beecham adjuvant system #2 which is an oil-in-water emulsion containing MPL and QS21: SmithKline Beecham Biologicals [SBB], Rixensart, Belgium); SB-AS4 (SmithKline Beecham adjuvant system #4 which contains alum and MPL; SBB, Belgium); non-ionic block copolymers that form micelles such as CRL 1005 (these contain a linear chain of hydrophobic polyoxpropylene flanked by chains of polyoxyethylene; Vaxcel, Inc., Norcross, Ga.); and Syntex Adjuvant Formulation (SAF, an oil-in-water emulsion containing Tween 80 and a nonionic block copolymer; Syntex Chemicals, Inc., Boulder, Colo.).
[0251]The immunostimulatory nucleic acids are also useful as mucosal adjuvants. It has previously been discovered that both systemic and mucosal immunity are induced by mucosal delivery of CpG nucleic acids. The systemic immunity induced in response to CpG nucleic acids included both humoral and cell-mediated responses to specific antigens that were not capable of inducing systemic immunity when administered alone to the mucosa. Furthermore, both CpG nucleic acids and cholera toxin (CT, a mucosal adjuvant that induces a Th2-like response) induced CTL. This was surprising since with systemic immunization, the presence of Th2-like antibodies is normally associated with a lack of CTL (Schirmbeck et al., 1995). Based on the results presented herein it is expected that the immunostimulatory nucleic acids will function in a similar manner.
[0252]Additionally, the immunostimulatory nucleic acids induce a mucosal response at both local (e.g., lung) and remote (e.g., lower digestive tract) mucosal sites. Significant levels of IgA antibodies are induced at distant mucosal sites by the immunostimulatory nucleic acids. CT is generally considered to be a highly effective mucosal adjuvant. As has been previously reported (Snider 1995), CT induces predominantly IgG1 isotype of antibodies, which are indicative of Th2-type response. In contrast, the immunostimulatory nucleic acids are more Th1 with predominantly IgG2a antibodies, especially after boost or when the two adjuvants are combined. Th1-type antibodies in general have better neutralizing capabilities, and furthermore, a Th2 response in the lung is highly undesirable because it is associated with asthma (Kay, 1996, Hogg, 1997). Thus the use of immunostimulatory nucleic acids as a mucosal adjuvant has benefits that other mucosal adjuvants cannot achieve. The immunostimulatory nucleic acids of the invention also are useful as mucosal adjuvants for induction of both a systemic and a mucosal immune response.
[0253]Mucosal adjuvants referred to as non-nucleic acid mucosal adjuvants may also be administered with the Immunostimulatory nucleic acids. A non-nucleic acid mucosal adjuvant as used herein is an adjuvant other than a immunostimulatory nucleic acid that is capable of inducing a mucosal immune response in a subject when administered to a mucosal surface in conjunction with an antigen. Mucosal adjuvants include but are not limited to Bacterial toxins e.g., Cholera toxin (CT), CT derivatives including but not limited to CT B subunit (CTB) (Wu et al., 1998, Tochikubo et al., 1998); CTD53 (Val to Asp) (Fontana et al., 1995); CTK97 (Val to Lys) (Fontana et al., 1995); CTK104 (Tyr to Lys) (Fontana et al., 1995); CTD53/K63 (Val to Asp, Ser to Lys) (Fontana et al., 1995); CTH54 (Arg to His) (Fontana et al., 1995); CTN107 (His to Asn) (Fontana et al., 1995); CTE114 (Ser to Glu) (Fontana et al., 1995); CTE112K (Glu to Lys) (Yamamoto et al., 1997a); CTS61F (Ser to Phe) (Yamamoto et al., 1997a, 1997b); CTS106 (Pro to Lys) (Douce et al., 1997, Fontana et al., 1995); and CTK63 (Ser to Lys) (Douce et al., 1997, Fontana et al., 1995), Zonula occludens toxin, zot, Escherichia coli heat-labile enterotoxin, Labile Toxin (LT), LT derivatives including but not limited to LT B subunit (LTB) (Verweij et al., 1998); LT7K (Arg to Lys) (Komase et al., 1998, Douce et al., 1995); LT61F (Ser to Phe) (Komase et al., 1998); LT112K (Glu to Lys) (Komase et al., 1998); LT118E (Gly to Glu) (Komase et al., 1998); LT146E (Arg to Glu) (Komase et al., 1998); LT192G (Arg to Gly) (Komase et al., 1998); LTK63 (Ser to Lys) (Marchetti et al., 1998, Douce et al., 1997, 1998, Di Tommaso et al., 1996); and LTR72 (Ala to Arg) (Giuliani et al., 1998), Pertussis toxin, PT. (Lycke et al., 1992, Spangler BD, 1992, Freytag and Clemments, 1999, Roberts et al., 1995, Wilson et al., 1995) including PT-9K/129G (Roberts et al., 1995, Cropley et al., 1995); Toxin derivatives (see below) (Holmgren et al., 1993, Verweij et al., 1998, Rappuoli et al., 1995, Freytag and Clements, 1999); Lipid A derivatives (e.g., monophosphoryl lipid A, MPL) (Sasaki et al., 1998, Vancott et al., 1998; Muramyl Dipeptide (MDP) derivatives (Fukushima et al., 1996, Ogawa et al., 1989, Michalek et al., 1983, Morisaki et al., 1983); Bacterial outer membrane proteins (e.g., outer surface protein A (OspA) lipoprotein of Borrelia burgdorferi, outer membrane protein of Neisseria meningitidis)(Marinaro et al., 1999, Van de Verg et al., 1996); Oil-in-water emulsions (e.g., MF59) (Barchfield et al., 1999, Verschoor et al., 1999, O'Hagan, 1998); Aluminum salts (Isaka et al., 1998, 1999); and Saponins (e.g., QS21) Aquila Biopharmaceuticals, Inc., Worster, Mass.) (Sasaki et al., 1998, MacNeal et al., 1998), ISCOMS, MF-59 (a squalene-in-water emulsion stabilized with Span 85 and Tween 80; Chiron Corporation, Emeryville, Calif.); the Seppic ISA series of Montanide adjuvants (e.g., Montanide ISA 720; AirLiquide, Paris, France); PROVAX (an oil-in-water emulsion containing a stabilizing detergent and a micelle-forming agent; IDEC Pharmaceuticals Corporation, San Diego, Calif.); Syntext Adjuvant Formulation (SAF; Syntex Chemicals, Inc., Boulder, Colo.); poly[di(carboxylatophenoxy)phosphazene (PCPP polymer; Virus Research Institute, USA) and Leishmania elongation factor (Corixa Corporation, Seattle, Wash.).
[0254]Immune responses can also be induced or augmented by the co-administration or co-linear expression of cytokines (Bueler & Mulligan, 1996; Chow et al., 1997; Geissler et al., 1997; Iwasaki et al., 1997; Kim et al., 1997) or B-7 co-stimulatory molecules (Iwasaki et al., 1997; Tsuji et al, 1997) with the Immunostimulatory nucleic acids. The cytokines can be administered directly with Immunostimulatory nucleic acids or may be administered in the form of a nucleic acid vector that encodes the cytokine, such that the cytokine can be expressed in vivo. In one embodiment, the cytokine is administered in the form of a plasmid expression vector. The term cytokine is used as a generic name for a diverse group of soluble proteins and peptides which act as humoral regulators at nano- to picomolar concentrations and which, either under normal or pathological conditions, modulate the functional activities of individual cells and tissues. These proteins also mediate interactions between cells directly and regulate processes taking place in the extracellular environment. Examples of cytokines include, but are not limited to IL-1, IL-2, IL-4, IL-5, IL-6, IL-7, IL-10, IL-12, IL-15, IL-18, granulocyte-macrophage colony stimulating factor (GM-CSF), granulocyte colony stimulating factor (G-CSF), interferon-α (α-IFN), IFN-α, tumor necrosis factor (TNF), TGF-β, FLT-3 ligand, and CD40 ligand.
[0255]Cytokines play a role in directing the T cell response. Helper (CD4+) T cells orchestrate the immune response of mammals through production of soluble factors that act on other immune system cells, including other T cells. Most mature CD4+ T helper cells express one of two cytokine profiles: Th1 or Th2. The Th1 subset promotes delayed-type hypersensitivity, cell-mediated immunity, and immunoglobulin class switching to IgG2a. The Th2 subset induces humoral immunity by activating B cells, promoting antibody production, and inducing class switching to IgG1 and IgE. In some embodiments, it is preferred that the cytokine be a Th1 cytokine.
[0256]The nucleic acids are also useful for redirecting an immune response from a Th2 immune response to a Th1 immune response. Redirection of an immune response from a Th2 to a Th1 immune response can be assessed by measuring the levels of cytokines produced in response to the nucleic acid (e.g., by inducing monocytic cells and other cells to produce Th1 cytokines, including IL-12, IFN-γ and GM-CSF). The redirection or rebalance of the immune response from a Th2 to a Th1 response is particularly useful for the treatment or prevention of asthma. For instance, an effective amount for treating asthma can be that amount; useful for redirecting a Th2 type of immune response that is associated with asthma to a Th1 type of response. Th2 cytokines, especially IL-4 and IL-5 are elevated in the airways of asthmatic subjects. These cytokines promote important aspects of the asthmatic inflammatory response, including IgE isotype switching, eosinophil chemotaxis and activation and mast cell growth. Th1 cytokines, especially IFN-γ and IL-12, can suppress the formation of Th2 clones and production of Th2 cytokines. The immunostimulatory nucleic acids of the invention cause an increase in Th1 cytokines which helps to rebalance the immune system, preventing or reducing the adverse effects associated with a predominately Th2 immune response.
[0257]The nucleic acids are also useful for improving survival, differentiation, activation and maturation of dendritic cells. The immunostimulatory nucleic acids have the unique capability to promote cell survival, differentiation, activation and maturation of dendritic cells. Dendritic precursor cells isolated from blood by immunomagnetic cell sorting develop morphologic and functional characteristics of dendritic cells during a two day incubation with GM-CSF. Without GM-CSF these cells undergo apoptosis. The immunostimulatory nucleic acids are superior to GM-CSF in promoting survival and differentiation of dendritic cells (MHC II expression, cell size, granularity). The immunostimulatory nucleic acids also induce maturation of dendritic cells. Since dendritic cells form the link between the innate and the acquired immune system, by presenting antigens as well as through their expression of pattern recognition receptors which detect microbial molecules like LPS in their local environment, the ability to activate dendritic cells with immunostimulatory nucleic acids supports the use of these immunostimulatory nucleic acid based strategies for in vivo and ex-vivo immunotherapy against disorders such as cancer and allergic or infectious diseases. The immunostimulatory nucleic acids are also useful for activating and inducing maturation of dendritic cells.
[0258]Immunostimulatory nucleic acids also increase natural killer cell lytic activity and antibody dependent cellular cytotoxicity (ADCC). ADCC can be performed using a immunostimulatory nucleic acid in combination with an antibody specific for a cellular target, such as a cancer cell. When the immunostimulatory nucleic acid is administered to a subject in conjunction with the antibody the subject's immune system is induced to kill the tumor cell. The antibodies useful in the ADCC procedure include antibodies which interact with a cell in the body. Many such antibodies specific for cellular targets have been described in the art and many are commercially available. Examples of these antibodies are listed below among the list of cancer immunotherapies.
[0259]The immunostimulatory nucleic acids may also be administered in conjunction with an anti-cancer therapy. Anti-cancer therapies include cancer medicaments, radiation and surgical procedures. As used herein, a "cancer medicament" refers to a agent which is administered to a subject for the purpose of treating a cancer. As used herein, "treating cancer" includes preventing the development of a cancer, reducing the symptoms of cancer, and/or inhibiting the growth of an established cancer. In other aspects, the cancer medicament is administered to a subject at risk of developing a cancer for the purpose of reducing the risk of developing the cancer. Various types of medicaments for the treatment of cancer are described herein. For the purpose of this specification, cancer medicaments are classified as chemotherapeutic agents, immunotherapeutic agents, cancer vaccines, hormone therapy, and biological response modifiers.
[0260]As used herein, a "cancer medicament" refers to an agent which is administered to a subject for the purpose of treating a cancer. As used herein, "treating cancer" includes preventing the development of a cancer, reducing the symptoms of cancer, and/or inhibiting the growth of an established cancer. In other aspects, the cancer medicament is administered to a subject at risk of developing a cancer for the purpose of reducing the risk of developing the cancer. Various types of medicaments for the treatment of cancer are described herein. For the purpose of this specification, cancer medicaments are classified as chemotherapeutic agents, immunotherapeutic agents, cancer vaccines, hormone therapy, and biological response modifiers. Additionally, the methods of the invention are intended to embrace the use of more than one cancer medicament along with the immunostimulatory nucleic acids. As an example, where appropriate, the immunostimulatory nucleic acids may be administered with a both a chemotherapeutic agent and an immunotherapeutic agent. Alternatively, the cancer medicament may embrace an immunotherapeutic agent and a cancer vaccine, or a chemotherapeutic agent and a cancer vaccine, or a chemotherapeutic agent, an immunotherapeutic agent and a cancer vaccine all administered to one subject for the purpose of treating a subject having a cancer or at risk of developing a cancer.
[0261]Cancer medicaments function in a variety of ways. Some cancer medicaments work by targeting physiological mechanisms that are specific to tumor cells. Examples include the targeting of specific genes and their gene products (i.e., proteins primarily) which are mutated in cancers. Such genes include but are not limited to oncogenes (e.g., Ras, Her2, bcl-2), tumor suppressor genes (e.g., EGF, p53, Rb), and cell cycle targets (e.g., CDK4, p21, telomerase). Cancer medicaments can alternately target signal transduction pathways and molecular mechanisms which are altered in cancer cells. Targeting of cancer cells via the epitopes expressed on their cell surface is accomplished through the use of monoclonal antibodies. This latter type of cancer medicament is generally referred to herein as immunotherapy.
[0262]Other cancer medicaments target cells other than cancer cells. For example, some medicaments prime the immune system to attack tumor cells (i.e., cancer vaccines). Still other medicaments, called angiogenesis inhibitors, function by attacking the blood supply of solid tumors. Since the most malignant cancers are able to metastasize (i.e., exist the primary tumor site and seed a distal tissue, thereby forming a secondary tumor), medicaments that impede this metastasis are also useful in the treatment of cancer. Angiogenic mediators include basic FGF, VEGF, angiopoietins, angiostatin, endostatin, TNFα, TNP-470, thrombospondin-1, platelet factor 4, CAI, and certain members of the integrin family of proteins. One category of this type of medicament is a metalloproteinase inhibitor, which inhibits the enzymes used by the cancer cells to exist the primary tumor site and extravasate into another tissue.
[0263]Some cancer cells are antigenic and thus can be targeted by the immune system. In one aspect, the combined administration of immunostimulatory nucleic acids and cancer medicaments, particularly those which are classified as cancer immunotherapies, is useful for stimulating a specific immune response against a cancer antigen. A "cancer antigen" as used herein is a compound, such as a peptide, associated with a tumor or cancer cell surface and which is capable of provoking an immune response when expressed on the surface of an antigen presenting cell in the context of an MHC molecule. Cancer antigens, such as those present in cancer vaccines or those used to prepare cancer immunotherapies, can be prepared from crude cancer cell extracts, as described in Cohen, et al., 1994, Cancer Research, 54:1055, or by partially purifying the antigens, using recombinant technology, or de novo synthesis of known antigens. Cancer antigens can be used in the form of immunogenic portions of a particular antigen or in some instances a whole cell or a tumor mass can be used as the antigen. Such antigens can be isolated or prepared recombinantly or by any other means known in the art.
[0264]The theory of immune surveillance is that a prime function of the immune system is to detect and eliminate neoplastic cells before a tumor forms. A basic principle of this theory is that cancer cells are antigenically different from normal cells and thus elicit immune reactions that are similar to those that cause rejection of immunologically incompatible allografts. Studies have confirmed that tumor cells differ, either qualitatively or quantitatively, in their expression of antigens. For example, "tumor-specific antigens" are antigens that are specifically associated with tumor cells but not normal cells. Examples of tumor specific antigens are viral antigens in tumors induced by DNA or RNA viruses. "Tumor-associated" antigens are present in both tumor cells and normal cells but are present in a different quantity or a different form in tumor cells. Examples of such antigens are oncofetal antigens (e.g., carcinoembryonic antigen), differentiation antigens (e.g., T and Tn antigens), and oncogene products (e.g., HER/neu).
[0265]Different types of cells that can kill tumor targets in vitro and in vivo have been identified: natural killer cells (NK cells), cytolytic T lymphocytes (CTLs), lymphokine-activated killer cells (LAKs), and activated macrophages. NK cells can kill tumor cells without having been previously sensitized to specific antigens, and the activity does not require the presence of class I antigens encoded by the major histocompatibility complex (MHC) on target cells. NK cells are thought to participate in the control of nascent tumors and in the control of metastatic growth. In contrast to NK cells, CTLs can kill tumor cells only after they have been sensitized to tumor antigens and when the target antigen is expressed on the tumor cells that also express MHC class I. CTLs are thought to be effector cells in the rejection of transplanted tumors and of tumors caused by DNA viruses. LAK cells are a subset of null lymphocytes distinct from the NK and CTL populations. Activated macrophages can kill tumor cells in a manner that is not antigen dependent nor MHC restricted once activated. Activated macrophages are through to decrease the growth rate of the tumors they infiltrate. In vitro assays have identified other immune mechanisms such as antibody-dependent, cell-mediated cytotoxic reactions and lysis by antibody plus complement. However, these immune effector mechanisms are thought to be less important in vivo than the function of NK, CTLs, LAK, and macrophages in vivo (for review see Piessens, W. F., and David, J., "Tumor Immunology", In: Scientific American Medicine, Vol. 2, Scientific American Books, N.Y., pp. 1-13, 1996.
[0266]The goal of immunotherapy is to augment a patient's immune response to an established tumor. One method of immunotherapy includes the use of adjuvants. Adjuvant substances derived from microorganisms, such as bacillus Calmette-Guerin, heighten the immune response and enhance resistance to tumors in animals.
[0267]Immunotherapeutic agents are medicaments which derive from antibodies or antibody fragments which specifically bind or recognize a cancer antigen. As used herein a cancer antigen is broadly defined as an antigen expressed by a cancer cell. Preferably, the antigen is expressed at the cell surface of the cancer cell. Even more preferably, the antigen is one which is not expressed by normal cells, or at least not expressed to the same level as in cancer cells. Antibody-based immunotherapies may function by binding to the cell surface of a cancer cell and thereby stimulate the endogenous immune system to attack the cancer cell. Another way in which antibody-based therapy functions is as a delivery system for the specific targeting of toxic substances to cancer cells. Antibodies are usually conjugated to toxins such as ricin (e.g., from castor beans), calicheamicin and maytansinoids, to radioactive isotopes such as Iodine-131 and Yttrium-90, to chemotherapeutic agents (as described herein), or to biological response modifiers. In this way, the toxic substances can be concentrated in the region of the cancer and non-specific toxicity to normal cells can be minimized. In addition to the use of antibodies which are specific for cancer antigens, antibodies which bind to vasculature, such as those which bind to endothelial cells, are also useful in the invention. This is because generally solid tumors are dependent upon newly formed blood vessels to survive, and thus most tumors are capable of recruiting and stimulating the growth of new blood vessels. As a result, one strategy of many cancer medicaments is to attack the blood vessels feeding a tumor and/or the connective tissues (or stroma) supporting such blood vessels.
[0268]The use of immunostimulatory nucleic acids in conjunction with immunotherapeutic agents such as monoclonal antibodies is able to increase long-term survival through a number of mechanisms including significant enhancement of ADCC (as discussed above), activation of natural killer (NK) cells and an increase in IFNα levels. The nucleic acids when used in combination with monoclonal antibodies serve to reduce the dose of the antibody required to achieve a biological result.
[0269]Examples of cancer immunotherapies which are currently being used or which are in development are listed in Table C.
TABLE-US-00004 TABLE C Cancer Immunotherapies in Development or on the Market MARKETER BRAND NAME (GENERIC NAME) INDICATION IDEC/Genentech, Inc./Hoffmann- Rituxan ® (rituximab, Mabthera) (IDEC- non-Hodgkin's lymphoma LaRoche (first monoclonal C2B8, chimeric murine/human anti-CD20 antibody licensed for the MAb) treatment of cancer in the U.S.) Genentech/Hoffmann-La Roche Herceptin, anti-Her2 hMAb Breast/ovarian Cytogen Corp. Quadramet (CYT-424) radiotherapeutic agent Bone metastases Centocor/Glaxo/Ajinomoto Panorex ® (17-1A) (murine monoclonal Adjuvant therapy for antibody) colorectal (Dukes-C) Centocor/Ajinomoto Panorex ® (17-1A) (chimeric murine Pancreatic, lung, breast, monoclonal antibody) ovary IDEC IDEC-Y2B8 (murine, anti-CD20 MAb non-Hodgkin's lymhoma labeled with Yttrium-90) ImClone Systems BEC2 (anti-idiotypic MAb, mimics the GD3 Small cell lung epitope) (with BCG) ImClone Systems C225 (chimeric monoclonal antibody to Renal cell epidermal growth factor receptor (EGFr)) Techniclone International/Alpha Oncolym (Lym-1 monoclonal antibody non-Hodgkin's lymphoma Therapeutics linked to 131 iodine) Protein Design Labs SMART M195 Ab, humanized Acute myleoid leukemia Techniclone 131I LYM-1 (Oncolym ®) non-Hodgkin's lymphoma Corporation/Cambridge Antibody Technology Aronex Pharmaceuticals, Inc. ATRAGEN ® Acute promyelocytic leukemia ImClone Systems C225 (chimeric anti-EGFr monoclonal Head & neck, non-small antibody) + cisplatin or radiation cell lung cancer Altarex, Canada Ovarex (B43.13, anti-idiotypic CA125, Ovarian mouse MAb) Coulter Pharma (Clinical results Bexxar (anti-CD20 Mab labeled with 131I) non-Hodgkin's lymphoma have been positive, but the drug has been associated with significant bone marrow toxicity) Aronex Pharmaceuticals, Inc. ATRAGEN ® Kaposi's sarcoma IDEC Pharmaceuticals Rituxan ® (MAb against CD20) pan-B Ab in B cell lymphoma Corp./Genentech combo. with chemotherapy LeukoSite/Ilex Oncology LDP-03, huMAb to the leukocyte antigen Chronic lymphocytic CAMPATH leukemia (CLL) Center of Molecular Immunology ior t6 (anti CD6, murine MAb) CTCL Cancer Medarex/Novartis MDX-210 (humanized anti-HER-2 bispecific Breast, ovarian antibody) Medarex/Novartis MDX-210 (humanized anti-HER-2 bispecific Prostate, non-small cell antibody) lung, pancreatic, breast Medarex MDX-11 (complement activating receptor Acute myelogenous (CAR) monoclonal antibody) leukemia (AML) Medarex/Novartis MDX-210 (humanized anti-HER-2 bispecific Renal and colon antibody) Medarex MDX-11 (complement activating receptor Ex vivo bone marrow (CAR) monoclonal antibody) purging in acute myelogenous leukemia (AML) Medarex MDX-22 (humanized bispecific antibody, Acute myleoid leukemia MAb-conjugates) (complement cascade activators) Cytogen OV103 (Yttrium-90 labelled antibody) Ovarian Cytogen OV103 (Yttrium-90 labelled antibody) Prostate Aronex Pharmaceuticals, Inc. ATRAGEN ® non-Hodgkin's lymphoma Glaxo Wellcome plc 3622W94 MAb that binds to EGP40 (17-1A) non-small cell lung, pancarcinoma antigen on adenocarcinomas prostate (adjuvant) Genentech Anti-VEGF, RhuMAb (inhibits angiogenesis) Lung, breast, prostate, colorectal Protein Design Labs Zenapax (SMART Anti-Tac (IL-2 receptor) Leukemia, lymphoma Ab, humanized) Protein Design Labs SMART M195 Ab, humanized Acute promyelocytic leukemia ImClone Systems C225 (chimeric anti-EGFr monoclonal Breast antibody) + taxol ImClone Systems (licensed from C225 (chimeric anti-EGFr monoclonal prostate RPR) antibody) + doxorubicin ImClone Systems C225 (chimeric anti-EGFr monoclonal prostate antibody) + adriamycin ImClone Systems BEC2 (anti-idiotypic MAb, mimics the GD3 Melanoma epitope) Medarex MDX-210 (humanized anti-HER-2 bispecific Cancer antibody) Medarex MDX-220 (bispecific for tumors that express Lung, colon, prostate, TAG-72) ovarian, endometrial, pancreatic and gastric Medarex/Novartis MDX-210 (humanized anti-HER-2 bispecific Prostate antibody) Medarex/Merck KgaA MDX-447 (humanized anti-EGF receptor EGF receptor cancers bispecific antibody) (head & neck, prostate, lung, bladder, cervical, ovarian) Medarex/Novartis MDX-210 (humanized anti-HER-2 bispecific Comb. Therapy with G- antibody) CSF for various cancers, esp. breast IDEC MELIMMUNE-2 (murine monoclonal Melanoma antibody therapeutic vaccine) IDEC MELIMMUNE-1 (murine monoclonal Melanoma antibody therapeutic vaccine) Immunomedics, Inc. CEACIDE ® (I-131) Colorectal and other NeoRx Pretarget ® radioactive antibodies non-Hodgkin's B cell lymphoma Novopharm Biotech, Inc. NovoMAb-G2 (pancarcinoma specific Ab) Cancer Techniclone Corporation/ TNT (chimeric MAb to histone antigens) Brain Cambridge Antibody Technology Techniclone International/ TNT (chimeric MAb to histone antigens) Brain Cambridge Antibody Technology Novopharm Gliomab-H (Monoclonals-Humanized Abs) Brain, melanomas, neuroblastomas Genetics Institute/AHP GNI-250 Mab Colorectal Merck KgaA EMD-72000 (chimeric-EGF antagonist) Cancer Immunomedics LymphoCide (humanized LL2 antibody) non-Hodgkin's B-cell lymphoma Immunex/AHP CMA 676 (monoclonal antibody conjugate) Acute myelogenous leukemia Novopharm Biotech, Inc. Monopharm-C Colon, lung, pancreatic Novopharm Biotech, Inc. 4B5 anti-idiotype Ab Melanoma, small-cell lung Center of Molecular Immunology ior egf/r3 (anti EGF-R humanized Ab) Radioimmunotherapy Center of Molecular Immunology ior c5 (murine MAb colorectal) for Colorectal radioimmunotherapy Creative BioMolecules/ BABS (biosynthetic antibody binding site) Breast cancer Chiron Proteins ImClone Systems/Chugai FLK-2 (monoclonal antibody to fetal liver Tumor-associated kinase-2 (FLK-2)) angiogenesis ImmunoGen, Inc. Humanized MAb/small-drug conjugate Small-cell lung Medarex, Inc. MDX-260 bispecific, targets GD-2 Melanoma, glioma, neuroblastoma Procyon Biopharma, Inc. ANA Ab Cancer Protein Design Labs SMART 1D10 Ab B-cell lymphoma Protein Design Labs/Novartis SMART ABL 364 Ab Breast, lung, colon Immunomedics, Inc. ImmuRAIT-CEA Colorectal
[0270]Yet other types of chemotherapeutic agents which can be used according to the invention include Aminoglutethimide, Asparaginase, Busulfan, Carboplatin, Chlorombucil, Cytarabine HCl, Dactinomycin, Daunorubicin HCl, Estramustine phosphate sodium, Etoposide (VP16-213), Floxuridine, Fluorouracil (5-FU), Flutamide, Hydroxyurea (hydroxycarbamide), Ifosfamide, Interferon Alfa-2a, Alfa-2b, Leuprolide acetate (LHRH-releasing factor analogue), Lomustine (CCNU), Mechlorethamine HCl (nitrogen mustard), Mercaptopurine, Mesna, Mitotane (o.p'-DDD), Mitoxantrone HCl, Octreotide, Plicamycin, Procarbazine HCl, Streptozocin, Tamoxifen citrate, Thioguanine, Thiotepa, Vinblastine sulfate, Amsacrine (m-AMSA), Azacitidine, Erthropoietin, Hexamethylmelamine (HMM), Interleukin 2, Mitoguazone (methyl-GAG; methyl glyoxal bis-guanylhydrazone; MGBG), Pentostatin (2'deoxycoformycin), Semustine (methyl-CCNU), Teniposide (VM-26) and Vindesine sulfate.
[0271]Cancer vaccines are medicaments which are intended to stimulate an endogenous immune response against cancer cells. Currently produced vaccines predominantly activate the humoral immune system (i.e., the antibody dependent immune response). Other vaccines currently in development are focused on activating the cell-mediated immune system including cytotoxic T lymphocytes which are capable of killing tumor cells. Cancer vaccines generally enhance the presentation of cancer antigens to both antigen presenting cells (e.g., macrophages and dendritic cells) and/or to other immune cells such as T cells, B cells, and NK cells.
[0272]Although cancer vaccines may take one of several forms, as discussed infra, their purpose is to deliver cancer antigens and/or cancer associated antigens to antigen presenting cells (APC) in order to facilitate the endogenous processing of such antigens by APC and the ultimate presentation of antigen presentation on the cell surface in the context of MHC class I molecules. One form of cancer vaccine is a whole cell vaccine which is a preparation of cancer cells which have been removed from a subject, treated ex vivo and then reintroduced as whole cells in the subject. Lysates of tumor cells can also be used as cancer vaccines to elicit an immune response. Another form cancer vaccine is a peptide vaccine which uses cancer-specific or cancer-associated small proteins to activate T cells. Cancer-associated proteins are proteins which are not exclusively expressed by cancer cells (i.e., other normal cells may still express these antigens). However, the expression of cancer-associated antigens is generally consistently upregulated with cancers of a particular type. Yet another form of cancer vaccine is a dendritic cell vaccine which includes whole dendritic cells which have been exposed to a cancer antigen or a cancer-associated antigen in vitro. Lysates or membrane fractions of dendritic cells may also be used as cancer vaccines. Dendritic cell vaccines are able to activate antigen-presenting cells directly. Other cancer vaccines include ganglioside vaccines, heat-shock protein vaccines, viral and bacterial vaccines, and nucleic acid vaccines.
[0273]The use of immunostimulatory nucleic acids in conjunction with cancer vaccines provides an improved antigen-specific humoral and cell mediated immune response, in addition to activating NK cells and endogenous dendritic cells, and increasing IFNα levels. This enhancement allows a vaccine with a reduced antigen dose to be used to achieve the same beneficial effect. In some instances, cancer vaccines may be used along with adjuvants, such as those described above.
[0274]As used herein, the terms "cancer antigen" and "tumor antigen" are used interchangeably to refer to antigens which are differentially expressed by cancer cells and can thereby be exploited in order to target cancer cells. Cancer antigens are antigens which can potentially stimulate apparently tumor-specific immune responses. Some of these antigens are encoded, although not necessarily expressed, by normal cells. These antigens can be characterized as those which are normally silent (i.e., not expressed) in normal cells, those that are expressed only at certain stages of differentiation and those that are temporally expressed such as embryonic and fetal antigens. Other cancer antigens are encoded by mutant cellular genes, such as oncogenes (e.g., activated ras oncogene), suppressor genes (e.g., mutant p53), fusion proteins resulting from internal deletions or chromosomal translocations. Still other cancer antigens can be encoded by viral genes such as those carried on RNA and DNA tumor viruses.
[0275]Other vaccines take the form of dendritic cells which have been exposed to cancer antigens in vitro, have processed the antigens and are able to express the cancer antigens at their cell surface in the context of MHC molecules for effective antigen presentation to other immune system cells.
[0276]The immunostimulatory nucleic acids are used in one aspect of the invention in conjunction with cancer vaccines which are dendritic cell based. A dendritic cell is a professional antigen presenting cell. Dendritic cells form the link between the innate and the acquired immune system by presenting antigens and through their expression of pattern recognition receptors which detect microbial molecules like LPS in their local environment. Dendritic cells efficiently internalize, process, and present soluble specific antigen to which it is exposed. The process of internalizing and presenting antigen causes rapid upregulation of the expression of major histocompatibility complex (MHC) and costimulatory molecules, the production of cytokines, and migration toward lymphatic organs where they are believed to be involved in the activation of T cells.
[0277]Table D lists a variety of cancer vaccines which are either currently being used or are in development.
TABLE-US-00005 TABLE D Cancer Vaccines in Development or on the Market MARKETER BRAND NAME (GENERIC NAME) INDICATION Center of Molecular EGF Cancer Immunology Center of Molecular Ganglioside cancer Immunology vaccine Center of Molecular Anti-idiotypic Cancer vaccine Immunology ImClone Systems/Memorial Gp75 antigen Melanoma Sloan-Kettering Cancer Center ImClone Systems/Memorial Anti-idiotypic Abs Cancer vaccines Sloan-Kettering Cancer Center Progenics Pharmaceuticals, Inc. GMK melanoma vaccine Melanoma Progenics Pharmaceuticals, Inc, MGV ganglioside conjugate vaccine Lymphoma, colorectal, lung Corixa Her2/neu Breast, ovarian AltaRex Ovarex Ovarian AVAX Technologies Inc. M-Vax, autologous whole cell Melanoma AVAX Technologies Inc. 0-Vax, autologous whole cell Ovarian AVAX Technologies Inc. L-Vax, autologous whole cell Leukemia-AML Biomira Inc./Chiron Theratope, STn-KLH Breast, Colorectal Biomira Inc. BLP25, MUC-1 peptide vaccine encapsulated Lung in liposomal delivery system Biomira Inc. BLP25, MUC-1 peptide vaccine encapsulated Lung in liposomal delivery system + Liposomal IL-2 Biomira Inc. Liposomal idiotypic vaccine Lymphoma B-cell malignancies Ribi Immunochem Melacine, cell lysate Melanoma Corixa Peptide antigens, microsphere delivery sysem Breast and LeIF adjuvant Corixa Peptide antigens, microsphere delivery sysem Prostate and LeIF adjuvant Corixa Peptide antigens, microsphere delivery sysem Ovarian and LeIF adjuvant Corixa Peptide antigens, microsphere delivery sysem Lymphoma and LeIF adjuvant Corixa Peptide antigens, microsphere delivery sysem Lung and LeIF adjuvant Virus Research Institute Toxin/antigen recombinant delivery system All cancers Apollon Inc. Genevax-TCR T-cell lymphoma Bavarian Nordic Research MVA-based (vaccinia virus) vaccine Melanoma Institute A/S BioChem Pharma/BioChem PACIS, BCG vaccine Bladder Vaccine Cantab Pharmaceuticals TA-HPV Cervical Cantab Pharmaceuticals TA-CIN Cervical Cantab Pharmaceuticals DISC-Virus, immunotherapy Cancer Pasteur Merieux Connaught ImmuCyst ®/TheraCys ® - BCG Bladder Immunotherapeutic (Bacillus Calmette- Guerin/Connaught), for intravesical treatment of superficial bladder cancer
[0278]As used herein, chemotherapeutic agents embrace all other forms of cancer medicaments which do not fall into the categories of immunotherapeutic agents or cancer vaccines. Chemotherapeutic agents as used herein encompass both chemical and biological agents. These agents function to inhibit a cellular activity which the cancer cell is dependent upon for continued survival. Categories of chemotherapeutic agents include alkylating/alkaloid agents, antimetabolites, hormones or hormone analogs, and miscellaneous antineoplastic drugs. Most if not all of these agents are directly toxic to cancer cells and do not require immune stimulation. Combination chemotherapy and immunostimulatory nucleic acid administration increases the maximum tolerable dose of chemotherapy.
[0279]Chemotherapeutic agents which are currently in development or in use in a clinical setting are shown in Table E.
TABLE-US-00006 TABLE E Cancer Drugs in Development or on the Market Marketer Brand Name Generic Name Indication Abbott TNP 470/AGM 1470 Fragyline Anti-Angiogenesis in Cancer Takeda TNP 470/AGM 1470 Fragyline Anti-Angiogenesis in Cancer Scotia Meglamine GLA Meglamine GLA Bladder Cancer Medeva Valstar Valrubicin Bladder Cancer - Refractory in situ carcinoma Medeva Valstar Valrubicin Bladder Cancer - Papillary Cancer Rhone Poulenc Gliadel Wafer Carmustaine + Polifepr Osan Brain Tumor Warner Lambert Undisclosed Cancer (b) Undisclosed Cancer (b) Cancer Bristol Myers RAS Famesyl Transferase RAS FamesylTransferase Cancer Squib Inhibitor Inhibitor Novartis MMI 270 MMI 270 Cancer Bayer BAY 12-9566 BAY 12-9566 Cancer Merck Famesyl Transferase Inhibitor Famesyl Transferase Cancer (Solid tumors - Inhibitor pancrease, colon, lung, breast) Pfizer PFE MMP Cancer, angiogenesis Pfizer PFE Tyrosine Kinase Cancer, angiogenesis Lilly MTA/LY 231514 MTA/LY 231514 Cancer Solid Tumors Lilly LY 264618/Lometexol Lometexol Cancer Solid Tumors Scotia Glamolec LiGLA (lithium-gamma Cancer, pancreatic, breast, linolenate) colon Warner Lambert CI-994 CI-994 Cancer, Solid Tumors/ Leukemia Schering AG Angiogenesis inhibitor Angiogenesis Inhibitor Cancer/Cardio Takeda TNP-470 n/k Malignant Tumor Smithkline Hycamtin Topotecan Metastatic Ovarian Cancer Beecham Novartis PKC 412 PKC 412 Multi-Drug Resistant Cancer Novartis Valspodar PSC 833 Myeloid Leukemia/Ovarian Cancer Immunex Novantrone Mitoxantrone Pain related to hormone refractory prostate cancer. Warner Lambert Metaret Suramin Prostate Genentech Anti-VEGF Anti-VEGF Prostate/Breast/Colorectal/ NSCL Cancer British Biotech Batimastat Batimastat (BB94) Pterygium Eisai E 7070 E 7070 Solid Tumors Biochem BCH-4556 BCH-4556 Solid Tumors Pharma Sankyo CS-682 CS-682 Solid Tumors Agouron AG2037 AG2037 Solid Tumors IDEC Pharma 9-AC 9-AC Solid Tumors Agouron VEGF/b-FGF Inhibitors VEGF/b-FGF Inhibitors Solid Tumors Agouron AG3340 AG3340 Solid Tumors/Macular Degen Vertex Incel VX-710 Solid Tumors - IV Vertex VX-853 VX-853 Solid Tumors - Oral Zeneca ZD 0101 (inj) ZD 0101 Solid Tumors Novartis ISI 641 ISI 641 Solid Tumors Novartis ODN 698 ODN 698 Solid Tumors Tanube Seiyaku TA 2516 Marimistat Solid Tumors British Biotech Marimastat Marimastat (BB 2516) Solid Tumors Celltech CDP 845 Aggrecanase Inhibitor Solid Tumors/Breast Cancer Chiroscience D2163 D2163 Solid Tumors/Metastases Warner Lambert PD 183805 PD 183805 Daiichi DX8951f DX8951f Anti-Cancer Daiichi Lemonal DP 2202 Lemonal DP 2202 Anti-Cancer Fujisawa FK 317 FK 317 Anticancer Antibiotic Chugai Picibanil OK-432 Antimalignant Tumor Nycomed AD 32/valrubicin Valrubicin Bladder Cancer-Refractory Amersham Insitu Carcinoma Nycomed Metastron Strontium Derivative Bone Cancer (adjunt therapy, Amersham Pain) Schering Plough Temodal Temozolomide Brain Tumours Schering Plough Temodal Temozolonide Brain Tumours Liposome Evacet Doxorubicin, Liposomal Breast Cancer Nycomed Yewtaxan Paclitaxel Breast Cancer Advanced, Amersham Ovarian Cancer Advanced Bristol Myers Taxol Paclitaxel Breast Cancer Advanced, Squib Ovarian Cancer Advanced, NSCLC Roche Xeloda Capecitabine Breast Cancer, Colorectal Cancer Roche Furtulon Doxifluridine Breast Cancer, Colorectal Cancer, Gastric Cancer Pharmacia & Adriamycin Doxorubicin Breast Cancer, Leukemia Upjohn Ivax Cyclopax Paclitaxel, Oral Breast/Ovarian Cancer Rhone Poulenc Oral Taxoid Oral Taxoid Broad Cancer AHP Novantrone Mitoxantrone Cancer Sequus SPI-077 Cisplatin, Stealth Cancer Hoechst HMR 1275 Flavopiridol Cancer Pfizer CP-358, 774 EGFR Cancer Pfizer CP-609, 754 RAS Oncogene Inhibitor Cancer Bristol Myers BMS-182751 Oral Platinum Cancer (Lung, Ovarian) Squib Bristol Myers UFT (Tegafur/Uracil) UFT (Tegafur/Uracil) Cancer Oral Squib Johnson & Ergamisol Levamisole Cancer Therapy Johnson Glaxo Wellcome Eniluracil/776C85 5FU Enhancer Cancer, Refractory Solid & Colorectal Cancer Johnson & Ergamisol Levamisole Colon Cancer Johnson Rhone Poulenc Campto Irinotecan Colorectal Cancer, Cervical Cancer Pharmacia & Camptosar Irinotecan Colorectal Cancer, Cervical Upjohn Cancer Zeneca Tomudex Ralitrexed Colorectal Cancer, Lung Cancer, Breast Cancer Johnson & Leustain Cladribine Hairy Cell Leukaemia Johnson Ivax Paxene Paclitaxel Kaposi Sarcoma Sequus Doxil Doxorubicin, Liposomal KS/Cancer Sequus Caelyx Doxorubicin, Liposomal KS/Cancer Schering AG Fludara Fludarabine Leukaemia Pharmacia & Pharmorubicin Epirubicin Lung/Breast Cancer Upjohn Chiron DepoCyt DepoCyt Neoplastic Meningitis Zeneca ZD1839 ZD 1839 Non Small Cell Lung Cancer, Pancreatic Cancer BASF LU 79553 Bis-Naphtalimide Oncology BASF LU 103793 Dolastain Oncology Shering Plough Caetyx Doxorubicin-Liposome Ovarian/Breast Cancer Lilly Gemzar Gemcitabine Pancreatic Cancer, Non Small Cell Lung Cancer, Breast, Bladder and Ovarian Zeneca ZD 0473/Anormed ZD 0473/Anormed Platinum based NSCL, ovarian etc. Yamanouchi YM 116 YM 116 Prostate Cancer Nycomed Seeds/I-125 Rapid St Lodine Seeds Prostate Cancer Amersham Agouron Cdk4/cdk2 inhibitors cdk4/cdk2 inhibitors Solid Tumors Agouron PARP inhibitors PARP Inhibitors Solid Tumors Chiroscience D4809 Dexifosamide Solid Tumors Bristol Myers UFT (Tegafur/Uracil) UFT (Tegafur/Uracil) Solid Tumors Squib Sankyo Krestin Krestin Solid Tumors Asta Medica Ifex/Mesnex Ifosamide Solid Tumors Bristol Meyers Ifex/Mesnex Ifosamide Solid Tumors Squib Bristol Myers Vumon Teniposide Solid Tumors Squib Bristol Myers Paraplatin Carboplatin Solid Tumors Squib Bristol Myers Plantinol Cisplatin, Stealth Solid Tumors Squib Bristol Myers Plantinol Cisplatin Solid Tumors Squib Bristol Myers Vepeside Etoposide Solid Tumors Melanoma Squib Zeneca ZD 9331 ZD 9331 Solid Tumors, Advanced Colorectal Chugai Taxotere Docetaxel Solid Tumors, Breast Cancer Rhone Poulenc Taxotere Docetaxel Solid Tumors, Breast Cancer Glaxo Wellcome Prodrug of guanine Prodrug of arabinside T Cell Leukemia/Lymphoma arabinside & B Cell Neoplasm Bristol Myers Taxane Analog Taxane Analog Taxol follow up Squib
[0280]In one embodiment, the methods of the invention use immunostimulatory nucleic acids as a replacement to the use of IFNα therapy in the treatment of cancer. Currently, some treatment protocols call for the use of IFNα. Since IFNα is produced following the administration of some immunostimulatory nucleic acids, these nucleic acids can be used to generate IFNα endogenously.
[0281]The invention also includes a method for inducing antigen non-specific innate immune activation and broad spectrum resistance to infectious challenge using the immunostimulatory nucleic acids. The term antigen non-specific innate immune activation as used herein refers to the activation of immune cells other than B cells and for instance can include the activation of NK cells, T cells or other immune cells that can respond in an antigen independent fashion or some combination of these cells. A broad spectrum resistance to infectious challenge is induced because the immune cells are in active form and are primed to respond to any invading compound or microorganism. The cells do not have to be specifically primed against a particular antigen. This is particularly useful in biowarfare, and the other circumstances described above such as travelers.
[0282]The stimulation index of a particular immunostimulatory nucleic acid can be tested in various immune cell assays. Preferably, the stimulation index of the immunostimulatory nucleic acid with regard to B cell proliferation is at least about 5, preferably at least about 10, more preferably at least about 15 and most preferably at least about 20 as determined by incorporation of 3H uridine in a murine B cell culture, which has been contacted with 20 μM of nucleic acid for 20 h at 37° C. and has been pulsed with 1 μCi of 3H uridine; and harvested and counted 4 h later as described in detail in PCT Published Patent Applications PCT/U.S. 95/01570 (WO 96/02555) and PCT/U.S. 97/19791 (WO 98/18810) claiming priority to U.S. Ser. Nos. 08/386,063, now U.S. Pat. Nos. 6,194,388, and 08/960,774, now U.S. Pat. No. 6,239,116, filed on Feb. 7, 1995 and Oct. 30, 1997 respectively. For use in vivo, for example, it is important that the immunostimulatory nucleic acids be capable of effectively inducing an immune response, such as, for example, antibody production.
[0283]Immunostimulatory nucleic acids are effective in non-rodent vertebrate. Different immunostimulatory nucleic acid can cause optimal immune stimulation depending on the type of subject and the sequence of the immunostimulatory nucleic acid. Many vertebrates have been found according to the invention to be responsive to the same class of immunostimulatory nucleic acids, sometimes referred to as human specific immunostimulatory nucleic acids. Rodents, however, respond to different nucleic acids. As shown herein an immunostimulatory nucleic acid causing optimal stimulation in humans may not generally cause optimal stimulation in a mouse and vice versa. An immunostimulatory nucleic acid causing optimal stimulation in humans often does, however, cause optimal stimulation in other animals such as cow, horses, sheep, etc. One of skill in the art can identify the optimal nucleic acid sequences useful for a particular species of interest using routine assays described herein and/or known in the art, using the guidance supplied herein.
[0284]The immunostimulatory nucleic acids may be directly administered to the subject or may be administered in conjunction with a nucleic acid delivery complex. A nucleic acid delivery complex shall mean a nucleic acid molecule associated with (e.g. ionically or covalently bound to; or encapsulated within) a targeting means (e.g. a molecule that results in higher affinity binding to target cell (e.g., B cell surfaces and/or increased cellular uptake by target cells). Examples of nucleic acid delivery complexes include nucleic acids associated with a sterol (e.g. cholesterol), a lipid (e.g. a cationic lipid, virosome or liposome), or a target cell specific binding agent (e.g. a ligand recognized by target cell specific receptor). Preferred complexes may be sufficiently stable in vivo to prevent significant uncoupling prior to internalization by the target cell. However, the complex can be cleavable under appropriate conditions within the cell so that the nucleic acid is released in a functional form.
[0285]Delivery vehicles or delivery devices for delivering antigen and nucleic acids to surfaces have been described. The Immunostimulatory nucleic acid and/or the antigen and/or other therapeutics may be administered alone (e.g., in saline or buffer) or using any delivery vehicles known in the art. For instance the following delivery vehicles have been described: Cochleates (Gould-Fogerite et al., 1994, 1996); Emulsomes (Vancott et al., 1998, Lowell et al., 1997); ISCOMs (Mowat et al., 1993, Carlsson et al., 1991, Hu et., 1998, Morein et al., 1999); Liposomes (Childers et al., 1999, Michalek et al., 1989, 1992, de Haan 1995a, 1995b); Live bacterial vectors (e.g., Salmonella, Escherichia coli, Bacillus calmatte-guerin, Shigella, Lactobacillus) (Hone et al., 1996, Pouwels et al., 1998, Chatfield et al., 1993, Stover et al., 1991, Nugent et al., 1998); Live viral vectors (e.g., Vaccinia, adenovirus, Herpes Simplex) (Gallichan et al., 1993, 1995, Moss et al., 1996, Nugent et al., 1998, Flexner et al., 1988, Morrow et al., 1999); Microspheres (Gupta et al., 1998, Jones et al., 1996, Maloy et al., 1994, Moore et al., 1995, O'Hagan et al., 1994, Eldridge et al., 1989); Nucleic acid vaccines (Fynan et al., 1993, Kuklin et al., 1997, Sasaki et al., 1998, Okada et al., 1997, Ishii et al., 1997); Polymers (e.g. carboxymethylcellulose, chitosan) (Hamajima et al., 1998, Jabbal-Gill et al., 1998); Polymer rings (Wyatt et al., 1998); Proteosomes (Vancott et al., 1998, Lowell et al., 1988, 1996, 1997); Sodium Fluoride (Hashi et al., 1998); Transgenic plants (Tacket et al., 1998, Mason et al., 1998, Haq et al., 1995); Virosomes (Gluck et al., 1992, Mengiardi et al., 1995, Cryz et al., 1998); Virus-like particles (Jiang et al., 1999, Leibl et al., 1998). Other delivery vehicles are known in the art and some additional examples are provided below in the discussion of vectors.
[0286]The term effective amount of a immunostimulatory nucleic acid refers to the amount necessary or sufficient to realize a desired biologic effect. For example, an effective amount of a immunostimulatory nucleic acid for inducing mucosal immunity is that amount necessary to cause the development of IgA in response to an antigen upon exposure to the antigen, whereas that amount required for inducing systemic immunity is that amount necessary to cause the development of IgG in response to an antigen upon exposure to the antigen. Combined with the teachings provided herein, by choosing among the various active compounds and weighing factors such as potency, relative bioavailability, patient body weight, severity of adverse side-effects and preferred mode of administration, an effective prophylactic or therapeutic treatment regimen can be planned which does not cause substantial toxicity and yet is entirely effective to treat the particular subject. The effective amount for any particular application can vary depending on such factors as the disease or condition being treated, the particular immunostimulatory nucleic acid being administered, the antigen, the size of the subject, or the severity of the disease or condition. One of ordinary skill in the art can empirically determine the effective amount of a particular immunostimulatory nucleic acid and/or antigen and/or other therapeutic agent without necessitating undue experimentation.
[0287]Subject doses of the compounds described herein for mucosal or local delivery typically range from about 0.1 μg to 10 mg per administration, which depending on the application could be given daily, weekly, or monthly and any other amount of time therebetween. More typically mucosal or local doses range from about 10 μg to 5 mg per administration, and most typically from about 100 μg to 1 mg, with 2-4 administrations being spaced days or weeks apart. More typically, immune stimulant doses range from 1 μg to 10 mg per administration, and most typically 10 μg to 1 mg, with daily or weekly administrations. Subject doses of the compounds described herein for parenteral delivery for the purpose of inducing an antigen-specific immune response, wherein the compounds are delivered with an antigen but not another therapeutic agent are typically 5 to 10,000 times higher than the effective mucosal dose for vaccine adjuvant or immune stimulant applications, and more typically 10 to 1,000 times higher, and most typically 20 to 100 times higher. Doses of the compounds described herein for parenteral delivery for the purpose of inducing an innate immune response or for increasing ADCC or for inducing an antigen specific immune response when the immunostimulatory nucleic acids are administered in combination with other therapeutic agents or in specialized delivery vehicles typically range from about 0.1 μg to 10 mg per administration, which depending on the application could be given daily, weekly, or monthly and any other amount of time therebetween. More typically parenteral doses for these purposes range from about 10 μg to 5 mg per administration, and most typically from about 100 μg to 1 mg, with 2-4 administrations being spaced days or weeks apart. In some embodiments, however, parenteral doses for these purposes may be used in a range of 5 to 10,000 times higher than the typical doses described above.
[0288]For any compound described herein the therapeutically effective amount can be initially determined from animal models. A therapeutically effective dose can also be determined from human data for CpG oligonucleotides which have been tested in humans (human clinical trials have been initiated) and for compounds which are known to exhibit similar pharmacological activities, such as other mucosal adjuvants, e.g., LT and other antigens for vaccination purposes, for the mucosal or local administration. Higher doses are required for parenteral administration. The applied dose can be adjusted based on the relative bioavailability and potency of the administered compound. Adjusting the dose to achieve maximal efficacy based on the methods described above and other methods as are well-known in the art is well within the capabilities of the ordinarily skilled artisan.
[0289]The formulations of the invention are administered in pharmaceutically acceptable solutions, which may routinely contain pharmaceutically acceptable concentrations of salt, buffering agents, preservatives, compatible carriers, adjuvants, and optionally other therapeutic ingredients.
[0290]For use in therapy, an effective amount of the immunostimulatory nucleic acid can be administered to a subject by any mode that delivers the nucleic acid to the desired surface, e.g., mucosal, systemic. Administering the pharmaceutical composition of the present invention may be accomplished by any means known to the skilled artisan. Preferred routes of administration include but are not limited to oral, parenteral, intramuscular, intranasal, intratracheal, inhalation, ocular, vaginal, and rectal.
[0291]For oral administration, the compounds (i.e., immunostimulatory nucleic acids, antigens and other therapeutic agents) can be formulated readily by combining the active compound(s) with pharmaceutically acceptable carriers well known in the art. Such carriers enable the compounds of the invention to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions and the like, for oral ingestion by a subject to be treated. Pharmaceutical preparations for oral use can be obtained as solid excipient, optionally grinding a resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries, if desired, to obtain tablets or dragee cores. Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tragacanth, methyl cellulose, hydroxypropylmethyl-cellulose, sodium carboxymethylcellulose, and/or polyvinylpyrrolidone (PVP). If desired, disintegrating agents may be added, such as the cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof such as sodium alginate. Optionally the oral formulations may also be formulated in saline or buffers for neutralizing internal acid conditions or may be administered without any carriers.
[0292]Dragee cores are provided with suitable coatings. For this purpose, concentrated sugar solutions may be used, which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, and/or titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures. Dyestuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses.
[0293]Pharmaceutical preparations which can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol. The push-fit capsules can contain the active ingredients in admixture with filler such as lactose, binders such as starches, and/or lubricants such as talc or magnesium stearate and, optionally, stabilizers. In soft capsules, the active compounds may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols. In addition, stabilizers may be added. Microspheres formulated for oral administration may also be used. Such microspheres have been well defined in the art. All formulations for oral administration should be in dosages suitable for such administration.
[0294]For buccal administration, the compositions may take the form of tablets or lozenges formulated in conventional manner.
[0295]For administration by inhalation, the compounds for use according to the present invention may be conveniently delivered in the form of an aerosol spray presentation from pressurized packs or a nebulizer, with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas. In the case of a pressurized aerosol the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges of e.g. gelatin for use in an inhaler or insufflator may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.
[0296]The compounds, when it is desirable to deliver them systemically, may be formulated for parenteral administration by injection, e.g., by bolus injection or continuous infusion. Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative. The compositions may take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
[0297]Pharmaceutical formulations for parenteral administration include aqueous solutions of the active compounds in water-soluble form. Additionally, suspensions of the active compounds may be prepared as appropriate oily injection suspensions. Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters, such as ethyl oleate or triglycerides, or liposomes. Aqueous injection suspensions may contain substances which increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran. Optionally, the suspension may also contain suitable stabilizers or agents which increase the solubility of the compounds to allow for the preparation of highly concentrated solutions.
[0298]Alternatively, the active compounds may be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.
[0299]The compounds may also be formulated in rectal or vaginal compositions such as suppositories or retention enemas, e.g., containing conventional suppository bases such as cocoa butter or other glycerides.
[0300]In addition to the formulations described previously, the compounds may also be formulated as a depot preparation. Such long acting formulations may be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.
[0301]The pharmaceutical compositions also may comprise suitable solid or gel phase carriers or excipients. Examples of such carriers or excipients include but are not limited to calcium carbonate, calcium phosphate, various sugars, starches, cellulose derivatives, gelatin, and polymers such as polyethylene glycols.
[0302]Suitable liquid or solid pharmaceutical preparation forms are, for example, aqueous or saline solutions for inhalation, microencapsulated, encochleated, coated onto microscopic gold particles, contained in liposomes, nebulized, aerosols, pellets for implantation into the skin, or dried onto a sharp object to be scratched into the skin. The pharmaceutical compositions also include granules, powders, tablets, coated tablets, (micro)capsules, suppositories, syrups, emulsions, suspensions, creams, drops or preparations with protracted release of active compounds, in whose preparation excipients and additives and/or auxiliaries such as disintegrants, binders, coating agents, swelling agents, lubricants, flavorings, sweeteners or solubilizers are customarily used as described above. The pharmaceutical compositions are suitable for use in a variety of drug delivery systems. For a brief review of methods for drug delivery, see Langer, Science 249:1527-1533, 1990, which is incorporated herein by reference.
[0303]The immunostimulatory nucleic acids and optionally other therapeutics and/or antigens may be administered per se (neat) or in the form of a pharmaceutically acceptable salt. When used in medicine the salts should be pharmaceutically acceptable, but non-pharmaceutically acceptable salts may conveniently be used to prepare pharmaceutically acceptable salts thereof. Such salts include, but are not limited to, those prepared from the following acids: hydrochloric, hydrobromic, sulphuric, nitric, phosphoric, maleic, acetic, salicylic, p-toluene sulphonic, tartaric, citric, methane sulphonic, formic, malonic, succinic, naphthalene-2-sulphonic, and benzene sulphonic. Also, such salts can be prepared as alkaline metal or alkaline earth salts, such as sodium, potassium or calcium salts of the carboxylic acid group.
[0304]Suitable buffering agents include: acetic acid and a salt (1-2% w/v); citric acid and a salt (1-3% w/v); boric acid and a salt (0.5-2.5% w/v); and phosphoric acid and a salt (0.8-2% w/v). Suitable preservatives include benzalkonium chloride (0.003-0.03% w/v); chlorobutanol (0.3-0.9% w/v); parabens (0.01-0.25% w/v) and thimerosal (0.004-0.02% w/v).
[0305]The pharmaceutical compositions of the invention contain an effective amount of a Immunostimulatory nucleic acid and optionally antigens and/or other therapeutic agents optionally included in a pharmaceutically-acceptable carrier. The term pharmaceutically-acceptable carrier means one or more compatible solid or liquid filler, diluents or encapsulating substances which are suitable for administration to a human or other vertebrate animal. The term carrier denotes an organic or inorganic ingredient, natural or synthetic, with which the active ingredient is combined to facilitate the application. The components of the pharmaceutical compositions also are capable of being commingled with the compounds of the present invention, and with each other, in a manner such that there is no interaction which would substantially impair the desired pharmaceutical efficiency.
[0306]The immunostimulatory nucleic acids useful in the invention may be delivered in mixtures with additional adjuvant(s), other therapeutics, or antigen(s). A mixture may consist of several adjuvants in addition to the Immunostimulatory nucleic acid or several antigens or other therapeutics.
[0307]A variety of administration routes are available. The particular mode selected will depend, of course, upon the particular adjuvants or antigen selected, the particular condition being treated and the dosage required for therapeutic efficacy. The methods of this invention, generally speaking, may be practiced using any mode of administration that is medically acceptable, meaning any mode that produces effective levels of an immune response without causing clinically unacceptable adverse effects. Preferred modes of administration are discussed above.
[0308]The compositions may conveniently be presented in unit dosage form and may be prepared by any of the methods well known in the art of pharmacy. All methods include the step of bringing the compounds into association with a carrier which constitutes one or more accessory ingredients. In general, the compositions are prepared by uniformly and intimately bringing the compounds into association with a liquid carrier, a finely divided solid carrier, or both, and then, if necessary, shaping the product. Liquid dose units are vials or ampoules. Solid dose units are tablets, capsules and suppositories. For treatment of a patient, depending on activity of the compound, manner of administration, purpose of the immunization (i.e., prophylactic or therapeutic), nature and severity of the disorder, age and body weight of the patient, different doses may be necessary. The administration of a given dose can be carried out both by single administration in the form of an individual dose unit or else several smaller dose units. Multiple administration of doses at specific intervals of weeks or months apart is usual for boosting the antigen-specific responses.
[0309]Other delivery systems can include time-release, delayed release or sustained release delivery systems. Such systems can avoid repeated administrations of the compounds, increasing convenience to the subject and the physician. Many types of release delivery systems are available and known to those of ordinary skill in the art. They include polymer base systems such as poly(lactide-glycolide), copolyoxalates, polycaprolactones, polyesteramides, polyorthoesters, polyhydroxybutyric acid, and polyanhydrides. Microcapsules of the foregoing polymers containing drugs are described in, for example, U.S. Pat. No. 5,075,109. Delivery systems also include non-polymer systems that are: lipids including sterols such as cholesterol, cholesterol esters and fatty acids or neutral fats such as mono-di- and tri-glycerides; hydrogel release systems; sylastic systems; peptide based systems; wax coatings; compressed tablets using conventional binders and excipients; partially fused implants; and the like. Specific examples include, but are not limited to: (a) erosional systems in which an agent of the invention is contained in a form within a matrix such as those described in U.S. Pat. Nos. 4,452,775, 4,675,189, and 5,736,152, and (b) diffusional systems in which an active component permeates at a controlled rate from a polymer such as described in U.S. Pat. Nos. 3,854,480, 5,133,974 and 5,407,686. In addition, pump-based hardware delivery systems can be used, some of which are adapted for implantation.
[0310]The present invention is further illustrated by the following Examples, which in no way should be construed as further limiting. The entire contents of all of the references (including literature references, issued patents, published patent applications, and co-pending patent applications) cited throughout this application are hereby expressly incorporated by reference.
EXAMPLES
Materials and Methods
[0311]Oligodeoxynucleotides: Native phosphodiester and phosphorothioate-modified ODN were purchased from Operon Technologies (Alameda, Calif.) and Hybridon Specialty Products (Milford, Mass.). ODN were tested for endotoxin using the LAL-assay (LAL-as say BioWhittaker, Walkersville, Md.; lower detection limit 0.1 EU/ml). For in vitro assays, ODN were diluted in TE-buffer (10 mM Tris, pH 7.0, 1 mM EDTA), and stored at -20° C. For in vivo use, ODN were diluted in phosphate buffered saline (0.1 M PBS, pH 7.3) and stored at 4° C. All dilutions were carried out using pyrogen-free reagents.
[0312]Isolation of human PBMC and cell culture: Peripheral blood mononuclear cells (PBMC) were isolated from peripheral blood of healthy volunteers by Ficoll-Paque density gradient centrifugation (Histopaque-1077, Sigma Chemical Co., St. Louis, Mo.) as described (Hartmann et al., 1999 Proc. Natl. Acad. Sci. USA 96:9305-10). Cells were suspended in RPMI 1640 culture medium supplemented with 10% (v/v) heat-inactivated (56° C., 1 h) FCS (HyClone, Logan, Utah), 1.5 mM L-glutamine, 100 U/ml penicillin and 100 μg/ml streptomycin (all from Gibco BRL, Grand Island, N.Y.) (complete medium). Cells (final concentration 1×106 cells/ml) were cultured in complete medium in a 5% CO2 humidified incubator at 37° C. ODN and LPS (from Salmonella typhimurium, Sigma Chemical Co., St. Louis, Mo.) or anti-IgM were used as stimuli. For measurement of human NK lytic activity, PBMC were incubated at 5×106/well in 24-well plates. Cultures were harvested after 24 hours, and cells were used as effectors in a standard 4 hours 51Cr-release assay against K562 target cells as previously described (Ballas et al., 1996J. Immunol. 157:1840-1845). For B cell proliferation, 1 μCi of 3H thymidine was added 18 hours before harvest, and the amount of 3H thymidine incorporation was determined by scintillation counting at day 5. Standard deviations of the triplicate wells were <5%.
[0313]Flow cytometry on human PBMC: Surface antigens on primate PBMC were stained as previously described (Hartmann et al., 1998 J. Pharmacol. Exp. Ther. 285:920-928). Monoclonal antibodies to CD3 (UCHT1), CD14 (M5E2), CD19 (B43), CD56 (B159), CD69 (FN50) and CD86 (2331 [FUN-1]) were purchased from Pharmingen, San Diego, Calif. IgG1, κ (MOPC-21) and IgG2b, κ (Hartmann et al., 1999 Proc. Natl. Acad. Sci. USA 96:9305-10) were used to control for non-specific staining. NK cells were identified by CD56 expression on CD3, CD14 and CD19 negative cells, whereas B cells were identified by expression of CD19. Flow cytometric data of 10000 cells per sample were acquired on a FACScan (Beckton Dickinson Immunocytometry Systems, San Jose, Calif.). The viability of cells within the FSC/SSC gate used for analysis was examined by propidium iodide staining (2 μg/ml) and found to be higher than 98%. Data were analyzed using the computer program FlowJo (version 2.5.1, Tree Star, Inc., Stanford, Calif.).
[0314]Results:
Example 1
CpG-Dependent Stimulation of Human B Cells Depends on Methylation and ODN Length
[0315]Human PBMC were obtained from normal donors and cultured for five days at 2×105 cells/well with the indicated concentrations of the indicated ODN sequences. As shown in Table F, human PBMCs proliferate above the background when cultured with a variety of different CpG ODN, but also show some proliferation even with ODN that do not contain any CpG motifs. The importance of unmethylated CpG motifs in providing optimal immune stimulation with these ODN is demonstrated by the fact that ODN 1840 (SEQ ID NO. 83) induces 56,603 counts of 3H-thymidine incorporation whereas the same T-rich ODN with the CpG motifs methylated (non-CpG), 1979 (SEQ ID NO. 222), induces lower, but still increased over background, activity (only 18,618 counts) at the same concentration of 0.6 μg/ml. The reduced proliferation at higher ODN concentrations may be an artifact of the cells becoming exhausted under these experimental conditions or could reflect some toxicity of the higher ODN concentrations. Interestingly, shorter ODN containing CpG motifs, such as the 13-14 mers 2015 and 2016, are less stimulatory despite the fact that their molar concentration would actually be higher since the ODNs were added on the basis of mass rather than molarity. This demonstrates that ODN length may also be an important determinant in the immune effects of the ODN. A non-CpG ODN but slight T-rich ODN (about 30% T), 1982 (SEQ ID NO. 225), caused only a small amount of background cell proliferation.
TABLE-US-00007 TABLE F Oligo Concentration ODN# 0.15 μg/ml 0.6 μg/ml 2 μg/ml Cues only 648 837 799 1840 5744 56,603 31,787 (SEQ ID NO. 83) 2016 768 4607 20,497 (SEQ ID NO. 256) 1979 971 18,618 29,246 (SEQ ID NO. 222) 1892 787 10,078 22,850 (SEQ ID NO. 135) 2010 849 20,741 8,054 (SEQ ID NO. 250) 2012 2586 62,955 52,462 (SEQ ID NO. 252) 2013 1043 47,960 47,231 (SEQ ID NO. 253) 2014 2700 50,708 46,625 (SEQ ID NO. 254) 2015 1059 23,239 36,119 (SEQ ID NO. 255)
[0316]Numbers represent cpm of 3H-thymidine incorporation for cultures of human PBMCs set up as described above.
Example 2
Concentration-Dependent Activation of Human NK Cell Activity with Thymidine-Rich ODN
[0317]Human PBMCs were cultured for 24 hours with a panel of different CpG or non-CpG ODN at two different concentrations, and then tested for their ability to kill NK target cells as described previously (Ballas et al., 1996 J. Immunol. 157:1840-1845). Killing is measured as lytic units, or L.U. The human donor used in this experiment had a background level of 3.69 L.U. which increased to 180.36 L.U. using the positive control, IL-2. A CpG oligo, 2006 (SEQ ID NO. 246), induced high levels of NK lytic function at a low concentration of 0.6, and a lower level at a concentration of 6.0. Surprisingly, a T-rich ODN in which the CpG motifs of 2006 were methylated (ODN at 2117 (SEQ ID NO. 358)) or inverted to GpCs (ODN 2137 (SEQ ID NO. 886)) retained strong immune stimulatory function at the higher ODN concentrations, as shown in Table G. These concentration-dependent immune stimulatory effects are not a general property of the phosphorothioate backbone since the experiments described below demonstrate that a poly-A ODN, is nonstimulatory above background levels. Some stimulation is seen with a 24-base long ODN in which all of the base positions are randomized so that A, C, G, and T will occur at a frequency of 25% in each of the base positions (ODN 2182 (SEQ ID NO. 432)). However, the stimulatory effect of such a 24-base ODN is greatly enhanced if it is pure poly-T, in which case stimulation is also seen at the lowest concentration of 0.6 μg/ml (ODN 2183 (SEQ ID NO. 433)). In fact, the stimulatory activity of ODN SEQ ID NO. 433 at this low concentration is higher than that of any other ODN tested at this low concentration, aside from the optimal human immune stimulatory ODN of SEQ ID NO. 246. In fact, the higher concentration of ODN SEQ ID NO. 433 stimulated more NK activity than any other phosphorothioate ODN except for the strong CpG ODN 2142 (SEQ ID NO. 890), which was marginally higher. If the G content of ODN SEQ ID NO. 246 is increased relative to the T content by addition of more Gs, thus resulting in a decrease in the proportion of T nucleotides the immune stimulatory effect of the ODN is reduced (see ODN 2132 (SEQ ID NO. 373)). Thus, the T content of an ODN is an important determinant of its immune stimulatory effect. Although a poly-T ODN is the most stimulatory of the non-CpG ODN, other bases are also important in determining the immune stimulatory effect of a non-CpG ODN. ODN 2131 (SEQ ID NO. 372), in which slightly more than half of the bases are T and in which there are no Gs, is immune stimulatory at a concentration of 6 μg/ml but has less activity than other T-rich ODN. If the 6 A's in ODN 2131 (SEQ ID NO. 372) are replaced by 6 Gs, the immune stimulatory effect of the ODN can be increased (see ODN 2130 (SEQ ID NO. 371)).
TABLE-US-00008 TABLE G HUMAN PBL CULTURED OVERNIGHT WITH OLIGOS MR 3605 SR 256 % SR 7.11 EFFECTOR 0.63 1.25 2.50 5.00 10.00 20.00 CONTROL [RM] L.U. ALONE 2.65 5.45 10.15 17.65 29.92 39.98 3.69 +IL2 (100 U/ml) 35.95 57.66 86.26 100.39 99.71 93.64 180.36 +1585 (0.6 ug/ml) 3.75 6.10 12.14 23.70 36.06 43.98 5.48 +1585 (6.0 ug/ml) 15.42 31.09 47.07 73.34 94.29 97.73 35.85 +2006 (0.6 ug/ml) 6.71 15.99 26.92 44.75 64.12 68.83 16.96 +2006 (6.0 ug/ml) 6.19 8.18 16.13 24.35 39.35 56.07 8.04 +2117 (0.6 ug/ml) 4.54 4.73 9.56 18.04 28.57 39.85 3.49 +2117 (6.0 ug/ml) 7.03 10.76 16.90 30.59 52.14 59.46 10.96 +2137 (0.6 ug/ml) 4.61 5.35 10.04 15.16 23.79 37.86 2.57 +2137 (6.0 ug/ml) 7.99 10.37 16.55 32.32 49.78 60.30 11.01 +2178 (0.6 ug/ml) 2.88 4.52 11.47 16.05 24.85 34.27 2.37 +2178 (6.0 ug/ml) 4.21 5.03 11.16 16.39 28.22 36.45 2.94 +2182 (0.6 ug/ml) 2.42 6.57 10.49 19.73 26.55 35.30 2.89 +2182 (6.0 ug/ml) 4.11 7.98 14.60 26.56 40.40 51.98 7.59 +2183 (0.6 ug/ml) 3.73 8.46 15.52 24.48 37.78 56.77 7.80 +2183 (0.6 ug/ml) 8.86 12.89 23.08 41.49 66.26 75.85 16.57 +2140 (0.6 ug/ml) 3.78 5.27 12.30 20.79 35.75 45.62 5.40 +2140 (6.0 ug/ml) 6.56 13.24 21.26 37.96 60.80 73.05 14.82 +2141 (0.6 ug/ml) 2.63 6.34 10.21 17.73 30.93 43.57 4.29 +2141 (6.0 ug/ml) 4.98 15.30 25.22 37.88 58.47 69.12 14.83 +2142 (0.6 ug/ml) 3.18 3.66 6.99 14.62 19.68 32.52 1.56 +2142 (6.0 ug/ml) 7.08 15.80 25.65 41.72 68.09 73.14 17.11 +2143 (0.6 ug/ml) 4.12 6.90 10.77 22.96 35.78 42.94 5.19 +2143 (6.0 ug/ml) 3.16 8.40 12.38 21.69 34.80 54.21 6.64 +2159 (6.0 ug/ml) 5.05 11.76 21.67 41.12 51.68 65.47 13.19 +2132 (6.0 ug/ml) 4.23 6.06 10.50 18.74 32.68 44.06 4.61 +2179 (6.0 ug/ml) 6.14 9.49 21.06 42.48 60.12 71.87 14.54 +2180 (6.0 ug/ml) 2.37 8.57 15.44 29.66 44.35 61.31 9.47 +2133 (6.0 ug/ml) 6.53 12.58 23.10 38.03 61.16 68.36 14.62 +2134 (6.0 ug/ml) 7.51 12.14 21.14 32.46 54.47 67.12 12.98 +2184 (6.0 ug/ml) 5.22 9.19 17.54 30.76 45.35 63.55 10.42 +2185 (6.0 ug/ml) 8.11 14.77 26.27 40.31 55.61 70.65 15.60 +2116 (6.0 ug/ml) 5.58 10.54 16.77 37.82 59.80 66.33 13.07 +2181 (6.0 ug/ml) 4.43 9.85 17.55 27.05 53.16 69.16 11.43 +2130 (6.0 ug/ml) 3.81 8.07 17.11 27.17 42.04 53.73 8.27 +2131 (6.0 ug/ml) 2.29 6.73 7.30 18.02 32.73 49.06 5.08 +2156 (0.3 ug/ml) 2.50 5.26 8.20 15.95 26.64 33.07 2.31 +2156 (1.0 ug/ml) 5.91 10.99 17.31 26.97 50.64 63.78 10.84 +2157 (0.3 ug/ml) 2.36 4.00 6.65 12.94 24.13 38.86 2.58 +2157 (1.0 ug/ml) 3.72 9.55 17.15 34.55 52.27 65.33 11.58 +2158 (0.3 ug/ml) 1.25 2.36 6.90 16.39 15.63 29.82 1.17 +2158 (1.0 ug/ml) 4.73 7.26 11.07 15.55 30.80 43.71 4.16 +2118 (0.6 ug/ml) 1.55 3.38 6.85 13.36 20.15 27.71 1.13 +2118 (6.0 ug/ml) 2.65 3.88 9.29 12.19 22.47 28.99 1.34
Example 3
Induction of B Cell Proliferation by T-Rich Non-CpG ODN
[0318]To assess the ability of T-rich ODN to activate B cell proliferation, human PBMCs were stained with the cytoplasmic dye CSFE, incubated with five days with the indicated ODN at either 0.15 or 0.3 ug/ml, and then analyzed by flow cytometry. B cells were identified by gating on cells positive for the lineage marker CD19). CpG ODN 2006 was a strong inducer of B cell proliferation, and this effect was reduced if the CpG motifs were methylated or inverted to GpC as shown in FIGS. 1A, B, C and D at an ODN concentration of 0.3 ug/ml. The base composition of the ODN appears to be important in determining the immune stimulatory effect. Reducing the T content of an ODN substantially reduces immune stimulatory effect, as exemplified by ODN 2177 (SEQ ID NO. 427) in which 6 of the Ts present in ODN 2137 (SEQ ID NO. 886) have been switched to A's, resulting in a greatly reduced immune stimulatory effect. The importance of T's in the immune stimulatory effect of an ODN is also shown by comparison of ODN 2116 (SEQ ID NO. 357) and 2181 (SEQ ID NO. 431), which differ in the 3' end of the ODN. ODN 2181, in which the 3' end is poly-T is more stimulatory than ODN 2116, in which the 3' end is poly-C, despite the fact that both ODN have a TCGTCG at the 5' end.
Example 4
B Cell Proliferation Induced by TG Oligonucleotides
[0319]The stimulatory effects of TG motifs are shown in FIG. 2. ODN 2137 has the identical base composition as ODN 2006, but the CG motifs have all been inverted to GC's resulting in a CG-free nucleic acid. ODN does however contain 6 TG dinucleotides. In ODN 2177, all the TG dinucleotides of ODN 2137 have been changed to AG. Although ODN 2177 contains only 6 adenines, it is virtually nonstimulatory at a concentration of 0.2 μg/ml. For comparison, an ODN 24 bases in length in which each position is randomized to be any of the four bases (ODN 2182) induces>12% of B cells to proliferate at a concentration of 0.2 μg/ml. These results indicate that the stimulatory effects of ODN 2137 are not simply those of a phosphorothioate backbone, but relate to the presence of TG dinucleotides.
[0320]In order to determine the effect of varying the number of TG dinucleotide motifs, ODN 2200 and ODN 2202 were compared, as shown in FIG. 2. Both ODN contain 18 Ts and 6 Gs, but in ODN 2200 all of the Gs are consecutive, so that there is only one TG dinucleotide, whereas in ODN 2202, the Gs are split up as GG dinucleotides throughout the ODN so that there are three TGs. ODN 2202 is significantly more stimulatory than ODN 2200, consistent with the model that at least three TG motifs in an ODN are required for optimal stimulatory activity. It is likely that even higher levels of stimulation could be achieved if the TG motifs had been optimized as taught herein.
Example 5
Effects of TTG Versus TTG Motifs
[0321]FIG. 3 shows the results of experiments conducted to study TG content in terms of the relative levels of Ts versus Gs as it relates to the stimulatory effect of an ODN. The Figure shows that an ODN in which all of the bases are randomized to be either T or G (ODN 2188 (SEQ ID NO. 905)) is nonstimulatory at a concentration of 0.2 μg/ml, similar to an ODN in which all of the bases are randomized to be either A or G (ODN 2189 (SEQ ID NO. 906)). However, at the higher concentration of 2 μg/ml, the randomized T/G ODN 2188 is significantly more stimulatory. This latter level of stimulation is still lower than that which occurs with a totally randomized ODN (ODN 2182 (SEQ ID NO. 432)). The highest stimulation at low concentrations is seen with an ODN in which half of the bases are fixed at T and the other half of the bases are randomized to be either T or G (ODN 2190 (SEQ ID NO. 907)). Since every other base is fixed to be a T, there cannot be any TG motifs. The data in FIG. 3 show that increasing the TG content of an ODN improves its stimulatory activity.
[0322]In yet other experiments, the results of which are not diagrammed herein, ODN 2190 (SEQ ID NO. 907) exhibited a stimulation of NK activity compared to ODN 2188 (SEQ ID NO. 905) or ODN 2189 (SEQ ID NO. 906).
Examples 6-8
Introduction
[0323]Above, we demonstrated that Poly T sequences are able to enhance stimulation of B and NK cells. Here and below we investigate the effect of a variety of non-CpG T-rich ODN as well as Poly C ODN for their ability to stimulate human B cells, NK cells and monocytes.
[0324]Materials and Methods:
[0325]Oligonucleotides: Phosphorothioate-modified ODN were purchased from ARK Scientific GmbH (Darmstadt, Germany). The sequences used were:
TABLE-US-00009 (SEQ ID NO.: 225) 1982: 5'-tccaggacttctctcaggtt-3', (SEQ ID NO.: 246) 2006: 5'-tcgtcgttttgtcgttttgtcgtt-3', (SEQ ID NO.: 282) 2041: 5'-ctggtctttctggtttttttctgg-3', (SEQ ID NO.: 358) 2117: 5'-tzgtzgttttgtgtzgttttgtzgtt-3', (SEQ ID NO.: 886) 2137: 5'-tgctgcttttgtgcttttgtgctt-3', (SEQ ID NO.: 443) 2183: 5'-ttttttttttttttttttttt-3', (SEQ ID NO.: 911) 2194: 5'-ttttttttttttttttttttttttttt-3', (SEQ ID NO.: 913) 2196: 5'-tttttttttttttttttt-3', (SEQ ID NO.: 1058) 5126: 5'-ggttcttttggtccttgtct-3', (SEQ ID NO.: 1095) 5162: 5'-aaaaaaaaaaaaaaaaaaaaaaaaaaaaaa-3', (SEQ ID NO.: 1096) 5168: 5'-cccccccccccccccccccccccccccccc-3' and (SEQ ID NO.: 1097) 5169: 5'-cgcgcgcgcgcgcgcgcgcgcgcgcgcgcg-3'.
Most ODN were tested for LPS content using the LAL assay (BioWhittaker, Belgium) (lower detection limit 0.1EU/ml) also described herein. For all assays ODN were diluted in TE buffer and stored at -20° C. All dilutions were conducted using pyrogen-free reagents.
[0326]Cell preparation and cell culture: Human PBMC were isolated from peripheral blood of healthy volunteers, obtained by the German Red Cross (Ratingen, Germany), as described above in Example 1, but all material were purchased from Life Technologies, Germany and were endotoxin-tested. For the B cell, NK cell and monocyte activation assays PBMC were cultured in complete medium at a concentration of 2×106 cells/ml in 200 μl in 96 round bottom plates in a humidified incubator at 37° C. Different ODNs, LPS (Sigma) or IL-2 (R&D Systems, USA) were used as stimuli. At the indicated time points, cells were harvested for flow cytometry.
[0327]Flow cytometry: MAbs used for staining of surface antigens were: CD3, CD14, CD19, CD56, CD69, CD80 and CD86 (all obtained from Pharmingen/Becton Dickinson, Germany). For monocytes Fc receptors were blocked using human IgG (Myltenyi, Germany) as previously described (Bauer, M., K. Heeg, H. Wagner, and G. B. Lipford. 1999. DNA activates human immune cells through a CpG sequence dependent manner. Immunology 97:699). Flow cytometric data of at least 1000 cells of a specified subpopulation (B cells, monocytes, NK cells, NKT cells or T cells) were acquired on a FACSCalibur (Becton Dickinson). Data were analyzed using the program CellQuest (Becton Dickinson).
[0328]NK-mediated cytotoxicity: PBMC were cultured overnight with or without 6 μg/ml ODN or 100 U/ml IL-2 at 37° C., 5% CO2. The next morning, K-562 target cells were labeled with a fluorescent dye, CFSE, as described previously for human B cells (Hartmann, G., and A. M. Krieg. 2000. Mechanism and function of a newly identified CpG DNA motif in human primary B cells. J. Immunol. 164:944). PBMC were added in different ratios (50:1, 25:1 and 12.5:1) to 2×105 target cells and incubated for 4 h at 37° C. Cells were harvested and incubated with the DNA-specific dye 7-AAD (Pharmingen) for detection of apoptotic cells. Results were measured by flow cytometry.
[0329]ELISA: PBMC (3×106 cells/ml) were cultured with the specified concentrations of ODN or LPS for 24 h (IL-6, IFNγ and TNFα) or 8 h (IL-11) in 48 well plates in a humidified atmosphere at 37° C. Supernatants were collected and cytokines were measured using OPTeia ELISA Kits (Pharmingen) for IL-6, IFNγ and TNFα or an Eli-pair ELISA assay (Hoelzel, Germany) for IL-11 according to the manufacturer protocols.
Example 6
B Cell Activation Induced by ODNs Lacking CpG Motifs
[0330]In the Experiments described above in Example 3, we demonstrate that T-rich ODN were capable of activating B cells. We expand those studies here using additional ODN and different cell and reagent sources. In a first set of experiments, we compared the activation potential of different non-CpG T-rich ODNs with the very potent known CpG ODN 2006 (SEQ ID NO.: 246). PBMC (2×06 cells/ml) of a blood donor (n=2) were incubated with the indicated concentrations of ODNs 2006 (SEQ ID NO.: 246), 2117 (SEQ ID NO.: 358), 2137 (SEQ ID NO.: 886), 5126 (SEQ ID NO.: 1058), and 5162 (SEQ ID NO.: 1094). Cells were incubated for 48 h at 37° C. as described above and stained with mAb for CD19 (B cell marker) and CD86 (B cell activation marker, B7-2). Expression was measured by flow cytometry.
[0331]Using different concentrations of ODNs, we showed (FIG. 4) that T-rich ODNs without a CpG motif, can induce stimulation of human B cells. ODN 5126 (SEQ ID NO.: 1058) which contains only a single poly-T sequence but is greater than 50% T, caused high levels of human B cell activation. Although there are some similarities to SEQ ID NO.: 246 (e.g. more than 80% T/G content), this ODN clearly lacks any known immunostimulatory CpG motif. Surprisingly, for all tested T-rich ODNs, the highest stimulatory index was obtained at concentrations between 3 and 10 μg/ml. The highest stimulatory index of the tested ODNs was achieved by CpG/T-rich ODN SEQ ID NO.: 246 at 0.4 μg/ml. Interestingly, the activity decreased at high concentrations.
[0332]Poly A, Poly C and Poly T sequences were synthesized and tested for biological activity. PBMC (2×106 cells/ml) of one representative donor (n=3) were stimulated as described above by 0.4 μg/ml, 1.0 μg/ml or 10.0 μg/ml of the following ODNs: 2006 (SEQ ID NO.: 246), 2196 (SEQ ID NO.: 913) (Poly T, 18 bases), 2194 (SEQ ID NO.: 911) (Poly T, 27 bases), 5162 (SEQ ID NO.: 1094) (Poly T, 30 bases), 5163 (SEQ ID NO.: 1095) (Poly A, 30 bases), 5168 (SEQ ID NO.: 1096) (Poly C, 30 bases) and 5169 (SEQ ID NO.: 1097) (Poly CG, 30 bases). Expression of the activation marker CD86 (B7-2) on CD19-positive B cells was measured by flow cytometry.
[0333]FIG. 5 demonstrates that the length of the sequence, at least for Poly T ODNs, has an important impact on its activity. A Poly T sequence containing only 18 bases (SEQ ID NO.: 913) was shown to be less stimulatory than one with 27 bases (SEQ ID NO.: 911) or one with 30 bases (SEQ ID NO.: 1094) with a clear rank of stimulation: SEQ ID NO.: 1094>SEQ ID NO.: 911>SEQ ID NO.: 913. Poly A (SEQ ID NO.: 1095) or Poly CG (SEQ ID NO.: 1097) sequences, in contrast, do not induce activation of human B cells. Surprisingly it was also discovered that Poly C sequences (SEQ ID NO.: 1096) can activate human B cells at least at high concentrations (10 μg/ml) (FIG. 5).
[0334]Two other T-rich ODNs, namely 1982 (SEQ ID NO.: 225) and 2041 (SEQ ID NO.: 282) lacking CpG motifs were tested for their effect on human B cells. PBMC (n=2) were incubated with the indicated concentrations of ODN 2006 (SEQ ID NO.: 246), 1982 (SEQ ID NO.: 225) and 2041 (SEQ ID NO.: 282) as described above. B cell activation (expression of the activation marker CD86) was measured by flow cytometry.
[0335]FIG. 6 demonstrates that T-rich non-CpG ODN are immunostimulatory at concentrations higher than 1 g/ml. Incorporation of a CpG motif into 1982 enhanced the immunostimulatory activity. Elongation with a Poly T sequence did not enhance the immunostimulatory activity of this already T-rich ODN but rather, decreased the activation potential slightly.
Example 7
Immunostimulation of Non-CpG ODNs is Reflected in the Enhancement of NK Activation, NK Cytotoxicity and Monocyte Activation
[0336]NK cells as well as monocytes were tested for their response to non-CpG ODNs. PBMC (2×106 cells/ml) were incubated with 6 μg/ml of the following ODNs (n=4): 2006 (SEQ ID NO.: 246), 2117 (SEQ ID NO.: 358), 2137 (SEQ ID NO.: 886), 2183 (SEQ ID NO.: 433), 2194 (SEQ ID NO.: 911) and 5126 (SEQ ID NO.: 1058). After 24 h of cultivation at 37° C. cells were harvested and stained with mAb for CD3 (T cell marker), CD56 (NK cell marker) and CD69 (early activation marker) as described above. Expression of CD69 on CD56-positive NK cells was measured by flow cytometry.
[0337]FIG. 7 shows that for Poly T ODNs similar effects can be observed as described in FIG. 5. The stimulation of NK cells, like B cells, may be influenced by the length of the ODN. ODN 2183 (SEQ ID NO.: 433) (21 bases) induced activation of NK cells but to a lesser extent than the longer ODN 2194 (SEQ ID NO.: 911) (27 bases), as measured by enhanced expression of the early activation marker CD69. ODN 5126 (SEQ ID NO.: 1058) was also demonstrated to activate human NK cells (FIG. 7).
[0338]It is believed that the anti-tumor activity of CpG ODNs can be assessed by the ability of the ODN to enhance NK-mediated cytotoxicity in vitro. ODNs containing at the 5' and 3' ends stretches of Poly G were shown to result in the highest induction of cytotoxicity (Ballas, Z. K., W. L. Rasmussen, and A. M. Krieg. 1996. Induction of natural killer cell activity in murine and human cells by CpG motifs in oligodeoxynucleotides and bacterial DNA. J. Immunol. 157:1840). To investigate the influence of non-CpG T-rich ODN on NK cytotoxicity, we analyzed the effect of the ODNs 2194 (SEQ ID NO.: 911) and 5126 (SEQ ID NO.: 1058) on NK-mediated lysis (FIG. 8). NK-mediated lysis of K-562 target cells was measured after over night incubation of PBMC with 6 μg/ml of the ODN 2006 (SEQ ID NO.: 246), SEQ ID NO.: 911 (SEQ ID NO.: 911) (Poly T, 27 bases) and 5126 (SEQ ID NO.: 1058) as described above. SEQ ID NO.: 1058 demonstrated small increases in lysis by human NK cells as compared to no ODN. SEQ ID NO.: 911 and SEQ ID NO.: 246 enhanced human NK cell cytotoxicity to an even higher extent.
[0339]Previous reports demonstrated that not only NK cells but also NKT cells are mediators of cytotoxic responses to tumor cells (14). We, therefore, looked at the potential activation of human NKT cells by T-rich non-CpG ODN. PBMC of one representative donor (n=2) were incubated with 6 μg/ml ODN 2006 (SEQ ID NO.: 246), 2117 (SEQ ID NO.: 358), 2137 (SEQ ID NO.: 886), 2183 (SEQ ID NO.: 433), 2194 (SEQ ID NO.: 913) and 5126 (SEQ ID NO.: 1058) for 24 h as described above. Activation of NKT cells was measured by flow cytometry after staining of cells with mAb for CD3 (T cell marker), CD56 (NK cell marker) and CD69 (early activation marker). Shown is the expression of CD69 on CD3 and CD56 double-positive cells (NKT cells).
[0340]In FIG. 9, SEQ ID NO.: 911 as well as SEQ ID NO.: 1058 were found to stimulate NKT cells. Similar to NK cells SEQ ID NO.: 911 (Poly T) was more active than SEQ ID NO. 1058. In addition, as described above for B cells and NK cells, the length of the ODN has some influence on the immunostimulatory potential, with the longer ODN having stronger effects on NKT cells. Similar results were observed for human T cells.
[0341]Another type of cell of the immune system involved in fighting infections is the monocytes. These cells release upon activation a variety of cytokines and can mature into dendritic cells (DC), professional antigen-presenting cells (Roitt, I., J. Brostoff, and D. Male. 1998. Immunology. Mosby, London). FIG. 10 shows activation of human monocytes after culturing of PBMC with different ODNs. PBMC (2×106 cells/ml) were incubated with 6 μg/ml 2006 (SEQ ID NO.: 246), 2117 (SEQ ID NO.: 358), 2137 (SEQ ID NO.: 886), 2178 (SEQ ID NO.:1096), 2183 (SEQ ID NO.: 433), 2194 (SEQ ID NO.: 911), 5126 (SEQ ID NO.: 1058) and 5163 (SEQ ID NO.: 1095) overnight at 37° C. as described above (n=3). Cells were harvested and stained for CD14 (monocyte marker) and CD80 (B7-1, activation marker). Expression was measured by flow cytometry.
[0342]As demonstrated above for NK and B cells, T-rich sequences (e.g., SEQ ID NO.: 433, SEQ ID NO.: 911) of different length induce monocyte stimulation but have different levels of activity e.g., SEQ ID NO.: 433>SEQ ID NO.: 911. Poly A (SEQ ID NO.: 1095) as well as Poly C (SEQ ID NO.: 1096 (2178) sequences, in contrast, did not lead to activation of monocytes (measured by the upregulation of CD80 at a concentration of 6 μg/ml ODN).
Example 8
Induction of Cytokine Release by Non-CpG ODNs
[0343]Next the ability of different T-rich ODNs to influence the cytokine milieu was examined. PBMC (3×106 cells/ml) were cultured for 24 h with or without 6 μg/ml of the indicated ODNs or 1 μg/ml LPS as positive control (n=2). After incubation supernatants were collected and TNFα measured by ELISA as described above and the results are shown in FIG. 11. PBMC were cultured with the indicated ODNs (1.0 μg/ml) as described in FIG. 11 and IL-6 was measured in the supernatants by ELISA and the results are shown in FIG. 12.
[0344]FIGS. 11 and 12 demonstrate that T-rich non-CpG and T-rich/CpG ODNs can induce the secretion of the pro-inflammatory cytokines TNFα and IL-6. For both cytokines, ODN 5126 (SEQ ID NO.: 1058) was found in most assays to be as potent as ODN 2194 (SEQ ID NO.: 911). It is known that CpG ODNs influence the Th1/Th2 balance by preferentially inducing Th1 cytokines (Krieg, A. M. 1999. Mechanism and applications of immune stimulatory CpG oligodeoxynucleotides. Biochemica et Biophysica Acta 93321:1). To test whether T-rich ODN caused a similar shift to Th1 cytokines, IFNγ production in PBMC was measured. In a first set of experiments, it was demonstrated that, as described for IL-6 and TNFα, ODNs SEQ ID NO.: 1058 and SEQ ID NO.: 911 induced the release of comparable amounts of this Th1 cytokine IFNγ. In addition, it was demonstrated that another pro-inflammatory cytokine, IL-1β, was released upon culture of PBMC with these two ODNs. Although the amount of these cytokines induced by the T-rich ODN lacking CpG motifs was less than when CpG ODN SEQ ID NO.: 246 was used the amounts induced by T-rich ODN were significantly higher than the control.
Examples 9-11
Introduction
[0345]An optimal CpG motif for immune system activation in non-rodent vertebrates is described herein. A phosphodiester oligonucleotide containing this motif was found to strongly stimulate CD86, CD40, CD54 and MHC II expression, IL-6 synthesis and proliferation of primary human B-cells. These effects required internalisation of the oligonucleotide and endosomal maturation. This CpG motif was associated with the sustained induction of the NFκB p50/p65 heterodimer and of the transcription factor complex activating protein-1 (AP-1). Transcription factor activation by CpG DNA was preceded by increased phosphorylation of the stress kinases c-jun NH2 terminal kinase (JNK) and p38, and of activating transcription factor-2 (ATF-2). In contrast to CpG, signaling through the B-cell receptor led to activation of extracellular receptor kinase (ERK) and to phosphorylation of a different isoform of JNK.
[0346]Materials and Methods:
[0347]Oligodeoxynucleotides: Unmodified (phosphodiester, PE) and modified nuclease-resistant (phosphorothioate, PS) ODN were purchased from Operon Technologies (Alameda, Calif.) and Hybridon Specialty Products (Milford, Mass.). The sequences used are provided in Table H. E. coli DNA and calf thymus DNA were purchased from Sigma Chemical Co., St. Louis, Mo. Genomic DNA samples were purified by extraction with phenol-chloroform-isoamyl alcohol (25/24/1) and ethanol precipitation. DNA was purified from endotoxin by repeated extraction with triton x-114 (Sigma Chemical Co., St. Louis, Mo.) and tested for endotoxin using the LAL-assay (LAL-assay BioWhittaker, Walkersville, Md.; lower detection limit 0.1 EU/ml) and the high sensitivity assay for endotoxin described earlier (lower detection limit 0.0014 EU/ml) (Hartmann G., and Krieg A. M. 1999. CpG DNA and LPS induce distinct patterns of activation in human monocytes. Gene Therapy 6:893). Endotoxin content of DNA samples was below 0.0014 U/ml. E. coli and calf thymus DNA were made single stranded before use by boiling for 10 minutes, followed by cooling on ice for 5 minutes. DNA samples were diluted in TE-buffer using pyrogen-free reagents.
TABLE-US-00010 TABLE H Oligonucleotide panel used1 Name (SEQ ID NO) Sequence 5' to 3' Starting sequence PE 2079 (320) TCG ACG TTC CCC CCC CCC CC Middle base PE 2100 (341) TCG GCG TTC CCC CCC CCC CC PE 2082 (323) TCG CCG TTC CCC CCC CCC CC Human CpG motif PE 2080 (321) TCG TCG TTC CCC CCC CCC CC 5'flanking base PE 2105 (346) GCG TCG TTC CCC CCC CCC CC PE 2107 (348) ACG TCG TTC CCC CCC CCC CC PE 2104 (345) CCG TCG TTC CCC CCC CCC CC 3'flanking base PE 2098 (339) TCG TCG CTC CCC CCC CCC CC PE 2099 (340) TCG TCG GTC CCC CCC CCC CC PE 2083 (324) TCG TCG ATC CCC CCC CCC CC First CpG deleted PE 2108 (349) CTG TCG TTC CCC CCC CCC CC Second CpG deleted PE 2106 (347) TCG TCA TTC CCC CCC CCC CC Methylation PE 2095 (336) TZG TZG TTC CCC CCC CCC CC PE 2094 (335) TCG TCG TTC CCC CCC ZCC CC Non-CpG control of PE 2078 (319) TGC TGC TTC CCC CCC CCC CC 2080 PE 2101 (342) GGC CTT TTC CCC CCC CCC CC Ps form of 2080 PS 2116 (357) TCG TCG TTC CCC CCC CCC CC Additional CpG motifs PE 2059 (300) TCG TCG TTT TGT CGT TTT GTC GTT Best PS PS 2006 (246) TCG TCG TTT TGT CGT TTT GTC GTT Methylated 2006 PS 2117 (358) TZG TZG TTT TGT ZGT TTT GTZGTT 1PE, phosphodiester; Ps, phosphorothioate; bold, base exchange; bold Z, methylated cytidine; underlined, CpG dinucleotides.
[0348]Cell preparation and cell culture: Human peripheral blood mononuclear cells (PBMC) were isolated from peripheral blood of healthy volunteers by Ficoll-Paque density gradient centrifugation (Histopaque-1077, Sigma Chemical Co., St. Louis, Mo.) as described (Hartmann G., Krug A., Eigler A., Moeller J., Murphy J., Albrecht R., and Endres S. 1996. Specific suppression of human tumor necrosis factor-alpha synthesis by antisense oligodeoxynucleotides. Antisense Nucleic Acid Drug Dev 6:291)). Cells were suspended in RPMI 1640 culture medium supplemented with 10% (v/v) heat-inactivated (56° C., 1 h) FCS (HyClone, Logan, Utah), 1.5 mM L-glutamine, 100 U/ml penicillin and 100 μg/ml streptomycin (all from Gibco BRL, Grand Island, N.Y.) (complete medium). All compounds were purchased endotoxin-tested. Viability was determined before and after incubation with ODN by trypan blue exclusion (conventional microscopy) or by propidium iodide exclusion (flow cytometric analysis). In all experiments, 96% to 99% of PBMC were viable. Cells (final concentration 1×106 cells/ml) were cultured in complete medium in a 5% CO2 humidified incubator at 37° C. Different oligonucleotides (see table I, concentration as indicated in the figure legends), LPS (from salmonella typhimurium, Sigma Chemical Co., St. Louis, Mo.) or anti-IgM were used as stimuli. Chloroquine (5 μg/ml; Sigma Chemical Co., St. Louis, Mo.) was used to block endosomal maturation/acidification. At the indicated time points, cells were harvested for flow cytometry as described below.
[0349]For signal transduction studies, human primary B-cells were isolated by immunomagnetic cell sorting using the VARIOMACS technique (Miltenyi Biotec Inc., Auburn, Calif.) as described by the manufacturer. In brief, PBMC obtained from buffy coats of healthy blood donors (Elmer L. DeGowin Blood Center, University of Iowa) were incubated with a microbeads-conjugated antibody to CD19 and passed over a positive selection column. Purity of B-cells was higher than 95%. After stimulation, whole cellular extracts (Western blot) and nuclear extracts (EMSA) for signal transduction studies were prepared.
[0350]For CpG binding protein studies, Ramos cells (human Burkitt lymphoma B cell line, ATCC CRL-1923 or CRL-1596; Intervirology 5: 319-334, 1975) were grown in complete medium. Untreated cells were harvested and cytosolic protein extracts were prepared and analyzed for the presence of CpG oligonucleotide binding proteins by EMSA and UV-crosslink as described below.
[0351]Flow cytometry: Staining of surface antigens was performed as previously described (Hartmann G., Krug A., Bidlingmaier M., Hacker U., Eigler A., Albrecht R., Strasburger C. J., and Endres S. 1998. Spontaneous and cationic lipid-mediated uptake of antisense oligonucleotides in human monocytes and lymphocytes. J Pharmacol Exp Ther 285:920). Monoclonal antibodies to HLA-DR were purchased from Immunotech, Marseille, France. All other antibodies were purchased from Pharmingen, San Diego, Calif.: mABs to CD19 (B43), CD40 (5C3), CD54 (HA58), CD86 (2331 (FUN-1)). IgG1, κ (MOPC-21) and IgG2b, κ were used to control for specific staining. Intracellular cytokine staining for IL-6 was performed as described (Hartmann G., and Krieg A. M. 1999. CpG DNA and LPS induce distinct patterns of activation in human monocytes. Gene Therapy 6:893). In brief, PBMC (final concentration 1×106 cells/ml) were incubated in the presence of brefeldin A (final concentration 1 μg/ml, Sigma Chemical Co., St. Louis, Mo.). After incubation, cells were harvested and stained using a FITC-labeled mAB to CD19 (B43), a PE-labeled rat anti-human IL-6 mAb (MQ2-6A3, Pharmingen) and the Fix and Perm Kit (Caltag Laboratories, Burlingame, Calif.). Flow cytometric data of 5000 cells per sample were acquired on a FACScan (Beckton Dickinson Immunocytometry Systems, San Jose, Calif.). Non-viable cells were excluded from analysis by propidium iodide staining (2 μg/ml). Data were analyzed using the computer program FlowJo (version 2.5.1, Tree Star, Inc., Stanford, Calif.).
[0352]Proliferation assay: CFSE (5-(and -6-) carboxyfluorescein diacetate succinimidyl ester, Molecular Probes, USA) is a fluorescein-derived intracellular fluorescent label which is divided equally between daughter cells upon cell division. Staining of cells with CFSE allows both quantification and immunophenotyping (phycoerythrin-labeled antibodies) of proliferating cells in a mixed cell suspension. Briefly, PBMC were washed twice in PBS, resuspended in PBS containing CFSE at a final concentration of 5 μM, and incubated at 37° C. for 10 minutes. Cells were washed three times with PBS and incubated for five days as indicated in the figure legends. Proliferating CD19-positive B-cells were identified by decreased CFSE content using flow cytometry.
[0353]Preparation of whole cell, nuclear and cytosolic protein extracts: For Western blot analysis, whole cell extracts were prepared. Primary B-cells were treated with medium, the phosphodiester oligonucleotides 2080 (SEQ ID NO.: 321) or 2078 (SEQ ID NO.: 319) at 30 μg/ml, or anti-IgM (10 μg/ml). Cells were harvested, washed twice with ice-cold PBS containing 1 mM Na3VO4, resuspended in lysis buffer (150 mM NaCl, 10 mM TRIS pH 7.4, 1% NP40, 1 mM Na3VO4, 50 mM NaF, 30 mg/ml leupeptin, 50 mg/ml aprotinin, 5 mg/ml antipain, 5 mg/ml pepstatin, 50 μg/ml phenylmethylsulfonylfluoride (PMSF)), incubated for 15 min on ice and spun at 14000 rpm for 10 min. The supernatant was frozen at -80 C. For the preparation of nuclear extracts, primary B-cells were resuspended in hypotonic buffer (10 mM HEPES/KOH (pH 7.9), 10 mM KCl, 0.05% NP40, 1.5 mM MgCl2, 0.5 mM dithiothreitol (DTT), 0.5 mM PMSF, 30 mg/ml leupeptin, 50 mg/ml aprotinin, 5 mg/ml antipain, 5 mg/ml pepstatin). After 15 minutes incubation on ice, the suspension was centrifuged at 1000×g for 5 minutes. The pelleted nuclei were resuspended in extraction buffer (20 mM HEPES (pH 7.9), 450 mM NaCl, 50 mM NaF, 20% glycerol, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, 1 mM PMSF, 30 mg/ml leupeptin, 50 mg/ml aprotinin, 5 mg/ml antipain, 5 mg/ml pepstatin) and incubated on ice for one hour. The nuclear suspension was centrifuged for 10 minutes at 16,000 g at 4° C. Supernatant was collected and stored at -80° C. Cytosolic extracts for the CpG binding protein studies were prepared from unstimulated Ramos cells, which were lysed with hypotonic buffer as described for the preparation of the nuclear extract. After centrifugation, the supernatant was removed as cytoplasmic fraction and stored at -80° C. Protein concentrations were measured using a Bradford protein assay (Bio-Rad, Hercules, Calif.) according to the manufacturer.
[0354]Western blot analysis: Equal concentrations of whole cell protein extracts (25 μg/lane) were boiled in SDS sample buffer (50 mM Tris-Cl, pH 6.8; 1% β-mercaptoethanol; 2% SDS; 0.1% bromphenolblue; 10% glycerol) for 4 min before being subjected to electrophoresis on a 10% polyacrylamide gel containing 0.1% SDS (SDS-PAGE). After electrophoresis, proteins were transferred to Immobilion-P transfer membranes (Millipore Corp. Bedford, Mass.). Blots were blocked with 5% nonfat dry milk. Specific antibodies against the phosphorylated form of extracellular receptor kinase (ERK), c-jun NH2-terminal kinase (JNK), p38 and activating transcription factor-2 (ATF-2) were used (New England BioLabs, Beverly, Mass.). Blots were developed in enhanced chemiluminescence reagent (ECL; Amersham International, Aylesbury, U.K.) according to the manufacturer's recommended procedure.
[0355]Electrophoretic mobility shift assay (EMSA): To detect the DNA-binding activity of the transcription factor activator protein-1 (AP-1) and NFκB, nuclear extracts (1 μg/lane) were analyzed by EMSA using the dsODNs 5' GAT CTA GTG ATG AGT CAG CCG GAT C 3' (SEQ ID NO.: 838) containing the AP-1 binding sequence, and the NFκB URE from the c-myc promotor region 5' TGC AGG AAG TCC GGG TTT TCC CCA ACC CCC C 3' (SEQ ID NO.: 1142), as probes. ODNs were end labeled with T4-polynucleotide kinase (New England Biolabs) and (γ-32P) ATP (Amersham, Arlington Heights, Ill.). Binding reactions were performed with 1 μg nuclear protein extract in DNA-binding buffer (10 mM Tris-HCl (pH 7.5), 40 mM MgCl2, 20 mM EDTA, 1 mM dithiothreitol, 8% glycerol and 100-400 ng of poly (dI-dC) with 20.000-40.000 cpm labeled ODN in 10 μl total volume. Specificity of the NFκB bands was confirmed by competition studies with cold oligonucleotides from unrelated transcription factor binding sites (10-100 ng). For the supershift assay, 2 μg of specific antibodies for c-Rel, p50 and p65 (Santa Cruz Biotechnology, Inc., Santa Cruz, Calif.) were added into the reaction mixture for 30 min before the radiolabeled probe was added. Following incubation for 30 minutes at room temperature loading buffer was added and the probes were electrophoresed on a 6% polyacrylamide gel in Tris-borate-EDTA running buffer (90 mM Tris, 90 mM boric acid, 2 mM EDTA, pH 8.0). Gels were dried and then autoradiographed.
[0356]UV-crosslinking and denaturing protein electrophoresis: Nuclear extracts were incubated with labeled phosphodiester oligonucleotide as described for the EMSA. DNA-protein complexes were crosslinked with UV-light in a Stratalinker (Stratagene) for 10 minutes. Probes were mixed with SDS-sample buffer, boiled for 10 minutes and loaded on a 7.5% SDS-PAGE. The gel was dried on Whatman paper and autoradiographed. Plotting the distance against the molecular weight of the marker proteins yielded a standard curve which was used to calculate the approximate molecular weight of the crosslinked protein-ODN complexes. The molecular weight of the oligonucleotide was subtracted from this value to give the size.
Example 9
Identification of an Optimal CpG Motif for Use Alone or in Combination with a T-Rich ODN
[0357]Phosphorothioate oligonucleotides containing the murine CpG motif GACGTT (SEQ ID NO.: 1143) (for example 1826 (SEQ ID NO.: 69)) and used at concentrations which are active in murine B-cells (Yi A. K., Chang M., Peckham D. W., Krieg A. M., and Ashman R. F. 1998. CpG oligodeoxyribonucleotides rescue mature spleen B cells from spontaneous apoptosis and promote cell cycle entry. J Immunol 160:5898), have showed little or no immunostimulatory activity on human immune cells. At higher concentrations this ODN was found to demonstrate some stimulatory effect on human B cells.
[0358]In earlier studies on B-cell activation in mice, it was found that a CpG-dinucleotide flanked by two 5' purines and two 3' pyrimidines and preferably the 6 mer motif 5' GACGTT 3' (SEQ ID NO: 1143) was optimal for a phosphodiester oligonucleotide to be active (Krieg A. M., et al. 1995 Nature 374:546, Yi A. K., Chang M., et al. 1998 J Immunol 160:5898).
[0359]In order to identify an optimal motif for stimulation of an immune response in humans and non-rodent vertebrates we designed a series of ODN and tested their activity. First we designed a 20 mer phosphodiester oligonucleotide with a TC dinucleotide at the 5' end preceding the optimal murine CpG motif 5' GACGTT 3' (SEQ ID NO.: 1143) and followed by a poly C tail (2079: 5' TCG ACG TTC CCC CCC CCC CC 3'(SEQ ID NO.: 320)). This oligonucleotide if added to human primary B-cells under the same conditions as found to be optimal for E. coli DNA (repeated addition at 0 hours, 4 hours and 18 hours; 30 μg/ml for each time point) stimulated high levels of CD86 expression on human primary B-cells after two days. To determine the structure-function relationship of the CpG motifs, we replaced the bases adjacent to the CpG dinucleotides while maintaining the two CpG dinucleotides within the sequence. Exchange of the adenine located between both CpG dinucleotides by thymidine (2080 (SEQ ID NO.: 321)) resulted in slightly higher activity. Replacement by guanosine (2100 (SEQ ID NO.: 341)) or cytidine (2082 (SEQ ID NO.: 323)) at this position showed no major changes compared to 2079 (SEQ ID NO.: 320). In contrast, replacement of the thymidine 3' to the second CpG dinucleotide by the purines guanosine (2099 (SEQ ID NO.: 340)) or adenine (2083 (SEQ ID NO.: 324)) resulted in a major drop in activity of the oligonucleotide, while the pyrimidine cytidine caused only a minor decrease. The thymidine immediately 5' to the first CpG dinucleotide was also important. Replacement of the thymidine by any other base (2105 (SEQ ID NO.: 346), guanosine; 2107 (SEQ ID NO.: 348), adenine; 2104 (SEQ ID NO.: 345), cytidine) led to a marked decrease in activity of the oligonucleotide. Elimination of the first (2108 (SEQ ID NO.: 349)) or the second (2106 (SEQ ID NO.: 347)) CpG dinucleotide also partially reduced the activity.
[0360]The addition of more 5' GTCGTT 3' (SEQ ID NO.: 1144) CpG motifs to the phosphodiester oligonucleotide containing the 8 mer duplex CpG motif (5' TCGTCGTT 3' (SEQ ID NO:1145), 2080 (SEQ ID NO.: 321)) did not further enhance CD86 expression on B-cells (2059 (SEQ ID NO.: 300)). An oligonucleotide with the same sequence as 2080 (SEQ ID NO.: 321) but with a phosphorothioate backbone showed no activity above background (2116 (SEQ ID NO.: 357)). This was surprising since the phosphorothioate backbone has been reported to greatly stabilize oligonucleotides and enhance CpG-induced stimulation (Krieg A. M., Yi A. K., Matson S., Waldschmidt T. J., Bishop G. A., Teasdale R., Koretzky G. A., and Klinman D. M. 1995. CpG motifs in bacterial DNA trigger direct B-cell activation. Nature 374:546). We therefore performed further structure-function analysis of phosphorothioate oligonucleotides containing the 5' GTCGTT 3' (SEQ ID NO: 1144) and 5' TCGTCGTT 3' (SEQ ID NO:1145) motifs, which showed that additional CpG motifs (2006 (SEQ ID NO.: 246)) tended to increase the activity of phosphorothioate oligonucleotides.
[0361]Purified B-cells isolated from peripheral blood by immunomagnetic cell sorting were activated by CpG DNA to the same extent as unpurified B-cells within PBMC. Thus, activation of B-cells is a primary response and not a secondary effect caused by cytokines secreted by other cells.
[0362]In addition to the co-stimulatory molecule CD86, the functional stage of B-cells is characterized by other surface markers. For example, activated T helper cells stimulate B-cells by CD40 ligation, the intercellular adhesion molecule-1 (ICAM-1, CD54) mediates binding to other immune cells, and major histocompatibility complex II (MHC II) is responsible for antigen presentation. We found that B cell expression of CD40, CD54 and MHC II was upregulated by the CpG oligonucleotide 2080 (SEQ ID NO.: 321). The non-CpG control oligonucleotide 2078 (SEQ ID NO.: 319) showed no activity compared to medium alone.
[0363]When PBMC were incubated for 5 days in the presence of 2080 (SEQ ID NO.: 321) (added at 0 hours, 4 hours, 18 hours and every subsequent morning), it was intriguing that a subpopulation of lymphocytes increased in cell size (FSC) and became more granular (SSC). To examine if this subpopulation represented proliferating B-cells, we stained freshly isolated PBMC with CFSE (5-(and -6-) carboxyfluorescein diacetate succinimidyl ester) at day 0 and incubated them for 5 days with 2080 (SEQ ID NO.: 321) as above. CFSE is a fluorescent molecule that binds irreversibly to cell proteins. Each cell division decreases CFSE stain by 50%. Cells staining low with CFSE (proliferating cells) were found to be mainly CD19-positive B-cells. The oligonucleotide 2080 (SEQ ID NO.: 321) induced 60 to 70% of CD19 positive B-cells to proliferate within 5 days. The control oligonucleotide 2078 (SEQ ID NO.: 319) induced less than 5% of B-cells to proliferate. Proliferating B-cells (CFSE low) showed a larger cell size (FSC) and higher granularity.
[0364]Proliferating B-cells expressed higher levels of CD86 than non-proliferating cells (not shown). In agreement with this finding, the oligonucleotide panel tested above for induction of CD86 expression resulted in an almost identical pattern of B-cell proliferation. Replacement of the 3' thymidine reduced activity more than changing the thymidine in the middle position.
Example 10
B-Cell Activation Requires Endosomal Maturation/Acidification
[0365]It has previously been shown that chloroquine, an inhibitor of endosomal acidification, blocks CpG-mediated stimulation of murine antigen presenting cells and B-cells, while not influencing LPS-mediated effects (Hacker H., et al 1998 Embo J 17:6230, Yi A. K. et al 1998 J Immunol 160:4755, Macfarlane D. E., and Manzel L. 1998 J Immunol 160:1122). We found that the addition of 5 μg/ml chloroquine completely blocked CpG DNA-mediated induction of CD86 expression on primary B-cells (MFI CD86: 2006 (SEQ ID NO.: 246), 4.7 vs 1.4; E. coli DNA, 3.4 vs. 1.4; medium only, 0.9; n=4). Furthermore, chloroquine completely inhibited the induction of B-cell proliferation by the phosphorothioate oligonucleotide 2006 (SEQ ID NO.: 246) measured with the CFSE proliferation assay as well as with the standard. These results suggest that as with murine cells, activation of human B-cells by CpG DNA requires the uptake of DNA in endosomes and subsequent endosomal acidification.
Example 11
Analysis of Sub-Cellular Events Resulting Upon Human B Cell Stimulation with Optimal Human ODN
[0366]Since the CpG motif requirement for maximal B-cell activation is substantially different between mouse (GACGTT) (SEQ ID NO: 1143) and humans (TCGTCGTT) (SEQ ID NO: 1145), we were interested if the basic intracellular signaling events are comparable. Rapid induction of NFκB binding activity has been found earlier in murine B-cells and macrophages (Stacey K. J., et al 1996 J Immunol 157:2116, Yi A. K et al 1998 J Immunol 160:4755). To investigate the NFκB response to CpG DNA in humans, human primary B-cells were isolated from peripheral blood by immunomagnetic cell sorting and incubated with the CpG oligonucleotide 2080 (SEQ ID NO.: 321), the non-CpG control oligonucleotide 2078 (SEQ ID NO.: 319), or medium. At the indicated time points, cells were harvested and nuclear extracts were prepared. In the presence of CpG oligonucleotide, NFκB binding activity was increased within one hour and maintained up to 18 hours (latest time point examined). The non-CpG control oligonucleotide 2078 (SEQ ID NO.: 319) did not show enhanced NFκB activity compared to cells incubated with medium only. The NFκB band was identified by cold competition, and shown to consist of p50 and p65 subunits by supershift assay.
[0367]The activating protein-1 (AP-1) transcription factor is involved in the regulation of immediate early genes and cytokine expression (Karin M. 1995. The regulation of AP-1 activity by mitogen-activated protein kinases. J Biol Chem 270:16483). In murine B-cells, AP-1 binding activity is induced in response to CpG DNA (Yi A. K., and Krieg A. M. 1998. Rapid induction of mitogen-activated protein kinases by immune stimulatory CpG DNA. J Immunol 161:4493). To determine whether this transcription factor would also be induced by CpG DNA in humans, we examined AP-1 DNA binding activity in human primary B-cells. Cells were incubated with the CpG oligonucleotide 2080 (SEQ ID NO.: 321) or the control oligonucleotide 2078 (SEQ ID NO.: 319). Nuclear extracts were prepared and the AP-1 binding activity was analyzed by EMSA. AP-1 binding activity was enhanced within one hour, and increased up to 18 hours (latest time point examined), showing a sustained response.
[0368]Since AP-1 activity is induced by many stimuli (Angel P., and Karin M. 1991. The role of Jun, Fos and the AP-1 complex in cell-proliferation and transformation. Biochim Biophys Acta 1072:129), we were interested in signal transduction pathways upstream of AP-1. The AP-1 transcription factor complex integrates different mitogen activated protein kinase (MAPK) pathways (Karin M. 1995. The regulation of AP-1 activity by mitogen-activated protein kinases. J Biol Chem 270:16483). Western blots were performed using whole cell extracts from primary B-cells incubated with the CpG oligonucleotide 2080 (SEQ ID NO.: 321), the control 2078 (SEQ ID NO.: 319), or medium only. Specific antibodies to the phosphorylated form of JNK, p38, ATF-2 and ERK were used. Strong induction of JNK phosphorylation was found 30 min and 60 min after exposure to CpG-DNA, while the non-CpG oligonucleotide showed no activity above background. The protein kinase p38, another stress activated protein kinase (SAPK), was also phosphorylated in response to CpG DNA within 60 min. ATF-2, a substrate of both p38 and JNK (Gupta S., Campbell D., Derijard B., and Davis R. J. 1995. Transcription factor ATF2 regulation by the JNK signal transduction pathway. Science 267:389) and a component of the AP-1 complex, showed weak phosphorylation after 30 min which increased after 60 min. CpG DNA failed to induce substantial phosphorylation of ERK. In contrast, anti-IgM, stimulating the B-cell receptor, did trigger phosphorylation of ERK. Anti-IgM activated different isoforms of JNK than CpG DNA.
Example 12
Assay for In Vivo Adjuvant Activity
[0369]An in vitro screening assay to identify ODN useful as an adjuvant in vivo in humans and other non-rodent animals was developed. Since we saw not only quantitative but also qualitative differences in activities of different CpG ODN in mice, we first screened a panel of CpG and non-CpG control ODN on mouse cells to find in vitro assays with reliable and strong correlation to in vivo adjuvant activity with hepatitis B surface antigen (HBsAg). We then systematically tested a panel of more than 250 ODN in corresponding human assays to identify sequences with in vitro immunostimulatory activity. We next examined if the ODN with the highest activity in these human assays also activate B cell proliferation in chimpanzees and monkeys, and finally, if they are active as adjuvants with HBsAg in chimpanzees and cynomolgus monkeys in vivo. These studies revealed that the sequence, number and spacing of individual CpG motifs contribute to the immunostimulatory activity of a CpG phosphorothioate ODN. An ODN with a TC dinucleotide at the 5' end followed by three 6 mer CpG motifs (5' GTCGTT 3') separated by TT dinucleotides consistently showed the highest activity for human, chimpanzee, and rhesus monkey leukocytes. Chimpanzees or monkeys vaccinated once against hepatitis B with this CpG ODN adjuvant developed 15 times higher anti-HBs antibody titers than those receiving vaccine alone.
[0370]Materials and Methods
[0371]Oligodeoxynucleotides: Phosphorothioate-modified ODN were purchased from Operon Technologies (Alameda, Calif.) and Hybridon Specialty Products (Milford, Mass.). ODN were tested for endotoxin using the LAL-assay (LAL-assay BioWhittaker, Walkersville, Md.; lower detection limit 0.1 EU/ml). For in vitro assays, ODN were diluted in TE-buffer (10 mM Tris, pH 7.0, 1 mM EDTA), and stored at -20° C. For in vivo use, ODN were diluted in phosphate buffered saline (0.1 M PBS, pH 7.3) and stored at 4° C. All dilutions were carried out using pyrogen-free reagents.
[0372]Mouse spleen cell cultures: Spleens were removed from 6-12 week old female BALB/c (The Jackson Laboratory), 2×106 splenocytes were cultured with 0.2 μM ODN for 4 hours (TNF-α) or 24 hours (IL-6, IFN-γ, IL-12), and cytokines were detected by ELISA as previously described (Yi A. K., Klinman D. M., Martin T. L., Matson S., and Krieg A. M. 1996. Rapid immune activation by CpG motifs in bacterial DNA. Systemic induction of IL-6 transcription through an antioxidant-sensitive pathway. J Immunol 157:5394). To evaluate CpG-induced B cell proliferation, spleen cells were depleted of T cells with anti-Thy-1.2 and complement and centrifugation over lympholyte M® (Cedarlane Laboratories, Hornby, ON, Canada), cultured for 44 hours with the indicated ODN, and then pulsed for 4 hours with 1 μCi of 3H thymidine as described previously (Krieg A. M., Yi A. K., Matson S., Waldschmidt T. J., Bishop G. A., Teasdale R., Koretzky G. A., and Klinman D. M. 1995. CpG motifs in bacterial DNA trigger direct B-cell activation. Nature 374:546). To examine NK cell lytic activity murine spleen cells were depleted of B cells using magnetic beads coated with goat anti-mouse Ig as previously detailed (Ballas Z. K., and Rasmussen W. 1993. Lymphokine-activated killer cells. VII. IL-4 induces an NK1.1+CD8 α+β.sup.- TCR-αβ B220+ lymphokine-activated killer subset. J Immunol 150:17). Cells were cultured at 5×106/well in 24-well plates and harvested at 18 hours for use as effector cells in a standard 4 hour 5Cr-release assay against YAC-1 target cells. One unit (LU) was defined as the number of cells needed to effect 30% specific lysis.
[0373]Immunization of mice against HBsAg and evaluation of the humoral response: Groups of 6-8 week old female BALB/c mice (n=5 or 10, Charles River, Montreal, QC) were immunized against HBsAg as previously described (Davis H. L., et al 1998 J Immunol 160:870). In brief, each mouse received a single IM injection of 50 μl PBS containing 1 μg recombinant HBsAg (Medix Biotech, Foster City, Calif.) and 10 μg of CpG ODN or non-CpG ODN as a sole adjuvant or combined with alum (Alhydrogel "85", Superfos Biosector, Vedbaek, Denmark; 25 mg Al3+/mg HBsAg). Control mice were immunized with HBsAg without adjuvant or with alum. Plasma was recovered from mice at various times after immunization and Abs specific to HBsAg (anti-HBs) were quantified by end-point dilution ELISA assay (in triplicate) as described previously (Davis H. L et al 1998 J Immunol 160:870). End-point titers were defined as the highest plasma dilution that resulted in an absorbance value (OD450) two times higher than that of non-immune plasma with a cut-off value of 0.05.
[0374]Isolation of primate PBMC and cell culture: Peripheral blood mononuclear cells (PBMC) were isolated from peripheral blood of healthy volunteers, chimpanzees or rhesus or cynomolgus monkeys by Ficoll-hypaque density gradient centrifugation (Histopaque-1077, Sigma Chemical Co., St. Louis, Mo.) as described (Hartmann G., et al 1996 Antisense Nucleic Acid Drug Dev 6:291). Cells were suspended in RPMI 1640 culture medium supplemented with 10% (v/v) heat-inactivated (56° C., 1 h) FCS (HyClone, Logan, Utah), 1.5 mM L-glutamine, 100 U/ml penicillin and 100 μg/ml streptomycin (all from Gibco BRL, Grand Island, N.Y.) (complete medium). Cells (final concentration 1×106 cells/ml) were cultured in complete medium in a 5% CO2 humidified incubator at 37° C. ODN and LPS (from Salmonella typhimurium, Sigma Chemical Co., St. Louis, Mo.) or anti-IgM were used as stimuli. For measurement of human NK lytic activity, PBMC were incubated at 5×106/well in 24-well plates. Cultures were harvested after 24 hours, and cells were used as effectors in a standard 4 hours 51Cr-release assay against K562 target cells as previously described (Ballas Z. K., Rasmussen W. L., and Krieg A. M. 1996. Induction of NK activity in murine and human cells by CpG motifs in oligodeoxynucleotides and bacterial DNA. J Immunol 157:1840; Ballas Z. K., and Rasmussen W. 1993. Lymphokine-activated killer cells. VII. IL-4 induces an NK1.1+CD8 α+β.sup.- TCR-αβ B220+ lymphokine-activated killer subset. J Immunol 150:17). For B cell proliferation, 1 μCi of 3H thymidine was added 18 hours before harvest, and the amount of 3H thymidine incorporation was determined by scintillation counting at day 5. Standard deviations of the triplicate wells were <5%.
[0375]Flow cytometry on primate PBMC: Surface antigens on primate PBMC were stained as previously described (Hartmann G et al 1998 J Pharmacol Exp Ther 285:920). Monoclonal antibodies to CD3 (UCHT1), CD14 (M5E2), CD19 (B43), CD56 (B159), CD69 (FN50) and CD86 (2331 (FUN-1)) were purchased from Pharmingen, San Diego, Calif. IgG1, κ (MOPC-21) and IgG2b, κ (Hartmann G et al 1999 PNAS 96:9305) were used to control for non-specific staining. NK cells were identified by CD56 expression on CD3, CD14 and CD19 negative cells, whereas B cells were identified by expression of CD19. Flow cytometric data from 10000 cells per sample were acquired on a FACScan (Beckton Dickinson Immunocytometry Systems, San Jose, Calif.). The viability of cells within the FSC/SSC gate used for analysis was examined by propidium iodide staining (2 μg/ml) and found to be higher than 98%. Data were analyzed using the computer program FlowJo (version 2.5.1, Tree Star, Inc., Stanford, Calif.).
[0376]Immunization of chimpanzees and cynomolgus monkeys against HBsAg and evaluation of the humoral response: Fourteen cynomolgus monkeys (2.0-3.5 kg) were immunized with a pediatric dose of Engerix-B (SmithKline Beecham Biologicals, Rixensart, BE) containing 10 μg HBsAg adsorbed to alum (25 mg Al3+/mg HBsAg). This was administered alone (n=5), or combined with CpG ODN 1968 (n=5, 500 μg) or CpG ODN 2006 (SEQ ID NO.: 246) (n=4, 150 μg). Four chimpanzees (10-20 kg) were immunized in the same fashion with two receiving control vaccine (Engerix-B only) and two receiving experimental vaccine (Engerix-B plus 1 mg CpG ODN 2006). All vaccines were administered IM in the right anterior thigh in a total volume of 1 ml. Monkeys were maintained in the animal facility of the Primate Research Center (Bogor, Indonesia) and chimpanzees were housed at Bioqual (Rockville, Md.). Animals were monitored daily by animal care specialists. No symptoms of general ill health or local adverse reactions at the injection site were noted. Plasma was recovered by IV puncture prior to and at various times after immunization and was stored frozen (-20° C.) until assayed for antibodies. Anti-HBs antibodies were detected using a commercial ELISA kit (Monolisa Anti-HBs; Sanofi-Pasteur, Montreal, QC) and titers were expressed in mIU/ml based on comparison with WHO defined standards (Monolisa Anti-HBs Standards; Sanofi-Pasteur).
[0377]Results
[0378]Identification of CpG ODN with different profiles of in vitro immune activities: Our studies showed that the precise bases on the 5' and 3' sides of a CpG dinucleotide within a CpG motif may have an impact on the level of immune activation of a synthetic ODN, but it has been unclear whether different CpG motifs might display different immune effects. To evaluate this possibility, we tested a panel of CpG ODN for their ability to induce NK lytic activity, B cell proliferation, and to stimulate synthesis of TNF-α, IL-6, IFN-γ and IL-12 in murine spleen cells. Immunostimulatory activity of ODN without CpG motifs (ODN 1982 (SEQ ID NO.: 225), ODN 1983 (SEQ ID NO.: 226)) was negative or weak compared to CpG ODN. ODN with non optimal CpG motifs (ODN 1628 (SEQ ID NO.: 767), ODN 1758 (SEQ ID NO.: 1)) were less active than ODN containing CpG motifs flanked by two 5' purines and two 3' pyrimidines (ODN 1760 (SEQ ID NO.: 3), ODN 1826 (SEQ ID NO.: 69), ODN 1841 (SEQ ID NO.: 84)). ODN 1826 containing two optimal murine CpG motifs (5' GACGTT 3') (SEQ ID NO: 1143) had the highest activity for 5 of 6 measured endpoints. Except for ODN 1628, all ODN showed a generally similar pattern of activity (NK cell-mediated lysis, B cell proliferation, IL-12, IL-6, TNF α, IFN-γ). Of note, ODN 1628, which was unique in this panel for containing two G-rich regions, showed preferential induction of IFN-γ synthesis but relatively low stimulation of the other activities.
[0379]Identification of in vitro assays which correlate with in vivo adjuvant activity: Since adjuvant activity is an in vivo endpoint, we were interested in identifying in vitro assays that would predict the adjuvant activity of a CpG ODN in vivo. The same ODN used for in vitro endpoints therefore were tested for their adjuvant activity to immunize mice against HBsAg. This was carried out both with ODN alone and with ODN combined with alum, since earlier studies had shown strong synergy for CpG ODN and alum adjuvants (PCT Published Patent Application WO98/40100).
[0380]BALB/c mice immunized with HBsAg without adjuvant attained only low titers of anti-HBs by 4 weeks, and this was not affected by addition of control ODN. In contrast, addition of CpG ODN raised anti-HBs titers by 5 to 40 fold, depending on the sequence used. When alum was added, titers of anti HBs were approximately 6 times higher than with HBsAg alone. Specifically, control ODN had no effect and the various CpG ODN augmented these titers 2 to 36 fold. Results obtained with the different ODN alone correlated very strongly (r=0.96) with those obtained using the same ODN plus alum. When linear regression was performed, a very high degree of correlation was found between certain in vitro assays and in vivo augmentation of anti-HBs titers. Of all the in vitro endpoints examined, the induction of NK lytic activity showed the best correlation to in vivo adjuvant activity (without alum, r=0.98; with alum, r=0.95; p<0.0001). A good correlation regarding adjuvant activity was also obtained for B-cell stimulation (r=0.84 and 0.7), as well as secretion of TNF-α (r=0.9 and 0.88), IL-12 (r=0.88 and 0.86) and IL-6 (r=0.85 and 0.91). The one in vitro assay that did not correlate well with the in vivo results was IFN-γ secretion (r=0.57 and 0.68). These data demonstrate that in vitro assays for NK lytic activity, B cell activation and production of TNF-α, IL-6 and IL-12 provide valuable information in vitro to predict the adjuvant activity of a given ODN in vivo.
[0381]Screening of a phosphorothioate ODN panel to activate human NK cells: In previous studies we found that synthesis of inflammatory cytokines by human PBMC is induced by extremely low amounts of endotoxin (induced TNF-α secretion is detectable with just 6 μg/ml endotoxin, 2 logs more sensitive than murine immune cells). In contrast, activation of human B cells and induction of human NK cell lytic activity with endotoxin is low even at high endotoxin concentrations. Based on these results we selected activation of NK cells (lytic activity and CD69 expression) and B cells (proliferation and CD86 expression) as the most highly specific and reproducible assays with low inter-subject variability and used these assays for in vitro screening of a pool of ODN.
[0382]First we studied the effect of phosphorothioate ODN containing various combinations and permutations of CpG motifs on NK cell-mediated lysis of target cells. For clarity and ease of presentation, only data with selected representative CpG and control ODN are shown. Human PBMC were incubated with different phosphorothioate ODN (6 μg/ml) for 24 hours and tested for their ability to lyse 51Cr-labeled K562 cells. ODN with two 6-mer CpG motifs (either 5' GACGTT 3' (SEQ ID NO.: 1143) or 5' GTCGTT 3' (SEQ ID NO.: 1144)) in combination with a TpC at the 5' end of the ODN (ODN 1840 5' TCCATGTCGTTCCTGTCGTT 3' (SEQ ID NO.: 83), ODN 1851 5' TCCTGACGTTCCTGACGTT 3' (SEQ ID NO.: 94) or with at least three 6-mer motifs without a TpC at the 5' end (ODN 2013 (SEQ ID NO.: 253)) show intermediate activity. High activity was found when the 5' TpC directly preceded a 6-mer human CpG motif (5' TCGTCGTT 3' (SEQ ID NO: 1145) (in SEQ ID NO.: 246)) and was followed by two 6-mer motifs (ODN 2005 (SEQ ID NO.: 245), ODN 2006 (SEQ ID NO.: 246) and ODN 2007 (SEQ ID NO.: 247)). The best results were obtained when the 6-mer CpG motifs were separated from each other and from the 5' 8-mer CpG motif by TpT (ODN 2006 (SEQ ID NO.: 246)).
[0383]Expression of the activation marker CD69 is rapidly upregulated on the surface of NK cells subsequent to stimulation. To confirm the results from the NK cell lysis assay, PBMC were incubated for 18 hours with ODN (2 μg/ml). CD69 expression was examined on CD56 positive NK cells (CD3, CD14 and CD19 negative). Although induction of CD69 expression was less sequence restricted than stimulation of NK cell functional activity, control ODN(ODN 1982, ODN 2116, ODN 2117, ODN 2010) showed only low activity similar to background levels. ODN with two human CpG motifs separated by 5' TTTT 3' (ODN 1965 (SEQ ID NO.: 208)) or four human CpG motifs without spacing (ODN 2013 (SEQ ID NO.: 253)) were relatively more active at inducing CD69 expression than at stimulating NK cell lytic activity. Optimal NK cell functional activity, as well as CD69 expression, was obtained with ODNs containing a TpC dinucleotide preceding the human CpG motif, and additional human motifs within the sequence (ODN 2006 (SEQ ID NO.: 246), ODN 2007 (SEQ ID NO.: 247)).
[0384]Activity of phosphorothioate ODN for stimulating human B cells: In preliminary experiments we found that the percentage of proliferating B cells (CFSE assay, see methods section) correlated with the surface expression of the co-stimulatory CD86 on B cells, as measured by flow cytometry. Thus we used CD86 expression on B cells to screen a panel of ODN for their immunostimulatory activity. PBMC were incubated with 0.6 μg/ml ODN. Expression of CD86 (mean fluorescence intensity, MFI) was examined on CD19 positive B cells. A poly C ODN (ODN 2017 (SEQ ID NO.: 257)) or ODN without CpG dinucleotides (ODN 1982 (SEQ ID NO.: 225)) failed to stimulate human B cells under these experimental conditions. A phosphorothioate ODN (ODN 2116 (SEQ ID NO.: 256)) with one optimal human CpG motif preceded by a TpC (5' TCGTCGTT 3' (SEQ ID NO: 1145) (in SEQ ID NO.: 246)) was inactive. The presence of one human 6-mer CpG motif (5' GTCGTT 3' (SEQ ID NO.: 1144)) had no activating effect. Two of these CpG motifs within the sequence showed no (ODN 1960 (SEQ ID NO.: 203), ODN 2016 (SEQ ID NO.: 256)) or intermediate (ODN 1965 (SEQ ID NO.: 208)) activity dependent on the sequence context. If the ODN was composed of three or four copies of this motif (ODN 2012 (SEQ ID NO.: 252), ODN 2013 (SEQ ID NO.: 253), ODN 2014 (SEQ ID NO.: 254)), intermediate activity on B cells could be detected. The combination of the human 8-mer CpG motif on the 5' end of the ODN with two 6-mer CpG motifs (ODN 2005 (SEQ ID NO.: 245), ODN 2006 (SEQ ID NO.: 246), ODN 2007 (SEQ ID NO.: 247), ODN 2102 (SEQ ID NO.: 343), ODN 2103 (SEQ ID NO.: 344)) led to a considerable increase in the ability of the ODN to stimulate B cells. The spacing between the single motifs was critical. The separation of CpG motifs by TpT was preferable (ODN 2006 (SEQ ID NO.: 246)) compared to unseparated CpG motifs (ODN 2005 (SEQ ID NO.:); also compare ODN 1965 (SEQ ID NO.: 208) to ODN 1960 (SEQ ID NO.: 203)). The human 6-mer CpG motif (5' GTCGTT 3') was better than the optimal mouse 6-mer CpG motif (5' GACGTT 3' (SEQ ID NO.: 246)) when combined with the human 8-mer CpG motif on the 5' end (ODN 2006 vs. ODN 2102 (SEQ ID NO.: 343) and ODN 2103 (SEQ ID NO.: 344)). A (TCG)poly ODN was inactive or only weakly active, as were ODN containing CpG dinucleotides flanked by guanines or other CpG dinucleotides (ODN 2010 (SEQ ID NO.: 250)). Taken together, the findings for NK cells and B cells showed consistently that of the ODN tested, ODN 2006 (SEQ ID NO.: 246) has the highest immunostimulatory activity on human immune cells.
[0385]Comparative analysis of potency of CpG phosphorothioate ODNs in different primates: Different CpG motifs are optimal to activate murine and human immune cells. Furthermore, the number and location of CpG motifs within an active phosphorothioate ODN is different in mice and humans. We were interested to know if CpG phosphorothioate ODN show a similar activity among different species of primates. We compared a panel of CpG ODN for their ability to induce B cell proliferation in humans, chimpanzees and rhesus or cynomolgus monkeys. The capability of ODN to stimulate human B cell proliferation (Table J) correlated well with their ability to induce CD86 expression on B cells. ODN 2006 (SEQ ID NO.: 246), which showed the highest activity in human B cells and NK cells, was also the most active in stimulating chimpanzee and rhesus monkey B cell proliferation (Table J). ODN 1968 (SEQ ID NO.: 211) and ODN 2006 (SEQ ID NO.: 246) gave the highest activation of cynomolgus monkey B-cells in vitro (SI of 25 and 29 respectively at 6 μg ODN/ml). Surprisingly, CpG ODN 2007 (SEQ ID NO.: 247), which displayed similarly high activity as the optimal ODN 2006 (SEQ ID NO.: 246) in human cells, did not stimulate Rhesus monkey or chimpanzee B cell proliferation, and the ODN 1968 (SEQ ID NO.: 211) showed low activity. CpG ODN originally identified with high activity in mice (ODN 1760 (SEQ ID NO.: 3), ODN 1826 (SEQ ID NO.: 69)) showed little activity in monkeys (Table J).
TABLE-US-00011 TABLE J Proliferative response of PBMC to phosphorothioate CpG ODN in primates Rhesus Humans Chimpanzee monkey No addition 0.5 +- 0.1 0.5 +- 0.1 0.5 +- 0.0 ODN 1760 23 +- 7 0.3 +- 0.1 0.5 +- 0.3 (SEQ ID NO.: 3) ODN 1826 0.8 +- 0.1 0.4 +- 0.1 0.6 +- 0.1 (SEQ ID NO.: 69) ODN 1968 35 +- 9 20.0 +- 3.8 1.9 +- 0.7 (SEQ ID NO.: 211) ODN 1982 9.7 +- 1.1 2.5 +- 1.1 0.7 +- 0.1 (SEQ ID NO.: 225) ODN 2006 58 +- 8 27.4 +- 8.9 6.3 +- 3.3 (SEQ ID NO.: 246) ODN 2007 47 +- 11 0.5 +- 0.1 0.4 +- 0.2 (SEQ ID NO.: 247)
PBMC were prepared from peripheral blood and incubated with ODN (0.6 μg/ml) as indicated for five days. Proliferation was measured by uptake of 3H/thymidine (cpm/1000) during the last 18 hours. More than 95% of proliferating cells were B-cells as determined using the CFSE assay. Four human probands, six chimpanzees and two rhesus monkeys were tested.
[0386]In vivo adjuvant activity of CpG ODN in chimpanzees and cynomolgus monkeys: In order to evaluate whether CpG ODN with strong in vitro stimulatory effects on primate cells had detectable adjuvant activity in vivo, Cynomolgus monkeys and chimpanzees were immunized with Engerix B, which comprises HBsAg adsorbed to alum, alone or with added ODN 1968 (500 μg) or ODN 2006 (SEQ ID NO.: 246) (1 mg) respectively. Compared to controls not receiving CpG ODN, anti-HBs titers at 4 weeks post-prime and 2 weeks post-boost were 66- and 16-fold higher respectively in the monkeys, and 15- and 3-fold higher in the chimpanzees (Table K). Thus a clear adjuvant effect of CpG ODN was seen, and this was particularly striking after a single immunization.
TABLE-US-00012 TABLE K Anti-HBs responses in primates immunized against HBsAg with CpG ODN3 Anti-HBs (mIU/ml) Primate 4 wks 2 wks species n CpG ODN post-prime post-boost Cynomolgus 5 None 15 ± 44 4880 ± 13113 monkey 5 ODN 1968 (500 μg) 995 ± 1309 76449 ± 42094 (SEQ ID NO. 211) Chimpanzee 2 None 6, 11 3712, 4706 2 ODN 2006 (1 mg) 125, 135 9640, 16800 (SEQ ID NO. 246) 3Animals were immunized by IM injection of Engerix B containing 10 μg HBsAg adsorbed to alum, alone or with added CpG ODN. Cynomolgus monkeys were boosted at 10 wks and chimpanzees were boosted at 4 wks post-prime. Anti-HBs was determined by ELISA assay; values for monkeys are GMT ± SEM (n = 5) whereas individual values for the two chimpanzees in each group are provided.
[0387]The foregoing written specification is considered to be sufficient to enable one skilled in the art to practice the invention. The present invention is not to be limited in scope by examples provided, since the examples are intended as a single illustration of one aspect of the invention and other functionally equivalent embodiments are within the scope of the invention. Various modifications of the invention in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description and fall within the scope of the appended claims. The advantages and objects of the invention are not necessarily encompassed by each embodiment of the invention.
Sequence CWU
1
1145118DNAArtificial SequenceSynthetic Sequence 1tctcccagcg tgcgccat
18220DNAArtificial
SequenceSynthetic Sequence 2ataatccagc ttgaaccaag
20320DNAArtificial SequenceSynthetic Sequence
3ataatcgacg ttcaagcaag
20418DNAArtificial SequenceSynthetic Sequence 4taccgcgtgc gaccctct
1859DNAArtificial
SequenceSynthetic Sequence 5ggggagggt
969DNAArtificial SequenceSynthetic Sequence
6ggggagggg
979DNAArtificial SequenceSynthetic Sequence 7ggtgaggtg
9820DNAArtificial
Sequencemodified_base(8)...(8)m5c 8tccatgtngt tcctgatgct
20915DNAArtificial
Sequencemodified_base(11)...(11)m5c 9gctaccttag ngtga
151020DNAArtificial
Sequencemodified_base(8)...(8)m5c 10tccatgangt tcctgatgct
201120DNAArtificial
Sequencemodified_base(13)...(13)m5c 11tccatgacgt tcntgatgct
201215DNAArtificial
Sequencemodified_base(7)...(7)m5c 12gctagangtt agtgt
151319DNAArtificial SequenceSynthetic
Sequence 13agctccatgg tgctcactg
191420DNAArtificial SequenceSynthetic Sequence 14ccacgtcgac
cctcaggcga
201520DNAArtificial SequenceSynthetic Sequence 15gcacatcgtc ccgcagccga
201619DNAArtificial
SequenceSynthetic Sequence 16gtcactcgtg gtacctcga
191725DNAArtificial SequenceSynthetic Sequence
17gttggataca ggccagactt tgttg
251825DNAArtificial SequenceSynthetic Sequence 18gattcaactt gcgctcatct
taggc 251924DNAArtificial
SequenceSynthetic Sequence 19accatggacg aactgtttcc cctc
242024DNAArtificial SequenceSynthetic Sequence
20accatggacg agctgtttcc cctc
242124DNAArtificial SequenceSynthetic Sequence 21accatggacg acctgtttcc
cctc 242224DNAArtificial
SequenceSynthetic Sequence 22accatggacg tactgtttcc cctc
242324DNAArtificial SequenceSynthetic Sequence
23accatggacg gtctgtttcc cctc
242424DNAArtificial SequenceSynthetic Sequence 24accatggacg ttctgtttcc
cctc 242525DNAArtificial
SequenceSynthetic Sequence 25ccactcacat ctgctgctcc acaag
252625DNAArtificial SequenceSynthetic Sequence
26acttctcata gtccctttgg tccag
252720DNAArtificial SequenceSynthetic Sequence 27tccatgagct tcctgagtct
202820DNAArtificial
SequenceSynthetic Sequence 28gaggaaggng nggangacgt
202920DNAArtificial SequenceSynthetic Sequence
29gtgaatncgt tcncgggnct
20306DNAArtificial SequenceSynthetic Sequence 30aaaaaa
6316DNAArtificial
SequenceSynthetic Sequence 31cccccc
6326DNAArtificial SequenceSynthetic Sequence
32ctgtca
6336DNAArtificial SequenceSynthetic Sequence 33tcgtag
6346DNAArtificial
SequenceSynthetic Sequence 34tcgtgg
6356DNAArtificial SequenceSynthetic Sequence
35cgtcgt
63620DNAArtificial SequenceSynthetic Sequence 36tccatgtcgg tcctgagtct
203720DNAArtificial
SequenceSynthetic Sequence 37tccatgccgg tcctgagtct
203820DNAArtificial SequenceSynthetic Sequence
38tccatgacgg tcctgagtct
203920DNAArtificial SequenceSynthetic Sequence 39tccatgacgg tcctgagtct
204020DNAArtificial
SequenceSynthetic Sequence 40tccatgtcga tcctgagtct
204120DNAArtificial SequenceSynthetic Sequence
41tccatgtcgc tcctgagtct
204220DNAArtificial SequenceSynthetic Sequence 42tccatgtcgt tcctgagtct
204320DNAArtificial
SequenceSynthetic Sequence 43tccatgacgt tcctgagtct
204420DNAArtificial SequenceSynthetic Sequence
44tccataacgt tcctgagtct
204520DNAArtificial SequenceSynthetic Sequence 45tccatgacgt ccctgagtct
204620DNAArtificial
SequenceSynthetic Sequence 46tccatcacgt gcctgagtct
204720DNAArtificial SequenceSynthetic Sequence
47tccatgctgg tcctgagtct
204820DNAArtificial Sequencemodified_base(8)...(8)m5c 48tccatgtngg
tcctgagtct
204939DNAArtificial SequenceSynthetic Sequence 49ccgcttcctc cagatgagct
catgggtttc tccaccaag 395039DNAArtificial
SequenceSynthetic Sequence 50cttggtggag aaacccatga gctcatctgg aggaagcgg
395120DNAArtificial SequenceSynthetic Sequence
51ccccaaaggg atgagaagtt
205220DNAArtificial SequenceSynthetic Sequence 52agatagcaaa tcggctgacg
205320DNAArtificial
SequenceSynthetic Sequence 53ggttcacgtg ctcatggctg
205418DNAArtificial SequenceSynthetic Sequence
54tctcccagcg tgcgccat
185518DNAArtificial SequenceSynthetic Sequence 55tctcccagcg tgcgccat
185618DNAArtificial
SequenceSynthetic Sequence 56taccgcgtgc gaccctct
185720DNAArtificial SequenceSynthetic Sequence
57ataatccagc ttgaaccaag
205820DNAArtificial SequenceSynthetic Sequence 58ataatcgacg ttcaagcaag
205920DNAArtificial
SequenceSynthetic Sequence 59tccatgattt tcctgatttt
206024DNAArtificial SequenceSynthetic Sequence
60ttgttttttt gtttttttgt tttt
246122DNAArtificial SequenceSynthetic Sequence 61ttttttttgt ttttttgttt tt
226224DNAArtificial
SequenceSynthetic Sequence 62tgctgctttt gtgcttttgt gctt
246322DNAArtificial SequenceSynthetic Sequence
63tgctgcttgt gcttttgtgc tt
226423DNAArtificial SequenceSynthetic Sequence 64gcattcatca ggcgggcaag
aat 236523DNAArtificial
SequenceSynthetic Sequence 65taccgagctt cgacgagatt tca
236615DNAArtificial SequenceSynthetic Sequence
66gcatgacgtt gagct
156715DNAArtificial SequenceSynthetic Sequence 67cacgttgagg ggcat
156815DNAArtificial
SequenceSynthetic Sequence 68ctgctgagac tggag
156920DNAArtificial SequenceSynthetic Sequence
69tccatgacgt tcctgacgtt
207017DNAArtificial SequenceSynthetic Sequence 70gcatgagctt gagctga
177112DNAArtificial
SequenceSynthetic Sequence 71tcagcgtgcg cc
127217DNAArtificial SequenceSynthetic Sequence
72atgacgttcc tgacgtt
177320DNAArtificial SequenceSynthetic Sequence 73ttttggggtt ttggggtttt
207420DNAArtificial
SequenceSynthetic Sequence 74tctaggcttt ttaggcttcc
207520DNAArtificial SequenceSynthetic Sequence
75tgcatttttt aggccaccat
207622DNAArtificial SequenceSynthetic Sequence 76tctcccagcg tgcgtgcgcc at
227717DNAArtificial
SequenceSynthetic Sequence 77tctcccagcg ggcgcat
177818DNAArtificial SequenceSynthetic Sequence
78tctcccagcg agcgccat
187918DNAArtificial SequenceSynthetic Sequence 79tctcccagcg cgcgccat
188019DNAArtificial
SequenceSynthetic Sequence 80ggggtgacgt tcagggggg
198124DNAArtificial SequenceSynthetic Sequence
81ggggtccagc gtgcgccatg gggg
248219DNAArtificial SequenceSynthetic Sequence 82ggggtgtcgt tcagggggg
198320DNAArtificial
SequenceSynthetic Sequence 83tccatgtcgt tcctgtcgtt
208420DNAArtificial SequenceSynthetic Sequence
84tccatagcgt tcctagcgtt
208521DNAArtificial SequenceSynthetic Sequence 85tcgtcgctgt ctccgcttct t
218615DNAArtificial
SequenceSynthetic Sequence 86gcatgacgtt gagct
158720DNAArtificial SequenceSynthetic Sequence
87tctcccagcg tgcgccatat
208820DNAArtificial Sequencemodified_base(8)...(8)m5c 88tccatgangt
tcctgangtt
208915DNAArtificial Sequencemodified_base(7)...(7)m5c 89gcatgangtt gagct
159016DNAArtificial
SequenceSynthetic Sequence 90tccagcgtgc gccata
169118DNAArtificial SequenceSynthetic Sequence
91tctcccagcg tgcgccat
189220DNAArtificial SequenceSynthetic Sequence 92tccatgagct tcctgagtct
209315DNAArtificial
SequenceSynthetic Sequence 93gcatgtcgtt gagct
159419DNAArtificial SequenceSynthetic Sequence
94tcctgacgtt cctgacgtt
199515DNAArtificial SequenceSynthetic Sequence 95gcatgatgtt gagct
159615DNAArtificial
SequenceSynthetic Sequence 96gcatttcgag gagct
159715DNAArtificial SequenceSynthetic Sequence
97gcatgtagct gagct
159820DNAArtificial SequenceSynthetic Sequence 98tccaggacgt tcctagttct
209920DNAArtificial
SequenceSynthetic Sequence 99tccaggagct tcctagttct
2010020DNAArtificial SequenceSynthetic Sequence
100tccaggatgt tcctagttct
2010120DNAArtificial SequenceSynthetic Sequence 101tccagtctag gcctagttct
2010220DNAArtificial
SequenceSynthetic Sequence 102tccagttcga gcctagttct
2010315DNAArtificial SequenceSynthetic Sequence
103gcatggcgtt gagct
1510415DNAArtificial SequenceSynthetic Sequence 104gcatagcgtt gagct
1510515DNAArtificial
SequenceSynthetic Sequence 105gcattgcgtt gagct
1510615DNAArtificial SequenceSynthetic Sequence
106gcttgcgttg cgttt
1510721DNAArtificial SequenceSynthetic Sequence 107tctcccagcg ttgcgccata
t 2110820DNAArtificial
SequenceSynthetic Sequence 108tctcccagcg tgcgttatat
2010920DNAArtificial SequenceSynthetic Sequence
109tctccctgcg tgcgccatat
2011020DNAArtificial SequenceSynthetic Sequence 110tctgcgtgcg tgcgccatat
2011120DNAArtificial
SequenceSynthetic Sequence 111tctcctagcg tgcgccatat
2011220DNAArtificial SequenceSynthetic Sequence
112tctcccagcg tgcgcctttt
2011313DNAArtificial SequenceSynthetic Sequence 113gctandcghh agc
1311413DNAArtificial
SequenceSynthetic Sequence 114tcctgacgtt ccc
1311513DNAArtificial SequenceSynthetic Sequence
115ggaagacgtt aga
1311613DNAArtificial SequenceSynthetic Sequence 116tcctgacgtt aga
1311727DNAArtificial
SequenceSynthetic Sequence 117tcagaccagc tggtcgggtg ttcctga
2711827DNAArtificial SequenceSynthetic Sequence
118tcaggaacac ccgaccagct ggtctga
2711913DNAArtificial SequenceSynthetic Sequence 119gctagtcgat agc
1312013DNAArtificial
SequenceSynthetic Sequence 120gctagtcgct agc
1312114DNAArtificial SequenceSynthetic Sequence
121gcttgacgtc tagc
1412214DNAArtificial SequenceSynthetic Sequence 122gcttgacgtt tagc
1412314DNAArtificial
SequenceSynthetic Sequence 123gcttgacgtc aagc
1412414DNAArtificial SequenceSynthetic Sequence
124gctagacgtt tagc
1412520DNAArtificial SequenceSynthetic Sequence 125tccatgacat tcctgatgct
2012614DNAArtificial
SequenceSynthetic Sequence 126gctagacgtc tagc
1412719DNAArtificial SequenceSynthetic Sequence
127ggctatgtcg ttcctagcc
1912819DNAArtificial SequenceSynthetic Sequence 128ggctatgtcg atcctagcc
1912921DNAArtificial
SequenceSynthetic Sequence 129ctcatgggtt tctccaccaa g
2113021DNAArtificial SequenceSynthetic Sequence
130cttggtggag aaacccatga g
2113120DNAArtificial SequenceSynthetic Sequence 131tccatgacgt tcctagttct
2013224DNAArtificial
SequenceSynthetic Sequence 132ccgcttcctc cagatgagct catg
2413324DNAArtificial SequenceSynthetic Sequence
133catgagctca tctggaggaa gcgg
2413424DNAArtificial SequenceSynthetic Sequence 134ccagatgagc tcatgggttt
ctcc 2413524DNAArtificial
SequenceSynthetic Sequence 135ggagaaaccc atgagctcat ctgg
2413620DNAArtificial SequenceSynthetic Sequence
136agcatcagga acgacatgga
2013720DNAArtificial SequenceSynthetic Sequence 137tccatgacgt tcctgacgtt
2013819DNAArtificial
SequenceSynthetic Sequence 138gcgcgcgcgc gcgcgcgcg
1913920DNAArtificial SequenceSynthetic Sequence
139ccggccggcc ggccggccgg
2014043DNAArtificial SequenceSynthetic Sequence 140ttccaatcag ccccacccgc
tctggcccca ccctcaccct cca 4314143DNAArtificial
SequenceSynthetic Sequence 141tggagggtga gggtggggcc agagcgggtg gggctgattg
gaa 4314227DNAArtificial SequenceSynthetic Sequence
142tcaaatgtgg gattttccca tgagtct
2714327DNAArtificial SequenceSynthetic Sequence 143agactcatgg gaaaatccca
catttga 2714427DNAArtificial
SequenceSynthetic Sequence 144tgccaagtgc tgagtcacta ataaaga
2714527DNAArtificial SequenceSynthetic Sequence
145tctttattag tgactcagca cttggca
2714631DNAArtificial SequenceSynthetic Sequence 146tgcaggaagt ccgggttttc
cccaaccccc c 3114731DNAArtificial
SequenceSynthetic Sequence 147ggggggttgg ggaaaacccg gacttcctgc a
3114838DNAArtificial SequenceSynthetic Sequence
148ggggactttc cgctggggac tttccagggg gactttcc
3814945DNAArtificial SequenceSynthetic Sequence 149tccatgacgt tcctctccat
gacgttcctc tccatgacgt tcctc 4515045DNAArtificial
SequenceSynthetic Sequence 150gaggaacgtc atggagagga acgtcatgga gaggaacgtc
atgga 4515120DNAArtificial SequenceSynthetic Sequence
151ataatagagc ttcaagcaag
2015220DNAArtificial SequenceSynthetic Sequence 152tccatgacgt tcctgacgtt
2015320DNAArtificial
SequenceSynthetic Sequence 153tccatgacgt tcctgacgtt
2015420DNAArtificial SequenceSynthetic Sequence
154tccaggactt tcctcaggtt
2015545DNAArtificial SequenceSynthetic Sequence 155tcttgcgatg ctaaaggacg
tcacattgca caatcttaat aaggt 4515645DNAArtificial
SequenceSynthetic Sequence 156accttattaa gattgtgcaa tgtgacgtcc tttagcatcg
caaga 4515728DNAArtificial SequenceSynthetic Sequence
157tcctgacgtt cctggcggtc ctgtcgct
2815819DNAArtificial SequenceSynthetic Sequence 158tcctgtcgct cctgtcgct
1915915DNAArtificial
SequenceSynthetic Sequence 159tcctgacgtt gaagt
1516015DNAArtificial SequenceSynthetic Sequence
160tcctgtcgtt gaagt
1516115DNAArtificial SequenceSynthetic Sequence 161tcctggcgtt gaagt
1516215DNAArtificial
SequenceSynthetic Sequence 162tcctgccgtt gaagt
1516315DNAArtificial SequenceSynthetic Sequence
163tccttacgtt gaagt
1516415DNAArtificial SequenceSynthetic Sequence 164tcctaacgtt gaagt
1516515DNAArtificial
SequenceSynthetic Sequence 165tcctcacgtt gaagt
1516615DNAArtificial SequenceSynthetic Sequence
166tcctgacgat gaagt
1516715DNAArtificial SequenceSynthetic Sequence 167tcctgacgct gaagt
1516815DNAArtificial
SequenceSynthetic Sequence 168tcctgacggt gaagt
1516915DNAArtificial SequenceSynthetic Sequence
169tcctgacgta gaagt
1517015DNAArtificial SequenceSynthetic Sequence 170tcctgacgtc gaagt
1517115DNAArtificial
SequenceSynthetic Sequence 171tcctgacgtg gaagt
1517215DNAArtificial SequenceSynthetic Sequence
172tcctgagctt gaagt
1517315DNAArtificial SequenceSynthetic Sequence 173gggggacgtt ggggg
1517415DNAArtificial
SequenceSynthetic Sequence 174tcctgacgtt ccttc
1517522DNAArtificial SequenceSynthetic Sequence
175tctcccagcg agcgagcgcc at
2217632DNAArtificial SequenceSynthetic Sequence 176tcctgacgtt cccctggcgg
tcccctgtcg ct 3217728DNAArtificial
SequenceSynthetic Sequence 177tcctgtcgct cctgtcgctc ctgtcgct
2817815DNAArtificial SequenceSynthetic Sequence
178tcctggcggg gaagt
1517915DNAArtificial Sequencemodified_base(7)...(7)m5c 179tcctgangtt
gaagt
1518015DNAArtificial Sequencemodified_base(3)...(3)m5c 180tcntgacgtt
gaagt
1518115DNAArtificial SequenceSynthetic Sequence 181tcctagcgtt gaagt
1518215DNAArtificial
SequenceSynthetic Sequence 182tccagacgtt gaagt
1518315DNAArtificial SequenceSynthetic Sequence
183tcctgacggg gaagt
1518415DNAArtificial SequenceSynthetic Sequence 184tcctggcggt gaagt
1518527DNAArtificial
SequenceSynthetic Sequence 185ggctccgggg agggaatttt tgtctat
2718627DNAArtificial SequenceSynthetic Sequence
186atagacaaaa attccctccc cggagcc
2718721DNAArtificial SequenceSynthetic Sequence 187tccatgagct tccttgagtc
t 2118821DNAArtificial
SequenceSynthetic Sequence 188tcgtcgctgt ctccgcttct t
2118921DNAArtificial SequenceSynthetic Sequence
189tcgtcgctgt ctccgcttct t
2119023DNAArtificial SequenceSynthetic Sequence 190tcgagacatt gcacaatcat
ctg 2319120DNAArtificial
SequenceSynthetic Sequence 191cagattgtgc aatgtctcga
2019220DNAArtificial SequenceSynthetic Sequence
192tccatgtcgt tcctgatgcg
2019320DNAArtificial SequenceSynthetic Sequence 193gcgatgtcgt tcctgatgct
2019420DNAArtificial
SequenceSynthetic Sequence 194gcgatgtcgt tcctgatgcg
2019520DNAArtificial SequenceSynthetic Sequence
195tccatgtcgt tccgcgcgcg
2019620DNAArtificial SequenceSynthetic Sequence 196tccatgtcgt tcctgccgct
2019720DNAArtificial
SequenceSynthetic Sequence 197tccatgtcgt tcctgtagct
2019820DNAArtificial SequenceSynthetic Sequence
198gcggcgggcg gcgcgcgccc
2019921DNAArtificial SequenceSynthetic Sequence 199atcaggaacg tcatgggaag
c 2120020DNAArtificial
SequenceSynthetic Sequence 200tccatgagct tcctgagtct
202018DNAArtificial SequenceSynthetic Sequence
201tcaacgtt
82028DNAArtificial SequenceSynthetic Sequence 202tcaagctt
820319DNAArtificial
SequenceSynthetic Sequence 203tcctgtcgtt cctgtcgtt
1920420DNAArtificial SequenceSynthetic Sequence
204tccatgtcgt ttttgtcgtt
2020520DNAArtificial SequenceSynthetic Sequence 205tcctgtcgtt ccttgtcgtt
2020620DNAArtificial
SequenceSynthetic Sequence 206tccttgtcgt tcctgtcgtt
2020729DNAArtificial
Sequencemisc_feature(1)...(3)Conjugated to biotin moiety. 207tccattccat
gacgttcctg atgcttcca
2920820DNAArtificial SequenceSynthetic Sequence 208tcctgtcgtt ttttgtcgtt
2020921DNAArtificial
SequenceSynthetic Sequence 209tcgtcgctgt ctccgcttct t
2121021DNAArtificial SequenceSynthetic Sequence
210tcgtcgctgt ctgcccttct t
2121121DNAArtificial SequenceSynthetic Sequence 211tcgtcgctgt tgtcgtttct
t 2121230DNAArtificial
SequenceSynthetic Sequence 212tcctgtcgtt cctgtcgttg gaacgacagg
3021340DNAArtificial SequenceSynthetic Sequence
213tcctgtcgtt cctgtcgttt caacgtcagg aacgacagga
4021421DNAArtificial SequenceSynthetic Sequence 214ggggtctgtc gttttggggg
g 2121521DNAArtificial
SequenceSynthetic Sequence 215ggggtctgtg cttttggggg g
2121615DNAArtificial SequenceSynthetic Sequence
216tccggccgtt gaagt
1521715DNAArtificial SequenceSynthetic Sequence 217tccggacggt gaagt
1521815DNAArtificial
SequenceSynthetic Sequence 218tcccgccgtt gaagt
1521915DNAArtificial SequenceSynthetic Sequence
219tccagacggt gaagt
1522015DNAArtificial SequenceSynthetic Sequence 220tcccgacggt gaagt
1522115DNAArtificial
SequenceSynthetic Sequence 221tccagagctt gaagt
1522220DNAArtificial
Sequencemodified_base(8)...(8)m5c 222tccatgtngt tcctgtngtt
2022320DNAArtificial SequenceSynthetic
Sequence 223tccatgacgt tcctgacgtt
2022420DNAArtificial SequenceSynthetic Sequence 224ggggttgacg
ttttgggggg
2022520DNAArtificial SequenceSynthetic Sequence 225tccaggactt ctctcaggtt
2022620DNAArtificial
SequenceSynthetic Sequence 226tttttttttt tttttttttt
2022720DNAArtificial SequenceSynthetic Sequence
227tccatgccgt tcctgccgtt
2022820DNAArtificial SequenceSynthetic Sequence 228tccatggcgg gcctggcggg
2022920DNAArtificial
SequenceSynthetic Sequence 229tccatgacgt tcctgccgtt
2023020DNAArtificial SequenceSynthetic Sequence
230tccatgacgt tcctggcggg
2023120DNAArtificial SequenceSynthetic Sequence 231tccatgacgt tcctgcgttt
2023220DNAArtificial
SequenceSynthetic Sequence 232tccatgacgg tcctgacggt
2023320DNAArtificial SequenceSynthetic Sequence
233tccatgcgtg cgtgcgtttt
2023420DNAArtificial SequenceSynthetic Sequence 234tccatgcgtt gcgttgcgtt
2023530DNAArtificial
Sequencemisc_feature(1)...(3)Conjugated to biotin moiety. 235tccattccat
tctaggcctg agtcttccat
3023620DNAArtificial SequenceSynthetic Sequence 236tccatagcgt tcctagcgtt
2023720DNAArtificial
SequenceSynthetic Sequence 237tccatgtcgt tcctgtcgtt
2023820DNAArtificial SequenceSynthetic Sequence
238tccatagcga tcctagcgat
2023920DNAArtificial SequenceSynthetic Sequence 239tccattgcgt tccttgcgtt
2024020DNAArtificial
SequenceSynthetic Sequence 240tccatagcgg tcctagcggt
2024129DNAArtificial SequenceSynthetic Sequence
241tccatgattt tcctgcagtt cctgatttt
2924229DNAArtificial SequenceSynthetic Sequence 242tccatgacgt tcctgcagtt
cctgacgtt 2924320DNAArtificial
SequenceSynthetic Sequence 243ggcggcggcg gcggcggcgg
2024420DNAArtificial SequenceSynthetic Sequence
244tccacgacgt tttcgacgtt
2024520DNAArtificial SequenceSynthetic Sequence 245tcgtcgttgt cgttgtcgtt
2024624DNAArtificial
SequenceSynthetic Sequence 246tcgtcgtttt gtcgttttgt cgtt
2424722DNAArtificial SequenceSynthetic Sequence
247tcgtcgttgt cgttttgtcg tt
2224821DNAArtificial SequenceSynthetic Sequence 248gcgtgcgttg tcgttgtcgt
t 2124919DNAArtificial
SequenceSynthetic Sequence 249cnggcnggcn gggcnccgg
1925020DNAArtificial SequenceSynthetic Sequence
250gcggcgggcg gcgcgcgccc
2025120DNAArtificial SequenceSynthetic Sequence 251agncccgnga acgnattcac
2025221DNAArtificial
SequenceSynthetic Sequence 252tgtcgtttgt cgtttgtcgt t
2125325DNAArtificial SequenceSynthetic Sequence
253tgtcgttgtc gttgtcgttg tcgtt
2525425DNAArtificial SequenceSynthetic Sequence 254tgtcgttgtc gttgtcgttg
tcgtt 2525514DNAArtificial
SequenceSynthetic Sequence 255tcgtcgtcgt cgtt
1425613DNAArtificial SequenceSynthetic Sequence
256tgtcgttgtc gtt
1325720DNAArtificial SequenceSynthetic Sequence 257cccccccccc cccccccccc
2025820DNAArtificial
SequenceSynthetic Sequence 258tctagcgttt ttagcgttcc
2025920DNAArtificial SequenceSynthetic Sequence
259tgcatccccc aggccaccat
2026023DNAArtificial SequenceSynthetic Sequence 260tcgtcgtcgt cgtcgtcgtc
gtt 2326120DNAArtificial
SequenceSynthetic Sequence 261tcgtcgttgt cgttgtcgtt
2026224DNAArtificial SequenceSynthetic Sequence
262tcgtcgtttt gtcgttttgt cgtt
2426322DNAArtificial SequenceSynthetic Sequence 263tcgtcgttgt cgttttgtcg
tt 2226439DNAArtificial
SequenceSynthetic Sequence 264ggggagggag gaacttctta aaattccccc agaatgttt
3926539DNAArtificial SequenceSynthetic Sequence
265aaacattctg ggggaatttt aagaagttcc tccctcccc
3926633DNAArtificial SequenceSynthetic Sequence 266atgtttactt cttaaaattc
ccccagaatg ttt 3326733DNAArtificial
SequenceSynthetic Sequence 267aaacattctg ggggaatttt aagaagtaaa cat
3326833DNAArtificial SequenceSynthetic Sequence
268atgtttacta gacaaaattc ccccagaatg ttt
3326933DNAArtificial SequenceSynthetic Sequence 269aaacattctg ggggaatttt
gtctagtaaa cat 3327020DNAArtificial
SequenceSynthetic Sequence 270aaaattgacg ttttaaaaaa
2027120DNAArtificial SequenceSynthetic Sequence
271ccccttgacg ttttcccccc
2027220DNAArtificial SequenceSynthetic Sequence 272ttttcgttgt ttttgtcgtt
2027324DNAArtificial
SequenceSynthetic Sequence 273tcgtcgtttt gtcgttttgt cgtt
2427414DNAArtificial SequenceSynthetic Sequence
274ctgcagcctg ggac
1427525DNAArtificial SequenceSynthetic Sequence 275acccgtcgta attatagtaa
aaccc 2527621DNAArtificial
SequenceSynthetic Sequence 276ggtacctgtg gggacattgt g
2127718DNAArtificial SequenceSynthetic Sequence
277agcaccgaac gtgagagg
1827820DNAArtificial SequenceSynthetic Sequence 278tccatgccgt tcctgccgtt
2027920DNAArtificial
SequenceSynthetic Sequence 279tccatgacgg tcctgacggt
2028020DNAArtificial SequenceSynthetic Sequence
280tccatgccgg tcctgccggt
2028120DNAArtificial SequenceSynthetic Sequence 281tccatgcgcg tcctgcgcgt
2028224DNAArtificial
SequenceSynthetic Sequence 282ctggtctttc tggttttttt ctgg
2428320DNAArtificial SequenceSynthetic Sequence
283tcaggggtgg ggggaacctt
2028420DNAArtificial Sequencemodified_base(8)...(8)m5c 284tccatgangt
tcctagttct
2028520DNAArtificial SequenceSynthetic Sequence 285tccatgatgt tcctagttct
2028626DNAArtificial
SequenceSynthetic Sequence 286cccgaagtca tttcctctta acctgg
2628726DNAArtificial SequenceSynthetic Sequence
287ccaggttaag aggaaatgac ttcggg
2628815DNAArtificial Sequencemodified_base(7)...(7)m5c 288tcctggnggg
gaagt
1528920DNAArtificial Sequencemodified_base(2)...(2)m5c 289gnggngggng
gngngngccc
2029020DNAArtificial SequenceSynthetic Sequence 290tccatgtgct tcctgatgct
2029120DNAArtificial
SequenceSynthetic Sequence 291tccatgtcct tcctgatgct
2029220DNAArtificial SequenceSynthetic Sequence
292tccatgtcgt tcctagttct
2029320DNAArtificial SequenceSynthetic Sequence 293tccaagtagt tcctagttct
2029420DNAArtificial
SequenceSynthetic Sequence 294tccatgtagt tcctagttct
2029520DNAArtificial SequenceSynthetic Sequence
295tcccgcgcgt tccgcgcgtt
2029620DNAArtificial SequenceSynthetic Sequence 296tcctggcggt cctggcggtt
2029715DNAArtificial
SequenceSynthetic Sequence 297tcctggaggg gaagt
1529815DNAArtificial SequenceSynthetic Sequence
298tcctgggggg gaagt
1529915DNAArtificial SequenceSynthetic Sequence 299tcctggtggg gaagt
1530024DNAArtificial
SequenceSynthetic Sequence 300tcgtcgtttt gtcgttttgt cgtt
2430124DNAArtificial SequenceSynthetic Sequence
301ctggtctttc tggttttttt ctgg
2430220DNAArtificial SequenceSynthetic Sequence 302tccatgacgt tcctgacgtt
2030320DNAArtificial
SequenceSynthetic Sequence 303tccaggactt ctctcaggtt
2030424DNAArtificial SequenceSynthetic Sequence
304tngtngtttt gtngttttgt ngtt
2430529DNAArtificial Sequencemisc_feature(1)...(3)Conjugated to biotin
moiety. 305tcgtcgtttt gtcgttttgt cgttttttt
2930618DNAArtificial SequenceSynthetic Sequence 306gctatgacgt
tccaaggg
183078DNAArtificial SequenceSynthetic Sequence 307tcaacgtt
830820DNAArtificial
SequenceSynthetic Sequence 308tccaggactt tcctcaggtt
2030920DNAArtificial SequenceSynthetic Sequence
309ctctctgtag gcccgcttgg
2031020DNAArtificial SequenceSynthetic Sequence 310ctttccgttg gacccctggg
2031120DNAArtificial
SequenceSynthetic Sequence 311gtccgggcca ggccaaagtc
2031220DNAArtificial SequenceSynthetic Sequence
312gtgcgcgcga gcccgaaatc
2031320DNAArtificial Sequencemodified_base(8)...(8)I 313tccatgangt
tcctgangtt
2031420DNAArtificial SequenceSynthetic Sequence 314aatagtcgcc ataacaaaac
2031520DNAArtificial
SequenceSynthetic Sequence 315aatagtcgcc atggcggggc
2031628DNAArtificial
Sequencemisc_difference(1)...(3)Biotin moiety attached at 5' end of
sequence. 316tttttccatg tcgttcctga tgcttttt
2831720DNAArtificial SequenceSynthetic Sequence 317tcctgtcgtt
gaagtttttt
2031824DNAArtificial SequenceSynthetic Sequence 318gctagcttta gagctttaga
gctt 2431920DNAArtificial
SequenceSynthetic Sequence 319tgctgcttcc cccccccccc
2032020DNAArtificial SequenceSynthetic Sequence
320tcgacgttcc cccccccccc
2032120DNAArtificial SequenceSynthetic Sequence 321tcgtcgttcc cccccccccc
2032220DNAArtificial
SequenceSynthetic Sequence 322tcgtcgttcc cccccccccc
2032320DNAArtificial SequenceSynthetic Sequence
323tcgccgttcc cccccccccc
2032420DNAArtificial SequenceSynthetic Sequence 324tcgtcgatcc cccccccccc
2032515DNAArtificial
SequenceSynthetic Sequence 325tcctgacgtt gaagt
1532615DNAArtificial SequenceSynthetic Sequence
326tcctgccgtt gaagt
1532715DNAArtificial SequenceSynthetic Sequence 327tcctgacggt gaagt
1532815DNAArtificial
SequenceSynthetic Sequence 328tcctgagctt gaagt
1532915DNAArtificial SequenceSynthetic Sequence
329tcctggcggg gaagt
1533021DNAArtificial SequenceSynthetic Sequence 330aaaatctgtg cttttaaaaa
a 2133133DNAArtificial
SequenceSynthetic Sequence 331gatccagtca cagtgacctg gcagaatctg gat
3333233DNAArtificial SequenceSynthetic Sequence
332gatccagatt ctgccaggtc actgtgactg gat
3333333DNAArtificial SequenceSynthetic Sequence 333gatccagtca cagtgactca
gcagaatctg gat 3333433DNAArtificial
SequenceSynthetic Sequence 334gatccagatt ctgctgagtc actgtgactg gat
3333520DNAArtificial
Sequencemodified_base(16)...(16)m5c 335tcgtcgttcc cccccncccc
2033620DNAArtificial
Sequencemodified_base(2)...(2)m5c 336tngtngttcc cccccccccc
2033720DNAArtificial
Sequencemodified_base(2)...(2)m5c 337tngtcgttcc cccccccccc
2033820DNAArtificial
Sequencemodified_base(5)...(5)m5c 338tcgtngttcc cccccccccc
2033920DNAArtificial SequenceSynthetic
Sequence 339tcgtcgctcc cccccccccc
2034020DNAArtificial SequenceSynthetic Sequence 340tcgtcggtcc
cccccccccc
2034120DNAArtificial SequenceSynthetic Sequence 341tcggcgttcc cccccccccc
2034220DNAArtificial
SequenceSynthetic Sequence 342ggccttttcc cccccccccc
2034324DNAArtificial SequenceSynthetic Sequence
343tcgtcgtttt gacgttttgt cgtt
2434424DNAArtificial SequenceSynthetic Sequence 344tcgtcgtttt gacgttttga
cgtt 2434520DNAArtificial
SequenceSynthetic Sequence 345ccgtcgttcc cccccccccc
2034620DNAArtificial SequenceSynthetic Sequence
346gcgtcgttcc cccccccccc
2034720DNAArtificial SequenceSynthetic Sequence 347tcgtcattcc cccccccccc
2034820DNAArtificial
SequenceSynthetic Sequence 348acgtcgttcc cccccccccc
2034920DNAArtificial SequenceSynthetic Sequence
349ctgtcgttcc cccccccccc
2035024DNAArtificial Sequencemisc_feature(1)...(3)Biotin moiety attached
at 5' end of sequence. 350tttttcgtcg ttcccccccc cccc
2435120DNAArtificial
Sequencemisc_feature(18)...(20)Biotin moiety attached at 3' end of
sequence. 351tcgtcgttcc cccccccccc
2035224DNAArtificial Sequencemisc_feature(22)...(24)Biotin
moiety attached at 3' end of sequence. 352tcgtcgtttt gtcgttttgt cgtt
2435320DNAArtificial
SequenceSynthetic Sequence 353tccagttcct tcctcagtct
2035424DNAArtificial
Sequencemodified_base(2)...(2)m5c 354tngtcgtttt gtcgttttgt cgtt
2435515DNAArtificial SequenceSynthetic
Sequence 355tcctggaggg gaagt
1535615DNAArtificial SequenceSynthetic Sequence 356tcctgaaaag
gaagt
1535717DNAArtificial SequenceSynthetic Sequence 357tcgtcgttcc ccccccc
1735824DNAArtificial
SequenceSynthetic Sequence 358tngtngtttt gtngttttgt ngtt
2435920DNAArtificial SequenceSynthetic Sequence
359ggggtcaagc ttgagggggg
2036020DNAArtificial SequenceSynthetic Sequence 360tgctgcttcc cccccccccc
2036114DNAArtificial
SequenceSynthetic Sequence 361tcgtcgtcgt cgtt
1436214DNAArtificial SequenceSynthetic Sequence
362tcgtcgtcgt cgtt
1436314DNAArtificial SequenceSynthetic Sequence 363tcgtcgtcgt cgtt
1436410DNAArtificial
SequenceSynthetic Sequence 364tcaacgttga
103658DNAArtificial SequenceSynthetic Sequence
365tcaacgtt
836620DNAArtificial SequenceSynthetic Sequence 366atagttttcc atttttttac
2036720DNAArtificial
SequenceSynthetic Sequence 367aatagtcgcc atcgcgcgac
2036820DNAArtificial SequenceSynthetic Sequence
368aatagtcgcc atcccgggac
2036920DNAArtificial SequenceSynthetic Sequence 369aatagtcgcc atcccccccc
2037024DNAArtificial
SequenceSynthetic Sequence 370tgctgctttt gtgcttttgt gctt
2437124DNAArtificial SequenceSynthetic Sequence
371ctgtgctttc tgtgtttttc tgtg
2437224DNAArtificial SequenceSynthetic Sequence 372ctaatctttc taattttttt
ctaa 2437326DNAArtificial
SequenceSynthetic Sequence 373tcgtcgttgg tgtcgttggt gtcgtt
2637424DNAArtificial SequenceSynthetic Sequence
374tcgtcgttgg ttgtcgtttt ggtt
2437524DNAArtificial SequenceSynthetic Sequence 375accatggacg agctgtttcc
cctc 2437620DNAArtificial
SequenceSynthetic Sequence 376tcgtcgtttt gcgtgcgttt
2037720DNAArtificial SequenceSynthetic Sequence
377ctgtaagtga gcttggagag
2037818DNAArtificial SequenceSynthetic Sequence 378gagaacgctg gaccttcc
1837920DNAArtificial
SequenceSynthetic Sequence 379cgggcgactc agtctatcgg
2038037DNAArtificial SequenceSynthetic Sequence
380gttctcagat aaagcggaac cagcaacaga cacagaa
3738137DNAArtificial SequenceSynthetic Sequence 381ttctgtgtct gttgctggtt
ccgctttatc tgagaac 3738223DNAArtificial
SequenceSynthetic Sequence 382cagacacaga agcccgatag acg
2338320DNAArtificial SequenceSynthetic Sequence
383agacagacac gaaacgaccg
2038420DNAArtificial SequenceSynthetic Sequence 384gtctgtccca tgatctcgaa
2038520DNAArtificial
SequenceSynthetic Sequence 385gctggccagc ttacctcccg
2038621DNAArtificial SequenceSynthetic Sequence
386ggggcctcta tacaacctgg g
2138718DNAArtificial SequenceSynthetic Sequence 387ggggtccctg agactgcc
1838820DNAArtificial
SequenceSynthetic Sequence 388gagaacgctg gaccttccat
2038920DNAArtificial SequenceSynthetic Sequence
389tccatgtcgg tcctgatgct
2039020DNAArtificial SequenceSynthetic Sequence 390ctcttgcgac ctggaaggta
2039120DNAArtificial
SequenceSynthetic Sequence 391aggtacagcc aggactacga
2039224DNAArtificial SequenceSynthetic Sequence
392accatggacg acctgtttcc cctc
2439324DNAArtificial SequenceSynthetic Sequence 393accatggatt acctttttcc
cctt 2439420DNAArtificial
SequenceSynthetic Sequence 394atggaaggtc cagcgttctc
2039520DNAArtificial SequenceSynthetic Sequence
395agcatcagga ccgacatgga
2039620DNAArtificial SequenceSynthetic Sequence 396ctctccaagc tcacttacag
2039721DNAArtificial
SequenceSynthetic Sequence 397tccctgagac tgccccacct t
2139820DNAArtificial SequenceSynthetic Sequence
398gccaccaaaa cttgtccatg
2039920DNAArtificial SequenceSynthetic Sequence 399gtccatggcg tgcgggatga
2040019DNAArtificial
SequenceSynthetic Sequence 400cctctataca acctgggac
1940120DNAArtificial SequenceSynthetic Sequence
401cgggcgactc agtctatcgg
2040220DNAArtificial SequenceSynthetic Sequence 402gcgctaccgg tagcctgagt
2040335DNAArtificial
SequenceSynthetic Sequence 403cgactgccga acaggatatc ggtgatcagc actgg
3540435DNAArtificial SequenceSynthetic Sequence
404ccagtgctga tcaccgatat cctgttcggc agtcg
3540517DNAArtificial SequenceSynthetic Sequence 405ccaggttgta tagaggc
1740618DNAArtificial
SequenceSynthetic Sequence 406tctcccagcg tacgccat
1840718DNAArtificial SequenceSynthetic Sequence
407tctcccagcg tgcgtttt
1840818DNAArtificial SequenceSynthetic Sequence 408tctcccgacg tgcgccat
1840918DNAArtificial
SequenceSynthetic Sequence 409tctcccgtcg tgcgccat
1841020DNAArtificial SequenceSynthetic Sequence
410ataatcgtcg ttcaagcaag
2041123DNAArtificial SequenceSynthetic Sequence 411tcgtcgtttt gtcgttttgt
cgt 2341224DNAArtificial
SequenceSynthetic Sequence 412tcgtcgtttt gtcgttttgt cgtt
2441324DNAArtificial SequenceSynthetic Sequence
413tcgtcgtttt gtcgttttgt cgtt
2441424DNAArtificial Sequencemisc_difference(3)...(3)n is a or c or g or
t/u 414tcntcgtntt ntcgtnttnt cgtn
2441517DNAArtificial SequenceSynthetic Sequence 415tctcccagcg tcgccat
1741617DNAArtificial
SequenceSynthetic Sequence 416tctcccatcg tcgccat
1741721DNAArtificial SequenceSynthetic Sequence
417ataatcgtgc gttcaagaaa g
2141820DNAArtificial SequenceSynthetic Sequence 418ataatcgacg ttcccccccc
2041920DNAArtificial
SequenceSynthetic Sequence 419tctatcgacg ttcaagcaag
2042014DNAArtificial SequenceSynthetic Sequence
420tcctgacggg gagt
1442119DNAArtificial SequenceSynthetic Sequence 421tccatgacgt tcctgatcc
1942219DNAArtificial
SequenceSynthetic Sequence 422tccatgacgt tcctgatcc
1942319DNAArtificial SequenceSynthetic Sequence
423tccatgacgt tcctgatcc
1942415DNAArtificial SequenceSynthetic Sequence 424tcctggcgtg gaagt
1542519DNAArtificial
SequenceSynthetic Sequence 425tccatgacgt tcctgatcc
1942621DNAArtificial SequenceSynthetic Sequence
426tcgtcgctgt tgtcgtttct t
2142724DNAArtificial SequenceSynthetic Sequence 427agcagcttta gagctttaga
gctt 2442824DNAArtificial
SequenceSynthetic Sequence 428cccccccccc cccccccccc cccc
2442932DNAArtificial SequenceSynthetic Sequence
429tcgtcgtttt gtcgttttgt cgttttgtcg tt
3243028DNAArtificial SequenceSynthetic Sequence 430tcgtcgtttt ttgtcgtttt
ttgtcgtt 2843120DNAArtificial
SequenceSynthetic Sequence 431tcgtcgtttt tttttttttt
2043220DNAArtificial SequenceSynthetic Sequence
432tttttcaacg ttgatttttt
2043324DNAArtificial SequenceSynthetic Sequence 433tttttttttt tttttttttt
tttt 2443420DNAArtificial
SequenceSynthetic Sequence 434ggggtcgtcg ttttgggggg
2043524DNAArtificial SequenceSynthetic Sequence
435tcgtcgtttt gtcgttttgg gggg
2443627DNAArtificial SequenceSynthetic Sequence 436tcgtcgctgt ctccgcttct
tcttgcc 2743715DNAArtificial
SequenceSynthetic Sequence 437tcgtcgctgt ctccg
1543820DNAArtificial SequenceSynthetic Sequence
438ctgtaagtga gcttggagag
2043920DNAArtificial SequenceSynthetic Sequence 439gagaacgctg gaccttccat
2044017DNAArtificial
SequenceSynthetic Sequence 440ccaggttgta tagaggc
1744117DNAArtificial SequenceSynthetic Sequence
441gctagacgtt agcgtga
1744220DNAArtificial SequenceSynthetic Sequence 442ggagctcttc gaacgccata
2044320DNAArtificial
SequenceSynthetic Sequence 443tctccatgat ggttttatcg
2044421DNAArtificial SequenceSynthetic Sequence
444aaggtggggc agtctcaggg a
2144520DNAArtificial SequenceSynthetic Sequence 445atcggaggac tggcgcgccg
2044620DNAArtificial
SequenceSynthetic Sequence 446ttaggacaag gtctagggtg
2044720DNAArtificial SequenceSynthetic Sequence
447accacaacga gaggaacgca
2044820DNAArtificial SequenceSynthetic Sequence 448ggcagtgcag gctcaccggg
2044917DNAArtificial
SequenceSynthetic Sequence 449gaaccttcca tgctgtt
1745017DNAArtificial SequenceSynthetic Sequence
450gctagacgtt agcgtga
1745120DNAArtificial SequenceSynthetic Sequence 451gcttggaggg cctgtaagtg
2045212DNAArtificial
SequenceSynthetic Sequence 452gtagccttcc ta
1245314DNAArtificial SequenceSynthetic Sequence
453cggtagcctt ccta
1445416DNAArtificial SequenceSynthetic Sequence 454cacggtagcc ttccta
1645518DNAArtificial
SequenceSynthetic Sequence 455agcacggtag ccttccta
1845618DNAArtificial SequenceSynthetic Sequence
456gaacgctgga ccttccat
1845710DNAArtificial SequenceSynthetic Sequence 457gaccttccat
1045812DNAArtificial
SequenceSynthetic Sequence 458tggaccttcc at
1245914DNAArtificial SequenceSynthetic Sequence
459gctggacctt ccat
1446016DNAArtificial SequenceSynthetic Sequence 460acgctggacc ttccat
1646120DNAArtificial
SequenceSynthetic Sequence 461taagctctgt caacgccagg
2046222DNAArtificial SequenceSynthetic Sequence
462gagaacgctg gaccttccat gt
2246320DNAArtificial SequenceSynthetic Sequence 463tccatgtcgg tcctgatgct
2046421DNAArtificial
SequenceSynthetic Sequence 464ttcatgcctt gcaaaatggc g
2146520DNAArtificial SequenceSynthetic Sequence
465tgctagctgt gcctgtacct
2046620DNAArtificial SequenceSynthetic Sequence 466agcatcagga ccgacatgga
2046722DNAArtificial
SequenceSynthetic Sequence 467gaccttccat gtcggtcctg at
2246820DNAArtificial SequenceSynthetic Sequence
468acaaccacga gaacgggaac
2046920DNAArtificial SequenceSynthetic Sequence 469gaaccttcca tgctgttccg
2047020DNAArtificial
SequenceSynthetic Sequence 470caatcaatct gaggagaccc
2047120DNAArtificial SequenceSynthetic Sequence
471tcagctctgg tactttttca
2047220DNAArtificial SequenceSynthetic Sequence 472tggttacggt ctgtcccatg
2047320DNAArtificial
SequenceSynthetic Sequence 473gtctatcgga ggactggcgc
2047420DNAArtificial SequenceSynthetic Sequence
474cattttacgg gcgggcgggc
2047520DNAArtificial SequenceSynthetic Sequence 475gaggggacca ttttacgggc
2047620DNAArtificial
SequenceSynthetic Sequence 476tgtccagccg aggggaccat
2047720DNAArtificial SequenceSynthetic Sequence
477cgggcttacg gcggatgctg
2047820DNAArtificial SequenceSynthetic Sequence 478tggaccttct atgtcggtcc
2047920DNAArtificial
SequenceSynthetic Sequence 479tgtcccatgt ttttagaagc
2048020DNAArtificial SequenceSynthetic Sequence
480gtggttacgg tcgtgcccat
2048120DNAArtificial SequenceSynthetic Sequence 481cctccaaatg aaagaccccc
2048220DNAArtificial
SequenceSynthetic Sequence 482ttgtactctc catgatggtt
2048320DNAArtificial SequenceSynthetic Sequence
483ttccatgctg ttccggctgg
2048420DNAArtificial SequenceSynthetic Sequence 484gaccttctat gtcggtcctg
2048520DNAArtificial
SequenceSynthetic Sequence 485gagaccgctc gaccttcgat
2048620DNAArtificial SequenceSynthetic Sequence
486ttgccccata ttttagaaac
2048718DNAArtificial SequenceSynthetic Sequence 487ttgaaactga ggtgggac
1848821DNAArtificial
SequenceSynthetic Sequence 488ctatcggagg actggcgcgc c
2148920DNAArtificial SequenceSynthetic Sequence
489cttggagggc ctcccggcgg
2049020DNAArtificial SequenceSynthetic Sequence 490gctgaacctt ccatgctgtt
2049132DNAArtificial
SequenceSynthetic Sequence 491tagaaacagc attcttcttt tagggcagca ca
3249224DNAArtificial SequenceSynthetic Sequence
492agatggttct cagataaagc ggaa
2449324DNAArtificial SequenceSynthetic Sequence 493ttccgcttta tctgagaacc
atct 2449423DNAArtificial
SequenceSynthetic Sequence 494gtcccaggtt gtatagaggc tgc
2349520DNAArtificial SequenceSynthetic Sequence
495gcgccagtcc tccgatagac
2049620DNAArtificial SequenceSynthetic Sequence 496atcggaggac tggcgcgccg
2049720DNAArtificial
SequenceSynthetic Sequence 497ggtctgtccc atatttttag
2049820DNAArtificial SequenceSynthetic Sequence
498tttttcaacg ttgagggggg
2049921DNAArtificial SequenceSynthetic Sequence 499tttttcaagc gttgattttt
t 2150020DNAArtificial
SequenceSynthetic Sequence 500ggggtcaacg ttgatttttt
2050125DNAArtificial SequenceSynthetic Sequence
501ggggttttca acgttttgag ggggg
2550220DNAArtificial SequenceSynthetic Sequence 502ggttacggtc tgtcccatat
2050320DNAArtificial
SequenceSynthetic Sequence 503ctgtcccata tttttagaca
2050420DNAArtificial SequenceSynthetic Sequence
504accatcctga ggccattcgg
2050523DNAArtificial SequenceSynthetic Sequence 505cgtctatcgg gcttctgtgt
ctg 2350621DNAArtificial
SequenceSynthetic Sequence 506ggccatccca cattgaaagt t
2150722DNAArtificial SequenceSynthetic Sequence
507ccaaatatcg gtggtcaagc ac
2250822DNAArtificial SequenceSynthetic Sequence 508gtgcttgacc accgatattt
gg 2250926DNAArtificial
SequenceSynthetic Sequence 509gtgctgatca ccgatatcct gttcgg
2651027DNAArtificial SequenceSynthetic Sequence
510ggccaacttt caatgtggga tggcctc
2751127DNAArtificial SequenceSynthetic Sequence 511ttccgccgaa tggcctcagg
atggtac 2751236DNAArtificial
SequenceSynthetic Sequence 512tatagtccct gagactgccc caccttctca acaacc
3651327DNAArtificial SequenceSynthetic Sequence
513gcagcctcta tacaacctgg gacggga
2751422DNAArtificial SequenceSynthetic Sequence 514ctatcggagg actggcgcgc
cg 2251521DNAArtificial
SequenceSynthetic Sequence 515tatcggagga ctggcgcgcc g
2151621DNAArtificial SequenceSynthetic Sequence
516gatcggagga ctggcgcgcc g
2151726DNAArtificial SequenceSynthetic Sequence 517ccgaacagga tatcggtgat
cagcac 2651824DNAArtificial
SequenceSynthetic Sequence 518ttttggggtc aacgttgagg gggg
2451920DNAArtificial SequenceSynthetic Sequence
519ggggtcaacg ttgagggggg
2052020DNAArtificial SequenceSynthetic Sequence 520cgcgcgcgcg cgcgcgcgcg
2052120DNAArtificial
SequenceSynthetic Sequence 521ggggcatgac gttcgggggg
2052220DNAArtificial SequenceSynthetic Sequence
522ggggcatgac gttcaaaaaa
2052320DNAArtificial SequenceSynthetic Sequence 523ggggcatgag cttcgggggg
2052420DNAArtificial
SequenceSynthetic Sequence 524ggggcatgac gttcgggggg
2052520DNAArtificial SequenceSynthetic Sequence
525aaaacatgac gttcaaaaaa
2052620DNAArtificial SequenceSynthetic Sequence 526aaaacatgac gttcgggggg
2052720DNAArtificial
SequenceSynthetic Sequence 527ggggcatgac gttcaaaaaa
2052824DNAArtificial SequenceSynthetic Sequence
528accatggacg atctgtttcc cctc
2452924DNAArtificial SequenceSynthetic Sequence 529gccatggacg aactgttccc
cctc 2453020DNAArtificial
SequenceSynthetic Sequence 530cccccccccc cccccccccc
2053120DNAArtificial SequenceSynthetic Sequence
531gggggggggg gggggggggg
2053220DNAArtificial SequenceSynthetic Sequence 532gctgtaaaat gaatcggccg
2053320DNAArtificial
SequenceSynthetic Sequence 533ttcgggcgga ctcctccatt
2053420DNAArtificial SequenceSynthetic Sequence
534tatgccgcgc ccggacttat
2053520DNAArtificial SequenceSynthetic Sequence 535ggggtaatcg atcagggggg
2053620DNAArtificial
SequenceSynthetic Sequence 536tttgagaacg ctggaccttc
2053720DNAArtificial SequenceSynthetic Sequence
537gatcgctgat ctaatgctcg
2053820DNAArtificial SequenceSynthetic Sequence 538gtcggtcctg atgctgttcc
2053920DNAArtificial
SequenceSynthetic Sequence 539tcgtcgtcag ttcgctgtcg
2054018DNAArtificial SequenceSynthetic Sequence
540ctggaccttc catgtcgg
1854117DNAArtificial SequenceSynthetic Sequence 541gctcgttcag cgcgtct
1754216DNAArtificial
SequenceSynthetic Sequence 542ctggaccttc catgtc
1654316DNAArtificial SequenceSynthetic Sequence
543cactgtcctt cgtcga
1654420DNAArtificial SequenceSynthetic Sequence 544cgctggacct tccatgtcgg
2054520DNAArtificial
SequenceSynthetic Sequence 545gctgagctca tgccgtctgc
2054620DNAArtificial SequenceSynthetic Sequence
546aacgctggac cttccatgtc
2054720DNAArtificial SequenceSynthetic Sequence 547tgcatgccgt acacagctct
2054820DNAArtificial
SequenceSynthetic Sequence 548ccttccatgt cggtcctgat
2054920DNAArtificial SequenceSynthetic Sequence
549tactcttcgg atcccttgcg
2055018DNAArtificial SequenceSynthetic Sequence 550ttccatgtcg gtcctgat
1855118DNAArtificial
SequenceSynthetic Sequence 551ctgattgctc tctcgtga
1855220DNAArtificial SequenceSynthetic Sequence
552ggcgttattc ctgactcgcc
2055322DNAArtificial SequenceSynthetic Sequence 553cctacgttgt atgcgcccag
ct 2255420DNAArtificial
SequenceSynthetic Sequence 554ggggtaatcg atgagggggg
2055520DNAArtificial SequenceSynthetic Sequence
555ttcgggcgga ctcctccatt
2055620DNAArtificial SequenceSynthetic Sequence 556tttttttttt tttttttttt
2055720DNAArtificial
SequenceSynthetic Sequence 557gggggttttt tttttggggg
2055820DNAArtificial SequenceSynthetic Sequence
558tttttggggg gggggttttt
2055919DNAArtificial SequenceSynthetic Sequence 559gggggggggg ggggggggt
1956020DNAArtificial
SequenceSynthetic Sequence 560aaaaaaaaaa aaaaaaaaaa
2056120DNAArtificial SequenceSynthetic Sequence
561cccccaaaaa aaaaaccccc
2056220DNAArtificial SequenceSynthetic Sequence 562aaaaaccccc cccccaaaaa
2056327DNAArtificial
SequenceSynthetic Sequence 563tttgaattca ggactggtga ggttgag
2756427DNAArtificial SequenceSynthetic Sequence
564tttgaatcct cagcggtctc cagtggc
2756545DNAArtificial SequenceSynthetic Sequence 565aattctctat cggggcttct
gtgtctgttg ctggttccgc tttat 4556645DNAArtificial
SequenceSynthetic Sequence 566ctagataaag cggaaccagc aacagacaca gaagccccga
tagag 4556728DNAArtificial SequenceSynthetic Sequence
567ttttctagag aggtgcacaa tgctctgg
2856829DNAArtificial SequenceSynthetic Sequence 568tttgaattcc gtgtacagaa
gcgagaagc 2956931DNAArtificial
SequenceSynthetic Sequence 569tttgcggccg ctagacttaa cctgagagat a
3157029DNAArtificial SequenceSynthetic Sequence
570tttgggccca cgagagacag agacacttc
2957129DNAArtificial SequenceSynthetic Sequence 571tttgggcccg cttctcgctt
ctgtacacg 2957220DNAArtificial
SequenceSynthetic Sequence 572gagaacgctg gaccttccat
2057320DNAArtificial SequenceSynthetic Sequence
573tccatgtcgg tcctgatgct
205746DNAArtificial SequenceSynthetic Sequence 574ctgtcg
65756DNAArtificial
SequenceSynthetic Sequence 575tcgtga
65766DNAArtificial SequenceSynthetic Sequence
576cgtcga
65776DNAArtificial SequenceSynthetic Sequence 577agtgct
65786DNAArtificial
SequenceSynthetic Sequence 578ctgtcg
65796DNAArtificial SequenceSynthetic Sequence
579agtgct
65806DNAArtificial SequenceSynthetic Sequence 580cgtcga
65816DNAArtificial
SequenceSynthetic Sequence 581tcgtga
658220DNAArtificial SequenceSynthetic Sequence
582gagaacgctc cagcttcgat
2058317DNAArtificial SequenceSynthetic Sequence 583gctagacgta agcgtga
1758420DNAArtificial
SequenceSynthetic Sequence 584gagaacgctc gaccttccat
2058521DNAArtificial SequenceSynthetic Sequence
585gagaacgctg gacctatcca t
2158617DNAArtificial SequenceSynthetic Sequence 586gctagaggtt agcgtga
1758719DNAArtificial
SequenceSynthetic Sequence 587gagaacgctg gacttccat
1958817DNAArtificial SequenceSynthetic Sequence
588tcacgctaac gtctagc
1758917DNAArtificial Sequencemisc_feature(1)...(3)Conjugated to biotin
moiety. 589gctagacgtt agcgtga
1759020DNAArtificial SequenceSynthetic Sequence 590atggaaggtc
gagcgttctc
2059120DNAArtificial SequenceSynthetic Sequence 591gagaacgctg gaccttcgat
2059220DNAArtificial
SequenceSynthetic Sequence 592gagaacgatg gaccttccat
2059317DNAArtificial SequenceSynthetic Sequence
593gagaacgctg gatccat
1759420DNAArtificial SequenceSynthetic Sequence 594gagaacgctc cagcactgat
2059520DNAArtificial
SequenceSynthetic Sequence 595tccatgtcgg tcctgctgat
2059620DNAArtificial SequenceSynthetic Sequence
596atgtcctcgg tcctgatgct
2059720DNAArtificial SequenceSynthetic Sequence 597gagaacgctc caccttccat
2059820DNAArtificial
SequenceSynthetic Sequence 598gagaacgctg gaccttcgta
2059920DNAArtificial
Sequencemisc_feature(1)...(3)Conjugated to biotin moiety. 599atggaaggtc
cagcgttctc
206006DNAArtificial SequenceSynthetic Sequence 600tcctga
66018DNAArtificial
SequenceSynthetic Sequence 601tcaacgtt
86026DNAArtificial SequenceSynthetic Sequence
602aacgtt
66038DNAArtificial SequenceSynthetic Sequence 603aacgttga
860417DNAArtificial
SequenceSynthetic Sequence 604tcacgctaac ctctagc
1760520DNAArtificial SequenceSynthetic Sequence
605gagaacgctg gaccttgcat
2060614DNAArtificial SequenceSynthetic Sequence 606gctggacctt ccat
1460722DNAArtificial
SequenceSynthetic Sequence 607gagaacgctg gacctcatcc at
2260823DNAArtificial SequenceSynthetic Sequence
608gagaacgctg gacgctcatc cat
2360915DNAArtificial SequenceSynthetic Sequence 609aacgttgagg ggcat
1561015DNAArtificial
SequenceSynthetic Sequence 610atgcccctca acgtt
1561110DNAArtificial SequenceSynthetic Sequence
611tcaacgttga
1061214DNAArtificial SequenceSynthetic Sequence 612gctggacctt ccat
146137DNAArtificial
SequenceSynthetic Sequence 613caacgtt
761410DNAArtificial SequenceSynthetic Sequence
614acaacgttga
106156DNAArtificial SequenceSynthetic Sequence 615tcacgt
66168DNAArtificial
SequenceSynthetic Sequence 616tcaagctt
86176DNAArtificial SequenceSynthetic Sequence
617tcgtca
66188DNAArtificial SequenceSynthetic Sequence 618aggatatc
86198DNAArtificial
SequenceSynthetic Sequence 619tagacgtc
86208DNAArtificial SequenceSynthetic Sequence
620gacgtcat
86218DNAArtificial SequenceSynthetic Sequence 621ccatcgat
86228DNAArtificial
SequenceSynthetic Sequence 622atcgatgt
86238DNAArtificial SequenceSynthetic Sequence
623atgcatgt
86248DNAArtificial SequenceSynthetic Sequence 624ccatgcat
86258DNAArtificial
SequenceSynthetic Sequence 625agcgctga
86268DNAArtificial SequenceSynthetic Sequence
626tcagcgct
86278DNAArtificial SequenceSynthetic Sequence 627ccttcgat
862818DNAArtificial
SequenceSynthetic Sequence 628gtgccggggt ctccgggc
1862918DNAArtificial SequenceSynthetic Sequence
629gctgtggggc ggctcctg
186308DNAArtificial Sequencemisc_feature(1)...(3)Conjugated to biotin
moiety. 630tcaacgtt
86318DNAArtificial Sequencemisc_feature(1)...(3)Conjugated to
FITC moiety. 631tcaacgtt
86328DNAArtificial Sequencemisc_feature(1)...(3)Conjugated
to FITC moiety. 632aacgttga
86337DNAArtificial SequenceSynthetic Sequence 633tcaacgt
76347DNAArtificial SequenceSynthetic Sequence 634aacgttg
76356DNAArtificial
SequenceSynthetic Sequence 635cgacga
66368DNAArtificial SequenceSynthetic Sequence
636tcaacgtt
86375DNAArtificial SequenceSynthetic Sequence 637tcgga
56388DNAArtificial
SequenceSynthetic Sequence 638agaacgtt
86398DNAArtificial SequenceSynthetic Sequence
639tcatcgat
86408DNAArtificial SequenceSynthetic Sequence 640taaacgtt
86418DNAArtificial
SequenceSynthetic Sequence 641ccaacgtt
86426DNAArtificial SequenceSynthetic Sequence
642gctcga
66436DNAArtificial SequenceSynthetic Sequence 643cgacgt
66446DNAArtificial
SequenceSynthetic Sequence 644cgtcgt
66456DNAArtificial SequenceSynthetic Sequence
645acgtgt
66466DNAArtificial SequenceSynthetic Sequence 646cgttcg
664720DNAArtificial
SequenceSynthetic Sequence 647gagcaagctg gaccttccat
206486DNAArtificial SequenceSynthetic Sequence
648cgcgta
66496DNAArtificial SequenceSynthetic Sequence 649cgtacg
66508DNAArtificial
SequenceSynthetic Sequence 650tcaccggt
865120DNAArtificial SequenceSynthetic Sequence
651caagagatgc taacaatgca
2065220DNAArtificial SequenceSynthetic Sequence 652acccatcaat agctctgtgc
206538DNAArtificial
SequenceSynthetic Sequence 653ccatcgat
86548DNAArtificial SequenceSynthetic Sequence
654tcgacgtc
86558DNAArtificial SequenceSynthetic Sequence 655ctagcgct
86568DNAArtificial
SequenceSynthetic Sequence 656taagcgct
865713DNAArtificial SequenceSynthetic Sequence
657tcgcgaattc gcg
1365819DNAArtificial SequenceSynthetic Sequence 658atggaaggtc cagcgttct
1965917DNAArtificial
SequenceSynthetic Sequence 659actggacgtt agcgtga
1766018DNAArtificial SequenceSynthetic Sequence
660cgcctggggc tggtctgg
1866118DNAArtificial SequenceSynthetic Sequence 661gtgtcggggt ctccgggc
1866218DNAArtificial
SequenceSynthetic Sequence 662gtgccggggt ctccgggc
1866318DNAArtificial SequenceSynthetic Sequence
663cgccgtcgcg gcggttgg
1866421DNAArtificial SequenceSynthetic Sequence 664gaagttcacg ttgaggggca
t 2166521DNAArtificial
SequenceSynthetic Sequence 665atctggtgag ggcaagctat g
2166621DNAArtificial SequenceSynthetic Sequence
666gttgaaaccc gagaacatca t
216678DNAArtificial SequenceSynthetic Sequence 667gcaacgtt
86688DNAArtificial
SequenceSynthetic Sequence 668gtaacgtt
86698DNAArtificial SequenceSynthetic Sequence
669cgaacgtt
86708DNAArtificial SequenceSynthetic Sequence 670gaaacgtt
86718DNAArtificial
SequenceSynthetic Sequence 671caaacgtt
86728DNAArtificial SequenceSynthetic Sequence
672ctaacgtt
86738DNAArtificial SequenceSynthetic Sequence 673ggaacgtt
86748DNAArtificial
SequenceSynthetic Sequence 674tgaacgtt
86758DNAArtificial SequenceSynthetic Sequence
675acaacgtt
86768DNAArtificial SequenceSynthetic Sequence 676ttaacgtt
86778DNAArtificial
SequenceSynthetic Sequence 677aaaacgtt
86788DNAArtificial SequenceSynthetic Sequence
678ataacgtt
86798DNAArtificial SequenceSynthetic Sequence 679aacgttct
86808DNAArtificial
SequenceSynthetic Sequence 680tccgatcg
86818DNAArtificial SequenceSynthetic Sequence
681tccgtacg
868217DNAArtificial SequenceSynthetic Sequence 682gctagacgct agcgtga
1768325DNAArtificial
SequenceSynthetic Sequence 683gagaacgctg gacctcatca tccat
2568420DNAArtificial SequenceSynthetic Sequence
684gagaacgcta gaccttctat
2068517DNAArtificial SequenceSynthetic Sequence 685actagacgtt agtgtga
1768622DNAArtificial
SequenceSynthetic Sequence 686cacaccttgg tcaatgtcac gt
2268722DNAArtificial SequenceSynthetic Sequence
687tctccatcct atggttttat cg
2268815DNAArtificial SequenceSynthetic Sequence 688cgctggacct tccat
1568923DNAArtificial
SequenceSynthetic Sequence 689caccaccttg gtcaatgtca cgt
2369017DNAArtificial SequenceSynthetic Sequence
690gctagacgtt agctgga
1769117DNAArtificial SequenceSynthetic Sequence 691agtgcgattg cagatcg
1769224DNAArtificial
SequenceSynthetic Sequence 692ttttcgtttt gtggttttgt ggtt
2469323DNAArtificial SequenceSynthetic Sequence
693ttttcgtttg tcgttttgtc gtt
2369424DNAArtificial SequenceSynthetic Sequence 694tttttgtttt gtggttttgt
ggtt 2469520DNAArtificial
SequenceSynthetic Sequence 695accgcatgga ttctaggcca
2069615DNAArtificial SequenceSynthetic Sequence
696gctagacgtt agcgt
1569717DNAArtificial SequenceSynthetic Sequence 697aacgctggac cttccat
176988DNAArtificial
Sequencemodified_base(5)...(5)m5c 698tcaangtt
86998DNAArtificial SequenceSynthetic
Sequence 699ccttcgat
870017DNAArtificial SequenceSynthetic Sequence 700actagacgtt
agtgtga
1770117DNAArtificial SequenceSynthetic Sequence 701gctagaggtt agcgtga
1770220DNAArtificial
SequenceSynthetic Sequence 702atggactctc cagcgttctc
2070320DNAArtificial SequenceSynthetic Sequence
703atcgactctc gagcgttctc
2070413DNAArtificial SequenceSynthetic Sequence 704gctagacgtt agc
137059DNAArtificial
SequenceSynthetic Sequence 705gctagacgt
970617DNAArtificial SequenceSynthetic Sequence
706agtgcgattc gagatcg
177078DNAArtificial Sequencemodified_base(5)...(5)m5c 707tcagngct
870818DNAArtificial
SequenceSynthetic Sequence 708ctgattgctc tctcgtga
187098DNAArtificial
Sequencemodified_base(2)...(2)m5c 709tnaacgtt
871020DNAArtificial
Sequencemodified_base(6)...(6)m5c 710gagaangctg gaccttccat
2071117DNAArtificial SequenceSynthetic
Sequence 711gctagacgtt aggctga
1771214DNAArtificial SequenceSynthetic Sequence 712gctacttagc
gtga
1471315DNAArtificial SequenceSynthetic Sequence 713gctaccttag cgtga
1571419DNAArtificial
SequenceSynthetic Sequence 714atcgacttcg agcgttctc
1971520DNAArtificial SequenceSynthetic Sequence
715atgcactctg cagcgttctc
2071620DNAArtificial SequenceSynthetic Sequence 716agtgactctc cagcgttctc
2071717DNAArtificial
SequenceSynthetic Sequence 717gccagatgtt agctgga
1771818DNAArtificial SequenceSynthetic Sequence
718atcgactcga gcgttctc
1871917DNAArtificial SequenceSynthetic Sequence 719atcgatcgag cgttctc
1772020DNAArtificial
Sequencemisc_feature(1)...(3)Conjugated to biotin moiety. 720gagaacgctc
gaccttcgat
2072117DNAArtificial SequenceSynthetic Sequence 721gctagacgtt agctgga
1772220DNAArtificial
SequenceSynthetic Sequence 722atcgactctc gagcgttctc
2072315DNAArtificial SequenceSynthetic Sequence
723tagacgttag cgtga
1572418DNAArtificial SequenceSynthetic Sequence 724cgactctcga gcgttctc
1872521DNAArtificial
SequenceSynthetic Sequence 725ggggtcgacc ttggaggggg g
2172616DNAArtificial SequenceSynthetic Sequence
726gctaacgtta gcgtga
167279DNAArtificial SequenceSynthetic Sequence 727cgtcgtcgt
972820DNAArtificial
Sequencemodified_base(14)...(14)m5c 728gagaacgctg gacnttccat
2072920DNAArtificial
Sequencemodified_base(18)...(18)m5c 729atcgacctac gtgcgttntc
2073020DNAArtificial
Sequencemodified_base(3)...(3)m5c 730atngacctac gtgcgttctc
2073115DNAArtificial
Sequencemodified_base(7)...(7)m5c 731gctagangtt agcgt
1573220DNAArtificial
Sequencemodified_base(14)...(14)m5c 732atcgactctc gagngttctc
2073320DNAArtificial SequenceSynthetic
Sequence 733ggggtaatgc atcagggggg
2073420DNAArtificial SequenceSynthetic Sequence 734ggctgtattc
ctgactgccc
2073517DNAArtificial SequenceSynthetic Sequence 735ccatgctaac ctctagc
1773617DNAArtificial
SequenceSynthetic Sequence 736gctagatgtt agcgtga
1773715DNAArtificial SequenceSynthetic Sequence
737cgtaccttac ggtga
1573820DNAArtificial SequenceSynthetic Sequence 738tccatgctgg tcctgatgct
2073922DNAArtificial
SequenceSynthetic Sequence 739atcgactctc tcgagcgttc tc
2274017DNAArtificial SequenceSynthetic Sequence
740gctagagctt agcgtga
1774120DNAArtificial SequenceSynthetic Sequence 741atcgactctc gagtgttctc
2074217DNAArtificial
SequenceSynthetic Sequence 742aacgctcgac cttcgat
1774320DNAArtificial SequenceSynthetic Sequence
743ctcaacgctg gaccttccat
2074420DNAArtificial SequenceSynthetic Sequence 744atcgacctac gtgcgttctc
2074520DNAArtificial
SequenceSynthetic Sequence 745gagaatgctg gaccttccat
2074617DNAArtificial SequenceSynthetic Sequence
746tcacgctaac ctctgac
1774720DNAArtificial Sequencemisc_feature(1)...(3)Conjugated to biotin
moiety. 747gagaacgctc cagcactgat
2074820DNAArtificial Sequencemisc_feature(1)...(3)Biotin moiety
attached at 5' end of sequence. 748gagcaagctg gaccttccat
2074918DNAArtificial SequenceSynthetic
Sequence 749cgctagaggt tagcgtga
1875015DNAArtificial SequenceSynthetic Sequence 750gctagatgtt
aacgt
1575119DNAArtificial SequenceSynthetic Sequence 751atggaaggtc cacgttctc
1975215DNAArtificial
SequenceSynthetic Sequence 752gctagatgtt agcgt
1575315DNAArtificial SequenceSynthetic Sequence
753gctagacgtt agtgt
1575420DNAArtificial SequenceSynthetic Sequence 754tccatgacgg tcctgatgct
2075520DNAArtificial
SequenceSynthetic Sequence 755tccatggcgg tcctgatgct
2075615DNAArtificial SequenceSynthetic Sequence
756gctagacgat agcgt
1575715DNAArtificial SequenceSynthetic Sequence 757gctagtcgat agcgt
1575820DNAArtificial
SequenceSynthetic Sequence 758tccatgacgt tcctgatgct
2075920DNAArtificial SequenceSynthetic Sequence
759tccatgtcgt tcctgatgct
2076015DNAArtificial Sequencemodified_base(13)...(13)m5c 760gctagacgtt
agngt
1576115DNAArtificial SequenceSynthetic Sequence 761gctaggcgtt agcgt
1576220DNAArtificial
Sequencemodified_base(8)...(8)m5c 762tccatgtngg tcctgatgct
2076320DNAArtificial
Sequencemodified_base(12)...(12)m5c 763tccatgtcgg tnctgatgct
2076420DNAArtificial SequenceSynthetic
Sequence 764atngactctn gagngttctc
2076520DNAArtificial SequenceSynthetic Sequence 765atggaaggtc
cagtgttctc
2076615DNAArtificial SequenceSynthetic Sequence 766gcatgacgtt gagct
1576720DNAArtificial
SequenceSynthetic Sequence 767ggggtcaacg ttgagggggg
2076820DNAArtificial SequenceSynthetic Sequence
768ggggtcaagt ctgagggggg
2076920DNAArtificial SequenceSynthetic Sequence 769cgcgcgcgcg cgcgcgcgcg
2077028DNAArtificial
SequenceSynthetic Sequence 770cccccccccc cccccccccc cccccccc
2877135DNAArtificial SequenceSynthetic Sequence
771cccccccccc cccccccccc cccccccccc ccccc
3577220DNAArtificial SequenceSynthetic Sequence 772tccatgtcgc tcctgatcct
2077315DNAArtificial
SequenceSynthetic Sequence 773gctaaacgtt agcgt
1577420DNAArtificial SequenceSynthetic Sequence
774tccatgtcga tcctgatgct
2077520DNAArtificial SequenceSynthetic Sequence 775tccatgccgg tcctgatgct
2077620DNAArtificial
SequenceSynthetic Sequence 776aaaatcaacg ttgaaaaaaa
2077720DNAArtificial SequenceSynthetic Sequence
777tccataacgt tcctgatgct
2077823DNAArtificial SequenceSynthetic Sequence 778tggaggtccc accgagatcg
gag 2377921DNAArtificial
SequenceSynthetic Sequence 779cgtcgtcgtc gtcgtcgtcg t
2178021DNAArtificial SequenceSynthetic Sequence
780ctgctgctgc tgctgctgct g
2178121DNAArtificial SequenceSynthetic Sequence 781gagaacgctc cgaccttcga
t 2178215DNAArtificial
SequenceSynthetic Sequence 782gctagatgtt agcgt
1578315DNAArtificial SequenceSynthetic Sequence
783gcatgacgtt gagct
1578410DNAArtificial Sequencemisc_feature(8)...(10)Conjugated to FITC
moiety. 784tcaatgctga
1078510DNAArtificial Sequencemisc_feature(8)...(10)Conjugated to
FITC moiety. 785tcaacgttga
1078610DNAArtificial Sequencemisc_feature(8)...(10)Conjugated
to biotin moiety. 786tcaacgttga
1078710DNAArtificial
Sequencemisc_feature(8)...(10)Conjugated to biotin moiety. 787gcaatattgc
1078810DNAArtificial Sequencemisc_feature(8)...(10)Conjugated to FITC
moiety. 788gcaatattgc
1078910DNAArtificial SequenceSynthetic Sequence 789agttgcaact
107908DNAArtificial
SequenceSynthetic Sequence 790tcttcgaa
87918DNAArtificial SequenceSynthetic Sequence
791tcaacgtc
879219DNAArtificial SequenceSynthetic Sequence 792ccatgtcggt cctgatgct
1979318DNAArtificial
SequenceSynthetic Sequence 793gtttttatat aatttggg
1879423DNAArtificial SequenceSynthetic Sequence
794tttttgtttg tcgttttgtc gtt
2379512DNAArtificial SequenceSynthetic Sequence 795ttgggggggg tt
1279613DNAArtificial
SequenceSynthetic Sequence 796ggggttgggg gtt
1379717DNAArtificial SequenceSynthetic Sequence
797ggtggtgtag gttttgg
1779820DNAArtificial Sequencemisc_feature(1)...(3)Conjugated to biotin
moiety. 798gagaangctc gaccttcgat
2079920DNAArtificial SequenceSynthetic Sequence 799tcaacgttaa
cgttaacgtt
2080020DNAArtificial Sequencemisc_feature(1)...(3)Conjugated to biotin
moiety. 800gagcaagntg gaccttccat
2080120DNAArtificial Sequencemisc_feature(1)...(3)Conjugated to
biotin moiety. 801gagaangctc cagcactgat
2080210DNAArtificial Sequencemodified_base(5)...(5)m5c
802tcaangttga
1080310DNAArtificial Sequencemodified_base(2)...(2)m5c 803gnaatattgc
1080424DNAArtificial SequenceSynthetic Sequence 804tgctgctttt gtcgttttgt
gctt 2480522DNAArtificial
SequenceSynthetic Sequence 805ctgcgttagc aatttaactg tg
2280620DNAArtificial SequenceSynthetic Sequence
806tccatgacgt tcctgatgct
2080728DNAArtificial SequenceSynthetic Sequence 807tgcatgccgt gcatccgtac
acagctct 2880820DNAArtificial
SequenceSynthetic Sequence 808tgcatgccgt acacagctct
2080912DNAArtificial SequenceSynthetic Sequence
809tgcatcagct ct
128108DNAArtificial SequenceSynthetic Sequence 810tgcgctct
881120DNAArtificial
SequenceSynthetic Sequence 811cccccccccc cccccccccc
2081212DNAArtificial SequenceSynthetic Sequence
812cccccccccc cc
128138DNAArtificial SequenceSynthetic Sequence 813cccccccc
881412DNAArtificial
SequenceSynthetic Sequence 814tgcatcagct ct
1281520DNAArtificial SequenceSynthetic Sequence
815tgcatgccgt acacagctct
2081620DNAArtificial SequenceSynthetic Sequence 816gagcaagctg gaccttccat
2081732DNAArtificial
SequenceSynthetic Sequence 817tcaacgttaa cgttaacgtt aacgttaacg tt
3281820DNAArtificial SequenceSynthetic Sequence
818gagaacgctc gaccttcgat
2081925DNAArtificial SequenceSynthetic Sequence 819gtccccattt cccagaggag
gaaat 2582025DNAArtificial
SequenceSynthetic Sequence 820ctagcggctg acgtcatcaa gctag
2582125DNAArtificial SequenceSynthetic Sequence
821ctagcttgat gacgtcagcc gctag
2582216DNAArtificial SequenceSynthetic Sequence 822cggctgacgt catcaa
168238DNAArtificial
SequenceSynthetic Sequence 823ctgacgtg
882410DNAArtificial SequenceSynthetic Sequence
824ctgacgtcat
1082521DNAArtificial SequenceSynthetic Sequence 825attcgatcgg ggcggggcga
g 2182621DNAArtificial
SequenceSynthetic Sequence 826ctcgccccgc cccgatcgaa t
2182715DNAArtificial SequenceSynthetic Sequence
827gactgacgtc agcgt
1582826DNAArtificial SequenceSynthetic Sequence 828ctagcggctg acgtcataaa
gctagc 2682926DNAArtificial
SequenceSynthetic Sequence 829ctagctttat gacgtcagcc gctagc
2683026DNAArtificial SequenceSynthetic Sequence
830ctagcggctg agctcataaa gctagc
2683125DNAArtificial SequenceSynthetic Sequence 831ctagtggctg acgtcatcaa
gctag 2583220DNAArtificial
SequenceSynthetic Sequence 832tccaccacgt ggtctatgct
2083324DNAArtificial SequenceSynthetic Sequence
833gggaatgaaa gattttatta taag
2483426DNAArtificial SequenceSynthetic Sequence 834tctaaaaacc atctattctt
aaccct 2683515DNAArtificial
SequenceSynthetic Sequence 835agctcaacgt catgc
1583624DNAArtificial SequenceSynthetic Sequence
836ttaacggtgg tagcggtatt ggtc
2483724DNAArtificial SequenceSynthetic Sequence 837ttaagaccaa taccgctacc
accg 2483825DNAArtificial
SequenceSynthetic Sequence 838gatctagtga tgagtcagcc ggatc
2583925DNAArtificial SequenceSynthetic Sequence
839gatccggctg actcatcact agatc
2584020DNAArtificial SequenceSynthetic Sequence 840tccaagacgt tcctgatgct
2084120DNAArtificial
SequenceSynthetic Sequence 841tccatgacgt ccctgatgct
2084220DNAArtificial SequenceSynthetic Sequence
842tccaccacgt ggctgatgct
2084317DNAArtificial SequenceSynthetic Sequence 843ccacgtggac ctctagc
1784427DNAArtificial
SequenceSynthetic Sequence 844tcagaccacg tggtcgggtg ttcctga
2784527DNAArtificial SequenceSynthetic Sequence
845tcaggaacac ccgaccacgt ggtctga
2784618DNAArtificial SequenceSynthetic Sequence 846catttccacg atttccca
1884719DNAArtificial
SequenceSynthetic Sequence 847ttcctctctg caagagact
1984819DNAArtificial SequenceSynthetic Sequence
848tgtatctctc tgaaggact
1984925DNAArtificial SequenceSynthetic Sequence 849ataaagcgaa actagcagca
gtttc 2585025DNAArtificial
SequenceSynthetic Sequence 850gaaactgctg ctagtttcgc tttat
2585130DNAArtificial SequenceSynthetic Sequence
851tgcccaaaga ggaaaatttg tttcatacag
3085230DNAArtificial SequenceSynthetic Sequence 852ctgtatgaaa caaattttcc
tctttgggca 3085320DNAArtificial
SequenceSynthetic Sequence 853ttagggttag ggttagggtt
2085420DNAArtificial SequenceSynthetic Sequence
854tccatgagct tcctgatgct
2085520DNAArtificial SequenceSynthetic Sequence 855aaaacatgac gttcaaaaaa
2085620DNAArtificial
SequenceSynthetic Sequence 856aaaacatgac gttcgggggg
2085720DNAArtificial SequenceSynthetic Sequence
857ggggcatgag cttcgggggg
2085824DNAArtificial SequenceSynthetic Sequence 858ctaggctgac gtcatcaagc
tagt 2485930DNAArtificial
SequenceSynthetic Sequence 859tctgacgtca tctgacgttg gctgacgtct
3086025DNAArtificial SequenceSynthetic Sequence
860ggaattagta atagatatag aagtt
2586130DNAArtificial SequenceSynthetic Sequence 861tttacctttt ataaacataa
ctaaaacaaa 3086215DNAArtificial
SequenceSynthetic Sequence 862gcgttttttt ttgcg
1586324DNAArtificial SequenceSynthetic Sequence
863atatctaatc aaaacattaa caaa
2486424DNAArtificial SequenceSynthetic Sequence 864tctatcccag gtggttcctg
ttag 2486520DNAArtificial
Sequencemisc_feature(1)...(3)Conjugated to biotin moiety. 865tccatgacgt
tcctgatgct
2086620DNAArtificial Sequencemisc_feature(1)...(3)Conjugated to biotin
moiety. 866tccatgagct tcctgatgct
2086713DNAArtificial Sequencemisc_feature(11)...(13)Conjugated to
FITC moiety. 867tttttttttt ttt
1386813DNAArtificial
Sequencemisc_feature(11)...(13)Conjugated to biotin moiety. 868tttttttttt
ttt
1386925DNAArtificial SequenceSynthetic Sequence 869ctagcttgat gagctcagcc
gctag 2587025DNAArtificial
SequenceSynthetic Sequence 870ttcagttgtc ttgctgctta gctaa
2587120DNAArtificial SequenceSynthetic Sequence
871tccatgagct tcctgagtct
2087225DNAArtificial SequenceSynthetic Sequence 872ctagcggctg acgtcatcaa
tctag 2587320DNAArtificial
SequenceSynthetic Sequence 873tgctagctgt gcctgtacct
2087423DNAArtificial SequenceSynthetic Sequence
874atgctaaagg acgtcacatt gca
2387523DNAArtificial SequenceSynthetic Sequence 875tgcaatgtga cgtcctttag
cat 2387631DNAArtificial
SequenceSynthetic Sequence 876gtaggggact ttccgagctc gagatcctat g
3187731DNAArtificial SequenceSynthetic Sequence
877cataggatct cgagctcgga aagtccccta c
3187822DNAArtificial SequenceSynthetic Sequence 878ctgtcaggaa ctgcaggtaa
gg 2287927DNAArtificial
SequenceSynthetic Sequence 879cataacatag gaatatttac tcctcgc
2788021DNAArtificial SequenceSynthetic Sequence
880ctccagctcc aagaaaggac g
2188121DNAArtificial SequenceSynthetic Sequence 881gaagtttctg gtaagtcttc
g 2188224DNAArtificial
SequenceSynthetic Sequence 882tgctgctttt gtgcttttgt gctt
2488324DNAArtificial SequenceSynthetic Sequence
883tcgtcgtttt gtggttttgt ggtt
2488423DNAArtificial SequenceSynthetic Sequence 884tcgtcgtttg tcgttttgtc
gtt 2388522DNAArtificial
SequenceSynthetic Sequence 885tcctgacgtt cggcgcgcgc cc
2288624DNAArtificial SequenceSynthetic Sequence
886tgctgctttt gtgcttttgt gctt
2488720DNAArtificial SequenceSynthetic Sequence 887tccatgagct tcctgagctt
2088824DNAArtificial
SequenceSynthetic Sequence 888tcgtcgtttc gtcgttttga cgtt
2488926DNAArtificial SequenceSynthetic Sequence
889tcgtcgtttg cgtgcgtttc gtcgtt
2689027DNAArtificial SequenceSynthetic Sequence 890tcgcgtgcgt tttgtcgttt
tgacgtt 2789125DNAArtificial
SequenceSynthetic Sequence 891ttcgtcgttt tgtcgttttg tcgtt
2589215DNAArtificial SequenceSynthetic Sequence
892tcctgacggg gaagt
1589315DNAArtificial SequenceSynthetic Sequence 893tcctggcgtg gaagt
1589415DNAArtificial
SequenceSynthetic Sequence 894tcctggcggt gaagt
1589515DNAArtificial SequenceSynthetic Sequence
895tcctggcgtt gaagt
1589615DNAArtificial SequenceSynthetic Sequence 896tcctgacgtg gaagt
1589720DNAArtificial
SequenceSynthetic Sequence 897gcgacgttcg gcgcgcgccc
2089820DNAArtificial SequenceSynthetic Sequence
898gcgacgggcg gcgcgcgccc
2089920DNAArtificial SequenceSynthetic Sequence 899gcggcgtgcg gcgcgcgccc
2090020DNAArtificial
SequenceSynthetic Sequence 900gcggcggtcg gcgcgcgccc
2090120DNAArtificial SequenceSynthetic Sequence
901gcgacggtcg gcgcgcgccc
2090220DNAArtificial SequenceSynthetic Sequence 902gcggcgttcg gcgcgcgccc
2090320DNAArtificial
SequenceSynthetic Sequence 903gcgacgtgcg gcgcgcgccc
2090415DNAArtificial SequenceSynthetic Sequence
904tcgtcgctgt ctccg
1590520DNAArtificial SequenceSynthetic Sequence 905tgtgggggtt ttggttttgg
2090620DNAArtificial
SequenceSynthetic Sequence 906aggggagggg aggggagggg
2090721DNAArtificial SequenceSynthetic Sequence
907tgtgtgtgtg tgtgtgtgtg t
2190822DNAArtificial SequenceSynthetic Sequence 908ctctctctct ctctctctct
ct 2290920DNAArtificial
SequenceSynthetic Sequence 909ggggtcgacg tcgagggggg
2091022DNAArtificial SequenceSynthetic Sequence
910atatatatat atatatatat at
2291127DNAArtificial SequenceSynthetic Sequence 911tttttttttt tttttttttt
ttttttt 2791221DNAArtificial
SequenceSynthetic Sequence 912tttttttttt tttttttttt t
2191318DNAArtificial SequenceSynthetic Sequence
913tttttttttt tttttttt
1891415DNAArtificial SequenceSynthetic Sequence 914gctagagggg agggt
1591515DNAArtificial
SequenceSynthetic Sequence 915gctagatgtt agggg
1591615DNAArtificial SequenceSynthetic Sequence
916gcatgagggg gagct
1591720DNAArtificial SequenceSynthetic Sequence 917atggaaggtc cagggggctc
2091820DNAArtificial
SequenceSynthetic Sequence 918atggactctg gagggggctc
2091920DNAArtificial SequenceSynthetic Sequence
919atggaaggtc caaggggctc
2092020DNAArtificial SequenceSynthetic Sequence 920gagaaggggg gaccttggat
2092120DNAArtificial
SequenceSynthetic Sequence 921gagaaggggg gaccttccat
2092220DNAArtificial SequenceSynthetic Sequence
922gagaaggggc cagcactgat
2092320DNAArtificial SequenceSynthetic Sequence 923tccatgtggg gcctgatgct
2092420DNAArtificial
SequenceSynthetic Sequence 924tccatgaggg gcctgatgct
2092520DNAArtificial SequenceSynthetic Sequence
925tccatgtggg gcctgctgat
2092620DNAArtificial SequenceSynthetic Sequence 926atggactctc cggggttctc
2092720DNAArtificial
SequenceSynthetic Sequence 927atggaaggtc cggggttctc
2092820DNAArtificial SequenceSynthetic Sequence
928atggactctg gaggggtctc
2092920DNAArtificial SequenceSynthetic Sequence 929atggaggctc catggggctc
2093020DNAArtificial
SequenceSynthetic Sequence 930atggactctg gggggttctc
2093120DNAArtificial SequenceSynthetic Sequence
931tccatgtggg tggggatgct
2093220DNAArtificial SequenceSynthetic Sequence 932tccatgcggg tggggatgct
2093320DNAArtificial
SequenceSynthetic Sequence 933tccatggggg tcctgatgct
2093420DNAArtificial SequenceSynthetic Sequence
934tccatggggt ccctgatgct
2093520DNAArtificial SequenceSynthetic Sequence 935tccatggggt gcctgatgct
2093620DNAArtificial
SequenceSynthetic Sequence 936tccatggggt tcctgatgct
2093720DNAArtificial SequenceSynthetic Sequence
937tccatcgggg gcctgatgct
2093814DNAArtificial SequenceSynthetic Sequence 938gctagaggga gtgt
1493918DNAArtificial
SequenceSynthetic Sequence 939tttttttttt tttttttt
1894021DNAArtificial
Sequencemisc_difference(2)...(2)m is a or c 940gmggtcaacg ttgagggmgg g
2194121DNAArtificial
SequenceSynthetic Sequence 941ggggagttcg ttgagggggg g
2194220DNAArtificial SequenceSynthetic Sequence
942tcgtcgtttc cccccccccc
2094325DNAArtificial SequenceSynthetic Sequence 943ttggggggtt tttttttttt
ttttt 2594423DNAArtificial
SequenceSynthetic Sequence 944tttaaatttt aaaatttaaa ata
2394524DNAArtificial SequenceSynthetic Sequence
945ttggtttttt tggttttttt ttgg
2494624DNAArtificial SequenceSynthetic Sequence 946tttccctttt ccccttttcc
cctc 2494721DNAArtificial
Sequencemisc_difference(21)...(21)s is g or c 947ggggtcatcg atgagggggg s
2194820DNAArtificial
SequenceSynthetic Sequence 948tccatgacgt tcctgacgtt
2094920DNAArtificial SequenceSynthetic Sequence
949tccatgacgt tcctgacgtt
2095020DNAArtificial SequenceSynthetic Sequence 950tccatgacgt tcctgacgtt
2095120DNAArtificial
SequenceSynthetic Sequence 951tccatgacgt tcctgacgtt
2095220DNAArtificial SequenceSynthetic Sequence
952tccatgacgt tcctgacgtt
2095320DNAArtificial SequenceSynthetic Sequence 953tccatgacgt tcctgacgtt
2095420DNAArtificial
SequenceSynthetic Sequence 954tccatgacgt tcctgacgtt
2095520DNAArtificial SequenceSynthetic Sequence
955tccatgacgt tcctgacgtt
2095620DNAArtificial SequenceSynthetic Sequence 956tccatgacgt tcctgacgtt
2095720DNAArtificial
SequenceSynthetic Sequence 957tccatgacgt tcctgacgtt
2095820DNAArtificial SequenceSynthetic Sequence
958tccatgacgt tcctgacgtt
2095919DNAArtificial SequenceSynthetic Sequence 959gggggacgat cgtcggggg
1996020DNAArtificial
SequenceSynthetic Sequence 960gggggtcgta cgacgggggg
2096124DNAArtificial SequenceSynthetic Sequence
961tttttttttt tttttttttt tttt
2496224DNAArtificial SequenceSynthetic Sequence 962aaaaaaaaaa aaaaaaaaaa
aaaa 2496324DNAArtificial
SequenceSynthetic Sequence 963cccccccccc cccccccccc cccc
2496424DNAArtificial SequenceSynthetic Sequence
964tcgtcgtttt gtcgttttgt cgtt
2496524DNAArtificial SequenceSynthetic Sequence 965tcgtcgtttt gtcgttttgt
cgtt 2496624DNAArtificial
SequenceSynthetic Sequence 966tcgtcgtttt gtcgttttgt cgtt
2496724DNAArtificial SequenceSynthetic Sequence
967tcgtcgtttt gtcgttttgt cgtt
2496820DNAArtificial SequenceSynthetic Sequence 968ggggtcaacg ttgagggggg
2096920DNAArtificial
SequenceSynthetic Sequence 969ggggtcaacg ttgagggggg
2097020DNAArtificial SequenceSynthetic Sequence
970ggggtcaagc ttgagggggg
2097120DNAArtificial SequenceSynthetic Sequence 971tgctgcttcc cccccccccc
2097220DNAArtificial
SequenceSynthetic Sequence 972ggggacgtcg acgtgggggg
2097320DNAArtificial SequenceSynthetic Sequence
973ggggtcgtcg acgagggggg
2097424DNAArtificial SequenceSynthetic Sequence 974ggggtcgacg tacgtcgagg
gggg 2497522DNAArtificial
SequenceSynthetic Sequence 975ggggaccggt accggtgggg gg
2297619DNAArtificial SequenceSynthetic Sequence
976gggtcgacgt cgagggggg
1997719DNAArtificial SequenceSynthetic Sequence 977ggggtcgacg tcgaggggg
1997822DNAArtificial
SequenceSynthetic Sequence 978ggggaacgtt aacgttgggg gg
2297920DNAArtificial SequenceSynthetic Sequence
979ggggtcaccg gtgagggggg
2098022DNAArtificial SequenceSynthetic Sequence 980ggggtcgttc gaacgagggg
gg 2298122DNAArtificial
SequenceSynthetic Sequence 981ggggacgttc gaacgtgggg gg
2298210DNAArtificial SequenceSynthetic Sequence
982tcaactttga
1098310DNAArtificial SequenceSynthetic Sequence 983tcaagcttga
1098412DNAArtificial
SequenceSynthetic Sequence 984tcacgatcgt ga
1298512DNAArtificial SequenceSynthetic Sequence
985tcagcatgct ga
1298620DNAArtificial SequenceSynthetic Sequence 986gggggagcat gctggggggg
2098720DNAArtificial
SequenceSynthetic Sequence 987gggggggggg gggggggggg
2098822DNAArtificial SequenceSynthetic Sequence
988gggggacgat atcgtcgggg gg
2298922DNAArtificial SequenceSynthetic Sequence 989gggggacgac gtcgtcgggg
gg 2299022DNAArtificial
SequenceSynthetic Sequence 990gggggacgag ctcgtcgggg gg
2299120DNAArtificial SequenceSynthetic Sequence
991gggggacgta cgtcgggggg
209928DNAArtificial SequenceSynthetic Sequence 992tcaacgtt
899320DNAArtificial
SequenceSynthetic Sequence 993tccataccgg tcctgatgct
2099420DNAArtificial SequenceSynthetic Sequence
994tccataccgg tcctaccggt
2099520DNAArtificial SequenceSynthetic Sequence 995gggggacgat cgttgggggg
2099620DNAArtificial
SequenceSynthetic Sequence 996ggggaacgat cgtcgggggg
2099721DNAArtificial SequenceSynthetic Sequence
997ggggggacga tcgtcggggg g
2199821DNAArtificial SequenceSynthetic Sequence 998gggggacgat cgtcgggggg
g 2199912DNAArtificial
SequenceSynthetic Sequence 999aaagacgtta aa
12100012DNAArtificial SequenceSynthetic
Sequence 1000aaagagctta aa
12100112DNAArtificial Sequencemodified_base(6)...(6)m5c
1001aaagangtta aa
12100212DNAArtificial SequenceSynthetic Sequence 1002aaattcggaa aa
12100321DNAArtificial
SequenceSynthetic Sequence 1003gggggtcatc gatgaggggg g
21100421DNAArtificial SequenceSynthetic
Sequence 1004gggggtcaac gttgaggggg g
21100520DNAArtificial SequenceSynthetic Sequence 1005atgtagctta
ataacaaagc
20100620DNAArtificial SequenceSynthetic Sequence 1006ggatcccttg
agttacttct
20100720DNAArtificial SequenceSynthetic Sequence 1007ccattccact
tctgattacc
20100820DNAArtificial SequenceSynthetic Sequence 1008tatgtattat
catgtagata
20100920DNAArtificial SequenceSynthetic Sequence 1009agcctacgta
ttcaccctcc
20101020DNAArtificial SequenceSynthetic Sequence 1010ttcctgcaac
tactattgta
20101120DNAArtificial SequenceSynthetic Sequence 1011atagaaggcc
ctacaccagt
20101220DNAArtificial SequenceSynthetic Sequence 1012ttacaccggt
ctatggaggt
20101320DNAArtificial SequenceSynthetic Sequence 1013ctaaccagat
caagtctagg
20101420DNAArtificial SequenceSynthetic Sequence 1014cctagacttg
atctggttag
20101520DNAArtificial SequenceSynthetic Sequence 1015tataagcctc
gtccgacatg
20101620DNAArtificial SequenceSynthetic Sequence 1016catgtcggac
gaggcttata
20101720DNAArtificial SequenceSynthetic Sequence 1017tggtggtggg
gagtaagctc
20101820DNAArtificial SequenceSynthetic Sequence 1018gagctactcc
cccaccacca
20101920DNAArtificial SequenceSynthetic Sequence 1019gccttcgatc
ttcgttggga
20102020DNAArtificial SequenceSynthetic Sequence 1020tggacttctc
tttgccgtct
20102120DNAArtificial SequenceSynthetic Sequence 1021atgctgtagc
ccagcgataa
20102220DNAArtificial SequenceSynthetic Sequence 1022accgaatcag
cggaaagtga
20102320DNAArtificial SequenceSynthetic Sequence 1023tccatgacgt
tcctgacgtt
20102424DNAArtificial SequenceSynthetic Sequence 1024ggagaaaccc
atgagctcat ctgg
24102520DNAArtificial SequenceSynthetic Sequence 1025accacagacc
agcaggcaga
20102620DNAArtificial SequenceSynthetic Sequence 1026gagcgtgaac
tgcgcgaaga
20102720DNAArtificial SequenceSynthetic Sequence 1027tcggtaccct
tgcagcggtt
20102820DNAArtificial SequenceSynthetic Sequence 1028ctggagccct
agccaaggat
20102920DNAArtificial SequenceSynthetic Sequence 1029gcgactccat
caccagcgat
20103021DNAArtificial SequenceSynthetic Sequence 1030cctgaagtaa
gaaccagatg t
21103121DNAArtificial SequenceSynthetic Sequence 1031ctgtgttatc
tgacatacac c
21103221DNAArtificial SequenceSynthetic Sequence 1032aattagcctt
aggtgattgg g
21103321DNAArtificial SequenceSynthetic Sequence 1033acatctggtt
cttacttcag g
21103423DNAArtificial SequenceSynthetic Sequence 1034ataagtcata
ttttgggaac tac
23103521DNAArtificial SequenceSynthetic Sequence 1035cccaatcacc
taaggctaat t
21103620DNAArtificial SequenceSynthetic Sequence 1036ggggtcgtcg
acgagggggg
20103722DNAArtificial SequenceSynthetic Sequence 1037ggggtcgttc
gaacgagggg gg
22103822DNAArtificial SequenceSynthetic Sequence 1038ggggacgttc
gaacgtgggg gg
22103915DNAArtificial Sequencemodified_base(9)...(9)n is
5-methylcytosine. 1039tcctggcgng gaagt
15104022DNAArtificial SequenceSynthetic Sequence
1040ggggaacgac gtcgttgggg gg
22104120DNAArtificial SequenceSynthetic Sequence 1041ggggaacgta
cgtcgggggg
20104224DNAArtificial SequenceSynthetic Sequence 1042ggggaacgta
cgtacgttgg gggg
24104320DNAArtificial SequenceSynthetic Sequence 1043ggggtcaccg
gtgagggggg
20104424DNAArtificial SequenceSynthetic Sequence 1044ggggtcgacg
tacgtcgagg gggg
24104522DNAArtificial SequenceSynthetic Sequence 1045ggggaccggt
accggtgggg gg
22104619DNAArtificial SequenceSynthetic Sequence 1046gggtcgacgt cgagggggg
19104718DNAArtificial
SequenceSynthetic Sequence 1047ggggtcgacg tcgagggg
18104822DNAArtificial SequenceSynthetic
Sequence 1048ggggaacgtt aacgttgggg gg
22104919DNAArtificial SequenceSynthetic Sequence 1049ggggacgtcg
acgtggggg
19105034DNAArtificial SequenceSynthetic Sequence 1050gcactcttcg
aagctacagc cggcagcctc tgat
34105132DNAArtificial SequenceSynthetic Sequence 1051cggctcttcc
atgaggtctt tgctaatctt gg
32105235DNAArtificial SequenceSynthetic Sequence 1052cggctcttcc
atgaaagtct ttggacgatg tgagc
35105315DNAArtificial SequenceSynthetic Sequence 1053tcctgcaggt taagt
15105420DNAArtificial
SequenceSynthetic Sequence 1054gggggtcgtt cgttgggggg
20105520DNAArtificial SequenceSynthetic
Sequence 1055gggggatgat tgttgggggg
20105620DNAArtificial Sequencemodified_base(7)...(7)m5c
1056gggggangat ngttgggggg
20105720DNAArtificial SequenceSynthetic Sequence 1057gggggagcta
gcttgggggg
20105820DNAArtificial SequenceSynthetic Sequence 1058ggttcttttg
gtccttgtct
20105920DNAArtificial SequenceSynthetic Sequence 1059ggttcttttg
gtcctcgtct
20106020DNAArtificial SequenceSynthetic Sequence 1060ggttcttttg
gtccttatct
20106120DNAArtificial SequenceSynthetic Sequence 1061ggttcttggt
ttccttgtct
20106220DNAArtificial SequenceSynthetic Sequence 1062tggtcttttg
gtccttgtct
20106320DNAArtificial SequenceSynthetic Sequence 1063ggttcaaatg
gtccttgtct
20106420DNAArtificial SequenceSynthetic Sequence 1064gggtcttttg
ggccttgtct
20106524DNAArtificial SequenceSynthetic Sequence 1065tccaggactt
ctctcaggtt tttt
24106620DNAArtificial SequenceSynthetic Sequence 1066tccaaaactt
ctctcaaatt
20106724DNAArtificial SequenceSynthetic Sequence 1067tactactttt
atacttttat actt
24106824DNAArtificial SequenceSynthetic Sequence 1068tgtgtgtgtg
tgtgtgtgtg tgtg
24106925DNAArtificial SequenceSynthetic Sequence 1069ttgttgttgt
tgtttgttgt tgttg
25107027DNAArtificial SequenceSynthetic Sequence 1070ggctccgggg
agggaatttt tgtctat
27107119DNAArtificial SequenceSynthetic Sequence 1071gggacgatcg tcggggggg
19107220DNAArtificial
SequenceSynthetic Sequence 1072gggtcgtcga cgaggggggg
20107319DNAArtificial SequenceSynthetic
Sequence 1073ggtcgtcgac gaggggggg
19107420DNAArtificial SequenceSynthetic Sequence 1074gggtcgtcgt
cgtggggggg
20107520DNAArtificial SequenceSynthetic Sequence 1075ggggacgatc
gtcggggggg
20107620DNAArtificial SequenceSynthetic Sequence 1076ggggacgtcg
tcgtgggggg
20107727DNAArtificial SequenceSynthetic Sequence 1077ggggtcgacg
tcgacgtcga ggggggg
27107821DNAArtificial SequenceSynthetic Sequence 1078ggggaaccgc
ggttgggggg g
21107921DNAArtificial SequenceSynthetic Sequence 1079ggggacgacg
tcgtgggggg g
21108023DNAArtificial SequenceSynthetic Sequence 1080tcgtcgtcgt
cgtcgtgggg ggg
23108115DNAArtificial SequenceSynthetic Sequence 1081tcctgccggg gaagt
15108215DNAArtificial
SequenceSynthetic Sequence 1082tcctgcaggg gaagt
15108315DNAArtificial SequenceSynthetic
Sequence 1083tcctgaaggg gaagt
15108415DNAArtificial SequenceSynthetic Sequence 1084tcctggcggg
caagt
15108515DNAArtificial SequenceSynthetic Sequence 1085tcctggcggg taagt
15108615DNAArtificial
SequenceSynthetic Sequence 1086tcctggcggg aaagt
15108715DNAArtificial SequenceSynthetic
Sequence 1087tccgggcggg gaagt
15108815DNAArtificial SequenceSynthetic Sequence 1088tcggggcggg
gaagt
15108915DNAArtificial SequenceSynthetic Sequence 1089tcccggcggg gaagt
15109015DNAArtificial
SequenceSynthetic Sequence 1090gggggacgtt ggggg
15109120DNAArtificial SequenceSynthetic
Sequence 1091ggggtttttt ttttgggggg
20109220DNAArtificial SequenceSynthetic Sequence 1092ggggcccccc
ccccgggggg
20109321DNAArtificial SequenceSynthetic Sequence 1093ggggttgttg
ttgttggggg g
21109430DNAArtificial SequenceSynthetic Sequence 1094tttttttttt
tttttttttt tttttttttt
30109530DNAArtificial SequenceSynthetic Sequence 1095aaaaaaaaaa
aaaaaaaaaa aaaaaaaaaa
30109630DNAArtificial SequenceSynthetic Sequence 1096cccccccccc
cccccccccc cccccccccc
30109730DNAArtificial SequenceSynthetic Sequence 1097cgcgcgcgcg
cgcgcgcgcg cgcgcgcgcg
30109812DNAArtificial SequenceSynthetic Sequence 1098gattttatcg tc
12109912DNAArtificial
SequenceSynthetic Sequence 1099tcgatttttc ga
12110012DNAArtificial SequenceSynthetic
Sequence 1100tcatttttat ga
12110112DNAArtificial SequenceSynthetic Sequence 1101gttttttacg
ac
12110212DNAArtificial SequenceSynthetic Sequence 1102tcaatttttt ga
12110312DNAArtificial
SequenceSynthetic Sequence 1103acgtttttac gt
12110412DNAArtificial SequenceSynthetic
Sequence 1104tcgtttttac ga
12110516DNAArtificial SequenceSynthetic Sequence 1105tcgattttta
cgtcga
16110614DNAArtificial SequenceSynthetic Sequence 1106aattttttaa cgtt
14110714DNAArtificial
SequenceSynthetic Sequence 1107tcgtttttta acga
14110814DNAArtificial SequenceSynthetic
Sequence 1108acgtttttta acgt
14110913DNAArtificial SequenceSynthetic Sequence 1109gatttttatc
gtc
13111014DNAArtificial SequenceSynthetic Sequence 1110gacgattttt cgtc
14111114DNAArtificial
SequenceSynthetic Sequence 1111gattttagct cgtc
14111212DNAArtificial SequenceSynthetic
Sequence 1112gatttttacg tc
12111310DNAArtificial SequenceSynthetic Sequence 1113attttatcgt
10111414DNAArtificial SequenceSynthetic Sequence 1114aacgattttt cgtt
14111512DNAArtificial
SequenceSynthetic Sequence 1115tcacttttgt ga
12111610DNAArtificial SequenceSynthetic
Sequence 1116tcgtatttta
10111714DNAArtificial SequenceSynthetic Sequence 1117acttttgtac
cggt
14111818DNAArtificial SequenceSynthetic Sequence 1118tcgatttttc gacgtcga
18111912DNAArtificial
SequenceSynthetic Sequence 1119acgatttttc gt
12112010DNAArtificial SequenceSynthetic
Sequence 1120gatgatcgtc
10112110DNAArtificial SequenceSynthetic Sequence 1121tcgatgtcga
10112210DNAArtificial SequenceSynthetic Sequence 1122tcatgtatga
10112310DNAArtificial
SequenceSynthetic Sequence 1123gtgttacgac
10112410DNAArtificial SequenceSynthetic
Sequence 1124tcaatgttga
10112510DNAArtificial SequenceSynthetic Sequence 1125acgtgtacgt
10112610DNAArtificial SequenceSynthetic Sequence 1126tcgtgtacga
10112714DNAArtificial
SequenceSynthetic Sequence 1127tcgatgtacg tcga
14112812DNAArtificial SequenceSynthetic
Sequence 1128aatgttaacg tt
12112912DNAArtificial SequenceSynthetic Sequence 1129tcgtgttaac
ga
12113012DNAArtificial SequenceSynthetic Sequence 1130acgtgttaac gt
12113111DNAArtificial
SequenceSynthetic Sequence 1131gatgtatcgt c
11113212DNAArtificial SequenceSynthetic
Sequence 1132gacgatgtcg tc
12113312DNAArtificial SequenceSynthetic Sequence 1133gatgagctcg
tc
12113410DNAArtificial SequenceSynthetic Sequence 1134gatgtacgtc
1011358DNAArtificial
SequenceSynthetic Sequence 1135atgatcgt
8113612DNAArtificial SequenceSynthetic
Sequence 1136aacgatgtcg tt
12113710DNAArtificial SequenceSynthetic Sequence 1137tcactggtga
1011388DNAArtificial SequenceSynthetic Sequence 1138tcgtatga
8113912DNAArtificial
SequenceSynthetic Sequence 1139actggtaccg gt
12114016DNAArtificial SequenceSynthetic
Sequence 1140tcgatgtcga cgtcga
16114110DNAArtificial SequenceSynthetic Sequence 1141acgatgtcgt
10114231DNAArtificial SequenceSynthetic Sequence 1142tgcaggaagt
ccgggttttc cccaaccccc c
3111436DNAArtificial SequenceSynthetic Sequence 1143gacgtt
611446DNAArtificial
SequenceSynthetic Sequence 1144gtcgtt
611458DNAArtificial SequenceSynthetic
Sequence 1145tcgtcgtt
8
User Contributions:
Comment about this patent or add new information about this topic:
People who visited this patent also read: | |
Patent application number | Title |
---|---|
20220168041 | MEDICAL TOOL POSITIONING DEVICES, SYSTEMS, AND METHODS OF USE AND MANUFACTURE |
20220168040 | TREATMENT INSTRUMENT |
20220168039 | METHOD OF MANUFACTURING A FLEXIBLE CIRCUIT ELECTRODE FOR ELECTROSURGICAL INSTRUMENT |
20220168038 | METHOD FOR TISSUE TREATMENT BY SURGICAL INSTRUMENT |
20220168037 | ENERGY-ACTIVATION MECHANISMS FOR SURGICAL INSTRUMENTS |