Patent application title: REGULATOR FOR FLOWERING TIME, TRANSGENIC PLANT TRANSFORMED WITH THE SAME, AND METHOD FOR REGULATING FLOWERING TIME
Inventors:
Gynheung An (Pohang-City, KR)
Shinyoung Lee (Kwangju, KR)
Dong-Hoon Jeong (Pohang-City, KR)
Jihye Yoo (Seoul, KR)
Choong-Hwan Ryu (Pohang-City, KR)
Jong-Seong Jeon (Pohang-City, KR)
Sung-Ryul Kim (Pohang-City, KR)
Young-Ock Kim (Pohang-City, KR)
Joonyul Kim (Pohang-City, KR)
Suyoung An (Pohang-City, KR)
Jong-Jin Han (Pohang-City, KR)
Min-Jung Han (Pohang-City, KR)
Assignees:
POSCO
POSTECH FOUNDATION
IPC8 Class: AC12N1582FI
USPC Class:
800290
Class name: Multicellular living organisms and unmodified parts thereof and related processes method of introducing a polynucleotide molecule into or rearrangement of genetic material within a plant or plant part the polynucleotide alters plant part growth (e.g., stem or tuber length, etc.)
Publication date: 2009-05-14
Patent application number: 20090126047
Inventors list |
Agents list |
Assignees list |
List by place |
Classification tree browser |
Top 100 Inventors |
Top 100 Agents |
Top 100 Assignees |
Usenet FAQ Index |
Documents |
Other FAQs |
Patent application title: REGULATOR FOR FLOWERING TIME, TRANSGENIC PLANT TRANSFORMED WITH THE SAME, AND METHOD FOR REGULATING FLOWERING TIME
Inventors:
GYNHEUNG AN
SHINYOUNG LEE
DONG-HOON JEONG
JIHYE YOO
CHOONG-HWAN RYU
JONG-SEONG JEON
SUNG-RYUL KIM
YOUNG-OCK KIM
JOONYUL KIM
SUYOUNG AN
JONG-JIN HAN
MIN-JUNG HAN
Agents:
JHK LAW
Assignees:
POSCO
Origin: LA CANADA, CA US
IPC8 Class: AC12N1582FI
USPC Class:
800290
Abstract:
The present invention relates to a flowering-time and/or stem elongation
regulator isolated from rice, which is selected from OsMADS50, OsMADSS1,
OsMADS56, OsMADS14, OsTRX1, OsVIN1, OsCOL4 and OsCOLS, a DNA construct
containing the regulator, a transgenic plant, a part thereof, and plant
cell transformed with the DNA construct, and method to control
flowering-time and/or stem elongation using the regulator. In the present
invention, the flowering-time and/or stem elongation can be controlled,
and thereby, various agricultural benefits obtained.Claims:
1. A flowering-time regulator having a gene selected form the group
consisting of OsMADS50 gene having the nucleotide sequence of SEQ ID NO:
1; OsMADS51 gene having the nucleotide sequence of SEQ ID NO: 3; OsMADS56
gene having the nucleotide sequence of SEQ ID NO: 5; truncated OsMADS14
gene of SEQ ID NO: 17 wherein the 3'-terminal region containing the C
domain coding sequence is deleted; OsTRX1 gene having the nucleotide
sequence of SEQ ID NO: 7; OsVIN2 gene having the nucleotide sequence of
SEQ ID NO: 9; OsCOL4 gene having the nucleotide sequence of SEQ ID NO: 1;
and OsCOL8 gene having the nucleotide sequence of SEQ ID NO: 13.
2. The flowering-time regulator according to claim 1, which has a gene selected from the group consisting of OsMADS50 gene having the nucleotide sequence of SEQ ID NO: 1; OsMADS51 gene having the nucleotide sequence of SEQ ID NO: 3; OsTRX1 gene having the nucleotide sequence of SEQ ID NO: 7; OsVIN2 gene having the nucleotide sequence of SEQ ID NO: 9; and OsCOL8 gene having the nucleotide sequence of SEQ ID NO: 13, and which has a function of activating flowering.
3. The flowering-time regulator according to claim 1, which has a gene selected from the group consisting of OsMADS56 gene having the nucleotide sequence of SEQ ID NO: 5; and OsCOL4 gene having the nucleotide sequence of SEQ ID NO: 11, and which has a function of inhibiting flowering.
4. The flowering-time regulator according to claim 1, which has truncated OsMADS14 gene of SEQ ID NO: 17 wherein the 3'-terminal region containing the C domain coding sequence is deleted, and which has an activity to activate flowering under short-day conditions and to inhibit flowering under long-day conditions.
5. A flowering-time regulator of monocotyledon, which has a counterpart gene corresponding to a rice gene selected from the group consisting of OsMADS50 gene having the nucleotide sequence of SEQ ID NO: 1; OsMADS51 gene having the nucleotide sequence of SEQ ID NO: 3; OsMADS56 gene having the nucleotide sequence of SEQ ID NO: 5; Truncated OsMADS14 gene of SEQ ID NO: 17 wherein the 3'-terminal region containing the C domain coding sequence is deleted; OsTRX1 gene having the nucleotide sequence of SEQ ID NO: 7; OsVIN2 gene having the nucleotide sequence of SEQ ID NO: 9; OsCOL4 gene having the nucleotide sequence of SEQ ID NO: 11; and OsCOL8 gene having the nucleotide sequence of SEQ ID NO: 13.
6. A stem elongation regulator of rice which has OsMADS50 gene having the nucleotide sequence of SEQ ID NO: 1.
7. A flowering-time regulating protein, which is encoded by the regulator of claim 1, and has an amino acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, and SEQ ID NO: 18.
8. A DNA construct containing a flowering-time regulator having a gene selected from the group consisting of OsMADS50 gene having the nucleotide sequence of SEQ ID NO: 1; OsMADS51 gene having the nucleotide sequence of SEQ ID NO: 3; OsMADS56 gene having the nucleotide sequence of SEQ ID NO: 5; Truncated OsMADS14 gene of SEQ ID NO: 17 wherein the 3'-terminal region containing the C domain coding sequence is deleted; OsTRX1 gene having the nucleotide sequence of SEQ ID NO: 7; OsVIN2 gene having the nucleotide sequence of SEQ ID NO: 9; OsCOL4 gene having the nucleotide sequence of SEQ ID NO: 11; and OsCOL8 gene having the nucleotide sequence of SEQ ID NO: 13,wherein the flowering-time regulator is overexpressed by operable linkage to a strong promoter operable in plants, or an enhancer, or is suppressed by insertion of a foreign gene which can be inserted into a plant gene, or an endogenous transposon, or by deletion of the whole or part of the sequence.
9. The DNA construct according to claim 8, wherein the flowering-time regulator is overexpressed by operable linkage to maize ubiquitin (ubi) promoter.
10. The DNA construct according to claim 8, wherein the flowering-time regulator is overexpressed by insertion of T-DNA containing 35S enhancer into the promoter region of the regulator.
11. The DNA construct according to claim 8, wherein the flowering-time regulator is suppressed by insertion of T-DNA or an endogenous transposon.
12. The DNA construct according to claim 8, wherein the flowering-time regulator is suppressed by deletion of the whole or part of the sequence.
13. The DNA construct according to claim 8, containing the flowering-time regulator having the OsMADS50 gene having the nucleotide sequence of SEQ ID NO: 1, wherein the OsMADS50 gene is suppressed by insertion of T-DNA into the fourth intron.
14. The DNA construct according to claim 8, containing the flowering-time regulator having the gene selected from the group consisting of OsCOL4 gene having the nucleotide sequence of SEQ ID NO: 11; and OsCOL8 gene having the nucleotide sequence of SEQ ID NO: 13, wherein the flowering-time regulator is suppressed by insertion of T-DNA into the first exon or 3' UTR region.
15. A transgenic plant, a part thereof, or a plant cell transformed by a DNA construct containing a flowering-time regulator having a gene selected from the group consisting of OsMADS50 gene having the nucleotide sequence of SEQ ID NO: 1; OsMADS51 gene having the nucleotide sequence of SEQ ID NO: 3; OsMADS56 gene having the nucleotide sequence of SEQ ID NO: 5; Truncated OsMADS14 gene of SEQ ID NO: 17 wherein the 3'-terminal region containing the C domain coding sequence is deleted; OsTRX1 gene having the nucleotide sequence of SEQ ID NO: 7; OsVIN2 gene having the nucleotide sequence of SEQ ID NO: 9; OsCOL4 gene having the nucleotide sequence of SEQ ID NO: 11; and OsCOL8 gene having the nucleotide sequence of SEQ ID NO: 13,wherein the flowering-time regulator is overexpressed by operable linkage with a strong promoter workable in plant, or an enhancer, or is suppressed by insertion of a foreign gene which can be inserted into a plant gene, or an endogenous transposon, or by deletion of the whole or part of the sequence, to exhibit late- or early-flowering phenotype.
16. The transgenic plant, a part thereof or a plant cell according to claim 15, which transformed with the DNA construct containing the flowering-time regulator having the gene selected from the group consisting of OsMADS50 gene having the nucleotide sequence of SEQ ID NO: 1; OsMADS51 gene having the nucleotide sequence of SEQ ID NO: 3; OsTRX1 gene having the nucleotide sequence of SEQ ID NO: 7; OsVIN2 gene having the nucleotide sequence of SEQ ID NO: 9; and OsCOL8 gene having the nucleotide sequence of SEQ ID NO: 13, wherein the flowering-time regulator is overexpressed by operable linkage with maize ubiquitin (ubi) promoter, to exhibit early-flowering phenotype.
17. The transgenic plant, a part thereof or a plant cell according to claim 15, which transformed with the DNA construct containing the flowering-time regulator having the gene selected from the group consisting of OsMADS50 gene having the nucleotide sequence of SEQ ID NO: 1; OsMADS51 gene having the nucleotide sequence of SEQ ID NO: 3; OsTRX1 gene having the nucleotide sequence of SEQ ID NO: 7; OsVIN2 gene having the nucleotide sequence of SEQ ID NO: 9; and OsCOL8 gene having the nucleotide sequence of SEQ ID NO: 13, wherein the flowering-time regulator is overexpressed by insertion of T-DNA containing a 35S enhancer into the promoter region, to exhibit early-flowering phenotype.
18. The transgenic plant, a part thereof or a plant cell according to claim 15, which is transformed with the DNA construct containing the flowering-time regulator having the gene selected from the group consisting of OsMADS50 gene having the nucleotide sequence of SEQ ID NO: 1; OsMADS51 gene having the nucleotide sequence of SEQ ID NO: 3; OsTRX1 gene having the nucleotide sequence of SEQ ID NO: 7; OsVIN2 gene having the nucleotide sequence of SEQ ID NO: 9; and OsCOL8 gene having the nucleotide sequence of SEQ ID NO: 13, wherein the flowering-time regulator is suppressed by insertion of T-DNA or an endogenous transposon, to exhibit a late-flowering phenotype.
19. The transgenic plant, a part thereof or a plant cell according to claim 15, which is transformed with the DNA construct containing the flowering-time regulator having the gene selected from the group consisting of OsMADS50 gene having the nucleotide sequence of SEQ ID NO: 1; OsMADS51 gene having the nucleotide sequence of SEQ ID NO: 3; OsTRX1 gene having the nucleotide sequence of SEQ ID NO: 7; OsVIN2 gene having the nucleotide sequence of SEQ ID NO: 9; and OsCOL8 gene having the nucleotide sequence of SEQ ID NO: 13, wherein the flowering-time regulator is suppressed by modification of the whole or part of the gene, to exhibit a late-flowering phenotype.
20. The transgenic plant, a part thereof or a plant cell according to claim 15, which is transformed with the DNA construct containing the flowering-time regulator having OsMADS50 gene having the nucleotide sequence of SEQ ID NO: 1, wherein the OsMADS50 gene is suppressed by insertion of T-DNA into the fourth intron, ortransformed with the DNA construct containing the flowering-time regulator having OsCOL8 gene having the nucleotide sequence of SEQ ID NO: 13, wherein the OsCOL8 gene is suppressed by insertion of T-DNA into the first exon or 3' UTR region,to exhibit a late-flowering phenotype.
21. The transgenic plant, a part thereof or a plant cell according to claim 15, which is transformed with the DNA construct containing the flowering-time regulator having the gene selected from the group consisting of OsMADS56 gene having the nucleotide sequence of SEQ ID NO: 5 and OsCOL4 gene having the nucleotide sequence of SEQ ID NO: 11, wherein the flowering-time regulator is overexpressed by operable linkage with a strong promoter, or insertion of a foreign gene containing an enhancer which can be inserted into a plant gene into a promoter region, to exhibit a late-flowering phenotype.
22. The transgenic plant, a part thereof or a plant cell according to claim 15, which is transformed with the DNA construct containing the flowering-time regulator having the gene selected from the group consisting of OsMADS56 gene having the nucleotide sequence of SEQ ID NO: 5 and OsCOL4 gene having the nucleotide sequence of SEQ ID NO: 11, the flowering-time regulator is suppressed by insertion of T-DNA or an endogenous transposon, or modification of the whole or part of the sequence, to exhibit an early-flowering phenotype.
23. The transgenic plant, a part thereof or a plant cell according to claim 15, which is transformed with the DNA construct containing the flowering-time regulator having truncated OsMADS14 gene of SEQ ID NO: 17 wherein the 3'-terminal region containing the C domain coding sequence is deleted, wherein the C domain region deleted partial OsMADS14 protein is overexpressed, to exhibit an early-flowering phenotype.
24. The transgenic plant, a part thereof or a plant cell according to claim 1, wherein the plant is rice.
25. A method to regulate flowering-time, comprising the step of inducing overexpression of a flowering-time regulator by operable linkage with a strong promoter workable in plant or an enhancer workable in plant, or inducing suppression by insertion of a foreign gene which can be inserted into a plant gene or an endogenous transposon, or by deletion of the whole or part of the following sequence, to activate or inhibit flowering of plant,wherein the flowering-time regulator has a gene selected from the OsMADS50 gene having the nucleotide sequence of SEQ ID NO: 1; OsMADS51 gene having the nucleotide sequence of SEQ ID NO: 3; OsMADS56 gene having the nucleotide sequence of SEQ ID NO: 5; Truncated OsMADS14 gene of SEQ ID NO: 17 wherein the 3'-terminal region containing the C domain coding sequence is deleted; OsTRX1 gene having the nucleotide sequence of SEQ ID NO: 7; OsVIN2 gene having the nucleotide sequence of SEQ ID NO: 9; OsCOL4 gene having the nucleotide sequence of SEQ ID NO: 11; and OsCOL8 gene having the nucleotide sequence of SEQ ID NO: 13.
26. The method according to claim 25, comprising the step of inducing overexpression of the flowering-time regulator having the gene selected from the group consisting of OsMADS50 gene having the nucleotide sequence of SEQ ID NO: 1; OsMADS51 gene having the nucleotide sequence of SEQ ID NO: 3; OsTRX1 gene having the nucleotide sequence of SEQ ID NO: 7; OsVIN2 gene having the nucleotide sequence of SEQ ID NO: 9; and OsCOL8 gene having the nucleotide sequence of SEQ ID NO: 13, by operably linking with maize ubiquitin (ubi) promoter, to activate flowering of plant.
27. The method according to claim 25, comprising the step of inducing overexpression of the flowering-time regulator having the gene selected from the group consisting of OsMADS50 gene having the nucleotide sequence of SEQ ID NO: 1; OsMADS51 gene having the nucleotide sequence of SEQ ID NO: 3; OsTRX1 gene having the nucleotide sequence of SEQ ID NO: 7; OsVIN2 gene having the nucleotide sequence of SEQ ID NO: 9; and OsCOL8 gene having the nucleotide sequence of SEQ ID NO: 13, by insertion T-DNA containing a 35S enhancer into the promoter region of the regulator, to activate flowering of plant.
28. The method according to claim 25, comprising the step of inducing suppression of the flowering-time regulator having the gene selected from the group consisting of OsMADS50 gene having the nucleotide sequence of SEQ ID NO: 1; OsMADS51 gene having the nucleotide sequence of SEQ ID NO: 3; OsTRX1 gene having the nucleotide sequence of SEQ ID NO: 7; OsVIN2 gene having the nucleotide sequence of SEQ ID NO: 9; and OsCOL8 gene having the nucleotide sequence of SEQ ID NO: 13, by insertion of T-DNA or an endogenous transposon, to inhibit flowering of plant.
29. The method according to claim 25, comprising the step of inducing suppression of the flowering-time regulator having the gene selected from the group consisting of OsMADS50 gene having the nucleotide sequence of SEQ ID NO: 1; OsMADS51 gene having the nucleotide sequence of SEQ ID NO: 3; OsTRX1 gene having the nucleotide sequence of SEQ ID NO: 7; OsVIN2 gene having the nucleotide sequence of SEQ ID NO: 9; and OsCOL8 gene having the nucleotide sequence of SEQ ID NO: 13, by modification of the whole or part of the sequence, to inhibit flowering of plant.
30. The method according to claim 25, comprising the step ofinducing suppression of OsMADS50 gene having the nucleotide sequence of SEQ ID NO: 1 by insertion of T-DNA into the fourth intron, orinducing suppression of OsCOL8 gene having the nucleotide sequence of SEQ ID NO: 13 by insertion of T-DNA into the first exon or 3' UTR region,to inhibit flowering of plant.
31. The method according to claim 25, comprising the step of inducing overexpression of the flowering-time regulator having the gene selected from the group consisting of OsMADS56 gene having the nucleotide sequence of SEQ ID NO: 5 and OsCOL4 gene having the nucleotide sequence of SEQ ID NO: 11, by operably linking with a strong promoter, or inserting a foreign gene containing an enhancer which can be inserted into a plant gene into a promoter region, to inhibit flowering of plant.
32. The method according to claim 25, comprising the step of inducing suppression of the flowering-time regulator having the gene selected from the group consisting of OsMADS56 gene having the nucleotide sequence of SEQ ID NO: 5 and OsCOL4 gene having the nucleotide sequence of SEQ ID NO: 11, by insertion of T-DNA or an endogenous transposon, or deletion of the whole or part of the sequence, to activate flowering of plant.
33. The method according to claim 25, comprising the steps of deleting 3'-terminal region having a nucleotide sequence of SEQ ID NO: 14 or SEQ ID NO: 15, and overexpressing C domain deleted partial OsMADS14 protein having an amino acid sequence of SEQ ID NO: 18, to activate flowering of plant.
34. The method according to claim 25, wherein the plant is rice.
35. A method to prepare a flowering-time regulated transgenic plant, a part thereof, or a plant cell, comprising the steps of:providing a plant cell;transforming the plant cell with the DNA construct of claim 8 and cultivating the transformed cell.
36. A method to regulate stem elongation, comprising the step of inducing overexpression or suppression of OsMADS50 gene having a nucleotide sequence of SEQ ID NO: 1.
Description:
FIELD OF THE INVENTION
[0001]The present invention relates to a regulator for flowering-time and/or internodes elongation, a transgenic plant transformed with the regulator, and a method to regulate flowering-time and/or stein elongation in plant.
BACKGROUND OF THE INVENTION
[0002]The growth phase of plants generally includes a vegetative growth phase and a reproductive growth phase. The transition from vegetative to reproductive growth is affected by various flowering signals. The flowering signals are affected by various factors, such as genetic factors such as genotype, and environmental factors such as photoperiod and light intensity, etc. (Dung et al., 1998; Yamamoto et al., 1998). The transition in the growth phase leads to various morphological changes of plant, which is interesting from a scientific viewpoint. Furthermore, due to the economic benefits gained by flowering regulation, many studies on flowering mechanisms have been carried out.
[0003]In particular, molecular genetic studies of Arabidopsis (hereafter, Arabidopsis) have shown the functions of the flowering regulatory genes and their interrelationships, elucidating the signaling pathway of flowering. In Arabidopsis, the flowering is affected by external signals, such as light, temperature, photoperiod, etc., and internal signals such as nutritive conditions, hormones, etc. The flowering pathway generally includes the photoperiod-dependent pathway, the vernalization-dependent pathway, the GA (gibberellin)-dependent pathway, and the endogenous pathway.
[0004]In rice, it has been reported that flowering-time is mainly controlled by the photoperiod-dependent pathway and the endogenous pathway (Yamamoto et al., 1998). Recently, several genes which are thought to be involved in the photoperiod-dependent pathway in rice have been isolated and identified, characterizing the photoperiod-dependent pathway to some degree. (Yano et al., 2001 Mouradov et al., 2002). Firstly, several specific gene loci which are involved in controlling photoperiod sensitivity, such as Se (Photoperiodic sensitivity)1 (Se1), Se3-Se7, and EE1-E3, have been identified (Poonyarit et al., 1989; Sano, 1992; Tsai, 1995; Yokoo et al., 1980; Yokoo and Okuno, 1993). (Furthermore, by quantitative trait loci (QTL) analyses using molecular level markers, several tens of gene loci involved in controlling heading date, such as Heading date 1 (Hd1), Heading date 6 (Hd6), Heading date 3a (Hd3a), etc., have been detected (Li et al., 1995; Lin et al., 1996, 1998; Maheswaran et al., 2000; Yano et al., 1997; Xiao et al., 1995). Among the above genes, Se5, Hd1, Hd6 and Hd3a are counterparts of LONG HYPOCOTYL 1 (HY1), CONSTANS (CO), CASEIN KINASE 2 (CK2) and FLOWERING LOCUS T (FT) of Arabidopsis, respectively, and they are expected to have biochemical functions similar to the counterparts in Arabidopsis.
[0005]However, in some cases, the above genes of rice and Arabidopsis show different responses to photoperiod. CO of Arabidopsis is a gene which is involved in long-day (LD) promotion pathway to activate flowering. There are orthologs of CONSTANS in rice, and among them, Hd1 (Heading date1) gene regulates the flowering-time. Hd1 gene of rice, which encodes a protein containing a zinc finger domain and a nuclear localization signal, increases expression of Hd3a gene to activate flowering under short-day (SD) conditions, whereas it decreases expression of Hd3a gene to inhibit flowering under LD conditions (Izawa et al., 2002). In Arabidopsis, the CO gene, which is an ortholog of Hd1 of rice, increases expression of the FT gene (an ortholog of Hd3a of rice) to activate flowering under long-day conditions. However, the CO does not act as a flowering inhibitor under short-day conditions (Putterill et al., 1995). The molecular level understanding of such different photoperiod reactions depending on plant species is expected to provide a clue for understanding the differences between LD plants and SD plants.
[0006]Although flowering-relating genes such as the above have been discovered, they are few in number. Furthermore, rice-specific genes distinguished from Arabidopsis genes have been mostly unknown, and long-day specific flowering regulators and regulators for controlling the endogenous pathway which is different from the photoperiod pathway also have been mostly unknown. Considering that flowering-time is a key trait in determining cropping season and regional adaptability, and that significant agricultural profit can be obtained by controlling flowering-time, it is necessary to elucidate the flowering-time regulating pathway in rice and to find the genes involved in the pathway.
[0007]The present inventors identified useful flowering regulators in rice and investigated the characteristics thereof, to achieve the present invention. In the present invention, previously unknown flowering regulators have been, found, as well as the fact that their functions are specifically differentiated in rice.
DETAILED DESCRIPTION OF THE ILLUSTRATED EMBODIMENTS
[0008]The object of the present invention is to find the genes involved in regulating flowering-time in rice, and their working conditions, for agricultural benefit.
[0009]To achieve this object, the present inventors screened rice mutant lines exhibiting early- or late-flowering phenotype from T-DNA-inserted lines of rice, and analyzed genotypes of the screened mutant lines, to isolate flowering-time regulators of rice including the counterparts of flowering-time regulators of Arabidopsis, such AGL20, CONSTANS, etc., and elucidated the functions and working conditions of the isolated regulators by additional transformation analyses, to complete the present invention. Furthermore, some of the regulators are found to stimulate internodes elongation in rice. The flowering-time regulators of rice are expected to exhibit similar effects in other monocotyledons which are developmentally homologous, such as corn, barley, wheat, etc., as in rice.
[0010]More specifically, the present invention provides 1) flowering-time and/or internodes elongation regulators; 2) flowering-time regulating proteins encoded by the regulators; 3) constructs wherein the regulator is overexpressed or suppressed; 4) transgenic plants, parts thereof, or plant cells transformed with the construct; 5) methods to prepare the transgenic plants; and 6) methods to regulate flowering-time and/or internodes elongation using the regulators.
[0011]The present invention provides a regulator involved in a regulating mechanism of flowering-time and/or internodes elongation.
[0012]In the present invention, the mutant lines exhibiting alteration in flowering-time, such as those exhibiting early- or late-flowering phenotypes, are screened from T-DNA-tagged transgenic plants, and the nucleotide sequence of the regions adjacent to the inserted T-DNA is analyzed, to find several flowering-time regulators as described below.
[0013]One such flowering-time regulator is Oryza stavis MADS50 (hereinafter, referred to as "OsMADS50"), which is one of the MADS-box genes of rice. The nucleotide sequence thereof is shown in SEQ ID NO: 1.
[0014]Said regulator is isolated by PCR from the gene having Accession No. AB003328 registered at the NCBI (National Center for Biotechnology Information) database, using a pair of primers specific thereto. The nucleotide sequence of the isolated regulator is analyzed and the regulator is named OsMADS50. OsMADS50 is one of the MADS-box genes, and a conventional MIKC [(MAPS, intervening, Keratin-like, and C-terminal domain)]-type MADS-box gene. The sequence of the genomic DNA of the OsMADS50 gene has been registered to have the Accession No. AC098695. The OsMADS50 gene is present in chromosome 3, and has seven (7) exons and six (6) introns (see FIG. 2a, and alvarez-Buylla et al., 2000; Lee et al., 2003). Among the MIKC-type MADS-box proteins present in rice (Lee et al., 2003), the OsMADS50 protein is the most homologous (60.8%) to the OsMADS56 protein.
[0015]OsMADS50 is found to be a flowering activator (accelerating factor) in rice, acting as a rice ortholog of SUPPRESSOR OF OVEREXPRESSION OF CO1/AGAMOUS-LIKE 20 (SOC1/AGL20) in Arabidopsis. Such a flowering accelerating effect of OsMADS50 can be shown by the fact that in a OsMADS50 knockout (KO) line wherein the OsMADS50 function is suppressed by T-DNA insertion, etc., a OsMADS50 RNAi (interference) line wherein OsMADS50 region, or a part or all of M, I, K and C domains of MADS-box present in OsMADS50 are deleted, or a modified line wherein a part or all of the above domains are modified by nt substitution, etc., flowering is delayed, whereas in a OsMADS50 overexpressed line (e.g., ubi:OsMADS50) with a strong promoter which is operable in plant, such as actin, cytochrome C, or maize ubiquitin (ubi) promoters, flowering is extremely accelerated at the callus stage.
[0016]In the present invention, the overexpression of a gene may be induced by being operably linked to a strong promoter operable in plants, such as actin promoter, cytochrome C, ubiquitin (ubi) promoter (Pubi), etc., or inserting a DNA fragment containing an enhancer into a proper site. The suppression of a gene may be performed by a foreign gene which can be inserted in to a plant gene, such as T-DNA, an endogeneous transposon such as TOS17, a mutation induced by X-ray or gamma-ray irradiation, or by RNAi or anti-sense methods. The overexpression and suppression methods above are also applied to the genes of the present invention.
[0017]The analyses of OsMADS50 KO, OsMADS50 RNAi, and ubi:OsMADS50 plants shows that OsMADS50 is an upstream regulator of OsMADS1, OsMADS14, OsMADS15, OsMADS18 and Hd3a, which are involved in the flowering mechanism in rice. This result shows that the OsMADS50 gene regulates flowering of rice not through an independent and direct way, but by controlling various genes involved in flowering mechanisms in rice in a more fundamental way.
[0018]Further, it is observed that an OsMADS50 suppressed line displays considerable internode elongation compared with wild type, which shows that the OsMADS50 gene controls stein elongation as well as flowering-time. That is, in the present invention, it is observed that the mutant line having a suppressed OsMADS50 gene exhibits late-flowering but elongated-internode phenotype, whereby it is established that the OsMADS50 gene is involved in stem elongation as well as control of flowering-time.
[0019]Further, it is also observed that in the mutant line with suppressed OsMADS50 gene, flowering-time is delayed under long-day conditions only, which shows that the OsMADS50 gene is a flowering activator working under long-day conditions.
[0020]In addition to the OsMADs50 gene, OsMADS51, OsMADS56, OsTRX1 and OsVIN2 genes are segregated as a flowering-time regulator working by overexpression or suppression.
[0021]The OsMADS51 gene has been registered in the NCBI database under Accession No. AB003327 (SEQ ID NO: 3). The organ-dependent expression profiles of the gene have been known, but its function is not yet known (Shinozuka et al., 1999). The sequence of the genomic DNA of the OsMADS51 gene has been registered under Accession No. AP008207. In the present invention, the OsMADS51 gene was sought out as a gene which alters flowering-time by overexpression or suppression, and isolated by PCR. In the present invention, it is shown that in a line overexpressing OsMADS51, flowering-time is accelerated by 1 to 2 weeks under field conditions, and in a OsMADS51 knockout line, flowering-time is delayed under short-day conditions (see FIG. 11), suggesting that the OsMADS51 gene is also a flowering-time regulator.
[0022]As another gene which alters flowering-time by overexpression or suppression, the OsMADS56 gene was isolated, characterized, and registered at NCBI with the Accession No. AY345224 (SEQ ID NO: 5). The genomic DNA sequence of the OsMADS56 gene has been registered under Accession No. AC092697. In the present invention, the flowering-time is delayed by 1 to 2 weeks in an OsMADS56 overexpressed mutant. When the photoperiod condition is controlled, flowering-time is not altered under short-day conditions, whereas it is delayed by approximately one month under long-day conditions (see FIG. 12).
[0023]As another gene which alters flowering-time by suppression due to T-DNA insertion, OsTRX1 and OsVIN2 genes were studied, and their nucleotide sequences are shown in SEQ ID NO: 7 (OsTRX1) and SEQ ID NO: 9 (OsVIN2), respectively. The genomic DNA sequences of these genes have been registered under Accession Nos. AP008215 (OsTRX1) and AP008208 (OsVIN2), respectively. In the present invention, the flowering is delayed by at least one month in an OsTRX1 knockout line under field conditions. In an OsVIN2 knockout line, flowering-time is delayed by approximately 32 days under long-day conditions, and delayed by approximately 10 days under short-day conditions. These results show that OsTRX1 and OsVIN2 genes also act as flowering regulators (see FIG. 13).
[0024]As another gene which alters flowering-time by suppression due to T-DNA insertion, the OsCOL4 (Oryza satvia CONSTANS Like 4) gene was investigated. The nucleotide sequence of the OsCOL4 gene has been known through the Rice Genome Project (SEQ ID NO: 11). The gene has been known as a rice homolog of the CONSTANS gene of Arabidopsis, but its function has been unknown. Its genomic DNA sequence has been registered under Accession No. AP004063.
[0025]In the present invention, the OsCOL4 activated mutant line (by induction of overexpression, etc.) exhibits delayed flowering-time phenotype with a delay of 15 or more days compared with wild-type (see FIG. 14), whereas the OsCOL4 suppressed mutant line exhibits early flowering-time phenotype which is early by approximately 10 days compared with wild-type. These results show that the OsCOL4 gene acts as a flowering inhibitor. The OsCOL4 gene only has a flowering inhibiting function, and has no effect on vegetative growth such as stem elongation. Upon investigating the alteration of flowering-time of OsCOL4 modified mutants depending on photoperiod conditions, it is found that the OsCOL4 overexpressed mutant exhibits a late-flowering phenotype compared with a wild-type line under both long-day and short-day conditions, whereas the OsCOL4 suppressed mutant exhibits an early-flowering phenotype compared with wild-type under both long-day and short-day conditions. These results show that the OsCOL4 gene acts as a flowering inhibitor in rice, regardless of the photoperiod conditions.
[0026]In all embodiment of the present invention, the activation of the OsCOL4 gene may be induced by a 35S enhancer in T-DNA inserted into a promoter region of OsCOL4 gene (see FIGS. 15 and 16), or by a ubiquitin (ubi) promoter (Pubi) operably linked thereto (see FIG. 17). The suppression of the OsCOL4 gene may be induced by an insertion of T-DNA into the first exon or 3'UTR region of the OsCOL4 gene (see FIG. 18).
[0027]Many flowering regulators of plants have been known, most of which are flowering-time activators, but only few of them are flowering inhibitors. Therefore, it is very valuable to find flowering inhibitors such as OsMADS56 and OsCOL4. In activating flowering, the flowering inhibitor suppressed mutants can be more stably inherited than the flowering activator overexpressed mutants. Further, the OsCOL4 suppressed mutants can be obtained by ways other than transformation, such as mutation by an endogenous transposon of rice, Tos17, and thus, problems of genetically modified organisms (GMO) can be avoided.
[0028]As another flowering regulator, OsCOL8 (Oryza sativa CONSTANS Like 8) is investigated, which is a CONSTANS like gene present in rice, and similar to the VRN2 gene controlling flowering-time in wheat by vernalization treatment. The nucleotide sequence of the OsCOL8 gene has been known through the Rice Genome Project (SEQ ID NO: 13), but the function thereof has been unknown. The genomic DNA sequence of the gene has been registered under Accession No. AC079874. In the present invention, it is found that an OsCOL8 suppressed mutant shows no alteration in flowering-time under long-day conditions, whereas it shows late-flowering phenotype under short-day conditions. These results show that the OsCOL8 gene is a flowering activator in plants under short-day conditions.
[0029]The flowering regulators of the present invention may act independently from each other. Further, each of the regulators may more effectively control flowering-time by acting in association with another regulator with a similar or opposed regulation activity to create offset or synergy of the flowering regulating action.
[0030]In addition to the above genes, OsMADS14 is investigated as another flowering regulator. The genomic DNA sequence and cDNA sequence of the OsMADS14 gene are shown in SEQ ID NO: 15 and SEQ ID NO: 16, respectively. APETALA1 (AP1) gene of Arabidopsis has been known- to be involved in the formation of floral organs and regulation of flowering-time. At least four (4) genes have been known as AP1 like genes present in rice. The four genes have been named OsMADS14, OsMADS15, OsMADS18 and OsMADS20, respectively. Among them, the OsMADS14 gene has been first cloned as a coding gene of a reciprocally binding partner of an OsMADS6 protein, and it has been known that the overexpression of the gene induces early flowering, but the details of the mechanism and conditions for such a function have been unknown.
[0031]In the present invention, it is observed that the mutants wherein T-DNA or Tos17 is inserted into the OsMADS14 gene exhibit no particular change in flowering-time and floral development (see FIG. 21). This result shows that other genes besides the OsMADS14 gene act redundantly in regulating flowering-time. Overexpression of the modified OsMADS14 protein, wherein among M, I, K (KI, KII, KIII, KIV) and C domains present in the MADS-box of OsMADS14, the terminus containing the C domain is deleted, leads to early-flowering by approximately one-month under short-day conditions, whereas it leads to late-flowering by approximately 2 weeks under long-day conditions. The partial OsMADS14 protein wherein the C domain is deleted may be obtained by deletion of the 3'-terminal region containing the C-domain coding sequence of the OsMADS14 gene and expression thereof. In an embodiment of the present invention, such C domain deleted partial OsMADS14 protein may be obtained by inserting a stop codon between the K and C domains. The nucleotide sequence of the OsMADS14 gene with the C domain coding region deleted is shown in SEQ ID NO: 17, and the amino acid sequence of the C domain deleted partial OsMADS14 protein encoded thereby is shown in SEQ ID NO: 18. The above results show that the C domain deleted partial OsMADS14 protein activates flowering-time under short-day conditions, while it inhibits flowering by interaction with the flowering activators under long-day conditions.
[0032]In corn, wheat, etc., which are monocotyledons like rice, counterparts of OsMADS50, OsMADS51, OsMADS56, OsMADS14, OsTRX1, OsVIN2, OSCOL4 and OsCOL8 of rice are also expected to act as regulators in flowering and/or stem elongation.
[0033]Another aspect of the present invention provides a flowering regulating protein encoded by OsMADS50; OsMADS51; OsMADS56; truncated OsMADS14 wherein a C domain coding sequence containing the 3'-terminal region is deleted; OsTRX1; OsVIN2; OSCOL4; or OsCOL8 genes. The flowering regulating protein may have an amino acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14 and SEQ ID NO: 18.
[0034]Another aspect of the present invention provides DNA constructs containing the overexpressed or suppressed flowering regulators.
[0035]The DNA construct may contain a suppressed OsMADS50, OsMADS51, OsMADS56, OsMADS14, OsTRX1 or OsVIN2 gene. More specifically, the DNA construct may contain a knockout variant of OsMADS50, OsMADS51, OsMADS56, OsMADS14, OsTRX1 or OsVIN2 gene induced by insertion of a foreign gene. For example, the DNA construct may contain a knockout variant wherein a DNA fragment which can be inserted in to a plant gene, such as T-DNA, is inserted in a specific site in OsMADS50, OsMADS51, OsMADS56, OsMADS14, OsTRX1 or OsVIN2 gene. Especially, in the case of OsMADS50, T-DNA may be inserted into the fourth (4th) intron among six introns (see FIG. 2a). Alternatively, the DNA construct of the present invention can contain suppressed OsMADS50, OsMADS51, OsMADS56 or OsMADS14 gene by deletion or nt substitution of the whole or part of OsMADS50, OsMADS51 or OsMADS56 gene, preferably the part containing at least the MADS-box region.
[0036]The DNA construct of the present invention can also contain an overexpressed OsMADS50, OsMADS51, OsMADS56, OsTRX1 or OsVIN2 gene. In an embodiment of the present invention, the DNA construct may contain an overexpressed OsMADS50, OsMADS51, OsMADS56, OsTRX1 or OsVIN2 gene wherein a strong promoter operable in plants, such as actin promoter, cytochrome C promoter and maize ubiquitin (ubi) promoter, is operably inked.
[0037]The DNA construct of the present invention may contain a truncated OsMADS14 gene producing a C domain deleted partial OsMADS14 protein by deletion of 3'-terminal region containing the C domain coding sequence. The C domain coding sequence containing truncated OsMADS14 with the 3'-terminal region deleted may be linked with a strong promoter operable in plants to induce an overexpression thereof.
[0038]The DNA construct may contain an overexpressed OsCOL4 gene. In an embodiment of the present invention, the overexpression of the OsCOL4 may be induced by operable linkage of a strong promoter, such as actin promoter, cytochrome C promoter, maize ubiquitin (ubi) promoter, or insertion of a DNA fragment which can be inserted in to a plant gene, such as T-DNA, into the promoter of the OsCOL4 gene, wherein an enhancer (e.g., 35S enhancer of T-DNA) of the inserted gene induces an overexpression of the gene. The DNA construct of the present invention may contain a suppressed OsCOL4 gene. In an embodiment of the present invention, the OsCOL4 gene may be suppressed by insertion of a DNA fragment which can be inserted into a plant gene, such as T-DNA, into a specific site of the OsCOL4 gene, more specifically, by insertion of T-DNA into the first exon or 3' UTR region.
[0039]The DNA construct of the present invention may contain an overexpressed OsCOL8 gene. In an embodiment of the present invention, the OsCOL8 gene may be overexpressed by operable linkage with a strong promoter, such as maize ubiquitin (ubi) promoter. Further, The DNA construct of the present invention may contain a suppressed OsCOL8 gene. In an embodiment of the present invention, the OsCOL8 gene may be suppressed by insertion of a DNA fragment which can be inserted into a plant gene, such as T-DNA, into a specific site of the OsCOL8 gene, more specifically, by insertion of T-DNA into the first exon region.
[0040]Another aspect of the present invention provides a transgenic plant, a part thereof, or a plant cell, wherein an overexpression or suppression of the flowering-time regulator is directly induced as above, or wherein transformation with a DNA construct containing the overexpressed or suppressed flowering-time regulator is performed. There is no limitation of the vector used in the transformation of the plant, part thereof, or plant cell. Any conventional vector which can be used in transformation of plants may be used, and more specifically, a binary vector of pGA1611 family may be used.
[0041]More specifically, the transgenic plant, part thereof, or plant cell of the present invention may have overexpression of the OsMADS50, OsMADS51, OsTRX1, OsVIN2 or OsCOL8 gene directly induced as above, or be transformated with a DNA construct containing the OsMADS50, OsMADS51, OsTRX1, OsVIN2 or OsCOL8 gene where overexpression is induced, whereby flowering-time is accelerated. In the transgenic plant, part thereof, or plant cell of the present invention, the suppression of OsMADS50, OsMADS51, OsTRX1, OsVIN2 or OsCOL8 gene may be directly induced as above, or transformation with a DNA construct containing the suppressed OsMADS50, OsMADS51, OsTRX1, OsVIN2 or OsCOL8 gene may be performed, whereby flowering-time is delayed.
[0042]In the transgenic plant, part thereof, or plant cell of the present invention, the overexpression of OsMADS56 or OsCOL4 gene may be directly induced as above, or transformation with a DNA construct containing the overexpressed OsMADS56 or OsCOL4 gene may be performed, whereby flowering-time is delayed. In the transgenic plant, part thereof, or plant cell of the present invention, the suppression of OsMADS56 or OsCOL4 gene may be directly induced as above, or transformation with a DNA construct containing the suppressed OsMADS56 or OsCOL4 gene may be performed, whereby flowering-time is accelerated.
[0043]The transgenic plant, part thereof, or plant cell of the present invention may be transformed with a DNA construct containing the OsMADS14 gene having the C domain coding region deleted, to produce a C domain deleted partial OsMADS14 protein, whereby flowering-time is delayed under long-day conditions and accelerated under short-day conditions.
[0044]The transgenic plant, part thereof, or plant cell of the present invention may be one wherein the suppression of the OsMADS50 gene is directly induced, or which is transformed with a DNA construct containing the suppressed OsMADS50 gene, to exhibit considerable stem elongation compared with wild type.
[0045]Another aspect of the present invention provides a method to regulate flowering-time and/or stem elongation by inducing an overexpression or suppression of the regulators as above.
[0046]The flowering-time regulating method of the present invention may comprise the step of inducing a suppression of OsMADS50, OsMADS51, OsTRX1, OsVIN2 or OsCOL8 gene, to delay flowering-time. More specifically, the flowering-time regulating method of the present invention may comprise the step of directly inducing a suppression of OsMADS50, OsMADS51, OsTRX1, OsVIN2 or OsCOL8 gene by insertion of a foreign gene, or gene deletion, or transforming with a DNA construct containing a suppressed OsMADS50, OsMADS51, OsTRX7, OsVIN2 or OsCOL8 gene, to delay flowering-time. For example, the suppression of the OsMADS50, OsMADS51, OsTRX1, OsVIN2 or OsCOL8 gene may be induced by insertion of a DNA fragment which can be inserted into a plant gene, such as T-DNA, into a specific site of the above gene. For example, in the case of the OsMADS50 gene, T-DNA may be inserted into the fourth intron among the six introns, and in the case of the OsCOL8 gene, T-DNA may be inserted into the first exon, to suppress the genes.
[0047]Alternatively, the suppression of the OsMADS50, OsMADS51, OsTRX1, OsVIN2 or OsCOL8 gene may be induced by deletion of the whole or part of the gene. For example, in case of the OsMADS50, OsMADS50 or OsMADS51 gene, at least the MADS-box region may be deleted, to suppress the gene.
[0048]The flowering-time regulating method of the present invention may comprise the step of transforming a plant with a DNA construct containing the suppressed OsMADS50, OsMADS51, OsTRX1, OsVIN2 or OsCOL8 gene as above, to delay flowering-time in the plant.
[0049]Further, the present invention provides a method of stimulating stem elongation by inserting a foreign gene into the OsMADS50 gene or deleting the whole or part of the OsMADS50 gene to induce suppression thereof.
[0050]The flowering-time regulating method of the present invention may comprise the step of inducing overexpression of the OsMADS50, OsMADS51, OsTRX1, OsVIN2 or OsCOL8 gene to activate flowering. For example, the flowering-time regulating method of the present invention may comprise the step of inducing overexpression by operably linking a strong promoter operable in plants to the OsMADS50, OsMADS51, OsTRX1, OsVIN2 or OsCOL8 gene to accelerate flowering-time. The flowering-time regulating method of the present invention may comprise the step of transforming a plant with a DNA construct containing an overexpressed OsMADS50, OsMADS51, OsTRX1, OsVIN2 or OsCOL8 gene which is operably linked with the above strong promoter, to accelerate flowering-time. The strong promoter includes the actin promoter, cytochrome C promoter, maize ubiquitin (ubi) promoter, etc.
[0051]The flowering-time regulating method of the present invention may comprise the step of inducing overexpression of the OsMADS56 or OsCOL4 gene to inhibit flowering, or inducing suppression of the OsMADS56 or OsCOL4 gene to activate flowering.
[0052]More specifically, the flowering-time regulating method of the present invention may comprise the step of inducing overexpression of the OsMADS56 or OsCOL4 gene by operable linkage with a strong promoter, or insertion of an enhancer containing foreign gene which can be inserted in a plant genome into the promoter region of the gene, to inhibit flowering. For example, the flowering-time regulating method of the present invention may comprise the step of inducing overexpression of the OsMADS56 by operable linkage with maize ubiquitin (ubi) promoter, or overexpression of the OsCOL4 gene by insertion of T-DNA which contains 35 enhancers into the promoter region of the OsCOL4 gene, to inhibit flowering. The flowering-time regulating method of the present invention may comprise the step of transforming a plant with a DNA construct containing the overexpressed OsMADS56 or OsCOL4 gene as above, to inhibit flowering.
[0053]The flowering-time regulating method of the present invention may comprise the step of inducing overexpression of a C domain deleted partial OsMADS14 protein by deletion of the 3'-terminal region containing the C domain coding sequence of the OsMADS14 gene, to delay flowering-time under long-day conditions, and to accelerate the flowering-time under short-day conditions.
[0054]The flowering-time regulating method of the present invention may comprise the step of inducing suppression of the OsMADS56 or OsCOL4 gene by insertion of a foreign gene, which can be inserted into a plant gene, into a specific site of the OsMADS56 or OsCOL4 gene, to activate flowering. More specifically, the flowering-time regulating method of the present invention may comprise the step of inducing suppression of the OsCOL4 gene by inserting T-DNA into the first exon or 3' UTR region of the OsCOL4 gene, to activate flowering. The flowering-time regulating method of the present invention may comprise the step of transforming a plant with a DNA construct containing the suppressed OsMADS56 or OsCOL4 gene as above, to activate flowering.
[0055]The flowering-time regulating method of the present invention may comprise the step of inducing overexpression of the OsMADS14 gene, to accelerate flowering under short-day conditions, and to delay flowering under long-day conditions. Such overexpression of the OsMADS14 gene may be performed by overexpressing a partial OsMADS14 protein wherein a C terminal region is deleted.
[0056]Another aspect of the present invention provides a method of preparing a flowering-time regulated transgenic plant, a part thereof, or a plant cell, comprising the step of transforming with a DNA constrict containing the overexpressed or suppressed flowering-time regulator. The preparation method of the present invention comprises the steps of providing a plant cell; transforming the plant cell with the DNA construct above; and cultivating the transformed cell. The flowering-time regulator may be selected from the group consisting of OsMADS50, OsMADS51, OsMADS56, OsMADS14, OsTRX1, OsVIN2, OsCOL4 and OsCOL8, which is overexpressed or suppressed through the above method. The transformed plant cell may be cultivated as cells, differentiated to specific tissue by a conventional method of inducing tissue differentiation, or developed to a plant body.
[0057]The methods of the present invention to regulate flowering-time or to prepare a transgenic plant may be also applied to monocotyledons other than rice, such as corn and wheat, wherein counterparts of the OsMADS50, OsMADS51, OsMADS56, OsMADS14, OsTRX1, OsVIN2, OsCOL4 and OsCOL8 genes of rice may be used.
BRIEF DESCRIPTION OF FIGURES
[0058]FIG. 1 shows the mutant (T/T) wherein T-DNA is inserted into the OsMADS50 gene, and the wild-type control (W/W).
[0059]FIG. 2 shows the factors, phenotype and flowering time of OsMADS50 KO (knockout) plants, wherein (a) shows the structure of OsMADS50 and the T-DNA insertion position therein; and (b) shows the phenotype of T-DNA-inserted T2 (generation 2) plants which are suppressed.
[0060]FIG. 3 shows the result of analysis of transgenic plants transformed with OsMADS50 RNAi (interference) vector, wherein (a) shows the structure of OsMADS50 RNAi vector; and (b) shows the distribution of flowering-time of rice T1 (generation 1) plants; and (c) shows the distribution of the number of elongated internodes of rice T1 plants.
[0061]FIG. 4 shows the result of analysis of the OsMADS50 RNA interference effect, wherein (a) shows the result of RNA gel blot for the expression profile of endogenously expressed OsMADS50 and foreign RNAi gene; and (b) shows the result of RT-PCR of endogenously expressed OsMADS50.
[0062]FIG. 5 shows the result of analysis of an OsMADS50 overexpressed mutant, wherein (a) shows the structure of the OsMADS50 overexpressing vector; (b)-(e) show phenotypes of rice T1 plants; and (f) shows the expression profile of OsMADS3 and OsMADS4 in floral-like organs.
[0063]FIG. 6 shows the result of the expression profile of OsMADS50 and other flowering regulators, wherein (a) shows the expression profile of OsMADS50 in various organs; and (b) shows the expression profile of flowering-time regulators in various developmental stages of leaf.
[0064]FIG. 7 shows the result of analysis of changes of expression of flowering regulators in an OsMADS50 KO mutant and an OsMADS50 overexpressed mutant, wherein (a) shows the result of RT-PCR in the OsMADS50 KO mutant; and (b) shows a schematic representation of the result of RT-PCR obtained above in (a); and (c) shows the result of RT-PCR in the OsMADS50 overexpressed mutant.
[0065]FIG. 8 is a graph showing the flowering-time of OsMADS50 KO plants under long-day and short-day conditions.
[0066]FIG. 9 shows the expression pattern of flowering-time regulators in the OsMADS50 KO plant.
[0067]FIG. 10 shows the late-flowering phenotype of OsTRX1 KO plants.
[0068]FIG. 11 is a graph showing delay of flowering-time in OsMADS51 KO plants.
[0069]FIG. 12 is a graph showing delay of flowering-time in OsMADS56 overexpressed plants.
[0070]FIG. 13 is a graph showing delay of flowering-time in OsVIN2 KO plants.
[0071]FIG. 14 shows the late-flowering phenotype of OsCOL4 overexpressed plaints.
[0072]FIG. 15 is a schematic view showing that T-DNA containing the 35S enhancer is inserted in the promoter region of OsCOL4.
[0073]FIG. 16 is an electrophoresis result showing overexpression of OsCOL4.
[0074]FIG. 17 is a photograph showing the late-flowering phenotype of OsCOL4 overexpressed plants.
[0075]FIG. 18 is a photograph showing the early-flowering phenotype of OsCOL4 suppressed plants.
[0076]FIG. 19 shows the flowering-time alteration in OsCOL4 suppressed plants under long-day, short-day, and field conditions.
[0077]FIG. 20 shows the flowering-time alteration in OsCOL8 suppressed plants under long-day, and short-day conditions.
[0078]FIG. 21 shows the structure of T-DNA inserted OsMADS14 and the expression profile thereof.
[0079]FIG. 22 shows the nucleotide sequence of OsMADS50 cDNA (SEQ ID NO: 1).
[0080]FIG. 23 shows the nucleotide sequence of OsMADS51 cDNA (SEQ ID NO: 3).
[0081]FIG. 24 shows the nucleotide sequence of OsMADS56 cDNA (SEQ ID NO: 5).
[0082]FIG. 25 shows the nucleotide sequence of OsTRX1 cDNA (SEQ ID NO: 7).
[0083]FIG. 26 shows the nucleotide sequence of OsVIN2 cDNA (SEQ ID NO: 9).
[0084]FIG. 27 shows the nucleotide sequence of OsCOL4 cDNA (SEQ ID NO: 11).
[0085]FIG. 28 shows the nucleotide sequence of OsCOL8 cDNA (SEQ ID NO: 13).
[0086]FIGS. 29A to 29F show the nucleotide sequence of genomic DNA of OsMADS14 (SEQ ID NO: 15).
[0087]FIG. 30A shows the nucleotide sequence of OsMADS4 cDNA (SEQ ID NO: 16).
[0088]FIG. 30B shows the nucleotide sequence of truncated OsMADS14 (SEQ ID NO: 17) wherein the 3'-terminal region containing the C domain coding sequence is deleted from the OsMADS14 gene.
EXAMPLE 1
Selection 1 of Flowering-Time Mutants in T-DNA-Tagging Lines
[0089]Rice cells (Oryza sativa var. japonica cv. Dongjin induced calluses) were treated by using Ti plasmid binary vector pGA2144 (Jeon et al., The Plant Journal (2000) 22(6), 561-570), to construct a T-DNA inserted T1 (first generation) mutant lines. The treatment using Ti plasmid binary vector pGA2144 was performed according to "Jeon et al. 2000b". That is, the rice cells were co-cultivated with agrobacteria, to transport T-DNA into the rice cells, and the T-DNA transported cells were selected by using an antibiotic and re-differentiated. 2933 T1 mutant lines obtained were developed in the field, to produce T2 (second generation) transgenic plants, wherein mutant lines exhibiting alteration in flowering-time were selected. Twenty-five (25) lines exhibiting alteration in flowering-time by at least 2 weeks compared with the flowering-time of the wild-type line were observed, wherein 16 lines exhibited early-flowering phenotype, and 9 lines exhibited late-flowering phenotype.
[0090]FIG. 1 shows a phenotype comparison between OsMADS50 knockout (10) plants wherein T-DNA is inserted in the OsMADS50 gene, and wild-type (WT) plants. The photograph was taken when WT plants flowered. However, the OsMADS50 KO plants had not bolted yet.
[0091]To analyze of the genotype of flowering-time mutant, the nucleotide sequence of the adjacent region of the insertion region of T-DNA was analyzed by using an inverse PCR method as reported in "An et al. 2003," wherein the genomic DNA was cleaved by a restriction enzyme, both ends are linked together, and then PCR is performed twice, to identify the nucleotide sequence of the adjacent region of the T-DNA inserted region. Then, the insertion site of T-DNA was confirmed by using the National Center for Biotechnology Information (NCBI) database. As a result, in a line shown at the right side in FIG. 1 (line 0-153-43), the retrieved sequence was the MADS-box gene OsMADS50, and the insertion site of T-DNA was the fourth intron of OsMADS50 (see FIG. 2a). The OsMADS50 protein showed 50.6% amino acid sequence identity with SOC1/AGL20 which is a flowering activator of Arabidopsis. Among the 36 MIKC (MAPS, intervening, Keratin-like, and C-terminal domain)-type MADS-box proteins present in rice, the OsMADS50 protein is most homologous (60.8%) to OsMADS56, and also shares homology with maize ZmMADS1 (75.2%), Tobacco TobMADS1 (51.1%) and mustard SaMADSA (50.0%). Full-length protein sequences were aligned to calculate homologies.
[0092]As shown in FIG. 1, in the mutant line (T/T) wherein T-DNA is inserted into the OsMADS50 gene, flowering-time was delayed by approximately one month compared with the wild-type (W/W) control. Such delay in flowering caused by the mutation induced in OsMADS50 is considered to be a significant result, because the OsMADS50 gene is thought to be the counterpart corresponding to the flowering-time regulator AGL20 of Arabidopsis.
[0093]As shown in FIG. 2a, one of the MADS-box genes, OsMADS50, is located on Chromosome 3, and is composed of six introns and seven exons that encode a typical MIKC-type MADS-box protein. In T-DNA inserted lines in the present example, the T-DNA was inserted into the fourth intron, and the transcript direction of beta-glucuronidase (gus) gene in the T-DNA was opposite to that of OsMADS50.
[0094]From FIG. 2a, the genotype of T2 plants was determined via PCR using the primers located in OsMADS50 and T-DNA. The amplification of the normal OsMADS50 gene (W) was confirmed by PCR using primers F2 (forward primer in the I region: 5'-aaagctgacg ctgatggttt-3', SEQ ID NO: 23) and R1 (reverse primer at 3' UTR: 5'-ttgggtaccg agatccagct tattcctgg-3', SEQ ID NO: 22), and the amplification of the T-DNA inserted OsMADS50 gene (T) was confirmed by PCR using primers F2 and R2 (reverse primer in the hygromycin phosphotransferase (hph).
[0095]As a result, among thirteen (13) plants, three (3) were homozygotic (T/T) for the T-DNA insertion (see FIG. 2b, Samples 4, 10 and 13). All of these plants flowered about 99 days after planting. Whereas the other T2 plants, being either heterozygotic (W/T) or wild-type (W/W) segregants, flowered about 73 days after planting.
[0096]FIG. 2 is a schematic diagram of OsMADS50, showing the position of T-DNA insertion and the genotyping of the OsMADS50 KO progeny. FIG. 2a shows the structure of OsMADS50 and T-DNA insertion. Seven exons (filled boxes) and six introns (lines between the filled boxes) are shown. In FIG. 2a, the M, I, K and C region indicate exons. The K region consists of four exons, whereas the other regions comprise one exon each. T-DNA was inserted into the fourth intron. Arrows indicate primers. F1 is a forward primer at 5'UTR, F2 is a forward primer in the I region, R1 is a reverse primer at 3'UTR, and R2 is a reverse primer in the hygromycin phosphotransferase (hph) gene in T-DNA.
[0097]FIG. 2b shows the genotyping of the OsMADS50 KO progeny. If no T-DNA insertion occurred, the F2 and R1 primers should be amplified as 1.6 kb genomic DNA. If T-DNA was inserted, the length between the two primers would be too large to be amplified. Furthermore, when the T-DNA is inserted into the fourth intron, the F2 and R2 primers should be amplified as an approximately 2 kb band. Samples 2, 3, 5, 11 and 12 were amplified as only the genomic DNA and therefore, they were considered to be wild-type (W/W); Samples 4, 10 and 13, which were harvested from late-flowering mutants, were amplified only as 2 kb bands, and therefore, they were considered to be heterozygous (T/T); and the other samples showed amplification of both bands and therefore, they were considered to be heterozygous (W/T). Days to heading after planting are indicated for each plant.
[0098]As seen from the above, all the late flowering plants included only T-DNA inserted OsMADS50 (T/T), and the normal flowering plants contained at least one normal OsMADS50 gene (W). Therefore, it could be confirmed that a late-flowering mutation is induced by T-DNA insertion.
EXAMPLE 2
Isolation of the OsMADS50 Gene
[0099]The nucleotide sequence of the above OsMADS50 gene is shown in SEQ ID NO: 1. The nucleotide sequence of the OsMADS50 gene is also registered in NCBI database under Accession No. AB003328. However, only the expression profiles in various organs is known, whereas its function is yet unknown (Shinozuka et al., 1999). Herein, the present inventors designed two specific primer pairs, isolated this gene through PCR using the primer pairs, and named the gene OsMADS50. The first PCR was performed for the gene using the primer pair having the nucleotide sequences of SEQ ID NO: 19 (F1: forward at 5' UTR: 5'-atcaagcttt acggccaaac cctacagc-3') and SEQ ID NO: 20 (R1: reverse primer at 3' UTR: 5'-ttgggtaccg atgggtagtg gagtctgc-3'), and then, the second PCR was performed using the PCR amplified product as a template and using a primer pair correspondiing to the nucleotide sequences of SEQ ID NO: 21 (5'-atcaagcttg ttggttcatc ggcgatcg-3') and SEQ ID NO: 22 (5'-ttgggtaccg agatccagct tattcctgg-3') present inside the PCR product to amplify the desired gene. The PCR amplified product containing the entire coding region of S11905 and the adjacent region was cleaved by HindIII-BamHI (Roche), and cloned into a pBluescript SK (-) vector (Stratagene). The nucleotide sequence thereof was determined by a sequencing machine (AbI3100), and the obtained gene was named OsMADS50. This gene is present in the clone registered as AP004322 positioned at the short arm of Chromosome 3, and this locus is identical to that of the mutation known as Hd9 (Lin et al., 2000).
EXAMPLE 3
Analysis of OsMADS50 RNA Interference (RNAi) Plants
[0100]To confirm that the late-flowering phenotype is due to the suppression of OsMDS50 gene expression, transgenic plants were generated by expressing RNAi constructs of the gene as shown in FIG. 3a. MAD S-box deleted OsMADS50 genes were cloned into pBluescript SK (-) vector (Stratagene) in opposite directions at both sides of the GUS gene, and then inserted in the pGA1611 vector (AY373338) at the position between the maize ubiquitin promoter (Pubi) and the nos terminator (Tnos). Among 82 T1 plants, 76 showed the delayed flowering phenotype delayed by at least one month (FIG. 3b). Six plants flowered 74 to 78 days after planting, similarly to the wild type control and transgenic controls; eight did not flower until 140 days after planting. These results show that the OsMADS50 gene is an important flowering activator.
[0101]In addition to the late-flowering phenotype, the transgenic plants carried more elongated internodes (FIG. 3c). In contrast, most of the OsMADS50 RNAi plants carried six (23.5%) to seven (62.7%) elongated internodes, but with some (13.7%) bearing as many as eight. In contrast, the wild-type (WT) and transgenic control (CON) plants possessed five to six elongated internodes. These results show that the OsMADS50 RNAi plant exhibits an internode elongation phenotype as well as a late-flowering phenotype.
[0102]FIG. 3 is a schematic diagram of the OsMADS50 RNAi construct and the phenotypes of the transgenic plants expressing the RNAi construct. FIG. 3a shows the OsMADS50 RNAi construct, with a GUS spacer inserted between two IKC regions of OsMADS50. The construct was inserted between the maize ubi promoter (Pubi) and the nos terminator (Tnos). FIG. 3b shows the frequency distribution of days to heading in the OsMADS50 RNAi T1 transgenic Plants, i.e., the number of days required for flowering from the time of transplanting. The wild-type (WT) and other transgenic control plants flowered 74 to 78 days after planting. Nine lines did not flower until 140 days after planting. The broken bar indicates a large gap between two X-axis values. FIG. 3c shows the proportion of elongated internode numbers in OsMADS50 RNAi plants and WT controls. The values are averages of 63 WT, 152 transgenic control plants, and 102 OsMADS50 RNAi plants. The Y-axis indicates the relative ratio of stems having elongated internodes, ranging from 4 to 8.
[0103]RNA gel blot analysis showed that high levels of the OsMADS50 RNAi transcript were present in the transgenic plants that displayed the late-flowering phenotype. Because expression was so high, it was difficult to visualize the endogenous OsMADS50 transcript levels in the blots. Therefore, RT-PCR analyses were employed to verify suppression of OsMADS50 expression (FIG. 4b). In the late-flowering transgenic plants, transcript levels (confirmed by F1/R1 primers) were significantly reduced. These results indicate that reducing the expression of OsMADS50 results in late flowering of rice plants. The degree of lateness in flowering was proportional to the RNAi levels since the RNAi plants 9 and 10 flowered later than plants 6 to 8.
[0104]FIG. 4 is an analysis of the OsMADS50 RNA interference effect, showing the endogenous level of OsMADS50 in OsMADS50 RNAi Plants. FIG. 4a is a result of RNA gel blot analysis for OsMADS50 and OsMADS50 RNAi transcripts in transgenic plants expressing OsMADS50 RNAi constructs, showing that the OsMADS50 RNAi gene is strongly expressed in the OsMADS50 RNAi transgenics. Five WT plants (1 to 5) and five independent transgenic plants (6 to 10) were examined. The transgenic plants 6, 7, 8, 9, and 10 flowered 111, 115, 115, 130, and 135 days after planting, respectively. The rRNA level was observed as a control (bottom). "RNAi" refers to an OsMADS50 RNAi transcript: and "sense" refers to an endogenous OsMADS50 transcript. FIG. 4b shows the results of RT-PCR analyses for OsMADS50 and OsMADS50 RNAi transcripts in WT plants (1 to 5) and transgenic plants (6 to 10). Identical RNA, isolated for RNA gel blot analysis, was reverse transcribed to synthesize cDNA. The primer pair used for detecting full-length OsMADS50 was F1 (SEQ ID NO: 2)/R1 (SEQ ID NO: 5), indicated in FIG. 2a. Actin was used as a control. PCR cycles for amplifying OsMADS50 and actin were 26 and 23, respectively. The results of RT-PCR analyses using the F1/R1 primer pair show that the OsMADS50 gene which is endogenously expressed is suppressed in the OsMADS50 RNAi transformant.
EXAMPLE 4
Analysis of OsMADS50 Overexpressed Plants
[0105]To further study the functional roles of OsMADS50 in flowering time, transgenic rice plants that overexpressed the sense constructs of the gene were generated as shown in FIG. 5a. The maize ubi promoter was used to drive constitutive expression. That is, the whole coding region of OsMADS50 gene was amplified by using a primer pair having the sequence of SEQ ID NO: 2 and SEQ ID NO: 3, respectively, cleaved by HindIII-Asp718 (Roche), cloned into pBluescript SK (-) vector (Stratagene), to confirm the nucleotide sequence, and inserted between the ubiquitin promoter and the nos terminator of the pGA1611 vector (AY373338).
[0106]When transformed calli were transferred onto shoot induction media (MRS media), about 20% of the calli developed into the structures that resembled floral organs, e.g., palea/lemma (FIG. 5b), stigmas (FIG. 5b), stamens (FIG. 5c), ovaries (FIG. 5c), and panicles (FIG. 5d). A spikelet containing all the floral organs was occasionally observed. Although approximately 80% of the calli developed into shoots, two thirds of those displayed the phenotype of extreme dwarfism and defective growth of the leaf blade (FIG. 5e). These plants eventually died. The remaining one third of the shoots differentiated into normal plants. Some then flowered earlier than the controls, while others flowered at the same time as the WT plants.
[0107]To examine whether the floral organ-like structures observed from the transgenic calli were indeed reproductive, the transcript levels of the flower-specific MADS-box genes, OsMADS3 and OsMADS4 were determined. The former is the C function gene (involved in development of stamen and pistil), and the latter is the B function gene (involved in development of calyx and stamen). These genes were expressed specifically in the floral organs that developed from the ubi:OsMADS50 transgenic calli, indicating that they were authentic.
[0108]FIG. 5 shows the result of analyses of ubi:OsMADS50 plants. FIG. 5a is a schematic diagram of the OsMADS50 sense construct (Pubi: maize ubi prompter, Tnos: nos terminator). FIG. 5b shows regenerated shoots with palea/lemma (p/l)- and stigma (s)-like structures. FIG. 5c shows regenerated shoots with Stamen (st)- and ovary (o)-like structures. FIG. 5d shows regenerated shoots with panicle (p)-like structures. FIG. 5e shows regenerated shoots displaying dwarfism and defective growth of the leaf blade. FIG. 5f shows expression portraits of OsMADS3 and OsMADS4 in the floral organ-like structures (Control leaves: leaves transformed with empty vector; 50S leaves: transgenic leaves overexpressing OsMADS50; and 50S flowers: floral organ-like structures overexpressing OsMADS50). Actin was used as a control. As shown by RT-PCR, the expressions of OsMADS3 and OsMADS4 genes which are expressed specifically in the floral organs were increased in the 50S flower which is a floral organ-like structure. In contrast, expressions of these genes were not detected in control leaves and transgenic leaves (50S leaves).
EXPERIMENTAL EXAMPLE 1
Expression Analysis for Flowering-Time Regulators Including OsMADS50
[0109]RNA gel blot analysis revealed that OsMADS50 was variably expressed in most organs (FIG. 6a). To perform the analysis, seedling roots, seeding shoots, young leaf blades (LBs) at 9 to 10 leaf stage, leaf blades at 80 DAP (days after planting), leaf blades at 105 DAP, flag leaf blades 105 DAP, panicles <2 cm long, and panicles between 10 and 20 cm were selected. This gene was detected at a low level during the seedling stage, with transcripts increasing as the plant matured. In young particles, expression was initially low, and continued to decline as these organs matured. In the leaf organ, this gene was strongly expressed. Semi-quantitative RT-PCR analysis of leaves at four developmental stages confirmed the RNA gel blot analysis (FIG. 6b). The OsMADS50 transcript was detected at all four stages, with the expression level slightly increasing in 49-day-old plants compared with 20-day-old plants. The transcripts of Hd3a, OsMADS14, OsMADS15, and OsMADS18 increased gradually, reaching a maximum at 80 days.
[0110]FIG. 6 shows the expression profiles of OsMADS50 and the other flowering-time regulators. FIG. 6a shows the result of RNA gel blot analysis, with 15 μg of total RNA used in each sample, and the KC region of OsMADS50 serving as a probe. At the bottom are the control ribosomal RNAs. From left, seedling roots and shoots 7 days after germination, young leaf blades (LBs) at the 9 to 10 leaf stage (35 days after planting; DAP), LBs 80 DAP, LBs 105 DAP, flag LBs 105 DAP, panicles <2 cm long, and panicles between 10 and 20 cm were shown. The plants flowered 90 DAP. FIG. 6b shows the result of RT-PCR analyses of the putative flowering-time regulators at various developmental stages. WT plants were grown under short-day conditions (10 h light/14 h dark, 30° C.) in the growth chamber, and LBs were sampled 20, 49, 80 and 113 DAP. All samples were harvested 6 h after the light was turned on. Days to flowering were 87.
[0111]The expression analyses have revealed that this gene acts early in plant development, being more abundantly expressed in the vegetative organs but decreasing to a very low level during the formation of floral organs.
EXPERIMENTAL EXAMPLE 2
Expression Analysis for Flowering-Time Regulators Including OsMADS50 in OsMADS50 Suppressed or Overexpressed Plants
[0112]To further investigate the role of OsMADS50, the alterations of expression of OsMADS50 KO mutants and OsMADS50 overexpressed plants were analyzed, and the results are shown in FIG. 7. In the OsMADS50 KO plants prepared in Example 1, RT-PCR analyses were carried out for Hd1, Hd3a, and OsGI, all of which control flowering-time in the photoperiod pathway. Four MADS-box genes (OsMADS1, OsMADS14, OsMADS15, and OsMADS18) that appear to be involved as well were also examined. In these experiments, expression of Hd1 and OsGI was not changed in the OsMADS50 knockout plants (FIG. 7). Interestingly, the Hd3a transcript was not detectable in the OsMADS50 KO mutant, suggesting that Hd3a is downstream of OsMADS50. Expression levels of all the MADS-box genes were significantly decreased in the OsMADS50 KO mutant plants, although the degree of reduction for OsMADS18 transcript was not as significant as for the other genes.
[0113]The expression levels of regulatory genes in the leaves of regenerating ubi:OsMADS50 plants were tested (FIG. 7c). These plants flowered a few weeks after being transferred to the regeneration media. In contrast to the KO plants, the levels of OsMADS14 and OsMADS18 transcripts were increased in the ubi:OsMADS50 plants while those of OsMADS1, OsGI, and Hd1 were not significantly changed. Expression levels of OsMADS15 and Hd3a were too low to determine any changes in their transcripts.
[0114]FIG. 7 shows the expression profiles of MADS-box genes and photoperiod pathway genes in OsMADS50 KO and ubi:OsMADS50 leaves. FIG. 7a shows the results of RT-PCR analyses in OsMADS50 KO leaves. Seventy-three (73) days after planting, leaf blades were harvested 2 h before sunset from KO plants. After RT-PCR, DNA gel blot analyses were performed with specific probes. Two independent WT segregants and two independent OsMADS50 KO plants were examined. FIG. 7b shows a schematic representation of RT-PCR results in OsMADS50 KO plants. DNA band intensity was measured and normalized against the actin transcript level. Results are an average of three independent experiments for each plant. Average values of two WT and two KO plants are represented. Bars, SDs. FIG. 7c shows the expression profiles in ubi:OsMADS50 plants. Leaf blades were sampled from transgenic plants overexpressing OsMADS50, and control plants, and were assayed for transcript levels of genes by quantitative RT-PCR analyses. Data are average of two to three independent samples. Con: T1 control transformed with empty vector; 5OS: Ubi:OsMADS50 leaves. Bars, SDs. PCR primers and number of cycles for amplification of each gene are listed in Table 1 below.
TABLE-US-00001 TABLE 1 Primers and PCR cycles used in RT-PCR analyses PCR PCR cycles cycles Gene Forward primer Reverse primer 50 KOa 50 Sb OsMADS1 tccatatgtcctggcaagat aagagagcacgcacgtactt 28 32 OsMADS14 tcctatgcagaaaaggtcctt ggacgaagccaaaatatacac 36 36 OsMADS15 gctcttatttcagctgaa tcatatgtagcctgtagg 36 36 OsMADS18 ccaaactggatgcacttcag atcaatatcgctggaagatg 23 32 OsGl tggagaaaggttgtggatgc gatagacggcacttcagcagat 23 26 Hd1 ttctcctctccaaagattc catacgcctttcttgtttca 28 26 Hd3a atggccggaagtggcagggac atcgatcgggatcatcgttag 36 36 Actin gtatccatgagactacatacaact tactcagccttggcaatccaca 23 26 aPCR cycles used for OsMADS50 KO plants and WT segregants. bPCR cycles used for ubi: OsMADS50 plants and WT controls.
[0115]In RT-PCT for OsMADS50 KO mutants, it was observed that the expressions of OsMADS1, OsMADS14, OsMADS15, OsMADS18 and Hd3a are significantly decreased compared with wild-type (WT), while no outstanding change was observed in the expression of Hd1 and OsGI. Further, in RT-PCT for an OsMADS50 overexpressed mutant, it was observed that the expressions of OsMADS14 and OsMADS18 increased, whereas no outstanding change was observed in the expressions of OsMADS1, OsMADS15, Hd3a, Hd1 and OsGI. From the above results, it is presumed that the OsMADS50 gene acts upstream of the other flowering-time regulators such as OsMADS14 or OsMADS15 to control the expression thereof, whereas it acts in parallel (independently) or downstream of Hd1 or OsGI.
EXPERIMENTAL EXAMPLE 3
Analysis of Flowering-Time of OsMADS50 KO Mutant Depending on Photoperiod Conditions
[0116]The flowering-times in two independent T2 OsMADS50 KO lines (named 50KO23 and 50KO24, respectively) isolated from T-DNA inserted lines of Example 1, and in wild-type lines (control) were observed under various photoperiod conditions. The photoperiod conditions were short-day conditions (SD: 10 h L/14 h D) and long-day conditions (LD: 14 h L/10 h D). The result of the above observation was shown in FIG. 8. As shown in FIG. 8, under short-day conditions, no outstanding difference was observed between the control and the OsMADS50 KO lines. However, under long-day conditions, the control flowered about 78 days after planting, while the OsMADS50 KO lines did not flower until 140 days after planting. Accordingly, it confirms that the OsMADS50 is a flowering-time regulator which acts under long-day conditions.
EXPERIMENTAL EXAMPLE 4
Analysis of the Expression Pattern of Flowering-Time Regulators in OsMADS50 KO Lines
[0117]Sixty (60) days after planting, leaf blades were sampled from the OsMADS50 KO lines of Example 1 and wild-type lines (control). The expressions of the flowering-time regulators such as OsMADS14, OsMADS18, Hd3a, Hd1 and OsGI, in addition to OsMADS50 were analyzed in the obtained samples, and the result is shown in FIG. 9. As shown in FIG. 9, under long-day conditions, the expression of OsMADS14, OsMADS18 and Hd3a were downregulated in the OsMADS50 KO lines, while the expression of Hd1 and OsGI were not considerably changed. Therefore, it confirms that OsMADS50 is an upstream flowering-time regulator of other regulators such as OsMADS14, OsMADS18 and Hd3a.
EXAMPLE 5
Isolation of OsMADS51, OsMADS56, OsTRX1 and OsVIN2
[0118]Among the T-DNA tagging lines prepared as disclosed in Example 1, the lines wherein T-DNA is respectively inserted in OsMADS51, OsMADS56, OsTRX1 and OsVIN2, were isolated.
[0119]The nucleotide sequence of the OsMADS51 gene was isolated and identified, then shown in SEQ ID NO: 2. The OsMADS51 gene has been registered in the NCBI database as AB003327. However, only the expression profiles in various organs is known, while its function is yet unknown (Shinozuka et al., 1999). In the present invention, this gene was isolated through PCR and its function was determined.
[0120]Furthermore, the nucleotide sequence of the OsMADS56 gene was isolated and identified, then shown in SEQ ID NO: 3. This was isolated through PCR and its nucleotide sequence was registered in the NCBI database as AY345224 by the present inventors.
[0121]Additionally, the nucleotide sequences of OsTRX1 and OsVIN2 are shown in SEQ ID NO: 4 and SEQ ID NO: 5.
EXPERIMENTAL EXAMPLE 5
Analysis of Flowering-Time in OverExpressed or Suppressed Mutants of OsMADS51, OsMADS56, OsTRX1 and OsVIN2
[0122]To further examine the functional role of the genes isolated in Example 5 in regulating the flowering-time, a transgenic nice was prepared which overexpresses the sense construct of OsMADS51 or OsMADS56 using the pGA1611 vector (AY373338) prepared in the laboratory, wherein constitutive expression was induced using the maize ubiquitin (ubi) promoter [see, FIG. 5(a)]. It was observed that in the OsMADS51 overexpressed mutants, the flowering-time was accelerated by 1 to 2 weeks under field conditions, while in the OsMADS56 overexpressed mutants, the flowering-time was delayed by 1 to 2 weeks under field conditions (see FIG. 12).
[0123]In the experiments under short-day conditions (SD: 10 h L/14 h D) and long-day conditions (LD: 14 h L/10 h D), interestingly, it was observed that in OsMADS51 KO mutants, the flowering-time was delayed by about one month only under short-day conditions (see FIG. 11), and in OsMADS56 overexpressed mutants, the flowering-time was delayed only under long-day conditions (see FIG. 12). In case of the OsMADS56 mutants, two independent lines (named Nos. 8 and 10, respectively) were tested. Furthermore, the OsMADS51 KO line showed a delayed-aging phenotype under field conditions.
[0124]Furthermore, OsTRX1 and OsVIN2 were respectively knocked-out to prepare OsTRX1 KO lines and OsVIN2 KO lines by the same method as that of the OsMADS50 KO line. The OsTRX7 KO lines showed a late-flowering phenotype late by at least one month under field conditions (see FIG. 10), and the OsVIN2 KO lines showed a late-flowering phenotype late by about 32 days under long-day conditions, and about 10 days under short-day conditions (see FIG. 13).
EXAMPLE 6
Isolation of OsCOL4
[0125]To research further flowering-time regulators, lines exhibiting alteration in flowering-time were screened from the rice mutant population wherein an activation tagging vector (pGA2715; Joeng et al, Plant Physiology, December 2002, Vol. 130, pp. 1636-1644) is inserted. Among them, the line named 1B-00735 is a late-flowering phenotype late by at least 15 days compared with the wild-type line (see FIG. 14). The analysis of the genotype of the mutant line revealed that T-DNA is inserted in the promoter region of OsCOL4 gene, and the OsCOL4 gene is overexpressed due to 35S enhancers present in T-DNA (see FIGS. 15 and 16). The T-DNA insertion position in the OsCOL4 gene and the function of the 35S enhancers present in T-DNA are shown in FIG. 15. Based on such results, the OsCOL4 gene was isolated and its nucleotide sequence is shown in SEQ ID NO: 6.
EXPERIMENTAL EXAMPLE 6
Analysis of Flowering-Time in OsCOL4 Overexpressed or Suppressed Mutants
[0126]As disclosed above, T-DNA was inserted in the promoter region of the OsCOL4 gene, and the obtained OsCOL4 overexpressed mutants exhibited a late-flowering phenotype caused by the 35S enhancers present in T-DNA. Furthermore, such late-flowering due to the overexpression (activation tagging) of the OsCOL4 gene was re-confirmed by observing that the mutant, wherein the OsCOL4 gene is operably linked to a strong promoter, pUbi, to be overexpressed, showed delayed-flowering phenotype delayed by about 2 week (see FIG. 17). In FIG. 17, Act1 indicates the actin gene of rice used as a control.
[0127]In contrast, the OsCOL4 suppressed mutant line exhibited an early-flowering phenotype early by about 2 weeks (see FIG. 18). Such an OsCOL4 suppression was confirmed in both the mutant wherein T-DNA is inserted in the first exon of the OsCOL4 gene (OsCOL4-1 shown in FIG. 18) and the mutant wherein T-DNA is inserted in the 3'UTR region (OsCOL4-2 shown in FIG. 18).
[0128]In experiments with changing photoperiod conditions, the OsCOL4 activation tagging lines displayed late flowering compared with wild-type lines regardless of the photoperiod conditions, while the OsCOL4 suppressed lines displayed early flowering regardless of the photoperiod conditions (see FIG. 19). In FIG. 19, `OsCOL4-D` indicates the OsCOL4 activation tagging mutant.
EXAMPLE 7
Isolation of OsCOL8
[0129]The OsCOL8 gene is a CONSTANS-like gene present in rice, and is similar to VRN2 which regulates flowering-time in wheat by vernalization treatment. Through the analysis of T-DNA inserted mutant line according to the present invention, the OsCOL8 gene was isolated as a flowering-time regulator inducing alteration in flowering-time by T-DNA insertion therein, and its nucleotide sequence is shown in SEQ ID NO: 7.
EXPERIMENTAL EXAMPLE 7
Analysis of Flowering-Time in OsCOL8 Suppressed Mutant
[0130]To examine the regulation in flowering-time by the OsCOL8 gene, the mutant wherein T-DNA is inserted in the first exon of the OsCOL8 gene was analyzed. The result of the analysis revealed that the flowering-time in the mutant is similar to the wild-type under long-day conditions, while it was delayed under short-day conditions (see FIG. 20). Accordingly, the OsCOL8 gene is expected to work as a flowering activator under short-day conditions.
EXAMPLE 8
Isolation of OsMADS14
[0131]Four (4) genes have been known as rice orthologs of APETALA1 (AP1) of Arabidopsis (APETALA1-like gene in rice) involved in formation of floral organs and regulation of flowering-time, each of which was named OsMADS14, OsMADS15, OsMADS18, and OsMADS20, respectively. Among them, the OsMADS14 gene was the first to be cloned as a binding partner of the OsMADS6 protein, however its specific function has been unknown. In the present example, based on the observation that the flowering-time is altered when a DNA fragment such as T-DNA is inserted in the OsMADS14 gene, the gene was isolated as a flowering-time regulator. The nucleotide sequence of the gene is shown in SEQ ID NO: 8.
EXPERIMENTAL EXAMPLE 3
Analysis of Flowering-Time in OsMADS14 Suppressed or Overexpressed Mutants
[0132]The result of analysis for the mutants wherein T-DNA or Tos17 is inserted inside the OsMADS14 gene showed no outstanding change in flowering-time and floral development (see FIG. 21). The insertion positions of T-DNA and Tos17 in the OsMADS14 gene are shown in FIG. 21. The above result suggests that other genes besides the OsMADS14 gene work redundantly.
[0133]The gene wherein the stop codon was artificially inserted between the last K domain and C domain of the OsMADS14 gene was introduced into the pGA1611(AY373338) vector to induce overexpression of OsMADS14 partial protein wherein the terminal region containing the C domain is deleted. The observation of overexpression of OsMADS14 partial protein wherein the terminal region containing the C domain is deleted as above showed that the flowering-time is accelerated by about one month under short-day conditions, and the flowering-time is delayed by about two weeks under long-day conditions. Such a result reveals that the overexpression of the 3, region deleted OsMADS14 partial gene results in flowering activation under short-day conditions, and in flowering inhibition by interaction with other flowering activators under long-day conditions.
Sequence CWU
1
241744DNAArtificial SequencecDNA sequence of OsMADS50 1gttggttcat
cggcgatcga agatggtgcg ggggaagacg cagatgaagc ggatagagaa 60ccccacgagc
cgccaggtca ccttctccaa gcgccgcaac ggcctgctca agaaggcctt 120cgagctctcc
gtcctctgcg acgccgaggt cgcgctcatc gtcttctccc cgcgcggcaa 180gctctacgaa
ttcgccagcg ccagtacgca gaaaacaatt gaacgctata ggacgtatac 240aaaggaaaat
atcggcaaca agacagtaca gcaagatata gagcaagtaa aagctgacgc 300tgatggtttg
gcaaagaaac ttgaagctct tgaaacttac aaaagaaaac tgctgggtga 360aaagttggat
gaatgttcta ttgaagaact gcatagcctg gaggtcaagc tggagagaag 420cctcattagc
atcaggggaa ggaagacaaa gctgcttgag gagcaggttg ccaaactgag 480agagaaggag
atgaagctgc gcaaggacaa tgaagagtta cgcgaaaagt gtaagaatca 540gcctcccttg
tctgctcctt tgactgtccg ggccgaagat gagaacccgg accgtaacat 600caacaccacc
aacgacaaca tggatgtcga aactgagcta ttcatagggc tgcctggcag 660aagtcgctcc
agcggcggtg ctgcagaaga tagccaagcg atgccccatt cttaagtaac 720aggccaggaa
taagctggat ctct
7442230PRTArtificial SequenceOsMADS50 protein 2Met Val Arg Gly Lys Thr
Gln Met Lys Arg Ile Glu Asn Pro Thr Ser1 5
10 15Arg Gln Val Thr Phe Ser Lys Arg Arg Asn Gly Leu
Leu Lys Lys Ala20 25 30Phe Glu Leu Ser
Val Leu Cys Asp Ala Glu Val Ala Leu Ile Val Phe35 40
45Ser Pro Arg Gly Lys Leu Tyr Glu Phe Ala Ser Ala Ser Thr
Gln Lys50 55 60Thr Ile Glu Arg Tyr Arg
Thr Tyr Thr Lys Glu Asn Ile Gly Asn Lys65 70
75 80Thr Val Gln Gln Asp Ile Glu Gln Val Lys Ala
Asp Ala Asp Gly Leu85 90 95Ala Lys Lys
Leu Glu Ala Leu Glu Thr Tyr Lys Arg Lys Leu Leu Gly100
105 110Glu Lys Leu Asp Glu Cys Ser Ile Glu Glu Leu His
Ser Leu Glu Val115 120 125Lys Leu Glu Arg
Ser Leu Ile Ser Ile Arg Gly Arg Lys Thr Lys Leu130 135
140Leu Glu Glu Gln Val Ala Lys Leu Arg Glu Lys Glu Met Lys
Leu Arg145 150 155 160Lys
Asp Asn Glu Glu Leu Arg Glu Lys Cys Lys Asn Gln Pro Pro Leu165
170 175Ser Ala Pro Leu Thr Val Arg Ala Glu Asp Glu
Asn Pro Asp Arg Asn180 185 190Ile Asn Thr
Thr Asn Asp Asn Met Asp Val Glu Thr Glu Leu Phe Ile195
200 205Gly Leu Pro Gly Arg Ser Arg Ser Ser Gly Gly Ala
Ala Glu Asp Ser210 215 220Gln Ala Met Pro
His Ser225 2303495DNAArtificial SequencecDNA sequence of
OsMADS51 3atggcgcgga gggggagagt gcagctgagg cggatcgagg acaaggcgag
ccggcaggtg 60cggttctcca agaggagggc ggggctgttc aagaaggcgt tcgagctcgc
cctgctctgc 120gacgtggagg tggcgctcct cgtcttctcc cccgtcggca agctctacga
gtactcctcc 180tccagcattg aaggtaccta tgatcgctat cagcaattcg ctggagccag
gagagacctg 240aacgaaggaa gtacaagcat caacagtgat gaaaatgcaa gtatacactc
caggcttagg 300gacataacgg cctggtctct ccaaaacaat gctgacgagt cggatgctaa
tcagctagag 360aaactggaga aactgctgac aaatgctttg agggatacga aatcaaagaa
gatgttggca 420aaacaaaatg gtgaagggag taggagcaga gcaaactcca gtggctctag
ggggcaggag 480gaaggaagtg catga
4954164PRTArtificial SequenceOsMADS51 protein 4Met Ala Arg
Arg Gly Arg Val Gln Leu Arg Arg Ile Glu Asp Lys Ala1 5
10 15Ser Arg Gln Val Arg Phe Ser Lys Arg
Arg Ala Gly Leu Phe Lys Lys20 25 30Ala
Phe Glu Leu Ala Leu Leu Cys Asp Val Glu Val Ala Leu Leu Val35
40 45Phe Ser Pro Val Gly Lys Leu Tyr Glu Tyr Ser
Ser Ser Ser Ile Glu50 55 60Gly Thr Tyr
Asp Arg Tyr Gln Gln Phe Ala Gly Ala Arg Arg Asp Leu65 70
75 80Asn Glu Gly Ser Thr Ser Ile Asn
Ser Asp Glu Asn Ala Ser Ile His85 90
95Ser Arg Leu Arg Asp Ile Thr Ala Trp Ser Leu Gln Asn Asn Ala Asp100
105 110Glu Ser Asp Ala Asn Gln Leu Glu Lys Leu
Glu Lys Leu Leu Thr Asn115 120 125Ala Leu
Arg Asp Thr Lys Ser Lys Lys Met Leu Ala Lys Gln Asn Gly130
135 140Glu Gly Ser Arg Ser Arg Ala Asn Ser Ser Gly Ser
Arg Gly Gln Glu145 150 155
160Glu Gly Ser Ala5693DNAArtificial SequencecDNA sequence of OsMADS56
5atggtgcggg ggaggacgga gctgaagcgg attgagaacc cgacgagccg gcaggtgacc
60ttctccaagc gccggaatgg cctcctcaag aaggcgttcg agctctccgt cctctgcgac
120gccgaggtcg ccctcatcgt cttctccccc cgcggccgcc tctacgagtt cgccagcgcc
180cccagcctac agaaaaccat cgaccgctat aaagcataca caaaggatca tgtcaacaat
240aagacaattc aacaagatat ccagcaagtc aaagatgata ctttaggctt ggccaagaaa
300cttgaagctc ttgatgagtc cagacggaaa atattgggag aaaatttaga aggatgctct
360attgaagaac tgcgtggtct agaaatgaaa cttgagaaga gcctccacaa cataagacta
420aagaagaccg agcttctgga gcggcagata gccaagctga aagagaagga gcggactttg
480cttaaagaca acgaaaattt acgcggaaag catcgcaacc ttgaggctgc ggcgctggtg
540gctaaccaca tgacgacgac gacggcgccg gcggcgtggc cgcgggacgt gcctatgacg
600agcagcacag ccggcgccat ggacgtggag actgatctgt acattggatt gcccggcact
660gagcgctcct ccaaccggtc ggagacaggt tga
6936230PRTArtificial SequenceOsMADS56 protein 6Met Val Arg Gly Arg Thr
Glu Leu Lys Arg Ile Glu Asn Pro Thr Ser1 5
10 15Arg Gln Val Thr Phe Ser Lys Arg Arg Asn Gly Leu
Leu Lys Lys Ala20 25 30Phe Glu Leu Ser
Val Leu Cys Asp Ala Glu Val Ala Leu Ile Val Phe35 40
45Ser Pro Arg Gly Arg Leu Tyr Glu Phe Ala Ser Ala Pro Ser
Leu Gln50 55 60Lys Thr Ile Asp Arg Tyr
Lys Ala Tyr Thr Lys Asp His Val Asn Asn65 70
75 80Lys Thr Ile Gln Gln Asp Ile Gln Gln Val Lys
Asp Asp Thr Leu Gly85 90 95Leu Ala Lys
Lys Leu Glu Ala Leu Asp Glu Ser Arg Arg Lys Ile Leu100
105 110Gly Glu Asn Leu Glu Gly Cys Ser Ile Glu Glu Leu
Arg Gly Leu Glu115 120 125Met Lys Leu Glu
Lys Ser Leu His Asn Ile Arg Leu Lys Lys Thr Glu130 135
140Leu Leu Glu Arg Gln Ile Ala Lys Leu Lys Glu Lys Glu Arg
Thr Leu145 150 155 160Leu
Lys Asp Asn Glu Asn Leu Arg Gly Lys His Arg Asn Leu Glu Ala165
170 175Ala Ala Leu Val Ala Asn His Met Thr Thr Thr
Thr Ala Pro Ala Ala180 185 190Trp Pro Arg
Asp Val Pro Met Thr Ser Ser Thr Ala Gly Ala Met Asp195
200 205Val Glu Thr Asp Leu Tyr Ile Gly Leu Pro Gly Thr
Glu Arg Ser Ser210 215 220Asn Arg Ser Glu
Thr Gly225 23073069DNAArtificial SequencecDNA sequence of
OSTRX1 7atggtgatcg cggtggaggg gggcttcgtg cacgaggagg aggaggtgga ccacccaatt
60cgctacctcc cacttggccg cgtctactcc tcctctgctc cgtgccctct ccccaagaag
120ccccgctccg ccgaggacgg caagcccccc gtgatcgtct actaccgccg ccgccgtaag
180aagccgcggg tcgaggggcc acctccctcg cctgccacag caccaccgat gctgcacccc
240cgggaggacg acgaggatga ggaggttaca cggcggaagg gttctctcaa gtacgagctg
300ctgagcctgg ggcaagcccc gcccgcatta ggcggggatg gggaggagcc cgcgcggcgg
360cgctgcctga ggcgtagcgg aggggctgag aggaggggtt acttctctga acccaagagg
420cggcagcggc agggcgtgca caaggaagct gcctcctcgg ctgggaggag atggttggag
480ttggaaattg aggctgcgga tccactggcc tttgtgggat taggatgcaa ggttttctgg
540cccctcgatg aggattggta caagggttct atcacagggt acaatgaagc gactaagaaa
600cattccgtaa agtatgatga tggcgaatca gaggacctta acctagctga tgaaaggata
660aaattttcta tttcatctga agaaatgaag tgcaggaact tgaaatttgg aatttccaat
720ctgaacaaga ggggctatga tgagttgctt gcccttgctg ttagccttca tgattaccaa
780ggtcttgatc caggtgatct tgtgtgggct aaacttacag gtcatgccat gtggccagct
840gttgtggtgg atgaatcaaa tgttcctgct aacagggctt tgaagccagg ccgactagat
900cagtcgatac ttgttcaatt ctttggtact catgattttg ccaggattaa gttgaagcaa
960gcggtgccct ttctgaatgg ccttctttct tctttgcatc ttaaatgcaa gcaagcacgc
1020ttctatcgga gtttagaaga agccaaggag tttctctgca cacagcttct cccagaaaat
1080atgttgcaac tacagaaatc catggaaaag ggcagttctg atgctaattc caataaagat
1140gtacattctt gtgacaattt atctgaagat aaaacagctg aaagcggagg ggattatgat
1200gagatgactc caatagaact aggaaatctt cgtgtgagca aattaggtag gatagtaact
1260gactcagact atttccataa caaaaagcat atatggcctg aagggtatac tgctttcagg
1320aagttcagat cagtgaaaga tccacatgta gtaatacttt acaaaatgga ggtactgagg
1380aattcagata taaaagctcg gccattgttt agggtcacat cagaagatgg aacacagatt
1440gatggctcta ccccaaatac atgttggaag gagatatatt gtagattaaa ggaaaaacag
1500cgcaatgtgg cctctggatt ggacagagat gtttgtcagg gatctggttc ctatatgttt
1560ggcttttcaa atccacaaat acggcaactt attcaggagt tacccaatgc aaggtcatgc
1620ttaaagtatt ttgaaaatgc tggagacacc tttcgtgggt atagagctgt tcatgtaaat
1680tggaaagatc tagactattg tagtgtttgt gatatggatg aggaatacga agacaatttg
1740ttcttgcaat gtgataagtg ccgtatgatg gtacatgcta gatgctatgg tgaactcgaa
1800ccattgaatg gagtcctttg gctttgcaac ctgtgtcgac ctgaggcgcc tcgtgtttct
1860ccacgatgct gtctttgtcc agtaacaggg ggcgcaatga aaccaacaac agatggtcgt
1920tgggctcatc ttgcatgtgc tatatggatt cctgaaactt gcttaaaaga tgtgaagaga
1980atggaaccga ttgatggatt gagcagaatc aacaaggacc gctggaaact tctatgcagc
2040atttgcggag ttgcttatgg agcttgcata cagtgttctc atcctacctg tcgtgttgca
2100tatcaccctc tttgtgcacg tgctgctgat ctttgtgttg agcttgaaga tgatgacaaa
2160atccacctca tgttacttga tgaggatgag gacccatgta ttcgtctact ttcatactgc
2220aagaagcaca gacaaccatc gactgaacgt ccatctcttg aaagtaacct tgctaagcct
2280gctgtggtag ttcagacaga tgcagttcca ccatccggtt gtgcaaggac tgaaccttat
2340aatatccatg ggagaagggg ccaaaagcaa cctcaagtta tggctaccgc ttctgtaaaa
2400cgtttatatg tagagaatat gccttatatt gttagtggtt tctgccaaaa tagagtaggc
2460catgatgcta tcagtgaacc aattcaatca gttggctttt tggatgttgc acatcaagaa
2520gctgttggca acgtgtcttc tatgattgaa aagtataaaa gcatgaaggc tacattcagg
2580aggagactag cttttggaaa gtcaagaatt catggatttg gtgtctttgc aaaggtttcg
2640cacaaggcag gcgacatgat gattgagtac atcggagagc tcgtcaggcc accaatatca
2700gacattagag agcggcgcat atacaactct ttagtgggtg ctgggacgta catgttcagg
2760atagatgatg agcgtgttat agatgctacg cgggcaggaa gcattgccca tttaattaat
2820cattcttgtg agccgaattg ttattcacgc gtcataagtg ttctcgggga tgagcatatc
2880atcatttttg caaagcggga tataaatcca tgggaagagt tgacttatga ttataggttt
2940gtttcgagtg atcagcgact tccttgttat tgtggattcc caaaatgccg tggagttgtt
3000aacgatgttg aagcagaggg gcaatcagcc aaaataaggg tcaatagaag tgaattattt
3060caacaatga
306981022PRTArtificial SequenceOSTRX1 protein 8Met Val Ile Ala Val Glu
Gly Gly Phe Val His Glu Glu Glu Glu Val1 5
10 15Asp His Pro Ile Arg Tyr Leu Pro Leu Gly Arg Val
Tyr Ser Ser Ser20 25 30Ala Pro Cys Pro
Leu Pro Lys Lys Pro Arg Ser Ala Glu Asp Gly Lys35 40
45Pro Pro Val Ile Val Tyr Tyr Arg Arg Arg Arg Lys Lys Pro
Arg Val50 55 60Glu Gly Pro Pro Pro Ser
Pro Ala Thr Ala Pro Pro Met Leu His Pro65 70
75 80Arg Glu Asp Asp Glu Asp Glu Glu Val Thr Arg
Arg Lys Gly Ser Leu85 90 95Lys Tyr Glu
Leu Leu Ser Leu Gly Gln Ala Pro Pro Ala Leu Gly Gly100
105 110Asp Gly Glu Glu Pro Ala Arg Arg Arg Cys Leu Arg
Arg Ser Gly Gly115 120 125Ala Glu Arg Arg
Gly Tyr Phe Ser Glu Pro Lys Arg Arg Gln Arg Gln130 135
140Gly Val His Lys Glu Ala Ala Ser Ser Ala Gly Arg Arg Trp
Leu Glu145 150 155 160Leu
Glu Ile Glu Ala Ala Asp Pro Leu Ala Phe Val Gly Leu Gly Cys165
170 175Lys Val Phe Trp Pro Leu Asp Glu Asp Trp Tyr
Lys Gly Ser Ile Thr180 185 190Gly Tyr Asn
Glu Ala Thr Lys Lys His Ser Val Lys Tyr Asp Asp Gly195
200 205Glu Ser Glu Asp Leu Asn Leu Ala Asp Glu Arg Ile
Lys Phe Ser Ile210 215 220Ser Ser Glu Glu
Met Lys Cys Arg Asn Leu Lys Phe Gly Ile Ser Asn225 230
235 240Leu Asn Lys Arg Gly Tyr Asp Glu Leu
Leu Ala Leu Ala Val Ser Leu245 250 255His
Asp Tyr Gln Gly Leu Asp Pro Gly Asp Leu Val Trp Ala Lys Leu260
265 270Thr Gly His Ala Met Trp Pro Ala Val Val Val
Asp Glu Ser Asn Val275 280 285Pro Ala Asn
Arg Ala Leu Lys Pro Gly Arg Leu Asp Gln Ser Ile Leu290
295 300Val Gln Phe Phe Gly Thr His Asp Phe Ala Arg Ile
Lys Leu Lys Gln305 310 315
320Ala Val Pro Phe Leu Asn Gly Leu Leu Ser Ser Leu His Leu Lys Cys325
330 335Lys Gln Ala Arg Phe Tyr Arg Ser Leu
Glu Glu Ala Lys Glu Phe Leu340 345 350Cys
Thr Gln Leu Leu Pro Glu Asn Met Leu Gln Leu Gln Lys Ser Met355
360 365Glu Lys Gly Ser Ser Asp Ala Asn Ser Asn Lys
Asp Val His Ser Cys370 375 380Asp Asn Leu
Ser Glu Asp Lys Thr Ala Glu Ser Gly Gly Asp Tyr Asp385
390 395 400Glu Met Thr Pro Ile Glu Leu
Gly Asn Leu Arg Val Ser Lys Leu Gly405 410
415Arg Ile Val Thr Asp Ser Asp Tyr Phe His Asn Lys Lys His Ile Trp420
425 430Pro Glu Gly Tyr Thr Ala Phe Arg Lys
Phe Arg Ser Val Lys Asp Pro435 440 445His
Val Val Ile Leu Tyr Lys Met Glu Val Leu Arg Asn Ser Asp Ile450
455 460Lys Ala Arg Pro Leu Phe Arg Val Thr Ser Glu
Asp Gly Thr Gln Ile465 470 475
480Asp Gly Ser Thr Pro Asn Thr Cys Trp Lys Glu Ile Tyr Cys Arg
Leu485 490 495Lys Glu Lys Gln Arg Asn Val
Ala Ser Gly Leu Asp Arg Asp Val Cys500 505
510Gln Gly Ser Gly Ser Tyr Met Phe Gly Phe Ser Asn Pro Gln Ile Arg515
520 525Gln Leu Ile Gln Glu Leu Pro Asn Ala
Arg Ser Cys Leu Lys Tyr Phe530 535 540Glu
Asn Ala Gly Asp Thr Phe Arg Gly Tyr Arg Ala Val His Val Asn545
550 555 560Trp Lys Asp Leu Asp Tyr
Cys Ser Val Cys Asp Met Asp Glu Glu Tyr565 570
575Glu Asp Asn Leu Phe Leu Gln Cys Asp Lys Cys Arg Met Met Val
His580 585 590Ala Arg Cys Tyr Gly Glu Leu
Glu Pro Leu Asn Gly Val Leu Trp Leu595 600
605Cys Asn Leu Cys Arg Pro Glu Ala Pro Arg Val Ser Pro Arg Cys Cys610
615 620Leu Cys Pro Val Thr Gly Gly Ala Met
Lys Pro Thr Thr Asp Gly Arg625 630 635
640Trp Ala His Leu Ala Cys Ala Ile Trp Ile Pro Glu Thr Cys
Leu Lys645 650 655Asp Val Lys Arg Met Glu
Pro Ile Asp Gly Leu Ser Arg Ile Asn Lys660 665
670Asp Arg Trp Lys Leu Leu Cys Ser Ile Cys Gly Val Ala Tyr Gly
Ala675 680 685Cys Ile Gln Cys Ser His Pro
Thr Cys Arg Val Ala Tyr His Pro Leu690 695
700Cys Ala Arg Ala Ala Asp Leu Cys Val Glu Leu Glu Asp Asp Asp Lys705
710 715 720Ile His Leu Met
Leu Leu Asp Glu Asp Glu Asp Pro Cys Ile Arg Leu725 730
735Leu Ser Tyr Cys Lys Lys His Arg Gln Pro Ser Thr Glu Arg
Pro Ser740 745 750Leu Glu Ser Asn Leu Ala
Lys Pro Ala Val Val Val Gln Thr Asp Ala755 760
765Val Pro Pro Ser Gly Cys Ala Arg Thr Glu Pro Tyr Asn Ile His
Gly770 775 780Arg Arg Gly Gln Lys Gln Pro
Gln Val Met Ala Thr Ala Ser Val Lys785 790
795 800Arg Leu Tyr Val Glu Asn Met Pro Tyr Ile Val Ser
Gly Phe Cys Gln805 810 815Asn Arg Val Gly
His Asp Ala Ile Ser Glu Pro Ile Gln Ser Val Gly820 825
830Phe Leu Asp Val Ala His Gln Glu Ala Val Gly Asn Val Ser
Ser Met835 840 845Ile Glu Lys Tyr Lys Ser
Met Lys Ala Thr Phe Arg Arg Arg Leu Ala850 855
860Phe Gly Lys Ser Arg Ile His Gly Phe Gly Val Phe Ala Lys Val
Ser865 870 875 880His Lys
Ala Gly Asp Met Met Ile Glu Tyr Ile Gly Glu Leu Val Arg885
890 895Pro Pro Ile Ser Asp Ile Arg Glu Arg Arg Ile Tyr
Asn Ser Leu Val900 905 910Gly Ala Gly Thr
Tyr Met Phe Arg Ile Asp Asp Glu Arg Val Ile Asp915 920
925Ala Thr Arg Ala Gly Ser Ile Ala His Leu Ile Asn His Ser
Cys Glu930 935 940Pro Asn Cys Tyr Ser Arg
Val Ile Ser Val Leu Gly Asp Glu His Ile945 950
955 960Ile Ile Phe Ala Lys Arg Asp Ile Asn Pro Trp
Glu Glu Leu Thr Tyr965 970 975Asp Tyr Arg
Phe Val Ser Ser Asp Gln Arg Leu Pro Cys Tyr Cys Gly980
985 990Phe Pro Lys Cys Arg Gly Val Val Asn Asp Val Glu
Ala Glu Gly Gln995 1000 1005Ser Ala Lys
Ile Arg Val Asn Arg Ser Glu Leu Phe Gln Gln1010 1015
102092253DNAArtificial SequencecDNA sequence of OsVIN2
9atggatccac cctacgcagg agtacctatt gatcctgcta aatgccgatt gatgagtgtg
60gatgaaaagc gggaacttgt ccgtgaatta tcgaagcggc cagaaagtgc tcctgacaaa
120ctgcagtctt ggagtcgccg tgaaattgta gagattcttt gtgctgattt aggaagggaa
180aggaagtaca ctggattatc gaagcagaga atgttggaat atctcttcag agttgtgact
240ggcaaatcat ctggtggtgg cgttgtggag catgtgcaag agaaggagcc tacccctgaa
300cccaacacag ccaaccatca gtcccctgcg aaacggcagc gaaagagtga caacccatca
360cgactaccaa ttgttgcaag cagtccaact acagaaatac ccaggccagc aagtaatgct
420cgcttctgcc acaatttagc ttgcagagcg actcttaatc cagaagataa attttgcaga
480cgctgttcat gctgtatttg tttcaagtac gatgacaata aggatcctag cctctggtta
540ttctgtagtt cagatcaacc cttgcagaaa gattcttgtg tattttcgtg ccatcttgaa
600tgtgctctta aggatggaag aactggcatc atgcagagtg ggcagtgcaa gaaacttgat
660ggtggttatt actgcactcg ctgtcggaaa cagaatgatc tgcttgggtc ctggaagaaa
720caactggtga tagctaaaga tgctcgccgg ttggatgtat tgtgtcatcg gatttttttg
780agtcataaga ttcttgtctc cacggagaag tacttggttt tgcatgaaat tgttgacaca
840gcgatgaaga aactggaggc tgaggttggt cctatatctg gagttgcaaa tatgggtcgt
900ggaattgtga gccggcttgc tgttggtgct gaagttcaga aactttgtgc tcgagcaata
960gaaaccatgg agtctctgtt ttgtggatct ccttctaact tgcaatttca acgttcacgg
1020atgataccat caaacttcgt aaagtttgaa gctataaccc aaacatctgt cactgtagtt
1080ttggatttgg gtcctatact tgctcaagat gtaacatgct ttaatgtatg gcacagagtg
1140gcagccacag gctcgttctc atcaagtcca actggcatca tacttgcacc attaaaaacg
1200ttagtggtca ctcaacttgt gccagctaca agctatatat tcaaggtagt tgccttcagt
1260aactacaagg agtttggatc gtgggaagcc aaaatgaaga caagctgtca gaaggaagtt
1320gatctgaagg gtttgatgcc aggtgggtct gggctagacc aaaacaatgg gagcccaaag
1380gcaaacagtg gtggtcagtc tgatccttct tcagaaggtg tggactcaaa taataacact
1440gcggtgtatg ctgatctcaa taaatcacca gaaagtgatt ttgaatattg tgaaaatcct
1500gagatacttg attcagacaa agcaagtcat caccccaatg aacctacaaa caactcacag
1560agtatgccga tggtcgtagc tagggttacg gaggtatctg gattggagga agctcctgga
1620ctctcagcat cagctttgga cgaggagccc aattcagcag ttcaaacaca attacttaga
1680gaatcctcaa attcaatgga gcagaaccag agaagcgaag ttcctggatc acaggatgca
1740tcaaatgctc ctgctggaaa tgaggtggtg attgttccac ctcgatattc tggctctatt
1800ccaccaactg cacctagata tatggaaaat ggtaaggata tcagtgggag gagcttgaaa
1860gcaaaacctg gtgataacat ccttcaaaat ggctcttcca agcctgaaag ggaaccaggg
1920aattcttcaa ataaaagaac atcaggtaaa tgtgaggaaa tcggccacaa ggatggatgc
1980ccagaagcat cttatgagta ctgtgttaag gtggtcaggt ggctggaatg tgagggttac
2040attgagacca acttcagagt gaagtttctg acttggtata gccttcgtgc tacccctcat
2100gacaggaaga tagtcagcgt ctacgtaaac actcttattg atgatcctgt tagcctttct
2160ggccagcttg ctgacacttt ctctgaggcc atctacagca aaaggccacc ttctgttcgc
2220tccggtttct gcatggaact ttggcattaa taa
225310749PRTArtificial SequenceOsVIN2 protein 10Met Asp Pro Pro Tyr Ala
Gly Val Pro Ile Asp Pro Ala Lys Cys Arg1 5
10 15Leu Met Ser Val Asp Glu Lys Arg Glu Leu Val Arg
Glu Leu Ser Lys20 25 30Arg Pro Glu Ser
Ala Pro Asp Lys Leu Gln Ser Trp Ser Arg Arg Glu35 40
45Ile Val Glu Ile Leu Cys Ala Asp Leu Gly Arg Glu Arg Lys
Tyr Thr50 55 60Gly Leu Ser Lys Gln Arg
Met Leu Glu Tyr Leu Phe Arg Val Val Thr65 70
75 80Gly Lys Ser Ser Gly Gly Gly Val Val Glu His
Val Gln Glu Lys Glu85 90 95Pro Thr Pro
Glu Pro Asn Thr Ala Asn His Gln Ser Pro Ala Lys Arg100
105 110Gln Arg Lys Ser Asp Asn Pro Ser Arg Leu Pro Ile
Val Ala Ser Ser115 120 125Pro Thr Thr Glu
Ile Pro Arg Pro Ala Ser Asn Ala Arg Phe Cys His130 135
140Asn Leu Ala Cys Arg Ala Thr Leu Asn Pro Glu Asp Lys Phe
Cys Arg145 150 155 160Arg
Cys Ser Cys Cys Ile Cys Phe Lys Tyr Asp Asp Asn Lys Asp Pro165
170 175Ser Leu Trp Leu Phe Cys Ser Ser Asp Gln Pro
Leu Gln Lys Asp Ser180 185 190Cys Val Phe
Ser Cys His Leu Glu Cys Ala Leu Lys Asp Gly Arg Thr195
200 205Gly Ile Met Gln Ser Gly Gln Cys Lys Lys Leu Asp
Gly Gly Tyr Tyr210 215 220Cys Thr Arg Cys
Arg Lys Gln Asn Asp Leu Leu Gly Ser Trp Lys Lys225 230
235 240Gln Leu Val Ile Ala Lys Asp Ala Arg
Arg Leu Asp Val Leu Cys His245 250 255Arg
Ile Phe Leu Ser His Lys Ile Leu Val Ser Thr Glu Lys Tyr Leu260
265 270Val Leu His Glu Ile Val Asp Thr Ala Met Lys
Lys Leu Glu Ala Glu275 280 285Val Gly Pro
Ile Ser Gly Val Ala Asn Met Gly Arg Gly Ile Val Ser290
295 300Arg Leu Ala Val Gly Ala Glu Val Gln Lys Leu Cys
Ala Arg Ala Ile305 310 315
320Glu Thr Met Glu Ser Leu Phe Cys Gly Ser Pro Ser Asn Leu Gln Phe325
330 335Gln Arg Ser Arg Met Ile Pro Ser Asn
Phe Val Lys Phe Glu Ala Ile340 345 350Thr
Gln Thr Ser Val Thr Val Val Leu Asp Leu Gly Pro Ile Leu Ala355
360 365Gln Asp Val Thr Cys Phe Asn Val Trp His Arg
Val Ala Ala Thr Gly370 375 380Ser Phe Ser
Ser Ser Pro Thr Gly Ile Ile Leu Ala Pro Leu Lys Thr385
390 395 400Leu Val Val Thr Gln Leu Val
Pro Ala Thr Ser Tyr Ile Phe Lys Val405 410
415Val Ala Phe Ser Asn Tyr Lys Glu Phe Gly Ser Trp Glu Ala Lys Met420
425 430Lys Thr Ser Cys Gln Lys Glu Val Asp
Leu Lys Gly Leu Met Pro Gly435 440 445Gly
Ser Gly Leu Asp Gln Asn Asn Gly Ser Pro Lys Ala Asn Ser Gly450
455 460Gly Gln Ser Asp Pro Ser Ser Glu Gly Val Asp
Ser Asn Asn Asn Thr465 470 475
480Ala Val Tyr Ala Asp Leu Asn Lys Ser Pro Glu Ser Asp Phe Glu
Tyr485 490 495Cys Glu Asn Pro Glu Ile Leu
Asp Ser Asp Lys Ala Ser His His Pro500 505
510Asn Glu Pro Thr Asn Asn Ser Gln Ser Met Pro Met Val Val Ala Arg515
520 525Val Thr Glu Val Ser Gly Leu Glu Glu
Ala Pro Gly Leu Ser Ala Ser530 535 540Ala
Leu Asp Glu Glu Pro Asn Ser Ala Val Gln Thr Gln Leu Leu Arg545
550 555 560Glu Ser Ser Asn Ser Met
Glu Gln Asn Gln Arg Ser Glu Val Pro Gly565 570
575Ser Gln Asp Ala Ser Asn Ala Pro Ala Gly Asn Glu Val Val Ile
Val580 585 590Pro Pro Arg Tyr Ser Gly Ser
Ile Pro Pro Thr Ala Pro Arg Tyr Met595 600
605Glu Asn Gly Lys Asp Ile Ser Gly Arg Ser Leu Lys Ala Lys Pro Gly610
615 620Asp Asn Ile Leu Gln Asn Gly Ser Ser
Lys Pro Glu Arg Glu Pro Gly625 630 635
640Asn Ser Ser Asn Lys Arg Thr Ser Gly Lys Cys Glu Glu Ile
Gly His645 650 655Lys Asp Gly Cys Pro Glu
Ala Ser Tyr Glu Tyr Cys Val Lys Val Val660 665
670Arg Trp Leu Glu Cys Glu Gly Tyr Ile Glu Thr Asn Phe Arg Val
Lys675 680 685Phe Leu Thr Trp Tyr Ser Leu
Arg Ala Thr Pro His Asp Arg Lys Ile690 695
700Val Ser Val Tyr Val Asn Thr Leu Ile Asp Asp Pro Val Ser Leu Ser705
710 715 720Gly Gln Leu Ala
Asp Thr Phe Ser Glu Ala Ile Tyr Ser Lys Arg Pro725 730
735Pro Ser Val Arg Ser Gly Phe Cys Met Glu Leu Trp His740
74511999DNAArtificial SequencecDNA sequence of OsCOL4
11atggaggcgg tggaggacaa ggcgatggtg ggagtgggag gagcggtggc ggcggggtac
60tcctcgtcgt cgtgggggtt ggggacgcgg gcgtgcgact cgtgcggcgg ggaggcggcg
120cggctctact gccgcgcaga cggggcgttc ctgtgcgccc ggtgcgacgc gcgggcgcac
180ggcgccgggt cgcgccacgc gcgggtgtgg ctgtgcgagg tgtgcgagca cgcgcccgcc
240gccgtcacgt gccgggcgga cgccgcggcg ctgtgcgccg cctgcgacgc cgacatccac
300tcggcgaacc cgctcgcgcg caggcacgag cgcctccccg tcgcgccctt cttcggcccg
360ctcgccgacg cgccgcagcc cttcaccttc tcccaggccg ccgcggatgc cgccggggcg
420cgggaggagg atgcggacga tgaccggagc aacgaggccg aggcggcgtc gtggcttctc
480cccgagcccg acgacaatag ccacgaggat agcgccgcag ccgccgacgc gttcttcgcc
540gacaccggcg cgtacctcgg cgtcgacctg gacttcgccc ggtccatgga cggaatcaag
600gccatcgggg taccggtcgc gccgcccgag ctggacctca ccgccggcag ccttttctac
660cccgaacact ccatggccca cagcttgtcg tcgtcggagg tcgcgatcgt accggacgcg
720ctgtcggcgg gcgcggcggc gccgcccatg gtggtggtgg tggcgagcaa ggggaaggag
780agggaggcgc ggctgatgcg gtacagggag aagcgcaaga accggcggtt cgacaagacc
840atccggtacg cgtcccgcaa ggcgtacgcc gagacgcggc cgcgcatcaa gggccggttc
900gccaagcgca ccgccgacgc cgacgacgac gacgaggcgc catgctcgcc ggcgttctcc
960gccctcgccg cgtcggacgg cgtcgtgccg tcgttctga
99912332PRTArtificial SequenceOsCOL4 protein 12Met Glu Ala Val Glu Asp
Lys Ala Met Val Gly Val Gly Gly Ala Val1 5
10 15Ala Ala Gly Tyr Ser Ser Ser Ser Trp Gly Leu Gly
Thr Arg Ala Cys20 25 30Asp Ser Cys Gly
Gly Glu Ala Ala Arg Leu Tyr Cys Arg Ala Asp Gly35 40
45Ala Phe Leu Cys Ala Arg Cys Asp Ala Arg Ala His Gly Ala
Gly Ser50 55 60Arg His Ala Arg Val Trp
Leu Cys Glu Val Cys Glu His Ala Pro Ala65 70
75 80Ala Val Thr Cys Arg Ala Asp Ala Ala Ala Leu
Cys Ala Ala Cys Asp85 90 95Ala Asp Ile
His Ser Ala Asn Pro Leu Ala Arg Arg His Glu Arg Leu100
105 110Pro Val Ala Pro Phe Phe Gly Pro Leu Ala Asp Ala
Pro Gln Pro Phe115 120 125Thr Phe Ser Gln
Ala Ala Ala Asp Ala Ala Gly Ala Arg Glu Glu Asp130 135
140Ala Asp Asp Asp Arg Ser Asn Glu Ala Glu Ala Ala Ser Trp
Leu Leu145 150 155 160Pro
Glu Pro Asp Asp Asn Ser His Glu Asp Ser Ala Ala Ala Ala Asp165
170 175Ala Phe Phe Ala Asp Thr Gly Ala Tyr Leu Gly
Val Asp Leu Asp Phe180 185 190Ala Arg Ser
Met Asp Gly Ile Lys Ala Ile Gly Val Pro Val Ala Pro195
200 205Pro Glu Leu Asp Leu Thr Ala Gly Ser Leu Phe Tyr
Pro Glu His Ser210 215 220Met Ala His Ser
Leu Ser Ser Ser Glu Val Ala Ile Val Pro Asp Ala225 230
235 240Leu Ser Ala Gly Ala Ala Ala Pro Pro
Met Val Val Val Val Ala Ser245 250 255Lys
Gly Lys Glu Arg Glu Ala Arg Leu Met Arg Tyr Arg Glu Lys Arg260
265 270Lys Asn Arg Arg Phe Asp Lys Thr Ile Arg Tyr
Ala Ser Arg Lys Ala275 280 285Tyr Ala Glu
Thr Arg Pro Arg Ile Lys Gly Arg Phe Ala Lys Arg Thr290
295 300Ala Asp Ala Asp Asp Asp Asp Glu Ala Pro Cys Ser
Pro Ala Phe Ser305 310 315
320Ala Leu Ala Ala Ser Asp Gly Val Val Pro Ser Phe325
33013894DNAArtificial SequencecDNA sequence of OsCOL8 13atgtcggcgg
cgtcgggcgc cgcgtgcggg gtgtgtgggg gaggggtggg ggagtgcggg 60tgcctgctgc
atcagcggcg tgggggaggc ggtggtggtg gaggtggagg ggtgaggtgc 120gggatcgcgg
cggacctgaa ccgggggttt ccggcgatct ttcagggggt gggggtggag 180gagacggcgg
tggaagggga tggaggagcc cagccggcgg ccgggctgca ggagttccag 240ttcttcggcc
acgacgacca cgacagcgtc gcgtggctct tcaacgaccc ggcgccgccc 300ggcgggacgg
accaccagct tcaccgccaa accgcgccca tggcggtcgg caacggcgcg 360gcggcggcgc
agcagcggca ggcgttcgac gcgtacgcgc agtaccagcc ggggcacggg 420ctcacgttcg
acgtgccgct cacccgaggc gaggccgccg ccgcggtgct cgaggccagc 480ctcggcctcg
gcggcgccgg cgccggcggc aggaacccgg cgacgtcgag cagcacaatc 540atgtccttct
gtgggagcac gttcactgac gccgtgagct ccatcccgaa agatcacgcg 600gcggcggcgg
cggtcgttgc caacggcggc ctgagcggcg gcggcggcga cccggcgatg 660gaccgggagg
cgaaggtgat gcggtacaag gagaagagga agcggaggcg atacgagaag 720cagatccggt
acgcctcgcg caaggcctac gccgagatgc ggccgcgcgt gaagggccgc 780ttcgccaagg
tgcccgacgg cgagctggac ggcgcgacac cgccgccgcc gtcctccgcc 840gccggcggcg
gctacgagcc cggccggctc gacctcggat ggttccgttc gtag
89414297PRTArtificial SequenceOsCOL8 protein 14Met Ser Ala Ala Ser Gly
Ala Ala Cys Gly Val Cys Gly Gly Gly Val1 5
10 15Gly Glu Cys Gly Cys Leu Leu His Gln Arg Arg Gly
Gly Gly Gly Gly20 25 30Gly Gly Gly Gly
Gly Val Arg Cys Gly Ile Ala Ala Asp Leu Asn Arg35 40
45Gly Phe Pro Ala Ile Phe Gln Gly Val Gly Val Glu Glu Thr
Ala Val50 55 60Glu Gly Asp Gly Gly Ala
Gln Pro Ala Ala Gly Leu Gln Glu Phe Gln65 70
75 80Phe Phe Gly His Asp Asp His Asp Ser Val Ala
Trp Leu Phe Asn Asp85 90 95Pro Ala Pro
Pro Gly Gly Thr Asp His Gln Leu His Arg Gln Thr Ala100
105 110Pro Met Ala Val Gly Asn Gly Ala Ala Ala Ala Gln
Gln Arg Gln Ala115 120 125Phe Asp Ala Tyr
Ala Gln Tyr Gln Pro Gly His Gly Leu Thr Phe Asp130 135
140Val Pro Leu Thr Arg Gly Glu Ala Ala Ala Ala Val Leu Glu
Ala Ser145 150 155 160Leu
Gly Leu Gly Gly Ala Gly Ala Gly Gly Arg Asn Pro Ala Thr Ser165
170 175Ser Ser Thr Ile Met Ser Phe Cys Gly Ser Thr
Phe Thr Asp Ala Val180 185 190Ser Ser Ile
Pro Lys Asp His Ala Ala Ala Ala Ala Val Val Ala Asn195
200 205Gly Gly Leu Ser Gly Gly Gly Gly Asp Pro Ala Met
Asp Arg Glu Ala210 215 220Lys Val Met Arg
Tyr Lys Glu Lys Arg Lys Arg Arg Arg Tyr Glu Lys225 230
235 240Gln Ile Arg Tyr Ala Ser Arg Lys Ala
Tyr Ala Glu Met Arg Pro Arg245 250 255Val
Lys Gly Arg Phe Ala Lys Val Pro Asp Gly Glu Leu Asp Gly Ala260
265 270Thr Pro Pro Pro Pro Ser Ser Ala Ala Gly Gly
Gly Tyr Glu Pro Gly275 280 285Arg Leu Asp
Leu Gly Trp Phe Arg Ser290 2951513000DNAArtificial
Sequencegenomic DNA sequence of OsMADS14 15gcttcagtta ataagatata
tacttggtat tttgcttaca ttttcatttt ttttcccctt 60gtcacagcaa attccccaag
cataacatgt gagtgtgaca acacagttcc tgttctctta 120gcttatcttg gattcaatcc
cctcatccaa aattaaattc catttgttcc ctatttcaga 180ggggaatttc tcggggtatc
tctagtattt agcaacactt taatgtgtcc tatatattcc 240cttggttcat cccctatagt
catttcccat gattctctgt tcccttgggt ccactatgta 300caggtattgc acatataaat
catgaaacta ccaaatgcat tggcaattgc aagttgatgt 360acaactatag aagtgtgttt
atttggggat gaagtgggat atgttaggtc catccttatt 420ttctgagatg ggatagcccc
atctatgtct ttggcataag ggatataatg ctcttatttt 480ttttataagg aatgtgaggg
tgtggcccgc atctcaattc gagtccgtta atttttttca 540tataaagttg acctggatct
agaaaaatat tccatttcaa ggattattct gtcccacctg 600ttatcgaacc gaacaccctg
aaaatagatt tgtccccaca tgactatctc atccctttca 660accaaataca ttataactta
ttgacggttc tgcagctctg gctcgtttcg gaaaagagct 720atgatggagg ctcgggctca
gctaatttgg cttacaagct gagctgagct ttttgtcctc 780acctagttct gcccatgggg
aatctaacat tatcaatcat acaccatatc ttaaagagat 840gctgctatga tacgtcaaga
agtcaagttt taaggtagaa tatatggtag ttgggaaaat 900agaatcatta cataaatgtt
agaaaatagg gatgccaacg cgacatgctt gcaggctttg 960aggcccagta aacctaattg
tacttttttt tcatccattt ttattatata cttgttgatg 1020aaaattaact tagaatatgg
gctcttatgt aagatagcat cgcctgcatc cttacaaaga 1080gacagataga tccaatcgta
caattaaatc agtaatttta taagagaatg aaataacatt 1140ctagctagtg tatccaagaa
tgcacagtga agtccgtatt taagtcccat ccaaaacgat 1200gtgatgttag atctgatcca
aaatatttaa taatgtagct caagttttgc atagcccctg 1260agaaccagac aagccaatgt
taaaattcct actgtgcata gggagggcaa tcaatcatcc 1320tactgcatga gtaggtccct
gcttcctgtt caaaatactt tctccgttct acgaagacta 1380catttttaga acaaagctaa
caaactaatg gtgagagaag aaaaatcaaa tgaacactca 1440ttaatacgaa aataaattat
cgtcaaatga taacctagga ataattttga gttacagatt 1500aattataggt aagaaagaac
aaagttaaag cgatcgaaaa tgaagtctat ttaaggacca 1560gtttagtatg gctctagcta
tagctccact cattctatag ctggagtcca accaaatagt 1620ttctacacct aaaatagaaa
tatagttggc tagagcgtta tcacaaaata aactagagag 1680gtggagttga gttcagaccg
ctacacaact tcactttaaa ctttaactcc taaagttaaa 1740ttttaagaga tgaagatcta
ctaaacaggc tttaatacgg aggaaatgca ttcatccaca 1800aaggtcaaaa gcagcagaaa
gagaacgaat gcctttgctg cattcaaccc caagcagagc 1860tgcaggggtg ccaactgcca
atcaggcaat catccactct gggagcgaca ggcgacgcca 1920ttgatgggca caccccctcg
ccggggccga cgggagacga gacgacgcag gcactgtttt 1980gcggccgacc caagccaagc
caagccagga gccatcccgt cccatcacga cgcattgctg 2040ccgcggccta attgggcagg
aaaagccatg gcccaccccc accgcctggc cagacgagac 2100ggcccaaaaa aggatcggcc
cagaaaagcc cacgagagta cgacgcacgc acgcgtcgcc 2160gggaggcggg gcccgggccg
gcgccgcctc gcccaatggc cgttcgacag cggaggcgat 2220cgaaaccacc ccggtatcgc
caaaccgcct cctcctcctc cgacgatccg gcgcgcgctc 2280cctttaaaat ccccccattt
cctcctcctc ctcctcctcg tcgtcgtcgt ctcccccact 2340cgatcgatcc atccatcgat
cgatcggtcc cccccatcgc gcgcgacgca ttccgccgcc 2400gtctcgccgt gtccacgtga
tgggggccgg ggctagggga taggcggata gccagcagcc 2460accaccacca gtagttgccg
tgtggggata ggtgtggcta tagggctagt ggtcgtcgct 2520gatagcgagg tgggtagggt
taattttggt tggaggtaga gagagagaga gagggaggga 2580gggaggagga ggaggaggag
gaggaggagg aagaacagga ggaagatggg gcggggcaag 2640gtgcagctga agcggatcga
gaacaagatc aaccggcagg tgaccttctc caagcgcagg 2700tcggggctgc tcaagaaggc
gaatgagatc tccgtgctct gcgacgccga ggtcgcgctc 2760atcatcttct ccaccaaggg
caagctctac gagtacgcca ccgactcatg gtacgtacgt 2820acgtacgtgt gcttgattaa
atttcatcct catcgcttgt ctctaagctt tcagttcttt 2880tcgcttaatc gagcaatcct
tgcgctacat gatgtgttcc cgtttccgtt ctgttcgtat 2940cgatcgattg cctttgaatt
ctgtgtgtga ttaattcgat ctgtcctgat tgctcgaatt 3000aattttgttg cgtgtgtttc
ggggttatcc ccaataatct gtttgaattt ctgctgcgat 3060tgttgattgc ttgccggcga
tggaggaggc agcgtgtttt gctatttcag gctttgagct 3120gacggcgtga ggtgagatgc
gttgcatctg tgcactgtag ctacagtgcc cgtacgaggg 3180taattttatg ctccgctttc
gctggagagg gcgttgctgc tgcgctattt ggggaatttt 3240tttttggccc tgccgatggg
tgctgcttgc ttggcgacaa gctagctttg cacccaaagg 3300ggagaggggt gattagctag
gaactctagt acgtagattt gatggacctg ggattatttg 3360gggattaaaa tggtcttggc
ttgtgttcat ctaaaattct actgaacttg ctgcttgtgt 3420tgtgtgtgcc tcttctttct
tcactattcc ccatattaat tctgggctcg tttagatctt 3480ctttctctct ccctggccat
ctctttctct tgaggcaact aagcatatta agggagaaga 3540tgaaacggga tgcatcggga
gatggaggag ttcatatctt aagctgctgg tgacttgttg 3600gaaccctttt cgctggttcg
tctgcctcta gctttcttgg actctttgct gatgcatgcc 3660atgcttttca gaacgaaaag
attttactag aacaaactta taagctaggg ctggccttta 3720atctttactt cttaattccc
ggctgtcatt agttcaatct aatggttcat tagttgctgg 3780gttctacctt tcctataagg
ttctttttga gatgtacatg gtttctgaag aaacatccat 3840gcttctagct agcctgatta
cagactggtt tcatgctgct tcttttttat cgaaaagtca 3900ccttggggga gagtttccca
cttaactcat tcgattttct tagttcagag gggaggtaca 3960aaggttacaa cattacatcg
gaggtctgtt aagatgttaa gacttagtaa gaggtagaga 4020ggagttaaca ggaaaaaaaa
gaacttataa gctaaaggtt catcctagtt agcgctttag 4080ttgctgggtt ctaccttttc
tgtcaggttc ttcttgggat gtgcatatgg ttcctgaaga 4140aacagacatt agaaatttag
aactaagaag caaaacgttg gatgcttcca gtataccata 4200tcatctgaag gatatttatc
cttcttgatg ttttcgacaa tgatttacta ttaatgcatt 4260gttatgcaag ctttgttaag
tcaacatgca aatcttagag tttgatggtt aattccagtt 4320cttatatatt ttttaagtta
aaaattttct tatctctcct ttttcctcac tacatacgaa 4380tagagtttga tctggctgtt
ataaattttc ttcagttttg tgggcatcct tatatctact 4440aatcagactc cccatatgat
cagtgattat cagcttatac tctattctaa ttctatgaat 4500gaacgactaa ttaacttaat
taactcctcg ctgatttaat ccaataaggg tagtgtgttg 4560ggcatcccca taatgctagc
aaccacatct ctagataaga gtcattagta tcacatattt 4620tgaaatcctt ctcactctaa
ccattgatca gtgagttaag acataggagt agagcttcac 4680gtgaggtaac agtgtttgga
tttcaaggta tcaagtttgg ggtgggagta cacgagccga 4740tggattaatc tgattttttt
ttcgtttctc gtacgtcatt aaacgtctta tttggaaatc 4800aactccatta ggttcctgca
gggtactgta gttatgctaa ttaatccttc ttaagacttt 4860tccaagattt agctttaaac
agatgctttc atgaacctag ttgggaaaca tgacaaatcc 4920tcttcgaact ttaattaaga
tgttacttta attagcatgc cttaagctgg catacgtagc 4980ggcaaatgca accacttaca
attcatcaca aggcaataga tcgactggct ttcttgttaa 5040agctaagcaa gtagttacct
actgcgccaa taagaatatt gagcctactc cattggtacg 5100atgggtaata tttataaatg
cttgtcgttt aggagtagca agacactagt tctttcatat 5160ttgtttgggt gccaatttag
aaaactctcc gtacttcaaa tgtagtaaaa tactctccta 5220ctgctctttg gacgatgaac
gtctacacag acaaacagta gtcatatttg aagtgactcg 5280ggagatattt taattctttt
taactataag cagtagaatt gtaaagttgg tttcctccat 5340cttaatccaa tgcacgaagt
tcagaactct gctttgatta atagagctcg cagcgacttg 5400catgctgttt tcacaacaag
actcttgtag tattgcatct agccgtatat agatgagtcg 5460gcaatgagtt aactctggct
ctcactgtct cacacgctat tagggttcca gacttccagt 5520ctacttgatt cagaaaaata
caaatattct cttataagtt agcccaaaat aataaaatgg 5580atatatattt gcgggcatta
attggtctaa ctatgctcgg aggcctactg gtccaactcg 5640cgtaggacat acaaactcat
aaccgcataa tatacctgtt cagctatttg gttatacagt 5700attgagttga ttcctgctgt
tgactgaact gtagcaacgt ctgtatatat ccgggactaa 5760tgataaattt tcagtttgga
ttgcattatt cacaatatct tttaagcatt aatactgtat 5820taattctctt gacacttcat
ttttgtaata attttgttaa ttttccatag gttgattaat 5880ttcaagttat cctatatact
tatatagttc atctccacta agtgtagtta atgatatttc 5940tctcctctta ttagactaca
ttaccccaat tatttctagc cattggataa tagatatatg 6000gttcaaattt tctcttcttt
cttctctcat tacaccaagt aatctcaatc atttttaggc 6060cttaaactca taagtatcaa
tttgttttag ttttaatatt catatttcat cttatttgta 6120catattatgc aacttaattt
cccgcagcaa cgcggcagag tattcattta gttaatgtag 6180acaacccaat atcacatgtg
atcttacttg attatcattg attagaccct gtctaggaat 6240aagaagcaaa tatgttctct
ttcaacaaag ttatgtttgc ttaagagtct agggtgttgt 6300atttcccctt aattctttct
atagatagtt atacttgcta tcctgtttca tttctttttc 6360ttaacgaaaa tgagatacag
ttcagttgct taagcttttc ttgacatgta tgcttgtatt 6420acatgtttac cttgactttg
ccccagaagt ataccttcta tatatatgca tattatcttt 6480ccccaaaagg ttatacagac
ccttttgaaa ggttgacatt ttagtatgcc gtagaaagta 6540tatatccttt ggttataaag
tgaacttgtt caaagtgcct caagaacatg gaaatacttt 6600agcaaacaat gaagctactc
cctccattta taattcattt catattataa gttactttga 6660atttatttcc tagtcaaact
attttaagtt cgactaaatt tatagaaaaa aataaaaata 6720tttctaacac aaaataaaca
ttttatcaaa tatgttcaat attaaattta acgaaactaa 6780tttggtattg ttgatgttgc
tatttttttt ctataaattg gtcaaatgta aagatgcttg 6840acttgggaaa aagtcaaaac
gacttgtaat atgaaacgga tggagtaaga cttaataatg 6900tttcagaact tgaaccatat
cagtgctacc accaaaagct gatcattctg atatatgaaa 6960atgtttattg ttagctttgc
ccaaaaaacc gttttcatga actgcataaa tacaacaatt 7020tattgttttt ttagggttct
gtgtgtgggg gggtggtgtg ttaatccaac tcttgtgtta 7080gaagtagatt ggcaaatcta
ttctgtatta tatcttacat aagttcttat aagaataaac 7140tgcaaaatgt aggtgttgtt
atttacacca ctacgaagta cccccattta aattttgaat 7200gtataacacc gttgactttt
atacatatgt ttgaccgttc gtcttattaa aaaatacgta 7260attgtcattt attttgttgt
gatgtgtttt aagcatcaaa ggtagtttaa gcatgacttt 7320tttttacata attgcaaaaa
agaatttgaa taaaacaaat ggcattttat tatgggttac 7380gcatttacat gtcataatat
ccactgtgac atttgagaaa cctattcatg ttttgaacta 7440gagattatta gtagttgagg
gcctttgtta gatgctgcta gtcctatgat tttggttagt 7500acatgtatgg caagtgaaat
cgtattgata ttatattccc acacaatatg taagttactt 7560caacacataa atatataaca
atatctagtt ttgtattact tatatatata tattctcatc 7620atagtgatag tcactaactt
acctattaag acattcaaag aaatgggcat ccttcagtta 7680ggatgttaca gtgatacacc
ttttcgtttt gacaatactg catacgcagt ttctaaaaca 7740actccatgtt aaaacataag
gggttgcact caagtagatt ttgaagtgtg tgtgcgcgcc 7800tgtgcaactt tcttgttctt
ccttcgtttt attttaaacc tggaaactaa agtaggtttc 7860ctgttaaatt cctatccttt
cttaaaaaaa tggacttcaa gaaaaaacag accagaatca 7920taaatacagt gtatgtatct
gacctgtata tgaaaaggta cagccatatg tgcatttgtt 7980gttgagatgg aagaatatat
atactgctta gttattatta caattatttc aaatgatgaa 8040acgtatattc ctcatttttc
acagtatgga caaaatcctt gaacgttatg agcgctactc 8100ctatgcagaa aaggtcctta
tttcagctga atctgacact caggtaaaaa taaagagctc 8160taattctgtt gtttctcata
tctcaatatc ttgtttattt tttgaacttt tcactacacc 8220tgtttcggtt gactcattca
agacgggtac atccaacatt ttagctctcc tcaagttgga 8280taaatcaatt aggcatcatt
ttttatggca attttccatt gttatgtaga tcaactttta 8340ataaatattg ctttacatct
ctttgaacag taatctctta cttcaatgta cttatcaaat 8400atgtagattt attctaaatt
agattatatc cattttttat tacatagcgt cctgaccttt 8460tggcatccca gcccaattga
acctatttgc tgtctgaaat cttgaaaact caaactgaac 8520tgttctttat attggtgcaa
ttaattaggc tctctctctc aggtcagatc attaaaaatt 8580gtggtattgt tacatttcat
aagtgaaatt ttgttcacaa attagatcaa atttatcttc 8640catgtttgtt tacacgtata
cagctttgcc agttccctct tattcaaaca ttttttacac 8700tatgattcaa tatacctttt
gtggatttta ctggaacaaa atcatagtta ttgcctaatg 8760aaaaactata aaaaaaaatt
ttggatgcat gactacatca acactcatta tggaattttg 8820tgtgccagag aatatcacaa
aacatatttt tcatcaaata aaacaaaata aacattttcc 8880agaacttttg gcgtggctca
tcagaagttt ggaaccttaa ataatccttg ttttcattta 8940gctgggactt actatagtca
attatgctat taaaaagatc cattcgtcta tttgttacga 9000ataatcttta ctctttagtt
ggggttgatg gactaatggt gtactccaaa atcagaagtt 9060cttttatggc tagatacatg
tagaccggat ttgaaaactt tcaagtttag atttgacaaa 9120aactttcaac tcgcgattga
aaattttcaa gtccacattt gaaaactttc aagtttagat 9180ttgaaaactt tcgacccaga
tttgaaaact ttcaactcga gatttgaaaa ctttcaagcc 9240tagatttaaa aactttcaag
ttcagattga aaaactttca agttaagatt tgaaaatttt 9300cagctcaaat atttttgaaa
acacgtatcc taacaattaa aaaaatcaga aaaaacacga 9360aagaatagcg aaaaaaagaa
aaaaacgaaa aagatggaaa aaaaggaaac acaaaaaaaa 9420aggaaaaaaa tcgcgtggga
ccgccagctg gcgcgcgcgc cagttccgta actgacttgc 9480gctcgccaat tagcatcccc
catgtagaca tgcatattct tcgtttgcaa tattttttgt 9540aagaagttgc tgtgtatgaa
cattgttgac tgaactaatg tagttattat gcagacagtg 9600gtaagtcata tttccatacc
ataaagagtg agactgagaa ttttctaatc aagatattac 9660aaaaagctga actagctagg
cagactgtaa ccctgttatc attcctagaa atgtttgcta 9720ctttggagat agtagataat
atagttatca cgctgatgaa ttgtcaagga aacatacatt 9780atagttccct ttcctaacat
gcactatctg cttagagctt ttctctatat agattttgga 9840tggcactatt gtatactctt
cagcacattc aatttctaaa cttgtaatat tagtgattct 9900gtgcttagaa ttgtggaggt
cactgtacat ccaccagtaa atttagtttg atgagtgtcg 9960agaagaaaag gtaagtgtgg
agtgggggac aaagttaatc atattttact gcaagcacac 10020tgaagtaaat ccatttattc
aatatacact gtacctaagc aattctccac ggaggtatct 10080tgcagttcta ggtgtccaca
gttttagcta tatgcagtgc caaaatcgat taaagttaca 10140cttgttaata tagaaattca
aggtactcca aagggcacaa tcatttgcac aatcagttct 10200tcctggcaat ttttcaaata
tcagctaatg tatgaatagt attgtgatac ttcctattta 10260ctcaaattta ttaatgtaaa
tcttctatgc ttgcttgtat agggcaactg gtgccacgaa 10320tataggaaac tgaaggctaa
ggttgagaca atacagaaat gtcaaaagta attggaaact 10380actcacaact ggtgccatta
tgacattatg tactatacac tgttgacata aaattgttcg 10440ccttaaatcc tgcaggcacc
tcatgggaga ggatcttgaa tctttgaatc tcaaagagct 10500gcagcagctg gagcagcagc
tggaaaattc gttgaaacat atcagatcca gaaaggtggt 10560ttttgtgatg agaattattc
aaggctgata tcaacaatat gtgcaaaatt tatatggttt 10620ttatacagct aaatatagat
gtcctgtatg ttttacgagc tgacaattac aaatctcctt 10680tatgtgcaga gccaactaat
gctcgagtcc attaacgagc ttcaacggaa ggtaatgatg 10740tcaaccatgt tagaccttta
attgagtact gggacttgct agaaataacc ttgtcaaaac 10800tcgagaaatc tttggccggc
caccagttga taccatcgcg tgttatgttt catactctta 10860ttttaagttc ccgccatgct
tgcaactgca agtgctgcca cactttcatt ttctaacatg 10920cacgccggat tcttgctgca
ggaaaagtca ctgcaggagg agaataaggt cctacagaaa 10980gaagtaggct gctagccttg
atgcccccta gtttccatgc ttcagctgat cttggtttgt 11040ttaacatcaa tcaagttaaa
ttgacagaac ccttgctcct tcctacagct ggtggagaag 11100cagaaagtcc agaagcaaca
agtgcaatgg gaccagacac aacctcaaac aagttcctca 11160tcatcctcct tcatgatgag
ggaagccctt ccaacaacta atatcaggta agtaactagc 11220agcctgaagt tagtttcgtc
cttatgtagc acagacgaat aaccttttgg actaaagatc 11280attagatcca gctttattag
aaaacaaaat taaatggctc gtttagttca ctaccatatc 11340aaaatattga cgatactaaa
acctagacaa atattggaag tgctacattt ttttgtcaac 11400ttatatatgt tatcactata
ttttaatagc aaatcaaaca ttagctaaaa tactattaaa 11460aataccaaca acttaatagg
ggcatatttt ggcaccaacc accaaacaac tgaaagttct 11520aacaaggttg tataaaccaa
taactatcaa acctttttta ggcacctcag aattttacgc 11580ttttttttgt ctgaaaacac
gccaaatctg ccccttttcc cccaaaacgc cagcgggctt 11640tttcttgtca ttttggttgg
tgatgtagct aagaggtgtg cttattcgtt ccacagtaac 11700taccctgcag cagctggcga
aaggatagag gatgtagcag cagggcagcc acagcatgtt 11760cgcattgggc tgccaccatg
gatgctgagc cacatcaacg gctaaggagg cttcagatcc 11820ataccagtaa tcacaagttg
caacctgacc cggtccggtc gcctgctgct ctggtttact 11880actagtacta ttgtcatctt
gcggttgcga gacgaggaaa gcattttagc cctaaattca 11940gcattagtag caagctgcaa
tgtgtatatt ttggcttcgt ccagcaccgt cttcctccca 12000ccagtaattt acccatgtaa
tatatgcgag tagcatgaac aaattttccc gtttccaacc 12060atctccattg gtgtcatgtg
tgacttaaat agcgaaattt cagcattgtg catagtgtga 12120ttactgtaag ataaataaac
tttgtagaca ataagtctcc gttatcttgc tgattggagc 12180tgaatctgtc cgatcaccgg
cagagctgat tgagcgcata ctgcataacg aataaattgt 12240atgcgaacaa gttgataggc
ataaatcgtt cgactgttta caaagaaaat aaggcgtgac 12300attctcagtt aaataatggg
agatcatctt gtatataatg atcttctgcc gtcactccta 12360tacaaacatt ttacccatta
caaaaaccaa gaaatatacc aaggcgccca agctcactgt 12420cactgctgac tcccctacca
ctaaaaattc tcaagagagg ataacgaatg ctaagcatta 12480gtcttctaag aatggcattc
agaactgtgg aactatgtgc cggctgatga gaactcagcc 12540tatgaataaa ttaatctagc
cacaacttta acataaagat attggtcaga ggttgtattt 12600aactgaacag ggatatgcta
gtattaaact cgaagcatct tctctttcag gcgtgaaatg 12660aacttgaatg tctcctctgc
tttgacctgt tgatacatat cacttcttga tactctgtcc 12720ggatggaatt tcaaaagagc
ttgcttgtaa gcagctttaa cctgaaaaaa gtttcatatt 12780aaacaattgt cagcgggaag
agatcaataa ttccttattt acatttatgg gtatcatttt 12840atgaacttat atcagaacat
ggcataaggt ggtaattgat ctcgcctaga ttgccagagg 12900caataattgg caaatcttcc
aaaatttgtc atgagaagct atctcttcta taaataaaca 12960aacgaatttg ggatttctcc
atagaaaatt gaaatacaat 1300016947DNAArtificial
SequencecDNA sequence of OsMADS14 16atgggggccg gggctagggg ataggcggat
agccagcagc caccaccacc agtagttgcc 60gtgtggggat aggtgtggct atagggctag
tggtcgtcgc tgatagcgag gtgggtaggg 120ttaattttgg ttggaggtag agagagagag
agagggaggg agggaggagg aggaggagga 180ggaggaggag gaagaacagg aggaagatgg
ggcggggcaa ggtgcagctg aagcggatcg 240agaacaagat caaccggcag gtgaccttct
ccaagcgcag gtcaaaactg ctcaagaagg 300cgaatgagat ctccgtgctc tgcgacgccg
aggtcgcgct catcatcttc tccaccaagg 360gcaagctcta cgagtacgcc accgactcat
gtatggacaa aatccttgaa cgttatgagc 420gctactccta tgcagaaaag gtccttattt
cagctgaatc tgacactcag ggcaactggt 480gccacgaata taggaaactg aaggctaagg
ttgagacaat acagaaatgt caaaagcacc 540tcatgggaga ggatcttgaa tctttgaatc
tcaaagagct gcagcagctg gagcagcagc 600tggaaaattc gttgaaacat atcagatcca
gaaagagcca actaatgctc gagtccatta 660acgagcttca acggaaggaa aagtcactgc
aggaggagaa taaggtccta cagaaagaac 720tggtggagaa gcagaaagtc cagaagcaac
aagtgcaatg ggaccagaca caacctcaaa 780caagttcctc atcatcctcc ttcatgatga
gggaagccct tccaacaact aatatcagta 840actaccctgc agcagctggc gaaaggatag
aggatgtagc agcagggcag ccacagcatg 900aacgcattgg gctgccacca tggatgctga
gccacatcaa cggctaa 94717540DNAArtificial SequencecDNA
sequence of truncated OsMADS14 17atggggcggg gcaaggtgca gctgaagcgg
atcgagaaca agatcaaccg gcaggtgacc 60ttctccaagc gcaggtcaaa actgctcaag
aaggcgaatg agatctccgt gctctgcgac 120gccgaggtcg cgctcatcat cttctccacc
aagggcaagc tctacgagta cgccaccgac 180tcatgtatgg acaaaatcct tgaacgttat
gagcgctact cctatgcaga aaaggtcctt 240atttcagctg aatctgacac tcagggcaac
tggtgccacg aatataggaa actgaaggct 300aaggttgaga caatacagaa atgtcaaaag
cacctcatgg gagaggatct tgaatctttg 360aatctcaaag agctgcagca gctggagcag
cagctggaaa attcgttgaa acatatcaga 420tccagaaaga gccaactaat gctcgagtcc
attaacgagc ttcaacggaa ggaaaagtca 480ctgcaggagg agaataaggt cctacagaaa
gaactggtgg agaagcagaa agtccagtaa 54018179PRTArtificial
SequenceOsMADS14 protein 18Met Gly Arg Gly Lys Val Gln Leu Lys Arg Ile
Glu Asn Lys Ile Asn1 5 10
15Arg Gln Val Thr Phe Ser Lys Arg Arg Ser Lys Leu Leu Lys Lys Ala20
25 30Asn Glu Ile Ser Val Leu Cys Asp Ala Glu
Val Ala Leu Ile Ile Phe35 40 45Ser Thr
Lys Gly Lys Leu Tyr Glu Tyr Ala Thr Asp Ser Cys Met Asp50
55 60Lys Ile Leu Glu Arg Tyr Glu Arg Tyr Ser Tyr Ala
Glu Lys Val Leu65 70 75
80Ile Ser Ala Glu Ser Asp Thr Gln Gly Asn Trp Cys His Glu Tyr Arg85
90 95Lys Leu Lys Ala Lys Val Glu Thr Ile Gln
Lys Cys Gln Lys His Leu100 105 110Met Gly
Glu Asp Leu Glu Ser Leu Asn Leu Lys Glu Leu Gln Gln Leu115
120 125Glu Gln Gln Leu Glu Asn Ser Leu Lys His Ile Arg
Ser Arg Lys Ser130 135 140Gln Leu Met Leu
Glu Ser Ile Asn Glu Leu Gln Arg Lys Glu Lys Ser145 150
155 160Leu Gln Glu Glu Asn Lys Val Leu Gln
Lys Glu Leu Val Glu Lys Gln165 170 175Lys
Val Gln1928DNAArtificial Sequencesequence of forward primer at 5' UTR
(F1) 19atcaagcttt acggccaaac cctacagc
282028DNAArtificial Sequencesequence of reverse primer at 3' UTR (R1)
20ttgggtaccg atgggtagtg gagtctgc
282128DNAArtificial Sequencesequence of forward primer 21atcaagcttg
ttggttcatc ggcgatcg
282229DNAArtificial Sequencesequence of reverse primer 22ttgggtaccg
agatccagct tattcctgg
292320DNAArtificial Sequencesequence of forward primer in the I region
(F2) 23aaagctgacg ctgatggttt
202421DNAArtificial Sequencesequence of reverse primer in hph gene in
T-DNA (R2) 24atccagactg aatgcccaca g
21
User Contributions:
comments("1"); ?> comment_form("1"); ?>Inventors list |
Agents list |
Assignees list |
List by place |
Classification tree browser |
Top 100 Inventors |
Top 100 Agents |
Top 100 Assignees |
Usenet FAQ Index |
Documents |
Other FAQs |
User Contributions:
Comment about this patent or add new information about this topic:
People who visited this patent also read: | |
Patent application number | Title |
---|---|
20170017337 | INPUT DEVICE AND CONTROL PROGRAM |
20170017336 | DETECTING DEVICE AND ELECTRONIC EQUIPMENT PROVIDED WITH SAME, AND METHOD OF CONTROLLING DETECTING DEVICE |
20170017335 | TOUCH PANEL, DISPLAY DEVICE, AND TOUCH PANEL MANUFACTURING METHOD |
20170017334 | IMAGE PROCESSING DEVICE AND IMAGE PROCESSING METHOD |
20170017333 | IN-CELL TOUCH SCREEN AND DISPLAY DEVICE |