PLANTS HAVING ALTERED AGRONOMIC CHARACTERISTICS UNDER NITROGEN LIMITING CONDITIONS AND RELATED CONSTRUCTS AND METHODS INVOLVING GENES ENCODING LNT2 POLYPEPTIDES AND HOMOLOGS THEREOF

Abstract

and polypeptides and recombinant DNA constructs particularly useful for altering agronomic characteristics of plants under nitrogen limiting conditions, compositions (such as plants or seeds) comprising these recombinant DNA constructs, and methods utilizing these recombinant DNA constructs. The recombinant DNA construct comprises a polynucleotide operably linked to a promoter functional in a plant, wherein said polynucleotide encodes an LNT2 polypeptide.

Description

FIELD OF THE INVENTION

[0001]The field of invention relates to plant breeding and genetics and, in particular, relates to recombinant DNA constructs useful in plants for conferring nitrogen use efficiency and/or tolerance to nitrogen limiting conditions.

BACKGROUND OF THE INVENTION

[0002]Abiotic stressors significantly limit crop production worldwide. Cumulatively, these factors are estimated to be responsible for an average 70% reduction in agricultural production. Plants are sessile and have to adjust to the prevailing environmental conditions of their surroundings. This has led to their development of a great plasticity in gene regulation, morphogenesis, and metabolism. Adaptation and defense strategies involve the activation of genes encoding proteins important in the acclimation or defense towards the different stressors.

[0003]The absorption of nitrogen by plants plays an important role in their growth (Gallais et al., J. Exp. Bot. 55(396):295-306 (2004)). Plants synthesize amino acids from inorganic nitrogen in the environment. Consequently, nitrogen fertilization has been a powerful tool for increasing the yield of cultivated plants, such as maize and soybean. Today farmers desire to reduce the use of nitrogen fertilizer, in order to avoid pollution by nitrates and to maintain a sufficient profit margin. If the nitrogen assimilation capacity of a plant can be increased, then increases in plant growth and yield increase are also expected. In summary, plant varieties that have a better nitrogen use efficiency (NUE) are desirable.

[0004]Activation tagging can be utilized to identify genes with the ability to affect a trait. This approach has been used in the model plant species Arabidopsis thaliana (Weigel et al., Plant Physiol. 122:1003-1013 (2000)). Insertions of transcriptional enhancer elements can dominantly activate and/or elevate the expression of nearby endogenous genes. This method can be used to identify genes of interest for a particular trait (e.g. nitrogen use efficiency in a plant), genes that when placed in an organism as a transgene can alter that trait.

SUMMARY OF THE INVENTION

[0005]The present invention includes:

[0006]In one embodiment, a plant comprising in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 24, 26, 28, 30, or 32, and wherein said plant exhibits increased nitrogen stress tolerance when compared to a control plant not comprising said recombinant DNA construct.

[0007]In another embodiment, a plant comprising in its genome a recombinant DNA construct comprising:

[0008](a) a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 24, 26, 28, 30, or 32; or

[0009](b) a suppression DNA construct comprising at least one regulatory element operably linked to: (i) all or part of: (A) a nucleic acid sequence encoding a polypeptide having an amino acid sequence of at least 50% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 24, 26, 28, 30, or 32, or (B) a full complement of the nucleic acid sequence of (b)(i)(A); or (ii) a region derived from all or part of a sense strand or antisense strand of a target gene of interest, said region having a nucleic acid sequence of at least 50% sequence identity, based on the Clustal V method of alignment, when compared to said all or part of a sense strand or antisense strand from which said region is derived, and wherein said target gene of interest encodes an LNT2 or LNT2-like polypeptide, and wherein said plant exhibits an alteration of at least one agronomic characteristic when compared to a control plant not comprising said recombinant DNA construct.

[0010]In another embodiment, a method of increasing nitrogen stress tolerance in a plant, comprising (a) introducing into a regenerable plant cell a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory sequence, wherein the polynucleotide encodes a polypeptide having an amino acid sequence of at least 50% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 24, 26, 28, 30, or 32; (b) regenerating a transgenic plant from the regenerable plant cell after step (a), wherein the transgenic plant comprises in its genome the recombinant DNA construct and exhibits increased nitrogen stress tolerance when compared to a control plant not comprising the recombinant DNA construct; and optionally, (c) obtaining a progeny plant derived from the transgenic plant, wherein said progeny plant comprises in its genome the recombinant DNA construct and exhibits increased nitrogen stress tolerance when compared to a control plant not comprising the recombinant DNA construct.

[0011]In another embodiment, a method of evaluating nitrogen stress tolerance in a plant, comprising (a) introducing into a regenerable plant cell a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory sequence, wherein the polynucleotide encodes a polypeptide having an amino acid sequence of at least 50% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 24, 26, 28, 30, or 32; (b) regenerating a transgenic plant from the regenerable plant cell after step (a), wherein the transgenic plant comprises in its genome the recombinant DNA construct; and (c) evaluating the transgenic plant for nitrogen stress tolerance compared to a control plant not comprising the recombinant DNA construct; and optionally, (d) obtaining a progeny plant derived from the transgenic plant, wherein the progeny plant comprises in its genome the recombinant DNA construct; and optionally, (e) evaluating the progeny plant for nitrogen stress tolerance compared to a control plant not comprising the recombinant DNA construct.

[0012]In another embodiment, a method of evaluating nitrogen stress tolerance in a plant, comprising (a) introducing into a regenerable plant cell a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory sequence, wherein the polynucleotide encodes a polypeptide having an amino acid sequence of at least 50% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 24, 26, 28, 30, or 32; (b) regenerating a transgenic plant from the regenerable plant cell after step (a), wherein the transgenic plant comprises in its genome the recombinant DNA construct; (c) obtaining a progeny plant derived from the transgenic plant, wherein the progeny plant comprises in its genome the recombinant DNA construct; and (d) evaluating the progeny plant for nitrogen stress tolerance compared to a control plant not comprising the recombinant DNA construct.

[0013]In another embodiment, a method of determining an alteration of an agronomic characteristic in a plant, comprising (a) introducing into a regenerable plant cell a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory sequence, wherein the polynucleotide encodes a polypeptide having an amino acid sequence of at least 50% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 24, 26, 28, 30, or 32; (b) regenerating a transgenic plant from the regenerable plant cell after step (a), wherein the transgenic plant comprises in its genome the recombinant DNA construct; and (c) determining whether the transgenic plant exhibits an alteration of at least one agronomic characteristic when compared to a control plant not comprising the recombinant DNA construct; and optionally, (d) obtaining a progeny plant derived from the transgenic plant, wherein the progeny plant comprises in its genome the recombinant DNA construct; and optionally, (e) determining whether the progeny plant exhibits an alteration of at least one agronomic characteristic when compared, optionally under nitrogen limiting conditions, to a control plant not comprising the recombinant DNA construct.

[0014]In another embodiment, a method of determining an alteration of an agronomic characteristic in a plant, comprising (a) introducing into a regenerable plant cell a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory sequence, wherein the polynucleotide encodes a polypeptide having an amino acid sequence of at least 50% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 24, 26, 28, 30, or 32; (b) regenerating a transgenic plant from the regenerable plant cell after step (a), wherein the transgenic plant comprises in its genome the recombinant DNA construct; (c) obtaining a progeny plant derived from the transgenic plant, wherein the progeny plant comprises in its genome the recombinant DNA construct; and (d) determining whether the progeny plant exhibits an alteration of at least one agronomic characteristic when compared optionally under nitrogen limiting conditions, to a control plant not comprising the recombinant DNA construct.

[0015]In another embodiment, a method of determining an alteration of an agronomic characteristic in a plant, comprising:

[0016](a) introducing into a regenerable plant cell a suppression DNA construct comprising at least one regulatory element operably linked to: [0017](i) all or part of: (A) a nucleic acid sequence encoding a polypeptide having an amino acid sequence of at least 50% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 24, 26, 28, 30, or 32, or (B) a full complement of the nucleic acid sequence of (b)(i)(A); or [0018](ii) a region derived from all or part of a sense strand or antisense strand of a target gene of interest, said region having a nucleic acid sequence of at least 50% sequence identity, based on the Clustal V method of alignment, when compared to said all or part of a sense strand or antisense strand from which said region is derived, and wherein said target gene of interest encodes an LNT2 or LNT2-like polypeptide;

[0019](b) regenerating a transgenic plant from the regenerable plant cell after step (a), wherein the transgenic plant comprises in its genome the suppression DNA construct; and

[0020](c) determining whether the transgenic plant exhibits an alteration of at least one agronomic characteristic when compared to a control plant not comprising the suppression DNA construct;

[0021]and optionally, (d) obtaining a progeny plant derived from the transgenic plant, wherein the progeny plant comprises in its genome the suppression DNA construct;

[0022]and optionally, (e) determining whether the progeny plant exhibits an alteration of at least one agronomic characteristic when compared optionally under nitrogen limiting conditions, to a control plant not comprising the suppression DNA construct.

[0023]In another embodiment, a method of determining an alteration of an agronomic characteristic in a plant, comprising:

[0024](a) introducing into a regenerable plant cell a suppression DNA construct comprising at least one regulatory element operably linked to: [0025](i) all or part of: (A) a nucleic acid sequence encoding a polypeptide having an amino acid sequence of at least 50% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 24, 26, 28, 30, or 32, or (B) a full complement of the nucleic acid sequence of (b)(i)(A); or [0026](ii) a region derived from all or part of a sense strand or antisense strand of a target gene of interest, said region having a nucleic acid sequence of at least 50% sequence identity, based on the Clustal V method of alignment, when compared to said all or part of a sense strand or antisense strand from which said region is derived, and wherein said target gene of interest encodes an LNT2 or LNT2-like polypeptide;

[0027](b) regenerating a transgenic plant from the regenerable plant cell after step (a), wherein the transgenic plant comprises in its genome the suppression DNA construct and exhibits an alteration of at least one agronomic trait when compared to a control plant not comprising the suppression DNA construct;

[0028](c) obtaining a progeny plant derived from the transgenic plant, wherein the progeny plant comprises in its genome the suppression DNA construct; and

[0029](d) determining whether the progeny plant exhibits an alteration of at least one agronomic characteristic when compared to a control plant not comprising the suppression DNA construct;

[0030]and optionally, (e) determining whether the transgenic plant exhibits an alteration of at least one agronomic characteristic when compared, optionally, under nitrogen limiting conditions, to a control plant not comprising the recombinant DNA construct.

[0031]In another embodiment, the present invention concerns an isolated polynucleotide comprising: (a) a nucleotide sequence encoding a polypeptide, wherein the amino acid sequence of the polypeptide and the amino acid sequence of SEQ ID NO:18, 24, or 26 have at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity based on the Clustal V alignment method, or (b) the complement of the nucleotide sequence, wherein the complement and the nucleotide sequence contain the same number of nucleotides and are 100% complementary. The polypeptide In an embodiment comprises the amino acid sequence of SEQ ID NO:18, 24, or 26, and the nucleotide sequence comprises the nucleotide sequence of SEQ ID NO:17, 23, or 25.

BRIEF DESCRIPTION OF THE FIGURES AND SEQUENCE LISTINGS

[0032]The invention can be more fully understood from the following detailed description and the accompanying drawings and Sequence Listing which form a part of this application.

[0033]FIG. 1 shows a schematic of the pHSbarENDs2 activation tagging construct used to make the Arabidopsis populations (SEQ ID NO:1).

[0034]FIG. 2 shows a schematic of the vector pDONR®Zeo (SEQ ID NO:2), GATEWAY® donor vector. The attP1 site is at nucleotides 570-801; the attP2 site is at nucleotides 2754-2985 (complementary strand).

[0035]FIG. 3 shows a schematic of the vector pDONR®221 (SEQ ID NO:3), GATEWAY® donor vector. The attP1 site is at nucleotides 570-801; the attP2 site is at nucleotides 2754-2985 (complementary strand).

[0036]FIG. 4 shows a schematic of the vector pBC-yellow (SEQ ID NO:4), a destination vector for use in construction of expression vectors for Arabidopsis. The attR1 site is at nucleotides 11276-11399 (complementary strand); the attR2 site is at nucleotides 9695-9819 (complementary strand).

[0037]FIG. 5 shows a schematic of the vector PHP27840 (SEQ ID NO:5), a destination vector for use in construction of expression vectors for soybean. The attR1 site is at nucleotides 7310-7434; the attR2 site is at nucleotides 8890-9014.

[0038]FIG. 6 shows a schematic of the vector PHP23236 (SEQ ID NO:6), a destination vector for use in construction of expression vectors for Gaspe Flint derived maize lines. The attR1 site is at nucleotides 2006-2130; the attR2 site is at nucleotides 2899-3023.

[0039]FIG. 7 shows a schematic of the vector PHP10523 (SEQ ID NO:7), a plasmid DNA present in Agrobacterium strain LBA4404 (Komari et al., Plant J. 10:165-174 (1996); NCBI General Identifier No. 59797027).

[0040]FIG. 8 shows a schematic of the vector PHP23235 (SEQ ID NO:8), a vector used to construct the destination vector PHP23236.

[0041]FIG. 9 shows a schematic of the vector PHP20234 (SEQ ID NO:9).

[0042]FIG. 10 shows a schematic of the destination vector PHP22655 (SEQ ID NO:10).

[0043]FIG. 11 shows a typical grid pattern for five lines (labeled 1 through 5--eleven individuals for each line), plus wild-type control C1 (nine individuals), used in screens.

[0044]FIG. 12 shows a graph showing the effect of several different potassium nitrate concentrations on plant color as determined by image analysis. The response of the green color bin (hues 50 to 66) to nitrate dosage demonstrates that this bin can be used as an indicator of nitrogen assimilation.

[0045]FIG. 13 shows the growth medium used for semi-hydroponics maize growth in Example 18.

[0046]FIGS. 14A and 14B show the multiple alignment of the full length amino acid sequences of the Arabidopsis thaliana LNT2 polypeptide (SEQ ID NO:28) and the LNT2 homologs (SEQ ID NOs: 18, 20, 24, 26, 30, 32, 33, and 34).

[0047]FIG. 15 shows a chart of the percent sequence identity and the divergence values for each pair of amino acids sequences displayed in FIGS. 14A and 14B.

[0048]FIG. 16 shows the results from screening of Gaspe Flint derived maize lines under reduced nitrogen (1 mM KNO₃) and optimal nitrogen (6.5 mM KNO₃) conditions. Four events containing PHP29689 were evaluated for a number of traits. Event means were compared to that of the segregant nulls. A p-value≦0.1 was used as the cut off.

[0049]FIG. 17 shows the results from screening of Gaspe Flint derived maize lines under reduced nitrogen (1 mM KNO₃) and optimal nitrogen (6.5 mM KNO₃) conditions. All events containing PHP29689 were considered in the analysis. For each variable, the construct mean was compared to that of the construct null. A p-value≦0.1 was used as the cut off.

[0050]FIG. 18 shows the yield trial results for PHP28840-containing plants under low nitrogen conditions. The yield values in gray represent significant increases, and the yield values in black represent significant decreases. The remaining values represent non-significant differences.

[0051]FIG. 19 shows the yield trial results for PHP28841-containing plants under low nitrogen conditions. The yield values in gray represent significant increases, and the yield values in black represent significant decreases. The remaining values represent non-significant differences.

[0052]FIG. 20 shows the yield trial results for PHP28840-containing plants under normal nitrogen conditions. The yield values in gray represent significant increases, and the yield values in black represent significant decreases. The remaining values represent non-significant differences.

[0053]FIG. 21 shows the yield trial results for PHP28841-containing plants under normal nitrogen conditions. The yield values in gray represent significant increases, and the yield values in black represent significant decreases. The remaining values represent non-significant differences.

[0054]FIG. 22 shows the results of the NUE seedling assay for plants containing either PHP28840 (expression cassette=Int2-3) or PHP28841 (expression cassette=Int2-2).

[0055]The sequence descriptions and Sequence Listing attached hereto comply with the rules governing nucleotide and/or amino acid sequence disclosures in patent applications as set forth in 37 C.F.R. §1.821-1.825. The Sequence Listing contains the one letter code for nucleotide sequence characters and the three letter codes for amino acids as defined in conformity with the IUPAC-IUBMB standards described in Nucleic Acids Res. 13:3021-3030 (1985) and in the Biochemical J. 219 (2):345-373 (1984) which are herein incorporated by reference. The symbols and format used for nucleotide and amino acid sequence data comply with the rules set forth in 37 C.F.R. §1.822.

[0056]Table 1 lists certain polypeptides that are described herein, the designation of the cDNA clones that comprise the nucleic acid fragments encoding polypeptides representing all or a substantial portion of these polypeptides, and the corresponding identifier (SEQ ID NO:) as used in the attached Sequence Listing.

TABLE-US-00001 TABLE 1 Low Nitrogen tolerant proteins (LNT) SEQ ID NO: Amino Clone Designation Nucleotide Acid LNT2-like cpg1c.pk013.o6:fis 17 18 LNT2-like rca1n.pk001.f6:fis 19 20 LNT2-like sfl1n1.pk002.j1 21 LNT2-like sds1f.pk001.k5 22

[0057]SEQ ID NO:1 is the nucleotide sequence of the pHSbarENDs2 activation tagging vector (FIG. 1).

[0058]SEQ ID NO:2 is the nucleotide sequence of the pDONR®Zeo construct (FIG. 2).

[0059]SEQ ID NO:3 is the nucleotide sequence of the pDONR®221 construct (FIG. 3).

[0060]SEQ ID NO:4 is the nucleotide sequence of the pBC-yellow vector (FIG. 4).

[0061]SEQ ID NO:5 is the nucleotide sequence of the PHP27840 vector (FIG. 5).

[0062]SEQ ID NO:6 is the nucleotide sequence of the destination vector PHP23236 (FIG. 6).

[0063]SEQ ID NO:7 is the nucleotide sequence of the PHP10523 vector (FIG. 7).

[0064]SEQ ID NO:8 is the nucleotide sequence of the PHP23235 vector (FIG. 8).

[0065]SEQ ID NO:9 is the nucleotide sequence of the PHP20234 vector (FIG. 9).

[0066]SEQ ID NO:10 is the nucleotide sequence of the destination vector PHP22655 (FIG. 10).

[0067]SEQ ID NO:11 is the nucleotide sequence of the poly-linker used to substitute the Pacl restriction site at position 5775 of pHSbarENDs2.

[0068]SEQ ID NO:12 is the nucleotide sequence of the attB1 sequence.

[0069]SEQ ID NO:13 is the nucleotide sequence of the attB2 sequence.

[0070]SEQ ID NO:14 is the nucleotide sequence of the entry clone PHP23112.

[0071]SEQ ID NO:15 is the forward primer VC062 in Example 5.

[0072]SEQ ID NO:16 is the reverse primer VC063 in Example 5.

[0073]SEQ ID NOs:17-22 (see Table 1).

[0074]SEQ ID NO:23 is the consensus nucleotide sequence of a contig, referred to herein as PSO415619, containing BI316280 (NCBI General Identifier No. 14990607), CD401485 (NCBI General Identifier No. 31459457) and sfl1n1.pk002.j1 (SEQ ID NO:21).

[0075]SEQ ID NO:24 is the amino acid sequence of the polypeptide encoded by PSO415619 (SEQ ID NO:23).

[0076]SEQ ID NO:25 is the consensus nucleotide sequence of a contig, referred to herein as PSO415620, containing CX548557 (NCBI General Identifier No. 57575582) and sds1f.pk001.k5 (SEQ ID NO:22).

[0077]SEQ ID NO:26 is the amino acid sequence of the polypeptide encoded by PSO415620 (SEQ ID NO:25).

[0078]SEQ ID NO:27 is the nucleotide sequence of the gene that encodes the Arabidopsis thaliana "unknown protein" (LNT2) (At5g50930; NCBI General Identifier No. 145359102).

[0079]SEQ ID NO:28 is the amino acid sequence of the Arabidopsis thaliana "unknown protein" (LNT2) (At5g50930; NCBI General Identifier No. 15241317).

[0080]SEQ ID NO:29 is the nucleotide sequence of an alternative splice variant (referred to herein as "Int2-2") of At5g50930.

[0081]SEQ ID NO:30 is the amino acid sequence of the polypeptide encoded by Int2-2 (SEQ ID NO:29) and is referred to herein as "LNT2-2".

[0082]SEQ ID NO:31 is the nucleotide sequence of a second alternative splice variant (referred to herein as "Int2-3") of At5g50930.

[0083]SEQ ID NO:32 is the amino acid sequence of the polypeptide encoded by Int2-3 (SEQ ID NO:29) and is referred to herein as "LNT2-3". SEQ ID NO:32 is 100% identical to SEQ ID NO:52198 in EP1033405 based on the Clustal V method of alignment, using default parameters.

[0084]SEQ ID NO:33 is the amino acid sequence of the Oryza sativa "unknown protein" (NCBI General Identifier No. 38347162).

[0085]SEQ ID NO:34 is the amino acid sequence of the Vitis vinifera "hypothetical protein" (NCBI General Identifier No.147791927).

[0086]SEQ ID NO:35 is the nucleotide sequence of the At5g50930-5' attB forward primer.

[0087]SEQ ID NO:36 is the nucleotide sequence of the At5g50930-3' attB reverse primer.

DETAILED DESCRIPTION OF OTHER EMBODIMENTS

[0088]The disclosure of each reference set forth herein is hereby incorporated by reference in its entirety.

[0089]As used herein and in the appended claims, the singular forms "a", "an", and "the" include plural reference unless the context clearly dictates otherwise. Thus, for example, reference to "a plant" includes a plurality of such plants, reference to "a cell" includes one or more cells and equivalents thereof known to those skilled in the art, and so forth.

[0090]As used herein:

[0091]"Nitrogen limiting conditions" refers to conditions where the amount of total available nitrogen (e.g., from nitrates, ammonia, or other known sources of nitrogen) is not sufficient to sustain optimal plant growth and development. One skilled in the art would recognize conditions where total available nitrogen is sufficient to sustain optimal plant growth and development. One skilled in the art would recognize what constitutes sufficient amounts of total available nitrogen, and what constitutes soils, media and fertilizer inputs for providing nitrogen to plants. Nitrogen limiting conditions will vary depending upon a number of factors, including but not limited to, the particular plant and environmental conditions.

[0092]"Agronomic characteristic" is a measurable parameter including but not limited to, greenness, yield, growth rate, biomass, fresh weight at maturation, dry weight at maturation, fruit yield, seed yield, total plant nitrogen content, fruit nitrogen content, seed nitrogen content, nitrogen content in vegetative tissue, whole plant amino acid content, vegetative tissue free amino acid content, fruit free amino acid content, seed free amino acid content, total plant protein content, fruit protein content, seed protein content, protein content in a vegetative tissue, drought tolerance, nitrogen uptake, resistance to root lodging, harvest index, stalk lodging, plant height, ear height, and ear length.

[0093]"Harvest index" refers to the grain weight divided by the total plant weight. "Int2" refers to the Arabidopsis thaliana gene locus, At5g50930 (SEQ ID NO: 27). "LNT2" refers to the protein (SEQ ID NO:28) encoded by SEQ ID NO:27.

[0094]"Int2-2" (SEQ ID NO:29) and "Int2-3" (SEQ ID NO:31) are naturally occurring alternative splice variants of the At5g50930 gene. "LNT2-2" (SEQ ID NO:30) and "LNT2-3" (SEQ ID NO:32) refer to the proteins encoded by "Int2-2" and "Int2-3", respectively.

[0095]"Int2-like" refers to nucleotide homologs from different species, such as corn and soybean, of the Arabidopsis thaliana "Int2" locus At5g50930 (SEQ ID NO: 28) and includes without limitation any of the nucleotide sequences of SEQ ID NOs: 17, 19, 23, and 25.

[0096]"LNT2-like" refers to protein homologs from different species, such as corn and soybean, of the Arabidopsis thaliana "LNT2" (SEQ ID NO: 28) and includes without limitation any of the amino acid sequences of SEQ ID NOs: 18, 20, 24, and 26.

[0097]"Alternative splice variants" used herein refers to alternative forms of RNA transcribed from a gene. Splice variation naturally occurs as a result of alternative sites being spliced within a single transcribed RNA molecule or between separately transcribed RNA molecules, and may result in several different forms of mRNA transcribed from the same gene. Thus, splice variants may encode polypeptides having different amino acid sequences, which may or may not have similar functions in the organism.

[0098]"Nitrogen stress tolerance" is a trait of a plant and refers to the ability of the plant to survive under nitrogen limiting conditions.

[0099]"Increased nitrogen stress tolerance" of a plant is measured relative to a reference or control plant, and means that the nitrogen stress tolerance of the plant is increased by any amount or measure when compared to the nitrogen stress tolerance of the reference or control plant.

[0100]A "nitrogen stress tolerant plant" is a plant that exhibits nitrogen stress tolerance. A nitrogen stress tolerant plant is In an embodiment a plant that exhibits an increase in at least one agronomic characteristic relative to a control plant under nitrogen limiting conditions.

[0101]"Environmental conditions" refer to conditions under which the plant is grown, such as the availability of water, availability of nutrients (for example nitrogen), or the presence of insects or disease.

[0102]"Transgenic" refers to any cell, cell line, callus, tissue, plant part or plant, the genome of which has been altered by the presence of a heterologous nucleic acid, such as a recombinant DNA construct, including those initial transgenic events as well as those created by sexual crosses or asexual propagation from the initial transgenic event. The term "transgenic" as used herein does not encompass the alteration of the genome (chromosomal or extra-chromosomal) by conventional plant breeding methods or by naturally occurring events such as random cross-fertilization, non-recombinant viral infection, non-recombinant bacterial transformation, non-recombinant transposition, or spontaneous mutation.

[0103]"Genome" as it applies to plant cells encompasses not only chromosomal DNA found within the nucleus, but organelle DNA found within subcellular components (e.g., mitochondrial, plastid) of the cell.

[0104]"Plant" includes reference to whole plants, plant organs, plant tissues, seeds and plant cells and progeny of same. Plant cells include, without limitation, cells from seeds, suspension cultures, embryos, meristematic regions, callus tissue, leaves, roots, shoots, gametophytes, sporophytes, pollen, and microspores.

[0105]"Progeny" comprises any subsequent generation of a plant.

[0106]"Transgenic plant" includes reference to a plant which comprises within its genome a heterologous polynucleotide. In an embodiment, the heterologous polynucleotide is stably integrated within the genome such that the polynucleotide is passed on to successive generations. The heterologous polynucleotide may be integrated into the genome alone or as part of a recombinant DNA construct.

[0107]"Heterologous" with respect to sequence means a sequence that originates from a foreign species, or, if from the same species, is substantially modified from its native form in composition and/or genomic locus by deliberate human intervention.

[0108]"Polynucleotide", "nucleic acid sequence", "nucleotide sequence", or "nucleic acid fragment" are used interchangeably to refer to a polymer of RNA or DNA that is single- or double-stranded, optionally containing synthetic, non-natural or altered nucleotide bases. Nucleotides (usually found in their 5'-monophosphate form) are referred to by their single letter designation as follows: "A" for adenylate or deoxyadenylate (for RNA or DNA, respectively), "C" for cytidylate or deoxycytidylate, "G" for guanylate or deoxyguanylate, "U" for uridylate, "T" for deoxythymidylate, "R" for purines (A or G), "Y" for pyrimidines (C or T), "K" for G or T, "H" for A or C or T, "I" for inosine, and "N" for any nucleotide.

[0109]"Polypeptide", "peptide", "amino acid sequence" and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical analogue of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers. The terms "polypeptide", "peptide", "amino acid sequence", and "protein" are also inclusive of modifications including, but not limited to, glycosylation, lipid attachment, sulfation, gamma-carboxylation of glutamic acid residues, hydroxylation and ADP-ribosylation.

[0110]"Messenger RNA (mRNA)" refers to the RNA that is without introns and that can be translated into protein by the cell.

[0111]"cDNA" refers to a DNA that is complementary to and synthesized from an mRNA template using the enzyme reverse transcriptase. The cDNA can be single-stranded or converted into the double-stranded form using the Klenow fragment of DNA polymerase 1.

[0112]An "Expressed Sequence Tag" ("EST") is a DNA sequence derived from a cDNA library and therefore is a sequence which has been transcribed. An EST is typically obtained by a single sequencing pass of a cDNA insert. The sequence of an entire cDNA insert is termed the "Full-insert Sequence" ("FIS"). A "Contig" sequence is a sequence assembled from two or more sequences that can be selected from, but not limited to, the group consisting of an EST, FIS and PCR sequence. A sequence encoding an entire or functional protein is termed a "Complete Gene Sequence" ("CGS") and can be derived from an FIS or a contig.

[0113]"Mature" protein refers to a post-translationally processed polypeptide; i.e., one from which any pre- or pro-peptides present in the primary translation product have been removed.

[0114]"Precursor" protein refers to the primary product of translation of mRNA; i.e., with pre- and pro-peptides still present. Pre- and pro-peptides may be and are not limited to intracellular localization signals.

[0115]"Isolated" refers to materials, such as nucleic acid molecules and/or proteins, which are substantially free or otherwise removed from components that normally accompany or interact with the materials in a naturally occurring environment. Isolated polynucleotides may be purified from a host cell in which they naturally occur. Conventional nucleic acid purification methods known to skilled artisans may be used to obtain isolated polynucleotides. The term also embraces recombinant polynucleotides and chemically synthesized polynucleotides.

[0116]"Recombinant" refers to an artificial combination of two otherwise separated segments of sequence, e.g., by chemical synthesis or by the manipulation of isolated segments of nucleic acids by genetic engineering techniques. "Recombinant" also includes reference to a cell or vector, that has been modified by the introduction of a heterologous nucleic acid or a cell derived from a cell so modified, but does not encompass the alteration of the cell or vector by naturally occurring events (e.g., spontaneous mutation, natural transformation/transduction/transposition) such as those occurring without deliberate human intervention.

[0117]"Recombinant DNA construct" refers to a combination of nucleic acid fragments that are not normally found together in nature. Accordingly, a recombinant DNA construct may comprise regulatory sequences and coding sequences that are derived from different sources, or regulatory sequences and coding sequences derived from the same source, but arranged in a manner different than that normally found in nature.

[0118]The terms "entry clone" and "entry vector" are used interchangeably herein.

[0119]"Regulatory sequences" and "regulatory elements" are used interchangeably and refer to nucleotide sequences located upstream (5' non-coding sequences), within, or downstream (3' non-coding sequences) of a coding sequence, and which influence the transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences may include, but are not limited to, promoters, translation leader sequences, introns, and polyadenylation recognition sequences.

[0120]"Promoter" refers to a nucleic acid fragment capable of controlling transcription of another nucleic acid fragment.

[0121]"Promoter functional in a plant" is a promoter capable of controlling transcription in plant cells whether or not its origin is from a plant cell.

[0122]"Tissue-specific promoter" and "tissue-preferred promoter" are used interchangeably to refer to a promoter that is expressed predominantly but not necessarily exclusively in one tissue or organ, but that may also be expressed in one specific cell.

[0123]"Developmentally regulated promoter" refers to a promoter whose activity is determined by developmental events.

[0124]"Operably linked" refers to the association of nucleic acid fragments in a single fragment so that the function of one is regulated by the other. For example, a promoter is operably linked with a nucleic acid fragment when it is capable of regulating the transcription of that nucleic acid fragment.

[0125]"Expression" refers to the production of a functional product. For example, expression of a nucleic acid fragment may refer to transcription of the nucleic acid fragment (e.g., transcription resulting in mRNA or functional RNA) and/or translation of mRNA into a precursor or mature protein.

[0126]"Phenotype" means the detectable characteristics of a cell or organism.

[0127]"Introduced" in the context of inserting a nucleic acid fragment (e.g., a recombinant DNA construct) into a cell, means "transfection" or "transformation" or "transduction" and includes reference to the incorporation of a nucleic acid fragment into a eukaryotic or prokaryotic cell where the nucleic acid fragment may be incorporated into the genome of the cell (e.g., chromosome, plasmid, plastid or mitochondrial DNA), converted into an autonomous replicon, or transiently expressed (e.g., transfected mRNA).

[0128]A "transformed cell" is any cell into which a nucleic acid fragment (e.g., a recombinant DNA construct) has been introduced.

[0129]"Transformation" as used herein refers to both stable transformation and transient transformation.

[0130]"Stable transformation" refers to the introduction of a nucleic acid fragment into a genome of a host organism resulting in genetically stable inheritance. Once stably transformed, the nucleic acid fragment is stably integrated in the genome of the host organism and any subsequent generation.

[0131]"Transient transformation" refers to the introduction of a nucleic acid fragment into the nucleus, or DNA-containing organelle, of a host organism resulting in gene expression without genetically stable inheritance.

[0132]"Allele" is one of several alternative forms of a gene occupying a given locus on a chromosome. When the alleles present at a given locus on a pair of homologous chromosomes in a diploid plant are the same that plant is homozygous at that locus. If the alleles present at a given locus on a pair of homologous chromosomes in a diploid plant differ that plant is heterozygous at that locus. If a transgene is present on one of a pair of homologous chromosomes in a diploid plant that plant is hemizygous at that locus.

[0133]Sequence alignments and percent identity calculations may be determined using a variety of comparison methods designed to detect homologous sequences including, but not limited to, the MEGALIGN® program of the LASERGENE® bioinformatics computing suite (DNASTAR® Inc., Madison, Wis.). Unless stated otherwise, multiple alignment of the sequences provided herein were performed using the Clustal V method of alignment (Higgins and Sharp, CABIOS. 5:151-153 (1989)) with the default parameters (GAP PENALTY=10, GAP LENGTH PENALTY=10). Default parameters for pairwise alignments and calculation of percent identity of protein sequences using the Clustal V method are KTUPLE=1, GAP PENALTY=3, WINDOW=5 and DIAGONALS SAVED=5. For nucleic acids these parameters are KTUPLE=2, GAP PENALTY=5, WINDOW=4 and DIAGONALS SAVED=4. After alignment of the sequences, using the Clustal V program, it is possible to obtain "percent identity" and "divergence" values by viewing the "sequence distances" table on the same program; unless stated otherwise, percent identities and divergences provided and claimed herein were calculated in this manner.

[0134]Standard recombinant DNA and molecular cloning techniques used herein are well known in the art and are described more fully in Sambrook, J., Fritsch, E. F. and Maniatis, T. Molecular Cloning: A Laboratory Manual; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, 1989 (hereinafter "Sambrook").

[0135]Turning now to several embodiments:

[0136]Other embodiments include isolated polynucleotides and polypeptides, recombinant DNA constructs, compositions (such as plants or seeds) comprising these recombinant DNA constructs, and methods utilizing these recombinant DNA constructs.

[0137]Other Isolated Polynucleotides and Polypeptides

[0138]The present invention includes the following other isolated polynucleotides and polypeptides:

[0139]An isolated polynucleotide comprising: (i) a nucleic acid sequence encoding a polypeptide having an amino acid sequence of at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 56%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 24, 26, 28, 30, or 32; or (ii) a full complement of the nucleic acid sequence of (i), wherein the full complement and the nucleic acid sequence of (i) consist of the same number of nucleotides and are 100% complementary. Any of the foregoing isolated polynucleotides may be utilized in any recombinant DNA constructs (including suppression DNA constructs) of the present invention. The polypeptide can be an LNT2 or LNT2-like protein.

[0140]An isolated polypeptide having an amino acid sequence of at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 56%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 24, 26, 28, 30, or 32. The polypeptide is can be an LNT2 or LNT2-like protein.

[0141]An isolated polynucleotide comprising (i) a nucleic acid sequence of at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 56%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:17, 19, 23, 25, 27, 29, or 31; or (ii) a full complement of the nucleic acid sequence of (i). Any of the foregoing isolated polynucleotides may be utilized in any recombinant DNA constructs (including suppression DNA constructs) of the present invention. The isolated polynucleotide can be encodes an LNT2 or LNT2-like protein.

[0142]Other Recombinant DNA Constructs and Suppression DNA Constructs

[0143]In one aspect, the present invention includes recombinant DNA constructs (including suppression DNA constructs).

[0144]In one other embodiment, a recombinant DNA construct comprises a polynucleotide operably linked to at least one regulatory sequence (e.g., a promoter functional in a plant), wherein the polynucleotide comprises (i) a nucleic acid sequence encoding an amino acid sequence of at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 56%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 24, 26, 28, 30, or 32; or (ii) a full complement of the nucleic acid sequence of (i).

[0145]In another other embodiment, a recombinant DNA construct comprises a polynucleotide operably linked to at least one regulatory sequence (e.g., a promoter functional in a plant), wherein said polynucleotide comprises (i) a nucleic acid sequence of at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 56%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:17, 19, 23, 25, 27, 29, or 31; or (ii) a full complement of the nucleic acid sequence of (i).

[0146]FIGS. 14A and 14B show the multiple alignment of the amino acid sequences of SEQ ID NOs: 18, 20, 24, 26, 28, 30, 32, 33, and 34 The multiple alignment of the sequences was performed using the MEGALIGN® program of the LASERGENE® bioinformatics computing suite (DNASTAR® Inc., Madison, Wis.); in particular, using the Clustal V method of alignment (Higgins and Sharp, CABIOS. 5:151-153 (1989)) with the multiple alignment default parameters of GAP PENALTY=10 and GAP LENGTH PENALTY=10, and the pairwise alignment default parameters of KTUPLE=1, GAP PENALTY=3, WINDOW=5 and DIAGONALS SAVED=5.

[0147]FIG. 15 is a chart of the percent sequence identity and the divergence values for each pair of amino acids sequences displayed in FIGS. 14A and 14B.

[0148]In another other embodiment, a recombinant DNA construct comprises a polynucleotide operably linked to at least one regulatory sequence (e.g., a promoter functional in a plant), wherein said polynucleotide encodes an LNT2 or LNT2-like protein.

[0149]In another aspect, the present invention includes suppression DNA constructs.

[0150]A suppression DNA construct can comprise at least one regulatory sequence (in an embodiment a promoter functional in a plant) operably linked to (a) all or part of: (i) a nucleic acid sequence encoding a polypeptide having an amino acid sequence of at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 56%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 24, 26, 28, 30, or 32; or (ii) a full complement of the nucleic acid sequence of (a)(i); or (b) a region derived from all or part of a sense strand or antisense strand of a target gene of interest, said region having a nucleic acid sequence of at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 56%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to said all or part of a sense strand or antisense strand from which said region is derived, and wherein said target gene of interest encodes an LNT2 or LNT2-like protein; or (c) all or part of: (i) a nucleic acid sequence of at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 56%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:17, 19, 23, 25, 27, 29, or 31; or (ii) a full complement of the nucleic acid sequence of (c)(i). The suppression DNA construct in an embodiment, comprises a cosuppression construct, antisense construct, viral-suppression construct, hairpin suppression construct, stem-loop suppression construct, double-stranded RNA-producing construct, RNAi construct, or small RNA construct (e.g., an siRNA construct or an miRNA construct).

[0151]It is understood, as those skilled in the art will appreciate, that the invention encompasses more than the specific exemplary sequences. Alterations in a nucleic acid fragment which result in the production of a chemically equivalent amino acid at a given site, but do not affect the functional properties of the encoded polypeptide, are well known in the art. For example, a codon for the amino acid alanine, a hydrophobic amino acid, may be substituted by a codon encoding another less hydrophobic residue, such as glycine, or a more hydrophobic residue, such as valine, leucine, or isoleucine. Similarly, changes which result in substitution of one negatively charged residue for another, such as aspartic acid for glutamic acid, or one positively charged residue for another, such as lysine for arginine, can also be expected to produce a functionally equivalent product. Nucleotide changes which result in alteration of the N-terminal and C-terminal portions of the polypeptide molecule would also not be expected to alter the activity of the polypeptide. Each of the proposed modifications is well within the routine skill in the art, as is determination of retention of biological activity of the encoded products.

[0152]"Suppression DNA construct" is a recombinant DNA construct which when transformed or stably integrated into the genome of the plant, results in "silencing" of a target gene in the plant. The target gene may be endogenous or transgenic to the plant. "Silencing," as used herein with respect to the target gene, refers generally to the suppression of levels of mRNA or protein/enzyme expressed by the target gene, and/or the level of the enzyme activity or protein functionality. The terms "suppression", "suppressing" and "silencing", used interchangeably herein, includes lowering, reducing, declining, decreasing, inhibiting, eliminating or preventing. "Silencing" or "gene silencing" does not specify mechanism and is inclusive, and not limited to, anti-sense, cosuppression, viral-suppression, hairpin suppression, stem-loop suppression, RNAi-based approaches, and small RNA-based approaches.

[0153]A suppression DNA construct may comprise a region derived from a target gene of interest and may comprise all or part of the nucleic acid sequence of the sense strand (or antisense strand) of the target gene of interest. Depending upon the approach to be utilized, the region may be 100% identical or less than 100% identical (e.g., at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 56%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical all or part of the sense strand (or antisense strand) of the gene of interest.

[0154]Suppression DNA constructs are well-known in the art, are readily constructed once the target gene of interest is selected, and include, without limitation, cosuppression constructs, antisense constructs, viral-suppression constructs, hairpin suppression constructs, stem-loop suppression constructs, double-stranded RNA-producing constructs, and more generally, RNAi (RNA interference) constructs and small RNA constructs such as siRNA (short interfering RNA) constructs and miRNA (microRNA) constructs.

[0155]"Antisense inhibition" refers to the production of antisense RNA transcripts capable of suppressing the expression of the target gene or gene product. "Antisense RNA" refers to an RNA transcript that is complementary to all or part of a target primary transcript or mRNA and that blocks the expression of a target isolated nucleic acid fragment (U.S. Pat. No. 5,107,065). The complementarity of an antisense RNA may be with any part of the specific gene transcript, i.e., at the 5' non-coding sequence, 3' non-coding sequence, introns, or the coding sequence.

[0156]"Cosuppression" refers to the production of sense RNA transcripts capable of suppressing the expression of the target gene or gene product. "Sense" RNA refers to RNA transcript that includes the mRNA and can be translated into protein within a cell or in vitro. Cosuppression constructs in plants have been previously designed by focusing on overexpression of a nucleic acid sequence having homology to a native mRNA, in the sense orientation, which results in the reduction of all RNA having homology to the overexpressed sequence (see Vaucheret et al., Plant J. 16:651-659 (1998); and Gura, Nature 404:804-808 (2000)).

[0157]Another variation describes the use of plant viral sequences to direct the suppression of proximal mRNA encoding sequences (PCT Publication No. WO 98/36083 published on Aug. 20, 1998).

[0158]Previously described is the use of "hairpin" structures that incorporate all, or part, of an mRNA encoding sequence in a complementary orientation that results in a potential "stem-loop" structure for the expressed RNA (PCT Publication No. WO 99/53050 published on Oct. 21,1999). In this case the stem is formed by polynucleotides corresponding to the gene of interest inserted in either sense or anti-sense orientation with respect to the promoter and the loop is formed by some polynucleotides of the gene of interest, which do not have a complement in the construct. This increases the frequency of cosuppression or silencing in the recovered transgenic plants. For a review of hairpin suppression see Wesley, S. V. et al. (2003) Methods in Molecular Biology, Plant Functional Genomics: Methods and Protocols 236:273-286.

[0159]A construct where the stem is formed by at least 30 nucleotides from a gene to be suppressed and the loop is formed by a random nucleotide sequence has also effectively been used for suppression (PCT Publication No. WO 99/61632 published on Dec. 2, 1999).

[0160]The use of poly-T and poly-A sequences to generate the stem in the stem-loop structure has also been described (PCT Publication No. WO 02/00894 published Jan. 3, 2002).

[0161]Yet another variation includes using synthetic repeats to promote formation of a stem in the stem-loop structure. Transgenic organisms prepared with such recombinant DNA fragments have been shown to have reduced levels of the protein encoded by the nucleotide fragment forming the loop as described in PCT Publication No. WO 02/00904, published Jan. 3, 2002.

[0162]RNA interference refers to the process of sequence-specific post-transcriptional gene silencing in animals mediated by short interfering RNAs (siRNAs) (Fire et al., Nature 391:806 (1998)). The corresponding process in plants is commonly referred to as post-transcriptional gene silencing (PTGS) or RNA silencing and is also referred to as quelling in fungi. The process of post-transcriptional gene silencing is thought to be an evolutionarily-conserved cellular defense mechanism used to prevent the expression of foreign genes and is commonly shared by diverse flora and phyla (Fire et al., Trends Genet. 15:358 (1999)). Such protection from foreign gene expression may have evolved in response to the production of double-stranded RNAs (dsRNAs) derived from viral infection or from the random integration of transposon elements into a host genome via a cellular response that specifically destroys homologous single-stranded RNA of viral genomic RNA. The presence of dsRNA in cells triggers the RNAi response through a mechanism that has yet to be fully characterized.

[0163]The presence of long dsRNAs in cells stimulates the activity of a ribonuclease III enzyme referred to as dicer. Dicer is involved in the processing of the dsRNA into short pieces of dsRNA known as short interfering RNAs (siRNAs) (Berstein et al., Nature 409:363 (2001)). Short interfering RNAs derived from dicer activity are typically about 21 to about 23 nucleotides in length and comprise about 19 base pair duplexes (Elbashir et al., Genes Dev. 15:188 (2001)). Dicer has also been implicated in the excision of 21- and 22-nucleotide small temporal RNAs (stRNAs) from precursor RNA of conserved structure that are implicated in translational control (Hutvagner et al., Science 293:834 (2001)). The RNAi response also features an endonuclease complex, commonly referred to as an RNA-induced silencing complex (RISC), which mediates cleavage of single-stranded RNA having sequence complementarity to the antisense strand of the siRNA duplex. Cleavage of the target RNA takes place in the middle of the region complementary to the antisense strand of the siRNA duplex. In addition, RNA interference can also involve small RNA (e.g., miRNA) mediated gene silencing, presumably through cellular mechanisms that regulate chromatin structure and thereby prevent transcription of target gene sequences (see, e.g., Allshire, Science 297:1818-1819 (2002); Volpe et al., Science 297:1833-1837 (2002); Jenuwein, Science 297:2215-2218 (2002); and Hall et al., Science 297:2232-2237 (2002)). As such, miRNA molecules of the invention can be used to mediate gene silencing via interaction with RNA transcripts or alternately by interaction with particular gene sequences, wherein such interaction results in gene silencing either at the transcriptional or post-transcriptional level.

[0164]RNAi has been studied in a variety of systems. Fire et al. (Nature 391:806 (1998)) were the first to observe RNAi in Caenorhabditis elegans. Wianny and Goetz (Nature Cell Biol. 2:70 (1999)) describe RNAi mediated by dsRNA in mouse embryos. Hammond et al. (Nature 404:293 (2000)) describe RNAi in Drosophila cells transfected with dsRNA. Elbashir et al., (Nature 411:494 (2001)) describe RNAi induced by introduction of duplexes of synthetic 21-nucleotide RNAs in cultured mammalian cells including human embryonic kidney and HeLa cells.

[0165]Small RNAs play an important role in controlling gene expression. Regulation of many developmental processes, including flowering, is controlled by small RNAs. It is now possible to engineer changes in gene expression of plant genes by using transgenic constructs which produce small RNAs in the plant.

[0166]Small RNAs appear to function by base-pairing to complementary RNA or DNA target sequences. When bound to RNA, small RNAs trigger either RNA cleavage or translational inhibition of the target sequence. When bound to DNA target sequences, it is thought that small RNAs can mediate DNA methylation of the target sequence. The consequence of these events, regardless of the specific mechanism, is that gene expression is inhibited.

[0167]It is thought that sequence complementarity between small RNAs and their RNA targets helps to determine which mechanism, RNA cleavage or translational inhibition, is employed. It is believed that siRNAs which are perfectly complementary with their targets, work by RNA cleavage. Some miRNAs have perfect or near-perfect complementarity with their targets, and RNA cleavage has been demonstrated for at least a few of these miRNAs. Other miRNAs have several mismatches with their targets, and apparently inhibit their targets at the translational level. Again, without being held to a particular theory on the mechanism of action, a general rule is emerging that perfect or near-perfect complementarity causes RNA cleavage, whereas translational inhibition is favored when the miRNA/target duplex contains many mismatches. The apparent exception to this is microRNA 172 (miR172) in plants. One of the targets of miR172 is APETALA2 (AP2), and although miR172 shares near-perfect complementarity with AP2 it appears to cause translational inhibition of AP2 rather than RNA cleavage.

[0168]MicroRNAs (miRNAs) are noncoding RNAs of about 19 to about 24 nucleotides (nt) in length that have been identified in both animals and plants (Lagos-Quintana et al., Science 294:853-858 (2001), Lagos-Quintana et al., Curr. Biol. 12:735-739 (2002); Lau et al., Science 294:858-862 (2001); Lee and Ambros, Science 294:862-864 (2001); Llave et al., Plant Cell 14:1605-1619 (2002); Mourelatos et al., Genes. Dev. 16:720-728 (2002); Park et al., Curr. Biol. 12:1484-1495 (2002); Reinhart et al., Genes. Dev. 16:1616-1626 (2002)). They are processed from longer precursor transcripts that range in size from approximately 70 to 200 nt, and these precursor transcripts have the ability to form stable hairpin structures. In animals, the enzyme involved in processing miRNA precursors is called dicer, an RNAse III-like protein (Grishok et al., Cell 106:23-34 (2001); Hutvagner et al., Science 293:834-838 (2001); Ketting et al., Genes. Dev. 15:2654-2659 (2001)). Plants also have a dicer-like enzyme, DCL1 (previously named CARPEL FACTORY/SHORT INTEGUMENTS1/SUSPENSOR1), and recent evidence indicates that it, like dicer, is involved in processing the hairpin precursors to generate mature miRNAs (Park et al., Curr. Biol. 12:1484-1495 (2002); Reinhart et al., Genes Dev. 16:1616-1626 (2002)). Furthermore, it is becoming clear from recent work that at least some miRNA hairpin precursors originate as longer polyadenylated transcripts, and several different miRNAs and associated hairpins can be present in a single transcript (Lagos-Quintana et al., Science 294:853-858 (2001); Lee et al., EMBO J. 21:4663-4670 (2002)). Recent work has also examined the selection of the miRNA strand from the dsRNA product arising from processing of the hairpin by DICER (Schwartz et al., Cell 115:199-208 (2003)). It appears that the stability (i.e., G:C versus A:U content, and/or mismatches) of the two ends of the processed dsRNA affects the strand selection, with the low stability end being easier to unwind by a helicase activity. The 5' end strand at the low stability end is incorporated into the RISC complex, while the other strand is degraded.

[0169]MicroRNAs (miRNAs) appear to regulate target genes by binding to complementary sequences located in the transcripts produced by these genes. In the case of lin-4 and let-7, the target sites are located in the 3' UTRs of the target mRNAs (Lee et al., Cell 75:843-854 (1993); Wightman et al., Cell 75:855-862 (1993); Reinhart et al., Nature 403:901-906 (2000); Slack et al., Mol. Cell 5:659-669 (2000)), and there are several mismatches between the lin-4 and let-7 miRNAs and their target sites. Binding of the lin-4 or let-7 miRNA appears to cause downregulation of steady-state levels of the protein encoded by the target mRNA without affecting the transcript itself (Olsen and Ambros, Dev. Biol. 216:671-680 (1999)). On the other hand, recent evidence suggests that miRNAs can in some cases cause specific RNA cleavage of the target transcript within the target site, and this cleavage step appears to require 100% complementarity between the miRNA and the target transcript (Hutvagner and Zamore, Science 297:2056-2060 (2002); Llave et al., Plant Cell 14:1605-1619 (2002)). It seems likely that miRNAs can enter at least two pathways of target gene regulation: (1) protein downregulation when target complementarity is <100%; and (2) RNA cleavage when target complementarity is 100%. MicroRNAs entering the RNA cleavage pathway are analogous to the 21-25 nt short interfering RNAs (siRNAs) generated during RNA interference (RNAi) in animals and posttranscriptional gene silencing (PTGS) in plants, and likely are incorporated into an RNA-induced silencing complex (RISC) that is similar or identical to that seen for RNAi.

[0170]Identifying the targets of miRNAs with bioinformatics has not been successful in animals, and this is probably due to the fact that animal miRNAs have a low degree of complementarity with their targets. On the other hand, bioinformatic approaches have been successfully used to predict targets for plant miRNAs (Llave et al., Plant Cell 14:1605-1619 (2002); Park et al., Curr. Biol. 12:1484-1495 (2002); Rhoades et al., Cell 110:513-520 (2002)), and thus it appears that plant miRNAs have higher overall complementarity with their putative targets than do animal miRNAs. Most of these predicted target transcripts of plant miRNAs encode members of transcription factor families implicated in plant developmental patterning or cell differentiation.

[0171]Regulatory Sequences:

[0172]A recombinant DNA construct (including a suppression DNA construct) of the present invention can comprise at least one regulatory sequence.

[0173]A regulatory sequence is a promoter.

[0174]A number of promoters can be used in recombinant DNA constructs (and suppression DNA constructs) of the present invention. The promoters can be selected based on the desired outcome, and may include constitutive, tissue-specific, inducible, or other promoters for expression in the host organism.

[0175]High level, constitutive expression of the candidate gene under control of the 35S or UBI promoter may (or may not) have pleiotropic effects, although candidate gene efficacy may be estimated when driven by a constitutive promoter. Use of tissue-specific and/or stress-specific promoters may eliminate undesirable effects, but retain the ability to enhance nitrogen tolerance. This type of effect has been observed in Arabidopsis for drought and cold tolerance (Kasuga et al., Nature Biotechnol. 17:287-91 (1999)).

[0176]Suitable constitutive promoters for use in a plant host cell include, for example, the core promoter of the Rsyn7 promoter and other constitutive promoters disclosed in WO 99/43838 and U.S. Pat. No. 6,072,050; the core CaMV 35S promoter (Odell et al., Nature 313:810-812 (1985)); rice actin (McElroy et al., Plant Cell 2:163-171 (1990)); ubiquitin (Christensen et al., Plant Mol. Biol. 12:619-632 (1989) and Christensen et al., Plant Mol. Biol. 18:675-689 (1992)); pEMU (Last et al., Theor. Appl. Genet. 81:581-588 (1991)); MAS (Velten et al., EMBO J. 3:2723-2730 (1984)); ALS promoter (U.S. Pat. No. 5,659,026), and the like. Other constitutive promoters include, for example, those discussed in U.S. Pat. Nos. 5,608,149; 5,608,144; 5,604,121; 5,569,597; 5,466,785; 5,399,680; 5,268,463; 5,608,142; and 6,177,611.

[0177]In choosing a promoter to use in the methods of the invention, it may be desirable to use a tissue-specific or developmentally regulated promoter.

[0178]Another tissue-specific or developmentally regulated promoter is a DNA sequence which regulates the expression of a DNA sequence selectively in the cells/tissues of a plant critical to tassel development, seed set, or both, and limits the expression of such a DNA sequence to the period of tassel development or seed maturation in the plant. Any identifiable promoter may be used in the methods of the present invention which causes the desired temporal and spatial expression.

[0179]Promoters which are seed or embryo-specific and may be useful in the invention include soybean Kunitz trypsin inhibitor (Kti3, Jofuku and Goldberg, Plant Cell 1:1079-1093 (1989)), patatin (potato tubers) (Rocha-Sosa, M., et al., EMBO J. 8:23-29 (1989)), convicilin, vicilin, and legumin (pea cotyledons) (Rerie, W. G., et al., Mol. Gen. Genet. 259:149-157 (1991); Newbigin, E. J., et al., Planta 180:461-470 (1990); Higgins, T. J. V., et al., Plant. Mol. Biol. 11:683-695 (1988)), zein (maize endosperm) (Schemthaner, J. P., et al., EMBO J. 7:1249-1255 (1988)), phaseolin (bean cotyledon) (Segupta-Gopalan, C., et al., Proc. Natl. Acad. Sci. U.S.A. 82:3320-3324 (1995)), phytohemagglutinin (bean cotyledon) (Voelker, T. et al., EMBO J. 6:3571-3577 (1987)), B-conglycinin and glycinin (soybean cotyledon) (Chen, Z-L, et al., EMBO J. 7:297-302 (1988)), glutelin (rice endosperm), hordein (barley endosperm) (Marris, C., et al., Plant Mol. Biol. 10:359-366 (1988)), glutenin and gliadin (wheat endosperm) (Colot, V., et al., EMBO J. 6:3559-3564 (1987)), and sporamin (sweet potato tuberous root) (Hattori, T., et al., Plant Mol. Biol. 14:595-604 (1990)). Promoters of seed-specific genes operably linked to heterologous coding regions in chimeric gene constructions maintain their temporal and spatial expression pattern in transgenic plants. Such examples include Arabidopsis thaliana 2S seed storage protein gene promoter to express enkephalin peptides in Arabidopsis and Brassica napus seeds (Vanderkerckhove et al., Bio/Technology 7:L929-932 (1989)), bean lectin and bean beta-phaseolin promoters to express luciferase (Riggs et al., Plant Sci. 63:47-57 (1989)), and wheat glutenin promoters to express chloramphenicol acetyl transferase (Colot et al., EMBO J. 6:3559-3564 (1987)).

[0180]Inducible promoters selectively express an operably linked DNA sequence in response to the presence of an endogenous or exogenous stimulus, for example by chemical compounds (chemical inducers) or in response to environmental, hormonal, chemical, and/or developmental signals. Inducible or regulated promoters include, for example, promoters regulated by light, heat, stress, flooding or drought, phytohormones, wounding, or chemicals such as ethanol, jasmonate, salicylic acid, or safeners.

[0181]Other promoters include the following: 1) the stress-inducible RD29A promoter (Kasuga et al., Nature Biotechnol. 17:287-91 (1999)); 2) the barley promoter, B22E; expression of B22E is specific to the pedicel in developing maize kernels ("Primary Structure of a Novel Barley Gene Differentially Expressed in Immature Aleurone Layers", Klemsdal et al., Mol. Gen. Genet. 228(1/2):9-16 (1991)); and 3) maize promoter, Zag2 ("Identification and molecular characterization of ZAG1, the maize homolog of the Arabidopsis floral homeotic gene AGAMOUS", Schmidt et al., Plant Cell 5(7):729-737 (1993); "Structural characterization, chromosomal localization and phylogenetic evaluation of two pairs of AGAMOUS-like MADS-box genes from maize", Theissen et al., Gene 156(2):155-166 (1995); NCBI GenBank Accession No. X80206)). Zag2 transcripts can be detected five days prior to pollination to seven to eight days after pollination ("DAP"), and directs expression in the carpel of developing female inflorescences and Ciml which is specific to the nucleus of developing maize kernels. Ciml transcript is detected four to five days before pollination to six to eight DAP. Other useful promoters include any promoter which can be derived from a gene whose expression is maternally associated with developing female florets.

[0182]Additional other promoters for regulating the expression of the nucleotide sequences of the present invention in plants are stalk-specific promoters. Such stalk-specific promoters include the alfalfa S2A promoter (GenBank Accession No. EF030816; Abrahams et al., Plant Mol. Biol. 27:513-528 (1995)) and S2B promoter (GenBank Accession No. EF030817) and the like, herein incorporated by reference.

[0183]Promoters may be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even comprise synthetic DNA segments. It is understood by those skilled in the art that different promoters may direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental conditions. It is further recognized that since in most cases the exact boundaries of regulatory sequences have not been completely defined, DNA fragments of some variation may have identical promoter activity. Promoters that cause a gene to be expressed in most cell types at most times are commonly referred to as "constitutive promoters". New promoters of various types useful in plant cells are constantly being discovered; numerous examples may be found in the compilation by Okamuro, J. K., and Goldberg, R. B., Biochem. Plants 15:1-82 (1989).

[0184]Other promoters may include: RIP2, mLIP15, ZmCOR1, Rab17, CaMV 35S, RD29A, B22E, Zag2, SAM synthetase, ubiquitin, CaMV 19S, nos, Adh, sucrose synthase, R-allele, the vascular tissue other promoters S2A (Genbank accession number EF030816) and S2B (GenBank Accession No. EF030817), and the constitutive promoter GOS2 from Zea mays. Other promoters include root promoters, such as the maize NAS2 promoter, the maize Cyclo promoter (US Publication No. 2006/0156439, published Jul. 13, 2006), the maize ROOTMET2 promoter (WO 2005/063998, published Jul. 14, 2005), the CR1 BIO promoter (WO 2006/055487, published May 26, 2006), the CRWAQ81 (WO 2005/035770, published Apr. 21, 2005) and the maize ZRP2.47 promoter (NCBI Accession No. U38790; NCBI GI No.1063664).

[0185]Recombinant DNA constructs (and suppression DNA constructs) of the present invention may also include other regulatory sequences including, but not limited to, translation leader sequences, introns, and polyadenylation recognition sequences. In another other embodiment of the present invention, a recombinant DNA construct of the present invention further comprises an enhancer or silencer.

[0186]An intron sequence can be added to the 5' untranslated region, the protein-coding region or the 3' untranslated region to increase the amount of the mature message that accumulates in the cytosol. Inclusion of a spliceable intron in the transcription unit in both plant and animal expression constructs has been shown to increase gene expression at both the mRNA and protein levels up to 1000-fold (Buchman and Berg, Mol. Cell Biol. 8:4395-4405 (1988); Callis et al., Genes Dev. 1:1183-1200 (1987)). Such intron enhancement of gene expression is typically greatest when placed near the 5' end of the transcription unit. Use of maize introns Adh1-S intron 1, 2, and 6, the Bronze-1 intron are known in the art. See generally, The Maize Handbook, Chapter 116, Freeling and Walbot, Eds., Springer, N.Y. (1994).

[0187]If polypeptide expression is desired, it is generally desirable to include a polyadenylation region at the 3'-end of a polynucleotide coding region. The polyadenylation region can be derived from the natural gene, from a variety of other plant genes, or from T-DNA. The 3'-end sequence to be added can be derived from, for example, the nopaline synthase or octopine synthase genes, or alternatively from another plant gene, or less in an embodiment from any other eukaryotic gene.

[0188]A translation leader sequence is a DNA sequence located between the promoter sequence of a gene and the coding sequence. The translation leader sequence is present in the fully processed mRNA upstream of the translation start sequence. The translation leader sequence may affect processing of the primary transcript to mRNA, mRNA stability or translation efficiency. Examples of translation leader sequences have been described (Turner, R. and Foster, G. D., Mol. Biotech. 3:225 (1995)).

[0189]Any plant can be selected for the identification of regulatory sequences and genes to be used in recombinant DNA constructs of the present invention. Examples of suitable plant targets for the isolation of genes and regulatory sequences would include but are not limited to alfalfa, apple, apricot, Arabidopsis, artichoke, arugula, asparagus, avocado, banana, barley, beans, beet, blackberry, blueberry, broccoli, brussels sprouts, cabbage, canola, cantaloupe, carrot, cassava, castorbean, cauliflower, celery, cherry, chicory, cilantro, citrus, clementines, clover, coconut, coffee, corn, cotton, cranberry, cucumber, Douglas fir, eggplant, endive, escarole, eucalyptus, fennel, figs, garlic, gourd, grape, grapefruit, honey dew, jicama, kiwifruit, lettuce, leeks, lemon, lime, Loblolly pine, linseed, maize, mango, melon, mushroom, nectarine, nut, oat, oil palm, oil seed rape, okra, olive, onion, orange, an ornamental plant, palm, papaya, parsley, parsnip, pea, peach, peanut, pear, pepper, persimmon, pine, pineapple, plantain, plum, pomegranate, poplar, potato, pumpkin, quince, radiata pine, radicchio, radish, rapeseed, raspberry, rice, rye, sorghum, Southern pine, soybean, spinach, squash, strawberry, sugarbeet, sugarcane, sunflower, sweet potato, sweetgum, tangerine, tea, tobacco, tomato, triticale, turf, turnip, a vine, watermelon, wheat, yams, and zucchini. Particularly other plants for the identification of regulatory sequences are Arabidopsis, maize, wheat, soybean, and cotton.

[0190]Other Compositions

[0191]A other composition of the present invention is a plant comprising in its genome any of the recombinant DNA constructs (including any of the suppression DNA constructs) of the present invention (such as any of the other constructs discussed above). Other compositions also include any progeny of the plant, and any seed obtained from the plant or its progeny, wherein the progeny or seed comprises within its genome the recombinant DNA construct (or suppression DNA construct). Progeny includes subsequent generations obtained by self-pollination or out-crossing of a plant. Progeny also includes hybrids and inbreds.

[0192]In an embodiment, in hybrid seed propagated crops, mature transgenic plants can be self-pollinated to produce a homozygous inbred plant. The inbred plant produces seed containing the newly introduced recombinant DNA construct (or suppression DNA construct). These seeds can be grown to produce plants that would exhibit an altered agronomic characteristic (e.g., an increased agronomic characteristic, e.g. under nitrogen limiting conditions), or used in a breeding program to produce hybrid seed, which can be grown to produce plants that would exhibit such an altered agronomic characteristic. In an embodiment, the seeds are maize.

[0193]In an embodiment, the plant is a monocotyledonous or dicotyledonous plant, a maize or soybean plant, a maize plant, such as a maize hybrid plant or a maize inbred plant. The plant may also be sunflower, sorghum, canola, wheat, alfalfa, cotton, rice, barley or millet.

[0194]In an embodiment, the recombinant DNA construct is stably integrated into the genome of the plant.

[0195]Particularly other embodiments include but are not limited to the following other embodiments 1-8:

[0196]1. A plant (in an embodiment a maize or soybean plant) comprising in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory sequence, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 56%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 24, 26, 28, 30, or 32, and wherein said plant exhibits increased nitrogen stress tolerance when compared to a control plant not comprising said recombinant DNA construct. In an embodiment, the plant further exhibits an alteration of at least one agronomic characteristic when compared to the control plant.

[0197]2. A plant (in an embodiment a maize or soybean plant) comprising in its genome a recombinant DNA construct comprising:

[0198](a) a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 24, 26, 28, 30, or 32; or

[0199](b) a suppression DNA construct comprising at least one regulatory element operably linked to: [0200](i) all or part of: (A) a nucleic acid sequence encoding a polypeptide having an amino acid sequence of at least 50% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 24, 26, 28, 30, or 32, or (B) a full complement of the nucleic acid sequence of (b)(i)(A); or [0201](ii) a region derived from all or part of a sense strand or antisense strand of a target gene of interest, said region having a nucleic acid sequence of at least 50% sequence identity, based on the Clustal V method of alignment, when compared to said all or part of a sense strand or antisense strand from which said region is derived, and wherein said target gene of interest encodes an LNT2 or LNT2-like polypeptide,

[0202]and wherein said plant exhibits an alteration of at least one agronomic characteristic when compared to a control plant not comprising said recombinant DNA construct.

[0203]3. A plant (in an embodiment a maize or soybean plant) comprising in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory sequence, wherein said polynucleotide encodes an LNT2 or LNT2-like polypeptide, and wherein said plant exhibits increased nitrogen stress tolerance when compared to a control plant not comprising said recombinant DNA construct. In an embodiment, the plant further exhibits an alteration of at least one agronomic characteristic when compared to the control plant. In an embodiment, the LNT2 polypeptide is from Arabidopsis thaliana, Zea mays, Glycine max, Glycine tabacina, Glycine soja or Glycine tomentella.

[0204]4. A plant (in an embodiment a maize or soybean plant) comprising in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory sequence, wherein said polynucleotide encodes an LNT2 or LNT2-like polypeptide, and wherein said plant exhibits an alteration of at least one agronomic characteristic under nitrogen limiting conditions when compared to a control plant not comprising said recombinant DNA construct. In an embodiment, the LNT2 polypeptide is from Arabidopsis thaliana, Zea mays, Glycine max, Glycine tabacina, Glycine soja or Glycine tomentella.

[0205]5. A plant (in an embodiment a maize or soybean plant) comprising in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 56%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 24, 26, 28, 30, or 32, and wherein said plant exhibits an alteration of at least one agronomic characteristic under nitrogen limiting conditions when compared to a control plant not comprising said recombinant DNA construct.

[0206]6. A plant (in an embodiment a maize or soybean plant) comprising in its genome a suppression DNA construct comprising at least one regulatory element operably linked to a region derived from all or part of a sense strand or antisense strand of a target gene of interest, said region having a nucleic acid sequence of at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 56%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to said all or part of a sense strand or antisense strand from which said region is derived, and wherein said target gene of interest encodes an LNT2 or LNT2-like polypeptide, and wherein said plant exhibits an alteration of at least one agronomic characteristic under nitrogen limiting conditions when compared to a control plant not comprising said suppression DNA construct.

[0207]7. A plant (in an embodiment a maize or soybean plant) comprising in its genome a suppression DNA construct comprising at least one regulatory element operably linked to all or part of: (a) a nucleic acid sequence encoding a polypeptide having an amino acid sequence of at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 56%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 24, 26, 28, 30, or 32; or (b) a full complement of the nucleic acid sequence of (a), and wherein said plant exhibits an alteration of at least one agronomic characteristic under nitrogen limiting conditions when compared to a control plant not comprising said suppression DNA construct.

[0208]8. Any progeny of the above plants in other embodiments 1-7, any seeds of the above plants in other embodiments 1-7, any seeds of progeny of the above plants in other embodiments 1-7, and cells from any of the above plants in other embodiments 1-7 and progeny thereof.

[0209]In any of the foregoing other embodiments 1-8 or any other embodiments of the present invention, the recombinant DNA construct (or suppression DNA construct) In an embodiment comprises at least a promoter functional in a plant as a other regulatory sequence.

[0210]In any of the foregoing other embodiments 1-8 or any other embodiments of the present invention, the alteration of at least one agronomic characteristic is either an increase or decrease, In an embodiment an increase.

[0211]In any of the foregoing other embodiments 1-8 or any other embodiments of the present invention, the at least one agronomic characteristic selected from the group consisting of greenness, yield, growth rate, biomass, fresh weight at maturation, dry weight at maturation, fruit yield, seed yield, total plant nitrogen content, fruit nitrogen content, seed nitrogen content, nitrogen content in a vegetative tissue, whole plant amino acid content, vegetative tissue free amino acid content, fruit free amino acid content, seed free amino acid content, total plant protein content, fruit protein content, seed protein content, protein content in a vegetative tissue, drought tolerance, nitrogen uptake, resistance to root lodging, harvest index, stalk lodging, plant height, ear height, and ear length. Yield, greenness and biomass are particularly other agronomic characteristics for alteration (In an embodiment an increase).

[0212]In any of the foregoing other embodiments 1-8 or any other embodiments of the present invention, the plant In an embodiment exhibits the alteration of at least one agronomic characteristic when compared, under nitrogen stress conditions, to a control plant not comprising said recombinant DNA construct (or suppression DNA construct).

[0213]One of ordinary skill in the art is familiar with protocols for simulating nitrogen conditions, whether limiting or non-limiting, and for evaluating plants that have been subjected to simulated or naturally-occurring nitrogen conditions, whether limiting or non-limiting. For example, one can simulate nitrogen conditions by giving plants less nitrogen than normally required or no nitrogen over a period of time, and one can evaluate such plants by looking for differences in agronomic characteristics, e.g., changes in physiological and/or physical condition, including (but not limited to) vigor, growth, size, or root length, or in particular, leaf color or leaf area size. Other techniques for evaluating such plants include measuring chlorophyll fluorescence, photosynthetic rates, root growth or gas exchange rates.

[0214]The Examples below describe some representative protocols and techniques for simulating nitrogen limiting conditions and/or evaluating plants under such conditions.

[0215]One can also evaluate nitrogen stress tolerance by the ability of a plant to maintain sufficient yield (In an embodiment at least 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% yield) in field testing under simulated or naturally-occurring low or high nitrogen conditions (e.g., by measuring for substantially equivalent yield under low or high nitrogen conditions compared to normal nitrogen conditions, or by measuring for less yield loss under low or high nitrogen conditions compared to a control or reference plant).

[0216]One of ordinary skill in the art would readily recognize a suitable control or reference plant to be utilized when assessing or measuring an agronomic characteristic or phenotype of a transgenic plant in any embodiment of the present invention in which a control or preference plant is utilized (e.g., compositions or methods as described herein). For example, by way of non-limiting illustrations:

[0217]1. Progeny of a transformed plant which is hemizygous with respect to a recombinant DNA construct (or suppression DNA construct), such that the progeny are segregating into plants either comprising or not comprising the recombinant DNA construct (or suppression DNA construct): the progeny comprising the recombinant DNA construct (or suppression DNA construct) would be typically measured relative to the progeny not comprising the recombinant DNA construct (or suppression DNA construct) (i.e., the progeny not comprising the recombinant DNA construct (or the suppression DNA construct) is the control or reference plant).

[0218]2. Introgression of a recombinant DNA construct (or suppression DNA construct) into an inbred line, such as in maize, or into a variety, such as in soybean: the introgressed line would typically be measured relative to the parent inbred or variety line (i.e., the parent inbred or variety line is the control or reference plant).

[0219]3. Two hybrid lines, where the first hybrid line is produced from two parent inbred lines, and the second hybrid line is produced from the same two parent inbred lines except that one of the parent inbred lines contains a recombinant DNA construct (or suppression DNA construct): the second hybrid line would typically be measured relative to the first hybrid line (i.e., the first hybrid line is the control or reference plant).

[0220]4. A plant comprising a recombinant DNA construct (or suppression DNA construct): the plant may be assessed or measured relative to a control plant not comprising the recombinant DNA construct (or suppression DNA construct) but otherwise having a comparable genetic background to the plant (e.g., sharing at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity of nuclear genetic material compared to the plant comprising the recombinant DNA construct (or suppression DNA construct)). There are many laboratory-based techniques available for the analysis, comparison and characterization of plant genetic backgrounds; among these are Isozyme Electrophoresis, Restriction Fragment Length Polymorphisms (RFLPs), Randomly Amplified Polymorphic DNAs (RAPDs), Arbitrarily Primed Polymerase Chain Reaction (AP-PCR), DNA Amplification Fingerprinting (DAF), Sequence Characterized Amplified Regions (SCARs), Amplified Fragment Length Polymorphisms (AFLP®s), and Simple Sequence Repeats (SSRs) which are also referred to as Microsatellites.

[0221]Furthermore, one of ordinary skill in the art would readily recognize that a suitable control or reference plant to be utilized when assessing or measuring an agronomic characteristic or phenotype of a transgenic plant would not include a plant that had been previously selected, via mutagenesis or transformation, for the desired agronomic characteristic or phenotype.

[0222]Other Methods

[0223]Other methods include but are not limited to methods for increasing nitrogen stress tolerance in a plant, methods for evaluating nitrogen stress tolerance in a plant, methods for altering an agronomic characteristic in a plant, methods for determining an alteration of an agronomic characteristic in a plant, and methods for producing seed. In an embodiment, the plant is a monocotyledonous or dicotyledonous plant, a maize or soybean plant, even more In an embodiment a maize plant. The plant may also be sunflower, sorghum, canola, wheat, alfalfa, cotton, rice, barley, or millet. The seed is can be a maize or soybean seed a maize seed, and even more In an embodiment, a maize hybrid seed or maize inbred seed.

[0224]Particularly other methods include but are not limited to the following:

[0225]A method of increasing nitrogen stress tolerance in a plant, comprising: (a) introducing into a regenerable plant cell a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory sequence (in an embodiment a promoter functional in a plant), wherein the polynucleotide encodes a polypeptide having an amino acid sequence of at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 56%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 24, 26, 28, 30, or 32; and (b) regenerating a transgenic plant from the regenerable plant cell after step (a), wherein the transgenic plant comprises in its genome the recombinant DNA construct and exhibits increased nitrogen stress tolerance when compared to a control plant not comprising the recombinant DNA construct. The method may further comprise (c) obtaining a progeny plant derived from the transgenic plant, wherein said progeny plant comprises in its genome the suppression DNA construct and exhibits increased nitrogen tolerance when compared to a control plant not comprising the recombinant DNA construct.

[0226]A method of increasing nitrogen stress tolerance in a plant, comprising: (a) introducing into a regenerable plant cell a suppression DNA construct comprising at least one regulatory sequence (in an embodiment a promoter functional in a plant) operably linked to all or part of (i) a nucleic acid sequence encoding a polypeptide having an amino acid sequence of at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 56%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:1 8, 20, 24, 26, 28, 30, or 32, or (ii) a full complement of the nucleic acid sequence of (a)(i); and (b) regenerating a transgenic plant from the regenerable plant cell after step (a), wherein the transgenic plant comprises in its genome the suppression DNA construct and exhibits increased nitrogen stress tolerance when compared to a control plant not comprising the suppression DNA construct. The method may further comprise (c) obtaining a progeny plant derived from the transgenic plant, wherein said progeny plant comprises in its genome the suppression DNA construct and exhibits increased nitrogen tolerance when compared to a control plant not comprising the suppression DNA construct.

[0227]A method of increasing nitrogen stress tolerance in a plant, comprising: (a) introducing into a regenerable plant cell a suppression DNA construct comprising at least one regulatory sequence (in an embodiment a promoter functional in a plant) operably linked to a region derived from all or part of a sense strand or antisense strand of a target gene of interest, said region having a nucleic acid sequence of at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 56%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to said all or part of a sense strand or antisense strand from which said region is derived, and wherein said target gene of interest encodes an LNT2 or LNT2-like polypeptide; and (b) regenerating a transgenic plant from the regenerable plant cell after step (a), wherein the transgenic plant comprises in its genome the suppression DNA construct and exhibits increased nitrogen stress tolerance when compared to a control plant not comprising the suppression DNA construct. The method may further comprise (c) obtaining a progeny plant derived from the transgenic plant, wherein said progeny plant comprises in its genome the suppression DNA construct and exhibits increased nitrogen tolerance when compared to a control plant not comprising the suppression DNA construct.

[0228]A method of evaluating nitrogen stress tolerance in a plant, comprising (a) introducing into a regenerable plant cell a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory sequence (in an embodiment a promoter functional in a plant), wherein the polynucleotide encodes a polypeptide having an amino acid sequence of at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 56%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 24, 26, 28, 30, or 32; (b) regenerating a transgenic plant from the regenerable plant cell after step (a), wherein the transgenic plant comprises in its genome the recombinant DNA construct; and (c) evaluating the transgenic plant for nitrogen stress tolerance compared to a control plant not comprising the recombinant DNA construct. The method may further comprise (d) obtaining a progeny plant derived from the transgenic plant, wherein the progeny plant comprises in its genome the recombinant DNA construct; and (e) evaluating the progeny plant for nitrogen stress tolerance compared to a control plant not comprising the recombinant DNA construct.

[0229]A method of evaluating nitrogen stress tolerance in a plant, comprising (a) introducing into a regenerable plant cell a suppression DNA construct comprising at least one regulatory sequence (in an embodiment a promoter functional in a plant) operably linked to all or part of (i) a nucleic acid sequence encoding a polypeptide having an amino acid sequence of at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 56%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 24, 26, 28, 30, or 32; or (ii) a full complement of the nucleic acid sequence of (a)(i); (b) regenerating a transgenic plant from the regenerable plant cell after step (a), wherein the transgenic plant comprises in its genome the suppression DNA construct; and (c) evaluating the transgenic plant for nitrogen stress tolerance compared to a control plant not comprising the suppression DNA construct. The method may further comprise (d) obtaining a progeny plant derived from the transgenic plant, wherein the progeny plant comprises in its genome the suppression DNA construct; and (e) evaluating the progeny plant for nitrogen stress tolerance compared to a control plant not comprising the suppression DNA construct.

[0230]A method of evaluating nitrogen stress tolerance in a plant, comprising (a) introducing into a regenerable plant cell a suppression DNA construct comprising at least one regulatory sequence (in an embodiment a promoter functional in a plant) operably linked to a region derived from all or part of a sense strand or antisense strand of a target gene of interest, said region having a nucleic acid sequence of at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 56%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to said all or part of a sense strand or antisense strand from which said region is derived, and wherein said target gene of interest encodes an LNT2 or LNT2-like polypeptide; (b) regenerating a transgenic plant from the regenerable plant cell after step (a), wherein the transgenic plant comprises in its genome the suppression DNA construct; and (c) evaluating the transgenic plant for nitrogen stress tolerance compared to a control plant not comprising the suppression DNA construct. The method may further comprise (d) obtaining a progeny plant derived from the transgenic plant, wherein the progeny plant comprises in its genome the suppression DNA construct; and (e) evaluating the progeny plant for nitrogen stress tolerance compared to a control plant not comprising the suppression DNA construct.

[0231]A method of evaluating nitrogen stress tolerance in a plant, comprising (a) introducing into a regenerable plant cell a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory sequence (in an embodiment a promoter functional in a plant), wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 56%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 24, 26, 28, 30, or 32; (b) regenerating a transgenic plant from the regenerable plant cell after step (a), wherein the transgenic plant comprises in its genome the recombinant DNA construct; (c) obtaining a progeny plant derived from said transgenic plant, wherein the progeny plant comprises in its genome the recombinant DNA construct; and (d) evaluating the progeny plant for nitrogen stress tolerance compared to a control plant not comprising the recombinant DNA construct.

[0232]A method of evaluating nitrogen stress tolerance in a plant, comprising (a) introducing into a regenerable plant cell a suppression DNA construct comprising at least one regulatory sequence (in an embodiment a promoter functional in a plant) operably linked to all or part of (i) a nucleic acid sequence encoding a polypeptide having an amino acid sequence of at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 56%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:1 8, 20, 24, 26, 28, 30, or 32; or (ii) a full complement of the nucleic acid sequence of (a)(i); (b) regenerating a transgenic plant from the regenerable plant cell after step (a), wherein the transgenic plant comprises in its genome the suppression DNA construct; (c) obtaining a progeny plant derived from said transgenic plant, wherein the progeny plant comprises in its genome the suppression DNA construct; and (d) evaluating the progeny plant for nitrogen stress tolerance compared to a control plant not comprising the recombinant DNA construct.

[0233]A method of evaluating nitrogen stress tolerance in a plant, comprising (a) introducing into a regenerable plant cell a suppression DNA construct comprising at least one regulatory sequence (in an embodiment a promoter functional in a plant) operably linked to a region derived from all or part of a sense strand or antisense strand of a target gene of interest, said region having a nucleic acid sequence of at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 56%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to said all or part of a sense strand or antisense strand from which said region is derived, and wherein said target gene of interest encodes an LNT2 or LNT2-like polypeptide; (b) regenerating a transgenic plant from the regenerable plant cell after step (a), wherein the transgenic plant comprises in its genome the suppression DNA construct; (c) obtaining a progeny plant derived from the transgenic plant, wherein the progeny plant comprises in its genome the suppression DNA construct; and (d) evaluating the progeny plant for nitrogen stress tolerance compared to a control plant not comprising the recombinant DNA construct.

[0234]A method of determining an alteration of an agronomic characteristic in a plant, comprising (a) introducing into a regenerable plant cell a recombinant DNA construct comprising a polynucleotide operably linked to at least on regulatory sequence (in an embodiment a promoter functional in a plant), wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 56%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 24, 26, 28, 30, or 32; (b) regenerating a transgenic plant from the regenerable plant cell after step (a), wherein the transgenic plant comprises in its genome said recombinant DNA construct; and (c) determining whether the transgenic plant exhibits an alteration of at least one agronomic characteristic when compared, in an embodiment under nitrogen limiting conditions, to a control plant not comprising the recombinant DNA construct. The method may further comprise (d) obtaining a progeny plant derived from the transgenic plant, wherein the progeny plant comprises in its genome the recombinant DNA construct; and (e) determining whether the progeny plant exhibits an alteration of at least one agronomic characteristic when compared, in an embodiment under nitrogen limiting conditions, to a control plant not comprising the recombinant DNA construct.

[0235]A method of determining an alteration of an agronomic characteristic in a plant, comprising (a) introducing into a regenerable plant cell a suppression DNA construct comprising at least one regulatory sequence (in an embodiment a promoter functional in a plant) operably linked to all or part of (i) a nucleic acid sequence encoding a polypeptide having an amino acid sequence of at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 56%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 24, 26, 28, 30, or 32; or (ii) a full complement of the nucleic acid sequence of (i); (b) regenerating a transgenic plant from the regenerable plant cell after step (a), wherein the transgenic plant comprises in its genome the suppression DNA construct; and (c) determining whether the transgenic plant exhibits an alteration of at least one agronomic characteristic when compared, in an embodiment under nitrogen limiting conditions, to a control plant not comprising the suppression DNA construct. The method may further comprise (d) obtaining a progeny plant derived from the transgenic plant, wherein the progeny plant comprises in its genome the suppression DNA construct; and (e) determining whether the progeny plant exhibits an alteration of at least one agronomic characteristic when compared, in an embodiment under nitrogen limiting conditions, to a control plant not comprising the suppression DNA construct.

[0236]A method of determining an alteration of an agronomic characteristic in a plant, comprising (a) introducing into a regenerable plant cell a suppression DNA construct comprising at least one regulatory sequence (in an embodiment a promoter functional in a plant) operably linked to a region derived from all or part of a sense strand or antisense strand of a target gene of interest, said region having a nucleic acid sequence of at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 56%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% sequence identity, based on the Clustal V method of alignment, when compared to said all or part of a sense strand or antisense strand from which said region is derived, and wherein said target gene of interest encodes an LNT2 or LNT2-like polypeptide; (b) regenerating a transgenic plant from the regenerable plant cell after step (a), wherein the transgenic plant comprises in its genome the suppression DNA construct; and (c) determining whether the transgenic plant exhibits an alteration of at least one agronomic characteristic when compared, in an embodiment under nitrogen limiting conditions, to a control plant not comprising the suppression DNA construct. The method may further comprise (d) obtaining a progeny plant derived from the transgenic plant, wherein the progeny plant comprises in its genome the suppression DNA construct; and (e) determining whether the progeny plant exhibits an alteration of at least one agronomic characteristic when compared, in an embodiment under nitrogen limiting conditions, to a control plant not comprising the suppression DNA construct.

[0237]A method of determining an alteration of an agronomic characteristic in a plant, comprising (a) introducing into a regenerable plant cell a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory sequence (in an embodiment a promoter functional in a plant), wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 56%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 24, 26, 28, 30, or 32; (b) regenerating a transgenic plant from the regenerable plant cell after step (a), wherein the transgenic plant comprises in its genome said recombinant DNA construct; (c) obtaining a progeny plant derived from said transgenic plant, wherein the progeny plant comprises in its genome the recombinant DNA construct; and (d) determining whether the progeny plant exhibits an alteration of at least one agronomic characteristic when compared, in an embodiment under nitrogen limiting conditions, to a control plant not comprising the recombinant DNA construct.

[0238]A method of determining an alteration of an agronomic characteristic in a plant, comprising (a) introducing into a regenerable plant cell a suppression DNA construct comprising at least one regulatory sequence (in an embodiment a promoter functional in a plant) operably linked to all or part of (i) a nucleic acid sequence encoding a polypeptide having an amino acid sequence of at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 56%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 24, 26, 28, 30, or 32; or (ii) a full complement of the nucleic acid sequence of (i); (b) regenerating a transgenic plant from the regenerable plant cell after step (a), wherein the transgenic plant comprises in its genome the suppression DNA construct; (c) obtaining a progeny plant derived from said transgenic plant, wherein the progeny plant comprises in its genome the suppression DNA construct; and (d) determining whether the progeny plant exhibits an alteration of at least one agronomic characteristic when compared, in an embodiment under nitrogen limiting conditions, to a control plant not comprising the recombinant DNA construct.

[0239]A method of determining an alteration of an agronomic characteristic in a plant, comprising (a) introducing into a regenerable plant cell a suppression DNA construct comprising at least one regulatory sequence (in an embodiment a promoter functional in a plant) operably linked to a region derived from all or part of a sense strand or antisense strand of a target gene of interest, said region having a nucleic acid sequence of at least 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 56%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity, based on the Clustal V method of alignment, when compared to said all or part of a sense strand or antisense strand from which said region is derived, and wherein said target gene of interest encodes an LNT2 or LNT2-like polypeptide; (b) regenerating a transgenic plant from the regenerable plant cell after step (a), wherein the transgenic plant comprises in its genome the suppression DNA construct; (c) obtaining a progeny plant derived from said transgenic plant, wherein the progeny plant comprises in its genome the suppression DNA construct; and (d) determining whether the progeny plant exhibits an alteration of at least one agronomic characteristic when compared, in an embodiment under nitrogen limiting conditions, to a control plant not comprising the suppression DNA construct.

[0240]A method of producing seed (in an embodiment seed that can be sold as a nitrogen stress tolerant product offering) comprising any of the preceding other methods, and further comprising obtaining seeds from said progeny plant, wherein said seeds comprise in their genome said recombinant DNA construct (or suppression DNA construct).

[0241]In any of the foregoing other methods or any other embodiments of methods of the present invention, the step of determining an alteration of an agronomic characteristic in a transgenic plant, if applicable, may in an embodiment comprise determining whether the transgenic plant exhibits an alteration of at least one agronomic characteristic when compared, under varying environmental conditions, to a control plant not comprising the recombinant DNA construct.

[0242]In any of the foregoing other methods or any other embodiments of methods of the present invention, the step of determining an alteration of an agronomic characteristic in a progeny plant, if applicable, may comprise determining whether the progeny plant exhibits an alteration of at least one agronomic characteristic when compared, under varying environmental conditions, to a control plant not comprising the recombinant DNA construct.

[0243]In any of the preceding other methods or any other embodiments of methods of the present invention, in said introducing step said regenerable plant cell may comprises a callus cell (in an embodiment embryogenic), a gametic cell, a meristematic cell, or a cell of an immature embryo. The regenerable plant cells are in an embodiment from an inbred maize plant.

[0244]In any of the preceding other methods or any other embodiments of methods of the present invention, said regenerating step in an embodiment comprises: (i) culturing said transformed plant cells in a media comprising an embryogenic promoting hormone until callus organization is observed; (ii) transferring said transformed plant cells of step (i) to a first media which includes a tissue organization promoting hormone; and (iii) subculturing said transformed plant cells after step (ii) onto a second media, to allow for shoot elongation, root development or both.

[0245]In any of the preceding other methods or any other embodiments of methods of the present invention, the at least one agronomic characteristic is selected from the group consisting of greenness, yield, growth rate, biomass, fresh weight at maturation, dry weight at maturation, fruit yield, seed yield, total plant nitrogen content, fruit nitrogen content, seed nitrogen content, nitrogen content in a vegetative tissue, whole plant amino acid content, vegetative tissue free amino acid content, fruit free amino acid content, seed free amino acid content, total plant protein content, fruit protein content, seed protein content, protein content in a vegetative tissue, drought tolerance, nitrogen uptake, resistance to root lodging, harvest index, stalk lodging, plant height, ear height, and ear length. Yield, greenness and biomass are particularly other agronomic characteristics for alteration (in an embodiment an increase).

[0246]In any of the preceding other methods or any other embodiments of methods of the present invention, the plant in an embodiment exhibits the alteration of at least one agronomic characteristic when compared, under nitrogen stress conditions, to a control plant not comprising said recombinant DNA construct (or suppression DNA construct).

[0247]In any of the preceding other methods or any other embodiments of methods of the present invention, alternatives exist for introducing into a regenerable plant cell a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory sequence. For example, one may introduce into a regenerable plant cell a regulatory sequence (such as one or more enhancers, in an embodiment as part of a transposable element), and then screen for an event in which the regulatory sequence is operably linked to an endogenous gene encoding a polypeptide of the instant invention.

[0248]The introduction of recombinant DNA constructs of the present invention into plants may be carried out by any suitable technique, including but not limited to direct DNA uptake, chemical treatment, electroporation, microinjection, cell fusion, infection, vector mediated DNA transfer, bombardment, or Agrobacterium mediated transformation.

[0249]Other techniques are set forth below in the Examples below for transformation of maize plant cells and soybean plant cells.

[0250]Other other methods for transforming dicots, primarily by use of Agrobacterium tumefaciens, and obtaining transgenic plants include those published for cotton (U.S. Pat. No. 5,004,863, U.S. Pat. No. 5,159,135, U.S. Pat. No. 5,518,908); soybean (U.S. Pat. No. 5,569,834, U.S. Pat. No. 5,416,011, McCabe et. al., Bio/Technology 6:923 (1988), Christou et al., Plant Physiol. 87:671 674 (1988)); Brassica (U.S. Pat. No. 5,463,174); peanut (Cheng et al., Plant Cell Rep. 15:653 657 (1996), McKently et al., Plant Cell Rep. 14:699 703 (1995)); papaya; and pea (Grant et al., Plant Cell Rep. 15:254-258 (1995)).

[0251]Transformation of monocotyledons using electroporation, particle bombardment, and Agrobacterium have also been reported and are included as other methods, for example, transformation and plant regeneration as achieved in asparagus (Bytebier et al., Proc. Natl. Acad. Sci. U.S.A. 84:5354, (1987)); barley (Wan and Lemaux, Plant Physiol. 104:37 (1994)); corn (Rhodes et al., Science 240:204 (1988), Gordon-Kamm et al., Plant Cell 2:603 618 (1990), Fromm et al., Bio/Technology 8:833 (1990), Koziel et al., Bio/Technology 11:194 (1993), Armstrong et al., Crop Science 35:550-557 (1995)); oat (Somers et al., Bio/Technology 10:1589 (1992)); orchard grass (Horn et al., Plant Cell Rep. 7:469 (1988)); rice (Toriyama et al., Theor. Appl. Genet. 205:34 (1986); Part et al., Plant Mol. Biol. 32:1135 1148, (1996); Abedinia et al., Aust. J. Plant Physiol. 24:133 141 (1997); Zhang and Wu, Theor. Appl. Genet. 76:835 (1988); Zhang et al., Plant Cell Rep. 7:379, (1988); Battraw and Hall, Plant Sci. 86:191 202 (1992); Christou et al., Bio/Technology 9:957 (1991)); rye (De la Pena et al., Nature 325:274 (1987)); sugarcane (Bower and Birch, Plant J. 2:409 (1992)); tall fescue (Wang et al., Bio/Technology 10:691 (1992)); and wheat (Vasil et al., Bio/Technology 10:667 (1992); U.S. Pat. No. 5,631,152).

[0252]There are a variety of methods for the regeneration of plants from plant tissue. The particular method of regeneration will depend on the starting plant tissue and the particular plant species to be regenerated.

[0253]The regeneration, development, and cultivation of plants from single plant protoplast transformants or from various transformed explants is well known in the art (Weissbach and Weissbach, In: Methods for Plant Molecular Biology, (Eds.), Academic Press, Inc. San Diego, Calif., (1988)). This regeneration and growth process typically includes the steps of selection of transformed cells, culturing those individualized cells through the usual stages of embryonic development through the rooted plantlet stage. Transgenic embryos and seeds are similarly regenerated. The resulting transgenic rooted shoots are thereafter planted in an appropriate plant growth medium such as soil.

[0254]The development or regeneration of plants containing the foreign, exogenous isolated nucleic acid fragment that encodes a protein of interest is well known in the art. In an embodiment, the regenerated plants are self-pollinated to provide homozygous transgenic plants. Otherwise, pollen obtained from the regenerated plants is crossed to seed-grown plants of agronomically important lines. Conversely, pollen from plants of these important lines is used to pollinate regenerated plants. A transgenic plant of the present invention containing a desired polypeptide is cultivated using methods well known to one skilled in the art.

EXAMPLES

[0255]The present invention is further illustrated in the following Examples, in which parts and percentages are by weight and degrees are Celsius, unless otherwise stated. It should be understood that these Examples, while indicating other embodiments of the invention, are given by way of illustration only. From the above discussion and these Examples, one skilled in the art can ascertain the essential characteristics of this invention, and without departing from the spirit and scope thereof, can make various changes and modifications of the invention to adapt it to various usages and conditions. Furthermore, various modifications of the invention in addition to those shown and described herein will be apparent to those skilled in the art from the foregoing description. Such modifications are also intended to fall within the scope of the appended claims.

EXAMPLE 1

Creation of an Arabidopsis Population with Activation-Tagged Genes

[0256]An 18.49-kb T-DNA based binary construct was created, pHSbarENDs2 (SEQ ID NO:1; FIG. 1), that contains four multimerized enhancer elements derived from the Cauliflower Mosaic Virus 35S promoter (corresponding to sequences -341 to -64, as defined by Odell et al., Nature 313:810-812 (1985)). The construct also contains vector sequences (pUC9) and a poly-linker (SEQ ID NO:11) to allow plasmid rescue, transposon sequences (Ds) to remobilize the T-DNA, and the bar gene to allow for glufosinate selection of transgenic plants. In principle, only the 10.8-kb segment from the right border (RB) to left border (LB) inclusive will be transferred into the host plant genome. Since the enhancer elements are located near the RB, they can induce cis-activation of genomic loci following T-DNA integration.

[0257]Arabidopsis activation-tagged populations were created by whole plant Agrobacterium transformation. The pHSbarENDs2 construct was transformed into Agrobacterium tumefaciens strain C58, grown in lysogeny broth medium at 25° C. to OD600˜1.0. Cells were then pelleted by centrifugation and resuspended in an equal volume of 5% sucrose/0.05% Silwet L-77 (OSI Specialties, Inc). At early bolting, soil grown Arabidopsis thaliana ecotype Col-0 were top watered with the Agrobacterium suspension. A week later, the same plants were top watered again with the same Agrobacterium strain in sucrose/Silwet. The plants were then allowed to set seed as normal. The resulting T1 seed were sown on soil, and transgenic seedlings were selected by spraying with glufosinate (FINALE®; AgrEvo; Bayer Environmental Science). A total of 100,000 glufosinate resistant T1 seedlings were selected. T2 seed from each line was kept separate.

EXAMPLE 2

Screens to Identify Lines with Tolerance to Low Nitrogen

[0258]From each of 100,000 separate T1 activation-tagged lines, eleven T2 plants are sown on square plates (15 mm×15 mm) containing 0.5× N-Free Hoagland's, 0.4 mM potassium nitrate, 0.1% sucrose, 1 mM MES and 0.25% Phytagel® (Low N medium). Five lines are plated per plate, and the inclusion of 9 wild-type individuals on each plate makes for a total of 64 individuals in an 8×8 grid pattern (see FIG. 11). Plates are kept for three days in the dark at 4° C. to stratify seeds, and then placed horizontally for nine days at 22° C. light and 20° C. dark. Photoperiod is sixteen hours light and eight hours dark, with an average light intensity of ˜200 mmol/m²/s. Plates are rotated and shuffled daily within each shelf. At day twelve (nine days of growth), seedling status is evaluated by imaging the entire plate.

[0259]After masking the plate image to remove background color, two different measurements are collected for each individual: total rosette area, and the percentage of color that falls into a green color bin. Using hue, saturation and intensity data (HSI), the green color bin consists of hues 50 to 66. Total rosette area is used as a measure of plant biomass, whereas the green color bin was shown by dose-response studies to be an indicator of nitrogen assimilation (see FIG. 12).

[0260]Lines with a significant increase in total rosette area and/or green color bin, when compared to the wild-type controls, are designated as Phase 1 hits. Phase 1 hits are re-screened in duplicate under the same assay conditions (Phase 2 screen). A Phase 3 screen is also employed to further validate mutants that passed through Phases 1 and 2. In Phase 3, each line is plated separately on Low N medium, such that 32 T2 individuals are grown next to 32 wild-type individuals on one plate, providing greater statistical rigor to the analysis. If a line shows a significant difference from the controls in Phase 3, the line is then considered a validated nitrogen-deficiency tolerant line.

EXAMPLE 3

Identification of Activation-Tagged Genes

[0261]Genes flanking the T-DNA insert in nitrogen tolerant lines are identified using one, or both, of the following two standard procedures: (1) thermal asymmetric interlaced (TAIL) PCR (Liu et al., Plant J. 8:457-63 (1995)); and (2) SAIFF PCR (Siebert et al., Nucleic Acids Res. 23:1087-1088 (1995)). In lines with complex multimerized T-DNA inserts, TAIL PCR and SAIFF PCR may both prove insufficient to identify candidate genes. In these cases, other procedures, including inverse PCR, plasmid rescue and/or genomic library construction, can be employed.

[0262]A successful result is one where a single TAIL or SAIFF PCR fragment contains a T-DNA border sequence and Arabidopsis genomic sequence. Once a tag of genomic sequence flanking a T-DNA insert is obtained, candidate genes are identified by alignment to publicly available Arabidopsis genome sequence. Specifically, the annotated gene nearest the 35S enhancer elements/T-DNA RB are candidates for genes that are activated.

[0263]To verify that an identified gene is truly near a T-DNA and to rule out the possibility that the TAIL/SAIFF fragment is a chimeric cloning artifact, a diagnostic PCR on genomic DNA is done with one oligo in the T-DNA and one oligo specific for the candidate gene. Genomic DNA samples that give a PCR product are interpreted as representing a T-DNA insertion. This analysis also verifies a situation in which more than one insertion event occurs in the same line, e.g., if multiple differing genomic fragments are identified in TAIL and/or SAIFF PCR analyses.

EXAMPLE 4

Identification of Activation-Tagged LNT2 Gene

[0264]An activation tagged-line (line 111786) showing nitrogen-deficiency tolerance was further analyzed. DNA from the line was extracted, and genes flanking the T-DNA insert in the mutant line were identified using ligation-mediated PCR (Siebert et al., Nucleic Acids Res. 23:1087-1088 (1995)). A single amplified fragment was identified that contained a T-DNA border sequence and Arabidopsis genomic sequence. Once a tag of genomic sequence flanking a T-DNA insert was obtained, a candidate gene was identified by alignment to the completed Arabidopsis genome. Specifically, the annotated gene nearest the 35S enhancer elements/T-DNA RB was the candidate for the gene activated in the line. In the case of line 111786 the gene nearest the 35S enhancers was At5g50930 (SEQ ID NO:27) encoding the Arabidopsis thaliana "unknown protein" referred to herein as LNT2 (SEQ ID NO:28; NCBI GI 15241317).

EXAMPLE 5

Validation of Candidate Arabidopsis Gene (At5g50930) via Transformation into Arabidopsis

[0265]Candidate genes can be transformed into Arabidopsis and overexpressed under the 35S promoter. If the same or similar phenotype is observed in the transgenic line as in the parent activation-tagged line, then the candidate gene is considered to be a validated "lead gene" in Arabidopsis.

[0266]The Arabidopsis At5g50930 gene (SEQ ID NO:27) was tested for its ability to confer nitrogen-deficiency tolerance in the following manner.

[0267]The At5g50930 cDNA was amplified by RT-PCR with the following primers:

[0268]1. At5g50930-5' attB forward primer (SEQ ID NO:35)

[0269]The forward primer contains the attB1 sequence [0270](ACAAGTTTGTACAAAAAAGCAGGCT; SEQ ID NO:12) and a consensus Kozak sequence (CAACA) upstream of the first 21 nucleotides of the protein-coding region, beginning with the ATG start codon, of said cDNA.

[0271]2. At5g50930-3' attB reverse primer (SEQ ID NO:36)

[0272]The reverse primer contains the attB2 sequence [0273](ACCACTTTGTACAAGAAAGCTGGGT; SEQ ID NO:13) adjacent to the reverse complement of the last 21 nucleotides of the protein-coding region, beginning with the reverse complement of the stop codon, of said cDNA.

[0274]The RT-PCR reaction yielded two products, referred to herein as Int2-2 and Int2-3 (SEQ ID NOs:29 and 31, respectively). The products were identified as splice variants of the At5g50930 gene.

[0275]Using the INVITROGEN® GATEWAY® CLONASE® technology, a BP Recombination Reaction was performed for each RT-PCR product with pDONR®Zeo (SEQ ID NO:2; FIG. 2). This process removes the bacteria lethal ccdB gene, as well as the chloramphenicol resistance gene (CAM), from pDONR®Zeo and directionally clones the PCR product with flanking attB1 and attB2 sites, creating an entry clone. One positively identified entry clone for each splice variant sequence was used for a subsequent LR Recombination Reaction with a destination vector, as follows.

[0276]A 16.8-kb T-DNA based binary vector (destination vector), called pBC-yellow (SEQ ID NO:4; FIG. 4), was constructed with a 1.3-kb 35S promoter immediately upstream of the INVITROGEN® GATEWAY C1 conversion insert, which contains the bacterial lethal ccdB gene as well as the chloramphenicol resistance gene (CAM) flanked by attR1 and attR2 sequences. The vector also contains the RD29a promoter driving expression of the gene for ZS-Yellow (INVITROGEN®), which confers yellow fluorescence to transformed seed. Using the INVITROGEN® GATEWAY® technology, an LR Recombination Reaction was performed with the entry clone containing Int2-2 and the pBC-yellow vector. This amplification allowed for rapid and directional cloning of Int2-2 (SEQ ID NO: 29) behind the 35S promoter in pBC-yellow. An LR Recombination Reaction was also performed with the entry clone containing Int2-3 and the pBC-yellow vector.

[0277]Applicants then introduced the 35S promoter:At5g50930 expression constructs into wild-type Arabidopsis ecotype Col-0, using the same Agrobacterium-mediated transformation procedure described in Example 1. Transgenic T1 seeds were selected by yellow fluorescence, and 32 of these T1 seeds were plated next to 32 wild-type Arabidopsis ecotype Col-0 seeds on low nitrogen medium. All subsequent growth and imaging conditions were performed as described in Example 1. It was found that the original phenotype from activation tagging, tolerance to nitrogen limiting conditions, could be recapitulated in wild-type Arabidopsis plants that were transformed with a construct where an At5g50930 gene was directly expressed by the 35S promoter.

EXAMPLE 6

Composition of cDNA Libraries, Isolation and Sequencing of cDNA Clones

[0278]cDNA libraries may be prepared by any one of many methods available. For example, the cDNAs may be introduced into plasmid vectors by first preparing the cDNA libraries in UNI-ZAP® XR vectors according to the manufacturer's protocol (Stratagene Cloning Systems, La Jolla, Calif.). The UNI-ZAP® XR libraries are converted into plasmid libraries according to the protocol provided by Stratagene. Upon conversion, cDNA inserts will be contained in the plasmid vector pBLUESCRIPT®. In addition, the cDNAs may be introduced directly into precut BLUESCRIPT® II SK(+) vectors (Stratagene) using T4 DNA ligase (New England Biolabs), followed by transfection into DH10B cells according to the manufacturer's protocol (GIBCO BRL Products). Once the cDNA inserts are in plasmid vectors, plasmid DNAs are prepared from randomly picked bacterial colonies containing recombinant pBLUESCRIPT® plasmids, or the insert cDNA sequences are amplified via polymerase chain reaction using primers specific for vector sequences flanking the inserted cDNA sequences. Amplified insert DNAs or plasmid DNAs are sequenced in dye-primer sequencing reactions to generate partial cDNA sequences (expressed sequence tags or "ESTs"; see Adams et al., Science 252:1651-1656 (1991)). The resulting ESTs are analyzed using a Perkin Elmer Model 377 fluorescent sequencer.

[0279]Full-insert sequence (FIS) data is generated utilizing a modified transposition protocol. Clones identified for FIS are recovered from archived glycerol stocks as single colonies, and plasmid DNAs are isolated via alkaline lysis. Isolated DNA templates are reacted with vector primed M13 forward and reverse oligonucleotides in a PCR-based sequencing reaction and loaded onto automated sequencers. Confirmation of clone identification is performed by sequence alignment to the original EST sequence from which the FIS request is made.

[0280]Confirmed templates are transposed via the Primer Island transposition kit (PE Applied Biosystems, Foster City, Calif.) which is based upon the Saccharomyces cerevisiae Ty1 transposable element (Devine and Boeke, Nucleic Acids Res. 22:3765-3772 (1994)). The in vitro transposition system places unique binding sites randomly throughout a population of large DNA molecules. The transposed DNA is then used to transform DH10B electro-competent cells (GIBCO BRL/Life Technologies, Rockville, Md.) via electroporation. The transposable element contains an additional selectable marker (named DHFR; Fling and Richards, Nucleic Acids Res. 11:5147-5158 (1983)), allowing for dual selection on agar plates of only those subclones containing the integrated transposon. Multiple subclones are randomly selected from each transposition reaction, plasmid DNAs are prepared via alkaline lysis, and templates are sequenced (ABI PRISM dye-terminator ReadyReaction mix) outward from the transposition event site, utilizing unique primers specific to the binding sites within the transposon.

[0281]Sequence data is collected (ABI PRISM® Collections) and assembled using Phred and Phrap (Ewing et al., Genome Res. 8:175-185 (1998); Ewing et al., Genome Res. 8:186-194 (1998)). Phred is a public domain software program which re-reads the ABI sequence data, re-calls the bases, assigns quality values, and writes the base calls and quality values into editable output files. The Phrap sequence assembly program uses these quality values to increase the accuracy of the assembled sequence contigs. Assemblies are viewed by the Consed sequence editor (Gordon et al., Genome Res. 8:195-202 (1998)).

[0282]In some of the clones the cDNA fragment corresponds to a portion of the 3'-terminus of the gene and does not cover the entire open reading frame. In order to obtain the upstream information one of two different protocols is used. The first of these methods results in the production of a fragment of DNA containing a portion of the desired gene sequence while the second method results in the production of a fragment containing the entire open reading frame. Both of these methods use two rounds of PCR amplification to obtain fragments from one or more libraries. The libraries sometimes are chosen based on previous knowledge that the specific gene should be found in a certain tissue and sometimes are randomly-chosen. Reactions to obtain the same gene may be performed on several libraries in parallel or on a pool of libraries. Library pools are normally prepared using from 3 to 5 different libraries and normalized to a uniform dilution. In the first round of amplification both methods use a vector-specific (forward) primer corresponding to a portion of the vector located at the 5'-terminus of the clone coupled with a gene-specific (reverse) primer. The first method uses a sequence that is complementary to a portion of the already known gene sequence while the second method uses a gene-specific primer complementary to a portion of the 3'-untranslated region (also referred to as UTR). In the second round of amplification a nested set of primers is used for both methods. The resulting DNA fragment is ligated into a pBLUESCRIPT® vector using a commercial kit and following the manufacturer's protocol. This kit is selected from many available from several vendors including INVITROGEN® (Carlsbad, Calif.), Promega Biotech (Madison, Wis.), and GIBCO-BRL (Gaithersburg, Md.). The plasmid DNA is isolated by alkaline lysis method and submitted for sequencing and assembly using Phred/Phrap, as above.

EXAMPLE 7

Identification of cDNA Clones

[0283]cDNA clones encoding LNT2-like polypeptides are identified by conducting BLAST (Basic Local Alignment Search Tool; Altschul et al., J. Mol. Biol. 215:403-410 (1993); see also the explanation of the BLAST algorithm on the world wide web site for the National Center for Biotechnology Information at the National Library of Medicine of the National Institutes of Health) searches for similarity to amino acid sequences contained in the BLAST "nr" database (comprising all non-redundant GenBank CDS translations, sequences derived from the 3-dimensional structure Brookhaven Protein Data Bank, the last major release of the SWISS-PROT protein sequence database, EMBL, and DDBJ databases). The DNA sequences from clones can be translated in all reading frames and compared for similarity to all publicly available protein sequences contained in the "nr" database using the BLASTX algorithm (Gish and States, Nat. Genet. 3:266-272 (1993)) provided by the NCBI. The polypeptides encoded by the cDNA sequences can be analyzed for similarity to all publicly available amino acid sequences contained in the "nr" database using the BLASTP algorithm provided by the National Center for Biotechnology Information (NCBI). For convenience, the P-value (probability) or the E-value (expectation) of observing a match of a cDNA-encoded sequence to a sequence contained in the searched databases merely by chance as calculated by BLAST are reported herein as "pLog" values, which represent the negative of the logarithm of the reported P-value or E-value. Accordingly, the greater the pLog value, the greater the likelihood that the cDNA-encoded sequence and the BLAST "hit" represent homologous proteins.

[0284]EST sequences can be compared to the GenBank database as described above. ESTs that contain sequences more 5- or 3-prime can be found by using the BLASTN algorithm (Altschul et al., Nucleic Acids Res. 25:3389-3402 (1997)) against the Dupont proprietary database comparing nucleotide sequences that share common or overlapping regions of sequence homology. Where common or overlapping sequences exist between two or more nucleic acid fragments, the sequences can be assembled into a single contiguous nucleotide sequence, thus extending the original fragment in either the 5 or 3 prime direction. Once the most 5-prime EST is identified, its complete sequence can be determined by Full Insert Sequencing.

[0285]Homologous genes belonging to different species can be found by comparing the amino acid sequence of a known gene (from either a proprietary source or a public database) against an EST database using the tBLASTn algorithm. The tBLASTn algorithm searches an amino acid query against a nucleotide database that is translated in all 6 reading frames. This search allows for differences in nucleotide codon usage between different species, and for codon degeneracy.

EXAMPLE 8

Characterization of cDNA Clones Encoding LNT2-Like Polypeptides

[0286]cDNA libraries representing mRNAs from various tissues of Zea mays (maize), Oryza sativa (rice), and Glycine max (soybean) were prepared. The characteristics of the libraries are described below.

TABLE-US-00002 TABLE 2 cDNA Libraries from Maize, Rice, and Soybean Library Description (tissue) Clone cpg1c Corn (Zea mays L.) pooled BMS treated cpg1c.pk013.o6:fis with chemicals related to RNA, DNA synthesis rca1n Rice (Oryza sativa L., Nipponbare) callus rca1n.pk001.f6:fis normalized sfl1n1 Soybean (Glycine max L., Wye) immature sfl1n1.pk002.j1 flower normalized. sds1f Soybean (Glycine max, Wye) 11 day old sds1f.pk001.k5 seedling full length library using trehalose

[0287]As shown in Table 3, FIGS. 14A-14B, and FIG. 15, cDNAs identified in Table 2 encode polypeptides similar to the LNT2 polypeptide from Arabidopsis thaliana (At5g50930; NCBI General Identifier No. 15241317; SEQ ID NO:28) and to the LNT2-like polypeptides from Oryza sativa (GI No. 38347162 corresponding to SEQ ID NO: 33) and from Vitis vinifera (GI No.147791927 corresponding to SEQ ID NO: 34).

[0288]Shown in Table 3 (non-patent literature) and Table 4 (patent literature) are the BLASTP results for individual ESTs ("EST"), the sequences of the entire cDNA inserts comprising the indicated cDNA clones ("FIS"), the sequences of contigs assembled from two or more EST, FIS or PCR sequences ("Contig"), or sequences encoding an entire or functional protein derived from an FIS or a contig ("CGS"). Also shown in Tables 3 and 4 are the percent sequence identity values for each pair of amino acid sequences using the Clustal V method of alignment with default parameters (described below).

TABLE-US-00003 TABLE 3 BLASTP Results for Polypeptides Homologous to LNT2 Polypeptides BLAST Sequence % pLog (SEQ ID NO: #) Status NCBI GI No. identity Score cpg1c.pk013.o6:fis CGS 38347162 77.4 17.8 (SEQ ID NO: 18) (SEQ ID: 33) rca1n.pk001.f6:fis CGS 38347162 100.0 15.8 (SEQ ID NO: 20) (SEQ ID: 33) PSO415619 contig 147791927 58.7 13.0 (SEQ ID NO: 24) (SEQ ID: 34) PSO415620 contig 147791927 57.1 11.8 (SEQ ID NO: 26) (SEQ ID: 34)

TABLE-US-00004 TABLE 4 BLASTP Results for Polypeptides Homologous to LNT2 Polypeptides BLAST Sequence % pLog (SEQ ID NO: #) Status Reference Identity score cpg1c.pk013.o6:fis CGS SEQ ID NO: 224380 92.3 21.0 (SEQ ID NO: 18) In US2004214272-A1 rca1n.pk001.f6:fis CGS SEQ ID NO: 188525 100.0 15.7 (SEQ ID NO: 20) In US2004123343-A1 PSO415619 contig SEQ ID NO: 183694 92.1 21.4 (SEQ ID NO: 24) In US2004031072-A1 PSO415620 contig SEQ ID NO: 183694 84.9 19.8 (SEQ ID NO: 26) In US2004031072-A1

[0289]FIGS. 14A and 14B present an alignment of the amino acid sequences set forth in SEQ ID NOs:18, 20, 24, 26, and the amino acid sequences of the LNT2 (At5g50930; NCBI General Identifier No. 15241317), LNT2-2, and LNT2-3 polypeptides from Arabidopsis thaliana (SEQ ID NOs: 28, 30, and 32, respectively). Also included in the alignment are the LNT2-like polypeptides from Oryza sativa (GI No. 38347162 corresponding to SEQ ID NO: 33) and from Vitis vinifera (GI No. 147791927 corresponding to SEQ ID NO: 34). FIG. 15 is a chart of the percent sequence identity and the divergence values for each pair of amino acids sequences presented in FIGS. 14A and 14B.

[0290]Sequence alignments and percent identity calculations were performed using the MEGALIGN® program of the LASERGENE® bioinformatics computing suite (DNASTAR® Inc., Madison, Wis.). Multiple alignment of the sequences was performed using the Clustal method of alignment (Higgins and Sharp (1989) CABIOS. 5:151-153) with the default parameters (GAP PENALTY=10, GAP LENGTH PENALTY=10). Default parameters for pairwise alignments using the Clustal method were KTUPLE 1, GAP PENALTY=3, WINDOW=5 and DIAGONALS SAVED=5.

EXAMPLE 9

Preparation of a Plant Expression Vector Containing a Homolog to the Arabidopsis Lead Gene

[0291]Sequences homologous to the lead LNT2 genes can be identified using sequence comparison algorithms such as BLAST (Basic Local Alignment Search Tool; Altschul et al., J. Mol. Biol. 215:403-410 (1993); see also the explanation of the BLAST algorithm on the world wide web site for the National Center for Biotechnology Information at the National Library of Medicine of the National Institutes of Health). Homologous LNT2-like sequences, such as the ones described in Example 8, can be PCR-amplified by either of the following methods.

[0292]Method 1 (RNA-based): If the 5' and 3' sequence information for the protein-coding region of an LNT2 homolog is available, gene-specific primers can be designed as outlined in Example 5. RT-PCR can be used with plant RNA to obtain a nucleic acid fragment containing the protein-coding region flanked by attB1 (SEQ ID NO:12) and attB2 (SEQ ID NO:13) sequences. The primer may contain a consensus Kozak sequence (CAACA) upstream of the start codon.

[0293]Method 2 (DNA-based): Alternatively, if a cDNA clone is available for the LNT2 homolog, the entire cDNA insert (containing 5' and 3' non-coding regions) can be PCR amplified. Forward and reverse primers can be designed that contain either the attB1 sequence and vector-specific sequence that precedes the cDNA insert or the attB2 sequence and vector-specific sequence that follows the cDNA insert, respectively. For a cDNA insert cloned into the vector pBLUESCRIPT SK+, the forward primer VC062 (SEQ ID NO:15) and the reverse primer VC063 (SEQ ID NO:16) can be used.

[0294]Methods 1 and 2 can be modified according to procedures known by one skilled in the art. For example, the primers of Method 1 may contain restriction sites instead of attB1 and attB2 sites, for subsequent cloning of the PCR product into a vector containing attB1 and attB2 sites. Additionally, Method 2 can involve amplification from a cDNA clone, a lambda clone, a BAC clone or genomic DNA.

[0295]A PCR product obtained by either method above can be combined with the GATEWAY® donor vector, such as pDONR® Zeo (SEQ ID NO:2; FIG. 2) or pDONR®221 (SEQ ID NO:3; FIG. 3), using a BP Recombination Reaction. This process removes the bacteria lethal ccdB gene, as well as the chloramphenicol resistance gene (CAM) from pDONR®Zeo or pDONR®221 and directionally clones the PCR product with flanking attB1 and attB2 sites to create an entry clone. Using the INVITROGEN® GATEWAY® CLONASE® technology, the sequence encoding the homologous LNT2 polypeptide from the entry clone can then be transferred to a suitable destination vector, such as pBC-Yellow (SEQ ID NO:4; FIG. 4), PHP27840 (SEQ ID NO:5; FIG. 5), or PHP23236 (SEQ ID NO:6; FIG. 6), to obtain a plant expression vector for use with Arabidopsis, soybean, and corn, respectively.

[0296]The attP1 and attP2 sites of donor vectors pDONR®/Zeo or pDONR®221 are shown in FIGS. 2 and 3, respectively. The attR1 and attR2 sites of destination vectors pBC-Yellow, PHP27840, and PHP23236 are shown in FIGS. 4, 5 and 6, respectively.

[0297]Alternatively a MultiSite GATEWAY® LR recombination reaction between multiple entry clones and a suitable destination vector can be performed to create an expression vector.

EXAMPLE 10

Preparation of Soybean Expression Vectors and Transformation of Soybean with Validated Arabidopsis Lead Genes

[0298]Soybean plants can be transformed to overexpress each validated Arabidopsis gene or the corresponding homologs from various species in order to examine the resulting phenotype.

[0299]The same GATEWAY® entry clone described in Example 5 can be used to directionally clone each gene into the PHP27840 vector (SEQ ID NO:5; FIG. 5) such that expression of the gene is under control of the SCP1 promoter.

[0300]Soybean embryos may then be transformed with the expression vector comprising sequences encoding the instant polypeptides.

[0301]To induce somatic embryos, cotyledons, 3-5 mm in length dissected from surface sterilized, immature seeds of the soybean cultivar A2872, can be cultured in the light or dark at 26° C. on an appropriate agar medium for six to ten weeks. Somatic embryos, which produce secondary embryos, are then excised and placed into a suitable liquid medium. After repeated selection for clusters of somatic embryos which multiply as early, globular staged embryos, the suspensions are maintained as described below.

[0302]Soybean embryogenic suspension cultures can be maintained in 35 mL liquid media on a rotary shaker, 150 rpm, at 26° C. with florescent lights on a 16:8 hour day/night schedule. Cultures are subcultured every two weeks by inoculating approximately 35 mg of tissue into 35 mL of liquid medium.

[0303]Soybean embryogenic suspension cultures may then be transformed by the method of particle gun bombardment (Klein et al., Nature (London) 327:70-73 (1987), U.S. Pat. No. 4,945,050). A DUPONT BIOLISTIC® PDS1000/HE instrument (helium retrofit) can be used for these transformations.

[0304]A selectable marker gene which can be used to facilitate soybean transformation is a chimeric gene composed of the 35S promoter from cauliflower mosaic virus (Odell et al., Nature 313:810-812 (1985)), the hygromycin phosphotransferase gene from plasmid pJR225 (from E. coli; Gritz et al., Gene 25:179-188 (1983)) and the 3' region of the nopaline synthase gene from the T-DNA of the Ti plasmid of Agrobacterium tumefaciens. Another selectable marker gene which can be used to facilitate soybean transformation is an herbicide-resistant acetolactate synthase (ALS) gene from soybean or Arabidopsis. ALS is the first common enzyme in the biosynthesis of the branched-chain amino acids valine, leucine and isoleucine. Mutations in ALS have been identified that convey resistance to some or all of three classes of inhibitors of ALS (U.S. Pat. No. 5,013,659; the entire contents of which are herein incorporated by reference). Expression of the herbicide-resistant ALS gene can be under the control of a SAM synthetase promoter (U.S. Patent Application No. US-2003-0226166-A1; the entire contents of which are herein incorporated by reference).

[0305]To 50 μL of a 60 mg/mL 1 μm gold particle suspension is added (in order): 5 μL DNA (1 μg/μL), 20 μL spermidine (0.1 M), and 50 μL CaCl₂ (2.5 M). The particle preparation is then agitated for three minutes, spun in a microfuge for 10 seconds and the supernatant removed. The DNA-coated particles are then washed once in 400 μL 70% ethanol and resuspended in 40 μL of anhydrous ethanol. The DNA/particle suspension can be sonicated three times for one second each. Five μL of the DNA-coated gold particles are then loaded on each macro carrier disk.

[0306]Approximately 300-400 mg of a two-week-old suspension culture is placed in an empty 60×15 mm petri dish and the residual liquid removed from the tissue with a pipette. For each transformation experiment, approximately 5-10 plates of tissue are normally bombarded. Membrane rupture pressure is set at 1100 psi and the chamber is evacuated to a vacuum of 28 inches mercury. The tissue is placed approximately 3.5 inches away from the retaining screen and bombarded three times. Following bombardment, the tissue can be divided in half and placed back into liquid and cultured as described above.

[0307]Five to seven days post bombardment, the liquid media may be exchanged with fresh media, and eleven to twelve days post bombardment, with fresh media containing 50 mg/mL hygromycin. This selective media can be refreshed weekly. Seven to eight weeks post bombardment, green, transformed tissue may be observed growing from untransformed, necrotic embryogenic clusters. Isolated green tissue is removed and inoculated into individual flasks to generate new, clonally propagated, transformed embryogenic suspension cultures. Each new line may be treated as an independent transformation event. These suspensions can then be subcultured and maintained as clusters of immature embryos or regenerated into whole plants by maturation and germination of individual somatic embryos.

[0308]Soybean plants transformed with validated genes can be assayed to study agronomic characteristics relative to control or reference plants. For example, yield enhancement and/or stability under low and high nitrogen conditions (e.g., nitrogen limiting conditions and nitrogen-sufficient conditions) can be assayed.

EXAMPLE 11

Transformation of Maize with Validated Arabidopsis Lead Genes using Particle Bombardment

[0309]Maize plants can be transformed to overexpress a validated Arabidopsis lead gene or the corresponding homologs from various species in order to examine the resulting phenotype.

[0310]The same GATEWAY® entry clones described in Example 5 can be used to directionally clone each respective gene into a maize transformation vector. Expression of the gene in the maize transformation vector can be under control of a constitutive promoter such as the maize ubiquitin promoter (Christensen et al., Plant Mol. Biol. 12:619-632 (1989) and Christensen et al., Plant Mol. Biol. 18:675-689 (1992))

[0311]The recombinant DNA construct described above can then be introduced into maize cells by the following procedure. Immature maize embryos can be dissected from developing caryopses derived from crosses of the inbred maize lines H99 and LH132. The embryos are isolated ten to eleven days after pollination when they are 1.0 to 1.5 mm long. The embryos are then placed with the axis-side facing down and in contact with agarose-solidified N6 medium (Chu et al., Sci. Sin. Peking 18:659-668 (1975)). The embryos are kept in the dark at 27° C. Friable embryogenic callus consisting of undifferentiated masses of cells with somatic proembryoids and embryoids borne on suspensor structures proliferates from the scutellum of these immature embryos. The embryogenic callus isolated from the primary explant can be cultured on N6 medium and sub-cultured on this medium every two to three weeks.

[0312]The plasmid, p35S/Ac (obtained from Dr. Peter Eckes, Hoechst Ag, Frankfurt, Germany) may be used in transformation experiments in order to provide for a selectable marker. This plasmid contains the pat gene (see European Patent Publication 0 242 236) which encodes phosphinothricin acetyl transferase (PAT). The enzyme PAT confers resistance to herbicidal glutamine synthetase inhibitors such as phosphinothricin. The pat gene in p35S/Ac is under the control of the 35S promoter from cauliflower mosaic virus (Odell et al., Nature 313:810-812 (1985)) and the 3' region of the nopaline synthase gene from the T-DNA of the Ti plasmid of Agrobacterium tumefaciens.

[0313]The particle bombardment method (Klein et al., Nature 327:70-73 (1987)) may be used to transfer genes to the callus culture cells. According to this method, gold particles (1 μm in diameter) are coated with DNA using the following technique. Ten μg of plasmid DNAs are added to 50 μL of a suspension of gold particles (60 mg per mL). Calcium chloride (50 μL of a 2.5 M solution) and spermidine free base (20 μL of a 1.0 M solution) are added to the particles. The suspension is vortexed during the addition of these solutions. After ten minutes, the tubes are briefly centrifuged (5 sec at 15,000 rpm) and the supernatant removed. The particles are resuspended in 200 μL of absolute ethanol, centrifuged again and the supernatant removed. The ethanol rinse is performed again and the particles resuspended in a final volume of 30 μL of ethanol. An aliquot (5 μL) of the DNA-coated gold particles can be placed in the center of a KAPTON® flying disc (Bio-Rad Labs). The particles are then accelerated into the maize tissue with a BIOLISTIC® PDS-1000/He (Bio-Rad Instruments, Hercules Calif.), using a helium pressure of 1000 psi, a gap distance of 0.5 cm and a flying distance of 1.0 cm.

[0314]For bombardment, the embryogenic tissue is placed on filter paper over agarose-solidified N6 medium. The tissue is arranged as a thin lawn and covers a circular area of about 5 cm in diameter. The petri dish containing the tissue can be placed in the chamber of the PDS-1000/He approximately 8 cm from the stopping screen. The air in the chamber is then evacuated to a vacuum of 28 inches of Hg. The macrocarrier is accelerated with a helium shock wave using a rupture membrane that bursts when the He pressure in the shock tube reaches 1000 psi.

[0315]Seven days after bombardment the tissue can be transferred to N6 medium that contains bialaphos (5 mg per liter) and lacks casein or proline. The tissue continues to grow slowly on this medium. After an additional two weeks the tissue can be transferred to fresh N6 medium containing bialaphos. After six weeks, areas of about 1 cm in diameter of actively growing callus can be identified on some of the plates containing the bialaphos-supplemented medium. These calli may continue to grow when sub-cultured on the selective medium.

[0316]Plants can be regenerated from the transgenic callus by first transferring clusters of tissue to N6 medium supplemented with 0.2 mg per liter of 2,4-D. After two weeks the tissue can be transferred to regeneration medium (Fromm et al., Bio/Technology 8:833-839 (1990)).

[0317]Transgenic T0 plants can be regenerated and their phenotype determined following HTP procedures. T1 seed can be collected.

[0318]T1 plants can be grown under nitrogen limiting conditions, for example 1 mM nitrate, and analyzed for phenotypic changes. The following parameters can be quantified using image analysis: plant area, volume, growth rate and color analysis can be collected and quantified. Overexpression constructs that result in an alteration, compared to suitable control plants, in greenness (green color bin), yield, growth rate, biomass, fresh or dry weight at maturation, fruit or seed yield, total plant nitrogen content, fruit or seed nitrogen content, nitrogen content in vegetative tissue, free amino acid content in the whole plant, free amino acid content in vegetative tissue, free amino acid content in the fruit or seed, protein content in the fruit or seed, or protein content in a vegetative tissue can be considered evidence that the Arabidopsis lead gene functions in maize to enhance tolerance to nitrogen deprivation (increased nitrogen tolerance). Furthermore, a recombinant DNA construct containing a validated Arabidopsis gene can be introduced into a maize inbred line either by direct transformation or introgression from a separately transformed line.

EXAMPLE 12

Electroporation of Agrobacterium tumefaciens LBA4404 (General Description)

[0319]Electroporation competent cells (40 μL), such as Agrobacterium tumefaciens LBA4404 (containing PHP10523), are thawed on ice (20-30 min). PHP10523 contains VIR genes for T-DNA transfer, an Agrobacterium low copy number plasmid origin of replication, a tetracycline resistance gene, and a Cos site for in vivo DNA bimolecular recombination. Meanwhile the electroporation cuvette is chilled on ice. The electroporator settings are adjusted to 2.1 kV. A DNA aliquot (0.5 μL parental DNA at a concentration of 0.2 μg -1.0 μg in low salt buffer or twice distilled H₂O) is mixed with the thawed Agrobacterium tumefaciens LBA4404 cells while still on ice. The mixture is transferred to the bottom of electroporation cuvette and kept at rest on ice for 1-2 min. The cells are electroporated (Eppendorf electroporator 2510) by pushing the "pulse" button twice (ideally achieving a 4.0 millisecond pulse). Subsequently, 0.5 mL of room temperature 2×YT medium (or SOC medium) are added to the cuvette and transferred to a 15 mL snap-cap tube (e.g., FALCON® tube). The cells are incubated at 28-30° C., 200-250 rpm for 3 h.

[0320]Aliquots of 250 μL are spread onto plates containing YM medium and 50 μg/mL spectinomycin and incubated three days at 28-30° C. To increase the number of transformants one of two optional steps can be performed:

[0321]Option 1: Overlay plates with 30 μL of 15 mg/mL rifampicin. LBA4404 has a chromosomal resistance gene for rifampicin. This additional selection eliminates some contaminating colonies observed when using poorer preparations of LBA4404 competent cells.

[0322]Option 2: Perform two replicates of the electroporation to compensate for poorer electrocompetent cells.

Identification of Transformants:

[0323]Four independent colonies are picked and streaked on plates containing AB minimal medium and 50 μg/mL spectinomycin for isolation of single colonies. The plates are incubated at 28° C. for two to three days. A single colony for each putative cointegrate is picked and inoculated with 4 mL of 10 g/L bactopeptone, 10 g/L yeast extract, 5 g/L sodium chloride, and 50 mg/L spectinomycin. The mixture is incubated for 24 h at 28° C. with shaking. Plasmid DNA from 4 mL of culture is isolated using QIAGEN Miniprep and an optional Buffer PB wash. The DNA is eluted in 30 μL. Aliquots of 2 μL are used to electroporate 20 μL of DH10b+20 μL of twice distilled H₂O as per above. Optionally a 15 μL aliquot can be used to transform 75-100 μL of INVITROGEN® Library Efficiency DH5α. The cells are spread on plates containing LB medium and 50 μg/mL spectinomycin and incubated at 37° C. overnight.

[0324]Three to four independent colonies are picked for each putative cointegrate and inoculated 4 mL of 2×YT medium (10 g/L bactopeptone, 10 g/L yeast extract, 5 g/L sodium chloride) with 50 μg/mL spectinomycin. The cells are incubated at 37° C. overnight with shaking. Next, the plasmid DNA is isolated from 4 mL of culture using QIAprep® Miniprep with optional Buffer PB wash (elute in 50 μL). 8 μL are used for digestion with SaII (using parental DNA and PHP10523 as controls). Three more digestions using restriction enzymes BamHI, EcoRI, and HindIII are performed for 4 plasmids that represent 2 putative cointegrates with correct SaII digestion pattern (using parental DNA and PHP10523 as controls). Electronic gels are recommended for comparison.

[0325]Alternatively, for high throughput applications, such as that described for Gaspe Flint Derived Maize Lines (Example 16), instead of evaluating the resulting cointegrate vectors by restriction analysis, three colonies can be simultaneously used for the infection step as described in Example 13 (transformation via Agrobacterium).

EXAMPLE 13

Transformation of Maize using Agrobacterium

[0326]Maize plants can be transformed to overexpress a validated Arabidopsis lead gene or the corresponding homologs from various species in order to examine the resulting phenotype.

[0327]Agrobacterium-mediated transformation of maize is performed essentially as described by Zhao et al., in Meth. Mol. Biol. 318:315-323 (2006) (see also Zhao et al., Mol. Breed. 8:323-333 (2001) and U.S. Pat. No. 5,981,840 issued Nov. 9, 1999, incorporated herein by reference). The transformation process involves bacterium inoculation, co-cultivation, resting, selection, and plant regeneration.

1. Immature Embryo Preparation:

[0328]Immature maize embryos are dissected from caryopses and placed in a 2 mL microtube containing 2 mL PHI-A medium.

2. Agrobacterium Infection and Co-Cultivation of Immature Embryos:

2.1 Infection Step:

[0329]PHI-A medium of (1) is removed with 1 mL micropipettor, and 1 mL of Agrobacterium suspension is added. The tube is gently inverted to mix. The mixture is incubated for 5 min at room temperature.

2.2 Co-Culture Step:

[0330]The Agrobacterium suspension is removed from the infection step with a 1 mL micropipettor. Using a sterile spatula the embryos are scraped from the tube and transferred to a plate of PHI-B medium in a 100×15 mm Petri dish. The embryos are oriented with the embryonic axis down on the surface of the medium. Plates with the embryos are cultured at 20° C., in darkness, for three days. L-Cysteine can be used in the co-cultivation phase. With the standard binary vector, the co-cultivation medium supplied with 100-400 mg/L L-cysteine is critical for recovering stable transgenic events.

3. Selection of Putative Transgenic Events:

[0331]To each plate of PHI-D medium in a 100×15 mm Petri dish, 10 embryos are transferred, maintaining orientation, and the dishes are sealed with parafilm. The plates are incubated in darkness at 28° C. Actively growing putative events, evinced as pale yellow embryonic tissue, are expected to be visible in six to eight weeks. Embryos that produce no events may be brown and necrotic, and little friable tissue growth is evident. Putative transgenic embryonic tissue is subcultured to fresh PHI-D plates at two-three week intervals, depending on growth rate. The events are recorded.

4. Regeneration of T0 Plants:

[0332]Embryonic tissue propagated on PHI-D medium is subcultured to PHI-E medium (somatic embryo maturation medium), in 100×25 mm Petri dishes and incubated at 28° C., in darkness, until somatic embryos mature, for about ten to eighteen days. Individual, matured somatic embryos with well-defined scutellum and coleoptile are transferred to PHI-F embryo germination medium and incubated at 28° C. in the light (about 80 μE from cool white or equivalent fluorescent lamps). In seven to ten days, regenerated plants, about 10 cm tall, are potted in horticultural mix and hardened-off using standard horticultural methods.

Media for Plant Transformation:

[0333]1. PHI-A: 4 g/L CHU basal salts, 1.0 mL/L 100× Eriksson's vitamin mix, 0.5 mg/L thiamin HCl, 1.5 mg/L 2,4-D, 0.69 g/L L-proline, 68.5 g/L sucrose, 36 g/L glucose, pH 5.2. Add 100 μM acetosyringone (filter-sterilized). [0334]2. PHI-B: PHI-A without glucose, increase 2,4-D to 2 mg/L, reduce sucrose to 30 g/L and supplemented with 0.85 mg/L silver nitrate (filter-sterilized), 3.0 g/L GELRITE®, 100 μM acetosyringone (filter-sterilized), pH 5.8. [0335]3. PHI-C: PHI-B without GELRITE® and acetosyringonee, reduce 2,4-D to 1.5 mg/L and supplemented with 8.0 g/L agar, 0.5 g/L 2-[N-morpholino]ethane-sulfonic acid (MES) buffer, 100 mg/L carbenicillin (filter-sterilized). [0336]4. PHI-D: PHI-C supplemented with 3 mg/L bialaphos (filter-sterilized). [0337]5. PHI-E: 4.3 g/L of Murashige and Skoog (MS) salts, (GIBCO, BRL 11117-074), 0.5 mg/L nicotinic acid, 0.1 mg/L thiamine HCl, 0.5 mg/L pyridoxine HCl, 2.0 mg/L glycine, 0.1 g/L myo-inositol, 0.5 mg/L zeatin (Sigma, Cat. No. Z-0164), 1 mg/L indole acetic acid (IAA), 26.4 μg/L abscisic acid (ABA), 60 g/L sucrose, 3 mg/L bialaphos (filter-sterilized), 100 mg/L carbenicillin (filter-sterilized), 8 g/L agar, pH 5.6. [0338]6. PHI-F: PHI-E without zeatin, IAA, ABA; reduce sucrose to 40 g/L; replacing agar with 1.5 g/L GELRITE®; pH 5.6.

[0339]Plants can be regenerated from the transgenic callus by first transferring clusters of tissue to N6 medium supplemented with 0.2 mg per liter of 2,4-D. After two weeks the tissue can be transferred to regeneration medium (Fromm et al., Bio/Technology 8:833-839 (1990)).

[0340]Transgenic T0 plants can be regenerated and their phenotype determined. T1 seed can be collected.

[0341]T1 plants can be grown under nitrogen limiting conditions, for example 1 mM nitrate, and analyzed for phenotypic changes. The following parameters can be quantified using image analysis: plant area, volume, growth rate and color analysis can be collected and quantified. Overexpression constructs that result in an alteration, compared to suitable control plants, in greenness (green color bin), yield, growth rate, biomass, fresh or dry weight at maturation, fruit or seed yield, total plant nitrogen content, fruit or seed nitrogen content, nitrogen content in vegetative tissue, free amino acid content in the whole plant, free amino acid content in vegetative tissue, free amino acid content in the fruit or seed, protein content in the fruit or seed, or protein content in a vegetative tissue can be considered evidence that the Arabidopsis lead gene functions in maize to enhance tolerance to nitrogen deprivation (increased nitrogen tolerance).

[0342]Furthermore, a recombinant DNA construct containing a validated Arabidopsis gene can be introduced into a maize inbred line either by direct transformation or introgression from a separately transformed line.

EXAMPLE 14A

Preparation of Expression Vector for Transformation of Maize Lines with Validated Candidate Arabidopsis Gene (At5q50930) Using Agrobacterium

[0343]Using the INVITROGEN® GATEWAY® technology, an LR Recombination Reaction was performed with the GATEWAY® entry clone containing the Arabidopsis Int2-2 (described in Example 5), entry clone PHP23112 (SEQ ID NO:14), entry clone PHP20234 (SEQ ID NO:9; FIG. 9) and destination vector PHP22655 (SEQ ID NO:10) to generate the precursor plasmid PHP28699. Likewise, an LR Recombination Reaction was performed with the GATEWAY® entry clone containing the Arabidopsis Int2-2 (described in Example 5), entry clone PHP23112 (SEQ ID NO:14), entry clone PHP20234 (SEQ ID NO:9; FIG. 9) and destination vector PHP22655 (SEQ ID NO:10) to generate the precursor plasmid PHP28700. PHP28699 and PHP28700 each contain the following expression cassettes:

[0344]1. Ubiquitin promoter::moPAT::PinII terminator cassette expressing the PAT herbicide resistance gene used for selection during the transformation process.

[0345]2. LTP2 promoter::DS-RED2::PinII terminator cassette expressing the DS-RED color marker gene used for seed sorting.

[0346]In addition, PHP28699 contains the Ubiquitin promoter::Int2-2::PinII terminator cassette overexpressing the Arabidopsis LNT2-2, and PHP28700 contains the Ubiquitin promoter::Int2-3::PinII terminator cassette overexpressing the Arabidopsis LNT2-3.

EXAMPLE 14B

Transformation of Maize Lines with Validated Candidate Arabidopsis Gene (At5g50930) using Agrobacterium

[0347]The LNT2-2 expression cassette present in vector PHP28699 (described in Example 14A) can be introduced into a maize inbred line, or a transformable maize line derived from an elite maize inbred line, using Agrobacterium-mediated transformation as described in Examples 12 and 13. The same procedures can also be used to introduce the LNT2-3 expression cassette present in PHP28700 into a maize inbred line, or a transformable maize line derived from an elite maize inbred line.

[0348]Expression vector PHP28699 can be electroporated into the LBA4404 Agrobacterium strain containing vector PHP10523 (SEQ ID NO:7, FIG. 7) to create the co-integrate vector PHP28841, which contains the Int2-2 expression cassette. The co-integrate vector is formed by recombination of the two plasmids, PHP28699 and PHP10523, through the COS recombination sites contained on each vector and contains the same three expression cassettes as above (Example 14A) in addition to other genes (TET, TET, TRFA, ORI terminator, CTL, ORI V, VIR Cl, VIR C2, VIR G, VIR B) needed for the Agrobacterium strain and the Agrobacterium-mediated transformation. Similarly, expression vector PHP28700 can be electroporated into the LBA4404 Agrobacterium strain containing vector PHP10523 (SEQ ID NO:7, FIG. 7) to create the co-integrate vector PHP28840, which contains the Int2-3 expression cassette. The electroporation protocol in, but not limited to, Example 12 may be used.

EXAMPLE 15

Preparation of the Destination Vector PHP23236 for Transformation into Gaspe Flint Derived Maize Lines

[0349]Destination vector PHP23236 (FIG. 6; SEQ ID NO:6) was obtained by transformation of Agrobacterium strain LBA4404 containing PHP10523 (FIG. 7; SEQ ID NO:7) with vector PHP23235 (FIG. 8; SEQ ID NO:8) and isolation of the resulting co-integration product.

[0350]Destination vector PHP23236 can be used in a recombination reaction with an entry clone, as described in Example 16, to create a maize expression vector for transformation of Gaspe Flint derived maize lines.

EXAMPLE 16

Preparation of Expression Constructs for Transformation into Gaspe Flint Derived Maize Lines

[0351]Using the INVITROGEN® GATEWAY® LR Recombination technology, the same entry clones described in Example 5 can be used to directionally clone the expression cassettes into the GATEWAY® destination vector PHP23236 (SEQ ID NO:6; FIG. 6) to create corresponding expression vectors. Expression vectors PHP29694 and PHP29689 contain Int2-2 (SEQ ID NO:29) and Int2-3 (SEQ ID NO:31), respectively. Each expression vector contains the cDNA of interest under control of the UBI promoter and is a T-DNA binary for Agrobacterium-mediated transformation into maize as described, but not limited to, the examples described herein.

EXAMPLE 17A

Transformation of Gaspe Flint Derived Maize Lines with Validated Candidate Arabidopsis Gene (At5g50930)

[0352]Maize plants can be transformed to overexpress the Arabidopsis At5g50930 gene (and the corresponding homologs from other species) in order to examine the resulting phenotype. Expression constructs such as the one described in Example 16 may be used.

[0353]Recipient Plants

[0354]Recipient plant cells can be from a uniform maize line having a short life cycle ("fast cycling"), a reduced size, and high transformation potential. Typical of these plant cells for maize are plant cells from any of the publicly available Gaspe Flint (GF) line varieties. One possible candidate plant line variety is the F1 hybrid of GF×QTM (Quick Turnaround Maize, a publicly available form of Gaspe Flint selected for growth under greenhouse conditions) disclosed in Tomes et al. (U.S. application Ser. No.10/367,416 filed Feb. 13, 2003; U.S. Patent Publication No. 2003/0221212 A1 published Nov. 27, 2003). Transgenic plants obtained from this line are of such a reduced size that they can be grown in four inch pots (1/4 the space needed for a normal sized maize plant) and mature in less than 2.5 months. (Traditionally 3.5 months is required to obtain transgenic T0 seed once the transgenic plants are acclimated to the greenhouse.) Another suitable line includes but is not limited to a double haploid line of GS3 (a highly transformable line)×Gaspe Flint. Yet another suitable line is a transformable elite maize inbred line carrying a transgene which causes early flowering, reduced stature, or both.

[0355]Transformation Protocol

[0356]Any suitable method may be used to introduce the transgenes into the maize cells, including but not limited to inoculation type procedures using Agrobacterium based vectors (see, for example, Examples 12 and 13). Transformation may be performed on immature embryos of the recipient (target) plant.

[0357]Precision Growth and Plant Tracking

[0358]The event population of transgenic (T0) plants resulting from the transformed maize embryos is grown in a controlled greenhouse environment using a modified randomized block design to reduce or eliminate environmental error. A randomized block design is a plant layout in which the experimental plants are divided into groups (e.g., thirty plants per group), referred to as blocks, and each plant is randomly assigned a location within the block.

[0359]For a group of thirty plants, twenty-four transformed, experimental plants and six control plants (plants with a set phenotype) (collectively, a "replicate group") are placed in pots which are arranged in an array (a.k.a. a replicate group or block) on a table located inside a greenhouse. Each plant, control or experimental, is randomly assigned to a location within the block which is mapped to a unique, physical greenhouse location as well as to the replicate group. Multiple replicate groups of thirty plants each may be grown in the same greenhouse in a single experiment. The layout (arrangement) of the replicate groups should be determined to minimize space requirements as well as environmental effects within the greenhouse. Such a layout may be referred to as a compressed greenhouse layout.

[0360]An alternative to the addition of a specific control group is to identify those transgenic plants that do not express the gene of interest. A variety of techniques such as RT-PCR can be applied to quantitatively assess the expression level of the introduced gene. T0 plants that do not express the transgene can be compared to those which do.

[0361]Each plant in the event population is identified and tracked throughout the evaluation process, and the data gathered from that plant is automatically associated with that plant so that the gathered data can be associated with the transgene carried by the plant. For example, each plant container can have a machine readable label (such as a Universal Product Code (UPC) bar code) which includes information about the plant identity, which in turn is correlated to a greenhouse location so that data obtained from the plant can be automatically associated with that plant.

[0362]Alternatively any efficient, machine readable, plant identification system can be used, such as two-dimensional matrix codes or even radio frequency identification tags (RFID) in which the data is received and interpreted by a radio frequency receiver/processor. See U.S. application Ser. No. 10/324,288 filed Dec. 19, 2002 (U.S. Patent Publication No. 2004/0122592 A1 published Jun. 24, 2004), incorporated herein by reference.

[0363]Phenotypic Analysis using Three-Dimensional Imaging

[0364]Each greenhouse plant in the T0 event population, including any control plants, is analyzed for agronomic characteristics of interest, and the agronomic data for each plant is recorded or stored in a manner so that it is associated with the identifying data (see above) for that plant. Confirmation of a phenotype (gene effect) can be accomplished in the T1 generation with a similar experimental design to that described above.

[0365]The T0 plants are analyzed at the phenotypic level using quantitative, non-destructive imaging technology throughout the plant's entire greenhouse life cycle to assess the traits of interest. In an embodiment, a digital imaging analyzer is used for automatic multi-dimensional analyzing of total plants. The imaging may be done inside the greenhouse. Two camera systems, located at the top and side, and an apparatus to rotate the plant, are used to view and image plants from all sides. Images are acquired from the top, front and side of each plant. All three images together provide sufficient information to evaluate, for example, the biomass, size, and morphology of each plant.

[0366]Due to the change in size of the plants from the time the first leaf appears from the soil to the time the plants are at the end of their development, the early stages of plant development are In an embodiment documented with a higher magnification from the top. This imaging may be accomplished by using a motorized zoom lens system that is fully controlled by the imaging software.

[0367]In a single imaging analysis operation, the following events occur: (1) the plant is conveyed inside the analyzer area, rotated 360 degrees so its machine readable label can be read, and left at rest until its leaves stop moving; (2) the side image is taken and entered into a database; (3) the plant is rotated 90 degrees and again left at rest until its leaves stop moving, and (4) the plant is transported out of the analyzer.

[0368]Plants are allowed at least six hours of darkness per twenty four hour period in order to have a normal day/night cycle.

[0369]Imaging Instrumentation

[0370]Any suitable imaging instrumentation may be used, including but not limited to light spectrum digital imaging instrumentation commercially available from LemnaTec GmbH of Wurselen, Germany. The images are taken and analyzed with a LemnaTec Scanalyzer HTS LT-0001-2 having a 1/2'' IT Progressive Scan IEE CCD imaging device. The imaging cameras may be equipped with a motor zoom, motor aperture, and motor focus. All camera settings may be made using LemnaTec software. In an embodiment, the instrumental variance of the imaging analyzer is less than about 5% for major components and less than about 10% for minor components.

[0371]Software

[0372]The imaging analysis system comprises a LemnaTec HTS Bonit software program for color and architecture analysis and a server database for storing data from about 500,000 analyses, including the analysis dates. The original images and the analyzed images are stored together to allow the user to do as much reanalyzing as desired. The database can be connected to the imaging hardware for automatic data collection and storage. A variety of commercially available software systems (e.g., Matlab, others) can be used for quantitative interpretation of the imaging data, and any of these software systems can be applied to the image data set.

[0373]Conveyor System

[0374]A conveyor system with a plant rotating device may be used to transport the plants to the imaging area and rotate them during imaging. For example, up to four plants, each with a maximum height of 1.5 m, are loaded onto cars that travel over the circulating conveyor system and through the imaging measurement area. In this case the total footprint of the unit (imaging analyzer and conveyor loop) is about 5 m×5 m.

[0375]The conveyor system can be enlarged to accommodate more plants at a time. The plants are transported along the conveyor loop to the imaging area and are analyzed for up to 50 seconds per plant. Three views of the plant are taken. The conveyor system, as well as the imaging equipment, should be capable of being used in greenhouse environmental conditions.

[0376]Illumination

[0377]Any suitable mode of illumination may be used for the image acquisition. For example, a top light above a black background can be used. Alternatively, a combination of top- and backlight using a white background can be used. The illuminated area should be housed to ensure constant illumination conditions. The housing should be longer than the measurement area so that constant light conditions prevail without requiring the opening and closing or doors. Alternatively, the illumination can be varied to cause excitation of either transgene (e.g., green fluorescent protein (GFP), red fluorescent protein (RFP)) or endogenous (e.g. Chlorophyll) fluorophores).

[0378]Biomass Estimation Based on Three-Dimensional Imaging

[0379]For best estimation of biomass the plant images should be taken from at least three axes, In an embodiment the top and two side (sides 1 and 2) views. These images are then analyzed to separate the plant from the background, pot and pollen control bag (if applicable). The volume of the plant can be estimated by the calculation:

Volume ( voxels ) = TopArea ( pixels ) × Side 1 Area ( pixels ) × Side 2 Area ( pixels ) ##EQU00001##

[0380]In the equation above the units of volume and area are "arbitrary units". Arbitrary units are entirely sufficient to detect gene effects on plant size and growth in this system because what is desired is to detect differences (both positive-larger and negative-smaller) from the experimental mean, or control mean. The arbitrary units of size (e.g. area) may be trivially converted to physical measurements by the addition of a physical reference to the imaging process. For instance, a physical reference of known area can be included in both top and side imaging processes. Based on the area of these physical references a conversion factor can be determined to allow conversion from pixels to a unit of area such as square centimeters (cm²). The physical reference may or may not be an independent sample. For instance, the pot, with a known diameter and height, could serve as an adequate physical reference.

[0381]Color Classification

[0382]The imaging technology may also be used to determine plant color and to assign plant colors to various color classes. The assignment of image colors to color classes is an inherent feature of the LemnaTec software. With other image analysis software systems color classification may be determined by a variety of computational approaches.

[0383]For the determination of plant size and growth parameters, a useful classification scheme is to define a simple color scheme including two or three shades of green (In an embodiment hues 50-66, see FIG. 12) and, in addition, a color class for chlorosis, necrosis and bleaching, should these conditions occur. A background color class which includes non plant colors in the image (for example pot and soil colors) is also used and these pixels are specifically excluded from the determination of size. The plants are analyzed under controlled constant illumination so that any change within one plant over time, or between plants or different batches of plants (e.g. seasonal differences) can be quantified.

[0384]In addition to its usefulness in determining plant size growth, color classification can be used to assess other yield component traits. For these other yield component traits additional color classification schemes may be used. For instance, the trait known as "staygreen", which has been associated with improvements in yield, may be assessed by a color classification that separates shades of green from shades of yellow and brown (which are indicative of senescing tissues). By applying this color classification to images taken toward the end of the T0 or T1 plants' life cycle, plants that have increased amounts of green colors relative to yellow and brown colors (expressed, for instance, as Green/Yellow Ratio) may be identified. Plants with a significant difference in this Green/Yellow ratio can be identified as carrying transgenes which impact this important agronomic trait.

[0385]The skilled plant biologist will recognize that other plant colors arise which can indicate plant health or stress response (for instance anthocyanins), and that other color classification schemes can provide further measures of gene action in traits related to these responses.

[0386]Plant Architecture Analysis

[0387]Transgenes which modify plant architecture parameters may also be identified using the present invention, including such parameters as maximum height and width, internodal distances, angle between leaves and stem, number of leaves starting at nodes, and leaf length. The LemnaTec system software may be used to determine plant architecture as follows. The plant is reduced to its main geometric architecture in a first imaging step and then, based on this image, parameterized identification of the different architecture parameters can be performed. Transgenes that modify any of these architecture parameters either singly or in combination can be identified by applying the statistical approaches previously described.

[0388]Pollen Shed Date

[0389]Pollen shed date is an important parameter to be analyzed in a transformed plant, and may be determined by the first appearance on the plant of an active male flower. To find the male flower object, the upper end of the stem is classified by color to detect yellow or violet anthers. This color classification analysis is then used to define an active flower, which in turn can be used to calculate pollen shed date.

[0390]Alternatively, pollen shed date and other easily visually detected plant attributes (e.g., pollination date, first silk date) can be recorded by the personnel responsible for performing plant care. To maximize data integrity and process efficiency, this data is tracked by utilizing the same barcodes utilized by the LemnaTec light spectrum digital analyzing device. A computer with a barcode reader, a palm device, or a notebook PC may be used for ease of data capture recording time of observation, plant identifier, and the operator who captured the data.

[0391]Orientation of the Plants

[0392]Mature maize plants grown at densities approximating commercial planting often have a planar architecture. That is, the plant has a clearly discernable broad side, and a narrow side. The image of the plant from the broadside is determined. To each plant a well defined basic orientation is assigned to obtain the maximum difference between the broadside and edgewise images. The top image is used to determine the main axis of the plant, and an additional rotating device is used to turn the plant to the appropriate orientation prior to starting the main image acquisition.

EXAMPLE 17B

Transformation of Gaspe Flint Derived Maize Lines with Maize Homolog

[0393]Using the INVITROGEN® GATEWAY® LR Recombination technology, an entry clone may be created for the maize homolog (SEQ ID NO:1 7) (see Example 5 for entry clone preparation) and can be directionally cloned into the GATEWAY® destination vector PHP23236 (SEQ ID NO:6; FIG. 6) to create an expression vector PHP30115. This expression vector now contains the cDNA of interest under control of the UBI promoter and is a T-DNA binary for Agrobacterium-mediated transformation into maize as described, but not limited to, the examples described herein.

EXAMPLE 18

Screening of Gaspe Flint Derived Maize Lines Under Optimal and Reduced Nitrogen Conditions

[0394]Transgenic plants contain two or three doses of Gaspe Flint-3 with one dose of GS3 (GS3/(Gaspe-3)2× or GS3/(Gaspe-3)3×) and segregate 1:1 for a dominant transgene. Transgenic plants containing PHP29689 (expression cassette=Int2-3) were planted in 100% Turface in classic 200 pots. Plants were watered with 1.0 mM KNO₃ growth medium (see FIG. 13) until segregant determination. At 8 DAP (days after planting), seedlings were randomized and placed equally into respective treatment groups. Two treatments were applied: optimal (6.5 mMol KNO₃) and reduced nitrogen (1.0 mMol KNO₃), twice daily until 13 DAP. The daily irrigation schedule consisted of a 9:00 AM, 12:00 PM, and 3:00 PM nutrient watering for 3 minutes (156 ml) between 13 and 24 DAP. A fourth watering was added at 5:00 AM on 25 DAP, and a fifth watering was added at 5:00 PM on 31 DAP. pH was monitored at least three times weekly for each table, and days to emergence and days to shed were recorded. Imaging to assess surface area accumulation, specific growth rates (sgr), and changes in color, was performed for each plant three times per week (Monday, Wednesday, and Friday). Plants were sampled for ELISA MOPAT on 8 DAP and for expression and metabolic profiling analysis on 35 DAP. Fresh weight data was obtained from harvested tissue, obtained at 37 DAP, and the harvested tissue was then oven dried (70° C. for 120 hrs.) to obtain dry weight data.

[0395]Four events for PHP29689 were evaluated (FIG. 16). The probability of a greater Student's t test was calculated for each transgenic mean compared to the appropriate null mean (either segregant null or construct null). A minimum (P<t ) of 0.1 was used as a cut off. Table 5 shows the variables for each event that were significantly increased, as compared to the segregant nulls.

TABLE-US-00005 TABLE 5 PHP29689 event summary Event Reduced nitrogen Optimal nitrogen EA2391.314.1.5 % light green end % light green end exponential exponential % light green harvest day Ear diameter Total area harvest day Ear dry weight Days to shed Ear fresh weight Maximum total area Specific growth rate Shoot fresh rate EA2391.314.1.6 Total area end % light green end exponential exponential Total area harvest day % light green harvest day Maximum total area Total area end exponential Shoot dry weight Total area harvest day Shoot fresh weight Maximum total area Shoot + ear dry weight Specific growth rate Shoot + ear fresh weight Shoot dry weight Stalk + ear diameter Shoot fresh weight Shoot + ear dry weight Shoot + ear fresh weight EA2391.314.1.8 Days to shed % light green end Specific growth rate exponential Shoot fresh weight % light green harvest day Shoot + ear fresh weight Days to shed Specific growth rate EA2391.314.1.9 % light green end exponential % light green harvest day Total area harvest day Maximum total area Specific growth rate

[0396]When all events were considered relative to the construct null (FIG. 17), the construct, on average, evinced a significant increase over the construct null for a number of variables (data summarized in Table 6).

TABLE-US-00006 TABLE 6 PHP29689 construct summary Reduced nitrogen Optimal nitrogen % light green harvest day % light green end exponential Total area harvest day % light green harvest day Days to shed Total area end exponential Max total area Total area harvest day Specific growth rate Days to shed Shoot fresh weight Max total area Specific growth rate Shoot dry weight Shoot fresh weight Shoot + ear dry weight Shoot + ear fresh weight

EXAMPLE 19

Yield Analysis of Maize Lines with the Arabidopsis Lead Genes

[0397]Transgenic plants, either inbreds or topcross hybrids, can undergo more vigorous field-based experiments to study yield enhancement and/or stability under nitrogen limiting and non-limiting conditions. For example, yield analysis can be done to determine whether plants that contain a validated Arabidopsis Int2-2 or Int2-3 gene have an improvement in yield performance (under nitrogen limiting or non-limiting conditions), when compared to the control (or reference) plants, that are either construct null or wild-type. Nitrogen limiting conditions are provided by a combination of previous fertility practices in which nitrogen is applied at reduced levels for one or more years where corn or an alternative crop is grown and the seed crop is removed each season. Under such conditions, a low nitrogen (LN) environment consists of a less than normal amount of nitrogen fertilizer applied in early spring or summer, whereas a normal nitrogen (NN) environment consists of adding adequate nitrogen for normal yields, based on soil test standards established for specific growing areas by Federal and State Extension services.

[0398]Corn hybrid testcrosses, containing either the validated Arabidopsis Int2-2 or Int2-3 gene, and their controls were grown in LN and NN environments in Woodland, Calif., and in Johnston, Iowa, and yield was assessed. Yield reduction was observed in LN environments compared to that obtained in NN environments. Yields of the corn hybrid testcrosses, containing either the validated Arabidopsis Int2-2 or Int2-3 gene, were compared to that of the construct nulls. The results of these yield trials are shown in FIGS. 18-21.

[0399]Individual events of plants containing PHP28840 (expression cassette=Int2-3) showed significantly increased yield under LN conditions in 2007 for events E6919.105.1.11 and E6919.105.1.21 in Woodland, while the E6919.105.1.21 event tested in Johnston in 2007 was numerically higher in yield. Similar testing in 2008 revealed significantly improved yield for event E6919.105.1.21 in both Woodland and Johnston and for events E6919.105.1.2 and E6919.105.1.24, in Woodland and in Johnston, respectively. The results for PHP28840-containing plants under low nitrogen conditions are shown in FIG. 18

[0400]Under normal nitrogen (NN) treatments, event E6919.105.1.11 was similar in yield to the construct null (not statistically different) in both Woodland and Johnston in 2007, suggesting that under higher nitrogen levels, this event retains high yield potential. A similar result was obtained in 2008 at the Woodland location. In contrast, event E3919.105.1.11 in Johnston in 2008 and events E6919.105.1.21 and E6919.105.1.24 in Johnston in 2007 and 2008 had significantly lower yields. The results for PHP28840-containing plants under normal nitrogen conditions are shown in FIG. 20.

[0401]Individual events of plants containing PHP28841 (expression cassette=Int2-2) showed a statistically significant increase in yield for events E6919.106.1.17 and E6919.106.1.3 under LN conditions in Woodland in 2007. However, in Johnston in 2007 under LN conditions, event E6919.106.1.3 showed significantly lower yields, and yields were not collected for event E6919.106.1.17. The results for PHP28841-containing plants under low nitrogen (LN) conditions are shown in FIG. 19.

[0402]Under normal nitrogen (NN) treatments, E6919.106.1.17 had numerically higher yields in both Woodland and Johnston in 2007, as compared to the construct null, while event E6919.106.1.3 showed a significant increase in yield in Woodland in 2007 and a numerical increase in Johnston in 2007. Events E6919.106.1.22 and E619.106.1.8 showed significant decreases in yield in Woodland. The results for PHP28841-containing plants under normal nitrogen (NN) conditions are shown in FIG. 21.

EXAMPLE 20

NUE Maize Seedling Assay

[0403]Seed of transgenic events (having construct PHP28841 or PHP28840) were separated into transgene (heterozygous) and null seed using a seed color marker. Two different random assignments of treatments were made to each block of 54 pots, which were arranged 6 rows by 9 columns using 9 replicates of all treatments. In one case, 4 null seed of 5 events of the same construct were mixed and used as a bulked control for comparisons of the 5 positive events in this block, making up 6 treatment combinations in each block. In the second case, 3 transgenic positive treatments and their corresponding nulls were randomly assigned to the 54 pots of the block, making 6 treatment combinations (3 positive and corresponding nulls) for each block, containing 9 replicates of all treatment combinations. In the first case, transgenic parameters were compared to a bulked construct null; in the second case, transgenic parameters were compared to the corresponding event null. In cases where there were 10,15, or 20 events per construct, the events were assigned in groups of 5 events and the variances were calculated for each block of 54 pots. However, the block null means were pooled across blocks before transgenic mean comparisons were made.

[0404]For each treatment, two seeds were planted in a 4 inch square pot containing Turface, on 8 inch, staggered centers. The pots were watered four times each day with a solution containing the following nutrients: 1 mM CaC₂, 2 mM MgSO₄, 0.5 mM KH₂PO₄, 83 ppm Sprint330, 3 mM KCl, 1 mM KNO₃, 1 μM ZnSO₄, 1 μM MnCl₂, 3 μM H₃BO₄, 0.1 μM CuSO₄, and 0.1 μM NaMoO₄.

[0405]After emergence, the plants were thinned to one seed per pot. Treatments were routinely planted on a Monday, and the plants emerged the following Friday. The plants were then harvested 18 days after planting. At harvest, plants were removed from the pots, and the Turface was washed from the roots. The roots were separated from the shoot, placed in a paper bag and dried at 70° C. for 70 hr. The dried plant parts (roots and shoots) were weighed and placed in a 50 ml conical tube with approximately 20 5/32 inch steel balls and then ground by shaking in a paint shaker. Approximately, 30 mg of the ground tissue (weight recorded for later adjustment) was hydrolyzed in 2 ml of 20% H₂O₂ and 6M H₂SO₄ for 30 min at 170° C. After cooling, water was added to 20 ml, and the solution was mixed thoroughly. A 50 μl aliquot was removed and added to 950 μl 1M Na₂CO₃. The ammonia in this solution was used to estimate total reduced plant nitrogen by placing 100 μl of this solution into individual wells of a 96 well plate and then adding 50 μl of OPA solution. Fluorescence, excitation=360 nM/emission=530 nM, was determined and compared to NH₄Cl standards dissolved in a similar solution and treated with OPA solution.

[0406]The following solutions were used in the aforementioned experiments:

[0407]OPA solution-5 μl Mercaptoethanol+1 ml OPA stock solution (make fresh, daily)

[0408]OPA stock-50 mg o-phthadialdehyde (OPA--Sigma #P0657) dissolved in 1.5 ml methanol+4.4 ml 1 M Borate buffer pH9.5 (3.09 g H₃BO₄+1 g NaOH in 50 ml water)+0.55ml 20% SDS (made fresh weekly)

[0409]The following parameters were measured, and the means were compared to null mean parameters using a Student's t test: SPAD (greenness), stem diameter, root dry weight, shoot dry weight, total dry weight, and plant N concentration. Variance was calculated within each block using a nearest neighbor calculation as well as by Analysis of Variance (ANOVA) using a completely random design (CRD) model. An overall treatment effect for each block was calculated using an F statistic, by dividing overall block treatment mean square by the overall block error mean square. The probability of a greater Student's t test was calculated for each transgenic mean compared to the appropriate null (either construct bulked or individual event null mean) mean. A minimum (P<t ) of 0.1 was used as a cut off.

[0410]The results of the NUE seedling assay for the PHP28840 (expression cassette=Int2-3) and PHP28841 (expression cassette=Int2-2) constructs are shown in FIG. 22. Event E6919.105.1.21, which contains the UBI:Int2-3 expression cassette, showed a statistically significant increase in the following: shoot dry weight, nitrogen concentration, and total N. Another event with the UBI:Int2-3 expression cassette and four out of six events with the UBI:Int2-2 expression cassette evinced a statistically significant increase in plant N concentration. In addition, two out of six events containing the UBI:Int2-2 expression cassette showed a statistically significant increase in total N.

EXAMPLE 21

Transformation and Evaluation of Soybean with Soybean Homologs of Validated Lead Genes

[0411]Based on homology searches, one or several candidate soybean homologs of validated Arabidopsis leads can be identified and also be assessed for their ability to enhance tolerance to nitrogen limiting conditions in soybean. Vector construction, plant transformation and phenotypic analysis will be similar to that in previously described Examples.

EXAMPLE 22

Transformation and Evaluation of Maize with Maize Homologs of Validated Lead Genes

[0412]Based on homology searches, one or several candidate maize homologs of validated Arabidopsis lead genes can be identified (e.g., SEQ ID NOs:18 and 20) and also be assessed for their ability to enhance tolerance to nitrogen limiting conditions in maize. Vector construction, plant transformation and phenotypic analysis can be similar to that in previously described Examples.

EXAMPLE 23

Transformation of Arabidopsis with Maize and Soybean Homologs of Validated Lead Genes

[0413]Soybean and maize homologs to validated Arabidopsis lead genes can be transformed into Arabidopsis under control of the 35S promoter and assayed for leaf area and green color bin accumulation when grown on low nitrogen medium. Vector construction and plant transformation can be as described in the examples herein. Assay conditions, data capture and data analysis can be similar to that in previously described Examples.

Sequence CWU 1 SEQUENCE LISTING <160> NUMBER OF SEQ ID NOS: 36 <210> SEQ ID NO 1 <211> LENGTH: 18491 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: pHSbarEND2s activation tagging vector <400> SEQUENCE: 1 catgaatcaa acaaacatac acagcgactt attcacacga gctcaaatta caacggtata 60 tatcctgccg tcgacaacca tggtctagac aggatccccg ggtaccgagc tcgaatttgc 120 aggtcgactg cgtcatccct tacgtcagtg gagatatcac atcaatccac ttgctttgaa 180 gacgtggttg gaacgtcttc tttttccacg atgctcctcg tgggtggggg tccatctttg 240 ggaccactgt cggcagaggc atcttgaacg atagcctttc ctttatcgca atgatggcat 300 ttgtaggtgc caccttcctt ttctactgtc cttttgatga agtgacagat agctgggcaa 360 tggaatccga ggaggtttcc cgatattacc ctttgttgaa aagtctcaat tgccctttgg 420 tcttctgaga ctgttgcgtc atcccttacg tcagtggaga tatcacatca atccacttgc 480 tttgaagacg tggttggaac gtcttctttt tccacgatgc tcctcgtggg tgggggtcca 540 tctttgggac cactgtcggc agaggcatct tgaacgatag cctttccttt atcgcaatga 600 tggcatttgt aggtgccacc ttccttttct actgtccttt tgatgaagtg acagatagct 660 gggcaatgga atccgaggag gtttcccgat attacccttt gttgaaaagt ctcagttaac 720 ccgcgatcct gcgtcatccc ttacgtcagt ggagatatca catcaatcca cttgctttga 780 agacgtggtt ggaacgtctt ctttttccac gatgctcctc gtgggtgggg gtccatcttt 840 gggaccactg tcggcagagg catcttgaac gatagccttt cctttatcgc aatgatggca 900 tttgtaggtg ccaccttcct tttctactgt ccttttgatg aagtgacaga tagctgggca 960 atggaatccg aggaggtttc ccgatattac cctttgttga aaagtctcaa ttgccctttg 1020 gtcttctgag actgttgcgt catcccttac gtcagtggag atatcacatc aatccacttg 1080 ctttgaagac gtggttggaa cgtcttcttt ttccacgatg ctcctcgtgg gtgggggtcc 1140 atctttggga ccactgtcgg cagaggcatc ttgaacgata gcctttcctt tatcgcaatg 1200 atggcatttg taggtgccac cttccttttc tactgtcctt ttgatgaagt gacagatagc 1260 tgggcaatgg aatccgagga ggtttcccga tattaccctt tgttgaaaag tctcagttaa 1320 cccgcaattc actggccgtc gttttacaac gtcgtgactg ggaaaaccct ggcgttaccc 1380 aacttaatcg ccttgcagca catccccctt tcgccagctg gcgtaatagc gaagaggccc 1440 gcaccgatcg cccttcccaa cagttgcgca gcctgaatgg cgaatggatc gatccgtcga 1500 tcgaccaaag cggccatcgt gcctccccac tcctgcagtt cgggggcatg gatgcgcgga 1560 tagccgctgc tggtttcctg gatgccgacg gatttgcact gccggtagaa ctccgcgagg 1620 tcgtccagcc tcaggcagca gctgaaccaa ctcgcgaggg gatcgagccc ctgctgagcc 1680 tcgacatgtt gtcgcaaaat tcgccctgga cccgcccaac gatttgtcgt cactgtcaag 1740 gtttgacctg cacttcattt ggggcccaca tacaccaaaa aaatgctgca taattctcgg 1800 ggcagcaagt cggttacccg gccgccgtgc tggaccgggt tgaatggtgc ccgtaacttt 1860 cggtagagcg gacggccaat actcaacttc aaggaatctc acccatgcgc gccggcgggg 1920 aaccggagtt cccttcagtg aacgttatta gttcgccgct cggtgtgtcg tagatactag 1980 cccctggggc cttttgaaat ttgaataaga tttatgtaat cagtctttta ggtttgaccg 2040 gttctgccgc tttttttaaa attggatttg taataataaa acgcaattgt ttgttattgt 2100 ggcgctctat catagatgtc gctataaacc tattcagcac aatatattgt tttcatttta 2160 atattgtaca tataagtagt agggtacaat cagtaaattg aacggagaat attattcata 2220 aaaatacgat agtaacgggt gatatattca ttagaatgaa ccgaaaccgg cggtaaggat 2280 ctgagctaca catgctcagg ttttttacaa cgtgcacaac agaattgaaa gcaaatatca 2340 tgcgatcata ggcgtctcgc atatctcatt aaagcagggg gtgggcgaag aactccagca 2400 tgagatcccc gcgctggagg atcatccagc cggcgtcccg gaaaacgatt ccgaagccca 2460 acctttcata gaaggcggcg gtggaatcga aatctcgtga tggcaggttg ggcgtcgctt 2520 ggtcggtcat ttcgaacccc agagtcccgc tcagaagaac tcgtcaagaa ggcgatagaa 2580 ggcgatgcgc tgcgaatcgg gagcggcgat accgtaaagc acgaggaagc ggtcagccca 2640 ttcgccgcca agctcttcag caatatcacg ggtagccaac gctatgtcct gatagcggtc 2700 cgccacaccc agccggccac agtcgatgaa tccagaaaag cggccatttt ccaccatgat 2760 attcggcaag caggcatcgc catgggtcac gacgagatcc tcgccgtcgg gcatgccccc 2820 caattcactg gccgtcgttt tacaacgtcg tgactgggaa aaccctggcg ttacccaact 2880 taatcgcctt gcagcacatc cccctttcgc cagctggcgt aatagcgaag aggcccgcac 2940 cgatcgccct tcccaacagt tgcgcagcct gaatggcgaa tggcgcctga tgcggtattt 3000 tctccttacg catctgtgcg gtatttcaca ccgcatatgg tgcactctca gtacaatctg 3060 ctctgatgcc gcatagttaa gccagccccg acacccgcca acacccgctg acgcgccctg 3120 acgggcttgt ctgctcccgg catccgctta cagacaagct gtgaccgtct ccgggagctg 3180 catgtgtcag aggttttcac cgtcatcacc gaaacgcgcg agacgaaagg gcctcgtgat 3240 acgcctattt ttataggtta atgtcatgat aataatggtt tcttagacgt caggtggcac 3300 ttttcgggga aatgtgcgcg gaacccctat ttgtttattt ttctaaatac attcaaatat 3360 gtatccgctc atgagacaat aaccctgata aatgcttcaa taatattgaa aaaggaagag 3420 tatgagtatt caacatttcc gtgtcgccct tattcccttt tttgcggcat tttgccttcc 3480 tgtttttgct cacccagaaa cgctggtgaa agtaaaagat gctgaagatc agttgggtgc 3540 acgagtgggt tacatcgaac tggatctcaa cagcggtaag atccttgaga gttttcgccc 3600 cgaagaacgt tttccaatga tgagcacttt taaagttctg ctatgtggcg cggtattatc 3660 ccgtattgac gccgggcaag agcaactcgg tcgccgcata cactattctc agaatgactt 3720 ggttgagtac tcaccagtca cagaaaagca tcttacggat ggcatgacag taagagaatt 3780 atgcagtgct gccataacca tgagtgataa cactgcggcc aacttacttc tgacaacgat 3840 cggaggaccg aaggagctaa ccgctttttt gcacaacatg ggggatcatg taactcgcct 3900 tgatcgttgg gaaccggagc tgaatgaagc cataccaaac gacgagcgtg acaccacgat 3960 gcctgtagca atggcaacaa cgttgcgcaa actattaact ggcgaactac ttactctagc 4020 ttcccggcaa caattaatag actggatgga ggcggataaa gttgcaggac cacttctgcg 4080 ctcggccctt ccggctggct ggtttattgc tgataaatct ggagccggtg agcgtgggtc 4140 tcgcggtatc attgcagcac tggggccaga tggtaagccc tcccgtatcg tagttatcta 4200 cacgacgggg agtcaggcaa ctatggatga acgaaataga cagatcgctg agataggtgc 4260 ctcactgatt aagcattggt aactgtcaga ccaagtttac tcatatatac tttagattga 4320 tttaaaactt catttttaat ttaaaaggat ctaggtgaag atcctttttg ataatctcat 4380 gaccaaaatc ccttaacgtg agttttcgtt ccactgagcg tcagaccccg tagaaaagat 4440 caaaggatct tcttgagatc ctttttttct gcgcgtaatc tgctgcttgc aaacaaaaaa 4500 accaccgcta ccagcggtgg tttgtttgcc ggatcaagag ctaccaactc tttttccgaa 4560 ggtaactggc ttcagcagag cgcagatacc aaatactgtc cttctagtgt agccgtagtt 4620 aggccaccac ttcaagaact ctgtagcacc gcctacatac ctcgctctgc taatcctgtt 4680 accagtggct gctgccagtg gcgataagtc gtgtcttacc gggttggact caagacgata 4740 gttaccggat aaggcgcagc ggtcgggctg aacggggggt tcgtgcacac agcccagctt 4800 ggagcgaacg acctacaccg aactgagata cctacagcgt gagcattgag aaagcgccac 4860 gcttcccgaa gggagaaagg cggacaggta tccggtaagc ggcagggtcg gaacaggaga 4920 gcgcacgagg gagcttccag ggggaaacgc ctggtatctt tatagtcctg tcgggtttcg 4980 ccacctctga cttgagcgtc gatttttgtg atgctcgtca ggggggcgga gcctatggaa 5040 aaacgccagc aacgcggcct ttttacggtt cctggccttt tgctggcctt ttgctcacat 5100 gttctttcct gcgttatccc ctgattctgt ggataaccgt attaccgcct ttgagtgagc 5160 tgataccgct cgccgcagcc gaacgaccga gcgcagcgag tcagtgagcg aggaagcgga 5220 agagcgccca atacgcaaac cgcctctccc cgcgcgttgg ccgattcatt aatgcagctg 5280 gcacgacagg tttcccgact ggaaagcggg cagtgagcgc aacgcaatta atgtgagtta 5340 gctcactcat taggcacccc aggctttaca ctttatgctt ccggctcgta tgttgtgtgg 5400 aattgtgagc ggataacaat ttcacacagg aaacagctat gaccatgatt acgccaagct 5460 ttctaggggg ggggtaccga tctgagatcg gtaacgaaaa cgaacgggta gggatgaaaa 5520 cggtcggtaa cggtcggtaa aatacctcta ccgttttcat tttcatattt aacttgcggg 5580 acggaaacga aaacgggata taccggtaac gaaaacgaac gggataaata cggtaatcga 5640 aaaccgatac gatccggtcg ggttaaagtc gaaatcggac gggaaccggt atttttgttc 5700 ggtaaaatca cacatgaaaa catatattca aaacttaaaa acaaatataa aaaattgtaa 5760 acacaagtct taatgatcac tagtggcgcg cctaggagat ctcgagtagg gataacaggg 5820 taatacatag ataaaatcca tataaatctg gagcacacat agtttaatgt agcacataag 5880 tgataagtct tgggctcttg gctaacataa gaagccatat aagtctacta gcacacatga 5940 cacaatataa agtttaaaac acatattcat aatcacttgc tcacatctgg atcacttagc 6000 atgctacagc tagtgcaata ttagacactt tccaatattt ctcaaacttt tcactcattg 6060 caacggccat tctcctaatg acaaattttt catgaacaca ccattggtca atcaaatcct 6120 ttatctcaca gaaacctttg taaaataaat ttgcagtgga atattgagta ccagatagga 6180 gttcagtgag atcaaaaaac ttcttcaaac acttaaaaag agttaatgcc atcttccact 6240 cctcggcttt aggacaaatt gcatcgtacc tacaataatt gacatttgat taattgagaa 6300 tttataatga tgacatgtac aacaattgag acaaacatac ctgcgaggat cacttgtttt 6360 aagccgtgtt agtgcaggct tataatataa ggcatccctc aacatcaaat aggttgaatt 6420 ccatctagtt gagacatcat atgagatccc tttagattta tccaagtcac attcactagc 6480 acacttcatt agttcttccc actgcaaagg agaagatttt acagcaagaa caatcgcttt 6540 gattttctca attgttcctg caattacagc caagccatcc tttgcaacca agttcagtat 6600 gtgacaagca cacctcacat gaaagaaagc accatcacaa actagatttg aatcagtgtc 6660 ctgcaaatcc tcaattatat cgtgcacagc tacttcattt gcactagcat tatccaaaga 6720 caaggcaaac aattttttct caatgttcca cttaaccatg attgcagtga aggtttgtga 6780 taacctttgg ccagtgtggc gcccttcaac atgaaaaaag ccaacaattc ttttttggag 6840 acaccaatca tcatcaatcc aatggatggt gacacacatg tatgacttat tttgacaaga 6900 tgtccacata tccatagttg tactgaagcg agactgaaca tcttttagtt ttccatacaa 6960 cttttctttt tcttccaaat acaaatccat gatatatttt ctagcagtga cacgggactt 7020 tattggaaag tgagggcgca gagacttaac aaactcaaca aagtactcat gttctacaat 7080 attgaaagga tattcatgca tgattattgc caaatgaagc ttctttaggc taaccacttc 7140 atcgtactta taaggctcaa tgagatttat gtctttgcca tgatcctttt cactttttag 7200 acacaactga cctttaacta aactatgtga tgttctcaag tgatttcgaa atccgcttgt 7260 tccatgatga ccctcagccc tatacttagc cttgcaatta ggaaagttgc aatgtcccca 7320 tacctgaacg tatttctttc catcgacctc cacttcaatt tccttcttgg tgaaatgctg 7380 ccatacatcc gatgtgcact tctttgccct cttctgtggt gcttcttctt cgggttcagg 7440 ttgtggctgt ggttgtggtt ctggttgtgg ttgtggttgt ggttgtggtt catgaacaat 7500 agccatatca tcttgactcg gatctgtagc tgtaccattt gcattactac tgcttacact 7560 ctgaataaaa tgcctctcgg cctcagctgt tgatgatgat ggtgatgtgc ggccacatcc 7620 atgcccacgc gcacgtgcac gtacattctg aatccgacta gaagaggctt cagcttttct 7680 tttcaaccct gttataaaca gatttttcgt attattctac agtcaatatg atgcttccca 7740 atctacaacc aattagtaat gctaatgcta ttgctactgt ttttctaata tataccttga 7800 gcatatgcag agaatacgga atttgttttg cgagtagaag gcgctcttgt ggtagacatc 7860 aacttggcca atcttatggc tgagcctgag ggaggattat ttccaaccgg aggcgtcatc 7920 tgaggaatgg agtcgtagcc ggctagccga agtggagagc agagccctgg acagcaggtg 7980 ttcagcaatc agcttggtgc tgtactgctg tgacttgtga gcacctggac ggctggacag 8040 caatcagcag gtgttgcaga gcccctggac agcacacaaa tgacacaaca gcttggtgca 8100 atggtgctga cgtgctgtac tgctaagtgc tgtgagcctg tgagcagccg tggagacagg 8160 gagaccgcgg atggccggat gggcgagcgc cgagcagtgg aggtctggag gaccgctgac 8220 cgcagatggc ggatggcgga tgggcggacc gcggatgggc gagcagtgga gtggaggtct 8280 gggcggatgg gcggaccgcg gcgcggatgg gcgagtcgcg agcagtggag tggagggcgg 8340 accgtggatg gcggcgtctg cgtccggcgt gccgcgtcac ggccgtcacc gcgtgtggtg 8400 cctggtgcag cccagcggcc ggccggctgg gagacaggga gagtcggaga gagcaggcga 8460 gagcgagacg cgtcgccggc gtcggcgtgc ggctggcggc gtccggactc cggcgtgggc 8520 gcgtggcggc gtgtgaatgt gtgatgctgt tactcgtgtg gtgcctggcc gcctgggaga 8580 gaggcagagc agcgttcgct aggtatttct tacatgggct gggcctcagt ggttatggat 8640 gggagttgga gctggccata ttgcagtcat cccgaattag aaaatacggt aacgaaacgg 8700 gatcatcccg attaaaaacg ggatcccggt gaaacggtcg ggaaactagc tctaccgttt 8760 ccgtttccgt ttaccgtttt gtatatcccg tttccgttcc gttttcgttt tttacctcgg 8820 gttcgaaatc gatcgggata aaactaacaa aatcggttat acgataacgg tcggtacggg 8880 attttcccat cctactttca tccctgagat tattgtcgtt tctttcgcag atcggtaccc 8940 cccccctaga gtcgacatcg atctagtaac atagatgaca ccgcgcgcga taatttatcc 9000 tagtttgcgc gctatatttt gttttctatc gcgtattaaa tgtataattg cgggactcta 9060 atcataaaaa cccatctcat aaataacgtc atgcattaca tgttaattat tacatgctta 9120 acgtaattca acagaaatta tatgataatc atcgcaagac cggcaacagg attcaatctt 9180 aagaaacttt attgccaaat gtttgaacga tctgcttcga cgcactcctt ctttaggtac 9240 ggactagatc tcggtgacgg gcaggaccgg acggggcggt accggcaggc tgaagtccag 9300 ctgccagaaa cccacgtcat gccagttccc gtgcttgaag ccggccgccc gcagcatgcc 9360 gcggggggca tatccgagcg cctcgtgcat gcgcacgctc gggtcgttgg gcagcccgat 9420 gacagcgacc acgctcttga agccctgtgc ctccagggac ttcagcaggt gggtgtagag 9480 cgtggagccc agtcccgtcc gctggtggcg gggggagacg tacacggtcg actcggccgt 9540 ccagtcgtag gcgttgcgtg ccttccaggg gcccgcgtag gcgatgccgg cgacctcgcc 9600 gtccacctcg gcgacgagcc agggatagcg ctcccgcaga cggacgaggt cgtccgtcca 9660 ctcctgcggt tcctgcggct cggtacggaa gttgaccgtg cttgtctcga tgtagtggtt 9720 gacgatggtg cagaccgccg gcatgtccgc ctcggtggca cggcggatgt cggccgggcg 9780 tcgttctggg ctcatggatc tggattgaga gtgaatatga gactctaatt ggataccgag 9840 gggaatttat ggaacgtcag tggagcattt ttgacaagaa atatttgcta gctgatagtg 9900 accttaggcg acttttgaac gcgcaataat ggtttctgac gtatgtgctt agctcattaa 9960 actccagaaa cccgcggctg agtggctcct tcaatcgttg cggttctgtc agttccaaac 10020 gtaaaacggc ttgtcccgcg tcatcggcgg gggtcataac gtgactccct taattctccg 10080 ctcatgatcc ccgggtaccg agctcgaatt gcggctgagt ggctccttca atcgttgcgg 10140 ttctgtcagt tccaaacgta aaacggcttg tcccgcgtca tcggcggggg tcataacgtg 10200 actcccttaa ttctccgctc atgatcttga tcccctgcgc catcagatcc ttggcggcaa 10260 gaaagccatc cagtttactt tgcagggctt cccaacctta ccagagggcg ccccagctgg 10320 caattccggt tcgcttgctg tatcgatatg gtggatttat cacaaatggg acccgccgcc 10380 gacagaggtg tgatgttagg ccaggacttt gaaaatttgc gcaactatcg tatagtggcc 10440 gacaaattga cgccgagttg acagactgcc tagcatttga gtgaattatg tgaggtaatg 10500 ggctacactg aattggtagc tcaaactgtc agtatttatg tatatgagtg tatattttcg 10560 cataatctca gaccaatctg aagatgaaat gggtatctgg gaatggcgaa atcaaggcat 10620 cgatcgtgaa gtttctcatc taagccccca tttggacgtg aatgtagaca cgtcgaaata 10680 aagatttccg aattagaata atttgtttat tgctttcgcc tataaatacg acggatcgta 10740 atttgtcgtt ttatcaaaat gtactttcat tttataataa cgctgcggac atctacattt 10800 ttgaattgaa aaaaaattgg taattactct ttctttttct ccatattgac catcatactc 10860 attgctgatc catgtagatt tcccggacat gaagccattt acaattgaat atatcctgcc 10920 gccgctgccg ctttgcaccc ggtggagctt gcatgttggt ttctacgcag aactgagccg 10980 gttaggcaga taatttccat tgagaactga gccatgtgca ccttcccccc aacacggtga 11040 gcgacggggc aacggagtga tccacatggg acttttaaac atcatccgtc ggatggcgtt 11100 gcgagagaag cagtcgatcc gtgagatcag ccgacgcacc gggcaggcgc gcaacacgat 11160 cgcaaagtat ttgaacgcag gtacaatcga gccgacgttc accgtcaccc tggatgctgt 11220 aggcataggc ttggttatgc cggtactgcc gggcctcttg cgggatatcg tccattccga 11280 cagcatcgcc agtcactatg gcgtgctgct agcgctatat gcgttgatgc aatttctatg 11340 cgcacccgtt ctcggagcac tgtccgaccg ctttggccgc cgcccagtcc tgctcgcttc 11400 gctacttgga gccactatcg actacgcgat catggcgacc acacccgtcc tgtggtccaa 11460 cccctccgct gctatagtgc agtcggcttc tgacgttcag tgcagccgtc ttctgaaaac 11520 gacatgtcgc acaagtccta agttacgcga caggctgccg ccctgccctt ttcctggcgt 11580 tttcttgtcg cgtgttttag tcgcataaag tagaatactt gcgactagaa ccggagacat 11640 tacgccatga acaagagcgc cgccgctggc ctgctgggct atgcccgcgt cagcaccgac 11700 gaccaggact tgaccaacca acgggccgaa ctgcacgcgg ccggctgcac caagctgttt 11760 tccgagaaga tcaccggcac caggcgcgac cgcccggagc tggccaggat gcttgaccac 11820 ctacgccctg gcgacgttgt gacagtgacc aggctagacc gcctggcccg cagcacccgc 11880 gacctactgg acattgccga gcgcatccag gaggccggcg cgggcctgcg tagcctggca 11940 gagccgtggg ccgacaccac cacgccggcc ggccgcatgg tgttgaccgt gttcgccggc 12000 attgccgagt tcgagcgttc cctaatcatc gaccgcaccc ggagcgggcg cgaggccgcc 12060 aaggcccgag gcgtgaagtt tggcccccgc cctaccctca ccccggcaca gatcgcgcac 12120 gcccgcgagc tgatcgacca ggaaggccgc accgtgaaag aggcggctgc actgcttggc 12180 gtgcatcgct cgaccctgta ccgcgcactt gagcgcagcg aggaagtgac gcccaccgag 12240 gccaggcggc gcggtgcctt ccgtgaggac gcattgaccg aggccgacgc cctggcggcc 12300 gccgagaatg aacgccaaga ggaacaagca tgaaaccgca ccaggacggc caggacgaac 12360 cgtttttcat taccgaagag atcgaggcgg agatgatcgc ggccgggtac gtgttcgagc 12420 cgcccgcgca cgtctcaacc gtgcggctgc atgaaatcct ggccggtttg tctgatgcca 12480 agctggcggc ctggccggcc agcttggccg ctgaagaaac cgagcgccgc cgtctaaaaa 12540 ggtgatgtgt atttgagtaa aacagcttgc gtcatgcggt cgctgcgtat atgatgcgat 12600 gagtaaataa acaaatacgc aagggaacgc atgaagttat cgctgtactt aaccagaaag 12660 gcgggtcagg caagacgacc atcgcaaccc atctagcccg cgccctgcaa ctcgccgggg 12720 ccgatgttct gttagtcgat tccgatcccc agggcagtgc ccgcgattgg gcggccgtgc 12780 gggaagatca accgctaacc gttgtcggca tcgaccgccc gacgattgac cgcgacgtga 12840 aggccatcgg ccggcgcgac ttcgtagtga tcgacggagc gccccaggcg gcggacttgg 12900 ctgtgtccgc gatcaaggca gccgacttcg tgctgattcc ggtgcagcca agcccttacg 12960 acatatgggc caccgccgac ctggtggagc tggttaagca gcgcattgag gtcacggatg 13020 gaaggctaca agcggccttt gtcgtgtcgc gggcgatcaa aggcacgcgc atcggcggtg 13080 aggttgccga ggcgctggcc gggtacgagc tgcccattct tgagtcccgt atcacgcagc 13140 gcgtgagcta cccaggcact gccgccgccg gcacaaccgt tcttgaatca gaacccgagg 13200 gcgacgctgc ccgcgaggtc caggcgctgg ccgctgaaat taaatcaaaa ctcatttgag 13260 ttaatgaggt aaagagaaaa tgagcaaaag cacaaacacg ctaagtgccg gccgtccgag 13320 cgcacgcagc agcaaggctg caacgttggc cagcctggca gacacgccag ccatgaagcg 13380 ggtcaacttt cagttgccgg cggaggatca caccaagctg aagatgtacg cggtacgcca 13440 aggcaagacc attaccgagc tgctatctga atacatcgcg cagctaccag agtaaatgag 13500 caaatgaata aatgagtaga tgaattttag cggctaaagg aggcggcatg gaaaatcaag 13560 aacaaccagg caccgacgcc gtggaatgcc ccatgtgtgg aggaacgggc ggttggccag 13620 gcgtaagcgg ctgggttgtc tgccggccct gcaatggcac tggaaccccc aagcccgagg 13680 aatcggcgtg agcggtcgca aaccatccgg cccggtacaa atcggcgcgg cgctgggtga 13740 tgacctggtg gagaagttga aggccgcgca ggccgcccag cggcaacgca tcgaggcaga 13800 agcacgcccc ggtgaatcgt ggcaagcggc cgctgatcga atccgcaaag aatcccggca 13860 accgccggca gccggtgcgc cgtcgattag gaagccgccc aagggcgacg agcaaccaga 13920 ttttttcgtt ccgatgctct atgacgtggg cacccgcgat agtcgcagca tcatggacgt 13980 ggccgttttc cgtctgtcga agcgtgaccg acgagctggc gaggtgatcc gctacgagct 14040 tccagacggg cacgtagagg tttccgcagg gccggccggc atggccagtg tgtgggatta 14100 cgacctggta ctgatggcgg tttcccatct aaccgaatcc atgaaccgat accgggaagg 14160 gaagggagac aagcccggcc gcgtgttccg tccacacgtt gcggacgtac tcaagttctg 14220 ccggcgagcc gatggcggaa agcagaaaga cgacctggta gaaacctgca ttcggttaaa 14280 caccacgcac gttgccatgc agcgtacgaa gaaggccaag aacggccgcc tggtgacggt 14340 atccgagggt gaagccttga ttagccgcta caagatcgta aagagcgaaa ccgggcggcc 14400 ggagtacatc gagatcgagc tagctgattg gatgtaccgc gagatcacag aaggcaagaa 14460 cccggacgtg ctgacggttc accccgatta ctttttgatc gatcccggca tcggccgttt 14520 tctctaccgc ctggcacgcc gcgccgcagg caaggcagaa gccagatggt tgttcaagac 14580 gatctacgaa cgcagtggca gcgccggaga gttcaagaag ttctgtttca ccgtgcgcaa 14640 gctgatcggg tcaaatgacc tgccggagta cgatttgaag gaggaggcgg ggcaggctgg 14700 cccgatccta gtcatgcgct accgcaacct gatcgagggc gaagcatccg ccggttccta 14760 atgtacggag cagatgctag ggcaaattgc cctagcaggg gaaaaaggtc gaaaaggtct 14820 ctttcctgtg gatagcacgt acattgggaa cccaaagccg tacattggga accggaaccc 14880 gtacattggg aacccaaagc cgtacattgg gaaccggtca cacatgtaag tgactgatat 14940 aaaagagaaa aaaggcgatt tttccgccta aaactcttta aaacttatta aaactcttaa 15000 aacccgcctg gcctgtgcat aactgtctgg ccagcgcaca gccgaagagc tgcaaaaagc 15060 gcctaccctt cggtcgctgc gctccctacg ccccgccgct tcgcgtcggc ctatcgcggc 15120 cgctggccgc tcaaaaatgg ctggcctacg gccaggcaat ctaccagggc gcggacaagc 15180 cgcgccgtcg ccactcgacc gccggcgccc acatcaaggc accctgcctc gcgcgtttcg 15240 gtgatgacgg tgaaaacctc tgacacatgc agctcccgga gacggtcaca gcttgtctgt 15300 aagcggatgc cgggagcaga caagcccgtc agggcgcgtc agcgggtgtt ggcgggtgtc 15360 ggggcgcagc catgacccag tcacgtagcg atagcggagt gtatactggc ttaactatgc 15420 ggcatcagag cagattgtac tgagagtgca ccatatgcgg tgtgaaatac cgcacagatg 15480 cgtaaggaga aaataccgca tcaggcgctc ttccgcttcc tcgctcactg actcgctgcg 15540 ctcggtcgtt cggctgcggc gagcggtatc agctcactca aaggcggtaa tacggttatc 15600 cacagaatca ggggataacg caggaaagaa catgtgagca aaaggccagc aaaaggccag 15660 gaaccgtaaa aaggccgcgt tgctggcgtt tttccatagg ctccgccccc ctgacgagca 15720 tcacaaaaat cgacgctcaa gtcagaggtg gcgaaacccg acaggactat aaagatacca 15780 ggcgtttccc cctggaagct ccctcgtgcg ctctcctgtt ccgaccctgc cgcttaccgg 15840 atacctgtcc gcctttctcc cttcgggaag cgtggcgctt tctcatagct cacgctgtag 15900 gtatctcagt tcggtgtagg tcgttcgctc caagctgggc tgtgtgcacg aaccccccgt 15960 tcagcccgac cgctgcgcct tatccggtaa ctatcgtctt gagtccaacc cggtaagaca 16020 cgacttatcg ccactggcag cagccactgg taacaggatt agcagagcga ggtatgtagg 16080 cggtgctaca gagttcttga agtggtggcc taactacggc tacactagaa ggacagtatt 16140 tggtatctgc gctctgctga agccagttac cttcggaaaa agagttggta gctcttgatc 16200 cggcaaacaa accaccgctg gtagcggtgg tttttttgtt tgcaagcagc agattacgcg 16260 cagaaaaaaa ggatctcaag aagatccttt gatcttttct acggggtctg acgctcagtg 16320 gaacgaaaac tcacgttaag ggattttggt catgagatta tcaaaaagga tcttcaccta 16380 gatcctttta aattaaaaat gaagttttaa atcaatctaa agtatatatg agtaaacttg 16440 gtctgacagt taccaatgct taatcagtga ggcacctatc tcagcgatct gtctatttcg 16500 ttcatccata gttgcctgac tccccgtcgt gtagataact acgatacggg agggcttacc 16560 atctggcccc agtgctgcaa tgataccgcg agacccacgc tcaccggctc cagatttatc 16620 agcaataaac cagccagccg gaagggccga gcgcagaagt ggtcctgcaa ctttatccgc 16680 ctccatccag tctattaatt gttgccggga agctagagta agtagttcgc cagttaatag 16740 tttgcgcaac gttgttgcca ttgctacagg catcgtggtg tcacgctcgt cgtttggtat 16800 ggcttcattc agctccggtt cccaacgatc aaggcgagtt acatgatccc ccatgttgtg 16860 caaaaaagcg gttagctcct tcggtcctcc gatcgttgtc agaagtaagt tggccgcagt 16920 gttatcactc atggttatgg cagcactgca taattctctt actgtcatgc catccgtaag 16980 atgcttttct gtgactggtg agtactcaac caagtcattc tgagaatagt gtatgcggcg 17040 accgagttgc tcttgcccgg cgtcaacacg ggataatacc gcgccacata gcagaacttt 17100 aaaagtgctc atcattggaa aagacctgca gggggggggg ggaaagccac gttgtgtctc 17160 aaaatctctg atgttacatt gcacaagata aaaatatatc atcatgaaca ataaaactgt 17220 ctgcttacat aaacagtaat acaaggggtg ttatgagcca tattcaacgg gaaacgtctt 17280 gctcgaggcc gcgattaaat tccaacatgg atgctgattt atatgggtat aaatgggctc 17340 gcgataatgt cgggcaatca ggtgcgacaa tctatcgatt gtatgggaag cccgatgcgc 17400 cagagttgtt tctgaaacat ggcaaaggta gcgttgccaa tgatgttaca gatgagatgg 17460 tcagactaaa ctggctgacg gaatttatgc ctcttccgac catcaagcat tttatccgta 17520 ctcctgatga tgcatggtta ctcaccactg cgatccccgg gaaaacagca ttccaggtat 17580 tagaagaata tcctgattca ggtgaaaata ttgttgatgc gctggcagtg ttcctgcgcc 17640 ggttgcattc gattcctgtt tgtaattgtc cttttaacag cgatcgcgta tttcgtctcg 17700 ctcaggcgca atcacgaatg aataacggtt tggttgatgc gagtgatttt gatgacgagc 17760 gtaatggctg gcctgttgaa caagtctgga aagaaatgca taagcttttg ccattctcac 17820 cggattcagt cgtcactcat ggtgatttct cacttgataa ccttattttt gacgagggga 17880 aattaatagg ttgtattgat gttggacgag tcggaatcgc agaccgatac caggatcttg 17940 ccatcctatg gaactgcctc ggtgagtttt ctccttcatt acagaaacgg ctttttcaaa 18000 aatatggtat tgataatcct gatatgaata aattgcagtt tcatttgatg ctcgatgagt 18060 ttttctaatc agaattggtt aattggttgt aacactggca gagcattacg ctgacttgac 18120 gggacggcgg ctttgttgaa taaatcgaac ttttgctgag ttgaaggatc agatcacgca 18180 tcttcccgac aacgcagacc gttccgtggc aaagcaaaag ttcaaaatca ccaactggtc 18240 cacctacaac aaagctctca tcaaccgtgg ctccctcact ttctggctgg atgatggggc 18300 gattcaggcc tggtatgagt cagcaacacc ttcttcacga ggcagacctc agcgcccccc 18360 cccccctgca ggtcaattcg gtcgatatgg ctattacgaa gaaggctcgt gcgcggagtc 18420 ccgtgaactt tcccacgcaa caagtgaacc gcaccgggtt tgccggaggc catttcgtta 18480 aaatgcgcag c 18491 <210> SEQ ID NO 2 <211> LENGTH: 4291 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: pDONRZeo construct <400> SEQUENCE: 2 ctttcctgcg ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga 60 taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga 120 gcgcccaata cgcaaaccgc ctctccccgc gcgttggccg attcattaat gcagctggca 180 cgacaggttt cccgactgga aagcgggcag tgagcgcaac gcaattaata cgcgtaccgc 240 tagccaggaa gagtttgtag aaacgcaaaa aggccatccg tcaggatggc cttctgctta 300 gtttgatgcc tggcagttta tggcgggcgt cctgcccgcc accctccggg ccgttgcttc 360 acaacgttca aatccgctcc cggcggattt gtcctactca ggagagcgtt caccgacaaa 420 caacagataa aacgaaaggc ccagtcttcc gactgagcct ttcgttttat ttgatgcctg 480 gcagttccct actctcgcgt taacgctagc atggatgttt tcccagtcac gacgttgtaa 540 aacgacggcc agtcttaagc tcgggcccca aataatgatt ttattttgac tgatagtgac 600 ctgttcgttg caacacattg atgagcaatg cttttttata atgccaactt tgtacaaaaa 660 agctgaacga gaaacgtaaa atgatataaa tatcaatata ttaaattaga ttttgcataa 720 aaaacagact acataatact gtaaaacaca acatatccag tcactatgaa tcaactactt 780 agatggtatt agtgacctgt agtcgaccga cagccttcca aatgttcttc gggtgatgct 840 gccaacttag tcgaccgaca gccttccaaa tgttcttctc aaacggaatc gtcgtatcca 900 gcctactcgc tattgtcctc aatgccgtat taaatcataa aaagaaataa gaaaaagagg 960 tgcgagcctc ttttttgtgt gacaaaataa aaacatctac ctattcatat acgctagtgt 1020 catagtcctg aaaatcatct gcatcaagaa caatttcaca actcttatac ttttctctta 1080 caagtcgttc ggcttcatct ggattttcag cctctatact tactaaacgt gataaagttt 1140 ctgtaatttc tactgtatcg acctgcagac tggctgtgta taagggagcc tgacatttat 1200 attccccaga acatcaggtt aatggcgttt ttgatgtcat tttcgcggtg gctgagatca 1260 gccacttctt ccccgataac ggagaccggc acactggcca tatcggtggt catcatgcgc 1320 cagctttcat ccccgatatg caccaccggg taaagttcac gggagacttt atctgacagc 1380 agacgtgcac tggccagggg gatcaccatc cgtcgcccgg gcgtgtcaat aatatcactc 1440 tgtacatcca caaacagacg ataacggctc tctcttttat aggtgtaaac cttaaactgc 1500 atttcaccag cccctgttct cgtcagcaaa agagccgttc atttcaataa accgggcgac 1560 ctcagccatc ccttcctgat tttccgcttt ccagcgttcg gcacgcagac gacgggcttc 1620 attctgcatg gttgtgctta ccagaccgga gatattgaca tcatatatgc cttgagcaac 1680 tgatagctgt cgctgtcaac tgtcactgta atacgctgct tcatagcata cctctttttg 1740 acatacttcg ggtatacata tcagtatata ttcttatacc gcaaaaatca gcgcgcaaat 1800 acgcatactg ttatctggct tttagtaagc cggatccacg cggcgtttac gccccgccct 1860 gccactcatc gcagtactgt tgtaattcat taagcattct gccgacatgg aagccatcac 1920 agacggcatg atgaacctga atcgccagcg gcatcagcac cttgtcgcct tgcgtataat 1980 atttgcccat ggtgaaaacg ggggcgaaga agttgtccat attggccacg tttaaatcaa 2040 aactggtgaa actcacccag ggattggctg agacgaaaaa catattctca ataaaccctt 2100 tagggaaata ggccaggttt tcaccgtaac acgccacatc ttgcgaatat atgtgtagaa 2160 actgccggaa atcgtcgtgg tattcactcc agagcgatga aaacgtttca gtttgctcat 2220 ggaaaacggt gtaacaaggg tgaacactat cccatatcac cagctcaccg tctttcattg 2280 ccatacggaa ttccggatga gcattcatca ggcgggcaag aatgtgaata aaggccggat 2340 aaaacttgtg cttatttttc tttacggtct ttaaaaaggc cgtaatatcc agctgaacgg 2400 tctggttata ggtacattga gcaactgact gaaatgcctc aaaatgttct ttacgatgcc 2460 attgggatat atcaacggtg gtatatccag tgattttttt ctccatttta gcttccttag 2520 ctcctgaaaa tctcgataac tcaaaaaata cgcccggtag tgatcttatt tcattatggt 2580 gaaagttgga acctcttacg tgccgatcaa cgtctcattt tcgccaaaag ttggcccagg 2640 gcttcccggt atcaacaggg acaccaggat ttatttattc tgcgaagtga tcttccgtca 2700 caggtattta ttcggcgcaa agtgcgtcgg gtgatgctgc caacttagtc gactacaggt 2760 cactaatacc atctaagtag ttgattcata gtgactggat atgttgtgtt ttacagtatt 2820 atgtagtctg ttttttatgc aaaatctaat ttaatatatt gatatttata tcattttacg 2880 tttctcgttc agctttcttg tacaaagttg gcattataag aaagcattgc ttatcaattt 2940 gttgcaacga acaggtcact atcagtcaaa ataaaatcat tatttgccat ccagctgata 3000 tcccctatag tgagtcgtat tacatggtca tagctgtttc ctggcagctc tggcccgtgt 3060 ctcaaaatct ctgatgttac attgcacaag ataaaataat atcatcatga tcagtcctgc 3120 tcctcggcca cgaagtgcac gcagttgccg gccgggtcgc gcagggcgaa ctcccgcccc 3180 cacggctgct cgccgatctc ggtcatggcc ggcccggagg cgtcccggaa gttcgtggac 3240 acgacctccg accactcggc gtacagctcg tccaggccgc gcacccacac ccaggccagg 3300 gtgttgtccg gcaccacctg gtcctggacc gcgctgatga acagggtcac gtcgtcccgg 3360 accacaccgg cgaagtcgtc ctccacgaag tcccgggaga acccgagccg gtcggtccag 3420 aactcgaccg ctccggcgac gtcgcgcgcg gtgagcaccg gaacggcact ggtcaacttg 3480 gccatggttt agttcctcac cttgtcgtat tatactatgc cgatatacta tgccgatgat 3540 taattgtcaa cacgtgctga tcatgaccaa aatcccttaa cgtgagttac gcgtcgttcc 3600 actgagcgtc agaccccgta gaaaagatca aaggatcttc ttgagatcct ttttttctgc 3660 gcgtaatctg ctgcttgcaa acaaaaaaac caccgctacc agcggtggtt tgtttgccgg 3720 atcaagagct accaactctt tttccgaagg taactggctt cagcagagcg cagataccaa 3780 atactgttct tctagtgtag ccgtagttag gccaccactt caagaactct gtagcaccgc 3840 ctacatacct cgctctgcta atcctgttac cagtggctgc tgccagtggc gataagtcgt 3900 gtcttaccgg gttggactca agacgatagt taccggataa ggcgcagcgg tcgggctgaa 3960 cggggggttc gtgcacacag cccagcttgg agcgaacgac ctacaccgaa ctgagatacc 4020 tacagcgtga gctatgagaa agcgccacgc ttcccgaagg gagaaaggcg gacaggtatc 4080 cggtaagcgg cagggtcgga acaggagagc gcacgaggga gcttccaggg ggaaacgcct 4140 ggtatcttta tagtcctgtc gggtttcgcc acctctgact tgagcgtcga tttttgtgat 4200 gctcgtcagg ggggcggagc ctatggaaaa acgccagcaa cgcggccttt ttacggttcc 4260 tggccttttg ctggcctttt gctcacatgt t 4291 <210> SEQ ID NO 3 <211> LENGTH: 4762 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: pDONR221 <400> SEQUENCE: 3 ctttcctgcg ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga 60 taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga 120 gcgcccaata cgcaaaccgc ctctccccgc gcgttggccg attcattaat gcagctggca 180 cgacaggttt cccgactgga aagcgggcag tgagcgcaac gcaattaata cgcgtaccgc 240 tagccaggaa gagtttgtag aaacgcaaaa aggccatccg tcaggatggc cttctgctta 300 gtttgatgcc tggcagttta tggcgggcgt cctgcccgcc accctccggg ccgttgcttc 360 acaacgttca aatccgctcc cggcggattt gtcctactca ggagagcgtt caccgacaaa 420 caacagataa aacgaaaggc ccagtcttcc gactgagcct ttcgttttat ttgatgcctg 480 gcagttccct actctcgcgt taacgctagc atggatgttt tcccagtcac gacgttgtaa 540 aacgacggcc agtcttaagc tcgggcccca aataatgatt ttattttgac tgatagtgac 600 ctgttcgttg caacacattg atgagcaatg cttttttata atgccaactt tgtacaaaaa 660 agctgaacga gaaacgtaaa atgatataaa tatcaatata ttaaattaga ttttgcataa 720 aaaacagact acataatact gtaaaacaca acatatccag tcactatgaa tcaactactt 780 agatggtatt agtgacctgt agtcgaccga cagccttcca aatgttcttc gggtgatgct 840 gccaacttag tcgaccgaca gccttccaaa tgttcttctc aaacggaatc gtcgtatcca 900 gcctactcgc tattgtcctc aatgccgtat taaatcataa aaagaaataa gaaaaagagg 960 tgcgagcctc ttttttgtgt gacaaaataa aaacatctac ctattcatat acgctagtgt 1020 catagtcctg aaaatcatct gcatcaagaa caatttcaca actcttatac ttttctctta 1080 caagtcgttc ggcttcatct ggattttcag cctctatact tactaaacgt gataaagttt 1140 ctgtaatttc tactgtatcg acctgcagac tggctgtgta taagggagcc tgacatttat 1200 attccccaga acatcaggtt aatggcgttt ttgatgtcat tttcgcggtg gctgagatca 1260 gccacttctt ccccgataac ggagaccggc acactggcca tatcggtggt catcatgcgc 1320 cagctttcat ccccgatatg caccaccggg taaagttcac gggagacttt atctgacagc 1380 agacgtgcac tggccagggg gatcaccatc cgtcgcccgg gcgtgtcaat aatatcactc 1440 tgtacatcca caaacagacg ataacggctc tctcttttat aggtgtaaac cttaaactgc 1500 atttcaccag cccctgttct cgtcagcaaa agagccgttc atttcaataa accgggcgac 1560 ctcagccatc ccttcctgat tttccgcttt ccagcgttcg gcacgcagac gacgggcttc 1620 attctgcatg gttgtgctta ccagaccgga gatattgaca tcatatatgc cttgagcaac 1680 tgatagctgt cgctgtcaac tgtcactgta atacgctgct tcatagcata cctctttttg 1740 acatacttcg ggtatacata tcagtatata ttcttatacc gcaaaaatca gcgcgcaaat 1800 acgcatactg ttatctggct tttagtaagc cggatccacg cggcgtttac gccccgccct 1860 gccactcatc gcagtactgt tgtaattcat taagcattct gccgacatgg aagccatcac 1920 agacggcatg atgaacctga atcgccagcg gcatcagcac cttgtcgcct tgcgtataat 1980 atttgcccat ggtgaaaacg ggggcgaaga agttgtccat attggccacg tttaaatcaa 2040 aactggtgaa actcacccag ggattggctg agacgaaaaa catattctca ataaaccctt 2100 tagggaaata ggccaggttt tcaccgtaac acgccacatc ttgcgaatat atgtgtagaa 2160 actgccggaa atcgtcgtgg tattcactcc agagcgatga aaacgtttca gtttgctcat 2220 ggaaaacggt gtaacaaggg tgaacactat cccatatcac cagctcaccg tctttcattg 2280 ccatacggaa ttccggatga gcattcatca ggcgggcaag aatgtgaata aaggccggat 2340 aaaacttgtg cttatttttc tttacggtct ttaaaaaggc cgtaatatcc agctgaacgg 2400 tctggttata ggtacattga gcaactgact gaaatgcctc aaaatgttct ttacgatgcc 2460 attgggatat atcaacggtg gtatatccag tgattttttt ctccatttta gcttccttag 2520 ctcctgaaaa tctcgataac tcaaaaaata cgcccggtag tgatcttatt tcattatggt 2580 gaaagttgga acctcttacg tgccgatcaa cgtctcattt tcgccaaaag ttggcccagg 2640 gcttcccggt atcaacaggg acaccaggat ttatttattc tgcgaagtga tcttccgtca 2700 caggtattta ttcggcgcaa agtgcgtcgg gtgatgctgc caacttagtc gactacaggt 2760 cactaatacc atctaagtag ttgattcata gtgactggat atgttgtgtt ttacagtatt 2820 atgtagtctg ttttttatgc aaaatctaat ttaatatatt gatatttata tcattttacg 2880 tttctcgttc agctttcttg tacaaagttg gcattataag aaagcattgc ttatcaattt 2940 gttgcaacga acaggtcact atcagtcaaa ataaaatcat tatttgccat ccagctgata 3000 tcccctatag tgagtcgtat tacatggtca tagctgtttc ctggcagctc tggcccgtgt 3060 ctcaaaatct ctgatgttac attgcacaag ataaaataat atcatcatga acaataaaac 3120 tgtctgctta cataaacagt aatacaaggg gtgttatgag ccatattcaa cgggaaacgt 3180 cgaggccgcg attaaattcc aacatggatg ctgatttata tgggtataaa tgggctcgcg 3240 ataatgtcgg gcaatcaggt gcgacaatct atcgcttgta tgggaagccc gatgcgccag 3300 agttgtttct gaaacatggc aaaggtagcg ttgccaatga tgttacagat gagatggtca 3360 gactaaactg gctgacggaa tttatgcctc ttccgaccat caagcatttt atccgtactc 3420 ctgatgatgc atggttactc accactgcga tccccggaaa aacagcattc caggtattag 3480 aagaatatcc tgattcaggt gaaaatattg ttgatgcgct ggcagtgttc ctgcgccggt 3540 tgcattcgat tcctgtttgt aattgtcctt ttaacagcga tcgcgtattt cgtctcgctc 3600 aggcgcaatc acgaatgaat aacggtttgg ttgatgcgag tgattttgat gacgagcgta 3660 atggctggcc tgttgaacaa gtctggaaag aaatgcataa acttttgcca ttctcaccgg 3720 attcagtcgt cactcatggt gatttctcac ttgataacct tatttttgac gaggggaaat 3780 taataggttg tattgatgtt ggacgagtcg gaatcgcaga ccgataccag gatcttgcca 3840 tcctatggaa ctgcctcggt gagttttctc cttcattaca gaaacggctt tttcaaaaat 3900 atggtattga taatcctgat atgaataaat tgcagtttca tttgatgctc gatgagtttt 3960 tctaatcaga attggttaat tggttgtaac actggcagag cattacgctg acttgacggg 4020 acggcgcaag ctcatgacca aaatccctta acgtgagtta cgcgtcgttc cactgagcgt 4080 cagaccccgt agaaaagatc aaaggatctt cttgagatcc tttttttctg cgcgtaatct 4140 gctgcttgca aacaaaaaaa ccaccgctac cagcggtggt ttgtttgccg gatcaagagc 4200 taccaactct ttttccgaag gtaactggct tcagcagagc gcagatacca aatactgttc 4260 ttctagtgta gccgtagtta ggccaccact tcaagaactc tgtagcaccg cctacatacc 4320 tcgctctgct aatcctgtta ccagtggctg ctgccagtgg cgataagtcg tgtcttaccg 4380 ggttggactc aagacgatag ttaccggata aggcgcagcg gtcgggctga acggggggtt 4440 cgtgcacaca gcccagcttg gagcgaacga cctacaccga actgagatac ctacagcgtg 4500 agctatgaga aagcgccacg cttcccgaag ggagaaaggc ggacaggtat ccggtaagcg 4560 gcagggtcgg aacaggagag cgcacgaggg agcttccagg gggaaacgcc tggtatcttt 4620 atagtcctgt cgggtttcgc cacctctgac ttgagcgtcg atttttgtga tgctcgtcag 4680 gggggcggag cctatggaaa aacgccagca acgcggcctt tttacggttc ctggcctttt 4740 gctggccttt tgctcacatg tt 4762 <210> SEQ ID NO 4 <211> LENGTH: 16843 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: pBC-yellow construct <400> SEQUENCE: 4 ccgggctggt tgccctcgcc gctgggctgg cggccgtcta tggccctgca aacgcgccag 60 aaacgccgtc gaagccgtgt gcgagacacc gcggccgccg gcgttgtgga tacctcgcgg 120 aaaacttggc cctcactgac agatgagggg cggacgttga cacttgaggg gccgactcac 180 ccggcgcggc gttgacagat gaggggcagg ctcgatttcg gccggcgacg tggagctggc 240 cagcctcgca aatcggcgaa aacgcctgat tttacgcgag tttcccacag atgatgtgga 300 caagcctggg gataagtgcc ctgcggtatt gacacttgag gggcgcgact actgacagat 360 gaggggcgcg atccttgaca cttgaggggc agagtgctga cagatgaggg gcgcacctat 420 tgacatttga ggggctgtcc acaggcagaa aatccagcat ttgcaagggt ttccgcccgt 480 ttttcggcca ccgctaacct gtcttttaac ctgcttttaa accaatattt ataaaccttg 540 tttttaacca gggctgcgcc ctgtgcgcgt gaccgcgcac gccgaagggg ggtgcccccc 600 cttctcgaac cctcccggcc cgctaacgcg ggcctcccat ccccccaggg gctgcgcccc 660 tcggccgcga acggcctcac cccaaaaatg gcagcgctgg cagtccttgc cattgccggg 720 atcggggcag taacgggatg ggcgatcagc ccgagcgcga cgcccggaag cattgacgtg 780 ccgcaggtgc tggcatcgac attcagcgac caggtgccgg gcagtgaggg cggcggcctg 840 ggtggcggcc tgcccttcac ttcggccgtc ggggcattca cggacttcat ggcggggccg 900 gcaattttta ccttgggcat tcttggcata gtggtcgcgg gtgccgtgct cgtgttcggg 960 ggtgcgataa acccagcgaa ccatttgagg tgataggtaa gattataccg aggtatgaaa 1020 acgagaattg gacctttaca gaattactct atgaagcgcc atatttaaaa agctaccaag 1080 acgaagagga tgaagaggat gaggaggcag attgccttga atatattgac aatactgata 1140 agataatata tcttttatat agaagatatc gccgtatgta aggatttcag ggggcaaggc 1200 ataggcagcg cgcttatcaa tatatctata gaatgggcaa agcataaaaa cttgcatgga 1260 ctaatgcttg aaacccagga caataacctt atagcttgta aattctatca taattgggta 1320 atgactccaa cttattgata gtgttttatg ttcagataat gcccgatgac tttgtcatgc 1380 agctccaccg attttgagaa cgacagcgac ttccgtccca gccgtgccag gtgctgcctc 1440 agattcaggt tatgccgctc aattcgctgc gtatatcgct tgctgattac gtgcagcttt 1500 cccttcaggc gggattcata cagcggccag ccatccgtca tccatatcac cacgtcaaag 1560 ggtgacagca ggctcataag acgccccagc gtcgccatag tgcgttcacc gaatacgtgc 1620 gcaacaaccg tcttccggag actgtcatac gcgtaaaaca gccagcgctg gcgcgattta 1680 gccccgacat agccccactg ttcgtccatt tccgcgcaga cgatgacgtc actgcccggc 1740 tgtatgcgcg aggttaccga ctgcggcctg agttttttaa gtgacgtaaa atcgtgttga 1800 ggccaacgcc cataatgcgg gctgttgccc ggcatccaac gccattcatg gccatatcaa 1860 tgattttctg gtgcgtaccg ggttgagaag cggtgtaagt gaactgcagt tgccatgttt 1920 tacggcagtg agagcagaga tagcgctgat gtccggcggt gcttttgccg ttacgcacca 1980 ccccgtcagt agctgaacag gagggacagc tgatagacac agaagccact ggagcacctc 2040 aaaaacacca tcatacacta aatcagtaag ttggcagcat cacccataat tgtggtttca 2100 aaatcggctc cgtcgatact atgttatacg ccaactttga aaacaacttt gaaaaagctg 2160 ttttctggta tttaaggttt tagaatgcaa ggaacagtga attggagttc gtcttgttat 2220 aattagcttc ttggggtatc tttaaatact gtagaaaaga ggaaggaaat aataaatggc 2280 taaaatgaga atatcaccgg aattgaaaaa actgatcgaa aaataccgct gcgtaaaaga 2340 tacggaagga atgtctcctg ctaaggtata taagctggtg ggagaaaatg aaaacctata 2400 tttaaaaatg acggacagcc ggtataaagg gaccacctat gatgtggaac gggaaaagga 2460 catgatgcta tggctggaag gaaagctgcc tgttccaaag gtcctgcact ttgaacggca 2520 tgatggctgg agcaatctgc tcatgagtga ggccgatggc gtcctttgct cggaagagta 2580 tgaagatgaa caaagccctg aaaagattat cgagctgtat gcggagtgca tcaggctctt 2640 tcactccatc gacatatcgg attgtcccta tacgaatagc ttagacagcc gcttagccga 2700 attggattac ttactgaata acgatctggc cgatgtggat tgcgaaaact gggaagaaga 2760 cactccattt aaagatccgc gcgagctgta tgatttttta aagacggaaa agcccgaaga 2820 ggaacttgtc ttttcccacg gcgacctggg agacagcaac atctttgtga aagatggcaa 2880 agtaagtggc tttattgatc ttgggagaag cggcagggcg gacaagtggt atgacattgc 2940 cttctgcgtc cggtcgatca gggaggatat cggggaagaa cagtatgtcg agctattttt 3000 tgacttactg gggatcaagc ctgattggga gaaaataaaa tattatattt tactggatga 3060 attgttttag tacctagatg tggcgcaacg atgccggcga caagcaggag cgcaccgact 3120 tcttccgcat caagtgtttt ggctctcagg ccgaggccca cggcaagtat ttgggcaagg 3180 ggtcgctggt attcgtgcag ggcaagattc ggaataccaa gtacgagaag gacggccaga 3240 cggtctacgg gaccgacttc attgccgata aggtggatta tctggacacc aaggcaccag 3300 gcgggtcaaa tcaggaataa gggcacattg ccccggcgtg agtcggggca atcccgcaag 3360 gagggtgaat gaatcggacg tttgaccgga aggcatacag gcaagaactg atcgacgcgg 3420 ggttttccgc cgaggatgcc gaaaccatcg caagccgcac cgtcatgcgt gcgccccgcg 3480 aaaccttcca gtccgtcggc tcgatggtcc agcaagctac ggccaagatc gagcgcgaca 3540 gcgtgcaact ggctccccct gccctgcccg cgccatcggc cgccgtggag cgttcgcgtc 3600 gtctcgaaca ggaggcggca ggtttggcga agtcgatgac catcgacacg cgaggaacta 3660 tgacgaccaa gaagcgaaaa accgccggcg aggacctggc aaaacaggtc agcgaggcca 3720 agcaggccgc gttgctgaaa cacacgaagc agcagatcaa ggaaatgcag ctttccttgt 3780 tcgatattgc gccgtggccg gacacgatgc gagcgatgcc aaacgacacg gcccgctctg 3840 ccctgttcac cacgcgcaac aagaaaatcc cgcgcgaggc gctgcaaaac aaggtcattt 3900 tccacgtcaa caaggacgtg aagatcacct acaccggcgt cgagctgcgg gccgacgatg 3960 acgaactggt gtggcagcag gtgttggagt acgcgaagcg cacccctatc ggcgagccga 4020 tcaccttcac gttctacgag ctttgccagg acctgggctg gtcgatcaat ggccggtatt 4080 acacgaaggc cgaggaatgc ctgtcgcgcc tacaggcgac ggcgatgggc ttcacgtccg 4140 accgcgttgg gcacctggaa tcggtgtcgc tgctgcaccg cttccgcgtc ctggaccgtg 4200 gcaagaaaac gtcccgttgc caggtcctga tcgacgagga aatcgtcgtg ctgtttgctg 4260 gcgaccacta cacgaaattc atatgggaga agtaccgcaa gctgtcgccg acggcccgac 4320 ggatgttcga ctatttcagc tcgcaccggg agccgtaccc gctcaagctg gaaaccttcc 4380 gcctcatgtg cggatcggat tccacccgcg tgaagaagtg gcgcgagcag gtcggcgaag 4440 cctgcgaaga gttgcgaggc agcggcctgg tggaacacgc ctgggtcaat gatgacctgg 4500 tgcattgcaa acgctagggc cttgtggggt cagttccggc tgggggttca gcagccagcg 4560 ctttactggc atttcaggaa caagcgggca ctgctcgacg cacttgcttc gctcagtatc 4620 gctcgggacg cacggcgcgc tctacgaact gccgataaac agaggattaa aattgacaat 4680 tgtgattaag gctcagattc gacggcttgg agcggccgac gtgcaggatt tccgcgagat 4740 ccgattgtcg gccctgaaga aagctccaga gatgttcggg tccgtttacg agcacgagga 4800 gaaaaagccc atggaggcgt tcgctgaacg gttgcgagat gccgtggcat tcggcgccta 4860 catcgacggc gagatcattg ggctgtcggt cttcaaacag gaggacggcc ccaaggacgc 4920 tcacaaggcg catctgtccg gcgttttcgt ggagcccgaa cagcgaggcc gaggggtcgc 4980 cggtatgctg ctgcgggcgt tgccggcggg tttattgctc gtgatgatcg tccgacagat 5040 tccaacggga atctggtgga tgcgcatctt catcctcggc gcacttaata tttcgctatt 5100 ctggagcttg ttgtttattt cggtctaccg cctgccgggc ggggtcgcgg cgacggtagg 5160 cgctgtgcag ccgctgatgg tcgtgttcat ctctgccgct ctgctaggta gcccgatacg 5220 attgatggcg gtcctggggg ctatttgcgg aactgcgggc gtggcgctgt tggtgttgac 5280 accaaacgca gcgctagatc ctgtcggcgt cgcagcgggc ctggcggggg cggtttccat 5340 ggcgttcgga accgtgctga cccgcaagtg gcaacctccc gtgcctctgc tcacctttac 5400 cgcctggcaa ctggcggccg gaggacttct gctcgttcca gtagctttag tgtttgatcc 5460 gccaatcccg atgcctacag gaaccaatgt tctcggcctg gcgtggctcg gcctgatcgg 5520 agcgggttta acctacttcc tttggttccg ggggatctcg cgactcgaac ctacagttgt 5580 ttccttactg ggctttctca gccccagatc tggggtcgat cagccgggga tgcatcaggc 5640 cgacagtcgg aacttcgggt ccccgacctg taccattcgg tgagcaatgg ataggggagt 5700 tgatatcgtc aacgttcact tctaaagaaa tagcgccact cagcttcctc agcggcttta 5760 tccagcgatt tcctattatg tcggcatagt tctcaagatc gacagcctgt cacggttaag 5820 cgagaaatga ataagaaggc tgataattcg gatctctgcg agggagatga tatttgatca 5880 caggcagcaa cgctctgtca tcgttacaat caacatgcta ccctccgcga gatcatccgt 5940 gtttcaaacc cggcagctta gttgccgttc ttccgaatag catcggtaac atgagcaaag 6000 tctgccgcct tacaacggct ctcccgctga cgccgtcccg gactgatggg ctgcctgtat 6060 cgagtggtga ttttgtgccg agctgccggt cggggagctg ttggctggct ggtggcagga 6120 tatattgtgg tgtaaacaaa ttgacgctta gacaacttaa taacacattg cggacgtttt 6180 taatgtactg gggtggtttt tcttttcacc agtgagacgg gcaacagctg attgcccttc 6240 accgcctggc cctgagagag ttgcagcaag cggtccacgc tggtttgccc cagcaggcga 6300 aaatcctgtt tgatggtggt tccgaaatcg gcaaaatccc ttataaatca aaagaatagc 6360 ccgagatagg gttgagtgtt gttccagttt ggaacaagag tccactatta aagaacgtgg 6420 actccaacgt caaagggcga aaaaccgtct atcagggcga tggcccacta cctgtatggc 6480 cgcattcgca aaacacacct agactagatt tgttttgcta acccaattga tattaattat 6540 atatgattaa tatttatatg tatatggatt tggttaatga aatgcatctg gttcatcaaa 6600 gaattataaa gacacgtgac attcatttag gataagaaat atggatgatc tctttctctt 6660 ttattcagat aactagtaat tacacataac acacaacttt gatgcccaca ttatagtgat 6720 tagcatgtca ctatgtgtgc atccttttat ttcatacatt aattaagttg gccaatccag 6780 aagatggaca agtctaggtt aaccatgtgg tacctacgcg ttcgaatatc catgggccgc 6840 ttcaggccag ggcgctgggg aaggcgatgg cgtgctcggt cagctgccac ttctggttct 6900 tggcgtcgct ccggtcctcc cgcagcagct tgtgctggat gaagtgccac tcgggcatct 6960 tgctgggcac gctcttggcc ttgtacacgg tgtcgaactg gcaccggtac cggccgccgt 7020 ccttcagcag caggtacatg ctcacgtcgc ccttcaggat gccctgctta ggcacgggca 7080 tgatcttctc gcagctggcc tcccagttgg tggtcatctt cttcatcacg gggccgtcgg 7140 cggggaagtt cacgccgttg aagatgctct tgtggtagat gcagttctcc ttcacgctca 7200 cggtgatgtc cacgttacag atgcacacgg cgccgtcctc gaacaggaag ctccggcccc 7260 aggtgtagcc ggcggggcag ctgttcttga agtagtccac gatgtcctgg gggtactcgg 7320 tgaagatccg gtcgccgtac ttgaagccgg cgctcaggat gtcctcgctg aagggcaggg 7380 ggccgccctc gatcacgcac aggttgatgg tctgcttgcc cttgaagggg tagccgatgc 7440 cctcgccggt gatcacgaac ttgtggccgt tcacgcagcc ctccatgtgg tacttcatgg 7500 tcatctcctc cttcaggccg tgcttgctgt gggccatggt ggcgaccggt gaattcgagc 7560 tcggtacccg gggatcctga gtaaaacaga ggagggtctc actaagttta tagagagact 7620 gagagagata aagggacacg tatgaagcgt ctgttttcgt ggtgtgacgt caaagtcatt 7680 ttgctctcta cgcgtgtctg tgtcggcttg atcttttttt ttgctttttg gaactcatgt 7740 cggtagtata tcttttattt attttttctt tttttccctt ttctttcaaa ctgatgtcgg 7800 tatgatattt attccatcct aaaatgtaac ttactattat tagtagtcgg tccatgtcta 7860 ttggcccatc atgtggtcat tttacgttta cgtcgtgtgg ctgtttatta taacaaacgg 7920 cacatccttc tcattcgaat tgtatttctc cttaatcgtt ctaataggta tgatctttta 7980 ttttatacgt aaaattaaaa ttgaatgatg tcaagaacga aaattaattt gtatttacaa 8040 aggagctaaa tattgtttat tcctctactg gtagaagata aaagaagtag atgaaataat 8100 gatcttacta gagaatattc ctcatttaca ctagtcaaat ggaaatcttg taaactttta 8160 caataattta tcctgaaaat atgaaaaaat agaagaaaat gtttacctcc tctctcctct 8220 taattcacct acgatcggtg cgggcctctt cgctattacg ccagctggcg aaagggggat 8280 gtgctgcaag gcgattaagt tgggtaacgc cagggttttc ccagtcacga cgttgtaaaa 8340 cgacggccag tgaattcgag ctcggtaccc ggggatcctc tagagtcgac ctgcaggcat 8400 gcaagcttgt tgaaacatcc ctgaagtgtc tcattttatt ttatttattc tttgctgata 8460 aaaaaataaa ataaaagaag ctaagcacac ggtcaaccat tgctctactg ctaaaagggt 8520 tatgtgtagt gttttactgc ataaattatg cagcaaacaa gacaactcaa attaaaaaat 8580 ttcctttgct tgtttttttg ttgtctctga cttgactttc ttgtggaagt tggttgtata 8640 aggattggga cacaccattg tccttcttaa tttaatttta tttctttgct gataaaaaaa 8700 aaaaatttca tatagtgtta aataataatt tgttaaataa ccaaaaagtc aaatatgttt 8760 actctcgttt aaataattga gagtcgtcca gcaaggctaa acgattgtat agatttatga 8820 caatatttac ttttttatag ataaatgtta tattataata aatttatata catatattat 8880 atgttattta ttatttatta ttattttaaa tccttcaata ttttatcaaa ccaactcata 8940 attttttttt tatctgtaag aagcaataaa attaaataga cccactttaa ggatgatcca 9000 acctttatac agagtaagag agttcaaata gtaccctttc atatacatat caactaaaat 9060 attagaaata tcatggatca aaccttataa agacattaaa taagtggata agtataatat 9120 ataaatgggt agtatataat atataaatgg atacaaactt ctctctttat aattgttatg 9180 tctccttaac atcctaatat aatacataag tgggtaatat ataatatata aatggagaca 9240 aacttcttcc attataattg ttatgtcttc ttaacactta tgtctcgttc acaatgctaa 9300 agttagaatt gtttagaaag tcttatagta cacatttgtt tttgtactat ttgaagcatt 9360 ccataagccg tcacgattca gatgatttat aataataaga ggaaatttat catagaacaa 9420 taaggtgcat agatagagtg ttaatatatc ataacatcct ttgtttattc atagaagaag 9480 tgagatggag ctcagttatt atactgttac atggtcggat acaatattcc atgctctcca 9540 tgagctctta cacctacatg cattttagtt catacttcat gcacgtggcc atcacagcta 9600 gctgcagcta catatttaca ttttacaaca ccaggagaac tgccctgtta gtgcataaca 9660 atcagaagat ggccgtggct actcgagtta tcgaaccact ttgtacaaga aagctgaacg 9720 agaaacgtaa aatgatataa atatcaatat attaaattag attttgcata aaaaacagac 9780 tacataatac tgtaaaacac aacatatcca gtcactatgg tcgacctgca gactggctgt 9840 gtataaggga gcctgacatt tatattcccc agaacatcag gttaatggcg tttttgatgt 9900 cattttcgcg gtggctgaga tcagccactt cttccccgat aacggagacc ggcacactgg 9960 ccatatcggt ggtcatcatg cgccagcttt catccccgat atgcaccacc gggtaaagtt 10020 cacgggagac tttatctgac agcagacgtg cactggccag ggggatcacc atccgtcgcc 10080 cgggcgtgtc aataatatca ctctgtacat ccacaaacag acgataacgg ctctctcttt 10140 tataggtgta aaccttaaac tgcatttcac cagtccctgt tctcgtcagc aaaagagccg 10200 ttcatttcaa taaaccgggc gacctcagcc atcccttcct gattttccgc tttccagcgt 10260 tcggcacgca gacgacgggc ttcattctgc atggttgtgc ttaccagacc ggagatattg 10320 acatcatata tgccttgagc aactgatagc tgtcgctgtc aactgtcact gtaatacgct 10380 gcttcatagc acacctcttt ttgacatact tcgggtatac atatcagtat atattcttat 10440 accgcaaaaa tcagcgcgca aatacgcata ctgttatctg gcttttagta agccggatcc 10500 tctagattac gccccgccct gccactcatc gcagtactgt tgtaattcat taagcattct 10560 gccgacatgg aagccatcac agacggcatg atgaacctga atcgccagcg gcatcagcac 10620 cttgtcgcct tgcgtataat atttgcccat ggtgaaaacg ggggcgaaga agttgtccat 10680 attggccacg tttaaatcaa aactggtgaa actcacccag ggattggctg agacgaaaaa 10740 catattctca ataaaccctt tagggaaata ggccaggttt tcaccgtaac acgccacatc 10800 ttgcgaatat atgtgtagaa actgccggaa atcgtcgtgg tattcactcc agagcgatga 10860 aaacgtttca gtttgctcat ggaaaacggt gtaacaaggg tgaacactat cccatatcac 10920 cagctcaccg tctttcattg ccatacggaa ttccggatga gcattcatca ggcgggcaag 10980 aatgtgaata aaggccggat aaaacttgtg cttatttttc tttacggtct ttaaaaaggc 11040 cgtaatatcc agctgaacgg tctggttata ggtacattga gcaactgact gaaatgcctc 11100 aaaatgttct ttacgatgcc attgggatat atcaacggtg gtatatccag tgattttttt 11160 ctccatttta gcttccttag ctcctgaaaa tctcgccgga tcctaactca aaatccacac 11220 attatacgag ccggaagcat aaagtgtaaa gcctggggtg cctaatgcgg ccgccatagt 11280 gactggatat gttgtgtttt acagtattat gtagtctgtt ttttatgcaa aatctaattt 11340 aatatattga tatttatatc attttacgtt tctcgttcag cttttttgta caaacttgtt 11400 tgataaccgg tactagtgtg cacgtcgagc gtgtcctctc caaatgaaat gaacttcctt 11460 atatagagga agggtcttgc gaaggatagt gggattgtgc gtcatccctt acgtcagtgg 11520 agatgtcaca tcaatccact tgctttgaag acgtggttgg aacgtcttct ttttccacga 11580 tgctcctcgt gggtgggggt ccatctttgg gaccactgtc ggcagaggca tcttgaatga 11640 tagcctttcc tttatcgcaa tgatggcatt tgtaggagcc accttccttt tctactgtcc 11700 tttcgatgaa gtgacagata gctgggcaat ggaatccgag gaggtttccc gaaattatcc 11760 tttgttgaaa agtctcaata gccctttggt cttctgagac tgtatctttg acatttttgg 11820 agtagaccag agtgtcgtgc tccaccatgt tgacgaagat tttcttcttg tcattgagtc 11880 gtaaaagact ctgtatgaac tgttcgccag tcttcacggc gagttctgtt agatcctcga 11940 tttgaatctt agactccatg catggcctta gattcagtag gaactacctt tttagagact 12000 ccaatctcta ttacttgcct tggtttatga agcaagcctt gaatcgtcca tactggaata 12060 gtacttctga tcttgagaaa tatgtctttc tctgtgttct tgatgcaatt agtcctgaat 12120 cttttgactg catctttaac cttcttggga aggtatttga tctcctggag attgttactc 12180 gggtagatcg tcttgatgag acctgctgcg taggcctctc taaccatctg tgggtcagca 12240 ttctttctga aattgaagag gctaaccttc tcattatcag tggtgaacat agtgtcgtca 12300 ccttcacctt cgaacttcct tcctagatcg taaagataga ggaaatcgtc cattgtaatc 12360 tccggggcaa aggagatctc ttttggggct ggatcactgc tgggcctttt ggttcctagc 12420 gtgagccagt gggctttttg ctttggtggg cttgttaggg ccttagcaaa gctcttgggc 12480 ttgagttgag cttctccttt ggggatgaag ttcaacctgt ctgtttgctg acttgttgtg 12540 tacgcgtcag ctgctgctct tgcctctgta atagtggcaa atttcttgtg tgcaactccg 12600 ggaacgccgt ttgttgccgc ctttgtacaa ccccagtcat cgtatatacc ggcatgtgga 12660 ccgttataca caacgtagta gttgatatga gggtgttgaa tacccgattc tgctctgaga 12720 ggagcaactg tgctgttaag ctcagatttt tgtgggattg gaattggatc ctctagagca 12780 aagcttggcg taatcatggt catagctgtt tcctgtgtga aattgttatc cgctcacaat 12840 tccacacaac atacgagccg gaagcataaa gtgtaaagcc tggggtgcct aatgagtgag 12900 ctaactcaca ttaattgcgt tgcgctcact gcccgctttc cagtcgggaa acctgtcgtg 12960 ccagctgcat taatgaatcg gccaacgcgc ggggagaggc ggtttgcgta ttgggccaaa 13020 gacaaaaggg cgacattcaa ccgattgagg gagggaaggt aaatattgac ggaaattatt 13080 cattaaaggt gaattatcac cgtcaccgac ttgagccatt tgggaattag agccagcaaa 13140 atcaccagta gcaccattac cattagcaag gccggaaacg tcaccaatga aaccatcatc 13200 tagtaacata gatgacaccg cgcgcgataa tttatcctag tttgcgcgct atattttgtt 13260 ttctatcgcg tattaaatgt ataattgcgg gactctaatc ataaaaaccc atctcataaa 13320 taacgtcatg cattacatgt taattattac atgcttaacg taattcaaca gaaattatat 13380 gataatcatc gcaagaccgg caacaggatt caatcttaag aaactttatt gccaaatgtt 13440 tgaacgatct gcttcgacgc actccttctt taggtacgga ctagatctcg gtgacgggca 13500 ggaccggacg gggcggtacc ggcaggctga agtccagctg ccagaaaccc acgtcatgcc 13560 agttcccgtg cttgaagccg gccgcccgca gcatgccgcg gggggcatat ccgagcgcct 13620 cgtgcatgcg cacgctcggg tcgttgggca gcccgatgac agcgaccacg ctcttgaagc 13680 cctgtgcctc cagggacttc agcaggtggg tgtagagcgt ggagcccagt cccgtccgct 13740 ggtggcgggg ggagacgtac acggtcgact cggccgtcca gtcgtaggcg ttgcgtgcct 13800 tccaggggcc cgcgtaggcg atgccggcga cctcgccgtc cacctcggcg acgagccagg 13860 gatagcgctc ccgcagacgg acgaggtcgt ccgtccactc ctgcggttcc tgcggctcgg 13920 tacggaagtt gaccgtgctt gtctcgatgt agtggttgac gatggtgcag accgccggca 13980 tgtccgcctc ggtggcacgg cggatgtcgg ccgggcgtcg ttctgggctc atggatctgg 14040 attgagagtg aatatgagac tctaattgga taccgagggg aatttatgga acgtcagtgg 14100 agcatttttg acaagaaata tttgctagct gatagtgacc ttaggcgact tttgaacgcg 14160 caataatggt ttctgacgta tgtgcttagc tcattaaact ccagaaaccc gcggctgagt 14220 ggctccttca acgttgcggt tctgtcagtt ccaaacgtaa aacggcttgt cccgcgtcat 14280 cggcgggggt cataacgtga ctcccttaat tctccgctca tgatcagatt gtcgtttccc 14340 gccttcagtt taaactatca gtgtttgaca ggatatattg gcgggtaaac ctaagagaaa 14400 agagcgttta ttagaataat cggatattta aaagggcgtg aaaaggttta tccgttcgtc 14460 catttgtatg tgcatgccaa ccacagggtt ccccagatct ggcgccggcc agcgagacga 14520 gcaagattgg ccgccgcccg aaacgatccg acagcgcgcc cagcacaggt gcgcaggcaa 14580 attgcaccaa cgcatacagc gccagcagaa tgccatagtg ggcggtgacg tcgttcgagt 14640 gaaccagatc gcgcaggagg cccggcagca ccggcataat caggccgatg ccgacagcgt 14700 cgagcgcgac agtgctcaga attacgatca ggggtatgtt gggtttcacg tctggcctcc 14760 ggaccagcct ccgctggtcc gattgaacgc gcggattctt tatcactgat aagttggtgg 14820 acatattatg tttatcagtg ataaagtgtc aagcatgaca aagttgcagc cgaatacagt 14880 gatccgtgcc gccctggacc tgttgaacga ggtcggcgta gacggtctga cgacacgcaa 14940 actggcggaa cggttggggg ttcagcagcc ggcgctttac tggcacttca ggaacaagcg 15000 ggcgctgctc gacgcactgg ccgaagccat gctggcggag aatcatacgc attcggtgcc 15060 gagagccgac gacgactggc gctcatttct gatcgggaat gcccgcagct tcaggcaggc 15120 gctgctcgcc taccgcgatg gcgcgcgcat ccatgccggc acgcgaccgg gcgcaccgca 15180 gatggaaacg gccgacgcgc agcttcgctt cctctgcgag gcgggttttt cggccgggga 15240 cgccgtcaat gcgctgatga caatcagcta cttcactgtt ggggccgtgc ttgaggagca 15300 ggccggcgac agcgatgccg gcgagcgcgg cggcaccgtt gaacaggctc cgctctcgcc 15360 gctgttgcgg gccgcgatag acgccttcga cgaagccggt ccggacgcag cgttcgagca 15420 gggactcgcg gtgattgtcg atggattggc gaaaaggagg ctcgttgtca ggaacgttga 15480 aggaccgaga aagggtgacg attgatcagg accgctgccg gagcgcaacc cactcactac 15540 agcagagcca tgtagacaac atcccctccc cctttccacc gcgtcagacg cccgtagcag 15600 cccgctacgg gctttttcat gccctgccct agcgtccaag cctcacggcc gcgctcggcc 15660 tctctggcgg ccttctggcg ctcttccgct tcctcgctca ctgactcgct gcgctcggtc 15720 gttcggctgc ggcgagcggt atcagctcac tcaaaggcgg taatacggtt atccacagaa 15780 tcaggggata acgcaggaaa gaacatgtga gcaaaaggcc agcaaaaggc caggaaccgt 15840 aaaaaggccg cgttgctggc gtttttccat aggctccgcc cccctgacga gcatcacaaa 15900 aatcgacgct caagtcagag gtggcgaaac ccgacaggac tataaagata ccaggcgttt 15960 ccccctggaa gctccctcgt gcgctctcct gttccgaccc tgccgcttac cggatacctg 16020 tccgcctttc tcccttcggg aagcgtggcg cttttccgct gcataaccct gcttcggggt 16080 cattatagcg attttttcgg tatatccatc ctttttcgca cgatatacag gattttgcca 16140 aagggttcgt gtagactttc cttggtgtat ccaacggcgt cagccgggca ggataggtga 16200 agtaggccca cccgcgagcg ggtgttcctt cttcactgtc ccttattcgc acctggcggt 16260 gctcaacggg aatcctgctc tgcgaggctg gccggctacc gccggcgtaa cagatgaggg 16320 caagcggatg gctgatgaaa ccaagccaac caggaagggc agcccaccta tcaaggtgta 16380 ctgccttcca gacgaacgaa gagcgattga ggaaaaggcg gcggcggccg gcatgagcct 16440 gtcggcctac ctgctggccg tcggccaggg ctacaaaatc acgggcgtcg tggactatga 16500 gcacgtccgc gagctggccc gcatcaatgg cgacctgggc cgcctgggcg gcctgctgaa 16560 actctggctc accgacgacc cgcgcacggc gcggttcggt gatgccacga tcctcgccct 16620 gctggcgaag atcgaagaga agcaggacga gcttggcaag gtcatgatgg gcgtggtccg 16680 cccgagggca gagccatgac ttttttagcc gctaaaacgg ccggggggtg cgcgtgattg 16740 ccaagcacgt ccccatgcgc tccatcaaga agagcgactt cgcggagctg gtgaagtaca 16800 tcaccgacga gcaaggcaag accgagcgcc tttgcgacgc tca 16843 <210> SEQ ID NO 5 <211> LENGTH: 9142 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: PHP27840 construct <400> SEQUENCE: 5 ctagttatct gaataaaaga gaaagagatc atccatattt cttatcctaa atgaatgtca 60 cgtgtcttta taattctttg atgaaccaga tgcatttcat taaccaaatc catatacata 120 taaatattaa tcatatataa ttaatatcaa ttgggttagc aaaacaaatc tagtctaggt 180 gtgttttgcg aattcgatat caagcttgat gggtaccggc gcgcccgatc atccggatat 240 agttcctcct ttcagcaaaa aacccctcaa gacccgttta gaggccccaa ggggttatgc 300 tagttattgc tcagcggtgg cagcagccaa ctcagcttcc tttcgggctt tgttagcagc 360 cggatcgatc caagctgtac ctcactattc ctttgccctc ggacgagtgc tggggcgtcg 420 gtttccacta tcggcgagta cttctacaca gccatcggtc cagacggccg cgcttctgcg 480 ggcgatttgt gtacgcccga cagtcccggc tccggatcgg acgattgcgt cgcatcgacc 540 ctgcgcccaa gctgcatcat cgaaattgcc gtcaaccaag ctctgataga gttggtcaag 600 accaatgcgg agcatatacg cccggagccg cggcgatcct gcaagctccg gatgcctccg 660 ctcgaagtag cgcgtctgct gctccataca agccaaccac ggcctccaga agaagatgtt 720 ggcgacctcg tattgggaat ccccgaacat cgcctcgctc cagtcaatga ccgctgttat 780 gcggccattg tccgtcagga cattgttgga gccgaaatcc gcgtgcacga ggtgccggac 840 ttcggggcag tcctcggccc aaagcatcag ctcatcgaga gcctgcgcga cggacgcact 900 gacggtgtcg tccatcacag tttgccagtg atacacatgg ggatcagcaa tcgcgcatat 960 gaaatcacgc catgtagtgt attgaccgat tccttgcggt ccgaatgggc cgaacccgct 1020 cgtctggcta agatcggccg cagcgatcgc atccatagcc tccgcgaccg gctgcagaac 1080 agcgggcagt tcggtttcag gcaggtcttg caacgtgaca ccctgtgcac ggcgggagat 1140 gcaataggtc aggctctcgc tgaattcccc aatgtcaagc acttccggaa tcgggagcgc 1200 ggccgatgca aagtgccgat aaacataacg atctttgtag aaaccatcgg cgcagctatt 1260 tacccgcagg acatatccac gccctcctac atcgaagctg aaagcacgag attcttcgcc 1320 ctccgagagc tgcatcaggt cggagacgct gtcgaacttt tcgatcagaa acttctcgac 1380 agacgtcgcg gtgagttcag gcttttccat gggtatatct ccttcttaaa gttaaacaaa 1440 attatttcta gagggaaacc gttgtggtct ccctatagtg agtcgtatta atttcgcggg 1500 atcgagatct gatcaacctg cattaatgaa tcggccaacg cgcggggaga ggcggtttgc 1560 gtattgggcg ctcttccgct tcctcgctca ctgactcgct gcgctcggtc gttcggctgc 1620 ggcgagcggt atcagctcac tcaaaggcgg taatacggtt atccacagaa tcaggggata 1680 acgcaggaaa gaacatgtga gcaaaaggcc agcaaaaggc caggaaccgt aaaaaggccg 1740 cgttgctggc gtttttccat aggctccgcc cccctgacga gcatcacaaa aatcgacgct 1800 caagtcagag gtggcgaaac ccgacaggac tataaagata ccaggcgttt ccccctggaa 1860 gctccctcgt gcgctctcct gttccgaccc tgccgcttac cggatacctg tccgcctttc 1920 tcccttcggg aagcgtggcg ctttctcaat gctcacgctg taggtatctc agttcggtgt 1980 aggtcgttcg ctccaagctg ggctgtgtgc acgaaccccc cgttcagccc gaccgctgcg 2040 ccttatccgg taactatcgt cttgagtcca acccggtaag acacgactta tcgccactgg 2100 cagcagccac tggtaacagg attagcagag cgaggtatgt aggcggtgct acagagttct 2160 tgaagtggtg gcctaactac ggctacacta gaaggacagt atttggtatc tgcgctctgc 2220 tgaagccagt taccttcgga aaaagagttg gtagctcttg atccggcaaa caaaccaccg 2280 ctggtagcgg tggttttttt gtttgcaagc agcagattac gcgcagaaaa aaaggatctc 2340 aagaagatcc tttgatcttt tctacggggt ctgacgctca gtggaacgaa aactcacgtt 2400 aagggatttt ggtcatgaca ttaacctata aaaataggcg tatcacgagg ccctttcgtc 2460 tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca 2520 cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg 2580 ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc 2640 accatatgga catattgtcg ttagaacgcg gctacaatta atacataacc ttatgtatca 2700 tacacatacg atttaggtga cactatagaa cggcgcgcca agctgggtct agaactagaa 2760 acgtgatgcc acttgttatt gaagtcgatt acagcatcta ttctgtttta ctatttataa 2820 ctttgccatt tctgactttt gaaaactatc tctggatttc ggtatcgctt tgtgaagatc 2880 gagcaaaaga gacgttttgt ggacgcaatg gtccaaatcc gttctacatg aacaaattgg 2940 tcacaatttc cactaaaagt aaataaatgg caagttaaaa aaggaatatg cattttactg 3000 attgcctagg tgagctccaa gagaagttga atctacacgt ctaccaaccg ctaaaaaaag 3060 aaaaacattg aatatgtaac ctgattccat tagcttttga cttcttcaac agattctcta 3120 cttagatttc taacagaaat attattacta gcacatcatt ttcagtctca ctacagcaaa 3180 aaatccaacg gcacaataca gacaacagga gatatcagac tacagagata gatagatgct 3240 actgcatgta gtaagttaaa taaaaggaaa ataaaatgtc ttgctaccaa aactactaca 3300 gactatgatg ctcaccacag gccaaatcct gcaactagga cagcattatc ttatatatat 3360 tgtacaaaac aagcatcaag gaacatttgg tctaggcaat cagtacctcg ttctaccatc 3420 accctcagtt atcacatcct tgaaggatcc attactggga atcatcggca acacatgctc 3480 ctgatggggc acaatgacat caagaaggta ggggccaggg gtgtccaaca ttctctgaat 3540 tgccgctcta agctcttcct tcttcgtcac tcgcgctgcc ggtatcccac aagcatcagc 3600 aaacttgagc atgtttggga atatctcgct ctcgctagac ggatctccaa gataggtgtg 3660 agctctattg gacttgtaga acctatcctc caactgaacc accataccca aatgctgatt 3720 gttcaacaac aatatcttaa ctgggagatt ctccactctt atagtggcca actcctgaac 3780 attcatgatg aaactaccat ccccatcaat gtcaaccaca acagccccag ggttagcaac 3840 agcagcacca atagccgcag gcaatccaaa acccatggct ccaagacccc ctgaggtcaa 3900 ccactgcctc ggtctcttgt acttgtaaaa ctgcgcagcc cacatttgat gctgcccaac 3960 cccagtacta acaatagcat ctccattagt caactcatca agaacctcga tagcatgctg 4020 cggagaaatc gcgtcctgga atgtcttgta acccaatgga aacttgtgtt tctgcacatt 4080 aatctcttct ctccaacctc caagatcaaa cttaccctcc actcctttct cctccaaaat 4140 catattaatt cccttcaagg ccaacttcaa atccgcgcaa accgacacgt gcgcctgctt 4200 gttcttccca atctcggcag aatcaatatc aatgtgaaca atcttagccc tactagcaaa 4260 agcctcaagc ttcccagtaa cacggtcatc aaaccttacc ccaaaggcaa gcaacaaatc 4320 actattgtca acagcatagt tagcataaac agtaccatgc atacccagca tctgaaggga 4380 atattcatca ccaataggaa aagttccaag acccattaaa gtgctagcaa cgggaatacc 4440 agtgagttca acaaagcgcc tcaattcagc actggaattc aaactgccac cgccgacgta 4500 gagaacgggc ttttgggcct ccatgatgag tctgacaatg tgttccaatt gggcctcggc 4560 ggggggcctg ggcagcctgg cgaggtaacc ggggaggtta acgggctcgt cccaattagg 4620 cacggcgagt tgctgctgaa cgtctttggg aatgtcgatg aggaccggac cggggcggcc 4680 ggaggtggcg acgaagaaag cctcggcgac gacgcggggg atgtcgtcga cgtcgaggat 4740 gaggtagttg tgcttcgtga tggatctgct cacctccacg atcggggttt cttggaaggc 4800 gtcggtgccg atcatccggc gggcgacctg gccggtgatg gcgacgactg ggacgctgtc 4860 cattaaagcg tcggcgaggc cgctcacgag gttggtggcg ccggggccgg aggtggcaat 4920 gcagacgccg gggaggccgg aggaacgcgc gtagccttcg gcggcgaaga cgccgccctg 4980 ctcgtggcgc gggagcacgt tgcggatggc ggcggagcgc gtgagcgcct ggtggatctc 5040 catcgacgca ccgccggggt acgcgaacac cgtcgtcacg ccctgcctct ccagcgcctc 5100 cacaaggatg tccgcgccct tgcgaggttc gccggaggcg aaccgtgaca cgaagggctc 5160 cgtggtcggc gcttccttgg tgaagggcgc cgccgtgggg ggtttggaga tggaacattt 5220 gattttgaga gcgtggttgg gtttggtgag ggtttgatga gagagaggga gggtggatct 5280 agtaatgcgt ttggggaagg tggggtgtga agaggaagaa gagaatcggg tggttctgga 5340 agcggtggcc gccattgtgt tgtgtggcat ggttatactt caaaaactgc acaacaagcc 5400 tagagttagt acctaaacag taaatttaca acagagagca aagacacatg caaaaatttc 5460 agccataaaa aaagttataa tagaatttaa agcaaaagtt tcatttttta aacatatata 5520 caaacaaact ggatttgaag gaagggatta attcccctgc tcaaagtttg aattcctatt 5580 gtgacctata ctcgaataaa attgaagcct aaggaatgta tgagaaacaa gaaaacaaaa 5640 caaaactaca gacaaacaag tacaattaca aaattcgcta aaattctgta atcaccaaac 5700 cccatctcag tcagcacaag gcccaaggtt tattttgaaa taaaaaaaaa gtgattttat 5760 ttctcataag ctaaaagaaa gaaaggcaat tatgaaatga tttcgactag atctgaaagt 5820 caaacgcgta ttccgcagat attaaagaaa gagtagagtt tcacatggat cctagatgga 5880 cccagttgag gaaaaagcaa ggcaaagcaa accagaagtg caagatccga aattgaacca 5940 cggaatctag gatttggtag agggagaaga aaagtacctt gagaggtaga agagaagaga 6000 agagcagaga gatatatgaa cgagtgtgtc ttggtctcaa ctctgaagcg atacgagttt 6060 agaggggagc attgagttcc aatttatagg gaaaccgggt ggcaggggtg agttaatgac 6120 ggaaaagccc ctaagtaacg agattggatt gtgggttaga ttcaaccgtt tgcatccgcg 6180 gcttagattg gggaagtcag agtgaatctc aaccgttgac tgagttgaaa attgaatgta 6240 gcaaccaatt gagccaaccc cagcctttgc cctttgattt tgatttgttt gttgcatact 6300 ttttatttgt cttctggttc tgactctctt tctctcgttt caatgccagg ttgcctactc 6360 ccacaccact cacaagaaga ttctactgtt agtattaaat attttttaat gtattaaatg 6420 atgaatgctt ttgtaaacag aacaagacta tgtctaataa gtgtcttgca acatttttta 6480 agaaattaaa aaaaatatat ttattatcaa aatcaaatgt atgaaaaatc atgaataata 6540 taattttata cattttttta aaaaatcttt taatttctta attaatatct taaaaataat 6600 gattaatatt taacccaaaa taattagtat gattggtaag gaagatatcc atgttatgtt 6660 tggatgtgag tttgatctag agcaaagctt actagagtcg acctgcagcc cctccaccgc 6720 ggtggcggcc gctctagaga tccgtcaaca tggtggagca cgacactctc gtctactcca 6780 agaatatcaa agatacagtc tcagaagacc aaagggctat tgagactttt caacaaaggg 6840 taatatcggg aaacctcctc ggattccatt gcccagctat ctgtcacttc atcaaaagga 6900 cagtagaaaa ggaaggtggc acctacaaat gccatcattg cgataaagga aaggctatcg 6960 ttcaagatgc ctctgccgac agtggtccca aagatggacc cccacccacg aggagcatcg 7020 tggaaaaaga agacgttcca accacgtctt caaagcaagt ggattgatgt gatgatccta 7080 tgcgtatggt atgacgtgtg ttcaagatga tgacttcaaa cctacctatg acgtatggta 7140 tgacgtgtgt cgactgatga cttagatcca ctcgagcggc tataaatacg tacctacgca 7200 ccctgcgcta ccatccctag agctgcagct tatttttaca acaattacca acaacaacaa 7260 acaacaaaca acattacaat tactatttac aattacagtc gacccatcaa caagtttgta 7320 caaaaaagct gaacgagaaa cgtaaaatga tataaatatc aatatattaa attagatttt 7380 gcataaaaaa cagactacat aatactgtaa aacacaacat atccagtcat attggcggcc 7440 gcattaggca ccccaggctt tacactttat gcttccggct cgtataatgt gtggattttg 7500 agttaggatc cgtcgagatt ttcaggagct aaggaagcta aaatggagaa aaaaatcact 7560 ggatatacca ccgttgatat atcccaatgg catcgtaaag aacattttga ggcatttcag 7620 tcagttgctc aatgtaccta taaccagacc gttcagctgg atattacggc ctttttaaag 7680 accgtaaaga aaaataagca caagttttat ccggccttta ttcacattct tgcccgcctg 7740 atgaatgctc atccggaatt ccgtatggca atgaaagacg gtgagctggt gatatgggat 7800 agtgttcacc cttgttacac cgttttccat gagcaaactg aaacgttttc atcgctctgg 7860 agtgaatacc acgacgattt ccggcagttt ctacacatat attcgcaaga tgtggcgtgt 7920 tacggtgaaa acctggccta tttccctaaa gggtttattg agaatatgtt tttcgtctca 7980 gccaatccct gggtgagttt caccagtttt gatttaaacg tggccaatat ggacaacttc 8040 ttcgcccccg ttttcaccat gggcaaatat tatacgcaag gcgacaaggt gctgatgccg 8100 ctggcgattc aggttcatca tgccgtttgt gatggcttcc atgtcggcag aatgcttaat 8160 gaattacaac agtactgcga tgagtggcag ggcggggcgt aaagatctgg atccggctta 8220 ctaaaagcca gataacagta tgcgtatttg cgcgctgatt tttgcggtat aagaatatat 8280 actgatatgt atacccgaag tatgtcaaaa agaggtatgc tatgaagcag cgtattacag 8340 tgacagttga cagcgacagc tatcagttgc tcaaggcata tatgatgtca atatctccgg 8400 tctggtaagc acaaccatgc agaatgaagc ccgtcgtctg cgtgccgaac gctggaaagc 8460 ggaaaatcag gaagggatgg ctgaggtcgc ccggtttatt gaaatgaacg gctcttttgc 8520 tgacgagaac aggggctggt gaaatgcagt ttaaggttta cacctataaa agagagagcc 8580 gttatcgtct gtttgtggat gtacagagtg atattattga cacgcccggg cgacggatgg 8640 tgatccccct ggccagtgca cgtctgctgt cagataaagt ctcccgtgaa ctttacccgg 8700 tggtgcatat cggggatgaa agctggcgca tgatgaccac cgatatggcc agtgtgccgg 8760 tctccgttat cggggaagaa gtggctgatc tcagccaccg cgaaaatgac atcaaaaacg 8820 ccattaacct gatgttctgg ggaatataaa tgtcaggctc ccttatacac agccagtctg 8880 caggtcgacc atagtgactg gatatgttgt gttttacagt attatgtagt ctgtttttta 8940 tgcaaaatct aatttaatat attgatattt atatcatttt acgtttctcg ttcagctttc 9000 ttgtacaaag tggttgataa cctagacttg tccatcttct ggattggcca acttaattaa 9060 tgtatgaaat aaaaggatgc acacatagtg acatgctaat cactataatg tgggcatcaa 9120 agttgtgtgt tatgtgtaat ta 9142 <210> SEQ ID NO 6 <211> LENGTH: 49911 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: PHP23236 construct <400> SEQUENCE: 6 gtgcagcgtg acccggtcgt gcccctctct agagataatg agcattgcat gtctaagtta 60 taaaaaatta ccacatattt tttttgtcac acttgtttga agtgcagttt atctatcttt 120 atacatatat ttaaacttta ctctacgaat aatataatct atagtactac aataatatca 180 gtgttttaga gaatcatata aatgaacagt tagacatggt ctaaaggaca attgagtatt 240 ttgacaacag gactctacag ttttatcttt ttagtgtgca tgtgttctcc tttttttttg 300 caaatagctt cacctatata atacttcatc cattttatta gtacatccat ttagggttta 360 gggttaatgg tttttataga ctaatttttt tagtacatct attttattct attttagcct 420 ctaaattaag aaaactaaaa ctctatttta gtttttttat ttaataattt agatataaaa 480 tagaataaaa taaagtgact aaaaattaaa caaataccct ttaagaaatt aaaaaaacta 540 aggaaacatt tttcttgttt cgagtagata atgccagcct gttaaacgcc gtcgacgagt 600 ctaacggaca ccaaccagcg aaccagcagc gtcgcgtcgg gccaagcgaa gcagacggca 660 cggcatctct gtcgctgcct ctggacccct ctcgagagtt ccgctccacc gttggacttg 720 ctccgctgtc ggcatccaga aattgcgtgg cggagcggca gacgtgagcc ggcacggcag 780 gcggcctcct cctcctctca cggcacggca gctacggggg attcctttcc caccgctcct 840 tcgctttccc ttcctcgccc gccgtaataa atagacaccc cctccacacc ctctttcccc 900 aacctcgtgt tgttcggagc gcacacacac acaaccagat ctcccccaaa tccacccgtc 960 ggcacctccg cttcaaggta cgccgctcgt cctccccccc cccccctctc taccttctct 1020 agatcggcgt tccggtccat ggttagggcc cggtagttct acttctgttc atgtttgtgt 1080 tagatccgtg tttgtgttag atccgtgctg ctagcgttcg tacacggatg cgacctgtac 1140 gtcagacacg ttctgattgc taacttgcca gtgtttctct ttggggaatc ctgggatggc 1200 tctagccgtt ccgcagacgg gatcgatttc atgatttttt ttgtttcgtt gcatagggtt 1260 tggtttgccc ttttccttta tttcaatata tgccgtgcac ttgtttgtcg ggtcatcttt 1320 tcatgctttt ttttgtcttg gttgtgatga tgtggtctgg ttgggcggtc gttctagatc 1380 ggagtagaat tctgtttcaa actacctggt ggatttatta attttggatc tgtatgtgtg 1440 tgccatacat attcatagtt acgaattgaa gatgatggat ggaaatatcg atctaggata 1500 ggtatacatg ttgatgcggg ttttactgat gcatatacag agatgctttt tgttcgcttg 1560 gttgtgatga tgtggtgtgg ttgggcggtc gttcattcgt tctagatcgg agtagaatac 1620 tgtttcaaac tacctggtgt atttattaat tttggaactg tatgtgtgtg tcatacatct 1680 tcatagttac gagtttaaga tggatggaaa tatcgatcta ggataggtat acatgttgat 1740 gtgggtttta ctgatgcata tacatgatgg catatgcagc atctattcat atgctctaac 1800 cttgagtacc tatctattat aataaacaag tatgttttat aattattttg atcttgatat 1860 acttggatga tggcatatgc agcagctata tgtggatttt tttagccctg ccttcatacg 1920 ctatttattt gcttggtact gtttcttttg tcgatgctca ccctgttgtt tggtgttact 1980 tctgcaggtc gactctagag gatccacaag tttgtacaaa aaagctgaac gagaaacgta 2040 aaatgatata aatatcaata tattaaatta gattttgcat aaaaaacaga ctacataata 2100 ctgtaaaaca caacatatcc agtcactatg gcggccgcat taggcacccc aggctttaca 2160 ctttatgctt ccggctcgta taatgtgtgg attttgagtt aggatttaaa tacgcgttga 2220 tccggcttac taaaagccag ataacagtat gcgtatttgc gcgctgattt ttgcggtata 2280 agaatatata ctgatatgta tacccgaagt atgtcaaaaa gaggtatgct atgaagcagc 2340 gtattacagt gacagttgac agcgacagct atcagttgct caaggcatat atgatgtcaa 2400 tatctccggt ctggtaagca caaccatgca gaatgaagcc cgtcgtctgc gtgccgaacg 2460 ctggaaagcg gaaaatcagg aagggatggc tgaggtcgcc cggtttattg aaatgaacgg 2520 ctcttttgct gacgagaaca ggggctggtg aaatgcagtt taaggtttac acctataaaa 2580 gagagagccg ttatcgtctg tttgtggatg tacagagtga tatcattgac acgcccggtc 2640 gacggatggt gatccccctg gccagtgcac gtctgctgtc agataaagtc tcccgtgaac 2700 tttacccggt ggtgcatatc ggggatgaaa gctggcgcat gatgaccacc gatatggcca 2760 gtgtgccggt ctccgttatc ggggaagaag tggctgatct cagccaccgc gaaaatgaca 2820 tcaaaaacgc cattaacctg atgttctggg gaatataaat gtcaggctcc cttatacaca 2880 gccagtctgc aggtcgacca tagtgactgg atatgttgtg ttttacagta ttatgtagtc 2940 tgttttttat gcaaaatcta atttaatata ttgatattta tatcatttta cgtttctcgt 3000 tcagctttct tgtacaaagt ggtgttaacc tagacttgtc catcttctgg attggccaac 3060 ttaattaatg tatgaaataa aaggatgcac acatagtgac atgctaatca ctataatgtg 3120 ggcatcaaag ttgtgtgtta tgtgtaatta ctagttatct gaataaaaga gaaagagatc 3180 atccatattt cttatcctaa atgaatgtca cgtgtcttta taattctttg atgaaccaga 3240 tgcatttcat taaccaaatc catatacata taaatattaa tcatatataa ttaatatcaa 3300 ttgggttagc aaaacaaatc tagtctaggt gtgttttgcg aattgcggcc gccaccgcgg 3360 tggagctcga attccggtcc gggtcacctt tgtccaccaa gatggaactg cggccgctca 3420 ttaattaagt caggcgcgcc tctagttgaa gacacgttca tgtcttcatc gtaagaagac 3480 actcagtagt cttcggccag aatggccatc tggattcagc aggcctagaa ggccatttaa 3540 atcctgagga tctggtcttc ctaaggaccc gggatatcgg accgattaaa ctttaattcg 3600 gtccgaagct tgcatgcctg cagtgcagcg tgacccggtc gtgcccctct ctagagataa 3660 tgagcattgc atgtctaagt tataaaaaat taccacatat tttttttgtc acacttgttt 3720 gaagtgcagt ttatctatct ttatacatat atttaaactt tactctacga ataatataat 3780 ctatagtact acaataatat cagtgtttta gagaatcata taaatgaaca gttagacatg 3840 gtctaaagga caattgagta ttttgacaac aggactctac agttttatct ttttagtgtg 3900 catgtgttct cctttttttt tgcaaatagc ttcacctata taatacttca tccattttat 3960 tagtacatcc atttagggtt tagggttaat ggtttttata gactaatttt tttagtacat 4020 ctattttatt ctattttagc ctctaaatta agaaaactaa aactctattt tagttttttt 4080 atttaataat ttagatataa aatagaataa aataaagtga ctaaaaatta aacaaatacc 4140 ctttaagaaa ttaaaaaaac taaggaaaca tttttcttgt ttcgagtaga taatgccagc 4200 ctgttaaacg ccgtcgacga gtctaacgga caccaaccag cgaaccagca gcgtcgcgtc 4260 gggccaagcg aagcagacgg cacggcatct ctgtcgctgc ctctggaccc ctctcgagag 4320 ttccgctcca ccgttggact tgctccgctg tcggcatcca gaaattgcgt ggcggagcgg 4380 cagacgtgag ccggcacggc aggcggcctc ctcctcctct cacggcaccg gcagctacgg 4440 gggattcctt tcccaccgct ccttcgcttt cccttcctcg cccgccgtaa taaatagaca 4500 ccccctccac accctctttc cccaacctcg tgttgttcgg agcgcacaca cacacaacca 4560 gatctccccc aaatccaccc gtcggcacct ccgcttcaag gtacgccgct cgtcctcccc 4620 cccccccctc tctaccttct ctagatcggc gttccggtcc atgcatggtt agggcccggt 4680 agttctactt ctgttcatgt ttgtgttaga tccgtgtttg tgttagatcc gtgctgctag 4740 cgttcgtaca cggatgcgac ctgtacgtca gacacgttct gattgctaac ttgccagtgt 4800 ttctctttgg ggaatcctgg gatggctcta gccgttccgc agacgggatc gatttcatga 4860 ttttttttgt ttcgttgcat agggtttggt ttgccctttt cctttatttc aatatatgcc 4920 gtgcacttgt ttgtcgggtc atcttttcat gctttttttt gtcttggttg tgatgatgtg 4980 gtctggttgg gcggtcgttc tagatcggag tagaattctg tttcaaacta cctggtggat 5040 ttattaattt tggatctgta tgtgtgtgcc atacatattc atagttacga attgaagatg 5100 atggatggaa atatcgatct aggataggta tacatgttga tgcgggtttt actgatgcat 5160 atacagagat gctttttgtt cgcttggttg tgatgatgtg gtgtggttgg gcggtcgttc 5220 attcgttcta gatcggagta gaatactgtt tcaaactacc tggtgtattt attaattttg 5280 gaactgtatg tgtgtgtcat acatcttcat agttacgagt ttaagatgga tggaaatatc 5340 gatctaggat aggtatacat gttgatgtgg gttttactga tgcatataca tgatggcata 5400 tgcagcatct attcatatgc tctaaccttg agtacctatc tattataata aacaagtatg 5460 ttttataatt attttgatct tgatatactt ggatgatggc atatgcagca gctatatgtg 5520 gattttttta gccctgcctt catacgctat ttatttgctt ggtactgttt cttttgtcga 5580 tgctcaccct gttgtttggt gttacttctg caggtcgact ttaacttagc ctaggatcca 5640 cacgacacca tgtcccccga gcgccgcccc gtcgagatcc gcccggccac cgccgccgac 5700 atggccgccg tgtgcgacat cgtgaaccac tacatcgaga cctccaccgt gaacttccgc 5760 accgagccgc agaccccgca ggagtggatc gacgacctgg agcgcctcca ggaccgctac 5820 ccgtggctcg tggccgaggt ggagggcgtg gtggccggca tcgcctacgc cggcccgtgg 5880 aaggcccgca acgcctacga ctggaccgtg gagtccaccg tgtacgtgtc ccaccgccac 5940 cagcgcctcg gcctcggctc caccctctac acccacctcc tcaagagcat ggaggcccag 6000 ggcttcaagt ccgtggtggc cgtgatcggc ctcccgaacg acccgtccgt gcgcctccac 6060 gaggccctcg gctacaccgc ccgcggcacc ctccgcgccg ccggctacaa gcacggcggc 6120 tggcacgacg tcggcttctg gcagcgcgac ttcgagctgc cggccccgcc gcgcccggtg 6180 cgcccggtga cgcagatctg agtcgaaacc tagacttgtc catcttctgg attggccaac 6240 ttaattaatg tatgaaataa aaggatgcac acatagtgac atgctaatca ctataatgtg 6300 ggcatcaaag ttgtgtgtta tgtgtaatta ctagttatct gaataaaaga gaaagagatc 6360 atccatattt cttatcctaa atgaatgtca cgtgtcttta taattctttg atgaaccaga 6420 tgcatttcat taaccaaatc catatacata taaatattaa tcatatataa ttaatatcaa 6480 ttgggttagc aaaacaaatc tagtctaggt gtgttttgcg aattgcggcc gccaccgcgg 6540 tggagctcga attcattccg attaatcgtg gcctcttgct cttcaggatg aagagctatg 6600 tttaaacgtg caagcgctac tagacaattc agtacattaa aaacgtccgc aatgtgttat 6660 taagttgtct aagcgtcaat ttggtttaca ccacaatata tcctgccacc agccagccaa 6720 cagctccccg accggcagct cggcacaaaa tcaccactcg atacaggcag cccatcagtc 6780 cgggacggcg tcagcgggag agccgttgta aggcggcaga ctttgctcat gttaccgatg 6840 ctattcggaa gaacggcaac taagctgccg ggtttgaaac acggatgatc tcgcggaggg 6900 tagcatgttg attgtaacga tgacagagcg ttgctgcctg tgatcaaata tcatctccct 6960 cgcagagatc cgaattatca gccttcttat tcatttctcg cttaaccgtg acaggctgtc 7020 gatcttgaga actatgccga cataatagga aatcgctgga taaagccgct gaggaagctg 7080 agtggcgcta tttctttaga agtgaacgtt gacgatcgtc gaccgtaccc cgatgaatta 7140 attcggacgt acgttctgaa cacagctgga tacttacttg ggcgattgtc atacatgaca 7200 tcaacaatgt acccgtttgt gtaaccgtct cttggaggtt cgtatgacac tagtggttcc 7260 cctcagcttg cgactagatg ttgaggccta acattttatt agagagcagg ctagttgctt 7320 agatacatga tcttcaggcc gttatctgtc agggcaagcg aaaattggcc atttatgacg 7380 accaatgccc cgcagaagct cccatctttg ccgccataga cgccgcgccc cccttttggg 7440 gtgtagaaca tccttttgcc agatgtggaa aagaagttcg ttgtcccatt gttggcaatg 7500 acgtagtagc cggcgaaagt gcgagaccca tttgcgctat atataagcct acgatttccg 7560 ttgcgactat tgtcgtaatt ggatgaacta ttatcgtagt tgctctcaga gttgtcgtaa 7620 tttgatggac tattgtcgta attgcttatg gagttgtcgt agttgcttgg agaaatgtcg 7680 tagttggatg gggagtagtc atagggaaga cgagcttcat ccactaaaac aattggcagg 7740 tcagcaagtg cctgccccga tgccatcgca agtacgaggc ttagaaccac cttcaacaga 7800 tcgcgcatag tcttccccag ctctctaacg cttgagttaa gccgcgccgc gaagcggcgt 7860 cggcttgaac gaattgttag acattatttg ccgactacct tggtgatctc gcctttcacg 7920 tagtgaacaa attcttccaa ctgatctgcg cgcgaggcca agcgatcttc ttgtccaaga 7980 taagcctgcc tagcttcaag tatgacgggc tgatactggg ccggcaggcg ctccattgcc 8040 cagtcggcag cgacatcctt cggcgcgatt ttgccggtta ctgcgctgta ccaaatgcgg 8100 gacaacgtaa gcactacatt tcgctcatcg ccagcccagt cgggcggcga gttccatagc 8160 gttaaggttt catttagcgc ctcaaataga tcctgttcag gaaccggatc aaagagttcc 8220 tccgccgctg gacctaccaa ggcaacgcta tgttctcttg cttttgtcag caagatagcc 8280 agatcaatgt cgatcgtggc tggctcgaag atacctgcaa gaatgtcatt gcgctgccat 8340 tctccaaatt gcagttcgcg cttagctgga taacgccacg gaatgatgtc gtcgtgcaca 8400 acaatggtga cttctacagc gcggagaatc tcgctctctc caggggaagc cgaagtttcc 8460 aaaaggtcgt tgatcaaagc tcgccgcgtt gtttcatcaa gccttacagt caccgtaacc 8520 agcaaatcaa tatcactgtg tggcttcagg ccgccatcca ctgcggagcc gtacaaatgt 8580 acggccagca acgtcggttc gagatggcgc tcgatgacgc caactacctc tgatagttga 8640 gtcgatactt cggcgatcac cgcttccctc atgatgttta actcctgaat taagccgcgc 8700 cgcgaagcgg tgtcggcttg aatgaattgt taggcgtcat cctgtgctcc cgagaaccag 8760 taccagtaca tcgctgtttc gttcgagact tgaggtctag ttttatacgt gaacaggtca 8820 atgccgccga gagtaaagcc acattttgcg tacaaattgc aggcaggtac attgttcgtt 8880 tgtgtctcta atcgtatgcc aaggagctgt ctgcttagtg cccacttttt cgcaaattcg 8940 atgagactgt gcgcgactcc tttgcctcgg tgcgtgtgcg acacaacaat gtgttcgata 9000 gaggctagat cgttccatgt tgagttgagt tcaatcttcc cgacaagctc ttggtcgatg 9060 aatgcgccat agcaagcaga gtcttcatca gagtcatcat ccgagatgta atccttccgg 9120 taggggctca cacttctggt agatagttca aagccttggt cggataggtg cacatcgaac 9180 acttcacgaa caatgaaatg gttctcagca tccaatgttt ccgccacctg ctcagggatc 9240 accgaaatct tcatatgacg cctaacgcct ggcacagcgg atcgcaaacc tggcgcggct 9300 tttggcacaa aaggcgtgac aggtttgcga atccgttgct gccacttgtt aacccttttg 9360 ccagatttgg taactataat ttatgttaga ggcgaagtct tgggtaaaaa ctggcctaaa 9420 attgctgggg atttcaggaa agtaaacatc accttccggc tcgatgtcta ttgtagatat 9480 atgtagtgta tctacttgat cgggggatct gctgcctcgc gcgtttcggt gatgacggtg 9540 aaaacctctg acacatgcag ctcccggaga cggtcacagc ttgtctgtaa gcggatgccg 9600 ggagcagaca agcccgtcag ggcgcgtcag cgggtgttgg cgggtgtcgg ggcgcagcca 9660 tgacccagtc acgtagcgat agcggagtgt atactggctt aactatgcgg catcagagca 9720 gattgtactg agagtgcacc atatgcggtg tgaaataccg cacagatgcg taaggagaaa 9780 ataccgcatc aggcgctctt ccgcttcctc gctcactgac tcgctgcgct cggtcgttcg 9840 gctgcggcga gcggtatcag ctcactcaaa ggcggtaata cggttatcca cagaatcagg 9900 ggataacgca ggaaagaaca tgtgagcaaa aggccagcaa aaggccagga accgtaaaaa 9960 ggccgcgttg ctggcgtttt tccataggct ccgcccccct gacgagcatc acaaaaatcg 10020 acgctcaagt cagaggtggc gaaacccgac aggactataa agataccagg cgtttccccc 10080 tggaagctcc ctcgtgcgct ctcctgttcc gaccctgccg cttaccggat acctgtccgc 10140 ctttctccct tcgggaagcg tggcgctttc tcatagctca cgctgtaggt atctcagttc 10200 ggtgtaggtc gttcgctcca agctgggctg tgtgcacgaa ccccccgttc agcccgaccg 10260 ctgcgcctta tccggtaact atcgtcttga gtccaacccg gtaagacacg acttatcgcc 10320 actggcagca gccactggta acaggattag cagagcgagg tatgtaggcg gtgctacaga 10380 gttcttgaag tggtggccta actacggcta cactagaagg acagtatttg gtatctgcgc 10440 tctgctgaag ccagttacct tcggaaaaag agttggtagc tcttgatccg gcaaacaaac 10500 caccgctggt agcggtggtt tttttgtttg caagcagcag attacgcgca gaaaaaaagg 10560 atctcaagaa gatcctttga tcttttctac ggggtctgac gctcagtgga acgaaaactc 10620 acgttaaggg attttggtca tgagattatc aaaaaggatc ttcacctaga tccttttaaa 10680 ttaaaaatga agttttaaat caatctaaag tatatatgag taaacttggt ctgacagtta 10740 ccaatgctta atcagtgagg cacctatctc agcgatctgt ctatttcgtt catccatagt 10800 tgcctgactc cccgtcgtgt agataactac gatacgggag ggcttaccat ctggccccag 10860 tgctgcaatg ataccgcgag acccacgctc accggctcca gatttatcag caataaacca 10920 gccagccgga agggccgagc gcagaagtgg tcctgcaact ttatccgcct ccatccagtc 10980 tattaattgt tgccgggaag ctagagtaag tagttcgcca gttaatagtt tgcgcaacgt 11040 tgttgccatt gctgcagggg gggggggggg gggggacttc cattgttcat tccacggaca 11100 aaaacagaga aaggaaacga cagaggccaa aaagcctcgc tttcagcacc tgtcgtttcc 11160 tttcttttca gagggtattt taaataaaaa cattaagtta tgacgaagaa gaacggaaac 11220 gccttaaacc ggaaaatttt cataaatagc gaaaacccgc gaggtcgccg ccccgtaacc 11280 tacctgtcgg atcaccggaa aggacccgta aagtgataat gattatcatc tacatatcac 11340 aacgtgcgtg gaggccatca aaccacgtca aataatcaat tatgacgcag gtatcgtatt 11400 aattgatctg catcaactta acgtaaaaac aacttcagac aatacaaatc agcgacactg 11460 aatacggggc aacctcatgt cccccccccc cccccccctg caggcatcgt ggtgtcacgc 11520 tcgtcgtttg gtatggcttc attcagctcc ggttcccaac gatcaaggcg agttacatga 11580 tcccccatgt tgtgcaaaaa agcggttagc tccttcggtc ctccgatcgt tgtcagaagt 11640 aagttggccg cagtgttatc actcatggtt atggcagcac tgcataattc tcttactgtc 11700 atgccatccg taagatgctt ttctgtgact ggtgagtact caaccaagtc attctgagaa 11760 tagtgtatgc ggcgaccgag ttgctcttgc ccggcgtcaa cacgggataa taccgcgcca 11820 catagcagaa ctttaaaagt gctcatcatt ggaaaacgtt cttcggggcg aaaactctca 11880 aggatcttac cgctgttgag atccagttcg atgtaaccca ctcgtgcacc caactgatct 11940 tcagcatctt ttactttcac cagcgtttct gggtgagcaa aaacaggaag gcaaaatgcc 12000 gcaaaaaagg gaataagggc gacacggaaa tgttgaatac tcatactctt cctttttcaa 12060 tattattgaa gcatttatca gggttattgt ctcatgagcg gatacatatt tgaatgtatt 12120 tagaaaaata aacaaatagg ggttccgcgc acatttcccc gaaaagtgcc acctgacgtc 12180 taagaaacca ttattatcat gacattaacc tataaaaata ggcgtatcac gaggcccttt 12240 cgtcttcaag aattcggagc ttttgccatt ctcaccggat tcagtcgtca ctcatggtga 12300 tttctcactt gataacctta tttttgacga ggggaaatta ataggttgta ttgatgttgg 12360 acgagtcgga atcgcagacc gataccagga tcttgccatc ctatggaact gcctcggtga 12420 gttttctcct tcattacaga aacggctttt tcaaaaatat ggtattgata atcctgatat 12480 gaataaattg cagtttcatt tgatgctcga tgagtttttc taatcagaat tggttaattg 12540 gttgtaacac tggcagagca ttacgctgac ttgacgggac ggcggctttg ttgaataaat 12600 cgaacttttg ctgagttgaa ggatcagatc acgcatcttc ccgacaacgc agaccgttcc 12660 gtggcaaagc aaaagttcaa aatcaccaac tggtccacct acaacaaagc tctcatcaac 12720 cgtggctccc tcactttctg gctggatgat ggggcgattc aggcctggta tgagtcagca 12780 acaccttctt cacgaggcag acctcagcgc cagaaggccg ccagagaggc cgagcgcggc 12840 cgtgaggctt ggacgctagg gcagggcatg aaaaagcccg tagcgggctg ctacgggcgt 12900 ctgacgcggt ggaaaggggg aggggatgtt gtctacatgg ctctgctgta gtgagtgggt 12960 tgcgctccgg cagcggtcct gatcaatcgt caccctttct cggtccttca acgttcctga 13020 caacgagcct ccttttcgcc aatccatcga caatcaccgc gagtccctgc tcgaacgctg 13080 cgtccggacc ggcttcgtcg aaggcgtcta tcgcggcccg caacagcggc gagagcggag 13140 cctgttcaac ggtgccgccg cgctcgccgg catcgctgtc gccggcctgc tcctcaagca 13200 cggccccaac agtgaagtag ctgattgtca tcagcgcatt gacggcgtcc ccggccgaaa 13260 aacccgcctc gcagaggaag cgaagctgcg cgtcggccgt ttccatctgc ggtgcgcccg 13320 gtcgcgtgcc ggcatggatg cgcgcgccat cgcggtaggc gagcagcgcc tgcctgaagc 13380 tgcgggcatt cccgatcaga aatgagcgcc agtcgtcgtc ggctctcggc accgaatgcg 13440 tatgattctc cgccagcatg gcttcggcca gtgcgtcgag cagcgcccgc ttgttcctga 13500 agtgccagta aagcgccggc tgctgaaccc ccaaccgttc cgccagtttg cgtgtcgtca 13560 gaccgtctac gccgacctcg ttcaacaggt ccagggcggc acggatcact gtattcggct 13620 gcaactttgt catgcttgac actttatcac tgataaacat aatatgtcca ccaacttatc 13680 agtgataaag aatccgcgcg ttcaatcgga ccagcggagg ctggtccgga ggccagacgt 13740 gaaacccaac atacccctga tcgtaattct gagcactgtc gcgctcgacg ctgtcggcat 13800 cggcctgatt atgccggtgc tgccgggcct cctgcgcgat ctggttcact cgaacgacgt 13860 caccgcccac tatggcattc tgctggcgct gtatgcgttg gtgcaatttg cctgcgcacc 13920 tgtgctgggc gcgctgtcgg atcgtttcgg gcggcggcca atcttgctcg tctcgctggc 13980 cggcgccact gtcgactacg ccatcatggc gacagcgcct ttcctttggg ttctctatat 14040 cgggcggatc gtggccggca tcaccggggc gactggggcg gtagccggcg cttatattgc 14100 cgatatcact gatggcgatg agcgcgcgcg gcacttcggc ttcatgagcg cctgtttcgg 14160 gttcgggatg gtcgcgggac ctgtgctcgg tgggctgatg ggcggtttct ccccccacgc 14220 tccgttcttc gccgcggcag ccttgaacgg cctcaatttc ctgacgggct gtttcctttt 14280 gccggagtcg cacaaaggcg aacgccggcc gttacgccgg gaggctctca acccgctcgc 14340 ttcgttccgg tgggcccggg gcatgaccgt cgtcgccgcc ctgatggcgg tcttcttcat 14400 catgcaactt gtcggacagg tgccggccgc gctttgggtc attttcggcg aggatcgctt 14460 tcactgggac gcgaccacga tcggcatttc gcttgccgca tttggcattc tgcattcact 14520 cgcccaggca atgatcaccg gccctgtagc cgcccggctc ggcgaaaggc gggcactcat 14580 gctcggaatg attgccgacg gcacaggcta catcctgctt gccttcgcga cacggggatg 14640 gatggcgttc ccgatcatgg tcctgcttgc ttcgggtggc atcggaatgc cggcgctgca 14700 agcaatgttg tccaggcagg tggatgagga acgtcagggg cagctgcaag gctcactggc 14760 ggcgctcacc agcctgacct cgatcgtcgg acccctcctc ttcacggcga tctatgcggc 14820 ttctataaca acgtggaacg ggtgggcatg gattgcaggc gctgccctct acttgctctg 14880 cctgccggcg ctgcgtcgcg ggctttggag cggcgcaggg caacgagccg atcgctgatc 14940 gtggaaacga taggcctatg ccatgcgggt caaggcgact tccggcaagc tatacgcgcc 15000 ctaggagtgc ggttggaacg ttggcccagc cagatactcc cgatcacgag caggacgccg 15060 atgatttgaa gcgcactcag cgtctgatcc aagaacaacc atcctagcaa cacggcggtc 15120 cccgggctga gaaagcccag taaggaaaca actgtaggtt cgagtcgcga gatcccccgg 15180 aaccaaagga agtaggttaa acccgctccg atcaggccga gccacgccag gccgagaaca 15240 ttggttcctg taggcatcgg gattggcgga tcaaacacta aagctactgg aacgagcaga 15300 agtcctccgg ccgccagttg ccaggcggta aaggtgagca gaggcacggg aggttgccac 15360 ttgcgggtca gcacggttcc gaacgccatg gaaaccgccc ccgccaggcc cgctgcgacg 15420 ccgacaggat ctagcgctgc gtttggtgtc aacaccaaca gcgccacgcc cgcagttccg 15480 caaatagccc ccaggaccgc catcaatcgt atcgggctac ctagcagagc ggcagagatg 15540 aacacgacca tcagcggctg cacagcgcct accgtcgccg cgaccccgcc cggcaggcgg 15600 tagaccgaaa taaacaacaa gctccagaat agcgaaatat taagtgcgcc gaggatgaag 15660 atgcgcatcc accagattcc cgttggaatc tgtcggacga tcatcacgag caataaaccc 15720 gccggcaacg cccgcagcag cataccggcg acccctcggc ctcgctgttc gggctccacg 15780 aaaacgccgg acagatgcgc cttgtgagcg tccttggggc cgtcctcctg tttgaagacc 15840 gacagcccaa tgatctcgcc gtcgatgtag gcgccgaatg ccacggcatc tcgcaaccgt 15900 tcagcgaacg cctccatggg ctttttctcc tcgtgctcgt aaacggaccc gaacatctct 15960 ggagctttct tcagggccga caatcggatc tcgcggaaat cctgcacgtc ggccgctcca 16020 agccgtcgaa tctgagcctt aatcacaatt gtcaatttta atcctctgtt tatcggcagt 16080 tcgtagagcg cgccgtgcgt cccgagcgat actgagcgaa gcaagtgcgt cgagcagtgc 16140 ccgcttgttc ctgaaatgcc agtaaagcgc tggctgctga acccccagcc ggaactgacc 16200 ccacaaggcc ctagcgtttg caatgcacca ggtcatcatt gacccaggcg tgttccacca 16260 ggccgctgcc tcgcaactct tcgcaggctt cgccgacctg ctcgcgccac ttcttcacgc 16320 gggtggaatc cgatccgcac atgaggcgga aggtttccag cttgagcggg tacggctccc 16380 ggtgcgagct gaaatagtcg aacatccgtc gggccgtcgg cgacagcttg cggtacttct 16440 cccatatgaa tttcgtgtag tggtcgccag caaacagcac gacgatttcc tcgtcgatca 16500 ggacctggca acgggacgtt ttcttgccac ggtccaggac gcggaagcgg tgcagcagcg 16560 acaccgattc caggtgccca acgcggtcgg acgtgaagcc catcgccgtc gcctgtaggc 16620 gcgacaggca ttcctcggcc ttcgtgtaat accggccatt gatcgaccag cccaggtcct 16680 ggcaaagctc gtagaacgtg aaggtgatcg gctcgccgat aggggtgcgc ttcgcgtact 16740 ccaacacctg ctgccacacc agttcgtcat cgtcggcccg cagctcgacg ccggtgtagg 16800 tgatcttcac gtccttgttg acgtggaaaa tgaccttgtt ttgcagcgcc tcgcgcggga 16860 ttttcttgtt gcgcgtggtg aacagggcag agcgggccgt gtcgtttggc atcgctcgca 16920 tcgtgtccgg ccacggcgca atatcgaaca aggaaagctg catttccttg atctgctgct 16980 tcgtgtgttt cagcaacgcg gcctgcttgg cctcgctgac ctgttttgcc aggtcctcgc 17040 cggcggtttt tcgcttcttg gtcgtcatag ttcctcgcgt gtcgatggtc atcgacttcg 17100 ccaaacctgc cgcctcctgt tcgagacgac gcgaacgctc cacggcggcc gatggcgcgg 17160 gcagggcagg gggagccagt tgcacgctgt cgcgctcgat cttggccgta gcttgctgga 17220 ccatcgagcc gacggactgg aaggtttcgc ggggcgcacg catgacggtg cggcttgcga 17280 tggtttcggc atcctcggcg gaaaaccccg cgtcgatcag ttcttgcctg tatgccttcc 17340 ggtcaaacgt ccgattcatt caccctcctt gcgggattgc cccgactcac gccggggcaa 17400 tgtgccctta ttcctgattt gacccgcctg gtgccttggt gtccagataa tccaccttat 17460 cggcaatgaa gtcggtcccg tagaccgtct ggccgtcctt ctcgtacttg gtattccgaa 17520 tcttgccctg cacgaatacc agcgacccct tgcccaaata cttgccgtgg gcctcggcct 17580 gagagccaaa acacttgatg cggaagaagt cggtgcgctc ctgcttgtcg ccggcatcgt 17640 tgcgccactc ttcattaacc gctatatcga aaattgcttg cggcttgtta gaattgccat 17700 gacgtacctc ggtgtcacgg gtaagattac cgataaactg gaactgatta tggctcatat 17760 cgaaagtctc cttgagaaag gagactctag tttagctaaa cattggttcc gctgtcaaga 17820 actttagcgg ctaaaatttt gcgggccgcg accaaaggtg cgaggggcgg cttccgctgt 17880 gtacaaccag atatttttca ccaacatcct tcgtctgctc gatgagcggg gcatgacgaa 17940 acatgagctg tcggagaggg caggggtttc aatttcgttt ttatcagact taaccaacgg 18000 taaggccaac ccctcgttga aggtgatgga ggccattgcc gacgccctgg aaactcccct 18060 acctcttctc ctggagtcca ccgaccttga ccgcgaggca ctcgcggaga ttgcgggtca 18120 tcctttcaag agcagcgtgc cgcccggata cgaacgcatc agtgtggttt tgccgtcaca 18180 taaggcgttt atcgtaaaga aatggggcga cgacacccga aaaaagctgc gtggaaggct 18240 ctgacgccaa gggttagggc ttgcacttcc ttctttagcc gctaaaacgg ccccttctct 18300 gcgggccgtc ggctcgcgca tcatatcgac atcctcaacg gaagccgtgc cgcgaatggc 18360 atcgggcggg tgcgctttga cagttgtttt ctatcagaac ccctacgtcg tgcggttcga 18420 ttagctgttt gtcttgcagg ctaaacactt tcggtatatc gtttgcctgt gcgataatgt 18480 tgctaatgat ttgttgcgta ggggttactg aaaagtgagc gggaaagaag agtttcagac 18540 catcaaggag cgggccaagc gcaagctgga acgcgacatg ggtgcggacc tgttggccgc 18600 gctcaacgac ccgaaaaccg ttgaagtcat gctcaacgcg gacggcaagg tgtggcacga 18660 acgccttggc gagccgatgc ggtacatctg cgacatgcgg cccagccagt cgcaggcgat 18720 tatagaaacg gtggccggat tccacggcaa agaggtcacg cggcattcgc ccatcctgga 18780 aggcgagttc cccttggatg gcagccgctt tgccggccaa ttgccgccgg tcgtggccgc 18840 gccaaccttt gcgatccgca agcgcgcggt cgccatcttc acgctggaac agtacgtcga 18900 ggcgggcatc atgacccgcg agcaatacga ggtcattaaa agcgccgtcg cggcgcatcg 18960 aaacatcctc gtcattggcg gtactggctc gggcaagacc acgctcgtca acgcgatcat 19020 caatgaaatg gtcgccttca acccgtctga gcgcgtcgtc atcatcgagg acaccggcga 19080 aatccagtgc gccgcagaga acgccgtcca ataccacacc agcatcgacg tctcgatgac 19140 gctgctgctc aagacaacgc tgcgtatgcg ccccgaccgc atcctggtcg gtgaggtacg 19200 tggccccgaa gcccttgatc tgttgatggc ctggaacacc gggcatgaag gaggtgccgc 19260 caccctgcac gcaaacaacc ccaaagcggg cctgagccgg ctcgccatgc ttatcagcat 19320 gcacccggat tcaccgaaac ccattgagcc gctgattggc gaggcggttc atgtggtcgt 19380 ccatatcgcc aggaccccta gcggccgtcg agtgcaagaa attctcgaag ttcttggtta 19440 cgagaacggc cagtacatca ccaaaaccct gtaaggagta tttccaatga caacggctgt 19500 tccgttccgt ctgaccatga atcgcggcat tttgttctac cttgccgtgt tcttcgttct 19560 cgctctcgcg ttatccgcgc atccggcgat ggcctcggaa ggcaccggcg gcagcttgcc 19620 atatgagagc tggctgacga acctgcgcaa ctccgtaacc ggcccggtgg ccttcgcgct 19680 gtccatcatc ggcatcgtcg tcgccggcgg cgtgctgatc ttcggcggcg aactcaacgc 19740 cttcttccga accctgatct tcctggttct ggtgatggcg ctgctggtcg gcgcgcagaa 19800 cgtgatgagc accttcttcg gtcgtggtgc cgaaatcgcg gccctcggca acggggcgct 19860 gcaccaggtg caagtcgcgg cggcggatgc cgtgcgtgcg gtagcggctg gacggctcgc 19920 ctaatcatgg ctctgcgcac gatccccatc cgtcgcgcag gcaaccgaga aaacctgttc 19980 atgggtggtg atcgtgaact ggtgatgttc tcgggcctga tggcgtttgc gctgattttc 20040 agcgcccaag agctgcgggc caccgtggtc ggtctgatcc tgtggttcgg ggcgctctat 20100 gcgttccgaa tcatggcgaa ggccgatccg aagatgcggt tcgtgtacct gcgtcaccgc 20160 cggtacaagc cgtattaccc ggcccgctcg accccgttcc gcgagaacac caatagccaa 20220 gggaagcaat accgatgatc caagcaattg cgattgcaat cgcgggcctc ggcgcgcttc 20280 tgttgttcat cctctttgcc cgcatccgcg cggtcgatgc cgaactgaaa ctgaaaaagc 20340 atcgttccaa ggacgccggc ctggccgatc tgctcaacta cgccgctgtc gtcgatgacg 20400 gcgtaatcgt gggcaagaac ggcagcttta tggctgcctg gctgtacaag ggcgatgaca 20460 acgcaagcag caccgaccag cagcgcgaag tagtgtccgc ccgcatcaac caggccctcg 20520 cgggcctggg aagtgggtgg atgatccatg tggacgccgt gcggcgtcct gctccgaact 20580 acgcggagcg gggcctgtcg gcgttccctg accgtctgac ggcagcgatt gaagaagagc 20640 gctcggtctt gccttgctcg tcggtgatgt acttcaccag ctccgcgaag tcgctcttct 20700 tgatggagcg catggggacg tgcttggcaa tcacgcgcac cccccggccg ttttagcggc 20760 taaaaaagtc atggctctgc cctcgggcgg accacgccca tcatgacctt gccaagctcg 20820 tcctgcttct cttcgatctt cgccagcagg gcgaggatcg tggcatcacc gaaccgcgcc 20880 gtgcgcgggt cgtcggtgag ccagagtttc agcaggccgc ccaggcggcc caggtcgcca 20940 ttgatgcggg ccagctcgcg gacgtgctca tagtccacga cgcccgtgat tttgtagccc 21000 tggccgacgg ccagcaggta ggccgacagg ctcatgccgg ccgccgccgc cttttcctca 21060 atcgctcttc gttcgtctgg aaggcagtac accttgatag gtgggctgcc cttcctggtt 21120 ggcttggttt catcagccat ccgcttgccc tcatctgtta cgccggcggt agccggccag 21180 cctcgcagag caggattccc gttgagcacc gccaggtgcg aataagggac agtgaagaag 21240 gaacacccgc tcgcgggtgg gcctacttca cctatcctgc ccggctgacg ccgttggata 21300 caccaaggaa agtctacacg aaccctttgg caaaatcctg tatatcgtgc gaaaaaggat 21360 ggatataccg aaaaaatcgc tataatgacc ccgaagcagg gttatgcagc ggaaaagcgc 21420 tgcttccctg ctgttttgtg gaatatctac cgactggaaa caggcaaatg caggaaatta 21480 ctgaactgag gggacaggcg agagacgatg ccaaagagct acaccgacga gctggccgag 21540 tgggttgaat cccgcgcggc caagaagcgc cggcgtgatg aggctgcggt tgcgttcctg 21600 gcggtgaggg cggatgtcga ggcggcgtta gcgtccggct atgcgctcgt caccatttgg 21660 gagcacatgc gggaaacggg gaaggtcaag ttctcctacg agacgttccg ctcgcacgcc 21720 aggcggcaca tcaaggccaa gcccgccgat gtgcccgcac cgcaggccaa ggctgcggaa 21780 cccgcgccgg cacccaagac gccggagcca cggcggccga agcagggggg caaggctgaa 21840 aagccggccc ccgctgcggc cccgaccggc ttcaccttca acccaacacc ggacaaaaag 21900 gatctactgt aatggcgaaa attcacatgg ttttgcaggg caagggcggg gtcggcaagt 21960 cggccatcgc cgcgatcatt gcgcagtaca agatggacaa ggggcagaca cccttgtgca 22020 tcgacaccga cccggtgaac gcgacgttcg agggctacaa ggccctgaac gtccgccggc 22080 tgaacatcat ggccggcgac gaaattaact cgcgcaactt cgacaccctg gtcgagctga 22140 ttgcgccgac caaggatgac gtggtgatcg acaacggtgc cagctcgttc gtgcctctgt 22200 cgcattacct catcagcaac caggtgccgg ctctgctgca agaaatgggg catgagctgg 22260 tcatccatac cgtcgtcacc ggcggccagg ctctcctgga cacggtgagc ggcttcgccc 22320 agctcgccag ccagttcccg gccgaagcgc ttttcgtggt ctggctgaac ccgtattggg 22380 ggcctatcga gcatgagggc aagagctttg agcagatgaa ggcgtacacg gccaacaagg 22440 cccgcgtgtc gtccatcatc cagattccgg ccctcaagga agaaacctac ggccgcgatt 22500 tcagcgacat gctgcaagag cggctgacgt tcgaccaggc gctggccgat gaatcgctca 22560 cgatcatgac gcggcaacgc ctcaagatcg tgcggcgcgg cctgtttgaa cagctcgacg 22620 cggcggccgt gctatgagcg accagattga agagctgatc cgggagattg cggccaagca 22680 cggcatcgcc gtcggccgcg acgacccggt gctgatcctg cataccatca acgcccggct 22740 catggccgac agtgcggcca agcaagagga aatccttgcc gcgttcaagg aagagctgga 22800 agggatcgcc catcgttggg gcgaggacgc caaggccaaa gcggagcgga tgctgaacgc 22860 ggccctggcg gccagcaagg acgcaatggc gaaggtaatg aaggacagcg ccgcgcaggc 22920 ggccgaagcg atccgcaggg aaatcgacga cggccttggc cgccagctcg cggccaaggt 22980 cgcggacgcg cggcgcgtgg cgatgatgaa catgatcgcc ggcggcatgg tgttgttcgc 23040 ggccgccctg gtggtgtggg cctcgttatg aatcgcagag gcgcagatga aaaagcccgg 23100 cgttgccggg ctttgttttt gcgttagctg ggcttgtttg acaggcccaa gctctgactg 23160 cgcccgcgct cgcgctcctg ggcctgtttc ttctcctgct cctgcttgcg catcagggcc 23220 tggtgccgtc gggctgcttc acgcatcgaa tcccagtcgc cggccagctc gggatgctcc 23280 gcgcgcatct tgcgcgtcgc cagttcctcg atcttgggcg cgtgaatgcc catgccttcc 23340 ttgatttcgc gcaccatgtc cagccgcgtg tgcagggtct gcaagcgggc ttgctgttgg 23400 gcctgctgct gctgccaggc ggcctttgta cgcggcaggg acagcaagcc gggggcattg 23460 gactgtagct gctgcaaacg cgcctgctga cggtctacga gctgttctag gcggtcctcg 23520 atgcgctcca cctggtcatg ctttgcctgc acgtagagcg caagggtctg ctggtaggtc 23580 tgctcgatgg gcgcggattc taagagggcc tgctgttccg tctcggcctc ctgggccgcc 23640 tgtagcaaat cctcgccgct gttgccgctg gactgcttta ctgccgggga ctgctgttgc 23700 cctgctcgcg ccgtcgtcgc agttcggctt gcccccactc gattgactgc ttcatttcga 23760 gccgcagcga tgcgatctcg gattgcgtca acggacgggg cagcgcggag gtgtccggct 23820 tctccttggg tgagtcggtc gatgccatag ccaaaggttt ccttccaaaa tgcgtccatt 23880 gctggaccgt gtttctcatt gatgcccgca agcatcttcg gcttgaccgc caggtcaagc 23940 gcgccttcat gggcggtcat gacggacgcc gccatgacct tgccgccgtt gttctcgatg 24000 tagccgcgta atgaggcaat ggtgccgccc atcgtcagcg tgtcatcgac aacgatgtac 24060 ttctggccgg ggatcacctc cccctcgaaa gtcgggttga acgccaggcg atgatctgaa 24120 ccggctccgg ttcgggcgac cttctcccgc tgcacaatgt ccgtttcgac ctcaaggcca 24180 aggcggtcgg ccagaacgac cgccatcatg gccggaatct tgttgttccc cgccgcctcg 24240 acggcgagga ctggaacgat gcggggcttg tcgtcgccga tcagcgtctt gagctgggca 24300 acagtgtcgt ccgaaatcag gcgctcgacc aaattaagcg ccgcttccgc gtcgccctgc 24360 ttcgcagcct ggtattcagg ctcgttggtc aaagaaccaa ggtcgccgtt gcgaaccacc 24420 ttcgggaagt ctccccacgg tgcgcgctcg gctctgctgt agctgctcaa gacgcctccc 24480 tttttagccg ctaaaactct aacgagtgcg cccgcgactc aacttgacgc tttcggcact 24540 tacctgtgcc ttgccacttg cgtcataggt gatgcttttc gcactcccga tttcaggtac 24600 tttatcgaaa tctgaccggg cgtgcattac aaagttcttc cccacctgtt ggtaaatgct 24660 gccgctatct gcgtggacga tgctgccgtc gtggcgctgc gacttatcgg ccttttgggc 24720 catatagatg ttgtaaatgc caggtttcag ggccccggct ttatctacct tctggttcgt 24780 ccatgcgcct tggttctcgg tctggacaat tctttgccca ttcatgacca ggaggcggtg 24840 tttcattggg tgactcctga cggttgcctc tggtgttaaa cgtgtcctgg tcgcttgccg 24900 gctaaaaaaa agccgacctc ggcagttcga ggccggcttt ccctagagcc gggcgcgtca 24960 aggttgttcc atctatttta gtgaactgcg ttcgatttat cagttacttt cctcccgctt 25020 tgtgtttcct cccactcgtt tccgcgtcta gccgacccct caacatagcg gcctcttctt 25080 gggctgcctt tgcctcttgc cgcgcttcgt cacgctcggc ttgcaccgtc gtaaagcgct 25140 cggcctgcct ggccgcctct tgcgccgcca acttcctttg ctcctggtgg gcctcggcgt 25200 cggcctgcgc cttcgctttc accgctgcca actccgtgcg caaactctcc gcttcgcgcc 25260 tggtggcgtc gcgctcgccg cgaagcgcct gcatttcctg gttggccgcg tccagggtct 25320 tgcggctctc ttctttgaat gcgcgggcgt cctggtgagc gtagtccagc tcggcgcgca 25380 gctcctgcgc tcgacgctcc acctcgtcgg cccgctgcgt cgccagcgcg gcccgctgct 25440 cggctcctgc cagggcggtg cgtgcttcgg ccagggcttg ccgctggcgt gcggccagct 25500 cggccgcctc ggcggcctgc tgctctagca atgtaacgcg cgcctgggct tcttccagct 25560 cgcgggcctg cgcctcgaag gcgtcggcca gctccccgcg cacggcttcc aactcgttgc 25620 gctcacgatc ccagccggct tgcgctgcct gcaacgattc attggcaagg gcctgggcgg 25680 cttgccagag ggcggccacg gcctggttgc cggcctgctg caccgcgtcc ggcacctgga 25740 ctgccagcgg ggcggcctgc gccgtgcgct ggcgtcgcca ttcgcgcatg ccggcgctgg 25800 cgtcgttcat gttgacgcgg gcggccttac gcactgcatc cacggtcggg aagttctccc 25860 ggtcgccttg ctcgaacagc tcgtccgcag ccgcaaaaat gcggtcgcgc gtctctttgt 25920 tcagttccat gttggctccg gtaattggta agaataataa tactcttacc taccttatca 25980 gcgcaagagt ttagctgaac agttctcgac ttaacggcag gttttttagc ggctgaaggg 26040 caggcaaaaa aagccccgca cggtcggcgg gggcaaaggg tcagcgggaa ggggattagc 26100 gggcgtcggg cttcttcatg cgtcggggcc gcgcttcttg ggatggagca cgacgaagcg 26160 cgcacgcgca tcgtcctcgg ccctatcggc ccgcgtcgcg gtcaggaact tgtcgcgcgc 26220 taggtcctcc ctggtgggca ccaggggcat gaactcggcc tgctcgatgt aggtccactc 26280 catgaccgca tcgcagtcga ggccgcgttc cttcaccgtc tcttgcaggt cgcggtacgc 26340 ccgctcgttg agcggctggt aacgggccaa ttggtcgtaa atggctgtcg gccatgagcg 26400 gcctttcctg ttgagccagc agccgacgac gaagccggca atgcaggccc ctggcacaac 26460 caggccgacg ccgggggcag gggatggcag cagctcgcca accaggaacc ccgccgcgat 26520 gatgccgatg ccggtcaacc agcccttgaa actatccggc cccgaaacac ccctgcgcat 26580 tgcctggatg ctgcgccgga tagcttgcaa catcaggagc cgtttctttt gttcgtcagt 26640 catggtccgc cctcaccagt tgttcgtatc ggtgtcggac gaactgaaat cgcaagagct 26700 gccggtatcg gtccagccgc tgtccgtgtc gctgctgccg aagcacggcg aggggtccgc 26760 gaacgccgca gacggcgtat ccggccgcag cgcatcgccc agcatggccc cggtcagcga 26820 gccgccggcc aggtagccca gcatggtgct gttggtcgcc ccggccacca gggccgacgt 26880 gacgaaatcg ccgtcattcc ctctggattg ttcgctgctc ggcggggcag tgcgccgcgc 26940 cggcggcgtc gtggatggct cgggttggct ggcctgcgac ggccggcgaa aggtgcgcag 27000 cagctcgtta tcgaccggct gcggcgtcgg ggccgccgcc ttgcgctgcg gtcggtgttc 27060 cttcttcggc tcgcgcagct tgaacagcat gatcgcggaa accagcagca acgccgcgcc 27120 tacgcctccc gcgatgtaga acagcatcgg attcattctt cggtcctcct tgtagcggaa 27180 ccgttgtctg tgcggcgcgg gtggcccgcg ccgctgtctt tggggatcag ccctcgatga 27240 gcgcgaccag tttcacgtcg gcaaggttcg cctcgaactc ctggccgtcg tcctcgtact 27300 tcaaccaggc atagccttcc gccggcggcc gacggttgag gataaggcgg gcagggcgct 27360 cgtcgtgctc gacctggacg atggcctttt tcagcttgtc cgggtccggc tccttcgcgc 27420 ccttttcctt ggcgtcctta ccgtcctggt cgccgtcctc gccgtcctgg ccgtcgccgg 27480 cctccgcgtc acgctcggca tcagtctggc cgttgaaggc atcgacggtg ttgggatcgc 27540 ggcccttctc gtccaggaac tcgcgcagca gcttgaccgt gccgcgcgtg atttcctggg 27600 tgtcgtcgtc aagccacgcc tcgacttcct ccgggcgctt cttgaaggcc gtcaccagct 27660 cgttcaccac ggtcacgtcg cgcacgcggc cggtgttgaa cgcatcggcg atcttctccg 27720 gcaggtccag cagcgtgacg tgctgggtga tgaacgccgg cgacttgccg atttccttgg 27780 cgatatcgcc tttcttcttg cccttcgcca gctcgcggcc aatgaagtcg gcaatttcgc 27840 gcggggtcag ctcgttgcgt tgcaggttct cgataacctg gtcggcttcg ttgtagtcgt 27900 tgtcgatgaa cgccgggatg gacttcttgc cggcccactt cgagccacgg tagcggcggg 27960 cgccgtgatt gatgatatag cggcccggct gctcctggtt ctcgcgcacc gaaatgggtg 28020 acttcacccc gcgctctttg atcgtggcac cgatttccgc gatgctctcc ggggaaaagc 28080 cggggttgtc ggccgtccgc ggctgatgcg gatcttcgtc gatcaggtcc aggtccagct 28140 cgatagggcc ggaaccgccc tgagacgccg caggagcgtc caggaggctc gacaggtcgc 28200 cgatgctatc caaccccagg ccggacggct gcgccgcgcc tgcggcttcc tgagcggccg 28260 cagcggtgtt tttcttggtg gtcttggctt gagccgcagt cattgggaaa tctccatctt 28320 cgtgaacacg taatcagcca gggcgcgaac ctctttcgat gccttgcgcg cggccgtttt 28380 cttgatcttc cagaccggca caccggatgc gagggcatcg gcgatgctgc tgcgcaggcc 28440 aacggtggcc ggaatcatca tcttggggta cgcggccagc agctcggctt ggtggcgcgc 28500 gtggcgcgga ttccgcgcat cgaccttgct gggcaccatg ccaaggaatt gcagcttggc 28560 gttcttctgg cgcacgttcg caatggtcgt gaccatcttc ttgatgccct ggatgctgta 28620 cgcctcaagc tcgatggggg acagcacata gtcggccgcg aagagggcgg ccgccaggcc 28680 gacgccaagg gtcggggccg tgtcgatcag gcacacgtcg aagccttggt tcgccagggc 28740 cttgatgttc gccccgaaca gctcgcgggc gtcgtccagc gacagccgtt cggcgttcgc 28800 cagtaccggg ttggactcga tgagggcgag gcgcgcggcc tggccgtcgc cggctgcggg 28860 tgcggtttcg gtccagccgc cggcagggac agcgccgaac agcttgcttg catgcaggcc 28920 ggtagcaaag tccttgagcg tgtaggacgc attgccctgg gggtccaggt cgatcacggc 28980 aacccgcaag ccgcgctcga aaaagtcgaa ggcaagatgc acaagggtcg aagtcttgcc 29040 gacgccgcct ttctggttgg ccgtgaccaa agttttcatc gtttggtttc ctgttttttc 29100 ttggcgtccg cttcccactt ccggacgatg tacgcctgat gttccggcag aaccgccgtt 29160 acccgcgcgt acccctcggg caagttcttg tcctcgaacg cggcccacac gcgatgcacc 29220 gcttgcgaca ctgcgcccct ggtcagtccc agcgacgttg cgaacgtcgc ctgtggcttc 29280 ccatcgacta agacgccccg cgctatctcg atggtctgct gccccacttc cagcccctgg 29340 atcgcctcct ggaactggct ttcggtaagc cgtttcttca tggataacac ccataatttg 29400 ctccgcgcct tggttgaaca tagcggtgac agccgccagc acatgagaga agtttagcta 29460 aacatttctc gcacgtcaac acctttagcc gctaaaactc gtccttggcg taacaaaaca 29520 aaagcccgga aaccgggctt tcgtctcttg ccgcttatgg ctctgcaccc ggctccatca 29580 ccaacaggtc gcgcacgcgc ttcactcggt tgcggatcga cactgccagc ccaacaaagc 29640 cggttgccgc cgccgccagg atcgcgccga tgatgccggc cacaccggcc atcgcccacc 29700 aggtcgccgc cttccggttc cattcctgct ggtactgctt cgcaatgctg gacctcggct 29760 caccataggc tgaccgctcg atggcgtatg ccgcttctcc ccttggcgta aaacccagcg 29820 ccgcaggcgg cattgccatg ctgcccgccg ctttcccgac cacgacgcgc gcaccaggct 29880 tgcggtccag accttcggcc acggcgagct gcgcaaggac ataatcagcc gccgacttgg 29940 ctccacgcgc ctcgatcagc tcttgcactc gcgcgaaatc cttggcctcc acggccgcca 30000 tgaatcgcgc acgcggcgaa ggctccgcag ggccggcgtc gtgatcgccg ccgagaatgc 30060 ccttcaccaa gttcgacgac acgaaaatca tgctgacggc tatcaccatc atgcagacgg 30120 atcgcacgaa cccgctgaat tgaacacgag cacggcaccc gcgaccacta tgccaagaat 30180 gcccaaggta aaaattgccg gccccgccat gaagtccgtg aatgccccga cggccgaagt 30240 gaagggcagg ccgccaccca ggccgccgcc ctcactgccc ggcacctggt cgctgaatgt 30300 cgatgccagc acctgcggca cgtcaatgct tccgggcgtc gcgctcgggc tgatcgccca 30360 tcccgttact gccccgatcc cggcaatggc aaggactgcc agcgctgcca tttttggggt 30420 gaggccgttc gcggccgagg ggcgcagccc ctggggggat gggaggcccg cgttagcggg 30480 ccgggagggt tcgagaaggg ggggcacccc ccttcggcgt gcgcggtcac gcgcacaggg 30540 cgcagccctg gttaaaaaca aggtttataa atattggttt aaaagcaggt taaaagacag 30600 gttagcggtg gccgaaaaac gggcggaaac ccttgcaaat gctggatttt ctgcctgtgg 30660 acagcccctc aaatgtcaat aggtgcgccc ctcatctgtc agcactctgc ccctcaagtg 30720 tcaaggatcg cgcccctcat ctgtcagtag tcgcgcccct caagtgtcaa taccgcaggg 30780 cacttatccc caggcttgtc cacatcatct gtgggaaact cgcgtaaaat caggcgtttt 30840 cgccgatttg cgaggctggc cagctccacg tcgccggccg aaatcgagcc tgcccctcat 30900 ctgtcaacgc cgcgccgggt gagtcggccc ctcaagtgtc aacgtccgcc cctcatctgt 30960 cagtgagggc caagttttcc gcgaggtatc cacaacgccg gcggccgcgg tgtctcgcac 31020 acggcttcga cggcgtttct ggcgcgtttg cagggccata gacggccgcc agcccagcgg 31080 cgagggcaac cagcccggtg agcgtcggaa aggcgctgga agccccgtag cgacgcggag 31140 aggggcgaga caagccaagg gcgcaggctc gatgcgcagc acgacatagc cggttctcgc 31200 aaggacgaga atttccctgc ggtgcccctc aagtgtcaat gaaagtttcc aacgcgagcc 31260 attcgcgaga gccttgagtc cacgctagat gagagctttg ttgtaggtgg accagttggt 31320 gattttgaac ttttgctttg ccacggaacg gtctgcgttg tcgggaagat gcgtgatctg 31380 atccttcaac tcagcaaaag ttcgatttat tcaacaaagc cacgttgtgt ctcaaaatct 31440 ctgatgttac attgcacaag ataaaaatat atcatcatga acaataaaac tgtctgctta 31500 cataaacagt aatacaaggg gtgttatgag ccatattcaa cgggaaacgt cttgctcgac 31560 tctagagctc gttcctcgag gaacggtacc tgcggggaag cttacaataa tgtgtgttgt 31620 taagtcttgt tgcctgtcat cgtctgactg actttcgtca taaatcccgg cctccgtaac 31680 ccagctttgg gcaagctcac ggatttgatc cggcggaacg ggaatatcga gatgccgggc 31740 tgaacgctgc agttccagct ttccctttcg ggacaggtac tccagctgat tgattatctg 31800 ctgaagggtc ttggttccac ctcctggcac aatgcgaatg attacttgag cgcgatcggg 31860 catccaattt tctcccgtca ggtgcgtggt caagtgctac aaggcacctt tcagtaacga 31920 gcgaccgtcg atccgtcgcc gggatacgga caaaatggag cgcagtagtc catcgagggc 31980 ggcgaaagcc tcgccaaaag caatacgttc atctcgcaca gcctccagat ccgatcgagg 32040 gtcttcggcg taggcagata gaagcatgga tacattgctt gagagtattc cgatggactg 32100 aagtatggct tccatctttt ctcgtgtgtc tgcatctatt tcgagaaagc ccccgatgcg 32160 gcgcaccgca acgcgaattg ccatactatc cgaaagtccc agcaggcgcg cttgatagga 32220 aaaggtttca tactcggccg atcgcagacg ggcactcacg accttgaacc cttcaacttt 32280 cagggatcga tgctggttga tggtagtctc actcgacgtg gctctggtgt gttttgacat 32340 agcttcctcc aaagaaagcg gaaggtctgg atactccagc acgaaatgtg cccgggtaga 32400 cggatggaag tctagccctg ctcaatatga aatcaacagt acatttacag tcaatactga 32460 atatacttgc tacatttgca attgtcttat aacgaatgtg aaataaaaat agtgtaacaa 32520 cgcttttact catcgataat cacaaaaaca tttatacgaa caaaaataca aatgcactcc 32580 ggtttcacag gataggcggg atcagaatat gcaacttttg acgttttgtt ctttcaaagg 32640 gggtgctggc aaaaccaccg cactcatggg cctttgcgct gctttggcaa atgacggtaa 32700 acgagtggcc ctctttgatg ccgacgaaaa ccggcctctg acgcgatgga gagaaaacgc 32760 cttacaaagc agtactggga tcctcgctgt gaagtctatt ccgccgacga aatgcccctt 32820 cttgaagcag cctatgaaaa tgccgagctc gaaggatttg attatgcgtt ggccgatacg 32880 cgtggcggct cgagcgagct caacaacaca atcatcgcta gctcaaacct gcttctgatc 32940 cccaccatgc taacgccgct cgacatcgat gaggcactat ctacctaccg ctacgtcatc 33000 gagctgctgt tgagtgaaaa tttggcaatt cctacagctg ttttgcgcca acgcgtcccg 33060 gtcggccgat tgacaacatc gcaacgcagg atgtcagaga cgctagagag ccttccagtt 33120 gtaccgtctc ccatgcatga aagagatgca tttgccgcga tgaaagaacg cggcatgttg 33180 catcttacat tactaaacac gggaactgat ccgacgatgc gcctcataga gaggaatctt 33240 cggattgcga tggaggaagt cgtggtcatt tcgaaactga tcagcaaaat cttggaggct 33300 tgaagatggc aattcgcaag cccgcattgt cggtcggcga agcacggcgg cttgctggtg 33360 ctcgacccga gatccaccat cccaacccga cacttgttcc ccagaagctg gacctccagc 33420 acttgcctga aaaagccgac gagaaagacc agcaacgtga gcctctcgtc gccgatcaca 33480 tttacagtcc cgatcgacaa cttaagctaa ctgtggatgc ccttagtcca cctccgtccc 33540 cgaaaaagct ccaggttttt ctttcagcgc gaccgcccgc gcctcaagtg tcgaaaacat 33600 atgacaacct cgttcggcaa tacagtccct cgaagtcgct acaaatgatt ttaaggcgcg 33660 cgttggacga tttcgaaagc atgctggcag atggatcatt tcgcgtggcc ccgaaaagtt 33720 atccgatccc ttcaactaca gaaaaatccg ttctcgttca gacctcacgc atgttcccgg 33780 ttgcgttgct cgaggtcgct cgaagtcatt ttgatccgtt ggggttggag accgctcgag 33840 ctttcggcca caagctggct accgccgcgc tcgcgtcatt ctttgctgga gagaagccat 33900 cgagcaattg gtgaagaggg acctatcgga acccctcacc aaatattgag tgtaggtttg 33960 aggccgctgg ccgcgtcctc agtcaccttt tgagccagat aattaagagc caaatgcaat 34020 tggctcaggc tgccatcgtc cccccgtgcg aaacctgcac gtccgcgtca aagaaataac 34080 cggcacctct tgctgttttt atcagttgag ggcttgacgg atccgcctca agtttgcggc 34140 gcagccgcaa aatgagaaca tctatactcc tgtcgtaaac ctcctcgtcg cgtactcgac 34200 tggcaatgag aagttgctcg cgcgatagaa cgtcgcgggg tttctctaaa aacgcgagga 34260 gaagattgaa ctcacctgcc gtaagtttca cctcaccgcc agcttcggac atcaagcgac 34320 gttgcctgag attaagtgtc cagtcagtaa aacaaaaaga ccgtcggtct ttggagcgga 34380 caacgttggg gcgcacgcgc aaggcaaccc gaatgcgtgc aagaaactct ctcgtactaa 34440 acggcttagc gataaaatca cttgctccta gctcgagtgc aacaacttta tccgtctcct 34500 caaggcggtc gccactgata attatgattg gaatatcaga ctttgccgcc agatttcgaa 34560 cgatctcaag cccatcttca cgacctaaat ttagatcaac aaccacgaca tcgaccgtcg 34620 cggaagagag tactctagtg aactgggtgc tgtcggctac cgcggtcact ttgaaggcgt 34680 ggatcgtaag gtattcgata ataagatgcc gcatagcgac atcgtcatcg ataagaagaa 34740 cgtgtttcaa cggctcacct ttcaatctaa aatctgaacc cttgttcaca gcgcttgaga 34800 aattttcacg tgaaggatgt acaatcatct ccagctaaat gggcagttcg tcagaattgc 34860 ggctgaccgc ggatgacgaa aatgcgaacc aagtatttca attttatgac aaaagttctc 34920 aatcgttgtt acaagtgaaa cgcttcgagg ttacagctac tattgattaa ggagatcgcc 34980 tatggtctcg ccccggcgtc gtgcgtccgc cgcgagccag atctcgccta cttcataaac 35040 gtcctcatag gcacggaatg gaatgatgac atcgatcgcc gtagagagca tgtcaatcag 35100 tgtgcgatct tccaagctag caccttgggc gctacttttg acaagggaaa acagtttctt 35160 gaatccttgg attggattcg cgccgtgtat tgttgaaatc gatcccggat gtcccgagac 35220 gacttcactc agataagccc atgctgcatc gtcgcgcatc tcgccaagca atatccggtc 35280 cggccgcata cgcagacttg cttggagcaa gtgctcggcg ctcacagcac ccagcccagc 35340 accgttcttg gagtagagta gtctaacatg attatcgtgt ggaatgacga gttcgagcgt 35400 atcttctatg gtgattagcc tttcctgggg ggggatggcg ctgatcaagg tcttgctcat 35460 tgttgtcttg ccgcttccgg tagggccaca tagcaacatc gtcagtcggc tgacgacgca 35520 tgcgtgcaga aacgcttcca aatccccgtt gtcaaaatgc tgaaggatag cttcatcatc 35580 ctgattttgg cgtttccttc gtgtctgcca ctggttccac ctcgaagcat cataacggga 35640 ggagacttct ttaagaccag aaacacgcga gcttggccgt cgaatggtca agctgacggt 35700 gcccgaggga acggtcggcg gcagacagat ttgtagtcgt tcaccaccag gaagttcagt 35760 ggcgcagagg gggttacgtg gtccgacatc ctgctttctc agcgcgcccg ctaaaatagc 35820 gatatcttca agatcatcat aagagacggg caaaggcatc ttggtaaaaa tgccggcttg 35880 gcgcacaaat gcctctccag gtcgattgat cgcaatttct tcagtcttcg ggtcatcgag 35940 ccattccaaa atcggcttca gaagaaagcg tagttgcgga tccacttcca tttacaatgt 36000 atcctatctc taagcggaaa tttgaattca ttaagagcgg cggttcctcc cccgcgtggc 36060 gccgccagtc aggcggagct ggtaaacacc aaagaaatcg aggtcccgtg ctacgaaaat 36120 ggaaacggtg tcaccctgat tcttcttcag ggttggcggt atgttgatgg ttgccttaag 36180 ggctgtctca gttgtctgct caccgttatt ttgaaagctg ttgaagctca tcccgccacc 36240 cgagctgccg gcgtaggtgc tagctgcctg gaaggcgcct tgaacaacac tcaagagcat 36300 agctccgcta aaacgctgcc agaagtggct gtcgaccgag cccggcaatc ctgagcgacc 36360 gagttcgtcc gcgcttggcg atgttaacga gatcatcgca tggtcaggtg tctcggcgcg 36420 atcccacaac acaaaaacgc gcccatctcc ctgttgcaag ccacgctgta tttcgccaac 36480 aacggtggtg ccacgatcaa gaagcacgat attgttcgtt gttccacgaa tatcctgagg 36540 caagacacac tttacatagc ctgccaaatt tgtgtcgatt gcggtttgca agatgcacgg 36600 aattattgtc ccttgcgtta ccataaaatc ggggtgcggc aagagcgtgg cgctgctggg 36660 ctgcagctcg gtgggtttca tacgtatcga caaatcgttc tcgccggaca cttcgccatt 36720 cggcaaggag ttgtcgtcac gcttgccttc ttgtcttcgg cccgtgtcgc cctgaatggc 36780 gcgtttgctg accccttgat cgccgctgct atatgcaaaa atcggtgttt cttccggccg 36840 tggctcatgc cgctccggtt cgcccctcgg cggtagagga gcagcaggct gaacagcctc 36900 ttgaaccgct ggaggatccg gcggcacctc aatcggagct ggatgaaatg gcttggtgtt 36960 tgttgcgatc aaagttgacg gcgatgcgtt ctcattcacc ttcttttggc gcccacctag 37020 ccaaatgagg cttaatgata acgcgagaac gacacctccg acgatcaatt tctgagaccc 37080 cgaaagacgc cggcgatgtt tgtcggagac cagggatcca gatgcatcaa cctcatgtgc 37140 cgcttgctga ctatcgttat tcatcccttc gcccccttca ggacgcgttt cacatcgggc 37200 ctcaccgtgc ccgtttgcgg cctttggcca acgggatcgt aagcggtgtt ccagatacat 37260 agtactgtgt ggccatccct cagacgccaa cctcgggaaa ccgaagaaat ctcgacatcg 37320 ctccctttaa ctgaatagtt ggcaacagct tccttgccat caggattgat ggtgtagatg 37380 gagggtatgc gtacattgcc cggaaagtgg aataccgtcg taaatccatt gtcgaagact 37440 tcgagtggca acagcgaacg atcgccttgg gcgacgtagt gccaattact gtccgccgca 37500 ccaagggctg tgacaggctg atccaataaa ttctcagctt tccgttgata ttgtgcttcc 37560 gcgtgtagtc tgtccacaac agccttctgt tgtgcctccc ttcgccgagc cgccgcatcg 37620 tcggcggggt aggcgaattg gacgctgtaa tagagatcgg gctgctcttt atcgaggtgg 37680 gacagagtct tggaacttat actgaaaaca taacggcgca tcccggagtc gcttgcggtt 37740 agcacgatta ctggctgagg cgtgaggacc tggcttgcct tgaaaaatag ataatttccc 37800 cgcggtaggg ctgctagatc tttgctattt gaaacggcaa ccgctgtcac cgtttcgttc 37860 gtggcgaatg ttacgaccaa agtagctcca accgccgtcg agaggcgcac cacttgatcg 37920 ggattgtaag ccaaataacg catgcgcgga tctagcttgc ccgccattgg agtgtcttca 37980 gcctccgcac cagtcgcagc ggcaaataaa catgctaaaa tgaaaagtgc ttttctgatc 38040 atggttcgct gtggcctacg tttgaaacgg tatcttccga tgtctgatag gaggtgacaa 38100 ccagacctgc cgggttggtt agtctcaatc tgccgggcaa gctggtcacc ttttcgtagc 38160 gaactgtcgc ggtccacgta ctcaccacag gcattttgcc gtcaacgacg agggtccttt 38220 tatagcgaat ttgctgcgtg cttggagtta catcatttga agcgatgtgc tcgacctcca 38280 ccctgccgcg tttgccaaga atgacttgag gcgaactggg attgggatag ttgaagaatt 38340 gctggtaatc ctggcgcact gttggggcac tgaagttcga taccaggtcg taggcgtact 38400 gagcggtgtc ggcatcataa ctctcgcgca ggcgaacgta ctcccacaat gaggcgttaa 38460 cgacggcctc ctcttgagtt gcaggcaatc gcgagacaga cacctcgctg tcaacggtgc 38520 cgtccggccg tatccataga tatacgggca caagcctgct caacggcacc attgtggcta 38580 tagcgaacgc ttgagcaaca tttcccaaaa tcgcgatagc tgcgacagct gcaatgagtt 38640 tggagagacg tcgcgccgat ttcgctcgcg cggtttgaaa ggcttctact tccttatagt 38700 gctcggcaag gctttcgcgc gccactagca tggcatattc aggccccgtc atagcgtcca 38760 cccgaattgc cgagctgaag atctgacgga gtaggctgcc atcgccccac attcagcggg 38820 aagatcgggc ctttgcagct cgctaatgtg tcgtttgtct ggcagccgct caaagcgaca 38880 actaggcaca gcaggcaata cttcatagaa ttctccattg aggcgaattt ttgcgcgacc 38940 tagcctcgct caacctgagc gaagcgacgg tacaagctgc tggcagattg ggttgcgccg 39000 ctccagtaac tgcctccaat gttgccggcg atcgccggca aagcgacaat gagcgcatcc 39060 cctgtcagaa aaaacatatc gagttcgtaa agaccaatga tcttggccgc ggtcgtaccg 39120 gcgaaggtga ttacaccaag cataagggtg agcgcagtcg cttcggttag gatgacgatc 39180 gttgccacga ggtttaagag gagaagcaag agaccgtagg tgataagttg cccgatccac 39240 ttagctgcga tgtcccgcgt gcgatcaaaa atatatccga cgaggatcag aggcccgatc 39300 gcgagaagca ctttcgtgag aattccaacg gcgtcgtaaa ctccgaaggc agaccagagc 39360 gtgccgtaaa ggacccactg tgccccttgg aaagcaagga tgtcctggtc gttcatcgga 39420 ccgatttcgg atgcgatttt ctgaaaaacg gcctgggtca cggcgaacat tgtatccaac 39480 tgtgccggaa cagtctgcag aggcaagccg gttacactaa actgctgaac aaagtttggg 39540 accgtctttt cgaagatgga aaccacatag tcttggtagt tagcctgccc aacaattaga 39600 gcaacaacga tggtgaccgt gatcacccga gtgataccgc tacgggtatc gacttcgccg 39660 cgtatgacta aaataccctg aacaataatc caaagagtga cacaggcgat caatggcgca 39720 ctcaccgcct cctggatagt ctcaagcatc gagtccaagc ctgtcgtgaa ggctacatcg 39780 aagatcgtat gaatggccgt aaacggcgcc ggaatcgtga aattcatcga ttggacctga 39840 acttgactgg tttgtcgcat aatgttggat aaaatgagct cgcattcggc gaggatgcgg 39900 gcggatgaac aaatcgccca gccttagggg agggcaccaa agatgacagc ggtcttttga 39960 tgctccttgc gttgagcggc cgcctcttcc gcctcgtgaa ggccggcctg cgcggtagtc 40020 atcgttaata ggcttgtcgc ctgtacattt tgaatcattg cgtcatggat ctgcttgaga 40080 agcaaaccat tggtcacggt tgcctgcatg atattgcgag atcgggaaag ctgagcagac 40140 gtatcagcat tcgccgtcaa gcgtttgtcc atcgtttcca gattgtcagc cgcaatgcca 40200 gcgctgtttg cggaaccggt gatctgcgat cgcaacaggt ccgcttcagc atcactaccc 40260 acgactgcac gatctgtatc gctggtgatc gcacgtgccg tggtcgacat tggcattcgc 40320 ggcgaaaaca tttcattgtc taggtccttc gtcgaaggat actgattttt ctggttgagc 40380 gaagtcagta gtccagtaac gccgtaggcc gacgtcaaca tcgtaaccat cgctatagtc 40440 tgagtgagat tctccgcagt cgcgagcgca gtcgcgagcg tctcagcctc cgttgccggg 40500 tcgctaacaa caaactgcgc ccgcgcgggc tgaatatata gaaagctgca ggtcaaaact 40560 gttgcaataa gttgcgtcgt cttcatcgtt tcctacctta tcaatcttct gcctcgtggt 40620 gacgggccat gaattcgctg agccagccag atgagttgcc ttcttgtgcc tcgcgtagtc 40680 gagttgcaaa gcgcaccgtg ttggcacgcc ccgaaagcac ggcgacatat tcacgcatat 40740 cccgcagatc aaattcgcag atgacgcttc cactttctcg tttaagaaga aacttacggc 40800 tgccgaccgt catgtcttca cggatcgcct gaaattcctt ttcggtacat ttcagtccat 40860 cgacataagc cgatcgatct gcggttggtg atggatagaa aatcttcgtc atacattgcg 40920 caaccaagct ggctcctagc ggcgattcca gaacatgctc tggttgctgc gttgccagta 40980 ttagcatccc gttgtttttt cgaacggtca ggaggaattt gtcgacgaca gtcgaaaatt 41040 tagggtttaa caaataggcg cgaaactcat cgcagctcat cacaaaacgg cggccgtcga 41100 tcatggctcc aatccgatgc aggagatatg ctgcagcggg agcgcatact tcctcgtatt 41160 cgagaagatg cgtcatgtcg aagccggtaa tcgacggatc taactttact tcgtcaactt 41220 cgccgtcaaa tgcccagcca agcgcatggc cccggcacca gcgttggagc cgcgctcctg 41280 cgccttcggc gggcccatgc aacaaaaatt cacgtaaccc cgcgattgaa cgcatttgtg 41340 gatcaaacga gagctgacga tggataccac ggaccagacg gcggttctct tccggagaaa 41400 tcccaccccg accatcactc tcgatgagag ccacgatcca ttcgcgcaga aaatcgtgtg 41460 aggctgctgt gttttctagg ccacgcaacg gcgccaaccc gctgggtgtg cctctgtgaa 41520 gtgccaaata tgttcctcct gtggcgcgaa ccagcaattc gccaccccgg tccttgtcaa 41580 agaacacgac cgtacctgca cggtcgacca tgctctgttc gagcatggct agaacaaaca 41640 tcatgagcgt cgtcttaccc ctcccgatag gcccgaatat tgccgtcatg ccaacatcgt 41700 gctcatgcgg gatatagtcg aaaggcgttc cgccattggt acgaaatcgg gcaatcgcgt 41760 tgccccagtg gcctgagctg gcgccctctg gaaagttttc gaaagagaca aaccctgcga 41820 aattgcgtga agtgattgcg ccagggcgtg tgcgccactt aaaattcccc ggcaattggg 41880 accaataggc cgcttccata ccaatacctt cttggacaac cacggcacct gcatccgcca 41940 ttcgtgtccg agcccgcgcg cccctgtccc caagactatt gagatcgtct gcatagacgc 42000 aaaggctcaa atgatgtgag cccataacga attcgttgct cgcaagtgcg tcctcagcct 42060 cggataattt gccgatttga gtcacggctt tatcgccgga actcagcatc tggctcgatt 42120 tgaggctaag tttcgcgtgc gcttgcgggc gagtcaggaa cgaaaaactc tgcgtgagaa 42180 caagtggaaa atcgagggat agcagcgcgt tgagcatgcc cggccgtgtt tttgcagggt 42240 attcgcgaaa cgaatagatg gatccaacgt aactgtcttt tggcgttctg atctcgagtc 42300 ctcgcttgcc gcaaatgact ctgtcggtat aaatcgaagc gccgagtgag ccgctgacga 42360 ccggaaccgg tgtgaaccga ccagtcatga tcaaccgtag cgcttcgcca atttcggtga 42420 agagcacacc ctgcttctcg cggatgccaa gacgatgcag gccatacgct ttaagagagc 42480 cagcgacaac atgccaaaga tcttccatgt tcctgatctg gcccgtgaga tcgttttccc 42540 tttttccgct tagcttggtg aacctcctct ttaccttccc taaagccgcc tgtgggtaga 42600 caatcaacgt aaggaagtgt tcattgcgga ggagttggcc ggagagcacg cgctgttcaa 42660 aagcttcgtt caggctagcg gcgaaaacac tacggaagtg tcgcggcgcc gatgatggca 42720 cgtcggcatg acgtacgagg tgagcatata ttgacacatg atcatcagcg atattgcgca 42780 acagcgtgtt gaacgcacga caacgcgcat tgcgcatttc agtttcctca agctcgaatg 42840 caacgccatc aattctcgca atggtcatga tcgatccgtc ttcaagaagg acgatatggt 42900 cgctgaggtg gccaatataa gggagataga tctcaccgga tctttcggtc gttccactcg 42960 cgccgagcat cacaccattc ctctccctcg tgggggaacc ctaattggat ttgggctaac 43020 agtagcgccc ccccaaactg cactatcaat gcttcttccc gcggtccgca aaaatagcag 43080 gacgacgctc gccgcattgt agtctcgctc cacgatgagc cgggctgcaa accataacgg 43140 cacgagaacg acttcgtaga gcgggttctg aacgataacg atgacaaagc cggcgaacat 43200 catgaataac cctgccaatg tcagtggcac cccaagaaac aatgcgggcc gtgtggctgc 43260 gaggtaaagg gtcgattctt ccaaacgatc agccatcaac taccgccagt gagcgtttgg 43320 ccgaggaagc tcgccccaaa catgataaca atgccgccga cgacgccggc aaccagccca 43380 agcgaagccc gcccgaacat ccaggagatc ccgatagcga caatgccgag aacagcgagt 43440 gactggccga acggaccaag gataaacgtg catatattgt taaccattgt ggcggggtca 43500 gtgccgccac ccgcagattg cgctgcggcg ggtccggatg aggaaatgct ccatgcaatt 43560 gcaccgcaca agcttggggc gcagctcgat atcacgcgca tcatcgcatt cgagagcgag 43620 aggcgattta gatgtaaacg gtatctctca aagcatcgca tcaatgcgca cctccttagt 43680 ataagtcgaa taagacttga ttgtcgtctg cggatttgcc gttgtcctgg tgtggcggtg 43740 gcggagcgat taaaccgcca gcgccatcct cctgcgagcg gcgctgatat gacccccaaa 43800 catcccacgt ctcttcggat tttagcgcct cgtgatcgtc ttttggaggc tcgattaacg 43860 cgggcaccag cgattgagca gctgtttcaa cttttcgcac gtagccgttt gcaaaaccgc 43920 cgatgaaatt accggtgttg taagcggaga tcgcccgacg aagcgcaaat tgcttctcgt 43980 caatcgtttc gccgcctgca taacgacttt tcagcatgtt tgcagcggca gataatgatg 44040 tgcacgcctg gagcgcaccg tcaggtgtca gaccgagcat agaaaaattt cgagagttta 44100 tttgcatgag gccaacatcc agcgaatgcc gtgcatcgag acggtgcctg acgacttggg 44160 ttgcttggct gtgatcttgc cagtgaagcg tttcgccggt cgtgttgtca tgaatcgcta 44220 aaggatcaaa gcgactctcc accttagcta tcgccgcaag cgtagatgtc gcaactgatg 44280 gggcacactt gcgagcaaca tggtcaaact cagcagatga gagtggcgtg gcaaggctcg 44340 acgaacagaa ggagaccatc aaggcaagag aaagcgaccc cgatctctta agcatacctt 44400 atctccttag ctcgcaacta acaccgcctc tcccgttgga agaagtgcgt tgttttatgt 44460 tgaagattat cgggagggtc ggttactcga aaattttcaa ttgcttcttt atgatttcaa 44520 ttgaagcgag aaacctcgcc cggcgtcttg gaacgcaaca tggaccgaga accgcgcatc 44580 catgactaag caaccggatc gacctattca ggccgcagtt ggtcaggtca ggctcagaac 44640 gaaaatgctc ggcgaggtta cgctgtctgt aaacccattc gatgaacggg aagcttcctt 44700 ccgattgctc ttggcaggaa tattggccca tgcctgcttg cgctttgcaa atgctcttat 44760 cgcgttggta tcatatgcct tgtccgccag cagaaacgca ctctaagcga ttatttgtaa 44820 aaatgtttcg gtcatgcggc ggtcatgggc ttgacccgct gtcagcgcaa gacggatcgg 44880 tcaaccgtcg gcatcgacaa cagcgtgaat cttggtggtc aaaccgccac gggaacgtcc 44940 catacagcca tcgtcttgat cccgctgttt cccgtcgccg catgttggtg gacgcggaca 45000 caggaactgt caatcatgac gacattctat cgaaagcctt ggaaatcaca ctcagaatat 45060 gatcccagac gtctgcctca cgccatcgta caaagcgatt gtagcaggtt gtacaggaac 45120 cgtatcgatc aggaacgtct gcccagggcg ggcccgtccg gaagcgccac aagatgacat 45180 tgatcacccg cgtcaacgcg cggcacgcga cgcggcttat ttgggaacaa aggactgaac 45240 aacagtccat tcgaaatcgg tgacatcaaa gcggggacgg gttatcagtg gcctccaagt 45300 caagcctcaa tgaatcaaaa tcagaccgat ttgcaaacct gatttatgag tgtgcggcct 45360 aaatgatgaa atcgtccttc tagatcgcct ccgtggtgta gcaacacctc gcagtatcgc 45420 cgtgctgacc ttggccaggg aattgactgg caagggtgct ttcacatgac cgctcttttg 45480 gccgcgatag atgatttcgt tgctgctttg ggcacgtaga aggagagaag tcatatcgga 45540 gaaattcctc ctggcgcgag agcctgctct atcgcgacgg catcccactg tcgggaacag 45600 accggatcat tcacgaggcg aaagtcgtca acacatgcgt tataggcatc ttcccttgaa 45660 ggatgatctt gttgctgcca atctggaggt gcggcagccg caggcagatg cgatctcagc 45720 gcaacttgcg gcaaaacatc tcactcacct gaaaaccact agcgagtctc gcgatcagac 45780 gaaggccttt tacttaacga cacaatatcc gatgtctgca tcacaggcgt cgctatccca 45840 gtcaatacta aagcggtgca ggaactaaag attactgatg acttaggcgt gccacgaggc 45900 ctgagacgac gcgcgtagac agttttttga aatcattatc aaagtgatgg cctccgctga 45960 agcctatcac ctctgcgccg gtctgtcgga gagatgggca agcattatta cggtcttcgc 46020 gcccgtacat gcattggacg attgcagggt caatggatct gagatcatcc agaggattgc 46080 cgcccttacc ttccgtttcg agttggagcc agcccctaaa tgagacgaca tagtcgactt 46140 gatgtgacaa tgccaagaga gagatttgct taacccgatt tttttgctca agcgtaagcc 46200 tattgaagct tgccggcatg acgtccgcgc cgaaagaata tcctacaagt aaaacattct 46260 gcacaccgaa atgcttggtg tagacatcga ttatgtgacc aagatcctta gcagtttcgc 46320 ttggggaccg ctccgaccag aaataccgaa gtgaactgac gccaatgaca ggaatccctt 46380 ccgtctgcag ataggtacca tcgatagatc tgctgcctcg cgcgtttcgg tgatgacggt 46440 gaaaacctct gacacatgca gctcccggag acggtcacag cttgtctgta agcggatgcc 46500 gggagcagac aagcccgtca gggcgcgtca gcgggtgttg gcgggtgtcg gggcgcagcc 46560 atgacccagt cacgtagcga tagcggagtg tatactggct taactatgcg gcatcagagc 46620 agattgtact gagagtgcac catatgcggt gtgaaatacc gcacagatgc gtaaggagaa 46680 aataccgcat caggcgctct tccgcttcct cgctcactga ctcgctgcgc tcggtcgttc 46740 ggctgcggcg agcggtatca gctcactcaa aggcggtaat acggttatcc acagaatcag 46800 gggataacgc aggaaagaac atgtgagcaa aaggccagca aaaggccagg aaccgtaaaa 46860 aggccgcgtt gctggcgttt ttccataggc tccgcccccc tgacgagcat cacaaaaatc 46920 gacgctcaag tcagaggtgg cgaaacccga caggactata aagataccag gcgtttcccc 46980 ctggaagctc cctcgtgcgc tctcctgttc cgaccctgcc gcttaccgga tacctgtccg 47040 cctttctccc ttcgggaagc gtggcgcttt ctcatagctc acgctgtagg tatctcagtt 47100 cggtgtaggt cgttcgctcc aagctgggct gtgtgcacga accccccgtt cagcccgacc 47160 gctgcgcctt atccggtaac tatcgtcttg agtccaaccc ggtaagacac gacttatcgc 47220 cactggcagc agccactggt aacaggatta gcagagcgag gtatgtaggc ggtgctacag 47280 agttcttgaa gtggtggcct aactacggct acactagaag gacagtattt ggtatctgcg 47340 ctctgctgaa gccagttacc ttcggaaaaa gagttggtag ctcttgatcc ggcaaacaaa 47400 ccaccgctgg tagcggtggt ttttttgttt gcaagcagca gattacgcgc agaaaaaaag 47460 gatctcaaga agatcctttg atcttttcta cggggtctga cgctcagtgg aacgaaaact 47520 cacgttaagg gattttggtc atgagattat caaaaaggat cttcacctag atccttttaa 47580 attaaaaatg aagttttaaa tcaatctaaa gtatatatga gtaaacttgg tctgacagtt 47640 accaatgctt aatcagtgag gcacctatct cagcgatctg tctatttcgt tcatccatag 47700 ttgcctgact ccccgtcgtg tagataacta cgatacggga gggcttacca tctggcccca 47760 gtgctgcaat gataccgcga gacccacgct caccggctcc agatttatca gcaataaacc 47820 agccagccgg aagggccgag cgcagaagtg gtcctgcaac tttatccgcc tccatccagt 47880 ctattaattg ttgccgggaa gctagagtaa gtagttcgcc agttaatagt ttgcgcaacg 47940 ttgttgccat tgctgcaggg gggggggggg ggggggactt ccattgttca ttccacggac 48000 aaaaacagag aaaggaaacg acagaggcca aaaagcctcg ctttcagcac ctgtcgtttc 48060 ctttcttttc agagggtatt ttaaataaaa acattaagtt atgacgaaga agaacggaaa 48120 cgccttaaac cggaaaattt tcataaatag cgaaaacccg cgaggtcgcc gccccgtagt 48180 cggatcaccg gaaaggaccc gtaaagtgat aatgattatc atctacatat cacaacgtgc 48240 gtggaggcca tcaaaccacg tcaaataatc aattatgacg caggtatcgt attaattgat 48300 ctgcatcaac ttaacgtaaa aacaacttca gacaatacaa atcagcgaca ctgaatacgg 48360 ggcaacctca tgtccccccc cccccccccc ctgcaggcat cgtggtgtca cgctcgtcgt 48420 ttggtatggc ttcattcagc tccggttccc aacgatcaag gcgagttaca tgatccccca 48480 tgttgtgcaa aaaagcggtt agctccttcg gtcctccgat cgttgtcaga agtaagttgg 48540 ccgcagtgtt atcactcatg gttatggcag cactgcataa ttctcttact gtcatgccat 48600 ccgtaagatg cttttctgtg actggtgagt actcaaccaa gtcattctga gaatagtgta 48660 tgcggcgacc gagttgctct tgcccggcgt caacacggga taataccgcg ccacatagca 48720 gaactttaaa agtgctcatc attggaaaac gttcttcggg gcgaaaactc tcaaggatct 48780 taccgctgtt gagatccagt tcgatgtaac ccactcgtgc acccaactga tcttcagcat 48840 cttttacttt caccagcgtt tctgggtgag caaaaacagg aaggcaaaat gccgcaaaaa 48900 agggaataag ggcgacacgg aaatgttgaa tactcatact cttccttttt caatattatt 48960 gaagcattta tcagggttat tgtctcatga gcggatacat atttgaatgt atttagaaaa 49020 ataaacaaat aggggttccg cgcacatttc cccgaaaagt gccacctgac gtctaagaaa 49080 ccattattat catgacatta acctataaaa ataggcgtat cacgaggccc tttcgtcttc 49140 aagaattggt cgacgatctt gctgcgttcg gatattttcg tggagttccc gccacagacc 49200 cggattgaag gcgagatcca gcaactcgcg ccagatcatc ctgtgacgga actttggcgc 49260 gtgatgactg gccaggacgt cggccgaaag agcgacaagc agatcacgct tttcgacagc 49320 gtcggatttg cgatcgagga tttttcggcg ctgcgctacg tccgcgaccg cgttgaggga 49380 tcaagccaca gcagcccact cgaccttcta gccgacccag acgagccaag ggatcttttt 49440 ggaatgctgc tccgtcgtca ggctttccga cgtttgggtg gttgaacaga agtcattatc 49500 gtacggaatg ccaagcactc ccgaggggaa ccctgtggtt ggcatgcaca tacaaatgga 49560 cgaacggata aaccttttca cgccctttta aatatccgtt attctaataa acgctctttt 49620 ctcttaggtt tacccgccaa tatatcctgt caaacactga tagtttaaac tgaaggcggg 49680 aaacgacaat ctgatcatga gcggagaatt aagggagtca cgttatgacc cccgccgatg 49740 acgcgggaca agccgtttta cgtttggaac tgacagaacc gcaacgttga aggagccact 49800 cagcaagctg gtacgattgt aatacgactc actatagggc gaattgagcg ctgtttaaac 49860 gctcttcaac tggaagagcg gttacccgga ccgaagcttg catgcctgca g 49911 <210> SEQ ID NO 7 <211> LENGTH: 36909 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: PHP10523 construct <400> SEQUENCE: 7 tctagagctc gttcctcgag gcctcgaggc ctcgaggaac ggtacctgcg gggaagctta 60 caataatgtg tgttgttaag tcttgttgcc tgtcatcgtc tgactgactt tcgtcataaa 120 tcccggcctc cgtaacccag ctttgggcaa gctcacggat ttgatccggc ggaacgggaa 180 tatcgagatg ccgggctgaa cgctgcagtt ccagctttcc ctttcgggac aggtactcca 240 gctgattgat tatctgctga agggtcttgg ttccacctcc tggcacaatg cgaatgatta 300 cttgagcgcg atcgggcatc caattttctc ccgtcaggtg cgtggtcaag tgctacaagg 360 cacctttcag taacgagcga ccgtcgatcc gtcgccggga tacggacaaa atggagcgca 420 gtagtccatc gagggcggcg aaagcctcgc caaaagcaat acgttcatct cgcacagcct 480 ccagatccga tcgagggtct tcggcgtagg cagatagaag catggataca ttgcttgaga 540 gtattccgat ggactgaagt atggcttcca tcttttctcg tgtgtctgca tctatttcga 600 gaaagccccc gatgcggcgc accgcaacgc gaattgccat actatccgaa agtcccagca 660 ggcgcgcttg ataggaaaag gtttcatact cggccgatcg cagacgggca ctcacgacct 720 tgaacccttc aactttcagg gatcgatgct ggttgatggt agtctcactc gacgtggctc 780 tggtgtgttt tgacatagct tcctccaaag aaagcggaag gtctggatac tccagcacga 840 aatgtgcccg ggtagacgga tggaagtcta gccctgctca atatgaaatc aacagtacat 900 ttacagtcaa tactgaatat acttgctaca tttgcaattg tcttataacg aatgtgaaat 960 aaaaatagtg taacaacgct tttactcatc gataatcaca aaaacattta tacgaacaaa 1020 aatacaaatg cactccggtt tcacaggata ggcgggatca gaatatgcaa cttttgacgt 1080 tttgttcttt caaagggggt gctggcaaaa ccaccgcact catgggcctt tgcgctgctt 1140 tggcaaatga cggtaaacga gtggccctct ttgatgccga cgaaaaccgg cctctgacgc 1200 gatggagaga aaacgcctta caaagcagta ctgggatcct cgctgtgaag tctattccgc 1260 cgacgaaatg ccccttcttg aagcagccta tgaaaatgcc gagctcgaag gatttgatta 1320 tgcgttggcc gatacgcgtg gcggctcgag cgagctcaac aacacaatca tcgctagctc 1380 aaacctgctt ctgatcccca ccatgctaac gccgctcgac atcgatgagg cactatctac 1440 ctaccgctac gtcatcgagc tgctgttgag tgaaaatttg gcaattccta cagctgtttt 1500 gcgccaacgc gtcccggtcg gccgattgac aacatcgcaa cgcaggatgt cagagacgct 1560 agagagcctt ccagttgtac cgtctcccat gcatgaaaga gatgcatttg ccgcgatgaa 1620 agaacgcggc atgttgcatc ttacattact aaacacggga actgatccga cgatgcgcct 1680 catagagagg aatcttcgga ttgcgatgga ggaagtcgtg gtcatttcga aactgatcag 1740 caaaatcttg gaggcttgaa gatggcaatt cgcaagcccg cattgtcggt cggcgaagca 1800 cggcggcttg ctggtgctcg acccgagatc caccatccca acccgacact tgttccccag 1860 aagctggacc tccagcactt gcctgaaaaa gccgacgaga aagaccagca acgtgagcct 1920 ctcgtcgccg atcacattta cagtcccgat cgacaactta agctaactgt ggatgccctt 1980 agtccacctc cgtccccgaa aaagctccag gtttttcttt cagcgcgacc gcccgcgcct 2040 caagtgtcga aaacatatga caacctcgtt cggcaataca gtccctcgaa gtcgctacaa 2100 atgattttaa ggcgcgcgtt ggacgatttc gaaagcatgc tggcagatgg atcatttcgc 2160 gtggccccga aaagttatcc gatcccttca actacagaaa aatccgttct cgttcagacc 2220 tcacgcatgt tcccggttgc gttgctcgag gtcgctcgaa gtcattttga tccgttgggg 2280 ttggagaccg ctcgagcttt cggccacaag ctggctaccg ccgcgctcgc gtcattcttt 2340 gctggagaga agccatcgag caattggtga agagggacct atcggaaccc ctcaccaaat 2400 attgagtgta ggtttgaggc cgctggccgc gtcctcagtc accttttgag ccagataatt 2460 aagagccaaa tgcaattggc tcaggctgcc atcgtccccc cgtgcgaaac ctgcacgtcc 2520 gcgtcaaaga aataaccggc acctcttgct gtttttatca gttgagggct tgacggatcc 2580 gcctcaagtt tgcggcgcag ccgcaaaatg agaacatcta tactcctgtc gtaaacctcc 2640 tcgtcgcgta ctcgactggc aatgagaagt tgctcgcgcg atagaacgtc gcggggtttc 2700 tctaaaaacg cgaggagaag attgaactca cctgccgtaa gtttcacctc accgccagct 2760 tcggacatca agcgacgttg cctgagatta agtgtccagt cagtaaaaca aaaagaccgt 2820 cggtctttgg agcggacaac gttggggcgc acgcgcaagg caacccgaat gcgtgcaaga 2880 aactctctcg tactaaacgg cttagcgata aaatcacttg ctcctagctc gagtgcaaca 2940 actttatccg tctcctcaag gcggtcgcca ctgataatta tgattggaat atcagacttt 3000 gccgccagat ttcgaacgat ctcaagccca tcttcacgac ctaaatttag atcaacaacc 3060 acgacatcga ccgtcgcgga agagagtact ctagtgaact gggtgctgtc ggctaccgcg 3120 gtcactttga aggcgtggat cgtaaggtat tcgataataa gatgccgcat agcgacatcg 3180 tcatcgataa gaagaacgtg tttcaacggc tcacctttca atctaaaatc tgaacccttg 3240 ttcacagcgc ttgagaaatt ttcacgtgaa ggatgtacaa tcatctccag ctaaatgggc 3300 agttcgtcag aattgcggct gaccgcggat gacgaaaatg cgaaccaagt atttcaattt 3360 tatgacaaaa gttctcaatc gttgttacaa gtgaaacgct tcgaggttac agctactatt 3420 gattaaggag atcgcctatg gtctcgcccc ggcgtcgtgc gtccgccgcg agccagatct 3480 cgcctacttc ataaacgtcc tcataggcac ggaatggaat gatgacatcg atcgccgtag 3540 agagcatgtc aatcagtgtg cgatcttcca agctagcacc ttgggcgcta cttttgacaa 3600 gggaaaacag tttcttgaat ccttggattg gattcgcgcc gtgtattgtt gaaatcgatc 3660 ccggatgtcc cgagacgact tcactcagat aagcccatgc tgcatcgtcg cgcatctcgc 3720 caagcaatat ccggtccggc cgcatacgca gacttgcttg gagcaagtgc tcggcgctca 3780 cagcacccag cccagcaccg ttcttggagt agagtagtct aacatgatta tcgtgtggaa 3840 tgacgagttc gagcgtatct tctatggtga ttagcctttc ctgggggggg atggcgctga 3900 tcaaggtctt gctcattgtt gtcttgccgc ttccggtagg gccacatagc aacatcgtca 3960 gtcggctgac gacgcatgcg tgcagaaacg cttccaaatc cccgttgtca aaatgctgaa 4020 ggatagcttc atcatcctga ttttggcgtt tccttcgtgt ctgccactgg ttccacctcg 4080 aagcatcata acgggaggag acttctttaa gaccagaaac acgcgagctt ggccgtcgaa 4140 tggtcaagct gacggtgccc gagggaacgg tcggcggcag acagatttgt agtcgttcac 4200 caccaggaag ttcagtggcg cagagggggt tacgtggtcc gacatcctgc tttctcagcg 4260 cgcccgctaa aatagcgata tcttcaagat catcataaga gacgggcaaa ggcatcttgg 4320 taaaaatgcc ggcttggcgc acaaatgcct ctccaggtcg attgatcgca atttcttcag 4380 tcttcgggtc atcgagccat tccaaaatcg gcttcagaag aaagcgtagt tgcggatcca 4440 cttccattta caatgtatcc tatctctaag cggaaatttg aattcattaa gagcggcggt 4500 tcctcccccg cgtggcgccg ccagtcaggc ggagctggta aacaccaaag aaatcgaggt 4560 cccgtgctac gaaaatggaa acggtgtcac cctgattctt cttcagggtt ggcggtatgt 4620 tgatggttgc cttaagggct gtctcagttg tctgctcacc gttattttga aagctgttga 4680 agctcatccc gccacccgag ctgccggcgt aggtgctagc tgcctggaag gcgccttgaa 4740 caacactcaa gagcatagct ccgctaaaac gctgccagaa gtggctgtcg accgagcccg 4800 gcaatcctga gcgaccgagt tcgtccgcgc ttggcgatgt taacgagatc atcgcatggt 4860 caggtgtctc ggcgcgatcc cacaacacaa aaacgcgccc atctccctgt tgcaagccac 4920 gctgtatttc gccaacaacg gtggtgccac gatcaagaag cacgatattg ttcgttgttc 4980 cacgaatatc ctgaggcaag acacacttta catagcctgc caaatttgtg tcgattgcgg 5040 tttgcaagat gcacggaatt attgtccctt gcgttaccat aaaatcgggg tgcggcaaga 5100 gcgtggcgct gctgggctgc agctcggtgg gtttcatacg tatcgacaaa tcgttctcgc 5160 cggacacttc gccattcggc aaggagttgt cgtcacgctt gccttcttgt cttcggcccg 5220 tgtcgccctg aatggcgcgt ttgctgaccc cttgatcgcc gctgctatat gcaaaaatcg 5280 gtgtttcttc cggccgtggc tcatgccgct ccggttcgcc cctcggcggt agaggagcag 5340 caggctgaac agcctcttga accgctggag gatccggcgg cacctcaatc ggagctggat 5400 gaaatggctt ggtgtttgtt gcgatcaaag ttgacggcga tgcgttctca ttcaccttct 5460 tttggcgccc acctagccaa atgaggctta atgataacgc gagaacgaca cctccgacga 5520 tcaatttctg agaccccgaa agacgccggc gatgtttgtc ggagaccagg gatccagatg 5580 catcaacctc atgtgccgct tgctgactat cgttattcat cccttcgccc ccttcaggac 5640 gcgtttcaca tcgggcctca ccgtgcccgt ttgcggcctt tggccaacgg gatcgtaagc 5700 ggtgttccag atacatagta ctgtgtggcc atccctcaga cgccaacctc gggaaaccga 5760 agaaatctcg acatcgctcc ctttaactga atagttggca acagcttcct tgccatcagg 5820 attgatggtg tagatggagg gtatgcgtac attgcccgga aagtggaata ccgtcgtaaa 5880 tccattgtcg aagacttcga gtggcaacag cgaacgatcg ccttgggcga cgtagtgcca 5940 attactgtcc gccgcaccaa gggctgtgac aggctgatcc aataaattct cagctttccg 6000 ttgatattgt gcttccgcgt gtagtctgtc cacaacagcc ttctgttgtg cctcccttcg 6060 ccgagccgcc gcatcgtcgg cggggtaggc gaattggacg ctgtaataga gatcgggctg 6120 ctctttatcg aggtgggaca gagtcttgga acttatactg aaaacataac ggcgcatccc 6180 ggagtcgctt gcggttagca cgattactgg ctgaggcgtg aggacctggc ttgccttgaa 6240 aaatagataa tttccccgcg gtagggctgc tagatctttg ctatttgaaa cggcaaccgc 6300 tgtcaccgtt tcgttcgtgg cgaatgttac gaccaaagta gctccaaccg ccgtcgagag 6360 gcgcaccact tgatcgggat tgtaagccaa ataacgcatg cgcggatcta gcttgcccgc 6420 cattggagtg tcttcagcct ccgcaccagt cgcagcggca aataaacatg ctaaaatgaa 6480 aagtgctttt ctgatcatgg ttcgctgtgg cctacgtttg aaacggtatc ttccgatgtc 6540 tgataggagg tgacaaccag acctgccggg ttggttagtc tcaatctgcc gggcaagctg 6600 gtcacctttt cgtagcgaac tgtcgcggtc cacgtactca ccacaggcat tttgccgtca 6660 acgacgaggg tccttttata gcgaatttgc tgcgtgcttg gagttacatc atttgaagcg 6720 atgtgctcga cctccaccct gccgcgtttg ccaagaatga cttgaggcga actgggattg 6780 ggatagttga agaattgctg gtaatcctgg cgcactgttg gggcactgaa gttcgatacc 6840 aggtcgtagg cgtactgagc ggtgtcggca tcataactct cgcgcaggcg aacgtactcc 6900 cacaatgagg cgttaacgac ggcctcctct tgagttgcag gcaatcgcga gacagacacc 6960 tcgctgtcaa cggtgccgtc cggccgtatc catagatata cgggcacaag cctgctcaac 7020 ggcaccattg tggctatagc gaacgcttga gcaacatttc ccaaaatcgc gatagctgcg 7080 acagctgcaa tgagtttgga gagacgtcgc gccgatttcg ctcgcgcggt ttgaaaggct 7140 tctacttcct tatagtgctc ggcaaggctt tcgcgcgcca ctagcatggc atattcaggc 7200 cccgtcatag cgtccacccg aattgccgag ctgaagatct gacggagtag gctgccatcg 7260 ccccacattc agcgggaaga tcgggccttt gcagctcgct aatgtgtcgt ttgtctggca 7320 gccgctcaaa gcgacaacta ggcacagcag gcaatacttc atagaattct ccattgaggc 7380 gaatttttgc gcgacctagc ctcgctcaac ctgagcgaag cgacggtaca agctgctggc 7440 agattgggtt gcgccgctcc agtaactgcc tccaatgttg ccggcgatcg ccggcaaagc 7500 gacaatgagc gcatcccctg tcagaaaaaa catatcgagt tcgtaaagac caatgatctt 7560 ggccgcggtc gtaccggcga aggtgattac accaagcata agggtgagcg cagtcgcttc 7620 ggttaggatg acgatcgttg ccacgaggtt taagaggaga agcaagagac cgtaggtgat 7680 aagttgcccg atccacttag ctgcgatgtc ccgcgtgcga tcaaaaatat atccgacgag 7740 gatcagaggc ccgatcgcga gaagcacttt cgtgagaatt ccaacggcgt cgtaaactcc 7800 gaaggcagac cagagcgtgc cgtaaaggac ccactgtgcc ccttggaaag caaggatgtc 7860 ctggtcgttc atcggaccga tttcggatgc gattttctga aaaacggcct gggtcacggc 7920 gaacattgta tccaactgtg ccggaacagt ctgcagaggc aagccggtta cactaaactg 7980 ctgaacaaag tttgggaccg tcttttcgaa gatggaaacc acatagtctt ggtagttagc 8040 ctgcccaaca attagagcaa caacgatggt gaccgtgatc acccgagtga taccgctacg 8100 ggtatcgact tcgccgcgta tgactaaaat accctgaaca ataatccaaa gagtgacaca 8160 ggcgatcaat ggcgcactca ccgcctcctg gatagtctca agcatcgagt ccaagcctgt 8220 cgtgaaggct acatcgaaga tcgtatgaat ggccgtaaac ggcgccggaa tcgtgaaatt 8280 catcgattgg acctgaactt gactggtttg tcgcataatg ttggataaaa tgagctcgca 8340 ttcggcgagg atgcgggcgg atgaacaaat cgcccagcct taggggaggg caccaaagat 8400 gacagcggtc ttttgatgct ccttgcgttg agcggccgcc tcttccgcct cgtgaaggcc 8460 ggcctgcgcg gtagtcatcg ttaataggct tgtcgcctgt acattttgaa tcattgcgtc 8520 atggatctgc ttgagaagca aaccattggt cacggttgcc tgcatgatat tgcgagatcg 8580 ggaaagctga gcagacgtat cagcattcgc cgtcaagcgt ttgtccatcg tttccagatt 8640 gtcagccgca atgccagcgc tgtttgcgga accggtgatc tgcgatcgca acaggtccgc 8700 ttcagcatca ctacccacga ctgcacgatc tgtatcgctg gtgatcgcac gtgccgtggt 8760 cgacattggc attcgcggcg aaaacatttc attgtctagg tccttcgtcg aaggatactg 8820 atttttctgg ttgagcgaag tcagtagtcc agtaacgccg taggccgacg tcaacatcgt 8880 aaccatcgct atagtctgag tgagattctc cgcagtcgcg agcgcagtcg cgagcgtctc 8940 agcctccgtt gccgggtcgc taacaacaaa ctgcgcccgc gcgggctgaa tatatagaaa 9000 gctgcaggtc aaaactgttg caataagttg cgtcgtcttc atcgtttcct accttatcaa 9060 tcttctgcct cgtggtgacg ggccatgaat tcgctgagcc agccagatga gttgccttct 9120 tgtgcctcgc gtagtcgagt tgcaaagcgc accgtgttgg cacgccccga aagcacggcg 9180 acatattcac gcatatcccg cagatcaaat tcgcagatga cgcttccact ttctcgttta 9240 agaagaaact tacggctgcc gaccgtcatg tcttcacgga tcgcctgaaa ttccttttcg 9300 gtacatttca gtccatcgac ataagccgat cgatctgcgg ttggtgatgg atagaaaatc 9360 ttcgtcatac attgcgcaac caagctggct cctagcggcg attccagaac atgctctggt 9420 tgctgcgttg ccagtattag catcccgttg ttttttcgaa cggtcaggag gaatttgtcg 9480 acgacagtcg aaaatttagg gtttaacaaa taggcgcgaa actcatcgca gctcatcaca 9540 aaacggcggc cgtcgatcat ggctccaatc cgatgcagga gatatgctgc agcgggagcg 9600 catacttcct cgtattcgag aagatgcgtc atgtcgaagc cggtaatcga cggatctaac 9660 tttacttcgt caacttcgcc gtcaaatgcc cagccaagcg catggccccg gcaccagcgt 9720 tggagccgcg ctcctgcgcc ttcggcgggc ccatgcaaca aaaattcacg taaccccgcg 9780 attgaacgca tttgtggatc aaacgagagc tgacgatgga taccacggac cagacggcgg 9840 ttctcttccg gagaaatccc accccgacca tcactctcga tgagagccac gatccattcg 9900 cgcagaaaat cgtgtgaggc tgctgtgttt tctaggccac gcaacggcgc caacccgctg 9960 ggtgtgcctc tgtgaagtgc caaatatgtt cctcctgtgg cgcgaaccag caattcgcca 10020 ccccggtcct tgtcaaagaa cacgaccgta cctgcacggt cgaccatgct ctgttcgagc 10080 atggctagaa caaacatcat gagcgtcgtc ttacccctcc cgataggccc gaatattgcc 10140 gtcatgccaa catcgtgctc atgcgggata tagtcgaaag gcgttccgcc attggtacga 10200 aatcgggcaa tcgcgttgcc ccagtggcct gagctggcgc cctctggaaa gttttcgaaa 10260 gagacaaacc ctgcgaaatt gcgtgaagtg attgcgccag ggcgtgtgcg ccacttaaaa 10320 ttccccggca attgggacca ataggccgct tccataccaa taccttcttg gacaaccacg 10380 gcacctgcat ccgccattcg tgtccgagcc cgcgcgcccc tgtccccaag actattgaga 10440 tcgtctgcat agacgcaaag gctcaaatga tgtgagccca taacgaattc gttgctcgca 10500 agtgcgtcct cagcctcgga taatttgccg atttgagtca cggctttatc gccggaactc 10560 agcatctggc tcgatttgag gctaagtttc gcgtgcgctt gcgggcgagt caggaacgaa 10620 aaactctgcg tgagaacaag tggaaaatcg agggatagca gcgcgttgag catgcccggc 10680 cgtgtttttg cagggtattc gcgaaacgaa tagatggatc caacgtaact gtcttttggc 10740 gttctgatct cgagtcctcg cttgccgcaa atgactctgt cggtataaat cgaagcgccg 10800 agtgagccgc tgacgaccgg aaccggtgtg aaccgaccag tcatgatcaa ccgtagcgct 10860 tcgccaattt cggtgaagag cacaccctgc ttctcgcgga tgccaagacg atgcaggcca 10920 tacgctttaa gagagccagc gacaacatgc caaagatctt ccatgttcct gatctggccc 10980 gtgagatcgt tttccctttt tccgcttagc ttggtgaacc tcctctttac cttccctaaa 11040 gccgcctgtg ggtagacaat caacgtaagg aagtgttcat tgcggaggag ttggccggag 11100 agcacgcgct gttcaaaagc ttcgttcagg ctagcggcga aaacactacg gaagtgtcgc 11160 ggcgccgatg atggcacgtc ggcatgacgt acgaggtgag catatattga cacatgatca 11220 tcagcgatat tgcgcaacag cgtgttgaac gcacgacaac gcgcattgcg catttcagtt 11280 tcctcaagct cgaatgcaac gccatcaatt ctcgcaatgg tcatgatcga tccgtcttca 11340 agaaggacga tatggtcgct gaggtggcca atataaggga gatagatctc accggatctt 11400 tcggtcgttc cactcgcgcc gagcatcaca ccattcctct ccctcgtggg ggaaccctaa 11460 ttggatttgg gctaacagta gcgccccccc aaactgcact atcaatgctt cttcccgcgg 11520 tccgcaaaaa tagcaggacg acgctcgccg cattgtagtc tcgctccacg atgagccggg 11580 ctgcaaacca taacggcacg agaacgactt cgtagagcgg gttctgaacg ataacgatga 11640 caaagccggc gaacatcatg aataaccctg ccaatgtcag tggcacccca agaaacaatg 11700 cgggccgtgt ggctgcgagg taaagggtcg attcttccaa acgatcagcc atcaactacc 11760 gccagtgagc gtttggccga ggaagctcgc cccaaacatg ataacaatgc cgccgacgac 11820 gccggcaacc agcccaagcg aagcccgccc gaacatccag gagatcccga tagcgacaat 11880 gccgagaaca gcgagtgact ggccgaacgg accaaggata aacgtgcata tattgttaac 11940 cattgtggcg gggtcagtgc cgccacccgc agattgcgct gcggcgggtc cggatgagga 12000 aatgctccat gcaattgcac cgcacaagct tggggcgcag ctcgatatca cgcgcatcat 12060 cgcattcgag agcgagaggc gatttagatg taaacggtat ctctcaaagc atcgcatcaa 12120 tgcgcacctc cttagtataa gtcgaataag acttgattgt cgtctgcgga tttgccgttg 12180 tcctggtgtg gcggtggcgg agcgattaaa ccgccagcgc catcctcctg cgagcggcgc 12240 tgatatgacc cccaaacatc ccacgtctct tcggatttta gcgcctcgtg atcgtctttt 12300 ggaggctcga ttaacgcggg caccagcgat tgagcagctg tttcaacttt tcgcacgtag 12360 ccgtttgcaa aaccgccgat gaaattaccg gtgttgtaag cggagatcgc ccgacgaagc 12420 gcaaattgct tctcgtcaat cgtttcgccg cctgcataac gacttttcag catgtttgca 12480 gcggcagata atgatgtgca cgcctggagc gcaccgtcag gtgtcagacc gagcatagaa 12540 aaatttcgag agtttatttg catgaggcca acatccagcg aatgccgtgc atcgagacgg 12600 tgcctgacga cttgggttgc ttggctgtga tcttgccagt gaagcgtttc gccggtcgtg 12660 ttgtcatgaa tcgctaaagg atcaaagcga ctctccacct tagctatcgc cgcaagcgta 12720 gatgtcgcaa ctgatggggc acacttgcga gcaacatggt caaactcagc agatgagagt 12780 ggcgtggcaa ggctcgacga acagaaggag accatcaagg caagagaaag cgaccccgat 12840 ctcttaagca taccttatct ccttagctcg caactaacac cgcctctccc gttggaagaa 12900 gtgcgttgtt ttatgttgaa gattatcggg agggtcggtt actcgaaaat tttcaattgc 12960 ttctttatga tttcaattga agcgagaaac ctcgcccggc gtcttggaac gcaacatgga 13020 ccgagaaccg cgcatccatg actaagcaac cggatcgacc tattcaggcc gcagttggtc 13080 aggtcaggct cagaacgaaa atgctcggcg aggttacgct gtctgtaaac ccattcgatg 13140 aacgggaagc ttccttccga ttgctcttgg caggaatatt ggcccatgcc tgcttgcgct 13200 ttgcaaatgc tcttatcgcg ttggtatcat atgccttgtc cgccagcaga aacgcactct 13260 aagcgattat ttgtaaaaat gtttcggtca tgcggcggtc atgggcttga cccgctgtca 13320 gcgcaagacg gatcggtcaa ccgtcggcat cgacaacagc gtgaatcttg gtggtcaaac 13380 cgccacggga acgtcccata cagccatcgt cttgatcccg ctgtttcccg tcgccgcatg 13440 ttggtggacg cggacacagg aactgtcaat catgacgaca ttctatcgaa agccttggaa 13500 atcacactca gaatatgatc ccagacgtct gcctcacgcc atcgtacaaa gcgattgtag 13560 caggttgtac aggaaccgta tcgatcagga acgtctgccc agggcgggcc cgtccggaag 13620 cgccacaaga tgacattgat cacccgcgtc aacgcgcggc acgcgacgcg gcttatttgg 13680 gaacaaagga ctgaacaaca gtccattcga aatcggtgac atcaaagcgg ggacgggtta 13740 tcagtggcct ccaagtcaag cctcaatgaa tcaaaatcag accgatttgc aaacctgatt 13800 tatgagtgtg cggcctaaat gatgaaatcg tccttctaga tcgcctccgt ggtgtagcaa 13860 cacctcgcag tatcgccgtg ctgaccttgg ccagggaatt gactggcaag ggtgctttca 13920 catgaccgct cttttggccg cgatagatga tttcgttgct gctttgggca cgtagaagga 13980 gagaagtcat atcggagaaa ttcctcctgg cgcgagagcc tgctctatcg cgacggcatc 14040 ccactgtcgg gaacagaccg gatcattcac gaggcgaaag tcgtcaacac atgcgttata 14100 ggcatcttcc cttgaaggat gatcttgttg ctgccaatct ggaggtgcgg cagccgcagg 14160 cagatgcgat ctcagcgcaa cttgcggcaa aacatctcac tcacctgaaa accactagcg 14220 agtctcgcga tcagacgaag gccttttact taacgacaca atatccgatg tctgcatcac 14280 aggcgtcgct atcccagtca atactaaagc ggtgcaggaa ctaaagatta ctgatgactt 14340 aggcgtgcca cgaggcctga gacgacgcgc gtagacagtt ttttgaaatc attatcaaag 14400 tgatggcctc cgctgaagcc tatcacctct gcgccggtct gtcggagaga tgggcaagca 14460 ttattacggt cttcgcgccc gtacatgcat tggacgattg cagggtcaat ggatctgaga 14520 tcatccagag gattgccgcc cttaccttcc gtttcgagtt ggagccagcc cctaaatgag 14580 acgacatagt cgacttgatg tgacaatgcc aagagagaga tttgcttaac ccgatttttt 14640 tgctcaagcg taagcctatt gaagcttgcc ggcatgacgt ccgcgccgaa agaatatcct 14700 acaagtaaaa cattctgcac accgaaatgc ttggtgtaga catcgattat gtgaccaaga 14760 tccttagcag tttcgcttgg ggaccgctcc gaccagaaat accgaagtga actgacgcca 14820 atgacaggaa tcccttccgt ctgcagatag gtaccatcga tagatctgct gcctcgcgcg 14880 tttcggtgat gacggtgaaa acctctgaca catgcagctc ccggagacgg tcacagcttg 14940 tctgtaagcg gatgccggga gcagacaagc ccgtcagggc gcgtcagcgg gtgttggcgg 15000 gtgtcggggc gcagccatga cccagtcacg tagcgatagc ggagtgtata ctggcttaac 15060 tatgcggcat cagagcagat tgtactgaga gtgcaccata tgcggtgtga aataccgcac 15120 agatgcgtaa ggagaaaata ccgcatcagg cgctcttccg cttcctcgct cactgactcg 15180 ctgcgctcgg tcgttcggct gcggcgagcg gtatcagctc actcaaaggc ggtaatacgg 15240 ttatccacag aatcagggga taacgcagga aagaacatgt gagcaaaagg ccagcaaaag 15300 gccaggaacc gtaaaaaggc cgcgttgctg gcgtttttcc ataggctccg cccccctgac 15360 gagcatcaca aaaatcgacg ctcaagtcag aggtggcgaa acccgacagg actataaaga 15420 taccaggcgt ttccccctgg aagctccctc gtgcgctctc ctgttccgac cctgccgctt 15480 accggatacc tgtccgcctt tctcccttcg ggaagcgtgg cgctttctca tagctcacgc 15540 tgtaggtatc tcagttcggt gtaggtcgtt cgctccaagc tgggctgtgt gcacgaaccc 15600 cccgttcagc ccgaccgctg cgccttatcc ggtaactatc gtcttgagtc caacccggta 15660 agacacgact tatcgccact ggcagcagcc actggtaaca ggattagcag agcgaggtat 15720 gtaggcggtg ctacagagtt cttgaagtgg tggcctaact acggctacac tagaaggaca 15780 gtatttggta tctgcgctct gctgaagcca gttaccttcg gaaaaagagt tggtagctct 15840 tgatccggca aacaaaccac cgctggtagc ggtggttttt ttgtttgcaa gcagcagatt 15900 acgcgcagaa aaaaaggatc tcaagaagat cctttgatct tttctacggg gtctgacgct 15960 cagtggaacg aaaactcacg ttaagggatt ttggtcatga gattatcaaa aaggatcttc 16020 acctagatcc ttttaaatta aaaatgaagt tttaaatcaa tctaaagtat atatgagtaa 16080 acttggtctg acagttacca atgcttaatc agtgaggcac ctatctcagc gatctgtcta 16140 tttcgttcat ccatagttgc ctgactcccc gtcgtgtaga taactacgat acgggagggc 16200 ttaccatctg gccccagtgc tgcaatgata ccgcgagacc cacgctcacc ggctccagat 16260 ttatcagcaa taaaccagcc agccggaagg gccgagcgca gaagtggtcc tgcaacttta 16320 tccgcctcca tccagtctat taattgttgc cgggaagcta gagtaagtag ttcgccagtt 16380 aatagtttgc gcaacgttgt tgccattgct gcaggggggg gggggggggg gttccattgt 16440 tcattccacg gacaaaaaca gagaaaggaa acgacagagg ccaaaaagct cgctttcagc 16500 acctgtcgtt tcctttcttt tcagagggta ttttaaataa aaacattaag ttatgacgaa 16560 gaagaacgga aacgccttaa accggaaaat tttcataaat agcgaaaacc cgcgaggtcg 16620 ccgccccgta acctgtcgga tcaccggaaa ggacccgtaa agtgataatg attatcatct 16680 acatatcaca acgtgcgtgg aggccatcaa accacgtcaa ataatcaatt atgacgcagg 16740 tatcgtatta attgatctgc atcaacttaa cgtaaaaaca acttcagaca atacaaatca 16800 gcgacactga atacggggca acctcatgtc cccccccccc ccccccctgc aggcatcgtg 16860 gtgtcacgct cgtcgtttgg tatggcttca ttcagctccg gttcccaacg atcaaggcga 16920 gttacatgat cccccatgtt gtgcaaaaaa gcggttagct ccttcggtcc tccgatcgtt 16980 gtcagaagta agttggccgc agtgttatca ctcatggtta tggcagcact gcataattct 17040 cttactgtca tgccatccgt aagatgcttt tctgtgactg gtgagtactc aaccaagtca 17100 ttctgagaat agtgtatgcg gcgaccgagt tgctcttgcc cggcgtcaac acgggataat 17160 accgcgccac atagcagaac tttaaaagtg ctcatcattg gaaaacgttc ttcggggcga 17220 aaactctcaa ggatcttacc gctgttgaga tccagttcga tgtaacccac tcgtgcaccc 17280 aactgatctt cagcatcttt tactttcacc agcgtttctg ggtgagcaaa aacaggaagg 17340 caaaatgccg caaaaaaggg aataagggcg acacggaaat gttgaatact catactcttc 17400 ctttttcaat attattgaag catttatcag ggttattgtc tcatgagcgg atacatattt 17460 gaatgtattt agaaaaataa acaaataggg gttccgcgca catttccccg aaaagtgcca 17520 cctgacgtct aagaaaccat tattatcatg acattaacct ataaaaatag gcgtatcacg 17580 aggccctttc gtcttcaaga attcggagct tttgccattc tcaccggatt cagtcgtcac 17640 tcatggtgat ttctcacttg ataaccttat ttttgacgag gggaaattaa taggttgtat 17700 tgatgttgga cgagtcggaa tcgcagaccg ataccaggat cttgccatcc tatggaactg 17760 cctcggtgag ttttctcctt cattacagaa acggcttttt caaaaatatg gtattgataa 17820 tcctgatatg aataaattgc agtttcattt gatgctcgat gagtttttct aatcagaatt 17880 ggttaattgg ttgtaacact ggcagagcat tacgctgact tgacgggacg gcggctttgt 17940 tgaataaatc gaacttttgc tgagttgaag gatcagatca cgcatcttcc cgacaacgca 18000 gaccgttccg tggcaaagca aaagttcaaa atcaccaact ggtccaccta caacaaagct 18060 ctcatcaacc gtggctccct cactttctgg ctggatgatg gggcgattca ggcctggtat 18120 gagtcagcaa caccttcttc acgaggcaga cctcagcgcc agaaggccgc cagagaggcc 18180 gagcgcggcc gtgaggcttg gacgctaggg cagggcatga aaaagcccgt agcgggctgc 18240 tacgggcgtc tgacgcggtg gaaaggggga ggggatgttg tctacatggc tctgctgtag 18300 tgagtgggtt gcgctccggc agcggtcctg atcaatcgtc accctttctc ggtccttcaa 18360 cgttcctgac aacgagcctc cttttcgcca atccatcgac aatcaccgcg agtccctgct 18420 cgaacgctgc gtccggaccg gcttcgtcga aggcgtctat cgcggcccgc aacagcggcg 18480 agagcggagc ctgttcaacg gtgccgccgc gctcgccggc atcgctgtcg ccggcctgct 18540 cctcaagcac ggccccaaca gtgaagtagc tgattgtcat cagcgcattg acggcgtccc 18600 cggccgaaaa acccgcctcg cagaggaagc gaagctgcgc gtcggccgtt tccatctgcg 18660 gtgcgcccgg tcgcgtgccg gcatggatgc gcgcgccatc gcggtaggcg agcagcgcct 18720 gcctgaagct gcgggcattc ccgatcagaa atgagcgcca gtcgtcgtcg gctctcggca 18780 ccgaatgcgt atgattctcc gccagcatgg cttcggccag tgcgtcgagc agcgcccgct 18840 tgttcctgaa gtgccagtaa agcgccggct gctgaacccc caaccgttcc gccagtttgc 18900 gtgtcgtcag accgtctacg ccgacctcgt tcaacaggtc cagggcggca cggatcactg 18960 tattcggctg caactttgtc atgcttgaca ctttatcact gataaacata atatgtccac 19020 caacttatca gtgataaaga atccgcgcgt tcaatcggac cagcggaggc tggtccggag 19080 gccagacgtg aaacccaaca tacccctgat cgtaattctg agcactgtcg cgctcgacgc 19140 tgtcggcatc ggcctgatta tgccggtgct gccgggcctc ctgcgcgatc tggttcactc 19200 gaacgacgtc accgcccact atggcattct gctggcgctg tatgcgttgg tgcaatttgc 19260 ctgcgcacct gtgctgggcg cgctgtcgga tcgtttcggg cggcggccaa tcttgctcgt 19320 ctcgctggcc ggcgccactg tcgactacgc catcatggcg acagcgcctt tcctttgggt 19380 tctctatatc gggcggatcg tggccggcat caccggggcg actggggcgg tagccggcgc 19440 ttatattgcc gatatcactg atggcgatga gcgcgcgcgg cacttcggct tcatgagcgc 19500 ctgtttcggg ttcgggatgg tcgcgggacc tgtgctcggt gggctgatgg gcggtttctc 19560 cccccacgct ccgttcttcg ccgcggcagc cttgaacggc ctcaatttcc tgacgggctg 19620 tttccttttg ccggagtcgc acaaaggcga acgccggccg ttacgccggg aggctctcaa 19680 cccgctcgct tcgttccggt gggcccgggg catgaccgtc gtcgccgccc tgatggcggt 19740 cttcttcatc atgcaacttg tcggacaggt gccggccgcg ctttgggtca ttttcggcga 19800 ggatcgcttt cactgggacg cgaccacgat cggcatttcg cttgccgcat ttggcattct 19860 gcattcactc gcccaggcaa tgatcaccgg ccctgtagcc gcccggctcg gcgaaaggcg 19920 ggcactcatg ctcggaatga ttgccgacgg cacaggctac atcctgcttg ccttcgcgac 19980 acggggatgg atggcgttcc cgatcatggt cctgcttgct tcgggtggca tcggaatgcc 20040 ggcgctgcaa gcaatgttgt ccaggcaggt ggatgaggaa cgtcaggggc agctgcaagg 20100 ctcactggcg gcgctcacca gcctgacctc gatcgtcgga cccctcctct tcacggcgat 20160 ctatgcggct tctataacaa cgtggaacgg gtgggcatgg attgcaggcg ctgccctcta 20220 cttgctctgc ctgccggcgc tgcgtcgcgg gctttggagc ggcgcagggc aacgagccga 20280 tcgctgatcg tggaaacgat aggcctatgc catgcgggtc aaggcgactt ccggcaagct 20340 atacgcgccc taggagtgcg gttggaacgt tggcccagcc agatactccc gatcacgagc 20400 aggacgccga tgatttgaag cgcactcagc gtctgatcca agaacaacca tcctagcaac 20460 acggcggtcc ccgggctgag aaagcccagt aaggaaacaa ctgtaggttc gagtcgcgag 20520 atcccccgga accaaaggaa gtaggttaaa cccgctccga tcaggccgag ccacgccagg 20580 ccgagaacat tggttcctgt aggcatcggg attggcggat caaacactaa agctactgga 20640 acgagcagaa gtcctccggc cgccagttgc caggcggtaa aggtgagcag aggcacggga 20700 ggttgccact tgcgggtcag cacggttccg aacgccatgg aaaccgcccc cgccaggccc 20760 gctgcgacgc cgacaggatc tagcgctgcg tttggtgtca acaccaacag cgccacgccc 20820 gcagttccgc aaatagcccc caggaccgcc atcaatcgta tcgggctacc tagcagagcg 20880 gcagagatga acacgaccat cagcggctgc acagcgccta ccgtcgccgc gaccccgccc 20940 ggcaggcggt agaccgaaat aaacaacaag ctccagaata gcgaaatatt aagtgcgccg 21000 aggatgaaga tgcgcatcca ccagattccc gttggaatct gtcggacgat catcacgagc 21060 aataaacccg ccggcaacgc ccgcagcagc ataccggcga cccctcggcc tcgctgttcg 21120 ggctccacga aaacgccgga cagatgcgcc ttgtgagcgt ccttggggcc gtcctcctgt 21180 ttgaagaccg acagcccaat gatctcgccg tcgatgtagg cgccgaatgc cacggcatct 21240 cgcaaccgtt cagcgaacgc ctccatgggc tttttctcct cgtgctcgta aacggacccg 21300 aacatctctg gagctttctt cagggccgac aatcggatct cgcggaaatc ctgcacgtcg 21360 gccgctccaa gccgtcgaat ctgagcctta atcacaattg tcaattttaa tcctctgttt 21420 atcggcagtt cgtagagcgc gccgtgcgtc ccgagcgata ctgagcgaag caagtgcgtc 21480 gagcagtgcc cgcttgttcc tgaaatgcca gtaaagcgct ggctgctgaa cccccagccg 21540 gaactgaccc cacaaggccc tagcgtttgc aatgcaccag gtcatcattg acccaggcgt 21600 gttccaccag gccgctgcct cgcaactctt cgcaggcttc gccgacctgc tcgcgccact 21660 tcttcacgcg ggtggaatcc gatccgcaca tgaggcggaa ggtttccagc ttgagcgggt 21720 acggctcccg gtgcgagctg aaatagtcga acatccgtcg ggccgtcggc gacagcttgc 21780 ggtacttctc ccatatgaat ttcgtgtagt ggtcgccagc aaacagcacg acgatttcct 21840 cgtcgatcag gacctggcaa cgggacgttt tcttgccacg gtccaggacg cggaagcggt 21900 gcagcagcga caccgattcc aggtgcccaa cgcggtcgga cgtgaagccc atcgccgtcg 21960 cctgtaggcg cgacaggcat tcctcggcct tcgtgtaata ccggccattg atcgaccagc 22020 ccaggtcctg gcaaagctcg tagaacgtga aggtgatcgg ctcgccgata ggggtgcgct 22080 tcgcgtactc caacacctgc tgccacacca gttcgtcatc gtcggcccgc agctcgacgc 22140 cggtgtaggt gatcttcacg tccttgttga cgtggaaaat gaccttgttt tgcagcgcct 22200 cgcgcgggat tttcttgttg cgcgtggtga acagggcaga gcgggccgtg tcgtttggca 22260 tcgctcgcat cgtgtccggc cacggcgcaa tatcgaacaa ggaaagctgc atttccttga 22320 tctgctgctt cgtgtgtttc agcaacgcgg cctgcttggc ctcgctgacc tgttttgcca 22380 ggtcctcgcc ggcggttttt cgcttcttgg tcgtcatagt tcctcgcgtg tcgatggtca 22440 tcgacttcgc caaacctgcc gcctcctgtt cgagacgacg cgaacgctcc acggcggccg 22500 atggcgcggg cagggcaggg ggagccagtt gcacgctgtc gcgctcgatc ttggccgtag 22560 cttgctggac catcgagccg acggactgga aggtttcgcg gggcgcacgc atgacggtgc 22620 ggcttgcgat ggtttcggca tcctcggcgg aaaaccccgc gtcgatcagt tcttgcctgt 22680 atgccttccg gtcaaacgtc cgattcattc accctccttg cgggattgcc ccgactcacg 22740 ccggggcaat gtgcccttat tcctgatttg acccgcctgg tgccttggtg tccagataat 22800 ccaccttatc ggcaatgaag tcggtcccgt agaccgtctg gccgtccttc tcgtacttgg 22860 tattccgaat cttgccctgc acgaatacca gcgacccctt gcccaaatac ttgccgtggg 22920 cctcggcctg agagccaaaa cacttgatgc ggaagaagtc ggtgcgctcc tgcttgtcgc 22980 cggcatcgtt gcgccactct tcattaaccg ctatatcgaa aattgcttgc ggcttgttag 23040 aattgccatg acgtacctcg gtgtcacggg taagattacc gataaactgg aactgattat 23100 ggctcatatc gaaagtctcc ttgagaaagg agactctagt ttagctaaac attggttccg 23160 ctgtcaagaa ctttagcggc taaaattttg cgggccgcga ccaaaggtgc gaggggcggc 23220 ttccgctgtg tacaaccaga tatttttcac caacatcctt cgtctgctcg atgagcgggg 23280 catgacgaaa catgagctgt cggagagggc aggggtttca atttcgtttt tatcagactt 23340 aaccaacggt aaggccaacc cctcgttgaa ggtgatggag gccattgccg acgccctgga 23400 aactccccta cctcttctcc tggagtccac cgaccttgac cgcgaggcac tcgcggagat 23460 tgcgggtcat cctttcaaga gcagcgtgcc gcccggatac gaacgcatca gtgtggtttt 23520 gccgtcacat aaggcgttta tcgtaaagaa atggggcgac gacacccgaa aaaagctgcg 23580 tggaaggctc tgacgccaag ggttagggct tgcacttcct tctttagccg ctaaaacggc 23640 cccttctctg cgggccgtcg gctcgcgcat catatcgaca tcctcaacgg aagccgtgcc 23700 gcgaatggca tcgggcgggt gcgctttgac agttgttttc tatcagaacc cctacgtcgt 23760 gcggttcgat tagctgtttg tcttgcaggc taaacacttt cggtatatcg tttgcctgtg 23820 cgataatgtt gctaatgatt tgttgcgtag gggttactga aaagtgagcg ggaaagaaga 23880 gtttcagacc atcaaggagc gggccaagcg caagctggaa cgcgacatgg gtgcggacct 23940 gttggccgcg ctcaacgacc cgaaaaccgt tgaagtcatg ctcaacgcgg acggcaaggt 24000 gtggcacgaa cgccttggcg agccgatgcg gtacatctgc gacatgcggc ccagccagtc 24060 gcaggcgatt atagaaacgg tggccggatt ccacggcaaa gaggtcacgc ggcattcgcc 24120 catcctggaa ggcgagttcc ccttggatgg cagccgcttt gccggccaat tgccgccggt 24180 cgtggccgcg ccaacctttg cgatccgcaa gcgcgcggtc gccatcttca cgctggaaca 24240 gtacgtcgag gcgggcatca tgacccgcga gcaatacgag gtcattaaaa gcgccgtcgc 24300 ggcgcatcga aacatcctcg tcattggcgg tactggctcg ggcaagacca cgctcgtcaa 24360 cgcgatcatc aatgaaatgg tcgccttcaa cccgtctgag cgcgtcgtca tcatcgagga 24420 caccggcgaa atccagtgcg ccgcagagaa cgccgtccaa taccacacca gcatcgacgt 24480 ctcgatgacg ctgctgctca agacaacgct gcgtatgcgc cccgaccgca tcctggtcgg 24540 tgaggtacgt ggccccgaag cccttgatct gttgatggcc tggaacaccg ggcatgaagg 24600 aggtgccgcc accctgcacg caaacaaccc caaagcgggc ctgagccggc tcgccatgct 24660 tatcagcatg cacccggatt caccgaaacc cattgagccg ctgattggcg aggcggttca 24720 tgtggtcgtc catatcgcca ggacccctag cggccgtcga gtgcaagaaa ttctcgaagt 24780 tcttggttac gagaacggcc agtacatcac caaaaccctg taaggagtat ttccaatgac 24840 aacggctgtt ccgttccgtc tgaccatgaa tcgcggcatt ttgttctacc ttgccgtgtt 24900 cttcgttctc gctctcgcgt tatccgcgca tccggcgatg gcctcggaag gcaccggcgg 24960 cagcttgcca tatgagagct ggctgacgaa cctgcgcaac tccgtaaccg gcccggtggc 25020 cttcgcgctg tccatcatcg gcatcgtcgt cgccggcggc gtgctgatct tcggcggcga 25080 actcaacgcc ttcttccgaa ccctgatctt cctggttctg gtgatggcgc tgctggtcgg 25140 cgcgcagaac gtgatgagca ccttcttcgg tcgtggtgcc gaaatcgcgg ccctcggcaa 25200 cggggcgctg caccaggtgc aagtcgcggc ggcggatgcc gtgcgtgcgg tagcggctgg 25260 acggctcgcc taatcatggc tctgcgcacg atccccatcc gtcgcgcagg caaccgagaa 25320 aacctgttca tgggtggtga tcgtgaactg gtgatgttct cgggcctgat ggcgtttgcg 25380 ctgattttca gcgcccaaga gctgcgggcc accgtggtcg gtctgatcct gtggttcggg 25440 gcgctctatg cgttccgaat catggcgaag gccgatccga agatgcggtt cgtgtacctg 25500 cgtcaccgcc ggtacaagcc gtattacccg gcccgctcga ccccgttccg cgagaacacc 25560 aatagccaag ggaagcaata ccgatgatcc aagcaattgc gattgcaatc gcgggcctcg 25620 gcgcgcttct gttgttcatc ctctttgccc gcatccgcgc ggtcgatgcc gaactgaaac 25680 tgaaaaagca tcgttccaag gacgccggcc tggccgatct gctcaactac gccgctgtcg 25740 tcgatgacgg cgtaatcgtg ggcaagaacg gcagctttat ggctgcctgg ctgtacaagg 25800 gcgatgacaa cgcaagcagc accgaccagc agcgcgaagt agtgtccgcc cgcatcaacc 25860 aggccctcgc gggcctggga agtgggtgga tgatccatgt ggacgccgtg cggcgtcctg 25920 ctccgaacta cgcggagcgg ggcctgtcgg cgttccctga ccgtctgacg gcagcgattg 25980 aagaagagcg ctcggtcttg ccttgctcgt cggtgatgta cttcaccagc tccgcgaagt 26040 cgctcttctt gatggagcgc atggggacgt gcttggcaat cacgcgcacc ccccggccgt 26100 tttagcggct aaaaaagtca tggctctgcc ctcgggcgga ccacgcccat catgaccttg 26160 ccaagctcgt cctgcttctc ttcgatcttc gccagcaggg cgaggatcgt ggcatcaccg 26220 aaccgcgccg tgcgcgggtc gtcggtgagc cagagtttca gcaggccgcc caggcggccc 26280 aggtcgccat tgatgcgggc cagctcgcgg acgtgctcat agtccacgac gcccgtgatt 26340 ttgtagccct ggccgacggc cagcaggtag gccgacaggc tcatgccggc cgccgccgcc 26400 ttttcctcaa tcgctcttcg ttcgtctgga aggcagtaca ccttgatagg tgggctgccc 26460 ttcctggttg gcttggtttc atcagccatc cgcttgccct catctgttac gccggcggta 26520 gccggccagc ctcgcagagc aggattcccg ttgagcaccg ccaggtgcga ataagggaca 26580 gtgaagaagg aacacccgct cgcgggtggg cctacttcac ctatcctgcc cggctgacgc 26640 cgttggatac accaaggaaa gtctacacga accctttggc aaaatcctgt atatcgtgcg 26700 aaaaaggatg gatataccga aaaaatcgct ataatgaccc cgaagcaggg ttatgcagcg 26760 gaaaagcgct gcttccctgc tgttttgtgg aatatctacc gactggaaac aggcaaatgc 26820 aggaaattac tgaactgagg ggacaggcga gagacgatgc caaagagcta caccgacgag 26880 ctggccgagt gggttgaatc ccgcgcggcc aagaagcgcc ggcgtgatga ggctgcggtt 26940 gcgttcctgg cggtgagggc ggatgtcgag gcggcgttag cgtccggcta tgcgctcgtc 27000 accatttggg agcacatgcg ggaaacgggg aaggtcaagt tctcctacga gacgttccgc 27060 tcgcacgcca ggcggcacat caaggccaag cccgccgatg tgcccgcacc gcaggccaag 27120 gctgcggaac ccgcgccggc acccaagacg ccggagccac ggcggccgaa gcaggggggc 27180 aaggctgaaa agccggcccc cgctgcggcc ccgaccggct tcaccttcaa cccaacaccg 27240 gacaaaaagg atctactgta atggcgaaaa ttcacatggt tttgcagggc aagggcgggg 27300 tcggcaagtc ggccatcgcc gcgatcattg cgcagtacaa gatggacaag gggcagacac 27360 ccttgtgcat cgacaccgac ccggtgaacg cgacgttcga gggctacaag gccctgaacg 27420 tccgccggct gaacatcatg gccggcgacg aaattaactc gcgcaacttc gacaccctgg 27480 tcgagctgat tgcgccgacc aaggatgacg tggtgatcga caacggtgcc agctcgttcg 27540 tgcctctgtc gcattacctc atcagcaacc aggtgccggc tctgctgcaa gaaatggggc 27600 atgagctggt catccatacc gtcgtcaccg gcggccaggc tctcctggac acggtgagcg 27660 gcttcgccca gctcgccagc cagttcccgg ccgaagcgct tttcgtggtc tggctgaacc 27720 cgtattgggg gcctatcgag catgagggca agagctttga gcagatgaag gcgtacacgg 27780 ccaacaaggc ccgcgtgtcg tccatcatcc agattccggc cctcaaggaa gaaacctacg 27840 gccgcgattt cagcgacatg ctgcaagagc ggctgacgtt cgaccaggcg ctggccgatg 27900 aatcgctcac gatcatgacg cggcaacgcc tcaagatcgt gcggcgcggc ctgtttgaac 27960 agctcgacgc ggcggccgtg ctatgagcga ccagattgaa gagctgatcc gggagattgc 28020 ggccaagcac ggcatcgccg tcggccgcga cgacccggtg ctgatcctgc ataccatcaa 28080 cgcccggctc atggccgaca gtgcggccaa gcaagaggaa atccttgccg cgttcaagga 28140 agagctggaa gggatcgccc atcgttgggg cgaggacgcc aaggccaaag cggagcggat 28200 gctgaacgcg gccctggcgg ccagcaagga cgcaatggcg aaggtaatga aggacagcgc 28260 cgcgcaggcg gccgaagcga tccgcaggga aatcgacgac ggccttggcc gccagctcgc 28320 ggccaaggtc gcggacgcgc ggcgcgtggc gatgatgaac atgatcgccg gcggcatggt 28380 gttgttcgcg gccgccctgg tggtgtgggc ctcgttatga atcgcagagg cgcagatgaa 28440 aaagcccggc gttgccgggc tttgtttttg cgttagctgg gcttgtttga caggcccaag 28500 ctctgactgc gcccgcgctc gcgctcctgg gcctgtttct tctcctgctc ctgcttgcgc 28560 atcagggcct ggtgccgtcg ggctgcttca cgcatcgaat cccagtcgcc ggccagctcg 28620 ggatgctccg cgcgcatctt gcgcgtcgcc agttcctcga tcttgggcgc gtgaatgccc 28680 atgccttcct tgatttcgcg caccatgtcc agccgcgtgt gcagggtctg caagcgggct 28740 tgctgttggg cctgctgctg ctgccaggcg gcctttgtac gcggcaggga cagcaagccg 28800 ggggcattgg actgtagctg ctgcaaacgc gcctgctgac ggtctacgag ctgttctagg 28860 cggtcctcga tgcgctccac ctggtcatgc tttgcctgca cgtagagcgc aagggtctgc 28920 tggtaggtct gctcgatggg cgcggattct aagagggcct gctgttccgt ctcggcctcc 28980 tgggccgcct gtagcaaatc ctcgccgctg ttgccgctgg actgctttac tgccggggac 29040 tgctgttgcc ctgctcgcgc cgtcgtcgca gttcggcttg cccccactcg attgactgct 29100 tcatttcgag ccgcagcgat gcgatctcgg attgcgtcaa cggacggggc agcgcggagg 29160 tgtccggctt ctccttgggt gagtcggtcg atgccatagc caaaggtttc cttccaaaat 29220 gcgtccattg ctggaccgtg tttctcattg atgcccgcaa gcatcttcgg cttgaccgcc 29280 aggtcaagcg cgccttcatg ggcggtcatg acggacgccg ccatgacctt gccgccgttg 29340 ttctcgatgt agccgcgtaa tgaggcaatg gtgccgccca tcgtcagcgt gtcatcgaca 29400 acgatgtact tctggccggg gatcacctcc ccctcgaaag tcgggttgaa cgccaggcga 29460 tgatctgaac cggctccggt tcgggcgacc ttctcccgct gcacaatgtc cgtttcgacc 29520 tcaaggccaa ggcggtcggc cagaacgacc gccatcatgg ccggaatctt gttgttcccc 29580 gccgcctcga cggcgaggac tggaacgatg cggggcttgt cgtcgccgat cagcgtcttg 29640 agctgggcaa cagtgtcgtc cgaaatcagg cgctcgacca aattaagcgc cgcttccgcg 29700 tcgccctgct tcgcagcctg gtattcaggc tcgttggtca aagaaccaag gtcgccgttg 29760 cgaaccacct tcgggaagtc tccccacggt gcgcgctcgg ctctgctgta gctgctcaag 29820 acgcctccct ttttagccgc taaaactcta acgagtgcgc ccgcgactca acttgacgct 29880 ttcggcactt acctgtgcct tgccacttgc gtcataggtg atgcttttcg cactcccgat 29940 ttcaggtact ttatcgaaat ctgaccgggc gtgcattaca aagttcttcc ccacctgttg 30000 gtaaatgctg ccgctatctg cgtggacgat gctgccgtcg tggcgctgcg acttatcggc 30060 cttttgggcc atatagatgt tgtaaatgcc aggtttcagg gccccggctt tatctacctt 30120 ctggttcgtc catgcgcctt ggttctcggt ctggacaatt ctttgcccat tcatgaccag 30180 gaggcggtgt ttcattgggt gactcctgac ggttgcctct ggtgttaaac gtgtcctggt 30240 cgcttgccgg ctaaaaaaaa gccgacctcg gcagttcgag gccggctttc cctagagccg 30300 ggcgcgtcaa ggttgttcca tctattttag tgaactgcgt tcgatttatc agttactttc 30360 ctcccgcttt gtgtttcctc ccactcgttt ccgcgtctag ccgacccctc aacatagcgg 30420 cctcttcttg ggctgccttt gcctcttgcc gcgcttcgtc acgctcggct tgcaccgtcg 30480 taaagcgctc ggcctgcctg gccgcctctt gcgccgccaa cttcctttgc tcctggtggg 30540 cctcggcgtc ggcctgcgcc ttcgctttca ccgctgccaa ctccgtgcgc aaactctccg 30600 cttcgcgcct ggtggcgtcg cgctcgccgc gaagcgcctg catttcctgg ttggccgcgt 30660 ccagggtctt gcggctctct tctttgaatg cgcgggcgtc ctggtgagcg tagtccagct 30720 cggcgcgcag ctcctgcgct cgacgctcca cctcgtcggc ccgctgcgtc gccagcgcgg 30780 cccgctgctc ggctcctgcc agggcggtgc gtgcttcggc cagggcttgc cgctggcgtg 30840 cggccagctc ggccgcctcg gcggcctgct gctctagcaa tgtaacgcgc gcctgggctt 30900 cttccagctc gcgggcctgc gcctcgaagg cgtcggccag ctccccgcgc acggcttcca 30960 actcgttgcg ctcacgatcc cagccggctt gcgctgcctg caacgattca ttggcaaggg 31020 cctgggcggc ttgccagagg gcggccacgg cctggttgcc ggcctgctgc accgcgtccg 31080 gcacctggac tgccagcggg gcggcctgcg ccgtgcgctg gcgtcgccat tcgcgcatgc 31140 cggcgctggc gtcgttcatg ttgacgcggg cggccttacg cactgcatcc acggtcggga 31200 agttctcccg gtcgccttgc tcgaacagct cgtccgcagc cgcaaaaatg cggtcgcgcg 31260 tctctttgtt cagttccatg ttggctccgg taattggtaa gaataataat actcttacct 31320 accttatcag cgcaagagtt tagctgaaca gttctcgact taacggcagg ttttttagcg 31380 gctgaagggc aggcaaaaaa agccccgcac ggtcggcggg ggcaaagggt cagcgggaag 31440 gggattagcg ggcgtcgggc ttcttcatgc gtcggggccg cgcttcttgg gatggagcac 31500 gacgaagcgc gcacgcgcat cgtcctcggc cctatcggcc cgcgtcgcgg tcaggaactt 31560 gtcgcgcgct aggtcctccc tggtgggcac caggggcatg aactcggcct gctcgatgta 31620 ggtccactcc atgaccgcat cgcagtcgag gccgcgttcc ttcaccgtct cttgcaggtc 31680 gcggtacgcc cgctcgttga gcggctggta acgggccaat tggtcgtaaa tggctgtcgg 31740 ccatgagcgg cctttcctgt tgagccagca gccgacgacg aagccggcaa tgcaggcccc 31800 tggcacaacc aggccgacgc cgggggcagg ggatggcagc agctcgccaa ccaggaaccc 31860 cgccgcgatg atgccgatgc cggtcaacca gcccttgaaa ctatccggcc ccgaaacacc 31920 cctgcgcatt gcctggatgc tgcgccggat agcttgcaac atcaggagcc gtttcttttg 31980 ttcgtcagtc atggtccgcc ctcaccagtt gttcgtatcg gtgtcggacg aactgaaatc 32040 gcaagagctg ccggtatcgg tccagccgct gtccgtgtcg ctgctgccga agcacggcga 32100 ggggtccgcg aacgccgcag acggcgtatc cggccgcagc gcatcgccca gcatggcccc 32160 ggtcagcgag ccgccggcca ggtagcccag catggtgctg ttggtcgccc cggccaccag 32220 ggccgacgtg acgaaatcgc cgtcattccc tctggattgt tcgctgctcg gcggggcagt 32280 gcgccgcgcc ggcggcgtcg tggatggctc gggttggctg gcctgcgacg gccggcgaaa 32340 ggtgcgcagc agctcgttat cgaccggctg cggcgtcggg gccgccgcct tgcgctgcgg 32400 tcggtgttcc ttcttcggct cgcgcagctt gaacagcatg atcgcggaaa ccagcagcaa 32460 cgccgcgcct acgcctcccg cgatgtagaa cagcatcgga ttcattcttc ggtcctcctt 32520 gtagcggaac cgttgtctgt gcggcgcggg tggcccgcgc cgctgtcttt ggggatcagc 32580 cctcgatgag cgcgaccagt ttcacgtcgg caaggttcgc ctcgaactcc tggccgtcgt 32640 cctcgtactt caaccaggca tagccttccg ccggcggccg acggttgagg ataaggcggg 32700 cagggcgctc gtcgtgctcg acctggacga tggccttttt cagcttgtcc gggtccggct 32760 ccttcgcgcc cttttccttg gcgtccttac cgtcctggtc gccgtcctcg ccgtcctggc 32820 cgtcgccggc ctccgcgtca cgctcggcat cagtctggcc gttgaaggca tcgacggtgt 32880 tgggatcgcg gcccttctcg tccaggaact cgcgcagcag cttgaccgtg ccgcgcgtga 32940 tttcctgggt gtcgtcgtca agccacgcct cgacttcctc cgggcgcttc ttgaaggccg 33000 tcaccagctc gttcaccacg gtcacgtcgc gcacgcggcc ggtgttgaac gcatcggcga 33060 tcttctccgg caggtccagc agcgtgacgt gctgggtgat gaacgccggc gacttgccga 33120 tttccttggc gatatcgcct ttcttcttgc ccttcgccag ctcgcggcca atgaagtcgg 33180 caatttcgcg cggggtcagc tcgttgcgtt gcaggttctc gataacctgg tcggcttcgt 33240 tgtagtcgtt gtcgatgaac gccgggatgg acttcttgcc ggcccacttc gagccacggt 33300 agcggcgggc gccgtgattg atgatatagc ggcccggctg ctcctggttc tcgcgcaccg 33360 aaatgggtga cttcaccccg cgctctttga tcgtggcacc gatttccgcg atgctctccg 33420 gggaaaagcc ggggttgtcg gccgtccgcg gctgatgcgg atcttcgtcg atcaggtcca 33480 ggtccagctc gatagggccg gaaccgccct gagacgccgc aggagcgtcc aggaggctcg 33540 acaggtcgcc gatgctatcc aaccccaggc cggacggctg cgccgcgcct gcggcttcct 33600 gagcggccgc agcggtgttt ttcttggtgg tcttggcttg agccgcagtc attgggaaat 33660 ctccatcttc gtgaacacgt aatcagccag ggcgcgaacc tctttcgatg ccttgcgcgc 33720 ggccgttttc ttgatcttcc agaccggcac accggatgcg agggcatcgg cgatgctgct 33780 gcgcaggcca acggtggccg gaatcatcat cttggggtac gcggccagca gctcggcttg 33840 gtggcgcgcg tggcgcggat tccgcgcatc gaccttgctg ggcaccatgc caaggaattg 33900 cagcttggcg ttcttctggc gcacgttcgc aatggtcgtg accatcttct tgatgccctg 33960 gatgctgtac gcctcaagct cgatggggga cagcacatag tcggccgcga agagggcggc 34020 cgccaggccg acgccaaggg tcggggccgt gtcgatcagg cacacgtcga agccttggtt 34080 cgccagggcc ttgatgttcg ccccgaacag ctcgcgggcg tcgtccagcg acagccgttc 34140 ggcgttcgcc agtaccgggt tggactcgat gagggcgagg cgcgcggcct ggccgtcgcc 34200 ggctgcgggt gcggtttcgg tccagccgcc ggcagggaca gcgccgaaca gcttgcttgc 34260 atgcaggccg gtagcaaagt ccttgagcgt gtaggacgca ttgccctggg ggtccaggtc 34320 gatcacggca acccgcaagc cgcgctcgaa aaagtcgaag gcaagatgca caagggtcga 34380 agtcttgccg acgccgcctt tctggttggc cgtgaccaaa gttttcatcg tttggtttcc 34440 tgttttttct tggcgtccgc ttcccacttc cggacgatgt acgcctgatg ttccggcaga 34500 accgccgtta cccgcgcgta cccctcgggc aagttcttgt cctcgaacgc ggcccacacg 34560 cgatgcaccg cttgcgacac tgcgcccctg gtcagtccca gcgacgttgc gaacgtcgcc 34620 tgtggcttcc catcgactaa gacgccccgc gctatctcga tggtctgctg ccccacttcc 34680 agcccctgga tcgcctcctg gaactggctt tcggtaagcc gtttcttcat ggataacacc 34740 cataatttgc tccgcgcctt ggttgaacat agcggtgaca gccgccagca catgagagaa 34800 gtttagctaa acatttctcg cacgtcaaca cctttagccg ctaaaactcg tccttggcgt 34860 aacaaaacaa aagcccggaa accgggcttt cgtctcttgc cgcttatggc tctgcacccg 34920 gctccatcac caacaggtcg cgcacgcgct tcactcggtt gcggatcgac actgccagcc 34980 caacaaagcc ggttgccgcc gccgccagga tcgcgccgat gatgccggcc acaccggcca 35040 tcgcccacca ggtcgccgcc ttccggttcc attcctgctg gtactgcttc gcaatgctgg 35100 acctcggctc accataggct gaccgctcga tggcgtatgc cgcttctccc cttggcgtaa 35160 aacccagcgc cgcaggcggc attgccatgc tgcccgccgc tttcccgacc acgacgcgcg 35220 caccaggctt gcggtccaga ccttcggcca cggcgagctg cgcaaggaca taatcagccg 35280 ccgacttggc tccacgcgcc tcgatcagct cttgcactcg cgcgaaatcc ttggcctcca 35340 cggccgccat gaatcgcgca cgcggcgaag gctccgcagg gccggcgtcg tgatcgccgc 35400 cgagaatgcc cttcaccaag ttcgacgaca cgaaaatcat gctgacggct atcaccatca 35460 tgcagacgga tcgcacgaac ccgctgaatt gaacacgagc acggcacccg cgaccactat 35520 gccaagaatg cccaaggtaa aaattgccgg ccccgccatg aagtccgtga atgccccgac 35580 ggccgaagtg aagggcaggc cgccacccag gccgccgccc tcactgcccg gcacctggtc 35640 gctgaatgtc gatgccagca cctgcggcac gtcaatgctt ccgggcgtcg cgctcgggct 35700 gatcgcccat cccgttactg ccccgatccc ggcaatggca aggactgcca gcgctgccat 35760 ttttggggtg aggccgttcg cggccgaggg gcgcagcccc tggggggatg ggaggcccgc 35820 gttagcgggc cgggagggtt cgagaagggg gggcaccccc cttcggcgtg cgcggtcacg 35880 cgcacagggc gcagccctgg ttaaaaacaa ggtttataaa tattggttta aaagcaggtt 35940 aaaagacagg ttagcggtgg ccgaaaaacg ggcggaaacc cttgcaaatg ctggattttc 36000 tgcctgtgga cagcccctca aatgtcaata ggtgcgcccc tcatctgtca gcactctgcc 36060 cctcaagtgt caaggatcgc gcccctcatc tgtcagtagt cgcgcccctc aagtgtcaat 36120 accgcagggc acttatcccc aggcttgtcc acatcatctg tgggaaactc gcgtaaaatc 36180 aggcgttttc gccgatttgc gaggctggcc agctccacgt cgccggccga aatcgagcct 36240 gcccctcatc tgtcaacgcc gcgccgggtg agtcggcccc tcaagtgtca acgtccgccc 36300 ctcatctgtc agtgagggcc aagttttccg cgaggtatcc acaacgccgg cggccgcggt 36360 gtctcgcaca cggcttcgac ggcgtttctg gcgcgtttgc agggccatag acggccgcca 36420 gcccagcggc gagggcaacc agcccggtga gcgtcggaaa ggcgctggaa gccccgtagc 36480 gacgcggaga ggggcgagac aagccaaggg cgcaggctcg atgcgcagca cgacatagcc 36540 ggttctcgca aggacgagaa tttccctgcg gtgcccctca agtgtcaatg aaagtttcca 36600 acgcgagcca ttcgcgagag ccttgagtcc acgctagatg agagctttgt tgtaggtgga 36660 ccagttggtg attttgaact tttgctttgc cacggaacgg tctgcgttgt cgggaagatg 36720 cgtgatctga tccttcaact cagcaaaagt tcgatttatt caacaaagcc acgttgtgtc 36780 tcaaaatctc tgatgttaca ttgcacaaga taaaaatata tcatcatgaa caataaaact 36840 gtctgcttac ataaacagta atacaagggg tgttatgagc catattcaac gggaaacgtc 36900 ttgctcgac 36909 <210> SEQ ID NO 8 <211> LENGTH: 13019 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: PHP23235 construct <400> SEQUENCE: 8 gttacccgga ccgaagctta gcccgggcat gcctgcagtg cagcgtgacc cggtcgtgcc 60 cctctctaga gataatgagc attgcatgtc taagttataa aaaattacca catatttttt 120 ttgtcacact tgtttgaagt gcagtttatc tatctttata catatattta aactttactc 180 tacgaataat ataatctata gtactacaat aatatcagtg ttttagagaa tcatataaat 240 gaacagttag acatggtcta aaggacaatt gagtattttg acaacaggac tctacagttt 300 tatcttttta gtgtgcatgt gttctccttt ttttttgcaa atagcttcac ctatataata 360 cttcatccat tttattagta catccattta gggtttaggg ttaatggttt ttatagacta 420 atttttttag tacatctatt ttattctatt ttagcctcta aattaagaaa actaaaactc 480 tattttagtt tttttattta ataatttaga tataaaatag aataaaataa agtgactaaa 540 aattaaacaa atacccttta agaaattaaa aaaactaagg aaacattttt cttgtttcga 600 gtagataatg ccagcctgtt aaacgccgtc gacgagtcta acggacacca accagcgaac 660 cagcagcgtc gcgtcgggcc aagcgaagca gacggcacgg catctctgtc gctgcctctg 720 gacccctctc gagagttccg ctccaccgtt ggacttgctc cgctgtcggc atccagaaat 780 tgcgtggcgg agcggcagac gtgagccggc acggcaggcg gcctcctcct cctctcacgg 840 cacggcagct acgggggatt cctttcccac cgctccttcg ctttcccttc ctcgcccgcc 900 gtaataaata gacaccccct ccacaccctc tttccccaac ctcgtgttgt tcggagcgca 960 cacacacaca accagatctc ccccaaatcc acccgtcggc acctccgctt caaggtacgc 1020 cgctcgtcct cccccccccc ccctctctac cttctctaga tcggcgttcc ggtccatggt 1080 tagggcccgg tagttctact tctgttcatg tttgtgttag atccgtgttt gtgttagatc 1140 cgtgctgcta gcgttcgtac acggatgcga cctgtacgtc agacacgttc tgattgctaa 1200 cttgccagtg tttctctttg gggaatcctg ggatggctct agccgttccg cagacgggat 1260 cgatttcatg attttttttg tttcgttgca tagggtttgg tttgcccttt tcctttattt 1320 caatatatgc cgtgcacttg tttgtcgggt catcttttca tgcttttttt tgtcttggtt 1380 gtgatgatgt ggtctggttg ggcggtcgtt ctagatcgga gtagaattct gtttcaaact 1440 acctggtgga tttattaatt ttggatctgt atgtgtgtgc catacatatt catagttacg 1500 aattgaagat gatggatgga aatatcgatc taggataggt atacatgttg atgcgggttt 1560 tactgatgca tatacagaga tgctttttgt tcgcttggtt gtgatgatgt ggtgtggttg 1620 ggcggtcgtt cattcgttct agatcggagt agaatactgt ttcaaactac ctggtgtatt 1680 tattaatttt ggaactgtat gtgtgtgtca tacatcttca tagttacgag tttaagatgg 1740 atggaaatat cgatctagga taggtataca tgttgatgtg ggttttactg atgcatatac 1800 atgatggcat atgcagcatc tattcatatg ctctaacctt gagtacctat ctattataat 1860 aaacaagtat gttttataat tattttgatc ttgatatact tggatgatgg catatgcagc 1920 agctatatgt ggattttttt agccctgcct tcatacgcta tttatttgct tggtactgtt 1980 tcttttgtcg atgctcaccc tgttgtttgg tgttacttct gcaggtcgac tctagaggat 2040 ccacaagttt gtacaaaaaa gctgaacgag aaacgtaaaa tgatataaat atcaatatat 2100 taaattagat tttgcataaa aaacagacta cataatactg taaaacacaa catatccagt 2160 cactatggcg gccgcattag gcaccccagg ctttacactt tatgcttccg gctcgtataa 2220 tgtgtggatt ttgagttagg atttaaatac gcgttgatcc ggcttactaa aagccagata 2280 acagtatgcg tatttgcgcg ctgatttttg cggtataaga atatatactg atatgtatac 2340 ccgaagtatg tcaaaaagag gtatgctatg aagcagcgta ttacagtgac agttgacagc 2400 gacagctatc agttgctcaa ggcatatatg atgtcaatat ctccggtctg gtaagcacaa 2460 ccatgcagaa tgaagcccgt cgtctgcgtg ccgaacgctg gaaagcggaa aatcaggaag 2520 ggatggctga ggtcgcccgg tttattgaaa tgaacggctc ttttgctgac gagaacaggg 2580 gctggtgaaa tgcagtttaa ggtttacacc tataaaagag agagccgtta tcgtctgttt 2640 gtggatgtac agagtgatat cattgacacg cccggtcgac ggatggtgat ccccctggcc 2700 agtgcacgtc tgctgtcaga taaagtctcc cgtgaacttt acccggtggt gcatatcggg 2760 gatgaaagct ggcgcatgat gaccaccgat atggccagtg tgccggtctc cgttatcggg 2820 gaagaagtgg ctgatctcag ccaccgcgaa aatgacatca aaaacgccat taacctgatg 2880 ttctggggaa tataaatgtc aggctccctt atacacagcc agtctgcagg tcgaccatag 2940 tgactggata tgttgtgttt tacagtatta tgtagtctgt tttttatgca aaatctaatt 3000 taatatattg atatttatat cattttacgt ttctcgttca gctttcttgt acaaagtggt 3060 gttaacctag acttgtccat cttctggatt ggccaactta attaatgtat gaaataaaag 3120 gatgcacaca tagtgacatg ctaatcacta taatgtgggc atcaaagttg tgtgttatgt 3180 gtaattacta gttatctgaa taaaagagaa agagatcatc catatttctt atcctaaatg 3240 aatgtcacgt gtctttataa ttctttgatg aaccagatgc atttcattaa ccaaatccat 3300 atacatataa atattaatca tatataatta atatcaattg ggttagcaaa acaaatctag 3360 tctaggtgtg ttttgcgaat tgcggccgcc accgcggtgg agctcgaatt ccggtccggg 3420 tcacctttgt ccaccaagat ggaactgcgg ccgctcatta attaagtcag gcgcgcctct 3480 agttgaagac acgttcatgt cttcatcgta agaagacact cagtagtctt cggccagaat 3540 ggccatctgg attcagcagg cctagaaggc catttaaatc ctgaggatct ggtcttccta 3600 aggacccggg atatcggacc gattaaactt taattcggtc cgaagcttgc atgcctgcag 3660 tgcagcgtga cccggtcgtg cccctctcta gagataatga gcattgcatg tctaagttat 3720 aaaaaattac cacatatttt ttttgtcaca cttgtttgaa gtgcagttta tctatcttta 3780 tacatatatt taaactttac tctacgaata atataatcta tagtactaca ataatatcag 3840 tgttttagag aatcatataa atgaacagtt agacatggtc taaaggacaa ttgagtattt 3900 tgacaacagg actctacagt tttatctttt tagtgtgcat gtgttctcct ttttttttgc 3960 aaatagcttc acctatataa tacttcatcc attttattag tacatccatt tagggtttag 4020 ggttaatggt ttttatagac taattttttt agtacatcta ttttattcta ttttagcctc 4080 taaattaaga aaactaaaac tctattttag tttttttatt taataattta gatataaaat 4140 agaataaaat aaagtgacta aaaattaaac aaataccctt taagaaatta aaaaaactaa 4200 ggaaacattt ttcttgtttc gagtagataa tgccagcctg ttaaacgccg tcgacgagtc 4260 taacggacac caaccagcga accagcagcg tcgcgtcggg ccaagcgaag cagacggcac 4320 ggcatctctg tcgctgcctc tggacccctc tcgagagttc cgctccaccg ttggacttgc 4380 tccgctgtcg gcatccagaa attgcgtggc ggagcggcag acgtgagccg gcacggcagg 4440 cggcctcctc ctcctctcac ggcaccggca gctacggggg attcctttcc caccgctcct 4500 tcgctttccc ttcctcgccc gccgtaataa atagacaccc cctccacacc ctctttcccc 4560 aacctcgtgt tgttcggagc gcacacacac acaaccagat ctcccccaaa tccacccgtc 4620 ggcacctccg cttcaaggta cgccgctcgt cctccccccc ccccctctct accttctcta 4680 gatcggcgtt ccggtccatg catggttagg gcccggtagt tctacttctg ttcatgtttg 4740 tgttagatcc gtgtttgtgt tagatccgtg ctgctagcgt tcgtacacgg atgcgacctg 4800 tacgtcagac acgttctgat tgctaacttg ccagtgtttc tctttgggga atcctgggat 4860 ggctctagcc gttccgcaga cgggatcgat ttcatgattt tttttgtttc gttgcatagg 4920 gtttggtttg cccttttcct ttatttcaat atatgccgtg cacttgtttg tcgggtcatc 4980 ttttcatgct tttttttgtc ttggttgtga tgatgtggtc tggttgggcg gtcgttctag 5040 atcggagtag aattctgttt caaactacct ggtggattta ttaattttgg atctgtatgt 5100 gtgtgccata catattcata gttacgaatt gaagatgatg gatggaaata tcgatctagg 5160 ataggtatac atgttgatgc gggttttact gatgcatata cagagatgct ttttgttcgc 5220 ttggttgtga tgatgtggtg tggttgggcg gtcgttcatt cgttctagat cggagtagaa 5280 tactgtttca aactacctgg tgtatttatt aattttggaa ctgtatgtgt gtgtcataca 5340 tcttcatagt tacgagttta agatggatgg aaatatcgat ctaggatagg tatacatgtt 5400 gatgtgggtt ttactgatgc atatacatga tggcatatgc agcatctatt catatgctct 5460 aaccttgagt acctatctat tataataaac aagtatgttt tataattatt ttgatcttga 5520 tatacttgga tgatggcata tgcagcagct atatgtggat ttttttagcc ctgccttcat 5580 acgctattta tttgcttggt actgtttctt ttgtcgatgc tcaccctgtt gtttggtgtt 5640 acttctgcag gtcgacttta acttagccta ggatccacac gacaccatgt cccccgagcg 5700 ccgccccgtc gagatccgcc cggccaccgc cgccgacatg gccgccgtgt gcgacatcgt 5760 gaaccactac atcgagacct ccaccgtgaa cttccgcacc gagccgcaga ccccgcagga 5820 gtggatcgac gacctggagc gcctccagga ccgctacccg tggctcgtgg ccgaggtgga 5880 gggcgtggtg gccggcatcg cctacgccgg cccgtggaag gcccgcaacg cctacgactg 5940 gaccgtggag tccaccgtgt acgtgtccca ccgccaccag cgcctcggcc tcggctccac 6000 cctctacacc cacctcctca agagcatgga ggcccagggc ttcaagtccg tggtggccgt 6060 gatcggcctc ccgaacgacc cgtccgtgcg cctccacgag gccctcggct acaccgcccg 6120 cggcaccctc cgcgccgccg gctacaagca cggcggctgg cacgacgtcg gcttctggca 6180 gcgcgacttc gagctgccgg ccccgccgcg cccggtgcgc ccggtgacgc agatctgagt 6240 cgaaacctag acttgtccat cttctggatt ggccaactta attaatgtat gaaataaaag 6300 gatgcacaca tagtgacatg ctaatcacta taatgtgggc atcaaagttg tgtgttatgt 6360 gtaattacta gttatctgaa taaaagagaa agagatcatc catatttctt atcctaaatg 6420 aatgtcacgt gtctttataa ttctttgatg aaccagatgc atttcattaa ccaaatccat 6480 atacatataa atattaatca tatataatta atatcaattg ggttagcaaa acaaatctag 6540 tctaggtgtg ttttgcgaat tgcggccgcc accgcggtgg agctcgaatt cattccgatt 6600 aatcgtggcc tcttgctctt caggatgaag agctatgttt aaacgtgcaa gcgctactag 6660 acaattcagt acattaaaaa cgtccgcaat gtgttattaa gttgtctaag cgtcaatttg 6720 tttacaccac aatatatcct gccaccagcc agccaacagc tccccgaccg gcagctcggc 6780 acaaaatcac cactcgatac aggcagccca tcagtccggg acggcgtcag cgggagagcc 6840 gttgtaaggc ggcagacttt gctcatgtta ccgatgctat tcggaagaac ggcaactaag 6900 ctgccgggtt tgaaacacgg atgatctcgc ggagggtagc atgttgattg taacgatgac 6960 agagcgttgc tgcctgtgat caaatatcat ctccctcgca gagatccgaa ttatcagcct 7020 tcttattcat ttctcgctta accgtgacag gctgtcgatc ttgagaacta tgccgacata 7080 ataggaaatc gctggataaa gccgctgagg aagctgagtg gcgctatttc tttagaagtg 7140 aacgttgacg atcgtcgacc gtaccccgat gaattaattc ggacgtacgt tctgaacaca 7200 gctggatact tacttgggcg attgtcatac atgacatcaa caatgtaccc gtttgtgtaa 7260 ccgtctcttg gaggttcgta tgacactagt ggttcccctc agcttgcgac tagatgttga 7320 ggcctaacat tttattagag agcaggctag ttgcttagat acatgatctt caggccgtta 7380 tctgtcaggg caagcgaaaa ttggccattt atgacgacca atgccccgca gaagctccca 7440 tctttgccgc catagacgcc gcgcccccct tttggggtgt agaacatcct tttgccagat 7500 gtggaaaaga agttcgttgt cccattgttg gcaatgacgt agtagccggc gaaagtgcga 7560 gacccatttg cgctatatat aagcctacga tttccgttgc gactattgtc gtaattggat 7620 gaactattat cgtagttgct ctcagagttg tcgtaatttg atggactatt gtcgtaattg 7680 cttatggagt tgtcgtagtt gcttggagaa atgtcgtagt tggatgggga gtagtcatag 7740 ggaagacgag cttcatccac taaaacaatt ggcaggtcag caagtgcctg ccccgatgcc 7800 atcgcaagta cgaggcttag aaccaccttc aacagatcgc gcatagtctt ccccagctct 7860 ctaacgcttg agttaagccg cgccgcgaag cggcgtcggc ttgaacgaat tgttagacat 7920 tatttgccga ctaccttggt gatctcgcct ttcacgtagt gaacaaattc ttccaactga 7980 tctgcgcgcg aggccaagcg atcttcttgt ccaagataag cctgcctagc ttcaagtatg 8040 acgggctgat actgggccgg caggcgctcc attgcccagt cggcagcgac atccttcggc 8100 gcgattttgc cggttactgc gctgtaccaa atgcgggaca acgtaagcac tacatttcgc 8160 tcatcgccag cccagtcggg cggcgagttc catagcgtta aggtttcatt tagcgcctca 8220 aatagatcct gttcaggaac cggatcaaag agttcctccg ccgctggacc taccaaggca 8280 acgctatgtt ctcttgcttt tgtcagcaag atagccagat caatgtcgat cgtggctggc 8340 tcgaagatac ctgcaagaat gtcattgcgc tgccattctc caaattgcag ttcgcgctta 8400 gctggataac gccacggaat gatgtcgtcg tgcacaacaa tggtgacttc tacagcgcgg 8460 agaatctcgc tctctccagg ggaagccgaa gtttccaaaa ggtcgttgat caaagctcgc 8520 cgcgttgttt catcaagcct tacagtcacc gtaaccagca aatcaatatc actgtgtggc 8580 ttcaggccgc catccactgc ggagccgtac aaatgtacgg ccagcaacgt cggttcgaga 8640 tggcgctcga tgacgccaac tacctctgat agttgagtcg atacttcggc gatcaccgct 8700 tccctcatga tgtttaactc ctgaattaag ccgcgccgcg aagcggtgtc ggcttgaatg 8760 aattgttagg cgtcatcctg tgctcccgag aaccagtacc agtacatcgc tgtttcgttc 8820 gagacttgag gtctagtttt atacgtgaac aggtcaatgc cgccgagagt aaagccacat 8880 tttgcgtaca aattgcaggc aggtacattg ttcgtttgtg tctctaatcg tatgccaagg 8940 agctgtctgc ttagtgccca ctttttcgca aattcgatga gactgtgcgc gactcctttg 9000 cctcggtgcg tgtgcgacac aacaatgtgt tcgatagagg ctagatcgtt ccatgttgag 9060 ttgagttcaa tcttcccgac aagctcttgg tcgatgaatg cgccatagca agcagagtct 9120 tcatcagagt catcatccga gatgtaatcc ttccggtagg ggctcacact tctggtagat 9180 agttcaaagc cttggtcgga taggtgcaca tcgaacactt cacgaacaat gaaatggttc 9240 tcagcatcca atgtttccgc cacctgctca gggatcaccg aaatcttcat atgacgccta 9300 acgcctggca cagcggatcg caaacctggc gcggcttttg gcacaaaagg cgtgacaggt 9360 ttgcgaatcc gttgctgcca cttgttaacc cttttgccag atttggtaac tataatttat 9420 gttagaggcg aagtcttggg taaaaactgg cctaaaattg ctggggattt caggaaagta 9480 aacatcacct tccggctcga tgtctattgt agatatatgt agtgtatcta cttgatcggg 9540 ggatctgctg cctcgcgcgt ttcggtgatg acggtgaaaa cctctgacac atgcagctcc 9600 cggagacggt cacagcttgt ctgtaagcgg atgccgggag cagacaagcc cgtcagggcg 9660 cgtcagcggg tgttggcggg tgtcggggcg cagccatgac ccagtcacgt agcgatagcg 9720 gagtgtatac tggcttaact atgcggcatc agagcagatt gtactgagag tgcaccatat 9780 gcggtgtgaa ataccgcaca gatgcgtaag gagaaaatac cgcatcaggc gctcttccgc 9840 ttcctcgctc actgactcgc tgcgctcggt cgttcggctg cggcgagcgg tatcagctca 9900 ctcaaaggcg gtaatacggt tatccacaga atcaggggat aacgcaggaa agaacatgtg 9960 agcaaaaggc cagcaaaagg ccaggaaccg taaaaaggcc gcgttgctgg cgtttttcca 10020 taggctccgc ccccctgacg agcatcacaa aaatcgacgc tcaagtcaga ggtggcgaaa 10080 cccgacagga ctataaagat accaggcgtt tccccctgga agctccctcg tgcgctctcc 10140 tgttccgacc ctgccgctta ccggatacct gtccgccttt ctcccttcgg gaagcgtggc 10200 gctttctcat agctcacgct gtaggtatct cagttcggtg taggtcgttc gctccaagct 10260 gggctgtgtg cacgaacccc ccgttcagcc cgaccgctgc gccttatccg gtaactatcg 10320 tcttgagtcc aacccggtaa gacacgactt atcgccactg gcagcagcca ctggtaacag 10380 gattagcaga gcgaggtatg taggcggtgc tacagagttc ttgaagtggt ggcctaacta 10440 cggctacact agaaggacag tatttggtat ctgcgctctg ctgaagccag ttaccttcgg 10500 aaaaagagtt ggtagctctt gatccggcaa acaaaccacc gctggtagcg gtggtttttt 10560 tgtttgcaag cagcagatta cgcgcagaaa aaaaggatct caagaagatc ctttgatctt 10620 ttctacgggg tctgacgctc agtggaacga aaactcacgt taagggattt tggtcatgag 10680 attatcaaaa aggatcttca cctagatcct tttaaattaa aaatgaagtt ttaaatcaat 10740 ctaaagtata tatgagtaaa cttggtctga cagttaccaa tgcttaatca gtgaggcacc 10800 tatctcagcg atctgtctat ttcgttcatc catagttgcc tgactccccg tcgtgtagat 10860 aactacgata cgggagggct taccatctgg ccccagtgct gcaatgatac cgcgagaccc 10920 acgctcaccg gctccagatt tatcagcaat aaaccagcca gccggaaggg ccgagcgcag 10980 aagtggtcct gcaactttat ccgcctccat ccagtctatt aattgttgcc gggaagctag 11040 agtaagtagt tcgccagtta atagtttgcg caacgttgtt gccattgctg cagggggggg 11100 gggggggggg gacttccatt gttcattcca cggacaaaaa cagagaaagg aaacgacaga 11160 ggccaaaaag cctcgctttc agcacctgtc gtttcctttc ttttcagagg gtattttaaa 11220 taaaaacatt aagttatgac gaagaagaac ggaaacgcct taaaccggaa aattttcata 11280 aatagcgaaa acccgcgagg tcgccgcccc gtaacctgtc ggatcaccgg aaaggacccg 11340 taaagtgata atgattatca tctacatatc acaacgtgcg tggaggccat caaaccacgt 11400 caaataatca attatgacgc aggtatcgta ttaattgatc tgcatcaact taacgtaaaa 11460 acaacttcag acaatacaaa tcagcgacac tgaatacggg gcaacctcat gtcccccccc 11520 cccccccccc tgcaggcatc gtggtgtcac gctcgtcgtt tggtatggct tcattcagct 11580 ccggttccca acgatcaagg cgagttacat gatcccccat gttgtgcaaa aaagcggtta 11640 gctccttcgg tcctccgatc gttgtcagaa gtaagttggc cgcagtgtta tcactcatgg 11700 ttatggcagc actgcataat tctcttactg tcatgccatc cgtaagatgc ttttctgtga 11760 ctggtgagta ctcaaccaag tcattctgag aatagtgtat gcggcgaccg agttgctctt 11820 gcccggcgtc aacacgggat aataccgcgc cacatagcag aactttaaaa gtgctcatca 11880 ttggaaaacg ttcttcgggg cgaaaactct caaggatctt accgctgttg agatccagtt 11940 cgatgtaacc cactcgtgca cccaactgat cttcagcatc ttttactttc accagcgttt 12000 ctgggtgagc aaaaacagga aggcaaaatg ccgcaaaaaa gggaataagg gcgacacgga 12060 aatgttgaat actcatactc ttcctttttc aatattattg aagcatttat cagggttatt 12120 gtctcatgag cggatacata tttgaatgta tttagaaaaa taaacaaata ggggttccgc 12180 gcacatttcc ccgaaaagtg ccacctgacg tctaagaaac cattattatc atgacattaa 12240 cctataaaaa taggcgtatc acgaggccct ttcgtcttca agaattggtc gacgatcttg 12300 ctgcgttcgg atattttcgt ggagttcccg ccacagaccc ggattgaagg cgagatccag 12360 caactcgcgc cagatcatcc tgtgacggaa ctttggcgcg tgatgactgg ccaggacgtc 12420 ggccgaaaga gcgacaagca gatcacgctt ttcgacagcg tcggatttgc gatcgaggat 12480 ttttcggcgc tgcgctacgt ccgcgaccgc gttgagggat caagccacag cagcccactc 12540 gaccttctag ccgacccaga cgagccaagg gatctttttg gaatgctgct ccgtcgtcag 12600 gctttccgac gtttgggtgg ttgaacagaa gtcattatcg tacggaatgc caagcactcc 12660 cgaggggaac cctgtggttg gcatgcacat acaaatggac gaacggataa accttttcac 12720 gcccttttaa atatccgtta ttctaataaa cgctcttttc tcttaggttt acccgccaat 12780 atatcctgtc aaacactgat agtttaaact gaaggcggga aacgacaatc tgatcatgag 12840 cggagaatta agggagtcac gttatgaccc ccgccgatga cgcgggacaa gccgttttac 12900 gtttggaact gacagaaccg caacgttgaa ggagccactc agcaagctgg tacgattgta 12960 atacgactca ctatagggcg aattgagcgc tgtttaaacg ctcttcaact ggaagagcg 13019 <210> SEQ ID NO 9 <211> LENGTH: 2991 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: PHP20234 construct <400> SEQUENCE: 9 ctttcctgcg ttatcccctg attctgtgga taaccgtatt accgcctttg agtgagctga 60 taccgctcgc cgcagccgaa cgaccgagcg cagcgagtca gtgagcgagg aagcggaaga 120 gcgcccaata cgcaaaccgc ctctccccgc gcgttggccg attcattaat gcagctggca 180 cgacaggttt cccgactgga aagcgggcag tgagcgcaac gcaattaata cgcgtaccgc 240 tagccaggaa gagtttgtag aaacgcaaaa aggccatccg tcaggatggc cttctgctta 300 gtttgatgcc tggcagttta tggcgggcgt cctgcccgcc accctccggg ccgttgcttc 360 acaacgttca aatccgctcc cggcggattt gtcctactca ggagagcgtt caccgacaaa 420 caacagataa aacgaaaggc ccagtcttcc gactgagcct ttcgttttat ttgatgcctg 480 gcagttccct actctcgcgt taacgctagc atggatgttt tcccagtcac gacgttgtaa 540 aacgacggcc agtcttaagc tcgggccctg cagctctaga gctcgaattc tacaggtcac 600 taataccatc taagtagttg gttcatagtg actgcatatg ttgtgtttta cagtattatg 660 tagtctgttt tttatgcaaa atctaattta atatattgat atttatatca ttttacgttt 720 ctcgttcaac tttcttgtac aaagtggccg ttaacggatc cagacttgtc catcttctgg 780 attggccaac ttaattaatg tatgaaataa aaggatgcac acatagtgac atgctaatca 840 ctataatgtg ggcatcaaag ttgtgtgtta tgtgtaatta ctagttatct gaataaaaga 900 gaaagagatc atccatattt cttatcctaa atgaatgtca cgtgtcttta taattctttg 960 atgaaccaga tgcatttcat taaccaaatc catatacata taaatattaa tcatatataa 1020 ttaatatcaa ttgggttagc aaaacaaatc tagtctaggt gtgttttgcg aattgcggca 1080 agcttgcggc cgccccgggc aactttatta tacaaagttg gcattataaa aaagcattgc 1140 ttatcaattt gttgcaacga acaggtcact atcagtcaaa ataaaatcat tatttggagc 1200 tccatggtag cgttaacgcg gccgcgatat cccctatagt gagtcgtatt acatggtcat 1260 agctgtttcc tggcagctct ggcccgtgtc tcaaaatctc tgatgttaca ttgcacaaga 1320 taaaaatata tcatcatgaa caataaaact gtctgcttac ataaacagta atacaagggg 1380 tgttatgagc catattcaac gggaaacgtc gaggccgcga ttaaattcca acatggatgc 1440 tgatttatat gggtataaat gggctcgcga taatgtcggg caatcaggtg cgacaatcta 1500 tcgcttgtat gggaagcccg atgcgccaga gttgtttctg aaacatggca aaggtagcgt 1560 tgccaatgat gttacagatg agatggtcag actaaactgg ctgacggaat ttatgcctct 1620 tccgaccatc aagcatttta tccgtactcc tgatgatgca tggttactca ccactgcgat 1680 ccccggaaaa acagcattcc aggtattaga agaatatcct gattcaggtg aaaatattgt 1740 tgatgcgctg gcagtgttcc tgcgccggtt gcattcgatt cctgtttgta attgtccttt 1800 taacagcgat cgcgtatttc gtctcgctca ggcgcaatca cgaatgaata acggtttggt 1860 tgatgcgagt gattttgatg acgagcgtaa tggctggcct gttgaacaag tctggaaaga 1920 aatgcataaa cttttgccat tctcaccgga ttcagtcgtc actcatggtg atttctcact 1980 tgataacctt atttttgacg aggggaaatt aataggttgt attgatgttg gacgagtcgg 2040 aatcgcagac cgataccagg atcttgccat cctatggaac tgcctcggtg agttttctcc 2100 ttcattacag aaacggcttt ttcaaaaata tggtattgat aatcctgata tgaataaatt 2160 gcagtttcat ttgatgctcg atgagttttt ctaatcagaa ttggttaatt ggttgtaaca 2220 ctggcagagc attacgctga cttgacggga cggcgcaagc tcatgaccaa aatcccttaa 2280 cgtgagttac gcgtcgttcc actgagcgtc agaccccgta gaaaagatca aaggatcttc 2340 ttgagatcct ttttttctgc gcgtaatctg ctgcttgcaa acaaaaaaac caccgctacc 2400 agcggtggtt tgtttgccgg atcaagagct accaactctt tttccgaagg taactggctt 2460 cagcagagcg cagataccaa atactgtcct tctagtgtag ccgtagttag gccaccactt 2520 caagaactct gtagcaccgc ctacatacct cgctctgcta atcctgttac cagtggctgc 2580 tgccagtggc gataagtcgt gtcttaccgg gttggactca agacgatagt taccggataa 2640 ggcgcagcgg tcgggctgaa cggggggttc gtgcacacag cccagcttgg agcgaacgac 2700 ctacaccgaa ctgagatacc tacagcgtga gcattgagaa agcgccacgc ttcccgaagg 2760 gagaaaggcg gacaggtatc cggtaagcgg cagggtcgga acaggagagc gcacgaggga 2820 gcttccaggg ggaaacgcct ggtatcttta tagtcctgtc gggtttcgcc acctctgact 2880 tgagcgtcga tttttgtgat gctcgtcagg ggggcggagc ctatggaaaa acgccagcaa 2940 cgcggccttt ttacggttcc tggccttttg ctggcctttt gctcacatgt t 2991 <210> SEQ ID NO 10 <211> LENGTH: 13278 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: PHP22655 construct (destination vector) <400> SEQUENCE: 10 aagctggtac gattgtaata cgactcacta tagggcgaat tgagcgctgt ttaaacgctc 60 ttcaactgga agagcggtta ccagagctgg tcacctttgt ccaccaagat ggaactgcgg 120 ccgctcatta attaagtcag gcgcgcctct agttgaagac acgttcatgt cttcatcgta 180 agaagacact cagtagtctt cggccagaat ggcccggacc gaagctggcc gctctagaac 240 tagtggatct cgatgtgtag tctacgagaa gggttaaccg tctcttcgtg agaataaccg 300 tggcctaaaa ataagccgat gaggataaat aaaatgtggt ggtacagtac ttcaagaggt 360 ttactcatca agaggatgct tttccgatga gctctagtag tacatcggac ctcacatacc 420 tccattgtgg tgaaatattt tgtgctcatt tagtgatggg taaattttgt ttatgtcact 480 ctaggttttg acatttcagt tttgccactc ttaggttttg acaaataatt tccattccgc 540 ggcaaaagca aaacaatttt attttacttt taccactctt agctttcaca atgtatcaca 600 aatgccactc tagaaattct gtttatgcca cagaatgtga aaaaaaacac tcacttattt 660 gaagccaagg tgttcatggc atggaaatgt gacataaagt aacgttcgtg tataagaaaa 720 aattgtactc ctcgtaacaa gagacggaaa catcatgaga caatcgcgtt tggaaggctt 780 tgcatcacct ttggatgatg cgcatgaatg gagtcgtctg cttgctagcc ttcgcctacc 840 gcccactgag tccgggcggc aactaccatc ggcgaacgac ccagctgacc tctaccgacc 900 ggacttgaat gcgctacctt cgtcagcgac gatggccgcg tacgctggcg acgtgccccc 960 gcatgcatgg cggcacatgg cgagctcaga ccgtgcgtgg ctggctacaa atacgtaccc 1020 cgtgagtgcc ctagctagaa acttacacct gcaactgcga gagcgagcgt gtgagtgtag 1080 ccgagtagat cccccggtcg ccaccatggc ctcctccgag aacgtcatca ccgagttcat 1140 gcgcttcaag gtgcgcatgg agggcaccgt gaacggccac gagttcgaga tcgagggcga 1200 gggcgagggc cgcccctacg agggccacaa caccgtgaag ctgaaggtga ccaagggcgg 1260 ccccctgccc ttcgcctggg acatcctgtc cccccagttc cagtacggct ccaaggtgta 1320 cgtgaagcac cccgccgaca tccccgacta caagaagctg tccttccccg agggcttcaa 1380 gtgggagcgc gtgatgaact tcgaggacgg cggcgtggcg accgtgaccc aggactcctc 1440 cctgcaggac ggctgcttca tctacaaggt gaagttcatc ggcgtgaact tcccctccga 1500 cggccccgtg atgcagaaga agaccatggg ctgggaggcc tccaccgagc gcctgtaccc 1560 ccgcgacggc gtgctgaagg gcgagaccca caaggccctg aagctgaagg acggcggcca 1620 ctacctggtg gagttcaagt ccatctacat ggccaagaag cccgtgcagc tgcccggcta 1680 ctactacgtg gacgccaagc tggacatcac ctcccacaac gaggactaca ccatcgtgga 1740 gcagtacgag cgcaccgagg gccgccacca cctgttcctg tagcggccca tggatattcg 1800 aacgcgtagg taccacatgg ttaacctaga cttgtccatc ttctggattg gccaacttaa 1860 ttaatgtatg aaataaaagg atgcacacat agtgacatgc taatcactat aatgtgggca 1920 tcaaagttgt gtgttatgtg taattactag ttatctgaat aaaagagaaa gagatcatcc 1980 atatttctta tcctaaatga atgtcacgtg tctttataat tctttgatga accagatgca 2040 tttcattaac caaatccata tacatataaa tattaatcat atataattaa tatcaattgg 2100 gttagcaaaa caaatctagt ctaggtgtgt tttgcgaatg cggccgccac cgcggtggag 2160 ctcgaattcc ggtccgggcc tagaaggcca tttaaatcct gaggatctgg tcttcctaag 2220 gacccgggat atcgctatca actttgtata gaaaagttga acgagaaacg taaaatgata 2280 taaatatcaa tatattaaat tagattttgc ataaaaaaca gactacataa tactgtaaaa 2340 cacaacatat ccagtcacta tggtcgacct gcagactggc tgtgtataag ggagcctgac 2400 atttatattc cccagaacat caggttaatg gcgtttttga tgtcattttc gcggtggctg 2460 agatcagcca cttcttcccc gataacggag accggcacac tggccatatc ggtggtcatc 2520 atgcgccagc tttcatcccc gatatgcacc accgggtaaa gttcacgggg gactttatct 2580 gacagcagac gtgcactggc cagggggatc accatccgtc gcccgggcgt gtcaataata 2640 tcactctgta catccacaaa cagacgataa cggctctctc ttttataggt gtaaacctta 2700 aactgcattt caccagcccc tgttctcgtc ggcaaaagag ccgttcattt caataaaccg 2760 ggcgacctca gccatccctt cctgattttc cgctttccag cgttcggcac gcagacgacg 2820 ggcttcattc tgcatggttg tgcttaccga accggagata ttgacatcat atatgccttg 2880 agcaactgat agctgtcgct gtcaactgtc actgtaatac gctgcttcat agcatacctc 2940 tttttgacat acttcgggta tacatatcag tatatattct tataccgcaa aaatcagcgc 3000 gcaaatacgc atactgttat ctggctttta gtaagccgga tcctctagat tacgccccgc 3060 ctgccactca tcgcagtact gttgtaattc attaagcatt ctgccgacat ggaagccatc 3120 acaaacggca tgatgaacct gaatcgccag cggcatcagc accttgtcgc cttgcgtata 3180 atatttgccc atggtgaaaa cgggggcgaa gaagttgtcc atattggcca cgtttaaatc 3240 aaaactggtg aaactcaccc agggattggc tgagacgaaa aacatattct caataaaccc 3300 tttagggaaa taggccaggt tttcaccgta acacgccaca tcttgcgaat atatgtgtag 3360 aaactgccgg aaatcgtcgt ggtattcact ccagagcgat gaaaacgttt cagtttgctc 3420 atggaaaacg gtgtaacaag ggtgaacact atcccatatc accagctcac cgtctttcat 3480 tgccatacgg aattccggat gagcattcat caggcgggca agaatgtgaa taaaggccgg 3540 ataaaacttg tgcttatttt tctttacggt ctttaaaaag gccgtaatat ccagctgaac 3600 ggtctggtta taggtacatt gagcaactga ctgaaatgcc tcaaaatgtt ctttacgatg 3660 ccattgggat atatcaacgg tggtatatcc agtgattttt ttctccattt tagcttcctt 3720 agctcctgaa aatctcgacg gatcctaact caaaatccac acattatacg agccggaagc 3780 ataaagtgta aagcctgggg tgccctaatg cggccgccat agtgactgga tatgttgtgt 3840 tttacagtat tatgtagtct gttttttatg caaaatctaa tttaatatat tgatatttat 3900 atcattttac gtttctcgtt caactttatt atacaaagtt gatagatatc ggaccgatta 3960 aactttaatt cggtccgaag cttgcatgcc tgcagtgcag cgtgacccgg tcgtgcccct 4020 ctctagagat aatgagcatt gcatgtctaa gttataaaaa attaccacat attttttttg 4080 tcacacttgt ttgaagtgca gtttatctat ctttatacat atatttaaac tttactctac 4140 gaataatata atctatagta ctacaataat atcagtgttt tagagaatca tataaatgaa 4200 cagttagaca tggtctaaag gacaattgag tattttgaca acaggactct acagttttat 4260 ctttttagtg tgcatgtgtt ctcctttttt tttgcaaata gcttcaccta tataatactt 4320 catccatttt attagtacat ccatttaggg tttagggtta atggttttta tagactaatt 4380 tttttagtac atctatttta ttctatttta gcctctaaat taagaaaact aaaactctat 4440 tttagttttt ttatttaata atttagatat aaaatagaat aaaataaagt gactaaaaat 4500 taaacaaata ccctttaaga aattaaaaaa actaaggaaa catttttctt gtttcgagta 4560 gataatgcca gcctgttaaa cgccgtcgac gagtctaacg gacaccaacc agcgaaccag 4620 cagcgtcgcg tcgggccaag cgaagcagac ggcacggcat ctctgtcgct gcctctggac 4680 ccctctcgag agttccgctc caccgttgga cttgctccgc tgtcggcatc cagaaattgc 4740 gtggcggagc ggcagacgtg agccggcacg gcaggcggcc tcctcctcct ctcacggcac 4800 cggcagctac gggggattcc tttcccaccg ctccttcgct ttcccttcct cgcccgccgt 4860 aataaataga caccccctcc acaccctctt tccccaacct cgtgttgttc ggagcgcaca 4920 cacacacaac cagatctccc ccaaatccac ccgtcggcac ctccgcttca aggtacgccg 4980 ctcgtcctcc cccccccccc tctctacctt ctctagatcg gcgttccggt ccatgcatgg 5040 ttagggcccg gtagttctac ttctgttcat gtttgtgtta gatccgtgtt tgtgttagat 5100 ccgtgctgct agcgttcgta cacggatgcg acctgtacgt cagacacgtt ctgattgcta 5160 acttgccagt gtttctcttt ggggaatcct gggatggctc tagccgttcc gcagacggga 5220 tcgatttcat gatttttttt gtttcgttgc atagggtttg gtttgccctt ttcctttatt 5280 tcaatatatg ccgtgcactt gtttgtcggg tcatcttttc atgctttttt ttgtcttggt 5340 tgtgatgatg tggtctggtt gggcggtcgt tctagatcgg agtagaattc tgtttcaaac 5400 tacctggtgg atttattaat tttggatctg tatgtgtgtg ccatacatat tcatagttac 5460 gaattgaaga tgatggatgg aaatatcgat ctaggatagg tatacatgtt gatgcgggtt 5520 ttactgatgc atatacagag atgctttttg ttcgcttggt tgtgatgatg tggtgtggtt 5580 gggcggtcgt tcattcgttc tagatcggag tagaatactg tttcaaacta cctggtgtat 5640 ttattaattt tggaactgta tgtgtgtgtc atacatcttc atagttacga gtttaagatg 5700 gatggaaata tcgatctagg ataggtatac atgttgatgt gggttttact gatgcatata 5760 catgatggca tatgcagcat ctattcatat gctctaacct tgagtaccta tctattataa 5820 taaacaagta tgttttataa ttattttgat cttgatatac ttggatgatg gcatatgcag 5880 cagctatatg tggatttttt tagccctgcc ttcatacgct atttatttgc ttggtactgt 5940 ttcttttgtc gatgctcacc ctgttgtttg gtgttacttc tgcaggtcga ctttaactta 6000 gcctaggatc cacacgacac catgtccccc gagcgccgcc ccgtcgagat ccgcccggcc 6060 accgccgccg acatggccgc cgtgtgcgac atcgtgaacc actacatcga gacctccacc 6120 gtgaacttcc gcaccgagcc gcagaccccg caggagtgga tcgacgacct ggagcgcctc 6180 caggaccgct acccgtggct cgtggccgag gtggagggcg tggtggccgg catcgcctac 6240 gccggcccgt ggaaggcccg caacgcctac gactggaccg tggagtccac cgtgtacgtg 6300 tcccaccgcc accagcgcct cggcctcggc tccaccctct acacccacct cctcaagagc 6360 atggaggccc agggcttcaa gtccgtggtg gccgtgatcg gcctcccgaa cgacccgtcc 6420 gtgcgcctcc acgaggccct cggctacacc gcccgcggca ccctccgcgc cgccggctac 6480 aagcacggcg gctggcacga cgtcggcttc tggcagcgcg acttcgagct gccggccccg 6540 ccgcgcccgg tgcgcccggt gacgcagatc tgagtcgaaa cctagacttg tccatcttct 6600 ggattggcca acttaattaa tgtatgaaat aaaaggatgc acacatagtg acatgctaat 6660 cactataatg tgggcatcaa agttgtgtgt tatgtgtaat tactagttat ctgaataaaa 6720 gagaaagaga tcatccatat ttcttatcct aaatgaatgt cacgtgtctt tataattctt 6780 tgatgaacca gatgcatttc attaaccaaa tccatataca tataaatatt aatcatatat 6840 aattaatatc aattgggtta gcaaaacaaa tctagtctag gtgtgttttg cgaattgcgg 6900 ccgccaccgc ggtggagctc gaattcattc cgattaatcg tggcctcttg ctcttcagga 6960 tgaagagcta tgtttaaacg tgcaagcgct actagacaat tcagtacatt aaaaacgtcc 7020 gcaatgtgtt attaagttgt ctaagcgtca atttgtttac accacaatat atcctgccac 7080 cagccagcca acagctcccc gaccggcagc tcggcacaaa atcaccactc gatacaggca 7140 gcccatcagt ccgggacggc gtcagcggga gagccgttgt aaggcggcag actttgctca 7200 tgttaccgat gctattcgga agaacggcaa ctaagctgcc gggtttgaaa cacggatgat 7260 ctcgcggagg gtagcatgtt gattgtaacg atgacagagc gttgctgcct gtgatcaaat 7320 atcatctccc tcgcagagat ccgaattatc agccttctta ttcatttctc gcttaaccgt 7380 gacaggctgt cgatcttgag aactatgccg acataatagg aaatcgctgg ataaagccgc 7440 tgaggaagct gagtggcgct atttctttag aagtgaacgt tgacgatcgt cgaccgtacc 7500 ccgatgaatt aattcggacg tacgttctga acacagctgg atacttactt gggcgattgt 7560 catacatgac atcaacaatg tacccgtttg tgtaaccgtc tcttggaggt tcgtatgaca 7620 ctagtggttc ccctcagctt gcgactagat gttgaggcct aacattttat tagagagcag 7680 gctagttgct tagatacatg atcttcaggc cgttatctgt cagggcaagc gaaaattggc 7740 catttatgac gaccaatgcc ccgcagaagc tcccatcttt gccgccatag acgccgcgcc 7800 ccccttttgg ggtgtagaac atccttttgc cagatgtgga aaagaagttc gttgtcccat 7860 tgttggcaat gacgtagtag ccggcgaaag tgcgagaccc atttgcgcta tatataagcc 7920 tacgatttcc gttgcgacta ttgtcgtaat tggatgaact attatcgtag ttgctctcag 7980 agttgtcgta atttgatgga ctattgtcgt aattgcttat ggagttgtcg tagttgcttg 8040 gagaaatgtc gtagttggat ggggagtagt catagggaag acgagcttca tccactaaaa 8100 caattggcag gtcagcaagt gcctgccccg atgccatcgc aagtacgagg cttagaacca 8160 ccttcaacag atcgcgcata gtcttcccca gctctctaac gcttgagtta agccgcgccg 8220 cgaagcggcg tcggcttgaa cgaattgtta gacattattt gccgactacc ttggtgatct 8280 cgcctttcac gtagtgaaca aattcttcca actgatctgc gcgcgaggcc aagcgatctt 8340 cttgtccaag ataagcctgc ctagcttcaa gtatgacggg ctgatactgg gccggcaggc 8400 gctccattgc ccagtcggca gcgacatcct tcggcgcgat tttgccggtt actgcgctgt 8460 accaaatgcg ggacaacgta agcactacat ttcgctcatc gccagcccag tcgggcggcg 8520 agttccatag cgttaaggtt tcatttagcg cctcaaatag atcctgttca ggaaccggat 8580 caaagagttc ctccgccgct ggacctacca aggcaacgct atgttctctt gcttttgtca 8640 gcaagatagc cagatcaatg tcgatcgtgg ctggctcgaa gatacctgca agaatgtcat 8700 tgcgctgcca ttctccaaat tgcagttcgc gcttagctgg ataacgccac ggaatgatgt 8760 cgtcgtgcac aacaatggtg acttctacag cgcggagaat ctcgctctct ccaggggaag 8820 ccgaagtttc caaaaggtcg ttgatcaaag ctcgccgcgt tgtttcatca agccttacag 8880 tcaccgtaac cagcaaatca atatcactgt gtggcttcag gccgccatcc actgcggagc 8940 cgtacaaatg tacggccagc aacgtcggtt cgagatggcg ctcgatgacg ccaactacct 9000 ctgatagttg agtcgatact tcggcgatca ccgcttccct catgatgttt aactcctgaa 9060 ttaagccgcg ccgcgaagcg gtgtcggctt gaatgaattg ttaggcgtca tcctgtgctc 9120 ccgagaacca gtaccagtac atcgctgttt cgttcgagac ttgaggtcta gttttatacg 9180 tgaacaggtc aatgccgccg agagtaaagc cacattttgc gtacaaattg caggcaggta 9240 cattgttcgt ttgtgtctct aatcgtatgc caaggagctg tctgcttagt gcccactttt 9300 tcgcaaattc gatgagactg tgcgcgactc ctttgcctcg gtgcgtgtgc gacacaacaa 9360 tgtgttcgat agaggctaga tcgttccatg ttgagttgag ttcaatcttc ccgacaagct 9420 cttggtcgat gaatgcgcca tagcaagcag agtcttcatc agagtcatca tccgagatgt 9480 aatccttccg gtaggggctc acacttctgg tagatagttc aaagccttgg tcggataggt 9540 gcacatcgaa cacttcacga acaatgaaat ggttctcagc atccaatgtt tccgccacct 9600 gctcagggat caccgaaatc ttcatatgac gcctaacgcc tggcacagcg gatcgcaaac 9660 ctggcgcggc ttttggcaca aaaggcgtga caggtttgcg aatccgttgc tgccacttgt 9720 taaccctttt gccagatttg gtaactataa tttatgttag aggcgaagtc ttgggtaaaa 9780 actggcctaa aattgctggg gatttcagga aagtaaacat caccttccgg ctcgatgtct 9840 attgtagata tatgtagtgt atctacttga tcgggggatc tgctgcctcg cgcgtttcgg 9900 tgatgacggt gaaaacctct gacacatgca gctcccggag acggtcacag cttgtctgta 9960 agcggatgcc gggagcagac aagcccgtca gggcgcgtca gcgggtgttg gcgggtgtcg 10020 gggcgcagcc atgacccagt cacgtagcga tagcggagtg tatactggct taactatgcg 10080 gcatcagagc agattgtact gagagtgcac catatgcggt gtgaaatacc gcacagatgc 10140 gtaaggagaa aataccgcat caggcgctct tccgcttcct cgctcactga ctcgctgcgc 10200 tcggtcgttc ggctgcggcg agcggtatca gctcactcaa aggcggtaat acggttatcc 10260 acagaatcag gggataacgc aggaaagaac atgtgagcaa aaggccagca aaaggccagg 10320 aaccgtaaaa aggccgcgtt gctggcgttt ttccataggc tccgcccccc tgacgagcat 10380 cacaaaaatc gacgctcaag tcagaggtgg cgaaacccga caggactata aagataccag 10440 gcgtttcccc ctggaagctc cctcgtgcgc tctcctgttc cgaccctgcc gcttaccgga 10500 tacctgtccg cctttctccc ttcgggaagc gtggcgcttt ctcatagctc acgctgtagg 10560 tatctcagtt cggtgtaggt cgttcgctcc aagctgggct gtgtgcacga accccccgtt 10620 cagcccgacc gctgcgcctt atccggtaac tatcgtcttg agtccaaccc ggtaagacac 10680 gacttatcgc cactggcagc agccactggt aacaggatta gcagagcgag gtatgtaggc 10740 ggtgctacag agttcttgaa gtggtggcct aactacggct acactagaag gacagtattt 10800 ggtatctgcg ctctgctgaa gccagttacc ttcggaaaaa gagttggtag ctcttgatcc 10860 ggcaaacaaa ccaccgctgg tagcggtggt ttttttgttt gcaagcagca gattacgcgc 10920 agaaaaaaag gatctcaaga agatcctttg atcttttcta cggggtctga cgctcagtgg 10980 aacgaaaact cacgttaagg gattttggtc atgagattat caaaaaggat cttcacctag 11040 atccttttaa attaaaaatg aagttttaaa tcaatctaaa gtatatatga gtaaacttgg 11100 tctgacagtt accaatgctt aatcagtgag gcacctatct cagcgatctg tctatttcgt 11160 tcatccatag ttgcctgact ccccgtcgtg tagataacta cgatacggga gggcttacca 11220 tctggcccca gtgctgcaat gataccgcga gacccacgct caccggctcc agatttatca 11280 gcaataaacc agccagccgg aagggccgag cgcagaagtg gtcctgcaac tttatccgcc 11340 tccatccagt ctattaattg ttgccgggaa gctagagtaa gtagttcgcc agttaatagt 11400 ttgcgcaacg ttgttgccat tgctgcaggg gggggggggg ggggggactt ccattgttca 11460 ttccacggac aaaaacagag aaaggaaacg acagaggcca aaaagcctcg ctttcagcac 11520 ctgtcgtttc ctttcttttc agagggtatt ttaaataaaa acattaagtt atgacgaaga 11580 agaacggaaa cgccttaaac cggaaaattt tcataaatag cgaaaacccg cgaggtcgcc 11640 gccccgtaac ctgtcggatc accggaaagg acccgtaaag tgataatgat tatcatctac 11700 atatcacaac gtgcgtggag gccatcaaac cacgtcaaat aatcaattat gacgcaggta 11760 tcgtattaat tgatctgcat caacttaacg taaaaacaac ttcagacaat acaaatcagc 11820 gacactgaat acggggcaac ctcatgtccc cccccccccc ccccctgcag gcatcgtggt 11880 gtcacgctcg tcgtttggta tggcttcatt cagctccggt tcccaacgat caaggcgagt 11940 tacatgatcc cccatgttgt gcaaaaaagc ggttagctcc ttcggtcctc cgatcgttgt 12000 cagaagtaag ttggccgcag tgttatcact catggttatg gcagcactgc ataattctct 12060 tactgtcatg ccatccgtaa gatgcttttc tgtgactggt gagtactcaa ccaagtcatt 12120 ctgagaatag tgtatgcggc gaccgagttg ctcttgcccg gcgtcaacac gggataatac 12180 cgcgccacat agcagaactt taaaagtgct catcattgga aaacgttctt cggggcgaaa 12240 actctcaagg atcttaccgc tgttgagatc cagttcgatg taacccactc gtgcacccaa 12300 ctgatcttca gcatctttta ctttcaccag cgtttctggg tgagcaaaaa caggaaggca 12360 aaatgccgca aaaaagggaa taagggcgac acggaaatgt tgaatactca tactcttcct 12420 ttttcaatat tattgaagca tttatcaggg ttattgtctc atgagcggat acatatttga 12480 atgtatttag aaaaataaac aaataggggt tccgcgcaca tttccccgaa aagtgccacc 12540 tgacgtctaa gaaaccatta ttatcatgac attaacctat aaaaataggc gtatcacgag 12600 gccctttcgt cttcaagaat tggtcgacga tcttgctgcg ttcggatatt ttcgtggagt 12660 tcccgccaca gacccggatt gaaggcgaga tccagcaact cgcgccagat catcctgtga 12720 cggaactttg gcgcgtgatg actggccagg acgtcggccg aaagagcgac aagcagatca 12780 cgcttttcga cagcgtcgga tttgcgatcg aggatttttc ggcgctgcgc tacgtccgcg 12840 accgcgttga gggatcaagc cacagcagcc cactcgacct tctagccgac ccagacgagc 12900 caagggatct ttttggaatg ctgctccgtc gtcaggcttt ccgacgtttg ggtggttgaa 12960 cagaagtcat tatcgtacgg aatgccaagc actcccgagg ggaaccctgt ggttggcatg 13020 cacatacaaa tggacgaacg gataaacctt ttcacgccct tttaaatatc cgttattcta 13080 ataaacgctc ttttctctta ggtttacccg ccaatatatc ctgtcaaaca ctgatagttt 13140 aaactgaagg cgggaaacga caatctgatc atgagcggag aattaaggga gtcacgttat 13200 gacccccgcc gatgacgcgg gacaagccgt tttacgtttg gaactgacag aaccgcaacg 13260 ttgaaggagc cactcagc 13278 <210> SEQ ID NO 11 <211> LENGTH: 50 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: poly-linker <400> SEQUENCE: 11 gatcactagt ggcgcgccta ggagatctcg agtagggata acagggtaat 50 <210> SEQ ID NO 12 <211> LENGTH: 25 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: attB1 seqeunce <400> SEQUENCE: 12 acaagtttgt acaaaaaagc aggct 25 <210> SEQ ID NO 13 <211> LENGTH: 25 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: attB2 sequence <400> SEQUENCE: 13 accactttgt acaagaaagc tgggt 25 <210> SEQ ID NO 14 <211> LENGTH: 4778 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: PHP23112 construct <400> SEQUENCE: 14 gaaaggccca gtcttccgac tgagcctttc gttttatttg atgcctggca gttccctact 60 ctcgcgttaa cgctagcatg gatgttttcc cagtcacgac gttgtaaaac gacggccagt 120 cttaagctcg ggcccgcgtt aacgctacca tggagctcca aataatgatt ttattttgac 180 tgatagtgac ctgttcgttg caacaaattg ataagcaatg cttttttata atgccaactt 240 tgtatagaaa agttgggccg aattcgagct cggtacggcc agaatggccc ggaccgggtt 300 accgaattcg agctcggtac cctgggatca gcttgcatgc ctgcagtgca gcgtgacccg 360 gtcgtgcccc tctctagaga taatgagcat tgcatgtcta agttataaaa aattaccaca 420 tatttttttt gtcacacttg tttgaagtgc agtttatcta tctttataca tatatttaaa 480 ctttactcta cgaataatat aatctatagt actacaataa tatcagtgtt ttagagaatc 540 atataaatga acagttagac atggtctaaa ggacaattga gtattttgac aacaggactc 600 tacagtttta tctttttagt gtgcatgtgt tctccttttt ttttgcaaat agcttcacct 660 atataatact tcatccattt tattagtaca tccatttagg gtttagggtt aatggttttt 720 atagactaat ttttttagta catctatttt attctatttt agcctctaaa ttaagaaaac 780 taaaactcta ttttagtttt tttatttaat aatttagata taaaatagaa taaaataaag 840 tgactaaaaa ttaaacaaat accctttaag aaattaaaaa aactaaggaa acatttttct 900 tgtttcgagt agataatgcc agcctgttaa acgccgtcga cgagtctaac ggacaccaac 960 cagcgaacca gcagcgtcgc gtcgggccaa gcgaagcaga cggcacggca tctctgtcgc 1020 tgcctctgga cccctctcga gagttccgct ccaccgttgg acttgctccg ctgtcggcat 1080 ccagaaattg cgtggcggag cggcagacgt gagccggcac ggcaggcggc ctcctcctcc 1140 tctcacggca ccggcagcta cgggggattc ctttcccacc gctccttcgc tttcccttcc 1200 tcgcccgccg taataaatag acaccccctc cacaccctct ttccccaacc tcgtgttgtt 1260 cggagcgcac acacacacaa ccagatctcc cccaaatcca cccgtcggca cctccgcttc 1320 aaggtacgcc gctcgtcctc cccccccccc ctctctacct tctctagatc ggcgttccgg 1380 tccatgcatg gttagggccc ggtagttcta cttctgttca tgtttgtgtt agatccgtgt 1440 ttgtgttaga tccgtgctgc tagcgttcgt acacggatgc gacctgtacg tcagacacgt 1500 tctgattgct aacttgccag tgtttctctt tggggaatcc tgggatggct ctagccgttc 1560 cgcagacggg atcgatttca tgattttttt tgtttcgttg catagggttt ggtttgccct 1620 tttcctttat ttcaatatat gccgtgcact tgtttgtcgg gtcatctttt catgcttttt 1680 tttgtcttgg ttgtgatgat gtggtctggt tgggcggtcg ttctagatcg gagtagaatt 1740 ctgtttcaaa ctacctggtg gatttattaa ttttggatct gtatgtgtgt gccatacata 1800 ttcatagtta cgaattgaag atgatggatg gaaatatcga tctaggatag gtatacatgt 1860 tgatgcgggt tttactgatg catatacaga gatgcttttt gttcgcttgg ttgtgatgat 1920 gtggtgtggt tgggcggtcg ttcattcgtt ctagatcgga gtagaatact gtttcaaact 1980 acctggtgta tttattaatt ttggaactgt atgtgtgtgt catacatctt catagttacg 2040 agtttaagat ggatggaaat atcgatctag gataggtata catgttgatg tgggttttac 2100 tgatgcatat acatgatggc atatgcagca tctattcata tgctctaacc ttgagtacct 2160 atctattata ataaacaagt atgttttata attattttga tcttgatata cttggatgat 2220 ggcatatgca gcagctatat gtggattttt ttagccctgc cttcatacgc tatttatttg 2280 cttggtactg tttcttttgt cgatgctcac cctgttgttt ggtgttactt ctgcaggtcg 2340 actctagagg atcagcttgg tcacccggtc cgggcctaga aggccagctt caagtttgta 2400 caaaaaagtt gaacgagaaa cgtaaaatga tataaatatc aatatattaa attagatttt 2460 gcataaaaaa cagactacat aatactgtaa aacacaacat atgcagtcac tatgaatcaa 2520 ctacttagat ggtattagtg acctgtagaa ttcgagctct agagctgcag ggcggccgcg 2580 atatccccta tagtgagtcg tattacatgg tcatagctgt ttcctggcag ctctggcccg 2640 tgtctcaaaa tctctgatgt tacattgcac aagataaaaa tatatcatca tgaacaataa 2700 aactgtctgc ttacataaac agtaatacaa ggggtgttat gagccatatt caacgggaaa 2760 cgtcgaggcc gcgattaaat tccaacatgg atgctgattt atatgggtat aaatgggctc 2820 gcgataatgt cgggcaatca ggtgcgacaa tctatcgctt gtatgggaag cccgatgcgc 2880 cagagttgtt tctgaaacat ggcaaaggta gcgttgccaa tgatgttaca gatgagatgg 2940 tcagactaaa ctggctgacg gaatttatgc ctcttccgac catcaagcat tttatccgta 3000 ctcctgatga tgcatggtta ctcaccactg cgatccccgg aaaaacagca ttccaggtat 3060 tagaagaata tcctgattca ggtgaaaata ttgttgatgc gctggcagtg ttcctgcgcc 3120 ggttgcattc gattcctgtt tgtaattgtc cttttaacag cgatcgcgta tttcgtctcg 3180 ctcaggcgca atcacgaatg aataacggtt tggttgatgc gagtgatttt gatgacgagc 3240 gtaatggctg gcctgttgaa caagtctgga aagaaatgca taaacttttg ccattctcac 3300 cggattcagt cgtcactcat ggtgatttct cacttgataa ccttattttt gacgagggga 3360 aattaatagg ttgtattgat gttggacgag tcggaatcgc agaccgatac caggatcttg 3420 ccatcctatg gaactgcctc ggtgagtttt ctccttcatt acagaaacgg ctttttcaaa 3480 aatatggtat tgataatcct gatatgaata aattgcagtt tcatttgatg ctcgatgagt 3540 ttttctaatc agaattggtt aattggttgt aacactggca gagcattacg ctgacttgac 3600 gggacggcgc aagctcatga ccaaaatccc ttaacgtgag ttacgcgtcg ttccactgag 3660 cgtcagaccc cgtagaaaag atcaaaggat cttcttgaga tccttttttt ctgcgcgtaa 3720 tctgctgctt gcaaacaaaa aaaccaccgc taccagcggt ggtttgtttg ccggatcaag 3780 agctaccaac tctttttccg aaggtaactg gcttcagcag agcgcagata ccaaatactg 3840 tccttctagt gtagccgtag ttaggccacc acttcaagaa ctctgtagca ccgcctacat 3900 acctcgctct gctaatcctg ttaccagtgg ctgctgccag tggcgataag tcgtgtctta 3960 ccgggttgga ctcaagacga tagttaccgg ataaggcgca gcggtcgggc tgaacggggg 4020 gttcgtgcac acagcccagc ttggagcgaa cgacctacac cgaactgaga tacctacagc 4080 gtgagcattg agaaagcgcc acgcttcccg aagggagaaa ggcggacagg tatccggtaa 4140 gcggcagggt cggaacagga gagcgcacga gggagcttcc agggggaaac gcctggtatc 4200 tttatagtcc tgtcgggttt cgccacctct gacttgagcg tcgatttttg tgatgctcgt 4260 caggggggcg gagcctatgg aaaaacgcca gcaacgcggc ctttttacgg ttcctggcct 4320 tttgctggcc ttttgctcac atgttctttc ctgcgttatc ccctgattct gtggataacc 4380 gtattaccgc ctttgagtga gctgataccg ctcgccgcag ccgaacgacc gagcgcagcg 4440 agtcagtgag cgaggaagcg gaagagcgcc caatacgcaa accgcctctc cccgcgcgtt 4500 ggccgattca ttaatgcagc tggcacgaca ggtttcccga ctggaaagcg ggcagtgagc 4560 gcaacgcaat taatacgcgt accgctagcc aggaagagtt tgtagaaacg caaaaaggcc 4620 atccgtcagg atggccttct gcttagtttg atgcctggca gtttatggcg ggcgtcctgc 4680 ccgccaccct ccgggccgtt gcttcacaac gttcaaatcc gctcccggcg gatttgtcct 4740 actcaggaga gcgttcaccg acaaacaaca gataaaac 4778 <210> SEQ ID NO 15 <211> LENGTH: 54 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: forward primer VC062 <400> SEQUENCE: 15 ttaaacaagt ttgtacaaaa aagcaggctg caattaaccc tcactaaagg gaac 54 <210> SEQ ID NO 16 <211> LENGTH: 53 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <220> FEATURE: <223> OTHER INFORMATION: reverse primer VC063 <400> SEQUENCE: 16 ttaaaccact ttgtacaaga aagctgggtg cgtaatacga ctcactatag ggc 53 <210> SEQ ID NO 17 <211> LENGTH: 788 <212> TYPE: DNA <213> ORGANISM: Zea mays <400> SEQUENCE: 17 gcaaacaccg ctccagccgc cttcgctgct gctcgtgtgt ctcgtggaag ctccgcggct 60 ggaccatgga cccggacctg gacctcgacc tagacatgga tatggagacg ctcgccggcg 120 acagcggcgg cgaggccgag cgcaacgaag ccgccgaggc cgaggctgag gtggagcggt 180 acgaggccgc cgaagccgag gccgacatcc tccgcgaccg attccgcctc gccgtcatca 240 gcatcgccac cgccgaagga aagaaggccg gaatgacggt cgccgacccc gttgtttcct 300 gcatcgccga cttggcgttc aagagcgcag agcagctagc aaaggatgca gagttgtttg 360 cacagcatgc cggtcgcaaa tccgtcagga tggatgatgt catactcaca gctcacagga 420 acgagcatct tatgggcctg ctgcggacct tctctcagga gctgaaggga aaggagcctg 480 ccagtgagag gaagagaaag aaatcgtcca agaaggatga gacggtgatc gaggtctgat 540 ttcagatctg tcctcttttt ttttagagag gaaggcatgc atttttatct cgcgaggtcc 600 tcccggcttg tacagcttcc ttgtgtcgat actatcttcc atgtcatttc gcagaacttt 660 tcttctacga accctttcat cctagtcagt ttttctagtc agttattgat ggtacttgag 720 ttgagcttgc tttctcaact gcacatagca ttagtactga gtccaaaaaa aaaaaaaaaa 780 aaaaaaaa 788 <210> SEQ ID NO 18 <211> LENGTH: 157 <212> TYPE: PRT <213> ORGANISM: Zea mays <400> SEQUENCE: 18 Met Asp Pro Asp Leu Asp Leu Asp Leu Asp Met Asp Met Glu Thr Leu 1 5 10 15 Ala Gly Asp Ser Gly Gly Glu Ala Glu Arg Asn Glu Ala Ala Glu Ala 20 25 30 Glu Ala Glu Val Glu Arg Tyr Glu Ala Ala Glu Ala Glu Ala Asp Ile 35 40 45 Leu Arg Asp Arg Phe Arg Leu Ala Val Ile Ser Ile Ala Thr Ala Glu 50 55 60 Gly Lys Lys Ala Gly Met Thr Val Ala Asp Pro Val Val Ser Cys Ile 65 70 75 80 Ala Asp Leu Ala Phe Lys Ser Ala Glu Gln Leu Ala Lys Asp Ala Glu 85 90 95 Leu Phe Ala Gln His Ala Gly Arg Lys Ser Val Arg Met Asp Asp Val 100 105 110 Ile Leu Thr Ala His Arg Asn Glu His Leu Met Gly Leu Leu Arg Thr 115 120 125 Phe Ser Gln Glu Leu Lys Gly Lys Glu Pro Ala Ser Glu Arg Lys Arg 130 135 140 Lys Lys Ser Ser Lys Lys Asp Glu Thr Val Ile Glu Val 145 150 155 <210> SEQ ID NO 19 <211> LENGTH: 676 <212> TYPE: DNA <213> ORGANISM: Oryza sativa <400> SEQUENCE: 19 aaatcccatc tcagtccgcc atggacgcgg agatggacct cctcgccgac gacgacggcg 60 gcgaggccga gaggctggag gccgcggagg cgcaggccga cctcctccgc gatcgcctcc 120 gcctcgccgt catcagcatc gccacctccg aaggaaagaa ggcggggatg gaggtctccg 180 accccgtcgt cgcctgcatc gccgatctgg cctacaagac cgtagagcag ctggctaagg 240 atgttgagtt gtttgcacag catgctggtc gtaaatccat caagatggaa gatgttatac 300 tcacagcaca tagaaatgag catctgatgg gcctcctgcg gacattttct caagaactga 360 agggtaagga gccttccagc gagaggaaga gaaagaaatc ttcgaagaag gacgacaacg 420 tgatgcaaat ctgatttaag tcatgagata aatcttcttc ccatagaaca aagtggtagg 480 ttcaagcagg aaactctgca agtaactcag gctacccact gatcctgtat ttcacacatt 540 tagatgtggt atgacacaat gttgtctgtg gaaagtggag atccttcaca cctgtaaatt 600 cactgaggct gttgtgtcaa gtagtaaatg gcaaaattca gagtttggtt cttaaaaaaa 660 aaaaaaaaaa aaaaaa 676 <210> SEQ ID NO 20 <211> LENGTH: 137 <212> TYPE: PRT <213> ORGANISM: Oryza sativa <400> SEQUENCE: 20 Met Asp Ala Glu Met Asp Leu Leu Ala Asp Asp Asp Gly Gly Glu Ala 1 5 10 15 Glu Arg Leu Glu Ala Ala Glu Ala Gln Ala Asp Leu Leu Arg Asp Arg 20 25 30 Leu Arg Leu Ala Val Ile Ser Ile Ala Thr Ser Glu Gly Lys Lys Ala 35 40 45 Gly Met Glu Val Ser Asp Pro Val Val Ala Cys Ile Ala Asp Leu Ala 50 55 60 Tyr Lys Thr Val Glu Gln Leu Ala Lys Asp Val Glu Leu Phe Ala Gln 65 70 75 80 His Ala Gly Arg Lys Ser Ile Lys Met Glu Asp Val Ile Leu Thr Ala 85 90 95 His Arg Asn Glu His Leu Met Gly Leu Leu Arg Thr Phe Ser Gln Glu 100 105 110 Leu Lys Gly Lys Glu Pro Ser Ser Glu Arg Lys Arg Lys Lys Ser Ser 115 120 125 Lys Lys Asp Asp Asn Val Met Gln Ile 130 135 <210> SEQ ID NO 21 <211> LENGTH: 513 <212> TYPE: DNA <213> ORGANISM: Glycine max <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (356)..(356) <223> OTHER INFORMATION: n is a, c, g, t or u <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (364)..(364) <223> OTHER INFORMATION: n is a, c, g, t or u <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (367)..(367) <223> OTHER INFORMATION: n is a, c, g, t or u <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (413)..(413) <223> OTHER INFORMATION: n is a, c, g, t or u <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (437)..(437) <223> OTHER INFORMATION: n is a, c, g, t or u <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (474)..(474) <223> OTHER INFORMATION: n is a, c, g, t or u <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (493)..(494) <223> OTHER INFORMATION: n is a, c, g, t or u <400> SEQUENCE: 21 cgcgaacagc gaagtcgaaa acgacgcgga aatgaagctc ttgagagata aattcaggct 60 ctccgcaatc tccatcatcg aatctcaagc aaaacaaaac ggcatggaag tatcaaaagt 120 cgtagtcact tgcgttgcgg atttggcctt caagtatacg gagcgcctgg ctagggatct 180 tcatctattt gcgcagcatg cgaatcgtaa atctgtaaat atggaagatg tgatactttg 240 tggacatagg aatgaacatg tatctggcat gttgaggagc ttctccaatg atttaaaagc 300 caaggatcct caatctgaaa ggaagcgaaa gaaagaaccc aaaaagaacg acaaangaac 360 cgcntancgc atatgcctga tgcatatata tgggcctaag aacatatttt ggnacgggta 420 ggtaatttta tgtatanttt tccccccctt aaaatgtttt tgggtttggg aagntagtgc 480 tgggatccat tannccaact taatcaattt atg 513 <210> SEQ ID NO 22 <211> LENGTH: 428 <212> TYPE: DNA <213> ORGANISM: Glycine max <220> FEATURE: <221> NAME/KEY: misc_feature <222> LOCATION: (415)..(415) <223> OTHER INFORMATION: n is a, c, g, t or u <400> SEQUENCE: 22 aaaatcgtag tcacttgcat tgcggatttg gccttcaaat atacagagtg cgtggctagg 60 gatcttcatc tatttgcgca gcatgcgaat cgtaaatctg taaatatgga agatgtgata 120 ctttgtggac ataggaatga acatgtatct ggcatgttga ggagcttctc caatgtttta 180 aaagccaacg atcctcaatc tgaaaggaag cgaaagaaag aaaccaaaaa gaacgacaaa 240 ggaaccgctt agaacatatt ttggtatgat taagtaaaat cttatatata tattatttcc 300 ttacttttat tggacttgtt agctattgct ggaatctatt agtccatctt aatcatttat 360 gggtgccttt aaacttaata cctatgatgt gtgtaattga atcaatttaa tttangagca 420 ttttctat 428 <210> SEQ ID NO 23 <211> LENGTH: 612 <212> TYPE: DNA <213> ORGANISM: Glycine max <400> SEQUENCE: 23 aaactcgacg atggaaagcg tggacgcgaa cagcgaagtc gaaaacgacg cggaaatgaa 60 gctcttgaga gataaattca ggctctccgc aatctccatc atcgaatctc aagcaaaaca 120 aaacggcatg gaagtatcaa aagtcgtagt cacttgcgtt gcggatttgg ccttcaagta 180 tacggagcgc ctggctaggg atcttcatct atttgcgcag catgcgaatc gtaaatctgt 240 aaatatggaa gatgtgatac tttgtggaca taggaatgaa catgtatctg gcatgttgag 300 gagcttctcc aatgatttaa aagccaagga tcctcaatct gaaaggaagc gaaagaaaga 360 acccaaaaag aacgacaaag gaaccgctta gcgcatatgc ctgatgcata tatatggtcc 420 taggaacata ttttggtacg gttagttaat tttatgtata tttttctctc ctttatatgt 480 ttttggattt ggtagctagt gctggaatct attagtccat cttaatcatt tatgcatgcc 540 tttaaactta attccagtaa ggcagtaact atgagtgcgt gattgaagta attaatttag 600 aagcattttt tt 612 <210> SEQ ID NO 24 <211> LENGTH: 126 <212> TYPE: PRT <213> ORGANISM: Glycine max <400> SEQUENCE: 24 Met Glu Ser Val Asp Ala Asn Ser Glu Val Glu Asn Asp Ala Glu Met 1 5 10 15 Lys Leu Leu Arg Asp Lys Phe Arg Leu Ser Ala Ile Ser Ile Ile Glu 20 25 30 Ser Gln Ala Lys Gln Asn Gly Met Glu Val Ser Lys Val Val Val Thr 35 40 45 Cys Val Ala Asp Leu Ala Phe Lys Tyr Thr Glu Arg Leu Ala Arg Asp 50 55 60 Leu His Leu Phe Ala Gln His Ala Asn Arg Lys Ser Val Asn Met Glu 65 70 75 80 Asp Val Ile Leu Cys Gly His Arg Asn Glu His Val Ser Gly Met Leu 85 90 95 Arg Ser Phe Ser Asn Asp Leu Lys Ala Lys Asp Pro Gln Ser Glu Arg 100 105 110 Lys Arg Lys Lys Glu Pro Lys Lys Asn Asp Lys Gly Thr Ala 115 120 125 <210> SEQ ID NO 25 <211> LENGTH: 578 <212> TYPE: DNA <213> ORGANISM: Glycine max <400> SEQUENCE: 25 gttgctgtcg aaaaatctcg acgatggaaa acgcggacgc gaacagcgaa gtcgaaaacg 60 acgcggaaat gaagctcttg agagataaat tcaggctctc cgcaatctcc ataatcgaat 120 ctcaagcaaa acaaaatggc atggaagtag caaaaatcgt agtcacttgc attgcggatt 180 tggccttcaa atatacagag tgcgtggcta gggatcttca tctatttgcg cagcatgcga 240 atcgtaaatc tgtaaatatg gaagatgtga tactttgtgg acataggaat gaacatgtat 300 ctggcatgtt gaggagcttc tccaatgttt taaaagccaa cgatcctcaa tctgaaagga 360 agcgaaagaa agaaaccaaa aagaacgaca aaggaaccgc ttagaacata ttttggtatg 420 attagtaaaa tcttatatat atattatttc cttactttta ttggacttgt tagctattgc 480 tggaatctat tagtccatct taatcattta tgggtgcctt taaacttaat accactcact 540 gtatgatgtg tgtaattgaa tcattttaat ttaggagc 578 <210> SEQ ID NO 26 <211> LENGTH: 126 <212> TYPE: PRT <213> ORGANISM: Glycine max <400> SEQUENCE: 26 Met Glu Asn Ala Asp Ala Asn Ser Glu Val Glu Asn Asp Ala Glu Met 1 5 10 15 Lys Leu Leu Arg Asp Lys Phe Arg Leu Ser Ala Ile Ser Ile Ile Glu 20 25 30 Ser Gln Ala Lys Gln Asn Gly Met Glu Val Ala Lys Ile Val Val Thr 35 40 45 Cys Ile Ala Asp Leu Ala Phe Lys Tyr Thr Glu Cys Val Ala Arg Asp 50 55 60 Leu His Leu Phe Ala Gln His Ala Asn Arg Lys Ser Val Asn Met Glu 65 70 75 80 Asp Val Ile Leu Cys Gly His Arg Asn Glu His Val Ser Gly Met Leu 85 90 95 Arg Ser Phe Ser Asn Val Leu Lys Ala Asn Asp Pro Gln Ser Glu Arg 100 105 110 Lys Arg Lys Lys Glu Thr Lys Lys Asn Asp Lys Gly Thr Ala 115 120 125 210> SEQ ID NO 27 <211> LENGTH: 847 <212> TYPE: DNA <213> ORGANISM: Arabidopsis thaliana <400> SEQUENCE: 27 atgtttaaca tttcttacgc caaacgaaac gctaaatatt tatttaaatt gctagcctgg 60 tgtatgatga tcgaggaagc tggacctaac atcggtaaca agcaaaaagt agttctccaa 120 cttagcaaaa tgctaataat gtatatcatt ctccatataa acgctgcgtt ttggacatgg 180 aggggatact taaaacgctg cgttttacac tttgttttcc cgcgtatatt tctcccttta 240 ttatcggata gcccaacaat cacacaggcg aagaaaccta gctattgctt cgccatggac 300 gtcggaggag aagacataag cgatctccag gtagaccaaa tcgttgaaga atattctatg 360 gacgatctca ttagagaccg attcagactc tccgcgatct ctatcgccga agccgaggcg 420 aagaaaaatg gaatggaaat aggtggacct gttgtggcat gtgtggcaga tttagccttc 480 aaatatgcag aaaacgttgc aaaggatctt gaactattcg ctcatcatgc tggacgcaaa 540 gttgtgaaca tggacgatgt tgttctctcc gcgcatagaa acgataactt agcagcatct 600 ttgaggtcac tatgcaatga gctaaaggca aaggagccac aatctgagag gaaacgcaag 660 aaaggatcag ccaagaaaga agacaaagcc agtagtagca atgccgttcg catcacgacc 720 gatctgtaac tcttcaagca gagtgtaaat acacgcactc ctctatatat atatataaac 780 attaactttg atggagaagc tgttattaaa tttttgtgga aaattttata tagaagactt 840 ttgcatt 847 <210> SEQ ID NO 28 <211> LENGTH: 242 <212> TYPE: PRT <213> ORGANISM: Arabidopsis thaliana <400> SEQUENCE: 28 Met Phe Asn Ile Ser Tyr Ala Lys Arg Asn Ala Lys Tyr Leu Phe Lys 1 5 10 15 Leu Leu Ala Trp Cys Met Met Ile Glu Glu Ala Gly Pro Asn Ile Gly 20 25 30 Asn Lys Gln Lys Val Val Leu Gln Leu Ser Lys Met Leu Ile Met Tyr 35 40 45 Ile Ile Leu His Ile Asn Ala Ala Phe Trp Thr Trp Arg Gly Tyr Leu 50 55 60 Lys Arg Cys Val Leu His Phe Val Phe Pro Arg Ile Phe Leu Pro Leu 65 70 75 80 Leu Ser Asp Ser Pro Thr Ile Thr Gln Ala Lys Lys Pro Ser Tyr Cys 85 90 95 Phe Ala Met Asp Val Gly Gly Glu Asp Ile Ser Asp Leu Gln Val Asp 100 105 110 Gln Ile Val Glu Glu Tyr Ser Met Asp Asp Leu Ile Arg Asp Arg Phe 115 120 125 Arg Leu Ser Ala Ile Ser Ile Ala Glu Ala Glu Ala Lys Lys Asn Gly 130 135 140 Met Glu Ile Gly Gly Pro Val Val Ala Cys Val Ala Asp Leu Ala Phe 145 150 155 160 Lys Tyr Ala Glu Asn Val Ala Lys Asp Leu Glu Leu Phe Ala His His 165 170 175 Ala Gly Arg Lys Val Val Asn Met Asp Asp Val Val Leu Ser Ala His 180 185 190 Arg Asn Asp Asn Leu Ala Ala Ser Leu Arg Ser Leu Cys Asn Glu Leu 195 200 205 Lys Ala Lys Glu Pro Gln Ser Glu Arg Lys Arg Lys Lys Gly Ser Ala 210 215 220 Lys Lys Glu Asp Lys Ala Ser Ser Ser Asn Ala Val Arg Ile Thr Thr 225 230 235 240 Asp Leu <210> SEQ ID NO 29 <211> LENGTH: 665 <212> TYPE: DNA <213> ORGANISM: Arabidopsis thaliana <400> SEQUENCE: 29 atgtttaaca tttcttacgc caaacgaaac gctaaatatt tatttaaatt gctagcctgg 60 taggcgcgta atagagagtg ctatgtttcc ttaaatcaaa gcaaaacata gatgttgttg 120 ccggcaacga ggatggtaat cgataaagcc acaggtgtat gatgatcgag gaagctggac 180 ctaacatcgg taacaagcaa aaagcgaaga aacctagcta ttgcttcgcc atggacgtcg 240 gaggagaaga cataagcgat ctccaggtag accaaatcgt tgaagaatat tctatggacg 300 atctcattag agaccgattc agactctccg cgatctctat cgccgaagcc gaggcgaaga 360 aaaatggaat ggaaataggt ggacctgttg tggcatgtgt ggcagattta gccttcaaat 420 atgcagaaaa cgttgcaaag gatcttgaac tattcgctca tcatgctgga cgcaaagttg 480 tgaacatgga cgatgttgtt ctctccgcgc atagaaacga taacttagca gcatctttga 540 ggtcactatg caatgagcta aaggcaaagg agccacaatc tgagaggaaa cgcaagaaag 600 gatcagccaa gaaagaagac aaagccagta gtagcaatgc cgttcgcatc acgaccgatc 660 tgtaa 665 <210> SEQ ID NO 30 <211> LENGTH: 168 <212> TYPE: PRT <213> ORGANISM: Arabidopsis thaliana <400> SEQUENCE: 30 Met Met Ile Glu Glu Ala Gly Pro Asn Ile Gly Asn Lys Gln Lys Ala 1 5 10 15 Lys Lys Pro Ser Tyr Cys Phe Ala Met Asp Val Gly Gly Glu Asp Ile 20 25 30 Ser Asp Leu Gln Val Asp Gln Ile Val Glu Glu Tyr Ser Met Asp Asp 35 40 45 Leu Ile Arg Asp Arg Phe Arg Leu Ser Ala Ile Ser Ile Ala Glu Ala 50 55 60 Glu Ala Lys Lys Asn Gly Met Glu Ile Gly Gly Pro Val Val Ala Cys 65 70 75 80 Val Ala Asp Leu Ala Phe Lys Tyr Ala Glu Asn Val Ala Lys Asp Leu 85 90 95 Glu Leu Phe Ala His His Ala Gly Arg Lys Val Val Asn Met Asp Asp 100 105 110 Val Val Leu Ser Ala His Arg Asn Asp Asn Leu Ala Ala Ser Leu Arg 115 120 125 Ser Leu Cys Asn Glu Leu Lys Ala Lys Glu Pro Gln Ser Glu Arg Lys 130 135 140 Arg Lys Lys Gly Ser Ala Lys Lys Glu Asp Lys Ala Ser Ser Ser Asn 145 150 155 160 Ala Val Arg Ile Thr Thr Asp Leu 165 <210> SEQ ID NO 31 <211> LENGTH: 669 <212> TYPE: DNA <213> ORGANISM: Arabidopsis thaliana <400> SEQUENCE: 31 atgtttaaca tttcttacgc caaacgaaac gctaaatatt tatttaaatt gctagcctgg 60 taggcgcgta atagagagtg ctatgtttcc ttaaatcaaa gcaaaacata gatgttgttg 120 ccggcaacga ggatggtaat cgataaagcc acaggtgtat gatgatcgag gaagctggac 180 ctaacatcgg taacaagcaa aaagtaggcg aagaaaccta gctattgctt cgccatggac 240 gtcggaggag aagacataag cgatctccag gtagaccaaa tcgttgaaga atattctatg 300 gacgatctca ttagagaccg attcagactc tccgcgatct ctatcgccga agccgaggcg 360 aagaaaaatg gaatggaaat aggtggacct gttgtggcat gtgtggcaga tttagccttc 420 aaatatgcag aaaacgttgc aaaggatctt gaactattcg ctcatcatgc tggacgcaaa 480 gttgtgaaca tggacgatgt tgttctctcc gcgcatagaa acgataactt agcagcatct 540 ttgaggtcac tatgcaatga gctaaaggca aaggagccac aatctgagag gaaacgcaag 600 aaaggatcag ccaagaaaga agacaaagcc agtagtagca atgccgttcg catcacgacc 660 gatctgtaa 669 <210> SEQ ID NO 32 <211> LENGTH: 144 <212> TYPE: PRT <213> ORGANISM: Arabidopsis thaliana <400> SEQUENCE: 32 Met Asp Val Gly Gly Glu Asp Ile Ser Asp Leu Gln Val Asp Gln Ile 1 5 10 15 Val Glu Glu Tyr Ser Met Asp Asp Leu Ile Arg Asp Arg Phe Arg Leu 20 25 30 Ser Ala Ile Ser Ile Ala Glu Ala Glu Ala Lys Lys Asn Gly Met Glu 35 40 45 Ile Gly Gly Pro Val Val Ala Cys Val Ala Asp Leu Ala Phe Lys Tyr 50 55 60 Ala Glu Asn Val Ala Lys Asp Leu Glu Leu Phe Ala His His Ala Gly 65 70 75 80 Arg Lys Val Val Asn Met Asp Asp Val Val Leu Ser Ala His Arg Asn 85 90 95 Asp Asn Leu Ala Ala Ser Leu Arg Ser Leu Cys Asn Glu Leu Lys Ala 100 105 110 Lys Glu Pro Gln Ser Glu Arg Lys Arg Lys Lys Gly Ser Ala Lys Lys 115 120 125 Glu Asp Lys Ala Ser Ser Ser Asn Ala Val Arg Ile Thr Thr Asp Leu 130 135 140 <210> SEQ ID NO 33 <211> LENGTH: 137 <212> TYPE: PRT <213> ORGANISM: Oryza sativa <400> SEQUENCE: 33 Met Asp Ala Glu Met Asp Leu Leu Ala Asp Asp Asp Gly Gly Glu Ala 1 5 10 15 Glu Arg Leu Glu Ala Ala Glu Ala Gln Ala Asp Leu Leu Arg Asp Arg 20 25 30 Leu Arg Leu Ala Val Ile Ser Ile Ala Thr Ser Glu Gly Lys Lys Ala 35 40 45 Gly Met Glu Val Ser Asp Pro Val Val Ala Cys Ile Ala Asp Leu Ala 50 55 60 Tyr Lys Thr Val Glu Gln Leu Ala Lys Asp Val Glu Leu Phe Ala Gln 65 70 75 80 His Ala Gly Arg Lys Ser Ile Lys Met Glu Asp Val Ile Leu Thr Ala 85 90 95 His Arg Asn Glu His Leu Met Gly Leu Leu Arg Thr Phe Ser Gln Glu 100 105 110 Leu Lys Gly Lys Glu Pro Ser Ser Glu Arg Lys Arg Lys Lys Ser Ser 115 120 125 Lys Lys Asp Asp Asn Val Met Gln Ile 130 135 <210> SEQ ID NO 34 <211> LENGTH: 135 <212> TYPE: PRT <213> ORGANISM: Vitis vinifera <400> SEQUENCE: 34 Met Glu Glu Ala Arg Ser Glu Leu Glu Arg Glu Glu Asp Glu Glu Ala 1 5 10 15 Thr Glu Leu Leu Arg Asp Arg Phe Arg Leu Ser Thr Ile Ser Ile Val 20 25 30 Glu Ala Gln Ala Lys Lys Ser Asp Met Glu Ile Ser Glu Pro Ile Val 35 40 45 Ala Cys Ile Ser Asp Leu Ala Phe Lys Tyr Thr Glu Gln Leu Ala Lys 50 55 60 Asp Leu Glu Leu Phe Ser Gln His Ala Gly Arg Lys Thr Val Asn Met 65 70 75 80 Glu Asp Val Ile Leu Ser Ala His Arg Asn Lys His Leu Ala Ser Ser 85 90 95 Leu Arg Ser Phe Cys Asn Asp Leu Lys Ala Lys Glu Ile Pro Ser Glu 100 105 110 Arg Lys Arg Lys Lys Ala Ser Arg Lys Glu Asp Lys Ala Ser Thr Ser 115 120 125 Val Val His Ile Pro Asp Leu 130 135 <210> SEQ ID NO 35 <211> LENGTH: 55 <212> TYPE: DNA <213> ORGANISM: Artificial <220> FEATURE: <223> OTHER INFORMATION: nucleotide sequence of the At5g50930-5' attB forward primer <400> SEQUENCE: 35 ttaaacaagt ttgtacaaaa aagcaggctc aacaatgttt aacatttctt acgcc 55 <210> SEQ ID NO 36 <211> LENGTH: 50 <212> TYPE: DNA <213> ORGANISM: Artificial <220> FEATURE: <223> OTHER INFORMATION: nucleotide sequence of the At5g50930-3' attB reverse primer <400> SEQUENCE: 36 ttaaaccact ttgtacaaga aagctgggtt tacagatcgg tcgtgatgcg 50

Claims

1. A plant comprising in its genome a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 24, 26, 28, 30, or 32,and wherein said plant exhibits increased nitrogen stress tolerance when compared to a control plant not comprising said recombinant DNA construct.

2. The plant of claim 1, wherein the plant is a maize plant or a soybean plant.

3. A plant comprising in its genome a recombinant DNA construct comprising:(a) a polynucleotide operably linked to at least one regulatory element, wherein said polynucleotide encodes a polypeptide having an amino acid sequence of at least 50% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO: 18, 20, 24, 26, 28, 30, or 32; or(b) a suppression DNA construct comprising at least one regulatory element operably linked to:(i) all or part of: (A) a nucleic acid sequence encoding a polypeptide having an amino acid sequence of at least 50% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO: 18, 20, 24, 26, 28, 30, or 32, or (B) a full complement of the nucleic acid sequence of (b)(i)(A); or(ii) a region derived from all or part of a sense strand or antisense strand of a target gene of interest, said region having a nucleic acid sequence of at least 50% sequence identity, based on the Clustal V method of alignment, when compared to said all or part of a sense strand or antisense strand from which said region is derived, and wherein said target gene of interest encodes an LNT2 polypeptide,and wherein said plant exhibits an alteration of at least one agronomic characteristic when compared to a control plant not comprising said recombinant DNA construct.

4. The plant of claim 3, wherein the plant is a maize plant or a soybean plant.

5. The plant of claim 3, wherein said plant exhibits said alteration of said at least one agronomic characteristic when compared, under nitrogen limiting conditions, to said control plant not comprising said recombinant DNA construct.

6. The plant of claim 5, wherein the plant is a maize plant or a soybean plant.

7. The plant of claim 3, wherein said at least one agronomic characteristic is selected from the group consisting of greenness, yield, growth rate, biomass, fresh weight at maturation, dry weight at maturation, fruit yield, seed yield, total plant nitrogen content, fruit nitrogen content, seed nitrogen content, nitrogen content in vegetative tissue, whole plant amino acid content, vegetative tissue free amino acid content, fruit free amino acid content, seed free amino acid content, total plant protein content, fruit protein content, seed protein content, protein content in a vegetative tissue, drought tolerance, nitrogen uptake, resistance to root lodging, harvest index, stalk lodging, plant height, ear height, and ear length.

8. The plant of claim 7, wherein the plant is a maize plant or a soybean plant.

9. The plant of claim 3, wherein said plant exhibits an increase of said at least one agronomic characteristic when compared to said control plant.

10. The plant of claim 9, wherein the plant is a maize plant or a soybean plant.

11. A method of increasing nitrogen stress tolerance in a plant, comprising:(a) introducing into a regenerable plant cell a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory sequence, wherein the polynucleotide encodes a polypeptide having an amino acid sequence of at least 50% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO: 18, 20, 24, 26, 28, 30, or 32; and(b) regenerating a transgenic plant from the regenerable plant cell after step (a), wherein the transgenic plant comprises in its genome the recombinant DNA construct and exhibits increased nitrogen stress tolerance when compared to a control plant not comprising the recombinant DNA construct.

12. The method of claim 11, further comprising:(c) obtaining a progeny plant derived from the transgenic plant, wherein said progeny plant comprises in its genome the recombinant DNA construct and exhibits increased nitrogen stress tolerance when compared to a control plant not comprising the recombinant DNA construct.

13. A method of evaluating nitrogen stress tolerance in a plant, comprising:(a) introducing into a regenerable plant cell a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory sequence, wherein the polynucleotide encodes a polypeptide having an amino acid sequence of at least 50% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO: 18, 20, 24, 26, 28, 30, or 32;(b) regenerating a transgenic plant from the regenerable plant cell after step (a), wherein the transgenic plant comprises in its genome the recombinant DNA construct; and(c) evaluating the transgenic plant for nitrogen stress tolerance compared to a control plant not comprising the recombinant DNA construct.

14. The method of claim 13, further comprising:(d) obtaining a progeny plant derived from the transgenic plant, wherein the progeny plant comprises in its genome the recombinant DNA construct; and(e) evaluating the progeny plant for nitrogen stress tolerance compared to a control plant not comprising the recombinant DNA construct.

15. A method of evaluating nitrogen stress tolerance in a plant, comprising:(a) introducing into a regenerable plant cell a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory sequence, wherein the polynucleotide encodes a polypeptide having an amino acid sequence of at least 50% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO: 18, 20, 24, 26, 28, 30, or 32;(b) regenerating a transgenic plant from the regenerable plant cell after step (a), wherein the transgenic plant comprises in its genome the recombinant DNA construct;(c) obtaining a progeny plant derived from the transgenic plant, wherein the progeny plant comprises in its genome the recombinant DNA construct; and(d) evaluating the progeny plant for nitrogen stress tolerance compared to a control plant not comprising the recombinant DNA construct.

16. A method of determining an alteration of an agronomic characteristic in a plant, comprising:(a) introducing into a regenerable plant cell a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory sequence, wherein the polynucleotide encodes a polypeptide having an amino acid sequence of at least 50% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO: 18, 20, 24, 26, 28, 30, or 32;(b) regenerating a transgenic plant from the regenerable plant cell after step (a), wherein the transgenic plant comprises in its genome the recombinant DNA construct; and(c) determining whether the transgenic plant exhibits an alteration of at least one agronomic characteristic when compared to a control plant not comprising the recombinant DNA construct.

17. The method of claim 16, further comprising:(d) obtaining a progeny plant derived from the transgenic plant, wherein the progeny plant comprises in its genome the recombinant DNA construct; and(e) determining whether the progeny plant exhibits an alteration of at least one agronomic characteristic when compared to a control plant not comprising the recombinant DNA construct.

18. The method of claim 16, wherein said determining step (c) comprises determining whether the transgenic plant exhibits an alteration of at least one agronomic characteristic when compared, under nitrogen limiting conditions, to a control plant not comprising the recombinant DNA construct.

19. The method of claim 17, wherein said determining step (e) comprises determining whether the progeny plant exhibits an alteration of at least one agronomic characteristic when compared, under nitrogen limiting conditions, to a control plant not comprising the recombinant DNA construct.

20. A method of determining an alteration of an agronomic characteristic in a plant, comprising:(a) introducing into a regenerable plant cell a recombinant DNA construct comprising a polynucleotide operably linked to at least one regulatory sequence, wherein the polynucleotide encodes a polypeptide having an amino acid sequence of at least 50% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO: 18, 20, 24, 26, 28, 30, or 32;(b) regenerating a transgenic plant from the regenerable plant cell after step (a), wherein the transgenic plant comprises in its genome the recombinant DNA construct;(c) obtaining a progeny plant derived from the transgenic plant, wherein the progeny plant comprises in its genome the recombinant DNA construct; and(d) determining whether the progeny plant exhibits an alteration of at least one agronomic characteristic when compared to a control plant not comprising the recombinant DNA construct.

21. The method of claim 20, wherein said determining step (d) comprises determining whether the transgenic plant exhibits an alteration of at least one agronomic characteristic when compared, under nitrogen limiting conditions, to a control plant not comprising the recombinant DNA construct.

22. A method of determining an alteration of an agronomic characteristic in a plant, comprising:(a) introducing into a regenerable plant cell a suppression DNA construct comprising at least one regulatory element operably linked to:(i) all or part of: (A) a nucleic acid sequence encoding a polypeptide having an amino acid sequence of at least 50% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 20, 24, 26, 28, 30, or 32, or (B) a full complement of the nucleic acid sequence of (b)(i)(A); or(ii) a region derived from all or part of a sense strand or antisense strand of a target gene of interest, said region having a nucleic acid sequence of at least 50% sequence identity, based on the Clustal V method of alignment, when compared to said all or part of a sense strand or antisense strand from which said region is derived, and wherein said target gene of interest encodes an LNT2 polypeptide;(b) regenerating a transgenic plant from the regenerable plant cell after step (a), wherein the transgenic plant comprises in its genome the suppression DNA construct; and(c) determining whether the transgenic plant exhibits an alteration of at least one agronomic characteristic when compared to a control plant not comprising the suppression DNA construct.

23. The method of claim 22, wherein said determining step (c) comprises determining whether the transgenic plant exhibits an alteration of at least one agronomic characteristic when compared, under nitrogen limiting conditions, to a control plant not comprising the suppression DNA construct.

24. The method of claim 22, further comprising:(d) obtaining a progeny plant derived from the transgenic plant, wherein the progeny plant comprises in its genome the suppression DNA construct; and(e) determining whether the progeny plant exhibits an alteration of at least one agronomic characteristic when compared to a control plant not comprising the suppression DNA construct.

25. The method of claim 24, wherein said determining step (e) comprises determining whether the progeny plant exhibits an alteration of at least one agronomic characteristic when compared, under nitrogen limiting conditions, to a control plant not comprising the suppression DNA construct.

26. A method of determining an alteration of an agronomic characteristic in a plant, comprising:(a) introducing into a regenerable plant cell a suppression DNA construct comprising at least one regulatory element operably linked to:(i) all or part of: (A) a nucleic acid sequence encoding a polypeptide having an amino acid sequence of at least 50% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO: 18, 20, 24, 26, 28, 30, or 32, or (B) a full complement of the nucleic acid sequence of (b)(i)(A); or(ii) a region derived from all or part of a sense strand or antisense strand of a target gene of interest, said region having a nucleic acid sequence of at least 50% sequence identity, based on the Clustal V method of alignment, when compared to said all or part of a sense strand or antisense strand from which said region is derived, and wherein said target gene of interest encodes an LNT2 polypeptide;(b) regenerating a transgenic plant from the regenerable plant cell after step (a), wherein the transgenic plant comprises in its genome the suppression DNA construct and exhibits an alteration of at least one agronomic trait when compared to a control plant not comprising the suppression DNA construct;(c) obtaining a progeny plant derived from the transgenic plant, wherein the progeny plant comprises in its genome the suppression DNA construct; and(d) determining whether the progeny plant exhibits an alteration of at least one agronomic characteristic when compared to a control plant not comprising the suppression DNA construct.

27. The method of claim 26, wherein said determining step (d) comprises determining whether the transgenic plant exhibits an alteration of at least one agronomic characteristic when compared, under nitrogen limiting conditions, to a control plant not comprising the recombinant DNA construct.

28. An isolated polynucleotide comprising:(i) a nucleic acid sequence encoding a polypeptide having an amino acid sequence of at least 85% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 24, or 26; or(ii) a full complement of the nucleic acid sequence of (i).

29. The isolated polynucleotide of claim 28, wherein said polypeptide has an amino acid sequence of at least 90% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 24, or 26.

30. The isolated polynucleotide of claim 28, wherein said polypeptide has an amino acid sequence of at least 95% sequence identity, based on the Clustal V method of alignment, when compared to SEQ ID NO:18, 24, or 26.

31. The isolated polynucleotide of claim 28, wherein the polypeptide sequence comprises SEQ ID NO:18, 24, or 26.

32. The isolated polynucleotide of claim 28, wherein the nucleic acid sequence comprises SEQ ID NO:17, 23, or 25.

Images