Patents - stay tuned to the technology

Inventors list

Assignees list

Classification tree browser

Top 100 Inventors

Top 100 Assignees

Patent application title: Extracellular/Epidermal Growth Factor Like Protein

Inventors:  Henrik S. Olsen (Gaithersburg, MD, US)  Haodong Li (Gaithersburg, MD, US)
Assignees:  Human Genome Sciences, Inc.
IPC8 Class: AG01N3353FI
USPC Class: 435 71
Class name: Chemistry: molecular biology and microbiology measuring or testing process involving enzymes or micro-organisms; composition or test strip therefore; processes of forming such composition or test strip involving antigen-antibody binding, specific binding protein assay or specific ligand-receptor binding assay
Publication date: 2009-04-23
Patent application number: 20090104622



closes an extracellular/epidermal growth factor polypeptides and polynucleotides encoding such polypeptides. Also provided is a procedure for producing such polypeptides by recombinant techniques and therapeutic uses of the polypeptides which include induction of DNA synthesis, stimulating wound healing, treating neurological disorders, treating ocular disorders, treating kidney and liver disorders and stimulating embryogenesis and angiogenesis. Also disclosed are antagonists against such polypeptide and their use as a therapeutic to treat neoplasia. Also disclosed are diagnostic assays for detecting altered levels of the polypeptide of the present invention and mutations in the nucleic acid sequences which encode the polypeptides of the present invention.

Claims:

1. An isolated antibody or fragment thereof that specifically binds to a protein selected from the group consisting of:(a) a polypeptide whose amino acid sequence consists of amino acid residues 2 to 448 of SEQ ID NO:2;(b) a polypeptide whose amino acid sequence consists of amino acid residues 26 to 448 of SEQ ID NO:2;(c) a polypeptide comprising the full-length EEGF polypeptide encoded by cDNA clone contained in ATCC Deposit No. 97285;(d) a polypeptide comprising the mature EEGF polypeptide encoded by cDNA clone contained in ATCC Deposit No. 97285;(e) a polypeptide whose amino acid sequence consists of a portion of SEQ ID NO:2, wherein said portion is at least 30 contiguous amino acid residues in length; and(f) a polypeptide whose amino acid sequence consists of a portion of SEQ ID NO:2, wherein said portion is at least 50 contiguous amino acid residues in length.

2. The antibody or fragment thereof of claim 1 that specifically binds protein (a).

3. The antibody or fragment thereof of claim 1 that specifically binds protein (b).

4. The antibody or fragment thereof of claim 1 that specifically binds protein (c).

5. The antibody or fragment thereof of claim 1 that specifically binds protein (d).

6. The antibody or fragment thereof of claim 1 that specifically binds protein (e).

7. The antibody or fragment thereof of claim 1 that specifically binds protein (f).

8. The antibody or fragment thereof of claim 2 that specifically binds protein (b).

9. The antibody or fragment thereof of claim 3 wherein said protein bound by said antibody or fragment thereof is glycosylated.

10. The antibody or fragment thereof of claim 3 wherein said antibody or fragment thereof is human.

11. The antibody or fragment thereof of claim 3 wherein said antibody or fragment thereof is polyclonal.

12. The antibody or fragment thereof of claim 3 wherein said antibody or fragment thereof is monoclonal.

13. The antibody or fragment thereof of claim 3 which is selected from the group consisting of:(a) a chimeric antibody or fragment thereof;(b) a humanized antibody or fragment thereof;(c) a single chain antibody; and(d) a Fab fragment.

14. The antibody or fragment thereof of claim 3 which is labeled.

15. The antibody or fragment thereof of claim 3 wherein said antibody or fragment thereof specifically binds to said protein in a Western blot or an ELISA.

16. An isolated cell that produces the antibody or fragment thereof of claim 3.

17. A hybridoma that produces the antibody or fragment thereof of claim 3.

18. A method of detecting EEGF protein in a biological sample comprising:(a) contacting the biological sample with the antibody or fragment thereof of claim 3; and(b) detecting the EEGF protein in the biological sample.

19. An isolated antibody or fragment thereof that specifically binds a EEGF protein purified from a cell culture wherein said EEGF protein is encoded by a polynucleotide encoding amino acids 2 to 448 of SEQ ID NO:2.

20. The antibody or fragment thereof of claim 19 wherein said antibody or fragment thereof is monoclonal.

21. The antibody or fragment thereof of claim 19 wherein said antibody or fragment thereof is polyclonal.

22. The antibody or fragment thereof of claim 19 wherein said antibody or fragment thereof is human.

23. The antibody or fragment thereof of claim 19 which is selected from the group consisting of:(a) a chimeric antibody or fragment thereof;(b) a humanized antibody or fragment thereof;(c) a single chain antibody; and(d) a Fab fragment.

24. The antibody or fragment thereof of claim 19 wherein said antibody or fragment thereof specifically binds to said protein in a Western blot or an ELISA.

Description:

CROSS REFERENCE TO RELATED APPLICATION

[0001]This application is a divisional of U.S. application Ser. No. 11/017,065, filed Dec. 21, 2004, which is a divisional of U.S. application Ser. No. 08/839,525, filed Apr. 11, 1997 (hereby incorporated by reference herein) (now U.S. Pat. No. 6,852,506, issued Feb. 8, 2005), which is a continuation-in-part of PCT Application Serial No. PCT/US96/05247, filed on Apr. 10, 1996.

REFERENCE TO SEQUENCE LISTING AS TEXT FILE

[0002]This application refers to a "Sequence Listing" listed below, which is provided as a text file. The text file contains a document entitled "PF224D2-SequenceListing.txt" (17,289 bytes, created Apr. 24, 2008), which is incorporated by reference in its entirety.

FIELD OF THE INVENTION

[0003]This invention relates to newly identified polynucleotides, polypeptides encoded by such polynucleotides, the use of such polynucleotides and polypeptides, as well as the production of such polynucleotides and polypeptides. The polypeptide of the present invention has been putatively identified as a human extracellular protein-like/Epidermal Growth Factor-like protein, hereafter referred to as "EEGF". The invention also relates to inhibiting the action of such polypeptides.

BACKGROUND OF THE INVENTION

[0004]Cellular growth and differentiation appear to be initiated, promoted, maintained and regulated by a multiplicity of stimulatory, inhibitory and synergistic factors and hormones. The alteration and/or breakdown of the cellular homeostasis mechanism seems to be a fundamental cause of growth related diseases, including neoplasia. Growth modulatory factors are implicated in a wide variety of pathological and physiological processes including signal transduction, cell communication, growth and development, embryogenesis, immune response, hematopoiesis cell survival and differentiation, inflammation, tissue repair and remodeling, atherosclerosis and cancer. Epidermal growth factor (EGF), transforming growth factor alpha (TGFα), betacellulin, amphiregulin, and vaccinia growth factor among other factors are growth and differentiation modulatory proteins produced by a variety of cell types either under normal physiological conditions or in response to exogenous stimuli and are members of the EGF family.

[0005]These peptide growth factors influence epithelial and epidermal cells through autocrine and paracrine mechanisms. They also play important roles in normal wound healing in tissues such as skin, cornea and gastrointestinal tract and all share substantial amino acid sequence homology including the conserved placement of three intra-chain disulfide bonds. In addition, all the factors of this family bind to a 170,000 molecular weight transmembrane glycoprotein receptor and activate the tyrosine kinase activity in the receptor's cytoplasmic domain (Buhrow, S. A. et al., J. Bio. Chem., 258:7824-7826 (1983)).

[0006]The receptors are expressed by many types of cells including skin keratinocytes, fibroblasts, vascular endothelial cells, and epithelial cells of the gastro-intestinal tract (GI) tract. These peptide growth factors are synthesized by several cells involved in wound healing including platelets, keratinocytes, and activated macrophages. These growth factors have also been implicated in both the stimulation of growth and differentiation of certain cells, for example, neoplasia, and the inhibition of other types of cells.

[0007]Betacellulin is a 32-kilodalton glycoprotein that appears to be processed from a larger transmembrane precursor by proteolytic cleavage. The carboxyl-terminal domain of betacellulin has 50% sequence similarity with that of rat transforming growth factor a. Betacellulin is a potent mitogen for retinal pigment epithelial cells and vascular smooth muscle cells.

[0008]Amphiregulin is a bifunctional cell growth regulatory factor which exhibits potent inhibitory activity on DNA synthesis in neoplastic cells, yet promotes the growth of certain normal cells. A wide variety of uses for amphiregulin have been assigned including the treatment of wounds and cancers. For example, amphiregulin has potent anti-proliferative effects in vitro on several human cancer cell lines of epithelial origin. Amphiregulin also induces the proliferation of human foreskin fibroblasts as shown in U.S. Pat. No. 5,115,096.

[0009]TGFα has pleiotropic biological effects. The production of certain members of TGFα is synthesized by a number of oncogenically transformed fibroblasts (Ciardiello et al., J. Cell. Biochem., 42:45-57 (1990)), as well as by a variety of tumors, including renal, breast and squamous carcinomas, melanomas and glioblastomas (Derynck, R. et al., Cancer Res., 47:707-712 (1987)). There is direct evidence that TGFα expression can be a contributing factor in the conversion of a normal cell to its tumorigenic counterpart by analyzing transgenic mice in which tumor cells express high levels of TGFα. TGFα transgenic animals display a variety of neoplastic lesions, depending on the strain of mouse and the choice of promoter regulating TGFα expression (Sandgren, et al., Cell, 61:1121-1135 (1990)).

[0010]TGFα also plays a role in normal embryonic development and adult physiology (Derynck, R. Adv. Cancer Res., 58:27-5 (1992)). TGFα has been expressed in many tissues including skin, brain, gastrointestinal mucosa and activating macrophages. Accordingly, TGFα is an important factor in controlling growth of epithelial cells and has a role in wound healing. TGFα has also been found to be angiogenic (Schreiber, et al., Science, 232:1250-1253 (1986)).

SUMMARY OF THE INVENTION

[0011]The polypeptide of the present invention has been putatively identified as an Extracellular/Epidermal Growth Factor. This identification has been made as a result of amino acid sequence homology to human extracellular protein which is a secreted protein with EGF-like domains that is abundant in heart tissue.

[0012]In accordance with one aspect of the present invention, there are provided novel full-length and mature EEGF polypeptides, as well as biologically active and diagnostically or therapeutically useful fragments, analogs and derivatives thereof. The polypeptides of the present invention are of human origin.

[0013]In accordance with another aspect of the present invention, there are provided isolated nucleic acid molecules encoding the EEGF polypeptides of the present invention, including mRNAs, cDNAs, genomic DNAs as well as analogs and biologically active and diagnostically or therapeutically useful fragments thereof.

[0014]In accordance with another aspect of the present invention there is provided an isolated nucleic acid molecule encoding a polypeptide expressed by the human cDNA contained in ATCC® Deposit No. 97285, deposited on Sep. 26, 1995 at the ATCC®, now located at 10801 University Blvd., Manassas, Va. 20110-2209.

[0015]In accordance with yet a further aspect of the present invention, there are provided processes for producing such polypeptide by recombinant techniques comprising culturing recombinant prokaryotic and/or eukaryotic host cells, containing a nucleic acid sequence encoding a polypeptide of the present invention.

[0016]In accordance with yet a further aspect of the present invention, there are provided processes for utilizing such polypeptides, or polynucleotides encoding such polypeptides for therapeutic purposes, for example, to regulate vascular smooth muscle cell proliferation, to treat Marfan syndrome, to stimulate wound healing, to restore normal neurological functioning after trauma or AIDS dementia, to treat ocular disorders, to treat kidney and liver disorders, to promote hair follicular development, to stimulate growth and differentiation of various epidermal and epithelial cells in vivo and in vitro and for the treatment of burns, ulcers and corneal incisions, to stimulate embryogenesis.

[0017]In accordance with yet a further aspect of the present invention, there is also provided nucleic acid probes comprising nucleic acid molecules of sufficient length to specifically hybridize to nucleic acid sequences of the present invention.

[0018]In accordance with yet a further aspect of the present invention, there are provided antibodies against such polypeptides.

[0019]In accordance with yet a further aspect of the present invention, there are provided agonists to the polypeptide of the present invention.

[0020]In accordance with yet another aspect of the present invention, there are provided antagonists to such polypeptides, which may be used to inhibit the action of such polypeptides, for example, in the treatment of corneal inflammation, neoplasia, for example, tumors and cancers and for psoriasis.

[0021]In accordance with still another aspect of the present invention, there are provided diagnostic assays for detecting diseases related to overexpression of the polypeptide of the present invention and mutations in the nucleic acid sequences encoding such polypeptide.

[0022]In accordance with yet a further aspect of the present invention, there is provided a process for utilizing such polypeptides, or polynucleotides encoding such polypeptides, for in vitro purposes related to scientific research, synthesis of DNA and manufacture of DNA vectors.

[0023]These and other aspects of the present invention should be apparent to those skilled in the art from the teachings herein.

BRIEF DESCRIPTION OF THE DRAWINGS

[0024]The following drawings are illustrative of embodiments of the invention and are not meant to limit the scope of the invention as encompassed by the claims.

[0025]FIGS. 1A-1D depict the cDNA sequence (SEQ ID NO:1) and corresponding deduced amino acid sequence (SEQ ID NO:2) of EEGF. Both the standard one letter and three letter abbreviations for amino acids are used. The leader sequence is underlined and the five EGF repeats are delineated.

[0026]FIG. 2 is an illustration of comparative amino acid sequence homology between the carboxyl terminal 392 amino acids of the polypeptide of the present invention (lower line) (amino acids 57-448 in SEQ ID NO:2) and human extracellular protein (upper line) (SEQ ID NO:9).

[0027]FIG. 3 shows an alignment of an EGF domain of TGF-β1 (SEQ ID NO:10), an EGF domain of fibulin ("FBL" SEQ ID NO:11) and the five EGF domains of the EEGF polypeptide of the present invention shown in FIGS. 1A-1D (EGF-1 comprises amino acids 112-153 of SEQ ID NO:2; EGF-2 comprises amino acids 154-190 of SEQ ID NO:2; EGF-3 comprises amino acids 191-230 of SEQ ID NO:2; EGF-4 comprises amino acids 231-271 of SEQ ID NO:2; and EGF-5 comprises amino acids 272-314 of SEQ ID NO:2).

DETAILED DESCRIPTION OF THE INVENTION

[0028]In accordance with an aspect of the present invention, there is provided an isolated nucleic acid (polynucleotide) which encodes for the full-length and mature EEGF polypeptides having the deduced amino acid sequences of FIGS. 1A-1D (SEQ ID NO:2).

[0029]A polynucleotide encoding a polypeptide of the present invention may be obtained from human heart, human brain and early stage brain tissue. The polynucleotide of this invention was discovered in a human fetal heart cDNA library. Its translation product has homology to the characteristic EGF domains. As shown in FIGS. 1 and 3, EEGF has five repeating EGF domains (EGF-1 comprises amino acids 112-153 of SEQ ID NO:2; EGF-2 comprises amino acids 154-190 of SEQ ID NO:2; EGF-3 comprises amino acids 191-230 of SEQ ID NO:2; EGF-4 comprises amino acids 231-271 of SEQ ID NO:2; and EGF-5 comprises amino acids 272-314 of SEQ ID NO:2) with strong homology between themselves and with other members of the EGF family. See, for example, Lecka-Czernik, et al., Molecular and Cellular Biology, 15(1):120 (1995), and in particular the consensus EGF domain shown in FIG. 5C on page 125. The polynucleotide contains an open reading frame encoding a complete EEGF polypeptide of 448 amino acids. EEGF exhibits a high degree of homology at the amino acid level to human extracellular protein with 45% identity and 34% similarity over a 392 amino acid stretch (as shown in FIG. 2). Northern blot analysis of this protein shows high levels of expression in heart tissue with the transcript being approximately 2 kb. In accordance with another aspect of the present invention there are provided isolated polynucleotides encoding an EEGF polypeptide expressed by the human cDNAs contained in ATCC® Deposit No. 97285, deposited with the American Type Culture Collection, 12301 Park Lawn Drive, Rockville, Md. 20852, USA, on Sep. 26, 1995. The deposited cDNA material is contained in a pBLUESCRIPT® plasmid (STRATAGENE®, La Jolla Calif.) which can be transformed into a viable host such as XL-1 Blue.

[0030]All deposit(s) of EEGF cDNAs disclosed herein have been made under the terms of the Budapest Treaty on the International Recognition of the Deposit of Micro-organisms for purposes of Patent Procedure. The strain will be irrevocably and without restriction or condition released to the public upon the issuance of a patent. These deposits are provided merely as convenience to those of skill in the art and are not an admission that a deposit is required under 35 U.S.C. §112. The sequence of the polynucleotides contained in the deposited materials, as well as the amino acid sequence of the polypeptides encoded thereby, are controlling in the event of any conflict with any description of sequences herein. A license may be required to make, use or sell the deposited materials, and no such license is hereby granted. References to "polynucleotides" throughout this specification includes the DNA of the deposit referred to above.

[0031]The polynucleotide of the present invention may be in the form of RNA or in the form of DNA, which DNA includes cDNA, genomic DNA, and synthetic DNA. The DNA may be double-stranded or single-stranded, and if single stranded may be the coding strand or non-coding (anti-sense) strand. The coding sequence which encodes the mature polypeptide may be identical to the coding sequence shown in FIGS. 1A-1D (SEQ ID NO:1) or may be a different coding sequence which coding sequence, as a result of the redundancy or degeneracy of the genetic code, encodes the same mature polypeptide as the DNA of FIGS. 1A-1D (SEQ ID NO:1).

[0032]The polynucleotide which encodes for the mature polypeptide of FIGS. 1A-1D (SEQ ID NO:2) may comprise, but is not limited to: nucleotide sequence coding for the mature polypeptide as shown in SEQ ID NO:2 as amino acids 26-448 or as encoded by the cDNA contained in ATCC® Deposit No. 97285; the coding sequence for the mature polypeptide and additional coding sequence such as a leader or secretory sequence or a proprotein sequence; the coding sequence for the mature polypeptide (and optionally additional coding sequence) and non-coding sequence, such as introns or non-coding sequence 5' and/or 3' of the coding sequence for the mature polypeptide.

[0033]Thus, the term "polynucleotide encoding a polypeptide" encompasses a polynucleotide which includes only coding sequence for the polypeptide as well as a polynucleotide which includes additional coding and/or non-coding sequence.

[0034]The present invention further relates to variants of the hereinabove described polynucleotides which encode for fragments, analogs and derivatives of the polypeptide having the deduced amino acid sequence of FIGS. 1A-1D (SEQ ID NO:2). The variant of the polynucleotide may be a naturally occurring allelic variant of the polynucleotide or a non-naturally occurring variant of the polynucleotide.

[0035]Thus, the present invention includes polynucleotides encoding the same mature polypeptide as shown in FIGS. 1A-1D (SEQ ID NO:2) as well as variants of such polynucleotides which variants encode for a fragment, derivative or analog of the polypeptide of FIGS. 1A-1D (SEQ ID NO:2). Such nucleotide variants include deletion variants, substitution variants and addition or insertion variants.

[0036]As hereinabove indicated, the polynucleotide may have a coding sequence which is a naturally occurring allelic variant of the coding sequence shown in FIGS. 1A-1D (SEQ ID NO:1). As known in the art, an allelic variant is an alternate form of a polynucleotide sequence which may have a substitution, deletion or addition of one or more nucleotides, which does not substantially alter the function of the encoded polypeptide.

[0037]The present invention also includes polynucleotides, wherein the coding sequence for the mature polypeptide may be fused in the same reading frame to a polynucleotide sequence which aids in expression and secretion of a polypeptide from a host cell, for example, a leader sequence which functions as a secretory sequence for controlling transport of a polypeptide from the cell. The polypeptide having a leader sequence is a preprotein and may have the leader sequence cleaved by the host cell to form the mature form of the polypeptide. The polynucleotides may also encode for a proprotein which is the mature protein plus additional 5' amino acid residues. A mature protein having a prosequence is a proprotein and is an inactive form of the protein. Once the prosequence is cleaved an active mature protein remains. Thus, for example, the polynucleotide of the present invention may encode for a mature protein, or for a protein having a prosequence or for a protein having both a prosequence and a presequence (leader sequence).

[0038]The polynucleotides of the present invention may also have the coding sequence fused in frame to a marker sequence which allows for purification of the polypeptide of the present invention. The marker sequence may be a hexa-histidine tag supplied by a pQE-9 vector to provide for purification of the mature polypeptide fused to the marker in the case of a bacterial host, or, for example, the marker sequence may be a hemagglutinin (HA) tag when a mammalian host, e.g. COS-7 cells, is used. The HA tag corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson, I., et al., Cell, 37:767 (1984)).

[0039]The term "gene" means the segment of DNA involved in producing a polypeptide chain; it includes regions preceding and following the coding region (leader and trailer) as well as intervening sequences (introns) between individual coding segments (exons).

[0040]Fragments of the full length EEGF gene may be used as a hybridization probe for a cDNA library to isolate the full length gene and to isolate other genes which have a high sequence similarity to the gene or similar biological activity. Probes of this type preferably have at least 30 bases and may contain, for example, 50 or more bases. The probe may also be used to identify a cDNA clone corresponding to a full length transcript and a genomic clone or clones that contain the complete EEGF gene including regulatory and promoter regions, exons, and introns. An example of a screen comprises isolating the coding region of the gene by using the known DNA sequence to synthesize an oligonucleotide probe. Labeled oligonucleotides having a sequence complementary to that of the gene of the present invention are used to screen a library of human cDNA, genomic DNA or mRNA to determine which members of the library the probe hybridizes to.

[0041]The present invention further relates to polynucleotides which hybridize to the hereinabove-described sequences if there is at least 70%, preferably at least 90%, and more preferably at least 95%, 96%, 97%, 98% or 99% identity between the sequences. The present invention particularly relates to polynucleotides which hybridize under stringent conditions to the hereinabove-described polynucleotides. As herein used, the term "stringent conditions" means hybridization will occur only if there is at least 95% and preferably at least 97% identity between the sequences. The polynucleotides which hybridize to the hereinabove described polynucleotides in a preferred embodiment encode polypeptides which either retain substantially the same biological function or activity as the mature polypeptide encoded by the cDNAs of FIGS. 1A-1D (SEQ ID NO:1). Such biological activity is known in the art and can be assayed by techniques known in the art. Particularly preferred techniques for assaying activity of a polypeptide of the invention include the EGF Receptor binding assays disclosed in Heath, et al., (1986) Proc. Natl. Acad. Sci. U.S.A. 83:6367 and Tam, et al., (1986) Proc. Natl. Acad. Sci. U.S.A. 83:8082, both of which are incorporated herein by reference.

[0042]Alternatively, the polynucleotide may have at least 15 bases, preferably at least 30 bases, and more preferably at least 50 bases which hybridize to a polynucleotide of the present invention and which has an identity thereto, as hereinabove described, and which may or may not retain activity. For example, such polynucleotides may be employed as probes for the polynucleotide of SEQ ID NO:1, for example, for recovery of the polynucleotide or as a diagnostic probe or as a PCR primer.

[0043]Thus, the present invention is directed to polynucleotides having at least a 70% identity, preferably at least 90% and more preferably at least a 95%, 96%, 97%, 98%, or 99% identity to a polynucleotide which encodes the polypeptide of SEQ ID NO:2 and polynucleotides complementary thereto as well as portions thereof, which portions have at least 15 consecutive bases preferably at least 30 consecutive bases and preferably at least 50 consecutive bases and to polypeptides encoded by such polynucleotides.

[0044]The present invention further relates to a polypeptide which has the deduced amino acid sequence of FIGS. 1A-1D (SEQ ID NO:2), as well as fragments, analogs and derivatives of such polypeptide.

[0045]The terms "fragment," "derivative" and "analog" when referring to the polypeptide of FIGS. 1A-1D (SEQ ID NO:2), means a polypeptide which retains essentially the same biological function or activity as such polypeptide. Thus, an analog includes a proprotein which can be activated by cleavage of the proprotein portion to produce an active mature polypeptide.

[0046]The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide or a synthetic polypeptide, preferably a recombinant polypeptide.

[0047]The fragment, derivative or analog of the polypeptide of FIGS. 1A-1D (SEQ ID NO:2) may be (i) one in which one or more of the amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code, or (ii) one in which one or more of the amino acid residues includes a substituent group, or (iii) one in which the mature polypeptide is fused with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol), or (iv) one in which the additional amino acids are fused to the mature polypeptide, such as a leader or secretory sequence or a sequence which is employed for purification of the mature polypeptide or a proprotein sequence. Such fragments, derivatives and analogs are deemed to be within the scope of those skilled in the art from the teachings herein.

[0048]Preferred EEGF polypeptides are those comprising one or more of the EEGF EGF domains. Such domains are shown in FIGS. 1A-1D (SEQ ID NO:2) as follows: EGF-1 comprises amino acids 112-153 of SEQ ID NO:2; EGF-2 comprises amino acids 154-190 of SEQ ID NO:2; EGF-3 comprises amino acids 191-230 of SEQ ID NO:2; EGF-4 comprises amino acids 231-271 of SEQ ID NO:2; and EGF-5 comprises amino acids 272-314 of SEQ ID NO:2. Polynucleotides encoding such polypeptides are also provided.

[0049]A particularly preferred EEGF polypeptide of the invention includes amino acids 57-448 of SEQ ID NO:2 or the polypeptide encoded by the cDNA contained in ATCC® Deposit No. 97285. Polynucleotides encoding this preferred polypeptide are also provided.

[0050]The polypeptides and polynucleotides of the present invention are preferably provided in an isolated form, and preferably are purified to homogeneity.

[0051]The term "isolated" means that the material is removed from its original environment (e.g., the natural environment if it is naturally occurring). For example, a naturally-occurring polynucleotide or polypeptide present in a living animal is not isolated, but the same polynucleotide or polypeptide, separated from some or all of the coexisting materials in the natural system, is isolated. Such polynucleotides could be part of a vector and/or such polynucleotides or polypeptides could be part of a composition, and still be isolated in that such vector or composition is not part of its natural environment.

[0052]The polypeptides of the present invention include the polypeptide of SEQ ID NO:2 (in particular the mature polypeptide) as well as polypeptides which have at least 70% similarity (preferably at least 70% identity) to the polypeptide of SEQ ID NO:2 and more preferably at least 90% similarity (more preferably at least 90% identity) to the polypeptide of SEQ ID NO:2 and still more preferably at least 95% similarity (still more preferably at least 95%, 96%, 97%, 98%, or 99% identity) to the polypeptide of SEQ ID NO:2 and also include portions of such polypeptides with such portion of the polypeptide generally containing at least 30 amino acids and more preferably at least 50 amino acids.

[0053]As known in the art "similarity" between two polypeptides is determined by comparing the amino acid sequence and its conserved amino acid substitutes of one polypeptide to the sequence of a second polypeptide.

[0054]Fragments or portions of the polypeptides of the present invention may be employed for producing the corresponding full-length polypeptide by peptide synthesis; therefore, the fragments may be employed as intermediates for producing the full-length polypeptides. Fragments or portions of the polynucleotides of the present invention may be used to synthesize full-length polynucleotides of the present invention.

[0055]The present invention also relates to vectors which include polynucleotides of the present invention, host cells which are genetically engineered with vectors of the invention and the production of polypeptides of the invention by recombinant techniques.

[0056]Host cells are genetically engineered (transduced or transformed or transfected) with the vectors of this invention which may be, for example, a cloning vector or an expression vector. The vector may be, for example, in the form of a plasmid, a viral particle, a phage, etc. The engineered host cells can be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformants or amplifying the genes of the present invention. The culture conditions, such as temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan.

[0057]The polynucleotides of the present invention may be employed for producing polypeptides by recombinant techniques. Thus, for example, the polynucleotide may be included in any one of a variety of expression vectors for expressing a polypeptide. Such vectors include chromosomal, nonchromosomal and synthetic DNA sequences, e.g., derivatives of SV40; bacterial plasmids; phage DNA; baculovirus; yeast plasmids; vectors derived from combinations of plasmids and phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox virus, and pseudorabies. However, any other vector may be used as long as it is replicable and viable in the host.

[0058]The appropriate DNA sequence may be inserted into the vector by a variety of procedures. In general, the DNA sequence is inserted into an appropriate restriction endonuclease site(s) by procedures known in the art. Such procedures and others are deemed to be within the scope of those skilled in the art.

[0059]The DNA sequence in the expression vector is operatively linked to an appropriate expression control sequence(s) (promoter) to direct mRNA synthesis. As representative examples of such promoters, there may be mentioned: LTR or SV40 promoter, the E. coli. lac or trp, the phage lambda PL promoter and other promoters known to control expression of genes in prokaryotic or eukaryotic cells or their viruses. The expression vector also contains a ribosome binding site for translation initiation and a transcription terminator. The vector may also include appropriate sequences for amplifying expression.

[0060]In addition, the expression vectors preferably contain one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells such as dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, or such as tetracycline or ampicillin resistance in E. coli.

[0061]The vector containing the appropriate DNA sequence as hereinabove described, as well as an appropriate promoter or control sequence, may be employed to transform an appropriate host to permit the host to express the protein.

[0062]As representative examples of appropriate hosts, there may be mentioned: bacterial cells, such as E. coli, Streptomyces, Salmonella typhimurium; fungal cells, such as yeast; insect cells such as Drosophila S2 and Spodoptera Sf9; animal cells such as CHO, COS or Bowes melanoma; adenoviruses; plant cells, etc. The selection of an appropriate host is deemed to be within the scope of those skilled in the art from the teachings herein.

[0063]More particularly, the present invention also includes recombinant constructs comprising one or more of the sequences as broadly described above. The constructs comprise a vector, such as a plasmid or viral vector, into which a sequence of the invention has been inserted, in a forward or reverse orientation. In a preferred aspect of this embodiment, the construct further comprises regulatory sequences, including, for example, a promoter, operably linked to the sequence. Large numbers of suitable vectors and promoters are known to those of skill in the art, and are commercially available. The following vectors are provided by way of example; Bacterial: pQE70, pQE60, pQE-9 (Qiagen), pBS, pD10, phagescript, psiX174, pBLUESCRIPT® SK, pbsks, pNH8A, pNH16a, pNH18A, pNH46A (STRATAGENE®); ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 (PHARMACIA®); Eukaryotic: pWLNEO, pSV2CAT, pOG44, pXT1, pSG (STRATAGENE®) pSVK3, pBPV, pMSG, pSVL (PHARMACIA®). However, any other plasmid or vector may be used as long as they are replicable and viable in the host.

[0064]Promoter regions can be selected from any desired gene using CAT (chloramphenicol transferase) vectors or other vectors with selectable markers. Two appropriate vectors are pKK232-8 and pCM7. Particular named bacterial promoters include lacI, lacZ, T3, T7, gpt, lambda PR, PL and trp. Eukaryotic promoters include CMV immediate early, HSV thymidine kinase, early and late SV40, LTRs from retrovirus, and mouse metallothionein-I. Selection of the appropriate vector and promoter is well within the level of ordinary skill in the art.

[0065]In a further embodiment, the present invention relates to host cells containing the above-described constructs. The host cell can be a higher eukaryotic cell, such as a mammalian cell, or a lower eukaryotic cell, such as a yeast cell, or the host cell can be a prokaryotic cell, such as a bacterial cell. Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE-Dextran mediated transfection, or electroporation (Davis, L., Dibner, M., Battey, I., Basic Methods in Molecular Biology, (1986)).

[0066]The constructs in host cells can be used in a conventional manner to produce the gene product encoded by the recombinant sequence. Alternatively, the polypeptides of the invention can be synthetically produced by conventional peptide synthesizers.

[0067]Mature proteins can be expressed in mammalian cells, yeast, bacteria, or other cells under the control of appropriate promoters. Cell-free translation systems can also be employed to produce such proteins using RNAs derived from the DNA constructs of the present invention. Appropriate cloning and expression vectors for use with prokaryotic and eukaryotic hosts are described by Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, N.Y., (1989), the disclosure of which is hereby incorporated by reference.

[0068]Transcription of the DNA encoding the polypeptides of the present invention by higher eukaryotes is increased by inserting an enhancer sequence into the vector. Enhancers are cis-acting elements of DNA, usually about from 10 to 300 bp that act on a promoter to increase its transcription. Examples including the SV40 enhancer on the late side of the replication origin bp 100 to 270, a cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.

[0069]Generally, recombinant expression vectors will include origins of replication and selectable markers permitting transformation of the host cell, e.g., the ampicillin resistance gene of E. coli and S. cerevisiae TRP1 gene, and a promoter derived from a highly-expressed gene to direct transcription of a downstream structural sequence. Such promoters can be derived from operons encoding glycolytic enzymes such as 3-phosphoglycerate kinase (PGK), α-factor, acid phosphatase, or heat shock proteins, among others. The heterologous structural sequence is assembled in appropriate phase with translation initiation and termination sequences, and preferably, a leader sequence capable of directing secretion of translated protein into the periplasmic space or extracellular medium. Optionally, the heterologous sequence can encode a fusion protein including an N-terminal identification peptide imparting desired characteristics, e.g., stabilization or simplified purification of expressed recombinant product.

[0070]Useful expression vectors for bacterial use are constructed by inserting a structural DNA sequence encoding a desired protein together with suitable translation initiation and termination signals in operable reading phase with a functional promoter. The vector will comprise one or more phenotypic selectable markers and an origin of replication to ensure maintenance of the vector and to, if desirable, provide amplification within the host. Suitable prokaryotic hosts for transformation include E. coli, Bacillus subtilis, Salmonella typhimurium and various species within the genera Pseudomonas, Streptomyces, and Staphylococcus, although others may also be employed as a matter of choice.

[0071]As a representative but nonlimiting example, useful expression vectors for bacterial use can comprise a selectable marker and bacterial origin of replication derived from commercially available plasmids comprising genetic elements of the well known cloning vector pBR322 (ATCC® 37017). Such commercial vectors include, for example, pKK223-3 (PHARMACIA® Fine Chemicals, Uppsala, Sweden) and GEM1 (PROMEGA® Biotec, Madison, Wis., USA). These pBR322 "backbone" sections are combined with an appropriate promoter and the structural sequence to be expressed.

[0072]Following transformation of a suitable host strain and growth of the host strain to an appropriate cell density, the selected promoter is induced by appropriate means (e.g., temperature shift or chemical induction) and cells are cultured for an additional period.

[0073]Cells are typically harvested by centrifugation, disrupted by physical or chemical means, and the resulting crude extract retained for further purification.

[0074]Microbial cells employed in expression of proteins can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents, such methods are well known to those skilled in the art.

[0075]Various mammalian cell culture systems can also be employed to express recombinant protein. Examples of mammalian expression systems include the COS-7 lines of monkey kidney fibroblasts, described by Gluzman, Cell, 23:175 (1981), and other cell lines capable of expressing a compatible vector, for example, the C127, 3T3, CHO, HeLa and BHK cell lines. Mammalian expression vectors will comprise an origin of replication, a suitable promoter and enhancer, and also any necessary ribosome binding sites, polyadenylation site, splice donor and acceptor sites, transcriptional termination sequences, and 5' flanking nontranscribed sequences. DNA sequences derived from the SV40 splice, and polyadenylation sites may be used to provide the required nontranscribed genetic elements.

[0076]The polypeptides can be recovered and purified from recombinant cell cultures by methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Protein refolding steps can be used, as necessary, in completing configuration of the mature protein. Finally, high performance liquid chromatography (HPLC) can be employed for final purification steps.

[0077]The polypeptides of the present invention may be a naturally purified product, or a product of chemical synthetic procedures, or produced by recombinant techniques from a prokaryotic or eukaryotic host (for example, by bacterial, yeast, higher plant, insect and mammalian cells in culture). Depending upon the host employed in a recombinant production procedure, the polypeptides of the present invention may be glycosylated or may be non-glycosylated. Polypeptides of the invention may also include an initial methionine amino acid residue.

[0078]The polynucleotides and polypeptides of the present invention may be employed as research reagents and materials for discovery of treatments and diagnostics for human disease.

[0079]The polypeptide of the present invention may be employed to regulate vascular smooth muscle cell proliferation.

[0080]The polypeptide of the present invention may also be employed for characterization of receptors. The EGF family of receptors currently includes four EGF receptors, denoted as EGFR1, EGFR2, EGFR3 and EGFR4. The EGFR2 receptor may also be referred to as ERB-2 and this molecule is useful for a variety of diagnostic and therapeutic indications (Prigent, S. A., and Lemoine, N. R., Prog Growth Factor Res., 4:1-24 (1992)). The EEGF polypeptide is likely a ligand for one or more of these receptors as well as for an unidentified new EGF-type receptor. Use of the EEGF can assist with the identification, characterization and cloning of such receptors. For example, the EGF receptor gene represents the cellular homolog of the v-erb-B oncogene of avian erythroblastosis virus. Over expression of the EGF-receptor or deletion of kinase regulatory segments of the protein can bring about tumorigenic transformation of cells (Manjusri, D. et al., Human Cytokines, 364 and 381 (1991)).

[0081]The polypeptides of the present invention may also be employed for restoration or enhancement of neurological functions diminished as a result of trauma or other damaging pathologies (such as AIDS dementia, senile dementia, etc). TGFα and its homologs have been found to be the most abundant ligand for the EGF/TGFα receptor in most parts of the brain (Kaser, et al., Mol Brain Res: 16:316-322, (1992)). EEGF or soluble form thereof may also be employed to treat ocular disorders, for example, corneal inflammation. A variety of experiments have implicated members of the TGFα gene family in such pathologies. A recent paper summarizes some of the data related to the role these growth factors play in eye disease (Mann, et al, Cell, 73:249-261 (1993)). Recent experiments have shown that a number of mice lacking the TGFα gene displayed corneal inflammation due to an infiltration of leukocytes and other cells to the substantia propria of the eyes.

[0082]In addition, the specificity of certain growth factors for their target cells can be exploited as a mechanism to destroy the target cell. For example, EEGF or soluble forms thereof can be coupled, by a wide variety of methods known in the art, to toxic molecules: for example, a radiopharmaceutical which inactivate target cells. These growth factor-toxin fusions kill the target cell (and in certain cases neighboring cells by a variety of "bystander" effects). A recent example of such toxin-fusion genes is published by Mesri, et al., J. Biol. Chem. 268:4853-62 (1993). EEGF and related molecules may also be encapsulated in liposomes and may be conjugated to antibodies which recognize and bind to tumor or cell specific antigens, thereby provided a means for "targeting" cells.

[0083]The EEGF polypeptide may also be employed to treat certain kidney disorders, since it has been found that there has been expression of these growth factors in the kidney. Thus, these factors may be necessary for the proper physiological maintenance of this organ. Treatments may also be related to liver regeneration or liver dysfunction.

[0084]A significant treatment involving EEGF relates to wound healing. The compositions of the present invention may be employed for treating a wide variety of wounds including substantially all cutaneous wounds, corneal wounds, and injuries to the epithelial-lined hollow organs of the body. Wounds suitable for treatment include those resulting from trauma such as burns, abrasions and cuts, as well as from surgical procedures such as surgical incisions and skin grafting. Other conditions suitable for treatment with the polypeptide of the present invention include chronic conditions, such as chronic ulcers, diabetic ulcers, other non-healing (trophic) conditions, to treat Marfan syndrome, to promote hair follicular development, to stimulate growth and differentiation of various epidermal and epithelial cells in vivo and in vitro and to stimulate embryogenesis.

[0085]EEGF or soluble fragment thereof may be incorporated in physiologically-acceptable carriers for application to the affected area. The nature of the carriers may vary widely and will depend on the intended location of application. For application to the skin, a cream or ointment base is usually preferred; suitable bases include lanolin, Silvadene (Marion) (particularly for the treatment of burns), Aquaphor (Duke Laboratories, South Norwalk, Conn.), and the like. If desired, it will be possible to incorporate EEGF containing compositions in bandages and other wound dressings to provide for continuous exposure of the wound to the peptide. Aerosol applications may also find use.

[0086]The concentration of EEGF in the treatment composition is not critical but should be enough to induce epithelial cell proliferation. The compositions may be applied topically to the affected area, typically as eye drops to the eye or as creams, ointments or lotions to the skin. In the case of the eyes, frequent treatment is desirable, usually being applied at intervals of 4 hours or less. On the skin, it is desirable to continually maintain the treatment composition on the affected area during the healing, with applications of the treatment composition from two to four times a day or more frequently.

[0087]The amount employed of the subject polypeptide will vary with the manner of administration, the employment of other active compounds, and the like, generally being in the range of about 1 mg to 100 mg. The subject polypeptide may be employed with a physiologically acceptable carrier, such as saline, phosphate-buffered saline, or the like. The amount of compound employed will be determined empirically, based on the response of cells in vitro and response of experimental animals to the subject polypeptides or formulations containing the subject polypeptides.

[0088]The EEGF or soluble fragment thereof may be employed in the modulation of angiogenesis, bone resorption, immune response, and synaptic and neuronal effector functions. EEGF may also be used in the modulation of the arachidonic acid cascade.

[0089]Applications are also related to alopecia, hair loss and to other skin conditions which affect hair follicular development. Several lines of evidence implicate the involvement of growth factors in such conditions. As described above, "knockout" mice engineered to contain a null mutation in the TGFα gene display abnormalities related to quantitative and qualitative hair synthesis. In addition, mapping studies in mice have shown that some mutations affecting hair growth map to the TGFα gene locus (Mann et al, Cell, 73:249-261(1993)). Topical or systemic applications of EEGF or derivatives thereof may be employed to treat some forms of alopecia and hair loss and these claims fall within the scope of this invention.

[0090]Certain disease pathologies may be partially or completely ameliorated by the systemic clinical administration of the EEGF growth factor. This administration can be in the form of gene therapy (see below); or through the administration of peptides or proteins synthesized from recombinant constructs of EEGF DNA or from peptide chemical synthesis (Woo, et al., Protein Engineering 3:29-37 (1989).

[0091]This invention provides a method for identification of EEGF receptors. The gene encoding a receptor can be identified by numerous methods known to those of skill in the art, for example, ligand panning and FACS sorting (Coligan, et al., Current Protocols in Immun., 1(2), Chapter 5, (1991)). Preferably, expression cloning is employed wherein polyadenylated RNA is prepared from a cell responsive to EEGF, and a cDNA library created from this RNA is divided into pools and used to transfect COS cells or other cells that are not responsive to EEGF. Transfected cells which are grown on glass slides are exposed to labeled EEGF, which can be labeled by a variety of means including iodination or inclusion of a recognition site for a site-specific protein kinase. Following fixation and incubation, the slides are subjected to auto-radiographic analysis. Positive pools are identified and sub-pools are prepared and re-transfected using an iterative sub-pooling and re-screening process, eventually yielding a single clone that encodes the putative receptor. As an alternative approach for receptor identification, labeled ligand can be photoaffinity linked with cell membrane or extract preparations that express the receptor molecule. Cross-linked material is resolved by PAGE and exposed to X-ray film. The labeled complex containing the ligand-receptor can be excised, resolved into peptide fragments, and subjected to protein microsequencing. The amino acid sequence obtained from microsequencing would be used to design a set of degenerate oligonucleotide probes to screen a cDNA library to identify the gene encoding the putative receptor.

[0092]This invention also provides a method of screening compounds to identify antagonist compounds to the polypeptide of the present invention. As an example, a mammalian cell or membrane preparation expressing a EEGF receptor is incubated with EEGF and a potential antagonist compound and the ability of the compound to inhibit a second signal from the receptor is measured to determine if it is an effective antagonist. Such second messenger systems include but are not limited to, cAMP guanylate cyclase, ion channels or phosphoinositide hydrolysis.

[0093]Another assay for identifying potential antagonists specific to the receptors to the polypeptide of the present invention is a competition assay which comprises isolating plasma membranes which over-express a receptor to the polypeptide of the present invention, for example, human A431 carcinoma cells. Serially diluted test sample in a medium (volume is approximately 10 microliters) containing 10 nM 125I-EEGF is added to five micrograms of the plasma membrane in the presence of the potential antagonist compound and incubated for 4 hours at 4° C. The reaction mixtures are diluted and immediately passed through a millipore filter. The filters are then rapidly washed and the bound radioactivity is measured in a gamma counter. The amount of bound EEGF is then measured. A control assay is also performed in the absence of the compound to determine if the antagonists reduce the amount of bound EEGF.

[0094]Potential antagonist compounds include an antibody, or in some cases, an oligopeptide, which binds to the polypeptide. Alternatively, a potential antagonist may be a closely related protein which binds to the receptor which is an inactive forms of the polypeptide and thereby prevent the action of the polypeptide of the present invention.

[0095]Another antagonist compound is an antisense construct prepared using antisense technology. Antisense technology can be used to control gene expression through triple-helix formation or antisense DNA or RNA, both of which methods are based on binding of a polynucleotide to DNA or RNA. For example, the 5' coding portion of the polynucleotide sequence, which encodes for the mature polypeptides of the present invention, is used to design an antisense RNA oligonucleotide of from about 10 to 40 base pairs in length. A DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription (triple helix--see Lee et al., Nucl. Acids Res., 6:3073 (1979); Cooney et al, Science, 241:456 (1988); and Dervan et al., Science, 251: 1360 (1991)), thereby preventing transcription and the production of the polypeptide of the present invention. The antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into the polypeptide of the present invention (Antisense--Okano, J. Neurochem., 56:560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, Fla. (1988)). The oligonucleotides described above can also be delivered to cells such that the antisense RNA or DNA may be expressed in vivo to inhibit production of the polypeptide of the present invention.

[0096]Antagonist compounds include a small molecule which binds to the polypeptide of the present invention and blocks its action at the receptor such that normal biological activity is prevented. The small molecules may also bind the receptor to the polypeptide to prevent binding. Examples of small molecules include but are not limited to small peptides or peptide-like molecules.

[0097]The antagonists may be employed to treat neoplasia, for example, cancers and tumors. It is known that inhibition of secretion or production of members of the EGF family by tumor cells in mice causes regression of tumors, since these proteins stimulate induction of DNA synthesis in all cells including neoplastic cells.

[0098]The antagonists to the polypeptides of the present invention may also be used therapeutically for the treatment of certain skin disorders, for example, psoriasis. Elevated levels of expression of members of this family of growth factors in skin biopsies taken from diseases such as psoriatic lesions have been found to be elevated (Cook, et al., Cancer Research, 52:3224-3227 (1992)). The antagonists may be employed in a composition with a pharmaceutically acceptable carrier, e.g., as hereinafter described.

[0099]The polypeptides of the present invention or agonist or antagonist compounds may be employed in combination with a suitable pharmaceutical carrier. Such compositions comprise a therapeutically effective amount of the polypeptide or compound, and a pharmaceutically acceptable carrier or excipient. Such a carrier includes but is not limited to saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. The formulation should suit the mode of administration.

[0100]The invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention. Associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration. In addition, the polypeptides or compounds of the present invention may be employed in conjunction with other therapeutic compounds.

[0101]The pharmaceutical compositions may be administered in a convenient manner such as by the oral, topical, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal routes. The pharmaceutical compositions are administered in an amount which is effective for treating and/or prophylaxis of the specific indication. In general, they are administered in an amount of at least about 10 μg/kg body weight and in most cases they will be administered in an amount not in excess of about 8 mg/Kg body weight per day. In most cases, the dosage is from about 10 μg/kg to about 1 mg/kg body weight daily, taking into account the routes of administration, symptoms, etc.

[0102]The polypeptides, and agonists and antagonists which are polypeptides, may also be employed in accordance with the present invention by expression of such polypeptides in vivo, which is often referred to as "gene therapy."

[0103]Thus, for example, cells from a patient may be engineered with a polynucleotide (DNA or RNA) encoding a polypeptide ex vivo, with the engineered cells then being provided to a patient to be treated with the polypeptide. Such methods are well-known in the art and are apparent from the teachings herein. For example, cells may be engineered by the use of a retroviral plasmid vector containing RNA encoding a polypeptide of the present invention.

[0104]Similarly, cells may be engineered in vivo for expression of a polypeptide in vivo by, for example, procedures known in the art. For example, a packaging cell is transduced with a retroviral plasmid vector containing RNA encoding a polypeptide of the present invention such that the packaging cell now produces infectious viral particles containing the gene of interest. These producer cells may be administered to a patient for engineering cells in vivo and expression of the polypeptide in vivo. These and other methods for administering a polypeptide of the present invention by such method should be apparent to those skilled in the art from the teachings of the present invention.

[0105]Retroviruses from which the retroviral plasmid vectors hereinabove mentioned may be derived include, but are not limited to, Moloney Murine Leukemia Virus, spleen necrosis virus, retroviruses such as Rous Sarcoma Virus, Harvey Sarcoma Virus, avian leukosis virus, gibbon ape leukemia virus, human immunodeficiency virus, adenovirus, Myeloproliferative Sarcoma Virus, and mammary tumor virus. In one embodiment, the retroviral plasmid vector is derived from Moloney Murine Leukemia Virus.

[0106]The vector includes one or more promoters. Suitable promoters which may be employed include, but are not limited to, the retroviral LTR; the SV40 promoter; and the human cytomegalovirus (CMV) promoter described in Miller, et al., Biotechniques, Vol. 7, No. 9, 980-990 (1989), or any other promoter (e.g., cellular promoters such as eukaryotic cellular promoters including, but not limited to, the histone, pol III, and b-actin promoters). Other viral promoters which may be employed include, but are not limited to, adenovirus promoters, thymidine kinase (TK) promoters, and B19 parvovirus promoters. The selection of a suitable promoter will be apparent to those skilled in the art from the teachings contained herein.

[0107]The nucleic acid sequence encoding the polypeptide of the present invention is under the control of a suitable promoter. Suitable promoters which may be employed include, but are not limited to, adenoviral promoters, such as the adenoviral major late promoter; or heterologous promoters, such as the cytomegalovirus (CMV) promoter; the respiratory syncytial virus (RSV) promoter; inducible promoters, such as the MMT promoter, the metallothionein promoter; heat shock promoters; the albumin promoter; the ApoAI promoter; human globin promoters; viral thymidine kinase promoters, such as the Herpes Simplex thymidine kinase promoter; retroviral LTRs (including the modified retroviral LTRs hereinabove described); the β-actin promoter; and human growth hormone promoters. The promoter also may be the native promoter which controls the gene encoding the polypeptide.

[0108]The retroviral plasmid vector is employed to transduce packaging cell lines to form producer cell lines. Examples of packaging cells which may be transfected include, but are not limited to, the PE501, PA317, ψ-2, ψ-AM, PA12, T19-14X, VT-19-17-H2, ψCRE, ψCRIP, G+E-86, GP+envAm12, and DAN cell lines as described in Miller, Human Gene Therapy, Vol. 1, pgs. 5-14 (1990), which is incorporated herein by reference in its entirety. The vector may transduce the packaging cells through any means known in the art. Such means include, but are not limited to, electroporation, the use of liposomes, and CaPO4 precipitation. In one alternative, the retroviral plasmid vector may be encapsulated into a liposome, or coupled to a lipid, and then administered to a host.

[0109]The producer cell line generates infectious retroviral vector particles which include the nucleic acid sequence(s) encoding the polypeptides. Such retroviral vector particles then may be employed, to transduce eukaryotic cells, either in vitro or in vivo. The transduced eukaryotic cells will express the nucleic acid sequence(s) encoding the polypeptide. Eukaryotic cells which may be transduced include, but are not limited to, embryonic stem cells, embryonic carcinoma cells, as well as hematopoietic stem cells, hepatocytes, fibroblasts, myoblasts, keratinocytes, endothelial cells, and bronchial epithelial cells.

[0110]This invention is also related to the use of the gene of the present invention as a diagnostic. Detection of a mutated form of the gene of the present invention will allow a diagnosis of a disease or a susceptibility to a disease which results from underexpression of the polypeptide of the present invention, for example, improper wound healing, improper neurological functioning, ocular disorders, kidney and liver disorders, hair follicular development, angiogenesis and embryogenesis.

[0111]Individuals carrying mutations in the human gene of the present invention may be detected at the DNA level by a variety of techniques. Nucleic acids for diagnosis may be obtained from a patient's cells, such as from blood, urine, saliva, tissue biopsy and autopsy material. The genomic DNA may be used directly for detection or may be amplified enzymatically by using PCR (Saiki et al., Nature, 324:163-166 (1986)) prior to analysis. RNA or cDNA may also be used for the same purpose. As an example, PCR primers complementary to the nucleic acid encoding a polypeptide of the present invention can be used to identify and analyze mutations thereof. For example, deletions and insertions can be detected by a change in size of the amplified product in comparison to the normal genotype. Point mutations can be identified by hybridizing amplified DNA to radiolabeled RNA or alternatively, radiolabeled antisense DNA sequences. Perfectly matched sequences can be distinguished from mismatched duplexes by RNase A digestion or by differences in melting temperatures.

[0112]Sequence differences between the reference gene and genes having mutations may be revealed by the direct DNA sequencing method. In addition, cloned DNA segments may be employed as probes to detect specific DNA segments. The sensitivity of this method is greatly enhanced when combined with PCR. For example, a sequencing primer is used with double-stranded PCR product or a single-stranded template molecule generated by a modified PCR. The sequence determination is performed by conventional procedures with radiolabeled nucleotide or by automatic sequencing procedures with fluorescent-tags.

[0113]Genetic testing based on DNA sequence differences may be achieved by detection of alteration in electrophoretic mobility of DNA fragments in gels with or without denaturing agents. Small sequence deletions and insertions can be visualized by high resolution gel electrophoresis. DNA fragments of different sequences may be distinguished on denaturing formamide gradient gels in which the mobilities of different DNA fragments are retarded in the gel at different positions according to their specific melting or partial melting temperatures (see, e.g., Myers et al., Science, 230:1242 (1985)).

[0114]Sequence changes at specific locations may also be revealed by nuclease protection assays, such as RNase and S1 protection or the chemical cleavage method (e.g., Cotton et al., PNAS, USA, 85:4397-4401 (1985)).

[0115]Thus, the detection of a specific DNA sequence may be achieved by methods such as hybridization, RNase protection, chemical cleavage, direct DNA sequencing or the use of restriction enzymes, (e.g., Restriction Fragment Length Polymorphisms (RFLP)) and Southern blotting of genomic DNA.

[0116]In addition to more conventional gel-electrophoresis and DNA sequencing, mutations can also be detected by in situ analysis.

[0117]The present invention also relates to diagnostic assays for detecting altered levels of the polypeptide of the present invention in various tissues since an over-expression of the proteins compared to normal control tissue samples can detect the presence of certain disease conditions such as neoplasia, skin disorders, ocular disorders and inflammation. Assays used to detect levels of the polypeptide of the present invention in a sample derived from a host are well-known to those of skill in the art and include radioimmunoassays, competitive-binding assays, Western Blot analysis and preferably an ELISA assay. An ELISA assay initially comprises preparing an antibody specific to an antigen of the polypeptide of the present invention, preferably a monoclonal antibody. In addition a reporter antibody is prepared against the monoclonal antibody. To the reporter antibody is attached a detectable reagent such as radioactivity, fluorescence or in this example a horseradish peroxidase enzyme. A sample is now removed from a host and incubated on a solid support, e.g. a polystyrene dish, that binds the proteins in the sample. Any free protein binding sites on the dish are then covered by incubating with a non-specific protein such as bovine serum albumin. Next, the monoclonal antibody is incubated in the dish during which time the monoclonal antibodies attach to any polypeptides of the present invention attached to the polystyrene dish. All unbound monoclonal antibody is washed out with buffer. The reporter antibody linked to horseradish peroxidase is now placed in the dish resulting in binding of the reporter antibody to any monoclonal antibody bound to polypeptides of the present invention. Unattached reporter antibody is then washed out. Peroxidase substrates are then added to the dish and the amount of color developed in a given time period is a measurement of the amount of protein present in a given volume of patient sample when compared against a standard curve.

[0118]A competition assay may also be employed to determine levels of the polypeptide of the present invention in a sample derived from the hosts. Such an assay comprises isolating plasma membranes which over-express the receptor for the polypeptide of the present invention. A test sample containing the polypeptides of the present invention which have been labeled, are then added to the plasma membranes and then incubated for a set period of time. Also added to the reaction mixture is a sample derived from a host which is suspected of containing the polypeptide of the present invention. The reaction mixtures are then passed through a filter which is rapidly washed and the bound radioactivity is then measured to determine the amount of competition for the receptors and therefore the amount of the polypeptides of the present invention in the sample.

[0119]Antibodies specific to EEGF may be used for cancer diagnosis and therapy, since many types of cancer cells up-regulate various members of the TGFα family during the process of neoplasia or hyperplasia. These antibodies bind to and inactivate EEGF. Monoclonal antibodies against EEGF (and/or its family members) are in clinical use for both the diagnosis and therapy of certain disorders including (but not limited to) hyperplastic and neoplastic growth abnormalities. Upregulation of growth factor expression by neoplastic tissues forms the basis for a variety of serum assays which detect increases in growth factor in the blood of affected patients. These assays are typically applied not only in diagnostic settings, but are applied in prognostic settings as well (to detect the presence of occult tumor cells following surgery, chemotherapy, etc).

[0120]In addition, malignant cells expressing the EEGF receptor may be detected by using labeled EEGF in a receptor binding assay, or by the use of antibodies to the EEGF receptor itself. Cells may be distinguished in accordance with the presence and density of receptors for EEGF, thereby providing a means for predicting the susceptibility of such cells to the biological activities of EEGF.

[0121]The sequences of the present invention are also valuable for chromosome identification. The sequence is specifically targeted to and can hybridize with a particular location on an individual human chromosome. Moreover, there is a current need for identifying particular sites on the chromosome. Few chromosome marking reagents based on actual sequence data (repeat polymorphisms) are presently available for marking chromosomal location. The mapping of DNAs to chromosomes according to the present invention is an important first step in correlating those sequences with genes associated with disease.

[0122]Briefly, sequences can be mapped to chromosomes by preparing PCR primers (preferably 15-25 bp) from the cDNA. Computer analysis of the 3' untranslated region of the gene is used to rapidly select primers that do not span more than one exon in the genomic DNA, thus complicating the amplification process. These primers are then used for PCR screening of somatic cell hybrids containing individual human chromosomes. Only those hybrids containing the human gene corresponding to the primer will yield an amplified fragment.

[0123]PCR mapping of somatic cell hybrids is a rapid procedure for assigning a particular DNA to a particular chromosome. Using the present invention with the same oligonucleotide primers, sublocalization can be achieved with panels of fragments from specific chromosomes or pools of large genomic clones in an analogous manner. Other mapping strategies that can similarly be used to map to its chromosome include in situ hybridization, prescreening with labeled flow-sorted chromosomes and preselection by hybridization to construct chromosome specific-cDNA libraries.

[0124]Fluorescence in situ hybridization (FISH) of a cDNA clone to a metaphase chromosomal spread can be used to provide a precise chromosomal location in one step. This technique can be used with cDNA as short as 50 or 60 bases. For a review of this technique, see Verma et al., Human Chromosomes: a Manual of Basic Techniques, Pergamon Press, New York (1988).

[0125]Once a sequence has been mapped to a precise chromosomal location, the physical position of the sequence on the chromosome can be correlated with genetic map data. Such data are found, for example, in V. McKusick, Mendelian Inheritance in Man (available on line through Johns Hopkins University Welch Medical Library). The relationship between genes and diseases that have been mapped to the same chromosomal region are then identified through linkage analysis (coinheritance of physically adjacent genes).

[0126]Next, it is necessary to determine the differences in the cDNA or genomic sequence between affected and unaffected individuals. If a mutation is observed in some or all of the affected individuals but not in any normal individuals, then the mutation is likely to be the causative agent of the disease.

[0127]With current resolution of physical mapping and genetic mapping techniques, a cDNA precisely localized to a chromosomal region associated with the disease could be one of between 50 and 500 potential causative genes. (This assumes 1 megabase mapping resolution and one gene per 20 kb).

[0128]The polypeptides, their fragments or other derivatives, or analogs thereof, or cells expressing them can be used as an immunogen to produce antibodies thereto. These antibodies can be, for example, polyclonal or monoclonal antibodies. The present invention also includes chimeric, single chain, and humanized antibodies, as well as Fab fragments, or the product of an Fab expression library. Various procedures known in the art may be used for the production of such antibodies and fragments.

[0129]Antibodies generated against the polypeptides corresponding to a sequence of the present invention can be obtained by direct injection of the polypeptides into an animal or by administering the polypeptides to an animal, preferably a nonhuman. The antibody so obtained will then bind the polypeptides itself. In this manner, even a sequence encoding only a fragment of the polypeptides can be used to generate antibodies binding the whole native polypeptides. Such antibodies can then be used to isolate the polypeptide from tissue expressing that polypeptide.

[0130]For preparation of monoclonal antibodies, any technique which provides antibodies produced by continuous cell line cultures can be used. Examples include the hybridoma technique (Kohler and Milstein, 1975, Nature, 256:495-497), the trioma technique, the human B-cell hybridoma technique (Kozbor et al., 1983, Immunology Today 4:72), and the EBV-hybridoma technique to produce human monoclonal antibodies (Cole, et al., 1985, in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96).

[0131]Techniques described for the production of single chain antibodies (U.S. Pat. No. 4,946,778) can be adapted to produce single chain antibodies to immunogenic polypeptide products of this invention. Also, transgenic mice may be used to express humanized antibodies to immunogenic polypeptide products of this invention.

[0132]The present invention will be further described with reference to the following examples; however, it is to be understood that the present invention is not limited to such examples. All parts or amounts, unless otherwise specified, are by weight.

[0133]In order to facilitate understanding of the following examples certain frequently occurring methods and/or terms will be described.

[0134]"Plasmids" are designated by a lower case p preceded and/or followed by capital letters and/or numbers. The starting plasmids herein are either commercially available, publicly available on an unrestricted basis, or can be constructed from available plasmids in accord with published procedures. In addition, equivalent plasmids to those described are known in the art and will be apparent to the ordinarily skilled artisan.

[0135]"Digestion" of DNA refers to catalytic cleavage of the DNA with a restriction enzyme that acts only at certain sequences in the DNA. The various restriction enzymes used herein are commercially available and their reaction conditions, cofactors and other requirements were used as would be known to the ordinarily skilled artisan. For analytical purposes, typically 1 μg of plasmid or DNA fragment is used with about 2 units of enzyme in about 20 μl of buffer solution. For the purpose of isolating DNA fragments for plasmid construction, typically 5 to 50 μg of DNA are digested with 20 to 250 units of enzyme in a larger volume. Appropriate buffers and substrate amounts for particular restriction enzymes are specified by the manufacturer. Incubation times of about 1 hour at 37° C. are ordinarily used, but may vary in accordance with the supplier's instructions. After digestion the reaction is electrophoresed directly on a polyacrylamide gel to isolate the desired fragment.

[0136]Size separation of the cleaved fragments is performed using 8 percent polyacrylamide gel described by Goeddel, D. et al., Nucleic Acids Res., 8:4057 (1980).

[0137]"Oligonucleotides" refers to either a single stranded polydeoxynucleotide or two complementary polydeoxynucleotide strands which may be chemically synthesized. Such synthetic oligonucleotides have no 5' phosphate and thus will not ligate to another oligonucleotide without adding a phosphate with an ATP in the presence of a kinase. A synthetic oligonucleotide will ligate to a fragment that has not been dephosphorylated.

[0138]"Ligation" refers to the process of forming phosphodiester bonds between two double stranded nucleic acid fragments (Maniatis, T., et al., Id., p. 146). Unless otherwise provided, ligation may be accomplished using known buffers and conditions with 10 units of T4 DNA ligase ("ligase") per 0.5 μg of approximately equimolar amounts of the DNA fragments to be ligated.

[0139]Unless otherwise stated, transformation was performed as described in the method of Graham, F. and Van der Eb, A., Virology, 52:456-457 (1973).

EXAMPLE 1

Bacterial Expression and Purification of EEGF

[0140]The DNA sequence encoding the mature EEGF is initially amplified using PCR oligonucleotide primers corresponding to the 5' sequences of the EEGF protein and the sequences 3' of the EEGF gene. The 5' oligonucleotide primer has the sequence 5' GACTGCATGCAGTGCACGAATGGCTTTG 3' (SEQ ID NO:3) contains an Sph I restriction enzyme site followed by 19 nucleotides of EEGF coding sequence starting from the presumed terminal amino acid. The 3' sequence 5' GACTGGATCCGAATGGGTACT GCGACACATATATC 3' (SEQ ID NO:4) contains complementary sequences to a BamHI site (underlined) and is followed by 25 nucleotides of EEGF. The restriction enzyme sites correspond to the restriction enzyme sites on the bacterial expression vector pQE-70 (Qiagen, Inc. Chatsworth, Calif.). pQE-70 encodes antibiotic resistance (Ampr), a bacterial origin of replication (ori), an IPTG-regulatable promoter operator (P/O), a ribosome binding site (RBS), a 6-His tag and restriction enzyme sites. pQE-70 is then digested with BamHI and SphI. The amplified sequences are ligated into pQE-70 and are inserted in frame with the sequence encoding for the histidine tag and the RBS. The ligation mixture is then used to transform E. coli strain M15/rep 4 (Qiagen, Inc.) by the procedure described in Sambrook, J. et al., Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989). M15/rep4 contains multiple copies of the plasmid pREP4, which expresses the lacI repressor and also confers kanamycin resistance (Kanr). Transformants are identified by their ability to grow on LB plates and ampicillin/kanamycin resistant colonies are selected. Plasmid DNA is isolated and confirmed by restriction analysis. Clones containing the desired constructs are grown overnight (O/N) in liquid culture in LB media supplemented with both Amp (100 μg/ml) and Kan (25 μg/ml). The O/N culture is used to inoculate a large culture at a ratio of 1:100 to 1:250. The cells are grown to an optical density 600 (O.D.600) of between 0.4 and 0.6. IPTG ("Isopropyl-B-D-thiogalacto pyranoside") is then added to a final concentration of 1 mM. IPTG induces by inactivating the lacI repressor, clearing the P/O leading to increased gene expression. Cells are grown an extra 3 to 4 hours. Cells are then harvested by centrifugation. The cell pellet is solubilized in the chaotropic agent 6 Molar Guanidine HCl. After clarification, solubilized EEGF is purified from this solution by chromatography on a Nickel-Chelate column under conditions that allow for tight binding by proteins containing the 6-His tag (Hochuli, E. et al., J. Chromatography 411:177-184 (1984)). EEGF is eluted from the column in 6 molar guanidine HCl pH 5.0 and for the purpose of renaturation adjusted to 3 molar guanidine HCl, 100 mM sodium phosphate, 10 mmolar glutathione (reduced) and 2 mmolar glutathione (oxidized). After incubation in this solution for 12 hours the protein is dialyzed to 10 mmolar sodium phosphate.

EXAMPLE 2

Cloning and Expression of EEGF Using the Baculovirus Expression System

[0141]The DNA sequence encoding the EEGF protein is amplified using PCR oligonucleotide primers corresponding to the 5' and 3' sequences of the gene.

[0142]The primer sequences are as follows: 5' GACTGGTACCGCCATCATGCCAG GAATAAAAAGGATAC 3' (SEQ ID NO:5), has a Asp718 restriction enzyme site (in bold) followed by 6 nucleotides resembling an efficient signal for the initiation of translation in eukaryotic cells (Kozak, M., J. Mol. Biol., 196:947-950 (1987) (the initiation codon for translation is "ATG") and 22 nucleotides corresponding to the 5' end of the full-length EEGF gene.

[0143]The 3' primer 5' GCATGGTACCCGTCGGAGGCTCCAGCCCGAGG 3' (SEQ ID NO:6) contains the cleavage site for the restriction endonuclease Asn718 (bold) and 22 nucleotides complementary to the 3' end of the EEGF gene. The amplified sequences are isolated from a 1% agarose gel using a commercially available kit ("GENECLEAN®," BIO 101 Inc., La Jolla, Calif.). The fragment is then digested with the endonuclease Asp718 and then purified again on a 1% agarose gel. This fragment is designated F2.

[0144]The vector pA2 is used (modification of pVL941 vector, discussed below) for the expression of the EEGF protein using the baculovirus expression system (for review see: Summers, M. D. and Smith, G. E. 1987, A manual of methods for baculovirus vectors and insect cell culture procedures, Texas Agricultural Experimental Station Bulletin No. 1555). This expression vector contains the strong polyhedrin promoter of the Autographa californica nuclear polyhedrosis virus (AcMNPV) followed by the recognition sites for the restriction endonucleases. The polyadenylation site of the simian virus (SV)40 is used for efficient polyadenylation. For an easy selection of recombinant virus the beta-galactosidase gene from E. coli is inserted in the same orientation as the polyhedrin promoter followed by the polyadenylation signal of the polyhedrin gene. The polyhedrin sequences are flanked at both sides by viral sequences for the cell-mediated homologous recombination of co-transfected wild-type viral DNA. Many other baculovirus vectors could be used such as pAc373, pRG1, pVL941 and pAcIM1 (Luckow, V. A. and Summers, M. D., Virology, 170:3 1-39).

[0145]The plasmid is digested with the restriction enzyme Asp718 and then dephosphorylated using calf intestinal phosphatase by procedures known in the art. The DNA is then isolated from a 1% agarose gel using the commercially available kit ("GENECLEAN®" BIO 101 Inc., La Jolla, Calif.). This vector DNA is designated V2.

[0146]Fragment F2 and the dephosphorylated plasmid V2 are ligated with T4 DNA ligase. E. coli HB101 cells are then transformed and bacteria identified that contained the plasmid (pBacEEGF) with the EEGF gene using the restriction enzyme Asp718. The sequence of the cloned fragment is confirmed by DNA sequencing.

[0147]5 μg of the plasmid pBacEEGF is co-transfected with 1.0 μg of a commercially available linearized baculovirus ("BACULOGOLD® baculovirus DNA", Pharmingen, San Diego, Calif.) using the lipofection method (Felgner et al. Proc. Natl. Acad. Sci. USA, 84:7413-7417 (1987)).

[0148]1 μg of BACULOGOLD® virus DNA and 5 μg of the plasmid pBacEEGF are mixed in a sterile well of a microtiter plate containing 50 μl of serum free Grace's medium (Life Technologies Inc., Gaithersburg, Md.). Afterwards 10 μl LIPOFECTIN® plus 90 μl Grace's medium are added, mixed and incubated for 15 minutes at room temperature. Then the transfection mixture is added drop-wise to the Sf9 insect cells (ATCC® CRL 1711) seeded in a 35 mm tissue culture plate with 1 ml Grace's medium without serum. The plate is rocked back and forth to mix the newly added solution. The plate is then incubated for 5 hours at 27° C. After 5 hours the transfection solution is removed from the plate and 1 ml of Grace's insect medium supplemented with 10% fetal calf serum is added. The plate is put back into an incubator and cultivation continued at 27° C. for four days.

[0149]After four days the supernatant is collected and a plaque assay performed similar as described by Summers and Smith (supra). As a modification an agarose gel with "Blue Gal" (Life Technologies Inc., Gaithersburg) is used which allows an easy isolation of blue stained plaques. (A detailed description of a "plaque assay" can also be found in the user's guide for insect cell culture and baculovirology distributed by Life Technologies Inc., Gaithersburg, page 9-10).

[0150]Four days after the serial dilution, the virus is added to the cells and blue stained plaques are picked with the tip of an Eppendorf pipette. The agar containing the recombinant viruses is then resuspended in an Eppendorf tube containing 200 μl of Grace's medium. The agar is removed by a brief centrifugation and the supernatant containing the recombinant baculovirus is used to infect Sf9 cells seeded in 35 mm dishes. Four days later the supernatants of these culture dishes are harvested and then stored at 4° C.

[0151]Sf9 cells are grown in Grace's medium supplemented with 10% heat-inactivated FBS. The cells are infected with the recombinant baculovirus V-EEGF at a multiplicity of infection (MOI) of 2. Six hours later the medium is removed and replaced with SF900 II medium minus methionine and cysteine (Life Technologies Inc., Gaithersburg). 42 hours later 5 mCi of 35S-methionine and 5 μCi 35S cysteine (Amersham) are added. The cells are further incubated for 16 hours before they are harvested by centrifugation and the labeled proteins visualized by SDS-PAGE and autoradiography.

EXAMPLE 3

Expression of Recombinant EEGF in COS Cells

[0152]The expression of plasmid, EEGF HA is derived from a vector pcDNA3/Amp (Invitrogen) containing: 1) SV40 origin of replication, 2) ampicillin resistance gene, 3) E. coli replication origin, 4) CMV promoter followed by a polylinker region, an SV40 intron and polyadenylation site. A DNA fragment encoding the entire EEGF precursor and a HA tag fused in frame to its 3' end is cloned into the polylinker region of the vector, therefore, the recombinant protein expression is directed under the CMV promoter. The HA tag corresponds to an epitope derived from the influenza hemagglutinin protein as previously described (I. Wilson, H. Niman, R. Heighten, A Cherenson, M. Connolly, and R. Lerner, 1984, Cell 37:767, (1984)). The infusion of HA tag to the target protein allows easy detection of the recombinant protein with an antibody that recognizes the HA epitope.

[0153]The plasmid construction strategy is described as follows:

[0154]The DNA sequence encoding a preferred EEGF fragment, ATCC® #97285, is constructed by PCR using two primers: the 5' primer 5' GACTGGATCCGCCACCATGA TGTGTGTTAACCAAAATG 3' (SEQ ID NO:7) contains a BamHI site (in bold) followed by 6 nucleotides resembling an efficient signal for the initiation of translation in eukaryotic cells and 22 nucleotides of EEGF coding sequence starting from the initiation codon; the 3' sequence 5' GACTTCTAGAGAATGGGTACTGCGACACATAT 3' (SEQ ID NO:8) contains complementary sequences to an XbaI site, 22 nucleotides of the EEGF gene followed by sequences encoding the HA tag. The pcDNA3/Amp vector contains BamHI/XbaI cloning sites which bring the PCR insert in frame with the 3' HA tag followed by a stop codon. The PCR amplified DNA fragment and the vector, pcDNA3/Amp, are digested with BamHI and XbaI restriction enzyme and ligated. The ligation mixture is transformed into E. coli strain SURE (available from STRATAGENE® Cloning Systems, La Jolla, Calif. 92037) the transformed culture is plated on ampicillin media plates and resistant colonies are selected. Plasmid DNA is isolated from transformants and examined by restriction analysis for the presence of the correct fragment. For expression of the recombinant EEGF, COS cells are transfected with the expression vector by DEAE-DEXTRAN method (J. Sambrook, E. Fritsch, T. Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989)). The expression of the EEGF HA protein is detected by radiolabelling and immunoprecipitation method (E. Harlow, D. Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, (1988)). Cells are labeled for 8 hours with 35S-cysteine two days post transfection. Culture media is then collected and cells are lysed with detergent (RIPA buffer (150 mM NaCl, 1% NP-40, 0.1% SDS, 1% NP-40, 0.5% DOC, 50 mM Tris, pH 7.5) (Wilson, I. et al., Id. 37:767 (1984)). Both cell lysate and culture media are precipitated with an HA specific monoclonal antibody. Proteins precipitated are analyzed on 15% SDS-PAGE gels.

EXAMPLE 4

Expression via Gene Therapy

[0155]Fibroblasts are obtained from a subject by skin biopsy. The resulting tissue is placed in tissue-culture medium and separated into small pieces. Small chunks of the tissue are placed on a wet surface of a tissue culture flask, approximately ten pieces are placed in each flask. The flask is turned upside down, closed tight and left at room temperature over night. After 24 hours at room temperature, the flask is inverted and the chunks of tissue remain fixed to the bottom of the flask and fresh media (e.g., Ham's F12 media, with 10% FBS, penicillin and streptomycin, is added. This is then incubated at 37° C. for approximately one week. At this time, fresh media is added and subsequently changed every several days. After an additional two weeks in culture, a monolayer of fibroblasts emerge. The monolayer is trypsinized and scaled into larger flasks.

[0156]pMV-7 (Kirschmeier, P. T. et al, DNA, 7:219-25 (1988) flanked by the long terminal repeats of the Moloney murine sarcoma virus, is digested with EcoRI and HindIII and subsequently treated with calf intestinal phosphatase. The linear vector is fractionated on agarose gel and purified, using glass beads.

[0157]The cDNA encoding a polypeptide of the present invention is amplified using PCR primers which correspond to the 5' and 3' end sequences respectively. The 5' primer containing an EcoRI site and the 3' primer further includes a HindIII site. Equal quantities of the Moloney murine sarcoma virus linear backbone and the amplified EcoRI and HindIII fragment are added together, in the presence of T4 DNA ligase. The resulting mixture is maintained under conditions appropriate for ligation of the two fragments. The ligation mixture is used to transform bacteria HB101, which are then plated onto agar-containing kanamycin for the purpose of confirming that the vector had the gene of interest properly inserted.

[0158]The amphotropic pA317 or GP+am12 packaging cells are grown in tissue culture to confluent density in Dulbecco's Modified Eagles Medium (DMEM) with 10% calf serum (CS), penicillin and streptomycin. The MSV vector containing the gene is then added to the media and the packaging cells are transduced with the vector. The packaging cells now produce infectious viral particles containing the gene (the packaging cells are now referred to as producer cells).

[0159]Fresh media is added to the transduced producer cells, and subsequently, the media is harvested from a 10 cm plate of confluent producer cells. The spent media, containing the infectious viral particles, is filtered through a millipore filter to remove detached producer cells and this media is then used to infect fibroblast cells. Media is removed from a sub-confluent plate of fibroblasts and quickly replaced with the media from the producer cells. This media is removed and replaced with fresh media. If the titer of virus is high, then virtually all fibroblasts will be infected and no selection is required. If the titer is very low, then it is necessary to use a retroviral vector that has a selectable marker, such as neo or his.

[0160]The engineered fibroblasts are then injected into the host, either alone or after having been grown to confluence on cytodex 3 microcarrier beads. The fibroblasts now produce the protein product.

[0161]Numerous modifications and variations of the present invention are possible in light of the above teachings and, therefore, within the scope of the appended claims, the invention may be practiced otherwise than as particularly described.

Sequence CWU 1

1111720DNAHomo sapiensCDS(211)..(1554)misc_feature(1633)W equals a or t 1aaccaggtgc ttgcgctgag ggctctgcag tggctgggga ggaccccggc gctctccccg 60tgtcctctcc acgactcgct cggcccctct ggaataaaac acccgcgagc cccgagggcc 120cagaggaggc cgacgtgccc gagctcctcc gggggtcccg cccgcgagct ttcttctcgc 180cttcgcatct cctcctcgcg cgtcttggac atg cca gga ata aaa agg ata ctc 234 Met Pro Gly Ile Lys Arg Ile Leu -25 -20act gtt acc att ctg gct ctc tgt ctt cca agc cct ggg aat gca cag 282Thr Val Thr Ile Leu Ala Leu Cys Leu Pro Ser Pro Gly Asn Ala Gln -15 -10 -5gca cag tgc acg aat ggc ttt gac ctg gat cgc cag tca gga cag tgt 330Ala Gln Cys Thr Asn Gly Phe Asp Leu Asp Arg Gln Ser Gly Gln Cys 1 5 10 15tta gat att gat gaa tgc cga acc atc ccc gag gcc tgc cga gga gac 378Leu Asp Ile Asp Glu Cys Arg Thr Ile Pro Glu Ala Cys Arg Gly Asp 20 25 30atg atg tgt gtt aac caa aat ggc ggg tat tta tgc att ccc cgg aca 426Met Met Cys Val Asn Gln Asn Gly Gly Tyr Leu Cys Ile Pro Arg Thr 35 40 45aac cct gtg tat cga ggg ccc tac tcg aac ccc tac tcg acc ccc tac 474Asn Pro Val Tyr Arg Gly Pro Tyr Ser Asn Pro Tyr Ser Thr Pro Tyr 50 55 60tca ggt ccg tac cca gca gct gcc cca cca ctc tca gct cca aac tat 522Ser Gly Pro Tyr Pro Ala Ala Ala Pro Pro Leu Ser Ala Pro Asn Tyr 65 70 75ccc acg atc tcc agg cct ctt ata tgc cgc ttt gga tac cag atg gat 570Pro Thr Ile Ser Arg Pro Leu Ile Cys Arg Phe Gly Tyr Gln Met Asp80 85 90 95gaa agc aac caa tgt gtg gat gtg gac gag tgt gca aca gat tcc cac 618Glu Ser Asn Gln Cys Val Asp Val Asp Glu Cys Ala Thr Asp Ser His 100 105 110cag tgc aac ccc acc cag atc tgc atc aat act gaa ggc ggg tac acc 666Gln Cys Asn Pro Thr Gln Ile Cys Ile Asn Thr Glu Gly Gly Tyr Thr 115 120 125tgc tcc tgc acc gac gga tat tgg ctt ctg gaa ggc cag tgc tta gac 714Cys Ser Cys Thr Asp Gly Tyr Trp Leu Leu Glu Gly Gln Cys Leu Asp 130 135 140att gat gaa tgt cgc tat ggt tac tgc cag cag ctc tgt gcg aat gtt 762Ile Asp Glu Cys Arg Tyr Gly Tyr Cys Gln Gln Leu Cys Ala Asn Val 145 150 155cct gga tcc tat tct tgt aca tgc aac cct ggt ttt acc ctc aat gag 810Pro Gly Ser Tyr Ser Cys Thr Cys Asn Pro Gly Phe Thr Leu Asn Glu160 165 170 175gat gga agg tct tgc caa gat gtg aac gag tgt gcc acc gag aac ccc 858Asp Gly Arg Ser Cys Gln Asp Val Asn Glu Cys Ala Thr Glu Asn Pro 180 185 190tgc gtg caa acc tgc gtc aac acc tac ggc tct ttc atc tgc cgc tgt 906Cys Val Gln Thr Cys Val Asn Thr Tyr Gly Ser Phe Ile Cys Arg Cys 195 200 205gac cca gga tat gaa ctt gag gaa gat ggc gtt cat tgc agt gat atg 954Asp Pro Gly Tyr Glu Leu Glu Glu Asp Gly Val His Cys Ser Asp Met 210 215 220gac gag tgc agc ttc tct gag ttc ctc tgc caa cat gag tgt gtg aac 1002Asp Glu Cys Ser Phe Ser Glu Phe Leu Cys Gln His Glu Cys Val Asn 225 230 235cag ccc ggc aca tac ttc tgc tcc tgc cct cca ggc tac atc ctg ctg 1050Gln Pro Gly Thr Tyr Phe Cys Ser Cys Pro Pro Gly Tyr Ile Leu Leu240 245 250 255gat gac aac cga agc tgc caa gac atc aac gaa tgt gag cac agg aac 1098Asp Asp Asn Arg Ser Cys Gln Asp Ile Asn Glu Cys Glu His Arg Asn 260 265 270cac acg tgc aac ctg cag cag acg tgc tac aat tta caa ggg ggc ttc 1146His Thr Cys Asn Leu Gln Gln Thr Cys Tyr Asn Leu Gln Gly Gly Phe 275 280 285aaa tgc atc gac ccc atc cgc tgt gag gag cct tat ctg agg atc agt 1194Lys Cys Ile Asp Pro Ile Arg Cys Glu Glu Pro Tyr Leu Arg Ile Ser 290 295 300gat aac cgc tgt atg tgt cct gct gag aac cct ggc tgc aga gac cag 1242Asp Asn Arg Cys Met Cys Pro Ala Glu Asn Pro Gly Cys Arg Asp Gln 305 310 315ccc ttt acc atc ttg tac cgg gac atg gac gtg gtg tca gga cgc tcc 1290Pro Phe Thr Ile Leu Tyr Arg Asp Met Asp Val Val Ser Gly Arg Ser320 325 330 335gtt ccc gct gac atc ttc caa atg caa gcc acg acc cgc tac cct ggg 1338Val Pro Ala Asp Ile Phe Gln Met Gln Ala Thr Thr Arg Tyr Pro Gly 340 345 350gcc tat tac att ttc cag atc aaa tct ggg aat gag ggc aga gaa ttt 1386Ala Tyr Tyr Ile Phe Gln Ile Lys Ser Gly Asn Glu Gly Arg Glu Phe 355 360 365tac atg cgg caa acg ggc ccc atc agt gcc acc ctg gtg atg aca cgc 1434Tyr Met Arg Gln Thr Gly Pro Ile Ser Ala Thr Leu Val Met Thr Arg 370 375 380ccc atc aaa ggg ccc cgg gaa atc cag ctg gac ttg gaa atg atc act 1482Pro Ile Lys Gly Pro Arg Glu Ile Gln Leu Asp Leu Glu Met Ile Thr 385 390 395gtc aac act gtc atc aac ttc aga ggc agc tcc gtg atc cga ctg cgg 1530Val Asn Thr Val Ile Asn Phe Arg Gly Ser Ser Val Ile Arg Leu Arg400 405 410 415ata tat gtg tcg cag tac cca ttc tgagcctcgg gctggagcct ccgacgctgc 1584Ile Tyr Val Ser Gln Tyr Pro Phe 420ctctcattgg caccaaggga caggagaaga gaggaaataa cagagagawt gagagcgama 1644cagacgttag gcatttcctg ctgaacgttt ccccgaagag tcagncccga cttcctgact 1704ctcacctgta ctattg 17202448PRTHomo sapiens 2Met Pro Gly Ile Lys Arg Ile Leu Thr Val Thr Ile Leu Ala Leu Cys-25 -20 -15 -10Leu Pro Ser Pro Gly Asn Ala Gln Ala Gln Cys Thr Asn Gly Phe Asp -5 1 5Leu Asp Arg Gln Ser Gly Gln Cys Leu Asp Ile Asp Glu Cys Arg Thr 10 15 20Ile Pro Glu Ala Cys Arg Gly Asp Met Met Cys Val Asn Gln Asn Gly 25 30 35Gly Tyr Leu Cys Ile Pro Arg Thr Asn Pro Val Tyr Arg Gly Pro Tyr40 45 50 55Ser Asn Pro Tyr Ser Thr Pro Tyr Ser Gly Pro Tyr Pro Ala Ala Ala 60 65 70Pro Pro Leu Ser Ala Pro Asn Tyr Pro Thr Ile Ser Arg Pro Leu Ile 75 80 85Cys Arg Phe Gly Tyr Gln Met Asp Glu Ser Asn Gln Cys Val Asp Val 90 95 100Asp Glu Cys Ala Thr Asp Ser His Gln Cys Asn Pro Thr Gln Ile Cys 105 110 115Ile Asn Thr Glu Gly Gly Tyr Thr Cys Ser Cys Thr Asp Gly Tyr Trp120 125 130 135Leu Leu Glu Gly Gln Cys Leu Asp Ile Asp Glu Cys Arg Tyr Gly Tyr 140 145 150Cys Gln Gln Leu Cys Ala Asn Val Pro Gly Ser Tyr Ser Cys Thr Cys 155 160 165Asn Pro Gly Phe Thr Leu Asn Glu Asp Gly Arg Ser Cys Gln Asp Val 170 175 180Asn Glu Cys Ala Thr Glu Asn Pro Cys Val Gln Thr Cys Val Asn Thr 185 190 195Tyr Gly Ser Phe Ile Cys Arg Cys Asp Pro Gly Tyr Glu Leu Glu Glu200 205 210 215Asp Gly Val His Cys Ser Asp Met Asp Glu Cys Ser Phe Ser Glu Phe 220 225 230Leu Cys Gln His Glu Cys Val Asn Gln Pro Gly Thr Tyr Phe Cys Ser 235 240 245Cys Pro Pro Gly Tyr Ile Leu Leu Asp Asp Asn Arg Ser Cys Gln Asp 250 255 260Ile Asn Glu Cys Glu His Arg Asn His Thr Cys Asn Leu Gln Gln Thr 265 270 275Cys Tyr Asn Leu Gln Gly Gly Phe Lys Cys Ile Asp Pro Ile Arg Cys280 285 290 295Glu Glu Pro Tyr Leu Arg Ile Ser Asp Asn Arg Cys Met Cys Pro Ala 300 305 310Glu Asn Pro Gly Cys Arg Asp Gln Pro Phe Thr Ile Leu Tyr Arg Asp 315 320 325Met Asp Val Val Ser Gly Arg Ser Val Pro Ala Asp Ile Phe Gln Met 330 335 340Gln Ala Thr Thr Arg Tyr Pro Gly Ala Tyr Tyr Ile Phe Gln Ile Lys 345 350 355Ser Gly Asn Glu Gly Arg Glu Phe Tyr Met Arg Gln Thr Gly Pro Ile360 365 370 375Ser Ala Thr Leu Val Met Thr Arg Pro Ile Lys Gly Pro Arg Glu Ile 380 385 390Gln Leu Asp Leu Glu Met Ile Thr Val Asn Thr Val Ile Asn Phe Arg 395 400 405Gly Ser Ser Val Ile Arg Leu Arg Ile Tyr Val Ser Gln Tyr Pro Phe 410 415 420328DNAArtificial SequenceSource Artificially synthesized oligonucleotide which contains an Sph I restriction enzyme site followed by 19 nucleotides encoding the EEGF (human extracellular protein-like/Epidermal Growth Factor-like protein) amino terminus. 3gactgcatgc agtgcacgaa tggctttg 28435DNAArtificial SequenceSource Artificially synthesized oligonucleotide which contains complementary sequences to a BamHI site followed by 25 nucleotides complementary to EEGF coding sequence. 4gactggatcc gaatgggtac tgcgacacat atatc 35538DNAArtificial SequenceSource Artificially synthesized oligonucleotide which contains Asp718 restriction enzyme site followed by 6 nucleotides to signal initiation of translation and 22 nucleotides corresponding to the 5' end of the full-length EEGF gene. 5gactggtacc gccatcatgc caggaataaa aaggatac 38632DNAArtificial SequenceSource Artificially synthesized oligonucleotide which contains Asn718 restriction enzyme site and 22 nucleotides complementary to the 3' end of the EEGF gene. 6gcatggtacc cgtcggaggc tccagcccga gg 32738DNAArtificial SequenceSource Artificially synthesized oligonucleotide which contains a BamHI restriction enzyme site followed by 6 nucleotides to signal initiation of translation and 22 nucleotides of EEGF amino terminus coding sequence. 7gactggatcc gccaccatga tgtgtgttaa ccaaaatg 38832DNAArtificial SequenceSource Artificially synthesized oligonucleotide which contains sequences complementary to XbaI restriction site and 22 nucleotides of the EEGF gene followed by sequences encoding the HA tag (epitope from the influenza hemagglutinin protein). 8gacttctaga gaatgggtac tgcgacacat at 329368PRTHomo sapiens 9Ala Val Ala Gly Pro Glu Met Gln Thr Gly Arg Asn Asn Phe Val Ile1 5 10 15Arg Arg Asn Pro Ala Asp Pro Gln Arg Ile Pro Ser Asn Pro Ser His 20 25 30Arg Ile Gln Cys Ala Ala Gly Tyr Glu Gln Ser Glu His Asn Val Cys 35 40 45Gln Asp Ile Asp Glu Thr Ala Gly Thr His Asn Cys Arg Ala Asp Gln 50 55 60Val Cys Ile Asn Leu Arg Gly Ser Phe Ala Cys Gln Cys Pro Pro Gly65 70 75 80Tyr Gln Lys Arg Gly Glu Gln Cys Val Asp Ile Asp Glu Cys Thr Ile 85 90 95Pro Pro Tyr Cys His Gln Arg Cys Val Asn Thr Pro Gly Ser Phe Tyr 100 105 110Cys Gln Cys Ser Pro Gly Phe Gln Leu Ala Ala Asn Asn Tyr Thr Cys 115 120 125Val Asp Ile Asn Glu Cys Asp Ala Ser Asn Gln Cys Ala Gln Gln Cys 130 135 140Tyr Asn Ile Leu Gly Ser Phe Ile Cys Gln Cys Asn Gln Gly Tyr Glu145 150 155 160Leu Ser Ser Asp Arg Leu Asn Cys Glu Asp Ile Asp Glu Cys Arg Thr 165 170 175Ser Ser Tyr Leu Cys Gln Tyr Gln Cys Val Asn Glu Pro Gly Lys Phe 180 185 190Ser Cys Met Cys Pro Gln Gly Tyr Gln Val Val Arg Ser Arg Thr Cys 195 200 205Gln Asp Ile Asn Glu Cys Glu Thr Thr Asn Glu Cys Arg Glu Asp Glu 210 215 220Met Cys Trp Asn Tyr His Gly Gly Phe Arg Cys Tyr Pro Arg Asn Pro225 230 235 240Cys Gln Asp Pro Tyr Ile Leu Thr Pro Glu Asn Arg Cys Val Cys Pro 245 250 255Val Ser Asn Ala Met Cys Arg Glu Leu Pro Gln Ser Ile Val Tyr Lys 260 265 270Tyr Met Ser Ile Arg Ser Asp Arg Ser Val Pro Ser Asp Ile Phe Gln 275 280 285Ile Gln Ala Thr Thr Ile Tyr Ala Asn Thr Ile Asn Thr Phe Arg Ile 290 295 300Lys Ser Gly Asn Glu Asn Gly Glu Phe Tyr Leu Arg Gln Thr Ser Pro305 310 315 320Val Ser Ala Met Leu Val Leu Val Lys Ser Leu Gly Pro Arg Glu His 325 330 335Ile Val Asp Leu Glu Met Leu Thr Val Ser Ser Ile Gly Thr Phe Arg 340 345 350Thr Ser Ser Val Leu Arg Leu Thr Ile Ile Val Gly Pro Phe Ser Phe 355 360 3651041PRTHomo sapiens 10Thr Cys Gly Gln Gly Tyr Gln Leu Ser Ala Ala Lys Asp Gln Cys Glu1 5 10 15Asp Ile Asp Glu Cys Gln His Arg His Leu Cys Ala His Gly Gln Cys 20 25 30Arg Asn Thr Glu Gly Ser Phe Gln Cys 35 401142PRTHomo sapiens 11Ser Cys Ser Val Gly Phe Arg Leu Ser Val Asp Gly Arg Ser Cys Glu1 5 10 15Asp Ile Asn Glu Cys Ser Ser Ser Pro Cys Ser Gln Glu Cys Ala Asn 20 25 30Val Tyr Gly Ser Glu Gly Phe Tyr Gln Cys 35 40



Patent applications by Haodong Li, Gaithersburg, MD US

Patent applications by Henrik S. Olsen, Gaithersburg, MD US

Patent applications by Human Genome Sciences, Inc.

Patent applications in class Involving antigen-antibody binding, specific binding protein assay or specific ligand-receptor binding assay

Patent applications in all subclasses Involving antigen-antibody binding, specific binding protein assay or specific ligand-receptor binding assay


User Contributions:

Comment about this patent or add new information about this topic:

CAPTCHA
People who visited this patent also read:
Patent application numberTitle
20120141605PYRAZOLOANTHRONE AND DERIVATIVES THEREOF FOR TREATMENT OF CANCER AND EXCESS ANDROGEN STATES
20120141604NOVEL COMPOSITIONS AND METHODS FOR THE IDENTIFICATION, ASSESSMENT, PREVENTION AND THERAPY OF HUMAN CANCERS
20120141603METHODS AND COMPOSITIONS FOR LUNG CANCER PROGNOSIS
20120141602SYSTEMS CONTAINING MAGNETIC NANOPARTICLES AND POLYMERS, SUCH AS NANOCOMPOSITES AND FERROFLUIDS, AND APPLICATIONS THEREOF
20120141601DIETARY SUPPLEMENT, FEED AND PHARMACEUTICAL COMPOSITION CONTAINING CHIA SEED AND MACA, AND PREPARATION METHOD THEREOF
Images included with this patent application:
Extracellular/Epidermal Growth Factor Like Protein diagram and imageExtracellular/Epidermal Growth Factor Like Protein diagram and image
Extracellular/Epidermal Growth Factor Like Protein diagram and imageExtracellular/Epidermal Growth Factor Like Protein diagram and image
Extracellular/Epidermal Growth Factor Like Protein diagram and imageExtracellular/Epidermal Growth Factor Like Protein diagram and image
Extracellular/Epidermal Growth Factor Like Protein diagram and imageExtracellular/Epidermal Growth Factor Like Protein diagram and image
Extracellular/Epidermal Growth Factor Like Protein diagram and imageExtracellular/Epidermal Growth Factor Like Protein diagram and image
Extracellular/Epidermal Growth Factor Like Protein diagram and imageExtracellular/Epidermal Growth Factor Like Protein diagram and image
Extracellular/Epidermal Growth Factor Like Protein diagram and image
Similar patent applications:
DateTitle
2011-03-17Expression of hiv polypeptides and production of virus-like particles
2009-06-11Fibroblast growth factor-like polypeptides
2011-01-06Fibroblast growth factor-like polypeptides
2009-02-05Method for recovering metal values from refractory sulfide ore
2008-10-16Connective tissue growth factor signaling
New patent applications in this class:
DateTitle
2022-05-05Antibody potency assay
2022-05-05Proteoform specific process validation
2022-05-05Kit for preparing sample for detecting monoclonal antibody
2022-05-05Full length kinase activity-conformation reporter
2022-05-05Chimeric protein, method of production and use thereof, and also a nucleic acid molecule, expression cassette, expression vector, host cell, composition for the diagnosis of leishmaniasis, kit for the diagnosis of leishmaniasis and method of diagnosis of leishmaniasis in vitro
New patent applications from these inventors:
DateTitle
2012-05-17186 human secreted proteins
2012-01-19Growth factor htter36
2011-05-19Growth factor htter36
2011-01-06Antibodies to ht5gj57
2010-02-18Connective tissue growth factor-2
Top Inventors for class "Chemistry: molecular biology and microbiology"
RankInventor's name
1Marshall Medoff
2Anthony P. Burgard
3Mark J. Burk
4Robin E. Osterhout
5Rangarajan Sampath
Website © 2025 Advameg, Inc.