Patent application title: Surface protein of leptospira
Inventors:
Ana L.t.o. Nascimento (Sao Paulo, BR)
Paulo L. Ho (Sao Paulo, BR)
Elizabeth A.l. Martins (Sao Paulo, BR)
Luciana C.c. Leite (Sao Paulo, BR)
Marcia Gamberini (Sao Paulo, BR)
IPC8 Class: AA61K3902FI
USPC Class:
4241901
Class name: Antigen, epitope, or other immunospecific immunoeffector (e.g., immunospecific vaccine, immunospecific stimulator of cell-mediated immunity, immunospecific tolerogen, immunospecific immunosuppressor, etc.) amino acid sequence disclosed in whole or in part; or conjugate, complex, or fusion protein or fusion polypeptide including the same disclosed amino acid sequence derived from bacterium (e.g., mycoplasma, anaplasma, etc.)
Publication date: 2009-02-12
Patent application number: 20090041796
Inventors list |
Agents list |
Assignees list |
List by place |
Classification tree browser |
Top 100 Inventors |
Top 100 Agents |
Top 100 Assignees |
Usenet FAQ Index |
Documents |
Other FAQs |
Patent application title: Surface protein of leptospira
Inventors:
Ana L.T.O. Nascimento
Paulo L. Ho
Elizabeth A.L. Martins
Luciana C.C. Leite
Marcia Gamberini
Agents:
FULBRIGHT & JAWORSKI, LLP
Assignees:
Origin: NEW YORK, NY US
IPC8 Class: AA61K3902FI
USPC Class:
4241901
Abstract:
The invention relates to Leptospiral surface proteins, and the nucleic
acid molecules which encode them. Various uses are described, including
immunoprophylactic, diagnostic and therapeutic methods.Claims:
1-17. (canceled)
18. An isolated Leptospiral protein consisting of the amino acid sequence set forth in SEQ ID NO: 32.
19. Immunogenic composition comprising the isolated Leptospiral protein of claim 18, and a pharmaceutically acceptable carrier.
20. An isolated antibody which specifically binds to the Leptospiral protein of claim 19.
21. The isolated antibody of claim 20, wherein the antibody is a monoclonal antibody.
22. Hybridoma cell line which produces the isolated monoclonal antibody of claim 21.
Description:
RELATED APPLICATION
[0001]This application is a divisional of application Ser. No. 11/414,721, filed Apr. 27, 2006, which is a divisional application of application Ser. No. 11/264,728, filed Nov. 1, 2005, which is a divisional application of application Ser. No. 10/889,526 filed Jul. 12, 2004, now U.S. Pat. No. 7,018,634, which is a divisional application of application Ser. No. 10/376,397 filed Feb. 28, 2003, now U.S. Pat. No. 6,852,322, and claims priority of application Ser. No. 60/360,566, filed Feb. 28, 2002, incorporated by reference in their entireties.
FIELD OF THE INVENTION
[0002]This invention relates to membrane associated proteins of Leptospira bacteria, Leptospira Copenhageni in particular. The proteins are useful both therapeutically, as, e.g., antisera, immunoprophylactically, as vaccines, as well as diagnostically. They can be used, for example, to detect antibodies in samples taken from subjects suspected of being infected, and also to generate antibodies which can then be used to detect the proteins, epitopic portions of the proteins, as well as the bacteria per se. Also a feature of the invention are nucleic acid molecules encoding these proteins, methods for purifying them, as well as various applications thereof.
BACKGROUND AND PRIOR ART
[0003]Leptospira is a genus of bacteria which is a member of the Spirochetes family. Other members of this family are Borrelia and Treponema. All three genuses are characterized by mobility, and a helical shape. All members of the family cause disease in animals, including humans, livestock, domesticated animals, and wild animals. For example, Borrelia is the causative agent for Lyme disease. Other diseases caused by Spirochetes include relapsing fever, syphilis and yaws.
[0004]Leptospira genus consists of a genetically diverse group of 12 species, eight of which are pathogenic, and four of which are non-pathogenic, and saprophytic. See Faine, et al. Leptospira and Leptospirosis (2nd edition, 1999, Melbourne, Australia, MediSci); Farr, Clin. Infect. Dis 21:1-8 (1995). Levett, Clin. Microbiol Rev. 14:296-326 (2001), incorporated by reference. There are over 200 known pathogenic serovars of Leptospira. It is hypothesized that structural heterogeneity in lypopolysacchacide structure accounts for this. See, Levett, supra.
[0005]Leptospirosis, the disease caused by Leptospira, is zoonotic. Transmission to humans results from contact with domestic or wild animal reservoirs, or via contact with animal urine. Infected individuals show a wide spectrum of clinical manifestations in the early phases of the illness including fever, headache, chills and severe myalgia. In 5-15% of the clinical infections, severe multisystem complications result, including jaundice, renal failure and hemorrhaging. See Farr, supra, Faine, et al., supra. Severe leptospirosis has a mortality rate of 5-40%.
[0006]There is a large spectrum of animal species which serve as reservoirs for the bacteria. As a result, human leptospirosis is found throughout the world, and is considered to be the most widespread zoonotic disease. High risk groups include military personnel, farmers, miners, sewage and waste removal workers, veterinarians and abattoir workers. See, in this regard, Levett, supra, Faine, et al., supra. New patterns of transmission of the disease have emerged; however, emphasizing the public health issues associated with this disease. In "developed" countries outbreaks have been associated with recreational diseases, such as white water rafters in Costa Rica, and sporting events involving extensive outdoor activity, such as triathlons and "Eco-challenges." See, e.g., Levett, supra; Jackson, Pediatr. Infect. Dis. J 12:48-54 (1993); Center For Disease Control and Prevention: Outbreak of leptospirosis among white water rafters in Costa Rica (1997); Update: Leptospirosis and Unexplained Acute febrile illness among athletes participating in triathlons: Illinois and Wisconsin (1998). Update: Outbreak of Acute Illness Among Athletes Participating in Eco-Challenge--Sahah 2000--Borneo, Malaysia (2000). Underlying conditions associated with poverty have led to large, urban, epidemics of leptospirosis in Brazil and other countries, resulting in high mortality rates. See Lomor, et al., Infect. Dis. Clin. North Am 14:23-39 (2000); Ko, et al., Lancet 354:820-5 (1999).
[0007]Leptospirosis is a major issue in agriculture as well, due to its association with livestock and domestic animals. Among the manifestations of animal leptospirosis are spontaneous abortions, still births, infertility, failure to thrive, reduced milk production, and high fatality rates in diverse species such as cows, pigs, sheep, goats, horses and dogs. See Faine, et al., supra. Other manifestations of the disease are chronic infection, and shedding of pathogenic leptospires. Standard approaches to controlling this include international and national quarantines in the animal husbandry industry, with negative economic ramifications.
[0008]Clearly, there is a need to control leptospirosis; however, efforts have been hindered due to a lack of effective approaches. Long term survival of pathogenic leptospires in soil and water, as well as the abundance of animal reservoirs support long term survival of the pathogen so eradication is not a viable option. Hence, efforts have turned to approaches based upon vaccines.
[0009]Currently, available vaccines are based upon inactivated whole cell, or membrane preparations of pathogenic bacteria. These appear to induce protective responses via antibody induction. See Levett, supra, Faine, et al, supra. These vaccines do not produce long term protection against infection, and they do not confer cross protective immunity against serovars not included in the vaccines used. The number of serovars possible, and the cost of multicomponent serovar vaccines have thwarted development in this area.
[0010]A key mechanism in the pathogenesis of leptospirosis, as in other spirochetal diseases (such as Lyme disease and syphilis), is the ability of the pathogen to disseminate widely in the host during the early stage of infection. See Faine, et al., supra. It is presumed that surface associated leptospiral proteins, mediate interactions which facilitate entry and dissemination through host tissues. Virulence factors associated with the surface of the bacteria serve as vaccine candidates, in that any immune or other protective response would block dissemination in the host. Another important aspect of surface associated proteins is that they are, literally, "surface-associated," rendering them accessible to immune attack. Protective mechanisms associated with such surface associated proteins include antibody-dependent phagacytosis, and complement-mediated killing.
[0011]It would be desirable to have pure, or substantially pure Leptospira surface associated proteins available. Production of such proteins, in recombinant form, for example is cost effective, and provides a method to screen proteins to determine sub-unit or epitopic fragment based vaccines. Further, availability of recombinant proteins permits one to determine which proteins are conserved, especially among different pathogenic Leptospira, to determine which are the most suitable, cross-serovar vaccines.
[0012]There have been difficulties in identifying surface associated Leptospira proteins. using conventional biochemical and molecular biological methods. The genome of the spirochete Borrelia burgdorferi has been analyzed, and more than 100 surface associated lepoproteins were identified. The large size of the Leptospira genome (-4.6 Mb), and its complex life cycle suggest that a far greater number of surface associated proteins will be found. Using standard membrane extraction, isolation, and purification techniques, less than Leptospira surface associated proteins have been identified and characterized. See Haake, et al., Infect. Immun 66:1579-1587 (1998); Haake et al., Infect. Immun. 6572-82 (1999); Haake, et al., Infect. Immun 68:2276-2285 (2000); Shang et al., Infect. Immun 63:3174-3181 (1995); Shang et al., Infect. Immun 64:2232-30 (1996). Also see U.S. Pat. Nos. 5,091,301; 5,643,754; 5,638,757; 5,824,321; 6,140,083; 6,262,235; 6,306,623; and 6,308,641. All of these articles and patents are incorporated by reference. While Haake, et al., Infect. Immun 67:6572-82 (1999), describe immunization with recombinant protein L1pL32, OmpL1 and L1pL41 but, the response was not complete. None of these reference identify virulence associated proteins.
[0013]As has been pointed out, supra, the Leptospira genome is large. As a result, technical difficulties have prevented meaningful results in identifying surface associated proteins; however, the emerging field of bioinformatics has placed extremely powerful and valuable tools in the hands of those involved in Leptospiral research.
[0014]Via application of the techniques described supra, the inventors have discovered further Leptospira surface associated proteins useful in vaccine production, as well as in production of diagnostic kits for use in determining presence, onset, or decrease in Leptospiral infection. These, and other aspects of the invention will be clear from the disclosure which follows.
BRIEF DESCRIPTION OF THE FIGURES
[0015]FIGS. 1-11 inclusive, present data obtained from Western Blotting experiments, using the recombinant proteins of the invention. In all figures, control rat serum, and serum from rats that had been immunized with Leptospira, and control human sera as well as sera from patients diagnosed as suffering from Leptospirosis were used. FIG. 1 shows work done with the protein of SEQ ID NO: 2 & 4, FIG. 2 with SEQ ID NO: 6 & 8, and so forth.
[0016]FIG. 1 shows data from Western Blotting experiments using the proteins of SEQ ID NOS: 2 and 4.
[0017]FIG. 2 shows data from Western Blotting experiments using the proteins of SEQ ID NOS: 6 and 8.
[0018]FIG. 3 shows data from Western Blotting experiments using the proteins of SEQ ID NOS: 10 and 12.
[0019]FIG. 4 shows data from Western Blotting experiments using the proteins of SEQ ID NOS: 14 and 18.
[0020]FIG. 5 shows data from Western Blotting experiments using the proteins of SEQ ID NOS: 20 and 22.
[0021]FIG. 6 shows data from Western Blotting experiments using the proteins of SEQ ID NOS: 24 and 26.
[0022]FIG. 7 shows data from Western Blotting experiments using the proteins of SEQ ID NOS: 28 and 30.
[0023]FIG. 8 shows data from Western Blotting experiments using the proteins of SEQ ID NOS: 32 and 34.
[0024]FIG. 9 shows data from Western Blotting experiments using the proteins of SEQ ID NOS: 36 and 38.
[0025]FIG. 10 shows data from Western Blotting experiments using the proteins of SEQ ID NOS: 40 and 42.
[0026]FIG. 11 shows data from Western Blotting experiments using the proteins of SEQ ID NOS: 44 and 46.
DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS
Example 1
[0027]A strain of Leptospira, referred to as "Fiocruz L1-30," was used. The strain was isolated from a patient with severe leptospirosis, contracted during an epidemic in 1996. See Ko, et al., Lancet 354:820-5 (1999), incorporated by reference. Leptospires were detected during dark field microscopy examination of a culture of tween-albumin media that had been inoculated with patient blood, following "Guidelines for the Control of Leptospirosis." WHO Offset Publ. (1982) incorporated by reference. The strain was identified as Leptospira interrogans, serovar Copenhageni, via biochemical and sera typing analysis. See Ko, et al., supra, Barocchi, et al., J. Clin. Microbiol 39:191-195 (2001). A culture of the organism was then prepared in media with 10% glycerol, and stored at -70° C. Virulence capacity was determined by inoculating 28 day old weaning hamsters. Kidneys were removed from anesthetized animals, approximately 7 days after infection, macerated and were used to inoculate Tween-albumin media. Any cultures for which growth was detected were used to infect additional hamsters, as part of a second passage step. In all, three passage steps were performed. Isolates from the final passage were used to prepare large scale, two liter cultures, again in Tween albumin media. Following centrifugation (10,000×g for 20 minutes), pellets were stored at -70 ° C., prior to use in DNA purification steps. The genomic DNA was extracted using standard methods, as set forth in, e.g., Sambrook and Maniatis, Molecular Cloning: A Laboratory Manual (2nd edition, Cold Spring Harbor, 1989).
[0028]Once the genomic DNA was isolated, it was partially digested with MboI, in order to generate fragments which ranged from 30 to 60 kilobase pairs. These were cloned into a cosmid vector "Lawrist 4," described by Hanke, et al., Biotechniques 21(4):686-8 and 690-3 (1996), incorporated by reference to produce a cosmid library. Any dephosphorylated DNA fragments were ligated to the cosmid vector, in the presence of T4 DNA ligase. The resulting, recombinant DNA was then packed into phage particles, using a commercially available product, and was then transfected into E. coli DH5*. Transfected cells were plated onto solid, Luria-Bertani medium supplemented with kanamycin, and were grown, overnight, at 37° C.
[0029]Following culture, the transfectants were used in a shotgun library construction protocol. To elaborate, genomic DNA was purified, in accordance with Fleischmann, et al., Science 269:496-512 (1995), incorporated by reference, and the purified DNA was sheared into fragments via nebulization.
[0030]The resulting fragments were repaired by end filling, using the Klenow fragment of E. coli DNA polymerase, or phage T7 DNA polymerase, or both, before ligation into the SmaI BAP site of pUC18. The resulting, recombinant DNA was transformed into E. coli DH10B cells, via electroporation. The transformants were plated, on Luria-Bertani agar medium containing ampicillin, and grown overnight at 37° C.
[0031]Single bacterial colonies resulting from the culture were inoculated in 96 well microtiter plates containing nutrient broth and ampicillin. These were grown, overnight, with shaking, at 37° C. DNA was purified via standard alkaline lysis, with one modification. Specifically, at the end of the procedure, supernatant was passed through a multi-screen filter prior to precipitation. Precipitated DNA was resuspended in water, and used as described in the following example.
Example 2
[0032]The purified DNA described in example 1 was sequenced, using commercially available reagents, and well known methods.
[0033]Specifically, commercially available products were used to carry out Taq dye deoxy terminator cycle sequencing reactions, using M13 reverse and forward matching primers, which flanked the inserts of the clones. Reaction products were analyzed on a commercially available genetic analyzer.
[0034]There were a total of 289,963 shotgun genomic sequences. Open reading frames were obtained from these, and assembled using phred/phrap software, as described by Ewing, et al., Genome Res 8(3):186-194 (1998) incorporated by reference. The assembly yielded 2,042 contigs. The "Glimmer" program of Delcher, et al., Nucl. Acids Res 27:4636-4641 (1999), incorporated by reference, was applied to the contigs, and yielded 5826 putative open reading frames. Each of these ORFs contained at least 90 base pairs, and overlapped other ORFs by 30 base pairs, or 10% of the ORF size, at most. Any ORFs with "N" or "X," which indicated either poor quality, or repetitive regions were discarded. The "PSORT" program described by Nakai, et al., Proteins: Structure, Function and Genetics 11:95-110 (1991), incorporated by reference, was used to predict protein location within the bacterium. Any ORF, with a PSORT score of 0.1 or more (outer membrane or periplasmic space localization), were considered to be potentially useful.
[0035]Protein coding genes were identified using known algorithms GeneMark and Glimmer, as described by Delcher, et al., Nucl. Acids Res. 27:4636-4641 (1999), incorporated by reference, after which the "PSORT" program, described by Nakai, et al., Proteins: Structure, Function and Genetics 11:95-110 (1991), incorporated by reference, was used to predict protein localization within the bacterium. The sequences chosen for further analysis were those which the program predicted to encode surface associated proteins. Such proteins are ideal candidates for generation of antibodies.
[0036]Once the relevant nucleotide sequences were identified, protocols were developed to amplify them for further work.
[0037]In each case, a pair of oligonucleotide primers were developed to hybridize specifically to the target sequence of interest. In general, primers from 18-28 nucleotides long were used. In each case, the forward primer was then modified to add the sequence "CACC" at the 5' end. This facilitates directional cloning in the vector used. As a general principle, the primers were designed to hybridize from 10-25 amino acids away from the start codon, so as to avoid hydrophobic regions that are characteristic of signal peptide sequences. The primer sequences follow
TABLE-US-00001 TABLE 1 Oligonucleotide primer sequences employed to amplify the target nucleic sequences by PCR methodology. Molecular weights are from the recombinant proteins obtained in E. coli expression systems. Molecular SEQ Weight ID (KDa) Primers NO: LpL53 53.8 LpL53F: CACCACCAATGTGTTTGGTATAGCG 47 LpL53R: CAGCGTTTTGTGATAAAATTAAC 48 OMPL55 53.8 OMPL55F: CACCGATGCTTACTACGGACTGGATG 49 OMPL55R: CAGGAGTGTGATCGAGCTTG 50 OMPL16 15.9 OMPL16F: CACCCCGTGTTCTTTTGGTTTAGAT 51 OMPL16R: TTCCAACAAATCGAATCATCT 52 OMPL31 32 OMPL31F: CACCAAGAAGGATTCCAACGATGATG 53 OMPL31R: TCTCCTGCTTGACAGCCGAC 54 OMPL15 15.2 OMPL15F: CACCATGCGTGCTGTCAGTAGAGAAAC 55 OMPL15R: GTCGACATTGGCAGAATTTACG 56 OMPL20 21.2 OMPL20F: CACCTTTGCACAATCCAAAGAGAAATG 57 OMPL20R: TCATTTCCGAACCGGATGAC 58 LpL23 18.5 LpL23F: ACCATGGGATCCGCTCTTTTGGTTGATCCAGAG 59 LpL23R: GAATTCCTAACAACCAGGACCTTCACAT 60 LpL40 39 LpL40F: ACCATGGGACTCGAGACGCCTCCTCCTAAAGATCC 61 LpL40R: CTCCATGGTCATTTCAAAACTTCTACGGGGC 62 LpL22 22.8 LpL22F: CACCCCTTCGAGGTTGGAAATCG 63 LpL22R: AATCGATGGATCACGTTACG 64 OMPL17 18.4 OMPL17F: CACCAAACCTGGATATGGAATGGC 65 OMPL17R: TACAGAGGTAGAAGCGTTAGAAG 66 OMPL30 29.2 OMPL30F: CACCAATCGACTTTTCACTGAGTTTCTT 67 OMPL30R: CGAAAGTATCAAGAAGAACCGTA 68 OMPL27 27.5 OMPL27F: CACCCAGGAAACGGAAAACGCTAA 69 OMPL27R: CTTATTGTTTGCCGTAGGTTTC 70 OMPL21 21.9 OMPL21F: CACCATGGGCGCTTTTAATCGG 71 OMPL21R: CGGAACTAGGGAACTTTTCAAC 72 OMPL22 20.6 OMPL22F: CACCATCATTCCTTCGGGAAGTGAC 73 OMPL22R: CCATTCTCTGTTGTTTGATCCC 74 MPL17 15.4 MPL17F: CACCGAAAGTCCCGTAAGGTTCAAA 75 MPL17R: TGCAGGAGTTCCCACATTTTA 76 MPL21 31.9 MPL21F: CACCACGTCTCAAAGTTACGCTTCAG 77 MPL21R: TTCTCACCATCCAGCTCGG 78 OMPAL21 20.6 OMPAL21F: CACCGAGCCTTCAACGCAAGAGCAA 79 OMPAL21R: AACGTAAGACGTTGAGTTGCCACA 80 OMPL63 64.3 OMPL63F: CACCACGATGATTCAGCCTACTTGG 81 OMPL63R: GAAGTAGAACCGGAAGATTTATTT 82 OMPL14 18.6 OMPL14F: CACCGGATGCAAACAAGATCCAGTAG 83 OMPL14R: GAAACGCCACTAAGTTAGATCAC 84 MPL36 35.1 MPL36F: CACCACGTCTTGTGCGTCGGTAGAG 85 MPL36R: CCAAGTATTCTATTTATACGTCCGAG 86 MPL39 30.8 MPL39F: CACCTCAGTAACTACTGGTCAGTGTAATG 87 MPL39R: CACGTGTTAGTTCTTTGGTTG 88 MPL40 43.2 MPL40F: CACCTTGTTTTTAAAAAAAAGGAAAGC 89 MPL40R: AACTAAGGAACCGGAGTTGC 90 MPL21 18.6 MPL21F: CACCGACATGCTTCCTACTTATTCCC 91 MPL21R: CGCTAAAAGTATCACAATGGTAA 92
[0038]The amplification was carried out by combining template DNA (1.0 ng), nucleotide triphosphates (0.4 mM), Pfx polymerase (0.5 units, taken from a stock solution of 1 unit/μl), and 0.2 μM primers, at a pH of 8.0. The total reaction volume was 50 μl.
[0039]PCR was then carried out in a thermocycler, where the DNA denaturation step was carried out for 3 minutes at 94° C., followed by primer-DNA template annealing at 55° C., for 20 seconds, and nucleotide polymerization for 4 minutes at 68° C. This cycle was repeated, 45 times, except that in the repeats, denaturation was for 20 seconds.
[0040]Following amplification, the sequences were cloned into a commercially available vector, "pENTR.TOPO." This vector includes a kanamycin resistance sequence useful in E. coli selection a pUC ORI, two "attL1" and "attL2" sites for site-specific recombination, and a TOPO cloning site for directional cloning of blunt end PCR products. Specifically, this is the sequence "CCCTT", which serves as a topoisomerase I binding site.
[0041]Cloning was carried out according to manufacturer's instructions, which call for 15 ng of the PCR product, and 5 ng of pENTR.TOPO vector, in 5 mM Tris buffer, pH 7.4, at a total volume of 10 μl. The reaction proceeded for 10 minutes, at room temperature, i.e., about 25° C.
[0042]Positive clones were obtained via culture in kanamycin containing Luria Broth.
[0043]Following the reaction, the PCR products were integrated into the pENTR.TOPO vector, and were transferred to specific expression vectors very easily, via reaction at the forementioned attR1 and attR2 sites, in the presence of LR Clonase.
[0044]Expression was facilitated by use of an expression vector derived from T7, the commercially available pDEST17 vector. This vector includes an ORI, a promoter sequence to facilitate transcription of inserted sequences, a ribosomal binding site, and an ATG start codon.
[0045]In the practice of the invention, 2 μl of the cloning mixture described supra, 15 ng of pDEST17, & 4 μl of LR Clonase enzyme mix were combined in Tris-EDTA (10 mM Tris-HCl, 0.1 mM EDTA) buffer, at pH 8, for 60 minutes, at room temperature. After 60 minutes, proteinase K (4 μg) was added for 30 minutes, at 37° C., to inactivate enzymes. Positive clones were isolated from Luria Broth agar plates, which contained 20 μg/ml of ampicillin. DNA sequences, when cloned, included a sequence encoding six His residues, at the N terminus of the protein. This well known technique was used to facilitate the purification of protein via metal affinity chromatography.
Example 3
[0046]The expression vectors resulting from the preceding examples were used to express the relevant proteins. E. coli strains BL21(DE3) or BL21SI were used under inducing conditions, including 1 mM IPTG, or 300 mM NaCl, respectively, using standard methods. Proteins were then analyzed on 10-20% SDS-PAGE gels, under denaturing conditions. Each of FIGS. 1-22 presents an SDS-PAGE pattern for the proteins.
[0047]In addition to the SDS-PAGE work, the proteins were purified, by using Ni2+ chelating sepharose. Either proteins were mixed with charged beads, or were applied onto columns in a balanced salt buffer (0.1M Tris/0.3 M NaCl, pH 8.0). Any impurities were washed away using the same buffer, with a low concentration of imidazole (20-60 mM). Proteins of interest were then eluted, using a buffer containing imidazole at a concentration of from 0.75 to 1.0M.
Example 4
[0048]Once the proteins were purified, they were tested for their ability to bind to antibodies in the sera of infected subjects.
[0049]Proteins were purified on 10-15% SDS-PAGE, and then blot transferred to nitrocellulose membranes. Protein was visualized with Ponceau staining.
[0050]The proteins were then contacted with either pooled sera obtained from patients who had been diagnosed with leptospiroses, or with rats immunized with Lentospira interrogans serovar Copenhageni. In the case of rats, dilutions varied from 1/500 to 1/1000. For patients, dilutions ranged from 1/100 to 1/1000. As controls, sera from healthy individuals and non-immunized rats were used.
[0051]After contact with the sera, a second antibody, either anti-rat or anti-human IgG, labeled with peroxidase was added, followed by O-phenyl diamine benzidine and hydrogen peroxide.
[0052]The results, shown in FIGS. 1-22, inclusive, show that all of the proteins reacted with sera from both sources.
[0053]In the discussion of the proteins which follows, signal and transmembrane regions were based upon the presence of hydrophobic amino acids, including Ile, Tyr, Val, Phe, Leu, Met and Ala, and Nielsen, et al., Protein Engineering 12:3-9 (1999), incorporated by reference. Each description is followed by reference to where the sequence appeared in the provisional application.
[0054]SEQ ID NO: 1 sets forth a polynucleotide segment encoding an amino acid sequence as set forth in SEQ ID NO: 2 with a predicted molecular weight of 52.7 KDa. It is a new Leptospiral lipoprotein, LpL53, according to the rules described in Haake, Microbiology 146:1491-1504 (2000), incorporated by reference. It has a hydrophobic region of a signal peptide from amino acid 4 to 10 characterized by the presence of Tyr, Leu, Ile, Phe, Leu, Phe, Ile, the lipoprotein signal peptidase cleavage site from amino acid 11-14, with Leu, Phe, Ser, Asn, and the cysteine to be lipidated at position 15 of the polypeptide sequence. (3909 & 3910)
[0055]SEQ ID NO: 3 sets forth a polynucleotide segment encoding an amino acid sequence as set forth in SEQ ID NO: 4 with a predicted molecular weight of 55 KDa. It has a signal peptide cleavage site from amino acid 1 to 28. (3531 & 3532)
[0056]SEQ ID NO: 5 sets forth a polynucleotide segment encoding an amino acid sequence as set forth in SEQ ID NO: 6 with a predicted molecular weight of 15.8 KDa. It has a signal peptide cleavage site from amino acid 1 to 38. (3489 & 3490)
[0057]SEQ ID NO: 7 sets forth a polynucleotide segment encoding an amino acid sequence as set forth in SEQ ID NO: 8 with a predicted molecular weight of 30.9 KDa. It has a signal peptide cleavage site from amino acid 1 to 19. (3871 & 3872)
[0058]SEQ ID NO: 9 sets forth a polynucleotide segment encoding an amino acid sequence as set forth in SEQ ID NO: 10 with a predicted molecular weight of 15 KDa. No match with any deposited protein in gene bank was found with this amino acid sequence. It has a signal peptide cleavage site from amino acid 1 to 19 and a transmembrane segment from amino acid 7 to 29, partially overlapping the signal peptide sequence. (3973 & 3974)
[0059]SEQ ID NO: 11 is a polynucleotide segment encoding an amino acid sequence as set forth in SEQ ID NO: 12 with a predicted molecular weight of 20.1 KDa. It has a signal peptide cleavage site from amino acid 1 to 20. (3679 & 3680)
[0060]SEQ ID NO: 13 corresponds to a polynucleotide segment encoding an amino acid sequence as set forth in SEQ ID NO: 14 with a predicted molecular weight of 23 KDa. This polypeptide sequence is a newly identified Leptospiral lipoprotein, according to Haake, supra. It has a signal peptide hydrophobic region from amino acid 6 to 15 (Ile, Val, Tyr, Val, Ile, Tyr, Leu, Phe, Leu, Ile), characterized by a higher proportion of hydrophobic amino acids, a lipoprotein signal peptides from amino acid 16 to 19 (Ser, Leu, Tyr, Gly) and a cysteine to be lipidated at position 20 of the polypeptide sequence. (81 & 82)
[0061]SEQ ID NO: 15 sets forth a polynucleotide segment encoding an amino acid sequence as set forth in SEQ ID NO: 16 with a predicted molecular weight of 40.6 KDa. This polypeptide sequence is a newly isolated Leptospiral lipoprotein, according to the rules described in Haake, supra. It has a signal peptide hydrophobic region from amino acid 7 to 16 (Ile, Leu, Phe, Val, Leu, Thr, Gly, Phe, Ile, Phe), characterized by a higher proportion of hydrophobic amino acids, a lipoprotein signal peptides from amino acid 1 to 20 (Phe, Val, Ser, Ala) and a cysteine to be lipidated at position 21 of the polypeptide sequence. (43 & 44)
[0062]SEQ ID NO: 17 corresponds to a polynucleotide segment encoding an amino acid sequence as set forth in SEQ ID NO: 18 with a predicted molecular weight of 22.6 KDa. This polypeptide sequence is a new Leptospiral lipoprotein, according to Haake, supra. It has a signal peptide hydrophobic region from amino acid 8 to 18 (Ile, Asn, Ile, Leu, Phe, Phe, Phe, Leu, Val, Tyr, Phe), a lipoprotein signal peptidase from amino acid 19 to 22 (Leu, Leu, Phe, Gly) that conforms to the rules described in Haake and a cysteine to be lipidated at position 23 of the polypeptide sequence. (125 & 126)
[0063]SEQ ID NO: 19 corresponds to a polynucleotide segment encoding an amino acid sequence as set forth in SEQ ID NO: 20 with a predicted molecular weight of 17.3 KDa. It has a signal peptide cleavage site from amino acid 1 to 20. (3991 & 3992)
[0064]SEQ ID NO: 21 sets forth a polynucleotide sequence encoding an amino acid sequence as set forth in SEQ ID NO: 22 with a predicted molecular weight of 30.9 KDa. It has a signal peptide cleavage site from amino acid 1 to 27. (3521 & 3522)
[0065]SEQ ID NO: 23 sets forth a polynucleotide sequence encoding an amino acid sequence as set forth in SEQ ID NO: 24 with a predicted molecular weight of 27.1 KDa. It has a signal peptide cleavage site from amino acid 1 to 20. It has some similarity to proteins belonging to cytochrome c family. Examples are: di-haem cytochrome c peroxidase and cytochrome c, class I found in bacteria, such as Bacillus subtilis. (3533 & 3534)
[0066]SEQ ID NO: 25 corresponds to a polynucleotide sequence encoding an amino acid sequence as set forth in SEQ ID NO: 26 with a predicted molecular weight of 20.9 KDa. It has a signal peptide cleavage site from amino acid 1 to 20. (3561 & 3562)
[0067]SEQ ID NO: 27 corresponds to a polynucleotide segment encoding an amino acid sequence as set forth in SEQ ID NO: 28 with a predicted molecular weight of 21.2 KDa. It has a signal peptide cleavage site from amino acid 1 to 34. It has some similarity to prokaryotic N-terminal methylation site found in bacterial general secretion pathway protein G and bacterial type II secretion system protein I/J. Examples of bacteria are E. coli, Xanthomonas canipestris and Pseudomonas aeruginosa. (3675 & 3676)
[0068]SEQ ID NO: 29 corresponds to a polynucleotide sequence encoding an amino acid sequence as set forth in SEQ ID NO: 30 with a predicted molecular weight of 16.6 KDa. It has a signal peptide cleavage site from amino acid 1 to 36. (3819 & 3820)
[0069]SEQ ID NO: 31 corresponds to a polynucleotide sequence encoding an amino acid sequence as set forth in SEQ ID NO: 32 with a predicted molecular weight of 20.5 KDa. It has a signal peptide cleavage site from amino acid 1 to 22. (3829 & 3830)
[0070]SEQ ID NO: 33 is a polynucleotide sequence encoding an amino acid sequence as set forth in SEQ ID NO: 34 with a predicted molecular weight of 20.9 KDa. It has a signal peptide cleavage site from amino acid 1 to 22. This polypeptide has some similarity to proteins having an outer membrane domain (from amino acid 77 to 182) that belong to the OmpA family. Most of these bacterial outer membrane proteins in this group are porin-like, integral membrane proteins, but some are small peptidoglycan-associated lipoprotein (such as pal). Escherichia coli is an example of a bacterium expressing a protein and having this domain. (3793 & 3794)
[0071]SEQ ID NO: 35 is a polynucleotide sequence encoding an amino acid sequence as set forth in SEQ ID NO: 36 with a predicted molecular weight of 63.5 KDa. It has a signal peptide cleavage site from amino acid 1 to 29. This polypeptide has some similarity to outer membrane efflux protein identified in other bacteria. Examples include the E. coli TolC outer membrane protein; the Rhizobium nodulation protein; and the Pseudomonas FusA protein. (4007 & 4008)
[0072]SEQ ID NO: 37 is a polynucleotide sequence encoding an amino acid sequence as set forth in SEQ ID NO: 38 with a predicted molecular weight of 14 KDa. It has a signal peptide cleavage site from amino acid 1 to 23. (3883 & 3884)
[0073]SEQ ID NO: 39 is a polynucleotide sequence encoding an amino acid sequence as set forth in SEQ ID NO: 40 with a predicted molecular weight of 35.6 KDa. It has a signal peptide cleavage site from amino acid 1 to 36. This polypeptide sequence has some similarity to bacterial lipoproteins family identified in bacteria, such as, Escherichia coli. (2019 & 2020)
[0074]SEQ ID NO: 41 is a polynucleotide sequence encoding an amino acid sequence as set forth in SEQ ID NO: 42 with a predicted molecular weight of 39.8 KDa. This protein has a transmembrane region from amino acid 68 to 90. This sequence has similarity to DshA protein of Leptospira with unknown function. (1031 & 1032)
[0075]SEQ ID NO: 43 is a polynucleotide sequence encoding an amino acid sequence as set forth in SEQ ID NO: 44 with a predicted molecular weight of 40 KDa. It is a cytoplasmic membrane protein, with one transmembrane segment from amino acid 63 to 79. This polypeptide sequence has some homology to the MoxR protein identified in Borrelia burgdorferi. The protein family (St. Louis Pfam Web site) (http://pfam.wustl.edu/) predicted two domains in this protein: (i) ATPase family domain associated with various cellular activities (AAA), such as chaperone-like functions that assist in the assembly, operation, or disassembly of protein complexes. (2517 & 2518)
[0076]SEQ ID NO: 45 corresponds to a polynucleotide segment encoding an amino acid sequence as set forth in SEQ ID NO: 46 with a predicted molecular weight of 21 KDa. This protein has a signal peptide cleavage site from amino acid 1 to 40 and a transmembrane domain from amino acid 20 to 40. The polypeptide sequence has some similarity to bacterial signal peptidases identified in bacteria, such as, Sinorhizobium meliloti and Bacillus subtilis. This is a Leptospiral membrane protein MPL21. (1991 & 1992)
[0077]The foregoing disclosure set forth various aspects of the invention, including the isolated, Leptospira surface proteins, the amino acid sequences of which are set forth as an attachment hereto, and isolated nucleic acid molecules which encode these proteins such as those set forth herein. It will be understood that once an amino acid sequence is known, various degenerate nucleotide sequences can be provided which encode that sequence. All of those are encompassed by this invention.
[0078]Also a part of the invention are antibodies which bind specifically to the proteins of the invention, monoclonal antibodies in particular, and the hybridoma which produce them.
[0079]"Surface protein" as used herein, refers to proteins which are associated and/or exposed to the surface of the organism.
[0080]The proteins of the invention may be used, alone or in combination with each other, as or as components of vaccines. Further, they can be used as immunogens, so as to generate an antibody response. The antibodies thus generated can be used, e.g., as diagnostic tools to determine Leptospira infection or presence, as well as components of vaccines used to generate passive immunity. Proteins and antibodies may be administered "neat" or "compounded" with other standard materials used in preparing vaccines, such as carriers, adjuvants, and other materials. Intravenous formulations are one embodiment and, it will be understood that other formulations of vaccines are possible, including intradermal, subcutaneous, oral, such as sublingual forms, and others. The vaccines may be in liquid or "dry" form, such as in lyophilized form. This type of vaccine is especially suitable when it must be carried "in the field," and used at some point in time later than when carried.
[0081]The nucleic acid molecules of the invention, as will be understood by the skilled artisan, can be used to produce the proteins described supra, via any of the recombinant methodologies well known to the skilled artisan. They can be placed in, e.g., expression vectors, under control of a promoter or other regulatory element, or they can be used "as is" to transfect or to transform cells. Eukaryotic cells, such as yeast cells, CHO cells, fibroblasts, insect cells, etc., are among the eukaryotes which can be transformed or transfected. Prokaryotes, such as E. coli or other bacteria can also be used. The choice of host cell will depend upon many factors, including whether or not glycosylation is desired, and to what end the transformant or transfectant will be used. One way these recombinant cells can be used is as in the form of a cell based vaccine, such as a whole cell vaccine. As the recombinant proteins of the invention are all surface proteins, it is to be expected that they will be expressed on the surface of host cells. If the cells are then processed so as to become non-proliferative, the cells present an ideal vaccine, especially if the host cell is one that is not normally the target of immune surveillance in the host.
[0082]Another aspect of the invention is the use of membrane preparations, or cellular "ghosts" of transformants or tranfectants. Such approaches have been used with other bacterial species, so preparation of these is well known. Transformants or transfectants which express the surface proteins of the invention can be used to prepare these materials in a fashion taught by the art.
[0083]The proteins have been discussed as vaccines, supra. It is to be understood that the vaccines of the invention can be formulated for any subject. Human vaccines are, of course, included, but so are vaccines for livestock animals, such as sheep, bovine animals, goats, pigs and so forth, and domesticated animals such as pets, confined zoo animals, etcetera. The vaccines may be used prophylactically, e.g., by administering them prior to possible exposure to Leptospira, and may also be used post exposure, in order to treat a pre-existing infection.
[0084]As will be recognized by the skilled artisan, the use of the proteins of the invention, or portions thereof, constitutes vaccination, and the protein or portion of the protein constitutes the vaccine. Upon administration to the individual or subject, in any of the ways described supra, an immune response results which protects the individual or subject when confronted with the pathogen. Such an approach, i.e., the immunization with one or more proteins or portions of proteins, can be used therapeutically or prophylactically. Passive immunization, as described supra, can also be used. In such a case, antibodies are developed against the proteins or protein portions, and via passive transfer serve a role in, e.g., prophylaxis.
[0085]It is to be understood that, while immunization with the proteins or portions of proteins can serve to stimulate an antibody response, cellular immune responses are also a part of the response of the subject to the immunization. It is well within the skill of the artisan to determine which proteins or portions of proteins function as antibody or cellular immune vaccine agents and that artisan can then formulate, e.g., "cocktails" of appropriate mixes of proteins which have the desired, immune effect.
[0086]In addition to the use of the proteins as vaccines, it is to be understood that the nucleic acid molecules described herein can also be used as vaccines. Via targeted delivery of nucleic acid molecules, one can assure an "in vivo" supply of the desired protein or protein portion molecules at a site of relevance. The artisan of delivery systems, such as liposomes, adenoviruses, retroviruses, and other formats for the delivery of DNA as immunoprophylactic or a therapeutic agents, and all are envisioned as methods for administering the vaccine. It should be kept in mind that the nucleic acid molecules of the invention include those which encode the proteins of the invention, but differ in nucleotide sequence due to codon degeneracy. Indeed, due to patterns of codon usage, which vary from organism to organism, it may be desirable to alter the sequence to maximize expression of the desired vaccine in the treated subject.
[0087]To prepare a vaccine the purified polypeptide can be isolated, lyophilized and/or stabilized, as described supra. The protein may then be adjusted to an appropriate concentration, optionally combined with a suitable vaccine adjuvant, and packaged for use. Suitable adjuvants include but are not limited to: surfactants and pluronic polyols; polyanions, e.g., pyran, dextran sulfate, poly IC; polyacrylics, carbopol; peptides, e.g., muramyl dipeptide, dimethylglycine, oil emulsions, vitamins, cytokines, hormones, aluminum, calcium salts, and mixtures thereof, bacterial and plant products, e.g., Bacillus Calmette-Guerin (BCG), complete Freund's adjuvant, and threalose. Alternatively, the immunogenic protein may be incorporated into liposomes for use in a vaccine formulation, may be fused to other immunogenic proteins, or may be conjugated to polysaccharides or other polymers. See Edelman, in New Generation Vaccines (Marshall Decker, N.Y. 1997), incorporated by reference.
[0088]The weight of the immunogenic protein included in a given dosage of vaccine can vary widely, e.g., from 5 ug-300 mg., and depends on: the age, weight, and physical condition of the animal or the human subject considered for vaccination.
[0089]In addition, the nucleic acid molecules of the invention can be used as vaccines. The rational of this approach is that the DNA will produce the protein following injection thus in turn inducing the desired immune response.
[0090]For such vaccines, a pharmaceutical composition can include either a mammalian recombinant expression vector, such as pTARGET, or a construct such as an expression vector, which includes a nucleic acid molecule encoding the protein, operatively linked to transcription control/terminator sequences, combined with a pharmaceutically acceptable carrier. These may include, but are not limited to, aqueous physiologically balanced solutions, artificial lipid-containing substrates, natural lipid-containing substrates, oils, esters, and glycols. Pharmaceutically acceptable carriers can also include a suitable delivery vehicle, such as liposomes, micelles, and cells. Adjuvants for DNA based vaccines can be used, such as CpG oligonucleotides and cytonkines. The vaccines can also be delivered by attenuated bacteria, such as Salmonella.
[0091]Another feature of the invention is the use of the proteins, or portions of the proteins of the invention, as well as nucleic acid molecules and portions of nucleic acid molecules, in the manufacture of kits useful for diagnosis of Leptospira infection, either "in the field" or in the laboratory. Such kits involve, e.g., the protein, protein portion, nucleic acid molecule, or nucleic acid molecule portion, in combination with, e.g., a solid phase, such as a bead, mutltiwell plate, etc., to which the component is affixed. The kit can then be used by contacting a sample of interest thereto, followed by a second component, which can also be included in the kit, such as a labeled protein or proteins portion, or labeled nucleic acid molecule or portion of a nucleic acid molecule. When nucleic acid molecules are used in the diagnostic kits of the invention, it is desirable that each portion hybridize to a separate portion of a target nucleic acid molecule.
[0092]It may be desirable to screen the proteins and nucleic acid molecules of the invention in, e.g., and animal or cellular model prior to administration to large animals or humans. Standard practice tests a potential vaccine in, e.g., a hamster, mouse, rat or other rodent model to determine it efficacy and strength, and the molecules of this invention may be so tested as well. Testing of the DNA molecules in, e.g., microorganisms such as E. coli or other prokaryotes or eukaryote organisms can be carried out to deter mine which are, in fact, good producers, i.e., molecules which produce high yields, and/or produce transformants which react well to culture.
Other aspects of the inventions will be clear to the skilled artisan, and need not be reiterated here.
Sequence CWU
1
4611431DNALeptospira interrogans serovar copenhageniCDS(1)...(1428) 1ttg
gtt cgt tat tta att ttt ctt ttt att tta ttt tcg aat tgt tta 48Leu
Val Arg Tyr Leu Ile Phe Leu Phe Ile Leu Phe Ser Asn Cys Leu 1
5 10 15cct acc aat gtg ttt ggt ata
gcg gcc ccc gaa aac att gat tat tgg 96Pro Thr Asn Val Phe Gly Ile
Ala Ala Pro Glu Asn Ile Asp Tyr Trp 20 25
30att cat ttt cta ctg aaa att ccg gat ttt ctt tta cag aat
aac gat 144Ile His Phe Leu Leu Lys Ile Pro Asp Phe Leu Leu Gln Asn
Asn Asp 35 40 45cca ctt cac tca
gat tct caa tct gac tca aga tta gat tgg acc tta 192Pro Leu His Ser
Asp Ser Gln Ser Asp Ser Arg Leu Asp Trp Thr Leu 50
55 60tta atc gga gct gaa aat gct caa acg gca agt aaa ggt
atc tac gta 240Leu Ile Gly Ala Glu Asn Ala Gln Thr Ala Ser Lys Gly
Ile Tyr Val 65 70 75
80gat caa aat ggt ttt atc tac gta gtt ggt gaa acc aat gga ggt gtt
288Asp Gln Asn Gly Phe Ile Tyr Val Val Gly Glu Thr Asn Gly Gly Val
85 90 95tat aat ccg aga cca
atc gga atg aaa gat ctc att tta gga aag tat 336Tyr Asn Pro Arg Pro
Ile Gly Met Lys Asp Leu Ile Leu Gly Lys Tyr 100
105 110gat tct cat aaa aat aca atc tgg act caa caa att
gga gct att gac 384Asp Ser His Lys Asn Thr Ile Trp Thr Gln Gln Ile
Gly Ala Ile Asp 115 120 125gta gca
ttg aat gtt agc gct atg act gtc gat cat aac gga aat gtt 432Val Ala
Leu Asn Val Ser Ala Met Thr Val Asp His Asn Gly Asn Val 130
135 140tac gtt acc ggt agt acg ggc aat gat gga ttt
ttt ccc aac cca ctt 480Tyr Val Thr Gly Ser Thr Gly Asn Asp Gly Phe
Phe Pro Asn Pro Leu145 150 155
160cgt agt tca gaa gat atg ttc gta att aaa ttc aac tcg gac gga acc
528Arg Ser Ser Glu Asp Met Phe Val Ile Lys Phe Asn Ser Asp Gly Thr
165 170 175aga gat tgg act aca
caa gcc ggc cca cag gaa aaa gaa tcc aga aca 576Arg Asp Trp Thr Thr
Gln Ala Gly Pro Gln Glu Lys Glu Ser Arg Thr 180
185 190act cca aca agt att tat ata gat aca tct gga aat
att ttt gta gtt 624Thr Pro Thr Ser Ile Tyr Ile Asp Thr Ser Gly Asn
Ile Phe Val Val 195 200 205ggg ttt
tca agc gga cct ttc gga ggt ccg gaa tta ggg gcg aac gga 672Gly Phe
Ser Ser Gly Pro Phe Gly Gly Pro Glu Leu Gly Ala Asn Gly 210
215 220ttt ata gct aaa ttt gat cct caa gga aat caa
act tgg gtc aga caa 720Phe Ile Ala Lys Phe Asp Pro Gln Gly Asn Gln
Thr Trp Val Arg Gln225 230 235
240ctt ttc att agt aga cat act caa atc tcc aca cta tgt gcc gct ttc
768Leu Phe Ile Ser Arg His Thr Gln Ile Ser Thr Leu Cys Ala Ala Phe
245 250 255gac aga gtt caa aat
act tat gta acc ggt tcg gga aac gca aat ttt 816Asp Arg Val Gln Asn
Thr Tyr Val Thr Gly Ser Gly Asn Ala Asn Phe 260
265 270gaa acg aat aca gag ata aat gac ttc ggc gtg aaa
aat ctt ttt att 864Glu Thr Asn Thr Glu Ile Asn Asp Phe Gly Val Lys
Asn Leu Phe Ile 275 280 285ttc aaa
tat gat aac gat aat gga aac aaa caa ttt ttc gct caa ctt 912Phe Lys
Tyr Asp Asn Asp Asn Gly Asn Lys Gln Phe Phe Ala Gln Leu 290
295 300agt ttc cct tca aga tca att gaa agt aat act
ata aca gtt gat act 960Ser Phe Pro Ser Arg Ser Ile Glu Ser Asn Thr
Ile Thr Val Asp Thr305 310 315
320tta gga aac gtt ttt gta ggt gga aat agc aac gct gat ttt gga tcc
1008Leu Gly Asn Val Phe Val Gly Gly Asn Ser Asn Ala Asp Phe Gly Ser
325 330 335ggt gct gac aga acg
tct cat ctt gca acc ttg gta aaa tac aat tct 1056Gly Ala Asp Arg Thr
Ser His Leu Ala Thr Leu Val Lys Tyr Asn Ser 340
345 350tta ggt gtt ctt caa tgg atc caa caa tta ggc ccg
gca caa agc caa 1104Leu Gly Val Leu Gln Trp Ile Gln Gln Leu Gly Pro
Ala Gln Ser Gln 355 360 365gat cct
caa aat aat tat cat act act att tct tct cta gat aca gat 1152Asp Pro
Gln Asn Asn Tyr His Thr Thr Ile Ser Ser Leu Asp Thr Asp 370
375 380act gag gga aat gtc tat tca ata ggt tct aca
aat gga aat ata tta 1200Thr Glu Gly Asn Val Tyr Ser Ile Gly Ser Thr
Asn Gly Asn Ile Leu385 390 395
400aaa gta cat gaa aac tct acc ggt att cga gat cta ttt ttt aca aaa
1248Lys Val His Glu Asn Ser Thr Gly Ile Arg Asp Leu Phe Phe Thr Lys
405 410 415cac aat cct tcc gga
gaa tta atc tgg tca cga caa ata ggc gct cct 1296His Asn Pro Ser Gly
Glu Leu Ile Trp Ser Arg Gln Ile Gly Ala Pro 420
425 430aat aga ctt aaa att ggt aat gga ata gca cat gac
tta aat gga aat 1344Asn Arg Leu Lys Ile Gly Asn Gly Ile Ala His Asp
Leu Asn Gly Asn 435 440 445tta tat
tac atg ggg aat aca aac gaa tat cta cat gaa gaa gcc gct 1392Leu Tyr
Tyr Met Gly Asn Thr Asn Glu Tyr Leu His Glu Glu Ala Ala 450
455 460gtg cat gac tta tat ata ttc atc gtc aaa tat
aaa tga 1431Val His Asp Leu Tyr Ile Phe Ile Val Lys Tyr
Lys465 470 4752476PRTLeptospira
interrogans serovar copenhageni 2Leu Val Arg Tyr Leu Ile Phe Leu Phe Ile
Leu Phe Ser Asn Cys Leu 1 5 10
15Pro Thr Asn Val Phe Gly Ile Ala Ala Pro Glu Asn Ile Asp Tyr Trp
20 25 30Ile His Phe Leu Leu
Lys Ile Pro Asp Phe Leu Leu Gln Asn Asn Asp 35
40 45Pro Leu His Ser Asp Ser Gln Ser Asp Ser Arg Leu Asp
Trp Thr Leu 50 55 60Leu Ile Gly Ala
Glu Asn Ala Gln Thr Ala Ser Lys Gly Ile Tyr Val 65 70
75 80Asp Gln Asn Gly Phe Ile Tyr Val Val
Gly Glu Thr Asn Gly Gly Val 85 90
95Tyr Asn Pro Arg Pro Ile Gly Met Lys Asp Leu Ile Leu Gly Lys
Tyr 100 105 110Asp Ser His Lys
Asn Thr Ile Trp Thr Gln Gln Ile Gly Ala Ile Asp 115
120 125Val Ala Leu Asn Val Ser Ala Met Thr Val Asp His
Asn Gly Asn Val 130 135 140Tyr Val Thr
Gly Ser Thr Gly Asn Asp Gly Phe Phe Pro Asn Pro Leu145
150 155 160Arg Ser Ser Glu Asp Met Phe
Val Ile Lys Phe Asn Ser Asp Gly Thr 165
170 175Arg Asp Trp Thr Thr Gln Ala Gly Pro Gln Glu Lys
Glu Ser Arg Thr 180 185 190Thr
Pro Thr Ser Ile Tyr Ile Asp Thr Ser Gly Asn Ile Phe Val Val 195
200 205Gly Phe Ser Ser Gly Pro Phe Gly Gly
Pro Glu Leu Gly Ala Asn Gly 210 215
220Phe Ile Ala Lys Phe Asp Pro Gln Gly Asn Gln Thr Trp Val Arg Gln225
230 235 240Leu Phe Ile Ser
Arg His Thr Gln Ile Ser Thr Leu Cys Ala Ala Phe 245
250 255Asp Arg Val Gln Asn Thr Tyr Val Thr Gly
Ser Gly Asn Ala Asn Phe 260 265
270Glu Thr Asn Thr Glu Ile Asn Asp Phe Gly Val Lys Asn Leu Phe Ile
275 280 285Phe Lys Tyr Asp Asn Asp Asn
Gly Asn Lys Gln Phe Phe Ala Gln Leu 290 295
300Ser Phe Pro Ser Arg Ser Ile Glu Ser Asn Thr Ile Thr Val Asp
Thr305 310 315 320Leu Gly
Asn Val Phe Val Gly Gly Asn Ser Asn Ala Asp Phe Gly Ser
325 330 335Gly Ala Asp Arg Thr Ser His
Leu Ala Thr Leu Val Lys Tyr Asn Ser 340 345
350Leu Gly Val Leu Gln Trp Ile Gln Gln Leu Gly Pro Ala Gln
Ser Gln 355 360 365Asp Pro Gln Asn
Asn Tyr His Thr Thr Ile Ser Ser Leu Asp Thr Asp 370
375 380Thr Glu Gly Asn Val Tyr Ser Ile Gly Ser Thr Asn
Gly Asn Ile Leu385 390 395
400Lys Val His Glu Asn Ser Thr Gly Ile Arg Asp Leu Phe Phe Thr Lys
405 410 415His Asn Pro Ser Gly
Glu Leu Ile Trp Ser Arg Gln Ile Gly Ala Pro 420
425 430Asn Arg Leu Lys Ile Gly Asn Gly Ile Ala His Asp
Leu Asn Gly Asn 435 440 445Leu Tyr
Tyr Met Gly Asn Thr Asn Glu Tyr Leu His Glu Glu Ala Ala 450
455 460Val His Asp Leu Tyr Ile Phe Ile Val Lys Tyr
Lys465 470 47531470DNALeptospira
interrogans serovar copenhageniCDS(1)...(1467) 3ttg ttc gag gga aac atg
aga ata ttt caa att tat ata att cta ttg 48Leu Phe Glu Gly Asn Met
Arg Ile Phe Gln Ile Tyr Ile Ile Leu Leu 1 5
10 15ttg tcc tta ttc ctg gcc cga acg gca tat tcg gaa
caa atc gta tcc 96Leu Ser Leu Phe Leu Ala Arg Thr Ala Tyr Ser Glu
Gln Ile Val Ser 20 25 30tca
aaa aaa gac gaa ccg gat gct tac tac gga ctg gat gta aaa gcg 144Ser
Lys Lys Asp Glu Pro Asp Ala Tyr Tyr Gly Leu Asp Val Lys Ala 35
40 45gtc att tcc cct tcc tac gga gcc aga
att aga gac ggc gca tct ggt 192Val Ile Ser Pro Ser Tyr Gly Ala Arg
Ile Arg Asp Gly Ala Ser Gly 50 55
60att tcc aac tcg gct cca aat gat aag aca ggg ttt tcc act cct tgg
240Ile Ser Asn Ser Ala Pro Asn Asp Lys Thr Gly Phe Ser Thr Pro Trp 65
70 75 80acc att ctt atg
att tct aaa acg ttt gaa gaa acc gga atc caa gca 288Thr Ile Leu Met
Ile Ser Lys Thr Phe Glu Glu Thr Gly Ile Gln Ala 85
90 95gaa ctc tgg ggg gaa ctt atc aga aac aac
caa cta aca tcg gat aca 336Glu Leu Trp Gly Glu Leu Ile Arg Asn Asn
Gln Leu Thr Ser Asp Thr 100 105
110cga act gac tct gga aca aaa caa aat cct tat att cta aac gtt cgt
384Arg Thr Asp Ser Gly Thr Lys Gln Asn Pro Tyr Ile Leu Asn Val Arg
115 120 125aga gcc agt att aaa aag aat
tgg gaa act tct tcc tat ggc aat tat 432Arg Ala Ser Ile Lys Lys Asn
Trp Glu Thr Ser Ser Tyr Gly Asn Tyr 130 135
140tct atc ggt ttc gga att caa gaa tta cct cat aca tac act cag tgg
480Ser Ile Gly Phe Gly Ile Gln Glu Leu Pro His Thr Tyr Thr Gln Trp145
150 155 160agt aac tat tgg
aga tgg aga tat att gac aaa ggt cct tta gaa tct 528Ser Asn Tyr Trp
Arg Trp Arg Tyr Ile Asp Lys Gly Pro Leu Glu Ser 165
170 175ctt ggt ttt gca cct caa ccc gcc gac ata
gga ttg aat gcg acc gga 576Leu Gly Phe Ala Pro Gln Pro Ala Asp Ile
Gly Leu Asn Ala Thr Gly 180 185
190aaa tgg tcc att ttc agc gca caa att atg atc agt aac gga gaa ggt
624Lys Trp Ser Ile Phe Ser Ala Gln Ile Met Ile Ser Asn Gly Glu Gly
195 200 205tat aga gaa acc caa aac aca
aat tct tcc gga atg gac gtt tcc tcc 672Tyr Arg Glu Thr Gln Asn Thr
Asn Ser Ser Gly Met Asp Val Ser Ser 210 215
220aga ttt tcc att gaa cct atg tta ggc gaa aaa acc aaa acg ggg ctt
720Arg Phe Ser Ile Glu Pro Met Leu Gly Glu Lys Thr Lys Thr Gly Leu225
230 235 240cat tta ttt tat
aga aaa gaa aac gct ttc ggc ttt gga gga aac gaa 768His Leu Phe Tyr
Arg Lys Glu Asn Ala Phe Gly Phe Gly Gly Asn Glu 245
250 255tgt ttc gaa ggg aaa aca aac tgt ctt cca
aac gat cta aat ccg gct 816Cys Phe Glu Gly Lys Thr Asn Cys Leu Pro
Asn Asp Leu Asn Pro Ala 260 265
270act tca tta tat aga caa att caa agt tta cag tcc gac act ttt ggt
864Thr Ser Leu Tyr Arg Gln Ile Gln Ser Leu Gln Ser Asp Thr Phe Gly
275 280 285tca gaa tcc aat ttg att tgg
aat ggt ttt ttg act tgg aat cta ggt 912Ser Glu Ser Asn Leu Ile Trp
Asn Gly Phe Leu Thr Trp Asn Leu Gly 290 295
300ttg ggc gga att ctc aaa aaa caa aac agc gga gaa atc cga gat aga
960Leu Gly Gly Ile Leu Lys Lys Gln Asn Ser Gly Glu Ile Arg Asp Arg305
310 315 320ctt cag ccg ttt
gca cct ccg att gct ttc gga aaa gac ggt ttc gga 1008Leu Gln Pro Phe
Ala Pro Pro Ile Ala Phe Gly Lys Asp Gly Phe Gly 325
330 335aag gcg tta tac att tgg tta tcc ata ggc
atc gaa aaa ttt cat ctt 1056Lys Ala Leu Tyr Ile Trp Leu Ser Ile Gly
Ile Glu Lys Phe His Leu 340 345
350ctg ggg aga ata gaa caa ggc aca gga aac aac gga att atg ggt gtc
1104Leu Gly Arg Ile Glu Gln Gly Thr Gly Asn Asn Gly Ile Met Gly Val
355 360 365acc gac acg gta caa aaa gaa
ttt cta cct ggt tta gga att cca aat 1152Thr Asp Thr Val Gln Lys Glu
Phe Leu Pro Gly Leu Gly Ile Pro Asn 370 375
380gta gat gct aca tta caa att cgg aat att ctc cca gaa acc aga gca
1200Val Asp Ala Thr Leu Gln Ile Arg Asn Ile Leu Pro Glu Thr Arg Ala385
390 395 400ggt gga tat tcc
agt aaa agt tca ttt aga agg atc agt gtg ttt ttc 1248Gly Gly Tyr Ser
Ser Lys Ser Ser Phe Arg Arg Ile Ser Val Phe Phe 405
410 415gaa tgg att gta aat ccc aga ttt aga atg
gca atc ggc tat atc gaa 1296Glu Trp Ile Val Asn Pro Arg Phe Arg Met
Ala Ile Gly Tyr Ile Glu 420 425
430aat aaa aat tat gat ttg aac gga ata tcc caa cgc gct tat atc gat
1344Asn Lys Asn Tyr Asp Leu Asn Gly Ile Ser Gln Arg Ala Tyr Ile Asp
435 440 445cca ctc ggg aat gaa aga act
gaa aaa gaa tat ctt tct caa tgg aaa 1392Pro Leu Gly Asn Glu Arg Thr
Glu Lys Glu Tyr Leu Ser Gln Trp Lys 450 455
460gag tca gga aac tta gga att gtt tct tat tcg gtt ttg gat aaa caa
1440Glu Ser Gly Asn Leu Gly Ile Val Ser Tyr Ser Val Leu Asp Lys Gln465
470 475 480ata ctt tta aga
act aca ata gaa ttc taa 1470Ile Leu Leu Arg
Thr Thr Ile Glu Phe 4854489PRTLeptospira interrogans
serovar copenhageni 4Leu Phe Glu Gly Asn Met Arg Ile Phe Gln Ile Tyr Ile
Ile Leu Leu 1 5 10 15Leu
Ser Leu Phe Leu Ala Arg Thr Ala Tyr Ser Glu Gln Ile Val Ser
20 25 30Ser Lys Lys Asp Glu Pro Asp Ala
Tyr Tyr Gly Leu Asp Val Lys Ala 35 40
45Val Ile Ser Pro Ser Tyr Gly Ala Arg Ile Arg Asp Gly Ala Ser Gly
50 55 60Ile Ser Asn Ser Ala Pro Asn
Asp Lys Thr Gly Phe Ser Thr Pro Trp 65 70
75 80Thr Ile Leu Met Ile Ser Lys Thr Phe Glu Glu Thr
Gly Ile Gln Ala 85 90
95Glu Leu Trp Gly Glu Leu Ile Arg Asn Asn Gln Leu Thr Ser Asp Thr
100 105 110Arg Thr Asp Ser Gly Thr Lys
Gln Asn Pro Tyr Ile Leu Asn Val Arg 115 120
125Arg Ala Ser Ile Lys Lys Asn Trp Glu Thr Ser Ser Tyr Gly Asn
Tyr 130 135 140Ser Ile Gly Phe Gly Ile
Gln Glu Leu Pro His Thr Tyr Thr Gln Trp145 150
155 160Ser Asn Tyr Trp Arg Trp Arg Tyr Ile Asp Lys
Gly Pro Leu Glu Ser 165 170
175Leu Gly Phe Ala Pro Gln Pro Ala Asp Ile Gly Leu Asn Ala Thr Gly
180 185 190Lys Trp Ser Ile Phe Ser
Ala Gln Ile Met Ile Ser Asn Gly Glu Gly 195 200
205Tyr Arg Glu Thr Gln Asn Thr Asn Ser Ser Gly Met Asp Val
Ser Ser 210 215 220Arg Phe Ser Ile Glu
Pro Met Leu Gly Glu Lys Thr Lys Thr Gly Leu225 230
235 240His Leu Phe Tyr Arg Lys Glu Asn Ala Phe
Gly Phe Gly Gly Asn Glu 245 250
255Cys Phe Glu Gly Lys Thr Asn Cys Leu Pro Asn Asp Leu Asn Pro Ala
260 265 270Thr Ser Leu Tyr Arg
Gln Ile Gln Ser Leu Gln Ser Asp Thr Phe Gly 275
280 285Ser Glu Ser Asn Leu Ile Trp Asn Gly Phe Leu Thr
Trp Asn Leu Gly 290 295 300Leu Gly Gly
Ile Leu Lys Lys Gln Asn Ser Gly Glu Ile Arg Asp Arg305
310 315 320Leu Gln Pro Phe Ala Pro Pro
Ile Ala Phe Gly Lys Asp Gly Phe Gly 325
330 335Lys Ala Leu Tyr Ile Trp Leu Ser Ile Gly Ile Glu
Lys Phe His Leu 340 345 350Leu
Gly Arg Ile Glu Gln Gly Thr Gly Asn Asn Gly Ile Met Gly Val 355
360 365Thr Asp Thr Val Gln Lys Glu Phe Leu
Pro Gly Leu Gly Ile Pro Asn 370 375
380Val Asp Ala Thr Leu Gln Ile Arg Asn Ile Leu Pro Glu Thr Arg Ala385
390 395 400Gly Gly Tyr Ser
Ser Lys Ser Ser Phe Arg Arg Ile Ser Val Phe Phe 405
410 415Glu Trp Ile Val Asn Pro Arg Phe Arg Met
Ala Ile Gly Tyr Ile Glu 420 425
430Asn Lys Asn Tyr Asp Leu Asn Gly Ile Ser Gln Arg Ala Tyr Ile Asp
435 440 445Pro Leu Gly Asn Glu Arg Thr
Glu Lys Glu Tyr Leu Ser Gln Trp Lys 450 455
460Glu Ser Gly Asn Leu Gly Ile Val Ser Tyr Ser Val Leu Asp Lys
Gln465 470 475 480Ile Leu
Leu Arg Thr Thr Ile Glu Phe 4855420DNALeptospira
interrogans serovar copenhageniCDS(1)...(417) 5atg aga ttc aaa tcg aga
tta ttt ttt tct tgt atg atc gtt ttt ttg 48Met Arg Phe Lys Ser Arg
Leu Phe Phe Ser Cys Met Ile Val Phe Leu 1 5
10 15agc aca act ctg ata gca tat aca atc ctt ccg tgt
tct ttt ggt tta 96Ser Thr Thr Leu Ile Ala Tyr Thr Ile Leu Pro Cys
Ser Phe Gly Leu 20 25 30gat
gct tgt tcc tgt gaa cca act cgg gga gaa acg ttg att agt tct 144Asp
Ala Cys Ser Cys Glu Pro Thr Arg Gly Glu Thr Leu Ile Ser Ser 35
40 45ctc tta ttt tta aca act aac tct gat
aaa acg tcc tgt cat agt att 192Leu Leu Phe Leu Thr Thr Asn Ser Asp
Lys Thr Ser Cys His Ser Ile 50 55
60acg gat tct gta tgt tac gaa agt ttt cat tcc gat tcg ttt tca att
240Thr Asp Ser Val Cys Tyr Glu Ser Phe His Ser Asp Ser Phe Ser Ile 65
70 75 80tta tgc aaa atg
tct aat gct gaa atc cgt tta aat gac gtc tgt tct 288Leu Cys Lys Met
Ser Asn Ala Glu Ile Arg Leu Asn Asp Val Cys Ser 85
90 95gat caa aat tca gtt gga gat tgt tat cta
gat aat tta cga ttg acg 336Asp Gln Asn Ser Val Gly Asp Cys Tyr Leu
Asp Asn Leu Arg Leu Thr 100 105
110ttt tat aac gat act tat act tct aag gcc gca gaa gat tat tgt aaa
384Phe Tyr Asn Asp Thr Tyr Thr Ser Lys Ala Ala Glu Asp Tyr Cys Lys
115 120 125aat caa ctg aga gga ttt ttt
tac aat aat aga tga 420Asn Gln Leu Arg Gly Phe Phe
Tyr Asn Asn Arg 130 1356139PRTLeptospira interrogans
serovar copenhageni 6Met Arg Phe Lys Ser Arg Leu Phe Phe Ser Cys Met Ile
Val Phe Leu 1 5 10 15Ser
Thr Thr Leu Ile Ala Tyr Thr Ile Leu Pro Cys Ser Phe Gly Leu
20 25 30Asp Ala Cys Ser Cys Glu Pro Thr
Arg Gly Glu Thr Leu Ile Ser Ser 35 40
45Leu Leu Phe Leu Thr Thr Asn Ser Asp Lys Thr Ser Cys His Ser Ile
50 55 60Thr Asp Ser Val Cys Tyr Glu
Ser Phe His Ser Asp Ser Phe Ser Ile 65 70
75 80Leu Cys Lys Met Ser Asn Ala Glu Ile Arg Leu Asn
Asp Val Cys Ser 85 90
95Asp Gln Asn Ser Val Gly Asp Cys Tyr Leu Asp Asn Leu Arg Leu Thr
100 105 110Phe Tyr Asn Asp Thr Tyr Thr
Ser Lys Ala Ala Glu Asp Tyr Cys Lys 115 120
125Asn Gln Leu Arg Gly Phe Phe Tyr Asn Asn Arg 130
1357918DNALeptospira interrogans serovar copenhageniCDS(1)...(915)
7gtg ttt gaa aac aat gta gga gaa aat atg att caa aaa tcg att tta
48Val Phe Glu Asn Asn Val Gly Glu Asn Met Ile Gln Lys Ser Ile Leu 1
5 10 15ata ttt ctg gtc ttt ctt
tcc ttc gtg gtt tgt aag aag gat tcc aac 96Ile Phe Leu Val Phe Leu
Ser Phe Val Val Cys Lys Lys Asp Ser Asn 20
25 30gat gat gat ctt act gta gct gct ttg gcc gcg ctt tct
ggc gga tat 144Asp Asp Asp Leu Thr Val Ala Ala Leu Ala Ala Leu Ser
Gly Gly Tyr 35 40 45tgt aat gga
agt tca gct aat acg gga att aca gta tct aag ggt acg 192Cys Asn Gly
Ser Ser Ala Asn Thr Gly Ile Thr Val Ser Lys Gly Thr 50
55 60gca act ttg gat gca tcc tca ggt tgt gtt acc gga
gtg act act tgt 240Ala Thr Leu Asp Ala Ser Ser Gly Cys Val Thr Gly
Val Thr Thr Cys 65 70 75
80atg gat tca gcg ctt cct act tgg atc aag aat aac ttt aaa tgt tcc
288Met Asp Ser Ala Leu Pro Thr Trp Ile Lys Asn Asn Phe Lys Cys Ser
85 90 95gta gct tat gta tct
ggt tcc agt tat ata ttt aaa tct cag aac gtt 336Val Ala Tyr Val Ser
Gly Ser Ser Tyr Ile Phe Lys Ser Gln Asn Val 100
105 110ccc aat acg aaa agt tat tat tac ggt tca agt tct
cct ttg ttt gaa 384Pro Asn Thr Lys Ser Tyr Tyr Tyr Gly Ser Ser Ser
Pro Leu Phe Glu 115 120 125aca ctt
ccg aca gga aat atg cct gca gga aat aat tcc gtt tcg agt 432Thr Leu
Pro Thr Gly Asn Met Pro Ala Gly Asn Asn Ser Val Ser Ser 130
135 140caa aaa ttc gtt tat acg att cct tcc agt ccc
ata aaa gga agt gga 480Gln Lys Phe Val Tyr Thr Ile Pro Ser Ser Pro
Ile Lys Gly Ser Gly145 150 155
160act gtc gga aca caa ggc gga ctt gtg tcg ata gga att aca gta aac
528Thr Val Gly Thr Gln Gly Gly Leu Val Ser Ile Gly Ile Thr Val Asn
165 170 175ggt ctt gcg att ttt
aat aac gca gcc aat cca cct gat act ctc gca 576Gly Leu Ala Ile Phe
Asn Asn Ala Ala Asn Pro Pro Asp Thr Leu Ala 180
185 190gtg gag gct cag act ttt gat aac ttt gga ggc cat
cct caa aat aca 624Val Glu Ala Gln Thr Phe Asp Asn Phe Gly Gly His
Pro Gln Asn Thr 195 200 205ggg gtt
tat cac cat cac gca gcg gta aca aag gtg agt aac aac gat 672Gly Val
Tyr His His His Ala Ala Val Thr Lys Val Ser Asn Asn Asp 210
215 220tca aat ttg atc gga gtg att ttg gat ggt tac
gca att tac gga aaa 720Ser Asn Leu Ile Gly Val Ile Leu Asp Gly Tyr
Ala Ile Tyr Gly Lys225 230 235
240aaa tgc gat aac gga act tcg tca act gga gat gac ttt gtc cca act
768Lys Cys Asp Asn Gly Thr Ser Ser Thr Gly Asp Asp Phe Val Pro Thr
245 250 255gat ttg gat aat ttg
cat ggg cat aca aaa gct acg gtt cac ttt tct 816Asp Leu Asp Asn Leu
His Gly His Thr Lys Ala Thr Val His Phe Ser 260
265 270act cca act tat cac tat cac ttt gct cct gat gct
act gca ggg att 864Thr Pro Thr Tyr His Tyr His Phe Ala Pro Asp Ala
Thr Ala Gly Ile 275 280 285gac act
ttg atg ggt tcc ttt ttt tac gga acg ata gga agt gtt tcc 912Asp Thr
Leu Met Gly Ser Phe Phe Tyr Gly Thr Ile Gly Ser Val Ser 290
295 300aac taa
918Asn3058305PRTLeptospira interrogans serovar
copenhageni 8Val Phe Glu Asn Asn Val Gly Glu Asn Met Ile Gln Lys Ser Ile
Leu 1 5 10 15Ile Phe Leu
Val Phe Leu Ser Phe Val Val Cys Lys Lys Asp Ser Asn 20
25 30Asp Asp Asp Leu Thr Val Ala Ala Leu Ala
Ala Leu Ser Gly Gly Tyr 35 40
45Cys Asn Gly Ser Ser Ala Asn Thr Gly Ile Thr Val Ser Lys Gly Thr 50
55 60Ala Thr Leu Asp Ala Ser Ser Gly Cys
Val Thr Gly Val Thr Thr Cys 65 70 75
80Met Asp Ser Ala Leu Pro Thr Trp Ile Lys Asn Asn Phe Lys
Cys Ser 85 90 95Val Ala
Tyr Val Ser Gly Ser Ser Tyr Ile Phe Lys Ser Gln Asn Val 100
105 110Pro Asn Thr Lys Ser Tyr Tyr Tyr Gly
Ser Ser Ser Pro Leu Phe Glu 115 120
125Thr Leu Pro Thr Gly Asn Met Pro Ala Gly Asn Asn Ser Val Ser Ser
130 135 140Gln Lys Phe Val Tyr Thr Ile
Pro Ser Ser Pro Ile Lys Gly Ser Gly145 150
155 160Thr Val Gly Thr Gln Gly Gly Leu Val Ser Ile Gly
Ile Thr Val Asn 165 170
175Gly Leu Ala Ile Phe Asn Asn Ala Ala Asn Pro Pro Asp Thr Leu Ala
180 185 190Val Glu Ala Gln Thr Phe
Asp Asn Phe Gly Gly His Pro Gln Asn Thr 195 200
205Gly Val Tyr His His His Ala Ala Val Thr Lys Val Ser Asn
Asn Asp 210 215 220Ser Asn Leu Ile Gly
Val Ile Leu Asp Gly Tyr Ala Ile Tyr Gly Lys225 230
235 240Lys Cys Asp Asn Gly Thr Ser Ser Thr Gly
Asp Asp Phe Val Pro Thr 245 250
255Asp Leu Asp Asn Leu His Gly His Thr Lys Ala Thr Val His Phe Ser
260 265 270Thr Pro Thr Tyr His
Tyr His Phe Ala Pro Asp Ala Thr Ala Gly Ile 275
280 285Asp Thr Leu Met Gly Ser Phe Phe Tyr Gly Thr Ile
Gly Ser Val Ser 290 295
300Asn3059399DNALeptospira interrogans serovar copenhageniCDS(1)...(396)
9atg cgt ata aga tat atc aca ttt ctt att ttc atg atc cca gcc att
48Met Arg Ile Arg Tyr Ile Thr Phe Leu Ile Phe Met Ile Pro Ala Ile 1
5 10 15cta aca atc tcg gtt att
tta gct tat ata att gta atg cgt gct gtc 96Leu Thr Ile Ser Val Ile
Leu Ala Tyr Ile Ile Val Met Arg Ala Val 20
25 30agt aga gaa act tgt gaa aaa aat ctc cga gga ctt tgg
tat ttg act 144Ser Arg Glu Thr Cys Glu Lys Asn Leu Arg Gly Leu Trp
Tyr Leu Thr 35 40 45tct ata ggg
agt cgt tgt gtt ctt gct act gaa tgt ttt tat cgt ggc 192Ser Ile Gly
Ser Arg Cys Val Leu Ala Thr Glu Cys Phe Tyr Arg Gly 50
55 60aac tgt ttg cca tcg tac gat gca gtt act aat tgc
gaa cgg ctt ttg 240Asn Cys Leu Pro Ser Tyr Asp Ala Val Thr Asn Cys
Glu Arg Leu Leu 65 70 75
80atc ggc gaa gaa agg aaa tat gtg tat tta cag ttg gga atg cct gta
288Ile Gly Glu Glu Arg Lys Tyr Val Tyr Leu Gln Leu Gly Met Pro Val
85 90 95aga agt gga agt ggt
cat gag tat ttt gac gga ggt gct atg aat cgt 336Arg Ser Gly Ser Gly
His Glu Tyr Phe Asp Gly Gly Ala Met Asn Arg 100
105 110tct gaa tta tcc gtt gaa ttc aat cat aat cga tta
gtt aaa aaa aat 384Ser Glu Leu Ser Val Glu Phe Asn His Asn Arg Leu
Val Lys Lys Asn 115 120 125tgt aga
ttt gaa tag 399Cys Arg
Phe Glu 13010132PRTLeptospira interrogans serovar copenhageni 10Met
Arg Ile Arg Tyr Ile Thr Phe Leu Ile Phe Met Ile Pro Ala Ile 1
5 10 15Leu Thr Ile Ser Val Ile Leu
Ala Tyr Ile Ile Val Met Arg Ala Val 20 25
30Ser Arg Glu Thr Cys Glu Lys Asn Leu Arg Gly Leu Trp Tyr
Leu Thr 35 40 45Ser Ile Gly Ser
Arg Cys Val Leu Ala Thr Glu Cys Phe Tyr Arg Gly 50
55 60Asn Cys Leu Pro Ser Tyr Asp Ala Val Thr Asn Cys Glu
Arg Leu Leu 65 70 75
80Ile Gly Glu Glu Arg Lys Tyr Val Tyr Leu Gln Leu Gly Met Pro Val
85 90 95Arg Ser Gly Ser Gly His
Glu Tyr Phe Asp Gly Gly Ala Met Asn Arg 100
105 110Ser Glu Leu Ser Val Glu Phe Asn His Asn Arg Leu
Val Lys Lys Asn 115 120 125Cys Arg
Phe Glu 13011543DNALeptospira interrogans serovar
copenhageniCDS(1)...(540) 11atg ttt aga tta aaa ata ttc att tta ctt tgt
att tat tct ttt tcc 48Met Phe Arg Leu Lys Ile Phe Ile Leu Leu Cys
Ile Tyr Ser Phe Ser 1 5 10
15att ttt gca caa tcc aaa gag aaa tgt tta ttc gga gat tgt aag gat
96Ile Phe Ala Gln Ser Lys Glu Lys Cys Leu Phe Gly Asp Cys Lys Asp
20 25 30gga aga ggt att ttt ata gac
atc cat gga aac gaa ttc ggc gga gtt 144Gly Arg Gly Ile Phe Ile Asp
Ile His Gly Asn Glu Phe Gly Gly Val 35 40
45ttc gta aac gga aag tta gaa gga gtg ggt gaa atc aaa ttt aaa
aac 192Phe Val Asn Gly Lys Leu Glu Gly Val Gly Glu Ile Lys Phe Lys
Asn 50 55 60gac gga aaa ttt tcc ggc
gtt tat aaa aat ccc tca tac cgt gga aaa 240Asp Gly Lys Phe Ser Gly
Val Tyr Lys Asn Pro Ser Tyr Arg Gly Lys 65 70
75 80tct aaa ttc att gat tca gat gga aaa gtt gta
tat gga acc gag ttt 288Ser Lys Phe Ile Asp Ser Asp Gly Lys Val Val
Tyr Gly Thr Glu Phe 85 90
95acg ggt gga tct tgt ggt gac tac gga tgt gaa act tgg act aaa ttt
336Thr Gly Gly Ser Cys Gly Asp Tyr Gly Cys Glu Thr Trp Thr Lys Phe
100 105 110ata ttc gat tcg aat gtg
aaa tgt gtt ttt cta ggg acg ttt caa aac 384Ile Phe Asp Ser Asn Val
Lys Cys Val Phe Leu Gly Thr Phe Gln Asn 115 120
125ggt caa aaa acc ggg aaa ggt agt tat act tgt gat aac cat
gaa cgt 432Gly Gln Lys Thr Gly Lys Gly Ser Tyr Thr Cys Asp Asn His
Glu Arg 130 135 140ttt gaa gga act tac
tca aac gat ttg gcc aat gga atg gga aaa tta 480Phe Glu Gly Thr Tyr
Ser Asn Asp Leu Ala Asn Gly Met Gly Lys Leu145 150
155 160acc tat tcc gat gga acc att tgg gaa gga
aaa ttt aaa aac ggt cat 528Thr Tyr Ser Asp Gly Thr Ile Trp Glu Gly
Lys Phe Lys Asn Gly His 165 170
175ccg gtt cgg aaa tga
543Pro Val Arg Lys 18012180PRTLeptospira interrogans
serovar copenhageni 12Met Phe Arg Leu Lys Ile Phe Ile Leu Leu Cys Ile Tyr
Ser Phe Ser 1 5 10 15Ile
Phe Ala Gln Ser Lys Glu Lys Cys Leu Phe Gly Asp Cys Lys Asp
20 25 30Gly Arg Gly Ile Phe Ile Asp Ile
His Gly Asn Glu Phe Gly Gly Val 35 40
45Phe Val Asn Gly Lys Leu Glu Gly Val Gly Glu Ile Lys Phe Lys Asn
50 55 60Asp Gly Lys Phe Ser Gly Val
Tyr Lys Asn Pro Ser Tyr Arg Gly Lys 65 70
75 80Ser Lys Phe Ile Asp Ser Asp Gly Lys Val Val Tyr
Gly Thr Glu Phe 85 90
95Thr Gly Gly Ser Cys Gly Asp Tyr Gly Cys Glu Thr Trp Thr Lys Phe
100 105 110Ile Phe Asp Ser Asn Val Lys
Cys Val Phe Leu Gly Thr Phe Gln Asn 115 120
125Gly Gln Lys Thr Gly Lys Gly Ser Tyr Thr Cys Asp Asn His Glu
Arg 130 135 140Phe Glu Gly Thr Tyr Ser
Asn Asp Leu Ala Asn Gly Met Gly Lys Leu145 150
155 160Thr Tyr Ser Asp Gly Thr Ile Trp Glu Gly Lys
Phe Lys Asn Gly His 165 170
175Pro Val Arg Lys 18013612DNALeptospira interrogans serovar
copenhageniCDS(1)...(609) 13atg aag aag att aaa att gta aca gtt att act
ttg ttt ctg att tct 48Met Lys Lys Ile Lys Ile Val Thr Val Ile Thr
Leu Phe Leu Ile Ser 1 5 10
15tta act ggt tgt aaa aag agc aaa gaa gaa att gaa aga gaa aag aaa
96Leu Thr Gly Cys Lys Lys Ser Lys Glu Glu Ile Glu Arg Glu Lys Lys
20 25 30gaa agt tta aaa aaa gac gtt
ctt aat tca ata act atg gtt tat gag 144Glu Ser Leu Lys Lys Asp Val
Leu Asn Ser Ile Thr Met Val Tyr Glu 35 40
45atg ggc ggc ggc tct act ttt gct ctt ttg gtt gat cca gag aat
tat 192Met Gly Gly Gly Ser Thr Phe Ala Leu Leu Val Asp Pro Glu Asn
Tyr 50 55 60aaa aag gtt gct tgg gct
tgt tta gat ttc aaa cct aat gaa aat cga 240Lys Lys Val Ala Trp Ala
Cys Leu Asp Phe Lys Pro Asn Glu Asn Arg 65 70
75 80gca att ata aaa tat tat aat ttt cct aat cgt
tat gaa gtt cgt gtt 288Ala Ile Ile Lys Tyr Tyr Asn Phe Pro Asn Arg
Tyr Glu Val Arg Val 85 90
95gaa gct att aat gag tta gaa tac aaa tta aat tac agc gat cga gaa
336Glu Ala Ile Asn Glu Leu Glu Tyr Lys Leu Asn Tyr Ser Asp Arg Glu
100 105 110gcc agt atg aaa tta gaa
gta aca ggt gat tat cct gta aaa gaa ggt 384Ala Ser Met Lys Leu Glu
Val Thr Gly Asp Tyr Pro Val Lys Glu Gly 115 120
125tct atg gga ttt tta act tcg act gtt tct ctt tct ttt aag
ggt gat 432Ser Met Gly Phe Leu Thr Ser Thr Val Ser Leu Ser Phe Lys
Gly Asp 130 135 140tct aaa gta tat aat
gat gtt ggt aga atg gat tta atc tac ggt agt 480Ser Lys Val Tyr Asn
Asp Val Gly Arg Met Asp Leu Ile Tyr Gly Ser145 150
155 160gat agt gta gcg aga tcg cgt cat ggt cgt
ttt aaa aca tta gaa gaa 528Asp Ser Val Ala Arg Ser Arg His Gly Arg
Phe Lys Thr Leu Glu Glu 165 170
175tgt gag gct caa ata tct gcg gat gaa gaa cta agc gaa aca ctt cgt
576Cys Glu Ala Gln Ile Ser Ala Asp Glu Glu Leu Ser Glu Thr Leu Arg
180 185 190aaa caa gat gga gca tgt
gaa ggt cct ggt tgt tag 612Lys Gln Asp Gly Ala Cys
Glu Gly Pro Gly Cys 195 20014203PRTLeptospira
interrogans serovar copenhageni 14Met Lys Lys Ile Lys Ile Val Thr Val Ile
Thr Leu Phe Leu Ile Ser 1 5 10
15Leu Thr Gly Cys Lys Lys Ser Lys Glu Glu Ile Glu Arg Glu Lys Lys
20 25 30Glu Ser Leu Lys Lys
Asp Val Leu Asn Ser Ile Thr Met Val Tyr Glu 35
40 45Met Gly Gly Gly Ser Thr Phe Ala Leu Leu Val Asp Pro
Glu Asn Tyr 50 55 60Lys Lys Val Ala
Trp Ala Cys Leu Asp Phe Lys Pro Asn Glu Asn Arg 65 70
75 80Ala Ile Ile Lys Tyr Tyr Asn Phe Pro
Asn Arg Tyr Glu Val Arg Val 85 90
95Glu Ala Ile Asn Glu Leu Glu Tyr Lys Leu Asn Tyr Ser Asp Arg
Glu 100 105 110Ala Ser Met Lys
Leu Glu Val Thr Gly Asp Tyr Pro Val Lys Glu Gly 115
120 125Ser Met Gly Phe Leu Thr Ser Thr Val Ser Leu Ser
Phe Lys Gly Asp 130 135 140Ser Lys Val
Tyr Asn Asp Val Gly Arg Met Asp Leu Ile Tyr Gly Ser145
150 155 160Asp Ser Val Ala Arg Ser Arg
His Gly Arg Phe Lys Thr Leu Glu Glu 165
170 175Cys Glu Ala Gln Ile Ser Ala Asp Glu Glu Leu Ser
Glu Thr Leu Arg 180 185 190Lys
Gln Asp Gly Ala Cys Glu Gly Pro Gly Cys 195
200151044DNALeptospira interrogans serovar copenhageniCDS(1)...(1041)
15atg ttt cat ttt aaa acg atc ctg ttt gtt tta act gga ttt att ttt
48Met Phe His Phe Lys Thr Ile Leu Phe Val Leu Thr Gly Phe Ile Phe 1
5 10 15ttc gtt tcg gct tgt aaa
acg cct cct cct aaa gat ccg tgg atc gtt 96Phe Val Ser Ala Cys Lys
Thr Pro Pro Pro Lys Asp Pro Trp Ile Val 20
25 30cct tct ctt aaa gag aat gaa aaa cta ttt tta gct cct
ttg aaa gtt 144Pro Ser Leu Lys Glu Asn Glu Lys Leu Phe Leu Ala Pro
Leu Lys Val 35 40 45gat gag ttt
gtt tct aaa gat tta gga gga agg cat tat cct gca tcg 192Asp Glu Phe
Val Ser Lys Asp Leu Gly Gly Arg His Tyr Pro Ala Ser 50
55 60aac gaa ctc aga atc gat ctt ttc aaa ccg tat att
gaa aat tta gaa 240Asn Glu Leu Arg Ile Asp Leu Phe Lys Pro Tyr Ile
Glu Asn Leu Glu 65 70 75
80ggt ggt tat tta ggt gct gga acg gat cag aac ttt aca ttt atc gtt
288Gly Gly Tyr Leu Gly Ala Gly Thr Asp Gln Asn Phe Thr Phe Ile Val
85 90 95tgg gca aag agt aaa
tat gta tgg tta atg gat ttt gat tat acg att 336Trp Ala Lys Ser Lys
Tyr Val Trp Leu Met Asp Phe Asp Tyr Thr Ile 100
105 110tgt cta att aat cga att cat ctt ttg ttt ttt aga
att gcc gta gat 384Cys Leu Ile Asn Arg Ile His Leu Leu Phe Phe Arg
Ile Ala Val Asp 115 120 125cct gaa
tcg tat cgg gag ctt tgg gct cga aaa aat aaa cat act tct 432Pro Glu
Ser Tyr Arg Glu Leu Trp Ala Arg Lys Asn Lys His Thr Ser 130
135 140ttt gaa atc ata aag aaa gaa tgg gag aaa gat
cca gaa tgg cca ctc 480Phe Glu Ile Ile Lys Lys Glu Trp Glu Lys Asp
Pro Glu Trp Pro Leu145 150 155
160att cga gaa gct tgg gaa gtg gct cat aga ggc aaa tca gac gtt cca
528Ile Arg Glu Ala Trp Glu Val Ala His Arg Gly Lys Ser Asp Val Pro
165 170 175caa aga tgg aat gag
ctt gat cga acg tcg caa aga ttt ggc ctt aag 576Gln Arg Trp Asn Glu
Leu Asp Arg Thr Ser Gln Arg Phe Gly Leu Lys 180
185 190acg ttt att cat tct aaa gaa gaa tac aat tac att
cga aac atg gtt 624Thr Phe Ile His Ser Lys Glu Glu Tyr Asn Tyr Ile
Arg Asn Met Val 195 200 205ctt caa
gga aga ata caa ata tta aaa ggg gac att aat gct gaa aaa 672Leu Gln
Gly Arg Ile Gln Ile Leu Lys Gly Asp Ile Asn Ala Glu Lys 210
215 220agt atg aga tct gtg gcg gag aga gcc gca aga
ttg aac gtt cca att 720Ser Met Arg Ser Val Ala Glu Arg Ala Ala Arg
Leu Asn Val Pro Ile225 230 235
240cga gtt gtt tat ctt tct aat ata gaa gac tat ttt tct tac agt gat
768Arg Val Val Tyr Leu Ser Asn Ile Glu Asp Tyr Phe Ser Tyr Ser Asp
245 250 255agt ttt cga gac aac
cta ctg agt tta ccc acg gat gaa aag gga gtt 816Ser Phe Arg Asp Asn
Leu Leu Ser Leu Pro Thr Asp Glu Lys Gly Val 260
265 270gtt ttg aga aca atg caa aat gga acc aag gaa gaa
tat gga tca cct 864Val Leu Arg Thr Met Gln Asn Gly Thr Lys Glu Glu
Tyr Gly Ser Pro 275 280 285gac gga
gaa aaa att ccg gtg gat tat cct tta cat tat aat gtt caa 912Asp Gly
Glu Lys Ile Pro Val Asp Tyr Pro Leu His Tyr Asn Val Gln 290
295 300cct ctg gaa aat ttg cag gat tgg atg tta tta
tct ggt cat ctt cat 960Pro Leu Glu Asn Leu Gln Asp Trp Met Leu Leu
Ser Gly His Leu His305 310 315
320aag gga atc cta atg caa ttc aga act cct att caa aaa ggt ttt tct
1008Lys Gly Ile Leu Met Gln Phe Arg Thr Pro Ile Gln Lys Gly Phe Ser
325 330 335ata atc aaa agt ggg
ccc gta gaa gtt ttg aaa tga 1044Ile Ile Lys Ser Gly
Pro Val Glu Val Leu Lys 340
34516347PRTLeptospira interrogans serovar copenhageni 16Met Phe His Phe
Lys Thr Ile Leu Phe Val Leu Thr Gly Phe Ile Phe 1 5
10 15Phe Val Ser Ala Cys Lys Thr Pro Pro Pro
Lys Asp Pro Trp Ile Val 20 25
30Pro Ser Leu Lys Glu Asn Glu Lys Leu Phe Leu Ala Pro Leu Lys Val
35 40 45Asp Glu Phe Val Ser Lys Asp
Leu Gly Gly Arg His Tyr Pro Ala Ser 50 55
60Asn Glu Leu Arg Ile Asp Leu Phe Lys Pro Tyr Ile Glu Asn Leu Glu
65 70 75 80Gly Gly Tyr
Leu Gly Ala Gly Thr Asp Gln Asn Phe Thr Phe Ile Val 85
90 95Trp Ala Lys Ser Lys Tyr Val Trp Leu
Met Asp Phe Asp Tyr Thr Ile 100 105
110Cys Leu Ile Asn Arg Ile His Leu Leu Phe Phe Arg Ile Ala Val Asp
115 120 125Pro Glu Ser Tyr Arg Glu
Leu Trp Ala Arg Lys Asn Lys His Thr Ser 130 135
140Phe Glu Ile Ile Lys Lys Glu Trp Glu Lys Asp Pro Glu Trp Pro
Leu145 150 155 160Ile Arg
Glu Ala Trp Glu Val Ala His Arg Gly Lys Ser Asp Val Pro
165 170 175Gln Arg Trp Asn Glu Leu Asp
Arg Thr Ser Gln Arg Phe Gly Leu Lys 180 185
190Thr Phe Ile His Ser Lys Glu Glu Tyr Asn Tyr Ile Arg Asn
Met Val 195 200 205Leu Gln Gly Arg
Ile Gln Ile Leu Lys Gly Asp Ile Asn Ala Glu Lys 210
215 220Ser Met Arg Ser Val Ala Glu Arg Ala Ala Arg Leu
Asn Val Pro Ile225 230 235
240Arg Val Val Tyr Leu Ser Asn Ile Glu Asp Tyr Phe Ser Tyr Ser Asp
245 250 255Ser Phe Arg Asp Asn
Leu Leu Ser Leu Pro Thr Asp Glu Lys Gly Val 260
265 270Val Leu Arg Thr Met Gln Asn Gly Thr Lys Glu Glu
Tyr Gly Ser Pro 275 280 285Asp Gly
Glu Lys Ile Pro Val Asp Tyr Pro Leu His Tyr Asn Val Gln 290
295 300Pro Leu Glu Asn Leu Gln Asp Trp Met Leu Leu
Ser Gly His Leu His305 310 315
320Lys Gly Ile Leu Met Gln Phe Arg Thr Pro Ile Gln Lys Gly Phe Ser
325 330 335Ile Ile Lys Ser
Gly Pro Val Glu Val Leu Lys 340
34517576DNALeptospira interrogans serovar copenhageniCDS(1)...(573) 17atg
ttc aaa ata tta gta aaa att aat att cta ttt ttc ttt tta gtt 48Met
Phe Lys Ile Leu Val Lys Ile Asn Ile Leu Phe Phe Phe Leu Val 1
5 10 15tat ttt tta ttg ttt ggg tgt
tgt gct cct tcg agg ttg gaa atc gtt 96Tyr Phe Leu Leu Phe Gly Cys
Cys Ala Pro Ser Arg Leu Glu Ile Val 20 25
30tct atg att ctt tgt gat cat ttc aat cgg gtt gga gaa tgt
ctc gaa 144Ser Met Ile Leu Cys Asp His Phe Asn Arg Val Gly Glu Cys
Leu Glu 35 40 45cct gtg gaa aga
aat cat cat tat aaa ata gaa att cca aat cac aaa 192Pro Val Glu Arg
Asn His His Tyr Lys Ile Glu Ile Pro Asn His Lys 50
55 60aaa ccg gat act tgg gaa aag ttt tct aat tat ctt tac
ttt cat gcg 240Lys Pro Asp Thr Trp Glu Lys Phe Ser Asn Tyr Leu Tyr
Phe His Ala 65 70 75
80aga gaa act cct ggt ttt ctg att cga ttt aat cga aag ttg act cct
288Arg Glu Thr Pro Gly Phe Leu Ile Arg Phe Asn Arg Lys Leu Thr Pro
85 90 95tcc gaa tct aaa atg
atc aaa gat tct tat tac gcc acg atg agt ttt 336Ser Glu Ser Lys Met
Ile Lys Asp Ser Tyr Tyr Ala Thr Met Ser Phe 100
105 110tcc gga act gta gaa agg atg gaa ggt ttt gaa atg
gga gaa gat tgg 384Ser Gly Thr Val Glu Arg Met Glu Gly Phe Glu Met
Gly Glu Asp Trp 115 120 125gtt ggt
tcg ttt cag tat ctg ggt tct ata att aaa gaa aaa tta aaa 432Val Gly
Ser Phe Gln Tyr Leu Gly Ser Ile Ile Lys Glu Lys Leu Lys 130
135 140aaa gaa aat cgc ctc tct tcc ttt cct tat aca
aat tct atc ttt ccg 480Lys Glu Asn Arg Leu Ser Ser Phe Pro Tyr Thr
Asn Ser Ile Phe Pro145 150 155
160gca gaa gtg gaa ttt aga ttc aat tct tct ctt ttt gaa ggg gaa gaa
528Ala Glu Val Glu Phe Arg Phe Asn Ser Ser Leu Phe Glu Gly Glu Glu
165 170 175aaa acg aaa att aat
cta agt ttt atc gtt ctt cct cca gaa aaa tga 576Lys Thr Lys Ile Asn
Leu Ser Phe Ile Val Leu Pro Pro Glu Lys 180
185 19018191PRTLeptospira interrogans serovar copenhageni
18Met Phe Lys Ile Leu Val Lys Ile Asn Ile Leu Phe Phe Phe Leu Val 1
5 10 15Tyr Phe Leu Leu Phe Gly
Cys Cys Ala Pro Ser Arg Leu Glu Ile Val 20
25 30Ser Met Ile Leu Cys Asp His Phe Asn Arg Val Gly Glu
Cys Leu Glu 35 40 45Pro Val Glu
Arg Asn His His Tyr Lys Ile Glu Ile Pro Asn His Lys 50
55 60Lys Pro Asp Thr Trp Glu Lys Phe Ser Asn Tyr Leu
Tyr Phe His Ala 65 70 75
80Arg Glu Thr Pro Gly Phe Leu Ile Arg Phe Asn Arg Lys Leu Thr Pro
85 90 95Ser Glu Ser Lys Met
Ile Lys Asp Ser Tyr Tyr Ala Thr Met Ser Phe 100
105 110Ser Gly Thr Val Glu Arg Met Glu Gly Phe Glu Met
Gly Glu Asp Trp 115 120 125Val Gly
Ser Phe Gln Tyr Leu Gly Ser Ile Ile Lys Glu Lys Leu Lys 130
135 140Lys Glu Asn Arg Leu Ser Ser Phe Pro Tyr Thr
Asn Ser Ile Phe Pro145 150 155
160Ala Glu Val Glu Phe Arg Phe Asn Ser Ser Leu Phe Glu Gly Glu Glu
165 170 175Lys Thr Lys Ile
Asn Leu Ser Phe Ile Val Leu Pro Pro Glu Lys 180
185 19019483DNALeptospira interrogans serovar
copenhageniCDS(1)...(480) 19atg aag aaa tta ttc gtt att gct ctg gct ctc
ttt atg gtt tct aac 48Met Lys Lys Leu Phe Val Ile Ala Leu Ala Leu
Phe Met Val Ser Asn 1 5 10
15ctt tct gca aaa cct gga tat gga atg gcg gga tgc ggt tta gga tct
96Leu Ser Ala Lys Pro Gly Tyr Gly Met Ala Gly Cys Gly Leu Gly Ser
20 25 30ata atc att aaa gat aat ggt
ttt gtg caa att ttt gca act acc tca 144Ile Ile Ile Lys Asp Asn Gly
Phe Val Gln Ile Phe Ala Thr Thr Ser 35 40
45aat cta act tct tac aat caa act ttt gga att act tct ggc act
tcc 192Asn Leu Thr Ser Tyr Asn Gln Thr Phe Gly Ile Thr Ser Gly Thr
Ser 50 55 60aat tgc agt tca gat gga
atc gtg aac aat gac aaa gca aag gaa att 240Asn Cys Ser Ser Asp Gly
Ile Val Asn Asn Asp Lys Ala Lys Glu Ile 65 70
75 80ttt gtt cat atg aac tac gaa agt ctt gaa caa
gaa att gca atg gga 288Phe Val His Met Asn Tyr Glu Ser Leu Glu Gln
Glu Ile Ala Met Gly 85 90
95aaa gga gag aaa ctt tcc agt tta gct gca ctt ttt gga tgt tct aac
336Lys Gly Glu Lys Leu Ser Ser Leu Ala Ala Leu Phe Gly Cys Ser Asn
100 105 110gat tct aaa aga ttt aaa
gaa gtt gct aaa gaa aat ttc tct aaa att 384Asp Ser Lys Arg Phe Lys
Glu Val Ala Lys Glu Asn Phe Ser Lys Ile 115 120
125ttc acg acg gca gca att aaa aat ccg act gta atg ctt tct
aat tta 432Phe Thr Thr Ala Ala Ile Lys Asn Pro Thr Val Met Leu Ser
Asn Leu 130 135 140gaa ttg gaa gtt gga
aaa gat aca gaa tta aag aac agc tgt aaa atc 480Glu Leu Glu Val Gly
Lys Asp Thr Glu Leu Lys Asn Ser Cys Lys Ile145 150
155 160taa
48320160PRTLeptospira interrogans serovar
copenhageni 20Met Lys Lys Leu Phe Val Ile Ala Leu Ala Leu Phe Met Val Ser
Asn 1 5 10 15Leu Ser Ala
Lys Pro Gly Tyr Gly Met Ala Gly Cys Gly Leu Gly Ser 20
25 30Ile Ile Ile Lys Asp Asn Gly Phe Val Gln
Ile Phe Ala Thr Thr Ser 35 40
45Asn Leu Thr Ser Tyr Asn Gln Thr Phe Gly Ile Thr Ser Gly Thr Ser 50
55 60Asn Cys Ser Ser Asp Gly Ile Val Asn
Asn Asp Lys Ala Lys Glu Ile 65 70 75
80Phe Val His Met Asn Tyr Glu Ser Leu Glu Gln Glu Ile Ala
Met Gly 85 90 95Lys Gly
Glu Lys Leu Ser Ser Leu Ala Ala Leu Phe Gly Cys Ser Asn 100
105 110Asp Ser Lys Arg Phe Lys Glu Val Ala
Lys Glu Asn Phe Ser Lys Ile 115 120
125Phe Thr Thr Ala Ala Ile Lys Asn Pro Thr Val Met Leu Ser Asn Leu
130 135 140Glu Leu Glu Val Gly Lys Asp
Thr Glu Leu Lys Asn Ser Cys Lys Ile145 150
155 16021819DNALeptospira interrogans serovar
copenhageniCDS(1)...(816) 21atg ttt tcc cgg tgt cga att ttc tta aaa cct
acg acc cta att tgg 48Met Phe Ser Arg Cys Arg Ile Phe Leu Lys Pro
Thr Thr Leu Ile Trp 1 5 10
15ttt gca att ctt ccg gga gcc tta tct gct tct cct caa aaa cca gga
96Phe Ala Ile Leu Pro Gly Ala Leu Ser Ala Ser Pro Gln Lys Pro Gly
20 25 30acc ttc gaa ttg tta ggt ggt
tac caa ccc aat tgg aat cga ctt ttc 144Thr Phe Glu Leu Leu Gly Gly
Tyr Gln Pro Asn Trp Asn Arg Leu Phe 35 40
45act gag ttt ctt ccg aaa cgt aca gca caa act ggt aac cta cct
tct 192Thr Glu Phe Leu Pro Lys Arg Thr Ala Gln Thr Gly Asn Leu Pro
Ser 50 55 60agc ggc gtc att tcc aga
gaa gaa gag gac ata gaa aat cca gag gaa 240Ser Gly Val Ile Ser Arg
Glu Glu Glu Asp Ile Glu Asn Pro Glu Glu 65 70
75 80aca gaa gaa gat aaa caa gaa gga tac caa gac
aat cga aaa acg gaa 288Thr Glu Glu Asp Lys Gln Glu Gly Tyr Gln Asp
Asn Arg Lys Thr Glu 85 90
95gtt gga gtt tgg gta gga gct tcc aat ccg tta ccc gga acc gaa act
336Val Gly Val Trp Val Gly Ala Ser Asn Pro Leu Pro Gly Thr Glu Thr
100 105 110caa aaa tat ctg gat act
acg tta ggt ggc ggt ttc ttt ttt aga att 384Gln Lys Tyr Leu Asp Thr
Thr Leu Gly Gly Gly Phe Phe Phe Arg Ile 115 120
125ccc tgg cct tgg atc ttt tat ctc gaa atg gga gcc ttt tac
gca aat 432Pro Trp Pro Trp Ile Phe Tyr Leu Glu Met Gly Ala Phe Tyr
Ala Asn 130 135 140tat ctt tcg gca aca
gaa aga gct ttg act aca att ccg gtc tat ctt 480Tyr Leu Ser Ala Thr
Glu Arg Ala Leu Thr Thr Ile Pro Val Tyr Leu145 150
155 160gct ttg ggt tat aaa att cct tta gat ctt
cca att tcg ttt atc ctt 528Ala Leu Gly Tyr Lys Ile Pro Leu Asp Leu
Pro Ile Ser Phe Ile Leu 165 170
175cgt gcg gga ggt gga gaa gcg ttt gta gta gca aga cct tcc aac aca
576Arg Ala Gly Gly Gly Glu Ala Phe Val Val Ala Arg Pro Ser Asn Thr
180 185 190tct cgt tgg gat cca atg
atg att gta gga tta gaa act agt ttt gta 624Ser Arg Trp Asp Pro Met
Met Ile Val Gly Leu Glu Thr Ser Phe Val 195 200
205gct gga aaa aaa atc cga atc gga att cga atc gat tac aat
aaa att 672Ala Gly Lys Lys Ile Arg Ile Gly Ile Arg Ile Asp Tyr Asn
Lys Ile 210 215 220tat gag tct cgt atg
gac gcc cca gga gaa aca aaa tat cct tac acg 720Tyr Glu Ser Arg Met
Asp Ala Pro Gly Glu Thr Lys Tyr Pro Tyr Thr225 230
235 240agt cct tac gaa gat tcc aga ttg agt aac
ccc aat tat tac aga gta 768Ser Pro Tyr Glu Asp Ser Arg Leu Ser Asn
Pro Asn Tyr Tyr Arg Val 245 250
255gta gat act gaa ttt ttt cag ttc ggt ttg atg gtg agt gta ttt tta
816Val Asp Thr Glu Phe Phe Gln Phe Gly Leu Met Val Ser Val Phe Leu
260 265 270tga
81922272PRTLeptospira
interrogans serovar copenhageni 22Met Phe Ser Arg Cys Arg Ile Phe Leu Lys
Pro Thr Thr Leu Ile Trp 1 5 10
15Phe Ala Ile Leu Pro Gly Ala Leu Ser Ala Ser Pro Gln Lys Pro Gly
20 25 30Thr Phe Glu Leu Leu
Gly Gly Tyr Gln Pro Asn Trp Asn Arg Leu Phe 35
40 45Thr Glu Phe Leu Pro Lys Arg Thr Ala Gln Thr Gly Asn
Leu Pro Ser 50 55 60Ser Gly Val Ile
Ser Arg Glu Glu Glu Asp Ile Glu Asn Pro Glu Glu 65 70
75 80Thr Glu Glu Asp Lys Gln Glu Gly Tyr
Gln Asp Asn Arg Lys Thr Glu 85 90
95Val Gly Val Trp Val Gly Ala Ser Asn Pro Leu Pro Gly Thr Glu
Thr 100 105 110Gln Lys Tyr Leu
Asp Thr Thr Leu Gly Gly Gly Phe Phe Phe Arg Ile 115
120 125Pro Trp Pro Trp Ile Phe Tyr Leu Glu Met Gly Ala
Phe Tyr Ala Asn 130 135 140Tyr Leu Ser
Ala Thr Glu Arg Ala Leu Thr Thr Ile Pro Val Tyr Leu145
150 155 160Ala Leu Gly Tyr Lys Ile Pro
Leu Asp Leu Pro Ile Ser Phe Ile Leu 165
170 175Arg Ala Gly Gly Gly Glu Ala Phe Val Val Ala Arg
Pro Ser Asn Thr 180 185 190Ser
Arg Trp Asp Pro Met Met Ile Val Gly Leu Glu Thr Ser Phe Val 195
200 205Ala Gly Lys Lys Ile Arg Ile Gly Ile
Arg Ile Asp Tyr Asn Lys Ile 210 215
220Tyr Glu Ser Arg Met Asp Ala Pro Gly Glu Thr Lys Tyr Pro Tyr Thr225
230 235 240Ser Pro Tyr Glu
Asp Ser Arg Leu Ser Asn Pro Asn Tyr Tyr Arg Val 245
250 255Val Asp Thr Glu Phe Phe Gln Phe Gly Leu
Met Val Ser Val Phe Leu 260 265
27023729DNALeptospira interrogans serovar copenhageniCDS(1)...(726)
23atg aat tac aaa ata aga ata tta ttt ctt atc att tta ctt tcg gct
48Met Asn Tyr Lys Ile Arg Ile Leu Phe Leu Ile Ile Leu Leu Ser Ala 1
5 10 15ata gca agc tcg atc aca
ctc ctg agc cag gaa acg gaa aac gct aaa 96Ile Ala Ser Ser Ile Thr
Leu Leu Ser Gln Glu Thr Glu Asn Ala Lys 20
25 30gta agt ttt tca tta ggt aaa tct tat gtt caa aaa tct
ggt aaa agc 144Val Ser Phe Ser Leu Gly Lys Ser Tyr Val Gln Lys Ser
Gly Lys Ser 35 40 45tcc tgg gaa
cct tta aaa cca aac gat ttt ttg gaa gaa gga gat tta 192Ser Trp Glu
Pro Leu Lys Pro Asn Asp Phe Leu Glu Glu Gly Asp Leu 50
55 60atc tcc acc gga aac ggt tct aga att acg gtt cat
tac aaa ggt tcc 240Ile Ser Thr Gly Asn Gly Ser Arg Ile Thr Val His
Tyr Lys Gly Ser 65 70 75
80gaa ttt aag att caa caa aac agc aaa gta aaa ctt tca aac ctt cct
288Glu Phe Lys Ile Gln Gln Asn Ser Lys Val Lys Leu Ser Asn Leu Pro
85 90 95gaa aaa tct aaa cga
ggt gta tta gaa gta aat caa ggt ttc gca tgg 336Glu Lys Ser Lys Arg
Gly Val Leu Glu Val Asn Gln Gly Phe Ala Trp 100
105 110ttt aag atc gta aat ctc aaa ggg aaa aaa ttt gaa
gtt aca aca cca 384Phe Lys Ile Val Asn Leu Lys Gly Lys Lys Phe Glu
Val Thr Thr Pro 115 120 125aat tcc
acg gcg gga gtc aga ggc act tca ttt tct gct ttc tac gat 432Asn Ser
Thr Ala Gly Val Arg Gly Thr Ser Phe Ser Ala Phe Tyr Asp 130
135 140cct aaa aca aga gaa tcg tct ttt tgc act tgc
gaa ggc aag gta tct 480Pro Lys Thr Arg Glu Ser Ser Phe Cys Thr Cys
Glu Gly Lys Val Ser145 150 155
160att tcc gat tct aca gga aaa gaa att ctt ttt caa gaa aaa ggc gaa
528Ile Ser Asp Ser Thr Gly Lys Glu Ile Leu Phe Gln Glu Lys Gly Glu
165 170 175ggt aca atc gtc tct
tca aaa gat ata gaa att aaa aaa ttt gaa tat 576Gly Thr Ile Val Ser
Ser Lys Asp Ile Glu Ile Lys Lys Phe Glu Tyr 180
185 190aaa gga att att aaa aaa tta aat acc cta tct ggc
ttt gaa gag agg 624Lys Gly Ile Ile Lys Lys Leu Asn Thr Leu Ser Gly
Phe Glu Glu Arg 195 200 205cta aaa
aaa aat cct ttt tta aaa aac tgt ctt tct tgt cac act cca 672Leu Lys
Lys Asn Pro Phe Leu Lys Asn Cys Leu Ser Cys His Thr Pro 210
215 220gag ggt tgg att cca caa gaa gaa act ctt aag
gac gaa acc tac ggc 720Glu Gly Trp Ile Pro Gln Glu Glu Thr Leu Lys
Asp Glu Thr Tyr Gly225 230 235
240aaa caa taa
729Lys Gln24242PRTLeptospira interrogans serovar copenhageni 24Met Asn
Tyr Lys Ile Arg Ile Leu Phe Leu Ile Ile Leu Leu Ser Ala 1
5 10 15Ile Ala Ser Ser Ile Thr Leu Leu
Ser Gln Glu Thr Glu Asn Ala Lys 20 25
30Val Ser Phe Ser Leu Gly Lys Ser Tyr Val Gln Lys Ser Gly Lys
Ser 35 40 45Ser Trp Glu Pro Leu
Lys Pro Asn Asp Phe Leu Glu Glu Gly Asp Leu 50 55
60Ile Ser Thr Gly Asn Gly Ser Arg Ile Thr Val His Tyr Lys
Gly Ser 65 70 75 80Glu
Phe Lys Ile Gln Gln Asn Ser Lys Val Lys Leu Ser Asn Leu Pro
85 90 95Glu Lys Ser Lys Arg Gly Val
Leu Glu Val Asn Gln Gly Phe Ala Trp 100 105
110Phe Lys Ile Val Asn Leu Lys Gly Lys Lys Phe Glu Val Thr
Thr Pro 115 120 125Asn Ser Thr Ala
Gly Val Arg Gly Thr Ser Phe Ser Ala Phe Tyr Asp 130
135 140Pro Lys Thr Arg Glu Ser Ser Phe Cys Thr Cys Glu
Gly Lys Val Ser145 150 155
160Ile Ser Asp Ser Thr Gly Lys Glu Ile Leu Phe Gln Glu Lys Gly Glu
165 170 175Gly Thr Ile Val Ser
Ser Lys Asp Ile Glu Ile Lys Lys Phe Glu Tyr 180
185 190Lys Gly Ile Ile Lys Lys Leu Asn Thr Leu Ser Gly
Phe Glu Glu Arg 195 200 205Leu Lys
Lys Asn Pro Phe Leu Lys Asn Cys Leu Ser Cys His Thr Pro 210
215 220Glu Gly Trp Ile Pro Gln Glu Glu Thr Leu Lys
Asp Glu Thr Tyr Gly225 230 235
240Lys Gln25546DNALeptospira interrogans serovar
copenhageniCDS(1)...(543) 25atg aaa att ttt gca ctg agt att tta gtt tta
gta gtt tta ctt gta 48Met Lys Ile Phe Ala Leu Ser Ile Leu Val Leu
Val Val Leu Leu Val 1 5 10
15gcg ttc ttg ttt tat atg ggc gct ttt aat cgg gtt ttg gtt caa gag
96Ala Phe Leu Phe Tyr Met Gly Ala Phe Asn Arg Val Leu Val Gln Glu
20 25 30gaa atg aaa gga ccg ttt tac
gtt ctt tcg cat gaa agg att gga gat 144Glu Met Lys Gly Pro Phe Tyr
Val Leu Ser His Glu Arg Ile Gly Asp 35 40
45tat aga aac gtt ggg ctt acg ttt gaa gcc ctt caa aaa gaa ctg
cct 192Tyr Arg Asn Val Gly Leu Thr Phe Glu Ala Leu Gln Lys Glu Leu
Pro 50 55 60gaa aaa gga att cga aat
ttt aaa ttg ttc tca ata tat ttg gat aat 240Glu Lys Gly Ile Arg Asn
Phe Lys Leu Phe Ser Ile Tyr Leu Asp Asn 65 70
75 80cca aat gag gtt cct aaa gaa aaa cta cga tgt
gaa gta gga gct ctt 288Pro Asn Glu Val Pro Lys Glu Lys Leu Arg Cys
Glu Val Gly Ala Leu 85 90
95ttt tcg gaa cca tta gaa aaa att cca aat gga ctt tct tta gag tta
336Phe Ser Glu Pro Leu Glu Lys Ile Pro Asn Gly Leu Ser Leu Glu Leu
100 105 110aaa ata aga acc att cct
tct aaa aaa tat ctt acc gcg gaa ttt cca 384Lys Ile Arg Thr Ile Pro
Ser Lys Lys Tyr Leu Thr Ala Glu Phe Pro 115 120
125ttg aga aat ttt ctt tct att ttt ctt gga att tat aag gtt
tat ccg 432Leu Arg Asn Phe Leu Ser Ile Phe Leu Gly Ile Tyr Lys Val
Tyr Pro 130 135 140aaa ctt ttc aga gcc
tgt gaa gaa aga ggt tgt gat ctt aaa gga agg 480Lys Leu Phe Arg Ala
Cys Glu Glu Arg Gly Cys Asp Leu Lys Gly Arg145 150
155 160gca tcc att gaa att tat gaa cct ctt acg
gaa cat aag act aca tat 528Ala Ser Ile Glu Ile Tyr Glu Pro Leu Thr
Glu His Lys Thr Thr Tyr 165 170
175ctt ctg cct tta gat tag
546Leu Leu Pro Leu Asp 18026181PRTLeptospira interrogans
serovar copenhageni 26Met Lys Ile Phe Ala Leu Ser Ile Leu Val Leu Val Val
Leu Leu Val 1 5 10 15Ala
Phe Leu Phe Tyr Met Gly Ala Phe Asn Arg Val Leu Val Gln Glu
20 25 30Glu Met Lys Gly Pro Phe Tyr Val
Leu Ser His Glu Arg Ile Gly Asp 35 40
45Tyr Arg Asn Val Gly Leu Thr Phe Glu Ala Leu Gln Lys Glu Leu Pro
50 55 60Glu Lys Gly Ile Arg Asn Phe
Lys Leu Phe Ser Ile Tyr Leu Asp Asn 65 70
75 80Pro Asn Glu Val Pro Lys Glu Lys Leu Arg Cys Glu
Val Gly Ala Leu 85 90
95Phe Ser Glu Pro Leu Glu Lys Ile Pro Asn Gly Leu Ser Leu Glu Leu
100 105 110Lys Ile Arg Thr Ile Pro Ser
Lys Lys Tyr Leu Thr Ala Glu Phe Pro 115 120
125Leu Arg Asn Phe Leu Ser Ile Phe Leu Gly Ile Tyr Lys Val Tyr
Pro 130 135 140Lys Leu Phe Arg Ala Cys
Glu Glu Arg Gly Cys Asp Leu Lys Gly Arg145 150
155 160Ala Ser Ile Glu Ile Tyr Glu Pro Leu Thr Glu
His Lys Thr Thr Tyr 165 170
175Leu Leu Pro Leu Asp 18027570DNALeptospira interrogans
serovar copenhageniCDS(1)...(567) 27atg aag gtt aaa aat atc cgg aaa gga
ttt acc ctg atc gag ttg atc 48Met Lys Val Lys Asn Ile Arg Lys Gly
Phe Thr Leu Ile Glu Leu Ile 1 5 10
15gtg gtt atc gcg atc ctc gcg ggg tta att agt att ctt gca agt
acc 96Val Val Ile Ala Ile Leu Ala Gly Leu Ile Ser Ile Leu Ala Ser
Thr 20 25 30gct gca aac ttt
atc att cct tcg gga agt gac gcg gca caa act tta 144Ala Ala Asn Phe
Ile Ile Pro Ser Gly Ser Asp Ala Ala Gln Thr Leu 35
40 45aaa caa gcc gct gaa ttc tgt tat cga aaa tcc att
ctt aca aac acc 192Lys Gln Ala Ala Glu Phe Cys Tyr Arg Lys Ser Ile
Leu Thr Asn Thr 50 55 60act atg gtt
tta gaa ctg gat ata gac aac gat acc tat tct atc aaa 240Thr Met Val
Leu Glu Leu Asp Ile Asp Asn Asp Thr Tyr Ser Ile Lys 65
70 75 80aaa tta ctt cga gac gaa agt gga
att aaa gaa gtt ttg gtt ttt aaa 288Lys Leu Leu Arg Asp Glu Ser Gly
Ile Lys Glu Val Leu Val Phe Lys 85 90
95cct cag aaa ctt cct tat act tcc gaa att ata gat ata act
gat att 336Pro Gln Lys Leu Pro Tyr Thr Ser Glu Ile Ile Asp Ile Thr
Asp Ile 100 105 110aga ggt ttt
aga tat acg aaa gga att att aaa gtt ccc tat acc tat 384Arg Gly Phe
Arg Tyr Thr Lys Gly Ile Ile Lys Val Pro Tyr Thr Tyr 115
120 125ctt ggg atc tcg gca gac tac agt gta cat tta
gga agt gat cct tcc 432Leu Gly Ile Ser Ala Asp Tyr Ser Val His Leu
Gly Ser Asp Pro Ser 130 135 140att tat
aga act ttg att ctt tat aga tac ggc gga aag gtt tcc gtt 480Ile Tyr
Arg Thr Leu Ile Leu Tyr Arg Tyr Gly Gly Lys Val Ser Val145
150 155 160gtg gaa gga gag cag ttt cat
act tct tcg aat ttg gca acc gat aaa 528Val Glu Gly Glu Gln Phe His
Thr Ser Ser Asn Leu Ala Thr Asp Lys 165
170 175aat tgg aaa gaa cag gat gat aac gaa caa caa cag
cct taa 570Asn Trp Lys Glu Gln Asp Asp Asn Glu Gln Gln Gln
Pro 180 18528189PRTLeptospira interrogans
serovar copenhageni 28Met Lys Val Lys Asn Ile Arg Lys Gly Phe Thr Leu Ile
Glu Leu Ile 1 5 10 15Val
Val Ile Ala Ile Leu Ala Gly Leu Ile Ser Ile Leu Ala Ser Thr
20 25 30Ala Ala Asn Phe Ile Ile Pro Ser
Gly Ser Asp Ala Ala Gln Thr Leu 35 40
45Lys Gln Ala Ala Glu Phe Cys Tyr Arg Lys Ser Ile Leu Thr Asn Thr
50 55 60Thr Met Val Leu Glu Leu Asp
Ile Asp Asn Asp Thr Tyr Ser Ile Lys 65 70
75 80Lys Leu Leu Arg Asp Glu Ser Gly Ile Lys Glu Val
Leu Val Phe Lys 85 90
95Pro Gln Lys Leu Pro Tyr Thr Ser Glu Ile Ile Asp Ile Thr Asp Ile
100 105 110Arg Gly Phe Arg Tyr Thr Lys
Gly Ile Ile Lys Val Pro Tyr Thr Tyr 115 120
125Leu Gly Ile Ser Ala Asp Tyr Ser Val His Leu Gly Ser Asp Pro
Ser 130 135 140Ile Tyr Arg Thr Leu Ile
Leu Tyr Arg Tyr Gly Gly Lys Val Ser Val145 150
155 160Val Glu Gly Glu Gln Phe His Thr Ser Ser Asn
Leu Ala Thr Asp Lys 165 170
175Asn Trp Lys Glu Gln Asp Asp Asn Glu Gln Gln Gln Pro 180
18529441DNALeptospira interrogans serovar
copenhageniCDS(1)...(438) 29atg aag aat tct ttt cat aaa caa aac cgc aag
gaa tcc tgt caa aat 48Met Lys Asn Ser Phe His Lys Gln Asn Arg Lys
Glu Ser Cys Gln Asn 1 5 10
15agt atg aaa aag tta tta ctc gtt tgt gtt tta gta tgt ttt gtt ggg
96Ser Met Lys Lys Leu Leu Leu Val Cys Val Leu Val Cys Phe Val Gly
20 25 30gtt ttt gcc gaa gaa gaa agt
ccc gta agg ttc aaa ctg gaa aaa agt 144Val Phe Ala Glu Glu Glu Ser
Pro Val Arg Phe Lys Leu Glu Lys Ser 35 40
45ttt ggt aat gcg tat att tta aaa att att cat ccg gct aac ttc
ggt 192Phe Gly Asn Ala Tyr Ile Leu Lys Ile Ile His Pro Ala Asn Phe
Gly 50 55 60gtt caa aag gac gct cct
cat aaa ata att tta aat cct agg aac gga 240Val Gln Lys Asp Ala Pro
His Lys Ile Ile Leu Asn Pro Arg Asn Gly 65 70
75 80gta aag gtt gaa aaa gcg gat ctg aaa gta aaa
gga aaa att tca gaa 288Val Lys Val Glu Lys Ala Asp Leu Lys Val Lys
Gly Lys Ile Ser Glu 85 90
95aag aaa aaa gaa tat ttt gcc tcg gtg gat ccg att tct ctt gtt gtg
336Lys Lys Lys Glu Tyr Phe Ala Ser Val Asp Pro Ile Ser Leu Val Val
100 105 110act ggt aaa gga gaa ttg
gag att caa gga aag att tac tac tgt aac 384Thr Gly Lys Gly Glu Leu
Glu Ile Gln Gly Lys Ile Tyr Tyr Cys Asn 115 120
125ttt gat aaa aat atc tgc att cca ggt aag att cag caa gta
gag atc 432Phe Asp Lys Asn Ile Cys Ile Pro Gly Lys Ile Gln Gln Val
Glu Ile 130 135 140att caa taa
441Ile
Gln14530146PRTLeptospira interrogans serovar copenhageni 30Met Lys Asn
Ser Phe His Lys Gln Asn Arg Lys Glu Ser Cys Gln Asn 1 5
10 15Ser Met Lys Lys Leu Leu Leu Val Cys
Val Leu Val Cys Phe Val Gly 20 25
30Val Phe Ala Glu Glu Glu Ser Pro Val Arg Phe Lys Leu Glu Lys Ser
35 40 45Phe Gly Asn Ala Tyr Ile
Leu Lys Ile Ile His Pro Ala Asn Phe Gly 50 55
60Val Gln Lys Asp Ala Pro His Lys Ile Ile Leu Asn Pro Arg Asn
Gly 65 70 75 80Val Lys
Val Glu Lys Ala Asp Leu Lys Val Lys Gly Lys Ile Ser Glu
85 90 95Lys Lys Lys Glu Tyr Phe Ala Ser
Val Asp Pro Ile Ser Leu Val Val 100 105
110Thr Gly Lys Gly Glu Leu Glu Ile Gln Gly Lys Ile Tyr Tyr Cys
Asn 115 120 125Phe Asp Lys Asn Ile
Cys Ile Pro Gly Lys Ile Gln Gln Val Glu Ile 130 135
140Ile Gln14531546DNALeptospira interrogans serovar
copenhageniCDS(1)...(543) 31atg aaa cat ttt aac caa ctc gtt ttg tcg ttt
ttg att ttt ttt acg 48Met Lys His Phe Asn Gln Leu Val Leu Ser Phe
Leu Ile Phe Phe Thr 1 5 10
15tct caa agt tac gct tca gag atc ctt aaa aaa gaa atc act ttt tta
96Ser Gln Ser Tyr Ala Ser Glu Ile Leu Lys Lys Glu Ile Thr Phe Leu
20 25 30gca att cat cct atg aaa gaa
gtt cat gga gct tgt aag gag ata caa 144Ala Ile His Pro Met Lys Glu
Val His Gly Ala Cys Lys Glu Ile Gln 35 40
45gta gat tct cct caa att caa acg agc gga acc gtt tat aaa ttg
aat 192Val Asp Ser Pro Gln Ile Gln Thr Ser Gly Thr Val Tyr Lys Leu
Asn 50 55 60tct cct ttt aca att aaa
att ccg att ttg aaa att cat tcg gga gat 240Ser Pro Phe Thr Ile Lys
Ile Pro Ile Leu Lys Ile His Ser Gly Asp 65 70
75 80gaa aac aga gac tct cat atc atg gaa att tta
ggt tat cct gat att 288Glu Asn Arg Asp Ser His Ile Met Glu Ile Leu
Gly Tyr Pro Asp Ile 85 90
95ccg gaa att ata gtt gtc gta gaa tcc gcc gaa gcc gtt ggt gaa acg
336Pro Glu Ile Ile Val Val Val Glu Ser Ala Glu Ala Val Gly Glu Thr
100 105 110tat tta att cgt ggt aaa
ctt tcg att cac gga ttt act cgc gac ttt 384Tyr Leu Ile Arg Gly Lys
Leu Ser Ile His Gly Phe Thr Arg Asp Phe 115 120
125caa tct tct gga aaa gtt gag cca aat ggg gtg ggt cag att
cgt ata 432Gln Ser Ser Gly Lys Val Glu Pro Asn Gly Val Gly Gln Ile
Arg Ile 130 135 140ttt gga aaa gtg aat
att caa ttt tcc gat ttt aat ctc gaa aga ccc 480Phe Gly Lys Val Asn
Ile Gln Phe Ser Asp Phe Asn Leu Glu Arg Pro145 150
155 160tct ctt tta ttt ata aaa aca aaa gaa gaa
att gaa att gga tat gat 528Ser Leu Leu Phe Ile Lys Thr Lys Glu Glu
Ile Glu Ile Gly Tyr Asp 165 170
175ttt tta att aag ata taa
546Phe Leu Ile Lys Ile 18032181PRTLeptospira interrogans
serovar copenhageni 32Met Lys His Phe Asn Gln Leu Val Leu Ser Phe Leu Ile
Phe Phe Thr 1 5 10 15Ser
Gln Ser Tyr Ala Ser Glu Ile Leu Lys Lys Glu Ile Thr Phe Leu
20 25 30Ala Ile His Pro Met Lys Glu Val
His Gly Ala Cys Lys Glu Ile Gln 35 40
45Val Asp Ser Pro Gln Ile Gln Thr Ser Gly Thr Val Tyr Lys Leu Asn
50 55 60Ser Pro Phe Thr Ile Lys Ile
Pro Ile Leu Lys Ile His Ser Gly Asp 65 70
75 80Glu Asn Arg Asp Ser His Ile Met Glu Ile Leu Gly
Tyr Pro Asp Ile 85 90
95Pro Glu Ile Ile Val Val Val Glu Ser Ala Glu Ala Val Gly Glu Thr
100 105 110Tyr Leu Ile Arg Gly Lys Leu
Ser Ile His Gly Phe Thr Arg Asp Phe 115 120
125Gln Ser Ser Gly Lys Val Glu Pro Asn Gly Val Gly Gln Ile Arg
Ile 130 135 140Phe Gly Lys Val Asn Ile
Gln Phe Ser Asp Phe Asn Leu Glu Arg Pro145 150
155 160Ser Leu Leu Phe Ile Lys Thr Lys Glu Glu Ile
Glu Ile Gly Tyr Asp 165 170
175Phe Leu Ile Lys Ile 18033588DNALeptospira interrogans
serovar copenhageniCDS(1)...(585) 33atg gtc aaa aag att ttg aat ctg att
ctg ctc ggt gca att gca ttt 48Met Val Lys Lys Ile Leu Asn Leu Ile
Leu Leu Gly Ala Ile Ala Phe 1 5 10
15tca ttc act ctc tgc tcc tct gct gaa aaa aaa gag gaa tcc gca
gct 96Ser Phe Thr Leu Cys Ser Ser Ala Glu Lys Lys Glu Glu Ser Ala
Ala 20 25 30cct gag cct tca
acg caa gag caa tcc gca gct gca aac aga aat gtt 144Pro Glu Pro Ser
Thr Gln Glu Gln Ser Ala Ala Ala Asn Arg Asn Val 35
40 45gac gtc aat tct ccg gaa gcg atc gca gat tct tta
aac gaa aaa cta 192Asp Val Asn Ser Pro Glu Ala Ile Ala Asp Ser Leu
Asn Glu Lys Leu 50 55 60aaa gat ttc
cga tat cca gac ggt tta act cgt cct gga ttt agt tat 240Lys Asp Phe
Arg Tyr Pro Asp Gly Leu Thr Arg Pro Gly Phe Ser Tyr 65
70 75 80aaa aaa gcg gat gtt acc cct ggt
gat ttc agc gag tgg tct aaa aca 288Lys Lys Ala Asp Val Thr Pro Gly
Asp Phe Ser Glu Trp Ser Lys Thr 85 90
95aac gct cct gta atc aaa gaa ggt ctt gga aaa ctt cca gat
agt tac 336Asn Ala Pro Val Ile Lys Glu Gly Leu Gly Lys Leu Pro Asp
Ser Tyr 100 105 110gct ctt gaa
att aca gga cac acc gat gcg atc ggt ccc gaa caa gca 384Ala Leu Glu
Ile Thr Gly His Thr Asp Ala Ile Gly Pro Glu Gln Ala 115
120 125gaa ggt gct aaa aaa gga aat att ttt tac tct
gag ctt cgt gca aat 432Glu Gly Ala Lys Lys Gly Asn Ile Phe Tyr Ser
Glu Leu Arg Ala Asn 130 135 140gca gtt
aaa caa gct tta atc aaa caa ggg att cca gca aat cgt atc 480Ala Val
Lys Gln Ala Leu Ile Lys Gln Gly Ile Pro Ala Asn Arg Ile145
150 155 160gtt act aaa ggt gcc ggt tct
tcc gag cca gtt tct ggt ctt gat gcg 528Val Thr Lys Gly Ala Gly Ser
Ser Glu Pro Val Ser Gly Leu Asp Ala 165
170 175aaa gat gct aaa aat aga aga gtc act ttc cgt ttt
gcg act tcc gca 576Lys Asp Ala Lys Asn Arg Arg Val Thr Phe Arg Phe
Ala Thr Ser Ala 180 185 190cca
caa caa taa 588Pro
Gln Gln 19534195PRTLeptospira interrogans serovar copenhageni
34Met Val Lys Lys Ile Leu Asn Leu Ile Leu Leu Gly Ala Ile Ala Phe 1
5 10 15Ser Phe Thr Leu Cys Ser
Ser Ala Glu Lys Lys Glu Glu Ser Ala Ala 20
25 30Pro Glu Pro Ser Thr Gln Glu Gln Ser Ala Ala Ala Asn
Arg Asn Val 35 40 45Asp Val Asn
Ser Pro Glu Ala Ile Ala Asp Ser Leu Asn Glu Lys Leu 50
55 60Lys Asp Phe Arg Tyr Pro Asp Gly Leu Thr Arg Pro
Gly Phe Ser Tyr 65 70 75
80Lys Lys Ala Asp Val Thr Pro Gly Asp Phe Ser Glu Trp Ser Lys Thr
85 90 95Asn Ala Pro Val Ile
Lys Glu Gly Leu Gly Lys Leu Pro Asp Ser Tyr 100
105 110Ala Leu Glu Ile Thr Gly His Thr Asp Ala Ile Gly
Pro Glu Gln Ala 115 120 125Glu Gly
Ala Lys Lys Gly Asn Ile Phe Tyr Ser Glu Leu Arg Ala Asn 130
135 140Ala Val Lys Gln Ala Leu Ile Lys Gln Gly Ile
Pro Ala Asn Arg Ile145 150 155
160Val Thr Lys Gly Ala Gly Ser Ser Glu Pro Val Ser Gly Leu Asp Ala
165 170 175Lys Asp Ala Lys
Asn Arg Arg Val Thr Phe Arg Phe Ala Thr Ser Ala 180
185 190Pro Gln Gln 195351674DNALeptospira
interrogans serovar copenhageniCDS(1)...(1671) 35atg tat tac aaa aag aaa
agg aca tta gaa aaa ttt ctc gtt ttc gga 48Met Tyr Tyr Lys Lys Lys
Arg Thr Leu Glu Lys Phe Leu Val Phe Gly 1 5
10 15acc att cta ctc acg atg att cag cct act tgg agt
gag gac ata ctt 96Thr Ile Leu Leu Thr Met Ile Gln Pro Thr Trp Ser
Glu Asp Ile Leu 20 25 30ccg
gaa gaa act gtt tta gaa gag aat aaa aaa tct ccc gtt gaa aat 144Pro
Glu Glu Thr Val Leu Glu Glu Asn Lys Lys Ser Pro Val Glu Asn 35
40 45tta ggt gac tcc aaa aaa ata ttg aga
ctg act tta aaa gac gca gtc 192Leu Gly Asp Ser Lys Lys Ile Leu Arg
Leu Thr Leu Lys Asp Ala Val 50 55
60aat tat gtt ctt gaa aag aat att aca atc caa aac gct aaa atg gaa
240Asn Tyr Val Leu Glu Lys Asn Ile Thr Ile Gln Asn Ala Lys Met Glu 65
70 75 80tat gta aaa gcg
gac ggt gga gaa ctt aaa aac gaa tcc caa ttt act 288Tyr Val Lys Ala
Asp Gly Gly Glu Leu Lys Asn Glu Ser Gln Phe Thr 85
90 95tgg aat cta atc ggt gga att acc gtt ttc
agg aca act ctc cct gcc 336Trp Asn Leu Ile Gly Gly Ile Thr Val Phe
Arg Thr Thr Leu Pro Ala 100 105
110aat aga aat aac atc ttt gcc gga acc aaa caa agc caa gat aaa tta
384Asn Arg Asn Asn Ile Phe Ala Gly Thr Lys Gln Ser Gln Asp Lys Leu
115 120 125agc gtc gga att gag aaa aat
ttt aga act gga acg tat gca aaa tta 432Ser Val Gly Ile Glu Lys Asn
Phe Arg Thr Gly Thr Tyr Ala Lys Leu 130 135
140gaa gca agt act act cgt ttt gat acg agc gct ttc gaa aac ccg tcc
480Glu Ala Ser Thr Thr Arg Phe Asp Thr Ser Ala Phe Glu Asn Pro Ser145
150 155 160aca act cct tcc
aac tta gcg gcg ctt gca att cct cct tta tat aca 528Thr Thr Pro Ser
Asn Leu Ala Ala Leu Ala Ile Pro Pro Leu Tyr Thr 165
170 175ggc gct ttg acc atc act tta agc cag gaa
atc tta aag tat agt ttt 576Gly Ala Leu Thr Ile Thr Leu Ser Gln Glu
Ile Leu Lys Tyr Ser Phe 180 185
190gga aaa act cag aaa gaa aga gaa gcc att tta aga caa aat act gta
624Gly Lys Thr Gln Lys Glu Arg Glu Ala Ile Leu Arg Gln Asn Thr Val
195 200 205atc aaa aga gaa gaa ttg att
tat gta ctt tcg cag ctt gta gca caa 672Ile Lys Arg Glu Glu Leu Ile
Tyr Val Leu Ser Gln Leu Val Ala Gln 210 215
220aca ttg att caa tat tgg agt tta aat atc tac gac tcg aac gta aaa
720Thr Leu Ile Gln Tyr Trp Ser Leu Asn Ile Tyr Asp Ser Asn Val Lys225
230 235 240acg ctg caa gat
tta gaa tcc aat act aga aac atc aga gat ttg acc 768Thr Leu Gln Asp
Leu Glu Ser Asn Thr Arg Asn Ile Arg Asp Leu Thr 245
250 255gtt aga aaa cga aac tta ggg ctt tcg gaa
ggt ttt gaa gtc aat cta 816Val Arg Lys Arg Asn Leu Gly Leu Ser Glu
Gly Phe Glu Val Asn Leu 260 265
270tgg aat tct att ctt tct caa aca gca ggt aat tta gaa aaa gct aaa
864Trp Asn Ser Ile Leu Ser Gln Thr Ala Gly Asn Leu Glu Lys Ala Lys
275 280 285gtg tct cgt aaa gaa gca gaa
aga aat tta att cgg att tta aac gcg 912Val Ser Arg Lys Glu Ala Glu
Arg Asn Leu Ile Arg Ile Leu Asn Ala 290 295
300gat cct tct tct aaa atc gaa ggt gtt act gat ctt caa gaa aac gtt
960Asp Pro Ser Ser Lys Ile Glu Gly Val Thr Asp Leu Gln Glu Asn Val305
310 315 320cct tta gat ttt
aac gtg gaa aag gat tat atc tac gca ctt gat cat 1008Pro Leu Asp Phe
Asn Val Glu Lys Asp Tyr Ile Tyr Ala Leu Asp His 325
330 335aga acc gat cta aaa aat ctt cgc aaa caa
agg gaa atc gca gaa tta 1056Arg Thr Asp Leu Lys Asn Leu Arg Lys Gln
Arg Glu Ile Ala Glu Leu 340 345
350aat ctt aag atc aaa gaa gca gaa gac atg cct tct tta aaa ctt tca
1104Asn Leu Lys Ile Lys Glu Ala Glu Asp Met Pro Ser Leu Lys Leu Ser
355 360 365ggg gcc tat tct aca aga gga
caa aat att gtt tct cct caa caa aat 1152Gly Ala Tyr Ser Thr Arg Gly
Gln Asn Ile Val Ser Pro Gln Gln Asn 370 375
380ctc acg gat gga aat aga gga gtc gcc tct ttt aaa tat ccg gaa gca
1200Leu Thr Asp Gly Asn Arg Gly Val Ala Ser Phe Lys Tyr Pro Glu Ala385
390 395 400tac gcg gct ttt
caa ttt tct tat cct ctt tgg gat aaa ggg atc aag 1248Tyr Ala Ala Phe
Gln Phe Ser Tyr Pro Leu Trp Asp Lys Gly Ile Lys 405
410 415gca gat att cga aac gca aaa tta gac gta
cag aat cta gaa aaa aaa 1296Ala Asp Ile Arg Asn Ala Lys Leu Asp Val
Gln Asn Leu Glu Lys Lys 420 425
430gaa gct gag tta aaa ctt tcc atc aaa gaa gaa tta gaa aat cgt tat
1344Glu Ala Glu Leu Lys Leu Ser Ile Lys Glu Glu Leu Glu Asn Arg Tyr
435 440 445gct gcc atc gtt gcc gat aaa
gat att ttc gaa ggt gct aaa aaa aga 1392Ala Ala Ile Val Ala Asp Lys
Asp Ile Phe Glu Gly Ala Lys Lys Arg 450 455
460aag gaa gaa gca aat aaa ttc tac aaa ggt ctt tcc gaa cgt ttt cgt
1440Lys Glu Glu Ala Asn Lys Phe Tyr Lys Gly Leu Ser Glu Arg Phe Arg465
470 475 480cag gga aga ttt
acc gcg gtc gcg gtt aaa aac gcc tta gac aac gta 1488Gln Gly Arg Phe
Thr Ala Val Ala Val Lys Asn Ala Leu Asp Asn Val 485
490 495att caa tct gaa tta caa gtt acc cag gca
aaa att caa ctg aac ata 1536Ile Gln Ser Glu Leu Gln Val Thr Gln Ala
Lys Ile Gln Leu Asn Ile 500 505
510gac att ctt cgt tat gaa ttg gca aaa aat cat atc ttc gaa agg ttc
1584Asp Ile Leu Arg Tyr Glu Leu Ala Lys Asn His Ile Phe Glu Arg Phe
515 520 525ggc gtg aac gta aat gac atc
atc gat cga ctg atg aag atg gtg gat 1632Gly Val Asn Val Asn Asp Ile
Ile Asp Arg Leu Met Lys Met Val Asp 530 535
540att gca caa tcc aaa tct tct acg gaa act tcc gaa aaa taa
1674Ile Ala Gln Ser Lys Ser Ser Thr Glu Thr Ser Glu Lys545
550 55536557PRTLeptospira interrogans serovar
copenhageni 36Met Tyr Tyr Lys Lys Lys Arg Thr Leu Glu Lys Phe Leu Val Phe
Gly 1 5 10 15Thr Ile Leu
Leu Thr Met Ile Gln Pro Thr Trp Ser Glu Asp Ile Leu 20
25 30Pro Glu Glu Thr Val Leu Glu Glu Asn Lys
Lys Ser Pro Val Glu Asn 35 40
45Leu Gly Asp Ser Lys Lys Ile Leu Arg Leu Thr Leu Lys Asp Ala Val 50
55 60Asn Tyr Val Leu Glu Lys Asn Ile Thr
Ile Gln Asn Ala Lys Met Glu 65 70 75
80Tyr Val Lys Ala Asp Gly Gly Glu Leu Lys Asn Glu Ser Gln
Phe Thr 85 90 95Trp Asn
Leu Ile Gly Gly Ile Thr Val Phe Arg Thr Thr Leu Pro Ala 100
105 110Asn Arg Asn Asn Ile Phe Ala Gly Thr
Lys Gln Ser Gln Asp Lys Leu 115 120
125Ser Val Gly Ile Glu Lys Asn Phe Arg Thr Gly Thr Tyr Ala Lys Leu
130 135 140Glu Ala Ser Thr Thr Arg Phe
Asp Thr Ser Ala Phe Glu Asn Pro Ser145 150
155 160Thr Thr Pro Ser Asn Leu Ala Ala Leu Ala Ile Pro
Pro Leu Tyr Thr 165 170
175Gly Ala Leu Thr Ile Thr Leu Ser Gln Glu Ile Leu Lys Tyr Ser Phe
180 185 190Gly Lys Thr Gln Lys Glu
Arg Glu Ala Ile Leu Arg Gln Asn Thr Val 195 200
205Ile Lys Arg Glu Glu Leu Ile Tyr Val Leu Ser Gln Leu Val
Ala Gln 210 215 220Thr Leu Ile Gln Tyr
Trp Ser Leu Asn Ile Tyr Asp Ser Asn Val Lys225 230
235 240Thr Leu Gln Asp Leu Glu Ser Asn Thr Arg
Asn Ile Arg Asp Leu Thr 245 250
255Val Arg Lys Arg Asn Leu Gly Leu Ser Glu Gly Phe Glu Val Asn Leu
260 265 270Trp Asn Ser Ile Leu
Ser Gln Thr Ala Gly Asn Leu Glu Lys Ala Lys 275
280 285Val Ser Arg Lys Glu Ala Glu Arg Asn Leu Ile Arg
Ile Leu Asn Ala 290 295 300Asp Pro Ser
Ser Lys Ile Glu Gly Val Thr Asp Leu Gln Glu Asn Val305
310 315 320Pro Leu Asp Phe Asn Val Glu
Lys Asp Tyr Ile Tyr Ala Leu Asp His 325
330 335Arg Thr Asp Leu Lys Asn Leu Arg Lys Gln Arg Glu
Ile Ala Glu Leu 340 345 350Asn
Leu Lys Ile Lys Glu Ala Glu Asp Met Pro Ser Leu Lys Leu Ser 355
360 365Gly Ala Tyr Ser Thr Arg Gly Gln Asn
Ile Val Ser Pro Gln Gln Asn 370 375
380Leu Thr Asp Gly Asn Arg Gly Val Ala Ser Phe Lys Tyr Pro Glu Ala385
390 395 400Tyr Ala Ala Phe
Gln Phe Ser Tyr Pro Leu Trp Asp Lys Gly Ile Lys 405
410 415Ala Asp Ile Arg Asn Ala Lys Leu Asp Val
Gln Asn Leu Glu Lys Lys 420 425
430Glu Ala Glu Leu Lys Leu Ser Ile Lys Glu Glu Leu Glu Asn Arg Tyr
435 440 445Ala Ala Ile Val Ala Asp Lys
Asp Ile Phe Glu Gly Ala Lys Lys Arg 450 455
460Lys Glu Glu Ala Asn Lys Phe Tyr Lys Gly Leu Ser Glu Arg Phe
Arg465 470 475 480Gln Gly
Arg Phe Thr Ala Val Ala Val Lys Asn Ala Leu Asp Asn Val
485 490 495Ile Gln Ser Glu Leu Gln Val
Thr Gln Ala Lys Ile Gln Leu Asn Ile 500 505
510Asp Ile Leu Arg Tyr Glu Leu Ala Lys Asn His Ile Phe Glu
Arg Phe 515 520 525Gly Val Asn Val
Asn Asp Ile Ile Asp Arg Leu Met Lys Met Val Asp 530
535 540Ile Ala Gln Ser Lys Ser Ser Thr Glu Thr Ser Glu
Lys545 550 55537480DNALeptospira
interrogans serovar copenhageniCDS(1)...(477) 37ttg atc ggt tta agt att
gcg att ttg att cga tcc ttt ctt ttt ttt 48Leu Ile Gly Leu Ser Ile
Ala Ile Leu Ile Arg Ser Phe Leu Phe Phe 1 5
10 15cca ttt acg ttg gaa acc aaa gac atg ctt cct act
tat tcc cct gga 96Pro Phe Thr Leu Glu Thr Lys Asp Met Leu Pro Thr
Tyr Ser Pro Gly 20 25 30aaa
aga att tat ttc cat agg ttt gta aat cgt tcc aat ctc tat ctt 144Lys
Arg Ile Tyr Phe His Arg Phe Val Asn Arg Ser Asn Leu Tyr Leu 35
40 45gga gat tta gtt tta gtc aaa cat cca
act caa gaa ggt aag gta gtt 192Gly Asp Leu Val Leu Val Lys His Pro
Thr Gln Glu Gly Lys Val Val 50 55
60ttt tcc agg atc tcc gga aaa cca gga gac aca gtt caa atg aaa aat
240Phe Ser Arg Ile Ser Gly Lys Pro Gly Asp Thr Val Gln Met Lys Asn 65
70 75 80aag atc ttg tat
cgt aat aat cat cca gaa gat att tct ggt gtt ggg 288Lys Ile Leu Tyr
Arg Asn Asn His Pro Glu Asp Ile Ser Gly Val Gly 85
90 95agt ggc ttt aca ctt cag ttc gaa gat aaa
cga gga gca ttt ccc tcc 336Ser Gly Phe Thr Leu Gln Phe Glu Asp Lys
Arg Gly Ala Phe Pro Ser 100 105
110agt ttt tct ggc aga gac aac gga gaa cct ttg att ctt aaa gac cga
384Ser Phe Ser Gly Arg Asp Asn Gly Glu Pro Leu Ile Leu Lys Asp Arg
115 120 125gat tat ttt ctt ctc tgc gac
aac cga gat tct tgc tcc gac tcc aga 432Asp Tyr Phe Leu Leu Cys Asp
Asn Arg Asp Ser Cys Ser Asp Ser Arg 130 135
140gat ttt ggt cca att cct ata gaa aac ata tta gga aaa gcg ttc taa
480Asp Phe Gly Pro Ile Pro Ile Glu Asn Ile Leu Gly Lys Ala Phe145
150 15538159PRTLeptospira interrogans serovar
copenhageni 38Leu Ile Gly Leu Ser Ile Ala Ile Leu Ile Arg Ser Phe Leu Phe
Phe 1 5 10 15Pro Phe Thr
Leu Glu Thr Lys Asp Met Leu Pro Thr Tyr Ser Pro Gly 20
25 30Lys Arg Ile Tyr Phe His Arg Phe Val Asn
Arg Ser Asn Leu Tyr Leu 35 40
45Gly Asp Leu Val Leu Val Lys His Pro Thr Gln Glu Gly Lys Val Val 50
55 60Phe Ser Arg Ile Ser Gly Lys Pro Gly
Asp Thr Val Gln Met Lys Asn 65 70 75
80Lys Ile Leu Tyr Arg Asn Asn His Pro Glu Asp Ile Ser Gly
Val Gly 85 90 95Ser Gly
Phe Thr Leu Gln Phe Glu Asp Lys Arg Gly Ala Phe Pro Ser 100
105 110Ser Phe Ser Gly Arg Asp Asn Gly Glu
Pro Leu Ile Leu Lys Asp Arg 115 120
125Asp Tyr Phe Leu Leu Cys Asp Asn Arg Asp Ser Cys Ser Asp Ser Arg
130 135 140Asp Phe Gly Pro Ile Pro Ile
Glu Asn Ile Leu Gly Lys Ala Phe145 150
15539966DNALeptospira interrogans serovar copenhageniCDS(1)...(963) 39atg
gtt ttt tcc aga tca acc gat ttg ttt aaa gga atc aat agg acc 48Met
Val Phe Ser Arg Ser Thr Asp Leu Phe Lys Gly Ile Asn Arg Thr 1
5 10 15gag gaa act atg aaa caa ata
gca atc tta acc gcc ctg atc att ttt 96Glu Glu Thr Met Lys Gln Ile
Ala Ile Leu Thr Ala Leu Ile Ile Phe 20 25
30acg tct tgt gcg tcg gta gag tct aaa cga agc gtc agc gct
tct gga 144Thr Ser Cys Ala Ser Val Glu Ser Lys Arg Ser Val Ser Ala
Ser Gly 35 40 45gat ccg tcg gag
att ttt ttt gaa aaa gaa att att ccg atg gat tct 192Asp Pro Ser Glu
Ile Phe Phe Glu Lys Glu Ile Ile Pro Met Asp Ser 50
55 60aat tca aat ttc gtt tct caa aaa cct gca cgt aga tct
ttc gaa gaa 240Asn Ser Asn Phe Val Ser Gln Lys Pro Ala Arg Arg Ser
Phe Glu Glu 65 70 75
80gaa ttg agt gtt gaa aag tat gca aaa gct caa cca cct gaa aaa acc
288Glu Leu Ser Val Glu Lys Tyr Ala Lys Ala Gln Pro Pro Glu Lys Thr
85 90 95aat tct tct gga gat
ttt gac gaa gtt gga atg tct tcc tgg tat ggc 336Asn Ser Ser Gly Asp
Phe Asp Glu Val Gly Met Ser Ser Trp Tyr Gly 100
105 110gca aag ttt cac ggt aaa cca acg gca agc gga gaa
aaa ttt gat aaa 384Ala Lys Phe His Gly Lys Pro Thr Ala Ser Gly Glu
Lys Phe Asp Lys 115 120 125aca aaa
cta act gct gca cat cca aca ctt cct tta ggt tcc atc att 432Thr Lys
Leu Thr Ala Ala His Pro Thr Leu Pro Leu Gly Ser Ile Ile 130
135 140aga gtt caa aat tta gaa aac caa aaa gaa gtt
ata gtt cgt gtc aac 480Arg Val Gln Asn Leu Glu Asn Gln Lys Glu Val
Ile Val Arg Val Asn145 150 155
160gat aga gga cct ttt gta aag gat aga atc att gat ctt tct gaa aaa
528Asp Arg Gly Pro Phe Val Lys Asp Arg Ile Ile Asp Leu Ser Glu Lys
165 170 175gct gca gat act tta
gat ttt aaa gat gta ggt att gct aaa gta ggt 576Ala Ala Asp Thr Leu
Asp Phe Lys Asp Val Gly Ile Ala Lys Val Gly 180
185 190att aaa gta gta aaa cgt gga gga gct gca aac gaa
gaa tcc gaa gat 624Ile Lys Val Val Lys Arg Gly Gly Ala Ala Asn Glu
Glu Ser Glu Asp 195 200 205ctc gaa
aat tct gac gat gaa gaa gct ctt tta gaa gat gga aaa cct 672Leu Glu
Asn Ser Asp Asp Glu Glu Ala Leu Leu Glu Asp Gly Lys Pro 210
215 220gaa aaa cta aat cct caa aaa tcg gat tat caa
aac aaa ccg att gcc 720Glu Lys Leu Asn Pro Gln Lys Ser Asp Tyr Gln
Asn Lys Pro Ile Ala225 230 235
240ggt gga aag tat atc aaa ggt gct cct aaa gga tat acg gtt caa gta
768Gly Gly Lys Tyr Ile Lys Gly Ala Pro Lys Gly Tyr Thr Val Gln Val
245 250 255ggt gtt ttt cgg gaa
caa tct aga gct gaa tct tat aaa tct aat ctt 816Gly Val Phe Arg Glu
Gln Ser Arg Ala Glu Ser Tyr Lys Ser Asn Leu 260
265 270gga caa gaa tac ggt gaa aaa act ttc cta ttt aca
aga gat ggt tta 864Gly Gln Glu Tyr Gly Glu Lys Thr Phe Leu Phe Thr
Arg Asp Gly Leu 275 280 285ttt gta
att cag tta ggg gat ttc gca agc aga act gag gcg gaa tcg 912Phe Val
Ile Gln Leu Gly Asp Phe Ala Ser Arg Thr Glu Ala Glu Ser 290
295 300ttg aaa tcg aaa tta aaa aac gat gga att gac
tgt ttc att ccg aaa 960Leu Lys Ser Lys Leu Lys Asn Asp Gly Ile Asp
Cys Phe Ile Pro Lys305 310 315
320aaa taa
966Lys40321PRTLeptospira interrogans serovar copenhageni 40Met Val Phe
Ser Arg Ser Thr Asp Leu Phe Lys Gly Ile Asn Arg Thr 1 5
10 15Glu Glu Thr Met Lys Gln Ile Ala Ile
Leu Thr Ala Leu Ile Ile Phe 20 25
30Thr Ser Cys Ala Ser Val Glu Ser Lys Arg Ser Val Ser Ala Ser Gly
35 40 45Asp Pro Ser Glu Ile Phe
Phe Glu Lys Glu Ile Ile Pro Met Asp Ser 50 55
60Asn Ser Asn Phe Val Ser Gln Lys Pro Ala Arg Arg Ser Phe Glu
Glu 65 70 75 80Glu Leu
Ser Val Glu Lys Tyr Ala Lys Ala Gln Pro Pro Glu Lys Thr
85 90 95Asn Ser Ser Gly Asp Phe Asp Glu
Val Gly Met Ser Ser Trp Tyr Gly 100 105
110Ala Lys Phe His Gly Lys Pro Thr Ala Ser Gly Glu Lys Phe Asp
Lys 115 120 125Thr Lys Leu Thr Ala
Ala His Pro Thr Leu Pro Leu Gly Ser Ile Ile 130 135
140Arg Val Gln Asn Leu Glu Asn Gln Lys Glu Val Ile Val Arg
Val Asn145 150 155 160Asp
Arg Gly Pro Phe Val Lys Asp Arg Ile Ile Asp Leu Ser Glu Lys
165 170 175Ala Ala Asp Thr Leu Asp Phe
Lys Asp Val Gly Ile Ala Lys Val Gly 180 185
190Ile Lys Val Val Lys Arg Gly Gly Ala Ala Asn Glu Glu Ser
Glu Asp 195 200 205Leu Glu Asn Ser
Asp Asp Glu Glu Ala Leu Leu Glu Asp Gly Lys Pro 210
215 220Glu Lys Leu Asn Pro Gln Lys Ser Asp Tyr Gln Asn
Lys Pro Ile Ala225 230 235
240Gly Gly Lys Tyr Ile Lys Gly Ala Pro Lys Gly Tyr Thr Val Gln Val
245 250 255Gly Val Phe Arg Glu
Gln Ser Arg Ala Glu Ser Tyr Lys Ser Asn Leu 260
265 270Gly Gln Glu Tyr Gly Glu Lys Thr Phe Leu Phe Thr
Arg Asp Gly Leu 275 280 285Phe Val
Ile Gln Leu Gly Asp Phe Ala Ser Arg Thr Glu Ala Glu Ser 290
295 300Leu Lys Ser Lys Leu Lys Asn Asp Gly Ile Asp
Cys Phe Ile Pro Lys305 310 315
320Lys411053DNALeptospira interrogans serovar
copenhageniCDS(1)...(1050) 41atg gaa cct aat tca gat tca aat cga agg tca
aat atg gaa cga gca 48Met Glu Pro Asn Ser Asp Ser Asn Arg Arg Ser
Asn Met Glu Arg Ala 1 5 10
15att tca aac gaa atg aca cgg cta gaa ctc agt gaa ttt tta tcg gat
96Ile Ser Asn Glu Met Thr Arg Leu Glu Leu Ser Glu Phe Leu Ser Asp
20 25 30cca aga tct aga aaa gaa ttt
ttt gag ttg atg aaa tta aag aat aaa 144Pro Arg Ser Arg Lys Glu Phe
Phe Glu Leu Met Lys Leu Lys Asn Lys 35 40
45atc gga cat tta gaa atg aat cta aag tta gga tcc gat gaa aac
aaa 192Ile Gly His Leu Glu Met Asn Leu Lys Leu Gly Ser Asp Glu Asn
Lys 50 55 60agt aga act ttc tat att
aga aat tca tta tta gct gct gct tgt gtt 240Ser Arg Thr Phe Tyr Ile
Arg Asn Ser Leu Leu Ala Ala Ala Cys Val 65 70
75 80ctt ttg ctt tca gct cta gct ttt tat ttc aga
ttt ttt tct tcg gaa 288Leu Leu Leu Ser Ala Leu Ala Phe Tyr Phe Arg
Phe Phe Ser Ser Glu 85 90
95caa aac gaa ttt gaa att aca aaa tca gta act act ggt cag tgt aat
336Gln Asn Glu Phe Glu Ile Thr Lys Ser Val Thr Thr Gly Gln Cys Asn
100 105 110gtt tct att aat aaa gaa
aac att att ctg aaa tcg ggt aag gat tct 384Val Ser Ile Asn Lys Glu
Asn Ile Ile Leu Lys Ser Gly Lys Asp Ser 115 120
125tat tgt gat tat aca att tcg gga gaa tta gga cta acg ttg
agg att 432Tyr Cys Asp Tyr Thr Ile Ser Gly Glu Leu Gly Leu Thr Leu
Arg Ile 130 135 140tta cca gaa tcc att
ttt tca gct tct aaa aaa gga gat gaa gta aat 480Leu Pro Glu Ser Ile
Phe Ser Ala Ser Lys Lys Gly Asp Glu Val Asn145 150
155 160cta agt tta agt tcc gga aaa gtt tta ttc
act acg aac aaa aaa aaa 528Leu Ser Leu Ser Ser Gly Lys Val Leu Phe
Thr Thr Asn Lys Lys Lys 165 170
175ata tct tta aaa att cgg tcg aaa gta gat act tta tct tcc gaa ctt
576Ile Ser Leu Lys Ile Arg Ser Lys Val Asp Thr Leu Ser Ser Glu Leu
180 185 190ttg gga aca act ctc gtt
ttg atc gca gat caa cat tct aaa aaa tat 624Leu Gly Thr Thr Leu Val
Leu Ile Ala Asp Gln His Ser Lys Lys Tyr 195 200
205caa att atg gtt ttg gaa gga gct ata cga gtc gat tct aca
aaa tca 672Gln Ile Met Val Leu Glu Gly Ala Ile Arg Val Asp Ser Thr
Lys Ser 210 215 220aaa atg gat att tta
cct ggt tat tcg gtt ttg aag gat gga tct tct 720Lys Met Asp Ile Leu
Pro Gly Tyr Ser Val Leu Lys Asp Gly Ser Ser225 230
235 240gaa agt tct act caa tcc tct ggg caa gaa
gtc gag gtt atg aaa att 768Glu Ser Ser Thr Gln Ser Ser Gly Gln Glu
Val Glu Val Met Lys Ile 245 250
255gag cca aaa gaa ttt aca aaa tac caa gcg ctt tcg gag aat tct aaa
816Glu Pro Lys Glu Phe Thr Lys Tyr Gln Ala Leu Ser Glu Asn Ser Lys
260 265 270aag gtc tta aat gaa aac
ttt act cat cac aat cgg gaa acg gat ttt 864Lys Val Leu Asn Glu Asn
Phe Thr His His Asn Arg Glu Thr Asp Phe 275 280
285tta atc aaa tcc gaa ata gaa gag aat tcg tat cct ata tat
cgt atc 912Leu Ile Lys Ser Glu Ile Glu Glu Asn Ser Tyr Pro Ile Tyr
Arg Ile 290 295 300act ctt aaa aac aaa
caa gtt gtt tct gga acg atc gaa gag act gaa 960Thr Leu Lys Asn Lys
Gln Val Val Ser Gly Thr Ile Glu Glu Thr Glu305 310
315 320aaa ttt tat cta ctt aaa gat aaa gat ggg
aat atc aaa gaa att gaa 1008Lys Phe Tyr Leu Leu Lys Asp Lys Asp Gly
Asn Ile Lys Glu Ile Glu 325 330
335aaa gag gat ata atc gaa tta gaa ctt gtt caa cca aag aac taa
1053Lys Glu Asp Ile Ile Glu Leu Glu Leu Val Gln Pro Lys Asn
340 345 35042350PRTLeptospira interrogans
serovar copenhageni 42Met Glu Pro Asn Ser Asp Ser Asn Arg Arg Ser Asn Met
Glu Arg Ala 1 5 10 15Ile
Ser Asn Glu Met Thr Arg Leu Glu Leu Ser Glu Phe Leu Ser Asp
20 25 30Pro Arg Ser Arg Lys Glu Phe Phe
Glu Leu Met Lys Leu Lys Asn Lys 35 40
45Ile Gly His Leu Glu Met Asn Leu Lys Leu Gly Ser Asp Glu Asn Lys
50 55 60Ser Arg Thr Phe Tyr Ile Arg
Asn Ser Leu Leu Ala Ala Ala Cys Val 65 70
75 80Leu Leu Leu Ser Ala Leu Ala Phe Tyr Phe Arg Phe
Phe Ser Ser Glu 85 90
95Gln Asn Glu Phe Glu Ile Thr Lys Ser Val Thr Thr Gly Gln Cys Asn
100 105 110Val Ser Ile Asn Lys Glu Asn
Ile Ile Leu Lys Ser Gly Lys Asp Ser 115 120
125Tyr Cys Asp Tyr Thr Ile Ser Gly Glu Leu Gly Leu Thr Leu Arg
Ile 130 135 140Leu Pro Glu Ser Ile Phe
Ser Ala Ser Lys Lys Gly Asp Glu Val Asn145 150
155 160Leu Ser Leu Ser Ser Gly Lys Val Leu Phe Thr
Thr Asn Lys Lys Lys 165 170
175Ile Ser Leu Lys Ile Arg Ser Lys Val Asp Thr Leu Ser Ser Glu Leu
180 185 190Leu Gly Thr Thr Leu Val
Leu Ile Ala Asp Gln His Ser Lys Lys Tyr 195 200
205Gln Ile Met Val Leu Glu Gly Ala Ile Arg Val Asp Ser Thr
Lys Ser 210 215 220Lys Met Asp Ile Leu
Pro Gly Tyr Ser Val Leu Lys Asp Gly Ser Ser225 230
235 240Glu Ser Ser Thr Gln Ser Ser Gly Gln Glu
Val Glu Val Met Lys Ile 245 250
255Glu Pro Lys Glu Phe Thr Lys Tyr Gln Ala Leu Ser Glu Asn Ser Lys
260 265 270Lys Val Leu Asn Glu
Asn Phe Thr His His Asn Arg Glu Thr Asp Phe 275
280 285Leu Ile Lys Ser Glu Ile Glu Glu Asn Ser Tyr Pro
Ile Tyr Arg Ile 290 295 300Thr Leu Lys
Asn Lys Gln Val Val Ser Gly Thr Ile Glu Glu Thr Glu305
310 315 320Lys Phe Tyr Leu Leu Lys Asp
Lys Asp Gly Asn Ile Lys Glu Ile Glu 325
330 335Lys Glu Asp Ile Ile Glu Leu Glu Leu Val Gln Pro
Lys Asn 340 345
350431074DNALeptospira interrogans serovar copenhageniCDS(1)...(1071)
43ttg ttt tta aaa aaa agg aaa gcg gtt tgt aaa gtt ttg tgt cct ttg
48Leu Phe Leu Lys Lys Arg Lys Ala Val Cys Lys Val Leu Cys Pro Leu 1
5 10 15aat tcg ctt gaa gcg aat
gat agg ttg tcg aat tct tac ctt atg gaa 96Asn Ser Leu Glu Ala Asn
Asp Arg Leu Ser Asn Ser Tyr Leu Met Glu 20
25 30aaa gaa aca ctg gaa gac tta gag ttt gcc agg atc aaa
ctg gaa act 144Lys Glu Thr Leu Glu Asp Leu Glu Phe Ala Arg Ile Lys
Leu Glu Thr 35 40 45ctc aaa caa
gaa ctg gga aaa gaa att aca gga caa gac gaa gtt att 192Leu Lys Gln
Glu Leu Gly Lys Glu Ile Thr Gly Gln Asp Glu Val Ile 50
55 60cga aac gta ttg gtt tgt ctg atc tgt caa ggt cat
gta ctt tta gaa 240Arg Asn Val Leu Val Cys Leu Ile Cys Gln Gly His
Val Leu Leu Glu 65 70 75
80ggg atg ccc ggg ctt gca aaa aca cta ctt gca agg tca ctt gca agt
288Gly Met Pro Gly Leu Ala Lys Thr Leu Leu Ala Arg Ser Leu Ala Ser
85 90 95gcg ctg gat tta aac
ttt aaa aga att caa ttt aca cct gat ctt tta 336Ala Leu Asp Leu Asn
Phe Lys Arg Ile Gln Phe Thr Pro Asp Leu Leu 100
105 110cca gcc gat ctc gtc gga aca gta gta ttt aat cca
aaa acc aca gaa 384Pro Ala Asp Leu Val Gly Thr Val Val Phe Asn Pro
Lys Thr Thr Glu 115 120 125ttt gaa
act aga aag gga cca gtg ttt acc gga gtt tta ctc gcg gac 432Phe Glu
Thr Arg Lys Gly Pro Val Phe Thr Gly Val Leu Leu Ala Asp 130
135 140gaa att aat aga gct ccg gct aag gtt cag tct
gct ctt cta gaa agt 480Glu Ile Asn Arg Ala Pro Ala Lys Val Gln Ser
Ala Leu Leu Glu Ser145 150 155
160atg gaa gaa aag acc gtt acg att gga gac aaa acc tat aaa cta gac
528Met Glu Glu Lys Thr Val Thr Ile Gly Asp Lys Thr Tyr Lys Leu Asp
165 170 175aaa ccg ttt tta gta
atc gca act caa aat cca atc gat cag gac gga 576Lys Pro Phe Leu Val
Ile Ala Thr Gln Asn Pro Ile Asp Gln Asp Gly 180
185 190act tat cct ctt ccc gaa gct cag atg gac cga ttt
ttg atg aag atc 624Thr Tyr Pro Leu Pro Glu Ala Gln Met Asp Arg Phe
Leu Met Lys Ile 195 200 205aac gta
gat tac cca act ttg gaa gag gaa gtt tcc att ttg gat caa 672Asn Val
Asp Tyr Pro Thr Leu Glu Glu Glu Val Ser Ile Leu Asp Gln 210
215 220cac gga aaa ata agt tcg gca aac gga aag att
aaa aaa acc gtt tct 720His Gly Lys Ile Ser Ser Ala Asn Gly Lys Ile
Lys Lys Thr Val Ser225 230 235
240tcc tct gaa att tta cga cta tct tct atg ctc gac gaa gta ttt atc
768Ser Ser Glu Ile Leu Arg Leu Ser Ser Met Leu Asp Glu Val Phe Ile
245 250 255gaa gaa aaa atc aaa
tcc tat att gta cga ttg gtt cga aat aca aga 816Glu Glu Lys Ile Lys
Ser Tyr Ile Val Arg Leu Val Arg Asn Thr Arg 260
265 270cca gaa gaa aga acc att ccg gaa ctc att ccg tat
atc cga cac gga 864Pro Glu Glu Arg Thr Ile Pro Glu Leu Ile Pro Tyr
Ile Arg His Gly 275 280 285gct tct
ccg aga gct tct tta agt ata tta aaa agt tct aaa gca aat 912Ala Ser
Pro Arg Ala Ser Leu Ser Ile Leu Lys Ser Ser Lys Ala Asn 290
295 300gct ctt ttg agt ggt agg aca tac gta act ccg
gaa gac gta aaa acg 960Ala Leu Leu Ser Gly Arg Thr Tyr Val Thr Pro
Glu Asp Val Lys Thr305 310 315
320tct ctt gtg gaa ata tta aga cat aga ata ctg ctt acc ttt gag gca
1008Ser Leu Val Glu Ile Leu Arg His Arg Ile Leu Leu Thr Phe Glu Ala
325 330 335att tcg gaa gaa ttg
aac gta gaa tct ttg atc cga act gtt gtg gag 1056Ile Ser Glu Glu Leu
Asn Val Glu Ser Leu Ile Arg Thr Val Val Glu 340
345 350gca act ccg gtt cct tag
1074Ala Thr Pro Val Pro 35544357PRTLeptospira
interrogans serovar copenhageni 44Leu Phe Leu Lys Lys Arg Lys Ala Val Cys
Lys Val Leu Cys Pro Leu 1 5 10
15Asn Ser Leu Glu Ala Asn Asp Arg Leu Ser Asn Ser Tyr Leu Met Glu
20 25 30Lys Glu Thr Leu Glu
Asp Leu Glu Phe Ala Arg Ile Lys Leu Glu Thr 35
40 45Leu Lys Gln Glu Leu Gly Lys Glu Ile Thr Gly Gln Asp
Glu Val Ile 50 55 60Arg Asn Val Leu
Val Cys Leu Ile Cys Gln Gly His Val Leu Leu Glu 65 70
75 80Gly Met Pro Gly Leu Ala Lys Thr Leu
Leu Ala Arg Ser Leu Ala Ser 85 90
95Ala Leu Asp Leu Asn Phe Lys Arg Ile Gln Phe Thr Pro Asp Leu
Leu 100 105 110Pro Ala Asp Leu
Val Gly Thr Val Val Phe Asn Pro Lys Thr Thr Glu 115
120 125Phe Glu Thr Arg Lys Gly Pro Val Phe Thr Gly Val
Leu Leu Ala Asp 130 135 140Glu Ile Asn
Arg Ala Pro Ala Lys Val Gln Ser Ala Leu Leu Glu Ser145
150 155 160Met Glu Glu Lys Thr Val Thr
Ile Gly Asp Lys Thr Tyr Lys Leu Asp 165
170 175Lys Pro Phe Leu Val Ile Ala Thr Gln Asn Pro Ile
Asp Gln Asp Gly 180 185 190Thr
Tyr Pro Leu Pro Glu Ala Gln Met Asp Arg Phe Leu Met Lys Ile 195
200 205Asn Val Asp Tyr Pro Thr Leu Glu Glu
Glu Val Ser Ile Leu Asp Gln 210 215
220His Gly Lys Ile Ser Ser Ala Asn Gly Lys Ile Lys Lys Thr Val Ser225
230 235 240Ser Ser Glu Ile
Leu Arg Leu Ser Ser Met Leu Asp Glu Val Phe Ile 245
250 255Glu Glu Lys Ile Lys Ser Tyr Ile Val Arg
Leu Val Arg Asn Thr Arg 260 265
270Pro Glu Glu Arg Thr Ile Pro Glu Leu Ile Pro Tyr Ile Arg His Gly
275 280 285Ala Ser Pro Arg Ala Ser Leu
Ser Ile Leu Lys Ser Ser Lys Ala Asn 290 295
300Ala Leu Leu Ser Gly Arg Thr Tyr Val Thr Pro Glu Asp Val Lys
Thr305 310 315 320Ser Leu
Val Glu Ile Leu Arg His Arg Ile Leu Leu Thr Phe Glu Ala
325 330 335Ile Ser Glu Glu Leu Asn Val
Glu Ser Leu Ile Arg Thr Val Val Glu 340 345
350Ala Thr Pro Val Pro 35545480DNALeptospira
interrogans serovar copenhageniCDS(1)...(477) 45atg aaa aaa cat tct atc
agt aaa atc att ata act gct tgt tgc att 48Met Lys Lys His Ser Ile
Ser Lys Ile Ile Ile Thr Ala Cys Cys Ile 1 5
10 15ttt ctt tta aca tac gga tgc aaa caa gat cca gta
gat tac aat aat 96Phe Leu Leu Thr Tyr Gly Cys Lys Gln Asp Pro Val
Asp Tyr Asn Asn 20 25 30aaa
atc atg gaa atc atg aac gct tct aca aac gat tta gat gcg tta 144Lys
Ile Met Glu Ile Met Asn Ala Ser Thr Asn Asp Leu Asp Ala Leu 35
40 45aac gca gcc atg gaa aag gaa gac ctt
aca aac gca gaa aat gtt aga 192Asn Ala Ala Met Glu Lys Glu Asp Leu
Thr Asn Ala Glu Asn Val Arg 50 55
60aaa gct tgg gaa aca aag cta gtt tct tca ctc gat aag ctt aaa gga
240Lys Ala Trp Glu Thr Lys Leu Val Ser Ser Leu Asp Lys Leu Lys Gly 65
70 75 80atc agt gat ttt
aaa gga gat tcc agt ttt aaa aat gca agc gtc caa 288Ile Ser Asp Phe
Lys Gly Asp Ser Ser Phe Lys Asn Ala Ser Val Gln 85
90 95gct ctc gaa act tat tta aac ata gta agt
aaa gac tac aaa cgt ttg 336Ala Leu Glu Thr Tyr Leu Asn Ile Val Ser
Lys Asp Tyr Lys Arg Leu 100 105
110atc gaa tta cga gga tta ggt gac aaa gca gac tca aat gaa atc aac
384Ile Glu Leu Arg Gly Leu Gly Asp Lys Ala Asp Ser Asn Glu Ile Asn
115 120 125caa gtt ctc aat cgt att aat
cag gat ttt gaa aaa gct gta aat act 432Gln Val Leu Asn Arg Ile Asn
Gln Asp Phe Glu Lys Ala Val Asn Thr 130 135
140ctc aat gct gct tct gat aaa ttt gcg aaa gaa tac gct tct caa taa
480Leu Asn Ala Ala Ser Asp Lys Phe Ala Lys Glu Tyr Ala Ser Gln145
150 15546159PRTLeptospira interrogans serovar
copenhageni 46Met Lys Lys His Ser Ile Ser Lys Ile Ile Ile Thr Ala Cys Cys
Ile 1 5 10 15Phe Leu Leu
Thr Tyr Gly Cys Lys Gln Asp Pro Val Asp Tyr Asn Asn 20
25 30Lys Ile Met Glu Ile Met Asn Ala Ser Thr
Asn Asp Leu Asp Ala Leu 35 40
45Asn Ala Ala Met Glu Lys Glu Asp Leu Thr Asn Ala Glu Asn Val Arg 50
55 60Lys Ala Trp Glu Thr Lys Leu Val Ser
Ser Leu Asp Lys Leu Lys Gly 65 70 75
80Ile Ser Asp Phe Lys Gly Asp Ser Ser Phe Lys Asn Ala Ser
Val Gln 85 90 95Ala Leu
Glu Thr Tyr Leu Asn Ile Val Ser Lys Asp Tyr Lys Arg Leu 100
105 110Ile Glu Leu Arg Gly Leu Gly Asp Lys
Ala Asp Ser Asn Glu Ile Asn 115 120
125Gln Val Leu Asn Arg Ile Asn Gln Asp Phe Glu Lys Ala Val Asn Thr
130 135 140Leu Asn Ala Ala Ser Asp Lys
Phe Ala Lys Glu Tyr Ala Ser Gln145 150
155
User Contributions:
comments("1"); ?> comment_form("1"); ?>Inventors list |
Agents list |
Assignees list |
List by place |
Classification tree browser |
Top 100 Inventors |
Top 100 Agents |
Top 100 Assignees |
Usenet FAQ Index |
Documents |
Other FAQs |
User Contributions:
Comment about this patent or add new information about this topic: