Patent application title: MODIFIED ANTI-CD52 ANTIBODY
Inventors:
Francis J. Carr (Balmedie, GB)
Anita A. Hamilton (Aberdeen, GB)
Anita A. Hamilton (Aberdeen, GB)
IPC8 Class: AC12P2100FI
USPC Class:
435 696
Class name: Micro-organism, tissue cell culture or enzyme using process to synthesize a desired chemical compound or composition recombinant dna technique included in method of making a protein or polypeptide blood proteins
Publication date: 2008-10-09
Patent application number: 20080248529
Inventors list |
Agents list |
Assignees list |
List by place |
Classification tree browser |
Top 100 Inventors |
Top 100 Agents |
Top 100 Assignees |
Usenet FAQ Index |
Documents |
Other FAQs |
Patent application title: MODIFIED ANTI-CD52 ANTIBODY
Inventors:
FRANCIS J. CARR
Anita A. Hamilton
Agents:
FULBRIGHT & JAWORSKI L.L.P.
Assignees:
Origin: AUSTIN, TX US
IPC8 Class: AC12P2100FI
USPC Class:
435 696
Abstract:
The present invention provides for modified forms of anti-CD52 antibodies
with reduced numbers of potential T-cell epitopes that are expected to
display decreased immunogenicity.Claims:
1-22. (canceled)
23. An expression vector comprising:a) a first nucleic acid sequence coding for a V-region heavy chain comprising a substituted variant of SEQ ID NO: 1 with one or more of the following substitutions wherein the numbering of amino acid residues relates to those of SEQ ID NO: 1:substitution of Lys at amino acid residue 3 with Gln;Leu at amino acid residue 5 with Ala, Cys, Asn, Asp, Gln, Glu, Gly, His, Lys, Pro, Arg, Ser, or Thr;Val at amino acid residue 12 with Asn, Asp, Glu, His, Lys, Pro, Gln, Arg, Ser, or Thr;Gln at amino acid residue 13 with Ala, Phe, His, Lys, Asn, Pro, Gln, Arg, Ser, Thr;Gly at amino acid residue 15 with Asp, His, Pro, Gln, Arg, Ser, Thr;Ser at amino acid residue 17 with Gly, Met, Pro or Trp;Met at amino acid residue 18 with Arg, Gly, Pro, Leu;Arg at amino acid residue 19 with Ala, Cys, Phe, Gly, Ile, Leu, Met, Pro, Val, Trp, or Tyr;Leu at amino acid residue 20 with Ala, Cys, Phe, Gly, His, Ile, Lys, Asn, Asp, Met, Gln, Glu, Pro, Arg, Ser, Thr, Val Trp, or Tyr;Ser at amino acid residue 21 with Pro;Ala at amino acid residue 23 with Asn, Asp, Glu, Gln, Gly, His, Lys, Pro, Arg, Ser, or Thr;Ser at amino acid residue 25 with Phe, Gly, Leu, Pro, Trp or Tyr;Gly at amino acid residue 26 with Asp, Asn, Glu, Gln, His, Lys, Pro, Arg, Ser, Thr, Trp or Tyr;Asp at amino acid residue 31 with Ala, Phe, Gly, Ile, Met, Pro, Val, Trp, or Tyr;Tyr at amino acid residue 33 with Ala, Gly, Met, or Pro;Asn at amino acid residue 35 with Pro;Trp at amino acid residue 36 with Ala, Asp, Glu, Gly, His, Lys, Asn, Pro, Gln, Arg, Ser, or The;Ile at amino acid residue 37 with Val;Arg at amino acid residue 38 with Phe, His, Pro, or Tyr;Pro at amino acid residue 40 with Ala;Ala at amino acid residue 41 with Asp, Asn, Glu, Gln, His, Lys, Pro, Arg, Ser, The or Trp;Gly at amino acid residue 42 with Ile, Pro, Thr, Tyr;Ala at amino acid residue 44 with Gly, His, Asn, Pro, Gln, Ser, Thr, Trp, Tyr,Pro at amino acid residue 45 with Leu;Leu at amino acid residue 48 with Val or Ile,Thr at amino acid residue 71 with Phe, Leu, Pro, Trp, or Tyr;Ile at amino acid residue 72 with Asp, Glu, His, Lys, Asn, Pro, Gln, Arg, Ser, or Thr;Ser at amino acid residue 73 with Ala, Gly, or Pro;Arg at amino acid residue 74 with Ala, Phe, Gly, Ile, Met, Pro, Trp, or Tyr;Thr at amino acid residue 77 with Ala, His, Ile, Pro or Ser;Gln at amino acid residue 78 with Lys;Asn at amino acid residue 79 with Ala, Phe, Gly, Ile, Met, Pro, Val, Trp or Tyr;Met at amino acid residue 80 with Ala, Asp, Glu, Gly, His, Lys, Asn, Pro, Gln, Arg, Thr, or Ser;Tyr at amino acid residue 82 with Ala, Asp, Glu, Gly, His, Lys, Asn, Pro, Gln, Arg, Ser or Thr;Gln at amino acid residue 84 with Ala, Phe, Gly, Ile, Leu, Met, Pro, Val, Trp or Tyr;Met at amino acid residue 85 with Ala, Asp, Glu, Gly, His, Lys, Asn, Pro, Gln, Arg, Ser or Thr;Thr at amino acid residue 87 with Ser;Leu at amino acid residue 88 with Asp, Glu, Gly, His, Lys, Asn, Pro, Gln, Arg, Ser, or Thr;Arg at amino acid residue 89 with Phe, Pro, Trp, Tyr;Ala at amino acid residue 90 with Asn, Asp, Glu, Gln, His, Lys, Pro, Arg, Ser, Thr, Trp or Tyr;Glu at amino acid residue 91 with Pro;Asp at amino acid residue 92 with Ala, Phe, Gly, Ile, Leu, Met, Pro, Val, Trp, Tyr;Thr at amino acid residue 95 with Val;Asp at amino acid residue 109 with Ala, Phe, Gly, Ile, Leu, Met, Pro, Val, Trp or Tyr;Trp at amino acid residue 111 with Ala, Asp, Glu, Gly, His, Lys, Asn, Pro, Gln, Arg, Ser, or Thr;Gly at amino acid residue 114 with His, Pro, Ser, or Thr;Val at amino acid residue 115 with Thr;Met at amino acid residue 116 with Thr, Phe, Ile, Leu, Pro, Val, Trp or Tyr;Val at amino acid residue 117 with Ala, Phe, Gly, Ile, Met, Pro, Trp or Tyr; andb) a second nucleic acid sequence coding for a V-region light chain comprising a substituted variant of SEQ ID NO:2 with one or more of the following substitutions wherein the numbering of amino acid residues relates to those of SEQ ID NO: 2:substitution of Lys at amino acid residue 3 with Gln;Phe at amino acid residue 10 with Ala, Asp, Asn, Glu, Gln, Gly, His, Lys, Pro, Arg, Ser or Thr;Val at amino acid residue 15 with Ala, Gly, His or Pro;Asp at amino acid residue 17 with Pro;Val at amino acid residue 19 with Pro or Trp;Leu at amino acid residue 21 with Pro or Ile;Asn at amino acid residue 22 with Thr;Lys at amino acid residue 24 with Arg;Leu at amino acid residue 33 with Ala, Asp, Asn, Gln, Glu, Gly, His, Lys, Pro, Arg, Ser or Thr;Leu at amino acid residue 40 with Asp, Asn, Gln, Glu, Gly, His, Lys, Pro, Arg, Ser or Thr;Glu at amino acid residue 42 with Lys;Ser at amino acid residue 43 with Ala;Leu at amino acid residue 46 with Ser;Thr at amino acid residue 56 with Ala, Phe, Gly, Ile, Met, Pro, Ser, Trp or Tyr;Ile at amino acid residue 58 with Ala; Gly, Met, Pro or Val;Ser at amino acid residue 60 with Ala, Phe; Gly, Ile, Met, Pro; Trp or Tyr;Arg at amino acid residue 61 with Pro;Ser at amino acid residue 63 with Phe, Leu, Pro, Trp or Tyr;Gly at amino acid residue 64 with Asp, Asn, Gln, Glu, His, Lys, Pro, Arg, Ser or Thr;Leu at amino acid residue 78 with Asp, Asn, Gln, Glu, Gly, His, Lys, Pro, Arg, Ser, Thr;Val at amino acid residue 83 with Ala, Asp, Asn, Glu, Gln, Gly, His, Ile, Lys, Pro, Arg, Ser, Thr;Phe at amino acid residue 87 with Tyr,wherein the first nucleic acid sequence and the second nucleic acid sequence are operably linked to one or more expression control sequences.
24. An expression vector comprising a nucleic acid sequence coding for SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 74 or SEQ ID NO: 75, or a degenerate variant thereof.
25. (canceled)
26. The expression vector of claim 23, further comprising a nucleic acid sequence coding for a human IgG1 constant region domain.
27. A cultured cell comprising the vector of claim 23.
28. (canceled)
29. An expression vector comprising a nucleic acid sequence coding for SEQ ID NO: 76, SEQ ID NO: 77, SEQ ID NO: 78, or SEQ ID NO: 79, or a degenerate variant thereof.
30. (canceled)
31. The expression vector of claim 23, further comprising a nucleic acid sequence coding for a human kappa constant region domain.
32-33. (canceled)
34. A method of preparing an immunoglobulin, comprising culturing the cell of claim 27 under conditions permitting expression under the control of the expression control sequences, and purifying the immunoglobulin from the medium of said cell, wherein the immunoglobulin has specificity for CD52 antigen.
Description:
[0001]This application claims priority to U.S. provisional application
60/516,210, filed Nov. 1, 2003, the entire contents of which are hereby
incorporated by reference.
FIELD OF THE INVENTION
[0002]The present invention relates to polypeptides to be administered, especially to humans and in particular for therapeutic use. The polypeptides are modified polypeptides, whereby the modification results in a reduced number of potential T-cell epitopes that provides a reduced propensity for the polypeptide to elicit an immune response upon administration to a human subject. The invention in particular relates to the modification of antibodies reactive to the CD52 human leukocyte antigen to provide anti-CD52 antibodies that have a reduced number of potential T-cell epitopes, but retain the ability to bind to CD52.
BACKGROUND OF THE INVENTION
[0003]There are many instances whereby the efficacy of a therapeutic protein is limited by an unwanted immune reaction to the therapeutic protein. Several mouse monoclonal antibodies have shown promise as therapies in a number of human disease settings but in certain cases have failed due to the induction of significant degrees of a human anti-murine antibody (HAMA) response [Schroff et al. (1985) Cancer Res. 45: 879-885; Shawler et al. (1985) J. Immunol. 135: 1530-1535]. For monoclonal antibodies, a number of techniques have been developed in attempt to reduce the HAMA response [WOA8909622; EPA0239400; EPA0438310; WOA9106667; EPA0699755]. These recombinant DNA approaches have generally reduced the mouse genetic information in the final antibody construct whilst increasing the human genetic information in the final construct. Notwithstanding, the resultant "humanised" antibodies have, in several cases, still elicited an immune response in patients [Issacs J. D. (1990) Sem. Immunol. 2: 449, 456; Rebello et al (1999) Transplantation 68: 1417-1420].
[0004]Antibodies are not the only class of polypeptide molecule administered as a therapeutic agent against which an immune response may be mounted. Even proteins of human origin and with the same amino acid sequences as occur within humans can still induce an immune response in humans. Notable examples include therapeutic use of granulocyte-macrophage colony stimulating factor [Wadhwa et al., (1999) Clin. Cancer Res. 5: 1353-1361] and interferon α2 [Russo et al. (1996) Bri. J. Haem. 94: 300-305; Stein et al. (1988) New Engl. J. Med. 318: 1409-1413] amongst others.
[0005]Key to the induction of an immune response is the presence within the protein of peptides that can stimulate the activity of T-cells via presentation on MHC class II molecules, so-called "T-cell epitopes." Such T-cell epitopes are commonly defined as any amino acid residue sequence with the ability to bind to MHC Class II molecules. Implicitly, a "T-cell epitope" means an epitope which when bound to MHC molecules can be recognized by a T-cell receptor (TCR), and which can, at least in principle, cause the activation of these T-cells by engaging a TCR to promote a T-cell response.
[0006]MHC Class II molecules are a group of highly polymorphic proteins which play a central role in helper T-cell selection and activation. The human leukocyte antigen group DR (HLA-DR) are the predominant isotype of this group of proteins however, isotypes HLA-DQ and HLA-DP perform similar functions. In the human population, individuals bear two to four DR alleles, two DQ and two DP alleles. The structure of a number of DR molecules has been solved and these appear as an open-ended peptide binding groove with a number of hydrophobic pockets which engage hydrophobic residues (pocket residues) of the peptide [Brown et al., Nature (1993) 364: 33; Stern et al. (1994) Nature 368: 215]. Polymorphism identifying the different allotypes of class II molecule contributes to a wide diversity of different binding surfaces for peptides within the peptide binding grove and at the population level ensures maximal flexibility with regard to the ability to recognise foreign proteins and mount an immune response to pathogenic organisms.
[0007]An immune response to a therapeutic protein proceeds via the MHC class II peptide presentation pathway. Here exogenous proteins are engulfed and processed for presentation in association with MHC class II molecules of the DR, DQ or DP type. MHC Class II molecules are expressed by professional antigen presenting cells (APCs), such as macrophages and dendritic cells amongst others. Engagement of a MHC class II peptide complex by a cognate T-cell receptor on the surface of the T-cell, together with the cross-binding of certain other co-receptors such as the CD4 molecule, can induce an activated state within the T-cell. Activation leads to the release of cytokines further activating other lymphocytes such as B cells to produce antibodies or activating T killer cells as a full cellular immune response.
[0008]T-cell epitope identification is the first step to epitope elimination as recognised in WO98/52976 and WO00/34317. In these teachings, predicted T-cell epitopes are removed by the use of judicious amino acid substitutions within the protein of interest. Besides computational techniques, there are in vitro methods for measuring the ability of synthetic peptides to bind MHC class II molecules. An exemplary method uses B-cell lines of defined MHC allotype as a source of MHC class II binding surface and may be applied to MHC class II ligand identification [Marshall et al. (1994) J. Immunol. 152:4946-4956; O'Sullivan et al. (1990) J. Immunol. 145: 1799-1808; Robadey et al. (1997) J. Immunol 159: 3238-3246]. However, such techniques are not adapted for the screening multiple potential epitopes to a wide diversity of MHC allotypes, nor can they confirm the ability of a binding peptide to function as a T-cell epitope.
[0009]Recently, techniques exploiting soluble complexes of recombinant MHC molecules in combination with synthetic peptides have come into use [Kern et al. (1998) Nature Medicine 4:975-978; Kwok et al (2001) TRENDS in Immunol. 22:583-588]. These reagents and procedures are used to identify the presence of T-cell clones from peripheral blood samples from human or experimental animal subjects that are able to bind particular MHC-peptide complexes and are not adapted for the screening multiple potential epitopes to a wide diversity of MHC allotypes.
[0010]As depicted above and as consequence thereof, it would be desirable to identify and to remove or at least to reduce potential T-cell epitopes from a given in principal therapeutically valuable but originally immunogenic peptide, polypeptide or protein. One of these therapeutically valuable molecules is a monoclonal antibody with binding specificity for the CD52 human leukocyte antigen. The preferred monoclonal antibody of the present invention is a modified form of the rat antibody termed "CAMPATH". It is an objective of the invention to provide for modified forms of the CAMPATH antibody with one or more potential T-cell epitopes removed.
[0011]The CD52 molecule has a molecule weight of 21-28 kDa, and the mature protein comprises a 12 amino acid peptide with a N-linked oligosaccharide being attached to the membrane by its glycophosphatidylinositol anchor. The antigen is present on at least 95% of human peripheral blood lymphocytes and also cells of the monocyte/macrophage series and in addition spermatozoa. It is not present on erythrocytes, platelets, tissue dendritic cells or bone marrow stem cells (Hale et al. (1990) Tissue Antigens 35:873; Buggins et al (2002) Blood, 100:1715).
[0012]The first CD52 antibodies were raised in a rat immunized with human lymphocytes in an attempt to obtain antibodies that activated complement for use to deplete donor marrow of T-cells prior to transplantation [Hale et al. (1983) Blood 62: 873-882]. The majority of lytic antibodies were anti-CD52 IgM antibodies. Although useful ex vivo, CD52 IgM (CAMPATH-1M) mediated complement activation was not effective in eliminating T-cells in vivo. CAMPATH-1G, a rat IgG2b monoclonal antibody, obtained by isotype switching from an IgG2a antibody clone, binds human Fc receptors, mediates cell death antibody-mediated cellular toxicity (ADCCD) and is effective in eliminating cells in vivo [Friend et al (1991) Transplant. Proc. 23: 2253-2254; Hale et al (1998) Blood 92: 4581-4590]. However, use of CAMPATH-1G is limited by the immune response elicited in patients [Cobbold, J. S. (1990) J. Immunol. Methods 127: 19-24; Dyer, M. J. S. (1989) Blood 73: 1431-1439]. To reduce immunogenicity, a humanized IgG1 antibody, CAMPATH-1H, was engineered by cloning the Kabat hypervariable regions into a framework provided from human NEW and Rei myeloma proteins [Riechmann et al., (1988) Nature 332: 323-327]. Although reducing the immunogenicity compared to CAMPTH-1G, the humanized antibody still elicits immune responses in some patients. In an early report of treatment for rheumatoid arthritis, no antiglobulin response was reported in the 8 patients treated by a first course of i.v. administration, but 3 of 4 patients who received a second course of CAMPATH-1H developed antiglobulin antibodies (Issacs et al. (1992) Lancet, 21:1103-06). In a subsequent single-dose escalation i.v. study in rheumatoid arthritis patients, 63% of subjects developed antiglobulin responses, which were primarily anti-idiotypic responses [Weinblatt et al. (1995) Arthritis. Rheum. 38: 1589-1594]. Antiglobulin responses were also reported for all 10 rheumatoid arthritis patients who received escalating doses of CAMPATH-1H by subcutaneous administration (Schnitzer et al., J. Rheumatol. (1997) 24:1031-36).
[0013]Thus, it is desirable to provide anti-CD52 antibodies with a reduced number of potential T-cell epitopes which may result in a reduced or absent potential to induce an immune response in the human subject. Such proteins may be expected to display an increased circulation time within a human subject capable of mounting an immune response to the non-modified antibody and may be of particular benefit in chronic or recurring disease settings such as is the case for a number of indications for CAMPATH. The present invention accordingly provides for modified forms of an anti-CD52 antibody with reduced numbers of potential T-cell epitopes that are expected to display decreased immunogenicity while however, substantially retaining the beneficial therapeutic features associated with the efficacy of the parental non-modified antibody.
[0014]The invention discloses sequences identified within the variable region sequences of the heavy and light chains of an anti-CD52 antibody that are potential T cell epitopes by virtue of MHC class II binding potential.
[0015]While others have provided anti-CD52 antibody molecules including "humanised" forms [U.S. Pat. Nos. 5,846,543; 6,120,766; 6,569,430; WO0230460] none of these teachings recognise the importance of T cell epitopes to the immunogenic properties of the protein nor have been conceived to directly influence said properties in a specific and controlled way according to the scheme of the present invention.
BRIEF DESCRIPTION OF FIGURES
[0016]FIG. 1 depicts an exemplified vector for a modified heavy chain, "camp VH." dhfr is dihydrofolate reductase selection; CMV pro is the CMV IE promoter; pA is Poly A; and Amp R is ampicillin resistance.
[0017]FIG. 2 depicts an exemplified vector for a modified light chain, "camp VL". Neo is neomycin (G148) selection; CMV pro is the CMV IE promoter; pA is Poly A; and Amp R is ampicillin resistance
[0018]FIG. 3 depicts the DNA and amino acid sequences of modified heavy chain variable region DIVHv1.
[0019]FIG. 4 depicts the DNA and amino acid sequences of modified heavy chain variable region DIVHv2.
[0020]FIG. 5 depicts the DNA and amino acid sequences of modified heavy chain variable region DIVHv3.
[0021]FIG. 6 depicts the DNA and amino acid sequences of modified heavy chain variable region DIVHv4.
[0022]FIG. 7 depicts the DNA and amino acid sequences of modified heavy chain variable region DIVHv5.
[0023]FIG. 8 depicts the DNA and amino acid sequences of modified light chain variable region DIVKv1.
[0024]FIG. 9 depicts the DNA and amino acid sequences of modified light chain variable region DIVKv2.
[0025]FIG. 10 depicts the DNA and amino acid sequences of modified light chain variable region DIVKv3.
[0026]FIG. 11 depicts the DNA and amino acid sequences of modified light chain variable region DIVKv4.
[0027]FIG. 12 depicts the DNA and amino acid sequences of modified light chain variable region DIVKv5.
[0028]FIG. 13 depicts the DNA and amino acid sequence of human IgG1 constant region.
[0029]FIG. 14 depicts the DNA and amino acid sequence of human kappa constant region.
[0030]FIG. 15 summarizes the results of the preliminary studies using the alternative dendritic cell:T cell protocol with the modified DIVHv5/DIVKv2 antibody.
[0031]FIG. 16 summarizes the comparison of T cell immunogenicity (dendritic cell:T cell assay) of humanised CAMPATH 1H and the modified DIVHv5/DIVKv2 antibody. Cpm values were compared (*) against untreated controls using Students T-Test (p<0.05)
SUMMARY AND DESCRIPTION OF THE INVENTION
[0032]The present invention provides for a modified antibody in which the immune characteristic is modified by means of reduced numbers of potential T-cell epitopes. Disclosed are sequences identified within the CAMPATH-1G variable region sequences of both the heavy chain and light chain that are potential T-cell epitopes by virtue of MHC class II binding potential. The invention discloses the major regions of the antibody V-region sequence that may be immunogenic in man and modified sequences to eliminate or reduce the potential immunogenic effectiveness of these sites.
[0033]In one aspect, the invention provides a modified antibody molecule having specificity for the CD52 antigen recognised by the rat antibody CAMPATH-1G wherein one or more amino acids in the variable region of the CAMPATH-1G antibody is substituted to reduce MHC class II recognition of peptides derived from this region. Implicit in the terms "anti-CD52 antibody" and "CAMPATH antibody," when applied to modified antibodies of the present invention, is an ability for such modified antibodies to retain an ability to bind to CD52. Embodiments of the invention encompass an anti-CD52 antibody comprising a heavy chain V-region comprising a substituted variant of SEQ ID NO: 1 with one or more of the substitutions listed in Table 1, wherein the numbering of amino acid residues relates to those of SEQ ID NO: 1, and comprising a light chain V-region comprising a substituted variant of SEQ ID NO: 2 with one or more of the substitutions listed in Table 2, wherein the numbering of amino acid residues relates to those of SEQ ID NO: 1. In some embodiments the anti-CD52 antibody heavy chain further comprise a human IgG1 constant region domain and the light chain further comprises a human kappa constant region domain.
TABLE-US-00001 TABLE 1 Substitutions within potential T-cell epitopes in the CAMPATH-1G variable heavy chain (SEQ ID NO: 1) VH WT Residue # residue Substitution 3 K Q 5 L A C B Z G H K P R S T 12 V B E H K P Q R S T 13 Q A F H K N P Q R S T 15 G D H P Q R S T 17 S G M P W 18 M A G P L 19 R A C F G I L M P V W Y 20 L A C F G H I K B M Z P R S T V W Y 21 S P 23 A B Z G H K P R S T 25 S F G L P W Y 26 G B Z H K P R S T W Y 31 D A F G I M P V W Y 33 Y A G M P 35 N P 36 W A D E G H K N P Q R S T 37 I V 38 R F H P Y 40 P A 41 A B Z H K P R S T W 42 G I P T Y 44 A G H N P Q S T W Y 45 P L 48 L V I 71 T F L P W Y 72 I D E H K N P Q R S T 73 S A G P 74 R A F G I M P W Y 76 N A G M P W Y 77 T A H I P S 78 Q K 79 N A F G I M P V W Y 80 M A D E G H K N P Q R T S 82 Y A D E G H K N P Q R S T 84 Q A F G I L M P V W Y 85 M A D E G H K N P Q R S T 87 T S 88 L D E G H K N P Q R S T 89 R F P W Y 90 A B Z H K P R S T W Y 91 E P 92 D A F G I L M P V W Y 95 T V 109 D A F G I L M P V W Y 111 W A D E G H K N P Q R S T 114 G H P S T 115 V T 116 M L F I P T V W Y 117 V A F G I M P W Y
TABLE-US-00002 TABLE 2 Substitutions within potential T-cell epitopes in the CAMPATH-1G light chain (SEQ ID NO: 2) VK WT Residue # residue Substitution 3 K Q 10 F A B Z G H K P R S T 15 V A G H P 17 D P 19 V P W 21 L P I 22 N T 24 K R 33 L A B Z G H K P R S T 40 L B Z G H K P R S T 42 E K 43 S A 46 L S 56 T A F G I M P S W Y 58 I A G M P V 60 S A F G I M P W Y 61 R P 63 S F L P W Y 64 G B Z H K P R S T 78 L B Z G H K P R S T 83 V A B Z G H I K P R S T 87 F Y
[0034]In various embodiments, more than 2 amino acid substitutions, or more than 3 amino acid substitutions, or more than 4 amino acid substitutions, or more than 5 amino acid substitutions, or more than 6 amino acid substitutions, or more than 7 amino acid, or more than 8, or more than 9, or more than 10, or more than 11 or more than 12 substitutions are made in the heavy chain and/or the light chain. In some embodiments, between 5 and 20, or between 7 and 14, amino acid substitutions are made in the heavy and/or light chain.
[0035]In some embodiments, the anti-CD52 antibody comprises a V-region heavy chain comprising a substituted variant of SEQ ID NO: 1 with one or more of the following substitutions, wherein the numbering of amino acid residues relates to those of SEQ ID NO: 1: [0036]substitution of Lys at amino acid residue 3 with Gln; [0037]Leu at amino acid residue 5 with Ala, Cys, Asn, Asp, Gln, Glu, Gly, His, Lys, Pro, Arg, Ser, or Thr; [0038]Met at amino acid residue 18 with Arg, Gly, Pro, Leu; [0039]Leu at amino acid residue 20 with Ala, Cys, Phe, Gly, His, Ile, Lys, Asn, Asp, Met, Gln, Glu, Pro, Arg, Ser, Thr, Val Trp, or Tyr; [0040]Ala at amino acid residue 23 with Asp, Asn, Glu, Gln, Gly, His, Lys, Pro, Arg, Ser, Thr; [0041]Ile at amino acid residue 37 with Val; [0042]Pro at amino acid residue 40 with Ala; [0043]Ala at amino acid residue 41 with Pro; [0044]Ala at amino acid residue 44 with Gly, His, Asn, Pro, Gln, Ser, Thr, Trp, Tyr; [0045]Pro at amino acid residue 45 with Leu; [0046]Leu at amino acid residue 48 with Ile or Val; [0047]Thr at amino acid residue 77 with Ala, His, Ile, Pro or Ser; [0048]Gln at amino acid residue 78 with Lys; [0049]Met at amino acid residue 80 with Ala, Asp, Glu, Gly, His, Lys, Asn, Pro, Gln, Arg, Thr, or Ser; [0050]Tyr at amino acid residue 82 with Ala, Asp, Glu, Gly, His, Lys, Asn, Pro, Gln, Arg, Ser or Thr; [0051]Met at amino acid residue 85 with Ala, Asp, Glu, Gly, His, Lys, Asn, Pro, Gln, Arg, Ser or Thr; [0052]Thr at amino acid residue 87 with Ser; [0053]Thr at amino acid residue 95 with Val; [0054]Val at amino acid residue 115 with Thr; [0055]Met at amino acid residue 116 with Thr, Phe, Ile, Leu, Pro, Val, Trp or Tyr; [0056]and comprising a V-region light chain comprising a substituted variant of SEQ ID NO: 2 with one or more of the following substitutions, wherein the numbering of amino acid residues relates to those of SEQ ID NO: 2: [0057]substitution of Lys at amino acid residue 3 with Gln Phe at amino acid residue 10 with Ala, Asp, Asn, Glu, Gln, Gly, His, Lys, Pro, Arg, Ser or Thr; [0058]Leu at amino acid residue 21 with Pro or Ile; [0059]Asn at amino acid residue 22 with Thr; [0060]Lys at amino acid residue 24 with Arg; [0061]Leu at amino acid residue 40 with Asp, Asn, Gln, Glu, Gly, His, Lys, Pro, Arg, Ser or Thr; [0062]Glu at amino acid residue 42 with Lys; [0063]Ser at amino acid residue 43 with Ala; [0064]Leu at amino acid residue 46 with Ser; [0065]Thr at amino acid residue 56 with Ala, Phe, Gly, Ile, Met, Pro, Ser, Trp or Tyr; [0066]Ile at amino acid residue 58 with Ala; Gly, Met, Pro or Val; [0067]Val at amino acid residue 83 with Ala, Asp, Asn, Glu, Gln, Gly, His, Ile, Lys, Pro, Arg, Ser, Thr; and [0068]Phe at amino acid residue 87 with Tyr.
[0069]In some embodiments of the present invention, the anti-CD52 antibody comprises a V-region heavy chain comprising a substituted variant of SEQ ID NO: 1 with one or more of the following substitutions, wherein the numbering of amino acid residues relates to those of SEQ ID NO: 1: [0070]substitution of Lys at amino acid residue 3 with Gln; [0071]Leu at amino acid residue 5 with Gln; [0072]Met at amino acid residue 18 with Leu; [0073]Leu at amino acid residue 20 with Ile; [0074]Ala at amino acid residue 23 with Ser; [0075]Ile at amino acid residue 37 with Val; [0076]Pro at amino acid residue 40 with Ala; [0077]Ala at amino acid residue 41 with Pro; [0078]Ala at amino acid residue 44 with Gly; [0079]Pro at amino acid residue 45 with Leu; [0080]Leu at amino acid residue 48 with Ile or Val; [0081]Thr at position 77 with Ala or Ser; [0082]Gln at amino acid residue 78 with Lys; [0083]Met at amino acid position 80 with Thr, or Ser; [0084]Tyr at amino acid residue 82 with His; [0085]Met at amino acid residue 85 with Ala; [0086]Thr at amino acid residue 87 with Ser; [0087]Thr at amino acid residue 95 with Val; [0088]Val at amino acid residue 115 with Thr; [0089]Met at amino acid residue 116 with Leu; [0090]and comprising a V-region light chain comprising a substituted variant of SEQ ID NO: 2 with one or more of the following substitutions, wherein the numbering of amino acid residues relates to those of SEQ ID NO: 2: [0091]substitution of Lys at amino acid residue 3 with Gin; [0092]Phe at amino acid residue 10 with Ser; [0093]Leu at amino acid residue 21 with Ile; [0094]Asn at amino acid residue 22 with Thr; [0095]Lys at amino acid residue 24 with Arg; [0096]Leu at amino acid residue 40 with Pro; [0097]Glu at amino acid residue 42 with Lys; [0098]Ser at amino acid residue 43 with Ala; [0099]Leu at amino acid residue 46 with Ser; [0100]Thr at amino acid residue 56 with Ser; [0101]Ile at amino acid residue 58 with Val; [0102]Val at amino acid residue 83 with Ile; [0103]Phe at amino acid residue 87 with Tyr.
[0104]In a further aspect of the invention, there are provided variant monoclonal antibodies with a reduced number of potential T-cell epitopes, said variants comprising a combination of heavy chain V-region comprising a sequence selected from SEQ ID NO: 3 through SEQ ID NO: 7 or SEQ ID NO: 13 through SEQ ID NO: 40 and light chain V-regions comprising a sequence selected from SEQ ID NO: 8 through SEQ ID NO: 12 or SEQ ID NO: 41 through SEQ ID NO: 70. In some preferred embodiments, the invention provides for variant monoclonal antibodies with a reduced number of potential T-cell epitopes, said variants comprising a combination of heavy chain V-region comprising a sequence selected from SEQ ID NO: 3 through SEQ ID NO:7 and light chain V-region comprising a sequence selected from SEQ ID NO: 8 through SEQ ID NO: 12. In some embodiments the anti-CD52 antibody further comprises a human IgG1 constant region domain and a human kappa constant region domain. In further embodiments, the anti-CD52 antibody comprising a human IgG1 constant region and a human kappa constant region comprises a heavy chain V-region comprising SEQ ID NO: 4 and a light chain V-region comprising SEQ ID NO: 12, or a heavy chain V-region comprising SEQ ID NO: 7 and a light chain V-region comprising SEQ ID NO: 12, or a heavy chain V-region comprising SEQ ID NO: 7 and a light chain V-region comprising SEQ ID NO: 10, or a heavy chain V-region comprising SEQ ID NO: 3 and a light chain V-region comprising SEQ ID NO: 10, or a heavy chain V-region comprising SEQ ID NO: 6 and a light chain V-region comprising SEQ ID NO: 10.
[0105]The present invention also encompasses an accordingly specified molecule, wherein the alteration of the amino acid residues is substitution, addition or deletion of originally present amino acid(s) residue(s) by other amino acid residue(s) at specific position(s); an accordingly specified molecule, wherein, if necessary, additionally further alteration usually by substitution, addition or deletion of specific amino acid(s) is conducted to restore a biological activity of said molecule; an accordingly specified molecule wherein alteration is conducted at one or more residues from any or all of the string of contiguous residues of sequences (A)-(S) as below wherein said sequences are derived from the CAMPATH-1G antibody V-region sequence domains of the molecule and where using single letter code;
TABLE-US-00003 A. = KLLESGGGLVQPG; B. = GLVQPGGSMRLSC; C. = GSMRLSCAGSGFT; D. = DFYMNWIRQPAGK; F. = MNWIRQPAGKAPE; F. = FTISRDNTQNMLY; G. = QNMLYLQMNTLRA; H. = MLYLQMNTLRAED; I. = LQMNTLRAEDTAT; J. = NTLRAEDTATYYC; K. = DYWGQGVMVTVSS; L. = PSFLSASVGDRVT; M. = ASVGDRVTLNCKA; N. = DRVTLNCKASQNI; O. = KYLNWYQQKLGES; P. = QKLGESPKLLIYN; Q. = TGIPSRFSGSGSG; R. = SSLQPEDVATYFC; S. = EDVATYFCLQHIS.
[0106]One aspect of the present invention is a pharmaceutical composition comprising a modified CAMPATH-1G molecule modified so as to reduce the number of potential T-cell epitopes and having the ability to bind to CD52, wherein said composition comprises a pharmaceutically acceptable carrier.
[0107]Another aspect of the present invention is an expression vector comprising a nucleic acid sequence coding a modified heavy or light chain of the present invention. In some embodiments, the expression vector comprises a nucleic acid sequence encoding a V-region heavy chain comprising a modified substituted variant of SEQ ID NO: 1 with a reduced number of potential T-cell epitopes, operably linked to an expression control sequence. In various embodiments, the expression vector comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO: 71 through SEQ ID NO: 75 and SEQ ID NO: 81 through SEQ ID NO: 108, or a degenerate variant thereof. Degeneracy in relation to polynucleotides refers to the fact well recognized in the art that in the genetic code many amino acids are specified by more than one codon. The degeneracy of the code accounts for 20 different amino acids encoded by 64 possible triplet sequences of the four different bases. In some embodiments, the expression vector comprises a nucleic acid sequence encoding a V-region light chain comprising a modified substituted variant of SEQ ID NO: 2 with a reduced number of potential T-cell epitopes, operably linked to an expression control sequence. In various embodiments, the expression vector comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO: 76 through SEQ ID NO: 80 and SEQ ID NO: 109 through SEQ ID NO: 138, or degenerate variant thereof. An example of a suitable expression vector for a heavy chain of the present invention is shown in FIG. 1 and an example of a suitable expression vector for a light chain of the present invention is shown FIG. 2. Another aspect of the present invention is a cultured cell comprising one or more of the aforementioned vectors. A further aspect of the present invention is a method of preparing an immunoglobulin, comprising culturing the aforementioned cell under conditions permitting expression under the control of suitable expression control sequence(s), and purifying the immunoglobulin from the medium of the cell.
[0108]Other aspects of the present invention are methods of therapeutic treatment. Embodiments encompass a method of treating lymphoid malignancies comprising administering to a patient an effective amount of a modified antibody according to the present invention. In some embodiments, the lymphoid malignancy is leukemia or lymphoma. Other embodiments include a method of treating autoimmune conditions in a patient comprising administering an effective amount of a modified antibody according to the present invention. In various embodiments the autoimmune condition is multiple sclerosis, rheumatoid arthritis, systemic vasiculitis, uveitis, inflammatory bowel disease or scleroderma.
[0109]Embodiments also include a method of immunosuppressing a patient prior to or subsequent to transplantation of an organ comprising administering to said patient an effective amount of an antibody according to the present invention. In some embodiments, the transplantation of on organ is a renal transplant.
[0110]Reference to "substantially non-immunogenic" or "reduced immunogenic potential" includes reduced immunogenicity compared to a parent antibody, i.e., a non-modified rodent or chimeric (rodent V-regions; human constant regions) monoclonal antibody or the humanized monoclonal antibody CAMPATH-1H. The term "immunogenicity" includes an ability to provoke, induce or otherwise facilitate a humoral and or T-cell mediated response in a host animal and in particular where the "host animal" is a human or the ability to elicit a response in a suitable in vitro assay, e.g., the dendritic cell/T-cell assay described herein.
[0111]A preferred feature of the modified antibodies of the present is that they substantially retain the functional activities of the non-modified or "parental" antibody CAMPATH-1G or the humanized antibody CAMAPATH-1H. Embodiments of the invention therefore encompass modified antibodies in which one or more of the beneficial technical features associated with the therapeutic efficacy of CAMPATH-1H or the parental non-modified antibody are exhibited. Such modified antibodies are useful in a number of important diseases in man including especially lymphoid malignancies such as leukemia and lymphoma, autoimmune conditions including, but not limited to, multiple sclerosis, rheumatoid arthritis, systemic vasiculitis, uveitis, inflammatory bowel disease and scleroderma and also for use in transplantations.
[0112]Accordingly, the modified antibody of the present exhibits an ability to bind to CD52 and in preferred embodiments the affinity for its target antigen CD52 is within an order of magnitude higher or lower than the affinity exhibited by the monoclonal antibody CAMPATH-1H.
[0113]The therapeutic efficacy of the parental molecule is believed also to be mediated by the ability of the antibody to induce antibody-dependent cell mediated cytotoxicity (ADCC) and complement dependent cytotoxicity (CDC). The phenomena of ADCC and CDC are mediated by the heavy chain constant region domain of whole antibody molecules, and the present invention contemplates production of a whole antibody molecules comprising a constant region domain compatible with ADCC and CDC induction. In preferred embodiments, the modified antibody comprises a human IgG1 constant region and a human kappa constant region domain.
[0114]By "antibody" is meant a protein of the immunoglobulin family that is capable of combining, interacting or otherwise associating with an antigen. The term "antigen" is used herein to refer to a substance that is capable of interacting with the antibody and in the context of the present invention is meant to be CD52.
[0115]The term "immunoglobulin" is used herein to refer to a protein consisting of one or more polypeptides substantially encoded by immunoglobulin genes. The recognised immunoglobulin genes include the κ, λ, α, γ (IgG1, IgG2, IgG3, IgG4), σ, ε and μ constant region genes and in nature multiple immunoglobulin variable region genes. One natural form of immunoglobulin is a tetramer comprising two identical pairs in which each pair has one light chain and one heavy chain. In each pair the heavy and light chain variable regions together provide the binding surface capable of interacting with the antigen. The term Vh is used herein to refer to the heavy chain variable region, and the term Vk is used herein to refer to the light chain variable region and in this instance in common with numerous monoclonal antibodies the light chain is a "kappa" (k) type chain.
[0116]As used herein, Vh means a polypeptide that is about 110 to 125 amino acid residues in length, the sequence of which corresponds to any of the specified Vh chains herein which in combination with a Vk are capable of binding CD52 antigen. Similarly, Vk means a polypeptide that is about 95-130 amino acid residues in length the sequence of which corresponds to any of the specified Vk chains herein which in combination with a Vh are capable of binding the CD52 antigen. Full-length immunoglobulin heavy chains are about 50 kDa molecular weight and are encoded by a Vh gene at the N-terminus and one of the constant region genes (e.g., γ) at the C-terminus. Similarly, full-length light chains are about 25 kDa molecular weight and are encoded by a V-region gene at the N-terminus and a κ or λ constant region gene at the C-terminus.
[0117]In addition to whole antibody (tetramers), immunoglobulins may exist in a number of other forms derived by application of recombinant DNA techniques or protein biochemistry. These forms include for example Fv, Fab, Fab' and (Fab)2 molecules and could all contain any of the Vh or Vk sequences of the present invention. A further example may include a "bi-specific" antibody comprising a Vh/Vk combination of the present invention in combination with a second Vh/Vk combination with a different antigen specificity.
[0118]The term "potential T-cell epitope" means according to the understanding of this invention an amino acid sequence which has potential to bind MHC class II. Such sequences may stimulate T-cells and/or bind (without necessarily measurably activating) T-cells in complex with MHC class II.
[0119]The term "peptide" as used herein and in the appended claims, is a compound that includes two or more amino acids. The amino acids are linked together by a peptide bond (defined herein below). There are 20 different naturally occurring amino acids involved in the biological production of peptides, and any number of them may be linked in any order to form a peptide chain or ring. The naturally occurring amino acids employed in the biological production of peptides all have the L-configuration. Synthetic peptides can be prepared employing conventional synthetic methods, utilizing L-amino acids, D-amino acids, or various combinations of amino acids of the two different configurations. Some peptides contain only a few amino acid units. Short peptides, e.g., having less than ten amino acid units, are sometimes referred to as "oligopeptides". Other peptides contain a large number of amino acid residues, e.g., up to 100 or more, and are referred to as "polypeptides". By convention, a "polypeptide" may be considered as any peptide chain containing three or more amino acids, whereas a "oligopeptide" is usually considered as a particular type of "short" polypeptide. Thus, as used herein, it is understood that any reference to a "polypeptide" also includes an oligopeptide. Further, any reference to a "peptide" includes polypeptides, oligopeptides, and proteins. Each different arrangement of amino acids forms different polypeptides or proteins. The number of polypeptides--and hence the number of different proteins-that can be formed is practically unlimited.
[0120]The general method of the present invention leading to the modified anti-CD52 antibody comprises the following steps: [0121](a) Determining the amino acid sequence of the polypeptide or part thereof. [0122](b) Identifying one or more potential T cell epitopes within the amino acid sequence of the protein by any method including determination of the binding of the peptides to MHC molecules using in vitro or in silico techniques or biological assays. [0123](c) Designing new sequence variants with one or more amino acids within the identified potential T cell epitopes modified in such a way to substantially reduce or eliminate binding of the peptides to MHC molecules measured by in vitro or in silico techniques or biological assays. Such sequence variants are created in such a way to avoid creation of new potential T cell epitopes by the sequence variations unless such new potential T cell epitopes are, in turn, modified in such a way to substantially reduce or eliminate binding of peptides to MHC class II molecules. [0124](d) Constructing such sequence variants by recombinant DNA techniques and testing said variants in order to identify one or more variants with desirable properties.
[0125]The identification of potential T-cell epitopes according to step (b) can be carried out according to methods described previously in the art. Suitable methods are disclosed in WO 98/59244; WO 00/34317; U.S. Application 20030153043, all incorporated herein by reference.
[0126]In practice a number of variant anti-CD52 antibodies may be produced and tested for the desired immune and functional characteristic. It is particularly important when conducting alterations to the protein sequence that the contemplated changes do not introduce new immunogenic epitopes. This event is avoided in practice by re-testing the contemplated sequence for the presence of epitopes and or of MHC class II ligands by any suitable means.
[0127]In various embodiments, the modified antibodies of the present invention are generated by expression of different combinations of the Vh and Vk genes specified herein. All such combinations of heavy and light chain are encompassed by the present invention.
[0128]The invention relates to an anti-CD52 antibody in which substitutions of at least one amino acid residue have been made at positions within the V-regions of the molecule to result in the elimination of one or more potential T-cell epitopes from the protein. It is most preferred to provide modified antibody molecules in which amino acid modification (e.g., a substitution) is conducted within the most immunogenic regions of the parent molecule. The various embodiments of the present invention comprise modified antibody molecules for which any of the MHC class II ligands are altered such as to eliminate binding or otherwise reduce the numbers of MHC allotypes to which the peptide can bind. The inventors have discovered and herein disclose, the immunogenic regions of the CAMPATH antibody molecule in man. It is understood that under certain circumstances additional regions of sequence to those disclosed herein can become immunogenic epitopes, for example in the event of infection with a pathogen expressing a protein or peptide with a similar sequence to that of the present case.
[0129]MHC class II epitope removal has involved amino acid substitution to create modified variants depleted of potential T-cell epitopes. The amino acid substitutions have been made at appropriate points within the peptide sequence predicted to achieve substantial reduction or elimination of the activity of the undesired potential T cell epitope. Examples of particularly useful substitutions in this respect are provided in Tables 1 and 2, wherein Table 1 relates to Vh region substitutions and Table 2 relates to Vk region substitutions.
[0130]As will be clear to the person skilled in art, multiple alternative sets of substitutions could be arrived at which achieve the objective of removing un-desired epitopes. The resulting sequences would however remain broadly homologous with the specific compositions disclosed herein and therefore fall under the scope of the present invention. It would be typical to arrive at sequences that were around 70%, or around 90%, or around 95%, or around 99% or more homologous with the present specified sequences over their least homologous region and yet remain operationally equivalent. Such sequences would equally fall under the scope of the present.
[0131]It is understood that single amino acid substitutions within a given potential T cell epitope are the most preferred route by which the epitope may be eliminated. Combinations of substitution within a single epitope may be contemplated and for example can be particularly appropriate where individually defined epitopes are in overlap with each other. Moreover, amino acid substitutions either singly within a given epitope or in combination within a single epitope may be made at positions not equating to the "pocket residues" with respect to the MHC class II binding groove, but at any point within the peptide sequence. All such substitutions fall within the scope of the present.
[0132]In as far as this invention relates to modified anti-CD52 antibodies, compositions containing such modified antibodies or fragments of modified antibodies and related compositions should be considered within the scope of the invention. The invention therefore contemplates the use and generation of antibody fragments including for example Fv, Fab, Fab' and F(ab')2 fragments. Such fragments may be prepared by standard methods [for example; Coligan et al., Current Protocols in Immunology, John Wiley & Sons 1991-1997, incorporated herein by reference]. The present invention also contemplates the various recombinant forms of antibody derived molecular species well known in the art. Such species include stabilised Fv fragments including single chain Fv forms (e.g., scFv) comprising a peptide linker joining the Vh and Vk domains, or an Fv stabilised by interchain di-sulphide linkage (dsFv) and which contain additional cysteine residues engineered to facilitate the conjoining of the Vh and Vk domains. Equally, other compositions are familiar in the art and could include species referred to as "minibodies"; and single variable domain "dAbs." Other species still may incorporate means for increasing the valency of the modified antibody V-region domain, i.e. species having multiple antigen binding sites for example by the engineering of dimerisation domains (e.g., "leucine zippers") or also chemical modification strategies.
[0133]Under the scheme of the present there are provided a number of different H-chain V-region and L-chain V-region sequences. The present disclosure provides no limit to the possible combinations of H-chain and L-chain that may be provided to constitute a complete antibody molecule. Constitution of the complete antibody molecule may be achieved by recombinant DNA techniques and methods for purifying and manipulating antibody molecules well known in the art. Necessary techniques are explained fully in the literature, such as, "Molecular Cloning: A Laboratory Manual," second edition (Sambrook et al., 1989); "Oligonucleotide Synthesis" (M. J. Gait, ed., 1984); "Animal Cell Culture" (R. I. Freshney, ed., 1987); "Methods in Enzymology" (Academic Press, Inc.); "Handbook of Experimental Immunology" (D. M. Weir & C. C. Blackwell, eds.); "Gene Transfer Vectors for Mammalian Cells" (J. M. Miller & M. P. Calos, eds., 1987); "Current Protocols in Molecular Biology" (Ausubel et al., eds., 1987); "PCR: The Polymerase Chain Reaction," (Mullis et al., eds., 1994); "Current Protocols in Immunology" (Coligan et al., eds., 1991).
[0134]The preferred molecules of this invention can be prepared in any of several ways but is most preferably conducted exploiting routine recombinant methods. It is a relatively facile procedure to use the protein sequences and information provided herein to deduce a polynucleotide (DNA) encoding any of the preferred antibody V-regions. This can be achieved for example using computer software tools such as the DNAstar software suite [DNAstar Inc, Madison, Wis., USA] or similar. Any such DNA sequence with the capability of encoding the preferred polypeptides of the present or significant homologues thereof, should be considered as embodiments of this invention.
[0135]As a general scheme any of the Vh or Vk chain genes can be made using gene synthesis and cloned into a suitable expression vector. In turn the expression vector is introduced into a host cell and cells selected and cultured. The antibody molecules are readily purified from the culture medium and formulated into a preparation suitable for therapeutic administration.
[0136]By way of a non-limiting example, one such scheme involves a gene synthesis process using panels of synthetic oligonucleotides. The genes are assembled using a ligase chain reaction (LCR) wherein the oligonucleotides featuring complementary ends are allowed to anneal followed by amplification and fill-in using a polymerase chain reaction (PCR). The PCR is driven by addition of an increased concentration of the flanking oligonucleotides to act as primers. The PCR products are assembled into full-length antibody genes by further PCR from vectors containing 5' and 3' immunoglobulin gene flanking regions and sub-cloning into expression vectors for expression of whole antibody. The assembled Vh and Vk genes can serve as templates for mutagenesis and construction of multiple variant antibody sequences such as any of those disclosed herein. It is particularly convenient to use the strategy of "overlap extension PCR" as described by Higuchi et al. [1988, Nucleic Acids Res. 16: 7351], although other methodologies and systems could be readily applied.
[0137]Full-length immunoglobulin genes containing the variable region cassettes are most conveniently assembled using overlapping PCR and sub-cloned into expression vectors containing the desired immunoglobulin constant region domains. The expression vectors may be introduced into a mammalian or other host cell for example using electroporation techniques. The NSO cell line is a non-immunoglobulin producing mouse myeloma, obtained from the European Collection of Animal Cell Cultures (ECACC) and is particularly suitable example host cell line for this procedure. Cell lines secreting antibody are expanded and antibody can be readily purified for example by use of protein A affinity chromatography [Harlow & Lane, ibid]. The concentration of the purified antibody can be determined using an enzyme linked immunosorbent assay (ELISA) detecting the human kappa constant region of the antibodies of interest.
[0138]In a further aspect the present invention relates to methods for therapeutic treatment of humans using the modified antibody compositions. For administration to an individual, any of the modified antibody compositions would be produced to be preferably at least 80% pure and free of pyrogens and other contaminants. It is further understood that the therapeutic compositions of the modified antibody proteins may be used in conjunction with a pharmaceutically acceptable excipient. The pharmaceutical compositions according to the present invention are prepared conventionally, comprising substances that are customarily used in pharmaceuticals, e.g., Remington's Pharmaceutical Sciences, (Alfonso R. Gennaro, ed., 18th edition, 1990), including excipients, carriers, adjuvants, and buffers. The compositions can be administered, e.g., parenterally, enterally, intramuscularly, subcutaneously, intravenously, or other routes useful to achieve an effect. For example: anti-CD52 antibodies can be given intravenously (Cloes et al. (1999) Ann. Neurol., 46:296-304; Moreau et al. (1996) Multiple Sclerosis, 1:357-65; Moreau et al. (1994) Lancet, 344:298-301, all herein incorporated by reference) and subcutaneously (Schnitzer et al. (1997) J. Rheumatol., 24:1031-6; Bowen et al. (1997) Br. J. Hematol., 96:617-9, both herein incorporated by reference). Conventional excipients include pharmaceutically acceptable organic or inorganic carrier substances suitable for parenteral, enteral, and other routes of administration that do not deleteriously react with the agents. For parenteral application, particularly suitable are injectable sterile solutions, preferably oil or aqueous solutions, as well as suspensions, emulsions or implants, including suppositories. Ampoules are convenient unit dosages. The pharmaceutical preparations can be sterilized and, if desired, mixed with stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, or other substances that do not react deleteriously with the active compounds.
[0139]In the methods of the present invention, the actual dosage of the anti-CD52 antibodies of the present invention employed will depend on a variety of factors including the type and seventy of disorder being treated, and other treatment modality or modalities selected. Guidance for dosage regimens is obtained from dosing of CAMPATH-1H known in the art.
EXPERIMENTAL EXAMPLES
Example 1
Construction of Anti-CD52 Antibody VH and VK Genes
[0140]The sequence of the rat anti-CD52 antibody was derived from data base entries RNIGHCC1G for the variable domain heavy chain (VH), and RNIGKCC1G for the variable domain light chain (VK). The sequences were modified slightly to remove internal HindIII and BamHI sites without altering the amino acid sequence. The VH and VK genes were made by gene synthesis. Briefly, a panel of synthetic oligonucleotides was designed and synthesised. The genes were assembled using a ligase chain reaction (LCR) wherein the oligonucleotides featuring complementary ends were allowed to anneal followed by amplification and fill-in using a polymerase chain reaction (PCR). The PCR was driven by addition of an increased concentration of the flanking oligonucleotides to act as primers. The PCR products were assembled into full-length antibody genes by further PCR from vectors containing 5' and 3' immunoglobulin gene flanking regions and sub-cloning into expression vectors for expression of whole antibody. The assembled VH and VK genes served as templates for mutagenesis and construction of multiple variant antibody sequences in which potential T-cell epitopes had been removed.
[0141]For assembly of the VH gene oligonucleotides VH1 to VH20 detailed in Table 3 were used. For assembly of the VK gene oligonucleotides VK1 to VK20 detailed in Table 4 were used. For both genes, the LCR was conducted by mixing 20 μl of phosphorylated oligonucleotides with 1 μl Pfu DNA ligase (Stratagene, Amsterdam, NL), 10 μl 10× reaction buffer (supplied with enzyme) and 69 μl water. The reaction mix was placed in a thermal cycler for incubation at 95° C. for 2 minutes followed by 25 cycles of 95° C. for 30 seconds, gradual cooling to 50° C., incubation at 50° C. for 30 seconds, and 55° C. for 20 minutes, followed by a final incubation of 3 hours at 55° C. Analysis of a sample of the LCR using 1% agarose gel electrophoresis gave a smear with a faint band of correct size just visible. The oligonucleotides in all cases were from Sigma-Genosys (Pampisford, UK) and were phosphorylated in vitro using T4 DNA kinase (Promega, Southampton, UK) and the supplier's recommended protocol. Following LCR, 5 μL of the reaction was transferred to a PCR mix to amplify the assembled fragment. Oligonucleotides VH1 and VH20 were used to drive the VH reaction, with oligonucleotides VK1 and VK20 used to drive the VK reaction. PCR was conducted in a total volume of 50 μl for 30 cycles using 1 μl Pfu DNA polymerase (Stratagene, Amsterdam, NL). Analysis of a sample of the PCR using 1% agarose gel electrophoresis gave a band of 380 bp for VH and 377 bp for VK.
[0142]Variable region cassettes were assembled using overlapping PCR. Briefly, DNAs derived from the vectors M13-VHPCR1 and M13-VKPCR1 [Orlandi et al. (1989), PNAS, 89: 3833-7] were used as templates to produce a further two overlapping PCR fragments for each VH and VK chain including 5' flanking sequence encoding the leader signal peptide and 3' flanking sequence including a splice site and intron sequences. The DNA fragments so produced for the VH and VK were combined in a PCR using flanking primers required to obtain full-length DNA sequences. The primer pairs used in these "linking" reactions were oligonucleotides VHVK5'CHO/VHVK3'SIG and VH19/VH12 for the VH gene, whereas for the VK gene, the oligonucleotides VHVK5'CHO/VHVK3'SIG and VK19/VK3'CHO were used.
[0143]After purification using a Qiagen (Crawley, UK) PCR PREP kit the PCR products were cut with HindIII and BamHI (Promega, Southampton, UK) and run on a 1% agarose gel. The desired bands were removed and purified using a Qiagen (Crawley, UK) DNA extraction kit. The products were cloned into HindIII and BamHI cut pUC19 vector and the DNA sequence confirmed.
TABLE-US-00004 TABLE 3 Oligonucleotides for synthesis of VH gene SEQ Name Sequence ID NO: VH1 TCCACAGGTGTCCACTCCGA 141 VH2 CCAGATTCCAACAGTTTCACCTCGGAGTGGACAC 142 CTGTGGA VH3 GGTGAAACTGTTGGAATCTGGAGGAGGCTTGGTA 143 CAGCC VH4 GGAGAGTCTCATAGAACCCCCCGGCTGTACCAAG 144 CCTCCT VH5 GGGGGGTTCTATGAGACTCTCCTGTGCAGGTTCT 145 GGATTCA VH6 CATGTAGAAATCAGTGAAGGTGAATCCAGAACCT 146 GCACA VH7 CCTTCACTGATTTCTACATGAACTGGATTCGCCA 147 GCCTGC VH8 GCCACTCAGGTGCCTTCCCTGCAGGCTGGCGAAT 148 CCAGTT VH9 AGGGAAGGCACCTGAGTGGCTGGGTTTTATTAGA 149 GACAAA VH10 TCTGTTGTGTAACCTTTAGCTTTGTCTCTAATAA 150 AACCCA VH11 GCTAAAGGTTACACAACAGAGTACAATCCATCTG 151 TGAAGGGG VH12 TCTGGAGATGGTGAACCGCCCCTTCACAGATGGA 152 TTGTAC VH13 CGGTTCACCATCTCCAGAGATAATACCCAAAACA 153 TGCT VH14 GGGTGTTCATTTGAAGATAGAGCATGTTTTGGGT 154 ATTATC VH15 CTATCTTCAAATGAACACCCTAAGAGCTGAGGAC 155 ACTGCC VH16 TCTCTTGCACAGTAGTAAGTGGCAGTGTCCTCAG 156 CTCTTA VH17 ACTTACTACTGTGCAAGAGAGGGCCACACTGCTG 157 CTCCTTTT VH18 CTCCTTGGCCCCAGTAATCAAAAGGAGCAGCAGT 158 GTGGCCC VH19 GATTACTGGGGCCAAGGAGTCATGGTCACCGTCT 159 CCTCA VH20 TGAGGAGACGGTGACCATGA 160 VHVK5'CHO GCATGTTGACCCTGACGCAAGCTTGCCGCCACCA 161 TGGG VHVK3'SIG GGAGTGGACACCTGTGGAGAGAAAGGC 162 VH12 GCGATAGCTGGACTGAATGGATCCTATAAATCTC 163 TG
TABLE-US-00005 TABLE 4 Oligonucleotides for synthesis of VK gene SEQ Name Sequence ID NO: VK1 TCCACAGGTGTCCACTCCGAC 164 VK2 AGACTGGGTCATCTTGATGTCGGAGTGGACACCT 165 GTGGA VK3 ATCAAGATGACCCAGTCTCCCTCATTCCTGTCTG 166 CATCTG VK4 AGAGTGACTCTGTCTCCCACAGATGCAGACAGGA 167 ATGAGGG VK5 TGGGAGACAGAGTCACTCTCAACTGCAAAGCAAG 168 TCAGAA VK6 GTTTAAGTATTTGTCAATATTCTGACTTGCTTTG 169 CAGTTG VK7 TATTGACAAATACTTAAACTGGTATCAGCAAAAG 170 CTGGGA VK8 TCAGGAGTTTGGGAGATTCTCCCAGCTTTTGCTG 171 ATACCA VK9 GAATCTCCCAAACTCCTGATATATAATACAAACA 172 ATTTGC VK10 CCTTGATGGGATGCCCGTTTGCAAATTGTTTGTA 173 TTATATA VK11 AAACGGGCATCCCATCAAGGTTCAGTGGCAGTGG 174 ATCTGG VK12 GGTGAGTGTGAAATCAGTACCAGATCCACTGCCA 175 CTGAA VK13 TACTGATTTCACACTCACCATCAGCAGCCTGCAG 176 CCTGAA VK14 CAGAAATATGTGGCAACATCTTCAGGCTGCAGGC 177 TGCTGAT VK15 GATGTTGCCACATATTTCTGCTTGCAGCATATAA 178 GTAGG VK16 CCCAGTTCCAAACGTGCGCGGCCTACTTATATGC 179 TGCAAG VK17 CCGCGCACGTTTGGAACTGGGACCAAGCTGGAGC 180 TGAAAC VK18 AAAGTTTAAATTCTACTCACGTTTCAGCTCCAGC 181 TTGGT VK19 GTGAGTAGAATTTAAACTTTGCTTCGTCGACTGG 182 ATCC VK20 GGATCCAGTCGACGAAGC 183 VHVK5'CHO GCATGTTGACCCTGACGCAAGCTTGCCGCCACCA 184 TGGG VHVK3'SIG GGAGTGGACACCTGTGGAGAGAAAGGC 185 VK3'CHO GCGATAGCTGGACTGAATGGATCCAGTCGACGAA 186 GC
[0144]Chimeric heavy and light chain expression vectors have been constructed consisting of the rat anti-CD52 variable regions linked to human IgG1 [Takahashi et al. (1982) Cell 29: 671] or κ [Heiter et al. (1980) Cell 22: 197] constant regions. These composite antibody genes were then transferred to expression vectors for production of recombinant antibody. The antibody genes are under the control of the human cytomegalovirus immediate early promoter. The heavy chain vector includes the dhfr gene and the light chain vector the neo gene for selection in mammalian cells. The DNA sequence was confirmed to be correct for the VH and VK in the chimaeric expression vectors.
Example 2
Construction of Modified Antibody VH and VK Genes
[0145]Modified VH and VK genes were constructed by PCR mutagenesis using the rat anti-CD52 variable region cassettes generated in Example 1 as templates. Table 5 lists the oligonucleotides used in the production of modified VHS. The following mutations are identified by the Kabat number of the residue with the linear number relating to the respectively identified polypeptide acid sequence in parenthesis. DIVHv1 (polypeptide SEQ ID NO: 3; polynucleotide SEQ ID NO: 71) included the mutations K3Q (3), M18L (18), 137V (37), P40A (40), A41P (41), A44G (44), P45L (45), L48V (48), T74S (77), Q75K (78), M77T (80), T82bS (87), T89V (95), V107T (115), M108L (116), and used oligonucleotides VHVK5'CHO, DIVH1, DIVH2, DIVH3, DIVH4, DIVH5, DIVH6, DIVH7, DIVH8, DIVH9, DIVH10, and VH12. DIVHv2 (polypeptide SEQ ID NO: 4; polynucleotide SEQ ID NO: 72) included the mutations K3Q (3), M18L (18), A41P (41), L48I (48), T74S (77), Q75K (78), M77T (80), T82bS (87), T89V (95), V107T (115), M108L (116), and used oligonucleotides VHVK5'CHO, DIVH1, DIVH2, DIVH3, DIVH4, DIVH5A, DIVH6A, DIVH7, DIVH8, DIVH9, DIVH10, and VH12. DIVHv3 (polypeptide SEQ ID NO: 5; polynucleotide SEQ ID NO: 73) included the mutations L5Q (5), L20I (20), A23S (23), A41P (41), A44G (44), L48I (48), M77T (80), Y79H (82), M82A (85), T89V (95), V107T (115), M108T (106), and used oligonucleotides VHVK5'CHO, DIVH11, DIVH12, DIVH13, DIVH14, DIVH15, DIVH16, DIVH17, DIVH18, DIVH19, DIVH20, and VH12. DIVHv4 (polypeptide SEQ ID NO: 6; polynucleotide SEQ ID NO: 74) included the mutations K3Q (3), M18L (18), I37V (37), P40A (40), A41P (41), A44G (44), P45L (45), L48V (48), T74A (77), Q75K (78), M77S (80), T82bS (87), T89V (95), V107T (115), M108L (116), and used oligonucleotides VHVK5'CHO, DIVH1, DIVH2, DIVH3, DIVH4, DIVH5, DIVH6, DIVH7, DIVH8, DIVH9, DIVH10, DIVH21, DIVH22 and VH12. DIVHv5 (polypeptide SEQ ID NO: 7; polynucleotide SEQ ID NO: 75) included the mutations K3Q (3), M18L (18), A41P (41), T74S (77), Q75K (78), M77T (80), T82bS (87), T89V (95), V107T (115), M108L (116) and used oligonucleotides VHVK5'CHO, DIVH1, DIVH2, DIVH3, DIVH4, DIVH23, DIVH6A, DIVH7, DIVH8, DIVH9, DIVH10, and VH12.
TABLE-US-00006 TABLE 5 Oligonucleotides used in the construction of modified ant-CD52 VHS SEQ Name Sequence ID NO: VHVK5'CHO GCATGTTGACCCTGACGCAAGCTTGCCGCCACCA 187 TGGG DIVH1 CCACTCCGAGGTGCAACTGTTGGAATCTGG 188 DIVH2 CCAGATTCCAACAGTTGCACCTCGGAGTGG 189 DIVH3 AGCCGGGGGGTTCTCTGAGACTCTCCTGTG 190 DIVH4 CACAGGAGAGTCTCAGAGAACCCCCCGGCT 191 DIVH5 AGGGAAGGGACTTGAGTGGGTGGGTTTTATTAGA 192 G DIVH5A CGGGAAAGCACCTGAGTGGATTGGTTTTATTAGA 193 G DIVH6 CCACTCAAGTCCCTTCCCTGGAGCCTGGCGGACC 194 CAGTTCATG DIVH6A CCACTCAGGTGCTTTCCCGGGAGGCTGGCGAATC 195 C DIVH7 TCTTCAAATGAACTCCCTAAGAGCTGAGGACACT 196 GCCGTTTACTACTG DIVH8 AGGGAGTTCATTTGAAGATAGAGGGTGTTTTTGG 197 AATTATCTCTGG DIVH9 TGGGGCCAAGGAACACTGGTCACCGTCTCCTCAG 198 G DIVH10 GGAGACTGTGACCAGTGTTCCTTGGCCCCAG 199 DIVH11 TCCGAGGTGAAACTGCAGGAATCTGGAGGAGGC 200 DIVH12 CCAGATTCCTGCAGTTTCACCTCGGAGTGG 201 DIVH13 GGGGGTTCTATGAGAATCTCCTGTTCAGGTTCTG 202 G DIVH14 GAACCTGAACAGGAGATTCTCATAGAACCCCCCG 203 G DIVH15 CGGGAAAGGACCTGAGTGGATTGGTTTTATTAGA 204 G DIVH16 CCAATCCACTCAGGTCCTTTCCCGGGAGGCTGGC 205 G DIVH17 GCTAACACCCTAAGAGCTGAGGACACTGCCGTTT 206 ACTACTG DIVH18 CTCTTAGGGTGTTAGCTTGAAGATGGAGGGTGTT 207 TTGGG DIVH19 TGGGGCCAAGGAACTACCGTCACCGTCTCCTCAG 208 G DIVH20 GGAGACGGTGACGGTAGTTCCTTGGCCCCAG 209 DIVH21 GATAATGCCAAAAACTCCCTCTATCTTCAAA 210 TGAAC DIVH22 ATAGAGGGAGTTTTTGGCATTATCTCTGGAG 211 ATGG DIVH23 CGGGAAAGCACCTGAGTGGCTGGGTTTTATT 212 AGAG VH12 GCGATAGCTGGACTGAATGGATCCTATAAAT 213 CTCTG
[0146]Table 6 lists the oligonucleotides used in the production of modified VKS. The following mutations are identified by the Kabat numbers of the residues and are the same as the linear numbering of the respectively identified polypeptide sequences. DIVKv1 (polypeptide SEQ ID NO: 8; polynucleotide SEQ ID NO: 76) included the mutations K3Q, F10S, L21I, N22T, K24R, L40P, E42K, S43A, L46S, T56S, I58V, V83I, F87Y, and used oligonucleotides VHVK5'CHO, DIVK1, DIVK2, DIVK3A, DIVK4A, DIVK5B, DIVK6, DIVK7, DIVK8A, DIVK9, DIVK10, and VK3'CHO. DIVKv2 (polypeptide SEQ ID NO: 9; polynucleotide SEQ ID NO: 77) included the mutations K3Q, F10S, L21I, N22T, L40P, E42K, S43A, I58V, V83I, F87Y, and used oligonucleotides VHVK5'CHO, DIVK1, DIVK2, DIVK3, DIVK4, DIVK5, DIVK6, DIVK7, DIVK8, DIVK9, DIVK10, and VK3'CHO. DIVKv3 (polypeptide SEQ ID NO: 10; polynucleotide SEQ ID NO: 78) included the mutations K3Q, F10S, L21I, N22T, K24R, L40P, E42K, S43A, T56S, I58V, V83I, F87Y, and used oligonucleotides VHVK5'CHO, DIVK1, DIVK2, DIVK3A, DIVK4A, DIVK5, DIVK6, DIVK7, DIVK8A, DIVK9, DIVK10, and VK3'CHO. DIVKv4 (polypeptide SEQ ID NO: 11; polynucleotide SEQ ID NO: 79) included the mutations K3Q, F10S, L21I, N22T, L40P, E42K, S43A, L46S, I58V, V83I, F87Y, and used oligonucleotides VHVK5'CHO, DIVK1, DIVK2, DIVK3, DIVK4, DIVK5B, DIVK6, DIVK7, DIVK8, DIVK9, DIVK10, and VK3'CHO. DIVKv5 (polypeptide SEQ ID NO: 12; polynucleotide SEQ ID NO: 80) included the mutations K3Q, F10S, L21I, N22T, L40P, E42K, I58V, V83I, F87Y, and used oligonucleotides VHVK5'CHO, DIVK1, DIVK2, DIVK3, DIVK4, DIVK5A, DIVK6A, DIVK7, DIVK8, DIVK9, DIVK10, and VK3'CHO.
TABLE-US-00007 TABLE 6 Oligonucleotides used in the construction of modified ant-CD52 VKS SEQ Name Sequence ID NO: VHVK5'CHO GCATGTTGACCCTGACGCAAGCTTGCCGCCACCA 214 TGGG DIVK1 ATGACCCAGTCTCCCTCATCCCTGTCTGCATC 215 DIVK2 GAGGGAGACTGGGTCATCTGGATGTCGGAGTGGA 216 C DIVK3 CAGAGTCACTATCACCTGCAAAGCAAGTCAGAAT 217 DIVK3A CAGAGTCACTATCACCTGCAGAGCAAGTCAGAAT 218 DIVK4 ATTCTGACTTGCTTTGCAGGTGATAGTGACTCTG 219 T DIVK4A ATTCTGACTTGCTCTGCAGGTGATAGTGACTCTG 220 T DIVK5 CCCGGAAAAGCTCCCAAACTCCTGATATATAATA 221 C DIVK5A CCCGGAAAATCTCCCAAACTCCTGATATATAATA 222 C DIVK5B CCCGGAAAAGCTCCCAAATCCCTGATATATAATA 223 C DIVK6 TTTGGGAGCTTTTCCGGGCTTTTGCTGATACC 224 DIVK6A TTTGGGAGATTTTCCGGGCTTTTGCTGATACC 225 DIVK7 CGTCCCATCAAGGTTCAGTGGCAGTGG 226 DIVK8 GCCACTGAACCTTGATGGGACGCCCGTTTGC 227 DIVK8A CACTGAACCTTGATGGGACGCCAGATTGCAAATT 228 G DIVK9 GCCTGAAGATATTGCCACATATTACTGCTTGCAG 229 C DIVK10 TGCAAGCAGTAATATGTGGCAATATCTTCAGGCT 230 G VK3'CHO GCGATAGCTGGACTGAATGGATCCAGTCGACGAA 231 GC
[0147]The modified VH and VK expression cassettes produced were cloned as HindIII to BamHI fragments (DNA and amino acid sequences for DIVHYv1-DIVHv5 are shown in FIG. 3-FIG. 7 and for DIVKv1-DIVKv5 are shown in FIG. 8-FIG. 12 respectively) into the plasmid vector pUC 19 and the entire DNA sequence was confirmed to be correct for each modified VH and VK.
[0148]The modified VH and VK expression cassettes were linked to human IgG1 (SEQ ID NO: 139; FIG. 13) [Takahashi et al. (1982) Cell 29: 671] and κ (SEQ ID NO: 140; FIG. 14) [Heiter et al. (1980) Cell 22: 197] constant regions respectively. These composite antibody genes were then transferred to expression vectors for production of recombinant antibody. The antibody genes are under the control of the human cytomegalovirus immediate early promoter. The heavy chain vector includes the dhfr gene and the light chain vector the neo gene for selection in mammalian cells. The DNA sequence was confirmed to be correct for the VH and VK in the expression vectors.
Example 3
Expression, Purification and Quantitation of Anti-CD52 Antibodies
[0149]The host cell line for antibody expression was CHO dhFr.sup.-, obtained from the European Collection of Animal Cell Cultures, Porton UK (ECACC No 94060607). The heavy and light chain expression vectors were co-transfected into CHO cells by electroporation. Colonies expressing the neo and dhfr genes were selected in Iscove's Modified Dulbecco's Medium (IMDM) without nucleosides, supplemented with 10% dialysed foetal bovine serum and 400 μg/ml geneticin (G-418 sulphate) (all from Gibco, Paisley, UK). Transfected cell clones were screened for production of human antibody by ELISA for human IgG [Tempest et al. (1991) BioTechnology 9: 266]. Cell lines secreting antibody were expanded and the highest producers selected and frozen down in liquid nitrogen. The anti-CD52 antibodies were purified using Prosep®-A (Bioprocessing Ltd) according to the manufacturer's instructions. The concentration was determined by ELISA for human IgG1 κ antibody.
[0150]The assay was conducted in 96-well plates and all determinations were conducted in duplicate. For the assay, plates (Dynatech Immulon 2) were coated using 100 μl per well of sheep anti-human κ antibody (The Binding Site, Birmingham, UK) diluted 1:250 in carbonate/bicarbonate coating buffer pH9.6 (Sigma, Poole, UK). Coating was conducted for 1 hr at 37° C. and the wells washed 3 times with PBST (PBS with 0.05% Tween 20). The wells were filled with 100 μL of PBST and the dilutions for the control and test antibodies set out. The negative control uses PBST only and no antibody was added. The standard antibody (Human IgG1/κ purified myeloma protein, The Binding Site, UK) was diluted to 2 micrograms per ml in PBST. 100 μL was added to duplicate wells in the first column (giving a final concentration of 1 μg/ml) and doubling dilutions made across the plate. Doubling dilution series were also set out for the test antibody preparations. The plate was incubated at room temperature for 1 hr and the wells washed as previously. Bound antibody was detected using a peroxidase conjugated sheep ant-human IgG γ chain specific reagent (The Binding Site, Birmingham, UK). This secondary antibody was diluted 1:1000 in PBST and 100 μl added to each well of the plate. The plate was incubated for a further 1 hour at room temperature and washed as previously. Detection was with o-phenylene diamine (OPD) substrate. One tablet (20 mg) of OPD (Sigma, Poole, UK) was dissolved in 45 ml of peroxidase buffer (Sigma, Poole, UK) with 10 μL 30% (w/w) hydrogen peroxide (Sigma, Poole, UK) added just before use. 100 μL of substrate was added per well and incubated at room temperature for five minutes or as required. Color development was stopped by adding 25 μL of 12.5% H2SO4 and the results at 492 nm. Antibody concentration versus A492 was plotted and the concentration of the sample antibody determined by comparison with the standard antibody curve.
Example 4
Testing of Modified Anti-CD52 Antibodies Using a Binding Assay
[0151]Human T-cell lymphoma cell line HUT-78 is CD52 positive and was used to assess binding of the modified antibodies of the present invention. In the present example, different concentrations of test antibody were incubated with the cells and the amount of bound antibody was assessed following incubation with a fluorescent-labelled reporter reagent. The reporter is measured using a fluorescence activated cell sorter (FACS).
[0152]Briefly, for each assay, 106 HUT-78 cells were incubated with serial dilutions of test antibody and humanised (CAMPATH-1H) and chimaeric anti-CD52 antibodies as controls. The concentrations of the antibodies in ng/ml were: 40000, 20000, 10000, 5000, 2500, 1250, 625, 312.5, 156.25, 78.125, 39.06, 19.53 and 0. All incubations were carried out in a 96 well plate in a final volume of 100 μl PBS/2% FBS.
[0153]The antibody and cell mixtures were incubated on ice in the dark for 1 hr and washed twice with 200 μl of cold PBS/2% FBS.
[0154]For detection, the cells were incubated for 1 hour on ice with a 1:1000 dilution of FITC-labelled anti-human IgG Fc domain. This reagent is a goat anti-human IgG (Fc specific) obtained from Sigma (Poole, UK). The cells were washed as previously and re-suspended in 100 μl of PBS/2% FBS and transferred to 4 ml FACS tubes (Becton Dickinson) containing 900 μl of PBS/2% FBS/Propidium Iodide (1:1000). The cells were analysed using a conventional Becton Dickenson FACS Calibur instrument.
[0155]The binding of the test and control antibodies was determined using the Median Fluorescence value. The saturating concentration of antibody was determined from plots of the Median Fluorescence--Zero Antibody Median Fluorescence versus Concentration of antibody. The binding curves were fitted to a logistic 4 parameter sigmoidal equation using SigmaPlot, giving an excellent fit with 95% confidence levels. The titres, i.e., concentrations at which 50% of maximum binding occurred, are shown in Table 7. The results indicate that many of the antibodies of the present invention show near equivalent binding to the chimeric CAMPATH-1G and the humanized CAMPATH-1H antibodies.
TABLE-US-00008 TABLE 7 Titre (μg/ml) (Concentration which gave 50% Antibody of maximum binding) Humanised CAMPATH-1H 1.49, 1.44, 2.62, 2.99 Chimaeric CAMPATH-1G 1.03, 1.99, 2.55, 2.35, 4.20 DIVH1/DIVK1 2.99 DIVH1/DIVK2 1.66 DIVH1/DIVK3 1.71 DIVH1/DIVK4 3.45 DIVH1/DIVK5 1.85 DIVH2/DIVK1 5.56 DIVH2/DIVK2 3.70 DIVH2/DIVK3 3.89 DIVH2/DIVK4 6.21 DIVH2/DIVK5 1.18 DIVH3/DIVK1 9.60 DIVH3/DIVK2 17.79 DIVH3/DIVK3 >40.0 DIVH3/DIVK4 8.63 DIVH3/DIVK5 3.30 DIVH4/DIVK1 4.43 DIVH4/DIVK2 1.59 DIVH4/DIVK3 2.28 DIVH4/DIVK4 8.54 DIVH4/DIVK5 2.39 DIVH5/DIVK1 4.01 DIVH5/DIVK2 2.45 DIVH5/DIVK3 2.55 DIVH5/DIVK4 4.05 DIVH5/DIVK5 3.00
Example 5
Testing of Modified Anti-CD52 Antibodies Using a Competition Assay
[0156]Competition binding assays were conducted using the modified antibodies of the present invention. In these assays the test antibodies were assessed for their ability to compete for binding to CD52 against the humanised CAMPATH-1H reagent. In the present example, HUT-78 cells are co-incubated with a sub-saturating amount of a biotinylated CAMPATH-1H and several concentrations of competing non-labelled test antibody. The amount of biotinylated reference antibody bound to the cells was determined following further incubation with an avidin-FITC reporter and fluorescence determination using a FACS instrument as per Example 4.
[0157]Briefly, for each competition assay, 106 HUT-78 cells were incubated with 2μg biotinylated human CAMPATH-1H. Pilot experiments had been previously conducted with the biotinylated CAMPATH-1H and unlabelled CAMPATH-1H to determine the optimum amount of biotinylated antibody required for subsequent to addition to each assay.
[0158]Serial dilutions of the test and control antibodies were set out into 96 well plates in a final volume of 100 μl PBS/2% FBS. Test antibodies were set out at 0, 0.1, 0.5, 1.0, 5.0, 10.0, 50.0, 100, 500, & 1000 μg/106 cells.
[0159]The cell and antibody mixtures were incubated on ice in the dark for 1 hour and washed twice with 200 μl of ice-cold PBS/2% FBS. The bound biotinylated antibody was detected by incubation with a 1:200 dilution of an avidin-FITC reagent (Sigma, Poole, UK). Incubation was for 1 hour on ice followed by two cycles of washing as previously. The cells were re-suspended in 100 μl of PBS/2% FBS and transferred to 4 ml tubes containing 900 μl of PBS/2% FBS/Propidium Iodide (diluted 1:1000). The cells were analysed using a Becton Dickenson FACS Calibur instrument.
[0160]The binding of the test and control antibodies was expressed as a per-cent inhibition relative to the maximal binding of the biotin labelled control.
[0161]The percent inhibition value was determined as below:
% Inhibition = [ % of Gated Cells No Competitor - % of Gated Cells with Competitor ] [ % of Gated Cells No Competitor ] × 100
The binding curves were fitted to a logistic 4 parameter sigmoidal equation using SigmaPlot, giving an excellent fit with 95% confidence levels. The EC50 values were calculated and are shown in Table 8. The results indicate that the antibodies of the present invention bind to CD52 on HUT-78 cells with equivalent efficiency to the chimeric CAMPATH-1G and the humanized CAMPATH-1H antibodies.
TABLE-US-00009 TABLE 8 Antibody EC50 Humanised 1.13, 1.43, 1.00 CAMPATH- 1H Chimaeric 1.00, 2.02, 0.87 CAMPATH- 1G DIVH1/DIVK2 2.15, 2.84 DIVH1/DIVK3 0.93, 2.20 DIVH1/DIVK5 1.95, 2.75 DIVH2/DIVK5 0.79, 1.04 DIVH4/DIVK2 1.25, 2.05 DIVH4/DIVK3 2.19, 2.40 DIVH4/DIVK5 2.20 DIVH5/DIVK1 2.05 DIVH5/DIVK2 2.25, 1.65 DIVH5/DIVK3 1.97, 1.10 DIVH5/DIVK5 1.39, 2.43
Example 6
T Cell Immunogenicity Analysis
[0162]Modified antibody CAMPATH-1G DIVHv2/DIVKv5, was prepared from the cell line CHO CAMPATH-1G DIVH2/DIVK5 grown in CHO Protein-free Animal Component-Free Medium (Sigma Cat No: G7513) supplemented with L-glutamine and Antibiotic-Antimycotic (Gibco/Invitrogen Cat No: 15240-062). Antibody was purified by PROSEP-A chromatography (Millipore), eluted with 0.1M glycine pH3.0, neutralised and dialysed against phosphate buffered saline (PBS), and finally sterilised by filtration.
[0163]Both the DIVH2/DIVK5 modified antibody and humanised CAMPATH control were subjected to a 2-stage purification using cation exchange and size exclusion chromatography. After buffer exchange into 50 mM MES pH6 on a Sephadex G25 (PD10 column), the protein was passed through a cation exchange column (Mono-S 10/10) and eluted with a sodium chloride gradient (0 to 0.5M). The eluted protein containing fractions were then applied to a Superdex 200 preparative column (XK16/60) run in PBS. Peak fractions were pooled and stored at 4° C. The antibody concentrations were determined by ELISA for human IgG.
[0164]Experimental: It was suspected that the anti-CD52 CAMPATH antibody would itself be inhibitory to T cells, and would interfere with the analysis of immunogenicity in the standard T cell assay. Preliminary experiments were carried out to test the effect of CAMPATH anti-CD52 antibody on T cells. PBMC were prepared from blood from three healthy normal donors. These were incubated with humanised CAMPATH-1H (supplied by Ilex) alone, Keyhole Limpet Haemocyanin (KLH) alone, KLH and CAMPATH-1H antibody together and untreated control. The results showed that there is a compete inhibition of the response to the control antigen KLH, in all 3 donors, due to the effect of the antibody on the T cells.
[0165]In order to analyze the immunogenicity of intact anti-CD52 antibody, a more complex T cell assay protocol was used where dendritic cells (DC) were loaded with whole anti-CD52 antibody and exogenous (non-processed) antigen was removed by washing prior to addition of autologous T cells. In this way, the inhibitory effect of anti-CD52 was avoided and normal responses to KLH achieved. A total of 10 healthy donors were used in this alternative protocol using humanized CAMPATH-1H as a test control antigen.
[0166]Briefly, PBMC were used as a source of monocytes, which were isolated by adherence to tissue culture plastic (>90% CD14.sup.+). Monocytes were cultured in AIM V medium (Gibco) with 3% heat inactivated human AB serum (Autogen Bioclear) (growth medium) at an approximate density of 1×106 per well (24-well plate). To induce an APC-like phenotype (CD40.sup.+, CD80hi, CD83hi, CD86hi, MHC class IIhi) monocytes were incubated in growth medium containing human IL-4 (Peprotech) and GM-CSF (Peprotech) for 4 days. On day 4, 50 μg/ml of test antigen (humanised CAMPATH-1H or modified CAMPATH-1G DIVHv2/DIVKv5 antibody) was added. Control wells received medium only. After 24 hrs the growth medium and antigen was removed and the cells washed once before adding fresh growth medium containing TNFα (Peprotech), GM-CSF and IL-4 for 4 days. Then both adherent and non-adherent dendritic cells (DCs) were harvested and counted. The DCs were distributed at 1×104 per well of 96 well round bottom plates, in sextuplicate cultures per treatment (humanised CAMPATH-1H or modified CAMPATH-1G DIVHv2/DIVKv5 antibody or control) per donor. The DC were gamma irradiated with 4000 rads before adding autologous CD4.sup.+ T cells that were negatively isolated from PBMC (Dynal Human CD4.sup.+ Negative Isolation Kit) at 1×105 per well. Plates were incubated for 7 days and proliferation was measured by incorporation of tritiated thymidine (a 6-hr pulse with 3H-Thymidine at 1 μCi/well). These data are expressed as a stimulation index where:
Stimulation Index = CPM of test antigen CPM of untreated control
A positive result is defined as a stimulation index (SI) greater than 2. Preliminary results (FIG. 15) show that 2 out of 10 these donors responded to CAMPATH-1H, one with a very high stimulation index.
[0167]Comparison of CAMPATH-1H and modified DIVHv5/DIVKv2 antibody: A panel of twenty healthy donors were selected based on HLA-DR typing (see Table 9) for screening the humanised and modified antibodies in T cell assays. This enabled the screening of the antibodies against greater than 80% of DR alleles expressed in the world population.
TABLE-US-00010 TABLE 9 HLA DR haplotypes of the set of 20 healthy donors used to test the immunogenicity of humanised and modified CAMPATH antibodies DONOR Allotype 1 DRB1*04, DRB4*01 2 DRB1*03, DRB1*04, DRB4*01, DRB5 3 DRB1*01, DRB1*13, DRB3 4 DRB1*01, DRB1*07, DRB4*01 5 DRB1*11 AND DRB1*13 OR 14, DRB3 6 DRB1*03 AND DRB1*08, 11 OR 13, DRB3 7 DRB1*01, DRB1*11, DRB3 8 DRB1*10, DRB1*15, DRB5 9 DRB1*04, DRb1*15, DRB4*01, DRB5 10 DRB1*03, DRB1*15, DRB3, DRB5 11 DRB1*13, DRB1*16, DRB3, DRB5 12 DRB1*03, DRB1*07, DRB3, DRB4 13 DRB1*03, DRB1*10, DRB3 14 DRB1*04, DRB1*09, DRB4*01 15 DRB1*09, DRB1*15, DRB4*01, DRB5 16 DRB1*03, DRB1*08, DRB3 17 DRB1*08, DRB1*15, DRB5 18 DRB1*13&DRB1*14 OR DRB13, DRB3 19 DRB1*07, DRB4*01 20 DRB1*07, DRB1*16, DRB4*01, DRB5
[0168]FIG. 16 shows that humanised CAMPATH 1H induced significant (p<0.05) proliferative responses (cpm compared to untreated controls) in three healthy individuals (donors 14, 17 and 19). However only T cells from donors 14 and 17 produced sufficiently high (SI>2) stimulation indexes of 4.2 and 2.5, respectively. The donor 19 response was excluded since the stimulation index was considerably lower (SI˜1.5) than the threshold set for this experiment. For Donor 8 the untreated control produced less than 400 cpm and was therefore excluded from the study. Importantly, none of the donors responded to the modified DIVHv5/DIVKv2 antibody.
[0169]Thus, the humanised CAMPATH 1H antibody has the potential to induce a T cell dependent humoral immune response (marked by affinity matured, isotype switched anti-CAMPATH 1H antibodies) in some human patients with certain MHC Class II allotypes. This observation was supported by ex vivo T cell assays in which T cell activation occurred in at least two healthy individuals (donors 14 and 17) in response to treatment with antigen processed CAMPATH 1H (expressed by matured DC). Comparison of ex vivo T cell responses using antigen processed modified DIVHv5/DIVKv2 antibody showed that this completely failed to induce T cell proliferation in any of the donors tested. These data demonstrate that the modified antibody is likely to provide an improved therapeutic molecule when substituted for humanised CAMPATH-1H, particularly when used for indications where repeated dosing is required.
Sequence CWU
1
2351121PRTRattus norvegicus 1Glu Val Lys Leu Leu Glu Ser Gly Gly Gly Leu
Val Gln Pro Gly Gly1 5 10
15Ser Met Arg Leu Ser Cys Ala Gly Ser Gly Phe Thr Phe Thr Asp Phe
20 25 30Tyr Met Asn Trp Ile Arg Gln
Pro Ala Gly Lys Ala Pro Glu Trp Leu 35 40
45Gly Phe Ile Arg Asp Lys Ala Lys Gly Tyr Thr Thr Glu Tyr Asn
Pro 50 55 60Ser Val Lys Gly Arg Phe
Thr Ile Ser Arg Asp Asn Thr Gln Asn Met65 70
75 80Leu Tyr Leu Gln Met Asn Thr Leu Arg Ala Glu
Asp Thr Ala Thr Tyr 85 90
95Tyr Cys Ala Arg Glu Gly His Thr Ala Ala Pro Phe Asp Tyr Trp Gly
100 105 110Gln Gly Val Met Val Thr
Val Ser Ser 115 1202107PRTRattus norvegicus 2Asp
Ile Lys Met Thr Gln Ser Pro Ser Phe Leu Ser Ala Ser Val Gly1
5 10 15Asp Arg Val Thr Leu Asn Cys
Lys Ala Ser Gln Asn Ile Asp Lys Tyr 20 25
30Leu Asn Trp Tyr Gln Gln Lys Leu Gly Glu Ser Pro Lys Leu
Leu Ile 35 40 45Tyr Asn Thr Asn
Asn Leu Gln Thr Gly Ile Pro Ser Arg Phe Ser Gly 50 55
60Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser
Leu Gln Pro65 70 75
80Glu Asp Val Ala Thr Tyr Phe Cys Leu Gln His Ile Ser Arg Pro Arg
85 90 95Thr Phe Gly Thr Gly Thr
Lys Leu Glu Leu Lys 100
1053121PRTArtificialMutated recombinant 3Glu Val Gln Leu Leu Glu Ser Gly
Gly Gly Leu Val Gln Pro Gly Gly1 5 10
15Ser Leu Arg Leu Ser Cys Ala Gly Ser Gly Phe Thr Phe Thr
Asp Phe 20 25 30Tyr Met Asn
Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35
40 45Gly Phe Ile Arg Asp Lys Ala Lys Gly Tyr Thr
Thr Glu Tyr Asn Pro 50 55 60Ser Val
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr65
70 75 80Leu Tyr Leu Gln Met Asn Ser
Leu Arg Ala Glu Asp Thr Ala Val Tyr 85 90
95Tyr Cys Ala Arg Glu Gly His Thr Ala Ala Pro Phe Asp
Tyr Trp Gly 100 105 110Gln Gly
Thr Leu Val Thr Val Ser Ser 115
1204121PRTArtificialMutated recombinant 4Glu Val Gln Leu Leu Glu Ser Gly
Gly Gly Leu Val Gln Pro Gly Gly1 5 10
15Ser Leu Arg Leu Ser Cys Ala Gly Ser Gly Phe Thr Phe Thr
Asp Phe 20 25 30Tyr Met Asn
Trp Ile Arg Gln Pro Pro Gly Lys Ala Pro Glu Trp Ile 35
40 45Gly Phe Ile Arg Asp Lys Ala Lys Gly Tyr Thr
Thr Glu Tyr Asn Pro 50 55 60Ser Val
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr65
70 75 80Leu Tyr Leu Gln Met Asn Ser
Leu Arg Ala Glu Asp Thr Ala Val Tyr 85 90
95Tyr Cys Ala Arg Glu Gly His Thr Ala Ala Pro Phe Asp
Tyr Trp Gly 100 105 110Gln Gly
Thr Leu Val Thr Val Ser Ser 115
1205121PRTArtificialMutated Recombinant 5Glu Val Lys Leu Gln Glu Ser Gly
Gly Gly Leu Val Gln Pro Gly Gly1 5 10
15Ser Met Arg Ile Ser Cys Ser Gly Ser Gly Phe Thr Phe Thr
Asp Phe 20 25 30Tyr Met Asn
Trp Ile Arg Gln Pro Pro Gly Lys Gly Pro Glu Trp Ile 35
40 45Gly Phe Ile Arg Asp Lys Ala Lys Gly Tyr Thr
Thr Glu Tyr Asn Pro 50 55 60Ser Val
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Thr Gln Asn Thr65
70 75 80Leu His Leu Gln Ala Asn Thr
Leu Arg Ala Glu Asp Thr Ala Val Tyr 85 90
95Tyr Cys Ala Arg Glu Gly His Thr Ala Ala Pro Phe Asp
Tyr Trp Gly 100 105 110Gln Gly
Thr Thr Val Thr Val Ser Ser 115
1206121PRTArtificialMUTATED RECOMBINANT 6Glu Val Gln Leu Leu Glu Ser Gly
Gly Gly Leu Val Gln Pro Gly Gly1 5 10
15Ser Leu Arg Leu Ser Cys Ala Gly Ser Gly Phe Thr Phe Thr
Asp Phe 20 25 30Tyr Met Asn
Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35
40 45Gly Phe Ile Arg Asp Lys Ala Lys Gly Tyr Thr
Thr Glu Tyr Asn Pro 50 55 60Ser Val
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser65
70 75 80Leu Tyr Leu Gln Met Asn Ser
Leu Arg Ala Glu Asp Thr Ala Val Tyr 85 90
95Tyr Cys Ala Arg Glu Gly His Thr Ala Ala Pro Phe Asp
Tyr Trp Gly 100 105 110Gln Gly
Thr Leu Val Thr Val Ser Ser 115
1207121PRTArtificialMutated Recombinant 7Glu Val Gln Leu Leu Glu Ser Gly
Gly Gly Leu Val Gln Pro Gly Gly1 5 10
15Ser Leu Arg Leu Ser Cys Ala Gly Ser Gly Phe Thr Phe Thr
Asp Phe 20 25 30Tyr Met Asn
Trp Ile Arg Gln Pro Pro Gly Lys Ala Pro Glu Trp Leu 35
40 45Gly Phe Ile Arg Asp Lys Ala Lys Gly Tyr Thr
Thr Glu Tyr Asn Pro 50 55 60Ser Val
Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr65
70 75 80Leu Tyr Leu Gln Met Asn Ser
Leu Arg Ala Glu Asp Thr Ala Val Tyr 85 90
95Tyr Cys Ala Arg Glu Gly His Thr Ala Ala Pro Phe Asp
Tyr Trp Gly 100 105 110Gln Gly
Thr Leu Val Thr Val Ser Ser 115
1208107PRTArtificialMR 8Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser
Ala Ser Val Gly1 5 10
15Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Asn Ile Asp Lys Tyr
20 25 30Leu Asn Trp Tyr Gln Gln Lys
Pro Gly Lys Ala Pro Lys Ser Leu Ile 35 40
45Tyr Asn Thr Asn Asn Leu Gln Ser Gly Val Pro Ser Arg Phe Ser
Gly 50 55 60Ser Gly Ser Gly Thr Asp
Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65 70
75 80Glu Asp Ile Ala Thr Tyr Tyr Cys Leu Gln His
Ile Ser Arg Pro Arg 85 90
95Thr Phe Gly Thr Gly Thr Lys Leu Glu Leu Lys 100
1059107PRTARTIFICIALMR 9Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu
Ser Ala Ser Val Gly1 5 10
15Asp Arg Val Thr Ile Thr Cys Lys Ala Ser Gln Asn Ile Asp Lys Tyr
20 25 30Leu Asn Trp Tyr Gln Gln Lys
Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40
45Tyr Asn Thr Asn Asn Leu Gln Thr Gly Val Pro Ser Arg Phe Ser
Gly 50 55 60Ser Gly Ser Gly Thr Asp
Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65 70
75 80Glu Asp Ile Ala Thr Tyr Tyr Cys Leu Gln His
Ile Ser Arg Pro Arg 85 90
95Thr Phe Gly Thr Gly Thr Lys Leu Glu Leu Lys 100
10510107PRTARTIFICIALMR 10Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu
Ser Ala Ser Val Gly1 5 10
15Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Asn Ile Asp Lys Tyr
20 25 30Leu Asn Trp Tyr Gln Gln Lys
Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40
45Tyr Asn Thr Asn Asn Leu Gln Ser Gly Val Pro Ser Arg Phe Ser
Gly 50 55 60Ser Gly Ser Gly Thr Asp
Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65 70
75 80Glu Asp Ile Ala Thr Tyr Tyr Cys Leu Gln His
Ile Ser Arg Pro Arg 85 90
95Thr Phe Gly Thr Gly Thr Lys Leu Glu Leu Lys 100
10511107PRTARTIFICIALMR 11Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu
Ser Ala Ser Val Gly1 5 10
15Asp Arg Val Thr Ile Thr Cys Lys Ala Ser Gln Asn Ile Asp Lys Tyr
20 25 30Leu Asn Trp Tyr Gln Gln Lys
Pro Gly Lys Ala Pro Lys Ser Leu Ile 35 40
45Tyr Asn Thr Asn Asn Leu Gln Thr Gly Val Pro Ser Arg Phe Ser
Gly 50 55 60Ser Gly Ser Gly Thr Asp
Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65 70
75 80Glu Asp Ile Ala Thr Tyr Tyr Cys Leu Gln His
Ile Ser Arg Pro Arg 85 90
95Thr Phe Gly Thr Gly Thr Lys Leu Glu Leu Lys 100
10512107PRTARTIFICIALMR 12Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu
Ser Ala Ser Val Gly1 5 10
15Asp Arg Val Thr Ile Thr Cys Lys Ala Ser Gln Asn Ile Asp Lys Tyr
20 25 30Leu Asn Trp Tyr Gln Gln Lys
Pro Gly Lys Ser Pro Lys Leu Leu Ile 35 40
45Tyr Asn Thr Asn Asn Leu Gln Thr Gly Val Pro Ser Arg Phe Ser
Gly 50 55 60Ser Gly Ser Gly Thr Asp
Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65 70
75 80Glu Asp Ile Ala Thr Tyr Tyr Cys Leu Gln His
Ile Ser Arg Pro Arg 85 90
95Thr Phe Gly Thr Gly Thr Lys Leu Glu Leu Lys 100
10513121PRTARTIFICIALMR 13Glu Val Gln Leu Gln Glu Ser Gly Gly Gly Leu
Val Gln Pro Gly Gly1 5 10
15Ser Leu Arg Leu Ser Cys Ala Gly Ser Gly Phe Thr Phe Thr Asp Phe
20 25 30Tyr Met Asn Trp Ile Arg Gln
Pro Pro Gly Lys Ala Pro Glu Trp Ile 35 40
45Gly Phe Ile Arg Asp Lys Ala Lys Gly Tyr Thr Thr Glu Tyr Asn
Pro 50 55 60Ser Val Lys Gly Arg Phe
Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr65 70
75 80Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu
Asp Thr Ala Val Tyr 85 90
95Tyr Cys Ala Arg Glu Gly His Thr Ala Ala Pro Phe Asp Tyr Trp Gly
100 105 110Gln Gly Thr Leu Val Thr
Val Ser Ser 115 12014121PRTARTIFICIALMR 14Glu Val
Gln Leu Gln Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly1 5
10 15Ser Leu Arg Leu Ser Cys Ala Gly
Ser Gly Phe Thr Phe Thr Asp Phe 20 25
30Tyr Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp
Val 35 40 45Gly Phe Ile Arg Asp
Lys Ala Lys Gly Tyr Thr Thr Glu Tyr Asn Pro 50 55
60Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Lys
Asn Ser65 70 75 80Leu
Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr
85 90 95Tyr Cys Ala Arg Glu Gly His
Thr Ala Ala Pro Phe Asp Tyr Trp Gly 100 105
110Gln Gly Thr Leu Val Thr Val Ser Ser 115
12015121PRTARTIFICIALMR 15Glu Val Gln Leu Gln Glu Ser Gly Gly Gly
Leu Val Gln Pro Gly Gly1 5 10
15Ser Leu Arg Leu Ser Cys Ala Gly Ser Gly Phe Thr Phe Thr Asp Phe
20 25 30Tyr Met Asn Trp Ile Arg
Gln Pro Pro Gly Lys Ala Pro Glu Trp Leu 35 40
45Gly Phe Ile Arg Asp Lys Ala Lys Gly Tyr Thr Thr Glu Tyr
Asn Pro 50 55 60Ser Val Lys Gly Arg
Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr65 70
75 80Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala
Glu Asp Thr Ala Val Tyr 85 90
95Tyr Cys Ala Arg Glu Gly His Thr Ala Ala Pro Phe Asp Tyr Trp Gly
100 105 110Gln Gly Thr Leu Val
Thr Val Ser Ser 115 12016121PRTARTIFICIALMR 16Glu
Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly1
5 10 15Ser Leu Arg Leu Ser Cys Ala
Gly Ser Gly Phe Thr Phe Thr Asp Phe 20 25
30Tyr Met Asn Trp Val Arg Gln Pro Pro Gly Lys Ala Pro Glu
Trp Ile 35 40 45Gly Phe Ile Arg
Asp Lys Ala Lys Gly Tyr Thr Thr Glu Tyr Asn Pro 50 55
60Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser
Lys Asn Thr65 70 75
80Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr
85 90 95Tyr Cys Ala Arg Glu Gly
His Thr Ala Ala Pro Phe Asp Tyr Trp Gly 100
105 110Gln Gly Thr Leu Val Thr Val Ser Ser 115
12017121PRTARTIFICIALMR 17Glu Val Lys Leu Gln Glu Ser Gly Gly
Gly Leu Val Gln Pro Gly Gly1 5 10
15Ser Met Arg Ile Ser Cys Ser Gly Ser Gly Phe Thr Phe Thr Asp
Phe 20 25 30Tyr Met Asn Trp
Val Arg Gln Pro Pro Gly Lys Gly Pro Glu Trp Ile 35
40 45Gly Phe Ile Arg Asp Lys Ala Lys Gly Tyr Thr Thr
Glu Tyr Asn Pro 50 55 60Ser Val Lys
Gly Arg Phe Thr Ile Ser Arg Asp Asn Thr Gln Asn Thr65 70
75 80Leu His Leu Gln Ala Asn Thr Leu
Arg Ala Glu Asp Thr Ala Val Tyr 85 90
95Tyr Cys Ala Arg Glu Gly His Thr Ala Ala Pro Phe Asp Tyr
Trp Gly 100 105 110Gln Gly Thr
Thr Val Thr Val Ser Ser 115
12018121PRTARTIFICIALMR 18Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val
Gln Pro Gly Gly1 5 10
15Ser Leu Arg Leu Ser Cys Ala Gly Ser Gly Phe Thr Phe Thr Asp Phe
20 25 30Tyr Met Asn Trp Val Arg Gln
Pro Pro Gly Lys Ala Pro Glu Trp Leu 35 40
45Gly Phe Ile Arg Asp Lys Ala Lys Gly Tyr Thr Thr Glu Tyr Asn
Pro 50 55 60Ser Val Lys Gly Arg Phe
Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr65 70
75 80Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu
Asp Thr Ala Val Tyr 85 90
95Tyr Cys Ala Arg Glu Gly His Thr Ala Ala Pro Phe Asp Tyr Trp Gly
100 105 110Gln Gly Thr Leu Val Thr
Val Ser Ser 115 12019121PRTARTIFICIALMR 19Glu Val
Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly1 5
10 15Ser Leu Arg Leu Ser Cys Ser Gly
Ser Gly Phe Thr Phe Thr Asp Phe 20 25
30Tyr Met Asn Trp Ile Arg Gln Pro Pro Gly Lys Ala Pro Glu Trp
Ile 35 40 45Gly Phe Ile Arg Asp
Lys Ala Lys Gly Tyr Thr Thr Glu Tyr Asn Pro 50 55
60Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys
Asn Thr65 70 75 80Leu
Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr
85 90 95Tyr Cys Ala Arg Glu Gly His
Thr Ala Ala Pro Phe Asp Tyr Trp Gly 100 105
110Gln Gly Thr Leu Val Thr Val Ser Ser 115
12020121PRTARTIFICIALMR 20Glu Val Gln Leu Leu Glu Ser Gly Gly Gly
Leu Val Gln Pro Gly Gly1 5 10
15Ser Leu Arg Leu Ser Cys Ser Gly Ser Gly Phe Thr Phe Thr Asp Phe
20 25 30Tyr Met Asn Trp Val Arg
Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40
45Gly Phe Ile Arg Asp Lys Ala Lys Gly Tyr Thr Thr Glu Tyr
Asn Pro 50 55 60Ser Val Lys Gly Arg
Phe Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser65 70
75 80Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala
Glu Asp Thr Ala Val Tyr 85 90
95Tyr Cys Ala Arg Glu Gly His Thr Ala Ala Pro Phe Asp Tyr Trp Gly
100 105 110Gln Gly Thr Leu Val
Thr Val Ser Ser 115 12021121PRTARTIFICIALMR 21Glu
Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly1
5 10 15Ser Leu Arg Leu Ser Cys Ser
Gly Ser Gly Phe Thr Phe Thr Asp Phe 20 25
30Tyr Met Asn Trp Ile Arg Gln Pro Pro Gly Lys Ala Pro Glu
Trp Leu 35 40 45Gly Phe Ile Arg
Asp Lys Ala Lys Gly Tyr Thr Thr Glu Tyr Asn Pro 50 55
60Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser
Lys Asn Thr65 70 75
80Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr
85 90 95Tyr Cys Ala Arg Glu Gly
His Thr Ala Ala Pro Phe Asp Tyr Trp Gly 100
105 110Gln Gly Thr Leu Val Thr Val Ser Ser 115
12022121PRTARTIFICIALMR 22Glu Val Gln Leu Leu Glu Ser Gly Gly
Gly Leu Val Gln Pro Gly Gly1 5 10
15Ser Leu Arg Leu Ser Cys Ala Gly Ser Gly Phe Thr Phe Thr Asp
Phe 20 25 30Tyr Met Asn Trp
Ile Arg Gln Ala Pro Gly Lys Ala Pro Glu Trp Ile 35
40 45Gly Phe Ile Arg Asp Lys Ala Lys Gly Tyr Thr Thr
Glu Tyr Asn Pro 50 55 60Ser Val Lys
Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr65 70
75 80Leu Tyr Leu Gln Met Asn Ser Leu
Arg Ala Glu Asp Thr Ala Val Tyr 85 90
95Tyr Cys Ala Arg Glu Gly His Thr Ala Ala Pro Phe Asp Tyr
Trp Gly 100 105 110Gln Gly Thr
Leu Val Thr Val Ser Ser 115
12023121PRTARTIFICIALMR 23Glu Val Lys Leu Gln Glu Ser Gly Gly Gly Leu Val
Gln Pro Gly Gly1 5 10
15Ser Met Arg Ile Ser Cys Ser Gly Ser Gly Phe Thr Phe Thr Asp Phe
20 25 30Tyr Met Asn Trp Ile Arg Gln
Ala Pro Gly Lys Gly Pro Glu Trp Ile 35 40
45Gly Phe Ile Arg Asp Lys Ala Lys Gly Tyr Thr Thr Glu Tyr Asn
Pro 50 55 60Ser Val Lys Gly Arg Phe
Thr Ile Ser Arg Asp Asn Thr Gln Asn Thr65 70
75 80Leu His Leu Gln Ala Asn Thr Leu Arg Ala Glu
Asp Thr Ala Val Tyr 85 90
95Tyr Cys Ala Arg Glu Gly His Thr Ala Ala Pro Phe Asp Tyr Trp Gly
100 105 110Gln Gly Thr Thr Val Thr
Val Ser Ser 115 12024121PRTARTIFICIALMR 24Glu Val
Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly1 5
10 15Ser Leu Arg Leu Ser Cys Ala Gly
Ser Gly Phe Thr Phe Thr Asp Phe 20 25
30Tyr Met Asn Trp Ile Arg Gln Ala Pro Gly Lys Ala Pro Glu Trp
Leu 35 40 45Gly Phe Ile Arg Asp
Lys Ala Lys Gly Tyr Thr Thr Glu Tyr Asn Pro 50 55
60Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys
Asn Thr65 70 75 80Leu
Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr
85 90 95Tyr Cys Ala Arg Glu Gly His
Thr Ala Ala Pro Phe Asp Tyr Trp Gly 100 105
110Gln Gly Thr Leu Val Thr Val Ser Ser 115
12025121PRTARTIFICIALMR 25Glu Val Gln Leu Leu Glu Ser Gly Gly Gly
Leu Val Gln Pro Gly Gly1 5 10
15Ser Leu Arg Leu Ser Cys Ala Gly Ser Gly Phe Thr Phe Thr Asp Phe
20 25 30Tyr Met Asn Trp Ile Arg
Gln Pro Pro Gly Lys Ala Pro Glu Trp Ile 35 40
45Gly Phe Ile Arg Asp Lys Ala Lys Gly Tyr Thr Thr Glu Tyr
Asn Pro 50 55 60Ser Val Lys Gly Arg
Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr65 70
75 80Leu Tyr Leu Gln Ala Asn Ser Leu Arg Ala
Glu Asp Thr Ala Val Tyr 85 90
95Tyr Cys Ala Arg Glu Gly His Thr Ala Ala Pro Phe Asp Tyr Trp Gly
100 105 110Gln Gly Thr Leu Val
Thr Val Ser Ser 115 12026121PRTARTIFICIALMR 26Glu
Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly1
5 10 15Ser Leu Arg Leu Ser Cys Ala
Gly Ser Gly Phe Thr Phe Thr Asp Phe 20 25
30Tyr Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu
Trp Val 35 40 45Gly Phe Ile Arg
Asp Lys Ala Lys Gly Tyr Thr Thr Glu Tyr Asn Pro 50 55
60Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala
Lys Asn Ser65 70 75
80Leu Tyr Leu Gln Ala Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr
85 90 95Tyr Cys Ala Arg Glu Gly
His Thr Ala Ala Pro Phe Asp Tyr Trp Gly 100
105 110Gln Gly Thr Leu Val Thr Val Ser Ser 115
12027121PRTARTIFICIALMR 27Glu Val Gln Leu Leu Glu Ser Gly Gly
Gly Leu Val Gln Pro Gly Gly1 5 10
15Ser Leu Arg Leu Ser Cys Ala Gly Ser Gly Phe Thr Phe Thr Asp
Phe 20 25 30Tyr Met Asn Trp
Ile Arg Gln Pro Pro Gly Lys Ala Pro Glu Trp Leu 35
40 45Gly Phe Ile Arg Asp Lys Ala Lys Gly Tyr Thr Thr
Glu Tyr Asn Pro 50 55 60Ser Val Lys
Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr65 70
75 80Leu Tyr Leu Gln Ala Asn Ser Leu
Arg Ala Glu Asp Thr Ala Val Tyr 85 90
95Tyr Cys Ala Arg Glu Gly His Thr Ala Ala Pro Phe Asp Tyr
Trp Gly 100 105 110Gln Gly Thr
Leu Val Thr Val Ser Ser 115
12028121PRTARTIFICIALMR 28Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val
Gln Pro Gly Gly1 5 10
15Ser Leu Arg Leu Ser Cys Ala Gly Ser Gly Phe Thr Phe Thr Asp Phe
20 25 30Tyr Met Asn Trp Ile Arg Gln
Pro Pro Gly Lys Ala Pro Glu Trp Ile 35 40
45Gly Phe Ile Arg Asp Lys Ala Lys Gly Tyr Thr Thr Glu Tyr Asn
Pro 50 55 60Ser Val Lys Gly Arg Phe
Thr Ile Ser Arg Asp Asn Ser Gln Asn Thr65 70
75 80Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu
Asp Thr Ala Val Tyr 85 90
95Tyr Cys Ala Arg Glu Gly His Thr Ala Ala Pro Phe Asp Tyr Trp Gly
100 105 110Gln Gly Thr Leu Val Thr
Val Ser Ser 115 12029121PRTARTIFICIALMR 29Glu Val
Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly1 5
10 15Ser Leu Arg Leu Ser Cys Ala Gly
Ser Gly Phe Thr Phe Thr Asp Phe 20 25
30Tyr Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp
Val 35 40 45Gly Phe Ile Arg Asp
Lys Ala Lys Gly Tyr Thr Thr Glu Tyr Asn Pro 50 55
60Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala Gln
Asn Ser65 70 75 80Leu
Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr
85 90 95Tyr Cys Ala Arg Glu Gly His
Thr Ala Ala Pro Phe Asp Tyr Trp Gly 100 105
110Gln Gly Thr Leu Val Thr Val Ser Ser 115
12030121PRTARTIFICIALMR 30Glu Val Gln Leu Leu Glu Ser Gly Gly Gly
Leu Val Gln Pro Gly Gly1 5 10
15Ser Leu Arg Leu Ser Cys Ala Gly Ser Gly Phe Thr Phe Thr Asp Phe
20 25 30Tyr Met Asn Trp Ile Arg
Gln Pro Pro Gly Lys Ala Pro Glu Trp Leu 35 40
45Gly Phe Ile Arg Asp Lys Ala Lys Gly Tyr Thr Thr Glu Tyr
Asn Pro 50 55 60Ser Val Lys Gly Arg
Phe Thr Ile Ser Arg Asp Asn Ser Gln Asn Thr65 70
75 80Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala
Glu Asp Thr Ala Val Tyr 85 90
95Tyr Cys Ala Arg Glu Gly His Thr Ala Ala Pro Phe Asp Tyr Trp Gly
100 105 110Gln Gly Thr Leu Val
Thr Val Ser Ser 115 12031121PRTARTIFICIALMR 31Glu
Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly1
5 10 15Ser Leu Arg Leu Ser Cys Ala
Gly Ser Gly Phe Thr Phe Thr Asp Phe 20 25
30Tyr Met Asn Trp Ile Arg Gln Pro Pro Gly Lys Ala Pro Glu
Trp Ile 35 40 45Gly Phe Ile Arg
Asp Lys Ala Lys Gly Tyr Thr Thr Glu Tyr Asn Pro 50 55
60Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Thr
Lys Asn Thr65 70 75
80Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr
85 90 95Tyr Cys Ala Arg Glu Gly
His Thr Ala Ala Pro Phe Asp Tyr Trp Gly 100
105 110Gln Gly Thr Leu Val Thr Val Ser Ser 115
12032121PRTARTIFICIALMR 32Glu Val Gln Leu Leu Glu Ser Gly Gly
Gly Leu Val Gln Pro Gly Gly1 5 10
15Ser Leu Arg Leu Ser Cys Ala Gly Ser Gly Phe Thr Phe Thr Asp
Phe 20 25 30Tyr Met Asn Trp
Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val 35
40 45Gly Phe Ile Arg Asp Lys Ala Lys Gly Tyr Thr Thr
Glu Tyr Asn Pro 50 55 60Ser Val Lys
Gly Arg Phe Thr Ile Ser Arg Asp Asn Thr Lys Asn Ser65 70
75 80Leu Tyr Leu Gln Met Asn Ser Leu
Arg Ala Glu Asp Thr Ala Val Tyr 85 90
95Tyr Cys Ala Arg Glu Gly His Thr Ala Ala Pro Phe Asp Tyr
Trp Gly 100 105 110Gln Gly Thr
Leu Val Thr Val Ser Ser 115
12033121PRTARTIFICIALMR 33Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val
Gln Pro Gly Gly1 5 10
15Ser Leu Arg Leu Ser Cys Ala Gly Ser Gly Phe Thr Phe Thr Asp Phe
20 25 30Tyr Met Asn Trp Ile Arg Gln
Pro Pro Gly Lys Ala Pro Glu Trp Leu 35 40
45Gly Phe Ile Arg Asp Lys Ala Lys Gly Tyr Thr Thr Glu Tyr Asn
Pro 50 55 60Ser Val Lys Gly Arg Phe
Thr Ile Ser Arg Asp Asn Thr Lys Asn Thr65 70
75 80Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu
Asp Thr Ala Val Tyr 85 90
95Tyr Cys Ala Arg Glu Gly His Thr Ala Ala Pro Phe Asp Tyr Trp Gly
100 105 110Gln Gly Thr Leu Val Thr
Val Ser Ser 115 12034121PRTARTIFICIALMR 34Glu Val
Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly1 5
10 15Ser Met Arg Leu Ser Cys Ala Gly
Ser Gly Phe Thr Phe Thr Asp Phe 20 25
30Tyr Met Asn Trp Ile Arg Gln Pro Pro Gly Lys Ala Pro Glu Trp
Leu 35 40 45Gly Phe Ile Arg Asp
Lys Ala Lys Gly Tyr Thr Thr Glu Tyr Asn Pro 50 55
60Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys
Asn Thr65 70 75 80Leu
Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr
85 90 95Tyr Cys Ala Arg Glu Gly His
Thr Ala Ala Pro Phe Asp Tyr Trp Gly 100 105
110Gln Gly Thr Leu Val Thr Val Ser Ser 115
12035121PRTARTIFICIALMR 35Glu Val Lys Leu Gln Glu Ser Gly Gly Gly
Leu Val Gln Pro Gly Gly1 5 10
15Ser Met Arg Ile Ser Cys Ser Gly Ser Gly Phe Thr Phe Thr Asp Phe
20 25 30Tyr Met Asn Trp Ile Arg
Gln Pro Pro Gly Lys Gly Pro Glu Trp Leu 35 40
45Gly Phe Ile Arg Asp Lys Ala Lys Gly Tyr Thr Thr Glu Tyr
Asn Pro 50 55 60Ser Val Lys Gly Arg
Phe Thr Ile Ser Arg Asp Asn Thr Gln Asn Thr65 70
75 80Leu His Leu Gln Ala Asn Thr Leu Arg Ala
Glu Asp Thr Ala Val Tyr 85 90
95Tyr Cys Ala Arg Glu Gly His Thr Ala Ala Pro Phe Asp Tyr Trp Gly
100 105 110Gln Gly Thr Thr Val
Thr Val Ser Ser 115 12036121PRTARTIFICIALMR 36Glu
Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly1
5 10 15Ser Leu Arg Leu Ser Cys Ala
Gly Ser Gly Phe Thr Phe Thr Asp Phe 20 25
30Tyr Met Asn Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu
Trp Leu 35 40 45Gly Phe Ile Arg
Asp Lys Ala Lys Gly Tyr Thr Thr Glu Tyr Asn Pro 50 55
60Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ala
Lys Asn Ser65 70 75
80Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr
85 90 95Tyr Cys Ala Arg Glu Gly
His Thr Ala Ala Pro Phe Asp Tyr Trp Gly 100
105 110Gln Gly Thr Leu Val Thr Val Ser Ser 115
12037121PRTARTIFICIALMR 37Glu Val Gln Leu Leu Glu Ser Gly Gly
Gly Leu Val Gln Pro Gly Gly1 5 10
15Ser Leu Arg Leu Ser Cys Ala Gly Ser Gly Phe Thr Phe Thr Asp
Phe 20 25 30Tyr Met Asn Trp
Ile Arg Gln Pro Pro Gly Lys Ala Pro Glu Trp Ile 35
40 45Gly Phe Ile Arg Asp Lys Ala Lys Gly Tyr Thr Thr
Glu Tyr Asn Pro 50 55 60Ser Val Lys
Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr65 70
75 80Leu Tyr Leu Gln Met Asn Ser Leu
Arg Ala Glu Asp Thr Ala Val Tyr 85 90
95Tyr Cys Ala Arg Glu Gly His Thr Ala Ala Pro Phe Asp Tyr
Trp Gly 100 105 110Gln Gly Thr
Thr Val Thr Val Ser Ser 115
12038121PRTARTIFICIALMR 38Glu Val Gln Leu Leu Glu Ser Gly Gly Gly Leu Val
Gln Pro Gly Gly1 5 10
15Ser Leu Arg Leu Ser Cys Ala Gly Ser Gly Phe Thr Phe Thr Asp Phe
20 25 30Tyr Met Asn Trp Val Arg Gln
Ala Pro Gly Lys Gly Leu Glu Trp Val 35 40
45Gly Phe Ile Arg Asp Lys Ala Lys Gly Tyr Thr Thr Glu Tyr Asn
Pro 50 55 60Ser Val Lys Gly Arg Phe
Thr Ile Ser Arg Asp Asn Ala Lys Asn Ser65 70
75 80Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu
Asp Thr Ala Val Tyr 85 90
95Tyr Cys Ala Arg Glu Gly His Thr Ala Ala Pro Phe Asp Tyr Trp Gly
100 105 110Gln Gly Thr Thr Val Thr
Val Ser Ser 115 12039121PRTARTIFICIALMR 39Glu Val
Gln Leu Leu Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly1 5
10 15Ser Leu Arg Leu Ser Cys Ala Gly
Ser Gly Phe Thr Phe Thr Asp Phe 20 25
30Tyr Met Asn Trp Ile Arg Gln Pro Pro Gly Lys Ala Pro Glu Trp
Leu 35 40 45Gly Phe Ile Arg Asp
Lys Ala Lys Gly Tyr Thr Thr Glu Tyr Asn Pro 50 55
60Ser Val Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys
Asn Thr65 70 75 80Leu
Tyr Leu Gln Met Asn Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr
85 90 95Tyr Cys Ala Arg Glu Gly His
Thr Ala Ala Pro Phe Asp Tyr Trp Gly 100 105
110Gln Gly Thr Thr Val Thr Val Ser Ser 115
12040121PRTARTIFICIALMR 40Glu Val Gln Leu Leu Glu Ser Gly Gly Gly
Leu Val Gln Pro Gly Gly1 5 10
15Ser Leu Arg Leu Ser Cys Ala Gly Ser Gly Phe Thr Phe Thr Asp Phe
20 25 30Tyr Met Asn Trp Ile Arg
Gln Pro Pro Gly Lys Ala Pro Glu Trp Leu 35 40
45Gly Phe Ile Arg Asp Lys Ala Lys Gly Tyr Thr Thr Glu Tyr
Asn Pro 50 55 60Ser Val Lys Gly Arg
Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr65 70
75 80Leu Tyr Leu Gln Met Asn Ser Leu Arg Ala
Glu Asp Thr Ala Thr Tyr 85 90
95Tyr Cys Ala Arg Glu Gly His Thr Ala Ala Pro Phe Asp Tyr Trp Gly
100 105 110Gln Gly Thr Thr Val
Thr Val Ser Ser 115 12041107PRTARTIFICIALMR 41Asp
Ile Gln Met Thr Gln Ser Pro Ser Ala Leu Ser Ala Ser Val Gly1
5 10 15Asp Arg Val Thr Pro Thr Cys
Arg Ala Ser Gln Asn Ile Asp Lys Tyr 20 25
30Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Ser
Leu Ile 35 40 45Tyr Asn Thr Asn
Asn Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly 50 55
60Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser
Leu Gln Pro65 70 75
80Glu Asp Ile Ala Thr Tyr Tyr Cys Leu Gln His Ile Ser Arg Pro Arg
85 90 95Thr Phe Gly Thr Gly Thr
Lys Leu Glu Leu Lys 100
10542107PRTARTIFICIALMR 42Asp Ile Gln Met Thr Gln Ser Pro Ser Ala Leu Ser
Ala Ser Val Gly1 5 10
15Asp Arg Val Thr Pro Thr Cys Lys Ala Ser Gln Asn Ile Asp Lys Tyr
20 25 30Leu Asn Trp Tyr Gln Gln Lys
Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40
45Tyr Asn Thr Asn Asn Leu Gln Thr Gly Val Pro Ser Arg Phe Ser
Gly 50 55 60Ser Gly Ser Gly Thr Asp
Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65 70
75 80Glu Asp Ile Ala Thr Tyr Tyr Cys Leu Gln His
Ile Ser Arg Pro Arg 85 90
95Thr Phe Gly Thr Gly Thr Lys Leu Glu Leu Lys 100
10543107PRTARTIFICIALMR 43Asp Ile Gln Met Thr Gln Ser Pro Ser Ala Leu
Ser Ala Ser Val Gly1 5 10
15Asp Arg Val Thr Pro Thr Cys Arg Ala Ser Gln Asn Ile Asp Lys Tyr
20 25 30Leu Asn Trp Tyr Gln Gln Lys
Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40
45Tyr Asn Thr Asn Asn Leu Gln Ser Gly Val Pro Ser Arg Phe Ser
Gly 50 55 60Ser Gly Ser Gly Thr Asp
Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65 70
75 80Glu Asp Ile Ala Thr Tyr Tyr Cys Leu Gln His
Ile Ser Arg Pro Arg 85 90
95Thr Phe Gly Thr Gly Thr Lys Leu Glu Leu Lys 100
10544107PRTARTIFICIALMR 44Asp Ile Gln Met Thr Gln Ser Pro Ser Ala Leu
Ser Ala Ser Val Gly1 5 10
15Asp Arg Val Thr Pro Thr Cys Lys Ala Ser Gln Asn Ile Asp Lys Tyr
20 25 30Leu Asn Trp Tyr Gln Gln Lys
Pro Gly Lys Ala Pro Lys Ser Leu Ile 35 40
45Tyr Asn Thr Asn Asn Leu Gln Thr Gly Val Pro Ser Arg Phe Ser
Gly 50 55 60Ser Gly Ser Gly Thr Asp
Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65 70
75 80Glu Asp Ile Ala Thr Tyr Tyr Cys Leu Gln His
Ile Ser Arg Pro Arg 85 90
95Thr Phe Gly Thr Gly Thr Lys Leu Glu Leu Lys 100
10545107PRTARTIFICIALMR 45Asp Ile Gln Met Thr Gln Ser Pro Ser Ala Leu
Ser Ala Ser Val Gly1 5 10
15Asp Arg Val Thr Pro Thr Cys Lys Ala Ser Gln Asn Ile Asp Lys Tyr
20 25 30Leu Asn Trp Tyr Gln Gln Lys
Pro Gly Lys Ser Pro Lys Leu Leu Ile 35 40
45Tyr Asn Thr Asn Asn Leu Gln Thr Gly Val Pro Ser Arg Phe Ser
Gly 50 55 60Ser Gly Ser Gly Thr Asp
Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65 70
75 80Glu Asp Ile Ala Thr Tyr Tyr Cys Leu Gln His
Ile Ser Arg Pro Arg 85 90
95Thr Phe Gly Thr Gly Thr Lys Leu Glu Leu Lys 100
10546107PRTARTIFICIALMR 46Asp Ile Gln Met Thr Gln Ser Pro Ser Ala Leu
Ser Ala Ser Val Gly1 5 10
15Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Asn Ile Asp Lys Tyr
20 25 30Leu Asn Trp Tyr Gln Gln Lys
Pro Gly Lys Ala Pro Lys Ser Leu Ile 35 40
45Tyr Asn Thr Asn Asn Leu Gln Ser Gly Val Pro Ser Arg Phe Ser
Gly 50 55 60Ser Gly Ser Gly Thr Asp
Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65 70
75 80Glu Asp Ile Ala Thr Tyr Tyr Cys Leu Gln His
Ile Ser Arg Pro Arg 85 90
95Thr Phe Gly Thr Gly Thr Lys Leu Glu Leu Lys 100
10547107PRTARTIFICIALMR 47Asp Ile Gln Met Thr Gln Ser Pro Ser Ala Leu
Ser Ala Ser Val Gly1 5 10
15Asp Arg Val Thr Ile Thr Cys Lys Ala Ser Gln Asn Ile Asp Lys Tyr
20 25 30Leu Asn Trp Tyr Gln Gln Lys
Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40
45Tyr Asn Thr Asn Asn Leu Gln Thr Gly Val Pro Ser Arg Phe Ser
Gly 50 55 60Ser Gly Ser Gly Thr Asp
Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65 70
75 80Glu Asp Ile Ala Thr Tyr Tyr Cys Leu Gln His
Ile Ser Arg Pro Arg 85 90
95Thr Phe Gly Thr Gly Thr Lys Leu Glu Leu Lys 100
10548107PRTARTIFICIALMR 48Asp Ile Gln Met Thr Gln Ser Pro Ser Ala Leu
Ser Ala Ser Val Gly1 5 10
15Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Asn Ile Asp Lys Tyr
20 25 30Leu Asn Trp Tyr Gln Gln Lys
Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40
45Tyr Asn Thr Asn Asn Leu Gln Ser Gly Val Pro Ser Arg Phe Ser
Gly 50 55 60Ser Gly Ser Gly Thr Asp
Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65 70
75 80Glu Asp Ile Ala Thr Tyr Tyr Cys Leu Gln His
Ile Ser Arg Pro Arg 85 90
95Thr Phe Gly Thr Gly Thr Lys Leu Glu Leu Lys 100
10549107PRTARTIFICIALMR 49Asp Ile Gln Met Thr Gln Ser Pro Ser Ala Leu
Ser Ala Ser Val Gly1 5 10
15Asp Arg Val Thr Ile Thr Cys Lys Ala Ser Gln Asn Ile Asp Lys Tyr
20 25 30Leu Asn Trp Tyr Gln Gln Lys
Pro Gly Lys Ala Pro Lys Ser Leu Ile 35 40
45Tyr Asn Thr Asn Asn Leu Gln Thr Gly Val Pro Ser Arg Phe Ser
Gly 50 55 60Ser Gly Ser Gly Thr Asp
Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65 70
75 80Glu Asp Ile Ala Thr Tyr Tyr Cys Leu Gln His
Ile Ser Arg Pro Arg 85 90
95Thr Phe Gly Thr Gly Thr Lys Leu Glu Leu Lys 100
10550107PRTARTIFICIALMR 50Asp Ile Gln Met Thr Gln Ser Pro Ser Ala Leu
Ser Ala Ser Val Gly1 5 10
15Asp Arg Val Thr Ile Thr Cys Lys Ala Ser Gln Asn Ile Asp Lys Tyr
20 25 30Leu Asn Trp Tyr Gln Gln Lys
Pro Gly Lys Ser Pro Lys Leu Leu Ile 35 40
45Tyr Asn Thr Asn Asn Leu Gln Thr Gly Val Pro Ser Arg Phe Ser
Gly 50 55 60Ser Gly Ser Gly Thr Asp
Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65 70
75 80Glu Asp Ile Ala Thr Tyr Tyr Cys Leu Gln His
Ile Ser Arg Pro Arg 85 90
95Thr Phe Gly Thr Gly Thr Lys Leu Glu Leu Lys 100
10551107PRTARTIFICIALMR 51Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu
Ser Ala Ser Val Gly1 5 10
15Asp Arg Val Thr Pro Thr Cys Arg Ala Ser Gln Asn Ile Asp Lys Tyr
20 25 30Leu Asn Trp Tyr Gln Gln Lys
Pro Gly Lys Ala Pro Lys Ser Leu Ile 35 40
45Tyr Asn Thr Asn Asn Leu Gln Ser Gly Val Pro Ser Arg Phe Ser
Gly 50 55 60Ser Gly Ser Gly Thr Asp
Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65 70
75 80Glu Asp Ile Ala Thr Tyr Tyr Cys Leu Gln His
Ile Ser Arg Pro Arg 85 90
95Thr Phe Gly Thr Gly Thr Lys Leu Glu Leu Lys 100
10552107PRTARTIFICIALMR 52Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu
Ser Ala Ser Val Gly1 5 10
15Asp Arg Val Thr Pro Thr Cys Lys Ala Ser Gln Asn Ile Asp Lys Tyr
20 25 30Leu Asn Trp Tyr Gln Gln Lys
Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40
45Tyr Asn Thr Asn Asn Leu Gln Thr Gly Val Pro Ser Arg Phe Ser
Gly 50 55 60Ser Gly Ser Gly Thr Asp
Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65 70
75 80Glu Asp Ile Ala Thr Tyr Tyr Cys Leu Gln His
Ile Ser Arg Pro Arg 85 90
95Thr Phe Gly Thr Gly Thr Lys Leu Glu Leu Lys 100
10553107PRTARTIFICIALMR 53Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu
Ser Ala Ser Val Gly1 5 10
15Asp Arg Val Thr Pro Thr Cys Arg Ala Ser Gln Asn Ile Asp Lys Tyr
20 25 30Leu Asn Trp Tyr Gln Gln Lys
Pro Gly Lys Ala Pro Lys Leu Leu Ile 35 40
45Tyr Asn Thr Asn Asn Leu Gln Ser Gly Val Pro Ser Arg Phe Ser
Gly 50 55 60Ser Gly Ser Gly Thr Asp
Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65 70
75 80Glu Asp Ile Ala Thr Tyr Tyr Cys Leu Gln His
Ile Ser Arg Pro Arg 85 90
95Thr Phe Gly Thr Gly Thr Lys Leu Glu Leu Lys 100
10554107PRTARTIFICIALMutated Recombinant 54Asp Ile Gln Met Thr Gln
Ser Pro Ser Ser Leu Ser Ala Ser Val Gly1 5
10 15Asp Arg Val Thr Pro Thr Cys Lys Ala Ser Gln Asn
Ile Asp Lys Tyr 20 25 30Leu
Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Ser Leu Ile 35
40 45Tyr Asn Thr Asn Asn Leu Gln Thr Gly
Val Pro Ser Arg Phe Ser Gly 50 55
60Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65
70 75 80Glu Asp Ile Ala Thr
Tyr Tyr Cys Leu Gln His Ile Ser Arg Pro Arg 85
90 95Thr Phe Gly Thr Gly Thr Lys Leu Glu Leu Lys
100 10555107PRTARTIFICIALMR 55Asp Ile Gln Met Thr
Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly1 5
10 15Asp Arg Val Thr Pro Thr Cys Lys Ala Ser Gln
Asn Ile Asp Lys Tyr 20 25
30Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ser Pro Lys Leu Leu Ile
35 40 45Tyr Asn Thr Asn Asn Leu Gln Thr
Gly Val Pro Ser Arg Phe Ser Gly 50 55
60Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65
70 75 80Glu Asp Ile Ala Thr
Tyr Tyr Cys Leu Gln His Ile Ser Arg Pro Arg 85
90 95Thr Phe Gly Thr Gly Thr Lys Leu Glu Leu Lys
100 10556107PRTARTIFICIALMR 56Asp Ile Gln Met Thr
Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly1 5
10 15Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln
Asn Ile Asp Lys Tyr 20 25
30Leu Asn Trp Tyr Gln Gln Lys Ser Gly Lys Ala Pro Lys Ser Leu Ile
35 40 45Tyr Asn Thr Asn Asn Leu Gln Ser
Gly Val Pro Ser Arg Phe Ser Gly 50 55
60Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65
70 75 80Glu Asp Ile Ala Thr
Tyr Tyr Cys Leu Gln His Ile Ser Arg Pro Arg 85
90 95Thr Phe Gly Thr Gly Thr Lys Leu Glu Leu Lys
100 10557107PRTSEQ ID 58 57Asp Ile Gln Met Thr
Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly1 5
10 15Asp Arg Val Thr Ile Thr Cys Lys Ala Ser Gln
Asn Ile Asp Lys Tyr 20 25
30Leu Asn Trp Tyr Gln Gln Lys Ser Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45Tyr Asn Thr Asn Asn Leu Gln Thr
Gly Val Pro Ser Arg Phe Ser Gly 50 55
60Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65
70 75 80Glu Asp Ile Ala Thr
Tyr Tyr Cys Leu Gln His Ile Ser Arg Pro Arg 85
90 95Thr Phe Gly Thr Gly Thr Lys Leu Glu Leu Lys
100 10558107PRTARTIFICIALMR 58Asp Ile Gln Met Thr
Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly1 5
10 15Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln
Asn Ile Asp Lys Tyr 20 25
30Leu Asn Trp Tyr Gln Gln Lys Ser Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45Tyr Asn Thr Asn Asn Leu Gln Ser
Gly Val Pro Ser Arg Phe Ser Gly 50 55
60Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65
70 75 80Glu Asp Ile Ala Thr
Tyr Tyr Cys Leu Gln His Ile Ser Arg Pro Arg 85
90 95Thr Phe Gly Thr Gly Thr Lys Leu Glu Leu Lys
100 10559107PRTARTIFICIALMR 59Asp Ile Gln Met Thr
Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly1 5
10 15Asp Arg Val Thr Ile Thr Cys Lys Ala Ser Gln
Asn Ile Asp Lys Tyr 20 25
30Leu Asn Trp Tyr Gln Gln Lys Ser Gly Lys Ala Pro Lys Ser Leu Ile
35 40 45Tyr Asn Thr Asn Asn Leu Gln Thr
Gly Val Pro Ser Arg Phe Ser Gly 50 55
60Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65
70 75 80Glu Asp Ile Ala Thr
Tyr Tyr Cys Leu Gln His Ile Ser Arg Pro Arg 85
90 95Thr Phe Gly Thr Gly Thr Lys Leu Glu Leu Lys
100 10560107PRTARTIFICIALMR 60Asp Ile Gln Met Thr
Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly1 5
10 15Asp Arg Val Thr Ile Thr Cys Lys Ala Ser Gln
Asn Ile Asp Lys Tyr 20 25
30Leu Asn Trp Tyr Gln Gln Lys Ser Gly Lys Ser Pro Lys Leu Leu Ile
35 40 45Tyr Asn Thr Asn Asn Leu Gln Thr
Gly Val Pro Ser Arg Phe Ser Gly 50 55
60Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65
70 75 80Glu Asp Ile Ala Thr
Tyr Tyr Cys Leu Gln His Ile Ser Arg Pro Arg 85
90 95Thr Phe Gly Thr Gly Thr Lys Leu Glu Leu Lys
100 10561107PRTARTIFICIALMR 61Asp Ile Gln Met Thr
Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly1 5
10 15Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln
Asn Ile Asp Lys Tyr 20 25
30Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Ser Leu Ile
35 40 45Tyr Asn Thr Asn Asn Leu Gln Ser
Gly Met Pro Ser Arg Phe Ser Gly 50 55
60Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65
70 75 80Glu Asp Ile Ala Thr
Tyr Tyr Cys Leu Gln His Ile Ser Arg Pro Arg 85
90 95Thr Phe Gly Thr Gly Thr Lys Leu Glu Leu Lys
100 10562107PRTARTIFICIALMR 62Asp Ile Gln Met Thr
Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly1 5
10 15Asp Arg Val Thr Ile Thr Cys Lys Ala Ser Gln
Asn Ile Asp Lys Tyr 20 25
30Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45Tyr Asn Thr Asn Asn Leu Gln Thr
Gly Met Pro Ser Arg Phe Ser Gly 50 55
60Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65
70 75 80Glu Asp Ile Ala Thr
Tyr Tyr Cys Leu Gln His Ile Ser Arg Pro Arg 85
90 95Thr Phe Gly Thr Gly Thr Lys Leu Glu Leu Lys
100 10563107PRTARTIFICIALMR 63Asp Ile Gln Met Thr
Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly1 5
10 15Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln
Asn Ile Asp Lys Tyr 20 25
30Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45Tyr Asn Thr Asn Asn Leu Gln Ser
Gly Met Pro Ser Arg Phe Ser Gly 50 55
60Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65
70 75 80Glu Asp Ile Ala Thr
Tyr Tyr Cys Leu Gln His Ile Ser Arg Pro Arg 85
90 95Thr Phe Gly Thr Gly Thr Lys Leu Glu Leu Lys
100 10564107PRTARTIFICIALMR 64Asp Ile Gln Met Thr
Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly1 5
10 15Asp Arg Val Thr Ile Thr Cys Lys Ala Ser Gln
Asn Ile Asp Lys Tyr 20 25
30Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Ser Leu Ile
35 40 45Tyr Asn Thr Asn Asn Leu Gln Thr
Gly Met Pro Ser Arg Phe Ser Gly 50 55
60Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65
70 75 80Glu Asp Ile Ala Thr
Tyr Tyr Cys Leu Gln His Ile Ser Arg Pro Arg 85
90 95Thr Phe Gly Thr Gly Thr Lys Leu Glu Leu Lys
100 10565107PRTARTIFICIALMR 65Asp Ile Gln Met Thr
Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly1 5
10 15Asp Arg Val Thr Ile Thr Cys Lys Ala Ser Gln
Asn Ile Asp Lys Tyr 20 25
30Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ser Pro Lys Leu Leu Ile
35 40 45Tyr Asn Thr Asn Asn Leu Gln Thr
Gly Met Pro Ser Arg Phe Ser Gly 50 55
60Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65
70 75 80Glu Asp Ile Ala Thr
Tyr Tyr Cys Leu Gln His Ile Ser Arg Pro Arg 85
90 95Thr Phe Gly Thr Gly Thr Lys Leu Glu Leu Lys
100 10566107PRTARTIFICIALMR 66Asp Ile Gln Met Thr
Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly1 5
10 15Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln
Asn Ile Asp Lys Tyr 20 25
30Leu Asn Trp Tyr Gln Gln Lys Ser Gly Lys Ala Pro Lys Ser Leu Ile
35 40 45Tyr Asn Thr Asn Asn Leu Gln Ser
Gly Met Pro Ser Arg Phe Ser Gly 50 55
60Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65
70 75 80Glu Asp Ile Ala Thr
Tyr Tyr Cys Leu Gln His Ile Ser Arg Pro Arg 85
90 95Thr Phe Gly Thr Gly Thr Lys Leu Glu Leu Lys
100 10567107PRTARTIFICIALMR 67Asp Ile Gln Met Thr
Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly1 5
10 15Asp Arg Val Thr Ile Thr Cys Lys Ala Ser Gln
Asn Ile Asp Lys Tyr 20 25
30Leu Asn Trp Tyr Gln Gln Lys Ser Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45Tyr Asn Thr Asn Asn Leu Gln Thr
Gly Met Pro Ser Arg Phe Ser Gly 50 55
60Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65
70 75 80Glu Asp Ile Ala Thr
Tyr Tyr Cys Leu Gln His Ile Ser Arg Pro Arg 85
90 95Thr Phe Gly Thr Gly Thr Lys Leu Glu Leu Lys
100 10568107PRTARTIFICIALMR 68Asp Ile Gln Met Thr
Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly1 5
10 15Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln
Asn Ile Asp Lys Tyr 20 25
30Leu Asn Trp Tyr Gln Gln Lys Ser Gly Lys Ala Pro Lys Leu Leu Ile
35 40 45Tyr Asn Thr Asn Asn Leu Gln Ser
Gly Met Pro Ser Arg Phe Ser Gly 50 55
60Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65
70 75 80Glu Asp Ile Ala Thr
Tyr Tyr Cys Leu Gln His Ile Ser Arg Pro Arg 85
90 95Thr Phe Gly Thr Gly Thr Lys Leu Glu Leu Lys
100 10569107PRTARTIFICIALMR 69Asp Ile Gln Met Thr
Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly1 5
10 15Asp Arg Val Thr Ile Thr Cys Lys Ala Ser Gln
Asn Ile Asp Lys Tyr 20 25
30Leu Asn Trp Tyr Gln Gln Lys Ser Gly Lys Ala Pro Lys Ser Leu Ile
35 40 45Tyr Asn Thr Asn Asn Leu Gln Thr
Gly Met Pro Ser Arg Phe Ser Gly 50 55
60Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65
70 75 80Glu Asp Ile Ala Thr
Tyr Tyr Cys Leu Gln His Ile Ser Arg Pro Arg 85
90 95Thr Phe Gly Thr Gly Thr Lys Leu Glu Leu Lys
100 10570107PRTARTIFICIALMR 70Asp Ile Gln Met Thr
Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly1 5
10 15Asp Arg Val Thr Ile Thr Cys Lys Ala Ser Gln
Asn Ile Asp Lys Tyr 20 25
30Leu Asn Trp Tyr Gln Gln Lys Ser Gly Lys Ser Pro Lys Leu Leu Ile
35 40 45Tyr Asn Thr Asn Asn Leu Gln Thr
Gly Met Pro Ser Arg Phe Ser Gly 50 55
60Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro65
70 75 80Glu Asp Ile Ala Thr
Tyr Tyr Cys Leu Gln His Ile Ser Arg Pro Arg 85
90 95Thr Phe Gly Thr Gly Thr Lys Leu Glu Leu Lys
100 10571363DNAARTIFICIALMR 71gaggtgcaac
tgttggaatc tggaggaggc ttggtacagc cggggggttc tctgagactc 60tcctgtgcag
gttctggatt caccttcact gatttctaca tgaactgggt ccgccaggct 120ccagggaagg
gacttgagtg ggtgggtttt attagagaca aagctaaagg ttacacaaca 180gagtacaatc
catctgtgaa ggggcggttc accatctcca gagataattc caaaaacacc 240ctctatcttc
aaatgaactc cctaagagct gaggacactg ccgtttacta ctgtgcaaga 300gagggccaca
ctgctgctcc ttttgattac tggggccaag gaacactggt caccgtctcc 360tca
36372363DNAARTIFICIALMR 72gaggtgcaac tgttggaatc tggaggaggc ttggtacagc
cggggggttc tctgagactc 60tcctgtgcag gttctggatt caccttcact gatttctaca
tgaactggat tcgccagcct 120cccgggaaag cacctgagtg gattggtttt attagagaca
aagctaaagg ttacacaaca 180gagtacaatc catctgtgaa ggggcggttc accatctcca
gagataattc caaaaacacc 240ctctatcttc aaatgaactc cctaagagct gaggacactg
ccgtttacta ctgtgcaaga 300gagggccaca ctgctgctcc ttttgattac tggggccaag
gaacactggt caccgtctcc 360tca
36373363DNAARTIFICIALMR 73gaggtgaaac tgcaggaatc
tggaggaggc ttggtacagc cggggggttc tatgagaatc 60tcctgttcag gttctggatt
caccttcact gatttctaca tgaactggat tcgccagcct 120cccgggaaag gacctgagtg
gattggtttt attagagaca aagctaaagg ttacacaaca 180gagtacaatc catctgtgaa
ggggcggttc accatctcca gagataatac ccaaaacacc 240ctccatcttc aagctaacac
cctaagagct gaggacactg ccgtttacta ctgtgcaaga 300gagggccaca ctgctgctcc
ttttgattac tggggccaag gaactaccgt caccgtctcc 360tca
36374363DNAARTIFICIALMR
74gaggtgcaac tgttggaatc tggaggaggc ttggtacagc cggggggttc tctgagactc
60tcctgtgcag gttctggatt caccttcact gatttctaca tgaactgggt ccgccaggct
120ccagggaagg gacttgagtg ggtgggtttt attagagaca aagctaaagg ttacacaaca
180gagtacaatc catctgtgaa ggggcggttc accatctcca gagataatgc caaaaactcc
240ctctatcttc aaatgaactc cctaagagct gaggacactg ccgtttacta ctgtgcaaga
300gagggccaca ctgctgctcc ttttgattac tggggccaag gaacactggt caccgtctcc
360tca
36375363DNAARTIFICIALMR 75gaggtgcaac tgttggaatc tggaggaggc ttggtacagc
cggggggttc tctgagactc 60tcctgtgcag gttctggatt caccttcact gatttctaca
tgaactggat tcgccagcct 120cccgggaaag cacctgagtg gctgggtttt attagagaca
aagctaaagg ttacacaaca 180gagtacaatc catctgtgaa ggggcggttc accatctcca
gagataattc caaaaacacc 240ctctatcttc aaatgaactc cctaagagct gaggacactg
ccgtttacta ctgtgcaaga 300gagggccaca ctgctgctcc ttttgattac tggggccaag
gaacactggt caccgtctcc 360tca
36376321DNAARTIFICIALMR 76gacatccaga tgacccagtc
tccctcatcc ctgtctgcat ctgtgggaga cagagtcact 60atcacctgca gagcaagtca
gaatattgac aaatacttaa actggtatca gcaaaagccc 120ggaaaagctc ccaaatccct
gatatataat acaaacaatt tgcaatctgg cgtcccatca 180aggttcagtg gcagtggatc
tggtactgat ttcacactca ccatcagcag cctgcagcct 240gaagatattg ccacatatta
ctgcttgcag catataagta ggccgcgcac gtttggaact 300gggaccaagc tggagctgaa a
32177321DNAARTIFICIALMR
77gacatccaga tgacccagtc tccctcatcc ctgtctgcat ctgtgggaga cagagtcact
60atcacctgca aagcaagtca gaatattgac aaatacttaa actggtatca gcaaaagccc
120ggaaaagctc ccaaactcct gatatataat acaaacaatt tgcaaacggg cgtcccatca
180aggttcagtg gcagtggatc tggtactgat ttcacactca ccatcagcag cctgcagcct
240gaagatattg ccacatatta ctgcttgcag catataagta ggccgcgcac gtttggaact
300gggaccaagc tggagctgaa a
32178321DNAARTIFICIALMR 78gacatccaga tgacccagtc tccctcatcc ctgtctgcat
ctgtgggaga cagagtcact 60atcacctgca gagcaagtca gaatattgac aaatacttaa
actggtatca gcaaaagccc 120ggaaaagctc ccaaactcct gatatataat acaaacaatt
tgcaatctgg cgtcccatca 180aggttcagtg gcagtggatc tggtactgat ttcacactca
ccatcagcag cctgcagcct 240gaagatattg ccacatatta ctgcttgcag catataagta
ggccgcgcac gtttggaact 300gggaccaagc tggagctgaa a
32179321DNAARTIFICIALMR 79gacatccaga tgacccagtc
tccctcatcc ctgtctgcat ctgtgggaga cagagtcact 60atcacctgca aagcaagtca
gaatattgac aaatacttaa actggtatca gcaaaagccc 120ggaaaagctc ccaaatccct
gatatataat acaaacaatt tgcaaacggg cgtcccatca 180aggttcagtg gcagtggatc
tggtactgat ttcacactca ccatcagcag cctgcagcct 240gaagatattg ccacatatta
ctgcttgcag catataagta ggccgcgcac gtttggaact 300gggaccaagc tggagctgaa a
32180321DNAARTIFICIALMR
80gacatccaga tgacccagtc tccctcatcc ctgtctgcat ctgtgggaga cagagtcact
60atcacctgca aagcaagtca gaatattgac aaatacttaa actggtatca gcaaaagccc
120ggaaaatctc ccaaactcct gatatataat acaaacaatt tgcaaacggg cgtcccatca
180aggttcagtg gcagtggatc tggtactgat ttcacactca ccatcagcag cctgcagcct
240gaagatattg ccacatatta ctgcttgcag catataagta ggccgcgcac gtttggaact
300gggaccaagc tggagctgaa a
32181363DNAARTIFICIALMR 81gaggtgcaac tgcaggaatc tggaggaggc ttggtacagc
cggggggttc tctgagactc 60tcctgtgcag gttctggatt caccttcact gatttctaca
tgaactggat tcgccagcct 120cccgggaaag cacctgagtg gattggtttt attagagaca
aagctaaagg ttacacaaca 180gagtacaatc catctgtgaa ggggcggttc accatctcca
gagataattc caaaaacacc 240ctctatcttc aaatgaactc cctaagagct gaggacactg
ccgtttacta ctgtgcaaga 300gagggccaca ctgctgctcc ttttgattac tggggccaag
gaacactggt caccgtctcc 360tca
36382363DNAARTIFICIALMR 82gaggtgcaac tgcaggaatc
tggaggaggc ttggtacagc cggggggttc tctgagactc 60tcctgtgcag gttctggatt
caccttcact gatttctaca tgaactgggt ccgccaggct 120ccagggaagg gacttgagtg
ggtgggtttt attagagaca aagctaaagg ttacacaaca 180gagtacaatc catctgtgaa
ggggcggttc accatctcca gagataatgc caaaaactcc 240ctctatcttc aaatgaactc
cctaagagct gaggacactg ccgtttacta ctgtgcaaga 300gagggccaca ctgctgctcc
ttttgattac tggggccaag gaacactggt caccgtctcc 360tca
36383363DNAARTIFICIALMR
83gaggtgcaac tgcaggaatc tggaggaggc ttggtacagc cggggggttc tctgagactc
60tcctgtgcag gttctggatt caccttcact gatttctaca tgaactggat tcgccagcct
120cccgggaaag cacctgagtg gctgggtttt attagagaca aagctaaagg ttacacaaca
180gagtacaatc catctgtgaa ggggcggttc accatctcca gagataattc caaaaacacc
240ctctatcttc aaatgaactc cctaagagct gaggacactg ccgtttacta ctgtgcaaga
300gagggccaca ctgctgctcc ttttgattac tggggccaag gaacactggt caccgtctcc
360tca
36384363DNAARTIFICIALMR 84gaggtgcaac tgttggaatc tggaggaggc ttggtacagc
cggggggttc tctgagactc 60tcctgtgcag gttctggatt caccttcact gatttctaca
tgaactgggt ccgccagcct 120cccgggaaag cacctgagtg gattggtttt attagagaca
aagctaaagg ttacacaaca 180gagtacaatc catctgtgaa ggggcggttc accatctcca
gagataattc caaaaacacc 240ctctatcttc aaatgaactc cctaagagct gaggacactg
ccgtttacta ctgtgcaaga 300gagggccaca ctgctgctcc ttttgattac tggggccaag
gaacactggt caccgtctcc 360tca
36385363DNAARTIFICIALMR 85gaggtgaaac tgcaggaatc
tggaggaggc ttggtacagc cggggggttc tatgagaatc 60tcctgttcag gttctggatt
caccttcact gatttctaca tgaactgggt ccgccagcct 120cccgggaaag gacctgagtg
gattggtttt attagagaca aagctaaagg ttacacaaca 180gagtacaatc catctgtgaa
ggggcggttc accatctcca gagataatac ccaaaacacc 240ctccatcttc aagctaacac
cctaagagct gaggacactg ccgtttacta ctgtgcaaga 300gagggccaca ctgctgctcc
ttttgattac tggggccaag gaactaccgt caccgtctcc 360tca
36386363DNAARTIFICIALMR
86gaggtgcaac tgttggaatc tggaggaggc ttggtacagc cggggggttc tctgagactc
60tcctgtgcag gttctggatt caccttcact gatttctaca tgaactgggt ccgccagcct
120cccgggaaag cacctgagtg gctgggtttt attagagaca aagctaaagg ttacacaaca
180gagtacaatc catctgtgaa ggggcggttc accatctcca gagataattc caaaaacacc
240ctctatcttc aaatgaactc cctaagagct gaggacactg ccgtttacta ctgtgcaaga
300gagggccaca ctgctgctcc ttttgattac tggggccaag gaacactggt caccgtctcc
360tca
36387363DNAARTIFICIALMR 87gaggtgcaac tgttggaatc tggaggaggc ttggtacagc
cggggggttc tctgagactc 60tcctgttcag gttctggatt caccttcact gatttctaca
tgaactggat tcgccagcct 120cccgggaaag cacctgagtg gattggtttt attagagaca
aagctaaagg ttacacaaca 180gagtacaatc catctgtgaa ggggcggttc accatctcca
gagataattc caaaaacacc 240ctctatcttc aaatgaactc cctaagagct gaggacactg
ccgtttacta ctgtgcaaga 300gagggccaca ctgctgctcc ttttgattac tggggccaag
gaacactggt caccgtctcc 360tca
36388363DNAARTIFICIALMR 88gaggtgcaac tgttggaatc
tggaggaggc ttggtacagc cggggggttc tctgagactc 60tcctgttcag gttctggatt
caccttcact gatttctaca tgaactgggt ccgccaggct 120ccagggaagg gacttgagtg
ggtgggtttt attagagaca aagctaaagg ttacacaaca 180gagtacaatc catctgtgaa
ggggcggttc accatctcca gagataatgc caaaaactcc 240ctctatcttc aaatgaactc
cctaagagct gaggacactg ccgtttacta ctgtgcaaga 300gagggccaca ctgctgctcc
ttttgattac tggggccaag gaacactggt caccgtctcc 360tca
36389363DNAARTIFICIALMR
89gaggtgcaac tgttggaatc tggaggaggc ttggtacagc cggggggttc tctgagactc
60tcctgttcag gttctggatt caccttcact gatttctaca tgaactggat tcgccagcct
120cccgggaaag cacctgagtg gctgggtttt attagagaca aagctaaagg ttacacaaca
180gagtacaatc catctgtgaa ggggcggttc accatctcca gagataattc caaaaacacc
240ctctatcttc aaatgaactc cctaagagct gaggacactg ccgtttacta ctgtgcaaga
300gagggccaca ctgctgctcc ttttgattac tggggccaag gaacactggt caccgtctcc
360tca
36390363DNAARTIFICIALMR 90gaggtgcaac tgttggaatc tggaggaggc ttggtacagc
cggggggttc tctgagactc 60tcctgtgcag gttctggatt caccttcact gatttctaca
tgaactggat tcgccaggct 120cccgggaaag cacctgagtg gattggtttt attagagaca
aagctaaagg ttacacaaca 180gagtacaatc catctgtgaa ggggcggttc accatctcca
gagataattc caaaaacacc 240ctctatcttc aaatgaactc cctaagagct gaggacactg
ccgtttacta ctgtgcaaga 300gagggccaca ctgctgctcc ttttgattac tggggccaag
gaacactggt caccgtctcc 360tca
36391363DNAARTIFICIALMR 91gaggtgaaac tgcaggaatc
tggaggaggc ttggtacagc cggggggttc tatgagaatc 60tcctgttcag gttctggatt
caccttcact gatttctaca tgaactggat tcgccaggct 120cccgggaaag gacctgagtg
gattggtttt attagagaca aagctaaagg ttacacaaca 180gagtacaatc catctgtgaa
ggggcggttc accatctcca gagataatac ccaaaacacc 240ctccatcttc aagctaacac
cctaagagct gaggacactg ccgtttacta ctgtgcaaga 300gagggccaca ctgctgctcc
ttttgattac tggggccaag gaactaccgt caccgtctcc 360tca
36392363DNAARTIFICIALMR
92gaggtgcaac tgttggaatc tggaggaggc ttggtacagc cggggggttc tctgagactc
60tcctgtgcag gttctggatt caccttcact gatttctaca tgaactggat tcgccaggct
120cccgggaaag cacctgagtg gctgggtttt attagagaca aagctaaagg ttacacaaca
180gagtacaatc catctgtgaa ggggcggttc accatctcca gagataattc caaaaacacc
240ctctatcttc aaatgaactc cctaagagct gaggacactg ccgtttacta ctgtgcaaga
300gagggccaca ctgctgctcc ttttgattac tggggccaag gaacactggt caccgtctcc
360tca
36393363DNAARTIFICIALMR 93gaggtgcaac tgttggaatc tggaggaggc ttggtacagc
cggggggttc tctgagactc 60tcctgtgcag gttctggatt caccttcact gatttctaca
tgaactggat tcgccagcct 120cccgggaaag cacctgagtg gattggtttt attagagaca
aagctaaagg ttacacaaca 180gagtacaatc catctgtgaa ggggcggttc accatctcca
gagataattc caaaaacacc 240ctctatcttc aagctaactc cctaagagct gaggacactg
ccgtttacta ctgtgcaaga 300gagggccaca ctgctgctcc ttttgattac tggggccaag
gaacactggt caccgtctcc 360tca
36394363DNAARTIFICIALMR 94gaggtgcaac tgttggaatc
tggaggaggc ttggtacagc cggggggttc tctgagactc 60tcctgtgcag gttctggatt
caccttcact gatttctaca tgaactgggt ccgccaggct 120ccagggaagg gacttgagtg
ggtgggtttt attagagaca aagctaaagg ttacacaaca 180gagtacaatc catctgtgaa
ggggcggttc accatctcca gagataatgc caaaaactcc 240ctctatcttc aagctaactc
cctaagagct gaggacactg ccgtttacta ctgtgcaaga 300gagggccaca ctgctgctcc
ttttgattac tggggccaag gaacactggt caccgtctcc 360tca
36395363DNAARTIFICIALMR
95gaggtgcaac tgttggaatc tggaggaggc ttggtacagc cggggggttc tctgagactc
60tcctgtgcag gttctggatt caccttcact gatttctaca tgaactggat tcgccagcct
120cccgggaaag cacctgagtg gctgggtttt attagagaca aagctaaagg ttacacaaca
180gagtacaatc catctgtgaa ggggcggttc accatctcca gagataattc caaaaacacc
240ctctatcttc aagctaactc cctaagagct gaggacactg ccgtttacta ctgtgcaaga
300gagggccaca ctgctgctcc ttttgattac tggggccaag gaacactggt caccgtctcc
360tca
36396363DNAARTIFICIALMR 96gaggtgcaac tgttggaatc tggaggaggc ttggtacagc
cggggggttc tctgagactc 60tcctgtgcag gttctggatt caccttcact gatttctaca
tgaactggat tcgccagcct 120cccgggaaag cacctgagtg gattggtttt attagagaca
aagctaaagg ttacacaaca 180gagtacaatc catctgtgaa ggggcggttc accatctcca
gagataattc ccaaaacacc 240ctctatcttc aaatgaactc cctaagagct gaggacactg
ccgtttacta ctgtgcaaga 300gagggccaca ctgctgctcc ttttgattac tggggccaag
gaacactggt caccgtctcc 360tca
36397363DNAARTIFICIALMR 97gaggtgcaac tgttggaatc
tggaggaggc ttggtacagc cggggggttc tctgagactc 60tcctgtgcag gttctggatt
caccttcact gatttctaca tgaactgggt ccgccaggct 120ccagggaagg gacttgagtg
ggtgggtttt attagagaca aagctaaagg ttacacaaca 180gagtacaatc catctgtgaa
ggggcggttc accatctcca gagataatgc ccaaaactcc 240ctctatcttc aaatgaactc
cctaagagct gaggacactg ccgtttacta ctgtgcaaga 300gagggccaca ctgctgctcc
ttttgattac tggggccaag gaacactggt caccgtctcc 360tca
36398363DNAARTIFICIALMR
98gaggtgcaac tgttggaatc tggaggaggc ttggtacagc cggggggttc tctgagactc
60tcctgtgcag gttctggatt caccttcact gatttctaca tgaactggat tcgccagcct
120cccgggaaag cacctgagtg gctgggtttt attagagaca aagctaaagg ttacacaaca
180gagtacaatc catctgtgaa ggggcggttc accatctcca gagataattc ccaaaacacc
240ctctatcttc aaatgaactc cctaagagct gaggacactg ccgtttacta ctgtgcaaga
300gagggccaca ctgctgctcc ttttgattac tggggccaag gaacactggt caccgtctcc
360tca
36399363DNAARTIFICIALMR 99gaggtgcaac tgttggaatc tggaggaggc ttggtacagc
cggggggttc tctgagactc 60tcctgtgcag gttctggatt caccttcact gatttctaca
tgaactggat tcgccagcct 120cccgggaaag cacctgagtg gattggtttt attagagaca
aagctaaagg ttacacaaca 180gagtacaatc catctgtgaa ggggcggttc accatctcca
gagataatac caaaaacacc 240ctctatcttc aaatgaactc cctaagagct gaggacactg
ccgtttacta ctgtgcaaga 300gagggccaca ctgctgctcc ttttgattac tggggccaag
gaacactggt caccgtctcc 360tca
363100363DNAARTIFICIALMR 100gaggtgcaac tgttggaatc
tggaggaggc ttggtacagc cggggggttc tctgagactc 60tcctgtgcag gttctggatt
caccttcact gatttctaca tgaactgggt ccgccaggct 120ccagggaagg gacttgagtg
ggtgggtttt attagagaca aagctaaagg ttacacaaca 180gagtacaatc catctgtgaa
ggggcggttc accatctcca gagataatac caaaaactcc 240ctctatcttc aaatgaactc
cctaagagct gaggacactg ccgtttacta ctgtgcaaga 300gagggccaca ctgctgctcc
ttttgattac tggggccaag gaacactggt caccgtctcc 360tca
363101363DNAARTIFICIALMR
101gaggtgcaac tgttggaatc tggaggaggc ttggtacagc cggggggttc tctgagactc
60tcctgtgcag gttctggatt caccttcact gatttctaca tgaactggat tcgccagcct
120cccgggaaag cacctgagtg gctgggtttt attagagaca aagctaaagg ttacacaaca
180gagtacaatc catctgtgaa ggggcggttc accatctcca gagataatac caaaaacacc
240ctctatcttc aaatgaactc cctaagagct gaggacactg ccgtttacta ctgtgcaaga
300gagggccaca ctgctgctcc ttttgattac tggggccaag gaacactggt caccgtctcc
360tca
363102363DNAARTIFICIALMR 102gaggtgcaac tgttggaatc tggaggaggc ttggtacagc
cggggggttc tatgagactc 60tcctgtgcag gttctggatt caccttcact gatttctaca
tgaactggat tcgccagcct 120cccgggaaag cacctgagtg gctgggtttt attagagaca
aagctaaagg ttacacaaca 180gagtacaatc catctgtgaa ggggcggttc accatctcca
gagataattc caaaaacacc 240ctctatcttc aaatgaactc cctaagagct gaggacactg
ccgtttacta ctgtgcaaga 300gagggccaca ctgctgctcc ttttgattac tggggccaag
gaacactggt caccgtctcc 360tca
363103363DNAARTIFICIALMR 103gaggtgaaac tgcaggaatc
tggaggaggc ttggtacagc cggggggttc tatgagaatc 60tcctgttcag gttctggatt
caccttcact gatttctaca tgaactggat tcgccagcct 120cccgggaaag gacctgagtg
gctgggtttt attagagaca aagctaaagg ttacacaaca 180gagtacaatc catctgtgaa
ggggcggttc accatctcca gagataatac ccaaaacacc 240ctccatcttc aagctaacac
cctaagagct gaggacactg ccgtttacta ctgtgcaaga 300gagggccaca ctgctgctcc
ttttgattac tggggccaag gaactaccgt caccgtctcc 360tca
363104363DNAARTIFICIALMR
104gaggtgcaac tgttggaatc tggaggaggc ttggtacagc cggggggttc tctgagactc
60tcctgtgcag gttctggatt caccttcact gatttctaca tgaactgggt ccgccaggct
120ccagggaagg gacttgagtg gctgggtttt attagagaca aagctaaagg ttacacaaca
180gagtacaatc catctgtgaa ggggcggttc accatctcca gagataatgc caaaaactcc
240ctctatcttc aaatgaactc cctaagagct gaggacactg ccgtttacta ctgtgcaaga
300gagggccaca ctgctgctcc ttttgattac tggggccaag gaacactggt caccgtctcc
360tca
363105363DNAARTIFICIALMR 105gaggtgcaac tgttggaatc tggaggaggc ttggtacagc
cggggggttc tctgagactc 60tcctgtgcag gttctggatt caccttcact gatttctaca
tgaactggat tcgccagcct 120cccgggaaag cacctgagtg gattggtttt attagagaca
aagctaaagg ttacacaaca 180gagtacaatc catctgtgaa ggggcggttc accatctcca
gagataattc caaaaacacc 240ctctatcttc aaatgaactc cctaagagct gaggacactg
ccgtttacta ctgtgcaaga 300gagggccaca ctgctgctcc ttttgattac tggggccaag
gaacaaccgt caccgtctcc 360tca
363106363DNAARTIFICIALMR 106gaggtgcaac tgttggaatc
tggaggaggc ttggtacagc cggggggttc tctgagactc 60tcctgtgcag gttctggatt
caccttcact gatttctaca tgaactgggt ccgccaggct 120ccagggaagg gacttgagtg
ggtgggtttt attagagaca aagctaaagg ttacacaaca 180gagtacaatc catctgtgaa
ggggcggttc accatctcca gagataatgc caaaaactcc 240ctctatcttc aaatgaactc
cctaagagct gaggacactg ccgtttacta ctgtgcaaga 300gagggccaca ctgctgctcc
ttttgattac tggggccaag gaacaaccgt caccgtctcc 360tca
363107363DNAARTIFICIALMR
107gaggtgcaac tgttggaatc tggaggaggc ttggtacagc cggggggttc tctgagactc
60tcctgtgcag gttctggatt caccttcact gatttctaca tgaactggat tcgccagcct
120cccgggaaag cacctgagtg gctgggtttt attagagaca aagctaaagg ttacacaaca
180gagtacaatc catctgtgaa ggggcggttc accatctcca gagataattc caaaaacacc
240ctctatcttc aaatgaactc cctaagagct gaggacactg ccgtttacta ctgtgcaaga
300gagggccaca ctgctgctcc ttttgattac tggggccaag gaacaaccgt caccgtctcc
360tca
363108363DNAARTIFICIALMR 108gaggtgcaac tgttggaatc tggaggaggc ttggtacagc
cggggggttc tctgagactc 60tcctgtgcag gttctggatt caccttcact gatttctaca
tgaactggat tcgccagcct 120cccgggaaag cacctgagtg gctgggtttt attagagaca
aagctaaagg ttacacaaca 180gagtacaatc catctgtgaa ggggcggttc accatctcca
gagataattc caaaaacacc 240ctctatcttc aaatgaactc cctaagagct gaggacactg
ccacctacta ctgtgcaaga 300gagggccaca ctgctgctcc ttttgattac tggggccaag
gaacactggt caccgtctcc 360tca
363109321DNAARTIFICIALMR 109gacatccaga tgacccagtc
tccctcagcc ctgtctgcat ctgtgggaga cagagtcact 60cccacctgca gagcaagtca
gaatattgac aaatacttaa actggtatca gcaaaagccc 120ggaaaagctc ccaaatccct
gatatataat acaaacaatt tgcaatctgg cgtcccatca 180aggttcagtg gcagtggatc
tggtactgat ttcacactca ccatcagcag cctgcagcct 240gaagatattg ccacatatta
ctgcttgcag catataagta ggccgcgcac gtttggaact 300gggaccaagc tggagctgaa a
321110321DNAARTIFICIALMR
110gacatccaga tgacccagtc tccctcagcc ctgtctgcat ctgtgggaga cagagtcact
60cccacctgca aagcaagtca gaatattgac aaatacttaa actggtatca gcaaaagccc
120ggaaaagctc ccaaactcct gatatataat acaaacaatt tgcaaacggg cgtcccatca
180aggttcagtg gcagtggatc tggtactgat ttcacactca ccatcagcag cctgcagcct
240gaagatattg ccacatatta ctgcttgcag catataagta ggccgcgcac gtttggaact
300gggaccaagc tggagctgaa a
321111321DNAARTIFICIALMR 111gacatccaga tgacccagtc tccctcagcc ctgtctgcat
ctgtgggaga cagagtcact 60cccacctgca gagcaagtca gaatattgac aaatacttaa
actggtatca gcaaaagccc 120ggaaaagctc ccaaactcct gatatataat acaaacaatt
tgcaatctgg cgtcccatca 180aggttcagtg gcagtggatc tggtactgat ttcacactca
ccatcagcag cctgcagcct 240gaagatattg ccacatatta ctgcttgcag catataagta
ggccgcgcac gtttggaact 300gggaccaagc tggagctgaa a
321112321DNAARTIFICIALMR 112gacatccaga tgacccagtc
tccctcagcc ctgtctgcat ctgtgggaga cagagtcact 60cccacctgca aagcaagtca
gaatattgac aaatacttaa actggtatca gcaaaagccc 120ggaaaagctc ccaaatccct
gatatataat acaaacaatt tgcaaacggg cgtcccatca 180aggttcagtg gcagtggatc
tggtactgat ttcacactca ccatcagcag cctgcagcct 240gaagatattg ccacatatta
ctgcttgcag catataagta ggccgcgcac gtttggaact 300gggaccaagc tggagctgaa a
321113321DNAARTIFICIALMR
113gacatccaga tgacccagtc tccctcagcc ctgtctgcat ctgtgggaga cagagtcact
60cccacctgca aagcaagtca gaatattgac aaatacttaa actggtatca gcaaaagccc
120ggaaaatctc ccaaactcct gatatataat acaaacaatt tgcaaacggg cgtcccatca
180aggttcagtg gcagtggatc tggtactgat ttcacactca ccatcagcag cctgcagcct
240gaagatattg ccacatatta ctgcttgcag catataagta ggccgcgcac gtttggaact
300gggaccaagc tggagctgaa a
321114321DNAARTIFICIALMR 114gacatccaga tgacccagtc tccctcagcc ctgtctgcat
ctgtgggaga cagagtcact 60atcacctgca gagcaagtca gaatattgac aaatacttaa
actggtatca gcaaaagccc 120ggaaaagctc ccaaatccct gatatataat acaaacaatt
tgcaatctgg cgtcccatca 180aggttcagtg gcagtggatc tggtactgat ttcacactca
ccatcagcag cctgcagcct 240gaagatattg ccacatatta ctgcttgcag catataagta
ggccgcgcac gtttggaact 300gggaccaagc tggagctgaa a
321115321DNAARTIFICIALMR 115gacatccaga tgacccagtc
tccctcagcc ctgtctgcat ctgtgggaga cagagtcact 60atcacctgca aagcaagtca
gaatattgac aaatacttaa actggtatca gcaaaagccc 120ggaaaagctc ccaaactcct
gatatataat acaaacaatt tgcaaacggg cgtcccatca 180aggttcagtg gcagtggatc
tggtactgat ttcacactca ccatcagcag cctgcagcct 240gaagatattg ccacatatta
ctgcttgcag catataagta ggccgcgcac gtttggaact 300gggaccaagc tggagctgaa a
321116321DNAARTIFICIALMR
116gacatccaga tgacccagtc tccctcagcc ctgtctgcat ctgtgggaga cagagtcact
60atcacctgca gagcaagtca gaatattgac aaatacttaa actggtatca gcaaaagccc
120ggaaaagctc ccaaactcct gatatataat acaaacaatt tgcaatctgg cgtcccatca
180aggttcagtg gcagtggatc tggtactgat ttcacactca ccatcagcag cctgcagcct
240gaagatattg ccacatatta ctgcttgcag catataagta ggccgcgcac gtttggaact
300gggaccaagc tggagctgaa a
321117321DNAARTIFICIALMR 117gacatccaga tgacccagtc tccctcagcc ctgtctgcat
ctgtgggaga cagagtcact 60atcacctgca aagcaagtca gaatattgac aaatacttaa
actggtatca gcaaaagccc 120ggaaaagctc ccaaatccct gatatataat acaaacaatt
tgcaaacggg cgtcccatca 180aggttcagtg gcagtggatc tggtactgat ttcacactca
ccatcagcag cctgcagcct 240gaagatattg ccacatatta ctgcttgcag catataagta
ggccgcgcac gtttggaact 300gggaccaagc tggagctgaa a
321118321DNAARTIFICIALMR 118gacatccaga tgacccagtc
tccctcagcc ctgtctgcat ctgtgggaga cagagtcact 60atcacctgca aagcaagtca
gaatattgac aaatacttaa actggtatca gcaaaagccc 120ggaaaatctc ccaaactcct
gatatataat acaaacaatt tgcaaacggg cgtcccatca 180aggttcagtg gcagtggatc
tggtactgat ttcacactca ccatcagcag cctgcagcct 240gaagatattg ccacatatta
ctgcttgcag catataagta ggccgcgcac gtttggaact 300gggaccaagc tggagctgaa a
321119321DNAARTIFICIALMR
119gacatccaga tgacccagtc tccctcatcc ctgtctgcat ctgtgggaga cagagtcact
60cccacctgca gagcaagtca gaatattgac aaatacttaa actggtatca gcaaaagccc
120ggaaaagctc ccaaatccct gatatataat acaaacaatt tgcaatctgg cgtcccatca
180aggttcagtg gcagtggatc tggtactgat ttcacactca ccatcagcag cctgcagcct
240gaagatattg ccacatatta ctgcttgcag catataagta ggccgcgcac gtttggaact
300gggaccaagc tggagctgaa a
321120321DNAARTIFICIALMR 120gacatccaga tgacccagtc tccctcatcc ctgtctgcat
ctgtgggaga cagagtcact 60cccacctgca aagcaagtca gaatattgac aaatacttaa
actggtatca gcaaaagccc 120ggaaaagctc ccaaactcct gatatataat acaaacaatt
tgcaaacggg cgtcccatca 180aggttcagtg gcagtggatc tggtactgat ttcacactca
ccatcagcag cctgcagcct 240gaagatattg ccacatatta ctgcttgcag catataagta
ggccgcgcac gtttggaact 300gggaccaagc tggagctgaa a
321121321DNAARTIFICIALMR 121gacatccaga tgacccagtc
tccctcatcc ctgtctgcat ctgtgggaga cagagtcact 60cccacctgca gagcaagtca
gaatattgac aaatacttaa actggtatca gcaaaagccc 120ggaaaagctc ccaaactcct
gatatataat acaaacaatt tgcaatctgg cgtcccatca 180aggttcagtg gcagtggatc
tggtactgat ttcacactca ccatcagcag cctgcagcct 240gaagatattg ccacatatta
ctgcttgcag catataagta ggccgcgcac gtttggaact 300gggaccaagc tggagctgaa a
321122321DNAARTIFICIALMR
122gacatccaga tgacccagtc tccctcatcc ctgtctgcat ctgtgggaga cagagtcact
60cccacctgca aagcaagtca gaatattgac aaatacttaa actggtatca gcaaaagccc
120ggaaaagctc ccaaatccct gatatataat acaaacaatt tgcaaacggg cgtcccatca
180aggttcagtg gcagtggatc tggtactgat ttcacactca ccatcagcag cctgcagcct
240gaagatattg ccacatatta ctgcttgcag catataagta ggccgcgcac gtttggaact
300gggaccaagc tggagctgaa a
321123321DNAARTIFICIALMR 123gacatccaga tgacccagtc tccctcatcc ctgtctgcat
ctgtgggaga cagagtcact 60cccacctgca aagcaagtca gaatattgac aaatacttaa
actggtatca gcaaaagccc 120ggaaaatctc ccaaactcct gatatataat acaaacaatt
tgcaaacggg cgtcccatca 180aggttcagtg gcagtggatc tggtactgat ttcacactca
ccatcagcag cctgcagcct 240gaagatattg ccacatatta ctgcttgcag catataagta
ggccgcgcac gtttggaact 300gggaccaagc tggagctgaa a
321124321DNAARTIFICIALMR 124gacatccaga tgacccagtc
tccctcatcc ctgtctgcat ctgtgggaga cagagtcact 60atcacctgca gagcaagtca
gaatattgac aaatacttaa actggtatca gcaaaagtct 120ggaaaagctc ccaaatccct
gatatataat acaaacaatt tgcaatctgg cgtcccatca 180aggttcagtg gcagtggatc
tggtactgat ttcacactca ccatcagcag cctgcagcct 240gaagatattg ccacatatta
ctgcttgcag catataagta ggccgcgcac gtttggaact 300gggaccaagc tggagctgaa a
321125321DNAARTIFICIALMR
125gacatccaga tgacccagtc tccctcatcc ctgtctgcat ctgtgggaga cagagtcact
60atcacctgca aagcaagtca gaatattgac aaatacttaa actggtatca gcaaaagtct
120ggaaaagctc ccaaactcct gatatataat acaaacaatt tgcaaacggg cgtcccatca
180aggttcagtg gcagtggatc tggtactgat ttcacactca ccatcagcag cctgcagcct
240gaagatattg ccacatatta ctgcttgcag catataagta ggccgcgcac gtttggaact
300gggaccaagc tggagctgaa a
321126321DNAARTIFICIALMR 126gacatccaga tgacccagtc tccctcatcc ctgtctgcat
ctgtgggaga cagagtcact 60atcacctgca gagcaagtca gaatattgac aaatacttaa
actggtatca gcaaaagtct 120ggaaaagctc ccaaactcct gatatataat acaaacaatt
tgcaatctgg cgtcccatca 180aggttcagtg gcagtggatc tggtactgat ttcacactca
ccatcagcag cctgcagcct 240gaagatattg ccacatatta ctgcttgcag catataagta
ggccgcgcac gtttggaact 300gggaccaagc tggagctgaa a
321127321DNAARTIFICIALMR 127gacatccaga tgacccagtc
tccctcatcc ctgtctgcat ctgtgggaga cagagtcact 60atcacctgca aagcaagtca
gaatattgac aaatacttaa actggtatca gcaaaagtct 120ggaaaagctc ccaaatccct
gatatataat acaaacaatt tgcaaacggg cgtcccatca 180aggttcagtg gcagtggatc
tggtactgat ttcacactca ccatcagcag cctgcagcct 240gaagatattg ccacatatta
ctgcttgcag catataagta ggccgcgcac gtttggaact 300gggaccaagc tggagctgaa a
321128321DNAARTIFICIALMR
128gacatccaga tgacccagtc tccctcatcc ctgtctgcat ctgtgggaga cagagtcact
60atcacctgca aagcaagtca gaatattgac aaatacttaa actggtatca gcaaaagtct
120ggaaaatctc ccaaactcct gatatataat acaaacaatt tgcaaacggg cgtcccatca
180aggttcagtg gcagtggatc tggtactgat ttcacactca ccatcagcag cctgcagcct
240gaagatattg ccacatatta ctgcttgcag catataagta ggccgcgcac gtttggaact
300gggaccaagc tggagctgaa a
321129321DNAARTIFICIALMR 129gacatccaga tgacccagtc tccctcatcc ctgtctgcat
ctgtgggaga cagagtcact 60atcacctgca gagcaagtca gaatattgac aaatacttaa
actggtatca gcaaaagccc 120ggaaaagctc ccaaatccct gatatataat acaaacaatt
tgcaatctgg catgccatca 180aggttcagtg gcagtggatc tggtactgat ttcacactca
ccatcagcag cctgcagcct 240gaagatattg ccacatatta ctgcttgcag catataagta
ggccgcgcac gtttggaact 300gggaccaagc tggagctgaa a
321130321DNAARTIFICIALMR 130gacatccaga tgacccagtc
tccctcatcc ctgtctgcat ctgtgggaga cagagtcact 60atcacctgca aagcaagtca
gaatattgac aaatacttaa actggtatca gcaaaagccc 120ggaaaagctc ccaaactcct
gatatataat acaaacaatt tgcaaacggg catgccatca 180aggttcagtg gcagtggatc
tggtactgat ttcacactca ccatcagcag cctgcagcct 240gaagatattg ccacatatta
ctgcttgcag catataagta ggccgcgcac gtttggaact 300gggaccaagc tggagctgaa a
321131321DNAARTIFICIALMR
131gacatccaga tgacccagtc tccctcatcc ctgtctgcat ctgtgggaga cagagtcact
60atcacctgca gagcaagtca gaatattgac aaatacttaa actggtatca gcaaaagccc
120ggaaaagctc ccaaactcct gatatataat acaaacaatt tgcaatctgg catgccatca
180aggttcagtg gcagtggatc tggtactgat ttcacactca ccatcagcag cctgcagcct
240gaagatattg ccacatatta ctgcttgcag catataagta ggccgcgcac gtttggaact
300gggaccaagc tggagctgaa a
321132321DNAARTIFICIALMR 132gacatccaga tgacccagtc tccctcatcc ctgtctgcat
ctgtgggaga cagagtcact 60atcacctgca aagcaagtca gaatattgac aaatacttaa
actggtatca gcaaaagccc 120ggaaaagctc ccaaatccct gatatataat acaaacaatt
tgcaaacggg catgccatca 180aggttcagtg gcagtggatc tggtactgat ttcacactca
ccatcagcag cctgcagcct 240gaagatattg ccacatatta ctgcttgcag catataagta
ggccgcgcac gtttggaact 300gggaccaagc tggagctgaa a
321133321DNAARTIFICIALMR 133gacatccaga tgacccagtc
tccctcatcc ctgtctgcat ctgtgggaga cagagtcact 60atcacctgca aagcaagtca
gaatattgac aaatacttaa actggtatca gcaaaagccc 120ggaaaatctc ccaaactcct
gatatataat acaaacaatt tgcaaacggg catgccatca 180aggttcagtg gcagtggatc
tggtactgat ttcacactca ccatcagcag cctgcagcct 240gaagatattg ccacatatta
ctgcttgcag catataagta ggccgcgcac gtttggaact 300gggaccaagc tggagctgaa a
321134321DNAARTIFICIALMR
134gacatccaga tgacccagtc tccctcatcc ctgtctgcat ctgtgggaga cagagtcact
60atcacctgca gagcaagtca gaatattgac aaatacttaa actggtatca gcaaaagtct
120ggaaaagctc ccaaatccct gatatataat acaaacaatt tgcaatctgg catgccatca
180aggttcagtg gcagtggatc tggtactgat ttcacactca ccatcagcag cctgcagcct
240gaagatattg ccacatatta ctgcttgcag catataagta ggccgcgcac gtttggaact
300gggaccaagc tggagctgaa a
321135321DNAARTIFICIALMR 135gacatccaga tgacccagtc tccctcatcc ctgtctgcat
ctgtgggaga cagagtcact 60atcacctgca aagcaagtca gaatattgac aaatacttaa
actggtatca gcaaaagtct 120ggaaaagctc ccaaactcct gatatataat acaaacaatt
tgcaaacggg catgccatca 180aggttcagtg gcagtggatc tggtactgat ttcacactca
ccatcagcag cctgcagcct 240gaagatattg ccacatatta ctgcttgcag catataagta
ggccgcgcac gtttggaact 300gggaccaagc tggagctgaa a
321136321DNAARTIFICIALMR 136gacatccaga tgacccagtc
tccctcatcc ctgtctgcat ctgtgggaga cagagtcact 60atcacctgca gagcaagtca
gaatattgac aaatacttaa actggtatca gcaaaagtct 120ggaaaagctc ccaaactcct
gatatataat acaaacaatt tgcaatctgg catgccatca 180aggttcagtg gcagtggatc
tggtactgat ttcacactca ccatcagcag cctgcagcct 240gaagatattg ccacatatta
ctgcttgcag catataagta ggccgcgcac gtttggaact 300gggaccaagc tggagctgaa a
321137321DNAARTIFICIALMR
137gacatccaga tgacccagtc tccctcatcc ctgtctgcat ctgtgggaga cagagtcact
60atcacctgca aagcaagtca gaatattgac aaatacttaa actggtatca gcaaaagtct
120ggaaaagctc ccaaatccct gatatataat acaaacaatt tgcaaacggg catgccatca
180aggttcagtg gcagtggatc tggtactgat ttcacactca ccatcagcag cctgcagcct
240gaagatattg ccacatatta ctgcttgcag catataagta ggccgcgcac gtttggaact
300gggaccaagc tggagctgaa a
321138321DNAARTIFICIALMR 138gacatccaga tgacccagtc tccctcatcc ctgtctgcat
ctgtgggaga cagagtcact 60atcacctgca aagcaagtca gaatattgac aaatacttaa
actggtatca gcaaaagtct 120ggaaaatctc ccaaactcct gatatataat acaaacaatt
tgcaaacggg catgccatca 180aggttcagtg gcagtggatc tggtactgat ttcacactca
ccatcagcag cctgcagcct 240gaagatattg ccacatatta ctgcttgcag catataagta
ggccgcgcac gtttggaact 300gggaccaagc tggagctgaa a
321139330PRTHomo Sapiens 139Ala Ser Thr Lys Gly
Pro Ser Val Phe Pro Leu Ala Pro Ser Ser Lys1 5
10 15Ser Thr Ser Gly Gly Thr Ala Ala Leu Gly Cys
Leu Val Lys Asp Tyr 20 25
30Phe Pro Glu Pro Val Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser
35 40 45Gly Val His Thr Phe Pro Ala Val
Leu Gln Ser Ser Gly Leu Tyr Ser 50 55
60Leu Ser Ser Val Val Thr Val Pro Ser Ser Ser Leu Gly Thr Gln Thr65
70 75 80Tyr Ile Cys Asn Val
Asn His Lys Pro Ser Asn Thr Lys Val Asp Lys 85
90 95Lys Val Glu Pro Lys Ser Cys Asp Lys Thr His
Thr Cys Pro Pro Cys 100 105
110Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro
115 120 125Lys Pro Lys Asp Thr Leu Met
Ile Ser Arg Thr Pro Glu Val Thr Cys 130 135
140Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn
Trp145 150 155 160Tyr Val
Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu
165 170 175Glu Gln Tyr Asn Ser Thr Tyr
Arg Val Val Ser Val Leu Thr Val Leu 180 185
190His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val
Ser Asn 195 200 205Lys Ala Leu Pro
Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly 210
215 220Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro
Ser Arg Asp Glu225 230 235
240Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr
245 250 255Pro Ser Asp Ile Ala
Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn 260
265 270Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp
Gly Ser Phe Phe 275 280 285Leu Tyr
Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn 290
295 300Val Phe Ser Cys Ser Val Met His Glu Ala Leu
His Asn His Tyr Thr305 310 315
320Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys 325
330140106PRTHomo Sapiens 140Thr Val Ala Ala Pro Ser Val Phe Ile
Phe Pro Pro Ser Asp Glu Gln1 5 10
15Leu Lys Ser Gly Thr Ala Ser Val Val Cys Leu Leu Asn Asn Phe
Tyr 20 25 30Pro Arg Glu Ala
Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser 35
40 45Gly Asn Ser Gln Glu Ser Val Thr Glu Gln Asp Ser
Lys Asp Ser Thr 50 55 60Tyr Ser Leu
Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu Lys65 70
75 80His Lys Leu Tyr Ala Cys Glu Val
Thr His Gln Gly Leu Ser Ser Pro 85 90
95Val Thr Lys Ser Phe Asn Arg Gly Glu Cys 100
10514120DNAARTIFICIALSYNTHESIZED 141tccacaggtg tccactccga
2014241DNAARTIFICIALSYNTHESIZED 142ccagattcca acagtttcac ctcggagtgg
acacctgtgg a 4114339DNAARTIFICIALSYNTHESIZED
143ggtgaaactg ttggaatctg gaggaggctt ggtacagcc
3914440DNAARTIFICIALSYNTHESIZED 144ggagagtctc atagaacccc ccggctgtac
caagcctcct 4014541DNAARTIFICIALSYNTHESIED
145ggggggttct atgagactct cctgtgcagg ttctggattc a
4114639DNAARTIFICIALSYNTHESIZED 146catgtagaaa tcagtgaagg tgaatccaga
acctgcaca 3914740DNAARTIFICIALSYNTHESIZED
147ccttcactga tttctacatg aactggattc gccagcctgc
4014840DNAARTIFICIALSYNTHESIZED 148gccactcagg tgccttccct gcaggctggc
gaatccagtt 4014940DNAARTIFICIALSYNTHESIZED
149agggaaggca cctgagtggc tgggttttat tagagacaaa
4015040DNAARTIFICIALSYNTHESIZED 150tctgttgtgt aacctttagc tttgtctcta
ataaaaccca 4015142DNAARTIFICIALSYNTHESIZED
151gctaaaggtt acacaacaga gtacaatcca tctgtgaagg gg
4215240DNAARTIFICIALSYNTHESIZED 152tctggagatg gtgaaccgcc ccttcacaga
tggattgtac 4015338DNAARTIFICIALSYNTHESIZED
153cggttcacca tctccagaga taatacccaa aacatgct
3815440DNAARTIFICIALSYNTHESIZED 154gggtgttcat ttgaagatag agcatgtttt
gggtattatc 4015540DNAARTIFICIALSYNTHESIZED
155ctatcttcaa atgaacaccc taagagctga ggacactgcc
4015640DNAARTIFICIALSYNTHESIZED 156tctcttgcac agtagtaagt ggcagtgtcc
tcagctctta 4015742DNAARTIFICIALSYNTHESIZED
157acttactact gtgcaagaga gggccacact gctgctcctt tt
4215841DNAARTIFICIALSYNTHESIZED 158ctccttggcc ccagtaatca aaaggagcag
cagtgtggcc c 4115939DNAARTIFICIALSYNTHESIZED
159gattactggg gccaaggagt catggtcacc gtctcctca
3916020DNAARTIFICIALSYNTHESIZED 160tgaggagacg gtgaccatga
2016138DNAARTIFICIALSYNTHESIZED
161gcatgttgac cctgacgcaa gcttgccgcc accatggg
3816227DNAARTIFICIALSYNTHESIZED 162ggagtggaca cctgtggaga gaaaggc
2716336DNAARTIFICIALSYNTHESIZED
163gcgatagctg gactgaatgg atcctataaa tctctg
3616421DNAARTIFICIALSYNTHESIZED 164tccacaggtg tccactccga c
2116539DNAARTIFICIALSYNTHESIZED
165agactgggtc atcttgatgt cggagtggac acctgtgga
3916640DNAARTIFICIALSYNTHESIZED 166atcaagatga cccagtctcc ctcattcctg
tctgcatctg 4016741DNAARTIFICIALSYNTHESIZED
167agagtgactc tgtctcccac agatgcagac aggaatgagg g
4116840DNAARTIFICIALSYNTHESIZED 168tgggagacag agtcactctc aactgcaaag
caagtcagaa 4016940DNAARTIFICIALSYNTHESIZED
169gtttaagtat ttgtcaatat tctgacttgc tttgcagttg
4017040DNAARTIFICIALSYNTHESIZED 170tattgacaaa tacttaaact ggtatcagca
aaagctggga 4017140DNAARTIFICIALSYNTHESIZED
171tcaggagttt gggagattct cccagctttt gctgatacca
4017240DNAARTIFICIALSYNTHESIZED 172gaatctccca aactcctgat atataataca
aacaatttgc 4017341DNAARTIFICIALSYNTHESIZED
173ccttgatggg atgcccgttt gcaaattgtt tgtattatat a
4117440DNAARTIFICIALSYNTHESIZED 174aaacgggcat cccatcaagg ttcagtggca
gtggatctgg 4017539DNAARTIFICIALSYNTHESIZED
175ggtgagtgtg aaatcagtac cagatccact gccactgaa
3917640DNAARTIFICIALSYNTHESIZED 176tactgatttc acactcacca tcagcagcct
gcagcctgaa 4017741DNAARTIFICIALSYNTHESIZED
177cagaaatatg tggcaacatc ttcaggctgc aggctgctga t
4117839DNAARTIFICIALSYNTHESIZED 178gatgttgcca catatttctg cttgcagcat
ataagtagg 3917940DNAARTIFICIALSYNTHESIZED
179cccagttcca aacgtgcgcg gcctacttat atgctgcaag
4018040DNAARTIFICIALSYNTHESIZED 180ccgcgcacgt ttggaactgg gaccaagctg
gagctgaaac 4018139DNAARTIFICIALSYNTHESIZED
181aaagtttaaa ttctactcac gtttcagctc cagcttggt
3918238DNAARTIFICIALSYNTHESIZED 182gtgagtagaa tttaaacttt gcttcgtcga
ctggatcc 3818318DNAARTIFICIALSYNTHESIZED
183ggatccagtc gacgaagc
1818438DNAARTIFICIALSYNTHESIZED 184gcatgttgac cctgacgcaa gcttgccgcc
accatggg 3818527DNAARTIFICIALSYNTHESIZED
185ggagtggaca cctgtggaga gaaaggc
2718636DNAARTIFICIALSYNTHESIZED 186gcgatagctg gactgaatgg atccagtcga
cgaagc 3618738DNAARTIFICIALSYNTHESIZED
187gcatgttgac cctgacgcaa gcttgccgcc accatggg
3818830DNAARTIFICIALSYNTHESIZED 188ccactccgag gtgcaactgt tggaatctgg
3018930DNAARTIFICIALSYNTHESIZED
189ccagattcca acagttgcac ctcggagtgg
3019030DNAARTIFICIALSYNTHESIZED 190agccgggggg ttctctgaga ctctcctgtg
3019130DNAARTIFICIALSYNTHESIZED
191cacaggagag tctcagagaa ccccccggct
3019235DNAARTIFICIALSYNTHESIZED 192agggaaggga cttgagtggg tgggttttat tagag
3519335DNAARTIFICIALSYNTHESIZED
193cgggaaagca cctgagtgga ttggttttat tagag
3519443DNAARTIFICIALSYNTHESIZED 194ccactcaagt cccttccctg gagcctggcg
gacccagttc atg 4319535DNAARTIFICIALSYNTHESIZED
195ccactcaggt gctttcccgg gaggctggcg aatcc
3519648DNAARTIFICIALSYNTHESIZED 196tcttcaaatg aactccctaa gagctgagga
cactgccgtt tactactg 4819746DNAARTIFICIALSYNTHESIZED
197agggagttca tttgaagata gagggtgttt ttggaattat ctctgg
4619835DNAARTIFICIALSYNTHESIZED 198tggggccaag gaacactggt caccgtctcc tcagg
3519931DNAARTIFICIALSYNTHESIZED
199ggagactgtg accagtgttc cttggcccca g
3120033DNAARTIFICIALSYNTHESIZED 200tccgaggtga aactgcagga atctggagga ggc
3320130DNAARTIFICIALSYNTHESIZED
201ccagattcct gcagtttcac ctcggagtgg
3020235DNAARTIFICIALSYNTHESIZED 202gggggttcta tgagaatctc ctgttcaggt tctgg
3520335DNAARTIFICIALSYNTHESIZED
203gaacctgaac aggagattct catagaaccc cccgg
3520435DNAARTIFICIALSYNTHESIZED 204cgggaaagga cctgagtgga ttggttttat tagag
3520535DNAARTIFICIALSYNTHESIZED
205ccaatccact caggtccttt cccgggaggc tggcg
3520641DNAARTIFICIALSYNTHESIZED 206gctaacaccc taagagctga ggacactgcc
gtttactact g 4120739DNAARTIFICIALSYNTHESIZED
207ctcttagggt gttagcttga agatggaggg tgttttggg
3920835DNAARTIFICIALSYNTHESIZED 208tggggccaag gaactaccgt caccgtctcc tcagg
3520931DNAARTIFICIALSYNTHESIZED
209ggagacggtg acggtagttc cttggcccca g
3121036DNAARTIFICIALSYNTHESIZED 210gataatgcca aaaactccct ctatcttcaa
atgaac 3621135DNAARTIFICIALSYNTHESIZED
211atagagggag tttttggcat tatctctgga gatgg
3521235DNAARTIFICIALSYNTHESIZED 212cgggaaagca cctgagtggc tgggttttat tagag
3521336DNAARTIFICIALSYNTHESIZED
213gcgatagctg gactgaatgg atcctataaa tctctg
3621438DNAARTIFICIALSYNTHESIZED 214gcatgttgac cctgacgcaa gcttgccgcc
accatggg 3821532DNAARTIFICIALSYNTHESIZED
215atgacccagt ctccctcatc cctgtctgca tc
3221635DNAARTIFICIALSYNTHESIZED 216gagggagact gggtcatctg gatgtcggag tggac
3521734DNAARTIFICIALSYNTHESIZED
217cagagtcact atcacctgca aagcaagtca gaat
3421834DNAARTIFICIALSYNTHESIZED 218cagagtcact atcacctgca gagcaagtca gaat
3421935DNAARTIFICIALSYNTHESIZED
219attctgactt gctttgcagg tgatagtgac tctgt
3522035DNAARTIFICIALSYNTHESIZED 220attctgactt gctctgcagg tgatagtgac tctgt
3522135DNAARTIFICIALSYNTHESIZED
221cccggaaaag ctcccaaact cctgatatat aatac
3522235DNAARTIFICIALSYNTHESIZED 222cccggaaaat ctcccaaact cctgatatat aatac
3522335DNAARTIFICIALSYNTHESIZED
223cccggaaaag ctcccaaatc cctgatatat aatac
3522432DNAARTIFICIALSYNTHESIZED 224tttgggagct tttccgggct tttgctgata cc
3222532DNAARTIFICIALSYNTHESIZED
225tttgggagat tttccgggct tttgctgata cc
3222627DNAARTIFICIALSYNTHESIZED 226cgtcccatca aggttcagtg gcagtgg
2722731DNAARTIFICIALSYNTHESIZED
227gccactgaac cttgatggga cgcccgtttg c
3122835DNAARTIFICIALSYNTHESIZED 228cactgaacct tgatgggacg ccagattgca aattg
3522935DNAARTIFICIALSYNTHESIZED
229gcctgaagat attgccacat attactgctt gcagc
3523035DNAARTIFICIALSYNTHESIZED 230tgcaagcagt aatatgtggc aatatcttca ggctg
3523136DNAARTIFICIALSYNTHESIZED
231gcgatagctg gactgaatgg atccagtcga cgaagc
362321375DNAHomo sapiens 232cctagggttc gatcgaaaga ccccgtccgg tccggactgg
aaccgaaacc ccgtccctcc 60cccgattcca ctccgtccac cgcggtcgtc cacgtgtggg
ttacgggtac tcgggtctgt 120gacctgcgac ttggagcgcc tgtcaattct tgggtccccg
gagacgcgga cccgggtcga 180gacagggtgt ggcgccagtg taccgtggtg gagagaacgt
cggaggtggt tcccgggtag 240ccagaagggg gaccgtggga ggaggttctc gtggagaccc
ccgtgtcgcc gggacccgac 300ggaccagttc ctgatgaagg ggcttggcca ctgccacagc
accttgagtc cgcgggactg 360gtcgccgcac gtgtggaagg gccgacagga tgtcaggagt
cctgagatga gggagtcgtc 420gcaccactgg cacgggaggt cgtcgaaccc gtgggtctgg
atgtagacgt caagtgttcg 480ggtcggtgtc cacctgcttt caaccatccg gtcgtgtccc
cacagacgac cttcgtccga 540gtcgcgagga cggacctgcg tagggccgat acgtcggggt
caggtcccgt cgttccgtcc 600ggggcagacg gagaagtggg cctcggagac gggcggggtg
agtacgagtc cctctcccag 660aagaccgaaa aagggtccga gacccgtccg tgtccgatcc
acggggattg ggtccgggac 720gtgtgtttcc ccgtccacga cccgagtctg gacggttctc
ggtataggcc ctcctgggac 780ggggactgga tgttgtcgtg catggcccac cagtcgcagg
agtggcagga cgtggtcctg 840accgacttac cgttcctcat gttcacgttc cagaggttgt
ttcgggaggc ttcgggggta 900gctcttttgg tagaggtttc ggtttccacc ctgggcaccc
cacgctcccg gtgtacctgt 960ctccggccga gccgggtggg agacgggact ctcactggcg
acatggttgg agacaggatg 1020tcccgtcggg gctcttggtg tccacatgtg ggacgggggt
agggccctac tcgactggtt 1080cttggtccag tcggactgga cggaccagtt tccgaagata
gggtcgctgt agcggcacct 1140caccctctcg ttacccgtcg gcctcttgtt gatgttctgg
tgcggagggc acgacctgag 1200gctgccgagg aagaaggaga tgtcgttcga gtggcacctg
ttctcgtcca ccgtcgtccc 1260cttgcagaag agtacgaggc actacgtact ccgagacgtg
ttggtgatgt gcgtcttctc 1320ggagagggac agaggcccat ttactcacgc tgccggccca
tggctcgagc ttaag 1375233330PRTHomo sapiens 233Ala Ser Thr Lys Gly
Pro Ser Val Phe Pro Leu Ala Pro Ser Ser Lys 1 5
10 15Ser Thr Ser Gly Gly Thr Ala Ala Leu Gly Cys
Leu Val Lys Asp Tyr 20 25
30Phe Pro Glu Pro Val Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser
35 40 45Gly Val His Thr Phe Pro Ala Val
Leu Gln Ser Ser Gly Leu Tyr Ser 50 55
60Leu Ser Ser Val Val Thr Val Pro Ser Ser Ser Leu Gly Thr Gln Thr 65
70 75 80Tyr Ile Cys Asn
Val Asn His Lys Pro Ser Asn Thr Lys Val Asp Lys 85
90 95Lys Val Glu Pro Lys Ser Cys Asp Lys Thr
His Thr Cys Pro Pro Cys 100 105
110Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro
115 120 125Lys Pro Lys Asp Thr Leu Met
Ile Ser Arg Thr Pro Glu Val Thr Cys 130 135
140Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn
Trp145 150 155 160Tyr Val
Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu
165 170 175Glu Gln Tyr Asn Ser Thr Tyr
Arg Val Val Ser Val Leu Thr Val Leu 180 185
190His Gln Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val
Ser Asn 195 200 205Lys Ala Leu Pro
Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly 210
215 220Gln Pro Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro
Ser Arg Asp Glu225 230 235
240Leu Thr Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr
245 250 255Pro Ser Asp Ile Ala
Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn 260
265 270Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp
Gly Ser Phe Phe 275 280 285Leu Tyr
Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn 290
295 300Val Phe Ser Cys Ser Val Met His Glu Ala Leu
His Asn His Tyr Thr305 310 315
320Gln Lys Ser Leu Ser Leu Ser Pro Gly Lys 325
3302345163DNAHomo sapiens 234cagctgagat ctcctagagt cggtgaaggg
tacaaagtaa aatacaatgt cgtttgtagt 60gttgttagta aggatgtcta gtggtgacgt
acactagtta ttttatcaaa aacgttgtta 120ccatgaatac tattagtaga aaataacaaa
tgtttatgac gaaatgttat caataagcca 180acgtgacaag tataatctaa aggttaatcg
agtgaatcct tgtattcagg gagcttgtcg 240agtcagtaga aaaagtaagg acaaagatag
gggatgtaga gaaaggaaac gtctgctgat 300agaggatgtg actttgtcct ttcgatcgaa
aaaaaaaaag tcacgataaa ttaataaagt 360tataggagag tagtttacat aaatttattg
ttttcgagtt cgtttttctt tctttataca 420ttaagaaagt ctcattttta gtgtgggtac
tggaccggtg actcccgaac tagttaagtg 480aaacttaaac cgtaatttat ggtaattcca
tataattgac taaaatttta ttctatataa 540gcactggtac aaaaattgaa agtttttaca
tcgacggtca cacactaaaa taaagtcaac 600atgttttata gatttggata tcgttacact
aattattttt gaatttgtat aaaaggtcat 660ggaattaaga cactatcctt ttaaaattag
actcataaaa ttaaagtatt agagatttta 720tcaaattact aaacagtaac acaacgacag
caaatgggtc gactagagtt ttcactataa 780attcctctaa taaaaccaga cgttgttgaa
ctatcctgat aaaatcccgg aaaaatttcg 840agataatttt gattgaatgt tgctaagttt
tgacaaaatt tgataaagtt ttactaaaat 900ctcggaaaac ttttgagaaa atttgtgaaa
aatttgagat aattttgatt attctattga 960actttattaa aagtacagtt tatgtaattg
acaaattaca aatttacggt ctacttttta 1020catttcgata gtcttaagtg ggtctatcct
catagaagta tcgtacaaaa agggacgaat 1080aaaaggtcac tagtgtaata aaacgatggt
accaataaaa tatgttaata gacttttttt 1140aatcaatact tctaattttc tcttctttta
taatttgtat tctctaagtc agaaagtaca 1200acttgacgaa ccaattgtca cttcaatcaa
aatttttttt ttttttgata aagacaatag 1260tcgactgaag agggatagac aactgaagag
ggtcgttttc taagaataaa atgtaaaatt 1320gatgacgaga gggtgggttg cccaccttag
ggggtctccc cctaaaggtt ctccggtgga 1380ccgtcaacga ctcccagtct tcacttcgat
cggtgaagga gaatccgtcc accggttcta 1440atgtcaactg gagaggacca taccgacttt
taacgacgta taccaatgtc cggaactccg 1500gaaaccctcc cgaatctctc aacgaccttg
tcagtcttcc acctccccga ctgtggtggg 1560tccgcgtctc cgtcccgagt cccggacgag
acgtccctaa ctgagtcggc gacggaccag 1620aagaagtctg gacaagactt aagatttgag
actcccccag cctactgcac cggtaagaaa 1680cggatttcgt aactcaaatg acgttccagt
cttttcgtac gtttcgggag tcttaccgac 1740gtttctcgag gttgttttgt taaatcttga
aataattcct tatccccctt cgatccttct 1800ttgagttttg tagttctaaa atttatgcga
agaaccagag gaacgatatt aatagaccct 1860attcgtacga caaaagacag acagggaatg
tacgggacac taataggcgt ttgttgtgtg 1920ggttcccgtc ttgaaacaat gaatttgtgg
taggacaaac gaagaaagga gtccttgaca 1980ccgacgtggt agacagaagt agaagggcgg
tagactactc gtcaacttta gaccttgacg 2040gagacaacac acggacgact tattgaagat
agggtctctc cggtttcatg tcaccttcca 2100cctattgcgg gaggttagcc cattgagggt
cctctcacag tgtctcgtcc tgtcgttcct 2160gtcgtggatg tcggagtcgt cgtgggactg
cgactcgttt cgtctgatgc tctttgtgtt 2220tgagatgcgg acgcttcagt gggtagtccc
ggactcgagc gggcagtgtt tctcgaagtt 2280gtcccctctc acaatctccc tcttcacggg
ggtggacgag gagtcaaggt cggactgggg 2340gagggtagga aaccggagac tgggaaaaag
gtgtcccctg gatggggata acgccaggag 2400gtcgagtaga aagtggagtg gggggaggag
gaggaaccga aattaatacg attacaacct 2460cctcttactt atttatttca cttagaaacg
tggacaccaa agagagaaag gagtaaatta 2520ttaataatag acaacaaaat ggttgatgag
ttaaagagaa tattccctga tttatacatc 2580agtaggattc cgcgtattgg taaatatttt
tagtaggaag taagataaaa tgggatagta 2640ggagacgttc tgtcaggagg gagtttgggt
gttcggaaga caggagtgtc aggggacccg 2700gtaccatcct ctctgaacga aggaacaaaa
ggggaggagt cgttcgggag tatcaggaaa 2760aattcccact gtccagaatg tcagtatata
ggaaactaag ttaagggact cttagttggt 2820ttcgtttaaa aagttttctt ctttggacga
tatttctctt agtaagtaac gttgtactat 2880attttattgt tgtgttattt tcgttaattt
atttgtttgt tatcccttta caaattcaag 2940tagtaccatg aatctgaatt accttacagt
acggaataaa tgtaaaaatt tgtccatgac 3000tccctgagga cagacggttc ccggcataac
tcatgaaagg tgttgcatta aattaggtgt 3060gatatgacac tctaattttt gtaagtaatt
ttacaacgtt tccaagatat ttcgactctc 3120tgtttatata agatattgag tcgttagggt
gaagatctac tgactcacag gggtgggtgg 3180ttttttgata cgttcttaca agtttcgtcg
aaataaatgt tttcggtttt taacctttat 3240cgggctaaca ggttgttatc ttactcaata
atttgacacc atacaaatat gtaatcttat 3300gggttactcc tcttaattgt tcgatgttga
tatggatgag tgtgtctact tagagtattt 3360ttattacaat gtattctctt tgagttacgt
tttctataca agacatacaa aagtaggtat 3420atttcaagtt ttggtccatt tttatttcaa
tctttaaacc tacctttaat gagaatcgac 3480ccccacccgc tcaatcacgg accctcttct
gttcttcccc gaagacccca gaaccattac 3540aagacaagga gcacacccca acacgtcaat
actagacacg tgacaagaca tatgtgtaat 3600acgaagtttt attgaagtgt atttcttgta
gaatatgggt caattatcta tcttctcctt 3660attcattatc cagttctggt acgtcgacca
ttcacccccc cggaccctag tttatcgatg 3720gacggattag gacgggagaa ctcgggactt
actcagacgg aaggtcccga gttccacgag 3780ttgttttgtt gtccggacga taaaaggacc
gtagacacgg gacaaaccga tcgatcctcg 3840tgtgtatgta tctttaattt actttgtctg
gaagtcgttc ccctgtctcc tgtcttaatt 3900ggaacgggtc tgtgaccttt gggtacatac
ttgtgagtgt acaaaccctt cccccttccc 3960gtgtacattt actcctgaga aggagtaaga
taccccgtga gaccgggacg gggagagtcg 4020atgagtaggt aggttgtgtg gaaagattca
tggagagaga cggatgtgag acttccccaa 4080gtcctcattg attgtgtcgt agggaaggga
gtttactgac tggtagggaa acaggacgaa 4140acaaaaagaa aggtcagtca tgaccctttc
accccttcct gtcagtacct ttttgatgta 4200ttccttcgtg gaacgggaag acggagaact
cttacaacta ctcatagttt agaaagtttg 4260aaacctccaa actcatcccc actctgagtc
attacaggga aggttactgt acttgaacga 4320gtgagtaggg acccccggtt taacttgtta
gtttccgtcc gtattaggtc aatacttaag 4380tttggaagaa gagtcttcta ttgtgagact
tccctttggg tgggtattgg attcgttcac 4440ttctgtccac gacgtccacc ttaacacagg
aagtttttcc atacgagttg aggaacgaga 4500accatgagta tttacccagt gtatttacac
tgaaataaac ctttatccca gaaacgtctc 4560cattagttca gttttaatcc agtatgactt
tacaaacact cctacgccac ttttacctag 4620taagtatata acgaccaccc ttatattttc
ccatatcgat gagatctttt atcaacagtc 4680aaagaacttt ttgatttgtt ttctgtggat
ggtatactgg gtccttaaca tgaggaaccc 4740ttaaatgggg gtcctttatt tttgaataca
ggtgtgtctt gggtatgtac taacaagtgt 4800cgtcgaaata aacaacatcg gtttcgatct
ttctcggttg ggtagggagt tatccgttga 4860tcggattgtt taacattata taggtacggt
atcttacgat actccgttat ttttccttgc 4920ttcacaacta tgtctcttga cctcactaag
acttcctgaa agatgactca cttttttcgg 4980ttagactttc ccagtgtatg gtacactaag
gaaaatgcat tgtaacaact tcactgtttt 5040aatatcccta tctctgtgct aagaccaacg
gtccccaatc ccaccacccc tttcttctca 5100tctgctttga tatttccctc taggggccca
tggctcgagc ttaagtagct actatcgccg 5160gcg
5163235106PRTHomo sapiens 235Thr Val Ala
Ala Pro Ser Val Phe Ile Phe Pro Pro Ser Asp Glu Gln 1 5
10 15Leu Lys Ser Gly Thr Ala Ser Val Val
Cys Leu Leu Asn Asn Phe Tyr 20 25
30Pro Arg Glu Ala Lys Val Gln Trp Lys Val Asp Asn Ala Leu Gln Ser
35 40 45Gly Asn Ser Gln Glu Ser
Val Thr Glu Gln Asp Ser Lys Asp Ser Thr 50 55
60Tyr Ser Leu Ser Ser Thr Leu Thr Leu Ser Lys Ala Asp Tyr Glu
Lys 65 70 75 80His Lys
Leu Tyr Ala Cys Glu Val Thr His Gln Gly Leu Ser Ser Pro
85 90 95Val Thr Lys Ser Phe Asn Arg Gly
Glu Cys 100 105
User Contributions:
comments("1"); ?> comment_form("1"); ?>Inventors list |
Agents list |
Assignees list |
List by place |
Classification tree browser |
Top 100 Inventors |
Top 100 Agents |
Top 100 Assignees |
Usenet FAQ Index |
Documents |
Other FAQs |
User Contributions:
Comment about this patent or add new information about this topic:
People who visited this patent also read: | |
Patent application number | Title |
---|---|
20210240136 | Watch That Facilitates Replacement of Watch Core and Bezel |
20210240135 | METHOD FOR PROCESSING A HOLOGRAM, AND ASSOCIATED DEVICE, HOLOGRAPHIC DISPLAY SYSTEM AND COMPUTER PROGRAM |
20210240134 | HOLOGRAPHIC RECONSTRUCTION APPARATUS AND METHOD |
20210240133 | HOLOGRAPHIC OPTICAL APPARATUS, HOLOGRAPHIC OPTICAL SYSTEM, AND HOLOGRAPHIC DISPLAY SYSTEM |
20210240132 | IMAGE FORMING APPARATUS THAT CONTROLS REGULATION UNIT |