Patent application title: ERYTHROVIRUS AND ITS APPLICATIONS
Inventors:
Quang Tri Nguyen (Ivry Sur Seine, FR)
Antonie Garbarg-Chenon (Paris, FR)
Veronique Auguste (Paris, FR)
IPC8 Class: AC12P2104FI
USPC Class:
435 693
Class name: Micro-organism, tissue cell culture or enzyme using process to synthesize a desired chemical compound or composition recombinant dna technique included in method of making a protein or polypeptide antigens
Publication date: 2008-10-09
Patent application number: 20080248528
Inventors list |
Agents list |
Assignees list |
List by place |
Classification tree browser |
Top 100 Inventors |
Top 100 Agents |
Top 100 Assignees |
Usenet FAQ Index |
Documents |
Other FAQs |
Patent application title: ERYTHROVIRUS AND ITS APPLICATIONS
Inventors:
Quang Tri Nguyen
Antonie Garbarg-Chenon
Veronique Auguste
Agents:
FOLEY & LARDNER LLP
Assignees:
Origin: SAN DIEGO, CA US
IPC8 Class: AC12P2104FI
USPC Class:
435 693
Abstract:
The invention relates to nucleic sequences derived from a human
erythrovirus type V9, fragments of the sequences and their methods of use
including applications as a diagnostic reagent and as immunogenic agent.Claims:
1. A method of making a polypeptide capable of being recognized by
antibodies induced by an erythrovirus V9 or capable of inducing the
production of antibodies to erythrovirus V9, the method
comprising:providing for expression of an erythrovirus V9 polypeptide in
a host cell, said host cell transformed with a recombinant nucleic acid
encoding at least seven continuous amino acids of an amino acid sequence
selected from the group consisting of SEQ ID Nos. 82, 86, 88, 92 or
95-104; andrecovering the polypeptide.
2. The method of claim 1, wherein said encoding recombinant nucleic acid comprises SEQ ID No. 82.
3. The method of claim 1, wherein said encoding recombinant nucleic acid comprises SEQ ID No. 86.
4. The method of claim 1, wherein said encoding recombinant nucleic acid comprises SEQ ID No. 88.
5. The method of claim 1, wherein said encoding recombinant nucleic acid comprises SEQ ID No. 92.
6. The method of claim 1, wherein said host cell is an insect cell.
7. The method of claim 6, wherein said insect cell is SF9.
8. The method of claim 1, wherein the polypeptide comprises the amino acid sequences of SEQ ID NO: 86.
9. The method of claim 1, wherein the polypeptide comprises the amino acid sequences of SEQ ID NO: 92.
10. The method of claim 9, wherein the polypeptide is recovered in the form of an empty viral capsid.
Description:
[0001]The present invention relates to nucleic sequences derived from a
human erythrovirus, to their fragments as well as to their applications
as diagnostic reagent and as an immunogenic agent.
[0002]Sero-epidemiological studies show that infection with the parvovirus B19, recently renamed erythrovirus B19, is commonly and widely distributed worldwide.
[0003]In Europe, the seroprevalence for erythrovirus B19 is about 10% in subjects under 5 years, about 50% for subjects over 20 years and greater than 90% in elderly persons.
[0004]The high seroprevalence rate suggests that erythrovirus B19 is highly contagious. During epidemics, the rate of transmission to subjects in close contact is 10 to 60%, the route of transmission being mainly aerial (respiratory secretions).
[0005]Erythrovirus B19 is a specifically human virus. Acute infection commonly causes benign maculopapular skin rashes in children (epidermal megalerythema or 5th disease). Arthralgias may accompany the rashes and may exceptionally become chronic.
[0006]A transient acute erythroblastic attack usually occurs in patients already carrying a chronic haemolytic anaemia (sickle cell anaemia, thalassaemia, pyruvate kinase deficiency and the like), causing a transient aregenerative acute anaemia.
[0007]Acute primary infection with erythrovirus B19 is particularly dangerous in pregnant women with a risk of transmission to the fetus estimated at 30%. The risk of foetal death by anaemia, hepatic insufficiency, cardiac insufficiency and foetoplacental anasarca is estimated at between 5 and 9%.
[0008]Chronic infections with erythrovirus B19 are found essentially in immunosuppressed subjects (chronic myeloid leukaemia, humoral and cellular immune deficiency, organ or marrow transplants, AIDS diseases).
[0009]In seropositive HIV-1 patients, chronic infection with erythrovirus B19 is responsible for chronic anaemia, but can also act on the other lineages (neutropenia and especially thrombopenia). The absence of a sufficient humoral immune response in these patients allows the installation of a chronic erythroviraemia and explains both the chronic erythroblastopenia and the absence of other symptoms such as rash or arthralgias.
[0010]Erythrovirus B19 is a virus having a single-stranded DNA genome of about 5.4 kbases; it is the only erythrovirus classified to date; all the strains which have been sequenced and which have been the subject of a publication in the sequence libraries (GenBank or EMBL) exhibit a low genetic variability (98% nucleic sequence similarity over the whole genome and 96% similarity over the VP1 region) (R. O. SHADE, J. Virol., 1986, 58, 3, 921-936, B19-AU).
[0011]Virological diagnosis of erythrovirus B19 infections is based essentially on the detection of the viral genome, insofar as the culture cannot be carried out routinely.
[0012]For acute infections with erythrovirus B19 (primary infections), this detection can be made by gene amplification (PCR), but also be hybridization (dot-blot) given the viral titre, which is usually very high during primary infections (up to 1014/ml of serum); however, the viral titre is much lower during chronic infections and only a gene amplification detection method can be envisaged.
[0013]These detection techniques are dependent on the genetic variability of the virus tested for; the reagents prepared from known erythrovirus B19 sequences do not make it possible to detect the variant erythro-virus infections, either by gene amplification or by B19 serodiagnosis.
[0014]Indeed, the existing serodiagnostic tests are specific for erythrovirus B19 (International Application PCT WO 91/12269; International Application POT WO 96/09391 (IDEIA® Parvovirus B19 IgG and IgM, DAKO; Parvovirus B19 IgG and IgM Enzyme Immunoassay, BIOTRIN)).
[0015]Consequently, the detection techniques specified above risk producing negative results both at the nucleic level and with respect to the antibody response.
[0016]The identification and the taking into account of new variants are important for developing: [0017]reagents for the detection and diagnosis of human erythrovirus infections (serodiagnosis, PCR, hybridization), which are sufficiently sensitive and specific, that is to say which do not lead to false-negative or false-positive results, [0018]compositions capable of protecting against all erythrovirus infections (vaccines), and [0019]compositions capable of treating a variant erythrovirus infection (serotherapy, monoclonal anti-bodies).
[0020]The inventors therefore set themselves the aim of providing erythrovirus-derived sequences capable of allowing the detection of a variant erythrovirus (called erythrovirus type V9), that is to say which is genetically distant from erythrovirus B19.
[0021]The subject of the present invention is a nucleic acid sequence, characterized in that it is selected from the group consisting of: [0022]the sequences derived from an erythrovirus which, molecularly, cannot be recognized as an erythro-virus B19 because it exhibits a genetic divergence or distance≧10% (<90% similarity) over the whole genome with respect to the erythrovirus B19 sequences and which exhibit a genetic divergence of less than or equal to 6% (>94% similarity) with respect to the sequence SEQ ID NO:1, [0023]the sequence SEQ ID NO:1, and [0024]the nucleotide sequences capable of hybridizing under stringent conditions with the said sequence ID NO:1.
[0025]This variant erythrovirus is called type V9 variant.
[0026]Stringent conditions are understood to mean, for the purposes of the present invention, the following conditions: [0027]hybridization for 3 to 24 h in a 1×SSC buffer containing 50% formamide, at 42° C., and [0028]3 washes of 15 min in a 2×SSC buffer, at 60° C.
[0029]The sequence SEQ ID NO:1, which corresponds to about 95% of the genome of an erythrovirus type V9 and which includes all the coding sequences, has a restriction map which is different from that of the B19 erythroviruses, in particular as regards the BamHII site (no site), HINDIII site (only one site) and PvuII site (five sites).
[0030]More precisely, the sequence SEQ ID NO: 1 has a restriction profile which is different from that of erythrovirus B19, in particular by the following restriction sites: AccI, AflIII, AlwI, AlwNI, ApaI, AvaI, AvaII, AvrII, BamHI, BanI, BanII, SbeI, BbsI, BceFI, BcgI, BcnI, BglII, BsgI, BsiEI, BsmI, BsmAI, Bsp120I, BspHI, BspMI, BsrFI, Bst1107I, BstEII, BstUI, Bsu36I, DpnI, DraIII, DsaI, EaeI, EagI, EarI, Ec1136I, EcoNI, Eco109I, EcoRI, EheI, FokI, HaeI, HaeIII, HgaI, HgiAI, HhaI, HincII, HindIII, HinPI, HpaI, KasI, MaeII, MboI, McrI, MscI, MunI, NarI, NciI, NcoI, NsiI, NspI, Nsp7524I, NspBII, NspCI, PflMI, PmeI, Ppu10I, PpuMI, stI, PvuII, SacI, Sau3AI, Scal, SfaNI, SfcI, SmaI, peI, SphI, SspI, StuI, StyI, SwaI, Tth111I, XbaI, XmaI and their isoschizomers.
[0031]The subject of the present invention is also fragments of sequence ID NO:1 which are capable of allowing the detection of an erythrovirus V9 and characterized in that they comprise a nucleotide sequence selected from the group consisting of:
a) a sequence corresponding to positions 328-2340 of SEQ ID NO:1, encoding the NS1 protein (SEQ ID NO:81),b) a sequence corresponding to positions 1796-2017 of SEQ ID NO:1, encoding the 7.5 kDa protein (SEQ ID NO:83),c) a sequence corresponding to positions 2336-4678 of SEQ ID NO:1, encoding the VP1 protein (SEQ ID NO:85),d) a sequence corresponding to positions 2336-3016 of SEQ ID NO:1, encoding the VP1u (SEQ ID NO:87),e) a sequence corresponding to positions 2523-2828 of SEQ ID NO:1, encoding the X protein (SEQ ID NO:89),f) a sequence corresponding to positions 3017-4678 of SEQ ID NO:1, encoding the VP2 (SEQ ID NO:91),g) a sequence corresponding to positions 4488-4883 of SEQ ID NO:1, encoding the 11 kDa protein (SEQ ID:93),h) a nucleotide sequence capable of hybridizing with one of the sequences SEQ ID NO:1, SEQ ID NO:81, SEQ ID NO:83, SEQ ID NO:85, SEQ ID NO:87, SEQ ID NO:89, SEQ ID NO:91 or SEQ ID NO:93,i) the sequences SEQ ID NO:2-80,j) the sequences SEQ ID NO:105 (E105f), 106 (E1987r), 107 (E2076f), 108 (E2151r), 109 (E2406r), 110 (E2149rs), 111 (E2717f), 112 (E2901r), 113 (e1855f), 114 (e2960r), 115 (e1863f), 116 (e2953), 117 (e2435fStul/BglII), 118 (e4813rEcoRI), 119 (e3115fBamHI), 120 (e4813rBamHI) and 121 (e1954fp) and k) the sequences complementary to the preceding sequences, the fragments derived from the preceding sequences of at least 17 nucleotides or their complementary sequences.
[0032]For the purposes of the present invention, nucleic sequence or nucleotide sequence (DNA or RNA sequence) is understood to mean one of the sequences as defined above and their complementary sequences (anti-sense sequences) as well as the sequences comprising one or more of the said sequences or fragments thereof.
[0033]The invention also includes nucleotide fragments complementary to the preceding ones as well as fragments modified with respect to the preceding ones by removal or addition of nucleotides in a proportion of about 15%, with respect to the length of the above fragments and/or modified at the level of the nature of the nucleotides, as long as the modified nucleotide fragments retain a capacity for hybridization with the erythrovirus V9 DNA or RNA sequence which is similar to that exhibited by the corresponding unmodified fragments.
[0034]Some of these fragments are specific and are used as a probe or primer; they hybridize specifically to an erythrovirus V9 or a related erythrovirus; a virus related to erythrovirus V9 is understood to mean an erythrovirus exhibiting a genetic divergence of less than or equal to 6%; these fragments are selected from the group consisting of the sequences SEQ ID NO:45-80 and NO:108 and 110, or their complementary sequences, the sequences derived from these sequences of at least 17 nucleotides and the sequences comprising the said sequences and they find application in the specific identification of an erythrovirus V9 or of a related erythrovirus.
[0035]Others of these fragments are used as primers, for the amplification of sequences derived from an erythrovirus type V9 or a related virus, such as the sequence SEQ ID NO:1; these primers are chosen from the group consisting of the sequences SEQ ID NO:2-44 and the sequences SEQ ID NO:105-109 and 111-121 or their complementary sequences and the sequences derived from the said sequences, of at least 17 nucleotides.
[0036]The said fragments also include, in the case of primers, the antisense sequences.
[0037]Such sequences find application for the differential identification of erythroviruses (erythrovirus B19 and erythrovirus V9), combined with probes as defined above and/or with suitable restriction enzymes.
[0038]The said primers preferably comprise between 17 and 30 nucleotides; preferred primers are the following: the sequence SEQ ID NO:105 (positions 1797-1815 of the sequence SEQ ID NO:1, which corresponds to the sequence SEQ ID NO:10, the sequence SEQ ID NO:106 (positions 1899-1879 of the sequence SEQ ID NO:1), which corresponds to a fragment of the antisense sequence of the sequence SEQ ID NO:11, the sequence SEQ ID NO:107 (positions 1968-1987 of the sequence SEQ ID NO:1), which corresponds to a fragment of the sequence SEQ ID NO:13, the sequence SEQ ID NO:108 (positions 2061-2043 of the sequence SEQ ID NO:1), which corresponds to a fragment of the antisense sequence of the sequence SEQ ID NO:58, the sequence SEQ ID NO:109 (positions 2317-2298 of the sequence SEQ ID NO:1), which corresponds to a fragment of the antisense sequence of the sequence SEQ ID NO:16, the sequence SEQ ID NO:111 (positions 2609-2627 of the sequence SEQ ID NO:1), which corresponds to a fragment of the sequence SEQ ID NO:19 and the sequence SEQ ID NO:112 (positions 2812-2793 of the sequence SEQ ID NO:1), which corresponds to a fragment of the antisense sequence of the sequence SEQ ID NO:23.
[0039]Preferred pairs of primers are the following: [0040]pair A: primers SEQ ID NO:111 and SEQ ID NO:112; [0041]pair B: primers SEQ ID NO:105 and SEQ ID NO:106; [0042]pair C: one of the sequences SEQ ID NO:2-44, 105, 106, 107, 109, 111 or 112 and one of the sequences SEQ ID NO:45-80, 108 or 110; [0043]pair D: primer SEQ ID NO:107 and primer SEQ ID NO:109; [0044]pair E: two primers selected from the sequences SEQ ID NO:2-44, 105, 106, 107, 109, 111 or 112; [0045]pair F: two primers selected from the sequences SEQ ID NO:45-80, 103 or 110.
[0046]These various primers can be used, depending on the fragment amplified, as sense primer or as antisense primer.
[0047]The subject of the present invention is also a variant erythrovirus, characterized in that its genome cannot be recognized molecularly as an erythrovirus B19, in that it exhibits a divergence of less than or equal to 6% with the sequence SEQ ID NO:1, as defined above, and in that its genome hybridizes specifically, under stringent conditions, as defined above, with one of the sequences SEQ ID NO:45 to 80, 108 and 110, as defined above.
[0048]The subject of the present invention is also a plasmid, characterized in that it comprises the viral genome of a variant erythrovirus strain, called erythrovirus V9 or a fragment thereof, which cannot be recognized molecularly as an erythrovirus B19 and which exhibits with the latter a genetic divergence of ≧10% over the whole genome with respect to the erythrovirus B19 sequences and a divergence of less than or equal to 6% with the sequence SEQ ID NO:1.
[0049]The viral genome of the said erythrovirus V9 is considered to be genetically distant from erythrovirus B19.
[0050]According to an advantageous embodiment of the said plasmid, it includes the sequence SEQ ID NO:1 (PCD.V9.C22).
[0051]The subject of the present invention is also a diagnostic reagent for the differential detection of type V9 erythroviruses, characterized in that it is selected from the sequences SEQ ID NO:45-80, 108 and 110, optionally labelled with an appropriate marker.
[0052]Among the appropriate markers, there may be mentioned radioactive isotopes, enzymes, fluorochromes, chemical markers (biotin and the like), haptens (digoxygenin and the like) and antibodies or appropriate base analogues.
[0053]The subject of the present invention is also a process for the rapid and differential detection of erythroviruses, by hybridization and/or gene amplification, using a biological sample as starting material, which process is characterized in that it comprises:
[0054](1) a step in which a biological sample to be analysed is brought into contact with at least one probe of sequence SEQ ID NO:45-80, 108 or 110, and
[0055](2) a step in which the product(s) resulting from the erythrovirus nucleotide sequence-probe interaction is (are) detected by any appropriate means.
[0056]Preferably, the hybridization comprises a pre-hybridization which is carried out in a buffer which comprises 5-60% of formamide; 1-5×SSC; 2% of blocking reagent (Blocking buffer, Boehringer Mannheim, Meylan, France); 0.1% of N-laurylsarcosine; 0.01-5% of SDS, at 40-70° C. for 90 minutes, and then the hybridization is carried out in 3 ml of a buffer of the same composition with 10 μl of labelled probe at 40-70° C. for 1-30 hours.
[0057]In accordance with the said process, it may comprise, prior to step (1); [0058]a step extracting the nucleic acid to be detected, belonging to the virus genome, which may be present in the biological sample, and [0059]at least one gene amplification cycle.
[0060]The gene amplification step is in particular carried out with the aid of one of the following gene amplification techniques: amplification with Qβ-replicase (I. Haruna et al., Proc. Nat. Acad. Sci. USA, 1965, 54, 579-587), PCR (polymerase chain reaction) (R. K. Saiki et al., 1986, Nature, 324:163-6), LCR (ligase chain reaction) (F. Barany, Proc. Nat. Acad. Sci. USA, 1991, 88, 189-193), ERA (end-run amplification) (C. Adams et al., 1994, Novel amplification technologies for DNA/RNA-based diagnostics meeting, San Francisco, Calif., United States), CPR (cycling probe reaction) (P. Duck et al., Bio-techniques, 1990, 9, 142-147) or SDA (strand displacement amplification) (GT. Walker, 1994, SDA: novel amplification technologies for DNA/RNA-based diagnostics meeting, San Francisco, Calif., United States).
[0061]According to an advantageous embodiment of the said process, the amplification cycles are carried out with the aid of a pair of primers selected from the sequences SEQ ID NO:2-44, 105-109 and 111-112 and fragments of these sequences, preferably from the pairs of primers as defined above.
[0062]When pair A is used, the amplification product is advantageously screened by the action of the restriction enzyme ApaI (GGGCCC): the product of amplification of a B19 genome is cleaved with ApaI (generating 2 fragments of 149 and 55 base pairs (bp)) whereas the product of amplification of a V9 genome is not cleaved by ApaI (a fragment of 204 bp); an agarose or acrylamide gel electrophoresis makes it possible to distinguish between these restriction fragments.
[0063]When pair B is used, the product of amplification is advantageously screened by the action of one of the following restriction enzymes: BglII (AGATCT), or MunI (CAATTG); different fragments are thus obtained depending on whether an erythrovirus V9 or B19 is involved; a fragment which comprises a BglII restriction site is specific for the variant erythrovirus V9 as defined above, whereas the B19 erythroviruses comprise an MunI site in this region. The product of amplification of a B19 genome is cleaved with MunI (generating 2 fragments of 36 and 67 bp) and is not cleaved by BgllI (a fragment of 103 bp) whereas the product of amplification of a V9 genome is cleaved by BglII (2 fragments of 19 and 84 bp) and is not cleaved by MunI (a fragment of 103 bp); an agarose or acrylamide gel electrophoresis makes it possible to distinguish between these different restriction fragments.
[0064]When pair C is used (a primer capable of hybridizing with all erythroviruses and a primer capable of specifically hybridizing with erythrovirus V9) or when pair F is used (two primers capable of specifically hybridizing with erythrovirus V9), the V9 genome is amplified whereas there is no specific amplification with the B19 genome.
[0065]When pair D is used, the product of amplification is advantageously screened by hybridization with a labelled specific probe for erythrovirus V9, selected from the sequences SEQ ID NO:58-60 and 110, preferably by hybridization with the probe of sequence SEQ ID NO:110; the product of amplification of a V9 genome hybridizes specifically with these probes and in particular the probe of sequence SEQ ID NO:110, whereas the product of amplification of a B19 genome does not hybridize with the abovementioned probes.
[0066]When pair E is used, the product of amplification is screened by any method of hybridization with a probe specific for erythrovirus V9, selected from the sequences SEQ ID NO:45-80, 108 and 110; in this case, the product of amplification of a V9 genome hybridizes with the probe, but not the product of amplification of a B19 genome.
[0067]The subject of the invention is also the use of the sequences described above, of fragments derived from these sequences or of their complementary sequences, for carrying out a method of hybridization or of gene amplification of erythrovirus nucleic sequences, these methods being applicable to the in vitro diagnosis of the potential infection of an individual with an erythrovirus type V9.
[0068]The subject of the present invention is also a method of screening and typing an erythrovirus V9 or a related virus, characterized in that it comprises bringing a probe selected from the group consisting of the sequences SEQ ID NO:45-80, 108 and 110, optionally labelled, into contact with the nucleic acid of the virus to be typed and detecting the nucleic acid-probe hybrid obtained.
[0069]The subject of the present invention is also products of translation, characterized in that they are encoded by a nucleotide sequence as defined above.
[0070]The subject of the present invention is also a protein, characterized in that it is in particular capable of being expressed with the aid of a nucleotide sequence selected from the group consisting of the sequences SEQ ID NO:81, 83, 85, 87, 89, 91 and 93, as defined above and the derived peptides comprising between 7 and 50 amino acids.
[0071]Peptide is understood to mean below both the proteins and the peptides, as defined above.
[0072]Such peptides are in particular capable of being recognized by antibodies induced by an erythro-virus V9 and/or of inducing the production of anti-erythrovirus V9 antibodies.
[0073]The said peptides are in particular selected from the sequences SEQ ID NO:82 (NS1 protein), SEQ ID NO:86 (VP1 protein), SEQ ID NO:88 (single VP1 protein), SEQ ID NO:92 (VP2 protein) and SEQ ID NO:95-104, namely fragments of the VP1 protein [VP1a peptide (SEQ ID NO:95); VP1b peptide (SEQ ID NO:96); VP1c peptide (SEQ ID NO:97); peptide VP1d (SEQ ID NO:98); peptide VP1e (SEQ ID NO:99) and peptide VP1f (SEQ ID NO:100)], or fragments of the VP2 protein [peptide VP2a (SEQ ID NO:101); peptide VP2b (SEQ ID NO:102); peptide VP2c (SEQ ID NO:103); peptide VP2d (SEQ ID NO:104)] as well as the derived peptides comprising 7 to 50 amino acids.
[0074]The subject of the invention is also immuno-genic compositions comprising one or more products of translation of the nucleotide sequences according to the invention and/or one or the peptides as defined above, obtained in particular by synthetic means.
[0075]The subject of the invention is also the anti-bodies directed against one or more of the peptides described above and their use for carrying out in particular a differential in vitro method of diagnosis of the infection of an individual with an erythrovirus.
[0076]The subject of the present invention is also a method for the immunological detection of an erythro-virus V9 infection, characterized in that it comprises: [0077]for the detection of anti-erythrovirus V9 antibodies, bringing a biological sample into contact with a peptide according to the invention (serodiagnosis), [0078]for the detection of erythrovirus V9 viral proteins, bringing a biological sample into contact with an antibody according to the invention; [0079]the reading of the result being revealed by an appropriate means, in particular EIA, ELISA, RIA, fluorescence.
[0080]By way of illustration, such an in vitro method of diagnosis according to the invention comprises bringing a biological sample, collected from a patient, into contact with antibodies according to the invention or peptides according to the invention, and detecting, with the aid of any appropriate method, in particular with the aid of labelled anti-immunoglobulins, immunological complexes formed between the antigens or the antibodies of the erythroviruses which may be present in the biological sample and the said antibodies or the said peptides, respectively.
[0081]The reagents according to the invention are in particular useful for the detection of the V9 erythro-viruses and related viruses in pregnant women, in HIV-positive patients with anaemia and/or chronic thrombopenia, recipients of organ or marrow trans-plants, and patients having a central acute anaemia and for whom the tests for the detection of erythrovirus B19 are negative.
[0082]The subject of the invention is, in addition, an erythrovirus diagnostic kit, characterized in that it includes at least one reagent according to the invention (probes, pairs of primers, peptides or anti-bodies).
[0083]In addition to the preceding features, the invention further comprises other features which will emerge from the description which follows, which refers to exemplary embodiments of the method which is the subject of the present invention as well as to the appended drawings, in which:
[0084]FIGS. 1, 2 and 3 illustrate phylogenetic trees for erythrovirus V9: FIG. 1: phylogenetic tree for the complete erythrovirus sequence; FIG. 2: phylogenetic tree for the erythrovirus NS1 genes; FIG. 3: phylogenetic tree for the erythrovirus VP1 genes;
[0085]FIGS. 4, 5 and 6 represent the genetic distances for the complete erythrovirus sequences (FIG. 4), for the erythrovirus NS1 genes (FIG. 5) and for the erythrovirus VP1 genes (FIG. 6);
[0086]FIG. 7 illustrates the restriction map of sequence ID NO:1.
[0087]It should be understood, however, that these examples are given solely by way of illustration of the subject of the invention and do not constitute in any manner a limitation thereto.
EXAMPLE 1
Production of Sequences Conforming to the Invention
[0088]An AatII/AatII restriction fragment of 5028 hp, representing virtually the entire (95%) genome of the V9 variant, was cloned into the sequencing vector pcDNA2.1 (Invitrogen, Netherlands) in the following manner.
[0089]The single-stranded viral DNA was extracted from the serum of a patient with an acute erythro-blastopenic attack with the aid of a QIAamp Blood Kit column (Qiagen S.A., France). Using a step of hybridization in a 50 mM Nacl buffer at 56° C. for 16 hours, the viral DNA is converted to double-stranded DNA. Next, 1.3 μg of double-stranded viral DNA is subjected to the AatII restriction enzyme (18 U) at 37° C. for 2 hours, the restriction enzyme is then inactivated at 65° C. for 15 minutes. The product is dialysed on a Millipore VSWPO13000 cellulose acetate and nitrate membrane against water for 2 hours. The double-stranded viral DNA AatII/AatII restriction fragment thus prepared is frozen at -20° C. while awaiting the ligation step.
[0090]The vector pCDNA2.1 is modified in order to receive the AatII fragment by site-directed insertion mutation: the EagI restriction site of the multiple cloning site was removed and replaced with an AatII site. The vector pcDNA2.1a thus produced was amplified in bacterial culture and purified with the aid of a QIAfilter Plasmid Maxi Kit (Qiagen S.A., France). Next, 3 μg of the vector pcDNA2.1a is subjected to restriction with the enzyme AatII at 37° C. for 1 hour and then dephosphorylated with shrimp alkaline phosphatase (Boehringer Mannheim, Meylan, France). The enzymes are inactivated at 65° C. for 15 minutes.
[0091]The ligation is carried out with a vector/viral DNA insert molar ratio of 1/1, that is to say 50 ng of vector and 100 ng of viral DNA insert, prepared as described above, with the aid of 1 U of T4 ligase (Life Technologies, France) at 24° C. for 16 hours. After a 1/2 dilution, the ligation product is heated at 65° C. in order to inactivate the T4 ligase and then cooled on ice. Electrocompetent bacteria Sure® (Stratagene, Heidelberg, Germany) are electrophorized with 2 or 4 μl of this ligation solution (1500 V, 50 μF, 200Ω) and then incubated with 1 ml of SOC medium (Life Technologies, France) for 1 hour before being spread on a Luria Broth agar medium (Life Technologies, France) containing 100 μg/ml of amoxicillin, 15 μg/ml of tetra-cycline, 100 μg/ml of IPTG and 50 μg/ml of X-gal.
[0092]Twenty four (recombinant) white colonies were selected, their plasmid is extracted by minipreparation of DNA and a rough restriction map (AatII, AatII+BamHI, BamHI, BamHI+BglII, HindII) made it possible to select 2 recombinant clones with an insert having a size and a restriction map compatible with a V9 viral DNA insert.
[0093]These 2 clones (2 and 22) were sequenced with the aid of an automated sequencer ABI 377 (Perkin Elmer, France): they indeed contain an insert of 5028 bp, the 2 sequences are identified except at position 1165 (A and G for the clones 2 and 22 respectively). The direct sequence of the V9 viral DNA made it possible to determine that it is the G at position 1165 which is correct; it is therefore clone 22 which was selected (PCD.V9.C22), whose sequence corresponds to SEQ ID NO:1.
[0094]FIGS. 1 to 6 show the genetic distances which exist between erythrovirus V9 and erythrovirus B19. In these figures, the different erythrovirus sequences are represented by their mnemonic in GenBank (release 103.0 of October 1997).
EXAMPLE 2
Diagnosis of an Erythrovirus type V9 by DNA Hybridization (Dot Blot or Slot Blot or Microplate) with a Specific Probe
[0095]The viral DNA is extracted, for example, with the aid of a QIAamp Blood Kit column (Qiagen S.A., France) or of any other method of extracting nucleic acids from a biological sample (blood, serum, plasma, amniotic fluid, bone marrow, tissue). The DNA in solution is denatured at 95° C. for 2 minutes and then cooled on ice, transferred onto nylon or cellulose nitrate membrane by vacuum filtration and then fixed (heating of the membrane at 80° C. for 1 hour). The membrane is then hybridized under stringent conditions with a DNA or RNA probe specific for V9, such as the sequence SEQ ID NO:1 or its complementary sequence or a fragment thereof, in particular the sequences SEQ ID NO:45 to SEQ ID NO:80 and 110 and their complementary sequences, or a fragment of these sequences which are appropriately labelled. This labelling may be a labelling with a radioelement (32P, 33P, 35S, 3H, 14C or another radio isotope), a cold labelling (biotin), fluorescent marker, digoxygenin or any other molecule which may be coupled or incorporated into a DNA or RNA fragment and which can be detected by a specific antibody, or by a ruthenium chelate). In the case of a labelling with a radioactive element, the visualization is performed by autoradiography or any other method allowing the detection of the radioisotope emission (such as Phosphorimager, Molecular Dynamics, Bondoufle, France). In the case of a labelling with biotin, the visualization is performed with the aid of an enzyme/streptavidine conjugate and a suitable visualization substrate. In the case of a fluorescent labelling, the visualization is made with the aid of a fluoro-Imager (Molecular Dynamics, Bondoufle, France) or any other apparatus capable of detecting the fluorescence emission. In the case of a labelling with digoxygenin (or with another antigen), the visualization is made with the aid of an anti-digoxygenin antibody (or an antibody specific for the antigen used for the labelling), coupled directly to an enzyme (alkaline phosphatase, peroxidase or any other enzyme), or in an indirect manner with an anti-digoxygenin antibody (or an antibody specific for the antigen used for the labelling) and an antibody coupled to an enzyme. A substrate suitable for the enzyme of the conjugate is used for the visualization. In the case of a labelling with ruthenium chelate (such as TBR), the visualization is performed by an electro-chemiluminescence reaction (G. F. Blackburn et al., Clin. Chem., 1991, 37:1534-1539).
[0096]A variant of this technique comprises the fixing of viral DNA on a microplate or another solid support and hybridization with a labelled probe as specified above.
[0097]Another variant of this technique comprises the fixing of an unlabelled probe on a microplate or another solid support and hybridization with the viral DNA of the sample which would have been labelled beforehand.
EXAMPLE 3
Diagnosis of an Erythrovirus Type V9 by Gene Amplification (PCR or Polymerase Chain Reaction) and Hybridization
[0098]Viral DNA is extracted from a biological sample (blood, serum, plasma, amniotic fluid, bone marrow, tissue) with the aid of a QIAamp Blood Kit column conventional technique (Sambrook J. et al., 1989, Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor).
[0099]The probe is an oligonucleotide of 20-30 mers, a fragment of a sequence specific for V9 (SEQ ID NO:45 to 80, 108 and 110) or their complementary sequences. It is labelled in 3' with DIG-dUTP with the aid of the DIG Oligonucleotide Tailing kit (Boehringer Mannheim, Meylan, France).
[0100]The transfer membrane is prehybridized in a buffer comprising (50% formamide; 5×SSC; 2% of blocking reagent (Boehringer Mannheim, Meylan, France); 0.1% of N-laurylsarcosine; 0.02% of SDS), at 42° C. for 90 minutes. The hybridization is carried out in 3 ml of a buffer of the same composition with 10 μl of labelled probe at 42° C. for 16 hours. The membrane is washed twice in 2×SSC buffer containing 0.1% SDS at 60° C. for 10 minutes, and then twice in 1×SSC buffer containing 0.1% SDS at 60° C. for 10 minutes. The membrane is then visualized with DIG Luminescent Detection Kit (Boehringer Mannheim, Meylan, France) and an autoradiography.
EXAMPLE 4
Group Diagnosis and Differential Diagnosis of Type B19 and V9 Erythroviruses by Gene Amplification and Hybridization
[0101]The viral DNA is extracted from a biological sample (blood, serum, plasma, amniotic fluid, bone marrow, tissue) with the aid of a QIAamp Blood Kit column (Qiagen S.A., France) or of any other method of extracting nucleic acids.
[0102]The PCR is carried out according to the method described by Saiki et al. (Nature, 1986, cited above) with 10 μl of DNA solution in a final volume of 100 μl of reaction mixture (50 mM KCl; 10 mM Tris-HCl pH 8.3; 2.5 mM MgCl2; 200 μM dNTP; 25 pmol of sense and antisense oligonucleotides) with 1.5 IU of AmpliTaq Gold® (Perkin Elmer, France). The amplification primers are oligonucleotides of 20 to 25 mers chosen so as to amplify the DNA of B19 and of the variant V9: the 2 (Qiagen S.A., France) or of any other method of extracting nucleic acids.
[0103]The PCR is carried out according to the method described by Saiki et al. (Nature, 1986, 324: 163-66) with 10 μl of DNA solution in a final volume of 100 μl of reaction mixture (50 mM KCl; 10 mM Tris-HCl pH 8.3; 2.5 mM MgCl2; 200 μM dNTP; 25 pmol of sense and antisense oligonucleotides) with 1.5 IU of AmpliTaq Gold® (Perkin Elmer, France). The amplification primers are oligonucleotides of 20 to 25 mers chosen so as to amplify only the DNA of the V9 variant: either the 2 primers (sense and antisense) are fragments of the sequences specific for V9 (SEQ ID NO:45 to 80, 108 and 110) or their complementary sequences, or one of the primers is chosen from the sequences specific for V9 (SEQ ID NO:45-80, 108 and 110) or their complementary sequences whereas the other primer is chosen from the sequences capable of hybridizing both the B19 erythro-viruses and the V9 erythroviruses (SEQ ID NO:2 to 44, 105-107, 109 and 111-112) or their complementary sequences. The temperature cycles are applied to the reaction mixture by a thermocycler (T9600, Perkin Elmer, France) according to the following programme:
[0104]1 Cycle: [0105]6 minutes at 95° C.
[0106]5 Cycles: [0107]60 seconds at 95° C. [0108]30 seconds at 60° C. [0109]30 seconds at 72° C.
[0110]45 Cycles: [0111]30 seconds at 95° C. [0112]30 seconds at 60° C. [0113]30 seconds at 72° C.
[0114]1 Cycle: [0115]5 minutes at 72° C.
[0116]The product of amplification is deposited on a 1.3% agarose gel so as to be subjected to an electro-phoretic separation and a transfer onto a nylon membrane loaded by capillarity according to a (sense and antisense) primers are fragments of the sequences capable of hybridizing both with the B19 erythroviruses and with the V9 erythroviruses (SEQ ID NO:2 to 44, 105-107, 109, 111-112) or of their complementary sequences. The temperature cycles are applied to the reaction mixture by a thermocycler (T9600, Perkin Elmer, France) according to the following programme:
[0117]1 Cycle: [0118]6 minutes at 95° C.
[0119]5 Cycles: [0120]60 seconds at 95° C. [0121]seconds at 60° C. [0122]seconds at 72° C.
[0123]45 Cycles: [0124]30 seconds at 95° C. [0125]seconds at 60° C. [0126]seconds at 72° C.
[0127]1 cycle: [0128]5 minutes at 72° C.
[0129]The product of amplification is deposited on a 1.3% agarose gel so as to be subjected to an electro-phoretic separation and a transfer onto a nylon membrane loaded by capillarity according to a conventional technique (Sambrook J. et al., 1989, cited above).
[0130]The probe is an oligonucleotide of 20-30 mers, a fragment of a sequence specific for V9 (SEQ ID NO:45 to 80, 108 and 110) or their complementary sequences, or alternatively specific for B19, or finally which hybridizes both with B19 and with V9 (SEQ ID NO:2 to 44 or 105-107, 109, 111-112), if it is sought to carry out a group diagnosis. It is labelled in 3' with DIG-dUTP with the aid of the DIG Oligonucleotide Tailing kit (Boehringer Mannheim, Meylan, France).
[0131]The transfer membrane is prehybridized and hybridized under the same conditions as those set out in Example 3.
EXAMPLE 5
Group Diagnosis and Differential Diagnosis of Type B19 and V9 Erythroviruses by Gene Amplification and Restriction Enzymes
[0132]Extraction of the viral DNA from a biological sample (blood, serum, plasma, amniotic fluid, bone marrow, tissue) with the aid of a QIAamp Blood Kit column (Qiagen S.A., France) or of any other method of extracting nucleic acids.
[0133]The NS1a PCR is carried out according to the method described by Saiki et al. with 5 μl of DNA solution in a final volume of 50 μl of reaction mixture (50 mM KCl; 10 mM Tris-HCl pH 8.3; 2.5 mM MgCl2; 200 μM dNTP; 12.5 pmol of sense and antisense oligonucleotides) with 1.5 IU of AmpliTaq Gold® (Perkin Elmer, France) and the pair of primer B (sense primer e1905f, SEQ ID NO:105; and the antisense primer e1987r, SEQ ID NO:106) using the following temperature cycles (on a thermocycler T9700, Perkin Elmer, France):
[0134]1 Cycle: [0135]6 minutes at 94° C.
[0136]5 Cycles: [0137]30 seconds at 94° C. [0138]1 minute at 55° C. [0139]1 minute at 72° C.
[0140]45 Cycles:
[0141]30 seconds at 94° C.
[0142]30 seconds at 60° C.
[0143]30 seconds at 72° C.
[0144]1 Cycle:
[0145]7 minutes at 72° C.
[0146]An aliquot of the product of amplification (10 μl) was deposited on a 2% agarose gel so as to be subjected to an electrophoretic separation and a transfer onto a nylon membrane loaded by capillarity according to a conventional technique (J. Sambrook et al., 1989, cited above). The membrane was hybridized with an oligonucleotide probe of 36 mer, e1954fp (SEQ ID NO:121): ACCAGTATCAGCAGCAGTGGTGGTGAAAGCTCTGAA, a fragment of the sequence SEQ ID NO:11. This probe allows a detection of type B19 and V9 erythroviruses.
[0147]An aliquot of the product of amplification (10 μl) was subjected to the action of the restriction enzyme MunI for 2 hours and then subjected to an electrophoretic separation on a 2% agarose gel. As described above, the erythrovirus type is B19 if there is cleavage, and V9 if there is no cleavage.
[0148]Results of the NS1a PCR:
[0149]79 samples found to be indeterminate or weakly positive with the old B19 PCR (Lefrere, et al., Transfusion, 1995, 35:389-391) were screened with the aid of the new NS1a PCR (consensus erythrovirus, sequences according to the invention). Of the 79 samples screened, 31 are positive and were typed with the aid of the restriction enzyme MunI: 18 (58%) were found to be of type B19 and 13 (42%) of type V9.
[0150]The samples which were positive by NS1a PCR were able to be amplified on 1100 bp by a nested PCR (S1S2 PCR) with the aid of the pair of primers e18S55f (SEQ ID NO:113) and e2960r (SEQ ID NO:114) for the first amplification step of 30 cycles (PCRS1), and of the pair of primers e1863f (SEQ ID NO:115) and e2953r (SEQ ID NO:116) for the second amplification step of 50 cycles (PCRS2). 15 samples were found to be positive by S1S2 PCR and sequenced on 1110 bp (13 of type B19 by NS1A PCR and 2 of the variant type). The analysis of the sequences showed that: [0151]the B primers (sense primer e1905f, SEQ ID NO:105; and antisense primer e1987r, SEQ ID NO:106), are perfectly conserved for all the 15 sequences (of the B19 and variant type) as well as for all the known B19 sequences, confirming their importance for use for a consensus diagnostic test for B19 and V9, [0152]the probe e1954fp (SEQ ID NO:121), a fragment of the sequence SEQ ID NO:11 is equally well conserved for the 15 sequences as well as for all the known B19 sequences, [0153]the B19 sequences form a well homogeneous group with less than 1.2% divergence between them (7 B19 sequences of GenBank and the 13 B19 sequences of this study), [0154]finally for the 2 sequences typed variant erythrovirus by NS1a PCR with MunI digestion, less than 4.5% divergence with V9 is observed.
EXAMPLE 6
Cloning of the Capsid Genes VP1 and VP2 of V9 into a Baculovirus Expression Vector
[0155]First Step:
[0156]Cloning of the VP1 Gene into a Bacterial Plasmid
[0157]The VP1 gene of V9 is amplified by PCR according to the method described by Saiki et al. (Nature, 1986, 324:163-166) with 10 μl of a 10-2 dilution of V9 viral DNA in a final volume of 100 μl of reaction mixture (20 mM Tris-HCl pH 8.8; 10 mM KCl, 10 mm (NH4)2SO4; 2 mM MgSC4; 0.1% Triton X-100; 0.1 mg/ml of BSA; 0.2 mM dNTP; 25 pmol of sense primers (e2435fStuI/BglII: AAAGGCCTAGATCTTGTAGATTATGAGTAAAAC, SEQ ID NO:117) and antisense primers (e4813rEcoRI: GGGAATTCGGTGGGTGACGGTTCCTG, SEQ ID NO:118) with 2.5 U of Pfu Turbo® (Stratagene, France). The amplification primers were chosen on the V9 sequence on either side of the VP1 gene, their 5' end was modified by addition of restriction site(s) (indicated in their name) in order to facilitate the cloning. The temperature cycles applied to the reaction mixture are the following:
[0158]1 Cycle: [0159]1 minute at 94° C.
[0160]20 Cycles: [0161]1 minute at 94° C.
[0162]1 minute at 55° C.
[0163]2.5 minutes at 72° C.
[0164]1 Cycle:
[0165]10 minutes at 72° C.
[0166]The product of amplification of the VP1 gene was purified with the aid of a silica column (QIAquick PCR Purification Kit, Qiagen, France) and then subjected to the action of the restriction enzymes StuI and EcoRI. After heat inactivation of the restriction enzymes (20 min at 65° C.), the VP1 gene fragment was purified by dialysis against H2O on a 0.025 μm filter (VSWP01300, Millipore).
[0167]The plasmid pBacPAK8 (Clontech, France) is subjected to the action of the restriction enzymes StuI and EcoRI, the vector is then dephosphorylated with shrimp alkaline phosphatase (Boehringer, France). After heat inactivation of the restriction enzymes (20 min at 65° C.), the plasmid was purified with the QIAquick PCR Purification Kit (Qiagen).
[0168]The ligation is carried out with 50 ng of plasmid pBacPAK8 and 100 ng of VP1 fragment (prepared as described above) with T4 ligase (Life Technologies, France). After heat inactivation of the T4 ligase (10 min at 65° C.), 2 μl of ligation product diluted 1/2 with water are electroporated with 25 μl of electro-competent bacteria (Epicurian Coli Sure Electroporation-Competent cells, Strategene). The electroporated bacteria are immediately taken up in 1 ml of SOC medium (2% tryptone, 0.5% of yeast extracts, 10 mM NaCl, 2.5 mM KCl, 10 mM MgCl2, 10 mM MgSO4 and 20 mM glucose), incubated for 1 h at 37° C., with stirring. Next, 10 μl, 100 μl and 890 μl of the transformed bacteria are plated on Lennox agar dishes (10 g/l of peptone, 5 g/l of yeast extracts, 5 g/l NaCl, and 13 g/l agar) containing 50 μg/ml of ampicillin. After 24 h of incubation at 37° C., 24 colonies per construct are subcultured in 5 ml of Lennox medium with 50 μg/ml of ampicillin and incubated for 24 h at 37° C., with stirring.
[0169]The plasmid DNA is extracted by alkaline minilysis with the aid of the QIAprep 8 Turbo miniprep kit (Qiagen) and analysed by StuI/EcoRI and KpnI/-HindIII restriction in order to determine the presence of the insert and its orientation. The clone pB8-VP1.C5 was selected and the recombinant plasmid was checked by sequencing [0170]cloning of the VP2 gene into a bacterial plasmid.
[0171]The VP2 gene of V9 is amplified by PCR according to the method described by Saiki et al. (Nature, 1986, 324:163-166) with 10 μl of a 10-2 dilution of V9 viral DNA in a final volume of 100 μl of reaction mixture (20 mM Tris-HCl pH 8.8; 10 mM KCl, 10 M (NH4)2SO4; 2 mM MgSO4; 0.1% Triton X-100; 0.1 mg/ml of BSA; 0.2 mM dNTP; 25 pmol of sense primers (e3115fBamHI: CACGGATCCATACCCCAGCATGACTTCAG, SEQ ID NO:119) and antisense primers (e4813rBamHI: CACGGATCCGGTGGGTGACGGTTCCTG, SEQ ID NO:120) with 2.5 U of Pfu Turbo® (Stratagene, France). The amplification primers were chosen on the V9 sequence on either side of the VP2 gene, their 5' end was modified by addition of restriction site(s) (indicated in their name) in order to facilitate the cloning. The temperature cycles applied to the reaction mixture are the following:
[0172]1 Cycle: [0173]1 minute at 94° C.
[0174]20 Cycles: [0175]1 minute at 94° C. [0176]1 minute at 60° C. [0177]2.5 minutes at 72° C.
[0178]1 Cycle: [0179]10 minutes at 72° C.
[0180]The product of amplification of the VP2 gene was purified with the aid of a silica column (QIAquick PCR Purification Kit, Qiagen, France) and then subjected to the action of the restriction enzymes BamHI. The VP2 gene fragment was purified by the QIAquick PCR Purification Kit (Qiagen).
[0181]The plasmid pBacPAK8 (Clontech, France) is subjected to the action of the restriction enzymes BamHI, the vector is then dephosphorylated with shrimp alkaline phosphatase (Boehringer, France). After heat inactivation of the shrimp alkaline phosphatase (20 min at 65° C.), the plasmid was purified by phenol/chloroform extraction and precipitated with ethanol.
[0182]The ligation is carried out with 50 ng of plasmid pBacPAK8 and 100 ng of VP2 fragment (prepared as described above) with T4 ligase (Life Technologies, France). After heat inactivation of the T4 ligase (10 min at 65° C.), 2 μl of ligation product diluted 1/2 with water are electroporated with 25 μl of electro-competent bacteria (Epicurian Coli Sure Electroporation-Competent cells, Stratagene). The electroporated bacteria are immediately taken up in 1 ml of SOC medium, incubated for 1 h at 37° C., with stirring. Next, 10 μl, 100 μl and 890 μl of the transformed bacteria are plated on Lennox agar dishes containing 50 μg/ml of ampicillin. After 24 h of incubation at 37° C., 24 colonies per construct are sub-cultured in 5 ml of Lennox medium with 50 μg/ml of ampicillin and incubated for 24 h at 37° C., with stirring.
[0183]The plasmid DNA is extracted by alkaline minilysis with the aid of the QIAprep 8 Turbo miniprep kit (Qiagen) and analysed by BamHI and SacI restriction in order to determine the presence of the insert and its orientation. The clone pB8-VP2.C20 was selected and the recombinant plasmid was checked by sequencing: a base A deleted just upstream of the initiator ATG of VP2 can be noted, but this mutation can be ignored: it will not generate the expression of VP2.
[0184]Second Step:
[0185]Construction of the Recombinant Baculovirus Expressing VP1
[0186]The plasmid pB8-VP1.C5 is cotransfected with the baculovirus BacPAk6, linearized with Bsu361 (BacPAK® Baculovirus Expression System, Clontech), into SF9 insect cells with lipofectin. 2 isolations are performed by the lysis plaque method, the plaques isolated are transferred onto a nitrocellulose membrane, the membrane is then hybridized with a DNA probe specific for the VP1 gene of V9.
[0187]The recombinant baculovirus BacPAK6-pB8-VP1.C4.2 was thus selected. The expression of the VP1 protein was verified by Western Blotting on a cellular pellet of SF9 cells infected with this recombinant baculovirus. A band was observed at the expected size of VP1 (about 80 kDa) but which is not recognized by the anti-VP1-B19 monoclonal antibody (Argene, France). It is possible that this monoclonal antibody does not crossreact with the VP1 protein of V9.
[0188]The cloning into a baculovirus was verified by sequencing after PCR with the primers Bac1 and Bac2 (Clontech).
[0189]Construction of the Recombinant Baculovirus Expressing VP2
[0190]The plasmid pB8-VP2.C20 is cotransfected with the baculovirus BacPAk6, linearized with Bsu361 (BacPAK® Baculovirus Expression System, Clontech), into SF9 insect cells with lipofectin. 2 isolations are performed by the lysis plaque method, the plaques isolated are transferred onto a nitrocellulose membrane, the membrane is then hybridized with a DNA probe specific for the VP2 gene of V9.
[0191]The recombinant baculovirus BacPAK6-pB8-VP2.-C1.3 is selected. The expression of the VP2 protein was verified by Western Blotting on a cellular pellet of SF9 cells infected with this recombinant baculovirus. The anti-VP2-B19 monoclonal antibody (Argene, France) indeed detects a protein with an apparent molecular weight of about 58 kDa which is also clearly visible on the acrylamide gel. Virus-like particles of about 20 to 30 nm in diameter are observed by electron microscopy in the culture supernatants of the SF9 cells after infection with a recombinant baculovirus expressing the VP2 protein of V9. The size and the appearance of the virus-like particles obtained are in every respect in conformity with those described for B19. This observation confirms that the VP2 protein of V9 is produced in a native form by the baculovirus, because it is capable of forming empty capsides by self-assembling.
[0192]The cloning into a baculovirus was verified by sequencing after PCR with the primers Bac1 and Bac2 (Clontech).
[0193]Third Step:
[0194]The proteins VP1 and VP2 of V9 expressed in a baculovirus will be purified so as to be used as a target antigen for new serological tests for the diagnosis of erythrovirus V9 infections.
[0195]As is evident from the above, the invention is not at all limited to its embodiments, implementations and applications which have just been described more explicitly; it encompasses on the contrary all the variants which may occur to the specialist in this field, without departing from the framework or the scope of the present invention.
Sequence CWU
1
12115028DNAerythrovirus 1gacgtcacag gaaatgacgt aactgtccgc catcttgtac
cggaagtccc gcctaccggc 60ggcgaccggc ggcatctgat ttggtgtctt ctttttgaaa
ttttggcggg ctttttcccg 120ccttatgcaa ataagcggcc atgtttaatg ttatatttta
atttaattgg acaaacgcct 180aacggttact aggggcggag ttacgggcgg tatataagca
gctgcgttcc ctgacacttt 240cttttctggt tgcttttgac tggaactcac ttgctgttct
ttgcctgcta agtaacaggt 300atttatacta acttttaatt tactaacatg gagctatttc
ggggtgtctt gcacatttcc 360tctaacattc tggactgtgc taatgataac tggtggtgct
ctatgctaga cttagatact 420tctgactggg aaccactaac ccattctaac agattaatgg
caatatattt aagcagtgtt 480gcttctaaac ttgattttac tggggggccg ctagcaggtt
gcttatactt ttttcaggtg 540gaatgtaaca aatttgagga aggctatcat atccatgtag
ttattggtgg tccaggacta 600aatgctagaa acttaactgt gtgcgtagaa ggtttattta
ataatgttct ttaccatctt 660gtaactgaaa gtgttaaact taaatttttg ccagggatga
ctaccaaagg aaaatatttt 720agagatggag agcagtttat agaaaattac ttaatgaaaa
aaattccttt aaatgttgtg 780tggtgtgtaa caaatattga cgggtatata gacacctgta
tttccgcctc ttttcggcga 840ggagcttgtc atgctaaaag accccgcatt actgcaaata
cagacagtgc tactaatgaa 900actggggagt ctagctgtgg agggggagat gttgtgccat
tcgctggaaa gggaacaaaa 960gcggggttaa agtttcaaac catggtaaat tggctatgtg
aaaacagagt atttactgaa 1020gataaatgga aattagtgga ttttaaccaa tatactttat
taagtagcag tcacagtggc 1080agctttcaaa ttcaaagtgc cttaaagtta gctatttata
aagctactaa cttagtaccc 1140actagtacat tcttgttaca ttcagacttt gagcaggtta
cttgcattaa agaaaataaa 1200atagtaaaat tattattgtg tcaaaactat gatcctcttt
tagtgggtca acatgtgtta 1260aggtggattg acaaaaaatg tggtaaaaaa aacaccctgt
ggttttacgg gccaccaagt 1320actggaaaaa caaatttggc aatggctatt gctaaaactg
taccagtgta tggaatggtg 1380aattggaata atgaaaactt tccatttaat gatgtagcgg
ggaaaagttt ggtggtctgg 1440gatgaaggca ttattaagtc cactattgtg gaagctgcaa
aagccatttt aggtggtcag 1500ccaaccaggg tagatcagaa aatgcgtggc agtgtggcag
tgcccggtgt gcctgtggtt 1560ataaccagca atggtgacat tacatttgtt gtgagtggta
ataccactac aactgtgcat 1620gctaaagcct taaaggaacg gatggtaaag ctaaacttta
ccataagatg tagccctgac 1680atgggtttac ttacagaggc tgatgtacaa caatggctaa
cttggtgtaa tgcacaaagc 1740tggagccact atgaaaactg ggcaataaac tacacatttg
atttccctgg aataaatgca 1800gatgccctcc acccagatct ccaaaccacc cccattgtcc
cagacaccag tatcagcagc 1860agtggtggtg aaagctctga agaactcagt gaaagcagct
ttttcaacct catcactcca 1920ggcgcctgga acagtgaaac cccgcgctct agtacgcccg
tccccgggac cagttcagga 1980gaatcatttg tcggaagccc agtttcctcc gaagtggtag
ccgcgtcgtg ggaggaagct 2040ttttacacgc cgcttgccga tcagtttcgt gaactgttag
taggggttga ctttgtatgg 2100gatggtgtga ggggattgcc tgtttgctgt gtggaacata
taaacaacag tgggggaggg 2160ttggggcttt gccctcattg tattaatgtg ggagcttggt
ataatggatg gaaatttaga 2220gagtttactc cagacttagt gcgctgcagt tgtcatgtag
gagcctctaa cccattttct 2280gtgttaactt gtaaaaaatg tgcttacctg tctggattac
aaagttttgt agattatgag 2340taaaaccact aacaaatggt gggaaagcag tgacaaattt
gcccaggacg tgtataagca 2400gtttgtgcaa ttttatgaaa aagctactgg aacagactta
gagcttattc aaattttaaa 2460agaccattac aacatttctt tagataatcc tttagaaaac
ccctcttctt tatttgactt 2520agttgctcgc attaaaagta atcttaaaaa ctctccagac
ctatatagtc atcattttca 2580gagccatgga cagttatctg accaccccca tgccttatca
tccagtaaca gtagtgcaga 2640acctagagga gaaaatgcag tattatctag tgaagactta
cacaagcctg ggcaagttag 2700catacaatta cccggtacta actatgttgg gcctggcaat
gagctacaag ctgggcctcc 2760gcagaatgct gtggacagtg ctgcaaggat tcatgacttt
aggtatagcc aattggctaa 2820gttgggaata aatccttata cacattggac ggtagcagat
gaagaattgt taaaaaatat 2880aaaaaatgaa acagggtttc aagcacaagc agtaaaagat
tactttactt taaaaggtgc 2940agctgcccct gtggcccatt ttcaaggaag tttaccggaa
gtgcccgcgt acaacgcctc 3000agaaaaatac cccagcatga cttcagttaa ctctgcagaa
gccagcactg gtgcaggcgg 3060gggaggtagc aaccctacaa aaagcatgtg gagtgaaggg
gctacattta ctgctaattc 3120tgtaacgtgt acattctcta ggcaattttt aattccatat
gatccagagc atcattataa 3180agtgttctct ccagcagcta gtagctgcca caatgctagt
gggaaagagg caaaagtgtg 3240cactattagt cccattatgg ggtactctac tccgtggaga
tacttagatt ttaatgcttt 3300aaatttgttt ttctcaccat tagagtttca gcacttaatt
gaaaattatg gtagtatagc 3360tccagatgct ttaactgtaa ctatttcaga aattgctgta
aaagatgtca cagacaaaac 3420aggaggaggt gtgcaagtta ctgacagcac cacaggacgt
ttgtgtatgt tagtggatca 3480tgagtataaa tacccatatg tgctaggtca gggacaagac
acactagctc cagaactgcc 3540catttgggtt tactttcccc cccagtatgc ttacttaaca
gtaggtgaag taaacacaca 3600aggaatttca ggagacagca aaaaattggc tagtgaagaa
tcagcttttt atgtgttaga 3660gcacagttca tttgaacttt tgggtacagg gggatctgcc
actatgtcct acaaatttcc 3720agctgtgccc ccagaaaacc tagaaggctg cagccaacat
ttttatgaaa tgtacaaccc 3780tttgtacggt tctcgtttag gggtacctga cacattagga
ggggacccta aatttagatc 3840attgacacac gaagaccacg caattcagcc acaaaacttt
atgcctgggc cactaataaa 3900ttcagtgtct accaaagaag gagacaattc taatacaggt
gctggaaaag cccttacggg 3960gcttagtact ggcactagcc aaaacaccag aatttcccta
cgccccgggc cagtatctca 4020gccataccat cactgggaca ctgataaata tgttacagga
ataaatgcca tttcacatgg 4080acaaaccact tatggaaatg ctgaggacaa agagtatcag
caaggggtag gaagatttcc 4140aaatgaaaaa gaacagctta agcagttaca aggtcttaac
atgcacacat acttccctaa 4200taaaggaacc caacaataca cagaccaaat tgaacgccct
cttatggtgg gctctgtttg 4260gaacagaaga gctcttcact atgaaagtca gctgtggagt
aaaatcccta acttagatga 4320cagttttaaa actcaatttg cagccctagg cgggtggggt
ttgcatcaac caccccctca 4380aatattttta aaaatactac cacaaagtgg gccaattgga
ggtattaaat ccatgggaat 4440tactacttta gttcaatatg ctgtgggaat aatgacagtt
accatgacct ttaaattggg 4500acctcgaaag gctactggaa ggtggaatcc ccagcctggc
gtttatcctc ctcatgcagc 4560tggtcattta ccatatgtac tgtatgaccc cacagctaca
gatgcaaagc aacaccacag 4620acacggatat gaaaagcctg aagaattgtg gactgccaaa
agccgtgtgc acccattgta 4680aacattcccc accgtgtcct cagccaggaa ccgtcaccca
ccgcccacct gtgccgccca 4740gattatatgt gccccctcca ataccccgta ggcaaccatc
tataaaagat acagacgctg 4800tagaatataa attattaact agatatgaac aacatgtaat
tagaatgcta agattatgta 4860atatgtacac aagtttggaa aaataaaagc cttaaataaa
taattcatag tgtatggttc 4920tttaaaaatt tcaaaaagaa gacaccaaat cagatgccgc
cggtcgccgc cggtaggcgg 4980gacttccggt acaagatggc ggacagttac gtcatttcct
gtgacgtc 5028223DNAerythrovirus 2acttctgact gggaaccact aac
23329DNAerythrovirus
3tttagagatg gagagcagtt tatagaaaa
29435DNAerythrovirus 4tggaataatg aaaactttcc atttaatgat gtagc
35520DNAerythrovirus 5ttggtggtct gggatgaagg
20620DNAerythrovirus 6acagaggctg
atgtacaaca
20721DNAerythrovirus 7tggtgtaatg cacaaagctg g
21831DNAerythrovirus 8ccactatgaa aactgggcaa taaactacac
a 31917DNAerythrovirus 9tttgatttcc
ctggaat
171023DNAerythrovirus 10aatgcagatg ccctccaccc aga
231164DNAerythrovirus 11cagacaccag tatcagcagc
agtggtggtg aaagctctga agaactcagt gaaagcagct 60tttt
641225DNAerythrovirus
12tgaaaccccg cgctctagta cgccc
251355DNAerythrovirus 13tccccgggac cagttcagga gaatcatttg tcggaagccc
agtttcctcc gaagt 551420DNAerythrovirus 14cagtttcgtg aactgttagt
201524DNAerythrovirus
15gcttggtata atggatggaa attt
241626DNAerythrovirus 16aaaaaatgtg cttacctgtc tggatt
261718DNAerythrovirus 17cttaaaaact ctccagac
181819DNAerythrovirus
18tatatagtca tcattttca
191943DNAerythrovirus 19catggacagt tatctgacca cccccatgcc ttatcatcca gta
432019DNAerythrovirus 20tgcagaacct agaggagaa
192147DNAerythrovirus
21atgcagtatt atctagtgaa gacttacaca agcctgggca agttagc
472249DNAerythrovirus 22tacccggtac taactatgtt gggcctggca atgagctaca
agctgggcc 492339DNAerythrovirus 23gacagtgctg caaggattca
tgactttagg tatagccaa 392422DNAerythrovirus
24tggctaagtt gggaataaat cc
222523DNAerythrovirus 25ttaaaaaata taaaaaatga aac
232653DNAerythrovirus 26tactttactt taaaaggtgc
agctgcccct gtggcccatt ttcaaggaag ttt 532723DNAerythrovirus
27tacaacgcct cagaaaaata ccc
232826DNAerythrovirus 28tctgcagaag ccagcactgg tgcagg
262923DNAerythrovirus 29ttagatttta atgctttaaa ttt
233032DNAerythrovirus
30ttagagtttc agcacttaat tgaaaattat gg
323120DNAerythrovirus 31acaggaataa atgccatttc
203224DNAerythrovirus 32gacaaagagt atcagcaagg ggta
243326DNAerythrovirus
33agatttccaa atgaaaaaga acagct
263418DNAerythrovirus 34tcagctgtgg agtaaaat
183523DNAerythrovirus 35ttagatgaca gttttaaaac tca
233621DNAerythrovirus
36cctcaaatat ttttaaaaat a
213734DNAerythrovirus 37taccacaaag tgggccaatt ggaggtatta aatc
343823DNAerythrovirus 38atgggaatta ctactttagt tca
233962DNAerythrovirus
39ggtcatttac catatgtact gtatgacccc acagctacag atgcaaagca acaccacaga
60ca
624029DNAerythrovirus 40ggatatgaaa agcctgaaga attgtggac
294130DNAerythrovirus 41gccaaaagcc gtgtgcaccc
attgtaaaca 304221DNAerythrovirus
42tccccaccgt gtcctcagcc a
2143109DNAerythrovirus 43ctttaaaaat ttcaaaaaga agacaccaaa tcagatgccg
ccggtcgccg ccggtaggcg 60ggacttccgg tacaagatgg cggacagtta cgtcatttcc
tgtgacgtc 10944103DNAerythrovirus 44gacgtcacag gaaatgacgt
aactgtccgc catcttgtac cggaagtccc gcctaccggc 60ggcgaccggc ggcatctgat
ttggtgtctt ctttttgaaa ttt 10345210DNAerythrovirus
45ctttttgaaa ttttggcggg ctttttcccg ccttatgcaa ataagcggcc atgtttaatg
60ttatatttta atttaattgg acaaacgcct aacggttact aggggcggag ttacgggcgg
120tatataagca gctgcgttcc ctgacacttt cttttctggt tgcttttgac tggaactcac
180ttgctgttct ttgcctgcta agtaacaggt
2104630DNAerythrovirus 46atttatacta acttttaatt tactaacatg
3047100DNAerythrovirus 47gagctatttc ggggtgtctt
gcacatttcc tctaacattc tggactgtgc taatgataac 60tggtggtgct ctatgctaga
cttagatact tctgactggg 10048117DNAerythrovirus
48aaccactaac ccattctaac agattaatgg caatatattt aagcagtgtt gcttctaaac
60ttgattttac tggggggccg ctagcaggtt gcttatactt ttttcaggtg gaatgta
11749183DNAerythrovirus 49acaaatttga ggaaggctat catatccatg tagttattgg
tggtccagga ctaaatgcta 60gaaacttaac tgtgtgcgta gaaggtttat ttaataatgt
tctttaccat cttgtaactg 120aaagtgttaa acttaaattt ttgccaggga tgactaccaa
aggaaaatat tttagagatg 180gag 18350670DNAerythrovirus 50agcagtttat
agaaaattac ttaatgaaaa aaattccttt aaatgttgtg tggtgtgtaa 60caaatattga
cgggtatata gacacctgta tttccgcctc ttttcggcga ggagcttgtc 120atgctaaaag
accccgcatt actgcaaata cagacagtgc tactaatgaa actggggagt 180ctagctgtgg
agggggagat gttgtgccat tcgctggaaa gggaacaaaa gcggggttaa 240agtttcaaac
catggtaaat tggctatgtg aaaacagagt atttactgaa gataaatgga 300aattagtgga
ttttaaccaa tatactttat taagtagcag tcacagtggc agctttcaaa 360ttcaaagtgc
cttaaagtta gctatttata aagctactaa cttagtaccc actagtacat 420tcttgttaca
ttcagacttt gagcaggtta cttgcattaa agaaaataaa atagtaaaat 480tattattgtg
tcaaaactat gatcctcttt tagtgggtca acatgtgtta aggtggattg 540acaaaaaatg
tggtaaaaaa aacaccctgt ggttttacgg gccaccaagt actggaaaaa 600caaatttggc
aatggctatt gctaaaactg taccagtgta tggaatggtg aattggaata 660atgaaaactt
6705136DNAerythrovirus 51tccatttaat gatgtagcgg ggaaaagttt ggtggt
365246DNAerythrovirus 52ctgggatgaa ggcattatta
agtccactat tgtggaagct gcaaaa 465384DNAerythrovirus
53gccattttag gtggtcagcc aaccagggta gatcagaaaa tgcgtggcag tgtggcagtg
60cccggtgtgc ctgtggttat aacc
845460DNAerythrovirus 54agcaatggtg acattacatt tgttgtgagt ggtaatacca
ctacaactgt gcatgctaaa 605576DNAerythrovirus 55gccttaaagg aacggatggt
aaagctaaac tttaccataa gatgtagccc tgacatgggt 60ttacttacag aggctg
765630DNAerythrovirus
56atgtacaaca atggctaact tggtgtaatg
305728DNAerythrovirus 57cacaaagctg gagccactat gaaaactg
285898DNAerythrovirus 58ttcaggagaa tcatttgtcg
gaagcccagt ttcctccgaa gtggtagccg cgtcgtggga 60ggaagctttt tacacgccgc
ttgccgatca gtttcgtg 9859134DNAerythrovirus
59aactgttagt aggggttgac tttgtatggg atggtgtgag gggattgcct gtttgctgtg
60tggaacatat aaacaacagt gggggagggt tggggctttg ccctcattgt attaatgtgg
120gagcttggta taat
13460100DNAerythrovirus 60ggatggaaat ttagagagtt tactccagac ttagtgcgct
gcagttgtca tgtaggagcc 60tctaacccat tttctgtgtt aacttgtaaa aaatgtgctt
1006130DNAerythrovirus 61acctgtctgg attacaaagt
tttgtagatt 3062102DNAerythrovirus
62atgagtaaaa ccactaacaa atggtgggaa agcagtgaca aatttgccca ggacgtgtat
60aagcagtttg tgcaatttta tgaaaaagct actggaacag ac
10263114DNAerythrovirus 63ttagagctta ttcaaatttt aaaagaccat tacaacattt
ctttagataa tcctttagaa 60aacccctctt ctttatttga cttagttgct cgcattaaaa
gtaatcttaa aaac 1146422DNAerythrovirus 64tctccagacc tatatagtca
tc 226523DNAerythrovirus
65attttcagag ccatggacag tta
236630DNAerythrovirus 66atcatccagt aacagtagtg cagaacctag
306739DNAerythrovirus 67caagctgggc ctccgcagaa
tgctgtggac agtgctgca 396856DNAerythrovirus
68ggaataaatc cttatacaca ttggacggta gcagatgaag aattgttaaa aaatat
566951DNAerythrovirus 69aaaaaatgaa acagggtttc aagcacaagc agtaaaagat
tactttactt t 517037DNAerythrovirus 70aaggaagttt accggaagtg
cccgcgtaca acgcctc 377142DNAerythrovirus
71agaaaaatac cccagcatga cttcagttaa ctctgcagaa gc
4272255DNAerythrovirus 72cagcactggt gcaggcgggg gaggtagcaa ccctacaaaa
agcatgtgga gtgaaggggc 60tacatttact gctaattctg taacgtgtac attctctagg
caatttttaa ttccatatga 120tccagagcat cattataaag tgttctctcc agcagctagt
agctgccaca atgctagtgg 180gaaagaggca aaagtgtgca ctattagtcc cattatgggg
tactctactc cgtggagata 240cttagatttt aatgc
2557333DNAerythrovirus 73tttaaatttg tttttctcac
cattagagtt tca 3374725DNAerythrovirus
74gaaaattatg gtagtatagc tccagatgct ttaactgtaa ctatttcaga aattgctgta
60aaagatgtca cagacaaaac aggaggaggt gtgcaagtta ctgacagcac cacaggacgt
120ttgtgtatgt tagtggatca tgagtataaa tacccatatg tgctaggtca gggacaagac
180acactagctc cagaactgcc catttgggtt tactttcccc cccagtatgc ttacttaaca
240gtaggtgaag taaacacaca aggaatttca ggagacagca aaaaattggc tagtgaagaa
300tcagcttttt atgtgttaga gcacagttca tttgaacttt tgggtacagg gggatctgcc
360actatgtcct acaaatttcc agctgtgccc ccagaaaacc tagaaggctg cagccaacat
420ttttatgaaa tgtacaaccc tttgtacggt tctcgtttag gggtacctga cacattagga
480ggggacccta aatttagatc attgacacac gaagaccacg caattcagcc acaaaacttt
540atgcctgggc cactaataaa ttcagtgtct accaaagaag gagacaattc taatacaggt
600gctggaaaag cccttacggg gcttagtact ggcactagcc aaaacaccag aatttcccta
660cgccccgggc cagtatctca gccataccat cactgggaca ctgataaata tgttacagga
720ataaa
7257549DNAerythrovirus 75tgccatttca catggacaaa ccacttatgg aaatgctgag
gacaaagag 497630DNAerythrovirus 76tatcagcaag gggtaggaag
atttccaaat 3077180DNAerythrovirus
77gaaaaagaac agcttaagca gttacaaggt cttaacatgc acacatactt ccctaataaa
60ggaacccaac aatacacaga ccaaattgaa cgccctctta tggtgggctc tgtttggaac
120agaagagctc ttcactatga aagtcagctg tggagtaaaa tccctaactt agatgacagt
1807864DNAerythrovirus 78tttaaaactc aatttgcagc cctaggcggg tggggtttgc
atcaaccacc ccctcaaata 60tttt
6479152DNAerythrovirus 79aggtattaaa tccatgggaa
ttactacttt agttcaatat gctgtgggaa taatgacagt 60taccatgacc tttaaattgg
gacctcgaaa ggctactgga aggtggaatc cccagcctgg 120cgtttatcct cctcatgcag
ctggtcattt ac 15280260DNAerythrovirus
80cccattgtaa acattcccca ccgtgtcctc agccaggaac cgtcacccac cgcccacctg
60tgccgcccag attatatgtg ccccctccaa taccccgtag gcaaccatct ataaaagata
120cagacgctgt agaatataaa ttattaacta gatatgaaca acatgtaatt agaatgctaa
180gattatgtaa tatgtacaca agtttggaaa aataaaagcc ttaaataaat aattcatagt
240gtatggttct ttaaaaattt
260812013DNAerythrovirusCDS(1)..(2013) 81atg gag cta ttt cgg ggt gtc ttg
cac att tcc tct aac att ctg gac 48Met Glu Leu Phe Arg Gly Val Leu
His Ile Ser Ser Asn Ile Leu Asp1 5 10
15tgt gct aat gat aac tgg tgg tgc tct atg cta gac tta gat
act tct 96Cys Ala Asn Asp Asn Trp Trp Cys Ser Met Leu Asp Leu Asp
Thr Ser 20 25 30gac tgg gaa
cca cta acc cat tct aac aga tta atg gca ata tat tta 144Asp Trp Glu
Pro Leu Thr His Ser Asn Arg Leu Met Ala Ile Tyr Leu 35
40 45agc agt gtt gct tct aaa ctt gat ttt act ggg
ggg ccg cta gca ggt 192Ser Ser Val Ala Ser Lys Leu Asp Phe Thr Gly
Gly Pro Leu Ala Gly 50 55 60tgc tta
tac ttt ttt cag gtg gaa tgt aac aaa ttt gag gaa ggc tat 240Cys Leu
Tyr Phe Phe Gln Val Glu Cys Asn Lys Phe Glu Glu Gly Tyr65
70 75 80cat atc cat gta gtt att ggt
ggt cca gga cta aat gct aga aac tta 288His Ile His Val Val Ile Gly
Gly Pro Gly Leu Asn Ala Arg Asn Leu 85 90
95act gtg tgc gta gaa ggt tta ttt aat aat gtt ctt tac
cat ctt gta 336Thr Val Cys Val Glu Gly Leu Phe Asn Asn Val Leu Tyr
His Leu Val 100 105 110act gaa
agt gtt aaa ctt aaa ttt ttg cca ggg atg act acc aaa gga 384Thr Glu
Ser Val Lys Leu Lys Phe Leu Pro Gly Met Thr Thr Lys Gly 115
120 125aaa tat ttt aga gat gga gag cag ttt ata
gaa aat tac tta atg aaa 432Lys Tyr Phe Arg Asp Gly Glu Gln Phe Ile
Glu Asn Tyr Leu Met Lys 130 135 140aaa
att cct tta aat gtt gtg tgg tgt gta aca aat att gac ggg tat 480Lys
Ile Pro Leu Asn Val Val Trp Cys Val Thr Asn Ile Asp Gly Tyr145
150 155 160ata gac acc tgt att tcc
gcc tct ttt cgg cga gga gct tgt cat gct 528Ile Asp Thr Cys Ile Ser
Ala Ser Phe Arg Arg Gly Ala Cys His Ala 165
170 175aaa aga ccc cgc att act gca aat aca gac agt gct
act aat gaa act 576Lys Arg Pro Arg Ile Thr Ala Asn Thr Asp Ser Ala
Thr Asn Glu Thr 180 185 190ggg
gag tct agc tgt gga ggg gga gat gtt gtg cca ttc gct gga aag 624Gly
Glu Ser Ser Cys Gly Gly Gly Asp Val Val Pro Phe Ala Gly Lys 195
200 205gga aca aaa gcg ggg tta aag ttt caa
acc atg gta aat tgg cta tgt 672Gly Thr Lys Ala Gly Leu Lys Phe Gln
Thr Met Val Asn Trp Leu Cys 210 215
220gaa aac aga gta ttt act gaa gat aaa tgg aaa tta gtg gat ttt aac
720Glu Asn Arg Val Phe Thr Glu Asp Lys Trp Lys Leu Val Asp Phe Asn225
230 235 240caa tat act tta
tta agt agc agt cac agt ggc agc ttt caa att caa 768Gln Tyr Thr Leu
Leu Ser Ser Ser His Ser Gly Ser Phe Gln Ile Gln 245
250 255agt gcc tta aag tta gct att tat aaa gct
act aac tta gta ccc act 816Ser Ala Leu Lys Leu Ala Ile Tyr Lys Ala
Thr Asn Leu Val Pro Thr 260 265
270agt aca ttc ttg tta cat tca gac ttt gag cag gtt act tgc att aaa
864Ser Thr Phe Leu Leu His Ser Asp Phe Glu Gln Val Thr Cys Ile Lys
275 280 285gaa aat aaa ata gta aaa tta
tta ttg tgt caa aac tat gat cct ctt 912Glu Asn Lys Ile Val Lys Leu
Leu Leu Cys Gln Asn Tyr Asp Pro Leu 290 295
300tta gtg ggt caa cat gtg tta agg tgg att gac aaa aaa tgt ggt aaa
960Leu Val Gly Gln His Val Leu Arg Trp Ile Asp Lys Lys Cys Gly Lys305
310 315 320aaa aac acc ctg
tgg ttt tac ggg cca cca agt act gga aaa aca aat 1008Lys Asn Thr Leu
Trp Phe Tyr Gly Pro Pro Ser Thr Gly Lys Thr Asn 325
330 335ttg gca atg gct att gct aaa act gta cca
gtg tat gga atg gtg aat 1056Leu Ala Met Ala Ile Ala Lys Thr Val Pro
Val Tyr Gly Met Val Asn 340 345
350tgg aat aat gaa aac ttt cca ttt aat gat gta gcg ggg aaa agt ttg
1104Trp Asn Asn Glu Asn Phe Pro Phe Asn Asp Val Ala Gly Lys Ser Leu
355 360 365gtg gtc tgg gat gaa ggc att
att aag tcc act att gtg gaa gct gca 1152Val Val Trp Asp Glu Gly Ile
Ile Lys Ser Thr Ile Val Glu Ala Ala 370 375
380aaa gcc att tta ggt ggt cag cca acc agg gta gat cag aaa atg cgt
1200Lys Ala Ile Leu Gly Gly Gln Pro Thr Arg Val Asp Gln Lys Met Arg385
390 395 400ggc agt gtg gca
gtg ccc ggt gtg cct gtg gtt ata acc agc aat ggt 1248Gly Ser Val Ala
Val Pro Gly Val Pro Val Val Ile Thr Ser Asn Gly 405
410 415gac att aca ttt gtt gtg agt ggt aat acc
act aca act gtg cat gct 1296Asp Ile Thr Phe Val Val Ser Gly Asn Thr
Thr Thr Thr Val His Ala 420 425
430aaa gcc tta aag gaa cgg atg gta aag cta aac ttt acc ata aga tgt
1344Lys Ala Leu Lys Glu Arg Met Val Lys Leu Asn Phe Thr Ile Arg Cys
435 440 445agc cct gac atg ggt tta ctt
aca gag gct gat gta caa caa tgg cta 1392Ser Pro Asp Met Gly Leu Leu
Thr Glu Ala Asp Val Gln Gln Trp Leu 450 455
460act tgg tgt aat gca caa agc tgg agc cac tat gaa aac tgg gca ata
1440Thr Trp Cys Asn Ala Gln Ser Trp Ser His Tyr Glu Asn Trp Ala Ile465
470 475 480aac tac aca ttt
gat ttc cct gga ata aat gca gat gcc ctc cac cca 1488Asn Tyr Thr Phe
Asp Phe Pro Gly Ile Asn Ala Asp Ala Leu His Pro 485
490 495gat ctc caa acc acc ccc att gtc cca gac
acc agt atc agc agc agt 1536Asp Leu Gln Thr Thr Pro Ile Val Pro Asp
Thr Ser Ile Ser Ser Ser 500 505
510ggt ggt gaa agc tct gaa gaa ctc agt gaa agc agc ttt ttc aac ctc
1584Gly Gly Glu Ser Ser Glu Glu Leu Ser Glu Ser Ser Phe Phe Asn Leu
515 520 525atc act cca ggc gcc tgg aac
agt gaa acc ccg cgc tct agt acg ccc 1632Ile Thr Pro Gly Ala Trp Asn
Ser Glu Thr Pro Arg Ser Ser Thr Pro 530 535
540gtc ccc ggg acc agt tca gga gaa tca ttt gtc gga agc cca gtt tcc
1680Val Pro Gly Thr Ser Ser Gly Glu Ser Phe Val Gly Ser Pro Val Ser545
550 555 560tcc gaa gtg gta
gcc gcg tcg tgg gag gaa gct ttt tac acg ccg ctt 1728Ser Glu Val Val
Ala Ala Ser Trp Glu Glu Ala Phe Tyr Thr Pro Leu 565
570 575gcc gat cag ttt cgt gaa ctg tta gta ggg
gtt gac ttt gta tgg gat 1776Ala Asp Gln Phe Arg Glu Leu Leu Val Gly
Val Asp Phe Val Trp Asp 580 585
590ggt gtg agg gga ttg cct gtt tgc tgt gtg gaa cat ata aac aac agt
1824Gly Val Arg Gly Leu Pro Val Cys Cys Val Glu His Ile Asn Asn Ser
595 600 605ggg gga ggg ttg ggg ctt tgc
cct cat tgt att aat gtg gga gct tgg 1872Gly Gly Gly Leu Gly Leu Cys
Pro His Cys Ile Asn Val Gly Ala Trp 610 615
620tat aat gga tgg aaa ttt aga gag ttt act cca gac tta gtg cgc tgc
1920Tyr Asn Gly Trp Lys Phe Arg Glu Phe Thr Pro Asp Leu Val Arg Cys625
630 635 640agt tgt cat gta
gga gcc tct aac cca ttt tct gtg tta act tgt aaa 1968Ser Cys His Val
Gly Ala Ser Asn Pro Phe Ser Val Leu Thr Cys Lys 645
650 655aaa tgt gct tac ctg tct gga tta caa agt
ttt gta gat tat gag 2013Lys Cys Ala Tyr Leu Ser Gly Leu Gln Ser
Phe Val Asp Tyr Glu 660 665
67082671PRTerythrovirus 82Met Glu Leu Phe Arg Gly Val Leu His Ile Ser Ser
Asn Ile Leu Asp1 5 10
15Cys Ala Asn Asp Asn Trp Trp Cys Ser Met Leu Asp Leu Asp Thr Ser
20 25 30Asp Trp Glu Pro Leu Thr His
Ser Asn Arg Leu Met Ala Ile Tyr Leu 35 40
45Ser Ser Val Ala Ser Lys Leu Asp Phe Thr Gly Gly Pro Leu Ala
Gly 50 55 60Cys Leu Tyr Phe Phe Gln
Val Glu Cys Asn Lys Phe Glu Glu Gly Tyr65 70
75 80His Ile His Val Val Ile Gly Gly Pro Gly Leu
Asn Ala Arg Asn Leu 85 90
95Thr Val Cys Val Glu Gly Leu Phe Asn Asn Val Leu Tyr His Leu Val
100 105 110Thr Glu Ser Val Lys Leu
Lys Phe Leu Pro Gly Met Thr Thr Lys Gly 115 120
125Lys Tyr Phe Arg Asp Gly Glu Gln Phe Ile Glu Asn Tyr Leu
Met Lys 130 135 140Lys Ile Pro Leu Asn
Val Val Trp Cys Val Thr Asn Ile Asp Gly Tyr145 150
155 160Ile Asp Thr Cys Ile Ser Ala Ser Phe Arg
Arg Gly Ala Cys His Ala 165 170
175Lys Arg Pro Arg Ile Thr Ala Asn Thr Asp Ser Ala Thr Asn Glu Thr
180 185 190Gly Glu Ser Ser Cys
Gly Gly Gly Asp Val Val Pro Phe Ala Gly Lys 195
200 205Gly Thr Lys Ala Gly Leu Lys Phe Gln Thr Met Val
Asn Trp Leu Cys 210 215 220Glu Asn Arg
Val Phe Thr Glu Asp Lys Trp Lys Leu Val Asp Phe Asn225
230 235 240Gln Tyr Thr Leu Leu Ser Ser
Ser His Ser Gly Ser Phe Gln Ile Gln 245
250 255Ser Ala Leu Lys Leu Ala Ile Tyr Lys Ala Thr Asn
Leu Val Pro Thr 260 265 270Ser
Thr Phe Leu Leu His Ser Asp Phe Glu Gln Val Thr Cys Ile Lys 275
280 285Glu Asn Lys Ile Val Lys Leu Leu Leu
Cys Gln Asn Tyr Asp Pro Leu 290 295
300Leu Val Gly Gln His Val Leu Arg Trp Ile Asp Lys Lys Cys Gly Lys305
310 315 320Lys Asn Thr Leu
Trp Phe Tyr Gly Pro Pro Ser Thr Gly Lys Thr Asn 325
330 335Leu Ala Met Ala Ile Ala Lys Thr Val Pro
Val Tyr Gly Met Val Asn 340 345
350Trp Asn Asn Glu Asn Phe Pro Phe Asn Asp Val Ala Gly Lys Ser Leu
355 360 365Val Val Trp Asp Glu Gly Ile
Ile Lys Ser Thr Ile Val Glu Ala Ala 370 375
380Lys Ala Ile Leu Gly Gly Gln Pro Thr Arg Val Asp Gln Lys Met
Arg385 390 395 400Gly Ser
Val Ala Val Pro Gly Val Pro Val Val Ile Thr Ser Asn Gly
405 410 415Asp Ile Thr Phe Val Val Ser
Gly Asn Thr Thr Thr Thr Val His Ala 420 425
430Lys Ala Leu Lys Glu Arg Met Val Lys Leu Asn Phe Thr Ile
Arg Cys 435 440 445Ser Pro Asp Met
Gly Leu Leu Thr Glu Ala Asp Val Gln Gln Trp Leu 450
455 460Thr Trp Cys Asn Ala Gln Ser Trp Ser His Tyr Glu
Asn Trp Ala Ile465 470 475
480Asn Tyr Thr Phe Asp Phe Pro Gly Ile Asn Ala Asp Ala Leu His Pro
485 490 495Asp Leu Gln Thr Thr
Pro Ile Val Pro Asp Thr Ser Ile Ser Ser Ser 500
505 510Gly Gly Glu Ser Ser Glu Glu Leu Ser Glu Ser Ser
Phe Phe Asn Leu 515 520 525Ile Thr
Pro Gly Ala Trp Asn Ser Glu Thr Pro Arg Ser Ser Thr Pro 530
535 540Val Pro Gly Thr Ser Ser Gly Glu Ser Phe Val
Gly Ser Pro Val Ser545 550 555
560Ser Glu Val Val Ala Ala Ser Trp Glu Glu Ala Phe Tyr Thr Pro Leu
565 570 575Ala Asp Gln Phe
Arg Glu Leu Leu Val Gly Val Asp Phe Val Trp Asp 580
585 590Gly Val Arg Gly Leu Pro Val Cys Cys Val Glu
His Ile Asn Asn Ser 595 600 605Gly
Gly Gly Leu Gly Leu Cys Pro His Cys Ile Asn Val Gly Ala Trp 610
615 620Tyr Asn Gly Trp Lys Phe Arg Glu Phe Thr
Pro Asp Leu Val Arg Cys625 630 635
640Ser Cys His Val Gly Ala Ser Asn Pro Phe Ser Val Leu Thr Cys
Lys 645 650 655Lys Cys Ala
Tyr Leu Ser Gly Leu Gln Ser Phe Val Asp Tyr Glu 660
665 67083222DNAerythroviursCDS(1)..(222)Encodes
amino acids 672-745 of SEQ ID NO 2. 83atg cag atg ccc tcc acc cag atc tcc
aaa cca ccc cca ttg tcc cag 48Met Gln Met Pro Ser Thr Gln Ile Ser
Lys Pro Pro Pro Leu Ser Gln1 5 10
15aca cca gta tca gca gca gtg gtg gtg aaa gct ctg aag aac tca
gtg 96Thr Pro Val Ser Ala Ala Val Val Val Lys Ala Leu Lys Asn Ser
Val 20 25 30aaa gca gct ttt
tca acc tca tca ctc cag gcg cct gga aca gtg aaa 144Lys Ala Ala Phe
Ser Thr Ser Ser Leu Gln Ala Pro Gly Thr Val Lys 35
40 45ccc cgc gct cta gta cgc ccg tcc ccg gga cca gtt
cag gag aat cat 192Pro Arg Ala Leu Val Arg Pro Ser Pro Gly Pro Val
Gln Glu Asn His 50 55 60ttg tcg gaa
gcc cag ttt cct ccg aag tgg 222Leu Ser Glu
Ala Gln Phe Pro Pro Lys Trp65 708474PRTerythroviurs
84Met Gln Met Pro Ser Thr Gln Ile Ser Lys Pro Pro Pro Leu Ser Gln1
5 10 15Thr Pro Val Ser Ala Ala
Val Val Val Lys Ala Leu Lys Asn Ser Val 20 25
30Lys Ala Ala Phe Ser Thr Ser Ser Leu Gln Ala Pro Gly
Thr Val Lys 35 40 45Pro Arg Ala
Leu Val Arg Pro Ser Pro Gly Pro Val Gln Glu Asn His 50
55 60Leu Ser Glu Ala Gln Phe Pro Pro Lys Trp65
70852343DNAerythrovirusCDS(1)..(2343)Encodes amino acids 75-855
of SEQ ID NO 2. 85atg agt aaa acc act aac aaa tgg tgg gaa agc agt gac aaa
ttt gcc 48Met Ser Lys Thr Thr Asn Lys Trp Trp Glu Ser Ser Asp Lys
Phe Ala1 5 10 15cag gac
gtg tat aag cag ttt gtg caa ttt tat gaa aaa gct act gga 96Gln Asp
Val Tyr Lys Gln Phe Val Gln Phe Tyr Glu Lys Ala Thr Gly 20
25 30aca gac tta gag ctt att caa att tta
aaa gac cat tac aac att tct 144Thr Asp Leu Glu Leu Ile Gln Ile Leu
Lys Asp His Tyr Asn Ile Ser 35 40
45tta gat aat cct tta gaa aac ccc tct tct tta ttt gac tta gtt gct
192Leu Asp Asn Pro Leu Glu Asn Pro Ser Ser Leu Phe Asp Leu Val Ala 50
55 60cgc att aaa agt aat ctt aaa aac tct
cca gac cta tat agt cat cat 240Arg Ile Lys Ser Asn Leu Lys Asn Ser
Pro Asp Leu Tyr Ser His His65 70 75
80ttt cag agc cat gga cag tta tct gac cac ccc cat gcc tta
tca tcc 288Phe Gln Ser His Gly Gln Leu Ser Asp His Pro His Ala Leu
Ser Ser 85 90 95agt aac
agt agt gca gaa cct aga gga gaa aat gca gta tta tct agt 336Ser Asn
Ser Ser Ala Glu Pro Arg Gly Glu Asn Ala Val Leu Ser Ser 100
105 110gaa gac tta cac aag cct ggg caa gtt
agc ata caa tta ccc ggt act 384Glu Asp Leu His Lys Pro Gly Gln Val
Ser Ile Gln Leu Pro Gly Thr 115 120
125aac tat gtt ggg cct ggc aat gag cta caa gct ggg cct ccg cag aat
432Asn Tyr Val Gly Pro Gly Asn Glu Leu Gln Ala Gly Pro Pro Gln Asn 130
135 140gct gtg gac agt gct gca agg att
cat gac ttt agg tat agc caa ttg 480Ala Val Asp Ser Ala Ala Arg Ile
His Asp Phe Arg Tyr Ser Gln Leu145 150
155 160gct aag ttg gga ata aat cct tat aca cat tgg acg
gta gca gat gaa 528Ala Lys Leu Gly Ile Asn Pro Tyr Thr His Trp Thr
Val Ala Asp Glu 165 170
175gaa ttg tta aaa aat ata aaa aat gaa aca ggg ttt caa gca caa gca
576Glu Leu Leu Lys Asn Ile Lys Asn Glu Thr Gly Phe Gln Ala Gln Ala
180 185 190gta aaa gat tac ttt act
tta aaa ggt gca gct gcc cct gtg gcc cat 624Val Lys Asp Tyr Phe Thr
Leu Lys Gly Ala Ala Ala Pro Val Ala His 195 200
205ttt caa gga agt tta ccg gaa gtg ccc gcg tac aac gcc tca
gaa aaa 672Phe Gln Gly Ser Leu Pro Glu Val Pro Ala Tyr Asn Ala Ser
Glu Lys 210 215 220tac ccc agc atg act
tca gtt aac tct gca gaa gcc agc act ggt gca 720Tyr Pro Ser Met Thr
Ser Val Asn Ser Ala Glu Ala Ser Thr Gly Ala225 230
235 240ggc ggg gga ggt agc aac cct aca aaa agc
atg tgg agt gaa ggg gct 768Gly Gly Gly Gly Ser Asn Pro Thr Lys Ser
Met Trp Ser Glu Gly Ala 245 250
255aca ttt act gct aat tct gta acg tgt aca ttc tct agg caa ttt tta
816Thr Phe Thr Ala Asn Ser Val Thr Cys Thr Phe Ser Arg Gln Phe Leu
260 265 270att cca tat gat cca gag
cat cat tat aaa gtg ttc tct cca gca gct 864Ile Pro Tyr Asp Pro Glu
His His Tyr Lys Val Phe Ser Pro Ala Ala 275 280
285agt agc tgc cac aat gct agt ggg aaa gag gca aaa gtg tgc
act att 912Ser Ser Cys His Asn Ala Ser Gly Lys Glu Ala Lys Val Cys
Thr Ile 290 295 300agt ccc att atg ggg
tac tct act ccg tgg aga tac tta gat ttt aat 960Ser Pro Ile Met Gly
Tyr Ser Thr Pro Trp Arg Tyr Leu Asp Phe Asn305 310
315 320gct tta aat ttg ttt ttc tca cca tta gag
ttt cag cac tta att gaa 1008Ala Leu Asn Leu Phe Phe Ser Pro Leu Glu
Phe Gln His Leu Ile Glu 325 330
335aat tat ggt agt ata gct cca gat gct tta act gta act att tca gaa
1056Asn Tyr Gly Ser Ile Ala Pro Asp Ala Leu Thr Val Thr Ile Ser Glu
340 345 350att gct gta aaa gat gtc
aca gac aaa aca gga gga ggt gtg caa gtt 1104Ile Ala Val Lys Asp Val
Thr Asp Lys Thr Gly Gly Gly Val Gln Val 355 360
365act gac agc acc aca gga cgt ttg tgt atg tta gtg gat cat
gag tat 1152Thr Asp Ser Thr Thr Gly Arg Leu Cys Met Leu Val Asp His
Glu Tyr 370 375 380aaa tac cca tat gtg
cta ggt cag gga caa gac aca cta gct cca gaa 1200Lys Tyr Pro Tyr Val
Leu Gly Gln Gly Gln Asp Thr Leu Ala Pro Glu385 390
395 400ctg ccc att tgg gtt tac ttt ccc ccc cag
tat gct tac tta aca gta 1248Leu Pro Ile Trp Val Tyr Phe Pro Pro Gln
Tyr Ala Tyr Leu Thr Val 405 410
415ggt gaa gta aac aca caa gga att tca gga gac agc aaa aaa ttg gct
1296Gly Glu Val Asn Thr Gln Gly Ile Ser Gly Asp Ser Lys Lys Leu Ala
420 425 430agt gaa gaa tca gct ttt
tat gtg tta gag cac agt tca ttt gaa ctt 1344Ser Glu Glu Ser Ala Phe
Tyr Val Leu Glu His Ser Ser Phe Glu Leu 435 440
445ttg ggt aca ggg gga tct gcc act atg tcc tac aaa ttt cca
gct gtg 1392Leu Gly Thr Gly Gly Ser Ala Thr Met Ser Tyr Lys Phe Pro
Ala Val 450 455 460ccc cca gaa aac cta
gaa ggc tgc agc caa cat ttt tat gaa atg tac 1440Pro Pro Glu Asn Leu
Glu Gly Cys Ser Gln His Phe Tyr Glu Met Tyr465 470
475 480aac cct ttg tac ggt tct cgt tta ggg gta
cct gac aca tta gga ggg 1488Asn Pro Leu Tyr Gly Ser Arg Leu Gly Val
Pro Asp Thr Leu Gly Gly 485 490
495gac cct aaa ttt aga tca ttg aca cac gaa gac cac gca att cag cca
1536Asp Pro Lys Phe Arg Ser Leu Thr His Glu Asp His Ala Ile Gln Pro
500 505 510caa aac ttt atg cct ggg
cca cta ata aat tca gtg tct acc aaa gaa 1584Gln Asn Phe Met Pro Gly
Pro Leu Ile Asn Ser Val Ser Thr Lys Glu 515 520
525gga gac aat tct aat aca ggt gct gga aaa gcc ctt acg ggg
ctt agt 1632Gly Asp Asn Ser Asn Thr Gly Ala Gly Lys Ala Leu Thr Gly
Leu Ser 530 535 540act ggc act agc caa
aac acc aga att tcc cta cgc ccc ggg cca gta 1680Thr Gly Thr Ser Gln
Asn Thr Arg Ile Ser Leu Arg Pro Gly Pro Val545 550
555 560tct cag cca tac cat cac tgg gac act gat
aaa tat gtt aca gga ata 1728Ser Gln Pro Tyr His His Trp Asp Thr Asp
Lys Tyr Val Thr Gly Ile 565 570
575aat gcc att tca cat gga caa acc act tat gga aat gct gag gac aaa
1776Asn Ala Ile Ser His Gly Gln Thr Thr Tyr Gly Asn Ala Glu Asp Lys
580 585 590gag tat cag caa ggg gta
gga aga ttt cca aat gaa aaa gaa cag ctt 1824Glu Tyr Gln Gln Gly Val
Gly Arg Phe Pro Asn Glu Lys Glu Gln Leu 595 600
605aag cag tta caa ggt ctt aac atg cac aca tac ttc cct aat
aaa gga 1872Lys Gln Leu Gln Gly Leu Asn Met His Thr Tyr Phe Pro Asn
Lys Gly 610 615 620acc caa caa tac aca
gac caa att gaa cgc cct ctt atg gtg ggc tct 1920Thr Gln Gln Tyr Thr
Asp Gln Ile Glu Arg Pro Leu Met Val Gly Ser625 630
635 640gtt tgg aac aga aga gct ctt cac tat gaa
agt cag ctg tgg agt aaa 1968Val Trp Asn Arg Arg Ala Leu His Tyr Glu
Ser Gln Leu Trp Ser Lys 645 650
655atc cct aac tta gat gac agt ttt aaa act caa ttt gca gcc cta ggc
2016Ile Pro Asn Leu Asp Asp Ser Phe Lys Thr Gln Phe Ala Ala Leu Gly
660 665 670ggg tgg ggt ttg cat caa
cca ccc cct caa ata ttt tta aaa ata cta 2064Gly Trp Gly Leu His Gln
Pro Pro Pro Gln Ile Phe Leu Lys Ile Leu 675 680
685cca caa agt ggg cca att gga ggt att aaa tcc atg gga att
act act 2112Pro Gln Ser Gly Pro Ile Gly Gly Ile Lys Ser Met Gly Ile
Thr Thr 690 695 700tta gtt caa tat gct
gtg gga ata atg aca gtt acc atg acc ttt aaa 2160Leu Val Gln Tyr Ala
Val Gly Ile Met Thr Val Thr Met Thr Phe Lys705 710
715 720ttg gga cct cga aag gct act gga agg tgg
aat ccc cag cct ggc gtt 2208Leu Gly Pro Arg Lys Ala Thr Gly Arg Trp
Asn Pro Gln Pro Gly Val 725 730
735tat cct cct cat gca gct ggt cat tta cca tat gta ctg tat gac ccc
2256Tyr Pro Pro His Ala Ala Gly His Leu Pro Tyr Val Leu Tyr Asp Pro
740 745 750aca gct aca gat gca aag
caa cac cac aga cac gga tat gaa aag cct 2304Thr Ala Thr Asp Ala Lys
Gln His His Arg His Gly Tyr Glu Lys Pro 755 760
765gaa gaa ttg tgg act gcc aaa agc cgt gtg cac cca ttg
2343Glu Glu Leu Trp Thr Ala Lys Ser Arg Val His Pro Leu 770
775 78086781PRTerythrovirus 86Met Ser Lys
Thr Thr Asn Lys Trp Trp Glu Ser Ser Asp Lys Phe Ala1 5
10 15Gln Asp Val Tyr Lys Gln Phe Val Gln
Phe Tyr Glu Lys Ala Thr Gly 20 25
30Thr Asp Leu Glu Leu Ile Gln Ile Leu Lys Asp His Tyr Asn Ile Ser
35 40 45Leu Asp Asn Pro Leu Glu Asn
Pro Ser Ser Leu Phe Asp Leu Val Ala 50 55
60Arg Ile Lys Ser Asn Leu Lys Asn Ser Pro Asp Leu Tyr Ser His His65
70 75 80Phe Gln Ser His
Gly Gln Leu Ser Asp His Pro His Ala Leu Ser Ser 85
90 95Ser Asn Ser Ser Ala Glu Pro Arg Gly Glu
Asn Ala Val Leu Ser Ser 100 105
110Glu Asp Leu His Lys Pro Gly Gln Val Ser Ile Gln Leu Pro Gly Thr
115 120 125Asn Tyr Val Gly Pro Gly Asn
Glu Leu Gln Ala Gly Pro Pro Gln Asn 130 135
140Ala Val Asp Ser Ala Ala Arg Ile His Asp Phe Arg Tyr Ser Gln
Leu145 150 155 160Ala Lys
Leu Gly Ile Asn Pro Tyr Thr His Trp Thr Val Ala Asp Glu
165 170 175Glu Leu Leu Lys Asn Ile Lys
Asn Glu Thr Gly Phe Gln Ala Gln Ala 180 185
190Val Lys Asp Tyr Phe Thr Leu Lys Gly Ala Ala Ala Pro Val
Ala His 195 200 205Phe Gln Gly Ser
Leu Pro Glu Val Pro Ala Tyr Asn Ala Ser Glu Lys 210
215 220Tyr Pro Ser Met Thr Ser Val Asn Ser Ala Glu Ala
Ser Thr Gly Ala225 230 235
240Gly Gly Gly Gly Ser Asn Pro Thr Lys Ser Met Trp Ser Glu Gly Ala
245 250 255Thr Phe Thr Ala Asn
Ser Val Thr Cys Thr Phe Ser Arg Gln Phe Leu 260
265 270Ile Pro Tyr Asp Pro Glu His His Tyr Lys Val Phe
Ser Pro Ala Ala 275 280 285Ser Ser
Cys His Asn Ala Ser Gly Lys Glu Ala Lys Val Cys Thr Ile 290
295 300Ser Pro Ile Met Gly Tyr Ser Thr Pro Trp Arg
Tyr Leu Asp Phe Asn305 310 315
320Ala Leu Asn Leu Phe Phe Ser Pro Leu Glu Phe Gln His Leu Ile Glu
325 330 335Asn Tyr Gly Ser
Ile Ala Pro Asp Ala Leu Thr Val Thr Ile Ser Glu 340
345 350Ile Ala Val Lys Asp Val Thr Asp Lys Thr Gly
Gly Gly Val Gln Val 355 360 365Thr
Asp Ser Thr Thr Gly Arg Leu Cys Met Leu Val Asp His Glu Tyr 370
375 380Lys Tyr Pro Tyr Val Leu Gly Gln Gly Gln
Asp Thr Leu Ala Pro Glu385 390 395
400Leu Pro Ile Trp Val Tyr Phe Pro Pro Gln Tyr Ala Tyr Leu Thr
Val 405 410 415Gly Glu Val
Asn Thr Gln Gly Ile Ser Gly Asp Ser Lys Lys Leu Ala 420
425 430Ser Glu Glu Ser Ala Phe Tyr Val Leu Glu
His Ser Ser Phe Glu Leu 435 440
445Leu Gly Thr Gly Gly Ser Ala Thr Met Ser Tyr Lys Phe Pro Ala Val 450
455 460Pro Pro Glu Asn Leu Glu Gly Cys
Ser Gln His Phe Tyr Glu Met Tyr465 470
475 480Asn Pro Leu Tyr Gly Ser Arg Leu Gly Val Pro Asp
Thr Leu Gly Gly 485 490
495Asp Pro Lys Phe Arg Ser Leu Thr His Glu Asp His Ala Ile Gln Pro
500 505 510Gln Asn Phe Met Pro Gly
Pro Leu Ile Asn Ser Val Ser Thr Lys Glu 515 520
525Gly Asp Asn Ser Asn Thr Gly Ala Gly Lys Ala Leu Thr Gly
Leu Ser 530 535 540Thr Gly Thr Ser Gln
Asn Thr Arg Ile Ser Leu Arg Pro Gly Pro Val545 550
555 560Ser Gln Pro Tyr His His Trp Asp Thr Asp
Lys Tyr Val Thr Gly Ile 565 570
575Asn Ala Ile Ser His Gly Gln Thr Thr Tyr Gly Asn Ala Glu Asp Lys
580 585 590Glu Tyr Gln Gln Gly
Val Gly Arg Phe Pro Asn Glu Lys Glu Gln Leu 595
600 605Lys Gln Leu Gln Gly Leu Asn Met His Thr Tyr Phe
Pro Asn Lys Gly 610 615 620Thr Gln Gln
Tyr Thr Asp Gln Ile Glu Arg Pro Leu Met Val Gly Ser625
630 635 640Val Trp Asn Arg Arg Ala Leu
His Tyr Glu Ser Gln Leu Trp Ser Lys 645
650 655Ile Pro Asn Leu Asp Asp Ser Phe Lys Thr Gln Phe
Ala Ala Leu Gly 660 665 670Gly
Trp Gly Leu His Gln Pro Pro Pro Gln Ile Phe Leu Lys Ile Leu 675
680 685Pro Gln Ser Gly Pro Ile Gly Gly Ile
Lys Ser Met Gly Ile Thr Thr 690 695
700Leu Val Gln Tyr Ala Val Gly Ile Met Thr Val Thr Met Thr Phe Lys705
710 715 720Leu Gly Pro Arg
Lys Ala Thr Gly Arg Trp Asn Pro Gln Pro Gly Val 725
730 735Tyr Pro Pro His Ala Ala Gly His Leu Pro
Tyr Val Leu Tyr Asp Pro 740 745
750Thr Ala Thr Asp Ala Lys Gln His His Arg His Gly Tyr Glu Lys Pro
755 760 765Glu Glu Leu Trp Thr Ala Lys
Ser Arg Val His Pro Leu 770 775
78087681DNAerythrovirusCDS(1)..(681)Encodes amino acids 782-1008 of SEQ
ID NO 2. 87atg agt aaa acc act aac aaa tgg tgg gaa agc agt gac aaa ttt
gcc 48Met Ser Lys Thr Thr Asn Lys Trp Trp Glu Ser Ser Asp Lys Phe
Ala1 5 10 15cag gac gtg
tat aag cag ttt gtg caa ttt tat gaa aaa gct act gga 96Gln Asp Val
Tyr Lys Gln Phe Val Gln Phe Tyr Glu Lys Ala Thr Gly 20
25 30aca gac tta gag ctt att caa att tta aaa
gac cat tac aac att tct 144Thr Asp Leu Glu Leu Ile Gln Ile Leu Lys
Asp His Tyr Asn Ile Ser 35 40
45tta gat aat cct tta gaa aac ccc tct tct tta ttt gac tta gtt gct
192Leu Asp Asn Pro Leu Glu Asn Pro Ser Ser Leu Phe Asp Leu Val Ala 50
55 60cgc att aaa agt aat ctt aaa aac tct
cca gac cta tat agt cat cat 240Arg Ile Lys Ser Asn Leu Lys Asn Ser
Pro Asp Leu Tyr Ser His His65 70 75
80ttt cag agc cat gga cag tta tct gac cac ccc cat gcc tta
tca tcc 288Phe Gln Ser His Gly Gln Leu Ser Asp His Pro His Ala Leu
Ser Ser 85 90 95agt aac
agt agt gca gaa cct aga gga gaa aat gca gta tta tct agt 336Ser Asn
Ser Ser Ala Glu Pro Arg Gly Glu Asn Ala Val Leu Ser Ser 100
105 110gaa gac tta cac aag cct ggg caa gtt
agc ata caa tta ccc ggt act 384Glu Asp Leu His Lys Pro Gly Gln Val
Ser Ile Gln Leu Pro Gly Thr 115 120
125aac tat gtt ggg cct ggc aat gag cta caa gct ggg cct ccg cag aat
432Asn Tyr Val Gly Pro Gly Asn Glu Leu Gln Ala Gly Pro Pro Gln Asn 130
135 140gct gtg gac agt gct gca agg att
cat gac ttt agg tat agc caa ttg 480Ala Val Asp Ser Ala Ala Arg Ile
His Asp Phe Arg Tyr Ser Gln Leu145 150
155 160gct aag ttg gga ata aat cct tat aca cat tgg acg
gta gca gat gaa 528Ala Lys Leu Gly Ile Asn Pro Tyr Thr His Trp Thr
Val Ala Asp Glu 165 170
175gaa ttg tta aaa aat ata aaa aat gaa aca ggg ttt caa gca caa gca
576Glu Leu Leu Lys Asn Ile Lys Asn Glu Thr Gly Phe Gln Ala Gln Ala
180 185 190gta aaa gat tac ttt act
tta aaa ggt gca gct gcc cct gtg gcc cat 624Val Lys Asp Tyr Phe Thr
Leu Lys Gly Ala Ala Ala Pro Val Ala His 195 200
205ttt caa gga agt tta ccg gaa gtg ccc gcg tac aac gcc tca
gaa aaa 672Phe Gln Gly Ser Leu Pro Glu Val Pro Ala Tyr Asn Ala Ser
Glu Lys 210 215 220tac ccc agc
681Tyr Pro
Ser22588227PRTerythrovirus 88Met Ser Lys Thr Thr Asn Lys Trp Trp Glu Ser
Ser Asp Lys Phe Ala1 5 10
15Gln Asp Val Tyr Lys Gln Phe Val Gln Phe Tyr Glu Lys Ala Thr Gly
20 25 30Thr Asp Leu Glu Leu Ile Gln
Ile Leu Lys Asp His Tyr Asn Ile Ser 35 40
45Leu Asp Asn Pro Leu Glu Asn Pro Ser Ser Leu Phe Asp Leu Val
Ala 50 55 60Arg Ile Lys Ser Asn Leu
Lys Asn Ser Pro Asp Leu Tyr Ser His His65 70
75 80Phe Gln Ser His Gly Gln Leu Ser Asp His Pro
His Ala Leu Ser Ser 85 90
95Ser Asn Ser Ser Ala Glu Pro Arg Gly Glu Asn Ala Val Leu Ser Ser
100 105 110Glu Asp Leu His Lys Pro
Gly Gln Val Ser Ile Gln Leu Pro Gly Thr 115 120
125Asn Tyr Val Gly Pro Gly Asn Glu Leu Gln Ala Gly Pro Pro
Gln Asn 130 135 140Ala Val Asp Ser Ala
Ala Arg Ile His Asp Phe Arg Tyr Ser Gln Leu145 150
155 160Ala Lys Leu Gly Ile Asn Pro Tyr Thr His
Trp Thr Val Ala Asp Glu 165 170
175Glu Leu Leu Lys Asn Ile Lys Asn Glu Thr Gly Phe Gln Ala Gln Ala
180 185 190Val Lys Asp Tyr Phe
Thr Leu Lys Gly Ala Ala Ala Pro Val Ala His 195
200 205Phe Gln Gly Ser Leu Pro Glu Val Pro Ala Tyr Asn
Ala Ser Glu Lys 210 215 220Tyr Pro
Ser22589306DNAerythrovirusCDS(1)..(306)Encodes amino acids 228-329 of SEQ
ID NO 2. 89ttg ctc gca tta aaa gta atc tta aaa act ctc cag acc tat ata
gtc 48Leu Leu Ala Leu Lys Val Ile Leu Lys Thr Leu Gln Thr Tyr Ile
Val1 5 10 15atc att ttc
aga gcc atg gac agt tat ctg acc acc ccc atg cct tat 96Ile Ile Phe
Arg Ala Met Asp Ser Tyr Leu Thr Thr Pro Met Pro Tyr 20
25 30cat cca gta aca gta gtg cag aac cta gag
gag aaa atg cag tat tat 144His Pro Val Thr Val Val Gln Asn Leu Glu
Glu Lys Met Gln Tyr Tyr 35 40
45cta gtg aag act tac aca agc ctg ggc aag tta gca tac aat tac ccg
192Leu Val Lys Thr Tyr Thr Ser Leu Gly Lys Leu Ala Tyr Asn Tyr Pro 50
55 60gta cta act atg ttg ggc ctg gca atg
agc tac aag ctg ggc ctc cgc 240Val Leu Thr Met Leu Gly Leu Ala Met
Ser Tyr Lys Leu Gly Leu Arg65 70 75
80aga atg ctg tgg aca gtg ctg caa gga ttc atg act tta ggt
ata gcc 288Arg Met Leu Trp Thr Val Leu Gln Gly Phe Met Thr Leu Gly
Ile Ala 85 90 95aat tgg
cta agt tgg gaa 306Asn Trp
Leu Ser Trp Glu 10090102PRTerythrovirus 90Leu Leu Ala Leu Lys
Val Ile Leu Lys Thr Leu Gln Thr Tyr Ile Val1 5
10 15Ile Ile Phe Arg Ala Met Asp Ser Tyr Leu Thr
Thr Pro Met Pro Tyr 20 25
30His Pro Val Thr Val Val Gln Asn Leu Glu Glu Lys Met Gln Tyr Tyr
35 40 45Leu Val Lys Thr Tyr Thr Ser Leu
Gly Lys Leu Ala Tyr Asn Tyr Pro 50 55
60Val Leu Thr Met Leu Gly Leu Ala Met Ser Tyr Lys Leu Gly Leu Arg65
70 75 80Arg Met Leu Trp Thr
Val Leu Gln Gly Phe Met Thr Leu Gly Ile Ala 85
90 95Asn Trp Leu Ser Trp Glu
100911662DNAerythrovirusCDS(1)..(1662)Encodes amino acids 103-656 of SEQ
ID NO 2. 91atg act tca gtt aac tct gca gaa gcc agc act ggt gca ggc ggg
gga 48Met Thr Ser Val Asn Ser Ala Glu Ala Ser Thr Gly Ala Gly Gly
Gly1 5 10 15ggt agc aac
cct aca aaa agc atg tgg agt gaa ggg gct aca ttt act 96Gly Ser Asn
Pro Thr Lys Ser Met Trp Ser Glu Gly Ala Thr Phe Thr 20
25 30gct aat tct gta acg tgt aca ttc tct agg
caa ttt tta att cca tat 144Ala Asn Ser Val Thr Cys Thr Phe Ser Arg
Gln Phe Leu Ile Pro Tyr 35 40
45gat cca gag cat cat tat aaa gtg ttc tct cca gca gct agt agc tgc
192Asp Pro Glu His His Tyr Lys Val Phe Ser Pro Ala Ala Ser Ser Cys 50
55 60cac aat gct agt ggg aaa gag gca aaa
gtg tgc act att agt ccc att 240His Asn Ala Ser Gly Lys Glu Ala Lys
Val Cys Thr Ile Ser Pro Ile65 70 75
80atg ggg tac tct act ccg tgg aga tac tta gat ttt aat gct
tta aat 288Met Gly Tyr Ser Thr Pro Trp Arg Tyr Leu Asp Phe Asn Ala
Leu Asn 85 90 95ttg ttt
ttc tca cca tta gag ttt cag cac tta att gaa aat tat ggt 336Leu Phe
Phe Ser Pro Leu Glu Phe Gln His Leu Ile Glu Asn Tyr Gly 100
105 110agt ata gct cca gat gct tta act gta
act att tca gaa att gct gta 384Ser Ile Ala Pro Asp Ala Leu Thr Val
Thr Ile Ser Glu Ile Ala Val 115 120
125aaa gat gtc aca gac aaa aca gga gga ggt gtg caa gtt act gac agc
432Lys Asp Val Thr Asp Lys Thr Gly Gly Gly Val Gln Val Thr Asp Ser 130
135 140acc aca gga cgt ttg tgt atg tta
gtg gat cat gag tat aaa tac cca 480Thr Thr Gly Arg Leu Cys Met Leu
Val Asp His Glu Tyr Lys Tyr Pro145 150
155 160tat gtg cta ggt cag gga caa gac aca cta gct cca
gaa ctg ccc att 528Tyr Val Leu Gly Gln Gly Gln Asp Thr Leu Ala Pro
Glu Leu Pro Ile 165 170
175tgg gtt tac ttt ccc ccc cag tat gct tac tta aca gta ggt gaa gta
576Trp Val Tyr Phe Pro Pro Gln Tyr Ala Tyr Leu Thr Val Gly Glu Val
180 185 190aac aca caa gga att tca
gga gac agc aaa aaa ttg gct agt gaa gaa 624Asn Thr Gln Gly Ile Ser
Gly Asp Ser Lys Lys Leu Ala Ser Glu Glu 195 200
205tca gct ttt tat gtg tta gag cac agt tca ttt gaa ctt ttg
ggt aca 672Ser Ala Phe Tyr Val Leu Glu His Ser Ser Phe Glu Leu Leu
Gly Thr 210 215 220ggg gga tct gcc act
atg tcc tac aaa ttt cca gct gtg ccc cca gaa 720Gly Gly Ser Ala Thr
Met Ser Tyr Lys Phe Pro Ala Val Pro Pro Glu225 230
235 240aac cta gaa ggc tgc agc caa cat ttt tat
gaa atg tac aac cct ttg 768Asn Leu Glu Gly Cys Ser Gln His Phe Tyr
Glu Met Tyr Asn Pro Leu 245 250
255tac ggt tct cgt tta ggg gta cct gac aca tta gga ggg gac cct aaa
816Tyr Gly Ser Arg Leu Gly Val Pro Asp Thr Leu Gly Gly Asp Pro Lys
260 265 270ttt aga tca ttg aca cac
gaa gac cac gca att cag cca caa aac ttt 864Phe Arg Ser Leu Thr His
Glu Asp His Ala Ile Gln Pro Gln Asn Phe 275 280
285atg cct ggg cca cta ata aat tca gtg tct acc aaa gaa gga
gac aat 912Met Pro Gly Pro Leu Ile Asn Ser Val Ser Thr Lys Glu Gly
Asp Asn 290 295 300tct aat aca ggt gct
gga aaa gcc ctt acg ggg ctt agt act ggc act 960Ser Asn Thr Gly Ala
Gly Lys Ala Leu Thr Gly Leu Ser Thr Gly Thr305 310
315 320agc caa aac acc aga att tcc cta cgc ccc
ggg cca gta tct cag cca 1008Ser Gln Asn Thr Arg Ile Ser Leu Arg Pro
Gly Pro Val Ser Gln Pro 325 330
335tac cat cac tgg gac act gat aaa tat gtt aca gga ata aat gcc att
1056Tyr His His Trp Asp Thr Asp Lys Tyr Val Thr Gly Ile Asn Ala Ile
340 345 350tca cat gga caa acc act
tat gga aat gct gag gac aaa gag tat cag 1104Ser His Gly Gln Thr Thr
Tyr Gly Asn Ala Glu Asp Lys Glu Tyr Gln 355 360
365caa ggg gta gga aga ttt cca aat gaa aaa gaa cag ctt aag
cag tta 1152Gln Gly Val Gly Arg Phe Pro Asn Glu Lys Glu Gln Leu Lys
Gln Leu 370 375 380caa ggt ctt aac atg
cac aca tac ttc cct aat aaa gga acc caa caa 1200Gln Gly Leu Asn Met
His Thr Tyr Phe Pro Asn Lys Gly Thr Gln Gln385 390
395 400tac aca gac caa att gaa cgc cct ctt atg
gtg ggc tct gtt tgg aac 1248Tyr Thr Asp Gln Ile Glu Arg Pro Leu Met
Val Gly Ser Val Trp Asn 405 410
415aga aga gct ctt cac tat gaa agt cag ctg tgg agt aaa atc cct aac
1296Arg Arg Ala Leu His Tyr Glu Ser Gln Leu Trp Ser Lys Ile Pro Asn
420 425 430tta gat gac agt ttt aaa
act caa ttt gca gcc cta ggc ggg tgg ggt 1344Leu Asp Asp Ser Phe Lys
Thr Gln Phe Ala Ala Leu Gly Gly Trp Gly 435 440
445ttg cat caa cca ccc cct caa ata ttt tta aaa ata cta cca
caa agt 1392Leu His Gln Pro Pro Pro Gln Ile Phe Leu Lys Ile Leu Pro
Gln Ser 450 455 460ggg cca att gga ggt
att aaa tcc atg gga att act act tta gtt caa 1440Gly Pro Ile Gly Gly
Ile Lys Ser Met Gly Ile Thr Thr Leu Val Gln465 470
475 480tat gct gtg gga ata atg aca gtt acc atg
acc ttt aaa ttg gga cct 1488Tyr Ala Val Gly Ile Met Thr Val Thr Met
Thr Phe Lys Leu Gly Pro 485 490
495cga aag gct act gga agg tgg aat ccc cag cct ggc gtt tat cct cct
1536Arg Lys Ala Thr Gly Arg Trp Asn Pro Gln Pro Gly Val Tyr Pro Pro
500 505 510cat gca gct ggt cat tta
cca tat gta ctg tat gac ccc aca gct aca 1584His Ala Ala Gly His Leu
Pro Tyr Val Leu Tyr Asp Pro Thr Ala Thr 515 520
525gat gca aag caa cac cac aga cac gga tat gaa aag cct gaa
gaa ttg 1632Asp Ala Lys Gln His His Arg His Gly Tyr Glu Lys Pro Glu
Glu Leu 530 535 540tgg act gcc aaa agc
cgt gtg cac cca ttg 1662Trp Thr Ala Lys Ser
Arg Val His Pro Leu545 55092554PRTerythrovirus 92Met Thr
Ser Val Asn Ser Ala Glu Ala Ser Thr Gly Ala Gly Gly Gly1 5
10 15Gly Ser Asn Pro Thr Lys Ser Met
Trp Ser Glu Gly Ala Thr Phe Thr 20 25
30Ala Asn Ser Val Thr Cys Thr Phe Ser Arg Gln Phe Leu Ile Pro
Tyr 35 40 45Asp Pro Glu His His
Tyr Lys Val Phe Ser Pro Ala Ala Ser Ser Cys 50 55
60His Asn Ala Ser Gly Lys Glu Ala Lys Val Cys Thr Ile Ser
Pro Ile65 70 75 80Met
Gly Tyr Ser Thr Pro Trp Arg Tyr Leu Asp Phe Asn Ala Leu Asn
85 90 95Leu Phe Phe Ser Pro Leu Glu
Phe Gln His Leu Ile Glu Asn Tyr Gly 100 105
110Ser Ile Ala Pro Asp Ala Leu Thr Val Thr Ile Ser Glu Ile
Ala Val 115 120 125Lys Asp Val Thr
Asp Lys Thr Gly Gly Gly Val Gln Val Thr Asp Ser 130
135 140Thr Thr Gly Arg Leu Cys Met Leu Val Asp His Glu
Tyr Lys Tyr Pro145 150 155
160Tyr Val Leu Gly Gln Gly Gln Asp Thr Leu Ala Pro Glu Leu Pro Ile
165 170 175Trp Val Tyr Phe Pro
Pro Gln Tyr Ala Tyr Leu Thr Val Gly Glu Val 180
185 190Asn Thr Gln Gly Ile Ser Gly Asp Ser Lys Lys Leu
Ala Ser Glu Glu 195 200 205Ser Ala
Phe Tyr Val Leu Glu His Ser Ser Phe Glu Leu Leu Gly Thr 210
215 220Gly Gly Ser Ala Thr Met Ser Tyr Lys Phe Pro
Ala Val Pro Pro Glu225 230 235
240Asn Leu Glu Gly Cys Ser Gln His Phe Tyr Glu Met Tyr Asn Pro Leu
245 250 255Tyr Gly Ser Arg
Leu Gly Val Pro Asp Thr Leu Gly Gly Asp Pro Lys 260
265 270Phe Arg Ser Leu Thr His Glu Asp His Ala Ile
Gln Pro Gln Asn Phe 275 280 285Met
Pro Gly Pro Leu Ile Asn Ser Val Ser Thr Lys Glu Gly Asp Asn 290
295 300Ser Asn Thr Gly Ala Gly Lys Ala Leu Thr
Gly Leu Ser Thr Gly Thr305 310 315
320Ser Gln Asn Thr Arg Ile Ser Leu Arg Pro Gly Pro Val Ser Gln
Pro 325 330 335Tyr His His
Trp Asp Thr Asp Lys Tyr Val Thr Gly Ile Asn Ala Ile 340
345 350Ser His Gly Gln Thr Thr Tyr Gly Asn Ala
Glu Asp Lys Glu Tyr Gln 355 360
365Gln Gly Val Gly Arg Phe Pro Asn Glu Lys Glu Gln Leu Lys Gln Leu 370
375 380Gln Gly Leu Asn Met His Thr Tyr
Phe Pro Asn Lys Gly Thr Gln Gln385 390
395 400Tyr Thr Asp Gln Ile Glu Arg Pro Leu Met Val Gly
Ser Val Trp Asn 405 410
415Arg Arg Ala Leu His Tyr Glu Ser Gln Leu Trp Ser Lys Ile Pro Asn
420 425 430Leu Asp Asp Ser Phe Lys
Thr Gln Phe Ala Ala Leu Gly Gly Trp Gly 435 440
445Leu His Gln Pro Pro Pro Gln Ile Phe Leu Lys Ile Leu Pro
Gln Ser 450 455 460Gly Pro Ile Gly Gly
Ile Lys Ser Met Gly Ile Thr Thr Leu Val Gln465 470
475 480Tyr Ala Val Gly Ile Met Thr Val Thr Met
Thr Phe Lys Leu Gly Pro 485 490
495Arg Lys Ala Thr Gly Arg Trp Asn Pro Gln Pro Gly Val Tyr Pro Pro
500 505 510His Ala Ala Gly His
Leu Pro Tyr Val Leu Tyr Asp Pro Thr Ala Thr 515
520 525Asp Ala Lys Gln His His Arg His Gly Tyr Glu Lys
Pro Glu Glu Leu 530 535 540Trp Thr Ala
Lys Ser Arg Val His Pro Leu545
55093396DNAerythrovirusCDS(1)..(396)Encodes amino acids 555-686 of SEQ ID
NO 2. 93cct tta aat tgg gac ctc gaa agg cta ctg gaa ggt gga atc ccc agc
48Pro Leu Asn Trp Asp Leu Glu Arg Leu Leu Glu Gly Gly Ile Pro Ser1
5 10 15ctg gcg ttt atc ctc
ctc atg cag ctg gtc att tac cat atg tac tgt 96Leu Ala Phe Ile Leu
Leu Met Gln Leu Val Ile Tyr His Met Tyr Cys 20
25 30atg acc cca cag cta cag atg caa agc aac acc aca
gac acg gat atg 144Met Thr Pro Gln Leu Gln Met Gln Ser Asn Thr Thr
Asp Thr Asp Met 35 40 45aaa agc
ctg aag aat tgt gga ctg cca aaa gcc gtg tgc acc cat tgt 192Lys Ser
Leu Lys Asn Cys Gly Leu Pro Lys Ala Val Cys Thr His Cys 50
55 60aaa cat tcc cca ccg tgt cct cag cca gga acc
gtc acc cac cgc cca 240Lys His Ser Pro Pro Cys Pro Gln Pro Gly Thr
Val Thr His Arg Pro65 70 75
80cct gtg ccg ccc aga tta tat gtg ccc cct cca ata ccc cgt agg caa
288Pro Val Pro Pro Arg Leu Tyr Val Pro Pro Pro Ile Pro Arg Arg Gln
85 90 95cca tct ata aaa gat
aca gac gct gta gaa tat aaa tta tta act aga 336Pro Ser Ile Lys Asp
Thr Asp Ala Val Glu Tyr Lys Leu Leu Thr Arg 100
105 110tat gaa caa cat gta att aga atg cta aga tta tgt
aat atg tac aca 384Tyr Glu Gln His Val Ile Arg Met Leu Arg Leu Cys
Asn Met Tyr Thr 115 120 125agt ttg
gaa aaa 396Ser Leu
Glu Lys 13094132PRTerythrovirus 94Pro Leu Asn Trp Asp Leu Glu Arg Leu
Leu Glu Gly Gly Ile Pro Ser1 5 10
15Leu Ala Phe Ile Leu Leu Met Gln Leu Val Ile Tyr His Met Tyr
Cys 20 25 30Met Thr Pro Gln
Leu Gln Met Gln Ser Asn Thr Thr Asp Thr Asp Met 35
40 45Lys Ser Leu Lys Asn Cys Gly Leu Pro Lys Ala Val
Cys Thr His Cys 50 55 60Lys His Ser
Pro Pro Cys Pro Gln Pro Gly Thr Val Thr His Arg Pro65 70
75 80Pro Val Pro Pro Arg Leu Tyr Val
Pro Pro Pro Ile Pro Arg Arg Gln 85 90
95Pro Ser Ile Lys Asp Thr Asp Ala Val Glu Tyr Lys Leu Leu
Thr Arg 100 105 110Tyr Glu Gln
His Val Ile Arg Met Leu Arg Leu Cys Asn Met Tyr Thr 115
120 125Ser Leu Glu Lys 1309540PRTerythrovirus
95Met Ser Lys Thr Thr Asn Lys Trp Trp Glu Ser Ser Asp Lys Phe Ala1
5 10 15Gln Asp Val Tyr Lys Gln
Phe Val Gln Phe Tyr Glu Lys Ala Thr Gly 20 25
30Thr Asp Leu Glu Leu Ile Gln Ile 35
409621PRTerythrovirus 96Ser Leu Phe Asp Leu Val Ala Arg Ile Lys Ser
Asn Leu Lys Asn Ser1 5 10
15Pro Asp Leu Tyr Ser 209724PRTerythrovirus 97Leu Ser Asp His
Pro His Ala Leu Ser Ser Ser Asn Ser Ser Ala Glu1 5
10 15Pro Arg Gly Glu Asn Ala Val Leu
209821PRTerythrovirus 98Glu Asp Leu His Lys Pro Gly Gln Val Ser Ile Gln
Leu Pro Gly Thr1 5 10
15Asn Tyr Val Gly Pro 209922PRTerythrovirus 99Gly Asn Glu Leu
Gln Ala Gly Pro Pro Gln Asn Ala Val Asp Ser Ala1 5
10 15Ala Arg Ile His Asp Phe
2010021PRTerythrovirus 100Ile Lys Asn Glu Thr Gly Phe Gln Ala Gln Ala Val
Lys Asp Tyr Phe1 5 10
15Thr Leu Lys Gly Ala 2010132PRTerythrovirus 101Ser Thr Gly
Ala Gly Gly Gly Gly Ser Asn Pro Thr Lys Ser Met Trp1 5
10 15Ser Glu Gly Ala Thr Phe Thr Ala Asn
Ser Val Thr Cys Thr Phe Ser 20 25
3010221PRTerythrovirus 102Pro Pro Gln Tyr Ala Tyr Leu Thr Val Gly
Glu Val Asn Thr Gln Gly1 5 10
15Ile Ser Gly Asp Ser 2010337PRTerythrovirus 103Ala Phe
Tyr Val Leu Glu His Ser Ser Phe Glu Leu Leu Gly Thr Gly1 5
10 15Gly Ser Ala Thr Met Ser Tyr Lys
Phe Pro Ala Val Pro Pro Glu Asn 20 25
30Leu Glu Gly Cys Ser 3510428PRTerythrovirus 104Gln Asn
Phe Met Pro Gly Pro Leu Ile Asn Ser Val Ser Thr Lys Glu1 5
10 15Gly Asp Asn Ser Asn Thr Gly Ala
Gly Lys Ala Leu 20 2510519DNAerythrovirus
105tgcagatgcc ctccaccca
1910621DNAerythrovirus 106gctgctttca ctgagttctt c
2110720DNAerythrovirus 107gaccagttca ggagaatcat
2010819DNAerythrovirus
108atcggcaagc ggcgtgtaa
1910920DNAerythrovirus 109atccagacag gtaagcacat
2011021DNAerythrovirus 110atcggcaagc ggcgtgtaaa a
2111119DNAerythrovirus
111catgccttat catccagta
1911220DNAerythrovirus 112ttggctatac ctaaagtcat
2011319DNAerythrovirus 113cactatgaaa actgggcaa
1911419DNAerythrovirus
114acaattcttc atctgctac
1911521DNAerythrovirus 115aaactgggca ataaactaca c
2111620DNAerythrovirus 116cttcatctgc taccgtccaa
2011733DNAerythrovirus
117aaaggcctag atcttgtaga ttatgagtaa aac
3311826DNAerythrovirus 118cggaattcgg tgggtgacgg ttcctg
2611929DNAerythrovirus 119cacggatcca taccccagca
tgacttcag 2912027DNAerythrovirus
120cacggatccg gtgggtgacg gttcctg
2712136DNAerythrovirus 121accagtatca gcagcagtgg tggtgaaagc tctgaa
36
User Contributions:
comments("1"); ?> comment_form("1"); ?>Inventors list |
Agents list |
Assignees list |
List by place |
Classification tree browser |
Top 100 Inventors |
Top 100 Agents |
Top 100 Assignees |
Usenet FAQ Index |
Documents |
Other FAQs |
User Contributions:
Comment about this patent or add new information about this topic: