Patent application title: Targeting Pseudotyped Retroviral Vectors
Inventors:
Irvin S.y. Chen (Palos Verdes Estates, CA, US)
Irvin S.y. Chen (Palos Verdes Estates, CA, US)
Kouki Morizono (Los Angeles, CA, US)
IPC8 Class: AA61K3170FI
USPC Class:
514 44
Class name: N-glycoside nitrogen containing hetero ring polynucleotide (e.g., rna, dna, etc.)
Publication date: 2008-09-18
Patent application number: 20080227736
Claims:
1. A pseudotyped, targeted retroviral vector comprising:a) a mutated
Sindbis envelope comprising Sindbis envelope proteins E1, E2, and E3,
wherein at least one of E1, E2, or E3 is mutated as compared to a
wild-type sequence;b) a targeting moiety linked to the Sindbis envelope.
2. The vector of claim 1, further comprising a retroviral-based nucleic acid genome.
3. The vector of claim 1, wherein the vector nucleic acid comprises a heterologous gene operably linked to a promoter.
4. The vector of claim 3, wherein the promoter is a tissue-specific promoter.
5. The vector of claim 4, wherein the tissue-specific promoter is a PSE-BC promoter.
6. The vector of claim 1, wherein the targeting moiety specifically binds to a target protein selected from the group consisting of P-glycoprotein, Her2/Neu, erythropoietin (EPO), epidermal growth factor receptor (EGFR), vascular endothelial growth factor receptor (VEGF-R), cadherin, carcinoembryonic antigen (CEA), CD4, CD8, CD19, CD20, CD33, CD34, CD45, CD117 (c-kit), CD133, HLA-A, HLA-B, HLA-C, chemokine receptor 5 (CCR5), stem cell marker ABCG2 transporter, ovarian cancer antigen CA125, an integrin, prostate specific antigen (PSA), prostate stem cell antigen (PSCA), dendritic cell-specific intercellular adhesion molecule 3-grabbing nonintegrin (DC-SIGN), thyroglobulin, granulocyte-macrophage colony stimulating factor (GM CSF), myogenic differentiation promoting factor-1 (MyoD-1), Leu-7 (CD57), LeuM-1, cell proliferation-associated human nuclear antigen defined by the monoclonal antibody Ki-67 (Ki-67), HIV gp120, and transferrin receptor.
7. The vector of claim 6, wherein the targeting moiety is an antibody.
8. The vector of claim 7, wherein the targeting moiety is an antibody directed against prostate stem cell antigen (PSCA).
9. The vector of claim 7, wherein the targeting moiety is an antibody directed against P-glycoprotein (P-gp).
10. The vector of claim 7, wherein the targeting moiety is an antibody directed against a transferrin receptor.
11. The vector of claim 1, wherein the targeting moiety is covalently linked to the Sindbis envelope.
12. The vector of claim 1, wherein the targeting moiety is non-covalently linked to the Sindbis envelope.
13. The vector of claim 1, wherein the targeting moiety is covalently linked to the E2 or the E3 protein of the Sindbis envelope.
14. The vector of claim 1, wherein the targeting moiety is non-covalently linked to the E2 or the E3 protein of the Sindbis envelope.
15. The vector of claim 14, wherein the targeting moiety is non-covalently linked to the E2 protein Sindbis envelope via the ZZ domain of protein A.
16. The vector of claim 1, wherein E2 protein is mutated at one amino acid position.
17. The vector of claim 1, wherein E2 protein is mutated at two or more amino acid positions.
18. The vector of claim 1, wherein E3 protein is mutated at one amino acid position.
19. The vector of claim 1, wherein E3 protein is mutated at two or more amino acid positions.
20. The vector of claim 1, wherein the mutated Sindbis envelope is encoded by a sequence listed in Table 1.
21. The vector of claim 1, wherein the mutated Sindbis envelope is encoded by m168 which has a mutation in Sindbis virus envelope protein E2.
22. The vector of claim 21, further comprising a mutation in Sindbis envelope protein E1.
23. A packaging system comprising a cell comprising nucleic acids encoding the pseudotyped, targeted retroviral vector of claim 1.
24. The packaging system of claim 23, wherein the vector further comprises a retroviral-based nucleic acid genome.
25. The packaging system of claim 24, wherein the Sinbis envelope proteins E1, E2, and E3 and the retroviral-based nucleic acid genome are encoded on the same nucleic acid.
26. The packaging cell of claim 24, wherein the Sinbis envelope proteins E1, E2, and E3 and the retroviral-based nucleic acid genome are encoded on separate nucleic acids.
27. An expression vector comprising a nucleic acid encoding Sindbis envelope proteins E1, E2, and E3, wherein at least one of E, E2, or E3 is mutated as compared to a wild-type sequence.
28. A method of making the pseudotyped, targeted retroviral vector of claim 1, the method comprising the step of expressing in a cell a nucleic acid comprising Sindbis envelope proteins E1, E2, and E3.
29. The method of claim 28, wherein the vector further comprises a retroviral-based nucleic acid genome.
30. The method of claim 29, wherein the Sindbis envelope proteins E1, E2, and E3 and the retroviral based nucleic acid genome are encoded on the same nucleic acid.
31. The method of claim 29, wherein the Sindbis envelope proteins E1, E2, and E3 and the retroviral based nucleic acid genome are encoded on separate nucleic acids.
32. The method of claim 28, further comprising the step of isolating a virus particle from the cell.
33. A method of transducing cells with a heterologous gene, the method comprising the step of contacting the cell with the pseudotyped, targeted retroviral vector of claim 1.
34. The method of claim 33, wherein the cells are in a subject and the vector is administered intravenously.
35. The method of claim 33, wherein the cells are transduced ex vivo.
36. The method of claim 33, wherein the cells are transduced in vivo.
37. The method of claim 33, wherein the cells are transduced in vitro.
38. A method of treating or preventing a disease state, the method comprising the step of contacting a cell with the pseudotyped, targeted retroviral vector of claim 1.
39. The method of claim 38, wherein the cell is contacted in vivo.
40. The method of claim 38, wherein the cell is contacted ex vivo.
41. The method of claim 38, wherein the cell is contacted in vitro.
42. A method of diagnosing a disease state, the method comprising the step of contacting a cell with the pseudotyped, targeted retroviral vector of claim 1.
43. The method of claim 42, wherein the cell is contacted in vivo.
44. The method of claim 42, wherein the cell is contacted ex vivo.
45. The method of claim 42, wherein the cell is contacted in vitro.
46. A method of delivering a pseudotyped, targeted retroviral vector across the blood brain barrier in a subject, the method comprising the step of contacting a cell with the pseudotyped, targeted retroviral vector of claim 10.
Description:
CROSS-REFERENCES TO RELATED APPLICATIONS
[0001]This application claims the benefit of U.S. Provisional Patent Application No. 60/577,248, filed Jun. 3, 2004, the disclosure of which is hereby incorporated herein by reference in its entirety for all purposes.
FIELD OF THE INVENTION
[0003]The present invention relates to lentiviral vectors pseudotyped with Sindbis envelope and targeted to specific cell types via a targeting moiety linked to the envelope.
BACKGROUND OF THE INVENTION
[0004]Clinically effective gene therapy protocols for various diseases would ideally utilize procedures for efficient and specific targeting of therapeutic genes to affected cells while maintaining stable transduction and long term expression. This would be accomplished by direct injection into the bloodstream followed by homing of the vector to the desired target cells or organs. Thus, there have been many attempts to develop targeted gene transduction systems based upon various viral vectors. Adenovirus and adeno-associated virus vectors have been used in targeted gene delivery strategies because of their simple binding and entry mechanisms. (Nicklin and Baker, Curr Gene Ther. 2, 273-293 (2002)) Although these vectors have been used successfully in vitro, for targeting to specific cells, their usefulness in vivo has been limited by their natural tropism (Muller et al., Nat. Blotechnol. 21, 1040-1046 (2003)), especially to liver cells (Martin et al., Mol. Ther. 8, 485-494 (2003)).
[0005]Oncoretroviral- and lentiviral-based vectors have several properties that make them ideal for use in gene therapy (Sandrin et al., Curr. Top. Microbiol. Immunol. 281:137-78, 137-178 (2003)). Efficient integration of retroviral DNA into the host genome enables stable long-term transgene expression. Unlike oncoretroviral vectors, lentiviral vectors are capable of transducing non-dividing cells. The application of specific targeting with retroviral vectors has been problematic and the few studies of retroviral vector targeting in living animals are not efficient (Martin et al., Mol. Ther. 5, 269-274 (2002); Jiang and Domburg, Gene Ther. 6, 1982-1987 (1999)). Inserting ligands, peptides or single chain antibodies into the retroviral receptor binding envelope subunit has been the most common approach used to alter and/or restrict the host range of retroviral vectors (Han et al., Proc Natl. Acad Sci U.S.A. 92, 9747-9751 (1995); Jiang et al., J. Virol. 72, 10148-10156 (1998); Marin et al., J. Virol. 70, 2957-2962 (1996); Martin et al., J. Virol. 73, 6923-6929 (1999); Nilson et al., Gene Ther. 3, 280-286 (1996); Somia et al., Proc Natl. Acad Sci U.S.A. 92, 7570-7574 (1995); Valsesia-Wittmann et al., J Virol 68, 4609-4619 (1994)). Another approach is bridging virus vector and cells by antibodies or ligands (Boerger et al., Proc Natl Acad Sci U.S.A. 96, 9867-9872 (1999); Roux et al., Proc Natl Acad Sci U.S.A. 86, 9079-9083 (1989)). In general, most strategies have suffered from inconsistent specificity and low viral titers as a result of modification of the retroviral envelope (Han et al., Proc Natl. Acad Sci U.S.A. 92, 9747-9751 (1995); Marin et al., J. Virol. 70, 2957-2962 (1996); Nilson et al., Gene Ther. 3, 280-286 (1996); Somia et al., Proc Natl. Acad Sci U.S.A. 92, 7570-7574 (1995); Valsesia-Wittmann et al., J. Virol 68, 4609-4619 (1994); Kasahara et al., Science 266, 1373-1376 (1994)). The modified envelope proteins appear to have specific binding activity but low fusion activity resulting in inefficient entry into cells (Martin et al., J. Virol. 73, 6923-6929 (1999); Zhao et al., Proc Natl. Acad Sci U.S.A. 96, 4005-4010 (1999)). In the absence of specific targeting, current strategies depend upon direct injection to a localized site (Akporiaye and Hersh, Curr. Opin. Mol. Ther. 1, 443-453 (1999)) or, as in the case of the only successful treatment of a heritable disease, X-linked SCID, ex vivo isolation, purification and transduction of target hematopoietic cells (Kohn et al., Nat. Med. 1, 1017-1023 (1995); Cavazzana-Calvo et al., Science 288, 669-672 (2000)).
[0006]Sindbis virus is a member of the Alphavirus genius (Schlesinger and Schlesinger, Fundamental Virology 523-539, Raven, Philadelphia (1996)). In mature Sindbis virions the plus-stranded RNA viral genome is complexed with the capsid protein to form an icosahedral nucleocapsid surrounded by a lipid bilayer embedded with two integral membrane glycoproteins, E1 and E2, that form a heterodimer and function as a unit. E1 and E2 are anchored in the membrane independently. E2 binds to the host cell receptor. E1 can mediate membrane fusion as long as it is exposed to the low pH of the endosome and in the absence of a specific interaction with a receptor. Monoclonal antibodies capable of neutralizing virus infection are usually E2 specific, and mutation of E2 is frequently associated with altered host range and virulence. E2 can be modified substantially yet retain viral infectivity. This property of E2 has been exploited to develop Sindbis virus vectors that target specific cells (Ohno et al., Nat. Biotechnol. 15, 763-767 (1997)). However, since Sindbis virus vectors are cytotoxic (Tseng et al. Systemic tumor targeting and killing by Sindbis viral vectors, Nat. Biotechnol. (2003)) and unable to stably transduce their target cells, they cannot be used where stable expression is desired.
[0007]We previously found that the Sindbis virus envelope (with E1 and E2) is able to pseudotype oncoretroviruses and lentiviruses (Morizono et al., J. Virol., September; 75.(17.):8015.-20. 75, 8016-8020 (2001)). We used the flexibility of the Sindbis virus E2 protein to our advantage in developing oncoretroviral and lentiviral vectors with the capacity to target specific cells. We previously reported an oncoretroviral and lentiviral gene targeting system based on antibody-mediated specific binding of a modified Sindbis virus envelope (ZZ SINDBIS) that encoded the ZZ domain of protein A. We demonstrated that monoclonal antibodies directed to cell surface antigens can be used to redirect the target specificity of these vectors when pseudotyped with the modified Sindbis envelope. Of particular note, the vectors maintained high viral titers, which could be further increased by simple ultracentrifugation.
[0008]Sindbis virus has a broad natural host range. The high-affinity laminin receptor (Wang et al., J. Virol. 66, 4992-5001 (1992)) and heparin sulfate are among the known receptors (Klimstra et al., J, Virol. 72, 7357-7366 (1998)). Their wide distribution and highly conserved nature may be in part responsible for the residual non-specific tropism observed with the ZZ SINDBIS pseudotyped vector. Accordingly, there exists a need for targeted retroviral vectors with decreased binding of endogenous receptors. The present invention fulfills this and other needs.
BRIEF SUMMARY OF THE INVENTION
[0009]In order to further reduce the natural tropism of the Sindbis virus envelope and thereby increase the specificity of targeted gene transduction in vivo, we screened a panel of E2 mutants. We identified several mutants within E2 that reduced the endogenous tropism of E2. We utilized our modified ZZ SINDBIS envelope, designated m168, and a lentiviral reporter vector to target P-glycoprotein (P-gp) expressing melanoma cells in the lungs of a murine model for metastatic melanoma. We demonstrate specific targeting of metastatic tumor cells through direct injection of the vector into the bloodstream.
[0010]The present invention therefore provides targeted lentiviral vectors that are pseudotyped with mutated Sindbis envelopes. In particular, mutations in the E2 protein and are used to alter viral titer, specificity, specificity index, tropism, and susceptibility to host immune response. The pseudotyped, targeted lentiviral vectors of the invention are used to transduce heterologous genes into a cell and can be used for in vivo and ex vivo therapeutic applications, as well as for diagnostic and research tool applications.
[0011]Accordingly, in a first aspect, the invention provides a pseudotyped, targeted retroviral vector comprising: [0012]a) a mutated Sindbis envelope comprising Sindbis envelope proteins E1, E2, and E3, wherein at least one of E1, E2, or E3 is mutated as compared to a wild-type sequence; [0013]b) a targeting moiety linked to the Sindbis envelope.
[0014]In certain embodiments, the vector further comprises a retroviral-based nucleic acid genome. In certain embodiments, the retroviral-based nucleic acid genome is a lentivirus or an oncoretrovirus genome. The genome can also optionally comprise a heterologous gene.
[0015]In certain embodiments, the vector is isolated. Typically, one or more of the E1, E2, or E3 proteins can be mutated at one or more amino acid positions. In one preferred embodiment, the vector comprises the following envelope protein mutations in comparison to wild-type Sindbis virus envelope proteins: (i) deletion of E3 amino acids 61-64; (ii) E2 KE159-160AA; and (iii) E2 SLKQ68-71AAAA (SEQ ID NOs: 3-4). In a further embodiment, the vector additionally comprises the envelope protein mutation E1 AK226-227SG. The vectors can also have a protein binding domain that specifically binds a protein of interest (i.e., a targeting moiety, including an antibody, an integrin, a transferrin receptor). In certain embodiments, the targeting moiety is an antibody.
[0016]The invention further encompasses a packaging system comprising a cell comprising one or more nucleic acids encoding the pseudotyped, targeted retroviral vectors described herein. In a related aspect, the invention provides expression vectors comprising one or more nucleic acids encoding Sindbis envelope proteins E1, E2, and E3, wherein at least one of E1, E2 or E3 is mutated as compared to a wild-type sequence.
[0017]In another aspect, the invention provides methods of making the pseudotyped, targeted retroviral vectors of the invention, the methods comprising the steps of expressing in a cell one or more nucleic acids comprising Sindbis envelope proteins E1, E2, and E3. The vector can optionally comprise a nucleic acid comprising the retroviral based nucleic acid genome. The Sindbis envelope proteins E1, E2 and E3 and the retroviral-based nucleic acid genome can be encoded on the same or separate nucleic acids.
[0018]In a related aspect, the invention also provides methods of transducing cells with a heterologous gene; methods of treating or preventing a disease state; and methods of diagnosing a disease state, the methods comprising the step of contacting the cell with the pseudotyped, targeted retroviral vectors described herein. In certain embodiments the cells are contacted in vitro, ex vivo, or in vivo. The pseudotyped, targeted retroviral vectors are typically administered intravenously.
[0019]In a another aspect, the invention provides a method for delivering a pseudotyped, targeted retroviral vector across the blood brain barrier in a subject, the method comprising the step of contacting a cell with a pseudotyped, targeted retroviral vector of the present invention, wherein the targeting moiety specifically binds to a transferrin receptor.
DEFINITIONS
[0020]Sindbis envelope," "ZZSINDBIS," and "m168" refer to a viral envelope comprising the Sindbis E1, E2, and E3 proteins. The terms "Sindbis E1 protein," "Sindbis E2 protein" and "Sindbis E3 protein" or a nucleic acid encoding "Sindbis E1 protein," "Sindbis E2 protein" and "Sindbis E3 protein" refer to nucleic acids and polypeptide polymorphic variants, alleles, mutants, and interspecies homologs that: (1) have a nucleotide sequence that has greater than about 60% nucleotide sequence identity, 65%, 70%, 75%, 80%, 85%, 90%, preferably 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or greater nucleotide sequence identity, preferably over a region of at least about 25, 50, 100, 200, 500, 1000, or more nucleic acids, up to the full length sequence, to the nucleotide sequence of E1, E2, and/or E3; (2) bind to antibodies, e.g., polyclonal or monoclonal antibodies, raised against an immunogen comprising an amino acid sequence of an E1, E2, and/or E3 protein, and conservatively modified variants thereof; (3) specifically hybridize under stringent hybridization conditions to an anti-sense strand corresponding to a nucleic acid sequence of E1, E2, and/or E3 and conservatively modified variants thereof; (4) encode a protein having an amino acid sequence that has greater than about 60% nucleotide sequence identity, 65%, 70%, 75%, 80%, 85%, 90%, preferably 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or greater nucleotide sequence identity, preferably over a region of at least about 25, 50, 100, 200, 500, 1000, or more amino acids, to a E1, E2, and/or E3 protein. The nucleic acids and proteins of the invention include both naturally occurring or recombinant molecules, as well as point mutations, including randomly generated point mutations and those generated by site-directed mutagenesis. E1, E2, and E3 are encoded by a polyprotein, the amino acid sequence of which is provided, e.g., by Accession No. VHWVB, VHWVB2, and P03316; the nucleic acid sequence is provided, e.g., by Accession No. SVU90536 and V01403 (see also Rice & Strauss, Proc. Nat'l Acad. Sci. USA 78:2062-2066 (1981); and Strauss et al., Virology 133:92-110 (1984)). Other Togaviridae family envelopes, e.g., from the Alphavirus genus, e.g., Semliki Forest Virus, Ross River Virus, and equine encephalitis virus, can also be used to pseudotype the vectors of the invention. The envelope protein sequences for such Alphaviruses are known in the art.
[0021]Pseudotype" refers to a virus particle, where the envelope or capsid includes heterologous viral proteins.
[0022]Nucleic acid genome" refers to the genomic or nucleic acid component of a virus particle, which encodes the genome of the virus particle, including any proteins required for replication and/or integration of the genome, if required, and optionally a heterologous protein operably linked to a promoter, the promoter being either native to the protein or heterologous (viral or non-viral). The nucleic acid genome can be based on any virus, and have an RNA or DNA genome, either single stranded or double stranded. Preferably, the nucleic acid genome is from the family Retroviridae.
[0023]Lentiviral vector" refers to viruses comprising nucleic acid genomes based on viruses of the Lentiviral genus of the family Retroviridae. Optionally, the vector encodes a heterologous gene.
[0024]Retroviral vectors," as used herein, refer to viruses based on viruses of the Retroviridae family. In their wild-type form, retroviral vectors typically contain a genomic nucleic acid. The pseudotyped, targeted retroviral vectors of the invention can optionally comprise a nucleic acid genome. The vectors of the invention can also comprise a heterologous gene.
[0025]Targeting moiety" refers to a heterologous protein linked, either covalently or non-covalently, to a pseudotyped virus particle, typically linked to an envelope protein, e.g., E1, E2, or E3. The targeting moiety binds to a protein on the cell surface of a selected cell type. Representative targeting moieties include antibodies and receptor ligands.
[0026]A viral "envelope" protein, or "Env" protein, as used herein, refers to any polypeptide sequence that resides on the surface lipid bilayer of a retroviral virion whose function is to mediate the adsorption to and the penetration of host cells susceptible to infection. A retroviral envelope is formed by a cell-derived lipid bilayer into which proteins encoded by the env region of the viral genome are inserted. Envelope proteins are typically glycoproteins and usually comprise a transmembrane (TM) and a surface (SU) component linked together by disulfide bonds. Virus structure is described in detail in, for example, Coffin, et al., Retroviruses, 1997, Cold Spring Harbor Laboratory Press.
[0027]A viral "capsid," as used herein, refers to the principal structural protein of the virion core derived from the central region of the Gag polyprotein. The capsid protein in a mature viral particle forms a shell surrounding the ribonucleoprotein complex that contains the genomic nucleic acid. This shell, which includes additional proteins, is also referred to as a capsid. A capsid shell can exist as a component of a virion without surrounding a genomic nucleic acid.
[0028]A "virion" refers to a retrovirus body, including the outer lipid bilayer which surrounds a capsid shell which in turn surrounds a genomic nucleic acid, when present. A virion of the invention, can, but need not, have a genomic nucleic acid.
[0029]Mutated Sindbis envelope" refers to a point mutation, insertion, or deletion in the amino acid sequence of a wild-type Sindbis E1, E2, or E3 protein. The E1, E2, or E3 protein can have one or more mutations. In addition, combinations of mutations in E1, E2, and E3 are encompassed by the invention, e.g., mutations in E1 and E2, or in E2 and E3, or E3 and E1, or E1, E2, and E3. Exemplary wild type sequences of E1, E2, and E3 proteins from Sindbis strains include Accession No. VHWVB, VHWVB2, and P03316.
[0030]Biological sample" includes sections of tissues such as biopsy and autopsy samples, and frozen sections taken for histologic purposes. Such samples include blood and blood fractions or products (e.g., serum, plasma, platelets, red blood cells, and the like), sputum, tissue, cultured cells, e.g., primary cultures, explants, and transformed cells, stool, urine, etc. A biological sample is typically obtained from a eukaryotic organism, most preferably a mammal such as a primate e.g., chimpanzee or human; cow; dog; cat; a rodent, e.g., guinea pig, rat, mouse; rabbit; bird; reptile; or fish.
[0031]The terms "identical" or percent "identity," in the context of two or more nucleic acids or polypeptide sequences, refer to two or more sequences or subsequences that are the same or have a specified percentage of amino acid residues or nucleotides that are the same (i.e., about 60% identity, preferably 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity over a specified region, when compared and aligned for maximum correspondence over a comparison window or designated region) as measured using a BLAST or BLAST 2.0 sequence comparison algorithms with default parameters described below, or by manual alignment and visual inspection (see, e.g., NCBI web site http://www.ncbi.nlm.nih.gov/BLAST/or the like). Such sequences are then said to be "substantially identical." This definition also refers to, or may be applied to, the compliment of a test sequence. The definition also includes sequences that have deletions and/or additions, as well as those that have substitutions. As described below, the preferred algorithms can account for gaps and the like. Preferably, identity exists over a region that is at least about 25 amino acids or nucleotides in length, or more preferably over a region that is 50-100 amino acids or nucleotides in length.
[0032]For sequence comparison, typically one sequence acts as a reference sequence, to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Preferably, default program parameters can be used, or alternative parameters can be designated. The sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters.
[0033]A "comparison window", as used herein, includes reference to a segment of any one of the number of contiguous positions selected from the group consisting of from 20 to 600, usually about 50 to about 200, more usually about 100 to about 150 in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned. Methods of alignment of sequences for comparison are well-known in the art. Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Nat'l. Acad. Sci. USA 85:2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by manual alignment and visual inspection (see, e.g., Current Protocols in Molecular Biology (Ausubel et al., eds. 1995 supplement)).
[0034]A preferred example of algorithm that is suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al., Nuc. Acids Res. 25:3389-3402 (1977) and Altschul et al., J. Mol. Biol. 215:403-410 (1990), respectively. BLAST and BLAST 2.0 are used, with the parameters described herein, to determine percent sequence identity for the nucleic acids and proteins of the invention. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov/). This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul et al., supra). These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always >0) and N (penalty score for mismatching residues; always <0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as defaults a wordlength (W) of 11, an expectation (E) of 10, M=5, N=-4 and a comparison of both strands. For amino acid sequences, the BLASTP program uses as defaults a wordlength of 3, and expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff & Henikoff, Proc. Natl. Acad. Sci. USA 89:10915 (1989)) alignments (B) of 50, expectation (E) of 10, M=5, N=-4, and a comparison of both strands.
[0035]Nucleic acid" refers to deoxyribonucleotides or ribonucleotides and polymers thereof in either single- or double-stranded form, and complements thereof. The term encompasses nucleic acids containing known nucleotide analogs or modified backbone residues or linkages, which are synthetic, naturally occurring, and non-naturally occurring, which have similar binding properties as the reference nucleic acid, and which are metabolized in a manner similar to the reference nucleotides. Examples of such analogs include, without limitation, phosphorothioates, phosphoramidates, methyl phosphonates, chiral-methyl phosphonates, 2-O-methyl ribonucleotides, peptide-nucleic acids (PNAs).
[0036]Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions) and complementary sequences, as well as the sequence explicitly indicated. Specifically, degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and/or deoxyinosine residues (Batzer et al., Nucleic Acid Res. 19:5081 (1991); Ohtsuka et al., J. Biol. Chem. 260:2605-2608 (1985); Rossolini et al., Mol. Cell. Probes 8:91-98 (1994)). The term nucleic acid is used interchangeably with gene, cDNA, mRNA, oligonucleotide, and polynucleotide.
[0037]A particular nucleic acid sequence also implicitly encompasses "splice variants." Similarly, a particular protein encoded by a nucleic acid implicitly encompasses any protein encoded by a splice variant of that nucleic acid. "Splice variants," as the name suggests, are products of alternative splicing of a gene. After transcription, an initial nucleic acid transcript may be spliced such that different (alternate) nucleic acid splice products encode different polypeptides. Mechanisms for the production of splice variants vary, but include alternate splicing of exons. Alternate polypeptides derived from the same nucleic acid by read-through transcription are also encompassed by this definition. Any products of a splicing reaction, including recombinant forms of the splice products, are included in this definition. An example of potassium channel splice variants is discussed in Leicher, et al., J. Biol. Chem. 273(52):35095-35101 (1998).
[0038]The terms "polypeptide," "peptide" and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers and non-naturally occurring amino acid polymer.
[0039]The term "amino acid" refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to the naturally occurring amino acids. Naturally occurring amino acids are those encoded by the genetic code, as well as those amino acids that are later modified, e.g., hydroxyproline, γ-carboxyglutamate, and O-phosphoserine. Amino acid analogs refers to compounds that have the same basic chemical structure as a naturally occurring amino acid, i.e., an α carbon that is bound to a hydrogen, a carboxyl group, an amino group, and an R group, e.g., homoserine, norleucine, methionine sulfoxide, methionine methyl sulfonium. Such analogs have modified R groups (e.g., norleucine) or modified peptide backbones, but retain the same basic chemical structure as a naturally occurring amino acid. Amino acid mimetics refers to chemical compounds that have a structure that is different from the general chemical structure of an amino acid, but that functions in a manner similar to a naturally occurring amino acid.
[0040]Amino acids may be referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides, likewise, may be referred to by their commonly accepted single-letter codes.
[0041]Conservatively modified variants" applies to both amino acid and nucleic acid sequences. With respect to particular nucleic acid sequences, conservatively modified variants refers to those nucleic acids which encode identical or essentially identical amino acid sequences, or where the nucleic acid does not encode an amino acid sequence, to essentially identical sequences. Because of the degeneracy of the genetic code, a large number of functionally identical nucleic acids encode any given protein. For instance, the codons GCA, GCC, GCG and GCU all encode the amino acid alanine. Thus, at every position where an alanine is specified by a codon, the codon can be altered to any of the corresponding codons described without altering the encoded polypeptide. Such nucleic acid variations are "silent variations," which are one species of conservatively modified variations. Every nucleic acid sequence herein which encodes a polypeptide also describes every possible silent variation of the nucleic acid. One of skill will recognize that each codon in a nucleic acid (except AUG, which is ordinarily the only codon for methionine, and TGG, which is ordinarily the only codon for tryptophan) can be modified to yield a functionally identical molecule. Accordingly, each silent variation of a nucleic acid which encodes a polypeptide is implicit in each described sequence with respect to the expression product, but not with respect to actual probe sequences.
[0042]As to amino acid sequences, one of skill will recognize that individual substitutions, deletions or additions to a nucleic acid, peptide, polypeptide, or protein sequence which alters, adds or deletes a single amino acid or a small percentage of amino acids in the encoded sequence is a "conservatively modified variant" where the alteration results in the substitution of an amino acid with a chemically similar amino acid. Conservative substitution tables providing functionally similar amino acids are well known in the art. Such conservatively modified variants are in addition to and do not exclude polymorphic variants, interspecies homologs, and alleles of the invention.
[0043]The following eight groups each contain amino acids that are conservative substitutions for one another: 1) Alanine (A), Glycine (G); 2) Aspartic acid (D), Glutamic acid (E); 3) Asparagine (N), Glutamine (Q); 4) Arginine (R), Lysine (K); 5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V); 6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W); 7) Serine (S), Threonine (T); and 8) Cysteine (C), Methionine (M) (see, e.g., Creighton, Proteins (1984)).
[0044]A "label" or a "detectable moiety" is a composition detectable by spectroscopic, photochemical, biochemical, immunochemical, chemical, or other physical means. For example, useful labels include 32P, fluorescent dyes, electron-dense reagents, enzymes (e.g., as commonly used in an ELISA), biotin, digoxigenin, or haptens and proteins which can be made detectable, e.g., by incorporating a radiolabel into the peptide or used to detect antibodies specifically reactive with the peptide.
[0045]The term "recombinant" when used with reference, e.g., to a cell, or nucleic acid, protein, or vector, indicates that the cell, nucleic acid, protein or vector, has been modified by the introduction of a heterologous nucleic acid or protein or the alteration of a native nucleic acid or protein, or that the cell is derived from a cell so modified. Thus, for example, recombinant cells express genes that are not found within the native (non-recombinant) form of the cell or express native genes that are otherwise abnormally expressed, under expressed or not expressed at all.
[0046]The term "heterologous" when used with reference to portions of a nucleic acid indicates that the nucleic acid comprises two or more subsequences that are not found in the same relationship to each other in nature. For instance, the nucleic acid is typically recombinantly produced, having two or more sequences from unrelated genes arranged to make a new functional nucleic acid, e.g., a promoter from one source and a coding region from another source. Similarly, a heterologous protein indicates that the protein comprises two or more subsequences that are not found in the same relationship to each other in nature (e.g., a fusion protein).
[0047]The phrase "stringent hybridization conditions" refers to conditions under which a probe will hybridize to its target subsequence, typically in a complex mixture of nucleic acids, but to no other sequences. Stringent conditions are sequence-dependent and will be different in different circumstances. Longer sequences hybridize specifically at higher temperatures. An extensive guide to the hybridization of nucleic acids is found in Tijssen, Techniques in Biochemistry and Molecular Biology--Hybridization with Nucleic Probes, "Overview of principles of hybridization and the strategy of nucleic acid assays" (1993). Generally, stringent conditions are selected to be about 5-10° C. lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength pH. The Tm is the temperature (under defined ionic strength, pH, and nucleic concentration) at which 50% of the probes complementary to the target hybridize to the target sequence at equilibrium (as the target sequences are present in excess, at Tm, 50% of the probes are occupied at equilibrium). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. For selective or specific hybridization, a positive signal is at least two times background, preferably 10 times background hybridization. Exemplary stringent hybridization conditions can be as following: 50% formamide, 5×SSC, and 1% SDS, incubating at 42° C., or, 5×SSC, 1% SDS, incubating at 65° C., with wash in 0.2×SSC, and 0.1% SDS at 65° C.
[0048]Nucleic acids that do not hybridize to each other under stringent conditions are still substantially identical if the polypeptides which they encode are substantially identical. This occurs, for example, when a copy of a nucleic acid is created using the maximum codon degeneracy permitted by the genetic code. In such cases, the nucleic acids typically hybridize under moderately stringent hybridization conditions. Exemplary "moderately stringent hybridization conditions" include a hybridization in a buffer of 40% formamide, 1 M NaCl, 1% SDS at 37° C., and a wash in 1×SSC at 45° C. A positive hybridization is at least twice background. Those of ordinary skill will readily recognize that alternative hybridization and wash conditions can be utilized to provide conditions of similar stringency. Additional guidelines for determining hybridization parameters are provided in numerous reference, e.g., and Current Protocols in Molecular Biology, ed. Ausubel, et al.
[0049]For PCR, a temperature of about 36° C. is typical for low stringency amplification, although annealing temperatures may vary between about 32° C. and 48° C. depending on primer length. For high stringency PCR amplification, a temperature of about 62° C. is typical, although high stringency annealing temperatures can range from about 50° C. to about 65° C., depending on the primer length and specificity. Typical cycle conditions for both high and low stringency amplifications include a denaturation phase of 90° C.-95° C. for 30 sec-2 min., an annealing phase lasting 30 sec.-2 min., and an extension phase of about 72° C. for 1-2 min. Protocols and guidelines for low and high stringency amplification reactions are provided, e.g., in Innis et al. (1990) PCR Protocols, A Guide to Methods and Applications, Academic Press, Inc. N.Y.).
[0050]Antibody" refers to a polypeptide comprising a framework region from an immunoglobulin gene or fragments thereof that specifically binds and recognizes an antigen. The recognized immunoglobulin genes include the kappa, lambda, alpha, gamma, delta, epsilon, and mu constant region genes, as well as the myriad immunoglobulin variable region genes. Light chains are classified as either kappa or lambda. Heavy chains are classified as gamma, mu, alpha, delta, or epsilon, which in turn define the immunoglobulin classes, IgG, IgM, IgA, IgD and IgE, respectively. Typically, the antigen-binding region of an antibody will be most critical in specificity and affinity of binding.
[0051]An exemplary immunoglobulin (antibody) structural unit comprises a tetramer. Each tetramer is composed of two identical pairs of polypeptide chains, each pair having one "light" (about 25 kD) and one "heavy" chain (about 50-70 kD). The N-terminus of each chain defines a variable region of about 100 to 110 or more amino acids primarily responsible for antigen recognition. The terms variable light chain (VL) and variable heavy chain (VH) refer to these light and heavy chains respectively.
[0052]Antibodies exist, e.g., as intact immunoglobulins or as a number of well-characterized fragments produced by digestion with various peptidases. Thus, for example, pepsin digests an antibody below the disulfide linkages in the hinge region to produce F(ab)'2, a dimer of Fab which itself is a light chain joined to VH-CH1 by a disulfide bond. The F(ab)'2 may be reduced under mild conditions to break the disulfide linkage in the hinge region, thereby converting the F(ab)'2 dimer into an Fab' monomer. The Fab' monomer is essentially Fab with part of the hinge region (see Fundamental Immunology (Paul ed., 3d ed. 1993). While various antibody fragments are defined in terms of the digestion of an intact antibody, one of skill will appreciate that such fragments may be synthesized de novo either chemically or by using recombinant DNA methodology. Thus, the term antibody, as used herein, also includes antibody fragments either produced by the modification of whole antibodies, or those synthesized de novo using recombinant DNA methodologies (e.g., single chain Fv) or those identified using phage display libraries (see, e.g., McCafferty et al., Nature 348:552-554 (1990))
[0053]For preparation of antibodies, e.g., recombinant, monoclonal, or polyclonal antibodies, many technique known in the art can be used (see, e.g., Kohler & Milstein, Nature 256:495-497 (1975); Kozbor et al., Immunology Today 4: 72 (1983); Cole et al., pp. 77-96 in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc. (1985); Coligan, Current Protocols in Immunology (1991); Harlow & Lane, Antibodies, A Laboratory Manual (1988); and Goding, Monoclonal Antibodies: Principles and Practice (2d ed. 1986)). The genes encoding the heavy and light chains of an antibody of interest can be cloned from a cell, e.g., the genes encoding a monoclonal antibody can be cloned from a hybridoma and used to produce a recombinant monoclonal antibody. Gene libraries encoding heavy and light chains of monoclonal antibodies can also be made from hybridoma or plasma cells. Random combinations of the heavy and light chain gene products generate a large pool of antibodies with different antigenic specificity (see, e.g., Kuby, Immunology (3rd ed. 1997)). Techniques for the production of single chain antibodies or recombinant antibodies (U.S. Pat. No. 4,946,778, U.S. Pat. No. 4,816,567) can be adapted to produce antibodies to polypeptides of this invention. Also, transgenic mice, or other organisms such as other mammals, may be used to express humanized or human antibodies (see, e.g., U.S. Pat. Nos. 5,545,807; 5,545,806; 5,569,825; 5,625,126; 5,633,425; 5,661,016, Marks et al., Bio/Technology 10:779-783 (1992); Lonberg et al., Nature 368:856-859 (1994); Morrison, Nature 368:812-13 (1994); Fishwild et al., Nature Biotechnology 14:845-51 (1996); Neuberger, Nature Biotechnology 14:826 (1996); and Lonberg & Huszar, Intern. Rev. Immunol. 13:65-93 (1995)). Alternatively, phage display technology can be used to identify antibodies and heteromeric Fab fragments that specifically bind to selected antigens (see, e.g., McCafferty et al., Nature 348:552-554 (1990); Marks et al., Biotechnology 10:779-783 (1992)). Antibodies can also be made bispecific, i.e., able to recognize two different antigens (see, e.g., WO 93/08829, Traunecker et al., EMBO J. 10:3655-3659 (1991); and Suresh et al., Methods in Enzymology 121:210 (1986)). Antibodies can also be heteroconjugates, e.g., two covalently joined antibodies, or immunotoxins (see, e.g., U.S. Pat. No. 4,676,980, WO 91/00360; WO 92/200373; and EP 03089).
[0054]Methods for humanizing or primatizing non-human antibodies are well known in the art. Generally, a humanized antibody has one or more amino acid residues introduced into it from a source which is non-human. These non-human amino acid residues are often referred to as import residues, which are typically taken from an import variable domain. Humanization can be essentially performed following the method of Winter and co-workers (see, e.g., Jones et al., Nature 321:522-525 (1986); Riechmann et al., Nature 332:323-327 (1988); Verhoeyen et al., Science 239:1534-1536 (1988) and Presta, Curr. Op. Struct. Biol. 2:593-596 (1992)), by substituting rodent CDRs or CDR sequences for the corresponding sequences of a human antibody. Accordingly, such humanized antibodies are chimeric antibodies (U.S. Pat. No. 4,816,567), wherein substantially less than an intact human variable domain has been substituted by the corresponding sequence from a non-human species. In practice, humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies.
[0055]A "chimeric antibody" is an antibody molecule in which (a) the constant region, or a portion thereof, is altered, replaced or exchanged so that the antigen binding site (variable region) is linked to a constant region of a different or altered class, effector function and/or species, or an entirely different molecule which confers new properties to the chimeric antibody, e.g., an enzyme, toxin, hormone, growth factor, drug, etc.; or (b) the variable region, or a portion thereof, is altered, replaced or exchanged with a variable region having a different or altered antigen specificity.
[0056]In one embodiment, the antibody is conjugated to an "effector" moiety. The effector moiety can be any number of molecules, including labeling moieties such as radioactive labels or fluorescent labels, or can be a therapeutic moiety. In one aspect the antibody modulates the activity of the protein.
[0057]The phrase "specifically (or selectively) binds" to an antibody or "specifically (or selectively) immunoreactive with," when referring to a protein or peptide, refers to a binding reaction that is determinative of the presence of the protein, often in a heterogeneous population of proteins and other biologics. Thus, under designated immunoassay conditions, the specified antibodies bind to a particular protein at least two times the background and more typically more than 10 to 100 times background. Specific binding to an antibody under such conditions requires an antibody that is selected for its specificity for a particular protein. For example, polyclonal antibodies can be selected to obtain only those polyclonal antibodies that are specifically immunoreactive with the selected antigen and not with other proteins. This selection may be achieved by subtracting out antibodies that cross-react with other molecules. A variety of immunoassay formats may be used to select antibodies specifically immunoreactive with a particular protein. For example, solid-phase ELISA immunoassays are routinely used to select antibodies specifically immunoreactive with a protein (see, e.g., Harlow & Lane, Antibodies, A Laboratory Manual (1988) for a description of immunoassay formats and conditions that can be used to determine specific immunoreactivity).
[0058]By "therapeutically effective dose" herein is meant a dose that produces effects for which it is administered. The exact dose will depend on the purpose of the treatment, and will be ascertainable by one skilled in the art using known techniques (see, e.g., Lieberman, Pharmaceutical Dosage Forms (vols. 1-3, 1992); Lloyd, The Art, Science and Technology of Pharmaceutical Compounding (1999); and Pickar, Dosage Calculations (1999)).
BRIEF DESCRIPTION OF THE DRAWINGS
[0059]FIG. 1. Schematic representation of FUhLucW, FUIntronRW and CCRMDRsc1. FUhLucW and FUIntronRW have the CMV enhancer and CCRMDRsc1 has the RSV enhancer/promoter substituted for the U3 region of the 5' LTR. AU3 denotes a deletion in the U3 region of the 3' LTR that renders the 5' LTR of the integrated provirus transcriptionally inactive. FUhLucW and FUIntronRW have the Ubiqutin-C promoter as an internal promoter to express humanized Firefly luciferase or humanized Renilla luciferase respectively. CCRMDRsc1 has the CMV promoter as internal promoter to express MDRsc1 (P-glycoprotein). All vectors have the central polypurine tract (cPPT). FUhLucW and FUIntronRW contain the Woodchuck hepatitis virus post transcriptional element (WRE). CCRMDRsc1 has the human hepatitis virus post-transcriptional element (PRE). FUIntronRW has a chimeric intron derived from phRL-CMV.
[0060]FIG. 2. HIV vector pseudotyped by ZZ SINDBIS has non-specific infectivity in the absence of target specific antibody in vitro and in vivo. a) 293T cells (2×105) were infected with TRIP GFP (ZZ SINDBIS) (34 ng of HIV p24) with or without anti-HLA (1 μg/ml). For comparison of titers, cells were infected with TRIP GFP (VSV-G) (8 ng of HIV p24). Three days after infection, EGFP expression was analyzed by flow cytometry. The titers of TRIP GFP (ZZ SINDBIS) and TRIP GFP (VSV-G) with 1 μg/ml of anti-HLA were 3×105 and 1.3×106 EGFP transduction units/100 ng HIV p24. (b) FUhLucW (VSV-G) (15 pg HIV p24), FUhLucW (Sindbis) (30 μg HIV p24) and FUhLucW (ZZ SINDBIS) (30 μg HIV p24) were injected intravenously through the tail vein. Five days after injection, mice were anesthetized and injected intraperitonially with 30 μg of D-luciferin. The reporter gene (Firefly luciferase) expression was imaged using a CCCD camera for 1 min prior to imaging. The acquisition time was determined to avoid saturation of the signal.
[0061]FIG. 3. Anti-SINDBIS virus antibody blocked non-specific background infectivity of the ZZ SINDBIS pesudotyped lentiviral vector. TRIP GFP (VSV-G) (3 ng HIV p24), TRIP GFP (Sindbis) (35 ng HIV p24) and TRIP GFP (ZZ SINDBIS 103 ng HIV p24) were incubated with anti-Sindbis virus antibody (0.1% volume) or control antibody for 1 hour at 4° C. The viruses were used for infection of 293T cells (2×105).
[0062]FIG. 4. Schematic representation of mutated domains and mutants.
[0063]FIG. 5. Analysis of the m168 mutant by flow cytometry and Western blotting. (a) 293T cells (1×105) were infected with 200 μl of unconcentrated TRIP GFP (ZZ SINDBIS) (24 ng HIV p24) or TRIP GFP (m168) (40 ng HIV p24) with or without anti-HLA (1 μg/ml). Three days after infection, EGFP expression was analyzed by flow cytometry. (b) SDS-PAGE and Western blotting of ZZ SINDBIS and m168 pseudotyped virions. Ultracentrifuged samples of HIV vectors (FUhLucW) pseudotyped by ZZ SINDBIS or m168 were lysed and subjected to SDS-polyacrylamide gel electrophoresis and Western blotting as described in the Methods section. The amount of virus for each sample was normalized by the amount of HIV p24 antigen (5 ng/sample). Viral proteins were detected with anti-Sindbis virus mouse immune ascites fluid. The band at approximately 65 kD in the ZZ SINDBIS lane is the chimeric E2 protein. The band at approximately 75 kD in the m168 lane is chimeric E2 protein with uncleaved E3 protein.
[0064]FIG. 6. The m168 pseudotyped lentiviral vector has reduced non-specific infectivity in vivo. FUhLucW (ZZ SINDBIS) (30 μg HIV p24) and FUhLucW (m168) were each injected into 3 mice via the tail vein. Five days after injection, mice were anesthetized and injected intraperitonially with D-luciferin (30 μg). The reporter gene (Firefly luciferase) expression was imaged in the dorsal and abdominal aspects of the mice using a CCCD camera for 1 min. The acquisition time was determined to avoid saturation of the signal.
[0065]FIG. 7. The m168 pseudotyped lentiviral vector mediates antibody-directed targeted gene transduction after systemic injection into mouse. Renilla luciferase expressing B16F10MDR5 (2×105 cells in 150 μl of PBS) were injected into mice via the tail vein. Thirty minutes later, FUhLucW (ZZ SINDBIS) or FUhLucW (m168) to which we had added anti P-glycoprotein monoclonal antibody or isotype (IgG2a) control antibody (10 μg/ml) was injected into the tail vein. The amount of each virus used for injection was normalized to the amount of HIV p24 (36 μg of HIV p24 in 150 μl PBS). Ten days later, the level of metastasis in the lungs of mice that had received B16F10MDR5 was investigated by CCCD imaging to determine the level of Renilla luciferase expression as described in the Methods section. Twelve days after cell and virus injection, virus infection was determined by imaging the expression level of Firefly luciferase reporter gene as described in the Methods section.
[0066]FIG. 8. Nucleic acid sequence encoding ZZ SINDBIS.
[0067]FIG. 9. Nucleic acid sequence encoding m168.
[0068]FIG. 10. Immunohistochemical analysis of metastasized tumors targeted by FUGW (m168) with anti-P-Glycoprotein. Frozen sections were prepared from the lungs of mice injected with B16F10 MDR5 cells and FUGW (m168) plus anti-P-Glycoprotein. Serial 10 μm sections were prepared and processed. a) Slides were stained for hematoxylin-eosin (HE). b) An adjacent serial section (to that shown in (a)) was stained for transgene expression (EGFP) and nuclei (DAPI). c) Another adjacent serial section was stained for melanoma antigen (S-100) and nuclei (DAPI). d) A EGFP and S-100 positive colony stained with HE is pictured at a higher magnification to show the morphology of the colony.
[0069]FIG. 11. Confocal microscopy analysis of frozen liver sections prepared from mice which had been injected with B16F10 MDR5 cells, and FUGW (VSV-G) or FUGW (m168) and anti-P-Glycoprotein. The sections were stained for Kupffer cell marker F4/80 (red) and EGFP (green).
[0070]FIG. 12. a) Flow cytometric analysis of Mac-1 expression on splenocytes of NOD/SCID mice. b) Flow cytometric analysis of EGFP expression in splenocytes isolated from mice injected with B16F10MDR5 cells, and FUGW (VSV-G) or FUGW (m168) and anti-P-Glycoprotein. The cells were stained to determine Mac-1 expression. EGFP expression in Mac-1 positive and negative population was analyzed.
[0071]FIG. 13. (a) B16F10MDR5 cells were injected into mice via the tail vein. Twelve days later, FUhLucW (m168), to which we had added anti-P-glycoprotein monoclonal antibody or isotype control antibody, or FUhLucW (VSV-G) was injected into the tail vein. The amount of each virus used for injection was normalized to the amount of HIV p24 (2.5 μg of HIV p24 in 250 μl PBS). Fifteen days after virus injection, virus infection was determined by imaging the level of Firefly luciferase reporter gene expression. (b) The mice were sacrificed immediately after whole body imaging and each organ was isolated to image luciferase expression.
[0072]FIG. 14. Prostate cells can be targeted in vitro through the prostate stem cell antigen. LPSCA4 cells were derived from LNCaP cells after stable transfection of the prostate stem cell antigen (PSCA). 1×105 LNCaP and LPSCA4 cells were infected with FUGW pseudotyped with m168 envelope (12 ng HIV-1 p24) without Ab targeting, or with αHLA or 1G8 mAb (1G8 mAB recognizes PSCA (Saffran, et al., Proc Natl Acad Sci (2001) 98:2658-2663)). Three days after infection, eGFP expression was analyzed by flow cytometry (ten thousand events acquired per sample). The x-axis indicates eGFP fluorescence intensity. Percentage and mean flourescence intensity of the positive population (R2) is indicated in each plot. Infection of LPSCA4 cells targeted with 1G8 is comparable to infection targeted with αHLA, whereas in LNCaP cells targeting with 1G8 antibody gives background levels similar to those without any antibody targeting.
[0073]FIG. 15. Transcription from the PSE-BC promoter in vitro in prostate cell lines (A) and non-prostate cell lines (B). 1×105 cells were infected with lentivirus vectors expressing eGFP under the control of the ubiquitin-C promoter (FUGW) or the PSE-BC promoter (FPGW) pseudotyped with VSV G (40 ng of HIV-1 p24). Three days after infection eGFP expression was analyzed by flow cytometry (ten thousand events acquired per sample). The x-axis indicates eGFP fluorescence intensity. Percentage and mean fluorescence intensity of the positive population (R2) is indicated in each plot. Expression from the PSE-BC promoter is comparable to ubiquitin-C promoter in prostate cell lines and up to 30 times lower in non-prostate cell lines.
[0074]FIG. 16. New targeting envelope (2.2), comprised of m168+E1 AK226-227SG, mediated transferrin receptor (TfR) targeted gene transduction more efficiently than previous targeting envelope (m168). 4×104 HUVEC cells were infected with lentiviral vector (40 ng HIV-1 p24) pseudotyped with m168 envelope protein or 2.2 envelope protein with or without anti-transferrin receptor antibody (2 μg/ml). The lentiviral vector carried EGFP as reporter gene. Three days after infection, EGFP expression was analyzed by flow cytometry. The X-axis indicates EGFP fluorescence intensity. Percentage of the positive population is indicated in each plot.
[0075]FIG. 17. Targeting envelope mediates targeted gene transduction to CNS via transferrin receptor (TfR). Lentiviral vector (3 μg HIV-1 p24) pseudotyped with 2.2 envelope protein was injected into NOD/SCID mice via the tail vein with or without anti-transferrin receptor antibody (50 μg/ml). The lentiviral vector carried Firefly luciferase as reporter gene. Five days after injection, mice were anesthetized and injected intraperitoneally with D-luciferin (30 ng). The reporter gene expression was imaged using a CCCD camera. Luciferase expression from the brain and spinal column was confirmed by removing the skin from the back after sacrifice.
DETAILED DESCRIPTION
[0076]Targeted gene transduction to specific tissues and organs via intravenous injection would be the ultimate preferred method of gene delivery. Here, we report successful targeting in a living animal via intravenous injection of a lentiviral vector pseudotyped with a modified chimeric Sindbis virus envelope. After intravenous administration into mice, the previously reported parental vector has non-specific infectivity in liver and spleen due to the residual natural tropism of Sindbis virus. Mutagenesis of domains within the Sindbis envelope ablated regions necessary for this natural tropism. M168 pseudotypes had significantly less non-specific infectivity to liver and spleen and these pseudotypes have high titer and high targeting specificity. A murine cancer model for metastatic melanoma was utilized to test specific targeting with m168. Human P-glycoprotein was ectopically expressed on the surface of melanoma cells and targeted by the m168 pseudotyped lentiviral vector conjugated with anti P-glycoprotein antibody. M168 pseudotypes successfully targeted metastatic melanoma cells growing in the lung after systemic administration via tail vein injection. This targeting technology has applications not only for cancers but also for genetic, infectious and autoimmune diseases.
[0077]The present invention therefore provides a pseudotyped virus or viral vector comprising an envelope comprising Sindbis E1, E2, and E3 proteins linked to a targeting moiety. The vector optionally further comprises a viral nucleic acid genome from the Retroviridae family, preferably the lentiviral genus. The vector can also optionally comprise a heterologous gene.
[0078]Structurally, at least one of the E1, E2, or E3 proteins has one or more mutations (preferably point mutations) in comparison to a wild type sequence in order to provide altered titer, specificity, specificity index, tropism, or host immune reaction. Combinations of mutated E1, E2, and E3 are also contemplated by the invention. Functionally, the mutated Sinbis viral envelope proteins of the present invention have a decreased ability to bind to endogenous receptors, including glycosaminoglycans (e.g., heparin sulfate). In certain embodiments, the pseudotyped virus vectors are isolated.
[0079]In certain embodiments, the pseudotyped viruses comprise one or more of the following mutations in a wild-type Sindbis or the Sindbis ZZ envelope sequence (SEQ ID NO:2): m1 (deletion of E3 amino acids 61-64), m2 (E2 R1D), m3 (m1+m2), m4 (deletion of E2 amino acids 68-71), m5 (E2 S114 P), m6 (E2 KE159-160AA), m7 (E2 E216A T218A), m8 (E2 SLKQ68-71AAAA), m9 (E3 RSKRS60-64AAAAA), m16 (m1+m6), m17 (m1+m7), m18 (m1+m8) or E1 AK226-227SG. In one embodiment, the mutation is exemplified by the m168 sequence (SEQ ID NO:4), which comprises the mutations m1 (deletion of E3 amino acids 61-64), m6 (E2 KE159-160AA), and m8 (E2 SLKQ68-71AAAA). In another embodiment, the m168 sequence comprises a further mutation in the E1 domain that makes the m168 titer 2-10 fold higher. The sequence "aagccttccgccaag" on the sequence of m168 was modified to "aagccttcctccggg" (SEQ ID NOs: 5 and 6). In this embodiment, the m168 sequence is further modified to eliminate cholesterol dependence for cell entry, (e.g. E1 AK226-227SG).
[0080]Mutations into one or more of the Sindbis viral envelope protein sequences can be introduced using any known methods in the art. Mutations can be targeted or random. For example, targeted mutations can be introduced using site-directed mutagenesis, for instance employing overlapping PCR or overlap extension PCR (see, for example, Aiyar, et al., Methods Mol Biol (1996) 57:177-91; and Pogulis, et al., Methods Mol Biol (1996) 57:167-76). Alternatively, mutations can be introduced by taking advantage of the error prone replication process of Sindbis viruses, which lack proof-reading and mismatch repair activities, and recombination between quasispecies in a virus population, for instance, by using a replication competent virus (see, Domingo and Holland, Annu Rev Microbiol (1997) 51:151-178). Mutant Sindbis virus envelope proteins of particular interest have a diminished ability to bind to endogenous receptors and therefore demonstrate decreased background infectivity in comparison to wild-type sequences. Preferably, the mutated Sinbis virus envelope proteins of the present invention have a decreased ability to bind to glycosaminoglycans (GAGs), including heparin sulfate (HS), in comparison to wild-type sequences.
[0081]The targeting moiety is covalently or non-covalently linked to the E1, E2, or E3 protein, preferably the E2 or E3 protein, or is linked to another portion of the envelope. In one embodiment, the targeting moiety is linked to E1, E2, or E3 via non-covalent interactions with a protein binding domain, where the protein binding domain is fused with E1, E2, or E3. In one embodiment, the protein binding domain is fused with E2 or E3. Exemplary protein binding domains include, e.g., the ZZ domain of protein A, streptavidin, avidin, a leucine zipper, a STAT protein N terminal domain, an FK506 binding protein, integrin binding sequence "4C-RGD" (CDCRGDCFC encoded by tgcgactgtagaggcgactgtttctgc), and transferrin receptor targeting sequence "B6" (GHKAKGPRK encoded by ggacataaagctaagggtcctagaaag) (see, e.g., O'Shea, Science 254: 539 (1991), Barahmand-Pour et al., Curr. Top. Microbiol. Immunol. 211:121-128 (1996); Klemm et al., Annu. Rev. Immunol. 16:569-592 (1998); Klemm et al., Annu. Rev. Immunol. 16:569-592 (1998); Ho et al, Nature 382:822-826 (1996); Pomeranz et al., Biochem. 37:965 (1998); and Xia, et al., J Virol (2000) 74:11359-66). In another embodiment, the targeting moiety is a fusion protein with either the E1, E2, or E3 protein. In one embodiment, the targeting moiety is fused with the E2 or the E3 protein. The targeting moiety can be, e.g., an antibody, such as a monoclonal or single chain antibody that specifically binds to an antigen or a cell surface molecule, or a ligand or binding partner of a cell surface molecule.
[0082]The targeting moiety can target normal or diseased tissue. For example, the targeting antigen can be directed to a transferrin receptor for delivery of the present vectors across the blood-brain barrier. The targeting moiety also can be directed to marker proteins indicative of diseases including cancers (e.g., breast, lung, ovarian, prostate, colon, lymphoma, leukemia, and melanoma); autoimmune disease (e.g., myasthenia gravis, multiple sclerosis, systemic lupus erythymatosis, rheumatoid arthritis, and diabetes mellitus); infectious disease, including infection by HIV, HCV, HBV, CMV, and HPV; and genetic diseases including sickle cell anemia, cystic fibrosis, Tay-Sachs, β-thalassemia, neurofibromatosis, polycystic kidney disease, hemophilia, etc. In certain embodiments, the targeting moiety targets a cell surface antigen specific to a particular cell or tissue type, e.g., lymphocytes, myocytes, keratinocytes, neurons, hepatocytes, lung, kidney, muscle, vascular, thyroid, ocular, breast, ovarian, testis, prostate tissue.
[0083]Exemplary antigens and cell surface molecules for targeting include, e.g., P-glycoprotein, Her2/Neu, erythropoietin (EPO), epidermal growth factor receptor (EGFR), vascular endothelial growth factor receptor (VEGF-R), cadherin, carcinoembryonic antigen (CEA), CD4, CD8, CD19, CD20, CD33, CD34, CD45, CD117 (c-kit), CD133, HLA-A, HLA-B, HLA-C, chemokine receptor 5 (CCR5), stem cell marker ABCG2 transporter, ovarian cancer antigen CA125, immunoglobulins, integrins, prostate specific antigen (PSA), prostate stem cell antigen (PSCA), dendritic cell-specific intercellular adhesion molecule 3-grabbing nonintegrin (DC-SIGN), thyroglobulin, granulocyte-macrophage colony stimulating factor (GM-CSF), myogenic differentiation promoting factor-1 (MyoD-1), Leu-7 (CD57), LeuM-1, cell proliferation-associated human nuclear antigen defined by the monoclonal antibody Ki-67 (Ki-67), viral envelope proteins, HIV gp120, transferrin receptor, etc. Any cell surface protein, known in the art or yet to be identified, preferentially expressed on a particular cell or tissue type can find use as a potential target for the pseudotyped, targeted vector of the invention.
[0084]The pseudotyped, targeted vectors of the invention can optionally comprise a genomic nucleic acid. The nucleic acid genome can be from any suitable virus and in one embodiment, is derived from the Retroviridae family of viruses, e.g., from the lentiviral genus: HIV1, HIV2, SIV, FIV, BIV, Visna, CAEV, and EIAV; and from oncogenic retroviruses or oncoretroviruses, e.g., avian sarcoma/leucosis viruses (ASLV); mammalian C-type viruses (murine leukemia viruses (MuLV); feline leukemia viruses (FeLV)); B-type viruses (mouse mammary tumor viruses (MMTV); D-type viruses; and HTLV-BLV group of viruses (human T cell leukemia viruses (HTLV). Preferably, the oncogenic retroviruses lack an oncogene. Retroviruses are reviewed in Coffin, et al., Retroviruses, 1997, Cold Spring Harbor Laboratory Press. The nucleic acid genome is based on any suitable virus, and contains genetic components and encodes proteins so that the genome can be replicated and transcribed. However, vectors of the present invention can be replication competent or replication incompetent. In one embodiment, the nucleic acid genome is from the family Retroviridae and contains genetic components and encodes proteins so that it can be reverse transcribed and integrated into the host genome. Optionally, the genome is replication incompetent so that it cannot make productive, infectious viral particles. In certain embodiments, the genome is replication competent. Retroviral nucleic acid genomes known to those of skill in the art can be used in the invention, or made according to methods known to those of skill in the art (see, Coffin, et al, supra). Within the genome, the E1, E2, E3 and optional heterologous gene sequences can be encoded as individual polypeptides, or one or more fusion proteins. The E1, E2, E3 and optional heterologous gene sequences can be on the same or separate nucleic acid sequences. The nucleic acid genome can be RNA or DNA.
[0085]Vectors that do not comprise a genomic nucleic acid find use in the targeted delivery of a desired protein. For example, a protein to be delivered can be expressed as a fusion protein with a viral protein that is incorporated into a viral capsid. Viral proteins that are incorporated into a capsid shell, including, for example, the virion-associated regulatory proteins, viral protein r (VPR), viral protein x (VPX); and integrase, are well known in the art. See, for example, Wu, et al., J Virol (1995) 69:3389-98; and Katz, et al., Virology (1996) 217:178-90.
[0086]The genome also optionally comprises a heterologous gene operably linked to a promoter, either a viral promoter or a heterologous promoter. The heterologous gene can be a marker gene, a cytotoxic gene, a gene encoding an inhibitory sequence or protein for therapeutic applications, or a gene encoding a wild type protein for gene therapy applications. Exemplary marker genes include luciferase, a fluorescent protein (green fluorescent protein, red fluorescent protein, yellow fluorescent protein), and β-galactosidase. Exemplary cytotoxic genes include ricin, tumor necrosis factor (TNF) and apoptin. Exemplary inhibitory sequences include those that encode antisense RNA, small inhibitory RNA, oligonucleotide aptamers, and antibodies. Exemplary wild-type proteins for gene therapy applications include glial cell-derived neurotrophic factor (GDNF), Factor VIII, adenosine deaminase (ADA), hypoxanthine guanine phosphoribosyl transferase, LDL receptor, cystic fibrosis (CF) transmembrane conductance regulators (CFTR), hexosaminidase gene (HEXA), hemoglobin, β-globin, proliferative kidney disease 1 gene (PKD1) and tumor suppressor genes including neurofibromatosis gene (NF1 and NF2), breast cancer marker genes (BRCA1 and BRCA2), retinoblastoma gene (Rb), von-Hippel Lindau gene (VHL). Additional heterologous genes of use in the present invention are described in, for example, Strachan and Read, Human Genetics 2, 2nd Ed., 1999, BIOS Scientific Publishers Ltd.; Gene Therapy in Inflammatory Diseases, Evans and Robbing, eds., 2000, Springer Verlag; Vascular Disease: Molecular Biology and Gene Therapy Protocols, Baker, ed., 1999, Human Press; Cancer Gene Therapy, Curiel and Douglas, 2005, Human Press; Gene Therapy for Autoimmune Diseases, 2004, Kluwer Academic Pub.; and Progress In Gene Technology And Skin Gene Therapy: Special Issue Cells Tissues Organs 2004, Hengge, ed., 2004, S Karger Pub.
[0087]The promoter can be a constitutive promoter (e.g., ubiquitin, actin) or an inducible promoter (e.g. metallothionein). In certain embodiments, the promoter allows for preferential expression of a heterologous gene in tissues of interest, including for example, prostate tissue (e.g., a prostate specific antigen (PSA) promoter (PSE-BC; see, Adams, et al., Nat Med (2002) 8:891-897; and Wu, et al., Gene Ther (2001) 8:1416-1426); testis tissue (Grimes, Gene (2004) 343:11-22; cardiovascular tissue (Beck, et al., Curr Gene Ther (2004) 4:457-467; breast tissue (e.g., a mammoglobin promoter; see, Goedegebuure, et al., Curr Cancer Drug Targets (2004) 4:531-542); thyroid tissue (e.g., a thyroglobulin promoter; see, DeGroot, and Zhang, Curr Drug Targets Immune Endocr Metabol Disord (2004) 4:235-44); a gastrointestinal tissue (e.g., UDP glucuronosyltransferase promoter; see, Gregory, et al., Toxicol Appl Pharmacol (2004) 199:354-63); and cervical tissue (see, Rein, et al., J. Gene Med (2004) 6:1281-9). Tissue specific promoters of use in cancer gene therapy are reviewed in Saukkonen and Hemminki, Expert Opin Biol Ther (2004) 4:683-96. Tissue specific promoters of use in the gene therapy treatment of prostate cancer are reviewed in Shiradawa, et al., Mol Urol (2000) 4:73-82. Additional tissue specific promoters of use in the present vectors and methods include those reviewed in Hart, Semin Oncol (1996) 23:154-8.
[0088]Packaging cells and systems, packaging techniques and vectors for packaging the nucleic acid genome into the pseudotyped viral particle are also known to those of skill in the art and can be made according to methods known to those of skill in the art (see, for example, Polo, et al, Proc Natl Acad Sci USA, (1999) 96:4598-4603). Methods of packaging include using packaging cells that permanently express the envelope components, or by transiently transfecting cells with plasmids encoding the components of the vector, or by using an adenoviral system that encodes the components of the vector. Virus packaging cells and kits are commercially available, for example, from BD Sciences/Clontech in Mountain View, Calif.).
[0089]The pseudotyped virus of the invention can be used for diagnostic and therapeutic applications, as well as for research tool applications. Diagnostic applications include both in vitro, ex vivo, and in vivo uses, e.g., in vivo imaging. Therapeutic applications include both in vivo, in vitro, and ex vivo uses. For example, a virus particle of the invention can be administered to a subject via IV injection to treat or prevent cancers, e.g., breast, lung, ovarian, prostate, colon, lymphoma, leukemia, and melanoma; autoimmune disease such as myasthenia gravis, multiple sclerosis, systemic lupus erythymatosis, rheumatoid arthritis, and diabetes mellitus; infectious disease such as infection by HIV, HCV, HBV, CMV, and HPV; and genetic diseases such as sickle cell anemia, cystic fibrosis, Tay-Sachs, β-thalassemia, neurofibromatosis, polycystic kidney disease, hemophilia, etc. For in vivo applications, preferably the targeting moiety is covalently linked. The virus particles of the invention can also be administered ex vivo, e.g., to whole bone marrow by targeting CD34+ cells with the targeting moiety. In this embodiment, the targeting moiety can be covalently or non-covalently linked (e.g., via protein A or its ZZ domain). The virus particles can be used for diagnostic applications with heterologous marker genes, and can be used as research tools to transduce specific cell types. The targeted Sindbis envelope of the invention can also be used to target cell to cell interactions, by expressing the targeted envelope in a cell such as a lympohocyte, and then allowing the cell to contact the targeted cell in vivo, in vitro, or ex vivo.
[0090]The present invention also provides methods of purifying the virus from cells. In one embodiment, the virus is purified from cells by the following method: Virus is filtered through 0.22-microM-pore-size filter before concentration. Virus (30 mL) was loaded onto sucrose cushion (7 mL) and spinned using SW32 (Beckman) roter. 20% Sucrose (wt/wt) in 1×PBS with 1 mM EDTA was used for cushion. The spinning condition is 40000×g for 90 min at 4 degree. The supernatant is discarded and pellet is resuspended in 300 microL of Hanks Balanced Salt Solution. The concentrated virus is filtered again using same size filter before administration into animal.
[0091]The present invention also provides methods of transducing cells with the virus, as follows: some primarily hematopoietic cells are resistant to gene transduction (primary T cells and stem cell) in vitro. However changing the pH of the medium (7.4 to 5.5) during gene transduction makes gene transduction efficiency higher. (3-20 fold). This method is useful for ex vivo and in vitro transduction of some cell types.
Pharmaceutical Compositions And Administration
[0092]Pharmaceutically acceptable carriers are determined in part by the particular composition being administered (e.g., nucleic acid, protein, virus or transduced cell), as well as by the particular method used to administer the composition. Accordingly, there are a wide variety of suitable formulations of pharmaceutical compositions of the present invention (see, e.g., Remington's Pharmaceutical Sciences, 17th ed., 1989). Administration can be in any convenient manner, e.g., by injection, oral administration, inhalation, transdermal application, or rectal administration.
[0093]In the practice of this invention, compositions can be administered, for example, by intravenous infusion, orally, topically, intraperitoneally, intravesically or intrathecally. Parenteral administration and intravenous administration are the preferred methods of administration. The formulations of commends can be presented in unit-dose or multi-dose sealed containers, such as ampules and vials.
[0094]Injection solutions and suspensions can be prepared from sterile powders, granules, and tablets of the kind previously described. Cells transduced by nucleic acids for ex vivo therapy can also be administered intravenously or parenterally as described above.
[0095]The dose administered to a patient, in the context of the present invention should be sufficient to effect a beneficial therapeutic response in the patient over time. The dose will be determined by the efficacy of the particular vector employed and the condition of the patient, as well as the body weight or surface area of the patient to be treated. The size of the dose also will be determined by the existence, nature, and extent of any adverse side-effects that accompany the administration of a particular vector, or transduced cell type in a particular patient.
[0096]In determining the effective amount of the vector to be administered in the treatment or prophylaxis of conditions owing to diminished or aberrant expression of the protein, the physician evaluates circulating plasma levels of the vector, vector toxicities, progression of the disease, and the production of anti-vector antibodies. In general, the dose equivalent of a naked nucleic acid from a vector is from about 1 μg to 100 μg for a typical 70 kilogram patient, and doses of vectors are calculated to yield an equivalent amount of therapeutic nucleic acid.
[0097]For administration, compounds and transduced cells of the present invention can be administered at a rate determined by the LD-50 of the inhibitor, vector, or transduced cell type, and the side-effects of the inhibitor, vector or cell type at various concentrations, as applied to the mass and overall health of the patient. Administration can be accomplished via single or divided doses.
EXAMPLES
[0098]The following examples are offered to illustrate, but not to limit the claimed invention.
Example 1
Targeted Lentiviral Vectors with Mutated Sindbis Envelopes
Methods
[0099]Plasmid construction. All mutants of pIntron ZZ SINDBIS were generated using a site directed mutagenesis kit (Stratagene, La Jolla, Calif.). Initially, the envelope region of pIntronZZ SINDBIS was cloned into pBS-SKII. Mutagenesis was performed using various oligonucleotide corresponding to the mutations (Table 1) following the manufacturer's protocol. The mutations were confirmed by sequence analysis. The sequenced regions were then cloned back into pIntron ZZSINBIS. CCR MDRsc1 was constructed from pRRL-cPPTCMV-X-PRE (kindly provided by Dr. William Osborne) (Barry et al., Hum. Gene Ther. 12, 1103-1108 (2001)) and ha-MDRsc (kindly provided by Dr. Brian Sorrentino) (Bunting et al., Blood 92, 2269-2279 (1998)). FUhLucW was constructed from FUGW (kindly provided by Dr. David Baltimore) and pGL3-Basic (Promega, Madison, Wis.). FUIntronRW was constructed from FUGW and phRL-CMV (Promega).
TABLE-US-00001 TABLE 1 Sindbis Envelope Mutations * Selectivity Index ** Titer (% of ZZ SINDBIS) Mutant Domain Details of mutation 293T HepG2 293T HepG2 ZZ SINDBIS 9 4.9 100 100 m1 R1 deletion of E3 a.a. 61-64 21 11.4 38 69 m2 R1 E2 R1D 7.5 4.6 85 97 m3 R1 m1 + m2 21 9.8 30 64 m9 R1 E3 RSKRS60-64AAAAA 32 9.2 47 71 m4 R2 deletion of E2 a.a. 68-71 11 5.3 30 59 m8 R2 E2 SLKQ68-71AAAA 17 5.7 101 78 m5 R3 E2 S114P *** *** *** *** m6 R4 E2 K159A E160A 10 4.9 113 95 m7 R5 E2 E216A T218A 11 4.6 111 86 1st combination of mutations ZZ SINDBIS 34 6.9 100 100 m1 R1 deletion of E3 a.a. 61-64 132 13.2 40 109 m16 R1 + 4 m1 + m6 151 14.9 53 115 m17 R1 + 5 m1 + m7 80 12.0 21 87 m18 R1 + 2 m1 + m8 120 15.4 42 105 2nd combination of mutations ZZ SINDBIS 42 6.3 100 100 m1 R1 deletion of E3 a.a. 61-64 127 14.8 68 133 m168 R1 + 2 + 4 m1 + m6 + m8 125 18.6 89 143 The results are average of three independent infection and flow cytrometry. a.a. is abbreviation of amino acid * Selectivity index was calculated as follows: (% EGFP + cells infected in the presence of anti-HLA monoclonal antibody)/(% EGFP + infected in the absence of antibody) ** Titer was calculated as follows: (% EGFP positive cells infected by lentiviral pseudotyped by each mutant in the presence of anti-HLA monoclonal antibody)/(% EGFP positive cells infected by lentiviral vector pseudotyped by ZZ SINDBIS in the presence of anti-HLA monoclonal antibody) × 100 *** m5 did not have any infectivity.
[0100]Cells. Hep G2 cells and B16F10 cells were purchased from ATCC and cultured in DMEM (Invitrogen, Carlsbad, Calif.) containing FCS (10%) (Hycione, Logan, Utah), penicillin (100 units/ml) and streptomycin (100 μg/ml). 293T cells were grown in IMDM (HRH Biosciences, Lenexa, Kans.) containing FCS (10%), penicillin (100 units/ml) and streptomycin (100 μg/ml). B16F10MDR 5 cells were generated by stable gene transduction of CCRMDRsc1 (VSV-G). After lentiviral gene transduction, cells were cloned by limiting dilution. The clones were analyzed for the expression of MDR-1 (P-gp) by flow cytometry. The clone designated B16F10MDR5 showed the highest level of the expression of the MDR-1 gene and was used for all further experiments.
[0101]Virus production. All lentivirus vectors were produced by calcium phosphate-mediated transient transfection of 293T cells. 293 T cells (1.8×107) were transfected with pCMVR8.2DVPR (12.5 μg), the appropriate lentiviral vector plasmid (12.5 μg), and pHCMVG (5 μg) or pIntron SINDBIS, pIntron ZZ SINDBIS or mutants derived thereof (10 μg). For in vitro screening of the mutant pIntron ZZ SINDBIS, TRIP GFP (kindly provided by Dr. Pierre Charneau) (Zennou et al., Cell, 101, 173-185 (2000)) was used as the lentiviral vector plasmid. CCRMDRsci was used as the lentiviral vector and pHCMVG as the envelope plasmid for generation of the MDR-1 expressing lentiviral vector. The Renilla luciferase expressing lentiviral vector was generated using FUIntronRW as the lentiviral vector plasmid and pHCMVG as the envelope plasmid. FUhLucW was used as the lentivirus vector for generation of the humanized Firefly luciferase expressing lentivirus vector.
[0102]Antibodies. Anti-HLA ABC was purchased from Sigma (St. Louis, Mo.). Anti-P-gp (multiple drug resistant gene-1 product) was purchased from Kamiya Biomedical Company (Seattle, Wash.). Anti-Sindbis virus ascites fluid and control ascites fluid were purchased from ATCC. Anti-mouse IL-2 receptor beta-chain (TM-Beta 1) was kindly provided by Dr. Masayukiso Miyasaka.
[0103]In vitro infection of cells. 293T cells (5×104) and HepG2 cells (5×104) were seeded on 24-well plates the day before infection. The cells were incubated with 200 μl of unconcentrated HIV vector (TRIP GFP) pseudotyped by ZZ SINDBIS or its mutants with or without anti-HLA (1 μg/ml) for 2 hours at 37° C. with 5% CO2. The virus was removed and replaced with fresh medium (1 ml). Three days post infection; the cells were trypsinized and analyzed by flow cytometry. Background infectivity of TRIP GFP (ZZ SINDBIS) was blocked by anti-Sindbis virus ascites fluid. Anti-Sindbis virus ascites fluid or control acites fluid was added to unconcentrated TRIP GFP (VSV-G), TRIP GFP (Sindbis) or TRIP GFP (ZZ SINDBIS) (0.1% volume) and incubated for 1 hour at 4° C. The virus was used for infection of 293T cells and infectivity was analyzed as previously described.
[0104]Immunoblot assay. The HIV vectors (FUhLucW) pseudotyped with ZZ SINDBIS or m168 were concentrated 100-fold by ultracentrifugation and resuspended in PBS. The concentrated virus was mixed with equal volume of electrophoresis loading buffer [glycerol (20%), β-mercaptoethanol (10%), sodium dodecyl sulfate (4%), Tris-HCl pH 6.8 (125 mM), bromophenol blue (0.02%)] and boiled for 5 min. The amount of virus sample was normalized to the amount of HIV p24 (5 μg of p24/lane). The samples were subjected to electrophoresis through an SDS polyacrylamide gel (10%) as described previously (Morizono et al., J. Virol., September; 75.(17.):8015.-20. 75, 8016-8020 (2001)). Immunoblot analysis was performed with anti-Sindbis virus ascites fluid and horseradish peroxidase-conjugated anti-mouse antibody (Santa Cruz Biotechnology, Santa Cruz, Calif.). The protein bands were visualized by enhanced chemiluminescence (Pierce, Rockford, Ill.).
[0105]In vivo analysis of background infection. HIV vector (FUhLucW) pseudotyped by VSV-G, Sindbis virus, ZZ SINDBIS or m168 were injected into the tail vein of 6-week old female NOD/SCID mouse. The amount injected for each virus was normalized to the amount of HIV p24 (30 pg of HIV p24 in 300 μl PBS). Five days post injection, the mice were anesthetized and injected with D-luciferin (3 mg/mouse) (Xenogen, Alameda, Calif.) intraperitonially. CCCD images were obtained using a cooled IVIS CCD camera (Xenogen), and analyzed with IGOR-PRO Living Image Software. The data acquisition was performed 20 min after D-luciferin injection for 1 min. Mice were sacrificed by CO2 narcosis after CCCD imaging. The organs from each mouse were excised and genomic DNA was isolated using a Dneasy kit (QIAGEN, Valencia, Calif.) following the manufacturer's protocol. Quantitation of the vector copy number and cell number in the DNA isolate was performed by using SYBRgreen real time PCR kit (QIAGEN) and an ABI PRISM 7700 sequence detector (Perkin Elmer, Wellesley, Mass.). The primers for the analysis of vector copy number (Firefly Luciferase) were Fluc-a (gagatacgccctggttcctg) and Fluc-b (gcatacgacgattctgtgatttg). The standard for quantitation of vector copy number was FUhLucW. The primers for the analysis of cell number (mouse beta actin) were beta-actin-F (caactccatcatgaagtgtgac) and beta-actin-R (ccacacggagtacttgcgctc). The standard for the analysis of cell number was made using genomic DNA isolated from normal mouse peripheral blood mononuclear cell.
[0106]Targeted infection of melanoma cells in vitro. B16F10MDR5 cells (1×104) were seeded on 48-well plate at the day before infection. The cells were incubated with FUhLucW (ZZ SINDBIS) or FUhLucW (m168) (10 ng HIV p24) with or without anti-P-gap antibody (1 μg/ml) for 2 hours at 37° C. with 5% CO2. The virus was subsequently removed and replaced with fresh medium (500 μl). Three days post infection, cells were lysed in passive lysis buffer (Promega) and Firefly luciferase activity was measured following the manufacturer's protocol.
[0107]Targeted infection of melanoma cells in vivo. To express Renilla luciferase as a marker, the human P-gp expressing mouse cell line, B16F10MDR5, was transduced by the lentiviral vector FUIntronRW (VSV-G). One day prior to subsequent cell and virus injection, TMbeta-1 (1 mg) was injected into 6-week old female NOD/SCID mice. Renilla luciferase expressing B16F10MDR5 (2×105 cells in 150 μl of PBS) were injected into mouse via the tail vein. Thirty minutes later, FUhLucW (ZZ SINDBIS) or FUhLucW (m168), to which we had added anti P-glycoprotein monoclonal antibody or Isotype (IgG2a) control antibody (10 μg/ml) was injected into the tail vein. The amount of each virus used for injection was normalized to the amount of HIV p24 (36 pg of HIV p24 in 150 μl PBS). Ten days after cells and virus injection, lung metastasis of B16F10MDR5 was determined by imaging the Renilla luciferase. Mice were anesthetized and coelenterazine (20 μg) (Prolume, Pinetop, Ariz.) was injected via the tail vein. Data acquisition was performed directly following coelenterazine injection for 1 min. Twelve days after cell and virus injection, virus infection was determined by imaging the expression of Firefly luciferase reporter gene. Mice were anesthetized and injected intraperitonially with D-luciferin (6 mg/mouse). Imaging was performed as previously described. Mice were sacrificed after imaging using D-Luciferin. To isolate tumor cells, whole lung was isolated, ground and passed through a cell strainer (BD, San Jose, Calif.). The cells were cultured for 10 days in DMEM supplemented with FCS (20%), penicillin (100 units/ml) and streptomycin (100>ag/ml). Cultured cells were trypsinized, counted, stained by anti-P-Glycoprotein monoclonal antibody conjugated to PE (BD) and analyzed by flow cytometry. More than 99% of cells expressed P-gp demonstrating that nearly all of the cells we harvested were B16F10MDR5 cells. Cells were not recovered from control mice that did not receive tumor cells. One million cells were then harvested and lysed in passive lysis buffer (200 μl) (Promega) and analyzed for Firefly luciferase activity following the manufacturer's protocol. Genomic DNA was isolated using a DNeasy kit (QIAGEN). The primers and standard for quantitation of vector copy number were the same as those used to quantitate the background level of infection as previously described. Quantitation of the cell number was performed using primers for murine beta-actin as described above and the standard was generated by using known numbers of B16F10MDR5 cells.
Results
[0108]We previously demonstrated specific targeting of our ZZ SINDBIS lentiviral vector and murine retroviral vectors to CD4.sup.+ and HLA.sup.+, cells using monoclonal antibodies specific for CD4 and HLA (Morizono et al., J. Virol., September; 75.(17.):8015.-20. 75, 8016-8020 (2001)). These vectors demonstrated an approximately 30-fold selectivity for infection of target cells in the presence of the specific cell surface monoclonal antibody. Our goal is to utilize these vectors for direct targeting of gene therapy vectors to specific target cells via direct injection in the bloodstream. We utilized lentiviral vectors bearing two distinct types of reporter genes to assess transduction efficiency (FIG. 1). The EGFP-expressing virus vector allowed a quantitative assessment of infectivity in vitro as monitored by flow cytometry (Zennou et al., Cell, 101, 173-185 (2000)). We utilized both Firefly and Renilla luciferase-expressing virus vectors and non-invasive cooled charged-coupled device (CCCD) imaging to quantitate the level of specific targeting of vectors in live mice (Bhaumik and Gambhir, Proc Natl. Acad. Sci. U.S.A. 99, 377-382 (2002)).
HIV Vector Pseudotyped by ZZ Sindbis has Non-Specific Infectivity In Vivo.
[0109]FIG. 2a shows the typical enhancement in infectivity of the ZZ SINDBIS pseudotyped virus vector in vitro using a monoclonal antibody directed to HLA. We observed approximately a 30-fold enhancement of EGFP.sup.+ cells in the presence of anti-HLA antibody relative to that seen in the absence of monoclonal antibody. As a comparison, VSV-G envelope pseudotyped virus infected cells at a high level in the absence of antibody. The titer of ZZ SINDBIS virus is usually about 5-fold lower than that of VSV-G pseudotyped virus but, like VSV-G pseudotypes can be further concentrated at least 100-fold by ultracentrifugation.
[0110]ZZ SINDBIS pseudotyped virus vectors expressing Firefly luciferase were utilized to quantitate the level and specificity of targeting in transduced cells in the organs of live mice. We used a lentiviral vector containing the Ubiquitin-C promoter for in vivo experiments since this vector has been shown to express well in all mouse tissues (Lois et al., Science, 295, 868-872 (2002)). ZZ SINDBIS virus vectors were injected into the tail vein in the absence of monoclonal antibody. The expression of virus was monitored by luciferase expression utilizing CCCD imaging (FIG. 2b). Lentiviral vectors pseudotyped with each of the envelopes, VSV-G, wild type Sindbis, and ZZ SINDBIS infected both liver and spleen. VSV-G and wild type Sindbis pseudotypes resulted in a strong signal. Although ZZ SINDBIS gave a weaker signal, consistent with its infectivity in vitro, there was still clear expression in liver and spleen. Injection of recombinant luciferase did not show a signal in major organs, indicating that the signal observed with ZZ SINDBIS was due to infection of cells in the organs (data not shown). We verified infection of Sindbis and ZZ SINDBIS in the liver and spleen by quantitative DNA PCR analysis (Table 2).
TABLE-US-00002 TABLE 2 Copy Number of Lentiviral Vector/104 Cells Vector Liver Heart Spleen Kidney Lung Ovary No vector *< *< *< *< *< *< SINDBIS 569 *< 1407 *< *< *< ZZ SINDBIS 75 *< 538 *< *< *< ZZ SINDBIS 397 *< 520 *< *< *< ZZ SINDBIS 146 *< 295 *< *< *< m168 26 *< 36 *< *< *< m168 66 *< 15 *< *< *< m168 38 *< 28 *< *< *< Genomic DNA from each organ was isolated and analyzed as described in materials and methods. *< represents undetectable The threshold for the copy number for detection from each organ was as below. Liver: 11 copies/104 cells. Heart: 26 copies/104 cells. Spleen: 3 copies/104 cells. Kidney: 3.3 copies/104 cells. Lung: 8.3 copies/104 cells. Ovary: 13 copies/104 cells.
The Non-Specific Infectivity of ZZ Sindbis Pseudotypes is Due to Sindbis Envelope Sequences.
[0111]We further investigated the nature of the non-specific background infectivity of ZZ SINDBIS pseudotypes. A mouse polyclonal antibody which neutralizes wild type Sindbis virus infectivity was utilized to demonstrate that the background infectivity was the result of Sindbis virus domains and not the ZZ protein A sequences (FIG. 3). Using flow cytometry we determined that the level of GFP.sup.+ cells in the wild type and ZZ SINDBIS virus pseudotypes was substantially reduced in the presence of the anti-Sindbis antibody. Infectivity of VSV-G pseudotypes was not blocked nor was infection with the control antibody. These results indicate that Sindbis virus domains within the Sindbis virus envelope are responsible for the non-specific infectivity of ZZ SINDBIS pseudotypes. Thus, we undertook a structure-function analysis of the Sinbis virus envelope through site-directed mutagenesis of ZZ SINDBIS with the aim of ablating residual background infectivity.
[0112]Identification of a ZZ SINDBIS E2 mutant with enhanced cell targeting specificity. We first determined the regions responsible for the residual infectivity of our ZZ SINDBIS envelope. The domains we targeted for mutagenesis have previously been reported to affect binding to target cells, block epitopes for neutralizing antibody and function in Sindbis virus tropism (Klimstra et al., J, Virol. 72, 7357-7366 (1998); London et al., Proc Natl. Acad Sci U.S.A. 89, 207-211 (1992); Klimstra et al., J. Virol. 73, 6299-6306 (1999); Byrnes and Griffin, J. Virol. 74, 644-651 (2000); Pence et al., Virology 175, 41-49 (1990); Gardner et al., J. Virol 74, 11849-11857 (2000); Dubuisson and Rice, Journal of Virology 67, 3363-3374 (1993); Polo and Johnston, J. Virol. 65, 6358-6361 (1991); Lee et al., J. Virol. 76, 6302-6310 (2002)). All these domains were located in the E2 protein of the Sindbis virus envelope (FIG. 4). We analyzed E2 mutant pseudotyped virus vectors for infectivity in 293T cells using flow cytometry. The infectivity of mutants was tested on two different cell types, 293T, a human kidney cell line used for standard titration of virus stocks and HepG2 cells, derived from a human hepatocellular carcinoma (Table 1). We tested infectivity in HepG2 cells, because of the background infectivity we observed in liver cells in vivo. We identified several E2 mutants with reduced levels of nonspecific infectivity and thus, an enhanced selectivity for targeting. Since some of these mutations also reduced the titer of viruses produced, we combined the mutations conferring enhanced selectivity with other mutations that enhanced infectivity. Five domains of Sindbis E2 previously reported to affect the infectivity of Sindbis virus were analyzed for their level of infectivity. Mutation ml in domain R1 enhanced the selectivity on 293T cells relative to wild type ZZ SINDBIS virus. However, this mutation also resulted in a decrease in virus titer. Mutations in domain R4 enhanced the titer without altering the specificity. Combining mutation m1 and m6 resulted in partial restoration of the titer and maintenance of the higher selectivity of ml. A double mutant of m1 and m8 resulted in enhanced selectivity on HepG2 liver cells. The combination of mutations of m1, m6, and m8 in domains R1, R2, and R4, respectively, resulted in a pseudotyped virus with enhanced selectivity on 293T and HepG2 liver cells while maintaining stability during concentration by ultracentrifugation high viral titers. This mutant ZZ SINDBIS envelope was termed m168. Our data is consistent with previous studies that demonstrate the role of the R1 and R2 domains for heparin sulfate binding and the R5 domain for rescue of the reduced titer of an R1 mutant in replication competent Sindbis virus (Heidner et al., J. Virol. 68, 2683-2692 (1994)). Identification of a neurotropic strain of Sindbis virus suggested use of an alternative receptor in neuronal cells (Lee et al., J. Virol. 76, 6302-6310 (2002)). m168 also displayed a higher level of specificity than ZZ SINDBIS (>20-fold) in the neuroblastoma cell line, NB41A3 (data not shown).
Enhanced Specificity of the Modified m168 ZZ Sindbis Pseudotyped Virus In Vitro.
[0113]A representative experiment illustrating enhanced specificity of m168 infection in 293T cells, in the presence of an HLA monoclonal antibody is shown in FIG. 5a. In the absence of antibody the background level of infectivity is reduced when compared to the ZZ SINDBIS virus and the levels of infectivity and stability are maintained. A Western blot of m168 pseudotyped virions shows the E2 envelope protein expressed from wild type ZZ SINDBIS and m168 (FIG. 5b). Note that the m168 envelope protein is larger as a result of mutation ml that prevents cleavage of E2 and E3. This mutant was used in subsequent experiments.
m168 ZZ SINDBIS Pseudotyped Virus Displays Reduced Non-Specific Infectivity in Mice.
[0114]The ultimate goal of these studies is to develop a gene transfer vector capable of delivery directly into the bloodstream to target specific tissues or cells. The ability of the genetically modified M168 lentiviral pseudotypes to infect target cells in live mice was tested. First, we determined the level of non-specific infectivity in the absence of targeting antibody. Viruses bearing luciferase reporter genes were injected via the tail vein into SCID mice and the location of the infectivity was assessed using a CCCD camera to determine the level of luciferase expression in the mice. Consistent with the in vitro results, the modified m168 ZZ SINDBIS pseudotyped virus displayed a substantially lower infectivity in the liver and spleen of inoculated animals, relative to the parental ZZ SINDBIS pseudotyped virus (FIG. 6). Because the intensity of the CCCD imaging for luciferase expression can be influenced by a number of variables such as depth of tissue and positioning of the animal during imaging, we confirmed these results by isolation of organs and PCR analysis for vector DNA sequences (Table 2). These results confirm that infectivity in liver and spleen is substantially reduced. Of note, we could not detect infection in ovaries indicating that transduction of our vector into germ line cells was unlikely to occur. Having successfully reduced the background infectivity, we tested the ability of these m168 pseudotypes to target cancer cells in the presence of monoclonal antibody directed to a tumor specific cell surface antigen, P-gp in mice.
m168 Virus Specifically Targets P-gp Expressing Melanoma Cells in NOD/SCID Mice.
[0115]Malignant melanoma is an aggressive human tumor that metastasizes to multiple tissues including remote skin, soft tissue, lympho node and lung (Allen and Coit, Curr. Opin. Oncol. 14, 221-226 (2002)). Several intrinsic properties of tumor cells contribute to the development of resistance to chemotherapeutic drugs. Increased expression of the multi-drug resistant (MDR) genes causes overproduction of the transmembrane transport protein P-gp (Ambudkar et al., Oncogene. 22, 7468-7485 (2003)). P-gp transports neutral and cationic hydrophobic compounds across the cell membrane. Selection for tumor cells that are resistant to natural product amphiphilic anticancer drugs can induce expression of P-gp. Elevated levels of P-gp have been found in many solid tumors of the colon, kidney, liver and lung that had not been exposed to chemotherapy accompanied by development of the multi-drug resistance. One study demonstrated that 33 to 76% of the melanoma cell lines derived from primary tumors or metastases of untreated patients scored positive for P-gP (Berger et al., Int. J. Cancer 59, 717-723 (1994)).
[0116]We selected a murine model for human malignant metastatic melanoma where the tumor cells migrate through the bloodstream to engraft and form tumors in the lungs. We engineered the murine melanoma cells to express the human MDRsc1 gene (the vector is shown in FIG. 1) in order to provide a cell surface molecule for targeting. This served as our live animal model system that allowed us to stringently test whether our mutant E2 virus vector can target P-gp on the surface of the melanoma cells within live animals.
[0117]First, we demonstrated the specificity of the targeting for the P-gp expressing melanoma cells in vitro. A Firefly luciferase reporter gene was used to quantitate transduction of the melanoma cells by flow cytometry. Our results demonstrate that P-gp can be specifically targeted on the surface of the melanoma cells. In the presence of monoclonal antibody, infection of the melanoma cells is significantly greater than the original ZZ SINDBIS pseudotyped vector (Table 3). The P-gp transducing vector does not significantly infect cells that do not bear P-gp (data not shown). Thus, this combination of tumor cells and transducing vector was utilized for vector targeting in live mice.
TABLE-US-00003 TABLE 3 Luciferase Assay of Melanomas Vector Copy#/ Virus Antibody RLU 104 cells §In vitro transduction -- -- <200* FUhLucW (ZZ SINDBIS) -- 302 FUhLucW (ZZ SINDBIS) Anti P-Glycoprotein 1667 FUhLucW (m168) -- 203 FUhLucW (m168) Anti P-Glycoprotein 1295 †In vivo transduction by systemic virus injection -- -- <200* <19 FUhLucW (m168) control antibody 405 <19 FUhLucW (m168) control antibody 233 <19 FUhLucW (m168) control antibody 296 <19 FUhLucW (m168) Anti P-Glycoprotein 2737 87 FUhLucW (m168) Anti P-Glycoprotein 2397 50 FUhLucW (m168) Anti P-Glycoprotein 3104 65 FUhLucW (ZZ SINDBIS) Anti P-Glycoprotein 1834 77 FUhLucW (ZZ SINDBIS) Anti P-Glycoprotein 115 <19 Cells are harvested and analyzed for firefly luciferase expression and copy number of vector as described in materials and methods. §The value of RLU for in vitro transduction is Relative Luciferase Unit/104 cells. †The value of RLU for in vivo transduction is Relative Luciferase Unit/103 cells. *The values of background (uninfected cells) ranged from 100 to 200.
[0118]The tumor cells were first marked in vitro by transducing with a vector expressing Renilla luciferase. This allowed us to differentially identify the location of vector expression in the tumor cells. The localization of vector expression and tumor cells in the mice was visualized using different substrates for the two luciferase genes, Firefly and Renilla, respectively (FIG. 7). Following injection, the tumor cells migrate to the lungs and can be visualized by CCCD imaging for Renilla luciferase. The virus bearing m168 and anti P-gp antibody was injected via the tail vein. Vectors injected in the absence of anti P-gp antibody, show no signal for Firefly luciferase. In contrast, when virus is pseudotyped with m168 bearing anti P-Gp antibody, the luciferase expression of Firefly luciferase (m168 virus vector) co-localizes in the lung with that of Renilla luciferase (tumor melanoma cells).
[0119]The co-localization in the lungs of Firefly and Renilla luciferase expression representing tumor and virus infection, respectively, was confirmed to be a result of infection of the melanoma cells by the targeting vector. Lung tissue was isolated and melanoma cells cultured. Firefly luciferase activity, representing expression from the vector, was observed predominately in those tumor cells isolated from animals in which anti P-gp targeted virus was used for the infection (Table 3). Quantitative real time PCR analysis confirmed these results. Interestingly, m168 pseudotype vectors demonstrate a higher level of infection in melanoma cells in vivo compared to the parental ZZ SINDBIS, most likely due to less nonspecific trapping in other mouse tissues.
[0120]The targeting of micrometastatic tumors was also visualized by immunohistochemistry (see, FIG. 10). Tumor micro-nodules are observed in the lungs at Day 6 following transplant with morphologic characteristics of melanoma and positive for melanoma antigen S-10037. About 1% of these nodules were also positive for EGFP, consistent with the previous PCR analysis (see, Table 2 of K. Morizono et al., Nature Med (2005) 11:346-352, hereby incorporated herein by reference in its entirety for all purposes).
[0121]Rare transduced cells in the spleen and liver were identified as macrophages and related Kupffer cells, respectively, by flow cytometry and immunohistochemistry (FIGS. 11, 12a and 12b).
Targeting of Established Melanoma Tumors.
[0122]In another set of experiments, we tested the ability of the m168 vector to target established tumors. The same protocols as above were utilized except that tumors were allowed to form for 12 days prior to intravenous injection of the targeting vector. In this model system, visible tumors are evident at 8 days after inoculation and death occurs within 16 days after inoculation. Animals were visualized by CCCD imaging 3 days following intravenous injection for both the location of tumors and the specificity of targeting. Specific targeting to the tumors in the lungs of the animals was observed only following intravenous injection with m168 pseudotypes plus P-gp antibody (see, FIG. 13A). No non-specific infection was observed in the lungs in the absence of tumor and the infection to tumors in the lungs was dependent upon the presence of P-gp antibody. The transduction of organs was confirmed by isolation of specific organs following sacrifice (see FIG. 13b). The reduced signal intensity in lungs of this experiment relative to targeting of micrometastatic cells (compare mice of FIG. 13A with mice of FIG. 7) is due to limited growth of transduced cells (3 days versus 12 days after transduction) prior to imaging. For comparison, intravenous injection of VSVG pseudotypes show infection of a broad number of tissues without specificity for the tumors consistent with previously published studies (Sawai and Meruelo, Biochem Biophys Res Commun (1998) 248:315-323).
Discussion
[0123]We developed a gene therapy targeting strategy that for the first time allows production of a high titer virus that can be directed to specific cells and tissues. Most importantly, the high titer and specificity of this vector system makes it suitable for applications within living animals.
[0124]We took advantage of several aspects of the Sindbis virus envelope in designing our vector system. The Sindbis envelope consists of a cell derived lipid bilayer embedded with two integral membrane glycoproteins, E1 and E2, which mediate membrane fusion and receptor binding, respectively. Following binding of E2 to its receptor and endocytosis, E1 leads to fusion in a pH dependent fashion independent of E2. E1 and E2 are anchored in the cell membrane independently via transmembrane domains; an attribute that likely accounts for the high level of envelope stability and maintenance of function in chimeric molecules. Previous studies indicated that the Sindbis virus E2 envelope protein could be modified substantially yet retain infectivity (Dubuisson and Rice, Journal of Virology 67, 3363-3374 (1993)). Sindbis virus vectors with chimeric E2 envelopes were capable of targeting cells in vitro (Ohno et al., Nat. Biotechnol. 15, 763-767 (1997)).
[0125]Although Sindbis is an RNA virus, we previously created a DNA vector expressing the Sindbis envelope and demonstrated that it could be used to express functional envelope and form pseudotypes with both the HIV-1- and MuLV-based vectors (Morizono et al., J. Virol., September; 75.(17.):8015.-20. 75, 8016-8020 (2001)). When the Sindbis virus envelope is modified to encode the ZZ domain of protein A, monoclonal antibodies directed to cell surface antigens can be used to redirect the target specificity of the retroviral vectors. Here, we substantially modified the Sindbis E2 envelope to further increase the specificity of infectivity to a degree sufficient to achieve the high level of specificity required for in vivo infection. In such a context, the virus would encounter multiple cell types and thus, an increased potential for non-specific infectivity. Although the parental (first generation) ZZ SINDBIS pseudotyped vector retains infectivity in the liver and spleen, the pseudotypes bearing modified Sindbis virus envelope show a substantially decreased level of infectivity in these organs.
[0126]Although we have not investigated the specific cellular receptors responsible for the non-specific infectivity of the parental ZZ SINDBIS virus, our results indicate that background infectivity is likely due to changes within the Sindbis envelope domains and not the ZZ domain. Some of the mutations we characterized are known to abolish binding of the Sindbis virus envelope to heparin sulfate and thus, are likely responsible for the decreased nonspecific infectivity and resultant enhanced selectivity of these viruses (Klimstra et al., J. Virol. 73, 6299-6306 (1999); Byrnes and Griffin, J. Virol. 74, 644-651 (2000)). The phenotypes of these mutants are consistent with a previous report that characterized the role of the heparin sulfate binding domain in non-specific transduction of a targeting adenovirus vector in mice (Smith et al., Hum. Gene Ther. 14, 777-787 (2003); Koizumi et al., J. Viral. 77, 13062-13072 (2003)). By reducing the non-specific infectivity, it was possible for us to redirect the target cell specificity of the virus to a specific human tumor cell antigen, P-gp, which is expressed on the surface of murine melanoma cells.
[0127]Once a melanoma acquires the ability to invade tissues, continue to proliferate and escape immune surveillance metastatic spread is likely to occur. Metastatic competent tumor cells migrate from the site of the primary lesion and subsequently grow at distant anatomical sites including the liver and lungs. Pulmonary metastases are the most common site of visceral metastasis with between 15% and 35% of recurrence occurring in this location (Allen and Coit, Curr. Opin. Oncol. 14, 221-226 (2002)). Only 4% of patients with pulmonary metastases survive 5 years. The murine melanoma model we chose to evaluate the specificity of our mutants mimics the progression of human melanoma to a metastatic stage often found in the lung. This system was ideal for testing specific targeting of our modified ZZ virus vectors to metastatic tumor cells by directly injecting them into the bloodstream of mice.
[0128]Targeting P-gp as a tumor antigen can be useful not only for metastatic melanoma, but for many other tumors, which express this gene and are thus rendered resistant to multiple chemotherapeutic drugs (Ambudkar et al., Oncogene. 22, 7468-7485 (2003)). However, P-gp is also expressed on some normal cells, thus the targeting of tumor cells that express P-gp would be most successful in those situations where the P-gp was significantly over-expressed in the tumor cells.
[0129]Although non-covalent interactions via the protein A ZZ domain would be useful in ex vivo applications, in an animal or patient with an immunocompetent humoral immune system, the presence of circulating antibodies would compete for the monoclonal antibodies of the targeting vector. Thus, clinical in vivo applications use chimeric, recombinant single chain antibody sequences or specific ligand and/or peptide sequences. Human chorionic gonadotropin sequences have been successfully recombined into chimeric Sindbis envelope to target Sindbis virus based vectors (Sawai and Meruelo, Biochem. Biophys. Res. Commun. 248, 315-323 (1998)). To date, we have tested these pseudotypes with over ten specific monoclonal antibodies. Any specific ligand or affinity reagent incorporated into the Sindbis envelope can be used to target a cell surface molecule specific to a given cell or tissue type.
[0130]The applications of a specific targeting gene therapy vector are broad. In the melanoma model, for example, one could introduce specific suicide genes to kill tumor cells and/or immunomodulatory genes to enhance immune response directed to metastatic legions. Early treatment of metastatic cells is of significant therapeutic value. In theory, metastases could be targeted well before they grow to a size to be visualized by current technologies. Residual tumor cells following localized treatment with radiation and/or surgery could also be targeted and eliminated.
[0131]The targeting of gene therapy vectors to specific cells and tissues at specific sites in the body has numerous applications. Current applications of gene therapy require either ex vivo purification of cells followed by transduction of the purified target cells and/or injection directly into localized sites, both of which require extensive technical manipulation (Kohn et al., Nat. Med. 1, 1017-1023 (1995); Cavazzana-Calvo et al., Science 288, 669-672 (2000)). Direct injection into the bloodstream and infection to specified regions would facilitate the application of gene therapy to many diseases. Since most diseases, both acquired and hereditary, either originate in specific cells or manifest their clinical phenotypes in specific tissues, the gene therapeutic vectors could be delivered where they would be most effective. For example, gene therapy utilizing hematopoeitic progenitor cells currently require purification of the hematopoeitic stem cells followed by transduction ex vivo. Specific targeting vectors can be developed that target antigens specific for hematopoeitic stem cells and thus, allow direct introduction of therapeutic genes into the stem cells through bone marrow and/or systemic injection after progenitor cell mobilization. As evidenced by our ability to target the melanoma tumor cells prior to establishment of visible tumors in the lungs, targeting vectors that circulate and home to specific cells could allow early therapeutic intervention in the case of diseases such as cancer, and residual cells of chronic or latent infections by infectious agents. This system could also be applied to treatment of pulmonary diseases such as cystic fibrosis and alpha-1 antitrypsin deficiency, caused by mutations in the CFTR (CF transmembrane conductance regulator) and alpha-1 antitrypsin genes respectively (West and Rodman, Chest 119, 613-617 (2001)). In principle, the CFTR and alpha-1 anti trypsin genes could be delivered efficiently to lung cells by a simple intravenous injection.
[0132]Finally, targeting of specific cells and tissues would greatly enhance the safety of gene therapeutic applications. Inappropriate expression due to inadvertent infection of irrelevant cells or tissues is one cause for concern in gene therapy applications and has resulted in serious adverse effects in some clinical trials (Lehrman, S., Nature 401, 517-518 (1999)). Targeting to specific cells would lessen the possibility of adverse side effects. In addition, insertional mutagenesis of the retroviral vector, if it does occur, would be limited to a much smaller subset of cells, thus diminishing the possibility of events leading to the initiation and/or progression of malignant transformation (Hacein-Bey-Abina et al., Science 302, 415-419 (2003)). It is important to note that this targeting system has broad applicability for use with other retroviral vectors. Although we utilized lentiviral vectors in this study, we previously demonstrated that the Sindbis ZZ pseudotypes will also form readily with MuLV vectors, more commonly utilized in most existing gene therapy clinical applications for a variety of diseases.
Example 2
Targeting Prostate Cancer Cells through the Prostate Stem Cell Antigen (PSCA)
[0133]Prostate cancer is the most common cancer diagnosis and the second leading cause of cancer-related death in American men. Prostate cancer mortality frequently results from metastasis to bone and hormone-independent tumor growth. Physiologically relevant prostate cancer models exist, such as the LAPC-9 xenograft model (see, Craft, et al., Cancer Res (2000) 60:2541-2546). LAPC-9 cells were derived from a human bone metastasis, and are able to form a prostate cancer xenograft that can be propagated in SCID mice, and expresses prostate specific antigen and wild-type androgen receptor (Id.). Hormone independent outgrowths can be selected after castration of the mice, and micrometastasis can eventually be detected in half of the mice, recapitulating the clinical progression of human prostate cancer (Klein, et al., Nature Med (1997) 3:402-408).
[0134]We generated vectors that specifically deliver genes to prostate cancer in a living animal, and validated our vectors in the LAPC-9 model system. First, we found a candidate surface molecule in prostate cancer cells that our engineered Sindbis envelopes could target. Prostate stem cell antigen (PSCA) is a prostate-specific gene with 30% homology to stem cell antigen 2, a member of the Thy-1/Ly-6 family of glycosylphosphatidylinositol (GPI)-anchored cell surface antigens. PSCA encodes a 123-aa protein with an amino-terminal signal sequence, a carboxyl-terminal GPI-anchoring sequence, and multiple N-glycosylation sites (Gu, et al., Oncogene (2000) 19:1288-96; and Reiter, et al., Proc Natl Acad Sci USA (1998) 95:1735-1740). PSCA mRNA expression is prostate-specific in normal male tissues and is highly up-regulated in both androgen-dependent and -independent prostate cancer xenografts. PSCA is expressed in over 80% of prostate cancers, among them the LAPC-9 xenograft (Saffran, et al., Proc Natl Acad Sci (2001) 98:2658-2663), and is a promising therapeutic target. Thus, we targeted Sindbis pseudotyped lentiviral vectors with an anti-PSCA mAb, 1G8 (Saffran, supra). Although PSCA is widely expressed in human prostate cancers, expression is very low or undetectable in prostate cancer cell lines. We obtained a LNCaP derivative cell line stably transfected with PSCA (R. Reiter, UCLA), LPSCA4, and analyzed the ability of 1G8 to mediate infection of FUGW (that expresses EGFP from ubiquitin C promoter) pseudotyped with m168 (FIG. 14). LPSCA4 was very effectively infected by FUGW with both αHLA and 1G8 antibodies, whereas the parental LNCaP cells could only be infected with αHLA. 1G8 did not mediate infection into LNCaP cells, as levels were comparable to background infection in the absence of targeting antibody.
Example 3
Combining Cell Surface Targeting with Selective Cell to Increase Efficiency of Specific Targeting
[0135]The ubiquitin-C promoter in the FUGW lentiviral vector (Morizono, et al., Nature Medicine (2005) 11:346-352; and Lois, et al., Science (2002) 295:868-872), with a chimeric prostate specific antigen (PSA) promoter, designated (PSE-BC), to produce the construct FPGW. The key regulatory elements of the PSA enhancer include a proximal promoter (-541 to +12) comprising two binding sites for the androgen receptor (AREI and II) and a distal enhancer, which contains a 390-bp androgen responsive core region (Schuur, et al., J Biol Chem (1996) 8:1416-1426; and Cleutjens, et al., J Biol Chem (1996) 271:6379-6388). The core region contains a cluster of closely spaced androgen response elements (AREs) and sites for other transcription factors. The androgen receptor (AR) binds cooperatively to the enhancer and mediates synergistic transcription, and other factors within and outside of the enhancer contribute to prostate specificity (Reid, et al., J Biol Chem (2001) 276:2943-2952); and Huang, et al., (1999) J Biol Chem (1999) 274: 25756-25768). The PSE-BC promoter was generated by duplication of the PSA enhancer core and insertion of this duplicated element closer to the proximal promoter (200 bp upstream). After these modifications PSE-BC produced 20-fold higher expression levels than the parental construct, yet retained androgen inducibility and tissue specificity (Wu, et al, Gene Ther (2001) 8:1416-1426).
[0136]To assess the specificity of expression we infected prostate and non-prostate cell lines and primary cells with either FUGW or FPGW. Expression from the PSE-BC promoter was potent as the ubiquitin-C promoter in prostate cell lines, and specific to prostate cells, although some background expression could be detected in a hepatoma cell line (HepG2), primary fibroblasts and endothelial cells (FIG. 15). Of note, no expression from the PSE-BC promoter could be detected in primary macrophages in vitro.
Example 4
Targeting CNS Tissue By Conjugation To Anti-Transferrin Receptor Antibody
[0137]Successfully Targeted Transduction of Human Umbilical Vein Endothelial Cells (HUVEC) via TfR using TfR Monoclonal Antibodies.
[0138]Transferrin receptor (TfR) is highly expressed on brain capillary endothelial cells and has been used by Pardridge and co-workers as a means to deliver therapeutic reagents into the brain (Pardridge, Neuron (2002) 36:555-558; and Pardridge, Nat Rev Drug Discov (2002) 1:131-139. We determined that TfR could serve as a receptor for targeted infection by testing infection with m168 pseudotypes conjugated with antibodies directed to human TfR expressed on human umbilical vein endothelial cells (HUVEC). There are several available monoclonal antibodies directed to different or unknown epitopes of TfR (Panaccio, et al., Immunol Cell Biol (1987) 65:461-472; Esserman, et al., Blood (1989) 74:2718-2729; and Takahashi, et al, Blood (1991) 77:826-832). Our results demonstrate successful infection of HUVEC with TfR antibody, but not in the absence of TfR antibody. However the levels of infectivity were low compared to targeting to other cell surface molecules such as CD4, HLA, and P-gp in other cell types. (FIG. 16)
[0139]It was reported that a single mutation within the E1 envelope protein renders Sindbis virus replication to be independent of a requirement for cholesterol (Lu, et al., J Virol (1999) 73:4272-4278). A similar mutation was also identified in Semliki Forest virus (Vashishtha, et al., J Cell Biol (1998) 140:91-99). The mechanism of this cholesterol independent replication is unclear. Since the E1 protein is responsible for fusion of Sindbis envelope to induce entry into the cell, we reasoned that this mutation in the context of our targeting vector would work in concert with antibody mediated binding to enhance the infectivity of the targeting viruses. Our results show that this is the case. Introduction of the cholesterol independent mutation (E1 AK226-227SG) into the targeting Sindbis envelope (termed 2.2) enhanced infectivity of lentiviral pseudotypes 8-fold over that of m168 pseudotypes targeted to TfR (FIG. 16). These results demonstrate that efficient targeting to TfR can be obtained in cell culture.
Targeting to the CNS in Living Mice.
[0140]Using the modified vector described above we tested its ability to target TfR, particularly TfR expressing cells of the brain capillary endothelium. Mice were injected intravenously with anti-TfR conjugated vector through the tail vein. Five (5) days after injection mice were analyzed for location of transduced cells by optical imaging for expression of the luciferase reporter gene. We observed a distribution of luciferase activity in the body consistent with successful targeting to the CNS. Intense optical signals were observed in regions corresponding to the brain and spinal column. These results were confirmed after sacrifice by removing the skin and muscle from the back of the animals confirming luciferase expression from the brain and spinal column (FIG. 17). Control mice injected with vector in the absence of TfR antibody did not show a signal in the CNS, consistent with typical control animals utilized in the experiments targeting P-gp on melanoma (Morizono, et al, supra). It is noteworthy that although TfR is expressed on multiple cells and tissues in the body (Gatter, et al., J Clin Pathol (1983) 36:539-45; Lu, et al., Acta Pathol Jpn (1989) 39:759-764; and Soyer, et al., J Cutan Pathol (1987) 14:1-5), the major sites of transduction were observed in the regions corresponding to the central nervous system. Without being bound to any theory, this may be due to a higher density of transferrin receptor and/or enhanced rates of internalization of transferrin receptor in these regions (Pardridge, Neuron, supra; and Pardridge, Nat Rev Drug Discov, supra).
[0141]It is understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application and scope of the appended claims. All publications, patents, and patent applications cited herein are hereby incorporated by reference in their entirety for all purposes.
Sequence CWU
1
1613339DNASindbis virusZZSINBIS Sindbis virus ZZ envelope protein
mutant 1atggcgtccg cagcaccact ggtcacggca atgtgtttgc tcggaaatgt gagcttccca
60tgcgaccgcc cgcccacatg ctatacccgc gaaccttcca gagccctcga catccttgaa
120gagaacgtga accatgaggc ctacgatacc ctgctcaatg ccatattgcg gtgcggatcg
180tctggcagaa gcaaaagaag cgtcattgac gactttaccc tgaccagccc ctacttgggc
240acatgctcgt actgccacca tactgtaccg tgcttcagcc ctgttaagat cgagcaggtc
300tgggacgaag cggacgataa caccatacgc atacagactt ccgcccagtt tggatacgac
360caaagcggag cagcaagcgc aaacaagtac cgctacatgt cgcttaagca ggtaaccgac
420aacaaattca acaaagaaca acaaaacgcg ttctatgaga tcttacattt acctaactta
480aacgaagaac aacgaaacgc cttcatccaa agtttaaaag atgacccaag ccaaagcgct
540aaccttttag cagaagctaa aaagctaaat gatgctcagg cgccgaaagt agacaacaaa
600ttcaacaaag aacaacaaaa cgcgttctat gagatcttac atttacctaa cttaaacgaa
660gaacaacgaa acgccttcat ccaaagttta aaagatgacc caagccaaag cgctaacctt
720ttagcagaag ctaaaaagct aaatgatgct caggcgccga aagtagacgc gaattcgagc
780tcggtacccg gggatccggt aaccaccgtt aaagaaggca ccatggatga catcaagatt
840agcacctcag gaccgtgtag aaggcttagc tacaaaggat actttctcct cgcaaaatgc
900cctccagggg acagcgtaac ggttagcata gtgagtagca actcagcaac gtcatgtaca
960ctggcccgca agataaaacc aaaattcgtg ggacgggaaa aatatgatct acctcccgtt
1020cacggtaaaa aaattccttg cacagtgtac gaccgtctga aagaaacaac tgcaggctac
1080atcactatgc acaggccgag accgcacgct tatacatcct acctggaaga atcatcaggg
1140aaagtttacg caaagccgcc atctgggaag aacattacgt atgagtgcaa gtgcggcgac
1200tacaagaccg gaaccgtttc gacccgcacc gaaatcactg gttgcaccgc catcaagcag
1260tgcgtcgcct ataagagcga ccaaacgaag tgggtcttca actcaccgga cttgatcaga
1320catgacgacc acacggccca agggaaattg catttgcctt tcaagttgat cccgagtacc
1380tgcatggtcc ctgttgccca cgcgccgaat gtaatacatg gctttaaaca catcagcctc
1440caattagata cagaccactt gacattgctc accaccagga gactaggggc aaacccggaa
1500ccaaccactg aatggatcgt cggaaagacg gtcagaaact tcaccgtcga ccgagatggc
1560ctggaataca tatggggaaa tcatgagcca gtgagggtct atgcccaaga gtcagcacca
1620ggagaccctc acggatggcc acacgaaata gtacagcatt actaccatcg ccatcctgtg
1680tacaccatct tagccgtcgc atcagctacc gtggcgatga tgattggcgt aactgttgca
1740gtgttatgtg cctgtaaagc gcgccgtgag tgcctgacgc catacgccct ggccccaaac
1800gccgtaatcc caacttcgct ggcactcttg tgctgcgtta ggtcggccaa tgctgaaacg
1860ttcaccgaga ccatgagtta cttgtggtcg aacagtcagc cgttcttctg ggtccagttg
1920tgcatacctt tggccgcttt catcgttcta atgcgctgct gctcctgctg cctgcctttt
1980ttagtggttg ccggcgccta cctggcgaag gtagacgcct acgaacatgc gaccactgtt
2040ccaaatgtgc cacagatacc gtataaggca cttgttgaaa gggcagggta tgccccgctc
2100aatttggaga tcactgtcat gtcctcggag gttttgcctt ccaccaacca agagtacatt
2160acctgcaaat tcaccactgt ggtcccctcc ccaaaaatca aatgctgcgg ctccttggaa
2220tgtcagccgg ccgctcatgc agactatacc tgcaaggtct tcggaggggt ctaccccttt
2280atgtggggag gagcgcaatg tttttgcgac agtgagaaca gccagatgag tgaggcgtac
2340gtcgaattgt cagcagattg cgcgtctgac cacgcgcagg cgattaaggt gcacactgcc
2400gcgatgaaag taggactgcg tattgtgtac gggaacacta ccagtttcct agatgtgtac
2460gtgaacggag tcacaccagg aacgtctaaa gacttgaaag tcatagctgg accaatttca
2520gcatcgttta cgccattcga tcataaggtc gttatccatc gcggcctggt gtacaactat
2580gacttcccgg aatatggagc gatgaaacca ggagcgtttg gagacattca agctacctcc
2640ttgactagca aggatctcat cgccagcaca gacattaggc tactcaagcc ttccgccaag
2700aacgtgcatg tcccgtacac gcaggcctca tcaggatttg agatgtggaa aaacaactca
2760ggccgcccac tgcaggaaac cgcacctttc gggtgtaaga ttgcagtaaa tccgctccga
2820gcggtggact gttcatacgg gaacattccc atttctattg acatcccgaa cgctgccttt
2880atcaggacat cagatgcacc actggtctca acagtcaaat gtgaagtcag tgagtgcact
2940tattcagcag acttcggcgg gatggccacc ctgcagtatg tatccgaccg cgaaggtcaa
3000tgccccgtac attcgcattc gagcacagca actctccaag agtcgacagt acatgtcctg
3060gagaaaggag cggtgacagt acactttagc accgcgagtc cacaggcgaa ctttatcgta
3120tcgctgtgtg ggaagaagac aacatgcaat gcagaatgta aaccaccagc tgaccatatc
3180gtgagcaccc cgcacaaaaa tgaccaagaa tttcaagccg ccatctcaaa aacatcatgg
3240agttggctgt ttgccctttt cggcggcgcc tcgtcgctat taattatagg acttatgatt
3300tttgcttgca gcatgatgct gactagcaca cgaagatga
333921112PRTSindbis virusZZSINDBIS Sindbis virus ZZ envelope protein
mutant 2Met Ala Ser Ala Ala Pro Leu Val Thr Ala Met Cys Leu Leu Gly Asn1
5 10 15Val Ser Phe Pro
Cys Asp Arg Pro Pro Thr Cys Tyr Thr Arg Glu Pro20 25
30Ser Arg Ala Leu Asp Ile Leu Glu Glu Asn Val Asn His Glu
Ala Tyr35 40 45Asp Thr Leu Leu Asn Ala
Ile Leu Arg Cys Gly Ser Ser Gly Arg Ser50 55
60Lys Arg Ser Val Ile Asp Asp Phe Thr Leu Thr Ser Pro Tyr Leu Gly65
70 75 80Thr Cys Ser Tyr
Cys His His Thr Val Pro Cys Phe Ser Pro Val Lys85 90
95Ile Glu Gln Val Trp Asp Glu Ala Asp Asp Asn Thr Ile Arg
Ile Gln100 105 110Thr Ser Ala Gln Phe Gly
Tyr Asp Gln Ser Gly Ala Ala Ser Ala Asn115 120
125Lys Tyr Arg Tyr Met Ser Leu Lys Gln Val Thr Asp Asn Lys Phe
Asn130 135 140Lys Glu Gln Gln Asn Ala Phe
Tyr Glu Ile Leu His Leu Pro Asn Leu145 150
155 160Asn Glu Glu Gln Arg Asn Ala Phe Ile Gln Ser Leu
Lys Asp Asp Pro165 170 175Ser Gln Ser Ala
Asn Leu Leu Ala Glu Ala Lys Lys Leu Asn Asp Ala180 185
190Gln Ala Pro Lys Val Asp Asn Lys Phe Asn Lys Glu Gln Gln
Asn Ala195 200 205Phe Tyr Glu Ile Leu His
Leu Pro Asn Leu Asn Glu Glu Gln Arg Asn210 215
220Ala Phe Ile Gln Ser Leu Lys Asp Asp Pro Ser Gln Ser Ala Asn
Leu225 230 235 240Leu Ala
Glu Ala Lys Lys Leu Asn Asp Ala Gln Ala Pro Lys Val Asp245
250 255Ala Asn Ser Ser Ser Val Pro Gly Asp Pro Val Thr
Thr Val Lys Glu260 265 270Gly Thr Met Asp
Asp Ile Lys Ile Ser Thr Ser Gly Pro Cys Arg Arg275 280
285Leu Ser Tyr Lys Gly Tyr Phe Leu Leu Ala Lys Cys Pro Pro
Gly Asp290 295 300Ser Val Thr Val Ser Ile
Val Ser Ser Asn Ser Ala Thr Ser Cys Thr305 310
315 320Leu Ala Arg Lys Ile Lys Pro Lys Phe Val Gly
Arg Glu Lys Tyr Asp325 330 335Leu Pro Pro
Val His Gly Lys Lys Ile Pro Cys Thr Val Tyr Asp Arg340
345 350Leu Lys Glu Thr Thr Ala Gly Tyr Ile Thr Met His
Arg Pro Arg Pro355 360 365His Ala Tyr Thr
Ser Tyr Leu Glu Glu Ser Ser Gly Lys Val Tyr Ala370 375
380Lys Pro Pro Ser Gly Lys Asn Ile Thr Tyr Glu Cys Lys Cys
Gly Asp385 390 395 400Tyr
Lys Thr Gly Thr Val Ser Thr Arg Thr Glu Ile Thr Gly Cys Thr405
410 415Ala Ile Lys Gln Cys Val Ala Tyr Lys Ser Asp
Gln Thr Lys Trp Val420 425 430Phe Asn Ser
Pro Asp Leu Ile Arg His Asp Asp His Thr Ala Gln Gly435
440 445Lys Leu His Leu Pro Phe Lys Leu Ile Pro Ser Thr
Cys Met Val Pro450 455 460Val Ala His Ala
Pro Asn Val Ile His Gly Phe Lys His Ile Ser Leu465 470
475 480Gln Leu Asp Thr Asp His Leu Thr Leu
Leu Thr Thr Arg Arg Leu Gly485 490 495Ala
Asn Pro Glu Pro Thr Thr Glu Trp Ile Val Gly Lys Thr Val Arg500
505 510Asn Phe Thr Val Asp Arg Asp Gly Leu Glu Tyr
Ile Trp Gly Asn His515 520 525Glu Pro Val
Arg Val Tyr Ala Gln Glu Ser Ala Pro Gly Asp Pro His530
535 540Gly Trp Pro His Glu Ile Val Gln His Tyr Tyr His
Arg His Pro Val545 550 555
560Tyr Thr Ile Leu Ala Val Ala Ser Ala Thr Val Ala Met Met Ile Gly565
570 575Val Thr Val Ala Val Leu Cys Ala Cys
Lys Ala Arg Arg Glu Cys Leu580 585 590Thr
Pro Tyr Ala Leu Ala Pro Asn Ala Val Ile Pro Thr Ser Leu Ala595
600 605Leu Leu Cys Cys Val Arg Ser Ala Asn Ala Glu
Thr Phe Thr Glu Thr610 615 620Met Ser Tyr
Leu Trp Ser Asn Ser Gln Pro Phe Phe Trp Val Gln Leu625
630 635 640Cys Ile Pro Leu Ala Ala Phe
Ile Val Leu Met Arg Cys Cys Ser Cys645 650
655Cys Leu Pro Phe Leu Val Val Ala Gly Ala Tyr Leu Ala Lys Val Asp660
665 670Ala Tyr Glu His Ala Thr Thr Val Pro
Asn Val Pro Gln Ile Pro Tyr675 680 685Lys
Ala Leu Val Glu Arg Ala Gly Tyr Ala Pro Leu Asn Leu Glu Ile690
695 700Thr Val Met Ser Ser Glu Val Leu Pro Ser Thr
Asn Gln Glu Tyr Ile705 710 715
720Thr Cys Lys Phe Thr Thr Val Val Pro Ser Pro Lys Ile Lys Cys
Cys725 730 735Gly Ser Leu Glu Cys Gln Pro
Ala Ala His Ala Asp Tyr Thr Cys Lys740 745
750Val Phe Gly Gly Val Tyr Pro Phe Met Trp Gly Gly Ala Gln Cys Phe755
760 765Cys Asp Ser Glu Asn Ser Gln Met Ser
Glu Ala Tyr Val Glu Leu Ser770 775 780Ala
Asp Cys Ala Ser Asp His Ala Gln Ala Ile Lys Val His Thr Ala785
790 795 800Ala Met Lys Val Gly Leu
Arg Ile Val Tyr Gly Asn Thr Thr Ser Phe805 810
815Leu Asp Val Tyr Val Asn Gly Val Thr Pro Gly Thr Ser Lys Asp
Leu820 825 830Lys Val Ile Ala Gly Pro Ile
Ser Ala Ser Phe Thr Pro Phe Asp His835 840
845Lys Val Val Ile His Arg Gly Leu Val Tyr Asn Tyr Asp Phe Pro Glu850
855 860Tyr Gly Ala Met Lys Pro Gly Ala Phe
Gly Asp Ile Gln Ala Thr Ser865 870 875
880Leu Thr Ser Lys Asp Leu Ile Ala Ser Thr Asp Ile Arg Leu
Leu Lys885 890 895Pro Ser Ala Lys Asn Val
His Val Pro Tyr Thr Gln Ala Ser Ser Gly900 905
910Phe Glu Met Trp Lys Asn Asn Ser Gly Arg Pro Leu Gln Glu Thr
Ala915 920 925Pro Phe Gly Cys Lys Ile Ala
Val Asn Pro Leu Arg Ala Val Asp Cys930 935
940Ser Tyr Gly Asn Ile Pro Ile Ser Ile Asp Ile Pro Asn Ala Ala Phe945
950 955 960Ile Arg Thr Ser
Asp Ala Pro Leu Val Ser Thr Val Lys Cys Glu Val965 970
975Ser Glu Cys Thr Tyr Ser Ala Asp Phe Gly Gly Met Ala Thr
Leu Gln980 985 990Tyr Val Ser Asp Arg Glu
Gly Gln Cys Pro Val His Ser His Ser Ser995 1000
1005Thr Ala Thr Leu Gln Glu Ser Thr Val His Val Leu Glu Lys Gly
Ala1010 1015 1020Val Thr Val His Phe Ser
Thr Ala Ser Pro Gln Ala Asn Phe Ile Val1025 1030
1035 1040Ser Leu Cys Gly Lys Lys Thr Thr Cys Asn Ala
Glu Cys Lys Pro Pro1045 1050 1055Ala Asp
His Ile Val Ser Thr Pro His Lys Asn Asp Gln Glu Phe Gln1060
1065 1070Ala Ala Ile Ser Lys Thr Ser Trp Ser Trp Leu Phe
Ala Leu Phe Gly1075 1080 1085Gly Ala Ser
Ser Leu Leu Ile Ile Gly Leu Met Ile Phe Ala Cys Ser1090
1095 1100Met Met Leu Thr Ser Thr Arg Arg1105
111033327DNASindbis virusm168 Sindbis virus ZZ envelope protein mutant
3atggcgtccg cagcaccact ggtcacggca atgtgtttgc tcggaaatgt gagcttccca
60tgcgaccgcc cgcccacatg ctatacccgc gaaccttcca gagccctcga catccttgaa
120gagaacgtga accatgaggc ctacgatacc ctgctcaatg ccatattgcg gtgcggatcg
180tctggcagcg tcattgacga ctttaccctg accagcccct acttgggcac atgctcgtac
240tgccaccata ctgtaccgtg cttcagccct gttaagatcg agcaggtctg ggacgaagcg
300gacgataaca ccatacgcat acagacttcc gcccagtttg gatacgacca aagcggagca
360gcaagcgcaa acaagtaccg ctacatggcg gctgcggcgg taaccgacaa caaattcaac
420aaagaacaac aaaacgcgtt ctatgagatc ttacatttac ctaacttaaa cgaagaacaa
480cgaaacgcct tcatccaaag tttaaaagat gacccaagcc aaagcgctaa ccttttagca
540gaagctaaaa agctaaatga tgctcaggcg ccgaaagtag acaacaaatt caacaaagaa
600caacaaaacg cgttctatga gatcttacat ttacctaact taaacgaaga acaacgaaac
660gccttcatcc aaagtttaaa agatgaccca agccaaagcg ctaacctttt agcagaagct
720aaaaagctaa atgatgctca ggcgccgaaa gtagacgcga attcgagctc ggtacccggg
780gatccggtaa ccaccgttaa agaaggcacc atggatgaca tcaagattag cacctcagga
840ccgtgtagaa ggcttagcta caaaggatac tttctcctcg caaaatgccc tccaggggac
900agcgtaacgg ttagcatagt gagtagcaac tcagcaacgt catgtacact ggcccgcaag
960ataaaaccaa aattcgtggg acgggaaaaa tatgatctac ctcccgttca cggtaaaaaa
1020attccttgca cagtgtacga ccgtctggca gcaacaactg caggctacat cactatgcac
1080aggccgagac cgcacgctta tacatcctac ctggaagaat catcagggaa agtttacgca
1140aagccgccat ctgggaagaa cattacgtat gagtgcaagt gcggcgacta caagaccgga
1200accgtttcga cccgcaccga aatcactggt tgcaccgcca tcaagcagtg cgtcgcctat
1260aagagcgacc aaacgaagtg ggtcttcaac tcaccggact tgatcagaca tgacgaccac
1320acggcccaag ggaaattgca tttgcctttc aagttgatcc cgagtacctg catggtccct
1380gttgcccacg cgccgaatgt aatacatggc tttaaacaca tcagcctcca attagataca
1440gaccacttga cattgctcac caccaggaga ctaggggcaa acccggaacc aaccactgaa
1500tggatcgtcg gaaagacggt cagaaacttc accgtcgacc gagatggcct ggaatacata
1560tggggaaatc atgagccagt gagggtctat gcccaagagt cagcaccagg agaccctcac
1620ggatggccac acgaaatagt acagcattac taccatcgcc atcctgtgta caccatctta
1680gccgtcgcat cagctaccgt ggcgatgatg attggcgtaa ctgttgcagt gttatgtgcc
1740tgtaaagcgc gccgtgagtg cctgacgcca tacgccctgg ccccaaacgc cgtaatccca
1800acttcgctgg cactcttgtg ctgcgttagg tcggccaatg ctgaaacgtt caccgagacc
1860atgagttact tgtggtcgaa cagtcagccg ttcttctggg tccagttgtg catacctttg
1920gccgctttca tcgttctaat gcgctgctgc tcctgctgcc tgcctttttt agtggttgcc
1980ggcgcctacc tggcgaaggt agacgcctac gaacatgcga ccactgttcc aaatgtgcca
2040cagataccgt ataaggcact tgttgaaagg gcagggtatg ccccgctcaa tttggagatc
2100actgtcatgt cctcggaggt tttgccttcc accaaccaag agtacattac ctgcaaattc
2160accactgtgg tcccctcccc aaaaatcaaa tgctgcggct ccttggaatg tcagccggcc
2220gctcatgcag actatacctg caaggtcttc ggaggggtct acccctttat gtggggagga
2280gcgcaatgtt tttgcgacag tgagaacagc cagatgagtg aggcgtacgt cgaattgtca
2340gcagattgcg cgtctgacca cgcgcaggcg attaaggtgc acactgccgc gatgaaagta
2400ggactgcgta ttgtgtacgg gaacactacc agtttcctag atgtgtacgt gaacggagtc
2460acaccaggaa cgtctaaaga cttgaaagtc atagctggac caatttcagc atcgtttacg
2520ccattcgatc ataaggtcgt tatccatcgc ggcctggtgt acaactatga cttcccggaa
2580tatggagcga tgaaaccagg agcgtttgga gacattcaag ctacctcctt gactagcaag
2640gatctcatcg ccagcacaga cattaggcta ctcaagcctt ccgccaagaa cgtgcatgtc
2700ccgtacacgc aggcctcatc aggatttgag atgtggaaaa acaactcagg ccgcccactg
2760caggaaaccg cacctttcgg gtgtaagatt gcagtaaatc cgctccgagc ggtggactgt
2820tcatacggga acattcccat ttctattgac atcccgaacg ctgcctttat caggacatca
2880gatgcaccac tggtctcaac agtcaaatgt gaagtcagtg agtgcactta ttcagcagac
2940ttcggcggga tggccaccct gcagtatgta tccgaccgcg aaggtcaatg ccccgtacat
3000tcgcattcga gcacagcaac tctccaagag tcgacagtac atgtcctgga gaaaggagcg
3060gtgacagtac actttagcac cgcgagtcca caggcgaact ttatcgtatc gctgtgtggg
3120aagaagacaa catgcaatgc agaatgtaaa ccaccagctg accatatcgt gagcaccccg
3180cacaaaaatg accaagaatt tcaagccgcc atctcaaaaa catcatggag ttggctgttt
3240gcccttttcg gcggcgcctc gtcgctatta attataggac ttatgatttt tgcttgcagc
3300atgatgctga ctagcacacg aagatga
332741108PRTSindbis virusm168 Sindbis virus ZZ envelope protein mutant
4Met Ala Ser Ala Ala Pro Leu Val Thr Ala Met Cys Leu Leu Gly Asn1
5 10 15Val Ser Phe Pro Cys Asp
Arg Pro Pro Thr Cys Tyr Thr Arg Glu Pro20 25
30Ser Arg Ala Leu Asp Ile Leu Glu Glu Asn Val Asn His Glu Ala Tyr35
40 45Asp Thr Leu Leu Asn Ala Ile Leu Arg
Cys Gly Ser Ser Gly Ser Val50 55 60Ile
Asp Asp Phe Thr Leu Thr Ser Pro Tyr Leu Gly Thr Cys Ser Tyr65
70 75 80Cys His His Thr Val Pro
Cys Phe Ser Pro Val Lys Ile Glu Gln Val85 90
95Trp Asp Glu Ala Asp Asp Asn Thr Ile Arg Ile Gln Thr Ser Ala Gln100
105 110Phe Gly Tyr Asp Gln Ser Gly Ala
Ala Ser Ala Asn Lys Tyr Arg Tyr115 120
125Met Ala Ala Ala Ala Val Thr Asp Asn Lys Phe Asn Lys Glu Gln Gln130
135 140Asn Ala Phe Tyr Glu Ile Leu His Leu
Pro Asn Leu Asn Glu Glu Gln145 150 155
160Arg Asn Ala Phe Ile Gln Ser Leu Lys Asp Asp Pro Ser Gln
Ser Ala165 170 175Asn Leu Leu Ala Glu Ala
Lys Lys Leu Asn Asp Ala Gln Ala Pro Lys180 185
190Val Asp Asn Lys Phe Asn Lys Glu Gln Gln Asn Ala Phe Tyr Glu
Ile195 200 205Leu His Leu Pro Asn Leu Asn
Glu Glu Gln Arg Asn Ala Phe Ile Gln210 215
220Ser Leu Lys Asp Asp Pro Ser Gln Ser Ala Asn Leu Leu Ala Glu Ala225
230 235 240Lys Lys Leu Asn
Asp Ala Gln Ala Pro Lys Val Asp Ala Asn Ser Ser245 250
255Ser Val Pro Gly Asp Pro Val Thr Thr Val Lys Glu Gly Thr
Met Asp260 265 270Asp Ile Lys Ile Ser Thr
Ser Gly Pro Cys Arg Arg Leu Ser Tyr Lys275 280
285Gly Tyr Phe Leu Leu Ala Lys Cys Pro Pro Gly Asp Ser Val Thr
Val290 295 300Ser Ile Val Ser Ser Asn Ser
Ala Thr Ser Cys Thr Leu Ala Arg Lys305 310
315 320Ile Lys Pro Lys Phe Val Gly Arg Glu Lys Tyr Asp
Leu Pro Pro Val325 330 335His Gly Lys Lys
Ile Pro Cys Thr Val Tyr Asp Arg Leu Ala Ala Thr340 345
350Thr Ala Gly Tyr Ile Thr Met His Arg Pro Arg Pro His Ala
Tyr Thr355 360 365Ser Tyr Leu Glu Glu Ser
Ser Gly Lys Val Tyr Ala Lys Pro Pro Ser370 375
380Gly Lys Asn Ile Thr Tyr Glu Cys Lys Cys Gly Asp Tyr Lys Thr
Gly385 390 395 400Thr Val
Ser Thr Arg Thr Glu Ile Thr Gly Cys Thr Ala Ile Lys Gln405
410 415Cys Val Ala Tyr Lys Ser Asp Gln Thr Lys Trp Val
Phe Asn Ser Pro420 425 430Asp Leu Ile Arg
His Asp Asp His Thr Ala Gln Gly Lys Leu His Leu435 440
445Pro Phe Lys Leu Ile Pro Ser Thr Cys Met Val Pro Val Ala
His Ala450 455 460Pro Asn Val Ile His Gly
Phe Lys His Ile Ser Leu Gln Leu Asp Thr465 470
475 480Asp His Leu Thr Leu Leu Thr Thr Arg Arg Leu
Gly Ala Asn Pro Glu485 490 495Pro Thr Thr
Glu Trp Ile Val Gly Lys Thr Val Arg Asn Phe Thr Val500
505 510Asp Arg Asp Gly Leu Glu Tyr Ile Trp Gly Asn His
Glu Pro Val Arg515 520 525Val Tyr Ala Gln
Glu Ser Ala Pro Gly Asp Pro His Gly Trp Pro His530 535
540Glu Ile Val Gln His Tyr Tyr His Arg His Pro Val Tyr Thr
Ile Leu545 550 555 560Ala
Val Ala Ser Ala Thr Val Ala Met Met Ile Gly Val Thr Val Ala565
570 575Val Leu Cys Ala Cys Lys Ala Arg Arg Glu Cys
Leu Thr Pro Tyr Ala580 585 590Leu Ala Pro
Asn Ala Val Ile Pro Thr Ser Leu Ala Leu Leu Cys Cys595
600 605Val Arg Ser Ala Asn Ala Glu Thr Phe Thr Glu Thr
Met Ser Tyr Leu610 615 620Trp Ser Asn Ser
Gln Pro Phe Phe Trp Val Gln Leu Cys Ile Pro Leu625 630
635 640Ala Ala Phe Ile Val Leu Met Arg Cys
Cys Ser Cys Cys Leu Pro Phe645 650 655Leu
Val Val Ala Gly Ala Tyr Leu Ala Lys Val Asp Ala Tyr Glu His660
665 670Ala Thr Thr Val Pro Asn Val Pro Gln Ile Pro
Tyr Lys Ala Leu Val675 680 685Glu Arg Ala
Gly Tyr Ala Pro Leu Asn Leu Glu Ile Thr Val Met Ser690
695 700Ser Glu Val Leu Pro Ser Thr Asn Gln Glu Tyr Ile
Thr Cys Lys Phe705 710 715
720Thr Thr Val Val Pro Ser Pro Lys Ile Lys Cys Cys Gly Ser Leu Glu725
730 735Cys Gln Pro Ala Ala His Ala Asp Tyr
Thr Cys Lys Val Phe Gly Gly740 745 750Val
Tyr Pro Phe Met Trp Gly Gly Ala Gln Cys Phe Cys Asp Ser Glu755
760 765Asn Ser Gln Met Ser Glu Ala Tyr Val Glu Leu
Ser Ala Asp Cys Ala770 775 780Ser Asp His
Ala Gln Ala Ile Lys Val His Thr Ala Ala Met Lys Val785
790 795 800Gly Leu Arg Ile Val Tyr Gly
Asn Thr Thr Ser Phe Leu Asp Val Tyr805 810
815Val Asn Gly Val Thr Pro Gly Thr Ser Lys Asp Leu Lys Val Ile Ala820
825 830Gly Pro Ile Ser Ala Ser Phe Thr Pro
Phe Asp His Lys Val Val Ile835 840 845His
Arg Gly Leu Val Tyr Asn Tyr Asp Phe Pro Glu Tyr Gly Ala Met850
855 860Lys Pro Gly Ala Phe Gly Asp Ile Gln Ala Thr
Ser Leu Thr Ser Lys865 870 875
880Asp Leu Ile Ala Ser Thr Asp Ile Arg Leu Leu Lys Pro Ser Ala
Lys885 890 895Asn Val His Val Pro Tyr Thr
Gln Ala Ser Ser Gly Phe Glu Met Trp900 905
910Lys Asn Asn Ser Gly Arg Pro Leu Gln Glu Thr Ala Pro Phe Gly Cys915
920 925Lys Ile Ala Val Asn Pro Leu Arg Ala
Val Asp Cys Ser Tyr Gly Asn930 935 940Ile
Pro Ile Ser Ile Asp Ile Pro Asn Ala Ala Phe Ile Arg Thr Ser945
950 955 960Asp Ala Pro Leu Val Ser
Thr Val Lys Cys Glu Val Ser Glu Cys Thr965 970
975Tyr Ser Ala Asp Phe Gly Gly Met Ala Thr Leu Gln Tyr Val Ser
Asp980 985 990Arg Glu Gly Gln Cys Pro Val
His Ser His Ser Ser Thr Ala Thr Leu995 1000
1005Gln Glu Ser Thr Val His Val Leu Glu Lys Gly Ala Val Thr Val His1010
1015 1020Phe Ser Thr Ala Ser Pro Gln Ala Asn
Phe Ile Val Ser Leu Cys Gly1025 1030 1035
1040Lys Lys Thr Thr Cys Asn Ala Glu Cys Lys Pro Pro Ala Asp
His Ile1045 1050 1055Val Ser Thr Pro His
Lys Asn Asp Gln Glu Phe Gln Ala Ala Ile Ser1060 1065
1070Lys Thr Ser Trp Ser Trp Leu Phe Ala Leu Phe Gly Gly Ala Ser
Ser1075 1080 1085Leu Leu Ile Ile Gly Leu
Met Ile Phe Ala Cys Ser Met Met Leu Thr1090 1095
1100Ser Thr Arg Arg110553327DNASindbis virusm168 mutant (E1
AK226-227SG) Sindbis virus ZZ envelope protein mutant, m168 with
mutation in E1 domain 5atggcgtccg cagcaccact ggtcacggca atgtgtttgc
tcggaaatgt gagcttccca 60tgcgaccgcc cgcccacatg ctatacccgc gaaccttcca
gagccctcga catccttgaa 120gagaacgtga accatgaggc ctacgatacc ctgctcaatg
ccatattgcg gtgcggatcg 180tctggcagcg tcattgacga ctttaccctg accagcccct
acttgggcac atgctcgtac 240tgccaccata ctgtaccgtg cttcagccct gttaagatcg
agcaggtctg ggacgaagcg 300gacgataaca ccatacgcat acagacttcc gcccagtttg
gatacgacca aagcggagca 360gcaagcgcaa acaagtaccg ctacatggcg gctgcggcgg
taaccgacaa caaattcaac 420aaagaacaac aaaacgcgtt ctatgagatc ttacatttac
ctaacttaaa cgaagaacaa 480cgaaacgcct tcatccaaag tttaaaagat gacccaagcc
aaagcgctaa ccttttagca 540gaagctaaaa agctaaatga tgctcaggcg ccgaaagtag
acaacaaatt caacaaagaa 600caacaaaacg cgttctatga gatcttacat ttacctaact
taaacgaaga acaacgaaac 660gccttcatcc aaagtttaaa agatgaccca agccaaagcg
ctaacctttt agcagaagct 720aaaaagctaa atgatgctca ggcgccgaaa gtagacgcga
attcgagctc ggtacccggg 780gatccggtaa ccaccgttaa agaaggcacc atggatgaca
tcaagattag cacctcagga 840ccgtgtagaa ggcttagcta caaaggatac tttctcctcg
caaaatgccc tccaggggac 900agcgtaacgg ttagcatagt gagtagcaac tcagcaacgt
catgtacact ggcccgcaag 960ataaaaccaa aattcgtggg acgggaaaaa tatgatctac
ctcccgttca cggtaaaaaa 1020attccttgca cagtgtacga ccgtctggca gcaacaactg
caggctacat cactatgcac 1080aggccgagac cgcacgctta tacatcctac ctggaagaat
catcagggaa agtttacgca 1140aagccgccat ctgggaagaa cattacgtat gagtgcaagt
gcggcgacta caagaccgga 1200accgtttcga cccgcaccga aatcactggt tgcaccgcca
tcaagcagtg cgtcgcctat 1260aagagcgacc aaacgaagtg ggtcttcaac tcaccggact
tgatcagaca tgacgaccac 1320acggcccaag ggaaattgca tttgcctttc aagttgatcc
cgagtacctg catggtccct 1380gttgcccacg cgccgaatgt aatacatggc tttaaacaca
tcagcctcca attagataca 1440gaccacttga cattgctcac caccaggaga ctaggggcaa
acccggaacc aaccactgaa 1500tggatcgtcg gaaagacggt cagaaacttc accgtcgacc
gagatggcct ggaatacata 1560tggggaaatc atgagccagt gagggtctat gcccaagagt
cagcaccagg agaccctcac 1620ggatggccac acgaaatagt acagcattac taccatcgcc
atcctgtgta caccatctta 1680gccgtcgcat cagctaccgt ggcgatgatg attggcgtaa
ctgttgcagt gttatgtgcc 1740tgtaaagcgc gccgtgagtg cctgacgcca tacgccctgg
ccccaaacgc cgtaatccca 1800acttcgctgg cactcttgtg ctgcgttagg tcggccaatg
ctgaaacgtt caccgagacc 1860atgagttact tgtggtcgaa cagtcagccg ttcttctggg
tccagttgtg catacctttg 1920gccgctttca tcgttctaat gcgctgctgc tcctgctgcc
tgcctttttt agtggttgcc 1980ggcgcctacc tggcgaaggt agacgcctac gaacatgcga
ccactgttcc aaatgtgcca 2040cagataccgt ataaggcact tgttgaaagg gcagggtatg
ccccgctcaa tttggagatc 2100actgtcatgt cctcggaggt tttgccttcc accaaccaag
agtacattac ctgcaaattc 2160accactgtgg tcccctcccc aaaaatcaaa tgctgcggct
ccttggaatg tcagccggcc 2220gctcatgcag actatacctg caaggtcttc ggaggggtct
acccctttat gtggggagga 2280gcgcaatgtt tttgcgacag tgagaacagc cagatgagtg
aggcgtacgt cgaattgtca 2340gcagattgcg cgtctgacca cgcgcaggcg attaaggtgc
acactgccgc gatgaaagta 2400ggactgcgta ttgtgtacgg gaacactacc agtttcctag
atgtgtacgt gaacggagtc 2460acaccaggaa cgtctaaaga cttgaaagtc atagctggac
caatttcagc atcgtttacg 2520ccattcgatc ataaggtcgt tatccatcgc ggcctggtgt
acaactatga cttcccggaa 2580tatggagcga tgaaaccagg agcgtttgga gacattcaag
ctacctcctt gactagcaag 2640gatctcatcg ccagcacaga cattaggcta ctcaagcctt
cctccgggaa cgtgcatgtc 2700ccgtacacgc aggcctcatc aggatttgag atgtggaaaa
acaactcagg ccgcccactg 2760caggaaaccg cacctttcgg gtgtaagatt gcagtaaatc
cgctccgagc ggtggactgt 2820tcatacggga acattcccat ttctattgac atcccgaacg
ctgcctttat caggacatca 2880gatgcaccac tggtctcaac agtcaaatgt gaagtcagtg
agtgcactta ttcagcagac 2940ttcggcggga tggccaccct gcagtatgta tccgaccgcg
aaggtcaatg ccccgtacat 3000tcgcattcga gcacagcaac tctccaagag tcgacagtac
atgtcctgga gaaaggagcg 3060gtgacagtac actttagcac cgcgagtcca caggcgaact
ttatcgtatc gctgtgtggg 3120aagaagacaa catgcaatgc agaatgtaaa ccaccagctg
accatatcgt gagcaccccg 3180cacaaaaatg accaagaatt tcaagccgcc atctcaaaaa
catcatggag ttggctgttt 3240gcccttttcg gcggcgcctc gtcgctatta attataggac
ttatgatttt tgcttgcagc 3300atgatgctga ctagcacacg aagatga
332761108PRTSindbis virusm168 mutant (E1
AK226-227SG) Sindbis virus ZZ envelope protein mutant, m168 with
mutation in E1 domain 6Met Ala Ser Ala Ala Pro Leu Val Thr Ala Met Cys
Leu Leu Gly Asn1 5 10
15Val Ser Phe Pro Cys Asp Arg Pro Pro Thr Cys Tyr Thr Arg Glu Pro20
25 30Ser Arg Ala Leu Asp Ile Leu Glu Glu Asn
Val Asn His Glu Ala Tyr35 40 45Asp Thr
Leu Leu Asn Ala Ile Leu Arg Cys Gly Ser Ser Gly Ser Val50
55 60Ile Asp Asp Phe Thr Leu Thr Ser Pro Tyr Leu Gly
Thr Cys Ser Tyr65 70 75
80Cys His His Thr Val Pro Cys Phe Ser Pro Val Lys Ile Glu Gln Val85
90 95Trp Asp Glu Ala Asp Asp Asn Thr Ile Arg
Ile Gln Thr Ser Ala Gln100 105 110Phe Gly
Tyr Asp Gln Ser Gly Ala Ala Ser Ala Asn Lys Tyr Arg Tyr115
120 125Met Ala Ala Ala Ala Val Thr Asp Asn Lys Phe Asn
Lys Glu Gln Gln130 135 140Asn Ala Phe Tyr
Glu Ile Leu His Leu Pro Asn Leu Asn Glu Glu Gln145 150
155 160Arg Asn Ala Phe Ile Gln Ser Leu Lys
Asp Asp Pro Ser Gln Ser Ala165 170 175Asn
Leu Leu Ala Glu Ala Lys Lys Leu Asn Asp Ala Gln Ala Pro Lys180
185 190Val Asp Asn Lys Phe Asn Lys Glu Gln Gln Asn
Ala Phe Tyr Glu Ile195 200 205Leu His Leu
Pro Asn Leu Asn Glu Glu Gln Arg Asn Ala Phe Ile Gln210
215 220Ser Leu Lys Asp Asp Pro Ser Gln Ser Ala Asn Leu
Leu Ala Glu Ala225 230 235
240Lys Lys Leu Asn Asp Ala Gln Ala Pro Lys Val Asp Ala Asn Ser Ser245
250 255Ser Val Pro Gly Asp Pro Val Thr Thr
Val Lys Glu Gly Thr Met Asp260 265 270Asp
Ile Lys Ile Ser Thr Ser Gly Pro Cys Arg Arg Leu Ser Tyr Lys275
280 285Gly Tyr Phe Leu Leu Ala Lys Cys Pro Pro Gly
Asp Ser Val Thr Val290 295 300Ser Ile Val
Ser Ser Asn Ser Ala Thr Ser Cys Thr Leu Ala Arg Lys305
310 315 320Ile Lys Pro Lys Phe Val Gly
Arg Glu Lys Tyr Asp Leu Pro Pro Val325 330
335His Gly Lys Lys Ile Pro Cys Thr Val Tyr Asp Arg Leu Ala Ala Thr340
345 350Thr Ala Gly Tyr Ile Thr Met His Arg
Pro Arg Pro His Ala Tyr Thr355 360 365Ser
Tyr Leu Glu Glu Ser Ser Gly Lys Val Tyr Ala Lys Pro Pro Ser370
375 380Gly Lys Asn Ile Thr Tyr Glu Cys Lys Cys Gly
Asp Tyr Lys Thr Gly385 390 395
400Thr Val Ser Thr Arg Thr Glu Ile Thr Gly Cys Thr Ala Ile Lys
Gln405 410 415Cys Val Ala Tyr Lys Ser Asp
Gln Thr Lys Trp Val Phe Asn Ser Pro420 425
430Asp Leu Ile Arg His Asp Asp His Thr Ala Gln Gly Lys Leu His Leu435
440 445Pro Phe Lys Leu Ile Pro Ser Thr Cys
Met Val Pro Val Ala His Ala450 455 460Pro
Asn Val Ile His Gly Phe Lys His Ile Ser Leu Gln Leu Asp Thr465
470 475 480Asp His Leu Thr Leu Leu
Thr Thr Arg Arg Leu Gly Ala Asn Pro Glu485 490
495Pro Thr Thr Glu Trp Ile Val Gly Lys Thr Val Arg Asn Phe Thr
Val500 505 510Asp Arg Asp Gly Leu Glu Tyr
Ile Trp Gly Asn His Glu Pro Val Arg515 520
525Val Tyr Ala Gln Glu Ser Ala Pro Gly Asp Pro His Gly Trp Pro His530
535 540Glu Ile Val Gln His Tyr Tyr His Arg
His Pro Val Tyr Thr Ile Leu545 550 555
560Ala Val Ala Ser Ala Thr Val Ala Met Met Ile Gly Val Thr
Val Ala565 570 575Val Leu Cys Ala Cys Lys
Ala Arg Arg Glu Cys Leu Thr Pro Tyr Ala580 585
590Leu Ala Pro Asn Ala Val Ile Pro Thr Ser Leu Ala Leu Leu Cys
Cys595 600 605Val Arg Ser Ala Asn Ala Glu
Thr Phe Thr Glu Thr Met Ser Tyr Leu610 615
620Trp Ser Asn Ser Gln Pro Phe Phe Trp Val Gln Leu Cys Ile Pro Leu625
630 635 640Ala Ala Phe Ile
Val Leu Met Arg Cys Cys Ser Cys Cys Leu Pro Phe645 650
655Leu Val Val Ala Gly Ala Tyr Leu Ala Lys Val Asp Ala Tyr
Glu His660 665 670Ala Thr Thr Val Pro Asn
Val Pro Gln Ile Pro Tyr Lys Ala Leu Val675 680
685Glu Arg Ala Gly Tyr Ala Pro Leu Asn Leu Glu Ile Thr Val Met
Ser690 695 700Ser Glu Val Leu Pro Ser Thr
Asn Gln Glu Tyr Ile Thr Cys Lys Phe705 710
715 720Thr Thr Val Val Pro Ser Pro Lys Ile Lys Cys Cys
Gly Ser Leu Glu725 730 735Cys Gln Pro Ala
Ala His Ala Asp Tyr Thr Cys Lys Val Phe Gly Gly740 745
750Val Tyr Pro Phe Met Trp Gly Gly Ala Gln Cys Phe Cys Asp
Ser Glu755 760 765Asn Ser Gln Met Ser Glu
Ala Tyr Val Glu Leu Ser Ala Asp Cys Ala770 775
780Ser Asp His Ala Gln Ala Ile Lys Val His Thr Ala Ala Met Lys
Val785 790 795 800Gly Leu
Arg Ile Val Tyr Gly Asn Thr Thr Ser Phe Leu Asp Val Tyr805
810 815Val Asn Gly Val Thr Pro Gly Thr Ser Lys Asp Leu
Lys Val Ile Ala820 825 830Gly Pro Ile Ser
Ala Ser Phe Thr Pro Phe Asp His Lys Val Val Ile835 840
845His Arg Gly Leu Val Tyr Asn Tyr Asp Phe Pro Glu Tyr Gly
Ala Met850 855 860Lys Pro Gly Ala Phe Gly
Asp Ile Gln Ala Thr Ser Leu Thr Ser Lys865 870
875 880Asp Leu Ile Ala Ser Thr Asp Ile Arg Leu Leu
Lys Pro Ser Ser Gly885 890 895Asn Val His
Val Pro Tyr Thr Gln Ala Ser Ser Gly Phe Glu Met Trp900
905 910Lys Asn Asn Ser Gly Arg Pro Leu Gln Glu Thr Ala
Pro Phe Gly Cys915 920 925Lys Ile Ala Val
Asn Pro Leu Arg Ala Val Asp Cys Ser Tyr Gly Asn930 935
940Ile Pro Ile Ser Ile Asp Ile Pro Asn Ala Ala Phe Ile Arg
Thr Ser945 950 955 960Asp
Ala Pro Leu Val Ser Thr Val Lys Cys Glu Val Ser Glu Cys Thr965
970 975Tyr Ser Ala Asp Phe Gly Gly Met Ala Thr Leu
Gln Tyr Val Ser Asp980 985 990Arg Glu Gly
Gln Cys Pro Val His Ser His Ser Ser Thr Ala Thr Leu995
1000 1005Gln Glu Ser Thr Val His Val Leu Glu Lys Gly Ala
Val Thr Val His1010 1015 1020Phe Ser Thr
Ala Ser Pro Gln Ala Asn Phe Ile Val Ser Leu Cys Gly1025
1030 1035 1040Lys Lys Thr Thr Cys Asn Ala
Glu Cys Lys Pro Pro Ala Asp His Ile1045 1050
1055Val Ser Thr Pro His Lys Asn Asp Gln Glu Phe Gln Ala Ala Ile Ser1060
1065 1070Lys Thr Ser Trp Ser Trp Leu Phe Ala
Leu Phe Gly Gly Ala Ser Ser1075 1080
1085Leu Leu Ile Ile Gly Leu Met Ile Phe Ala Cys Ser Met Met Leu Thr1090
1095 1100Ser Thr Arg Arg1105715DNAArtificial
SequenceDescription of Artificial Sequencem168 sequence modified
for mutant (E1 AK226-227SG) Sindbis virus ZZ envelope protein
mutant, m168 with mutation in E1 domain 7aagccttccg ccaag
15815DNAArtificial
SequenceDescription of Artificial Sequencem168 sequence modified in
mutant (E1 AK226-227SG) Sindbis virus ZZ envelope protein mutant,
m168 with mutation in E1 domain 8aagccttcct ccggg
1599PRTArtificial SequenceDescription of
Artificial Sequencesynthetic integrin binding sequence "4C-RGD" 9Cys
Asp Cys Arg Gly Asp Cys Phe Cys1 51027DNAArtificial
SequenceDescription of Artificial Sequencesynthetic integrin binding
sequence "4C-RGD" 10tgcgactgta gaggcgactg tttctgc
27119PRTArtificial SequenceDescription of Artificial
Sequencesynthetic transferrin receptor targeting sequence "B6" 11Gly
His Lys Ala Lys Gly Pro Arg Lys1 51227DNAArtificial
SequenceDescription of Artificial Sequencesynthetic transferrin
receptor targeting sequence "B6" 12ggacataaag ctaagggtcc tagaaag
271320DNAArtificial SequenceDescription of
Artificial SequenceFluc-a PCR primer for analysis of vector copy
number (Firefly Luciferase) 13gagatacgcc ctggttcctg
201423DNAArtificial SequenceDescription of
Artificial SequenceFluc-b PCR primer for analysis of vector copy
number (Firefly Luciferase) 14gcatacgacg attctgtgat ttg
231522DNAArtificial SequenceDescription of
Artificial Sequencebeta-actin-F PCR primer for analysis of cell
number (mouse beta actin) 15caactccatc atgaagtgtg ac
221621DNAArtificial SequenceDescription of
Artificial Sequencebeta-actin-R PCR primer for analysis of cell
number (mouse beta actin) 16ccacacggag tacttgcgct c
21
User Contributions:
Comment about this patent or add new information about this topic: