Patent application title: ALPHA-GLUCANASE AND ORAL CARE COMPOSITION CONTAINING THE SAME
Inventors:
Steven Kim (Fremont, CA, US)
Suzanne Lantz (San Carlos, CA, US)
Michael Pepsin (Castro Valley, CA, US)
Assignees:
DANISCO US INC.
IPC8 Class: AA61K866FI
USPC Class:
424 50
Class name: Drug, bio-affecting and body treating compositions dentifrices (includes mouth wash) ferment containing (e.g., enzymes, bacteria, etc.)
Publication date: 2014-08-21
Patent application number: 20140234231
Abstract:
Isolated α-glucanases from Hypocrea tawa, Trichoderma reesei, and
Trichoderma konilangbra are described, as well as oral care compositions
containing the same. The oral care composition may be employed to prevent
or reduce dental plaque.Claims:
1. An isolated α-glucanase comprising an amino acid sequence that
is: a) at least 99% identical to the mature Hypocrea tawa
α-glucanase (amino acid residues 38-635 of SEQ ID NO: 1); or b) at
least 85% identical to the mature Trichoderma konilangbra
α-glucanase (amino acid residues 38-627 of SEQ ID NO: 3).
2. An isolated polynucleotide encoding an isolated α-glucanase of claim 1.
3. A recombinant nucleic acid comprising the isolated polynucleotide of claim 2.
4. A vector comprising the recombinant nucleic acid of claim 3.
5. A host cell comprising the recombinant nucleic acid of claim 3.
6. A cell culture comprising: a) growth medium; and b) a population of cells of claim 5.
7. A method of producing protein comprising: maintaining the culture of cells of claim 6 under conditions suitable for production of said isolated α-glucanase.
8. The method of claim 7, further comprising harvesting said α-glucanase from said growth medium.
9. A method comprising receiving an isolated α-glucanase selected from the following: a) α-glucanase having an amino acid sequence that is at least 99% identical to that of mature Hypocrea tawa α-glucanase (amino acid residues 38-635 of SEQ ID NO: 1); b) α-glucanase having an amino acid sequence that is at least 85% identical to that of mature Trichoderma reesei α-glucanase (amino acid residues 38-622 of SEQ ID NO: 2); or c) α-glucanase having an amino acid sequence that is at least 85% identical to that of mature Trichoderma konilangbra α-glucanase (amino acid residues 38-627 of SEQ ID NO: 3); and admixing said isolated α-glucanase with an orally acceptable excipient to make an oral care composition.
10. The method of claim 9, further comprising: packaging said oral care composition.
11. The method of claim 1, wherein the α-glucanase is not identical to Trichoderma reesei α-glucanase (amino acid residues 38-622 of SEQ ID NO: 2).
12. An oral care composition comprising: a) an orally acceptable excipient; and b) an isolated α-glucanase of claim 1.
13. An oral care composition comprising: an orally acceptable excipient; and an isolated α-glucanase selected from the following: a) α-glucanase having an amino acid sequence that is at least 99% identical to that of mature Hypocrea tawa α-glucanase (amino acid residues 38-635 of SEQ ID NO: 1); b) α-glucanase having an amino acid sequence that is at least 85% identical to that of mature Trichoderma reesei α-glucanase (amino acid residues 38-622 of SEQ ID NO: 2); or c) α-glucanase having an amino acid sequence that is at least 85% identical to that of mature Trichoderma konilangbra α-glucanase (amino acid residues 38-627 of SEQ ID NO: 3).
14. The composition of claim 13, wherein the α-glucanase is not identical to Trichoderma reesei α-glucanase (amino acid residues 38-622 of SEQ ID NO: 2).
15. The oral care composition of claim 12, wherein said α-glucanase is present in said composition at a concentration of 0.0001% to 5% by weight of said composition.
16. The oral care composition of claim 12, further comprising a second enzyme.
17. The oral care composition of claim 16, wherein said second enzyme is a deaminase, esterase, glycosidase, lipase, oxidase, peroxidase, protease, urease or cellulase.
18. The oral care composition of claim 12, wherein said composition is formulated as a toothpaste.
19. The oral care composition of claim 12, wherein said composition comprises at least one of a thickener, a surfactant, a humectant, and an abrasive.
20. A method comprising: contacting the oral care composition of claim 12 with a tooth under conditions suitable for activity of said α-glucanase.
21. The method of claim 20, wherein said contacting is performed using a toothbrush.
22. The method of claim 20, wherein said method results in prevention and/or reduction in dental plaque.
Description:
PRIORITY
[0001] The present application is a divisional of U.S. patent application Ser. No. 12/937,362, filed May 26, 2011, now U.S. Pat. No. 8,709,386, which is a U.S. National Phase Application of International Application No. PCT/US2009/040013, filed Apr. 9, 2009, which claims priority to U.S. Provisional Application Ser. No. 61/044,316, filed on Apr. 11, 2008, which are incorporated by reference in their its entirety.
SEQUENCE LISTING
[0002] The sequence listing submitted via EFS, in compliance with 37 C.F.R. §1.52(e), is incorporated herein by reference. The sequence listing text file submitted via EFS contains the file "31149US-D1_SequenceListing.txt" created on Feb. 21, 2014, which is 53,951 bytes in size.
BACKGROUND
[0003] The formation of dental plaque leads to dental caries, gingival inflammation, periodontal disease, and eventually tooth loss. Dental plaque is a mixture of bacteria, epithelial cells, leukocytes, macrophages, and other oral exudate. The bacteria produce highly branched polysaccharides, which, together with micro-organisms from the oral cavity, form an adhesive matrix for the continued proliferation of dental plaque.
[0004] As dental plaque continues to accumulate, rock-hard white or yellowish deposits arise. These deposits are called calcified plaque, calculus, or tartar, and are formed in the saliva from plaque and minerals, e.g., calcium.
[0005] There is an ongoing need for new ways to prevent and/or reduce dental plaque and associated tooth decay.
SUMMARY
[0006] In one aspect, an isolated α-glucanase is provided, comprising an amino acid sequence that is (a) at least 99% identical to the mature Hypocrea tawa α-glucanase (amino acid residues 38-635 of SEQ ID NO: 1); or (b) at least 85% identical to the mature Trichoderma konilangbra α-glucanase (amino acid residues 38-627 of SEQ ID NO: 3).
[0007] In another aspect, an isolated polynucleotide encoding a subject α-glucanase, and recombinant nucleic acid containing the isolated polynucleotide is provided. A vector and a host cell containing the recombinant nucleic acid are also provided.
[0008] In another aspect, a cell culture is provided. In some embodiments, the cell culture contains a growth medium and a population of the above-described host cells. The cell culture may be used to produce a subject α-glucanase by maintaining the cell culture under conditions suitable for production of the isolated α-glucanase. If the α-glucanase is secreted, it may be harvested from the growth medium.
[0009] In another aspect, a method of producing protein is provided, comprising maintaining the culture of cells described above under conditions suitable for production of the isolated α-glucanase. In some embodiments, the method further comprises harvesting the α-glucanase from the growth medium.
[0010] In another aspect, a method is provided, comprising receiving an isolated α-glucanase selected from the following: (a) α-glucanase having an amino acid sequence that is at least 99% identical to that of mature Hypocrea tawa α-glucanase (amino acid residues 38-635 of SEQ ID NO: 1); (b) α-glucanase having an amino acid sequence that is at least 85% identical to that of mature Trichoderma reesei α-glucanase (amino acid residues 38-622 of SEQ ID NO: 2); or (c) α-glucanase having an amino acid sequence that is at least 85% identical to that of mature Trichoderma konilangbra α-glucanase (amino acid residues 38-627 of SEQ ID NO: 3); and admixing the isolated α-glucanase with an orally acceptable excipient to make an oral care composition. In some embodiments, the α-glucanase is not identical to Trichoderma reesei α-glucanase (amino acid residues 38-622 of SEQ ID NO: 2). In some embodiments, the method further comprises packaging the oral care composition.
[0011] In another aspect, an oral care composition is provided, comprising (a) an orally acceptable excipient; and (b) an isolated α-glucanase.
[0012] In a related aspect, an oral care composition is provided, comprising: an orally acceptable excipient and an isolated α-glucanase selected from the following: (a) α-glucanase having an amino acid sequence that is at least 99% identical to that of mature Hypocrea tawa α-glucanase (amino acid residues 38-635 of SEQ ID NO: 1); (b) α-glucanase having an amino acid sequence that is at least 85% identical to that of mature Trichoderma reesei α-glucanase (amino acid residues 38-622 of SEQ ID NO: 2); or (c) α-glucanase having an amino acid sequence that is at least 85% identical to that of mature Trichoderma konilangbra α-glucanase (amino acid residues 38-627 of SEQ ID NO: 3). In some embodiments, the α-glucanase is not identical to Trichoderma reesei α-glucanase (amino acid residues 38-622 of SEQ ID NO: 2).
[0013] In some embodiments, the α-glucanase is present in the composition at a concentration of 0.0001% to 5% by weight of the composition.
[0014] In some embodiments, the oral care composition further comprises a second enzyme. In particular embodiments, the second enzyme is a deaminase, esterase, glycosidase, lipase, oxidase, peroxidase, protease, urease or cellulase.
[0015] In some embodiments, the composition is formulated as a toothpaste, although other oral care formulations are envisioned. In some embodiments, the composition comprises at least one of a thickener, a surfactant, a humectant, and an abrasive, for example.
[0016] In another aspect, a method is provided, in which the isolated α-glucanase is received, and then admixing with an orally acceptable excipient to make an oral care composition is provided. The oral care composition may be packaged.
[0017] In yet another aspect, a method comprising contacting a subject oral care composition with a tooth under conditions suitable for activity of the α-glucanase is provided. The contacting may be performed using, e.g., a toothbrush. In particular cases, the method results in prevention and/or reduction in dental plaque.
BRIEF DESCRIPTION OF THE DRAWINGS
[0018] FIG. 1 shows an amino acid sequence alignment of α-glucanases from Hypocrea tawa (SEQ ID NO: 1), Trichoderma reesei (SEQ ID NO: 2); Trichoderma konilangbra (SEQ ID NO: 3) and T. harzianum (SEQ ID NO: 4), and a consensus sequence (SEQ ID NO: 5) based on the alignment. Various features of the α-glucanases are indicated, such as the signal sequence, the catalytic domain, the linker domain, and the glucan-binding domain.
[0019] FIG. 2 is a table that summarizes the results of HPLC analysis of the insoluble glucan hydrolysates obtained following overnight incubation with various cell-free culture solutions.
[0020] FIG. 3 shows the activity of supernatants from cultures of T. reesei expressing the putative alphα-1,3-glucanases from T. reesei, H. tawa, and T. konilangbra at pH 4.5 and at pH 6.0. The native alpha-glucanases were not deleted from the host strain. The glucan hydrolysis reactions were loaded based on culture volume, not protein content.
DEFINITIONS
[0021] Unless defined otherwise herein, all technical and scientific terms should be given their ordinary meaning as used in the art. The following terms are defined for clarity. Other definitions may appear elsewhere in the specification.
[0022] As used herein, the term "α-glucanase" refers to an enzyme that hydrolyses 1,3-α-D-glucosidic linkages in a polysaccharide. The α-glucanases s described herein have an activity described as EC 3.2.1.59, according to IUBMB enzyme nomenclature, and can hydrolyse insoluble glucan. The systematic name for an α-glucanase is 1,3(1,3;1,4)-α-D-glucan 3-glucanohydrolase. This enzyme may be referred to as 1,3-α-glucanase in certain publications. Note that the present enzymes may have other activities in addition to 1,3-α-D-glucosidic activity, including but not limited to 1,2-α-D-glucosidic activity.
[0023] As used herein, the term "oral care composition" refers to an admixture of ingredients, which in the ordinary course of usage is not intentionally swallowed for purposes of systemic administration of particular therapeutic agents, but is rather retained in the oral cavity for a time sufficient to contact dental surfaces and/or oral tissues for purposes of delivering a beneficial agent to the oral activity. An oral composition may be in the form of toothpaste, dentifrice, tooth powder, tooth gel, subgingival gel, mouthrinse, denture product, mouthspray, lozenge, oral tablet, chewing gum, or the like. The oral composition may also be incorporated onto strips or films for direct application or attachment to oral surfaces.
[0024] Unless otherwise specified, the term "dentrifice" refers to paste, gel, solid or liquid oral care composition formulation. Examples of dentrifices are toothpaste, tooth gel, and tooth powder. A dentrifice may be a single phase composition or may be a combination of two or more separate compositions. A dentrifice may be in any desired form, such as deep striped, surface striped, multilayered, having the gel surrounding the paste, or any combination thereof. Each composition in a dentrifice comprising two or more separate compositions may be contained in a physically separated compartment of a dispenser and dispensed side-by-side.
[0025] As used herein, the term "orally acceptable carrier" refers to a safe and effective material for use in an oral care composition. Such materials include fluoride ion sources, anticalculus agents, buffers, abrasive polishing materials, peroxide sources, alkali metal bicarbonate salts, thickening materials, humectants, water, surfactants, titanium dioxide, flavor system, sweetening agents, xylitol, coloring agents, and mixtures thereof.
[0026] As used herein, the terms "tooth" or "teeth" refers to natural teeth as well as artificial teeth or dental prosthesis.
[0027] As used herein, the term "enamel" refers to the part of a tooth that is normally visible and is composed of mostly minerals, including hydroxylapatite. Enamel encompasses naturally-occurring enamels in teeth of humans and animals as well as enamel-like substance used to replace damaged or missing teeth parts, including resins and porcelains used for such purposes.
[0028] As used herein, the terms "tartar" and "calculus" are used interchangeably to refer to mineralized dental plaque deposits.
[0029] As used herein, the term "glycocalyx" refers to extracellular polymeric material produced by some bacteria, epithelial cells, and other cells, which forms a coating on the surface of teeth and serves as a matrix for the attachment of plaque.
[0030] As used herein, the term "plaque" refers to a biofilm that forms on the surface of a tooth (or of teeth). The microorganisms that form the biofilm are mostly bacteria, including but not limited to Streptococcus mutans, Streptococcus anaerobes, Fusobacterium spp., and Actinobacteria spp. Plaque may form on, be supported by, or be part of a glycocalyx.
[0031] The microorganisms present in dental plaque are all naturally present in the oral cavity, and are normally harmless. However, failure to remove plaque by regular tooth brushing means that they are allowed to build up in a thick layer. Those microorganisms nearest the tooth surface convert to anaerobic respiration; it is in this state that they start to produce acids.
[0032] As used herein, the term "recombinant" refers to a polynucleotide or polypeptide that does not occur in, is not secreted by, or has an altered expression pattern in, a wild type host cell. Recombinant polypeptides and polynucleotides have respective sequences that are different from the wild-type sequence, have different temporal or spacial expression patterns from wild type polypeptides and polynucleotides, and/or are expressed at different levels than wild type polypeptides and polynucleotides. A recombinant molecule may contain two or more naturally-occurring sequences that are linked together in a way that does not occur naturally. A recombinant cell contains a recombinant polynucleotide or a recombinant polypeptide.
[0033] As used herein, the term "heterologous" refers to elements that are not normally associated with each other. For example, if a host cell produces a heterologous protein, that protein is not normally produced in that host cell. Likewise, a promoter that is operably linked to a heterologous coding sequence is a promoter that is operably linked to a coding sequence that it is not usually operably linked to in a wild-type host cell. The term "homologous", with reference to a polynucleotide or protein, refers to a polynucleotide or protein that occurs naturally in a host cell.
[0034] As used herein, the terms "protein" and "polypeptide" are used interchangeably to refer to a chain of amino acids linked by peptide bonds. Unless otherwise specified polypeptides are written in the standard N-terminal to C-terminal direction.
[0035] As used herein, a "signal sequence" is a sequence of amino acids present at the N-terminal portion of a protein which facilitates the secretion of the mature form of the protein from the cell. The definition of a signal sequence is a functional one, although the structures of many signal sequence are known. The mature form of the extracellular protein lacks the signal sequence, which is cleaved off during the secretion process.
[0036] As used herein, a "coding sequence" is a DNA segment that encodes a polypeptide.
[0037] As used herein, the term "nucleic acid" encompasses DNA, RNA, hybrids, and synthetic or chemically-modified nucleic acids, whether single-stranded or double-stranded. The terms "nucleic acid" and "polynucleotide" are used interchangeably to refer to a chain of nucleosides linked by phosphodiester, sulfodiester, or similar bonds. Unless otherwise specified polynucleotides are written in the standard 5' to 3' direction.
[0038] As used herein, a "vector" refers to a polynucleotide designed to introduce nucleic acids into one or more host cells. Vectors can autonomously replicate in different host cells and include: cloning vectors, expression vectors, shuttle vectors, plasmids, phage particles, cassettes and the like.
[0039] As used herein, an "expression vector" refers to a DNA construct comprising a protein-coding region that is operably linked to a suitable control sequence capable of effecting expression of the protein in a suitable host cell. Such control sequences may include a promoter to effect transcription, an optional operator sequence to control transcription to produce mRNA, a sequence encoding suitable ribosome binding sites on the mRNA, and enhancers and other sequences which control the termination of transcription and translation.
[0040] As used herein, a "promoter" is a regulatory sequence that initiates transcription of a downstream nucleic acid.
[0041] As used herein, the term "operably linked" refers to an arrangement of elements that allows the elements to function in a described or apparent manner. For example, a promoter is operably linked to a coding sequence if it controls the transcription of the sequence.
[0042] As used herein, the term "selective/selectable marker" refers to a protein capable of expression in a host that allows for ease of selection of those cells containing an introduced nucleic acid or vector. Examples of selectable markers include, but are not limited to, proteins that confer resistance to antimicrobials (e.g., hygromycin, bleomycin, or chloramphenicol) and/or genes that confer a metabolic advantage, such as a nutritional advantage on the host cell.
[0043] As used herein, the term "derived from" encompasses the terms "originated from," "obtained" or "obtainable from," and "isolated from".
[0044] As used herein, a "non-pathogenic" organism is an organism that is not pathogenic (i.e., disease or disorder-causing) to humans.
[0045] As used herein, the terms "recovered," "isolated," and "separated" refer to a protein, cell, nucleic acid or amino acid that is removed from at least one component with which it is naturally associated.
[0046] As used herein, the terms "transformed," "stably transformed," and "transgenic," used in reference to a cell, means that the cell has a non-native (e.g., heterologous) nucleic acid sequence integrated into its genome or as an episomal plasmid that is maintained over multiple generations.
[0047] As used herein, the term "expression" refers to the process by which a polypeptide is produced based on the nucleic acid sequence of a gene. The process includes both transcription and translation.
[0048] As used herein, the term "introduced" in the context of inserting a nucleic acid sequence into a cell, means "transfection," or "transformation," or "transduction," and includes reference to the incorporation of a nucleic acid sequence into a eukaryotic or prokaryotic cell wherein the nucleic acid sequence may be incorporated into the genome of the cell (e.g., chromosome, plasmid, plastid, or mitochondrial DNA), converted into an autonomous replicon, or transiently expressed (e.g., transfected mRNA).
[0049] As used herein, the term "compatible" means that the components of a specified composition are capable of being commingled (admixed) without interaction in a manner which would substantially reduce the stability and/or efficacy of a component in the composition.
[0050] As used herein, the term "lozenge" includes but is not limited to: breath mints, troches, pastilles, microcapsules, and fast-dissolving solid forms including freeze dried forms (cakes, wafers, thin films, tablets) and compressed tablets.
[0051] As used herein, the term "fast-dissolving solid form" means that a solid dosage form dissolves in less than about 60 seconds, less than about 15 seconds, or less than about 5 seconds, after placing the solid dosage form in the oral cavity or a container containing dental prosthetics.
[0052] Numeric ranges are inclusive of the numbers defining the range. All percentages and ratios used herein are by weight of the specific oral composition and not of the overall oral formulation that is delivered, unless otherwise specified. The singular articles "a," an," and the," include the plural unless otherwise specified or apparent from context.
[0053] Headings are provided for ease of reading and should not be construed as limitations. The description included under one heading generally applies to the document as a whole, unless otherwise specified or apparent from context.
[0054] Exemplary material and methods are described, although other methods and materials may result in similar or equivalent results. All patents and publications, including all sequences disclosed within such patents and publications, are expressly incorporated by reference.
DETAILED DESCRIPTION
[0055] Described are compositions and methods relating to polypeptides having α-glucanase activity. The compositions and methods are useful for reducing or preventing the formation of plaque, and for reducing or preventing the underlying physiological conditions that promote the formation of plaque.
A. Polypeptides, Polynucleotides, and Host Cells
[0056] One aspect of the present compositions and methods relates to an isolated α-glucanase. In some embodiments, the α-glucanase comprises an amino acid sequence that is at least 98% identical to (e.g., at least 99% or 99.5% identical to) the amino acid sequence of the mature Hypocrea tawa α-glucanase (amino acid residues 38-635 of SEQ ID NO: 1). In particular embodiments, the α-glucanase comprises the amino acid sequence of the mature H. tawa α-glucanase (amino acid residues 38-635 of SEQ ID NO: 1).
[0057] In some embodiments, the α-glucanase comprises an amino acid sequence that is at least 85% identical to (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to) the amino acid sequence of the mature Trichoderma konilangbra α-glucanase (amino acids 38-627 of SEQ ID NO: 3). In particular embodiments, the α-glucanase comprises the amino acid sequence of the mature T. konilangbra α-glucanase (amino acids 38-627 of SEQ ID NO: 3).
[0058] In some embodiments, the α-glucanase comprises an amino acid sequence that is at least 85% identical to (e.g., at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to) the amino acid sequence of the mature Trichoderma reesei α-glucanase (amino acids 38-622 of SEQ ID NO: 2). In particular embodiments, the α-glucanase comprises an amino acid sequence that is not identical to the amino acid sequence of the mature T. reesei α-glucanase (amino acids 38-622 of SEQ ID NO: 2).
[0059] In some embodiments, the α-glucanase is similar to but not identical to a wild type α-glucanase. For example, in some embodiments, the α-glucanase has an amino acid sequence that is at least 98% identical to, but not identical to, the mature H. tawa α-glucanase (amino acid residues 38-635 of SEQ ID NO: 1). Likewise, in certain embodiments, the α-glucanase may have an amino acid sequence that at least 85% identical to, but not identical to, the mature T. reesei or T. konilangbra α-glucanase (amino acids 38-622 of SEQ ID NO: 2 or amino acids 38-627 of SEQ ID NO: 3, respectively).
[0060] The amino acid sequences for over 50 different α-glucanases are known and have been deposited in NCBI's Genbank database, including those from Aspergillus niger (accession no.: XP--001390909.1; GID: 145236523), Penicillium purpurogenum (accession no.: AAF27912.1; GID: 6752866), Emericella nidulans (accession no.: CAC48025.1; GID: 15072711) and Cryptococcus neoformans (accession no.: AAW47079.1; GID: 57230770). These Genbank accessions are incorporated by reference in their entirety, including the nucleic acid and protein sequences therein and the annotation of those sequences, as of the earliest filing date of this patent application. An entry describing a domain that is conserved in α-glucanases has been deposited as pfam03659 in NCBI's Conserved Domain Database (Marchler-Bauer et al. CDD: a conserved domain database for interactive domain family analysis. (2007) Nucleic Acids Res. 35:D237-40). The sequence of a α-glucanase from S. pombe, as well as a discussion of the structure of α-glucanases is found in Fuglsang et al. ((2000) J. Biol. Chem. 275:2009-18).
[0061] Guidance for which amino acids can be changed to produce an active variant of the wild-type α-glucanases of H. tawa, T. reesei and T. konilangbra that retains α-glucanase activity can be obtained, for example, by aligning the amino acid sequences of those α-glucanase proteins, identifying amino acids that are at identical positions in the proteins but are different between the proteins, and transferring those amino acids from one protein to the other. Exemplary sequence alignments are shown in FIG. 1, and in Fuglsang et al. (supra).
[0062] A variant polypeptide may include conservative amino acid substitutions that preserve the general charge, hydrophobicity/hydrophilicity, and/or steric bulk of the amino acid being substituted, while imparting other beneficial biochemical properties on the polypeptide. Non-limiting examples of conservative substitutions include those between the following groups: Gly/Ala, Val/Ile/Leu, Lys/Arg, Asn/Gln, Glu/Asp, Ser/Cys/Thr and Phe/Trp/Tyr. These and other conservative substitutions are shown in the Table, below.
TABLE-US-00001 Original Amino Acid Code Conservative Substitution Alanine A D-Ala, Gly, beta-Ala, L-Cys, D-Cys Arginine R D-Arg, Lys, D-Lys, homo-Arg, D-homo-Arg, Met, Ile, D-Met, D-Ile, Orn, D-Orn Asparagine N D-Asn, Asp, D-Asp, Glu, D-Glu, Gln, D-Gln Aspartic Acid D D-Asp, D-Asn, Asn, Glu, D-Glu, Gln, D-Gln Cysteine C D-Cys, S-Me-Cys, Met, D-Met, Thr, D-Thr Glutamine Q D-Gln, Asn, D-Asn, Glu, D-Glu, Asp, D-Asp Glutamic Acid E D-Glu, D-Asp, Asp, Asn, D-Asn, Gln, D-Gln Glycine G Ala, D-Ala, Pro, D-Pro, b-Ala, Acp Isoleucine I D-Ile, Val, D-Val, Leu, D-Leu, Met, D-Met Leucine L D-Leu, Val, D-Val, Leu, D-Leu, Met, D-Met Lysine K D-Lys, Arg, D-Arg, homo-Arg, D-homo-Arg, Met, D-Met, Ile, D-Ile, Orn, D-Orn Methionine M D-Met, S-Me-Cys, Ile, D-Ile, Leu, D-Leu, Val, D-Val Phenylalanine F D-Phe, Tyr, D-Thr, L-Dopa, His, D-His, Trp, D- Trp, Trans-3,4, or 5-phenylproline, cis-3,4, or 5-phenylproline Proline P D-Pro, L-I-thioazolidine-4-carboxylic acid, D-or L-1-oxazolidine-4-carboxylic acid Serine S D-Ser, Thr, D-Thr, allo-Thr, Met, D-Met, Met(O), D-Met(O), L-Cys, D-Cys Threonine T D-Thr, Ser, D-Ser, allo-Thr, Met, D-Met, Met(O), D-Met(O), Val, D-Val Tyrosine Y D-Tyr, Phe, D-Phe, L-Dopa, His, D-His Valine V D-Val, Leu, D-Leu, Ile, D-Ile, Met, D-Met
[0063] Alternatively, the amino acid substitutions are not conservative and change the general charge, hydrophobicity/hydrophilicity, and/or steric bulk of the amino acid being substituted.
[0064] Assays for evaluating α-glucanase activity are described in a variety of publications, including: Fuglsang et al. (supra), Inoue et al. ((1988) Carbohydr. Res. 182:277-86), Ait-Lahsen et al. ((2001) Appl. Environ. Microbiol. 67:5833-9), and Sumitomo et al. ((2007) Biochim. Biophys. Acta. 1770:716-24).
[0065] Also provided is an isolated polynucleotide encoding an α-glucanas as described, and a recombinant nucleic acid containing the isolated polynucleotide. Given that the genetic code is known, such a polynucleotide can be readily designed based on the amino acid sequence. In one embodiment, the isolated polynucleotide has a nucleotide sequence that is at least 70% identical to (e.g., at least 80% identical to, at least 90% identical to, at least 95% identical to, at least 98% identical to), or may hybridize under stringent conditions to, the nucleotide sequence of a wild type H. tawa α-glucanase gene or coding sequence (e.g., SEQ ID NOs: 29 and 30, respectively), a wild type T. reesei α-glucanase gene or coding sequence (e.g., SEQ ID NOs: 31 and 32, respectively), or a wild type T. konilangbra α-glucanase gene or coding sequence (e.g., SEQ ID NOs: 33 and 34, respectively). In certain embodiments, the coding sequence of the α-glucanase is codon optimized for expression of the α-glucanase in the host cell used. Since codon usage tables listing the usage of each codon in many host cells, including Trichoderma reesei and various other yeast and bacterial host cells are known in the art (see, e.g., Nakamura et al. (2000) Nucl. Acids Res. 28:292) or readily derivable, such nucleic acids can be readily designed given the amino acid sequence of a α-glucanase to be expressed.
[0066] An expression vector and a host cell containing the recombinant nucleic acid are also provided. In certain embodiments, the host cell is bacterial (e.g., a Bacillus sp. or Streptomyces sp. host cell) or filamentous fungal host cell that, in certain cases, may be non-pathogenic, i.e., non-pathogenic to humans. In particular embodiments, the cells may be filamentous fungal cells of a strain that has a history of use for production of proteins that has GRAS status, i.e., a Generally Recognized as Safe, by the FDA.
[0067] In particular embodiments, the subject fungal cell may be a cell of the following species: Trichoderma, (e.g., Trichoderma reesei (previously classified as T. longibrachiatum and currently also known as Hypocrea jecorina), Trichoderma viride, Trichoderma koningii, and Trichoderma harzianum)); Penicillium spp., Humicola spp. (e.g., Humicola insolens and Humicola grisea); Chrysosporium spp. (e.g., C. lucknowense), Gliocladium spp., Aspergillus spp. (e.g., Aspergillus oryzae, Aspergillus niger, Aspergillus nidulans, Aspergillus kawachi, Aspergillus aculeatus, Aspergillus japonicus, Aspergillus sojae, and Aspergillus awamori), Fusarium spp., Neurospora spp., Hypocrea spp., or Emericella spp. (see, also, Innis et al. (1985) Science 228:21-26), among others. In some embodiments, subject fungal cells may be strains of Aspergillus niger which include ATCC 22342, ATCC 44733, ATCC 14331 and strains derived therefrom. In some embodiments, a host cell may be one wherein native genes have been deleted or inactivated. For example, genes corresponding to protease genes or genes corresponding to cellulase genes may be deleted or inactivated.
[0068] The above described nucleic acid may be present in the nuclear genome of the host cell or may be present in a plasmid that replicates in the host cell, for example, a transient expression vector, a shuttle vector, an artificial chromosome, and the like.
[0069] In particular embodiments, the α-glucanase may be produced by expressing a fusion protein containing a signal sequence operably linked to the α-glucanase in a fungal host cell. In such embodiments, the α-glucanase may be secreted into culture medium, where it can be harvested. The signal sequence of the fusion protein may be any signal sequence that facilitates protein secretion from the host cell. The signal sequence employed may be endogenous or non-endogenous to the host cell and, in certain embodiments, may be a signal sequence of a protein that is known to be highly secreted from a Trichoderma sp. or Aspergillus sp. host cell. Such signal sequence include, but are not limited to: the signal sequence of cellobiohydrolase I, cellobiohydrolase II, endoglucanases I, endoglucanases II, endoglucanases III, α-amylase, aspartyl proteases, glucoamylase, mannanase, glycosidase and barley endopeptidase B (see, e.g., Saarelainen (1997) Appl. Environ. Microbiol. 63:4938-40). In a particular embodiment, an α-glucanase may be secreted using its own (i.e., the endogenous) signal sequence.
[0070] It follows that in some embodiments an α-glucanase is produced by introducing a nucleic acid into a host cell, which nucleic acid comprises a signal sequence-encoding portion operably linked to a α-glucanase-encoding portion, where translation of the nucleic acid produces a fusion protein comprising an α-glucanase portion having an N-terminal signal sequence for secretion of the α-glucanase portion from the host cell.
[0071] In particular embodiments, the fusion protein may further contain, in addition to a signal sequence, a carrier protein that is a portion of a protein that is endogenous to and highly secreted by the host cell. Suitable carrier proteins include those of T. reesei mannanase I (Man5A, or MANI), T. reesei cellobiohydrolase II (Ce16A, or CBHII) (see, e.g., Paloheimo et al. (2003) Appl. Environ. Microbiol. 69:7073-82), or T. reesei cellobiohydrolase I (CBHI). In one embodiment, the carrier protein is a truncated T. reesei CBH1 protein that includes the CBH1 core region and part of the CBH1 linker region. A nucleic acid encoding a fusion protein containing, from amino-terminus to carboxy-terminus, a signal sequence, a carrier protein and a subject α-glucanase in operable linkage may therefore be employed.
[0072] In addition to a coding sequence, the nucleic acid may further contain other elements that are necessary for expression of the α-glucanase in the host cell. For example, the nucleic acid may contain a promoter for transcription of the coding sequence, and a transcriptional terminator. Exemplary promoters that may be employed in T. reesei include the T. reesei cbh1, cbh2, egl1, egl2, eg5, xln1 and xln2 promoters, or a hybrid or truncated version thereof. For example, the promoter may be a T. reesei cbh1 promoter. Suitable terminators include the T. reesei cbh1, cbh2, egl1, egl2, eg5, xln1 and xln2 terminators, and many others, including, for example, the terminators from A. niger or A. awamori glucoamylase genes (Nunberg et al. (1984) Mol Cell Biol. 4:2306-15); Boel et al. (1984) EMBO J. 3:1097-102; and Boel et al. (1984) EMBO J. 3:1581-85), Aspergillus nidulans anthranilate synthase genes, Aspergillus oryzae TAKA amylase genes, or A. nidulans trpC (Punt et al. (1987) Gene 56:117-24). The promoter and/or terminator may be native or non-endogenous to the Trichoderma sp. host cell.
[0073] A culture of host cells (i.e., a composition containing a population of host cells and growth media) is also provided. The growth medium of the culture may contain the α-glucanase described above. In certain embodiments, the cell culture may contain growth medium and a population of the above-described cells. The cell culture may be used to produce a subject α-glucanase by maintaining the cell culture under conditions suitable for production of the isolated α-glucanase. If the α-glucanase is secreted, it may be harvested from the growth medium.
[0074] Methods of expressing proteins in filamentous fungi, including methods in which cells are engineered to produce secreted protein include those described in U.S. Pat. Nos. 6,022,725 and 6,268,328, and in published U.S. Pat. App. Nos. 20060041113, 20060040353, 20060040353, and 20050208623, which are incorporated herein by reference. In addition, general methods for the transformation of Aspergillus strains are disclosed in Cao et al. (2000) Protein Sci. 9:991-1001) and Yelton et al. (1984) Proc. Natl. Acad. Sci. USA 81:1470-74) and general methods for the transformation of Trichoderma strains are disclosed in Nevalainen et al. (1992) "The Molecular Biology of Trichoderma and its Application to the Expression of Both Homologous and Heterologous Genes" in Molecular Industrial Mycology, Eds. Leong and Berka, Marcel Dekker Inc., NY, pp 129-48).
[0075] If it is secreted in to culture medium, the α-glucanase may be recovered by any convenient method, e.g., by precipitation, centrifugation, affinity, filtration or any other method known in the art. For example, affinity chromatography (Tilbeurgh et al. (1984) FEBS Lett. 16:215); ion-exchange chromatographic methods (Goyal et al. (1991) Biores. Technol. 36:37; Fliess et al. (1983) Eur. J. Appl. Microbiol. Biotechnol. 17:314; Bhikhabhai et al. (1984) J. Appl. Biochem. 6:336; and Ellouz et al. (1987) Chromatography 396:307), including ion-exchange using materials with high resolution power (Medve et al. (1998) J. Chromatography A. 808153; hydrophobic interaction chromatography (Tomaz and Queiroz (1999) J. Chromatography A. 865:123; two-phase partitioning (Brumbauer et al. (1999) Bioseparation 7:287); ethanol precipitation; reverse phase HPLC; chromatography on silica or on a cation-exchange resin such as DEAE; chromatofocusing; SDS-PAGE; ammonium sulfate precipitation; or gel filtration using, e.g., Sephadex G-75, may be employed. In particular embodiments, the α-glucanase may be used without purification from the other components of the culture medium. In these embodiments, the culture medium may simply be concentrated, for example, and then used without further purification of the protein from the components of the growth medium, or used without any further modification.
B. Oral Care Compositions
[0076] An aspect of the present compositions and methods relates to an oral care composition. The oral care composition contains one or more of the described α-glucanases and an orally acceptable carrier. Each of the one or more α-glucanases may be present in the composition at a concentration in the range of 0.0001% to 5% (e.g., 0.0001% to 0.0005%, 0.0005% to 0.001%, 0.001% to 0.005%, 0.005% to 0.01%, 0.01% to 0.05%, 0.05% to 0.1%, 0.1% to 0.5%, 0.5% to 1%, or 1% to 5%) by weight, although concentrations outside of this range are envisioned. The oral care composition may be made by a method that includes admixing the α-glucanase with an orally acceptable excipient. In certain cases, this method may further include packinging the oral care composition.
[0077] The oral care composition may be in the form of, e.g., a dentifrice, toothpaste, tooth powder, topical oral gel, mouthrinse, denture product, mouthspray, lozenge, oral tablet, or chewing gum. The oral composition may also be incorporated onto strips, films, floss, or tape for direct application or attachment to oral surfaces.
[0078] An orally acceptable carrier may comprise one or more compatible solid or liquid filler diluents or encapsulating substances, which are suitable for topical oral administration. Suitable carriers or excipients include the usual and conventional components of dentifrices (including non-abrasive gels and gels for subgingival application), mouth rinses, mouth sprays, chewing gums, and lozenges (including breath mints) as more fully described hereinafter. The present oral care compositions in aqueous form may optimally have a pH ranging from about 4.0 to about 10.0, e.g., from about 5.0 to about 8.0.
[0079] In some embodiments, the carrier is selected based on the manner in which the way the composition is to be introduced into the oral cavity. For example, if a toothpaste (including tooth gels, etc.) is to be used, then a "toothpaste carrier" may be chosen (comprising e.g., abrasive materials, surfactants, binders, humectants, flavoring and sweetening agents, etc.) as disclosed in e.g., U.S. Pat. No. 3,988,433, to Benedict. If a mouthrinse is to be used, then a "mouthrinse carrier" may be chosen (comprising e.g., water, flavoring and sweetening agents, etc.), as disclosed in e.g., U.S. Pat. No. 3,988,433 to Benedict. If a mouth spray is to be used, then a "mouth spray carrier" may be chosen or if a lozenge is to be used, then a "lozenge carrier" may be chosen (e.g., a candy base). If a chewing gum is to be used, a "chewing gum carrier" may be chosen (comprising e.g., gum base, flavoring and sweetening agents). If a sachet is to be used, then a "sachet carrier" may be chosen (e.g., sachet bag, flavoring and sweetening agents). If a subgingival gel is to be used (for delivery of actives into the periodontal pockets or around the periodontal pockets), then a "subgingival gel carrier" may be chosen. Other useful carriers suitable for the preparation of compositions of the present invention are well known in the art. Their selection may depend on secondary considerations like taste, cost, shelf stability, the desire for a sugar or salt-free composition, and the like.
[0080] In some embodiments, the composition may be in the form of a non-abrasive gel, e.g., a subgingival gel, which may be aqueous or non-aqueous. Aqueous gels generally include a thickening agent (from about 0.1% to about 20%), a humectant (from about 10% to about 55%), a flavoring agent (from about 0.04% to about 2%), a sweetening agent (from about 0.1% to about 3%), a coloring agent (from about 0.01% to about 0.5%), and the balance water. In certain cases, the composition may comprise an anticaries agent (from about 0.05% to about 0.3% as fluoride ion), and an anticalculus agent (from about 0.1% to about 13%).
[0081] In other embodiments, the composition may also be in the form of a dentifrice, such as a toothpaste, tooth gel or tooth powder. Components of such toothpaste and tooth gels may include one or more of a dental abrasive (from about 5% to about 50%), a surfactant (from about 0.5% to about 10%), a thickening agent (from about 0.1% to about 5%), a humectant (from about 10% to about 55%), a flavoring agent (from about 0.04% to about 2%), a sweetening agent (from about 0.1% to about 3%), a coloring agent (from about 0.01% to about 0.5%) and water (from about 2% to about 45%). Such toothpaste or tooth gel may also include one or more of an anticaries agent (from about 0.05% to about 0.3% as fluoride ion), and an anticalculus agent (from about 0.1% to about 13%). Tooth powder may contain substantially all non-liquid components.
[0082] One exemplary dentifrice composition is described in U.S. Pat. No. 6,238,648, and has the following formulation (w/w):
TABLE-US-00002 Glycerin 14.0 Polyethylene Glycol 300 4.5 Silica 21.5 Tetrasodium Pyrophosphate 4.5 Water 23.5 Xanthan Gum 0.3 Carboxymethyl Cellulose 0.5 Sodium Fluoride 0.2 Flavor 1.0 Sodium Lauryl Sulfate (27.9% Solution) 4.5 Sodium Saccharin 0.4 Titanium Dioxide 0.4 Sodium Bicarbonate 0.9 Sodium Carbonate, Anhydrous 1.4 Poloxamer 407 1.8 Xylitol 10.0 Propylene Glycol 10.6 TOTAL 100.00
[0083] Another exemplary dentifrice composition is described in U.S. Pat. No. 5,578,295, and has the following formulation (w/w):
TABLE-US-00003 Triclosan diphosphate 1 Sorbitol 33 Saccharin 0.46 Silica 22 NaF 0.243 Glycerin 9 NaOH (50%) 0.2 Carbopol 0.2 Keltrol 0.6 TiO2 0.5 Sodium alkyl sulphate (28% soln.) 4 PEG 6 3 FD&C Blue #1 (1% soln) 0.05 Flavor 1.1 Water q.s.
[0084] In some embodiments, the composition is a mouthwash, including mouth spray. Components of such mouthwashes and mouth sprays typically include one or more of water (from about 45% to about 95%), ethanol (from about 0% to about 25%), a humectant (from about 0% to about 50%), a surfactant (from about 0.01% to about 7%), a flavoring agent (from about 0.04% to about 2%), a sweetening agent (from about 0.1% to about 3%), and a coloring agent (from about 0.001% to about 0.5%). Such mouthwashes and mouth sprays may also include one or more of an anticaries agent (from about 0.05% to about 0.3% as fluoride ion), and an anticalculus agent (from about 0.1% to about 3%).
[0085] In certain embodiments, the composition may be dental solutions including irrigation fluids. Components of such dental solutions generally include one or more of water (from about 90% to about 99%), preservative (from about 0.01% to about 0.5%), thickening agent (from 0% to about 5%), flavoring agent (from about 0.04% to about 2%), sweetening agent (from about 0.1% to about 3%), and surfactant (from 0% to about 5%).
[0086] Chewing gum compositions typically include one or more of a gum base (from about 50% to about 99%), a flavoring agent (from about 0.4% to about 2%) and a sweetening agent (from about 0.01% to about 20%).
[0087] Lozenges may include discoid-shaped solids comprising a therapeutic agent in a flavored base. The base may be a hard sugar candy, glycerinated gelatin or combination of sugar with sufficient mucilage to give it form. These dosage forms are generally well known in the art.
[0088] In another embodiment, the invention provides a dental implement impregnated with the composition provided herein. The dental implement may comprise an implement for contact with teeth and other tissues in the oral cavity, the implement being impregnated with a composition comprising an oxidase with polyethyleneimine or sorbitol. The dental implement may be in the form of impregnated fibers including dental floss or tape, chips, strips, films, toothpicks, and polymer fibers.
[0089] Exemplary materials that may be present in an orally acceptable carrier are described below.
[0090] Abrasives
[0091] Dental abrasives include many different materials. The material selected may be compatible within the composition of interest and may not excessively abrade dentin. Suitable abrasives may include, for example, silicas including gels and precipitates, insoluble sodium polymetaphosphate, hydrated alumina, calcium carbonate, dicalcium orthophosphate dihydrate, calcium pyrophosphate, tricalcium phosphate, calcium polymetaphosphate, and resinous abrasive materials such as particulate condensation products of urea and formaldehyde.
[0092] One class of abrasives for use in the compositions is a particulate thermo-setting polymerized resin. Suitable resins include, for example, melamines, phenolics, ureas, melamine-ureas, melamine-formaldehydes, urea-formaldehyde, melamine-urea-formaldehydes, cross-linked epoxides, and cross-linked polyesters.
[0093] Silica dental abrasives of various types may be selected because of their benefits dental cleaning and polishing performance without unduly abrading tooth enamel or dentine. The silica abrasive polishing materials, as well as other abrasives, may have an average particle size ranging between about 0.1 to about 30 microns, or from about 1 to about 15 microns. The abrasive can be precipitated silica or silica gels such as the silica xerogels.
[0094] Mixtures of abrasives may also be used. The total amount of abrasive in dentifrice compositions may range from about 6% to about 70% by weight. Toothpastes may contain from about 10% to about 50% of abrasives, by weight of the composition. Solution, mouth spray, mouthwash and non-abrasive gel compositions may contain no abrasive.
[0095] Surfactants
[0096] The present compsotions may also contain a surfactant, e.g., a sarcosinate surfactant, isethionate surfactant or taurate surfactant. In certain embodiments, the composition may contain alkali metal or ammonium salts of these surfactants. In certain cases, the composition may contain sodium and potassium salts of the following: lauroyl sarcosinate, myristoyl sarcosinate, palmitoyl sarcosinate, stearoyl sarcosinate and oleoyl sarcosinate. Other suitable compatible surfactants may be used in place of or in combination with these surfactants.
[0097] Suitable anionic surfactants include the water-soluble salts of alkyl sulfates having from 10 to 18 carbon atoms in the alkyl radical and the water-soluble salts of sulfonated monoglycerides of fatty acids having from 10 to 18 carbon atoms. Sodium lauryl sulfate and sodium coconut monoglyceride sulfonates are examples of anionic surfactants of this type. Mixtures of anionic surfactants may also be utilized.
[0098] Suitable cationic surfactants include derivatives of aliphatic quaternary ammonium compounds having one long alkyl chain containing from about 8 to 18 carbon atoms such as lauryl trimethylammonium chloride; cetyl pyridinium chloride; cetyl trimethylammonium bromide; di-isobutylphenoxyethyl-dimethylbenzylammonium chloride; coconut alkyltrimethylammonium nitrite; cetyl pyridinium fluoride; etc. In certain cases, surfactant compounds may be the quaternary ammonium fluorides with detergent properties. Some cationic surfactants may act as germicides in the composition.
[0099] Suitable nonionic surfactants include compounds produced by the condensation of alkylene oxide groups (hydrophilic in nature) with an organic hydrophobic compound which may be aliphatic or alkylaromatic in nature. Examples include the Pluronics, polyethylene oxide condensates of alkyl phenols, products derived from the condensation of ethylene oxide with the reaction product of propylene oxide and ethylene diamine, ethylene oxide condensates of aliphatic alcohols, long chain tertiary amine oxides, long chain tertiary phosphine oxides, long chain dialkyl sulfoxides and mixtures of such materials.
[0100] Suitable zwitterionic synthetic surfactants include derivatives of aliphatic quaternary ammonium, phosphonium, and sulfonium compounds, in which the aliphatic radicals can be straight chain or branched, and wherein one of the aliphatic substituents contains from about 8 to 18 carbon atoms and one contains an anionic water-solubilizing group, e.g., carboxy, sulfonate, sulfate, phosphate or phosphonate.
[0101] Suitable betaine surfactants include decyl betaine or 2-(N-decyl-N,N-dimethylammonio)acetate, coco betaine or 2-(N-coco-N,N-dimethyl ammonio)acetate, myristyl betaine, palmityl betaine, lauryl betaine, cetyl betaine, cetyl betaine, stearyl betaine, etc. Amidobetaines are exemplified by cocoamidoethyl betaine, cocoamidopropyl betaine, lauramidopropyl betaine and the like. In certain embodiments, the betaines in the composition are cocoamidopropyl betaine or lauramidopropyl betaine.
[0102] Surfactants may be present at a concentration in the range of about 0.1% to about 2.5%, from about 0.3% to about 2.5%, or from about 0.5% to about 2.0% by weight of the total composition.
[0103] Anti-Plaque Agent
[0104] The compositions may also include an anti-plaque agent, such as a synthetic anionic polymer, e.g., polyacrylate or copolymers of maleic anhydride or acid and methyl vinyl ether as well as polyamino propane sulfonic acid (AMPS), zinc citrate trihydrate, polypeptides (such as polyaspartic and polyglutamic acids), and mixtures thereof.
[0105] Chelating Agents
[0106] The compositions may include a chelating agent. Chelating agents include tartaric acid and pharmaceutically-acceptable salts thereof, citric acid and alkali metal citrates and mixtures thereof. Chelating agents may complex calcium found in the cell walls of the bacteria. Chelating agents may also disrupt plaque by removing calcium from the calcium bridges which help hold this biomass intact. A chelating agent that may result in tooth demineralization should not be used.
[0107] In some embodiments, alkali metal citrates (e.g., sodium and potassium citrate) are present in the compositions. In certain cases, chelating agents include a citric acid/alkali metal citrate combination. In other cases, alkali metal salts of tartaric acid may be used. Other agents include disodium tartrate, dipotassium tartrate, sodium potassium tartrate, sodium hydrogen tartrate and potassium hydrogen tartrate. The tartaric acid salt chelating agent may be used alone or in combination with other optional chelating agents. In certain embodiments, these chelating agents have a calcium binding constant of about 101 to 105 to provide improved cleaning with reduced plaque formation.
[0108] Another group of chelating agents is the anionic polymeric polycarboxylates. Such materials are well known in the art, being employed in the form of their free acids, partially or fully neutralized water soluble alkali metal (e.g. potassium and preferably sodium) or ammonium salts. In certain cases, composition contain 1:4 to 4:1 copolymers of maleic anhydride or acid with another polymerizable ethylenically unsaturated monomer, such as methyl vinyl ether (methoxyethylene) having an average molecular weight (AMW) of about 30,000 to about 1,000,000.
[0109] Other operative polymeric polycarboxylates may include those such as the 1:1 copolymers of maleic anhydride with ethyl acrylate, hydroxyethyl methacrylate, N-vinyl-2-pyrrolidone, or ethylene, and 1:1 copolymers of acrylic acid with methyl or hydroxyethyl methacrylate, methyl or ethyl acrylate, isobutyl vinyl ether or N-vinyl-2-pyrrolidone.
[0110] Additional operative polymeric polycarboxylates may be copolymers of maleic anhydride with styrene, isobutylene or ethyl vinyl ether, polyacrylic, polyitaconic and polymaleic acids, and sulfoacrylic oligomers of AMW as low as 1,000.
[0111] The amounts of chelating agent may be about 0.1% to about 2.5%, about 0.5% to about 2.5%, or from about 1.0% to about 2.5%.
[0112] Fluoride Source
[0113] In certain embodiments, a water-soluble fluoride compound may be present in an oral care composition in an amount sufficient to give a fluoride ion concentration in the composition at 25° C., from about 0.0025% to about 5.0% by weight, or about 0.005% to about 2.0% by weight. A wide variety of fluoride ion-yielding materials may be employed as sources of soluble fluoride in the present compositions. Representative fluoride ion sources may include stannous fluoride, sodium fluoride, potassium fluoride, sodium monofluorophosphate and many others. In certain cases, the subject composition contain stannous fluoride and sodium fluoride, as well as mixtures thereof.
[0114] Teeth Whitening Actives and Teeth Color Modifying Substances
[0115] A teeth whitening agent and/or teeth color-modifying substance may also be present in the oral care compositions. These substances are suitable for modifying the color of the teeth. These substances may comprise particles that when applied on the tooth surface modify that surface in terms of absorption and, or reflection of light. Such particles may provide an appearance benefit when a film containing such particles is applied over the surfaces of a tooth or teeth.
[0116] Particles include pigments and colorants routinely used in the cosmetic arts. There are no specific limitations as to the pigment and, or colorant used in the present composition. Pigments and colorants include inorganic white pigments, inorganic colored pigments, pearling agents, filler powders and the like. Specific examples may be selected from the group consisting of talc, mica, magnesium carbonate, calcium carbonate, magnesium silicate, aluminum magnesium silicate, silica, titanium dioxide, zinc oxide, red iron oxide, brown iron oxide, yellow iron oxide, black iron oxide, ferric ammonium ferrocyanide, manganese violet, ultramarine, nylon powder, polyethylene powder, methacrylate powder, polystyrene powder, silk powder, crystalline cellulose, starch, titanated mica, iron oxide titanated mica, bismuth oxychloride, and mixtures thereof. In certain embodiments, titanium dioxide, bismuth oxychloride, zinc oxide, or mixtures thereof are used.
[0117] The pigments may be used as opacifiers and colorants. These pigments may be used as treated particles, or as the raw pigments themselves. Typical pigment levels may be selected for the particular impact that is desired by the consumer. For example, for teeth that are particularly dark or stained one may use pigments in sufficient amount to lighten the teeth. On the other hand, where individual teeth or spots on the teeth are lighter than other teeth, pigments to darken the teeth may be useful. The levels of pigments and colorants may be used in the range of about 0.05% to about 20%, from about 0.10% to about 15%, or from about 0.25% to about 10% of the composition.
[0118] Thickening Agents
[0119] In certain embodiments, such as toothpaste or gels, some thickening material may provide a consistency of the composition, active release characteristics upon use, shelf stability, and stability of the composition, etc. Thickening agents include carboxyvinyl polymers, carrageenan, hydroxyethyl cellulose, laponite and water soluble salts of cellulose ethers such as sodium carboxymethylcellulose and sodium carboxymethyl hydroxyethyl cellulose. Natural gums, such as gum karaya, xanthan gum, gum arabic, and gum tragacanth, may also be used. Colloidal magnesium aluminum silicate or finely divided silica may be used as part of the thickening agent to further improve texture.
[0120] Thickening or gelling agents may include a class of homopolymers of acrylic acid crosslinked with an alkyl ether of pentaerythritol or an alkyl ether of sucrose, or carbomers, or mixtures thereof.
[0121] Copolymers of lactide and glycolide monomers having a molecular weight in the range of from about 1,000 to about 120,000 (number average), may be used in the subject composition such as a "subgingival gel."
[0122] Thickening agents may be used in an amount from about 0.1% to about 15%, about 2% to about 10%, or from about 4% to about 8%, by weight of the total toothpaste or gel composition. Higher concentrations may be used for chewing gums, lozenges (including breath mints), sachets, non-abrasive gels and subgingival gels.
[0123] Humectants
[0124] In certain embodiments, topical, oral carrier of the subject composition may include a humectant. The humectant may serve to keep the subject compositions from hardening upon exposure to air, to give compositions a moist feel to the mouth, and, for particular humectants, to impart desirable sweetness of flavor to toothpaste compositions. The humectant, on a pure humectant basis, may comprise from about 0% to about 70%, or about 5% to about 25%, by weight of the compositions herein. Suitable humectants for use in compositions of the subject invention include edible polyhydric alcohols such as glycerin, sorbitol, xylitol, butylene glycol, polyethylene glycol, and propylene glycol. In certain cases, the humectant is sorbitol and/or glycerin.
[0125] Flavoring and Sweetening Agents
[0126] Flavoring agents may also be added to the compositions. Suitable flavoring agents include oil of wintergreen, oil of peppermint, oil of spearmint, clove bud oil, menthol, anethole, methyl salicylate, eucalyptol, cassia, 1-menthyl acetate, sage, eugenol, parsley oil, oxanone, alpha-irisone, marjoram, lemon, orange, propenyl guaethol, cinnamon, vanillin, thymol, linalool, cinnamaldehyde glycerol acetal known as CGA, and mixtures thereof. Flavoring agents may be used in the compositions at levels of from about 0.001% to about 5%, by weight of the composition.
[0127] Suitable sweetening agents include sucrose, glucose, saccharin, dextrose, levulose, lactose, mannitol, sorbitol, fructose, maltose, xylitol, saccharin salts, thaumatin, aspartame, D-tryptophan, dihydrochalcones, acesulfame, cyclamate salts, sodium cyclamate or sodium saccharin, and mixtures thereof. A composition may contain from about 0.1% to about 10% of these agents, or from about 0.1% to about 1%, by weight of the composition.
[0128] In addition to flavoring and sweetening agents, coolants, salivating agents, warming agents, and numbing agents may be used as optional ingredients in the subject composition. These agents may be present in the compositions at a level of from about 0.001% to about 10%, or from about 0.1% to about 1%, by weight of the composition.
[0129] The coolant may be any of a wide variety of materials. Included among such materials are carboxamides, menthol, ketals, diols, and mixtures thereof. Exemplary coolants are paramenthan carboxyamide agents such as N-ethyl-p-menthan-3-carboxamide, N,2,3-trimethyl-2-isopropylbutanamide, and mixtures thereof. Other coolants may be selected from the group consisting of menthol, 3-1-menthoxypropane-1,2-diol, menthone glycerol acetal, and menthyl lactate. The terms menthol and menthyl include dextro- and levorotatory isomers of these compounds and racemic mixtures, thereof.
[0130] Warming agents include capsicum and nicotinate esters, such as benzyl nicotinate. Numbing agents may include benzocaine, lidocaine, clove bud oil, and ethanol.
[0131] Alkali Metal Bicarbonate Salt
[0132] The compositions may also include an alkali metal bicarbonate salt. Alkali metal bicarbonate salts may be soluble in water and unless stabilized, may release carbon dioxide in an aqueous system. Sodium bicarbonate, also known as baking soda, may be present as the alkali metal bicarbonate salt. In certain embodiments, the composition contains from about 0.5% to about 30%, about 0.5% to about 15%, or from about 0.5% to about 5% of an alkali metal bicarbonate salt.
[0133] Miscellaneous Carriers
[0134] Water employed in the preparation of the oral care compositions may be of low ion content and free of organic impurities, and may be present in an amount of about 5% to about 70%, or from about 20% to about 50%, by weight, of an aqueous composition. These amounts of water may include free water that is added, plus water that is introduced with other agents or carriers.
[0135] Poloxamers may be employed in the compositions. The poloxamer may be classified as a nonionic surfactant. It may function as an emulsifying agent, binder, or stabilizer, or perform a related function. Poloxamers include difunctional block-polymers terminating in primary hydroxyl groups with molecular weights ranging from 1,000 to above 15,000.
[0136] Other emulsifying agents that may be used in the compositions include polymeric emulsifiers. Predominantly high molecular weight polyacrylic acid polymers may be useful as emulsifiers.
[0137] Titanium dioxide may also be added to the composition. Titanium dioxide is a white powder which may add opacity to the compositions. Titanium dioxide may comprise from about 0.25% to about 5% by weight of the composition.
[0138] The pH of the composition is preferably adjusted through the use of one or more buffering agents. Buffering agents refer to agents that can be used to adjust the pH of the compositions in a range of about pH 4.0 to about pH 10.0. Buffering agents include monosodium phosphate, trisodium phosphate, sodium hydroxide, sodium carbonate, sodium acid pyrophosphate, citric acid, and sodium citrate. Buffering agents may be administered at a level of from about 0.5% to about 10%, by weight of the present compositions. In certain embodiments, the pH of dentifrice compositions may be measured from a 3:1 aqueous slurry of dentifrice, e.g., 3 parts water to 1 part dentifrice.
[0139] Other agents that may be used in the present compositions include dimethicone copolyols selected from alkyl- and alkoxy-dimethicone copolyols, such as C12 to C20 alkyl dimethicone copolyols and mixtures thereof. In certain cases, the compositions contain cetyl dimethicone copolyol. The dimethicone copolyol may be present in a level of from about 0.01% to about 25%, about 0.1% to about 5%, or from about 0.5% to about 1.5% by weight. The dimethicone copolyols may aid in providing positive tooth feel benefits.
[0140] Other Active Agents
[0141] The present oral care composition may also include other active agents, such as antimicrobial agents. Included among such agents are water insoluble non-cationic antimicrobial agents such as halogenated diphenyl ethers, phenolic compounds including phenol and its homologs, mono and poly-alkyl and aromatic halophenols, resorcinol and its derivatives, bisphenolic compounds and halogenated salicylanilides, benzoic esters, and halogenated carbanilides. Water soluble antimicrobials include quaternary ammonium salts and bis-biquamide salts, among others. An additional water soluble antimicrobial agent is triclosan monophosphate. Quaternary ammonium agents include those in which one or two of the substitutes on the quaternary nitrogen has a carbon chain length (typically alkyl group) from about 8 to about 20, or from about 10 to about 18 carbon atoms while the remaining substitutes (typically alkyl or benzyl group) have a lower number of carbon atoms, such as from about 1 to about 7 carbon atoms, such as methyl or ethyl groups. Dodecyl trimethyl ammonium bromide, tetradecylpyridinium chloride, domiphen bromide, N-tetradecyl-4-ethyl pyridinium chloride, dodecyl dimethyl (2-phenoxyethyl)ammonium bromide, benzyl dimethylstearyl ammonium chloride, cetyl pyridinium chloride, quaternized 5-amino-1,3-bis(2-ethyl-hexyl)-5-methyl-hexahydropyrimidine, benzalkonium chloride, benzethonium chloride and methyl benzethonium chloride are exemplary of quaternary ammonium antibacterial agents. Other compounds are bis[4-(R-amino)-1-pyridinium]alkanes. Other antimicrobials, such as copper bisglycinate, copper glycinate, zinc citrate, and zinc lactate, may also be included.
[0142] In addition to an α-glucanase, the present oral care compositions may also contain one or more other enzymes that have carbohydrate hydrolysis, antimicrobial, or teeth whitening activity. Such enzymes include, but are not limited to, a deaminase, an esterase, a glycosidase, glucanhydrolase, a dextrinase, an amylase, a transglucosidase, a cellulase, a hemicellulase, a lipase, an oxidase, a peroxidase, a protease, and a urease.
C. Method of Use
[0143] Another aspect of the present compositions and method is a method of contacting a tooth surface with a composition comprising an alpha-glucanase to reduce or prevent tooth decay, or to reduce or prevent the underlying causes of tooth decay.
[0144] In some embodiments, the method involves contacting a tooth surface with a composition comprising an alpha-glucanase to hydrolyze a glycocalyx present on the tooth surface. According to this embodiment, the 1,3-α-D-glucosidase activity of the alpha-glucanase, and/or other activities of the alpha-glucanase, hydrolizes polysaccharides, glucans, mannans, and/or adhesive molecules produced by plaque bacteria, thereby decreasing the ability of plaque to adhere to the tooth surface, reducing plaque formation or reducing the levels of existing plaque. Such polysaccharides, glucans, mannans, and/or adhesive molecules may be present in what is conventionally referred to as the glycocalyx.
[0145] In some embodiments, the method involves contacting a tooth surface with a composition comprising an alpha-glucanase to dewater the tooth surface by disrupting the polysaccharides, glucans, mannans, and/or adhesive molecules produced by bacteria in the mouth, thereby reducing film formation or bacterial adhesion, and/or preventing the accumulation of bacterial acids and other substances that damage the tooth surface.
[0146] The method may include contacting the tooth surface with one or more alpha-glucanases, which may be formulated as described, above. The methods may include contacting the tooth surface with an additional enzyme, which may be present in the same formulation or a different formulation. In some embodiments, the enzyme is a deaminase, an esterase, a glycosidase, glucanhydrolase, a dextrinase, an amylase, a transglucosidase, a cellulase, a hemicellulase, a lipase, an oxidase, a peroxidase, a protease, and a urease. The additional enzyme may also be an additional alpha-glucanase.
[0147] Tooth and other personal care compositions and their mechanisms of action are described in detail in Lad. R. (ed.) "Biotechnology in Personal Care", Cosmetic Science and Technology Series, Vol. 29, Taylor and Francis Group, New York, N.Y., USA, 2006. This reference is indicative of the state of the art, as is incorporated herein.
[0148] In addition to oral care applications, the present compositions and methods can be adapted for the prevention or removal of biofilims in a large number of other situtations, for example, in cooling water equipment, in drinking water equipment, in food products and food handling equipment, on (or in) medical implants, in paper and textile manufacturing and processing, in oil refinery and mining equipment, on the hulls of ships and boats, in chemical manufacturing, in swimming pools, aquariums, and ponds, and the like. In such cases, alpha glucanases can be used to disrupt polysaccharide components present in the biofilm, thereby reducing the attachment and/or adhesion of microorganism to surfaces. The disruption of such polysaccharides also results in dewatering, which reduces or prevents the formation of a microenvironment suitable for the growth and propagation of microorganism on a surface.
[0149] Other aspects and embodiments of the present compositions and methods will be apparent to the skilled person in view of the disclosure.
EXPERIMENTAL
[0150] The following examples are offered to illustrate the present compositions and methods, and advantages thereof, and should not be construed as limiting their scope.
Example 1
Identification of Candidate Fungal α-1,3-glucanases (EC 3.2.1.59)
[0151] Several candidate fungi, including Hypocrea tawa, Trichoderma reesei, Trichoderma konilangbra, and Trichoderma harzianum were grown in culture in defined media with 15% maltose (28° C., 7 days, 150 rpm agitation). Supernatants were harvested by sterile filtration, concentrated, and desalted for glucan (and dextran) hydrolysis activity screening. The desalted culture supernatants (5% by volume) were added to 0.2% washed insoluble glucan in 100 mM phosphate buffer, pH 6.3 (or 100 mM acetate buffer, pH 4.5). The reaction mixtures were incubated overnight at 37-40 C.°. The mixtures were visually inspected for solubilization of the insoluble glucan, and the supernatants were analyzed by HPLC for soluble hydrolysis products. For HPLC analysis, the reaction supernatant was diluted 10-fold into 10 mM NaOH, and 10 μl was then injected into an Agilent 1100 HPLC equipped with electrochemical detection. Mono- and disaccharides were eluted with a NaOH/sodium acetate gradient on a PA1 anion exchange column. The components of unknown mixtures were identified based on previously run standards. The supernatants from the Trichoderma reesei, Trichoderma konilangbra, and Hypocrea tawa resulted in the most solubilization of glucan (see, e.g., FIG. 2). The α-1,3-glucanases of H. tawa, T. reesei, and T. konilangbra were selected for cloning, expression, and characterization. Putative T. reesei α-1,3-glucanase sequences were identified in the genome sequence (JGI) by homology.
Example 2
Isolation of Genomic DNA
[0152] Fungal cultures of T. reesei, T. konilangbra, and H. tawa were prepared by adding 30 mL of sterile YEG broth to three 250 mL baffled Erlenmeyer shaking flasks in the biological hood. A 1×1 inch square was cut and removed from each respective fungal culture plate using a sterile plastic loop and placed into the appropriate culture flask. The inoculated flasks were then placed into the 28° C. shaking incubator to grow overnight.
[0153] The T. reesei, T. konilangbra, H. tawa cultures were removed from the shaking incubator and the contents of each flask were poured into separate sterile 50 mL Sarstedt tubes. The Sarstedt tubes were placed in a table-top centrifuge and spun at 4,500 rpm for 10 minutes to pellet the fungal mycelia. The supernatants were discarded and a large loopful of each mycelial sample was transferred to a separate tube containing lysing matrix (FastDNA). Genomic DNA was extracted from the harvested mycelia using the FastDNA kit (Qbiogene), according to the manufacturer's protocol for algae, fungi and yeast. The homogenization time (Mini BeadBeater-8) was 25 seconds. The amount and quality of genomic DNA extracted was determined by gel electrophoresis.
Example 3
Obtaining alpha-glucanase polypeptides by PCR
[0154] A. T. reesei
[0155] Putative α-1,3 glucanase genes were identified in the T. reesei genome (JGI) by homology. PCR primers for T. reesei were designed based on the putative homolog DNA sequences. Degenerate PCR primers were designed for T. konilangbra or H. tawa based on the putative T. reesei protein sequences and other published α-1,3 glucanase protein sequences.
TABLE-US-00004 T. reesei specific PCR primers: (SEQ ID NO: 6) SK592: 5'-CACCATGTTTGGTCTTGTCCGC (SEQ ID NO: 7) SK593: 5'-TCAGCAGTACTGGCATGCTG
[0156] The PCR conditions used to amplify the putative α-1,3 glucanase from genomic DNA extracted from T. reesei strain RL-P37 were as follows: 1. 94° C. for 2 minutes, 2. 94° C. for 30 seconds, 3. 56° C. for 30 seconds, 4. 72° C. for 3 minutes, 5. return to step 2 for 24 cycles, 6. 4° C. indefinitely. Reaction samples contained 2 μL of RL-P37 genomic DNA, 10 μL of the 10× buffer, 2 μL 10 mM dNTPs mixture, 1 μL primers SK592 and SK593 at 20 μM, 1 μL of the Pfu Ultra and 83 μL distilled water.
B. T. konilangbra and H. tawa
[0157] Initial PCR reactions used degenerate primers designed from protein alignments of several homologous sequences. A primary set of degenerate primers, designed to anneal near the 5' and 3' ends, were used in the first PCR reaction to amplify similar sequences to that of an α-1,3 glucanase.
Degenerate Primers for Initial Cloning:
TABLE-US-00005
[0158] H. tawa and T. konilangbra: (SEQ ID NO: 8) MA1F: GTNTTYTGYCAYTTYATGAT (SEQ ID NO: 9) MA2F: GTNTTYTGYCAYTTYATGATHGGNAT (SEQ ID NO: 10) MA4F: GAYTAYGAYGAYGAYATGCARCG (SEQ ID NO: 11) MA5F: GTRCAYTTRCAIGGICCIGGIGGRCARTANCC (SEQ ID NO: 12) MA6R: YTCICCIGGNAGNGGRCANCCRTT (SEQ ID NO: 13) MA7R: RCARTAYTGRCAIGCYGTYGGYGGRCARTA
[0159] The products of these PCR reactions were then used in a nested PCR, using primers designed to attach within the product of the initial PCR fragment, under the same amplification conditions.
Specific Primers for Initial Cloning:
TABLE-US-00006
[0160] T. konilangbra: (SEQ ID NO: 14) TP1S: CCCCCTGGCCAAGTATGTGT (SEQ ID NO: 15) TP2A: GTACGCAAAGTTGAGCTGCT (SEQ ID NO: 16) TP3S: AGCACATCGCTGATGGATAT (SEQ ID NO: 17) TP3A: AAGTATACGTTGCTTCCGGC (SEQ ID NO: 18) TP4S: CTGACGATCGGACTRCACGT (SEQ ID NO: 19) TP4A: GGTTGTCGACGTAGAGCTGT H. tawa: (SEQ ID NO: 20) HP2A: ACGATCGGCAGAGTCATAGG (SEQ ID NO: 21) HP3S: ATCGGATTGCATGTCACGAC (SEQ ID NO: 22) HP3A: TACATCCAGACCGTCACCAG (SEQ ID NO: 23) HP4S: ACGTTTGCTCTTGCGGTATC (SEQ ID NO: 24) HP4A: TCATTATCCCAGGCCTAAAA
[0161] Gel electrophoresis of the PCR products was used to determine whether fragments of expected size were amplified. Single nested PCR products of the expected size were purified using the QIAquick PCR purification kit (Qiagen). In addition, expected size products were excised and extracted from agarose gels containing multiple product bands and purified using the QIAquick Gel Extraction kit (Qiagen).
Example 4
Transformation/Isolate Screening/Plasmid Extraction
[0162] PCR products were inserted into cloning vectors using the Invitrogen Zero Blunt® TOPO® PCR Cloning Kit, according to the manufacturer's specifications. The vector was then transformed into One®Shot Top 10 chemically competent E. coli cells (Invitrogen), according to the manufacturer's recommendation and then spread onto LB plates containing 50 ppm of Kanamycin. These plates were incubated in the 37° C. incubator overnight.
[0163] To select transformants that contained the vector and DNA insert, colonies were selected from the plate for crude plasmid extraction. 50 μL of DNA Extraction Solution (100 mM NaCl, 10 mM EDTA, 2 mM Tris pH 7) was added to clean 1.5 mL Eppendorf tubes. In the biological hood, 7-10 individual colonies of each TOPO® transformation clone were numbered, picked and resuspended in the extraction solution. In the chemical hood, 50 μL of Phenol: Chloroform: Isoamyl alcohol was added to each sample and vortexed thoroughly. Tubes were microcentrifuged at maximum speed for 5 minutes, after which 20 μL of the top aqueous layer was removed and placed into a clean PCR tubes. 1 μL of RNase 2 mg/mL was then added, and samples were mixed and incubated at 37° C. for 30 minutes. The entire sample volume was then run on a gel to determine the presence of the insert in the TOPO® vector based on difference in size to an empty vector. Once the transformant colonies had been identified, those clones was scraped from the plate, and used to inoculate separate 15 mL tubes containing 5 ml of LB/Kanamycin medium (0.0001%). The cultures were placed in the 37° C. shaking incubator overnight.
[0164] Samples were removed from the incubator and centrifuged for 6 minutes at 6,000 rpm using the Sorval centrifuge. The QIAprep Spin Miniprep kit (Qiagen) and protocol were used to isolate the plasmid DNA, which was then digested to confirm the presence of the insert. The restriction enzyme used was dependent on the sites present in and around the insert sequence. Gel electrophoresis was used to determine fragment size. Appropriate DNA samples were submitted for sequencing (Sequetech, Mountain View, Calif.).
Example 5
Cloning the 3' and 5' Ends
[0165] All DNA fragments were sequenced. Sequences were aligned and compared to determine nucleotide and amino acid identities using Align X and ContigExpress® (Vector NTI® suite, Invitrogen). Specific primers were designed to amplify the 3' and 5' portions of each incomplete fragment from H. tawa and T. konilangbra by extending outward from the known sequence. At least three specific primers, each nested within the amplified product of the previous primer set, were designed for each template. Amplification of the 5' and 3' sequences was performed using the nested primer sets with the LA PCR In vitro Cloning Kit (TaKaRa BIO Inc.).
[0166] Fresh genomic DNA was prepared for this amplification. Cultures of T. konilangbra and H. tawa were prepared by inoculating 30 mL of YEG broth with a 1 square inch section of the appropriate sporulated fungal plate culture in 250 mL baffled Erlenmeyer flasks. The flasks were incubated in the 28° C. shaking incubator overnight. The cultures were harvested by centrifugation in 50 mL Sarstedt tubes at 4,500 rpm for 10 minutes. The supernatant was discarded and the mycelia were stored overnight in a -80° C. freezer. The frozen mycelia were then placed into a coffee grinder along with a few pieces of dry ice. The grinder was run until the entire mixture had a powder-like consistency. The powder was then air dried and transferred to a sterile 50 mL Sarstedt tube containing 10 mL of Easy-DNA® Kit Solution A (Invitrogen) and the manufacturer's protocol was followed. The concentration of the genomic DNA collected from the extraction was measured using the NanoDrop spectrophotometer.
[0167] The LA PCR In vitro Cloning Kit cassettes were chosen based on the absence of a particular restriction site within the known DNA sequences, and the manufacturer's instructions were followed. For first PCR run, 1 μL of the ligation DNA sample was diluted in 33.5 μL of sterilized distilled water. Different primers were used depending on the sample and the end fragment desired. For the 5' ends, primers HP4A and TP3A were used for H. tawa and T. konilangbra respectively, while for the 3' ends primers HP4S and TP3S were used for H. tawa and T. konilangbra. The PCR mixture was prepared by adding 34.5 μL diluted ligation DNA solution, 5 μL of 10× LA Buffer II (Mg+2), 8 μL dNTPs mixture, 1 μL cassette primer 1, 1 μL specific primer I (depending on sample and end fragment), and 0.5 μL TaKaRa LA Taq. The PCR tubes were then placed in a thermocycler following the listed protocol: 1. 94° C. for 10 minutes, 2. 94° C. for 30 seconds, 3. 55° C. for 30 seconds, 4. 72° C. for 4 minutes, return to step 2. 30 times, 4° C. indefinitely.
[0168] A second PCR reaction was prepared by taking 1 μL of the first PCR reaction and diluting the sample in sterilized distilled water to a dilution factor of 1/10,000. A second set of primers nested within the first amplified region were used to amplify the fragment isolated in the first PCR reaction. Primers HP3A and TP4A were used to amplify toward the 5' end of H. tawa and T. konilangbra respectively, while primers HP3S and TP4S were used to amplify toward the 3' end. The diluted DNA was added to the PCR reaction containing 33.5 μL distilled sterilized water, 5 μL 10× LA Buffer II (Mg+2), 8 μL dNTPs mixture, 1 μL of cassette primer 2, 1 μL of specific primer 2 (dependent on sample and fragment end), 0.5 μL, TaKaRa LA Taq, and mixed thoroughly before the PCR run. The PCR protocol was the same as the first reaction, without the initial 94° C. for 10 minutes. After the reaction was complete, the sample was run by gel electrophoresis to determine size and number of fragments isolated. If a single band was present, the sample was purified and sent for sequencing. If no fragment was isolated, a third PCR reaction was performed using the previous protocol for a nested PCR reaction. After running the amplified fragments by gel electrophoresis, the brightest band was excised, purified, and sent for sequencing.
Example 6
Analysis of Sequence Alignments
[0169] Sequences were obtained and analyzed using the Vector NTI suite, including Align X, and ContigExpress. Each respective end fragment sequence was aligned to the previously obtained fragments of H. tawa and T. konilangbra to obtain the entire gene sequence. Nucleotide alignments with T. harzianum and T. reesei sequences revealed the translation start and stop points of the gene of interest in both H. tawa and T. konilangbra. After the entire gene sequence was identified, specific primers were designed to amplify the entire gene from the genomic DNA. Primers were designed as described earlier, with the exception of adding CACC nucleotide sequence before the translational starting point, for GATEWAY® cloning (Invitrogen).
[0170] Primers for Final Cloning:
TABLE-US-00007 T. konilangbra: (SEQ ID NO: 25) T1FS: caccatgctaggcattctccg (SEQ ID NO: 26) T1FA: tcagcagtattggcatgccg H. tawa: (SEQ ID NO: 27) H1FS: CACCATGTTGGGCGTTTTTCG (SEQ ID NO: 28) H1FA: CTAGCAGTATTGRCATGCCG
[0171] The PCR protocol was followed as previously described with the exception of altering the annealing temperature to 55° C. After a single band was isolated and viewed through gel electrophoresis, the amplified fragment was purified as described earlier and used in the pENTR/D TOPO® (Invitrogen) transformation, according to the manufacturer's instructions. Chemically competent E. coli were then transformed as previously described, and transferred to LB plates containing 50 ppm of kanamycin. Following 37° C. incubation overnight, transformants containing the plasmid and insert were selected after crude DNA extraction and plasmid size analysis, as previously described. The selected transformants were scraped from the plate and used to inoculate a fresh 15 mL tube containing 5 ml of LB/Kanamycin medium (0.0001%). Cultures were placed in the 37° C. shaking incubator overnight. Cells were harvested by centrifugation and the plasmid DNA extracted as previously described. Plasmid DNA was digested to confirm the presence of the insert sequence, and then submitted for sequencing. The LR Clonase reaction (Gateway Cloning, Invitrogen) was used, according to manufacturer's instructions, to directionally transfer the insert from the pENTR/D vector into the destination vector. The destination vector is designed for expression of a gene of interest, in T. reesei, under control of the CBH1 promoter and terminator, with A. niger acetamidase for selection.
Example 7
Biolistic Transformation
[0172] A T. reesei spore suspension was spread onto the center ˜6 cm diameter of an acetamidase transformation plate (150 μL of a 5×107-5×108 spore/mL suspension). The plate was then air dried in a biological hood. The stopping screens (BioRad 165-2336) and the macrocarrier holders (BioRad 1652322) were soaked in 70% ethanol and air dried. DriRite desiccant was placed in small Petri dishes (6 cm Pyrex) and overlaid with Whatman filter paper. The macrocarrier holder containing the macrocarrier (BioRad 165-2335) was placed flatly on top of the filter paper and the Petri dish lid replaced.
[0173] A tungsten particle suspension was prepared by adding 60 mg tungsten M-10 particles (microcarrier, 0.7 micron, BioRad #1652266) to an Eppendorf tube. 1 mL ethanol (100%) was added. The tungsten was vortexed in the ethanol solution and allowed to soak for 15 minutes. The Eppendorf tube was microfuged briefly at maximum speed to pellet the tungsten. The ethanol was decanted and washed three times with sterile distilled water. After the water wash was decanted the third time, the tungsten was resuspended in 1 mL of sterile 50% glycerol.
[0174] The transformation reaction was prepared by adding 25 μL suspended tungsten to a 1.5 mL Eppendorf tube for each transformation. Subsequent additions were made in order, 2 μL DNA pTrex3g expression vectors, 25 μL 2.5M CaCl2, 10 μL 0.1M spermidine. The reaction was vortexed continuously for 5-10 minutes, keeping the tungsten suspended. The Eppendorf tube was the microfuged briefly and decanted. The tungsten pellet was washed with 200 μL of 70% ethanol, microfuged briefly to pellet and decanted. The pellet was washed with 200 μL of 100% ethanol, microfuged briefly to pellet, and decanted. The tungsten pellet was resuspended in 24 μL 100% ethanol. The Eppendorf tube was placed in an ultrasonic water bath for 15 seconds and 8 μL aliquots were transferred onto the center of the desiccated macrocarriers. The macrocarriers were left to dry in the desiccated Petri dishes.
[0175] A Helium tank was turned on to 1500 psi. 1100 psi rupture discs (BioRad 165-2329) were used in the Model PDS-1000/He Biolistic Particle Delivery System (BioRad).
[0176] When the tungsten solution was dry, a stopping screen and the macrocarrier holder were inserted into the PDS-1000. An acetamidase plate, containing the target T. reesei spores, was placed 6 cm below the stopping screen. A vacuum of 29 inches Hg was pulled on the chamber and held. The He Biolistic Particle Delivery System was fired. The chamber was vented and the acetamidase plate removed for incubation at 28° C. until colonies appeared (5 days).
TABLE-US-00008 Modified amdS Biolistic agar (MABA) per liter Part I, make in 500 ml dH2O 1000x salts 1 ml Noble agar 20 g pH to 6.0, autoclave Part II, make in 500 ml dH2O Acetamide 0.6 g CsCl 1.68 g Glucose 20 g KH2PO4 15 g MgSO4•7H2O 0.6 g CaCl2•2H2O 0.6 g pH to 4.5, 0.2 micron filter sterilize; leave in 50° C. oven to warm, add to agar, mix, pour plates. Stored at room temperature.
TABLE-US-00009 1000x Salts per liter FeSO4•7H2O 5 g MnSO4•H2O 1.6 g ZnSO4•7H2O 1.4 g CoCl2•6H2O 1 g Bring up to 1 L dH2O. 0.2 micron filter sterilize
Example 8
Expression of α-1,3 glucanases by T. reesei Transformants
[0177] A 1 cm2 agar plug was used to inoculate Proflo seed media. Cultures were incubated at 28° C., with 200 rpm shaking. On the second day, a 10% transfer was aseptically made into Production media. The cultures were incubated at 28° C., with 200 rpm shaking. On the third day, cultures were harvested by centrifugation. Supernatants were sterile-filtered (0.2 μm PES) and stored at 4° C. Analysis by SDS-PAGE identified clones expressing the respective alpha-glucanase genes.
Example 9
Preparation of Insoluble Glucan Substrate
[0178] Four sterile flasks containing BHI (brain heart infusion) broth were inoculated with Streptococcus sobrinus (ATCC 27607), from a BHI plate. The cultures were incubated at 37° C. for 24 hrs, static, after which they were visibly turbid. The supernatants (containing the S. sobrinus glucosyltransferases) were harvested by centrifugation (15 minutes, 10,000 rpm). The supernatants were pooled and sterile-filtered (0.22 μm) to remove any remaining cells. Aseptically, sucrose was added to a final concentration of 5%, which induces the glucosyltransferases to produce glucan polymer. The culture supernatant plus sucrose was sealed, mixed, and stored at 37° C. incubator for 24-48 hrs (static). A fluffy precipitate formed and was harvested by centrifugation (10,000 rpm, 15 minutes). The supernatant was decanted, leaving the precipitate, which was washed with dI water three times, lastly in a tared Eppendorf tube. The glucan was dried in a SpeedVac, and the Eppendorf weight was recorded after drying.
Example 10
PAHBAH Reducing Sugars Assay to Measure the Activity of Cloned Alpha-Glucanases
[0179] Transformed T. reesei culture supernatants, buffer and insoluble glucan were distributed into a round-bottom 96-well plate in the amounts listed below. Two types of buffers (pH 4.5 and pH 6.0) were used to compare activity levels. After the samples were distributed, the 96-well plate was sealed and placed into a shaking 37° C. incubator overnight.
[0180] Glucan Hydrolysis Mixture:
TABLE-US-00010 50 μL culture supernatant 50 μL of a 28 mg/mL glucan solution 5 μL 1M Citrate buffer (pH 4.5 or 6.0) 105 μL
[0181] PAHBAH solution:
TABLE-US-00011 0.5 g Sodium potassium tartrate 0.15 g p-hydroxybenzoic acid hydrazide (PAHBAH) 10 mL 2% NaOH
[0182] Following incubation, 150 μL, of freshly made PAHBAH (p-hydroxybenzoic acid hydrazide) reagent was transferred into 0.2 mL PCR tubes along with 20 μL of each hydrolysis mixture. These tubes were then lightly mixed and placed into a thermocycler, where they were heated to 99° C. for 30 minutes. The PCR tubes were removed and 150 μL, of each sample was transferred to a fresh 96-well plate. The absorbance of each sample was measured at 410 nm. Results of this assay are shown in FIG. 3.
Sequence CWU
1
1
341635PRTHypocrea tawa 1Met Leu Gly Val Phe Arg Arg Leu Gly Leu Gly Ser
Leu Ala Ala Ala 1 5 10
15 Ala Leu Ser Ser Leu Gly Thr Ala Ala Pro Ala Asn Val Ala Ile Arg
20 25 30 Ser Leu Glu
Glu Arg Ala Ser Ser Ala Asp Arg Leu Val Phe Cys His 35
40 45 Phe Met Ile Gly Ile Val Gly Asp
Arg Gly Ser Ser Ala Asp Tyr Asp 50 55
60 Asp Asp Met Gln Arg Ala Lys Ala Ala Gly Ile Asp Ala
Phe Ala Leu 65 70 75
80 Asn Ile Gly Val Asp Gly Tyr Thr Asp Gln Gln Leu Gly Tyr Ala Tyr
85 90 95 Asp Ser Ala Asp
Arg Asn Gly Met Lys Val Phe Ile Ser Phe Asp Phe 100
105 110 Asn Trp Trp Ser Pro Gly Asn Ala Val
Gly Val Gly Gln Lys Ile Ala 115 120
125 Gln Tyr Ala Asn Arg Pro Ala Gln Leu Tyr Val Asp Asn Arg
Pro Phe 130 135 140
Ala Ser Ser Phe Ala Gly Asp Gly Leu Asp Val Asn Ala Leu Arg Asn 145
150 155 160 Ala Ala Gly Ser Asn
Val Tyr Phe Val Pro Asn Phe His Pro Gly Gln 165
170 175 Ser Ser Pro Ser Asn Ile Asp Gly Ala Leu
Asn Trp Met Ala Trp Asp 180 185
190 Asn Asp Gly Asn Asn Lys Ala Pro Lys Gln Gly Gln Thr Val Thr
Val 195 200 205 Ala
Asp Gly Asp Asn Ala Tyr Lys Asn Trp Leu Gly Gly Lys Pro Tyr 210
215 220 Leu Ala Pro Val Ser Pro
Trp Phe Phe Thr His Phe Gly Pro Glu Val 225 230
235 240 Ser Tyr Ser Lys Asn Trp Val Phe Pro Gly Gly
Ala Leu Ile Tyr Asn 245 250
255 Arg Trp Gln Gln Val Leu Gln Gln Gly Phe Pro Met Val Glu Ile Val
260 265 270 Thr Trp
Asn Asp Tyr Gly Glu Ser His Tyr Val Gly Pro Leu Lys Ser 275
280 285 Lys His Phe Asp Asp Gly Asn
Ser Lys Trp Val Asn Asp Met Pro His 290 295
300 Asp Gly Phe Leu Asp Leu Ser Lys Pro Phe Ile Ala
Ala Tyr Lys Asn 305 310 315
320 Arg Asp Thr Asp Ile Ser Lys Tyr Val Gln Asn Glu Gln Leu Val Tyr
325 330 335 Trp Tyr Arg
Arg Asn Leu Lys Ala Leu Asp Cys Asp Ala Thr Asp Thr 340
345 350 Thr Ser Asn Arg Pro Ala Asn Asn
Gly Ser Gly Asn Tyr Phe Met Gly 355 360
365 Arg Pro Asp Gly Trp Gln Thr Met Asp Asp Thr Val Tyr
Val Ala Ala 370 375 380
Leu Leu Lys Thr Ala Gly Ser Val Thr Val Thr Ser Gly Gly Thr Thr 385
390 395 400 Gln Thr Phe Gln
Gly Asn Ala Gly Ala Asn Leu Phe Gln Ile Pro Ala 405
410 415 Ser Ile Gly Gln Gln Lys Phe Ala Leu
Thr Arg Asn Gly Gln Thr Val 420 425
430 Phe Ser Gly Thr Ser Leu Met Asp Ile Thr Asn Val Cys Ser
Cys Gly 435 440 445
Ile Tyr Asn Phe Asn Pro Tyr Val Gly Thr Ile Pro Ala Gly Phe Asp 450
455 460 Asp Pro Leu Gln Ala
Asp Gly Leu Phe Ser Leu Thr Ile Gly Leu His 465 470
475 480 Val Thr Thr Cys Gln Ala Lys Pro Ser Leu
Gly Thr Asn Pro Pro Val 485 490
495 Thr Ser Gly Pro Val Ser Ser Leu Pro Ala Ser Ser Thr Thr Arg
Ala 500 505 510 Ser
Ser Pro Pro Val Ser Ser Thr Arg Val Ser Ser Pro Pro Val Ser 515
520 525 Ser Pro Pro Val Thr Ser
Arg Thr Ser Ser Ser Pro Pro Pro Pro Ala 530 535
540 Ser Ser Thr Pro Ser Ser Gly Gln Val Cys Val
Ala Gly Thr Val Ala 545 550 555
560 Asp Gly Glu Ser Gly Asn Tyr Ile Gly Leu Cys Gln Phe Ser Cys Asn
565 570 575 Tyr Gly
Tyr Cys Pro Pro Gly Pro Cys Lys Cys Thr Ala Phe Gly Ala 580
585 590 Pro Ile Ser Pro Pro Ala Ser
Asn Gly Arg Asn Gly Cys Pro Leu Pro 595 600
605 Gly Glu Gly Asp Gly Tyr Leu Gly Leu Cys Ser Phe
Ser Cys Asn His 610 615 620
Asn Tyr Cys Pro Pro Thr Ala Cys Gln Tyr Cys 625 630
635 2622PRTTrichoderma reesei 2Met Phe Gly Leu Val Arg
Arg Leu Gly Val Gly Ala Leu Val Ala Ala 1 5
10 15 Ala Leu Ser Ser Leu Ala Ala Ala Ala Pro Ala
Asn Val Ala Ile Arg 20 25
30 Ser Leu Glu Glu Arg Ala Ser Ser Ala Asp Arg Leu Val Phe Cys
His 35 40 45 Phe
Met Ile Gly Ile Cys Gly Asp Arg Thr Ser Ser Thr Asp Tyr Asp 50
55 60 Asp Asp Met Gln Arg Ala
Lys Ala Ala Gly Ile Asp Ala Phe Ala Leu 65 70
75 80 Asn Ile Gly Val Asp Gly Tyr Thr Asp Gln Gln
Leu Asn Phe Ala Tyr 85 90
95 Asp Ala Ala Asp Arg Ala Gly Met Lys Val Phe Ile Ser Phe Asp Phe
100 105 110 Asn Trp
Trp Ser Pro Gly Asn Ala Ala Gly Val Gly Gln Lys Ile Ala 115
120 125 Gln Tyr Ala Ser Arg Pro Ala
Gln Leu Tyr Val Asp Asn Arg Pro Phe 130 135
140 Ala Ser Ser Phe Ala Gly Asp Gly Leu Asp Val Asn
Thr Leu Arg Asn 145 150 155
160 Ala Ala Gly Ser Asn Val Tyr Phe Val Pro Asn Phe His Pro Gly Gln
165 170 175 Ser Ser Pro
Ser Thr Ile Asp Gly Ala Leu Asn Trp Met Ala Trp Asp 180
185 190 Asn Asp Gly Asn Asn Lys Ala Pro
Lys Pro Gly Gln Asn Val Thr Val 195 200
205 Ala Asp Gly Asp Asn Ser Tyr Arg Ser Trp Leu Ala Gly
Lys Pro Tyr 210 215 220
Leu Ala Pro Val Ser Pro Trp Phe Phe Thr His Phe Gly Pro Glu Val 225
230 235 240 Ser Tyr Ser Lys
Asn Trp Val Phe Pro Gly Gly Ser Leu Trp Tyr Asp 245
250 255 Arg Trp Gln Asp Val Leu Arg Gln Gly
Phe Glu Met Val Glu Ile Val 260 265
270 Thr Trp Asn Asp Tyr Gly Glu Ser His Tyr Thr Gly Pro Leu
Glu Ser 275 280 285
Arg His Tyr Asp Asp Gly Asn Ser Lys Trp Thr Asn Asp Met Pro His 290
295 300 Asp Gly Phe Leu Asp
Leu Ala Lys Pro Phe Ile Ala Ala Tyr Lys Asn 305 310
315 320 Arg Asp Thr Asp Val Ala Pro Tyr Ile Gln
Asn Glu Gln Leu Ile Tyr 325 330
335 Trp Tyr Arg Arg Asn Leu Lys Gly Leu Asp Cys Asp Ala Thr Asp
Thr 340 345 350 Thr
Ser Asn Arg Pro Ala Asn Asn Gly Ser Gly Asn Tyr Phe Met Gly 355
360 365 Arg Pro Asp Gly Trp Gln
Thr Met Asp Asp Thr Val Tyr Val Val Ala 370 375
380 Leu Leu Lys Ser Ala Gly Thr Val Thr Val Thr
Ser Gly Gly Ala Thr 385 390 395
400 Gln Thr Phe Gln Gly Thr Ala Gly Ala Asn Leu Phe Glu Val Pro Ala
405 410 415 Asn Leu
Gly Gln Gln Lys Phe Ala Leu Ser Arg Asn Gly Gln Thr Val 420
425 430 Phe Ser Ser Thr Ser Leu Met
Asp Ile Thr Asn Val Cys Pro Cys Gly 435 440
445 Ile Tyr Asn Phe Asn Pro Tyr Val Gly Thr Val Pro
Ala Gly Phe Asp 450 455 460
Asp Pro Leu Gly Pro Asp Gly Leu Ala Ser Leu Thr Ile Gly Leu His 465
470 475 480 Val Thr Thr
Cys Gln Ala Lys Pro Ser Leu Gly Thr Asn Pro Pro Ile 485
490 495 Thr Ser Gly Pro Gly Ser Ser Val
Pro Val Ser Thr Pro Pro Gly Ser 500 505
510 Thr Thr Arg Phe Ser Ser Thr Pro Val Ser Ser Arg Ser
Ser Ser Ser 515 520 525
Thr Pro Pro Val Ser Thr Pro Pro Pro Gly Gln Val Cys Val Ala Gly 530
535 540 Thr Val Ala Asp
Gly Gln Ser Gly Asn Tyr Ile Gly Leu Cys Asn Phe 545 550
555 560 Ser Cys Asn Phe Gly Tyr Cys Pro Pro
Gly Pro Cys Lys Cys Thr Ala 565 570
575 Tyr Gly Ala Pro Ile Asn Pro Pro Ala Thr Asn Gly Arg Asn
Gly Cys 580 585 590
Pro Leu Pro Gly Glu Asp Asp Ser Tyr Leu Gly Leu Cys Ser Phe Ser
595 600 605 Cys Asn His Asn
Tyr Cys Pro Pro Thr Ala Cys Gln Tyr Cys 610 615
620 3627PRTTrichoderma konilangbra 3Met Leu Gly Ile Leu
Arg Arg Leu Ala Leu Gly Ala Leu Ala Ala Ala 1 5
10 15 Ala Leu Ser Pro Leu Val Val Ala Ala Pro
Ala Asn Val Ala Ile Arg 20 25
30 Ser Leu Glu Glu Arg Ala Ser Ser Ala Asp Arg Leu Val Phe Cys
His 35 40 45 Phe
Met Ile Gly Ile Cys Gly Asp Arg Gly Ser Ser Thr Asp Tyr Asp 50
55 60 Asp Asp Met Gln Arg Ala
Lys Ala Ala Gly Ile Asp Ala Phe Ala Leu 65 70
75 80 Asn Ile Gly Val Asp Gly Tyr Thr Asp Gln Gln
Leu Asn Phe Ala Tyr 85 90
95 Asp Ala Ala Asp Arg Ala Gly Met Lys Val Phe Ile Ser Phe Asp Phe
100 105 110 Asn Trp
Trp Ser Pro Gly Asn Ala Val Gly Val Gly Gln Lys Ile Ala 115
120 125 Gln Tyr Ala Ser Arg Pro Ala
Gln Leu Tyr Val Asp Asn Arg Pro Phe 130 135
140 Ala Ser Ser Phe Ala Gly Asp Gly Leu Asp Val Asn
Ala Leu Arg Asn 145 150 155
160 Ala Ala Gly Ser Asn Val Tyr Phe Val Pro Asn Phe His Pro Gly Gln
165 170 175 Ser Ser Pro
Ser Thr Ile Asp Gly Ala Leu Asn Trp Met Ala Trp Asp 180
185 190 Asn Asp Gly Asn Asn Lys Ala Pro
Lys Pro Gly Arg Asn Val Thr Val 195 200
205 Ala Asp Gly Asp Asn Ser Tyr Arg Ser Trp Leu Gly Gly
Lys Pro Tyr 210 215 220
Leu Ala Pro Val Ser Pro Trp Phe Phe Thr His Phe Gly Pro Glu Val 225
230 235 240 Ser Phe Ser Lys
Asn Trp Val Phe Pro Gly Gly Ser Leu Leu Tyr Asp 245
250 255 Arg Trp Gln Asp Val Leu Arg Gln Gly
Pro Glu Met Val Glu Ile Ile 260 265
270 Thr Trp Asn Asp Tyr Gly Glu Ser His Tyr Thr Gly Pro Leu
Lys Ser 275 280 285
Arg His Tyr Asp Asp Gly Asn Ser Lys Trp Thr Asn Asp Met Pro His 290
295 300 Asp Gly Phe Leu Asp
Leu Ser Lys Pro Phe Ile Ala Ala Tyr Lys Asn 305 310
315 320 Arg Asp Thr Asn Val Ala Arg Tyr Val Gln
Ser Asp Gln Leu Val Tyr 325 330
335 Trp Tyr Arg Arg Thr Leu Lys Gly Leu Asp Cys Asp Ala Thr Asp
Thr 340 345 350 Thr
Ser Asn Arg Pro Ala Asn Asn Ala Ser Gly Asn Tyr Phe Met Gly 355
360 365 Arg Pro Asp Gly Trp Gln
Thr Met Asp Asp Thr Val Tyr Val Val Ala 370 375
380 Leu Leu Thr Ala Ala Gly Thr Val Thr Val Thr
Ser Gly Gly Ala Thr 385 390 395
400 Gln Thr Phe Gln Gly Thr Ala Gly Ala Asn Leu Phe Glu Val Pro Ala
405 410 415 Asn Leu
Gly Gln Gln Lys Phe Ala Leu Ser Arg Asn Gly Gln Thr Val 420
425 430 Phe Ser Ser Thr Ser Leu Met
Asp Ile Ala Asn Val Cys Pro Cys Gly 435 440
445 Leu Tyr Asn Phe Asn Pro Tyr Val Gly Thr Val Pro
Pro Gly Phe Asp 450 455 460
Asp Pro Leu Gln Ala Asp Gly Leu Ala Ser Leu Thr Ile Gly Leu His 465
470 475 480 Val Thr Thr
Cys Gln Ala Arg Pro Ser Leu Gly Thr Asn Pro Pro Ile 485
490 495 Thr Ser Gly Pro Gly Ser Ser Val
Pro Ala Ser Thr Thr Arg Ser Thr 500 505
510 Ser Pro Pro Gly Ser Thr Ser Arg Phe Ser Ser Thr Pro
Val Ser Ser 515 520 525
Arg Ser Ile Ser Ser Thr Pro Pro Val Ser Thr Pro Pro Pro Gly Gln 530
535 540 Val Cys Val Ala
Gly Thr Val Ala Asp Gly Gln Ser Gly Asn Tyr Ile 545 550
555 560 Gly Leu Cys Asn Phe Ser Cys Asn Phe
Gly Tyr Cys Pro Pro Gly Pro 565 570
575 Cys Lys Cys Thr Ala Phe Gly Ala Pro Ile Asn Pro Pro Ala
Thr Asn 580 585 590
Gly Arg Asn Gly Cys Pro Leu Pro Gly Glu Asp Asp Ser Tyr Leu Gly
595 600 605 Leu Cys Ser Phe
Ser Cys Asn His Asn Tyr Cys Pro Pro Thr Ala Cys 610
615 620 Gln Tyr Cys 625
4634PRTTrichoderma harzianum 4Met Leu Gly Val Val Arg Arg Leu Gly Leu Gly
Ala Leu Ala Ala Ala 1 5 10
15 Ala Leu Ser Ser Leu Gly Ser Ala Ala Pro Ala Asn Val Ala Ile Arg
20 25 30 Ser Leu
Glu Glu Arg Ala Ser Ser Ala Asp Arg Leu Val Phe Cys His 35
40 45 Phe Met Ile Gly Ile Val Gly
Asp Arg Gly Ser Ser Ala Asp Tyr Asp 50 55
60 Asp Asp Met Gln Arg Ala Lys Ala Ala Gly Ile Asp
Ala Phe Ala Leu 65 70 75
80 Asn Ile Gly Val Asp Gly Tyr Thr Asp Gln Gln Leu Gly Tyr Ala Tyr
85 90 95 Asp Ser Ala
Asp Arg Asn Gly Met Lys Val Phe Ile Ser Phe Asp Phe 100
105 110 Asn Trp Trp Ser Pro Gly Asn Ala
Val Gly Val Gly Gln Lys Ile Ala 115 120
125 Gln Tyr Ala Ser Arg Pro Ala Gln Leu Tyr Val Asp Asn
Arg Pro Phe 130 135 140
Ala Ser Ser Phe Ala Gly Asp Gly Leu Asp Val Asn Ala Leu Arg Ser 145
150 155 160 Ala Ala Gly Ser
Asn Val Tyr Phe Val Pro Asn Phe His Pro Gly Gln 165
170 175 Ser Ser Pro Ser Asn Ile Asp Gly Ala
Leu Asn Trp Met Ala Trp Asp 180 185
190 Asn Asp Gly Asn Asn Lys Ala Pro Lys Pro Gly Gln Thr Val
Thr Val 195 200 205
Ala Asp Gly Asp Asn Ala Tyr Lys Asn Trp Leu Gly Gly Lys Pro Tyr 210
215 220 Leu Ala Pro Val Ser
Pro Trp Phe Phe Thr His Phe Gly Pro Glu Val 225 230
235 240 Ser Tyr Ser Lys Asn Trp Val Phe Pro Gly
Gly Pro Leu Ile Tyr Asn 245 250
255 Arg Trp Gln Gln Val Leu Gln Gln Gly Phe Pro Met Val Glu Ile
Val 260 265 270 Thr
Trp Asn Asp Tyr Gly Glu Ser His Tyr Val Gly Pro Leu Lys Ser 275
280 285 Lys His Phe Asp Asp Gly
Asn Ser Lys Trp Val Asn Asp Met Pro His 290 295
300 Asp Gly Phe Leu Asp Leu Ser Lys Pro Phe Ile
Ala Ala Tyr Lys Asn 305 310 315
320 Arg Asp Thr Asp Ile Ser Lys Tyr Val Gln Asn Glu Gln Leu Val Tyr
325 330 335 Trp Tyr
Arg Arg Asn Leu Lys Ala Leu Asp Cys Asp Ala Thr Asp Thr 340
345 350 Thr Ser Asn Arg Pro Ala Asn
Asn Gly Ser Gly Asn Tyr Phe Met Gly 355 360
365 Arg Pro Asp Gly Trp Gln Thr Met Asp Asp Thr Val
Tyr Val Ala Ala 370 375 380
Leu Leu Lys Thr Ala Gly Ser Val Thr Val Thr Ser Gly Gly Thr Thr 385
390 395 400 Gln Thr Phe
Gln Ala Asn Ala Gly Ala Asn Leu Phe Gln Ile Pro Ala 405
410 415 Ser Ile Gly Gln Gln Lys Phe Ala
Leu Thr Arg Asn Gly Gln Thr Val 420 425
430 Phe Ser Gly Thr Ser Leu Met Asp Ile Thr Asn Val Cys
Ser Cys Gly 435 440 445
Ile Tyr Asn Phe Asn Pro Tyr Val Gly Thr Ile Pro Ala Gly Phe Asp 450
455 460 Asp Pro Leu Gln
Ala Asp Gly Leu Phe Ser Leu Thr Ile Gly Leu His 465 470
475 480 Val Thr Thr Cys Gln Ala Lys Pro Ser
Leu Gly Thr Asn Pro Pro Val 485 490
495 Thr Ser Gly Pro Val Ser Ser Leu Pro Ala Ser Ser Thr Thr
Arg Ala 500 505 510
Ser Ser Pro Pro Val Ser Ser Thr Arg Val Ser Ser Pro Pro Val Ser
515 520 525 Ser Pro Pro Val
Ser Arg Thr Ser Ser Pro Pro Pro Pro Pro Ala Ser 530
535 540 Ser Thr Pro Pro Ser Gly Gln Val
Cys Val Ala Gly Thr Val Ala Asp 545 550
555 560 Gly Glu Ser Gly Asn Tyr Ile Gly Leu Cys Gln Phe
Ser Cys Asn Tyr 565 570
575 Gly Tyr Cys Pro Pro Gly Pro Cys Lys Cys Thr Ala Phe Gly Ala Pro
580 585 590 Ile Ser Pro
Pro Ala Ser Asn Gly Arg Asn Gly Cys Pro Leu Pro Gly 595
600 605 Glu Gly Asp Gly Tyr Leu Gly Leu
Cys Ser Phe Ser Cys Asn His Asn 610 615
620 Tyr Cys Pro Pro Thr Ala Cys Gln Tyr Cys 625
630 5633PRTArtificial Sequencesynthetic consensus
sequence 5Met Leu Gly Val Val Arg Arg Leu Gly Leu Gly Ala Leu Ala Ala Ala
1 5 10 15 Ala Leu
Ser Ser Leu Gly Xaa Ala Ala Pro Ala Asn Val Ala Ile Arg 20
25 30 Ser Leu Glu Glu Arg Ala Ser
Ser Ala Asp Arg Leu Val Phe Cys His 35 40
45 Phe Met Ile Gly Ile Xaa Gly Asp Arg Gly Ser Ser
Xaa Asp Tyr Asp 50 55 60
Asp Asp Met Gln Arg Ala Lys Ala Ala Gly Ile Asp Ala Phe Ala Leu 65
70 75 80 Asn Ile Gly
Val Asp Gly Tyr Thr Asp Gln Gln Leu Xaa Xaa Ala Tyr 85
90 95 Asp Xaa Ala Asp Arg Xaa Gly Met
Lys Val Phe Ile Ser Phe Asp Phe 100 105
110 Asn Trp Trp Ser Pro Gly Asn Ala Val Gly Val Gly Gln
Lys Ile Ala 115 120 125
Gln Tyr Ala Ser Arg Pro Ala Gln Leu Tyr Val Asp Asn Arg Pro Phe 130
135 140 Ala Ser Ser Phe
Ala Gly Asp Gly Leu Asp Val Asn Ala Leu Arg Asn 145 150
155 160 Ala Ala Gly Ser Asn Val Tyr Phe Val
Pro Asn Phe His Pro Gly Gln 165 170
175 Ser Ser Pro Ser Xaa Ile Asp Gly Ala Leu Asn Trp Met Ala
Trp Asp 180 185 190
Asn Asp Gly Asn Asn Lys Ala Pro Lys Pro Gly Gln Xaa Val Thr Val
195 200 205 Ala Asp Gly Asp
Asn Xaa Tyr Xaa Xaa Trp Leu Gly Gly Lys Pro Tyr 210
215 220 Leu Ala Pro Val Ser Pro Trp Phe
Phe Thr His Phe Gly Pro Glu Val 225 230
235 240 Ser Tyr Ser Lys Asn Trp Val Phe Pro Gly Gly Ser
Leu Ile Tyr Xaa 245 250
255 Arg Trp Gln Xaa Val Leu Xaa Gln Gly Phe Xaa Met Val Glu Ile Val
260 265 270 Thr Trp Asn
Asp Tyr Gly Glu Ser His Tyr Xaa Gly Pro Leu Lys Ser 275
280 285 Xaa His Xaa Asp Asp Gly Asn Ser
Lys Trp Xaa Asn Asp Met Pro His 290 295
300 Asp Gly Phe Leu Asp Leu Ser Lys Pro Phe Ile Ala Ala
Tyr Lys Asn 305 310 315
320 Arg Asp Thr Asp Xaa Xaa Lys Tyr Val Gln Asn Glu Gln Leu Val Tyr
325 330 335 Trp Tyr Arg Arg
Asn Leu Lys Xaa Leu Asp Cys Asp Ala Thr Asp Thr 340
345 350 Thr Ser Asn Arg Pro Ala Asn Asn Gly
Ser Gly Asn Tyr Phe Met Gly 355 360
365 Arg Pro Asp Gly Trp Gln Thr Met Asp Asp Thr Val Tyr Val
Xaa Ala 370 375 380
Leu Leu Lys Thr Ala Gly Xaa Val Thr Val Thr Ser Gly Gly Xaa Thr 385
390 395 400 Gln Thr Phe Gln Gly
Xaa Ala Gly Ala Asn Leu Phe Xaa Xaa Pro Ala 405
410 415 Xaa Xaa Gly Gln Gln Lys Phe Ala Leu Xaa
Arg Asn Gly Gln Thr Val 420 425
430 Phe Ser Xaa Thr Ser Leu Met Asp Ile Thr Asn Val Cys Xaa Cys
Gly 435 440 445 Ile
Tyr Asn Phe Asn Pro Tyr Val Gly Thr Xaa Pro Ala Gly Phe Asp 450
455 460 Asp Pro Leu Gln Ala Asp
Gly Leu Xaa Ser Leu Thr Ile Gly Leu His 465 470
475 480 Val Thr Thr Cys Gln Ala Lys Pro Ser Leu Gly
Thr Asn Pro Pro Xaa 485 490
495 Thr Ser Gly Pro Xaa Ser Ser Xaa Pro Ala Ser Xaa Thr Xaa Arg Ala
500 505 510 Ser Ser
Pro Pro Xaa Ser Xaa Thr Arg Xaa Ser Ser Xaa Pro Val Ser 515
520 525 Ser Xaa Xaa Xaa Arg Xaa Ser
Ser Ser Xaa Pro Pro Xaa Xaa Xaa Ser 530 535
540 Thr Pro Pro Xaa Gly Gln Val Cys Val Ala Gly Thr
Val Ala Asp Gly 545 550 555
560 Xaa Ser Gly Asn Tyr Ile Gly Leu Cys Xaa Phe Ser Cys Asn Xaa Gly
565 570 575 Tyr Cys Pro
Pro Gly Pro Cys Lys Cys Thr Ala Phe Gly Ala Pro Ile 580
585 590 Xaa Pro Pro Ala Xaa Asn Gly Arg
Asn Gly Cys Pro Leu Pro Gly Glu 595 600
605 Xaa Asp Xaa Tyr Leu Gly Leu Cys Ser Phe Ser Cys Asn
His Asn Tyr 610 615 620
Cys Pro Pro Thr Ala Cys Gln Tyr Cys 625 630
622DNAArtificial Sequencesynthetic oligonucleotide 6caccatgttt ggtcttgtcc
gc 22720DNAArtificial
Sequencesynthetic oligonucleotide 7tcagcagtac tggcatgctg
20820DNAArtificial Sequencesynthetic
oligonucleotide 8gtnttytgyc ayttyatgat
20926DNAArtificial Sequencesynthetic oligonucleotide
9gtnttytgyc ayttyatgat hggnat
261023DNAArtificial Sequencesynthetic oligonucleotide 10gaytaygayg
aygayatgca rcg
231132DNAArtificial Sequencesynthetic oligonucleotide 11gtrcayttrc
anggnccngg nggrcartan cc
321224DNAArtificial Sequencesynthetic oligonucleotide 12ytcnccnggn
agnggrcanc crtt
241330DNAArtificial Sequencesynthetic oligonucleotide 13rcartaytgr
cangcygtyg gyggrcarta
301420DNAArtificial Sequencesynthetic oligonucleotide 14ccccctggcc
aagtatgtgt
201520DNAArtificial Sequencesynthetic oligonucleotide 15gtacgcaaag
ttgagctgct
201620DNAArtificial Sequencesynthetic oligonucleotide 16agcacatcgc
tgatggatat
201720DNAArtificial Sequencesynthetic oligonucleotide 17aagtatacgt
tgcttccggc
201820DNAArtificial Sequencesynthetic oligonucleotide 18ctgacgatcg
gactrcacgt
201920DNAArtificial Sequencesynthetic oligonucleotide 19ggttgtcgac
gtagagctgt
202020DNAArtificial Sequencesynthetic oligonucleotide 20acgatcggca
gagtcatagg
202120DNAArtificial Sequencesynthetic oligonucleotide 21atcggattgc
atgtcacgac
202220DNAArtificial Sequencesynthetic oligonucleotide 22tacatccaga
ccgtcaccag
202320DNAArtificial Sequencesynthetic oligonucleotide 23acgtttgctc
ttgcggtatc
202420DNAArtificial Sequencesynthetic oligonucleotide 24tcattatccc
aggcctaaaa
202521DNAArtificial Sequencesynthetic oligonucleotide 25caccatgcta
ggcattctcc g
212620DNAArtificial Sequencesynthetic oligonucleotide 26tcagcagtat
tggcatgccg
202721DNAArtificial Sequencesynthetic oligonucleotide 27caccatgttg
ggcgtttttc g
212820DNAArtificial Sequencesynthetic oligonucleotide 28ctagcagtat
tgrcatgccg
20292145DNAHypocrea tawa 29atgttgggcg tttttcgccg cctcgggctc ggctcccttg
ccgccgcagc tctgtcttct 60ctcggcactg ccgctcccgc caatgttgct attcggtctc
tcgaggaacg tgcttcttct 120gccgaccgtc tcgtattctg tcacttcatg gttagtgttt
atttacgaag tatcagaatc 180aggactaaca tggcattttc atgacagatt ggtattgttg
gtgaccgtgg cagctcggca 240gactatgatg atgatatgca acgtgccaaa gccgctggca
ttgacgcctt cgctctgaat 300atcggcgttg acggctatac cgaccagcag cttgggtatg
cctatgactc tgccgatcgt 360aatggcatga aagtcttcat ttcattcgat ttcaattggt
ggagccccgg caatgcagtt 420ggtgttggcc agaagattgc gcagtatgcc aaccgtcccg
cccagctata tgtcgataac 480cgtccattcg cctcttcctt cgctggtgac ggtctggatg
taaatgcgtt gcgcaatgct 540gcaggctcca acgtttactt tgtgcccaac ttccaccctg
gtcaatcttc tccctcaaac 600attgacggcg ccctgaactg gatggtaagt tgcaactgca
gagctgagag taggaaagca 660aactgatgtg tttttaggcc tgggataatg atggaaacaa
caaggcaccc aagcaaggcc 720agacagtcac ggtggcagac ggcgacaacg cctacaagaa
ttggttaggt ggcaagcctt 780acctagcacc tgtctcacct tggtttttca cccatttcgg
ccccgaagtt tcatattcca 840agaactgggt tttcccaggt ggtgctctga tctataaccg
gtggcaacag gtcttgcagc 900aaggcttccc catggttgag attgttacat ggaatgacta
cggcgagtct cactacgtcg 960gcccacttaa gtctaagcat ttcgacgatg gcaactccaa
atgggtcaat gatatgcccc 1020atgatggatt cctggatctt tcaaagccgt tcattgctgc
ttataagaac agggatactg 1080acatctccaa gtatgttcag aatgagcagc ttgtctactg
gtaccgccgc aacttaaagg 1140cactggactg cgacgccacc gacaccacct ctaaccgccc
ggctaataat ggaagcggta 1200attactttat gggacgccct gatggttggc aaaccatgga
tgatactgtt tatgttgccg 1260cacttctcaa gactgccggt tctgttacgg tcacgtctgg
cggcaccact caaacgttcc 1320agggcaacgc cggagccaac ctcttccaaa tcccagccag
catcggccag caaaagtttg 1380ctctaactcg taacggtcag accgtcttta gcggaacctc
attgatggat atcaccaacg 1440tttgctcttg cggtatctac aacttcaacc catatgtggg
taccattcct gccggcttcg 1500acgaccctct tcaggctgac ggtcttttct ctttgaccat
cggattgcat gtcacgactt 1560gtcaggccaa gccatctctt ggaaccaatc ctcctgtcac
ttctggccct gtgtcctcgc 1620ttccagcttc ctccactacc cgcgcatcct cgcctcctgt
ttcttcaact cgcgtctctt 1680ccccccctgt ctcttcccct ccagttactt ctcgcacctc
ttcttctcct ccccctccgg 1740ccagcagcac gccgtcatcg ggtcaggttt gcgttgccgg
aaccgttgct gacggcgagt 1800ctggcaacta catcggcctg tgccaattca gctgcaagta
ggttgccccc atacccctta 1860cttgttttct taactaatcc tttgtagcta cggttactgc
ccaccaggac cgtgcaagtg 1920caccgccttt ggcgctccca tctcgccacc ggcaagcaat
gggcgcaatg gctgccctct 1980accgggcgaa ggagatggtt atctgggcct gtgcagtttc
agttgtaacc ataattactg 2040ccccccaacg gcatgccaat actgctagaa gggtgggcgc
gccgacccag ctttcttgta 2100caaagttggc attataagaa agcattgctt atcaatttgt
tgcaa 2145301908DNAHypocrea tawa 30atgttgggcg
tttttcgccg cctcgggctc ggctcccttg ccgccgcagc tctgtcttct 60ctcggcactg
ccgctcccgc caatgttgct attcggtctc tcgaggaacg tgcttcttct 120gccgaccgtc
tcgtattctg tcacttcatg attggtattg ttggtgaccg tggcagctcg 180gcagactatg
atgatgatat gcaacgtgcc aaagccgctg gcattgacgc cttcgctctg 240aatatcggcg
ttgacggcta taccgaccag cagcttgggt atgcctatga ctctgccgat 300cgtaatggca
tgaaagtctt catttcattc gatttcaatt ggtggagccc cggcaatgca 360gttggtgttg
gccagaagat tgcgcagtat gccaaccgtc ccgcccagct atatgtcgat 420aaccgtccat
tcgcctcttc cttcgctggt gacggtctgg atgtaaatgc gttgcgcaat 480gctgcaggct
ccaacgttta ctttgtgccc aacttccacc ctggtcaatc ttctccctca 540aacattgacg
gcgccctgaa ctggatggcc tgggataatg atggaaacaa caaggcaccc 600aagcaaggcc
agacagtcac ggtggcagac ggcgacaacg cctacaagaa ttggttaggt 660ggcaagcctt
acctagcacc tgtctcacct tggtttttca cccatttcgg ccccgaagtt 720tcatattcca
agaactgggt tttcccaggt ggtgctctga tctataaccg gtggcaacag 780gtcttgcagc
aaggcttccc catggttgag attgttacat ggaatgacta cggcgagtct 840cactacgtcg
gcccacttaa gtctaagcat ttcgacgatg gcaactccaa atgggtcaat 900gatatgcccc
atgatggatt cctggatctt tcaaagccgt tcattgctgc ttataagaac 960agggatactg
acatctccaa gtatgttcag aatgagcagc ttgtctactg gtaccgccgc 1020aacttaaagg
cactggactg cgacgccacc gacaccacct ctaaccgccc ggctaataat 1080ggaagcggta
attactttat gggacgccct gatggttggc aaaccatgga tgatactgtt 1140tatgttgccg
cacttctcaa gactgccggt tctgttacgg tcacgtctgg cggcaccact 1200caaacgttcc
agggcaacgc cggagccaac ctcttccaaa tcccagccag catcggccag 1260caaaagtttg
ctctaactcg taacggtcag accgtcttta gcggaacctc attgatggat 1320atcaccaacg
tttgctcttg cggtatctac aacttcaacc catatgtggg taccattcct 1380gccggcttcg
acgaccctct tcaggctgac ggtcttttct ctttgaccat cggattgcat 1440gtcacgactt
gtcaggccaa gccatctctt ggaaccaatc ctcctgtcac ttctggccct 1500gtgtcctcgc
ttccagcttc ctccactacc cgcgcatcct cgcctcctgt ttcttcaact 1560cgcgtctctt
ccccccctgt ctcttcccct ccagttactt ctcgcacctc ttcttctcct 1620ccccctccgg
ccagcagcac gccgtcatcg ggtcaggttt gcgttgccgg aaccgttgct 1680gacggcgagt
ctggcaacta catcggcctg tgccaattca gctgcaacta cggttactgc 1740ccaccaggac
cgtgcaagtg caccgccttt ggcgctccca tctcgccacc ggcaagcaat 1800gggcgcaatg
gctgccctct accgggcgaa ggagatggtt atctgggcct gtgcagtttc 1860agttgtaacc
ataattactg ccccccaacg gcatgccaat actgctag
1908312063DNATrichoderma reesei 31atgtttggtc ttgtccgccg actcggggtc
ggcgcccttg tcgccgcagc cctttcctcc 60ctcgctgccg ccgcgccagc caacgtcgcc
atccgctccc tcgaggaacg ggctagcagc 120gcagatagac ttgtgttttg ccactttatg
gtgcgtttgt ccgccccaag agcattgaaa 180attcagtaat cactgacacg ccttactcgt
gatgctagat tgggatatgt ggtgatcgca 240cctccagtac cgattatgat gatgatatgc
agcgagccaa ggccgcgggc attgacgcct 300ttgcccttaa cattggtgtc gacggataca
cggaccagca gctcaacttt gcctacgacg 360ccgctgatcg cgccgggatg aaggtgttca
tctcctttga cttcaactgg tggagccccg 420gcaacgcggc aggcgtcggc cagaagattg
cccaatatgc gtcgcggccc gcacagctct 480acgtcgacaa ccgtcccttt gcatcgtcgt
ttgccggtga cggccttgac gtgaatacgc 540tgcggaatgc ggccggcagc aacgtgtact
ttgtgcccaa cttccacccc gggcagtcgt 600cgccgtccac catcgacggg gctctgaact
ggatggtacg tctgggcgtt gtggctcgag 660gataaagcaa agaccaagta ctcatgcgct
gacacgctcc acaggcctgg gacaacgacg 720gcaacaacaa ggcccccaag cccggccaaa
acgtcacagt cgccgacggc gacaactcct 780accgcagctg gctcgccggc aagccctacc
tcgcccccgt ctcgccctgg ttcttcaccc 840acttcggccc agaggtatcg tacagtaaga
actgggtctt ccctggcggc tccctgtggt 900acgaccgctg gcaggacgtg ctgcgccagg
gcttcgagat ggtcgaaatc gtcacctgga 960acgattacgg tgagagccac tacacggggc
ccctggaaag tcgacactat gacgacggaa 1020actcgaaatg gaccaacgac atgccgcacg
acggcttcct ggacctggcg aagccattca 1080ttgccgcgta caagaaccgc gacacggacg
tggcgcccta catccagaat gagcagctga 1140tctactggta tcggcggaat ctcaaggggc
tggactgcga cgcgaccgac acgacgtcga 1200accgcccggc gaacaacggc agcggcaact
acttcatggg tcggcccgac gggtggcaga 1260cgatggacga cacggtgtat gtggtggcgc
tgctcaagag cgcgggcacg gtgacggtga 1320cgtcgggcgg cgccacgcag acgttccagg
gcaccgccgg cgccaacctg ttcgaggtcc 1380cagccaacct tgggcagcag aagtttgccc
tgtcccgcaa cgggcagacc gtcttcagca 1440gcacgtcgct gatggatatc accaatgtgt
gcccgtgcgg catctacaac ttcaacccgt 1500atgtcgggac tgtgcccgct ggctttgacg
acccgctcgg gcccgatggc cttgcttctt 1560tgacaatcgg actgcacgtc acgacttgtc
aggccaagcc gtcgctgggg accaacccgc 1620ccatcacttc cggccccggc tcctcggtgc
ccgtttccac tccgcccggt tccacgaccc 1680gcttctcgtc aacgccggtt tcatctcgct
ccagctcgtc cacgccgccg gttagcacgc 1740cgccgcctgg ccaagtctgt gtcgccggta
cggtggctga cggccagtcc ggcaactata 1800ttggcctctg caacttcagc tgcaagtaag
ttaccccatg tctcatgacg atgtatctcc 1860gacaccagct aacgtttgcc agcttcgggt
actgtccccc cggaccctgc aagtgcactg 1920cctacggcgc tccgatcaac ccaccagcaa
cgaatgggcg aaatgggtgc cccttgcctg 1980gagaagacga tagttatctg ggcctctgca
gcttcagctg caaccacaat tactgtccgc 2040caacagcatg ccagtactgc tga
2063321869DNATrichoderma reesei
32atgtttggtc ttgtccgccg actcggggtc ggcgcccttg tcgccgcagc cctttcctcc
60ctcgctgccg ccgcgccagc caacgtcgcc atccgctccc tcgaggaacg ggctagcagc
120gcagatagac ttgtgttttg ccactttatg attgggatat gtggtgatcg cacctccagt
180accgattatg atgatgatat gcagcgagcc aaggccgcgg gcattgacgc ctttgccctt
240aacattggtg tcgacggata cacggaccag cagctcaact ttgcctacga cgccgctgat
300cgcgccggga tgaaggtgtt catctccttt gacttcaact ggtggagccc cggcaacgcg
360gcaggcgtcg gccagaagat tgcccaatat gcgtcgcggc ccgcacagct ctacgtcgac
420aaccgtccct ttgcatcgtc gtttgccggt gacggccttg acgtgaatac gctgcggaat
480gcggccggca gcaacgtgta ctttgtgccc aacttccacc ccgggcagtc gtcgccgtcc
540accatcgacg gggctctgaa ctggatggcc tgggacaacg acggcaacaa caaggccccc
600aagcccggcc aaaacgtcac agtcgccgac ggcgacaact cctaccgcag ctggctcgcc
660ggcaagccct acctcgcccc cgtctcgccc tggttcttca cccacttcgg cccagaggta
720tcgtacagta agaactgggt cttccctggc ggctccctgt ggtacgaccg ctggcaggac
780gtgctgcgcc agggcttcga gatggtcgaa atcgtcacct ggaacgatta cggtgagagc
840cactacacgg ggcccctgga aagtcgacac tatgacgacg gaaactcgaa atggaccaac
900gacatgccgc acgacggctt cctggacctg gcgaagccat tcattgccgc gtacaagaac
960cgcgacacgg acgtggcgcc ctacatccag aatgagcagc tgatctactg gtatcggcgg
1020aatctcaagg ggctggactg cgacgcgacc gacacgacgt cgaaccgccc ggcgaacaac
1080ggcagcggca actacttcat gggtcggccc gacgggtggc agacgatgga cgacacggtg
1140tatgtggtgg cgctgctcaa gagcgcgggc acggtgacgg tgacgtcggg cggcgccacg
1200cagacgttcc agggcaccgc cggcgccaac ctgttcgagg tcccagccaa ccttgggcag
1260cagaagtttg ccctgtcccg caacgggcag accgtcttca gcagcacgtc gctgatggat
1320atcaccaatg tgtgcccgtg cggcatctac aacttcaacc cgtatgtcgg gactgtgccc
1380gctggctttg acgacccgct cgggcccgat ggccttgctt ctttgacaat cggactgcac
1440gtcacgactt gtcaggccaa gccgtcgctg gggaccaacc cgcccatcac ttccggcccc
1500ggctcctcgg tgcccgtttc cactccgccc ggttccacga cccgcttctc gtcaacgccg
1560gtttcatctc gctccagctc gtccacgccg ccggttagca cgccgccgcc tggccaagtc
1620tgtgtcgccg gtacggtggc tgacggccag tccggcaact atattggcct ctgcaacttc
1680agctgcaact tcgggtactg tccccccgga ccctgcaagt gcactgccta cggcgctccg
1740atcaacccac cagcaacgaa tgggcgaaat gggtgcccct tgcctggaga agacgatagt
1800tatctgggcc tctgcagctt cagctgcaac cacaattact gtccgccaac agcatgccag
1860tactgctga
1869332294DNATrichoderma konilangbra 33ggctccgcgg ccgccccctt caccatgcta
ggcattctcc gccgtctcgc gctcggcgcc 60ctcgccgccg cggccctctc tcctctcgtc
gtcgccgcgc ctgccaatgt cgccatccgc 120tccctcgagg aacgggcgag tagcgcagac
aggctcgtgt tctgccactt catggtacgt 180gtggctgccc gaaaaggata cggcgtcatc
ccgatagcaa cctgggctgt caccgcagca 240cccgatgtta caaccactga cgtgccggcc
tcgttgtaga ttgggatatg cggtgatcgc 300ggctccagca ctgattatga cgacgatatg
caaagggcca aggcagcggg catcgacgcg 360tttgcgttga acattggcgt cgatggatac
acggaccagc agctcaactt tgcgtacgac 420gccgccgacc gcgccgggat gaaggtgttc
atctccttcg acttcaactg gtggagcccc 480ggcaacgcag taggcgtcgg ccagaagatt
gcccaatacg cgtcgcggcc cgcacagctc 540tacgtcgaca accggccctt tgcgtcgtcg
tttgccggcg atggccttga cgtgaatgcg 600ctgcgcaacg ccgccggaag caacgtatac
tttgtgccca acttccaccc cgggcagtcc 660tccccgtcaa ccatcgacgg ggccctcaac
tggatggtac gtttggacgt tgcgagtcaa 720ggagaatccg cagaaaaagg ctgacagctg
aggccaatgt gctcatgtgc tgacaygccg 780gacaggcctg ggacaatgac ggaaacaaca
aggcccccaa gcccggccgc aacgtcaccg 840tcgccgacgg cgacaactcg taccgtagct
ggctgggcgg caagccctac ctggcccccg 900tttcgccctg gttcttcacc cacttcggcc
ccgaggtttc cttcagcaag aactgggtct 960tcccgggcgg ctcgctcctc tacgaccgct
ggcaggacgt gctgcrccag ggccccgaaa 1020tggtcgagat catcacctgg aacgattacg
gtgagagcca ctacaccggg cccctcaaaa 1080gtcgccacta tgacgacgga aactcgaaat
ggaccaacga catgccgcac gacggattcc 1140tggacctgtc gaaaccgttt atagcggcgt
acaagaaccg cgacacgaac gtggcacggt 1200acgtccagtc cgaccagctc gtctactggt
acagaaggac gctcaagggg ctggactgcg 1260acgcgactga cacgacgtca aaccggcccg
cgaacaacgc cagcggcaac tacttcatgg 1320gccggcccga cgggtggcag acgatggacg
acaccgtgta cgtggtggcg ctrctcacgg 1380ccgcgggaac tgtgacggtg acgtccggcg
gggccaccca gacgttccag ggcaccrccg 1440gagccaacct gttcgaggtc ccggccaacc
tgggccagca gaagtttgcc ctgtcccgca 1500acgggcagac cgtcttcagc agcacatcgc
tgatggatat cgctaatgtg tgcccgtgcg 1560gcctctacaa cttcaacccg tatgtcggga
ctgtcccgcc cggttttgac gacccgctgc 1620aggctgatgg ccttgcgtcg ctgacgatcg
gactgcacgt cacgacctgt caggccagac 1680cctccctggg aacgaacccg cccatcactt
ccggccccgg ctcctcggtg cccgcttcaa 1740ccacccgctc gacttctccg cccggttcca
cgagccgctt ctcgtcgacc ccggtttcgt 1800cccgctccat ctcttcgacg ccaccggtca
gcacgccgcc ccctggccaa gtatgtgtgg 1860ccggcacagt cgctgacggc cagtcgggca
actatattgg cctatgcaac ttcagctgca 1920agtaagtcgt cccacgttcc gtcatgatgt
ctctgcctca gctaacatgt gccagcttcg 1980gctactgtcc tcccggccct tgcaagtgca
ccgcctttgg cgctcccatc aacccaccgg 2040cgaccaatgg gcgaaacgga tgccccttgc
ctggagagga tgatagttac ttgggcctct 2100gcagcttcag ttgcaaccat aactactgcc
ctccgacggc atgccaatac tgctgaaagg 2160gtgggcgcgc cgacccagct ttcttgtaca
aagttggcat tataagaaag cattgcttat 2220caatttgttg caacgaacag gtcactatca
gtcaaaataa aatcattatt tgccatccag 2280ctgatatccc ctat
2294341884DNATrichoderma konilangbra
34atgctaggca ttctccgccg tctcgcgctc ggcgccctcg ccgccgcggc cctctctcct
60ctcgtcgtcg ccgcgcctgc caatgtcgcc atccgctccc tcgaggaacg ggcgagtagc
120gcagacaggc tcgtgttctg ccacttcatg attgggatat gcggtgatcg cggctccagc
180actgattatg acgacgatat gcaaagggcc aaggcagcgg gcatcgacgc gtttgcgttg
240aacattggcg tcgatggata cacggaccag cagctcaact ttgcgtacga cgccgccgac
300cgcgccggga tgaaggtgtt catctccttc gacttcaact ggtggagccc cggcaacgca
360gtaggcgtcg gccagaagat tgcccaatac gcgtcgcggc ccgcacagct ctacgtcgac
420aaccggccct ttgcgtcgtc gtttgccggc gatggccttg acgtgaatgc gctgcgcaac
480gccgccggaa gcaacgtata ctttgtgccc aacttccacc ccgggcagtc ctccccgtca
540accatcgacg gggccctcaa ctggatggcc tgggacaatg acggaaacaa caaggccccc
600aagcccggcc gcaacgtcac cgtcgccgac ggcgacaact cgtaccgtag ctggctgggc
660ggcaagccct acctggcccc cgtttcgccc tggttcttca cccacttcgg ccccgaggtt
720tccttcagca agaactgggt cttcccgggc ggctcgctcc tctacgaccg ctggcaggac
780gtgctgcrcc agggccccga aatggtcgag atcatcacct ggaacgatta cggtgagagc
840cactacaccg ggcccctcaa aagtcgccac tatgacgacg gaaactcgaa atggaccaac
900gacatgccgc acgacggatt cctggacctg tcgaaaccgt ttatagcggc gtacaagaac
960cgcgacacga acgtggcacg gtacgtccag tccgaccagc tcgtctactg gtacagaagg
1020acgctcaagg ggctggactg cgacgcgact gacacgacgt caaaccggcc cgcgaacaac
1080gccagcggca actacttcat gggccggccc gacgggtggc agacgatgga cgacaccgtg
1140tacgtggtgg cgctrctcac ggccgcggga actgtgacgg tgacgtccgg cggggccacc
1200cagacgttcc agggcaccrc cggagccaac ctgttcgagg tcccggccaa cctgggccag
1260cagaagtttg ccctgtcccg caacgggcag accgtcttca gcagcacatc gctgatggat
1320atcgctaatg tgtgcccgtg cggcctctac aacttcaacc cgtatgtcgg gactgtcccg
1380cccggttttg acgacccgct gcaggctgat ggccttgcgt cgctgacgat cggactgcac
1440gtcacgacct gtcaggccag accctccctg ggaacgaacc cgcccatcac ttccggcccc
1500ggctcctcgg tgcccgcttc aaccacccgc tcgacttctc cgcccggttc cacgagccgc
1560ttctcgtcga ccccggtttc gtcccgctcc atctcttcga cgccaccggt cagcacgccg
1620ccccctggcc aagtatgtgt ggccggcaca gtcgctgacg gccagtcggg caactatatt
1680ggcctatgca acttcagctg caacttcggc tactgtcctc ccggcccttg caagtgcacc
1740gcctttggcg ctcccatcaa cccaccggcg accaatgggc gaaacggatg ccccttgcct
1800ggagaggatg atagttactt gggcctctgc agcttcagtt gcaaccataa ctactgccct
1860ccgacggcat gccaatactg ctga
1884
User Contributions:
Comment about this patent or add new information about this topic: