Patent application title: Maize Cellulose Synthases and Uses Thereof
Inventors:
Kanwarpal S. Dhugga (Johnston, IA, US)
Timothy George Helentjaris (Tucson, AZ, US)
Timothy George Helentjaris (Tucson, AZ, US)
Dwight Tomes (Grimes, IA, US)
Dwight Tomes (Grimes, IA, US)
Haiyin Wang (Johnston, IA, US)
Assignees:
PIONEER HI-BRED INTERNATIONAL, INC.
IPC8 Class: AC12N910FI
USPC Class:
800312
Class name: Plant, seedling, plant seed, or plant part, per se higher plant, seedling, plant seed, or plant part (i.e., angiosperms or gymnosperms) soybean
Publication date: 2014-06-19
Patent application number: 20140173782
Abstract:
The invention provides isolated cellulose synthase nucleic acids and
their encoded proteins. The present invention provides methods and
compositions relating to altering cellulose synthase levels in plants.
The invention further provides recombinant expression cassettes, host
cells, and transgenic plants comprising said nucleic acids.Claims:
1. A cellulose synthase product derived from the method of processing of
plant tissues expressing an isolated polynucleotide encoding a functional
cellulose synthase, the method comprising: a) transforming a plant cell
with a recombinant expression cassette comprising a polynucleotide having
at least 90% sequence identity to the full length sequence of a
polynucleotide selected from the group consisting of SEQ ID NO: 13, 17,
21, 25, 27, 29, 45 and 49, operably linked to a promoter; and b)
culturing the transformed plant cell under plant cell growing conditions;
wherein the level of cellulose synthase in said transformed plant cell is
modulated; c) growing the plant cell under plant-forming conditions to
express the polynucleotide in the plant tissue; and d) processing the
plant tissue to obtain a cellulose synthase product.
2. A cellulose synthase product according to claim 1, wherein the polynucleotide further encodes a polypeptide selected from the group consisting of SEQ ID NO: 14, 18, 22, 26, 28, 30, 46 and 50.
3. The transgenic plant of claim 1, wherein the plant is a monocot.
4. The transgenic plant of claim 1, wherein the plant is selected from the group consisting of: maize, soybean, sunflower, sorghum, canola, wheat, alfalfa, cotton, rice, barley and millet.
5. A cellulose synthase product according to claim 1, which improves stalk strength of a plant by overexpression of the polynucleotide.
6. A cellulose synthase product according to claim 1, which reduces green snap by improving nodal strength.
7. A cellulose synthase product according to claim 1, which is a constituent of ethanol.
Description:
RELATED APPLICATIONS
[0001] This application is a divisional of co-pending U.S. patent application Ser. No. 13/887,430 filed May 6, 2013 which is a continuation of U.S. patent application Ser. No. 13/459,370 filed Apr. 30, 2012, now issued as U.S. Pat. No. 8,481,682 which is a continuation of U.S. patent application Ser. No. 13/079,071 filed Apr. 4, 2011, now issued as U.S. Pat. No. 8,207,302, which is a divisional of U.S. patent application Ser. No. 12/903,472 filed Oct. 13, 2010, now issued as U.S. Pat. No. 7,982,009, which is a divisional of Ser. No. 12/782,738 filed May 19, 2010, now issued as U.S. Pat. No. 7,838,632, which is a divisional of Ser. No. 12/486,129 filed Jun. 17, 2009, now issued as U.S. Pat. No. 7,851,597, which is a divisional of U.S. patent application Ser. No. 12/277,418 filed Nov. 25, 2008, now issued as U.S. Pat. No. 7,579,443, which is a divisional of U.S. patent application Ser. No. 11/859,968 filed Sep. 24, 2007, now issued as U.S. Pat. No. 7,524,933, which is a divisional of U.S. patent application Ser. No. 10/963,217 filed Oct. 12, 2004, now issued as U.S. Pat. No. 7,307,149, which is a continuation-in-part of U.S. patent application Ser. No. 10/209,059, filed Jul. 31, 2002, now issued as U.S. Pat. No. 6,930,225, which is a continuation-in-part of U.S. patent application Ser. No. 09/550,483, filed Apr. 14, 2000, now abandoned, which is a continuation-in-part of U.S. patent application Ser. No. 09/371,383, filed Aug. 6, 1999, now abandoned, which claims benefit of U.S. Provisional Patent Application Ser. No. 60/096,822, filed Aug. 17, 1998, now abandoned, all of which are incorporated herein by reference. Also incorporated by reference are U.S. patent application Ser. No. 11/493,187, filed Jul. 26, 2006, now issued as U.S. Pat. No. 7,312,377 and U.S. patent application Ser. No. 10/961,254 filed Oct. 8, 2004, now issued as U.S. Pat. No. 7,214,852, U.S. patent application Ser. No. 10/160,719, filed Jun. 3, 2002, now issued as U.S. Pat. No. 6,803,498, which is a continuation of U.S. patent application Ser. No. 09/371,383, filed Aug. 6, 1999, now abandoned, which claims benefit of U.S. Provisional Patent Application Ser. No. 60/096,822, filed Aug. 17, 1998, now abandoned.
TECHNICAL FIELD
[0002] The present invention relates generally to plant molecular biology. More specifically, it relates to nucleic acids and methods for modulating their expression in plants.
BACKGROUND OF THE INVENTION
[0003] Polysaccharides constitute the bulk of the plant cell walls and have been traditionally classified into three categories: cellulose, hemicellulose and pectin. Fry, (1988) The growing plant cell wall: Chemical and metabolic analysis, New York: Longman Scientific & Technical. Whereas cellulose is made at the plasma membrane and directly laid down into the cell wall, hemicellulosic and pectic polymers are first made in the Golgi apparatus and then exported to the cell wall by exocytosis. Ray, et al., (1976) Ber. Deutsch. Bot. Ges. Bd. 89:121-146. The variety of chemical linkages in the pectic and hemicellulosic polysaccharides indicates that there must be tens of polysaccharide synthases in the Golgi apparatus. Darvill, et al., (1980) The primary cell walls of flowering plants. In The Plant Cell (N E Tolbert, ed.), Vol. 1 in Series: The biochemistry of plants: A comprehensive treatise, eds. Stumpf and Conn, (New York: Academic Press), pp. 91-162.
[0004] Even though sugar and polysaccharide compositions of the plant cell walls have been well characterized, very limited progress has been made toward identification of the enzymes involved in polysaccharides formation, the reason being their labile nature and recalcitrance to solubilization by available detergents. Sporadic claims for the identification of cellulose synthase from plant sources were made over the years. Callaghan and Benziman, (1984) Nature 311:165-167; Okuda, et al., (1993) Plant Physiol. 101:1131-1142. However, these claims were met with skepticism. Callaghan and Benziman, (1985), Nature 314:383-384; Delmer, et al., (1993) Plant Physiol. 103:307-308. It was only relatively recently that a putative gene for plant cellulose synthase (CesA) was cloned from the developing cotton fibers based on homology to the bacterial gene. Pear, et al., Proc. Natl. Acad. Sci. USA 93:12637-12642; Saxena, et al., (1990) Plant Molecular Biology 15:673-684; see also, WO 1998/18949; see also, Arioli, et al., (1998). Molecular analysis of cellulose biosynthesis in Arabidopsis. Science Washington D C. Jan. 279:717-720. A number of genes for cellulose synthase family were later isolated from other plant species based on sequence homology to the cotton gene (Richmond and Somerville, (2000) Plant Physiology 124:495-498.)
[0005] Cellulose, by virtue of its ability to form semicrystalline microfibrils, has a very high tensile strength which approaches that of some metals. Niklas, (1992), Plant Biomechanics: An engineering approach to plant form and function, The University of Chicago Press, p. 607. Bending strength of the culm of normal and brittle-culm mutants of barley has been found to be directly correlated with the concentration of cellulose in the cell wall. Kokubo, et al., (1989), Plant Physiology 91:876-882; Kokubo, et al., (1991) Plant Physiology 97:509-514.
[0006] Although stalk composition contributes to numerous quality factors important in maize breeding, little is known in the art about the impact of cellulose levels on such agronomically important traits as stalk lodging, silage digestibility or downstream processing. The present invention provides these and other advantages.
SUMMARY OF THE INVENTION
[0007] Generally, it is the object of the present invention to provide nucleic acids and proteins relating to cellulose synthases. It is an object of the present invention to provide transgenic plants comprising the nucleic acids of the present invention and methods for modulating, in a transgenic plant, expression of the nucleic acids of the present invention.
[0008] Therefore, in one aspect the present invention relates to an isolated nucleic acid comprising a member selected from the group consisting of (a) a polynucleotide having a specified sequence identity to a polynucleotide encoding a polypeptide of the present invention; (b) a polynucleotide which is complementary to the polynucleotide of (a) and (c) a polynucleotide comprising a specified number of contiguous nucleotides from a polynucleotide of (a) or (b). The isolated nucleic acid can be DNA.
[0009] In other aspects the present invention relates to: 1) recombinant expression cassettes, comprising a nucleic acid of the present invention operably linked to a promoter, 2) a host cell into which has been introduced the recombinant expression cassette, 3) a transgenic plant comprising the recombinant expression cassette and 4) a transgenic plant comprising a recombinant expression cassette containing more than one nucleic acid of the present invention each operably linked to a promoter. Furthermore, the present invention also relates to combining by crossing and hybridization recombinant cassettes from different transformants. The host cell and plant are optionally from maize, wheat, rice or soybean.
[0010] In other aspects the present invention relates to methods of altering stalk lodging and other standability traits, including, but not limited to brittle snap and improving stalk digestibility, through the introduction of one or more of the polynucleotides that encode the polypeptides of the present invention. Additional aspects of the present invention include methods and transgenic plants useful in the end use processing of compounds such ads cellulose or use of transgenic plants as end products either directly, such as silage, or indirectly following processing, for such uses known to those of skill in the art, such as, but not limited to, ethanol. Also, one of skill in the art would recognize that the polynucleotides and encoded polypeptides of the present invention can be introduced into an host cell or transgenic plant wither singly or in multiples, sometimes referred to in the art as "stacking" of sequences or traits. It is intended that these compositions and methods be encompassed in the present invention.
BRIEF DESCRIPTION OF THE DRAWINGS
[0011] FIG. 1: Stalk breaking strength of hybrids and its comparison with the lodging scores. The mechanical strength is very similar to the lodging scores that have been assigned based on field observations. The vertical light-colored bar in the upper right corner of the figure is the least significant difference (LSD) estimate at 5% level.
[0012] FIG. 2: Stalk strength of T0 transgenic plants. Plants overexpressing ("up") ZmCesA4 and ZmCesA8 had significantly stronger stalks than the controls. Overexpression of CesA5 did not alter stalk strength whereas the overexpression of CesA1 led to weaker and stunted stalks.
[0013] FIG. 3: Correlation between unit cellulose and stalk breaking strength. Stalk breaking strength was highly correlated with the amount of cellulose in a unit stalk length (correlation coefficient, r: 0.76; 0.63; 0.92; 0.86.) While these correlations are specifically related to the different CesA genes, it should be noted that in general the same correlation would apply. In other words, it is expected this would apply to low cellulose levels as well as higher cellulose levels.
[0014] FIG. 4: Unrooted cladogram of CesA proteins from different species. Sequences are labeled by prefixes. This cladogram demonstrates the relevance of the maize genes to those of Arabidopsis and rice. Prefixes: At, Arabidopsis thaliana; Gh, Gossypium herbaceum; Lj, Lotus japonicus; Mt, Medicago truncatula; Na, Nicotiana alata; Os, Oriza sativa; Pc, Populus canescens; Ptr, Populus tremula×tremuloides; Ze, Zinnia elegans; Zm, Zea mays.
[0015] FIG. 5: Expression pattern of CesA10, 11 and 12 in different maize tissues. All three genes are nearly synchronously expressed in tissues rich in secondary wall.
[0016] FIG. 6: Effect of overexpression of different CesA genes on plant height in corn. Whereas the overexpression of CesA8 led to an increase in height, CesA4 and CesA5 had not effect. Overexpression of CesA1 resulted in stunted plants.
[0017] FIG. 7: Effect of the overexpression of different CesA genes on the amount of cellulose in a unit length of the stalk tissue below ear in corn. CesA4 and CesA8, when overexpressed, resulted in an increased cellulose/length, CesA5 had no effect and CesA1 resulted in reduced cellulose/length.
[0018] FIG. 8: Contribution of different stalk components to dry matter, diameter, volume and stalk strength in maize hybrids. The data are derived from seven hybrids grown at three densities (27, 43 and 59 K per acre) in three replications each in 2001. Two stalks were sampled from each replication. Internodes 3 and 4 below the ear were broken with Instron model 4411 (Instron Corporation, 100 Royall Street, Canton, Mass. 02021). After breaking, the 3rd internode was separated into rind and inner tissue. Path coefficient analyses were performed using rind and inner tissue as independent variables (X1 and X2, respectively) and the whole stalk as the dependent variable (Y). The multiple regression equation: Y=a+b1X1+b2X2+e where a is the intercept and e error. Path coefficients were calculated as follows: ρYXn=bn*δn/εY where n is 1 or 2. The contribution of each independent variable to whole stalk (Y) was calculated as follows: ρYxn*rYxn where r is the correlation coefficient.
[0019] FIG. 9: Expression of the maize CesA genes in the pulvinal tissue of leaf derived from an elongating internode. The expression was studied by the Lynx MPSS technology.
DETAILED DESCRIPTION OF THE INVENTION
Overview
A. Nucleic Acids and Protein of the Present Invention
[0020] Unless otherwise stated, the polynucleotide and polypeptide sequences identified in Table 1 represent polynucleotides and polypeptides of the present invention. Table 1 cross-references these polynucleotide and polypeptides to their gene name and internal database identification number (SEQ ID NO.). A nucleic acid of the present invention comprises a polynucleotide of the present invention. A protein of the present invention comprises a polypeptide of the present invention.
TABLE-US-00001 TABLE 1 Database ID Polynucleotide Polypeptide SEQ Gene Name NO: SEQ ID NO: ID NO: Cellulose synthase CesA-1 1 2 Cellulose synthase CesA-2 45 46 Cellulose synthase CesA-3 5 6 Cellulose synthase CesA-4 9 10 Cellulose synthase CesA-5 13 14 Cellulose synthase CesA-6 41 42 Cellulose synthase CesA-7 49 50 Cellulose synthase CesA-8 17 18 Cellulose synthase CesA-9 21 22 Cellulose synthase CesA-10 25 26 Cellulose synthase CesA-11 27 28 Cellulose synthase CesA-12 29 30
[0021] Table 2 further provides a comparison detailing the homology as a percentage of the 12 CesA genes from maize that have been described herein (see, also, "Related Applications" above).
TABLE-US-00002 TABLE 2 CesA1 CesA2 CesA3 CesA4 CesA5 CesA6 CesA7 CesA8 CesA9 CesA10 CesA11 CesA12 CesA1 93 60 59 60 55 55 57 61 51 51 46 CesA2 60 59 61 55 55 57 61 51 51 47 CesA3 47 48 49 45 46 49 46 52 50 CesA4 77 54 52 58 86 54 53 52 CesA5 55 53 57 75 52 52 51 CesA6 74 73 56 56 55 53 CesA7 70 54 50 48 46 CesA8 59 55 52 51 CesA9 52 52 50 CesA10 53 64 CesA11 56 CesA12
[0022] Further characterization of the CesA group is provided in FIG. 4, as a consensus tree for plant Ces A proteins. It describes the relationship between Ces A from maize, rice and Arabidopsis sources.
B. Exemplary Utility of the Present Invention
[0023] The present invention provides utility in such exemplary applications as improvement of stalk quality for improved stand lodging or standability or silage digestibility. Further, the present invention provides for an increased concentration of cellulose in the pericarp, hardening the kernel and thus improving its handling ability. Stalk lodging at maturity can cause significant yield losses in corn. Environmental stresses from flowering to harvest, such as drought and nutrient deficiency, further worsen this problem. The effect of abiotic stresses is exacerbated by biotic factors, such as stalk rot resulting from the soil-living pathogens growing through the ground tissue.
[0024] Maize hybrids known to be resistant to stalk lodging have mechanically stronger stalks. At the compositional level, cellulose in a unit stalk length is highly correlated with breaking strength. The present invention provides for modulation of cellulose synthase composition leading to increased stalk strength.
DEFINITIONS
[0025] Units, prefixes and symbols may be denoted in their SI accepted form. Unless otherwise indicated, nucleic acids are written left to right in 5' to 3' orientation; amino acid sequences are written left to right in amino to carboxy orientation, respectively. Numeric ranges recited within the specification are inclusive of the numbers defining the range and include each integer within the defined range. Amino acids may be referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUBMB Nomenclature Commission. Nucleotides, likewise, may be referred to by their commonly accepted single-letter codes. Unless otherwise provided for, software, electrical and electronics terms as used herein are as defined in The New IEEE Standard Dictionary of Electrical and Electronics Terms (5th edition, 1993). The terms defined below are more fully defined by reference to the specification as a whole. Section headings provided throughout the specification are not limitations to the various objects and embodiments of the present invention.
[0026] By "amplified" is meant the construction of multiple copies of a nucleic acid sequence or multiple copies complementary to the nucleic acid sequence using at least one of the nucleic acid sequences as a template. Amplification systems include the polymerase chain reaction (PCR) system, ligase chain reaction (LCR) system, nucleic acid sequence based amplification (NASBA, Cangene, Mississauga, Ontario), Q-Beta Replicase systems, transcription-based amplification system (TAS) and strand displacement amplification (SDA). See, e.g., Diagnostic Molecular Microbiology Principles and Applications, Persing, et al., Ed., American Society for Microbiology, Washington, D.C. (1993). The product of amplification is termed an amplicon.
[0027] As used herein, "antisense orientation" includes reference to a duplex polynucleotide sequence that is operably linked to a promoter in an orientation where the antisense strand is transcribed. The antisense strand is sufficiently complementary to an endogenous transcription product such that translation of the endogenous transcription product is often inhibited.
[0028] By "encoding" or "encoded", with respect to a specified nucleic acid, is meant comprising the information for translation into the specified protein. A nucleic acid encoding a protein may comprise non-translated sequences (e.g., introns) within translated regions of the nucleic acid or may lack such intervening non-translated sequences (e.g., as in cDNA). The information by which a protein is encoded is specified by the use of codons. Typically, the amino acid sequence is encoded by the nucleic acid using the "universal" genetic code. However, variants of the universal code, such as are present in some plant, animal and fungal mitochondria, the bacterium Mycoplasma capricolumn or the ciliate Macronucleus, may be used when the nucleic acid is expressed therein.
[0029] When the nucleic acid is prepared or altered synthetically, advantage can be taken of known codon preferences of the intended host where the nucleic acid is to be expressed. For example, although nucleic acid sequences of the present invention may be expressed in both monocotyledonous and dicotyledonous plant species, sequences can be modified to account for the specific codon preferences and GC content preferences of monocotyledons or dicotyledons as these preferences have been shown to differ (Murray, et al., (1989) Nucl. Acids Res. 17:477-498). Thus, the maize preferred codon for a particular amino acid may be derived from known gene sequences from maize. Maize codon usage for 28 genes from maize plants is listed in Table 4 of Murray, et al., supra.
[0030] As used herein "full-length sequence" in reference to a specified polynucleotide or its encoded protein means having the entire amino acid sequence of a native (non-synthetic), endogenous, biologically (e.g., structurally or catalytically) active form of the specified protein. Methods to determine whether a sequence is full-length are well known in the art, including such exemplary techniques as northern or western blots, primer extension, S1 protection and ribonuclease protection. See, e.g., Plant Molecular Biology: A Laboratory Manual, Clark, Ed., Springer-Verlag, Berlin (1997). Comparison to known full-length homologous (orthologous and/or paralogous) sequences can also be used to identify full-length sequences of the present invention. Additionally, consensus sequences typically present at the 5' and 3' untranslated regions of mRNA aid in the identification of a polynucleotide as full-length. For example, the consensus sequence ANNNNAUGG, where the underlined codon represents the N-terminal methionine, aids in determining whether the polynucleotide has a complete 5' end. Consensus sequences at the 3' end, such as polyadenylation sequences, aid in determining whether the polynucleotide has a complete 3' end.
[0031] As used herein, "heterologous" in reference to a nucleic acid is a nucleic acid that originates from a foreign species, or, if from the same species, is substantially modified from its native form in composition and/or genomic locus by human intervention. For example, a promoter operably linked to a heterologous structural gene is from a species different from that from which the structural gene was derived, or, if from the same species, one or both are substantially modified from their original form. A heterologous protein may originate from a foreign species or, if from the same species, is substantially modified from its original form by human intervention.
[0032] By "host cell" is meant a cell which contains a vector and supports the replication and/or expression of the vector. Host cells may be prokaryotic cells such as E. coli, or eukaryotic cells such as yeast, insect, amphibian or mammalian cells. Preferably, host cells are monocotyledonous or dicotyledonous plant cells. A particularly preferred monocotyledonous host cell is a maize host cell.
[0033] The term "introduced" includes reference to the incorporation of a nucleic acid into a eukaryotic or prokaryotic cell where the nucleic acid may be incorporated into the genome of the cell (e.g., chromosome, plasmid, plastid or mitochondrial DNA), converted into an autonomous replicon, or transiently expressed (e.g., transfected mRNA). The term includes such nucleic acid introduction means as "transfection", "transformation" and "transduction".
[0034] The term "isolated" refers to material, such as a nucleic acid or a protein, which is: (1) substantially or essentially free from components which normally accompany or interact with it as found in its natural environment. The isolated material optionally comprises material not found with the material in its natural environment or (2) if the material is in its natural environment, the material has been synthetically altered or synthetically produced by deliberate human intervention and/or placed at a different location within the cell. The synthetic alteration or creation of the material can be performed on the material within or apart from its natural state. For example, a naturally-occurring nucleic acid becomes an isolated nucleic acid if it is altered or produced by non-natural, synthetic methods or if it is transcribed from DNA which has been altered or produced by non-natural, synthetic methods. The isolated nucleic acid may also be produced by the synthetic re-arrangement ("shuffling") of a part or parts of one or more allelic forms of the gene of interest. Likewise, a naturally-occurring nucleic acid (e.g., a promoter) becomes isolated if it is introduced to a different locus of the genome. Nucleic acids which are "isolated," as defined herein, are also referred to as "heterologous" nucleic acids. See, e.g., Compounds and Methods for Site Directed Mutagenesis in Eukaryotic Cells, Kmiec, U.S. Pat. No. 5,565,350; In Vivo Homologous Sequence Targeting in Eukaryotic Cells, Zarling, et al., WO 1993/22443 (PCT/US93/03868).
[0035] As used herein, "nucleic acid" includes reference to a deoxyribonucleotide or ribonucleotide polymer or chimeras thereof in either single- or double-stranded form and unless otherwise limited, encompasses known analogues having the essential nature of natural nucleotides in that they hybridize to single-stranded nucleic acids in a manner similar to naturally occurring nucleotides (e.g., peptide nucleic acids).
[0036] By "nucleic acid library" is meant a collection of isolated DNA or RNA molecules which comprise and substantially represent the entire transcribed fraction of a genome of a specified organism, tissue or of a cell type from that organism. Construction of exemplary nucleic acid libraries, such as genomic and cDNA libraries, is taught in standard molecular biology references such as Berger and Kimmel, Guide to Molecular Cloning Techniques, Methods in Enzymology, Vol. 152, Academic Press, Inc., San Diego, Calif. (Berger); Sambrook, et al., Molecular Cloning--A Laboratory Manual, 2nd ed., Vol. 1-3 (1989) and Current Protocols in Molecular Biology, Ausubel, et al., Eds., Current Protocols, a joint venture between Greene Publishing Associates, Inc. and John Wiley & Sons, Inc. (1994).
[0037] As used herein "operably linked" includes reference to a functional linkage between a promoter and a second sequence, wherein the promoter sequence initiates and mediates transcription of the DNA sequence corresponding to the second sequence. Generally, operably linked means that the nucleic acid sequences being linked are contiguous and, where necessary to join two protein coding regions, contiguous and in the same reading frame.
[0038] As used herein, the term "plant" includes reference to whole plants, plant parts or organs (e.g., leaves, stems, roots, etc.), plant cells, seeds and progeny of same. Plant cell, as used herein, further includes, without limitation, cells obtained from or found in: seeds, suspension cultures, embryos, meristematic regions, callus tissue, leaves, roots, shoots, gametophytes, sporophytes, pollen and microspores. Plant cells can also be understood to include modified cells, such as protoplasts, obtained from the aforementioned tissues. The class of plants which can be used in the methods of the invention is generally as broad as the class of higher plants amenable to transformation techniques, including both monocotyledonous and dicotyledonous plants. A particularly preferred plant is Zea mays.
[0039] As used herein, "polynucleotide" includes reference to a deoxyribopolynucleotide, ribopolynucleotide or chimeras or analogs thereof that have the essential nature of a natural deoxy- or ribo-nucleotide in that they hybridize, under stringent hybridization conditions, to substantially the same nucleotide sequence as naturally occurring nucleotides and/or allow translation into the same amino acid(s) as the naturally occurring nucleotide(s). A polynucleotide can be full-length or a subsequence of a native or heterologous structural or regulatory gene. Unless otherwise indicated, the term includes reference to the specified sequence as well as the complementary sequence thereof. Thus, DNAs or RNAs with backbones modified for stability or for other reasons are "polynucleotides" as that term is intended herein. Moreover, DNAs or RNAs comprising unusual bases, such as inosine, or modified bases, such as tritylated bases, to name just two examples, are polynucleotides as the term is used herein. It will be appreciated that a great variety of modifications have been made to DNA and RNA that serve many useful purposes known to those of skill in the art. The term polynucleotide as it is employed herein embraces such chemically, enzymatically or metabolically modified forms of polynucleotides, as well as the chemical forms of DNA and RNA characteristic of viruses and cells, including among other things, simple and complex cells.
[0040] The terms "polypeptide", "peptide" and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical analogue of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers. The essential nature of such analogues of naturally occurring amino acids is that, when incorporated into a protein, that protein is specifically reactive to antibodies elicited to the same protein but consisting entirely of naturally occurring amino acids. The terms "polypeptide", "peptide" and "protein" are also inclusive of modifications including, but not limited to, glycosylation, lipid attachment, sulfation, gamma-carboxylation of glutamic acid residues, hydroxylation and ADP-ribosylation. Further, this invention contemplates the use of both the methionine-containing and the methionine-less amino terminal variants of the protein of the invention.
[0041] As used herein "promoter" includes reference to a region of DNA upstream from the start of transcription and involved in recognition and binding of RNA polymerase and other proteins to initiate transcription. A "plant promoter" is a promoter capable of initiating transcription in plant cells whether or not its origin is a plant cell. Exemplary plant promoters include, but are not limited to, those that are obtained from plants, plant viruses and bacteria which comprise genes expressed in plant cells such Agrobacterium or Rhizobium. Examples of promoters under developmental control include promoters that preferentially initiate transcription in certain tissues, such as leaves, roots or seeds. Such promoters are referred to as "tissue preferred". Promoters which initiate transcription only in certain tissue are referred to as "tissue specific". A "cell type" specific promoter primarily drives expression in certain cell types in one or more organs, for example, vascular cells in roots or leaves. An "inducible" or "repressible" promoter is a promoter which is under environmental control. Examples of environmental conditions that may effect transcription by inducible promoters include anaerobic conditions or the presence of light. Tissue specific, tissue preferred, cell type specific and inducible promoters constitute the class of "non-constitutive" promoters. A "constitutive" promoter is a promoter which is active under most environmental conditions.
[0042] As used herein "recombinant" includes reference to a cell or vector, that has been modified by the introduction of a heterologous nucleic acid or that the cell is derived from a cell so modified. Thus, for example, recombinant cells express genes that are not found in identical form within the native (non-recombinant) form of the cell or express native genes that are otherwise abnormally expressed, under-expressed or not expressed at all as a result of human intervention. The term "recombinant" as used herein does not encompass the alteration of the cell or vector by naturally occurring events (e.g., spontaneous mutation, natural transformation/transduction/transposition) such as those occurring without human intervention.
[0043] As used herein, a "recombinant expression cassette" is a nucleic acid construct, generated recombinantly or synthetically, with a series of specified nucleic acid elements which permit transcription of a particular nucleic acid in a host cell. The recombinant expression cassette can be incorporated into a plasmid, chromosome, mitochondrial DNA, plastid DNA, virus or nucleic acid fragment. Typically, the recombinant expression cassette portion of an expression vector includes, among other sequences, a nucleic acid to be transcribed and a promoter.
[0044] The terms "residue" or "amino acid residue" or "amino acid" are used interchangeably herein to refer to an amino acid that is incorporated into a protein, polypeptide or peptide (collectively "protein"). The amino acid may be a naturally occurring amino acid and, unless otherwise limited, may encompass non-natural analogs of natural amino acids that can function in a similar manner as naturally occurring amino acids.
[0045] The term "selectively hybridizes" includes reference to hybridization, under stringent hybridization conditions, of a nucleic acid sequence to a specified nucleic acid target sequence to a detectably greater degree (e.g., at least 2-fold over background) than its hybridization to non-target nucleic acid sequences and to the substantial exclusion of non-target nucleic acids. Selectively hybridizing sequences typically have about at least 80% sequence identity, preferably 90% sequence identity and most preferably 100% sequence identity (i.e., complementary) with each other.
[0046] The term "stringent conditions" or "stringent hybridization conditions" includes reference to conditions under which a probe will selectively hybridize to its target sequence, to a detectably greater degree than to other sequences (e.g., at least 2-fold over background). Stringent conditions are sequence-dependent and will be different in different circumstances. By controlling the stringency of the hybridization and/or washing conditions, target sequences can be identified which are 100% complementary to the probe (homologous probing). Alternatively, stringency conditions can be adjusted to allow some mismatching in sequences so that lower degrees of similarity are detected (heterologous probing). Generally, a probe is less than about 1000 nucleotides in length, optionally less than 500 nucleotides in length.
[0047] Typically, stringent conditions will be those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30° C. for short probes (e.g., 10 to 50 nucleotides) and at least about 60° C. for long probes (e.g., greater than 50 nucleotides). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. Exemplary low stringency conditions include hybridization with a buffer solution of 30 to 35% formamide, 1 M NaCl, 1% SDS (sodium dodecyl sulphate) at 37° C. and a wash in 1× to 2×SSC (20×SSC=3.0 M NaCl/0.3 M trisodium citrate) at 50 to 55° C. Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1 M NaCl, 1% SDS at 37° C. and a wash in 0.5× to 1×SSC at 55 to 60° C. Exemplary high stringency conditions include hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37° C. and a wash in 0.1×SSC at 60 to 65° C.
[0048] Specificity is typically the function of post-hybridization washes, the critical factors being the ionic strength and temperature of the final wash solution. For DNA-DNA hybrids, the Tm can be approximated from the equation of Meinkoth and Wahl, (1984) Anal. Biochem., 138:267-284: Tm=81.5° C.+16.6 (log M)+0.41(% GC)-0.61(% form)-500/L; where M is the molarity of monovalent cations, % GC is the percentage of guanosine and cytosine nucleotides in the DNA, % form is the percentage of formamide in the hybridization solution, and L is the length of the hybrid in base pairs. The Tm is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe. Tm is reduced by about 1° C. for each 1% of mismatching; thus, Tm, hybridization and/or wash conditions can be adjusted to hybridize to sequences of the desired identity. For example, if sequences with >90% identity are sought, the Tm can be decreased 10° C. Generally, stringent conditions are selected to be about 5° C. lower than the thermal melting point ("Tm") for the specific sequence and its complement at a defined ionic strength and pH. However, severely stringent conditions can utilize a hybridization and/or wash at 1, 2, 3 or 4° C. lower than the Tm; moderately stringent conditions can utilize a hybridization and/or wash at 6, 7, 8, 9 or 10° C. lower than the Tm; low stringency conditions can utilize a hybridization and/or wash at 11, 12, 13, 14, 15 or 20° C. lower than the Tm. Using the equation, hybridization and wash compositions, and desired Tm, those of ordinary skill will understand that variations in the stringency of hybridization and/or wash solutions are inherently described. If the desired degree of mismatching results in a Tm of less than 45° C. (aqueous solution) or 32° C. (formamide solution) it is preferred to increase the SSC concentration so that a higher temperature can be used. Hybridization and/or wash conditions can be applied for at least 10, 30, 60, 90, 120 or 240 minutes. An extensive guide to the hybridization of nucleic acids is found in Tijssen, Laboratory Techniques in Biochemistry and Molecular Biology--Hybridization with Nucleic Acid Probes, Part I, Chapter 2 "Overview of principles of hybridization and the strategy of nucleic acid probe assays", Elsevier, New York (1993); and Current Protocols in Molecular Biology, Chapter 2, Ausubel, et al., Eds., Greene Publishing and Wiley-Interscience, New York (1995).
[0049] As used herein, "transgenic plant" includes reference to a plant which comprises within its genome a heterologous polynucleotide. Generally, the heterologous polynucleotide is stably integrated within the genome such that the polynucleotide is passed on to successive generations. The heterologous polynucleotide may be integrated into the genome alone or as part of a recombinant expression cassette. "Transgenic" is used herein to include any cell, cell line, callus, tissue, plant part or plant, the genotype of which has been altered by the presence of heterologous nucleic acid including those transgenics initially so altered as well as those created by sexual crosses or asexual propagation from the initial transgenic. The term "transgenic" as used herein does not encompass the alteration of the genome (chromosomal or extra-chromosomal) by conventional plant breeding methods or by naturally occurring events such as random cross-fertilization, non-recombinant viral infection, non-recombinant bacterial transformation, non-recombinant transposition or spontaneous mutation.
[0050] As used herein, "vector" includes reference to a nucleic acid used in introduction of a polynucleotide of the present invention into a host cell. Vectors are often replicons. Expression vectors permit transcription of a nucleic acid inserted therein.
[0051] The following terms are used to describe the sequence relationships between a polynucleotide/polypeptide of the present invention with a reference polynucleotide/polypeptide: (a) "reference sequence", (b) "comparison window", (c) "sequence identity" and (d) "percentage of sequence identity".
[0052] (a) As used herein, "reference sequence" is a defined sequence used as a basis for sequence comparison with a polynucleotide/polypeptide of the present invention. A reference sequence may be a subset or the entirety of a specified sequence; for example, as a segment of a full-length cDNA or gene sequence or the complete cDNA or gene sequence.
[0053] (b) As used herein, "comparison window" includes reference to a contiguous and specified segment of a polynucleotide/polypeptide sequence, wherein the polynucleotide/polypeptide sequence may be compared to a reference sequence and wherein the portion of the polynucleotide/polypeptide sequence in the comparison window may comprise additions or deletions (i.e., gaps) compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. Generally, the comparison window is at least 20 contiguous nucleotides/amino acids residues in length, and optionally can be 30, 40, 50, 100 or longer. Those of skill in the art understand that to avoid a high similarity to a reference sequence due to inclusion of gaps in the polynucleotide/polypeptide sequence, a gap penalty is typically introduced and is subtracted from the number of matches.
[0054] Methods of alignment of sequences for comparison are well-known in the art. Optimal alignment of sequences for comparison may be conducted by the local homology algorithm of Smith and Waterman, (1981) Adv. Appl. Math. 2:482; by the homology alignment algorithm of Needleman and Wunsch, (1970) J. Mol. Biol. 48:443; by the search for similarity method of Pearson and Lipman, (1988) Proc. Natl. Acad. Sci. 85:2444; by computerized implementations of these algorithms, including, but not limited to: CLUSTAL in the PC/Gene program by Intelligenetics, Mountain View, Calif.; GAP, BESTFIT, BLAST, FASTA and TFASTA in the Wisconsin Genetics Software Package®, Genetics Computer Group (GCG®), 575 Science Dr., Madison, Wis., USA; the CLUSTAL program is well described by Higgins and Sharp, (1988) Gene 73:237-244; Higgins and Sharp, (1989) CABIOS 5:151-153; Corpet, et al., (1988) Nucleic Acids Research 16:10881-90; Huang, et al., (1992) Computer Applications in the Biosciences 8:155-65 and Pearson, et al., (1994) Methods in Molecular Biology 24:307-331.
[0055] The BLAST family of programs which can be used for database similarity searches includes: BLASTN for nucleotide query sequences against nucleotide database sequences; BLASTX for nucleotide query sequences against protein database sequences; BLASTP for protein query sequences against protein database sequences; TBLASTN for protein query sequences against nucleotide database sequences and TBLASTX for nucleotide query sequences against nucleotide database sequences. See, Current Protocols in Molecular Biology, Chapter 19, Ausubel, et al., Eds., Greene Publishing and Wiley-Interscience, New York (1995); Altschul, et al., (1990) J. Mol. Biol., 215:403-410 and Altschul, et al., (1997) Nucleic Acids Res. 25:3389-3402.
[0056] Software for performing BLAST analyses is publicly available, e.g., through the National Center for Biotechnology Information. This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold. These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are then extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always>0) and N (penalty score for mismatching residues; always<0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T and X determine the sensitivity and speed of the alignment. The BLASTN program (for nucleotide sequences) uses as defaults a wordlength (W) of 11, an expectation (E) of 10, a cutoff of 100, M=5, N=-4, and a comparison of both strands. For amino acid sequences, the BLASTP program uses as defaults a wordlength (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix (see, Henikoff and Henikoff, (1989) Proc. Natl. Acad. Sci. USA 89:10915).
[0057] In addition to calculating percent sequence identity, the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin and Altschul, (1993) Proc. Nat'l. Acad. Sci. USA 90:5873-5877). One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance.
[0058] BLAST searches assume that proteins can be modeled as random sequences. However, many real proteins comprise regions of nonrandom sequences which may be homopolymeric tracts, short-period repeats or regions enriched in one or more amino acids. Such low-complexity regions may be aligned between unrelated proteins even though other regions of the protein are entirely dissimilar. A number of low-complexity filter programs can be employed to reduce such low-complexity alignments. For example, the SEG (Wooten and Federhen, (1993) Comput. Chem. 17:149-163) and XNU (Claverie and States, (1993) Comput. Chem 17:191-201) low-complexity filters can be employed alone or in combination.
[0059] Unless otherwise stated, nucleotide and protein identity/similarity values provided herein are calculated using GAP (GCG® Version 10) under default values.
[0060] GAP (Global Alignment Program) can also be used to compare a polynucleotide or polypeptide of the present invention with a reference sequence. GAP uses the algorithm of Needleman and Wunsch, (J. Mol. Biol. 48: 443-453 (1970)) to find the alignment of two complete sequences that maximizes the number of matches and minimizes the number of gaps. GAP considers all possible alignments and gap positions and creates the alignment with the largest number of matched bases and the fewest gaps. It allows for the provision of a gap creation penalty and a gap extension penalty in units of matched bases. GAP must make a profit of gap creation penalty number of matches for each gap it inserts. If a gap extension penalty greater than zero is chosen, GAP must, in addition, make a profit for each gap inserted of the length of the gap times the gap extension penalty. Default gap creation penalty values and gap extension penalty values in Version 10 of the Wisconsin Genetics Software Package® for protein sequences are 8 and 2, respectively. For nucleotide sequences the default gap creation penalty is 50 while the default gap extension penalty is 3. The gap creation and gap extension penalties can be expressed as an integer selected from the group of integers consisting of from 0 to 100. Thus, for example, the gap creation and gap extension penalties can each independently be: 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60 or greater.
[0061] GAP presents one member of the family of best alignments. There may be many members of this family, but no other member has a better quality. GAP displays four figures of merit for alignments: Quality, Ratio, Identity and Similarity. The Quality is the metric maximized in order to align the sequences. Ratio is the quality divided by the number of bases in the shorter segment. Percent Identity is the percent of the symbols that actually match. Percent Similarity is the percent of the symbols that are similar. Symbols that are across from gaps are ignored. A similarity is scored when the scoring matrix value for a pair of symbols is greater than or equal to 0.50, the similarity threshold. The scoring matrix used in Version 10 of the Wisconsin Genetics Software Package® is BLOSUM62 (see, Henikoff and Henikoff, (1989) Natl. Acad. Sci. USA 89:10915).
[0062] Multiple alignment of the sequences can be performed using the CLUSTAL method of alignment (Higgins and Sharp, (1989) CABIOS. 5:151-153) with the default parameters (GAP PENALTY=10, GAP LENGTH PENALTY=10). Default parameters for pairwise alignments using the CLUSTAL method are KTUPLE 1, GAP PENALTY=3, WINDOW=5 and DIAGONALS SAVED=5.
[0063] (c) As used herein, "sequence identity" or "identity" in the context of two nucleic acid or polypeptide sequences includes reference to the residues in the two sequences which are the same when aligned for maximum correspondence over a specified comparison window. When percentage of sequence identity is used in reference to proteins it is recognized that residue positions which are not identical often differ by conservative amino acid substitutions, where amino acid residues are substituted for other amino acid residues with similar chemical properties (e.g., charge or hydrophobicity) and therefore do not change the functional properties of the molecule. Where sequences differ in conservative substitutions, the percent sequence identity may be adjusted upwards to correct for the conservative nature of the substitution. Sequences which differ by such conservative substitutions are said to have "sequence similarity" or "similarity". Means for making this adjustment are well-known to those of skill in the art. Typically this involves scoring a conservative substitution as a partial rather than a full mismatch, thereby increasing the percentage sequence identity. Thus, for example, where an identical amino acid is given a score of 1 and a non-conservative substitution is given a score of zero, a conservative substitution is given a score between zero and 1. The scoring of conservative substitutions is calculated, e.g., according to the algorithm of Meyers and Miller, (1988) Computer Applic. Biol. Sci. 4:11-17 e.g., as implemented in the program PC/GENE (Intelligenetics, Mountain View, Calif., USA).
[0064] (d) As used herein, "percentage of sequence identity" means the value determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100 to yield the percentage of sequence identity.
Utilities
[0065] The present invention provides, among other things, compositions and methods for modulating (i.e., increasing or decreasing) the level of polynucleotides and polypeptides of the present invention in plants. In particular, the polynucleotides and polypeptides of the present invention can be expressed temporally or spatially, e.g., at developmental stages, in tissues and/or in quantities, which are uncharacteristic of non-recombinantly engineered plants.
[0066] The present invention also provides isolated nucleic acids comprising polynucleotides of sufficient length and complementarity to a polynucleotide of the present invention to use as probes or amplification primers in the detection, quantitation or isolation of gene transcripts. For example, isolated nucleic acids of the present invention can be used as probes in detecting deficiencies in the level of mRNA in screenings for desired transgenic plants, for detecting mutations in the gene (e.g., substitutions, deletions or additions), for monitoring upregulation of expression or changes in enzyme activity in screening assays of compounds, for detection of any number of allelic variants (polymorphisms), orthologs or paralogs of the gene or for site directed mutagenesis in eukaryotic cells (see, e.g., U.S. Pat. No. 5,565,350). The isolated nucleic acids of the present invention can also be used for recombinant expression of their encoded polypeptides or for use as immunogens in the preparation and/or screening of antibodies. The isolated nucleic acids of the present invention can also be employed for use in sense or antisense suppression of one or more genes of the present invention in a host cell, tissue or plant. Attachment of chemical agents which bind, intercalate, cleave and/or crosslink to the isolated nucleic acids of the present invention can also be used to modulate transcription or translation.
[0067] The present invention also provides isolated proteins comprising a polypeptide of the present invention (e.g., preproenzyme, proenzyme or enzymes). The present invention also provides proteins comprising at least one epitope from a polypeptide of the present invention. The proteins of the present invention can be employed in assays for enzyme agonists or antagonists of enzyme function or for use as immunogens or antigens to obtain antibodies specifically immunoreactive with a protein of the present invention. Such antibodies can be used in assays for expression levels, for identifying and/or isolating nucleic acids of the present invention from expression libraries, for identification of homologous polypeptides from other species or for purification of polypeptides of the present invention.
[0068] The isolated nucleic acids and polypeptides of the present invention can be used over a broad range of plant types, particularly monocots such as the species of the family Gramineae including Hordeum, Secale, Oryza, Triticum, Sorghum (e.g., S. bicolor) and Zea (e.g., Z. mays) and dicots such as Glycine.
[0069] The isolated nucleic acid and proteins of the present invention can also be used in species from the genera: Cucurbita, Rosa, Vitis, Juglans, Fragaria, Lotus, Medicago, Onobrychis, Trifolium, Trigonella, Vigna, Citrus, Linum, Geranium, Manihot, Daucus, Arabidopsis, Brassica, Raphanus, Sinapis, Atropa, Capsicum, Datura, Hyoscyamus, Lycopersicon, Nicotiana, Solanum, Petunia, Digitalis, Majorana, Ciahorium, Helianthus, Lactuca, Bromus, Asparagus, Antirrhinum, Heterocallis, Nemesis, Pelargonium, Panieum, Pennisetum, Ranunculus, Senecio, Salpiglossis, Cucumis, Browallia, Pisum, Phaseolus, Lolium and Avena.
Nucleic Acids
[0070] The present invention provides, among other things, isolated nucleic acids of RNA, DNA and analogs and/or chimeras thereof, comprising a polynucleotide of the present invention.
[0071] A polynucleotide of the present invention is inclusive of those in Table 1 and:
[0072] (a) an isolated polynucleotide encoding a polypeptide of the present invention such as those referenced in Table 1, including exemplary polynucleotides of the present invention;
[0073] (b) an isolated polynucleotide which is the product of amplification from a plant nucleic acid library using primer pairs which selectively hybridize under stringent conditions to loci within a polynucleotide of the present invention;
[0074] (c) an isolated polynucleotide which selectively hybridizes to a polynucleotide of (a) or (b);
[0075] (d) an isolated polynucleotide having a specified sequence identity with polynucleotides of (a), (b) or (c);
[0076] (e) an isolated polynucleotide encoding a protein having a specified number of contiguous amino acids from a prototype polypeptide, wherein the protein is specifically recognized by antisera elicited by presentation of the protein and wherein the protein does not detectably immunoreact to antisera which has been fully immunosorbed with the protein;
[0077] (f) complementary sequences of polynucleotides of (a), (b), (c), (d) or (e);
[0078] (g) an isolated polynucleotide comprising at least a specific number of contiguous nucleotides from a polynucleotide of (a), (b), (c), (d), (e) or (f);
[0079] (h) an isolated polynucleotide from a full-length enriched cDNA library having the physico-chemical property of selectively hybridizing to a polynucleotide of (a), (b), (c), (d), (e), (f) or (g);
[0080] (i) an isolated polynucleotide made by the process of: 1) providing a full-length enriched nucleic acid library, 2) selectively hybridizing the polynucleotide to a polynucleotide of (a), (b), (c), (d), (e), (f), (g) or (h), thereby isolating the polynucleotide from the nucleic acid library.
A. Polynucleotides Encoding a Polypeptide of the Present Invention
[0081] As indicated in (a), above, the present invention provides isolated nucleic acids comprising a polynucleotide of the present invention, wherein the polynucleotide encodes a polypeptide of the present invention. Every nucleic acid sequence herein that encodes a polypeptide also, by reference to the genetic code, describes every possible silent variation of the nucleic acid. One of ordinary skill will recognize that each codon in a nucleic acid (except AUG, which is ordinarily the only codon for methionine and UGG, which is ordinarily the only codon for tryptophan) can be modified to yield a functionally identical molecule. Thus, each silent variation of a nucleic acid which encodes a polypeptide of the present invention is implicit in each described polypeptide sequence and is within the scope of the present invention. Accordingly, the present invention includes polynucleotides of the present invention and polynucleotides encoding a polypeptide of the present invention.
B. Polynucleotides Amplified from a Plant Nucleic Acid Library
[0082] As indicated in (b), above, the present invention provides an isolated nucleic acid comprising a polynucleotide of the present invention, wherein the polynucleotides are amplified, under nucleic acid amplification conditions, from a plant nucleic acid library. Nucleic acid amplification conditions for each of the variety of amplification methods are well known to those of ordinary skill in the art. The plant nucleic acid library can be constructed from a monocot such as a cereal crop. Exemplary cereals include maize, sorghum, alfalfa, canola, wheat or rice. The plant nucleic acid library can also be constructed from a dicot such as soybean. Zea mays lines B73, PHRE1, A632, BMS-P2#10, W23 and Mo17 are known and publicly available. Other publicly known and available maize lines can be obtained from the Maize Genetics Cooperation (Urbana, Ill.). Wheat lines are available from the Wheat Genetics Resource Center (Manhattan, Kans.).
[0083] The nucleic acid library may be a cDNA library, a genomic library or a library generally constructed from nuclear transcripts at any stage of intron processing. cDNA libraries can be normalized to increase the representation of relatively rare cDNAs. In optional embodiments, the cDNA library is constructed using an enriched full-length cDNA synthesis method. Examples of such methods include Oligo-Capping (Maruyama and Sugano, (1994) Gene 138:171-174,), Biotinylated CAP Trapper (Carninci, et al., (1996) Genomics 37:327-336) and CAP Retention Procedure (Edery, et al., (1995) Molecular and Cellular Biology 15:3363-3371). Rapidly growing tissues or rapidly dividing cells are preferred for use as an mRNA source for construction of a cDNA library. Growth stages of maize are described in "How a Corn Plant Develops," Special Report Number 48, Iowa State University of Science and Technology Cooperative Extension Service, Ames, Iowa, Reprinted February 1993.
[0084] A polynucleotide of this embodiment (or subsequences thereof) can be obtained, for example, by using amplification primers which are selectively hybridized and primer extended, under nucleic acid amplification conditions, to at least two sites within a polynucleotide of the present invention or to two sites within the nucleic acid which flank and comprise a polynucleotide of the present invention or to a site within a polynucleotide of the present invention and a site within the nucleic acid which comprises it. Methods for obtaining 5' and/or 3' ends of a vector insert are well known in the art. See, e.g., RACE (Rapid Amplification of Complementary Ends) as described in Frohman, in PCR Protocols: A Guide to Methods and Applications, Innis, et al., Eds. (Academic Press, Inc., San Diego), pp. 28-38 (1990)); see, also, U.S. Pat. No. 5,470,722 and Current Protocols in Molecular Biology, Unit 15.6, Ausubel, et al., Eds., Greene Publishing and Wiley-Interscience, New York (1995); Frohman and Martin, Techniques 1:165 (1989).
[0085] Optionally, the primers are complementary to a subsequence of the target nucleic acid which they amplify but may have a sequence identity ranging from about 85% to 99% relative to the polynucleotide sequence which they are designed to anneal to. As those skilled in the art will appreciate, the sites to which the primer pairs will selectively hybridize are chosen such that a single contiguous nucleic acid can be formed under the desired nucleic acid amplification conditions. The primer length in nucleotides is selected from the group of integers consisting of from at least 15 to 50. Thus, the primers can be at least 15, 18, 20, 25, 30, 40 or 50 nucleotides in length. Those of skill will recognize that a lengthened primer sequence can be employed to increase specificity of binding (i.e., annealing) to a target sequence. A non-annealing sequence at the 5' end of a primer (a "tail") can be added, for example, to introduce a cloning site at the terminal ends of the amplicon.
[0086] The amplification products can be translated using expression systems well known to those of skill in the art. The resulting translation products can be confirmed as polypeptides of the present invention by, for example, assaying for the appropriate catalytic activity (e.g., specific activity and/or substrate specificity) or verifying the presence of one or more epitopes which are specific to a polypeptide of the present invention. Methods for protein synthesis from PCR derived templates are known in the art and available commercially. See, e.g., Amersham Life Sciences, Inc, Catalog '97, p. 354.
C. Polynucleotides which Selectively Hybridize to a Polynucleotide of (A) or (B)
[0087] As indicated in (c), above, the present invention provides isolated nucleic acids comprising polynucleotides of the present invention, wherein the polynucleotides selectively hybridize, under selective hybridization conditions, to a polynucleotide of sections (A) or (B) as discussed above. Thus, the polynucleotides of this embodiment can be used for isolating, detecting and/or quantifying nucleic acids comprising the polynucleotides of (A) or (B). For example, polynucleotides of the present invention can be used to identify, isolate or amplify partial or full-length clones in a deposited library. In some embodiments, the polynucleotides are genomic or cDNA sequences isolated or otherwise complementary to a cDNA from a dicot or monocot nucleic acid library. Exemplary species of monocots and dicots include, but are not limited to: maize, canola, soybean, cotton, wheat, sorghum, sunflower, alfalfa, oats, sugar cane, millet, barley and rice. The cDNA library comprises at least 50% to 95% full-length sequences (for example, at least 50%, 60%, 70%, 80%, 90% or 95% full-length sequences). The cDNA libraries can be normalized to increase the representation of rare sequences. See, e.g., U.S. Pat. No. 5,482,845. Low stringency hybridization conditions are typically, but not exclusively, employed with sequences having a reduced sequence identity relative to complementary sequences. Moderate and high stringency conditions can optionally be employed for sequences of greater identity. Low stringency conditions allow selective hybridization of sequences having about 70% to 80% sequence identity and can be employed to identify orthologous or paralogous sequences.
D. Polynucleotides Having a Specific Sequence Identity with the Polynucleotides of (A), (B) or (C)
[0088] As indicated in (d), above, the present invention provides isolated nucleic acids comprising polynucleotides of the present invention, wherein the polynucleotides have a specified identity at the nucleotide level to a polynucleotide as disclosed above in sections (A), (B) or (C), above. Identity can be calculated using, for example, the BLAST, CLUSTALW or GAP algorithms under default conditions. The percentage of identity to a reference sequence is at least 50% and, rounded upwards to the nearest integer, can be expressed as an integer selected from the group of integers consisting of from 50 to 99. Thus, for example, the percentage of identity to a reference sequence can be at least 60%, 70%, 75%, 80%, 85%, 90% or 95%.
[0089] Optionally, the polynucleotides of this embodiment will encode a polypeptide that will share an epitope with a polypeptide encoded by the polynucleotides of sections (A), (B) or (C). Thus, these polynucleotides encode a first polypeptide which elicits production of antisera comprising antibodies which are specifically reactive to a second polypeptide encoded by a polynucleotide of (A), (B) or (C). However, the first polypeptide does not bind to antisera raised against itself when the antisera has been fully immunosorbed with the first polypeptide. Hence, the polynucleotides of this embodiment can be used to generate antibodies for use in, for example, the screening of expression libraries for nucleic acids comprising polynucleotides of (A), (B) or (C), or for purification of, or in immunoassays for, polypeptides encoded by the polynucleotides of (A), (B) or (C). The polynucleotides of this embodiment comprise nucleic acid sequences which can be employed for selective hybridization to a polynucleotide encoding a polypeptide of the present invention.
[0090] Screening polypeptides for specific binding to antisera can be conveniently achieved using peptide display libraries. This method involves the screening of large collections of peptides for individual members having the desired function or structure. Antibody screening of peptide display libraries is well known in the art. The displayed peptide sequences can be from 3 to 5000 or more amino acids in length, frequently from 5-100 amino acids long, and often from about 8 to 15 amino acids long. In addition to direct chemical synthetic methods for generating peptide libraries, several recombinant DNA methods have been described. One type involves the display of a peptide sequence on the surface of a bacteriophage or cell. Each bacteriophage or cell contains the nucleotide sequence encoding the particular displayed peptide sequence. Such methods are described in PCT Patent Publication Numbers 1991/17271, 1991/18980, 1991/19818 and 1993/08278. Other systems for generating libraries of peptides have aspects of both in vitro chemical synthesis and recombinant methods. See, PCT Patent Publication Numbers 1992/05258, 1992/14843 and 1997/20078. See also, U.S. Pat. Nos. 5,658,754 and 5,643,768. Peptide display libraries, vectors and screening kits are commercially available from such suppliers as Invitrogen (Carlsbad, Calif.).
E. Polynucleotides Encoding a Protein Having a Subsequence from a Prototype Polypeptide and Cross-Reactive to the Prototype Polypeptide
[0091] As indicated in (e), above, the present invention provides isolated nucleic acids comprising polynucleotides of the present invention, wherein the polynucleotides encode a protein having a subsequence of contiguous amino acids from a prototype polypeptide of the present invention such as are provided in (a), above. The length of contiguous amino acids from the prototype polypeptide is selected from the group of integers consisting of from at least 10 to the number of amino acids within the prototype sequence. Thus, for example, the polynucleotide can encode a polypeptide having a subsequence having at least 10, 15, 20, 25, 30, 35, 40, 45 or 50, contiguous amino acids from the prototype polypeptide. Further, the number of such subsequences encoded by a polynucleotide of the instant embodiment can be any integer selected from the group consisting of from 1 to 20, such as 2, 3, 4 or 5. The subsequences can be separated by any integer of nucleotides from 1 to the number of nucleotides in the sequence such as at least 5, 10, 15, 25, 50, 100 or 200 nucleotides.
[0092] The proteins encoded by polynucleotides of this embodiment, when presented as an immunogen, elicit the production of polyclonal antibodies which specifically bind to a prototype polypeptide such as but not limited to, a polypeptide encoded by the polynucleotide of (a) or (b), above. Generally, however, a protein encoded by a polynucleotide of this embodiment does not bind to antisera raised against the prototype polypeptide when the antisera has been fully immunosorbed with the prototype polypeptide. Methods of making and assaying for antibody binding specificity/affinity are well known in the art. Exemplary immunoassay formats include ELISA, competitive immunoassays, radioimmunoassays, Western blots, indirect immunofluorescent assays and the like.
[0093] In a preferred assay method, fully immunosorbed and pooled antisera which is elicited to the prototype polypeptide can be used in a competitive binding assay to test the protein. The concentration of the prototype polypeptide required to inhibit 50% of the binding of the antisera to the prototype polypeptide is determined. If the amount of the protein required to inhibit binding is less than twice the amount of the prototype protein, then the protein is said to specifically bind to the antisera elicited to the immunogen. Accordingly, the proteins of the present invention embrace allelic variants, conservatively modified variants and minor recombinant modifications to a prototype polypeptide.
[0094] A polynucleotide of the present invention optionally encodes a protein having a molecular weight as the non-glycosylated protein within 20% of the molecular weight of the full-length non-glycosylated polypeptides of the present invention. Molecular weight can be readily determined by SDS-PAGE under reducing conditions. Optionally, the molecular weight is within 15% of a full length polypeptide of the present invention, more preferably within 10% or 5%, and most preferably within 3%, 2% or 1% of a full length polypeptide of the present invention.
[0095] Optionally, the polynucleotides of this embodiment will encode a protein having a specific enzymatic activity at least 50%, 60%, 80% or 90% of a cellular extract comprising the native, endogenous full-length polypeptide of the present invention. Further, the proteins encoded by polynucleotides of this embodiment will optionally have a substantially similar affinity constant (Km) and/or catalytic activity (i.e., the microscopic rate constant, kcat) as the native endogenous, full-length protein. Those of skill in the art will recognize that kcat/Km value determines the specificity for competing substrates and is often referred to as the specificity constant. Proteins of this embodiment can have a kcat/Km value at least 10% of a full-length polypeptide of the present invention as determined using the endogenous substrate of that polypeptide. Optionally, the kcat/Km value will be at least 20%, 30%, 40%, 50% and most preferably at least 60%, 70%, 80%, 90% or 95% the kcat/Km value of the full-length polypeptide of the present invention. Determination of kcat, Km and kcat/Km can be determined by any number of means well known to those of skill in the art. For example, the initial rates (i.e., the first 5% or less of the reaction) can be determined using rapid mixing and sampling techniques (e.g., continuous-flow, stopped-flow or rapid quenching techniques), flash photolysis or relaxation methods (e.g., temperature jumps) in conjunction with such exemplary methods of measuring as spectrophotometry, spectrofluorimetry, nuclear magnetic resonance or radioactive procedures. Kinetic values are conveniently obtained using a Lineweaver-Burk or Eadie-Hofstee plot.
F. Polynucleotides Complementary to the Polynucleotides of (A)-(E) As indicated in (f), above, the present invention provides isolated nucleic acids comprising polynucleotides complementary to the polynucleotides of paragraphs A-E, above. As those of skill in the art will recognize, complementary sequences base-pair throughout the entirety of their length with the polynucleotides of sections (A)-(E) (i.e., have 100% sequence identity over their entire length). Complementary bases associate through hydrogen bonding in double stranded nucleic acids. For example, the following base pairs are complementary: guanine and cytosine; adenine and thymine and adenine and uracil. G. Polynucleotides which are Subsequences of the Polynucleotides of (A)-(F)
[0096] As indicated in (g), above, the present invention provides isolated nucleic acids comprising polynucleotides which comprise at least 15 contiguous bases from the polynucleotides of sections (A) through (F) as discussed above. The length of the polynucleotide is given as an integer selected from the group consisting of from at least 15 to the length of the nucleic acid sequence from which the polynucleotide is a subsequence of. Thus, for example, polynucleotides of the present invention are inclusive of polynucleotides comprising at least 15, 20, 25, 30, 40, 50, 60, 75 or 100 contiguous nucleotides in length from the polynucleotides of (A)-(F). Optionally, the number of such subsequences encoded by a polynucleotide of the instant embodiment can be any integer selected from the group consisting of from 1 to 20, such as 2, 3, 4 or 5. The subsequences can be separated by any integer of nucleotides from 1 to the number of nucleotides in the sequence such as at least 5, 10, 15, 25, 50, 100 or 200 nucleotides.
[0097] Subsequences can be made by in vitro synthetic, in vitro biosynthetic or in vivo recombinant methods. In optional embodiments, subsequences can be made by nucleic acid amplification. For example, nucleic acid primers will be constructed to selectively hybridize to a sequence (or its complement) within, or co-extensive with, the coding region.
[0098] The subsequences of the present invention can comprise structural characteristics of the sequence from which it is derived. Alternatively, the subsequences can lack certain structural characteristics of the larger sequence from which it is derived such as a poly (A) tail. Optionally, a subsequence from a polynucleotide encoding a polypeptide having at least one epitope in common with a prototype polypeptide sequence as provided in (a), above, may encode an epitope in common with the prototype sequence. Alternatively, the subsequence may not encode an epitope in common with the prototype sequence but can be used to isolate the larger sequence by, for example, nucleic acid hybridization with the sequence from which it's derived. Subsequences can be used to modulate or detect gene expression by introducing into the subsequences compounds which bind, intercalate, cleave and/or crosslink to nucleic acids. Exemplary compounds include acridine, psoralen, phenanthroline, naphthoquinone, daunomycin or chloroethylaminoaryl conjugates.
H. Polynucleotides from a Full-Length Enriched cDNA Library Having the Physico-Chemical Property of Selectively Hybridizing to a Polynucleotide of (A)-(G)
[0099] As indicated in (h), above, the present invention provides an isolated polynucleotide from a full-length enriched cDNA library having the physico-chemical property of selectively hybridizing to a polynucleotide of paragraphs (A), (B), (C), (D), (E), (F) or (G) as discussed above. Methods of constructing full-length enriched cDNA libraries are known in the art and discussed briefly below. The cDNA library comprises at least 50% to 95% full-length sequences (for example, at least 50%, 60%, 70%, 80%, 90% or 95% full-length sequences). The cDNA library can be constructed from a variety of tissues from a monocot or dicot at a variety of developmental stages. Exemplary species include maize, wheat, rice, canola, soybean, cotton, sorghum, sunflower, alfalfa, oats, sugar cane, millet, barley and rice. Methods of selectively hybridizing, under selective hybridization conditions, a polynucleotide from a full-length enriched library to a polynucleotide of the present invention are known to those of ordinary skill in the art. Any number of stringency conditions can be employed to allow for selective hybridization. In optional embodiments, the stringency allows for selective hybridization of sequences having at least 70%, 75%, 80%, 85%, 90%, 95% or 98% sequence identity over the length of the hybridized region. Full-length enriched cDNA libraries can be normalized to increase the representation of rare sequences.
I. Polynucleotide Products Made by a cDNA Isolation Process
[0100] As indicated in (I), above, the present invention provides an isolated polynucleotide made by the process of: 1) providing a full-length enriched nucleic acid library, 2) selectively hybridizing the polynucleotide to a polynucleotide of paragraphs (A), (B), (C), (D), (E), (F), (G) or (H) as discussed above, and thereby isolating the polynucleotide from the nucleic acid library. Full-length enriched nucleic acid libraries are constructed as discussed in paragraph (G) and below. Selective hybridization conditions are as discussed in paragraph (G). Nucleic acid purification procedures are well known in the art. Purification can be conveniently accomplished using solid-phase methods; such methods are well known to those of skill in the art and kits are available from commercial suppliers such as Advanced Biotechnologies (Surrey, UK). For example, a polynucleotide of paragraphs (A)-(H) can be immobilized to a solid support such as a membrane, bead, or particle. See, e.g., U.S. Pat. No. 5,667,976. The polynucleotide product of the present process is selectively hybridized to an immobilized polynucleotide and the solid support is subsequently isolated from non-hybridized polynucleotides by methods including, but not limited to, centrifugation, magnetic separation, filtration, electrophoresis and the like.
Construction of Nucleic Acids
[0101] The isolated nucleic acids of the present invention can be made using (a) standard recombinant methods, (b) synthetic techniques or combinations thereof. In some embodiments, the polynucleotides of the present invention will be cloned, amplified or otherwise constructed from a monocot such as maize, rice or wheat or a dicot such as soybean.
[0102] The nucleic acids may conveniently comprise sequences in addition to a polynucleotide of the present invention. For example, a multi-cloning site comprising one or more endonuclease restriction sites may be inserted into the nucleic acid to aid in isolation of the polynucleotide. Also, translatable sequences may be inserted to aid in the isolation of the translated polynucleotide of the present invention. For example, a hexa-histidine marker sequence provides a convenient means to purify the proteins of the present invention. A polynucleotide of the present invention can be attached to a vector, adapter or linker for cloning and/or expression of a polynucleotide of the present invention. Additional sequences may be added to such cloning and/or expression sequences to optimize their function in cloning and/or expression, to aid in isolation of the polynucleotide, or to improve the introduction of the polynucleotide into a cell. Typically, the length of a nucleic acid of the present invention less the length of its polynucleotide of the present invention is less than 20 kilobase pairs, often less than 15 kb and frequently less than 10 kb. Use of cloning vectors, expression vectors, adapters, and linkers is well known and extensively described in the art. For a description of various nucleic acids see, for example, Stratagene Cloning Systems, Catalogs 1999 (La Jolla, Calif.) and Amersham Life Sciences, Inc, Catalog '99 (Arlington Heights, Ill.).
A. Recombinant Methods for Constructing Nucleic Acids
[0103] The isolated nucleic acid compositions of this invention, such as RNA, cDNA, genomic DNA or a hybrid thereof, can be obtained from plant biological sources using any number of cloning methodologies known to those of skill in the art. In some embodiments, oligonucleotide probes which selectively hybridize, under stringent conditions, to the polynucleotides of the present invention are used to identify the desired sequence in a cDNA or genomic DNA library. Isolation of RNA, and construction of cDNA and genomic libraries is well known to those of ordinary skill in the art. See, e.g., Plant Molecular Biology: A Laboratory Manual, Clark, Ed., Springer-Verlag, Berlin (1997); and, Current Protocols in Molecular Biology, Ausubel, et al., Eds., Greene Publishing and Wiley-Interscience, New York (1995).
A1. Full-Length Enriched cDNA Libraries
[0104] A number of cDNA synthesis protocols have been described which provide enriched full-length cDNA libraries. Enriched full-length cDNA libraries are constructed to comprise at least 600%, and more preferably at least 70%, 80%, 90% or 95% full-length inserts amongst clones containing inserts. The length of insert in such libraries can be at least 2, 3, 4, 5, 6, 7, 8, 9, 10 or more kilobase pairs. Vectors to accommodate inserts of these sizes are known in the art and available commercially. See, e.g., Stratagene's lambda ZAP Express (cDNA cloning vector with 0 to 12 kb cloning capacity). An exemplary method of constructing a greater than 95% pure full-length cDNA library is described by Carninci, et al., (1996) Genomics, 37:327-336. Other methods for producing full-length libraries are known in the art. See, e.g., Edery, et al., (1995) Mol. Cell Biol. 15(6):3363-3371 and PCT Application Number WO 1996/34981.
A2. Normalized or Subtracted cDNA Libraries
[0105] A non-normalized cDNA library represents the mRNA population of the tissue it was made from. Since unique clones are out-numbered by clones derived from highly expressed genes their isolation can be laborious. Normalization of a cDNA library is the process of creating a library in which each clone is more equally represented. Construction of normalized libraries is described in Ko, (1990) Nucl. Acids. Res. 18(19):5705-5711; Patanjali, et al., (1991) Proc. Natl. Acad. U.S.A. 88:1943-1947; U.S. Pat. Nos. 5,482,685, 5,482,845 and 5,637,685. In an exemplary method described by Soares, et al., normalization resulted in reduction of the abundance of clones from a range of four orders of magnitude to a narrow range of only 1 order of magnitude. Proc. Natl. Acad. Sci. USA, 91:9228-9232 (1994).
[0106] Subtracted cDNA libraries are another means to increase the proportion of less abundant cDNA species. In this procedure, cDNA prepared from one pool of mRNA is depleted of sequences present in a second pool of mRNA by hybridization. The cDNA:mRNA hybrids are removed and the remaining un-hybridized cDNA pool is enriched for sequences unique to that pool. See, Foote, et al., in, Plant Molecular Biology: A Laboratory Manual, Clark, Ed., Springer-Verlag, Berlin (1997); Kho and Zarbl, (1991) Technique 3(2):58-63; Sive and St. John, (1988) Nucl. Acids Res., 16(22):10937; Current Protocols in Molecular Biology, Ausubel, et al., Eds., Greene Publishing and Wiley-Interscience, New York (1995) and Swaroop, et al., (1991) Nucl. Acids Res., 19(8):1954. cDNA subtraction kits are commercially available. See, e.g., PCR-Select (Clontech, Palo Alto, Calif.).
[0107] To construct genomic libraries, large segments of genomic DNA are generated by fragmentation, e.g., using restriction endonucleases, and are ligated with vector DNA to form concatemers that can be packaged into the appropriate vector. Methodologies to accomplish these ends and sequencing methods to verify the sequence of nucleic acids are well known in the art. Examples of appropriate molecular biological techniques and instructions sufficient to direct persons of skill through many construction, cloning and screening methodologies are found in Sambrook, et al., Molecular Cloning A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Vols. 1-3 (1989), Methods in Enzymology, Vol. 152: Guide to Molecular Cloning Techniques, Berger and Kimmel, Eds., San Diego: Academic Press, Inc. (1987), Current Protocols in Molecular Biology, Ausubel, et al., Eds., Greene Publishing and Wiley-Interscience, New York (1995); Plant Molecular Biology: A Laboratory Manual, Clark, Ed., Springer-Verlag, Berlin (1997). Kits for construction of genomic libraries are also commercially available.
[0108] The cDNA or genomic library can be screened using a probe based upon the sequence of a polynucleotide of the present invention such as those disclosed herein. Probes may be used to hybridize with genomic DNA or cDNA sequences to isolate homologous genes in the same or different plant species. Those of skill in the art will appreciate that various degrees of stringency of hybridization can be employed in the assay and either the hybridization or the wash medium can be stringent.
[0109] The nucleic acids of interest can also be amplified from nucleic acid samples using amplification techniques. For instance, polymerase chain reaction (PCR) technology can be used to amplify the sequences of polynucleotides of the present invention and related genes directly from genomic DNA or cDNA libraries. PCR and other in vitro amplification methods may also be useful, for example, to clone nucleic acid sequences that code for proteins to be expressed, to make nucleic acids to use as probes for detecting the presence of the desired mRNA in samples, for nucleic acid sequencing or for other purposes. The T4 gene 32 protein (Boehringer Mannheim) can be used to improve yield of long PCR products.
[0110] PCR-based screening methods have been described. Wilfinger, et al., describe a PCR-based method in which the longest cDNA is identified in the first step so that incomplete clones can be eliminated from study. BioTechniques, 22(3):481-486 (1997). Such methods are particularly effective in combination with a full-length cDNA construction methodology, above.
B. Synthetic Methods for Constructing Nucleic Acids
[0111] The isolated nucleic acids of the present invention can also be prepared by direct chemical synthesis by methods such as the phosphotriester method of Narang, et al., (1979) Meth. Enzymol. 68: 90-99; the phosphodiester method of Brown, et al., (1979) Meth. Enzymol. 68:109-151; the diethylphosphoramidite method of Beaucage, et al., (1981) Tetra. Lett. 22:1859-1862; the solid phase phosphoramidite triester method described by Beaucage and Caruthers, (1981) Tetra. Letts. 22(20):1859-1862, e.g., using an automated synthesizer, e.g., as described in Needham-VanDevanter, et al., (1984) Nucleic Acids Res., 12:6159-6168 and the solid support method of U.S. Pat. No. 4,458,066. Chemical synthesis generally produces a single stranded oligonucleotide. This may be converted into double stranded DNA by hybridization with a complementary sequence or by polymerization with a DNA polymerase using the single strand as a template. One of skill will recognize that while chemical synthesis of DNA is best employed for sequences of about 100 bases or less, longer sequences may be obtained by the ligation of shorter sequences.
Recombinant Expression Cassettes
[0112] The present invention further provides recombinant expression cassettes comprising a nucleic acid of the present invention. A nucleic acid sequence coding for the desired polypeptide of the present invention, for example a cDNA or a genomic sequence encoding a full length polypeptide of the present invention, can be used to construct a recombinant expression cassette which can be introduced into the desired host cell. A recombinant expression cassette will typically comprise a polynucleotide of the present invention operably linked to transcriptional initiation regulatory sequences which will direct the transcription of the polynucleotide in the intended host cell, such as tissues of a transformed plant.
[0113] For example, plant expression vectors may include (1) a cloned plant gene under the transcriptional control of 5' and 3' regulatory sequences and (2) a dominant selectable marker. Such plant expression vectors may also contain, if desired, a promoter regulatory region (e.g., one conferring inducible or constitutive, environmentally- or developmentally-regulated, or cell- or tissue-specific/selective expression), a transcription initiation start site, a ribosome binding site, an RNA processing signal, a transcription termination site and/or a polyadenylation signal.
[0114] A plant promoter fragment can be employed which will direct expression of a polynucleotide of the present invention in all tissues of a regenerated plant. Such promoters are referred to herein as "constitutive" promoters and are active under most environmental conditions and states of development or cell differentiation. Examples of constitutive promoters include the cauliflower mosaic virus (CaMV) 35S transcription initiation region, the 1'- or 2'-promoter derived from T-DNA of Agrobacterium tumefaciens, the ubiquitin 1 promoter, the Smas promoter, the cinnamyl alcohol dehydrogenase promoter (U.S. Pat. No. 5,683,439), the Nos promoter, the pEmu promoter, the rubisco promoter and the GRP1-8 promoter.
[0115] Alternatively, the plant promoter can direct expression of a polynucleotide of the present invention in a specific tissue or may be otherwise under more precise environmental or developmental control. Such promoters are referred to here as "inducible" promoters. Environmental conditions that may effect transcription by inducible promoters include pathogen attack, anaerobic conditions or the presence of light. Examples of inducible promoters are the Adh1 promoter which is inducible by hypoxia or cold stress, the Hsp70 promoter which is inducible by heat stress and the PPDK promoter which is inducible by light.
[0116] Examples of promoters under developmental control include promoters that initiate transcription only, or preferentially, in certain tissues, such as leaves, roots, fruit, seeds or flowers. Exemplary promoters include the anther-specific promoter 5126 (U.S. Pat. Nos. 5,689,049 and 5,689,051), glb-1 promoter and gamma-zein promoter. Also see, for example, U.S. Patent Application Ser. Nos. 60/155,859 and 60/163,114. The operation of a promoter may also vary depending on its location in the genome. Thus, an inducible promoter may become fully or partially constitutive in certain locations.
[0117] Both heterologous and non-heterologous (i.e., endogenous) promoters can be employed to direct expression of the nucleic acids of the present invention. These promoters can also be used, for example, in recombinant expression cassettes to drive expression of antisense nucleic acids to reduce, increase or alter concentration and/or composition of the proteins of the present invention in a desired tissue. Thus, in some embodiments, the nucleic acid construct will comprise a promoter, functional in a plant cell, operably linked to a polynucleotide of the present invention. Promoters useful in these embodiments include the endogenous promoters driving expression of a polypeptide of the present invention.
[0118] In some embodiments, isolated nucleic acids which serve as promoter or enhancer elements can be introduced in the appropriate position (generally upstream) of a non-heterologous form of a polynucleotide of the present invention so as to up or down regulate expression of a polynucleotide of the present invention. For example, endogenous promoters can be altered in vivo by mutation, deletion and/or substitution (see, Kmiec, U.S. Pat. No. 5,565,350; Zarling, et al., PCT/US93/03868) or isolated promoters can be introduced into a plant cell in the proper orientation and distance from a cognate gene of a polynucleotide of the present invention so as to control the expression of the gene. Gene expression can be modulated under conditions suitable for plant growth so as to alter the total concentration and/or alter the composition of the polypeptides of the present invention in plant cell. Thus, the present invention provides compositions, and methods for making, heterologous promoters and/or enhancers operably linked to a native, endogenous (i.e., non-heterologous) form of a polynucleotide of the present invention.
[0119] If polypeptide expression is desired, it is generally desirable to include a polyadenylation region at the 3'-end of a polynucleotide coding region. The polyadenylation region can be derived from the natural gene, from a variety of other plant genes or from T-DNA. The 3' end sequence to be added can be derived from, for example, the nopaline synthase or octopine synthase genes or alternatively from another plant gene or less preferably from any other eukaryotic gene.
[0120] An intron sequence can be added to the 5' untranslated region or the coding sequence of the partial coding sequence to increase the amount of the mature message that accumulates in the cytosol. Inclusion of a spliceable intron in the transcription unit in both plant and animal expression constructs has been shown to increase gene expression at both the mRNA and protein levels up to 1000-fold. Buchman and Berg, (1988) Mol. Cell Biol. 8:4395-4405; Callis, et al., (1987) Genes Dev. 1:1183-1200. Such intron enhancement of gene expression is typically greatest when placed near the 5' end of the transcription unit. Use of maize introns Adh1-S intron 1, 2, and 6, the Bronze-1 intron are known in the art. See generally, The Maize Handbook, Chapter 116, Freeling and Walbot, Eds., Springer, New York (1994). The vector comprising the sequences from a polynucleotide of the present invention will typically comprise a marker gene which confers a selectable phenotype on plant cells. Typical vectors useful for expression of genes in higher plants are well known in the art and include vectors derived from the tumor-inducing (Ti) plasmid of Agrobacterium tumefaciens described by Rogers, et al., (1987) Meth. in Enzymol. 153:253-277.
[0121] A polynucleotide of the present invention can be expressed in either sense or anti-sense orientation as desired. It will be appreciated that control of gene expression in either sense or anti-sense orientation can have a direct impact on the observable plant characteristics. Antisense technology can be conveniently used to inhibit gene expression in plants. To accomplish this, a nucleic acid segment from the desired gene is cloned and operably linked to a promoter such that the anti-sense strand of RNA will be transcribed. The construct is then transformed into plants and the antisense strand of RNA is produced. In plant cells, it has been shown that antisense RNA inhibits gene expression by preventing the accumulation of mRNA which encodes the enzyme of interest, see, e.g., Sheehy, et al., (1988) Proc. Nat'l. Acad. Sci. (USA) 85:8805-8809 and Hiatt, et al., U.S. Pat. No. 4,801,340.
[0122] Another method of suppression is sense suppression (i.e., co-supression). Introduction of nucleic acid configured in the sense orientation has been shown to be an effective means by which to block the transcription of target genes. For an example of the use of this method to modulate expression of endogenous genes see, Napoli, et al., (1990) The Plant Cell 2:279-289 and U.S. Pat. No. 5,034,323.
[0123] Catalytic RNA molecules or ribozymes can also be used to inhibit expression of plant genes. It is possible to design ribozymes that specifically pair with virtually any target RNA and cleave the phosphodiester backbone at a specific location, thereby functionally inactivating the target RNA. In carrying out this cleavage, the ribozyme is not itself altered, and is thus capable of recycling and cleaving other molecules, making it a true enzyme. The inclusion of ribozyme sequences within antisense RNAs confers RNA-cleaving activity upon them, thereby increasing the activity of the constructs. The design and use of target RNA-specific ribozymes is described in Haseloff, et al., (1988) Nature 334:585-591.
[0124] A variety of cross-linking agents, alkylating agents and radical generating species as pendant groups on polynucleotides of the present invention can be used to bind, label, detect and/or cleave nucleic acids. For example, Vlassov, et al., (1986) Nucleic Acids Res 14:4065-4076, describe covalent bonding of a single-stranded DNA fragment with alkylating derivatives of nucleotides complementary to target sequences. A report of similar work by the same group is that by Knorre, et al., (1985) Biochimie 67:785-789. Iverson and Dervan also showed sequence-specific cleavage of single-stranded DNA mediated by incorporation of a modified nucleotide which was capable of activating cleavage (J Am Chem Soc (1987) 109:1241-1243). Meyer, et al., (1989) J Am Chem Soc 111:8517-8519, effect covalent crosslinking to a target nucleotide using an alkylating agent complementary to the single-stranded target nucleotide sequence. A photoactivated crosslinking to single-stranded oligonucleotides mediated by psoralen was disclosed by Lee, et al., (1988) Biochemistry 27:3197-3203. Use of crosslinking in triple-helix forming probes was also disclosed by Home, et al., (1990) J Am Chem Soc 112:2435-2437. Use of N4,N4-ethanocytosine as an alkylating agent to crosslink to single-stranded oligonucleotides has also been described by Webb and Matteucci, (1986) J Am Chem Soc 108:2764-2765; Nucleic Acids Res (1986) 14:7661-7674; Feteritz, et al., (1991) J. Am. Chem. Soc. 113:4000. Various compounds to bind, detect, label and/or cleave nucleic acids are known in the art. See, for example, U.S. Pat. Nos. 5,543,507; 5,672,593; 5,484,908; 5,256,648 and 5,681,941.
Proteins
[0125] The isolated proteins of the present invention comprise a polypeptide having at least 10 amino acids from a polypeptide of the present invention (or conservative variants thereof) such as those encoded by any one of the polynucleotides of the present invention as discussed more fully above (e.g., Table 1). The proteins of the present invention or variants thereof can comprise any number of contiguous amino acid residues from a polypeptide of the present invention, wherein that number is selected from the group of integers consisting of from 10 to the number of residues in a full-length polypeptide of the present invention. Optionally, this subsequence of contiguous amino acids is at least 15, 20, 25, 30, 35 or 40 amino acids in length, often at least 50, 60, 70, 80 or 90 amino acids in length. Further, the number of such subsequences can be any integer selected from the group consisting of from 1 to 20, such as 2, 3, 4 or 5.
[0126] The present invention further provides a protein comprising a polypeptide having a specified sequence identity/similarity with a polypeptide of the present invention. The percentage of sequence identity/similarity is an integer selected from the group consisting of from 50 to 99. Exemplary sequence identity/similarity values include 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% and 95%. Sequence identity can be determined using, for example, the GAP, CLUSTALW or BLAST algorithms.
[0127] As those of skill will appreciate, the present invention includes, but is not limited to, catalytically active polypeptides of the present invention (i.e., enzymes). Catalytically active polypeptides have a specific activity of at least 20%, 30% or 40% and preferably at least 50%, 60% or 70% and most preferably at least 80%, 90% or 95% that of the native (non-synthetic), endogenous polypeptide. Further, the substrate specificity (kcat/Km) is optionally substantially similar to the native (non-synthetic), endogenous polypeptide. Typically, the Km will be at least 30%, 40%, or 50%, that of the native (non-synthetic), endogenous polypeptide; and more preferably at least 60%, 70%, 80% or 90%. Methods of assaying and quantifying measures of enzymatic activity and substrate specificity (kcat/Km) are well known to those of skill in the art.
[0128] Generally, the proteins of the present invention will, when presented as an immunogen, elicit production of an antibody specifically reactive to a polypeptide of the present invention. Further, the proteins of the present invention will not bind to antisera raised against a polypeptide of the present invention which has been fully immunosorbed with the same polypeptide. Immunoassays for determining binding are well known to those of skill in the art. A preferred immunoassay is a competitive immunoassay. Thus, the proteins of the present invention can be employed as immunogens for constructing antibodies immunoreactive to a protein of the present invention for such exemplary utilities as immunoassays or protein purification techniques.
Expression of Proteins in Host Cells
[0129] Using the nucleic acids of the present invention, one may express a protein of the present invention in a recombinantly engineered cell such as bacteria, yeast, insect, mammalian or preferably plant cells. The cells produce the protein in a non-natural condition (e.g., in quantity, composition, location and/or time), because they have been genetically altered through human intervention to do so.
[0130] It is expected that those of skill in the art are knowledgeable in the numerous expression systems available for expression of a nucleic acid encoding a protein of the present invention. No attempt to describe in detail the various methods known for the expression of proteins in prokaryotes or eukaryotes will be made.
[0131] In brief summary, the expression of isolated nucleic acids encoding a protein of the present invention will typically be achieved by operably linking, for example, the DNA or cDNA to a promoter (which is either constitutive or regulatable), followed by incorporation into an expression vector. The vectors can be suitable for replication and integration in either prokaryotes or eukaryotes. Typical expression vectors contain transcription and translation terminators, initiation sequences and promoters useful for regulation of the expression of the DNA encoding a protein of the present invention. To obtain high level expression of a cloned gene, it is desirable to construct expression vectors which contain, at the minimum, a strong promoter to direct transcription, a ribosome binding site for translational initiation and a transcription/translation terminator. One of skill would recognize that modifications can be made to a protein of the present invention without diminishing its biological activity. Some modifications may be made to facilitate the cloning, expression, or incorporation of the targeting molecule into a fusion protein. Such modifications are well known to those of skill in the art and include, for example, a methionine added at the amino terminus to provide an initiation site or additional amino acids (e.g., poly His) placed on either terminus to create conveniently located purification sequences. Restriction sites or termination codons can also be introduced.
Synthesis of Proteins
[0132] The proteins of the present invention can be constructed using non-cellular synthetic methods. Solid phase synthesis of proteins of less than about 50 amino acids in length may be accomplished by attaching the C-terminal amino acid of the sequence to an insoluble support followed by sequential addition of the remaining amino acids in the sequence. Techniques for solid phase synthesis are described by Barany and Merrifield, Solid-Phase Peptide Synthesis, pp. 3-284 in The Peptides: Analysis, Synthesis, Biology Vol. 2: Special Methods in Peptide Synthesis, Part A.; Merrifield, et al., (1963) J. Am. Chem. Soc. 85:2149-2156 and Stewart, et al., Solid Phase Peptide Synthesis, 2nd ed., Pierce Chem. Co., Rockford, Ill. (1984). Proteins of greater length may be synthesized by condensation of the amino and carboxy termini of shorter fragments. Methods of forming peptide bonds by activation of a carboxy terminal end (e.g., by the use of the coupling reagent N,N'-dicycylohexylcarbodiimide) are known to those of skill.
Purification of Proteins
[0133] The proteins of the present invention may be purified by standard techniques well known to those of skill in the art. Recombinantly produced proteins of the present invention can be directly expressed or expressed as a fusion protein. The recombinant protein is purified by a combination of cell lysis (e.g., sonication, French press) and affinity chromatography. For fusion products, subsequent digestion of the fusion protein with an appropriate proteolytic enzyme releases the desired recombinant protein.
[0134] The proteins of this invention, recombinant or synthetic, may be purified to substantial purity by standard techniques well known in the art, including detergent solubilization, selective precipitation with such substances as ammonium sulfate, column chromatography, immunopurification methods and others. See, for instance, Scopes, Protein Purification: Principles and Practice, Springer-Verlag: New York (1982); Deutscher, Guide to Protein Purification, Academic Press (1990). For example, antibodies may be raised to the proteins as described herein. Purification from E. coli can be achieved following procedures described in U.S. Pat. No. 4,511,503. The protein may then be isolated from cells expressing the protein and further purified by standard protein chemistry techniques as described herein. Detection of the expressed protein is achieved by methods known in the art and include, for example, radioimmunoassays, Western blotting techniques or immunoprecipitation.
Introduction of Nucleic Acids into Host Cells
[0135] The method of introducing a nucleic acid of the present invention into a host cell is not critical to the instant invention. Transformation or transfection methods are conveniently used. Accordingly, a wide variety of methods have been developed to insert a DNA sequence into the genome of a host cell to obtain the transcription and/or translation of the sequence to effect phenotypic changes in the organism. Thus, any method which provides for effective introduction of a nucleic acid may be employed.
A. Plant Transformation
[0136] A nucleic acid comprising a polynucleotide of the present invention is optionally introduced into a plant. Generally, the polynucleotide will first be incorporated into a recombinant expression cassette or vector. Isolated nucleic acid acids of the present invention can be introduced into plants according to techniques known in the art. Techniques for transforming a wide variety of higher plant species are well known and described in the technical, scientific, and patent literature. See, for example, Weising, et al., (1988) Ann. Rev. Genet. 22:421-477. For example, the DNA construct may be introduced directly into the genomic DNA of the plant cell using techniques such as electroporation, polyethylene glycol (PEG) poration, particle bombardment, silicon fiber delivery or microinjection of plant cell protoplasts or embryogenic callus. See, e.g., Tomes, et al., Direct DNA Transfer into Intact Plant Cells Via Microprojectile Bombardment. pp. 197-213 in Plant Cell, Tissue and Organ Culture, Fundamental Methods. eds. Gamborg and Phillips. Springer-Verlag Berlin Heidelberg New York, 1995; see, U.S. Pat. No. 5,990,387. The introduction of DNA constructs using PEG precipitation is described in Paszkowski, et al., (1984) Embo J. 3:2717-2722. Electroporation techniques are described in Fromm, et al., (1985) Proc. Natl. Acad. Sci. (USA) 82:5824. Ballistic transformation techniques are described in Klein, et al., (1987) Nature 327:70-73.
[0137] Agrobacterium tumefaciens-mediated transformation techniques are well described in the scientific literature. See, for example, Horsch, et al., (1984) Science 233:496-498; Fraley, et al., (1983) Proc. Natl. Acad. Sci. (USA) 80:4803 and Plant Molecular Biology: A Laboratory Manual, Chapter 8, Clark, Ed., Springer-Verlag, Berlin (1997). The DNA constructs may be combined with suitable T-DNA flanking regions and introduced into a conventional Agrobacterium tumefaciens host vector. The virulence functions of the Agrobacterium tumefaciens host will direct the insertion of the construct and adjacent marker into the plant cell DNA when the cell is infected by the bacteria. See, U.S. Pat. No. 5,591,616. Although Agrobacterium is useful primarily in dicots, certain monocots can be transformed by Agrobacterium. For instance, Agrobacterium transformation of maize is described in U.S. Pat. No. 5,550,318.
[0138] Other methods of transfection or transformation include (1) Agrobacterium rhizogenes-mediated transformation (see, e.g., Lichtenstein and Fuller In: Genetic Engineering, vol. 6, Rigby, Ed., London, Academic Press, 1987; and Lichtenstein, and Draper, In: DNA Cloning, Vol. II, Glover, Ed., Oxford, IRI Press, 1985), PCT Application Number PCT/US87/02512 (WO 1988/02405 published Apr. 7, 1988) describes the use of A. rhizogenes strain A4 and its Ri plasmid along with A. tumefaciens vectors pARC8 or pARC16 (2) liposome-mediated DNA uptake (see, e.g., Freeman, et al., (1984) Plant Cell Physiol. 25:1353), (3) the vortexing method (see, e.g., Kindle, (1990) Proc. Natl. Acad. Sci., (USA) 87:1228).
[0139] DNA can also be introduced into plants by direct DNA transfer into pollen as described by Zhou, et al., (1983) Methods in Enzymology 101:433; Hess, (1987) Intern Rev. Cytol. 107:367; Luo, et al., (1988) Plant Mol. Biol. Reporter 6:165. Expression of polypeptide coding genes can be obtained by injection of the DNA into reproductive organs of a plant as described by Pena, et al., (1987) Nature, 325.274. DNA can also be injected directly into the cells of immature embryos and the rehydration of desiccated embryos as described by Neuhaus, et al., (1987) Theor. Appl. Genet., 75:30 and Benbrook, et al., in Proceedings Bio Expo 1986, Butterworth, Stoneham, Mass., pp. 27-54 (1986). A variety of plant viruses that can be employed as vectors are known in the art and include cauliflower mosaic virus (CaMV), geminivirus, brome mosaic virus and tobacco mosaic virus.
B. Transfection of Prokaryotes, Lower Eukaryotes, and Animal Cells
[0140] Animal and lower eukaryotic (e.g., yeast) host cells are competent or rendered competent for transfection by various means. There are several well-known methods of introducing DNA into animal cells. These include: calcium phosphate precipitation, fusion of the recipient cells with bacterial protoplasts containing the DNA, treatment of the recipient cells with liposomes containing the DNA, DEAE dextran, electroporation, biolistics and micro-injection of the DNA directly into the cells. The transfected cells are cultured by means well known in the art. Kuchler, Biochemical Methods in Cell Culture and Virology, Dowden, Hutchinson and Ross, Inc. (1977).
Transgenic Plant Regeneration
[0141] Plant cells which directly result or are derived from the nucleic acid introduction techniques can be cultured to regenerate a whole plant which possesses the introduced genotype. Such regeneration techniques often rely on manipulation of certain phytohormones in a tissue culture growth medium. Plants cells can be regenerated, e.g., from single cells, callus tissue or leaf discs according to standard plant tissue culture techniques. It is well known in the art that various cells, tissues, and organs from almost any plant can be successfully cultured to regenerate an entire plant. Plant regeneration from cultured protoplasts is described in Evans, et al., Protoplasts Isolation and Culture, Handbook of Plant Cell Culture, Macmillan Publishing Company, New York, pp. 124-176 (1983) and Binding, Regeneration of Plants, Plant Protoplasts, CRC Press, Boca Raton, pp. 21-73 (1985).
[0142] The regeneration of plants from either single plant protoplasts or various explants is well known in the art. See, for example, Methods for Plant Molecular Biology, Weissbach and Weissbach, eds., Academic Press, Inc., San Diego, Calif. (1988). This regeneration and growth process includes the steps of selection of transformant cells and shoots, rooting the transformant shoots and growth of the plantlets in soil. For maize cell culture and regeneration see generally, The Maize Handbook, Freeling and Walbot, Eds., Springer, New York (1994); Corn and Corn Improvement, 3rd edition, Sprague and Dudley Eds., American Society of Agronomy, Madison, Wis. (1988). For transformation and regeneration of maize see, Gordon-Kamm, et al., (1990) The Plant Cell 2:603-618.
[0143] The regeneration of plants containing the polynucleotide of the present invention and introduced by Agrobacterium from leaf explants can be achieved as described by Horsch, et al., (1985) Science, 227:1229-1231. In this procedure, transformants are grown in the presence of a selection agent and in a medium that induces the regeneration of shoots in the plant species being transformed as described by Fraley, et al., (1983) Proc. Natl. Acad. Sci. (U.S.A.) 80:4803. This procedure typically produces shoots within two to four weeks and these transformant shoots are then transferred to an appropriate root-inducing medium containing the selective agent and an antibiotic to prevent bacterial growth. Transgenic plants of the present invention may be fertile or sterile.
[0144] One of skill will recognize that after the recombinant expression cassette is stably incorporated in transgenic plants and confirmed to be operable, it can be introduced into other plants by sexual crossing. Any of a number of standard breeding techniques can be used, depending upon the species to be crossed. In vegetatively propagated crops, mature transgenic plants can be propagated by the taking of cuttings or by tissue culture techniques to produce multiple identical plants. Selection of desirable transgenics is made and new varieties are obtained and propagated vegetatively for commercial use. In seed propagated crops, mature transgenic plants can be self-crossed to produce a homozygous inbred plant. The inbred plant produces seed containing the newly introduced heterologous nucleic acid. These seeds can be grown to produce plants that would produce the selected phenotype. Parts obtained from the regenerated plant, such as flowers, seeds, leaves, branches, fruit and the like are included in the invention, provided that these parts comprise cells comprising the isolated nucleic acid of the present invention. Progeny and variants, and mutants of the regenerated plants are also included within the scope of the invention, provided that these parts comprise the introduced nucleic acid sequences.
[0145] Transgenic plants expressing a polynucleotide of the present invention can be screened for transmission of the nucleic acid of the present invention by, for example, standard immunoblot and DNA detection techniques. Expression at the RNA level can be determined initially to identify and quantitate expression-positive plants. Standard techniques for RNA analysis can be employed and include PCR amplification assays using oligonucleotide primers designed to amplify only the heterologous RNA templates and solution hybridization assays using heterologous nucleic acid-specific probes. The RNA-positive plants can then analyzed for protein expression by Western immunoblot analysis using the specifically reactive antibodies of the present invention. In addition, in situ hybridization and immunocytochemistry according to standard protocols can be done using heterologous nucleic acid specific polynucleotide probes and antibodies, respectively, to localize sites of expression within transgenic tissue. Generally, a number of transgenic lines are usually screened for the incorporated nucleic acid to identify and select plants with the most appropriate expression profiles.
[0146] A preferred embodiment is a transgenic plant that is homozygous for the added heterologous nucleic acid; i.e., a transgenic plant that contains two added nucleic acid sequences, one gene at the same locus on each chromosome of a chromosome pair. A homozygous transgenic plant can be obtained by sexually mating (selfing) a heterozygous transgenic plant that contains a single added heterologous nucleic acid, germinating some of the seed produced and analyzing the resulting plants produced for altered expression of a polynucleotide of the present invention relative to a control plant (i.e., native, non-transgenic). Back-crossing to a parental plant and out-crossing with a non-transgenic plant are also contemplated.
Modulating Polypeptide Levels and/or Composition
[0147] The present invention further provides a method for modulating (i.e., increasing or decreasing) the concentration or ratio of the polypeptides of the present invention in a plant or part thereof. Modulation can be effected by increasing or decreasing the concentration and/or the ratio of the polypeptides of the present invention in a plant. The method comprises introducing into a plant cell a recombinant expression cassette comprising a polynucleotide of the present invention as described above to obtain a transgenic plant cell, culturing the transgenic plant cell under transgenic plant cell growing conditions and inducing or repressing expression of a polynucleotide of the present invention in the transgenic plant for a time sufficient to modulate concentration and/or the ratios of the polypeptides in the transgenic plant or plant part.
[0148] In some embodiments, the concentration and/or ratios of polypeptides of the present invention in a plant may be modulated by altering, in vivo or in vitro, the promoter of a gene to up- or down-regulate gene expression. In some embodiments, the coding regions of native genes of the present invention can be altered via substitution, addition, insertion or deletion to decrease activity of the encoded enzyme. (See, e.g., Kmiec, U.S. Pat. No. 5,565,350; Zarling, et al., PCT/US93/03868.) And in some embodiments, an isolated nucleic acid (e.g., a vector) comprising a promoter sequence is transfected into a plant cell. Subsequently, a plant cell comprising the promoter operably linked to a polynucleotide of the present invention is selected for by means known to those of skill in the art such as, but not limited to, Southern blot, DNA sequencing or PCR analysis using primers specific to the promoter and to the gene and detecting amplicons produced therefrom. A plant or plant part altered or modified by the foregoing embodiments is grown under plant forming conditions for a time sufficient to modulate the concentration and/or ratios of polypeptides of the present invention in the plant. Plant forming conditions are well known in the art and discussed briefly, supra.
[0149] In general, concentration or the ratios of the polypeptides is increased or decreased by at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% relative to a native control plant, plant part or cell lacking the aforementioned recombinant expression cassette. Modulation in the present invention may occur during and/or subsequent to growth of the plant to the desired stage of development. Modulating nucleic acid expression temporally and/or in particular tissues can be controlled by employing the appropriate promoter operably linked to a polynucleotide of the present invention in, for example, sense or antisense orientation as discussed in greater detail, supra. Induction of expression of a polynucleotide of the present invention can also be controlled by exogenous administration of an effective amount of inducing compound. Inducible promoters and inducing compounds which activate expression from these promoters are well known in the art. In preferred embodiments, the polypeptides of the present invention are modulated in monocots, particularly maize.
UTRs and Codon Preference
[0150] In general, translational efficiency has been found to be regulated by specific sequence elements in the 5' non-coding or untranslated region (5' UTR) of the RNA. Positive sequence motifs include translational initiation consensus sequences (Kozak, (1987) Nucleic Acids Res. 15:8125) and the 7-methylguanosine cap structure (Drummond, et al., (1985) Nucleic Acids Res. 13:7375). Negative elements include stable intramolecular 5' UTR stem-loop structures (Muesing, et al., (1987) Cell 48:691) and AUG sequences or short open reading frames preceded by an appropriate AUG in the 5' UTR (Kozak, supra, Rao, et al., (1988) Mol. and Cell. Biol. 8:284). Accordingly, the present invention provides 5' and/or 3' untranslated regions for modulation of translation of heterologous coding sequences.
[0151] Further, the polypeptide-encoding segments of the polynucleotides of the present invention can be modified to alter codon usage. Altered codon usage can be employed to alter translational efficiency and/or to optimize the coding sequence for expression in a desired host such as to optimize the codon usage in a heterologous sequence for expression in maize. Codon usage in the coding regions of the polynucleotides of the present invention can be analyzed statistically using commercially available software packages such as "Codon Preference" available from the University of Wisconsin Genetics Computer Group (see, Devereaux, et al., (1984) Nucleic Acids Res. 12:387-395) or MacVector 4.1 (Eastman Kodak Co., New Haven, Conn.). Thus, the present invention provides a codon usage frequency characteristic of the coding region of at least one of the polynucleotides of the present invention. The number of polynucleotides that can be used to determine a codon usage frequency can be any integer from 1 to the number of polynucleotides of the present invention as provided herein. Optionally, the polynucleotides will be full-length sequences. An exemplary number of sequences for statistical analysis can be at least 1, 5, 10, 20, 50 or 100.
Sequence Shuffling
[0152] The present invention provides methods for sequence shuffling using polynucleotides of the present invention, and compositions resulting therefrom. Sequence shuffling is described in PCT Publication Number WO 1997/20078. See also, Zhang, et al., (1997) Proc. Natl. Acad. Sci. USA 94:4504-4509. Generally, sequence shuffling provides a means for generating libraries of polynucleotides having a desired characteristic which can be selected or screened for. Libraries of recombinant polynucleotides are generated from a population of related sequence polynucleotides which comprise sequence regions which have substantial sequence identity and can be homologously recombined in vitro or in vivo. The population of sequence-recombined polynucleotides comprises a subpopulation of polynucleotides which possess desired or advantageous characteristics and which can be selected by a suitable selection or screening method. The characteristics can be any property or attribute capable of being selected for or detected in a screening system and may include properties of: an encoded protein, a transcriptional element, a sequence controlling transcription, RNA processing, RNA stability, chromatin conformation, translation or other expression property of a gene or transgene, a replicative element, a protein-binding element or the like, such as any feature which confers a selectable or detectable property. In some embodiments, the selected characteristic will be a decreased Km and/or increased Kcat over the wild-type protein as provided herein. In other embodiments, a protein or polynucleotide generated from sequence shuffling will have a ligand binding affinity greater than the non-shuffled wild-type polynucleotide. The increase in such properties can be at least 110%, 120%, 130%, 140% or at least 150% of the wild-type value.
Generic and Consensus Sequences
[0153] Polynucleotides and polypeptides of the present invention further include those having: (a) a generic sequence of at least two homologous polynucleotides or polypeptides, respectively, of the present invention and (b) a consensus sequence of at least three homologous polynucleotides or polypeptides, respectively, of the present invention. The generic sequence of the present invention comprises each species of polypeptide or polynucleotide embraced by the generic polypeptide or polynucleotide sequence, respectively. The individual species encompassed by a polynucleotide having an amino acid or nucleic acid consensus sequence can be used to generate antibodies or produce nucleic acid probes or primers to screen for homologs in other species, genera, families, orders, classes, phyla or kingdoms. For example, a polynucleotide having a consensus sequence from a gene family of Zea mays can be used to generate antibody or nucleic acid probes or primers to other Gramineae species such as wheat, rice or sorghum. Alternatively, a polynucleotide having a consensus sequence generated from orthologous genes can be used to identify or isolate orthologs of other taxa. Typically, a polynucleotide having a consensus sequence will be at least 9, 10, 15, 20, 25, 30 or 40 amino acids in length, or 20, 30, 40, 50, 100 or 150 nucleotides in length. As those of skill in the art are aware, a conservative amino acid substitution can be used for amino acids which differ amongst aligned sequence but are from the same conservative substitution group as discussed above. Optionally, no more than 1 or 2 conservative amino acids are substituted for each 10 amino acid length of consensus sequence.
[0154] Similar sequences used for generation of a consensus or generic sequence include any number and combination of allelic variants of the same gene, orthologous or paralogous sequences as provided herein. Optionally, similar sequences used in generating a consensus or generic sequence are identified using the BLAST algorithm's smallest sum probability (P(N)). Various suppliers of sequence-analysis software are listed in chapter 7 of Current Protocols in Molecular Biology, Ausubel et al., Eds., Current Protocols, a joint venture between Greene Publishing Associates, Inc. and John Wiley & Sons, Inc. (Supplement 30). A polynucleotide sequence is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.1, more preferably less than about 0.01, or 0.001 and most preferably less than about 0.0001 or 0.00001. Similar polynucleotides can be aligned and a consensus or generic sequence generated using multiple sequence alignment software available from a number of commercial suppliers such as the Genetics Computer Group's (Madison, Wis.) PILEUP software, Vector NTI's (North Bethesda, Md.) ALIGNX, or Genecode's (Ann Arbor, Mich.) SEQUENCHER. Conveniently, default parameters of such software can be used to generate consensus or generic sequences.
Machine Applications
[0155] The present invention provides machines, data structures, and processes for modeling or analyzing the polynucleotides and polypeptides of the present invention.
A. Machines: Data, Data Structures, Processes and Functions
[0156] The present invention provides a machine having a memory comprising: 1) data representing a sequence of a polynucleotide or polypeptide of the present invention, 2) a data structure which reflects the underlying organization and structure of the data and facilitates program access to data elements corresponding to logical sub-components of the sequence, 3) processes for effecting the use, analysis, or modeling of the sequence, and 4) optionally, a function or utility for the polynucleotide or polypeptide. Thus, the present invention provides a memory for storing data that can be accessed by a computer programmed to implement a process for affecting the use, analyses or modeling of a sequence of a polynucleotide, with the memory comprising data representing the sequence of a polynucleotide of the present invention.
[0157] The machine of the present invention is typically a digital computer. The term "computer" includes one or several desktop or portable computers, computer workstations, servers (including intranet or internet servers), mainframes and any integrated system comprising any of the above irrespective of whether the processing, memory, input or output of the computer is remote or local, as well as any networking interconnecting the modules of the computer. The term "computer" is exclusive of computers of the United States Patent and Trademark Office or the European Patent Office when data representing the sequence of polypeptides or polynucleotides of the present invention is used for patentability searches.
[0158] The present invention contemplates providing as data a sequence of a polynucleotide of the present invention embodied in a computer readable medium. As those of skill in the art will be aware, the form of memory of a machine of the present invention or the particular embodiment of the computer readable medium, are not critical elements of the invention and can take a variety of forms. The memory of such a machine includes, but is not limited to, ROM or RAM or computer readable media such as, but not limited to, magnetic media such as computer disks or hard drives or media such as CD-ROMs, DVDs and the like.
[0159] The present invention further contemplates providing a data structure that is also contained in memory. The data structure may be defined by the computer programs that define the processes (see below) or it may be defined by the programming of separate data storage and retrieval programs subroutines or systems. Thus, the present invention provides a memory for storing a data structure that can be accessed by a computer programmed to implement a process for affecting the use, analysis or modeling of a sequence of a polynucleotide. The memory comprises data representing a polynucleotide having the sequence of a polynucleotide of the present invention. The data is stored within memory. Further, a data structure, stored within memory, is associated with the data reflecting the underlying organization and structure of the data to facilitate program access to data elements corresponding to logical sub-components of the sequence. The data structure enables the polynucleotide to be identified and manipulated by such programs.
[0160] In a further embodiment, the present invention provides a data structure that contains data representing a sequence of a polynucleotide of the present invention stored within a computer readable medium. The data structure is organized to reflect the logical structuring of the sequence, so that the sequence is easily analyzed by software programs capable of accessing the data structure. In particular, the data structures of the present invention organize the reference sequences of the present invention in a manner which allows software tools to perform a wide variety of analyses using logical elements and sub-elements of each sequence.
[0161] An example of such a data structure resembles a layered hash table, where in one dimension the base content of the sequence is represented by a string of elements A, T, C, G and N. The direction from the 5' end to the 3' end is reflected by the order from the position 0 to the position of the length of the string minus one. Such a string, corresponding to a nucleotide sequence of interest, has a certain number of substrings, each of which is delimited by the string position of its 5' end and the string position of its 3' end within the parent string. In a second dimension, each substring is associated with or pointed to one or multiple attribute fields. Such attribute fields contain annotations to the region on the nucleotide sequence represented by the substring.
[0162] For example, a sequence under investigation is 520 bases long and represented by a string named SeqTarget. There is a minor groove in the 5' upstream non-coding region from position 12 to 38, which is identified as a binding site for an enhancer protein HM-A, which in turn will increase the transcription of the gene represented by SeqTarget. Here, the substring is represented as (12, 38) and has the following attributes: [upstream uncoded], [minor groove], [HM-A binding] and [increase transcription upon binding by HM-A]. Similarly, other types of information can be stored and structured in this manner, such as information related to the whole sequence, e.g., whether the sequence is a full length viral gene, a mammalian house keeping gene or an EST from clone X, information related to the 3' down stream non-coding region, e.g., hair pin structure and information related to various domains of the coding region, e.g., Zinc finger.
[0163] This data structure is an open structure and is robust enough to accommodate newly generated data and acquired knowledge. Such a structure is also a flexible structure. It can be trimmed down to a 1-D string to facilitate data mining and analysis steps, such as clustering, repeat-masking, and HMM analysis. Meanwhile, such a data structure also can extend the associated attributes into multiple dimensions. Pointers can be established among the dimensioned attributes when needed to facilitate data management and processing in a comprehensive genomics knowledgebase. Furthermore, such a data structure is object-oriented. Polymorphism can be represented by a family or class of sequence objects, each of which has an internal structure as discussed above. The common traits are abstracted and assigned to the parent object, whereas each child object represents a specific variant of the family or class. Such a data structure allows data to be efficiently retrieved, updated and integrated by the software applications associated with the sequence database and/or knowledgebase.
[0164] The present invention contemplates providing processes for effecting analysis and modeling, which are described in the following section.
[0165] Optionally, the present invention further contemplates that the machine of the present invention will embody in some manner a utility or function for the polynucleotide or polypeptide of the present invention. The function or utility of the polynucleotide or polypeptide can be a function or utility for the sequence data, per se, or of the tangible material. Exemplary function or utilities include the name (per International Union of Biochemistry and Molecular Biology rules of nomenclature) or function of the enzyme or protein represented by the polynucleotide or polypeptide of the present invention; the metabolic pathway of the protein represented by the polynucleotide or polypeptide of the present invention; the substrate or product or structural role of the protein represented by the polynucleotide or polypeptide of the present invention or the phenotype (e.g., an agronomic or pharmacological trait) affected by modulating expression or activity of the protein represented by the polynucleotide or polypeptide of the present invention.
B. Computer Analysis and Modeling
[0166] The present invention provides a process of modeling and analyzing data representative of a polynucleotide or polypeptide sequence of the present invention. The process comprises entering sequence data of a polynucleotide or polypeptide of the present invention into a machine having a hardware or software sequence modeling and analysis system, developing data structures to facilitate access to the sequence data, manipulating the data to model or analyze the structure or activity of the polynucleotide or polypeptide and displaying the results of the modeling or analysis. Thus, the present invention provides a process for affecting the use, analysis or modeling of a polynucleotide sequence or its derived peptide sequence through use of a computer having a memory. The process comprises: 1) placing into the memory data representing a polynucleotide having the sequence of a polynucleotide of the present invention, developing within the memory a data structure associated with the data and reflecting the underlying organization and structure of the data to facilitate program access to data elements corresponding to logical sub-components of the sequence, 2) programming the computer with a program containing instructions sufficient to implement the process for effecting the use, analysis or modeling of the polynucleotide sequence or the peptide sequence and 3) executing the program on the computer while granting the program access to the data and to the data structure within the memory.
[0167] A variety of modeling and analytic tools are well known in the art and available commercially. Included amongst the modeling/analysis tools are methods to: 1) recognize overlapping sequences (e.g., from a sequencing project) with a polynucleotide of the present invention and create an alignment called a "contig"; 2) identify restriction enzyme sites of a polynucleotide of the present invention; 3) identify the products of a T1 ribonuclease digestion of a polynucleotide of the present invention; 4) identify PCR primers with minimal self-complementarity; 5) compute pairwise distances between sequences in an alignment, reconstruct phylogentic trees using distance methods and calculate the degree of divergence of two protein coding regions; 6) identify patterns such as coding regions, terminators, repeats and other consensus patterns in polynucleotides of the present invention; 7) identify RNA secondary structure; 8) identify sequence motifs, isoelectric point, secondary structure, hydrophobicity and antigenicity in polypeptides of the present invention; 9) translate polynucleotides of the present invention and backtranslate polypeptides of the present invention and 10) compare two protein or nucleic acid sequences and identifying points of similarity or dissimilarity between them.
[0168] The processes for effecting analysis and modeling can be produced independently or obtained from commercial suppliers. Exemplary analysis and modeling tools are provided in products such as InforMax's (Bethesda, Md.) Vector NTI Suite (Version 5.5), Intelligenetics' (Mountain View, Calif.) PC/Gene program and Genetics Computer Group's (Madison, Wis.) Wisconsin Package® (Version 10.0); these tools, and the functions they perform, (as provided and disclosed by the programs and accompanying literature) are incorporated herein by reference and are described in more detail in section C which follows.
[0169] Thus, in a further embodiment, the present invention provides a machine-readable media containing a computer program and data, comprising a program stored on the media containing instructions sufficient to implement a process for affecting the use, analysis or modeling of a representation of a polynucleotide or peptide sequence. The data stored on the media represents a sequence of a polynucleotide having the sequence of a polynucleotide of the present invention. The media also includes a data structure reflecting the underlying organization and structure of the data to facilitate program access to data elements corresponding to logical sub-components of the sequence, the data structure being inherent in the program and in the way in which the program organizes and accesses the data.
C. Homology Searches
[0170] As an example of such a comparative analysis, the present invention provides a process of identifying a candidate homologue (i.e., an ortholog or paralog) of a polynucleotide or polypeptide of the present invention. The process comprises entering sequence data of a polynucleotide or polypeptide of the present invention into a machine having a hardware or software sequence analysis system, developing data structures to facilitate access to the sequence data, manipulating the data to analyze the structure the polynucleotide or polypeptide and displaying the results of the analysis. A candidate homologue has statistically significant probability of having the same biological function (e.g., catalyzes the same reaction, binds to homologous proteins/nucleic acids, has a similar structural role) as the reference sequence to which it is compared. Accordingly, the polynucleotides and polypeptides of the present invention have utility in identifying homologs in animals or other plant species, particularly those in the family Gramineae such as, but not limited to, sorghum, wheat or rice.
[0171] The process of the present invention comprises obtaining data representing a polynucleotide or polypeptide test sequence. Test sequences can be obtained from a nucleic acid of an animal or plant. Test sequences can be obtained directly or indirectly from sequence databases including, but not limited to, those such as: GenBank, EMBL, GenSeq, SWISS-PROT or those available on-line via the UK Human Genome Mapping Project (HGMP) GenomeWeb. In some embodiments the test sequence is obtained from a plant species other than maize whose function is uncertain but will be compared to the test sequence to determine sequence similarity or sequence identity. The test sequence data is entered into a machine, such as a computer, containing: i) data representing a reference sequence and ii) a hardware or software sequence comparison system to compare the reference and test sequence for sequence similarity or identity.
[0172] Exemplary sequence comparison systems are provided for in sequence analysis software such as those provided by the Genetics Computer Group (Madison, Wis.) or InforMax (Bethesda, Md.) or Intelligenetics (Mountain View, Calif.). Optionally, sequence comparison is established using the BLAST or GAP suite of programs. Generally, a smallest sum probability value (P(N)) of less than 0.1, or alternatively, less than 0.01, 0.001, 0.0001 or 0.00001 using the BLAST 2.0 suite of algorithms under default parameters identifies the test sequence as a candidate homologue (i.e., an allele, ortholog or paralog) of the reference sequence. Those of skill in the art will recognize that a candidate homologue has an increased statistical probability of having the same or similar function as the gene/protein represented by the test sequence.
[0173] The reference sequence can be the sequence of a polypeptide or a polynucleotide of the present invention. The reference or test sequence is each optionally at least 25 amino acids or at least 100 nucleotides in length. The length of the reference or test sequences can be the length of the polynucleotide or polypeptide described, respectively, above in the sections entitled "Nucleic Acids" (particularly section (g)) and "Proteins". As those of skill in the art are aware, the greater the sequence identity/similarity between a reference sequence of known function and a test sequence, the greater the probability that the test sequence will have the same or similar function as the reference sequence. The results of the comparison between the test and reference sequences are outputted (e.g., displayed, printed, recorded) via any one of a number of output devices and/or media (e.g., computer monitor, hard copy or computer readable medium).
Detection of Nucleic Acids
[0174] The present invention further provides methods for detecting a polynucleotide of the present invention in a nucleic acid sample suspected of containing a polynucleotide of the present invention, such as a plant cell lysate, particularly a lysate of maize. In some embodiments, a cognate gene of a polynucleotide of the present invention or portion thereof can be amplified prior to the step of contacting the nucleic acid sample with a polynucleotide of the present invention. The nucleic acid sample is contacted with the polynucleotide to form a hybridization complex. The polynucleotide hybridizes under stringent conditions to a gene encoding a polypeptide of the present invention. Formation of the hybridization complex is used to detect a gene encoding a polypeptide of the present invention in the nucleic acid sample. Those of skill will appreciate that an isolated nucleic acid comprising a polynucleotide of the present invention should lack cross-hybridizing sequences in common with non-target genes that would yield a false positive result. Detection of the hybridization complex can be achieved using any number of well known methods. For example, the nucleic acid sample, or a portion thereof, may be assayed by hybridization formats including but not limited to, solution phase, solid phase, mixed phase or in situ hybridization assays.
[0175] Detectable labels suitable for use in the present invention include any composition detectable by spectroscopic, radioisotopic, photochemical, biochemical, immunochemical, electrical, optical or chemical means. Useful labels in the present invention include biotin for staining with labeled streptavidin conjugate, magnetic beads, fluorescent dyes, radiolabels, enzymes and colorimetric labels. Other labels include ligands which bind to antibodies labeled with fluorophores, chemiluminescent agents and enzymes. Labeling the nucleic acids of the present invention is readily achieved such as by the use of labeled PCR primers.
[0176] Although the present invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be obvious that certain changes and modifications may be practiced within the scope of the appended claims.
Example 1
[0177] This example describes the construction of a cDNA library.
[0178] Total RNA can be isolated from maize tissues with TRIzol Reagent (Life Technology Inc. Gaithersburg, Md.) using a modification of the guanidine isothiocyanate/acid-phenol procedure described by Chomczynski and Sacchi (Chomczynski and Sacchi, (1987) Anal. Biochem. 162:156). In brief, plant tissue samples is pulverized in liquid nitrogen before the addition of the TRIzol Reagent and then further homogenized with a mortar and pestle. Addition of chloroform followed by centrifugation is conducted for separation of an aqueous phase and an organic phase. The total RNA is recovered by precipitation with isopropyl alcohol from the aqueous phase.
[0179] The selection of poly(A)+ RNA from total RNA can be performed using PolyATact system (Promega Corporation. Madison, Wis.). Biotinylated oligo(dT) primers are used to hybridize to the 3' poly(A) tails on mRNA. The hybrids are captured using streptavidin coupled to paramagnetic particles and a magnetic separation stand. The mRNA is then washed at high stringency conditions and eluted by RNase-free deionized water. cDNA synthesis and construction of unidirectional cDNA libraries can be accomplished using the SuperScript Plasmid System (Life Technology Inc. Gaithersburg, Md.). The first strand of cDNA is synthesized by priming an oligo(dT) primer containing a Not I site. The reaction is catalyzed by SuperScript Reverse Transcriptase II at 45° C. The second strand of cDNA is labeled with alpha-32P-dCTP and a portion of the reaction analyzed by agarose gel electrophoresis to determine cDNA sizes. cDNA molecules smaller than 500 base pairs and unligated adapters are removed by Sephacryl-S400 chromatography. The selected cDNA molecules are ligated into pSPORT1 vector in between of Not I and Sal I sites.
[0180] Alternatively, cDNA libraries can be prepared by any one of many methods available. For example, the cDNAs may be introduced into plasmid vectors by first preparing the cDNA libraries in Uni-ZAP® XR vectors according to the manufacturer's protocol (Stratagene Cloning Systems, La Jolla, Calif.). The Uni-ZAP® XR libraries are converted into plasmid libraries according to the protocol provided by Stratagene. Upon conversion, cDNA inserts will be contained in the plasmid vector pBluescript. In addition, the cDNAs may be introduced directly into precut Bluescript II SK(+) vectors (Stratagene) using T4 DNA ligase (New England Biolabs), followed by transfection into DH10B cells according to the manufacturer's protocol (GIBCO BRL Products). Once the cDNA inserts are in plasmid vectors, plasmid DNAs are prepared from randomly picked bacterial colonies containing recombinant pBluescript plasmids or the insert cDNA sequences are amplified via polymerase chain reaction using primers specific for vector sequences flanking the inserted cDNA sequences. Amplified insert DNAs or plasmid DNAs are sequenced in dye-primer sequencing reactions to generate partial cDNA sequences (expressed sequence tags or "ESTs"; see, Adams, et al., (1991) Science 252:1651-1656). The resulting ESTs are analyzed using a Perkin Elmer Model 377 fluorescent sequencer.
Example 2
[0181] This method describes construction of a full-length enriched cDNA library.
[0182] An enriched full-length cDNA library can be constructed using one of two variations of the method of Carninci, et al., (1996) Genomics 37:327-336. These variations are based on chemical introduction of a biotin group into the diol residue of the 5' cap structure of eukaryotic mRNA to select full-length first strand cDNA. The selection occurs by trapping the biotin residue at the cap sites using streptavidin-coated magnetic beads followed by RNase I treatment to eliminate incompletely synthesized cDNAs. Second strand cDNA is synthesized using established procedures such as those provided in Life Technologies' (Rockville, Md.) "SuperScript Plasmid System for cDNA Synthesis and Plasmid Cloning" kit. Libraries made by this method have been shown to contain 50% to 70% full-length cDNAs.
[0183] The first strand synthesis methods are detailed below. An asterisk denotes that the reagent was obtained from Life Technologies, Inc.
A. First Strand cDNA Synthesis Method 1 (with Trehalose)
TABLE-US-00003 mRNA (10 ug) 25 μl *Not I primer (5 ug) 10 μl *5x 1st strand buffer 43 μl *0.1 m DTT 20 μl *dNTP mix 10 mm 10 μl BSA 10 ug/μl 1 μl Trehalose (saturated) 59.2 μl RNase inhibitor (Promega) 1.8 μl *Superscript II RT 200 u/μl 20 μl 100% glycerol 18 μl Water 7 μl
[0184] The mRNA and Not I primer are mixed and denatured at 65° C. for 10 min. They are then chilled on ice and other components added to the tube. Incubation is at 45° C. for 2 min. Twenty microliters of RT (reverse transcriptase) is added to the reaction and start program on the thermocycler (MJ Research, Waltham, Mass.):
TABLE-US-00004 Step 1 45° C. 10 min Step 2 45° C. -0.3° C./cycle, 2 seconds/cycle Step 3 go to 2 for 33 cycles Step 4 35° C. 5 min Step 5 45° C. 5 min Step 6 45° C. 0.2° C./cycle, 1 sec/cycle Step 7 go to 7 for 49 cycles Step 8 55° C. 0.1° C./cycle, 12 sec/cycle Step 9 go to 8 for 49 cycles Step 10 55° C. 2 min Step 11 60° C. 2 min Step 12 go to 11 for 9 times Step 13 4° C. forever Step 14 end
B. First Strand cDNA Synthesis Method 2
TABLE-US-00005 mRNA (10 μg) 25 μl water 30 μl *Not I adapter primer (5 μg) 10 μl 65° C. for 10 min, chill on ice, then add following reagents, *5x first buffer 20 μl *0.1M DTT 10 μl *10 mM dNTP mix 5 μl
[0185] Incubate at 45° C. for 2 min, then add 10 μl of *Superscript II RT (200u/μl), start the following program:
TABLE-US-00006 Step 1 45° C. for 6 sec, -0.1° C./cycle Step 2 go to 1 for 99 additional cycles Step 3 35° C. for 5 min Step 4 45° C. for 60 min Step 5 50° C. for 10 min Step 6 4° C. forever Step 7 end
[0186] After the 1st strand cDNA synthesis, the DNA is extracted by phenol according to standard procedures, and then precipitated in NaOAc and ethanol, and stored in -20° C.
C. Oxidization of the Diol Group of mRNA for Biotin Labeling
[0187] First strand cDNA is spun down and washed once with 70% EtOH. The pellet resuspended in 23.2 μl of DEPC treated water and put on ice. Prepare 100 mM of NalO4 freshly and then add the following reagents:
TABLE-US-00007 mRNA:1st cDNA (start with 20 μg mRNA) 46.4 μl 100 mM NaIO4 (freshly made) 2.5 μl NaOAc 3M pH 4.5 1.1 μl
[0188] To make 100 mM NalO4, use 21.39 μg of NalO4 for 1 μl of water.
[0189] Wrap the tube in a foil and incubate on ice for 45 min.
[0190] After the incubation, the reaction is then precipitated in:
TABLE-US-00008 5M NaCl 10 μl 20% SDS 0.5 μl isopropanol 61 μl
[0191] Incubate on ice for at least 30 min, then spin it down at max speed at 4° C. for 30 min and wash once with 70% ethanol and then 80% EtOH.
D. Biotinylation of the mRNA Diol Group
[0192] Resuspend the DNA in 110 μl DEPC treated water, then add the following reagents:
TABLE-US-00009 20% SDS 5 μl 2M NaOAc pH 6.1 5 μl 10 mm biotin hydrazide (freshly made) 300 μl
[0193] Wrap in a foil and incubate at room temperature overnight.
E. RNase I Treatment
[0194] Precipitate DNA in:
TABLE-US-00010 5M NaCl 10 μl 2M NaOAc pH 6.1 75 μl biotinylated mRNA:cDNA 420 μl 100% EtOH (2.5 Vol) 1262.5 μl
[0195] (Perform this precipitation in two tubes and split the 420 μl of DNA into 210 μl each, add 5 μl of 5M NaCl, 37.5 μl of 2M NaOAc pH 6.1 and 631.25 μl of 100% EtOH).
[0196] Store at -20° C. for at least 30 min. Spin the DNA down at 4° C. at maximal speed for 30 min. and wash with 80% EtOH twice, then dissolve DNA in 70 μl RNase free water. Pool two tubes and end up with 140 μl.
[0197] Add the following reagents:
TABLE-US-00011 RNase One 10 U/μl 40 μl 1st cDNA:RNA 140 μl 10X buffer 20 μl Incubate at 37° C. for 15 min.
[0198] Add 5 μl of 40 μg/μl yeast tRNA to each sample for capturing.
F. Full Length 1st cDNA Capturing
[0199] Blocking the beads with yeast tRNA:
TABLE-US-00012 Beads 1 ml Yeast tRNA 40 μg/μl 5 μl
[0200] Incubate on ice for 30 min with mixing, wash 3 times with 1 ml of 2M NaCl, 50 mmEDTA, pH 8.0.
[0201] Resuspend the beads in 800 μl of 2M NaCl, 50 mm EDTA, pH 8.0, add RNase I treated sample 200 μl, and incubate the reaction for 30 min at room temperature.
[0202] Capture the beads using the magnetic stand, save the supernatant, and start following washes:
[0203] 2 washes with 2M NaCl, 50 mm EDTA, pH 8.0, 1 ml each time,
[0204] 1 wash with 0.4% SDS, 50 μg/ml tRNA,
[0205] 1 wash with 10 mm Tris-Cl pH 7.5, 0.2 mm EDTA, 10 mm NaCl, 20% glycerol,
[0206] 1 wash with 50 μg/m tRNA,
[0207] 1 wash with 1st cDNA buffer
G. Second Strand cDNA Synthesis
[0208] Resuspend the beads in:
TABLE-US-00013 *5X first buffer 8 μl *0.1 mM DTT 4 μl *10 mm dNTP mix 8 μl *5X 2nd buffer 60 μl *E. coli Ligase 10 U/μl 2 μl *E. coli DNA polymerase 10 U/μl 8 μl *E. coli RNaseH 2 U/μl 2 μl P32 dCTP 10 μci/μl 2 μl Or water up to 300 μl 208 μl
[0209] Incubate at 16° C. for 2 hr with mixing the reaction in every 30 min.
[0210] Add 4 μl of T4 DNA polymerase and incubate for additional 5 min at 16° C.
[0211] Elute 2nd cDNA from the beads.
[0212] Use a magnetic stand to separate the 2nd cDNA from the beads, then resuspend the beads in 200 μl of water, and then separate again, pool the samples (about 500 μl), Add 200 μl of water to the beads, then 200 μl of phenol:chloroform, vortex and spin to separate the sample with phenol.
[0213] Pool the DNA together (about 700 μl) and use phenol to clean the DNA again, DNA is then precipitated in 2 μg of glycogen and 0.5 vol of 7.5M NH4OAc and 2 vol of 100% EtOH. Precipitate overnight. Spin down the pellet and wash with 70% EtOH, air-dry the pellet.
TABLE-US-00014 DNA 250 μl DNA 200 μl 7.5M NH4OAc 125 μl 7.5M NH4OAc 100 μl 100% EtOH 750 μl 100% EtOH 600 μl glycogen 1 μg/μl 2 μl glycogen 1 μg/μl 2 μl
H. Sal I Adapter Ligation
[0214] Resuspend the pellet in 26 μl of water and use 1 μl for TAE gel.
[0215] Set up reaction as following:
TABLE-US-00015 2nd strand cDNA 25 μl *5X T4 DNA ligase buffer 10 μl *Sal I adapters 10 μl *T4 DNA ligase 5 μl
[0216] Mix gently, incubate the reaction at 16° C. overnight.
[0217] Add 2 μl of ligase second day and incubate at room temperature for 2 hrs (optional).
[0218] Add 50 μl water to the reaction and use 100 μl of phenol to clean the DNA, 90 μl of the upper phase is transferred into a new tube and precipitate in:
TABLE-US-00016 Glycogen 1 μg/μl 2 μl Upper phase DNA 90 μl 7.5M NH4OAc 50 μl 100% EtOH 300 μl
precipitate at -20° C. overnight
[0219] Spin down the pellet at 4° C. and wash in 70% EtOH, dry the pellet.
I. Not I Digestion
TABLE-US-00017
[0220] 2nd cDNA 41 μl *Reaction 3 buffer 5 μl *Not I 15 u/μl 4 μl
[0221] Mix gently and incubate the reaction at 37° C. for 2 hr.
[0222] Add 50 μl of water and 100 μl of phenol, vortex, and take 90 μl of the upper phase to a new tube, then add 50 μl of NH40Ac and 300 μl of EtOH. Precipitate overnight at -20° C.
[0223] Cloning, ligation and transformation are performed per the Superscript cDNA synthesis kit.
Example 3
[0224] This example describes cDNA sequencing and library subtraction.
[0225] Individual colonies can be picked and DNA prepared either by PCR with M13 forward primers and M13 reverse primers or by plasmid isolation. cDNA clones can be sequenced using M13 reverse primers.
[0226] cDNA libraries are plated out on 22×22 cm2 agar plate at density of about 3,000 colonies per plate. The plates are incubated in a 37° C. incubator for 12-24 hours. Colonies are picked into 384-well plates by a robot colony picker, Q-bot (GENETIX Limited). These plates are incubated overnight at 37° C. Once sufficient colonies are picked, they are pinned onto 22×22 cm2 nylon membranes using Q-bot. Each membrane holds 9,216 or 36,864 colonies. These membranes are placed onto an agar plate with an appropriate antibiotic. The plates are incubated at 37° C. overnight.
[0227] After colonies are recovered on the second day, these filters are placed on filter paper prewetted with denaturing solution for four minutes, then incubated on top of a boiling water bath for an additional four minutes. The filters are then placed on filter paper prewetted with neutralizing solution for four minutes. After excess solution is removed by placing the filters on dry filter papers for one minute, the colony side of the filters is placed into Proteinase K solution, incubated at 37° C. for 40-50 minutes. The filters are placed on dry filter papers to dry overnight. DNA is then cross-linked to nylon membrane by UV light treatment
[0228] Colony hybridization is conducted as described by Sambrook, et al., (in Molecular Cloning: A laboratory Manual, 2nd Edition). The following probes can be used in colony hybridization:
[0229] 1. First strand cDNA from the same tissue as the library was made from to remove the most redundant clones.
[0230] 2. 48-192 most redundant cDNA clones from the same library based on previous sequencing data.
[0231] 3. 192 most redundant cDNA clones in the entire maize sequence database.
[0232] 4. A Sal-A20 oligo nucleotide: TCG ACC CAC GCG TCC GAA AAA AAA AAA AAA AAA AAA, SEQ ID NO: 31, removes clones containing a poly A tail but no cDNA.
[0233] 5. cDNA clones derived from rRNA.
[0234] The image of the autoradiography is scanned into computer and the signal intensity and cold colony addresses of each colony is analyzed. Re-arraying of cold-colonies from 384 well plates to 96 well plates is conducted using Q-bot.
Example 4
[0235] This example describes identification of the gene from a computer homology search.
[0236] Gene identities can be determined by conducting BLAST (Basic Local Alignment Search Tool; Altschul, et al., (1993) J. Mol. Biol. 215:403-410) searches under default parameters for similarity to sequences contained in the BLAST "nr" database (comprising all non-redundant GenBank CDS translations, sequences derived from the 3-dimensional structure Brookhaven Protein Data Bank, the last major release of the SWISS-PROT protein sequence database, EMBL and DDBJ databases). The cDNA sequences are analyzed for similarity to all publicly available DNA sequences contained in the "nr" database using the BLASTN algorithm. The DNA sequences are translated in all reading frames and compared for similarity to all publicly available protein sequences contained in the "nr" database using the BLASTX algorithm (Gish and States, (1993) Nature Genetics 3:266-272) provided by the NCBI. In some cases, the sequencing data from two or more clones containing overlapping segments of DNA are used to construct contiguous DNA sequences.
[0237] Sequence alignments and percent identity calculations can be performed using the Megalign program of the LASERGENE bioinformatics computing suite (DNASTAR Inc., Madison, Wis.). Multiple alignments of the sequences can be performed using the Clustal method of alignment (Higgins and Sharp, (1989) CABIOS. 5:151-153) with the default parameters (GAP PENALTY=10, GAP LENGTH PENALTY=10). Default parameters for pairwise alignments using the Clustal method are KTUPLE 1, GAP PENALTY=3, WINDOW=5 and DIAGONALS SAVED=5.
[0238] Other methods of sequence alignment and percent identity analysis known to those of skill in the art, including those disclosed herein, can also be employed.
Example 5
[0239] This example describes expression of transgenes in monocot cells.
[0240] A transgene comprising a cDNA encoding the instant polypeptides in sense orientation with respect to the maize 27 kD zein promoter that is located 5' to the cDNA fragment, and the 10 kD zein 3' end that is located 3' to the cDNA fragment, can be constructed. The cDNA fragment of this gene may be generated by polymerase chain reaction (PCR) of the cDNA clone using appropriate oligonucleotide primers. Cloning sites (NcoI or SmaI) can be incorporated into the oligonucleotides to provide proper orientation of the DNA fragment when inserted into the digested vector pML103 as described below. Amplification is then performed in a standard PCR. The amplified DNA is then digested with restriction enzymes NcoI and SmaI and fractionated on an agarose gel. The appropriate band can be isolated from the gel and combined with a 4.9 kb NcoI-SmaI fragment of the plasmid pML103. Plasmid pML103 has been deposited under the terms of the Budapest Treaty at ATCC (American Type Culture Collection, 10801 University Blvd., Manassas, Va. 20110-2209) and bears accession number ATCC 97366. The DNA segment from pML103 contains a 1.05 kb SalI-NcoI promoter fragment of the maize 27 kD zein gene and a 0.96 kb SmaI-SalI fragment from the 3' end of the maize 10 kD zein gene in the vector pGem9Zf(+) (Promega). Vector and insert DNA can be ligated at 15° C. overnight, essentially as described (Maniatis). The ligated DNA may then be used to transform E. coli XL1-Blue (Epicurian Coli XL-1 Blue; Stratagene). Bacterial transformants can be screened by restriction enzyme digestion of plasmid DNA and limited nucleotide sequence analysis using the dideoxy chain termination method (Sequenase DNA Sequencing Kit; US Biochemical). The resulting plasmid construct would comprise a transgene encoding, in the 5' to 3' direction, the maize 27 kD zein promoter, a cDNA fragment encoding the instant polypeptides and the 10 kD zein 3' region.
[0241] The transgene described above can then be introduced into maize cells by the following procedure. Immature maize embryos can be dissected from developing caryopses derived from crosses of the inbred maize lines H99 and LH132. The embryos are isolated 10 to 11 days after pollination when they are 1.0 to 1.5 mm long. The embryos are then placed with the axis-side facing down and in contact with agarose-solidified N6 medium (Chu, et al., (1975) Sci. Sin. Peking 18:659-668). The embryos are kept in the dark at 27° C. Friable embryogenic callus consisting of undifferentiated masses of cells with somatic proembryoids and embryoids borne on suspensor structures proliferates from the scutellum of these immature embryos. The embryogenic callus isolated from the primary explant can be cultured on N6 medium and sub-cultured on this medium every 2 to 3 weeks.
[0242] The plasmid, p35S/Ac (Hoechst Ag, Frankfurt, Germany) or equivalent may be used in transformation experiments in order to provide for a selectable marker. This plasmid contains the Pat gene (see, EP Patent Publication Number 0 242 236) which encodes phosphinothricin acetyl transferase (PAT). The enzyme PAT confers resistance to herbicidal glutamine synthetase inhibitors such as phosphinothricin. The pat gene in p35S/Ac is under the control of the 35S promoter from Cauliflower Mosaic Virus (Odell, et al., (1985) Nature 313:810-812) and the 3' region of the nopaline synthase gene from the T-DNA of the Ti plasmid of Agrobacterium tumefaciens.
[0243] The particle bombardment method (Klein, et al., (1987) Nature 327:70-73) may be used to transfer genes to the callus culture cells. According to this method, gold particles (1 μm in diameter) are coated with DNA using the following technique. Ten μg of plasmid DNAs are added to 50 μL of a suspension of gold particles (60 mg per mL). Calcium chloride (50 μL of a 2.5 M solution) and spermidine free base (20 μL of a 1.0 M solution) are added to the particles. The suspension is vortexed during the addition of these solutions. After 10 minutes, the tubes are briefly centrifuged (5 sec at 15,000 rpm) and the supernatant removed. The particles are resuspended in 200 μL of absolute ethanol, centrifuged again and the supernatant removed. The ethanol rinse is performed again and the particles resuspended in a final volume of 30 μL of ethanol. An aliquot (5 μL) of the DNA-coated gold particles can be placed in the center of a Kapton flying disc (Bio-Rad Labs). The particles are then accelerated into the maize tissue with a Biolistic PDS-1000/He (Bio-Rad Instruments, Hercules Calif.), using a helium pressure of 1000 psi, a gap distance of 0.5 cm and a flying distance of 1.0 cm.
[0244] For bombardment, the embryogenic tissue is placed on filter paper over agarose-solidified N6 medium. The tissue is arranged as a thin lawn and covers a circular area of about 5 cm in diameter. The petri dish containing the tissue can be placed in the chamber of the PDS-1000/He approximately 8 cm from the stopping screen. The air in the chamber is then evacuated to a vacuum of 28 inches of Hg. The macrocarrier is accelerated with a helium shock wave using a rupture membrane that bursts when the He pressure in the shock tube reaches 1000 psi.
[0245] Seven days after bombardment the tissue can be transferred to N6 medium that contains gluphosinate (2 mg per liter) and lacks casein or proline. The tissue continues to grow slowly on this medium. After an additional 2 weeks the tissue can be transferred to fresh N6 medium containing gluphosinate. After 6 weeks, areas of about 1 cm in diameter of actively growing callus can be identified on some of the plates containing the glufosinate-supplemented medium. These calli may continue to grow when sub-cultured on the selective medium.
[0246] Plants can be regenerated from the transgenic callus by first transferring clusters of tissue to N6 medium supplemented with 0.2 mg per liter of 2,4-D. After two weeks the tissue can be transferred to regeneration medium (Fromm, et al., (1990) Bio/Technology 8:833-839).
Example 6
[0247] This example describes expression of transgenes in dicot cells.
[0248] A seed-specific expression cassette composed of the promoter and transcription terminator from the gene encoding the β subunit of the seed storage protein phaseolin from the bean Phaseolus vulgaris (Doyle, et al., (1986) J. Biol. Chem. 261:9228-9238) can be used for expression of the instant polypeptides in transformed soybean. The phaseolin cassette includes about 500 nucleotides upstream (5') from the translation initiation codon and about 1650 nucleotides downstream (3') from the translation stop codon of phaseolin. Between the 5' and 3' regions are the unique restriction endonuclease sites Nco I (which includes the ATG translation initiation codon), SmaI, KpnI and XbaI. The entire cassette is flanked by Hind III sites.
[0249] The cDNA fragment of this gene may be generated by polymerase chain reaction (PCR) of the cDNA clone using appropriate oligonucleotide primers. Cloning sites can be incorporated into the oligonucleotides to provide proper orientation of the DNA fragment when inserted into the expression vector. Amplification is then performed as described above, and the isolated fragment is inserted into a pUC18 vector carrying the seed expression cassette.
[0250] Soybean embryos may then be transformed with the expression vector comprising sequences encoding the instant polypeptides. To induce somatic embryos, cotyledons, 3-5 mm in length dissected from surface sterilized, immature seeds of the soybean cultivar A2872, can be cultured in the light or dark at 26° C. on an appropriate agar medium for 6-10 weeks. Somatic embryos which produce secondary embryos are then excised and placed into a suitable liquid medium. After repeated selection for clusters of somatic embryos which multiplied as early, globular staged embryos, the suspensions are maintained as described below.
[0251] Soybean embryogenic suspension cultures can maintained in 35 mL liquid media on a rotary shaker, 150 rpm, at 26° C. with florescent lights on a 16:8 hour day/night schedule. Cultures are subcultured every two weeks by inoculating approximately 35 mg of tissue into 35 mL of liquid medium.
[0252] Soybean embryogenic suspension cultures may then be transformed by the method of particle gun bombardment (Klein, et al., (1987) Nature (London) 327:70-73, U.S. Pat. No. 4,945,050). A DuPont Biolistic PDS1000/HE instrument (helium retrofit) can be used for these transformations.
[0253] A selectable marker gene which can be used to facilitate soybean transformation is a transgene composed of the 35S promoter from Cauliflower Mosaic Virus (Odell, et al., (1985) Nature 313:810-812), the hygromycin phosphotransferase gene from plasmid pJR225 (from E. coli; Gritz, et al., (1983) Gene 25:179-188) and the 3' region of the nopaline synthase gene from the T-DNA of the Ti plasmid of Agrobacterium tumefaciens. The seed expression cassette comprising the phaseolin 5' region, the fragment encoding the instant polypeptides and the phaseolin 3' region can be isolated as a restriction fragment. This fragment can then be inserted into a unique restriction site of the vector carrying the marker gene.
[0254] To 50 μL of a 60 mg/mL 1 μmgold particle suspension is added (in order): 5 μL DNA (1 μg/4), 20 μl spermidine (0.1 M), and 50 μL CaCl2 (2.5 M). The particle preparation is then agitated for three minutes, spun in a microfuge for 10 seconds and the supernatant removed. The DNA-coated particles are then washed once in 400 μL 70% ethanol and resuspended in 40 μL of anhydrous ethanol. The DNA/particle suspension can be sonicated three times for one second each. Five microliters of the DNA-coated gold particles are then loaded on each macro carrier disk.
[0255] Approximately 300-400 mg of a two-week-old suspension culture is placed in an empty 60×15 mm petri dish and the residual liquid removed from the tissue with a pipette. For each transformation experiment, approximately 5-10 plates of tissue are normally bombarded. Membrane rupture pressure is set at 1100 psi and the chamber is evacuated to a vacuum of 28 inches mercury. The tissue is placed approximately 3.5 inches away from the retaining screen and bombarded three times. Following bombardment, the tissue can be divided in half and placed back into liquid and cultured as described above.
[0256] Five to seven days post bombardment, the liquid media may be exchanged with fresh media and eleven to twelve days post bombardment with fresh media containing 50 mg/mL hygromycin. This selective media can be refreshed weekly. Seven to eight weeks post bombardment, green, transformed tissue may be observed growing from untransformed, necrotic embryogenic clusters. Isolated green tissue is removed and inoculated into individual flasks to generate new, clonally propagated, transformed embryogenic suspension cultures. Each new line may be treated as an independent transformation event. These suspensions can then be subcultured and maintained as clusters of immature embryos or regenerated into whole plants by maturation and germination of individual somatic embryos.
Example 7
[0257] This example describes expression of a transgene in microbial cells.
[0258] The cDNAs encoding the instant polypeptides can be inserted into the T7 E. coli expression vector pBT430. This vector is a derivative of pET-3a (Rosenberg, et al., (1987) Gene 56:125-135) which employs the bacteriophage T7 RNA polymerase/T7 promoter system. Plasmid pBT430 was constructed by first destroying the EcoR I and Hind III sites in pET-3a at their original positions. An oligonucleotide adaptor containing EcoR I and Hind III sites was inserted at the BamH I site of pET-3a. This created pET-3aM with additional unique cloning sites for insertion of genes into the expression vector. Then, the Nde I site at the position of translation initiation was converted to an Nco I site using oligonucleotide-directed mutagenesis. The DNA sequence of pET-3aM in this region, 5'-CATATGG, was converted to 5'-CCCATGG in pBT430.
[0259] Plasmid DNA containing a cDNA may be appropriately digested to release a nucleic acid fragment encoding the protein. This fragment may then be purified on a 1% NuSieve GTG low melting agarose gel (FMC). Buffer and agarose contain 10 μg/ml ethidium bromide for visualization of the DNA fragment. The fragment can then be purified from the agarose gel by digestion with GELase (Epicentre Technologies) according to the manufacturer's instructions, ethanol precipitated, dried and resuspended in 20 μL of water. Appropriate oligonucleotide adapters may be ligated to the fragment using T4 DNA ligase (New England Biolabs, Beverly, Mass.). The fragment containing the ligated adapters can be purified from the excess adapters using low melting agarose as described above. The vector pBT430 is digested, dephosphorylated with alkaline phosphatase (NEB) and deproteinized with phenol/chloroform as described above. The prepared vector pBT430 and fragment can then be ligated at 16° C. for 15 hours followed by transformation into DH5 electrocompetent cells (GIBCO BRL). Transformants can be selected on agar plates containing LB media and 100 μg/mL ampicillin. Transformants containing the gene encoding the instant polypeptides are then screened for the correct orientation with respect to the T7 promoter by restriction enzyme analysis.
[0260] For high level expression, a plasmid clone with the cDNA insert in the correct orientation relative to the T7 promoter can be transformed into E. coli strain BL21(DE3) (Studier, et al., (1986) J. Mol. Biol. 189:113-130). Cultures are grown in LB medium containing ampicillin (100 mg/L) at 25° C. At an optical density at 600 nm of approximately 1, IPTG (isopropylthio-β-galactoside, the inducer) can be added to a final concentration of 0.4 mM and incubation can be continued for 3 h at 25° C. Cells are then harvested by centrifugation and re-suspended in 50 μL of 50 mM Tris-HCl at pH 8.0 containing 0.1 mM DTT and 0.2 mM phenyl methylsulfonyl fluoride. A small amount of 1 mm glass beads can be added and the mixture sonicated 3 times for about 5 seconds each time with a microprobe sonicator. The mixture is centrifuged and the protein concentration of the supernatant determined. One microgram of protein from the soluble fraction of the culture can be separated by SDS-polyacrylamide gel electrophoresis. Gels can be observed for protein bands migrating at the expected molecular weight.
Example 8
[0261] Isolation of the CesA10, 11 and 12 genes and their relevance to cell wall synthesis and stalk strength in maize.
[0262] All three genes were isolated from a library made from the zone of an elongating corn stalk internode between the elongation zone and the most mature part of the internode, the "transition zone". The library was made, subtracted, and sequenced as described in the preceding Examples 1, 2 and 3. A genomic database search was conducted as described in Example 4. Derived polypeptide sequences of all the Expressed Tag Sequences (ESTs) showing homology to the 1 kb 5'-end of any of the 9 previously known ZmCesA genes were aligned with the protein sequences of the latter. The sequences that did not fully match any of the known genes were sequenced from both ends of the respective cDNA clones. Three new, full-length genes, ZmCesA10 (SEQ ID NO: 25), ZmCesA11 (SEQ ID NO: 27) and ZmCesA12 (SEQ ID NO: 29) were isolated by this method.
[0263] The polypeptide sequences of the three genes derived from the cDNA sequences (SEQ ID NOS: 26, 28 and 30, respectively) clustered with the CesA genes from other species where they are known to be involved in secondary wall formation (FIG. 4). AtCesA7 and AtCesA8 have been found to make secondary wall in the vascular bundles (Taylor, et al., (2000). Multiple cellulose synthase catalytic subunits are required for cellulose synthesis in Arabidopsis. Plant Cell, (2000) 12:2529-2539.). Retrotransposon insertions into OsCesA4 and OsCesA7 resulted in a brittle culm phenotype in rice (Katsuyuki Tanaka, Akio Miyao, Kazumasa Murata, Katsura Onosato, Naoko Kojima, Yumiko Yamashita, Mayuko Harada, Takuji Sasaki, Hirohiko Hirochika, 2002, Analysis of rice brittle mutants caused by disruption of cellulose synthase genes OsCesA4 and OsCesA11 with the retrotransposon tos17. Plant, Animal & Microbe Genomes X. San Diego, Calif. Abs. Number 324). Each of the genes, ZmCesA 10, 11 or 12, groups with one or the other CesA gene from Arabidopsis or rice known to be involved in secondary wall formation and thus in determining tissue strength (FIG. 4). The CesA genes derived from the tissues specializing in secondary wall formation from other species (Gossypium, Zinnia, Populus) also group into the same clades with the aforementioned genes.
[0264] Further evidence that the maize genes are involved in secondary wall formation and thus in determining stalk strength was obtained from their expression pattern using the Massively Parallel Signature Sequencing (MPSS) technology (Brenner, et al., (2000), In vitro cloning of complex mixtures of DNA on microbeads: Physical separation of differentially expressed cDNAs. Proceedings-of-the-National-Academy-of-Sciences-of-the-United-States-of-A- merica (Feb. 15, 2000) 97:1665-1670; see also, Brenner, et al., (2000) Gene expression analysis by massively parallel signature sequencing (MPSS) on microbead arrays. Nature-Biotechnolog, [print] (June 2000) 18:630-634; see also, Dhugga, (2001), Building the wall: genes and enzyme complexes for polysaccharide synthases, Curr. Opin. Plant Biol. 4:488-493). All three genes are expressed in the tissues rich in cell wall content, supporting their involvement in secondary wall formation as deduced from their relationship to the genes from the other, aforementioned species know to play this role (FIG. 5). All three genes are expressed nearly identically across multiple tissues as seen from the correlation coefficient matrix (Table 3), further strengthening the argument that they are involved in secondary wall formation in the vascular bundles and thus in determining tissue strength.
[0265] Correlation among the expression level of the different CesA genes from maize as studied from Lynx are shown in Table 3.
TABLE-US-00018 TABLE 3 CesA1 CesA2 CesA3 CesA4 CesA5 CesA6 CesA7 CesA8 CesA10 CesA11 CesA12 CesA1 1 CesA2 0.59 1.00 CesA3 0.07 -0.15 1.00 CesA4 0.44 0.55 -0.10 1.00 CesA5 -0.20 -0.29 0.45 -0.33 1.00 CesA6 0.56 0.14 0.14 0.08 -0.13 1.00 CesA7 0.68 0.76 -0.06 0.57 -0.29 0.32 1.00 CesA8 0.59 0.73 -0.16 0.58 -0.36 0.26 0.61 1.00 CesA10 0.27 0.37 -0.27 0.33 -0.26 0.02 0.33 0.36 1.00 CesA11 0.39 0.47 -0.22 0.38 -0.28 0.11 0.40 0.42 0.95 1.00 CesA12 0.34 0.49 -0.27 0.37 -0.31 0.08 0.44 0.45 0.95 0.95 1
[0266] The correlation matrix was derived from the expression, measured in PPM, from 65 different tissue libraries. Note the nearly perfect correlation among the expression pattern of the CesA10, 11 and 12 genes.
Example 9
[0267] This example describes a procedure to identify plants containing Mu inserted into genes of interest and a strategy to identify the function of those genes. This procedure was also described in U.S. patent application Ser. No. 09/371,383 which disclosed members of the same gene family as the present application. One of skill in the art could readily conceive of use of this procedure with the any of the Cellulose Synthase (CesA) sequences disclosed in the current application. The current example is based on work with the CesA11 gene, identified as SEQ ID NO: 27 herein.
[0268] The Trait Utility System for Corn (TUSC) is a method that employs genetic and molecular techniques to facilitate the study of gene function in maize. Studying gene function implies that the gene's sequence is already known, thus the method works in reverse: from sequence to phenotype. This kind of application is referred to as "reverse genetics", which contrasts with "forward" methods that are designed to identify and isolate the gene(s) responsible for a particular trait (phenotype).
[0269] Pioneer Hi-Bred International, Inc., has a proprietary collection of maize genomic DNA from approximately 42,000 individual F1 plants (Reverse genetics for maize, Meeley and Briggs, (1995) Maize Genet. Coop. Newslett. 69:67-82). The genome of each of these individuals contains multiple copies of the transposable element family, Mutator (Mu). The Mu family is highly mutagenic; in the presence of the active element Mu-DR, these elements transpose throughout the genome, inserting into genic regions, and often disrupting gene function. By collecting genomic DNA from a large number (42,000) of individuals, Pioneer has assembled a library of the mutagenized maize genome.
[0270] Mu insertion events are predominantly heterozygous; given the recessive nature of most insertional mutations, the F1 plants appear wild-type. Each of the F1 plants is selfed to produce F2 seed, which is collected. In generating the F2 progeny, insertional mutations segregate in a Mendelian fashion so are useful for investigating a mutant allele's effect on the phenotype. The TUSC system has been successfully used by a number of laboratories to identify the function of a variety of genes (Cloning and characterization of the maize An1 gene, Bensen, et al., (1995) Plant Cell 7:75-84; Diversification of C-function activity in maize flower development, Mena, et al., (1996) Science 274:1537-1540; Analysis of a chemical plant defense mechanism in grasses, Frey, et al., (1997) Science 277:696-699; The control of maize spikelet meristem fate by the APETALA2-like gene Indeterminate spikelet 1, Chuck, et al., (1998) Genes and Development 12:1145-1154; A SecY homologue is required for the elaboration of the chloroplast thylakoid membrane and for normal chloroplast gene expression, Roy and Barkan, (1998) J. Cell Biol. 141:1-11).
[0271] PCR Screening for Mu insertions in CesA11:
[0272] Two primers were designed from within the CesA11 cDNA and designated as gene-specific primers (GSPs):
TABLE-US-00019 Forward primer (GSP1/SEQ ID NO. 32): 5'- TACGATGAGTACGAGAGGTCCATGCTCA -3' Reverse primer (GSP2/SEQ ID NO. 33): 5'- GGCAAAAGCCCAGATGCGAGATAGAC -3' Mu TIR primer (SEQ ID NO. 34): 5'- AGAGAAGCCAACGCCAWCGCCTCYATTTCGTC -3'
[0273] Pickoligo was used to select primers for PCR. This program chooses the Tm according to the following equation:
Tm=[((GC*3+AT*2)*37-562)/length]-5
[0274] PCR reactions were run with an annealing temperature of 62° C. and a thermocycling profile as follows:
##STR00001##
[0275] Gel electrophoresis of the PCR products confirmed that there was no false priming in single primer reactions and that only one fragment was amplified in paired GSP reactions.
[0276] The genomic DNA from 42,000 plants, combined into pools of 48 plants each, was subjected to PCR with either GSP1 or GSP2 and Mu TIR. The pools that were confirmed to be positive by dot-blot hybridization using CesA11 cDNA as a probe were subjected to gel-blot analysis in order to determine the size of fragments amplified. The pools in which clean fragments were identified were subjected to further analysis to identify the individual plants within those pools that contained Mu insertion(s).
[0277] Seed from F1 plants identified in this manner was planted in the field. Leaf discs from twenty plants in each F2 row were collected and genomic DNA was isolated. The same twenty plants were selfed and the F3 seed saved. Pooled DNA (from 20 plants) from each of twelve rows was subjected to PCR using GSP1 or GSP2 and Mu TIR primer as mentioned above. Three pools identified to contain Mu insertions were subjected to individual plant analysis and homozygotes identified. The Mu insertion sites with the surrounding signature sequences are identified below:
TABLE-US-00020 Allele 1: 5'-TGGCGGCCG (SEQ ID NO: 35)- Mu-TCTGAAATG (SEQ ID NO: 36)-3' Allele 2: 5'-GCCCACAAG (SEQ ID NO: 37)- Mu-CATCCTGGT (SEQ ID NO: 38)-3' Allele 3: 5'-GTGTTCTTC (SEQ ID NO: 39)- Mu-GCCATGTGG (SEQ ID NO: 40)-3'
[0278] All three insertions are within 500 nucleotides of each other in the open reading frame, suggesting that this region in the gene might represent a hot spot for Mu insertion. One of the insertions, allele 1, is in the region upstream of the predicted six transmembrane domains near the C-terminal end of the protein. Each of these insertions is expected to inactivate the gene since they are all in the exonic regions of the gene.
Example 10
[0279] This example describes the method used to measure mechanical strength of the maize stalks as well as the effect of the overexpression of different CesA genes on stalk strength. The mechanical strength of the mature corn stalks was measured with an electromechanical test system. The internodes below the ear were subjected to a 3-point bend test using an Instron, model 4411 (Instron Corporation, 100 Royall Street, Canton, Mass. 02021), with a span-width of 200 mm between the anchoring points and a speed of 200 mm/min of the 3rd point attached to a load cell. For measuring rind puncture strength, a needle was mounted on the load cell of the Instron and the load taken to puncture the rind was used as a measure of rind puncture strength.
[0280] Load needed to break the internode was used as a measure of mechanical strength. The internodes are stronger toward the base of the stalk. This mechanical stalk breaking strength or the "load to break" was used to classify the hybrids with known stalk characteristics into respective categories based on the internodal breaking strength. The load to break the internodal zone was very similar to the lodging score that had been assigned to the hybrids based on field observations (see, FIG. 1). Approximately 90% of the variation for internodal breaking strength was explained by unit stalk dry matter below the ear (47%), stalk diameter (30%) and rind puncture resistance (10%). Moisture levels above 30% in the stalk tissue masked the contribution of the rind tissue to breaking strength. The internodal breaking strength was highly correlated with the amount of cellulose per unit length of the stalk.
[0281] Four of the CesA genes were expressed under the control of a weak constitutive promoter, F3.7 (see, Coughlin, et al., U.S. patent application Ser. No. 09/387,720, filed Aug. 30, 1999). Table 4 discloses the construct numbers, corresponding sequence IDs from the patent, promoters, and the gene names. In2 is an inducible promoter from the In2 gene from maize. The In2 promoter responds to benzenesulfonamide herbicide safeners (see, Hershey, et al., (1991) Mol. Gen. Genetics 227:229-237 and Gatz, et al., (1994) Mol. Gen Genetics 243:32-38).
TABLE-US-00021 TABLE 4 Construct CesA SEQ ID NO. Promoter Gene name 1 1 F3.7 CesA1 2 9 F3.7 CesA4 3 13 F3.7 CesA5 4 17 F3.7 CesA8 5 Control IN2 GUSINT
[0282] Twenty-five individual T0 events for each construct were generated in a hybrid maize background using Agrobacterium-mediated transformation. Data for various traits, such as plant height, stalk mass below ear, stalk diameter, internodal breaking strength and structural material and cellulose percentages in the internodal tissue were collected.
[0283] The plants from the transgenic events generated using the CesA8 gene were significantly taller in comparison to the control plants containing a GUS gene. Interestingly, a reduction in height was observed when the CesA1 gene was introduced. The other two genes, CesA4 and CesA5, did not differ from the control plants. (See, FIG. 6.) It has long been known that cellulose synthase occurs as a terminal rosette complex consisting of multiple functional cellulose synthase polypeptides that are organized in a ring with a hexagonal symmetry. Each of the six members of the ring is believed to contain six or more functional enzyme units. In general, 36 or more cellulose chains are extruded simultaneous to their synthesis through the plasma membrane into the apoplast. These chains are crystallized into a microfibril right as they come in contact with each other after extrusion through the rosette complex. A functional cellulose synthase is believed to consist of two polypeptides derived form different CesA genes, forming a heterodimer, resulting in a total of 72 or more CesA polypeptides in each rosette.
[0284] While not intending to be limited to a single theory, it is possible that a homodimer could also form a functional enzyme. Therefore, the possible reasons for a reduction in plant height in the events where CesA1 was overexpressed are: 1) the other CesA gene with which its polypeptide forms a heterodimer is down-regulated and 2) the expression of the other gene is not affected but the CESA1 homodimer forms a nonfunctional enzyme, in which case the functional dimers are competed out of the rosette complex. In the latter case, the overexpressed gene behaves as a dominant repressor of cellulose synthesis. This should manifest in the form of microfibrils with fewer cellulose chains. This could be detected by some physical techniques such as differential scanning calorimetry (DSC). The reverse could be true for the CesA8 gene whose homodimers may be functional, and/or whose overexpression might induce the expression of its partner gene the product of which it uses to make a functional enzyme. The fact that an increase in height is observed may result from stalk becoming an active sink when CesA8 is overexpressed. Stalk is usually considered to be a passive sink which cannot compete well with the developing ear. This argument is supported by the observation that the plants containing CesA8 as a transgene had smaller ears.
[0285] Cellulose content and stalk length below the ear is highly correlated with the breaking strength of the stalk (see, FIG. 3). An increase in cellulose production can be accommodated by the following alterations: 1) synthesis of the other cell wall constituents stays constant, leading to an increased cellulose percentage in the wall and 2) increase in cellulose synthesis upregulates the synthesis of the other cell wall constituents as well, in which case the percentage of cellulose does not change in the wall but the amount of cellulose in a unit length does. Two of the CesA genes, CesA4 and CesA8, showed an increase in the amount of cellulose in a unit length of the stalk below the ear (see, FIG. 7). One of the genes, CesA5, did not have any effect on the amount of cellulose in the stalk. It was recently suggested, based on its expression pattern in different tissues, that CesA5 might actually be involved in the formation of some non-cellulosic polysaccharide, most probably mixed-linked glucan (Dhugga, (2001) Curr. Opin. Plant Biol. 4:488-493). The data in the accompanying figure seem to support this argument.
[0286] The internodes were subjected to breakage with a 3-point Instron and the load to break plotted as a function of unit cellulose amount. (See, FIG. 2.) A high correlation between these two traits is observed from the multiple events, particularly for CesA8 (FIG. 3). We have found from other studies that this gene is involved in cellulose synthesis in the vascular bundles in the elongating cells (Holland, et al., (2000) Plant Physiol. 123:1313-1323). These data support our previous observations and supports the observation that the amount of cellulose in a unit length of stalk below the ear results in an increased stalk strength.
Example 11
[0287] This example describes the method used to overexpress CesA genes which will increase the quality of harvested stover, leading to an increase in ethanol yield per unit stover.
[0288] Transgenic plants expressing the Ces A gene of interest could be produced by the method outlined in Example 5 or other suitable methods. These plants containing increased quantities of cellulose would then be used to produce higher quality stover.
[0289] The following is an example of the applications of the present invention in applications of ethanol biorefineries. In addition the cellulose biosynthetic pathway's role as primary determinant of tissue strength, a trait that is of significant interest in agriculture, where cellulose constitutes the most abundant renewable energy resource. More than 200 million metric tons of stover is produced just from maize in the United States every year. About one-third of this could potentially be utilized in ethanol biorefineries (Kadam and McMillan, 2003). The worldwide production of lignocellulosic wastes from cereal stover and straw is estimated to be ˜3 billion tons per year (Kuhad and Singh, 1993). Stover material containing higher amounts of cellulose and lower amounts of lignin is expected to increase ethanol production in the biorefineries. Lignin is a target for reduction because it is an undesirable constituent in paper industry as well as in silage digestibility (Hu, et al., 1999; Li, et al., 2003).
[0290] Corn stover alone offers a significant target as a feedstock for the ethanol biorefineries (see, the World Wide Web at ctic.purdue.edu/Core4/ctic-dc.ppt; and_bioproducts-bioenergy.gov/pdfs/bcota/abstracts/31/z263.pdf.) Aside from its use in biorefineries, it can substitute hardwood fiber for paper production. With rapid progress being made in streamlining the process of fermentation of stover material and increasing cost of imported oil, corn stover is expected to become a key feedstock in ethanol and paper production (Wheals, et al., 1999; Atistidou and Penttila, 2000). In addition to supplying 5-8 billion gallons of ethanol per year with no additional land use, it is expected to contribute to an annual farm income of $2.3 billion and reduce the greenhouse gases by 60-95 million metric tons, which is 12-20% of the US-Kyoto commitment (see, the World Wide Web at ctic.purdue.edu/Core4/ctic-dc.ppt; and bioproducts--bioenergy.gov/pdfs/bcota/abstracts/31/z263.pdf). Ethanol combustion results in carbon dioxide and water, the same molecules plant primarily uses to make biomass.
[0291] The concern about there being an effect on the soil organic matter by the removal of the aboveground biomass is mitigated by the findings that over a 30-year period, no significant difference was observed in the soil organic matter between a field where the aboveground stover was removed for silage and the one where the stover was ploughed into the ground after grain harvest. Most of the ploughed stover is lost as carbon dioxide into the atmosphere.
[0292] During pretreatment of the corn stover for enzymatic digestion, the soluble sugars are discarded. Also, pentose sugars are not as well fermented as the hexose sugars despite the progress made in the fermentation process, which involves using Zymomonas bacteria instead of the traditional yeast (Atistidou and Penttila, 2000; Badger, 2002). The polysaccharide fraction of the corn stalk contains ˜20% pentose sugars, the remainder being hexose sugars (Dhugga, unpublished). Also, the free sugar concentration ranges from 4-12%. Lignin content averages ˜19% and ranges from 18-23%. By overexpressing the CesA genes of the present invention, the free sugars can be converted into polymeric (cellulosic) form, which will increase ethanol yield per unit of the harvested stover. The claimed invention also teaches an increase cellulose at the expense of pentose-containing polymers (e.g., arabinoxylan) and lignin.
Example 12
[0293] This example discusses the application of CesA genes in late season stalk strength.
[0294] Stalk lodging results in significant yield losses in crop plants, particularly in cereals (Duvick and Cassman, 1999). Stalk standability is dependent upon the amount of dry matter per unit length of the stalk and is thus a function of resource partitioning and allocation. Harvest index, the ratio of the grain to total aboveground biomass, is an indicator of dry matter partitioning efficiency. It has remained around 50% for over a hundred years in maize (Sinclair, 1998). In comparison to maize, harvest index acquired a different role in increasing plant standability in small grain cereals where it was significantly increased with the introduction of dwarfing genes. Reduced stature made these cereals less likely to lodge by reducing torque on the top-heavy straw, which allowed for higher inputs such as fertilizers and irrigation, resulting in increased biomass production per unit land area. Whereas yield increases in small grain cereals have resulted from an increase in both harvest index and total biomass production per unit land area, those in maize have been the consequence of mainly an increase in total biomass. Increased planting density as a means of increasing grain yield in maize has affected changes in leaf angle and shape as adaptations to this environment and has in general resulted in increased plant and ear heights (Duvick and Cassman, 1999). The stalk becomes mechanically weaker with increasing planting density because of reduction in individual plant vigor that results from a nonlinear relationship between planting density and biomass increase.
[0295] The understanding that cellulose in a unit length of the stalk is indeed the main determinant of mechanical strength had been proposed. (Appenzeller, et al., 2004). Most of the dry matter and thus cellulose in the stalk is concentrated in the outer layers, collectively referred to as rind, which is composed of densely packed vascular bundles. Vascular bundles are surrounded by sclerenchymatous cells. Although vascular bundles are also sparsely distributed in the internal tissue, a great majority of them are present in the outer layers as judged from the dry matter distribution (FIG. 8). FIG. 8 describes the contribution of different stalk components to dry matter, diameter, volume and stalk strength in maize hybrids. The data are derived from seven hybrids grown at three densities (27, 43 and 59 K per acre) in three replications each in 2001. Two stalks were sampled from each replication. Internodes 3 and 4 below the ear were broken with Instron. After breaking, the 3rd internode was separated into rind and inner tissue. Path coefficient analyses were performed using rind and inner tissue as independent variables (X1 and X2, respectively) and the whole stalk as the dependent variable (Y). The multiple regression equation: Y=a+b1X1+b2X2+e where a is the intercept and e error. Path coefficients were calculated as follows: ΣYXn=bn*δn/δY where n is 1 or 2. The contribution of each independent variable to whole stalk (Y) was calculated as follows: ρYxn*rYxn where r is the correlation coefficient. Note: the unexplained variation for diameter is attributable to the corn stalk not being perfectly round and the difficulty thus associated with determining the cross-sectional area accurately. Some other variable, like size and number of vascular bundles and their density, may account for the remaining variation in strength. The introduced transgene, by removing the limitation of the particular step it encodes the enzyme for catalyzing, may either lead to an increase in the percentage of that particular polysaccharide (composition changed) or of the whole cell wall (composition not changed). In the latter case, the additional dry matter could be accommodated in enlarged vascular bundles which could, in turn, result in an increased diameter.
[0296] Isolation of genes that affect cellulose formation has made it possible to test their respective roles in stalk strength by transgenic and reverse genetics approaches (Appenzeller, et al., 2004). Transgenic plants expressing the Ces A gene of interest are produced by the method outlined in Example 5 or other suitable methods. Expression of the cellulose synthase gene is measured Three of the twelve cellulose synthase genes are preferentially expressed in the secondary wall-forming cells (Appenzeller, et al., 2004). Whereas two of these genes, CesA10 and CesA11, are expressed more highly in the vascular bundles, CesA12 appears to be more highly expressed in the surrounding, sclerenchymatous cells (Appenzeller, et al., 2004). Overexpression of the three CesA genes individually and in combinations is used to increase cellulose production in the rind cells as well as the internal tissue cells. Internal tissue cells, as shown in FIG. 8, account for a majority of the volume but only a small amount of biomass and thus offer suitable targets for making more cellulose. Isolated promoters for each of these genes are used to drive the expression of these genes in different cell types. In addition, promoters from other genes can be used to express the CesA genes in other cell types.
Example 13
[0297] This example discusses the application of the CesA genes in improving nodal strength to reduce mid-season green snap.
[0298] Mid-season green snap is a significant problem in the Western plains, e.g., Nebraska, North and South Dakota and Western Minnesota, whereby the stalk snaps at the nodal plate before flowering in a severe windstorm at or below the ear node, resulting in yield losses of up to 80%. The underlying reason for this lesion is the disparity in the rates of elongation growth and dry matter deposition in the corn plant before flowering. Whereas a plant doubles in height in approximately two weeks before flowering, the most rapid rate of elongation growth, it accumulates only 30% additional dry matter during the same period, resulting in a 3-fold disparity (Dhugga, unpublished data). The plant thus becomes susceptible to breakage. It has been determined that the breakage occurs through the pulvinal zone at the base of the leaf sheath.
[0299] Transgenic plants expressing the CesA genes are produced by the method outlined in Example 5 or other suitable methods. The expression pattern of eleven of the twelve maize CesA genes in the pulvinal zone tissue is shown in FIG. 9. The twelfth, CesA9, had the same tag at CesA4 to which it is very highly related. Seven of the genes, CesA1, 4, 7, 8, 10, 11 and 12 are expressed at a higher level than the remaining genes. CesA8 shows the highest expression in this tissue. The expression of the various CesA genes, particularly CesA8, in this tissue can be used to increase its strength.
[0300] The above examples are provided to illustrate the invention but not to limit its scope. Other variants of the invention will be readily apparent to one of ordinary skill in the art and are encompassed by the appended claims. All publications, patents, patent applications, and computer programs cited herein are hereby incorporated by reference.
Sequence CWU
1
1
5213780DNAZea mays 1gtcgacccac gcgtccgcag cagcagaagc actgcgcggc attgcagcga
tcgagcggga 60ggaatttggg gcatggtggt cgccaacgcc gctcggatct agaggcccgc
acgggccgat 120tggtctccgc ccgcctcgtc ggtgttggtg tcgttggcgt gtggagccgt
ctcggtggga 180gcagcgggga gggagcggag atggcggcca acaaggggat ggtggcgggc
tcgcacaacc 240gcaacgagtt cgtcatgatc cgccacgacg gcgatgtgcc gggctcggct
aagcccacaa 300agagtgcgaa tggacaggtc tgccagattt gcggtgactc tgtgggtgtt
tcagccactg 360gtgatgtctt tgttgcctgc aatgagtgtg ccttccctgt ctgccgccca
tgctatgagt 420atgagcgcaa ggaggggaac caatgctgcc cccagtgcaa gactagatac
aagagacaga 480aaggtagccc tcgagttcat ggtgatgagg atgaggaaga tgttgatgac
ctagacaatg 540aattcaacta caagcaaggc agtgggaaag gcccagagtg gcaactgcaa
ggagatgatg 600ctgatctgtc ttcatctgct cgccatgagc cacatcatcg gattccacgc
ctgacaagcg 660gtcaacagat atctggagag attcctgatg cttcccctga ccgtcattct
atccgcagtc 720caacatcgag ctatgttgat ccaagcgtcc cagttcctgt gaggattgtg
gacccctcga 780aggacttgaa ttcctatggg cttaatagtg ttgactggaa ggaaagagtt
gagagctgga 840gggttaaaca ggacaaaaat atgatgcaag tgactaataa atatccagag
gctagaggag 900gagacatgga ggggactggc tcaaatggag aagatatgca aatggttgat
gatgcacggc 960tacctttgag ccgtatcgtg ccaatttcct caaaccagct caacctttac
cgggtagtga 1020tcattctccg tcttatcatc ctgtgcttct tcttccagta tcgtgtcagt
catccagtgc 1080gtgatgctta tggattatgg ctagtatctg ttatctgcga ggtctggttt
gccttgtctt 1140ggcttctaga tcagttccca aaatggtatc caatcaaccg tgagacatat
cttgacaggc 1200ttgcattgag gtatgataga gagggagagc catcacagct ggctcccatt
gatgtcttcg 1260tcagtacagt ggatccattg aaggaacctc cactgatcac agccaacact
gttttgtcca 1320ttctttctgt ggattaccct gttgacaaag tgtcatgcta tgtttctgat
gatggttcag 1380ctatgctgac ttttgagtct ctctcagaaa ccgcagaatt tgctagaaag
tgggttccct 1440tttgtaagaa gcacaatatt gaaccaagag ctccagaatt ttactttgct
caaaaaatag 1500attacctgaa ggacaaaatt caaccttcat ttgttaagga aagacgcgca
atgaagaggg 1560agtatgaaga attcaaagta agaatcaatg cccttgttgc caaagcacag
aaagtgcctg 1620aagaggggtg gaccatggct gatggaactg catggcctgg gaataatcct
agggaccatc 1680ctggcatgat tcaggttttc ttggggcaca gtggtgggct cgacactgat
ggaaatgagt 1740taccacgtct tgtctatgtc tctcgtgaaa agagaccagg ctttcagcat
cacaagaagg 1800ctggtgcaat gaatgcgctg attcgtgtat ctgctgtgct gacaaatggt
gcctatcttc 1860tcaatgtgga ttgcgaccat tacttcaata gcagcaaagc tcttagagaa
gcaatgtgct 1920tcatgatgga tccggctcta ggaaggaaaa cttgttatgt acaatttcca
cagagatttg 1980atggcattga cttgcacgat cgatatgcta atcggaacat agttttcttt
gatatcaaca 2040tgaaaggtct ggatggcatt cagggtccag tttacgtggg aacaggatgc
tgtttcaata 2100gacaggcttt gtatggatac gatcctgttt tgactgaagc tgatctggag
ccaaacattg 2160ttattaagag ctgctgtggt agaaggaaga aaaagaacaa gagttatatg
gatagtcaaa 2220gccgtattat gaagagaaca gaatcttcag ctcccatctt caatatggaa
gacatcgaag 2280agggtattga aggttacgag gatgaaaggt cagtgcttat gtcccagagg
aaattggaga 2340aacgctttgg tcagtctcct attttcattg catccacctt tatgacacaa
ggtggcatac 2400caccttcaac aaacccagct tctctactaa aggaagctat ccatgtcatc
agttgtggat 2460atgaggacaa aactgaatgg ggaaaagaga ttggctggat ctatggttca
gtaacggagg 2520atattctgac tgggtttaaa atgcatgcaa ggggctggca atcaatctac
tgcatgccac 2580cacgaccttg tttcaagggt tctgcaccaa tcaatctttc cgatcgtctt
aatcaggtgc 2640tccgttgggc tcttgggtca gtggaaattc tgcttagtag acattgtcct
atctggtatg 2700gttacaatgg acgattgaag cttttggaga ggctggctta catcaacact
attgtatatc 2760caatcacatc cattccgctt attgcctatt gtgtgcttcc cgctatctgc
ctccttacca 2820ataaatttat cattcctgag attagcaatt atgctgggat gttcttcatt
cttcttttcg 2880cctccatttt tgccactggt atattggagc ttagatggag tggtgttggc
attgaagatt 2940ggtggagaaa tgagcagttt tgggttattg gtggcacctc tgcccatctc
ttcgcagtgt 3000tccagggtct gctgaaagtg ttggctggga ttgataccaa cttcacagtt
acctcaaagg 3060catctgatga ggatggcgac tttgctgagc tatatgtgtt caagtggacc
agtttgctca 3120ttcctccgac cactgttctt gtcattaacc tggtcggaat ggtggcagga
atttcttatg 3180ccattaacag tggctaccaa tcctggggtc cgctctttgg aaagctgttc
ttctcgatct 3240gggtgatcct ccatctctac cccttcctca agggtctcat gggaaggcag
aaccgcacac 3300caacaatcgt cattgtctgg tccatccttc ttgcatctat cttctccttg
ctgtgggtga 3360agatcgatcc tttcatctcc ccgacacaga aagctgctgc cttggggcaa
tgtggcgtca 3420actgctgatc gagacagtga ctcttatttg aagaggctca atcaagatct
gccccctcgt 3480gtaaatacct gaggaggcta gatgggaatt ccttttgttg taggtgagga
tggatttgca 3540tctaagttat gcctctgttc attagcttct tccgtgccgg tgctgctgcg
gactaagaat 3600cacggagcct ttctaccttc catgtagcgc cagccagcag cgtaagatgt
gaattttgaa 3660gttttgttat gcgtgcagtt tattgtttta gagtaaatta tcatttgttt
gtgggaactg 3720ttcacacgag cttataatgg caatgctgtt atttaaaaaa aaaaaaaaaa
gggcggccgc 378021075PRTZea mays 2Met Ala Ala Asn Lys Gly Met Val Ala
Gly Ser His Asn Arg Asn Glu1 5 10
15 Phe Val Met Ile Arg His Asp Gly Asp Val Pro Gly Ser Ala
Lys Pro 20 25 30
Thr Lys Ser Ala Asn Gly Gln Val Cys Gln Ile Cys Gly Asp Ser Val 35
40 45 Gly Val Ser Ala Thr
Gly Asp Val Phe Val Ala Cys Asn Glu Cys Ala 50 55
60 Phe Pro Val Cys Arg Pro Cys Tyr Glu Tyr
Glu Arg Lys Glu Gly Asn65 70 75
80 Gln Cys Cys Pro Gln Cys Lys Thr Arg Tyr Lys Arg Gln Lys Gly
Ser 85 90 95 Pro
Arg Val His Gly Asp Glu Asp Glu Glu Asp Val Asp Asp Leu Asp
100 105 110 Asn Glu Phe Asn Tyr
Lys Gln Gly Ser Gly Lys Gly Pro Glu Trp Gln 115
120 125 Leu Gln Gly Asp Asp Ala Asp Leu Ser
Ser Ser Ala Arg His Glu Pro 130 135
140 His His Arg Ile Pro Arg Leu Thr Ser Gly Gln Gln Ile
Ser Gly Glu145 150 155
160 Ile Pro Asp Ala Ser Pro Asp Arg His Ser Ile Arg Ser Pro Thr Ser
165 170 175 Ser Tyr Val Asp
Pro Ser Val Pro Val Pro Val Arg Ile Val Asp Pro 180
185 190 Ser Lys Asp Leu Asn Ser Tyr Gly Leu
Asn Ser Val Asp Trp Lys Glu 195 200
205 Arg Val Glu Ser Trp Arg Val Lys Gln Asp Lys Asn Met Met
Gln Val 210 215 220
Thr Asn Lys Tyr Pro Glu Ala Arg Gly Gly Asp Met Glu Gly Thr Gly225
230 235 240 Ser Asn Gly Glu Asp
Met Gln Met Val Asp Asp Ala Arg Leu Pro Leu 245
250 255 Ser Arg Ile Val Pro Ile Ser Ser Asn Gln
Leu Asn Leu Tyr Arg Val 260 265
270 Val Ile Ile Leu Arg Leu Ile Ile Leu Cys Phe Phe Phe Gln Tyr
Arg 275 280 285 Val
Ser His Pro Val Arg Asp Ala Tyr Gly Leu Trp Leu Val Ser Val 290
295 300 Ile Cys Glu Val Trp Phe
Ala Leu Ser Trp Leu Leu Asp Gln Phe Pro305 310
315 320 Lys Trp Tyr Pro Ile Asn Arg Glu Thr Tyr Leu
Asp Arg Leu Ala Leu 325 330
335 Arg Tyr Asp Arg Glu Gly Glu Pro Ser Gln Leu Ala Pro Ile Asp Val
340 345 350 Phe Val Ser
Thr Val Asp Pro Leu Lys Glu Pro Pro Leu Ile Thr Ala 355
360 365 Asn Thr Val Leu Ser Ile Leu Ser
Val Asp Tyr Pro Val Asp Lys Val 370 375
380 Ser Cys Tyr Val Ser Asp Asp Gly Ser Ala Met Leu Thr
Phe Glu Ser385 390 395
400 Leu Ser Glu Thr Ala Glu Phe Ala Arg Lys Trp Val Pro Phe Cys Lys
405 410 415 Lys His Asn Ile
Glu Pro Arg Ala Pro Glu Phe Tyr Phe Ala Gln Lys 420
425 430 Ile Asp Tyr Leu Lys Asp Lys Ile Gln
Pro Ser Phe Val Lys Glu Arg 435 440
445 Arg Ala Met Lys Arg Glu Tyr Glu Glu Phe Lys Val Arg Ile
Asn Ala 450 455 460
Leu Val Ala Lys Ala Gln Lys Val Pro Glu Glu Gly Trp Thr Met Ala465
470 475 480 Asp Gly Thr Ala Trp
Pro Gly Asn Asn Pro Arg Asp His Pro Gly Met 485
490 495 Ile Gln Val Phe Leu Gly His Ser Gly Gly
Leu Asp Thr Asp Gly Asn 500 505
510 Glu Leu Pro Arg Leu Val Tyr Val Ser Arg Glu Lys Arg Pro Gly
Phe 515 520 525 Gln
His His Lys Lys Ala Gly Ala Met Asn Ala Leu Ile Arg Val Ser 530
535 540 Ala Val Leu Thr Asn Gly
Ala Tyr Leu Leu Asn Val Asp Cys Asp His545 550
555 560 Tyr Phe Asn Ser Ser Lys Ala Leu Arg Glu Ala
Met Cys Phe Met Met 565 570
575 Asp Pro Ala Leu Gly Arg Lys Thr Cys Tyr Val Gln Phe Pro Gln Arg
580 585 590 Phe Asp Gly
Ile Asp Leu His Asp Arg Tyr Ala Asn Arg Asn Ile Val 595
600 605 Phe Phe Asp Ile Asn Met Lys Gly
Leu Asp Gly Ile Gln Gly Pro Val 610 615
620 Tyr Val Gly Thr Gly Cys Cys Phe Asn Arg Gln Ala Leu
Tyr Gly Tyr625 630 635
640 Asp Pro Val Leu Thr Glu Ala Asp Leu Glu Pro Asn Ile Val Ile Lys
645 650 655 Ser Cys Cys Gly
Arg Arg Lys Lys Lys Asn Lys Ser Tyr Met Asp Ser 660
665 670 Gln Ser Arg Ile Met Lys Arg Thr Glu
Ser Ser Ala Pro Ile Phe Asn 675 680
685 Met Glu Asp Ile Glu Glu Gly Ile Glu Gly Tyr Glu Asp Glu
Arg Ser 690 695 700
Val Leu Met Ser Gln Arg Lys Leu Glu Lys Arg Phe Gly Gln Ser Pro705
710 715 720 Ile Phe Ile Ala Ser
Thr Phe Met Thr Gln Gly Gly Ile Pro Pro Ser 725
730 735 Thr Asn Pro Ala Ser Leu Leu Lys Glu Ala
Ile His Val Ile Ser Cys 740 745
750 Gly Tyr Glu Asp Lys Thr Glu Trp Gly Lys Glu Ile Gly Trp Ile
Tyr 755 760 765 Gly
Ser Val Thr Glu Asp Ile Leu Thr Gly Phe Lys Met His Ala Arg 770
775 780 Gly Trp Gln Ser Ile Tyr
Cys Met Pro Pro Arg Pro Cys Phe Lys Gly785 790
795 800 Ser Ala Pro Ile Asn Leu Ser Asp Arg Leu Asn
Gln Val Leu Arg Trp 805 810
815 Ala Leu Gly Ser Val Glu Ile Leu Leu Ser Arg His Cys Pro Ile Trp
820 825 830 Tyr Gly Tyr
Asn Gly Arg Leu Lys Leu Leu Glu Arg Leu Ala Tyr Ile 835
840 845 Asn Thr Ile Val Tyr Pro Ile Thr
Ser Ile Pro Leu Ile Ala Tyr Cys 850 855
860 Val Leu Pro Ala Ile Cys Leu Leu Thr Asn Lys Phe Ile
Ile Pro Glu865 870 875
880 Ile Ser Asn Tyr Ala Gly Met Phe Phe Ile Leu Leu Phe Ala Ser Ile
885 890 895 Phe Ala Thr Gly
Ile Leu Glu Leu Arg Trp Ser Gly Val Gly Ile Glu 900
905 910 Asp Trp Trp Arg Asn Glu Gln Phe Trp
Val Ile Gly Gly Thr Ser Ala 915 920
925 His Leu Phe Ala Val Phe Gln Gly Leu Leu Lys Val Leu Ala
Gly Ile 930 935 940
Asp Thr Asn Phe Thr Val Thr Ser Lys Ala Ser Asp Glu Asp Gly Asp945
950 955 960 Phe Ala Glu Leu Tyr
Val Phe Lys Trp Thr Ser Leu Leu Ile Pro Pro 965
970 975 Thr Thr Val Leu Val Ile Asn Leu Val Gly
Met Val Ala Gly Ile Ser 980 985
990 Tyr Ala Ile Asn Ser Gly Tyr Gln Ser Trp Gly Pro Leu Phe Gly
Lys 995 1000 1005 Leu
Phe Phe Ser Ile Trp Val Ile Leu His Leu Tyr Pro Phe Leu Lys 1010
1015 1020 Gly Leu Met Gly Arg Gln
Asn Arg Thr Pro Thr Ile Val Ile Val Trp1025 1030
1035 1040Ser Ile Leu Leu Ala Ser Ile Phe Ser Leu Leu
Trp Val Lys Ile Asp 1045 1050
1055 Pro Phe Ile Ser Pro Thr Gln Lys Ala Ala Ala Leu Gly Gln Cys Gly
1060 1065 1070 Val Asn Cys
1075325DNAZea mays 3atggcggcca acaaggggat ggtgg
25425DNAZea mays 4tcagcagttg acgccacatt gcccc
2552830DNAZea maysmisc_feature2809,
2818, 2824, 2826, 2829n = A,T,C or G 5tacctctaag tcgcatagtt ccgatatctc
caaacgagct taacctttat cggatcgtga 60ttgttctccg gcttatcatc ctatgtttct
tctttcaata tcgtataact catccagtgg 120aagatgctta tgggttgtgg cttgtatctg
ttatttgtga agtttggttt gccttgtctt 180ggcttctaga tcagttccca aagtggtatc
ctatcaaccg tgaaacttac ctcgatagac 240ttgcattgag atatgatagg gagggtgagc
catcccagtt ggctccaatc gatgtctttg 300ttagtacagt ggatccactt aaggaacctc
ctctaattac tggcaacact gtcctgtcca 360ttcttgctgt ggattaccct gttgacaaag
tatcatgtta tgtttctgat gacggttcag 420ctatgttgac ttttgaagcg ctatctgaaa
ccgcagagtt tgcaaggaaa tgggttccct 480tttgcaagaa acacaatatt gaacctaggg
ctccagagtt ttactttgct cgaaagatag 540attacctaaa ggacaaaata caaccttctt
ttgtgaaaga aaggcgggct atgaagaggg 600agtgtgaaga gttcaaagta cggatcgatg
cccttgttgc aaaagcgcaa aaaatacctg 660aggagggctg gaccatggct gatggcactc
cttggcctgg gaataaccct agagatcatc 720caggaatgat ccaagtattc ttgggccaca
gtggtgggct tgacacggat gggaatgagt 780tgccacggct tgtttatgtt tctcgtgaaa
agaggccagg cttccagcac cacaagaagg 840ctggtgccat gaatgctttg attcgcgtat
cagctgtcct gacgaatggt gcttatcttc 900ttaatgtgga ttgtgatcac tacttcaata
gcagcaaagc tcttagagag gctatgtgtt 960tcatgatgga tccagcacta ggaaggaaaa
cttgctatgt tcagtttcca caaagatttg 1020atggtataga cttgcatgat cgatatgcaa
accggaacat tgtcttcttt gatattaata 1080tgaagggtct agatggcatt caaggacctg
tttatgtggg aacaggatgc tgtttcaata 1140ggcaggcctt gtatggctat gatcctgtat
tgacagaagc tgatttggag cctaacatta 1200tcattaaaag ttgctgtggc ggaagaaaaa
agaaggacaa gagctatatt gattccaaaa 1260accgtgatat gaagagaaca gaatcttcgg
ctcccatctt caacatggaa gatatagaag 1320agggatttga aggttacgag gatgaaaggt
cactgcttat gtctcagaag agcttggaga 1380aacgctttgg ccagtctcca atttttattg
catccacctt tatgactcaa ggtggcatac 1440ccccttcaac aaacccaggt tccctgctaa
aggaagctat acatgtcatt agttgtggat 1500atgaggataa aacagaatgg gggaaagaga
tcggatggat atatggctct gttactgaag 1560atattttaac tggtttcaag atgcatgcaa
gaggttggat atccatctac tgcatgccac 1620ttcggccttg cttcaagggt tctgctccaa
ttaatctttc tgatcgtctc aaccaagtgt 1680tacgctgggc tcttggttca gttgaaattc
tacttagcag acactgtcct atctggtatg 1740gttacaatgg aaggctaaag cttctggaga
gactggcata catcaacacc attgtttatc 1800caattacatc tatcccacta gtagcatact
gcgtccttcc tgctatctgt ttactcacca 1860acaaatttat tattcctgcg attagcaatt
atgctggggc gttcttcatc ctgctttttg 1920cttccatctt cgccactggt attttggagc
ttcgatggag tggtgttggc attgaggatt 1980ggtggagaaa tgagcagttt tgggtcattg
gtggcacctc tgcacatctc tttgctgtgt 2040tccaaggtct cttaaaagtg ctagcaggga
tcgacacaaa cttcacggtc acatcaaagg 2100caaccgatga tgatggtgat tttgctgagc
tgtatgtgtt caagtggaca actcttctga 2160tcccccccac cactgtgctt gtgattaacc
tggttggtat agtggctgga gtgtcgtatg 2220ctatcaacag tggctaccaa tcatggggtc
cactattcgg gaagctgttc tttgcaatct 2280gggtgatcct ccacctctac cctttcctga
agggtctcat ggggaagcag aaccgcacac 2340cgaccatcgt catcgtttgg tccgtccttc
ttgcttccat attctcgctg ctgtgggtga 2400agatcgaccc cttcatatcc cctacccaga
aggctctttc ccgtgggcag tgtggtgtaa 2460actgctgaaa tgatccgaac tgcctgctga
ataacattgc tccggcacaa tcatgatcta 2520ccccttcgtg taaataccag aggttaggca
agacttttct tggtaggtgg cgaagatgtg 2580tcgtttaagt tcactctact gcatttgggg
tgggcagcat gaaactttgt caacttatgt 2640cgtgctactt atttgtagct aagtagcagt
aagtagtgcc tgtttcatgt tgactgtcgt 2700gactacctgt tcaccgtggg ctctggactg
tcgtgatgta acctgtatgt tggaacttca 2760agtactgatt gagctgtttg gtcaatgaca
ttgagggatt ctctctctng aaattaanac 2820aaantnggnt
28306821PRTZea mays 6Pro Leu Ser Arg Ile
Val Pro Ile Ser Pro Asn Glu Leu Asn Leu Tyr1 5
10 15 Arg Ile Val Ile Val Leu Arg Leu Ile Ile
Leu Cys Phe Phe Phe Gln 20 25
30 Tyr Arg Ile Thr His Pro Val Glu Asp Ala Tyr Gly Leu Trp Leu
Val 35 40 45 Ser
Val Ile Cys Glu Val Trp Phe Ala Leu Ser Trp Leu Leu Asp Gln 50
55 60 Phe Pro Lys Trp Tyr Pro
Ile Asn Arg Glu Thr Tyr Leu Asp Arg Leu65 70
75 80 Ala Leu Arg Tyr Asp Arg Glu Gly Glu Pro Ser
Gln Leu Ala Pro Ile 85 90
95 Asp Val Phe Val Ser Thr Val Asp Pro Leu Lys Glu Pro Pro Leu Ile
100 105 110 Thr Gly Asn
Thr Val Leu Ser Ile Leu Ala Val Asp Tyr Pro Val Asp 115
120 125 Lys Val Ser Cys Tyr Val Ser Asp
Asp Gly Ser Ala Met Leu Thr Phe 130 135
140 Glu Ala Leu Ser Glu Thr Ala Glu Phe Ala Arg Lys Trp
Val Pro Phe145 150 155
160 Cys Lys Lys His Asn Ile Glu Pro Arg Ala Pro Glu Phe Tyr Phe Ala
165 170 175 Arg Lys Ile Asp
Tyr Leu Lys Asp Lys Ile Gln Pro Ser Phe Val Lys 180
185 190 Glu Arg Arg Ala Met Lys Arg Glu Cys
Glu Glu Phe Lys Val Arg Ile 195 200
205 Asp Ala Leu Val Ala Lys Ala Gln Lys Ile Pro Glu Glu Gly
Trp Thr 210 215 220
Met Ala Asp Gly Thr Pro Trp Pro Gly Asn Asn Pro Arg Asp His Pro225
230 235 240 Gly Met Ile Gln Val
Phe Leu Gly His Ser Gly Gly Leu Asp Thr Asp 245
250 255 Gly Asn Glu Leu Pro Arg Leu Val Tyr Val
Ser Arg Glu Lys Arg Pro 260 265
270 Gly Phe Gln His His Lys Lys Ala Gly Ala Met Asn Ala Leu Ile
Arg 275 280 285 Val
Ser Ala Val Leu Thr Asn Gly Ala Tyr Leu Leu Asn Val Asp Cys 290
295 300 Asp His Tyr Phe Asn Ser
Ser Lys Ala Leu Arg Glu Ala Met Cys Phe305 310
315 320 Met Met Asp Pro Ala Leu Gly Arg Lys Thr Cys
Tyr Val Gln Phe Pro 325 330
335 Gln Arg Phe Asp Gly Ile Asp Leu His Asp Arg Tyr Ala Asn Arg Asn
340 345 350 Ile Val Phe
Phe Asp Ile Asn Met Lys Gly Leu Asp Gly Ile Gln Gly 355
360 365 Pro Val Tyr Val Gly Thr Gly Cys
Cys Phe Asn Arg Gln Ala Leu Tyr 370 375
380 Gly Tyr Asp Pro Val Leu Thr Glu Ala Asp Leu Glu Pro
Asn Ile Ile385 390 395
400 Ile Lys Ser Cys Cys Gly Gly Arg Lys Lys Lys Asp Lys Ser Tyr Ile
405 410 415 Asp Ser Lys Asn
Arg Asp Met Lys Arg Thr Glu Ser Ser Ala Pro Ile 420
425 430 Phe Asn Met Glu Asp Ile Glu Glu Gly
Phe Glu Gly Tyr Glu Asp Glu 435 440
445 Arg Ser Leu Leu Met Ser Gln Lys Ser Leu Glu Lys Arg Phe
Gly Gln 450 455 460
Ser Pro Ile Phe Ile Ala Ser Thr Phe Met Thr Gln Gly Gly Ile Pro465
470 475 480 Pro Ser Thr Asn Pro
Gly Ser Leu Leu Lys Glu Ala Ile His Val Ile 485
490 495 Ser Cys Gly Tyr Glu Asp Lys Thr Glu Trp
Gly Lys Glu Ile Gly Trp 500 505
510 Ile Tyr Gly Ser Val Thr Glu Asp Ile Leu Thr Gly Phe Lys Met
His 515 520 525 Ala
Arg Gly Trp Ile Ser Ile Tyr Cys Met Pro Leu Arg Pro Cys Phe 530
535 540 Lys Gly Ser Ala Pro Ile
Asn Leu Ser Asp Arg Leu Asn Gln Val Leu545 550
555 560 Arg Trp Ala Leu Gly Ser Val Glu Ile Leu Leu
Ser Arg His Cys Pro 565 570
575 Ile Trp Tyr Gly Tyr Asn Gly Arg Leu Lys Leu Leu Glu Arg Leu Ala
580 585 590 Tyr Ile Asn
Thr Ile Val Tyr Pro Ile Thr Ser Ile Pro Leu Val Ala 595
600 605 Tyr Cys Val Leu Pro Ala Ile Cys
Leu Leu Thr Asn Lys Phe Ile Ile 610 615
620 Pro Ala Ile Ser Asn Tyr Ala Gly Ala Phe Phe Ile Leu
Leu Phe Ala625 630 635
640 Ser Ile Phe Ala Thr Gly Ile Leu Glu Leu Arg Trp Ser Gly Val Gly
645 650 655 Ile Glu Asp Trp
Trp Arg Asn Glu Gln Phe Trp Val Ile Gly Gly Thr 660
665 670 Ser Ala His Leu Phe Ala Val Phe Gln
Gly Leu Leu Lys Val Leu Ala 675 680
685 Gly Ile Asp Thr Asn Phe Thr Val Thr Ser Lys Ala Thr Asp
Asp Asp 690 695 700
Gly Asp Phe Ala Glu Leu Tyr Val Phe Lys Trp Thr Thr Leu Leu Ile705
710 715 720 Pro Pro Thr Thr Val
Leu Val Ile Asn Leu Val Gly Ile Val Ala Gly 725
730 735 Val Ser Tyr Ala Ile Asn Ser Gly Tyr Gln
Ser Trp Gly Pro Leu Phe 740 745
750 Gly Lys Leu Phe Phe Ala Ile Trp Val Ile Leu His Leu Tyr Pro
Phe 755 760 765 Leu
Lys Gly Leu Met Gly Lys Gln Asn Arg Thr Pro Thr Ile Val Ile 770
775 780 Val Trp Ser Val Leu Leu
Ala Ser Ile Phe Ser Leu Leu Trp Val Lys785 790
795 800 Ile Asp Pro Phe Ile Ser Pro Thr Gln Lys Ala
Leu Ser Arg Gly Gln 805 810
815 Cys Gly Val Asn Cys 820 725DNAZea mays
7cctctaagtc gcatagttcc gatat
25825DNAZea mays 8tcagcagttt acaccacact gccca
2593773DNAZea mays 9gtcgacccac gcgtccgcta ggatcaaaac
cgtctcgccg ctgcaataat cttttgtcaa 60ttcttaatcc ctcgcgtcga cagcgacagc
ggaaccaact cacgttgccg cggcttcctc 120catcggtgcg gtgccctgtc cttttctctc
gtccctcctc cccccgtata gttaagcccc 180gccccgctac tactactact agcagcagca
gcgctctcgc agcgggagat gcggtgttga 240tccgtgcccc gctcggatct cgggactggt
gccggctctg cccaggcccc aggctccagg 300ccagctccct cgacgtttct cggcgagctc
gcttgccatg gagggcgacg cggacggcgt 360gaagtcgggg aggcgcggtg gcggacaggt
gtgccagatc tgcggcgacg gcgtgggcac 420cacggcggag ggggacgtct tcgccgcctg
cgacgtctgc gggtttccgg tgtgccgccc 480ctgctacgag tacgagcgca aggacggcac
gcaggcgtgc ccccagtgca agaccaagta 540caagcgccac aaggggagcc cggcgatccg
tggggaggaa ggagacgaca ctgatgccga 600tagcgacttc aattaccttg catctggcaa
tgaggaccag aagcagaaga ttgccgacag 660aatgcgcagc tggcgcatga acgttggggg
cagcggggat gttggtcgcc ccaagtatga 720cagtggcgag atcgggctta ccaagtatga
cagtggcgag attcctcggg gatacatccc 780atcagtcact aacagccaga tctcaggaga
aatccctggt gcttcccctg accatcatat 840gatgtcccca actgggaaca ttggcaagcg
tgctccattt ccctatgtga accattcgcc 900aaatccgtca agggagttct ctggtagcat
tgggaatgtt gcctggaaag agagggttga 960tggctggaaa atgaagcagg acaaggggac
gattcccatg acgaatggca caagcattgc 1020tccctctgag ggtcggggtg ttggtgatat
tgatgcatca actgattaca acatggaaga 1080tgccttattg aacgacgaaa ctcgacagcc
tctatctagg aaagttccac ttccttcctc 1140caggataaat ccatacagga tggtcattgt
gctgcgattg attgttctaa gcatcttctt 1200gcactaccgt atcacaaatc ctgtgcgcaa
tgcataccca ttatggcttc tatctgttat 1260atgtgagatc tggtttgctc tttcgtggat
attggatcag ttccctaagt ggtttccaat 1320caaccgggag acgtaccttg ataggctggc
attaaggtat gaccgggaag gtgagccatc 1380tcagttggct gctgttgaca ttttcgtcag
tacagtcgac ccaatgaagg agcctcctct 1440tgtcactgcc aataccgtgc tatccattct
tgctgtggat taccctgtgg ataaggtctc 1500ttgctatgta tctgatgatg gagctgcgat
gctgacattt gatgcactag ctgagacttc 1560agagtttgct agaaaatggg taccatttgt
taagaagtac aacattgaac ctagagctcc 1620tgaatggtac ttctcccaga aaattgatta
cttgaaggac aaagtgcacc cttcatttgt 1680taaagaccgc cgggccatga agagagaata
tgaagaattc aaagttaggg taaatggcct 1740tgttgctaag gcacagaaag ttcctgagga
aggatggatc atgcaagatg gcacaccatg 1800gccaggaaac aataccaggg accatcctgg
aatgattcag gttttccttg gtcacagtgg 1860tggccttgat actgagggca atgagctacc
ccgtttggtc tatgtttctc gtgaaaagcg 1920tcctggattc cagcatcaca agaaagctgg
tgccatgaat gctcttgttc gtgtctcagc 1980tgtgcttacc aatggacaat acatgttgaa
tcttgattgt gatcactaca ttaacaacag 2040taaggctctc agggaagcta tgtgcttcct
tatggaccct aacctaggaa ggagtgtctg 2100ctacgtccag tttccccaga gattcgatgg
cattgacagg aatgatcgat atgccaacag 2160gaacaccgtg tttttcgata ttaacttgag
aggtcttgat ggcatccaag gaccagttta 2220tgtcggaact ggctgtgttt tcaaccgaac
agctctatat ggttatgagc ccccaattaa 2280gcagaagaag ggtggtttct tgtcatcact
atgtggcggt aggaagaagg caagcaaatc 2340aaagaagggc tcggacaaga agaagtcgca
gaagcatgtg gacagttctg tgccagtatt 2400caaccttgaa gatatagagg agggagttga
aggcgctgga tttgacgacg agaaatcact 2460tcttatgtct caaatgagcc tggagaagag
atttggccag tccgcagcgt ttgttgcctc 2520cactctgatg gagtatggtg gtgttcctca
gtccgcaact ccggagtctc ttctgaaaga 2580agctatccat gttataagct gtggctatga
ggacaagact gaatggggaa ctgagatcgg 2640gtggatctac ggttctgtga cagaagacat
tctcaccgga ttcaagatgc acgcgcgagg 2700ctggcggtcg atctactgca tgcccaagcg
gccagctttc aaggggtctg cccccatcaa 2760tctttcggac cgtctgaacc aggtgctccg
gtgggctctt gggtccgtgg agatcctctt 2820cagccggcac tgccccctgt ggtacggcta
cggagggcgg ctcaagttcc tggagagatt 2880cgcgtacatc aacaccacca tctacccgct
cacgtccatc ccgcttctca tctactgcat 2940cctgcccgcc atctgtctgc tcaccggaaa
gttcatcatt ccagagatca gcaacttcgc 3000cagcatctgg ttcatctccc tcttcatctc
gatcttcgcc acgggcatcc tggagatgag 3060gtggagcggg gtgggcatcg acgagtggtg
gaggaacgag cagttctggg tgatcggggg 3120catctccgcg cacctcttcg ccgtgttcca
gggcctgctc aaggtgctgg ccggcatcga 3180caccaacttc accgtcacct ccaaggcctc
ggacgaggac ggcgacttcg cggagctgta 3240catgttcaag tggacgacgc tcctgatccc
gcccaccacc atcctgatca tcaacctggt 3300cggcgtcgtc gccggcatct cctacgccat
caacagcgga taccagtcgt ggggcccgct 3360cttcggcaag ctcttcttcg ccttctgggt
catcgtccac ctgtacccgt tcctcaaggg 3420cctcatgggc aggcagaacc gcaccccgac
catcgtcgtc gtctgggcca tcctgctggc 3480gtccatcttc tccttgctgt gggttcgcat
cgaccccttc accacccgcg tcactggccc 3540ggatacccag acgtgtggca tcaactgcta
gggaagtgga aggtttgtac tttgtagaaa 3600cggaggaata ccacgtgcca tctgttgtct
gttaagttat atatatataa gcagcaagtg 3660gcgttattta cagctacgta cagaccagtg
gatattgttt accacaaagt tttacttgtg 3720ttaatatgca ttcttttgtt gatataaaaa
aaaaaaaaaa aaagggcggc cgc 3773101077PRTZea mays 10Met Glu Gly
Asp Ala Asp Gly Val Lys Ser Gly Arg Arg Gly Gly Gly1 5
10 15 Gln Val Cys Gln Ile Cys Gly Asp
Gly Val Gly Thr Thr Ala Glu Gly 20 25
30 Asp Val Phe Ala Ala Cys Asp Val Cys Gly Phe Pro Val
Cys Arg Pro 35 40 45
Cys Tyr Glu Tyr Glu Arg Lys Asp Gly Thr Gln Ala Cys Pro Gln Cys 50
55 60 Lys Thr Lys Tyr Lys
Arg His Lys Gly Ser Pro Ala Ile Arg Gly Glu65 70
75 80 Glu Gly Asp Asp Thr Asp Ala Asp Ser Asp
Phe Asn Tyr Leu Ala Ser 85 90
95 Gly Asn Glu Asp Gln Lys Gln Lys Ile Ala Asp Arg Met Arg Ser
Trp 100 105 110 Arg
Met Asn Val Gly Gly Ser Gly Asp Val Gly Arg Pro Lys Tyr Asp 115
120 125 Ser Gly Glu Ile Gly Leu
Thr Lys Tyr Asp Ser Gly Glu Ile Pro Arg 130 135
140 Gly Tyr Ile Pro Ser Val Thr Asn Ser Gln Ile
Ser Gly Glu Ile Pro145 150 155
160 Gly Ala Ser Pro Asp His His Met Met Ser Pro Thr Gly Asn Ile Gly
165 170 175 Lys Arg Ala
Pro Phe Pro Tyr Val Asn His Ser Pro Asn Pro Ser Arg 180
185 190 Glu Phe Ser Gly Ser Ile Gly Asn
Val Ala Trp Lys Glu Arg Val Asp 195 200
205 Gly Trp Lys Met Lys Gln Asp Lys Gly Thr Ile Pro Met
Thr Asn Gly 210 215 220
Thr Ser Ile Ala Pro Ser Glu Gly Arg Gly Val Gly Asp Ile Asp Ala225
230 235 240 Ser Thr Asp Tyr Asn
Met Glu Asp Ala Leu Leu Asn Asp Glu Thr Arg 245
250 255 Gln Pro Leu Ser Arg Lys Val Pro Leu Pro
Ser Ser Arg Ile Asn Pro 260 265
270 Tyr Arg Met Val Ile Val Leu Arg Leu Ile Val Leu Ser Ile Phe
Leu 275 280 285 His
Tyr Arg Ile Thr Asn Pro Val Arg Asn Ala Tyr Pro Leu Trp Leu 290
295 300 Leu Ser Val Ile Cys Glu
Ile Trp Phe Ala Leu Ser Trp Ile Leu Asp305 310
315 320 Gln Phe Pro Lys Trp Phe Pro Ile Asn Arg Glu
Thr Tyr Leu Asp Arg 325 330
335 Leu Ala Leu Arg Tyr Asp Arg Glu Gly Glu Pro Ser Gln Leu Ala Ala
340 345 350 Val Asp Ile
Phe Val Ser Thr Val Asp Pro Met Lys Glu Pro Pro Leu 355
360 365 Val Thr Ala Asn Thr Val Leu Ser
Ile Leu Ala Val Asp Tyr Pro Val 370 375
380 Asp Lys Val Ser Cys Tyr Val Ser Asp Asp Gly Ala Ala
Met Leu Thr385 390 395
400 Phe Asp Ala Leu Ala Glu Thr Ser Glu Phe Ala Arg Lys Trp Val Pro
405 410 415 Phe Val Lys Lys
Tyr Asn Ile Glu Pro Arg Ala Pro Glu Trp Tyr Phe 420
425 430 Ser Gln Lys Ile Asp Tyr Leu Lys Asp
Lys Val His Pro Ser Phe Val 435 440
445 Lys Asp Arg Arg Ala Met Lys Arg Glu Tyr Glu Glu Phe Lys
Val Arg 450 455 460
Val Asn Gly Leu Val Ala Lys Ala Gln Lys Val Pro Glu Glu Gly Trp465
470 475 480 Ile Met Gln Asp Gly
Thr Pro Trp Pro Gly Asn Asn Thr Arg Asp His 485
490 495 Pro Gly Met Ile Gln Val Phe Leu Gly His
Ser Gly Gly Leu Asp Thr 500 505
510 Glu Gly Asn Glu Leu Pro Arg Leu Val Tyr Val Ser Arg Glu Lys
Arg 515 520 525 Pro
Gly Phe Gln His His Lys Lys Ala Gly Ala Met Asn Ala Leu Val 530
535 540 Arg Val Ser Ala Val Leu
Thr Asn Gly Gln Tyr Met Leu Asn Leu Asp545 550
555 560 Cys Asp His Tyr Ile Asn Asn Ser Lys Ala Leu
Arg Glu Ala Met Cys 565 570
575 Phe Leu Met Asp Pro Asn Leu Gly Arg Ser Val Cys Tyr Val Gln Phe
580 585 590 Pro Gln Arg
Phe Asp Gly Ile Asp Arg Asn Asp Arg Tyr Ala Asn Arg 595
600 605 Asn Thr Val Phe Phe Asp Ile Asn
Leu Arg Gly Leu Asp Gly Ile Gln 610 615
620 Gly Pro Val Tyr Val Gly Thr Gly Cys Val Phe Asn Arg
Thr Ala Leu625 630 635
640 Tyr Gly Tyr Glu Pro Pro Ile Lys Gln Lys Lys Gly Gly Phe Leu Ser
645 650 655 Ser Leu Cys Gly
Gly Arg Lys Lys Ala Ser Lys Ser Lys Lys Gly Ser 660
665 670 Asp Lys Lys Lys Ser Gln Lys His Val
Asp Ser Ser Val Pro Val Phe 675 680
685 Asn Leu Glu Asp Ile Glu Glu Gly Val Glu Gly Ala Gly Phe
Asp Asp 690 695 700
Glu Lys Ser Leu Leu Met Ser Gln Met Ser Leu Glu Lys Arg Phe Gly705
710 715 720 Gln Ser Ala Ala Phe
Val Ala Ser Thr Leu Met Glu Tyr Gly Gly Val 725
730 735 Pro Gln Ser Ala Thr Pro Glu Ser Leu Leu
Lys Glu Ala Ile His Val 740 745
750 Ile Ser Cys Gly Tyr Glu Asp Lys Thr Glu Trp Gly Thr Glu Ile
Gly 755 760 765 Trp
Ile Tyr Gly Ser Val Thr Glu Asp Ile Leu Thr Gly Phe Lys Met 770
775 780 His Ala Arg Gly Trp Arg
Ser Ile Tyr Cys Met Pro Lys Arg Pro Ala785 790
795 800 Phe Lys Gly Ser Ala Pro Ile Asn Leu Ser Asp
Arg Leu Asn Gln Val 805 810
815 Leu Arg Trp Ala Leu Gly Ser Val Glu Ile Leu Phe Ser Arg His Cys
820 825 830 Pro Leu Trp
Tyr Gly Tyr Gly Gly Arg Leu Lys Phe Leu Glu Arg Phe 835
840 845 Ala Tyr Ile Asn Thr Thr Ile Tyr
Pro Leu Thr Ser Ile Pro Leu Leu 850 855
860 Ile Tyr Cys Ile Leu Pro Ala Ile Cys Leu Leu Thr Gly
Lys Phe Ile865 870 875
880 Ile Pro Glu Ile Ser Asn Phe Ala Ser Ile Trp Phe Ile Ser Leu Phe
885 890 895 Ile Ser Ile Phe
Ala Thr Gly Ile Leu Glu Met Arg Trp Ser Gly Val 900
905 910 Gly Ile Asp Glu Trp Trp Arg Asn Glu
Gln Phe Trp Val Ile Gly Gly 915 920
925 Ile Ser Ala His Leu Phe Ala Val Phe Gln Gly Leu Leu Lys
Val Leu 930 935 940
Ala Gly Ile Asp Thr Asn Phe Thr Val Thr Ser Lys Ala Ser Asp Glu945
950 955 960 Asp Gly Asp Phe Ala
Glu Leu Tyr Met Phe Lys Trp Thr Thr Leu Leu 965
970 975 Ile Pro Pro Thr Thr Ile Leu Ile Ile Asn
Leu Val Gly Val Val Ala 980 985
990 Gly Ile Ser Tyr Ala Ile Asn Ser Gly Tyr Gln Ser Trp Gly Pro
Leu 995 1000 1005 Phe
Gly Lys Leu Phe Phe Ala Phe Trp Val Ile Val His Leu Tyr Pro 1010
1015 1020 Phe Leu Lys Gly Leu Met
Gly Arg Gln Asn Arg Thr Pro Thr Ile Val1025 1030
1035 1040Val Val Trp Ala Ile Leu Leu Ala Ser Ile Phe
Ser Leu Leu Trp Val 1045 1050
1055 Arg Ile Asp Pro Phe Thr Thr Arg Val Thr Gly Pro Asp Thr Gln Thr
1060 1065 1070 Cys Gly Ile
Asn Cys 1075 1125DNAZea mays 11atggagggcg acgcggacgg cgtga
251225DNAZea mays 12ctagcagttg
atgccacacg tctgg 25133704DNAZea
mays 13gtcgacccac gcttccggtc ggttccgcgt cccttttccc ctcccccctc cgtcgccgcc
60tcgagcgagc tccaccactt gctcctgcgc gaggtgaaca ctgggttagg gccactgcca
120ccgctgggct gcctctgctt ctgcctctcc cgccagcgcg cgagcccggg ggcgattcgg
180cgccggcacg cgggagggga agccgaggaa tgcggtgagt cggcgggggt ccggcgtttg
240tgaactcgtg gagggctcgg attggtgcgc catggacggc ggcgacgcca cgaattcggg
300gaagcatgtg gccgggcagg tgtgccagat ctgcggcgac ggcgtgggca ccgcggcgga
360cggcgacctc ttcaccgcct gcgacgtctg cggcttcccc gtgtgccgcc catgctacga
420gtacgagcgc aaggacggca cccaggcgtg cccgcagtgc aagactaagt acaagcgcca
480caaagggagc ccaccagtac acggtgagga aaatgaggat gtggatgctg acgatgtgag
540tgactacaac taccaagcat ctggcaacca ggatcagaag caaaagattg ctgagagaat
600gctcacttgg cggacaaact cacgtggcag tgatattggc ctggctaagt atgacagcgg
660tgaaattggg catgggaagt atgacagtgg tgagatccct cgtggatata tcccgtcact
720aactcatagc cagatctcag gagagattcc tggagcttcc cctgatcata tgatgtctcc
780tgttgggaac attggcaggc gtggacatca atttccttat gtaaatcatt ctccaaaccc
840atcgagggag ttctccggta gccttggcaa tgttgcatgg aaagagaggg tggatggatg
900gaaaatgaag gataaaggtg caattcctat gaccaatgga acaagcattg ctccatcaga
960agggcgtgga gttgctgata ttgatgcttc tactgattat aacatggaag atgccttact
1020gaatgatgaa actcggcaac ctctatctag aaaagtgcca attccttcat ccagaataaa
1080tccgtacaga atggtcattg tgctacgttt ggctgttcta tgcatattct tgcgctaccg
1140tatcacacat cctgtgaaca atgcatatcc actgtggctt ttatccgtca tatgtgagat
1200ctggtttgct ttgtcctgga ttttggatca gttcccaaag tggtccccaa tcaaccgtga
1260aacatacctt gatagactgg ctttaaggta tgaccgagaa ggtgaaccat ctcaattagc
1320tcctgttgat atttttgtca gtactgtgga tccaatgaag gagcctcctc ttgtcactgc
1380aaatactgtg ctttccatcc ttgctgtcga ttatccggtt gacaaggtat cttgctatgt
1440ttcggatgat ggagctgcta tgctgacttt tgatgctctc tctgaaactt cagagtttgc
1500tagaaaatgg gttccgttct gtaagaagta caacatagag cctagggccc cggaatggta
1560ctttgctcag aaaattgatt acttgaaaga caaagttcaa acctcatttg tgaaagaacg
1620ccgggccatg aagagagaat atgaagaatt caaagttcgt atcaatggtc ttgtagccaa
1680ggcacaaaaa gttcccgagg agggatggat catgcaagat ggtacacctt ggcctgggaa
1740caatactagg gaccatcctg gaatgattca ggttttcctg ggtcacagtg gagggcttga
1800cgttgaaggc aatgaacttc ctcgtttggt ttatgtgtct cgtgaaaaac gtcctggatt
1860ccaacatcac aagaaggctg gtgccatgaa tgcacttgtt cgtgtatcag ctgtccttac
1920taatgggcaa tacatgttga atcttgattg tgaccactac atcaataata gcaaggctct
1980tcgagaagct atgtgcttcc ttatggaccc aaacctagga aggaatgtct gttatgtcca
2040atttcctcag aggtttgatg gtattgatag gaatgaccga tatgcaaaca ggaacactgt
2100gtttttcgat attaacttga gaggtcttga cggcattcaa gggccagttt atgtgggaac
2160tggttgtgtg tttaacagaa cggccttata tggttatgag cctccagtca agaaaaaaaa
2220gccaggcttc ttctcttcgc tttgtggggg aaggaaaaag acgtcaaaat ctaagaagag
2280ctcggaaaag aagaagtcac atagacacgc agacagttct gtaccagtat ttaatctcga
2340agatatagag gaagggattg aaggttctca gtttgatgat gagaaatcgc tgattatgtc
2400tcaaatgagc ttggagaaga gatttggcca gtccagtgtt tttgtagcct ctactctgat
2460ggaatatggt ggtgttccac aatctgcaac tccagagtct cttctgaaag aagctattca
2520tgtcatcagc tgtggctatg aggacaaaac tgactgggga actgagattg ggtggatcta
2580tggttctgtt acagaagaca ttctcaccgg attcaagatg catgctcgag gctggcgatc
2640aatctactgc atgcctaagc gaccagcttt caagggatct gctcctatca acctttcgga
2700tcgtttgaat caagtgcttc ggtgggctct tggttccatt gaaattcttt tcagcaggca
2760ttgtcccata tggtatggct atggaggccg gcttaaattc ctggagagat ttgcttatat
2820caacacaaca atttatccac tcacatcaat cccgctcctc ctgtactgca tattgccagc
2880agtttgtctt ctcactggga agttcatcat cccaaagatt agtaacctag agagtgtttg
2940gtttatatcg ctctttatct caatctttgc cactggtatc cttgagatga ggtggagtgg
3000tgttggcatt gatgaatggt ggaggaacga gcagttctgg gtcattggtg gtatttctgc
3060gcatttattt gccgtcttcc agggtctcct gaaggtgctt gctggtatcg acacgagctt
3120cactgtcacc tctaaggcca ctgacgaaga aggtgatttt gccgagctct acatgttcaa
3180gtggacaacg cttctgatcc caccaaccac tattttgatc atcaacctgg tcggcgtggt
3240cgctggcatt tcctacgcaa tcaatagcgg ttaccagtca tggggacctc ttttcgggaa
3300gctcttcttt gcgttctggg tgattgtcca cctgtacccc ttcctcaagg gcctcatggg
3360gaagcagaac cgcacgccga ccattgtcgt tgtctgggct atcctccttg cgtcgatctt
3420ttccctgatg tgggttcgta tcgatccatt caccacccgg gtcactggcc ctgatatcgc
3480gaaatgtggc atcaactgct aggatgagct gaagatagtt aaagagtgga actagacgca
3540ttgtgcatcg taagttatca gtgggtggct ctttttatag tatggtagga acttggtcgg
3600gagacgttaa ttacatatgc tatatgtacc tccgctggtc tttatccgta agttaatata
3660tatactgctt tgagaattaa aaaaaaaaaa aaaagggcgg ccgc
3704141076PRTZea mays 14Met Asp Gly Gly Asp Ala Thr Asn Ser Gly Lys His
Val Ala Gly Gln1 5 10 15
Val Cys Gln Ile Cys Gly Asp Gly Val Gly Thr Ala Ala Asp Gly Asp
20 25 30 Leu Phe Thr Ala
Cys Asp Val Cys Gly Phe Pro Val Cys Arg Pro Cys 35
40 45 Tyr Glu Tyr Glu Arg Lys Asp Gly Thr
Gln Ala Cys Pro Gln Cys Lys 50 55 60
Thr Lys Tyr Lys Arg His Lys Gly Ser Pro Pro Val His Gly
Glu Glu65 70 75 80
Asn Glu Asp Val Asp Ala Asp Asp Val Ser Asp Tyr Asn Tyr Gln Ala
85 90 95 Ser Gly Asn Gln Asp
Gln Lys Gln Lys Ile Ala Glu Arg Met Leu Thr 100
105 110 Trp Arg Thr Asn Ser Arg Gly Ser Asp Ile
Gly Leu Ala Lys Tyr Asp 115 120
125 Ser Gly Glu Ile Gly His Gly Lys Tyr Asp Ser Gly Glu Ile
Pro Arg 130 135 140
Gly Tyr Ile Pro Ser Leu Thr His Ser Gln Ile Ser Gly Glu Ile Pro145
150 155 160 Gly Ala Ser Pro Asp
His Met Met Ser Pro Val Gly Asn Ile Gly Arg 165
170 175 Arg Gly His Gln Phe Pro Tyr Val Asn His
Ser Pro Asn Pro Ser Arg 180 185
190 Glu Phe Ser Gly Ser Leu Gly Asn Val Ala Trp Lys Glu Arg Val
Asp 195 200 205 Gly
Trp Lys Met Lys Asp Lys Gly Ala Ile Pro Met Thr Asn Gly Thr 210
215 220 Ser Ile Ala Pro Ser Glu
Gly Arg Gly Val Ala Asp Ile Asp Ala Ser225 230
235 240 Thr Asp Tyr Asn Met Glu Asp Ala Leu Leu Asn
Asp Glu Thr Arg Gln 245 250
255 Pro Leu Ser Arg Lys Val Pro Ile Pro Ser Ser Arg Ile Asn Pro Tyr
260 265 270 Arg Met Val
Ile Val Leu Arg Leu Ala Val Leu Cys Ile Phe Leu Arg 275
280 285 Tyr Arg Ile Thr His Pro Val Asn
Asn Ala Tyr Pro Leu Trp Leu Leu 290 295
300 Ser Val Ile Cys Glu Ile Trp Phe Ala Leu Ser Trp Ile
Leu Asp Gln305 310 315
320 Phe Pro Lys Trp Ser Pro Ile Asn Arg Glu Thr Tyr Leu Asp Arg Leu
325 330 335 Ala Leu Arg Tyr
Asp Arg Glu Gly Glu Pro Ser Gln Leu Ala Pro Val 340
345 350 Asp Ile Phe Val Ser Thr Val Asp Pro
Met Lys Glu Pro Pro Leu Val 355 360
365 Thr Ala Asn Thr Val Leu Ser Ile Leu Ala Val Asp Tyr Pro
Val Asp 370 375 380
Lys Val Ser Cys Tyr Val Ser Asp Asp Gly Ala Ala Met Leu Thr Phe385
390 395 400 Asp Ala Leu Ser Glu
Thr Ser Glu Phe Ala Arg Lys Trp Val Pro Phe 405
410 415 Cys Lys Lys Tyr Asn Ile Glu Pro Arg Ala
Pro Glu Trp Tyr Phe Ala 420 425
430 Gln Lys Ile Asp Tyr Leu Lys Asp Lys Val Gln Thr Ser Phe Val
Lys 435 440 445 Glu
Arg Arg Ala Met Lys Arg Glu Tyr Glu Glu Phe Lys Val Arg Ile 450
455 460 Asn Gly Leu Val Ala Lys
Ala Gln Lys Val Pro Glu Glu Gly Trp Ile465 470
475 480 Met Gln Asp Gly Thr Pro Trp Pro Gly Asn Asn
Thr Arg Asp His Pro 485 490
495 Gly Met Ile Gln Val Phe Leu Gly His Ser Gly Gly Leu Asp Val Glu
500 505 510 Gly Asn Glu
Leu Pro Arg Leu Val Tyr Val Ser Arg Glu Lys Arg Pro 515
520 525 Gly Phe Gln His His Lys Lys Ala
Gly Ala Met Asn Ala Leu Val Arg 530 535
540 Val Ser Ala Val Leu Thr Asn Gly Gln Tyr Met Leu Asn
Leu Asp Cys545 550 555
560 Asp His Tyr Ile Asn Asn Ser Lys Ala Leu Arg Glu Ala Met Cys Phe
565 570 575 Leu Met Asp Pro
Asn Leu Gly Arg Asn Val Cys Tyr Val Gln Phe Pro 580
585 590 Gln Arg Phe Asp Gly Ile Asp Arg Asn
Asp Arg Tyr Ala Asn Arg Asn 595 600
605 Thr Val Phe Phe Asp Ile Asn Leu Arg Gly Leu Asp Gly Ile
Gln Gly 610 615 620
Pro Val Tyr Val Gly Thr Gly Cys Val Phe Asn Arg Thr Ala Leu Tyr625
630 635 640 Gly Tyr Glu Pro Pro
Val Lys Lys Lys Lys Pro Gly Phe Phe Ser Ser 645
650 655 Leu Cys Gly Gly Arg Lys Lys Thr Ser Lys
Ser Lys Lys Ser Ser Glu 660 665
670 Lys Lys Lys Ser His Arg His Ala Asp Ser Ser Val Pro Val Phe
Asn 675 680 685 Leu
Glu Asp Ile Glu Glu Gly Ile Glu Gly Ser Gln Phe Asp Asp Glu 690
695 700 Lys Ser Leu Ile Met Ser
Gln Met Ser Leu Glu Lys Arg Phe Gly Gln705 710
715 720 Ser Ser Val Phe Val Ala Ser Thr Leu Met Glu
Tyr Gly Gly Val Pro 725 730
735 Gln Ser Ala Thr Pro Glu Ser Leu Leu Lys Glu Ala Ile His Val Ile
740 745 750 Ser Cys Gly
Tyr Glu Asp Lys Thr Asp Trp Gly Thr Glu Ile Gly Trp 755
760 765 Ile Tyr Gly Ser Val Thr Glu Asp
Ile Leu Thr Gly Phe Lys Met His 770 775
780 Ala Arg Gly Trp Arg Ser Ile Tyr Cys Met Pro Lys Arg
Pro Ala Phe785 790 795
800 Lys Gly Ser Ala Pro Ile Asn Leu Ser Asp Arg Leu Asn Gln Val Leu
805 810 815 Arg Trp Ala Leu
Gly Ser Ile Glu Ile Leu Phe Ser Arg His Cys Pro 820
825 830 Ile Trp Tyr Gly Tyr Gly Gly Arg Leu
Lys Phe Leu Glu Arg Phe Ala 835 840
845 Tyr Ile Asn Thr Thr Ile Tyr Pro Leu Thr Ser Ile Pro Leu
Leu Leu 850 855 860
Tyr Cys Ile Leu Pro Ala Val Cys Leu Leu Thr Gly Lys Phe Ile Ile865
870 875 880 Pro Lys Ile Ser Asn
Leu Glu Ser Val Trp Phe Ile Ser Leu Phe Ile 885
890 895 Ser Ile Phe Ala Thr Gly Ile Leu Glu Met
Arg Trp Ser Gly Val Gly 900 905
910 Ile Asp Glu Trp Trp Arg Asn Glu Gln Phe Trp Val Ile Gly Gly
Ile 915 920 925 Ser
Ala His Leu Phe Ala Val Phe Gln Gly Leu Leu Lys Val Leu Ala 930
935 940 Gly Ile Asp Thr Ser Phe
Thr Val Thr Ser Lys Ala Thr Asp Glu Glu945 950
955 960 Gly Asp Phe Ala Glu Leu Tyr Met Phe Lys Trp
Thr Thr Leu Leu Ile 965 970
975 Pro Pro Thr Thr Ile Leu Ile Ile Asn Leu Val Gly Val Val Ala Gly
980 985 990 Ile Ser Tyr
Ala Ile Asn Ser Gly Tyr Gln Ser Trp Gly Pro Leu Phe 995
1000 1005 Gly Lys Leu Phe Phe Ala Phe Trp
Val Ile Val His Leu Tyr Pro Phe 1010 1015
1020 Leu Lys Gly Leu Met Gly Lys Gln Asn Arg Thr Pro Thr
Ile Val Val1025 1030 1035
1040Val Trp Ala Ile Leu Leu Ala Ser Ile Phe Ser Leu Met Trp Val Arg
1045 1050 1055 Ile Asp Pro Phe
Thr Thr Arg Val Thr Gly Pro Asp Ile Ala Lys Cys 1060
1065 1070 Gly Ile Asn Cys 1075
1525DNAZea mays 15atggacggcg gcgacgccac gaatt
251625DNAZea mays 16ctagcagttg atgccacatt tcgcg
25173813DNAZea mays 17ccacagctca tataccaaga
gccggagcag cttagcgcag cccagagcgg cgccgcgcca 60agcacaaccc ccacccgcca
cagccgcgtg cgcatgtgag cggtcgccgc ggccgggaga 120ccagaggagg ggaggactac
gtgcatttcg ctgtgccgcc gccgcggggt tcgtgcgcga 180gcgagatccg gcggggcggg
gcggggggcc tgagatggag gctagcgcgg ggctggtggc 240cggctcgcat aaccggaacg
agctggtggt gatccgccgc gaccgcgagt cgggagccgc 300gggcggcggc gcggcgcgcc
gggcggaggc gccgtgccag atatgcggcg acgaggtcgg 360ggtgggcttc gacggggagc
ccttcgtggc gtgcaacgag tgcgccttcc ccgtctgccg 420cgcctgctac gagtacgagc
gccgcgaggg ctcgcaagcg tgcccgcagt gcaggacccg 480ctacaagcgc ctcaagggct
gcccgcgggt ggccggcgac gaggaggagg acggcgtcga 540cgacctggag ggcgagttcg
gcctgcagga cggcgccgcc cacgaggacg acccgcagta 600cgtcgccgag tccatgctca
gggcgcagat gagctacggc cgcggcggcg acgcgcaccc 660cggcttcagc cccgtcccca
acgtgccgct cctcaccaac ggccagatgg ttgatgacat 720cccgccggag cagcacgcgc
tcgtgccgtc ctacatgagc ggcggcggcg gcgggggcaa 780gaggatccac ccgctccctt
tcgcagatcc caaccttcca gtgcaaccga gatccatgga 840cccgtccaag gatctggccg
cctacggata tggcagcgtg gcctggaagg agagaatgga 900gggctggaag cagaagcagg
agcgcctgca gcatgtcagg agcgagggtg gcggtgattg 960ggatggcgac gatgcagatc
tgccactaat ggatgaagct aggcagccat tgtccagaaa 1020agtccctata tcatcaagcc
gaattaatcc ctacaggatg attatcgtta tccggttggt 1080ggttttgggt ttcttcttcc
actaccgagt gatgcatccg gcgaaagatg catttgcatt 1140gtggctcata tctgtaatct
gtgaaatctg gtttgcgatg tcctggattc ttgatcagtt 1200cccaaagtgg cttccaatcg
agagagagac ttacctggac cgtttgtcac taaggtttga 1260caaggaaggt caaccctctc
agcttgctcc aatcgacttc tttgtcagta cggttgatcc 1320cacaaaggaa cctcccttgg
tcacagcgaa cactgtcctt tccatccttt ctgtggatta 1380tccggttgag aaggtctcct
gctatgtttc tgatgatggt gctgcaatgc ttacgtttga 1440agcattgtct gaaacatctg
aatttgcaaa gaaatgggtt cctttcagca aaaagtttaa 1500tatcgagcct cgtgctcctg
agtggtactt ccaacagaag atagactacc tgaaagacaa 1560ggttgctgct tcatttgtta
gggagaggag ggcgatgaag agagaatacg aggaattcaa 1620ggtaaggatc aatgccttgg
ttgcaaaagc ccaaaaggtt cctgaggaag gatggacaat 1680gcaagatgga agcccctggc
ctggaaacaa cgtacgcgat catcctggaa tgattcaggt 1740attccttggc caaagtggcg
gtcgtgatgt ggaaggaaat gagttgcctc gcctggttta 1800tgtctcgaga gaaaagaggc
caggttataa ccatcacaag aaggctggtg ccatgaatgc 1860actggtccgt gtctctgctg
tcttatcaaa tgctgcatac ctattgaact tggactgtga 1920tcactacatc aacaatagca
aggccataaa agaggctatg tgtttcatga tggatccttt 1980ggtggggaag aaagtgtgct
atgtacagtt ccctcagagg tttgatggta ttgacaaaaa 2040tgatcgatac gctaacagga
acgttgtctt ttttgacatc aacatgaaag gtttggacgg 2100tattcaagga cccatttatg
tgggtactgg atgtgttttc agacggcagg cactgtatgg 2160ttatgatgct cctaaaacga
agaagccacc atcaagaact tgcaactgct ggcccaagtg 2220gtgcctctct tgctgctgca
gcaggaacaa gaataaaaag aagactacaa aaccaaagac 2280ggagaagaag aaaagattat
ttttcaagaa agcagaaaac ccatctcctg catatgcttt 2340gggtgaaatt gatgaaggtg
ctccaggtgc tgatatcgag aaggccggaa tcgtaaatca 2400acagaaacta gagaagaaat
ttgggcagtc ttctgttttt gtcgcatcaa cacttcttga 2460gaacggaggg accctgaaga
gcgcaagtcc agcttctctt ctgaaggaag ctatacatgt 2520tatcagctgc ggctacgaag
acaagaccga ctggggaaaa gagattggct ggatttacgg 2580atcgatcaca gaggatatct
tgactggatt taagatgcac tgccatggct ggcggtctat 2640ttactgcatc ccgaagcggc
ctgcattcaa aggttctgcg cctctgaacc tttccgaccg 2700tcttcaccag gtccttcgct
gggcccttgg gtccgtcgaa attttcttca gcaagcactg 2760cccactttgg tacggatacg
gcggcgggct aaaattcctg gaaaggtttt cttatatcaa 2820ctccatcgtt tatccctgga
cgtccattcc tctcctggct tactgtacct tgcctgccat 2880ctgcctgctc acggggaagt
ttatcacacc agagcttacc aatgtcgcca gtatctggtt 2940catggcactt ttcatctgca
tctccgtgac cggcatcctg gaaatgaggt ggagtggcgt 3000ggccatcgac gactggtgga
ggaacgagca gttctgggtc atcggaggcg tttcggcgca 3060tctgttcgcg gtgttccagg
gcctgctgaa ggtgttcgcc ggcatcgaca cgagcttcac 3120cgtgacgtcg aaggccgggg
acgacgagga gttctcggag ctgtacacgt tcaagtggac 3180caccctgctg atacccccga
ccacgctcct cctgctgaac ttcatcgggg tggtggccgg 3240gatctcgaac gcgatcaaca
acgggtacga gtcgtggggc cccctgttcg ggaagctctt 3300cttcgccttc tgggtgatcg
tccacctgta cccgttcctc aagggtctgg tggggaggca 3360gaacaggacg ccgacgatcg
tcatcgtctg gtccatcctg ctggcctcga tcttctcgct 3420cctgtgggtc cgcgtcgacc
cgttcctcgc caagagcaac ggcccgctcc tggaggagtg 3480tggcctggac tgcaactgaa
gtgggggccc cctgtcactc gaagttctgt cacgggcgaa 3540ttacgcctga ttttttgttg
ttgttgttgt tggaattctt tgctgtagat agaaaccaca 3600tgtccacggc atctctgctg
tgtccattgg agcaggagag aggtgcctgc tgctgtttgt 3660tgagtaaatt aaaagtttta
aagttataca gtgatgcaca ttccagtgcc cagtgtattc 3720cctttttaca gtctgtatat
tagcgacaaa ggacatattg gttaggagtt tgattctttt 3780gtaaaaaaaa aaaaaaaaaa
aaaaaaaaaa aaa 3813181094PRTZea mays 18Met
Glu Ala Ser Ala Gly Leu Val Ala Gly Ser His Asn Arg Asn Glu1
5 10 15 Leu Val Val Ile Arg Arg
Asp Arg Glu Ser Gly Ala Ala Gly Gly Gly 20 25
30 Ala Ala Arg Arg Ala Glu Ala Pro Cys Gln Ile
Cys Gly Asp Glu Val 35 40 45
Gly Val Gly Phe Asp Gly Glu Pro Phe Val Ala Cys Asn Glu Cys Ala
50 55 60 Phe Pro Val
Cys Arg Ala Cys Tyr Glu Tyr Glu Arg Arg Glu Gly Ser65 70
75 80 Gln Ala Cys Pro Gln Cys Arg Thr
Arg Tyr Lys Arg Leu Lys Gly Cys 85 90
95 Pro Arg Val Ala Gly Asp Glu Glu Glu Asp Gly Val Asp
Asp Leu Glu 100 105 110
Gly Glu Phe Gly Leu Gln Asp Gly Ala Ala His Glu Asp Asp Pro Gln
115 120 125 Tyr Val Ala Glu
Ser Met Leu Arg Ala Gln Met Ser Tyr Gly Arg Gly 130
135 140 Gly Asp Ala His Pro Gly Phe Ser
Pro Val Pro Asn Val Pro Leu Leu145 150
155 160 Thr Asn Gly Gln Met Val Asp Asp Ile Pro Pro Glu
Gln His Ala Leu 165 170
175 Val Pro Ser Tyr Met Ser Gly Gly Gly Gly Gly Gly Lys Arg Ile His
180 185 190 Pro Leu Pro
Phe Ala Asp Pro Asn Leu Pro Val Gln Pro Arg Ser Met 195
200 205 Asp Pro Ser Lys Asp Leu Ala Ala
Tyr Gly Tyr Gly Ser Val Ala Trp 210 215
220 Lys Glu Arg Met Glu Gly Trp Lys Gln Lys Gln Glu Arg
Leu Gln His225 230 235
240 Val Arg Ser Glu Gly Gly Gly Asp Trp Asp Gly Asp Asp Ala Asp Leu
245 250 255 Pro Leu Met Asp
Glu Ala Arg Gln Pro Leu Ser Arg Lys Val Pro Ile 260
265 270 Ser Ser Ser Arg Ile Asn Pro Tyr Arg
Met Ile Ile Val Ile Arg Leu 275 280
285 Val Val Leu Gly Phe Phe Phe His Tyr Arg Val Met His Pro
Ala Lys 290 295 300
Asp Ala Phe Ala Leu Trp Leu Ile Ser Val Ile Cys Glu Ile Trp Phe305
310 315 320 Ala Met Ser Trp Ile
Leu Asp Gln Phe Pro Lys Trp Leu Pro Ile Glu 325
330 335 Arg Glu Thr Tyr Leu Asp Arg Leu Ser Leu
Arg Phe Asp Lys Glu Gly 340 345
350 Gln Pro Ser Gln Leu Ala Pro Ile Asp Phe Phe Val Ser Thr Val
Asp 355 360 365 Pro
Thr Lys Glu Pro Pro Leu Val Thr Ala Asn Thr Val Leu Ser Ile 370
375 380 Leu Ser Val Asp Tyr Pro
Val Glu Lys Val Ser Cys Tyr Val Ser Asp385 390
395 400 Asp Gly Ala Ala Met Leu Thr Phe Glu Ala Leu
Ser Glu Thr Ser Glu 405 410
415 Phe Ala Lys Lys Trp Val Pro Phe Ser Lys Lys Phe Asn Ile Glu Pro
420 425 430 Arg Ala Pro
Glu Trp Tyr Phe Gln Gln Lys Ile Asp Tyr Leu Lys Asp 435
440 445 Lys Val Ala Ala Ser Phe Val Arg
Glu Arg Arg Ala Met Lys Arg Glu 450 455
460 Tyr Glu Glu Phe Lys Val Arg Ile Asn Ala Leu Val Ala
Lys Ala Gln465 470 475
480 Lys Val Pro Glu Glu Gly Trp Thr Met Gln Asp Gly Ser Pro Trp Pro
485 490 495 Gly Asn Asn Val
Arg Asp His Pro Gly Met Ile Gln Val Phe Leu Gly 500
505 510 Gln Ser Gly Gly Arg Asp Val Glu Gly
Asn Glu Leu Pro Arg Leu Val 515 520
525 Tyr Val Ser Arg Glu Lys Arg Pro Gly Tyr Asn His His Lys
Lys Ala 530 535 540
Gly Ala Met Asn Ala Leu Val Arg Val Ser Ala Val Leu Ser Asn Ala545
550 555 560 Ala Tyr Leu Leu Asn
Leu Asp Cys Asp His Tyr Ile Asn Asn Ser Lys 565
570 575 Ala Ile Lys Glu Ala Met Cys Phe Met Met
Asp Pro Leu Val Gly Lys 580 585
590 Lys Val Cys Tyr Val Gln Phe Pro Gln Arg Phe Asp Gly Ile Asp
Lys 595 600 605 Asn
Asp Arg Tyr Ala Asn Arg Asn Val Val Phe Phe Asp Ile Asn Met 610
615 620 Lys Gly Leu Asp Gly Ile
Gln Gly Pro Ile Tyr Val Gly Thr Gly Cys625 630
635 640 Val Phe Arg Arg Gln Ala Leu Tyr Gly Tyr Asp
Ala Pro Lys Thr Lys 645 650
655 Lys Pro Pro Ser Arg Thr Cys Asn Cys Trp Pro Lys Trp Cys Leu Ser
660 665 670 Cys Cys Cys
Ser Arg Asn Lys Asn Lys Lys Lys Thr Thr Lys Pro Lys 675
680 685 Thr Glu Lys Lys Lys Arg Leu Phe
Phe Lys Lys Ala Glu Asn Pro Ser 690 695
700 Pro Ala Tyr Ala Leu Gly Glu Ile Asp Glu Gly Ala Pro
Gly Ala Asp705 710 715
720 Ile Glu Lys Ala Gly Ile Val Asn Gln Gln Lys Leu Glu Lys Lys Phe
725 730 735 Gly Gln Ser Ser
Val Phe Val Ala Ser Thr Leu Leu Glu Asn Gly Gly 740
745 750 Thr Leu Lys Ser Ala Ser Pro Ala Ser
Leu Leu Lys Glu Ala Ile His 755 760
765 Val Ile Ser Cys Gly Tyr Glu Asp Lys Thr Asp Trp Gly Lys
Glu Ile 770 775 780
Gly Trp Ile Tyr Gly Ser Ile Thr Glu Asp Ile Leu Thr Gly Phe Lys785
790 795 800 Met His Cys His Gly
Trp Arg Ser Ile Tyr Cys Ile Pro Lys Arg Pro 805
810 815 Ala Phe Lys Gly Ser Ala Pro Leu Asn Leu
Ser Asp Arg Leu His Gln 820 825
830 Val Leu Arg Trp Ala Leu Gly Ser Val Glu Ile Phe Phe Ser Lys
His 835 840 845 Cys
Pro Leu Trp Tyr Gly Tyr Gly Gly Gly Leu Lys Phe Leu Glu Arg 850
855 860 Phe Ser Tyr Ile Asn Ser
Ile Val Tyr Pro Trp Thr Ser Ile Pro Leu865 870
875 880 Leu Ala Tyr Cys Thr Leu Pro Ala Ile Cys Leu
Leu Thr Gly Lys Phe 885 890
895 Ile Thr Pro Glu Leu Thr Asn Val Ala Ser Ile Trp Phe Met Ala Leu
900 905 910 Phe Ile Cys
Ile Ser Val Thr Gly Ile Leu Glu Met Arg Trp Ser Gly 915
920 925 Val Ala Ile Asp Asp Trp Trp Arg
Asn Glu Gln Phe Trp Val Ile Gly 930 935
940 Gly Val Ser Ala His Leu Phe Ala Val Phe Gln Gly Leu
Leu Lys Val945 950 955
960 Phe Ala Gly Ile Asp Thr Ser Phe Thr Val Thr Ser Lys Ala Gly Asp
965 970 975 Asp Glu Glu Phe
Ser Glu Leu Tyr Thr Phe Lys Trp Thr Thr Leu Leu 980
985 990 Ile Pro Pro Thr Thr Leu Leu Leu Leu
Asn Phe Ile Gly Val Val Ala 995 1000
1005 Gly Ile Ser Asn Ala Ile Asn Asn Gly Tyr Glu Ser Trp Gly
Pro Leu 1010 1015 1020
Phe Gly Lys Leu Phe Phe Ala Phe Trp Val Ile Val His Leu Tyr Pro1025
1030 1035 1040Phe Leu Lys Gly Leu
Val Gly Arg Gln Asn Arg Thr Pro Thr Ile Val 1045
1050 1055 Ile Val Trp Ser Ile Leu Leu Ala Ser Ile
Phe Ser Leu Leu Trp Val 1060 1065
1070 Arg Val Asp Pro Phe Leu Ala Lys Ser Asn Gly Pro Leu Leu Glu
Glu 1075 1080 1085 Cys
Gly Leu Asp Cys Asn 1090 1925DNAZea mays 19atggaggcta
gcgcggggct ggtgg 252025DNAZea
mays 20tcagttgcag tccaggccac actcc
25213799DNAZea maysmisc_feature3757, 3775, 3777, 3782n = A,T,C or G
21caactcacgt tgccgcggct tcctccatcg gtgcggtgcc ctgtcctttt ctctcctcca
60cctccctagt ccctcctccc ccccgcatac atagctacta ctagtagcac cacgctcgca
120gcgggagatg cggtgctgat ccgtgcccct gctcggatct cgggagtggt gccgacttgt
180gtcgcttcgg ctctgcctag gccagctcct tgtcggttct gggcgagctc gcctgccatg
240gagggcgacg cggacggcgt gaagtcgggg aggcgcgggg gagggcaggt gtgccagatc
300tgcggcgatg gcgtgggcac tacggcggag ggagacgtct tcaccgcctg cgacgtctgc
360gggttcccgg tgtgccgccc ctgctacgag tacgagcgca aggacggcac acaagcgtgc
420ccccagtgca aaaacaagta caagcgccac aaggggagtc cagcgatccg aggggaggaa
480ggagacgata ctgatgccga tgatgctagc gacttcaact accctgcatc tggcaatgac
540gaccagaagc agaagattgc tgacaggatg cgcagctggc gcatgaatgc tgggggcagc
600ggggatgttg gccgccccaa gtatgacagt ggtgagatcg ggcttaccaa gtacgacagt
660ggtgagatcc ctcggggata catcccgtca gtcactaaca gccagatttc gggagaaatc
720cctggtgctt cccctgacca tcatatgatg tctcctactg ggaacattgg caggcgcgcc
780ccatttccct atatgaatca ttcatcaaat ccgtcgaggg aattctctgg tagcgttggg
840aatgttgcct ggaaagagag ggttgatggc tggaaaatga agcaggacaa gggaacaatt
900cccatgacga atggcacaag cattgctccc tctgagggcc ggggtgttgg tgatattgat
960gcatcaactg attacaacat ggaagatgcc ttattaaacg atgaaactcg ccagcctcta
1020tctaggaaag ttccacttcc ttcctccagg ataaatccat acaggatggt cattgtgcta
1080cgattgattg ttctaagcat cttcttgcac taccggatca caaatcctgt gcgtaatgca
1140tacccactgt ggcttctatc tgttatatgt gagatctggt ttgctctttc ctggatattg
1200gatcagtttc caaagtggtt tccaatcaac cgcgagactt accttgatag actcgcatta
1260aggtatgacc gggaaggtga gccatctcag ttggctgctg ttgacatttt tgtcagtact
1320gtcgacccaa tgaaggagcc tcctcttgtc actgccaata ccgtgctatc cattctcgct
1380gtggactatc ctgtggataa ggtctcttgc tatgtatctg atgatggagc tgctatgctg
1440acatttgatg cactagctga gacttcagag tttgctagaa aatgggtgcc atttgttaag
1500aagtacaaca ttgaacctag agctcctgaa tggtacttct cccagaaaat tgattacttg
1560aaggacaaag tgcacccttc atttgttaaa gaccgccggg ccatgaagag agaatatgaa
1620gaattcaaaa ttagggtaaa tggccttgtt gctaaggcac aaaaagtccc tgaggaagga
1680tggatcatgc aagatggcac accatggcca ggaaacaata ccagggacca tcctggaatg
1740attcaggttt tccttggtca cagtggtggt cttgatactg agggtaatga gctaccccgt
1800ttggtctatg tttctcgtga aaaacgtcct ggattccagc atcacaagaa agctggtgcc
1860atgaatgctc ttgtccgcgt ctcagctgtg cttaccaatg gacaatacat gttgaatctt
1920gattgtgatc actacatcaa caacagtaag gctctcaggg aagctatgtg cttccttatg
1980gatcctaacc taggaaggag tgtctgctat gttcagtttc cccagaggtt cgatggtatt
2040gataggaatg atcgatatgc caacaggaac accgtgtttt tcgatattaa cttgagaggt
2100cttgatggca tccaaggacc agtttatgtg ggcactggct gtgttttcaa cagaacagct
2160ctatatggtt atgagccccc aattaagcaa aagaagggtg gtttcttgtc atcactatgt
2220ggtggcagga agaagggaag caaatcaaag aagggctcag acaagaaaaa gtcacagaag
2280catgtggaca gttctgtgcc agtattcaat cttgaagata tagaggaggg agttgaaggc
2340gctggatttg atgatgagaa atcacttctt atgtctcaaa tgagcttgga gaagagattt
2400ggccaatctg cagcttttgt tgcgtccact ctgatggaat atggtggtgt tcctcagtct
2460gcgactccag aatctcttct gaaagaagct atccatgtca taagttgtgg ctacgaggac
2520aagattgaat ggggaactga gattgggtgg atctatggtt ctgtgacgga agatattctc
2580actgggttca agatgcacgc acgaggctgg cggtcgatct actgcatgcc taagcggccg
2640gccttcaagg gatcggctcc catcaatctc tcagaccgtc tgaaccaggt gctccggtgg
2700gctctcggtt cagtggaaat ccttttcagc cggcattgcc ccctatggta cgggtacgga
2760ggacgcctga agttcttgga gagattcgcc tacatcaaca ccaccatcta cccgctcacg
2820tccctcccgc tcctcattta ctgtatcctg cctgccatct gcctgctcac ggggaagttc
2880atcatcccag agatcagcaa cttcgctagt atctggttca tctctctctt catctcgatc
2940ttcgccacgg gtatcctgga gatgaggtgg agcggcgtgg gcatcgacga gtggtggagg
3000aacgagcagt tctgggtcat cggaggcatc tccgcccacc tcttcgccgt cttccagggc
3060ctcctcaagg tgcttgccgg catcgacacc aacttcaccg tcacctccaa ggcctcggat
3120gaagacggcg acttcgcgga gctgtacatg ttcaagtgga cgacacttct gatcccgccc
3180accaccatcc tgatcatcaa cctggtcggc gttgttgccg gcatctccta cgccatcaac
3240agcgggtacc agtcgtgggg tccgctcttc ggcaagctct tcttcgcctt ctgggtgatc
3300gttcacctgt acccgttcct caagggtctc atgggtcggc agaaccgcac cccgaccatc
3360gtggttgtct gggcgatcct gctggcgtcg atcttctcct tgctgtgggt tcgcatcgat
3420ccgttcacca accgcgtcac tggcccggat actcgaacgt gtggcatcaa ctgctaggga
3480ggtggaaggt ttgtagaaac agagagatac cacgaatgtg ccgctgccac aaattgtctg
3540ttagtaagtt atataggcag gtggcgttat ttacagctac gtacacacaa ggggatactc
3600cgtttatcac tggtgtgcat tcttttgttg atataagtta ctatatatac gtattgcttc
3660tactttgtgg agagtggctg acaggaccag ttttgtaatg ttatgaacag caaagaaata
3720agttagtttc caaaaaaaaa aaaaaaaaaa aaaaaanaaa aaaaaaaaaa aaaananaaa
3780anaaaaaaaa aaaaacccc
3799221079PRTZea mays 22Met Glu Gly Asp Ala Asp Gly Val Lys Ser Gly Arg
Arg Gly Gly Gly1 5 10 15
Gln Val Cys Gln Ile Cys Gly Asp Gly Val Gly Thr Thr Ala Glu Gly
20 25 30 Asp Val Phe Thr
Ala Cys Asp Val Cys Gly Phe Pro Val Cys Arg Pro 35
40 45 Cys Tyr Glu Tyr Glu Arg Lys Asp Gly
Thr Gln Ala Cys Pro Gln Cys 50 55 60
Lys Asn Lys Tyr Lys Arg His Lys Gly Ser Pro Ala Ile Arg
Gly Glu65 70 75 80
Glu Gly Asp Asp Thr Asp Ala Asp Asp Ala Ser Asp Phe Asn Tyr Pro
85 90 95 Ala Ser Gly Asn Asp
Asp Gln Lys Gln Lys Ile Ala Asp Arg Met Arg 100
105 110 Ser Trp Arg Met Asn Ala Gly Gly Ser Gly
Asp Val Gly Arg Pro Lys 115 120
125 Tyr Asp Ser Gly Glu Ile Gly Leu Thr Lys Tyr Asp Ser Gly
Glu Ile 130 135 140
Pro Arg Gly Tyr Ile Pro Ser Val Thr Asn Ser Gln Ile Ser Gly Glu145
150 155 160 Ile Pro Gly Ala Ser
Pro Asp His His Met Met Ser Pro Thr Gly Asn 165
170 175 Ile Gly Arg Arg Ala Pro Phe Pro Tyr Met
Asn His Ser Ser Asn Pro 180 185
190 Ser Arg Glu Phe Ser Gly Ser Val Gly Asn Val Ala Trp Lys Glu
Arg 195 200 205 Val
Asp Gly Trp Lys Met Lys Gln Asp Lys Gly Thr Ile Pro Met Thr 210
215 220 Asn Gly Thr Ser Ile Ala
Pro Ser Glu Gly Arg Gly Val Gly Asp Ile225 230
235 240 Asp Ala Ser Thr Asp Tyr Asn Met Glu Asp Ala
Leu Leu Asn Asp Glu 245 250
255 Thr Arg Gln Pro Leu Ser Arg Lys Val Pro Leu Pro Ser Ser Arg Ile
260 265 270 Asn Pro Tyr
Arg Met Val Ile Val Leu Arg Leu Ile Val Leu Ser Ile 275
280 285 Phe Leu His Tyr Arg Ile Thr Asn
Pro Val Arg Asn Ala Tyr Pro Leu 290 295
300 Trp Leu Leu Ser Val Ile Cys Glu Ile Trp Phe Ala Leu
Ser Trp Ile305 310 315
320 Leu Asp Gln Phe Pro Lys Trp Phe Pro Ile Asn Arg Glu Thr Tyr Leu
325 330 335 Asp Arg Leu Ala
Leu Arg Tyr Asp Arg Glu Gly Glu Pro Ser Gln Leu 340
345 350 Ala Ala Val Asp Ile Phe Val Ser Thr
Val Asp Pro Met Lys Glu Pro 355 360
365 Pro Leu Val Thr Ala Asn Thr Val Leu Ser Ile Leu Ala Val
Asp Tyr 370 375 380
Pro Val Asp Lys Val Ser Cys Tyr Val Ser Asp Asp Gly Ala Ala Met385
390 395 400 Leu Thr Phe Asp Ala
Leu Ala Glu Thr Ser Glu Phe Ala Arg Lys Trp 405
410 415 Val Pro Phe Val Lys Lys Tyr Asn Ile Glu
Pro Arg Ala Pro Glu Trp 420 425
430 Tyr Phe Ser Gln Lys Ile Asp Tyr Leu Lys Asp Lys Val His Pro
Ser 435 440 445 Phe
Val Lys Asp Arg Arg Ala Met Lys Arg Glu Tyr Glu Glu Phe Lys 450
455 460 Ile Arg Val Asn Gly Leu
Val Ala Lys Ala Gln Lys Val Pro Glu Glu465 470
475 480 Gly Trp Ile Met Gln Asp Gly Thr Pro Trp Pro
Gly Asn Asn Thr Arg 485 490
495 Asp His Pro Gly Met Ile Gln Val Phe Leu Gly His Ser Gly Gly Leu
500 505 510 Asp Thr Glu
Gly Asn Glu Leu Pro Arg Leu Val Tyr Val Ser Arg Glu 515
520 525 Lys Arg Pro Gly Phe Gln His His
Lys Lys Ala Gly Ala Met Asn Ala 530 535
540 Leu Val Arg Val Ser Ala Val Leu Thr Asn Gly Gln Tyr
Met Leu Asn545 550 555
560 Leu Asp Cys Asp His Tyr Ile Asn Asn Ser Lys Ala Leu Arg Glu Ala
565 570 575 Met Cys Phe Leu
Met Asp Pro Asn Leu Gly Arg Ser Val Cys Tyr Val 580
585 590 Gln Phe Pro Gln Arg Phe Asp Gly Ile
Asp Arg Asn Asp Arg Tyr Ala 595 600
605 Asn Arg Asn Thr Val Phe Phe Asp Ile Asn Leu Arg Gly Leu
Asp Gly 610 615 620
Ile Gln Gly Pro Val Tyr Val Gly Thr Gly Cys Val Phe Asn Arg Thr625
630 635 640 Ala Leu Tyr Gly Tyr
Glu Pro Pro Ile Lys Gln Lys Lys Gly Gly Phe 645
650 655 Leu Ser Ser Leu Cys Gly Gly Arg Lys Lys
Gly Ser Lys Ser Lys Lys 660 665
670 Gly Ser Asp Lys Lys Lys Ser Gln Lys His Val Asp Ser Ser Val
Pro 675 680 685 Val
Phe Asn Leu Glu Asp Ile Glu Glu Gly Val Glu Gly Ala Gly Phe 690
695 700 Asp Asp Glu Lys Ser Leu
Leu Met Ser Gln Met Ser Leu Glu Lys Arg705 710
715 720 Phe Gly Gln Ser Ala Ala Phe Val Ala Ser Thr
Leu Met Glu Tyr Gly 725 730
735 Gly Val Pro Gln Ser Ala Thr Pro Glu Ser Leu Leu Lys Glu Ala Ile
740 745 750 His Val Ile
Ser Cys Gly Tyr Glu Asp Lys Ile Glu Trp Gly Thr Glu 755
760 765 Ile Gly Trp Ile Tyr Gly Ser Val
Thr Glu Asp Ile Leu Thr Gly Phe 770 775
780 Lys Met His Ala Arg Gly Trp Arg Ser Ile Tyr Cys Met
Pro Lys Arg785 790 795
800 Pro Ala Phe Lys Gly Ser Ala Pro Ile Asn Leu Ser Asp Arg Leu Asn
805 810 815 Gln Val Leu Arg
Trp Ala Leu Gly Ser Val Glu Ile Leu Phe Ser Arg 820
825 830 His Cys Pro Leu Trp Tyr Gly Tyr Gly
Gly Arg Leu Lys Phe Leu Glu 835 840
845 Arg Phe Ala Tyr Ile Asn Thr Thr Ile Tyr Pro Leu Thr Ser
Leu Pro 850 855 860
Leu Leu Ile Tyr Cys Ile Leu Pro Ala Ile Cys Leu Leu Thr Gly Lys865
870 875 880 Phe Ile Ile Pro Glu
Ile Ser Asn Phe Ala Ser Ile Trp Phe Ile Ser 885
890 895 Leu Phe Ile Ser Ile Phe Ala Thr Gly Ile
Leu Glu Met Arg Trp Ser 900 905
910 Gly Val Gly Ile Asp Glu Trp Trp Arg Asn Glu Gln Phe Trp Val
Ile 915 920 925 Gly
Gly Ile Ser Ala His Leu Phe Ala Val Phe Gln Gly Leu Leu Lys 930
935 940 Val Leu Ala Gly Ile Asp
Thr Asn Phe Thr Val Thr Ser Lys Ala Ser945 950
955 960 Asp Glu Asp Gly Asp Phe Ala Glu Leu Tyr Met
Phe Lys Trp Thr Thr 965 970
975 Leu Leu Ile Pro Pro Thr Thr Ile Leu Ile Ile Asn Leu Val Gly Val
980 985 990 Val Ala Gly
Ile Ser Tyr Ala Ile Asn Ser Gly Tyr Gln Ser Trp Gly 995
1000 1005 Pro Leu Phe Gly Lys Leu Phe Phe
Ala Phe Trp Val Ile Val His Leu 1010 1015
1020 Tyr Pro Phe Leu Lys Gly Leu Met Gly Arg Gln Asn Arg
Thr Pro Thr1025 1030 1035
1040Ile Val Val Val Trp Ala Ile Leu Leu Ala Ser Ile Phe Ser Leu Leu
1045 1050 1055 Trp Val Arg Ile
Asp Pro Phe Thr Asn Arg Val Thr Gly Pro Asp Thr 1060
1065 1070 Arg Thr Cys Gly Ile Asn Cys
1075 2325DNAZea mays 23atggagggcg acgcggacgg cgtga
252425DNAZea mays 24ctagcagttg
atgccacacg ttcga 25253470DNAZea
mays 25gcccccggtc gatcgctcgg caatcggcat ggacgccggc tcggtcaccg gtggcctcgc
60cgcgggctcg cacatgcggg acgagctgca tgtcatgcgc gcccgcgagg agccgaacgc
120caaggtccgg agcgccgacg tgaagacgtg ccgcgtgtgc gccgacgagg tcgggacgcg
180ggaggacggg cagcccttcg tggcgtgcgc cgagtgcggc ttccccgtct gccggccctg
240ctacgagtac gagcgcagcg agggcacgca gtgctgcccg cagtgcaaca cccgctacaa
300gcgccagaaa gggtgcccga gggtggaagg ggacgaggag gagggcccgg agatggacga
360cttcgaggac gagttccccg ccaagagccc caagaagcct cacgagcctg tcgcgttcga
420cgtctactcg gagaacggcg agcacccggc gcagaaatgg cggacgggtg gccagacgct
480gtcgtccttc accggaagcg tcgccgggaa ggacctggag gcggagaggg agatggaggg
540gagcatggag tggaaggacc ggatcgacaa gtggaagacc aagcaggaga agaggggcaa
600gctcaaccac gacgacagcg acgacgacga cgacaagaac gaagacgagt acatgctgct
660tgccgaggcc cgacagccgc tgtggcgcaa ggttccgatc ccgtcgagca tgatcaaccc
720gtaccgcatc gtcatcgtgc tccgcctggt ggtgctctgc ttcttcctca agttccggat
780cacgacgccc gccacggacg ccgtgcctct gtggctggcg tccgtcatct gcgagctctg
840gttcgccttc tcctggatcc tggaccagct gccaaagtgg gcgccggtga cgcgggagac
900gtacctggac cgcctggcgc tgcggtacga ccgtgagggc gaggcgtgcc ggctgtcccc
960catcgacttc ttcgtcagca cggtggaccc gctcaaggag ccgcccatca tcaccgccaa
1020caccgtgctg tccatcctcg ccgtcgacta ccccgtggac cgcgtcagct gctacgtctc
1080cgacgacggc gcgtccatgc tgctcttcga cgcgctgtcc gagaccgccg agttcgcgcg
1140ccgctgggtg cccttctgca agaagttcgc cgtggagccg cgcgccccgg agttctactt
1200ctcgcagaag atcgactacc tcaaggacaa ggtgcagccg acgttcgtca aggagcgccg
1260cgccatgaag agggagtacg aggagttcaa ggtgcgcatc aacgcgctgg tggccaaggc
1320gcagaagaag cccgaggagg ggtgggtcat gcaggacggc acgccgtggc ccgggaacaa
1380cacgcgcgac cacccgggta tgatccaggt ctacctcggc aaccagggcg cgctggacgt
1440ggagggccac gagctgccgc gcctcgtcta cgtgtcccgt gagaagcgcc ccgggtacaa
1500ccaccacaag aaggcgggcg ccatgaacgc gctggtgcgc gtctccgccg tgctcaccaa
1560cgcgcccttc atcctcaacc tcgactgcga ccactacgtc aacaacagca aggccgtgcg
1620cgaggccatg tgcttcctca tggacccgca gctggggaag aagctctgct acgtccagtt
1680cccgcagcgc ttcgatggca tcgatcgcca cgaccgatac gccaaccgca acgtcgtctt
1740cttcgacatc aacatgaagg ggctggacgg catccagggc ccggtgtacg tcggcacggg
1800gtgcgtgttc aaccgccagg cgctgtacgg ctacgacccg ccgcggcccg agaagcggcc
1860caagatgacg tgcgactgct ggccgtcgtg gtgctgctgc tgctgctgct tcggcggcgg
1920caagcgcggc aaggcgcgca aggacaagaa gggcgacggc ggcgaggagc cgcgccgggg
1980cctgctcggc ttctacagga agcggagcaa gaaggacaag ctcggcggcg ggtcggtggc
2040cggcagcaag aagggcggcg ggctgtacaa gaagcaccag cgcgcgttcg agctggagga
2100gatcgaggag gggctggagg ggtacgacga gctggagcgc tcctcgctca tgtcgcagaa
2160gagcttcgag aagcggttcg gccagtcgcc cgtgttcatc gcctccacgc tcgtcgagga
2220cggcggcctg ccgcagggcg ccgccgccga ccccgccgcg ctcatcaagg aggccatcca
2280cgtcatcagc tgcggatacg aggagaagac cgagtggggc aaggagattg ggtggatcta
2340tgggtcggtg acagaggata tcctgacggg gttcaagatg cactgccggg ggtggaagtc
2400cgtgtactgc acgccgacac ggccggcgtt caaggggtcg gcgcccatca acttgtctga
2460tcgtctccac caggtgctgc gctgggcgct ggggtccgtg gagatcttca tgagccgcca
2520ctgcccgctc cggtacgcct acggcggccg gctcaagtgg ctggagcgct tcgcctacac
2580caacaccatc gtgtacccct tcacctccat cccgctcctc gcctactgca ccatccccgc
2640cgtctgcctg ctcaccggca agttcatcat tcccacgctg aacaacctcg ccagcatctg
2700gttcatcgcg ctcttcctgt ccatcatcgc gacgagcgtc ctggagctgc ggtggagcgg
2760ggtgagcatc gaggactggt ggcgcaacga gcagttctgg gtcatcggcg gcgtgtccgc
2820gcatctcttc gccgtgttcc agggcttcct caaggttctg ggcggcgtgg acaccagctt
2880caccgtcacc tccaaggcgg ccggcgacga ggccgacgcc ttcggggacc tctacctctt
2940caagtggacc accctgctgg tgccccccac cacgctcatc atcatcaaca tggtgggcat
3000cgtggccggc gtgtccgacg ccgtcaacaa cggctacggc tcctggggcc cgctcttcgg
3060caagctcttc ttctccttct gggtcatcgt ccacctctac ccgttcctca aggggctcat
3120ggggaggcag aaccggacgc ccaccatcgt cgtgctctgg tccatcctcc tcgcctccat
3180cttctcgctc gtctgggtca ggatcgaccc gtttatcccg aaggccaagg gccccatcct
3240caagccatgc ggagtcgagt gctgagctca cctagctacc ttcttgttgc atgtacggac
3300gccgccgtgc gtttggacat acaggcactt ttgggccagg ctactcatgt tcgacttttt
3360ttttaatttt gtacaagatt tgtgatcgag tgactgagtg agacagagtg ttgggtgtaa
3420gaactgtgat ggaattcact caaattaatg gacatttttt ttcttcaaaa
3470261078PRTZea mays 26Met Asp Ala Gly Ser Val Thr Gly Gly Leu Ala Ala
Gly Ser His Met1 5 10 15
Arg Asp Glu Leu His Val Met Arg Ala Arg Glu Glu Pro Asn Ala Lys
20 25 30 Val Arg Ser Ala
Asp Val Lys Thr Cys Arg Val Cys Ala Asp Glu Val 35
40 45 Gly Thr Arg Glu Asp Gly Gln Pro Phe
Val Ala Cys Ala Glu Cys Gly 50 55 60
Phe Pro Val Cys Arg Pro Cys Tyr Glu Tyr Glu Arg Ser Glu
Gly Thr65 70 75 80
Gln Cys Cys Pro Gln Cys Asn Thr Arg Tyr Lys Arg Gln Lys Gly Cys
85 90 95 Pro Arg Val Glu Gly
Asp Glu Glu Glu Gly Pro Glu Met Asp Asp Phe 100
105 110 Glu Asp Glu Phe Pro Ala Lys Ser Pro Lys
Lys Pro His Glu Pro Val 115 120
125 Ala Phe Asp Val Tyr Ser Glu Asn Gly Glu His Pro Ala Gln
Lys Trp 130 135 140
Arg Thr Gly Gly Gln Thr Leu Ser Ser Phe Thr Gly Ser Val Ala Gly145
150 155 160 Lys Asp Leu Glu Ala
Glu Arg Glu Met Glu Gly Ser Met Glu Trp Lys 165
170 175 Asp Arg Ile Asp Lys Trp Lys Thr Lys Gln
Glu Lys Arg Gly Lys Leu 180 185
190 Asn His Asp Asp Ser Asp Asp Asp Asp Asp Lys Asn Glu Asp Glu
Tyr 195 200 205 Met
Leu Leu Ala Glu Ala Arg Gln Pro Leu Trp Arg Lys Val Pro Ile 210
215 220 Pro Ser Ser Met Ile Asn
Pro Tyr Arg Ile Val Ile Val Leu Arg Leu225 230
235 240 Val Val Leu Cys Phe Phe Leu Lys Phe Arg Ile
Thr Thr Pro Ala Thr 245 250
255 Asp Ala Val Pro Leu Trp Leu Ala Ser Val Ile Cys Glu Leu Trp Phe
260 265 270 Ala Phe Ser
Trp Ile Leu Asp Gln Leu Pro Lys Trp Ala Pro Val Thr 275
280 285 Arg Glu Thr Tyr Leu Asp Arg Leu
Ala Leu Arg Tyr Asp Arg Glu Gly 290 295
300 Glu Ala Cys Arg Leu Ser Pro Ile Asp Phe Phe Val Ser
Thr Val Asp305 310 315
320 Pro Leu Lys Glu Pro Pro Ile Ile Thr Ala Asn Thr Val Leu Ser Ile
325 330 335 Leu Ala Val Asp
Tyr Pro Val Asp Arg Val Ser Cys Tyr Val Ser Asp 340
345 350 Asp Gly Ala Ser Met Leu Leu Phe Asp
Ala Leu Ser Glu Thr Ala Glu 355 360
365 Phe Ala Arg Arg Trp Val Pro Phe Cys Lys Lys Phe Ala Val
Glu Pro 370 375 380
Arg Ala Pro Glu Phe Tyr Phe Ser Gln Lys Ile Asp Tyr Leu Lys Asp385
390 395 400 Lys Val Gln Pro Thr
Phe Val Lys Glu Arg Arg Ala Met Lys Arg Glu 405
410 415 Tyr Glu Glu Phe Lys Val Arg Ile Asn Ala
Leu Val Ala Lys Ala Gln 420 425
430 Lys Lys Pro Glu Glu Gly Trp Val Met Gln Asp Gly Thr Pro Trp
Pro 435 440 445 Gly
Asn Asn Thr Arg Asp His Pro Gly Met Ile Gln Val Tyr Leu Gly 450
455 460 Asn Gln Gly Ala Leu Asp
Val Glu Gly His Glu Leu Pro Arg Leu Val465 470
475 480 Tyr Val Ser Arg Glu Lys Arg Pro Gly Tyr Asn
His His Lys Lys Ala 485 490
495 Gly Ala Met Asn Ala Leu Val Arg Val Ser Ala Val Leu Thr Asn Ala
500 505 510 Pro Phe Ile
Leu Asn Leu Asp Cys Asp His Tyr Val Asn Asn Ser Lys 515
520 525 Ala Val Arg Glu Ala Met Cys Phe
Leu Met Asp Pro Gln Leu Gly Lys 530 535
540 Lys Leu Cys Tyr Val Gln Phe Pro Gln Arg Phe Asp Gly
Ile Asp Arg545 550 555
560 His Asp Arg Tyr Ala Asn Arg Asn Val Val Phe Phe Asp Ile Asn Met
565 570 575 Lys Gly Leu Asp
Gly Ile Gln Gly Pro Val Tyr Val Gly Thr Gly Cys 580
585 590 Val Phe Asn Arg Gln Ala Leu Tyr Gly
Tyr Asp Pro Pro Arg Pro Glu 595 600
605 Lys Arg Pro Lys Met Thr Cys Asp Cys Trp Pro Ser Trp Cys
Cys Cys 610 615 620
Cys Cys Cys Phe Gly Gly Gly Lys Arg Gly Lys Ala Arg Lys Asp Lys625
630 635 640 Lys Gly Asp Gly Gly
Glu Glu Pro Arg Arg Gly Leu Leu Gly Phe Tyr 645
650 655 Arg Lys Arg Ser Lys Lys Asp Lys Leu Gly
Gly Gly Ser Val Ala Gly 660 665
670 Ser Lys Lys Gly Gly Gly Leu Tyr Lys Lys His Gln Arg Ala Phe
Glu 675 680 685 Leu
Glu Glu Ile Glu Glu Gly Leu Glu Gly Tyr Asp Glu Leu Glu Arg 690
695 700 Ser Ser Leu Met Ser Gln
Lys Ser Phe Glu Lys Arg Phe Gly Gln Ser705 710
715 720 Pro Val Phe Ile Ala Ser Thr Leu Val Glu Asp
Gly Gly Leu Pro Gln 725 730
735 Gly Ala Ala Ala Asp Pro Ala Ala Leu Ile Lys Glu Ala Ile His Val
740 745 750 Ile Ser Cys
Gly Tyr Glu Glu Lys Thr Glu Trp Gly Lys Glu Ile Gly 755
760 765 Trp Ile Tyr Gly Ser Val Thr Glu
Asp Ile Leu Thr Gly Phe Lys Met 770 775
780 His Cys Arg Gly Trp Lys Ser Val Tyr Cys Thr Pro Thr
Arg Pro Ala785 790 795
800 Phe Lys Gly Ser Ala Pro Ile Asn Leu Ser Asp Arg Leu His Gln Val
805 810 815 Leu Arg Trp Ala
Leu Gly Ser Val Glu Ile Phe Met Ser Arg His Cys 820
825 830 Pro Leu Arg Tyr Ala Tyr Gly Gly Arg
Leu Lys Trp Leu Glu Arg Phe 835 840
845 Ala Tyr Thr Asn Thr Ile Val Tyr Pro Phe Thr Ser Ile Pro
Leu Leu 850 855 860
Ala Tyr Cys Thr Ile Pro Ala Val Cys Leu Leu Thr Gly Lys Phe Ile865
870 875 880 Ile Pro Thr Leu Asn
Asn Leu Ala Ser Ile Trp Phe Ile Ala Leu Phe 885
890 895 Leu Ser Ile Ile Ala Thr Ser Val Leu Glu
Leu Arg Trp Ser Gly Val 900 905
910 Ser Ile Glu Asp Trp Trp Arg Asn Glu Gln Phe Trp Val Ile Gly
Gly 915 920 925 Val
Ser Ala His Leu Phe Ala Val Phe Gln Gly Phe Leu Lys Val Leu 930
935 940 Gly Gly Val Asp Thr Ser
Phe Thr Val Thr Ser Lys Ala Ala Gly Asp945 950
955 960 Glu Ala Asp Ala Phe Gly Asp Leu Tyr Leu Phe
Lys Trp Thr Thr Leu 965 970
975 Leu Val Pro Pro Thr Thr Leu Ile Ile Ile Asn Met Val Gly Ile Val
980 985 990 Ala Gly Val
Ser Asp Ala Val Asn Asn Gly Tyr Gly Ser Trp Gly Pro 995
1000 1005 Leu Phe Gly Lys Leu Phe Phe Ser
Phe Trp Val Ile Val His Leu Tyr 1010 1015
1020 Pro Phe Leu Lys Gly Leu Met Gly Arg Gln Asn Arg Thr
Pro Thr Ile1025 1030 1035
1040Val Val Leu Trp Ser Ile Leu Leu Ala Ser Ile Phe Ser Leu Val Trp
1045 1050 1055 Val Arg Ile Asp
Pro Phe Ile Pro Lys Ala Lys Gly Pro Ile Leu Lys 1060
1065 1070 Pro Cys Gly Val Glu Cys 1075
273231DNAZea mays 27ccacgcgtcc gggaggggcc atgatggagt cggcggcggc
ccagtcctgc gcggcgtgcg 60gggacgacgc gcgcgctgcc tgccgcgcgt gcagctacgc
gctctgcagg gcgtgcctcg 120acgaggacgc cgccgagggc cgcaccacat gcgcgcgctg
cggaggggac tacgccgcta 180tcaacccagc gcgcgccagc gagggaaccg aggcggagga
ggaggtggtg gagaaccacc 240acaccgccgg tggcctgcgt gagagggtca ccatgggcag
ccacctcaat gatcgccagg 300atgaagtaag ccacgccagg accatgagca gcttgtcggg
aattggtagt gaattgaatg 360atgaatctgg taagcccatc tggaagaaca gggtggagag
ttggaaggaa aagaagaatg 420agaagaaagc ctcggccaaa aagactgcag ctaaagcaca
gcctccgcct gtcgaagaac 480agatcatgga tgaaaaagac ttgacagatg catatgagcc
actctcccgg gtcatcccaa 540tatcaaagaa caagctcaca ccttacagag cagtgatcat
tatgcggtta attgttcttg 600ggctcttctt tcactaccgt atcaccaatc ctgttaacag
tgcctttggt ctctggatga 660catcagttat atgtgagatc tggtttggtt tctcctggat
attggatcaa ttcccgaagt 720ggtatcctat caatcgtgag acttatgttg ataggctgat
tgcacgatat ggagatggtg 780aagaatctgg gttagcacct gtagatttct ttgtcagtac
agtggatcca ttgaaagagc 840ctccactaat cactgcaaac actgtgctgt ctattcttgc
tgtggactat cccgttgaga 900agatctcatg ctatgtatct gatgatggtt ctgctatgct
cacatttgaa tcgctcgcag 960agactgcaga atatgctaga aagtgggtgc cgttttgcaa
gaagtacgcc attgagccac 1020gagctcctga gttctacttc tcacagaaaa ttgactactt
gaaggacaag atacacccat 1080cttttgtcaa ggagcgtagg gctatgaaga gagactatga
agagtacaag gtgaggataa 1140atgctttggt tgccaaggct caaaagacac ctgatgaagg
ctggatcatg caagacggta 1200caccatggcc tgggaacaat cctcgtgacc accctggcat
gatccaggtt ttcctgggtg 1260agactggtgc acgggacttt gatggaaatg aacttcctcg
gttagtgtat gtgtcaagag 1320agaaaagacc aggctaccaa caccacaaga aggcaggggc
tatgaatgct ctggtccgag 1380tgtctgctgt tctgacaaat gccccttaca ttcttaatct
tgattgtgat cactatgtta 1440acaacagcaa agctgttcgt gaagcaatgt gcttcatgat
ggaccctact gttggcagag 1500atgtctgcta tgtacaattc ccccagaggt tcgatggcat
tgatcgcagt gatcgatatg 1560ccaataggaa cgttgtgttc tttgatgtta atatgaaagg
acttgatggc ctccaaggcc 1620cagtttatgt gggaactggt tgttgtttca ataggcaagc
actttatggt tatgggcctc 1680catctctgcc cgcacttcca aagtcttcga tttgttcctg
gtgttgctgc tgctgtccca 1740agaaaaaggt tgaaagaagt gagagggaaa tcaacagaga
ctctcggcga gaagacctcg 1800agtctgccat ttttaacctt cgcgaaattg acaactacga
tgagtacgag aggtccatgc 1860tcatctctca gatgagcttc gagaagtctt ttgggctgtc
ctcggtcttt attgaatcga 1920cccttatgga gaatgggggc gtccctgaat ctgcaaaccc
atctacccta attaaagaag 1980ccattcatgt cattagctgt ggatatgaag agaaaactga
atggggaaaa gagattggct 2040ggatctatgg ttcagttaca gaggatattc tgactgggtt
taagatgcac tgccgtggct 2100ggagatccat ctactgcatg ccggtgagac ctgcattcaa
gggatcagcc ccaatcaatc 2160tttccgatcg tcttcaccaa gttctccggt gggctcttgt
ttctgtcgag atcttcttca 2220gtcggcactg cccgctgtgg tacggttacg gtggcggccg
tctgaaatgg ctccagaggc 2280tctcctacat caacaccatc gtgtacccgt tcacttctct
tcctctcgtt gcctactgtt 2340gcctgcctgc catttgcctg ctcacaggaa agttcattat
acctacgctg tccaacgctg 2400caacgatatg gtttcttggc ctcttcatgt ccatcatcgt
gacgagcgtg ttggagctgc 2460ggtggagtgg catcgggatc gaggactggt ggcgcaacga
gcagttctgg gtcatcggag 2520gcgtgtccgc gcacctgttc gccgtgttcc agggtatcct
caagatgatt gccgggctgg 2580acaccaactt cacggtcacg gcaaaggcca cggacgacac
tgagttcggg gagctgtacc 2640tgttcaagtg gacgacggtg ctgatcccgc ccacaagcat
cctggtgctg aacctggtgg 2700gcgtggtggc tgggttctcg gccgcgctca acagcggcta
cgagtcctgg ggcccgctct 2760tcggtaaggt gttcttcgcc atgtgggtga tcatgcacct
gtacccgttc ctcaagggtc 2820tcatgggccg ccagaaccgc acgccgacca tcgtggtgct
ctggtccgtc ctcctcgcct 2880ccgtcttctc cctcctgtgg gtcaagatcg acccattcgt
tggaggaacc gagaccgtca 2940acaccaacaa ctgcaacaca catctgctga ttcaccatcg
gtcagctgct gtcgtgccgc 3000ggcggacgtg tttctggtgt tgcaaacgtg ggttgcctgc
ctgatgcggg tctcctctgt 3060ctatctcgca tctgggcttt tgccccagga tctgaagcgg
gtggtgtagg ttagctttat 3120tttgcgtcca agtgttgatt gatgttgtct gtgttatgaa
aagttttggt ggtgaaacct 3180gaaatgttaa aattcggctc aattgtgaga aaaaaaaaaa
aaaaaaaaaa a 3231281007PRTZea mays 28Met Met Glu Ser Ala Ala
Ala Gln Ser Cys Ala Ala Cys Gly Asp Asp1 5
10 15 Ala Arg Ala Ala Cys Arg Ala Cys Ser Tyr Ala
Leu Cys Arg Ala Cys 20 25 30
Leu Asp Glu Asp Ala Ala Glu Gly Arg Thr Thr Cys Ala Arg Cys Gly
35 40 45 Gly Asp Tyr
Ala Ala Ile Asn Pro Ala Arg Ala Ser Glu Gly Thr Glu 50
55 60 Ala Glu Glu Glu Val Val Glu Asn
His His Thr Ala Gly Gly Leu Arg65 70 75
80 Glu Arg Val Thr Met Gly Ser His Leu Asn Asp Arg Gln
Asp Glu Val 85 90 95
Ser His Ala Arg Thr Met Ser Ser Leu Ser Gly Ile Gly Ser Glu Leu
100 105 110 Asn Asp Glu Ser Gly
Lys Pro Ile Trp Lys Asn Arg Val Glu Ser Trp 115
120 125 Lys Glu Lys Lys Asn Glu Lys Lys Ala
Ser Ala Lys Lys Thr Ala Ala 130 135
140 Lys Ala Gln Pro Pro Pro Val Glu Glu Gln Ile Met Asp
Glu Lys Asp145 150 155
160 Leu Thr Asp Ala Tyr Glu Pro Leu Ser Arg Val Ile Pro Ile Ser Lys
165 170 175 Asn Lys Leu Thr
Pro Tyr Arg Ala Val Ile Ile Met Arg Leu Ile Val 180
185 190 Leu Gly Leu Phe Phe His Tyr Arg Ile
Thr Asn Pro Val Asn Ser Ala 195 200
205 Phe Gly Leu Trp Met Thr Ser Val Ile Cys Glu Ile Trp Phe
Gly Phe 210 215 220
Ser Trp Ile Leu Asp Gln Phe Pro Lys Trp Tyr Pro Ile Asn Arg Glu225
230 235 240 Thr Tyr Val Asp Arg
Leu Ile Ala Arg Tyr Gly Asp Gly Glu Glu Ser 245
250 255 Gly Leu Ala Pro Val Asp Phe Phe Val Ser
Thr Val Asp Pro Leu Lys 260 265
270 Glu Pro Pro Leu Ile Thr Ala Asn Thr Val Leu Ser Ile Leu Ala
Val 275 280 285 Asp
Tyr Pro Val Glu Lys Ile Ser Cys Tyr Val Ser Asp Asp Gly Ser 290
295 300 Ala Met Leu Thr Phe Glu
Ser Leu Ala Glu Thr Ala Glu Tyr Ala Arg305 310
315 320 Lys Trp Val Pro Phe Cys Lys Lys Tyr Ala Ile
Glu Pro Arg Ala Pro 325 330
335 Glu Phe Tyr Phe Ser Gln Lys Ile Asp Tyr Leu Lys Asp Lys Ile His
340 345 350 Pro Ser Phe
Val Lys Glu Arg Arg Ala Met Lys Arg Asp Tyr Glu Glu 355
360 365 Tyr Lys Val Arg Ile Asn Ala Leu
Val Ala Lys Ala Gln Lys Thr Pro 370 375
380 Asp Glu Gly Trp Ile Met Gln Asp Gly Thr Pro Trp Pro
Gly Asn Asn385 390 395
400 Pro Arg Asp His Pro Gly Met Ile Gln Val Phe Leu Gly Glu Thr Gly
405 410 415 Ala Arg Asp Phe
Asp Gly Asn Glu Leu Pro Arg Leu Val Tyr Val Ser 420
425 430 Arg Glu Lys Arg Pro Gly Tyr Gln His
His Lys Lys Ala Gly Ala Met 435 440
445 Asn Ala Leu Val Arg Val Ser Ala Val Leu Thr Asn Ala Pro
Tyr Ile 450 455 460
Leu Asn Leu Asp Cys Asp His Tyr Val Asn Asn Ser Lys Ala Val Arg465
470 475 480 Glu Ala Met Cys Phe
Met Met Asp Pro Thr Val Gly Arg Asp Val Cys 485
490 495 Tyr Val Gln Phe Pro Gln Arg Phe Asp Gly
Ile Asp Arg Ser Asp Arg 500 505
510 Tyr Ala Asn Arg Asn Val Val Phe Phe Asp Val Asn Met Lys Gly
Leu 515 520 525 Asp
Gly Leu Gln Gly Pro Val Tyr Val Gly Thr Gly Cys Cys Phe Asn 530
535 540 Arg Gln Ala Leu Tyr Gly
Tyr Gly Pro Pro Ser Leu Pro Ala Leu Pro545 550
555 560 Lys Ser Ser Ile Cys Ser Trp Cys Cys Cys Cys
Cys Pro Lys Lys Lys 565 570
575 Val Glu Arg Ser Glu Arg Glu Ile Asn Arg Asp Ser Arg Arg Glu Asp
580 585 590 Leu Glu Ser
Ala Ile Phe Asn Leu Arg Glu Ile Asp Asn Tyr Asp Glu 595
600 605 Tyr Glu Arg Ser Met Leu Ile Ser
Gln Met Ser Phe Glu Lys Ser Phe 610 615
620 Gly Leu Ser Ser Val Phe Ile Glu Ser Thr Leu Met Glu
Asn Gly Gly625 630 635
640 Val Pro Glu Ser Ala Asn Pro Ser Thr Leu Ile Lys Glu Ala Ile His
645 650 655 Val Ile Ser Cys
Gly Tyr Glu Glu Lys Thr Glu Trp Gly Lys Glu Ile 660
665 670 Gly Trp Ile Tyr Gly Ser Val Thr Glu
Asp Ile Leu Thr Gly Phe Lys 675 680
685 Met His Cys Arg Gly Trp Arg Ser Ile Tyr Cys Met Pro Val
Arg Pro 690 695 700
Ala Phe Lys Gly Ser Ala Pro Ile Asn Leu Ser Asp Arg Leu His Gln705
710 715 720 Val Leu Arg Trp Ala
Leu Val Ser Val Glu Ile Phe Phe Ser Arg His 725
730 735 Cys Pro Leu Trp Tyr Gly Tyr Gly Gly Gly
Arg Leu Lys Trp Leu Gln 740 745
750 Arg Leu Ser Tyr Ile Asn Thr Ile Val Tyr Pro Phe Thr Ser Leu
Pro 755 760 765 Leu
Val Ala Tyr Cys Cys Leu Pro Ala Ile Cys Leu Leu Thr Gly Lys 770
775 780 Phe Ile Ile Pro Thr Leu
Ser Asn Ala Ala Thr Ile Trp Phe Leu Gly785 790
795 800 Leu Phe Met Ser Ile Ile Val Thr Ser Val Leu
Glu Leu Arg Trp Ser 805 810
815 Gly Ile Gly Ile Glu Asp Trp Trp Arg Asn Glu Gln Phe Trp Val Ile
820 825 830 Gly Gly Val
Ser Ala His Leu Phe Ala Val Phe Gln Gly Ile Leu Lys 835
840 845 Met Ile Ala Gly Leu Asp Thr Asn
Phe Thr Val Thr Ala Lys Ala Thr 850 855
860 Asp Asp Thr Glu Phe Gly Glu Leu Tyr Leu Phe Lys Trp
Thr Thr Val865 870 875
880 Leu Ile Pro Pro Thr Ser Ile Leu Val Leu Asn Leu Val Gly Val Val
885 890 895 Ala Gly Phe Ser
Ala Ala Leu Asn Ser Gly Tyr Glu Ser Trp Gly Pro 900
905 910 Leu Phe Gly Lys Val Phe Phe Ala Met
Trp Val Ile Met His Leu Tyr 915 920
925 Pro Phe Leu Lys Gly Leu Met Gly Arg Gln Asn Arg Thr Pro
Thr Ile 930 935 940
Val Val Leu Trp Ser Val Leu Leu Ala Ser Val Phe Ser Leu Leu Trp945
950 955 960 Val Lys Ile Asp Pro
Phe Val Gly Gly Thr Glu Thr Val Asn Thr Asn 965
970 975 Asn Cys Asn Thr His Leu Leu Ile His His
Arg Ser Ala Ala Val Val 980 985
990 Pro Arg Arg Thr Cys Phe Trp Cys Cys Lys Arg Gly Leu Pro Ala
995 1000 1005 293028DNAZea
mays 29cacgagttca acatcgacga cgagaatcag cagaggcagc tggagggcaa catgcagaac
60agccagatca ccgaggcgat gctgcacggc aggatgagct acgggagggg ccccgacgac
120ggcgacggca acaacacccc gcagatcccg cccatcatca ccggctcccg ctccgtgccg
180gtgagcggtg agtttccgat taccaacggg tatggccacg gcgaggtctc gtcttccctg
240cacaagcgca tccatccgta ccctgtgtct gagccaggga gtgccaagtg ggacgagaag
300aaagaagtga gctggaagga gaggatggac gactggaagt ccaagcaggg catcctcggc
360ggcggcgccg atcccgaaga catggacgcc gacgtggcac tgaacgacga ggcgaggcag
420ccgctgtcga ggaaggtgtc gatcgcgtcg agcaaggtga acccgtaccg gatggtgatc
480gtggtgcgtc tcgttgtgct cgccttcttc ctccggtacc gtatcctgca ccccgtcccg
540gacgccatcg ggctgtggct cgtctccatc atctgcgaga tctggttcgc catctcctgg
600atcctcgacc agttccccaa gtggttcccc atcgaccgcg agacgtacct cgaccgcctc
660tccctcaggt acgagaggga aggggagccg tcgctgctgt cggcggtgga cctgttcgtg
720agcacggtgg acccgctcaa ggagccgccg ctggtgaccg ccaacaccgt gctctccatc
780ctcgccgtag actaccccgt ggacaaggtc tcctgctacg tctccgacga cggcgcgtcg
840atgctgacgt tcgagtcgct gtcggagacg gccgagttcg cgcgcaagtg ggtgcccttc
900tgcaagaagt tcggcatcga gccccgcgcc ccggagttct acttctcgct caaggtcgac
960tacctcaagg acaaggtgca gcccaccttc gtgcaggagc gccgcgccat gaagagagag
1020tatgaggagt tcaaggtccg gatcaacgcg ctggtggcca aggccatgaa ggtgccggca
1080gaggggtgga tcatgaagga cggcacgccg tggcccggga acaacacccg cgaccacccc
1140ggcatgatcc aggtgttcct gggccacagc ggcggccacg acaccgaggg caacgagctg
1200ccccgcctcg tgtacgtctc ccgtgagaag cgcccgggat tccagcacca caagaaggcc
1260ggcgccatga acgctctgat tcgcgtctcc gccgtgctga ccaacgcgcc attcatgctc
1320aacttggact gtgatcacta catcaacaac agcaaggcca tccgggaggc catgtgcttc
1380ctcatggacc ctcaggtcgg ccggaaggtc tgctacgttc agttcccgca gaggttcgac
1440ggcatcgacg tgcacgaccg atacgctaac aggaacaccg tcttcttcga catcaacatg
1500aaggggctgg acggcatcca aggcccggtg tacgtcggga cagggtgcgt gttccggcgc
1560caggcgctct acggctacaa ccctcccaag ggacccaaga ggcccaagat ggtgacctgc
1620gactgctgcc cgtgcttcgg ccgcaagaag cggaaacacg ccaaggacgg gctgccggag
1680ggcaccgctg atatgggagt agatagcgac aaggagatgc tcatgtccca catgaacttc
1740gagaagcggt tcgggcagtc cgcggcgttc gtcacgtcga cgctgatgga ggaaggcggc
1800gtccctcctt cgtcgagccc cgccgcgctc ctcaaggagg ccatccatgt catcagctgc
1860ggctacgagg acaagaccga ctgggggctg gagctggggt ggatctacgg gtcgatcacg
1920gaggacatcc tgacggggtt caagatgcac tgccgcgggt ggcgctccgt gtactgcatg
1980ccgaagcggg cggcgttcaa ggggtcggcg ccgatcaatc tatcggaccg tctcaaccag
2040gtgctccggt gggcgctggg gtccgtcgag atcttcttca gccggcacag ccccctgctg
2100tacggctaca agaacggcaa cctcaagtgg ctggagcgct tcgcctacat caacaccacc
2160atctacccct tcacctcgct cccgctgctc gcctactgca ccctccccgc cgtctgcctc
2220ctcaccggca agttcatcat gccgtcgatt agcacgttcg ccagcctctt cttcatcgcc
2280ctcttcatgt ccatcttcgc gacgggcatc ctggagatgc ggtggagcgg ggtgagcatc
2340gaggagtggt ggaggaacga gcagttctgg gtcatcggcg gcgtgtccgc gcatctcttc
2400gccgtcgtgc agggcctgct caaggtcctc gccgggatcg acaccaactt caccgtcacc
2460tccaaggcca ccggcgacga ggacgacgag ttcgccgagc tctacgcctt caagtggacc
2520acgctcctca tcccgcccac cacgctgctc atcattaacg tcatcggcgt cgtggccggc
2580atctccgacg ccatcaacaa cgggtaccag tcctgggggc ccctcttcgg caagctcttc
2640ttcgccttct gggtcatcgt ccacctctac ccgttcctca aggggctcat ggggcgccag
2700aacaggacgc ccaccgttgt tgtcatctgg tccattctgc tggcctccat cttctccctg
2760ctctgggtca ggatcgaccc tttcatcgtc aggaccaagg gcccggacgt caggcagtgt
2820ggcatcaatt gctgagctgt ttattaaggt tcaaaattct ggagcttgtg catagggaga
2880aaaaaacaat ttagaaattt tgtaaggttg ttgtgtctgt aatgttatgg tacccagaat
2940tgtcggacga ggaattgaac aaaggacaag gtttgattgt taaatggcaa aaaaaaaaaa
3000aaaaaaaaaa aaaaaaaaaa aaaaaaaa
302830927PRTZea mays 30Met Gln Asn Ser Gln Ile Thr Glu Ala Met Leu His
Gly Arg Met Ser1 5 10 15
Tyr Gly Arg Gly Pro Asp Asp Gly Asp Gly Asn Asn Thr Pro Gln Ile
20 25 30 Pro Pro Ile Ile
Thr Gly Ser Arg Ser Val Pro Val Ser Gly Glu Phe 35
40 45 Pro Ile Thr Asn Gly Tyr Gly His Gly
Glu Val Ser Ser Ser Leu His 50 55 60
Lys Arg Ile His Pro Tyr Pro Val Ser Glu Pro Gly Ser Ala
Lys Trp65 70 75 80
Asp Glu Lys Lys Glu Val Ser Trp Lys Glu Arg Met Asp Asp Trp Lys
85 90 95 Ser Lys Gln Gly Ile
Leu Gly Gly Gly Ala Asp Pro Glu Asp Met Asp 100
105 110 Ala Asp Val Ala Leu Asn Asp Glu Ala Arg
Gln Pro Leu Ser Arg Lys 115 120
125 Val Ser Ile Ala Ser Ser Lys Val Asn Pro Tyr Arg Met Val
Ile Val 130 135 140
Val Arg Leu Val Val Leu Ala Phe Phe Leu Arg Tyr Arg Ile Leu His145
150 155 160 Pro Val Pro Asp Ala
Ile Gly Leu Trp Leu Val Ser Ile Ile Cys Glu 165
170 175 Ile Trp Phe Ala Ile Ser Trp Ile Leu Asp
Gln Phe Pro Lys Trp Phe 180 185
190 Pro Ile Asp Arg Glu Thr Tyr Leu Asp Arg Leu Ser Leu Arg Tyr
Glu 195 200 205 Arg
Glu Gly Glu Pro Ser Leu Leu Ser Ala Val Asp Leu Phe Val Ser 210
215 220 Thr Val Asp Pro Leu Lys
Glu Pro Pro Leu Val Thr Ala Asn Thr Val225 230
235 240 Leu Ser Ile Leu Ala Val Asp Tyr Pro Val Asp
Lys Val Ser Cys Tyr 245 250
255 Val Ser Asp Asp Gly Ala Ser Met Leu Thr Phe Glu Ser Leu Ser Glu
260 265 270 Thr Ala Glu
Phe Ala Arg Lys Trp Val Pro Phe Cys Lys Lys Phe Gly 275
280 285 Ile Glu Pro Arg Ala Pro Glu Phe
Tyr Phe Ser Leu Lys Val Asp Tyr 290 295
300 Leu Lys Asp Lys Val Gln Pro Thr Phe Val Gln Glu Arg
Arg Ala Met305 310 315
320 Lys Arg Glu Tyr Glu Glu Phe Lys Val Arg Ile Asn Ala Leu Val Ala
325 330 335 Lys Ala Met Lys
Val Pro Ala Glu Gly Trp Ile Met Lys Asp Gly Thr 340
345 350 Pro Trp Pro Gly Asn Asn Thr Arg Asp
His Pro Gly Met Ile Gln Val 355 360
365 Phe Leu Gly His Ser Gly Gly His Asp Thr Glu Gly Asn Glu
Leu Pro 370 375 380
Arg Leu Val Tyr Val Ser Arg Glu Lys Arg Pro Gly Phe Gln His His385
390 395 400 Lys Lys Ala Gly Ala
Met Asn Ala Leu Ile Arg Val Ser Ala Val Leu 405
410 415 Thr Asn Ala Pro Phe Met Leu Asn Leu Asp
Cys Asp His Tyr Ile Asn 420 425
430 Asn Ser Lys Ala Ile Arg Glu Ala Met Cys Phe Leu Met Asp Pro
Gln 435 440 445 Val
Gly Arg Lys Val Cys Tyr Val Gln Phe Pro Gln Arg Phe Asp Gly 450
455 460 Ile Asp Val His Asp Arg
Tyr Ala Asn Arg Asn Thr Val Phe Phe Asp465 470
475 480 Ile Asn Met Lys Gly Leu Asp Gly Ile Gln Gly
Pro Val Tyr Val Gly 485 490
495 Thr Gly Cys Val Phe Arg Arg Gln Ala Leu Tyr Gly Tyr Asn Pro Pro
500 505 510 Lys Gly Pro
Lys Arg Pro Lys Met Val Thr Cys Asp Cys Cys Pro Cys 515
520 525 Phe Gly Arg Lys Lys Arg Lys His
Ala Lys Asp Gly Leu Pro Glu Gly 530 535
540 Thr Ala Asp Met Gly Val Asp Ser Asp Lys Glu Met Leu
Met Ser His545 550 555
560 Met Asn Phe Glu Lys Arg Phe Gly Gln Ser Ala Ala Phe Val Thr Ser
565 570 575 Thr Leu Met Glu
Glu Gly Gly Val Pro Pro Ser Ser Ser Pro Ala Ala 580
585 590 Leu Leu Lys Glu Ala Ile His Val Ile
Ser Cys Gly Tyr Glu Asp Lys 595 600
605 Thr Asp Trp Gly Leu Glu Leu Gly Trp Ile Tyr Gly Ser Ile
Thr Glu 610 615 620
Asp Ile Leu Thr Gly Phe Lys Met His Cys Arg Gly Trp Arg Ser Val625
630 635 640 Tyr Cys Met Pro Lys
Arg Ala Ala Phe Lys Gly Ser Ala Pro Ile Asn 645
650 655 Leu Ser Asp Arg Leu Asn Gln Val Leu Arg
Trp Ala Leu Gly Ser Val 660 665
670 Glu Ile Phe Phe Ser Arg His Ser Pro Leu Leu Tyr Gly Tyr Lys
Asn 675 680 685 Gly
Asn Leu Lys Trp Leu Glu Arg Phe Ala Tyr Ile Asn Thr Thr Ile 690
695 700 Tyr Pro Phe Thr Ser Leu
Pro Leu Leu Ala Tyr Cys Thr Leu Pro Ala705 710
715 720 Val Cys Leu Leu Thr Gly Lys Phe Ile Met Pro
Ser Ile Ser Thr Phe 725 730
735 Ala Ser Leu Phe Phe Ile Ala Leu Phe Met Ser Ile Phe Ala Thr Gly
740 745 750 Ile Leu Glu
Met Arg Trp Ser Gly Val Ser Ile Glu Glu Trp Trp Arg 755
760 765 Asn Glu Gln Phe Trp Val Ile Gly
Gly Val Ser Ala His Leu Phe Ala 770 775
780 Val Val Gln Gly Leu Leu Lys Val Leu Ala Gly Ile Asp
Thr Asn Phe785 790 795
800 Thr Val Thr Ser Lys Ala Thr Gly Asp Glu Asp Asp Glu Phe Ala Glu
805 810 815 Leu Tyr Ala Phe
Lys Trp Thr Thr Leu Leu Ile Pro Pro Thr Thr Leu 820
825 830 Leu Ile Ile Asn Val Ile Gly Val Val
Ala Gly Ile Ser Asp Ala Ile 835 840
845 Asn Asn Gly Tyr Gln Ser Trp Gly Pro Leu Phe Gly Lys Leu
Phe Phe 850 855 860
Ala Phe Trp Val Ile Val His Leu Tyr Pro Phe Leu Lys Gly Leu Met865
870 875 880 Gly Arg Gln Asn Arg
Thr Pro Thr Val Val Val Ile Trp Ser Ile Leu 885
890 895 Leu Ala Ser Ile Phe Ser Leu Leu Trp Val
Arg Ile Asp Pro Phe Ile 900 905
910 Val Arg Thr Lys Gly Pro Asp Val Arg Gln Cys Gly Ile Asn Cys
915 920 925
3136DNAArtificial SequenceSal-A20 oligonucleotide 31tcgacccacg cgtccgaaaa
aaaaaaaaaa aaaaaa 363228DNAArtificial
SequenceGSP1 forward primer 32tacgatgagt acgagaggtc catgctca
283326DNAArtificial SequenceGSP2 reverse primer
33ggcaaaagcc cagatgcgag atagac
263432DNAArtificial SequenceMu TIR primer 34agagaagcca acgccawcgc
ctcyatttcg tc 32359DNAZea mays
35tggcggccg
9369DNAZea mays 36tctgaaatg
9379DNAZea mays 37gcccacaag
9389DNAZea mays 38catcctggt
9399DNAZea mays 39gtgttcttc
9409DNAZea
mays 40gccatgtgg
9413568DNAZea maysmisc_feature3487n = A,T,C or G 41gtcgacccac
gcgtccggag ctcgtcgtca tccgccgcga tggcgagcca gggccgaagc 60ccatggacca
gcggaacggc caggtgtgcc agatttgcgg cgacgacgtg gggcgcaacc 120ccgacgggga
gcctttcgtg gcctgcaacg agtgcgcctt ccccatctgc cgggactgct 180acgagtacga
gcgccgcgag ggcacgcaga actgccccca gtgcaagacc cgcttcaagc 240gcttcaaggg
gtgcgcgcgc gtgcccgggg acgaggagga ggacggcgtc gacgacctgg 300agaacgagtt
caactggagc gacaagcacg actcccagta cctcgccgag tccatgctcc 360acgcccacat
gagctacggc cgcggcgccg acctcgacgg cgtgccgcag ccattccacc 420ccatccccaa
tgttcccctc ctcaccaacg gacagatggt cgatgacatc ccgccggacc 480agcacgccct
tgtgccctcg ttcgtgggtg gcggggggaa gaggattcac cctctcccgt 540acgcggatcc
caaccttcct gtgcaaccga ggtctatgga cccttccaag gatctcgccg 600catatggcta
cgggagcgta gcatggaagg agaggatgga gagctggaag cagaagcagg 660agaggatgca
ccagacgagg aacgatggcg gcggcgatga tggtgatgat gcagatctac 720cactaatgga
tgaagctaga cagccattgt ccagaaagat cccgcttcct tcaagccaaa 780tcaaccccta
taggatgatt ataataattc ggctagtggt tttgtgtttc ttcttccact 840accgagtgat
gcatccggtg cctgatgcat ttgctttatg gctcatatct gtgatctgtg 900aaatttggtt
tgccatgtct tggattcttg accagtttcc aaagtggttt cctatcgaga 960gggaaaccta
tcttgaccgg ctgagtttaa ggtttgacaa ggaagggcat ccttctcaac 1020tcgcccctgt
tgatttcttt gtcagtacgg ttgatccctt gaaggaacct ccattggtca 1080ctgctaatac
tgttctatct atcctttcgg tggattatcc agttgataag gtttcatgct 1140acgtttctga
tgatggtgct gccatgctga catttgaagc attgtctgaa acatctgaat 1200ttgcaaagaa
atgggttcct ttctgcaaaa gatatagcct tgagcctcgt gctccagagt 1260ggtacttcca
acagaagata gactacctga aagacaaggt ggcgccaaac tttgttagag 1320aacggagagc
aatgaagaga gagtatgagg aattcaaggt cagaatcaat gccttggttg 1380ctaaagccca
aaaggttcct gaggaaggat ggacaatgca ggatggaact ccatggcccg 1440gaaataatgt
ccgtgatcat cctggaatga ttcaggtttt ccttggtcaa agtggtggcc 1500atgatgtgga
aggaaatgag ctgcctcgat tggtttatgt ttcaagagaa aaacggccag 1560gctacaacca
tcacaagaag gctggtgcta tgaatgcatt ggtccgagtc tctgctgtac 1620taactaatgc
tccttatttg ctgaacttgg attgtgatca ctatatcaat aatagtaagg 1680ctataaagga
agcaatgtgt tttatgatgg atcctttgct tggaaagaaa gtttgctatg 1740tgcagtttcc
tcaaagattt gatgggattg atcgccatga tcgatatgct aacagaaatg 1800ttgtcttttt
cgatatcaac atgaaaggtt tggatggtat ccagggccca atttatgtgg 1860gtactggatg
tgtcttcaga aggcaggcat tatatggcta cgatgctccc aaaacaaaga 1920agccaccatc
aagaacttgc aactgctggc caaagtggtg catttgctgt tgctgttttg 1980gtaacaggaa
gaccaagaag aagaccaaga cctctaaacc taaatttgag aagataaaga 2040aactttttaa
gaaaaaggaa aatcaagccc ctgcatatgc tcttggtgaa attgatgaag 2100ccgctccagg
agctgaaaat gaaaaggcta gtattgtaaa tcaacagaag ttggaaaaga 2160aatttggcca
gtcttcagtt tttgttgcat ccacacttct tgagaatggt ggaaccctga 2220agagtgccag
tccagcttct cttctgaagg aagctataca tgtcatcagt tgtggatatg 2280aagacaaaac
aggctgggga aaagatattg gttggattta tggatcagtc acagaagata 2340ttcttactgg
gtttaagatg cactgccatg gttggcggtc aatttactgc atacctaaac 2400gggccgcctt
caaaggttcc gcacctctca atctttccga tcgttttcac caggttcttc 2460ggtgggctct
tggttcaatt gaaattttgt tcagcaacca ctgccctctc tggtatgggt 2520atggtggtgg
actaaagttc ctggaaaggt tttcgtacat taactccatc gtataccctt 2580ggacatctat
cccgctcttg gcctattgca cattgcctgc catctgcttg ctgacaggga 2640aatttatcac
gccagagctt aacaatgttg ccagcctctg gttcatgtca cttttcatct 2700gcatttttgc
tacgagcatc ctggaaatga gatggagtgg tgtaggcatc gatgactggt 2760ggagaaacga
gcagttttgg gtcattggag gcgtgtcttc acatctcttt gctgtgttcc 2820agggactcct
caaggtcata gctggtgtag acacgagctt cactgtgaca tccaagggcg 2880gagacgacga
ggagttctca gagctgtaca cattcaaatg gacgaccctt ctgatacctc 2940cgacaaccct
gctcctactg aacttcattg gagtggtagc tggcatctcc aatgcgatca 3000acaacggata
tgaatcatgg ggccccctgt tcgggaagct cttctttgca ttttgggtga 3060tcgtccatct
ttacccgttc ctcaagggtc tggttgggag gcagaacagg acgccaacga 3120ttgtcattgt
ctggtccatc ctcctggctt cgatcttctc gctgctttgg gtccggatcg 3180acccgttcct
tgcgaaggat gatggtcccc tgttggagga gtgtggtctg gattgcaact 3240aggaggtcag
cacgtggact tccccgtcag tgtgtggtcg aagaagtatt tttgcagatg 3300ttttgtgccc
atatttcttt actcaatttt tgtccctctg tagattgaaa caaggggtga 3360aggggaaaaa
aagtacttgt atttcttttg ttccatggtg gtggtggtgg tgggcggctc 3420agcctcgtga
gtgcaatatt gggcaaaccg gaggttgcgg caaccttgtg cagttcgtcc 3480acgaatntac
tagggatgat cgcgaccaat caatcaatcg atgaccgagt tcaattgttc 3540aaaaaaaaaa
aaaaaaaagg gcggccgc 3568421059PRTZea
mays 42Met Asp Gln Arg Asn Gly Gln Val Cys Gln Ile Cys Gly Asp Asp Val1
5 10 15 Gly Arg Asn
Pro Asp Gly Glu Pro Phe Val Ala Cys Asn Glu Cys Ala 20
25 30 Phe Pro Ile Cys Arg Asp Cys Tyr
Glu Tyr Glu Arg Arg Glu Gly Thr 35 40
45 Gln Asn Cys Pro Gln Cys Lys Thr Arg Phe Lys Arg Phe
Lys Gly Cys 50 55 60
Ala Arg Val Pro Gly Asp Glu Glu Glu Asp Gly Val Asp Asp Leu Glu65
70 75 80 Asn Glu Phe Asn Trp
Ser Asp Lys His Asp Ser Gln Tyr Leu Ala Glu 85
90 95 Ser Met Leu His Ala His Met Ser Tyr Gly
Arg Gly Ala Asp Leu Asp 100 105
110 Gly Val Pro Gln Pro Phe His Pro Ile Pro Asn Val Pro Leu Leu
Thr 115 120 125 Asn
Gly Gln Met Val Asp Asp Ile Pro Pro Asp Gln His Ala Leu Val 130
135 140 Pro Ser Phe Val Gly Gly
Gly Gly Lys Arg Ile His Pro Leu Pro Tyr145 150
155 160 Ala Asp Pro Asn Leu Pro Val Gln Pro Arg Ser
Met Asp Pro Ser Lys 165 170
175 Asp Leu Ala Ala Tyr Gly Tyr Gly Ser Val Ala Trp Lys Glu Arg Met
180 185 190 Glu Ser Trp
Lys Gln Lys Gln Glu Arg Met His Gln Thr Arg Asn Asp 195
200 205 Gly Gly Gly Asp Asp Gly Asp Asp
Ala Asp Leu Pro Leu Met Asp Glu 210 215
220 Ala Arg Gln Pro Leu Ser Arg Lys Ile Pro Leu Pro Ser
Ser Gln Ile225 230 235
240 Asn Pro Tyr Arg Met Ile Ile Ile Ile Arg Leu Val Val Leu Cys Phe
245 250 255 Phe Phe His Tyr
Arg Val Met His Pro Val Pro Asp Ala Phe Ala Leu 260
265 270 Trp Leu Ile Ser Val Ile Cys Glu Ile
Trp Phe Ala Met Ser Trp Ile 275 280
285 Leu Asp Gln Phe Pro Lys Trp Phe Pro Ile Glu Arg Glu Thr
Tyr Leu 290 295 300
Asp Arg Leu Ser Leu Arg Phe Asp Lys Glu Gly His Pro Ser Gln Leu305
310 315 320 Ala Pro Val Asp Phe
Phe Val Ser Thr Val Asp Pro Leu Lys Glu Pro 325
330 335 Pro Leu Val Thr Ala Asn Thr Val Leu Ser
Ile Leu Ser Val Asp Tyr 340 345
350 Pro Val Asp Lys Val Ser Cys Tyr Val Ser Asp Asp Gly Ala Ala
Met 355 360 365 Leu
Thr Phe Glu Ala Leu Ser Glu Thr Ser Glu Phe Ala Lys Lys Trp 370
375 380 Val Pro Phe Cys Lys Arg
Tyr Ser Leu Glu Pro Arg Ala Pro Glu Trp385 390
395 400 Tyr Phe Gln Gln Lys Ile Asp Tyr Leu Lys Asp
Lys Val Ala Pro Asn 405 410
415 Phe Val Arg Glu Arg Arg Ala Met Lys Arg Glu Tyr Glu Glu Phe Lys
420 425 430 Val Arg Ile
Asn Ala Leu Val Ala Lys Ala Gln Lys Val Pro Glu Glu 435
440 445 Gly Trp Thr Met Gln Asp Gly Thr
Pro Trp Pro Gly Asn Asn Val Arg 450 455
460 Asp His Pro Gly Met Ile Gln Val Phe Leu Gly Gln Ser
Gly Gly His465 470 475
480 Asp Val Glu Gly Asn Glu Leu Pro Arg Leu Val Tyr Val Ser Arg Glu
485 490 495 Lys Arg Pro Gly
Tyr Asn His His Lys Lys Ala Gly Ala Met Asn Ala 500
505 510 Leu Val Arg Val Ser Ala Val Leu Thr
Asn Ala Pro Tyr Leu Leu Asn 515 520
525 Leu Asp Cys Asp His Tyr Ile Asn Asn Ser Lys Ala Ile Lys
Glu Ala 530 535 540
Met Cys Phe Met Met Asp Pro Leu Leu Gly Lys Lys Val Cys Tyr Val545
550 555 560 Gln Phe Pro Gln Arg
Phe Asp Gly Ile Asp Arg His Asp Arg Tyr Ala 565
570 575 Asn Arg Asn Val Val Phe Phe Asp Ile Asn
Met Lys Gly Leu Asp Gly 580 585
590 Ile Gln Gly Pro Ile Tyr Val Gly Thr Gly Cys Val Phe Arg Arg
Gln 595 600 605 Ala
Leu Tyr Gly Tyr Asp Ala Pro Lys Thr Lys Lys Pro Pro Ser Arg 610
615 620 Thr Cys Asn Cys Trp Pro
Lys Trp Cys Ile Cys Cys Cys Cys Phe Gly625 630
635 640 Asn Arg Lys Thr Lys Lys Lys Thr Lys Thr Ser
Lys Pro Lys Phe Glu 645 650
655 Lys Ile Lys Lys Leu Phe Lys Lys Lys Glu Asn Gln Ala Pro Ala Tyr
660 665 670 Ala Leu Gly
Glu Ile Asp Glu Ala Ala Pro Gly Ala Glu Asn Glu Lys 675
680 685 Ala Ser Ile Val Asn Gln Gln Lys
Leu Glu Lys Lys Phe Gly Gln Ser 690 695
700 Ser Val Phe Val Ala Ser Thr Leu Leu Glu Asn Gly Gly
Thr Leu Lys705 710 715
720 Ser Ala Ser Pro Ala Ser Leu Leu Lys Glu Ala Ile His Val Ile Ser
725 730 735 Cys Gly Tyr Glu
Asp Lys Thr Gly Trp Gly Lys Asp Ile Gly Trp Ile 740
745 750 Tyr Gly Ser Val Thr Glu Asp Ile Leu
Thr Gly Phe Lys Met His Cys 755 760
765 His Gly Trp Arg Ser Ile Tyr Cys Ile Pro Lys Arg Ala Ala
Phe Lys 770 775 780
Gly Ser Ala Pro Leu Asn Leu Ser Asp Arg Phe His Gln Val Leu Arg785
790 795 800 Trp Ala Leu Gly Ser
Ile Glu Ile Leu Phe Ser Asn His Cys Pro Leu 805
810 815 Trp Tyr Gly Tyr Gly Gly Gly Leu Lys Phe
Leu Glu Arg Phe Ser Tyr 820 825
830 Ile Asn Ser Ile Val Tyr Pro Trp Thr Ser Ile Pro Leu Leu Ala
Tyr 835 840 845 Cys
Thr Leu Pro Ala Ile Cys Leu Leu Thr Gly Lys Phe Ile Thr Pro 850
855 860 Glu Leu Asn Asn Val Ala
Ser Leu Trp Phe Met Ser Leu Phe Ile Cys865 870
875 880 Ile Phe Ala Thr Ser Ile Leu Glu Met Arg Trp
Ser Gly Val Gly Ile 885 890
895 Asp Asp Trp Trp Arg Asn Glu Gln Phe Trp Val Ile Gly Gly Val Ser
900 905 910 Ser His Leu
Phe Ala Val Phe Gln Gly Leu Leu Lys Val Ile Ala Gly 915
920 925 Val Asp Thr Ser Phe Thr Val Thr
Ser Lys Gly Gly Asp Asp Glu Glu 930 935
940 Phe Ser Glu Leu Tyr Thr Phe Lys Trp Thr Thr Leu Leu
Ile Pro Pro945 950 955
960 Thr Thr Leu Leu Leu Leu Asn Phe Ile Gly Val Val Ala Gly Ile Ser
965 970 975 Asn Ala Ile Asn
Asn Gly Tyr Glu Ser Trp Gly Pro Leu Phe Gly Lys 980
985 990 Leu Phe Phe Ala Phe Trp Val Ile Val
His Leu Tyr Pro Phe Leu Lys 995 1000
1005 Gly Leu Val Gly Arg Gln Asn Arg Thr Pro Thr Ile Val Ile
Val Trp 1010 1015 1020
Ser Ile Leu Leu Ala Ser Ile Phe Ser Leu Leu Trp Val Arg Ile Asp1025
1030 1035 1040Pro Phe Leu Ala Lys
Asp Asp Gly Pro Leu Leu Glu Glu Cys Gly Leu 1045
1050 1055 Asp Cys Asn4325DNAArtificial
Sequenceamplicon 43atggaccagc ggaacggcca ggtgt
254425DNAArtificial Sequenceamplicon 44ctagttgcaa
tccagaccac actcc 25453725DNAZea
mays 45gcagcagcag caccaccact gcgcggcatt gcagcgagca agcgggaggg atctggggca
60tggtggcggt cgctgccgct gccgctcgga tctagagggc cgcacgggct gattgccctc
120cgccggcctc gtcggtgtcg gtggagtgtg aatcggtgtg tgtaggagga gcgcggagat
180ggcggccaac aaggggatgg tggcaggctc tcacaaccgc aacgagttcg tcatgatccg
240ccacgacggc gacgcgcctg tcccggctaa gcccacgaag agtgcgaatg ggcaggtctg
300ccagatttgt ggcgacactg ttggcgtttc agccactggt gatgtctttg ttgcctgcaa
360tgagtgtgcc ttccctgtct gccgcccttg ctatgagtac gagcgcaagg aagggaacca
420atgctgccct cagtgcaaga ctagatacaa gagacagaaa ggtagccctc gagttcatgg
480tgatgatgag gaggaagatg ttgatgacct ggacaatgaa ttcaactata agcaaggcaa
540tgggaagggc ccagagtggc agcttcaagg agatgacgct gatctgtctt catctgctcg
600ccatgaccca caccatcgga ttccacgcct tacaagtgga caacagatat ctggagagat
660ccctgatgca tcccctgacc gtcattctat ccgcagtcca acatcgagct atgttgatcc
720aagcgttcca gttcctgtga ggattgtgga cccctcgaag gacttgaatt cctatgggct
780taatagtgtt gactggaagg aaagagttga gagctggagg gttaaacagg acaaaaatat
840gttgcaagtg actaataaat atccagaggc tagaggagac atggagggga ctggctcaaa
900tggagaagat atgcaaatgg ttgatgatgc acgcctacct ttgagccgca ttgtgccaat
960ttcctcaaac cagctcaacc tttaccggat agtaatcatt ctccgtctta tcatcctgtg
1020cttcttcttc caatatcgta tcagtcatcc agtgcgtaat gcttatggat tgtggctagt
1080atctgttatc tgtgaggtct ggtttgcctt gtcctggctt ctagatcagt tcccaaaatg
1140gtatccaatc aaccgtgaga catatctcga caggcttgca ttgaggtatg atagagaggg
1200agagccatca cagctggctc ccattgatgt ctttgtcagt acagtggatc cattgaagga
1260acctccactg atcacagcca acactgtttt gtccattctt gctgtggatt accctgttga
1320caaagtgtca tgctatgttt ctgatgatgg ctcagctatg ctgacttttg agtctctctc
1380tgaaactgcc gaatttgcta gaaagtgggt tcccttttgt aagaagcaca atattgaacc
1440aagagctcca gaattttact ttgctcaaaa aatagattac ctgaaggaca aaattcaacc
1500ttcatttgtt aaggaaagac gagcaatgaa gagagagtat gaagaattca aaataagaat
1560caatgccctt gttgccaaag cacagaaagt gcctgaagag gggtggacca tggctgatgg
1620aactgcttgg cctgggaata accctaggga ccatcctggc atgattcagg tgttcttggg
1680gcacagtggt gggcttgaca ctgatggaaa tgaattacca cgtcttgtct atgtctctcg
1740tgaaaagaga ccaggctttc agcatcacaa gaaggctggt gcaatgaatg cactgattcg
1800tgtatctgct gtgctgacaa atggtgccta tcttctcaat gtggattgtg accattactt
1860caatagcagc aaagctctta gagaagcaat gtgcttcatg atggatccag ctctaggaag
1920gaaaacttgt tatgtacaat ttccacaaag atttgatggc attgacttgc acgatcgata
1980tgctaatagg aacatagtct tctttgatat caacatgaaa ggtctagatg gcattcaggg
2040tccagtctat gtgggaacag gatgctgttt caataggcag gctttgtatg gatatgatcc
2100tgttttgact gaagctgatc tggaacctaa cattgttgtt aagagctgct gtggtagaag
2160gaagagaaag aacaagagtt atatggatag tcaaagccgt attatgaaga gaacagaatc
2220ttcagctccc atctttaaca tggaagacat cgaggagggt attgaaggtt atgaggatga
2280aaggtcagtg cttatgtccc agaggaaatt ggagaaacgc tttggtcagt ctccaatctt
2340cattgcatcc acctttatga ctcaaggtgg cataccacct tcaacaaacc cagcttctct
2400actgaaggaa gctatccatg ttatcagctg tgggtacgag gacaaaactg aatggggaaa
2460agagattggc tggatctatg gttcagttac agaggatatt ctgactgggt ttaaaatgca
2520tgcaagaggc tggcaatcaa tctactgcat gccaccacga ccttgtttca agggttctgc
2580accaatcaat ctttctgatc gtcttaatca ggtgctccgt tgggctcttg ggtcagtgga
2640aattctgctt agcagacatt gtcctatatg gtatggctac aatgggcgat tgaagctttt
2700ggagaggctg gcttacatta acaccattgt ttatccaatc acatctgttc cgcttatcgc
2760ctattgtgtg cttcctgcta tctgtcttct taccaataaa tttatcattc ctgagattag
2820taattatgct ggaatgttct tcattcttct ttttgcctcc attttcgcaa ctggtatatt
2880ggagctcaga tggagtggtg ttggcattga agattggtgg agaaatgagc agttttgggt
2940tattggtggc acctctgccc atctcttcgc ggtgttccag ggtctgctga aagtgttggc
3000tgggattgat accaacttca cagttacctc aaaggcatct gatgaggatg gcgactttgc
3060tgagctatat gtgttcaagt ggaccagttt gctcatccct ccgaccactg ttcttgtcat
3120taacctggtc ggaatggtgg caggaatttc gtatgccatt aacagcggct accaatcctg
3180gggtccgctc tttggaaagc tgttcttctc gatctgggtg atcctccatc tctacccctt
3240cctcaagggt ctcatgggca ggcagaaccg cacgccaaca atcgtcatcg tttggtccat
3300cctccttgcg tctatcttct ccttgctgtg ggtgaagatc gatcctttca tctccccgac
3360acagaaagct gccgccttgg ggcaatgtgg tgtgaactgc tgatccagat tgtgactctt
3420atctgaagag gctcagccaa agatctgccc cctcgtgtaa atacctgagg gggctagatg
3480ggaatttttt gttgtagatg aggatggatc tgcatccaag ttatgcctct gtttattagc
3540ttcttcggtg ccggtgctgc tgcagacaat catggagcct ttctaccttg cttgtagtgc
3600tggccagcag cgtaaattgt gaattctgca tttttttata cgtggtgttt attgttttag
3660agtaaattat catttgtttg aggtaactat tcacacgaac tatatggcaa tgctgttatt
3720taaaa
3725461074PRTZea mays 46Met Ala Ala Asn Lys Gly Met Val Ala Gly Ser His
Asn Arg Asn Glu1 5 10 15
Phe Val Met Ile Arg His Asp Gly Asp Ala Pro Val Pro Ala Lys Pro
20 25 30 Thr Lys Ser Ala
Asn Gly Gln Val Cys Gln Ile Cys Gly Asp Thr Val 35
40 45 Gly Val Ser Ala Thr Gly Asp Val Phe
Val Ala Cys Asn Glu Cys Ala 50 55 60
Phe Pro Val Cys Arg Pro Cys Tyr Glu Tyr Glu Arg Lys Glu
Gly Asn65 70 75 80
Gln Cys Cys Pro Gln Cys Lys Thr Arg Tyr Lys Arg Gln Lys Gly Ser
85 90 95 Pro Arg Val His Gly
Asp Asp Glu Glu Glu Asp Val Asp Asp Leu Asp 100
105 110 Asn Glu Phe Asn Tyr Lys Gln Gly Asn Gly
Lys Gly Pro Glu Trp Gln 115 120
125 Leu Gln Gly Asp Asp Ala Asp Leu Ser Ser Ser Ala Arg His
Asp Pro 130 135 140
His His Arg Ile Pro Arg Leu Thr Ser Gly Gln Gln Ile Ser Gly Glu145
150 155 160 Ile Pro Asp Ala Ser
Pro Asp Arg His Ser Ile Arg Ser Pro Thr Ser 165
170 175 Ser Tyr Val Asp Pro Ser Val Pro Val Pro
Val Arg Ile Val Asp Pro 180 185
190 Ser Lys Asp Leu Asn Ser Tyr Gly Leu Asn Ser Val Asp Trp Lys
Glu 195 200 205 Arg
Val Glu Ser Trp Arg Val Lys Gln Asp Lys Asn Met Leu Gln Val 210
215 220 Thr Asn Lys Tyr Pro Glu
Ala Arg Gly Asp Met Glu Gly Thr Gly Ser225 230
235 240 Asn Gly Glu Asp Met Gln Met Val Asp Asp Ala
Arg Leu Pro Leu Ser 245 250
255 Arg Ile Val Pro Ile Ser Ser Asn Gln Leu Asn Leu Tyr Arg Ile Val
260 265 270 Ile Ile Leu
Arg Leu Ile Ile Leu Cys Phe Phe Phe Gln Tyr Arg Ile 275
280 285 Ser His Pro Val Arg Asn Ala Tyr
Gly Leu Trp Leu Val Ser Val Ile 290 295
300 Cys Glu Val Trp Phe Ala Leu Ser Trp Leu Leu Asp Gln
Phe Pro Lys305 310 315
320 Trp Tyr Pro Ile Asn Arg Glu Thr Tyr Leu Asp Arg Leu Ala Leu Arg
325 330 335 Tyr Asp Arg Glu
Gly Glu Pro Ser Gln Leu Ala Pro Ile Asp Val Phe 340
345 350 Val Ser Thr Val Asp Pro Leu Lys Glu
Pro Pro Leu Ile Thr Ala Asn 355 360
365 Thr Val Leu Ser Ile Leu Ala Val Asp Tyr Pro Val Asp Lys
Val Ser 370 375 380
Cys Tyr Val Ser Asp Asp Gly Ser Ala Met Leu Thr Phe Glu Ser Leu385
390 395 400 Ser Glu Thr Ala Glu
Phe Ala Arg Lys Trp Val Pro Phe Cys Lys Lys 405
410 415 His Asn Ile Glu Pro Arg Ala Pro Glu Phe
Tyr Phe Ala Gln Lys Ile 420 425
430 Asp Tyr Leu Lys Asp Lys Ile Gln Pro Ser Phe Val Lys Glu Arg
Arg 435 440 445 Ala
Met Lys Arg Glu Tyr Glu Glu Phe Lys Ile Arg Ile Asn Ala Leu 450
455 460 Val Ala Lys Ala Gln Lys
Val Pro Glu Glu Gly Trp Thr Met Ala Asp465 470
475 480 Gly Thr Ala Trp Pro Gly Asn Asn Pro Arg Asp
His Pro Gly Met Ile 485 490
495 Gln Val Phe Leu Gly His Ser Gly Gly Leu Asp Thr Asp Gly Asn Glu
500 505 510 Leu Pro Arg
Leu Val Tyr Val Ser Arg Glu Lys Arg Pro Gly Phe Gln 515
520 525 His His Lys Lys Ala Gly Ala Met
Asn Ala Leu Ile Arg Val Ser Ala 530 535
540 Val Leu Thr Asn Gly Ala Tyr Leu Leu Asn Val Asp Cys
Asp His Tyr545 550 555
560 Phe Asn Ser Ser Lys Ala Leu Arg Glu Ala Met Cys Phe Met Met Asp
565 570 575 Pro Ala Leu Gly
Arg Lys Thr Cys Tyr Val Gln Phe Pro Gln Arg Phe 580
585 590 Asp Gly Ile Asp Leu His Asp Arg Tyr
Ala Asn Arg Asn Ile Val Phe 595 600
605 Phe Asp Ile Asn Met Lys Gly Leu Asp Gly Ile Gln Gly Pro
Val Tyr 610 615 620
Val Gly Thr Gly Cys Cys Phe Asn Arg Gln Ala Leu Tyr Gly Tyr Asp625
630 635 640 Pro Val Leu Thr Glu
Ala Asp Leu Glu Pro Asn Ile Val Val Lys Ser 645
650 655 Cys Cys Gly Arg Arg Lys Arg Lys Asn Lys
Ser Tyr Met Asp Ser Gln 660 665
670 Ser Arg Ile Met Lys Arg Thr Glu Ser Ser Ala Pro Ile Phe Asn
Met 675 680 685 Glu
Asp Ile Glu Glu Gly Ile Glu Gly Tyr Glu Asp Glu Arg Ser Val 690
695 700 Leu Met Ser Gln Arg Lys
Leu Glu Lys Arg Phe Gly Gln Ser Pro Ile705 710
715 720 Phe Ile Ala Ser Thr Phe Met Thr Gln Gly Gly
Ile Pro Pro Ser Thr 725 730
735 Asn Pro Ala Ser Leu Leu Lys Glu Ala Ile His Val Ile Ser Cys Gly
740 745 750 Tyr Glu Asp
Lys Thr Glu Trp Gly Lys Glu Ile Gly Trp Ile Tyr Gly 755
760 765 Ser Val Thr Glu Asp Ile Leu Thr
Gly Phe Lys Met His Ala Arg Gly 770 775
780 Trp Gln Ser Ile Tyr Cys Met Pro Pro Arg Pro Cys Phe
Lys Gly Ser785 790 795
800 Ala Pro Ile Asn Leu Ser Asp Arg Leu Asn Gln Val Leu Arg Trp Ala
805 810 815 Leu Gly Ser Val
Glu Ile Leu Leu Ser Arg His Cys Pro Ile Trp Tyr 820
825 830 Gly Tyr Asn Gly Arg Leu Lys Leu Leu
Glu Arg Leu Ala Tyr Ile Asn 835 840
845 Thr Ile Val Tyr Pro Ile Thr Ser Val Pro Leu Ile Ala Tyr
Cys Val 850 855 860
Leu Pro Ala Ile Cys Leu Leu Thr Asn Lys Phe Ile Ile Pro Glu Ile865
870 875 880 Ser Asn Tyr Ala Gly
Met Phe Phe Ile Leu Leu Phe Ala Ser Ile Phe 885
890 895 Ala Thr Gly Ile Leu Glu Leu Arg Trp Ser
Gly Val Gly Ile Glu Asp 900 905
910 Trp Trp Arg Asn Glu Gln Phe Trp Val Ile Gly Gly Thr Ser Ala
His 915 920 925 Leu
Phe Ala Val Phe Gln Gly Leu Leu Lys Val Leu Ala Gly Ile Asp 930
935 940 Thr Asn Phe Thr Val Thr
Ser Lys Ala Ser Asp Glu Asp Gly Asp Phe945 950
955 960 Ala Glu Leu Tyr Val Phe Lys Trp Thr Ser Leu
Leu Ile Pro Pro Thr 965 970
975 Thr Val Leu Val Ile Asn Leu Val Gly Met Val Ala Gly Ile Ser Tyr
980 985 990 Ala Ile Asn
Ser Gly Tyr Gln Ser Trp Gly Pro Leu Phe Gly Lys Leu 995
1000 1005 Phe Phe Ser Ile Trp Val Ile Leu
His Leu Tyr Pro Phe Leu Lys Gly 1010 1015
1020 Leu Met Gly Arg Gln Asn Arg Thr Pro Thr Ile Val Ile
Val Trp Ser1025 1030 1035
1040Ile Leu Leu Ala Ser Ile Phe Ser Leu Leu Trp Val Lys Ile Asp Pro
1045 1050 1055 Phe Ile Ser Pro
Thr Gln Lys Ala Ala Ala Leu Gly Gln Cys Gly Val 1060
1065 1070 Asn Cys4725DNAArtificial
Sequenceamplicon 47atggcggcca acaaggggat ggtgg
254825DNAArtificial Sequenceamplicon 48tcagcagttc
acaccacatt gcccc 25493969DNAZea
mays 49cttctccctc gtcggtgcgg cgtggcgcgg ctcggcgttc ggtgagaaac cactcggggg
60atgaggatct gctgctagag tgagaggagc tacggtcagt atcctctgcc ttcgtcggcg
120gcggaagtgg aggggaggaa gcgatggagg cgagcgccgg gctggtggcc ggctcccaca
180accgcaacga gctcgtcgtc atccgccgcg acggcgatcc cgggccgaag ccgccgcggg
240agcagaacgg gcaggtgtgc cagatttgcg gcgacgacgt cggccttgcc cccggcgggg
300accccttcgt ggcgtgcaac gagtgcgcct tccccgtctg ccgggactgc tacgaatacg
360agcgccggga gggcacgcag aactgccccc agtgcaagac tcgatacaag cgcctcaagg
420gctgccaacg tgtgaccggt gacgaggagg aggacggcgt cgatgacctg gacaacgagt
480tcaactggga cggccatgac tcgcagtctg tggccgagtc catgctctac ggccacatga
540gctacggccg tggaggtgac cctaatggcg cgccacaagc tttccagctc aaccccaatg
600ttccactcct caccaacggg caaatggtgg atgacatccc accggagcag cacgcgctgg
660tgccttcttt catgggtggt gggggaaaga ggatacatcc ccttccttat gcggatccca
720gcttacctgt gcaacccagg tctatggacc catccaagga tcttgctgca tatgggtatg
780gtagtgttgc ttggaaggaa cggatggaga attggaagca gagacaagag aggatgcacc
840agacggggaa tgatggtggt ggtgatgatg gtgacgatgc tgatctacca ctaatggatg
900aagcaagaca acaactgtcc aggaaaattc cacttccatc aagccagatt aatccatata
960ggatgattat cattattcgg cttgtggttt tggggttctt cttccactac cgagtgatgc
1020atccggtgaa tgatgcattt gctttgtggc tcatatctgt tatctgtgaa atctggtttg
1080ccatgtcttg gattcttgat caattcccaa agtggttccc tattgagaga gagacttacc
1140tagaccggct gtcactgagg ttcgacaagg aaggccagcc atctcaactt gctccaattg
1200atttctttgt cagtacggtt gatcccttaa aggaacctcc tttggtcaca acaaatactg
1260ttctatctat cctttcggtg gattatcctg ttgataaggt ttcttgctat gtttctgatg
1320atggtgctgc aatgctaacg tttgaagcat tatctgaaac atctgaattt gcaaagaaat
1380gggttccttt ctgcaaacgg tacaatattg aacctcgcgc tccagagtgg tacttccaac
1440agaagataga ctacttgaaa gacaaggtgg cagcaaactt tgttagggag aggagagcaa
1500tgaagagaga gtatgaggaa ttcaaggtga gaatcaatgc cttagttgcc aaagcccaga
1560aagttcctga agaaggatgg acaatgcaag atggaacccc ctggcctgga aacaatgttc
1620gtgatcatcc tggaatgatt caggtcttcc ttggccaaag cggaggcctt gactgtgagg
1680gaaatgaact gccacgattg gtttatgttt ctagagagaa acgaccaggc tataaccatc
1740ataagaaagc tggtgctatg aatgcattgg tccgagtctc tgctgtacta acaaatgctc
1800catatttgtt aaacttggat tgtgatcact acatcaacaa cagcaaggct ataaaggaag
1860caatgtgttt tatgatggac cctttactag gaaagaaggt ttgctatgta cagttccctc
1920aaagatttga tgggattgat cgccatgacc gatatgctaa ccggaatgtt gtcttttttg
1980atatcaacat gaaaggtttg gatggtattc agggtccaat ttatgttggt actggatgtg
2040tatttagaag gcaggcatta tatggttatg atgcccccaa aacaaagaag ccaccatcaa
2100ggacttgcaa ctgctggccc aagtggtgct tttgctgttg ctgctttggc aataggaagc
2160aaaagaagac taccaaaccc aaaacagaga agaaaaagtt attatttttc aagaaagaag
2220agaaccaatc ccctgcatat gctcttggtg aaattgacga agctgctcca ggagctgaga
2280atgaaaaggc cggtattgta aatcaacaaa aattagaaaa gaaatttggc caatcttctg
2340tttttgttac atccacactt ctcgagaatg gtggaacctt gaagagtgca agtcctgctt
2400ctcttttgaa agaagctata catgtcatta gttgtggtta tgaagacaag acagactggg
2460gaaaagagat tggctggatc tatggatcag ttacagaaga tattctaact ggtttcaaga
2520tgcattgtca tggttggcgg tcaatttact gcatacctaa acgggttgca ttcaaaggtt
2580ctgcacctct gaatctttca gatcgtcttc accaggtgct tcggtgggct cttgggtcta
2640ttgagatctt cttcagcaat cattgccctc tttggtatgg gtatggtggc ggtctgaaat
2700ttttggaaag attttcctac atcaactcca tcgtgtatcc ttggacatct attcccctct
2760tggcttactg tacattgcct gccatctgtt tattgacagg gaaatttatc actccagagc
2820tgaataatgt tgccagcctg tggttcatgt cactttttat ctgcattttt gctacgagca
2880tcctagaaat gagatggagt ggtgttggaa ttgatgactg gtggaggaat gagcagttct
2940gggtcattgg aggtgtgtcc tcacacctct ttgctgtgtt ccagggactt ctcaaggtca
3000tagctggtgt tgatacaagc ttcaccgtga catcaaaggg tggagatgat gaggagttct
3060cagagctata tacattcaaa tggactacct tattgatacc tcctaccacc ttgcttctat
3120tgaacttcat tggtgtggtc gctggcgttt caaatgcgat caataacgga tatgagtcat
3180ggggccccct ctttgggaag ctattctttg cattttgggt gattgtccat ctttatccct
3240ttctcaaagg tttggttgga aggcaaaaca ggacaccaac gattgtcatc gtctggtcca
3300ttctgctggc ttcaatcttc tcgctccttt gggttcggat tgatcctttc cttgcgaagg
3360atgatggtcc gcttcttgag gagtgtggtt tggattgcaa ctaggatgtc agtgcatcag
3420ctcccccaat ctgcatatgc ttgaagtata ttttctggtg tttgtcccca tattcagtgt
3480ctgtagataa gagacatgaa atgtcccaag tttcttttga tccatggtga acctacttaa
3540tatctgagag atatactggg ggaaaatgga ggctgcggca atccttgtgc agttgggccg
3600tggaatacag catatgcaag tgtttgattg tgcagcattc tttattactt ggtcgcaata
3660tagatgggct gagccgaaca gcaaggtatt ttgattctgc actgctcccg tgtacaaact
3720tggttctcaa taaggcaggc aggaatgcat ctgccagtgg aacagagcaa cctgcacatt
3780atttatgtat gcctgttcat tggagggctt gttcattaca tgttcgtcta tactagaaaa
3840aacagaatat tagcattaat ctatagttaa ttaaagtatg taaatgcgcc tgttttttgt
3900tgtgtactgt aatcatctga gttggttttg tgaaaaaaaa aaaaaaaaaa aaaaaaaaaa
3960aaaaaaaaa
3969501086PRTZea mays 50Met Glu Ala Ser Ala Gly Leu Val Ala Gly Ser His
Asn Arg Asn Glu1 5 10 15
Leu Val Val Ile Arg Arg Asp Gly Asp Pro Gly Pro Lys Pro Pro Arg
20 25 30 Glu Gln Asn Gly
Gln Val Cys Gln Ile Cys Gly Asp Asp Val Gly Leu 35
40 45 Ala Pro Gly Gly Asp Pro Phe Val Ala
Cys Asn Glu Cys Ala Phe Pro 50 55 60
Val Cys Arg Asp Cys Tyr Glu Tyr Glu Arg Arg Glu Gly Thr
Gln Asn65 70 75 80
Cys Pro Gln Cys Lys Thr Arg Tyr Lys Arg Leu Lys Gly Cys Gln Arg
85 90 95 Val Thr Gly Asp Glu
Glu Glu Asp Gly Val Asp Asp Leu Asp Asn Glu 100
105 110 Phe Asn Trp Asp Gly His Asp Ser Gln Ser
Val Ala Glu Ser Met Leu 115 120
125 Tyr Gly His Met Ser Tyr Gly Arg Gly Gly Asp Pro Asn Gly
Ala Pro 130 135 140
Gln Ala Phe Gln Leu Asn Pro Asn Val Pro Leu Leu Thr Asn Gly Gln145
150 155 160 Met Val Asp Asp Ile
Pro Pro Glu Gln His Ala Leu Val Pro Ser Phe 165
170 175 Met Gly Gly Gly Gly Lys Arg Ile His Pro
Leu Pro Tyr Ala Asp Pro 180 185
190 Ser Leu Pro Val Gln Pro Arg Ser Met Asp Pro Ser Lys Asp Leu
Ala 195 200 205 Ala
Tyr Gly Tyr Gly Ser Val Ala Trp Lys Glu Arg Met Glu Asn Trp 210
215 220 Lys Gln Arg Gln Glu Arg
Met His Gln Thr Gly Asn Asp Gly Gly Gly225 230
235 240 Asp Asp Gly Asp Asp Ala Asp Leu Pro Leu Met
Asp Glu Ala Arg Gln 245 250
255 Gln Leu Ser Arg Lys Ile Pro Leu Pro Ser Ser Gln Ile Asn Pro Tyr
260 265 270 Arg Met Ile
Ile Ile Ile Arg Leu Val Val Leu Gly Phe Phe Phe His 275
280 285 Tyr Arg Val Met His Pro Val Asn
Asp Ala Phe Ala Leu Trp Leu Ile 290 295
300 Ser Val Ile Cys Glu Ile Trp Phe Ala Met Ser Trp Ile
Leu Asp Gln305 310 315
320 Phe Pro Lys Trp Phe Pro Ile Glu Arg Glu Thr Tyr Leu Asp Arg Leu
325 330 335 Ser Leu Arg Phe
Asp Lys Glu Gly Gln Pro Ser Gln Leu Ala Pro Ile 340
345 350 Asp Phe Phe Val Ser Thr Val Asp Pro
Leu Lys Glu Pro Pro Leu Val 355 360
365 Thr Thr Asn Thr Val Leu Ser Ile Leu Ser Val Asp Tyr Pro
Val Asp 370 375 380
Lys Val Ser Cys Tyr Val Ser Asp Asp Gly Ala Ala Met Leu Thr Phe385
390 395 400 Glu Ala Leu Ser Glu
Thr Ser Glu Phe Ala Lys Lys Trp Val Pro Phe 405
410 415 Cys Lys Arg Tyr Asn Ile Glu Pro Arg Ala
Pro Glu Trp Tyr Phe Gln 420 425
430 Gln Lys Ile Asp Tyr Leu Lys Asp Lys Val Ala Ala Asn Phe Val
Arg 435 440 445 Glu
Arg Arg Ala Met Lys Arg Glu Tyr Glu Glu Phe Lys Val Arg Ile 450
455 460 Asn Ala Leu Val Ala Lys
Ala Gln Lys Val Pro Glu Glu Gly Trp Thr465 470
475 480 Met Gln Asp Gly Thr Pro Trp Pro Gly Asn Asn
Val Arg Asp His Pro 485 490
495 Gly Met Ile Gln Val Phe Leu Gly Gln Ser Gly Gly Leu Asp Cys Glu
500 505 510 Gly Asn Glu
Leu Pro Arg Leu Val Tyr Val Ser Arg Glu Lys Arg Pro 515
520 525 Gly Tyr Asn His His Lys Lys Ala
Gly Ala Met Asn Ala Leu Val Arg 530 535
540 Val Ser Ala Val Leu Thr Asn Ala Pro Tyr Leu Leu Asn
Leu Asp Cys545 550 555
560 Asp His Tyr Ile Asn Asn Ser Lys Ala Ile Lys Glu Ala Met Cys Phe
565 570 575 Met Met Asp Pro
Leu Leu Gly Lys Lys Val Cys Tyr Val Gln Phe Pro 580
585 590 Gln Arg Phe Asp Gly Ile Asp Arg His
Asp Arg Tyr Ala Asn Arg Asn 595 600
605 Val Val Phe Phe Asp Ile Asn Met Lys Gly Leu Asp Gly Ile
Gln Gly 610 615 620
Pro Ile Tyr Val Gly Thr Gly Cys Val Phe Arg Arg Gln Ala Leu Tyr625
630 635 640 Gly Tyr Asp Ala Pro
Lys Thr Lys Lys Pro Pro Ser Arg Thr Cys Asn 645
650 655 Cys Trp Pro Lys Trp Cys Phe Cys Cys Cys
Cys Phe Gly Asn Arg Lys 660 665
670 Gln Lys Lys Thr Thr Lys Pro Lys Thr Glu Lys Lys Lys Leu Leu
Phe 675 680 685 Phe
Lys Lys Glu Glu Asn Gln Ser Pro Ala Tyr Ala Leu Gly Glu Ile 690
695 700 Asp Glu Ala Ala Pro Gly
Ala Glu Asn Glu Lys Ala Gly Ile Val Asn705 710
715 720 Gln Gln Lys Leu Glu Lys Lys Phe Gly Gln Ser
Ser Val Phe Val Thr 725 730
735 Ser Thr Leu Leu Glu Asn Gly Gly Thr Leu Lys Ser Ala Ser Pro Ala
740 745 750 Ser Leu Leu
Lys Glu Ala Ile His Val Ile Ser Cys Gly Tyr Glu Asp 755
760 765 Lys Thr Asp Trp Gly Lys Glu Ile
Gly Trp Ile Tyr Gly Ser Val Thr 770 775
780 Glu Asp Ile Leu Thr Gly Phe Lys Met His Cys His Gly
Trp Arg Ser785 790 795
800 Ile Tyr Cys Ile Pro Lys Arg Val Ala Phe Lys Gly Ser Ala Pro Leu
805 810 815 Asn Leu Ser Asp
Arg Leu His Gln Val Leu Arg Trp Ala Leu Gly Ser 820
825 830 Ile Glu Ile Phe Phe Ser Asn His Cys
Pro Leu Trp Tyr Gly Tyr Gly 835 840
845 Gly Gly Leu Lys Phe Leu Glu Arg Phe Ser Tyr Ile Asn Ser
Ile Val 850 855 860
Tyr Pro Trp Thr Ser Ile Pro Leu Leu Ala Tyr Cys Thr Leu Pro Ala865
870 875 880 Ile Cys Leu Leu Thr
Gly Lys Phe Ile Thr Pro Glu Leu Asn Asn Val 885
890 895 Ala Ser Leu Trp Phe Met Ser Leu Phe Ile
Cys Ile Phe Ala Thr Ser 900 905
910 Ile Leu Glu Met Arg Trp Ser Gly Val Gly Ile Asp Asp Trp Trp
Arg 915 920 925 Asn
Glu Gln Phe Trp Val Ile Gly Gly Val Ser Ser His Leu Phe Ala 930
935 940 Val Phe Gln Gly Leu Leu
Lys Val Ile Ala Gly Val Asp Thr Ser Phe945 950
955 960 Thr Val Thr Ser Lys Gly Gly Asp Asp Glu Glu
Phe Ser Glu Leu Tyr 965 970
975 Thr Phe Lys Trp Thr Thr Leu Leu Ile Pro Pro Thr Thr Leu Leu Leu
980 985 990 Leu Asn Phe
Ile Gly Val Val Ala Gly Val Ser Asn Ala Ile Asn Asn 995
1000 1005 Gly Tyr Glu Ser Trp Gly Pro Leu
Phe Gly Lys Leu Phe Phe Ala Phe 1010 1015
1020 Trp Val Ile Val His Leu Tyr Pro Phe Leu Lys Gly Leu
Val Gly Arg1025 1030 1035
1040Gln Asn Arg Thr Pro Thr Ile Val Ile Val Trp Ser Ile Leu Leu Ala
1045 1050 1055 Ser Ile Phe Ser
Leu Leu Trp Val Arg Ile Asp Pro Phe Leu Ala Lys 1060
1065 1070 Asp Asp Gly Pro Leu Leu Glu Glu Cys
Gly Leu Asp Cys Asn 1075 1080 1085
5125DNAArtificial Sequenceamplicon 51atggaggcga gcgccgggct ggtgg
255225DNAArtificial Sequenceamplicon
52ctagttgcaa tccaaaccac actcc
25
User Contributions:
Comment about this patent or add new information about this topic: