Veltman
André Veltman, Culemborg NL
Patent application number | Description | Published |
---|---|---|
20100090618 | DIMMABLE LIGHTING SYSTEM - A lighting system for operation with a dimmer circuit comprising a triac connected to a load. The load comprises a driver circuit for supplying current to a light source comprising one or more LEDs, the current being determined at least in part by an adjusted setpoint value. The system further comprises a setpoint filter circuit for obtaining a dimmer setpoint value determined at least in part by a setting of the dimmer circuit, and for generating an adjusted setpoint value. The sensitivity of the adjusted setpoint value to changes in the dimmer setpoint value is low at low values of the dimmer setpoint value. | 04-15-2010 |
André Veltman, Culemborg NL
Patent application number | Description | Published |
---|---|---|
20090251059 | DIMMER TRIGGERING CIRCUIT, DIMMER SYSTEM AND DIMMABLE DEVICE - The invention relates to a dimmer triggering circuit ( | 10-08-2009 |
20100090618 | DIMMABLE LIGHTING SYSTEM - A lighting system for operation with a dimmer circuit comprising a triac connected to a load. The load comprises a driver circuit for supplying current to a light source comprising one or more LEDs, the current being determined at least in part by an adjusted setpoint value. The system further comprises a setpoint filter circuit for obtaining a dimmer setpoint value determined at least in part by a setting of the dimmer circuit, and for generating an adjusted setpoint value. The sensitivity of the adjusted setpoint value to changes in the dimmer setpoint value is low at low values of the dimmer setpoint value. | 04-15-2010 |
20140284105 | METHOD OF AND A DEVICE AND AN ELECTRONIC CONTROLLER FOR MITIGATING STICK-SLIP OSCILLATIONS IN BOREHOLE EQUIPMENT - A method for mitigating stick-slip oscillations in borehole equipment while drilling a borehole in an earth formation is described. The borehole equipment is modelled by a computational model for computer simulation. The model has elements representing a particular mechanical and physical behavior of the borehole equipment. In a simulated stick mode of the borehole equipment, physical quantities are loaded to the elements, which quantities represent an initial state of the borehole equipment prior to a transition from stick mode to slip mode. From a simulation of such transition, a time response of rotational speeds of a drive system and bottom hole assembly of the borehole equipment is recorded and a lower limit of the rotational speed of the drive system is determined for which the rotational driven speed of the bottom hole assembly is zero. | 09-25-2014 |
20150037169 | Determination method and a control method for a fluid displacement device, controller and system - The fluid flow of a fluid displacement device ( | 02-05-2015 |
20150097500 | STATOR RESISTANCE ESTIMATION FOR ELECTRIC MOTORS - A method of controlling an electric motor (motor) includes providing a processor having an associated memory storing a stator resistance (Rs) estimation (RSE) algorithm that is programmed to implement the RSE algorithm to execute steps including injecting a current waveform at an arbitrary frame of reference into the stator using a field-oriented-control (FOC) motor controller including an Id controller and an Iq controller, and measuring current and voltage values from the motor responsive to the injecting. The measured current and voltage values are then transformed into transformed current and voltage values in a d/q coordinate system. The transformed current and voltage values are low pass filtered to generate filtered d/q current and voltage values, and a value for Rs is estimated from the filtered d/q current and voltage values. The arbitrary frame of reference can be a time-varying frame of reference. | 04-09-2015 |
Dana Veltman, Reno, NV US
Patent application number | Description | Published |
---|---|---|
20150072751 | GAMING SYSTEM AND METHOD PROVIDING A SLOT GAME IN WHICH DIFFERENT SETS OF SYMBOLS ARE RANDOMLY ASSOCIATED WITH DIFFERENT SYMBOL DISPLAY AREAS AND USED TO DETERMINE AN OUTCOME - Various embodiments of the present disclosure provide a gaming system and method providing a slot game in which, for each play of the slot game, different sets of symbols are randomly associated with different symbol display areas and used to determine an outcome for that play of the slot game. Generally, for each play of the slot game, the gaming system does so by: (a) randomly associating each of a plurality of different sets of symbols with a different one of a plurality of different symbol display areas; (b) for each of the sets of symbols, randomly selecting one of the symbols of that set to determine an outcome for that play of the slot game; and (c) displaying the randomly selected symbols at the associated symbol display areas (i.e., displaying the determined outcome). | 03-12-2015 |
Hendrikus Markus Veltman, Tokyo JP
Patent application number | Description | Published |
---|---|---|
20110158318 | ENCODING DEVICE, ENCODING METHOD, DECODING DEVICE, AND DECODING METHOD - Continuous reproduction can be made possible. An encoding apparatus for executing an encoding process with an encoding system capable of at least B-pictures as pictures to be prediction-encoded comprises a timing calculation means for, anticipating that a plurality of encoded information created by performing the encoding process will be sequentially decoded on a decoding side, calculating output timing for results of decoding the encoded information, and a timing notification means for notifying the decoding side of the output timing calculated by the timing calculation means before a result of decoding corresponding encoded information is obtained. | 06-30-2011 |
Jerome J. Veltman, Racine, WI US
Katharina Veltman, Muenster DE
Patent application number | Description | Published |
---|---|---|
20140199402 | NOVEL COMPOUNDS FOR THE TREATMENT OF INFLAMMATORY BOWEL DISEASE - The present invention relates to a nucleic acid molecule of up to 150 nucleotides comprising consecutively from 5′ to 3′ (a) a first part whose sequence is between 50% and 100% complementary to the sequence AAAAGCUGGGUUGAGAGGGCGA; (b) a second part capable of forming a loop between the first and the third part; and (c) a third part comprising or consisting of the sequence AAAAGCUGGGUUGAGAGGGCGA; for use as a medicament. The present invention further relates to a nucleic acid molecule of up to 25 nucleotides comprising the sequence AAAAGCUGGGUUGAGAGGGCGA, for use as a medicament. In another aspect, the present invention relates to a composition comprising at least one mature miRNA selected from the group consisting of hsa-miR-320a, ptr-miR-320a, ppy-miR-320a, bta-miR-320, cfa-miR-320, mmu-miR-320, rno-miR-320, and mml-miR-320, and/or one or more mir-RNA precursor(s) thereof, for use as a medicament. | 07-17-2014 |
Mark Veltman, Tokyo JP
Patent application number | Description | Published |
---|---|---|
20110200096 | ENCODING APPARATUS AND THE METHOD - An encoding apparatus adds delay time information DTI indicating initial delay time i_d and delay time d of each group data to a position to be read prior to frame data by a decoding apparatus in the group data of encoding stream data DBI and transmits the same to the decoding apparatus | 08-18-2011 |
20110200117 | ENCODING APPARATUS AND THE METHOD - An encoding apparatus adds delay time information DTI indicating initial delay time i_d and delay time d of each group data to a position to be read prior to frame data by a decoding apparatus in the group data of encoding stream data DBI and transmits the same to the decoding apparatus | 08-18-2011 |
20110200118 | ENCODING APPARATUS AND THE METHOD - An encoding apparatus adds delay time information DTI indicating initial delay time i_d and delay time d of each group data to a position to be read prior to frame data by a decoding apparatus in the group data of encoding stream data DBI and transmits the same to the decoding apparatus | 08-18-2011 |
20110280320 | ENCODING APPARATUS AND THE METHOD - An encoding apparatus adds delay time information DTI indicating initial delay time i_d and delay time d of each group data to a position to be read prior to frame data by a decoding apparatus in the group data of encoding stream data DBI and transmits the same to the decoding apparatus | 11-17-2011 |
Markus Veltman, Stuttgart DE
Patent application number | Description | Published |
---|---|---|
20100118956 | METHOD AND DEVICE FOR EXTRACTING A MEAN LUMINANCE VARIANCE FROM A SEQUENCE OF VIDEO FRAMES - A method and a device for extracting a mean luminance value from a inter-coded frame is proposed, wherein the inter-coded frame is a part of a sequence of video frames, the method comprising: approximating DC coefficients for macro-blocks of the inter-coded frame based on DC coefficients of intra-coded macro-blocks surrounding reference blocks in a reference frame of the sequence, the reference blocks being pointed to by motion vectors of the macro-blocks of the inter-coded frame; and calculating the mean luminance value based on the approximated DC coefficients. | 05-13-2010 |
20100158122 | METHOD AND DEVICE FOR APPROXIMATING A DC COEFFICIENT OF A BLOCK OF PIXELS OF A FRAME - A method and a device for approximating a DC coefficient of a first block of pixels of a first frame are proposed. The method comprises: calculating a luminance DC average value based on DC coefficients of first frame's macro-blocks without an approximation error; and determining the DC coefficient of the first block based on the DC coefficient of a second block, wherein the second block is a part of a second frame, which is a reference frame of the first frame, the second block overlapping with a reference block of the first block and having the closest DC coefficient to the luminance DC average value. | 06-24-2010 |
Markus Hendriks Veltman, Tokyo JP
Patent application number | Description | Published |
---|---|---|
20100189130 | Data processing apparatus and method and encoding device - A data processing apparatus able to start decoding at a timing earlier than the conventional timing and able to reduce the storage capacity required for a storing means for storing the encoded data until a decoding side decodes the input encoded data in comparison with the conventional storage capacity, which apparatus selects frame data from frame data f( | 07-29-2010 |
Oene R. Veltman, Aalborg DK
Patent application number | Description | Published |
---|---|---|
20110212241 | MODIFIED AMYLASES, NUCLEIC ACIDS ENCODING THOSE AMYLASES AND USES THEREOF - This invention relates to nucleic acids encoding amylase polypeptides, the encoded polypeptides and uses thereof. The amylases of the present invention have been engineered to have more beneficial qualities. Specifically, the amylases of the current invention show an altered exo-specificity and/or thermostability. Some embodiments of the invention relate to said polypeptides and nucleic acids and their uses as non-maltogenic exoamylases in producing food products. | 09-01-2011 |
Oene Robert Veltman, Alborg DK
Patent application number | Description | Published |
---|---|---|
20080220414 | Method, Chip, Device and Integrated System for Detection Biological Particles - The present invention relates to a method, a chip, a device, and a system for detection of biological particles. The method of the invention typically comprises collecting the biological particles from a gaseous sample, contacting the biological particles with a first liquid reagent, extracting biological material from the collected biological particles, and analysing the biological material for the presence of a target nucleic acid sequence. | 09-11-2008 |
Peter Veltman, Nieuwerkerk A/d Ijssel NL
Patent application number | Description | Published |
---|---|---|
20110216299 | ELECTROSTATIC LENS STRUCTURE - An electrostatic lens comprising a first conductive plate with a first aperture, a second conductive plate with a second aperture, the second aperture being substantially aligned with the first aperture, a voltage supply for supplying a first voltage to the first conductive plate and a second voltage to the second conductive plate, the first voltage being lower than the second voltage, and an insulating structure for separating the first conductive plate from the second conductive plate. The insulating structure comprises a first portion in contact with the first conductive plate and a second portion in contact with the second conductive plate, the first portion having an overhanging portion and the second portion having an indented portion at an edge of the insulating structure, so that a gap is formed between the overhanging portion and the second conductive plate. | 09-08-2011 |
Peter Jan Marie Veltman, Kerk Avezaath NL
Patent application number | Description | Published |
---|---|---|
20140318080 | METHOD OF MANUFACTURING A SCREW CAP, AND A SCREW CAP FOR CLOSING A PRESERVING JAR - A screw cap and a method of manufacturing a screw cap for closing a preserving jar is provided. The screw cap has a weakening line, which can be broken by means of finger force applied thereto, by removing material from the cap at the intended location of the weakening line so as to obtain a slot. | 10-30-2014 |
Robertus Wilhelmus Veltman, Wijchen NL
Patent application number | Description | Published |
---|---|---|
20120320357 | CLAMPING DEVICE, ASSEMBLY AND LITHOGRAPHIC PROJECTION APPARATUS - A clamping device is constructed and arranged to clamp two parts together. The clamping device includes an aligner constructed and arranged to bring the two parts in an aligned position with respect to each other, a clamp constructed and arranged to maintain the two parts in the aligned position, a disconnect constructed and arranged to guide the two parts away from the aligned position to a disconnected position, and an actuator constructed and arranged to convert an electrical current to kinetic energy. The aligner, the clamp, and the disconnect are constructed and arranged to be driven by the actuator. | 12-20-2012 |
Rob Henk Veltman, Ct Nijmegen NL
Patent application number | Description | Published |
---|---|---|
20150017296 | METHOD AND APPARATUS FOR CONTROLLING THE ATMOSPHERE IN A SPACE FILLED WITH AGRICULTURAL OR HORTICULTURAL PRODUCTS - The invention relates to a method for controlling the atmosphere in a closable space filled with agricultural or horticultural products. The method comprises directly detecting the respiration of the agricultural or horticultural products and adjusting an oxygen content, a carbon dioxide content and/or a nitrogen content in the space subject to the detected respiration. The respiration is detected here periodically, in each case for a determined time, and the space is sealed off from external influences during detection of the respiration. A very good control is achieved by taking the actual respiration as starting point, and a highly reliable detection forms the basis of this control when the detection is performed periodically for some time in a completely isolated atmosphere. The invention also relates to an installation for performing the method, and to a closable space provided with such an installation. | 01-15-2015 |
Thomas Richard Veltman, Towson, MD US
Patent application number | Description | Published |
---|---|---|
20150226702 | RAPID SMALL VOLUME DETECTION OF BLOOD AMMONIA - A method for measuring ammonia in a blood sample may involve positioning the blood sample in proximity with an ammonia gas sensor, generating a current with the ammonia gas sensor in response to ammonia gas released from the blood sample, and measuring the current generated by the ammonia gas sensor, using a current measurement member coupled with the ammonia gas sensor. A device for measuring an ammonia level in a blood sample may include a blood sample containment member, an ammonia gas sensor coupled with the blood sample containment member, and a current measurement member coupled with the ammonia gas sensor. The method and device may be used to measure an ammonia level in a blood sample as small as one drop of blood, or approximately 0.05 mL of blood. | 08-13-2015 |