29th week of 2014 patent applcation highlights part 33 |
Patent application number | Title | Published |
20140199390 | CONTROLLED RELEASE PHARMACEUTICAL COMPOSITIONS COMPRISING A FUMARIC ACID ESTER - The present invention relates to controlled release pharmaceutical compositions comprising fumaric acid ester(s) as active substance(s). The compositions are suitable for use in the treatment of e.g. psoriasis or other hyperproliferative, inflammatory or autoimmune disorders and are designated to release the fumaric acid ester in a controlled manner so that local high concentrations of the active substance within the gastrointestinal tract upon oral administration can be avoided and, thereby, enabling a reduction in gastro-intestinal related side-effects. | 2014-07-17 |
20140199391 | METHODS OF INCREASING SOLUBILITY OF POORLY SOLUBLE COMPOUNDS AND METHODS OF MAKING AND USING FORMULATIONS OF SUCH COMPOUND - The subject invention relates to novel soluble forms of planar ring structured organic compounds including flavonoids, and their production. The invention also includes the use of these novel formulations of planar ring structured organic compounds in the preparation of formulations and products. The invention also relates to a wide variety of applications of the formulations of the invention. The subject invention includes novel soluble forms and various formulations of flavonoids. Further, the invention includes novel methods of manufacturing the flavonoid formulations. The invention also relates to a wide variety of applications of the flavonoid formulations. | 2014-07-17 |
20140199392 | CONTROLLED RELEASE PHARMACEUTICAL COMPOSITIONS COMPRISING A FUMARIC ACID ESTER - The present invention relates to controlled release pharmaceutical compositions comprising fumaric acid ester(s) as active substance(s). The compositions are suitable for use in the treatment of e.g. psoriasis or other hyperproliferative, inflammatory or autoimmune disorders and are designated to release the fumaric acid ester in a controlled manner so that local high concentrations of the active substance within the gastrointestinal tract upon oral administration can be avoided and, thereby, enabling a reduction in gastro-intestinal related side-effects. | 2014-07-17 |
20140199393 | CONTROLLED RELEASE PHARMACEUTICAL COMPOSITIONS COMPRISING A FUMARIC ACID ESTER - The present invention relates to controlled release pharmaceutical compositions comprising fumaric acid ester(s) as active substance(s). The compositions are suitable for use in the treatment of e.g. psoriasis or other hyperproliferative, inflammatory or autoimmune disorders and are designated to release the fumaric acid ester in a controlled manner so that local high concentrations of the active substance within the gastrointestinal tract upon oral administration can be avoided and, thereby, enabling a reduction in gastro-intestinal related side-effects. | 2014-07-17 |
20140199394 | CONTROLLED RELEASE HYDROCODONE - A solid oral controlled-release dosage form of hydrocodone is disclosed, the dosage form comprising an analgesically effective amount of hydrocodone or a pharmaceutically acceptable salt thereof, and controlled release material. | 2014-07-17 |
20140199395 | NOVEL FORMULATION OF MELOXICAM - The present invention relates to methods for producing particles of meloxicam using dry milling processes as well as compositions comprising meloxicam, medicaments produced using meloxicam in particulate form and/or compositions, and to methods of treatment of an animal, including man, using a therapeutically effective amount of meloxicam administered by way of said medicaments. | 2014-07-17 |
20140199396 | PROCESS FOR THE MANUFACTURE OF A POWDER CONTAINING LUTEIN - Process for the manufacture of a powder containing lutein, powder obtainable by said process and food composition containing said powder. | 2014-07-17 |
20140199397 | Benzoyl Peroxide Microparticle Process - The present invention relates to the manufacture of microparticle benzoyl peroxide. The process of the invention provides for an aqueous slurry of USP benzoyl peroxide, optionally containing additives, being processed via microfluidization technology. The process comprises forcing a slurry of benzoyl peroxide at high pressure through a narrow channel designed to produce high shear, thereby achieving primary particle size reduction in addition to de-agglomeration. | 2014-07-17 |
20140199398 | HIGH CAPACITY DIEKTOPIPERAZINE MICROPARTICLES AND METHODS - Disclosed herein are diketopiperazine microparticles having high capacity for adsorbing a drug or active agent. In particular, the diketopiperazine microparticle are formed using fumaryl diketopiperazine and can comprise a drug in large doses for the treatment of disease or disorders by pulmonary delivery via oral inhalation. | 2014-07-17 |
20140199399 | USE OF TGF-BETA ANTAGONISTS TO TREAT INFANTS AT RISK OF DEVELOPING BRONCHOPULMONARY DYSPLASIA - The disclosure relates to methods of treating an infant at risk of developing bronchopulmonary dysplasia, including premature infants, by administering a TGF-β antagonist during the perinatal period, including the prenatal period and/or the postnatal period. For administration during the prenatal period, the TGF-β antagonist can be administered either directly to the infant in utero, or indirectly by administration to the mother. | 2014-07-17 |
20140199400 | Active Agent Loaded Uniform, Rigid, Spherical, Nanoporous Calcium Phosphate Particles and Methods of Making and Using the Same - Uniform, rigid, spherical nanoporous calcium phosphate particles that define an internal space and an amount of active agent present in the internal space are provided. Also provided are topical delivery compositions that include the active agent loaded particles, as well as methods of making the particles and topical compositions. The particles and compositions thereof find use in a variety of different applications, including active agent delivery applications. | 2014-07-17 |
20140199401 | EXTENDED RELEASE PHARMACEUTICAL COMPOSITIONS OF FESOTERODINE - A stable extend release pharmaceutical composition is disclosed. The composition comprises particles of fesoterodine or salts thereof, one or more rate controlling polymers and one or more pharmaceutically acceptable excipients wherein at least 90% of the total amount of particles of fesoterodine or salts thereof by volume (D | 2014-07-17 |
20140199402 | NOVEL COMPOUNDS FOR THE TREATMENT OF INFLAMMATORY BOWEL DISEASE - The present invention relates to a nucleic acid molecule of up to 150 nucleotides comprising consecutively from 5′ to 3′ (a) a first part whose sequence is between 50% and 100% complementary to the sequence AAAAGCUGGGUUGAGAGGGCGA; (b) a second part capable of forming a loop between the first and the third part; and (c) a third part comprising or consisting of the sequence AAAAGCUGGGUUGAGAGGGCGA; for use as a medicament. The present invention further relates to a nucleic acid molecule of up to 25 nucleotides comprising the sequence AAAAGCUGGGUUGAGAGGGCGA, for use as a medicament. In another aspect, the present invention relates to a composition comprising at least one mature miRNA selected from the group consisting of hsa-miR-320a, ptr-miR-320a, ppy-miR-320a, bta-miR-320, cfa-miR-320, mmu-miR-320, rno-miR-320, and mml-miR-320, and/or one or more mir-RNA precursor(s) thereof, for use as a medicament. | 2014-07-17 |
20140199403 | METHODS OF TREATING PANCREATIC CANCER - Provided herein are methods for the treatment of metastatic pancreatic cancer comprising administration of a composition comprising nanoparticles comprising a taxane (such as paclitaxel) and a carrier protein in combination with gemcitabine. | 2014-07-17 |
20140199404 | METHOD FOR TREATING CANCER BASED ON LEVEL OF A NUCLEOSIDE TRANSPORTER - The present invention provides methods and compositions for treating cancer by administering a) a composition comprising nanoparticles that comprise paclitaxel and an albumin and b) a nucleoside analog (e.g., gemcitabine) based upon levels of a nucleoside transporter (e.g., hENT1). | 2014-07-17 |
20140199405 | METHOD FOR TREATING CANCER BASED ON MUTATION STATUS OF K-RAS - The present invention provides methods and compositions for treating cancer by administering a) a composition comprising nanoparticles that comprise paclitaxel and an albumin and/or b) a therapeutic agent (e.g., gemcitabine) based upon K-ras mutation status. | 2014-07-17 |
20140199406 | Coating Composition, Drug-Containing Particle, Solid Preparation and Method for Preparing Drug-Containing Particle - Provided are a drug-containing particle capable of suppressing dissolution of a drug in the oral cavity to suppress an unpleasant taste thereof and having excellent dissolution of the drug in the digestive tract after passing through the oral cavity; a method for preparing the drug-containing particle; a coating composition used for preparing the drug-containing particle; and a solid preparation having the drug-containing particle. More specifically, provided are a coating composition having 100 parts by weight of a cellulose-based enteric base and 50 parts by weight or less of a water-soluble cellulose ether; a drug-containing particle having a drug-containing core and a coat portion obtained by coating the core with the coating composition; a solid preparation having the drug-containing particle; and a method for preparing a drug-containing particle having a step of coating the drug-containing core with the coating composition. | 2014-07-17 |
20140199407 | PALLADIUM-RUTHENIUM-ZINC-ORGANO COMPLEXES AND METHODS FOR THEIR USE IN THE TREATMENT OF INFLAMMATORY DISEASES - The described invention provides organometallic complexes capable of spin transfer, comprising at least three different metals and the use of pharmaceutical compositions comprising such complexes in detoxification of reactive oxygen species in inflammatory conditions. | 2014-07-17 |
20140199408 | THERAPEUTIC STEM CELL NUTRIENT COMPOSITION AND USES THEREOF - The present invention relates to a composition and uses thereof for treatment of damaged tissue comprising at least one essential amino acid in L form and at least one essential lipid; wherein the composition is administered to a mammal suffering from severe tissue damage. The invention further relates to a composition and uses thereof comprising the mixture of one or more free L-amino acids in which the molar ratio of the free L-amino acids corresponds to the molar ratio of amino components in a mammalian tissue protein; and at least one essential lipid. | 2014-07-17 |
20140199409 | OXYGENATED DEMINERALIZED BONE MATRIX FOR BONE GROWTH - An improved composition for inducing bone growth is provided that is a mixture of DBM and a perfluorocarbon oxygen carrier. Injection/implantation of a composition of DBM and a perfluorocarbon results in enhancement of bone formation. | 2014-07-17 |
20140199410 | EDIBLE BROWN ALGAE EXTRACT WITH A LOW IODINE CONTENT - The invention relates to a brown algae extract containing less than 50 ppm of iodine and between 5 and 15%, and preferably between 8 and 10%, of polyphenols, said percentage of polyphenols being expressed as a chlorogenic acid equivalent in relation to the dry weight of the extract, the invention also relating to an oral absorption composition comprising such an extract, and to a method for preparing the extract according to the invention. | 2014-07-17 |
20140199411 | THERAPEUTIC AGENT FOR EMPHYSEMA AND COPD - The invention described herein relates to methods of treating emphysema and COPD with a GHK tripeptide. The invention further relates to methods of determining the state of the lungs using biomarkers described herein. | 2014-07-17 |
20140199412 | TREATING INFLAMMATION WITH A BINDING SYSTEM - The teachings provided herein generally relate to site-activated binding systems that selectively increase the bioactivity of phenolic compounds at target sites. More particularly, the systems taught here include a phenolic compound bound to a reactive oxygen species, wherein the phenolic compound and the reactive oxygen species react at a target area in the presence of an oxidoreductase enzyme. | 2014-07-17 |
20140199413 | MELATONIN AND AN ANTIMICROBIAL OR ANTIBACTERIAL AGENT FOR THE TREATMENT OF ACNE - The invention relates to formulations for topical use comprising an antiseborrheic agent and an antimicrobial and/or antibacterial agent for the treatment of inflammatory dermatoses. In particular said formulations comprise melatonin and an antimicrobial or antibacterial agent, can be used in the pharmaceutical, cosmetic/cosmeceutical or dermatological field and are particularly suitable for the treatment of acne and of the clinical symptoms associated thereto. | 2014-07-17 |
20140199414 | KRILL AND/OR MARINE EXTRACTS FOR PREVENTION AND/OR TREATMENT OF CARDIOVASCULAR DISEASES, ARTHRITIS, SKIN CANCER, DIABETES, PREMENSTRUAL SYNDROME AND TRANSDERMAL TRANSPORT - The present invention relates to a method of treatment and/or prevention of cardiovascular disease, rheumatoid arthritis, skin cancer, premenstrual syndrome, diabetes and transdermal transport enhancement. The method comprises the administration of a therapeutically effective amount of krill and/or marine oil to a patient. The present invention also relates to a composition for the treatment and/or prevention of these diseases. | 2014-07-17 |
20140199415 | PHARMACEUTICAL COMBINATION COMPRISING A CIP2A SILENCING AGENT FOR USE IN THE TREATMENT OF A HYPERPROLIFERATIVE DISORDER, PREFERABLY ONE WITH IMPAIRED P53 FUNCTION - The invention is based on a finding that silencing CIP2A (KI-AA1524) gene sensitizes cancer cells for apoptosis-inducing activity of certain small molecule chemotherapeutic agents. Thus, the invention is directed to a respective combination therapy, sensitization method and pharmaceutical compositions. The invention further relates to a method of selecting cancer therapy for a subject on the basis of CIP2A and p53 expression and/or protein activity in a sample obtained from said subject. | 2014-07-17 |
20140199416 | Mold and mildew stain removing solution - A solution having improved mold and mildew stain removing properties on hard surfaces, that is easier to handle (less corrosive and less malodorous) and that is environmentally friendly. The mold and mildew stain removing solution includes the following components: a surfactant selected from the group consisting of alcohol ethoxylates, alkyl sulfates, alkyl ether sulfates, alpha olefin sulfonates, alkyl phosphates, alkyl amidopropyl betaines, alkyl betaines, amphoacetates, amphoproprionates, amphosulfonates, amine oxides, alkanolamides, sulfosuccinates, and sultaines, a solvent, and at least one chelating agent. The solution may further comprise a hydrotrope, a diluent, a preservative, and/or a fungicide. The surfactant is preferably an alcohol ethoxylate. The hydrotrope is preferably lauramine oxide. The solvent is preferably a glycol ether. The chelating agents are preferably sodium gluconate and a solution of the trisodium salt of methyl glycine diacetic acid. | 2014-07-17 |
20140199417 | Antihistamines Combined with Dietary Supplements for Improved Health - The present invention provides combinations comprising a sedating antihistamine and selected indole-based natural products such as L-tryptophan, 5-hydroxytryptophan and melatonin, along with pharmaceutically acceptable calcium and magnesium salts and selected B vitamins. These combinations are useful in providing a medicament for improving sleep in mammals, especially humans. | 2014-07-17 |
20140199418 | HERPES TREATMENT - Herpes infections in hum an patients can be treated with injections of garlic juice. The garlic juice is produced by cutting, crushing, or otherwise damaging garlic cloves, and collecting the juice. This garlic juice is dissolved in a carrier solution, such as water or saline, and then injected into the patient. | 2014-07-17 |
20140199419 | COMPOSITION COMPRISING BANYAN TREE, LOTUS, AND CLOVER SERUM FRACTIONS (HYPERPIGMENTATION) - The present invention relates to compositions comprising banyan tree, lotus, and clover serum fractions. A method of improving the appearance of a hyperpigmented spot may comprise the step of applying a composition comprising an effective amount of banyan tree serum fraction, lotus serum fraction, and clover serum fraction to a hyperpigmented spot on a skin surface, wherein the composition is applied for a period of time sufficient to improve the appearance of the hyperpigmented spot. The method may include the step of identifying a hyperpigmented spot on a facial skin surface. Other methods as disclosed include a method for improving the appearance of post-inflammatory hyperpigmentation. | 2014-07-17 |
20140199420 | USES OF TOONA SINENSIS EXTRACT - The present invention is related to a | 2014-07-17 |
20140199421 | Botanical Composition and Methods of Manufacture and Use - A botanical composition and combinations thereof that include a leaf extract of | 2014-07-17 |
20140199422 | COMPOSITE CARRIER FRAME FOR PLASTIC INJECTION MOLDING - Methods and devices for forming a composite carrier frame assembly used in an injection molding process are described. Methods and devices described herein are well suited for insert molding multiple small pieces into a single injection molded part. The composite carrier frame assembly can include a number of insert attached thereto that are positioned in a pre-determined arrangement such during an injection molding process the inserts are molded in a molded part in the pre-determined arrangement. Each insert can include an anchor portion arranged to be molded in the single injection molded part and an exterior portion arranged to be positioned exterior to the single injection molded part. | 2014-07-17 |
20140199423 | FOOD FORMING APPARATUS WITH A FOOD FEED MEMBER - The present invention relates to a food-form-apparatus with: a rotating drum ( | 2014-07-17 |
20140199424 | EXTRUDER SCREW, EXTRUDER, AND METHOD FOR PRODUCING AN EXTRUDER SCREW - An extruder screw includes an extruder shaft and at least one extruder segment The extruder shaft has a prismatic mandrel having external teeth and a longitudinal mandrel axis. The extruder segment has internal teeth and a longitudinal internal-teeth axis and can be slid onto the mandrel, such that the extruder segment can be connected to the mandrel for rotation therewith. The internal teeth have a profile having a meshing profile and, in an inner area between the first and second end faces of the extruder segment, include a prismatic main profile that has a main cross-section. Furthermore, the internal teeth of the extruder segment have an edge profile adjacent to at least one end face of the extruder segment, which edge profile has a smaller edge cross-section than the main profile at least in the area of the meshing profile. | 2014-07-17 |
20140199425 | METHOD OF SEPARATING EXCESS LENS FORMING MATERIAL FROM A MOLDED OPHTHALMIC LENS, IN PARTICULAR A CONTACT LENS - There is described a method of separating excess lens forming material from a molded ophthalmic lens, in particular a contact lens. After polymerization and/or cross-linking of a lens forming material (P) within a mold cavity ( | 2014-07-17 |
20140199426 | IMPRINTING APPARATUS AND IMPRINTING METHOD USING THE SAME - Disclosed is an imprinting apparatus and imprinting method using the same that prevent a process of forming a pattern on a substrate from being affected by flatness of a stage. The imprinting apparatus comprises a chamber unit in which a process of forming a pattern on a substrate is carried out; a stage for supporting the substrate on which a resin layer is formed; an installing member positioned above the stage and having a mold member attached to transform the resin layer so as to form the pattern on the substrate; and a first spraying unit for spraying fluid to separate the substrate supported by the stage from the stage, wherein the installing member moves the mold member in the direction getting near to the substrate separated from the stage so that the mold member and the resin layer are brought into contact with each other. | 2014-07-17 |
20140199427 | Press - The invention relates to a press, a rotary press in particular, comprising a press housing in which several operating components of the press are arranged, further comprising power-related components, which provide the operating components with electric energy for the operation, and comprising control components which exchange control- and/or measurement signals with the operating components and control signals with the power-related components, characterised in that the power-related components are arranged separately from the control components in a power element box which can be arranged at option on or within the press housing, or outside of the press housing and separately from the same. | 2014-07-17 |
20140199428 | Apparatus, Systems and Methods for Manufacturing Food Products - Apparatus, systems and methods are disclosed for manufacturing slices of sausages that appear to have been cut from a conventional round sausage log at an angle. An illustrative embodiment provides a manufacturing process for making portions to be finished into angled pet treats comprising: (a) providing a ground mix of proteinaceous material, flavor enhancers and preservatives to a forming chamber comprising: a fixed base surface, a fixed top surface, and a movable intermediate section insertable between said base and top surfaces, said intermediate section having a plurality of die cavities that each have a central axis oblique to the surface of said intermediate plate, said top surface having a plurality of feeder holes that overlap at least partially with said die cavities, (b) filling said plurality of die cavities via said feeder holes with said foodstuff, thereby forming a plurality of portions in shapes and dimensions that generally correspond to the shapes and dimensions of said die cavities, (b) moving said intermediate section containing said plurality of portions out of said chamber, (c) forcibly ejecting said portions with a plurality of longitudinal elements that reciprocate in and out of said die cavities along said central axis, thereby forming angled pet treats. | 2014-07-17 |
20140199429 | METHOD FOR REDUCTION OF ENERGY INTAKE BY CONSUMING AN AERATED PRODUCT AT LEAST THREE TIMES A DAY - A method of facilitating compliance by individuals to low calorie diets, by ingestion of a pourable or spoonable aerated composition on at least 3 moments a day, e.g. as a snack. | 2014-07-17 |
20140199430 | FOOD PRODUCT AND METHOD OF USING SUCH FOR REDUCING DESIRE TO EAT AND USE IN A WEIGHT CONTROL SCHEME - A method for reducing, in an individual, the desire to eat a meal or a snack in between meals, by consuming by said individual, in between meals or as an adjunct to a meal, a portion of at least 50 ml and less than 150 ml, of a pourable or spoonable edible aerated composition having an overrun of at least 100%, which aerated composition contains less than 50 kcal/portion. | 2014-07-17 |
20140199431 | LIQUID TRANSITION NUTRITION FOR INFANTS - Liquid composition suitable for supporting the transition period wherein the infant changes from a diet consisting of breast milk or liquid infant formula to solid foods with a viscosity 20-150 mPas, containing a digestible carbohydrate fraction and an indigestible carbohydrate fraction with at least 50 wt. % soluble indigestible oligosaccharide with a degree of polymerisation (DP) between 2 and 100. | 2014-07-17 |
20140199432 | ALKALINE COMPOSITIONS - An alkaline sports drink that utilizes phosphate buffer to achieve a pH of 7.4 (+/−0.3) for the purpose of preventing dental caries, improving physical performance, and benefiting overall health, is disclosed. This beverage product is stable at an alkaline pH, which is beneficial for oral health and the use of phosphate buffer increases physical performance by increasing muscle oxygen availability. The product is beneficial to overall health by buffering harmful acidic metabolites and aiding in their excretion from the body. | 2014-07-17 |
20140199433 | POLYDIORGANOSILOXANE-ENCAPSULATED ACTIVE INGREDIENT, METHOD FOR THE PREPARATION THEREOF, AND CHEWING GUM COMPRISING SAME - Delayed release in chewing gum of an active ingredient, such as a sweetener or a food acid, is provided by encapsulating solid particles of the active ingredient in a polydiorganosiloxane. The resulting polydiorganosiloxane-encapsulated active ingredient includes a continuous phase with the polydiorganosiloxane and a disperse phase with the solid particles of the active ingredient. When incorporated into a chewing gum, the polydiorganosiloxane-encapsulated active ingredient provides a more delayed release than conventional poly(vinyl acetate)-encapsulated active ingredients. | 2014-07-17 |
20140199434 | BARLEY WITH LOW LEVELS OF HORDEINS - The present invention relates to methods of producing a food or malt-base beverage suitable for consumption by a subject with Coeliac's disease. In particular, the present invention relates to methods of producing a food or malt-based beverage with low levels of hordeins. Also provided are barley plants which produce grain that can be used in the methods of the invention. | 2014-07-17 |
20140199435 | NOVEL SOURDOUGH COMPOSITIONS AND METHODS FOR THEIR PREPARATION - The present invention provides new flavors based on the fermentation of specific combinations of plants or plants extracts with specific combinations of microbial strains. More specifically sourdough products are provided with tea leaves or fractions thereof and fermented with the combination of strains of acetic acid bacteria and yeast in order to provide the new flavors. | 2014-07-17 |
20140199436 | Method for Improving Viscosity, Solubility, and Particle Size of Milk Protein Concentrates - Disclosed is a method for decreasing viscosity, increasing solubility and decreasing particle size of milk proteins by admixing milk protein with at least one transglutaminase. | 2014-07-17 |
20140199437 | Micro-Fermentation of Cocoa - The present invention provides methods for micro-fermentation of cocoa allowing quality evaluation on a tree by tree basis. | 2014-07-17 |
20140199438 | METHOD OF SUPPLYING OXYGENATED WATER - A method of supplying oxygenated water is performed on a water tank, in which oxygenated water is received. The method lets the water tank supply a constant amount of the oxygenated water once, and then supply the water tank with water and pure oxygen to recover the dissolution ratio of oxygen of the oxygenated water in the water tank. The method may supply a constant amount of oxygenated water every time for the user to drink it up once. | 2014-07-17 |
20140199439 | COATED CALCIUM PARTICULATES FOR USE IN BEVERAGE PRODUCTS - Coated particulate material used to enable the incorporation of calcium materials in a beverage product (especially those having a low pH) preserved with sodium hexametaphosphate (SHMP) are disclosed. The particulates are made up of a substrate material, such as a calcium salt, such as calcium phosphate. The substrate material can, in preferred embodiments, be incorporated into a prill which utilizes a sterol as the prilling material. The substrate material, preferably in the form of a prill, is then coated with a phospholipid coating, such as hydrogenated phosphatidyl choline, such that the final coated particulate product includes from about 70% to about 200% (by weight of the substrate) of the phospholipid coating. Beverage compositions which include these coated particulates are also disclosed. | 2014-07-17 |
20140199440 | DISPOSABLE STRAINER FOR INFUSING TEA WITH A SQUEEZING SYSTEM - A disposable strainer for infusing tea has a rigid base with a fold line along which the base of the strainer is folded once infusion is complete, an easily deformable moisture-permeable infusion container, and a squeezing mechanism consisting of threads, the threads being laid over the surface of the moisture-permeable container of the strainer, and the squeezing mechanism allowing by threads drawing to squeeze the infused tea inside the strainer once the strainer is folded. | 2014-07-17 |
20140199441 | COFFEE POWDER WITH COATING LAYER - A coffee powder includes a plurality of particles which are obtained by grinding coffee beans from a coffee grinder and each particle of the coffee powder is coated by a coating layer. The coating layer is made by food-grad powder which is ground at low speed by a U-shaped grinder. The coating layer keeps air from the particles of the coffee powder so as to keep the freshness of the coffee powder. | 2014-07-17 |
20140199442 | CAPSULE PART FOR A COFFEE CAPSULE - A coffee capsule which contains a capsule part is configured to receive roasted and ground coffee and is suitable for preparing an espresso beverage using pressurized hot water in an espresso machine. The capsule part is a frustoconical plastics part with a conical side wall and an outwardly protruding peripheral flange integrally formed on the large frustoconical diameter. The peripheral flange has a peripheral external thickened portion. A tearable membrane is able to be welded onto an internal peripheral welding surface of the peripheral flange. A radially extending bellows is present between the welding surface and the peripheral external thickened portion. The bellows can be plastically and/or elastically deformed while maintaining a sealing effect with radial and axial tolerance compensation for a brewing chamber-closing device of the espresso machine. | 2014-07-17 |
20140199443 | METHOD AND A SYSTEM FOR MAKING A BEVERAGE, AND A BEVERAGE CARTRIDGE - The present invention provides a method of delivering a beverage comprising the steps of at least partially filling an extraction chamber with roasted ground coffee, passing an aqueous medium through the extraction chamber to form the beverage and discharging the beverage from the extraction chamber; wherein the roasted ground coffee has a dry Helos particle size distribution D50 of less than or equal to 200 microns; wherein the aqueous medium has a temperature of ° C. to 40° C.; and wherein the flow rate of the aqueous medium through the extraction chamber is 0.5 to 5 mls | 2014-07-17 |
20140199444 | LONG LIFE DOUGH PACKAGE - This invention relates to a packaging material for unbaked dough products which includes a container that is impermeable to water vapor transmission, a relative humidity control device in the container, dough, and a water permeable sheet forming a cover for the container wherein the relative humidity control device includes a water vapor permeable container containing a solidified humectant composition which further includes a humectant salt, water and carrier. | 2014-07-17 |
20140199445 | Apparatus and a Method for Processing and Cooking a Food Preparation - An apparatus ( | 2014-07-17 |
20140199446 | Split-Belt Conveyor Toaster - A conveyor toaster includes a housing with a split-conveyor extending through the housing to convey food items through a cooking chamber for cooking by infrared heating elements located above and below the conveyor. Electrical components are separated from the heating elements and cooled with ambient air. | 2014-07-17 |
20140199447 | SYSTEM AND METHOD FOR CONTINUOUSLY COATING CONFECTIONARY PRODUCT - Disclosed is a system for continuously coating individual pieces of confectionary product, the system including a product feed device, at least one drum coating arrangement configured to continuously receive the individual pieces of confectionary product from the product feed device, the drum coating arrangement including a first rotating drum rotatable about a first drum axis and a second rotating drum rotatable about a second drum axis, a first drum volume defined by the first rotating drum, and a second drum volume defined by the second rotating drum, the first drum volume being communicable with the second drum volume, wherein the drum coating arrangement is configured such that the confectionary product has a longer residence time in the second drum volume than the first drum volume. | 2014-07-17 |
20140199448 | DEVICE, SYSTEM AND METHOD FOR FOAMING PRODUCTS - Device and method for foaming products such as egg-white, ice cream and soft serve ice cream. The device may include a main tank for holding the product, pressure pump to pressurize gas in the main tank and gas tank to provide added gas to the main tank when needed. The product in the main tank is foamed due to the pressure of gas in the main tank and as a result its volume extends by 30% to 60%. A cooling unit may be added to cool the content of the main tank. | 2014-07-17 |
20140199449 | METHODS FOR EXTENDING THE SHELF LIFE OF PROCESSED CUCURBITA PEPO VEGETABLES - Methods for extending the shelf life of processed | 2014-07-17 |
20140199450 | FRUIT SHELF-LIFE EXTENSION - A method of maintaining freshly harvested fruit in a fresh condition includes treating freshly picked highly-hydrated fruit with a composition comprising a lower alkyl naphthalene at a rate of less than about 10 ppm. Another method includes treating freshly picked berries en route to market with a vapor of 1,4 DMN. | 2014-07-17 |
20140199451 | PRESERVING BAKED GOODS DURING STORAGE - The invention provides a method of preserving baked goods comprising placing the baked goods in package and inserting an absorber for hexanal into the package. | 2014-07-17 |
20140199452 | LIQUID FLOW CONTROL AND BEVERAGE PREPARATION APPARATUSES, METHODS AND SYSTEMS - Apparatuses, methods and systems for liquid flow control and beverage preparation are disclosed. The apparatuses, methods and systems of the present invention include liquid flow control and beverage preparation capsules, pods, cartridges, pouches, systems, and modules for controlling and directing flow streams of liquid through a beverage preparation process. The apparatuses, methods and systems of the present invention may be used in combination with or included as an integral assembly of any apparatus, method or system for liquid dispension. | 2014-07-17 |
20140199453 | METHOD AND SYSTEM FOR PROCESSING USED COOKING OIL - Methods and systems for processing used cooking oil to remove contaminates therefrom to produce recycled cooking oil are disclosed. The systems and methods may comprise a continuous flow of the used cooking oil therethrough. The methods and systems may comprise a first filter configured to remove solid contaminates of a first size from used cooking oil flowing therethrough, and a heating mechanism in communication with the first filter to heat the used cooking oil to at least about 120 degrees Fahrenheit. The methods and systems may further comprise a centrifuge mechanism in communication with the heating mechanism to remove solid contaminates and liquid contaminates from the heated used cooing oil. The methods and systems may also comprise a second filter in communication with the centrifuge mechanism that is configured to remove solid contaminates of a second size from the used cooking oil to produce processed recycled cooking oil. | 2014-07-17 |
20140199454 | Food Movement and Control Within a Container for Food Preparation - An apparatus and method for controlling the movement of a food product in a container is described. The apparatus can be cleanable, portable, and fully automated. It can include a main container for holding the food product and one or more other containers for holding a substance, such as liquid. The main container can be moved between the one or more other containers so that the food product is immersed in the substance (e.g., liquid) in the one or more other containers. Any of the containers can be heated to heat the food product. This movement of the main container can be used run fully automated cycles (e.g., sprouting, rinsing, soaking, cooking, cleaning, etc.) that do not require user interaction. | 2014-07-17 |
20140199455 | DRY STEAM OVENS - A method of cooking a food item includes supporting a food item having multiple cooking sites, providing a jet of dry steam from a steam nozzle, determining a targeted subset of the cooking sites, and dynamically moving the food item or the steam nozzle so that the jet of dry steam is directed onto the targeted subset of the cooking sites. | 2014-07-17 |
20140199456 | Apparatus, Systems and Methods for Manufacturing Food Products - Apparatus, systems and methods are disclosed for manufacturing slices of sausages that appear to have been cut from a conventional round sausage log at an angle. An illustrative embodiment provides a manufacturing process for making portions to be finished into angled pet treats comprising: (a) providing a ground mix of proteinaceous material, flavor enhancers and preservatives to a forming chamber comprising: a fixed base surface, a fixed top surface, and a movable intermediate section insertable between said base and top surfaces, said intermediate section having a plurality of die cavities that each have a central axis oblique to the surface of said intermediate plate, said top surface having a plurality of feeder holes that overlap at least partially with said die cavities, (b) filling said plurality of die cavities via said feeder holes with said foodstuff, thereby forming a plurality of portions in shapes and dimensions that generally correspond to the shapes and dimensions of said die cavities, (b) moving said intermediate section containing said plurality of portions out of said chamber, (c) forcibly ejecting said portions with a plurality of longitudinal elements that reciprocate in and out of said die cavities along said central axis, thereby forming angled pet treats. | 2014-07-17 |
20140199457 | ENERGY-EFFICIENT APPARATUS FOR MAKING CHEESE - An apparatus for making cheese including a whey conduit, a milk conduit, and a heat exchange device between the whey conduit and the milk conduit. Preferably, the heat exchange device includes a heat transfer circuit including a heat transfer conduit, heat transfer medium in the heat transfer conduit, a whey heat exchanger between the whey conduit and the heat transfer conduit, and a milk heat exchanger between the heat transfer conduit and the milk conduit. A thermal storage device can be in thermal contact with the heat exchange device to allow heat energy from the whey to be accumulated and stored for future use in heating incoming milk. The thermal storage device includes a thermal storage conduit, a thermal storage heat exchanger between the heat exchange device and the thermal storage conduit, thermal storage medium in the thermal storage conduit, and a thermal storage tank. | 2014-07-17 |
20140199458 | "Le Four en Brique" - The first brick oven designed for your oven - An apparatus and method to temporarily convert an oven into a brick oven comprising a dome with a ventilation aperture governed by a damper to control the accumulation of hot air within the dome, and a plate placed within the dome possessing a diameter less than the diameter dome to permit heat to rise up from within the oven into the dome. A handle is secured to the dome to facilitate handling of the dome. | 2014-07-17 |
20140199459 | Sandwich Making Appliance and Method of Making a Sandwich with the Same - A small cooking appliance comprises a bottom housing, a top housing, and a ring assembly. The bottom housing has a top surface that forms a bottom cooking surface of the appliance. The top housing has a bottom surface that forms a top cooking surface of the appliance. The top housing is movably attached to the bottom housing and moveable between a closed position and an open position. The ring assembly is positionable between the top and bottom cooking surfaces when the top housing is in its closed position. The ring assembly comprises a top ring, a bottom ring, and an optional center cooking plate. The center cooking plate is movable between (i) a closed position in which a space defined by the ring assembly is divided into top and bottom cooking cavities and (ii) an open position. | 2014-07-17 |
20140199460 | EDIBLE WATER-SOLUBLE FILM - Disclosed herein are water-soluble films and resulting packets including a water soluble film, wherein the water-soluble film includes a water-soluble mixture of polyvinyl alcohol, a compatibilizing agent, and a sugar alcohol plasticizer that is a solid at room temperature, wherein the water-soluble film is substantially transparent. | 2014-07-17 |
20140199461 | FUNCTIONAL SUGAR REPLACEMENT - The present invention is related to a functional food ingredient, which replaces sugar on a 1/1 weight and/or volume basis in food recipes containing sucrose, with a substantial caloric reduction in view. More than an ingredient, it has to be seen as a functional ingredient, since it possesses some health promoting effects. The functional food replacement for sucrose according to the present invention comprises prebiotic fibres and sweeteners, and possibly other non selective fibres, minerals, vitamins and probiotic strains. | 2014-07-17 |
20140199462 | Low Sodium Salt Composition - The present invention relates to a low sodium salt composition and the methods used to make it. The low sodium salt composition includes sodium chloride and a modified chloride salt composition. The modified chloride salt composition includes a homogenous amalgamation of chloride salt, food grade acidulant, and carrier, which does not contain sodium chloride. The modified chloride salt composition may be combined with sodium chloride to form a low sodium salt composition. The modified chloride salt composition may be enhanced to increase particle size. | 2014-07-17 |
20140199463 | METHOD FOR PRODUCING A SOLUBLE COCOA PRODUCT FROM COCOA POWDER - The present invention relates to a method for producing a soluble cocoa product from cocoa powder. The present invention further relates to cocoa products obtained by the present method and uses thereof. The present invention is also directed to a cocoa-derived material comprising a soluble cocoa powder and a cocoa extract, wherein said extract comprises more than 25 wt % based on the extract of polyphenols. The cocoa-derived material can be a syrup, a ready to use beverage or a powder composition. The invention also relates to uses of this cocoa-derived material for preparing carbonated beverages containing cocoa. The invention further relates to a carbonated beverage comprising said cocoa-derived material and to methods for preparing such cocoa-derived materials and beverages. The invention also provides an ice cream comprising a cocoa powder, and in particular to an ice cream comprising up to 15 wt % of a soluble cocoa powder, wherein said cocoa powder has a solubility in water of at least 50% at a temperature of less than 10° C. The invention further relates to a method for preparing such ice cream and the use thereof in food products. | 2014-07-17 |
20140199464 | Acerola Cherry Powder and A Method for Producing the Same - The present invention relates to a powder of acerola cherry fruit and a manufacturing method therefore. Said powder comprises at least 51-60 mass percent of acerola cherry-juice solids and 40-49 mass percent of oxidized starch. The manufacturing method comprises: preparing a concentrate of acerola cherry-juice, adding oxidized starch to the concentrate and spray-drying. | 2014-07-17 |
20140199465 | INJECTABLE LOW TEMPERATURE LIQUID CROP PRESERVATIVE FORMULATION - A liquid crop-preservative composition containing a volatile, liquid active ingredient suitable for effective crop-preservation in the vapor-phase. The crop-preservative composition is sufficiently non-viscous to be applied to crops or to a surface disassociated with said crops via one or more minute orifices. A suitable compatible lubricant and diluent may be incorporated in said composition. | 2014-07-17 |
20140199466 | PURIFICATION OF LUO HAN GUO EXTRACT - A method of purifying a Luo Han Guo extract includes contacting the Luo Han Guo extract with activated carbon and a macroporous polymeric adsorbent resin, an ion exchange resin, or both. | 2014-07-17 |
20140199467 | LIQUID FEED COMPRISED OF CORN STEEPWATER AND HYDROL - The application relates to a composition comprising: from about 10 parts to about 40 parts of hydrol and from about 60 parts to about 90 parts of steepwater by volume. | 2014-07-17 |
20140199468 | NANOFIBERS CONTAINING LATENT REACTIVE GROUPS - A nanofiber is formed by combining one or more natural or synthetic polymeric materials and one or more than one cross-linking agents having at least two latent reactive activatable groups. The latent reactive activatable nanofiber may be used to modify the surface of a substrate by activating at least one of the latent reactive activatable groups to bond the nanofiber to the surface by the formation of a covalent bond between the surface of the substrate and the latent reactive activatable group. Some of the remaining latent reactive activatable group(s) are left accessible on the surface of the substrate, and may be used for further surface modification of the substrate. Biologically active materials may be immobilized on the nanofiber modified surface by reacting with the latent reactive groups that are accessible on the surface of the substrate. | 2014-07-17 |
20140199469 | SUSTAINED-RELEASE TABLET AND PROCESS FOR PREPARING THE SAME - A method for producing a sustained-release tablet having improved stability and content uniformity is provided. The method involves first preparing a core tablet by granulating, drying, milling, blending, and compressing a mixture of active and inactive ingredients. Four coating layers are applied to the core tablet: an inner layer, an enteric coating layer, an active layer, and an outer layer. The active ingredient may be a tetracycline, such as doxycycline. A sustained-release tablet prepared according to the method is also described. | 2014-07-17 |
20140199470 | POLYMER COMPOSITION ON SUBSTRATE AND SURFACE MODIFICATION METHOD - Provided are a polymer composition on a substrate and a surface modification method which is non-selective to substrate materials. Chemical vapor deposition polymerization is used to deposit a maleimide-functionalized poly-p-xylylene coating on a substrate. The substrate is readily available to perform a thiol-maleimide coupling reaction under mild conditions so as to modify the surface thereof. Furthermore, through a tailored thiol-terminal molecule, a designer surface can be created via thiol-maleimide coupling on a substrate, and the resulting surface can exhibit various desired biological functions for biotechnological applications. Therefore, this modification technique can be applied to biological fields extensively. | 2014-07-17 |
20140199471 | METHOD FOR MANUFACTURING INSULATED WIRE AND MANUFACTURING APPARATUS OF THE SAME - There is provided a method for manufacturing an insulated wire, including at least: coating an outer periphery of a running wire with an insulation coating material discharged from a coating material discharging tank; baking the insulation coating material by an incinerator, the insulation coating material being used for coating the outer periphery of the running wire; and cooling the running wire by a cooling mechanism so that a temperature of the running wire before being coated with the insulation coating material, is a specific temperature, based on a temperature of the running wire detected by a temperature detector, wherein the coating, the baking, and the cooling are repeated. | 2014-07-17 |
20140199472 | EJECTION VOLUME CORRECTION METHOD FOR INKJET HEAD, EJECTION VOLUME CORRECTION APPARATUS - An aspect of the present invention provides an ejection volume correction method for an inkjet head, including: an arranging step of ejecting functional ink as ink droplets from nozzles of an inkjet head so as to discretely arrange the ink droplets on a front surface of a substrate; a contacting step of filling the functional ink in between a mold and the substrate by causing the mold to contact the ink droplets arranged on the front surface of the substrate; a curing step of curing the filled functional ink so as to generate a functional film ; a separating step of separating the mold from the functional film; a measuring step of measuring a thickness of the functional film; and a correcting step of correcting an ejection volume from the nozzles based on the measured thickness. | 2014-07-17 |
20140199473 | APPARATUS AND METHOD FOR PROVIDING AN EMBEDDED STRUCTURE AND FOR PROVIDING AN ELECTRO-OPTICAL DEVICE INCLUDING THE SAME - An apparatus for providing a patterned structure includes a deposition facility for depositing an electrically conductive material on a cylindrical surface of a transfer roll, a supply facility for providing a flexible substrate with a carrier layer, a press-roll for pressing the flexible substrate with the carrier layer against the surface of the transfer roll, the press-roll being positioned in the rotation direction of the transfer roll with respect to a position where the first deposition facility deposits the substance on the transfer roll, and being arranged for embedding the deposited substance in said carrier layer, wherein the adhesion between the printed substance and the cylindrical surface of the transfer roll is less than the adhesion between the printed substance and said carrier layer, a transport facility for releasing the flexible substrate with the carrier layer embedding the substance as the patterned structure from the transfer roll. | 2014-07-17 |
20140199474 | Multilayer Electrical Component, Coating Composition, and Method of Making Electrical Component - An electrical component including a substrate comprising an electroconductive filler in a first polymeric binder, and a coating layer adhered to at least a portion of the substrate surface, the coating layer comprising a nanostructured electroconductive particulate dispersed in a polymeric binder, such as an epoxy resin. A method of making the component also is described. | 2014-07-17 |
20140199475 | POSITIVE ELECTRODE ACTIVE MATERIAL FOR LITHIUM SECONDARY BATTERY AND PRODUCTION METHOD OF SAME - A positive electrode active material for a lithium secondary battery having a core portion and a shell layer is employed in which the core portion is represented by Lix | 2014-07-17 |
20140199476 | MAGNETIC RECORDING MEDIUM FABRICATION METHOD AND APPARATUS - A method of fabricating a magnetic recording medium sequentially forms a magnetic recording layer, a protection layer, and a lubricant layer on a stacked body. The stacked body is enclosed in a transfer container unit without exposing the stacked body to atmosphere after forming the protection layer on the stacked body by a deposition apparatus, and the transfer container unit is transported to a vapor-phase lubrication deposition apparatus. The stacked body is removed from the transfer container unit without exposing the stacked body to the atmosphere, in order to form the lubricant layer on the stacked body within the vapor-phase lubrication deposition apparatus. | 2014-07-17 |
20140199477 | Linerless Labels - Linerless labels are presented. A label includes a specific pattern or set of patterns of adhesive applied to one side of the label. The adhesive pattern(s) reduces contact between a cutter blade of a printer and the adhesive on the one side of the label. Moreover, the adhesive patterns reduce buildup of adhesive on the cutter blade and reduce buildup at specific locations on the cutter blade. That is, the adhesive patterns more evenly distribute adhesive buildup across the cutter blade. Consequently, the cutter blade can be used for a longer period of time before the cutter blade needs to be cleaned of the adhesive. | 2014-07-17 |
20140199478 | METHOD FOR PRODUCING CARBON MEMBRANE - Provided is a method of producing a carbon membrane including dipping a porous support in a suspension of a phenolic resin or a suspension of a phenolic resin precursor, drying the resulting support to form a membrane made of the phenolic resin or the phenolic resin precursor, and heat treating and thereby carbonizing the resulting membrane into a carbon membrane. | 2014-07-17 |
20140199479 | APPARATUS AND PROCESS FOR LOW-TEMPERATURE INJECTION OF A LIQUID CROP PRESERVATIVE FORMULATION - An apparatus and method for treating a substrate with a volatile liquid, crop-preservative formulation, wherein said substrate is in proximity to a crop to be treated by the vapor from said formulation, is disclosed. The substrate is most conveniently a portion of a container in which said crop is stored or shipped. The apparatus and method are adapted to place predetermined quantities of said formulation upon a desired substrate. | 2014-07-17 |
20140199480 | METHOD OF MANUFACTURING FUEL SYSTEM PART AND FUEL SYSTEM PART - A method manufactures a fuel delivery pipe including a crude metal made of forged iron, a nickel-phosphorus plating layer formed on an inner surface of the crude metal, and a nonmetal paint film formed on an outer surface of the crude metal. The method includes coating the outer surface of the crude metal with paint to form the paint film, machining the crude metal with the paint film formed thereon to form a machined surface inside the crude metal, and electroless plating the machined crude metal in nickel-phosphorus plating solution to form the nickel-phosphorus plating layer on the machined surface. | 2014-07-17 |
20140199481 | METHOD FOR FORMING CHEMICAL LAYER AND APPARATUS FOR FORMING CHEMICAL LAYER - A method for forming a chemical layer on a surface of a substrate by rotationally applying a chemical, including spraying a chemical-removing solvent to a region where a filamentously entangled chemical is generated when excess of the chemical discharged to the outside of the substrate during rotational application of the chemical becomes solidified. | 2014-07-17 |
20140199482 | CEMENT AND SKINNING MATERIAL FOR CERAMIC HONEYCOMB STRUCTURES - Skins and/or adhesive layers are formed on a porous ceramic honeycomb by applying a layer of a cement composition to a surface of the honeycomb and firing the cement composition. The cement composition contains inorganic filler particles, a carrier fluid and a clay material rather than the colloidal alumina and/or silica materials that are conventionally used in such cements. The cement compositions resist permeation into the porous walls of the ceramic honeycomb. As a result, lower temperature gradients are seen in the honeycomb structure during rapid temperature changes, which results in an increased thermal shock resistance. | 2014-07-17 |
20140199483 | COMPOSITE POLYAMIDE MEMBRANE INCLUDING TRI-HYDROCARBYL PHOSPHATE - A method for making a composite polyamide membrane comprising a porous support and a thin film polyamide layer, wherein the method includes:
| 2014-07-17 |
20140199484 | PROCESS AND SYSTEM FOR PRODUCING WATERBORNE COATING LAYER IN HIGH TEMPERATURE AND LOW HUMIDITY CLIMATE - The present disclosure is directed to a process for applying a waterborne coating composition in a spray booth and a system thereof. The disclosure is particularly directed a process for introducing water into incoming air for the spray booth to produce a conditioned spray booth having appropriate humidity levels. The process of this disclosure is particularly useful for applying waterborne coating composition having effect pigments in a low humidity and high temperature climate. | 2014-07-17 |
20140199485 | IMPRINT LITHOGRAPHY - A method of depositing an imprintable medium onto a target area of a substrate for imprint lithography is disclosed. The method includes moving the substrate, a print head comprising a nozzle to eject an imprintable medium onto the substrate, or both, relative to the other in a first direction across the target area while ejecting a first series of droplets of imprintable medium onto the substrate and moving the substrate, the print head; or both, relative to the other in a second opposing direction across the target area while ejecting a second series of droplets of imprintable medium onto the substrate on or adjacent to droplets from the first series of droplets. | 2014-07-17 |
20140199486 | MULTI-COMPONENT COATING METHOD FOR POROUS SUBSTRATES - The disclosure relates to a coating method including the steps of providing a multi-component coating composition including two or more components, applying each component to a porous substrate, mixing each component with at least one other component thereby causing at least two components to undergo a chemical reaction. | 2014-07-17 |
20140199487 | METHOD FOR PRODUCING HIGH-STRENGTH HOT-DIP GALVANNEALED STEEL SHEET - Exemplary embodiments of the present invention can provide a method for producing hot dip galvannealed steel sheet which exhibits high strength, high ductility, and a significant degree of alloying. Such exemplary method can be applied to, e.g., a pickled hot rolled steel sheet or an annealed and pickled cold rolled steel sheet containing between about 0.02% and about 0.2% C and between about 0.15% and about 2.5% Mn, and may include one or more procedures for rinsing the sheet, preplating the sheet with Ni, rapidly heating the sheet in a nonoxidizing atmosphere to a sheet temperature of about 430° C. to 500° C., then hot dip plating the sheet in a galvanizing bath containing between about 0.05% and about 0.2% Al, and then immediately heating the sheet rapidly for an alloying treatment. Such exemplary method can provide an improved alloying speed, improved plating appearance and better plating adhesion. | 2014-07-17 |
20140199488 | Cement Hydrate Products For Sprayed Concrete - Process for the preparation of a sprayable inorganic binder composition containing as main components water, aggregates, inorganic binder, set accelerator, characterized in, that a cement hydrate products containing component is added before and/or at the spray nozzle. | 2014-07-17 |
20140199489 | Applicator for polishing solution - An applicator for vehicle polishing solution is provided. The user would fill the handle of the device with polishing solution and would be able to continuously polish the vehicle, dispersing the polishing solution at a controlled interval. This applicator would have a hollow tube constituting the handle of the device, which would curve approximately ninety degrees at each end. The top of the handle would have an opening to fill the device and an opening at the bottom to disperse the solution onto the sponge for application. The middle section of the handle would have a button that would enable the user to control the outflow of the solution onto the sponge. The bottom of the handle would be a ball-and-socket swivel joint that would connect the handle to a sponge mount, allowing the sponge mount to be tilted and rotated relative to the handle. | 2014-07-17 |